<%BANNER%>

Identification and Characterization of Genes Unique Genes Systemic Xanthomonas Pathogens

Permanent Link: http://ufdc.ufl.edu/UFE0011348/00001

Material Information

Title: Identification and Characterization of Genes Unique Genes Systemic Xanthomonas Pathogens
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0011348:00001

Permanent Link: http://ufdc.ufl.edu/UFE0011348/00001

Material Information

Title: Identification and Characterization of Genes Unique Genes Systemic Xanthomonas Pathogens
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0011348:00001


This item has the following downloads:


Full Text

PAGE 1

IDENTIFICATION AND CHARACTERIZAT ION OF GENES UNIQUE TO SYSTEMIC Xanthomonas PATHOGENS By LUZ ADRIANA CASTAEDA C. A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2005

PAGE 2

Copyright 2005 by Adriana Castaeda C.

PAGE 3

This document is dedicated to my family and husband

PAGE 4

ACKNOWLEDGMENTS There are so many things and so many people to be thankful about. First I want to thank my parents for their love and for giving me the best education and the best example, my uncle Luis for leading me to follow this area of studies, and Drs. Marcial Pastor-Corrales Talo and Edgar Martnez for encouraging me and, why not, pushing me to go to graduate school. But in order to go to graduate school I also got a lot of help from several people at ICA, first of all from Capt. Jorge Forero, who first brought me to work for ICA and then single-handedly got me the funding and consent from the Institution to go to grad school. I also want to thank the people who helped me in my second round at UF like Drs. Ana Luisa Diaz, Hernando Montenegro, Lilia Amparo Bonilla, and Claudia Marn and all people from continued education (Oficina de Capacitacin). In Gainesville I would like to thank my advisor Dr. Dean W. Gabriel for his support and great ideas, my committee members Dr. Jeff Jones, Dr. Jeff Rollins and Dr. Vallejos who were always available for advice and comments about my research project, and all professors in the department who were also always ready to help. The chairperson Dr. Wisler and the staff in Plant Pathology made my life so much easier with all the help and support they gave me, and also I am grateful to all the friends I made here. I would like to mention Gary Marlow for his great help in the lab and present and past members from Dean Gabriels lab who helped me and taught me so much. iv

PAGE 5

I want to also thank the rest of my family I did not mentioned before, my big brother and sisters, aunt, grandmother, nephews and nieces for their love and support and specially my sister Rosie and her family. They were a big help for me and my husband during the time we lived here. Last but not least, I want to thank my husband for his love, for leaving all behind and to join me here and for putting up with me during these three years and God for blessing me in every single aspect of my life. v

PAGE 6

TABLE OF CONTENTS page ACKNOWLEDGMENTS.................................................................................................iv LIST OF TABLES.............................................................................................................ix LIST OF FIGURES.............................................................................................................x ABSTRACT.....................................................................................................................xiii CHAPTER 1 INTRODUCTION........................................................................................................1 The Crucifera-Xanthomonas Pathosystem...................................................................2 The Host: Cruciferae Family.................................................................................2 Xanthomonas spp. Infecting Crucifer Plants (XCC and XCA).............................3 The Phaseolus vulgaris-Xanthomonas Pathosystem....................................................5 The Host: Common Bean......................................................................................5 Xanthomonas Infecting Phaseolus sp (XAP, XAPF, XAA).................................6 Bacterial Effectors........................................................................................................7 Methods for Cloning and Identification of Bacterial Effectors....................................9 Functional Genomics..................................................................................................10 2 COMPARISON BETWEEN SYSTEMIC AND NON-SYSTEMIC BACTERIA OF BEAN THROUGH SUPPRESSION SUBTRACTIVE HYBRIDIZATION......12 Introduction.................................................................................................................12 Materials and Methods...............................................................................................13 Plasmids, Bacterial Strains and Culture Conditions............................................13 Modified Suppresion Subtractive Hybridization.................................................13 DNA Sequencing and Analyses..........................................................................14 Molecular Biology Techniques...........................................................................15 Plant Assays.........................................................................................................16 Results.........................................................................................................................16 DNA Fragments Obtained by SSH......................................................................16 The Majority of Gene Fragments Cloned were Found Only on CBB Strains.....17 Gene Fragments Categories.................................................................................17 Southern Blot Confirmation................................................................................17 Mutagenesis Analyses.........................................................................................18 vi

PAGE 7

Discussion...................................................................................................................18 3 INTERRUPTION AND TRANSIENT EXPRESSION OF PTHF, AN AVRBS3/PTHA MEMBER CLONED FROM XPF...................................................28 Introduction.................................................................................................................28 Materials and Methods...............................................................................................29 Plasmids, Bacterial Strains and Culture Conditions............................................29 Genomic Library.................................................................................................29 Molecular Biology Techniques...........................................................................31 Plant Assays.........................................................................................................31 Transient Expression Assays...............................................................................32 Thin Sections.......................................................................................................32 Complementation Attempts.................................................................................33 Results.........................................................................................................................33 Cosmid Library....................................................................................................33 Several Cosmid Clones Contained a Copy of Three Homologues......................34 Transient Expression Assays and Thin Sections.................................................34 Attempts to Mutagenize pth Homologues...........................................................35 Some Mutants of pthF Caused a Pathogenicity Reduction.................................35 Attempts to Complement Pathogenicity Deficient Mutants................................35 Discussion...................................................................................................................35 4 SITE DIRECTED MUTAGENESIS IN THE REGIONS IN THE C-TERMINUS OF TWO AVRBS3/PTHA MEMBERS.......................................................................43 Introduction.................................................................................................................43 Materials and Methods...............................................................................................44 Plasmids, Bacterial Strains and Culture Conditions............................................44 Site-Directed Mutagenesis...................................................................................44 Plant Inoculations................................................................................................46 Results.........................................................................................................................46 UDG Cloning.......................................................................................................46 No Change in the Non-Host HR on Bean...........................................................47 No Change in Water-Soaking or the Non-Host HR on Cotton...........................47 Mutations of CK2 or the UCK, but not LZL Region, Resulted in Reduced Canker Symptoms............................................................................................47 Discussion...................................................................................................................48 5 INDIVIDUAL AND SEQUENTIAL MUTAGENESIS OF XCC AVR GENES, IDENTIFICATION OF A FUNCTIONAL AVR GENE, ATTEMPTS TO DEMONSTRATE HR SUPPRESSION BY AVR GENES........................................53 Introduction.................................................................................................................53 Materials and Methods...............................................................................................54 Plasmids, Bacterial Strains and Culture Conditions............................................54 Molecular Biology Techniques...........................................................................54 vii

PAGE 8

Suppression Subtractive Hybridization...............................................................56 DNA Sequencing and Analysis...........................................................................57 Mutagenesis Experiments....................................................................................58 Growth Kinetics...................................................................................................59 Electrolyte Leakage Measurements.....................................................................59 Complementation Assays....................................................................................59 Race Specificity Change......................................................................................60 Plant Assays.........................................................................................................60 Cell Death Suppression Assays...........................................................................61 Results.........................................................................................................................62 Suppression Subtractive Hybridization...............................................................62 No Evidence of Pleiotropic Pathogenicity Function by any Individual XCC avr Gene or XopD............................................................................................62 No Evidence of Collective Pleiotropic Pathogenicity Function by all Annotated XCC avr Genes..............................................................................63 avrXccFM confers avirulence on B. juncea without inducing a typical mesophyl HR...................................................................................................63 avrXccFM Is a Critical Race Determinant of XCC.............................................65 Electrolyte Leakage Assays Showed That No Apparent Cell Death Is Involved in B. juncea Resistance.....................................................................66 HR In B. juncea Appears to be Restricted to Cells Surrounding the Vascular System..............................................................................................................66 Non-HR Resistance Response in Arabidopsis was Not Affected in Any of the Mutants............................................................................................................66 Non-host HR Was Not Altered in Strains Carrying Mutations in avr Genes.....67 HR Induction by a P. syringae Gene Was Not Inhibited by XCC avr Genes.....67 Discussion...................................................................................................................68 6 SUMMARY AND CONCLUSSIONS.......................................................................86 APPENDIX A BACTERIAL STRAINS AND PLASMIDS..............................................................88 B XANTHOMONAS TOTAL DNA EXTRACTION.....................................................93 C PRIMERS USED........................................................................................................95 D PLANTS USED........................................................................................................100 E PLASMID EXTRACTION......................................................................................101 LIST OF REFERENCES.................................................................................................103 BIOGRAPHICAL SKETCH...........................................................................................121 viii

PAGE 9

LIST OF TABLES Table page 2-1 Summary of sequences found by SSH........................................................................26 2-2 Categories of genes found by SSH..............................................................................26 2-3 Candidate genes selected from Southern hybridization..............................................27 5-1 List of genes classified as avr in XCC528T.................................................................84 5-2 Races in XCC..............................................................................................................84 5-3. Race changes due to the presence of avrXccFM.......................................................84 5-4. Actual sizes of four of the avr genes according to our analyses...............................85 5-5. Seedlings assay for Vascular Hypersensitive Response (VHR)................................85 5-6. List of additional putative effectors...........................................................................85 ix

PAGE 10

LIST OF FIGURES Figure page 2-1 Schematic representation of SSH procedure............................................................22 2-2 PCR amplifications for SSH....................................................................................23 2-3 PCR amplification from random pGEMTeasy clones using M13R and M13 primers......................................................................................................................23 2-4 Dot blot hybridization of pGEMT clones................................................................24 2-5 Chart summarizing the categories of genes obtained by SSH..................................24 2-6 Southern blot hybridization of three of the genes identified by SSH.......................25 2-7 Southern hybridization performed on two of the genes identified by SSH.............25 2-8 Southern blot hybridization showing confirmation a hypothetical protein interrupted in Xanthomonas phaseoli (XP) strain G66............................................26 3-1 Diagram showing the domains of a protein belonging to the avrBs3/pthA family..38 3-2 Southern blot of XPF total DNA probed against pthA.............................................38 3-3 Diagram representing cosmid vector preparation....................................................38 3-4 Fractions collected after sucrose gradient of partially digested DNA......................38 3-5 Agarose gel at 0.7% of eighteen cosmid clones DNA digested with EcoRI............39 3-6 Colony hybridization of the cosmid library probed against pthA............................39 3-7 Southern hybridization of three of the hybridizing cosmid clones..........................40 3-8 Transient expression in bean leaves.........................................................................40 3-9 Thin sections performed in leaves inoculated with Agrobacterium tumefaciens for transient expression............................................................................................41 3-10 Southern blot hybridization of of pthF mutants.......................................................42 x

PAGE 11

3-11 Bean leaf inoculated with pthF mutants...................................................................42 4-1 Map of a avrBs3/pthA proteins.................................................................................50 4-2 Schematic representation of UDG cloning...............................................................50 4-3 PCR amplification of the HincII-HindIII region of pthA in pUC19........................51 4-4 Common bean plants inoculated with KX-1 carrying pthA mutations....................51 4-5 Cotton plants inoculated with H2.2S strain with avrb6 mutations..........................51 4-6 Citrus plants inoculated with mutant versions of pthA into B21.2...........................52 5-1 Mutagenesis strategies used.....................................................................................75 5-2 Dot blot of pGEMTeasy clones hybridized against total DNA...............................76 5-3 Distribution of some relevant gene fragments found in XCC-XCA by Suppression Subtractive Hybridization (SSH).........................................................76 5-4 PCR performed in mutant X23.................................................................................77 5-5 Southern blots of XCC528T wild type and X8.8 DNA digested with EcoRI...........77 5-6 Growth of XCC528T and X8.8 in white turnip Hakurei Hybrid..............................78 5-7 Inoculation of 528T in B. juncea...............................................................................78 5-8 Clip inoculation of some mutants inoculated in Florida Mustard............................78 5-9 Clip inoculation of strains carrying single mutation in Xcc2109.............................79 5-10 B. juncea leaf inoculated by syringe infiltration at high concentration....................79 5-11 Codon preference analyses performed on four avr genes by GCG..........................80 5-12 Complementation tests in B. juncea.........................................................................80 5-13 Southern blot of different strains representing three races of XCC probed against avrXccFM.................................................................................................................81 5-14 Race change of two XCC strains in Florida mustard inoculated by leaf clipping...81 5-15 Growth of XCC6181 and X83 (6181/avrXccFM) syringe infiltrated in Florida Mustard plants..........................................................................................................82 5-16 Time course of electrolyte leakage from leaves of Florida Mustard plants inoculated with four different strains of XCC and one of XCA..............................82 xi

PAGE 12

5-17 Seedling assay performed B. juncea plants..............................................................83 5-18 Apparent HR suppression by avr genes from XCC in pepper and tobacco plants..83 xii

PAGE 13

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy IDENTIFICATION AND CHARACTERIZATION OF GENES UNIQUE TO SYSTEMIC Xanthomonas PATHOGENS By Luz Adriana Castaeda C. August 2005 Chair: Dean W. Gabriel Major Department: Plant Pathology Suppression Subtractive Hybridization (SSH) was used to identify genes present in the systemic pathogen Xanthomonas campestris pv. campestris (XCC), and missing from the nonsystemic pathogen Xanthomonas campestris pv. armoraciae (XCA). Among the DNA fragments unique to XCC was Xcc2109, one of eight putative avr genes identified in the XCC528T genome (NC 003902). Individual and sequential deletion and/or insertion mutations of all eight putative XCC avr gene loci were made, but no change in pathogenicity was observed in any combination of avr mutations, including a strain with all eight avr genes deleted. However, insertion or deletion mutants at the Xcc2109 locus lost avirulence (i.e., became virulent) on Brassica juncea, a race-determining differential host. The Xcc2109 ORF as annotated was cloned and found to be nonfunctional. A longer gene, encompassing Xcc2109 and here designated avrXccFM, was defined and found to confer avirulence to Xcc2109 mutant strains and to two additional wild type xiii

PAGE 14

strains, thereby changing their designation. Resistance in B. juncea to XCC528T strains carrying avrXccFM occurs without a typical HR, but with a vascular HR (VHR). A similar but modified SSH was performed between the two systemic pathogens Xanthomonas phaseoli (XP) and Xanthomonas axonopodis pv. phaseoli var. fuscans (XAP), and the non systemic Xanthomonas axonopodis pv. alfalfae (XAA). Among other gene fragments, a large number of transposable elements as well as gene fragments of unknown function were obtained. Five genes also present in other bacterial pathogens were mutagenized in XP. None of the mutant strains obtained exhibited any effect in virulence except for a pthA homolog, a gene earlier identified in XP and included in the functional study. Complementation assays were inconclusive although in detached leaves transient expression of the pthA gene homolog obtained from an XPF cosmid library, induced a phenotype similar to common bacterial blight of bean. xiv

PAGE 15

CHAPTER 1 INTRODUCTION Xanthomonads are Gram-negative, plant-associated bacteria. Cells exist mostly alone or in pairs, but chains and filaments may also occur (Swings and Civerolo 1993). Cell length is variable even within the same strain, and a single polar flagellum is usually observed. Individual bacterial cells are surrounded by the extracellular polysaccharide xanthan gum, and most strains form yellow, water-insoluble pigments (xanthomonadins) when grown in culture media (Shaad 1988). Xanthomonads are biotrophic (derive their nutrition from living cells) and capable of intimate, highly-specific host interactions. Although the host range of the genus is wide, the host range of any one strain is typically quite narrow (the host range of each pathovar is usually limited to few species or genera of the same plant family, (Hayward 1993)). Bacteria belonging to the genus Xanthomonas produce leaf spots, cankers, and systemic blights. Among the Xanthomonas species that cause systemic diseases that are relevant for this study are: Xanthomonas campestris pv campestris (XCC) causing bacterial blight and black rot of crucifers (Alvarez et al. 1994), Xanthomonas pv. phaseoli, (XP) causing common bean blight (Vidaver 1993), and Xanthomonas axonopodis pv. phaseoli var. fuscans (XPF) also causing common bean blight (Schwartz and Pastor-Corrales 1989). Xanthomonas species that cause leaf spot that are relevant to this study are Xanthomonas campestris pv. armoraciae (XCA) which causes a leaf spot of crucifers (Schaad and Alvarez 1993) and Xanthomonas axonopodis pv. alfalfae (XAA) which causes leaf spot of alfalfae (Esnault et al. 1993). 1

PAGE 16

2 Up to this date three xanthomonads species have been sequenced: Xanthomonas citri strain 306 (da Silva et al. 2002), Xanthomonas campestris pv. campestris strains ATCC33913 (synonym 528T), B100 and 8004 (da Silva et al. 2002; Vorhlter et al. 2003; Qian et al. 2005), and Xanthomonas oryzae pv. oryzae strain KACC10331 (Lee et al. 2005). The Crucifera-Xanthomonas Pathosystem The Host: Cruciferae Family The Brassicaceae comprises more than 300 genera and 3000 species of plants (Rubatzky and Yamaguchi 1997). Some of the plant species members of this family are recognized for their contribution to human nutrition, and suggestions have been made that when consumed fresh, these plants possess cancer-preventive attributes (Talalay and Fahey 2001; Mezencev et al. 2003; Keck and Finley 2004). According to the 2004 FAO (FAO statistics, 2004) reports, in the year 2002, oil mainly from rape and mustard seed, provided 32 calories per capita per day. Brassica is the most important genus agriculturally with 40 species, and the majority of cultivated ones occur in six species: three diploid species with 8, 9 and 10 pairs of chromosomes identified as B, C and A genomes of B. nigra, B. oleracea and B. rapa respectively, and three amphidiploid species (B. carinata, B. juncea and B. napus) having the BC, AB and AC genomes with 17, 18 and 19 chromosomes, respectively. In the United States production of broccoli (B. oleracea var. italica), cabbage (B. oleracea var. capitata) and cauliflower (B. oleracea var. botrytis) yielded 916,000, 2,433,110 and 397,850 metric tons respectively. The total market value was $1.2 billion in 2003 with California and Arizona being the major producers. Broccoli was the crucifer most cultivated in 2003 in the U.S., with 136,000 acres harvested, followed by cabbage and cauliflower with 76,850 and 44,000 acres

PAGE 17

3 harvested respectively (USDA, NASS, 2004). According to FAO statistics for 2003, cabbage was the most cultivated fresh market crucifer in the world with production of 65,956,162 metric tons, followed by cauliflower with production of 15,948,166 metric tons. The most cultivated seed crucifers in the world were oil-rape (B. napus), with a total yield of 36,145,663 metric tons, followed by mustard seed (B. nigra) with a 632,354 metric tons yield (FAO statistics 2004). Xanthomonas spp. Infecting Crucifer Plants (XCC and XCA) XCC is a bacterial species that infects a wide range of plant taxa throughout the world (Bradbury 1984). Black rot of crucifers is one of the most destructive diseases (Williams 1980) attacking cauliflower, cabbage, kale, broccoli, brussels sprouts, Chinese cabbage, collard, kohlrabi, mustards, rape, rutabaga and turnip. During periods of warm, wet weather, black rot may reduce yield by more than 50% (RPD 924 1999). The bacterium can overwinter in plant debris, on seeds from diseased plants, and on weeds. The pathogen may survive in diseased crop residue buried in soil for up to two years, but not for more than sixty days when free of plant material in the soil. Crucifer seed is the primary means of dissemination (Miller et al. 2002). XCC enters the plant primarily through hydathodes, and then colonizes and moves through the vascular system (Williams 1980). The systemic pathogen can spread throughout the plant by seed, root or leaf infections (Cook et al. 1952). In natural infections, mechanical or insect wounds are also a major route of entry (Kucharek and Strandberg 1981), but natural openings become most important in the absence of such wounds (Shaw and Kado 1988). Extensive yellowing of leaf margins is a common early symptom of black rot. The affected tissue may become necrotic and advanced systemic infections can cause darkened leaf veins and vascular tissue within the stem, expanded

PAGE 18

4 leaf yellowing, leaf necrosis and leaf wilting. By contrast, XCA enters the plant mainly through stomata (Hugouvieux et al. 1998) and remains localized in the mesophyl tissue (McCulloch 1929). XCA lesions occur near the original point of entry and lesions are limited, appearing as circular spots. As with other Xanthomonads, XCC requires a hrp system for both pathogenicity on host plants and the ability to elicit the hypersensitive response on non-host plants (Kamoun and Kado 1990). The virulence of XCC also depends upon a number of other factors including the synthesis of enzymes like proteases (Dow et al. 1990), and the extracellular polysaccharide (EPS) xanthan (Crossman and Dow, 2004). The rpf gene cluster (for r egulation of p athogenicity f actors) positively controls both the production of these compounds and the virulence in plants (Tang et al. 1991). Genes within the rpf cluster encode elements of a regulatory system involving the diffusible signal factor, (DSF), which has been implicated in regulation of biofilm dispersal (Barber et al. 1997). rpf mutation studies show coordinated regulation of endoglucanases, proteases, polygalacturosate lyases and EPS xanthan. rpfB and rpfF control the production of DSF which is most probably a lipid or a lipid derivative (Barber et al. 1997). DSF does not accumulate in later growth phases, and it does not function as an auto-inducer (Wilson et al. 1998; Dow et al. 2000; Crossman and Dow 2004). Other enzymatic proteins that are involved in pathogenicity include a zinc metalloprotease which has been shown to degrade proline-rich glycoproteins in Brassica species (Dow et al. 1998), and an endo -(1,4)-mannanase that is required for full virulence in Chinese radish. The later is probably involved in bacterial release from the xanthan-based biofilm to planktonic state in order to promote colonization of the vascular system (Dow et al. 2003).

PAGE 19

5 XCC was initially shown to be comprised of five races, based on disease reactions on different plant species: Brassica oleracea, Brassica rapa and Brassica juncea (Kamoun et al. 1992). Later a new race system was developed which included an extended series of Brassica species (B. oleracea var. botrytis and B. carinata (Vicente et al. 2001)) and as a result six races were renamed accordingly. Three major resistance genes designated R1, R3 and R4 appear to be present in the host differentials used to identify races. B. juncea has at least one resistance gene (R1) that probably originated from the B genome of B. nigra. The A genome also has one resistance gene (R4), and R3 likely originated in the C genome (Taylor et al. 2002). The complete genomic DNA sequence of the XCC type species ATCC 33913 (synonym to 528T) was recently published (da Silva et al. 2002). The genome carries a single chromosome of about 5.0 Mb, no plasmids, a GC content of 65% and a total protein coding region of 84%. It also possesses one copy of a type IV secretion system, has a conserved type III secretion machine and contains 8 putative avirulence genes. Analyses indicate that numerous events of horizontal gene transfer probably occurred in this species, based in part on the appearance of 109 different types of transposable elements. A total of 285 genes present in XCC are suggested to have been acquired horizontally (Garcia-Vallv et al. 2003), including three of the eight avirulence/pathogenicity effector genes identified. The Phaseolus vulgaris-Xanthomonas Pathosystem The Host: Common Bean Common dry bean, Phaseolus vulgaris, is the most important food legume for direct human consumption in the world (Schwartz and Pastor-Corrales 1989, Broughton, 2003). The genus Phaseolus comprises 55 species, five of which have been

PAGE 20

6 domesticated: P. coccineus, P. acutifolius, P. lunatus, P. polyanthus and P. vulgaris (Broughton et al. 2003). In 2003, 19,038,458 metric tons of dry bean and 5,933,264 metric tons of green beans were produced in the world. Of these, 7,000,000 metric tons were produced in Latin America and Africa. In the US, 1,021,260 of dry beans were produced on 545,000 hectares and 127,500 metric tons of green beans were produced on 21,400 hectares during 2003 (FAOSTAT, 2004). During the same period, the production of green beans in the US was valued at $267,762,000 (USDA, NASS, 2004). Xanthomonas Infecting Phaseolus sp (XAP, XAPF, XAA) X. phaseoli (XP) and X. axonopodis pv phaseoli var. fuscans (XPF) are two bacterial species that cause common bacterial blight of bean (CBB). Both bacteria induce identical symptoms on leaves, stems, pods and seeds (Schwartz and Pastor-Corrales, 1989). The two bacteria are frequently found in the same field and even in the same plant. Leaf symptoms initially appear as water-soaked spots which enlarge and frequently coalesce with adjacent lesions, often surrounded by a zone of lemon-yellow tissue. CBB bacteria enter leaves through natural openings such as stomata and hydathodes and wounds. Cells invade intercellular spaces causing a gradual dissolution of the middle lamella. Colonization of the xylem tissue may cause wilting as a result of plugging vessels or disintegrating cell walls. By contrast X. axonopodis pv. alfalfae (XAA) produces only a leaf spot in bean similar to the disease caused by XCA in crucifers. Yield losses due to CBB can be very high. For example, in 1967 the disease affected at least 75% of 265,000 hectares of Navy bean in Michigan causing between 10 and 20% losses (Saettler in Schwartz 1989). In 1975, Wallen and Galway reported yield losses of 38% in Ontario, Canada. In Colombia, natural and artificial infections resulted

PAGE 21

7 in yield losses of 22 and 45%, respectively (Yosshi et al. 1976). In Florida, it is the most frequently found bacterial disease on both snap beans and dry beans. XP can survive and multiply as an epiphyte on weed hosts, especially from the legume family (Pernezny and Jones 2002). There is little molecular information available regarding either organism causing common bacterial blight of bean. The chromosome size of an XPF strain was estimated to be 3938 kb based on Pulse-Field Gel Electrophoresis (PFGE) and Southern blots (Chan and Goodwin 1999). Genes involved in the oxidative metabolism of XP have been identified (Chauvatcharin et al. 2003; Vattanaviboon et al. 2002, 2003); however, no pathogenicity or avirulence genes have been identified. Bacterial Effectors Most pathogenic xanthomonads deliver effectors through a type three secretion system (T3SS), which allows them to inject proteins directly into the plant cytoplasm that are crucial for eliciting disease and hypersensitive responses (Galan and Collmer 1999; Gauthier et al. 2003; Alfano and Collmer 2004; He S.Y. et al. 2004). Avirulence (avr) genes, considered as a class of effectors, have been identified in both bacteria and fungi based on their ability to confer incompatibility in otherwise compatible interactions (Ellingboe 1976). In gene-for-gene systems, dominant avr genes in the pathogen interact with specific resistance (R) genes in the host and are known to determine pathogenic races and the range of host cultivars attacked (Flor 1956). Recent publications (Rohmer et al. 2004) suggest that pathogenic bacteria may secrete as many as fifty effectors through its T3SS. Besides their major role in race-cultivar specificity, avr genes have pleiotropic functions. AvrPtoB from Pseudomonas syringae pv. tomato inhibits programmed cell death in tobacco and induces a

PAGE 22

8 hypersensitive response in tomato plants carrying Pto (Abramovitch et al. 2003); avrE confers avirulence to Pseudomonas syringae pv. glycinea, adds pathogenicity to some strains of Pseudomonas syringae pv. tomato and it also complements dsp mutants in Erwinia amylovora (Bogdanove et al. 1998). The avrBs2 gene of X. vesicatoria, which is widespread in Xanthomonas, has been shown to contribute to the fitness of the pathogen by increasing the in planta growth (Kearney & Staskawicz 1990). pthA, a member of the avrBs3/pthA family is present in X. citri and is necessary for production of symptoms on citrus plants, and also for eliciting a hypersensitive response in non-hosts (Swarup et al. 1992). Spontaneous and marker exchanged avrb6 mutants of X. axonopodis pv. malvacearum, also a member of the avrBs3 family had reduced pathogenicity as shown by a decrease in water-soaking ability in cotton. Enzymatic activity has been demonstrated for nine effectors and plant defense suppression phenotype for ten effector genes (Alfano and Collmer 2004). Pleiotropic fitness effects are a common feature of several avirulence/effector genes and have been reported in several other pathogen species (Lorang et al. 1994; Yang et al. 1996; Badel et al. 2003; Wichmann et al. 2004). However, there appears to be no associated fitness benefit for some avr effector genes. Indeed avrBs1 has been shown to produce a fitness cost when present in the pathogen, since when present in X. vesicatoria (XV), it decreases the ability of the pathogen to survive in soil and dead plant material (OGarro et al. 1997). Horizontal gene transfer could account for the lack of a fitness advantage of some avr genes. However, it is unlikely that effector genes lack a beneficial function at least in some contexts since selection is not expected to maintain genes that incur a high cost with no counteracting benefit (Frank et al. 1992). In fact, Wichmann (2004) found that

PAGE 23

9 wild type XV was better fit than all mutant effector genotypes, showing greater ability to develop disease lesions. Different combinations of avr mutations have also given different results in transmissibility, demonstrating that complex interaction exist among effector genes. Additionally only after mutation of several effector genes were fitness costs observed in terms of lesion development and in planta growth. These mutations contributed to a drastically reduced ability to be transmitted in the field. Methods for Cloning and Identification of Bacterial Effectors Diverse molecular and genomic approaches have been used to identify potential bacterial effectors (Buttner et al. 2003; Nomura and He, 2005). Among those, the complementation of non-pathogenic strains with a genomic library of a pathogenic strain, or the transfer of an avirulent strain genomic library into a virulent strain of the same pathogen have been widely used (Ronald and Staskawicz 1988; DeFeyter et al. 1991; Dong et al. 1991; Whalen et al. 1991 and 1993; Ronald et al. 1992; Chen et al. 1994). Recently, reporter fusion systems have been used in which the gene of interest was disrupted and fused to a reporter gene; this fusion is measured or detected by RT-PCR, -Galactosidase activity, or calmodulin-dependent adenylate cyclase assays (Cunnac et al. 2004; Losada et al. 2004). Other gene fusions have also been attempted in which known HR inducing domains of genes are fused with the gene of interest in order to obtain a hypersensitive response when effector genes are injected. These include fusions to P. syringae pv. tomato AvrRpt2, which were screened in Arabidopsis thaliana carrying RPS2 gene (Guttman et al. 2002), or fusions to AvrBs2 from XV screened in pepper plants carrying Bs2 (Roden et al. 2004). Effector induction or co-regulation also can be screened in planta by cDNA-AFLP (Noel et al. 2001), or detected by a modified in vivo expression technology (Boch et al. 2002). Finally, another technique that has been used

PAGE 24

10 is the Agrosuppresion assay in which the target gene is introduced into a tumorogenic Agrobacterium strain in order to detect HR or otherwise to obtain a tumor (Kamoun et al. 2003). In silico identification of genes using common sequences features present on effector genes such as PIP and hrp boxes, signatures of horizontal acquisition and an N-termini with characteristics such as a high percentage of serine residues, aliphatic amino acids or proline in the third or fourth position, and the lack of negatively charged amino acids in the first two residues and structural motifs for eukaryotic activity (Lloyd et al. 2002; Petnicki-Ocwieja et al. 2002; Schechter et al. 2004) are also widely exploted for bacteria with genome sequence data. Functional Genomics In the pre-genomics era (McKusik et al. 1993), mutations to observe a loss of function were randomly introduced by physical (X-ray irradiation or UV light), chemical (N-methyl-Nnitro-N-nitrosoguanidine (NG) or ethyl methanosulfonate EMS-) agents, or biological agents (transposable elements (Turner et al. 1984)). In addition, genes that are differentially represented in two cDNA populations (Harakava and Gabriel 2003) can be isolated by a simplified subtractive hybridization procedure called suppression subtractive hybridization (SSH) developed by Diatchenko et al. (1996). With the outcome of complete sequences from diverse plant pathogenic bacteria (Simpson et al. 2000; Woods et al. 2001; da Silva et al. 2002; Salanoubat et al. 2002, Buell et al. 2003; Vorhlter et al. 2003), efforts have been focused to investigate the function of genes found in each of the pathogens and their role in disease elicitation. This can be done by inactivation of the gene product(s) of interest and analyzing the phenotype (Snyder and Gerstein 2003). Homologous recombination in bacteria has been

PAGE 25

11 used to create such directed mutations. Techniques based on PCR to introduce mutations in the gene of interest include UDG cloning and replacement (Rashtchian et al. 1992), marker disruption (OReilly et al. 1986), Spliceoverlap PCR (Ho et al. 1989) and FLP recombinase (Hoang et al. 1998). The latter two have been used to induce deletions of the target gene allowing multiple rounds of mutations to study the function of several genes simultaneously.

PAGE 26

CHAPTER 2 COMPARISON BETWEEN SYSTEMIC AND NON-SYSTEMIC BACTERIA OF BEAN THROUGH SUPPRESSION SUBTRACTIVE HYBRIDIZATION Introduction Xanthomonas phaseoli (XP) and Xanthomonas axonopodis pv. phaseoli var. fuscans (XPF) are two different bacterial species that systemically infect bean (Phaseolus vulgaris) to cause common bacterial blight (CBB). Both bacteria induce indistinguishable symptoms on leaves, stems, pods and seeds (Schwartz and Pastor-Corrales 1989), even though RFLP and DNA-DNA hybridization studies have shown that they are genetically diverse (Gabriel et al. 1989; Vauterin et al. 1995). The two bacteria are frequently found in the same field and even in the same plant. Growth in most culture media (any that contain tyrosine) will differentiate the two bacteria, since XPF produces a brown diffusible melanin-like compound, and like most xanthomonads, XP does not (Basu 1974). At the beginning of the CBB infection process, XP and XPF enter leaves through natural openings such as stomata, hydathodes and wounds. Water-soaked spots appear on leaves about 7 days later, which enlarge and frequently coalesce with adjacent lesions. As the disease advances, the lesions usually show a zone of lemon-yellow tissue around the edges (Schwartz and Pastor-Corrales 1989). The bacteria then invade intercellular spaces, causing a gradual dissolution of the middle lamella that allows them to reach the xylem tissue (Schwartz and Pastor-Corrales 1989). In contrast, a related but a non-systemic pathogen of bean, X. axonopodis pv. alfalfae (XAA), infects primarily through 12

PAGE 27

13 stomata, causing a water-soaked spot that later turns dark and usually does not exceed 3 mm in diameter (Moffett and Irwin 1975). A simplified subtractive hybridization procedure, called suppression subtractive hybridization (SSH), was developed by Diatchenko (1996) to isolate genes that are differentially represented in two cDNA populations. Because bacterial genomes are smaller and less complex than most eukaryotic cDNA populations, SSH can be applied to find genomic differences between closely related bacterial strains (Akopyants et al. 1998; Bogush et al. 1999, Harakava and Gabriel 2003). A modified SSH experiment was performed here in order to find unique sequences present in both XP and XPF and absent from XAA. Materials and Methods Plasmids, Bacterial Strains and Culture Conditions Bacterial strains and plasmids used or constructed in this study are listed in Appendix A. Xanthomonas strains were grown in PYGM (Gabriel et al. 1989) at 30C and E. coli strains were grown at 37C in Luria-Bertani (LB) medium (Maniatis et al. 1982). When necessary, appropriate antibiotics were used at the following concentrations: ampicillin (Amp), 100 g/ml; gentamicin (Gm), 3 g/ml; kanamycin (Kn), 20 g/ml; rifampicin (Rif), 75 g/ml; chloramphenicol (Cm), 35 g/ml, and spectinomycin (Sp), 50 g/ml. Modified Suppresion Subtractive Hybridization DNA from XP and XPF was extracted according to protocol in Appendix B. XP and XPF DNAs was first digested with RsaI and they were each ligated to one of the specific SSH adaptors, and XAA DNA was used as driver DNA. The rest of the procedure, illustrated in Figure 2-1, was performed according to the instructions of the

PAGE 28

14 commercially available SSH kit (PCR-Select Bacterial Genome Subtraction Kit-Clontech Laboratories, Inc) with minor changes as follows. Two micrograms of DNA from each of three strains (XP strain G66, XPF strain 203B and XAA strain KX-1) were extracted using the protocol in Appendix B. The DNA was digested with 15 units of RsaI for 16 h at 37C. The DNA from XP was ligated to adaptor 1 and XPF DNA ligated to adaptor 2R (Appendix C). Two microliters of XAA DNA was diluted with 1l of 4x hybridization buffer and mixed with 1 l of DNA from XP and 1 l of DNA from XPF in separate 0.5 ml tubes. The samples were heated at 98C for 1.5 m, followed by incubation at 63C for 1.5 h. The XP/XAA and XPF/XAA samples were then combined and an additional 1 l of XAA DNA melted at 98C for 1.5 m was added. The mixture was heated at 63C overnight and then PCR amplified with primer 1 at four annealing temperatures (57C, 59C, 61C and 63C) for 35 cycles. A second round of PCR amplification using the product from the first PCR at 61C was performed with nested primers 1R and 2R at 58C, 60C, 62C and 64C annealing temperatures for 25 cycles. Three microliters of the DNA from the second PCR amplification at 64C annealing temperature was ligated into pGEMTeasy according to the manufacturer, transformed into DH5 cells, and selected on LB plus Amp plates. DNA Sequencing and Analyses Primers used in this study were ordered from Integrated DNA technologies, Inc. (Coralville, Iowa) and are listed in Appendix C. All DNA clones resulting from SSH were sequenced at the University of Florida ICBR (Interdisciplinary center for biotechnology research) DNA Sequencing Core facility. To confirm that the cloned DNA fragments were unique to CBB, all SSH clones were colony PCR amplified with

PAGE 29

15 vector-based primers M13R (-48) and M13 (-47). Two microliters of DNA from the PCR amplification were spotted in duplicate on a nylon membrane with a replicator (VP 408S2a, V & P Scientific Inc. San Diego, CA) and also run on a 1% agarose gel to confirm that the amplified products were uniform. Five hundred nanograms of total RsaI-digested DNA from all strains were separately labeled with 32P with the Random Primer kit II (Stratagene) according to the manufacturers protocol. The labeled DNA was probed against each of the corresponding membranes. The DNA fragments of interest were further confirmed as CBB-specific by Southern hybridization analysis (Maniatis et al. 1982). Probes used were labeled PCR products amplified with vector-based primers, or with primers specific for internal regions of the sequences (Appendix C). Molecular Biology Techniques For marker interruption, an internal region of the target gene was PCR amplified with appropriate primers. A single bacterial colony taken with a toothpick and swirled into the PCR reaction mix, and it was used as template DNA. PCR reactions were performed using Taq polymerase (Invitrogen Corporation, Carlsbad, CA) with the Invitrogen PCR buffer, using magnesium chloride, primers and nucleotide concentrations as recommended by the manufacturer. The mix was initially denaturated at 95C for 3 m to release DNA from the cells, and then 35 PCR cycles were performed (30 s at 95C, 30 s at the specified annealing temperature, 70C for the specified extension time) with a final 10 m extension at 70C. One microliter of the PCR reaction was used for cloning into the TOPO vector (Invitrogen Corporation, Carlsbad, CA) and transformed in E. coli cells. Approximately 250 ng of DNA from the TOPO clones containing the insert were

PAGE 30

16 electroporated into 40 l of electrocompetent Xanthomonas phaseoli at 1.8 kV/cm in an Eppendorf 2510 electroporator. PYGM liquid medium was added to the bacteria to bring the volume to 1 ml. The cultures were grown at 30C for 2 h at 120 rpm and then the whole ml was spread onto PYGM plates containing Rif and Kn. Single colonies growing on the plates were restreaked and later confirmed to be transformed with the appropriate cloned DNA by PCR and Southern hybridization analysis. Plant Assays Xanthomonas cultures grown overnight at 30Cin liquid PYGM, were centrifuged at 5000 rpm for 5 m, washed with sterile tap water and adjusted to 0.3 OD600 (approximately 108 CFU/ml). A 1:1000 dilution of each suspension was made for low concentration inoculations (approximately 105 CFU/ml) of Phaseolus vulgaris plants cultivar California Redloud Kidney (Appendix D). For each inoculation, 2 cm at each side of the trifoliate leaves from 4 week old plants were cut with scissors and dipped in the bacterial suspension. Scissors were flame sterilized between inoculations. The plants were kept in a growth chamber at 27C with a 14 h light, 10 h dark cycle. Symptoms were scored daily for up to 3 weeks. Results DNA Fragments Obtained by SSH Since the Clontech procedure for SSH was standardized based on E. coli DNA, different temperatures were tested for Xanthomonas DNA. Figure 2-2 illustrates first and second round PCR products from reactions performed at different annealing temperatures. Four temperatures were tested, and the amplified products obtained at 61C in the first PCR round and at 64C in the second PCR round were selected for cloning into pGEMTeasy. Agarose gels were run with the PCR amplified products

PAGE 31

17 obtained from 348 colonies (Figure 2-3) to confirm uniformity of concentration prior to the dot blots. The Majority of Gene Fragments Cloned were Found Only on CBB Strains Dot blot analyses (Figure 2-4) showed that the majority of gene fragments cloned were present exclusively in CBB. Only one of the 96 clones spotted on the membrane pictured in Figure 2-4 hybridized with XAA labeled total DNA. Similar results were obtained with all plates analyzed (data not shown). Gene Fragments Categories Three hundred and eighty eight putative CBB-specific pGEMTeasy clones were sequenced. The average size of the sequence reads was 492 bp. Forty-two of the insert sequences were eliminated due to the low quality of the sequence read and 24 of the clones contained no insert. Three hundred and twenty two sequences were retained for further analysis (Table 2-1), and Blast analysis demonstrated that the sequences showed similarity to: transposable elements (104) (Table 2-2, Figure 2-5), transcriptional regulators (58), S-receptor kinases (34), hypothetical proteins (26), pectate lyases (23) and ABC transporters (16) among others. Forty of the 322 sequences (12.4%) were obtained only once. One avirulence/pathogenicity gene homolog belonging to the avrBs3/pthA gene family was found. Southern Blot Confirmation Twenty-five genes that appeared to be CBB exclusive by dot blot hybridization were analyzed by Southern blot hybridization. Three of the 25 genes tested were not CBB unique by Southern hybridization (Figure 2-6, some data not shown). All others were confirmed by Southern hybridization to be present only in the CBB strains (XP and XPF) (3 representative Southern hybridization results are shown in Figure 2-7). Some of

PAGE 32

18 the analyses also showed that few of the CBB-specific clones hybridized multiple times to different probes, suggesting that the CBB specific DNA could represent portions of transposable elements (not shown). Table 2-3 shows the gene fragments selected after Southern hybridization as candidates for mutagenesis, based on their presence only in the two CBB strains. Mutagenesis Analyses Five genes from XP (Table 2-3) were marker interrupted with internal regions cloned into TOPO, including XAC2373, a pectate lyase, RSp1239, a hypothetical protein, XACa0025, a hypothetical protein, XCC3132, a conserved hypothetical protein, and XAC2620, a VirB4 homolog. Figure 2-8 shows confirmation of one of the mutations (homolog of XACa0025) performed in XP strain G66. None of the mutational inserts appeared to affect pathogenicity, morphology or growth. Discussion Three hundred and twenty two gene sequences putatively conserved in both CBB strains of X. phaseoli and X. phaseoli var. fuscans, but not found in a leaf spot strain of X. axonopodis pv. alfalfae were identified by SSH. The modifications used (two tester strains instead of one, and different hybridization temperatures) appear to have increased the efficiency of the method and resulted in a reduced background, since about 88% of the sequences analyzed by Southern hybridizattion were demonstrated to be present only in CBB strains. Analyses between two E. coli strains have shown that the test efficiency is close to 50% (clontech manual). The appearance of many phage-related sequences in the library is surprising, since these elements tend to be strain specific (Winstanley 2002). However, the fact that XP and XPF are frequently found together in the same plant in the field would allow

PAGE 33

19 development of a common phage. Bacteriophages could be important components of the evolution of CBB strains, as these elements have been shown to be mediators of horizontal gene transfer. Bacteriophages could bring new advantageous genetic material to its host and/or interrupt host genes upon integration (Hendrix et al. 1999). Some gene sequences obtained through SSH and confirmed as exclusively present in CBB strains were not considered for functional analyses since they were present in high copy number (>10 copies, data not shown), and elaborate methods would be needed to accomplish mutagenesis of such a large number of copies. Those include ABC transporter proteins and S-receptor kinases that are usually involved in a variety of basic cellular processes and also in virulence in animal pathogens (Davidson and Chen 2004). In the case of pectate lyase, a Southern blot showed that two hybridizing gene fragments were present in both CBB strains (Figure 2-6 B). Nevertheless, an attempt was made to mutate one of these by marker interruption, but the mutation had no evident effect on virulence. In order to mutate both copies, a different method, such as splice overlap PCR (Horton et al. 1989) or FLP recombinase (Hoang et al. 1998) would need to be used to sequentially mutate the additional copy and determine the role of these genes if any, in CBB-specific pathogenicity. Several copies of the type IV secretion system genes VirB9-VirB10 were found only in CBB strains, and a copy of the VirB4 homolog was chosen to knock out the entire system, since this gene was also found present in single copy in both CBB strains and not in XAA (data not shown). VirB4 plays a major role in the type IV secretion/transfer system as an ATPase (Remaut and Waskman 2004) and plays an essential role in pathogenicity of Agrobacterium tumefaciens (Sagulenko et al. 2001). However, mutation

PAGE 34

20 of the VirB4 locus did not produce a reduction in pathogenicity. In XP and XPF, the type IV system could be involved solely in plasmid conjugation. It is also possible that XP could be carrying an additional but functional type IV system that is divergent at the DNA level, but able to functionally complement the mutation (Xanthomonas ONSA FAPESP network. 2001/2002). Some genes originally identified as CBB unique and potential pathogenicity factors (including HrpD5, pthA, and a conserved hypothetical protein (Figure 2-6), some data not shown) were not considered for knock-out experiments after Southern hybridization revealed their presence in all three bacterial species. Traditional techniques such as complementation of non-pathogenic strains with a genomic library of a pathogenic strain (Chen et al.1994), reporter fusion systems (Cunnac et al. 2004; Guttman et al. 2002; Roden et al. 2004a), screening of genes induced in planta (Noel et al. 2001), and promoter-trap assays (Losada et al. 2004) have been successfully used to identify pathogenicity genes present in a given pathogenic strain. However, none of these techniques has ever resulted in discovery of genes involved in systemic pathogenicity vs. mesophyll-limited pathogenicity. This study was designed to find genes common to two different systemic strains and absent from a non-sytemic. This is the first report of an attempt to use the SSH technique with two tester strains and one driver. SSH followed by limited knock-out mutagenesis did not reveal any genes critical for systemic pathogenicity among 322 examined. There are several possible explanations for this: first, the putative gene or genes involved in pathogenicity or systemic movement could be present in all three bacteria species but they could be either regulated

PAGE 35

21 differently, or they could carry mutations when present in the non-systemic pathogen (frame shifts, or short deletions or insertions); such differences would be undetectable by SSH. Second, even though the two CBB species apparently cause the same disease, they could potentially utilize different effectors to cause symptoms. If this were the case, SSH would not be useful to detect the genes involved in pathogenicity in each CBB strain, since each strain would carry different genes. Third, Pomati and Neilan (2004) suggested that SSH-based techniques preferentially select for genomic regions with high GC content. Since virulence genes are often found in pathogenicity islands that have atypical GC content than the rest of the genome (Schmidt and Hensel 2004), it is possible that the candidate genes could be present in regions with low GC. Fourth, since CBB strains were used as testers and XAA as driver, the presence of a negative factor present in XAA could be responsible for its inability to cause systemic symptoms. A reverse analysis (i.e. by using XAA as tester and CBB as drivers) might be used to obtain this type of gene. Some modifications in SSH could improve the results obtained by this technique. DNA shearing instead of a RsaI digest, different hybridization temperatures and a titration of PCR annealing temperatures, could have help reduce background and obtain a more representative group of gene sequences possibly involved in pathogenicity.

PAGE 36

22 X. phaseoliX. alfalfae X. fuscansC)D)A) B) E) *1*1*2*2*3*4 Figure 2-1 Schematic representation of SSH procedure. A) Genomic DNA from the three strains is digested with RsaI. B) The two tester DNAs (XP and XPF) are each ligated to a different adaptor. C) A hybridization step is performed separately for both adaptor-ligated tester DNA samples using an excess of driver DNA D). A second hybridization step is performed with fresh denatured driver DNA and the two samples from the previous step. E) A fill-in reaction is performed followed by two PCR reactions. The first PCR with a primer which sequence is found in both adaptors (primer 1), and the second one with two primers, indicated in the figure (Nested primer 1 and Nester primer 2R). The molecules type *1 will amplify linearly, since they carry only one adaptor. Molecules type *2 will likely form a panhandle-like structure due to the suppression effect. Type *3 molecules will not amplify due to the lack of adaptors. Only the molecules type *4 that have two different adaptors at their ends will be amplified exponentially. The amplified products obtained are then cloned in a PCR cloning vector.

PAGE 37

23 BAM C 58 C 60 C 62 C 64 M C 57 C 59 C 61 C 63 Figure 2-2 PCR amplifications. Five microliters from the 25 l reactions were run on a 1% Agarose gel. Products of first (A), and second round PCR (B) performed at different hybridization temperatures are shown. From left to right, M, 1 kb ladder, C, control unsubracted DNA, and SSH mix at the different temperatures shown on top of the gels. M Figure 2-3. PCR amplification from 18 random pGEMTeasy colonies using M13R and M13 primers (Appendix C) were performed and 5 l of the 25-l reactions were run in a 1% agarose gel. From left to right M, 1 kb ladder, and PCR products from 18 clones.

PAGE 38

24 A B C Figure 2-4. Dot blot hybridization of clone inserts obtained by SSH. DNA was PCR amplified with M13R and M13 primers, spotted twice on each of the membranes on each of the three membranes and each one was hybridized against 500 ng of labeled DNA from A) Xanthomonas phaseoli strain G66, B) Xanthomonas axonopodis pv. phaseoli var. fuscans strain 203B, and C) Xanthomonas axonopodis pv. alfalfae strain KX-1. Transposase Transcriptional Regualtor S-receptor kinase Hypotetical protein Pectate Lyase ABC Transporter Unknown VirB9 HrpD5 Integrase Recombinase pthA Others Figure 2-5 Chart summarizing the categories of genes obtained by SSH

PAGE 39

25 ABXPXAAXPFXPXAAXPF Figure 2-6 Southern hybridization performed with two of the genes found by SSH. From left to right /HindIII, Xanthomoas phaseoli XP (strain G66), Xanthomonas axonopodis pv. alfalfae XAA (strain KX-1), and Xanthomonas axonopodis pv. phaseoli var. fuscans XPF (strain 203B) DNA. Total genomic DNA was extracted with the Amersham total DNA kit (A) or with protocol in Appendix B, (B), digested with EcoRI and hybridized with pthA gene (pUFY 14.5) in A, or with a sequence encoding an unknown protein in B. XPXAAXPF/HindIIIXPXAAXPFXC XAAXPFXCABCXCCXCCXCAXCA/HindIII/HindIII Figure 2-7 Southern blot hybridization of three of the genes found by SSH. Total DNA from Xanthomonas axonopodis pv. phaseoli var. fuscans XPF (strain 203B), Xanthomoas phaseoli XP(strain G66), Xanthomonas axonopodis pv. alfalfae XAA (strain KX-1), Xanthomonas citri (strain 3213), Xanthomonas campestris pv. campestris (strain 528T) and Xanthomonas campestris pv. armoraciae (417T) was extracted with the Amersahm total DNA kit, EcoRI digested and run in a 0.7% gel. Blots were probed against PCR amplified internal regions of: A. A gene encoding a hypothetical protein, B. Pectate Lyase and C. A gene encoding a conserved hypothetical protein.

PAGE 40

26 XP M XP M Figure 2-8. Southern blot hybridization showing confirmation a gene encoding a hypothetical protein (XACa0025 homolog) interrupted in Xanthomonas phaseoli (XP) strain G66. From left to right: Marker (/HindIII), XP (G66) and interrupted mutant (M) digested with BglII, XP (G66) and interrupted mutant (M) digested with MluI. Table 2-1 Summary of sequences found by SSH Number of clones obtained 348 Zero trimmed 8.05% Empty vector 6.90% Passing sequences 85% Average bases reading 492 Table 2-2 Categories of genes found by SSH Gene fragment Number Percentage Transposases (different classes) 104 32.3 Transcriptional Regulator 58 18.0 S-receptor Kinase 34 10.6 Hypotetical protein 26 8.1 Pectate Lyase 23 7.1 ABC Transporter 16 5.0 Unknown 7 2.2 VirB9 5 1.6 H rpD5 3 0.9 Integrase 2 0.6 Recombinase 2 0.6 p thA 1 0.3 Others 41 12.4

PAGE 41

27 Table 2-3 Candidate genes selected from Southern hybridization Gene Organism Gene Number Pectate Lyase X anthomonas citri XAC2373 Hypothetical protein X ylella/Xanthomonas citri XACa0025, XfasA1573 Hypothetical protein R alstonia solanacearum RSp1239 Conserved hypothetical p rotein X campestris pv. campestris XCC 3132 VirB9, VirB10 X anthomonas citri XAC2620 Hypothetical protein R alstonia solanacearum RSp0593* *This gene was not interrupted

PAGE 42

CHAPTER 3 INTERRUPTION AND TRANSIENT EXPRESSION OF PTHF, AN AVRBS3/PTHA MEMBER CLONED FROM XPF Introduction All members of the Xanthomonas avrBs3/pthA gene family share nearly identical DNA sequence and are important in the pathogenicity of some Xanthomonas spp. and pathovars (De Feyter et al. 1993; Leach and White 1996). All of the predicted AvrBs3/PthA proteins have tandem leucine-rich repeats that are almost always 34 aa in length. In addition, the predicted proteins (Figure 3-1) encode nuclear localization sequences, and a C-terminal eukaryotic transcriptional activation domain (Zhu et al. 1998; Gabriel 1999). Most members of the gene family have been shown to be avirulence (avr) genes that act in a gene-for-gene fashion to elicit a hypersensitive response (HR) on plants that carry cognate resistance genes. pthA was the first member of the gene family shown to be required for pathogenicity (Swarup et al. 1991). Since then, many, but not all (three pthA homologues in X. citri have been shown to be non-functional, (Al-Saadi 2005)) gene family members have been shown to contribute to pathogenicity. For example, avrb6 allows X. c. pv. malvacearum to release many times more bacteria from infected leaves and contributes to water soaking on cotton (Yang et al. 1994), and avrXa7 has been shown to be a pathogenicity determinant of bacterial blight of rice caused by X. oryzae, (Bai et al. 2000, Yang and White 2004). At least 27 members of the avrBs3/pthA family have been identified in diverse xanthomonads (Gabriel 1999; Leach and White 1996), including Xanthomonas phaseoli 28

PAGE 43

29 (XP) and X. a. pv. phaseoli var. fuscans (XPF) (De Feyter et al. 1993, Figure 3-2). In order to clone potential avrBs3/pthA homologues from XPF and determine their possible role in common bacterial blight of beans, an XPF cosmid library was constructed. Cosmid clones containing three pthA homologues were obtained and used for complementation tests, transient expression assays and site directed mutagenesis. Materials and Methods Plasmids, Bacterial Strains and Culture Conditions Bacterial strains and plasmids used or constructed in this study are listed in Appendix A. Xanthomonas strains were grown in PYGM (Gabriel et al. 1989) at 30C, E. coli strains in Luria-Bertani (LB) medium (Maniatis et al. 1982) at 37C, and Agrobacterium strains at 30C in YEB media (Kapila et al. 1997). When appropriate, antibiotics were used at the following concentrations: ampicillin, 50 g/ml (Amp); gentamicin, 3 g/ml (Gm); rifampicin, 75 g/ml (Rif); chloramphenicol, 35 g/ml (Cm) and kanamycin (Kn), 20 g/ml. Genomic Library The XPF genomic cosmid library was constructed according to standard procedures (Maniatis et al. 1992) with some modifications. Total XPF DNA was extracted (Appendix B) and purified by cesium chloride-ethidium bromide density centrifugation. The purified DNA was partially digested with Sau3A and size-fractionated by sucrose density gradient centrifugation at 26,000 rpm for 16-18 h, and the fraction containing the appropriate fragment sizes was used for ligation into the vector. Cosmid vector pUFR043 (DeFeyter and Gabriel 1991) was used for cloning. The vector was cut with EcoRI and SalI to produce two arms and treated with alkaline phosphatase (USB

PAGE 44

30 Corporation Cleveland, Ohio) to prevent self-concatamerization. The treated vector arms were then cut with BamHI to create common cloning ends. DNA fractionated in the sucrose gradient within the size range of 30-50 kb was used for overnight ligations with T4 DNA ligase (Invitrogen Corporation, Carlsbad, CA) with the pretreated cloning vector. The recombinant DNA was packaged with packing mix using GIGAPACK Gold packaging extracts (Strategene, La Jolla, CA), and introduced into E. coli strain DH5 via transfection, according to the manufacturers protocol. Six hundred and fifty eight individual colonies were isolated on selective LB agar medium containing Gm and Kn and stored in LB broth with 14% glycerol plus antibiotics in 96 microtiter well plates and also patched onto agar plates and a nylon membrane using a replicator fork. A modified alkaline lysis procedure was used to prepare the plasmid DNA of 18 randomly picked cosmid clones (Appendix E). The plasmid DNA was digested with EcoRI and the resultant DNA fragments were separated using 0.7% agarose gel electrophoresis to determine average insert size and test for randomness of the inserts. The probe used to screen the clones was an internal BamHI fragment of pthA from pZit45 that was gel purified using QIAquick gel extraction kit according to manufacturers instructions (Qiagen, Valencia, CA). The probe was labeled with 32P by primer extension according to the Prime II kit instructions (Stratagene, La Jolla, CA). Colony and Southern hybridization (Sambrook et al 1989) were performed using GeneScreen Plus nylon membranes according to the manufacturers recommendation (Bio-Rad laboratories, Richmond, CA).

PAGE 45

31 Molecular Biology Techniques For marker interruption of the pthF homologues, pYY40.10, a clone containing a StuI-HincII internal region from pthA cloned into pUFR004 was used (Appendix A). Approximately 250 ng of DNA were electroporated into 40 l of electrocompetent X. phaseoli strain G66 and X. axonopodis pv. phaseoli var. fuscans strain 203B at 1.8 kV/cm in an Eppendorf 2510 electroporator. An additional 960 l of liquid PYGM were added to the bacteria, the culture was grown at 30C for 3 h at 120 rpm and then the whole culture was spread onto PYGM plates containing Rif and Cm at the appropriate concentrations. Colonies were purified, the DNA extracted, digested with EcoRI and BamHI then screened by Southern hybridization. For transient expression assays, a 7 kb BamHI fragment obtained from cosmid CC1 showing a hybridization signal against the pthA probe, was used to replace the BamHI fragment from pGZ6.4 (Agrobacterium vector carrying avrb6 (Duan et al. 1999)). The DNA was transferred to Agrobacterium GV2260 via triparental mating (De Feyter and Gabriel 1991). Plant Assays Inoculations were performed on Phaseolus vulgaris California Red Light Kidney bean cultivar (Appendix D). Overnight cultures were grown in liquid PYGM, centrifuged at 5,000 rpm for 5 min, washed with tap water and adjusted to an OD600 of 0.3 (approximately 108 CFU/ml). A 1:1000 dilution of this suspension was made for low concentration inoculations (approximately 105 CFU/ml). For each inoculation, 2 cm on each side of the trifoliate leaves from 4 week old plants were cut with scissors after dipping them in the bacterial suspension. Scissors were flame sterilized between

PAGE 46

32 inoculations. The plants were kept in a growth chamber at 27C with a 16 h light, 8 h dark cycle. Symptoms were scored daily for up to 3 weeks. Transient Expression Assays Agrobacterium tumefaciens strains (Appendix A) were grown overnight in YEB (Kapila et al. 1997) liquid medium supplemented with antibiotics and transferred to induction medium (YEB plus 10 mM 2-N-morpholino ethasulfonic acid [MES] pH adjusted to 5.6 and 20M of acetosyringone). The culture was grown overnight, centrifuged and resuspended in MMA medum (MS salts, 10 mM MES, 20 g/l sucrose, 200 M acetosyringone, pH 5.6) at an OD600 of 0.8 (Kapila et al. 1997). The suspension was kept at 4C for 1 h. Trifoliate leaves from California red light kidney bean plants (Appendix D) were detached and submerged in the inoculum in a Petri dish. Vacuum infiltration was applied at 27 mmHg for 10 m and then rapidly released to ensure maximum tissue infiltration by the inoculum. The leaves were washed in distilled water and the abaxial side was placed down on a Petri dish containing wet filter paper. The plates were kept in the laboratory at 24C under constant light. Thin Sections Tissue subjected to transient expression was cut into 0.5 x 0.5 cm pieces 24 h after Agrobacterium inoculation. Immediately afterwards, the tissue was infiltrated with fixation solution (Formaldehyde 10%, acetic acid 5%, ethanol 5%) for 20 m and then left shaking in the same solution at 4C overnight. The tissue was washed once with PBS at 30C, and then successively with 30, 40, 50, 60, 70, and 85% ethanol at 4C for 60 m. The last wash was performed in 95% ethanol overnight. The tissue was then washed ten times with agitation at room temperature as follows: two washes with 100% ethanol for 30 m, then two washes in 100% ethanol for 60 m, then a wash in 25% histoclear (R.A.

PAGE 47

33 Lamb, NC)-75% ethanol for 60 m, then a wash in 50% histoclear-50% ethanol for 60 m, then a wash in 75% histoclear-25% ethanol for 60 m, then two washes with 100% histoclear for 60 m and finally a wash with 100% histoclear and paraplast chips (Sigma-Aldrich, St. Louis, MO) overnight. On day four, the mix was heated at 42C to melt the chips, more chips were added until they melted and then the temperature was increased to 60C. The preparation was left for several hours at 60C, the wax was poured off and new wax was added and melted. On days 5, 6 and 7, two wax changes were performed per day and on day 8, the tissue was placed in 2 cm thick molds. On day 9 the tissue was cut into squares of about 1 x 1 x 0.5 cm with a scalpel, fixed on a piece of wood and cut with a microtome into 10 M sections. The sections were placed on slides containing 1ml of water and left at 60C for 10 m, and then at 42C overnight. The slides were stained with safranin and fast green according to Ruzin (1999). Complementation Attempts The cosmid clones that hybridized to pthA were analyzed by restriction enzyme digest profiling. Three cosmid clones that appeared to contain divergent pthA homologues (CC1, CD2 and KB4) were extracted with the high-speed plasmid maxi kit (Qiagen, Valencia, CA) according to the manufacturers instructions. Approximately 250 ng of cosmid DNA were electroporated into the mutant strains and selected as before. Colonies growing in Gm PYGM were single colony purified and used for plant inoculations. Results Cosmid Library Ten microliters of every other 0.5 ml fraction collected from the sucrose gradient were run in a 0.7% gel to select fractions with the most suitable fragment size. Fraction

PAGE 48

34 number 34 (Figure 3-3) was used for ligation into pUFR043 and 658 colonies were obtained after transfection. Eighteen of the colonies were randomly chosen for cosmid DNA extraction and EcoRI digestion. Results shown in Figure 3-4 confirmed that the library was representative. The average size of the inserts was estimated to be 41 Kb. Several Cosmid Clones Contained a Copy of Three Homologues Colony blot hybridizations performed on all 658 colonies indicated that six cosmids contained at least one copy of a potential avr/pth homolog (Figure 3-5). Southern hybridization analysis showed that at least three diverse XPF homologues were present in the library based on restriction profile with different enzymes (CC1, CD2 and KB4, Figure 3-6) and the rest of the hybridizing cosmid clones were duplicates of the same three putative genes (data not shown). The three putative genes were named pthF, pthF1 and pthF2 and the BamHI internal fragment sizes of these genes were approximately 7, 3.5 and 3.6 respectively. The cosmid clones were hybridized with probes containing the 5 and 3 ends of the pthA and were sequenced with vector-based primers to determine if the cosmids contained the entire gene homologues. Transient Expression Assays and Thin Sections A. tumefaciens strain GV2260 carrying pthA (pYD40.1) and an empty vector (pYD40.2) were used as controls (Duan et al. 1999). As shown in Figure 3-7, strain GV2260 containing pthA induced an HR after 48 hours and the empty control showed a slight chlorosis in bean leaves starting at 72 h. A. tumefaciens containing pthF (pLZ1.7) showed a blight-like phenotype, apparently different from pthA or empty vector at 72 h. Thin section experiments showed that pthF induced necrosis to a lesser extent than pthA, but pthF expression caused collapse to an extent similar to that seen with pthA (Figure 3-8).

PAGE 49

35 Attempts to Mutagenize pth Homologues Several XP and XPF colonies grew on Rf-Cm PYGM plates after attempts to marker-interrupt pthA homologues with PYY40.10. Southerns hybridization patterns similar to wild type using pthA as a probe indicated that about half of the colonies were spontaneous Cm resistant mutants (data not shown). Hybridization analyses also showed that three mutants had apparently lost an entire plasmid (F3 and F6 from XP and FF19 from XPF) and two others (F1 and F2) showed interruption of one of the small BamHI fragments (Figure 3-9, some data not shown). Some Mutants of pthF Caused a Pathogenicity Reduction None of the marker-interrupted mutants were affected in growth, in planta, pathogenicity or any other obvious characteristic. Three mutants that apparently had lost a plasmid, had also lost the ability to grow in Cm plates, and also exhibited reduced pathogenicity on bean plants (F3, F6 and FF19, Figure 3-10, some data not shown). The two mutants showing an interruption in one of the pthF genes (pthF1 or pthF2) showed no alteration of pathogenicity. Attempts to Complement Pathogenicity Deficient Mutants Three cosmid clones from the library were used for complementation assays: CC1, CD2 and KB4 carrying pthF, pthF1 and pthF2 respectively. None of the cosmid clones complemented the pathogenicity deficiency in any of the mutants (data not shown). Discussion Diverse members of the avrBs3/pthA gene family have been shown to be involved in pathogenicity in several Xanthomonas spp. They have been associated with elicitation of diverse plant phenotypes, including water soaking, hypertrophy, hyperplasia, epidermal necrosis, hypersensitive response and blight (Yang et al. 1994; Duan et al.

PAGE 50

36 1999; Yang and White 2004). In the transient assays reported here, one of the pthA homologues from XPF, pthF, consistently elicited a blight-like symptom when expressed in bean leaves. Since empty vector in Agrobacterium elicits a slight chlorosis in bean leaves, thin sections were examined to confirm the pthF-elicited phenotype observed. The analyses showed that pthF induced symptoms similar to those elicited by pthA in bean, although less necrosis was observed with pthF. In both cases the intercellular spaces were greatly reduced when compared with empty vector alone. However, pthF knock-out mutations were not obtained and therefore the potential role of pthF in pathogenicity of XPF or XP was not determined. Since fragments that hybridize to pthA have been found in all examined CBB bacteria, a role for pthF and other avrBs3/pthA genes in bean blight is likely. Marker interruption mutations in pthA homologues were all equally pathogenic to the wild type. Plasmid cured strains revealed reduced virulence when compared to wild-type strains, but these were not complemented by any of the three XPF pthA homologs. None of the mutants obtained occurred in pthF that was used for transient expression. There are several reasons that might explain why complementation of a plasmid cured strain failed when using single genes. First it is possible that additional genes present in that plasmid besides the pthF gene could also be needed for full pathogenicity. Second, it is possible that the clone chosen for complementation was not functional. Third the plasmid vector may have been unstable in XPF even though repW has been demonstrated to be highly stable in all other Xanthomonas tested, including X. citri, X. malvacearum, X. albilineans and X. campestris (De Feyter et al. 1990).

PAGE 51

37 A new study using different techniques for interruption of homologous genes is needed since Southern hybridizations showed that the plasmid containing the pthF gene was apparently lost after incorporation of the suicide vector. A different and more quantitative inoculation method also needs to be developed in order to detect possible subtle differences in pathogenicity between mutant and the wild type strains.

PAGE 52

38 | | | | | | | | | | | | | | | | NH2Repeat regionTACOOHLZ CK| | | | | | | | | | | | | | | | | | NH2Repeat regionTACOOHLZ CK| | SHABB Ss Figure 3-1 Diagram of pthF showing restriction sites and domains of the predicted protein: Leucine zipperlike area (LZ), casein kinase 2 (CK), nuclear localization signals (NLS) and transcriptional activator (TA). Letters appearing on top of the figure represent the following enzymes: BamHI (B), StuI (S), HincII (H), AatII (A) and SstI (Ss). XPF 23 Kb9 Kb6 Kb pthFpthF1pthF2 Figure 3-2 Southern blot of total DNA from XPF probed with an internal fragment from pthA. DNA from XPF strain 203B was cut with BamHI, run in a 0.7% agarose gel. Arrows indicate the locations of bands corresponding to pthF, pthF1 and pthF2. 20222426283032343623 kb_9 kb_6 kb_4.5 kb_2.2 kb_2 kb_ Figure 3-3 Fractions collected after sucrose density gradient centrifugation of XPF, partially digested Sau3A DNA were run on a 0.7% agarose gel. Fraction 34 was used for constructing the cosmid library.

PAGE 53

39 23 kb_9 kb_6 kb_4.5 kb_2.2 kb_2 kb__23 kb_9 kb_6 kb_4.5 kb_2.2 kb_2 kb Figure 3-4 Eighteen XPF cosmid clones, digested with EcoRI, and run on a 0.7% gel. Cosmid DNA from randomly chosen colonies was extracted and digested with EcoRI. The outside lanes carry marker DNA (/HindIII). A B C D E F 12345678 Figure 3-5 Colony hybridization of 48 clones from the XPF cosmid library probed with pthA. Three hybridizing clones are shown.

PAGE 54

40 1 2 3 1 2 3 1 2 3 1 2 3 1 2 3 BamHIBamHI+KpnIBamHI+PstIBamHI+SstIPstI+KpnI23 Kb9 Kb6 Kb2.2 Kb2.0 Kb Figure 3-6 Southern hybridization of the three different cosmid clones. Clones CC1 (1), CD2 (2) and KB4 (3) were extracted, digested with the indicated enzymes, run on a 0.7% gel and probed with pthA. pthFEmptyvectorpthA Figure 3-7 Transient expression of pthF and pthA in bean leaves. From left to right LZ 1.7 (pthF), pYD 40.2 (empty vector) and pYD40.1 (pthA).

PAGE 55

41 A B C Figure 3-8 Transient expression of pthF in detached bean leaves. Thin sections of A, LZ 1.7 (pthF); B, pYD 40.2 (empty vector), and C, pYD40.1 (pthA).

PAGE 56

42 23 Kb XP F3 F6 F1 F2A9 Kb6 KbBXP F3 F6 F1 F2 23 Kb9 Kb6 Kb XP F3 F6 F1 F2~15 Kb~4 KbC DE23 kb_23 kb_9 kb_9 kb_6 kb_6 kb_XPXPF3F3F6F6F1F1F2F2 Figure 3-9 Southern blot hybridization of four putative pthF mutants (F3, F6, F1 and F2) and X. phaseoli (XP) strain G66. In panels A and C the total DNA was probed with pthA and in B, with pUFR004 vector DNA. Gel D was used for blots A and B and E used for blot C. In A, B, and D total DNA was digested with EcoRI and in C and E with BamHI. The asterisk in panel C indicates pthF band. Figure 3-10 Bean leaf inoculated with F6 mutant on the right side and with the wild type XP (G66) on the left side of the leaf. The picture was taken 6 days after inoculation.

PAGE 57

CHAPTER 4 SITE DIRECTED MUTAGENESIS IN THE REGIONS IN THE C-TERMINUS OF TWO AVRBS3/PTHA MEMBERS Introduction Xanthomonas campestris pv. malvacearum (XCM) causes cotton blight and Xanthomonas citri (XC) causes citrus canker disease. Avrb6 from XCM and PthA from XC are effector genes that function in avirulence and pathogenicity and belong to the Xanthomonas AvrBs3/PthA family. These genes have been shown to contribute significantly to cotton blight and citrus canker diseases respectively (Yang et al. 1994; Swarup et al. 1991). All members of the AvrBs3/PthA family are very similar in sequence and all carry three nuclear localization sequences (NLS), a C-terminal eukaryotic transcriptional activation domain (TA), and a 34 amino acid, tandem direct repeat region (Figure 4-1, Gabriel 1999; Zhu et al. 1998). NLS, TA and repeat region domains of the protein family have been shown to be required for the specific pathogenicity and/or avirulence phenotypes that are determined by the proteins. The one notable exception is avrBs3-2 (synonym avrBsP), which elicits gene-for-gene avirulence in tomato without the NLS and/or TA domains (Canteros et al. 1991). The three NLSs function additively in avirulence and pathogenicity (Van den Ackerveken et al. 1996, Duan et al. unpublished). The repeat region is essential for host-pathogenic specificity and for gene-for-gene avirulence specificity (Yang et al.1994); the repeat region is also essential for homo-dimerization of the proteins before entering the 43

PAGE 58

44 nucleus (Gurlebeck et al. 2005). The eukaryotic transcriptional activation domain (TA) is also required for pathogenicity and avirulence (Yang et al. 2000; Zhu et al. 1998). The purpose of this study was to examine the potential role of three additional regions in the function of pthA and avrb6: a leucine zipper-like region (LZL), a casein kinase 2 (CK2) site and a randomly selected region between the LZL and CK2 (U pstream of C asein K inase (UCK)). Materials and Methods Plasmids, Bacterial Strains and Culture Conditions Bacterial strains and plasmids used or constructed in this study are listed in Appendix A. Xanthomonas strains were grown in liquid PYGM at 30C and E. coli strains were grown at 37C in Luria-Bertani (LB) medium (Maniatis et al. 1982). When appropriate, antibiotics were used at the following concentrations: ampicillin, 50 g/ml (Amp); gentamicin, 3 g/ml (Gm); kanamycin, 20 g/ml (Kn); rifampicin, 75 g/ml (Rf); spectinomycin, 50 g/ml (Sp) and tetracycline, 50 g/ml (Tc). DNA constructs were introduced by triparental mating into B21.2, and KX-1 strains (De Feyter and Gabriel 1991) and inoculated into their hosts Citrus paradise (grapefruit) and Phaseolus vulgaris (common bean), respectively (Appendix D). For introduction into HM2.2S, the DNA was first methylated as described (Yang et al. 1996), introduced into the strain by triparental mating and then inoculated on cotton (Gossypium) plants (Appendix D). Site-Directed Mutagenesis UDG cloning (Rashtchian et al. 1992, Figure 4-2) was used to introduce specific, site-directed mutations. The respective primers were synthesized by Gibco BRL (Carlsbad, CA), and are listed on Appendix C. The regions of interest were amplified using pQY107.1 as target DNA (3 end of pthA extending from the HincII site to HindIII,

PAGE 59

45 refer to Figure 4-1). For PCR standardization, 1, 10 and 100 ng of DNA template, and 0.5 mM, 1 mM and 2 mM of magnesium chloride were used with Taq Polymerase (Gibco, Carlsbad, CA) and the remaining components at concentrations recommended by the manufacturer (Gibco, Carlsbad, CA) in a 50 l PCR mix. Denaturation was at 95C for 4 m, followed by 25 cycles at 94C for 45 s, 62C for 30 s and 72C for 90 s, with a final extension of 5 m at 72C. Following amplification, 10 l of the PCR product was treated with DpnI for 30 m at 37C to degrade methylated residues in the template, and then the enzyme was heat inactivated for 30 m at 65C. The mix was then incubated with 1.5 Units of UDG at 37C for 30 m to degrade the deoxy-uracyl residues contained in the primers, followed by incubation for 10 m at 65C to both inactivate the enzyme and to melt the remaining oligonucleotides (12 bp) adjacent to the uracils. The mix was annealed at room temperature for 1 h and then transformed in DH5 without ligation. Plasmid DNA from transformed cells was extracted with the alkaline lysis protocol in Appendix E, cut with NcoI, and plasmids showing the expected restriction profile (pLZ7.1 for LZL, pUCK for UCK and pCK2.1 for CK2) were sequenced at the ICBR (Interdisciplinary center for biotechnology research) core facility (http://www.biotech.ufl.edu/Genomics/). Plasmids with the correctly mutated sequence were cut with AatII and SstI and the mutated region was substituted for the wild type region in pthA using pYD9.4 cut with SstI and then partially cut with AatII. The desired bands from pYD9.4 and pLZ7.1, pUCK1 or pCK2.1 were gel purified using Qiagen columns (Qiagen, Valencia, CA) and ligated. The resulting plasmids were cut with EcoRI-HindIII and the fragment carrying the modified pthA gene was recloned into shuttle vector pUFR047 to form pAC1.16, pAC14.1 and

PAGE 60

46 pAC6.1, respectively. The internal wild type StuI-HincII region from avrb6 was swapped with the same region in pAC1.16, pAC14.1 and pAC6.1 to form pAY8.1, pUCK3 and pALZ4, respectively. In the LZL region replaced in pAC1.16 (pthA) and pAY8.1 (avrb6), two residues were changed from leucine to methionine (L918 to M918 and L925 to M925 in pthA, and L790 to M790 and L797 to M797 in avrb6). In the UCK region replaced in pAC14.1 (pthA) and pUCK3 (avrb6), one residue was changed from arginine to proline (R955 to P955 in pthA and R827 to P827 in avrb6). In the CK2 region replaced in pAC6.1 (pthA) and pALZ4 (avrb6), one residue was changed from glutamic acid to valine (E997 to V997 in pthA, and E867 to V867 in avrb6). Plant Inoculations All citrus plants (Appendix D) were grown under greenhouse conditions and inoculated in the quarantine facility at the Division of Plant Industry, Florida Department of Agriculture in Gainesville, Florida. Cotton (Gossypium hirsutum) and common bean plants (Phaseolus vulgaris) (Appendix D) were grown under greenhouse conditions and after inoculations they were kept in growth chamber conditions with a 16 h light 8 h dark cycle at 30C. Bacterial cultures were grown in PYGM at 30C, suspended in sterile tap water to 109 CFU/ml, and inoculated into newly expanded leaves by pressure inoculation with the blunt end of a tuberculin syringe as described by Swarup et al. (1991). Results UDG Cloning Different PCR conditions were tested for the three site directed mutations performed. Figure 4-3 shows a 1% agarose gel with the products obtained at different conditions for mutation of the leucine zipper-like region. In this case, the PCR product

PAGE 61

47 obtained with 0.5 mM of magnesium chloride using 10 ng of DNA as template was used for treatment with UDG and then transformed into E. coli cells. No Change in the Non-Host HR on Bean When pZit45 (pthA) was introduced into X. axonopodis pv. alfalfae strain KX-1, it elicited a strong HR on common bean 24 h after inoculation. When the different mutated versions of pthA were introduced into KX-1 and inoculated on bean, none showed a change in the timing or intensity of the HR when compared to strains carrying pZit45, (Figure 4-4, some data not shown). No Change in Water-Soaking or the Non-Host HR on Cotton HM2.2S is an X. c. pv. malvacearum strain in which six of the twelve avr genes have been mutated, including avrb6; this strain releases approximately 1600 times less bacteria than the wild type and is nearly asymptomatic on cotton, including resistant lines (Yang et al. 1996). When avrb6 is re-introduced into HM2.2S, water soaking symptoms were restored on resistant cotton line AcalaB6. When the different mutated versions of avrb6 were introduced into HM2.2S strain, all conferred the same phenotype as the wild type gene. Mutations of CK2 or the UCK, but not LZL Region, Resulted in Reduced Canker Symptoms B21.2 carries a Tn5 mutation in pthA and is unable to induce canker on citrus; when pZit45 carrying pthA is introduced in this strain, the canker phenotype is restored (Swarup et al. 1991). B21.2 strains carrying pthA mutated in the LZL region exhibited canker symptoms comparable to that of wild type strains. However, pthA mutated in the CK2 or the UCK regions was and introduced into B21.2, reduced canker symptoms compared to strains carrying pZit45 (Figure 4-6).

PAGE 62

48 Discussion AvrBs3/PthA proteins are unique effectors with eukaryotic features. They apparently function as transcriptional activating factors, which often contain leucine zipper motifs (Jakoby et al. 2002). A detailed analysis of the amino acids present in Avrb6 and PthA showed that they do not have leucine zipper motifs, but a region very similar to leucine zippers with four hydrophobic amino acids for every seven residues. However, instead of forming an helix, which is necessary for the structure of this type of transcriptional factor, two proline residues are present in the LZL region that would break the potential helix. No difference between wild type pthA or mutated avrb6 LZL was observed in the non host-HR on bean, host HR on cotton or pathogenicity on cotton and citrus plants. The methionines used to replace the leucines in these mutants have the same neutral and hydrophobic characteristics as the leucines. It is possible that charged amino acid substitutions would have revealed a different phenotype. Some bacterial effectors are known to induce phosphorylation of host proteins that in turn activate resistance signal response cascades in plants (Mackey et al. 2002). No studies have been conducted to demonstrate phosphorylation in AvrBs3/PthA proteins, but CK2 regions are known to be important in nuclear localization (Jensen et al. 1998). Individual mutations in the CK2 and the UCK region demonstrated their importance in canker elicitation by pthA on citrus, but not in blight or water soaking elicitation by avrb6 in cotton, and not in host on non-host HR responses by either gene. The difference between the two pathogenicity phenotypes could be explained by the nature of the two diseases. While transient expression assays (canker vs. water soaking on blight) have demonstrated that pthA alone induces canker lesions in citrus leaves, similar experiments

PAGE 63

49 in cotton expressing avrb6 were unsuccessful in eliciting blight or water soaking in cotton (Gabriel lab unpublished). In addition, knock-out mutations of pthA (as in B21.2) cause reduction of growth in planta, whereas knock-out mutations of avrb6 cause no such loss of in planta growth (Yang et al. 1996). X. malvacearum carries at least six other members of the gene family, and it is likely that some other members are functional such as a partial loss of nuclear localization ability would not be detected. It is also possible that through hetero-dimerization, a partial loss of nuclear localization ability would not be detected, although hetero-dimerization has not been reported. Yang et al. (1996) reported that there are 2 CK2 sites (at positions 994-997 and 1068-1071 in pthA) and one of them was mutated in this study, possibly a non-functional one. Reanalysis of the gene family for CK2 sites also reveals the possibility that two additional sites (at positions 892-895 and 1120-1123 in pthA) are also present in the gene family.

PAGE 64

50 | | | | | | | | | | | | | | | | Repeat regionNLSTALZ CK2| | | | | | | | | | | | | | | | | | Repeat regionNLSTALZL SHABBATG Ss TGAHi Figure 4-1 Map of typical avrBs3/pthA gene. Leucine zipperlike area (LZL), casein kinase 2 (CK2), nuclear localization signals (NLS) and transcriptional activator (TA). Coding region extends from ATG to TGA and letters appearing on top of the figure represent the following enzymes: BamHI (B), StuI (S), HincII (H), AatII (A), SstI (Ss), and HindIII (Hi). A. Synthesize primersB. PCR amplifyC.Treat with UDGD. Transform withoutin vitroligation Figure 4-2 Schematic representation of the UDG cloning technique. A. Primers with uracil (U) replacing thimidine (T) are synthesized. B. PCR amplification is performed. C. Treatment with Uracyl DNA Glycosilase (UDG) D. The mix is incubated at room temperature and then transformed directly into E.coli.

PAGE 65

51 M 1 2 3 4 Figure 4-3 PCR amplification of the HincII-HindIII region of pthA in pUC19. Five microliters from of the 25-l reaction were run in a 1% agarose. From left to right: M, /HindIII marker; 1, control plasmid cut with EcoRI; 2, 2 mM MgCl2; 3, 1 mM, and 4, 0.5 mM of magnesium chloride used with 10 ng of DNA as template. Figure 4-4 California Light Red Kidney bean plant inoculated with KX-1 carrying pUFR047 (KX-1) and mutants in the leucine rich area (KX-1/pAC1.16 and 1.19). The picture was taken 36 hours after inoculation. AB123461234556 Figure 4-5 Acala 44 cotton plants (A) and AcalaB6 cotton plants (B) inoculated with: 1, HM2.2S; 2, HM2.2S containing pUFR047; 3, HM2.2S containing avrb6, 4, HM2.2S containing avrb6 mutated in Leucine zipper-like area; 5, HM2.2S containing avrb6 mutated in casein kinase 2, and 6, HM2.2S containing avrb6 mutated and upstream casein kinase (6).

PAGE 66

52 ABCDEF Figure 4-6. Citrus leaf inoculated with mutant versions of pthA in B21.2: A, F, pAC6.1 (CK2 mutated); B, pZit45 (pthA wild type); C, pUFR047 (empty vector), and D, E, pAC14.1 (UCK mutated).

PAGE 67

CHAPTER 5 INDIVIDUAL AND SEQUENTIAL MUTAGENESIS OF XCC AVR GENES, IDENTIFICATION OF A FUNCTIONAL AVR GENE, ATTEMPTS TO DEMONSTRATE HR SUPPRESSION BY AVR GENES Introduction Xanthomonas campestris pv. campestris (XCC) causes black rot of crucifers, a systemic bacterial infection that generates serious economic losses worldwide. Xanthomonas campestris pv. armoraciae (McCulloch 1929) Dye 1978b (XCA), also infects crucifer plants, but causes only localized leaf spots and hydathode necrosis (Black and Machmud 1983). Genes determining systemic movement of XCC have not yet been identified. Like most other phytopathogenic xanthomonads, hypersensitive response and pathogenicity (hrp) gene mutations in XCC result in a loss of the ability to induce a hypersensitive response (HR) on nonhosts and pathogenicity on hosts (Kamoun and Kado 1990), indicating that type III secretion is critical for pathogenicity of XCC. Diverse methods have been used to identify bacterial effectors that are secreted by the type III system (Buttner et al. 2003, Nomura and He 2005). These methods include: 1) complementation of non-pathogenic strains with a genomic library of a pathogenic strain (Chen et al.1994), 2) reporter fusion systems (Cunnac et al. 2004; Guttman et al. 2002; Roden et al. 2004a), 3) screening of genes induced in planta or co-regulated with hrp genes (Noel et al. 2001), 4) promoter-trap assays (Losada et al. 2004) and 5) suppression subtractive hybridization or SSH (Harakava and Gabriel 2003). Functional genomics techniques have become increasingly effective for elucidating pathogenicity mechanisms as more genomic DNA sequences have become available. 53

PAGE 68

54 This approach allows rapid in silico identification of potential homologous effectors. In this study, when SSH revealed that a putative avirulence (avr) effector was present in XCC but not XCA, a search of the published genome of XCC528T (synonym: ATCC33913, Xanthomonas-ONSA FAPESP network. 2001/2002) revealed a total of seven additional putative avr genes (Table 5-1). In order to determine the role of the avr genes in pathogenicity of XCC on crucifers, individual and sequential mutations were created by marker interruption in all eight avr genes. Since several studies have shown additive effects of avr genes as pathogenic effectors (Lorang et al. 1994; Yang et al. 1996; Badel et al. 2003; Wichmann and Bergelson 2004; Lin and Martin 2005), cumulative targeted mutagenesis of all eight putative avr genes was performed by using splice overlap PCR and marker interruption techniques. Materials and Methods Plasmids, Bacterial Strains and Culture Conditions Bacterial strains and plasmids used or constructed in this study are listed in Appendix A. Xanthomonas and Pseudomonas strains were grown in PYGM at 30 C and E. coli strains were grown at 37 C in Luria-Bertani (LB) medium (Maniatis et al, 1982). When appropriate, antibiotics were used at the following concentrations: ampicillin (Amp) 50 g/ml; gentamicin (Gm) 3 g/ml; kanamycin (Kn) either at 12.5 g/ml or 20 g/ml; rifampicin (Rif) at 75 g/ml, chloramphenicol (Cm) at 35 g/ml and tetracycline (Tc) at 10 g/ml. When needed, sucrose was added to a final concentration of 5%. Molecular Biology Techniques Primers used in this study were synthesized by Integrated DNA technologies, Inc. (Coralville, Iowa) and are listed in Appendix C, and enzymes used were purchased from Invitrogen Technologies (Carlsbad, California). A more suitable suicide vector was

PAGE 69

55 constructed for marker interruption experiments. pAC3.1 was constructed from pUFR004, a suicide vector, in three steps. First pUFR004 was digested with XbaI, and the recessed termini were filled with Klenow. Then it was digested with EcoRI and ligated to the kanamycin gene from pKLN66 that had been cut with BamHI, filled in with Klenow, and subsequently digested with EcoRI. The resultant plasmid was called pAC7. pUC118 was digested with BsmBI, Klenow filled, digested with EcoRI to obtain the polylinker, which was ligated to pAC7 that had been cut with EcoRI and SmaI. The resultant vector was named pAC2, a suicide vector with Cm and Kn resistance. In order to eliminate the extra BamHI site present at the 3 of the kanamycin resistance marker, pAC2 was partially digested with BamHI, filled in with Klenow and religated to form pAC3.1. For marker interruption, an internal region of the target gene was amplified with appropriate primers from a single bacterial colony touched with a toothpick and added into the PCR mix. Twenty-five microliter reactions were performed using Invitrogen Taq polymerase (Invitrogen Corporation, Carlsbad, CA) with its PCR buffer, magnesium chloride and nucleotides at concentrations recommended by the manufacturers, and with 0.4 M each primer. In order to lyse the cells and obtain the target DNA, an initial denaturation was performed at 95C for 3 m, followed by 35 cycles of 30 s at 95C, 30 s at the specified annealing temperature, 70C for the specified extension time, with a final 10 m extension at 70C. One microliter of the PCR reaction was used for cloning into TOPO vector (Invitrogen Corporation, Carlsbad, CA) using the manufacturers protocol. Except for the XopD homolog, in which the internal region was cloned in TOPO and used

PAGE 70

56 directly for marker interruption, the inserts obtained from all eight avr genes were recloned into pAC7, pAC3.1 or pUFR12 (Figure 5-1 A). For splice overlap PCR, two regions of approximately 1 kb long, upstream and downstream of the target gene were PCR amplified independently with their respective primers (primers a, b and c, d in Figure 5-1 C) in the Fail Safe PCR premix D from Epicenter (Epicenter Technologies, Madison, WI). The primers b and c (Figure 5-1 C) of each amplicon have complementary stretches in the proximal termini that will be used for annealing of the amplicon in the next step. Both products were diluted 1:25 and 1 l of each was mixed and a fill-in reaction was done in the premix D at 95C for 3 m, 50C for 1 m and 70C for 10 m in presence of Taq. After that, the external primers (a and d, Figure 5-1 C) were added at 0.5 M to the reaction and 35 cycles of PCR was performed as before. One microliter was cloned directly into TOPO, or the desired band was gel purified using Qiagen columns (Qiagen, Valencia, CA), cloned into TOPO and transformed in DH5 cells. The insert was then recloned in pUFR080 and sequenced. For the FLP recombinase excision experiments, an internal region of Xcc3731 was PCR amplified using primers AC-19 and AC-20, cloned into TOPO as described, and recloned into BY17.1 using BamHI-SstI restriction enzymes (Figure 5-1 B). Suppression Subtractive Hybridization The procedure was performed using the PCR Select Bacterial Genome Subtraction kit, (Clontech Laboratories, Inc. Palo Alto, California) according to the manufacturers instructions. XCC and XCA genomic DNA were extracted using the protocol in Appendix B. Approximately 2 g of both XCC and XCA genomic DNA

PAGE 71

57 were each cut with 15 units of RsaI for 16 hours at 37C. Half of the DNA from XCC was ligated to adaptor 1 and the other half to adaptor 2R as recommended. Digested XCA DNA was diluted and mixed with each of the XCC adaptor-ligated DNAs in separate tubes, and the samples hybridized according to Clontech instructions except the hybridization temperature which was set at 63C. The final molar ration between tester (XCC) and driver (XCA) DNAs was approximately 1 to 2.5. Amplification of SSH product was also according to Clontech instructions except that the first round of PCR amplification was performed with Nested primer 1 at 61C for 35 cycles and the second round of amplification with Nested primer 2R was at 64C for 25 cycles. Three microliters of DNA from the second PCR amplification mix was ligated into pGEMTeasy (Promega Co, Madison WI) according to the manufacturers instructions, transformed into DH5 cells and plated on LB plus Amp. DNA Sequencing and Analysis All XCC DNA clones resulting from SSH were sequenced at the ICBR (Interdisciplinary center for biotechnology research) DNA Sequencing Core Facility of the University of Florida. To confirm that the cloned DNA fragments were unique to XCC, the SSH clones were PCR amplified with vector based primers M13R (-48) and M13 (-47). Two microliters of the product from the PCR amplification was spotted twice with a VP408S2a replicator (V & P Scientific Inc., San Diego, CA) on two different nylon membranes, and also run in a 1% agarose gel to confirm that the amplified products were uniform in DNA concentration. Five hundred nanograms of total RsaI digested DNA from all strains were separately labeled with 32P with the Random Primer kit II (Stratagene) according to manufacturers protocol. The labeled DNA was used as a probe against each of the

PAGE 72

58 corresponding membranes (Figure 5-2). The DNA fragments of interest were further confirmed as XCC-specific by Southern hybridization analyses. Mutagenesis Experiments For single mutations, approximately 250 ng of the plasmid DNA was electroporated into 40 l of electrocompetent XCC strain 528T at 1.8 kV/cm in an Eppendorf 2510 electroporator. Liquid PYGM to complete 1 ml was added to the bacteria, the culture grown at 30C for 2 to 3 hours at 5000 rpm and then the entire volume was spread onto a PYGM plate containing Rif and Kn at the appropriate concentrations. The colonies growing on Kn plates were transferred to Cm plates, except for the mutant strain interrupted with a TOPO vector, which was PCR tested immediately (XopD mutant) and confirmed by Southern hybridization analysis (not shown). For splice overlap mutagenesis, colonies were also confirmed on Cm plates and then grown in liquid PYGM overnight, the OD adjusted to 0.13, and 20 ml were spread onto PYGM containing sucrose and Rif. Colonies that grew on sucrose were replica plated onto PYGM plus Kn and sucrose plates, and the colonies growing only on sucrose plates were analyzed by PCR and Southern hybridization, and selected for successive rounds of mutation. Probes used were PCR products and/or PCR products cloned in TOPO or pUFR080. For FLP recombinase eviction assays, the mutant strain was selected also on Cm plates, screened by PCR and then electroporated with 50 ng of pJR4 (Appendix A) to evict the plasmid, and selected in Gm plates. The colonies growing on Gm plates were replica plated onto Kn and plain plates. The colonies growing only on plain plates were confirmed by PCR and Southern hybridization, grown in plane PYGM overnight, and transferred to sucrose as before to evict pJR4. Colonies growing in sucrose were replica

PAGE 73

59 plated on Gm and sucrose, and the colonies sensitive to Gm were selected to perform an additional round of mutation. Growth Kinetics The abaxial leaf surface of fully expanded leaves from white turnip and Florida mustard plants (Appendix D) were syringe infiltrated with 106 CFU/ml of inoculum. Each inoculation site was flooded to achieve a zone of ca. 0.5 cm in diameter. Samples were taken in triplicate with a core-borer number 14 (22 mm diameter) to encompass the entire inoculation site starting at day 0 and every two days until day 8. The leaf tissue samples were macerated in 1 ml of 100 l of Silwett L-77 (Osi Specialties Inc., Friendly, WV) per 500 ml and CaCO3 added to saturation. They were serially diluted and plated on PYGM plates, and the colonies were counted two days after plating. The experiment was repeated twice. Electrolyte Leakage Measurements For electrolyte leakage studies, bacterial suspensions were diluted to a concentration of 106 CFU/ml in sterile tap water, inoculated by syringe infiltration and measurements were carried out as previously described (Hibberd et al. 1987). For each sample, six leaf disks were removed with a 0.5 cm cork borer number 7, submerged in 3 ml distilled water, vacuum infiltrated, shaken at 28C at low speed and after 1 h the net leakage was measured with a conductivity meter (YSI Model 31). Two samples were taken for each measurement in each experiment; the experiments were repeated three times. Complementation Assays Primers AC-35 and AC-45 (Appendix C) were used to amplify the ORF Xcc2109 (Xanthomonas-ONSA FAPESP network. 2001/2002). Primers 09-04 and AC-45 were

PAGE 74

60 used to amplify a longer ORF that includes Xcc2109 and 327 bp upstream. The two DNA sequences were cloned into TOPO PCR vector (Appendix A) and recloned into pUFR070 to form pAC10 and pAC19 respectively. Correct orientation of both clones for expression from the lacZ promoter on pUFR070 was confirmed by sequencing, and approximately 50 ng of DNA was electroporated into the individual Xcc2109 knockout mutants X48 and X109. Colonies appearing on appropriate selection media were grown in liquid PYGM supplemented with antibiotics, the cultures were centrifuged, washed with tap water, the concentration adjusted to 106 CFU/ml and the suspension was inoculated into Florida Mustard leaves by scissors clipping described in the plant assays below. Plants were scored one week after inoculation. Race Specificity Change XCC strains 6181 and 3849A, representatives of races 0 and 2, respectively (Kamoun et al. 1992, Table 5-2), were electroporated with pAC19 and pAC10 and selected on the appropriate antibiotics. Cultures were grown and inoculated in B. juncea, B. oleracea var capitata, and B. rapa plants as described for other strains of XCC. At least three plants were inoculated in each experiment, and each experiment was repeated at least once. Plant Assays All plants were grown under greenhouse conditions and are listed in Appendix D. Leaves from 3-week-old crucifers, were inoculated at two concentrations. Overnight cultures were grown in liquid PYGM, centrifuged at 5000 g for 5 m, washed with tap water and adjusted to 0.3 OD (approximately 109 CFU/ml). A 1:1000 dilution of this suspension was made for low concentration inoculation (Approximately 106 CFU/ml). For each inoculation, approximately one third of the leaves were cut with scissors after

PAGE 75

61 dipping them in the bacterial suspension. Scissors were flame sterilized between inoculations. After inoculation, the plants were maintained in a growth chamber for 14 days with a daily regimen of 16 h at 28C in the light, followed by 8 h of dark at 27C. Plants were scored every day up to 14 days. For seedling assays, B. juncea and B. olareceae var. capitata seeds were grown under continuous light at 29C. Seven-day-old plants were inoculated by pricking the hypocotyls with a 25-gauge syringe needle that was dipped into a bacterial colony. Plants were observed starting at 16 hours and for up to five days. For the non-host HR, pepper plants ECW, ECW-10R, ECW-20R and ECW-30R (Capsicum annum), were used. They were inoculated by pressure infiltration using the blunt end of a tuberculin syringe into the abaxial leaf surface at four (109, 108, 107 and 106 CFU/ml) serially diluted concentrations, and observed at 18, 24, 36 and 48 h. At least three plants were inoculated in each experiment, and each experiment was repeated at least three times. HR was observed every h starting at 12 h and for the next 36 h. Cell Death Suppression Assays pAC10, pAC19, pAC99 and pAC31 were electroporated into P. fluorescens strains 55 carrying pHIR11 or pLN18 and selected with the appropriate antibiotics. Colonies were then grown overnight in liquid PYGM suplemented with Gm, resuspended in sterile tap water at the desired concentration and inoculated in tobacco and ECW pepper plants with a syringe by pressure infiltration. Initially 55/pHIR11 carrying each one of the constructs were inoculated starting at 0.2 OD600 and at 1:5 dilutions up to 1:625. Later, 55/pLN18 transconjugants were inoculated at 0.2 OD600 and after 2 h 55/pHIR11 was co-inoculated at 1:100 dilution from the 0.2 OD600 suspension. As an expression control,

PAGE 76

62 pZit45 was introduced in 55/pLN18, selected in PYGM Gm plates, and inoculated in tomato plants at 0.3 OD600. pAC19, pAC10, pAC99 and pAC31 were electropotated into 95-2 and selected in the appropriate antibiotics. Colonies were then grown overnight in liquid PYGM suplemented with Gm, and inoculated in 30R pepper plants as before. All strains were inoculated starting at 0.3 OD600 and at 1:5 dilutions up to 1:625. Results Suppression Subtractive Hybridization A total of 226 XCC clones were obtained and subjected to dot blot analysis. This analysis showed that about half of the clones obtained were represented in both XCC and XCA (Figure 5-2). The XCC clones resulting from SSH were sequenced and the genes of interest confirmed or discarded as XCC-specific after Southern hybridization analysis (not shown). On average, the XCC fragment readings were 375 bp long. As shown in Figure 5-3, more than half of the sequences (119) corresponded to hypothetical proteins, 11 to enzymatic proteins, 2 to proteins involved in two-component system, and one to an the avirulence gene Xcc2109 (NC_003902.). No other potential plant effectors were identified. Twenty-one transposable elements and related genes were also found. Except for six of the genes found once, all gene fragments were obtained two or more times through the SSH analysis. No Evidence of Pleiotropic Pathogenicity Function by any Individual XCC avr Gene or XopD To test if the putative avr effectors identified by SSH (one) or by sequence homology (seven) (Xanthomonas ONSA FAPESP network. 2001/2002) had a function in pathogenicity, single mutations were performed by marker interruption. Mutations were

PAGE 77

63 confirmed by PCR and southern hybridization. Figure 5-4 illustrates confirmation of one of the avr mutants (X23, Appendix A). Individual mutants of the eight avr genes and the XopD homolog inoculated on cabbage at the two concentrations descibed in the materials and methods section, showed no difference when compared with wild type strain 528T at either of the concentrations used (not shown). When inoculated in other susceptible hosts: white turnip Hakurei hybrid, radish Sparkler or Seven Top turnip (Appendix D), none of the mutants showed a change in the in planta phenotype (not shown). No Evidence of Collective Pleiotropic Pathogenicity Function by all Annotated XCC avr Genes Sequential mutagenesis of all eight avr genes was performed using splice overlap PCR, FLP Recombinase and marker interruption. Two different series of additive mutations in the avr genes were constructed using X21 and X37.2 as a base to perform several rounds of mutations (Appendix A) and a mutant for the eight avr genes was obtained (Figure 5-5). None of the mutants inoculated in other susceptible hosts: white turnip Hakurei hybrid, radish Sparkler or Seven Top turnip (Appendix D), showed any difference in virulence when compared with the wild type. To further confirm that there was no effect on pathogenicity, growth curves were performed with wild type 528T and strain X8.8. Growth kinetic studies in planta using wild type 528T and strain X8.8 revealed that population dynamics in white turnip of the two strains was not significantly different up to eight days post inoculation (Figure 5-6). avrXccFM confers avirulence on B. juncea without inducing a typical mesophyl HR Strain 528T is a race 1 XCC strain that is not pathogenic on Florida Indian mustard (Florida Mustard, B. juncea, Kamoun et al. 1992). There is no plant response following low concentration inoculation (approx. 106 CFU/ml). At high (109 CFU/ml)

PAGE 78

64 inoculum concentration, a cell collapse was observed starting 15 h after inoculation (Figure 5-7). When all 528T mutant strains were inoculated at high and low concentrations by both syringe infiltration and scissor clipping, some mutants showed systemic symptoms of progressive chlorosis and necrosis outside of the immediate inoculation zone(s) as early as 4 days after inoculation (Figure 5-8), indicating a gain of virulence on this host differential. Strains carrying single mutations of Xcc2109, whether obtained by marker interruption (eg., X48) or by splice overlap PCR (eg., X109) caused systemic infection symptoms when inoculated on Florida Mustard at both high and low concentration, indicating that Xcc2109 was in fact a functional avr gene on Florida Mustard plants (Figure 5-9). The resulting mutations created a race change from the wild type 528T race 1 to race 0 (Table 5-3). No change in the tissue collapse phenotype at high inoculum concentration typical of the wild type strain was observed in any of the mutants, however the ones carrying a mutation in Xcc2109 were able to systemically produce blight symptoms (Figure 5-10). Xcc2109, a gene earlier identified by SSH, is 72% identical to avrC and 45% to avrB, both avirulence genes from Pseudomonas syringae pv. glycinea. da Silva (2002), annotated the Xcc2109 ORF as avrXccC, 996 nucleotides long and encoding 332 amino acids. pAC10 carrying this ORF fused to a 5 amino acid LacZ leader failed to complement X48 and X109. Further analyses indicated that the functional gene was more likely 1323 bp and 441 amino acids long, and started 327 bp upstream from the previously annotated start site, and additional analyses of the rest of the avr genes from 528T strain by codon preference of GCG program (Genetics Computer, Madison, WI.) showed that four of the eight genes appear to be longer than

PAGE 79

65 annotated (Figure 5-11, Table 5-4). The longer Xcc2109 gene, here designated avrXccFM (avirulence on F lorida M ustard), contains a Shine-Dalgarno region at -11 from the start site (2493758 in NC 003902) and a putative PIP -plant inducible promoterbox in the promoter region at -67 and -83 from the start site (TTCGN16TTCG). The 1323 bp avrXccFM cloned in pUFR070 conferred avirulence to X48 and X109 making the mutants, like the wild type, unable to produce disease in B. juncea (Figure 5-12). avrXccFM Is a Critical Race Determinant of XCC Strain 6181 belongs to race 0 and 3849A belongs to race 2, based on the host differentials proposed by Kamoun et al. (1992). Based on Southern blot analyses, neither strain carries a copy of avrXccFM (Fig 5-13). When pAC19 containing avrXccFM was introduced into strain 6181 (Figure 5-13), the transconjugant became less aggressive in Brassica juncea, induced the formation of smaller lesions (Figure 5-14) and bacterial titer in planta was up to 100 times lower than the wild type (Figure 5-15). Introduction of pAC19 caused a change from race 0 to a new and previously uncharacterized race (Table 5-3). When pAC10, carrying the truncated avrXccFM (Xcc2109) was introduced into either strain 6181 or 3849A, no effect on virulence was observed on the set of host differentials. When pAC19 was introduced into strain 3849A (Figure 5-13), the bacterium became avirulent on Florida Mustard plants at both high and low concentrations, causing a change from race 2 to yet another new, and previously uncharacterized race (Figure 5-14, Table 5-3). These results confirmed that avrXccFM is an active avr gene recognized by B. juncea plants

PAGE 80

66 Electrolyte Leakage Assays Showed That No Apparent Cell Death Is Involved in B. juncea Resistance No significant differences in electrolyte leakage over the first 72 h after inoculation were observed between plants inoculated with the wild type XCC strain and the mutants X48 and X7.8 (Figure 5-16). The HR eliciting strain XCA417T induced electrolyte leakage beginning 48 h after inoculation. According to electrolyte leakage experiments, no measurable cell death occurred in any of the strains tested, including the ones carrying avrXccFM (XCC528T, X52, Figure 5-16). Virulent strains with avrXccFM deleted, started to induce plant cell death 60 h after inoculation, indicative of the necrosis produced by pathogenic strains. Preliminary results also indicated no induction of electrolyte leakage when avrXccFM was present in strain 6181 (not shown). HR In B. juncea Appears to be Restricted to Cells Surrounding the Vascular System Incompatible XCC strains have been shown to induce a vascular HR (VHR) in Brassica plants (Kamoun et al. 1992). Seedling assays experiments performed in B. juncea showed that the incompatible 528T consistently induced a VHR starting at 24 h after inoculation. In contrast, the compatible mutants X48 and X8.10 failed to induce a necrotic response and resulted in a null reaction (Figure 5-17, Table 5-5), confirming that a localized HR occurs, and appears to be restricted to cell layers surrounding the vascular system (Bretschneider et al. 1989) Non-HR Resistance Response in Arabidopsis was Not Affected in Any of the Mutants X. campestris pv. campestris is a pathogen of A. thaliana plants and four general phenotypes induced by different XCC strains have been identified in different Arabidopsis ecotypes: susceptibility, tolerance, HR-resistance and non-HR resistance (Buell 2002). Ecotypes Col-1 and Co-i showed a non-HR resistance against XCC 528T

PAGE 81

67 strain. Some of the avr mutant strains obtained including X8.8 were inoculated in this plant species and none of them had any apparent effect in the resistance phenotype (not shown). Non-host HR Was Not Altered in Strains Carrying Mutations in avr Genes Inoculation of pepper plant cultivars with all mutant strains at different concentrations showed no change in the non-host hypersensitive response (HR) after 48 hours in any of the cultivars tested. All strains elicited an HR typical of the wild type at bacterial concentrations above approximately 107 CFU/ml (not shown). HR Induction by a P. syringae Gene Was Not Inhibited by XCC avr Genes P. fluorescens 55 carrying pHIR11 cosmid induces a HR in tobacco and pepper due to the presence of a functional hrp system and HopPsyA and its chaperon protein (SchA) from P. syringae pv. syringae (Appendix A, Jamir et al. 2004). Strain 55/pHIR11 also carrying three of the avr genes (Xcc2100, avrXccFM and Xcc3731) showed a reduction in the HR response elicited in tobacco and pepper at 107 and 106 CFU/ml (Figure 5-18). Coinoculations of a non-HR inducing P. fluorescens with a functional hrp system (55/pLN18) carrying Xcc2100, avrXccFM and Xcc3731 genes, and later with 55/pHIR11 did not show any reduction in HR at any of the concentrations tested (not shown). As control, pZit45 that contains pthA gene was electroporated into 55/pLN18 since X. strains induce HR in tomato cultivars when carrying this clone. However, when pZit45 was introduced into P. fluorescens as an expression control, no HR was observed in tomato (not shown). As another attempt to detect HR suppression mediated by avr genes, a X. vesicatoria strain (95-2 carrying avrbs3) that induces an HR response in 30-R pepper plants, was used. Strains 95-2 also carrying three avr genes (Xcc2100, avrXccFM and

PAGE 82

68 Xcc3731) showed no HR reduction or change at any of the concentrations tested (not shown). Discussion Genomic analyses of XCC528T indicate that numerous horizontal gene transfer events probably occurred (da Silva et al. 2002). At least 109 genes related to transposable elements were identified, as well as extended regions with low GC content and uncommon codon usage (da Silva et al. 2002) and 285 genes present in XCC528T appear to have been acquired horizontally (Garcia-Vallv et al. 2003), including three of the eight putative avr gene homologs investigated in this study. It is often assumed that when avr genes are acquired by bacteria through horizontal gene transfer, they become fixed in the genome because they confer a selective advantage to the pathogen as effectors by increasing their pathogenicity and expanding their host range (Alfano and Collmer 2004; Rohmer et al. 2004). Pleiotropic pathogenicity effects are a common feature of avr genes and have been reported in several pathogen species (Abramovitch et al. 2003; Alfano and Collmer 2004; Badel et al. 2003; Bogdanove et al. 1998; Kearney and Staskawicz 1990; Lorang et al. 1994; Swarup et al. 1992; Yang et al. 1996; Wichmann and Bergelson 2004). Once fixed in the genome, the % G+C content of an acquired gene with selective value may gradually evolve to match that of the recipient (Lawrence and Ochman, 1997), and other characteristic features indicative of horizontal transfer may be lost as well (Hacker and Kaper 2000). Since five of the eight putative XCC528T avr genes have not been identified as being horizontally transferred (Garcia-Vallv et al. 2003), a selective value in terms of pathogenicity for these five would seem particularly likely.

PAGE 83

69 Nevertheless, none of the eight putative avr gene loci, when deleted or interrupted in XCC528T, affected pathogenicity on any of the six cruciferous host differential species tested. Indeed, they did not appear to confer any pathogenic effect even in an additive way, as inoculations of strain X8.8 (all eight putative avr gene loci mutated) was as pathogenic as the wild type when inoculated onto five susceptible Brassica species. In addition, growth curves showed no difference between wild type and X8.8 in white turnip plants. Some effector genes found in Pseudomonas spp., including avr genes, are known to suppress host defenses as indicated by suppression of the HR (Abramovith et al. 2003; Alfano and Collmer 2004). However, none of the avr gene mutations, singly or in any combination, affected the non-host HR elicited by XCC strains on pepper plants (data not shown). In addition, three putative XCC avr genes (Xcc2100, Xcc2109 and Xcc3731), cloned and expressed in X. axonopodis pv. vesicatoria strain 95-2, failed to suppress the HR elicited by this strain on Capsicum annum 30R plants carrying the Bs3 gene (data not shown). The initial results of apparent HR inhibition by avr genes in P. fluorescens inoculated in tobacco and pepper were not considered, since a P. fluorescens transconjugant control carrying an XCC gene did not elicit the expected response in tomato. The reasons for this phenomenon could be explained by earlier observations that some effectors can block the type three-secretion system (Jamir et al. 2004) inhibiting delivery of HR-inducing genes. Other explanation could be that Xanthomonas proteins are either not expressed or not delivered by Pseudomonas host, or that the vector used (pUFR070) could be unstable in Pseudomonas.

PAGE 84

70 A few putative non-avr effector genes have been identified in XCC based on sequence similarity to Ralstonia, Pseudomonas and Xanthomonas type III secreted proteins, but only one has some experimental support as an effector in Xanthomonas. This ORF, classified as psvA (Xcc2896) by da Silva (2002), is 71% identical to xopD from X. c. vesicatoria and since it was shown to be secreted through the hrp system and to have s mall u biquitin-like mo difier (SUMO) proteolytic activity (Noel et al. 2002, Roden et al. 2004b), this gene was included in the present study. As with many effector genes, it was proposed as to have been horizontally acquired (Garcia-Vallv et al. 2003). However, interruption of the homologue in XCC alone or in combination with others (not shown) did not show any effect on XCC pathogenicity on any of the hosts tested. Among the one putative xopD effector gene and the eight putative XCC528T avr genes experimentally investigated here, only avrXccFM appeared to function non-redundantly as an effector; since avrXccFM was found to confer avirulence on Florida Mustard. Deletion and insertion mutations of this gene in strain XCC528T, which is avirulent on Florida Mustard, enables the mutant bacterium to become virulent on this differential host. The truncated, annotated version of avrXccFM, Xcc2109, was identified as likely acquired by horizontal gene transfer (Garcia-Vallv et al. 2003). When avrXccFM was transferred to other races of XCC pathogenic in B. juncea, the bacteria became either avirulent in the case of race 2 strain 3849A, or much less virulent in the case of race 0 strain 6181 (Table 5-4, Figure 5-14, Figure 5-15). The visible although smaller lesions observed in the latter case might be due to: 1) poor gene expression in this strain; 2) a defense suppression mechanism specific to this strain; 3) lack of a chaperone-like protein or an imperfectly functioning chaperone-like protein

PAGE 85

71 required for delivering into the host. We favor the latter explanation because chaperone-like proteins have been identified as important secretion co-factors for some avr genes (Alfano and Collmer 2004) and in particular, lack of an avrBs3 chaperone in X. vesicatoria resulted in a reduced HR elicited by avrBs3 on pepper (Buttner et al. 2004). Despite the avirulence phenotype (eg., no disease development) elicited by avrXccFM in XCC strains on Florida Mustard, repeated attempts to detect a leaf HR elicited by avrXccFM failed. In all comparisons of avrXccFM mutants (or transconjugants carrying avrXccFM) to the wild type, a tissue collapse identical to that elicited by the wild type was observed, starting at 15 h after inoculation with 109 CFU/ml (not shown). However, in the avrXccFM mutants, systemic disease symptoms develop starting after 4 days. In order to help confirm resistance to XCC in the absence of a leaf HR with Florida Mustard, electrolyte leakage experiments were performed. When inoculated at low bacteria concentration (106 CFU/ml) Florida Mustard is capable of an HR response to at least some xanthomonads such as wild type XCA, beginning at 48 h after inoculation, that was coincident with electrolyte leakage (refer Figure 5-16). However, there was no evidence of an HR response to any XCC strain carrying avrXccFM, and an increase in electrolyte leakage was first detected only beginning at 72 h after inoculation in strains not carrying avrXccFM. Attempts to detect a VHR (Kamoun et al. 1992) were successful and a seedling assay showed a localized necrosis around the inoculation site starting at 24 h after inoculation when avrXccFM was present, while the compatible responses in the absence of avrXccFM resulted in a null reaction (Figure 5-18, Table 5-5) and later developed in disease (not shown). Earlier reports also

PAGE 86

72 associated resistance in crucifers with this phenotype and showed that only the cells surrounding the vascular system appear to be affected (Bretschneider et al. 1989). XCC was proposed to be comprised of five races, based on disease reactions using three differential Brassica species: B. oleracea, B. rapa and B. juncea (Kamoun et al. 1992). We based our race analyses on this system. Vicente et al. (2001) proposed a new race defined by the additional host differentials B. carinata PI199947 and B. oleracea Miracle F1; however, we could not reproduce the race reactions on these additional differentials as proposed. It is possible that there is significant genetic variation within these varieties. A report by Ignatov et al. (2003) suggested that in addition to the HR response in pepper plant cultivar 20R, an avrBs2 homologue was involved in avirulence in Brassica plants with the B genome, which includes Brassica juncea and Brassica carinata. However, our analysis showed that a deletion of the entire putative avrBs2 homolog, Xcc0052, alone or in combination with other avr gene deletions (Figure 5-5), did not have any effect on either pathogenicity or avirulence phenotypes in any host or non-host plants tested (not shown). Besides the putative avr effectors and xopD examined in this study, eight additional putative XCC pathogenicity effectors identified in silico at present remain to be experimentally tested for function (Table 5-6). These include two leucine-rich proteins having PIP boxes (Xcc2565 and Xcc4186) identified by da Silva et al. (2002); two genes identified as type III secreted (Xcc1072 and Xcc1247) by Roden et al. (2004a), and four genes identified as type III secreted proteins (Xcc1246, Xcc3258, Xcc1089, and Xcc3600) by Rohmer et al. (2004) and Genin et al. (2004).

PAGE 87

73 With the exception of avrXccFM, which functioned for avirulence, there was no evidence found that any of the other eight putative effector genes tested were functional as plant effectors. There are a number of possible explanations for the result. First, it is possible that the putative avr effectors are pseudogenes or poorly expressed. Second, these genes may encode proteins with defective secretion signals, and fail to be recognized by the Type III secretion system or by a required chaperone; at least some effectors appear to require chaperones for secretion (Alfano and Collmer, 2004). Third, it is also possible that some of these genes were horizontally acquired without their chaperones, which are usually closely linked to the effector (Alfano and Collmer 2004), and so fail to be secreted. However, these explanations seem generally unlikely for all eight of the putative effectors. A more likely possibility is that the assays for pathogenicity were not sensitive enough in growth chambers or not done in the right context to detect a change in pathogenicity phenotype (Chang et al. 2004). Wichmann and Belgerson (2004) showed that the mutation of three avr genes in Xanthomonas axonopodis pv. vesicatoria had no effect on pathogenicity in experiments performed in a growth chamber, but when the same mutants were inoculated in the field, in combination with an additional mutation in a avrBs2, they showed a large additive effect on pathogenicity. The four avr genes aided in epiphytic survival, in planta growth and lesion development, and apparently interacted with each other in different ways. Field experiments would need to be conducted with the XCC mutants to determine if these putative homologs affect pathogenicity under field conditions. In these experiments, all of the putative avr genes present in the genome

PAGE 88

74 were disrupted or removed. However, it seems unlikely that additive effects on pathogenicity would not be detected in a growth chamber, if all avr genes were deleted. We favor the idea that horizontal transfer of an effector gene to a recipient that does not colonize the same host as the donor should result in the effector being secreted into plant cells for which the effector is unadapted and without conferring any selective value. This idea is based on three facts. First, the type III secretion machine is indiscriminate, secreting all available effectors with a type III signal into both host and non-host cells alike (Silhavy 1997; Jin et al. 2003; Rossier et al. 1999). Second, horizontal gene transfer is by nature a random, stochastic event. Third, effectors are in most cases host-specific. For most putative effector genes, with or without evidence of horizontal transfer, no associated fitness benefit has been found so far (Wichmann and Bergelson, 2004, Chang et al. 2004). Effectors may or may not be recognized as avr genes, depending entirely on the existence of an appropriate indicator plant with a cognate R gene. Horizontal transfer of effector genes should therefore result in the presence in any given pathogenic strain of genes annotated as effector homologs, but which are gratuitous or even detrimental in terms of pathogenicity or other fitness function.

PAGE 89

75 A B pBY18.1KnCm+ FLP recombinase abcdadC Cm pUFR080KnSacB pAC3CmKn Figure 5-1. Mutagenesis strategies used. A) In marker insertion, a duplication of the homology region occurs and the gene gets interrupted by the suicide vector. B) FLP recombinase. The vector gets integrated as in A) and then the FLP recombinase evicts DNA regions that are between FRT sequences (Hoang et al. 1998). C) Splice overlap PCR (Horton et al. 1989). One region upstream and one downstream of the target gene are PCR amplified and then mixed to produce a region lacking the target gene. The PCR product is cloned into a suicide vector containing the SacB gene (pUFR080). Double recombination occurs and as a result, a deletion in the target gene is obtained. Arrows represent primers. Filled arrows represent FRT (Flip recognition target) sites. Regions of homology are shown in boxes with vertical lines.

PAGE 90

76 A B Figure 5-2. Dot blot of SSH clones hybridized against total DNA from. A. XCC B. XCA digested with RsaI. 3%3%3%3%3%70%6%3%6% Hypothetical protein Pil Glycosiltransferases Two component Sensor kinase Regulatory proteins Kinase Avirulence gene(Xcc2109) Anticodon nuclease Figure 5-3. Functional categories of gene fragments found in XCC-XCA (Xanthomonas campestris pv. campestris-Xanthomonas campestris pv. armoraciae) following Suppression Subtractive Hybridization (SSH) and identified in NC_003902

PAGE 91

77 BCA D M 1 2 3 4 5M 1 2 3 4 51 2 3 4 5 Figure 5-4. PCR performed in mutant X23. A. Map of Xcc2396 gene interrupted. Blue arrows represent vector-based primers, black arrows represent external primers, dashed box represent duplicated region, blue region between them represents integrated vector. B. PCR with external primers. M is /HindIII C. PCR with vector based-upstream primers. M is 1kb ladder D. PCR with vector based-downstream primers 1 is wild type and 2 to 5 show individual mutant colonies. Figure 5-5. Southern blots of XCC528T wild type and X8.8 (mutated in eight putative avr genes) DNAs digested with EcoRI. On each blot, from left to right: HindIII marker, wild type 528T, and the mutant strain X8.8. Except for Xcc1629 that was interrupted and Xcc3731 that was flipped, the avr genes were deleted by splice-overlap PCR. Probes used were DNA fragments amplified with the following PCR primer sets or DNA fragments amplified and cloned in TOPO or pUFR080: A) 52C-52D* to detect Xcc0052 deletion. Xcc0052 has an EcoRI site that is lost and consequently an 11 kb band becomes a 16.2 kb band. B) AC5-AC-6 to detect Xcc1629 interruption. The integration of the suicide vector introduces a new EcoRI site and a 2.1 kb band becomes two 5.8 kb and 2.1 kb bands, C) 2099A-2099D to detect both Xcc2099 and Xcc2100 deletion. A 11.3 kb band becomes a 8.4 kb band, D) AC35-AC45 to detect Xcc2109 deletion. A 10.5 kb becomes a 9.4 kb band, E) 2396A*-2396D to detect Xcc2396 deletion. A 12.4 kb band becomes a 10.3 kb band, F) AC32-AC48 to detect Xcc3731 interruption by FLP recombinase. A 7.5 Kb band turns to one 9 kb band due to an internal region duplication and the remains of pAC3.1 vector after flipping the vector out. G) 4229A-4229D to detect Xcc4229 deletion, the fragment deleted contained an EcoRI site. In the mutant, two bands of 1.6 and 2.8 kb become a 2.5 kb band.

PAGE 92

78 012345678902468Days after inoculationLog 10 (CFU/4 cm2) 528 8.8 Figure 5-6. Growth of XCC528T and X8.8 (all eight avr genes interrupted or deleted) in white turnip Hakurei Hybrid. AB Figure 5-7. Inoculation of 528T in B. juncea by A. Infiltration at high concentration 24 h after inoculation and B. Scissorsinoculated at low concentration shown at 7 days after inoculation. A B Figure 5-8. Clipping inoculation of some of the mutants inoculated in Florida Mustard in an initial screen. Wild type strain was inoculated on the left side of the leaf and X2.1 (A) and X5.5 (B) on the right of the leaf.

PAGE 93

79 AB Figure5-9. Strains carrying single mutation in Xcc2109. On the left inoculated with wt strain and on the right single mutation in Xcc2109 obtained by splice overlap PCR X48 (A) and marker interruption X109 (B). Figure 5-10. B. juncea leaf inoculated by syringe infiltration at high concentration inoculum. On the right infiltrated with XCC528T and on the right with X48. Picture taken one week after inoculation.

PAGE 94

80 C A BD Figure 5-11. Codon preference analyses performed on four avr genes by GCG. A. Xcc1629, B. Xcc2099, C. Xcc2109 and D.Xcc3731. The Y axis on the left represents codon preference and the Y axis on the right represents third position bias. AB Figure 5-12. Complementation tests in B. juncea. Mustard plants inoculated with X48 (A) and X109 (B) on the left side of the leaves and in the right side with complementing strains X52 and X113 respectively.

PAGE 95

81 M1 2 3 4 5 6 7 Figure 5-13. Different strains representing three races of XCC probed against avrXccFM. Total DNA was digested with EcoRI and in the gel loaded in the following order: from left to right M: /HindIII, 1: 528T, 2: X48, 3:X52, 4: 6181, 5: 6181/avrXccFM, 6: 3849A, 7: 3849A/avrXccFM. Figure 5-14. Race change of two XCC strains in Florida mustard inoculated by clipping. The wild type strain was inoculated on the left and the transconjugants carrying avrXccFM on the right. A. 6181, B. 3849A. Inoculated areas are shown with asterisks.

PAGE 96

82 0246810027Days after inoculationLog10 (CFU/4 cm2) 6181 6181/avrXccFM Figure 5-15. Growth of XCC6181 and X83 (6181/avrXccFM) syringe infiltrated in Florida Mustard plants. 050100150200250300350400024487296120Hours after inoculationuMHOS 528 48 52 7.8 417 Figure 5-16. Time course of electrolyte leakage from leaves of Florida Mustard plants inoculated with four different strains of XCC (XCC528T, X48, X52, X7.8) and one of XCA (417T).

PAGE 97

83 Figure 5-17. Seedling assay performed B. juncea plants. The two plants on the left were prick inoculated with 528T and the two plants on the right with strain X48. The sites of inoculation are circled. ABCDEABCDE Figure 5-18. Apparent HR suppression by avr genes from XCC in pepper (left) and tobacco plants inoculated with Pseudomonas fluorescens at 107 CFU/ml. A. pHIR11, B. pHIR11/pAC99, C. pHIR11/pAC10, D. pHIR11/pAC19, E. pHIR11/pAC31.

PAGE 98

84 Table 5-1 List of genes classified as avr in XCC528T Gene Number avr homolog Identity Bacterial species Xcc0052 avrBs2 76% X. vesicatoria Xcc1629 avrPphE 26% P. syringae pv. syringae Xcc2099 avrBs1 100% X. vesicatoria Xcc2100 avrBs1 99% X. vesicatoria Xcc2109 avrB 73% P. syringae Xcc2396 avrxcA 25% Pectobacterium carotovorum Xcc3731 avrBsT 20% X. vesicatoria Xcc4229 avrXca 88% X. armoraciae From Xanthomonas ONSA FAPESP network. 2001/2002 Table 5-2 Races in XCC Races Hosts 0 1 2 3 4 Genome Cabbage (B. oleraceae var. capitata) C + + + + + Just right turnip (B. rapa) A + + + + Seven Top turnip (B. rapa) A + + Florida Broadleaf Indian mustard (B. juncea) AB + + From Kamoun et al. 1992 + Black rot symptoms Null phenotype Table 5-3. Race changes due to the presence of avrXccFM Differentials Strains Early Jersey Wakefield B. oleracea Just Right Turnip B. rapa Seven Top Turnip B.rapa Florida Mustard B.juncea Race 528T(avrXccFM) 1 + + + X48 (528TavrXccFM) 0 + + + + X52 (528T avrXccFM/avrXccFM) 1 + + + 6181 0 + + + + X83 (6181/avrXccFM) ? + + + (+) 3849A 2 + + + X54 (3849A/avrXccFM) ? + + + Black rot symptoms Null phenotype (+) Reduced black rot symptoms ? Not characterized

PAGE 99

85 Table 5-4. Actual sizes of four of the avr genes according to our analyses. avr gene Annotated Actual size Position annotated Actual position Xcc1629 1068bp-356aa 1353bp-451aa 1899569-1900636 1899287-1900640 Xcc2099 315 bp-105aa 1068-356aa 2480823-2481137 2480067-2481135 Xcc2109 996bp-332 1323bp-441aa 2492436-2493431 2493758-2493431 Xcc3731 708bp-236 aa 1086bp-361aa 4438603-4439310 4438603-4439686 Table 5-5. Seedlings assay for Vascular Hypersensitive Response (VHR) Xanthomonas strain B. juncea VHR Percentage B. oleracea VHR Percentage 417T 92 85 528T 73 0 X48 15 0 X52 67 ND X8.10 0 0 Table 5-6. List of additional putative effectors Name Homolog genes Number HGT PIPbox Hypothetical protein XopQ-HolPtoQ Xcc1072 NO NO Transducer protein car HolPtoR Xcc1089 NO NO Conserved hypothetical protein Hrp Box protein-avrPphE Xcc1246 YES NO Conserved hypothetical protein XopP Xcc1247 NO NO Leucine rich protein None Xcc2565 NO YES Virulence protein PsvA-XopD Xcc2896 YES NO Conserved hypothetical protein HopPtoH Xcc3258 YES YES Hypothetical protein HopPtoG Xcc3600 NO YES Leucine rich protein None Xcc4186 YES YES HGT Predicted to be horizontally transferred PIP Plant inducible promoter

PAGE 100

CHAPTER 6 SUMMARY AND CONCLUSSIONS Xanthomonads cause devastating diseases worldwide, in crops that are important for human nutrition. As many more animal and plant pathogens, they carry a diverse array of secretion systems that allow them to inject and secrete proteins into their environment, in order to obtain their nutrition. Among them, type III secreted proteins have been proven to be involved in pathogenicity and hypersensitive response in plants. The battery of proteins secreted through this system has been recently proposed to be up to 40 or 50 in Pseudomonas species. By using different techniques, several candidates, including few type III secreted proteins, were identified and by functional analyses we concluded: 1. avrXccFM identified by Suppression Subtractive Hybridization in Xanthomonas campestris pv. campestris, confers avirulence against Florida broadleaf Indian mustard, a differential host. 2. Complementation tests confirmed that the functional gene was 327 bp and 109 aa longer than the annotated one. 3. The avr genes showed no effect in pathogenicity either individually or additively, in any of the susceptible hosts tested. 4. Mutation of a pthA homolog gene (pthF) on both common bacterial blight of bean complex (Xanthomonas phaseoli and Xanthomonas axonopodis pv. phaseoli var. fuscans) showed pathogenicity reduction. However complementation attempts failed. 86

PAGE 101

87 5. Transient expression assays of pthF isolated from Xanthomonas axonopodis pv. phaseoli var. fuscans in detached bean leaves induced a blight-like phenotype. Additional analyses need to be done in order to characterize the rest of effectors identified by homology in Xanthomonas campestris pv. campestris and to confirm the role of pthF in blight phenotype caused by the common bacterial blight complex.

PAGE 102

APPENDIX A BACTERIAL STRAINS AND PLASMIDS Strains Relevant Characteristics Reference or Source E. coli E. coli DH5 F-, endA1, hsdR17 (rk-mk-), supE44, thi-1, recA1 gyrA, relA1, f80dlacZDM15, D (lacZYA-argF)U169 Invitrogen Corporation Carlsbad, California E. coli DH5-T1 F80dlacZM15 (lacZYA-argF) U169 recA1 endA1 hsdR17 (rk-, mk+) phoA supE44 thi-1 gyrA96 relA1 Invitrogen Corporation Carlsbad, California Xanthomonas 95-2 Xanthomonas axonopodis pv. vesicatoria, wild type RifR avrBs3+ Minsavage, personal communication HM2.2S Xanthomonas axonopodis pv. malvacearum avrB4-, avrB5avrB6-, avrBIn-, avrB101-, avr102-SpR Yang et al. 1996 B21.2 pthA::Tn5-gusA, marker exchanged mutant of 3213 SpRKnR Swarup et al 1991 KX-1 X. axonopodis pv. alfalfae wild type, SpR Lazo et al 1987 203B Xanthomonas axonopodis pv. phaseoli var. fuscans wild type RifR DeFeyter et al 1991 G66 Xanthomonas phaseoli wild type RifR DeFeyter et al 1991 F3 G66 pthF::pUFR004 RifR CmR This work F6 G66 pthF::pUFR004 RifR CmR This work FF19 203B pthF::pUFR004 RifR CmR This work 3849A Xanthomonas campestris pv. campestris wild type Race 2 Kamoun and Kado 1992 6181 Xanthomonas campestris pv. campestris wild type Race 0 Vicente et al. 2001 417 Xanthomonas campestris pv. armoraciae wild type RifR Alvarez et al. 1994 528T derived strains 528T Xanthomonas campestris pv. campestris wild Type Rif R Race 1 Alvarez et al. 1994 X05 Xcc0052::pAC7 RifR KnR This work 88

PAGE 103

89 Strains Relevant Characteristics Reference or Source X16 Xcc1629::pUFR12 RifR KnR This work X99 Xcc2099::pAC7 RifR KnR This work X100 Xcc2100::pAC7 RifR KnR This work X109 Xcc2109::pAC7 RifR KnR This work X23 Xcc2396::pAC7 RifR KnR This work X37.1 Xcc3731::pAC7 RifR KnR This work X42 Xcc4229::pAC7 RifR KnR This work X48 Xcc2109 RifR This work X37.2 Xcc3731::FRT RifR KnR This work X44 Xcc2896::TOPO RifR KnR This work X49 Xcc2099, Xcc3731::pAC3 RifR KnR This work X21 Xcc2099, Xcc2100 RifR This work X4.4 Xcc0052, Xcc3731::FRT RifR This work X4.1 Xcc3731::FRT, Xcc2099, Xcc2100 RifR This work X5.1 Xcc2099, Xcc2100, Xcc2109 RifR This work X6.1 Xcc0052, Xcc2099, Xcc2100 RifR This work X12.1 Xcc3731::FRT, Xcc2099, Xcc2100, Xcc2109 RifR This work X2.1 Xcc0052, Xcc2099, Xcc2100, Xcc2109 RifR This work X1.1 Xcc0052, Xcc2099, Xcc2100, Xcc2109, Xcc3731::FRT RifR This work X5.5 Xcc0052, Xcc2099, Xcc2100, Xcc2109, Xcc2396 RifR This work X6.6 Xcc0052, Xcc2099, Xcc2100, Xcc2109, Xcc2396, Xcc3731::FRT RifR This work X6.7 Xcc0052, Xcc2099, Xcc2100, Xcc2109, Xcc2396, Xcc4229 RifR This work X7.7 Xcc0052, Xcc2099, Xcc2100, Xcc2109, Xcc2396, Xcc3731::FRT, Xcc4229 RifR This work X7.8 Xcc0052, Xcc2099, Xcc2100, Xcc2109, Xcc2396, Xcc3731 Xcc4229 RifR This work X8.8 Xcc0052, Xcc1629::pUFR12, Xcc2099, Xcc2100, Xcc2109, Xcc2396, Xcc3731:FRT, Xcc4229 RifR KnR This work X8.10 Xcc0052, Xcc2099, Xcc2100, Xcc2109, Xcc2396, Xcc2896::TOPO, Xcc3731, Xcc4229 RifR KnR This work X52 X48/pAC19 RifR GmR This work X113 X109/pAC19 RifR KnR GmR This work

PAGE 104

90 Strains Relevant Characteristics Reference or Source Pseudomonas fluorescens 55 Wild type, NmR Jamir et al. 2004 Agrobacterium tumefaciens GV2260 RifR Duan et al. 1999 Plasmids 124.4 IncP, Mob+ containing methylases XmaI and XmaIII TcR De Feyter et al. 1991 138.22 avrb6 in pUFR047 AmpR GmR De Feyter et al. 1993 FLP2 ColE1, AmpR, SacB, FLP under Cro promoter GmR Hoang et al. 1998 pAC1.16 Change L918 to M918 and L925 to M925 in pZit45 AmpR GmR This work pAC3.1 pAC7 was cut with EcoRI and SmaI and the poly linker from pUC118 was cut out with BsmBI, Klenow filled, cut with EcoRI and ligated together. To eliminate an extra BamHI site it was partially cut with BamHI, treated with Klenow and religated to form pAC3.1. ColE1, Mob+, lacZ+, CmR KnR This work pAC6.1 Change from E997 to V997 in pZit45 AmpR GmR This work pAC7 pUFR004 cut with XbaI, filled with Klenow. Cut with EcoRI and ligated to the kanamycin gene from pKLN66 that was cut with BamHI, filled with Klenow, and cut with EcoRI. ColE1, Mob+, CmR KnR This work pAC10 996 bp Xcc2109 region into pUFR070 as described in NC_003902 CmR GmR This work pAC14.1 Change from R955 to P955 in pZit45 This work pAC19 1323 bp region encompassing Xcc2109 (avrXccFM) into pUFR070 CmR GmR This work pAC31 Xcc3731 into pUFR070 as described in NC_003902 CmR GmR This work pAC99 Xcc2100 into pUFR070 as described in NC_003902 CmR GmR This work pAY8.1 Change from L790 to M790 and L797 to M797 in avrb6 in pUFR047 AmpR GmR This work pAY12.1 Change from R827 to P827 in pthA in pUC19 AmpR This work pAYLZ4 Change from E867 to V867 138.22 AmpR GmR This work Plasmid Relevant Characteristics Reference or Source

PAGE 105

91 pBY17.1 pAC3.1 with FRTs from sites in the in the cloning site KnR CmR Castaeda et al. unpublished pGEMTeasy PCR cloning vector. AmpR Promega Corporation, Madison, WI pGZ6.4 avrb6 in binary vector pB48.212, double 35S promoter KnR Duan et al. 1999 pHIR11 pLAFR3 derivative containing 25-kb P. syringae pv. syringae 61 hrc-hrp cluster including shcA and hopPsyA TcR Jamir et al. 2004 pJR4 IncW, Mob+, lacZ+, Par+, SacB, FLP under Cro promoter, GmR AmpR Castaeda et al. unpublished pKLN66 Kn gene in pGEMTe derivative of pKLN56 Newman et al. 2003 pLN18 pLAFR3 derivative containing 25-kb P. syringae pv. syringae 61 hrc-hrp cluster with shcA and hopPsyA replaced by an nptII cassette, TcR KmR Jamir et al. 2004 pLZ1.7 L to M in LZL region included in AatII-StuI band of pthA gene pUC19 AmpR This work pLZ7.1 BamHI fragment from pthF into BamHI site of Agrobacterium vector pYD 40.2 KnR This work pQY 107.1 HincII-HindIII region of pthA in pUC19 AmpR Unpublished Duan et al. pQY 113 EcoRI-HincII region from avrb6 in pUC19 AmpR Yang et al. 1996 pRK2013 ColE1,Tra+, helper plasmid KnR Figurski and Helinski 1979 pUC118 ColE1, M13, lacZ+, AmpR Yanisch-Perron et al. 1985 pUCK3 Change from R827 to P827 in avrb6 in pUFR047 AmpR GmR This work pUFR004 ColE1, Mob+, lacZ+, CmR De Feyter et al. 1990 pUFR012 ColE1, Mob+, lacZ+ CmR KnR El Yacoubi 2005 pUFR047 IncW, Mob+, lacZ+, Par+, GmR AmpR De Feyter et al. 1993 pUFR053 IncW, Mob+, lacZ+, Par+ GmR CmR El Yacoubi 2005 pUFR070 IncW, Mob+, lacZ+, Par+, CmR, GmR Castaeda et al. in press pUFR080 ColE1, Mob+, lacZ+, SacB, CmR KnR Castaeda et al. in press pUFY14.5 4.1 SalI region from pthA in pZit45 was recloned into pGEMTeasy AmpR Yang and Gabriel 1995b pYD9.4 pthA complete gene in pUC118 AmpR Duan unpublished data pYD40.1 BamHI fragment from pthA cloned into Agrobacterium vector pYD40.2 KnR Duan et al. 1999

PAGE 106

92 Plasmid Relevant Characteristics Reference or Source pYD40.2 BamHI region was cut out from vector pGZ6.4 and religated KnR Duan et al. 1999 pYY40.10 2.0 Kb internal StuI-HincII fragment of pthA from pZit45 cloned into pUFR004 CmR Yang and Gabriel, unpublished data pZit45 pthA in pUFR047 Swarup et al. 1991 TOPO PCR cloning vector. Version P. AmpR KnR Invitrogen Corporation, Carlsbad, CA Amp=ampicillin, Gm=getamicin, Cm=chloramphenicol, Kn=kanamycin, Rif=rifampicin, ORF=open reading frame

PAGE 107

APPENDIX B XANTHOMONAS TOTAL DNA EXTRACTION For extraction of total DNA from Xanthomonas, 12 mL PYGM (De Feyter et al. 1990) cultures were grown in 25 mL flasks at 30C over night at 120 rpm. Cells were harvested at 8000 g and washed twice with 12 mL and 1.5 mL of 50 mM Tris-HCl, 50 mM EDTA, 0.15 mM NaCl, pH 8.0. The cells were resuspended in 627 L of TES buffer (10 mM Tris-HCl, 10 mM EDTA, 0.5% SDS, pH 7.8). Afterwards 33 L of protease stock solution was added, the tubes were inverted several times to mix well, and the cell suspension was incubated at 37C for 3 hours. The protease stock solution consists of 20 mg/mL protease in 10 mM Tris-HCl, 10 mM NaCl, pH7.5; the protease was predigested at 37C for 1 hour and stored at -20C. The mixture was gently mixed overnight by rotation with an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1) buffered with Tris-HCl pH 8.0. The layers were separated by centrifuging for 15 minutes at 5000 g, and the top layer was gently transferred to a new tube with a pipet. A second extraction with phenol:chloroform:isoamyl alcohol (25:24:1) was carried out, followed by an extraction with chloroform:isoamyl alcohol (24:1). One-tenth volume of 3 M NaOAc was added, the tubes were inverted several times, and 0.9 volume of room temperature isopropanol was added and mixed. Precipitated DNA was spooled out with a heat-sealed glass Pasteur pipet, transferred to a tube containing 600 L of 10 mM Tris-HCl, 1 mM EDTA, pH 8, and 200 g/mL RNaseA, and incubated for 1-2 hours at 37C. A phenol:chloroform:isoamyl alcohol and a chloroform extraction were carried out, 93

PAGE 108

followed by precipitation with NaOAc and 2 volumes of room temperature 95% ethanol. After careful mixing, the total DNA was spooled out as before and resuspended in 200 L sterile distilled water. To analyze the DNA, 1L was digested with a restriction enzyme and run on a 0.7% agarose gel. 94

PAGE 109

APPENDIX C PRIMERS USED Number Sequence 5' To 3' Tm Gene Ext. Time For marker interruption AC-5 GGAATTCAGAATAGGAA CCTTCAATTCATGGGCAGGAAGCGCACTG >72 XCC1629 30" AC-6 GGGATCCAGTATAGGAA CTTCTCTGAATCCGTTTGTCCTGTCCAG >72 XCC1629 30" AC-23 GGATCC ATGATGAGAGACTGCATGTAC 68 XCC2099 30" AC-24 GAGCTC TGACCGTTCATTACGAAATTC 68 XCC2099 30" AC-29 GGATCC ACGCTGCATGACATTGTC 66 XCC2100 30" AC-30 GAGCTC ATTTCACGGATATGACTTCC 66 XCC2100 30" AC-27 GGATCC AAGGAACTGCTACAACTATC 66 XCC2109 30" AC-28 GAGCTC GCACTAATGGCATTATCATC 68 XCC2109 30" AC-25 GGCATCCAGTTCTACAGCGGCGG 68 XCC2396 30" AC-26 GAGCTC AGCGGCGTCAACGG 68 XCC2396 30" AC-19 GTTAAC GTGGAGCGGATCCATG 68 XCC3731 30" AC-20 GAGCTC ACATAGAGCACGTCAGAG 70 XCC3731 30" AC-17 CCACCTGGATCCGGGCTTCG 68 XCC4229 30" AC-18 GAGCTC AGGGTCACGCTCCACG 68 XCC4229 30" AC-C1 GGCGACGGCGTGTCCAGCGCC >72 XCC4229 30" AC-C2 GTGTAGTCCCAGTTGACGTTGC 68 XCC4229 30" AC-60 TGGCCGCGAATTCGACCTCAAC 68 XCC2896 30" AC-61 CGACGACGAGCAATGACCAATGAAAGT >72 XCC2896 30" PEC-1 CCCGCAGTGGACCGAACGATG 70 Pectate Lyase 30" PEC-2 CGCTTTGCAAGTAGGTAGCGGC 70 Pectate Lyase 30" MAC-1 TACCAGGCCAGGCTTTGGACG 68 Unknown 30" MAC-2 CCTAGGCGAGTTTTCCGACG 64 Unknown 30" UNK-1 TTCCCTAGGCGAGTTTTCCGAC 68 Unknown 30" 95

PAGE 110

96 Number Sequence 5' To 3' Tm Gene Ext. Time UNK-2 AGGTACCAGCCAAGCTTTGGAC 66 Unknown 30" HYP-1 CATCGCTGCACTTGTAGGCCG 68 Hypot-hetical 30" HYP-2 GCAGTCCATATGCGTAAGCGG 66 Hypothetical 30" For interruption confirmation AC-13 GCAGGCGGCCTACCAGCTTG 68 XCC1629 1' AC-14 TGCGCGGCGAAATGGGCTGC 68 XCC1629 1' AC-15 GGTCATCATCTGCCCGCCATG 68 XCC1629 1' AC-37 ATGTCAATGGAGCGGGAGATGG 68 XCC2099 1' AC-43 TTATGCATTGTGGTCGAGCCATTC 70 XCC2099 1' AC-49 GCGAGCGCGGCAGGACTAC 66 XCC2099 1' AC-50 CCAGCAAGGTGGTGCAATCGG 68 XCC2099 1' AC-34 ATGTCCGACATGAAAGTTAATTTCTG 70 XCC2100 1' AC-41 TTACGCTTCTCCTGCATTTGTAAC 68 XCC2100 1' AC-35 ATGTGGTCTCAGCCCGTATGG 66 XCC2109 1' AC-39 TTAGGATAATCAGCCACAAATTGG 66 XCC2109 1' AC-45 CTGCAGTTTTTGTACGAATCCCTACCGATC 68 XCC2109 1' AC-36 GTGCTGGAGAGTGCCGATGGC 70 XCC2396 1' AC-44 GTGAGACCACAGTGAATCGCC 66 XCC2396 1' AC-32 GTGGTGGCGGCCCAGAATCAC 66 XCC3731 1' AC-48 TTAGCTCCAGTACTCGGCGTC 66 XCC3731 1' AC-33 TGCCCGAGCGCCCTCATGC 66 XCC4229 1' AC-42 AGTTCCAGATCGCCACGCACC 68 XCC4229 1' FW-XopD ATGGAATATATACCAAGATA 50 XCC2896 1 RV-XopD CTAGAACTTTTTCCACCACTT 58 XCC2896 1 For splice overlap PCR 52-A1 CGCTGGCCGCCGAATGGATG 68 XCC052 1' 52-F TCATACGCGTTCAGATCTTACTGTTCTAGCGCAGGCGATG 60 XCC052 1' 52-C TAAGATCTGAACGCGTATGAGCAGACCATTCGCACGATG 60 XCC052 1' 52-D1 CCGATGGATCTATTGTTCTTCG 64 XCC052 1' 2099-A GGAATTCTCGATGACCTGCTCCAACG >72 XCC2099, XCC2100 1'

PAGE 111

97 Number Sequence 5' To 3' Tm Gene Ext. Time 2099-B TCATACGCGTTCAGATCTTACATCTATGGGGCCTGTTCG 60 XCC2099, XCC2100 1' 2099-C TAAGATCTGAACGCGTATGAAGAGAAGAAGTATCCGCCAC 60 2099, 2100 1' 2099-D GGAATTCGGACGAACTCGCCCAGCC >72 2099, 2100 1' 2109-A TTTGTCGAGCGAGCGTCAC 60 2109 1' 2109-B TCATACGCGTTCAGATCTTACCAATTTGTGGCTGATTATCC 60 2109 1' 2109-E TAAGATCTGAACGCGTATGAGTCCGAAATCTGGTGAAGAG 60 2109 1' 2109-F GTGAGTTCGGCCTACAACCA 62 2109 1' 2396-A1 GCTGATCTGGAAGTTGTAGG 60 2396 1' 2396-B TCATACGCGTTCAGATCTTATACCTGCTGATGCACATGTC 60 2396 1' 2396-C TAAGATCTGAACGCGTATGAGGTCGTGCAAGTGGGCAGTGG 60 2396 1' 2396-D GCAGTGCGGATGGCAGCC 62 2396 1' 4229-A GGCGTTTTCCATGCTGATGTAC 66 4229 1' 4229-B TCATACGCGTTCAGATCTTAGCAGGCGGCGGGGCAATGCAGGC 60 4229 1' 4229-C TAAGATCTGAACGCGTATGAGCCGATCAACAGCCTGCGCTC 60 4229 1' 4229-D CGCGTGGTCGACTGACAACG 66 4229 1' For deletion confirmation 52-E GCTGGATCTGATCCGCAGT 60 52 1' 30" 52-H CCTGGGTGGACCACGATGTG 66 52 1' 30" 2099-A1 GTGCTGCGCTGATGTATTCGG 66 2099, 2100 2 2099-D1 AAGACAAGAGCGACCAACACC 64 2099, 2100 2 2109-A1 GCAATCGAGGTATCGTCATG 60 2109 1' 30" 2109-F GTGAGTTCGGCCTACAACCA 62 2109 1' 30" 2396-A1 GCTGATCTGGAAGTTGTAGG 60 2396 1' 30" 2396-D1 CCGTACTACCGCCATGCC 60 2396 1' 30" 4229-A1 AATCGGCGAACTCGTTGTTG 60 4229 1' 30" 4229-D1 CTCCGGGCGCACCATCCAGATC 74 4229 1' 30"

PAGE 112

98 Number Sequence 5' To 3' Tm Gene Ext. Time For complementation assays 9.03 GAATTC CATGGGTCTATGCGCT TCAAAACC 68 2109 1'30" 9.04 GAATTC CAGGAGATCGACATG GGTCTATG 70 2109 1'30" AC-35 ATGTGGTCTCAGCCCGTATGG 66 2109 1'30" AC-45 CTGCAGTTTTTGTACGAATCCCT ACCGATC 68 2109 1'30" SSH adaptor 1 CTAATACGACTCACTATAGGGCTCGAGCGGCCGCCCGGGAGGT 3-GGCCCGTCCA-5 SSH NA NA adaptor 2R CTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCGAGGT 3GCCGGCTCCA5 SSH NA NA Primer 1 CTAATACGACTCACTATAGGGC SSH NA NA Nested primer 1 TCGAGCGGCCGCCCGGGCAGGT SSH NA NA Nested primer 2R AGCGTGGTCGCGGCCGAGGT SSH NA NA Vector-based primers M13R (-48) AGCGGATAACAATTTCACACAGGA 64 Vector based V M13 (-47) GCCAGGGTTTTCCCAGTCACG 64 Vector based V UDG CLONING LZP2 ACUGCAUCCAUGG CUGGACGTC 70 Leucine Zipper 30 LZP1 CCAUGGAUGCAGUGAAAAAGGGAATGCCG >72 Leucine Zipper 30 YP04 ACGAGUUCGGUGACUCCCACTC 70 Casein Kinase 30 YP03 AGUCACCGAACUCGUAGCCCG 68 Casein Kinase 30 YP02 AACCACUUGAGCGUGGTCGGC 68 Upstream Casein kinase 30

PAGE 113

99 Number Sequence 5' To 3' Tm Gene Ext. Time YP01 ACGCUCAAGUGGUUCCCGTGC 68 Upstream Casein kinase 30 Underlined sequences indicate restriction site added. Bold sequences indicate homology region for splice overlap PCR. Italic sequences indicate the nucleotide changed by UDG cloning.

PAGE 114

APPENDIX D PLANTS USED Species Variety Common name Company Brassica oleracea var. capitata Early jersey Wakefield cabbage Sawan seed co., Pelham, GA Brassica rapa Seven Top turnip Sieger seed co., Zeeland, MI Brassica rapa Hakurei hybrid turnip Ferry-Morse seed Co., Phoenix, AZ Raphanus sativa Sparkler Radish radish Excel seeds, Camp Point, IL Brassica juncea Florida Broadleaf Indian Mustard Indian mustard Siegers seed Co., Zeeland, MI Brassica oleracea var. botrytis Miracle F1 cauliflower Jeff Jones, PC Brassica carinata PI 199947 Ethiopian mustard Jeff Jones, PC Phaseolus vulgaris California Redloud Kidney Bean common bean Agway Seeds, Syracuse, NY Phaseolus vulgaris California Redlight Kidney Bean common bean Sacramento Valley Milling Ordbend, CA Capsicum annum California Wonder pepper Jeff Jones, PC Capsicum annum 10R pepper Jeff Jones, PC Capsicum annus 20R pepper Jeff Jones, PC Capsicum annum 30R pepper Jeff Jones, PC Lycopersicum esculentum tomato Jeff Jones, PC Nicotiana benthamiana tobacco Plant Pathology greenhouse A rabidopsis thaliana eco. Coimbra-1 Jeff Rollins, PC A rabidopsis thaliana eco. Columbia Jeff Rollins, PC Gossypium hirsutum Acala Bs6 cotton M. Essenberg Oklahoma St.University Gossypium hirsutum Acala 44 cotton M. Essenberg Oklahoma St.University Citrus paradisi Duncan grapefruit grapefruit DPI 100

PAGE 115

APPENDIX E PLASMID EXTRACTION For extraction of plasmid DNA from E. coli is grown 2 mL of LB plus antibiotics overnight at 37C at 200 rpm and then cells are harvested at 8000 rpm by centrifugation. The supernatant is discarded and then the cells were resuspended in 90 L solution I by vortexing. Ten microliters of lysozyme solution (50 /ml of Solution I) are added, then mixed by inversion and the tubes incubated for 5 to 10 min at 37C. The samples are then frozen at C for 10 min and defrosted at 37C and 200l are added and mixed evenly by rolling the tubes. Two hundred l of solution III are added and the tubes are inverted three to four times and placed on ice for 5 to 10 m to complete precipitation. The precipitate is then centrifuged for 15 m at full speed in the cold room and the supernatant transferred to a new tube. Four hundred microliters of phenol/chloroform/isoamylalcohol are added and the tubes are vortexed then centrifuged in the cold room for 10 m at full speed. The top phase is removed with a pipet and mixed with 400 l of chloroform/isoamylalcohol, vortexed for few seconds and spun down for 15 m at full speed. The top phase is transferred to a new 1.5 ml tube and mixed with 1.0 ml of 95% ethanol, spun down at full speed for 10 m and the supernatant discarded. Seventy percent alcohol is added, mixed and spun down for 5 m at high speed then discarded and dried. The pellet are resuspended in 25 l of water. 101

PAGE 116

102 Solution I: 50 m glucose 25 mM Tris HCl pH 8 10 mM EDTA pH 8 Solution II 0.2 N NaOH 1% SDS Solution III 3 M potassium acetate 5 M Glacial acetic acid

PAGE 117

LIST OF REFERENCES Abramovitch, R.B., Kim, Y.J., Chen, S., Dickman, M.B., and Martin, G.B. 2003. Pseudomonas type III effector AvrPtoB induces plant disease susceptibility by inhibition of host programmed cell death. EMBO J. 22:60-69. Akopyants, N.S., Fradkov, A., Diatchenko, L., Hill, J.E., Siebert, P.D., Lukyanov, S.A., Sverdlov, E.D., and Berg, D.E. 1998. PCR-based subtractive hybridization and differences in gene content among strains of Helicobacter pylori. Proc. Natl. Acad. Sci. U. S. A. 95:13108-13113. Alfano, J.R., and Collmer, A. 2004. Type III secretion system effector proteins: double agents in bacterial disease and plant defense. Annu. Rev. Phytopathol. 42:385-414. Al-Saadi, A. 2005. Phenotypic characterization and sequence analysis of pthA homologs from five pathogenic variant groups of Xanthomonas citri. University of Florida Ph.D. dissertation. Alvarez, A.M., Benedict, A.A., Mizumoto, C.Y., Hunter, J.E., and Gabriel, D.W. 1994. Serological, pathological, and genetic diversity among strains of Xanthomonas campestris infecting crucifers. Phytopathology. 84:1449-1457. Arlat, M., Gough, C.L., Barber, C.E., Boucher, C. and Daniels, M.J. 1991. Xanthomonas campestris contains a cluster of hrp genes related to the larger hrp cluster of Pseudomonas solanacearum. Mol. Plant-Microb. Interact. 6:593-601. Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A. and Struhl, K. 1997. Short Protocols in Molecular Biology, 3rd edition. New York: John Wiley and Sons Inc. Badel, J.L., Nomura, K., Bandyopadhay, S., Shimizu, R., Collmer, A. and Yang He, S. 2003. Pseudomonas syringae pv. tomato DC3000 HopPtoM (CEL ORF3) is important for lesion formation but not growth in tomato and is secreted and translocated by the Hrp type III secretion system in a chaperone-dependent manner. Mol. Microbiol. 5:1239-1251. Bai, J., Choi, S. H., Ponciano, G., Leung, H., and Leach, J.E. 2000. Xanthomonas oryzae pv. oryzae avirulence genes contribute differently and specifically to pathogen aggressiveness. Mol. Plant-Microbe Interact. 13:1322-1329. 103

PAGE 118

104 Balague, C., Lin, B., Alcon, C., Flottes, G., Malmstrom, S., Kohler, C., Neuhaus, G., Pelletier, G., Gaymard, F., and Roby, D. 2003. HLM1, an essential signaling component in the hypersensitive response, is a member of the cyclic nucleotide-gated channel ion channel family. Plant Cell 2:365-379. Barber, C.E., Tang, J.L., Feng, J.X., Pan, M.Q., Wilson, T.J., Slater, H., Dow, J.M., Williams, P. and Daniels, M.J. 1997. A novel regulatory system required for pathogenicity of Xanthomonas campestris is mediated by a small diffusible signal molecule. Mol. Microbiol. 24:555-566. Basu, P. K. 1974. Glucose inhibition of the characteristic melanoid pigment of Xanthomonas phaseoli var. fuscans. Can. J. Bot. 44:1239-1245. Black, L.L. and Machmud, M. 1983. Xanthomonas leaf spot of crucifers. In: Int. Congr. Plant Pathol., 4th. Melbourne, Aust. P 126 (abs). Boch, J., Joardar, V., Gao, L., Robertson, T.L., Lim, M. and Kunkel, B.N. 2002. Identification of Pseudomonas syringae pv. tomato genes induced during infection of Arabidopsis thaliana. Mol. Microbiol. 1:73-88. Bogdanove, A.J., Kim, J.F., Wei, Z., Kolchinsky, P., Charkowski, A.O., Conlin, A.K., Collmer, A. and Beer, S.V. 1998. Homology and functional similarity of a hrp-linked pathogenicity locus, dspEF, of Erwinia amylovora and the avirulence locus avrE of Pseudomonas syringae pathovar tomato. Proc. Natl. Acad. Sci. U. S. A. 95:1325-1330. Bogush, M.L., Velikodvorskaya, T.V., Lebedev, Y.B., Nikolaev, L.G., Lukyanov, S.A., Fradkov, A.F., Pliyev, B.K., Boichenko, M.N., Usatova, G.N., Vorobiev, A.A., Andersen, G.L. and Sverdlov, E.D. 1999. Identification and localization of differences between Escherichia coli and Salmonella typhimurium genomes by suppressive subtractive hybridization. Mol. Gen. Genetics 262:721-729. Bonas, U., Schulte, R., Fenselau, S., Minsavage, G.V., Staskawicz, B.J., and Stall, R.E. 1991. Isolation of a gene cluster from Xanthomonas campestris pv. vesicatoria that determines pathogenicity and the hypersensitive response on peper and tomato. Mol. Plant-Microbe Interact. 4:81-88. Bonas, U., Staskawicz, B.J., and Stall R.E. 1989. Genetic and structural characterization of the avirulence gene avrBs3 from Xanthomonas campestris pv. vesicatoria. Mol. Gen. Genet. 218:127-136. Boucher, C.A., Van Gijsegem, F, Barberis, P.A., Arlat, M., and Zischek, C. 1987. Pseudomonas solanacearum genes controlling both pathogenicity on tomato and hypersensitivity on tobacco are clustered. J. Bacteriol. 12:5626-32. Boyce JD, Cullen PA, Adler B. 2004. Genomic-scale analysis of bacterial gene and protein expression in the host. Emerg. Infect. Dis. 10:1357-1362.

PAGE 119

105 Bradbury, J.F. 1984. Xanthomonas Dowson. 1939. In Bergeys manuals of systematic bacteriology. N.R. Krieg and J.G. Holt, eds. Williams & Wilkins, Baltimore. Bretschneider, K.E., Gonella, M.P. and Robeson, D.J. 1989. A comparative light and electron microscopical study of compatible and incompatible interactions between Xanthomonas-campestris pv. campestris and cabbage (Brassica-oleracea) Physiol. Mol. Plant Pathol. 34:285-297. Broughton, W.J., Hernandez, G., Blair, M., Beebe, S., Gepts, P., and Varderleyden, J. 2003. Beans (Phaseolus spp), model food legumes. Plant Soil 252:55-128. Buell, C.R. 2002. Interaction between Xanthomonas species and Arabidopsis thaliana. In The Arabidopsis Book, eds. C.R. Somerville and E.M. Meyerowitz, American Society of Plant Biologists, Rockville, MD. Buell, C.R., Joardar, V, Lindeberg, M, Selengut, J., Paulsen, I.T., Gwinn, M.L., Dodson, R.J., Deboy, R.T., Durkin, A.S., Kolonay, J.F., Madupu, R., Daugherty, S., Brinkac, L., Beanan, M.J., Haft, D.H., Nelson, W.C., Davidsen, T., Zafar, N., Zhou, L., Liu, J., Yuan, Q., Khouri, H., Fedorova, N., Tran, B., Russell, D., Berry, K., Utterback, T., Van Aken, S.E., Feldblyum, T.V., D'Ascenzo, M., Deng, W.L., Ramos, A.R., Alfano, J.R., Cartinhour, S., Chatterjee, A.K., Delaney, T.P., Lazarowitz, S.G., Martin, G.B., Schneider, D.J., Tang, X., Bender, C.L., White, O., Fraser, C.M. and Collmer, A. 2003. The complete genome sequence of the Arabidopsis and tomato pathogen Pseudomonas syringae pv. tomato DC3000. Proc. Natl. Acad. Sci. U.S.A. 100:10181-10186. Bttner, D. and Bonas, U. 2002. Getting across-bacterial type III effector proteins on their way to the plant cell. EMBO J. 21:5313-5322. Bttner, D., Gurlebeck, D., Noel, L.D., and Bonas, U. 2004. HpaB from Xanthomonas campestris pv. vesicatoria acts as an exit control protein in type III-dependent protein secretion. Mol. Microbiol. 3:755-768. Canteros, B., Minsavage, G., Bonas, U., Pring, D., and Stall, R. 1991. A gene from Xanthomonas campestris pv. vesicatoria that determines avirulence in tomato is related to avrBs3. Mol. Plant-Microbe Interact. 4:628-632. Cawly, J., Cole, A.B., Kiraly, L., Qiu, W., and Schoelz, J.E. 2005. The plant gene CCD1 selectively blocks cell death during the hypersensitive response to Cauliflower mosaic virus infection. Mol. Plant-Microbe Interact. 18:212-219. Chan, J.W., and Goodwin, P.H. 1999. A physical map of the chromosome of Xanthomonas campestris pv. phaseoli var. fuscans BXPF65. FEMS Microbiol. Lett. 1:85-90. Chang, J.H., Goel, A.K., Grant, S.R., and Dangl J.L. 2004. Wake of the flood: ascribing functions to the wave of type III effector proteins of phytopathogenic bacteria. Curr. Opin. Microbiol. 1:11-18

PAGE 120

106 Chang, K.W., Weng, S.F., and Tseng Y.H. 2001. UDP-glucose dehydrogenase gene of Xanthomonas campestris is required for virulence. Biochem. Biophys. Res. commun. 287:550-555. Chauvatcharin, N., Atichartpongkul, S., Utamapongchai, S., Whangsuk, W., Vattanaviboon, P., and Mongkolsuk, S. 2005. Genetic and physiological analysis of the major OxyR-regulated katA from Xanthomonas campestris pv. phaseoli. Microbiology 151:597-605. Chauvatcharin, N., Vattanaviboon, P., Switala, J., Loewen, P.C., and Mongkolsuk, S. 2003. Cloning and characterization of katA, encoding the major monofunctional catalase from Xanthomonas campestris pv. phaseoli and characterization of the encoded catalase KatA. Curr. Microbiol. 2:83-87. Clough, S.J., Fengler, K.A., Yu, I.C., Lippok, B., Smith, Jr. R.K., and Bent, A.F. 2000. The Arabidopsis dnd1 "defense, no death" gene encodes a mutated cyclic nucleotide-gated ion channel. Proc. Natl. Acad. Sci. U.S.A. 97:9323-9328. Cook, A.A., Walker, J.C., and Larson, R.H. 1952. Studies on the disease cycle of black rot of crucifers. Phytopathology 42:162-167. Crossman, L., and Dow J.M. 2004. Biofilm formation and dispersal in Xanthomonas campestris. Microbes Infect. 6:623-629. Cunnac, S., Occhialini, A., Barberis, P., Boucher, C., and Genin, S. 2004. Inventory and functional analysis of the large Hrp regulon in Ralstonia solanacearum: identification of novel effector proteins translocated to plant host cells through the type III secretion system. Mol. Microbiol. 1:115-128. Daniels, M.J., Barber, C.E., Turner, P.C., Cleary, W.G., and Sawczyc, M.K. 1984a. Isolation of mutants of Xanthomonas-campestris pv. campestris showing altered pathogenicity. J. Gen. Microbiol. 130:2447-2455. Daniels, M.J., Barber, C.E., Turner, P.C, Sawczyc, M.K., Byrde, R.J.W., and Fielding, A.H. 1984b. Cloning of genes involved in pathogenicity of Xanthomonas campestris pv. campestris using the broad host range cosmid-pLAFR1. EMBO J. 13:3323-3328. Daniels, M.J., Collinge, D.B., and Dow, J.M. 1987. Molecular biology of the interaction of Xanthomonas campestris with plants. Plant Physiol. Biochem. 3: 353-359. Datsenko, K.A., and Wanner, B.L. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U.S.A. 97:6640-6645. Davidson, A.L., and Chen, J. 2004. ATP-binding cassette transporters in bacteria. Annu. Rev. Biochem. 73:241-268.

PAGE 121

107 da Silva, A.C., Ferro, J.A., Reinach, F.C., Farah, C.S., Furlan, L.R., Quaggio, R.B., Monteiro-Vitorello, C.B., Van Sluys, M.A., Almeida, N.F., Alves, L.M., do Amaral, A.M., Bertolini, M.C., Camargo, L.E., Camarotte, G., Cannavan, F., Cardozo, J., Chambergo, F., Ciapina, L.P., Cicarelli, R.M., Coutinho, L.L., Cursino-Santos, J.R., El-Dorry, H., Faria, J.B., Ferreira, A.J., Ferreira, R.C., Ferro, M.I., Formighieri, E.F., Franco, M.C., Greggio, C.C., Gruber, A., Katsuyama, A.M., Kishi L.T., Leite, R.P., Lemos, E.G., Lemos, M.V., Locali, E.C., Machado, M.A., Madeira, A.M., Martinez-Rossi, N.M., Martins, E.C., Meidanis, J., Menck, C.F., Miyaki, C.Y., Moon, D.H., Moreira, L.M., Novo, M.T., Okura, V.K., Oliveira, M.C., Oliveira, V.R., Pereira, H.A., Rossi, A., Sena, J.A., Silva, C., de Souza, R.F., Spinola, L.A., Takita, M.A., Tamura, R.E., Teixeira, E.C., Tezza, R.I., Trindade dos Santos, M., Truffi, D., Tsai, S.M., White, F.F., Setubal J.C., and Kitajima, J.P. 2002. Comparison of the genomes of two Xanthomonas pathogens with differing host specificities. Nature 417:459-463. Debouck, D.G. 1994. In Neglected Crops: 1492 from a Different Perspective. J.E. Hernndo Bermejo and J. Len (eds.). Plant Production and Protection Series No. 26. FAO, Rome, Italy. 47-62. De Feyter, R., Kado, C.I., and Gabriel, D.W. 1990. Small stable shuttle vectors for use in Xanthomonas. Gene 88:65-72. De Feyter, R., and Gabriel, D.W. 1991. At least six avirulence genes are clustered on a 90-kilobase plasmid in Xanthomonas campestris pv. malvacearum. Mol. Plant-Microbe Interact. 4:423-432. De Feyter, R., and Gabriel, D.W. 1991. Use of cloned DNA methylase genes to increase the frequency of transfer of foreign genes into Xanthomonas campestris pv. malvacearum. J. Bacteriol. 173:6421-6427. De Feyter, R., Yang, Y., and Gabriel, D.W. 1993. Gene-for-genes interactions between cotton R genes and Xanthomonas campestris pv. malvacearum avr genes. Mol. Plant-Microbe Interact. 6:225-237. Diatchenko, L., Lau, Y.F.C., Campbell, A.P., Chenchik, A., Moqadam, F., Huang, B., Lukyanov, S., Lukyanov, K., Gurskaya, N., Sverdlov, E.D., and Siebert, P.D. 1996. Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries. Proc. Natl. Acad. Sci. U.S.A. 93: 6025-6030. Dong, X., Mindrinos, M., Davis, K.R., and Ausubel, F.M. 1991. Induction of Arabidopsis defense genes by virulent and avirulent Pseudomonas syringae strains and by a cloned avirulence gene. Plant Cell 1:61-72. Dow, J.M., Clarke, B.R., Milligan, D.E., Tang, J.L., and Daniels M.J. 1990. Extracellular proteases from Xanthomonas campestris pv. campestris, the black rot pathogen. Appl. Environ. Microbiol. 10:2994-2998.

PAGE 122

108 Dow, J.M., Crossman, L., Findlay, K., He, Y.Q., Feng, J.X., and Tang, J.L. 2003. Biofilm dispersal in Xanthomonas campestris is controlled by cell-cell signaling and is required for full virulence to plants. Proc. Natl. Acad. Sci. U.S.A. 19:10995-11000. Dow, J.M., Davies, H.A., and Daniels, M.J. 1998. A metalloprotease from Xanthomonas campestris that specifically degrades proline/hydroxyproline-rich glycoproteins of the plant extracellular matrix. Mol. Plant-Microbe Interact. 11:1085-1093. Dow, J.M., Feng, J.X., Barber, C.E., Tang, J.L., and Daniels, M.J. 2000. Novel genes involved in the regulation of pathogenicity factor production within the rpf gene cluster of Xanthomonas campestris. Microbiology 146:885-891. Duan, Y.P., Castaeda, A., Zhao, G., Erdos, G. and Gabriel, D.W. 1999. Expression of a single, host-specific, bacterial pathogenicity gene in plant cells elicits division, enlargement and cell death. Mol. Plant-Microbe Interact. 12: 556-560. Egler, M., Grosse, C., Grass, G., and Nies, D.H. 2005. Role of the extracytoplasmic function protein family sigma factor RpoE in metal resistance of Escherichia coli. J. Bacteriol. 187:2297-2307. Ellingboe, A.H. 1976. Genetics of host-parasite interactions. In: Encyclopedia of Plant Physiology (Heitefass, R. and Williams, P.H., eds.). Springer-Verlag, Berlin, Germany 4:761-778. El Yacoubi, B. 2005. Bacterial citrus canker: molecular aspects of a compatible plant-microbe interaction. University of Florida, Ph.D. dissertation. Esnault, R., Buffard, D., Breda, C., Sallaud, C., el Turk, J., and Kondorosi, A. 1993. Pathological and molecular characterizations of alfalfa interactions with compatible and incompatible bacteria, Xanthomonas campestris pv.. alfalfae and Pseudomonas syringae pv. pisi. Mol. Plant-Microbe Interact. 5:655-664. FAOSTAT data 2004. http://apps.fao.org/faostat/notes/citation.htm. Figurski, D.H., and Helinski, D.R. 1979. Replication of an origin-containing derivatives of plasmid RK2 dependent on a plasmid function provided in trans. Proc. Natl. Acad. Sci. U.S.A. 76:1648-1652. Flor, H.H. 1956. The complementary genic systems in flax and flax rust. Advances in Genetics Incorporating Molecular Genetic Medicine 8: 29-54 Frank, S. A. 1992. Models of plant-pathogen coevolution. Trends Genet. 6:213-219. Gabriel, D.W. 1997. Targeting of protein signals from Xanthomonas to the plant nucleus. Trends Plant Sci. 2:204-206.

PAGE 123

109 Gabriel, D. W. 1999. Why do pathogens carry avirulence genes? Physiol. Molec. Plant Pathol. 55:205-214. Gabriel, D.W., Burges, A., and Lazo G.R. 1986. Gene-for-gene recognition of five cloned avirulence genes from Xanthomonas campestris pv. malvacearum by specific resistance genes in cotton. Proc. Natl. Acad. Sci. U.S A. 83:6415-6419. Gabriel, D.W., Kingsley, M.T., Hunter, J.E., and Gottwald, T.R. 1989. Reinstatement of Xanthomonas citri (ex Hasse) and X. phaseoli (ex Smith) and reclassification of all X. campestris pv. citri strains. Int. J. Syst. Bacteriol. 39:14-22. Galan, J.E., and Collmer A. 1999. Type III secretion machines: Bacterial devices for protein delivery into host cells. Science 284:1322-1328. Garcia-Vallv, S., Guzman, E., Montero, M.A., and Romeu, A. 2003. HGT-DB: a database of putative horizontally transferred genes in prokaryotic complete genomes. Nucl. Acids Res. 1:187-189. Gauthier, A., Thomas, N.A., and Finlay, B.B. 2003. Bacterial injection machines. J. Biol. Chem. 28:25273-25276. Gillings, M.R., Holley, M.P., Stokes, H.W., and Holmes, A.J. 2005. Integrons in Xanthomonas: a source of species genome diversity. Proc. Natl. Acad. Sci. U.S.A. 102:4419-4424. Goodner, B., Hinkle, G., Gattung, S., Miller, N., Blanchard, M., Qurollo, B., Goldman, B.S., Cao, Y., Askenazi, M., Halling, C., Mullin, L., Houmiel, K., Gordon, J., Vaudin, M., Iartchouk, O., Epp, A., Liu, F., Wollam, C., Allinger, M., Doughty, D., Scott, C., Lappas, C., Markelz, B., Flanagan, C., Crowell, C., Gurson, J., Lomo, C., Sear, C., Strub, G., Cielo, C., and Slater, S. 2001. Genome sequence of the plant pathogen and biotechnology agent Agrobacterium tumefaciens C58. Science 5550:2323-2328. Gopalan, S., Bauer, D.W., Alfano, J.R., Loniello, A.O., He, S.Y., and Collmer A. 1996. Expression of the Pseudomonas syringae avirulence protein AvrB in plant cells alleviates its dependence on the hypersensitive response and pathogenicity (Hrp) secretion system in eliciting genotype-specific hypersensitive cell death. Plant Cell 8:1095-1105. Greenberg, J.T., and Vinatzer B.A. 2003. Identifying type III effectors of plant pathogens and analyzing their interaction with plant cells. Curr. Opin. Microbiol. 6:20-28. Gurlebeck, D., Szurek, B., and Bonas, U. 2005. Dimerization of the bacterial effector protein AvrBs3 in the plant cell cytoplasm prior to nuclear import. Plant J. 42:175-187.

PAGE 124

110 Guttman, D.S., Vinatzer, B.A., Sarkar, S.F., Ranall, M.V., Kettler, G., and Greenberg, J.T. 2002. A functional screen for the type III (Hrp) secretome of the plant pathogen Pseudomonas syringae. Science 295:1722-1726. Hacker, J., and Kaper, J.B. 2000. Pathogenicity islands and the evolution of microbes. Annu. Rev. Microbiol. 54:641-679. Harakava, R., and Gabriel, D.W. 2003. Genetic differences between two strains of Xylella fastidiosa revealed by suppression subtractive hybridization. Appl. Environ. Microbiol. 69:1315-1319. Hayward, A.C. 1993. The hosts of Xanthomonas. In Xanthomonas. Chapman & Hall. New York. He, S.Y., Nomura, K., and Whittam, T.S. 2004. Type III protein secretion mechanism in mammalian and plant pathogens. Biochim. Biophys. Acta 1694:181-206. Hendrix, R.W., Smith, M.C., Burns, R.N., Ford, M.E. and Hatfull, G.F. 1999. Evolutionary relationships among diverse bacteriophages and prophages: all the world's a phage. Proc. Natl. Acad. Sci. U.S.A. 96:2192-2197. Hibberd, A.M., Stall, R.E., and Basset, M.J. 1987. Different phenotypes associated with incompatible races and resistance genes in bacterial spot disease of pepper. Plant Dis. 71:1075-1078. Hieter, P., and Boguse, M. 1997. Functional genomics: Its how you read it. Science 278:601-602. Hildebrand, D.C., Palleroni, N.J., and Schroth, M.N. 1990. Deoxyribonucleic acid relatedness of 24 xanthomonad strains representing 23 Xanthomonas campestris pathovars and Xanthomonas fragariae. J. Appl. Bacteriol. 68: 263-269. Ho, S.N., Hunt, H.D., Horton, R.M., Pullen, J.K., and Pease L.R. 1989. Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 1:51-59. Hoang, T.T., Karkhoff-Schweizer, R.R., Kutchma, A.J., and Schweizer, H.P. 1998. A broad host range FLP-FRT recombination system for site-specific excision of chromosome located DNA sequences: application for isolation of unmarked Pseudomonas aeruginosa mutants. Gene 212:77-86. Horton, R.M., Hunt, H.D., Ho, S.N., Pullen, J.K., and Pease, L.R. 1989. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77:61-68. Hotson, A., Chosed, R., Shu, H., Orth, K., and Mudgett, M.B. 2003. Xanthomonas type III effector XopD targets SUMO-conjugated proteins in planta. Mol. Microbiol. 2:377-389.

PAGE 125

111 Hugouvieux, V., Barber, C.E., and Daniels, M.J. 1998. Entry of Xanthomonas campestris pv. campestris into hydathodes of Arabidopsis thaliana leaves: a system for studying early infection events in bacterial pathogenesis. Mol. Plant-Microbe Interact. 6:537-543. Ignatov, A.N., Monakhos, G.F., Dzhalilov, F.S., and Pozmogova G.V. 2003. Avirulence gene from Xanthomonas campestris pv. campestris homologous to the avrBs2 locus is recognized in race-specific reaction by two different resistance genes in Brassicas. Russian Journal of Genetics 12: 1404-1410. Innes, R.W., Bent, A.F., Kunkel, B.N., Bisgrove, S.R., and Staskawicz B.J. 1993. Molecular analysis of avirulence gene avrRpt2 and identification of a putative regulatory sequence common to all known Pseudomonas syringae avirulence genes. J. Bacteriol. 15:4859-4869. James, B.D., and Higgins, S.J. 1985. Nucleic Acid Hybridization. IRL Press Ltd., Oxford. Jamir, Y., Guo, M., Oh, H.S., Petnicki-Ocwieja, T., Chen, S., Tang, X., Dickman, M.B., Collmer, A., and Alfano, J.R. 2004. Identification of Pseudomonas syringae type III effectors that can suppress programmed cell death in plants and yeast. Plant J. 4:554-565. Jakoby, M., Weisshaar, B., Droge-Laser, W., Vicente-Carbajosa, J., Tiedemann, J., Kroj, T., and Parcy, F. 2002. bZIP transcription factors in Arabidopsis. Trends Plant Sci. 7:106-111. Jensen, A.B., Goday, A., Figueras, M., and Jessop, A.C. 1998. Phosphorylation mediates the nuclear targeting of the maize Rab17 protein. Plant J. 13:691-697. Jin, Q.L., and He, S.Y. 2001. Role of the Hrp pilus in type III protein secretion in Pseudomonas syringae. Science 294: 2556-2558. Jin, Q.L., Thilmony, R., Zwiesler-Vollick, J., and He, S.Y. 2003. Type III protein secretion in Pseudomonas syringae. Microbes and Infection 5:301-310. Jurkowski, G.I., Smith, Jr. R.K., Yu, I.C., Ham, J.H., Sharma, S.B., Klessig, D.F., Fengler, K.A. and Bent, A.F. 2004. Arabidopsis dnd2, a second cyclic nucleotide-gated ion channel gene for which mutation causes the "defense, no death" phenotype. Mol. Plant-Microbe Interact. 17:511-520. Kamoun, S., Hamada, W., and Huitema, E. 2003. Agrosuppression: a bioassay for the hypersensitive response suited to high-throughput screening. Mol. Plant-Microbe Interact. 1:7-13. Kamoun, S., and Kado, C.I. 1990. A plant-inducible gene of Xanthomonas campestris pv. campestris encodes an exocellular component required for growth in the host and hypersensitivity on nonhosts. J. Bacteriol. 9:5165-5172.

PAGE 126

112 Kamoun, S., Kamdar, H.V., Tola, E., and Kado, C.I. 1992. Incompatible interactions between crucifers and Xanthomonas campestris involve a vascular hypersensitive response: Role of the hrpX locus. Mol. Plant-Microbe Interact. 5:22-33. Kapila, J., DeRycke, R., Van Montagu, M., and Angenon, G. 1997. An Agrobacterium-mediated transient gene expression system for intact leaves. Plant Sci. 122:101-108. Kearny, B., and Staskawicz, B.J. 1990. Widespread distribution and fitness contribution of Xanthomonas campestris avirulence gene avrBs2. Nature 332:541-543. Keck, A.S., and Finley, J.W. 2004. Cruciferous vegetables: cancer protective mechanisms of glucosinolate hydrolysis products and selenium. Integr. Cancer Ther. 3:5-12. Kucharek, T., and Strandberg, J. 1981. Black rot of crucifers. Plant Pathology Fact Sheet. IFAS/University of Florida, Gainesville. Lawrence, J.G., and Ochman, H. 1997. Amelioration of bacterial genomes: rates of change and exchange. J. Mol. Evol. 4:383-397. Lazo, G.R., and Gabriel, D.W. 1987. Conservation of plasmid DNA sequences and pathovar identification of strains of Xanthomonas campestris. Phytopathology 77:448-453. Lazo, G. R., Roffey, R., and Gabriel, D. W. 1987. Pathovars of Xanthomonas campestris are distinguishable by restriction fragment length polymorphisms. Int. J. Syst. Bacteriol. 37:214-221. Leach, J.E., and White, F.F. 1996. Bacterial avirulence genes. Annu. Rev. Phytopathol. 34:153-179. Lee, B.M., Park, Y.J., Park, D.S., Kang, H.W., Kim, J.G., Song, E.S., Park, I.C., Yoon, U.H., Hahn, J.H., Koo, B.S., Lee, G.B., Kim, H., Park, H.S., Yoon, K.O., Kim, J.H., Jung, C.H., Koh, N.H., Seo J.S., Go, S.J. 2005. The genome sequence of Xanthomonas oryzae pathovar oryzae KACC10331, the bacterial blight pathogen of rice. Nucleic Acids Res. 33:577-586. Liang, B., Yu, T.G., Guo, B., Yang, C., Dai, L., and Shen, D.L. 2004. Cloning and characterization of a novel avirulence gene (arp3) from Xanthomonas oryzae pv. oryzae. DNA Seq. 15:110-117. Lim, M.T., and Kunkel, B.N. 2004. The Pseudomonas syringae type III effector AvrRpt2 promotes virulence independently of RIN4, a predicted virulence target in Arabidopsis thaliana. Plant J. 40:790-798.

PAGE 127

113 Lin, N.C., and Martin, G.B. 2005. An avrPto/avrPtoB Mutant of Pseudomonas syringae pv. tomato DC3000 does not elicit Pto-mediated resistance and is less virulent on tomato. Mol. Plant-Microbe Interact. 1:43-51. Lloyd, S.A., Sjostrom, M., Andersson, S., and Wolf-Watz, H. 2002. Molecular characterization of type III secretion signals via analysis of synthetic N-terminal amino acid sequences. Mol. Microbiol. 1:51-59. Lorang, J.M., Shen, H., Kobayashi, D., Cooksey, D., and Keen N.T. 1994. avrA and avrE in Pseudomonas syringae pv. tomato PT23 play a role in virulence on tomato plants. Mol. Plant-Microbe Interact. 7:508-515. Losada, L., Sussan, T., Pak, K., Zeyad, S., Rozenbaum, I. and Hutcheson, S.W. 2004. Identification of a novel Pseudomonas syringae Psy61 effector with virulence and avirulence functions by a HrpL-dependent promoter-trap assay. Mol. Plant-Microbe Interact. 3:254-262. Mackey, D., Holt, B.F., Wiig, A. and Dangl, J.L. 2002. RIN4 interacts with Pseudomonas syringae type III effector molecules and is required for RPM1-mediated resistance in Arabidopsis. Cell 108:743-754. Maniatis, T., Fritsch, E.T., and Sambrook, J. 1982. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. McKusik, V.A, Kucherlapati, R.S, and Ruddle, F.H. 1993. Genomics: stock-taking after 5 years. Genomics 1:1-2. Mezencev, R., Mojzis, J., Pilatova, M., and Kutschy, P. 2003. Antiproliferative and cancer chemopreventive activity of phytoalexins: focus on indole phytoalexins from crucifers. Neoplasma 4:239-245. Miller, S.A., Sahin, F., and Rowe, R.C. 2002. Black rot of crucifers. Plant Pathology fact sheet. Plant Pathology Department, the Ohio State University, Columbus. Mills, D. 1985. Transposon mutagenesis and its potential for studying virulence genes in plant pathogens. Annu. Rev. Phytopathol. 23:297-320. Minsavage, G.V., Dahlbeck, D., and Whalen, M.C. 1990. Gene-for-gene relationships specifying disease resistance in Xanthomonas campestris pv. vesicatoria-pepper Interactions. Mol. Plant-Microbe Interact. 1:41-47. Moffett, M.L., and. Irwin, J.A.G. 1975. Bacterial leaf and stem spot (Xanthomonas alfalfae)of lucerne in Queensland. Aust. J. Exp. Agric. 15: 223-226. Newman, K.L, Almeida, R.P., Purcell, A.H., and Lindow, S.E. 2003. Use of a green fluorescent strain for analysis of Xylella fastidiosa colonization of Vitis vinifera. Appl. Environ. Microbiol. 69:7319-7327.

PAGE 128

114 Noel, L., Thieme, F., Nennstiel, D., and Bonas, U. 2001. cDNA-AFLP analysis unravels a genome-wide hrpG-regulon in the plant pathogen Xanthomonas campestris pv. vesicatoria. Mol. Microbiol. 6:1271-1281. Nomura, K., and He, S.Y. 2005. Powerful screens for bacterial virulence proteins. Proc. Natl. Acad. Sci. U.S.A. 102:3527-3528. O'Garro, L.W., Gibbs, H., and Newton A. 1997. Mutation in the avrBs1 avirulence gene of Xanthomonas campestris pv. vesicatoria influences survival of the bacterium in soil and detached leaf tissue. Phytopathology 87:960-966. O'Reilly, M., de Azavedo, J.C., Kennedy, S., and Foster T.J. 1986. Inactivation of the alpha-haemolysin gene of Staphylococcus aureus 8325-4 by site-directed mutagenesis and studies on the expression of its haemolysins. Microb. Pathog. 2:125-138. Osbourn, A.E., Clarke, B.R., and Daniels, M.J. 1990. Identification and DNA-sequence of a pathogenicity gene of Xanthomonas campestris pv. campestris. Mol. Plant-Microbe Interact. 5:280-285. Parker, J.E., Barber, C.E., Fan, M.J., and Daniels, M.J. 1993. Interaction of Xanthomonas campestris with Arabidopsis thaliana: characterization of a gene from X. c. pv. raphani that confers avirulence to most A. thaliana accessions. Mol. Plant-Microbe Interact. 2:216-224. Pernezny, K., and Jones, J.B. 2002. Common bacterial blight of snap bean in Florida. Institute of Food and Agricultural Sciences. Fact sheet. University of Florida Extension. Petnicki-Ocwieja, T., Schneider, D.J., Tam, V.C., Chancey, S.T., Shan, L., Jamir, Y., Schechter, L.M, Buell, C.R., Tang, X., Collmer, A., and. Alfano, J.R. 2002. Genomewide identification of proteins secreted by the Hrp type III protein secretion system of Pseudomonas syringae pv. tomato DC3000. Proc. Natl. Acad. Sci. U. S. A. 99:7652-7657. Pomati, F., and Neilan, B.A. 2004. PCR-based positive hybridization to detect genomic diversity associated with bacterial secondary metabolism. Nucleic Acids Res. 32:e7. Qian, W., Jia, Y., Ren, S.X., He, Y.Q., Feng, J.X., Lu, L.F., Sun, Q., Ying, G., Tang, D.J., Tang, H., Wu, W., Hao, P., Wang, L., Jiang, B.L., Zeng, S., Gu, W.Y., Lu, G., Rong, L., Tian, Y., Yao, Z., Fu, G., Chen, B., Fang, R., Qiang, B., Chen, Z., Zhao, G.P., Tang, J.L. and He, C. 2005. Comparative and functional genomic analyses of the pathogenicity of phytopathogen Xanthomonas campestris pv. campestris. Genome Res. 15:757-767.

PAGE 129

115 Rashtchian, A., Buchman, G.W., Schuster, D.M. and Berninger, M.S. 1992. Uracil DNA glycosylase-mediated cloning of polymerase chain reaction-amplified DNA: application to genomic and cDNA cloning. Ann. Biochem. 206:91-97. Remaut, H. and Waksman, G. 2004. Structural biology of bacterial pathogenesis. Curr. Opin. Struct. Biol. 14:161-170. Roden, J.A., Belt, B., Ross, J.B., Tachibana, T., Vargas, J., and Mudgett, M.B. 2004. A genetic screen to isolate type III effectors translocated into pepper cells during Xanthomonas infection. Proc. Natl. Acad. Sci. U.S.A. 47:16624-16629. Roden, J., Eardley, L., Hotson, A., Cao, Y., and Mudgett, M.B. 2004. Characterization of the Xanthomonas AvrXv4 effector, a SUMO protease translocated into plant cells. Mol. Plant-Microbe Interact. 6:633-643. Rohmer, L., Guttman, D.S., and Dangl J.L. 2004. Diverse evolutionary mechanisms shape the type III effector virulence factor repertoire in the plant pathogen Pseudomonas syringae. Genetics 3:1341-1360. Ronald, P.C., and Staskawicz, B.J. 1988. The avirulence gene avrBs1 from Xanthomonas campestris pv. vesicatoria encodes a 50-kD protein. Mol. Plant-Microbe Interact. 5:191-198. Ronald, P.C., Salmeron, J.M., Carland, F.M., and Staskawicz, B.J. 1992. The cloned avirulence gene avrPto induces disease resistance in tomato cultivars containing the Pto resistance gene. J. Bacteriol. 5:1604-1611. Rossier, O., Wengelnik, K., Hahn, K., and Bonas U. 1999. The Xanthomonas Hrp type III system secretes proteins from plant and mammalian bacterial pathogens. Proc. Natl. Acad. Sci. U.S.A. 16:9368-9673. RPD 924. 1999. Black rot of cabbage and other crucifers. Reports on Plant Diseases. University of Illinois Extension. Rubatzky, V.E., and Yamaguchi, M. 1997. World Vegetables. Principles, Production and Nutritive Values. Second Edition. Chapman & Hall, New York. Ruzin, S.E. 1999. Plant Microtechnique and Microscopy. Oxford University Press, New York. Sagulenko, E., Sagulenko, V., Chen, J., and Christie, P.J. 2001. Role of Agrobacterium VirB11 ATPase in T-pilus assembly and substrate selection. J Bacteriol. 183:5813-5825.

PAGE 130

116 Salanoubat, M., Lemcke, K., Rieger, M., Ansorge, W., Unseld, M., Fartmann, B., Valle, G., Blocker, H., Perez-Alonso, M., Obermaier, B., Delseny, M., Boutry, M., Grivell, L.A., Mache, R., Puigdomenech, P., De Simone, V., Choisne, N., Artiguenave, F., Robert, C., Brottier, P., Wincker, P., Cattolico, L., Weissenbach, J., Saurin, W., Quetier, F., Schafer, M., Muller-Auer, S., Gabel, C., Fuchs, M., Benes, V., Wurmbach, E., Drzonek, H., Erfle, H., Jordan, N., Bangert, S., Wiedelmann, R., Kranz, H., Voss, H., Holland, R., Brandt, P., Nyakatura, G., Vezzi, A., D'Angelo, M., Pallavicini, A., Toppo, S., Simionati, B., Conrad, A., Hornischer, K., Kauer, G., Lohnert, T.H., Nordsiek, G., Reichelt, J., Scharfe, M., Schon, O., Bargues, M., Terol, J., Climent, J., Navarro, P., Collado, C., Perez-Perez, A., Ottenwalder, B., Duchemin, D., Cooke, R., Laudie, M., Berger-Llauro, C., Purnelle, B., Masuy, D., de Haan, M., Maarse, A.C., Alcaraz, J.P., Cottet, A., Casacuberta, E., Monfort, A., Argiriou, A., Flores, M,, Liguori, R., Vitale, D., Mannhaupt, G., Haase, D., Schoof, H., Rudd, S., Zaccaria, P., Mewes, H.W., Mayer, K.F., Kaul, S., Town, C.D., Koo, H.L., Tallon, L.J., Jenkins, J., Rooney, T., Rizzo, M., Walts, A., Utterback, T., Fujii, C.Y., Shea, T.P., Creasy, T.H., Haas, B., Maiti, R., Wu, D., Peterson, J., Van Aken, S., Pai, G., Militscher, J., Sellers, P., Gill, J.E., Feldblyum, T.V., Preuss, D., Lin, X., Nierman, W.C., Salzberg, S.L., White, O., Venter, J.C., Fraser, C.M., Kaneko, T., Nakamura, Y., Sato, S., Kato, T., Asamizu, E., Sasamoto, S., Kimura, T., Idesawa, K., Kawashima, K., Kishida, Y., Kiyokawa, C., Kohara, M., Matsumoto, M., Matsuno, A., Muraki, A., Nakayama, S., Nakazaki, N., Shinpo, S., Takeuchi, C., Wada, T., Watanabe, A., Yamada, M., Yasuda M., and Tabata, S.; European Union Chromosome 3 Arabidopsis Sequencing Consortium; Institute for Genomic Research; Kazusa DNA Research Institute. 2002. Genome sequence of the plant pathogen Ralstonia solanacearum. Science 415:497-502. Schechter, L.M., Roberts, K.A., Jamir, Y., Alfano, J.R., and Collmer, A. 2004. Pseudomonas syringae type III secretion system targeting signals and novel effectors studied with a Cya translocation reporter. J. Bacteriol. 2:543-555. Schwartz, H. F., and Pastor-Corrales, M.A. 1989. Bean Production in the Tropics (second edition). Centro Internacional de Agricultura Tropical, Cali, Colombia. Schaad, N.W. 1988. Laboratory guide for identification of plant pathogenic bacteria. Second edition. APS press. Schaad, N.W., and Alvarez, A.M. 1993. Xanthomonas campestris pv. campestris in Xanthomonas. Chapman & Hall. New York. Schmidt, H., and Hensel, M. 2004. Pathogenicity islands in bacterial pathogenesis. Clin. Microbiol. 17:14-56. Shaw, J.J., Kado, C.I. 1998. Whole plant wound inoculation for consistent reproduction of black rot of crucifers. Phytopathology 78: 981-986. Silhavy, T.J. 1991. Death by lethal injection. Science 278:1085-1086.

PAGE 131

117 Simpson, A.J., Reinach, F.C., Arruda, P., Abreu, F.A., Acencio, M., Alvarenga, R., Alves, L.M., Araya, J.E., Baia, G.S., Baptista, C.S., Barros, M.H., Bonaccorsi, E.D., Bordin, S., Bove, J.M., Briones, M.R., Bueno, M.R., Camargo, A.A., Camargo, L.E., Carraro, D.M., Carrer, H., Colauto, N.B., Colombo, C., Costa, F.F., Costa, M.C., Costa-Neto, C.M., Coutinho, L.L., Cristofani, M., Dias-Neto, E., Docena, C., El-Dorry, H., Facincani, A.P., Ferreira, A.J., Ferreira, V.C., Ferro, J.A., Fraga, J.S., Franca, S.C., Franco, M.C., Frohme, M., Furlan, L.R., Garnier, M., Goldman, G.H., Goldman, M.H., Gomes, S.L., Gruber, A., Ho, P.L., Hoheisel, J.D., Junqueira, M.L., Kemper, E.L., Kitajima, J.P., Krieger, J,E,, Kuramae, E.E., Laigret, F., Lambais, M.R., Leite, L.C., Lemos, E.G., Lemos, M.V., Lopes, S.A., Lopes, C.R., Machado, J.A., Machado, M.A., Madeira, A.M., Madeira, H.M., Marino, C.L., Marques, M.V., Martins, E.A., Martins, E.M., Matsukuma, A.Y., Menck, C.F., Miracca, E.C., Miyaki, C.Y., Monteriro-Vitorello, C.B., Moon, D.H., Nagai, M.A., Nascimento, A.L., Netto, L.E., Nhani, A. Jr., Nobrega, F.G., Nunes, L.R., Oliveira, M.A., de Oliveira, M.C., de Oliveira, R.C., Palmieri, D.A., Paris, A., Peixoto, B.R., Pereira, G.A., Pereira, H.A. Jr., Pesquero, J.B., Quaggio, R.B., Roberto, P.G., Rodrigues, V., de M Rosa, A.J., de Rosa, V.E. Jr., de Sa, R.G., Santelli, R.V., Sawasaki, H.E., da Silva, A.C., da Silva, A.M., da Silva, F.R., da Silva, W.A. Jr., da Silveira, J.F., Silvestri, M.L., Siqueira, W.J., de Souza, A.A., de Souza, A.P., Terenzi, M.F., Truffi, D., Tsai, S.M., Tsuhako, M.H., Vallada, H., Van Sluys, M.A., Verjovski-Almeida, S., Vettore, A.L., Zago, M.A., Zatz, M., Meidanis, J., and Setubal, J.C. 2000. The genome sequence of the plant pathogen Xylella fastidiosa. Nature 406:151-157. Snyder, M., and Gerstein, M. 2003. Defining genes in the genomics era. Science 300:258-260. Steller, S., Angenendt, P., Cahill, D.J., Heuberger, S., Lehrach, H., and Kreutzberger, J. 2005. Bacterial protein microarrays for identification of new potential diagnostic markers for Neisseria meningitidis infections. Proteomics 5:2048-2055. Swarup, S., De Feyter, R., Brlansky, R.H., and Gabriel, D.W. 1991. A pathogenicity locus from Xanthomonas citri enables strains from several pathovars of X. campestris to elicit cankerlike lesions on citrus. Phytopathology 81:802-809. Swarup, S., Yang, Y., Kingsley, M.K., and Gabriel, D.W. 1992. A Xanthomonas citri pathogenicity gene, pthA, pleiotropically encodes gratuitous avirulence on nonhost. Mol. Plant-Microbe Interact. 5:204-213. Swings, J.G., and Civerolo, E.L. 1993. Xanthomonas. Chapman & Hall. New York. Szurek, B., Marois, E., Bonas, U., and Van den Ackerveken, G. 2001. Eukaryotic features of the Xanthomonas type III effector AvrBs3: protein domains involved in transcriptional activation and the interaction with nuclear import receptors from pepper. Plant J. 5:523-534.

PAGE 132

118 Talalay, P., and Fahey, J.W. 2001. Phytochemicals from cruciferous plants protect against cancer by modulating carcinogen metabolism. J. Nutr. 131:3027S-3033S. Tang, J.L., Liu, Y.N., Barber, C.E., Dow, J.M., Wootton, J.C., and Daniels, M.J. 1991. Genetic and molecular analysis of a cluster of rpf genes involved in positive regulation of synthesis of extracellular enzymes and polysaccharide in Xanthomonas campestris pathovar campestris. Mol. Gen. Genet. 3:409-417. Taylor, J.D., Conway, S.W., Roberts, S.J., Astley, D., and Vicente J.G. 2002. Sources and origin of resistance to Xanthomonas campestris pv. campestris in Brassica Genomes. Phytopathology 92:105-111. USDA. 2004. National Agricultural Statistics Service NASS. http://www.usda.gov/nass/pubs/estindx.htm Van den Ackerveken, G., Marois, E., and Bonas, U. 1996. Recognition of the bacterial avirulence protein AvrBs3 occurs inside the host plant cell. Cell 87:1307-1316. Vattanaviboon, P., Whangsuk, W., Panmanee, W., Klomsiri, C., Dharmsthiti, S., and Mongkolsuk, S. 2002. Evaluation of the roles that alkyl hydroperoxide reductase and Ohr play in organic peroxide-induced gene expression and protection against organic peroxides in Xanthomonas campestris. Biochem. Biophys. Res. Commun. 2:177-182. Vattanaviboon, P., Whangsuk, W., and Mongkolsuk, S. 2003. A suppressor of the menadione-hypersensitive phenotype of a Xanthomonas campestris pv. phaseoli oxyR mutant reveals a novel mechanism of toxicity and the protective role of alkyl hydroperoxide reductase. J. Bacteriol. 5:1734-1738. Vauterin, L., Hoste, B., Yang, P., Alvarez, A., Kersters K., and Swings, J. 1993. Taxonomy of the genus Xanthomonas. In Xanthomonas. Chapman and Hall, New York. Vauterin, L., Hoste, B., Kersters K., and Swings, J. 1995. Reclassification of Xanthomonas. Int. J. Syst. Bacteriol. 3: 472-489. Vera Cruz, C.M., Bai, J., Ona, I., Leung, H., Nelson, R.J., Mew, T.W., and Leach, J.E. 2000. Predicting durability of a disease resistance gene based on an assessment of the fitness loss and epidemiological consequences of avirulence gene mutation. Proc. Natl. Acad. Sci. U.S.A. 25:13500-13505. Vicente, J.G., Conway, J., Roberts, S.J., and Taylor J.D. 2001. Identification and origin of Xanthomonas campestris pv campestris races and related pathovars. Phytopathology 91:492-499. Vidaver, A.K. 1993. Xanthomonas campestris pv. phaseoli. In Xanthomonas Chapman & Hall. New York.

PAGE 133

119 Vojnov, A.A., Slater, H., Newman, M.A., Daniels, M.J., and Dow, J.M. 2001. Regulation of the synthesis of cyclic glucan in Xanthomonas campestris by a diffusible signal molecule. Arch. Microbiol. 6:415-420. Vorhlter, F.J., Thias, T., Meyer, F., Bekel, T., Kaiser, O., Phler, A., and Niehaus, K. 2003. Comparison of two Xanthomonas campestris pathovar campestris genomes revealed differences in their gene composition. J. Biotechnol. 106:193-202. Wallen, V. R., and Galway, D.S. 1979. Effective management of bacterial blight of field beans in Ontario: a 10-year program. Can. J. Plant Pathol. 1:42-46. Whalen, M.C., Innes, R.W., Bent, A.F., and Staskawicz, B.J. 1991. Identification of Pseudomonas syringae pathogens of Arabidopsis and a bacterial locus determining avirulence on both Arabidopsis and soybean. Plant Cell 1:49-59. Whalen, M.C., Wang, J.F., Carland, F.M., Heiskell, M.E., Dahlbeck, D., Minsavage, G.V., Jones, J.B., Scott, J.W., Stall, R.E., and Staskawicz, B.J. 1993. Avirulence gene avrRxv from Xanthomonas campestris pv. vesicatoria specifies resistance on tomato line Hawaii 7998. Mol. Plant-Microbe Interact. 5:616-627. White, H.E. 1930. Bacterial spot of radish and turnip. Phytopathology 20:653-662. Wichmann, G., and Bergelson, J. 2004. Effector genes of Xanthomonas axonopodis pv. vesicatoria promote transmission and enhance other fitness traits in the field. Genetics 166: 693-706. Williams, P.H. 1980. Black rot: a continuing threat to world crucifers. Plant Dis. 64:736-742. Wilson, T.J., Bertrand, N., Tang, J.L., Feng, J.X., Pan, M.Q., Barber, C.E., Dow, J.M., and Daniels, M.J. 1998. The rpfA gene of Xanthomonas campestris pathovar campestris, which is involved in the regulation of pathogenicity factor production, encodes an aconitase. Mol. Microbiol. 5:961-970. Winstanley, C. 2002. Spot the difference: applications of subtractive hybridisation to the study of bacterial pathogens. J. Med. Microbiol. 51:459-467. Wood, D.W., Setubal, J.C., Kaul, R., Monks, D.E., Kitajima, J.P., Okura, V.K., Zhou, Y., Chen, L., Wood, G.E., Almeida, N.F. Jr., Woo, L., Chen, Y., Paulsen, I.T., Eisen, J.A., Karp, P.D., Bovee, D. Sr., Chapman, P., Clendenning, J., Deatherage, G., Gillet, W., Grant, C., Kutyavin, T., Levy, R., Li, M.J., McClelland, E., Palmieri, A., Raymond, C., Rouse, G., Saenphimmachak, C., Wu, Z., Romero, P., Gordon, D., Zhang, S., Yoo, H., Tao, Y., Biddle, P., Jung, M., Krespan, W., Perry, M., Gordon-Kamm, B., Liao, L., Kim, S., Hendrick, C., Zhao, Z.Y., Dolan, M., Chumley, F., Tingey, S.V., Tomb, J.F., Gordon, M.P., Olson, M.V., and Nester, E.W. 2001. The Genome of the Natural Genetic Engineer Agrobacterium tumefaciens C58. Science 5550:2317-2323.

PAGE 134

120 Xanthomonas ONSA FAPESP network. 2001/2002. http://cancer.lbi.ic.unicamp.br/xanthomonas/ Yang, B., and White, F.F. 2004. Diverse members of the AvrBs3/PthA family of type III effectors are major virulence determinants in bacterial blight disease of rice. Mol. Plant-Microbe Interact. 11:1192-1200. Yang, B., Sugio, A., and White, F.F. 2005. Avoidance of host recognition by alterations in the repetitive and C-terminal regions of AvrXa7, a type III effector of Xanthomonas oryzae pv. oryzae. Mol. Plant-Microbe Interact. 18:142-149. Yang, B., Zhu, W., Johnson, L.B., and White, F.F. 2000. The virulence factor AvrXa7 of Xanthomonas oryzae pv. oryzae is a type III secretion pathway-dependent nuclear-localized double-stranded DNA-binding protein. Proc. Natl. Acad. Sci. U.S.A. 97:9807-9812. Yang, Y., De Feyter, R., and Gabriel, D.W. 1994. Host-specific symptoms and increased release of Xanthomonas citri and X. campestris pv. malvacearum from leaves are determined by the 102 bp tandem repeats of pthA and avrb6, respectively. Mol. Plant-Microbe Interact. 5:204-213. Yang, Y., and Gabriel, D.W. 1995a. Xanthomonas avirulence/pathogenicity gene family encodes functional plant nuclear targeting signals. Mol. Plant-Microbe Interact. 8:627-631. Yang, Y., and Gabriel, D.W. 1995b. Intragenic recombination of a single plant pathogen gene provides a mechanism for the evolution of new host specificities. J. Bacteriol. 177:4963-4968. Yang, Y., Yuan, Q., and Gabriel, D.W. 1996. Water soaking functions(s) of Xcm H1005 are redundantly encoded by members of the Xanthomonas avr/pth gene family. Mol. Plant-Microbe Interact. 5:204-213. Yanisch-Perron, C., Vieira, J., and Messing, J. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33:103-119. Yoshii, K., Galvez, G.E., and Alvarez-Ayala, G. 1976. Estimation of yield losses in beans caused by common blight. Proc. Am. Phytopathol. Soc. 3:298-299. Yu, I.C., Parker, J., and Bent AF. 1998. Gene-for-gene disease resistance without the hypersensitive response in Arabidopsis dnd1 mutant. Proc. Natl. Acad. Sci. U.S.A. 95:7819-7824. Zhu, W., Yang, B., Chittoor, J.M., Johnson, L.B., and White, F.F. 1998. AvrXa10 contains an acidic transcriptional activation domain in the functionally conserved C terminus. Mol. Plant-Microbe Interact. 8:824-832.

PAGE 135

BIOGRAPHICAL SKETCH Adriana is native of Colombia, South America. She graduated with a B.S. degree in microbiology from Andes University in Bogot and went on to work for the Colombia Agriculture and Livestock Institute in the Plant Quarantine Facility, and she became its director on 1994. In 1996 she was awarded a scholarship from the same institute and came to the University of Florida to get an M.S. in the Plant Pathology Department, that she obtained in 1999. She went back to Colombia to work for the same Institute in the Seed Division and in 2000 she became the director of the Seed National Laboratory. In 2002, with ICAs permission she came back to UF to pursue a Ph.D. 121


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20101129_AAAABC INGEST_TIME 2010-11-30T02:10:07Z PACKAGE UFE0011348_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 11271 DFID F20101129_AAATFA ORIGIN DEPOSITOR PATH castaneda_l_Page_009.QC.jpg GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
e2cfc5f47cf0ae89d5704c6fcf08653a
SHA-1
36c81e454c51999444767eac134a2d35780430be
25041 F20101129_AAATFB castaneda_l_Page_071.QC.jpg
3379754c2a63303948d2e5a04ac5930b
c79d326ef06dd7f9ef17511f760f7f468f78eb63
1053954 F20101129_AAATFC castaneda_l_Page_025.tif
083fe2f5e65e2a99230258ff1d2a53c7
7995d371cabd4924276ad74f3ff949815f179dc0
69630 F20101129_AAATFD castaneda_l_Page_032.jpg
29e29a11241e7a6935bdf9fb568ce17c
9b78453d61987691d85608c3583d4b2be394b81b
6391 F20101129_AAATFE castaneda_l_Page_007thm.jpg
834fe6998752f55f6e0aed07150ae86e
14a48ca6767b278dfe5154d27f8cfdb27cf433e2
5922 F20101129_AAATFF castaneda_l_Page_057thm.jpg
1f9276759ad9b549982b8fc6ad8c94b5
84b1ff193320d70d38d4989d099030517d795550
72845 F20101129_AAATER castaneda_l_Page_029.jpg
af6868f817fb4940708898b91071e838
2b58afa0a1b86dfc3f417c4b2b92307b159c1473
13316 F20101129_AAATFG castaneda_l_Page_116.jp2
70c160375a8f2760bae7647f57b4071d
a9a56d1f43e9fa0a854a53e997f6b3f3737b32b7
6430 F20101129_AAATES castaneda_l_Page_073thm.jpg
33cba60be97a4eacb1b77189c2f63e09
a52ec9fb4da45448ec562d4c3c136b27fb614b42
6778 F20101129_AAATFH castaneda_l_Page_028thm.jpg
74eed28b5bdf6cffb731e654cffdd3f1
5ae2cdc6348a5923874e183ed4628a2796b20f7f
7059 F20101129_AAATET castaneda_l_Page_081thm.jpg
eb9c5ecd85c2f1843e18df42773108eb
ba88ed0a79b213d00c0e95dbfaddf41076974973
2559 F20101129_AAATFI castaneda_l_Page_101thm.jpg
18444dc0314e18bffe50cf1ebf99359c
9a5bb7a703a94223c641ec33365675da3ed086bf
6877 F20101129_AAATEU castaneda_l_Page_016thm.jpg
2c01a8cee70762957bebac94d4d8f3c2
1547b0d5fd889f6371941f36d0f1107c8693b300
111323 F20101129_AAATFJ castaneda_l_Page_048.jp2
be5d63b02a1eb22fae1f15c3784c7cc3
c8236ac754e5ab2233fa524ee8a4d99f3c23bc13
4703 F20101129_AAATEV castaneda_l_Page_012.QC.jpg
53f4e82dfbd2821dfd0e005bbfac5dbf
5cbf7f5edd757d5e083e48b041d379f0de55bcbe
6905 F20101129_AAATFK castaneda_l_Page_113.QC.jpg
bfb7fd923687467f53bb1bababdbaa33
7469eafc888630b26510a23e686beb125ff3bde1
25271604 F20101129_AAATEW castaneda_l_Page_091.tif
1f370007a0ea707518254e6471165d84
3963d54626951a60f9ac320b4704d50cdc28c1b0
55671 F20101129_AAATFL castaneda_l_Page_052.jpg
885c9e4a526845892ce3fa4996c226a2
f08740d834465f5f4e2a1a86ae304d77867193ca
6537 F20101129_AAATEX castaneda_l_Page_082thm.jpg
73edec6fc3bbcd04708e2f6c2db0fbcc
1c5854431e240780f5257017c37d074be9156d5c
92052 F20101129_AAATFM castaneda_l_Page_057.jp2
a77507a3266ea9f00466028ed06c6728
847a2770638e2139949a886a844ce3dc280048ff
22267 F20101129_AAATEY castaneda_l_Page_114.QC.jpg
f8f3c59a35e7bc1e17b9c043fcc91ba6
fab8851983ec906b89d3ed40aeded52f95b5533b
23071 F20101129_AAATGA castaneda_l_Page_066.jpg
fa09793fd15d04954aae201b4c78fe04
45572c85925bff494c047fc556e92ab66a15e305
25696 F20101129_AAATFN castaneda_l_Page_011.QC.jpg
ec7175ae2a768bc3c3ba841632cf3e31
62ab65b2f9ea729871e45b5bdfdd66780fe004d1
109839 F20101129_AAATEZ castaneda_l_Page_071.jp2
ebbe80459178a8923931997cd293536a
d66e290f7acee7a259d830d949e496c79936ef88
751382 F20101129_AAATGB castaneda_l_Page_064.jp2
61dbf76c26121cfd26823c1aad88c9fd
b7f5d560b40701ecc92d4149ea23b376faedb50f
23117 F20101129_AAATFO castaneda_l_Page_074.QC.jpg
5b8bb95e3ea9520cea138d372ea3d17e
0d5e789f23471efdfd37691e9254af5cd69aec1a
22496 F20101129_AAATGC castaneda_l_Page_051.jpg
a47512d80c0bc2cf7e98ec4c5cf43817
ad86cf6f2b11428ac56b113a0494d8851ca11a56
73278 F20101129_AAATFP castaneda_l_Page_021.jpg
1d22a1aefdbfe451faf416cd9f7744f9
d254ea3721de51e2fb0442f88071dc8d8ac6ee09
28093 F20101129_AAATGD castaneda_l_Page_111.QC.jpg
95c1d2df5529fc08b9218b9ac8e9993d
bb2d7953d532f6754bda30bcc5708af5ac0f5b5b
1051983 F20101129_AAATFQ castaneda_l_Page_122.jp2
e7fe887703f3b76ff8cfc0dc6e3abf47
6544f0c58f7741f35d4c9a5a6c418a5edd05b37f
4738 F20101129_AAATGE castaneda_l_Page_090thm.jpg
bd5ec2a13eeab53d0edb95c7fff51279
0cd254ccedbb6e7ac3b848cd4fe906b99f536997
22530 F20101129_AAATFR castaneda_l_Page_079.QC.jpg
8eadfb0c7749ccecb78153a32a4b66ab
a769e992ff9733c16858c316223c4ca2ac776af7
4185 F20101129_AAATGF castaneda_l_Page_014thm.jpg
b8eaaa06480e7c89150be06c1f5121c1
c8eff9cc942773b317acd3730049ceb92fd57e86
7251 F20101129_AAATFS castaneda_l_Page_131thm.jpg
2f0dadcf570deff39255b8c9d692a36c
46bb870f0675d2594b96e3d8a220dcd556b58786
9408 F20101129_AAATGG castaneda_l_Page_106.QC.jpg
40a73818dedd1601446b39bf6bf7052b
b2809d234deeb2a2e94a518c1f614a3acbdcee23
72165 F20101129_AAATFT castaneda_l_Page_114.jpg
9082f92e0b0d760dfd4b72d24d204664
7dd00f650fea0bb777feb9a33cfce97b4e585c74
F20101129_AAATGH castaneda_l_Page_124.tif
6dd184cff6f0b216486a34d64b7620ec
0c6ed2a9e6978014df9182386dd7af9f71908f2d
118740 F20101129_AAATFU castaneda_l_Page_105.jp2
ec02a71335806613e3a016c162c60975
f7c57a98d4ad62cd0b093f267b326bfc4d4fdb41
F20101129_AAATGI castaneda_l_Page_071.tif
bf1dc08a6c2b89368306f2665d032bf8
543ea91f3848c8d19805390a43c1bdcc64cb9e87
21208 F20101129_AAATFV castaneda_l_Page_010.QC.jpg
95f6e3758eb99473a79a6be56dc9a3c4
296a12e5f52544fd4c25e6a1d5d5f9f34f39d2b5
773574 F20101129_AAATGJ castaneda_l_Page_090.jp2
33da712fb2c28e677ee6bdf18f0dee68
606c429b551488f107e368fadad2d0f896f5d823
114942 F20101129_AAATFW castaneda_l_Page_020.jp2
3e16142de60d4ece26c43d42c018a856
631870de9d3e3281432ec1c891c7dab6fd414512
3296 F20101129_AAATGK castaneda_l_Page_002.QC.jpg
9d2b5d4bdf7f91f811758fd6bf531b0a
fbd2aecd114215b5df1b66842afb0738deaebdbf
F20101129_AAATFX castaneda_l_Page_005.tif
0efe79047d6f7b6e094e6f1a0df0ab9b
081785fa1299ec198be21e94b8b62d44161ce27c
2544 F20101129_AAATGL castaneda_l_Page_025thm.jpg
0dd50f8e9408cb97e9b020c4ec00bd55
8f17e7c0c5b26aa446c8206d7fb0741b5c689c9d
102686 F20101129_AAATFY castaneda_l_Page_070.jp2
de4a38587a89e74ab49a3b37feffc5af
33280c81763a65e18f70f5c07eadcb3433cba360
5705 F20101129_AAATHA castaneda_l_Page_114thm.jpg
d1aba572d304192f2553179815e735ba
f7a73f4b6025da7225d7ec0ca314339d3d23faf6
70207 F20101129_AAATGM castaneda_l_Page_031.jpg
b37797f33a63feab83be31b091be9ba9
bc8767efbfc103897be3d6a7e36ceff449e3150a
28241 F20101129_AAATFZ castaneda_l_Page_133.QC.jpg
54f14e03c557085f36e7f3286febbf51
2e5ed30b33ae235a38e7febea3377d57c7b955e0
58021 F20101129_AAATHB castaneda_l_Page_098.jpg
37cfb0f836f94cef8dcd9c12ef64d2d0
2dd88e93c2cc06873886c9c3218cf3c5f3e4d2c6
6498 F20101129_AAATGN castaneda_l_Page_044thm.jpg
db83dab335898d175c7c8422131f392a
aeb17ad24487e5d85eca836ebc4418b60dd91419
7471 F20101129_AAATHC castaneda_l_Page_130thm.jpg
ad7a58f34cd145ee5765d0d6c4500df1
0317765f7ea22517ee206d1c61153bcd51706608
58643 F20101129_AAATGO castaneda_l_Page_013.jpg
d47050ea774650127355d218f8c79373
b540881b3cc3a9039b5d954276950cc0e7e64bd8
80254 F20101129_AAATHD castaneda_l_Page_088.jp2
ac46a9de344dbe8d9881c88620d64543
e241889fdb02917951c62fdca4c7a45c8cb68676
71259 F20101129_AAATGP castaneda_l_Page_050.jpg
85ac8e69d9c2ba3d54b5f8377db602d3
9c570bec7e6225f5687339128e9b3f387c46e720
28958 F20101129_AAATHE castaneda_l_Page_119.QC.jpg
04225f19e2de2ae42670f8fbfad3ffce
4ef5cbba852deb3adc40cd089a84465275c4b45f
F20101129_AAATGQ castaneda_l_Page_099.tif
7314cd65b2dc6d41e7e2afb0bddf2e2f
749334b750345ca7c1ae494eb01a3f6ccb008b15
21706 F20101129_AAATHF castaneda_l_Page_073.QC.jpg
211091590910b63165a2bc0a0f929bbf
fbde7ba5bcec1c95cde5554819d7483c6a23992a
F20101129_AAATGR castaneda_l_Page_128.tif
223ff5f827edd355ac6911be4c63b01a
d7a85007ab198c9bdd5570fb5de1b4e8c3a6de59
773408 F20101129_AAATHG castaneda_l_Page_052.jp2
02f583b06f42526750d89e23d5bbb309
e3c8f9f2e528aef5d14bfc35146b0cc2afa47c70
110088 F20101129_AAATGS castaneda_l_Page_072.jp2
82b9d5d6c7e2c8de08c1f7767eefd11a
914ac417f9800a6a777ded9f872a3cfc48d27a72
15112 F20101129_AAATHH castaneda_l_Page_037.QC.jpg
3a58788522bee5b23c3c40f9e4a16940
8cb09cf715f112db8b2033a0d41225a43fce9493
F20101129_AAATGT castaneda_l_Page_013.tif
3107d845229e2799bf159b3fbfc52be3
7fc89b0821fb8028b17211e2214ba9a27095fbd5
110660 F20101129_AAATHI castaneda_l_Page_059.jp2
198f1304f922feed655e88063c94228f
557781afcd27e58d60212a0ae09b38485c46ebdf
F20101129_AAATGU castaneda_l_Page_015.tif
9cc3a4dd01a544fcd95e02bdbe45ce16
76501e3e9bbb817f3b65efb0c488a34ac42ccb2b
1051972 F20101129_AAATHJ castaneda_l_Page_132.jp2
73a2ac34a5eda09d5295a3e758e4a982
a4ddc98845bd940cadc25eb8d046ad04fb4ef531
84052 F20101129_AAATGV castaneda_l_Page_098.jp2
4280c1aa89d9475ebd614820d9655f8f
370e50b9fafcaab19bc679a8603436760bc63a67
1404 F20101129_AAATHK castaneda_l_Page_002thm.jpg
1c0af25a55a7f7798b67b52c0910c107
bf83894a9484de4631199f4cfd5f295eabb91c5f
7258 F20101129_AAATGW castaneda_l_Page_124thm.jpg
17e21b5ef1a42137e9fd1f3fca46b630
55237d09963edfa83c35bda5258b857d4e2cedc9
80159 F20101129_AAATHL castaneda_l_Page_129.jpg
cf0c2c5f83d702238cb1a204a0daf059
4d4700cfb959e5e0355b6442f0714d86863a8712
70937 F20101129_AAATGX castaneda_l_Page_010.jpg
0009454124473488394f4ee3721da502
4a8930a3469540ae386705a478bf8d27960f523c
6294 F20101129_AAATIA castaneda_l_Page_109thm.jpg
d07ebc31df0b226996cfa3c50d8274a5
d9b0d7166c82d3051fbf86b9e6d789c9cc92b4eb
6621 F20101129_AAATHM castaneda_l_Page_003.jp2
641c7607325588607df037cacb0a3b35
3250b9843970dea3143e3b0d5b0d27740b1f5fd3
24610 F20101129_AAATGY castaneda_l_Page_019.QC.jpg
af9c7e513d5d4e204d32efbb5c9870be
d0184f84a114e6223f0a1b495404066c6b47e177
3385 F20101129_AAATIB castaneda_l_Page_003.QC.jpg
c66ae6530855d06b1ec5bd6ecb18bd71
9609f1666977d459c26966b52108f653457cddb0
75199 F20101129_AAATHN castaneda_l_Page_080.jpg
dadc368bcd89b8e9fa324ddcea698ea2
e15c7681ca0b278b6a3cb35741bd9f8649451864
F20101129_AAATGZ castaneda_l_Page_022.tif
08cdc09c6b0693b1e2bf3adb9ec48a82
e1706006c624df7f880d7b7960554667cbfd7a6f
109721 F20101129_AAATIC castaneda_l_Page_021.jp2
69b985ad712fb52f92c152fbb485c68b
5d25eba4f08b47b464b9e05153ff18f4b8a62ae2
69309 F20101129_AAATHO castaneda_l_Page_070.jpg
2d3b3cdde5ae7081e207f97141b9235a
3efbac170ea427c692ca715d2bec182ba2bbdb3c
F20101129_AAATID castaneda_l_Page_117.tif
c2e40855f0220bdbc0a778c6e228c55d
1e9498f97eb301a252b74e09aec707578f7dbf72
115039 F20101129_AAATHP castaneda_l_Page_017.jp2
578157d5939486e7816c00855089e1b5
1092bced582cc524e6d4f0dba32be2581cd0685e
7030 F20101129_AAATIE castaneda_l_Page_077thm.jpg
abbf97577561c23a0f3a745103ed947c
0fe4a2743409432e4712638d797b6d9fd1f312c0
24359 F20101129_AAATHQ castaneda_l_Page_016.QC.jpg
2e19b0e9852c6231cc05dc30b6eca82b
fb9bb1aec1b82ee701918827112e614238ea782e
15840 F20101129_AAATIF castaneda_l_Page_097.QC.jpg
3d7825d2832e260f8cd74322accf3768
07d508ba07901c300900a891c421b36345b6f41d
67912 F20101129_AAATHR castaneda_l_Page_079.jpg
4ceec45c21a4f442c5a1deec93056450
c91089174e76858fadd3f289bf32e4fa0b6f1903
61639 F20101129_AAATIG castaneda_l_Page_004.jpg
5b88f2f05e2da2039f8e0bf17b7f0011
db29b2f15693137f6747237dfe98eac214320518
F20101129_AAATHS castaneda_l_Page_056.tif
0908b5ecc63e7002e03eaaadbd40314d
af8cdeb55bc715ade2bf4fd5c9a3b88e598283c3
106313 F20101129_AAATIH castaneda_l_Page_050.jp2
f8247fc5034f517c8f7a81d8be1906b1
18a26fb5adecc078965cb3d178c6372423029990
73422 F20101129_AAATHT castaneda_l_Page_016.jpg
8e9e0e45cd5a18780ae2e1876dce69ec
4cb643e0cf53c4858261d4e57ac8eb01d90d1ba3
F20101129_AAATII castaneda_l_Page_041thm.jpg
05e7942e2ccbc2ac501b35817397a0af
2d0074c3e02e2d9d761666e4466d7cdb3a7ccc03
F20101129_AAATHU castaneda_l_Page_107.tif
53b6226aeb8ea618a54c479e5f34cf3e
bfb11a6ea894e5fba10f396e952f25e35b693086
2689468 F20101129_AAATIJ castaneda_l.pdf
bc60e760946234533e890d28806fc269
bd51c3577b1475797625b057dc8b4d5cbefd10f8
F20101129_AAATHV castaneda_l_Page_104.tif
392828a9ff42b5369f5a51ca395800fd
fac6ac6e79929c8cb99998b83c91209ccb90809a
22470 F20101129_AAATIK castaneda_l_Page_082.QC.jpg
8317131f5dc3c8f47b1aa9ec38caec1d
576109695c6c61fffd943f6f46f203cd413af96d
51815 F20101129_AAATHW castaneda_l_Page_064.jpg
e53328c7e3aa46404d1562068ee03507
4921d9ee97ec2b595c1decc7515ed3a12f76e296
6840 F20101129_AAATIL castaneda_l_Page_048thm.jpg
ddc413c832edc97914125190c58ce665
4d02d04d017e3c261335ca6c0f3d144d232e46cf
6757 F20101129_AAATHX castaneda_l_Page_069thm.jpg
b626a40582fd5650b5dc1c939a8e4690
7092c92212b309b6e97b069d51acb495235963e1
97242 F20101129_AAATJA castaneda_l_Page_110.jpg
f5393c9c303a0224ded6bb702fa26c5c
b12035064aeb6a24dd7e856f7413b879f9cec943
15054 F20101129_AAATIM castaneda_l_Page_040.QC.jpg
a3c0809f6fbe963ba6e0b0fb2e22ac4c
ee467db08bf9c0c0dd4003300386f1f85fedcc01
73525 F20101129_AAATHY castaneda_l_Page_085.jpg
9041c0be091a3f6b0fe65fb0f716cdcb
35eced22ef2add0b79edbd716c8e3858f1c29ad1
F20101129_AAATIN castaneda_l_Page_103.tif
5f21c53072994a5b969f63cbdbf06255
512070728fbb4c4ea5376739d9a2082b1a24ac2b
72468 F20101129_AAATHZ castaneda_l_Page_019.jpg
f0f55332b3aaf83dd6ec188b6b36ed56
b224466351ba0c0c72156f54fce2b1850afbabe1
73797 F20101129_AAATJB castaneda_l_Page_112.jpg
542e5b3ba726f233a804594b0eefff88
246eb4e27e1d45bd5f603a187dbb269a821ac180
23675 F20101129_AAATIO castaneda_l_Page_049.QC.jpg
94cfeca3b96c9ed951091eff5670ac45
915764dd1783fec7ce4dd72d9eb80092ef72e5b0
107579 F20101129_AAATJC castaneda_l_Page_087.jp2
a1f3c46877e73baf694c879838d019e5
dcc2f9c812612970f733896b291f51c11f38a778
18167 F20101129_AAATIP castaneda_l_Page_013.QC.jpg
ef6bf975b901a6db47cab48a08d8be03
b29ab2fec339a51a0fc972ad4cd0fceef68eae5e
106816 F20101129_AAATJD castaneda_l_Page_032.jp2
fd92cd7f8edc06413f52b644b8e98b68
63568d10fad0a385a56d77225801de9c244c61ca
85454 F20101129_AAATIQ castaneda_l_Page_112.jp2
b84254bf50c09cba6cd06051da584a8f
9042a25645755f6f0cd8bd8b20a8a6dd4f8f4cf9
F20101129_AAATJE castaneda_l_Page_102.tif
c372f7440536f6edf665b85521cf520b
0bb64007cad18a38f4894f12d6b375d795cdda8e
F20101129_AAATIR castaneda_l_Page_007.tif
0d79d6a19d9a93bc2303127d51ab965c
01c42c8b16cd0a35167f07a729e00c7511624f47
23655 F20101129_AAATJF castaneda_l_Page_001.jpg
63c9ce9dad123896a4b615e6af4fdcc8
991d353c028549c12a9bfebf6e759128d50727cc
10449 F20101129_AAATIS castaneda_l_Page_003.jpg
4cde6f395a8f6a3663c8ce18da42d6d5
0cecacd9d901006f32b3ff12b0596202a06c2cee
5476 F20101129_AAATJG castaneda_l_Page_039thm.jpg
5658e40767d3229fde94ca04713d6234
bcf57fde282f2b2e20a05baffee599bdfd171398
26213 F20101129_AAATJH castaneda_l_Page_007.QC.jpg
9dddd90c1831adc0ee4ea0a156a1e033
cc9c3a6f2f95ab168f1d085fa9f52ee6a57bdd12
4902 F20101129_AAATIT castaneda_l_Page_037thm.jpg
0dad25e05a366249c948b1a140b7e8e4
5bf4d90f0fda28a8903a8c550d937b5e6bb19c95
6341 F20101129_AAATJI castaneda_l_Page_112thm.jpg
27a5e1ac55bffa2c152b410e7e3dc112
83cf1c33abce5807a8628e64f0246fce5a71483c
5785 F20101129_AAATIU castaneda_l_Page_010thm.jpg
f1aeaae267b615cc9753214e73208901
45524f5dbc5f60c7da2a4f732328ac32c3d622c2
2845 F20101129_AAATJJ castaneda_l_Page_106thm.jpg
25e73af2e18eb26d018106852c772f5c
409907475cb4a8027c6059669ab607b445cc2e34
7279 F20101129_AAATIV castaneda_l_Page_118thm.jpg
42f1a8237cb63aca18c36caedf8e0ab7
7d798c6c44df7433a3b462d5edcd7ee065733281
91695 F20101129_AAATJK castaneda_l_Page_114.jp2
c1447909b83fd41d6201f7c906e4dbbc
76c98370a3f24e60e47f4c7430be33f1aa2ffe60
F20101129_AAATIW castaneda_l_Page_094.tif
878a669d0245d5c7cc5b5d985547ab88
7e3978ba87fff3dd4f532be6b279c17e3b976cf7
19843 F20101129_AAATKA castaneda_l_Page_006.QC.jpg
b225dae55cb6c056676ddfad4a56f9a7
203e9e15e3ccb6f6f7ceb0e6e980abbf593f046e
109255 F20101129_AAATJL castaneda_l_Page_024.jp2
5f0b7c426bbb8455187a6f40fc08bc6f
b91c01f862db22bbd65c70c8f07dc69c080bb23c
19747 F20101129_AAATIX castaneda_l_Page_115.QC.jpg
d114c8c1529b62ec8aadc4eea52e4bc7
a5b0ef052335d9d903a3e87db5f7e25f26795c4f
117378 F20101129_AAATKB castaneda_l_Page_117.jp2
cdb0353a6ad648101b42002c6f14da43
1bd403091e195ed0d0d32b0f8e37dc77c0f315b3
73518 F20101129_AAATJM castaneda_l_Page_068.jpg
20ad36499dad95d067ef5f461fc47b35
943d1f45e27e1dcc8eaa797446ecd2b7c3d95287
F20101129_AAATIY castaneda_l_Page_110.tif
0fa60a9bd92f223c86fed2d52c431d11
193d3358ca86d1308611d7d2c58cfd877c25635f
6272 F20101129_AAATJN castaneda_l_Page_042thm.jpg
bbd7c16e5d963cad295a4b6919356d2f
5ffd65dbe4f51ba02a150a4c04a3e95ca9675d19
11375 F20101129_AAATIZ castaneda_l_Page_096.QC.jpg
6459014ec4c425b6675d1d4c635d365d
7d061e0b12a264ea06451ca0721e418a431286eb
24137 F20101129_AAATKC castaneda_l_Page_129.QC.jpg
799abf2291dad377134aebc7d59a36ff
925479c42e54da31d401fd146e0aa015a9cb2d2a
71688 F20101129_AAATJO castaneda_l_Page_075.jpg
6cce30e5984defb9b50f559b64c6a9d0
8ae6061bec89c72a4f410372763fd10a51d40a90
24027 F20101129_AAATKD castaneda_l_Page_021.QC.jpg
4174cb60f5cfe0ad71e3ef3a1c282e2c
823307e8e6f8f5bbf3f095ed000553b641813ce3
F20101129_AAATJP castaneda_l_Page_131.tif
33d1dc6f239a7d91993c8595e889e9e8
e27c6232c690125801ab8ec3623dce3f3442025d
69607 F20101129_AAATKE castaneda_l_Page_067.jpg
927af49aebdfbb856a5b8d08970efd3a
6d599afab84138579fbe2905689a2f3950db5984
24347 F20101129_AAATJQ castaneda_l_Page_068.QC.jpg
12ce10a732fff8556b1999fec2d91374
657322fc58266a3028a4a99d885e0c90a0f21f4d
5193 F20101129_AAATKF castaneda_l_Page_006thm.jpg
8a0fc5f76f3d3c7a3efb4a05ed0e2875
8727e55e6bcdd20429b65b3910254c2f28ebaa0c
23182 F20101129_AAATJR castaneda_l_Page_032.QC.jpg
ecf90722ebae4cce6aee095b97666392
3ea4c053a508a100c04eb3b148d2932d84a3cdc1
27112 F20101129_AAATKG castaneda_l_Page_125.QC.jpg
883d70e6fcb8fa33490a2e0bccd6a35b
c4c6e6c17808d1c71842b7c91cc471f7655f8f2b
6175 F20101129_AAATJS castaneda_l_Page_117thm.jpg
d558bebaba3eb3260ee1d6dd2b7e4cce
48e1bcb9b2dbc84a09718017f9f8890d9d4c100b
F20101129_AAATKH castaneda_l_Page_072.tif
d1bd18280d489cb080e471a78c171f19
41278fed0f6f99213c3063f4f4e69f1d93411eed
4962 F20101129_AAATJT castaneda_l_Page_052thm.jpg
1f8dfd8f60174e1f355aa5ec1cbdbc85
070a3123e9e100baf068bbba4b0aac1928cf4947
108055 F20101129_AAATKI castaneda_l_Page_086.jp2
7079ca12a332701db12e5f9c308de28b
8f416a7490dacba600ddb4db1adc588b6c73807e
4830 F20101129_AAATJU castaneda_l_Page_036thm.jpg
5b0b187f1c87b6f48ca9f38052e76ef7
cb1063535bea998ea954ab16e7d176057ca692fe
92327 F20101129_AAATKJ castaneda_l_Page_123.jpg
04ded5313172e1721f597fd1f6db18b5
e3b779b4195e1b8d4d150ca41f7da401aec34922
5415 F20101129_AAATJV castaneda_l_Page_035thm.jpg
3146b48ac9b399942ec46bac99b6d085
a371498b5e86bf0314992323d57d5a0c37b079c8
97786 F20101129_AAATKK castaneda_l_Page_042.jp2
4315684ec644e331c5d981490bc9e97f
9f845e60cf471c2e0439f6bd89210103ae249ba4
F20101129_AAATJW castaneda_l_Page_082.tif
43d3628b07afc616b1ca8657759368c2
ea571ea2f1416b3444c6a07142d6e4b91b022865
65806 F20101129_AAATKL castaneda_l_Page_026.jpg
d5b9bba7f481cf9eedb7b0d68cf43d75
6ec76824196e4164d59cfd1fbcabe8da4eedc9db
6925 F20101129_AAATJX castaneda_l_Page_126thm.jpg
24f6c37e2450b963c37df248fcef4dbb
553fc067fc3f43c5d4c9de97a4097c9f196f7fab
F20101129_AAATLA castaneda_l_Page_121.tif
e60b3d71a850be2b2ff45616866cb411
2f40e0a150cad8bee0a0cf628d6ba9d980a1932a
22863 F20101129_AAATKM castaneda_l_Page_083.QC.jpg
f33761bf7ce11e6ddfc0e27c1146e4c5
334a2a518468d5f61e4cc3d2fb94ee5eded7aa3c
F20101129_AAATJY castaneda_l_Page_106.tif
9ab89a020d9713a6098e0f9b48a1f0a6
355a878dfe7ae517eae423b72ccdcdd44daa5f3b
10935 F20101129_AAATLB castaneda_l_Page_135.QC.jpg
9f01acca9c58d4ef32172ba71026d412
6f14ae71557182c7213172bea64320fbdb52e3d8
23172 F20101129_AAATKN castaneda_l_Page_047.QC.jpg
e1ff60dd9bac4176faa259913dee8814
7da356a1e5cbb4dec20d1de467d19e00db4f9bd6
10267 F20101129_AAATJZ castaneda_l_Page_002.jpg
37c25fcaaff3212ffad5a011be5706bc
69a117f33be90b7aa3e6165c1cbb52e7a3a89c70
98039 F20101129_AAATLC castaneda_l_Page_102.jp2
b4892a14e0f95dc862b03ee59b791ae4
5f1b00487e6c209b4de2705e8840623dbe9b467d
6904 F20101129_AAATKO castaneda_l_Page_033thm.jpg
74531971141d80c5c24713998b25664a
9c53577361711a76f5c3f49a12316a2741f53218
22964 F20101129_AAATKP castaneda_l_Page_061.QC.jpg
898ac72789068169ab846f25c7322258
40311f0bbee93ea941550ec6fdd2ffefbf1da13c
F20101129_AAATLD castaneda_l_Page_010.tif
cd070c602d628c9536ec7e22d45e373c
ddc23c43f27a76580cd06aca766db1b083371e37
6342 F20101129_AAATKQ castaneda_l_Page_108.QC.jpg
86eaa3c6458353583777c709ae041a61
ab4417f5918009d8a79f9cbbf119c1138157f58c
29733 F20101129_AAATLE castaneda_l_Page_106.jpg
ff081a64b5dccf99fa2d981ea96a149f
4812e9f7328374bb3f602a565e842540f7766e57
23239 F20101129_AAATKR castaneda_l_Page_069.QC.jpg
b0e6b44213c3dbc777b889e26cb9df4a
6feeaaf1510077fb64e1cbae2f3053800b7a35de
68976 F20101129_AAATLF castaneda_l_Page_027.jpg
095fb93f765d8006ad1cfc1e23f1d01c
1b14f3acefa70f9ab2539d3bb59c4849c00f242c
22893 F20101129_AAATKS castaneda_l_Page_008.QC.jpg
c7b5dcc7849b1a1e2b0069b408eac504
20007ab4a6a114e0b4b9379ebddb6c693bd6fefe
6564 F20101129_AAATLG castaneda_l_Page_034thm.jpg
b628c58862eb064ef13d0829fc18bac4
d92e8b69b18eba339bc7a17cdc5c4a2f1799bde4
37167 F20101129_AAATKT castaneda_l_Page_054.jpg
8dc3b80d810cafa6dbafab2bb8370e02
b9d1c69fdb0ba8a724510377942061a039b0e197
58823 F20101129_AAATLH castaneda_l_Page_115.jpg
6dd2771a8de06acdbb897869ed8c9c08
72b91205f5713140828adc6c50858cbebb55182e
6692 F20101129_AAATKU castaneda_l_Page_087thm.jpg
e406aba284d39e1d9d3fe55cf83b98c5
d5761b3e68460bc17244fb8307d5dde4d2a0dccb
14095 F20101129_AAATLI castaneda_l_Page_095.QC.jpg
be9c966f73e5be656c0c5aeaaefb72f9
a47aafa6a5726ffe97d5e3ed4e57f9738078eefe
54304 F20101129_AAATKV castaneda_l_Page_088.jpg
597bc2d327b04d40c093ea41a2f0d5bb
5ab7ac06fad0f6929f25a48efeeb4300a50b2cdc
6551 F20101129_AAATLJ castaneda_l_Page_047thm.jpg
4b8ece047c2fce8ea28f4b015c82827a
a0e0038548e7307fcf993c065d18ce577b7e1301
105096 F20101129_AAATKW castaneda_l_Page_069.jp2
e0b0060d3b2a777c9f1cb8ed491726b0
9f6d176f04ea510bb3417fcd444a7c472e1d006d
54939 F20101129_AAATLK castaneda_l_Page_092.jpg
977f1882e2f1837988d8226b9b584ed6
cf5074df84d69be13d89ed7eda39ff137506f3e5
4965 F20101129_AAATKX castaneda_l_Page_099thm.jpg
aec39fd6d4f7394cf197d6fbcbaa9e38
1941fc8b33e9f8261863fa57f6065dadae90c317
23447 F20101129_AAATMA castaneda_l_Page_086.QC.jpg
2f7a80f4ad6f1f7e439db7cbaeefb209
5d3aced6c12d84d5d4036d5f6fbc4aae06f68fc5
137573 F20101129_AAATLL castaneda_l_Page_125.jp2
ceb09f52979bed67d1bd7273599a43b6
ff5ef36c78f9b7d273262aa7f9540e8720ac7626
F20101129_AAATKY castaneda_l_Page_051.tif
cbb54dc407a5941a03130d9573eb22bd
ee14d05559b4aee93787b34b3647a056bf9a6996
F20101129_AAATMB castaneda_l_Page_055.tif
8bf1a884106ddcefcda19b6969af0020
50528475c8014af133a7afee28d31a931079da3a
130322 F20101129_AAATLM castaneda_l_Page_124.jp2
3cedd7d785f06096c8dcea313d45eeb3
0ccbc6faf5e7f4df0531179a6ba817563218db60
F20101129_AAATKZ castaneda_l_Page_002.tif
27602a45f26883557932e7025f42275a
0f635b20915929031754cb2571a3762f4c73fe5c
75057 F20101129_AAATMC castaneda_l_Page_022.jpg
cc1d238cf0016d093428277f0c787b21
60f3e9802e8012c51687a05349e335ea0831b310
7346 F20101129_AAATLN castaneda_l_Page_133thm.jpg
6248bdd7c1dfa8c0202746afab70e167
041a799a7547c58c2795ed00ff5d8a0133d95210
105188 F20101129_AAATMD castaneda_l_Page_082.jp2
6b41768e5e763e97c94cb07136ea7f5c
10e64915f4a4180c1ad8189fcb490976bbcb116d
65843 F20101129_AAATLO castaneda_l_Page_015.jpg
cd56fc888cc939246365808aacd8a2cf
b7e8cb872ba24fb2415c2369a422dc17e24ec159
131922 F20101129_AAATLP castaneda_l_Page_128.jp2
d740e7e085bda412494d7ed83cfee654
db32abb0ff8da276cac4c2111fdc3cf8fba49b8f
14881 F20101129_AAATME castaneda_l_Page_090.QC.jpg
e766933c4798a9731b84de1a8b570b0f
66a16c862d28a044386447109432da62b716cfc9
6370 F20101129_AAATLQ castaneda_l_Page_091thm.jpg
609a330c97ec353a22f1f7405027b528
098b7fb22566fd68b9cf20de1b588346f91d9d9a
F20101129_AAATMF castaneda_l_Page_083.tif
ce1d198004c4beb3d430e9d7acb777cf
2e0aec27b9b29086a1b0e914d8ffcebb5930f277
104223 F20101129_AAATLR castaneda_l_Page_109.jp2
93e460701d64e54ba3c1eda8aa48dbb3
6f53c6a5c2604b43be22215ae4f7184b55c745c9
3295 F20101129_AAATMG castaneda_l_Page_055thm.jpg
399b2250fb07e45f0fcdeac9064943a1
83b987c85f8c441726c5b77eac728b3bafec562f
92596 F20101129_AAATLS castaneda_l_Page_111.jpg
db05e592635e17fd293846c60dc01418
629a84f2127760b50901201b60b5b37129b3a400
7025 F20101129_AAATMH castaneda_l_Page_046thm.jpg
706f12dacd78d3d4756e7252cdba13eb
17d71636845fe34cd8016c31c047489037f16d49
25437 F20101129_AAATLT castaneda_l_Page_001.jp2
960024b283bee7bfd8624616e0fdadf6
bb21c7d15720662b2813477a090d2ae4dfaa372e
6500 F20101129_AAATMI castaneda_l_Page_045thm.jpg
a9a6848e898aa31a26ee2bee554c6201
cbc4c0491e7cc1af7f33fcabe8014c75781dfd0c
1051977 F20101129_AAATLU castaneda_l_Page_097.jp2
4cc6554302f4af58971e8468a88a4c2d
0c40c9b523e1c02942930eee49b4fcd5201ac69c
2218 F20101129_AAATMJ castaneda_l_Page_108thm.jpg
935582f51455104f1745a4f59861d7bc
ee409aee648fa24c6ebaa2e86ac344b9beb9a25e
22845 F20101129_AAATLV castaneda_l_Page_027.QC.jpg
6bf767e21611060e060f68058d814ebe
02ad392beb913dc7583620028de7ef3a07c4ed9c
34650 F20101129_AAATMK castaneda_l_Page_053.jpg
52d040deb59d427d26a2351dc07f48ad
7aae7c3bfd91face881fc8811d9324fb318c3605
6955 F20101129_AAATLW castaneda_l_Page_019thm.jpg
064cc0eb97288f76c11a9a3a1a5643bf
ee2dc3968063a1b7368ddc4eab382df1fbe90a40
18137 F20101129_AAATNA castaneda_l_Page_088.QC.jpg
324a2c73952c25e0db2e053569adb71e
875323db0d0d1af792ec18146ba1bcc17f5fd6f6
56388 F20101129_AAATML castaneda_l_Page_100.jpg
22d4e0192b40f7bed4af070f06f3c04b
510aeb5358e5a4959f538cbc04bd7a7d3be82b98
F20101129_AAATLX castaneda_l_Page_134.tif
f23f761a7245bc3ce28927aea5421c2b
8dc8406ec7dfb6c19c184bd5a9ac2302c1e3b2e6
5502 F20101129_AAATNB castaneda_l_Page_092thm.jpg
1ddd2150eccfabd94558b03ed47fef64
dc7cb63b886cd4f6681af91fb83abcf5b6d52b49
1051982 F20101129_AAATMM castaneda_l_Page_134.jp2
1e516ba2941af58fe954b30190c67d1a
7ff1b4181de1f5d8e6bca104681cc412cec6071b
88417 F20101129_AAATLY castaneda_l_Page_126.jpg
58f4b888fcaa36d7c9904b3396b1127e
d44800cabf318fd3fe0335f6c4b18b07692955c1
23800 F20101129_AAATNC castaneda_l_Page_112.QC.jpg
d5d25a8260e0c5b8bc8cffd88653c5ac
0c7d1802003f73f9f9942b5f253cfec074fcd292
146502 F20101129_AAATMN castaneda_l_Page_121.jp2
d12bf382350f01a31a75a3b8fe0750e5
5c1e22983809c81e5a7fc8e616fc4f009d681e84
6860 F20101129_AAATLZ castaneda_l_Page_072thm.jpg
af3d7152479717a4fd1b9b7c7f5bae31
847559191a05761cffc658fc219e38d0ea512cf3
F20101129_AAATND castaneda_l_Page_125.tif
64bd330ed2f2167bc3c950ac6a591b81
f66c2791ccc1d0fb3d4b3f47e9bd8d2c2fb65a38
6793 F20101129_AAATMO castaneda_l_Page_049thm.jpg
6e6733c886989771ce93f5f70a3e02f8
6f8eebb6f884e8cb088370675e7e7cc6860db723
F20101129_AAATNE castaneda_l_Page_014.tif
b378b5920a9be2d0866e83918315128c
ce75ab4ff86fdd9ffd0ec76c40e0a29f26759d1d
114404 F20101129_AAATMP castaneda_l_Page_084.jp2
b3ff39c3b8308da7bbd826a3e15b4025
72a0f41d6293a6d2d7232caf4dd8ee4a88a1caa0
24781 F20101129_AAATMQ castaneda_l_Page_033.QC.jpg
6016564f8715a542ed634d44fe44ea48
817e7ca174b4b1662a0132bd51ad491e08eef0f9
21498 F20101129_AAATNF castaneda_l_Page_042.QC.jpg
ab7a66a3a789b5b8da0a7c03ab012cbf
788c2de1433206d23c36718bae59a79210df8ebe
F20101129_AAATMR castaneda_l_Page_064.tif
f356bb012275417477758ffd17c18325
7e26f51aa541725f7885bd84cb2fb1e10af62a1c
22942 F20101129_AAATNG castaneda_l_Page_030.QC.jpg
dbda14bfe946a5ed4733a11262cb61a0
e4e715a6e95b2adf81744e1c0107ab1c49ebe4ca
27702 F20101129_AAATMS castaneda_l_Page_051.jp2
298d4bb1488c768d3011e478fc2877d5
e35fcd3811d2e9b4196cc3d4ee169904cf8c5f3d
F20101129_AAATNH castaneda_l_Page_011.tif
d7727011df0c4d79d1a9aa9c62da4fae
ff4e209199c27f63d312e12089f499ac20de3f64
F20101129_AAATMT castaneda_l_Page_114.tif
3601bd717cc5a4eecbadf454c25532fb
7c35329405966b82ae4b21886af165911bd99eb1
104269 F20101129_AAATNI castaneda_l_Page_132.jpg
9c2bd9e10581557bb6e81678230aa2cf
e372e4f9400bb9d282106778858aba6a981dbccf
22463 F20101129_AAATMU castaneda_l_Page_113.jpg
e6d9c43cc52554994f17afb342a51d71
17f6d8464864e9b00e9575a887e9836ee60b735b
F20101129_AAATNJ castaneda_l_Page_023.tif
269666d7392334c492a86bb3315015b1
79d036484ac2a87bdc3ebedd944cdbc72c78cad3
62326 F20101129_AAATMV castaneda_l_Page_057.jpg
3050969b0357265db0e54879cfaf38d1
a1b6e331a450f57ac4c72d719d757f003985edbd
6695 F20101129_AAATNK castaneda_l_Page_074thm.jpg
8b5ebafa4daeb06d78d643fcd48bd064
e7990cd5901a2274a305e1f4af74c2669ae6e470
90690 F20101129_AAATMW castaneda_l_Page_103.jpg
7470f20d5ce5dd080be7d691cdb1ae99
b2ca103aab949119b0e2e94efd89560fa73667a9
7381 F20101129_AAATNL castaneda_l_Page_051.QC.jpg
5a3aed33fab7aebde99245ac241e5cf4
e869fff4fcf1a713c235140559671446b51c46ee
70322 F20101129_AAATMX castaneda_l_Page_094.jpg
06de7337fe6390fb0cde6dcfe32f3200
6d0bf3f5f67db24eac3449816d123d60f4570ad0
68597 F20101129_AAATOA castaneda_l_Page_082.jpg
74f3168f00d135fbbc4e028cc9820d6f
a6bd7d732c90d4c78eb58c5b28b840c93c36fecc
73665 F20101129_AAATNM castaneda_l_Page_048.jpg
6b4b41c4fcea555331038168b1b486ab
2e5743c2d2331c2887f7a0088ca8bcb04d1de2e9
4230 F20101129_AAATMY castaneda_l_Page_063thm.jpg
5420aac402375531edea92d9b5922ed7
b76783a49f1a02de28752a1719ad21f40dcf0440
1397 F20101129_AAATOB castaneda_l_Page_003thm.jpg
6fc36c806dec24e5124c314c335b17ba
54d25f3fcef30511a0aeae670f240a5fd283887d
F20101129_AAATNN castaneda_l_Page_084.tif
ad305871ccd6cad7a2202a7ba3505cfe
837405952ace825e930f144f613c8862416957c8
1051940 F20101129_AAATMZ castaneda_l_Page_092.jp2
dc185cd4a8a9ecf8db73e44aca00b2b4
7abebcd1ccf5fbedcea77f3ebbe18e23e9cafac5
84785 F20101129_AAATOC castaneda_l_Page_115.jp2
b80034b51e4d2817d380801fd3640b73
29327633f106369604cc29f5e30c591c2680c3ee
7498 F20101129_AAATNO castaneda_l_Page_132thm.jpg
eb925cd7c9138c7adc622bc9a10976cb
70cdf4e1f4a6b18d4b0c5108bd95c8bb889126d9
24128 F20101129_AAATOD castaneda_l_Page_025.jpg
db0f7710f68e9bac794f5ae109dc7aa7
a8918d12cfb7fa32e80908b214586cb10e5b6292
62628 F20101129_AAATNP castaneda_l_Page_014.jp2
7c87746a3e034264969c69325c3128dc
1231c76118875e22c6f218c78979071479b47a87
27862 F20101129_AAATOE castaneda_l_Page_101.jp2
c8bf010b3dcb1f2bca1c90985e100a7d
2e78291df7b31cb79d37984ac9dcf42dbc055e78
43656 F20101129_AAATOF castaneda_l_Page_056.jpg
ce63e491496fcfb93e4841f59d5775f5
ea10fa49359ecb71228758568ac4c9f200b4e828
510177 F20101129_AAATNQ castaneda_l_Page_053.jp2
e6f6fd380579b3dc719154e510405858
bb4c33be992a9d288bc5e86145df17cd6ff3efa0
115870 F20101129_AAATNR castaneda_l_Page_022.jp2
018f02f25288dc54e86039e5d0a5d43a
0d0f8c573f75b46940676ff8cd8beefd3f9c7374
F20101129_AAATOG castaneda_l_Page_029.tif
3ea51b2431cfd956aeb020c1be124332
69ebf00c796935bd73e23ebf0421cd230dd9ea28
109877 F20101129_AAATNS castaneda_l_Page_085.jp2
a28c93c868cd646e6d90ecf448665675
da919a1d45c664a0281b5cbb809e6b1dca5b5915
6908 F20101129_AAATOH castaneda_l_Page_024thm.jpg
2bcf24c6d411608a673eec678400a657
6d39d9477f26a68e6d65dc19d42aecec2912b725
16231 F20101129_AAATNT castaneda_l_Page_052.QC.jpg
934e7600d5c897d1d90864164a5a57ff
71b18a7b67fed6869310380ea7c63a835dcabb60
29963 F20101129_AAATOI castaneda_l_Page_130.QC.jpg
c54661d07ece71e0453c42d3cd03adac
9558596c85b3008b9d071a85a681b4a97df4c492
89359 F20101129_AAATNU castaneda_l_Page_127.jpg
f5101d51cbff105a9c6f49e291531345
fe5fecae239cabe0fd0f0e0db0bd7d0cf0ceae83
92981 F20101129_AAATOJ castaneda_l_Page_124.jpg
5ecb4657281183eb9154dacd7a15aafe
9fbeeaba54b5cc9ea2e7414b23dace0bc79316f2
F20101129_AAATNV castaneda_l_Page_119.tif
0ee2b7fd4bc1b221d24d520b5f4552ee
fbdd752087d2de70d0776388ed6a85eefed1cb31
24838 F20101129_AAATOK castaneda_l_Page_078.QC.jpg
6b301f10ec1d6e887b7f2f09b8e3ca8b
e2ad3b15dc71d3665f0da2e51818563caeeea4a9
29111 F20101129_AAATNW castaneda_l_Page_131.QC.jpg
dc70c2a54465c61b674cb63196f68ea2
c8316faf30dc1de43dd34bb20a9a87672657eaee
77498 F20101129_AAATPA castaneda_l_Page_023.jpg
b78b946ba5e21b2209b7fac9565eaefb
55b4b596ababbcf8abab2fbd30b786c96a588c1d
34689 F20101129_AAATOL castaneda_l_Page_096.jpg
648f3d312895e0fd04a4610101f8e861
28db16a31e1f655874551aac97e5013bcf9d4cbf
F20101129_AAATNX castaneda_l_Page_020.tif
7d2d9c459684b85c71f52641192cea51
9e2b7cdb450f9a5040eec660f9b95a3dd0326d8a
25051 F20101129_AAATPB castaneda_l_Page_109.QC.jpg
995b40c154585734bd48b4c92c4a3ed3
8daf7f8bd65714f93fb4e4f78e46681e32349372
F20101129_AAATOM castaneda_l_Page_132.tif
8bd618ce90bfa476fd5f68a2cef8cf1b
dc3805b99afb75c12ec15b4b715d1987e6bafbca
90396 F20101129_AAATNY castaneda_l_Page_008.jpg
f54a6d29ba584ba98ca6c423fabafcb4
c88f5cb687c98be2e6614ac7d9a49e282de09410
122939 F20101129_AAATPC castaneda_l_Page_126.jp2
e37b1a9677788127db3c62f816823df3
4af0c935fd5e64ab9e290540bfbc0ed92f2f46cf
5561 F20101129_AAATON castaneda_l_Page_100thm.jpg
f6bb712bfa50556264e939d9c6e50eec
555560df71f2db8fb6286b24905ec954ff2d75e1
F20101129_AAATNZ castaneda_l_Page_098.tif
a19dca87348e10029b03ac4215262978
57056bbcb36b5aac904dc18d12bcbfff04d7c2ff
112314 F20101129_AAATPD castaneda_l_Page_080.jp2
c2b0d3183001597a58aa33075fafdcb5
64295fe8c9793d4c8a1411eb2d2da505d62ef0cb
19370 F20101129_AAATOO castaneda_l_Page_035.QC.jpg
03a387a50f346005dcf2c4ba3f1e815b
18d6018d0302d2628480edcd8cee59621123f08d
100039 F20101129_AAATPE castaneda_l_Page_133.jpg
0cd89586e55b1bf831d729ad4d824586
eed491842fc87ab8f355304fefbce3d8ac3baaf1
F20101129_AAATOP castaneda_l_Page_052.tif
25c7a2a51b58fcce8cecb64d587658e4
274b464284f7ac895612263e9353c7b1b2d15880
25956 F20101129_AAATPF castaneda_l_Page_104.QC.jpg
585363add78d1c4df3b21951af98f2a6
2cfd1ac054fb8b14423f1fcb4b49d58d4ba6fe7a
101932 F20101129_AAATOQ castaneda_l_Page_076.jp2
c97df984edebe14721b17083f5a2040f
cafdeec6108fb338c46980b6a74c682847fd432a
88289 F20101129_AAATPG castaneda_l_Page_011.jpg
6ef8c47f1c3f7aed67a06b7a00a54626
3cf2a09f02354fa77f083b711141fe099f2fecf7
48291 F20101129_AAATOR castaneda_l_Page_090.jpg
d768e585d8e4610bf15e6433c11b6ec8
b8359b16fbb7457c89b050805363a699ec826ea8
F20101129_AAATOS castaneda_l_Page_078.tif
c7effc5dcfc438c250d6e14d42b3f02e
318998c9d264813faee292036efd7c8e1d023abd
31943 F20101129_AAATPH castaneda_l_Page_005.jp2
3c3344d6cee1a3b80bd6c7127486a3bd
0fb6446c5aaaa42db7b5598f0b3d0f178928cb59
62340 F20101129_AAATOT castaneda_l_Page_063.jp2
1843d3638ccdd430b6419e2a2e8b3d9d
f5417ed7ffd25094737f3c487adf0f0c871e285e
3811 F20101129_AAATPI castaneda_l_Page_093thm.jpg
0fea89717b16fc2c24f072c6c684331a
0e888648d7bc549d13988c46ff7906883ea86e0e
F20101129_AAATOU castaneda_l_Page_018.tif
c8918adc663b14e02b33448aeeee43ca
1805430a002345bfac49ab1806a45684ac388b69
89376 F20101129_AAATPJ castaneda_l_Page_004.jp2
c340268c42ac76f65b3fd1898a97c554
9c9cb647ffd88ba74fc9d3a31fff9c5c3cbd5808
59377 F20101129_AAATOV castaneda_l_Page_065.jpg
b9f3322e01484f29d0e821cf6d72b2d4
60fb6e7171f33189b55951917a2befd53195b059
57510 F20101129_AAATPK castaneda_l_Page_089.jpg
c614eb5c555f9a985e0161625727677e
0f3a5a93192f38442b2fa51de2016b11385acf56
6373 F20101129_AAATOW castaneda_l_Page_043thm.jpg
f0c4012505e35a6d728751bc178d2370
3289343e60ad5e94fe0c41fdc9e19d6fb544456d
24684 F20101129_AAATPL castaneda_l_Page_081.QC.jpg
76be45ec2d8d0f64edf126296cd89032
31abdb90159ba162a36de7516bcf5c886185bd8f
114772 F20101129_AAATOX castaneda_l_Page_110.jp2
7765e2e83479c81731ead04907f08020
f0b22a4567b2f43eb25b3d2e363e5bc1e73d8f9a
7379 F20101129_AAATQA castaneda_l_Page_119thm.jpg
87822829ca1b265bd238dd9d2d01f631
692ca208c14917eebe3fdd0340f3c5315875d29e
F20101129_AAATPM castaneda_l_Page_035.tif
f904c85c054b6da269ae0fbb13971a0b
8e61588670fb3298360b038799cae52dd8950527
76290 F20101129_AAATOY castaneda_l_Page_017.jpg
51833cccb369fec6427ef897053d6710
18ac60413cbcc6f51f04b8a7364cb176c04fea9e
848349 F20101129_AAATQB castaneda_l_Page_036.jp2
fb1a83bcdf8d9fc063fd6a2b1426268f
66a797a11ba4994fff94fd18c79e219c291a5126
67575 F20101129_AAATPN castaneda_l_Page_107.jpg
cdf559922d53086e098a7b041677ec24
5d9766090a7a9c37a603a0792cf890c8784d7aec
119427 F20101129_AAATOZ castaneda_l_Page_129.jp2
259bae1d5f6d6024b1b818a06cce7134
330387bf99928195295d4a7d028f322d0da7f357
6387 F20101129_AAATQC castaneda_l_Page_076thm.jpg
f2360ac703ad8e0e919800d95304f8d0
a325e3859e88c7dcafb6517deb060bd5023faddb
622984 F20101129_AAATPO castaneda_l_Page_054.jp2
56d46e880b7445d45228f50728272e1b
8da8a6809d2dd5cc1a3ced571ca01520b5105ca2
109559 F20101129_AAATQD castaneda_l_Page_111.jp2
6c12b8a06809dbd269c28062941c422a
5b5cf259fe50c84d379be202d683bdae63c91926
117765 F20101129_AAATPP castaneda_l_Page_103.jp2
b7b047754955a43afd0a1eeaedd0112a
f4d2385aeb4204389d99bfc50d9dc0d3203137f5
27867 F20101129_AAATQE castaneda_l_Page_122.QC.jpg
75f01220c77f24268368b9c47866a777
b94cf2255074cf76cb719b76a4fda2336331e2d5
F20101129_AAATPQ castaneda_l_Page_054.tif
ecd97f88c5765b39e6594ce0c55e9cba
07ae775042013086d3d162606f9b66087dbd9868
104637 F20101129_AAATQF castaneda_l_Page_031.jp2
ca641ecb6c8400cc3b4a3bed705647d9
7b2a5696d56840855b4e2a0bea62be2385908e0e
7567 F20101129_AAATPR castaneda_l_Page_001.QC.jpg
a662ddbca79981fcbd17550af80b2df0
8d44f4b1c4eb3edba262878c7f58a3b5dd4687e8
1051980 F20101129_AAATQG castaneda_l_Page_010.jp2
9ca0e590dbdfb1256ac7b2873463c26e
25e6943618a42d436092fa07d060b4e1e6c3faa5
F20101129_AAATPS castaneda_l_Page_133.tif
7aa1eae131781ab131a0aaad12e92d8d
656fa24e5f21dd5b2e3d44a2c8875c8daa3e5446
F20101129_AAATQH castaneda_l_Page_075.tif
c7276f1ed8a4e8a16e2442fa4c2009d0
2bbad9a94167d21855ce89e6363ad67663a58459
68373 F20101129_AAATPT castaneda_l_Page_044.jpg
81ef841caae9a791ae1283510055471a
bc73b6410de526b8a467d2cfb943d336a8bf1053
17148 F20101129_AAATPU castaneda_l_Page_065.QC.jpg
e7951a2f96f167a187cef1a2a22989a5
9f01524af5832e0ab0636e1e69aababd5292d8f9
25480 F20101129_AAATQI castaneda_l_Page_126.QC.jpg
a07152059b834e8b6870f1776c49b26c
45f7963eef87e1d846ee0ccc773d202039e0ceb4
101532 F20101129_AAATPV castaneda_l_Page_061.jp2
0238886e3f64fe296321bc70d394c778
106270f79fc19e3f4e2a2ce6d4e20cd0751e6a0b
1051981 F20101129_AAATQJ castaneda_l_Page_006.jp2
d303e62b2d174ce94583ff23d8c0d137
411d2ec61fccd2a63925f5abba5c08908db3a30a
1051897 F20101129_AAATPW castaneda_l_Page_091.jp2
7b378530f81c8fa344534be3dcc39e5a
026b2a1b9afce27a922acf59030c31d39ec80029
6766 F20101129_AAATQK castaneda_l_Page_059thm.jpg
58c85765abcfc79c05a3fbc8633a765a
070067061666051b1c02f05eddd4a0eed73052d1
27641 F20101129_AAATPX castaneda_l_Page_134.QC.jpg
c095ad657b5389af01ceb40fd8cc4672
be310d1f53330e09449730ee31fdd8c42c05c22d
6656 F20101129_AAATRA castaneda_l_Page_032thm.jpg
4a7e60af1850545e05766fbe0d714243
d5de0b7462f773d8c90ab0d0829a40e7a3a97de4
6969 F20101129_AAATQL castaneda_l_Page_110thm.jpg
3791fb3aa31f4626406e0f471bda1667
c9bae151805c361ec9531152dba6055c6b73d0bc
112675 F20101129_AAATPY castaneda_l_Page_016.jp2
e988f172676ae7023572ef7b0f5b374a
38f8c70ec3953fc7c65d722b4af41dce233edcd4
5076 F20101129_AAATRB castaneda_l_Page_097thm.jpg
02d9af72595448d68bf745f2c67bd757
f0a0a0484cfab56e2633e71770fe8cceea41919a
74113 F20101129_AAATQM castaneda_l_Page_018.jpg
80c68b36fcc77639c590bad759e7a422
70c0eeb1993cc999aff087ef8370f137da6196af
28546 F20101129_AAATPZ castaneda_l_Page_110.QC.jpg
886e04bfab7523d6f93218da91c430eb
c7fe3814a73da8cfc47ba8fd245feaa05fd0e649
F20101129_AAATRC castaneda_l_Page_016.tif
fae0bc8ed36914ea6272070e03c0c6e6
a6b69fe2e10d42f0ab2f88dbb42aaab94c3187a2
22757 F20101129_AAATQN castaneda_l_Page_045.QC.jpg
127b7b4af78500122844064747b9c083
978662c8a826f9f748d42fc46bc91431de2500f0
101497 F20101129_AAATRD castaneda_l_Page_007.jpg
fd6ce44d73f526a935337eb70bba54d5
9ec4abbe1e7304f76e648dab3501cbfd7174e63c
21727 F20101129_AAATQO castaneda_l_Page_026.QC.jpg
4866c7e32afa630bdea709927d8ea5a4
d5673fa0422e974b75329bfa3a336db5c719323c
F20101129_AAATRE castaneda_l_Page_032.tif
253d693db90809261a9bc384aff3b80e
10e43050c49726cd7328c7f399245241b12621d1
105931 F20101129_AAATQP castaneda_l_Page_083.jp2
1a79b0f1df12e9d6ef9a4f2a4784d673
07851438b886553a5f98839c0b576a7f85e60a2b
F20101129_AAATRF castaneda_l_Page_095.tif
69d0693021ee1a123e69fb140c26534e
87813505fbf7c630eb88d470c2626712b8576ccb
15657 F20101129_AAATQQ castaneda_l_Page_038.QC.jpg
cec54201b5e0691eaa231c484ffe7b4f
ed7c5bd0def60d66a21c29c59d7b5f7dce70b410
67074 F20101129_AAATRG castaneda_l_Page_039.jpg
b688c30278900d2accdede0c8887d643
77e888ae5c9bfddca0806dba0ed5216aa4088108
6764 F20101129_AAATQR castaneda_l_Page_058thm.jpg
94102811a019c6d81b92e6ac44781ea9
a7a9e88ebcbc49d051812854f01d17c6f2289e01
F20101129_AAATRH castaneda_l_Page_079.tif
bbce2570866c0573af99a0269b19ed9e
fa2b57a36287b2fe9bba04cc0879ccfa003a2897
50820 F20101129_AAATQS castaneda_l_Page_038.jpg
8e0ecb76a86fee66f0376283841c71c0
e0d4b6ab88e3ec0ff9c01ac31bd084e086906e31
3963 F20101129_AAATRI castaneda_l_Page_054thm.jpg
ad2fc47660aba2207f83f3c151055cdf
beb02dfc6500c54f1ffaf8c0e919e0aa51dc5634
F20101129_AAATQT castaneda_l_Page_069.tif
16d5bb5f866754fca3cae0d582058a78
a6f2f6788da892625dbebce53ac7ec1dddb6c34e
32219 F20101129_AAATQU castaneda_l_Page_055.jpg
2182eb2343107f4887aa9b7185ccf42e
dc5bc241284b9ad220d14dfee644067696ec60c8
F20101129_AAATRJ castaneda_l_Page_070thm.jpg
a5376520e7b919611f2639761c7816b4
b5c049d55b24da319b99bd95789a08f616dee729
8884 F20101129_AAATQV castaneda_l_Page_005.QC.jpg
fe62fa453e86ae7aded68823876c8c74
6adfdaa25c8ceeb59e456ec2d4eb429e94c7e401
F20101129_AAATRK castaneda_l_Page_127.tif
09b656a68e22d1f8e7367d12466fdcd4
a4d494e5ec16b54cd0429d51d6b9d5a2a56769eb
F20101129_AAATQW castaneda_l_Page_130.tif
af8efcf994f121ca9d0d39d6158c9cd4
91d18e3901bef600217966be73f6a997e3b30d59
24633 F20101129_AAATSA castaneda_l_Page_022.QC.jpg
308efb6d3ff4553f16c82a7449cad683
36d8d9719edb5a811b9c3a8ca27801c3859b8576
23215 F20101129_AAATRL castaneda_l_Page_034.QC.jpg
18aa56d6dd6445da78043ccb80fabe36
a799a8fc766d360fdf0032a94a0119dbfab2e1e4
F20101129_AAATQX castaneda_l_Page_089.tif
a2f7b048ab8410c6df3662189f36378b
1864ed86811f4c8af24b3b07e2c45bc0b0f86264
85347 F20101129_AAATSB castaneda_l_Page_013.jp2
915a574008985347d770d70410642967
62109ab5029fe55dd094fc92bc103cacefaf8617
5200 F20101129_AAATRM castaneda_l_Page_088thm.jpg
e4894bab3611fc2deecabf3050e1aedd
637cb9f9fc2619222ce7a2f29155838e731cf910
28879 F20101129_AAATQY castaneda_l_Page_132.QC.jpg
0bff4f8bef97310c917a150d09cb9b75
642b63322dda25d34e324bfa4de3f6f1f26fcf31
4396 F20101129_AAATSC castaneda_l_Page_040thm.jpg
903d86c447a7eec42a3433af78e29aff
69ad58d3376feac60a53e0ccd4149a0a235b1cb0
7737 F20101129_AAATRN castaneda_l_Page_101.QC.jpg
6d6f58bbb95e2820320181cb22f25f46
0e60a3d319cdebe3db7f4cc1c7f0833446f72dee
7040 F20101129_AAATQZ castaneda_l_Page_123thm.jpg
63bbe225342a9c0971d5bc38bd700235
83fe4334814690e8b771c2b003c5bae05c4a652d
14457 F20101129_AAATSD castaneda_l_Page_063.QC.jpg
1746940b76c9b0e1351613b078fc8ab9
e243a82e7b4b5412c8693a6b419749149c760070
6490 F20101129_AAATRO castaneda_l_Page_107thm.jpg
51dd88373c9ea2268d663f8b342b7155
e9157581b61e391522f7ac06aac7636abe20f6ec
145665 F20101129_AAATSE castaneda_l_Page_118.jp2
e6e19f184ea93556a182f3cd18bc366f
637718d2af99539d15690fdb4de1cecb7b6c8707
3248 F20101129_AAATRP castaneda_l_Page_009thm.jpg
8ab7968cf668fcbb5dc7d0c27fca1807
f5e18ced2b1c2ddc339842b575b770deae030c1c
11841 F20101129_AAATSF castaneda_l_Page_054.QC.jpg
1b46d0c16dc36dee1ac5b3382c1590fc
a5a45e1c9bdaba0923e0068542cba0a582f0d0ba
5219 F20101129_AAATRQ castaneda_l_Page_013thm.jpg
0efd0f3c7db042ed4aecaeed6b42f2e5
e853ba88a93c919d4d0c676a26bba7dd3f947dc4
340054 F20101129_AAATSG castaneda_l_Page_066.jp2
9fc8932749f04d25f6350c6333d3966e
6652396a15e25f70a23eab0b2088e3c9d800055e
43525 F20101129_AAATRR castaneda_l_Page_063.jpg
9315385e8588f03190b31cbd2770e3f6
4c15cfa34f466af11bc80dbea1646ddd4616b773
70261 F20101129_AAATSH castaneda_l_Page_083.jpg
bb8f98bb9e912e042b269206435a896c
03cd441d7e7fc511d87bcc17656a44de83412cea
F20101129_AAATRS castaneda_l_Page_049.tif
279894638dcea0bbcf3872da94135d99
ffbd3be94b5dab8a883e3744c4f9e314557287ff
102683 F20101129_AAATSI castaneda_l_Page_134.jpg
80eb50f6ed4938a503c16ad93c2ba2f5
4fc841c8be6f35fb2db911a628cc37b037bdec26
26956 F20101129_AAATRT castaneda_l_Page_127.QC.jpg
5003de2104e504245968e25e7eb3fd96
9a4821c87eb16674a7143b522879b2aea567a4cc
22765 F20101129_AAATSJ castaneda_l_Page_102.QC.jpg
f2476973e710e3efdc3ac349f75ab98b
a44f2393ee3900f1730c91be0c6350e7f8433357
24155 F20101129_AAATRU castaneda_l_Page_075.QC.jpg
a6ddfbc6922e4e478c2022194e32ddc9
c28a79bc2e94b65b5b78b8b82b8392382eeed577
22214 F20101129_AAATRV castaneda_l_Page_044.QC.jpg
80d100917a1541d4636e94199c707272
b8cab5b173b7e70dfd842105e9b60095b8fa86c5
5171 F20101129_AAATSK castaneda_l_Page_065thm.jpg
f0decd8d9e48123d950d56e8dc237cae
f8907f661b986b4e2d7e7b650cbd73a42fdf31de
6530 F20101129_AAATRW castaneda_l_Page_031thm.jpg
dcea872180fe3ce837115ea4b80d6b6d
7a6fb3a48973296c2438093eed1a7fa8d9032928
F20101129_AAATSL castaneda_l_Page_076.tif
15a83078eb3786ab8fd64b2d11a6e8de
ff11950e123ac0bca4156fb0b1bfc70c9827de5e
90341 F20101129_AAATRX castaneda_l_Page_120.jpg
4ae8644202223d4da42b9902adb883c4
64ed6e0e2eced0cbf9e8ff6662c334ecc0b9a1be
F20101129_AAATTA castaneda_l_Page_006.tif
17899554bcd80be0a2a61a9249666ceb
489c1196a989c00391023b3a020a516820bb6047
6205 F20101129_AAATSM castaneda_l_Page_015thm.jpg
76b2136e7cff749b6217b490074edf1b
904e8857774a68987dc02a3f3006583d814c7e68
21032 F20101129_AAATRY castaneda_l_Page_057.QC.jpg
54546345dc3ca4b664bbc5362f5d498e
79d8605833216395df5ddee49e4219906d7bd12d
F20101129_AAATTB castaneda_l_Page_080.tif
8d5106651eb779bccf525af98dd5824e
4f81b70de7ba2ddf1d78fc6c2c178439d23d32a1
F20101129_AAATRZ castaneda_l_Page_062.tif
ef2c933e477efdd68af9d38882d6a08a
6f9ca5bae89bfa80474f7fb869cd4e7afece1fe7
153727 F20101129_AAATTC castaneda_l_Page_130.jp2
e22a224d8af81e53178aca02900d39fd
3dfb86c9a67083035c59d158bcda4618d0d23d05
14423 F20101129_AAATSN castaneda_l_Page_014.QC.jpg
a5894f9ca51e7f8b3d7fe388e044b943
6f4508c429c076023c3fd3af4cd19ad28a803815
1786 F20101129_AAATTD castaneda_l_Page_012thm.jpg
41897d93efedb70aca1425e3f41a03e3
238c1e22d5ac078062607f73a7224adf4346793a
226670 F20101129_AAATSO castaneda_l_Page_012.jp2
c15e73680480627b33f0e212505c94c6
373fe92656c2a423cbe97c49c92097d94c14adcf
6913 F20101129_AAATTE castaneda_l_Page_111thm.jpg
c5b71b4e8ee035028119c9367f17b673
a9f9346c9b9f4a26e55df77867a31c2f9b7fd609
89671 F20101129_AAATSP castaneda_l_Page_128.jpg
1a2503e55b97602c01e0fbe1c5a7640a
2b5d01e47222bdcf9452f2e78d2d3e8bc7172867
F20101129_AAATTF castaneda_l_Page_026.tif
9184ddb84d9b4d575cf800a66ad34425
993ae4327ee2b41e8fe9a7e78df7946f4a94c141
405177 F20101129_AAATSQ castaneda_l_Page_096.jp2
d887ec26dd3ceebc8a11c344ce869c96
9243b967acb617f71b44bd660b03e1789429fd70
32729 F20101129_AAATTG castaneda_l_Page_135.jpg
a58444313894d5004534b43970b05343
ad4a92744ec5a91a10f80306ca4dcfb30cbf3ae1
25238 F20101129_AAATSR castaneda_l_Page_005.jpg
edd148018368f59628db7063e0ac0ca5
b22d340d36e956a9e9c0727657d636fbcb137ea3
107546 F20101129_AAATTH castaneda_l_Page_104.jp2
5e636e3fe9ffa77ceecbac16076909f2
50c4882b38a8f84986993e96f2f04e1652a4d85e
75311 F20101129_AAATSS castaneda_l_Page_020.jpg
509e76d8905bcea64cd5644346bb05dc
95f0796819d744cd51a24f1d8c815cf6f973fbb6
101373 F20101129_AAATTI UFE0011348_00001.mets FULL
0bb0bb5bc11f8e7b8042bc2ebfcb0a75
cbdd57df975bd37b775cb742c1d1a9d3b62f6a70
92999 F20101129_AAATST castaneda_l_Page_125.jpg
c0d4612484c87401ae51c6567c36248b
3607760447051114a1ee26cdf73ef6a8ad28938a
F20101129_AAATSU castaneda_l_Page_037.tif
4410ca639bcccabe78e4fedfbbb0b926
ded1f35568a7c53f46701890c9e5f5d9f7d05a6c
825934 F20101129_AAATSV castaneda_l_Page_037.jp2
15b199fcc0b35029a63b26868f3417cd
0c9b63b2b1a14b41041c2f9d696bc9e5e6708f94
16904 F20101129_AAATSW castaneda_l_Page_036.QC.jpg
d6e1505a910023ab3ed574bcb0a1169d
6f5905d9e9d9345f69e26a131ae240bb4cac7306
68250 F20101129_AAATUA castaneda_l_Page_043.jpg
8528ff05eb15b88c4639db87f8f7ed03
943227238e15ed29fd7c25eca8d5a1e4d8dab29a
76268 F20101129_AAATTL castaneda_l_Page_006.jpg
d10d2ffd73a0f48b20c96240a60f9a36
56dedac73dc986018d2200d59ce89cb0758552e3
F20101129_AAATSX castaneda_l_Page_093.tif
ccf0146dfb2d5dee4f97c0d7ed9b76d6
af6c5db5df2e985e0b9c94b8feb68e2c8eefdb4a
68668 F20101129_AAATUB castaneda_l_Page_045.jpg
3b4ae83037bb62144f1c4ba3bcc0e046
bbf2fd17c946b982d5f733a1e105f17aeb45a212
35888 F20101129_AAATTM castaneda_l_Page_009.jpg
8ed2e06e5379f6a1e9a4c727dac00bb7
7b92ff2a05c1f9003bba7cc06cac4182cf5ea6c4
6940 F20101129_AAATSY castaneda_l_Page_017thm.jpg
59ffadd8514d93961947e9aa997e4c43
e838298a2d492677de8b34c78bc10435634d14d8
72941 F20101129_AAATUC castaneda_l_Page_046.jpg
718ffeaecf6300dacdf04e24bad11c1e
c1526534e9827448c012304189aa684768b68cb8
14520 F20101129_AAATTN castaneda_l_Page_012.jpg
546f2dbcbc1b4609d4fe6a618b01186f
9a26a4e6ef0edecc0c8090bb012d41bda8ad8d2e
7075 F20101129_AAATSZ castaneda_l_Page_023thm.jpg
a73407e9df72e764c956a8ae930dabfb
0f5d7d256a6bac53eeade5f22731a588a4c2c5be
70083 F20101129_AAATUD castaneda_l_Page_047.jpg
a09fe4b3b6214059c93e192b529b69c7
04e8982a11ed9d79a2615795f3b33f064a6948f9
43287 F20101129_AAATTO castaneda_l_Page_014.jpg
88936657b93a2eabf036f4416bded904
0225e8c04a58894972265fd0a46c045aaa9a24bb
69623 F20101129_AAATUE castaneda_l_Page_049.jpg
06b7bb97868b59938ab867e2c1b63059
3c90bc7aa403baaa3da6eaa69b2c7c4eafbdcfe2
74046 F20101129_AAATTP castaneda_l_Page_024.jpg
6cc19cd719318fd0d3c936c82487ecc1
7b69e503d54de9d2e01aee24e006467c53d0395f
72270 F20101129_AAATUF castaneda_l_Page_058.jpg
560c16ab104c1e13d3c45c774cc46926
82d2445f53e60dd0900c861549b751a9a52a0ec9
72860 F20101129_AAATTQ castaneda_l_Page_028.jpg
795af3cb9e2468b6f54d34d8fe7c8479
55ecd509f70ee5ab8ca4f439fc0a436b005615bd
74975 F20101129_AAATUG castaneda_l_Page_059.jpg
cbae532bfbd9e3494885bfdda584e244
9cd4c63845af588ee2992c920724723831de8005
69643 F20101129_AAATTR castaneda_l_Page_030.jpg
a244a99dc39709c94daa79e7cb829f0c
c1fddea231f4bee1716b02102b687afae70e75f4
F20101129_AAAUAA castaneda_l_Page_105.tif
78146ec17e53967617fc2bba36fd8308
d7d181328635012c421e218790bf8bdddd93b98e
70535 F20101129_AAATUH castaneda_l_Page_060.jpg
4fb4df79429dcbfa346f3f5d3b9cdef2
b2e7dcd83c10040c292e9c781d7f84ea9830458a
74147 F20101129_AAATTS castaneda_l_Page_033.jpg
bd9f23c8413d38510795f188f066316b
065b17bf6cc275a49e9bb773a4efbcfca54108af
F20101129_AAAUAB castaneda_l_Page_108.tif
bf169c7fa71c54ad1a76dada72d7fafb
26cae50eda140fd54a1c7313263332c2a33095ea
67270 F20101129_AAATUI castaneda_l_Page_061.jpg
dd596df4f963f963bb66310596126dc1
761662a86bff515cc16024754922b533fc3fc085
71199 F20101129_AAATTT castaneda_l_Page_034.jpg
0407d9c61310f14fa356e0a14ca4dbd3
b72cbfb9c3c28e8b44fcb56e5ecd568de21cb6e0
F20101129_AAAUAC castaneda_l_Page_109.tif
e3de38fb3f0a3ad68b7ccc80e86e952c
cfb08ca3f52f03c34cf09febabf18fcaf088e7e9
72917 F20101129_AAATUJ castaneda_l_Page_062.jpg
7c8ca859df81542a08e824e586c237ee
72da19276cb77db1cf0f496af32d82462783530b
58816 F20101129_AAATTU castaneda_l_Page_035.jpg
82cc59c0001c153a53fb8ab085f3cfca
47d256da997e389f9de048894ff4510b95632f0f
F20101129_AAAUAD castaneda_l_Page_111.tif
07da1d44aca8f98ac01844c7b3fe10ce
cd58a46afe1a4f2948a2033e97cc36039af5d73a
69983 F20101129_AAATUK castaneda_l_Page_069.jpg
30d33a83105603667178c82286588bff
1a0e2a461b7b3ba324dee02a3700862fe57f6fbe
63034 F20101129_AAATTV castaneda_l_Page_036.jpg
70ac084457b7e8f2e834a8717178c1da
62f43ae9e5b4870bd301c1bd088d43f38ea5218a
F20101129_AAAUAE castaneda_l_Page_112.tif
f1efc9794acced3f80c33386f8ad7308
3e8b4a6d37d4385de68280c1e7df1fc4c996762f
74369 F20101129_AAATUL castaneda_l_Page_071.jpg
43585bd6f7bece44a97509e4023e1afe
f433657bb53c47210b0a5ce9ec643a0de8e3fce8
50142 F20101129_AAATTW castaneda_l_Page_037.jpg
7af3926f7bdab4bca457f722b4ac2aaf
fec0a640df3bb5f020dca8ff1c973d3e04103ff5
F20101129_AAAUAF castaneda_l_Page_113.tif
0b5133842078a218480d72628440ae68
b5216a69e20f9d00e3c02c531588787c53f6e474
53348 F20101129_AAATTX castaneda_l_Page_040.jpg
4f58ccd00aba712e907225ae37a05d43
f701114e6ad3b34982403bffcfc8ca2542e4b8b7
F20101129_AAAUAG castaneda_l_Page_115.tif
1162f8334f8dc86e69db9363bf72f47d
4aeb70b1e6184440bd46d7682f994ad6794bec2b
58579 F20101129_AAATVA castaneda_l_Page_099.jpg
408915af1247397f11f2671d59865c9f
f717fa683e2423456bd7412f489f89d3d4ef838e
74460 F20101129_AAATUM castaneda_l_Page_072.jpg
eaedef45f95ba8a49cad37ee9a1d3c81
bd4d49d445ab7e06a96e56f3805036f53890eabd
28526 F20101129_AAATTY castaneda_l_Page_041.jpg
230bc265982ae5fe4f2137f0060fbaf5
999611e77535fa8245cc8d6f862679ed4f02a3f2
F20101129_AAAUAH castaneda_l_Page_116.tif
4edc70735f66ee0db5af2d7cd8d6dd77
0bd4a8d73c65323f70eb18a70f2ac32dc2078fee
22878 F20101129_AAATVB castaneda_l_Page_101.jpg
bf148e2aa7f2e3ae5b01ffde7f269c4e
7dce0eb8c10334fb04f4c381c5def9016092cb3e
65570 F20101129_AAATUN castaneda_l_Page_073.jpg
75b143a8e2664c6f7b61fe6632b277a7
b007c88c54c385eec53a41388ec5049724502cfe
65644 F20101129_AAATTZ castaneda_l_Page_042.jpg
b087c96fc92bf4405130ac3cfb353019
52f86fdcccd3d335374eaff5bbc4ba2f3cde8ca9
F20101129_AAAUAI castaneda_l_Page_118.tif
056e675751fa44df11309a7373ef477e
20966f8ae7c4ce81156436f499d624f6cfad3ac4
75273 F20101129_AAATVC castaneda_l_Page_102.jpg
dea86abd8c073d6bd7a0f1c8f96356c0
820c4752bf90d4d07c1e36f605cc8c162bc071f4
71952 F20101129_AAATUO castaneda_l_Page_074.jpg
cc85e04eab58a557d4eb08a1a49696e0
d97c7c4c59efd5b89aaa9e39e237b4344260e3a5
F20101129_AAAUAJ castaneda_l_Page_120.tif
fb9b6f054fa9862946221e01d8e9187e
407a2a9f9d59f3c14a85bf3c5ca367930c47b88c
84929 F20101129_AAATVD castaneda_l_Page_104.jpg
17246ef9d0c95a8e295695c0e3b8ac2e
7c0ce09c29ac9994b1da9e8f0b8a097ee231b465
67447 F20101129_AAATUP castaneda_l_Page_076.jpg
6e8316e20f5afbd3ec75c27cfe6aaffa
3874d6407a06ef610193991c86c745366460d4c5
F20101129_AAAUAK castaneda_l_Page_122.tif
f4049301d95f163b1131abf9e6ba97d1
e7eb0084c03f8a0e8cd19b2c89232875b0fc4660
91810 F20101129_AAATVE castaneda_l_Page_105.jpg
8100c3688580c49abe2317d42a0c0a5e
3dcfdd10c510f9b3d6d20484efa3efc144bbb23b
75348 F20101129_AAATUQ castaneda_l_Page_077.jpg
ff3c16d3e9cf4a16eac2c98b8f107a71
f3b2d0020fb7e9555f76fa18d5c4ef949dc16393
F20101129_AAAUAL castaneda_l_Page_123.tif
84dda8f9dcb42ed7c0f836a5db37a656
3b14ba51535ab9a8ab25a147043e9ba23e33e74a
18905 F20101129_AAATVF castaneda_l_Page_108.jpg
dacbaf729e753b709d36f1568d7c24f1
5affa071c2822961032fc7576cfd018dcd393bc8
74549 F20101129_AAATUR castaneda_l_Page_078.jpg
34d632c67f235c07c3efbdde2b85b1ea
a4a2a0692bf62b9bdf23b52e5947141009ca9ca6
23828 F20101129_AAAUBA castaneda_l_Page_024.QC.jpg
4ff9a7efc29506ac163612e29a1f36f4
b301bdbd015531080adf299a0d0cd723187aaaeb
F20101129_AAAUAM castaneda_l_Page_126.tif
11e8fffb348f777a30ed39f6b7d55713
bd1725f27b572ec880959acdd134d642d776c38c
86412 F20101129_AAATVG castaneda_l_Page_109.jpg
566a3ab23287b8281af5eb3fc49505d1
296b01fc206b7d71c4c4e3b721f626da9c295bb0
72880 F20101129_AAATUS castaneda_l_Page_081.jpg
a40475bc0545a9435fb9df506ab437e7
e754d4c7103e11e25ce1f31daba06b6d0fef15a2
22738 F20101129_AAAUBB castaneda_l_Page_043.QC.jpg
b4528b5a2b5002f812b7fd1aaca67c8d
f9f25cc3fb25ff615e59c6809d13d930684dff11
F20101129_AAAUAN castaneda_l_Page_129.tif
e11f26b534e1fc8218c9654fce5f5e3c
1ac181aed9af12b6ecc54ad5d05aef9f98420c23
14712 F20101129_AAATVH castaneda_l_Page_116.jpg
bf2aaf9d3fb83ac8ed805474be1e938b
94f6b277baf2c7f80c6b6ee8c5871f4ade3b5e8a
75317 F20101129_AAATUT castaneda_l_Page_084.jpg
f83ab86d603972b5369f02248e253bf2
81982a15a681307b25ae046d815086105c822429
24759 F20101129_AAAUBC castaneda_l_Page_072.QC.jpg
5b83e12e65e258b54b729f7abc7a4e83
98f5c3fdbf58b54585c92d0f9591a8c119ec77dd
F20101129_AAAUAO castaneda_l_Page_135.tif
fab84bf4611b90c9ebbb16a9ec43d494
8421fa107448380b0ba08096252c43e39b89b326
79232 F20101129_AAATVI castaneda_l_Page_117.jpg
316a5558fa66e6f9a1db1ad550271bfb
00bd1c6cdaf79d8940d21e6b6a9206081b21b785
71358 F20101129_AAATUU castaneda_l_Page_086.jpg
e603fa755f573769850a3774769592f2
54e9d8ae6948bd9f320d1bd3ede6881be12d0777
24122 F20101129_AAAUBD castaneda_l_Page_058.QC.jpg
057ab8640fa1ffbb7af6c3a7223165ed
b4d4a664a295d04c23a92e1d317c96f2b1519a0b
2528 F20101129_AAAUAP castaneda_l_Page_001thm.jpg
c9d955d5b82693b3d00adb9b89061f51
94aba4f41e5aac77100d26813f303317b39df61e
96796 F20101129_AAATVJ castaneda_l_Page_118.jpg
9e4b2246018cb3cc7c79f139dca32092
f551c39099e291587022616bfa8b2b9b8139efa1
72133 F20101129_AAATUV castaneda_l_Page_087.jpg
2c47cd435291d38c8430bde7f95a1223
ec48282b5dd0956542f6db5ea919c4eb87491d36
6941 F20101129_AAAUBE castaneda_l_Page_020thm.jpg
afefca35aa85f1658d06a0aa2225aeb6
b1a2994b339b80ceea56decf29420e2935e49086
6025 F20101129_AAAUAQ castaneda_l_Page_094thm.jpg
2f62acdc64d50d3775f3b98322b5bd54
3d2aeb78a4752c39de86ea1999fabe9e5c1efbf6
103370 F20101129_AAATVK castaneda_l_Page_119.jpg
0ae231d9fad4128780a0cc3d24707db6
010940f22f92f6f703c5f36852ba5665b8110317
90079 F20101129_AAATUW castaneda_l_Page_091.jpg
1c3ab4bc099d8d16c24e48e3b3692c4c
b35b3502f3618ac052e6658aaf705241901275bf
9896 F20101129_AAAUBF castaneda_l_Page_055.QC.jpg
ff08a04de4b0e9f1900842932ce5cb09
e48f6517c2febf7cd1506328f03aeb82df202fa2
26356 F20101129_AAAUAR castaneda_l_Page_124.QC.jpg
458e7a6fc12ea9692e4a20cf71f770ed
7b53c7f5feb3c95bdb275a99eceed721d46ad2ed
97167 F20101129_AAATVL castaneda_l_Page_121.jpg
e3c52c67c1c7cad6e26728e05cc2c9be
6cdc39f3e6258b8e9eeb4b05577a2a50d0e3420e
41282 F20101129_AAATUX castaneda_l_Page_093.jpg
4ca9d9581f49db5dfa8eed31f1a9de8f
3d3895363a5f2abe1c8eeaa142fcbe9d0a25063c
6467 F20101129_AAAUBG castaneda_l_Page_027thm.jpg
976b865b6ce0c73bece2f9299a380ae3
5655d2cf5c06c6e12e44cf32192502dadecc3334
102098 F20101129_AAATWA castaneda_l_Page_027.jp2
0f7b1fe7df9713da169ffbf5faa55511
c00cde0471aa697776b43a3644ba1adfbb681611
24031 F20101129_AAAUAS castaneda_l_Page_029.QC.jpg
bbadc5d01065c335d128f171445b5639
b117b49f39b3e498f0819ca217b9c266fa478c90
101151 F20101129_AAATVM castaneda_l_Page_122.jpg
8b35c1ed350cd890ab09a2e283b6c29b
1607caa9c54fcf9ac3f30402c6d1b31d1a8b6a36
45333 F20101129_AAATUY castaneda_l_Page_095.jpg
f6b6531db264640d85e40998439b7aa2
cf782e2497dcbcd4caf36141303692840dcb92b3
27521 F20101129_AAAUBH castaneda_l_Page_118.QC.jpg
a9783c2473070ee6c0d891df45ab3ba9
458f73957fae77a6f9aaa9b00151972d5f47be2b
107904 F20101129_AAATWB castaneda_l_Page_028.jp2
ace78afb00831c6643123850f21b04bb
0c29fedc48232fe81f9326d29cc97fd8e8481fef
4821 F20101129_AAAUAT castaneda_l_Page_089thm.jpg
0ac0db95e4f99f5860784bb15c2cb9aa
d698a5ceb58a5c98a0b8cea078786e29845227f4
52790 F20101129_AAATUZ castaneda_l_Page_097.jpg
7aed2fa0417a1d0c66fed7160bf17a6e
ae6820a977abc8ec795904cc5b462d382e5b454e
12426 F20101129_AAAUBI castaneda_l_Page_056.QC.jpg
eb5fcd29f77b7568ecc73e1fe6163cff
86ed212579458feeac4b566cd49f6da1a08e14c7
107120 F20101129_AAATWC castaneda_l_Page_029.jp2
7333d4bc1245bd24f56ad5b66c93bb61
ebb3f670c01c780f5ef3d47d9160f4b8cfec58bd
27275 F20101129_AAAUAU castaneda_l_Page_105.QC.jpg
da9e68dd63be33c24909542a89084f92
987c0df806bfcee3040034bfeb4a1479dce28b03
107903 F20101129_AAATVN castaneda_l_Page_130.jpg
b8abb82ab4a4ad63176e018d79b50f19
304fb4d82bba991ce91ca87a0f56549217e6dd29
6163 F20101129_AAAUBJ castaneda_l_Page_026thm.jpg
a9e8aedd79445e6b527b88d06f0083f7
a23de4d28f1e71fa84ebd23b75512967ac8ac314
103936 F20101129_AAATWD castaneda_l_Page_030.jp2
8ac299d0fd05b4ba8ce1fba737886a5f
a9a540a9dc232513d464e862be36f51c32fc5ea8
23005 F20101129_AAAUAV castaneda_l_Page_117.QC.jpg
bff2ce71a86ff4378e592de3ac0b87ac
0562595a016b668ecee92f5e8916c6c818bbb2ae
102476 F20101129_AAATVO castaneda_l_Page_131.jpg
02178e65635de32b196bdd339bdf5151
7b2b67eea9fc24c47b60d34ea7160dcd95e6a406
23607 F20101129_AAAUBK castaneda_l_Page_062.QC.jpg
83a104536fde173b6bc04e6f13405750
83922f84109f791a15ba9b63b8d905f23f5801db
112008 F20101129_AAATWE castaneda_l_Page_033.jp2
13c8cc72b3814d10c0760df4dd17ff7d
2a28f809c1c726d44f377fec4af0e65376ffe5b2
25851 F20101129_AAAUAW castaneda_l_Page_128.QC.jpg
dffb300dd189ae408b6b59b7b76ff496
e4075504586170147767d4410b15432198b5dcf3
6111 F20101129_AAATVP castaneda_l_Page_002.jp2
bedf96970a7c529a625155daf52abf45
42dccd05c6350f60122bc81167b301936f61c294
7380 F20101129_AAAUBL castaneda_l_Page_122thm.jpg
ecaaa51334715a5433a69087d2c87711
43ddcbe7aac440015b653d4c12e1c059c8e923e8
107141 F20101129_AAATWF castaneda_l_Page_034.jp2
003c25fa8cf90d6e501bb6c6ff19b069
b17923f09b837e44028c4a7b0c972b33bba97965
F20101129_AAATVQ castaneda_l_Page_007.jp2
d3246d789fa94d3ae897e0a277314c70
9327b7c308eef65b62cd5e9f3e8599ae0707da6b
6448 F20101129_AAAUBM castaneda_l_Page_083thm.jpg
b3614b60bb72caa6cae51ea7ba5510cc
96e6882e39fd98889c0c5cc4cf9ca5f0036bf0a3
87758 F20101129_AAATWG castaneda_l_Page_035.jp2
b0f69878709dac60e930dd75b2d16349
91e07167f48519be33b1e6edb78a038e5c34bb58
5960 F20101129_AAAUAX castaneda_l_Page_102thm.jpg
892e46c6e3c55f3683ea2e5a367d0429
68ba201cc6518b2fd1dc7f996549ab6447761b3f
1051966 F20101129_AAATVR castaneda_l_Page_008.jp2
e9f288b64929db8660289ef123b9bdb0
88bfac6573cffaa697165c4646f2f7f7cdd8d994
7293 F20101129_AAAUCA castaneda_l_Page_121thm.jpg
ca749d447d1534bbfa5288fd7a6991fd
fb78589369393d7c6b3ba47f696bb282fc62ad38
7036 F20101129_AAAUBN castaneda_l_Page_128thm.jpg
2a92e62625ff20a6d3776516580da4a4
848c10120ca021c2f0f7a48f4a6a27203017afc9
734504 F20101129_AAATWH castaneda_l_Page_038.jp2
fa24abca8328d250842c1a7977cec1b6
32432cd643f9446ecf8956fd9ff1895a43ef94d5
8007 F20101129_AAAUAY castaneda_l_Page_025.QC.jpg
65e489e8bf8682fd869863737780176d
d08244307d56b972d9b7f02513c0a7a40b7d8660
838430 F20101129_AAATVS castaneda_l_Page_009.jp2
bb03465fea91c35069c2c215da44c60d
3148e08f4ca646139c5ba1b5e9da15b2480c73ce
6850 F20101129_AAAUCB castaneda_l_Page_021thm.jpg
cb82ad0ca68d7256106037a5375abef2
7d2aae26c73e1193f7317efb0e211d38ca8b7ddf
6428 F20101129_AAAUBO castaneda_l_Page_079thm.jpg
760a8c2ebd66fd157d2e759436a2521d
5ac3c47a8bf523709221947eaa4bc5b3dd917855
1038160 F20101129_AAATWI castaneda_l_Page_039.jp2
64a14d4dac83cc216a057bbf0962c390
f7fab06b434cce5fd61e334c268d53c20a92d60b
25122 F20101129_AAAUAZ castaneda_l_Page_017.QC.jpg
c1ce1cb5fa8172a8f02d3da726ca8279
4f58e1f17f2af4529aedd14856a268e1711ac9cf
F20101129_AAATVT castaneda_l_Page_011.jp2
c2846106770c2ffd7449582d93ae9b94
fc20889b134b615f0056c3b4ed0a9128d0b6f41d
6734 F20101129_AAAUCC castaneda_l_Page_075thm.jpg
154e7f398804b3e866da9a9a783b91e3
0d0870621f3ce2c1a9b26ee4cf68bdc8fae5c416
22950 F20101129_AAAUBP castaneda_l_Page_076.QC.jpg
7bb3a41ddfec17684c728d49db4cb839
2afbe690860638777b0fece19ec36c6c506faffe
632647 F20101129_AAATWJ castaneda_l_Page_040.jp2
a896dc1ef56558f811b21fc5bb8501a0
746e082b58664d49690e779b17ad732bcc3e239a
101293 F20101129_AAATVU castaneda_l_Page_015.jp2
57fbaac9f3807a073add52702397e6a0
13f4cd7d132c2e3e82298a22e3bf457bcd4f52c7
24919 F20101129_AAAUCD castaneda_l_Page_084.QC.jpg
d1b2aa1ca58f3806e11241472919b486
cbbd01a17956fe5836031375e623b27aa5090856
5584 F20101129_AAAUBQ castaneda_l_Page_098thm.jpg
a1dc25c62bda875209d2a811f1c11414
0c5e2a5e0dd3ba65b6235a45032782ee737aeb96
33172 F20101129_AAATWK castaneda_l_Page_041.jp2
08c9fbea94a07a376e9d165c452bacb9
55a7381d81d07ebb3c44c6f0e74827ca8800c8fa
112242 F20101129_AAATVV castaneda_l_Page_018.jp2
f3072ef7d193c6d3854c2678b0fcd769
59c82d43222ac86f27d1f017b936cee3866e1307
7162 F20101129_AAAUCE castaneda_l_Page_080thm.jpg
4aca308acf80881f3b8a518cc1f2263a
bb1009ff7f4463261ba2c1a0ff99e2d2ef78d71b
8147 F20101129_AAAUBR castaneda_l_Page_041.QC.jpg
3035ec26a60de33ba966f688cedb3ebf
cffa4530d76a5fb7ecac9758e7acde12a9ea1b69
102354 F20101129_AAATWL castaneda_l_Page_043.jp2
8705187eef74cf662a67e50187602811
62210e15e6d22cbe3470b716c5770fd849e94abf
110767 F20101129_AAATVW castaneda_l_Page_019.jp2
dde27b66bca1bf915d5f2361935b8adf
ad9070699ef288f702dd755df7609072290d4161
26725 F20101129_AAAUCF castaneda_l_Page_120.QC.jpg
79b590673bf88769eadcc0048435b930
f1aec4b84aa492f371b9a880c0e2f2e72be363d5
106973 F20101129_AAATXA castaneda_l_Page_074.jp2
83404f93114f46cf4140534104dd43af
c1f3f91a66aa9f6b62a6a9492baf2460accc6822
6746 F20101129_AAAUBS castaneda_l_Page_061thm.jpg
5b4a869ae4c75deb4af9e9afb3fd4cef
91860a63b11afcb54f69c2683b7afdb6f9d4658e
102547 F20101129_AAATWM castaneda_l_Page_044.jp2
9540963742ec6d5c7a7e5634304476c4
ea98daf521914804a55b0b1eab3ac293fb244f30
118415 F20101129_AAATVX castaneda_l_Page_023.jp2
3c2a94fda68dbc44d37b5f73dc5f748f
4dbfc5f355b3c5d978d22b4a3e2339edb236f77a
7413 F20101129_AAAUCG castaneda_l_Page_125thm.jpg
7fa55f05d1c38101e13acd4b12f8ceb6
6cd62953e42b519f30907320b2eff83a380a025f
108175 F20101129_AAATXB castaneda_l_Page_075.jp2
bcabb6222f89110b565a91ee58f7f829
d4637e21da39a26d4800ab3a41fc07bf09f6dd13
2395 F20101129_AAAUBT castaneda_l_Page_051thm.jpg
52c74f737597431a09d72bb782242255
e9c8b911c2a183e51033eafd3ec08fa471db4ae7
102026 F20101129_AAATWN castaneda_l_Page_045.jp2
7e3491491bdf0c69711e3cd47d3b3c4a
06b262062321ed9a2879637ffa9b5751468b992a
29426 F20101129_AAATVY castaneda_l_Page_025.jp2
74ab6c676f12531e07a136dfbcf3f97c
62d4e64ee3f814f1766650fff9805743939b47f6
23241 F20101129_AAAUCH castaneda_l_Page_087.QC.jpg
51ed5686a5265a9cedea9c8a9f6b35c1
1fc52c323ab3c6138c107dd68ad2e7aa8bbb9e8e
112483 F20101129_AAATXC castaneda_l_Page_077.jp2
17b280835bc40c4eae0d6bc35d8aec43
0d711209c1a7123b557ce26e0fccaf6833b8dcde
5983 F20101129_AAAUBU castaneda_l_Page_008thm.jpg
d57c352ad79c97d037f1e383ab7e7f53
d39148ab2bb809f6e94ea60186de0393ec2da93e
96938 F20101129_AAATVZ castaneda_l_Page_026.jp2
2224647b93b6ffef06765c72d116abe8
7a6df332be7cd5f256f106f7245bb453cd544408
F20101129_AAAUCI castaneda_l_Page_085thm.jpg
72a2121556738462b38b216c6242a23a
04221bd06d792eaee6b3c6c296e280e550bcf31f
111997 F20101129_AAATXD castaneda_l_Page_078.jp2
0a0aea5f37aa3dddbd877f8ce676e15c
ad7dd5ce988f7ae33bf769ad437d1386c45ac38b
6130 F20101129_AAAUBV castaneda_l_Page_067thm.jpg
def047abf73ca39944ac9ce427e41cbb
61dda12fe84fe7de4343f3d0d8bcf9ad337d4fb1
109177 F20101129_AAATWO castaneda_l_Page_046.jp2
328afff2e7cf1da1a871201b0da724ad
0e9f7d90d5861f84b0c422a15726a5f6e7d25f92
24735 F20101129_AAAUCJ castaneda_l_Page_048.QC.jpg
ed27c46edf5fb18f72cdd6e587bfa86d
5e767fc48b3ccc6d90e65a119fe6c6bbae8f37ca
101382 F20101129_AAATXE castaneda_l_Page_079.jp2
de213e68051ea3de5363f3bdbd7ccf56
ba1de54ecec730673d5869fe212e950c4eb9ee8d
2502 F20101129_AAAUBW castaneda_l_Page_066thm.jpg
1ec52fc79af13a0fe3788cbe53ace3cf
78a682a4333978d2c1f759e840787db6922543ed
102867 F20101129_AAATWP castaneda_l_Page_047.jp2
430fd26052fdab22dc6d7bf6b638fe4b
95e7e08856d3f1a75a8b4407fd90477f42094643
6900 F20101129_AAAUCK castaneda_l_Page_068thm.jpg
8db3006fc67a440440214bb7b102f862
5f387c294bd5df7409edbfb5d45e49d190dd42b5
109885 F20101129_AAATXF castaneda_l_Page_081.jp2
f631c984e1bb9bd8d6e134628b093c87
7ac92343a18716207f0d4acd37e8e711a487191f
6932 F20101129_AAAUBX castaneda_l_Page_084thm.jpg
54e2fd45342208c148f26bcf282fbebd
fed91a46a67e70eac669c91911f74d8a5c2aaa7b
104621 F20101129_AAATWQ castaneda_l_Page_049.jp2
69ab855a9f542b4e24cc8110bc493517
94c7298765905ba99ee8f6c2bb3b7682a46339b6
6698 F20101129_AAAUCL castaneda_l_Page_060thm.jpg
65a321a40f2a73566c541d9f09b4c30b
7d666ce72a4a822ef86f231c50ef9b80ceefde1c
665433 F20101129_AAATXG castaneda_l_Page_089.jp2
3d0cb2cc5797d9ab58c734dd7b97a697
a3e2d7aac0dee9e5f4b862df20b1e9b0ac4097f7
788160 F20101129_AAATWR castaneda_l_Page_055.jp2
d787121181003d7257eaf3c50becfc62
3c1d6a32136a59b177fb7b59c96bfec882a7610a
6930 F20101129_AAAUDA castaneda_l_Page_066.QC.jpg
3c2f80ccf842cc07cf944d40a9b8aa6e
0c8b92992103505ff94f2051edd6ed77fdec3496
24677 F20101129_AAAUCM castaneda_l_Page_046.QC.jpg
30e14f626b50e839294773090912ea66
f926301d3a7b419fbf5d91ccfc49b59c9244b017
883473 F20101129_AAATXH castaneda_l_Page_093.jp2
036a08a4a2bb6d8d5f82536f93405df0
72f294577a86988ee8011fbe064bd071400287fa
23524 F20101129_AAAUBY castaneda_l_Page_070.QC.jpg
24ed686247975355c100ce65d030d84a
a5e6aa297e48589ec2d260588de3f617cb83aea6
570141 F20101129_AAATWS castaneda_l_Page_056.jp2
2f1b4b952b720db8d1c07ddf7c0a1f72
e6ec1c0c057d0dbb5108768091f96bf2663b1738
23212 F20101129_AAAUDB castaneda_l_Page_031.QC.jpg
a15b934d6efd049526b709b6c3fa3536
6e18e59dd8448e4f889b8f36f809cba84cea5086
25516 F20101129_AAAUCN castaneda_l_Page_077.QC.jpg
0c43edd7112b244092ba03cfe03abacc
c682e5fc4d0803e4ddfa251494fe98bc49a6c6e3
1051986 F20101129_AAATXI castaneda_l_Page_094.jp2
ee313ef93a7bb28e352df3ff916bf9c8
5bfa93eb3a656f1e7bb301748bc22c43dcfb3aef
6851 F20101129_AAAUBZ castaneda_l_Page_071thm.jpg
818aa23d8ebd0111d552f856382377b3
1b1b1662eea73b331c477d20cc357c1bbecbcf15
107817 F20101129_AAATWT castaneda_l_Page_058.jp2
554389351d0acbe3698f4c71c7fe02f3
1129f5e20be558440d4f1151fa0cada49dd1c0fa
2811 F20101129_AAAUDC castaneda_l_Page_005thm.jpg
037826aea1525fa3d8b93568a1a2bb86
029b47372d3d679468df33a1d08ee87e2b0329af
17514 F20101129_AAAUCO castaneda_l_Page_099.QC.jpg
6f0bb0f6c69d28a71f597169b840eba4
ac20b49fe221660392685a18e142f1537dd1a68b
914562 F20101129_AAATXJ castaneda_l_Page_095.jp2
303f5b147e2772f0c7027fbcd84aad9f
bc729b933d40f1f4bdaeb3e4e3409cd52c4abb34
102233 F20101129_AAATWU castaneda_l_Page_060.jp2
7bef032f8f16c9b8189e4809e85f6c74
8fab95187bf926a9d4c4e16f82dca8be71567204
1833 F20101129_AAAUDD castaneda_l_Page_116thm.jpg
43066225dcf1861b4c0bd4e81b65ddfe
389c181cc5f2a06908d833770ec0cb742e21b145
3342 F20101129_AAAUCP castaneda_l_Page_135thm.jpg
80161a21abdf7b390219d78e8b0ae909
523c2c045e74e97111bcb19cc81176675497689f
81754 F20101129_AAATXK castaneda_l_Page_099.jp2
53063a03c9da528730a38c88ffa23db3
663c28b079fec2029a20e9b4c8bfe6b21cff5d95
109954 F20101129_AAATWV castaneda_l_Page_062.jp2
8fd0c56e199e79bfffcd131bc998e532
9b0101569e42f59f450c02ba9238f79754859690
15508 F20101129_AAAUDE castaneda_l_Page_064.QC.jpg
b59a2f7d399618995b82c16122102c6b
a8628c493f55e039a3630ed8d766b7a5fcd0d36a
6979 F20101129_AAAUCQ castaneda_l_Page_105thm.jpg
49cc24bf7655b55cb4dcc089aaebcbdd
5299a1ec84096fc9d283bd4d4b7c74acd78719db
1051976 F20101129_AAATWW castaneda_l_Page_065.jp2
cdb20eff627e6bd35114986e1a34a15a
db172bb2436c517d069673d7ddce52f93b6eb226
22946 F20101129_AAAUDF castaneda_l_Page_060.QC.jpg
92a5d77209b49e55e8ff328dd1c9e59a
ec3ca72c4d0364e0dd5806ab55934de35cce99ad
11221 F20101129_AAAUCR castaneda_l_Page_053.QC.jpg
7ac7624812a3846b384c8564e0bd3bc1
77e0e70837ebe86427cd349be73194dcf7ef0586
85881 F20101129_AAATXL castaneda_l_Page_100.jp2
7e9839c809ef2303de5ca748f9fee335
955eaa7e25b5f65523ee1d0c52c2da2521ad7052
103001 F20101129_AAATWX castaneda_l_Page_067.jp2
9b458d1ce567f73a01c690199a3f43cc
5780c12e6264b6fb60602fd1127044e309bf8b9e
22365 F20101129_AAAUDG castaneda_l_Page_067.QC.jpg
698ff8b8bea9fb908f159c4c0923a874
b84c01cdd6e9ca64009acbbaeb3ffaeebebefed1
F20101129_AAATYA castaneda_l_Page_008.tif
ebd4f77708c7644bd281ebb6e44c588f
40e345c237ea54f285869415449878b3ead57951
26691 F20101129_AAAUCS castaneda_l_Page_103.QC.jpg
f8029a07d499068f0d1a3f611cf122fe
dfc744120a48b129e9e1e783876a59f2866f22dc
34558 F20101129_AAATXM castaneda_l_Page_106.jp2
5db874b14f9fe5e9ff96e5e21660a937
a54db481f2eaca4999d1f8a6aa18330ba228e0ab
109976 F20101129_AAATWY castaneda_l_Page_068.jp2
3a341b3d38cc47d226dd7529951607ba
52807fd5755dcb30cd146917de815d4e25fd7eb2
4783 F20101129_AAAUDH castaneda_l_Page_116.QC.jpg
3229aea59cc3e7d715199a17edfed2c7
0547c9c90e1edad4b6c2a8a3be989cf958e7fcc8
F20101129_AAATYB castaneda_l_Page_009.tif
1afe41549274386b18d7f9a95a54fdd6
e1dbe3d6ae770db51f810744f653962aeb80544e
4030 F20101129_AAAUCT castaneda_l_Page_056thm.jpg
f1fff0ffb24884899c5b9bf618b34199
bbd2d70b158ba3b0e0c4bb1b15f21b4257b9d260
97404 F20101129_AAATXN castaneda_l_Page_107.jp2
0393874466e6bd94cc05840bbcf0f2d2
5288149b8fe0b4db5f5af5e2f9356763155b6772
98284 F20101129_AAATWZ castaneda_l_Page_073.jp2
441bf15dc6f1e11076ac8625f441d67f
6f943da53e6006b0a62e69a81cb9e627b52b166b
F20101129_AAAUDI castaneda_l_Page_078thm.jpg
783b95ff5dba2ae168dc95a3ea0b1b6d
fc1688a3037b80f0712c38695d714bbe693b3f3f
F20101129_AAATYC castaneda_l_Page_012.tif
338b951100e8fb60b53bf8c2b9ecf1db
f866e1c519cc7294a6490fbe6b5c084813a7ba89
24086 F20101129_AAAUCU castaneda_l_Page_028.QC.jpg
8395bfb3cdcfc0672b4dedc42df674cd
8d775485055411c45bfa1bef857d81393d5554be
21244 F20101129_AAATXO castaneda_l_Page_108.jp2
b8870b8a5f7b668464061ce0e8485780
3fbd9ca6509313ffdc29a7deabe094395bbaf47f
16255 F20101129_AAAUDJ castaneda_l_Page_089.QC.jpg
0d4c8161a2cc82e390289a44a1461b2a
805f8a1526a84d09f55d10866ac6761e6992e804
F20101129_AAATYD castaneda_l_Page_017.tif
ce58ddd4a806aec1921b0a08c36456e5
7ccc5ce208d52d684d87a38c30fb6b24da73a711
23871 F20101129_AAAUCV castaneda_l_Page_085.QC.jpg
193a027e4fcf594afc84bb9c6c4ede83
faa7b25435502a2321c04e1e3ccb2058f6e4912d
17052 F20101129_AAAUDK castaneda_l_Page_092.QC.jpg
7bd46360eaded79911f2ace6aa517b28
2d7eb513c753bbfd4b54da6109f1f309c0a35e91
F20101129_AAATYE castaneda_l_Page_019.tif
0a63d130c63f9596b0fc3da7d77163f2
cb40021b8e99830cfbc002291ccb3e6aa695129a
6802 F20101129_AAAUCW castaneda_l_Page_086thm.jpg
cad70f2ef30a2687e1c11b9bceaa2ec9
1f8017f6b2c8593801cb91476915ad8722273a9b
21801 F20101129_AAATXP castaneda_l_Page_113.jp2
eaa0f276cf52c9b0b462dc0a01987896
55cfd9da5d4f1462855829609b6e7ec6cd233b3c
6730 F20101129_AAAUDL castaneda_l_Page_050thm.jpg
4d6be41115ef0bdcea82c07c00cf4f4f
a502bc1b7871edbf638001b2aad949ca8c2a1212
F20101129_AAATYF castaneda_l_Page_021.tif
81245a93865e36b00953a0af21c5ed6b
311ca9424fa5a8d619d62a0c58c0dbc3c844acca
26455 F20101129_AAAUCX castaneda_l_Page_123.QC.jpg
bc48e82c0d2a1b2958afa1d19fd2740a
71e29c36297a0447c4a237c40bbf44a817378cfd
147315 F20101129_AAATXQ castaneda_l_Page_119.jp2
3adb397ec94fc7d82bd6285c3241d6f9
ea5e6c47e6b03a5c8ece47821ad46206a9227540
25060 F20101129_AAAUEA castaneda_l_Page_080.QC.jpg
f29629e4af5ec72e1e8a9ca5ad4b44bb
bfdf33a22160da995ae760ff9bab9cd2c9b34e0b
7530 F20101129_AAAUDM castaneda_l_Page_134thm.jpg
b4f81f558c59d6abe4f66baa008c9638
b388ffc17690866f9abd21337c7d9426b40777d1
F20101129_AAATYG castaneda_l_Page_024.tif
c48d6b14acb65d18ab12184d15d5c970
11cf19294c44dd5c65965a4ff69c48c0f9a688a8
3558 F20101129_AAAUCY castaneda_l_Page_096thm.jpg
6f42ac18431162e269fed37d50ad3b9b
f8b743612164e55317b1abe881ed1e802730ffa6
136565 F20101129_AAATXR castaneda_l_Page_120.jp2
efbd5c5e43f1efbdc164288839d6f80f
04a1212d9b9b5684629e866d5c217aad47fb1eeb
2226 F20101129_AAAUEB castaneda_l_Page_113thm.jpg
56277751798d9116b2107213b2e0d75f
d435b9a04bd7781ff992b2cdbca8fce42c791420
25576 F20101129_AAAUDN castaneda_l_Page_023.QC.jpg
54a863341a2ae791947fe0191fd6a0e3
62b6f0e71f8567dce030f53484aa0c6918c663c6
F20101129_AAATYH castaneda_l_Page_027.tif
2853fc773b7403181a9157bac4cfb260
046a9ee2e0425f4b69b83bafb7a09f0b51e55b1c
131391 F20101129_AAATXS castaneda_l_Page_123.jp2
f9565eb1937700b8ba3ba516432048af
d969f754234b432ce8bec9f551818cdd446ad829
18924 F20101129_AAAUEC castaneda_l_Page_098.QC.jpg
765b36333b7efffce5540baade46177e
b66baadcaa91490cea5abe0ec4e4d4c5d9ee802f
6889 F20101129_AAAUDO castaneda_l_Page_029thm.jpg
c72c3f430a845f643d1881c5791eaf61
ef254b04070d0fea3faeffd969bcdbdebf89e4ac
F20101129_AAATYI castaneda_l_Page_028.tif
dfb5a09b5dc8045eefa6f328bed534c6
e7e140e979e3b9e30e32f44e67dde2792c595340
20687 F20101129_AAAUCZ castaneda_l_Page_004.QC.jpg
b38428622574b299a18c03f317091428
710002c227cbad47145dd0a66d4fd9ba9c2c2bdd
135802 F20101129_AAATXT castaneda_l_Page_127.jp2
a3235fd59b8618708915e13ecc9d501b
81c10a142c47d2c7d158c38a55efd2ba8f831689
148193 F20101129_AAAUED UFE0011348_00001.xml
b9df1dfb31fe57833ea4a9ce6a87fb9e
cc46482be91bb1deeee9b6dc531960757ea44d5f
18649 F20101129_AAAUDP castaneda_l_Page_039.QC.jpg
943fd4ceb95c1886eca5ac06c61e6451
1e2ada8595bcd5f0cee39b292cf669cea1db13a4
F20101129_AAATYJ castaneda_l_Page_030.tif
11d1a8180444e3e15aa1f744fc2575be
443611f8c04871bc1ce09082d4898a7887c5cbd9
151322 F20101129_AAATXU castaneda_l_Page_131.jp2
d8c8822b4f5f4f3583e3af5685403ef2
654126ad1630156bcd61f1066099a1ca65f4cfc9
5970 F20101129_AAAUEE castaneda_l_Page_004thm.jpg
758ed94f19f7d47d22be3e2ce2590d52
f242964dcdc9774bc05e6f3595dcf6419c3128f9
24565 F20101129_AAAUDQ castaneda_l_Page_018.QC.jpg
51dd8400f5f40f13f4dd396d38701033
9c3ac626f8d2794655c393f7c0bf1a7726ab85c5
F20101129_AAATYK castaneda_l_Page_031.tif
a4d4b984d10a0bd79d891ed0e110b95d
a559b527aaf5df99396370fc52ba65e25bfae710
145108 F20101129_AAATXV castaneda_l_Page_133.jp2
fa1b14a42c01b395d8d5ba707ace71a8
b66505f662fcb191b41cddbc4a9bda7925f8b2e8
6690 F20101129_AAAUEF castaneda_l_Page_011thm.jpg
6a19bd0af3e653b9f3cdbf9d9c229e92
2d7ac39000c9abf231e2fe8628712e6e49e42bf4
24256 F20101129_AAAUDR castaneda_l_Page_091.QC.jpg
a0b1c71b9382d7b502c2e02d29aa42df
44c87cefca62daf8ecb6fd016ee8cecf3bfad1ae
F20101129_AAATYL castaneda_l_Page_033.tif
3bb44b90dd83752b36f611ad935446d0
2a25bbad18248a1be1471dba10f4e14d0cb6f3f3
43173 F20101129_AAATXW castaneda_l_Page_135.jp2
873b321ba95cefa2dfadf0be87e7f81e
7ad9137d995f2c8b988f82c03ca1258dc3c743ba
21760 F20101129_AAAUEG castaneda_l_Page_015.QC.jpg
8542287bd93b7c3544c1a7f29f6b869d
4d4d24a2dc425d652495e124cabde5ece6afaac6
F20101129_AAATZA castaneda_l_Page_053.tif
697d85224243c2def2261be42e3275c9
e520fc9d8d4a66924f64d970c2bca6a6f6625930
23402 F20101129_AAAUDS castaneda_l_Page_050.QC.jpg
4929327eb55f1aa1f1063d19ab2bed4c
c91b1758705db22c51ec9802cd56994418b3e28f
F20101129_AAATYM castaneda_l_Page_034.tif
961e8452e7a1ff07eb3f5e78f18a1881
c42c5058f41df2325e6718cb1d85cedf15e8af63
F20101129_AAATXX castaneda_l_Page_001.tif
2c3746a3c118a9173761ed351d422ee1
e556fc8c805a81ef7099fbd6bbe6c2a97dc223e0
6869 F20101129_AAAUEH castaneda_l_Page_022thm.jpg
7c474197a15fcdd8f70010a5b17d21d7
9a707cf7eb1295dc1a1a08e5c7ce08054732b05a
F20101129_AAATZB castaneda_l_Page_057.tif
e3bc3d9a009494ad87e0ce0390cc08e1
84af8d52ce03e3aa91a381d08b27b90a26cbc707
25264 F20101129_AAAUDT castaneda_l_Page_020.QC.jpg
7f7f78cd4a93aec0770cf7930f6c83b4
3db7cfae11621f6a66afe2a19c57b3d569ff3675
F20101129_AAATYN castaneda_l_Page_036.tif
ccaaf0e27cf3656f248bbbde8756bc01
b612a081bf4a7532cdc1b7a67b284d5cb487e668
F20101129_AAATXY castaneda_l_Page_003.tif
2b7b4944e147b38a985c1d8fc314545c
94081c60afc69938826307622ac9bebdd4fa44b7
F20101129_AAATZC castaneda_l_Page_058.tif
473a6586cf6b6f874e36784f0620bdb9
9fe08ae803684d98310dba209f2b7c8a597164e1
4605 F20101129_AAAUDU castaneda_l_Page_095thm.jpg
19885c1ab9fc5feb4c2a1d9ceaecc0de
7400a1a9d50b00246e7cf2833e7272011fe03a08
F20101129_AAATYO castaneda_l_Page_038.tif
deb7dbc8f0a3a327218ff98c99873c34
a199ea607f99b2dad8452b299b96731905a40aaf
F20101129_AAATXZ castaneda_l_Page_004.tif
72ebf4d7244b16e228b8f6a8bab76957
8754bacd8b8605af908235a4482bbaae59a78fdd
6602 F20101129_AAAUEI castaneda_l_Page_030thm.jpg
beb85b06df0e83d4a3690188b79fad8f
79ce032bdd97df780f517b9438c32bdd3f3cd4c3
F20101129_AAATZD castaneda_l_Page_059.tif
d500d8f5cf0490705d70237b7f3b6c8e
8ad0e3f9423a3aaeec8b5d569387d129b27a0d8e
6748 F20101129_AAAUDV castaneda_l_Page_129thm.jpg
bc9c51976cb44cb2186a7bcd37989f5d
51ec2171c6217e583a44dae790ab209fc5b4f01b
F20101129_AAATYP castaneda_l_Page_039.tif
78abb34d04db45520ac83edd7bc6df0f
bf51215ad2fc969dd18928e7a50750d1902edd90
4949 F20101129_AAAUEJ castaneda_l_Page_038thm.jpg
c295a78d1416521fe77daf8fba56db48
82c1487d01e241e0529598f26dde5f1e9e975a72
F20101129_AAATZE castaneda_l_Page_060.tif
78b123c30a56be647a6df881af7894c6
78350d4db8018965c58cebd688dcc357fd2534bb
6859 F20101129_AAAUDW castaneda_l_Page_018thm.jpg
93cc82b269a4c68b5f6090d042d20a25
509100804ddbbebde7067f7d09b2ba8abcd29939
3592 F20101129_AAAUEK castaneda_l_Page_053thm.jpg
b5572de2f7395897f85c5586ba421004
9d5f9eb652744940ba9258f9cd4b2c2fe94d7109
F20101129_AAATZF castaneda_l_Page_061.tif
3a333e1a9676065c603bd63146858976
2f35c87ea651bfac522d693ac35603fadf1b9fe3
6635 F20101129_AAAUDX castaneda_l_Page_062thm.jpg
4f108a10a07c3175dad0c0446b293705
3e7641a47b78b3fe5129404240bd1645f8262625
F20101129_AAATYQ castaneda_l_Page_040.tif
8ce616d082d146ca2ba8ed50a8685834
48412f6d0cc5a79d33265976d425e36602156ae9
24765 F20101129_AAAUEL castaneda_l_Page_059.QC.jpg
de2feef11b1020b7f2fb0887decee879
dc854d54ca99ce3939ce9a07b0a520bceb27cd6c
F20101129_AAATZG castaneda_l_Page_063.tif
0ed8380f079309beb56b07015b4f60ee
521b8c28b512f5ac898040cfad3e274bef6577d4
7343 F20101129_AAAUDY castaneda_l_Page_127thm.jpg
5a3658d54a1845533b3bd219d6e8810c
db938693bded96d6bf5aa9384a1ab59a49c2d543
F20101129_AAATYR castaneda_l_Page_041.tif
081dc2b7107a93a66ca4d1eac0f17767
460890c5b0802fe7c33e7ccb887bb4d3ac5e8079
F20101129_AAAUEM castaneda_l_Page_064thm.jpg
c00ad3fc2d5004307f605ac322318584
4e912d76b4f5d954bb341bd2d7497fa131db8001
F20101129_AAATZH castaneda_l_Page_065.tif
89b727458ac737c2c5aa970824ff85c3
7e6cd63d628c6de6931772d091683a3dd976263e
6335 F20101129_AAAUDZ castaneda_l_Page_104thm.jpg
aff454e5086fe49a39d6aa3dd67177eb
dd19df0e4a223f7ab8942043ce1ee5ce548f9ddb
F20101129_AAATYS castaneda_l_Page_042.tif
53be272feece0aa469cf737beec50c67
2a9637c2fc71e1b91753a9ce761b65235e69ba2d
12399 F20101129_AAAUEN castaneda_l_Page_093.QC.jpg
4097a26d1c673f7700e651a9daab4a2c
cadc24312de7a7de3240df05953eba359be750d3
F20101129_AAATZI castaneda_l_Page_066.tif
71fdf623b76b9449faeb2263735f493f
2ca7be67ef94c5a06fa1e6848e64651d38a9e1d5
F20101129_AAATYT castaneda_l_Page_043.tif
ace7ae19bd059f81683fb712348eb72d
941328c5a817eea2a1ab485c29610c8cc396a7fa
20955 F20101129_AAAUEO castaneda_l_Page_094.QC.jpg
383780e0f83bf778c73510d85483dab8
93d55393c505160f5c3f5e1a02df50281fb1e5a3
F20101129_AAATZJ castaneda_l_Page_067.tif
d73e9c094279b2a3ee1f9e9c69dc4657
e2a54e545ab304cd53d0c5c6670f35c707b64cfd
F20101129_AAATYU castaneda_l_Page_044.tif
b196c2b509c2c809ac92e76e70a20810
5b9a9effb533901ce550853650a0b5f86adb909b
19174 F20101129_AAAUEP castaneda_l_Page_100.QC.jpg
82cf5f1422a8f08f03e129b69b0f0a1e
48f0c180b15e7fa430feed78dab086c00a441d93
F20101129_AAATZK castaneda_l_Page_068.tif
63963e00d68c58eaa7cbace62213507a
f6c25f8cce59ba7435a3531dcbbd7629056c35a3
F20101129_AAATYV castaneda_l_Page_045.tif
62f37340b1376f29d354ebb9ba8c9338
883bf34dc979d21ba793ec167f2a38d7944a0acf
6496 F20101129_AAAUEQ castaneda_l_Page_103thm.jpg
6cec59f4a5f301741a97d706be0c89b9
1439a877876b19fd08f878b77553cafffde4a399
F20101129_AAATZL castaneda_l_Page_070.tif
97ebe70c9cf3249d719bdc3c870e8b6c
6cc421eb19c624e65cb550ebdaff81cd69f1a4a1
F20101129_AAATYW castaneda_l_Page_046.tif
70f4968143e2b0d1ce0e27094dc56179
b16ffc7a3d9e5074b87c9aedaea4eaa20088aff2
22293 F20101129_AAAUER castaneda_l_Page_107.QC.jpg
4ae75189c02b91e2fba59e8d042c63ea
6d30500a7fd307abc22cf7f099f4e9e721018c55
F20101129_AAATZM castaneda_l_Page_073.tif
9314a17d96b2b1554f6a9769972e3eed
b20ec3c7518bbda0946de3936946d78adcf6de37
F20101129_AAATYX castaneda_l_Page_047.tif
04fb225e18ed83aebbf9bc56dd0cf3e7
9fa31517e5f2b5141c711544575217a398249d46
5466 F20101129_AAAUES castaneda_l_Page_115thm.jpg
24721539befac2860394937c8cfe0bd5
8ae40fa2e251c3706ca1a681df276a11b29d347e
F20101129_AAATZN castaneda_l_Page_074.tif
ca541112ffcfd65459ccf9f81a3afd55
e1f0f2f6743b78d19dcad840984823ff3019339a
F20101129_AAATYY castaneda_l_Page_048.tif
5a6ed239b8645f171bbb7f94985212f1
1e7a3078a8102f0b086c40a57494690969a20eb2
7049 F20101129_AAAUET castaneda_l_Page_120thm.jpg
0be41218b614816d5418e9956cde188a
7e2b767c5356abaca9f2b6595ffe1dc31674649a
F20101129_AAATZO castaneda_l_Page_077.tif
b110b380f4c725b6e658135df2e8eec1
75939b218d6281be94aa28a194d9ccd2a2488331
F20101129_AAATYZ castaneda_l_Page_050.tif
a3fa91b93b80e196eb590b3d111601ca
83020609965051a8c79e473179dc13589f1b42c3
28132 F20101129_AAAUEU castaneda_l_Page_121.QC.jpg
cd6fe45b3a53b7cb93670bcbd802cf1a
b200b13742b245e0f8cefbddab9316830716d9b4
F20101129_AAATZP castaneda_l_Page_081.tif
9a682273813ae4f9519eb3bd056ba44c
9275c81f515f729b85feff0e3321200a855da0ad
F20101129_AAATZQ castaneda_l_Page_085.tif
bd0cc3ea033cddb8bfc3de3bed760382
280ac8a57f988d52c85dcb863c4af041985bdc18
F20101129_AAATZR castaneda_l_Page_086.tif
bc9e51b7f65de875c94a7e72a5745edf
23bee8be699ffcf8980043a24c696073f9926b41
F20101129_AAATZS castaneda_l_Page_087.tif
9a304b7979ee8db6cae1955bdfb330bf
d6409dae72b75cbe32525a8d9dd0f0d765ad2348
F20101129_AAATZT castaneda_l_Page_088.tif
a89df97b095cfeec11cb4fc628911321
ece5b36da3da85901744766f47eeb8e9a317e51f
F20101129_AAATZU castaneda_l_Page_090.tif
ccd4380a27ca3ddd3a4168e9853120c6
26dc1117269b7bc91e723b3b4a3ee4a0bd3b4725
F20101129_AAATZV castaneda_l_Page_092.tif
294a26db6eaf04436b213f9ef0511486
97a6f6c199d955253511af13206607a1eef4e819
8423998 F20101129_AAATZW castaneda_l_Page_096.tif
84b4ac91bef0a8607033bf8159a93662
f3b59d83c14978ac4424b6eb49cb54bde2e18360
F20101129_AAATZX castaneda_l_Page_097.tif
9f0cb958ff779a338be608ef892c3808
beacccbd404f01d1dbc89c929185446c71a1895d
F20101129_AAATZY castaneda_l_Page_100.tif
22655294c5d3e163423103350b76a325
1458989f87e2272acde1fd43ce6bac7611385525
F20101129_AAATZZ castaneda_l_Page_101.tif
9bd659451174bb2af133d179c2a95cca
0a28371e5c151be490a23ab547cf0259c47a4817