<%BANNER%>

Molecular Beacon Aptamers: Fundamentals for Fluorescence-Based Detection and for Protein Studies

xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20101220_AAAABQ INGEST_TIME 2010-12-20T15:47:54Z PACKAGE UFE0011464_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 705 DFID F20101220_AABNGJ ORIGIN DEPOSITOR PATH vicenscontreras_m_Page_095.txt GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
95aae2d958223ea91fb3863d51d3090c
SHA-1
10f63e336102f70b5de61d98b4486b83d4a9c737
1898 F20101220_AABNFV vicenscontreras_m_Page_069.txt
5de9b88e908e1b14986732a97c0f6398
32e24f15ceb921605ee0fb085a9381d8d98e1ed5
111140 F20101220_AABMDH vicenscontreras_m_Page_040.jpg
fe359da101c0223f4a52f6e7d42be7a9
c5f3c68c48de2c3a68f8613a0ab401f745e3a8cc
48549 F20101220_AABMCT vicenscontreras_m_Page_136.pro
891da11a1015724764951c6c9633820a
9420311ab80985d6837f8a77f402530d042b2de0
1971 F20101220_AABNGK vicenscontreras_m_Page_100.txt
3a4f7e4471ac963d4ce8f524d6e3f437
bdf0977fd4561a1bbf6fa02269e2c78461e09527
1230 F20101220_AABNFW vicenscontreras_m_Page_070.txt
f39a46fed8de97f601d07df494f24248
c328b78fe1bc50b54411ef97c9f5469e9d365468
22695 F20101220_AABMDI vicenscontreras_m_Page_102.pro
e53259e5d6bfc3c6660aaffe37671b51
936279e27dc1b717674da72accf8b631d0e82a33
32563 F20101220_AABMCU vicenscontreras_m_Page_041.pro
8ea1b5886dc9d9362391175af498a5e0
9335e2649b4e13b6d65768f8cbed08a36fde2c3a
2006 F20101220_AABNGL vicenscontreras_m_Page_101.txt
ef15c0346fc59ceaf2e5b8b3ba2ccb93
9706be680f963c5a09a577acf97901b603607d9c
1922 F20101220_AABNFX vicenscontreras_m_Page_072.txt
8723c68ec74cbaf4dc3bc1b2f8f0ffc7
bab1f31886d87f9e2fadffdb424b51190a207efd
25271604 F20101220_AABMDJ vicenscontreras_m_Page_065.tif
710f98fa89c9bee685927093955320ef
909e093135ff9ed298d6a45ce2fb6e3fc9161dd5
841 F20101220_AABMCV vicenscontreras_m_Page_046.txt
a5750e43d3d03878dcb95e2653deff63
3f0e5fcb458ada380ff2135418defb00bb836bb0
1991 F20101220_AABNHA vicenscontreras_m_Page_130.txt
1e188fe6273d2550481dcd34425c995b
dc5df5937a4e8dbccf0a82b014ee8a1fb8d4605f
1607 F20101220_AABNGM vicenscontreras_m_Page_105.txt
0b3a6fd8bffbab8b3a39d15197ed30b6
ec5c0687232527f41d87fd0155cb19b02c2b1851
1528 F20101220_AABNFY vicenscontreras_m_Page_074.txt
abbdeeb72718561cd3e03e5122d335c2
2594ed8af2f7cdb1281ce86257b8aa792c3666a7
20671 F20101220_AABMDK vicenscontreras_m_Page_033.QC.jpg
9f5aba90f6d05f8a6d6c304c54e6f07c
d9f77ac8f28d4f78d1fdc02122d61250b2ebe13d
48558 F20101220_AABMCW vicenscontreras_m_Page_018.pro
5fcf220b5aa8417745a843a0dfd2dce4
4f479959781bb99727e061b4062d92922616fe3d
2187 F20101220_AABNHB vicenscontreras_m_Page_135.txt
e43c4fcd2a15a0670e5dbe9d75396148
480f91814b1af61eea780aa7058fd75e955d67ce
1355 F20101220_AABNGN vicenscontreras_m_Page_106.txt
6b093313eb5aa138d34faf39d31c13ce
0801ed4c978246a7f15103a4dd09c0e6c27109ad
1246 F20101220_AABNFZ vicenscontreras_m_Page_075.txt
2d4628f0323c518a08dafb48e4fe2f37
112f93fca02f2643b9282fb0e04c54bfcb07cd9e
17454 F20101220_AABMDL vicenscontreras_m_Page_138.pro
9f936bd1642b9f473176518b32169f84
6ca49701ababcfbbc189b05b0ddad908fb132891
1654 F20101220_AABMCX vicenscontreras_m_Page_083.txt
af2acf57f3c8abc73d09e9fb8e40f541
cf46db29c7e516fa2af3084cf58641cc5785e91a
760 F20101220_AABNHC vicenscontreras_m_Page_138.txt
88c9c678cbdb378fdb9a80878315d355
a36e61cd292a4467c3f2264023a53530fe22053b
1974 F20101220_AABNGO vicenscontreras_m_Page_107.txt
36ca671852666353f2a1b58ebb1c8ed6
a868b5ddb43a9a554288849224401e986fde8912
1841 F20101220_AABMDM vicenscontreras_m_Page_114.txt
feee90729db2f7c0633870d5e3a9839d
e1bb6a56b1823ffebba93f5ddb39ef07422d7039
F20101220_AABMCY vicenscontreras_m_Page_112.tif
ac6f3ee3610d5678465442e774a984c8
34ced4f26b5bad015dbe67bce67ec33aa8dc3927
1958 F20101220_AABMEA vicenscontreras_m_Page_127.txt
37263b1cd597d14003ca1defe438a36a
df73c4345c2ce70072d72df2f20d7539fb3ac47c
1019 F20101220_AABNHD vicenscontreras_m_Page_139.txt
9a1d32dc106b26fafb200b3a48086bec
c0dbee51b5216069bafbdab719c3fc0735765030
1980 F20101220_AABNGP vicenscontreras_m_Page_108.txt
06e222415e298748516552711c9feb90
21dc12997bc89adb92650cb9188cf0e4dcdac46d
34491 F20101220_AABMDN vicenscontreras_m_Page_116.pro
c48f572cb3b6dccd97d8be115b2772d1
243a70460d521f4829723c3b3febf3133c129a23
6506 F20101220_AABMCZ vicenscontreras_m_Page_012thm.jpg
01d10c1b14d854bdcbde9f4831913a2a
4c15438358fcd16e599c0670dbfe2abfb9eddf7b
50747 F20101220_AABMEB vicenscontreras_m_Page_079.pro
15da26bf3600d8eb70220273879fdcec
eed946b79983260e2403c54ffee5f2f9ff7008de
167246 F20101220_AABNHE UFE0011464_00001.mets FULL
260ed521211df2d41e1a384b28b4f616
18a05456424026238fb4e977f1aeeb4ce151a5c2
1299 F20101220_AABNGQ vicenscontreras_m_Page_109.txt
7182846430a5e55ad6e1b186043e64b0
7dcdf4acb12f2ed23cffd3a9a898746bc966d9ac
F20101220_AABMDO vicenscontreras_m_Page_090.tif
e879e5f88083bcf07b25a99b21155219
a0a328729db35843fbe51ce9160297a6785a2202
1051977 F20101220_AABMEC vicenscontreras_m_Page_010.jp2
fec4abdb05aede9fee3e6e5a6c2f526a
87975a06daeb64522dc21c5b313f4e8ce73f3f13
8731 F20101220_AABNHF vicenscontreras_m_Page_001.QC.jpg
708fef8a6a59abc191ca17ba01dddd12
92fdf635179f72bf91fcfa1c84df3efce979d648
1549 F20101220_AABNGR vicenscontreras_m_Page_110.txt
4462ef1efd95886c3b7c886f9105dfd3
31b42b4a0cc0beb0e2957c6316595d14be24afaa
1851 F20101220_AABMDP vicenscontreras_m_Page_122.txt
9ac491446348d1f85cf4cad1d86c6529
990c58b3b9c1531653d7492ee1a386994fb83029
1051986 F20101220_AABMED vicenscontreras_m_Page_091.jp2
4cfd1b029ec5c0e844db8e4473c62472
379d566397ab75a6c62fac0a31b8e1f11a8258cb
1962 F20101220_AABNHG vicenscontreras_m_Page_002.QC.jpg
b19c90409cb74c850b5a86a2abbe7c53
c29c461ab4f2682b4cf6b27ced8d1b5a4cdd1902
1858 F20101220_AABNGS vicenscontreras_m_Page_112.txt
459a7ffb98586dc4fb6ed8a9e55466b7
7070d2dc6319c722440988366b2472c8fdf59926
907388 F20101220_AABMDQ vicenscontreras_m_Page_012.jp2
f3977d74d39858e45d10d21f0e750ab8
a1aa19885d19ae6856baf6d27fd5cba201a035f8
6988 F20101220_AABMEE vicenscontreras_m_Page_086thm.jpg
f9e6ce24d13985499f1a82ab69a98cac
deb9f10d6959a6d652b0b25fb4a001390fc87b8b
694 F20101220_AABNHH vicenscontreras_m_Page_002thm.jpg
a36e3830aaa5c925a7185a7c2366a454
5e4906735e107a59c3ec1635c9231ebd57a0ea2c
1775 F20101220_AABNGT vicenscontreras_m_Page_113.txt
27c39f32a8b22a6540a22f23691f7a96
c2d2b07acca7949cdf0a71b40f940af87492a1ef
34352 F20101220_AABMDR vicenscontreras_m_Page_135.QC.jpg
ca01468d630a073ac27148473bb9d61f
8c927523c8b6654e0101c396286f8ff48f3af3f0
1828 F20101220_AABMEF vicenscontreras_m_Page_091.txt
135cfe0c7be2c9269a7f75284c5f9367
0786c8dd24b50035fb168d7ff7307c18cd768dc4
28013 F20101220_AABNHI vicenscontreras_m_Page_003.QC.jpg
eff9336ab220370491bc9d68ab04806c
ab31fc9c71a75e7cc5a4a811e24a3abc7d3dac76
1902 F20101220_AABNGU vicenscontreras_m_Page_117.txt
1639ffdd2f24b5afae3c3607cf73fd0d
4eafa3f3aea33c010013f8b4fa7cf23f4779a96b
752509 F20101220_AABMDS vicenscontreras_m_Page_088.jp2
72db510f3c95c66289920df1c91c4b21
d20f9e06cfeb410ae12204a415ada0d788f529c6
25780 F20101220_AABMEG vicenscontreras_m_Page_053.QC.jpg
54be5800587636ca521b92f139195d78
4b74dd1b649f3a071b7dab3489ce82d4cf6fbc5e
26282 F20101220_AABNHJ vicenscontreras_m_Page_005.QC.jpg
fea1c1a26244eb815b9611f199dcacef
f7855f56671918d26cf36e9303dd6780e8e4edf7
277 F20101220_AABNGV vicenscontreras_m_Page_124.txt
bc1efc282097d8db3cf94a5eacb080c7
bd82e921c02597d8aac056522803f6f18a758b17
1051961 F20101220_AABMDT vicenscontreras_m_Page_042.jp2
1d6de10c716d14232c0cedd8c4caecfd
c64f605ed1cbed7c83fc3a1f11f61bbf07a25751
16086 F20101220_AABMEH vicenscontreras_m_Page_046.QC.jpg
7e72d81470119e3462719d9b9a8f240b
20d7a4cf8e2720ac2eae29b49ff68e3c14935c65
34674 F20101220_AABNHK vicenscontreras_m_Page_006.QC.jpg
cc5d24f402f4eb83ad5260a8febe2438
e83dab2bb1579c6249cc4b85a48c476790435184
1817 F20101220_AABNGW vicenscontreras_m_Page_125.txt
ad7200814c34049e91b0a28200591cab
732a3954f38eca9a8127d49f020d096fcc242847
64141 F20101220_AABMEI vicenscontreras_m_Page_075.jpg
276a77fba0feff7e945c6ee7838a9a2a
12672bf758c4f36bafa90244bbece18bd1f9810b
33821 F20101220_AABMDU vicenscontreras_m_Page_060.QC.jpg
17f0e20ff82dcbecf605c2e0632953eb
b6333bb88cdcf0ff4afcc3aba0ff4370b74af86f
13082 F20101220_AABNHL vicenscontreras_m_Page_007.QC.jpg
3f7882911149ed45083a7448f9722461
45bd158a980cf6fa017d2e0775aab2c0b584301d
1994 F20101220_AABNGX vicenscontreras_m_Page_126.txt
fc96ee54f9659500ad64dfbac80fcbd7
ea939196a3873660f839710fe58a73e5def91676
90166 F20101220_AABMEJ vicenscontreras_m_Page_048.jpg
2fae09996416d07c70309f396960fadc
72221726deac0c2009a1c7e0d0c4a723de1cb450
5163 F20101220_AABMDV vicenscontreras_m_Page_064thm.jpg
d0300fd650dc1871ab6e0f583f3978cc
ec886f415662f62eb9eb567cb58489fbf953ab56
7906 F20101220_AABNIA vicenscontreras_m_Page_021thm.jpg
6f65dd92141ef14227370ee423259b4e
251d88ece13e23caace8fba1cdb3864c69accdff
3391 F20101220_AABNHM vicenscontreras_m_Page_007thm.jpg
715739ba70ce689d81427219bdc73a3b
6cad227f7186c41ae0ba02731267cf994f200fb1
2018 F20101220_AABNGY vicenscontreras_m_Page_128.txt
755c9620752e91bb5b9975b1b972f840
7bcdc25d157386e49c22ee2cb1d0eab3434c2d85
2041 F20101220_AABMEK vicenscontreras_m_Page_057.txt
23d547342c9798779346457922f98b25
b94338ace000f397fe0fe07e734595b1a108b867
33511 F20101220_AABMDW vicenscontreras_m_Page_042.QC.jpg
7c76530756338c035a605a07e3e58004
b1a3ff9286d2b8e62a6d709d15c393824ad7d2e0
33045 F20101220_AABNIB vicenscontreras_m_Page_022.QC.jpg
3af44fa6ecd9d7d748a7910a2e7b9e36
b3fbe98e8bbb4a850a813b6ab7e9f5460eb8d4a9
3394 F20101220_AABNHN vicenscontreras_m_Page_008thm.jpg
c4a317be3cab5f05b027190d6818d86a
cd50771e11ab60d675c87de42033c2e3ce31a689
1984 F20101220_AABNGZ vicenscontreras_m_Page_129.txt
3fe85e3e34fcf64304e1386cbb22d356
a3601c74065a9c388b776c4d69c00032825da8be
47067 F20101220_AABMEL vicenscontreras_m_Page_112.pro
8c78875b7fb56ef00fdcb8f4e08e6e25
78ff6d024483c6dbb0cd4a86bb23e1dd61932022
927746 F20101220_AABMDX vicenscontreras_m_Page_053.jp2
71f9f6d3d6da99dd9a178bb6e7f6e0b3
84b23e4359425fc4ba5427ca4573661a529fb45f
8457 F20101220_AABNIC vicenscontreras_m_Page_022thm.jpg
a686d2a3502930cf2855f05d09c195d0
2723818f980b7c5a4a2b6b9158dfb05a5b0b6e2c
33956 F20101220_AABNHO vicenscontreras_m_Page_010.QC.jpg
f48bf8b4531bfe684207938793864f90
2e47d677fc62490d08bf59d57d143a3e1c17dfda
31288 F20101220_AABMFA vicenscontreras_m_Page_068.QC.jpg
2abcb566e516a2b19a96c4464517d843
6a1e8c412e3d1c9a590e91bf8b8dee4393bedd2e
35631 F20101220_AABMEM vicenscontreras_m_Page_023.pro
e00c85b7c41787b8c162b1c41f0b7338
8272261801cd0df252d8fcaa5480b833c93d4a91
150716 F20101220_AABMDY vicenscontreras_m_Page_006.jpg
18740c6a47ed2026ad53af9a77b3b5a1
86e169dffa77a97c2c14a49077c6dfb214426041
29163 F20101220_AABNID vicenscontreras_m_Page_023.QC.jpg
f5ba9afe18e8e755fcb59837a2334591
dafabdd7f26d74f3c03e436a3d9bbac6bd407407
8449 F20101220_AABNHP vicenscontreras_m_Page_010thm.jpg
5c0ac3019d2012b6a201fc5925319dc6
3bd337f033556e84aeb245286284b3351394bfe7
8314 F20101220_AABMFB vicenscontreras_m_Page_035thm.jpg
071429c0784909d142c9cbffee450667
469786183dee7c75c3d5544ac7dc4dd45f73b18e
F20101220_AABMEN vicenscontreras_m_Page_011.tif
d8c8adf4fea9bd3a4cff2afbab453b52
479813b75ae5c92090c3cc1920c9ba0162b1c016
41615 F20101220_AABMDZ vicenscontreras_m_Page_082.pro
9d516fe406d54786bad458a341098f34
e209cb6e2f6cedf3d154e48cda7b821f57b2a046
7554 F20101220_AABNIE vicenscontreras_m_Page_023thm.jpg
dd74b74cb56f0de8e32b463ebc139aff
3aba27d7ab7778da095b712b7bcffd717b49895f
4144 F20101220_AABNHQ vicenscontreras_m_Page_011thm.jpg
1fdab8eea87a189f91333f47926978c4
08cdca13561a8c38cea56a8e6385a016e1c1d7fd
F20101220_AABMFC vicenscontreras_m_Page_044.tif
cbc16507bf96d1cca1e63f110a474f44
fdad1f6fe342a3c5b5b570008ad31320506d8954
47444 F20101220_AABMEO vicenscontreras_m_Page_039.pro
297ed0d7270fa273ea3a016084bddc96
292b66522bdd3584cd729e86b6b61c0b52eec473
32274 F20101220_AABNIF vicenscontreras_m_Page_024.QC.jpg
5b872581c374ef59c63f5d196b383cf5
4f33de0ac0b8a43632bc44fdc9cfffa3e4f05201
25910 F20101220_AABNHR vicenscontreras_m_Page_012.QC.jpg
eed592536cc0e4f7d62e5a3571faec86
89fdb09053e442bf539cf39a5f402c93e0ae1d28
1855 F20101220_AABMFD vicenscontreras_m_Page_098.txt
06aec942e0454ba18719fca4b1e86a84
baa41d5688c9e67528746964bc8cfbd2d514c895
8364 F20101220_AABMEP vicenscontreras_m_Page_131thm.jpg
b2dc327b87585137d65faddf5c4ccd18
5df304e1e754b86ba0e1056244f95342f77ef898
7991 F20101220_AABNIG vicenscontreras_m_Page_024thm.jpg
242b53d3b8fe0c429314d41acb8e48be
50c3762ba59dca885ad65df73cc70740c541bf2d
25502 F20101220_AABNHS vicenscontreras_m_Page_013.QC.jpg
cef4cbc237adb3544d2a4e40b4cc83e1
ed6d9ed809d1961510deff60fd21a4ebc3e2b632
584 F20101220_AABMFE vicenscontreras_m_Page_087.txt
aa839ad01b072cc8ca6833a114ab1e04
2cef3b37b2da25b91e10f6621974cade7d4b18df
F20101220_AABMEQ vicenscontreras_m_Page_067.tif
79c00c96bc91bad46e3a96287c1f0ccc
a4635d804a2bde09ba7fc57c2cfbf53a624db204
27344 F20101220_AABNIH vicenscontreras_m_Page_026.QC.jpg
72ea3af6da6390ee6819e26bc948e27b
e9614d5baf11fd02448a358f190cb6c28b4ca6e5
7347 F20101220_AABNHT vicenscontreras_m_Page_014thm.jpg
da695748764167a8ceed688bb08cc506
b3908d2bf31e16418617b6ea2ea5cad3ee4e7f6e
26670 F20101220_AABMFF vicenscontreras_m_Page_086.QC.jpg
2a2222a595c883ad4b0bac81ea00b82e
a29c66d2ab8f496882d4238fcd23a2d941fe1266
1051949 F20101220_AABMER vicenscontreras_m_Page_136.jp2
362da796448ed1f3e4623a404e4d53b3
542067e65a758b0e971130045c79fcc665f9d4e0
7330 F20101220_AABNII vicenscontreras_m_Page_026thm.jpg
a07e4ef488b7d50f5d6333a83381f232
62ec648107a53a763856ea84f6cd0b348e431a69
34014 F20101220_AABNHU vicenscontreras_m_Page_016.QC.jpg
0fbc42467d2ff847da4ca433efe66367
1b3c1f1148423cf7aea865876060812952dbc2af
8047 F20101220_AABMFG vicenscontreras_m_Page_117thm.jpg
3df124f0d09bd49dd47dccbdce0d5ff3
30eac023fc2a16b30c95b10745fd05136022ed9e
33997 F20101220_AABMES vicenscontreras_m_Page_065.QC.jpg
495e5e1da6f9b05ec3496baff496991d
3ffd47967bbcfc64eaa404b91c73507cdcab96f5
33763 F20101220_AABNIJ vicenscontreras_m_Page_027.QC.jpg
191b06256a69abdd1612e30732e6fe24
ed0c15bfd7702d2ddcc172fdfd0e1a1f50aa5bdd
8269 F20101220_AABNHV vicenscontreras_m_Page_016thm.jpg
1404df35f9762519c3db0329d166f08e
7ca81665c5095e9d539d4dffb674044b97b3bb06
33197 F20101220_AABMFH vicenscontreras_m_Page_035.QC.jpg
45ac63f640c381ed0592fbddfd78a5d2
771ee2be9fa6671f84bb60c4a5bf12b4753d6a24
1008065 F20101220_AABMET vicenscontreras_m_Page_085.jp2
feeb46b19169147af52cfa78c662cc64
1de15311c7eaee540b87b9bb29bb66221a997664
30891 F20101220_AABNIK vicenscontreras_m_Page_028.QC.jpg
cb071b13e175d7beca1871e2e9e5988e
87b8db4ca909c74ed3ccecb61aaffca6dece8f5c
30353 F20101220_AABNHW vicenscontreras_m_Page_017.QC.jpg
2637be5b2c57c267ebdc748970bc754b
9a4581ff5cb6ceccc87accd12d59b577372bd3a4
104115 F20101220_AABMFI vicenscontreras_m_Page_022.jpg
1e9d772f04dc854e140251a4152f4cb3
4c1eeaa7625c596113da277dee55b77206a6939f
F20101220_AABMEU vicenscontreras_m_Page_104.tif
28333599e2e3691b3ee9dd12192ab92a
73eab2d5e962eb87d74ccc35b59c786ec0e662ad
34062 F20101220_AABNIL vicenscontreras_m_Page_029.QC.jpg
32794b15b52871d58b17c394d9151a35
fbb9ffdb72fddd2dea27e1a60a8d847625548627
33556 F20101220_AABNHX vicenscontreras_m_Page_019.QC.jpg
5a53e9186b46d046e43e77e97c89d2a1
df2882d5d68caf8f4ca407eb94aa179d0ca40b16
8103 F20101220_AABMFJ vicenscontreras_m_Page_063thm.jpg
6c0b49a80ec72ce37fef99cb3c4d983d
c281c5fae95bfcac2670b778d49de77c0de6fe89
99089 F20101220_AABMEV vicenscontreras_m_Page_021.jpg
7ca7899fb442775286703f7c7e8c66b8
2538632b9cae5a220e5c30fc021ffa30b7b6589e
7510 F20101220_AABNJA vicenscontreras_m_Page_041thm.jpg
667c412974088bd26df28451d11a6307
211942440c684fc8e7eba2af616821c268876d64
8094 F20101220_AABNIM vicenscontreras_m_Page_029thm.jpg
98af9606933fa77f99fb2da5bcfdbf2b
2e3aee42a6c05b4654ba9823873585e050cb9377
8295 F20101220_AABNHY vicenscontreras_m_Page_020thm.jpg
0dc2a65b2161726b98d3cd40567b2085
453adc6b99465caf00336c51e1ea092cf9065fbf
46081 F20101220_AABMFK vicenscontreras_m_Page_025.pro
21b13256b1179addef40061d6288762f
2668b836059373f8aaa94d80822824ddb5acff3d
28230 F20101220_AABMEW vicenscontreras_m_Page_110.QC.jpg
744acd87d7889f3448a945a27476fa47
5d7fe97141c69418db9648e60608cf37de19c5e3
8924 F20101220_AABNJB vicenscontreras_m_Page_042thm.jpg
bf11938525f0d8d01024d2563f9fb812
dd141582fad7ea03c1eb163c07c5465da5510f03
7882 F20101220_AABNIN vicenscontreras_m_Page_030thm.jpg
e66138b9fa0fc5984e565cbf40e0e9a1
fb17a4b564f8f1922cc678b527941ec1e72b08b5
32075 F20101220_AABNHZ vicenscontreras_m_Page_021.QC.jpg
005ca4e8768b28761de184cefa8923b0
97b960dc0858a2028a4e8964ae23c4129483d080
49794 F20101220_AABMFL vicenscontreras_m_Page_127.pro
ea59d4a1a0bccb2f466957ec61ca2c8c
28de6f0f0cc28c86a8b2cbeb74eecfe5395daabc
1051971 F20101220_AABMEX vicenscontreras_m_Page_030.jp2
ce389bfcb2845cb415627965433063c6
43579f7fb6dfa2d5bf9528c81e1d626d040a0746
32835 F20101220_AABNJC vicenscontreras_m_Page_043.QC.jpg
d2163ca5279956f62bd8b33442719413
858bc27770823716f3a454b0edd6147fb2e65175
8599 F20101220_AABNIO vicenscontreras_m_Page_031thm.jpg
09a50fb3476798b8007455ea860bf686
fe484a16f59267846f028a8d00da781e56f82ef4
909 F20101220_AABMFM vicenscontreras_m_Page_102.txt
2c15457232dcfd895742ba9a9fe430cb
2bb5ed74e79ef4dc1a70e1bbd33659a1f1414fa6
1976 F20101220_AABMEY vicenscontreras_m_Page_120.txt
0324eaf0f4f02cd8918b3cd3a2939db1
3dedfb55f987e864ce05e1bc1af98414ede34d3f
1975 F20101220_AABMGA vicenscontreras_m_Page_020.txt
30c0980a02ccefa8603137f760d40425
4c018ccfc428b539003888c608b0606f07bf42e9
31658 F20101220_AABNJD vicenscontreras_m_Page_044.QC.jpg
546bedacebf76281b220e43e61670987
d02be20e8f54f83cead708808922f5b4204952cc
33422 F20101220_AABNIP vicenscontreras_m_Page_032.QC.jpg
e2360e9bd26a689e4756b709614623e2
9ad2f0859e8ed372a3fc9ccd18f93f4e992ec771
7215 F20101220_AABMFN vicenscontreras_m_Page_105thm.jpg
ca6e604fdbfa328444a4318d986a5c85
e076055f9ebcb737c3dacf0a8ba52254363e4497
F20101220_AABMEZ vicenscontreras_m_Page_008.tif
d8941aa7da7094946bb55a5e79f0c669
5099abf79616b5e817f4f20b9dd664d954d3bd99
7320 F20101220_AABMGB vicenscontreras_m_Page_009thm.jpg
57286323c431c4a5c957632dceb7b9ac
b61519536b7ee5f4e2f0d1179b7702800b53f785
8571 F20101220_AABNJE vicenscontreras_m_Page_044thm.jpg
4092d098b5dc6975273fe0dbefa4ba90
c1293a0ce0405c6484fa2c2a7258716bc2e3ae9c
8816 F20101220_AABNIQ vicenscontreras_m_Page_032thm.jpg
54d1a567659c43d1ae5f88165ee9c649
ed4297e8a9714e7a55a6b716d4337427847f0ec8
37663 F20101220_AABMFO vicenscontreras_m_Page_138.jpg
94b1dc3e2a6b27039fafb77dcba92b7d
bba7ad0ea57f3bc3bb77ef9319aee971228a6246
32057 F20101220_AABMGC vicenscontreras_m_Page_030.QC.jpg
45ab734e3e44f680f98446788dd68f0e
c20730d51c44b5c6dfd8ef36749828012132043c
31905 F20101220_AABNJF vicenscontreras_m_Page_045.QC.jpg
cfc94d986fc7e695960e9f01fb66eb3a
cf47bce79fc3a3366d5a8462c704825c44be9790
5475 F20101220_AABNIR vicenscontreras_m_Page_033thm.jpg
7b5f0d8d85c9f3eafa0e25afed0e35ef
d11142f25934f56e39591be00fe27b0770cb4a14
43320 F20101220_AABMFP vicenscontreras_m_Page_042.pro
6f38cda15e76826acffbe0fca8a6fee8
c5904b300c1bd3badc755a081d6f1b599bbe4657
1956 F20101220_AABMGD vicenscontreras_m_Page_062.txt
4c2f1171cce3ebcee64e207cfbd3415f
a08661115e778866fe9b568e418ff319bb0b2c66
8153 F20101220_AABNJG vicenscontreras_m_Page_047thm.jpg
8166a501d5d2f129e5fed7a5c0bf3f30
43e6dea7aeb3ce1b14f2d14c4ceb1d8318b7b8ed
29346 F20101220_AABNIS vicenscontreras_m_Page_034.QC.jpg
c629681f6860f2c4eee0df080bdc34b8
9b5e879d510e76dc0a45ca3e3980ac441fb50842
100810 F20101220_AABMFQ vicenscontreras_m_Page_092.jpg
906e16c3c6d0dd0a58db09a763c973bc
85c717d815ab8fbdadc8cae3924edaf0501f6943
1051980 F20101220_AABMGE vicenscontreras_m_Page_127.jp2
969e51c11a516428fa8c4e409ff49c04
e89025c1df674f371b060bdfc058f2d07382fc1d
30274 F20101220_AABNJH vicenscontreras_m_Page_048.QC.jpg
e82e246d224f19430d6319bad9f8ce1e
ef476228cd55e9d2b34105aadada01ef7fcaf288
7346 F20101220_AABNIT vicenscontreras_m_Page_034thm.jpg
d44858c3cd7b6e77a81945eb59059d41
443689f8082cae407659ecb070f962ad71c596e7
2014 F20101220_AABMFR vicenscontreras_m_Page_029.txt
125cc3cd089e8c0fd9e816f64b541259
df450061a836694262a168569ec90819bc7c6ad2
8479 F20101220_AABMGF vicenscontreras_m_Page_121thm.jpg
7a1438fe172d4a4122e243133fc83c7b
e8f9e5abd66b5d9582d2baba9b7b7b7197ec3f48
8337 F20101220_AABNJI vicenscontreras_m_Page_049thm.jpg
394553e96dbad1d328f8189829b2ff9b
b3da05d6ebf639156315e2274c41762483b03514
8066 F20101220_AABNIU vicenscontreras_m_Page_036thm.jpg
26a34326e90e6cbe9be1c7af7fcc36b0
35663216497aeaf6af0918ab2e2820f1a10b1516
83007 F20101220_AABMFS vicenscontreras_m_Page_111.jpg
f69ab680ed29cba71e2633c5d16dd99c
c47e41aff8c886f3798b1602fa236be68485e826
1735 F20101220_AABMGG vicenscontreras_m_Page_133.txt
f0537d80f0fe658661eadd3a63506b61
e32b79225d26f22fbd6959f8c86dc7359199195b
20084 F20101220_AABNJJ vicenscontreras_m_Page_050.QC.jpg
ee722b4e2487a6ebd2aaeeebf09917b8
d617aababe415ddc96321c89d30377c5014d7c6a
33628 F20101220_AABNIV vicenscontreras_m_Page_037.QC.jpg
26db8978620c17ed89bbcb4496abd183
c0a0aaab1cbe0f789cab63a3172a6ed9d794e741
1051960 F20101220_AABMFT vicenscontreras_m_Page_135.jp2
153821a8fc93387a4a19956aa7ec62e2
286b5b4415ee06629ab352fd602c00fb1ef9f7ca
1737 F20101220_AABMGH vicenscontreras_m_Page_085.txt
b2bdc2e21c367a47113f20eca9a11938
6ee87fe0340ee4cbd8cb1dc33f3711be81863a7e
6654 F20101220_AABNJK vicenscontreras_m_Page_051thm.jpg
f204bbf710148b52b02d620862990905
cb516dd712d9398ec09b1e0ab054359cd57080c8
8372 F20101220_AABNIW vicenscontreras_m_Page_037thm.jpg
1e897e90af3328fdc41158c3aed0d214
208631a56b5149ed52fb6dc026132970bcb502c0
86563 F20101220_AABMFU vicenscontreras_m_Page_073.jpg
facfe88236d82a45c6a53a0e5aba94b7
40bf0e8d8bbd01fab0c9c69947bbf2acf390716b
F20101220_AABMGI vicenscontreras_m_Page_040.tif
4550e92dd02c4da1b26030ff74ffb3b9
17d4296f1a78e06541a7d6aa17b6b2a14a307af0
24605 F20101220_AABNKA vicenscontreras_m_Page_067.QC.jpg
81cde362432f9527e566bd3c8c55d63d
0f66e73384c032725379411942d648b1a85465ce
24474 F20101220_AABNJL vicenscontreras_m_Page_052.QC.jpg
ef9b7b02d37bfbafcdb825d1c6372e9f
fa21d165ab8480e29a1e6d00309cdee121dc1d52
F20101220_AABNIX vicenscontreras_m_Page_038thm.jpg
b0057aa153a243e038a298ff8d5a3cf9
349b8508f3488baf1fd89799344389870f819ea4
48207 F20101220_AABMFV vicenscontreras_m_Page_100.pro
d68124b13614f50c2bfdaa63c2a762b7
7c149b2f466a131ce426f97d3dfdd227e15af39b
7964 F20101220_AABMGJ vicenscontreras_m_Page_018thm.jpg
aaa53a8ed13a122c35863eba9f37da3e
1d8e87cfe2517e8ea108a7fabb102e4c2928a340
6873 F20101220_AABNJM vicenscontreras_m_Page_052thm.jpg
5aabc588ab5026c7a2733b87f4766f51
7f4c4e743040a37b3e6857cb4b410ad0207eff20
32553 F20101220_AABNIY vicenscontreras_m_Page_039.QC.jpg
e01e555e99d3a15603626c06d64ab854
bc6acf248506a772cd2ff70ac50ec12e01d8fbcd
1051976 F20101220_AABMFW vicenscontreras_m_Page_055.jp2
1e68b5e2cf1fbe119696a73b2459f258
1f6a0298661645a210c4a74160042f5bab1a7165
1051915 F20101220_AABMGK vicenscontreras_m_Page_028.jp2
de0ce8c962c14f75df5fea47e1f1a56c
b1dc56f6cbae375d3ad7762547afbf3773faf07e
6736 F20101220_AABNKB vicenscontreras_m_Page_067thm.jpg
e71a267c3fae639a92bc59751a0893eb
0522a509c99cabad966fafeabe94906c94f55ea9
16076 F20101220_AABNJN vicenscontreras_m_Page_054.QC.jpg
ae9ee3f6d68d22193572df8b0b70fdde
d9ba361405dcbccc85ef8b0bbcd1eca1f594adba
8716 F20101220_AABNIZ vicenscontreras_m_Page_040thm.jpg
c1ebbb8cefbe81c795895be29fffc4fd
b2b94916abfdba548619372efd138132d5972664
7235 F20101220_AABMFX vicenscontreras_m_Page_133thm.jpg
7fe0c0b1feac2221555fb67bd781188c
5a61e9f68b05e36a7801b7e5f09fa9fb1193e303
1665 F20101220_AABMGL vicenscontreras_m_Page_026.txt
403b66a7f93a19521104aae03e695284
a605f59c3b7e815679a0d5b06ac533a5503af715
32048 F20101220_AABNKC vicenscontreras_m_Page_069.QC.jpg
954b013902886e6498fe4dff41207f1d
a8197800ef495dad4f336057ccf7aab3cbf96092
5346 F20101220_AABNJO vicenscontreras_m_Page_054thm.jpg
24129dd9b0e305c1e4b41b08342d16f6
1cc742fa90b6f1ce234f790a8d3e97b6d9a10086
1642 F20101220_AABMFY vicenscontreras_m_Page_115.txt
e9979045835d3de5b93257bbf29bf6af
14a88a46b6e014844b31b846cc6d39e1588d6bef
136050 F20101220_AABMHA vicenscontreras_m_Page_124.jp2
1cc4a7d2e776e132a5006284abd89ee4
8ed69fd189b5fae474d2ed691b5b707c86f29f02
F20101220_AABMGM vicenscontreras_m_Page_092.tif
6534990d976bcb1e5f97d70cbaf5c899
4938eb88d997fe75ab7e2a7510214e12a2472c11
19903 F20101220_AABNKD vicenscontreras_m_Page_070.QC.jpg
455ca446c6c62a3d0b7fef382481c72e
fc88b45c4c7fb52d22d8867328628fff8a93ea56
33941 F20101220_AABNJP vicenscontreras_m_Page_055.QC.jpg
f27e00aa288d4e65e7fe579a4309541b
940edd04ca464a2dea69ae97f2ce6d08095c1ea1
42627 F20101220_AABMFZ vicenscontreras_m_Page_118.pro
6125b4bc75874379f34b298645a5f115
7c6422d1e33cb93777e9cf9ca0187182d5f21198
945567 F20101220_AABMHB vicenscontreras_m_Page_023.jp2
2e3caee7857afb62ab3b058dd432f860
67c36fd80ed73c6c7c90654aabc22a47eb6ef1ff
16112 F20101220_AABMGN vicenscontreras_m_Page_011.QC.jpg
b33f11aa057a76616e09ceda42810b9f
9e8ac3fc962d982afb4363f0457c5d6c38f851ac
34422 F20101220_AABNKE vicenscontreras_m_Page_071.QC.jpg
0206204502dce6499513dd935e144c5d
c1256db90d03561c0911bb73ece2bd4aeb256704
29398 F20101220_AABNJQ vicenscontreras_m_Page_056.QC.jpg
4846625e2deacbc26dbcd525a97b7197
e5156a5b5f06905af67f73c87d7aceb8a05d2f61
34280 F20101220_AABMHC vicenscontreras_m_Page_131.QC.jpg
682b902fad5bf32b08fce92a42801f17
28069a7c52ff78343ebd077eb236d6a0370c1b9d
F20101220_AABMGO vicenscontreras_m_Page_127.tif
b672496a1ff5044fdfa41b7cedfafe7b
282f222317bf8139f8fa21e84ef3202d4ffc2903
32811 F20101220_AABNKF vicenscontreras_m_Page_072.QC.jpg
c816575b5b92419c7a5e707344a0cc97
375cb8969785d29c19d038d3976d44808ea62a3e
7986 F20101220_AABNJR vicenscontreras_m_Page_056thm.jpg
0cd8220b54a64242b74107fdb554abad
0e52ad2986e15f25c6eab6cf34d0e13a93e27b21
1794 F20101220_AABMHD vicenscontreras_m_Page_099.txt
19afc314e52d30e3bf326f542d4ff8e9
c1602347f2b2cf2f877b91f284da402fe6f461b8
5893 F20101220_AABMGP vicenscontreras_m_Page_070thm.jpg
9ec27b8ea84596b3d9d45cd669a4364e
407acb8fda7f4c2c2d34000a19682a247a495ef9
28353 F20101220_AABNKG vicenscontreras_m_Page_073.QC.jpg
438f4bbc64b7282b8a0f4a03771a4d08
d77afea8b253a6060f7ef52d529e5523c74f4aee
8280 F20101220_AABNJS vicenscontreras_m_Page_057thm.jpg
936be2a9ee5b902158a840bf8f7737d2
c68ffdb505d5be0304688c150d354360ffc15fef
104875 F20101220_AABMHE vicenscontreras_m_Page_107.jpg
ae00b4343869bd0564f9035126f79fd0
0b18a80f167604c57a8e2bc05739a44d52a3929d
1051975 F20101220_AABMGQ vicenscontreras_m_Page_117.jp2
db4a5eb45dd42f5eed26852d57b04b9b
14f1f5653f4b3f2e8b179c1c4a111ca05ac40778
28897 F20101220_AABNKH vicenscontreras_m_Page_074.QC.jpg
86533b3e1efa63318963c62946574e83
a20d3c5cf706b57eaa146ac145b1722e214369dd
19789 F20101220_AABNJT vicenscontreras_m_Page_058.QC.jpg
264416a703cca2c6112d323a8cb65dfc
151301cb1e05cc6e8e42f191d0ae9a1957bbd4b4
7886 F20101220_AABMHF vicenscontreras_m_Page_019thm.jpg
f06333b7d4e0a810778a42fa48f71a2a
c1daf4e8f66c934451b3da30f18ce4e4e64841c6
1983 F20101220_AABMGR vicenscontreras_m_Page_123.txt
26c33cb7941cf89875d97b1f003b8cd5
3d147728074bb54a0d3d00fa6d4b976b9f357cda
8213 F20101220_AABNKI vicenscontreras_m_Page_074thm.jpg
2f211f1e624b91fc0b1ab2c49ad2ed6f
1fe720642406face6bb6987853c238f39c4d344e
4922 F20101220_AABNJU vicenscontreras_m_Page_058thm.jpg
693a51948e6dd0974c79aed68ebb7efd
37b12c054983eabff3a07a5c9439eb88a651e9ce
30327 F20101220_AABMHG vicenscontreras_m_Page_085.QC.jpg
b728e6b1427a528ff9b337050d973db4
aa4f7d099936aa64f4b769974149fd23417c0b63
105209 F20101220_AABMGS vicenscontreras_m_Page_120.jpg
0c3b2addc4fd273f4c99c679ccf7d978
4d6237cef4a837b4403253d7100d7f8a0591458e
7500 F20101220_AABNKJ vicenscontreras_m_Page_078thm.jpg
0a31463d9b7ed5511750469b646d1818
6034c7215554d1080181dbd3f6507d04719f50d5
7528 F20101220_AABNJV vicenscontreras_m_Page_059thm.jpg
709b9cf95ef54230c2f8a47726310f8e
6c17727f10fa484fedf799425ab7c1dc26d64756
1051957 F20101220_AABMHH vicenscontreras_m_Page_068.jp2
f5e78db920aaffc5fcefbde091a4afe2
0c56ae2e2c2644f0a8077404367e1d1fd193340a
100456 F20101220_AABMGT vicenscontreras_m_Page_038.jpg
afc01ca61d3f11739ac9e0be71c69cef
a26e9a56523cc39899181a086be5be613e8f585f
8355 F20101220_AABNKK vicenscontreras_m_Page_079thm.jpg
1dd77abd9f9b69f1ffbdd143a393b9a6
2500a9bc422b6632f4999d91b624696f601a3e9b
33963 F20101220_AABNJW vicenscontreras_m_Page_062.QC.jpg
d815816fdb6d316d5b7d983413d8b9c5
3311f6dc34feb707df954627ada5c0440cbab756
34832 F20101220_AABMHI vicenscontreras_m_Page_118.QC.jpg
bf23c5a588d6336596bbb7e745bdce36
779925f731eb19fa1bfc64794f947abd3b72d391
103362 F20101220_AABMGU vicenscontreras_m_Page_065.jpg
11bf0fb089a5c6a01030088cce16fdb8
7a1e43096962938d9caedb51f5da4c96ab0c8f88
20244 F20101220_AABNLA vicenscontreras_m_Page_097.QC.jpg
bf0e615669bd8a51ac2137d20ffc5c51
99ade01313c76f3fb2241449dd601b96a1d5eda3
33135 F20101220_AABNKL vicenscontreras_m_Page_080.QC.jpg
1180bd21ba97c99b5421b99a1b07916c
9ef3fd19f54f2184e9d96ab92a46b95ace562b1f
17946 F20101220_AABNJX vicenscontreras_m_Page_064.QC.jpg
78b7c89eaf92d0c5f2ad0209a164d0d4
6b2c28f8a8350504e39e1f13d44e628256ac6b3b
48672 F20101220_AABMHJ vicenscontreras_m_Page_024.pro
ab6b0a41d441ca1575982fe8a7336baf
f30bd56d46a288092ed52bbf90874268d53f4b45
7247 F20101220_AABMGV vicenscontreras_m_Page_111thm.jpg
2ed9735b34229fb5e50246f72ad51c4e
d540b0a7c33390a753200297c26cef99a4125cb0
32500 F20101220_AABNLB vicenscontreras_m_Page_098.QC.jpg
b6bf64b0a9cb0bd401d80c60dcc85908
312cfc357130360b934a9e963dae1a197508315c
33080 F20101220_AABNKM vicenscontreras_m_Page_081.QC.jpg
af605f1f5bc7caea9757e8179112800f
978040dd94edaba30213cc3ea14ce81c83bbf42a
32298 F20101220_AABNJY vicenscontreras_m_Page_066.QC.jpg
08bd5ae4f9a3dbcb298af486f9dfa19c
35b007aca8d39385da5d18b8fd234a944e75cc5e
F20101220_AABMHK vicenscontreras_m_Page_097.tif
0700cfb1a88cd8d8a842e8c945036511
9321c7fec49677475fe4fa9aa7bedd33e073811f
51258 F20101220_AABMGW vicenscontreras_m_Page_016.pro
59a5835bcc40938c54df6bfe2fc51969
1e385adf4f32ca37e84355091d6cc9129a6a4a3a
8439 F20101220_AABNKN vicenscontreras_m_Page_081thm.jpg
8453e74a4f5ae68ef2c79baecb3f653f
c8c7bd39ee7ee95353a6831e81ea8b1600d0628d
7595 F20101220_AABNJZ vicenscontreras_m_Page_066thm.jpg
ab558f6c3ac810ee72cca7d5c07848e9
93e40c2b5172384a18b4bbca6329eee400683a4d
95712 F20101220_AABMHL vicenscontreras_m_Page_017.jpg
ba886111073fb4a48e5eab095f8f8d82
285977e25ae5b0a0b67c4527a351e50975904a0e
16468 F20101220_AABMGX vicenscontreras_m_Page_087.QC.jpg
671706f1381e7f7b5accba7b5024558d
e5f88ced78228572e12d2d9b860a8ed0e3567a9e
30693 F20101220_AABNLC vicenscontreras_m_Page_099.QC.jpg
2f8e06ec5f1b41dc096765253b626068
aa6c9ccd08324051411bd4b4a71d3f6c4328a321
29964 F20101220_AABNKO vicenscontreras_m_Page_082.QC.jpg
e2606c45d526033b784f354f82dffd20
d10910e4e114e87feab1fb17baa55f1347c974cf
2012 F20101220_AABMIA vicenscontreras_m_Page_104.txt
8f50bbacd9689395d30f6b1249ba8f9b
917d65b46e3a4c064c420f27f580df1b7cda09a1
7474 F20101220_AABMHM vicenscontreras_m_Page_096thm.jpg
a20185f5e606a880b20e616e9070107b
369520a4adde111e0d4c7562ef6bf6a2cac9b1f7
1051979 F20101220_AABMGY vicenscontreras_m_Page_063.jp2
37a19ee599cfb3389e2264f30d147ac0
252c2133d38158eede35d86b28b4e6421309a432
33565 F20101220_AABNLD vicenscontreras_m_Page_101.QC.jpg
11b6bb7f455a6c0d2fad3e9d7a127220
beaae7cd2f2b80bedb21dc0d27620b4169daebbf
32448 F20101220_AABNKP vicenscontreras_m_Page_083.QC.jpg
cc545840e47152dd7fa06d8327109f90
05afb6e8d8432859164bebdeca7d2e5cff24a02d
2179 F20101220_AABMIB vicenscontreras_m_Page_137.txt
bb4db848c165d369f12fe8f7cb1e9053
3d6615e5fb3bec05c65e9541b2481f79720831e4
22227 F20101220_AABMHN vicenscontreras_m_Page_064.pro
0da51fb6f699cc283e4a21975fa07725
92e5e3e88835e113461344dae3b560333dd97488
33275 F20101220_AABMGZ vicenscontreras_m_Page_136.QC.jpg
981b5d784b517a4af76a7938e5a312ca
b7260419d796353358284e14e5072c61881055a0
16098 F20101220_AABNLE vicenscontreras_m_Page_102.QC.jpg
cb335fe1f9179589a04019424d987de3
827d9b312144dc1602f9bbf8ec2363b6b95ddb04
9021 F20101220_AABNKQ vicenscontreras_m_Page_083thm.jpg
fbeca863df1c06889c35470611bb971f
9508bcd12e50b18ea69c5984268c486abf09037a
8327 F20101220_AABMIC vicenscontreras_m_Page_062thm.jpg
6d66e17975855def6318bfc8113a701a
0fd846dc2aaa267a5f6cb6ff06730104281de172
929693 F20101220_AABMHO vicenscontreras_m_Page_048.jp2
1e5fbfdc1290236563a8fcfea8a31c8a
9e62e451177779c0d03f97448fbcf7bb26abf786
4070 F20101220_AABNLF vicenscontreras_m_Page_102thm.jpg
18e7ba8f51b3a17f66615fb04311558e
f480897db14ecf50c3687c4823f79976b1950a99
27915 F20101220_AABNKR vicenscontreras_m_Page_084.QC.jpg
461064df44b3f606a1a3aa49c13745e9
c1b90ac20e48c5643487848cc0676392b553854b
936947 F20101220_AABMID vicenscontreras_m_Page_078.jp2
2e6af21a047443c80ebe5766989ed30a
096c90a867cc8d05d3ae196455d808a8b697b62a
34945 F20101220_AABMHP vicenscontreras_m_Page_049.QC.jpg
d0444fe53a05408b0e41b81c82feec7f
01ae15525574e0f8729a6ade2d006e0d04b1b6cd
30743 F20101220_AABNLG vicenscontreras_m_Page_103.QC.jpg
c6d674262981e3569fc631b4fbbb938e
c24362935a7a5528e7b8d004fb5bb1051d1a924f
7406 F20101220_AABNKS vicenscontreras_m_Page_085thm.jpg
662ec7e12adccabe4b2d8736d1a22745
03b4bf28335d9fda08f6ea740762407885fe44c6
2015 F20101220_AABMIE vicenscontreras_m_Page_121.txt
6165e9fbba03693f1c88b7d2ab1d2b67
961743b31ea96934ee05ccfdc9d888684098b9cd
97590 F20101220_AABMHQ vicenscontreras_m_Page_036.jpg
f9871b8935209a946e9f886c46f84e5e
e341a4d0bca1d3c72bfd1d7048c5a6b6a6874c3b
29442 F20101220_AABNLH vicenscontreras_m_Page_105.QC.jpg
29ac2385983f63b9edb2bdd48a1900c7
9268d69d87efe3f9f5a4d59a8aa655a9f4dd2fbe
24279 F20101220_AABNKT vicenscontreras_m_Page_088.QC.jpg
6699d5696d75d6377bec3892987efefd
7ea8c804c540380fbd3816010f3ea97aaf5e9178
1921 F20101220_AABMIF vicenscontreras_m_Page_018.txt
3fdbdfdb7502c9f078f74df2ae5e2a4b
8691f8be230f85f0ce4fdeb515b7cc0ae8babbcf
1051861 F20101220_AABMHR vicenscontreras_m_Page_130.jp2
ece637a8449db480efb802cd02c3ab47
0a767f8e68b8efa9d800895431022f43e6f1acf5
25826 F20101220_AABNLI vicenscontreras_m_Page_106.QC.jpg
de661e63ecf5901485de662bed8296f1
91b84b85e0d81ea10180ab2db847e59ddc9fda92
7087 F20101220_AABNKU vicenscontreras_m_Page_089thm.jpg
97cedf6a580c4c46983b0aeb1dcd994d
839cb54b4d52ce6e2d101338b421611b76a1433b
F20101220_AABMIG vicenscontreras_m_Page_022.tif
4a48f83137b2c9b9c10d04c5a3168d71
10d196b2406c35f2ee1cc959829473e33d669983
957016 F20101220_AABMHS vicenscontreras_m_Page_026.jp2
ae99fa2c6ea7e9ad2f2adb73d24d1fb1
996347136e939ac87c5ccccac8cc33af4c90590b
36239 F20101220_AABNLJ vicenscontreras_m_Page_108.QC.jpg
3799db53ae936e9d60aea3f9429c27f9
e890d9e5c25e5bb110fa9f53d9dcd32c81d80e93
25608 F20101220_AABNKV vicenscontreras_m_Page_093.QC.jpg
ad9d9945e694f2ebfab0e96ab1e830ab
9ad1271183acab382e1d241b4f7d0411a8e33deb
F20101220_AABMIH vicenscontreras_m_Page_110.tif
931340d68a6671fe1a0f0022b675a6b2
56f82eb790213f9f4571ce90e4e6c3af295018f5
F20101220_AABMHT vicenscontreras_m_Page_064.tif
695abdf4c4e9765cdff2d198765764ed
b2944901e477d5ae372465a3df22875f821b4cdd
8771 F20101220_AABNLK vicenscontreras_m_Page_108thm.jpg
9d64925cf10ab4c910d347d63e7b54f7
f650e97b854b844e241000a9c283668f578f2069
6871 F20101220_AABNKW vicenscontreras_m_Page_093thm.jpg
ff175091016eb16472aee3cc85953ff7
5db0ff8dd73ccf903fe21f26cf81aadf8a4b2629
109098 F20101220_AABMII vicenscontreras_m_Page_137.jpg
c26c404c6034babf2f2adbe0aa35656f
5aafea8f2868d0bec4fdf0f75b3934374db262f6
31077 F20101220_AABMHU vicenscontreras_m_Page_091.QC.jpg
9f8fd69706a5a18381b8f4940e36c50c
d1d92e24b7b75399ddeadc606161857dad4ccb9a
32969 F20101220_AABNMA vicenscontreras_m_Page_120.QC.jpg
cacabf8bef78642536fc1605c55d1565
8b092a733d079ce9105c87817e5547db2a9b8b1b
25844 F20101220_AABNLL vicenscontreras_m_Page_109.QC.jpg
0f43a5b83cb928c92d3ad7f984deea7c
0569ecaffc0d0c2f64e7f935cbe5c8fc0d74264b
25458 F20101220_AABNKX vicenscontreras_m_Page_094.QC.jpg
ea4590d187151dbac610a84bba59701d
6924cf613ca073f94d68c1b05f1899e513b4b45b
1141 F20101220_AABMIJ vicenscontreras_m_Page_056.txt
383cc2641cce693b92d086449f9aa309
14de0108f100bdf6a60e55c01267c0b668f5736d
F20101220_AABMHV vicenscontreras_m_Page_129.tif
15bce9d26ed519010ea44b53cfd6e15c
b8f5bec304e6266c098731716c0012c9adff1c53
8673 F20101220_AABNMB vicenscontreras_m_Page_120thm.jpg
158a91a2f73438daa849cb796dcf5af9
c593cc788a4477da4950143a2c2eab96c06206c4
6693 F20101220_AABNLM vicenscontreras_m_Page_109thm.jpg
3e5dee5b67d87a7f6b7d7a21c14a2e5d
85a5f4fb4f2c039231e0918253e8a94312005854
6273 F20101220_AABNKY vicenscontreras_m_Page_094thm.jpg
9c5e33ee061930ce461ec5603ab695b8
5eb9ab5a2465ca690cdaec5d72d0302657912711
1997 F20101220_AABMIK vicenscontreras_m_Page_131.txt
9f937a0a1a5dd016ce6b1e1a4387a65c
28bafd12a72606c76a925e4b2286e5ce38bb675b
1051966 F20101220_AABMHW vicenscontreras_m_Page_107.jp2
32e21a6ddff8a6cef1dbbce9c1a43985
8abe81e4bad336ffba80e34ba53c1423320e2fcd
32299 F20101220_AABNMC vicenscontreras_m_Page_121.QC.jpg
fdb362e17a8006abd9928a68a5c33b15
02ab7832842bb5cb3d3286aacd1b7c12b810c4ff
7910 F20101220_AABNLN vicenscontreras_m_Page_110thm.jpg
dc46ce8228b4e28067a230a854531bff
a8c70f14644e277d634b362acc4a253b25cb5e9f
32333 F20101220_AABNKZ vicenscontreras_m_Page_095.QC.jpg
fe072075305b869606afe66bcac97f23
20780bc19c1b577dbdf5943f48b19b722b866d7f
F20101220_AABMIL vicenscontreras_m_Page_007.tif
8f9730579840662e911456daaeb7f40a
edab518be7317f4000899a1400f3273482318adf
F20101220_AABMHX vicenscontreras_m_Page_020.tif
b6f53afbf98445d58f860fde93a11945
0498f400df6267add8aea3d93cfc4300a6ea4146
31624 F20101220_AABMJA vicenscontreras_m_Page_096.pro
459a330d3f4220619faf06d19a1b7188
ca4b06c9b68ada053dfdecd698bc10b1ededa3ee
26906 F20101220_AABNLO vicenscontreras_m_Page_111.QC.jpg
6a9cd08120560eb49acbde8ab7bd939c
b3e04a849d87c2898e342678cb05aa6dc2a2d148
28872 F20101220_AABMIM vicenscontreras_m_Page_078.QC.jpg
1a516ca03038ee7ca7423006cdaad02f
56227d4b74993dc7aa5309e8efef2862430d7875
45830 F20101220_AABMHY vicenscontreras_m_Page_122.pro
34e1a886de4981e8064c5b1990183d68
2b7ff77424d256541d8a07bc55696a530565b1b8
31155 F20101220_AABNMD vicenscontreras_m_Page_122.QC.jpg
24a6de3b7a836a0d13f18528bd95e3ce
77497256fec3da80602c07bb8223023a5d1273fe
32531 F20101220_AABNLP vicenscontreras_m_Page_112.QC.jpg
695da6d1cb2087f2d5426368e5c7ccec
f306f89182418894789626373877cb64f9010d97
7136 F20101220_AABMIN vicenscontreras_m_Page_003thm.jpg
311f0819ecfdb0704e5b9e4f3fa6d934
5b2184d7482548eda7558a1fec1b82c33a2c51d8
25314 F20101220_AABMHZ vicenscontreras_m_Page_007.pro
75827b2e25e2eeb48deded49cb46bc27
141f50180fe942b60f8f40c4b673719e37c5a321
F20101220_AABMJB vicenscontreras_m_Page_076.tif
41c937e3922122c6192c33efe0c28748
362d1471f86282b85bd3a9b30d50ee8b90422fd4
7788 F20101220_AABNME vicenscontreras_m_Page_122thm.jpg
324f359e37bf1fcdd676d26a2853440b
f4fb321e4e084aef3f1921e371338a5e7eea1799
7912 F20101220_AABNLQ vicenscontreras_m_Page_112thm.jpg
f36defff057a2e28a6238045855447e0
8e8f35727a7cc9308acfb8a586d4abe0b4df835d
F20101220_AABMIO vicenscontreras_m_Page_023.tif
529d71b69d2b0768aa08692bc4a9d370
35e38716c5c9fcad57eae9a515cc68d01534eb1b
49005 F20101220_AABMJC vicenscontreras_m_Page_077.pro
9e3ce99feb3efee82a03ad97e45055ab
e58d83093007683d35d719a356e4ee1a346a4e56
33410 F20101220_AABNMF vicenscontreras_m_Page_123.QC.jpg
29c276ac39b751c5156fddfe115b7185
580ee514f5f74c3a6a76ce3177df67cf72da8ff5
29821 F20101220_AABNLR vicenscontreras_m_Page_113.QC.jpg
2147212a90eab31e7396515fc1376441
6873d6586d5dab1bec30e08fb5e993f0a03b15ad
27431 F20101220_AABMIP vicenscontreras_m_Page_133.QC.jpg
fb61a939fbeacdce07593e8f3b309fba
abd8dc36b6c5da896f51f69bcb50be61a0dccd28
F20101220_AABMJD vicenscontreras_m_Page_071.txt
542a9aa29c06e4596e7437fc43a9109f
e1cac482c97f8648cf03edb589df0f061ed9e92f
8362 F20101220_AABNMG vicenscontreras_m_Page_123thm.jpg
6b8c51553742c6693816c7c244c4b8cf
4a409a7a916783b4f0cddd5261ae9a8586f5b232
8198 F20101220_AABNLS vicenscontreras_m_Page_114thm.jpg
0f33b10b7606a2269d7f5fd91e4e254f
ff3c6b8c681185e152d7b030bdc73d64b325455e
F20101220_AABMIQ vicenscontreras_m_Page_106.tif
5162ed9216d4e48e93ed7cf336a62f7a
14fe7dfad109f88ccb808b2623120799e0c7c713
99874 F20101220_AABMJE vicenscontreras_m_Page_060.jpg
f7cd6297ddc8f8089ed4dfdc086c6426
2398eaba780309efe6e80f40736b389edd3fb12f
5393 F20101220_AABNMH vicenscontreras_m_Page_124.QC.jpg
c316dedf35aaff4e2939c41ff4437422
8f35412246dbe2618982aa466db91a004065f510
28494 F20101220_AABNLT vicenscontreras_m_Page_115.QC.jpg
3fad4ae9fbf6f570ca0f3c6247255365
380d4403ee2a756d2e4064d1edd71376e3f34d6c
831657 F20101220_AABMJF vicenscontreras_m_Page_116.jp2
1e39c78034eee965f31d06e9a021cf37
94fc8628ab0d8617beeed420fcd7bd094e5965b2
32449 F20101220_AABMIR vicenscontreras_m_Page_114.QC.jpg
544f0c2eb6dbc783275561ece1e0f50d
f175560e99992232a857e656f9bde988b20072ef
1460 F20101220_AABNMI vicenscontreras_m_Page_124thm.jpg
43265f84b226d6cc3fe5a8e51124b11c
3d75b8454dbe45d6d3922ac6a7871e897115b042
23458 F20101220_AABNLU vicenscontreras_m_Page_116.QC.jpg
8263bffe299a518ff69d0eddf7260bdc
bd3e8cca19edc6f965fb607e87d7c56de8957520
F20101220_AABMJG vicenscontreras_m_Page_111.tif
e7e0e7f2346cd61cf6bb797eeeb12bb5
8b85d7b7a5a2005e6db537162d2afc73d8e2ffce
7851 F20101220_AABMIS vicenscontreras_m_Page_025thm.jpg
4fab8db9c456416d2efb40c3ce61f129
75d895fdc300911b69e77af4887aeee5f9e93f16
29361 F20101220_AABNMJ vicenscontreras_m_Page_125.QC.jpg
46b43e98ecd7d7ff4bac7bf876538d64
8d6a322086a9c286089744578f325bc22695188b
6672 F20101220_AABNLV vicenscontreras_m_Page_116thm.jpg
c83aa9685132e26a06e79a3f0cb2867f
a5514f355de451b9b4fccccc4e63d975e86de3c7
F20101220_AABMJH vicenscontreras_m_Page_036.tif
1308dbd351eb942413a23b590eb579f8
7fea3efd87ff48e33b2a09ed354056b09424759c
30227 F20101220_AABMIT vicenscontreras_m_Page_053.pro
ddd2c9c1766694eb61478a8a3337e212
4a01d916276ea053daaee6bc00f93bf61d35065c
7407 F20101220_AABNMK vicenscontreras_m_Page_125thm.jpg
8f339cea42a14f0db6feea4022f14e0d
f9a6329708693fcfeeff9d24d5f667c203d9a3cf
32276 F20101220_AABNLW vicenscontreras_m_Page_117.QC.jpg
6b724b2d90379e034107bc353dd83369
f395624d32eeaa0342758842d6cb7536cb8f96a7
8095 F20101220_AABMJI vicenscontreras_m_Page_100thm.jpg
bb644bc919513ae7204a9a520a54067b
7e22509518f0b7c985656362928517783e4d272f
103459 F20101220_AABMIU vicenscontreras_m_Page_020.jpg
aee201ce8e65520f7c75afc7b636cfca
970005e656fb6706b3939447af745af63061fabe
33480 F20101220_AABNML vicenscontreras_m_Page_126.QC.jpg
0b26ec19a2ea1d79f05b7afc02f1d4d4
8b3d2ca8afa55d16f03b249c6b3e748559bdeeaf
8919 F20101220_AABNLX vicenscontreras_m_Page_118thm.jpg
de4e4558b0968186c2fee0316863d369
ae6385eb468aec90984d87de320058d4185aed46
F20101220_AABMJJ vicenscontreras_m_Page_130.tif
01f43a418266f0bff20608ecb9ff099e
47d1d4b93f8b0d599f4f8bfa01bd9ef0676aa506
32100 F20101220_AABMIV vicenscontreras_m_Page_036.QC.jpg
40a5bdeafc0f556d66f6285fa7bb840e
245c9a5d6cdee7708686419dcb1e462e6819c034
33633 F20101220_AABNMM vicenscontreras_m_Page_128.QC.jpg
2a66108ae79d0e0debb5473e899dc7e7
9e0fb81fd33812ad62f232f2fcb184e8b1c15528
34743 F20101220_AABNLY vicenscontreras_m_Page_119.QC.jpg
2b62790d6d21810a3dde66eca0665a66
0864367ce1818e018fd7336c074efb68bfc29ea4
8081 F20101220_AABMJK vicenscontreras_m_Page_092thm.jpg
04ec3bb5cd25e41a4cea05cbbd65f687
7dee611112de57f58a64ef605bf04adea6533e12
31567 F20101220_AABMIW vicenscontreras_m_Page_063.QC.jpg
f8a4d37f7b70eacf3c2b9c5d0306c883
414930a20c4c45af8bd47e75fb5c6b659f5a6211
8382 F20101220_AABNMN vicenscontreras_m_Page_128thm.jpg
58b0f086b049152f2946b3f86690c2c4
e5038222de47e840a12ecc7e9c39eccae3fff884
8534 F20101220_AABNLZ vicenscontreras_m_Page_119thm.jpg
cd04369f659479937afba09b00219e94
b69ea39175108dc445eee2fc6624da10d4be8483
35147 F20101220_AABMKA vicenscontreras_m_Page_074.pro
4919c10a6ca29211338aa5fce828abfc
1ada56d3bbf4b467f4565986aad6a92151beadc0
F20101220_AABMJL vicenscontreras_m_Page_070.tif
ea81279a401829f781e03436bac93364
c95213c5e4e04d2e177eaebcd3f3aefc32492ade
83402 F20101220_AABMIX vicenscontreras_m_Page_093.jpg
e81baef5f4d887b00ab31215bbacb0db
79475ed1632f33f3b523b0c81c020753fcebb881
34018 F20101220_AABNMO vicenscontreras_m_Page_129.QC.jpg
c8f24f71ece64c3e4c0381fbdcea616f
e610b27aab204a1d403ac8badae463a533b9c4bf
52237 F20101220_AABMKB vicenscontreras_m_Page_054.jpg
9b92ef872d3e653a635e9d69d43b570a
014ae145d6c7116e66abab6748b71133dc14ed72
33183 F20101220_AABMJM vicenscontreras_m_Page_077.QC.jpg
4ac26c2b25af8d15c24c14294773e438
05a9d4d04b45e551c266d89d9da67472532e41a8
8494 F20101220_AABMIY vicenscontreras_m_Page_065thm.jpg
d97a421e5f4dd264365e954523776cc1
6b63cd72d1d57f25104ff0fa4562fc08c4fff96d
8551 F20101220_AABNMP vicenscontreras_m_Page_129thm.jpg
e47f9c4fd140c6b518d6e57d732cab23
d273ef55f59d5cfab26bea530d19d1125219afa3
8146 F20101220_AABMJN vicenscontreras_m_Page_015thm.jpg
d82f6517abf57d4d83f0e24c759ba5d5
7ff7c9c6adb21852d2b9dcc926858469fc41bc8c
F20101220_AABMIZ vicenscontreras_m_Page_104thm.jpg
e2592e39382eeeef28c24faa1c8553ea
b42748f2ce5d9dcc4fa279f0191eb4cf583ea833
33508 F20101220_AABNMQ vicenscontreras_m_Page_130.QC.jpg
c40062c3c1f8fce080d1f4dce46956b9
877c28dd7c80fc6f26467ee83216bc85a98612ee
29272 F20101220_AABMKC vicenscontreras_m_Page_076.QC.jpg
4ad71920e3a5c7f32cfc3ddec47719e7
c4f5f69452360a5767ef72d3a51d05c68a13bb87
97121 F20101220_AABMJO vicenscontreras_m_Page_039.jpg
7d753033c3e39a318bc594898b01696d
e94c65fa5d6c5d225625f82d3c1d7dc5e127f458
8259 F20101220_AABNMR vicenscontreras_m_Page_130thm.jpg
264449f84f9cd9a78c9be5687d1f4d7a
55b75798eee125f1e6a65a12065653961fd43e06
636612 F20101220_AABMKD vicenscontreras_m_Page_064.jp2
c7020b3eeaaea6fc04706ec15b9c412c
b2adb97f63379aec375da9430d0caebe16fef617
49594 F20101220_AABMJP vicenscontreras_m_Page_102.jpg
eb684892b6ec2f3634e4f4bb926e3b07
b80907a6960267bf75f8805e33b1b81b2ddae482
25920 F20101220_AABNMS vicenscontreras_m_Page_132.QC.jpg
bb628c95e6211007f188218bc9e4259c
0b000c1c49a9fa71d470c414ad5c2efc2542bfd5
104330 F20101220_AABMKE vicenscontreras_m_Page_042.jpg
c64e48098bb3a1868258d9d60ba2a0e1
669e758adac2ab79ebd553bdc11c097baf65f8cc
12390 F20101220_AABMJQ vicenscontreras_m_Page_008.QC.jpg
8bc36522319b84cff5cf786982917963
00c11ca005c326b188e370ea4ffddbd7579c3a1e
32730 F20101220_AABNMT vicenscontreras_m_Page_134.QC.jpg
555264a460f90a6e613445bc64755ce3
1ae52ab49dab2e024722efadce3dc923ed62a314
33227 F20101220_AABMKF vicenscontreras_m_Page_047.QC.jpg
5fef69f8f294d4ea904870248ae66b1e
9c690297fa304f57ef1ebcca1b7240f15591af33
F20101220_AABMJR vicenscontreras_m_Page_098.jp2
80b9da4e81b291ffaed935ab0b50a141
cc923afbd14595de3e09effc9d60ff161eb13d5f
8507 F20101220_AABNMU vicenscontreras_m_Page_134thm.jpg
47916c197abf2ab957906c09d3e25ae9
6ce81508fe4a4b777419b6aed7e19ea97ca0c054
1051938 F20101220_AABMKG vicenscontreras_m_Page_020.jp2
ccb4cfd9a522aa6428b4e26fdd104c40
eaf57e8d0435eaa7b2a2835e15f8c8133aebca7b
1143 F20101220_AABMJS vicenscontreras_m_Page_050.txt
0123eab6d39b6ae72d2e6b3b65b29858
ddc85f2f8781fcde0cb6c8e2958253ce5dfc0137
8456 F20101220_AABNMV vicenscontreras_m_Page_135thm.jpg
7718cd26ec4ea10ac1c02d3b45d84018
381aa205ddd075b932e8decf5932b3a07701d546
684947 F20101220_AABMKH vicenscontreras_m_Page_087.jp2
8b94932fb82b5b1b986e929fe2e545d1
ce0e7bf55f57bb8ae133d7daa98674d83304437f
53587 F20101220_AABMJT vicenscontreras_m_Page_137.pro
d846ebbe378386dad11fb60dd3d4d1a8
c990b9d69b1f7a392f32b33bfd64fefda27867b6
8065 F20101220_AABNMW vicenscontreras_m_Page_136thm.jpg
d672fdfe6321fa564212772a403bea45
cc458bc17247ed3ec57d5eaa2ccac881fd50d5f4
25408 F20101220_AABMKI vicenscontreras_m_Page_089.QC.jpg
4cbaf7ea4f8402d04d6bc4705bdd8056
049b7d8604c4b971177a274b6d45f74e6b656416
1036649 F20101220_AABMJU vicenscontreras_m_Page_066.jp2
2bae22108046d034ec3deaf0e389e315
581c906ba6c8dcacf5df3c1024afc960ddacf454
12965 F20101220_AABNMX vicenscontreras_m_Page_138.QC.jpg
48dcd5d79b26d695d525801e9efbb857
8e39a211973e3219c08738113a8098aa25381205
F20101220_AABMKJ vicenscontreras_m_Page_014.tif
ee295968763081ba9a96b1c769318b77
5e26d986e3ddeb75fb9b4e05ace639b2f08eb6fe
F20101220_AABMJV vicenscontreras_m_Page_122.tif
6845cd70d612250d812f95135cb14806
186c7b5869576bd7faf33c5f93585917255d595e
3431 F20101220_AABNMY vicenscontreras_m_Page_138thm.jpg
054e7cbbc5bc9f6d6366590c38192bac
98f5baec3f2e81f66cd69b5d650965642b0bd091
25381 F20101220_AABMKK vicenscontreras_m_Page_056.pro
a858df37244bb216bc1b1bf4334522f8
07d15d91ed63a6989edcd6e15a0ea81d0777e473
87999 F20101220_AABMJW vicenscontreras_m_Page_115.jpg
a0fb34fe1f0e5555520fc3831bcd3558
479b29303dacae08a6be50983d2f867fa7dd27e3
17978 F20101220_AABNMZ vicenscontreras_m_Page_139.QC.jpg
594196a53564b0c321a39f011e00bf07
9375e116f11d570adebdaafae4d80319cb4e54be
34404 F20101220_AABMKL vicenscontreras_m_Page_079.QC.jpg
55126450dd98902b499b3536ab5b212d
8cda21674099790e677a7165541df2637001167b
7185 F20101220_AABMJX vicenscontreras_m_Page_053thm.jpg
3c34ee076d85ff33091472209c0381fa
d3eb2e8f1aa997de5f9646071badfab1c02e85ab
27592 F20101220_AABMLA vicenscontreras_m_Page_033.pro
84f35ff1e13e26327ae4c60e1f623138
caaa8ae51a45c8de4b77e59a4837d8c453e7643e
854547 F20101220_AABMKM vicenscontreras_m_Page_094.jp2
c7ed8ca38abff2ee5c9894d1668ee40e
c5dfd5c49b3fa2cfbf6fb6954e48eda059a974df
F20101220_AABMJY vicenscontreras_m_Page_004.tif
f62f50fc7c7183e34baaf196dfa3b58c
5054945e05226891e7d5293f1b9ba7abf8a293f1
F20101220_AABMLB vicenscontreras_m_Page_040.jp2
030a22366ed108c54dab7a02ca6b09e0
fe021c865dabad711e64ccf0ab9abbdb3279f661
1969 F20101220_AABMKN vicenscontreras_m_Page_060.txt
3a95122dc0c0ad3bad22ef8a28ed31f8
8119f8caabb1e8b4766441e2f87937bb8890ed0b
7455 F20101220_AABMJZ vicenscontreras_m_Page_076thm.jpg
51ddc09d9718c2dfcf8a042e32bcecd6
7624a428814f3207bf530ac928519e9f3b2c4c92
97152 F20101220_AABMLC vicenscontreras_m_Page_044.jpg
3bd86f8022ffbb514e11748a63a7f435
ec729169a626e57f21d40ff3fef6776b20e98121
F20101220_AABMKO vicenscontreras_m_Page_138.tif
4a43bce251d7f331fb1f254e50804df0
9b28878a65ebbc393d875a5509348a66b348e23b
F20101220_AABMKP vicenscontreras_m_Page_113.tif
79139097ab3958c9d14133f9346948d2
09296622224375b1765d20b29d6034805473bec1
46959 F20101220_AABMLD vicenscontreras_m_Page_098.pro
e4926d5e563ba0415a9101afdc7a5edd
c5130d535575ff5e6a0d0dbdfee23ff61d752500
1051933 F20101220_AABMKQ vicenscontreras_m_Page_015.jp2
f74563636deef86a1f714a946023c02d
8ff4c3594eed77a68e2740f09601a04067aeef8e
F20101220_AABMLE vicenscontreras_m_Page_131.tif
24b07a3941e0baa243d5207d6645a7b8
629f0ab94b865c020ca10fbf2884a82cd3df6d45
104820 F20101220_AABMKR vicenscontreras_m_Page_009.jpg
e626b1369de69299308934dc8ed06d09
50ba2a459c35fb92c8e2b72a95e1bfee5d3e6e17
1800 F20101220_AABMLF vicenscontreras_m_Page_017.txt
583d6420f2f358d39e0fe0fbc3cb8a03
82c6c05533bc05a52b662d025eab7d1efce95289
32209 F20101220_AABMKS vicenscontreras_m_Page_018.QC.jpg
cff562df6b3ff677ff2f7ea447405914
8b4d5930457ca2eefce9bc1a85a40d6f46daa2cf
8009 F20101220_AABMLG vicenscontreras_m_Page_027thm.jpg
763a19604fd0700e4e032d2707a5622c
be527837c47bf4ffa12e0cbac6f9be2ce5b816b6
1051964 F20101220_AABMKT vicenscontreras_m_Page_092.jp2
fb08d082185e3a57a6262d6444182b3f
97fef679d735f31c33547cf2f07414dbab2aa9ca
1080 F20101220_AABMLH vicenscontreras_m_Page_064.txt
362c2d2d4e845ba3fdb031113ee7dbd9
5a3e2666097c91119dbecf6447cbcd678ecf9a76
F20101220_AABMKU vicenscontreras_m_Page_084.tif
5b8ff87ceca87df4c39ffcb6b0f65a05
0a762011360de82c760d25497601da2db637c5c8
1865 F20101220_AABMLI vicenscontreras_m_Page_014.txt
9ed438bd6f41e1f6da22bdd0cafe0ea3
85f2fa17a17ff3d57935e34f8118d771a34359d4
1293 F20101220_AABMKV vicenscontreras_m_Page_053.txt
78150fcbb8a849ea21bc6b9f00495a7b
f8f94cb7f4ec087f6c9f3b52af8012c343631f2c
79364 F20101220_AABMLJ vicenscontreras_m_Page_116.jpg
fc3a8daced9d8837ebc9ffc1dc8f463b
b2ef670a509702a0bf550dcce4f9685cb9f35809
75826 F20101220_AABMKW vicenscontreras_m_Page_052.jpg
c27a5c6903922a780d74368e384f8560
84a38b33c000b284d3bf99c0b45963dc0225acdb
F20101220_AABMLK vicenscontreras_m_Page_091.tif
6232d6bee0bf81f2936bebcd9709d4dc
5ce6a963d56b42b4e562543263811314a056a028
34644 F20101220_AABMKX vicenscontreras_m_Page_137.QC.jpg
d690934c4738bd532a2891c6fb4f0712
150ded102d6fb4252ab5d110858a3851da08cd8e
929422 F20101220_AABMMA vicenscontreras_m_Page_133.jp2
d6a31b2499252cf3d701ff0ed7cf91c8
d41c312bba0c33959d4d7a978258c73fdf4040e5
858 F20101220_AABMLL vicenscontreras_m_Page_054.txt
64fe14bcae6c81ad5eb194d5c74edf4e
f91e6108d0eb119a47ebce2a57b46e1b6cd7cf84
F20101220_AABMKY vicenscontreras_m_Page_119.tif
c111b60ca50039f056281a3470e2ce13
f70e6b4f2646978430697f379a090ee8e21abf00
F20101220_AABMMB vicenscontreras_m_Page_049.tif
bf19cbe22737d816b1a4bd5fa2169f2a
2bfc93b049178a2687e01c53a91c4031c7e154a2
F20101220_AABMLM vicenscontreras_m_Page_107.tif
b539b1b349b7e0dc4d3f7d36eff5b7de
8a27a1daefb3486e0fa9962a1c90059c083037d0
1698 F20101220_AABMKZ vicenscontreras_m_Page_028.txt
dc685a8c535bd23b61a69c3c870da5d8
e50dfda899da443537e9777b1a8b4c23435f2086
101974 F20101220_AABMMC vicenscontreras_m_Page_127.jpg
ca900abc7cd915691213674fbd07b297
c302c9f35f083fc6f064c36678dbd39fa9275947
39076 F20101220_AABMLN vicenscontreras_m_Page_026.pro
6d194b5c3cfcbe094d5282318469bbb6
9fe721a92c95dda451098aedbd76d9d8e9f12d6a
1926 F20101220_AABMMD vicenscontreras_m_Page_055.txt
3ae9b91e05d3685c441f398589843e02
7b2ed2136a0f664e71b566da3544ebe9b77fb551
39198 F20101220_AABMLO vicenscontreras_m_Page_083.pro
df9db23bdd3c257c3471e9b52dd734b3
1e921e91bae807533c6921368d8855c1ca8b1dfb
902058 F20101220_AABMLP vicenscontreras_m_Page_110.jp2
f7f0a3c0857a5fc6fd7ae9963c6497e2
2b9a4882614e3d0eb030024fd38d425c0835b3e3
20496 F20101220_AABMME vicenscontreras_m_Page_075.QC.jpg
b9e4a65080a7ef40d9d4b1a88151fb74
2b7674060cb18130d6e5b6dbc32844ae4ac7a05b
1660 F20101220_AABMLQ vicenscontreras_m_Page_078.txt
e3c3fa41c03f5175a1464173ce4a14e7
c4a80034e4e3f6bd112fc1058b5f54517b1e77de
37151 F20101220_AABMMF vicenscontreras_m_Page_094.pro
5a3629a2a9c2f65a2c3fe0f571580234
4f48cd2de03cad16bd2e568d3258d71612a3c529
51000 F20101220_AABMLR vicenscontreras_m_Page_049.pro
8aa9875110d76b9cd1a6163178b86645
0a38bdaa9a41688a814fb3e6f6e6d7e0853de525
1311 F20101220_AABMMG vicenscontreras_m_Page_089.txt
7f455e5b30036e30be719f06513acf3e
ff9b2737ea186b9b1654de8ab14d465bdbb27185
85043 F20101220_AABMLS vicenscontreras_m_Page_012.jpg
cb17630c722456e572d1bc8df5d988d2
0d7a4e927b65c77e4a5cc6fb4920b51c3e30ceb7
25544 F20101220_AABMMH vicenscontreras_m_Page_050.pro
6fff1312e92714920a61bbda8fabf9b7
211460cfc84bad979205a7b13eae8b28b0bf2617
1016816 F20101220_AABMLT vicenscontreras_m_Page_076.jp2
2c9a376345557a49f63876cae6902176
d4e3348f970a238091bd461df21fabd382394974
2019 F20101220_AABMMI vicenscontreras_m_Page_027.txt
5f51e9375903061cb004f5f3e840a80a
adb9dfc379ebb143fb3018ca6cff2defdff9a35b
1051962 F20101220_AABMLU vicenscontreras_m_Page_019.jp2
2234b4b9f038bccf64a8fd2506ec9281
7f40484e4c921c8a378f28d2be66bfffd9a8d7ae
1051955 F20101220_AABMMJ vicenscontreras_m_Page_011.jp2
18b6a773b64451fe1d1251c6547a59c4
8b355d105d49f4d96d69e42fb96a07187e7580cd
93854 F20101220_AABMLV vicenscontreras_m_Page_099.jpg
87e96abf64a06d2061bbb5597c4c7ab4
2f0a92f8a641992c429a0f682dcf5ad120ef844d
1016017 F20101220_AABMMK vicenscontreras_m_Page_014.jp2
3c6cb00ab9edc4acef850f511ef1ad28
29672b5f81a38a18fdd0418e37ce40f72615bdca
8335 F20101220_AABMLW vicenscontreras_m_Page_077thm.jpg
23d4740849515430b07efc33f07bc68f
bc2cbc628f10c522986e85bc026a2c97e07e1131
6290 F20101220_AABMNA vicenscontreras_m_Page_013thm.jpg
a74070b3abf05eb070871fc9d13d61dc
f874ff4550323fe8fbe5e3fa85d6d9cdd3828df0
45487 F20101220_AABMML vicenscontreras_m_Page_121.pro
bf42ea904fbb3439ebc3ea2332f1ed7c
4d9544ee03e07388124126cd88eaa35b661bc231
59917 F20101220_AABMLX vicenscontreras_m_Page_050.jpg
d68e10d5c43f70b1c181b98e5c5db49e
dde28aa98714a9832ae04b198ef87bacf5841faf
F20101220_AABMNB vicenscontreras_m_Page_078.tif
4c18cee3367a101b7dc4d4a93b329c0c
33ab0cf6c827a8fcf29b1786234f76a8d769fb52
28344 F20101220_AABMMM vicenscontreras_m_Page_090.QC.jpg
6be520126d784119d3e28166bf511fdf
c01b53dad46162872a74773cf186c72b332a14be
33937 F20101220_AABMLY vicenscontreras_m_Page_107.QC.jpg
81fd28fbc7b0e7d36f16d2e130f54d2b
9eac646e0f2ea98864b4b4b3b7ef0132031360bc
F20101220_AABMNC vicenscontreras_m_Page_135.tif
ff2fe1673c4172d52d40b3cc379f1c3e
09719cf59f809b63a814424babdcd2a93368113b
F20101220_AABMMN vicenscontreras_m_Page_083.tif
cd218781228ac116ed2cdce4e80d2e2a
02ce2f8c269fc0fa9645bc51dfb7577ef862801f
103916 F20101220_AABMLZ vicenscontreras_m_Page_121.jpg
3bccb774963ffa2819d3d62b300541c6
74efb0aebb987e355c2e6e42c89123fa7641ea2f
F20101220_AABMND vicenscontreras_m_Page_037.jp2
f10d902624824850b279716df13a9f31
aea865a1c9d28b8f51f5e2d27ca9300f6ad16446
60405 F20101220_AABMMO vicenscontreras_m_Page_010.pro
85e1c94fb31e593f91024623db204cbd
584a4c5a380f3cc08891f767708970d68477a4ce
33740 F20101220_AABMNE vicenscontreras_m_Page_020.QC.jpg
40370be2cae5e475c029c83d2b661710
a488e16d0742944711d6eb2ccd8260a41fc2034a
8887 F20101220_AABMMP vicenscontreras_m_Page_048thm.jpg
6ff6d562e703423c2dc10ad43f5596d3
e76ab53a27099dc790afd71d529646e65a2b6e16
35582 F20101220_AABMMQ vicenscontreras_m_Page_031.QC.jpg
a8fc61e61729019e7c1fb0d34270d3ec
d08f904b119743c62d32590cef4426c786af9bc7
1051929 F20101220_AABMNF vicenscontreras_m_Page_079.jp2
94ff9c6471b189c03e02c4b60706ed91
1ed2bb69c624312a3da89c67d017bfc775097860
1051969 F20101220_AABMMR vicenscontreras_m_Page_024.jp2
420e795f1e4c0f85c90c527d026bd44c
46116e5bb022a01a6d51cbf1bc2c54538c450e27
F20101220_AABMNG vicenscontreras_m_Page_092.txt
2558edd694f094e0d23ec5da102bdf10
2b80af87888b2b26140db401a07e22fb3ac4f0c7
50254 F20101220_AABMMS vicenscontreras_m_Page_019.pro
534245e856ef64ac02c7ee42bca86c16
f324fbf72fe0481cec2a496b7c0a004dfb768d67
F20101220_AABMNH vicenscontreras_m_Page_125.tif
e5379b5c755e48013674d64555a161a6
c0aa410dce8804002b01599333ff89947fb3361e
F20101220_AABMMT vicenscontreras_m_Page_082.txt
f121f9cbc6a1fb64a4528a05d58d9eab
6962f046ea488a9069227600387c471094624772
49300 F20101220_AABMNI vicenscontreras_m_Page_061.pro
c9c3312379bfc9642e85f5166b07ba49
e82b0e36c207c31cc0f2a416731e97ba0e155944
1051954 F20101220_AABMMU vicenscontreras_m_Page_027.jp2
728b2b81a9eab56fd7f261ddc9bafe30
537e9efaa011f3aa8388aa1ef36d70a929941c79
1308 F20101220_AABMNJ vicenscontreras_m_Page_052.txt
ecb355028ad388cb6d3bc5b7df3346eb
af92db46be045458c1f5aa6ecedf64cbe3a9a0c8
6355 F20101220_AABMMV vicenscontreras_m_Page_132thm.jpg
cb015d3089de0c9c7cde1ca443d0f9bf
ba4d2f06a355eec88be0f8bcb8f541a42e14caaa
7927 F20101220_AABMNK vicenscontreras_m_Page_098thm.jpg
62ba0ff8dbd22cd812ccd0e4a6cc3e24
488e689c0192779d64660f3c430b7ac82a5c1a4d
7015 F20101220_AABMMW vicenscontreras_m_Page_115thm.jpg
7ac1a9af9a0a1944d27a161b3c3f7f40
7a2511a80a7be94ed89c7e22250a5fe7e2c76a96
7721 F20101220_AABMNL vicenscontreras_m_Page_073thm.jpg
2b75ee38b67ef09210b95c1ec23f2795
39d447fc8b8c35170550820356f52a07d1e7c1f6
8323 F20101220_AABMMX vicenscontreras_m_Page_126thm.jpg
c85430557ce481c964c3094e93e6aa84
819ef94d1db6c664f68886bfa69920e133355080
625972 F20101220_AABMOA vicenscontreras_m_Page_050.jp2
36383383b077b59b72156ec0ccded996
67d4d98044910e72ab1ddbafdb4de6700e113f1e
4634 F20101220_AABMNM vicenscontreras_m_Page_139thm.jpg
b7f06ff33a24f7d97fc94d9158ec30db
1fd878afbfa1ce69aa0b854ee0663c3ab8138823
97932 F20101220_AABMMY vicenscontreras_m_Page_028.jpg
e254a187bab6e5f553e1c7479a324c31
7595488ecb6d8969a327072722e7bd03fa96ff15
32468 F20101220_AABMOB vicenscontreras_m_Page_092.QC.jpg
17a337186c1886fb7f17bd8d3c7a0a4e
0fb9ec2759f0f2d0823bcbb53e90a2e43126c4b7
8779 F20101220_AABMNN vicenscontreras_m_Page_137thm.jpg
eb9025e88f2be8a071fb5d8ab9f61315
390520b97d6ef3e91c0f2a342faa566a20cbd4c1
35242 F20101220_AABMMZ vicenscontreras_m_Page_061.QC.jpg
807d6177e2023eb5a1fb5225f7f78f71
c20557d529da7d217c944734d1cdbc2373685863
81297 F20101220_AABMOC vicenscontreras_m_Page_084.jpg
aded8a117147bf04436b1bf97e7850fc
9dfa567ee75e28824b8c59bed7d08ac99e348939
7782 F20101220_AABMOD vicenscontreras_m_Page_045thm.jpg
9ecdddb515c46deadd2809a50973af7f
67d8d2d10a11ff58bbdecc9ee6c5962f79f60b89
47938 F20101220_AABMNO vicenscontreras_m_Page_043.pro
a312df0e2d7fe988e88243664bf72ae0
8bb3c69ca1b56e844fd43f4398bc4220a38098d5
7619 F20101220_AABMOE vicenscontreras_m_Page_091thm.jpg
9fa9efbd6f4e062548ae99dbbc820c0b
3447c6e700e55b2d650be6cc5f2f3cfc4bb4e559
1938 F20101220_AABMNP vicenscontreras_m_Page_134.txt
05087207effa1eba83c39f6071f4f17c
b9a7ca4054a1198cb939556fa1d70112d95c83a7
1843 F20101220_AABMOF vicenscontreras_m_Page_045.txt
1b4f9fbe5492e7e86da98483b7d1f03e
0d49b7ee91b3ce83b07d83005cc881b7f3b4502c
8223 F20101220_AABMNQ vicenscontreras_m_Page_072thm.jpg
f245002cde5f94c4e0031d55070911d1
5964dd9901c13b3985b002fb91156af388ab8a2a
8048 F20101220_AABMNR vicenscontreras_m_Page_028thm.jpg
7e7ce19ed2025a3a58646307cd5e6a56
2c40bc7ee81df5a94e97ace146ab60de7f45ce6c
88306 F20101220_AABMOG vicenscontreras_m_Page_096.jpg
344bf767104a32b7f574f0732bcf3ec6
f11e919e3845409b88830f5834f37d1750d9dfa9
7428 F20101220_AABMNS vicenscontreras_m_Page_082thm.jpg
7f4a3fac0d06b406b8034d523f15c610
33d87ce9b6bdcff754d79a38a036d9eef02fdc84
6333 F20101220_AABMOH vicenscontreras_m_Page_005thm.jpg
cb14f79cd92deff21ffaa202c8e5f27d
09cbfae70d51dc023bba69b2f39906d87973e139
30269 F20101220_AABMNT vicenscontreras_m_Page_075.pro
550ef4c50f7334ddf748a1f81a6789ab
ed5a7a8513a367dc9a6cdb4366aa84e67e535ff5
89805 F20101220_AABMOI vicenscontreras_m_Page_034.jpg
dfd091a3d1e5280cbdea9e43a390e90d
24d2d2f6f26c9dcd38f540ef9b8099ec4846ac66
8197 F20101220_AABMNU vicenscontreras_m_Page_107thm.jpg
844d900c841cacb47776291f93b827f8
ed38fd5e29487507dae68a8bfdecd2997f6d5038
F20101220_AABMOJ vicenscontreras_m_Page_048.tif
34594540d82f69b8072a55a709a1866b
093a9e38474d7dc8c6bf1a303a10702aec879e28
105840 F20101220_AABMNV vicenscontreras_m_Page_119.jpg
db4c3805496731768e33c64ea1325ac3
3b3f985c5a6297310e5d7ed7ecc8f287e1e81873
22038101 F20101220_AABMOK vicenscontreras_m.pdf
0ae615f548e2f2378a99c889b64b51ce
d777fa36f9f2bd60b5d04547e69222cd78a7b158
8183 F20101220_AABMNW vicenscontreras_m_Page_127thm.jpg
33b898373d4f5d47bd813356c1383494
9980cea285582d0baeac496960832599202297b7
92467 F20101220_AABMPA vicenscontreras_m_Page_014.jpg
256f55b62a0bcfb02d9a033356f85733
3f6dc0719459f7f15812d0c99ed182f7e4e48b72
50192 F20101220_AABMOL vicenscontreras_m_Page_004.jpg
c2707431e0fa98d067ff426ec4989b2f
bb5d1c98ee375d037f408ea145567fe60af62087
46589 F20101220_AABMNX vicenscontreras_m_Page_120.pro
abe37faada9bb35e18c610a649412c31
7805432ba465253eaf60fa8fe3f623f04064cfda
50135 F20101220_AABMPB vicenscontreras_m_Page_107.pro
61a98b2c16806c916bd1aa9576a02e85
d4f9ec2c4d1e3e5d324ffb350717426138fc779e
F20101220_AABMOM vicenscontreras_m_Page_069.tif
a024500350698dd1d30bbf6a2ccf3a72
36d1674f084862ed04bb7fc7a6fa58c76305c2d1
35384 F20101220_AABMNY vicenscontreras_m_Page_086.pro
8cde4830b80bab5dc019f7b453a38bcf
22a5266df0617d3fe4119963f4d14bebdbc4788c
5380 F20101220_AABMPC vicenscontreras_m_Page_097thm.jpg
ae33b803ea3ce6f1de9b52f8d93d25fc
4312538e99da4704695e275530fae89e4f5cb83d
1906 F20101220_AABMON vicenscontreras_m_Page_030.txt
b6fbd953d3f60677e58750a516bd7513
61b968c644462595b8d19f0a58ada59809bf5bcc
48810 F20101220_AABMNZ vicenscontreras_m_Page_072.pro
e399194a70e45e7bf8afe6cc4eca2846
383e1c0114008033077619512dc49dc6550f690e
F20101220_AABMPD vicenscontreras_m_Page_009.jp2
88671f14e3e9668dbd7777c547d8099a
b14221b993f55d1928399c04cedda20c85be4527
7926 F20101220_AABMOO vicenscontreras_m_Page_039thm.jpg
d8a71ed5caf6794fbd9b6183cb18cc6d
91d18bb12d4bbeb569d00710319e6dbeaa482c54
1051947 F20101220_AABMPE vicenscontreras_m_Page_072.jp2
5ccc045b546a54922ec5aec4e2c98372
1594293ac1fbb35dd4a082857e6b18ee120a26bb
1539 F20101220_AABMOP vicenscontreras_m_Page_090.txt
b3523bc2417339912fcbc512ca93466a
07c8969099761c24ee574231afabd986750aa31b
8570 F20101220_AABMPF vicenscontreras_m_Page_101thm.jpg
cf2e59d52e2fe39e3861cabd38d7b3dd
84a04d0c5ee80883876f43a9c64173dd679084a2
51215 F20101220_AABMOQ vicenscontreras_m_Page_022.pro
49a7a06c71bb8a1106775a56e5db3d66
be58bb2a318792067d0d6fcf0f19f1c16167fa03
108403 F20101220_AABMPG vicenscontreras_m_Page_031.jpg
a716430133801840a26e723e0b5d7199
3d8748b179337a45bd55ecc73c0ba3afb9bfd574
7557 F20101220_AABMOR vicenscontreras_m_Page_103thm.jpg
1b0aa0a9a7ff5a0a0fcdf45e036fca67
eb17ec4169920a72877f5069e6fc213c17629514
1517 F20101220_AABMOS vicenscontreras_m_Page_111.txt
e7acd57ee4747d12e223de293623b2e2
49cf6bd16cfd95c845dea0e0de5901a3cb693398
8531 F20101220_AABMPH vicenscontreras_m_Page_061thm.jpg
f30050668bcb62f1ee97f6f05e431f12
87ac8eb68270ddc3bff40c56e3db4d446886496e
28890 F20101220_AABMOT vicenscontreras_m_Page_058.pro
c5421d9eb69f60e1550f04e87b0b98d5
03e41e4d4a973d26e7303373af1240b23a3759a6
32667 F20101220_AABMPI vicenscontreras_m_Page_127.QC.jpg
3b8c903a43cd9b233f77a167e55ac830
b96ff1f3e4b280c55d83c89ea1676a9e395e3ab5
40484 F20101220_AABMOU vicenscontreras_m_Page_003.pro
f02254f0ff19f519f6b24f831e1cb1c2
43f611309cfc794464fa2b13f588ca95e637f02d
86273 F20101220_AABMPJ vicenscontreras_m_Page_023.jpg
1a051da984292747afede37c158f34f3
030bc9930e8bbdb4f93720d8ec662e189b51a11e
F20101220_AABMOV vicenscontreras_m_Page_036.jp2
cccbe0c5118eb42b912e9b42f79993bc
0665fa45bd3c1d323db851ad4c5faa9805433c67
1051978 F20101220_AABMPK vicenscontreras_m_Page_021.jp2
93b74577eacea75962f5ad8d3e0a36f3
af6a1482ebbd0ac786259a9396fbcf6a48e06466
33110 F20101220_AABMOW vicenscontreras_m_Page_015.QC.jpg
e060c912f01e7a6fe57ae02c00ac8080
d40ebf45eab7848a6f53cb9ea62bbb3b5c769591
1486 F20101220_AABMPL vicenscontreras_m_Page_116.txt
a57200a0ccb7641b61426c76390c1b19
d15f816b83d9ec0b75e4b43937df4b5b55c8f728
1051925 F20101220_AABMOX vicenscontreras_m_Page_134.jp2
4f5aef310d469f22fa406808f66203ed
0de612eae55d8699ef969a55ba60841c0c1f6a8a
570194 F20101220_AABMQA vicenscontreras_m_Page_139.jp2
00b0f86e8e6846a9e6a171c4562dd48a
374ac1307918d47a7b9ff8c6be195615dcd98249
101592 F20101220_AABMPM vicenscontreras_m_Page_047.jpg
af98ddbe94f228432cfbde0b8c643ad9
75eb7b28e802479b18a7a76ba108f4123b83caf7
F20101220_AABMOY vicenscontreras_m_Page_029.tif
26e491fc16fbde6ace815608d181af37
d74c0dac5e32ff85dade27d8710d135abaf4236e
50207 F20101220_AABMQB vicenscontreras_m_Page_065.pro
5a74d53e2c2a0cb481b1dc0126da76d7
7fa38287d85de56625a813ba1c1ee9ce9be5eb02
50033 F20101220_AABMPN vicenscontreras_m_Page_046.jpg
7843e008e42a2267706485d16477254d
d66194648e450be2f820b61889787e4ce3791961
76106 F20101220_AABMOZ vicenscontreras_m_Page_089.jpg
a4712804e97268abfc8871c42841f412
e22f352a323c0f0d34bb18731ef004881df79bd7
F20101220_AABMQC vicenscontreras_m_Page_050.tif
0ca2c351b318df6d714d7a43e261e699
bddb4da3afdf93de9a6f9ba110c38e3c2d5b2df1
F20101220_AABMPO vicenscontreras_m_Page_071thm.jpg
38c2f2bfcbe5b6ee60d440add6b9795d
64f4345ad3547d2868be7328a4e295383f0a8772
F20101220_AABMQD vicenscontreras_m_Page_100.tif
e1e33ceb2d9f0c5a009ce2660365e404
c2df864550c8c9fa99730673ab03f8bb5568ab18
78585 F20101220_AABMPP vicenscontreras_m_Page_094.jpg
6554e98087b511b99b6040a3b82661d8
d0492bc17558eb611dccd66ba71d205427f3acd6
98965 F20101220_AABMQE vicenscontreras_m_Page_117.jpg
6fcb2a6bb4a55be5d7a3633413ecdf53
13f7c66d4a35a0935456494241b9597d2a7c749b
104553 F20101220_AABMPQ vicenscontreras_m_Page_101.jpg
7aec77e60178d16df45b8bb01a8a4fa5
05ce42409feb25596c4eb8b5efe75d00f7223c4d
49626 F20101220_AABMQF vicenscontreras_m_Page_047.pro
bbfb0e5da103fd8d90be7ed016c6b30d
96774646b598f53dfe9fe2cfd9e31571c05c4bb8
38684 F20101220_AABMPR vicenscontreras_m_Page_012.pro
5a0773692a6e33f0a1e033db0ceffa62
3c4855e65a2d64a688d8b9e712b04c715e25a34c
95389 F20101220_AABMQG vicenscontreras_m_Page_122.jpg
066c2e40dd5d9f6ba7d73c8618aa7ba9
cc200db57caa5795506fc577e87f6fdb2715774a
104803 F20101220_AABMPS vicenscontreras_m_Page_071.jpg
ba0053bbe241937e9aaf07ba4451d0cf
194201240b09470ea704d5013a012f28d6de9090
97872 F20101220_AABMQH vicenscontreras_m_Page_045.jpg
0f6fae0dd23b1137c28467a8466d2cd8
48009810c32e59e1e799d46c80596e334fa70f17
F20101220_AABMPT vicenscontreras_m_Page_113thm.jpg
0f2e5362bf528737463831740824601b
f0880e8b7ad3fcb340a072996fb0bbe03721142e
7704 F20101220_AABMPU vicenscontreras_m_Page_099thm.jpg
2a750efadebbabc67023ccb904204879
684bef516d8825bd01f3f2f81afd7d5dcb804a17
27465 F20101220_AABMQI vicenscontreras_m_Page_096.QC.jpg
b5da01e80d7f5f62934aadb2ecac2229
242ff97983bfb7a99eb83eff77a60f52b68ee54d
1940 F20101220_AABMPV vicenscontreras_m_Page_061.txt
a8db41e53c73b71f864e6bded3223ca3
c8897cb35dd4df802f6c2727e0c30255dfa8f27f
28389 F20101220_AABMQJ vicenscontreras_m_Page_001.jpg
1b2b04cc8d91054d3bc07a3f551dc220
7e805647f0719567a13ea3dfadc2ae87e189908d
75147 F20101220_AABMPW vicenscontreras_m_Page_106.jpg
2caecf60b061e4642cfe3479487f3b12
9438d97707370c257dc103dc09cb5ae8804942c6
35643 F20101220_AABMQK vicenscontreras_m_Page_048.pro
6b366286c219ae0d740dab8b92666532
34b552cb830ad75d8baf61772ca8f7ea779737b1
1051974 F20101220_AABMPX vicenscontreras_m_Page_038.jp2
80c49b7bda1a6e49a0fd3316cb5ff458
f5bd4c45e04baef22c6222efcd7077382dd4087b
41037 F20101220_AABMRA vicenscontreras_m_Page_002.jp2
ff7de7c9a62cc0fd6456e6b8bd861a87
7d0ff7ff21b1836881e6fd3c33709479fda41917
48140 F20101220_AABMQL vicenscontreras_m_Page_030.pro
3b1747998b387f36044678890cbb67ea
e08510ee5d19261c6b050acda3c47647add13826
1437 F20101220_AABMPY vicenscontreras_m_Page_073.txt
82ad15d23d33689dfd77e31e731aae87
b9fab0aee719bf52795290ee27eeab1eb624c86f
40734 F20101220_AABMRB vicenscontreras_m_Page_078.pro
90265ba5f05c7299e89731436e2dc641
1b8c2104f37338ff77d90815873661a08d5a725b
F20101220_AABMQM vicenscontreras_m_Page_013.tif
107826b3ccc69e26374216d4f01d1629
9d9a454dd975eadeefdca8b1418a0fa49b01abae
8312 F20101220_AABMPZ vicenscontreras_m_Page_060thm.jpg
bae831feb306cc8ef6c52a87b2fce179
5e7cf79c7e912d9aa6b3925b943c990ab0736b08
33374 F20101220_AABMRC vicenscontreras_m_Page_038.QC.jpg
c423b65d8aee812c22c0ee809da05c35
6a13e78b0b41b7aea7895a614d96eda3cd06ad4a
1051945 F20101220_AABMQN vicenscontreras_m_Page_120.jp2
7eb3c96079e988bb6ec1e6e0a1530b71
d5b7447165a96ac6c66ed76a33055919b9a5312f
1985 F20101220_AABMRD vicenscontreras_m_Page_119.txt
647ba4a2dccbeff6ebee7906dfc49f9e
33e5ff9780cb423bc0b03e923e3d1931cb8a4a9c
6467 F20101220_AABMQO vicenscontreras_m_Page_088thm.jpg
36c22531b088390a03010be6d92b9b5c
ec61e55116140cae60e81b19f1efb1c584b03c3f
91866 F20101220_AABMRE vicenscontreras_m_Page_059.jpg
74fc7b5085b682018eadaf611e31f4a0
a1ff5697a05772c90ed6647f5a48b2e688670175
34412 F20101220_AABMQP vicenscontreras_m_Page_057.QC.jpg
0e560494053b5455c458f7bd7ca40035
dfc789b6e0cba440445ac67eddf76b98c752635b
F20101220_AABMRF vicenscontreras_m_Page_128.tif
733784e041862bf109a1c5dcadc65b2b
b4334668ec0fc8c37b2d9e4dde9b36fb29f3b099
49217 F20101220_AABMQQ vicenscontreras_m_Page_060.pro
0d82bb65a6adf1c3350314155c63fc17
001d64f1814943adc08a100b17d59ef56ca4ac20
64590 F20101220_AABMRG vicenscontreras_m_Page_033.jpg
0aad84fe45255d5264a655d95d091354
82205894baba511f182efd3640adbcee68327faa
1515 F20101220_AABMQR vicenscontreras_m_Page_096.txt
ff57038e1f6bed038cf93efa4f48a330
4767cfbf9a60940b635e5f9f1d33ae9f0ee53486
8152 F20101220_AABMRH vicenscontreras_m_Page_069thm.jpg
fc0f1e79a46275c846c47a6e024a63d2
57e9a5f3ca571c1741d76e776e28de91dad61b34
28175 F20101220_AABMQS vicenscontreras_m_Page_093.pro
4c988c8aff6b8147d72439a4a8a31c97
872722e927b91d4530978f2c544811556b0050af
F20101220_AABMRI vicenscontreras_m_Page_077.tif
fa4192c807e233768857d4df627a1b19
a5843fed9fd56dae3a841c3f3c92570d4fe59259
35794 F20101220_AABMQT vicenscontreras_m_Page_017.pro
4c0ed95811166e546700cb485fbff01a
ddec27391a5c79208dfcf5416a4f712c094fd57d
104090 F20101220_AABMQU vicenscontreras_m_Page_131.jpg
214efa6a052883642f15ee284467b829
3735146d97799744fbdee0a418bdc4b19fc6d9aa
51138 F20101220_AABMRJ vicenscontreras_m_Page_071.pro
b47c2dc73c8a5d4bc28e3f50a506508d
cd6374ead2ac374706ad0bcaedd76e1aee3e0d81
36080 F20101220_AABMQV vicenscontreras_m_Page_040.QC.jpg
96a1c7c231b80cde9f7872905a740bd7
fefc3d2bbfffbbf2a1d081dd388db0c817402fda
18305 F20101220_AABMRK vicenscontreras_m_Page_046.pro
f0ab6473558c3e0f819f5fc01440211f
05006d0900f5d3357cc2f1e0a6fe805dbc4bfff7
43612 F20101220_AABMQW vicenscontreras_m_Page_076.pro
05b473627e82054b4c60870fae68856c
4804310927b1962d0f9955385abcc0a9b40051a1
8309 F20101220_AABMSA vicenscontreras_m_Page_080thm.jpg
e60cedc331a58bbf8ae1cdb3f2ea6210
9665bd040776f64601be409780aa3aca43d26507
1495 F20101220_AABMRL vicenscontreras_m_Page_132.txt
771d691987853f5ab7b0f58005724612
f1e192f1f7286845d7f8c27375169b7e891747ee
944007 F20101220_AABMQX vicenscontreras_m_Page_007.jp2
56a4fb25802875224dea736b91b49a25
5dcc669afdf0ba7bc69e72cce9c261f179d2a65b
84056 F20101220_AABMSB vicenscontreras_m_Page_003.jpg
55d034ccc3ae991be62f3da49e43b146
c2686468931219d877409bac6f55348e65cc6593
908313 F20101220_AABMRM vicenscontreras_m_Page_084.jp2
d42ad530b525a7d5240d3e361e4a50cd
d0ae37dc27abd463d711ef959afbebc66c63e19a
8122 F20101220_AABMQY vicenscontreras_m_Page_043thm.jpg
20b13371fac94fdec346671b700e9b16
f363214da36aae8ef960aaecb3fe4b1724521837
1889 F20101220_AABMSC vicenscontreras_m_Page_103.txt
0daf1e4161af672bcd12ee40fd5ee40e
19a9e79a191853e27330ea815132111d66ad3b62
61423 F20101220_AABMRN vicenscontreras_m_Page_058.jpg
8208a927c5345c0cd4a74657c640f1cd
2209146cf0a7fe708cadc6097960d34ae32adfb5
93518 F20101220_AABMQZ vicenscontreras_m_Page_113.jpg
005f852ef3affa009fb8b7511f844e63
616f0818a0763dcc9ece567df80e0216af5f5546
566331 F20101220_AABMSD vicenscontreras_m_Page_054.jp2
6ca0ab684b9c4e569e4fae5bf4023c66
4298ec6bb87982b8fb0ff3cfff4061120fb6024f
F20101220_AABMRO vicenscontreras_m_Page_056.jp2
e3c30d7f9aa72432e90bb92ec613d10e
3d145f6db8031d414b988a3b72a049af7585d97d
5184 F20101220_AABMSE vicenscontreras_m_Page_075thm.jpg
c3cdbe6ed932ddbaf36168f263a89814
01e82fe0609e5a26ee4dac281eafd38bde27a5b9
F20101220_AABMRP vicenscontreras_m_Page_063.tif
f6e63d4a69ee58e3770fea0103378425
579f64339c97c0d0c337929d6088479478d0bff6
34181 F20101220_AABMSF vicenscontreras_m_Page_104.QC.jpg
6b2a7dc5ece985f5dc763e030f593f6b
cf0f08f92d7d6a9c6f2ddcdd88aeae67b3c3f3bc
43804 F20101220_AABMRQ vicenscontreras_m_Page_008.jpg
803926d64905b29c47fdc7334f92d3b1
30b83cb6789aa655a5cb98e889fc9c08d3973480
73458 F20101220_AABMSG vicenscontreras_m_Page_088.jpg
9b253d7d0ed274121f7b594512f788c5
5809a782c6ad44bc90461cdfd910d398b4b238fe
50349 F20101220_AABMRR vicenscontreras_m_Page_027.pro
6b7c9d437aab7e0724e83c36000e4614
b4cf49fda80c3ef02e7042925c1d9c7741b0468a
34189 F20101220_AABMSH vicenscontreras_m_Page_100.QC.jpg
8573fccab423607c403a91a54c3a9af0
b7e0bba7d1697676c119cd8820f52f4264874187
1048409 F20101220_AABMRS vicenscontreras_m_Page_122.jp2
464b6b813140b5ca28cc49887e659d21
7cc34ea61cdff2a2c2d2c7f5d0e7debce2a9fbce
1935 F20101220_AABMSI vicenscontreras_m_Page_068.txt
223e2131dd6dd44bc0d3b3279c0dc93a
7b6761552a08c3316c93b07173285bb422ebc313
24431 F20101220_AABMRT vicenscontreras_m_Page_139.pro
2b36e359060bc95bf50ad4f0fc192b36
985196299dafdc84abcb5f3fc7cf59509754e4c8
89573 F20101220_AABMSJ vicenscontreras_m_Page_026.jpg
83f4dfde2a586e54d369357fe8265778
6b54d03a120a640a871db4a458a8c0d3e5bc38d9
F20101220_AABMRU vicenscontreras_m_Page_039.jp2
ec488bdc5f7c459fa4926435bdc97908
f60b72d6d3ea190eb5b660b7b1dcaf528af774fb
49541 F20101220_AABMRV vicenscontreras_m_Page_130.pro
4014f6082b7601256c1b4b5bb6f97b6f
205cb46a2a0fe5a6b752b0be619b2f7337aafa55
4218 F20101220_AABMSK vicenscontreras_m_Page_004thm.jpg
0633708e88ad20fe4affc684445bce79
607c048d54fd87a3bec094ad9ddd46ceb890c277
1051981 F20101220_AABMRW vicenscontreras_m_Page_096.jp2
3d0e81582f2c36bfd60a14a64415cc71
f783827a9a00fe991272b4521281eb6344d32f77
16920 F20101220_AABMRX vicenscontreras_m_Page_004.QC.jpg
1bd3c82d92fe9bef2e22f03575b4dcf0
c92693c528101b94f32b74de32a478c85ce066fd
51837 F20101220_AABMTA vicenscontreras_m_Page_087.jpg
55259a7c1f4d98997f8abb6af3c10fd9
bf54b6299a86c8fd7fd03a51e33882e037e1e9db
103650 F20101220_AABMSL vicenscontreras_m_Page_126.jpg
982ecccc5b946d1a2912610d96d140b1
dd3c08e23c3794217acdf3cf32776ba0f3d6699e
101315 F20101220_AABMRY vicenscontreras_m_Page_043.jpg
9c28cda8c7f396d26d30ba7213a40791
c5fc8f76430efbfad4cae55b08f63f1e6ed041e5
F20101220_AABMTB vicenscontreras_m_Page_056.tif
140e8168b11ce8e0c5f6d089a3fc6b34
025db0c9f663af8c6e1bdc518f7ed7079646128b
1564 F20101220_AABMSM vicenscontreras_m_Page_048.txt
a84650a2613575660c5e0a2e953ae948
74e3303777bf18cdbf39f99c9e0ae280d476cf2f
51653 F20101220_AABMRZ vicenscontreras_m_Page_007.jpg
7437b11de7d104955beb5f3702a73984
dfb0bdee284f064ff72f5f05fd32e5b79c938ead
F20101220_AABMTC vicenscontreras_m_Page_081.tif
e0757a36a29c539fdd3a39a5342749f7
573a40f61a827808bf3ecaa74e9e4536f8d3321f
860 F20101220_AABMSN vicenscontreras_m_Page_097.txt
6b5c69c29b770e57e3d5f206c2eb09e9
a08ed42a370e50bdd08ce5292fbffdb3dad72a0a
50121 F20101220_AABMTD vicenscontreras_m_Page_020.pro
eac4442c3749e6c687402bf22c9508d9
478d051266eaecf72bcad8392c241c74ef8e4b1b
5527 F20101220_AABMSO vicenscontreras_m_Page_050thm.jpg
ce3e3069e0ad1703de6f93b2b7bf1cf1
48cddad3f9cee5e75c1a2ec650b50ba8bf8d7a68
1967 F20101220_AABMTE vicenscontreras_m_Page_136.txt
e687b9f77d9aac6b35845432d65a7660
50aa4a3a4ac7d1ee0231425890d917aa7d17ef2e
29730 F20101220_AABMSP vicenscontreras_m_Page_059.QC.jpg
04149944bceba568848efd64c53a6b9a
fa8d0edb1b79245d02ee3ae37266f6d766f49d36
46785 F20101220_AABMTF vicenscontreras_m_Page_045.pro
b732c4d779367b013cc1662b9558199d
a648cd0f6b3fbee17aca609306e1f3fe85523707
F20101220_AABMSQ vicenscontreras_m_Page_031.tif
bf0f69172184e9e8de7e75a76bb8fbb5
9c6e3c46810ec32da17f106ddeec0354027e8cc4
905968 F20101220_AABMTG vicenscontreras_m_Page_003.jp2
6aea04daade565c6513869e1170440df
d501d6ca8d36b6bc974f47b82d8a55deae953dd3
7983 F20101220_AABMSR vicenscontreras_m_Page_068thm.jpg
f9e203c561b4299213cb997bad0b207b
884f4bf32b13d88b1f18ccc705477ee4a864275f
98609 F20101220_AABMTH vicenscontreras_m_Page_134.jpg
0c10f4cbb69c951e0b905b938759156f
094d13dcb459d31cc038a1c937907fee63683eaf
F20101220_AABMSS vicenscontreras_m_Page_065.txt
56d19509315539875b731f87722e07ff
3798387be37a06cb1c5a4dd4c9dc5c45c4928309
F20101220_AABMTI vicenscontreras_m_Page_087.tif
fb9dcbe7b9b4606c06ca2a1c68ea64ee
cf78d6f62223f3ffcf863d0fb222e6d2dff71dbe
F20101220_AABMST vicenscontreras_m_Page_095.jp2
f1c1dc53dcc234b23131f092bd2f9e5b
4a1eab2a6ae0f718daa05ba5f9144d050be8b931
99045 F20101220_AABMTJ vicenscontreras_m_Page_024.jpg
04419cef605196a24d2186d6bf4660a0
7e084dd87df560de17f3500ba49b2f67832dc30e
102551 F20101220_AABMSU vicenscontreras_m_Page_035.jpg
7910fd8268870e521d2d6b6ac1dd7b4f
0d19f02ac126ccaf50ea9377f85d886cfbf6ceb3
217112 F20101220_AABMTK UFE0011464_00001.xml
2bea6e578ce53dce854e8daf68ef0c31
f9532ab812a07bd4ea02795d147ddb1827d9941e
8401 F20101220_AABMSV vicenscontreras_m_Page_055thm.jpg
03590698a4f7e82593057bf0763cbb8c
71bdd48ca49bb875cfb2ff122e32386c69996cc3
F20101220_AABMSW vicenscontreras_m_Page_112.jp2
10f03eeb8fc55ceb7386330ac01a6397
186399ab501f8653deaead4978976211e672fa24
102964 F20101220_AABMUA vicenscontreras_m_Page_032.jpg
c3153a063620bf2380a2a3ce0dda8d79
1ba6df102f6054af912fc3feb8cb7bcd83aad0dd
6922 F20101220_AABMSX vicenscontreras_m_Page_106thm.jpg
fc78243efb1e4193ce585062c2eebb23
e4af3d1c2d43a89a0637262601adb3b6b59d0128
83948 F20101220_AABMUB vicenscontreras_m_Page_041.jpg
31ed50cca5006522175c838c8cf46f83
e23cd7b62e2144d0706f6783fcdaa2163b095158
F20101220_AABMSY vicenscontreras_m_Page_017.tif
f91052dc4104dc35051d774f49927a5d
f99fb506aaf77ef68ca0c1ea93c94b0d5a6ca842
103594 F20101220_AABMUC vicenscontreras_m_Page_049.jpg
98eb86819df2e5da7f24c8d29771184c
e5ea0044be797a0ed329a0b67b1f7756fba295af
5669 F20101220_AABMTN vicenscontreras_m_Page_002.jpg
5810068aeb15b3ffb9f1a5bc4af33137
24c6477214454bfe20a0f758e824382de843b0c0
F20101220_AABMSZ vicenscontreras_m_Page_006.tif
5352690658aa2043c8318f02737d3f7b
fc86f238a5b1822bd942860fbef2c10e107e7c1a
79689 F20101220_AABMUD vicenscontreras_m_Page_051.jpg
2d68035a54c725f0018d5ee1460f06b3
73b4ca74c7264daea63acbb5763704411af3c2f9
112367 F20101220_AABMTO vicenscontreras_m_Page_005.jpg
bd6fbb6b2e37ee14c1aef39dc74f0141
709edf2ec040873e181279cde6121ae4b038e427
80957 F20101220_AABMUE vicenscontreras_m_Page_053.jpg
a03c1e6f56f177b17b79aa0aa825d47a
f231345707c872cab879fd049321233cfce83729
122804 F20101220_AABMTP vicenscontreras_m_Page_010.jpg
7e5ef8fdab14d926898d58df1bc581d3
4473e5fe40a4c0451c9dca0ad0688c44fbdd5d60
89055 F20101220_AABMUF vicenscontreras_m_Page_056.jpg
3b256a2735721b91a5f8db3f4e6d577f
b925cb2d1e89fc13741c23ee60f6dc1c5ae4856a
56860 F20101220_AABMTQ vicenscontreras_m_Page_011.jpg
c05c7390d2476614a75f2621e88ea039
6b21886a39ac46c92045bcc5e015f009087bc5db
104267 F20101220_AABMUG vicenscontreras_m_Page_057.jpg
095667a06f44171909e21db8eb91e8e7
b1498a2e675aee492a0e3bc5baf3d050618df8a5
78505 F20101220_AABMTR vicenscontreras_m_Page_013.jpg
2cc67a35d4baa7e1c53cbc86e700b9a0
f7aff314ba0a6069cd304fa0aaf654480438cee7
F20101220_AABNAA vicenscontreras_m_Page_060.tif
f07913337bdc2aadf9b184a877b0fe57
87a565616153be7c412cbd689529c7c7c843b668
105014 F20101220_AABMUH vicenscontreras_m_Page_061.jpg
792423f3a4c47284b37d5d3c692ea091
0dac3b5101546eccd5b2aef2f19fda17f874d82f
100281 F20101220_AABMTS vicenscontreras_m_Page_015.jpg
fcf12e64bb9a89d8d2fab81613d42fdb
2a3b2383c5aeced8fb7fb318ff8518dec88e2578
F20101220_AABNAB vicenscontreras_m_Page_061.tif
014c7226264bac6be26b901f38d9a80f
413a817d08c1c0d5e5508b2d6f849295293def11
101785 F20101220_AABMUI vicenscontreras_m_Page_062.jpg
e7d7474c07501b98f6d9b76d5641ad9c
894dc142a72855a3da900bb337da4753b1e48050
104343 F20101220_AABMTT vicenscontreras_m_Page_016.jpg
3ada9e2110976a3aee3783aef8429d19
6913d464feec384b6e79787b2161b1a8be73ad68
F20101220_AABNAC vicenscontreras_m_Page_066.tif
988f28fa42c1223dc9e4875364986acd
458ccafd4f71790afe675f72b8b04589ac97a07b
98728 F20101220_AABMUJ vicenscontreras_m_Page_063.jpg
a701ab87a98450a9ea1a863bb7bce92a
a926637f48e897c4231182d668b410f8dbbeb5ca
97914 F20101220_AABMTU vicenscontreras_m_Page_018.jpg
0f8a599da6e840deb7ade35697df5143
7d80e30788f66804ef00c48924d45c94a7359637
F20101220_AABNAD vicenscontreras_m_Page_068.tif
bac7420546022e9c57c1e313d5dc2218
5a84354d3c6106484be34a18f075afd4d87520e3
95420 F20101220_AABMUK vicenscontreras_m_Page_066.jpg
83edd580b81d1a9ec52dc4e5d48d0ced
ace91f5b610e847e859c77521ecb26743e783529
102649 F20101220_AABMTV vicenscontreras_m_Page_019.jpg
9c03677a7b085a9419931be22a286f87
1a14ec5cb34b503c443ee58826f148e4e124d9b9
F20101220_AABNAE vicenscontreras_m_Page_071.tif
b4a311a997b1e36fd31b1cfdc45bbfa5
1f22f0eebe28f245f2dda3234dbcf189d6251a2a
73729 F20101220_AABMUL vicenscontreras_m_Page_067.jpg
58f2c68542c02ba01d1de685e1d1bb6c
ee48d043060b0705b6a9d524a81a34b3421e8db9
93248 F20101220_AABMTW vicenscontreras_m_Page_025.jpg
983cc12cb09eb7f4d6db3eba1e48d9ca
9602c7f00e3b39b9f7a63eb69e67e78af3de41a1
F20101220_AABNAF vicenscontreras_m_Page_072.tif
f2a9a9d42bbe57b8af426cd673c6d849
812493873fcb22081cbd918f16e8659d715d43fa
102601 F20101220_AABMTX vicenscontreras_m_Page_027.jpg
8d2792225ad766dd3adc46054b9e2849
30edc94e00c6ecfb3b76f10c5f466221ea698c19
F20101220_AABNAG vicenscontreras_m_Page_073.tif
fb3b930eed1992300dd441db0d1820d0
11276384775456be4d4bfb5a12d1f9d142c063b3
95997 F20101220_AABMVA vicenscontreras_m_Page_091.jpg
80137b0c4eebedcb0f39275a5e12c426
649bc05d30c7638e2f28880949e346bb51698705
97628 F20101220_AABMUM vicenscontreras_m_Page_069.jpg
06721cdbb7d181f17dda8b0e96244d02
f8f12347606a0e66b3256df43d3cad10c5fe7be4
103717 F20101220_AABMTY vicenscontreras_m_Page_029.jpg
f01af44fa4dceecc99ab533c064775ac
9f9e32bda11abf2fcdf5238b1fe48c6ced67ec9e
F20101220_AABNAH vicenscontreras_m_Page_074.tif
4e080a7ada53694fccac9fbfbe635d73
9648bfbe6a6079388adad73dda1f21a231f225f5
100538 F20101220_AABMVB vicenscontreras_m_Page_095.jpg
553a58acca9d7c3a41da532ab2e15575
9f491e9ea4ec6afde758c95b783352139ec5d4d4
64527 F20101220_AABMUN vicenscontreras_m_Page_070.jpg
062bf6b06b54c22c85f4996bd4121ffe
dcac8461171e3c1cc6d8cbe420a2388e74bd1a9e
98067 F20101220_AABMTZ vicenscontreras_m_Page_030.jpg
552d0c64b95d3355d30a76b498a72e9a
0df9b5fe9de4a2fef6b71cb15e54ec9b9896241c
F20101220_AABNAI vicenscontreras_m_Page_075.tif
7695e31f4b16c3581966cee5c907bef4
a2fb7d4f8d9f70d9559892cc2f996dbf219bbbc5
66418 F20101220_AABMVC vicenscontreras_m_Page_097.jpg
61e30fa0afd05171a0f9337742a0eff2
95580587499e661244647f6ef85ef7ccd8083132
100973 F20101220_AABMUO vicenscontreras_m_Page_072.jpg
7d56dd79789c76b62bd3744e6b31d902
e585805928120f97dbe4df7fbc61fd244eab6af1
F20101220_AABNAJ vicenscontreras_m_Page_079.tif
e8a38832e3f195b6232d3bc44cd2c3a1
57f27b95f58fb0ade785459719f68344876c7aff
98294 F20101220_AABMVD vicenscontreras_m_Page_098.jpg
1a6925e2a93c47900ed23735c3e6dc32
6585913405263f9b8e13ae47c67c3fbf63af5cda
88641 F20101220_AABMUP vicenscontreras_m_Page_074.jpg
f1c218bc1787a055ac30874761e5d30d
505b7540e14120e65bb2f40e3cec4d709ef69597
F20101220_AABNAK vicenscontreras_m_Page_080.tif
194963e2450dbc4aac1ef239ba6e176c
33ed69d5f7224db73ae7d535b677d37174d0db60
101593 F20101220_AABMVE vicenscontreras_m_Page_104.jpg
9ca9ac00314f75ee8a6784d7f2bbe7c0
0b75bdca8b71012c21b76440e97fd486e6127459
93114 F20101220_AABMUQ vicenscontreras_m_Page_076.jpg
90670f3bb00180b06647cdd60a0aeb9b
fb781fd6016b91edeb3ba4227fe4ab45aa6a6c2b
F20101220_AABNAL vicenscontreras_m_Page_082.tif
50a0d8c817dbc5bec9d6994ee0a85c97
c9a71c3489194c15fe2221a756508895c2eb3142
91602 F20101220_AABMVF vicenscontreras_m_Page_105.jpg
2765af94e50ef1b4ad5d2884237824da
a86b44d8317de5a152d9ace5ba58a2b2506cc974
102735 F20101220_AABMUR vicenscontreras_m_Page_077.jpg
74daec11f8b04bc9925c908db3891d53
3f32a9d2460d9f47017e0f4f755c986674743475
F20101220_AABNBA vicenscontreras_m_Page_109.tif
cfd218908ab89c6b9cbcec4331e183f1
8b6e9cd2a9bcc823c15b579fecb08732b2d1243a
F20101220_AABNAM vicenscontreras_m_Page_086.tif
3b0e9cfeddf82f8e82f2c25328d5135c
eb9c12b1d64807cc06f507ac989d1d431fa8e513
110018 F20101220_AABMVG vicenscontreras_m_Page_108.jpg
e1640f3d30ce9d7266c12aff01e56760
5fbc777b28e89f91757ce274ae0b35c3ca4628a8
103064 F20101220_AABMUS vicenscontreras_m_Page_079.jpg
049440458531b331c0556658d13de758
2ddde8e8426ea404a14bed24d6165a53a2cddb0f
F20101220_AABNBB vicenscontreras_m_Page_114.tif
8ecc82a13d513c8d1a8918c1c8d95a5d
dd39ced20a7693cca2668305b401c1e81fae4e61
F20101220_AABNAN vicenscontreras_m_Page_088.tif
1c3da1f12db647b0490257162e7bbca2
62902c65e6f02d187854cc8a1a9f273d9316fc3b
87462 F20101220_AABMVH vicenscontreras_m_Page_110.jpg
1759e4e80b5f384f1723c36134e4ed5d
fb88fef13d3633042e1b5bb8ce7f6e647229fe87
103710 F20101220_AABMUT vicenscontreras_m_Page_080.jpg
b982ad98e770adc82dea19a131b9fca8
2c88da453b117c3fafa8135dc1ebd4c65f39de4a
F20101220_AABNBC vicenscontreras_m_Page_115.tif
5eeed82455e13899ab7cd3d861e2c3b5
aa69b2534a46c87e85c9b5bb80f18b596a4c7f12
F20101220_AABNAO vicenscontreras_m_Page_089.tif
d3ef4ad13e227cd63197eb14f7e92be3
189c43d11c3c7a26cdf55fb7f139b4f3fc7b3244
98507 F20101220_AABMVI vicenscontreras_m_Page_112.jpg
2145c247ada677e0ee1519894ae7c770
55200b91632fc4e850d8df7ebcf054699593e320
106566 F20101220_AABMUU vicenscontreras_m_Page_081.jpg
dcd7da4f8261077b730b606c661f51de
a539256d5becd2509efc69118b86ea2aa00b03a6
F20101220_AABNBD vicenscontreras_m_Page_117.tif
b6d2a5e39826db61cbdd4fac9353d164
475d6882330dfac4e5b73ce07675395666908cd8
F20101220_AABNAP vicenscontreras_m_Page_093.tif
87ad11ff49993018978fc5c291d4fcbf
ab757079b60864300c4c18c4fa8a1c1ae93b8ba6
98000 F20101220_AABMVJ vicenscontreras_m_Page_114.jpg
2f621454acf80bd2585adcf431dcce55
c80396f7022f051beae830221ff1c230d10aaa99
89814 F20101220_AABMUV vicenscontreras_m_Page_082.jpg
0dd1120594cc9fb95008862862e5e2d1
e73816eeabcad3b3ca96dc3def4ab4292ab79305
F20101220_AABNBE vicenscontreras_m_Page_118.tif
86df9d7c811c450a5c3d0fabc4cf0487
333e344190179806b0dfcc193616297e764d68fe
F20101220_AABNAQ vicenscontreras_m_Page_094.tif
7beb93e34f55e8d7911b500f61da29cf
e6e5f64e2068298b86687e6ea3fe889123c6774d
110163 F20101220_AABMVK vicenscontreras_m_Page_118.jpg
1eabb99474e121265595c28fb9d39e04
fb47aaf8e1a098ac1bed04a996e38f05e7deeb0e
100355 F20101220_AABMUW vicenscontreras_m_Page_083.jpg
ab3eede1aae636a3338a72e7d0fee866
36c4499aab27f9cea4a27b8c42e2fa950f5b27a4
F20101220_AABNBF vicenscontreras_m_Page_120.tif
7c12064987a76c7f70a0de92077960b7
9162fb347bf639a5905908fd67532baf4ba34e0f
F20101220_AABNAR vicenscontreras_m_Page_095.tif
a4594afbf69b99ac31fd02c3e2bf1253
ba0e351cc4a05874c719afd9f2b49dfd9cecabea
104691 F20101220_AABMVL vicenscontreras_m_Page_123.jpg
82b3612adbe3c9acb0d66d9ad5161123
2a6c3749910be2e9eeba32c0b29d7eb345407641
93314 F20101220_AABMUX vicenscontreras_m_Page_085.jpg
f1bd41813b330c52fad3046c05ecae60
c475be1dbaddfb15f96118bc8ba6b1dd8f4a1596
F20101220_AABNBG vicenscontreras_m_Page_121.tif
83ae971d90bd76b5c2a30ebad1c2db03
cb2d63a8740c063336b7761265b864221dcfe877
790858 F20101220_AABMWA vicenscontreras_m_Page_008.jp2
63329aa6a947fd9081248a7efd128c08
55f4357185d2b5e032c2152f3a5c1f50681ff9b5
F20101220_AABNAS vicenscontreras_m_Page_096.tif
fee11ca2eb3b25fb5994645a8358c881
7d0b6c94649f178b137df060c674e60933160bc8
14832 F20101220_AABMVM vicenscontreras_m_Page_124.jpg
69f3dd3a66c4d68d4fae51660685c2a7
99bf398fd1a6d2a2676ac1c6294eab9fbc4e2ad5
81880 F20101220_AABMUY vicenscontreras_m_Page_086.jpg
45773db978a32ddc0e7cc1cf2d56fb88
763d1d298a530e3fa325b9e3652a289ddd9e6092
F20101220_AABNBH vicenscontreras_m_Page_123.tif
b1beab9de336cfdd488750c58d3868c8
d055527f7f687caab696e256afd840d9da30db20
847781 F20101220_AABMWB vicenscontreras_m_Page_013.jp2
cf3de8651b2a5b94b432cd986ed6d1dd
f560c8a83c2f51167047ea49a161d9b036463b1e
F20101220_AABNAT vicenscontreras_m_Page_098.tif
aed10cf150fa831ba0347a5df8dbf8d3
04cc32bc43d9cccb4485ff44dbcc9da3e1105b7a
83887 F20101220_AABMUZ vicenscontreras_m_Page_090.jpg
2824990856cd6130555f723b9355331e
de9c020ae0ba255fc66d8ead628b4744b3e6f8b4
F20101220_AABNBI vicenscontreras_m_Page_124.tif
116a0262a16c2a44e7c6bb68411cafa2
8b2e2742e3adeeaf6ed7b0c4a71a32e2312d8596
F20101220_AABMWC vicenscontreras_m_Page_016.jp2
504f5a5e90bcf9205df0dbb1c551820d
3694d2fb51085b634b30f04706eb8a61b422f46a
F20101220_AABNAU vicenscontreras_m_Page_099.tif
6c5da6a06909f5bd31935dbb2c46478f
57894079568ff07eeb3ceecfd69df8a81ffa99af
92041 F20101220_AABMVN vicenscontreras_m_Page_125.jpg
7d45d6c4a98db32255a1f2ada0fc30db
07a6d2bfeecde2a8749df94602208304e6726e64
F20101220_AABNBJ vicenscontreras_m_Page_126.tif
5747b32b6c8142e765e904e10a5c510e
e008b76c3f75f81ae2b65fcaff27ea03d01e9fc7
F20101220_AABMWD vicenscontreras_m_Page_017.jp2
6eb95903a5fbc89a913a2167216f6b63
fa75d9e780a19fb127a1e166ac4b71af8642e480
F20101220_AABNAV vicenscontreras_m_Page_101.tif
994df0a91f1b030aeedfd5fdca282793
65554d6cbbdc48e8def011fa4c1bc5f34ee0bac7
104179 F20101220_AABMVO vicenscontreras_m_Page_128.jpg
64f68614f98d67dcbcd4a47538e9797f
0fc575b5c51e12b14255f4dd968053db61c2d776
F20101220_AABNBK vicenscontreras_m_Page_137.tif
0b795d040e6d11f0d4d98b31c5084f1b
6e279940924aff5ca60d4e8d187c9e279f7df288
F20101220_AABMWE vicenscontreras_m_Page_018.jp2
f2e443ea9ea137aebf4cb1495a5e6ac7
6102e50641021acfb9b0955d653e027299d85fd8
F20101220_AABNAW vicenscontreras_m_Page_102.tif
63df8cdf55a592552ceff175e5e14292
caaff7008e7a2a4be643081c6e41263a988bd662
104931 F20101220_AABMVP vicenscontreras_m_Page_129.jpg
028bd40b03fe80040a38fad302c554b4
aa9aa6489cd94efdd2ecfee91fed6a53a29d519d
F20101220_AABNBL vicenscontreras_m_Page_139.tif
d95ee056c316d639d9fd265a7f76f55f
a98ca869e6b6c5287f6b8f5597ba48b788dd85c7
F20101220_AABMWF vicenscontreras_m_Page_022.jp2
bda8f61dc8fdb833ff7e1aed7ecbfe11
590aa9a3aa8ad6f63fb70487e782183cb8f030a3
103495 F20101220_AABMVQ vicenscontreras_m_Page_130.jpg
5f3967f5bf9c972911d40c22ed1ce668
d892347d358ac08d1a628fd0091afc13bc4f835b
9116 F20101220_AABNBM vicenscontreras_m_Page_001.pro
8e2fa18a35c5abb3a20442d62960d4f1
9ce035e24fdf3ca8fcb6afbef423c4ce9109b341
1019050 F20101220_AABMWG vicenscontreras_m_Page_025.jp2
29b26a6d3a1efe46fd247d23acc5bb58
6d855417c830243925ea0676f4f70693b5506bea
F20101220_AABNAX vicenscontreras_m_Page_103.tif
1dcaac8355bb0fb683307fc84c1b30a9
6566852fa6a0c3ef4fd047c51496844c2854215c
80698 F20101220_AABMVR vicenscontreras_m_Page_132.jpg
ee717940b8e3b2ace18cd4a4c4d8b99a
3ce89ef2a6ff0165b013d2de15e97fb081f79aa8
52796 F20101220_AABNCA vicenscontreras_m_Page_031.pro
a5f8b1c4c6ecd50ce70510dc9444a152
5217be9e4f1f80a4fad4e5ca25bdde5298b9f589
1545 F20101220_AABNBN vicenscontreras_m_Page_002.pro
d1968dc6c1a5b8eff4431f050260b4be
8eec14e4fb12b1d18d3c26c669e969ca27b39758
F20101220_AABMWH vicenscontreras_m_Page_029.jp2
6d00a3825aca2697e47b0ce5fd74b6e1
4ab3056ce1c0f317b1e760bb6d595e2fa47e3f3e
F20101220_AABNAY vicenscontreras_m_Page_105.tif
42fca3e1a9ae937a10258eb60b14a742
355f262c695b898eaf7f8386d961a8de58377c9c
83625 F20101220_AABMVS vicenscontreras_m_Page_133.jpg
da28c1bd2617f2e666fb51ca6466c321
265eb4e56be23abbde8eaddb086d728887e54db4
41484 F20101220_AABNCB vicenscontreras_m_Page_032.pro
283c750fd30b57e941b21096c82a63ce
7f2631bd52327fb07961ae616c101823eb77f987
23493 F20101220_AABNBO vicenscontreras_m_Page_004.pro
4aca0fcdc001e50368629d3cfd9040d5
b76c75ce5c1c99fe46f4716d6804bf2473a37f47
1051982 F20101220_AABMWI vicenscontreras_m_Page_031.jp2
aa59d3854a31d95b425c3f30ee8c1c68
2b4d0b3ec855823f01b04e6efc55d5042555722c
F20101220_AABNAZ vicenscontreras_m_Page_108.tif
6f247bee75cefb5722ec94869b505e14
cbdac2814acc39a21cac254ff318cce0622ebffc
106203 F20101220_AABMVT vicenscontreras_m_Page_135.jpg
2b426ae88cb455979ab1c350f6d402ec
3c4696166881f2c9bfdb40626bea74bf61a4a8e7
42102 F20101220_AABNCC vicenscontreras_m_Page_034.pro
65756179f83a56de1e4b896bf22ac2d7
58486965d7abc1a695ce2e7d6889604b1bf1af19
63587 F20101220_AABNBP vicenscontreras_m_Page_005.pro
089c2deddc39d83cd18ba56a636730bf
b19c2653ff39380127e8b920194f030bb8e09111
F20101220_AABMWJ vicenscontreras_m_Page_032.jp2
7c4fc3506dc174a20a382ca107271eff
3af505705ed7188abcfec3f87f2e1bbeb20f5c20
99468 F20101220_AABMVU vicenscontreras_m_Page_136.jpg
02638983e2fb9413043c35f37f6d7c21
e55a87cc658e434521a302d7fdf4e023dfcdfb98
50413 F20101220_AABNCD vicenscontreras_m_Page_035.pro
d0dff4e7084861206506ae6d624e9c5c
bc7b37314f1058e8fce52b8dfd345bb07e60d6f0
79409 F20101220_AABNBQ vicenscontreras_m_Page_006.pro
9bc9ea42ee9f2e6ce690488802dac6f5
f3b95ee756ba38f17759ef36b64be710d15e868f
682968 F20101220_AABMWK vicenscontreras_m_Page_033.jp2
b3f60b2975848658db343c85946e47a5
e77fbbab5f7b82c3fda4996abef20791314741ef
54583 F20101220_AABMVV vicenscontreras_m_Page_139.jpg
894325e63d0e411091ec121067572dc0
e672702b673965be24829f0d514f035e4e8e839d
46082 F20101220_AABNCE vicenscontreras_m_Page_036.pro
0c1d5a5d1d66c132a08dd13e322e9556
37222a16a40dbe928eabfa04847a77bc159383c5
19926 F20101220_AABNBR vicenscontreras_m_Page_008.pro
2c32fcfbab3808fd086d6781907f4fa6
27539e8c8f3f9a185b86de34a734de9133c2df1d
988770 F20101220_AABMWL vicenscontreras_m_Page_034.jp2
ebc63a75f0bc68c7b701a9c9c184bee0
912c19004af42a4b1458eca3c58d3267be2fbcb8
275630 F20101220_AABMVW vicenscontreras_m_Page_001.jp2
f59d2e364069541dc9caf352533b033a
68df8e8344615f640b0c34f1dd21c0b9eb86ea28
49274 F20101220_AABNCF vicenscontreras_m_Page_037.pro
ba077ba293b5df6bf9f3f76d3ed1bb75
1c982d5e56fde7caebee0e4e6c50bc1b88fd1eee
F20101220_AABMXA vicenscontreras_m_Page_062.jp2
fe93efa2ae9cf89e3a9e2314763c6aaa
8f3ef4d1554eef9fb33e08a5045db70efd71588a
50131 F20101220_AABNBS vicenscontreras_m_Page_009.pro
79e38021cff5dd7bcd9c8245d71a3404
7bdc4f680ade876233ba6794fecdb1dcd14d709e
F20101220_AABMWM vicenscontreras_m_Page_035.jp2
2a91bd2b23a4c33b3c1e11c7c7354837
7d20fee75aec4d58f6c2920f922bbb6677ba54d3
524860 F20101220_AABMVX vicenscontreras_m_Page_004.jp2
969790ab0ade6feb02e549687b4fb9c1
766c8181525514e05e9f9a48e04d8456576e2cc1
46705 F20101220_AABNCG vicenscontreras_m_Page_038.pro
d8136e746eb96a1f5188156f5bb7b211
bff50e7ea0ba5600b8c649d11bc6d11370ae1e7c
1051985 F20101220_AABMXB vicenscontreras_m_Page_065.jp2
869989e1cd8156044b04ebfebcd8db5a
c5502208aa13b0e57ee07af31f8d6233573e77d6
24425 F20101220_AABNBT vicenscontreras_m_Page_011.pro
724bec48760089c69c6f7ba79718d7ea
120b06d256b55660b3be34e63d08855ea22baadc
897709 F20101220_AABMWN vicenscontreras_m_Page_041.jp2
94d0ce9d769c95a369f6bf65d41a7b60
7538ea22c72436d98167d1a282990d19bc7d6263
F20101220_AABMVY vicenscontreras_m_Page_005.jp2
d6bc3b85d6bd2b3eacf614eef8c69658
581bd79a1b2dc4e0c04b8758777cd50fa97e5b9b
53949 F20101220_AABNCH vicenscontreras_m_Page_040.pro
8ac33177cb89f774fad81736affd9674
c9eb8457f92c9166d1c6fb7961a6b97f23b43da8
745336 F20101220_AABMXC vicenscontreras_m_Page_067.jp2
88e0aec2b69208d6c6b8a2e608b5d725
ccc8fd2b7f6b68f96b4c92ede9d1777edc2ce419
36424 F20101220_AABNBU vicenscontreras_m_Page_013.pro
3feec683320ae5aa3c1b7c153d20e6a0
8dd218348cc6554ca4ae605c8548da782c15acf2
F20101220_AABMVZ vicenscontreras_m_Page_006.jp2
fa3989ce5a321e5a05fe533cb1d556a3
f18082893d9d820efd38233b200cadcff2cb230f
33764 F20101220_AABNCI vicenscontreras_m_Page_051.pro
dc925d790db5f5370662c0a6d0497102
90336aff2494d8457a1630d618d465fdb91ac5b2
F20101220_AABMXD vicenscontreras_m_Page_069.jp2
8a0c9b1fae659cdba4666c10286f62e7
f7a0ad2724d6b173c32f99dbb3fff11b6cba21ce
45466 F20101220_AABNBV vicenscontreras_m_Page_014.pro
bfaf20bc5d8062880b05735517eb9188
c5d546c71aa64ca569b1196d646b8b2062096507
998012 F20101220_AABMWO vicenscontreras_m_Page_044.jp2
8a6684111ee11bcc205e33a00a563a20
acedd2b946698dde1e11172ccfd457d80645882a
30283 F20101220_AABNCJ vicenscontreras_m_Page_052.pro
e9ac7b57766c5df443bfdc4f58acf869
ed388d0b050e723325ed9b70885b1a34b88f94eb
662895 F20101220_AABMXE vicenscontreras_m_Page_070.jp2
b73f3758802d92f8be301a628e01664e
03c0fef302b3bd05d4ea7efe35532620fae72239
49680 F20101220_AABNBW vicenscontreras_m_Page_015.pro
e84613fd3ed423646165a814146d59b7
6efe4746ad4329f5e79a52edd910198b1417fec3
F20101220_AABMWP vicenscontreras_m_Page_045.jp2
5b3342529a17de07185e06300fde1039
644bbf8ff1e38310c13a18ea01c58149fb100afb
19057 F20101220_AABNCK vicenscontreras_m_Page_054.pro
adb7a841ab74593d73d9168a69160fa8
719ad30034c1494a1d2f8632db095878f0c39b07
F20101220_AABMXF vicenscontreras_m_Page_071.jp2
6eb7da31e1150e2f2898c9c3f1a9286d
88f0f0007b866e563315eb746449990ecd70254e
49018 F20101220_AABNBX vicenscontreras_m_Page_021.pro
c5e21fa6fa5af0f965277169837e3056
c2af1d4cbe2e17e206c2d00d67537013e7adfcc2
532549 F20101220_AABMWQ vicenscontreras_m_Page_046.jp2
faab21a52b9aee03ea6d11479bafa48b
6f0f78e5c721a972da4eac9e88da18f1a951b52f
48747 F20101220_AABNCL vicenscontreras_m_Page_055.pro
6fcd2443804e1906daaf7226dd5b5be5
76b178daa9e9c13f84efd6d5af8bcf34753684b5
867584 F20101220_AABMXG vicenscontreras_m_Page_073.jp2
85efccb011333a676f35583176b90aa1
930535270e75fe0c44a67a34554709b2a2371351
F20101220_AABMWR vicenscontreras_m_Page_047.jp2
561ff831e1768ad6b5941aa1f05f619e
d67b7cf70a0c61c5107610e902e6098c0ff9143a
10599 F20101220_AABNDA vicenscontreras_m_Page_087.pro
05215faf307014a3f7c429a1d21b5dd2
79ff67f4c276fd2d8ba9213f35d872101be888d0
50954 F20101220_AABNCM vicenscontreras_m_Page_057.pro
58358c0eaddf5a16a448d469e03d86d8
01df5eb03bbdb5c7f6a94fdb658163bae5620a7d
881388 F20101220_AABMXH vicenscontreras_m_Page_074.jp2
5ef77ffc3ac69d3a2f8613654a2ace1e
6ed60a87f2c09b29ca390f429182379e1783f8f5
39786 F20101220_AABNBY vicenscontreras_m_Page_028.pro
06a588313f06b04658951712bc3cdd86
ff458ab799efc9910cb2a59d68686cceb23c99d0
1051956 F20101220_AABMWS vicenscontreras_m_Page_049.jp2
a51841c65538a6eaa01a6734da52dcf9
5efb9b82b4f5dc44cfc79ee15d687e63b42b1200
27519 F20101220_AABNDB vicenscontreras_m_Page_088.pro
3bce4e506272006c4f22fc10b77e7a72
4d6410f52b4ec9396d7b3d2d55b3d4f8699e0783
43587 F20101220_AABNCN vicenscontreras_m_Page_059.pro
bbbf12b9827b100f366342e797c4e47c
66bf7c4567c5b552d0571bfbe15309f32e380d58
687527 F20101220_AABMXI vicenscontreras_m_Page_075.jp2
18bba20642365adcac6886a8c66c43fc
a00733bdc7884f2e77f52d460dddb6fbd4b38633
51150 F20101220_AABNBZ vicenscontreras_m_Page_029.pro
c8c19ce4af405d5461fafdc18dca0658
49fcaa6bc4db474448c7ec2f154926e3e2a01985
829044 F20101220_AABMWT vicenscontreras_m_Page_051.jp2
af75b843b945e6a21476d0089c38f924
249bdae4715c86a12be2bb694e2ff4c55f991e36
31609 F20101220_AABNDC vicenscontreras_m_Page_089.pro
fcff2953841a8485ab70c0d1bea2f367
2b7799d7c588c23a5648b5bbee10cb14c12c1b38
49027 F20101220_AABNCO vicenscontreras_m_Page_062.pro
b6d5cb9c7841cf31ef0f5ad49aebb600
1078e3849c8237350e45423eeabdec914da6e0b0
786186 F20101220_AABMWU vicenscontreras_m_Page_052.jp2
13de538273090a0284de945a656c941d
c63aa3af569979dbaca4b8cd7b0535a1a332d1ff
33716 F20101220_AABNDD vicenscontreras_m_Page_090.pro
0897ab190aef2d39201531215d06a061
45a09de2ae314f58149233282a0cb0c29c434a9a
47590 F20101220_AABNCP vicenscontreras_m_Page_063.pro
d1602fe147692adacdb90b3a2430eca1
8f29f9dacef4f4f283d2f857f0e06a912560acad
F20101220_AABMXJ vicenscontreras_m_Page_077.jp2
3e22384fd83a7fadf583dd6e64264958
a4956f4e0b84b83c4bf8bcf39dee7b1ce987af46
1051931 F20101220_AABMWV vicenscontreras_m_Page_057.jp2
1730220fcbe04ae53f68c87b9d91a492
7128048b13e30e1e5b20244c2c0e533decf195bf
14828 F20101220_AABNDE vicenscontreras_m_Page_095.pro
27b1e4a2c0824e1e1ee8023e61349d1c
cd1e8bab70b072f7b830d45dd9053582a61fcd82
45888 F20101220_AABNCQ vicenscontreras_m_Page_066.pro
8582035fb53fde7dfa2f6e4419fbf279
753403a114508a120d11f77b53bf230020689c19
1051935 F20101220_AABMXK vicenscontreras_m_Page_080.jp2
37d6b37751caace42d0c0db36570cd6c
cb436fe11ae168a24e24bc30d9e9610d101248f6
655981 F20101220_AABMWW vicenscontreras_m_Page_058.jp2
804ea16205d88a2062c9d6f38b852728
5ed9ff3ec47fd7b96788ee1cc9d63f0e0e1e26f9
18754 F20101220_AABNDF vicenscontreras_m_Page_097.pro
75397a5d5dd284091b6a320404eb7670
8f3424e7970a6dd8b4ec03dcd1ab90d32c612aed
32305 F20101220_AABNCR vicenscontreras_m_Page_067.pro
bd4ee1ef5280ccd0d546a63326dbdf6f
036f8ac5c1298cdce4aef3e6c46691e42afd3beb
1051893 F20101220_AABMXL vicenscontreras_m_Page_081.jp2
44143a982296fa88aa1198b1f8e648a5
2e31e2e82ba373ed3ee40fd9eea266a8af5a4ab1
1001309 F20101220_AABMWX vicenscontreras_m_Page_059.jp2
5efee5a54cd34797e3e38388cc6e8c76
ce9db84e9892c010eef5103934fbd250c30f6c8f
44587 F20101220_AABNDG vicenscontreras_m_Page_099.pro
a52ed97aad73a696a02697d5eea94cf9
770267b9942c1c0df516690ece6f832caefdaf46
F20101220_AABMYA vicenscontreras_m_Page_108.jp2
3b3a3a2382a36a80053e9a759631dd84
5746e52f1f6fd75ec3546c92bbf2906cd45b434a
49071 F20101220_AABNCS vicenscontreras_m_Page_068.pro
bd3237147566aa05ba9109987959b2fe
8aa69f8c19a1add5c6a6a5150bbc5ca5e49ef236
969336 F20101220_AABMXM vicenscontreras_m_Page_082.jp2
6553814a8d831cdd9b7fc3f1c226bfbb
cf3a7754e5129ad0ee01d10b9f4c0c34bfa7ed44
F20101220_AABMWY vicenscontreras_m_Page_060.jp2
c37f2e4c86a028afade053978f22a27b
a28fa019d1116cfb420a1459ecdc70a54a67d5e8
51077 F20101220_AABNDH vicenscontreras_m_Page_101.pro
fb7896f6893aff436cce34cc1aedfb50
2c87208546bb5ddbc178e12c8d0bf1002d5fe5d5
799946 F20101220_AABMYB vicenscontreras_m_Page_109.jp2
875abff926673693effc100011699326
1e193bd6103f479014de40d158ea0ff4a13f9db2
48122 F20101220_AABNCT vicenscontreras_m_Page_069.pro
8b8a81328f5188c239ae9d2cfce2a12d
b67a130b825cdfa9fc05e9c8849538a6266a524f
F20101220_AABMXN vicenscontreras_m_Page_083.jp2
c47fcd5c2ad152bb3327ba4442ddc83c
4417948a5ae6248e13a95a9f61f65847ebfa3b7e
F20101220_AABMWZ vicenscontreras_m_Page_061.jp2
6bd49f0c7e06d6049d183c34642262ea
e0f082ea7c2982b68a14ccb0d787372602b03e6d
45469 F20101220_AABNDI vicenscontreras_m_Page_103.pro
61e3d2e478854464a756bf45cc08232c
434e4e3213e777bb9e7a26803f06f30d3cdb4263
863412 F20101220_AABMYC vicenscontreras_m_Page_111.jp2
7a4e69c7cb9c258cd68dbbb45307ad77
8f31d51b70c8ba81c7989a04eb184c9cdf70e957
24435 F20101220_AABNCU vicenscontreras_m_Page_070.pro
85caac3340872cbe00759ff5fe90a14b
89140ca93230dee2640e553fcde280a9b1c99246
881918 F20101220_AABMXO vicenscontreras_m_Page_086.jp2
e6f57518c996aab36d65d8d89dfed75f
108d707058d364d4da05d90200b49addb2cc1975
50325 F20101220_AABNDJ vicenscontreras_m_Page_104.pro
60003127a4ee7656b303042804905569
a27dd92e768579b6a82fcb54775b980e7d7c048a
971554 F20101220_AABMYD vicenscontreras_m_Page_113.jp2
4141ba3d5f5248a03f256c17b84b8015
88d2cce372f6abb0f64af155df7ec2568713d371
33034 F20101220_AABNCV vicenscontreras_m_Page_073.pro
9605b3c3e2a8874e7ef378d27f44a631
9185a414bde3be2082e3cf51e4bb4c839251e3b9
39962 F20101220_AABNDK vicenscontreras_m_Page_105.pro
b31c8c29c328d0f3b95d232e551df9ab
42ea4046aebe3a37e5b4bdfdaa18d2b1a9c14493
F20101220_AABMYE vicenscontreras_m_Page_114.jp2
297466dd716db109fb2e42cc1f44050b
bcdc6c91adae0f52ea82ecef8d899f3f29cea21b
51784 F20101220_AABNCW vicenscontreras_m_Page_080.pro
4e3486f70c05817b5e71b5d69df8893b
e9f0b857d094bb2642d77f6c1330f793111eebe3
1041738 F20101220_AABMXP vicenscontreras_m_Page_090.jp2
fe001761ac62b7cc139962217717d374
4f174c14afb08e67cc3fd9113fe44cf6dfb28089
31632 F20101220_AABNDL vicenscontreras_m_Page_106.pro
96d5e0c3dea00cade2d33ac4436e127a
1c4c5ac33125c56f9fb122febf9d0e8b008fe9b4
956016 F20101220_AABMYF vicenscontreras_m_Page_115.jp2
1320c8e1612d066356927424dea01416
48ff6b4b8e032594122650760f28936cc4eb4afc
47618 F20101220_AABNCX vicenscontreras_m_Page_081.pro
9ffb44fbc0abe1fbe7dcb1363122a988
0bf6150ea37cd5162bc2a994df0f0b1e948dc877
F20101220_AABMXQ vicenscontreras_m_Page_093.jp2
e1bc068b5bab334a35871965a5a6fcfd
886c7f6a6a42221716f83d199ac5c42d6d48f8d8
50568 F20101220_AABNEA vicenscontreras_m_Page_129.pro
72d1bfa932bfd941763f60ef3e09214d
b33b517c6c3e2a1c59cb79374e282f6d0d725fd2
49509 F20101220_AABNDM vicenscontreras_m_Page_108.pro
386594a8166e6dc05e10b3ec5c2e29f0
d31402721ea6e24f2f41b3fdebb234d9df3319f6
1051951 F20101220_AABMYG vicenscontreras_m_Page_118.jp2
36f4477cd5303c4c421b37e146073ad6
5f8c9566bb9b8b687af0da60caf9fc90e818a1af
36048 F20101220_AABNCY vicenscontreras_m_Page_084.pro
9871845f0fd175952df1da9d453df943
93a6189cfdf9097de8c22de9691bbcbcec59a6dd
880909 F20101220_AABMXR vicenscontreras_m_Page_097.jp2
6a2154a6d4529626bad422edfc79957d
0fbd30f911795e942dcc814dbbb20f51cc0ceaf3
50811 F20101220_AABNEB vicenscontreras_m_Page_131.pro
4b8034868c46d3124b9c5ac37e98d9fb
36d0ff59c12a05676b895cf181d076bfc99a07bd
31852 F20101220_AABNDN vicenscontreras_m_Page_109.pro
b67ccdfc91724d172e1fb1632865d379
616f992bdc26246db9a91f3125000659e1643f75
F20101220_AABMYH vicenscontreras_m_Page_119.jp2
db9ee1b86cad6dcf67daf0c9d7e0e636
3d332a76808288f416361b94ea73c0af88c8cec0
995379 F20101220_AABMXS vicenscontreras_m_Page_099.jp2
e9cc0e2a015684f3ef91eedf0b437a91
db87e69ac2c801923ce9362f47c6b815a72eaa30
37493 F20101220_AABNEC vicenscontreras_m_Page_132.pro
7fcda2ebf9d31f8661a69e2db4857fe6
de2c8ccd147affe89599673caf4ab846c074229f
33947 F20101220_AABNDO vicenscontreras_m_Page_110.pro
50344b4e68df307ccc52b111bf55ae3a
abf941a3af0dbc3b6e42bc5fd1063079fb4b6b9f
1051927 F20101220_AABMYI vicenscontreras_m_Page_121.jp2
a1b98edb6808d192875f61743007bd68
0f28049d47cfaacd5fcba106d99991dc5880f00f
43843 F20101220_AABNCZ vicenscontreras_m_Page_085.pro
051492ec21b7ff616c704166a7b43412
d3ca4d774b83a303b74b280718ffcc351f31f3ab
1051968 F20101220_AABMXT vicenscontreras_m_Page_100.jp2
fb3812dcef7a4a66a6bced7f47ad8e29
a3648bd1877636126d54e8fd6c1b4dec5cb74dd6
41795 F20101220_AABNED vicenscontreras_m_Page_133.pro
ba4004a6bfd8ee9606526ae76c966bcd
9c1002bb9341c6132c6fbf69947ac4921ba075b0
35756 F20101220_AABNDP vicenscontreras_m_Page_111.pro
a73efba9f8a6377782823b6047edbefd
f4c5316cf3b67829124ec5fa2572323fb878fb29
1051963 F20101220_AABMYJ vicenscontreras_m_Page_123.jp2
804d046c6c540d0747ef79ff97e21d14
22872f31191f2a518370d00c73de25d3377ab1be
1051909 F20101220_AABMXU vicenscontreras_m_Page_101.jp2
ad564b6d792ef47d902e9c0dae6b42ac
fc0c04eb29dbc63a4d7b2f17b083e8906db12b31
47897 F20101220_AABNEE vicenscontreras_m_Page_134.pro
dc0f6c343fb466f85429846e32b08b33
35c0f7e4d28c4c4213697f494ac9412306fd5e0d
41237 F20101220_AABNDQ vicenscontreras_m_Page_113.pro
94fd40ffe0d700a31398a534374bbb41
03365c3e9123ee5225f34a6c4c2b57818503b43e
F20101220_AABMYK vicenscontreras_m_Page_126.jp2
d8d6f033ce1b00bf8f679a3e1e969d28
0de4c6830b5de46824d6eeff7015dda7c1defc01
522267 F20101220_AABMXV vicenscontreras_m_Page_102.jp2
55b05435352b8e4aa6e073bdb6bd8b01
d0c7837581036d0dc5c7f1cc41689530dabe978d
53347 F20101220_AABNEF vicenscontreras_m_Page_135.pro
6815a2ff88630a3cebf11be6072f2275
a70f5a8a99de0ae8efdfc7e08a4791b84d1e59ff
46455 F20101220_AABNDR vicenscontreras_m_Page_114.pro
a7a0d16259b2cd57b927c3dac654f298
d7d59db038a879effdf6c3aaafc7e25e6207fc73
1051908 F20101220_AABMYL vicenscontreras_m_Page_128.jp2
f6887d3c752c6acd5460a69ef4b926e1
f56b0f17c83533a461d6f4a2e64bf9cfa9bf093e
1051967 F20101220_AABMXW vicenscontreras_m_Page_103.jp2
9a472ee41ed9e1d62b9b6f19238eeb01
1dbb52db4c29df1e2fbeb14b16b0d3c41529e247
F20101220_AABMZA vicenscontreras_m_Page_019.tif
36196814df8d95f468538945b7441c0e
1c93fe69be3804ff1b858d27a9359455f81b0a5d
41244 F20101220_AABNDS vicenscontreras_m_Page_115.pro
8d13736e27e473e901a388d3c6517c4a
eda4bfdd30b22f64efbfc8171b3c77f06fefb4eb
F20101220_AABMYM vicenscontreras_m_Page_129.jp2
7140768757606e0f9aced11c78670688
b57f2fa78b9f856d47f15b3712203d102a1f1525
1051948 F20101220_AABMXX vicenscontreras_m_Page_104.jp2
cc065e71eb847795e74ddf433acb4736
7b419f233ab9f6c5202801e8a923f2b755617d1f
461 F20101220_AABNEG vicenscontreras_m_Page_001.txt
e96944b69dc45bfdff80cd8b1ff3996f
87388bc8b652c10afcf397e8f71ac0bbe6bfd524
F20101220_AABMZB vicenscontreras_m_Page_024.tif
5c972d786574b23a95e61c7d90b46410
057a889b41b19a73073228a3d1b9ac42e918c4d5
48273 F20101220_AABNDT vicenscontreras_m_Page_117.pro
ec066a71803f778a8cb9bdc9d8099941
09fd27f1f45095808fd519f8edbe81f5c765d760
1051958 F20101220_AABMYN vicenscontreras_m_Page_131.jp2
daec2e31e3a5bedd68b4b1d854fe47a0
2326397df36e71b8b7febd3e7b3c2d3f3d4fbc4d
1026850 F20101220_AABMXY vicenscontreras_m_Page_105.jp2
c050d310d27c0b81045d5d03cbaf54e1
b030b88fc07573166e2150947b5f83613ee96eaf
1650 F20101220_AABNEH vicenscontreras_m_Page_003.txt
afcb1aef1ebcb7a3b48bf528a0809458
af6d2f8a48cb1760102f2857072ee0bb06a8d6c4
F20101220_AABMZC vicenscontreras_m_Page_025.tif
3bc8d7096c6182dd3335f92d903fb48e
7a15474192902eaab00152691b85028117dc60a9
50386 F20101220_AABNDU vicenscontreras_m_Page_119.pro
661d74fb400d7d83a77eedb6349fac24
b8abf797dc03ec1e392b4f8a21f25dfcd2cb0b6f
866590 F20101220_AABMYO vicenscontreras_m_Page_132.jp2
0a3edb535b17703e5ac6538aa2be5a59
4b3a6216a344bcca858daacc26c846934ce38e06
766694 F20101220_AABMXZ vicenscontreras_m_Page_106.jp2
c84c3b07c816417c48c59d1a211ec881
8ff8b280c07de7ecced35178863973cc7376ed2b
956 F20101220_AABNEI vicenscontreras_m_Page_004.txt
40356d76fb8a1c0409dd084cad1c80d2
273d7aceefc4f73961165868d5faed6ba5ca904a
F20101220_AABMZD vicenscontreras_m_Page_026.tif
ebe0eaf605581ac7a2525a9650fe15cb
37cc6c60c28b9926f757580cd8e77f7ee7165f55
50400 F20101220_AABNDV vicenscontreras_m_Page_123.pro
7308f4974261c2df7cad111517d14dab
17d64c3e62667da652fb06ef4a3932485399e676
F20101220_AABMYP vicenscontreras_m_Page_137.jp2
1b08bdc0b7f8089fbf02aee5fd9f564f
5cc4552aa532916a7975ccd18443494e479060dc
2759 F20101220_AABNEJ vicenscontreras_m_Page_005.txt
f49663f38b3635c5eba4cb91d705925b
eaa943be64789cb90f61b2fc0e26faaa0c18a7c2
F20101220_AABMZE vicenscontreras_m_Page_027.tif
26dca8f0b408b91ba7a7b5a9f8a083de
951f8fd04ce2de30c677a522e62196ff26a51c5d
5919 F20101220_AABNDW vicenscontreras_m_Page_124.pro
5a41feba62ffa91d6a25ed0831737256
e3bfdcb8a2040db38ecbdf045062a024ac0fa4c4
3348 F20101220_AABNEK vicenscontreras_m_Page_006.txt
3ac076ff9eb4cd8c89b6f7e326212792
825aed3876f318bb0b42f2b8389f0a45cbdf4d2d
F20101220_AABMZF vicenscontreras_m_Page_030.tif
58fd076b2e477810d4e9db1dff6bd1fd
3dd4b1a116d962330a0980e2c282801fb492819e
43413 F20101220_AABNDX vicenscontreras_m_Page_125.pro
01d6b2d9f0b7f383f9c0002b8bc7edff
cbeb891b3191838f88c74b7de284c787cfa39a4d
413967 F20101220_AABMYQ vicenscontreras_m_Page_138.jp2
3cacba7f747be0f71bca2d4887d5debd
2e89f444ed8c04a32f954eb364ec1b4dc2000d7a
1093 F20101220_AABNEL vicenscontreras_m_Page_007.txt
8d8bdc71a1fe70a2fe476f73fdf92c73
f56208bcae83d63a8422a1f4b6bbbb1db789387a
F20101220_AABMZG vicenscontreras_m_Page_032.tif
f1ee9ea63e1a50bee948273ee432958b
66aba5f016bd28d2bdb41686f4acf122dd9f946b
50664 F20101220_AABNDY vicenscontreras_m_Page_126.pro
767ff4ec46f622554be673e9218a53f1
df3b3fb3f4b761e1d4e67a9338a77ef02c095f94
F20101220_AABMYR vicenscontreras_m_Page_001.tif
f531f4828c88f12914f4a289f16aef5c
38b0373eebe12fd89d1a9933c15ac6ed9a12f9e0
1672 F20101220_AABNFA vicenscontreras_m_Page_032.txt
5bf1dbbf72479848d8f06eaa091c5cfc
5f9e968ca10f307f6f70c743f60305436021be6e
7464 F20101220_AABMBK vicenscontreras_m_Page_090thm.jpg
45b512b952995563bf1abaee2a9ab4ac
ab791391046b7c7179e889e62c9be84324de9742
851 F20101220_AABNEM vicenscontreras_m_Page_008.txt
7111d3b15caa16699a17e2eb4a63a09f
36da3eac1fbb64bf5145c911425d619c9a4c85fa
F20101220_AABMZH vicenscontreras_m_Page_033.tif
ce5250fc831b24bdc690a45de7affc35
9992abb6fae11015cb962b6cafed9439fc5abec5
51144 F20101220_AABNDZ vicenscontreras_m_Page_128.pro
458673f63c10bb92e119c9f14455121e
ce68395b4803139206d0ca1832cebccb84eb1afc
F20101220_AABMYS vicenscontreras_m_Page_002.tif
9554a3eb0035c911fa6639fa31f34bf3
1a9f9800c73d2ad13eed53d1e43b3f83b6d40bd5
1187 F20101220_AABNFB vicenscontreras_m_Page_033.txt
562ac1c98f8361af3abf520aa1e8f3e0
6f779cacd5e6c5572a3bb623e6e451982cab4d7b
29554 F20101220_AABMBL vicenscontreras_m_Page_009.QC.jpg
ac88f8579b06632bbd7e9abc4c063c9d
0a17fa775151a16da02c01402ed9314246d15e7e
2407 F20101220_AABNEN vicenscontreras_m_Page_010.txt
4f1007abc29d5ac16b8560f9fe534afb
58dc17b47bc66a503e8b4c63f36148e65bb2c820
F20101220_AABMZI vicenscontreras_m_Page_034.tif
3dd9596835f31d4d05537e913c797217
82aaf43971dfcc2a5e50fcb31208367976a3d5b9
F20101220_AABMYT vicenscontreras_m_Page_003.tif
67be24f3d53b55d72d7b544be975ce58
73b3410742df0b4e3d92e701d44593b7ca269090
48327 F20101220_AABMCA vicenscontreras_m_Page_092.pro
a8619b979ebb86d7c3e6cbf3d1ded986
1eea2a1c0b92ef9e26d0f093a756f70049ef9894
1750 F20101220_AABNFC vicenscontreras_m_Page_034.txt
1c5ad3debd9bd23780b3f3b26f086f41
89c2c1fba5da470991f1d403fdd10fa213b7a3dd
F20101220_AABMBM vicenscontreras_m_Page_132.tif
bc56b7f00d05a9a0ab3190bafce851e6
9b18abb53fc3cc398dc084ac97453164c7e5e754
1026 F20101220_AABNEO vicenscontreras_m_Page_011.txt
9cbfccb5aeb832bf13f4e0e82d0137ea
551561715daf264c36bd70c748fe0ba0a4bd2f0a
F20101220_AABMZJ vicenscontreras_m_Page_035.tif
f6c3b8ce94c0a9f3516f185735d0c09f
ad4334f259a505d101eb9d993fbcd4289971eba0
F20101220_AABMYU vicenscontreras_m_Page_005.tif
512ab4323938ba70672b992fa7c844b9
b2e77a16bb2b119f962daf5e3df3b6dbaf380cfb
F20101220_AABMCB vicenscontreras_m_Page_133.tif
8b08dd59656f9480b8581c80ed77ed3f
171bb833ccaabcf3f12fb17133e8c0ae601d7eeb
1979 F20101220_AABNFD vicenscontreras_m_Page_035.txt
72eae75ef16204846bf85a562b7a8d9c
9b678d9dc3ae7cb40e3eab03d0f79d50986a41de
85966 F20101220_AABMBN vicenscontreras_m_Page_078.jpg
12e2014f4729c573759cacdc71cb91ed
2ad2b4efef8028b6d2a965482edc296518acc716
1686 F20101220_AABNEP vicenscontreras_m_Page_012.txt
7f786d404c9cf696451329074621a8cd
fbbcc0f2b062afd69e37f4dfad2d580b636c4784
F20101220_AABMZK vicenscontreras_m_Page_037.tif
349ec03e1946f4c2c5eabf5670b9ec75
7fc0d08907114d5c90d99f87a864ec421f5aaf69
F20101220_AABMYV vicenscontreras_m_Page_009.tif
3dcbe14fa1dcaa57832b6ffa4debfa07
48f89b41aa5362c8156e1c9715e08da8e01b4510
138 F20101220_AABMCC vicenscontreras_m_Page_002.txt
a9ea78127412e8da83f47e2b500dc88e
1720e6897c74ddc428d28ad1392135bf930927b4
1846 F20101220_AABNFE vicenscontreras_m_Page_036.txt
3a177efffebe065085a11ebd88633077
15e29347a389e31f071fc45d85d704d148ace13f
25581 F20101220_AABMBO vicenscontreras_m_Page_051.QC.jpg
7f19077075b88184d532bb0c6681ccb8
66642bc2baa17fac21e6daa0e894c74df06183c3
F20101220_AABNEQ vicenscontreras_m_Page_013.txt
2bcd6f3056e5e74add5e3d309401d52a
d0ff5c7aeab024648a180539f3662ec46174f1b7
F20101220_AABMZL vicenscontreras_m_Page_038.tif
8247728260d7fcde5187c8a23ba24a56
c42d2d0e941490a53c617c03181eee3a36d169ce
F20101220_AABMYW vicenscontreras_m_Page_010.tif
6bee23ecc23de0a084f85c59000e82d2
6b646444a8e659f4f596705912658bff93bbea30
F20101220_AABMCD vicenscontreras_m_Page_134.tif
2bf39a8577cfed9724497abb192eefed
540040db0f1ca664300291a770a030e8f8092145
1939 F20101220_AABNFF vicenscontreras_m_Page_037.txt
9ee44b65f0d024a6f615f19f7bb36036
b5ce1148e445a0bda727d98d0672b8f222848420
99910 F20101220_AABMBP vicenscontreras_m_Page_068.jpg
daeb5415346f50c432bdaf70b990c92c
ec4c3a511b0bf85c8150f96158ccb1e044d1b3f1
1986 F20101220_AABNER vicenscontreras_m_Page_015.txt
bb67667b58f005384a0dd75b671bede0
bf05c6818fb071a0247d04cb8fb0646ae8c525d2
F20101220_AABMZM vicenscontreras_m_Page_039.tif
7e5f7cdde5fd4a4c3b7603a3eb896ac6
529474e1a225b6fbe4ebebd52d058400a98bc920
F20101220_AABMYX vicenscontreras_m_Page_012.tif
7a4cd07b99ffeb299481dd81e7f44232
5faa0c8422851b499ff797889bb1d8158ba5b40e
40060 F20101220_AABMCE vicenscontreras_m_Page_044.pro
dbfe18cb07ce6e803db23112ee045032
f9e3d7f86b6a729f8cd105d599d5c4b36ae1746d
F20101220_AABNFG vicenscontreras_m_Page_038.txt
fc5f52f8d834308b29e304c5fd10a297
0f7853731244cf81de8880f2a02fc9f71696bfa4
F20101220_AABMBQ vicenscontreras_m_Page_015.tif
06b39fc9aee0bfcaef852663a0a5a7a6
fc710188ade135ea4bb26a92fcc47edd7dcf867e
F20101220_AABNES vicenscontreras_m_Page_016.txt
d80537e3c1466948f642981df7e7619a
1a848c37efb06d9a603597a9e2f31dc7664e332c
F20101220_AABMZN vicenscontreras_m_Page_041.tif
2ec43b348fc2317f16e66da7481acd33
ab94586a1ae43b62fdacb1b42dffe9595bb550c7
F20101220_AABMYY vicenscontreras_m_Page_016.tif
d877a344f301d00b7342c7160f227629
98eae2f3a80c20788a39ef4839cfd4a5c9efb824
F20101220_AABMCF vicenscontreras_m_Page_116.tif
20652aadf8b94c37d6ab5d0800e88914
e37f6a0194259811062bb23d6c8d5f63521779bc
1909 F20101220_AABNFH vicenscontreras_m_Page_039.txt
00904e6465c83ce41ca44afb5d79168f
8b99312de6eb50dbf6af5129b7115e9cf8f37076
F20101220_AABMBR vicenscontreras_m_Page_062.tif
c2684281e84e959f7f8e6681fc203270
3258ee3c1740d7a6351f462f6fb88bf6594fa121
1977 F20101220_AABNET vicenscontreras_m_Page_019.txt
8307ac105474300a6b937300e9d8a9b9
dd29cd4d84bc2ba85cef56076993e37ef9aa90b4
F20101220_AABMZO vicenscontreras_m_Page_042.tif
08a1a4ff7ba712400d9f4c8574f2bbb7
ab51b041747bcdf4eef6d3e1fdd79d751ae41fa6
F20101220_AABMYZ vicenscontreras_m_Page_018.tif
f16002207689fabe6ce64fff6f129678
7dfcafe813eb04d3ec356dee1547a0a181f30532
42336 F20101220_AABMCG vicenscontreras_m_Page_091.pro
5b4e0ee5e9ba06272dd17171262bc2ad
4c03b5d7eb4d401d31c187398a356623c6c3b1c7
2112 F20101220_AABNFI vicenscontreras_m_Page_040.txt
9aa96744eaa2af5c95f798d2a51755bb
264e246c70f5e36f3704d2fed501a1862e69c5d3
998983 F20101220_AABMBS vicenscontreras_m_Page_125.jp2
6a3fba3c8b57893a987dae21a8dd10cc
37bc2907c9b39c08858bc323c8e415450b20648f
F20101220_AABNEU vicenscontreras_m_Page_021.txt
a7b82e24b8ed811bf26f502910738fae
2ed11e20eba077574a1864f0ae6f0f1b29c8bc68
F20101220_AABMZP vicenscontreras_m_Page_043.tif
b1a0390676c8f922e8b7861e016457f1
a2736df38affa22a0629bd9cf8d75cd5aa854a3d
76644 F20101220_AABMCH vicenscontreras_m_Page_109.jpg
ce7493ea4f114844ba3bacd14a2dc146
a32f97e9e51a106e8e3394a1851b5b0c7f374a4f
1383 F20101220_AABNFJ vicenscontreras_m_Page_041.txt
f7d7840508d23e3ec2acc0d2c420770a
09a4e0f771919b173752bc24167267bc7bdff149
98583 F20101220_AABMBT vicenscontreras_m_Page_100.jpg
54df33deaf18ae6aa76d9801e8b9189b
79f8174204b2746c6c6b1a4b72c0db35a4598b98
2016 F20101220_AABNEV vicenscontreras_m_Page_022.txt
34ce7bbce0871d272df147e028348ba6
a4ca1c84c62d87b9d173abbd8a1ba71e4ec54b4a
F20101220_AABMZQ vicenscontreras_m_Page_045.tif
56f53766510447292fb95b7402b7236f
024913ff911d61c2d46ee04f4d5128693d17883a
764380 F20101220_AABMCI vicenscontreras_m_Page_089.jp2
117ac7938cf2985ad184806ca3a82c56
c86093db4763a65a110f4600e719fb55646d802d
1811 F20101220_AABNFK vicenscontreras_m_Page_042.txt
bbc949e87223c48c2ab2e583f176b5b1
38208ef4516afbef347536f3263f99d86235ecb9
F20101220_AABMBU vicenscontreras_m_Page_006thm.jpg
c86afaba7742ac9d13139e0a9552ed2e
f175fd57e6d0ecb4969f54e928461a00edeef28a
1534 F20101220_AABNEW vicenscontreras_m_Page_023.txt
a1b296abf93fb35c23decc1af2fad5de
11520ba655cccbba0ca10c0434fb587c6ed3fd56
F20101220_AABMCJ vicenscontreras_m_Page_136.tif
df3799bd43d5df7267758dec823f067f
5c1dd2fa090fcb64ffb98048e82cb35c0392991b
1888 F20101220_AABNFL vicenscontreras_m_Page_043.txt
24ac66cdfa661cf60e6e3d11d3a83eee
ddc36a220044a75067d33b2898a158247d6c1d42
F20101220_AABMBV vicenscontreras_m_Page_047.tif
29cce987351d9e75c5b0ec27dcdbcabf
3463e75a34aa008961a6efeb497d04cba1579d93
1929 F20101220_AABNEX vicenscontreras_m_Page_024.txt
9245b770b01be51bf2d0680942e5d526
8dd6b6a931bdeb554d668d674b5cd850670270cc
F20101220_AABNGA vicenscontreras_m_Page_077.txt
32ec90f8979107df1422df3287877a33
de5b0f6ec7eb43c946c296ba00434ba067f5fa62
F20101220_AABMZR vicenscontreras_m_Page_046.tif
5f0ff69f8dc0f8f87321daf2a2900ce0
98195110593235e28e028b674dd0079b732ef26d
5152 F20101220_AABMCK vicenscontreras_m_Page_046thm.jpg
47f93cc1aeb0c12e59d2ad281177e396
d74d78d59dd4a4f5383df9e5dd4f0424c0af4fc0
1728 F20101220_AABNFM vicenscontreras_m_Page_044.txt
9ed8338bd22df2442bf640ed6356ba4a
974309d4c4f437f6e99e903d7cfb5c624b87c774
29497 F20101220_AABMBW vicenscontreras_m_Page_014.QC.jpg
7d975e56b693a5218e48c5e3d1ecaaee
1a97b81edac6f2fdbf3318ea8dc9c607321133cc
1837 F20101220_AABNEY vicenscontreras_m_Page_025.txt
70fee9cb872dd14c3196db827b3b1e5c
1104eb362c7cbeac63dddd1ec378a4674c5137d0
2002 F20101220_AABNGB vicenscontreras_m_Page_079.txt
47075df5ba3254471e563aa38456f7b4
657c878903f303a807bd0b30cea5ac75299af697
F20101220_AABMZS vicenscontreras_m_Page_051.tif
058fbd9a13176629bd92ead496a85cbd
4540c8da4a01c8185c2afc28e00a8f5b50138a5e
8278 F20101220_AABMCL vicenscontreras_m_Page_017thm.jpg
15b14951c8cbe433d117c4656e5bcfa5
729016a078c7c95fdbb5a58fbbe9135659642e71
1954 F20101220_AABNFN vicenscontreras_m_Page_047.txt
a034b4d6b507f944e2adb677a9afd6d3
b4b860c27d369538f1ff24f55eb0266f2ee7403d
F20101220_AABMBX vicenscontreras_m_Page_085.tif
f8921afcc59a267b4a5466d560ca779d
05279649c3373c268e83e3783c2b63da76c11e85
2083 F20101220_AABNEZ vicenscontreras_m_Page_031.txt
e2e3f70697dad9a6ba82ba4996d6919f
a799777faf0d02d1030f5406a5f3afc80652ac11
F20101220_AABNGC vicenscontreras_m_Page_080.txt
6c57dd70aa92a4828fd3caf096352cd4
8a4f37223549ae0474377486a2dc830b064f83d6
F20101220_AABMZT vicenscontreras_m_Page_052.tif
bab50032729991ec73697e9c8d1efc80
d5adf5c61310e55f7d359b9058c9dca713215fca
7038 F20101220_AABMDA vicenscontreras_m_Page_084thm.jpg
6634cf512d0bdccea936c7f4f130a63d
9a0a9ceb5fe9fdd7368dc2586857de5d38d5d197
8767 F20101220_AABMCM vicenscontreras_m_Page_095thm.jpg
11810a37a6022aaca340dadf6f855284
1547de78d8a1beab8513fc3d969980678df15a51
2000 F20101220_AABNFO vicenscontreras_m_Page_049.txt
bf1e332e0a8c2db84629fd6e2e85e03c
5925508deb119714d5dcba577b016670e15b7231
1832 F20101220_AABMBY vicenscontreras_m_Page_076.txt
c75a9324bd7a7dd8cd9f9c320a4b2cf5
2779166a70b9989d9f40c57be3fe10a65826c279
F20101220_AABNGD vicenscontreras_m_Page_081.txt
27a2f40525e7820dadef0b5e4cf68957
aa9dc0fd22eb073e41ee9b0a039309e549001f36
F20101220_AABMZU vicenscontreras_m_Page_053.tif
42b15385562765411aae4a253147b923
44e92fac116aa490fe70bfd13071da7322aa8d7b
60936 F20101220_AABMDB vicenscontreras_m_Page_064.jpg
2b6a6aa5263001ad05bea9358875ea99
9b111732f6476c2b000965f3a036b826c430844a
105274 F20101220_AABMCN vicenscontreras_m_Page_037.jpg
fa2406700a9249bd79b234b2fd07cb56
c2c05a4e1413af1f02fb8da1184c2b33ffd979a0
1454 F20101220_AABNFP vicenscontreras_m_Page_051.txt
57948df9a861580d22ecd1de1bd20755
b384f2a1f9f5c1df8514ebee509c2292ec32dbe8
1605 F20101220_AABNGE vicenscontreras_m_Page_084.txt
f30ad824813013463fc5db5a6d98da4e
ffff0f5bc2fa30afcbbaa3b520d47567a27a6cf7
1152 F20101220_AABNFQ vicenscontreras_m_Page_058.txt
9990cafbf6e5d31d6e35c3a2aec58bf4
21c1cd7c24aae7919e2c8cdb18623a335c2b69d0
F20101220_AABMZV vicenscontreras_m_Page_054.tif
89388585489f4ac92b10695937e5b919
8fd48e87de9812fd3cc250958bff66cdbe900106
2571 F20101220_AABMDC vicenscontreras_m_Page_001thm.jpg
0521936b15751fc7fdee5b54f0f05570
610386905cb23521d515277d38f7d5debc026868
28796 F20101220_AABMCO vicenscontreras_m_Page_041.QC.jpg
19fd92f0065e8201c715ba281e111144
b0554e5a89a6836827af955ffd9cdbe6d9d3d294
F20101220_AABMBZ vicenscontreras_m_Page_043.jp2
da2a0a910d034d7402fadc5c5f993732
0af8cd5fe18817a8811337cbc747b24b0d8c3c20
1577 F20101220_AABNGF vicenscontreras_m_Page_086.txt
ccb3f1f08c87b60d2256420853ccfe2d
3491547c3a868c24292bf2409dad00377ebfc52f
1822 F20101220_AABNFR vicenscontreras_m_Page_059.txt
7d7d9636b196a621e2601dbaa45b8f20
eb35e136c85690f8b40ba580e6c2f3d447333b95
F20101220_AABMZW vicenscontreras_m_Page_055.tif
fe8a4fa5e39bd7a1df627eac38695afd
108ae0688f07d8ebb000d1ab1a6e88e2e71a5101
2056 F20101220_AABMDD vicenscontreras_m_Page_009.txt
79b4b3cdf4422dea1883eebb303bd7f1
bbdacb8174e46ad3ab049e1dd57c3fc09b3fa545
102304 F20101220_AABMCP vicenscontreras_m_Page_055.jpg
090271e2e9332c7fe5891e0e9699fbae
4c5245910e9125085757bcda8aebf73ec1df51dc
1183 F20101220_AABNGG vicenscontreras_m_Page_088.txt
3b65708a6727817ad39e1142af0a4c38
5568e7e3b49ef899974cf0f2f370084ca5143d2d
1877 F20101220_AABNFS vicenscontreras_m_Page_063.txt
fbe17793f1c82a8979b2dce0efa83506
2103950b8ec9c79f5597c33e1ecc4e6f3229c3d6
F20101220_AABMZX vicenscontreras_m_Page_057.tif
13e5e99f3f8c3a75ed6f399218c3154e
42f7e99cfa0bc8c364bcf94758d79ec53e5b79e4
4892 F20101220_AABMDE vicenscontreras_m_Page_087thm.jpg
eff2a63782b11ee051b4b4b49473b6c4
70d603812c343479b83aebb28a30041f9e784a41
F20101220_AABMCQ vicenscontreras_m_Page_021.tif
a22f5dfdbe4785f93ed020a4a6d7be06
7c3c4320ef17400e36ba2faa6795c60ca28343ee
1345 F20101220_AABNGH vicenscontreras_m_Page_093.txt
88f5e3a9fa8ec529cf56029c5e4899e2
a76b940a876ea1d7e67fababca7b63d8ac2ae8f9
1820 F20101220_AABNFT vicenscontreras_m_Page_066.txt
e622a8e3063318b1e5204fcd5be5043f
04b49ec19efa7a8dda4b674fb58705be1051c5c0
F20101220_AABMZY vicenscontreras_m_Page_058.tif
5e2afad9b5103f84feb8aa4bc7f0a0da
b0fb1f10f69b732df4cb3d2dcd2c23df9d9f802e
97239 F20101220_AABMDF vicenscontreras_m_Page_103.jpg
c50ec35db3311cfc9edf66038f2078fd
b1ef72cfcc3e88c74d047a01aae9eac917a1b5d1
30257 F20101220_AABMCR vicenscontreras_m_Page_025.QC.jpg
d8cd5be7898b5f9824df81db75b59580
3ab7353dde5024021e2655592d88a903d6e207e6
1482 F20101220_AABNGI vicenscontreras_m_Page_094.txt
45f7a10637a2ea092bb7fcf9239d61b5
61eb343a9526353c1f6f983606d648b4a590c927
1433 F20101220_AABNFU vicenscontreras_m_Page_067.txt
63cc2b7d5aba3c408b2d6479943d19c4
9340caca89a5cc0aaf6b1a417c33405f1d276a0e
F20101220_AABMZZ vicenscontreras_m_Page_059.tif
0a939208466bd8c4e5202be669625b72
ac5f963bbde862aceec7165ddff99f2b26aa57f8
F20101220_AABMDG vicenscontreras_m_Page_028.tif
68b39ad1d1a948bfc44cb1b8ac2b43ca
df90bd0284e637519a8ef5fa803005d6713ed7b1
1793 F20101220_AABMCS vicenscontreras_m_Page_118.txt
12f6a2680ab8f4b9f5d4c791ed8275a6
701bbe033d05fb47bfc7e1bfca8922bce738ca87


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20110409_AAAAIH INGEST_TIME 2011-04-10T00:14:26Z PACKAGE UFE0011464_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 8183 DFID F20110409_AABUSB ORIGIN DEPOSITOR PATH vicenscontreras_m_Page_127thm.jpg GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
33b898373d4f5d47bd813356c1383494
SHA-1
9980cea285582d0baeac496960832599202297b7
49300 F20110409_AABURN vicenscontreras_m_Page_061.pro
c9c3312379bfc9642e85f5166b07ba49
e82b0e36c207c31cc0f2a416731e97ba0e155944
1660 F20110409_AABUQY vicenscontreras_m_Page_082.txt
f121f9cbc6a1fb64a4528a05d58d9eab
6962f046ea488a9069227600387c471094624772
46589 F20110409_AABUSC vicenscontreras_m_Page_120.pro
abe37faada9bb35e18c610a649412c31
7805432ba465253eaf60fa8fe3f623f04064cfda
1308 F20110409_AABURO vicenscontreras_m_Page_052.txt
ecb355028ad388cb6d3bc5b7df3346eb
af92db46be045458c1f5aa6ecedf64cbe3a9a0c8
1051954 F20110409_AABUQZ vicenscontreras_m_Page_027.jp2
728b2b81a9eab56fd7f261ddc9bafe30
537e9efaa011f3aa8388aa1ef36d70a929941c79
35384 F20110409_AABUSD vicenscontreras_m_Page_086.pro
8cde4830b80bab5dc019f7b453a38bcf
22a5266df0617d3fe4119963f4d14bebdbc4788c
7927 F20110409_AABURP vicenscontreras_m_Page_098thm.jpg
62ba0ff8dbd22cd812ccd0e4a6cc3e24
488e689c0192779d64660f3c430b7ac82a5c1a4d
48810 F20110409_AABUSE vicenscontreras_m_Page_072.pro
e399194a70e45e7bf8afe6cc4eca2846
383e1c0114008033077619512dc49dc6550f690e
625972 F20110409_AABUSF vicenscontreras_m_Page_050.jp2
36383383b077b59b72156ec0ccded996
67d4d98044910e72ab1ddbafdb4de6700e113f1e
7721 F20110409_AABURQ vicenscontreras_m_Page_073thm.jpg
2b75ee38b67ef09210b95c1ec23f2795
39d447fc8b8c35170550820356f52a07d1e7c1f6
32468 F20110409_AABUSG vicenscontreras_m_Page_092.QC.jpg
17a337186c1886fb7f17bd8d3c7a0a4e
0fb9ec2759f0f2d0823bcbb53e90a2e43126c4b7
4634 F20110409_AABURR vicenscontreras_m_Page_139thm.jpg
b7f06ff33a24f7d97fc94d9158ec30db
1fd878afbfa1ce69aa0b854ee0663c3ab8138823
81297 F20110409_AABUSH vicenscontreras_m_Page_084.jpg
aded8a117147bf04436b1bf97e7850fc
9dfa567ee75e28824b8c59bed7d08ac99e348939
8779 F20110409_AABURS vicenscontreras_m_Page_137thm.jpg
eb9025e88f2be8a071fb5d8ab9f61315
390520b97d6ef3e91c0f2a342faa566a20cbd4c1
7782 F20110409_AABUSI vicenscontreras_m_Page_045thm.jpg
9ecdddb515c46deadd2809a50973af7f
67d8d2d10a11ff58bbdecc9ee6c5962f79f60b89
47938 F20110409_AABURT vicenscontreras_m_Page_043.pro
a312df0e2d7fe988e88243664bf72ae0
8bb3c69ca1b56e844fd43f4398bc4220a38098d5
7619 F20110409_AABUSJ vicenscontreras_m_Page_091thm.jpg
9fa9efbd6f4e062548ae99dbbc820c0b
3447c6e700e55b2d650be6cc5f2f3cfc4bb4e559
1938 F20110409_AABURU vicenscontreras_m_Page_134.txt
05087207effa1eba83c39f6071f4f17c
b9a7ca4054a1198cb939556fa1d70112d95c83a7
1843 F20110409_AABUSK vicenscontreras_m_Page_045.txt
1b4f9fbe5492e7e86da98483b7d1f03e
0d49b7ee91b3ce83b07d83005cc881b7f3b4502c
8223 F20110409_AABURV vicenscontreras_m_Page_072thm.jpg
f245002cde5f94c4e0031d55070911d1
5964dd9901c13b3985b002fb91156af388ab8a2a
88306 F20110409_AABUSL vicenscontreras_m_Page_096.jpg
344bf767104a32b7f574f0732bcf3ec6
f11e919e3845409b88830f5834f37d1750d9dfa9
8048 F20110409_AABURW vicenscontreras_m_Page_028thm.jpg
7e7ce19ed2025a3a58646307cd5e6a56
2c40bc7ee81df5a94e97ace146ab60de7f45ce6c
6333 F20110409_AABUSM vicenscontreras_m_Page_005thm.jpg
cb14f79cd92deff21ffaa202c8e5f27d
09cbfae70d51dc023bba69b2f39906d87973e139
7428 F20110409_AABURX vicenscontreras_m_Page_082thm.jpg
7f4a3fac0d06b406b8034d523f15c610
33d87ce9b6bdcff754d79a38a036d9eef02fdc84
1051986 F20110409_AABUTA vicenscontreras_m_Page_036.jp2
cccbe0c5118eb42b912e9b42f79993bc
0665fa45bd3c1d323db851ad4c5faa9805433c67
89805 F20110409_AABUSN vicenscontreras_m_Page_034.jpg
dfd091a3d1e5280cbdea9e43a390e90d
24d2d2f6f26c9dcd38f540ef9b8099ec4846ac66
30269 F20110409_AABURY vicenscontreras_m_Page_075.pro
550ef4c50f7334ddf748a1f81a6789ab
ed5a7a8513a367dc9a6cdb4366aa84e67e535ff5
33110 F20110409_AABUTB vicenscontreras_m_Page_015.QC.jpg
e060c912f01e7a6fe57ae02c00ac8080
d40ebf45eab7848a6f53cb9ea62bbb3b5c769591
25271604 F20110409_AABUSO vicenscontreras_m_Page_048.tif
34594540d82f69b8072a55a709a1866b
093a9e38474d7dc8c6bf1a303a10702aec879e28
8197 F20110409_AABURZ vicenscontreras_m_Page_107thm.jpg
844d900c841cacb47776291f93b827f8
ed38fd5e29487507dae68a8bfdecd2997f6d5038
1051925 F20110409_AABUTC vicenscontreras_m_Page_134.jp2
4f5aef310d469f22fa406808f66203ed
0de612eae55d8699ef969a55ba60841c0c1f6a8a
22038101 F20110409_AABUSP vicenscontreras_m.pdf
0ae615f548e2f2378a99c889b64b51ce
d777fa36f9f2bd60b5d04547e69222cd78a7b158
F20110409_AABUTD vicenscontreras_m_Page_029.tif
26e491fc16fbde6ace815608d181af37
d74c0dac5e32ff85dade27d8710d135abaf4236e
50192 F20110409_AABUSQ vicenscontreras_m_Page_004.jpg
c2707431e0fa98d067ff426ec4989b2f
bb5d1c98ee375d037f408ea145567fe60af62087
76106 F20110409_AABUTE vicenscontreras_m_Page_089.jpg
a4712804e97268abfc8871c42841f412
e22f352a323c0f0d34bb18731ef004881df79bd7
92467 F20110409_AABUTF vicenscontreras_m_Page_014.jpg
256f55b62a0bcfb02d9a033356f85733
3f6dc0719459f7f15812d0c99ed182f7e4e48b72
F20110409_AABUSR vicenscontreras_m_Page_069.tif
a024500350698dd1d30bbf6a2ccf3a72
36d1674f084862ed04bb7fc7a6fa58c76305c2d1
50135 F20110409_AABUTG vicenscontreras_m_Page_107.pro
61a98b2c16806c916bd1aa9576a02e85
d4f9ec2c4d1e3e5d324ffb350717426138fc779e
1906 F20110409_AABUSS vicenscontreras_m_Page_030.txt
b6fbd953d3f60677e58750a516bd7513
61b968c644462595b8d19f0a58ada59809bf5bcc
5380 F20110409_AABUTH vicenscontreras_m_Page_097thm.jpg
ae33b803ea3ce6f1de9b52f8d93d25fc
4312538e99da4704695e275530fae89e4f5cb83d
7926 F20110409_AABUST vicenscontreras_m_Page_039thm.jpg
d8a71ed5caf6794fbd9b6183cb18cc6d
91d18bb12d4bbeb569d00710319e6dbeaa482c54
F20110409_AABUTI vicenscontreras_m_Page_009.jp2
88671f14e3e9668dbd7777c547d8099a
b14221b993f55d1928399c04cedda20c85be4527
1539 F20110409_AABUSU vicenscontreras_m_Page_090.txt
b3523bc2417339912fcbc512ca93466a
07c8969099761c24ee574231afabd986750aa31b
1051947 F20110409_AABUTJ vicenscontreras_m_Page_072.jp2
5ccc045b546a54922ec5aec4e2c98372
1594293ac1fbb35dd4a082857e6b18ee120a26bb
51215 F20110409_AABUSV vicenscontreras_m_Page_022.pro
49a7a06c71bb8a1106775a56e5db3d66
be58bb2a318792067d0d6fcf0f19f1c16167fa03
8570 F20110409_AABUTK vicenscontreras_m_Page_101thm.jpg
cf2e59d52e2fe39e3861cabd38d7b3dd
84a04d0c5ee80883876f43a9c64173dd679084a2
7557 F20110409_AABUSW vicenscontreras_m_Page_103thm.jpg
1b0aa0a9a7ff5a0a0fcdf45e036fca67
eb17ec4169920a72877f5069e6fc213c17629514
108403 F20110409_AABUTL vicenscontreras_m_Page_031.jpg
a716430133801840a26e723e0b5d7199
3d8748b179337a45bd55ecc73c0ba3afb9bfd574
1517 F20110409_AABUSX vicenscontreras_m_Page_111.txt
e7acd57ee4747d12e223de293623b2e2
49cf6bd16cfd95c845dea0e0de5901a3cb693398
1940 F20110409_AABUUA vicenscontreras_m_Page_061.txt
a8db41e53c73b71f864e6bded3223ca3
c8897cb35dd4df802f6c2727e0c30255dfa8f27f
8531 F20110409_AABUTM vicenscontreras_m_Page_061thm.jpg
f30050668bcb62f1ee97f6f05e431f12
87ac8eb68270ddc3bff40c56e3db4d446886496e
28890 F20110409_AABUSY vicenscontreras_m_Page_058.pro
c5421d9eb69f60e1550f04e87b0b98d5
03e41e4d4a973d26e7303373af1240b23a3759a6
75147 F20110409_AABUUB vicenscontreras_m_Page_106.jpg
2caecf60b061e4642cfe3479487f3b12
9438d97707370c257dc103dc09cb5ae8804942c6
32667 F20110409_AABUTN vicenscontreras_m_Page_127.QC.jpg
3b8c903a43cd9b233f77a167e55ac830
b96ff1f3e4b280c55d83c89ea1676a9e395e3ab5
40484 F20110409_AABUSZ vicenscontreras_m_Page_003.pro
f02254f0ff19f519f6b24f831e1cb1c2
43f611309cfc794464fa2b13f588ca95e637f02d
1051974 F20110409_AABUUC vicenscontreras_m_Page_038.jp2
80c49b7bda1a6e49a0fd3316cb5ff458
f5bd4c45e04baef22c6222efcd7077382dd4087b
86273 F20110409_AABUTO vicenscontreras_m_Page_023.jpg
1a051da984292747afede37c158f34f3
030bc9930e8bbdb4f93720d8ec662e189b51a11e
1437 F20110409_AABUUD vicenscontreras_m_Page_073.txt
82ad15d23d33689dfd77e31e731aae87
b9fab0aee719bf52795290ee27eeab1eb624c86f
1051978 F20110409_AABUTP vicenscontreras_m_Page_021.jp2
93b74577eacea75962f5ad8d3e0a36f3
af6a1482ebbd0ac786259a9396fbcf6a48e06466
8312 F20110409_AABUUE vicenscontreras_m_Page_060thm.jpg
bae831feb306cc8ef6c52a87b2fce179
5e7cf79c7e912d9aa6b3925b943c990ab0736b08
1486 F20110409_AABUTQ vicenscontreras_m_Page_116.txt
a57200a0ccb7641b61426c76390c1b19
d15f816b83d9ec0b75e4b43937df4b5b55c8f728
570194 F20110409_AABUUF vicenscontreras_m_Page_139.jp2
00b0f86e8e6846a9e6a171c4562dd48a
374ac1307918d47a7b9ff8c6be195615dcd98249
101592 F20110409_AABUTR vicenscontreras_m_Page_047.jpg
af98ddbe94f228432cfbde0b8c643ad9
75eb7b28e802479b18a7a76ba108f4123b83caf7
50207 F20110409_AABUUG vicenscontreras_m_Page_065.pro
5a74d53e2c2a0cb481b1dc0126da76d7
7fa38287d85de56625a813ba1c1ee9ce9be5eb02
F20110409_AABVAA vicenscontreras_m_Page_108.tif
6f247bee75cefb5722ec94869b505e14
cbdac2814acc39a21cac254ff318cce0622ebffc
F20110409_AABUUH vicenscontreras_m_Page_050.tif
0ca2c351b318df6d714d7a43e261e699
bddb4da3afdf93de9a6f9ba110c38e3c2d5b2df1
50033 F20110409_AABUTS vicenscontreras_m_Page_046.jpg
7843e008e42a2267706485d16477254d
d66194648e450be2f820b61889787e4ce3791961
F20110409_AABVAB vicenscontreras_m_Page_109.tif
cfd218908ab89c6b9cbcec4331e183f1
8b6e9cd2a9bcc823c15b579fecb08732b2d1243a
F20110409_AABUUI vicenscontreras_m_Page_100.tif
e1e33ceb2d9f0c5a009ce2660365e404
c2df864550c8c9fa99730673ab03f8bb5568ab18
8456 F20110409_AABUTT vicenscontreras_m_Page_071thm.jpg
38c2f2bfcbe5b6ee60d440add6b9795d
64f4345ad3547d2868be7328a4e295383f0a8772
F20110409_AABVAC vicenscontreras_m_Page_114.tif
8ecc82a13d513c8d1a8918c1c8d95a5d
dd39ced20a7693cca2668305b401c1e81fae4e61
98965 F20110409_AABUUJ vicenscontreras_m_Page_117.jpg
6fcb2a6bb4a55be5d7a3633413ecdf53
13f7c66d4a35a0935456494241b9597d2a7c749b
78585 F20110409_AABUTU vicenscontreras_m_Page_094.jpg
6554e98087b511b99b6040a3b82661d8
d0492bc17558eb611dccd66ba71d205427f3acd6
F20110409_AABVAD vicenscontreras_m_Page_115.tif
5eeed82455e13899ab7cd3d861e2c3b5
aa69b2534a46c87e85c9b5bb80f18b596a4c7f12
49626 F20110409_AABUUK vicenscontreras_m_Page_047.pro
bbfb0e5da103fd8d90be7ed016c6b30d
96774646b598f53dfe9fe2cfd9e31571c05c4bb8
104553 F20110409_AABUTV vicenscontreras_m_Page_101.jpg
7aec77e60178d16df45b8bb01a8a4fa5
05ce42409feb25596c4eb8b5efe75d00f7223c4d
F20110409_AABVAE vicenscontreras_m_Page_117.tif
b6d2a5e39826db61cbdd4fac9353d164
475d6882330dfac4e5b73ce07675395666908cd8
95389 F20110409_AABUUL vicenscontreras_m_Page_122.jpg
066c2e40dd5d9f6ba7d73c8618aa7ba9
cc200db57caa5795506fc577e87f6fdb2715774a
38684 F20110409_AABUTW vicenscontreras_m_Page_012.pro
5a0773692a6e33f0a1e033db0ceffa62
3c4855e65a2d64a688d8b9e712b04c715e25a34c
F20110409_AABVAF vicenscontreras_m_Page_118.tif
86df9d7c811c450a5c3d0fabc4cf0487
333e344190179806b0dfcc193616297e764d68fe
36080 F20110409_AABUVA vicenscontreras_m_Page_040.QC.jpg
96a1c7c231b80cde9f7872905a740bd7
fefc3d2bbfffbbf2a1d081dd388db0c817402fda
97872 F20110409_AABUUM vicenscontreras_m_Page_045.jpg
0f6fae0dd23b1137c28467a8466d2cd8
48009810c32e59e1e799d46c80596e334fa70f17
104803 F20110409_AABUTX vicenscontreras_m_Page_071.jpg
ba0053bbe241937e9aaf07ba4451d0cf
194201240b09470ea704d5013a012f28d6de9090
F20110409_AABVAG vicenscontreras_m_Page_120.tif
7c12064987a76c7f70a0de92077960b7
9162fb347bf639a5905908fd67532baf4ba34e0f
43612 F20110409_AABUVB vicenscontreras_m_Page_076.pro
05b473627e82054b4c60870fae68856c
4804310927b1962d0f9955385abcc0a9b40051a1
27465 F20110409_AABUUN vicenscontreras_m_Page_096.QC.jpg
b5da01e80d7f5f62934aadb2ecac2229
242ff97983bfb7a99eb83eff77a60f52b68ee54d
8372 F20110409_AABUTY vicenscontreras_m_Page_113thm.jpg
0f2e5362bf528737463831740824601b
f0880e8b7ad3fcb340a072996fb0bbe03721142e
F20110409_AABVAH vicenscontreras_m_Page_121.tif
83ae971d90bd76b5c2a30ebad1c2db03
cb2d63a8740c063336b7761265b864221dcfe877
944007 F20110409_AABUVC vicenscontreras_m_Page_007.jp2
56a4fb25802875224dea736b91b49a25
5dcc669afdf0ba7bc69e72cce9c261f179d2a65b
28389 F20110409_AABUUO vicenscontreras_m_Page_001.jpg
1b2b04cc8d91054d3bc07a3f551dc220
7e805647f0719567a13ea3dfadc2ae87e189908d
7704 F20110409_AABUTZ vicenscontreras_m_Page_099thm.jpg
2a750efadebbabc67023ccb904204879
684bef516d8825bd01f3f2f81afd7d5dcb804a17
F20110409_AABVAI vicenscontreras_m_Page_123.tif
b1beab9de336cfdd488750c58d3868c8
d055527f7f687caab696e256afd840d9da30db20
35643 F20110409_AABUUP vicenscontreras_m_Page_048.pro
6b366286c219ae0d740dab8b92666532
34b552cb830ad75d8baf61772ca8f7ea779737b1
F20110409_AABVAJ vicenscontreras_m_Page_124.tif
116a0262a16c2a44e7c6bb68411cafa2
8b2e2742e3adeeaf6ed7b0c4a71a32e2312d8596
8122 F20110409_AABUVD vicenscontreras_m_Page_043thm.jpg
20b13371fac94fdec346671b700e9b16
f363214da36aae8ef960aaecb3fe4b1724521837
48140 F20110409_AABUUQ vicenscontreras_m_Page_030.pro
3b1747998b387f36044678890cbb67ea
e08510ee5d19261c6b050acda3c47647add13826
F20110409_AABVAK vicenscontreras_m_Page_126.tif
5747b32b6c8142e765e904e10a5c510e
e008b76c3f75f81ae2b65fcaff27ea03d01e9fc7
93518 F20110409_AABUVE vicenscontreras_m_Page_113.jpg
005f852ef3affa009fb8b7511f844e63
616f0818a0763dcc9ece567df80e0216af5f5546
F20110409_AABUUR vicenscontreras_m_Page_013.tif
107826b3ccc69e26374216d4f01d1629
9d9a454dd975eadeefdca8b1418a0fa49b01abae
F20110409_AABVAL vicenscontreras_m_Page_137.tif
0b795d040e6d11f0d4d98b31c5084f1b
6e279940924aff5ca60d4e8d187c9e279f7df288
41037 F20110409_AABUVF vicenscontreras_m_Page_002.jp2
ff7de7c9a62cc0fd6456e6b8bd861a87
7d0ff7ff21b1836881e6fd3c33709479fda41917
1051945 F20110409_AABUUS vicenscontreras_m_Page_120.jp2
7eb3c96079e988bb6ec1e6e0a1530b71
d5b7447165a96ac6c66ed76a33055919b9a5312f
1977 F20110409_AABVBA vicenscontreras_m_Page_019.txt
8307ac105474300a6b937300e9d8a9b9
dd29cd4d84bc2ba85cef56076993e37ef9aa90b4
F20110409_AABVAM vicenscontreras_m_Page_139.tif
d95ee056c316d639d9fd265a7f76f55f
a98ca869e6b6c5287f6b8f5597ba48b788dd85c7
40734 F20110409_AABUVG vicenscontreras_m_Page_078.pro
90265ba5f05c7299e89731436e2dc641
1b8c2104f37338ff77d90815873661a08d5a725b
1935 F20110409_AABVBB vicenscontreras_m_Page_021.txt
a7b82e24b8ed811bf26f502910738fae
2ed11e20eba077574a1864f0ae6f0f1b29c8bc68
461 F20110409_AABVAN vicenscontreras_m_Page_001.txt
e96944b69dc45bfdff80cd8b1ff3996f
87388bc8b652c10afcf397e8f71ac0bbe6bfd524
33374 F20110409_AABUVH vicenscontreras_m_Page_038.QC.jpg
c423b65d8aee812c22c0ee809da05c35
6a13e78b0b41b7aea7895a614d96eda3cd06ad4a
6467 F20110409_AABUUT vicenscontreras_m_Page_088thm.jpg
36c22531b088390a03010be6d92b9b5c
ec61e55116140cae60e81b19f1efb1c584b03c3f
2016 F20110409_AABVBC vicenscontreras_m_Page_022.txt
34ce7bbce0871d272df147e028348ba6
a4ca1c84c62d87b9d173abbd8a1ba71e4ec54b4a
1650 F20110409_AABVAO vicenscontreras_m_Page_003.txt
afcb1aef1ebcb7a3b48bf528a0809458
af6d2f8a48cb1760102f2857072ee0bb06a8d6c4
1985 F20110409_AABUVI vicenscontreras_m_Page_119.txt
647ba4a2dccbeff6ebee7906dfc49f9e
33e5ff9780cb423bc0b03e923e3d1931cb8a4a9c
34412 F20110409_AABUUU vicenscontreras_m_Page_057.QC.jpg
0e560494053b5455c458f7bd7ca40035
dfc789b6e0cba440445ac67eddf76b98c752635b
1534 F20110409_AABVBD vicenscontreras_m_Page_023.txt
a1b296abf93fb35c23decc1af2fad5de
11520ba655cccbba0ca10c0434fb587c6ed3fd56
956 F20110409_AABVAP vicenscontreras_m_Page_004.txt
40356d76fb8a1c0409dd084cad1c80d2
273d7aceefc4f73961165868d5faed6ba5ca904a
91866 F20110409_AABUVJ vicenscontreras_m_Page_059.jpg
74fc7b5085b682018eadaf611e31f4a0
a1ff5697a05772c90ed6647f5a48b2e688670175
49217 F20110409_AABUUV vicenscontreras_m_Page_060.pro
0d82bb65a6adf1c3350314155c63fc17
001d64f1814943adc08a100b17d59ef56ca4ac20
1929 F20110409_AABVBE vicenscontreras_m_Page_024.txt
9245b770b01be51bf2d0680942e5d526
8dd6b6a931bdeb554d668d674b5cd850670270cc
2759 F20110409_AABVAQ vicenscontreras_m_Page_005.txt
f49663f38b3635c5eba4cb91d705925b
eaa943be64789cb90f61b2fc0e26faaa0c18a7c2
F20110409_AABUVK vicenscontreras_m_Page_128.tif
733784e041862bf109a1c5dcadc65b2b
b4334668ec0fc8c37b2d9e4dde9b36fb29f3b099
1515 F20110409_AABUUW vicenscontreras_m_Page_096.txt
ff57038e1f6bed038cf93efa4f48a330
4767cfbf9a60940b635e5f9f1d33ae9f0ee53486
1837 F20110409_AABVBF vicenscontreras_m_Page_025.txt
70fee9cb872dd14c3196db827b3b1e5c
1104eb362c7cbeac63dddd1ec378a4674c5137d0
3348 F20110409_AABVAR vicenscontreras_m_Page_006.txt
3ac076ff9eb4cd8c89b6f7e326212792
825aed3876f318bb0b42f2b8389f0a45cbdf4d2d
64590 F20110409_AABUVL vicenscontreras_m_Page_033.jpg
0aad84fe45255d5264a655d95d091354
82205894baba511f182efd3640adbcee68327faa
28175 F20110409_AABUUX vicenscontreras_m_Page_093.pro
4c988c8aff6b8147d72439a4a8a31c97
872722e927b91d4530978f2c544811556b0050af
2083 F20110409_AABVBG vicenscontreras_m_Page_031.txt
e2e3f70697dad9a6ba82ba4996d6919f
a799777faf0d02d1030f5406a5f3afc80652ac11
49541 F20110409_AABUWA vicenscontreras_m_Page_130.pro
4014f6082b7601256c1b4b5bb6f97b6f
205cb46a2a0fe5a6b752b0be619b2f7337aafa55
1093 F20110409_AABVAS vicenscontreras_m_Page_007.txt
8d8bdc71a1fe70a2fe476f73fdf92c73
f56208bcae83d63a8422a1f4b6bbbb1db789387a
8152 F20110409_AABUVM vicenscontreras_m_Page_069thm.jpg
fc0f1e79a46275c846c47a6e024a63d2
57e9a5f3ca571c1741d76e776e28de91dad61b34
35794 F20110409_AABUUY vicenscontreras_m_Page_017.pro
4c0ed95811166e546700cb485fbff01a
ddec27391a5c79208dfcf5416a4f712c094fd57d
1672 F20110409_AABVBH vicenscontreras_m_Page_032.txt
5bf1dbbf72479848d8f06eaa091c5cfc
5f9e968ca10f307f6f70c743f60305436021be6e
1051981 F20110409_AABUWB vicenscontreras_m_Page_096.jp2
3d0e81582f2c36bfd60a14a64415cc71
f783827a9a00fe991272b4521281eb6344d32f77
851 F20110409_AABVAT vicenscontreras_m_Page_008.txt
7111d3b15caa16699a17e2eb4a63a09f
36da3eac1fbb64bf5145c911425d619c9a4c85fa
F20110409_AABUVN vicenscontreras_m_Page_077.tif
fa4192c807e233768857d4df627a1b19
a5843fed9fd56dae3a841c3f3c92570d4fe59259
104090 F20110409_AABUUZ vicenscontreras_m_Page_131.jpg
214efa6a052883642f15ee284467b829
3735146d97799744fbdee0a418bdc4b19fc6d9aa
1187 F20110409_AABVBI vicenscontreras_m_Page_033.txt
562ac1c98f8361af3abf520aa1e8f3e0
6f779cacd5e6c5572a3bb623e6e451982cab4d7b
16920 F20110409_AABUWC vicenscontreras_m_Page_004.QC.jpg
1bd3c82d92fe9bef2e22f03575b4dcf0
c92693c528101b94f32b74de32a478c85ce066fd
2407 F20110409_AABVAU vicenscontreras_m_Page_010.txt
4f1007abc29d5ac16b8560f9fe534afb
58dc17b47bc66a503e8b4c63f36148e65bb2c820
51138 F20110409_AABUVO vicenscontreras_m_Page_071.pro
b47c2dc73c8a5d4bc28e3f50a506508d
cd6374ead2ac374706ad0bcaedd76e1aee3e0d81
1750 F20110409_AABVBJ vicenscontreras_m_Page_034.txt
1c5ad3debd9bd23780b3f3b26f086f41
89c2c1fba5da470991f1d403fdd10fa213b7a3dd
101315 F20110409_AABUWD vicenscontreras_m_Page_043.jpg
9c28cda8c7f396d26d30ba7213a40791
c5fc8f76430efbfad4cae55b08f63f1e6ed041e5
1026 F20110409_AABVAV vicenscontreras_m_Page_011.txt
9cbfccb5aeb832bf13f4e0e82d0137ea
551561715daf264c36bd70c748fe0ba0a4bd2f0a
18305 F20110409_AABUVP vicenscontreras_m_Page_046.pro
f0ab6473558c3e0f819f5fc01440211f
05006d0900f5d3357cc2f1e0a6fe805dbc4bfff7
1979 F20110409_AABVBK vicenscontreras_m_Page_035.txt
72eae75ef16204846bf85a562b7a8d9c
9b678d9dc3ae7cb40e3eab03d0f79d50986a41de
51653 F20110409_AABUWE vicenscontreras_m_Page_007.jpg
7437b11de7d104955beb5f3702a73984
dfb0bdee284f064ff72f5f05fd32e5b79c938ead
1686 F20110409_AABVAW vicenscontreras_m_Page_012.txt
7f786d404c9cf696451329074621a8cd
fbbcc0f2b062afd69e37f4dfad2d580b636c4784
1495 F20110409_AABUVQ vicenscontreras_m_Page_132.txt
771d691987853f5ab7b0f58005724612
f1e192f1f7286845d7f8c27375169b7e891747ee
1846 F20110409_AABVBL vicenscontreras_m_Page_036.txt
3a177efffebe065085a11ebd88633077
15e29347a389e31f071fc45d85d704d148ace13f
8309 F20110409_AABUWF vicenscontreras_m_Page_080thm.jpg
e60cedc331a58bbf8ae1cdb3f2ea6210
9665bd040776f64601be409780aa3aca43d26507
1460 F20110409_AABVAX vicenscontreras_m_Page_013.txt
2bcd6f3056e5e74add5e3d309401d52a
d0ff5c7aeab024648a180539f3662ec46174f1b7
908313 F20110409_AABUVR vicenscontreras_m_Page_084.jp2
d42ad530b525a7d5240d3e361e4a50cd
d0ae37dc27abd463d711ef959afbebc66c63e19a
1939 F20110409_AABVBM vicenscontreras_m_Page_037.txt
9ee44b65f0d024a6f615f19f7bb36036
b5ce1148e445a0bda727d98d0672b8f222848420
84056 F20110409_AABUWG vicenscontreras_m_Page_003.jpg
55d034ccc3ae991be62f3da49e43b146
c2686468931219d877409bac6f55348e65cc6593
1986 F20110409_AABVAY vicenscontreras_m_Page_015.txt
bb67667b58f005384a0dd75b671bede0
bf05c6818fb071a0247d04cb8fb0646ae8c525d2
61423 F20110409_AABUVS vicenscontreras_m_Page_058.jpg
8208a927c5345c0cd4a74657c640f1cd
2209146cf0a7fe708cadc6097960d34ae32adfb5
1820 F20110409_AABVCA vicenscontreras_m_Page_066.txt
e622a8e3063318b1e5204fcd5be5043f
04b49ec19efa7a8dda4b674fb58705be1051c5c0
1841 F20110409_AABVBN vicenscontreras_m_Page_038.txt
fc5f52f8d834308b29e304c5fd10a297
0f7853731244cf81de8880f2a02fc9f71696bfa4
1889 F20110409_AABUWH vicenscontreras_m_Page_103.txt
0daf1e4161af672bcd12ee40fd5ee40e
19a9e79a191853e27330ea815132111d66ad3b62
2019 F20110409_AABVAZ vicenscontreras_m_Page_016.txt
d80537e3c1466948f642981df7e7619a
1a848c37efb06d9a603597a9e2f31dc7664e332c
1051977 F20110409_AABUVT vicenscontreras_m_Page_056.jp2
e3c30d7f9aa72432e90bb92ec613d10e
3d145f6db8031d414b988a3b72a049af7585d97d
1433 F20110409_AABVCB vicenscontreras_m_Page_067.txt
63cc2b7d5aba3c408b2d6479943d19c4
9340caca89a5cc0aaf6b1a417c33405f1d276a0e
1909 F20110409_AABVBO vicenscontreras_m_Page_039.txt
00904e6465c83ce41ca44afb5d79168f
8b99312de6eb50dbf6af5129b7115e9cf8f37076
566331 F20110409_AABUWI vicenscontreras_m_Page_054.jp2
6ca0ab684b9c4e569e4fae5bf4023c66
4298ec6bb87982b8fb0ff3cfff4061120fb6024f
1898 F20110409_AABVCC vicenscontreras_m_Page_069.txt
5de9b88e908e1b14986732a97c0f6398
32e24f15ceb921605ee0fb085a9381d8d98e1ed5
2112 F20110409_AABVBP vicenscontreras_m_Page_040.txt
9aa96744eaa2af5c95f798d2a51755bb
264e246c70f5e36f3704d2fed501a1862e69c5d3
5184 F20110409_AABUWJ vicenscontreras_m_Page_075thm.jpg
c3cdbe6ed932ddbaf36168f263a89814
01e82fe0609e5a26ee4dac281eafd38bde27a5b9
F20110409_AABUVU vicenscontreras_m_Page_063.tif
f6e63d4a69ee58e3770fea0103378425
579f64339c97c0d0c337929d6088479478d0bff6
1230 F20110409_AABVCD vicenscontreras_m_Page_070.txt
f39a46fed8de97f601d07df494f24248
c328b78fe1bc50b54411ef97c9f5469e9d365468
1383 F20110409_AABVBQ vicenscontreras_m_Page_041.txt
f7d7840508d23e3ec2acc0d2c420770a
09a4e0f771919b173752bc24167267bc7bdff149
34181 F20110409_AABUWK vicenscontreras_m_Page_104.QC.jpg
6b2a7dc5ece985f5dc763e030f593f6b
cf0f08f92d7d6a9c6f2ddcdd88aeae67b3c3f3bc
43804 F20110409_AABUVV vicenscontreras_m_Page_008.jpg
803926d64905b29c47fdc7334f92d3b1
30b83cb6789aa655a5cb98e889fc9c08d3973480
1922 F20110409_AABVCE vicenscontreras_m_Page_072.txt
8723c68ec74cbaf4dc3bc1b2f8f0ffc7
bab1f31886d87f9e2fadffdb424b51190a207efd
1811 F20110409_AABVBR vicenscontreras_m_Page_042.txt
bbc949e87223c48c2ab2e583f176b5b1
38208ef4516afbef347536f3263f99d86235ecb9
73458 F20110409_AABUWL vicenscontreras_m_Page_088.jpg
9b253d7d0ed274121f7b594512f788c5
5809a782c6ad44bc90461cdfd910d398b4b238fe
50349 F20110409_AABUVW vicenscontreras_m_Page_027.pro
6b7c9d437aab7e0724e83c36000e4614
b4cf49fda80c3ef02e7042925c1d9c7741b0468a
1528 F20110409_AABVCF vicenscontreras_m_Page_074.txt
abbdeeb72718561cd3e03e5122d335c2
2594ed8af2f7cdb1281ce86257b8aa792c3666a7
8401 F20110409_AABUXA vicenscontreras_m_Page_055thm.jpg
03590698a4f7e82593057bf0763cbb8c
71bdd48ca49bb875cfb2ff122e32386c69996cc3
1888 F20110409_AABVBS vicenscontreras_m_Page_043.txt
24ac66cdfa661cf60e6e3d11d3a83eee
ddc36a220044a75067d33b2898a158247d6c1d42
34189 F20110409_AABUWM vicenscontreras_m_Page_100.QC.jpg
8573fccab423607c403a91a54c3a9af0
b7e0bba7d1697676c119cd8820f52f4264874187
1048409 F20110409_AABUVX vicenscontreras_m_Page_122.jp2
464b6b813140b5ca28cc49887e659d21
7cc34ea61cdff2a2c2d2c7f5d0e7debce2a9fbce
1246 F20110409_AABVCG vicenscontreras_m_Page_075.txt
2d4628f0323c518a08dafb48e4fe2f37
112f93fca02f2643b9282fb0e04c54bfcb07cd9e
F20110409_AABUXB vicenscontreras_m_Page_112.jp2
10f03eeb8fc55ceb7386330ac01a6397
186399ab501f8653deaead4978976211e672fa24
1728 F20110409_AABVBT vicenscontreras_m_Page_044.txt
9ed8338bd22df2442bf640ed6356ba4a
974309d4c4f437f6e99e903d7cfb5c624b87c774
F20110409_AABUWN vicenscontreras_m_Page_068.txt
223e2131dd6dd44bc0d3b3279c0dc93a
7b6761552a08c3316c93b07173285bb422ebc313
24431 F20110409_AABUVY vicenscontreras_m_Page_139.pro
2b36e359060bc95bf50ad4f0fc192b36
985196299dafdc84abcb5f3fc7cf59509754e4c8
F20110409_AABVCH vicenscontreras_m_Page_077.txt
32ec90f8979107df1422df3287877a33
de5b0f6ec7eb43c946c296ba00434ba067f5fa62
6922 F20110409_AABUXC vicenscontreras_m_Page_106thm.jpg
fc78243efb1e4193ce585062c2eebb23
e4af3d1c2d43a89a0637262601adb3b6b59d0128
1954 F20110409_AABVBU vicenscontreras_m_Page_047.txt
a034b4d6b507f944e2adb677a9afd6d3
b4b860c27d369538f1ff24f55eb0266f2ee7403d
89573 F20110409_AABUWO vicenscontreras_m_Page_026.jpg
83f4dfde2a586e54d369357fe8265778
6b54d03a120a640a871db4a458a8c0d3e5bc38d9
1051960 F20110409_AABUVZ vicenscontreras_m_Page_039.jp2
ec488bdc5f7c459fa4926435bdc97908
f60b72d6d3ea190eb5b660b7b1dcaf528af774fb
2002 F20110409_AABVCI vicenscontreras_m_Page_079.txt
47075df5ba3254471e563aa38456f7b4
657c878903f303a807bd0b30cea5ac75299af697
F20110409_AABUXD vicenscontreras_m_Page_017.tif
f91052dc4104dc35051d774f49927a5d
f99fb506aaf77ef68ca0c1ea93c94b0d5a6ca842
2000 F20110409_AABVBV vicenscontreras_m_Page_049.txt
bf1e332e0a8c2db84629fd6e2e85e03c
5925508deb119714d5dcba577b016670e15b7231
4218 F20110409_AABUWP vicenscontreras_m_Page_004thm.jpg
0633708e88ad20fe4affc684445bce79
607c048d54fd87a3bec094ad9ddd46ceb890c277
2041 F20110409_AABVCJ vicenscontreras_m_Page_080.txt
6c57dd70aa92a4828fd3caf096352cd4
8a4f37223549ae0474377486a2dc830b064f83d6
F20110409_AABUXE vicenscontreras_m_Page_006.tif
5352690658aa2043c8318f02737d3f7b
fc86f238a5b1822bd942860fbef2c10e107e7c1a
1454 F20110409_AABVBW vicenscontreras_m_Page_051.txt
57948df9a861580d22ecd1de1bd20755
b384f2a1f9f5c1df8514ebee509c2292ec32dbe8
103650 F20110409_AABUWQ vicenscontreras_m_Page_126.jpg
982ecccc5b946d1a2912610d96d140b1
dd3c08e23c3794217acdf3cf32776ba0f3d6699e
F20110409_AABVCK vicenscontreras_m_Page_081.txt
27a2f40525e7820dadef0b5e4cf68957
aa9dc0fd22eb073e41ee9b0a039309e549001f36
51837 F20110409_AABUXF vicenscontreras_m_Page_087.jpg
55259a7c1f4d98997f8abb6af3c10fd9
bf54b6299a86c8fd7fd03a51e33882e037e1e9db
1152 F20110409_AABVBX vicenscontreras_m_Page_058.txt
9990cafbf6e5d31d6e35c3a2aec58bf4
21c1cd7c24aae7919e2c8cdb18623a335c2b69d0
1564 F20110409_AABUWR vicenscontreras_m_Page_048.txt
a84650a2613575660c5e0a2e953ae948
74e3303777bf18cdbf39f99c9e0ae280d476cf2f
1775 F20110409_AABVDA vicenscontreras_m_Page_113.txt
27c39f32a8b22a6540a22f23691f7a96
c2d2b07acca7949cdf0a71b40f940af87492a1ef
1605 F20110409_AABVCL vicenscontreras_m_Page_084.txt
f30ad824813013463fc5db5a6d98da4e
ffff0f5bc2fa30afcbbaa3b520d47567a27a6cf7
F20110409_AABUXG vicenscontreras_m_Page_056.tif
140e8168b11ce8e0c5f6d089a3fc6b34
025db0c9f663af8c6e1bdc518f7ed7079646128b
1822 F20110409_AABVBY vicenscontreras_m_Page_059.txt
7d7d9636b196a621e2601dbaa45b8f20
eb35e136c85690f8b40ba580e6c2f3d447333b95
860 F20110409_AABUWS vicenscontreras_m_Page_097.txt
6b5c69c29b770e57e3d5f206c2eb09e9
a08ed42a370e50bdd08ce5292fbffdb3dad72a0a
1577 F20110409_AABVCM vicenscontreras_m_Page_086.txt
ccb3f1f08c87b60d2256420853ccfe2d
3491547c3a868c24292bf2409dad00377ebfc52f
F20110409_AABUXH vicenscontreras_m_Page_081.tif
e0757a36a29c539fdd3a39a5342749f7
573a40f61a827808bf3ecaa74e9e4536f8d3321f
1877 F20110409_AABVBZ vicenscontreras_m_Page_063.txt
fbe17793f1c82a8979b2dce0efa83506
2103950b8ec9c79f5597c33e1ecc4e6f3229c3d6
5527 F20110409_AABUWT vicenscontreras_m_Page_050thm.jpg
ce3e3069e0ad1703de6f93b2b7bf1cf1
48cddad3f9cee5e75c1a2ec650b50ba8bf8d7a68
1902 F20110409_AABVDB vicenscontreras_m_Page_117.txt
1639ffdd2f24b5afae3c3607cf73fd0d
4eafa3f3aea33c010013f8b4fa7cf23f4779a96b
1183 F20110409_AABVCN vicenscontreras_m_Page_088.txt
3b65708a6727817ad39e1142af0a4c38
5568e7e3b49ef899974cf0f2f370084ca5143d2d
50121 F20110409_AABUXI vicenscontreras_m_Page_020.pro
eac4442c3749e6c687402bf22c9508d9
478d051266eaecf72bcad8392c241c74ef8e4b1b
29730 F20110409_AABUWU vicenscontreras_m_Page_059.QC.jpg
04149944bceba568848efd64c53a6b9a
fa8d0edb1b79245d02ee3ae37266f6d766f49d36
277 F20110409_AABVDC vicenscontreras_m_Page_124.txt
bc1efc282097d8db3cf94a5eacb080c7
bd82e921c02597d8aac056522803f6f18a758b17
1345 F20110409_AABVCO vicenscontreras_m_Page_093.txt
88f5e3a9fa8ec529cf56029c5e4899e2
a76b940a876ea1d7e67fababca7b63d8ac2ae8f9
1967 F20110409_AABUXJ vicenscontreras_m_Page_136.txt
e687b9f77d9aac6b35845432d65a7660
50aa4a3a4ac7d1ee0231425890d917aa7d17ef2e
1817 F20110409_AABVDD vicenscontreras_m_Page_125.txt
ad7200814c34049e91b0a28200591cab
732a3954f38eca9a8127d49f020d096fcc242847
1482 F20110409_AABVCP vicenscontreras_m_Page_094.txt
45f7a10637a2ea092bb7fcf9239d61b5
61eb343a9526353c1f6f983606d648b4a590c927
46785 F20110409_AABUXK vicenscontreras_m_Page_045.pro
b732c4d779367b013cc1662b9558199d
a648cd0f6b3fbee17aca609306e1f3fe85523707
F20110409_AABUWV vicenscontreras_m_Page_031.tif
bf0f69172184e9e8de7e75a76bb8fbb5
9c6e3c46810ec32da17f106ddeec0354027e8cc4
1994 F20110409_AABVDE vicenscontreras_m_Page_126.txt
fc96ee54f9659500ad64dfbac80fcbd7
ea939196a3873660f839710fe58a73e5def91676
705 F20110409_AABVCQ vicenscontreras_m_Page_095.txt
95aae2d958223ea91fb3863d51d3090c
10f63e336102f70b5de61d98b4486b83d4a9c737
905968 F20110409_AABUXL vicenscontreras_m_Page_003.jp2
6aea04daade565c6513869e1170440df
d501d6ca8d36b6bc974f47b82d8a55deae953dd3
7983 F20110409_AABUWW vicenscontreras_m_Page_068thm.jpg
f9e203c561b4299213cb997bad0b207b
884f4bf32b13d88b1f18ccc705477ee4a864275f
2018 F20110409_AABVDF vicenscontreras_m_Page_128.txt
755c9620752e91bb5b9975b1b972f840
7bcdc25d157386e49c22ee2cb1d0eab3434c2d85
1971 F20110409_AABVCR vicenscontreras_m_Page_100.txt
3a4f7e4471ac963d4ce8f524d6e3f437
bdf0977fd4561a1bbf6fa02269e2c78461e09527
98609 F20110409_AABUXM vicenscontreras_m_Page_134.jpg
0c10f4cbb69c951e0b905b938759156f
094d13dcb459d31cc038a1c937907fee63683eaf
F20110409_AABUWX vicenscontreras_m_Page_065.txt
56d19509315539875b731f87722e07ff
3798387be37a06cb1c5a4dd4c9dc5c45c4928309
1984 F20110409_AABVDG vicenscontreras_m_Page_129.txt
3fe85e3e34fcf64304e1386cbb22d356
a3601c74065a9c388b776c4d69c00032825da8be
F20110409_AABUYA vicenscontreras_m_Page_018.tif
f16002207689fabe6ce64fff6f129678
7dfcafe813eb04d3ec356dee1547a0a181f30532
2006 F20110409_AABVCS vicenscontreras_m_Page_101.txt
ef15c0346fc59ceaf2e5b8b3ba2ccb93
9706be680f963c5a09a577acf97901b603607d9c
F20110409_AABUXN vicenscontreras_m_Page_087.tif
fb9dcbe7b9b4606c06ca2a1c68ea64ee
cf78d6f62223f3ffcf863d0fb222e6d2dff71dbe
F20110409_AABUWY vicenscontreras_m_Page_095.jp2
f1c1dc53dcc234b23131f092bd2f9e5b
4a1eab2a6ae0f718daa05ba5f9144d050be8b931
1991 F20110409_AABVDH vicenscontreras_m_Page_130.txt
1e188fe6273d2550481dcd34425c995b
dc5df5937a4e8dbccf0a82b014ee8a1fb8d4605f
F20110409_AABUYB vicenscontreras_m_Page_019.tif
36196814df8d95f468538945b7441c0e
1c93fe69be3804ff1b858d27a9359455f81b0a5d
1607 F20110409_AABVCT vicenscontreras_m_Page_105.txt
0b3a6fd8bffbab8b3a39d15197ed30b6
ec5c0687232527f41d87fd0155cb19b02c2b1851
99045 F20110409_AABUXO vicenscontreras_m_Page_024.jpg
04419cef605196a24d2186d6bf4660a0
7e084dd87df560de17f3500ba49b2f67832dc30e
102551 F20110409_AABUWZ vicenscontreras_m_Page_035.jpg
7910fd8268870e521d2d6b6ac1dd7b4f
0d19f02ac126ccaf50ea9377f85d886cfbf6ceb3
2187 F20110409_AABVDI vicenscontreras_m_Page_135.txt
e43c4fcd2a15a0670e5dbe9d75396148
480f91814b1af61eea780aa7058fd75e955d67ce
F20110409_AABUYC vicenscontreras_m_Page_024.tif
5c972d786574b23a95e61c7d90b46410
057a889b41b19a73073228a3d1b9ac42e918c4d5
1355 F20110409_AABVCU vicenscontreras_m_Page_106.txt
6b093313eb5aa138d34faf39d31c13ce
0801ed4c978246a7f15103a4dd09c0e6c27109ad
233478 F20110409_AABUXP UFE0011464_00001.xml FULL
2efa5a011558606f649d2c4895af1c3a
490c69ffc8052e82a82056de90074a6c9e454821
760 F20110409_AABVDJ vicenscontreras_m_Page_138.txt
88c9c678cbdb378fdb9a80878315d355
a36e61cd292a4467c3f2264023a53530fe22053b
F20110409_AABUYD vicenscontreras_m_Page_025.tif
3bc8d7096c6182dd3335f92d903fb48e
7a15474192902eaab00152691b85028117dc60a9
1974 F20110409_AABVCV vicenscontreras_m_Page_107.txt
36ca671852666353f2a1b58ebb1c8ed6
a868b5ddb43a9a554288849224401e986fde8912
1019 F20110409_AABVDK vicenscontreras_m_Page_139.txt
9a1d32dc106b26fafb200b3a48086bec
c0dbee51b5216069bafbdab719c3fc0735765030
F20110409_AABUYE vicenscontreras_m_Page_026.tif
ebe0eaf605581ac7a2525a9650fe15cb
37cc6c60c28b9926f757580cd8e77f7ee7165f55
1980 F20110409_AABVCW vicenscontreras_m_Page_108.txt
06e222415e298748516552711c9feb90
21dc12997bc89adb92650cb9188cf0e4dcdac46d
41484 F20110409_AABVEA vicenscontreras_m_Page_032.pro
283c750fd30b57e941b21096c82a63ce
7f2631bd52327fb07961ae616c101823eb77f987
9116 F20110409_AABVDL vicenscontreras_m_Page_001.pro
8e2fa18a35c5abb3a20442d62960d4f1
9ce035e24fdf3ca8fcb6afbef423c4ce9109b341
F20110409_AABUYF vicenscontreras_m_Page_027.tif
26dca8f0b408b91ba7a7b5a9f8a083de
951f8fd04ce2de30c677a522e62196ff26a51c5d
1299 F20110409_AABVCX vicenscontreras_m_Page_109.txt
7182846430a5e55ad6e1b186043e64b0
7dcdf4acb12f2ed23cffd3a9a898746bc966d9ac
F20110409_AABUXS vicenscontreras_m_Page_001.tif
f531f4828c88f12914f4a289f16aef5c
38b0373eebe12fd89d1a9933c15ac6ed9a12f9e0
42102 F20110409_AABVEB vicenscontreras_m_Page_034.pro
65756179f83a56de1e4b896bf22ac2d7
58486965d7abc1a695ce2e7d6889604b1bf1af19
1545 F20110409_AABVDM vicenscontreras_m_Page_002.pro
d1968dc6c1a5b8eff4431f050260b4be
8eec14e4fb12b1d18d3c26c669e969ca27b39758
F20110409_AABUYG vicenscontreras_m_Page_030.tif
58fd076b2e477810d4e9db1dff6bd1fd
3dd4b1a116d962330a0980e2c282801fb492819e
1549 F20110409_AABVCY vicenscontreras_m_Page_110.txt
4462ef1efd95886c3b7c886f9105dfd3
31b42b4a0cc0beb0e2957c6316595d14be24afaa
F20110409_AABUXT vicenscontreras_m_Page_002.tif
9554a3eb0035c911fa6639fa31f34bf3
1a9f9800c73d2ad13eed53d1e43b3f83b6d40bd5
23493 F20110409_AABVDN vicenscontreras_m_Page_004.pro
4aca0fcdc001e50368629d3cfd9040d5
b76c75ce5c1c99fe46f4716d6804bf2473a37f47
F20110409_AABUYH vicenscontreras_m_Page_032.tif
f1ee9ea63e1a50bee948273ee432958b
66aba5f016bd28d2bdb41686f4acf122dd9f946b
1858 F20110409_AABVCZ vicenscontreras_m_Page_112.txt
459a7ffb98586dc4fb6ed8a9e55466b7
7070d2dc6319c722440988366b2472c8fdf59926
F20110409_AABUXU vicenscontreras_m_Page_003.tif
67be24f3d53b55d72d7b544be975ce58
73b3410742df0b4e3d92e701d44593b7ca269090
50413 F20110409_AABVEC vicenscontreras_m_Page_035.pro
d0dff4e7084861206506ae6d624e9c5c
bc7b37314f1058e8fce52b8dfd345bb07e60d6f0
63587 F20110409_AABVDO vicenscontreras_m_Page_005.pro
089c2deddc39d83cd18ba56a636730bf
b19c2653ff39380127e8b920194f030bb8e09111
F20110409_AABUYI vicenscontreras_m_Page_033.tif
ce5250fc831b24bdc690a45de7affc35
9992abb6fae11015cb962b6cafed9439fc5abec5
F20110409_AABUXV vicenscontreras_m_Page_005.tif
512ab4323938ba70672b992fa7c844b9
b2e77a16bb2b119f962daf5e3df3b6dbaf380cfb
46082 F20110409_AABVED vicenscontreras_m_Page_036.pro
0c1d5a5d1d66c132a08dd13e322e9556
37222a16a40dbe928eabfa04847a77bc159383c5
79409 F20110409_AABVDP vicenscontreras_m_Page_006.pro
9bc9ea42ee9f2e6ce690488802dac6f5
f3b95ee756ba38f17759ef36b64be710d15e868f
F20110409_AABUYJ vicenscontreras_m_Page_034.tif
3dd9596835f31d4d05537e913c797217
82aaf43971dfcc2a5e50fcb31208367976a3d5b9
49274 F20110409_AABVEE vicenscontreras_m_Page_037.pro
ba077ba293b5df6bf9f3f76d3ed1bb75
1c982d5e56fde7caebee0e4e6c50bc1b88fd1eee
19926 F20110409_AABVDQ vicenscontreras_m_Page_008.pro
2c32fcfbab3808fd086d6781907f4fa6
27539e8c8f3f9a185b86de34a734de9133c2df1d
F20110409_AABUYK vicenscontreras_m_Page_035.tif
f6c3b8ce94c0a9f3516f185735d0c09f
ad4334f259a505d101eb9d993fbcd4289971eba0
F20110409_AABUXW vicenscontreras_m_Page_009.tif
3dcbe14fa1dcaa57832b6ffa4debfa07
48f89b41aa5362c8156e1c9715e08da8e01b4510
46705 F20110409_AABVEF vicenscontreras_m_Page_038.pro
d8136e746eb96a1f5188156f5bb7b211
bff50e7ea0ba5600b8c649d11bc6d11370ae1e7c
50131 F20110409_AABVDR vicenscontreras_m_Page_009.pro
79e38021cff5dd7bcd9c8245d71a3404
7bdc4f680ade876233ba6794fecdb1dcd14d709e
F20110409_AABUYL vicenscontreras_m_Page_037.tif
349ec03e1946f4c2c5eabf5670b9ec75
7fc0d08907114d5c90d99f87a864ec421f5aaf69
F20110409_AABUXX vicenscontreras_m_Page_010.tif
6bee23ecc23de0a084f85c59000e82d2
6b646444a8e659f4f596705912658bff93bbea30
53949 F20110409_AABVEG vicenscontreras_m_Page_040.pro
8ac33177cb89f774fad81736affd9674
c9eb8457f92c9166d1c6fb7961a6b97f23b43da8
F20110409_AABUZA vicenscontreras_m_Page_059.tif
0a939208466bd8c4e5202be669625b72
ac5f963bbde862aceec7165ddff99f2b26aa57f8
24425 F20110409_AABVDS vicenscontreras_m_Page_011.pro
724bec48760089c69c6f7ba79718d7ea
120b06d256b55660b3be34e63d08855ea22baadc
F20110409_AABUYM vicenscontreras_m_Page_038.tif
8247728260d7fcde5187c8a23ba24a56
c42d2d0e941490a53c617c03181eee3a36d169ce
F20110409_AABUXY vicenscontreras_m_Page_012.tif
7a4cd07b99ffeb299481dd81e7f44232
5faa0c8422851b499ff797889bb1d8158ba5b40e
33764 F20110409_AABVEH vicenscontreras_m_Page_051.pro
dc925d790db5f5370662c0a6d0497102
90336aff2494d8457a1630d618d465fdb91ac5b2
F20110409_AABUZB vicenscontreras_m_Page_060.tif
f07913337bdc2aadf9b184a877b0fe57
87a565616153be7c412cbd689529c7c7c843b668
36424 F20110409_AABVDT vicenscontreras_m_Page_013.pro
3feec683320ae5aa3c1b7c153d20e6a0
8dd218348cc6554ca4ae605c8548da782c15acf2
F20110409_AABUYN vicenscontreras_m_Page_039.tif
7e5f7cdde5fd4a4c3b7603a3eb896ac6
529474e1a225b6fbe4ebebd52d058400a98bc920
F20110409_AABUXZ vicenscontreras_m_Page_016.tif
d877a344f301d00b7342c7160f227629
98eae2f3a80c20788a39ef4839cfd4a5c9efb824
30283 F20110409_AABVEI vicenscontreras_m_Page_052.pro
e9ac7b57766c5df443bfdc4f58acf869
ed388d0b050e723325ed9b70885b1a34b88f94eb
F20110409_AABUZC vicenscontreras_m_Page_061.tif
014c7226264bac6be26b901f38d9a80f
413a817d08c1c0d5e5508b2d6f849295293def11
45466 F20110409_AABVDU vicenscontreras_m_Page_014.pro
bfaf20bc5d8062880b05735517eb9188
c5d546c71aa64ca569b1196d646b8b2062096507
F20110409_AABUYO vicenscontreras_m_Page_041.tif
2ec43b348fc2317f16e66da7481acd33
ab94586a1ae43b62fdacb1b42dffe9595bb550c7
19057 F20110409_AABVEJ vicenscontreras_m_Page_054.pro
adb7a841ab74593d73d9168a69160fa8
719ad30034c1494a1d2f8632db095878f0c39b07
F20110409_AABUZD vicenscontreras_m_Page_066.tif
988f28fa42c1223dc9e4875364986acd
458ccafd4f71790afe675f72b8b04589ac97a07b
49680 F20110409_AABVDV vicenscontreras_m_Page_015.pro
e84613fd3ed423646165a814146d59b7
6efe4746ad4329f5e79a52edd910198b1417fec3
F20110409_AABUYP vicenscontreras_m_Page_042.tif
08a1a4ff7ba712400d9f4c8574f2bbb7
ab51b041747bcdf4eef6d3e1fdd79d751ae41fa6
48747 F20110409_AABVEK vicenscontreras_m_Page_055.pro
6fcd2443804e1906daaf7226dd5b5be5
76b178daa9e9c13f84efd6d5af8bcf34753684b5
F20110409_AABUZE vicenscontreras_m_Page_068.tif
bac7420546022e9c57c1e313d5dc2218
5a84354d3c6106484be34a18f075afd4d87520e3
49018 F20110409_AABVDW vicenscontreras_m_Page_021.pro
c5e21fa6fa5af0f965277169837e3056
c2af1d4cbe2e17e206c2d00d67537013e7adfcc2
F20110409_AABUYQ vicenscontreras_m_Page_043.tif
b1a0390676c8f922e8b7861e016457f1
a2736df38affa22a0629bd9cf8d75cd5aa854a3d
50954 F20110409_AABVEL vicenscontreras_m_Page_057.pro
58358c0eaddf5a16a448d469e03d86d8
01df5eb03bbdb5c7f6a94fdb658163bae5620a7d
F20110409_AABUZF vicenscontreras_m_Page_071.tif
b4a311a997b1e36fd31b1cfdc45bbfa5
1f22f0eebe28f245f2dda3234dbcf189d6251a2a
39786 F20110409_AABVDX vicenscontreras_m_Page_028.pro
06a588313f06b04658951712bc3cdd86
ff458ab799efc9910cb2a59d68686cceb23c99d0
F20110409_AABUYR vicenscontreras_m_Page_045.tif
56f53766510447292fb95b7402b7236f
024913ff911d61c2d46ee04f4d5128693d17883a
27519 F20110409_AABVFA vicenscontreras_m_Page_088.pro
3bce4e506272006c4f22fc10b77e7a72
4d6410f52b4ec9396d7b3d2d55b3d4f8699e0783
43587 F20110409_AABVEM vicenscontreras_m_Page_059.pro
bbbf12b9827b100f366342e797c4e47c
66bf7c4567c5b552d0571bfbe15309f32e380d58
F20110409_AABUZG vicenscontreras_m_Page_072.tif
f2a9a9d42bbe57b8af426cd673c6d849
812493873fcb22081cbd918f16e8659d715d43fa
51150 F20110409_AABVDY vicenscontreras_m_Page_029.pro
c8c19ce4af405d5461fafdc18dca0658
49fcaa6bc4db474448c7ec2f154926e3e2a01985
F20110409_AABUYS vicenscontreras_m_Page_046.tif
5f0ff69f8dc0f8f87321daf2a2900ce0
98195110593235e28e028b674dd0079b732ef26d
31609 F20110409_AABVFB vicenscontreras_m_Page_089.pro
fcff2953841a8485ab70c0d1bea2f367
2b7799d7c588c23a5648b5bbee10cb14c12c1b38
49027 F20110409_AABVEN vicenscontreras_m_Page_062.pro
b6d5cb9c7841cf31ef0f5ad49aebb600
1078e3849c8237350e45423eeabdec914da6e0b0
F20110409_AABUZH vicenscontreras_m_Page_073.tif
fb3b930eed1992300dd441db0d1820d0
11276384775456be4d4bfb5a12d1f9d142c063b3
52796 F20110409_AABVDZ vicenscontreras_m_Page_031.pro
a5f8b1c4c6ecd50ce70510dc9444a152
5217be9e4f1f80a4fad4e5ca25bdde5298b9f589
F20110409_AABUYT vicenscontreras_m_Page_051.tif
058fbd9a13176629bd92ead496a85cbd
4540c8da4a01c8185c2afc28e00a8f5b50138a5e
33716 F20110409_AABVFC vicenscontreras_m_Page_090.pro
0897ab190aef2d39201531215d06a061
45a09de2ae314f58149233282a0cb0c29c434a9a
47590 F20110409_AABVEO vicenscontreras_m_Page_063.pro
d1602fe147692adacdb90b3a2430eca1
8f29f9dacef4f4f283d2f857f0e06a912560acad
F20110409_AABUZI vicenscontreras_m_Page_074.tif
4e080a7ada53694fccac9fbfbe635d73
9648bfbe6a6079388adad73dda1f21a231f225f5
F20110409_AABUYU vicenscontreras_m_Page_052.tif
bab50032729991ec73697e9c8d1efc80
d5adf5c61310e55f7d359b9058c9dca713215fca
45888 F20110409_AABVEP vicenscontreras_m_Page_066.pro
8582035fb53fde7dfa2f6e4419fbf279
753403a114508a120d11f77b53bf230020689c19
F20110409_AABUZJ vicenscontreras_m_Page_075.tif
7695e31f4b16c3581966cee5c907bef4
a2fb7d4f8d9f70d9559892cc2f996dbf219bbbc5
F20110409_AABUYV vicenscontreras_m_Page_053.tif
42b15385562765411aae4a253147b923
44e92fac116aa490fe70bfd13071da7322aa8d7b
14828 F20110409_AABVFD vicenscontreras_m_Page_095.pro
27b1e4a2c0824e1e1ee8023e61349d1c
cd1e8bab70b072f7b830d45dd9053582a61fcd82
32305 F20110409_AABVEQ vicenscontreras_m_Page_067.pro
bd4ee1ef5280ccd0d546a63326dbdf6f
036f8ac5c1298cdce4aef3e6c46691e42afd3beb
F20110409_AABUZK vicenscontreras_m_Page_079.tif
e8a38832e3f195b6232d3bc44cd2c3a1
57f27b95f58fb0ade785459719f68344876c7aff
F20110409_AABUYW vicenscontreras_m_Page_054.tif
89388585489f4ac92b10695937e5b919
8fd48e87de9812fd3cc250958bff66cdbe900106
18754 F20110409_AABVFE vicenscontreras_m_Page_097.pro
75397a5d5dd284091b6a320404eb7670
8f3424e7970a6dd8b4ec03dcd1ab90d32c612aed
49071 F20110409_AABVER vicenscontreras_m_Page_068.pro
bd3237147566aa05ba9109987959b2fe
8aa69f8c19a1add5c6a6a5150bbc5ca5e49ef236
F20110409_AABUZL vicenscontreras_m_Page_080.tif
194963e2450dbc4aac1ef239ba6e176c
33ed69d5f7224db73ae7d535b677d37174d0db60
44587 F20110409_AABVFF vicenscontreras_m_Page_099.pro
a52ed97aad73a696a02697d5eea94cf9
770267b9942c1c0df516690ece6f832caefdaf46
48122 F20110409_AABVES vicenscontreras_m_Page_069.pro
8b8a81328f5188c239ae9d2cfce2a12d
b67a130b825cdfa9fc05e9c8849538a6266a524f
F20110409_AABUZM vicenscontreras_m_Page_082.tif
50a0d8c817dbc5bec9d6994ee0a85c97
c9a71c3489194c15fe2221a756508895c2eb3142
F20110409_AABUYX vicenscontreras_m_Page_055.tif
fe8a4fa5e39bd7a1df627eac38695afd
108ae0688f07d8ebb000d1ab1a6e88e2e71a5101
51077 F20110409_AABVFG vicenscontreras_m_Page_101.pro
fb7896f6893aff436cce34cc1aedfb50
2c87208546bb5ddbc178e12c8d0bf1002d5fe5d5
24435 F20110409_AABVET vicenscontreras_m_Page_070.pro
85caac3340872cbe00759ff5fe90a14b
89140ca93230dee2640e553fcde280a9b1c99246
F20110409_AABUZN vicenscontreras_m_Page_086.tif
3b0e9cfeddf82f8e82f2c25328d5135c
eb9c12b1d64807cc06f507ac989d1d431fa8e513
F20110409_AABUYY vicenscontreras_m_Page_057.tif
13e5e99f3f8c3a75ed6f399218c3154e
42f7e99cfa0bc8c364bcf94758d79ec53e5b79e4
45469 F20110409_AABVFH vicenscontreras_m_Page_103.pro
61e3d2e478854464a756bf45cc08232c
434e4e3213e777bb9e7a26803f06f30d3cdb4263
33034 F20110409_AABVEU vicenscontreras_m_Page_073.pro
9605b3c3e2a8874e7ef378d27f44a631
9185a414bde3be2082e3cf51e4bb4c839251e3b9
F20110409_AABUZO vicenscontreras_m_Page_088.tif
1c3da1f12db647b0490257162e7bbca2
62902c65e6f02d187854cc8a1a9f273d9316fc3b
F20110409_AABUYZ vicenscontreras_m_Page_058.tif
5e2afad9b5103f84feb8aa4bc7f0a0da
b0fb1f10f69b732df4cb3d2dcd2c23df9d9f802e
50325 F20110409_AABVFI vicenscontreras_m_Page_104.pro
60003127a4ee7656b303042804905569
a27dd92e768579b6a82fcb54775b980e7d7c048a
51784 F20110409_AABVEV vicenscontreras_m_Page_080.pro
4e3486f70c05817b5e71b5d69df8893b
e9f0b857d094bb2642d77f6c1330f793111eebe3
F20110409_AABUZP vicenscontreras_m_Page_089.tif
d3ef4ad13e227cd63197eb14f7e92be3
189c43d11c3c7a26cdf55fb7f139b4f3fc7b3244
39962 F20110409_AABVFJ vicenscontreras_m_Page_105.pro
b31c8c29c328d0f3b95d232e551df9ab
42ea4046aebe3a37e5b4bdfdaa18d2b1a9c14493
47618 F20110409_AABVEW vicenscontreras_m_Page_081.pro
9ffb44fbc0abe1fbe7dcb1363122a988
0bf6150ea37cd5162bc2a994df0f0b1e948dc877
F20110409_AABUZQ vicenscontreras_m_Page_093.tif
87ad11ff49993018978fc5c291d4fcbf
ab757079b60864300c4c18c4fa8a1c1ae93b8ba6
31632 F20110409_AABVFK vicenscontreras_m_Page_106.pro
96d5e0c3dea00cade2d33ac4436e127a
1c4c5ac33125c56f9fb122febf9d0e8b008fe9b4
36048 F20110409_AABVEX vicenscontreras_m_Page_084.pro
9871845f0fd175952df1da9d453df943
93a6189cfdf9097de8c22de9691bbcbcec59a6dd
F20110409_AABUZR vicenscontreras_m_Page_094.tif
7beb93e34f55e8d7911b500f61da29cf
e6e5f64e2068298b86687e6ea3fe889123c6774d
50811 F20110409_AABVGA vicenscontreras_m_Page_131.pro
4b8034868c46d3124b9c5ac37e98d9fb
36d0ff59c12a05676b895cf181d076bfc99a07bd
49509 F20110409_AABVFL vicenscontreras_m_Page_108.pro
386594a8166e6dc05e10b3ec5c2e29f0
d31402721ea6e24f2f41b3fdebb234d9df3319f6
43843 F20110409_AABVEY vicenscontreras_m_Page_085.pro
051492ec21b7ff616c704166a7b43412
d3ca4d774b83a303b74b280718ffcc351f31f3ab
F20110409_AABUZS vicenscontreras_m_Page_095.tif
a4594afbf69b99ac31fd02c3e2bf1253
ba0e351cc4a05874c719afd9f2b49dfd9cecabea
37493 F20110409_AABVGB vicenscontreras_m_Page_132.pro
7fcda2ebf9d31f8661a69e2db4857fe6
de2c8ccd147affe89599673caf4ab846c074229f
31852 F20110409_AABVFM vicenscontreras_m_Page_109.pro
b67ccdfc91724d172e1fb1632865d379
616f992bdc26246db9a91f3125000659e1643f75
F20110409_AABUZT vicenscontreras_m_Page_096.tif
fee11ca2eb3b25fb5994645a8358c881
7d0b6c94649f178b137df060c674e60933160bc8
41795 F20110409_AABVGC vicenscontreras_m_Page_133.pro
ba4004a6bfd8ee9606526ae76c966bcd
9c1002bb9341c6132c6fbf69947ac4921ba075b0
33947 F20110409_AABVFN vicenscontreras_m_Page_110.pro
50344b4e68df307ccc52b111bf55ae3a
abf941a3af0dbc3b6e42bc5fd1063079fb4b6b9f
10599 F20110409_AABVEZ vicenscontreras_m_Page_087.pro
05215faf307014a3f7c429a1d21b5dd2
79ff67f4c276fd2d8ba9213f35d872101be888d0
F20110409_AABUZU vicenscontreras_m_Page_098.tif
aed10cf150fa831ba0347a5df8dbf8d3
04cc32bc43d9cccb4485ff44dbcc9da3e1105b7a
47897 F20110409_AABVGD vicenscontreras_m_Page_134.pro
dc0f6c343fb466f85429846e32b08b33
35c0f7e4d28c4c4213697f494ac9412306fd5e0d
35756 F20110409_AABVFO vicenscontreras_m_Page_111.pro
a73efba9f8a6377782823b6047edbefd
f4c5316cf3b67829124ec5fa2572323fb878fb29
F20110409_AABUZV vicenscontreras_m_Page_099.tif
6c5da6a06909f5bd31935dbb2c46478f
57894079568ff07eeb3ceecfd69df8a81ffa99af
41237 F20110409_AABVFP vicenscontreras_m_Page_113.pro
94fd40ffe0d700a31398a534374bbb41
03365c3e9123ee5225f34a6c4c2b57818503b43e
F20110409_AABUZW vicenscontreras_m_Page_101.tif
994df0a91f1b030aeedfd5fdca282793
65554d6cbbdc48e8def011fa4c1bc5f34ee0bac7
53347 F20110409_AABVGE vicenscontreras_m_Page_135.pro
6815a2ff88630a3cebf11be6072f2275
a70f5a8a99de0ae8efdfc7e08a4791b84d1e59ff
46455 F20110409_AABVFQ vicenscontreras_m_Page_114.pro
a7a0d16259b2cd57b927c3dac654f298
d7d59db038a879effdf6c3aaafc7e25e6207fc73
F20110409_AABUZX vicenscontreras_m_Page_102.tif
63df8cdf55a592552ceff175e5e14292
caaff7008e7a2a4be643081c6e41263a988bd662
8731 F20110409_AABVGF vicenscontreras_m_Page_001.QC.jpg
708fef8a6a59abc191ca17ba01dddd12
92fdf635179f72bf91fcfa1c84df3efce979d648
41244 F20110409_AABVFR vicenscontreras_m_Page_115.pro
8d13736e27e473e901a388d3c6517c4a
eda4bfdd30b22f64efbfc8171b3c77f06fefb4eb
5669 F20110409_AABVGG vicenscontreras_m_Page_002.jpg
5810068aeb15b3ffb9f1a5bc4af33137
24c6477214454bfe20a0f758e824382de843b0c0
48273 F20110409_AABVFS vicenscontreras_m_Page_117.pro
ec066a71803f778a8cb9bdc9d8099941
09fd27f1f45095808fd519f8edbe81f5c765d760
F20110409_AABUZY vicenscontreras_m_Page_103.tif
1dcaac8355bb0fb683307fc84c1b30a9
6566852fa6a0c3ef4fd047c51496844c2854215c
1962 F20110409_AABVGH vicenscontreras_m_Page_002.QC.jpg
b19c90409cb74c850b5a86a2abbe7c53
c29c461ab4f2682b4cf6b27ced8d1b5a4cdd1902
50386 F20110409_AABVFT vicenscontreras_m_Page_119.pro
661d74fb400d7d83a77eedb6349fac24
b8abf797dc03ec1e392b4f8a21f25dfcd2cb0b6f
F20110409_AABUZZ vicenscontreras_m_Page_105.tif
42fca3e1a9ae937a10258eb60b14a742
355f262c695b898eaf7f8386d961a8de58377c9c
28013 F20110409_AABVGI vicenscontreras_m_Page_003.QC.jpg
eff9336ab220370491bc9d68ab04806c
ab31fc9c71a75e7cc5a4a811e24a3abc7d3dac76
50400 F20110409_AABVFU vicenscontreras_m_Page_123.pro
7308f4974261c2df7cad111517d14dab
17d64c3e62667da652fb06ef4a3932485399e676
112367 F20110409_AABVGJ vicenscontreras_m_Page_005.jpg
bd6fbb6b2e37ee14c1aef39dc74f0141
709edf2ec040873e181279cde6121ae4b038e427
5919 F20110409_AABVFV vicenscontreras_m_Page_124.pro
5a41feba62ffa91d6a25ed0831737256
e3bfdcb8a2040db38ecbdf045062a024ac0fa4c4
26282 F20110409_AABVGK vicenscontreras_m_Page_005.QC.jpg
fea1c1a26244eb815b9611f199dcacef
f7855f56671918d26cf36e9303dd6780e8e4edf7
43413 F20110409_AABVFW vicenscontreras_m_Page_125.pro
01d6b2d9f0b7f383f9c0002b8bc7edff
cbeb891b3191838f88c74b7de284c787cfa39a4d
34674 F20110409_AABVGL vicenscontreras_m_Page_006.QC.jpg
cc5d24f402f4eb83ad5260a8febe2438
e83dab2bb1579c6249cc4b85a48c476790435184
50664 F20110409_AABVFX vicenscontreras_m_Page_126.pro
767ff4ec46f622554be673e9218a53f1
df3b3fb3f4b761e1d4e67a9338a77ef02c095f94
32075 F20110409_AABVHA vicenscontreras_m_Page_021.QC.jpg
005ca4e8768b28761de184cefa8923b0
97b960dc0858a2028a4e8964ae23c4129483d080
13082 F20110409_AABVGM vicenscontreras_m_Page_007.QC.jpg
3f7882911149ed45083a7448f9722461
45bd158a980cf6fa017d2e0775aab2c0b584301d
51144 F20110409_AABVFY vicenscontreras_m_Page_128.pro
458673f63c10bb92e119c9f14455121e
ce68395b4803139206d0ca1832cebccb84eb1afc
33045 F20110409_AABVHB vicenscontreras_m_Page_022.QC.jpg
3af44fa6ecd9d7d748a7910a2e7b9e36
b3fbe98e8bbb4a850a813b6ab7e9f5460eb8d4a9
122804 F20110409_AABVGN vicenscontreras_m_Page_010.jpg
7e5ef8fdab14d926898d58df1bc581d3
4473e5fe40a4c0451c9dca0ad0688c44fbdd5d60
50568 F20110409_AABVFZ vicenscontreras_m_Page_129.pro
72d1bfa932bfd941763f60ef3e09214d
b33b517c6c3e2a1c59cb79374e282f6d0d725fd2
29163 F20110409_AABVHC vicenscontreras_m_Page_023.QC.jpg
f5ba9afe18e8e755fcb59837a2334591
dafabdd7f26d74f3c03e436a3d9bbac6bd407407
33956 F20110409_AABVGO vicenscontreras_m_Page_010.QC.jpg
f48bf8b4531bfe684207938793864f90
2e47d677fc62490d08bf59d57d143a3e1c17dfda
32274 F20110409_AABVHD vicenscontreras_m_Page_024.QC.jpg
5b872581c374ef59c63f5d196b383cf5
4f33de0ac0b8a43632bc44fdc9cfffa3e4f05201
56860 F20110409_AABVGP vicenscontreras_m_Page_011.jpg
c05c7390d2476614a75f2621e88ea039
6b21886a39ac46c92045bcc5e015f009087bc5db
93248 F20110409_AABVHE vicenscontreras_m_Page_025.jpg
983cc12cb09eb7f4d6db3eba1e48d9ca
9602c7f00e3b39b9f7a63eb69e67e78af3de41a1
25910 F20110409_AABVGQ vicenscontreras_m_Page_012.QC.jpg
eed592536cc0e4f7d62e5a3571faec86
89fdb09053e442bf539cf39a5f402c93e0ae1d28
78505 F20110409_AABVGR vicenscontreras_m_Page_013.jpg
2cc67a35d4baa7e1c53cbc86e700b9a0
f7aff314ba0a6069cd304fa0aaf654480438cee7
27344 F20110409_AABVHF vicenscontreras_m_Page_026.QC.jpg
72ea3af6da6390ee6819e26bc948e27b
e9614d5baf11fd02448a358f190cb6c28b4ca6e5
25502 F20110409_AABVGS vicenscontreras_m_Page_013.QC.jpg
cef4cbc237adb3544d2a4e40b4cc83e1
ed6d9ed809d1961510deff60fd21a4ebc3e2b632
102601 F20110409_AABVHG vicenscontreras_m_Page_027.jpg
8d2792225ad766dd3adc46054b9e2849
30edc94e00c6ecfb3b76f10c5f466221ea698c19
100281 F20110409_AABVGT vicenscontreras_m_Page_015.jpg
fcf12e64bb9a89d8d2fab81613d42fdb
2a3b2383c5aeced8fb7fb318ff8518dec88e2578
33763 F20110409_AABVHH vicenscontreras_m_Page_027.QC.jpg
191b06256a69abdd1612e30732e6fe24
ed0c15bfd7702d2ddcc172fdfd0e1a1f50aa5bdd
104343 F20110409_AABVGU vicenscontreras_m_Page_016.jpg
3ada9e2110976a3aee3783aef8429d19
6913d464feec384b6e79787b2161b1a8be73ad68
30891 F20110409_AABVHI vicenscontreras_m_Page_028.QC.jpg
cb071b13e175d7beca1871e2e9e5988e
87b8db4ca909c74ed3ccecb61aaffca6dece8f5c
34014 F20110409_AABVGV vicenscontreras_m_Page_016.QC.jpg
0fbc42467d2ff847da4ca433efe66367
1b3c1f1148423cf7aea865876060812952dbc2af
103717 F20110409_AABVHJ vicenscontreras_m_Page_029.jpg
f01af44fa4dceecc99ab533c064775ac
9f9e32bda11abf2fcdf5238b1fe48c6ced67ec9e
30353 F20110409_AABVGW vicenscontreras_m_Page_017.QC.jpg
2637be5b2c57c267ebdc748970bc754b
9a4581ff5cb6ceccc87accd12d59b577372bd3a4
34062 F20110409_AABVHK vicenscontreras_m_Page_029.QC.jpg
32794b15b52871d58b17c394d9151a35
fbb9ffdb72fddd2dea27e1a60a8d847625548627
97914 F20110409_AABVGX vicenscontreras_m_Page_018.jpg
0f8a599da6e840deb7ade35697df5143
7d80e30788f66804ef00c48924d45c94a7359637
80957 F20110409_AABVIA vicenscontreras_m_Page_053.jpg
a03c1e6f56f177b17b79aa0aa825d47a
f231345707c872cab879fd049321233cfce83729
98067 F20110409_AABVHL vicenscontreras_m_Page_030.jpg
552d0c64b95d3355d30a76b498a72e9a
0df9b5fe9de4a2fef6b71cb15e54ec9b9896241c
102649 F20110409_AABVGY vicenscontreras_m_Page_019.jpg
9c03677a7b085a9419931be22a286f87
1a14ec5cb34b503c443ee58826f148e4e124d9b9
16076 F20110409_AABVIB vicenscontreras_m_Page_054.QC.jpg
ae9ee3f6d68d22193572df8b0b70fdde
d9ba361405dcbccc85ef8b0bbcd1eca1f594adba
102964 F20110409_AABVHM vicenscontreras_m_Page_032.jpg
c3153a063620bf2380a2a3ce0dda8d79
1ba6df102f6054af912fc3feb8cb7bcd83aad0dd
33556 F20110409_AABVGZ vicenscontreras_m_Page_019.QC.jpg
5a53e9186b46d046e43e77e97c89d2a1
df2882d5d68caf8f4ca407eb94aa179d0ca40b16
33941 F20110409_AABVIC vicenscontreras_m_Page_055.QC.jpg
f27e00aa288d4e65e7fe579a4309541b
940edd04ca464a2dea69ae97f2ce6d08095c1ea1
33422 F20110409_AABVHN vicenscontreras_m_Page_032.QC.jpg
e2360e9bd26a689e4756b709614623e2
9ad2f0859e8ed372a3fc9ccd18f93f4e992ec771
89055 F20110409_AABVID vicenscontreras_m_Page_056.jpg
3b256a2735721b91a5f8db3f4e6d577f
b925cb2d1e89fc13741c23ee60f6dc1c5ae4856a
29346 F20110409_AABVHO vicenscontreras_m_Page_034.QC.jpg
c629681f6860f2c4eee0df080bdc34b8
9b5e879d510e76dc0a45ca3e3980ac441fb50842
29398 F20110409_AABVIE vicenscontreras_m_Page_056.QC.jpg
4846625e2deacbc26dbcd525a97b7197
e5156a5b5f06905af67f73c87d7aceb8a05d2f61
33628 F20110409_AABVHP vicenscontreras_m_Page_037.QC.jpg
26db8978620c17ed89bbcb4496abd183
c0a0aaab1cbe0f789cab63a3172a6ed9d794e741
104267 F20110409_AABVIF vicenscontreras_m_Page_057.jpg
095667a06f44171909e21db8eb91e8e7
b1498a2e675aee492a0e3bc5baf3d050618df8a5
32553 F20110409_AABVHQ vicenscontreras_m_Page_039.QC.jpg
e01e555e99d3a15603626c06d64ab854
bc6acf248506a772cd2ff70ac50ec12e01d8fbcd
83948 F20110409_AABVHR vicenscontreras_m_Page_041.jpg
31ed50cca5006522175c838c8cf46f83
e23cd7b62e2144d0706f6783fcdaa2163b095158
19789 F20110409_AABVIG vicenscontreras_m_Page_058.QC.jpg
264416a703cca2c6112d323a8cb65dfc
151301cb1e05cc6e8e42f191d0ae9a1957bbd4b4
32835 F20110409_AABVHS vicenscontreras_m_Page_043.QC.jpg
d2163ca5279956f62bd8b33442719413
858bc27770823716f3a454b0edd6147fb2e65175
105014 F20110409_AABVIH vicenscontreras_m_Page_061.jpg
792423f3a4c47284b37d5d3c692ea091
0dac3b5101546eccd5b2aef2f19fda17f874d82f
31658 F20110409_AABVHT vicenscontreras_m_Page_044.QC.jpg
546bedacebf76281b220e43e61670987
d02be20e8f54f83cead708808922f5b4204952cc
101785 F20110409_AABVII vicenscontreras_m_Page_062.jpg
e7d7474c07501b98f6d9b76d5641ad9c
894dc142a72855a3da900bb337da4753b1e48050
31905 F20110409_AABVHU vicenscontreras_m_Page_045.QC.jpg
cfc94d986fc7e695960e9f01fb66eb3a
cf47bce79fc3a3366d5a8462c704825c44be9790
33963 F20110409_AABVIJ vicenscontreras_m_Page_062.QC.jpg
d815816fdb6d316d5b7d983413d8b9c5
3311f6dc34feb707df954627ada5c0440cbab756
30274 F20110409_AABVHV vicenscontreras_m_Page_048.QC.jpg
e82e246d224f19430d6319bad9f8ce1e
ef476228cd55e9d2b34105aadada01ef7fcaf288
98728 F20110409_AABVIK vicenscontreras_m_Page_063.jpg
a701ab87a98450a9ea1a863bb7bce92a
a926637f48e897c4231182d668b410f8dbbeb5ca
103594 F20110409_AABVHW vicenscontreras_m_Page_049.jpg
98eb86819df2e5da7f24c8d29771184c
e5ea0044be797a0ed329a0b67b1f7756fba295af
93114 F20110409_AABVJA vicenscontreras_m_Page_076.jpg
90670f3bb00180b06647cdd60a0aeb9b
fb781fd6016b91edeb3ba4227fe4ab45aa6a6c2b
17946 F20110409_AABVIL vicenscontreras_m_Page_064.QC.jpg
78b7c89eaf92d0c5f2ad0209a164d0d4
6b2c28f8a8350504e39e1f13d44e628256ac6b3b
20084 F20110409_AABVHX vicenscontreras_m_Page_050.QC.jpg
ee722b4e2487a6ebd2aaeeebf09917b8
d617aababe415ddc96321c89d30377c5014d7c6a
102735 F20110409_AABVJB vicenscontreras_m_Page_077.jpg
74daec11f8b04bc9925c908db3891d53
3f32a9d2460d9f47017e0f4f755c986674743475
95420 F20110409_AABVIM vicenscontreras_m_Page_066.jpg
83edd580b81d1a9ec52dc4e5d48d0ced
ace91f5b610e847e859c77521ecb26743e783529
79689 F20110409_AABVHY vicenscontreras_m_Page_051.jpg
2d68035a54c725f0018d5ee1460f06b3
73b4ca74c7264daea63acbb5763704411af3c2f9
F20110409_AABUGA vicenscontreras_m_Page_047.tif
29cce987351d9e75c5b0ec27dcdbcabf
3463e75a34aa008961a6efeb497d04cba1579d93
103064 F20110409_AABVJC vicenscontreras_m_Page_079.jpg
049440458531b331c0556658d13de758
2ddde8e8426ea404a14bed24d6165a53a2cddb0f
32298 F20110409_AABVIN vicenscontreras_m_Page_066.QC.jpg
08bd5ae4f9a3dbcb298af486f9dfa19c
35b007aca8d39385da5d18b8fd234a944e75cc5e
24474 F20110409_AABVHZ vicenscontreras_m_Page_052.QC.jpg
ef9b7b02d37bfbafcdb825d1c6372e9f
fa21d165ab8480e29a1e6d00309cdee121dc1d52
29497 F20110409_AABUGB vicenscontreras_m_Page_014.QC.jpg
7d975e56b693a5218e48c5e3d1ecaaee
1a97b81edac6f2fdbf3318ea8dc9c607321133cc
103710 F20110409_AABVJD vicenscontreras_m_Page_080.jpg
b982ad98e770adc82dea19a131b9fca8
2c88da453b117c3fafa8135dc1ebd4c65f39de4a
73729 F20110409_AABVIO vicenscontreras_m_Page_067.jpg
58f2c68542c02ba01d1de685e1d1bb6c
ee48d043060b0705b6a9d524a81a34b3421e8db9
F20110409_AABUGC vicenscontreras_m_Page_085.tif
f8921afcc59a267b4a5466d560ca779d
05279649c3373c268e83e3783c2b63da76c11e85
33135 F20110409_AABVJE vicenscontreras_m_Page_080.QC.jpg
1180bd21ba97c99b5421b99a1b07916c
9ef3fd19f54f2184e9d96ab92a46b95ace562b1f
24605 F20110409_AABVIP vicenscontreras_m_Page_067.QC.jpg
81cde362432f9527e566bd3c8c55d63d
0f66e73384c032725379411942d648b1a85465ce
1832 F20110409_AABUGD vicenscontreras_m_Page_076.txt
c75a9324bd7a7dd8cd9f9c320a4b2cf5
2779166a70b9989d9f40c57be3fe10a65826c279
106566 F20110409_AABVJF vicenscontreras_m_Page_081.jpg
dcd7da4f8261077b730b606c661f51de
a539256d5becd2509efc69118b86ea2aa00b03a6
97628 F20110409_AABVIQ vicenscontreras_m_Page_069.jpg
06721cdbb7d181f17dda8b0e96244d02
f8f12347606a0e66b3256df43d3cad10c5fe7be4
1051980 F20110409_AABUGE vicenscontreras_m_Page_043.jp2
da2a0a910d034d7402fadc5c5f993732
0af8cd5fe18817a8811337cbc747b24b0d8c3c20
33080 F20110409_AABVJG vicenscontreras_m_Page_081.QC.jpg
af605f1f5bc7caea9757e8179112800f
978040dd94edaba30213cc3ea14ce81c83bbf42a
7464 F20110409_AABUFP vicenscontreras_m_Page_090thm.jpg
45b512b952995563bf1abaee2a9ab4ac
ab791391046b7c7179e889e62c9be84324de9742
32048 F20110409_AABVIR vicenscontreras_m_Page_069.QC.jpg
954b013902886e6498fe4dff41207f1d
a8197800ef495dad4f336057ccf7aab3cbf96092
29554 F20110409_AABUFQ vicenscontreras_m_Page_009.QC.jpg
ac88f8579b06632bbd7e9abc4c063c9d
0a17fa775151a16da02c01402ed9314246d15e7e
64527 F20110409_AABVIS vicenscontreras_m_Page_070.jpg
062bf6b06b54c22c85f4996bd4121ffe
dcac8461171e3c1cc6d8cbe420a2388e74bd1a9e
48327 F20110409_AABUGF vicenscontreras_m_Page_092.pro
a8619b979ebb86d7c3e6cbf3d1ded986
1eea2a1c0b92ef9e26d0f093a756f70049ef9894
89814 F20110409_AABVJH vicenscontreras_m_Page_082.jpg
0dd1120594cc9fb95008862862e5e2d1
e73816eeabcad3b3ca96dc3def4ab4292ab79305
F20110409_AABUFR vicenscontreras_m_Page_132.tif
bc56b7f00d05a9a0ab3190bafce851e6
9b18abb53fc3cc398dc084ac97453164c7e5e754
19903 F20110409_AABVIT vicenscontreras_m_Page_070.QC.jpg
455ca446c6c62a3d0b7fef382481c72e
fc88b45c4c7fb52d22d8867328628fff8a93ea56
F20110409_AABUGG vicenscontreras_m_Page_133.tif
8b08dd59656f9480b8581c80ed77ed3f
171bb833ccaabcf3f12fb17133e8c0ae601d7eeb
29964 F20110409_AABVJI vicenscontreras_m_Page_082.QC.jpg
e2606c45d526033b784f354f82dffd20
d10910e4e114e87feab1fb17baa55f1347c974cf
85966 F20110409_AABUFS vicenscontreras_m_Page_078.jpg
12e2014f4729c573759cacdc71cb91ed
2ad2b4efef8028b6d2a965482edc296518acc716
34422 F20110409_AABVIU vicenscontreras_m_Page_071.QC.jpg
0206204502dce6499513dd935e144c5d
c1256db90d03561c0911bb73ece2bd4aeb256704
138 F20110409_AABUGH vicenscontreras_m_Page_002.txt
a9ea78127412e8da83f47e2b500dc88e
1720e6897c74ddc428d28ad1392135bf930927b4
100355 F20110409_AABVJJ vicenscontreras_m_Page_083.jpg
ab3eede1aae636a3338a72e7d0fee866
36c4499aab27f9cea4a27b8c42e2fa950f5b27a4
25581 F20110409_AABUFT vicenscontreras_m_Page_051.QC.jpg
7f19077075b88184d532bb0c6681ccb8
66642bc2baa17fac21e6daa0e894c74df06183c3
100973 F20110409_AABVIV vicenscontreras_m_Page_072.jpg
7d56dd79789c76b62bd3744e6b31d902
e585805928120f97dbe4df7fbc61fd244eab6af1
F20110409_AABUGI vicenscontreras_m_Page_134.tif
2bf39a8577cfed9724497abb192eefed
540040db0f1ca664300291a770a030e8f8092145
32448 F20110409_AABVJK vicenscontreras_m_Page_083.QC.jpg
cc545840e47152dd7fa06d8327109f90
05afb6e8d8432859164bebdeca7d2e5cff24a02d
99910 F20110409_AABUFU vicenscontreras_m_Page_068.jpg
daeb5415346f50c432bdaf70b990c92c
ec4c3a511b0bf85c8150f96158ccb1e044d1b3f1
32811 F20110409_AABVIW vicenscontreras_m_Page_072.QC.jpg
c816575b5b92419c7a5e707344a0cc97
375cb8969785d29c19d038d3976d44808ea62a3e
33565 F20110409_AABVKA vicenscontreras_m_Page_101.QC.jpg
11b6bb7f455a6c0d2fad3e9d7a127220
beaae7cd2f2b80bedb21dc0d27620b4169daebbf
40060 F20110409_AABUGJ vicenscontreras_m_Page_044.pro
dbfe18cb07ce6e803db23112ee045032
f9e3d7f86b6a729f8cd105d599d5c4b36ae1746d
27915 F20110409_AABVJL vicenscontreras_m_Page_084.QC.jpg
461064df44b3f606a1a3aa49c13745e9
c1b90ac20e48c5643487848cc0676392b553854b
F20110409_AABUFV vicenscontreras_m_Page_015.tif
06b39fc9aee0bfcaef852663a0a5a7a6
fc710188ade135ea4bb26a92fcc47edd7dcf867e
28353 F20110409_AABVIX vicenscontreras_m_Page_073.QC.jpg
438f4bbc64b7282b8a0f4a03771a4d08
d77afea8b253a6060f7ef52d529e5523c74f4aee
16098 F20110409_AABVKB vicenscontreras_m_Page_102.QC.jpg
cb335fe1f9179589a04019424d987de3
827d9b312144dc1602f9bbf8ec2363b6b95ddb04
F20110409_AABUGK vicenscontreras_m_Page_116.tif
20652aadf8b94c37d6ab5d0800e88914
e37f6a0194259811062bb23d6c8d5f63521779bc
93314 F20110409_AABVJM vicenscontreras_m_Page_085.jpg
f1bd41813b330c52fad3046c05ecae60
c475be1dbaddfb15f96118bc8ba6b1dd8f4a1596
F20110409_AABUFW vicenscontreras_m_Page_062.tif
c2684281e84e959f7f8e6681fc203270
3258ee3c1740d7a6351f462f6fb88bf6594fa121
88641 F20110409_AABVIY vicenscontreras_m_Page_074.jpg
f1c218bc1787a055ac30874761e5d30d
505b7540e14120e65bb2f40e3cec4d709ef69597
30743 F20110409_AABVKC vicenscontreras_m_Page_103.QC.jpg
c6d674262981e3569fc631b4fbbb938e
c24362935a7a5528e7b8d004fb5bb1051d1a924f
81880 F20110409_AABVJN vicenscontreras_m_Page_086.jpg
45773db978a32ddc0e7cc1cf2d56fb88
763d1d298a530e3fa325b9e3652a289ddd9e6092
998983 F20110409_AABUFX vicenscontreras_m_Page_125.jp2
6a3fba3c8b57893a987dae21a8dd10cc
37bc2907c9b39c08858bc323c8e415450b20648f
28897 F20110409_AABVIZ vicenscontreras_m_Page_074.QC.jpg
86533b3e1efa63318963c62946574e83
a20d3c5cf706b57eaa146ac145b1722e214369dd
841 F20110409_AABUHA vicenscontreras_m_Page_046.txt
a5750e43d3d03878dcb95e2653deff63
3f0e5fcb458ada380ff2135418defb00bb836bb0
42336 F20110409_AABUGL vicenscontreras_m_Page_091.pro
5b4e0ee5e9ba06272dd17171262bc2ad
4c03b5d7eb4d401d31c187398a356623c6c3b1c7
101593 F20110409_AABVKD vicenscontreras_m_Page_104.jpg
9ca9ac00314f75ee8a6784d7f2bbe7c0
0b75bdca8b71012c21b76440e97fd486e6127459
24279 F20110409_AABVJO vicenscontreras_m_Page_088.QC.jpg
6699d5696d75d6377bec3892987efefd
7ea8c804c540380fbd3816010f3ea97aaf5e9178
98583 F20110409_AABUFY vicenscontreras_m_Page_100.jpg
54df33deaf18ae6aa76d9801e8b9189b
79f8174204b2746c6c6b1a4b72c0db35a4598b98
48558 F20110409_AABUHB vicenscontreras_m_Page_018.pro
5fcf220b5aa8417745a843a0dfd2dce4
4f479959781bb99727e061b4062d92922616fe3d
76644 F20110409_AABUGM vicenscontreras_m_Page_109.jpg
ce7493ea4f114844ba3bacd14a2dc146
a32f97e9e51a106e8e3394a1851b5b0c7f374a4f
91602 F20110409_AABVKE vicenscontreras_m_Page_105.jpg
2765af94e50ef1b4ad5d2884237824da
a86b44d8317de5a152d9ace5ba58a2b2506cc974
83887 F20110409_AABVJP vicenscontreras_m_Page_090.jpg
2824990856cd6130555f723b9355331e
de9c020ae0ba255fc66d8ead628b4744b3e6f8b4
8439 F20110409_AABUFZ vicenscontreras_m_Page_006thm.jpg
c86afaba7742ac9d13139e0a9552ed2e
f175fd57e6d0ecb4969f54e928461a00edeef28a
1654 F20110409_AABUHC vicenscontreras_m_Page_083.txt
af2acf57f3c8abc73d09e9fb8e40f541
cf46db29c7e516fa2af3084cf58641cc5785e91a
764380 F20110409_AABUGN vicenscontreras_m_Page_089.jp2
117ac7938cf2985ad184806ca3a82c56
c86093db4763a65a110f4600e719fb55646d802d
29442 F20110409_AABVKF vicenscontreras_m_Page_105.QC.jpg
29ac2385983f63b9edb2bdd48a1900c7
9268d69d87efe3f9f5a4d59a8aa655a9f4dd2fbe
95997 F20110409_AABVJQ vicenscontreras_m_Page_091.jpg
80137b0c4eebedcb0f39275a5e12c426
649bc05d30c7638e2f28880949e346bb51698705
F20110409_AABUHD vicenscontreras_m_Page_112.tif
ac6f3ee3610d5678465442e774a984c8
34ced4f26b5bad015dbe67bce67ec33aa8dc3927
F20110409_AABUGO vicenscontreras_m_Page_136.tif
df3799bd43d5df7267758dec823f067f
5c1dd2fa090fcb64ffb98048e82cb35c0392991b
25826 F20110409_AABVKG vicenscontreras_m_Page_106.QC.jpg
de661e63ecf5901485de662bed8296f1
91b84b85e0d81ea10180ab2db847e59ddc9fda92
25608 F20110409_AABVJR vicenscontreras_m_Page_093.QC.jpg
ad9d9945e694f2ebfab0e96ab1e830ab
9ad1271183acab382e1d241b4f7d0411a8e33deb
6506 F20110409_AABUHE vicenscontreras_m_Page_012thm.jpg
01d10c1b14d854bdcbde9f4831913a2a
4c15438358fcd16e599c0670dbfe2abfb9eddf7b
5152 F20110409_AABUGP vicenscontreras_m_Page_046thm.jpg
47f93cc1aeb0c12e59d2ad281177e396
d74d78d59dd4a4f5383df9e5dd4f0424c0af4fc0
110018 F20110409_AABVKH vicenscontreras_m_Page_108.jpg
e1640f3d30ce9d7266c12aff01e56760
5fbc777b28e89f91757ce274ae0b35c3ca4628a8
25458 F20110409_AABVJS vicenscontreras_m_Page_094.QC.jpg
ea4590d187151dbac610a84bba59701d
6924cf613ca073f94d68c1b05f1899e513b4b45b
7038 F20110409_AABUHF vicenscontreras_m_Page_084thm.jpg
6634cf512d0bdccea936c7f4f130a63d
9a0a9ceb5fe9fdd7368dc2586857de5d38d5d197
8278 F20110409_AABUGQ vicenscontreras_m_Page_017thm.jpg
15b14951c8cbe433d117c4656e5bcfa5
729016a078c7c95fdbb5a58fbbe9135659642e71
100538 F20110409_AABVJT vicenscontreras_m_Page_095.jpg
553a58acca9d7c3a41da532ab2e15575
9f491e9ea4ec6afde758c95b783352139ec5d4d4
8767 F20110409_AABUGR vicenscontreras_m_Page_095thm.jpg
11810a37a6022aaca340dadf6f855284
1547de78d8a1beab8513fc3d969980678df15a51
36239 F20110409_AABVKI vicenscontreras_m_Page_108.QC.jpg
3799db53ae936e9d60aea3f9429c27f9
e890d9e5c25e5bb110fa9f53d9dcd32c81d80e93
32333 F20110409_AABVJU vicenscontreras_m_Page_095.QC.jpg
fe072075305b869606afe66bcac97f23
20780bc19c1b577dbdf5943f48b19b722b866d7f
60936 F20110409_AABUHG vicenscontreras_m_Page_064.jpg
2b6a6aa5263001ad05bea9358875ea99
9b111732f6476c2b000965f3a036b826c430844a
105274 F20110409_AABUGS vicenscontreras_m_Page_037.jpg
fa2406700a9249bd79b234b2fd07cb56
c2c05a4e1413af1f02fb8da1184c2b33ffd979a0
25844 F20110409_AABVKJ vicenscontreras_m_Page_109.QC.jpg
0f43a5b83cb928c92d3ad7f984deea7c
0569ecaffc0d0c2f64e7f935cbe5c8fc0d74264b
66418 F20110409_AABVJV vicenscontreras_m_Page_097.jpg
61e30fa0afd05171a0f9337742a0eff2
95580587499e661244647f6ef85ef7ccd8083132
2571 F20110409_AABUHH vicenscontreras_m_Page_001thm.jpg
0521936b15751fc7fdee5b54f0f05570
610386905cb23521d515277d38f7d5debc026868
28796 F20110409_AABUGT vicenscontreras_m_Page_041.QC.jpg
19fd92f0065e8201c715ba281e111144
b0554e5a89a6836827af955ffd9cdbe6d9d3d294
87462 F20110409_AABVKK vicenscontreras_m_Page_110.jpg
1759e4e80b5f384f1723c36134e4ed5d
fb88fef13d3633042e1b5bb8ce7f6e647229fe87
20244 F20110409_AABVJW vicenscontreras_m_Page_097.QC.jpg
bf0e615669bd8a51ac2137d20ffc5c51
99ade01313c76f3fb2241449dd601b96a1d5eda3
2056 F20110409_AABUHI vicenscontreras_m_Page_009.txt
79b4b3cdf4422dea1883eebb303bd7f1
bbdacb8174e46ad3ab049e1dd57c3fc09b3fa545
102304 F20110409_AABUGU vicenscontreras_m_Page_055.jpg
090271e2e9332c7fe5891e0e9699fbae
4c5245910e9125085757bcda8aebf73ec1df51dc
14832 F20110409_AABVLA vicenscontreras_m_Page_124.jpg
69f3dd3a66c4d68d4fae51660685c2a7
99bf398fd1a6d2a2676ac1c6294eab9fbc4e2ad5
26906 F20110409_AABVKL vicenscontreras_m_Page_111.QC.jpg
6a9cd08120560eb49acbde8ab7bd939c
b3e04a849d87c2898e342678cb05aa6dc2a2d148
98294 F20110409_AABVJX vicenscontreras_m_Page_098.jpg
1a6925e2a93c47900ed23735c3e6dc32
6585913405263f9b8e13ae47c67c3fbf63af5cda
4892 F20110409_AABUHJ vicenscontreras_m_Page_087thm.jpg
eff2a63782b11ee051b4b4b49473b6c4
70d603812c343479b83aebb28a30041f9e784a41
F20110409_AABUGV vicenscontreras_m_Page_021.tif
a22f5dfdbe4785f93ed020a4a6d7be06
7c3c4320ef17400e36ba2faa6795c60ca28343ee
5393 F20110409_AABVLB vicenscontreras_m_Page_124.QC.jpg
c316dedf35aaff4e2939c41ff4437422
8f35412246dbe2618982aa466db91a004065f510
98507 F20110409_AABVKM vicenscontreras_m_Page_112.jpg
2145c247ada677e0ee1519894ae7c770
55200b91632fc4e850d8df7ebcf054699593e320
32500 F20110409_AABVJY vicenscontreras_m_Page_098.QC.jpg
b6bf64b0a9cb0bd401d80c60dcc85908
312cfc357130360b934a9e963dae1a197508315c
97239 F20110409_AABUHK vicenscontreras_m_Page_103.jpg
c50ec35db3311cfc9edf66038f2078fd
b1ef72cfcc3e88c74d047a01aae9eac917a1b5d1
30257 F20110409_AABUGW vicenscontreras_m_Page_025.QC.jpg
d8cd5be7898b5f9824df81db75b59580
3ab7353dde5024021e2655592d88a903d6e207e6
92041 F20110409_AABVLC vicenscontreras_m_Page_125.jpg
7d45d6c4a98db32255a1f2ada0fc30db
07a6d2bfeecde2a8749df94602208304e6726e64
32531 F20110409_AABVKN vicenscontreras_m_Page_112.QC.jpg
695da6d1cb2087f2d5426368e5c7ccec
f306f89182418894789626373877cb64f9010d97
30693 F20110409_AABVJZ vicenscontreras_m_Page_099.QC.jpg
2f8e06ec5f1b41dc096765253b626068
aa6c9ccd08324051411bd4b4a71d3f6c4328a321
5163 F20110409_AABUIA vicenscontreras_m_Page_064thm.jpg
d0300fd650dc1871ab6e0f583f3978cc
ec886f415662f62eb9eb567cb58489fbf953ab56
F20110409_AABUHL vicenscontreras_m_Page_028.tif
68b39ad1d1a948bfc44cb1b8ac2b43ca
df90bd0284e637519a8ef5fa803005d6713ed7b1
1793 F20110409_AABUGX vicenscontreras_m_Page_118.txt
12f6a2680ab8f4b9f5d4c791ed8275a6
701bbe033d05fb47bfc7e1bfca8922bce738ca87
29361 F20110409_AABVLD vicenscontreras_m_Page_125.QC.jpg
46b43e98ecd7d7ff4bac7bf876538d64
8d6a322086a9c286089744578f325bc22695188b
29821 F20110409_AABVKO vicenscontreras_m_Page_113.QC.jpg
2147212a90eab31e7396515fc1376441
6873d6586d5dab1bec30e08fb5e993f0a03b15ad
33511 F20110409_AABUIB vicenscontreras_m_Page_042.QC.jpg
7c76530756338c035a605a07e3e58004
b1a3ff9286d2b8e62a6d709d15c393824ad7d2e0
111140 F20110409_AABUHM vicenscontreras_m_Page_040.jpg
fe359da101c0223f4a52f6e7d42be7a9
c5f3c68c48de2c3a68f8613a0ab401f745e3a8cc
48549 F20110409_AABUGY vicenscontreras_m_Page_136.pro
891da11a1015724764951c6c9633820a
9420311ab80985d6837f8a77f402530d042b2de0
33480 F20110409_AABVLE vicenscontreras_m_Page_126.QC.jpg
0b26ec19a2ea1d79f05b7afc02f1d4d4
8b3d2ca8afa55d16f03b249c6b3e748559bdeeaf
98000 F20110409_AABVKP vicenscontreras_m_Page_114.jpg
2f621454acf80bd2585adcf431dcce55
c80396f7022f051beae830221ff1c230d10aaa99
927746 F20110409_AABUIC vicenscontreras_m_Page_053.jp2
71f9f6d3d6da99dd9a178bb6e7f6e0b3
84b23e4359425fc4ba5427ca4573661a529fb45f
22695 F20110409_AABUHN vicenscontreras_m_Page_102.pro
e53259e5d6bfc3c6660aaffe37671b51
936279e27dc1b717674da72accf8b631d0e82a33
32563 F20110409_AABUGZ vicenscontreras_m_Page_041.pro
8ea1b5886dc9d9362391175af498a5e0
9335e2649b4e13b6d65768f8cbed08a36fde2c3a
104179 F20110409_AABVLF vicenscontreras_m_Page_128.jpg
64f68614f98d67dcbcd4a47538e9797f
0fc575b5c51e12b14255f4dd968053db61c2d776
28494 F20110409_AABVKQ vicenscontreras_m_Page_115.QC.jpg
3fad4ae9fbf6f570ca0f3c6247255365
380d4403ee2a756d2e4064d1edd71376e3f34d6c
150716 F20110409_AABUID vicenscontreras_m_Page_006.jpg
18740c6a47ed2026ad53af9a77b3b5a1
86e169dffa77a97c2c14a49077c6dfb214426041
F20110409_AABUHO vicenscontreras_m_Page_065.tif
710f98fa89c9bee685927093955320ef
909e093135ff9ed298d6a45ce2fb6e3fc9161dd5
33633 F20110409_AABVLG vicenscontreras_m_Page_128.QC.jpg
2a66108ae79d0e0debb5473e899dc7e7
9e0fb81fd33812ad62f232f2fcb184e8b1c15528
23458 F20110409_AABVKR vicenscontreras_m_Page_116.QC.jpg
8263bffe299a518ff69d0eddf7260bdc
bd3e8cca19edc6f965fb607e87d7c56de8957520
41615 F20110409_AABUIE vicenscontreras_m_Page_082.pro
9d516fe406d54786bad458a341098f34
e209cb6e2f6cedf3d154e48cda7b821f57b2a046
20671 F20110409_AABUHP vicenscontreras_m_Page_033.QC.jpg
9f5aba90f6d05f8a6d6c304c54e6f07c
d9f77ac8f28d4f78d1fdc02122d61250b2ebe13d
104931 F20110409_AABVLH vicenscontreras_m_Page_129.jpg
028bd40b03fe80040a38fad302c554b4
aa9aa6489cd94efdd2ecfee91fed6a53a29d519d
32276 F20110409_AABVKS vicenscontreras_m_Page_117.QC.jpg
6b724b2d90379e034107bc353dd83369
f395624d32eeaa0342758842d6cb7536cb8f96a7
1958 F20110409_AABUIF vicenscontreras_m_Page_127.txt
37263b1cd597d14003ca1defe438a36a
df73c4345c2ce70072d72df2f20d7539fb3ac47c
17454 F20110409_AABUHQ vicenscontreras_m_Page_138.pro
9f936bd1642b9f473176518b32169f84
6ca49701ababcfbbc189b05b0ddad908fb132891
34018 F20110409_AABVLI vicenscontreras_m_Page_129.QC.jpg
c8f24f71ece64c3e4c0381fbdcea616f
e610b27aab204a1d403ac8badae463a533b9c4bf
110163 F20110409_AABVKT vicenscontreras_m_Page_118.jpg
1eabb99474e121265595c28fb9d39e04
fb47aaf8e1a098ac1bed04a996e38f05e7deeb0e
50747 F20110409_AABUIG vicenscontreras_m_Page_079.pro
15da26bf3600d8eb70220273879fdcec
eed946b79983260e2403c54ffee5f2f9ff7008de
F20110409_AABUHR vicenscontreras_m_Page_114.txt
feee90729db2f7c0633870d5e3a9839d
e1bb6a56b1823ffebba93f5ddb39ef07422d7039
34743 F20110409_AABVKU vicenscontreras_m_Page_119.QC.jpg
2b62790d6d21810a3dde66eca0665a66
0864367ce1818e018fd7336c074efb68bfc29ea4
34491 F20110409_AABUHS vicenscontreras_m_Page_116.pro
c48f572cb3b6dccd97d8be115b2772d1
243a70460d521f4829723c3b3febf3133c129a23
103495 F20110409_AABVLJ vicenscontreras_m_Page_130.jpg
5f3967f5bf9c972911d40c22ed1ce668
d892347d358ac08d1a628fd0091afc13bc4f835b
32969 F20110409_AABVKV vicenscontreras_m_Page_120.QC.jpg
cacabf8bef78642536fc1605c55d1565
8b092a733d079ce9105c87817e5547db2a9b8b1b
F20110409_AABUIH vicenscontreras_m_Page_010.jp2
fec4abdb05aede9fee3e6e5a6c2f526a
87975a06daeb64522dc21c5b313f4e8ce73f3f13
F20110409_AABUHT vicenscontreras_m_Page_090.tif
e879e5f88083bcf07b25a99b21155219
a0a328729db35843fbe51ce9160297a6785a2202
33508 F20110409_AABVLK vicenscontreras_m_Page_130.QC.jpg
c40062c3c1f8fce080d1f4dce46956b9
877c28dd7c80fc6f26467ee83216bc85a98612ee
32299 F20110409_AABVKW vicenscontreras_m_Page_121.QC.jpg
fdb362e17a8006abd9928a68a5c33b15
02ab7832842bb5cb3d3286aacd1b7c12b810c4ff
F20110409_AABUII vicenscontreras_m_Page_091.jp2
4cfd1b029ec5c0e844db8e4473c62472
379d566397ab75a6c62fac0a31b8e1f11a8258cb
1851 F20110409_AABUHU vicenscontreras_m_Page_122.txt
9ac491446348d1f85cf4cad1d86c6529
990c58b3b9c1531653d7492ee1a386994fb83029
F20110409_AABVMA vicenscontreras_m_Page_016.jp2
504f5a5e90bcf9205df0dbb1c551820d
3694d2fb51085b634b30f04706eb8a61b422f46a
80698 F20110409_AABVLL vicenscontreras_m_Page_132.jpg
ee717940b8e3b2ace18cd4a4c4d8b99a
3ce89ef2a6ff0165b013d2de15e97fb081f79aa8
31155 F20110409_AABVKX vicenscontreras_m_Page_122.QC.jpg
24a6de3b7a836a0d13f18528bd95e3ce
77497256fec3da80602c07bb8223023a5d1273fe
6988 F20110409_AABUIJ vicenscontreras_m_Page_086thm.jpg
f9e6ce24d13985499f1a82ab69a98cac
deb9f10d6959a6d652b0b25fb4a001390fc87b8b
907388 F20110409_AABUHV vicenscontreras_m_Page_012.jp2
f3977d74d39858e45d10d21f0e750ab8
a1aa19885d19ae6856baf6d27fd5cba201a035f8
1051961 F20110409_AABVMB vicenscontreras_m_Page_017.jp2
6eb95903a5fbc89a913a2167216f6b63
fa75d9e780a19fb127a1e166ac4b71af8642e480
25920 F20110409_AABVLM vicenscontreras_m_Page_132.QC.jpg
bb628c95e6211007f188218bc9e4259c
0b000c1c49a9fa71d470c414ad5c2efc2542bfd5
104691 F20110409_AABVKY vicenscontreras_m_Page_123.jpg
82b3612adbe3c9acb0d66d9ad5161123
2a6c3749910be2e9eeba32c0b29d7eb345407641
1828 F20110409_AABUIK vicenscontreras_m_Page_091.txt
135cfe0c7be2c9269a7f75284c5f9367
0786c8dd24b50035fb168d7ff7307c18cd768dc4
34352 F20110409_AABUHW vicenscontreras_m_Page_135.QC.jpg
ca01468d630a073ac27148473bb9d61f
8c927523c8b6654e0101c396286f8ff48f3af3f0
F20110409_AABVMC vicenscontreras_m_Page_018.jp2
f2e443ea9ea137aebf4cb1495a5e6ac7
6102e50641021acfb9b0955d653e027299d85fd8
83625 F20110409_AABVLN vicenscontreras_m_Page_133.jpg
da28c1bd2617f2e666fb51ca6466c321
265eb4e56be23abbde8eaddb086d728887e54db4
33410 F20110409_AABVKZ vicenscontreras_m_Page_123.QC.jpg
29c276ac39b751c5156fddfe115b7185
580ee514f5f74c3a6a76ce3177df67cf72da8ff5
25780 F20110409_AABUIL vicenscontreras_m_Page_053.QC.jpg
54be5800587636ca521b92f139195d78
4b74dd1b649f3a071b7dab3489ce82d4cf6fbc5e
752509 F20110409_AABUHX vicenscontreras_m_Page_088.jp2
72db510f3c95c66289920df1c91c4b21
d20f9e06cfeb410ae12204a415ada0d788f529c6
99089 F20110409_AABUJA vicenscontreras_m_Page_021.jpg
7ca7899fb442775286703f7c7e8c66b8
2538632b9cae5a220e5c30fc021ffa30b7b6589e
1051933 F20110409_AABVMD vicenscontreras_m_Page_022.jp2
bda8f61dc8fdb833ff7e1aed7ecbfe11
590aa9a3aa8ad6f63fb70487e782183cb8f030a3
32730 F20110409_AABVLO vicenscontreras_m_Page_134.QC.jpg
555264a460f90a6e613445bc64755ce3
1ae52ab49dab2e024722efadce3dc923ed62a314
16086 F20110409_AABUIM vicenscontreras_m_Page_046.QC.jpg
7e72d81470119e3462719d9b9a8f240b
20d7a4cf8e2720ac2eae29b49ff68e3c14935c65
F20110409_AABUHY vicenscontreras_m_Page_042.jp2
1d6de10c716d14232c0cedd8c4caecfd
c64f605ed1cbed7c83fc3a1f11f61bbf07a25751
28230 F20110409_AABUJB vicenscontreras_m_Page_110.QC.jpg
744acd87d7889f3448a945a27476fa47
5d7fe97141c69418db9648e60608cf37de19c5e3
1019050 F20110409_AABVME vicenscontreras_m_Page_025.jp2
29b26a6d3a1efe46fd247d23acc5bb58
6d855417c830243925ea0676f4f70693b5506bea
106203 F20110409_AABVLP vicenscontreras_m_Page_135.jpg
2b426ae88cb455979ab1c350f6d402ec
3c4696166881f2c9bfdb40626bea74bf61a4a8e7
64141 F20110409_AABUIN vicenscontreras_m_Page_075.jpg
276a77fba0feff7e945c6ee7838a9a2a
12672bf758c4f36bafa90244bbece18bd1f9810b
33821 F20110409_AABUHZ vicenscontreras_m_Page_060.QC.jpg
17f0e20ff82dcbecf605c2e0632953eb
b6333bb88cdcf0ff4afcc3aba0ff4370b74af86f
1051971 F20110409_AABUJC vicenscontreras_m_Page_030.jp2
ce389bfcb2845cb415627965433063c6
43579f7fb6dfa2d5bf9528c81e1d626d040a0746
1051969 F20110409_AABVMF vicenscontreras_m_Page_029.jp2
6d00a3825aca2697e47b0ce5fd74b6e1
4ab3056ce1c0f317b1e760bb6d595e2fa47e3f3e
99468 F20110409_AABVLQ vicenscontreras_m_Page_136.jpg
02638983e2fb9413043c35f37f6d7c21
e55a87cc658e434521a302d7fdf4e023dfcdfb98
90166 F20110409_AABUIO vicenscontreras_m_Page_048.jpg
2fae09996416d07c70309f396960fadc
72221726deac0c2009a1c7e0d0c4a723de1cb450
1976 F20110409_AABUJD vicenscontreras_m_Page_120.txt
0324eaf0f4f02cd8918b3cd3a2939db1
3dedfb55f987e864ce05e1bc1af98414ede34d3f
1051982 F20110409_AABVMG vicenscontreras_m_Page_031.jp2
aa59d3854a31d95b425c3f30ee8c1c68
2b4d0b3ec855823f01b04e6efc55d5042555722c
12965 F20110409_AABVLR vicenscontreras_m_Page_138.QC.jpg
48dcd5d79b26d695d525801e9efbb857
8e39a211973e3219c08738113a8098aa25381205
F20110409_AABUIP vicenscontreras_m_Page_057.txt
23d547342c9798779346457922f98b25
b94338ace000f397fe0fe07e734595b1a108b867
F20110409_AABUJE vicenscontreras_m_Page_008.tif
d8941aa7da7094946bb55a5e79f0c669
5099abf79616b5e817f4f20b9dd664d954d3bd99
F20110409_AABVMH vicenscontreras_m_Page_032.jp2
7c4fc3506dc174a20a382ca107271eff
3af505705ed7188abcfec3f87f2e1bbeb20f5c20
54583 F20110409_AABVLS vicenscontreras_m_Page_139.jpg
894325e63d0e411091ec121067572dc0
e672702b673965be24829f0d514f035e4e8e839d
47067 F20110409_AABUIQ vicenscontreras_m_Page_112.pro
8c78875b7fb56ef00fdcb8f4e08e6e25
78ff6d024483c6dbb0cd4a86bb23e1dd61932022
31288 F20110409_AABUJF vicenscontreras_m_Page_068.QC.jpg
2abcb566e516a2b19a96c4464517d843
6a1e8c412e3d1c9a590e91bf8b8dee4393bedd2e
682968 F20110409_AABVMI vicenscontreras_m_Page_033.jp2
b3f60b2975848658db343c85946e47a5
e77fbbab5f7b82c3fda4996abef20791314741ef
17978 F20110409_AABVLT vicenscontreras_m_Page_139.QC.jpg
594196a53564b0c321a39f011e00bf07
9375e116f11d570adebdaafae4d80319cb4e54be
35631 F20110409_AABUIR vicenscontreras_m_Page_023.pro
e00c85b7c41787b8c162b1c41f0b7338
8272261801cd0df252d8fcaa5480b833c93d4a91
8314 F20110409_AABUJG vicenscontreras_m_Page_035thm.jpg
071429c0784909d142c9cbffee450667
469786183dee7c75c3d5544ac7dc4dd45f73b18e
988770 F20110409_AABVMJ vicenscontreras_m_Page_034.jp2
ebc63a75f0bc68c7b701a9c9c184bee0
912c19004af42a4b1458eca3c58d3267be2fbcb8
275630 F20110409_AABVLU vicenscontreras_m_Page_001.jp2
f59d2e364069541dc9caf352533b033a
68df8e8344615f640b0c34f1dd21c0b9eb86ea28
F20110409_AABUIS vicenscontreras_m_Page_011.tif
d8c8adf4fea9bd3a4cff2afbab453b52
479813b75ae5c92090c3cc1920c9ba0162b1c016
F20110409_AABUJH vicenscontreras_m_Page_044.tif
cbc16507bf96d1cca1e63f110a474f44
fdad1f6fe342a3c5b5b570008ad31320506d8954
524860 F20110409_AABVLV vicenscontreras_m_Page_004.jp2
969790ab0ade6feb02e549687b4fb9c1
766c8181525514e05e9f9a48e04d8456576e2cc1
47444 F20110409_AABUIT vicenscontreras_m_Page_039.pro
297ed0d7270fa273ea3a016084bddc96
292b66522bdd3584cd729e86b6b61c0b52eec473
F20110409_AABVMK vicenscontreras_m_Page_035.jp2
2a91bd2b23a4c33b3c1e11c7c7354837
7d20fee75aec4d58f6c2920f922bbb6677ba54d3
1051976 F20110409_AABVLW vicenscontreras_m_Page_005.jp2
d6bc3b85d6bd2b3eacf614eef8c69658
581bd79a1b2dc4e0c04b8758777cd50fa97e5b9b
8364 F20110409_AABUIU vicenscontreras_m_Page_131thm.jpg
b2dc327b87585137d65faddf5c4ccd18
5df304e1e754b86ba0e1056244f95342f77ef898
1855 F20110409_AABUJI vicenscontreras_m_Page_098.txt
06aec942e0454ba18719fca4b1e86a84
baa41d5688c9e67528746964bc8cfbd2d514c895
745336 F20110409_AABVNA vicenscontreras_m_Page_067.jp2
88e0aec2b69208d6c6b8a2e608b5d725
ccc8fd2b7f6b68f96b4c92ede9d1777edc2ce419
897709 F20110409_AABVML vicenscontreras_m_Page_041.jp2
94d0ce9d769c95a369f6bf65d41a7b60
7538ea22c72436d98167d1a282990d19bc7d6263
F20110409_AABVLX vicenscontreras_m_Page_006.jp2
fa3989ce5a321e5a05fe533cb1d556a3
f18082893d9d820efd38233b200cadcff2cb230f
F20110409_AABUIV vicenscontreras_m_Page_067.tif
79c00c96bc91bad46e3a96287c1f0ccc
a4635d804a2bde09ba7fc57c2cfbf53a624db204
584 F20110409_AABUJJ vicenscontreras_m_Page_087.txt
aa839ad01b072cc8ca6833a114ab1e04
2cef3b37b2da25b91e10f6621974cade7d4b18df
F20110409_AABVNB vicenscontreras_m_Page_069.jp2
8a0c9b1fae659cdba4666c10286f62e7
f7a0ad2724d6b173c32f99dbb3fff11b6cba21ce
998012 F20110409_AABVMM vicenscontreras_m_Page_044.jp2
8a6684111ee11bcc205e33a00a563a20
acedd2b946698dde1e11172ccfd457d80645882a
790858 F20110409_AABVLY vicenscontreras_m_Page_008.jp2
63329aa6a947fd9081248a7efd128c08
55f4357185d2b5e032c2152f3a5c1f50681ff9b5
1051949 F20110409_AABUIW vicenscontreras_m_Page_136.jp2
362da796448ed1f3e4623a404e4d53b3
542067e65a758b0e971130045c79fcc665f9d4e0
26670 F20110409_AABUJK vicenscontreras_m_Page_086.QC.jpg
2a2222a595c883ad4b0bac81ea00b82e
a29c66d2ab8f496882d4238fcd23a2d941fe1266
662895 F20110409_AABVNC vicenscontreras_m_Page_070.jp2
b73f3758802d92f8be301a628e01664e
03c0fef302b3bd05d4ea7efe35532620fae72239
1051957 F20110409_AABVMN vicenscontreras_m_Page_045.jp2
5b3342529a17de07185e06300fde1039
644bbf8ff1e38310c13a18ea01c58149fb100afb
847781 F20110409_AABVLZ vicenscontreras_m_Page_013.jp2
cf3de8651b2a5b94b432cd986ed6d1dd
f560c8a83c2f51167047ea49a161d9b036463b1e
33997 F20110409_AABUIX vicenscontreras_m_Page_065.QC.jpg
495e5e1da6f9b05ec3496baff496991d
3ffd47967bbcfc64eaa404b91c73507cdcab96f5
48207 F20110409_AABUKA vicenscontreras_m_Page_100.pro
d68124b13614f50c2bfdaa63c2a762b7
7c149b2f466a131ce426f97d3dfdd227e15af39b
8047 F20110409_AABUJL vicenscontreras_m_Page_117thm.jpg
3df124f0d09bd49dd47dccbdce0d5ff3
30eac023fc2a16b30c95b10745fd05136022ed9e
F20110409_AABVND vicenscontreras_m_Page_071.jp2
6eb7da31e1150e2f2898c9c3f1a9286d
88f0f0007b866e563315eb746449990ecd70254e
532549 F20110409_AABVMO vicenscontreras_m_Page_046.jp2
faab21a52b9aee03ea6d11479bafa48b
6f0f78e5c721a972da4eac9e88da18f1a951b52f
1008065 F20110409_AABUIY vicenscontreras_m_Page_085.jp2
feeb46b19169147af52cfa78c662cc64
1de15311c7eaee540b87b9bb29bb66221a997664
F20110409_AABUKB vicenscontreras_m_Page_055.jp2
1e68b5e2cf1fbe119696a73b2459f258
1f6a0298661645a210c4a74160042f5bab1a7165
33197 F20110409_AABUJM vicenscontreras_m_Page_035.QC.jpg
45ac63f640c381ed0592fbddfd78a5d2
771ee2be9fa6671f84bb60c4a5bf12b4753d6a24
867584 F20110409_AABVNE vicenscontreras_m_Page_073.jp2
85efccb011333a676f35583176b90aa1
930535270e75fe0c44a67a34554709b2a2371351
1051966 F20110409_AABVMP vicenscontreras_m_Page_047.jp2
561ff831e1768ad6b5941aa1f05f619e
d67b7cf70a0c61c5107610e902e6098c0ff9143a
F20110409_AABUIZ vicenscontreras_m_Page_104.tif
28333599e2e3691b3ee9dd12192ab92a
73eab2d5e962eb87d74ccc35b59c786ec0e662ad
7235 F20110409_AABUKC vicenscontreras_m_Page_133thm.jpg
7fe0c0b1feac2221555fb67bd781188c
5a61e9f68b05e36a7801b7e5f09fa9fb1193e303
104115 F20110409_AABUJN vicenscontreras_m_Page_022.jpg
1e9d772f04dc854e140251a4152f4cb3
4c1eeaa7625c596113da277dee55b77206a6939f
881388 F20110409_AABVNF vicenscontreras_m_Page_074.jp2
5ef77ffc3ac69d3a2f8613654a2ace1e
6ed60a87f2c09b29ca390f429182379e1783f8f5
1051956 F20110409_AABVMQ vicenscontreras_m_Page_049.jp2
a51841c65538a6eaa01a6734da52dcf9
5efb9b82b4f5dc44cfc79ee15d687e63b42b1200
1642 F20110409_AABUKD vicenscontreras_m_Page_115.txt
e9979045835d3de5b93257bbf29bf6af
14a88a46b6e014844b31b846cc6d39e1588d6bef
8103 F20110409_AABUJO vicenscontreras_m_Page_063thm.jpg
6c0b49a80ec72ce37fef99cb3c4d983d
c281c5fae95bfcac2670b778d49de77c0de6fe89
687527 F20110409_AABVNG vicenscontreras_m_Page_075.jp2
18bba20642365adcac6886a8c66c43fc
a00733bdc7884f2e77f52d460dddb6fbd4b38633
829044 F20110409_AABVMR vicenscontreras_m_Page_051.jp2
af75b843b945e6a21476d0089c38f924
249bdae4715c86a12be2bb694e2ff4c55f991e36
42627 F20110409_AABUKE vicenscontreras_m_Page_118.pro
6125b4bc75874379f34b298645a5f115
7c6422d1e33cb93777e9cf9ca0187182d5f21198
46081 F20110409_AABUJP vicenscontreras_m_Page_025.pro
21b13256b1179addef40061d6288762f
2668b836059373f8aaa94d80822824ddb5acff3d
F20110409_AABVNH vicenscontreras_m_Page_077.jp2
3e22384fd83a7fadf583dd6e64264958
a4956f4e0b84b83c4bf8bcf39dee7b1ce987af46
786186 F20110409_AABVMS vicenscontreras_m_Page_052.jp2
13de538273090a0284de945a656c941d
c63aa3af569979dbaca4b8cd7b0535a1a332d1ff
1975 F20110409_AABUKF vicenscontreras_m_Page_020.txt
30c0980a02ccefa8603137f760d40425
4c018ccfc428b539003888c608b0606f07bf42e9
49794 F20110409_AABUJQ vicenscontreras_m_Page_127.pro
ea59d4a1a0bccb2f466957ec61ca2c8c
28de6f0f0cc28c86a8b2cbeb74eecfe5395daabc
1051935 F20110409_AABVNI vicenscontreras_m_Page_080.jp2
37d6b37751caace42d0c0db36570cd6c
cb436fe11ae168a24e24bc30d9e9610d101248f6
1051931 F20110409_AABVMT vicenscontreras_m_Page_057.jp2
1730220fcbe04ae53f68c87b9d91a492
7128048b13e30e1e5b20244c2c0e533decf195bf
7320 F20110409_AABUKG vicenscontreras_m_Page_009thm.jpg
57286323c431c4a5c957632dceb7b9ac
b61519536b7ee5f4e2f0d1179b7702800b53f785
909 F20110409_AABUJR vicenscontreras_m_Page_102.txt
2c15457232dcfd895742ba9a9fe430cb
2bb5ed74e79ef4dc1a70e1bbd33659a1f1414fa6
1051893 F20110409_AABVNJ vicenscontreras_m_Page_081.jp2
44143a982296fa88aa1198b1f8e648a5
2e31e2e82ba373ed3ee40fd9eea266a8af5a4ab1
655981 F20110409_AABVMU vicenscontreras_m_Page_058.jp2
804ea16205d88a2062c9d6f38b852728
5ed9ff3ec47fd7b96788ee1cc9d63f0e0e1e26f9
32057 F20110409_AABUKH vicenscontreras_m_Page_030.QC.jpg
45ab734e3e44f680f98446788dd68f0e
c20730d51c44b5c6dfd8ef36749828012132043c
7215 F20110409_AABUJS vicenscontreras_m_Page_105thm.jpg
ca6e604fdbfa328444a4318d986a5c85
e076055f9ebcb737c3dacf0a8ba52254363e4497
969336 F20110409_AABVNK vicenscontreras_m_Page_082.jp2
6553814a8d831cdd9b7fc3f1c226bfbb
cf3a7754e5129ad0ee01d10b9f4c0c34bfa7ed44
1001309 F20110409_AABVMV vicenscontreras_m_Page_059.jp2
5efee5a54cd34797e3e38388cc6e8c76
ce9db84e9892c010eef5103934fbd250c30f6c8f
1956 F20110409_AABUKI vicenscontreras_m_Page_062.txt
4c2f1171cce3ebcee64e207cfbd3415f
a08661115e778866fe9b568e418ff319bb0b2c66
37663 F20110409_AABUJT vicenscontreras_m_Page_138.jpg
94b1dc3e2a6b27039fafb77dcba92b7d
bba7ad0ea57f3bc3bb77ef9319aee971228a6246
F20110409_AABVMW vicenscontreras_m_Page_060.jp2
c37f2e4c86a028afade053978f22a27b
a28fa019d1116cfb420a1459ecdc70a54a67d5e8
43320 F20110409_AABUJU vicenscontreras_m_Page_042.pro
6f38cda15e76826acffbe0fca8a6fee8
c5904b300c1bd3badc755a081d6f1b599bbe4657
863412 F20110409_AABVOA vicenscontreras_m_Page_111.jp2
7a4e69c7cb9c258cd68dbbb45307ad77
8f31d51b70c8ba81c7989a04eb184c9cdf70e957
1051938 F20110409_AABVNL vicenscontreras_m_Page_083.jp2
c47fcd5c2ad152bb3327ba4442ddc83c
4417948a5ae6248e13a95a9f61f65847ebfa3b7e
1051985 F20110409_AABVMX vicenscontreras_m_Page_061.jp2
6bd49f0c7e06d6049d183c34642262ea
e0f082ea7c2982b68a14ccb0d787372602b03e6d
F20110409_AABUKJ vicenscontreras_m_Page_127.jp2
969e51c11a516428fa8c4e409ff49c04
e89025c1df674f371b060bdfc058f2d07382fc1d
100810 F20110409_AABUJV vicenscontreras_m_Page_092.jpg
906e16c3c6d0dd0a58db09a763c973bc
85c717d815ab8fbdadc8cae3924edaf0501f6943
971554 F20110409_AABVOB vicenscontreras_m_Page_113.jp2
4141ba3d5f5248a03f256c17b84b8015
88d2cce372f6abb0f64af155df7ec2568713d371
881918 F20110409_AABVNM vicenscontreras_m_Page_086.jp2
e6f57518c996aab36d65d8d89dfed75f
108d707058d364d4da05d90200b49addb2cc1975
F20110409_AABVMY vicenscontreras_m_Page_062.jp2
fe93efa2ae9cf89e3a9e2314763c6aaa
8f3ef4d1554eef9fb33e08a5045db70efd71588a
8479 F20110409_AABUKK vicenscontreras_m_Page_121thm.jpg
7a1438fe172d4a4122e243133fc83c7b
e8f9e5abd66b5d9582d2baba9b7b7b7197ec3f48
2014 F20110409_AABUJW vicenscontreras_m_Page_029.txt
125cc3cd089e8c0fd9e816f64b541259
df450061a836694262a168569ec90819bc7c6ad2
F20110409_AABVOC vicenscontreras_m_Page_114.jp2
297466dd716db109fb2e42cc1f44050b
bcdc6c91adae0f52ea82ecef8d899f3f29cea21b
1041738 F20110409_AABVNN vicenscontreras_m_Page_090.jp2
fe001761ac62b7cc139962217717d374
4f174c14afb08e67cc3fd9113fe44cf6dfb28089
F20110409_AABVMZ vicenscontreras_m_Page_065.jp2
869989e1cd8156044b04ebfebcd8db5a
c5502208aa13b0e57ee07af31f8d6233573e77d6
7247 F20110409_AABULA vicenscontreras_m_Page_111thm.jpg
2ed9735b34229fb5e50246f72ad51c4e
d540b0a7c33390a753200297c26cef99a4125cb0
1735 F20110409_AABUKL vicenscontreras_m_Page_133.txt
f0537d80f0fe658661eadd3a63506b61
e32b79225d26f22fbd6959f8c86dc7359199195b
83007 F20110409_AABUJX vicenscontreras_m_Page_111.jpg
f69ab680ed29cba71e2633c5d16dd99c
c47e41aff8c886f3798b1602fa236be68485e826
956016 F20110409_AABVOD vicenscontreras_m_Page_115.jp2
1320c8e1612d066356927424dea01416
48ff6b4b8e032594122650760f28936cc4eb4afc
F20110409_AABVNO vicenscontreras_m_Page_093.jp2
e1bc068b5bab334a35871965a5a6fcfd
886c7f6a6a42221716f83d199ac5c42d6d48f8d8
51258 F20110409_AABULB vicenscontreras_m_Page_016.pro
59a5835bcc40938c54df6bfe2fc51969
1e385adf4f32ca37e84355091d6cc9129a6a4a3a
1737 F20110409_AABUKM vicenscontreras_m_Page_085.txt
b2bdc2e21c367a47113f20eca9a11938
6ee87fe0340ee4cbd8cb1dc33f3711be81863a7e
F20110409_AABUJY vicenscontreras_m_Page_135.jp2
153821a8fc93387a4a19956aa7ec62e2
286b5b4415ee06629ab352fd602c00fb1ef9f7ca
1051951 F20110409_AABVOE vicenscontreras_m_Page_118.jp2
36f4477cd5303c4c421b37e146073ad6
5f8c9566bb9b8b687af0da60caf9fc90e818a1af
880909 F20110409_AABVNP vicenscontreras_m_Page_097.jp2
6a2154a6d4529626bad422edfc79957d
0fbd30f911795e942dcc814dbbb20f51cc0ceaf3
16468 F20110409_AABULC vicenscontreras_m_Page_087.QC.jpg
671706f1381e7f7b5accba7b5024558d
e5f88ced78228572e12d2d9b860a8ed0e3567a9e
F20110409_AABUKN vicenscontreras_m_Page_040.tif
4550e92dd02c4da1b26030ff74ffb3b9
17d4296f1a78e06541a7d6aa17b6b2a14a307af0
86563 F20110409_AABUJZ vicenscontreras_m_Page_073.jpg
facfe88236d82a45c6a53a0e5aba94b7
40bf0e8d8bbd01fab0c9c69947bbf2acf390716b
F20110409_AABVOF vicenscontreras_m_Page_119.jp2
db9ee1b86cad6dcf67daf0c9d7e0e636
3d332a76808288f416361b94ea73c0af88c8cec0
995379 F20110409_AABVNQ vicenscontreras_m_Page_099.jp2
e9cc0e2a015684f3ef91eedf0b437a91
db87e69ac2c801923ce9362f47c6b815a72eaa30
1051979 F20110409_AABULD vicenscontreras_m_Page_063.jp2
37a19ee599cfb3389e2264f30d147ac0
252c2133d38158eede35d86b28b4e6421309a432
7964 F20110409_AABUKO vicenscontreras_m_Page_018thm.jpg
aaa53a8ed13a122c35863eba9f37da3e
1d8e87cfe2517e8ea108a7fabb102e4c2928a340
1051927 F20110409_AABVOG vicenscontreras_m_Page_121.jp2
a1b98edb6808d192875f61743007bd68
0f28049d47cfaacd5fcba106d99991dc5880f00f
1051968 F20110409_AABVNR vicenscontreras_m_Page_100.jp2
fb3812dcef7a4a66a6bced7f47ad8e29
a3648bd1877636126d54e8fd6c1b4dec5cb74dd6
33275 F20110409_AABULE vicenscontreras_m_Page_136.QC.jpg
981b5d784b517a4af76a7938e5a312ca
b7260419d796353358284e14e5072c61881055a0
1051915 F20110409_AABUKP vicenscontreras_m_Page_028.jp2
de0ce8c962c14f75df5fea47e1f1a56c
b1dc56f6cbae375d3ad7762547afbf3773faf07e
1051963 F20110409_AABVOH vicenscontreras_m_Page_123.jp2
804d046c6c540d0747ef79ff97e21d14
22872f31191f2a518370d00c73de25d3377ab1be
1051909 F20110409_AABVNS vicenscontreras_m_Page_101.jp2
ad564b6d792ef47d902e9c0dae6b42ac
fc0c04eb29dbc63a4d7b2f17b083e8906db12b31
136050 F20110409_AABULF vicenscontreras_m_Page_124.jp2
1cc4a7d2e776e132a5006284abd89ee4
8ed69fd189b5fae474d2ed691b5b707c86f29f02
1665 F20110409_AABUKQ vicenscontreras_m_Page_026.txt
403b66a7f93a19521104aae03e695284
a605f59c3b7e815679a0d5b06ac533a5503af715
1051962 F20110409_AABVOI vicenscontreras_m_Page_126.jp2
d8d6f033ce1b00bf8f679a3e1e969d28
0de4c6830b5de46824d6eeff7015dda7c1defc01
522267 F20110409_AABVNT vicenscontreras_m_Page_102.jp2
55b05435352b8e4aa6e073bdb6bd8b01
d0c7837581036d0dc5c7f1cc41689530dabe978d
945567 F20110409_AABULG vicenscontreras_m_Page_023.jp2
2e3caee7857afb62ab3b058dd432f860
67c36fd80ed73c6c7c90654aabc22a47eb6ef1ff
F20110409_AABUKR vicenscontreras_m_Page_092.tif
6534990d976bcb1e5f97d70cbaf5c899
4938eb88d997fe75ab7e2a7510214e12a2472c11
1051908 F20110409_AABVOJ vicenscontreras_m_Page_128.jp2
f6887d3c752c6acd5460a69ef4b926e1
f56b0f17c83533a461d6f4a2e64bf9cfa9bf093e
1051967 F20110409_AABVNU vicenscontreras_m_Page_103.jp2
9a472ee41ed9e1d62b9b6f19238eeb01
1dbb52db4c29df1e2fbeb14b16b0d3c41529e247
34280 F20110409_AABULH vicenscontreras_m_Page_131.QC.jpg
682b902fad5bf32b08fce92a42801f17
28069a7c52ff78343ebd077eb236d6a0370c1b9d
16112 F20110409_AABUKS vicenscontreras_m_Page_011.QC.jpg
b33f11aa057a76616e09ceda42810b9f
9e8ac3fc962d982afb4363f0457c5d6c38f851ac
F20110409_AABVOK vicenscontreras_m_Page_129.jp2
7140768757606e0f9aced11c78670688
b57f2fa78b9f856d47f15b3712203d102a1f1525
1051948 F20110409_AABVNV vicenscontreras_m_Page_104.jp2
cc065e71eb847795e74ddf433acb4736
7b419f233ab9f6c5202801e8a923f2b755617d1f
1794 F20110409_AABULI vicenscontreras_m_Page_099.txt
19afc314e52d30e3bf326f542d4ff8e9
c1602347f2b2cf2f877b91f284da402fe6f461b8
F20110409_AABUKT vicenscontreras_m_Page_127.tif
b672496a1ff5044fdfa41b7cedfafe7b
282f222317bf8139f8fa21e84ef3202d4ffc2903
1051958 F20110409_AABVOL vicenscontreras_m_Page_131.jp2
daec2e31e3a5bedd68b4b1d854fe47a0
2326397df36e71b8b7febd3e7b3c2d3f3d4fbc4d
1026850 F20110409_AABVNW vicenscontreras_m_Page_105.jp2
c050d310d27c0b81045d5d03cbaf54e1
b030b88fc07573166e2150947b5f83613ee96eaf
5893 F20110409_AABUKU vicenscontreras_m_Page_070thm.jpg
9ec27b8ea84596b3d9d45cd669a4364e
407acb8fda7f4c2c2d34000a19682a247a495ef9
104875 F20110409_AABULJ vicenscontreras_m_Page_107.jpg
ae00b4343869bd0564f9035126f79fd0
0b18a80f167604c57a8e2bc05739a44d52a3929d
7991 F20110409_AABVPA vicenscontreras_m_Page_024thm.jpg
242b53d3b8fe0c429314d41acb8e48be
50c3762ba59dca885ad65df73cc70740c541bf2d
766694 F20110409_AABVNX vicenscontreras_m_Page_106.jp2
c84c3b07c816417c48c59d1a211ec881
8ff8b280c07de7ecced35178863973cc7376ed2b
1051975 F20110409_AABUKV vicenscontreras_m_Page_117.jp2
db4a5eb45dd42f5eed26852d57b04b9b
14f1f5653f4b3f2e8b179c1c4a111ca05ac40778
7330 F20110409_AABVPB vicenscontreras_m_Page_026thm.jpg
a07e4ef488b7d50f5d6333a83381f232
62ec648107a53a763856ea84f6cd0b348e431a69
866590 F20110409_AABVOM vicenscontreras_m_Page_132.jp2
0a3edb535b17703e5ac6538aa2be5a59
4b3a6216a344bcca858daacc26c846934ce38e06
F20110409_AABVNY vicenscontreras_m_Page_108.jp2
3b3a3a2382a36a80053e9a759631dd84
5746e52f1f6fd75ec3546c92bbf2906cd45b434a
1983 F20110409_AABUKW vicenscontreras_m_Page_123.txt
26c33cb7941cf89875d97b1f003b8cd5
3d147728074bb54a0d3d00fa6d4b976b9f357cda
7886 F20110409_AABULK vicenscontreras_m_Page_019thm.jpg
f06333b7d4e0a810778a42fa48f71a2a
c1daf4e8f66c934451b3da30f18ce4e4e64841c6
8094 F20110409_AABVPC vicenscontreras_m_Page_029thm.jpg
98af9606933fa77f99fb2da5bcfdbf2b
2e3aee42a6c05b4654ba9823873585e050cb9377
F20110409_AABVON vicenscontreras_m_Page_137.jp2
1b08bdc0b7f8089fbf02aee5fd9f564f
5cc4552aa532916a7975ccd18443494e479060dc
799946 F20110409_AABVNZ vicenscontreras_m_Page_109.jp2
875abff926673693effc100011699326
1e193bd6103f479014de40d158ea0ff4a13f9db2
105209 F20110409_AABUKX vicenscontreras_m_Page_120.jpg
0c3b2addc4fd273f4c99c679ccf7d978
4d6237cef4a837b4403253d7100d7f8a0591458e
F20110409_AABUMA vicenscontreras_m_Page_129.tif
15bce9d26ed519010ea44b53cfd6e15c
b8f5bec304e6266c098731716c0012c9adff1c53
30327 F20110409_AABULL vicenscontreras_m_Page_085.QC.jpg
b728e6b1427a528ff9b337050d973db4
aa4f7d099936aa64f4b769974149fd23417c0b63
7882 F20110409_AABVPD vicenscontreras_m_Page_030thm.jpg
e66138b9fa0fc5984e565cbf40e0e9a1
fb17a4b564f8f1922cc678b527941ec1e72b08b5
413967 F20110409_AABVOO vicenscontreras_m_Page_138.jp2
3cacba7f747be0f71bca2d4887d5debd
2e89f444ed8c04a32f954eb364ec1b4dc2000d7a
100456 F20110409_AABUKY vicenscontreras_m_Page_038.jpg
afc01ca61d3f11739ac9e0be71c69cef
a26e9a56523cc39899181a086be5be613e8f585f
F20110409_AABUMB vicenscontreras_m_Page_107.jp2
32e21a6ddff8a6cef1dbbce9c1a43985
8abe81e4bad336ffba80e34ba53c1423320e2fcd
F20110409_AABULM vicenscontreras_m_Page_068.jp2
f5e78db920aaffc5fcefbde091a4afe2
0c56ae2e2c2644f0a8077404367e1d1fd193340a
8599 F20110409_AABVPE vicenscontreras_m_Page_031thm.jpg
09a50fb3476798b8007455ea860bf686
fe484a16f59267846f028a8d00da781e56f82ef4
694 F20110409_AABVOP vicenscontreras_m_Page_002thm.jpg
a36e3830aaa5c925a7185a7c2366a454
5e4906735e107a59c3ec1635c9231ebd57a0ea2c
103362 F20110409_AABUKZ vicenscontreras_m_Page_065.jpg
11bf0fb089a5c6a01030088cce16fdb8
7a1e43096962938d9caedb51f5da4c96ab0c8f88
F20110409_AABUMC vicenscontreras_m_Page_020.tif
b6f53afbf98445d58f860fde93a11945
0498f400df6267add8aea3d93cfc4300a6ea4146
34832 F20110409_AABULN vicenscontreras_m_Page_118.QC.jpg
bf23c5a588d6336596bbb7e745bdce36
779925f731eb19fa1bfc64794f947abd3b72d391
8816 F20110409_AABVPF vicenscontreras_m_Page_032thm.jpg
54d1a567659c43d1ae5f88165ee9c649
ed4297e8a9714e7a55a6b716d4337427847f0ec8
3391 F20110409_AABVOQ vicenscontreras_m_Page_007thm.jpg
715739ba70ce689d81427219bdc73a3b
6cad227f7186c41ae0ba02731267cf994f200fb1
45830 F20110409_AABUMD vicenscontreras_m_Page_122.pro
34e1a886de4981e8064c5b1990183d68
2b7ff77424d256541d8a07bc55696a530565b1b8
48672 F20110409_AABULO vicenscontreras_m_Page_024.pro
ab6b0a41d441ca1575982fe8a7336baf
f30bd56d46a288092ed52bbf90874268d53f4b45
5475 F20110409_AABVPG vicenscontreras_m_Page_033thm.jpg
7b5f0d8d85c9f3eafa0e25afed0e35ef
d11142f25934f56e39591be00fe27b0770cb4a14
3394 F20110409_AABVOR vicenscontreras_m_Page_008thm.jpg
c4a317be3cab5f05b027190d6818d86a
cd50771e11ab60d675c87de42033c2e3ce31a689
25314 F20110409_AABUME vicenscontreras_m_Page_007.pro
75827b2e25e2eeb48deded49cb46bc27
141f50180fe942b60f8f40c4b673719e37c5a321
F20110409_AABULP vicenscontreras_m_Page_097.tif
0700cfb1a88cd8d8a842e8c945036511
9321c7fec49677475fe4fa9aa7bedd33e073811f
7346 F20110409_AABVPH vicenscontreras_m_Page_034thm.jpg
d44858c3cd7b6e77a81945eb59059d41
443689f8082cae407659ecb070f962ad71c596e7
8449 F20110409_AABVOS vicenscontreras_m_Page_010thm.jpg
5c0ac3019d2012b6a201fc5925319dc6
3bd337f033556e84aeb245286284b3351394bfe7
2012 F20110409_AABUMF vicenscontreras_m_Page_104.txt
8f50bbacd9689395d30f6b1249ba8f9b
917d65b46e3a4c064c420f27f580df1b7cda09a1
95712 F20110409_AABULQ vicenscontreras_m_Page_017.jpg
ba886111073fb4a48e5eab095f8f8d82
285977e25ae5b0a0b67c4527a351e50975904a0e
8066 F20110409_AABVPI vicenscontreras_m_Page_036thm.jpg
26a34326e90e6cbe9be1c7af7fcc36b0
35663216497aeaf6af0918ab2e2820f1a10b1516
4144 F20110409_AABVOT vicenscontreras_m_Page_011thm.jpg
1fdab8eea87a189f91333f47926978c4
08cdca13561a8c38cea56a8e6385a016e1c1d7fd
2179 F20110409_AABUMG vicenscontreras_m_Page_137.txt
bb4db848c165d369f12fe8f7cb1e9053
3d6615e5fb3bec05c65e9541b2481f79720831e4
7474 F20110409_AABULR vicenscontreras_m_Page_096thm.jpg
a20185f5e606a880b20e616e9070107b
369520a4adde111e0d4c7562ef6bf6a2cac9b1f7
F20110409_AABVPJ vicenscontreras_m_Page_037thm.jpg
1e897e90af3328fdc41158c3aed0d214
208631a56b5149ed52fb6dc026132970bcb502c0
7347 F20110409_AABVOU vicenscontreras_m_Page_014thm.jpg
da695748764167a8ceed688bb08cc506
b3908d2bf31e16418617b6ea2ea5cad3ee4e7f6e
8327 F20110409_AABUMH vicenscontreras_m_Page_062thm.jpg
6d66e17975855def6318bfc8113a701a
0fd846dc2aaa267a5f6cb6ff06730104281de172
22227 F20110409_AABULS vicenscontreras_m_Page_064.pro
0da51fb6f699cc283e4a21975fa07725
92e5e3e88835e113461344dae3b560333dd97488
F20110409_AABVPK vicenscontreras_m_Page_038thm.jpg
b0057aa153a243e038a298ff8d5a3cf9
349b8508f3488baf1fd89799344389870f819ea4
8269 F20110409_AABVOV vicenscontreras_m_Page_016thm.jpg
1404df35f9762519c3db0329d166f08e
7ca81665c5095e9d539d4dffb674044b97b3bb06
936947 F20110409_AABUMI vicenscontreras_m_Page_078.jp2
2e6af21a047443c80ebe5766989ed30a
096c90a867cc8d05d3ae196455d808a8b697b62a
929693 F20110409_AABULT vicenscontreras_m_Page_048.jp2
1e5fbfdc1290236563a8fcfea8a31c8a
9e62e451177779c0d03f97448fbcf7bb26abf786
8716 F20110409_AABVPL vicenscontreras_m_Page_040thm.jpg
c1ebbb8cefbe81c795895be29fffc4fd
b2b94916abfdba548619372efd138132d5972664
8295 F20110409_AABVOW vicenscontreras_m_Page_020thm.jpg
0dc2a65b2161726b98d3cd40567b2085
453adc6b99465caf00336c51e1ea092cf9065fbf
2015 F20110409_AABUMJ vicenscontreras_m_Page_121.txt
6165e9fbba03693f1c88b7d2ab1d2b67
961743b31ea96934ee05ccfdc9d888684098b9cd
34945 F20110409_AABULU vicenscontreras_m_Page_049.QC.jpg
d0444fe53a05408b0e41b81c82feec7f
01ae15525574e0f8729a6ade2d006e0d04b1b6cd
8213 F20110409_AABVQA vicenscontreras_m_Page_074thm.jpg
2f211f1e624b91fc0b1ab2c49ad2ed6f
1fe720642406face6bb6987853c238f39c4d344e
7510 F20110409_AABVPM vicenscontreras_m_Page_041thm.jpg
667c412974088bd26df28451d11a6307
211942440c684fc8e7eba2af616821c268876d64
7906 F20110409_AABVOX vicenscontreras_m_Page_021thm.jpg
6f65dd92141ef14227370ee423259b4e
251d88ece13e23caace8fba1cdb3864c69accdff
1921 F20110409_AABUMK vicenscontreras_m_Page_018.txt
3fdbdfdb7502c9f078f74df2ae5e2a4b
8691f8be230f85f0ce4fdeb515b7cc0ae8babbcf
97590 F20110409_AABULV vicenscontreras_m_Page_036.jpg
f9871b8935209a946e9f886c46f84e5e
e341a4d0bca1d3c72bfd1d7048c5a6b6a6874c3b
7500 F20110409_AABVQB vicenscontreras_m_Page_078thm.jpg
0a31463d9b7ed5511750469b646d1818
6034c7215554d1080181dbd3f6507d04719f50d5
8457 F20110409_AABVOY vicenscontreras_m_Page_022thm.jpg
a686d2a3502930cf2855f05d09c195d0
2723818f980b7c5a4a2b6b9158dfb05a5b0b6e2c
1051861 F20110409_AABULW vicenscontreras_m_Page_130.jp2
ece637a8449db480efb802cd02c3ab47
0a767f8e68b8efa9d800895431022f43e6f1acf5
8355 F20110409_AABVQC vicenscontreras_m_Page_079thm.jpg
1dd77abd9f9b69f1ffbdd143a393b9a6
2500a9bc422b6632f4999d91b624696f601a3e9b
8924 F20110409_AABVPN vicenscontreras_m_Page_042thm.jpg
bf11938525f0d8d01024d2563f9fb812
dd141582fad7ea03c1eb163c07c5465da5510f03
7554 F20110409_AABVOZ vicenscontreras_m_Page_023thm.jpg
dd74b74cb56f0de8e32b463ebc139aff
3aba27d7ab7778da095b712b7bcffd717b49895f
32100 F20110409_AABUNA vicenscontreras_m_Page_036.QC.jpg
40a5bdeafc0f556d66f6285fa7bb840e
245c9a5d6cdee7708686419dcb1e462e6819c034
F20110409_AABUML vicenscontreras_m_Page_022.tif
4a48f83137b2c9b9c10d04c5a3168d71
10d196b2406c35f2ee1cc959829473e33d669983
957016 F20110409_AABULX vicenscontreras_m_Page_026.jp2
ae99fa2c6ea7e9ad2f2adb73d24d1fb1
996347136e939ac87c5ccccac8cc33af4c90590b
F20110409_AABVQD vicenscontreras_m_Page_081thm.jpg
8453e74a4f5ae68ef2c79baecb3f653f
c8c7bd39ee7ee95353a6831e81ea8b1600d0628d
8571 F20110409_AABVPO vicenscontreras_m_Page_044thm.jpg
4092d098b5dc6975273fe0dbefa4ba90
c1293a0ce0405c6484fa2c2a7258716bc2e3ae9c
31567 F20110409_AABUNB vicenscontreras_m_Page_063.QC.jpg
f8a4d37f7b70eacf3c2b9c5d0306c883
414930a20c4c45af8bd47e75fb5c6b659f5a6211
F20110409_AABUMM vicenscontreras_m_Page_110.tif
931340d68a6671fe1a0f0022b675a6b2
56f82eb790213f9f4571ce90e4e6c3af295018f5
F20110409_AABULY vicenscontreras_m_Page_064.tif
695abdf4c4e9765cdff2d198765764ed
b2944901e477d5ae372465a3df22875f821b4cdd
9021 F20110409_AABVQE vicenscontreras_m_Page_083thm.jpg
fbeca863df1c06889c35470611bb971f
9508bcd12e50b18ea69c5984268c486abf09037a
8153 F20110409_AABVPP vicenscontreras_m_Page_047thm.jpg
8166a501d5d2f129e5fed7a5c0bf3f30
43e6dea7aeb3ce1b14f2d14c4ceb1d8318b7b8ed
83402 F20110409_AABUNC vicenscontreras_m_Page_093.jpg
e81baef5f4d887b00ab31215bbacb0db
79475ed1632f33f3b523b0c81c020753fcebb881
109098 F20110409_AABUMN vicenscontreras_m_Page_137.jpg
c26c404c6034babf2f2adbe0aa35656f
5aafea8f2868d0bec4fdf0f75b3934374db262f6
31077 F20110409_AABULZ vicenscontreras_m_Page_091.QC.jpg
9f8fd69706a5a18381b8f4940e36c50c
d1d92e24b7b75399ddeadc606161857dad4ccb9a
7406 F20110409_AABVQF vicenscontreras_m_Page_085thm.jpg
662ec7e12adccabe4b2d8736d1a22745
03b4bf28335d9fda08f6ea740762407885fe44c6
8337 F20110409_AABVPQ vicenscontreras_m_Page_049thm.jpg
394553e96dbad1d328f8189829b2ff9b
b3da05d6ebf639156315e2274c41762483b03514
8494 F20110409_AABUND vicenscontreras_m_Page_065thm.jpg
d97a421e5f4dd264365e954523776cc1
6b63cd72d1d57f25104ff0fa4562fc08c4fff96d
1141 F20110409_AABUMO vicenscontreras_m_Page_056.txt
383cc2641cce693b92d086449f9aa309
14de0108f100bdf6a60e55c01267c0b668f5736d
7087 F20110409_AABVQG vicenscontreras_m_Page_089thm.jpg
97cedf6a580c4c46983b0aeb1dcd994d
839cb54b4d52ce6e2d101338b421611b76a1433b
6654 F20110409_AABVPR vicenscontreras_m_Page_051thm.jpg
f204bbf710148b52b02d620862990905
cb516dd712d9398ec09b1e0ab054359cd57080c8
8362 F20110409_AABUNE vicenscontreras_m_Page_104thm.jpg
e2592e39382eeeef28c24faa1c8553ea
b42748f2ce5d9dcc4fa279f0191eb4cf583ea833
1997 F20110409_AABUMP vicenscontreras_m_Page_131.txt
9f937a0a1a5dd016ce6b1e1a4387a65c
28bafd12a72606c76a925e4b2286e5ce38bb675b
6871 F20110409_AABVQH vicenscontreras_m_Page_093thm.jpg
ff175091016eb16472aee3cc85953ff7
5db0ff8dd73ccf903fe21f26cf81aadf8a4b2629
6873 F20110409_AABVPS vicenscontreras_m_Page_052thm.jpg
5aabc588ab5026c7a2733b87f4766f51
7f4c4e743040a37b3e6857cb4b410ad0207eff20
31624 F20110409_AABUNF vicenscontreras_m_Page_096.pro
459a330d3f4220619faf06d19a1b7188
ca4b06c9b68ada053dfdecd698bc10b1ededa3ee
F20110409_AABUMQ vicenscontreras_m_Page_007.tif
8f9730579840662e911456daaeb7f40a
edab518be7317f4000899a1400f3273482318adf
6273 F20110409_AABVQI vicenscontreras_m_Page_094thm.jpg
9c5e33ee061930ce461ec5603ab695b8
5eb9ab5a2465ca690cdaec5d72d0302657912711
5346 F20110409_AABVPT vicenscontreras_m_Page_054thm.jpg
24129dd9b0e305c1e4b41b08342d16f6
1cc742fa90b6f1ce234f790a8d3e97b6d9a10086
F20110409_AABUNG vicenscontreras_m_Page_076.tif
41c937e3922122c6192c33efe0c28748
362d1471f86282b85bd3a9b30d50ee8b90422fd4
28872 F20110409_AABUMR vicenscontreras_m_Page_078.QC.jpg
1a516ca03038ee7ca7423006cdaad02f
56227d4b74993dc7aa5309e8efef2862430d7875
4070 F20110409_AABVQJ vicenscontreras_m_Page_102thm.jpg
18e7ba8f51b3a17f66615fb04311558e
f480897db14ecf50c3687c4823f79976b1950a99
7986 F20110409_AABVPU vicenscontreras_m_Page_056thm.jpg
0cd8220b54a64242b74107fdb554abad
0e52ad2986e15f25c6eab6cf34d0e13a93e27b21
49005 F20110409_AABUNH vicenscontreras_m_Page_077.pro
9e3ce99feb3efee82a03ad97e45055ab
e58d83093007683d35d719a356e4ee1a346a4e56
7136 F20110409_AABUMS vicenscontreras_m_Page_003thm.jpg
311f0819ecfdb0704e5b9e4f3fa6d934
5b2184d7482548eda7558a1fec1b82c33a2c51d8
8771 F20110409_AABVQK vicenscontreras_m_Page_108thm.jpg
9d64925cf10ab4c910d347d63e7b54f7
f650e97b854b844e241000a9c283668f578f2069
8280 F20110409_AABVPV vicenscontreras_m_Page_057thm.jpg
936be2a9ee5b902158a840bf8f7737d2
c68ffdb505d5be0304688c150d354360ffc15fef
F20110409_AABUNI vicenscontreras_m_Page_071.txt
542a9aa29c06e4596e7437fc43a9109f
e1cac482c97f8648cf03edb589df0f061ed9e92f
F20110409_AABUMT vicenscontreras_m_Page_023.tif
529d71b69d2b0768aa08692bc4a9d370
35e38716c5c9fcad57eae9a515cc68d01534eb1b
6693 F20110409_AABVQL vicenscontreras_m_Page_109thm.jpg
3e5dee5b67d87a7f6b7d7a21c14a2e5d
85a5f4fb4f2c039231e0918253e8a94312005854
4922 F20110409_AABVPW vicenscontreras_m_Page_058thm.jpg
693a51948e6dd0974c79aed68ebb7efd
37b12c054983eabff3a07a5c9439eb88a651e9ce
99874 F20110409_AABUNJ vicenscontreras_m_Page_060.jpg
f7cd6297ddc8f8089ed4dfdc086c6426
2398eaba780309efe6e80f40736b389edd3fb12f
27431 F20110409_AABUMU vicenscontreras_m_Page_133.QC.jpg
fb61a939fbeacdce07593e8f3b309fba
abd8dc36b6c5da896f51f69bcb50be61a0dccd28
8507 F20110409_AABVRA vicenscontreras_m_Page_134thm.jpg
47916c197abf2ab957906c09d3e25ae9
6ce81508fe4a4b777419b6aed7e19ea97ca0c054
7910 F20110409_AABVQM vicenscontreras_m_Page_110thm.jpg
dc46ce8228b4e28067a230a854531bff
a8c70f14644e277d634b362acc4a253b25cb5e9f
7528 F20110409_AABVPX vicenscontreras_m_Page_059thm.jpg
709b9cf95ef54230c2f8a47726310f8e
6c17727f10fa484fedf799425ab7c1dc26d64756
831657 F20110409_AABUNK vicenscontreras_m_Page_116.jp2
1e39c78034eee965f31d06e9a021cf37
94fc8628ab0d8617beeed420fcd7bd094e5965b2
F20110409_AABUMV vicenscontreras_m_Page_106.tif
5162ed9216d4e48e93ed7cf336a62f7a
14fe7dfad109f88ccb808b2623120799e0c7c713
F20110409_AABVRB vicenscontreras_m_Page_135thm.jpg
7718cd26ec4ea10ac1c02d3b45d84018
381aa205ddd075b932e8decf5932b3a07701d546
7912 F20110409_AABVQN vicenscontreras_m_Page_112thm.jpg
f36defff057a2e28a6238045855447e0
8e8f35727a7cc9308acfb8a586d4abe0b4df835d
7595 F20110409_AABVPY vicenscontreras_m_Page_066thm.jpg
ab558f6c3ac810ee72cca7d5c07848e9
93e40c2b5172384a18b4bbca6329eee400683a4d
F20110409_AABUNL vicenscontreras_m_Page_111.tif
e7e0e7f2346cd61cf6bb797eeeb12bb5
8b85d7b7a5a2005e6db537162d2afc73d8e2ffce
32449 F20110409_AABUMW vicenscontreras_m_Page_114.QC.jpg
544f0c2eb6dbc783275561ece1e0f50d
f175560e99992232a857e656f9bde988b20072ef
8065 F20110409_AABVRC vicenscontreras_m_Page_136thm.jpg
d672fdfe6321fa564212772a403bea45
cc458bc17247ed3ec57d5eaa2ccac881fd50d5f4
6736 F20110409_AABVPZ vicenscontreras_m_Page_067thm.jpg
e71a267c3fae639a92bc59751a0893eb
0522a509c99cabad966fafeabe94906c94f55ea9
7851 F20110409_AABUMX vicenscontreras_m_Page_025thm.jpg
4fab8db9c456416d2efb40c3ce61f129
75d895fdc300911b69e77af4887aeee5f9e93f16
F20110409_AABUOA vicenscontreras_m_Page_122.tif
6845cd70d612250d812f95135cb14806
186c7b5869576bd7faf33c5f93585917255d595e
3431 F20110409_AABVRD vicenscontreras_m_Page_138thm.jpg
054e7cbbc5bc9f6d6366590c38192bac
98f5baec3f2e81f66cd69b5d650965642b0bd091
8198 F20110409_AABVQO vicenscontreras_m_Page_114thm.jpg
0f33b10b7606a2269d7f5fd91e4e254f
ff3c6b8c681185e152d7b030bdc73d64b325455e
F20110409_AABUNM vicenscontreras_m_Page_036.tif
1308dbd351eb942413a23b590eb579f8
7fea3efd87ff48e33b2a09ed354056b09424759c
30227 F20110409_AABUMY vicenscontreras_m_Page_053.pro
ddd2c9c1766694eb61478a8a3337e212
4a01d916276ea053daaee6bc00f93bf61d35065c
87999 F20110409_AABUOB vicenscontreras_m_Page_115.jpg
a0fb34fe1f0e5555520fc3831bcd3558
479b29303dacae08a6be50983d2f867fa7dd27e3
167246 F20110409_AABVRE UFE0011464_00001.mets
260ed521211df2d41e1a384b28b4f616
18a05456424026238fb4e977f1aeeb4ce151a5c2
6672 F20110409_AABVQP vicenscontreras_m_Page_116thm.jpg
c83aa9685132e26a06e79a3f0cb2867f
a5514f355de451b9b4fccccc4e63d975e86de3c7
8095 F20110409_AABUNN vicenscontreras_m_Page_100thm.jpg
bb644bc919513ae7204a9a520a54067b
7e22509518f0b7c985656362928517783e4d272f
103459 F20110409_AABUMZ vicenscontreras_m_Page_020.jpg
aee201ce8e65520f7c75afc7b636cfca
970005e656fb6706b3939447af745af63061fabe
7185 F20110409_AABUOC vicenscontreras_m_Page_053thm.jpg
3c34ee076d85ff33091472209c0381fa
d3eb2e8f1aa997de5f9646071badfab1c02e85ab
8919 F20110409_AABVQQ vicenscontreras_m_Page_118thm.jpg
de4e4558b0968186c2fee0316863d369
ae6385eb468aec90984d87de320058d4185aed46
F20110409_AABUNO vicenscontreras_m_Page_130.tif
01f43a418266f0bff20608ecb9ff099e
47d1d4b93f8b0d599f4f8bfa01bd9ef0676aa506
F20110409_AABUOD vicenscontreras_m_Page_004.tif
f62f50fc7c7183e34baaf196dfa3b58c
5054945e05226891e7d5293f1b9ba7abf8a293f1
8534 F20110409_AABVQR vicenscontreras_m_Page_119thm.jpg
cd04369f659479937afba09b00219e94
b69ea39175108dc445eee2fc6624da10d4be8483
8081 F20110409_AABUNP vicenscontreras_m_Page_092thm.jpg
04ec3bb5cd25e41a4cea05cbbd65f687
7dee611112de57f58a64ef605bf04adea6533e12
7455 F20110409_AABUOE vicenscontreras_m_Page_076thm.jpg
51ddc09d9718c2dfcf8a042e32bcecd6
7624a428814f3207bf530ac928519e9f3b2c4c92
8673 F20110409_AABVQS vicenscontreras_m_Page_120thm.jpg
158a91a2f73438daa849cb796dcf5af9
c593cc788a4477da4950143a2c2eab96c06206c4
F20110409_AABUNQ vicenscontreras_m_Page_070.tif
ea81279a401829f781e03436bac93364
c95213c5e4e04d2e177eaebcd3f3aefc32492ade
35147 F20110409_AABUOF vicenscontreras_m_Page_074.pro
4919c10a6ca29211338aa5fce828abfc
1ada56d3bbf4b467f4565986aad6a92151beadc0
7788 F20110409_AABVQT vicenscontreras_m_Page_122thm.jpg
324f359e37bf1fcdd676d26a2853440b
f4fb321e4e084aef3f1921e371338a5e7eea1799
33183 F20110409_AABUNR vicenscontreras_m_Page_077.QC.jpg
4ac26c2b25af8d15c24c14294773e438
05a9d4d04b45e551c266d89d9da67472532e41a8
52237 F20110409_AABUOG vicenscontreras_m_Page_054.jpg
9b92ef872d3e653a635e9d69d43b570a
014ae145d6c7116e66abab6748b71133dc14ed72
F20110409_AABVQU vicenscontreras_m_Page_123thm.jpg
6b8c51553742c6693816c7c244c4b8cf
4a409a7a916783b4f0cddd5261ae9a8586f5b232
8146 F20110409_AABUNS vicenscontreras_m_Page_015thm.jpg
d82f6517abf57d4d83f0e24c759ba5d5
7ff7c9c6adb21852d2b9dcc926858469fc41bc8c
29272 F20110409_AABUOH vicenscontreras_m_Page_076.QC.jpg
4ad71920e3a5c7f32cfc3ddec47719e7
c4f5f69452360a5767ef72d3a51d05c68a13bb87
F20110409_AABVQV vicenscontreras_m_Page_124thm.jpg
43265f84b226d6cc3fe5a8e51124b11c
3d75b8454dbe45d6d3922ac6a7871e897115b042
97121 F20110409_AABUNT vicenscontreras_m_Page_039.jpg
7d753033c3e39a318bc594898b01696d
e94c65fa5d6c5d225625f82d3c1d7dc5e127f458
636612 F20110409_AABUOI vicenscontreras_m_Page_064.jp2
c7020b3eeaaea6fc04706ec15b9c412c
b2adb97f63379aec375da9430d0caebe16fef617
7407 F20110409_AABVQW vicenscontreras_m_Page_125thm.jpg
8f339cea42a14f0db6feea4022f14e0d
f9a6329708693fcfeeff9d24d5f667c203d9a3cf
49594 F20110409_AABUNU vicenscontreras_m_Page_102.jpg
eb684892b6ec2f3634e4f4bb926e3b07
b80907a6960267bf75f8805e33b1b81b2ddae482
104330 F20110409_AABUOJ vicenscontreras_m_Page_042.jpg
c64e48098bb3a1868258d9d60ba2a0e1
669e758adac2ab79ebd553bdc11c097baf65f8cc
8382 F20110409_AABVQX vicenscontreras_m_Page_128thm.jpg
58b0f086b049152f2946b3f86690c2c4
e5038222de47e840a12ecc7e9c39eccae3fff884
12390 F20110409_AABUNV vicenscontreras_m_Page_008.QC.jpg
8bc36522319b84cff5cf786982917963
00c11ca005c326b188e370ea4ffddbd7579c3a1e
33227 F20110409_AABUOK vicenscontreras_m_Page_047.QC.jpg
5fef69f8f294d4ea904870248ae66b1e
9c690297fa304f57ef1ebcca1b7240f15591af33
8551 F20110409_AABVQY vicenscontreras_m_Page_129thm.jpg
e47f9c4fd140c6b518d6e57d732cab23
d273ef55f59d5cfab26bea530d19d1125219afa3
F20110409_AABUNW vicenscontreras_m_Page_098.jp2
80b9da4e81b291ffaed935ab0b50a141
cc923afbd14595de3e09effc9d60ff161eb13d5f
F20110409_AABUOL vicenscontreras_m_Page_020.jp2
ccb4cfd9a522aa6428b4e26fdd104c40
eaf57e8d0435eaa7b2a2835e15f8c8133aebca7b
8259 F20110409_AABVQZ vicenscontreras_m_Page_130thm.jpg
264449f84f9cd9a78c9be5687d1f4d7a
55b75798eee125f1e6a65a12065653961fd43e06
1143 F20110409_AABUNX vicenscontreras_m_Page_050.txt
0123eab6d39b6ae72d2e6b3b65b29858
ddc85f2f8781fcde0cb6c8e2958253ce5dfc0137
1293 F20110409_AABUPA vicenscontreras_m_Page_053.txt
78150fcbb8a849ea21bc6b9f00495a7b
f8f94cb7f4ec087f6c9f3b52af8012c343631f2c
684947 F20110409_AABUOM vicenscontreras_m_Page_087.jp2
8b94932fb82b5b1b986e929fe2e545d1
ce0e7bf55f57bb8ae133d7daa98674d83304437f
53587 F20110409_AABUNY vicenscontreras_m_Page_137.pro
d846ebbe378386dad11fb60dd3d4d1a8
c990b9d69b1f7a392f32b33bfd64fefda27867b6
75826 F20110409_AABUPB vicenscontreras_m_Page_052.jpg
c27a5c6903922a780d74368e384f8560
84a38b33c000b284d3bf99c0b45963dc0225acdb
1036649 F20110409_AABUNZ vicenscontreras_m_Page_066.jp2
2bae22108046d034ec3deaf0e389e315
581c906ba6c8dcacf5df3c1024afc960ddacf454
34644 F20110409_AABUPC vicenscontreras_m_Page_137.QC.jpg
d690934c4738bd532a2891c6fb4f0712
150ded102d6fb4252ab5d110858a3851da08cd8e
25408 F20110409_AABUON vicenscontreras_m_Page_089.QC.jpg
4cbaf7ea4f8402d04d6bc4705bdd8056
049b7d8604c4b971177a274b6d45f74e6b656416
F20110409_AABUPD vicenscontreras_m_Page_119.tif
c111b60ca50039f056281a3470e2ce13
f70e6b4f2646978430697f379a090ee8e21abf00
F20110409_AABUOO vicenscontreras_m_Page_014.tif
ee295968763081ba9a96b1c769318b77
5e26d986e3ddeb75fb9b4e05ace639b2f08eb6fe
1698 F20110409_AABUPE vicenscontreras_m_Page_028.txt
dc685a8c535bd23b61a69c3c870da5d8
e50dfda899da443537e9777b1a8b4c23435f2086
25381 F20110409_AABUOP vicenscontreras_m_Page_056.pro
a858df37244bb216bc1b1bf4334522f8
07d15d91ed63a6989edcd6e15a0ea81d0777e473
27592 F20110409_AABUPF vicenscontreras_m_Page_033.pro
84f35ff1e13e26327ae4c60e1f623138
caaa8ae51a45c8de4b77e59a4837d8c453e7643e
34404 F20110409_AABUOQ vicenscontreras_m_Page_079.QC.jpg
55126450dd98902b499b3536ab5b212d
8cda21674099790e677a7165541df2637001167b
F20110409_AABUPG vicenscontreras_m_Page_040.jp2
030a22366ed108c54dab7a02ca6b09e0
fe021c865dabad711e64ccf0ab9abbdb3279f661
854547 F20110409_AABUOR vicenscontreras_m_Page_094.jp2
c7ed8ca38abff2ee5c9894d1668ee40e
c5dfd5c49b3fa2cfbf6fb6954e48eda059a974df
97152 F20110409_AABUPH vicenscontreras_m_Page_044.jpg
3bd86f8022ffbb514e11748a63a7f435
ec729169a626e57f21d40ff3fef6776b20e98121
1969 F20110409_AABUOS vicenscontreras_m_Page_060.txt
3a95122dc0c0ad3bad22ef8a28ed31f8
8119f8caabb1e8b4766441e2f87937bb8890ed0b
46959 F20110409_AABUPI vicenscontreras_m_Page_098.pro
e4926d5e563ba0415a9101afdc7a5edd
c5130d535575ff5e6a0d0dbdfee23ff61d752500
F20110409_AABUOT vicenscontreras_m_Page_138.tif
4a43bce251d7f331fb1f254e50804df0
9b28878a65ebbc393d875a5509348a66b348e23b
F20110409_AABUPJ vicenscontreras_m_Page_131.tif
24b07a3941e0baa243d5207d6645a7b8
629f0ab94b865c020ca10fbf2884a82cd3df6d45
F20110409_AABUOU vicenscontreras_m_Page_113.tif
79139097ab3958c9d14133f9346948d2
09296622224375b1765d20b29d6034805473bec1
1800 F20110409_AABUPK vicenscontreras_m_Page_017.txt
583d6420f2f358d39e0fe0fbc3cb8a03
82c6c05533bc05a52b662d025eab7d1efce95289
F20110409_AABUOV vicenscontreras_m_Page_015.jp2
f74563636deef86a1f714a946023c02d
8ff4c3594eed77a68e2740f09601a04067aeef8e
8009 F20110409_AABUPL vicenscontreras_m_Page_027thm.jpg
763a19604fd0700e4e032d2707a5622c
be527837c47bf4ffa12e0cbac6f9be2ce5b816b6
104820 F20110409_AABUOW vicenscontreras_m_Page_009.jpg
e626b1369de69299308934dc8ed06d09
50ba2a459c35fb92c8e2b72a95e1bfee5d3e6e17
93854 F20110409_AABUQA vicenscontreras_m_Page_099.jpg
87e96abf64a06d2061bbb5597c4c7ab4
2f0a92f8a641992c429a0f682dcf5ad120ef844d
1080 F20110409_AABUPM vicenscontreras_m_Page_064.txt
362c2d2d4e845ba3fdb031113ee7dbd9
5a3e2666097c91119dbecf6447cbcd678ecf9a76
32209 F20110409_AABUOX vicenscontreras_m_Page_018.QC.jpg
cff562df6b3ff677ff2f7ea447405914
8b4d5930457ca2eefce9bc1a85a40d6f46daa2cf
8335 F20110409_AABUQB vicenscontreras_m_Page_077thm.jpg
23d4740849515430b07efc33f07bc68f
bc2cbc628f10c522986e85bc026a2c97e07e1131
1865 F20110409_AABUPN vicenscontreras_m_Page_014.txt
9ed438bd6f41e1f6da22bdd0cafe0ea3
85f2fa17a17ff3d57935e34f8118d771a34359d4
1051964 F20110409_AABUOY vicenscontreras_m_Page_092.jp2
fb08d082185e3a57a6262d6444182b3f
97fef679d735f31c33547cf2f07414dbab2aa9ca
59917 F20110409_AABUQC vicenscontreras_m_Page_050.jpg
d68e10d5c43f70b1c181b98e5c5db49e
dde28aa98714a9832ae04b198ef87bacf5841faf
F20110409_AABUOZ vicenscontreras_m_Page_084.tif
5b8ff87ceca87df4c39ffcb6b0f65a05
0a762011360de82c760d25497601da2db637c5c8
33937 F20110409_AABUQD vicenscontreras_m_Page_107.QC.jpg
81fd28fbc7b0e7d36f16d2e130f54d2b
9eac646e0f2ea98864b4b4b3b7ef0132031360bc
79364 F20110409_AABUPO vicenscontreras_m_Page_116.jpg
fc3a8daced9d8837ebc9ffc1dc8f463b
b2ef670a509702a0bf550dcce4f9685cb9f35809
103916 F20110409_AABUQE vicenscontreras_m_Page_121.jpg
3bccb774963ffa2819d3d62b300541c6
74efb0aebb987e355c2e6e42c89123fa7641ea2f
F20110409_AABUPP vicenscontreras_m_Page_091.tif
6232d6bee0bf81f2936bebcd9709d4dc
5ce6a963d56b42b4e562543263811314a056a028
929422 F20110409_AABUQF vicenscontreras_m_Page_133.jp2
d6a31b2499252cf3d701ff0ed7cf91c8
d41c312bba0c33959d4d7a978258c73fdf4040e5
858 F20110409_AABUPQ vicenscontreras_m_Page_054.txt
64fe14bcae6c81ad5eb194d5c74edf4e
f91e6108d0eb119a47ebce2a57b46e1b6cd7cf84
F20110409_AABUPR vicenscontreras_m_Page_107.tif
b539b1b349b7e0dc4d3f7d36eff5b7de
8a27a1daefb3486e0fa9962a1c90059c083037d0
F20110409_AABUQG vicenscontreras_m_Page_049.tif
bf19cbe22737d816b1a4bd5fa2169f2a
2bfc93b049178a2687e01c53a91c4031c7e154a2
39076 F20110409_AABUPS vicenscontreras_m_Page_026.pro
6d194b5c3cfcbe094d5282318469bbb6
9fe721a92c95dda451098aedbd76d9d8e9f12d6a
101974 F20110409_AABUQH vicenscontreras_m_Page_127.jpg
ca900abc7cd915691213674fbd07b297
c302c9f35f083fc6f064c36678dbd39fa9275947
39198 F20110409_AABUPT vicenscontreras_m_Page_083.pro
df9db23bdd3c257c3471e9b52dd734b3
1e921e91bae807533c6921368d8855c1ca8b1dfb
1926 F20110409_AABUQI vicenscontreras_m_Page_055.txt
3ae9b91e05d3685c441f398589843e02
7b2ed2136a0f664e71b566da3544ebe9b77fb551
902058 F20110409_AABUPU vicenscontreras_m_Page_110.jp2
f7f0a3c0857a5fc6fd7ae9963c6497e2
2b9a4882614e3d0eb030024fd38d425c0835b3e3
20496 F20110409_AABUQJ vicenscontreras_m_Page_075.QC.jpg
b9e4a65080a7ef40d9d4b1a88151fb74
2b7674060cb18130d6e5b6dbc32844ae4ac7a05b
F20110409_AABUPV vicenscontreras_m_Page_078.txt
e3c3fa41c03f5175a1464173ce4a14e7
c4a80034e4e3f6bd112fc1058b5f54517b1e77de
37151 F20110409_AABUQK vicenscontreras_m_Page_094.pro
5a3629a2a9c2f65a2c3fe0f571580234
4f48cd2de03cad16bd2e568d3258d71612a3c529
51000 F20110409_AABUPW vicenscontreras_m_Page_049.pro
8aa9875110d76b9cd1a6163178b86645
0a38bdaa9a41688a814fb3e6f6e6d7e0853de525
1311 F20110409_AABUQL vicenscontreras_m_Page_089.txt
7f455e5b30036e30be719f06513acf3e
ff9b2737ea186b9b1654de8ab14d465bdbb27185
85043 F20110409_AABUPX vicenscontreras_m_Page_012.jpg
cb17630c722456e572d1bc8df5d988d2
0d7a4e927b65c77e4a5cc6fb4920b51c3e30ceb7
6355 F20110409_AABURA vicenscontreras_m_Page_132thm.jpg
cb015d3089de0c9c7cde1ca443d0f9bf
ba4d2f06a355eec88be0f8bcb8f541a42e14caaa
25544 F20110409_AABUQM vicenscontreras_m_Page_050.pro
6fff1312e92714920a61bbda8fabf9b7
211460cfc84bad979205a7b13eae8b28b0bf2617
1016816 F20110409_AABUPY vicenscontreras_m_Page_076.jp2
2c9a376345557a49f63876cae6902176
d4e3348f970a238091bd461df21fabd382394974
7015 F20110409_AABURB vicenscontreras_m_Page_115thm.jpg
7ac1a9af9a0a1944d27a161b3c3f7f40
7a2511a80a7be94ed89c7e22250a5fe7e2c76a96
F20110409_AABUQN vicenscontreras_m_Page_027.txt
5f51e9375903061cb004f5f3e840a80a
adb9dfc379ebb143fb3018ca6cff2defdff9a35b
F20110409_AABUPZ vicenscontreras_m_Page_019.jp2
2234b4b9f038bccf64a8fd2506ec9281
7f40484e4c921c8a378f28d2be66bfffd9a8d7ae
8323 F20110409_AABURC vicenscontreras_m_Page_126thm.jpg
c85430557ce481c964c3094e93e6aa84
819ef94d1db6c664f68886bfa69920e133355080
1051955 F20110409_AABUQO vicenscontreras_m_Page_011.jp2
18b6a773b64451fe1d1251c6547a59c4
8b355d105d49f4d96d69e42fb96a07187e7580cd
97932 F20110409_AABURD vicenscontreras_m_Page_028.jpg
e254a187bab6e5f553e1c7479a324c31
7595488ecb6d8969a327072722e7bd03fa96ff15
35242 F20110409_AABURE vicenscontreras_m_Page_061.QC.jpg
807d6177e2023eb5a1fb5225f7f78f71
c20557d529da7d217c944734d1cdbc2373685863
1016017 F20110409_AABUQP vicenscontreras_m_Page_014.jp2
3c6cb00ab9edc4acef850f511ef1ad28
29672b5f81a38a18fdd0418e37ce40f72615bdca
6290 F20110409_AABURF vicenscontreras_m_Page_013thm.jpg
a74070b3abf05eb070871fc9d13d61dc
f874ff4550323fe8fbe5e3fa85d6d9cdd3828df0
45487 F20110409_AABUQQ vicenscontreras_m_Page_121.pro
bf42ea904fbb3439ebc3ea2332f1ed7c
4d9544ee03e07388124126cd88eaa35b661bc231
F20110409_AABURG vicenscontreras_m_Page_078.tif
4c18cee3367a101b7dc4d4a93b329c0c
33ab0cf6c827a8fcf29b1786234f76a8d769fb52
28344 F20110409_AABUQR vicenscontreras_m_Page_090.QC.jpg
6be520126d784119d3e28166bf511fdf
c01b53dad46162872a74773cf186c72b332a14be
F20110409_AABURH vicenscontreras_m_Page_135.tif
ff2fe1673c4172d52d40b3cc379f1c3e
09719cf59f809b63a814424babdcd2a93368113b
F20110409_AABUQS vicenscontreras_m_Page_083.tif
cd218781228ac116ed2cdce4e80d2e2a
02ce2f8c269fc0fa9645bc51dfb7577ef862801f
F20110409_AABURI vicenscontreras_m_Page_037.jp2
f10d902624824850b279716df13a9f31
aea865a1c9d28b8f51f5e2d27ca9300f6ad16446
60405 F20110409_AABUQT vicenscontreras_m_Page_010.pro
85e1c94fb31e593f91024623db204cbd
584a4c5a380f3cc08891f767708970d68477a4ce
33740 F20110409_AABURJ vicenscontreras_m_Page_020.QC.jpg
40370be2cae5e475c029c83d2b661710
a488e16d0742944711d6eb2ccd8260a41fc2034a
8887 F20110409_AABUQU vicenscontreras_m_Page_048thm.jpg
6ff6d562e703423c2dc10ad43f5596d3
e76ab53a27099dc790afd71d529646e65a2b6e16
1051929 F20110409_AABURK vicenscontreras_m_Page_079.jp2
94ff9c6471b189c03e02c4b60706ed91
1ed2bb69c624312a3da89c67d017bfc775097860
35582 F20110409_AABUQV vicenscontreras_m_Page_031.QC.jpg
a8fc61e61729019e7c1fb0d34270d3ec
d08f904b119743c62d32590cef4426c786af9bc7
F20110409_AABURL vicenscontreras_m_Page_092.txt
2558edd694f094e0d23ec5da102bdf10
2b80af87888b2b26140db401a07e22fb3ac4f0c7
F20110409_AABUQW vicenscontreras_m_Page_024.jp2
420e795f1e4c0f85c90c527d026bd44c
46116e5bb022a01a6d51cbf1bc2c54538c450e27
105840 F20110409_AABUSA vicenscontreras_m_Page_119.jpg
db4c3805496731768e33c64ea1325ac3
3b3f985c5a6297310e5d7ed7ecc8f287e1e81873
F20110409_AABURM vicenscontreras_m_Page_125.tif
e5379b5c755e48013674d64555a161a6
c0aa410dce8804002b01599333ff89947fb3361e
50254 F20110409_AABUQX vicenscontreras_m_Page_019.pro
534245e856ef64ac02c7ee42bca86c16
f324fbf72fe0481cec2a496b7c0a004dfb768d67



PAGE 1

MOLECULAR BEACON APTA MERS: FUNDAMENTALS FOR FLUORESCENCE-BASED DETECTION AND FOR PROTEIN STUDIES By MARIE CARMEN VICNS-CONTRERAS A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2005

PAGE 2

Copyright 2005 by Marie Carmen Vicns-Contreras

PAGE 3

ACKNOWLEDGMENTS I am grateful for all the efforts and kindness of all the people involved in this project. I especially thank my advisor Dr.Weihong Tan, for his guidance, encouragement, and ideas throughout my graduate studies. I appreciate the opportunity of working in his lab. He provided all of the resources that I needed for the past 5 years. I appreciate the assistance of former group members of the Tan Lab, especially Xiaohong Fang, for teaching me the basics to begin this project; and Andrew Vanderlaan, for his hard work and help during his time in the group. Also, I thank Richard J. Rogers, Jon Stewart, James Winefordner, and Richard Yost, for having agreed to be part of my graduate committee. I thank Arup Sen who profoundly influenced me and helped me to get to where I am today, for sharing so many ideas and offering me a new perspective on many things, and teaching me much about learning and development. My life as a graduate student was fun and cheerful thanks to my officemates. All of them have taught me many things about life and their cultural heritage. For all the great times we spent together celebrating life, I want to thank all of the members of the Tan Group, especially Alina, Lisa, Tina, Prabodhika, Josh, Colin, James, Hong, and Shelly. I thank Karen Martinez, for being a happy spirit and making me smile every day. Intelligence and a deeply critical and analytical way of looking at ideas made Tim Drake a fantastic colleague and great friend. I wish them all the best! iii

PAGE 4

My adopted Puerto Rican family in Gainesville (which we like to call el corillo), made my life joyful. I especially thank Wilfredo Ortiz for one of the best friendships I can ever imagine. I am extremely thankful to mi familia, especially my parents (Carmen and Francisco) for their endless love, support, advice, and encouragement. I thank my amazing brothers and sisters for taking care of me from a distance and calling me whenever I forgot to call them. At last, without the love, support, interest, sense of humor, assistance of all kind, time, motivation and care from Jos I would be nowhere. It was his suggestion to come to the University of Florida. His patience and his continuous encouragement enabled me to succeed. He is one of the most wonderful human beings in this world. I am so indebted to him that there is no way to repay him. I am overwhelmed with gratitude. iv

PAGE 5

TABLE OF CONTENTS page ACKNOWLEDGMENTS.................................................................................................iii LIST OF TABLES...........................................................................................................viii LIST OF FIGURES...........................................................................................................ix ABSTRACT......................................................................................................................xii CHAPTER 1 INTRODUCTION........................................................................................................1 Aptamers.......................................................................................................................2 What Is an Aptamer?.............................................................................................2 The Aptamer Selection Process: Systematic Evolution of Ligands by Exponential Enrichment (SELEX)....................................................................3 Aptamers versus Antibodies..................................................................................5 Aptamers in Bioanalytical Chemistry...................................................................6 Fluorescence Methods for Signal Transduction.........................................................10 Fluorescence Quenching.....................................................................................11 Fluorescence Resonance Energy Transfer (FRET).............................................12 Molecular Beacons.....................................................................................................14 Molecular Beacons for Non-Specific Protein Detection.....................................14 Aptamers and FRET for Protein Detection.........................................................16 Molecular Beacon Aptamer (MBA) Development for a Model Protein System..............................................................................................................18 Aptamers for Platelet Derived Growth Factor-BB (PDGF-BB).........................18 2 DEVELOPMENT AND CHARACTERIZATION OF A MOLECULAR BEACON APTAMER FOR PLATELET DERIVED GROWTH FACTOR............21 Introduction.................................................................................................................21 Materials and Methods...............................................................................................23 Synthesis and Purification of MBAs...................................................................23 Standard Fluorescence Quenching Assay...........................................................25 Results and Discussion...............................................................................................26 Choice of Aptamer Sequence for MBA Development........................................27 Evaluation of Additional Fluorophore Quencher-Pairs.......................................29 Incubation Conditions for MBA Bioassay..........................................................34 v

PAGE 6

Selectivity of the MBA-Based Fluorescence Quenching Assay.........................39 Fluorescence Quenching Assay Distinguishes Molecular Variants of PDGF....42 Conclusions.................................................................................................................44 3 IMPLICATIONS OF USING A MBA IN A FRET BASED ASSAY FOR PDGF STUDIES IN BIOLOGICAL SAMPLES..................................................................46 Introduction.................................................................................................................46 Materials and Methods...............................................................................................47 Instrumentation....................................................................................................47 Preparation of a Simulated Biological Sample....................................................48 Cell Culture and Preparation of Conditioned Media...........................................48 Results and Discussion...............................................................................................49 Use of MBA in Biological Sample......................................................................49 Implications of Total Protein Content on the MBA Assay.................................53 Sample Pre-Treatment.........................................................................................55 Conclusions.................................................................................................................62 4 LIGHT SWITCHING APTAMER PROBE FOR PLATELET DERIVED GROWTH FACTOR USING RATIOMETRIC AND TIME-RESOLVED FLUORESCENCE MEASUREMENTS....................................................................63 Introduction.................................................................................................................63 Photophysics of Pyrene Excimers.......................................................................64 Time-Resolved Measurements............................................................................66 Experimental Section..................................................................................................68 Instruments..........................................................................................................69 Synthesis and Purification of Pyrene Labeled MBA...........................................69 Results and Discussion...............................................................................................70 Light Switching Excimer Aptamer Probe Design...............................................70 Light Switching Aptamer Probe for PDGF-BB Detection..................................71 Sensitivity and Selectivity of the Probe...............................................................73 Direct Quantitative Detection of PDGF in Cell Medium....................................77 Detection of PDGF-BB in Simulated Biological Sample...................................82 Expression of PDGF-BB from Cells...................................................................85 Conclusions.................................................................................................................87 5 FLUORESCENCE RESONANCE ENRGY TRANSFER STUDIES FOR MOLECULAR BEACON APTAMERS: UNDERSTANDING PROTEIN INTERACTION AND VERSITILITY OF PROBES................................................90 Introduction.................................................................................................................90 Results and Discussion...............................................................................................91 Backbone-Modification of DNA.........................................................................91 MBAs Created from Homologous RNA and DNA Aptamers Display Significant Differences in Eliciting FRET in Response to PDGF-BB............94 vi

PAGE 7

Fluorescence Enhancement Assays with MBAs.................................................99 Two-Step FRET Assays Using Restriction Enzymes Cleavage Sites...............104 Conclusions...............................................................................................................109 6 SUMMARY AND FUTURE WORK......................................................................112 Summary...................................................................................................................112 Future Work..............................................................................................................117 New MBA Development for Other Proteins and Small Molecules..................117 Enrichment and Simplification of Complex Samples.......................................117 Pyrene Application to Other Protein Recognition Systems..............................118 Signal Amplification of Aptamer Recognition through PCR............................119 LIST OF REFERENCES.................................................................................................120 BIOGRAPHICAL SKETCH...........................................................................................126 vii

PAGE 8

LIST OF TABLES Table page 2-1 Percentage of quenching of different consensus sequences of 50 nM of MBA for PDGF aptamer with 200 nM of PDGF...............................................................28 3-1 Analysis for PDGF-BB spiked samples after fractionation on a G-100 Sephadex column using enzyme-linked immunosorbent assay (ELISA).................60 4-1 Pyrene-labeled oligonucleotide sequences used in this study..................................68 4-2 Amount of protein collected in 24 hours..................................................................86 4-3 Amount of protein collected in 24 and 36 hours......................................................87 5-1 Aptamers synthesized for PDGF-BB detection.......................................................95 viii

PAGE 9

LIST OF FIGURES Figure page 1-1 Overview of the systematic evolution of ligands by exponential enrichment process........................................................................................................................4 1-2 Typical Jablonski diagram.......................................................................................10 1-3 Fluorescence resonance energy transfer diagram.....................................................13 1-4 Working principle of molecular beacon...................................................................15 1-5 Assumed biological foldings of Platelet Derived Growth Factor............................19 1-6 Folding of 36t molecular beacon aptamer (MBA)...................................................20 2-1 Fluorescence intensity changes versus time of different aptamer sequences...........28 2-2 Proposed mechanism of PDGF-BB induced FRET responses for the 36t probe.....29 2-3 Evaluation of fluorescence quenching caused by PDGF-BB with MBAs...............31 2-4 Calibration curves for PDGF-BB.............................................................................33 2-5 Effect of increasing temperature on fluorescence signal of free MBA in solution.....................................................................................................................35 2-6 Effect of increasing pH on fluorescence signal of free MBA in solution................37 2-7 Effect of divalent cations on fluorescence signal of free MBA in solution.............38 2-8 The effect of monovalent cations on fluorescence signal of free MBA in solution.....................................................................................................................39 2-9 Binding selectivity of the MBA...............................................................................40 2-10 Fluorescence quenching displayed by the MBA......................................................41 2-11 Cartoon representing PDGF-BB and its molecular variants....................................43 2-12 Dose-response curves of PDGF variants: fluorescence signals of MBA for PDGF-AA.................................................................................................................43 ix

PAGE 10

3-1 Use of molecular beacon aptamer in biological samples.........................................51 3-2 Molecular beacon aptamer fluorescence quenching................................................54 3-3 Fluorescence quenching caused by PDGF-BB in the presence of proteins in a simulated biological specimen.................................................................................57 3-4 Fluorescence intensity of fractions of simulated biological sample (SBS) collected from G-100 column..................................................................................60 3-5 Fluorescence intensity of dilutions of SBS..............................................................61 4-1 The chemical structure of pyrene.............................................................................65 4-2 Use of pyrene excimer to probe PDGF-BB.............................................................70 4-3 Fluorescence emission spectra of Pyr-MBA with and without PDGF-BB in binding buffer...........................................................................................................71 4-4 Real-time response of excimer/monomer ratio........................................................73 4-5 Dose-dependent excimer formation on additions of PDGF-BB..............................74 4-6 Visual detection of PDGF-BB..................................................................................75 4-7 Response of excimer probe to different proteins.....................................................75 4-8 Response of 50 nM Pyr-MBA to 500 nM of different growth factors.....................76 4-9 Increasing amounts of BSA incubated with 50 nM Pyr-MBA................................77 4-10 Fluorescence spectra of simulated biological sample..............................................78 4-11 Monomer time-resolved spectra collected at 398 nm..............................................80 4-12 Excimer time-resolved spectra collected at 480 nm.................................................80 4-13 Fluorescence intensity as a function of wavelength at different times.....................82 4-14 Steady-state and time-resolved fluorescence spectra of SBS samples.....................83 4-15 Fluorescence decays of 200 nM Pyr-MBA in simulated biological specimen........84 5-1 Phosphorothioate DNA backbone modification......................................................92 5-2 Fluorescence quenching produced by a phosphorothiate modified MBA...............93 5-3 Theoretical model of the 36tRNA-MBA.................................................................96 x

PAGE 11

5-4 Comparison of FRETresponse of 36t-DNA-MBA and the homologous 36t-RNA-MBA with PDGF-BB.....................................................................................97 5-5 Competition of FRET-response by unmodified 36t-DNA aptamer with the standard 36t-DNA-MBA..........................................................................................98 5-6 Competition of FRET response by unmodified RNA aptamer with DNA-MBA and by unmodified DNA aptamer with RNA-MBA..............................................100 5-7 Fluorescence enhancement FRET-assay................................................................103 5-8 Working principle of the enzyme-site modified MBA..........................................105 5-9 Molecular beacon aptamer variants with restriction enzyme cleavable stem sequence response to magnesium...........................................................................107 5-10 Molecular beacon aptamer variants with restriction enzyme cleavable stem sequence response to PDGF-BB............................................................................108 xi

PAGE 12

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy MOLECULAR BEACON APTAMERS: FUNDAMENTALS FOR FLUORESCENCE-BASED DETECTION AND FOR PROTEIN STUDIES By Marie Carmen Vicns-Contreras August 2005 Chair: Weihong Tan Major Department: Chemistry Molecular beacon aptamers (MBA) are created by combining synthetic oligonucleotide ligands with high affinity for a protein target with a sensitive signal transduction mechanism. In this study, an MBA was developed and examined for the detection of platelet derived growth factor-BB (PDGF-BB) using it in a fluorescence-based assay. The developed probe was capable of consistently detecting 10 nM PDGF-BB in homogeneous solution. The influence of certain physical and chemical parameters of incubation that would affect DNA conformation were examined and the results show that this bioassay is compatible with pH, temperature, and monovalent cation levels typically encountered in biological samples. After a complete investigation in homogeneous solution, the MBA was examined for PDGF-BB detection in biological samples. This is the first attempt to use single aptamer molecules with an inherent signal transduction mechanism for the detection of PDGF-BB in biological samples. For this particular aptamer and assay conditions, the presence of more than 100 ug/mL of serum xii

PAGE 13

proteins resulted in non-specific fluorescence quenching of the probe. The results indicated that a sample processing method prior to the assay is required to remove potential biological interferences. Selective and quantitative protein analysis in complex biological fluids still presents considerable challenges for future research, mainly due to the background signals from both the fluorescent probe and the components of typical cellular samples. To overcome the problem of background signals, the existing MBA was modified by labeling each end with pyrene molecules. This produced a monomer-excimer light-switching aptamer probe for protein monitoring by using both steady-state and time-resolved fluorescence measurements. With a time-correlated single photon counting technique and the long fluorescence lifetime of pyrene, the biological background signal was separated from the excimer signal and 200 pM of PDGF-BB were detected in a simulated biological sample. We also examined FRET responses to PDGF-BB shown by MBAs with modified aptamer sequences that affect DNA conformation. Our findings provide new insights into the fundamental mechanisms underlying protein-induced FRET shown by MBAs and have significant implications on the design strategy and use of MBAs in structure-function analysis, and in bioassays for protein biomarkers and their molecular variants. xiii

PAGE 14

CHAPTER 1 INTRODUCTION Proteins are essential for the structure and function of all living cells. Protein have different shapes and conformations that are responsible for many functions, such as enzymatic reactions, regulation of cell growth, structure, movement, carriers, and receptors. Thus, many scientists in the bioanalytical sciences are interested in developing methods and probes to be used for protein studies and detection. Biological interactions are used to provide either qualitative or quantitative information about protein content and could yield important data about the molecular mechanism of action of biologically active compounds. Methodologies are needed to study disease biomarkers that can help diagnose a disease at the biochemical level or help distinguish the responses of different patients to the same medical treatment.1 For protein biomarker detection and quantitation, several techniques are widely used including: gel electrophoresis,2 isoelectric focusing, affinity chromatography,3 surface enhanced laser desorption time-of-flight mass spectrometry (SELDI),4 proximity ligation,5 cell-based bioactivity assays6 and immunological assays, such as enzyme-linked immunosorbent assays (ELISA).7 Many of the above methods are time-consuming and labor intensive; and require multiple steps, such as immobilization, repeated incubations and washings, and additional reagents to amplify the signal. Additional methods, such as nucleic-acid molecules labeled with two signaling moieties, can be used in different types of formats, for biomarker detection. Nucleic-acid sequences, known as aptamers, can adopt complex three-dimensional structures capable of selectively 1

PAGE 15

2 recognizing protein molecules.8 Thus, aptamers are good candidates for detecting diverse protein targets, including those proteins that do not naturally recognize or bind to DNA or RNA. Aptamer-based probes can be developed with the idea that when the target protein binds to the detector molecules, a change in the optical properties of the reporter molecules will be triggered, to indicate the recognition event. Unfortunately, little is understood about the basic mechanism of action for aptamer-based signal transduction mechanism or its applications. With careful design and systematic characterization, aptamer-based probes could be useful in diagnostic applications and protein-biomarker studies. Aptamers What Is an Aptamer? Nucleic acid binding species generated by in vitro selection have been referred to as aptamers.9 Aptamers can be RNA, modified RNA, single-stranded DNA or double-stranded DNA, and have been selected to bind targets ranging from small organic molecules to cells.10 In vitro selection has been used to identify aptamers against different targets covering a wide range of sizes, including ions,11 small molecules,9 peptides,12 single proteins,13 organelles,14 viruses,15 and even entire cells.16 In addition to carrying genetic information, oligonucleotide sequences (aptamers) can adopt complex three-dimensional structures, capable of specific binding to target molecules and, furthermore, of catalyzing chemical reactions.17 Aptamers have been generated for over 100 proteins, including growth factors, transcription factors, enzymes, immunoglobulins, and receptors.10 At present, an aptamer database10 that contains sequences drawn from 239 published in vitro selection experiments available for public use. A typical aptamer is 10 to 15 kDa in size (30 to 45 nucleotides), binds its target with subnanomolar affinity, and

PAGE 16

3 discriminates against closely related targets (e.g., will typically not bind other proteins from the same gene family). A series of structural studies show that aptamers can use the same types of binding interactions (hydrogen bonding, electrostatic, hydrophobic contacts, steric exclusion, etc.) that drive affinity and specificity in antibody-antigen complexes and are exploited in systematic evolution of ligands by exponential enrichment, the aptamer-selection method. The Aptamer Selection Process: Systematic Evolution of Ligands by Exponential Enrichment (SELEX) In 1990, Gold 13,Ellington and Szostak9 simultaneously reported the development of an in vitro procedure for the selection of single-stranded nucleic acids to perform a specific function. This in vitro procedure has been called systematic evolution of ligands by exponential enrichment (SELEX). Since its introduction over 10 years ago, in vitro selection has been widely adopted as a tool for the development of research reagents, and shows promise generating diagnostic and therapeutic agents. The SELEX process consists of exponentially selecting and amplifying aptamers from a large library (1015 to 1018) of oligonucleotide molecules.18-21 (Figure 1-1). The starting point for the in vitro selection process is a combinatorial library composed of single-stranded nucleic acids (RNA or DNA) typically containing 20 to 40 randomized positions. Randomization creates an enormous diversity of possible sequences (e.g., four different nucleotides at 40 randomized positions gives a theoretical possibility of 440 or ~1024 different sequences). Since short, single-stranded nucleic acids adopt somewhat rigid structures (imposed by their sequences), such a library contains many molecular shapes or conformations. To identify high-affinity nucleic acid ligands to a given target protein, the starting library of nucleic acids (in practice, ~1014 to 1015

PAGE 17

4 different sequences) is incubated with the protein of interest. Nucleic acid molecules that adopt conformations that allow them to bind to a specific protein are then partitioned from other sequences in the library that are incapable of binding to the protein under the conditions used. 1014 10 15 DNA or RNA sequences Incubate with specific target Figure 1-1.Overview of the systematic evolution of ligands by exponential enrichment process. The initial library of nucleic acids is incubated with the protein target of interest. Molecules that bind to the target protein are then partitioned from other sequences in the library. The bound sequences are then amplified to generate a library enriched in sequences that bind to the target protein. The bound sequences are then removed from the protein and amplified by reverse transcription polymerase chain reaction (RT-PCR) (for RNA-based libraries) or PCR (for DNA-based libraries) to generate a reduced-complexity library enriched in sequences that bind to the target protein. The DNA population is then used to generate a new library of single-stranded molecules (transcription for RNA; strand separation for DNA) that is again subjected to the selection procedure. This process is repeated, until a group of Partition Bound Unbound Repeat process with selected sequences Amplify selected DNA/RNA Protein target

PAGE 18

5 single-stranded molecules are selected whose binding affinities are sufficient for the intended application. Aptamers versus Antibodies Most of the ligand-detection methods known in the bioanalytical sciences are based on antibody binding. Like aptamer-based methods, antibody-based detection methods require maintenance of the ligand-antibody complex, to generate a detectable signal. In addition, antibody methods such as ELISA or competitive radioimmunoassay (RIA), while robust and highly sensitive, have limited applicability because of the require heterogeneous assay conditions: The detection must be done on a solid surface In most applications both a capture antibody and detection antibody are required For ELISA-based protein detection methods, the antibodies must recognize the folded, native structure of the protein that is present in cell or tissue isolates.7;22;23 As an alternative (or complementary) molecule to antibodies, aptamers have several inherent advantages that merit study. Since aptamers consist of a short, single strand of DNA or RNA, they are much easier and economical to synthesize and have a much longer shelf life. In terms of stability, aptamers are chemically robust and are intrinsically able to regain activity after exposure to heat and denaturants, and can be stored for extended periods (more than a year) at room temperature as lyophilized powders. In contrast, antibodies must be stored refrigerated. Aptamers are chemically synthesized and thus can be readily scaled as needed to meet production demand. Whereas difficulties in scaling production currently limit the availability of some biological products and the cost of a large-scale protein production plant is high, a single large-scale synthesizer can produce more than 100 kg of oligonucleotide per year and

PAGE 19

6 requires a relatively modest initial investment.18 One of the most significant advantages of aptamers is that their selection process mimics natural selection, so it is possible, in theory, to develop a highly specific aptamer for virtually any target molecule with the same high affinity similar offered by antibodies. The affinities of aptamers range from dissociation constants of 0.3 to 500 nM, with most aptamers having binding affinities in the range of 1 to10 nM (comparable to or grea ter than the typical Fab fragments obtained through immunization). In comparison to engineering antibodies for particular applications, incorporating site-specific labels or coupling sites into an aptamer is usually a minor procedure. Since the aptamer itself lacks any means of signal transduction on binding a protein, this ease of molecular labeling is crucial for their development into fluorescence probes for protein studies. Aptamers in Bioanalytical Chemistry Aptamer molecules have been developed and used to detect specific analyte molecules in different experimental settings. RNA or DNA molecules must create a specific cavity to enclose and recognize a small molecule. Nonetheless, proteins possess extensive surfaces (with ridges, grooves, projections, and depressions) with several hydrogen-bond donors and acceptors; suggesting that proteins may be excellent targets for aptamer-probe developmental studies.9 The first known nuclei-acid aptamer to a protein that does not normally interact with RNA or DNA was a single-stranded DNA aptamer against thrombin.24 The aptamer for thrombin has been used extensively for multiple applications. In one case25, fluorescently labeled anti-thrombin aptamers attached to a glass surface were used to detect the presence of thrombin proteins in a sample, by detecting changes in the optical properties of the aptamers. In this system,

PAGE 20

7 binding of thrombin to the labeled aptamer is monitored by detecting fluorescent emission of the dye-labeled aptamer on excitation by an evanescent field. McGown and her group at Duke University26 used the same aptamer for affinity capture of thrombin with Matrix Assisted Laser Desorption and IonizationTime of Flight-Mass Spectrometry (MALDI-TOF-MS). The aptamer was covalently attached to the surface of a glass slide that served as the MALDI surface. Results showed that thrombin is retained at the aptamer-modified surface while other proteins, such as albumin, are removed by rinsing with buffer. Upon application of a low-pH MALDI matrix, the G-quartet structure of the aptamer unfolded, releasing the captured thrombin. After TOF-MS analysis, residual matrix and proteins were washed from the surface, and buffer was applied to refold the aptamers, allowing the surface to be reused. The aptamer demonstrated high selectivity against mixtures of thrombin and albumin and of thrombin and mixtures of prothrombin from human plasma. Aptamers can also be used to separate closely related compounds depending on their dissociation constants.27 Deng et al 28 explored the use of a 42-mer DNA aptamer for adenosine/ATP binding, as a weak affinity chromatography stationary phase using biotin-avidin coupling. Their data demonstrated that affinity chromatography is useful for characterizing the binding of aptamers to multiple targets. In addition, they evaluated the aptamer stationary phase for separation of cyclic-AMP, NAD+, AMP, ADP, ATP, and adenosine. Their data demonstrated that an aptamer immobilized by biotin-avidin coupling can selectively retain and separate related target compounds by weak affinity chromatography. The reported data suggested that it may be possible to develop stationary phases that selectively retain and separate classes of compounds based on

PAGE 21

8 aptamers and that affinity chromatography is a valuable and convenient technique for characterizing the affinity and selectivity of aptamers. Other nucleic acid-based detection schemes have exploited the ligand-sensitive catalytic properties of some nucleic acids, such as ribozymes. For example, Robertson and Ellington29demonstrated that a ribozyme that acquires a ligase activity on ligand binding can be used to detect a ligand by monitoring the ligation of a small, labeled, second oligonucleotide to the ribozyme. In a complementary approach, 30;31 labeled allosteric ribozymes that undergo cleavage upon binding to a ligand have been used to detect ligands by monitoring the release of the label from the ribozyme. However, the majority of the detection techniques have the disadvantage that the ligand-activated ribozyme is irreversibly modified in the course of generating a signal. Thus, ribozymes can be used only once in an assay. Furthermore, signal generation is slow with ribozymes and can take from 1 minute to 1 hour or more. Manalis32 developed a method for label-free protein detection using a microfabricated cantilever-based sensor that was functionalized with DNA aptamers to act as receptor molecules. The sensor used two adjacent cantilevers that constituted a sensor/reference pair and allowed direct detection of the differential bending between the two cantilevers. In this case one cantilever was functionalized with aptamers selected for Taq DNA polymerase while the other was blocked with single stranded DNA. They reported that the polymerase aptamer binding induced a change in surface stress, which caused a differential cantilever bending dependent on the ligand concentration. Protein recognition on the sensor surface was specific and had a concentration dependence that is similar to that in solution.

PAGE 22

9 Another class of aptamer probe is based on monitoring the change in fluorescence anisotropy on protein binding.21;25;33 Anisotropy probes are designed by labeling an aptamer with a single fluorophore molecule. When the labeled aptamer is bound with its target protein, the rotational motion of the fluorophore becomes much slower as a result of the larger molecular weight of the aptamer-protein complex. As a consequence of the binding event, a significant increase in fluorescence anisotropy can be monitored using plane-polarized light. Anisotropy-based aptamer probes serves as an alternative mechanism of signal transduction for aptamer-protein binding which results in on and off type signals. Some advantages of anisotropy-based aptamer probes versus analogous antibody probes are a result of their respective sizes. Since most aptamers are substantially smaller than antibodies, the relative increase in molecular weight and fluorescence anisotropy will be much larger on binding with proteins for aptamer probes. However, the sensitivity of aptamer anisotropy probes is generally not as good as fluorescence resonance energy transfer-based probes. For Platelet Derived Growth Factor (PDGF-BB) detection, an aptamer was converted into an anisotropy probe through 5-labeling with fluorescein.33 Addition of PDGF-BB (nM concentration) to an equimolar solution of the labeled aptamer increases the fluorescence anisotropy more than 2-fold. The binding of protein to the aptamer clearly results in a large molecular-weight complex, thereby slowing down the rotational diffusion of the fluorescein label. The binding reaction is quick, with equilibrium achieved in less than 20 s, including mixing time. Controls using free fluorescein dye with PDGF-BB show no effect on anisotropy, validating that the observed changes are a direct result of the aptamerPDGF-BB binding. All the reported applications of aptamers

PAGE 23

10 demonstrate that with the use of aptamer-based molecules it is possible to detect analyte binding in both solution (homogeneous) and on solid supports (heterogeneous). Aptamers are required to work along with a signal transduction mechanism to report the binding event to the target molecule. High affinity and selective aptamer probes can be further exploited by incorporating a highly sensitive signal transduction mechanism within the synthetic DNA sequence that would allow their use for single-step detection schemes without the need of separating the aptamer-target complex from the solution. Fluorescence Methods for Signal Transduction Fluorescence is a highly sensitive detection method. Figure 1-2 shows a typical Jablonski diagram where S0, S1 and S2 stand for the singlet, first and second electronic states, respectively, while T1 stands for triplet state. Following light absorption, a fluorophore is excited to a higher vibrational level. By a process called internal conversion, the molecules in condensed phases rapidly relax to the lowest vibrational level of S1. Internal conversion is generally complete prior to emission; hence, fluorescence emission generally results from the lowest-energy vibrational state of S1. S0 S1 S2 T1 FLUORESCENCE INTERSYSTEM CROSSING INTERNAL CONVERSION hhhh PHOSPHORESCENCE Figure 1-2. Typical Jablonski diagram

PAGE 24

11 Upon excitation into higher electronic and vibrational levels, the excess energy is quickly dissipated leaving the fluorophore in the lowest vibrational level of S1. Since this is a rapid relaxation, emission spectra are usually independent of the excitation wavelength. One of the general characteristics of fluorescence is that it exhibits what is known as the phenomenon of Stokes Shift. This phenomenon reveals that the energy of the emission is typically less than that of absorption; hence, fluorescence typically occurs at lower energies or longer wavelengths. The intensity of fluorescence can be decreased by a wide variety of processes known as quenching. Fluorescence Quenching The process of decreasing fluorescence intensity is termed quenching and it usually happens through two major mechanisms.34 The first mechanism, known as collisional quenching, takes place when a fluorophore is excited by incident light and as a consequence goes into an excited state and stays there for a short period of time (nanoseconds). The time it stays in the excited state is called fluorescence lifetime. In this case, the quencher must diffuse to the fluorophore during the lifetime of the excited state. Upon contact, the fluorophore returns to the ground state, without emission of a photon. Collisional quenching is described by the Stern-Volmer as shown in Equation 2-1; where F0 and F are the fluorescence intensities in the absence and presence of quencher, respectively, kq is the bimolecular quenching constant, 0 is the lifetime of the fluorophore in the absence of the quencher, and [Q] is the concentration of the quencher. F0/F=1+kq0[Q]=1+KD[Q] (2-1) The second mechanism of fluorescence quenching, named static quenching, is characterized by the formation of a nonfluorescent complex between a fluorophore and a

PAGE 25

12 quencher. When fluorophore-quencher complex absorbs light, it immediately returns to ground state without emission of a photon. Fluorescence Resonance Energy Transfer (FRET) Fluorescence resonance energy tranfer is an interesting fluorescence-related phenomenon which relies on the radiationless transfer of energy from a donor fluorophore to an acceptor fluorophore. The distance dependent transfer of energy is a physical process that depends on the spectral overlap of the donor and acceptor spectra and proper dipole alignment of the two fluorophores. FRET is considered to be one of the few tools available for measuring nanometer scale distances and changes in distances, both in vitro and in vivo. In FRET, a donor fluorophore is excited by incident light, and if an acceptor is in close proximity, the excited state energy from the donor can be transferred. This leads to a reduction in the donors fluorescence intensity and excited state lifetime, and an increase in the acceptors emission intensity. One of the requirements for FRET is that the two molecules need to be very close, typically less than 10 nm. In fact, Lakowics34 showed that the efficiency of this process (E) depends on the inverse of the distance, between donor and acceptor, to the sixth power as shown in Equation 2-2, where E is the energy transfer efficiency, r is the distance between the donor and the acceptor, and Ro is the Forster distance at which half of the energy is transferred (typically 20 to 60 ), and depends on the spectral characteristics of the dyes and their relative orientation. When non-fluorescent molecules are used as acceptors, the result of the energy transfer is quenching of the donor fluorescence. E = R06/R06+r6 (2-2)

PAGE 26

13 ABSORPTION ENERGY TRANSFER hh DONOR ACCEPTOR Figure 1-3. Fluorescence resonance energy transfer diagram. Whereas normally an excited fluorophore returns back to the ground state with the emission of a photon, FRET results in the excitation of the nearby acceptor fluorophore that in turn emits a photon when it returns to the ground state. The occurrence of FRET is characterized by a decrease in observed donor emission, and a simultaneously sensitized (increased) acceptor emission. Fluorescence resonance energy transfer is a distance-dependent phenomenon that can be applied to the development of aptamer probes to study intermolecular and intramolecular relationships in biophysical systems and cell biology. The development of an efficient aptamer probe is not only dependent on the oligonucleotide sequence and conformation but also on the selection of the fluorophore and the quencher pair. With the high diversity of existing fluorophores and the growing number of the alternatives quenchers, the aptamer probes can be modified to fulfill specific experimental needs. Several reports have been published with updated information regarding the efficiencies of FRET for commonly used fluorophore-quencher pairs and their effects on duplex stability.35 Various approaches, including the well studied molecular beacons, have exploited the ability of fluorescent compounds to absorb energy and transfer it to nearby molecules for the study of molecular interactions.36

PAGE 27

14 Molecular Beacons Molecular beacons (MBs) 36 are synthetic oligonucleotide probes that possess a stem-and-loop structure, designed for specific recognition of DNA or RNA targets. The basis for target recognition is the hybridization of the nucleic acid to its complementary target. The single-stranded loop portion of the MBs has a sequence complementary to the target DNA and can report the presence of specific target nucleic acids. The stem typically has five to seven base pairs which are complementary to each other but unrelated to the target. Signal transduction in MBs is accomplished by resonance energy transfer. A fluorophore (donor molecule) and a quencher (acceptor molecule) are covalently linked to the two ends of the stem. The stem keeps the two moieties in close proximity, causing the fluorescence of the fluorophore to be quenched by energy transfer. When the probe encounters a target DNA molecule, the molecular beacon undergoes a spontaneous conformational reorganization, leading to the formation of a hybrid that is longer and more stable than that of the stem, that forces the stem apart and a consequent fluorescence restoration. The conformational state of a molecular beacon is thus directly reported by its fluorescence: in the closed state, the molecular beacon is not fluorescent; in the open state, when the fluorophore and the quencher molecules are apart, it emits intense fluorescence. Different molecular beacons can be designed by choosing loop sequence and length. Also, the quencher and the fluorophores can be changed according to the application. Molecular Beacons for Non-Specific Protein Detection Although molecular beacons were originally designed to bind and recognize specific nucleic acids, the probes can also lead to increased fluorescence on binding to certain proteins. Since the binding of proteins to DNA or RNA molecules can readily

PAGE 28

15 Figure 1-4. Working principle of molecular beacon. Before hybridization with target nucleic acid sequences the MB takes on a stem-loop structure which maintains the close proximity of the fluorophore (F) and quencher (Q) moieties. The resulting fluorescence is minimal due to static quenching of the fluorophore molecule. After introducing target nucleic acid sequences, the loop sequence of the molecular beacon hybridizes to the target and unstabilizes the stem hybrid. Consequently, the two moieties spatially separate and result in the restoration of the fluorescence. disturb the conformation of the nucleic acid, it is expected that this binding would result in spatial separation of the MB fluorophore and quencher. As an example37, an E.coli single stranded DNA binding protein (SSB) was used to demonstrate the protein recognition capability of MBs. This DNA-binding protein is used in DNA replication, recombination, and repair. Using a conventional fluorescence spectrofluoremeter, the investigators detected as low as 20 nM of SSB using a MB labeled with tetramethylrhodamine (TMR) and dimethylaminophenylazobenzoic acid (DABCYL). The measured fluorescence intensity changes over time revealed that the SSB-MB interaction is rapid, reaching equilibrium within 10 s. The MB-based SSB assay is not, however, particularly specific. In fact, SSB leads to a fluorescence enhancement nearly equal to that of the complementary DNA, but other proteins

PAGE 29

16 (including histone and Rec A) can also bind with the MB and cause a fluorescence intensity increase. The results demonstrated that while MBs were sensitive and somewhat selective to DNA-binding proteins, they were not specific enough to be capable of distinguishing a particular protein. In order to apply the principle of MBs for real-time detection of protein biomarkers, a more selective protein recognition mechanism is required. Aptamers and FRET for Protein Detection In addition to exploiting the inherent conformational changes that aptamers undergo, aptamers have been engineered similar to MBs such that the addition of an analyte results in a conformational change and simultaneous reduction or increase in a fluorescent signal. Utilizing FRET between fluorophore and quencher moieties for signal transduction of protein binding is one of the more popular designs. Depending on the relative positions of the fluorophore and quencher before and after protein binding, probes can result in either enhanced or reduced fluorescence on binding. It is important to mention that the design of optimized probes is not always a trivial process. A maximum change in fluorescence on binding is often achieved by gaining knowledge about the conformations of the free aptamer and the aptamer-protein complex. Ideally, when this structural information is available, one can strategically incorporate the fluorophore and quencher moieties on the aptamer probe in such a way that the transition from bound to unbound conformations causes a dramatic change in their relative positions. An example of a FRET based quenching aptamer probe is the one developed using a thrombin aptamer.37 The first reported aptamer for thrombin contains a 15-nucleotide consensus sequence.38 When bound to thrombin, the aptamer exists primarily in its quadruplex form containing two G-quartet structures, but in free solution, it can adopt

PAGE 30

17 either conformation, dependent in part on the ionic strength and temperature. This conformation shift provides the basis for an aptamer probe. By labeling the two ends of the aptamer with a fluorophore and quencher pair and extending the aptamer by one base on each end, aptamer binding of thrombin would force the quencher adjacent to the fluorophore, resulting in a substantial decrease in fluorescence. Another method of detecting binding of a target protein to an aptamer has also been described which relies on the use of fluorescence-quenching pairs whose fluorescence is sensitive to changes in secondary structure of the aptamer upon ligand binding.39 However, target protein-mediated changes in secondary structure were engineered into the aptamer molecule via a laborious engineering process in which four to six nucleotides were added to the 5' end of the aptamer that was complementary to the bases at the 3' end of the thrombin binding region. In the absence of thrombin, this structure forms a stem loop structure, while it forms a G-quartet structure in the presence of thrombin. Fluorescent and quenching groups attached to the 5' and 3' end signal this change. A related class of aptamer probes is the two fluorophore FRET probes.40 Binding of target protein can be detected by monitoring the fluorescence of a second fluorophore (F2) directly or preferably by the ratio of fluorescence of both fluorophores (F2/F1). Ratiometric detection may provide enhanced sensitivity, with reported detection limits in the low pM regime. All of the design considerations applicable to the quenching aptamer probes are also crucial to this class of aptamer probes. Detailed structural information of the aptamer and aptamer-protein complex allows optimized positioning of the fluorescence donor and acceptor.

PAGE 31

18 Molecular Beacon Aptamer (MBA) Development for a Model Protein System Based on previous studies that showed that the high affinity and selectivity of aptamers can be successfully combined to develop aptamer probes, it is of interest to further investigate and develop aptamers for biomolecule studies. In this case, PDGF-BB was chosen based on the significance of the protein in biological systems and the fact that an aptamer had already been selected for this protein. Platelet derived growth factor was discovered as a major mitogenic factor present in serum but absent from plasma. The biological function of PDGF-BB is to stimulate the division and proliferation of the cells through binding to receptors on the cell surface. Studies showed41-44 that PDGF is not one molecule but three, each a dimeric combination of two distinct but structurally related peptide chains designated A and B. Dimeric isoforms PDGF-AA, AB and BB are differentially expressed in various cell types and their effects are mediated through two distinct receptors, named and Platelet derived growth factor is considered a cancer biomarker because it is expressed at low or undetectable levels in normal cells, but it is found to overexpressed in many tumor cells and the autocrine and paracrine effects of PDGF-BB increase w ith the degree of malignancy. 45;46 In addition to cancer, PDGF has been implicated in other diseases, including renal disease. There is a hypothesis that PDGF is important to cell transformation processes, tumor growth and progression and thus could be used as a cancer marker for diagnosis. The assumed biological foldings for PDGF-BB are shown in the Figure 1-5. Aptamers for Platelet Derived Growth Factor-BB (PDGF-BB) The first step towards the development of a novel MBA is the selection of an aptamer. In 1996, Louis Green and his group47 used the SELEX procedure for the development of an aptamer for high affinity and selectivity against the B chain of PDGF

PAGE 32

19 BB. The first selection was initiated by incubating approximately 3x1014 molecules of random ssDNA with PDGF-AB in binding buffer. The two best ligands from this group were identified by their relative affinities for PDGF-BB and its molecular variants over a range of protein concentrations. Figure 1-5. Assumed biological foldings of Platelet Derived Growth Factor (PDGF) 44 The biological molecule is the macromolecule that has been shown to be or is believed to be functional. In both cases, the affinity of ligands for PDGF-BB was higher than the affinity for the other PDGF isoforms. The selected aptamers, 41t and 36t, shared a secondary structure motif: a three-way helix junction with a three-nucleotide loop at the branch point.(Figure 1-6) Two of the helices end in highly variable loops at the distal end from the junction, suggesting that the regions distal from the helix junction are not important for high-affinity binding to PDGF. The highly conserved nucleotides are indeed found near the helix junction. The 36t aptamer is composed of 39 DNA bases with a dissociation constant of 0.093nM. The other selected aptamer, 41t, is a 44-mer sequence with a higher dissociation constant of 0.129 nM. Based on theoretical determinations, both sequences appear to have several possible conformations before and after binding of the protein. Using this information, the possibility exists to develop a new aptamer based detection scheme for PDGF. Also, given that the protein has multiple isoforms, this makes the PDGF system particularly

PAGE 33

20 attractive to explore because we can evaluate the different interactions of a single aptamer with a family of proteins that have, in this case, ~60 % identity. In the next few chapters, a systematic investigation of the PDGF-BB protein-aptamer system will be presented. A variety of conditions have been evaluated for the effective recognition of the protein as well as several transduction mechanisms studied for potential use in biological studies. Figure 1-6. Folding of 36t molecular beacon aptamer (MBA) The scope of the work presented here was to conduct a systematic investigation of a novel design for an aptamer-based biomolecule, used to detect and study a target biomarker PDGF-BB. The combination of a nucleic acid molecule with different fluorescence phenomena as signal transduction mechanisms will be investigated. Potential applications of this probe in multiple assay environments and assay formats will be explored and evaluated for homogeneous solution and in cellular samples.

PAGE 34

CHAPTER 2 DEVELOPMENT AND CHARACTERIZATION OF A MOLECULAR BEACON APTAMER FOR PLATELET DERIVED GROWTH FACTOR Introduction Proteins play very important roles in almost all functions of life. Molecular probes for specific and sensitive detection of proteins and their molecular variants are necessary in many biotechnology applications and biomedical studies. Monoclonal antibody-based immunoassays have been used for protein analysis and studies during the past decades. Most immunological methods and many nucleic-acid-based methods involve multiple steps to achieve amplification of the specific signal produced by a target protein. By attaching a fluorophore and a quencher to an aptamer, the high degree of sensitivity afforded by fluorescent signals40;48;49 can be combined with the selectivity of the DNA binding to the target protein to form a single-step molecular beacon aptamer (MBA) assay. Fluorescence changes upon the interaction between a fluorophore and a quencher have been studied using molecular beacons (MBs) for DNA and RNA targets. Both, MBs and MBAs share a common characteristic: they have similar inherent signal transduction mechanisms and allows for target detection and reporting without removing for probe-target complex from the sample solution (detection without separation). Some differences between the two probes include the fact that MBs are mostly used for DNA and RNA detection and are based on the hybridization of the loop sequence to the target sequence. MB probes interact with their complement primarily through hydrogen bonding at 21

PAGE 35

22 various sites, depending on the length of the hybrid. In contrast, the use of MBAs is mainly used for the detection of protein targets and relies on a mixture of forces: hydrophobic, ionic and hydrogen bonding, at only a few specific sites. The basis for differences in secondary structures between the free and bound forms of MBAs for protein targets is not well understood, however interactions with different proteins are likely to result in secondary structure changes that could be used to produce FRET signals.40 Platelet derived growth factor is a dimeric protein for which several natural molecular variants are known, and at least two natural variants of cell-membrane receptors have been described with different specificity for the PDGF variants.41-43 The expression of variants of PDGF and the PDGF receptors have been implicated in malignancy and developmental abnormalities.50;51 The use of MBAs for protein targets is in its infancy and the basis for differences in secondary structures between the free and bound forms of MBAs for protein targets is not well understood. Theoretical models predicted that when the aptamers selected for PDGF-BB are free in solution, several stable conformations are possible. Based on the previously described MBA for thrombin which forms a G-quartet after binding to the protein, the possibility existed for the PDGF aptamer to undergo a conformational change after binding to the protein as a result of stabilizing one of the predicted conformations. Initially, it was unclear whether the stem structure would be open or closed prior to protein binding. Therefore, the first PDGF-BB probe was designed as an anisotropy probe in an effort to explore the application of an aptamer anisotropy probe for protein analysis. The PDGF-BB aptamer was labeled with a single fluorescein dye at the 5' end.33 PDGF-BB in the nM range, when added to the

PAGE 36

23 aptamer solution, caused an anisotropy increase due to the larger molecular weight of the complex. The results were our initial attempts toward developing a PDGF-BB probe. Given the possibility of conformational changes that could occur due to binding of the protein, a distance dependent signal transduction mechanism was incorporated into the aptamer molecule. The initial hypothesis was that a FRET-based aptamer probe could be designed for the PDGF aptamer. In this chapter, the result of a systematic study of the chemical and physical properties of a fluorescence quenching DNA aptamer probe will be presented. Materials and Methods Synthesis and Purification of MBAs All DNA molecules were obtained from Geno-Mechanix, LLC (Gainesville, FL) and the general synthesis protocols are described in this section. The DNA molecules were synthesized using the standard phosphoramidite chemistry in an Expedite 8909 automated DNA synthesizer on controlled pore glass beads, deprotected in ammonium hydroxide and purified by gel filtration. Unmodified DNA aptamers were purified by ion-exchange HPLC followed by gel filtration to remove salts. The standard MBA was synthesized using DABCYL immobilized on controlled pore glass beads (BioSearch Technologies, Novato, CA) and fluorescein (6-FAM) was added at the 5-end using 6-carboxyfluorescein phosphoramidite (BioSearch Technologies, Novato, CA). The dually modified DNA was deprotected at 55C for 6 hr with ammonium hydroxide (50%) in methanol. The deprotected DNA was first subjected to gel filtration followed by two cycles of reverse phase HPLC using two different hydrophobic resins with triethylammonium acetate (pH 6.0, 0.05 M) buffer and eluted with an acetonitrile

PAGE 37

24 gradient. The final purified material was subjected to gel filtration to remove solvents, dried under vacuum and stored dry at -20C until use. MBAs with tetramethylrhodamine (TMR)-6-FAM pair was synthesized and purified as described above using TMR-immobilized on controlled pore glass (BioSearch Technologies, Novato, CA), except that deprotection was carried out in potassium carbonate (0.1M) in methanol (80%) for 4 hr at 55C before processing the deprotected dual labeled DNA. For the synthesis of MBA with Black Hole Quencher 2 (BHQ2)Texas Red pair, synthesis was done using BHQ2 immobilized on controlled pore glass (BioSearch Technologies, Novato, CA) and a 5-modification with a functional amine group using a C3 spacer. Following deprotection at 55C with ammonium hydroxide/methanol and gel filtration, the DNA was reacted with the N-hydroxysuccinimidyl ester of Texas Red (Molecular Probes, Eugene, OR) in sodium borate buffer (pH 8.2, 0.1 M) and the labeled material was again subjected to gel filtration prior to the two cycles of reverse phase gel filtration as described above. For the synthesis of MBA labeled with Cy3 and Cy5, the DNA was synthesized with a functional amine group immobilized on controlled pore glass beads and Cy5 was added to the 5-end using Cy5 phosphoramidite (Amersham Bioproducts, Piscataway, NJ). Following deprotection with potassium carbonate (0.1M)/methanol and gel filtration, the DNA was reacted with N-hydroxysuccinimidyl ester of Cy3 (Amersham Bioproducts, Piscataway, NJ) and the dual labeled material was purified as described for Texas Red labeling above. All the MBA stock solutions were prepared at 100 M concentration in Tris/HCl buffer (pH 7.5, 20 mM) with NaCl (20 mM), and stored at -20C in aliquots. The DNA aptamer sequence in the standard 36tMBA used in most of the studies

PAGE 38

25 described here is the one designated 36t by Green et.al (5-CACAGGCTACGGCAC GTAGAGCATCACCATGATCCTGTG-3) and contains a 6 base complementary sequence at the 5 and 3ends that can form a double stranded stem in a closed conformation.47 Recombinant human PDGF-BB, PDGF-AB, and PDGF-AA were purchased from R&D Systems (Minneapolis, MN). PDGF and its isoforms were reconstituted in 4 mM hydrochloric acid with at least 0.1% bovine serum albumin (BSA). Other recombinant human growth factors used in the selectivity experiments, epidermal growth factor (EGF), insulin-like growth factor-I (IGF1), were bought from Roche (Indianapolis, IN). Human hemoglobin (HEM), porcine lactic dehydrogenase (LDH), myoglobin (MYO), chicken lysozyme (LYS), and human gamma-thrombin (THR) were purchased from Sigma (St. Louis, MO). Other biomolecules used include: BSA, (New Englands Biolabs, MA), thrombin (Haematologic, Inc, VT), ovalbumin (US Biological, Sawmpscott, MA) and, glycogen (Fisher Biotech, USA).The binding buffer used for all the characterization experiments was 20 mM Tris-HCl (pH 7.5) with 20 mM sodium chloride. Standard Fluorescence Quenching Assay All the characterization experiments for the MBA measurements were carried out in a 100 l cuvette (Starna Cells). Standard fluorescence quenching assays were performed by incubating the desired concentration of protein target with a 50 nM solution of the MBA in binding buffer at room temperature in a final volume of 100 l. All fluorescence measurements were monitored using a Fluorolog-Tau-3 spectrofluorometer (Jobin Yvon Inc., Edison, NY) equipped with a thermostat accurate to 0.1C. The sample cell was a 100 l cuvette (Starna Cells,Atascadero, CA). The fluorescence emission of 6

PAGE 39

26 FAM was monitored at the excitation maximum, 480 nm, and the fluorescence intensity was measured at the emission maximum, 520 nm. Both excitation and emission slits were varied to yield the best signals. The results are reported as mean values of triplicates. The effect of temperature on MBA fluorescence was monitored using a Fluorolog-Tau-3 spectrofluorometer (Jobin Yvon Inc, NY) equipped with a thermostat accurate to 0.1C. The sample cell was a 100 l cuvette (Starna cells, Atascadero, CA). The fluorescence intensity of a 50 nm MBA solution in the binding buffer was monitored before and after the addition of 200 nM PDGF-BB. In order to adapt the fluorescence quenching assay to high throughput format, a Tecan Saphire (Durhan, NC) fluorescence microplate reader was used with 96-well flat bottom microtiter plates (Nalge Nunc International, Rochester, NY). All experiments were carried in a final volume of 100 L, and the excitation and emission maxima were selected according to the fluorophores used. Results and Discussion Aptamer probes have significant appeal in the development of new methodologies for purification, labeling, and inhibition and characterization of proteins; however, their use as molecular probes has been under development and advances made only in the last 5 years.8;52 One of our major goals for this research was to develop a single-step assay which could analyze protein concentrations of distinct biomarkers in biological samples. The initial efforts focused on the protein, PDGF-BB, for which two potential DNA aptamer sequences for probe development have been selected.47 To characterize the MBA and determine if the probe could operate in a typical biological sample, a variety of chemical and physical parameters were evaluated.

PAGE 40

27 Choice of Aptamer Sequence for MBA Development Based on the predicted secondary structures, the first step toward developing a FRET-based aptamer probe for PDGF was to determine if a secondary structure change could be observed on binding to PDGF. To accomplish this task, two MBAs which are based on the aptamers previously characterized,47designated 36t and 41t, were evaluated (Table 2-1). Each aptamer was converted into an MBA by attaching DABCYL at the 3'-end and 6-FAM at the 5'-end. Using thermodynamic software calculations, the aptamers were predicted to form a helix-loop conformation with a single stranded region at the 5' and 3' end as a possible conformation with a reasonable free energy in the absence of PDGF.53;54 As a result of labeling the two ends of the aptamer, the fluorescence intensity of the free aptamer sequence is expected to be fairly high since the fluorophore and quencher pair will be spatially separated. Upon the addition of PDGF-BB, if protein binding induces a conformational change in the stem structure of the aptamer a change in the fluorescence intensity should be observed. In a fluorescence versus time experiment, both aptamers were first monitored for approximately 300 s and then PDGF-BB was added at four-fold excess (Figure 2-1). Upon PDGF-BB addition the fluorescence signal decreases and reaches equilibrium rapidly. The quenching efficiencies were considerably different between the two aptamer sequences. The reported47 binding affinities demonstrated that the 36t aptamer has a higher affinity for PDGF consistent with the fact that this aptamer showed a higher fluorescence quenching. The labeling of the aptamer molecule with a fluorophore and quencher at each end of the oligonucleotide sequences should not affect the binding capabilities of the aptamers since it was reported47that the regions distal from the trinucleotide loop of both sequences are not critical for binding. Since FRET is dependent on the distance between the fluorophore and the quencher, it

PAGE 41

28 Table 2-1. Percentage of quenching of different consensus sequences of 50 nM of MBA for PDGF aptamer with 200 nM of PDGF Name Sequence % quenching 36t CACAGGCTACGGCACGTAGAGCATCACCATGATCCTGTG 94 41t TACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTA 55 02000004000006000008000000100200300400500600700800Time ( s ) Fluorescence Intensity (A.U.) 41T 36T Figure 2-1. Fluorescence intensity changes versus time of different aptamer sequences. may be possible that preferential binding of PDGF stabilizes, or closes, the stem thus resulting in a decreased FRET response. Based on the observed decrease in the fluorescence signal, the 36t and 41t aptamer sequences appear to have a conformation change on binding to the protein. The PDGF FRET aptamer is proposed to have a stem-open conformation prior to binding, due to the high fluorescence signal that was observed (See Figure 2-2). Prior to binding one or several structural conformations could be possible, and PDGF most likely stabilizes the closed-stem structure for the 36t probe. Since the 41t aptamer had similar fluorescence prior to binding and quite different from after binding, most likely the structure of the 41t

PAGE 42

29 aptamer after binding is not a stem-closed structure but a partially-closed structure. Also, it could be possible that due to the decreased affinity of the 41t sequence for PDGF, the equilibrium fluorescence would be less in comparison to the 36t control aptamer. However since the experiments were done in 4-fold molar excess of PDGF, this is not likely to be the case because most of the aptamer probes should be bound. Another possibility for the observed difference could be the modifications themselves. If single fluorophore labeled DNA impurities existed within the solution, one might expect that the degree of quenching would be less. As a result other synthetic batches were tested and still similar results were obtained. PDGFA B Figure 2-2. Proposed mechanism of PDGF-BB induced FRET responses for the 36t probe. When the MBA is free in homogeneous solution, multiple conformations are possible. Upon binding of PDGF-BB, the probe conformation shifts from the opened (A), or partially opened (B), to a closed conformation. The fluorescence signal, therefore, is high prior to binding; and on stem formation, the signal is quenched. Evaluation of Additional Fluorophore Quencher-Pairs Since the 36t aptamer probe was clearly superior to the 41t in producing a quenching response, the 36t probe was selected to further develop and characterize the assay. One of the advantages of the MBA assay is that the use of FRET as a signal transduction allows for a single step detection of the target without having to isolate the MBA-protein complex from the solution. With FRET, alterations in the emission of

PAGE 43

30 fluorescent labels are measured. An important consideration in the design of aptamer probes for protein binding assays is the efficiency of energy transfer between the fluorophore and quencher used to label the probes. The versatility of the assay would be significantly improved if various known fluorophore-quencher pairs were found to be more effective for PDGF detection. Measurements of quenching efficiencies of different fluorophore-quencher pairs can be used to aid in the design of different kinds of MBAs. In the next section, several MBA molecules carrying known FRET pairs were studied and compared to the standard MBA labeled with 6-FAMDABCYL pair. The following pairs: Texas Red-BHQ2, Cy5-BHQ2 and 6-FAM-TMR were selected for their high quenching efficiency in other systems. The synthesis and purification of MBAs with FRET pairs is described in the Experimental Section and tested in the presence of a four-fold molar excess of PDGF-BB in the standard fluorescence quenching assay. As shown in Figure 2-3, all the selected FRET pairs were quenched when PDGF was added, albeit to different degrees. Two of the most commonly used quenchers, DABCYL and TMR, were paired against 6-FAM. Both quenchers may affect the sensitivity and flexibility of FRET assays. DABCYL is a dark quencher that absorbs broadly without emitting light; consequently, when paired with 6-FAM it can reduce more than 90% of the original fluorescence intensity of the MBA with high sensitivity and low background fluorescence. On the other hand, TMR is not a dark quencher and contributes to an overall increase in background because of its own native fluorescence. When both quenchers are paired against the same fluorophore for the MBA, DABCYL is superior in terms of overall fluorescence quenching against 6-FAM.

PAGE 44

31 0.00.20.40.60.81.0FAM-DABCYLFAM-TMRTexasRed-BHQ2CY5-BHQ2Relative fluorescence quenching MBA MBA + PDGF-BB Figure 2-3. Evaluation of fluorescence quenching caused by PDGF-BB with MBAs containing different fluorophore-quencher combinations. PDGF MBA molecules labeled with different fluorophore-quencher pairs were incubated in the standard fluorescence quenching assay buffer (final volume 100 L) with a four-fold molar excess of PDGF-BB (300 nM) to the concentration of the MBA (75 nM). Black Hole quenchers were designed to maximize the spectral overlap with many fluorophores and it does not re-emit the absorbed fluorescence as light, thus decreasing the background fluorescence. BHQ-2 was capable of quenching more than 50 % of the initial fluorescence intensity when paired with two commonly used dyes, Texas Red (TR) and Cy5 with different extents. In this particular case, the Cy-5 labeled MBA resulted in 74% quenching efficiency versus the Texas Red analog with only 54 %, even though previous reports35 predicted that both dyes, Texas-Red and Cy5 should have similar quenching efficiency mediated by contact quenching. Possible reason for the difference in quenching efficiency includes the possibility that the effective closed conformation of the MBA on binding to PDGF-BB is favorable for the FRET efficiency of the Cy5 labeled probe.34 In addition, when the BHQ-2-Cy5 pair is in close proximity, the dye-pair interaction actually increases the stem stability.55;56 Since FRET is a distance dependent

PAGE 45

32 phenomenon, it could be possible to improve the performance of other fluorophore-quencher pairs by changing the location of the label molecules in the MBA.57 The availability of choices in the selection of fluorophore and quencher is an important part of MBA-based assay development because various biological samples might present potential interference at certain excitation-emission spectra that may be effectively addressed by selecting the proper FRET pair. In addition, the development of a multiplex assays for the simultaneous detection of multiple proteins in a single homogeneous incubation may be possible by using two or more MBAs that are selective for different targets and that are labeled with different fluorophore-quencher pairs. The results above support the notion that MBAs are compatible with various fluorophores; however, the aptamer sequence, conformation, and binding principle will all potentially affect the FRET process. Each MBA that is developed would need to be fully characterized in order to obtain the most effective position and dye-pair for labeling. Once the MBA was developed with an appropriate fluorophore-quencher pair, we then investigated the applicability of the MBA for the in vitro detection of PDGF-BB in homogeneous solution by incubating a fixed amount of the 36t MBA with increasing amounts of PDGF-BB in binding buffer. As can be observed in Figure 2-4A, a dose-dependent fluorescence quenching was observed on the addition of PDGF-BB and 1.5 nM of PDGF was detected in repeated experiments. In comparison, an ELISA-based PDGF-BB assay was reported to have a detection limit of ~15 pg/mL (0.6 pM) PDGFBB (Figure 2-4B). The almost 100-fold difference in detection capabilities is understandable in this case.

PAGE 46

33 010000200003000040000500000255075100PDGF (nM)Fluorescence Intensity (A.U.) 0100002000030000400005000002468 A 0.00.51.01.52.002004006008001000PDGF (pg/mL)Absorbance B Figure 2-4. Calibration curves for PDGF-BB. (A)Dose-dependent fluorescence quenching of the MBA 36t-MBA on addition of PDGF-BB. Increasing concentrations of PDGF-BB were incubated in the standard fluorescence quenching assay buffer (final volume 100 uL) with the 36tMBA labeled with Dabcyl quencher at the 3end and 6-FAM at the 5-end (fluorescence measurements were made at the excitation and emission maxima for 6-FAM) (B) Calibration curve obtained with PDGF-BB ELISA kit (RnDsystems)

PAGE 47

34 In the MBA assay, the fluorescence response is produced as the result of a single (or possibly two as will be shown in later chapters) fluorophore molecule being quenched in the presence of a single PDGF-BB molecule. Since the ELISA assays utilizes an enzyme to effectively amplify the signals for each bound protein, clearly the sensitivity and detection limits of such assays will be better. However, ELISA does present the difficulty of being extremely time consuming (~7 h for one set of analysis). The time factor is essentially attributed to the washing and incubation steps which allow for binding of target molecules and the removal of unbound species. Since the MBA bioassay involves only the mixing of two solutions, the MBA solution and the analyte solution, and a short binding time, the analysis time is much shorter (~30 min for the MBA assay). As a result, in terms of sensitivity, if one can sacrifice analysis time and the detection limits and sensitivity are not an issue, then the MBA assay will provide a simple single step capability for screening purposes. Incubation Conditions for MBA Bioassay Effects of temperature. A critical factor in the MBA-based bioassay is the difference in distance between the quencher and the fluorophore in the free MBA (open conformation) and the target-bound MBA (closed conformation). Physical factors that affect DNA conformation and the distance between the FRET pairs are expected to influence the dynamic range of the assay. It is unclear as to the exact mechanism for PDGF binding to the 36t control sequence; however, it is believed that the opened, or partially open, conformation is bound by the protein and then the stem is consequently stabilized. At higher temperatures, the free MBA would preferentially assume a more open conformation and increase the fluorescence signal. Conversely, at lower

PAGE 48

35 temperatures, the equilibrium would be shifted to a more closed conformation. Both instances could potentially influence the binding of PDGF by either inhibiting it or increasing its ability to bind. In order to assess the effect of temperature on the MBA probe and binding, we measured the fluorescence intensity of the MBA at different temperatures under conditions used in the standard fluorescence quenching assay and then compared 25, 30 and 37C for binding to the PDGF aptamer. 03000006000009000001200000150000018000001525303745526067Tem p erature ( C ) Fluorescence Intensity (A.U.) no PDGF-BB with 200 nM PDGF-BB Figure 2-5. Effect of increasing temperature on fluorescence signal of free MBA in solution. A solution of MBA (75nM) in standard fluorescence quenching assay buffer as described in Materials and Methods was subjected to a gradual increase in temperature (5C per minute), held at the indicated temperatures for 5 min and the fluorescence signal was measured. The results presented in Figure 2-5 show that as the temperature increases, the initial fluorescence intensity increases presumably resulting from a larger separation of the arms of the predicted three-way helix junction where the six-base pair double stranded region would be formed. The largest fluorescence quenching was observed for

PAGE 49

36 the MBA incubated at 37C, which is the standard physiological temperature. The initial fluorescence intensity does not significantly increase above 37C. Since the aptamer probe can potentially exist in solution as multiple conformations (i.e., random coil, partially open, and closed structures), this particular assay offers the unique opportunity to observe not only the specific closing of the probe due to PDGF binding but nonspecific interactions that could result in the opening of the probe. As a result, experiments were performed at 30C to monitor events that induce conformational changes that may result in higher fluorescence intensities. This temperature also allows to monitoring PDGF-BB induced quenching. Effects of pH. Since the 6-FAM/DABCYL dye pair was chosen for assay development, the pH sensitivity of fluorescein could potentially affect the overall performance of the FRET based assay. As a result, the effect of pH on the fluorescence intensity of the probe without target protein was investigated. The fluorescence intensity of a 75 nM solution of the MBA in binding buffer used in the standard fluorescence quenching assay was also measured in the microplate reader except that the pH was varied between 5.0 and 10. The scope of this experiment was limited by the pH dependence of fluorescence intensity of fluorescein. The results (Figure 2-6) showed that within a pH range of 6.5 to 9.5, the fluorescence intensity of the MBA is within 10% of that observed at pH 7.5. The pH-dependent intensity profile of the MBA correlated with the pH-dependent spectra of fluorescein;58 consequently, the observed trend is believed to be due to the fluorescence characteristics of the dye molecule rather than conformational changes leading to quenching. Even though fluorescein is a highly pH dependent fluorophore, the optical properties should not affect the measurements of the FRET based

PAGE 50

37 010000200003000040000500004.55.56.57.58.59.510.5pH Fluorescence Intensity (A.U.) Figure 2-6. Effect of increasing pH on fluorescence signal of free MBA in solution. Fluorescence intensity measurements of a solution of MBA (75nM) in binding buffer with varying pH conditions. assay because the pH conditions during the experiments are similar to the optimal range for fluorescein.47 Effects of ionic strength. Certain monovalent and divalent cations commonly encountered in biological specimens are known to affect DNA conformation. A series of experiments to study the effects of varying concentrations of two divalent cations (magnesium and calcium) and two monovalent cations (sodium and potassium) on the fluorescence intensity of the free MBA in solution were performed. The results are presented in Figures 2-7 and 2-8. Each of the divalent cations caused a concentration-dependent decrease in the fluorescence intensity (Figure2-7) and at more than 1 mM

PAGE 51

38 00.20.40.60.811.20.00.51.01.52.02.53.0ion concentration (mM)Relative Fluorescence Intensity Mg2+ Ca2+ Figure 2-7. Effect of divalent cations on fluorescence signal of free MBA in solution. Increasing concentrations of divalent cations (CaCl2 and MgCl2) were added to a solution of MBA (75nM) in the standard fluorescence quenching assay buffer and the fluorescence signals were measured. concentration, the extent of quenching was comparable to that obtained with an excess of PDGF-BB. The results were not surprising since divalent cations stabilize secondary structures in DNA molecules and would thus shift the equilibrium to a closed conformation of the MBA.Monovalent cations sodium and potassium caused only a small initial decrease in fluorescence intensity (Figure 2-8) and even at concentrations of more than 50 mM the extent of quenching by the ions was less than 13% as compared to more than 90% quenching obtained with a 4-fold molar excess (300 nM) of PDGF-BB in a standard fluorescence quenching assay. Since typical combined concentrations of Na1+ and K1+ in cell culture medium is between 150 mM to 160 mM, desalting columns can be used to remove monovalent and divalent cations and prevent potential contributions towards quenching of the probe.

PAGE 52

39 00.20.40.60.811.20100200300400500600ion concentration (mM) Relative Fluorescence Intensity K+ Na+ Figure 2-8. The effect of monovalent cations on fluorescence signal of free MBA in solution. Increasing concentrations of monovalent cations (NaCl and KCl) were added to a solution of MBA (75nM) in the standard fluorescence quenching assay and the fluorescence signals were measured. Selectivity of the MBA-Based Fluorescence Quenching Assay Once the aptamer was selected and tested against PDGF for fluorescence quenching on binding, the selectivity of the MBA was examined. We incubated 20 nM MBA with 100 nM of either PDGF-BB or one of several extracellular proteins (bovine serum albumin, hemoglobin, lactate dehydrogenase, lysozyme, myoglobin, and thrombin) or unrelated growth factors (such as epidermal growth factor and insulin-like growth factor-1). The results shown in Figure 2-9 indicated that only pure human PDGFBB causes a marked reduction in fluorescence signal. All other proteins tested failed to cause any significant change in fluorescence, even at 10-fold higher concentrations than that used for PDGF-BB.

PAGE 53

40 Figure 2-9. Binding selectivity of the MBA. Relative fluorescence signals of incubation mixtures containing MBA (20 nM) and one of the following proteins (200 nM): bovine serum albumin (BSA), hemoglobin (HEM), lactate dehydrogenase (LDH), lysozyme (LYZ), myoglobin (MYO), thrombin (THR); or one of the growth factors, epidermal growth factor (EGF), basic fibroblast growth factor (bFGF), insulin-like growth factor-1 (iGF1), or PDGF-BB. In a subsequent experiment, some of the previously tested biomolecules including, growth factors (EGF), common proteins that are abundant in biological specimens (thrombin, ovalbumin and serum albumin) and glycogen (an abundant natural polysaccharide in tissues) were tested individually in a dose dependent manner. Dose-response curves were obtained by incubating increasing amounts of each biomolecule in a standard fluorescence quenching assay. The results are presented in Figures 2-10A and 2-10B. The small dose-dependent decrease in fluorescence due to thrombin and EGF indicated a slight interaction with the MBA probe. In comparison to similar

PAGE 54

41 02000040000600000510biomolecule concentration (g/mL)Fluorescence Intensity (A.U.) 15 BSA Ovalbumin Glycogen A 02000040000600000255075100protein concentration (nM)Fluorescence Intensity (A.U.) EGF Thrombin PDGF-BB B Figure 2-10. Fluorescence quenching displayed by the MBA in response to increasing concentrations of PDGF and other biomolecules. In a typical fluorescence quenching assay containing MBA (75 nM) in Tris (pH 7.5, 20 nM) and NaCl (20nM) as described in Materials and Methods, fluorescence signal was measured following the addition of increasing concentrations of various biomolecules: [A] BSA, ovalbumin, glycogen; and [B] PDGF-BB, epidermal growth factor, thrombin.

PAGE 55

42 concentrations of PDGF, the final extent of quenching was substantially lower than the quenching observed for PDGF. Conversely, minor changes in fluorescence intensity were observed for unrelated, commonly occurring biomolecules (bovine serum albumin, ovalbumin and glycogen, up to 12 ug/mL). Since only PDGF was capable of producing a large change in fluorescence signal in comparison to other proteins tested individually at the respective concentrations, the assay should be selective and sensitive for PDGF detection in the presence of other proteins commonly found in biological specimens. Fluorescence Quenching Assay Distinguishes Molecular Variants of PDGF Green et al. reported47 that the PDGF aptamers selected for binding to PDGF-BB by using isotropic labeling bound to three molecular variants of PDGF (Figure 2-11), namely BB, AB, and AA, albeit with different affinities, presumably because of the amino acid sequence homology (60%) between the A and the B chains. We tested the three common PDGF variants for their effects on the fluorescence quenching assay. Serial dilutions of each protein were incubated with 10 nM MBA in binding buffer and the dose-response curves for fluorescence quenching were compared. Parallel sets of experiments were conducted with varying amounts of the MBA. The calibration curves obtained with 10 nM MBA are shown in Figure 2-12. The results presented in Figure 2-12 indicated that the slopes and the concentration of protein required to attain 50% of the maximum quenching are distinct for the three molecular variants of PDGF. Although this data indicates that the MBA response shown for PDGF-AB is more similar to that for PDGF-BB (in comparison to the response for PDGF-AA), the difference between PDGF-AB and PDGF-BB is much more easily distinguishable than that reported method.47

PAGE 56

43 A A A B B B Figure 2-11. Cartoon representing PDGF-BB and its molecular variants (PDGF-AA and PDGF-AB) and its receptors alpha () and beta (). PDGF-AB 070000140000210000280000350000051015202530PDGF (nM)Fluorescence Intensity (A.U.)Denatured PDGF PDGF-BB PDGF-AA PDGF-AB Figure 2-12. Dose-response curves of PDGF variants: fluorescence signals of MBA for PDGF-AA (), PDGF-AB (), PDGF-BB (), and denatured PDGF-BB (). The concentration of the MBA was 10 nM. When PDGF-BB is reduced by dithiothreitol and denatured with sodium dodecyl sulfate, the resulting protein fails to cause any fluorescence quenching. Also, based on the slopes of the linear portion of the serial dilution curves it is clear that the binding affinity of each isoform is different for the aptamer probe. The results collectively indicated that the fluorescence quenching assay is not merely dependent on the primary sequence of the

PAGE 57

44 protein chains, but is capable of distinguishing conformational characteristics or the folding of highly related protein molecules. Conclusions For the development of a molecular beacon aptamer probe that will successfully report the binding event to a target protein in a single step, a signal transduction mechanism must be incorporated into the recognition molecule. Theoretical calculations using commercially available software showed that when the selected aptamers for PDGF are free in homogeneous solution, one possible conformation was the spatial separation of the 5' and 3' end.53;54 Taking advantage of the inherent structural properties of the aptamer, a distance dependent signal transduction mechanism, such as FRET, was incorporated to create a probe for the detection and study of PDGF-BB. Once the aptamer binds PDGF-BB, the distance between the ends of the aptamer molecule was reduced, resulting in the formation of a 6-base long stem. Also, the results obtained with varying incubation conditions described, in this chapter, support the notion that MBA-based FRET may be used in assays for protein detection in biological specimens since the FRET assay is effective at physiological pH and temperature. Divalent cations show interference with the assay by causing quenching in the absence of PDGF target probably due to a stabilizing effect on the stem of the probe. The results offer us new insights into, and justify the need for, future development and optimization of this one step MBA-based FRET assay. It was also demonstrated that three highly related molecular variants of PDGF (AA, AB, and BB dimers) can be distinguished from one another. In comparison to ELISA, the quenching assay developed is less sensitive, detection limits are higher, and has a higher throughput. Also, based on product literature and experimental controls for the ELISA assay, cross reactivity of the

PAGE 58

45 PDGF-BB antibody is prevalent for the AA isoform, which is often the case for antibody assays. As a result, depending on the information and degree of scrutiny needed from a given experiment one method may be preferred over the other. The use of fluorescence quenching as a measure of binding between the aptamer probe and the target protein eliminates the potential false signals that may arise in traditional fluorescence enhancement assays as a result of degradation of the aptamer by contaminating nucleases. Utilizing the conformational change of the aptamer to signal protein binding may be applied to essentially all proteins, especially those that do not naturally bind to DNA. Finally, other DNA aptamers with desirable selectivities for chosen target proteins can be synthesized and coupled to different fluorophore-quencher combinations to allow simultaneous detection of multiple target proteins in the same solution at different excitation/emission wavelengths or, conversely, a multiple-well microtiter plate can be used for many distinct samples for monitoring the same protein.

PAGE 59

CHAPTER 3 IMPLICATIONS OF USING A MBA IN A FRET BASED ASSAY FOR PDGF STUDIES IN BIOLOGICAL SAMPLES Introduction The development of a bioanalytical method includes the characterization of all procedures and parameters that demonstrate that a particular method can be used for quantitative measurements of analytes (in this case PDGF). The performance characteristics of the method should be suitable, reproducible and reliable for the intended analytical applications. In the previous chapter, detailed characterization experiments revealed that the developed MBA can detect nanomolar amounts of PDGF in a homogeneous solution, and that the optimal conditions for the MBA-PDGF complex formation are compatible with the conditions typically found in a biological sample. The next step in the development of the MBA-based bioassay will be focused on the implications of using this aptamer probe to study and detect PDGF in cellular samples. The aptamer selected for PDGF, was reported to have a 700 fold higher affinity for PDGF versus other random oligonucleotide sequences.47 This characteristic is especially important for the detection of PDGF in the presence of a complex biological sample. Nonetheless, in a biological sample such as cell culture medium, many other species may be present that could potentially interfere with the binding and the subsequent monitoring of the fluorescence change on binding. It has been reported, that PDGF and PDGF-like growth factors can be over-expressed and secreted into the media of various types of cancer cells; including MCF-7,46MDA-MB-231,50 and, PC3 cancer cell lines.59;60 In 46

PAGE 60

47 addition to PDGF, high levels of other proteins typically encountered in cell cultures may non-specifically bind to the probe, induce conformational changes, and as result produce false positive quenching. Also, many species in biological samples may present optical interferences for fluorescence measurements, due to absorption and auto-fluorescence. The above issues and others need to be carefully considered and explored before attributing the total signal change solely to PDGF binding. As a result, two directions were concurrently taken. One specifically designed to address non-specific interactions of the aptamer and the other addresses signal differentiation of PDGF responses and cellular interferences. This chapter will be aimed towards the determination of the robustness of the fluorescence quenching assay against other species present in the biological samples. Specifically, the incorporation of sample processing prior to carrying out the assay to remove potential biological interferences was investigated to minimize the effect of the factors mentioned above. The first part will include studies with simulated biological samples containing PDGF. For the second part, cancer cell conditioned media will be used in the first attempt to detect PDGF in biological samples using a MBA. Materials and Methods Instrumentation Fluorescence was monitored using a Fluorolog-Tau-3 spectrofluorometer (Jobin Yvon Inc., Edison, NY). The sample cell was a 100 l cuvette (Starna Cells, Atascadero, CA). The fluorescence emission of 6-FAM was monitored at the excitation maximum, 480 nm, and the fluorescence intensity was measured at the emission maximum, 520 nm. Both excitation and emission slits were varied to yield the best signals. For high throughput format assay, a Tecan Saphire (Durhan, NC) fluorescence microplate reader

PAGE 61

48 was used with 96-well flat bottom microtiter plates (Nalge Nunc International, Rochester, NY). All absorbance measurements were carried out in a Cary 300 UV-Vis spectrophotometer (Varian, Palo Alto, CA). Preparation of a Simulated Biological Sample A simulated biological sample (SBS) was prepared by combining Dulbeccos Modified Eagles Medium (DMEM, Mediatech, Hendon,VA) with serum proteins from fetal bovine serum(Invitrogen, Carlsbad, CA). SBS will be used as an intermediate between a homogeneous solution and a complex biological specimen, such as cell culture media, to investigate the applicability of using MBAs for protein detection. Total protein content was determined using the Bradford Protein Assay Kit61 (Biorad, Hercules, CA). Cell Culture and Preparation of Conditioned Media The cell lines used were human breast carcinoma MDA-MB-231, and murine BALB/c-3T3 fibroblasts (American Type Culture Collection,Manassas, VA), were grown in DMEM supplemented with 1 % Gentamicin (Sigma, Saint Louis,MI) and either 10 % fetal bovine serum for MDA-MB-231 or 10 % calf serum (Invitrogen,Carlsbad,CA) for BALB/c-3T3. Prostate cancer cells, PC-3(American Type Culture Collection, Manassas,VA), were grown in R12K medium (American Type Culture Collection, Manassas,VA) supplemented with 10 % fetal bovine serum and 1 % Gentamicin. The cells were incubated in humidified air containing 5 % CO2 at 37C. For the collection of serum-free conditioned media, the culture medium of confluent cultures was replaced with serum-free DMEM when the cell monolayers reached 80-90 % confluence. After approximately 60 minutes, the medium was replaced with fresh serum-free DMEM and the cells were incubated for an additional 24 hours. The serum-free CM was collected and clarified by centrifugation. Acetic acid was added to the supernatant to a final

PAGE 62

49 concentration of 0.1 M and the material was lyophilized. The lyophilized powder was resuspended in 0.1 M acetic acid, clarified by centrifugation at high speed in a microfuge for 5 minutes, and the supernatant containing the soluble proteins was subjected to size exclusion chromatography utilizing a NAP-5 (Amersham Biosciences, Piscataway, NJ) column packed with Sephadex G-25 in 0.1 M acetic acid. The excluded volume fractions with the highest absorbance at 280 nM were collected and lyophilized again. The protein preparation was resuspended in binding buffer (Chapter 2) to maintain appropriate pH conditions and used as the stock solution from which dilutions were made for incubation in the fluorescence assay. Results and Discussion Use of MBA in Biological Sample A SBS sample was used to determine the potential application of this one-step fluorescence-quenching assay for PDGF-BB detection in the presence of low levels of serum proteins. In the first case, the sample was lyophilized and split in two equal portions, one of which (Sa) was additionally supplemented with 100 nM recombinant human PDGF-BB (the other was labeled Sb and did not contained PDGF). Each portion (Sa and Sb) was resuspended in 0.1M acetic acid and the protein components were collected using a gel filtration column packed with Sephadex G-25 to remove salts and small molecules. As was mentioned on Chapter 2, high levels of monovalent and divalent cations resulted in background quenching and need to be removed prior analysis. Fluorescence quenching activity of the two preparations was compared by adding 50 nM MBA. As shown in Figure 3-1a, Sa caused a marked reduction in fluorescence, comparable to that observed with pure human PDGF-BB (see Figure 2-4A), and Sb caused a small fluorescence decrease.33 Analytical denaturing and reducing

PAGE 63

50 polyacrylamide gel electrophoresis of Sa and Sb showed that the low protein compositions of the two samples were indistinguishable from each other, which may indicate that the differences in fluorescence quenching presented by both samples was due to the PDGF-induced conformational change. Nonetheless, 20 % of quenching in the nonspiked sample may indicate nonspecific binding of other proteins in the sample. It is conceivable that as a result of binding to the MBA a reduced fluorescence is observed from the sample, as seen in Chapter 2 for thrombin and EGF. The results do, however, de monstrate that, when in the presence of similar total protein concentrations, the MBA has the potential to qualitatively distinguish the presence of nanomolar qua ntities of PDGF-BB in SBS. The next sample to be examined for PDGF detection was conditioned media from cultured cells. Conditioned media (CM) is a general term to describe media in which cells have been cultivated for a period of time. It contains many mediator substances that were secreted by the cells which were produced in this medium. The mediator substances contain growth factors, such as PDGF, and may promote the growth of new cells. A human breast carcinoma cell line, MDA-MB-231, has been reported to secrete PDGF-BB in culture medium.50 Serum-free CM was collected from human HTB cells and normal murine BALB/3T3 fibroblast cells in culture. The samples were collected and processed as described in Materials and Methods and serial dilutions of protein preparations from each cell line were incubated with a fixed amount of the MBA and fluorescence measurements were obtained to construct a dose-response curve. Parallel sets of dose-response curves were obtained by using different amounts of the MBA for each such set.

PAGE 64

51 A B Figure 3-1. Use of molecular beacon aptamer in biological samples.(A) Fluorescence signals of incubation mixtures of MBA (50 nM) with serum proteins without (Sb) or supplemented with (Sa) PDGF-BB, as compared to the MBA alone. (B) Dose-response curves/calibration curves for conditioned media and PDGF standard samples: fluorescence signals of mixtures of MBA (10 nM) with serial dilutions of protein preparations of conditioned cell media from HTB cells (triangles) or BALB cells (squares). Serial dilutions of a 500 nM solution of PDGF-BB (circles) were used as a control. Vd is the dilution factor.33

PAGE 65

52 For each set, a control dose-response curve for fluorescence quenching was obtained with serial dilutions of a solution of pure human PDGF-BB. The results obtained with 10 nM MBA are presented in Figure 3 -1B.33 Typically, several factors may indicate the presence of PDGF or PDGF-like molecules when the dose-response curves from the CM samples are compared with the one obtained using standard PDGF-BB. The factors include a concentration-dependent fluorescence intensity decrease, the similarity of the slope, and the final extent of quenching. For HTB conditioned media, the final extent of quenching as well as the dose-dependent decrease in fluorescence is comparable to the standard PDGF-BB. In the case of BALB conditioned media, the final extent of quenching is lower than the one obtained with HTB cells a nd standard PDGF-BB. It is important to mention here that initially BALB cells were selected as a negative control since it has not been reported that this particular cell line over-expresses PDGF. The observation that serial dilutions of BALB conditioned media produced a dose dependent quenching in some way similar to the standard PDGFBB reveals that this cell line may have measurable levels of PDGF (or PDGF-like mo lecules) or high levels of interfering proteins that bind non-specifica lly to PDGF and produce a co nformational change of the MBA. Although the final extent of quenchi ng for both samples was different indicating that the total amount of PDGF is different in each case, the use of MBA for PDGF quantitation and detection in cancer cell media samples may not be reliable due to the presence of interfering species in the biological environment that may lead to false positive results. An additional contribution to the change in fluorescence intensity may be due to filtering effects in the conditioned media that masked the true fluorescence signal.

PAGE 66

53 Implications of Total Protein Content on the MBA Assay The MBA appear to have the ability to qualitatively discriminate between cellular samples that contain PDGF; however, in order to verify the reliability of the results, the potential interfering compounds that could exist within cellular samples needs to be explored. For protein assay development, it is critical to determine the tolerable amount of protein that would allow a reliable fluorescence measurement. Protein aggregation and non-specific protein binding may have significant implications in the formation of the MBA-PDGF complex. Two samples of protein mixtures containing a total of 10 g/mL and 100 g/mL were prepared in binding buffer to study solely the protein effect on the MBA binding by combining the following representative biomolecules: bovine serum albumin, albumin, ovalbumin, lyzozime, glycogen, myoglobin, thrombin and a few growth factors including: insulin-like growth factor (IGF), epidermal growth factor (EGF) and vascular endothelial growth factor (VEGF). In the first case, a solution containing 10 g/mL of total protein was incubated with 50 nM of MBA in binding buffer and compared with a solution of 10 g/mL of pure PDGF-BB incubated with 50 nM MBA. The results presented in Figure 3-2 revealed that 10 g/ml of a protein mixture was capable of causing a 17 % quenching of the MBA. PDGF was added to the sample the fluorescence intensity drastically decreased, up to 96 %, indicating that PDGF is necessary for a complete quenching of the MBA at this protein concentration. In a separate experiment, the total protein content of the sample was increased by an order of magnitude. With 100 g/mL in the sample, 76 % of the

PAGE 67

54 0100200300400500600700MBA10 ug/mLPDGF-BB10 ug/mLserumproteins100 ug/mL serumproteins100 ug/mLserumproteins andPDGF-BBFluorescence Intensity (A.U.) Figure 3-2. Molecular beacon aptamer fluorescence quenching caused by a protein mixtures containing 10 g/mL. fluorescence of the MBA is quenched indicating that non-specific binding may be responsible for the decrease in fluorescence intensity. Nonetheless, the addition of 10 g/mL of pure PDGF-BB in the solution further reduces the fluorescence intensity of the aptamer probe. Based on the above results, a plausible explanation for the observed fluorescence quenching in cellular samples is non-specific binding. Thus, the dose dependent fluorescence decrease observed in cellular samples can not only be attributed to the presence of PDGF but to a combination of specific and nonspecific binding of proteins to the aptamer probe. Another alternative includes that the the MBA may be recognizing similar binding sites in other growth factors that may have a degree of identity with PDGF. In order to be able to use the PDGF aptamer in an assay for protein detection, alternative strategies for sample clean-up before analysis needed to be developed.

PAGE 68

55 Sample Pre-Treatment The development of recognition molecules for any type of assay should be experimentally convenient, sensitive and easy to perform in a short period of time. The developed MBA meets the characteristics for homogeneous solution analysis. Unfortunately, the response of the aptamer may be compromised by the presence of excess proteins in solution. Having the protein of interest in a biological environment is somewhat difficult for reliable detection by DNA-based methods. Based on the data presented in the last section, a mixture with total protein content higher than 100 g/mL in a 50 nM MBA solution may lead to false positive results due to non-specific binding. For this reason, the protein of interest needed to be isolated or the sample itself needs to be partially cleaned-up in order to obtain more reliable results. The ability to study proteins in mixtures with complete control of their environment (salts, temperature, pH, total protein content, etc.) is critical for the development of an in vitro assay using the PDGF-MBA. To simplify the sample before analysis, one must begin with the starting material (in this case cellular CM) and fractionate it using any one of a large number of physical or biochemical approaches: centrifugation, solid precipitation, binding to affinity columns or separation by sizing columns (gel filtration chromatography). In this case, size exclusion chromatography was used. After the cell medium was collected, clarified by centrifugation and lyophilized, it was run through a commercial NAP-5 or in a G-100 column to desalt the samples and remove low molecular weight protein components. In gel filtration chromatography, the stationary phase consists of porous beads with a well-defined range of pore sizes. The stationary phase for gel filtration is said to have a

PAGE 69

56 fractionation range, meaning that molecules within that molecular weight range can be separated. Proteins that are small enough can fit inside all the pores in the beads and are said to be included. The small proteins have access to the mobile phase inside the beads as well as the mobile phase between beads and elute last in a gel filtration separation. Proteins that are too large to fit inside any of the pores are said to be excluded. They have access only to the mobile phase between the beads and, therefore, elute first. Proteins of intermediate size are partially included meaning they can fit inside some but not all of the pores in the beads. The proteins will then elute between the large ("excluded") and small ("totally included") proteins. For our experiments we tested two different packing materials: Sephadex G-25 (PDGF will be included in the pores) and Sephadex G-100 (PDGF will be excluded from the pores). A control SBS was prepared to mimic conditioned media collected from tissue cultured cells that are commonly used to study the expression of proteins by normal and deceased cells. The sample contained DMEM supplemented with serum proteins and no PDGF-BB. It was processed by lyophilization to reduce the volume, diluted to 1 mL with 0.1 M acetic acid, loaded into a NAP-5 colu mn equilibrated with acetic acid, and collected at 0.5 mL fractions with 0.1 M acetic acid running buffer. After lyophilization and reconstitution in the binding buffer, each fraction was analyzed using the standard fluorescence quenching assay. Each fraction contained ~16.5 g/ml on average of serum proteins, as calculated with the Bradford assay. The results for the control SBM (Figure 3-3 A) showed that Fractions 6 to 16 caused different extents of quenching even though PDGF-BB had not been added.

PAGE 70

57 0100002000030000400005000024610121416MBAFraction numberFluorescence Intensity (A.U.) A 0200004000060000MBAFraction 1250 ng PDGF250 ng PDGFFluorescence Intensity (A.U.) B Figure 3-3. Fluorescence quenching caused by PDGF in the presence of proteins in a simulated biological specimen. Protein fractions were obtained from a Sephadex G-25 gel filtration of acetic acid soluble materials in a simulated biological specimen as described in Materials and Methods and each fraction was resuspended in 130 ul of a stock buffer Tris (pH 7.5, 10mM) with NaCl (20 mM). (A) 65 ul of each fraction indicated on the X-axis was incubated in a standard fluorescence quenching assay (final volume 100 ul) with the MBA (75nM) and the resulting fluorescence was measured. (B) Indicated amounts of PDGF-BB were added to a dilution of Fraction 12 with serum-derived proteins and incubated in a standard fluorescence quenching assay.62

PAGE 71

58 Based on repeated experiments conducted with PDGF-BB in buffer solution, it was determined that fractions 11 to 13 should contain PDGF-BB if added to the control SBS. Given that in fraction 6 there is ~50% quenching without the presence of PDGF-BB, gel filtration does appear to minimize the interferences by removing them from the PDGF-BB containing factions. To investigate this possibility and establish the limit of detection for the PDGF assay in the presence of serum proteins, varying amounts of PDGF-BB were added to fraction 12 of the control SBS. The results (Figure 3-3 B) showed a detectable decrease in fluorescence on the addition of as low as 50 ng of PDGF-BB.62 This data shows that the current assay can detect as little as 50ng/16.5 g of serum proteins. This leads us to believe that for MBA applications to be effective in biological samples the model system chosen for any protein of interest, should adequately express the protein at high enough levels to allow for the detection of the target in the presence of typical amounts of serum proteins. We further tested the reliability and effective range of operation for the fluorescence quenching assay by trying to improve the sample clean-up procedure using a Sephadex G-100 gel filtration column. For the G-100 packing material, the solid phase has larger pores and, as a result, retains PDGF in the column longer. This property should improve the exclusion of interfering impurities from PDGF containing fractions. Also, a direct comparison between an ELISA analysis and MBA assay was conducted. The ELISA not only allowed for the identification of the distinct fractions for which PDGF was eluted, but also, enabled us to compare the quenching results with the PDGF-BB responses in the presence of serum proteins. For the next experiment, a buffer sample containing only 50 g/mL PDGF was used. A Sephadex G-100 gel filtration column was

PAGE 72

59 equilibrated with 0.1 M acetic acid and the sample loaded. Then, 0.5 mL fractions were collected as the sample was eluted. To determine the fraction(s) that contained PDGF-BB, each one of the collected 0.5 mL fractions was tested using a commercial ELISA kit and PDGF was found in fractions 19 to 22. Using this information, we ran a SBS spiked with PDGF-BB in the Sephadex G-100 gel-filtration column and tested fractions 11 to 25 with the fluorescence quenching assay. Similar to the previous results obtained with the NAP-5 column (Figure 3-3A), several fractions exhibited different degrees of quenching when analyzed with the fluorescence quenching assay (Figure 3-4). The quenching assay indicated a significant amount of quenching in the fractions 17 to 22 after a 2-fold dilution of the original sample which was required for assay analysis. To determine the amount of PDGF in each fraction of the spiked SBS sample, fractions 7 to 18, 19 to 20, and 21 to 22 were pooled and analyzed using ELISA. PDGF-BB was found in samples 19 to 22 as expected based on the spiked ELISA experiments (Table 3-1). Even though fractions 17 to 18 did not contain PDGF-BB based on the ELISA experiment, a large degree of quenching was still observed for the MBA assay. The results further suggest the need for sample pre-treatment in order to minimize the interfering proteins such as those found in fractions 17 to 18. Unfortunately, it is still not understood as to whether the amount of quenching is due to PDGF versus non-specific binding to the probe. Interestingly, it was also observed that when the total protein concentration in individual fractions that did not contain PDGF from the two gel-filtration columns studied here was higher, the extent of quenching was higher. This finding points out the possibility that dilutions could be

PAGE 73

60 performed to minimize the extent of perceived interferences. A control sample that did not contain PDGF was made and processed as before. No PDGF was found in fractions 19-22 using ELISA. Since fractions 21-22 contained the highest amount of PDGF-BB, a side-by-side comparison of the PDGF and non-PDGF containing fractions was conducted with the MBA assay (Figure 3-5). Table 3-1. Analysis for PDGF-BB spiked samples after fractionation on a G-100 Sephadex column using enzyme-linked immunosorbent assay (ELISA) Eluted Fraction # g/mL PDGF 7-18 0.8 19-20 2.4 21-22 3.0 01000020000300004000050000111213141516171819202122232425MBAMBA+ PDGF-BBfraction numberFluorescence Intensity (A.U.) Figure 3-4. Fluorescence intensity of fractions of simulated biological sample (SBS) collected from G-100 column. Each fraction was 0.5 mL. After lyophilization samples were resuspended in binding buffer for the fluorescecence quenching assay. MBA concentration was 50 nM. Both fractions were adjusted to the same total protein concentration and the fluorescence quenching was monitored with the MBA assay. As shown in figure 3-5, the measured florescence intensity of the combined fractions spiked with PDGF-BB was more than the un-spiked control. As the dilution factor increases, the corresponding

PAGE 74

61 fluorescence intensities increased for both samples. This indicated that the cause of quenching in the control sample was capable of being diluted. To determine if PDGF could interact with the aptamer to cause complete quenching of the probe in the samples, an excess of PDGF-BB (250 ng) was spiked into the control samples after processing. The aptamer appeared to respond and bind to this addition of PDGF even in the presence of the serum proteins regardless of the dilution factor. The results were consistent with the above results and told us that with dilutions and gel-filtration PDGF-BB could be monitored in the presence of serum proteins. The amount required to obtain full quenching of the probe would, however, be significant considering the sample would need to be diluted. Upon a 4-fold dilution of the total proteins, the aptamer appeared to be unaffected by the serum proteins and capable of distinguishing between the control sample with and without PDGF. 010000200003000040000500002 fold4 fold6 fold8 fold10 foldbufferMBAMBA +PDGFFluorescence Intensity(A.U.) spiked with pdgf-bb no pdgf-bb added pdgf-bb added to spl 21 Figure 3-5. Fluorescence intensity of dilutions of SBS. Green columns represent fraction spiked with an additional 200 nM PDGF-BB post processing. MBA concentration is 50 nM.

PAGE 75

62 Conclusions The results presented in this chapter were used to explore the applicability of the PDGF-MBA probe to monitor PDGF secretion from cancer cells in cell media. Initially, the assay showed the ability to detect PDGF in spiked biological samples containing low levels of serum proteins. The conditioned media from two cell lines, which express different levels of PDGF, was analyzed with the assay. For HTB conditioned media, the final extent of quenching as well as the dose-dependent decrease in fluorescence illustrated a noticeable increase in the PDGF concentration in comparison to the BALB conditioned media. The MBA appeared to have the ability to qualitatively discriminate between cellular samples that contain PDGF; however, higher levels of serum proteins may result in false positive quenching. Simple size exclusion chromatography allowed for more reliable results to be obtained and showed that 50 ng of PDGF could be detected in the presence of ~16.5 g/mL of serum proteins. Further improvements in the sample processing could be explored; however, signal differential methodologies could provide more reliable results.

PAGE 76

CHAPTER 4 LIGHT SWITCHING APTAMER PROBE FOR PLATELET DERIVED GROWTH FACTOR USING RATIOMETRIC AND TIME-RESOLVED FLUORESCENCE MEASUREMENTS Introduction Fluorescent techniques offer excellent choices as signal transduction mechanisms to report binding events because most samples remain intact under normal excitation conditions and the sensitivity afforded by fluorescence detection. Fluorescence resonance energy transfer (FRET),40;62-64 anisotropy 25;33and lifetime-based measurements are examples of some fluorescent methods that, combined with a selected aptamer sequence, can be used for bioassay development. All signal transduction techniques have their individual strengths for different experimental needs. Nonetheless, FRET and anisotropy suffer from some limitations that could hamper their effective applications in complex biological samples. For instance, although fluorescence anisotropy only requires singly labeling of one dye molecule on each aptamer sequence, it entails non-standard instrumentation and data interpretation. FRET or fluorescence quenching based probes quantify target concentrations with changes in fluorescence intensity, but the two methods are sensitive to the solution environment and protein content as was showed in the last chapter. More importantly, depending on the selection of fluorophores, directly applying them to biological samples in their native environments may be difficult due to fluorescence interferences. The major goal of the experiments discussed in this chapter was to explore the possibility of designing a DNA probe that has the ability to differentiate between PDGF 63

PAGE 77

64 responses and the biological background responses. Typically, protein analysis in their native environments has two significant contributors to background signals. The first one is the probe itself. For example, in a quenching based FRET molecular probe for protein studies, the probe may suffer from incomplete quenching, resulting in significant background. Moreover, in a native biological environment, there are many potential sources for non-specific quenching of the probe as discussed in the previous chapter. This greatly limits exploring the full potential of FRET-based MBAs for protein detection. Concurrent with the experiments presented in this chapter, the effect of extracellular proteins in cellular samples was also addressed in Chapter 3 and a sample processing procedure to aid in the removal of most interfering proteins. Nonetheless, the effect of background signal from auto-fluorescing components of the cell media still needed to be investigated. Several molecular species exist in a biological environment, some of which will yield a strong fluorescence background signal when light is applied to the dye molecules. If the auto-fluorescence intensity of some of the cell media components is comparable to or larger than the fluorescence intensity of the fluorescence of the MBA, the fluorescence quenching becomes masked and the analysis of the fluorescence signals becomes difficult. Great efforts have been made to solve this problem 65; however, effective solutions are limited. The interesting spectroscopic properties of pyrene will be employed and combined with time-resolved measurements as an alternative approach to FRET. 34;66-68 Photophysics of Pyrene Excimers Pyrene is a four-ringed polycyclic aromatic hydrocarbon (PAH) that gives monomers and excimer emissions depending on its concentration. An excimer is a

PAGE 78

65 dimmer which is associative in an electronic excited state and dissociative in its ground state. The pyrene excimer was the first species of this type to be discovered.69;70 Figure 4-1. The chemical structure of pyrene The formation of a pyrene excimer requires an electronically excited pyrene encountering with a second pyrene in its ground electronic state. The excimer fluorescence of pyrene can be described by the following equilibrium: M* + M D* Molecular absorption occurs to produce an excited monomer (M*), which then interacts with its neighbor (M) to form the excimer (D*). When excimer formation takes place in any given pyrene-containing system, it can be easily monitored by a steady-state fluorescence spectrum: the broad, featureless emission centered at 480 to 500 nm is extremely easy to recognize, even when extensive monomer emission occurs; since the monomer fluorescence takes place in the 380 to 400 nm wavelength range.67 Another good example of a dye that exhibits the excimer phenomena is BODIPY, whose monomer emits at 520 nm, and excimer has emission of 620 nm.71;72 The formation of the excimer is useful to probe spatial arrangement of some molecules. Similar to FRET, the distance dependent property of excimer can be used as a unique signal transduction in the development of aptamer-based probes that change their secondary structures on binding of its target, such as the aptamers selected against, PDGF,33;62;63 cocaine,73thrombin,39;74 and HIV1 Tat protein.75The emission wavelength

PAGE 79

66 switching property solves the background signal problem that occurs with FRET molecular probes. This finding encouraged us to apply the use of pyrene molecules in a new aptamer probe design to develop oligonucleotide probes. Time-Resolved Measurements Time-resolved fluorescence spectroscopy is a well-established technique for studying the emission dynamics of fluorescent molecules, i.e. the distribution of times between the electronic excitation of a fluorophore and the radiative decay of the electron from the excited stated producing an emitted photon. The temporal extent of this distribution is referred to as the fluorescence lifetime of the molecule. This technique is widely used in fluorescence spectroscopy because it often contains more information than is available from steady-state data. With steady-state measurements some of the molecular information is lost during the averaging process. Many macromolecules can exist in more than a single conformation and the decay time of a bound probe may depend on the conformation. The intensity decay may reveal two different decay times indicating the presence of more than one conformational state. The steady state intensity will only reveal an average intensity dependent on a weighted average of two decay times. There are additional reasons for using time-resolved experiments. For example, in the presence of energy transfer, the intensity decays may reveal how acceptors are distributed in space around the donors. Also, time resolved measurements reveal whether quenching is due to diffusion or to complex formation with the ground state fluorophores. In fluorescence, much of the molecular information content is available only from the time-resolved measurements.34 Fluorescence decay kinetics gives a complete picture of the fluorophore and its interactions within the microenvironment. Complex intermolecular interactions can be

PAGE 80

67 revealed by lifetime measurements made across an emission spectrum which has little structure. Time correlated single photon counting (TCSPC) is a commonly used method for the detection of the fluorescence lifetimes. TCSPC is a digital counting technique that relies on the concept that the probability distribution for emission of a single photon after an excitation event yields the actual intensity against time distribution of all the photons emitted as a result of excitation. By sampling the single photon emission following a large number of excitation flashes, the probability distribution can be constructed. As a result of the above spectroscopic properties afforded by lifetime measurements together with the use of a pyrene-based aptamer probe, it was of interest to evaluate its potential for use with biological samples. Both steady-state and time-resolved fluorescence measurements were conducted to provide in vitro monitoring of biological samples with MBAs. In this approach, the MBA was labeled with pyrene molecules, similar to what has been reported in using pyrene for molecular beacons.66 The optical properties of pyrene were exploited, including that with the same excitation, the excimer emitted at a longer wavelength than that for the monomer. Although excimer formation is a very attractive characteristic of pyrene for protein detection in solution, the excimer phenomena alone can not solve the problem of signal from the multiple species in the biological environment. One feature of the pyrene excimer is that it has a long lifetime67 compared with other potential fluorescent species. The lifetime of the pyrene excimer could be as long as 100 ns, while that for most of the species that contribute to the biological background signal is shorter than 5 ns. This property should allow the separation of the biological background signal from that of the excimer signal using time-resolved fluorescent measurements.

PAGE 81

68 Experimental Section All the aptamer-based probes listed in Table 4-1 were synthesized in-house and purified with RP-HPLC. Reagents for the synthesis of DNA were purchased from Glen Research (Sterling,VA). The pyrene labeled aptamer used for this set of experiments, Pyr-MBA, is a shorter version of the original 36t aptamer designed specifically to reduce pyrene background emission due to the close proximity of the dye molecules at each end of the probe. Since the stem sequence is not important for the high affinity binding to PDGF-BB47, in order to reduce the background emission, the stem was shortened gradually to identify an aptamer sequence that was in fully open conformation in the absence of target while reserving good binding affinity. All aptamers were labeled with pyrene at both termini. SGL-MBA is single labeled with pyrene at its 5 end. SCR-MBA is a 39-mer scramble oligonucleotide sequence with pyrene molecules at both ends. Table 4-1. Pyrene-labeled oligonucleotide sequences used in this study. Sequence Name Sequence Pyr-MBA Pyrene-AGGCTACGGCACGTAGAGCATCACCATGATCCT-Pyrene SGL-MBA Pyrene-AGGCTACGGCACGTAGAGCATCACCATGATCCT SCR-MBA Pyrene-GGAACGTAATCAACTGGGAGAATGTAACTGACTGC-Pyrene Pyrene butylic acid was purchased from Sigma (St Louis, MO). Recombinant human PDGF-BB, PDGF-AB, PDGF-AA, and, TNFwere purchased from R&D Systems (Minneapolis, MN) and dissolved in 4 mM HCl with 0.1% BSA and then diluted in 20 mM Tris buffer (pH 7.5) before use. Other recombinant human growth factors, including recombinant human epidermal growth (EGF) and insulin-like growth factor 1 (IGF-1), were from Roche (Indianapolis, IN). Bovine serum albumin (BSA), human hemoglobin (HEM), horse myoglobin (MYO), chicken lysozyme (LYS), human

PAGE 82

69 thrombin (THR) and other chemicals were from Sigma. The binding buffer used for all the characterization experiments was 20 mM Tris-HCl (pH 7.5) with 20 mM sodium chloride. To prepare a simulated biological sample (SBS), Dulbeccos Mofication of Eagles Medium (DMEM) (Mediatech, Inc, Hendon, VA) was supplemented with fetal bovine serum (Invitrogen, Carlsbad, CA) and used for the detection of PDGF in biological samples. Instruments An ABI3400 DNA/RNA synthesizer (Applied Biosystems, Foster City, CA) was used for DNA synthesis. Probe purification was performed with a ProStar HPLC (Varian, Walnut Creek, CA) where a C18 column (Econosil, 5u, 250.6 mm) from Alltech (Deerfield, IL) was used. UV-Vis measurements were performed with a Cary 300 UV-Vis spectrophotometer (Varian, Palo Alto, CA). Steady-state fluorescence measurements were performed on a Fluorolog-Tau-3 spectrofluorometer (Jobin Yvon, Inc., Edison, NJ). For emission spectra, 349 nm was used for excitation. Time-resolved measurements were made with a single photon counting instrument (OB900, Edinburgh Analytical Instrument), where a nitrogen flash lamp was used as the excitation source (=337 nm). Synthesis and Purification of Pyrene Labeled MBA Several methods have been reported for oligonucleotide labeling.66;76 Unfortunately, for dually labeling pyrene on both nucleic acid termini, the reported procedures proceeded in low yields partially due to solubility incompatibility of pyrene derivatives and oligonucleic acids. A new solid phase coupling method that allow multi

PAGE 83

70 labeling organic dyes to DNA sequences with coupling yields as high as 80 % was used to synthesize all the pyrene labeled aptamers.77 Results and Discussion Light Switching Excimer Aptamer Probe Design As a proof of principle, the excimer signaling approach was used to develop a probe for PDGF-BB. An excimer switching aptamer probe was developed by labeling both ends with pyrene molecules that can form excimers. When the dual-pyrene-labeled aptamer probe is free in solution without the target protein, both pyrene molecules will be spatially separated, based on the FRET experiments in Chapter 2, and only the monomer emission peaks (at 375 nm and 398 nm) will be observed. The binding of the aptamer probe to protein brings the pyrene molecules at 3' and 5' ends close together, allowing the excimer to form. Thus, the emission peak around 485 nm will be observed. The change in emission color serves as a rapid process for qualitation and the excimer fluorescence intensity can be used for highly sensitive real-time quantitation of PDGF in homogeneous solutions. Figure 4-2. Use of pyrene excimer to probe PDGF-BB. PDGF-BB aptamer was labeled with pyrene molecule at both ends. The two pyrenes will be away from each other because of the open structure of the aptamer. After binding to PDGF-BB, the aptamer adapts a close conformation, bringing two pyrenes close to each other. As a consequence, pyrene excimer forms and green light emits.

PAGE 84

71 Light Switching Aptamer Probe for PDGF-BB Detection A light switching aptamer probe, named Pyr-MBA (sequence shown in Table 4-1), was prepared by labeling a 33-nucleotide sequence, a shorter version of the 36t MBA with pyrene molecules at both 3' and 5' ends.47 Figure 4-3 shows the fluorescence emission spectrum from a solution containing 100 nM of Pyr-MBA. Two emission peaks at 375 and 398 nm corresponds to pyrene monomer emission. No significant excimer emission was observed from this solution (Figure 4-3). Upon addition of 50 nM PDGF-BB into the Pyr-MBA solution, an aptamer-protein target complex was formed leading to a secondary structure where the 3' end sequence hybridizes to the 5' end sequence, forming a stable stem. This stem brings both pyrene molecules together, resulting in excimer emission at 485 nm (Figure 4-3). 400450500550600050000100000150000200000250000300000350000400000450000 Fluorescence Intensity (A.U.)Wavelength (nm) Pyr-MBA Pyr-MBA + PDGFBB Figure 4-3. Fluorescence emission spectra of Pyr-MBA with and without PDGF-BB in binding buffer. As shown in Figure 4-3, protein-bound probe gives emission peaks, two monomer peaks at 375 nm and 398 nm respectively, and excimer peak at 485 nm. This allows for ratiometric measurements. By taking the intensity ratio of the excimer peak to either one

PAGE 85

72 of the monomer peaks, one could effectively eliminate signal fluctuation and minimize impact of environmental quenching on the accuracy of measurement. We further explored excimer formation by designing two control DNA sequences, SGL-MBA and SCR-MBA. The sequences were prepared to confirm that the observed excimer emission was a result of the aptamer-protein binding. The first sequence SGL-MBA was the same sequences of the Pyr-MBA aptamer labeled with pyrene at the 5' end. Green et al. reported47 that PDGF-BB has two binding sites; the phenyalanine-84 residue in the B-chain of PDGF forms a point of contact with a specific nucleotide residue in loop at the helix junction of the selected aptamer However, the addition of PDGF-BB into the SGL-MBA solution did not change the emission spectrum of the solution, indicating that two pyrene molecules need to be in close proximity. This suggests that the distance between adjacent molecules was not enough for the excimer formation and emission. This data also showed that PDGF-BB itself has no measurable effect on the optical properties of pyrene molecules. The second sequence, SCR-MBA, is a random DNA sequence with its 3' and 5' ends labeled with pyrene. This sequence was used as a control aptamer with no or low affinity for PDGF-BB to demonstrate that the excimer emission is a direct result of the formation of the Pyr-MBA/PDGF-BB complex. This dually labeled scramble sequence, did not give any excimer emission after the addition of PDGF-BB. Both results indicated that the excimer emission showed in Figure 4-3 was indeed from the aptamer conformation change on specific binding to PDGF-BB.

PAGE 86

73 e501001502000.00.20.40.60.81.01.21.41.61.82.02.22.4 F485nm / F378nmt (s) pyr-MBA SGL-MBA SCR-MBA PDGF-BB addition Figure 4-4. Real-time response of excimer/monomer ratio. It showed that the binding of PDGF-BB aptamer to PDGF-BB takes place within seconds. It affords a rapid protein assay. Sensitivity and Selectivity of the Probe The dose-dependent excimer formation was determined to evaluate the sensitivity of the pyrene-labeled aptamer probe (Figure 4-5). A linear response was observed with the addition of increasing amounts of PDGF-BB in concentrations ranging from 0 to 40 nM. This result confirmed the formation of the excimer due to the spatial proximity of the two pyrene molecules (and the appropriate geometrical arrangement required for excimer emission) at the ends of the MBA. According to the measurements for blank samples, the limit of detection was calculated an about 200 pM were consistently detected in homogeneous solution. Moreover, the high sensitivity together with the emission wavelength switching and detection without separation nature of this probe, enabled detection of the presence of 40 nM PDGF-BB just with the naked eye (Figure 4-6). A clear green color was observed when PDGF-BB was added to 100 nM of excimer probe solution.

PAGE 87

74 360380400420440460480500520540560050000100000150000200000250000300000350000400000 Fluorescence Intensity(A.U.)Wavelength (nM) 0nM 2nM 4nM 6nM 8 nM 10nM 12nM 14nM 16nM 20 nM 24nM 30nM 35nM A 0510152025303540450.00.20.40.60.81.01.21.41.61.8 F 485nm / F 378nmPDGF-BB (nM) B Figure 4-5. Dose-dependent excimer formation on additions of PDGF-BB to a Pyr-MBA. A)in binding buffer, B)calibration curve.

PAGE 88

75 Figure 4-6. Visual detection of PDGF-BB. Solution of the 100 nM pyr-MBA under UV light (left), and 100 ul of 100 nM pyr-MBA with 40 nM of PDGF-BB (right). To detect PDGF-BB in the presence of other biomolecules the selectivity of the pyr-MBA probe is critical. Similar to the FRET-based MBA, the pyrene labeled MBA was mixed with excess extra-cellular proteins such as albumin, hemoglobin, myoglobin, and lysozyme. Even at 10 times the PDGF-BB concentration, the proteins did not produce significant changes in signal (Figure 4-7). LSMHMGMYGTHRBSAPDGF BB0.00.20.40.60.81.0 Relative Fluorescence Quenching (A.U.) Figure 4-7. Response of excimer probe to different proteins. Concentration of PDGF-BB was 50 nM, while the concentration of other proteins was ten times higher (500 nM). Furthermore, we tested the selectivity of the excimer probe for proteins and peptides potentially coexisting with PDGF-BB in biological samples. The results showed this shorter version of the original MBA probe retain its high selectivity for PDGF-BB in

PAGE 89

76 homogeneous solution. The responses to epidermal growth factor (EGF), vascular endothelial growth factor (VEGF), or insulin-like growth factor 1 (IGF-1) were minimal. PDGF-AA and PDGF-AB, both of which have shown lower response to the aptamer sequence in the FRET system, gave lower fluorescence-signa l response in this case as well (Figure 4-8).47 EGFIGFVEGFPDGFAAPDGFABPDGFBB0.00.20.40.60.81.0 Probe response (A.U.) Figure 4-8. Response of 50 nM Pyr-MBA to 500 nM of different growth factors. Bovine serum albumin (BSA) belongs to the class of serum proteins called albumins, which make up about half of the protein in plasma and are the most stable and soluble proteins in plasma. It is very common for laboratories developing immunoassays, mostly due to its availability, solubility and the numerous functional groups present for coupling to haptens. For PDGF-BB reconstitution, a buffer containing BSA as a carrier protein was used and as result BSA will be present throughout. To rule out any possible contribution of BSA to the measured fluorescence emission, increasing amounts of BSA were incubated with the pyr-MBA. In this case, high concentrations of BSA did not alter

PAGE 90

77 the optical properties of pyr-MBA; the measured excimer emission is negligible as can be observed from the data presented in Figure 4-9. 05000100001500020000375425475525575Wavelength (nM)Fluorescence Intensity (A.U.) 0.1 mg/mL 0.15 mg/mL 0.2 mg/mL 0.25 mg/mL 0 mg/mL Figure 4-9. Increasing amounts of BSA incubated with 50 nM Pyr-MBA. Direct Quantitative Detection of PDGF-BB in Cell Medium To be applicable for a potential bioassay development, the MBA probe must tolerate interferences typically present in a biological sample. In the previous chapter we showed that when the MBA is incubated with a protein mixture containing high levels of cellular proteins, false-positive quenching signals were obtained. On the other hand, when the protein levels are monitored and adjusted to acceptable levels, the MBA binds to PDGF-BB with high affinity and responds by a decrease in fluorescence intensity attributable to the formation of the PDGF-BB-MBA complex. In this chapter, the interference presented by autofluorescencing components in the media will be investigated. For the purposes of simplicity and to investigate solely the effect of auto-fluorescence cell media components, a simulated biological specimen (SBS) was made

PAGE 91

78 by combining cell medium with low levels of serum proteins. Figure 4-10 shows the spectra of 200 nM Pyr-MBA in a Tris-HCl buffer solution and cell medium (DMEM). 3504004505005506006500100000200000300000400000500000600000700000800000900000 Fluorescence Intensity (A.U.)Wavelength (nm) 200 nM Pyr-MBA in buffer 200 nM Pyr-MBA + 50 nM PDGFBB in buffer 200 nM Pyr-MBA in DMEM DMEM 200 nM Pyr-MBA + 50 nM PDGF-BB in DMEM Figure 4-10. Fluorescence spectra of simulated biological sample. (DMEM, 200 nM Pyr-MBA in DMEM, 200 nM Pyr-MBA and 50 nM PDGF-BB in DMEM, 200 nM Pyr-MBA in Tris-HCl buffer, and 200 nM Pyr-MBA and 50 nM PDGF-BB in Tris-HCl buffer) In binding buffer, the MBA showed an intense excimer emission which was observed when the target protein was added to the probe solution. Unfortunately, intense background fluorescence, contributing from some species typically encountered in the cell medium such as riboflavin, nicotinamide, pyridoxine, tryptophan, tyrosine as well as phenol red, was observed, which masked the signal response from the probe and made it indistinguishable. This result indicates that simple steady-state fluorescence measurements are questionable for direct detection of PDGF-BB in a biological sample. As mentioned before, the MBA labeled with pyrene molecules not only has the excimer formation capability but also the advantage of a long fluorescence lifetime. Most of the background fluorescence has a lifetime of less than a few nanoseconds(~10 ns), while the monomer and excimer emission of pyrene have much longer lifetimes. Since

PAGE 92

79 we were interested in studying the possibility the pyrene molecules for signal differentiation based on lifetime, the total amount of protein was maintained at acceptable levels (~10 g/mL) for the PDGF-BB aptamer. Also, based on the steady state fluorescence spectra (Figure 4-10) there is considerable background signals at this concentration produced by SBS at the wavelength of interest which impede the ability for pyrene to be useful in standard fluorescence measurements. Therefore, there is a need to study this format by alternative fluorescence measurements and explore the potential of using the lifetime characteristics of pyrene. Time correlated single photon counting measurement of the Pyr-MBA and Pyr-MBA-protein complex solutions were investigated to characterize their lifetimes and identify the nature of excimer formation. The results obtained by TCSPC suggested that the lifetimes of both pyrene monomer and excimer were around 40 ns. This is one magnitude longer than lifetimes of most organic fluorophores and fluorescent components in cell medium and cells, which should allow temporal resolution of the excimer signal from intense background fluorescence from cell medium. Three cell media samples were then subjected to SPC measurements: simulated biological sample (SBS), 200 nM Pyr-MBA in SBS, and 200 nM MBA-Pyr-MBA and 50 nM PDGF-BB in SBS. The data reported on Figure 4-11 and 4-12 showed that the fluorescence emission from both pyrene monomer and excimer can be differentiated from background fluorescence. Although pyrene monomer has a longer lifetime, the difference in intensity between Pyr-MBA in SBS and SBS itself is small (~3 times). This may be because many components of the SBS fluoresce at this region and their concentrations are higher than the MBA concentration.

PAGE 93

80 0255075100125150175200110100100010000100000 Fluorescence Intensity (A.U.)Time (ns) SBS SBS + Pyr-MBA SBS + Pur-MBA + PDGFBB Figure 4-11. Monomer time-resolved spectra collected at 398 nm (monomer emission) for a sample of simulated biological medium (SBS), 200 nM Pyr-MBA in SBA and 50 nM Pyr-MBA and PDGF-BB in SBS. 0255075100125150175200110100100010000 Fluorescence Intensity (A.U.)Time (ns) SBS SBS + Pyr-MBA SBS + Pyr-MBA + PDGFBB Figure 4-12. Excimer time-resolved spectra collected at 480 nm (excimer emission) for a sample of simulated biological medium (SBS), 200 nM Pyr-MBA in SBA and Pyr-MBA and 50 nM PDGF-BB in SBS. Time resolved emission spectra revealed changes in emission spectra on a nanosecond time scale (Figure 4-13). Due to its short fluorescence lifetime, the fluorescence from the SBS decayed rapidly, getting to 0.1 % of its original signal 40 nanoseconds after the excitation pulse reached maximum intensity. In contrast, the excimer emission decayed slower and retained reasonably high emission intensity even

PAGE 94

81 after 40 ns of decay. The highest signal to noise ratio at 480 nm was observed from 40 to about 100 ns after the excitation pulse reached maximum intensity. Before 40 ns, there was still significant background fluorescence from the SBS while the signal to noise ratio dropped below 3 after 100 ns of decay. In contrast, the excimer emission from a mixture of protein and probe in SBS decayed much slower (Figure 4-13). The emission remained after 40 ns of decay. The temporal separation of intense background from weak signals is evident in Figure 4-14, where time-resolved fluorescence emission spectra of SBS samples are compared with steady-state fluorescence emission spectra. For steady-state measurements no resolved peak around 485 nm was observed when PDGF-BB was added to Pyr-MBA in the SBS sample due to a significant amount of background signal. However, in time-resolved emission spectra the long lifetime emission peak at 480 nm was well resolved. This peak corresponded to excimer emission from protein-bound probe, which was supported by two observations: its intensity varied with changes of protein concentration, and no such peak was observed in either spectrum of cell medium or cell medium solution containing PDGF-BB and a single-pyrene-labeled aptamer sequence (SGL-MBA). Thus, this characteristic emission peak could be used to examine the presence of PDGF-BB in biological fluids.

PAGE 95

82 Figure 4-13. Fluorescence intensity as a function of wavelength at different times. SBS (green), 200nM Pyr-MBA in SBS (red), and 200nM Pyr-MBA with 50nM PDGF-BB in cell SBS (blue) at 25C. Excitation=337nm. Time=0 ns correspond to the time at which the excitation pulse reaches maximum intensity. Detection of PDGF-BB in Simulated Biological Sample With the single photon counting technique, the Pyr-MBA probe can qualitatively detect target protein in homogeneous solution and in a simulated biological sample containing low levels of potential interfering proteins. When the concentration of PDGF-BB was increased, the fluorescence intensity of the excimer peak in time-resolved emission spectrum increased accordingly. Figure 14-15 shows the decays of 200 nM

PAGE 96

83 aptamer probe Pyr-MBA in the cell medium with increasing concentrations of PDGF-BB at 480 nm emission. 3603804004204404604805005205405605806000.00.20.40.60.81.01.2 Signal (counts)Wavelength (nm) Steady State: Pyr-MBA in SBS Steady State: Pyr-MBA + PDGFBB in SBS Time-resolved: Pyr-MBA in SBS Time-resolved: Pyr-MBA + PDGFBB in SBS Figure 4-14. Steady-state and time-resolved fluorescence spectra of SBS samples. Steady state fluorescence emission spectra of 200 nM Pyr-MBA in SBS and 200 nM Pyr-MBA with 50 nM PDGF-BB. Time-resolved fluorescence spectra of 200 nM Pyr-MBA in SBS, and 200 nM Pyr-MBA with 50 nM PDGF-BB in SBS. Time resolved spectra were taken over 60 ns to 79 ns after the excitation pulse reaches the maximum intensity. Fluorescence intensity from the response of each solution could be calculated by integrating photons emitted over an optimized time window. Photons emitted between 40 and 100 ns were counted and integrated for each concentration to construct a calibration curve. The resulting fluorescence intensity is proportional to the PDGF-BB concentration (Figure 14-14). This linear response of fluorescence intensity to PDGF-BB

PAGE 97

84 in cell medium demonstrates the feasibility of detection of the target proteins in simple biological samples containing low levels of proteins. 020406080100120140160180200110100100010000 Signal (counts)Time (ns) 100nM 75nM 50nM 25nM 0nM Medium A 020406080100050000100000150000200000 Signal (counts)PDGF-BB (nM) B Figure 4-15. Fluorescence decays of 200 nM Pyr-MBA in simulated biological specimen. (A) Simulated biological sample with various concentrations of PDGF-BB and response of fluorescence intensity to the change of protein concentration. Excitation= 337 nm. The collection time for each decay was 3000 seconds. (B)Photons emitted between 40 and 100 ns after excitation pulse reached maximum were counted to construct the calibration curve.

PAGE 98

85 Expression of PDGF-BB from Cells Several reports have indicated that PDGF-BB can be over-expressed by various types of cancer cells, including MCF-7, MDA-MB-231 and PC3 cultured cell lines.46 Unfortunately, the literature is ambiguous as to the specific amounts of PDGF-BB that can be expressed under any given condition. This is largely limited to the fact that most of methodologies currently used provide only qualitative information and often not just specific to PDGF-BB expression.78;79 As a result, ELISA was employed to determine specific amounts of expression that could be expected from PC-3 tissue cultured cells. PC-3 cells are adherent prostate cancer cells and on incubation with TNFover-express PDGF-BB. TNF(also called cachectin) is a major immune response modifying cytokine produced primarily by activated macrophages. TNFalso induces the expression of other autocrine growth factors, increases cellular responsiveness to growth factors and induces signaling pathways that lead to proliferation. TNFacts synergistically with EGF and PDGF-BB in some cell types. In order to determine the levels of PDGF-BB present in conditioned media, ELISA tests were performed on different samples. The levels of PDGF-BB lwere measured from samples which were cultured to confluency and spiked with Recombinant Human TNFto induce PDGF-BB production (Table 4-2). The total protein concentration was determined by the Bradford Assay. Since the addition of TNFto PC-3 cells in culture should increase the levels of PDGF-BB in the conditioned media, it was first important to find out if we could monitor PDGF-BB induction. PC-3 cells were cultured in 35 mm cell culture dishes in a final volume of 2 mL. Twenty mg of TNFwas added to each cell

PAGE 99

86 dish and the conditioned media was collected at 0, 3, 6, 9, 12 and 24 hours after induction. Table 4-2. Amount of protein collected in 24 hours Incubation time (hrs) PDGF-BB (pg/mL) PDGF-BB (pM) Total protein concentration (g/mL) 0 < 15 <0.6 5893 3 < 15 <0.6 6915 9 16.3 0.7 6787 12 42.9 1.7 6934 24 197 7.9 7340 In this case it can be observed that TNFinduced the expression of PDGF-BB in PC-3 cells. Non induced samples have less than 15 pg/mL of PDGF-BB. On the other hand, after 9 hours of incubation, an increase in PDGF-BB levels can be observed, up to 197 pg/mL after 24 hours. The total protein concentration of all the samples was measured and it ranged from approximately 5,900 g/mL to more than 7000 g/mL. A second set of samples was prepared with the idea of increasing the amount of PDGF-BB present per sample. Changes included: incubation in a larger flask, with a small volume (enough to cover the surface of the flask), and with a higher amount of TNF-. A large surface area of adherent cells in a small volume should allow for a higher amount of PDGF-BB collection. The second change in the sample handling includes a concentration step by lyophilization (25 ml were reduced to 5 mL). In this case, PC-3 cells were cultured in five 75 cm2 flasks with 5 mL of cell media in each. Cells were grown to confluency and 25 mg of TNFwas added to each flask and the conditioned media was collected after 24 hours for one set and after 36 hours for the following. The total volume of conditioned media collected was 25 mL. After lyophilization the volume was reduced to 5 mL. The results from the ELISA and Bradford assays are shown in

PAGE 100

87 Table 4-3. It is illustrated that the amount of PDGF-BB is indeed higher with the modified sample collection method, doubling in a period of 12 hours. Table 4-3. Amount of protein collected in 24 and 36 hours Incubation time (hrs) PDGF-BB (pg/mL) PDGF-BB (pM) Total protein concentration (g/mL) 24 865 35 9334 36 1775 71 11934 The two sample collections methods showed an increase in PDGF-BB production after induction with TNF-, but the levels of PDGF-BB are lower than the current limits of detection of the pyrene and the FRET assay. In addition, even if the levels of PDGF-BB were detectable, the total amount of protein per sample is about 2 orders of magnitude higher than the allowed protein concentration determined for the quenching assay. Since the interfering non-specific interactions would be similar for the Pyr-MBA and FRET MBA (essentially, non-specific binding to the aptamer), it is reasonable to assume that the total protein concentration would limit both assays. If the total amount of protein commonly found in serum exceeds 100 g/mL before sample processing, non-specific interactions will result in false positive signals for this particular aptamer as shown in Figure 3-2. A longer incubation time may be a possibility for increasing PDGF-BB production, but after 36 hours of incubation, cells are 100% confluent and as result they begin to die. Also, the total amount of total protein concentration increased as well. Conclusions The method of excimer light switching is an excellent signal transduction for aptamer probe development. Pyr-MBA is able to detect protein in homogeneous solution and simple biological samples containing low, or acceptable levels of proteins for the aptamer. The generation of the excimer emission requires the conformation change of the

PAGE 101

88 aptamer brought about by complexation with a target protein to bring two pyrene molecules together. This stringent requirement prevents false positive signals when the probe is digested by nucleases. Another advantage of using this approach is that it potentially allows for ratiometric measurements to be obtained, which could minimize environmental errors and afford a more accurate detection. With this approach, a sensitive and selective PDGF-BB aptamer probe has shown a detection limit of about 200 pM in homogeneous solution. With the time-resolved single photon counting technique, the pyr-MBA was able to detect PDGF-BB in a simulated biological sample in the presence of low levels of serum proteins. For homogeneous solution experiments, the detection-without separation and sensitivity of this approach may find useful applications to construct biosensors for protein function studies in vitro with other aptamers for oligonucleotide probes. By using a combined approach, 4-12 mol of PDGF-BB were detected in a few seconds in vitro. With the use of time resolved measurements and the long fluorescence lifetime of pyrene relative to the lifetime of the cell media components, the fluorescence due to the excimer formation can be distinguished from autofluorescence of some of the cell media. Unfortunately, the direct application of the this particular Pyr-MBA for PDGF-BB detection may be hindered by the fact that the levels of PDGF-BB is lower than the limits of detection of the current assay and in addition the total protein concentration is high enough to produce false positive signals due to non specific binding. Both problems need to be addressed carefully in addition to the selection of sensitive signaling mechanisms for future MBA assay applications. The findings for the MBA and PDGF-BB interaction can not be generalized to every aptamer-target system and it may be possible that the

PAGE 102

89 same concepts and methods developed here can be successfully applied for the detection and studies of other protein biomarkers. Further exploration of lifetime measurements can yield information on the molecular microenvironment of a fluorescent molecule. Factors such as ionic strength, hydrophobicity, oxygen concentration, binding to macromolecules and the proximity of molecules that can deplete the excited state by resonance energy transfer can all modify the lifetime of a fluorophore used to label an aptamer based probe. Measurements of lifetimes can therefore be used not only for protein studies but also add an additional dimension to assay development. Furthermore, with instrumentation improvements that would allow for more high-throughput analysis, pyrene-based molecular probes could be adapted for multiplexing and multi-protein analysis.

PAGE 103

CHAPTER 5 FLUORESCENCE RESONANCE ENRGY TRANSFER STUDIES FOR MOLECULAR BEACON APTAMERS: UNDERSTANDING PROTEIN INTERACTION AND VERSITILITY OF PROBES Introduction Given the clear importance and drive to develop aptamers for pharmaceutical leads, detection reagents, and proteomic tools, understanding the structure and behavior of aptamers under practical conditions is critical to developing aptamer based prototypes that can ultimately be optimized and have an impact in industry.21;80-84 Thus, it is necessary to conduct systematic analyses of aptamers to understand any given aptamer-protein interaction, what factors are involved in this interaction, how the modification of the existing conditions affect the total change in fluorescence quenching on biding and if there is any universal rules that govern aptamer functions in assays, much like that of antibodies. Since their inception, aptamers have been shown to work well in homogeneous solution; however, in recent years the focus has changed towards the development of new aptamer based technologies.8 One example of such an application is the development of the most advanced therapeutic aptamer, pegaptanib from Macugen, an aptamer directed against VEGF.85;86 This anti-VEGF-aptamer, a PEGylated short 2'Fand 2'-methoxy modified RNA oligonucleotide was developed for the treatment of exudative age-related macular degeneration, the leading cause of irreversible loss of vision among Americans over the age of 55. Clinical phase trials showed that more than 80% of the patients show stable or improved vision after treatment with Macugen. As a result of these applications, fundamental studies on aptamer behaviors in more complex 90

PAGE 104

91 systems are important. As seen in previous chapters, the fact that any given aptamer probe can be used for sensitive detection of a target molecule (i.e. protein) in optimized homogeneous solution does not necessarily mean that the probe can be directly adapted for use in a complex biological matrix. Our initial efforts focused on the design of the probe and solving two of the major issues for using the PDGF-BB aptamer in biological samples. Even though this aptamer system appeared to be incompatible with the chosen cellular expression systems, several more general areas of interest could be studied with the current FRET-probe system that could be extended to a more general knowledge base for other aptamer detection methods. In this chapter, several assay formats are described and demonstrate that other strategies can be used and, if successful, optimized for the use of aptamers in different applications. Specifically, oligonucleotide backbone modifications, effects of the homologous RNA aptamer on FRET responses, utilization of multiple binding sites to generate signal transduction, and a two step restriction enzyme assay will be discussed. Although our studies could be generally applied to other aptamer systems, we targeted our experiments towards improving the existing FRET format for PDGF-BB. Results and Discussion Backbone-Modification of DNA The exchange of one non-bridging oxygen atom with a sulfur atom in the DNA phosphorothioate modification is a conservative change, as th e negative charge of the phosphate group is retained and the size of the sulfur atom is only slightly larger than the oxygen atom (Figure 5-1). The phosphorothioate internucleotidic linkage is considerably more stable than the phosphodiester bond toward nucleases degradation, and this attribute makes it practical for studies where cells would be involved.87 Oligonucleotide

PAGE 105

92 phosphorothioates can be synthesized by two methods: the first one is chemical synthesis utilizing a sulfurizing reagent in the oxidation step and the second is enzymatic incorporation. When oligonucleotides are employed for protein detection in cellular samples or in vivo therapeutic purposes such as the antisense oligonucleotide-mediated inhibition of gene expression this property (nuclease resistance) becomes especially important. Figure 5-1. Phosphorothioate DNA backbone modification. Standard phosphorothioate backbone (left). The diagram on the right shows were a sulphur atom replaces one of the non-bridging oxygen atoms in the phosphate group. Since the normal phosphodiester backbone of synthetic DNAs is vulnerable to nucleases present in biological samples, the 36t-MBA modified with a phosphorothioate backbone DNA was investigated to determine if an MBA probe could be modified and still remain functional. The phosphorothioate backbone-modified DNA was synthesized using the standard sulfurizing agent, Beaucage Reagent, to achieve stepwise sulphurization instead of the iodine oxidation step in the standard synthetic cycle. The backbone modified DNA was synthesized using a DABCYL moiety at the 3-end and a phosphoramidite fluorescein at the 5'-end. The resulting MBA was then purified using standard by reverse phase HPLC. Retention time for phosphorothioates will be longer than for corresponding phosphodiester analogues. As a result, purification is improved;

PAGE 106

93 however, partial modifications, or incomplete modifications, would still be difficult to remove from the synthesis product. The impurities will mostly attribute to partial cleavage of the probe, but not significantly affect the general open versus closed fluorescence of the probe because cleaved probes would not result in quenching. 01000020000300004000050000Thio-MBAFluorescence Intensity/A.U. withoutPDGF-BB 50 nMPDGF-BB Figure 5-2. Fluorescence quenching produced by a phosphorothiate modified MBA. Seventy five nM of the backbone-modified MBA showed a detectable quenching, approximately 75 % as compared to 90% observed with unmodified MBA, when incubated with a 300 nM 4-fold molar excess of PDGF-BB in a standard fluorescence quenching assay (Figure 5-2). The results presented in Figure 5-2 indicated that the DNA backbone modification to achieve nuclease resistance did not significantly inhibit the binding and the conformational change of the MBA in response to PDGF-BB; but the overall quenching efficiency was slightly lower. Possible reasons for a decrease in the overall fluorescence response of the MBA include the fact that some modifications may

PAGE 107

94 disrupt some of the secondary structures that are important for binding. In another respect, the negative charge of the phosphodiester group is more important for protein interactions than interactions with other nucleic acids, since specific contacts between the protein residues and the phosphodiester groups could be critical for binding. Nonetheless, since the backbone modified MBA should be more stable than the standard 36tMBA to nucleases encountered in biological specimens the use of the modified MBA is promising.87 MBAs Created from Homologous RNA and DNA Aptamers Display Significant Differences in Eliciting FRET in Response to PDGF-BB Homologous RNA and DNA sequences display significant differences in the stability of the secondary structures in solution. RNA is made of four different building blocks, the ribonucleotides. The pyrimidine base thymine is modified in that it lacks a methyl group and the resulting uracil takes its place in base pairing. The ribose is fully hydroxylated form making it less stable than DNA. Together, the presence of uracil in place of thymine, and the 2'-OH in the ribose constitute the two chemical differences between RNA and DNA. Other properties that distinguish DNA versus RNA molecules include: RNA is mostly a single stranded molecule, with some sections that may double back on themselves resulting in double stranded regions; RNA is generally shorter; single stranded RNA is more susceptible to degradation than DNA; and the RNA is less easily repaired due to the lack of a secondary strand to correct mistakes. Similar to DNA, oligoribonucleotide synthesis is also performed on solid supports through the use of appropriately protected phosphoramidites. Continued development of 2-OH protecting groups, the use of efficient activators, and purification methods has greatly improved RNA synthesis and nuclease resistance.

PAGE 108

95 The use of RNA-aptamers is appealing for the studies of small molecules and proteins because it is capable of recognizing a large variety of targets and in many cases RNA aptamers show impressive specificity. With the advances in oligo synthesis methods and with the potential advantages that an RNA aptamer may present for protein detection, a series of experiments were targeted towards switching the DNA-aptamer for PDGF-BB into an RNA-based aptamer. Currently, no reports exist that have investigated whether or not an RNA version of any existing DNA aptamer will bind to the target protein with the same affinity as the equivalent DNA. Therefore, the FRET responses displayed by MBAs created from the DNA aptamer designated 36t47 and an RNA aptamer with the same nucleotide sequence (for the RNA aptamer all the T nucleotides were replaced with U as shown in Table 5-1) were compared. Table 5-1. Aptamers synthesized for PDGF-BB detection Name Sequence 36tDNA MBA 5FAM-CACAGGCTACGGCACGTAGA GCATCACCATGATCCTGTG-Dab3 36tRNA MBA 5FAM-CACAGGCUACGGCACGUAGAGCAU CACCAUGAUCCUGUG-Dab3 A theoretical model for the RNA equivalent of the 36tDNA-MBA show that folding of the aptamer is similar to the standard 36t MBA: a three-way helix junction with a three-nucleotide loop at the branch point. For this set of experiments both aptamer beacons (DNA and RNA based) contained a DABCYL quencher at the 3-end and a 6-FAM dye at the 5-end due to the previous results (Figure 2-3) which indicated, that for this aptamer probe, DABCYL/6-FAM was the most effective pair. Standard fluorescence quenching assays (as described in Material and Methods on Chapter 2) were performed in parallel with the DNA-MBA and RNA-MBA using a two-fold and a four-fold molar excess of PDGF-BB. As reported in Chapter 2 for the standard 36t DNA-MBA, PDGF

PAGE 109

96 BB causes fluorescence quenching in a dose-dependent manner and that between equimolar to 2-fold molar excess of PDGF-BB, the extent of quenching in the standard fluorescence quenching assay is approximately 90%.62 Figure 5-3. Theoretical model of the 36tRNA-MBA. The 3' end was labeled with DABCYL as the fluorophore and the 5'end was labeled with fluorescein as the quencher The RNA equivalent of the MBA was directly compared to the standard 36tMBA and the results are shown in Figure 5-4. Both 2-fold and 4-fold molar excess yielded more than 90% quenching with the DNA-MBA; however, with the RNA-MBA, the extents of observed quenching were significantly lower% at 2-fold and 54% at 4-fold molar excess of PDGF-BB. The higher quenching efficiency of the DNA versus the RNA molecules may be due to the fact that the 2'-OH group is known to play a role in determining helical parameters and helix stability. As a result, for MBAs it may also contribute to tertiary interactions that stabilize aptamer structure and interact directly with the ligand, thereby decreasing, or possibly increasing, an aptamers ability to bind and recognize the target molecule.88

PAGE 110

97 90%91%21%54 % 0300000600000900000DNA-MBADNA-MBA +100 nMPDGFDNA-MBA +200 nMPDGFRNA-MBARNA-MBA +100 nMPDGFRNA-MBA +200 nMPDGFFluorescence Intensity/A.U. Figure 5-4. Comparison of FRETresponse of 36t-DNA-MBA and the homologous 36t-RNA-MBA with PDGF-BB. Two-fold and 4-fold molar excess of PDGF-BB were incubated with 50 nM of the 36t-DNA-MBA and 36t-RNA-MBA in binding buffer. To further analyze the difference between the DNAand the RNA-MBAs, we next examined the ability of unmodified DNA and RNA aptamers to restore the fluorescence quenching by competing with the DNA-MBA for binding with PDGF-BB. A competition assay using unmodified DNA aptamers at increasing concentrations with the standard DNA-MBA (Figure 5-5) showed the expected disappearance of fluorescence quenching. We then examined the reciprocal abilities of unmodified RNA and DNA aptamers to abrogate fluorescence quenching response of DNA-MBA (6-FAM-DABCYL labeled DNA aptamer) and RNA-MBA (6-FAM-DABCYL labeled RNA aptamer), respectively. Competition experiments on the fluorescence quenching assays were performed as follows in 100 L each: 50 nM of the MBA were incubated with different amounts of the competitor (unlabeled DNA and/or RNA with a similar sequence of the 36t) for 30

PAGE 111

98 minutes in binding buffer, then, 200 nM of PDGF-BB were mixed into the solution and fluorescence measurements were obtained immediately. Fluorescence intensities were measured before and after the addition of PDGF-BB to the sample solution. As shown in Figure 5-5, a standard competition assay using unmodified DNA aptamers in increasing concentrations with the labeled DNA-MBA showed an increasing fluorescence as the amount of unlabelled DNA was increased. 040000080000012000000:11:12:14:110:11:0Ratio of DNA:PDGF-BB Fluorescence Intensity/A.U. Figure 5-5. Competition of FRET-response by unmodified 36t-DNA aptamer with the standard 36t-DNA-MBA. A standard competition assay using increasing concentrations of the unmodified DNA aptamer with 50 nM of the standard DNA-MBA incubated with 200 nM PDGF-BB showed the expected disappearance of fluorescence quenching. Unmodified RNA molecules were not able to effectively weaken the FRET response of the DNA-MBA even at a ten-fold molar excess (compared to PDGF-BB) as can be observed in Figure 5-6. In contrast, the unmodified DNA aptamer, even at a 1:1 molar ratio to PDGF-BB, almost completely reversed the fluorescence quenching observed in the presence of 200 nM PDGF-BB relative to the RNA-MBA concentration. The data clearly demonstrates that the DNA-MBA is able to bind and elicit a FRET

PAGE 112

99 response to PDGF-BB better than the homologous RNA-MBA. In terms of the mechanism for binding, the results indicated that the difference between the RNA and DNA aptamer sequences is significant enough to inhibit one-another. The DNA aptamer binds stronger to the protein and therefore is not competed with, when in the presence of the unlabelled RNA aptamer. This point is reiterated in the competition of the labeled-RNA aptamer with unlabelled-DNA aptamer, where the fluorescence is restored for the probe. As a result, MBAs that are developed for molecular detection will most likely bind regardless of whether the probe consists of RNA or DNA. However, individual experiments for other aptamer probes should be conducted to determine which modification will result in the highest affinity for the target. Interestingly for the PDGF-BB, we did observe binding the probe but clearly the DNA based aptamer is more appropriate for MBA applications. Fluorescence Enhancement Assays with MBAs Since the principle of the MBA-based assay relies on signal transduction resulting from differences in the structure of free versus the protein-bound MBA, it should be possible to modify the assay from a quenching to an enhancement format by selecting an appropriate pair of fluorophores. It is generally believed that an enhancement assay format provides a higher degree of sensitivity than that achieved with a quenching format because the initial fluorescence signal from the probe will be low. Specifically, the sensitivity and dynamic range of MBAs are determined mainly by two parameters: the initial fluorescence intensity when the MBA is its open conformation and the residual fluorescence intensity when the MBAs are in the closed conformation (incomplete quenching).

PAGE 113

100 02000004000006000008000001000000MBA+1X rnaDNA-MBA +10X rnaRNA-MBA +1X dnaRNA-MBA +10X dnaFluorescence Intensity/A.U. without PDGF-BB 200 nM PDGF-BB 50 nM DNA MBA50 nM DNA MBA50 nM RNA MBA50 nM RNA MBA200 nM RNA2 M RNA200 nM DNA2 M DNA50 nM DNA MBA50 nM DNA MBA50 nM RNA MBA50 nM RNA MBA200 nM RNA2 M RNA200 nM DNA2 M DNA Figure 5-6. Competition of FRET response by unmodified RNA aptamer with DNA-MBA and by unmodified DNA aptamer with RNA-MBA. Unmodified RNA molecules incubated with 50 nM MBA-DNA at 1:1 and 1:10 ratios were not able to effectively abrogate the FRET response of the DNA-MBA on PDGF-BB binding. In contrast, when the unmodified DNA aptamer was studied at a 1:1 molar ratio to the RNA-MBA,the fluorescence quenching observed in the presence of 200 nM PDGF-BB concentration was almost completely reversed. In principle, the fluorophore should be co mpletely quenched by the quencher in the closed form. In reality, however, the residual fluorescence varies greatly, because of factors such as the selection of the fluorophore/quencher pair, the synthesis of the MBA, and the way the fluorophore/quencher groups are attached to the oligonucleotide. Such residual fluorescence greatly limits the detection sensitivity of the MBAs. This issue can be addressed by attaching two fluorophores (F1 and F2) to the ends of the probe instead of a fluorophore and a quencher. When the MBA is in its open conformation prior to binding, the observed fluorescence of the acceptor fluorophore should be minimal. Therefore, in general a fluorescence enhancement assay will initially have a lower fluorescence than the quenching assay before the protein is added to the assay solution. In

PAGE 114

101 the quenching format the signals changes are observed in the presence of high background signals (in this case the open conformation of the quenching assay) which can limit the sensitivity of the assay. For the synthesis of a Cy3/Cy5 MBA, the DNA was synthesized with a functional amine group immobilized on controlled pore glass beads and Cy5 was added to the 5-end using Cy5 phosphoramidite (Amersham Bioproducts, Piscataway, NJ). Following deprotection with potassium carbonate (0.1M)/methanol and gel filtration, the DNA was reacted with N-hydroxysuccinimidyl ester of Cy3 (Amersham Bioproducts, Piscataway, NJ) and the dual labeled material was purified. All the MBA stock solutions were prepared at 100 M concentration in Tris/HCl buffer (pH 7.5, 20 mM) with NaCl (20 mM), and stored at -20C in aliquots. We used the standard fluorescence quenching assay to compare the response of the standard MBA to one that was labeled with a Cy3 dye at the 3-end and a Cy5 dye at the 5-end. The Cy-labeled MBA is suitable for an enhancement format since Cy3 and Cy5 are well known FRET pairs used for DNA hybridization studies. The donor dye Cy3 can be excited at the absorption maximum (546 nm) and the fluorescence signal can be measured at the emission maximum of the acceptor dye, Cy5 (662 nm) when the MBA is in its closed conformation. A 46% enhancement in the measured fluorescence intensity was observed with 50 nM of the Cy3/Cy5-labeled MBA on the addition of 200 nM of of PDGF-BB. Another potential application of the enhancement FRET assay was to further explore and investigate the probe: protein binding ratio. Photo-crosslinking experiments reported by Green et al.47 suggested that the phenyalanine-84 residue in the B-chain of

PAGE 115

102 PDGF-BB forms a point of contact with a specific nucleotide residue in loop at the helix junction of the closed conformation of a PDGF-BB-specific aptamer. It was hypothesized that if the homodimer PDGF-BB could bind two MBA molecules with appropriate conformational characteristics, then FRET could occur between two aptamers each labeled with one of the two dyes of a FRET pair. This would allow the design of a fluorescence enhancement format for a FRET assay for PDGF-BB that uses two single fluorophore-labeled aptamers. Specifically, the aptamer sequence was labeled either with Cy3 (the donor) at the 3-end or with Cy5 (the acceptor) at the 5-end. A solution was then prepared by mixing an equimolar ratio of the 3-Cy3 and the 5-Cy5 labeled PDGF-BB aptamer preparations. Once two aptamers carrying two different labels bind to the same PDGF-BB molecule, the two fluorophores would be in close proximity. It should then be possible to excite the donor fluorophore, Cy3, at its absorption band and due to FRET its fluorescence will be quenched by Cy5. However, there will be a simultaneous increase in the fluorescence of Cy5 even when the MBA molecule is excited at the absorption band of Cy3. For the fluorescence enhancement assay, increasing amounts of PDGF-BB were incubated with a fixed amount (75 nM) of the Cy3/Cy5-aptamer equimolar mixtures and fluorescence intensity was measured at each different concentration. The sample solution was excited at the absorbance maximum of Cy3 and the fluorescence was monitored at the emission maximum of Cy5.

PAGE 116

103 010000200003000002468PDGF (g/mL)Fluorescence Intensity/ A.U. Figure 5-7. Fluorescence enhancement FRET-assay. Increasing concentrations of PDGF-BB were incubated in the standard fluorescence quenching assay buffer (final volume 100 L) with an equimolar mixture of the PDGF-BB aptamer labeled with Cy3 at the 3'-end and a PDGF-BB aptamer labeled with Cy5 at the 5'-end (fluorescence measurements were made at excitation maximum of Cy3 and emission maximum of Cy5). A dose-dependent increase in Cy5 fluorescence emission on additions of increasing amounts of PDGF-BB is shown in Figure 5-7. The results demonstrate the capability of this mixed aptamer solution in a sensitive enhancement assay consistent with the hypothesis that two or more aptamers bind to a single PDGF-BB molecule with a detection limit in the nanomolar range without optimization. This was the first demonstration of a fluorescence enhancement assay in a single incubation where binding to a target protein molecule of two separate aptamer molecules carrying a donor and an acceptor dye presumably results in FRET due to the close proximity of both aptamer molecules. This is a striking contrast to opening up of a double stranded stem of a molecular beacon to produce fluorescence enhancement in studies on nucleic acid targets.

PAGE 117

104 The ability to perform a FRET bioassay with single labeled DNA molecules have important future implications in the development of novel fluorescence assays for multimeric proteins, protein modifications and protein aggregates by using high affinity DNA aptamers that recognize different domains of the proteins. Two-Step FRET Assays Using Restriction Enzymes Cleavage Sites To further explore the relationship between the signal transduction domain (the fluorophore-quencher labeled stem), and the molecular recognition domain (the helix/loop structure) of the MBA and its influence on the FRET efficiency, several modifications need to be properly engineered and designed. With this in mind, an extension of the use of FRET response by MBA to the target protein in a novel manner based on the principle of stabilization of the stem by specific binding of the target protein PDGF-BB will be presented next. As Green et al. reported,47 the base sequence distal from the loop portion of the PDGF-BB aptamer are not critical for binding to the target protein, therefore, modifications in the stem sequence should not prevent the selective binding to PDGF-BB. To demonstrate this ability, two new MBAs were designed with two minimal variations in the terminal sequences of the 36t aptamer to create a BamHI and a HpaII cleavage site in the 6 base pair stem. BamHI and HpaII are restriction enzymes (endonucleases that recognize specific double stranded DNA sequences and subsequently cleave the DNA in both strands). The enzymes have high specificity for their recognition sites and under optimum reaction conditions, even sites that differ in only one base pair from the canonical or original site are not cleaved, unless large enzyme concentrations are used or the reaction is allowed to proceed for sufficient time.89

PAGE 118

105 MBAs designed to contain 3and 5sequences that can form a 6 base pair double stranded stem with the cleavage site either for BamHI (GGATCC) or HpaII/MspI (ACCGGA) were synthesized with a 3-Dabcyl quencher and a 5-fluorescein dye using standard phosphoramidite chemistry as described in Chapter 2. As shown in Figure 5-8, the bases that compose the stem were changed to create a cleavage site for a specific restriction enzyme. This series of modified MBAs can be used in a simple two-step mechanism: the first step will be the stem stabilization due to the binding of PDGF-BB to the MBA which can be confirmed by fluorescence quenching. The second step will be the addition of the appropriate restriction enzyme to the aptamer-protein complex solution, where the fluorescence of the MBA is restored by restriction enzyme cleavage. With this straightforward mechanism, the binding of the protein target to the aptamer can be confirmed with two separate signal changes. Figure 5-8. Working principle of the enzyme-site modified MBA. In this case, the base sequence stem of the MBA was modified for the appropriate bases that will create a specific site for restriction enzyme cleavage. When an excess of PDGF-BB is incubated with the MBA, the stem will be stabilized and as consequence, a decrease in fluorescence intensity will be observed. On a subsequent, step the specific restriction enzyme will be added to the solution. The enzyme will cleave the double stranded stem, and as result the fluorophore and the quencher will be spatially separated and the fluorescence will be restored.

PAGE 119

106 Effects of Mg on the modified MBA probes In order to determine the relative abundance of MBA conformational state with a double stranded stemthe closed conformationwe designed and tested two MBA variants of 36t sequence where the 5and the 3ends (CACAGG [ . ] CCTGTG) were modified to create recognition sequences for two restriction enzymes HpaII/MspI (ACCGGA [ . .] TGGCCT) and BamHI (GGATCC [ . ] GGATCC). Each MBA was tested for its ability to elicit FRET in a standard fluorescence quenching assay except that the MBA was used at a final concentration of 25 nM. After measuring fluorescence following incubation with PDGF-BB at 100 nM concentration, 1 unit of the appropriate restriction enzyme and 10 l of a 10x reaction buffer recommended for the respective enzyme was added. Fluorescence readings were measured after 30 min incubation with the enzyme at 37C. It should be noted that both reaction buffers contain 10 mM Mg2+, a divalent cation that causes detectable fluorescence quenching with the standard 36t MBA.62 As expected from our previous studies, the addition of Mg2+ did cause detectable quenching in both MBAs (Figure 5-9). The differences in the presence of Mg2+ for the two MBAs most likely reflect the greater stability of the 4 base pair duplex in the 6 base pair stem needed by HpaII as compared to the need for the entire 6 base pair stem for BamHI. In the presence of PDGF-BB, both MBAs displayed quenching under standard conditions of fluorescence quenching assay albeit to different extents; both, however, performed worse than the 36t MBA. Our observations show that the sequence of the stem plays a significant role in the mediation of the FRET response for the PDGF-BB aptamer. Cleavage of the stem by restriction enzymes In order to further assess the presence and the stability of the stem in the presence of PDGF-BB, 25 nM of the MBA

PAGE 120

107 was first incubated with 100 nM of PDGF-BB and then treated with the respective restriction enzymes without Mg2+. With both MBAs the fluorescence quenching observed in response to PDGF-BB was followed by an enhancement upon treatment with the respective restriction enzyme, even in the absence of Mg2+ in the reaction buffer. In both cases the fluorescence readings following the restriction enzyme treatment were comparable to those prior to the addition of PDGF-BB. The results shown in Figure 5-10 demonstrate that PDGF-BB induces the formation of stable double stranded stems that serve as effective substrates for the respective restriction enzymes. In addition to the new insight into the basis of FRET response elicited by the MBAs, the observations provide a novel FRET assay, where the combination of two steps might result into a more reliable target protein recognition than the standard fluorescence quenching assays described to date. 010000200003000040000HPA MBAHPA MBA+ MgHPA MBA+ Mg +HPABAMHIMBABAMHIMBA + MgBAMHIMBA + Mg+ BAMH1Fluorescence Intensity/ A.U. Figure 5-9. Molecular beacon aptamer variants with restriction enzyme cleavable stem sequence response to magnesium. MBA variants of 36t sequence where the 5and the 3ends were modified to create recognition sequence for BamHI and HpaII/MspI. The presence of a stable double stranded stem in the MBA in the presence of PDGF-BB was detected by measuring fluorescence enhancement on treatment with the specific restriction enzyme in the standard reaction buffer recommended for the respective enzymes which contains 10 mM Mg2+. 25 nM of the 36t-DNA-MBA was first incubated with 100nM of PDGF-BB and then treated with the respective restriction enzymes.

PAGE 121

108 It appears that the one with HpaII cleavage site was more responsive both in quenching in response to PDGF-BB and subsequent restoration on the addition of either HpaII or its isoschitzomer, MspI. The difference could be due to the fact that HpaII/MspI cleavage requires only the center 4 bases to stably form a duplex in the 6 base pair stem while BamHI requires the entire 6 base pair stem to be stable. With the use of DNA folding algorithms we obtained theoretical secondary structures for both MBAs that showed that in the case of BamHI modified MBA, the majority of the secondary structures do not have the stable stem required for high FRET efficiency. 010000200003000040000HPA MBAHPA MBA+ PDGFHPA MBA+ PDGF +HPABAMHIMBABAMHIMBA+PDGFBAMHIMBA +PDGF +BAMHIFluorescence Intensity / A.U. Figure 5-10. Molecular beacon aptamer variants with restriction enzyme cleavable stem sequence response to PDGF-BB. MBA variants of 36t sequence where the 5and the 3ends were modified to create recognition sequence for BamHI and HpaII/MspI. The presence of a stable double stranded stem in the MAB in the absence of PDGF-BB was detected by measuring fluorescence enhancement upon treatment with the specific restriction enzyme in the standard reaction buffer recommended for the respective enzymes. 25 nM of the 36t-DNA-MBA was first incubated with 100nM of PDGF-BB and then treated with the respective restriction enzymes in the absence of 10 mM Mg2+ at 37 C. Only one of the four possible structures has the stem and is not a thermodynamically preferred conformation. For the HPAII modified MBA, the majority of the possible secondary structures have the stem structure and have the lowest energy (G=-4.8),

PAGE 122

109 versus only one conformation where the ends are completely separated and G =-3.9. This novel two-step FRET assay provides the foundation for a unique strategy of designing MBAs from high affinity DNA aptamers for protein targets by using terminal sequence modifications for one or more of an extensive array of available restriction enzymes. The ability to monitor subtle changes in the structure of the nucleic acid aptamer probes upon specific binding to a target protein as compared to one of its variants should provide a significant expansion of the use of MBAs as novel tools to study protein molecules. Conclusions The ability to develop affinity based systems of tailor designed characteristics, which can be applied to the detection of proteins offers great opportunities to explore new and dynamic routes for sensor development. Among many possible settings, in this chapter, a backbone modification of the MBA showed fluorescence quenching upon binding to the target protein but with lower affinity, a comparison between homologous DNA-MBA and RNA-MBA was conducted and revealed that indeed both RNA and DNA based aptamers of identical sequence could bind to the target. Interestingly, competition assays revealed that they have different binding capabilities. Thus, depending on which background yields better affinities and fluorescence enhancements, improved probe selectivity and signaling should be explored for any MBA that is subsequently developed. Optimization of the assay may also be achieved by using other combinations of dye-quencher or dye-dye FRET pairs for higher signal-to-background ratios. Also, the distance between the FRET signaling moieties can be adjusted based on the conformation

PAGE 123

110 of the closed form of the bound MBA as predicted by DNA structure modeling software The use of a dye-dye pair for signal enhancement showed that an MBA can be readily modified to satisfy experimental requirements. In addition, modified sequences at the 3and the 5-ends of the MBA that allow the formation of restriction enzyme cleavage sites in the predicted double stranded stem portion were investigated. The MBAs presented themselves as a novel class of molecules that displayed an expected fluorescence quenching (using DABCYL-Fluorescein as the quencher-fluorophore pair) upon the addition of PDGF-BB. Subsequent addition of the restriction enzyme elicited fluorescence enhancement presumably as a result of releasing a very short DNA fragment (2 to 4 base pair) carrying the FRET pair but is unstable under assay conditions. The restriction enzyme cleavage was observed even in the absence of Mg2+ further supporting the notion that PDGF-BB stabilizes the double stranded stem of the MBA. The observed two-step FRET response is unique to MBAs designed for protein targets and may serve as the foundation for the development of novel assays for structure-function analysis of protein molecules. The ability to achieve signal transduction using several known FRET pairs not only indicates the versatility of the MBA-based assay method but also strongly supports the notion that multiple MBAs for selected biomarkers can be created with distinct FRET pairs. There is a need to develop multiplex assays to simultaneously monitor disease biomarkers in a single incubation in homogeneous solutions. With the MBAs that contain specific sites for restriction enzyme cleavage, it may be possible to design a panel of MBA for protein biomarkers, where the binding of the biomarker can be confirmed by the combination of two individual signaling events. It will require a careful choice of

PAGE 124

111 FRET pairs, an analysis of their relative positions in the open versus closed conformations of the aptamer and studies on incubation conditions that will give the largest signal change upon binding and cleavage.

PAGE 125

CHAPTER 6 SUMMARY AND FUTURE WORK Summary Our study showed how a synthetic DNA sequence can be modified into a probe to report the binding of a target protein biomarker platelet derived growth factor (PDGF-BB) in homogeneous solution and in simple biological samples. The developed probe, a molecular beacon aptamer (MBA), was used for the development of a fluorescence assay. The selectivity and sensitivity of this assay method arises from the fact that the signal generation requires not only the binding to the target protein but also specific conformational characteristic of the bound DNA. Our results show that using the MBA in a FRET assay, 10 nM of PDGF-BB were consistently detected in repeated experiments and the conditions required for successfully using MBAs to perform the novel single-step FRET bioassay are compatible with the physiological pH, temperature range and common monovalent cations. We also showed that the two highly related molecular variants of PDGF-BB (PDGF-AA and PDGF-AB) can be distinguished from one another in homogeneous solution, in a single-step assay that can be readily adapted to a microtiter plate assay for high-throughput analysis. The results obtained in the first part of this study are promising for future applications of this assay for the detection of PDGF-BB in biological samples, although processing methods to remove divalent cations and major protein contaminants still need to be optimized. Once the assay was completely characterized in homogeneous solution, a simulated biological sample was used to determine the feasibility and applicability of the MBA for 112

PAGE 126

113 PDGF-BB detection in a more complex biological matrix. Initial experiments showed that, when in the presence of similar total protein concentrations, the MBA has the potential to qualitatively distinguish the presence of nanomolar quantities of PDGF-BB in a spiked simulated biological sample. However, when unspiked samples containing high levels of serum proteins were studied, fluorescence quenching was also observed, indicating that it may be possible that non-specific binding of other proteins may lead to false positive quenching. Further studies were conducted towards the determination of the robustness of this assay against other species present in the biological samples. For this particular PDGF-BB aptamer and assay conditions, the presence of more than 100 g/mL of serum proteins resulted in 76% of quenching in the absence of PDGF-BB. The results indicated that a sample processing method needs to be performed before the FRET-based assay in order to obtain consistent results. Simple chromatographic methods were tested to process the sample prior to the assay to remove potential biological interferences. With dilutions and gel-filtration, PDGF-BB could be monitored in the presence of serum proteins; however, the amount of PDGF-BB required to obtain full quenching of the probe would be significant, considering the sample would need to be processed. Moreover, in a native biological environment, there are other potential sources for non-specific quenching of the probe. This greatly limits exploring the full potential of FRET-based MBAs for protein detection. For this reason, the effect of background signal from auto-fluorescing components of the cell media was investigated. Several molecular species exist in a biological environment, some of which will yield a strong fluorescence background signal when light is applied to the dye molecules. If the auto-fluorescence

PAGE 127

114 intensity of some of the cell media components is comparable to or larger than the fluorescence intensity of the fluorescence of the MBA, the fluorescence quenching becomes masked and the analysis of the fluorescence signals. For this purpose, an alternative signal transduction was implemented within the PDGF-BB aptamer sequence. Specifically, the aptamer was labeled with pyrene molecules at each end. The pyrene-labeled probe was able to detect protein in homogeneous solution and in real time. The generation of the excimer emission requires the conformation change of the aptamer brought about by complexation with a target to bring two pyrene molecules together. One feature of the pyrene excimer is that it has a very long lifetime compared with other potential fluorescent species. The lifetime of the pyrene excimer could be as long as 100 ns, while that for most of the species that contribute to the biological background signal is shorter than 5 ns. This property allowed the separation of the biological background signal from that of the excimer signal using time-resolved fluorescent measurements and for the detection of 200 pM of PDGF-BB in a simulated biological sample with low level levels of interfering proteins. An advantage of using this approach is that it allows ratiometric measurement, which could minimize the environmental effect to afford more precise detection. More importantly, this excimer light switching approach significantly reduces background problems both from the probe itself and from biological species. Both signaling approaches, FRET and excimer emission, have wide applicability for the design and development of MBAs for several reasons. First, there are many aptamers besides PDGF-BB aptamer that undergo conformation changes with target binding event, for example, human -Thrombin aptamer, cocaine aptamer, HIV1 TAT

PAGE 128

115 protein aptamer, and Human Tenasin-C aptamer. Conformational change can be immediately exploited for the design of probes for protein detection. Second, even for aaptamer that does not have obvious target-induced structure change, it can be designed to change its secondary structure as desired upon target binding with rational structure modification. Simple and general approaches for the modification of aptamer sequences into structure switching aptamers for real-time signaling applications can be found in the literature. Third, the signal transduction mechanisms reported here require target-induced structure switching in order to produce a signal change, which prevents false signals caused by nucleases degradation. In addition, by combining the fast turnaround of automatic SELEX technique and novel selection techniques virtually any protein target can have at least one conformation-changing aptamer sequence. Thus, numerous aptamer signaling probes may be developed for different targets. For this project, all the experiments were made exclusively with the PDGF-BB aptamer system. Nonetheless, it is necessary to conduct a systematic analysis of aptamers structures and behaviors to understand the different processes that leads to the formation of stable protein-DNA complexes, what factors are involved in this interaction, how the modification of the existing conditions affect the total change in fluorescence quenching upon binding and if there is any universal rules that govern aptamer functions in assays. With advances in the selection of aptamers for different targets, it is necessary to conduct studies to determine what parameters are important for optimal aptamer performance in assays and detection systems as well as their limitations. Aptamers can be easily modified to meet different experimental requirements for bioassays. We investigated several modifications, including a DNA backbone

PAGE 129

116 modification to create a nuclease-resistant that showed fluorescence quenching upon binding to the target protein but with lower affinity. A comparison between homologous DNA-MBA and RNA-MBA was conducted and revealed that indeed both RNA and DNA based aptamers of identical sequence could bind to the target. Optimization of the assay may be achieved by using other combination of dye-quencher or dye-dye FRET pairs for higher signal and lower background and also by adjusting the distance between the FRET signaling moieties based on the conformation of the closed form of the bound MBA as predicted by DNA structure modeling software. In this case we tested a combination of two-dyes, Cy3 and Cy5, which resulted in a fluorescence enhancement assay. The ability to achieve signal transduction using several known FRET pairs not only indicates the versatility of the MBA-based assay method but also strongly supports the notion that multiple MBAs for selected biomarkers can be created with distinct FRET pairs and used in a multiplex bioassay. There is a need to develop multiplex assays to simultaneously monitor disease biomarkers in a single incubation in homogeneous solutions. The design of a successful MBA for protein biomarkers will require a careful choice of FRET pairs, an analysis of their relative positions in the open versus closed conformations of the aptamer and studies on incubation conditions that will give the largest signal change upon binding. In addition, MBAs were designed to incorporate restriction enzyme cleavage sites at the 3and 5-ends of the PDGF-BB aptamer. Upon addition of PDGF-BB the expected fluorescence quenching was observed. Subsequent addition of the restriction enzyme elicited fluorescence enhancement as a result of releasing a very short DNA fragment (2-4 base pair) carrying the FRET pair the fluorescence was restored. The unique two-step

PAGE 130

117 FRET response towards protein targets could provide new means to develop a novel class of bioassays for structure-function analysis of protein molecules. In conclusion, the molecular beacon aptamer studied here indicates the potential for aptamers to be used in the detection of protein targets in homogenous and simple biological solutions as well as provided significant insight into the design and development of aptamer based assays. Future Work New MBA Development for Other Proteins and Small Molecules One of the main problems that have prevented the widespread use of aptamer so far is the limited number of aptamers that has been developed. Currently, much effort is being put into developing new methodologies for aptamer selection. These include automated SELEX,18 CE-based SELEX,90-92 and cell-based SELEX93;94 and should provide a much broader assortment of aptamers than is currently available. As a result, other aptamer systems besides PDGF-BB can be identified and explored for their potential use in assay development. Also, for aptamers can be developed new protein and small molecule targets of interest and then used for probe design. In this work, we have applied several strategies for probe characterization which allowed for the effective evaluation of the PDGF-BB system. Similar approaches will be followed to determine the applicability of others aptamer sequences. The possibility exists that other aptamer probes will not experience the same drawbacks of the PDGF-BB aptamer system, and given the right aptamer-target combination and experimental scenario improved sensitivity and selectivity could be feasible. Enrichment and Simplification of Complex Samples For biological samples, low levels of target molecule often exist in the presence of excess unrelated biomolecules. One possible area to further explore includes sample

PAGE 131

118 enrichment through the use of magnetic particles. Previously, aptamer labeled magnetic-nanoparticles have been used to preconcentrate analyte prior to analysis with mass spectrometry.27 In the case of PDGF-BB, similar methodologies could be applied to extract and enrich PDGF-BB from cellular samples prior to analysis. To effectively develop such a protocol, non-specific interactions with the aptamer functionalized nanoparticle would need to be explored as well as the efficiency of collection and release of the protein preceding analysis. Pyrene Application to Other Protein Recognition Systems The pyrene signaling mechanism has wide applicability and should be further investigated for other systems for various reasons. First, there are many aptamers besides PDGF-BB aptamer that undergo conformation changes with target binding event, for example, human -Thrombin aptamer,39;74 cocaine aptamer,73 HIV1 TAT protein aptamer,75 and Human Tenasin-C aptamer.93 This conformational change should be used to design new probes for the detection of other biologically important protein molecules. For instance, -Thrombin aptamer labeled with two pyrenes has already been shown77 to yield intense excimer emission that was proportional to different concentrations of thrombin. Second, even for aptamers that do not have obvious target-induced structural changes, the sequence can be designed to change its secondary structure as desired upon target binding with rational structure engineering, as was shown in Chapter 5.64;75;95 This strategy has been well demonstrated by Bayer et al. 95 who used aptamer target binding event to switch aptamer structure to convert it as a gene expression regulator. In combination with the spectral characteristics of pyrene molecules, MBA-type of probes can be exploited to study structural changes of aptamers as well as potentially identify targets in complex samples.

PAGE 132

119 Signal Amplification of Aptamer Recognition through PCR When aptamer molecules are combined with signal transduction mechanisms, they can successfully be applied for protein detection in homogeneous solution. However, the practical application of a single-signaling MBA for protein detection is limited by the presence of large amounts of extracellular proteins and the low levels of PDGF-BB in typical biological samples. Several alternatives can be explored to demonstrate that the appealing properties of aptamers can still be applied for protein studies and detection. Aptamer molecules can be combined with antibodies, nanoparticles and signal amplification methods, such as PCR, for the development of novel probes and assay formats that will allow the detection of low levels of PDGF-BB. The use of magnetic nanoparticles immobilized with antibodies against PDGF-BB could be used to selectively isolate and enrich the PDGF-BB. Assuming different binding domains of the protein, aptamers that are flanked by PCR primer sequences could then be added and allowed to bind to PDGF-BB in buffer. Once washed, the aptamer can be released from the particle and real-time PCR performed to detect the original protein concentration. The high affinity and selectivity of antibodies and aptamers together with the amplification power and sensitivity of PCR will enable the detection the secreted PDGF-BB from cellular samples.

PAGE 133

LIST OF REFERENCES 1. Sidransky, D. Nature Reviews Cancer 2002, 2, 210-219. 2. Barnouin, K. Methods in Molecular Biology (Totowa, NJ, United States) 2004, 261, 479-497. 3. Narayanan, S. R. Journal of Chromatography 1994, 658, 237-258. 4. Tang, N.; Tornatore, P.; Weinberger, S. R. Mass Spectrometry Reviews 2003, 23, 34-44. 5. Gullberg, M.; Fredriksson, S.; Taussig, M.; Jarvius, J.; Gustafsdottir, S.; Landegren, U. Current Opinion in Biotechnology 2003, 14, 82-86. 6. Belford, D. A.; Rogers, M. L.; Francis, G. L.; Payne, C.; Ballard, F. J.; Goddard, C. Journal of endocrinology 1997, 154, 45-55. 7. Engvall, E.; Perlmann, P. Immunochemistry 1971, 8, 871-874. 8. Mukhopadhyay, R. Analytical Chemistry 2005, 77, 114A-118A. 9. Ellington, A. D.; Szostak, J. W. Nature 1990, 346, 818-822. 10. Lee, J. F.; Hesselberth, J. R.; Meyers, L. A.; Ellington, A. D. Nucl.Acids Res. 2004, 32, D95-100. 11. Ciesiolka, J.; Yarus, M. RNA 1996, 2, 785-793. 12. Nieuwlandt, D.; Wecker, M.; Gold, L. Biochemistry 1995, 34, 5651-5659. 13. Tuerk, C.; Gold, L. Science 1990, 249, 505-510. 14. Ringquist, S.; Jones, T.; Snyder, E. E.; Gibson, T.; Boni, I.; Gold, L. Biochemistry 1995, 34, 3640-3648. 15. Pan, W.; Craven, R. C.; Qiu, Q.; Wilson, C. B.; Wills, J. W.; Golovine, S.; Wang, J. F. Proceedings of the National Academy of Sciences of the United States of America 1995, 92, 11509-11513. 16. Morris, K. N.; Jensen, K. B.; Julin, C. M.; Weil, M.; Gold, L. Proceedings of the National Academy of Sciences of the United States of America 1998, 95, 2902-2907. 120

PAGE 134

121 17. Pavlov, V.; Shlyahovsky, B.; Willner, I. Journal of the American Chemical Society 2005, 127, 6522-6523. 18. Brody, E. N.; Gold, L. Reviews in Molecular Biotechnology 2000, 74, 5-13. 19. Lupold, S. E.; Hicke, B. J.; Lin, Y.; Coffey, D. S. Cancer research 2002, 62, 4029-4033. 20. Martell, R. E.; Nevins, J. R.; Sullenger, B. A. Molecular Therapy 2002, 6, 30-34. 21. Jayasena, S. D. Clinical Chemistry 1999, 45, 1628-1650. 22. Butler, V. P., Jr. Journal of Immunological Methods 1975, 7, 1-24. 23. Engvall, E.; Jonsson, K.; Perlmann, P. Biochimica et Biophysica Acta 1971, 251, 427-434. 24. Bock, L. C.; Griffin, L. C.; Latham, J. A.; Vermaas, E. H.; Toole, J. J. Nature 1992, 355, 564-566. 25. Potyrailo, R. A.; Conrad, R. C.; Ellington, A. D.; Hieftje, G. M. Analytical Chemistry 1998, 70, 3419-3425. 26. Dick, L. W., Jr.; McGown, L. B. Analytical Chemistry 2004, 76, 3037-3041. 27. Turney, K.; Drake, T. J.; Smith, J. E.; Tan, W.; Harrison, W. W. Rapid Communications in Mass Spectrometry 2004, 18, 2367-2374. 28. Deng, Q.; German, I.; Buchanan, D.; Kennedy, R. T. Analytical Chemistry 2001, 73, 5415-5421. 29. Robertson, M. P.; Ellington, A. D. Nucl.Acids Res. 2000, 28, 1751-1759. 30. Soukup, G. A.; Breaker, R. R. Current Opinion in Structural Biology 2000, 10, 318-325. 31. Tang, J.; Breaker, R. R. Nucl.Acids Res. 1998, 26, 4214-4221. 32. Savran, C. A.; Knudsen, S. M.; Ellington, A. D.; Manalis, S. R. Analytical Chemistry 2004, 76, 3194-3198. 33. Fang, X.; Cao, Z.; Beck, T.; Tan, W. Analytical Chemistry 2001, 73, 5752-5757. 34. Lakowicz, J. R. Principles of Fluorescent Spectroscopy NY, 1986; 2nd Edition. 35. Marras, S. A. E.; Kramer, F. R.; Tyagi, S. Nucl.Acids Res. 2002, 30, e122-1-e122/8. 36. Tyagi, S.; Kramer, F. R. Nature Biotechnology 1996, 14, 303-308.

PAGE 135

122 37. Li, J. J.; Fang, X.; Schuster, S. M.; Tan, W. Angewandte Chemie, International Edition 2000, 39, 1049-1052. 38. Schultze, P.; Macaya, R. F.; Feigon, J. Journal of Molecular Biology 1994, 235, 1532-1547. 39. Hamaguchi, N.; Ellington, A.; Stanton, M. Analytical Biochemistry 2001, 294, 126-131. 40. Li, J. J.; Fang, X.; Tan, W. Biochemical and Biophysical Research Communications 2002, 292, 31-40. 41. Bergsten, E.; Uutela, M.; Li, X.; Pietras, K.; Ostman, A.; Heldin, C. H.; Alitalo, K.; Eriksson, U. Nature Cell Biology 2001, 3, 512-516. 42. Heldin, C. H.; Westermark, B. Physiological Reviews 1999, 79, 1283-1316. 43. Li, X.; Ponten, A.; Aase, K.; Karlsson, L.; Abramsson, A.; Uutela, M.; Backstrom, G.; Hallstrom, M.; Bostrom, H.; Li, H.; Soriano, P.; Betsholtz, C.; Heldin, C. H.; Alitalo, K.; Ostman, A.; Eriksson, U. Nature Cell Biology 2000, 2, 302-309. 44. Oefner, C. ; D'Arcy, A. ; Winkler, F. K. ; Eggimann, B. ; Hosang, M. EMBO J 1992, 11, 3921. 45. Heldin, C. H.; Johnsson, A.; Wennergren, S.; Wernstedt, C.; Betsholtz, C.; Westermark, B. Nature 1986, 319, 511-514. 46. Peres, R.; Betsholtz, C.; Westermark, B.; Heldin, C. H. Cancer Research 1987, 47, 3425-3429. 47. Green, L. S.; Jellinek, D.; Jenison, R.; Oestman, A.; Heldin, C. H.; Janjic, N. Biochemistry 1996, 35, 14413-14424. 48. Fang, X.; Tan, W. Analytical Chemistry 1999, 71, 3101-3105. 49. Fang, X.; Liu, X.; Schuster, S.; Tan, W. Journal of the American Chemical Society 1999, 121, 2921-2922. 50. Bronzert, D. A.; Pantazis, P.; Antoniades, H. N.; Kasid, A.; Davidson, N.; Dickson, R. B.; Lippman, M. E. Proceedings of the National Academy of Sciences of the United States of America 1987, 84, 5763-5767. 51. Leitzel, K.; Bryce, W.; Tomita, J.; Manderino, G.; Tribby, I.; Thomason, A.; Billingsley, M.; Podczaski, E.; Harvey, H.; Bartholomew, M.; Cancer Research 1991, 51, 4149-4154. 52. Mayer, G.; Jenne, A. BioDrugs 2004, 18, 351-359. 53. Jacobson, A. B.; Zuker M. Journal of Molecular Biology 1993, 233, 261-269.

PAGE 136

123 54. Zuker, M. Nucl.Acids Res. 2003, 31, 3406-3415. 55. Moreira, B. G.; You, Y.; Behlke, M. A.; Owczarzy, R. Biochemical and Biophysical Research Communications 2005, 327, 473-484. 56. Yarmoluk, S. M.; Lukashov, S. S.; Ogul'chansky, T. Y.; Losytskyy, M. Y.; Kornyushyna, O. S. Biopolymers 2001, 62, 219-227. 57. Ueberfeld, J.; Walt, D. R. Analytical Chemistry 2004, 76, 947-952. 58. Haugland, R. P. The Handbook A Guide to Fluorescent Probes and Labeling Technologies; Molecular Probes, Inc: Eugene, OR, 2004; pp 7-9. 59. Tokuda, Y.; Satoh, Y.; Fujiyama, C.; Toda, S.; Sugihara, H.; Masaki, Z. BJU international 2003, 91, 716-720. 60. Ng, S. S. W.; MacPherson, G. R.; Gutschow, M.; Eger, K.; Figg, W. D. Clin Cancer Res 2004, 10, 4192-4197. 61. Bradford, M. M. Analytical Biochemistry 1971, 72, 248-254. 62. Vicns, M. C.; Sen, A.; Vanderlaan, A.; Drake, T. J.; Tan, W. ChemBioChem 2005, 6, 900-907. 63. Fang, X.; Sen, A.; Vicens, M.; Tan, W. ChemBioChem 2003, 4, 829-834. 64. Nutiu, R.; Li, Y. Chemistry--A European Journal 2004, 10, 1868-1876. 65. Gao, X.; Cui, Y.; Levenson, R. M.; Chung, L. W. K.; Nie, S. Nature Biotechnology 2004, 22, 969-976. 66. Fujimoto, K.; Shimizu, H.; Inouye, M. Journal of Organic Chemistry 2004, 69, 3271-3275. 67. Birks, J. B. Photophysics of Aromatic Molecules (Wiley Monographs in Chemical Physics); 1970; 704. 68. Winnik, F. M. Chemical Reviews, 1993, 93, 587-614. 69. Birks, J. B.; Lumb, M. D.; Munro, I. H. Proc.Roy.Soc.Ser.A 1964, 280, 289-297. 70. Birks, J. B.; Dyson, D. J.; Munro, I. H. Proc.Roy.Soc. 1963, 275, 575-588. 71. Dahim, M.; Mizuno, N. K.; Li, X. M.; Momsen, W. E.; Momsen, M. M.; Brockman, H. L. Biophysical Journal 2002, 83, 1511-1524. 72. Pagano, R. E.; Martin, O. C.; Kang, H. C.; Haugland, R. P. Journal of cell biology 1991, 113, 1267-1279.

PAGE 137

124 73. Stojanovic, M. N.; de Prada, P.; Landry, D. W. Journal of the American Chemical Society 2001, 123, 4928-4931. 74. Paborsky, L. R.; McCurdy, S. N.; Griffin, L. C.; Toole, J. J.; Leung, L. L. K. Journal of Biological Chemistry 1993, 268, 20808-20811. 75. Yamamoto, R.; Baba, T.; Kumar, P. K. R. Genes to Cells 2000, 5, 523. 76. Masuko, M.; Ohtani, H.; Ebata, K.; Shimadzu, A. Nucl.Acids Res. 1998, 26, 5409-5416. 77. Yang, C. J., Jockush, S., Vicns, M. C., Turro, N. J., and Tan, W. 2005. (Unpublished Work) 78. Nazarova, N.; Golovko, O.; Blauer, M.; Tuohimaa, P. The Journal of Steroid Biochemistry and Molecular Biology 2005, 94, 189-196. 79. Langerak, A. W.; De Laat, P. A. J. M.; Van der Linden-Van Beurfen; Delahaye, M.; Van der Kwast, T. H.; Hoogsteden, H. C.; Benner, R.; Versnel, M. A. Journal of Pathology 1996, 178, 151-160. 80. Bock, C.; Coleman, M.; Collins, B.; Davis, J.; Foulds, G.; Gold, L.; Greef, C.; Heil, J.; Heilig, J. S.; Hicke, B.; Hurst, M. N.; Husar, G. M.; Miller, D.; Ostroff, R.; Petach, H.; Schneider, D.; Vant-Hull, B.; Waugh, S.; Weiss, A.; Wilcox, S. K.; Zichi, D. Proteomics 2004, 4, 609-618. 81. Famulok, M.; Mayer, G.; Blind, M. Accounts of Chemical Research 2000, 33, 591-599. 82. Famulok, M.; Blind, M.; Mayer, G. Chemistry & Biology 2001, 8, 931-939. 83. Burgstaller, P.; Girod, A.; Blind, M. Drug Discovery Today 2002, 7, 1221-1228. 84. Burgstaller, P.; Jenne, A.; Blind, M. Current Opinion in Drug Discovery & Development 2002, 5, 690-700. 85. Fine, S. L.; Martin, D. F.; Kirkpatrick, P. Nature Reviews Drug Discovery 2005, 4, 187-188. 86. Gragoudas, E. S.; Adamis, A. P.; Cunningham, E. T., Jr.; Feinsod, M.; Guyer, D. R. New England Journal of Medicine 2004, 351, 2805-2816. 87. De Clercq, E.; Eckstein, F.; Merigan, T. C. Science 1969, 165, 1137-1139. 88. Wilson, D. S.; Szostak, J. W. Annual Review of Biochemistry 1999, 68, 611-647. 89. Burrell, M. M. Enzymes of Molecular Biology. [In: Methods Mol. Biol. (Totowa, N. J.), 1993; 16]; 1993; p 370.

PAGE 138

125 90. Mendonsa, S. D.; Bowser, M. T. Journal of the American Chemical Society 2004, 126, 20-21. 91. Mendonsa, S. D.; Bowser, M. T. Journal of the American Chemical Society 2005, 127, 9382-9383. 92. Mendonsa, S. D.; Bowser, M. T. Analytical Chemistry 2004, 76, 5387-5392. 93. Daniels, D. A.; Chen, H.; Hicke, B. J.; Swiderek, K. M.; Gold, L. Proceedings of the National Academy of Sciences of the United States of America 2003, 100, 15416-15421. 94. Wang, C.; Zhang, M.; Yang, G.; Zhang, D.; Ding, H.; Wang, H.; Fan, M.; Shen, B.; Shao, N. Journal of Biotechnology 2003, 102, 15-22. 95. Bayer, T. S.; Smolke, C. D. Nature Biotechnology 2005, 23, 337-343.

PAGE 139

BIOGRAPHICAL SKETCH Marie Carmen Vicns Contreras was born on March 11, 1976 in San Juan, Puerto Rico. She is the youngest of seven siblings and was raised by her parents, Francisco Vicns and Carmen Contreras in Caguas, P.R. Marie attended a private Catholic school, Colegio Catlico Notre Dame, for her secondary schooling. She then attended the University of Puerto Rico at Mayagez and received a Bachelor of Science degree in Chemistry in 1998 and a Master of Science degree in Chemistry in 1999. After that, she worked at Searle (now Pfizer) in Caguas, P.R. as a laboratory technician. To increase her opportunities in the chemical sciences, she moved to Gainesville, Florida in August of 2000 to pursue a Ph.D. in Bioanalytical Chemistry. Marie joined Dr. Weihong Tans research group in 2001. She will receive her Doctor of Philosophy degree in analytical chemistry from the University of Florida in August 2005. 126


Permanent Link: http://ufdc.ufl.edu/UFE0011464/00001

Material Information

Title: Molecular Beacon Aptamers: Fundamentals for Fluorescence-Based Detection and for Protein Studies
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0011464:00001

Permanent Link: http://ufdc.ufl.edu/UFE0011464/00001

Material Information

Title: Molecular Beacon Aptamers: Fundamentals for Fluorescence-Based Detection and for Protein Studies
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0011464:00001


This item has the following downloads:


Full Text











MOLECULAR BEACON APTAMERS: FUNDAMENTALS FOR
FLUORESCENCE-BASED DETECTION AND FOR PROTEIN STUDIES














By

MARIE CARMEN VICENS-CONTRERAS


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2005

































Copyright 2005

by

Marie Carmen Vicens-Contreras
















ACKNOWLEDGMENTS

I am grateful for all the efforts and kindness of all the people involved in this

proj ect. I especially thank my advisor Dr.Weihong Tan, for his guidance, encouragement,

and ideas throughout my graduate studies. I appreciate the opportunity of working in his

lab. He provided all of the resources that I needed for the past 5 years.

I appreciate the assistance of former group members of the Tan Lab, especially

Xiaohong Fang, for teaching me the basics to begin this proj ect; and Andrew Vanderlaan,

for his hard work and help during his time in the group.

Also, I thank Richard J. Rogers, Jon Stewart, James Winefordner, and Richard

Yost, for having agreed to be part of my graduate committee. I thank Arup Sen who

profoundly influenced me and helped me to get to where I am today, for sharing so many

ideas and offering me a new perspective on many things, and teaching me much about

learning and development.

My life as a graduate student was fun and cheerful thanks to my officemates. All of

them have taught me many things about life and their cultural heritage. For all the great

times we spent together celebrating life, I want to thank all of the members of the Tan

Group, especially Alina, Lisa, Tina, Prabodhika, Josh, Colin, James, Hong, and Shelly. I

thank Karen Martinez, for being a happy spirit and making me smile every day.

Intelligence and a deeply critical and analytical way of looking at ideas made Tim Drake

a fantastic colleague and great friend. I wish them all the best!










My adopted Puerto Rican family in Gainesville (which we like to call "el corillo"),

made my life j oyful. I especially thank Wilfredo Ortiz for one of the best friendships I

can ever imagine.

I am extremely thankful to "mi familiar especially my parents (Carmen and

Francisco) for their endless love, support, advice, and encouragement. I thank my

amazing brothers and sisters for taking care of me from a distance and calling me

whenever I forgot to call them.

At last, without the love, support, interest, sense of humor, assistance of all kind,

time, motivation and care from Jose I would be nowhere. It was his suggestion to come to

the University of Florida. His patience and his continuous encouragement enabled me to

succeed. He is one of the most wonderful human beings in this world. I am so indebted to

him that there is no way to repay him. I am overwhelmed with gratitude.


















TABLE OF CONTENTS


page

ACKNOWLEDGMENT S ............ ..... .__ .............. iii...


LI ST OF T ABLE S ............ ..... ._ .............. viii..

LI ST OF FIGURE S .............. .................... ix


AB STRAC T ................ .............. xii

CHAPTER


1 INTRODUCTION ................. ...............1.......... ......


Aptamers ................. ........... ...............2.......
W hat Is an Aptamer? ............. ......... ...... .... .. .. ... .... .......2
The Aptamer Selection Process: Systematic Evolution of Ligands by
Exponential Enrichment (SELEX) .............. ...............3.....
Aptamers versus Antibodies............... ...............
Aptamers in Bioanalytical Chemistry .............. ...............6.....
Fluorescence Methods for Signal Transduction .............. ...............10....
Fluorescence Quenching ................. .... ..._..._.. ............ ............. 1
Fluorescence Resonance Energy Transfer (FRET) ................. ............. .......12
M olecular Beacons ................ ................. ...............1
Molecular Beacons for Non-Specific Protein Detection ................ ................. 14
Aptamers and FRET for Protein Detection .............. ............. ........ .........1
Molecular Beacon Aptamer (MBA) Development for a Model Protein
System ................... .. ... .. ..... ...... .. ...... ...... ....................1
Aptamers for Platelet Derived Growth Factor-BB (PDGF-BB) .........................18

2 DEVELOPMENT AND CHARACTERIZATION OF A MOLECULAR
BEACON APTAMER FOR PLATELET DERIVED GROWTH FACTOR ............21

Introducti on .................. ...............21._____......
Materials and Methods ................ ......... ...............2
Synthesis and Purification of MBAs ........._ ....... ....._ .............23
Standard Fluorescence Quenching Assay .............. ...............25....
Results and Discussion .............. .... ........... ... ...........2
Choice of Aptamer Sequence for MBA Development............_. ............____...27
Evaluati on of Additi onal Fluorophore Quencher-P ai rs ................ ................. .2 9
Incubation Conditions for MBA Bioassay .............. ...............34....












Selectivity of the MBA-Based Fluorescence Quenching Assay .......................39
Fluorescence Quenching Assay Distinguishes Molecular Variants of PDGF ....42
Conclusions............... ..............4


3 IMPLICATIONS OF USING A MBA IN A FRET BASED AS SAY FOR PDGF
STUDIES IN BIOLOGICAL SAMPLES .............. ...............46....

Introducti on ................. ...............46.................
M materials and M ethods .............. ...............47....
In storm entati on.................. ....... ..... .. ...............47....

Preparation of a Simulated Biological Sample ................. ............... ...._...48
Cell Culture and Preparation of Conditioned Media ........._._......... .......... .....48
Results and Discussion ............... ...............49...
Use of MBA in Biological Sample ................. ................ ............... 49. ...
Implications of Total Protein Content on the MBA Assay ................ ...............53
Sample Pre-Treatment .....__ ................. ...............55.......
Conclusions............... ..............6


4 LIGHT SWITCHING APTAMER PROBE FOR PLATELET DERIVED
GROWTH FACTOR USING RATIOMETRIC AND TIME-RESOLVED
F LUORE SCENCE ME ASURE MENT S ........._ ....... ......__............6


Introducti on ............... ... ......__ ...............63...
Photophysics of Pyrene Excimers ................ ......... ....___ ............6
Time-Resolved Measurements .............. ...............66....
Experimental Section............... ...............68
Instrum ents .................. .................................6
Synthesis and Purification of Pyrene Labeled MBA............_._. ........._._.....69
Results and Discussion ................. ............. ... ........7
Light Switching Excimer Aptamer Probe Design ....._____ ..... .....___..........70
Light Switching Aptamer Prob e for PDGF -BB D etecti on .............. ..............7 1
Sensitivity and Selectivity of the Probe..................... ..............7
Direct Quantitative Detection of PDGF in Cell Medium .............. ..............77
Detection of PDGF-BB in Simulated Biological Sample .............. ..................82
Expression of PDGF-BB from Cells .........___....... ......__..........8
Conclusions............... ..............8


5 FLUORESCENCE RESONANCE ENERGY TRANSFER STUDIES FOR
MOLECULAR BEACON APTAMERS: UNDERSTANDING PROTEIN
INTERACTION AND VERSITILITY OF PROBES ................ ..................9


Introducti on ............ ..... ._ ...............90....
Results and Discussion ...................... ...............91
Backbone-Modification of DNA .............. ........... .. .... .... ._ ............9
MBAs Created from Homologous RNA and DNA Aptamers Display
Significant Differences in Eliciting FRET in Response to PDGF-BB ............94












Fluorescence Enhancement Assays with MBAs ............_... ..... ..__............99
Two-Step FRET Assays Using Restriction Enzymes Cleavage Sites ..............104
Conclusions............... ..............10


6 SUMMARY AND FUTURE WORK ................. ....___.....__ ............1


Summary ............ ..... .._ ...............112...
Future W ork ........... __.... .....__ ..... ....... ._ .. .. .. ..... ........ 1
New MBA Development for Other Proteins and Small Molecules ..................1 17
Enrichment and Simplification of Complex Samples ........._.._.. ...............1 17
Pyrene Application to Other Protein Recognition Systems .............. .............118
Signal Amplification of Aptamer Recognition through PCR. ........................1 19

LIST OF REFERENCES ............ .......__ ...............120.


BIOGRAPHICAL SKETCH ............ ...... ._ ...............126..

















LIST OF TABLES


Table pg

2-1 Percentage of quenching of different consensus sequences of 50 nM of MBA
for PDGF aptamer with 200 nM of PDGF ..........._ ..... .__ .......___.......2

3-1 Analysis for PDGF-BB spiked samples after fractionation on a G-100
Sephadex column using enzyme-linked immunosorbent assay (ELISA).................60

4-1 Pyrene-labeled oligonucleotide sequences used in this study. ................ ...............68

4-2 Amount of protein collected in 24 hours ................. ...............86..............

4-3 Amount of protein collected in 24 and 36 hours ................. .......... ...............87

5-1 Aptamers synthesized for PDGF-BB detection .............. ..... ............... 9


















LIST OF FIGURES


Finure pg

1-1 Overview of the systematic evolution of ligands by exponential enrichment
process ........... ....... __ ...............4...

1-2 Typical Jablonski diagram .............. ...............10....

1-3 Fluorescence resonance energy transfer diagram ................. ................ ....__.13

1-4 Working principle of molecular beacon ................. ...............15...............

1-5 Assumed biological foldings of Platelet Derived Growth Factor ................... .........19

1-6 Folding of 36t molecular beacon aptamer (MBA) ................ ........................20

2-1 Fluorescence intensity changes versus time of different aptamer sequences. ..........28

2-2 Proposed mechanism of PDGF-BB induced FRET responses for the 36t probe.....29

2-3 Evaluation of fluorescence quenching caused by PDGF-BB with MBAs.............31

2-4 Calibration curves for PDGF-BB .....__.....___ ..........__ ...........3

2-5 Effect of increasing temperature on fluorescence signal of free MBA in
solution ........... _.......__ ...............35....

2-6 Effect of increasing pH on fluorescence signal of free MBA in solution ...............37

2-7 Effect of divalent cations on fluorescence signal of free MBA in solution .............38

2-8 The effect of monovalent cations on fluorescence signal of free MBA in
solution ................. ...............39.................

2-9 Binding selectivity of the MBA ........._._.. .......... ...._.._ ...........4

2-10 Fluorescence quenching displayed by the MBA............... ...............41..

2-11 Cartoon representing PDGF-BB and its molecular variants .............. ..................43

2-12 Dose-response curves of PDGF variants: fluorescence signals of MBA for
PD GF-AA ........... .......__ ...............43..











3-1 Use of molecular beacon aptamer in biological samples ................ ................ ...51

3-2 Molecular beacon aptamer fluorescence quenching .............. ....................5

3-3 Fluorescence quenching caused by PDGF-BB in the presence of proteins in a
simulated biological specimen .............. ...............57....

3-4 Fluorescence intensity of fractions of simulated biological sample (SBS)
collected from G-100 column .............. ...............60....

3-5 Fluorescence intensity of dilutions of SBS .............. ...............61....

4-1 The chemical structure of pyrene ................ ...............65...............

4-2 Use of pyrene excimer to probe PDGF-BB ........._ ....... __ ........__........70

4-3 Fluorescence emission spectra of Pyr-MBA with and without PDGF-BB in
binding buffer. .............. ...............71....

4-4 Real-time response of excimer/monomer ratio .............. ...............73....

4-5 Dose-dependent excimer formation on additions of PDGF-BB .............. .............74

4-6 Visual detection of PDGF-BB............... ...............7

4-7 Response of excimer probe to different proteins .............. ...............75....

4-8 Response of 50 nM Pyr-MBA to 500 nM of different growth factors....................76

4-9 Increasing amounts of BSA incubated with 50 nM Pyr-MBA. ............. ................77

4-10 Fluorescence spectra of simulated biological sample .............. ....................7

4-11 Monomer time-resolved spectra collected at 398 nm .............. ....................8

4-12 Excimer time-resolved spectra collected at 480 nm............... ...................8

4-13 Fluorescence intensity as a function of wavelength at different times. .........._.......82

4-14 Steady-state and time-resolved fluorescence spectra of SBS samples.....................83

4-15 Fluorescence decays of 200 nM Pyr-MBA in simulated biological specimen ........84

5-1 Phosphorothioate DNA backbone modification .............. ...............92....

5-2 Fluorescence quenching produced by a phosphorothiate modified MBA. ..............93

5-3 Theoretical model of the 36tRNA-MBA ................. ...............96...............











5-4 Comparison of FRET- response of 36Gt-DNA-MBA and the homologous 3 6t-
RNA-MBA with PDGF-BB .............. ...............97....

5-5 Competition of FRET-response by unmodified 36Gt-DNA aptamer with the
standard 36t-DNA-MBA............... ..............9

5-6 Competition of FRET response by unmodified RNA aptamer with DNA-MBA
and by unmodified DNA aptamer with RNA-MBA ................ ......................100

5-7 Fluorescence enhancement FRET-assay ..........._ ..... ..__ .........__........10

5-8 Working principle of the enzyme-site modified MBA ...........__... .........__.....105

5-9 Molecular beacon aptamer variants with restriction enzyme cleavable stem
sequence response to magnesium ....__ ......_____ .......___ .............0

5-10 Molecular beacon aptamer variants with restriction enzyme cleavable stem
sequence response to PDGF-BB .............. ...............108....
















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

MOLECULAR BEACON APTAMERS: FUNDAMENTALS FOR
FLUORESCENCE-BASED DETECTION AND FOR PROTEIN STUDIES

By

Marie Carmen Vicens-Contreras

August 2005

Chair: Weihong Tan
Maj or Department: Chemistry

Molecular beacon aptamers (MBA) are created by combining synthetic

oligonucleotide ligands with high affinity for a protein target with a sensitive signal

transduction mechanism. In this study, an MBA was developed and examined for the

detection of platelet derived growth factor-BB (PDGF-BB) using it in a fluorescence-

based assay. The developed probe was capable of consistently detecting 10 nM PDGF-

BB in homogeneous solution. The influence of certain physical and chemical parameters

of incubation that would affect DNA conformation were examined and the results show

that this bioassay is compatible with pH, temperature, and monovalent cation levels

typically encountered in biological samples. After a complete investigation in

homogeneous solution, the MBA was examined for PDGF-BB detection in biological

samples. This is the first attempt to use single aptamer molecules with an inherent signal

transduction mechanism for the detection of PDGF-BB in biological samples. For this

particular aptamer and assay conditions, the presence of more than 100 ug/mL of serum









proteins resulted in non-specific fluorescence quenching of the probe. The results

indicated that a sample processing method prior to the assay is required to remove

potential biological interference.

Selective and quantitative protein analysis in complex biological fluids still

presents considerable challenges for future research, mainly due to the background

signals from both the fluorescent probe and the components of typical cellular samples.

To overcome the problem of background signals, the existing MBA was modified by

labeling each end with pyrene molecules. This produced a monomer-excimer light-

switching aptamer probe for protein monitoring by using both steady-state and time-

resolved fluorescence measurements. With a time-correlated single photon counting

technique and the long fluorescence lifetime of pyrene, the biological background signal

was separated from the excimer signal and 200 pM of PDGF-BB were detected in a

simulated biological sample.

We also examined FRET responses to PDGF-BB shown by MBAs with modified

aptamer sequences that affect DNA conformation. Our findings provide new insights into

the fundamental mechanisms underlying protein-induced FRET shown by MBAs and

have significant implications on the design strategy and use of MBAs in structure-

function analysis, and in bioassays for protein biomarkers and their molecular variants.














CHAPTER 1
INTTRODUCTION

Proteins are essential for the structure and function of all living cells. Protein have

different shapes and conformations that are responsible for many functions, such as

enzymatic reactions, regulation of cell growth, structure, movement, carriers, and

receptors. Thus, many scientists in the bioanalytical sciences are interested in developing

methods and probes to be used for protein studies and detection. Biological interactions

are used to provide either qualitative or quantitative information about protein content

and could yield important data about the molecular mechanism of action of biologically

active compounds. Methodologies are needed to study disease biomarkers that can help

diagnose a disease at the biochemical level or help distinguish the responses of different

patients to the same medical treatment.'

For protein biomarker detection and quantitation, several techniques are widely

used including: gel electrophoresis,2 isoelectric focusing, affinity chromatography,3

surface enhanced laser desorption time-of-flight mass spectrometry (SELDI),4 prOximity

ligation,5 cell-based bioactivity assayS6 and immunological assays, such as enzyme-

linked immunosorbent assays (ELISA).7 Many of the above methods are time-consuming

and labor intensive; and require multiple steps, such as immobilization, repeated

incubations and washings, and additional reagents to amplify the signal. Additional

methods, such as nucleic-acid molecules labeled with two signaling moieties, can be used

in different types of formats, for biomarker detection. Nucleic-acid sequences, known as

aptamers, can adopt complex three-dimensional structures capable of selectively









recognizing protein molecules.8 Thus, aptamers are good candidates for detecting diverse

protein targets, including those proteins that do not naturally recognize or bind to DNA or

RNA. Aptamer-based probes can be developed with the idea that when the target protein

binds to the detector molecules, a change in the optical properties of the reporter

molecules will be triggered, to indicate the recognition event. Unfortunately, little is

understood about the basic mechanism of action for aptamer-based signal transduction

mechanism or its applications. With careful design and systematic characterization,

aptamer-based probes could be useful in diagnostic applications and protein-biomarker

studies.

Aptamers

What Is an Aptamer?

Nucleic acid binding species generated by in vitro selection have been referred to as

aptamers.9 Aptamers can be RNA, modified RNA, single-stranded DNA or double-

stranded DNA, and have been selected to bind targets ranging from small organic

molecules to cells.10 In vitro selection has been used to identify aptamers against different

targets covering a wide range of sizes, including ions," small molecules,9 peptides,12

single proteins,13 Organelles,14 VITusCS,15 and even entire cells.16 In addition to carrying

genetic information, oligonucleotide sequences (aptamers) can adopt complex three-

dimensional structures, capable of specific binding to target molecules and, furthermore,

of catalyzing chemical reactions.l7 Aptamers have been generated for over 100 proteins,

including growth factors, transcription factors, enzymes, immunoglobulins, and

receptors.l0 At present, an aptamer databaselo that contains sequences drawn from 239

published in vitro selection experiments available for public use. A typical aptamer is 10

to 15 kDa in size (30 to 45 nucleotides), binds its target with subnanomolar affinity, and









discriminates against closely related targets (e.g., will typically not bind other proteins

from the same gene family). A series of structural studies show that aptamers can use the

same types of binding interactions (hydrogen bonding, electrostatic, hydrophobic

contacts, steric exclusion, etc.) that drive affinity and specificity in antibody-antigen

complexes and are exploited in systematic evolution of ligands by exponential

enrichment, the aptamer-selection method.

The Aptamer Selection Process: Systematic Evolution of Ligands by Exponential
Enrichment (SELEX)

In 1990, Gold 13,Ellington and Szostak9 Simultaneously reported the development

of an in vitro procedure for the selection of single-stranded nucleic acids to perform a

specific function. This in vitro procedure has been called systematic evolution of ligands

by exponential enrichment (SELEX). Since its introduction over 10 years ago, in vitro

selection has been widely adopted as a tool for the development of research reagents, and

shows promise generating diagnostic and therapeutic agents. The SELEX process consists

of exponentially selecting and amplifying aptamers from a large library (1015 to 10 ") of

oligonucleotide molecules.1-2 (Figure 1-1).

The starting point for the in vitro selection process is a combinatorial library

composed of single-stranded nucleic acids (RNA or DNA) typically containing 20 to 40

randomized positions. Randomization creates an enormous diversity of possible

sequences (e.g., four different nucleotides at 40 randomized positions gives a theoretical

possibility of 440 Or ~1024 different sequences). Since short, single-stranded nucleic acids

adopt somewhat rigid structures (imposed by their sequences), such a library contains

many molecular shapes or conformations. To identify high-affinity nucleic acid ligands to

a given target protein, the starting library of nucleic acids (in practice, ~1014 to 1015









different sequences) is incubated with the protein of interest. Nucleic acid molecules that

adopt conformations that allow them to bind to a specific protein are then partitioned

from other sequences in the library that are incapable of binding to the protein under the

conditions used.


1014 10 15

sequences nL2seifctre



Repeat process
with selected
sequences
Protein
target




Partition
Bound Unbound

AmO pD se


Figure 1-1.Overview of the systematic evolution of ligands by exponential enrichment
process. The initial library of nucleic acids is incubated with the protein
target of interest. Molecules that bind to the target protein are then partitioned
from other sequences in the library. The bound sequences are then amplified
to generate a library enriched in sequences that bind to the target protein.

The bound sequences are then removed from the protein and amplified by reverse

transcription polymerase chain reaction (RT-PCR) (for RNA-based libraries) or PCR (for

DNA-based libraries) to generate a reduced-complexity library enriched in sequences that

bind to the target protein. The DNA population is then used to generate a new library of

single-stranded molecules (transcription for RNA; strand separation for DNA) that is

again subj ected to the selection procedure. This process is repeated, until a group of










single-stranded molecules are selected whose binding affinities are sufficient for the

intended application.

Aptamers versus Antibodies

Most of the ligand-detection methods known in the bioanalytical sciences are based

on antibody binding. Like aptamer-based methods, antibody-based detection methods

require maintenance of the ligand-antibody complex, to generate a detectable signal. In

addition, antibody methods such as ELISA or competitive radioimmunoassay (RIA),

while robust and highly sensitive, have limited applicability because of the require

heterogeneous assay conditions:

* The detection must be done on a solid surface

* In most applications both a capture antibody and detection antibody are required

* For ELISA-based protein detection methods, the antibodies must recognize the
folded, native structure of the protein that is present in cell or tissue isolates.7;22;23

As an alternative (or complementary) molecule to antibodies, aptamers have

several inherent advantages that merit study. Since aptamers consist of a short, single

strand of DNA or RNA, they are much easier and economical to synthesize and have a

much longer shelf life. In terms of stability, aptamers are chemically robust and are

intrinsically able to regain activity after exposure to heat and denaturants, and can be

stored for extended periods (more than a year) at room temperature as lyophilized

powders. In contrast, antibodies must be stored refrigerated. Aptamers are chemically

synthesized and thus can be readily scaled as needed to meet production demand.

Whereas difficulties in scaling production currently limit the availability of some

biological products and the cost of a large-scale protein production plant is high, a single

large-scale synthesizer can produce more than 100 kg of oligonucleotide per year and









requires a relatively modest initial investment.l One of the most significant advantages

of aptamers is that their selection process mimics natural selection, so it is possible, in

theory, to develop a highly specific aptamer for virtually any target molecule with the

same high affinity similar offered by antibodies. The affinities of aptamers range from

dissociation constants of 0.3 to 500 nM, with most aptamers having binding affinities in

the range of 1 tol0 nM (comparable to or greater than the typical Fab fragments obtained

through immunization).

In comparison to engineering antibodies for particular applications, incorporating

site-specific labels or coupling sites into an aptamer is usually a minor procedure. Since

the aptamer itself lacks any means of signal transduction on binding a protein, this ease of

molecular labeling is crucial for their development into fluorescence probes for protein

studies.

Aptamers in Bioanalytical Chemistry

Aptamer molecules have been developed and used to detect specific analyte

molecules in different experimental settings. RNA or DNA molecules must create a

specific cavity to enclose and recognize a small molecule. Nonetheless, proteins possess

extensive surfaces (with ridges, grooves, projections, and depressions) with several

hydrogen-bond donors and acceptors; suggesting that proteins may be excellent targets

for aptamer-probe developmental shtdies.9 The first known nuclei-acid aptamer to a

protein that does not normally interact with RNA or DNA was a single-stranded DNA

aptamer against thrombin.24 The aptamer for thrombin has been used extensively for

multiple applications. In one case25, flUOrescently labeled anti-thrombin aptamers

attached to a glass surface were used to detect the presence of thrombin proteins in a

sample, by detecting changes in the optical properties of the aptamers. In this system,









binding of thrombin to the labeled aptamer is monitored by detecting fluorescent

emission of the dye-labeled aptamer on excitation by an evanescent field.

McGown and her group at Duke University26 USed the same aptamer for affinity

capture of thrombin with Matrix Assisted Laser Desorption and lonization-Time of

Flight-Mass Spectrometry (MALDI-TOF-MS). The aptamer was covalently attached to

the surface of a glass slide that served as the MALDI surface. Results showed that

thrombin is retained at the aptamer-modified surface while other proteins, such as

albumin, are removed by rinsing with buffer. Upon application of a low-pH MALDI

matrix, the G-quartet structure of the aptamer unfolded, releasing the captured thrombin.

After TOF-MS analysis, residual matrix and proteins were washed from the surface, and

buffer was applied to refold the aptamers, allowing the surface to be reused. The aptamer

demonstrated high selectivity against mixtures of thrombin and albumin and of thrombin

and mixtures of prothrombin from human plasma.

Aptamers can also be used to separate closely related compounds depending on

their dissociation constants.27 Deng et al 28 explored the use of a 42-mer DNA aptamer

for adenosine/ATP binding, as a weak affinity chromatography stationary phase using

biotin-avidin coupling. Their data demonstrated that affinity chromatography is useful for

characterizing the binding of aptamers to multiple targets. In addition, they evaluated the

aptamer stationary phase for separation of cyclic-AMP, NAD AMP, ADP, ATP, and

adenosine. Their data demonstrated that an aptamer immobilized by biotin-avidin

coupling can selectively retain and separate related target compounds by weak affinity

chromatography. The reported data suggested that it may be possible to develop

stationary phases that selectively retain and separate classes of compounds based on









aptamers and that affinity chromatography is a valuable and convenient technique for

characterizing the affinity and selectivity of aptamers.

Other nucleic acid-based detection schemes have exploited the ligand-sensitive

catalytic properties of some nucleic acids, such as ribozymes. For example, Robertson

and Ellington29demonstrated that a ribozyme that acquires a ligase activity on ligand

binding can be used to detect a ligand by monitoring the ligation of a small, labeled,

second oligonucleotide to the ribozyme. In a complementary approach, 30;31 labeled

allosteric ribozymes that undergo cleavage upon binding to a ligand have been used to

detect ligands by monitoring the release of the label from the ribozyme. However, the

maj ority of the detection techniques have the disadvantage that the ligand-activated

ribozyme is irreversibly modified in the course of generating a signal. Thus, ribozymes

can be used only once in an assay. Furthermore, signal generation is slow with ribozymes

and can take from 1 minute to 1 hour or more.

Manalis32 developed a method for label-free protein detection using a

microfabricated cantilever-based sensor that was functionalized with DNA aptamers to

act as receptor molecules. The sensor used two adj acent cantilevers that constituted a

sensor/reference pair and allowed direct detection of the differential bending between the

two cantilevers. In this case one cantilever was functionalized with aptamers selected for

Taq DNA polymerase while the other was blocked with single stranded DNA. They

reported that the polymerase aptamer binding induced a change in surface stress, which

caused a differential cantilever bending dependent on the ligand concentration. Protein

recognition on the sensor surface was specific and had a concentration dependence that is

similar to that in solution.









Another class of aptamer probe is based on monitoring the change in fluorescence

anisotropy on protein binding.21;25;33 Anisotropy probes are designed by labeling an

aptamer with a single fluorophore molecule. When the labeled aptamer is bound with its

target protein, the rotational motion of the fluorophore becomes much slower as a result

of the larger molecular weight of the aptamer-protein complex. As a consequence of the

binding event, a significant increase in fluorescence anisotropy can be monitored using

plane-polarized light. Anisotropy-based aptamer probes serves as an alternative

mechanism of signal transduction for aptamer-protein binding which results in 'on' and

'off' type signals. Some advantages of anisotropy-based aptamer probes versus analogous

antibody probes are a result of their respective sizes. Since most aptamers are

substantially smaller than antibodies, the relative increase in molecular weight and

fluorescence anisotropy will be much larger on binding with proteins for aptamer probes.

However, the sensitivity of aptamer anisotropy probes is generally not as good as

fluorescence resonance energy transfer-based probes.

For Platelet Derived Growth Factor (PDGF-BB) detection, an aptamer was

converted into an anisotropy probe through 5'-labeling with fluorescein.33 Addition of

PDGF-BB (nM concentration) to an equimolar solution of the labeled aptamer increases

the fluorescence anisotropy more than 2-fold. The binding of protein to the aptamer

clearly results in a large molecular-weight complex, thereby slowing down the rotational

diffusion of the fluorescein label. The binding reaction is quick, with equilibrium

achieved in less than 20 s, including mixing time. Controls using free fluorescein dye

with PDGF-BB show no effect on anisotropy, validating that the observed changes are a

direct result of the aptamer-PDGF-BB binding. All the reported applications of aptamers










demonstrate that with the use of aptamer-based molecules it is possible to detect analyte

binding in both solution (homogeneous) and on solid supports (heterogeneous).

Aptamers are required to work along with a signal transduction mechanism to

report the binding event to the target molecule. High affinity and selective aptamer

probes can be further exploited by incorporating a highly sensitive signal transduction

mechanism within the synthetic DNA sequence that would allow their use for single-step

detection schemes without the need of separating the aptamer-target complex from the

solution.

Fluorescence Methods for Signal Transduction

Fluorescence is a highly sensitive detection method. Figure 1-2 shows a typical

Jablonski diagram where So, S1 and S2 Stand for the singlet, first and second electronic

states, respectively, while T1 stands for triplet state. Following light absorption, a

fluorophore is excited to a higher vibrational level. By a process called internal

conversion, the molecules in condensed phases rapidly relax to the lowest vibrational

level of S1. Internal conversion is generally complete prior to emission; hence,

fluorescence emission generally results from the lowest-energy vibrational state of S1.



I INTERNAL CONVERSION
S, INTERSYSTEM
CROSSING







PHOSPHORESCENCE
h 0



Figure 1-2. Typical Jablonski diagram









Upon excitation into higher electronic and vibrational levels, the excess energy is

quickly dissipated leaving the fluorophore in the lowest vibrational level of S1. Since this

is a rapid relaxation, emission spectra are usually independent of the excitation

wavelength. One of the general characteristics of fluorescence is that it exhibits what is

known as the phenomenon of Stokes Shift. This phenomenon reveals that the energy of

the emission is typically less than that of absorption; hence, fluorescence typically occurs

at lower energies or longer wavelengths. The intensity of fluorescence can be decreased

by a wide variety of processes known as quenching.

Fluorescence Quenching

The process of decreasing fluorescence intensity is termed quenching and it usually

happens through two maj or mechanisms.34 The first mechanism, known as collisional

quenching, takes place when a fluorophore is excited by incident light and as a

consequence goes into an excited state and stays there for a short period of time

(nanoseconds). The time it stays in the excited state is called fluorescence lifetime. In this

case, the quencher must diffuse to the fluorophore during the lifetime of the excited state.

Upon contact, the fluorophore returns to the ground state, without emission of a photon.

Collisional quenching is described by the Stern-Volmer as shown in Equation 2-1; where

Fo and F are the fluorescence intensities in the absence and presence of quencher,

respectively, k, is the bimolecular quenching constant, to is the lifetime of the

fluorophore in the absence of the quencher, and [Q] is the concentration of the quencher.

Fo/F=1+kgro[Q]=1+KD [Q] (2-1)

The second mechanism of fluorescence quenching, named static quenching, is

characterized by the formation of a nonfluorescent complex between a fluorophore and a










quencher. When fluorophore-quencher complex absorbs light, it immediately returns to

ground state without emission of a photon.

Fluorescence Resonance Energy Transfer (FRET)

Fluorescence resonance energy transfer is an interesting fluorescence-related

phenomenon which relies on the radiationless transfer of energy from a donor

fluorophore to an acceptor fluorophore. The distance dependent transfer of energy is a

physical process that depends on the spectral overlap of the donor and acceptor spectra

and proper dipole alignment of the two fluorophores. FRET is considered to be one of the

few tools available for measuring nanometer scale distances and changes in distances,

both in vitro and in vivo.

In FRET, a donor fluorophore is excited by incident light, and if an acceptor is in

close proximity, the excited state energy from the donor can be transferred. This leads to

a reduction in the donor's fluorescence intensity and excited state lifetime, and an

increase in the acceptor' s emission intensity. One of the requirements for FRET is that

the two molecules need to be very close, typically less than 10 nm. In fact, Lakowics34

showed that the efficiency of this process (E) depends on the inverse of the distance,

between donor and acceptor, to the sixth power as shown in Equation 2-2, where E is the

energy transfer efficiency, r is the distance between the donor and the acceptor, and Ro is

the Forster distance at which half of the energy is transferred (typically 20 to 60 A+), and

depends on the spectral characteristics of the dyes and their relative orientation. When

non-fluorescent molecules are used as acceptors, the result of the energy transfer is

quenching of the donor fluorescence.

E = RO6 R6 r6 (2-2)










DONOR

ACCEPTOR


RI ENERGY TRANSFER







Figure 1-3. Fluorescence resonance energy transfer diagram. Whereas normally an
excited fluorophore returns back to the ground state with the emission of a
photon, FRET results in the excitation of the nearby acceptor fluorophore that
in turn emits a photon when it returns to the ground state. The occurrence of
FRET is characterized by a decrease in observed donor emission, and a
simultaneously sensitized (increased) acceptor emission.

Fluorescence resonance energy transfer is a distance-dependent phenomenon that

can be applied to the development of aptamer probes to study intermolecular and

intramolecular relationships in biophysical systems and cell biology. The development of

an efficient aptamer probe is not only dependent on the oligonucleotide sequence and

conformation but also on the selection of the fluorophore and the quencher pair. With the

high diversity of existing fluorophores and the growing number of the alternatives

quenchers, the aptamer probes can be modified to fulfill specific experimental needs.

Several reports have been published with updated information regarding the efficiencies

of FRET for commonly used fluorophore-quencher pairs and their effects on duplex

stability.35 Various approaches, including the well studied molecular beacons, have

exploited the ability of fluorescent compounds to absorb energy and transfer it to nearby

molecules for the study of molecular interactions.36









Molecular Beacons

Molecular beacons (MBs) 36 are synthetic oligonucleotide probes that possess a

stem-and-loop structure, designed for specific recognition of DNA or RNA targets. The

basis for target recognition is the hybridization of the nucleic acid to its complementary

target. The single-stranded loop portion of the MBs has a sequence complementary to the

target DNA and can report the presence of specific target nucleic acids. The stem

typically has five to seven base pairs which are complementary to each other but

unrelated to the target. Signal transduction in MBs is accomplished by resonance energy

transfer. A fluorophore (donor molecule) and a quencher (acceptor molecule) are

covalently linked to the two ends of the stem. The stem keeps the two moieties in close

proximity, causing the fluorescence of the fluorophore to be quenched by energy transfer.

When the probe encounters a target DNA molecule, the molecular beacon undergoes a

spontaneous conformational reorganization, leading to the formation of a hybrid that is

longer and more stable than that of the stem, that forces the stem apart and a consequent

fluorescence restoration. The conformational state of a molecular beacon is thus directly

reported by its fluorescence: in the closed state, the molecular beacon is not fluorescent;

in the open state, when the fluorophore and the quencher molecules are apart, it emits

intense fluorescence. Different molecular beacons can be designed by choosing loop

sequence and length. Also, the quencher and the fluorophores can be changed according

to the application.

Molecular Beacons for Non-Specific Protein Detection

Although molecular beacons were originally designed to bind and recognize

specific nucleic acids, the probes can also lead to increased fluorescence on binding to

certain proteins. Since the binding of proteins to DNA or RNA molecules can readily










i Target
DNA
Loop MB 'Y















Figure 1-4. Working principle of molecular beacon. Before hybridization with target
nucleic acid sequences the MB takes on a stem-loop structure which maintains
the close proximity of the fluorophore (F) and quencher (Q) moieties. The
resulting fluorescence is minimal due to static quenching of the fluorophore
molecule. After introducing target nucleic acid sequences, the loop sequence
of the molecular beacon hybridizes to the target and unstabilizes the stem
hybrid. Consequently, the two moieties spatially separate and result in the
restoration of the fluorescence.

disturb the conformation of the nucleic acid, it is expected that this binding would result

in spatial separation of the MB fluorophore and quencher. As an example, an E.coli

single stranded DNA binding protein (SSB) was used to demonstrate the protein

recognition capability of MBs. This DNA-binding protein is used in DNA

replication, recombination, and repair. Using a conventional fluorescence

spectrofluoremeter, the investigators detected as low as 20 nM of SSB using a MB

labeled with tetramethylrhodamine (TMR) and dimethylaminophenylazobenzoic acid

(DABCYL). The measured fluorescence intensity changes over time revealed that the

SSB-MB interaction is rapid, reaching equilibrium within 10 s. The MB-based

SSB assay is not, however, particularly specific. In fact, SSB leads to a fluorescence

enhancement nearly equal to that of the complementary DNA, but other proteins










(including histone and Rec A) can also bind with the MB and cause a fluorescence

intensity increase. The results demonstrated that while MBs were sensitive and somewhat

selective to DNA-binding proteins, they were not specific enough to be capable of

distinguishing a particular protein. In order to apply the principle of MBs for real-time

detection of protein biomarkers, a more selective protein recognition mechanism is

required.

Aptamers and FRET for Protein Detection

In addition to exploiting the inherent conformational changes that aptamers

undergo, aptamers have been engineered similar to MBs such that the addition of an

analyte results in a conformational change and simultaneous reduction or increase in a

fluorescent signal. Utilizing FRET between fluorophore and quencher moieties for signal

transduction of protein binding is one of the more popular designs. Depending on the

relative positions of the fluorophore and quencher before and after protein binding,

probes can result in either enhanced or reduced fluorescence on binding. It is important to

mention that the design of optimized probes is not always a trivial process. A maximum

change in fluorescence on binding is often achieved by gaining knowledge about the

conformations of the free aptamer and the aptamer-protein complex. Ideally, when this

structural information is available, one can strategically incorporate the fluorophore and

quencher moieties on the aptamer probe in such a way that the transition from bound to

unbound conformations causes a dramatic change in their relative positions.

An example of a FRET based quenching aptamer probe is the one developed using

a thrombin aptamer.37 The first reported aptamer for thrombin contains a 15-nucleotide

consensus sequence.38 When bound to thrombin, the aptamer exists primarily in its

quadruplex form containing two G-quartet structures, but in free solution, it can adopt









either conformation, dependent in part on the ionic strength and temperature. This

conformation shift provides the basis for an aptamer probe. By labeling the two ends of

the aptamer with a fluorophore and quencher pair and extending the aptamer by one base

on each end, aptamer binding of thrombin would force the quencher adj acent to the

fluorophore, resulting in a substantial decrease in fluorescence.

Another method of detecting binding of a target protein to an aptamer has also been

described which relies on the use of fluorescence-quenching pairs whose fluorescence is

sensitive to changes in secondary structure of the aptamer upon ligand binding.39

However, target protein-mediated changes in secondary structure were engineered into

the aptamer molecule via a laborious engineering process in which four to six nucleotides

were added to the 5' end of the aptamer that was complementary to the bases at the 3' end

of the thrombin binding region. In the absence of thrombin, this structure forms a stem

loop structure, while it forms a G-quartet structure in the presence of thrombin.

Fluorescent and quenching groups attached to the 5' and 3' end signal this change.

A related class of aptamer probes is the two fluorophore FRET probes.40 Binding of

target protein can be detected by monitoring the fluorescence of a second fluorophore

(F2) directly or preferably by the ratio of fluorescence of both fluorophores (F2/F l).

Ratiometric detection may provide enhanced sensitivity, with reported detection limits in

the low pM regime. All of the design considerations applicable to the quenching aptamer

probes are also crucial to this class of aptamer probes. Detailed structural information of

the aptamer and aptamer-protein complex allows optimized positioning of the

fluorescence donor and acceptor.









Molecular Beacon Aptamer (MBA) Development for a Model Protein System

Based on previous studies that showed that the high affinity and selectivity of

aptamers can be successfully combined to develop aptamer probes, it is of interest to

further investigate and develop aptamers for biomolecule studies. In this case, PDGF-BB

was chosen based on the significance of the protein in biological systems and the fact that

an aptamer had already been selected for this protein.

Platelet derived growth factor was discovered as a maj or mitogenic factor present

in serum but absent from plasma. The biological function of PDGF-BB is to stimulate the

division and proliferation of the cells through binding to receptors on the cell surface.

Studies showed41-44 that PDGF is not one molecule but three, each a dimeric combination

of two distinct but structurally related peptide chains designated A and B. Dimeric

isoforms PDGF-AA, AB and BB are differentially expressed in various cell types and

their effects are mediated through two distinct receptors, named oc and P. Platelet derived

growth factor is considered a cancer biomarker because it is expressed at low or

undetectable levels in normal cells, but it is found to overexpressed in many tumor cells

and the autocrine and paracrine effects of PDGF-BB increase with the degree of malignancy.

45;46 In addition to cancer, PDGF has been implicated in other diseases, including renal

disease. There is a hypothesis that PDGF is important to cell transformation processes,

tumor growth and progression and thus could be used as a cancer marker for diagnosis.

The assumed biological foldings for PDGF-BB are shown in the Figure 1-5.

Aptamers for Platelet Derived Growth Factor-BB (PDGF-BB)

The first step towards the development of a novel 1VBA is the selection of an

aptamer. In 1996, Louis Green and his group47 USed the SELEX procedure for the

development of an aptamer for high affinity and selectivity against the B chain of PDGF-









BB. The first selection was initiated by incubating approximately 3x1014 mOleCUleS Of

random ssDNA with PDGF-AB in binding buffer. The two best ligands from this group

were identified by their relative affinities for PDGF-BB and its molecular variants over a

range of protein concentrations.












Figure 1-5. Assumed biological foldings of Platelet Derived Growth Factor (PDGF) 44
The biological molecule is the macromolecule that has been shown to be or is
believed to be functional.

In both cases, the affinity of ligands for PDGF-BB was higher than the affinity for

the other PDGF isoforms. The selected aptamers, 41t and 36t, shared a secondary

structure motif: a three-way helix junction with a three-nucleotide loop at the branch

point.(Figure 1-6) Two of the helices end in highly variable loops at the distal end from

the junction, suggesting that the regions distal from the helix junction are not important

for high-affinity binding to PDGF. The highly conserved nucleotides are indeed found

near the helix junction. The 36t aptamer is composed of 39 DNA bases with a

dissociation constant of 0.093nM. The other selected aptamer, 41t, is a 44-mer sequence

with a higher dissociation constant of 0. 129 nM.

Based on theoretical determinations, both sequences appear to have several

possible conformations before and after binding of the protein. Using this information,

the possibility exists to develop a new aptamer based detection scheme for PDGF. Also,

given that the protein has multiple isoforms, this makes the PDGF system particularly










attractive to explore because we can evaluate the different interactions of a single

aptamer with a family of proteins that have, in this case, ~60 % identity. In the next few

chapters, a systematic investigation of the PDGF-BB protein-aptamer system will be

presented. A variety of conditions have been evaluated for the effective recognition of the

protein as well as several transduction mechanisms studied for potential use in biological

studies.


C C

GGCA AG AG ,CA -A /C



GC
AST
COG


Figure 1-6. Folding of 36t molecular beacon aptamer (1VBA)

The scope of the work presented here was to conduct a systematic investigation of

a novel design for an aptamer-based biomolecule, used to detect and study a target

biomarker PDGF-BB. The combination of a nucleic acid molecule with different

fluorescence phenomena as signal transduction mechanisms will be investigated.

Potential applications of this probe in multiple assay environments and assay formats will

be explored and evaluated for homogeneous solution and in cellular samples.















CHAPTER 2
DEVELOPMENT AND CHARACTERIZATION OF A MOLECULAR BEACON
APTAMER FOR PLATELET DERIVED GROWTH FACTOR

Introduction

Proteins play very important roles in almost all functions of life. Molecular probes

for specific and sensitive detection of proteins and their molecular variants are necessary

in many biotechnology applications and biomedical studies. Monoclonal antibody-based

immunoassays have been used for protein analysis and studies during the past decades.

Most immunological methods and many nucleic-acid-based methods involve multiple

steps to achieve amplification of the specific signal produced by a target protein. By

attaching a fluorophore and a quencher to an aptamer, the high degree of sensitivity

afforded by fluorescent signals40;48;4 can be combined with the selectivity of the DNA

binding to the target protein to form a single-step molecular beacon aptamer (MBA)

assay.

Fluorescence changes upon the interaction between a fluorophore and a quencher

have been studied using molecular beacons (MBs) for DNA and RNA targets. Both, MBs

and MBAs share a common characteristic: they have similar inherent signal transduction

mechanisms and allows for target detection and reporting without removing for probe-

target complex from the sample solution (detection without separation). Some differences

between the two probes include the fact that MBs are mostly used for DNA and RNA

detection and are based on the hybridization of the loop sequence to the target sequence.

MB probes interact with their complement primarily through hydrogen bonding at









various sites, depending on the length of the hybrid. In contrast, the use of MBAs is

mainly used for the detection of protein targets and relies on a mixture of forces:

hydrophobic, ionic and hydrogen bonding, at only a few specific sites. The basis for

differences in secondary structures between the free and bound forms of MBAs for

protein targets is not well understood, however interactions with different proteins are

likely to result in secondary structure changes that could be used to produce FRET

signa s.1 4

Platelet derived growth factor is a dimeric protein for which several natural

molecular variants are known, and at least two natural variants of cell-membrane

receptors have been described with different specifieity for the PDGF variants.41-43 The

expression of variants of PDGF and the PDGF receptors have been implicated in

malignancy and developmental abnormalities."o"s The use of MBAs for protein targets is

in its infancy and the basis for differences in secondary structures between the free and

bound forms of MBAs for protein targets is not well understood. Theoretical models

predicted that when the aptamers selected for PDGF-BB are free in solution, several

stable conformations are possible. Based on the previously described MBA for thrombin

which forms a G-quartet after binding to the protein, the possibility existed for the PDGF

aptamer to undergo a conformational change after binding to the protein as a result of

stabilizing one of the predicted conformations. Initially, it was unclear whether the stem

structure would be open or closed prior to protein binding. Therefore, the first PDGF-BB

probe was designed as an anisotropy probe in an effort to explore the application of an

aptamer anisotropy probe for protein analysis. The PDGF-BB aptamer was labeled with a

single fluorescein dye at the 5' end.33 PDGF-BB in the nM range, when added to the









aptamer solution, caused an anisotropy increase due to the larger molecular weight of the

complex. The results were our initial attempts toward developing a PDGF-BB probe.

Given the possibility of conformational changes that could occur due to binding of the

protein, a distance dependent signal transduction mechanism was incorporated into the

aptamer molecule. The initial hypothesis was that a FRET-based aptamer probe could be

designed for the PDGF aptamer. In this chapter, the result of a systematic study of the

chemical and physical properties of a fluorescence quenching DNA aptamer probe will

be presented.

Materials and Methods

Synthesis and Purification of MBAs

All DNA molecules were obtained from Geno-Mechanix, LLC (Gainesville, FL)

and the general synthesis protocols are described in this section. The DNA molecules

were synthesized using the standard phosphoramidite chemistry in an Expedite 8909

automated DNA synthesizer on controlled pore glass beads, deprotected in ammonium

hydroxide and purified by gel filtration. Unmodified DNA aptamers were purified by ion-

exchange HPLC followed by gel filtration to remove salts. The standard MBA was

synthesized using DABCYL immobilized on controlled pore glass beads (BioSearch

Technologies, Novato, CA) and fluorescein (6-FAM) was added at the 5'-end using 6-

carboxyfluorescein phosphoramidite (BioSearch Technologies, Novato, CA). The dually

modified DNA was deprotected at 550C for 6 hr with ammonium hydroxide (50%) in

methanol. The deprotected DNA was first subj ected to gel filtration followed by two

cycles of reverse phase HPLC using two different hydrophobic resins with

triethylammonium acetate (pH 6.0, 0.05 M) buffer and eluted with an acetonitrile









gradient. The Einal purified material was subj ected to gel filtration to remove solvents,

dried under vacuum and stored dry at -200C until use.

MBAs with tetramethylrhodamine (TMR)-6-FAM pair was synthesized and

purified as described above using TMR-immobilized on controlled pore glass (BioSearch

Technologies, Novato, CA), except that deprotection was carried out in potassium

carbonate (0.1M) in methanol (80%) for 4 hr at 550C before processing the deprotected

dual labeled DNA. For the synthesis of MBA with Black Hole Quencher 2 (BHQ2)-

Texas Red pair, synthesis was done using BHQ2 immobilized on controlled pore glass

(BioSearch Technologies, Novato, CA) and a 5'-modification with a functional amine

group using a C3 spacer. Following deprotection at 550C with ammonium

hydroxide/methanol and gel filtration, the DNA was reacted with the N-

hydroxysuccinimidyl ester of Texas Red (Molecular Probes, Eugene, OR) in sodium

borate buffer (pH 8.2, 0. 1 M) and the labeled material was again subj ected to gel

filtration prior to the two cycles of reverse phase gel filtration as described above.

For the synthesis of MBA labeled with Cy3 and Cy5, the DNA was synthesized

with a functional amine group immobilized on controlled pore glass beads and Cy5 was

added to the 5'-end using Cy5 phosphoramidite (Amersham Bioproducts, Piscataway,

NJ). Following deprotection with potassium carbonate (0.1M)/methanol and gel filtration,

the DNA was reacted with N-hydroxysuccinimidyl ester of Cy3 (Amersham Bioproducts,

Piscataway, NJ) and the dual labeled material was purified as described for Texas Red

labeling above. All the MBA stock solutions were prepared at 100 CIM concentration in

Tris/HCI buffer (pH 7.5, 20 mM) with NaCl (20 mM), and stored at -200C in aliquots.

The DNA aptamer sequence in the standard 36tMBA used in most of the studies










described here is the one designated 36t by Green et.al (5'-CACAGGCTACGGCAC

GTAGAGCATCACCATGATCCTGTG-3 ') and contains a 6 base complementary

sequence at the 5' and 3'- ends that can form a double stranded stem in a closed

conformation.47

Recombinant human PDGF-BB, PDGF-AB, and PDGF-AA were purchased from

R&D Systems (Minneapolis, MN). PDGF and its isoforms were reconstituted in 4 mM

hydrochloric acid with at least 0. 1% bovine serum albumin (BSA). Other recombinant

human growth factors used in the selectivity experiments, epidermal growth factor

(EGF), insulin-like growth factor-I (IGF l), were bought from Roche (Indianapolis, IN).

Human hemoglobin (HEM), porcine lactic dehydrogenase (LDH), myoglobin (MYO),

chicken lysozyme (LYS), and human gamma-thrombin (THR) were purchased from

Sigma (St. Louis, MO). Other biomolecules used include: BSA, (New Englands Biolabs,

MA), thrombin (Haematologic, Inc, VT), ovalbumin (US Biological, Sawmpscott, MA)

and, glycogen (Fisher Biotech, USA).The binding buffer used for all the characterization

experiments was 20 mM Tris-HCI (pH 7.5) with 20 mM sodium chloride.

Standard Fluorescence Quenching Assay

All the characterization experiments for the MBA measurements were carried out

in a 100 Cll cuvette (Starna Cells). Standard fluorescence quenching assays were

performed by incubating the desired concentration of protein target with a 50 nM solution

of the MBA in binding buffer at room temperature in a final volume of 100 Cll. All

fluorescence measurements were monitored using a Fluorolog-Tau-3 spectrofluorometer

(Jobin Yvon Inc., Edison, NY) equipped with a thermostat accurate to 0.10C. The sample

cell was a 100 Cll cuvette (Starna Cells,Atascadero, CA). The fluorescence emission of 6-









FAM was monitored at the excitation maximum, 480 nm, and the fluorescence intensity

was measured at the emission maximum, 520 nm. Both excitation and emission slits were

varied to yield the best signals. The results are reported as mean values of triplicates.

The effect of temperature on MBA fluorescence was monitored using a Fluorolog-

Tau-3 spectrofluorometer (Jobin Yvon Inc, NY) equipped with a thermostat accurate to

0.10C. The sample cell was a 100 Cll cuvette (Starna cells, Atascadero, CA). The

fluorescence intensity of a 50 nm MBA solution in the binding buffer was monitored

before and after the addition of 200 nM PDGF-BB.

In order to adapt the fluorescence quenching assay to high throughput format, a

Tecan Saphire (Durhan, NC) fluorescence microplate reader was used with 96-well flat

bottom microtiter plates (Nalge Nunc International, Rochester, NY). All experiments

were carried in a final volume of 100 CIL, and the excitation and emission maxima were

selected according to the fluorophores used.

Results and Discussion

Aptamer probes have significant appeal in the development of new methodologies

for purification, labeling, and inhibition and characterization of proteins; however, their

use as molecular probes has been under development and advances made only in the last

5 years.8;52 One of our maj or goals for this research was to develop a single-step assay

which could analyze protein concentrations of distinct biomarkers in biological samples.

The initial efforts focused on the protein, PDGF-BB, for which two potential DNA

aptamer sequences for probe development have been selected.47 To characterize the MBA

and determine if the probe could operate in a typical biological sample, a variety of

chemical and physical parameters were evaluated.









Choice of Aptamer Sequence for MBA Development

Based on the predicted secondary structures, the first step toward developing a

FRET-based aptamer probe for PDGF was to determine if a secondary structure change

could be observed on binding to PDGF. To accomplish this task, two MBAs which are

based on the aptamers previously characterized,47designated 36t and 41t, were evaluated

(Table 2-1). Each aptamer was converted into an MBA by attaching DABCYL at the 3'-

end and 6-FAM at the 5'-end. Using thermodynamic software calculations, the aptamers

were predicted to form a helix-loop conformation with a single stranded region at the 5'

and 3' end as a possible conformation with a reasonable free energy in the absence of

PDGF.53;54 As a result of labeling the two ends of the aptamer, the fluorescence intensity

of the free aptamer sequence is expected to be fairly high since the fluorophore and

quencher pair will be spatially separated. Upon the addition of PDGF-BB, if protein

binding induces a conformational change in the stem structure of the aptamer a change in

the fluorescence intensity should be observed. In a fluorescence versus time experiment,

both aptamers were first monitored for approximately 300 s and then PDGF-BB was

added at four-fold excess (Figure 2-1). Upon PDGF-BB addition the fluorescence signal

decreases and reaches equilibrium rapidly. The quenching efficiencies were considerably

different between the two aptamer sequences. The reported binding affinities

demonstrated that the 36t aptamer has a higher affinity for PDGF consistent with the fact

that this aptamer showed a higher fluorescence quenching. The labeling of the aptamer

molecule with a fluorophore and quencher at each end of the oligonucleotide sequences

should not affect the binding capabilities of the aptamers since it was reported47that the

regions distal from the trinucleotide loop of both sequences are not critical for binding.

Since FRET is dependent on the distance between the fluorophore and the quencher, it










Table 2-1. Percentage of quenching of different consensus sequences of 50 nM of MBA
for PDGF aptamer with 200 nM of PDGF
Name Sequence % quenching
36t CACAGGCTACGGCACGTAGAGCATCACCAT 94
GATCCTGTG
41t TACTCAGGGCACTGCAAGCAATTGTGGTCC 55
CAATGGGCTGAGTA


_______~___1___


800000


* 41T
* 36T


j'
~600000



400000

o-
o

LI.


O 100 200 300 400 500 600 700 800
Time (s)
Figure 2-1. Fluorescence intensity changes versus time of different aptamer sequences.

may be possible that preferential binding of PDGF stabilizes, or closes, the stem thus

resulting in a decreased FRET response.

Based on the observed decrease in the fluorescence signal, the 36t and 41t aptamer

sequences appear to have a conformation change on binding to the protein. The PDGF

FRET aptamer is proposed to have a "stem-open" conformation prior to binding, due to

the high fluorescence signal that was observed (See Figure 2-2). Prior to binding one or

several structural conformations could be possible, and PDGF most likely stabilizes the

"closed-stem" structure for the 36t probe. Since the 41t aptamer had similar fluorescence

prior to binding and quite different from after binding, most likely the structure of the 41It









aptamer after binding is not a "stem-closed" structure but a partially-closed structure.

Also, it could be possible that due to the decreased affinity of the 41It sequence for PDGF,

the equilibrium fluorescence would be less in comparison to the 36t control aptamer.

However since the experiments were done in 4-fold molar excess of PDGF, this is not

likely to be the case because most of the aptamer probes should be bound. Another

possibility for the observed difference could be the modifications themselves. If single

fluorophore labeled DNA impurities existed within the solution, one might expect that

the degree of quenching would be less. As a result other synthetic batches were tested and

still similar results were obtained.






PDGF



A B
Figure 2-2. Proposed mechanism of PDGF-BB induced FRET responses for the 36t
probe. When the MBA is free in homogeneous solution, multiple
conformations are possible. Upon binding of PDGF-BB, the probe
conformation shifts from the opened (A), or partially opened (B), to a closed
conformation. The fluorescence signal, therefore, is high prior to binding; and
on stem formation, the signal is quenched.

Evaluation of Additional Fluorophore Quencher-Pairs

Since the 36t aptamer probe was clearly superior to the 41t in producing a

quenching response, the 36t probe was selected to further develop and characterize the

assay. One of the advantages of the MBA assay is that the use of FRET as a signal

transduction allows for a single step detection of the target without having to isolate the

MBA-protein complex from the solution. With FRET, alterations in the emission of









fluorescent labels are measured. An important consideration in the design of aptamer

probes for protein binding assays is the efficiency of energy transfer between the

fluorophore and quencher used to label the probes. The versatility of the assay would be

significantly improved if various known fluorophore-quencher pairs were found to be

more effective for PDGF detection. Measurements of quenching efficiencies of different

fluorophore-quencher pairs can be used to aid in the design of different kinds of MBAs.

In the next section, several MBA molecules carrying known FRET pairs were studied and

compared to the standard MBA labeled with 6-FAM-DABCYL pair. The following

pairs: Texas Red-BHQ2, Cy5-BHQ2 and 6-FAM-TMR were selected for their high

quenching efficiency in other systems. The synthesis and purification of MBAs with

FRET pairs is described in the Experimental Section and tested in the presence of a four-

fold molar excess of PDGF-BB in the standard fluorescence quenching assay.

As shown in Figure 2-3, all the selected FRET pairs were quenched when PDGF

was added, albeit to different degrees. Two of the most commonly used quenchers,

DABCYL and TMR, were paired against 6-FAM. Both quenchers may affect the

sensitivity and flexibility of FRET assays. DABCYL is a dark quencher that absorbs

broadly without emitting light; consequently, when paired with 6-FAM it can reduce

more than 90% of the original fluorescence intensity of the MBA with high sensitivity

and low background fluorescence. On the other hand, TMR is not a dark quencher and

contributes to an overall increase in background because of its own native fluorescence.

When both quenchers are paired against the same fluorophore for the MBA, DABCYL is

superior in terms of overall fluorescence quenching against 6-FAM.










5 MBA 5 MBA + PDGF-BB


1 .0



S0.6

S0.4




0.0
FAM-DABCYL FAM-TMR TexasRed- CY5-BHQ2
BHQ2
Figure 2-3. Evaluation of fluorescence quenching caused by PDGF-BB with MBAs
containing different fluorophore-quencher combinations. PDGF MBA
molecules labeled with different fluorophore-quencher pairs were incubated in
the standard fluorescence quenching assay buffer (final volume 100 C1L) with
a four-fold molar excess of PDGF-BB (300 nM) to the concentration of the
MBA (75 nM).

Black Hole quenchers were designed to maximize the spectral overlap with many

fluorophores and it does not re-emit the absorbed fluorescence as light, thus decreasing

the background fluorescence. BHQ-2 was capable of quenching more than 50 % of the

initial fluorescence intensity when paired with two commonly used dyes, Texas Red (TR)

and Cy5 with different extents. In this particular case, the Cy-5 labeled MBA resulted in

74% quenching effciency versus the Texas Red analog with only 54 %, even though

previous reports35 predicted that both dyes, Texas-Red and Cy5 should have similar

quenching effciency mediated by contact quenching. Possible reason for the difference

in quenching effciency includes the possibility that the effective closed conformation of

the MBA on binding to PDGF-BB is favorable for the FRET effciency of the Cy5

labeled probe.34 In addition, when the BHQ-2-Cy5 pair is in close proximity, the dye-pair

interaction actually increases the stem stability.55;56 Since FRET is a distance dependent









phenomenon, it could be possible to improve the performance of other fluorophore-

quencher pairs by changing the location of the label molecules in the MBA.57 The

availability of choices in the selection of fluorophore and quencher is an important part of

MBA-based assay development because various biological samples might present

potential interference at certain excitation-emission spectra that may be effectively

addressed by selecting the proper FRET pair. In addition, the development of a multiplex

assays for the simultaneous detection of multiple proteins in a single homogeneous

incubation may be possible by using two or more MBAs that are selective for different

targets and that are labeled with different fluorophore-quencher pairs. The results above

support the notion that MBAs are compatible with various fluorophores; however, the

aptamer sequence, conformation, and binding principle will all potentially affect the

FRET process. Each MBA that is developed would need to be fully characterized in order

to obtain the most effective position and dye-pair for labeling.

Once the MBA was developed with an appropriate fluorophore-quencher pair, we then

investigated the applicability of the MBA for the in vitro detection of PDGF-BB in

homogeneous solution by incubating a fixed amount of the 36t MBA with increasing

amounts of PDGF-BB in binding buffer. As can be observed in Figure 2-4A, a dose-

dependent fluorescence quenching was observed on the addition of PDGF-BB and 1.5

nM of PDGF was detected in repeated experiments. In comparison, an ELISA-based

PDGF-BB assay was reported to have a detection limit of ~15 pg/mL (0.6 pM) PDGF-

BB (Figure 2-4B). The almost 100-fold difference in detection capabilities is

understandable in this case.










50000
-000


40000

200


30000


50000



30000

20000

10000

0


50
PDGF (nM)


A


2.0


1.5


e 1.0
O

0.5


0.0 *
0


200


800


1000


600


PDGF (pg/mL)


Figure 2-4. Calibration curves for PDGF-BB. (A)Dose-dependent fluorescence
quenching of the MBA 36Gt-MBA on addition of PDGF-BB. Increasing
concentrations of PDGF-BB were incubated in the standard fluorescence
quenching assay buffer (final volume 100 uL) with the 36tMBA labeled with
Dabcyl quencher at the 3'- end and 6-FAM at the 5'-end (fluorescence
measurements were made at the excitation and emission maxima for 6-FAM)
(B) Calibration curve obtained with PDGF-BB ELISA kit (RnDsystems)









In the MBA assay, the fluorescence response is produced as the result of a single (or

possibly two as will be shown in later chapters) fluorophore molecule being quenched in

the presence of a single PDGF-BB molecule. Since the ELISA assays utilizes an enzyme

to effectively amplify the signals for each bound protein, clearly the sensitivity and

detection limits of such assays will be better. However, ELISA does present the difficulty

of being extremely time consuming (~7 h for one set of analysis). The time factor is

essentially attributed to the washing and incubation steps which allow for binding of

target molecules and the removal of unbound species. Since the MBA bioassay involves

only the mixing of two solutions, the MBA solution and the analyte solution, and a short

binding time, the analysis time is much shorter (~30 min for the MBA assay). As a result,

in terms of sensitivity, if one can sacrifice analysis time and the detection limits and

sensitivity are not an issue, then the MBA assay will provide a simple single step

capability for screening purposes.

Incubation Conditions for MBA Bionssay

Effects of temperature. A critical factor in the MBA-based bioassay is the

difference in distance between the quencher and the fluorophore in the free MBA (open

conformation) and the target-bound MBA (closed conformation). Physical factors that

affect DNA conformation and the distance between the FRET pairs are expected to

influence the dynamic range of the assay. It is unclear as to the exact mechanism for

PDGF binding to the 36t control sequence; however, it is believed that the opened, or

partially open, conformation is bound by the protein and then the stem is consequently

stabilized. At higher temperatures, the free MBA would preferentially assume a more

open conformation and increase the fluorescence signal. Conversely, at lower









temperatures, the equilibrium would be shifted to a more closed conformation. Both

instances could potentially influence the binding of PDGF by either inhibiting it or

increasing its ability to bind. In order to assess the effect of temperature on the MBA

probe and binding, we measured the fluorescence intensity of the MBA at different

temperatures under conditions used in the standard fluorescence quenching assay and

then compared 250, 30o and 37oC for binding to the PDGF aptamer.


Sno PDGF-BB with 200 nM PDGF-BB
1800000

< 1500000

'5 1200000

3 900000

a 600000

S 300000

F4 0
15 25 30 37 45 52 60 67

Temperature (0 C)
Figure 2-5. Effect of increasing temperature on fluorescence signal of free MBA in
solution. A solution of MBA (75nM) in standard fluorescence quenching
assay buffer as described in Materials and Methods was subjected to a gradual
increase in temperature (50C per minute), held at the indicated temperatures
for 5 min and the fluorescence signal was measured.

The results presented in Figure 2-5 show that as the temperature increases, the

initial fluorescence intensity increases presumably resulting from a larger separation of

the arms of the predicted three-way helix junction where the six-base pair double

stranded region would be formed. The largest fluorescence quenching was observed for









the MBA incubated at 370C, which is the standard physiological temperature. The initial

fluorescence intensity does not significantly increase above 370C. Since the aptamer

probe can potentially exist in solution as multiple conformations (i.e., random coil,

partially open, and closed structures), this particular assay offers the unique opportunity

to observe not only the specific closing of the probe due to PDGF binding but nonspecific

interactions that could result in the opening of the probe. As a result, experiments were

performed at 300C to monitor events that induce conformational changes that may result

in higher fluorescence intensities. This temperature also allows to monitoring PDGF-BB

induced quenching.

Effects of pH. Since the 6-FAM/DABCYL dye pair was chosen for assay

development, the pH sensitivity of fluorescein could potentially affect the overall

performance of the FRET based assay. As a result, the effect of pH on the fluorescence

intensity of the probe without target protein was investigated. The fluorescence intensity

of a 75 nM solution of the MBA in binding buffer used in the standard fluorescence

quenching assay was also measured in the microplate reader except that the pH was

varied between 5.0 and 10. The scope of this experiment was limited by the pH

dependence of fluorescence intensity of fluorescein. The results (Figure 2-6) showed that

within a pH range of 6.5 to 9.5, the fluorescence intensity of the MBA is within + 10% of

that observed at pH 7.5. The pH-dependent intensity profile of the MBA correlated with

the pH-dependent spectra of fluorescein;5 consequently, the observed trend is believed to

be due to the fluorescence characteristics of the dye molecule rather than conformational

changes leading to quenching. Even though fluorescein is a highly pH dependent

fluorophore, the optical properties should not affect the measurements of the FRET based












50000


S40000 -


S30000


rl20000








4.5 5.5 6.5 7.5 8.5 9.5 10. 5

pH

Figure 2-6. Effect of increasing pH on fluorescence signal of free MBA in solution.
Fluorescence intensity measurements of a solution of MBA (75nM) in binding
buffer with varying pH conditions.

assay because the pH conditions during the experiments are similar to the optimal range

for fluorescein.47

Effects of ionic strength. Certain monovalent and divalent cations commonly

encountered in biological specimens are known to affect DNA conformation. A series of

experiments to study the effects of varying concentrations of two divalent cations

(magnesium and calcium) and two monovalent cations (sodium and potassium) on the

fluorescence intensity of the free MBA in solution were performed. The results are

presented in Figures 2-7 and 2-8. Each of the divalent cations caused a concentration-

dependent decrease in the fluorescence intensity (Figure2-7) and at more than 1 mM











1.2 1 Mg2+
u, H Ca2+







0.4

0.2


0.0 0.5 1.0 1.5 2.0 2.5 3.0
ion concentration (mMI)

Figure 2-7. Effect of divalent cations on fluorescence signal of free MBA in solution.
Increasing concentrations of divalent cations (CaCl2 and MgCl2) were added
to a solution of MBA (75nM) in the standard fluorescence quenching assay
buffer and the fluorescence signals were measured.

concentration, the extent of quenching was comparable to that obtained with an excess of

PDGF-BB. The results were not surprising since divalent cations stabilize secondary

structures in DNA molecules and would thus shift the equilibrium to a closed

conformation of the MBA.Monovalent cations sodium and potassium caused only a small

initial decrease in fluorescence intensity (Figure 2-8) and even at concentrations of more

than 50 mM the extent of quenching by the ions was less than 13% as compared to more

than 90% quenching obtained with a 4-fold molar excess (300 nM) of PDGF-BB in a

standard fluorescence quenching assay. Since typical combined concentrations ofNal

and K1+ in cell culture medium is between 150 mM to 160 mM, desalting columns can be

used to remove monovalent and divalent cations and prevent potential contributions

towards quenching of the probe.










1.2 1 K+ Na+





e 0.8



mo 0.6

-0.4






0 100 200 300 400 500 600

ion concentration (mM)

Figure 2-8. The effect of monovalent cations on fluorescence signal of free MBA in
solution. Increasing concentrations of monovalent cations (NaCl and KC1)
were added to a solution of MBA (75nM) in the standard fluorescence
quenching assay and the fluorescence signals were measured.

Selectivity of the MBA-Based Fluorescence Quenching Assay

Once the aptamer was selected and tested against PDGF for fluorescence

quenching on binding, the selectivity of the MBA was examined. We incubated 20 nM

MBA with 100 nM of either PDGF-BB or one of several extracellular proteins (bovine

serum albumin, hemoglobin, lactate dehydrogenase, lysozyme, myoglobin, and thrombin)

or unrelated growth factors (such as epidermal growth factor and insulin-like growth

factor-1). The results shown in Figure 2-9 indicated that only pure human PDGF-

BB causes a marked reduction in fluorescence signal. All other proteins tested failed to

cause any significant change in fluorescence, even at 10-fold higher concentrations than

that used for PDGF-BB.













3 0.8

cn 0.6-

.= 0.14




-0.2







Figure 2-9. Binding selectivity of the MBA. Relative fluorescence signals of incubation
mixtures containing MBA (20 nM) and one of the following proteins (200
nM): bovine serum albumin (BSA), hemoglobin (HEM), lactate
dehydrogenase (LDH), lysozyme (LYZ), myoglobin (MYO), thrombin
(THR); or one of the growth factors, epidermal growth factor (EGF), basic
fibroblast growth factor (bFGF), insulin-like growth factor-1 (iGFl), or
PDGF-BB.

In a subsequent experiment, some of the previously tested biomolecules including,

growth factors (EGF), common proteins that are abundant in biological specimens

(thrombin, ovalbumin and serum albumin) and glycogen (an abundant natural

polysaccharide in tissues) were tested individually in a dose dependent manner. Dose-

response curves were obtained by incubating increasing amounts of each biomolecule in

a standard fluorescence quenching assay. The results are presented in Figures 2-10A and

2-10B. The small dose-dependent decrease in fluorescence due to thrombin and EGF

indicated a slight interaction with the MBA probe. In comparison to similar






41




BSA Ovalbumin = Glycogen


60000



gj40000



~20000

L.


5 10
biomolecule concentration (pig/mL)

A


60000


+ EGF m Thrombin PDGF-BB


~40000


2000
O'
LI.

Ocnn


50
protein concentration (nM)


Figure 2-10. Fluorescence quenching displayed by the MBA in response to increasing
concentrations of PDGF and other biomolecules. In a typical fluorescence
quenching assay containing MBA (75 nM) in Tris (pH 7.5, 20 nM) and NaCl
(20nM) as described in Materials and Methods, fluorescence signal was
measured following the addition of increasing concentrations of various
biomolecules: [A] BSA, ovalbumin, glycogen; and [B] PDGF-BB, epidermal
growth factor, thrombin.


]'5 *









concentrations of PDGF, the final extent of quenching was substantially lower than the

quenching observed for PDGF. Conversely, minor changes in fluorescence intensity were

observed for unrelated, commonly occurring biomolecules (bovine serum albumin,

ovalbumin and glycogen, up to 12 ug/mL). Since only PDGF was capable of producing a

large change in fluorescence signal in comparison to other proteins tested individually at

the respective concentrations, the assay should be selective and sensitive for PDGF

detection in the presence of other proteins commonly found in biological specimens.

Fluorescence Quenching Assay Distinguishes Molecular Variants of PDGF

Green et al. reported that the PDGF aptamers selected for binding to PDGF-BB

by using isotropic labeling bound to three molecular variants of PDGF (Figure 2-11i),

namely BB, AB, and AA, albeit with different affinities, presumably because of the

amino acid sequence homology (60%) between the A and the B chains. We tested the

three common PDGF variants for their effects on the fluorescence quenching assay.

Serial dilutions of each protein were incubated with 10 nM MBA in binding buffer and

the dose-response curves for fluorescence quenching were compared. Parallel sets of

experiments were conducted with varying amounts of the MBA. The calibration curves

obtained with 10 nM MBA are shown in Figure 2-12.

The results presented in Figure 2-12 indicated that the slopes and the concentration

of protein required to attain 50% of the maximum quenching are distinct for the three

molecular variants of PDGF. Although this data indicates that the MBA response shown

for PDGF-AB is more similar to that for PDGF-BB (in comparison to the response for

PDGF-AA), the difference between PDGF-AB and PDGF-BB is much more easily

distinguishable than that reported method.47










AA AS


Figure 2-11. Cartoon representing PDGF-BB and its molecular variants (PDGF-AA and
PDGF-AB) and its receptors alpha (a) and beta (P).


350000
Denatured PDGF

~v280000 *I

S210000

140000 A
9 a ". .PDGF-AA
70000
E PDG-BB DGF-AB

0 5 10 15 20 25 30
PDGF (nM)

Figure 2-12. Dose-response curves of PDGF variants: fluorescence signals of MBA for
PDGF-AA (A), PDGF-AB (m), PDGF-BB (*), and denatured PDGF-BB (+).
The concentration of the MBA was 10 nM.

When PDGF-BB is reduced by dithiothreitol and denatured with sodium dodecyl

sulfate, the resulting protein fails to cause any fluorescence quenching. Also, based on the

slopes of the linear portion of the serial dilution curves it is clear that the binding affinity

of each isoform is different for the aptamer probe. The results collectively indicated that

the fluorescence quenching assay is not merely dependent on the primary sequence of the










protein chains, but is capable of distinguishing conformational characteristics or the

folding of highly related protein molecules.

Conclusions

For the development of a molecular beacon aptamer probe that will successfully

report the binding event to a target protein in a single step, a signal transduction

mechanism must be incorporated into the recognition molecule. Theoretical calculations

using commercially available software showed that when the selected aptamers for PDGF

are free in homogeneous solution, one possible conformation was the spatial separation

of the 5' and 3' end.53;54 Taking advantage of the inherent structural properties of the

aptamer, a distance dependent signal transduction mechanism, such as FRET, was

incorporated to create a probe for the detection and study of PDGF-BB. Once the aptamer

binds PDGF-BB, the distance between the ends of the aptamer molecule was reduced,

resulting in the formation of a 6-base long stem.

Also, the results obtained with varying incubation conditions described, in this

chapter, support the notion that MBA-based FRET may be used in assays for protein

detection in biological specimens since the FRET assay is effective at physiological pH

and temperature. Divalent cations show interference with the assay by causing quenching

in the absence of PDGF target probably due to a stabilizing effect on the stem of the

probe. The results offer us new insights into, and justify the need for, future development

and optimization of this one step MBA-based FRET assay. It was also demonstrated that

three highly related molecular variants of PDGF (AA, AB, and BB dimers) can be

distinguished from one another. In comparison to ELISA, the quenching assay developed

is less sensitive, detection limits are higher, and has a higher throughput. Also, based on

product literature and experimental controls for the ELISA assay, cross reactivity of the









PDGF-BB antibody is prevalent for the AA isoform, which is often the case for antibody

assays. As a result, depending on the information and degree of scrutiny needed from a

given experiment one method may be preferred over the other.

The use of fluorescence quenching as a measure of binding between the aptamer

probe and the target protein eliminates the potential false signals that may arise in

traditional fluorescence enhancement assays as a result of degradation of the aptamer by

contaminating nucleases. Utilizing the conformational change of the aptamer to signal

protein binding may be applied to essentially all proteins, especially those that do not

naturally bind to DNA. Finally, other DNA aptamers with desirable selectivities for

chosen target proteins can be synthesized and coupled to different fluorophore-quencher

combinations to allow simultaneous detection of multiple target proteins in the same

solution at different excitation/emission wavelengths or, conversely, a multiple-well

microtiter plate can be used for many distinct samples for monitoring the same protein.















CHAPTER 3
IMPLICATIONS OF USING A MBA INT A FRET BASED AS SAY FOR PDGF
STUDIES INT BIOLOGICAL SAMPLES

Introduction

The development of a bioanalytical method includes the characterization of all

procedures and parameters that demonstrate that a particular method can be used for

quantitative measurements of analytes (in this case PDGF). The performance

characteristics of the method should be suitable, reproducible and reliable for the

intended analytical applications. In the previous chapter, detailed characterization

experiments revealed that the developed MBA can detect nanomolar amounts of PDGF in

a homogeneous solution, and that the optimal conditions for the MBA-PDGF complex

formation are compatible with the conditions typically found in a biological sample. The

next step in the development of the MBA-based bioassay will be focused on the

implications of using this aptamer probe to study and detect PDGF in cellular samples.

The aptamer selected for PDGF, was reported to have a 700 fold higher affinity for

PDGF versus other random oligonucleotide sequences.47 This characteristic is especially

important for the detection of PDGF in the presence of a complex biological sample.

Nonetheless, in a biological sample such as cell culture medium, many other species may

be present that could potentially interfere with the binding and the subsequent monitoring

of the fluorescence change on binding. It has been reported, that PDGF and PDGF-like

growth factors can be over-expressed and secreted into the media of various types of

cancer cells; including MCF-7,46MDA-MB-23 1,5o and, PC3 cancer cell lines.59;60 In










addition to PDGF, high levels of other proteins typically encountered in cell cultures may

non-specifieally bind to the probe, induce conformational changes, and as result produce

false positive quenching. Also, many species in biological samples may present optical

interference for fluorescence measurements, due to absorption and auto-fluorescence.

The above issues and others need to be carefully considered and explored before

attributing the total signal change solely to PDGF binding. As a result, two directions

were concurrently taken. One specifically designed to address non-specific interactions of

the aptamer and the other addresses signal differentiation of PDGF responses and cellular

interference.

This chapter will be aimed towards the determination of the robustness of the

fluorescence quenching assay against other species present in the biological samples.

Specifically, the incorporation of sample processing prior to carrying out the assay to

remove potential biological interference was investigated to minimize the effect of the

factors mentioned above. The first part will include studies with simulated biological

samples containing PDGF. For the second part, cancer cell conditioned media will be

used in the first attempt to detect PDGF in biological samples using a MBA.

Materials and Methods

Instrumentation

Fluorescence was monitored using a Fluorolog-Tau-3 spectrofluorometer (Jobin

Yvon Inc., Edison, NY). The sample cell was a 100 Cll cuvette (Starna Cells, Atascadero,

CA). The fluorescence emission of 6-FAM was monitored at the excitation maximum,

480 nm, and the fluorescence intensity was measured at the emission maximum, 520 nm.

Both excitation and emission slits were varied to yield the best signals. For high

throughput format assay, a Tecan Saphire (Durhan, NC) fluorescence microplate reader









was used with 96-well flat bottom microtiter plates (Nalge Nunc International, Rochester,

NY). All absorbance measurements were carried out in a Cary 300 UV-Vis

spectrophotometer (Varian, Palo Alto, CA).

Preparation of a Simulated Biological Sample

A simulated biological sample (SBS) was prepared by combining Dulbeccos

Modified Eagle's Medium (DMEM, Mediatech, Hendon,VA) with serum proteins from

fetal bovine serum(Invitrogen, Carlsbad, CA). SBS will be used as an intermediate

between a homogeneous solution and a complex biological specimen, such as cell culture

media, to investigate the applicability of using MBAs for protein detection. Total protein

content was determined using the Bradford Protein Assay Kit61 (Biorad, Hercules, CA).

Cell Culture and Preparation of Conditioned Media

The cell lines used were human breast carcinoma MDA-MB-231, and murine

BALB/c-3T3 fibroblasts (American Type Culture Collection,Manassas, VA), were grown

in DMEM supplemented with 1 % Gentamicin (Sigma, Saint Louis,MI) and either 10 %

fetal bovine serum for MDA-MB-231 or 10 % calf serum (Invitrogen,Carlsbad,CA) for

BALB/c-3T3. Prostate cancer cells, PC-3(American Type Culture Collection,

Manassas,VA), were grown in R12K medium (American Type Culture Collection,

Manassas,VA) supplemented with 10 % fetal bovine serum and 1 % Gentamicin. The

cells were incubated in humidified air containing 5 % CO2 at 370C. For the collection of

serum-free conditioned media, the culture medium of confluent cultures was replaced

with serum-free DMEM when the cell monolayers reached 80-90 % confluence. After

approximately 60 minutes, the medium was replaced with fresh serum-free DMEM and

the cells were incubated for an additional 24 hours. The serum-free CM was collected

and clarified by centrifugation. Acetic acid was added to the supernatant to a final









concentration of 0. 1 M and the material was lyophilized. The lyophilized powder was

resuspended in 0.1 M acetic acid, clarified by centrifugation at high speed in a microfuge

for 5 minutes, and the supernatant containing the soluble proteins was subj ected to size

exclusion chromatography utilizing a NAP-5 (Amersham Biosciences, Piscataway, NJ)

column packed with Sephadex G-25 in 0.1 M acetic acid. The excluded volume fractions

with the highest absorbance at 280 nM were collected and lyophilized again. The protein

preparation was resuspended in binding buffer (Chapter 2) to maintain appropriate pH

conditions and used as the stock solution from which dilutions were made for incubation

in the fluorescence assay.

Results and Discussion

Use of MBA in Biological Sample

A SB S sample was used to determine the potential application of this one-step

fluorescence-quenching assay for PDGF-BB detection in the presence of low levels of

serum proteins. In the first case, the sample was lyophilized and split in two equal

portions, one of which (Sa) was additionally supplemented with 100 nM recombinant

human PDGF-BB (the other was labeled Sb and did not contained PDGF). Each portion

(Sa and Sb) was resuspended in 0.1M acetic acid and the protein components were

collected using a gel filtration column packed with Sephadex G-25 to remove salts and

small molecules. As was mentioned on Chapter 2, high levels of monovalent and divalent

cations resulted in background quenching and need to be removed prior analysis.

Fluorescence quenching activity of the two preparations was compared by adding 50 nM

MBA. As shown in Figure 3-la, Sa caused a marked reduction in fluorescence,

comparable to that observed with pure human PDGF-BB (see Figure 2-4A), and Sb

caused a small fluorescence decrease.33 Analytical denaturing and reducing










polyacrylamide gel electrophoresis of Sa and Sb showed that the low protein

compositions of the two samples were indistinguishable from each other, which may

indicate that the differences in fluorescence quenching presented by both samples was

due to the PDGF-induced conformational change. Nonetheless, 20 % of quenching in the

nonspiked sample may indicate nonspecific binding of other proteins in the sample. It

is conceivable that as a result of binding to the MBA a reduced fluorescence is observed

from the sample, as seen in Chapter 2 for thrombin and EGF. The results do, however,

demonstrate that, when in the presence of similar total protein concentrations, the MBA

has the potential to qualitatively distinguish the presence of nanomolar quantities of

PDGF-BB in SBS.

The next sample to be examined for PDGF detection was conditioned media from

cultured cells. Conditioned media (CM) is a general term to describe media in which cells

have been cultivated for a period of time. It contains many mediator substances that were

secreted by the cells which were produced in this medium. The mediator substances

contain growth factors, such as PDGF, and may promote the growth of new cells. A

human breast carcinoma cell line, MDA-MB-231, has been reported to secrete PDGF-BB

in culture medium.'" Serum-free CM was collected from human HTB cells and normal

murine BALB/3 T3 fibroblast cells in culture. The samples were collected and processed

as described in Materials and Methods and serial dilutions of protein preparations from

each cell line were incubated with a fixed amount of the MBA and fluorescence

measurements were obtained to construct a dose-response curve. Parallel sets of dose-

response curves were obtained by using different amounts of the MBA for each such set.
































HTB cells



BALB cells






PDGF serial dilutionl
i M~~ralilegn


300000




S200000


o 1000


O C~


MB~A


MBA+Sa


M/BA+Sb


350000

300000

250000 -

200000

150000

100000


50000

0


Log Vd ------


Figure 3-1. Use of molecular beacon aptamer in biological samples.(A) Fluorescence
signals of incubation mixtures of MBA (50 nM) with serum proteins without
(Sb) or supplemented with (Sa) PDGF-BB, as compared to the MBA alone.
(B) Dose-response curves/calibration curves for conditioned media and PDGF
standard samples: fluorescence signals of mixtures of MBA (10 nM) with
serial dilutions of protein preparations of conditioned cell media from HTB
cells (triangles) or BALB cells (squares). Serial dilutions of a 500 nM solution
of PDGF-BB (circles) were used as a control. Vd is the dilution factor.33









For each set, a control dose-response curve for fluorescence quenching was obtained with

serial dilutions of a solution of pure human PDGF-BB. The results obtained with 10 nM

MBA are presented in Figure 3-1B.33 Typically, several factors may indicate the presence

of PDGF or PDGF-like molecules when the dose-response curves from the CM samples

are compared with the one obtained using standard PDGF-BB. The factors include a

concentration-dependent fluorescence intensity decrease, the similarity of the slope, and

the final extent of quenching. For HTB conditioned media, the final extent of quenching

as well as the dose-dependent decrease in fluorescence is comparable to the standard

PDGF-BB .

In the case of BALB conditioned media, the final extent of quenching is lower than the

one obtained with HTB cells and standard PDGF-BB. It is important to mention here that

initially BALB cells were selected as a negative control since it has not been reported that

this particular cell line over-expresses PDGF. The observation that serial dilutions of

BALB conditioned media produced a dose dependent quenching in some way similar to

the standard PDGF-BB reveals that this cell line may have measurable levels of PDGF

(or PDGF-like molecules) or high levels of interfering proteins that bind non-specifically

to PDGF and produce a conformational change of the MBA. Although the final extent of

quenching for both samples was different indicating that the total amount of PDGF is

different in each case, the use of MBA for PDGF quantitation and detection in cancer cell

media samples may not be reliable due to the presence of interfering species in the

biological environment that may lead to false positive results. An additional contribution

to the change in fluorescence intensity may be due to filtering effects in the conditioned

media that masked the true fluorescence signal.









Implications of Total Protein Content on the MBA Assay

The MBA appear to have the ability to qualitatively discriminate between cellular

samples that contain PDGF; however, in order to verify the reliability of the results, the

potential interfering compounds that could exist within cellular samples needs to be

explored. For protein assay development, it is critical to determine the tolerable amount

of protein that would allow a reliable fluorescence measurement. Protein aggregation and

non-specific protein binding may have significant implications in the formation of the

MBA-PDGF complex.

Two samples of protein mixtures containing a total of 10 Clg/mL and 100 Clg/mL

were prepared in binding buffer to study solely the protein effect on the MBA binding by

combining the following representative biomolecules: bovine serum albumin, albumin,

ovalbumin, lyzozime, glycogen, myoglobin, thrombin and a few growth factors

including: insulin-like growth factor (IGF), epidermal growth factor (EGF) and vascular

endothelial growth factor (VEGF).

In the first case, a solution containing 10 Clg/mL of total protein was incubated with

50 nM of MBA in binding buffer and compared with a solution of 10 Clg/mL of pure

PDGF-BB incubated with 50 nM MBA. The results presented in Figure 3-2 revealed that

10 Clg/ml of a protein mixture was capable of causing a 17 % quenching of the MBA.

PDGF was added to the sample the fluorescence intensity drastically decreased, up to

96 %, indicating that PDGF is necessary for a complete quenching of the MBA at this

protein concentration. In a separate experiment, the total protein content of the sample

was increased by an order of magnitude. With 100 Clg/mL in the sample, 76 % of the










700

600

500

g 400

S 300

S200

0 100


MBA 10 ug/mL 10 ug/mL 100 ug/mL 100 ug/mL
PDGF-BB serum serum serum
proteins proteins proteins and
PDGF-BB

Figure 3-2. Molecular beacon aptamer fluorescence quenching caused by a protein
mixtures containing 10 Clg/mL.

fluorescence of the MBA is quenched indicating that non-specific binding may be

responsible for the decrease in fluorescence intensity. Nonetheless, the addition of 10

Clg/mL of pure PDGF-BB in the solution further reduces the fluorescence intensity of the

aptamer probe.

Based on the above results, a plausible explanation for the observed fluorescence

quenching in cellular samples is non-specific binding. Thus, the dose dependent

fluorescence decrease observed in cellular samples can not only be attributed to the

presence of PDGF but to a combination of specific and nonspecific binding of proteins to

the aptamer probe. Another alternative includes that the the MBA may be recognizing

similar binding sites in other growth factors that may have a degree of identity with

PDGF. In order to be able to use the PDGF aptamer in an assay for protein detection,

alternative strategies for sample clean-up before analysis needed to be developed.










Sample Pre-Treatment

The development of recognition molecules for any type of assay should be

experimentally convenient, sensitive and easy to perform in a short period of time. The

developed MBA meets the characteristics for homogeneous solution analysis.

Unfortunately, the response of the aptamer may be compromised by the presence of

excess proteins in solution. Having the protein of interest in a biological environment is

somewhat difficult for reliable detection by DNA-based methods. Based on the data

presented in the last section, a mixture with total protein content higher than 100 Clg/mL

in a 50 nM MBA solution may lead to false positive results due to non-specific binding.

For this reason, the protein of interest needed to be isolated or the sample itself needs to

be partially cleaned-up in order to obtain more reliable results. The ability to study

proteins in mixtures with complete control of their environment (salts, temperature, pH,

total protein content, etc.) is critical for the development of an in vitro assay using the

PDGF-MBA.

To simplify the sample before analysis, one must begin with the starting material

(in this case cellular CM) and fractionate it using any one of a large number of physical

or biochemical approaches: centrifugation, solid precipitation, binding to affinity

columns or separation by sizing columns (gel filtration chromatography). In this case,

size exclusion chromatography was used. After the cell medium was collected, clarified

by centrifugation and lyophilized, it was run through a commercial NAP-5 or in a G-100

column to desalt the samples and remove low molecular weight protein components. In

gel filtration chromatography, the stationary phase consists of porous beads with a well-

defined range of pore sizes. The stationary phase for gel filtration is said to have a









fractionation range, meaning that molecules within that molecular weight range can be

separated. Proteins that are small enough can fit inside all the pores in the beads and are

said to be included. The small proteins have access to the mobile phase inside the beads

as well as the mobile phase between beads and elute last in a gel filtration separation.

Proteins that are too large to fit inside any of the pores are said to be excluded. They have

access only to the mobile phase between the beads and, therefore, elute first. Proteins of

intermediate size are partially included meaning they can fit inside some but not all of

the pores in the beads. The proteins will then elute between the large ("excluded") and

small ("totally included") proteins. For our experiments we tested two different packing

materials: Sephadex G-25 (PDGF will be included in the pores) and Sephadex G-100

(PDGF will be excluded from the pores).

A control SBS was prepared to mimic conditioned media collected from tissue

cultured cells that are commonly used to study the expression of proteins by normal and

deceased cells. The sample contained DMEM supplemented with serum proteins and no

PDGF-BB. It was processed by lyophilization to reduce the volume, diluted to 1 mL with

0.1 M acetic acid, loaded into a NAP-5 column equilibrated with acetic acid, and

collected at 0.5 mL fractions with 0.1 M acetic acid running buffer. After lyophilization

and reconstitution in the binding buffer, each fraction was analyzed using the standard

fluorescence quenching assay. Each fraction contained ~16.5 Clg/ml on average of serum

proteins, as calculated with the Bradford assay. The results for the control SBM (Figure

3-3 A) showed that Fractions 6 to 16 caused different extents of quenching even though

PDGF-BB had not been added.










50000

40000 -


~30000

~20000

10000



2 4 6 10 12 14 16 MBA
Fraction number

A


60000




S40000




S 20000






MBA Fraction 12 50 ng PDGF 250 ng PDGF


B
Figure 3-3. Fluorescence quenching caused by PDGF in the presence of proteins in a
simulated biological specimen. Protein fractions were obtained from a
Sephadex G-25 gel filtration of acetic acid soluble materials in a simulated
biological specimen as described in Materials and Methods and each fraction
was resuspended in 130 ul of a stock buffer Tris (pH 7.5, 10mM) with NaCl
(20 mM). (A) 65 ul of each fraction indicated on the X-axis was incubated in a
standard fluorescence quenching assay (final volume 100 ul) with the MBA
(75nM) and the resulting fluorescence was measured. (B) Indicated amounts
of PDGF-BB were added to a dilution of Fraction 12 with serum-derived
proteins and incubated in a standard fluorescence quenching assay.62









Based on repeated experiments conducted with PDGF-BB in buffer solution, it was

determined that fractions 11 to 13 should contain PDGF-BB if added to the control SBS.

Given that in fraction 6 there is ~50% quenching without the presence of PDGF-BB, gel

filtration does appear to minimize the interference by removing them from the PDGF-

BB containing factions. To investigate this possibility and establish the limit of detection

for the PDGF assay in the presence of serum proteins, varying amounts of PDGF-BB

were added to fraction 12 of the control SBS. The results (Figure 3-3 B) showed a

detectable decrease in fluorescence on the addition of as low as 50 ng of PDGF-BB.62

This data shows that the current assay can detect as little as 50ng/16.5 Clg of serum

proteins. This leads us to believe that for 1VBA applications to be effective in biological

samples the model system chosen for any protein of interest, should adequately express

the protein at high enough levels to allow for the detection of the target in the presence of

typical amounts of serum proteins.

We further tested the reliability and effective range of operation for the

fluorescence quenching assay by trying to improve the sample clean-up procedure using a

Sephadex G-100 gel filtration column. For the G-100 packing material, the solid phase

has larger pores and, as a result, retains PDGF in the column longer. This property should

improve the exclusion of interfering impurities from PDGF containing fractions. Also, a

direct comparison between an ELISA analysis and IVBA assay was conducted. The

ELISA not only allowed for the identification of the distinct fractions for which PDGF

was eluted, but also, enabled us to compare the quenching results with the PDGF-BB

responses in the presence of serum proteins. For the next experiment, a buffer sample

containing only 50 Clg/mL PDGF was used. A Sephadex G-100 gel filtration column was









equilibrated with 0.1 M acetic acid and the sample loaded. Then, 0.5 mL fractions were

collected as the sample was eluted. To determine the fraction(s) that contained PDGF-

BB, each one of the collected 0.5 mL fractions was tested using a commercial ELISA kit

and PDGF was found in fractions 19 to 22. Using this information, we ran a SBS spiked

with PDGF-BB in the Sephadex G-100 gel-fi1tration column and tested fractions 11 to 25

with the fluorescence quenching assay. Similar to the previous results obtained with the

NAP-5 column (Figure 3-3A), several fractions exhibited different degrees of quenching

when analyzed with the fluorescence quenching assay (Figure 3-4). The quenching assay

indicated a significant amount of quenching in the fractions 17 to 22 after a 2-fold

dilution of the original sample which was required for assay analysis. To determine the

amount of PDGF in each fraction of the spiked SBS sample, fractions 7 to 18, 19 to 20,

and 21 to 22 were pooled and analyzed using ELISA. PDGF-BB was found in samples 19

to 22 as expected based on the spiked ELISA experiments (Table 3-1). Even though

fractions 17 to 18 did not contain PDGF-BB based on the ELISA experiment, a large

degree of quenching was still observed for the IVBA assay. The results further suggest

the need for sample pre-treatment in order to minimize the interfering proteins such as

those found in fractions 17 to 18.

Unfortunately, it is still not understood as to whether the amount of quenching is

due to PDGF versus non-specifie binding to the probe. Interestingly, it was also observed

that when the total protein concentration in individual fractions that did not contain

PDGF from the two gel-fi1tration columns studied here was higher, the extent of

quenching was higher. This finding points out the possibility that dilutions could be










performed to minimize the extent of perceived interference. A control sample that did

not contain PDGF was made and processed as before.

No PDGF was found in fractions 19-22 using ELISA. Since fractions 21-22

contained the highest amount of PDGF-BB, a side-by-side comparison of the PDGF and

non-PDGF containing fractions was conducted with the MBA assay (Figure 3-5).

Table 3-1. Analysis for PDGF-BB spiked samples after fractionation on a G-100
Sephadex column using enzyme-linked immunosorbent assay (ELISA)
Eluted Fraction # I g/mL PDGF
7-18 0.8
19-20 2.4
21-22 3.0


50000-

S40000

S30000

S20000



S10000





fraction number

Figure 3-4. Fluorescence intensity of fractions of simulated biological sample (SB S)
collected from G-100 column. Each fraction was 0.5 mL. After lyophilization
samples were resuspended in binding buffer for the fluorescecence quenching
assay. MBA concentration was 50 nM.

Both fractions were adjusted to the same total protein concentration and the

fluorescence quenching was monitored with the MBA assay. As shown in figure 3-5, the

measured florescence intensity of the combined fractions spiked with PDGF-BB was

more than the un-spiked control. As the dilution factor increases, the corresponding










fluorescence intensities increased for both samples. This indicated that the cause of

quenching in the control sample was capable of being diluted. To determine if PDGF

could interact with the aptamer to cause complete quenching of the probe in the samples,

an excess of PDGF-BB (250 ng) was spiked into the control samples after processing.

The aptamer appeared to respond and bind to this addition of PDGF even in the presence

of the serum proteins regardless of the dilution factor. The results were consistent with

the above results and told us that with dilutions and gel-filtration PDGF-BB could be

monitored in the presence of serum proteins. The amount required to obtain full

quenching of the probe would, however, be significant considering the sample would

need to be diluted. Upon a 4-fold dilution of the total proteins, the aptamer appeared to be

unaffected by the serum proteins and capable of distinguishing between the control

sample with and without PDGF.

Spiked with pdgf-bb H no pdgf-bb added O pdgf-bb added to spl 21
50000


S40000


S30000


S20000


~10000


O -
2 fold 4 fold 6 fold 8 fold 10 fold buffer MBA MBA +
PDGF

Figure 3-5. Fluorescence intensity of dilutions of SBS. Green columns represent fraction
spiked with an additional 200 nM PDGF-BB post processing. MBA
concentration is 50 nM.









Conclusions

The results presented in this chapter were used to explore the applicability of the

PDGF-MBA probe to monitor PDGF secretion from cancer cells in cell media. Initially,

the assay showed the ability to detect PDGF in spiked biological samples containing low

levels of serum proteins. The conditioned media from two cell lines, which express

different levels of PDGF, was analyzed with the assay. For HTB conditioned media, the

final extent of quenching as well as the dose-dependent decrease in fluorescence

illustrated a noticeable increase in the PDGF concentration in comparison to the BALB

conditioned media. The MBA appeared to have the ability to qualitatively discriminate

between cellular samples that contain PDGF; however, higher levels of serum proteins

may result in false positive quenching. Simple size exclusion chromatography allowed

for more reliable results to be obtained and showed that 50 ng of PDGF could be detected

in the presence of ~16.5 Clg/mL of serum proteins. Further improvements in the sample

processing could be explored; however, signal differential methodologies could provide

more reliable results.















CHAPTER 4
LIGHT SWITCHING APTAMER PROBE FOR PLATELET DERIVED GROWTH
FACTOR USINTG RATIOMETRIC AND TIME-RESOLVED FLUORESCENCE
MEASUREMENTS

Introduction

Fluorescent techniques offer excellent choices as signal transduction mechanisms

to report binding events because most samples remain intact under normal excitation

conditions and the sensitivity afforded by fluorescence detection. Fluorescence resonance

energy transfer (FRET),40;62-64 anisotropy 25;33and lifetime-based measurements are

examples of some fluorescent methods that, combined with a selected aptamer sequence,

can be used for bioassay development. All signal transduction techniques have their

individual strengths for different experimental needs. Nonetheless, FRET and anisotropy

suffer from some limitations that could hamper their effective applications in complex

biological samples. For instance, although fluorescence anisotropy only requires singly

labeling of one dye molecule on each aptamer sequence, it entails non-standard

instrumentation and data interpretation. FRET or fluorescence quenching based probes

quantify target concentrations with changes in fluorescence intensity, but the two

methods are sensitive to the solution environment and protein content as was showed in

the last chapter. More importantly, depending on the selection of fluorophores, directly

applying them to biological samples in their native environments may be difficult due to

fluorescence interference.

The maj or goal of the experiments discussed in this chapter was to explore the

possibility of designing a DNA probe that has the ability to differentiate between PDGF










responses and the biological background responses. Typically, protein analysis in their

native environments has two significant contributors to background signals. The first one

is the probe itself. For example, in a quenching based FRET molecular probe for protein

studies, the probe may suffer from incomplete quenching, resulting in significant

background. Moreover, in a native biological environment, there are many potential

sources for non-specific quenching of the probe as discussed in the previous chapter. This

greatly limits exploring the full potential of FRET-based MBAs for protein detection.

Concurrent with the experiments presented in this chapter, the effect of extracellular

proteins in cellular samples was also addressed in Chapter 3 and a sample processing

procedure to aid in the removal of most interfering proteins. Nonetheless, the effect of

background signal from auto-fluorescing components of the cell media still needed to be

investigated. Several molecular species exist in a biological environment, some of which

will yield a strong fluorescence background signal when light is applied to the dye

molecules. If the auto-fluorescence intensity of some of the cell media components is

comparable to or larger than the fluorescence intensity of the fluorescence of the MBA,

the fluorescence quenching becomes masked and the analysis of the fluorescence signals

becomes difficult. Great efforts have been made to solve this problem 65; however,

effective solutions are limited. The interesting spectroscopic properties of pyrene will be

employed and combined with time-resolved measurements as an alternative approach to

FRET. 34;66-68

Photophysics of Pyrene Excimers

Pyrene is a four-ringed polycyclic aromatic hydrocarbon (PAH) that gives

monomers and excimer emissions depending on its concentration. An excimer is a









dimmer which is associative in an electronic excited state and dissociative in its ground

state. The pyrene excimer was the first species of this type to be discovered.69;70








Figure 4-1. The chemical structure of pyrene

The formation of a pyrene excimer requires an electronically excited pyrene

encountering with a second pyrene in its ground electronic state. The excimer

fluorescence of pyrene can be described by the following equilibrium:

M* +M ++D*

Molecular absorption occurs to produce an excited monomer (M*), which then

interacts with its neighbor (M) to form the excimer (D*). When excimer formation takes

place in any given pyrene-containing system, it can be easily monitored by a steady-state

fluorescence spectrum: the broad, featureless emission centered at 480 to 500 nm is

extremely easy to recognize, even when extensive monomer emission occurs; since the

monomer fluorescence takes place in the 380 to 400 nm wavelength range.67

Another good example of a dye that exhibits the excimer phenomena is BODIPY,

whose monomer emits at 520 nm, and excimer has emission of 620 nm.71;72 The

formation of the excimer is useful to probe spatial arrangement of some molecules.

Similar to FRET, the distance dependent property of excimer can be used as a unique

signal transduction in the development of aptamer-based probes that change their

secondary structures on binding of its target, such as the aptamers selected against,

PDGF,33;62;63 COcaine,73thrombin,39;74 and HIV1 Tat protein. 5The emission wavelength










switching property solves the background signal problem that occurs with FRET

molecular probes. This finding encouraged us to apply the use of pyrene molecules in a

new aptamer probe design to develop oligonucleotide probes.

Time-Resolved Measurements

Time-resolved fluorescence spectroscopy is a well-established technique for

studying the emission dynamics of fluorescent molecules, i.e. the distribution of times

between the electronic excitation of a fluorophore and the radiative decay of the electron

from the excited stated producing an emitted photon. The temporal extent of this

distribution is referred to as the fluorescence lifetime of the molecule. This technique is

widely used in fluorescence spectroscopy because it often contains more information than

is available from steady-state data. With steady-state measurements some of the

molecular information is lost during the averaging process. Many macromolecules can

exist in more than a single conformation and the decay time of a bound probe may

depend on the conformation. The intensity decay may reveal two different decay times

indicating the presence of more than one conformational state. The steady state intensity

will only reveal an average intensity dependent on a weighted average of two decay

times. There are additional reasons for using time-resolved experiments. For example, in

the presence of energy transfer, the intensity decays may reveal how acceptors are

distributed in space around the donors. Also, time resolved measurements reveal whether

quenching is due to diffusion or to complex formation with the ground state fluorophores.

In fluorescence, much of the molecular information content is available only from the

time-resolved measurements.34

Fluorescence decay kinetics gives a complete picture of the fluorophore and its

interactions within the microenvironment. Complex intermolecular interactions can be









revealed by lifetime measurements made across an emission spectrum which has little

structure. Time correlated single photon counting (TCSPC) is a commonly used method

for the detection of the fluorescence lifetimes. TCSPC is a digital counting technique that

relies on the concept that the probability distribution for emission of a single photon after

an excitation event yields the actual intensity against time distribution of all the photons

emitted as a result of excitation. By sampling the single photon emission following a

large number of excitation flashes, the probability distribution can be constructed.

As a result of the above spectroscopic properties afforded by lifetime

measurements together with the use of a pyrene-based aptamer probe, it was of interest to

evaluate its potential for use with biological samples. Both steady-state and time-resolved

fluorescence measurements were conducted to provide in vitro monitoring of biological

samples with MBAs. In this approach, the MBA was labeled with pyrene molecules,

similar to what has been reported in using pyrene for molecular beacons.66 The optical

properties of pyrene were exploited, including that with the same excitation, the excimer

emitted at a longer wavelength than that for the monomer.

Although excimer formation is a very attractive characteristic of pyrene for protein

detection in solution, the excimer phenomena alone can not solve the problem of signal

from the multiple species in the biological environment. One feature of the pyrene

excimer is that it has a long lifetime67 COmpared with other potential fluorescent species.

The lifetime of the pyrene excimer could be as long as 100 ns, while that for most of the

species that contribute to the biological background signal is shorter than 5 ns. This

property should allow the separation of the biological background signal from that of the

excimer signal using time-resolved fluorescent measurements.










Experimental Section

All the aptamer-based probes listed in Table 4-1 were synthesized in-house and

purified with RP-HPLC. Reagents for the synthesis of DNA were purchased from Glen

Research (Sterling,VA). The pyrene labeled aptamer used for this set of experiments,

Pyr-MBA, is a shorter version of the original 36t aptamer designed specifically to reduce

pyrene background emission due to the close proximity of the dye molecules at each end

of the probe. Since the stem sequence is not important for the high affinity binding to

PDGF-BB47, in Order to reduce the background emission, the stem was shortened

gradually to identify an aptamer sequence that was in fully open conformation in the

absence of target while reserving good binding affinity. All aptamers were labeled with

pyrene at both termini. SGL-MBA is single labeled with pyrene at its 5' end. SCR-MBA

is a 39-mer scramble oligonucleotide sequence with pyrene molecules at both ends.

Table 4-1. Pyrene-labeled oligonucleotide sequences used in this study
Sequence Name Seauence
Pyr-MBA Pyrene -AGGC TAC GGCAC GTAGAGCAT CAC CAT GATC CT -
Pyrene
SGL-MBA Pyrene-AGGC TAC GGCAC GTAGAGCAT CAC CAT GAT CC T
SCR-MBA Pyrene- GGAAC GTAAT CAAC TGGGAGAAT GTAAC TGAC TGC -
Prene

Pyrene butylic acid was purchased from Sigma (St Louis, MO). Recombinant

human PDGF-BB, PDGF-AB, PDGF-AA, and, TNF-oc were purchased from R&D

Systems (Minneapolis, MN) and dissolved in 4 mM HCI with 0.1% BSA and then diluted

in 20 mM Tris buffer (pH 7.5) before use. Other recombinant human growth factors,

including recombinant human epidermal growth (EGF) and insulin-like growth factor 1

(IGF-1), were from Roche (Indianapolis, IN). Bovine serum albumin (BSA), human

hemoglobin (HEM), horse myoglobin (MYO), chicken lysozyme (LYS), human ot-









thrombin (THR) and other chemicals were from Sigma. The binding buffer used for all

the characterization experiments was 20 mM Tris-HCI (pH 7.5) with 20 mM sodium

chloride.

To prepare a simulated biological sample (SBS), Dulbecco's Mofication of Eagle' s

Medium (DMEM) (Mediatech, Inc, Hendon, VA) was supplemented with fetal bovine

serum (Invitrogen, Carlsbad, CA) and used for the detection of PDGF in biological

samples.

Instruments

An ABI3400 DNA/RNA synthesizer (Applied Biosystems, Foster City, CA) was

used for DNA synthesis. Probe purification was performed with a ProStar HPLC (Varian,

Walnut Creek, CA) where a C18 column (Econosil, Su, 250x4.6 mm) from Alltech

(Deerfield, 1L) was used. UV-Vis measurements were performed with a Cary 300 UV-

Vis spectrophotometer (Varian, Palo Alto, CA).

Steady-state fluorescence measurements were performed on a Fluorolog-Tau-3

spectrofluorometer (Jobin Yvon, Inc., Edison, NJ). For emission spectra, 349 nm was

used for excitation. Time-resolved measurements were made with a single photon

counting instrument (OB900, Edinburgh Analytical Instrument), where a nitrogen flash

lamp was used as the excitation source (h=337 nm).

Synthesis and Purification of Pyrene Labeled MBA

Several methods have been reported for oligonucleotide labeling.66;76

Unfortunately, for dually labeling pyrene on both nucleic acid termini, the reported

procedures proceeded in low yields partially due to solubility incompatibility of pyrene

derivatives and oligonucleic acids. A new solid phase coupling method that allow multi-









labeling organic dyes to DNA sequences with coupling yields as high as 80 % was used

to synthesize all the pyrene labeled aptamers.n7

Results and Discussion

Light Switching Excimer Aptamer Probe Design

As a proof of principle, the excimer signaling approach was used to develop a

probe for PDGF-BB. An excimer switching aptamer probe was developed by labeling

both ends with pyrene molecules that can form excimers. When the dual-pyrene-labeled

aptamer probe is free in solution without the target protein, both pyrene molecules will be

spatially separated, based on the FRET experiments in Chapter 2, and only the monomer

emission peaks (at 375 nm and 398 nm) will be observed. The binding of the aptamer

probe to protein brings the pyrene molecules at 3' and 5' ends close together, allowing the

excimer to form. Thus, the emission peak around 485 nm will be observed. The change in

emission color serves as a rapid process for qualitation and the excimer fluorescence

intensity can be used for highly sensitive real-time quantitation of PDGF in homogeneous

solutions.







PDG F



Figure 4-2. Use of pyrene excimer to probe PDGF-BB. PDGF-BB aptamer was labeled
with pyrene molecule at both ends. The two pyrenes will be away from each
other because of the open structure of the aptamer. After binding to PDGF-
BB, the aptamer adapts a close conformation, bringing two pyrenes close to
each other. As a consequence, pyrene excimer forms and green light emits.







71


Light Switching Aptamer Probe for PDGF-BB Detection

A light switching aptamer probe, named Pyr-MBA (sequence shown in Table 4-1),

was prepared by labeling a 33-nucleotide sequence, a shorter version of the 36t MBA

with pyrene molecules at both 3' and 5' ends.47 Figure 4-3 shows the fluorescence

emission spectrum from a solution containing 100 nM of Pyr-MBA. Two emission peaks

at 375 and 398 nm corresponds to pyrene monomer emission. No significant excimer

emission was observed from this solution (Figure 4-3). Upon addition of 50 nM PDGF-

BB into the Pyr-MBA solution, an aptamer-protein target complex was formed leading to

a secondary structure where the 3' end sequence hybridizes to the 5' end sequence,

forming a stable stem. This stem brings both pyrene molecules together, resulting in

excimer emission at 485 nm (Figure 4-3).


450000~ Pyr-MBA
Pyr-MBA + PDGFBB
S400000-

S350000-
S300000-
250000-
4 200000-
S150000-
100000-
50000-

400 450 500 550 600
Wavelength (nm)


Figure 4-3. Fluorescence emission spectra of Pyr-MBA with and without PDGF-BB in
binding buffer.

As shown in Figure 4-3, protein-bound probe gives emission peaks, two monomer

peaks at 375 nm and 398 nm respectively, and excimer peak at 485 nm. This allows for

ratiometric measurements. By taking the intensity ratio of the excimer peak to either one









of the monomer peaks, one could effectively eliminate signal fluctuation and minimize

impact of environmental quenching on the accuracy of measurement. We further

explored excimer formation by designing two control DNA sequences, SGL-MBA and

SCR-MBA. The sequences were prepared to confirm that the observed excimer emission

was a result of the aptamer-protein binding. The first sequence SGL-MBA was the same

sequences of the Pyr-MBA aptamer labeled with pyrene at the 5' end. Green et al.

reported that PDGF-BB has two binding sites; the phenyalanine-84 residue in the B-

chain of PDGF forms a point of contact with a specific nucleotide residue in loop at the

helix junction of the selected aptamer However, the addition of PDGF-BB into the SGL-

MBA solution did not change the emission spectrum of the solution, indicating that two

pyrene molecules need to be in close proximity. This suggests that the distance between

adj acent molecules was not enough for the excimer formation and emission. This data

also showed that PDGF-BB itself has no measurable effect on the optical properties of

pyrene molecules.

The second sequence, SCR-MBA, is a random DNA sequence with its 3' and 5'

ends labeled with pyrene. This sequence was used as a control aptamer with no or low

affinity for PDGF-BB to demonstrate that the excimer emission is a direct result of the

formation of the Pyr-MBA/PDGF-BB complex. This dually labeled scramble sequence,

did not give any excimer emission after the addition of PDGF-BB. Both results indicated

that the excimer emission showed in Figure 4-3 was indeed from the aptamer

conformation change on specific binding to PDGF-BB.







73




2.4 -( .......................
2.2-g
2.0 --m- pyr-MBA
1.8- -*- SGL-MBA

E1.6- SCR-MBA

LL1.2-


S0.8- addition
-- ~ 6 0.61- ( D F
0.4-

0.2-
e 50 100 150 200
t (s)


Figure 4-4. Real-time response of excimer/monomer ratio. It showed that the binding of
PDGF-BB aptamer to PDGF-BB takes place within seconds. It affords a rapid
protein assay.

Sensitivity and Selectivity of the Probe

The dose-dependent excimer formation was determined to evaluate the sensitivity


of the pyrene-labeled aptamer probe (Figure 4-5). A linear response was observed with

the addition of increasing amounts of PDGF-BB in concentrations ranging from 0 to 40


nM. This result confirmed the formation of the excimer due to the spatial proximity of the


two pyrene molecules (and the appropriate geometrical arrangement required for excimer

emission) at the ends of the MBA. According to the measurements for blank samples, the

limit of detection was calculated an about 200 pM were consistently detected in


homogeneous solution. Moreover, the high sensitivity together with the emission

wavelength switching and detection without separation nature of this probe, enabled


detection of the presence of 40 nM PDGF-BB just with the naked eye (Figure 4-6). A

clear green color was observed when PDGF-BB was added to 100 nM of excimer probe

solution.





































360 380 400 420 440 460 480 500 520 540 560
Wavelength (nM)


- OnM
- 2nM
4nM
- 6nM
8 nM
-10nM
12nM
- 14nM
- 16nM
- 20 nM
- 24nM
- 30nM
- 35nM


400000

350000 1

300000 -

250000 1

200000-

150000 1

100000 -

50000 1

0-I


15 20 25 30 35 40


PDGF-BB (nM)




Figure 4-5. Dose-dependent excimer formation on additions of PDGF-BB to a Pyr-MBA.
A)in binding buffer, B)calibration curve.

















Figure 4-6. Visual detection of PDGF-BB. Solution of the 100 nM pyr-MBA under UV
light (left), and 100 ul of 100 nM pyr-MBA with 40 nM of PDGF-BB (right).

To detect PDGF-BB in the presence of other biomolecules the selectivity of the

pyr-MBA probe is critical. Similar to the FRET-based MBA, the pyrene labeled MBA

was mixed with excess extra-cellular proteins such as albumin, hemoglobin, myoglobin,

and lysozyme. Even at 10 times the PDGF-BB concentration, the proteins did not

produce significant changes in signal (Figure 4-7).




1 .0


.c 0.8-





S0.2





S0.0-
SLSM HMG MYG THR BSA PDGF BB

Figure 4-7. Response of excimer probe to different proteins. Concentration of PDGF-BB
was 50 nM, while the concentration of other proteins was ten times higher
(500 nM).

Furthermore, we tested the selectivity of the excimer probe for proteins and

peptides potentially coexisting with PDGF-BB in biological samples. The results showed

this shorter version of the original MBA probe retain its high selectivity for PDGF-BB in










homogeneous solution. The responses to epidermal growth factor (EGF), vascular

endothelial growth factor (VEGF), or insulin-like growth factor 1 (IGF-1) were minimal.

PDGF-AA and PDGF-AB, both of which have shown lower response to the aptamer

sequence in the FRET system, gave lower fluorescence-signal response in this case as well

(Figure 4-8).47



1.0-





v,0.6-





0- 0.2-


0.0-
EGF IGF VEGF PDGFAA PDGFAB PDGFBB


Figure 4-8. Response of 50 nM Pyr-MBA to 500 nM of different growth factors.

Bovine serum albumin (BSA) belongs to the class of serum proteins called

albumins, which make up about half of the protein in plasma and are the most stable and

soluble proteins in plasma. It is very common for laboratories developing immunoassays,

mostly due to its availability, solubility and the numerous functional groups present for

coupling to haptens. For PDGF-BB reconstitution, a buffer containing BSA as a carrier

protein was used and as result BSA will be present throughout. To rule out any possible

contribution of B SA to the measured fluorescence emission, increasing amounts of BSA

were incubated with the pyr-MBA. In this case, high concentrations of BSA did not alter










the optical properties of pyr-MBA; the measured excimer emission is negligible as can be

observed from the data presented in Figure 4-9.


20000
0.1 mg/mL
ar: 0.15 mg/mL
j 0.2 mg/mL
< 15000 -I;i 8 0.25 mg/mL
rz *Omg/mL


-10000 -



5000




375 425 475 525 575
Wavelength (nM)

Figure 4-9. Increasing amounts of BSA incubated with 50 nM Pyr-MBA.

Direct Quantitative Detection of PDGF-BB in Cell Medium

To be applicable for a potential bioassay development, the MBA probe must

tolerate interference typically present in a biological sample. In the previous chapter we

showed that when the MBA is incubated with a protein mixture containing high levels of

cellular proteins, false-positive quenching signals were obtained. On the other hand,

when the protein levels are monitored and adjusted to acceptable levels, the MBA binds

to PDGF-BB with high affinity and responds by a decrease in fluorescence intensity

attributable to the formation of the PDGF-BB-MBA complex. In this chapter, the

interference presented by autofluorescencing components in the media will be

investigated. For the purposes of simplicity and to investigate solely the effect of auto-

fluorescence cell media components, a simulated biological specimen (SBS) was made










by combining cell medium with low levels of serum proteins. Figure 4-10 shows the

spectra of 200 nM Pyr-MBA in a Tris-HCI buffer solution and cell medium (DMEM).


900000- 200 nM Pyr-MBA in buffer
80000-200 nM Pyr-MBA + 50 nM PDGFBB in buffer
200 nM Pyr-MBA in DMEM
S700000- DMEM
1 I \200 nM Pyr-MBA + 50 nM PDGF-BB in DMEM
S600000-

S500000-
S400000-
E 300000-
u- 200000-
100000-

350 400 450 500 550 600 650
Wavelength (nm)


Figure 4-10. Fluorescence spectra of simulated biological sample. (DMEM, 200 nM Pyr-
MBA in DMEM, 200 nM Pyr-MBA and 50 nM PDGF-BB in DMEM, 200
nM Pyr-MBA in Tris-HCI buffer, and 200 nM Pyr-MBA and 50 nM PDGF-
BB in Tris-HCI buffer)

In binding buffer, the MBA showed an intense excimer emission which was

observed when the target protein was added to the probe solution. Unfortunately, intense

background fluorescence, contributing from some species typically encountered in the

cell medium such as riboflavin, nicotinamide, pyridoxine, tryptophan, tyrosine as well as

phenol red, was observed, which masked the signal response from the probe and made it

indistinguishable. This result indicates that simple steady-state fluorescence

measurements are questionable for direct detection of PDGF-BB in a biological sample.

As mentioned before, the MBA labeled with pyrene molecules not only has the

excimer formation capability but also the advantage of a long fluorescence lifetime. Most

of the background fluorescence has a lifetime of less than a few nanoseconds(~10 ns),

while the monomer and excimer emission of pyrene have much longer lifetimes. Since









we were interested in studying the possibility the pyrene molecules for signal

differentiation based on lifetime, the total amount of protein was maintained at acceptable

levels (~10 Clg/mL) for the PDGF-BB aptamer. Also, based on the steady state

fluorescence spectra (Figure 4-10) there is considerable background signals at this

concentration produced by SBS at the wavelength of interest which impede the ability for

pyrene to be useful in standard fluorescence measurements. Therefore, there is a need to

study this format by alternative fluorescence measurements and explore the potential of

using the lifetime characteristics of pyrene.

Time correlated single photon counting measurement of the Pyr-MBA and Pyr-

MBA-protein complex solutions were investigated to characterize their lifetimes and

identify the nature of excimer formation. The results obtained by TCSPC suggested that

the lifetimes of both pyrene monomer and excimer were around 40 ns. This is one

magnitude longer than lifetimes of most organic fluorophores and fluorescent

components in cell medium and cells, which should allow temporal resolution of the

excimer signal from intense background fluorescence from cell medium. Three cell

media samples were then subjected to SPC measurements: simulated biological sample

(SB S), 200 nM Pyr-MBA in SBS, and 200 nM MBA-Pyr-MBA and 50 nM PDGF-BB in

SBS. The data reported on Figure 4-11 and 4-12 showed that the fluorescence emission

from both pyrene monomer and excimer can be differentiated from background

fluorescence. Although pyrene monomer has a longer lifetime, the difference in intensity

between Pyr-MBA in SBS and SBS itself is small (~3 times). This may be because many

components of the SB S fluoresce at this region and their concentrations are higher than

the MBA concentration.












100000~
10 0


10000


1000


100


10 -


I


* SBS
* SBS +Pyr-MBA
SBS +Pur-MBA + PDGFBB


0~ 25 50b 7'5 1~00 125 150O 175 200
Time (ns)
Figure 4-11. Monomer time-resolved spectra collected at 398 nm (monomer emission)
for a sample of simulated biological medium (SBS), 200 nM Pyr-MBA in
SBA and 50 nM Pyr-MBA and PDGF-BB in SBS.


10000- SBS
*SBS +Pyr-MBA
~SBS + Pyr-MBA + PDGFBB

S1000-



-c 100-







0 25 50 75 100 125 150 175 200
Time (ns)
Figure 4-12. Excimer time-resolved spectra collected at 480 nm (excimer emission) for a
sample of simulated biological medium (SB S), 200 nM Pyr-MBA in SBA and
Pyr-MBA and 50 nM PDGF-BB in SBS.

Time resolved emission spectra revealed changes in emission spectra on a

nanosecond time scale (Figure 4-13). Due to its short fluorescence lifetime, the

fluorescence from the SBS decayed rapidly, getting to 0. 1% of its original signal 40

nanoseconds after the excitation pulse reached maximum intensity. In contrast, the

excimer emission decayed slower and retained reasonably high emission intensity even









after 40 ns of decay. The highest signal to noise ratio at 480 nm was observed from 40 to

about 100 ns after the excitation pulse reached maximum intensity. Before 40 ns, there

was still significant background fluorescence from the SBS while the signal to noise ratio

dropped below 3 after 100 ns of decay. In contrast, the excimer emission from a mixture

of protein and probe in SBS decayed much slower (Figure 4-13). The emission remained

after 40 ns of decay.

The temporal separation of intense background from weak signals is evident in

Figure 4-14, where time-resolved fluorescence emission spectra of SB S samples are

compared with steady-state fluorescence emission spectra. For steady-state measurements

no resolved peak around 485 nm was observed when PDGF-BB was added to Pyr-1VBA

in the SBS sample due to a significant amount of background signal. However, in time-

resolved emission spectra the long lifetime emission peak at 480 nm was well resolved.

This peak corresponded to excimer emission from protein-bound probe, which was

supported by two observations: its intensity varied with changes of protein concentration,

and no such peak was observed in either spectrum of cell medium or cell medium

solution containing PDGF-BB and a single-pyrene-labeled aptamer sequence

(SGL-1VBA). Thus, this characteristic emission peak could be used to examine

the presence of PDGF-BB in biological fluids.







82



1A 19 A I~20-3Bos 40-50m











110D-139s 1 4-5ns 1210-10




Waeent (nm)
Fiue4-3 lurseceitnst sa ucio fwveegh tdfern ims B
(gee) 200n Py-B nSS(e) n 0n y-B ith5n

PDG-BBin cel SBS (bue at2 .Ectton37m ie0n
corspn to th iea hc h xiato us ece aiu
intensity.
Dtctino D FB in Siuate ilgclSml
Wihtesnl htncutn ehiue h y-B rb a ulttvl
detct aret rotinin omgenoussoutin ad n asiulaed ioogialsample000
cnainn o eeso oeta nefrn rtis hntecnetaino D F
BBwsicesd h loesec nest fteecie eki iersle
emisin spcrmicesdacringyFiue1-5sostedc sof20n










aptamer probe Pyr-MBA in the cell medium with increasing concentrations of PDGF-BB

at 480 nm emission.



-4 Steady State: Pyr-MBA in SBS
-0 Steady State: Pyr-MBA + PDGFBB in SBS
Time-resolved: Pyr-MBA in SBS
1.2-
-o- Time-resolved: Pyr-MBA + PDGFBB in SBS





0.8-


S0.6-

0.







0.0-

360 380 400 420 440 460 480 500 520 540 560 580 600

Wavelength (nm)

Figure 4-14. Steady-state and time-resolved fluorescence spectra of SBS samples. Steady
state fluorescence emission spectra of 200 nM Pyr-MBA in SBS and 200 nM
Pyr-MBA with 50 nM PDGF-BB. Time-resolved fluorescence spectra of 200
nM Pyr-MBA in SB S, and 200 nM Pyr-MBA with 50 nM PDGF-BB in SBS.
Time resolved spectra were taken over 60 ns to 79 ns after the excitation pulse
reaches the maximum intensity.

Fluorescence intensity from the response of each solution could be calculated by

integrating photons emitted over an optimized time window. Photons emitted between 40

and 100 ns were counted and integrated for each concentration to construct a

calibration curve. The resulting fluorescence intensity is proportional to the PDGF-BB

concentration (Figure 14-14). This linear response of fluorescence intensity to PDGF-BB







84


in cell medium demonstrates the feasibility of detection of the target proteins in simple

biological samples containing low levels of proteins.


Time (ns)
A


200000-


150000


O 100000-
-


S50000
0-


0 20 40 60
PDGF-BB (nM)


80 100


Figure 4-15. Fluorescence decays of 200 nM Pyr-MBA in simulated biological specimen.
(A) Simulated biological sample with various concentrations of PDGF-BB
and response of fluorescence intensity to the change of protein concentration.
Excitation= 337 nm. The collection time for each decay was 3000 seconds.
(B)Photons emitted between 40 and 100 ns after excitation pulse reached
maximum were counted to construct the calibration curve.









Expression of PDGF-BB from Cells

Several reports have indicated that PDGF-BB can be over-expressed by various

types of cancer cells, including MCF-7, MDA-MB-231 and PC3 cultured cell lines.46

Unfortunately, the literature is ambiguous as to the specific amounts of PDGF-BB that

can be expressed under any given condition. This is largely limited to the fact that most

of methodologies currently used provide only qualitative information and often not just

specific to PDGF-BB expression.78;7 As a result, ELISA was employed to determine

specific amounts of expression that could be expected from PC-3 tissue cultured cells.

PC-3 cells are adherent prostate cancer cells and on incubation with TNF-a over-express

PDGF-BB. TNF-a (also called cachectin) is a maj or immune response modifying

cytokine produced primarily by activated macrophages. TNF-a also induces the

expression of other autocrine growth factors, increases cellular responsiveness to growth

factors and induces signaling pathways that lead to proliferation. TNF-a acts

synergistically with EGF and PDGF-BB in some cell types.

In order to determine the levels of PDGF-BB present in conditioned media, ELISA

tests were performed on different samples. The levels of PDGF-BB were measured from

samples which were cultured to confluency and spiked with Recombinant Human TNF-a

to induce PDGF-BB production (Table 4-2). The total protein concentration was

determined by the Bradford Assay. Since the addition of TNF-a to PC-3 cells in culture

should increase the levels of PDGF-BB in the conditioned media, it was first important to

Eind out if we could monitor PDGF-BB induction. PC-3 cells were cultured in 3 5 mm cell

culture dishes in a Einal volume of 2 mL. Twenty mg of TNF-a was added to each cell









dish and the conditioned media was collected at 0, 3, 6, 9, 12 and 24 hours after

induction.

Table 4-2. Amount of protein collected in 24 hours
PDGF- PDGF- Total protein
Incubation
BB BB concentration
time (hrs)
(pg/mL) (pM) (Clg/mL)
0 < 15 <0.6 5893
3 < 15 <0.6 6915
9 16.3 0.7 6787
12 42.9 1.7 6934
24 197 7.9 7340

In this case it can be observed that TNF-a induced the expression of PDGF-BB in

PC-3 cells. Non induced samples have less than 15 pg/mL of PDGF-BB. On the other

hand, after 9 hours of incubation, an increase in PDGF-BB levels can be observed, up to

197 pg/mL after 24 hours. The total protein concentration of all the samples was

measured and it ranged from approximately 5,900 Clg/mL to more than 7000 Clg/mL.

A second set of samples was prepared with the idea of increasing the amount of

PDGF-BB present per sample. Changes included: incubation in a larger flask, with a

small volume (enough to cover the surface of the flask), and with a higher amount of

TNF-u. A large surface area of adherent cells in a small volume should allow for a higher

amount of PDGF-BB collection. The second change in the sample handling includes a

concentration step by lyophilization (25 ml were reduced to 5 mL). In this case, PC-3

cells were cultured in five 75 cm2 flasks with 5 mL of cell media in each. Cells were

grown to confluency and 25 mg of TNF-a was added to each flask and the conditioned

media was collected after 24 hours for one set and after 36 hours for the following. The

total volume of conditioned media collected was 25 mL. After lyophilization the volume

was reduced to 5 mL. The results from the ELISA and Bradford assays are shown in









Table 4-3. It is illustrated that the amount of PDGF-BB is indeed higher with the

modified sample collection method, doubling in a period of 12 hours.

Table 4-3. Amount of protein collected in 24 and 36 hours
Incubation PDGF-BB PDGF-BB Total protein
time (hrs) (pg/mL) (pM) concentration
(Clg/mL)
24 865 35 9334
36 1775 71 11934

The two sample collections methods showed an increase in PDGF-BB production

after induction with TNF-ot, but the levels of PDGF-BB are lower than the current limits

of detection of the pyrene and the FRET assay. In addition, even if the levels of PDGF-

BB were detectable, the total amount of protein per sample is about 2 orders of

magnitude higher than the allowed protein concentration determined for the quenching

assay. Since the interfering non-specific interactions would be similar for the Pyr-MBA

and FRET MBA (essentially, non-specific binding to the aptamer), it is reasonable to

assume that the total protein concentration would limit both assays. If the total amount of

protein commonly found in serum exceeds 100 Clg/mL before sample processing, non-

specific interactions will result in false positive signals for this particular aptamer as

shown in Figure 3-2. A longer incubation time may be a possibility for increasing PDGF-

BB production, but after 36 hours of incubation, cells are 100% confluent and as result

they begin to die. Also, the total amount of total protein concentration increased as well.

Conclusions

The method of excimer light switching is an excellent signal transduction for

aptamer probe development. Pyr-MBA is able to detect protein in homogeneous solution

and simple biological samples containing low, or acceptable levels of proteins for the

aptamer. The generation of the excimer emission requires the conformation change of the