Identification and Initial Characterization of Genes Controlled by DNA Methylation in Embryonic Stem Cells

Permanent Link: http://ufdc.ufl.edu/UFE0011344/00001

Material Information

Title: Identification and Initial Characterization of Genes Controlled by DNA Methylation in Embryonic Stem Cells
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0011344:00001

Permanent Link: http://ufdc.ufl.edu/UFE0011344/00001

Material Information

Title: Identification and Initial Characterization of Genes Controlled by DNA Methylation in Embryonic Stem Cells
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0011344:00001

This item has the following downloads:

Full Text
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20101129_AAAAAY INGEST_TIME 2010-11-30T01:51:00Z PACKAGE UFE0011344_00001
113852 F20101129_AAARTN rodic_n_Page_014.jp2
104287 F20101129_AAAROQ rodic_n_Page_088.jp2
13404 F20101129_AAARYL rodic_n_Page_004.QC.jpg
24240 F20101129_AAASAM rodic_n_Page_041.QC.jpg
108818 F20101129_AAARTO rodic_n_Page_015.jp2
33050 F20101129_AAAROR rodic_n_Page_102.jp2
4022 F20101129_AAARYM rodic_n_Page_004thm.jpg
6705 F20101129_AAASAN rodic_n_Page_041thm.jpg
110682 F20101129_AAARTP rodic_n_Page_017.jp2
6319 F20101129_AAAROS rodic_n_Page_025thm.jpg
19359 F20101129_AAARYN rodic_n_Page_005.QC.jpg
9578 F20101129_AAASAO rodic_n_Page_043.QC.jpg
111045 F20101129_AAARTQ rodic_n_Page_019.jp2
1408 F20101129_AAAROT rodic_n_Page_003thm.jpg
4937 F20101129_AAARYO rodic_n_Page_005thm.jpg
20435 F20101129_AAASAP rodic_n_Page_044.QC.jpg
106079 F20101129_AAARTR rodic_n_Page_021.jp2
112564 F20101129_AAAROU rodic_n_Page_049.jp2
23619 F20101129_AAARYP rodic_n_Page_006.QC.jpg
1053954 F20101129_AAARJX rodic_n_Page_033.tif
24243 F20101129_AAASAQ rodic_n_Page_045.QC.jpg
111553 F20101129_AAARTS rodic_n_Page_022.jp2
110627 F20101129_AAAROV rodic_n_Page_035.jp2
5638 F20101129_AAARYQ rodic_n_Page_006thm.jpg
40423 F20101129_AAARJY rodic_n_Page_066.jpg
25468 F20101129_AAASAR rodic_n_Page_046.QC.jpg
113083 F20101129_AAARTT rodic_n_Page_024.jp2
101533 F20101129_AAAROW rodic_n_Page_060.jp2
5637 F20101129_AAARYR rodic_n_Page_007.QC.jpg
62856 F20101129_AAARJZ rodic_n_Page_031.jpg
22671 F20101129_AAASAS rodic_n_Page_047.QC.jpg
109865 F20101129_AAARTU rodic_n_Page_025.jp2
23719 F20101129_AAAROX rodic_n_Page_049.QC.jpg
6444 F20101129_AAASAT rodic_n_Page_047thm.jpg
103202 F20101129_AAARTV rodic_n_Page_027.jp2
74325 F20101129_AAARMA rodic_n_Page_013.jpg
3271 F20101129_AAAROY rodic_n_Page_002.QC.jpg
1984 F20101129_AAARYS rodic_n_Page_007thm.jpg
6668 F20101129_AAASAU rodic_n_Page_048thm.jpg
108837 F20101129_AAARTW rodic_n_Page_028.jp2
F20101129_AAARMB rodic_n_Page_003.tif
106594 F20101129_AAAROZ rodic_n_Page_037.jp2
23100 F20101129_AAARYT rodic_n_Page_008.QC.jpg
6320 F20101129_AAASAV rodic_n_Page_050thm.jpg
33216 F20101129_AAARTX rodic_n_Page_030.jp2
F20101129_AAARMC rodic_n_Page_037.tif
6028 F20101129_AAARYU rodic_n_Page_008thm.jpg
24109 F20101129_AAASAW rodic_n_Page_051.QC.jpg
92187 F20101129_AAARTY rodic_n_Page_031.jp2
24302 F20101129_AAARMD rodic_n_Page_048.QC.jpg
11483 F20101129_AAARYV rodic_n_Page_009.QC.jpg
68292 F20101129_AAARRA rodic_n_Page_027.jpg
6446 F20101129_AAASAX rodic_n_Page_051thm.jpg
113620 F20101129_AAARTZ rodic_n_Page_032.jp2
11504 F20101129_AAARME rodic_n_Page_080.QC.jpg
5266 F20101129_AAARYW rodic_n_Page_010thm.jpg
71536 F20101129_AAARRB rodic_n_Page_028.jpg
24272 F20101129_AAASAY rodic_n_Page_052.QC.jpg
474064 F20101129_AAARMF rodic_n_Page_081.jp2
5503 F20101129_AAARYX rodic_n_Page_011.QC.jpg
20762 F20101129_AAARRC rodic_n_Page_029.jpg
F20101129_AAARWA rodic_n_Page_014.tif
5720 F20101129_AAARYY rodic_n_Page_012thm.jpg
29556 F20101129_AAARRD rodic_n_Page_030.jpg
6702 F20101129_AAASAZ rodic_n_Page_052thm.jpg
33978 F20101129_AAARMG rodic_n_Page_074.jpg
F20101129_AAARWB rodic_n_Page_015.tif
24259 F20101129_AAARYZ rodic_n_Page_013.QC.jpg
76373 F20101129_AAARRE rodic_n_Page_032.jpg
25594 F20101129_AAARMH rodic_n_Page_029.jp2
F20101129_AAARWC rodic_n_Page_016.tif
70892 F20101129_AAARRF rodic_n_Page_033.jpg
6525 F20101129_AAASDA rodic_n_Page_091thm.jpg
73801 F20101129_AAARMI rodic_n_Page_053.jpg
F20101129_AAARWD rodic_n_Page_018.tif
74523 F20101129_AAARRG rodic_n_Page_034.jpg
22427 F20101129_AAASDB rodic_n_Page_092.QC.jpg
62575 F20101129_AAARMJ rodic_n_Page_010.jpg
F20101129_AAARWE rodic_n_Page_019.tif
75240 F20101129_AAARRH rodic_n_Page_035.jpg
6308 F20101129_AAASDC rodic_n_Page_092thm.jpg
16472 F20101129_AAARMK rodic_n_Page_101.QC.jpg
F20101129_AAARWF rodic_n_Page_022.tif
71793 F20101129_AAARRI rodic_n_Page_037.jpg
18251 F20101129_AAASDD rodic_n_Page_093.QC.jpg
100312 F20101129_AAARML rodic_n_Page_087.jp2
F20101129_AAARWG rodic_n_Page_023.tif
65425 F20101129_AAARRJ rodic_n_Page_038.jpg
5198 F20101129_AAASDE rodic_n_Page_093thm.jpg
73019 F20101129_AAARMM rodic_n_Page_051.jpg
F20101129_AAARWH rodic_n_Page_024.tif
75704 F20101129_AAARRK rodic_n_Page_039.jpg
10005 F20101129_AAASDF rodic_n_Page_094.QC.jpg
106590 F20101129_AAARMN rodic_n_Page_020.jp2
F20101129_AAARWI rodic_n_Page_025.tif
22686 F20101129_AAASDG rodic_n_Page_095.QC.jpg
112220 F20101129_AAARMO rodic_n_Page_016.jp2
F20101129_AAARWJ rodic_n_Page_026.tif
72471 F20101129_AAARRL rodic_n_Page_040.jpg
24949 F20101129_AAASDH rodic_n_Page_096.QC.jpg
F20101129_AAARMP rodic_n_Page_020.tif
F20101129_AAARWK rodic_n_Page_027.tif
72638 F20101129_AAARRM rodic_n_Page_041.jpg
6952 F20101129_AAASDI rodic_n_Page_096thm.jpg
115956 F20101129_AAARMQ rodic_n_Page_097.jp2
F20101129_AAARWL rodic_n_Page_028.tif
28435 F20101129_AAARRN rodic_n_Page_043.jpg
6963 F20101129_AAASDJ rodic_n_Page_097thm.jpg
6254 F20101129_AAARMR rodic_n_Page_027thm.jpg
F20101129_AAARWM rodic_n_Page_029.tif
74420 F20101129_AAARRO rodic_n_Page_045.jpg
6861 F20101129_AAASDK rodic_n_Page_098thm.jpg
110218 F20101129_AAARMS rodic_n_Page_018.jp2
F20101129_AAARWN rodic_n_Page_031.tif
77283 F20101129_AAARRP rodic_n_Page_046.jpg
23339 F20101129_AAASDL rodic_n_Page_099.QC.jpg
F20101129_AAARWO rodic_n_Page_034.tif
71058 F20101129_AAARRQ rodic_n_Page_047.jpg
3318 F20101129_AAARMT rodic_n_Page_003.QC.jpg
6478 F20101129_AAASDM rodic_n_Page_099thm.jpg
F20101129_AAARWP rodic_n_Page_035.tif
72872 F20101129_AAARRR rodic_n_Page_049.jpg
12380 F20101129_AAARMU rodic_n_Page_063.QC.jpg
6878 F20101129_AAASDN rodic_n_Page_100thm.jpg
68384 F20101129_AAARRS rodic_n_Page_050.jpg
72155 F20101129_AAARMV rodic_n_Page_017.jpg
4982 F20101129_AAASDO rodic_n_Page_101thm.jpg
F20101129_AAARWQ rodic_n_Page_040.tif
74028 F20101129_AAARRT rodic_n_Page_052.jpg
F20101129_AAARMW rodic_n_Page_017.tif
8820 F20101129_AAASDP rodic_n_Page_102.QC.jpg
F20101129_AAARWR rodic_n_Page_041.tif
86357 F20101129_AAARRU rodic_n_Page_054.jpg
80269 F20101129_AAARMX rodic_n_Page_096.jpg
2754 F20101129_AAASDQ rodic_n_Page_102thm.jpg
F20101129_AAARWS rodic_n_Page_042.tif
72239 F20101129_AAARRV rodic_n_Page_055.jpg
F20101129_AAARKA rodic_n_Page_030.tif
74569 F20101129_AAARMY rodic_n_Page_059.jpg
76322 F20101129_AAASDR UFE0011344_00001.mets FULL
F20101129_AAARWT rodic_n_Page_043.tif
73447 F20101129_AAARRW rodic_n_Page_056.jpg
578961 F20101129_AAARKB rodic_n_Page_078.jp2
53871 F20101129_AAARMZ rodic_n_Page_069.jpg
F20101129_AAARWU rodic_n_Page_044.tif
72588 F20101129_AAARRX rodic_n_Page_057.jpg
24649 F20101129_AAARKC rodic_n_Page_026.QC.jpg
F20101129_AAARWV rodic_n_Page_045.tif
27023 F20101129_AAARPA rodic_n_Page_054.QC.jpg
71944 F20101129_AAARRY rodic_n_Page_058.jpg
10487 F20101129_AAARKD rodic_n_Page_085.QC.jpg
F20101129_AAARWW rodic_n_Page_046.tif
3291 F20101129_AAARPB rodic_n_Page_084thm.jpg
67778 F20101129_AAARRZ rodic_n_Page_060.jpg
F20101129_AAARWX rodic_n_Page_050.tif
F20101129_AAARPC rodic_n_Page_056.tif
3795 F20101129_AAARKE rodic_n_Page_077thm.jpg
F20101129_AAARWY rodic_n_Page_051.tif
25271604 F20101129_AAARPD rodic_n_Page_009.tif
F20101129_AAARKF rodic_n_Page_100.tif
105984 F20101129_AAARUA rodic_n_Page_033.jp2
F20101129_AAARWZ rodic_n_Page_052.tif
6164 F20101129_AAARPE rodic_n_Page_060thm.jpg
6935 F20101129_AAARKG rodic_n_Page_046thm.jpg
113334 F20101129_AAARUB rodic_n_Page_034.jp2
F20101129_AAARPF rodic_n_Page_079.tif
421223 F20101129_AAARKH rodic_n_Page_086.jp2
98223 F20101129_AAARUC rodic_n_Page_036.jp2
24804 F20101129_AAASBA rodic_n_Page_053.QC.jpg
6294 F20101129_AAARPG rodic_n_Page_036thm.jpg
24592 F20101129_AAARZA rodic_n_Page_014.QC.jpg
67581 F20101129_AAARKI rodic_n_Page_036.jpg
95644 F20101129_AAARUD rodic_n_Page_038.jp2
6839 F20101129_AAASBB rodic_n_Page_053thm.jpg
63655 F20101129_AAARPH rodic_n_Page_012.jpg
6637 F20101129_AAARZB rodic_n_Page_014thm.jpg
2571 F20101129_AAARKJ rodic_n_Page_001thm.jpg
105048 F20101129_AAARUE rodic_n_Page_039.jp2
7446 F20101129_AAASBC rodic_n_Page_054thm.jpg
6638 F20101129_AAARPI rodic_n_Page_040thm.jpg
6677 F20101129_AAARZC rodic_n_Page_015thm.jpg
6699 F20101129_AAARKK rodic_n_Page_057thm.jpg
107205 F20101129_AAARUF rodic_n_Page_040.jp2
6515 F20101129_AAASBD rodic_n_Page_055thm.jpg
24139 F20101129_AAARZD rodic_n_Page_016.QC.jpg
35208 F20101129_AAARKL rodic_n_Page_073.jpg
37273 F20101129_AAARUG rodic_n_Page_043.jp2
6658 F20101129_AAASBE rodic_n_Page_056thm.jpg
F20101129_AAARPJ rodic_n_Page_099.tif
6507 F20101129_AAARZE rodic_n_Page_016thm.jpg
12876 F20101129_AAARKM rodic_n_Page_066.QC.jpg
94192 F20101129_AAARUH rodic_n_Page_044.jp2
24142 F20101129_AAASBF rodic_n_Page_057.QC.jpg
41820 F20101129_AAARPK rodic_n_Page_068.jp2
23726 F20101129_AAARZF rodic_n_Page_017.QC.jpg
32861 F20101129_AAARKN rodic_n_Page_070.jpg
112938 F20101129_AAARUI rodic_n_Page_045.jp2
23628 F20101129_AAASBG rodic_n_Page_058.QC.jpg
111719 F20101129_AAARPL rodic_n_Page_023.jp2
6534 F20101129_AAARZG rodic_n_Page_017thm.jpg
20268 F20101129_AAARKO rodic_n_Page_012.QC.jpg
107082 F20101129_AAARUJ rodic_n_Page_047.jp2
6398 F20101129_AAASBH rodic_n_Page_058thm.jpg
73881 F20101129_AAARPM rodic_n_Page_016.jpg
23440 F20101129_AAARZH rodic_n_Page_018.QC.jpg
6447 F20101129_AAARKP rodic_n_Page_095thm.jpg
113033 F20101129_AAARUK rodic_n_Page_048.jp2
24749 F20101129_AAASBI rodic_n_Page_059.QC.jpg
3383 F20101129_AAARPN rodic_n_Page_094thm.jpg
6543 F20101129_AAARZI rodic_n_Page_018thm.jpg
19389 F20101129_AAARKQ rodic_n_Page_010.QC.jpg
103494 F20101129_AAARUL rodic_n_Page_050.jp2
23103 F20101129_AAASBJ rodic_n_Page_061.QC.jpg
24468 F20101129_AAARZJ rodic_n_Page_019.QC.jpg
23264 F20101129_AAARPO rodic_n_Page_055.QC.jpg
729236 F20101129_AAARKR rodic_n_Page_063.jp2
110163 F20101129_AAARUM rodic_n_Page_051.jp2
6216 F20101129_AAASBK rodic_n_Page_061thm.jpg
6680 F20101129_AAARZK rodic_n_Page_019thm.jpg
F20101129_AAARKS rodic_n_Page_078.tif
112623 F20101129_AAARUN rodic_n_Page_053.jp2
42955 F20101129_AAARPP rodic_n_Page_063.jpg
15284 F20101129_AAASBL rodic_n_Page_062.QC.jpg
6326 F20101129_AAARZL rodic_n_Page_020thm.jpg
23564 F20101129_AAARKT rodic_n_Page_028.QC.jpg
74376 F20101129_AAARPQ rodic_n_Page_048.jpg
4452 F20101129_AAASBM rodic_n_Page_062thm.jpg
23525 F20101129_AAARZM rodic_n_Page_021.QC.jpg
1051986 F20101129_AAARKU rodic_n_Page_071.jp2
F20101129_AAARUO rodic_n_Page_054.jp2
25374 F20101129_AAARPR rodic_n_Page_097.QC.jpg
4067 F20101129_AAASBN rodic_n_Page_063thm.jpg
6449 F20101129_AAARZN rodic_n_Page_021thm.jpg
F20101129_AAARKV rodic_n_Page_067.tif
108014 F20101129_AAARUP rodic_n_Page_055.jp2
25283 F20101129_AAARPS rodic_n_Page_032.QC.jpg
16457 F20101129_AAASBO rodic_n_Page_064.QC.jpg
24477 F20101129_AAARZO rodic_n_Page_022.QC.jpg
117913 F20101129_AAARKW rodic_n_Page_096.jp2
111236 F20101129_AAARUQ rodic_n_Page_056.jp2
2871 F20101129_AAARPT rodic_n_Page_043thm.jpg
5376 F20101129_AAASBP rodic_n_Page_064thm.jpg
24257 F20101129_AAARZP rodic_n_Page_023.QC.jpg
F20101129_AAARKX rodic_n_Page_049thm.jpg
111399 F20101129_AAARUR rodic_n_Page_057.jp2
72287 F20101129_AAARPU rodic_n_Page_025.jpg
4285 F20101129_AAASBQ rodic_n_Page_065thm.jpg
6723 F20101129_AAARZQ rodic_n_Page_023thm.jpg
23055 F20101129_AAARKY rodic_n_Page_020.QC.jpg
107837 F20101129_AAARUS rodic_n_Page_058.jp2
108314 F20101129_AAARPV rodic_n_Page_042.jp2
4090 F20101129_AAASBR rodic_n_Page_066thm.jpg
6621 F20101129_AAARZR rodic_n_Page_024thm.jpg
113099 F20101129_AAARKZ rodic_n_Page_052.jp2
111708 F20101129_AAARUT rodic_n_Page_059.jp2
F20101129_AAARPW rodic_n_Page_001.tif
3625 F20101129_AAASBS rodic_n_Page_067thm.jpg
23810 F20101129_AAARZS rodic_n_Page_025.QC.jpg
67040 F20101129_AAARUU rodic_n_Page_062.jp2
22303 F20101129_AAARPX rodic_n_Page_036.QC.jpg
10079 F20101129_AAASBT rodic_n_Page_068.QC.jpg
548844 F20101129_AAARUV rodic_n_Page_065.jp2
6718 F20101129_AAARNA rodic_n_Page_013thm.jpg
F20101129_AAARPY rodic_n_Page_042thm.jpg
14743 F20101129_AAASBU rodic_n_Page_069.QC.jpg
6754 F20101129_AAARZT rodic_n_Page_026thm.jpg
395233 F20101129_AAARUW rodic_n_Page_067.jp2
18080 F20101129_AAARNB rodic_n_Page_079.QC.jpg
F20101129_AAARPZ rodic_n_Page_049.tif
4176 F20101129_AAASBV rodic_n_Page_069thm.jpg
22384 F20101129_AAARZU rodic_n_Page_027.QC.jpg
720757 F20101129_AAARUX rodic_n_Page_069.jp2
75000 F20101129_AAARNC rodic_n_Page_022.jpg
10610 F20101129_AAASBW rodic_n_Page_070.QC.jpg
6788 F20101129_AAARZV rodic_n_Page_029.QC.jpg
70044 F20101129_AAARSA rodic_n_Page_061.jpg
38800 F20101129_AAARUY rodic_n_Page_070.jp2
17267 F20101129_AAARND rodic_n_Page_082.QC.jpg
3341 F20101129_AAASBX rodic_n_Page_070thm.jpg
2268 F20101129_AAARZW rodic_n_Page_029thm.jpg
46853 F20101129_AAARSB rodic_n_Page_062.jpg
585547 F20101129_AAARUZ rodic_n_Page_072.jp2
68986 F20101129_AAARNE rodic_n_Page_088.jpg
19415 F20101129_AAASBY rodic_n_Page_071.QC.jpg
10235 F20101129_AAARZX rodic_n_Page_030.QC.jpg
47934 F20101129_AAARSC rodic_n_Page_064.jpg
F20101129_AAARNF rodic_n_Page_090.tif
5307 F20101129_AAASBZ rodic_n_Page_071thm.jpg
20395 F20101129_AAARZY rodic_n_Page_031.QC.jpg
45736 F20101129_AAARSD rodic_n_Page_065.jpg
10154 F20101129_AAARNG rodic_n_Page_067.QC.jpg
F20101129_AAARXA rodic_n_Page_053.tif
5680 F20101129_AAARZZ rodic_n_Page_031thm.jpg
31568 F20101129_AAARSE rodic_n_Page_067.jpg
F20101129_AAARXB rodic_n_Page_054.tif
33154 F20101129_AAARSF rodic_n_Page_068.jpg
3842 F20101129_AAARNH rodic_n_Page_081thm.jpg
F20101129_AAARXC rodic_n_Page_055.tif
70309 F20101129_AAARSG rodic_n_Page_071.jpg
24333 F20101129_AAARNI rodic_n_Page_056.QC.jpg
F20101129_AAARXD rodic_n_Page_057.tif
40532 F20101129_AAARSH rodic_n_Page_072.jpg
63285 F20101129_AAARNJ rodic_n_Page_044.jpg
F20101129_AAARXE rodic_n_Page_058.tif
52413 F20101129_AAARSI rodic_n_Page_075.jpg
6907 F20101129_AAARNK rodic_n_Page_032thm.jpg
F20101129_AAARXF rodic_n_Page_059.tif
40960 F20101129_AAARSJ rodic_n_Page_077.jpg
F20101129_AAARNL rodic_n_Page_038.tif
F20101129_AAARXG rodic_n_Page_060.tif
48570 F20101129_AAARSK rodic_n_Page_078.jpg
105393 F20101129_AAARNM rodic_n_Page_061.jp2
F20101129_AAARXH rodic_n_Page_062.tif
63254 F20101129_AAARSL rodic_n_Page_079.jpg
115665 F20101129_AAARNN rodic_n_Page_089.jp2
F20101129_AAARXI rodic_n_Page_064.tif
109243 F20101129_AAARNO rodic_n_Page_041.jp2
F20101129_AAARXJ rodic_n_Page_065.tif
1051983 F20101129_AAARNP rodic_n_Page_005.jp2
F20101129_AAARXK rodic_n_Page_066.tif
38269 F20101129_AAARSM rodic_n_Page_080.jpg
3533 F20101129_AAARNQ rodic_n_Page_009thm.jpg
F20101129_AAARXL rodic_n_Page_070.tif
32643 F20101129_AAARSN rodic_n_Page_081.jpg
24089 F20101129_AAARNR rodic_n_Page_024.QC.jpg
F20101129_AAARXM rodic_n_Page_071.tif
67766 F20101129_AAARSO rodic_n_Page_082.jpg
362081 F20101129_AAARNS rodic_n_Page_074.jp2
F20101129_AAARXN rodic_n_Page_072.tif
57912 F20101129_AAARSP rodic_n_Page_083.jpg
3520 F20101129_AAARNT rodic_n_Page_030thm.jpg
F20101129_AAARXO rodic_n_Page_073.tif
35097 F20101129_AAARSQ rodic_n_Page_084.jpg
1937 F20101129_AAARNU rodic_n_Page_011thm.jpg
F20101129_AAARXP rodic_n_Page_074.tif
35014 F20101129_AAARSR rodic_n_Page_085.jpg
23886 F20101129_AAARNV rodic_n_Page_098.QC.jpg
F20101129_AAARXQ rodic_n_Page_075.tif
67917 F20101129_AAARSS rodic_n_Page_087.jpg
6520 F20101129_AAARNW rodic_n_Page_028thm.jpg
76503 F20101129_AAARST rodic_n_Page_089.jpg
F20101129_AAARNX rodic_n_Page_063.tif
F20101129_AAARXR rodic_n_Page_076.tif
72359 F20101129_AAARSU rodic_n_Page_090.jpg
52813 F20101129_AAARNY rodic_n_Page_076.jpg
F20101129_AAARXS rodic_n_Page_077.tif
73638 F20101129_AAARSV rodic_n_Page_091.jpg
24072 F20101129_AAARLA rodic_n_Page_015.QC.jpg
55230 F20101129_AAARNZ rodic_n_Page_004.jp2
F20101129_AAARXT rodic_n_Page_080.tif
68888 F20101129_AAARSW rodic_n_Page_092.jpg
6772 F20101129_AAARLB rodic_n_Page_059thm.jpg
F20101129_AAARXU rodic_n_Page_081.tif
54616 F20101129_AAARSX rodic_n_Page_093.jpg
1368 F20101129_AAARLC rodic_n_Page_002thm.jpg
F20101129_AAARXV rodic_n_Page_082.tif
F20101129_AAARQA rodic_n_Page_039thm.jpg
73543 F20101129_AAARSY rodic_n_Page_095.jpg
21765 F20101129_AAARLD rodic_n_Page_087.QC.jpg
F20101129_AAARXW rodic_n_Page_083.tif
64424 F20101129_AAARQB rodic_n_Page_064.jp2
81608 F20101129_AAARSZ rodic_n_Page_097.jpg
6545 F20101129_AAARLE rodic_n_Page_090thm.jpg
F20101129_AAARXX rodic_n_Page_084.tif
5657 F20101129_AAARQC rodic_n_Page_044thm.jpg
416649 F20101129_AAARVA rodic_n_Page_073.jp2
F20101129_AAARXY rodic_n_Page_085.tif
F20101129_AAARQD rodic_n_Page_021.tif
23971 F20101129_AAARLF rodic_n_Page_042.QC.jpg
73099 F20101129_AAARVB rodic_n_Page_075.jp2
F20101129_AAARXZ rodic_n_Page_086.tif
F20101129_AAARQE rodic_n_Page_048.tif
22074 F20101129_AAARLG rodic_n_Page_060.QC.jpg
66323 F20101129_AAARVC rodic_n_Page_076.jp2
F20101129_AAARQF rodic_n_Page_039.tif
F20101129_AAARLH rodic_n_Page_069.tif
11907 F20101129_AAASCA rodic_n_Page_072.QC.jpg
917299 F20101129_AAARVD rodic_n_Page_079.jp2
10712 F20101129_AAARQG rodic_n_Page_084.QC.jpg
F20101129_AAARLI rodic_n_Page_061.tif
3444 F20101129_AAASCB rodic_n_Page_072thm.jpg
483804 F20101129_AAARVE rodic_n_Page_080.jp2
111015 F20101129_AAARQH UFE0011344_00001.xml
533383 F20101129_AAARLJ rodic_n_Page_066.jp2
10518 F20101129_AAASCC rodic_n_Page_073.QC.jpg
1051918 F20101129_AAARVF rodic_n_Page_082.jp2
F20101129_AAARLK rodic_n_Page_068.tif
3634 F20101129_AAASCD rodic_n_Page_073thm.jpg
1051966 F20101129_AAARVG rodic_n_Page_083.jp2
74563 F20101129_AAARLL rodic_n_Page_099.jpg
9668 F20101129_AAASCE rodic_n_Page_074.QC.jpg
418947 F20101129_AAARVH rodic_n_Page_084.jp2
78086 F20101129_AAARLM rodic_n_Page_100.jpg
2941 F20101129_AAASCF rodic_n_Page_074thm.jpg
25518 F20101129_AAARQK rodic_n_Page_001.jpg
112899 F20101129_AAARLN rodic_n_Page_026.jp2
109264 F20101129_AAARVI rodic_n_Page_090.jp2
15134 F20101129_AAASCG rodic_n_Page_075.QC.jpg
10268 F20101129_AAARQL rodic_n_Page_002.jpg
F20101129_AAARLO rodic_n_Page_098.tif
103333 F20101129_AAARVJ rodic_n_Page_092.jp2
4457 F20101129_AAASCH rodic_n_Page_075thm.jpg
11011 F20101129_AAARQM rodic_n_Page_003.jpg
83117 F20101129_AAARLP rodic_n_Page_093.jp2
366051 F20101129_AAARVK rodic_n_Page_094.jp2
15630 F20101129_AAASCI rodic_n_Page_076.QC.jpg
76922 F20101129_AAARQN rodic_n_Page_005.jpg
F20101129_AAARLQ rodic_n_Page_093.tif
104917 F20101129_AAARVL rodic_n_Page_095.jp2
4568 F20101129_AAASCJ rodic_n_Page_076thm.jpg
96408 F20101129_AAARQO rodic_n_Page_006.jpg
3270 F20101129_AAARLR rodic_n_Page_068thm.jpg
114757 F20101129_AAARVM rodic_n_Page_098.jp2
15516 F20101129_AAASCK rodic_n_Page_078.QC.jpg
17381 F20101129_AAARQP rodic_n_Page_007.jpg
30498 F20101129_AAARLS rodic_n_Page_086.jpg
107746 F20101129_AAARVN rodic_n_Page_099.jp2
5134 F20101129_AAASCL rodic_n_Page_078thm.jpg
84107 F20101129_AAARQQ rodic_n_Page_008.jpg
11921 F20101129_AAARLT rodic_n_Page_077.QC.jpg
115615 F20101129_AAARVO rodic_n_Page_100.jp2
5752 F20101129_AAASCM rodic_n_Page_079thm.jpg
40055 F20101129_AAARQR rodic_n_Page_009.jpg
7711 F20101129_AAARLU rodic_n_Page_001.QC.jpg
3419 F20101129_AAASCN rodic_n_Page_080thm.jpg
16066 F20101129_AAARQS rodic_n_Page_011.jpg
457532 F20101129_AAARLV rodic_n_Page_077.jp2
73553 F20101129_AAARVP rodic_n_Page_101.jp2
11001 F20101129_AAASCO rodic_n_Page_081.QC.jpg
75044 F20101129_AAARQT rodic_n_Page_014.jpg
45212 F20101129_AAARLW rodic_n_Page_085.jp2
F20101129_AAARVQ rodic_n_Page_002.tif
4792 F20101129_AAASCP rodic_n_Page_082thm.jpg
72338 F20101129_AAARQU rodic_n_Page_018.jpg
32944 F20101129_AAARLX rodic_n_Page_094.jpg
F20101129_AAARVR rodic_n_Page_004.tif
4074 F20101129_AAASCQ rodic_n_Page_083thm.jpg
74239 F20101129_AAARQV rodic_n_Page_019.jpg
73480 F20101129_AAARLY rodic_n_Page_024.jpg
F20101129_AAARVS rodic_n_Page_005.tif
3345 F20101129_AAASCR rodic_n_Page_085thm.jpg
69524 F20101129_AAARQW rodic_n_Page_020.jpg
F20101129_AAARLZ rodic_n_Page_036.tif
F20101129_AAARVT rodic_n_Page_006.tif
9484 F20101129_AAASCS rodic_n_Page_086.QC.jpg
70620 F20101129_AAARQX rodic_n_Page_021.jpg
F20101129_AAARVU rodic_n_Page_007.tif
3002 F20101129_AAASCT rodic_n_Page_086thm.jpg
75509 F20101129_AAARQY rodic_n_Page_023.jpg
F20101129_AAARVV rodic_n_Page_008.tif
88657 F20101129_AAAROA rodic_n_Page_010.jp2
6038 F20101129_AAASCU rodic_n_Page_087thm.jpg
75121 F20101129_AAARQZ rodic_n_Page_026.jpg
F20101129_AAARVW rodic_n_Page_010.tif
F20101129_AAAROB rodic_n_Page_097.tif
22454 F20101129_AAASCV rodic_n_Page_088.QC.jpg
F20101129_AAARVX rodic_n_Page_011.tif
F20101129_AAAROC rodic_n_Page_100.QC.jpg
6371 F20101129_AAASCW rodic_n_Page_088thm.jpg
76686 F20101129_AAARTA rodic_n_Page_098.jpg
F20101129_AAARVY rodic_n_Page_012.tif
13630 F20101129_AAAROD rodic_n_Page_065.QC.jpg
24755 F20101129_AAASCX rodic_n_Page_089.QC.jpg
52382 F20101129_AAARTB rodic_n_Page_101.jpg
F20101129_AAARVZ rodic_n_Page_013.tif
24051 F20101129_AAAROE rodic_n_Page_091.QC.jpg
6829 F20101129_AAASCY rodic_n_Page_089thm.jpg
26801 F20101129_AAARTC rodic_n_Page_102.jpg
22549 F20101129_AAAROF rodic_n_Page_050.QC.jpg
23218 F20101129_AAASCZ rodic_n_Page_090.QC.jpg
23199 F20101129_AAASAA rodic_n_Page_033.QC.jpg
F20101129_AAARYA rodic_n_Page_087.tif
25451 F20101129_AAARTD rodic_n_Page_001.jp2
6639 F20101129_AAAROG rodic_n_Page_022thm.jpg
6430 F20101129_AAASAB rodic_n_Page_033thm.jpg
F20101129_AAARYB rodic_n_Page_088.tif
5597 F20101129_AAARTE rodic_n_Page_002.jp2
6794 F20101129_AAAROH rodic_n_Page_045thm.jpg
24664 F20101129_AAASAC rodic_n_Page_034.QC.jpg
F20101129_AAARYC rodic_n_Page_089.tif
6762 F20101129_AAARTF rodic_n_Page_003.jp2
6835 F20101129_AAASAD rodic_n_Page_034thm.jpg
F20101129_AAARYD rodic_n_Page_091.tif
F20101129_AAARTG rodic_n_Page_006.jp2
111976 F20101129_AAAROI rodic_n_Page_091.jp2
24532 F20101129_AAASAE rodic_n_Page_035.QC.jpg
302798 F20101129_AAARTH rodic_n_Page_007.jp2
71628 F20101129_AAAROJ rodic_n_Page_015.jpg
F20101129_AAARYE rodic_n_Page_092.tif
6642 F20101129_AAASAF rodic_n_Page_035thm.jpg
1051852 F20101129_AAARTI rodic_n_Page_008.jp2
F20101129_AAAROK rodic_n_Page_032.tif
8423998 F20101129_AAARYF rodic_n_Page_094.tif
23448 F20101129_AAASAG rodic_n_Page_037.QC.jpg
1051939 F20101129_AAARTJ rodic_n_Page_009.jp2
15070 F20101129_AAAROL rodic_n_Page_083.QC.jpg
F20101129_AAARYG rodic_n_Page_095.tif
6614 F20101129_AAASAH rodic_n_Page_037thm.jpg
16297 F20101129_AAARTK rodic_n_Page_011.jp2
F20101129_AAAROM rodic_n_Page_047.tif
F20101129_AAARYH rodic_n_Page_096.tif
21508 F20101129_AAASAI rodic_n_Page_038.QC.jpg
94406 F20101129_AAARTL rodic_n_Page_012.jp2
40368 F20101129_AAARON rodic_n_Page_004.jpg
F20101129_AAARYI rodic_n_Page_101.tif
6010 F20101129_AAASAJ rodic_n_Page_038thm.jpg
112530 F20101129_AAARTM rodic_n_Page_013.jp2
72885 F20101129_AAAROO rodic_n_Page_042.jpg
F20101129_AAARYJ rodic_n_Page_102.tif
24312 F20101129_AAASAK rodic_n_Page_039.QC.jpg
116728 F20101129_AAAROP rodic_n_Page_046.jp2
1428729 F20101129_AAARYK rodic_n.pdf




Copyright 2005 by Nemanja Rodic


This document is dedicated to my family in Yugoslavia.


ACKNOWLEDGMENTS I first want to thank my mentor, Dr. Naohiro Terada, for his positive attitude and exemplary conduct that he maintained throughout the years. I would like to thank to all members of the Terada Laboratory. I thank Dr. Masahiro Oka, for numerous discussions and invaluable insights into critical thinking. I am grateful to Dr. Takashi Hamazaki for technical advice he provided. I thank our laboratory manager, Amy Meacham, for frequent help she provided. I thank to my friends and fellow graduate students Amar Singh, Michaeal Rutenberg, and Sarah Kehoe, for providing me with many suggestions and help through the years. I would also like to acknowledge Dr. Bungert, Dr. Petersen, Dr. Resnick, Dr. Oh, and Dr.Yang along with their respective laboratory members for sharing their knowledge and technical advice. Finally, I am grateful to my wife, Dr. Keisha-Gay Hylton Rodi, for her love and care. iv


TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................iv LIST OF TABLES ............................................................................................................vii LIST OF FIGURES .........................................................................................................viii ABSTRACT .........................................................................................................................x CHAPTER 1 INTRODUCTION........................................................................................................1 Epigenetics....................................................................................................................1 DNA Methylation in Development..............................................................................2 Epigenetic Studies in ES Cells.....................................................................................3 CpG Islands..................................................................................................................4 DNA Methylation Patterns...........................................................................................6 DNA Methylation of Tissue-Specific Genes.........................................................6 DNA Methylation in Cancer.................................................................................8 DNA Methylation Associated Factors..........................................................................9 DNA Methyltransferases.....................................................................................10 DNA Methylation Associated Proteins...............................................................12 Chromatin Related Modification and Chromatin Imposed Boundaries.....................13 De Novo DNA Methylation........................................................................................14 Drugs That Affect DNA Methylation.........................................................................15 Nutrients That Affect DNA Methylation....................................................................16 Additional Comments.................................................................................................16 Study Design and Rationale........................................................................................17 2 METHODS AND MATERIALS...............................................................................20 In Vitro ES Cell Differentiation..................................................................................20 Methylation Sensitive Restriction Fingerprinting (MSRF)........................................20 MSRF Cloning and Sequencing.................................................................................21 5'RACE.......................................................................................................................22 Construction and in vitro Methylation of Reporter Vectors.......................................22 Chromatin Immunoprecipitation................................................................................23 FLAG Tagget Ant4 Protein Overexpression..............................................................25 Untagged Ant4 Protein Overexpression.....................................................................25 v


Western Blotting.........................................................................................................26 Immunohistochemistry...............................................................................................26 Bisulfite Sequencing and Combined Bisulfite Restriction Analysis (COBRA).........27 Reverse Transcriptase Polymerase Chain Reaction (RT-PCR)..................................28 Northern Blotting........................................................................................................29 In situ RNA Hybridization..........................................................................................29 Immunostaining for Ant4...........................................................................................30 Primordial Germ Cell Preparation..............................................................................31 Targeted Disruption of Mouse Ant4 gene...................................................................31 3 RESULTS...................................................................................................................33 Introduction.................................................................................................................33 Identification of Differentially Methylated Genomic Regions...................................34 A Survey of DNA Methylation Screeing Methods.............................................34 Methylation Sensitive Restriction Fingerprinting (MSRF) Method...................35 Identification of DNA Methylation Controlled Genes........................................37 Identification of a Novel ES and Germ Cell-Specific Gene Using the MSRF Method...................................................................................................................40 RIKENcDNA 1700034J06 Computational Analysis..................................................41 5RACE......................................................................................................................42 Ant4 Promoter Transcription is Inhibited by DNA Methylation................................43 Ant4 Genomic Locus Undergoes Epigenetic Restructuring During ES cell Differentiation........................................................................................................45 Semi-quantitative RT-PCR Analysis of the Ant4 Transcript During ES cells Differentiation........................................................................................................46 5-aza-dC Treatment Reactivates Ant4 Transcript Expression....................................47 Dnmt3 Activity Is Required for Ant4 Repression.......................................................47 Ant4 is a Germ Cell-specific Gene.............................................................................48 Ant4 Promoter DNA Methylation in Normal Adult Organs.......................................50 4 DISCUSSION.............................................................................................................76 On Newly Identified Differentially Methylated Genomic Regions...........................76 On Newly Identified DNA Methylation Controlled Genes........................................77 On the Link Between DNA Methylation and Germ-specific Genes..........................78 On the Newly Identified Adenine Nucleotide Translocase, Ant4...............................80 LIST OF REFERENCES...................................................................................................84 BIOGRAPHICAL SKETCH.............................................................................................91 vi


LIST OF TABLES Table page 1-1 Molecular mechanisms of de novo DNA methylation............................................19 3-1 Characteristics of MSRF derived differentially methylated fragments in ES differentiation model................................................................................................53 vii


LIST OF FIGURES Figure page 3-1 Morphology of ES cells and methylation sensitive restriction fingerprinting (MSRF) method outline...........................................................................................52 3-2 RT-PCR analyses of levels of RIKENcDNA 1700034J06, Viaat, Nr4A1, AK005608, and -actin transcripts during ES cell differentiation...........................54 3-3 Germ cell-specific genes are repressed by DNA methylation during ES cells differentiation...........................................................................................................55 3-4 Germ cell-specific genes are repressed by DNA in NIH3T3 somatic cell line........56 3-5 Germ cell-specific promoters are repressed by DNA methylation during ES cell differentiation...........................................................................................................57 3-6 Identification of differentially methylated CpG-rich fragment in ES cells and EBs...........................................................................................................................58 3-7 MF1 genomic localization. MF1 nucleotide sequence is identical to exon 1/intron 1 boundry region of a previously unknown sequence, RIKEN cDNA 1700034J06..............................................................................................................59 3-8 RIKEN cDNA 1700034J06 encodes Ant4, a novel isoform of adenine nucleotide translocase..............................................................................................60 3-9 Transcription initiation site of the Ant4 gene determination using 5RACE sequencing................................................................................................................61 3-10 Analysis of Ant4 promoter activity by a luciferase reporter assay in R1 ES and NIH3T3 cells............................................................................................................62 3-11 Promoter hypermethylation silences expression of Ant4. Analysis of Ant4 promoter activity by a luciferase reporter assays in R1 ES cells.............................63 3-12 Ant4 promoter region is hypomethyated in undifferentiated ES cells.....................64 3-13 Ant4 promoter region undergoes DNA methylation in differentiated EB cells.......65 3-14 Ant4 promoter region undergoes covalent histone 3 changes during ES cell differentiation...........................................................................................................66 viii


3-15 Ant4 is repressed by DNA methylation during ES cell differentiation....................67 3-16 Dnmt3 is required for Ant4 repression during ES cell differentiation.....................68 3-17 Dnmt3 is required for Ant4 repression during ES cell differentiation.....................69 3-18 Ant4 is expressed selectively in testis......................................................................70 3-19 Localization of Ant4 demonstrated by in situ hybridization....................................71 3-20 Ant4 is expressed in male and female germ cells....................................................72 3-21 Ant4 is expressed in primordial germ cells..............................................................73 3-22 Bisulfite analysis of the Ant4 promoter in various organs from adult mice.............74 3-23 COBRA analysis of the Ant4 promoter for DNA methylation levels in various adult mice organs.....................................................................................................75 4-1 Disruption of Ant4....................................................................................................83 ix


Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy IDENTIFICATION AND INITIAL CHARACTERIZATION OF GENES CONTROLLED BY DNA METHYLATION IN EMBRYONIC STEM CELLS By Nemanja Rodi August 2005 Chair: Naohiro Terada Major Department: Molecular Cell Biology (IDP) Capacity for cellular differentiation is governed by the repertoire of available transcription factors and by the accessibility of cis-regulatory elements. Studying changes in epigenetic modifications during stem cell differentiation will help us to understand how cells maintain or lose differentiation potentials. I have investigated changes in DNA methylation during pluripotent embryonic stem (ES) cell transitions into differentiated cell types. Using a methylation-sensitive restriction fingerprinting method, I identified a novel adenine nucleotide translocase gene (Ant4) that was selectively hypomethylated and expressed in undifferentiated ES cells. In contrast to other pluripotent stem cell-specific genes, Oct4 and Nanog, repression of the Ant4 gene during ES cell differentiation was dependent on functional Dnmt3 expression. Additionally, 5-aza-2'-deoxycytidine readily up-regulates the Ant4 gene but not the Oct4 or Nanog gene in differentiated cells. These resu lts indicate that DNA methylati on plays a primary role in the transcriptional silencing of Ant4 during stem cell differentiation. While the deduced x


amino acid sequence of Ant4 is highly homologous to the previously identified Ant isoforms, Ant1 and Ant2, the expression of Ant4 and its promoter hypomethylation were uniquely restricted to germ cells in adult mice. xi


CHAPTER 1 INTRODUCTION Epigenetics During the early period of molecular biology studies spanning the 1930s to the 1960s, epigenetic phenomena were thought of as a form of heredity independent of the nucleus. The term epigenetics, originally coined by Waddington in 1942 (1,2), referred to a process whereby the genome gives rise to the phenotype. Such a broad definition of epigenetics would include many processes that by todays standards are not considered epigenetic. These include T-cell rearrangement, bacterial conjugation, prion-like phenomenon, and monocellular morphological heredity. With the proposition of the operon model by Monod and Jacob, the concept of a genetic program of development became available. It is with such notion of restricted cellular potency that the modern definition of epigenetics came to existance as a study of mitotically heritable gene function that cannot be explained by DNA sequence alone. Today we consider eukaryotic gene transcription as a process that requires a competent genomic DNA sequence, availability of transcription factors, and a permissive state of the chromatin. If the surrounding chromatin state, such as CpG dinucleotide DNA methylation or covalent histone modifications (histone code), is faithfully propagated through cell division, then such regulation is called an epigenetic gene regulation. DNA methylation is the most widely studied epigenetic program. DNA methylation contributes to numerous processes, both physiological and pathological in nature. The wave of genome wide de novo methylation during early embryonic 1


2 development, imprinting of differentially methylated regions during gametogenesis, and DNA methylation associated with aging and cancer are all examples of how widely the epigenetic process influences cell fate. DNA methlyation was first studied as a prototypic prokaryotic immune program, restriction-modification system, targeted against bacteriophage infection (2,3). Shortly after, the involvement of DNA methylation in eukaryotic gene expression became evident during both gene silencing and X-chromosome inactivation (4). The DNA methylation within mammalian somatic nuclei occurs mostly within the context of CpG dinucleotide sequences. However, low levels of CpA dinucleotide methylation have also been reported (5-7). A 5-methyl cytosine group constitutes anywhere from 1 to 9% of all cytosine residues within a normal eukaryotic nuclei (2). In mammals, DNA methylation patterns of both single copy and repetitive regions are propagated with high fidelity in a tissue specific manner and are highly evolutionary conserved (2). DNA Methylation in Development Gene expression changes are part of concerted cellular programs, restricted in a temporal and spatial manner. We know of several well-characterized instances in which epigenetic phenomena, mostly DNA methylation, play a decisive role during cellular differentiation. On an organism level, the Jaenisch group found that normal mouse development requires the activity of DNA methyltransferase (Dnmt) Dnmt1, Dnmt3a, and Dnmt3b methyltransferase genes (8-10). In the absence of these genes, embryonic lethality ensues. On a tissue-restricted level, it is known that mesenchymal cell line 10T1/2 commitment toward myogenic differentiation is controlled by demethylation of the myogenic determination (MyoD) promoter region (11). Differentiation of other cell types, such as primordial germ cells, has also been found to be controlled by DNA


3 methylation (12). An early embryo undergoes genome wide demethylation prior to implantation. However, after implantation most of the non-imprinted genes in the embryo proper undergo a high degree of a genome wide de novo methylation around embryonic day 6 (E 6). Interestingly, extraembryonic lineages (yolk sac, placenta) undergo genome wide demethylation following differentiation (13). Some genes, such as octamer binding protein (POU5F1/Oct4), a well studied transcription factor essential for early embryonic development, undergo delayed de novo methylation, around embryonic day E 6.5 (14). Primordial germ cells undergo genome wide demethylation by embryonic day E 9.5, which erases DNA methylation imprints (15,16). A subset of genes undergo parental specific methylation in migrating primordial germ cells, which ensures there will be a regulated pattern of expression of these genes in the developing embryo. Epigenetic Studies in ES Cells Embryonic stem (ES) cells are pluripotent cells derived from the inner cell mass of a E 3.5 embryo blastocyst. ES cells indefinitely expand in vitro under appropriate culturing conditions. When grown in the presence of leukemia inhibitory factor (LIF), mouse ES cells undergo cell proliferation and retain their ability to contribute to all chimeric mouse cell lineages. In the absence of LIF, ES cells undergo molecular, phenotypic, and functional differentiation dependent changes, which are considered to recapitulate the early processes of mammalian development. This in vitro ES cell differentiation system has served as an excellent model to study transcription factors required for stem cell self-renewal and pluripotency (17-19). Recent studies have begun revealing that pluripotent ES cells have a unique expression pattern of Dnmts and methyl-binding proteins (MBPs) (10) and have a differential loci specific DNA methylation pattern when compared to their descendant differentiated cells


4 (20,21). Additionally, trophoblast stem cells also have differential DNA methylation patterns relative to trophoblast derived differentiated cells (20,22). However, due to technical limitations, the exact genomic positions of such differentially methylated regions are yet to be determined. Judging by a nearest-neighbor analysis of ES and ES-derived differentiated cells, there are no genome wide changes in the overall levels of DNA methylation during ES cell differentiation (23). Epigenetic state of ES cells is unusually unstable, as evidenced by variation in imprinted gene expression and DNA methylation of imprinting centers (ICs) loci (24). An in vitro growth of ES cells is not affected by loss of genome wide DNA methylation; however the ability of ES cells to form teratocarcinomas in vivo is severely diminished in the absence of DNA methylation activity. Finally, the ability of ES cells to undergo differentiation into multiple lineages in vitro is nearly abolished in the absence of DNA methylation. In conclusion, while DNA methylation seems dispensable for ES cell maintenance, DNA methylation is required for both in vitro and in vivo ES cell differentiation. CpG Islands The term CpG island was coined in the late 1970s after a characteristic appearance of DNA restriction fragment on an agarose gel. The Bird group first detected such islands of DNA with an average size of 1kb when genomic DNA from a variety of vertebrates was digested with HpaII and HhaI restriction enzymes (2). Such regions were later found to represent non-repetitive DNA segments. Today, we know that more than half of all genes in the mouse genome contain CpG islands in their respective 5'end region. A CpG island is a genomic sequence that satisfies three factors: (i) at least 200bp in length, (ii) >50% sequence containing cytosine and guanine nucleotides, and (iii)


5 observed/expected CpG content of >0.6. However, it is imperative to remember that on a genome wide scale, the majority of available CpG dinucleotides are present within the context of highly repetitive sequences. In fact, more than half of all methylcytosines are present in satellite DNA (2). There is an appreciable amount of tissue variation in satellite DNA methylation. For instance, in premeiotic spermatogonial cells, both major and minor satellites are undermethylated relative to somatic cells. Such undermethylation is thought to play a role in pairing and recombination (2). Changes in gene specific and genome wide DNA methylation are referred to as de novo DNA methylation events. In vertebrate organisms, DNA methylation is observed in CpG island regions as well as on a genome wide basis. Genome wide methylation is a vertebrate characteristic, and it is not observed in invertebrate organisms. However, gene specific methylation preceds the invertebrate to vertebrate boundary, suggesting that it might be an evolutionary more conserved mechanism of gene control (25). A CpG island is an important factor that participates in the regulation of de novo methylation. CpG islands have been proposed to contain functionally important CpG sites within a DNA sequence, such that they might present unique molecular targets for trans-acting factors (26). Supporting this model is the work from the Grummt group concerning the DNA methylation dependent repression of ribosomal genes in mammalian cells. Santoro and Grummt provided clear evidence supporting the existence of critical CpG residues in ribosomal promoter regions (27). Furthermore, specific methylation of such critical CpG sites is required and necessary for transcriptional repression of ribosomal genes. Additionally, methylation of CpA sequences has been proposed to potentially serve as a target of de novo methyltransferase activity and proceeds


6 methylation of entire CpG islands (7). Methylation density also plays a decisive role in the maintenance of transcriptional repression in a given genomic locus. Partially methylated viral constructs do not repress reporter gene transcription as well as fully methylated constructs (28). Finally, certain CpG islands from highly expressed genes, such as the adenine phosphoribosyltransferase (APRT) gene, can protect neighboring flanking DNA sequences from differentiation induced methylation (29,30). DNA Methylation Patterns Historically, DNA methylation has been studied as a developmental program that controls the expression of endogenous genes, and has been shown to be an important factor in transcriptional repression of numerous retroviral sequences. DNA methylation has been implicated as a dominant factor in chromatin condensation during development (31). An in vitro methylated DNA fragments is maintained through subsequent mitosis, with a repressed chromatin state and a repressive histone code faithfully propagated (32). Methylation induced blockage of transcription is most likely mediated by blocking the RNA polymerase initiation step (32). DNA Methylation of Tissue-Specific Genes DNA methylation is a part of repressive transcription complexes that control multiple genomic loci. One group of such loci are tissue-specific genes. For instance, neuroepithelial cell differentiation into astrocytes is precluded by DNA methylation of an important cell differentiation gene marker, glial fibrillary acidic protein (GFAP) (33). GFAP promoter methylation increases during differentiation, which prohibits the transcription factor, signal transducer and activator of transcription 3 (STAT3), from binding. This results in transcriptional repression of GFAP. Another tissue-specific model devised by the Rosenfeld group provides insight into how neuronal-specific genes


7 are repressed in non-neuronal cell types. DNA methylation, as well as histone deacetylation, represses specific target genes by recruiting additional repressor factors. One such repressor factor, neuron-restrictive silencer factor (NSRF), binds target promoter regions and represses neuronal gene expression in non neuronal tissues in vivo (34). Repressor molecules can provide molecular platforms to allow binding of multiple heterochromatic factors, such as heterochromatin protein 1 (HP1) and Dnmts. However, repressor molecules can associate with a wide range of functionally distinct molecular complexes depending on the state of differentiation. Harter and Mal show that the MyoD transcription factor complexes with histone acetyl transferase (HAT) and histone de-acetylase (HDAC), in myoblasts and myotubes, respectively (35). DNA methylation also regulates Oct4 in somatic cells in a methylation-dependent manner (36). This methylation is a trans-factor dependent process in which repression is mediated at the transcription level, and absence of methylation is correlated with high expression of the Oct4 transcript. A region in 5'proximity of the Oct4 transcription start site, the so called proximal enhancer region, was implicated as a cis-acting factor necessary for Oct4 locus demethylation in Oct4 expressing cells (14). Additionally, the homeobox (Hox) genes, a set of genes important in axial patterning, are transcriptionally inactivated in certain somatic organs. The Hox genes exhibit tissue specific expression, deregulation in malignant cells, and transcriptional downregulation in embryogenesis The HoxA5 gene is transcriptionally inactivated in somatic cells, as is the whole neighboring locus spanning ~25kb (37). DNA methylation in germ cells represents another important topic in differentiation-dependent methylation. DNA methylation is a critical factor involved in


8 the propagation of imprints (38), and has been used widely as an imprinting status marker in numerous studies. General chromatin factors such as DNA methyltransferase proteins Dnmt3a and Dnmt3L were found to be essential in the establishment of maternally derived imprints (39). Other locus specific factors, such as the zinc finger containing protein (CTCF), were found to be essential for the activity of certain ICs, such as the IC for Igf2 and the H19 imprinting locus (40). Imprinting might not be the only target of DNA methylation in germ cells. It also appears that DNA methylation can dominantly control the cell-intrinsic program of differentiation from primordial germ cell derivatives into post migratory germ cells (12). As such, DNA methylation is implicated as being part of an intrinsic cellular memory mechanism, controlling cellular differentiation without extracellular instructions. DNA Methylation in Cancer It is widely accepted that the alteration of chromatin structure is one of the hallmarks of cancerous cells. The Dnmt1 is known to increase in activity in the latter stages of cancer progression, and is thought to be responsible in part for the genome wide de novo methylation that is commonly found in cancer (41). It is also known that Dnmt1 is transcriptionally upregulated by c-fos, and that this up-regulation might be responsible for at least a part of the methylation changes seen in early transformation. Dnmt1 up-regulation is followed by a genome wide de novo wave of methylation, and it is required for the transforming ability of the proto oncogene (c-fos) gene (41). However, the opposite effect of DNA methylation, that is, genome wide hypomethylation, is another hallmark of cancer. A recent study by the Jaenisch group points out that the Dnmt1 hypomorphic expression can cause a genome wide hypomethylation that in turns leads to an increase in chromosomal breaks (42). This crucial finding points out that DNA


9 methylation is not only associated with cancer, but that DNA methylation alterations are actually involved in cancer initiation and progression. Histone modifying factors, such as histone deacetylase and methylase activities, are commonly found in promoter regions of aberrantly regulated genes involved in carcinogenesis (43). Numerous target genes undergo de novo methylation/demethyaltion events during tumorigenesis. Numerous genes involved in diverse cellular processes such as: cell cycle regulation (p16, p21), metabolism (asparagine synthetase), differentiation (AML-RAR, pinin), and adhesion (E-catherin) are commonly affected by methylation-dependent changes in human cancer. This suggests that methylation plays an important role in cancer (44). Cancer-related de novo DNA methylation is thought to require cell division. For instance, methylation of the tumor suppressor p16 can only take place when cells are progressing through the cell cycle (45). Nevertheless, the basic question of how de novo methylation targets a specific gene locus is still poorly understood. An important mechanistic study by the Pelicci group proposed a mechanism for locus specific DNA methylation, wherby transforming fusion transcription factor PML-RAR can bring about de novo methylation to a targeting locus by interacting with Dnmt1 and Dnmt3a proteins (46). DNA Methylation Associated Factors Mammalian DNA methylation is achieved by a family of conserved eukaryotic Dnmts 1-3, which contains a C-terminal methyl-cytosine transferase active domain. It has been difficult to determine the exact DNA methyltransferases responsible for de novo DNA methylation. This is most likely due to the synergistic nature and functional overlap of known Dnmts. For instance, the Li group showed that de novo DNA


10 methylation of exogenous MMLV viral sequences requires both Dnmt3a and Dnmt3b enzyme activity (10). DNA Methyltransferases The Dnmt1 gene product is believed to be responsible for the majority of methylation maintenance, which is the activity that propagates preexisting methylation patterns following cell division. The Dnmt1 null murine embryonic stem (ES) cells retain the ability to de novo methylate integrated virus sequences, indicating that de novo machinery can operate even in the absence of Dnmt1 protein (10). The Dnmt1 transcript increases in the G1/S boundary and during S phase of the cell cycle (47). In fact, this may partially delineate mechanisms leading to hypermethylation during neoplasia. The Dnmt1 might be regulated by polyadenosine diphosphate-ribose polymerase (PARP), which regulates Dnmt1's association with proliferating cell nuclear antigen (PCNA) (47). Dnmt1 also binds, through its N-terminal domain, to HDAC2 and DNA methyltransferase associated protein 1 (DMAP1). This association implicates Dnmt1 activity in not only the maintenance of pre-existing methylation patterns, but also in the formation of new transcriptionally inactive chromatin (48). The Dnmt3b gene appears to be an important co-operator that modulates DNA methylation alongside Dnmt1. In Dnmt1 and 3b double null cells centromeric satellite sequences, imprinted genes, and tumor suppressor genes all suffer nearly a complete loss of methylation (49). This loss of methylation is associated with a severe loss in cell growth. Again, functional overlap with other chromatin factors is illustrated by the fact that human colon cancer Dnmt1 null cells largely retain normal methylation patterns. In Dnmt1 null cells centromeric satellite repeats undergo demethylation; however, gene specific methylation remains unaffected (50).


11 Other Dnmts include Dnmt3a, Dnmt3b, Dnmt3L, and Dnmt2. Both Dnmt3a and Dnmt3b are expressed in ES cells; they both undergo a decrease in expression after differentiation. Both Dnmts are expressed at low levels in adult tissues. Dnmt3a and Dnmt3b are thought to be responsible for de novo methylation, as genomic disruption of these genes causes a loss of de novo methylation at proviral sequences in ES cells (51). More specifically, a loss of Dnmt3a and Dnmt3b in double null ES cells leads to a loss of methylation in the Igf2 and Xist genes (51). There also exist two additional Dnmt3a isoforms, Dnmt3aand Dnmt3a2, in murine ES cells. Both of these proteins lack the N-terminal domain of the Dnmt3a isoform. The Dnmt3a2 isoform is produced by an internal intronic promoter (52). Since Dnmt3a2 is localized in euchromatin, and is expressed in both physiological settings, such as mouse ES cells, and in pathological settings, such as breast and ovarian cancer cell lines, it is possible that Dnmt3a2 may be responsible for de novo methylation (52). The Dnmt3aisoform is highly expressed in ES cells and is expressed at lower levels in adult tissues (53). Also, Dnmt3a was shown to methylate DNA in a distributive manner, which is a characteristic of de novo methylase activity (54). A cooperation between Dnmt3a, Dnmt3b and Dnmt1 is illustrated by the Jones group, where Dnmt3a and Dnmt3b double null ES cells and Dnmt1 null ES cells were used to study novel hypomethylated genomic targets. Mouse LINE-1 promoters were found to be extensively hypomethylated in all null ES cells (55). Also, these investigators showed that Dnmt1 could not methylate certain target genes in the absence of Dnmt3a and Dnmt3b proteins. An additional Dnmt enzyme, Dnmt3L, is known to be a catalytically inactive Dnmt-like protein. Furthermore, Dnmt3L binds to other Dnmts to modulate maternal imprinting (39) and is exclusively expressed in ES


12 cells and testis (56). Also, Dnmt3L contains a zinc finger region, which is thought to modify protein DNA interactions (56). Genomic deletion of Dnmt3L exhibit maternal infertility, with a loss of imprinting in maternally imprinted genes (57). The significance of this finding lies in the fact that Dnmt3L knockout studies led, for the first time, to sequence-specific DNA methylation changes. To date, Dnmt3L is the only known gene to selectively influence locus-specific methylation in vivo (57). Cooperation between Dnmt3L and Dnmt3a has been implicated in genome wide methylation, which includes ICs and endogenous repetitive sequence methylation (58). Lastly, Dnmt3L did not synergize with the Dnmt3b enzyme in de novo methylation of small nucleolar RNAs (SNRPN) IC region (58). DNA Methylation Associated Proteins Heterochromatin-related proteins are thought to be important in the maintenance of a repressive epigenetic code, that is in translating DNA methylation as an actual repressive message. Methyl-binding proteins (MBPs) complexed with multiple protein factors can recognize methylated DNA as a molecular binding platform. The methyl-CpG-binding protein 2 (MeCP2) and the HDAC complex were first precipitated together in extracts from frog embryos; this finding paved the way for an understanding of molecular synergy between DNA methylation and histone modifications (59). However, MBPs have also been implicated in binding transcriptional activators. For instance, MBP interacting protein (MBPin) was found to relieve MeCP2 transcriptional repression (60). Interestingly, this relief from transcriptional repression comes without any loss of methylated CpG bases. Another major repressor molecule is heterochromatin protein 1 (HP1), initially identified as a protein responsible for position effect variegation (PEV) in mice (61). The PEV refers to a chromosomal context dependent expression of a


13 transgene. The HP1 family of genes consists of three isoforms, each has distinct nuclear localization and numerous genomic targets. Isoforms are known to interact and also antagonize between distinct target genes. For instance, asparagine synthetase is known to be repressed by HP1and HPoverexpression, but is enhanced when HP1is selectively overexpressed (62). Chromatin Related Modification and Chromatin Imposed Boundaries Differentiation-dependant methylation could conceivably be signal dependent as many cell-to-cell signaling occurs during differentiation. Current thinking is that reversible covalent modification largely affects the histone code, which in turn creates alternative chromatin states. One recent finding points to a novel histone kinase protein, which dominantly up-regulates inositol responsive gene (INO) transcription in response to a lack of inositol in the feeding media. These investigators show that the kinase acts upstream and in conjunction with histone acetylation (63). Since DNA methylation is assumed to be a genome wide epigenetic regulatory mechanism, scientists have focused on the identification of cis-acting boundary element factors that might separate differentially regulated chromosomal regions. Studies in budding yeast provided some of the most complete data with respect to this question. The Grewal group described the existence of a heterochromatic epigenetic code across a mating type locus region spanning around 20kb of DNA. Heterochromatin is separated by inverted repeat DNA elements, which serve as boundary elements between euchromatin and heterochromatin. Heterochromatin contains highly methylated histones across the entire region. Also, the same investigators showed that the histone modification was carried out by the heterochromatin protein homolog (Swi6) protein (64). Heterochromatin initiation was also found to depend on RNAi machinery (65).


14 Studies in yeast thus defined basic concepts of heterochromatin initiation and spreading. Other loci are implicated in organizing chromatin into functional segments. For instance, tissue-specific heterochromatic proteins are also involved in the silencing of targeted genes in their given cell populations. The nuclear matrix association region-binding protein (SATB1) is a thymocyte-specific nuclear protein, which is distributed through thymocytes' heterochromatin where it is required for both silencing and activation of target genes (66). De Novo DNA Methylation The molecular mechanism of de novo DNA methylation is not entirely clear. Practically, this means that although we know of proteins responsible for de novo DNA methylation, namely Dnmt3a and Dnmt3b, we have little knowledge as to how these molecules are selectively recruited to distinct genomic sites in vivo (Table 1-1). During the past five years, two proposed models have gained grounds. The first model was originally proposed by the Pelicci group (Table 1-1). This so called recruitment model proposes that DNA methyltransferases are recruited to selective genomic loci by the action of sequence-specific transcription factors (46). Supporting this model is the study by the Kohn group, where reporter gene DNA methylation-dependent repression can be relieved by point mutations that disrupt repressor transcription factor binding or by the creation of binding sites for transcription activators (67). The Pelicci group showed that a fusion generated an aberant PML-RAR transcription factor that is responsible for the recruitment of DNA methyltranferase proteins to targeted promoters (46). Recently, this same group reported that the well-known transcription factor (c-myc), also recruits DNA methyltransferase to target gene promoters. The interaction with DNA methyltransferases is critical in c-myc mediated


15 repression of the p21 promoter, and is also necessary for c-myc mediated cellular transformation (68). In support of this model, recent data points out that small interfering RNAs (siRNAs), mediated transcriptional repression in human cells operates by recruiting de novo DNA methlyation to target promoters (69,70). The protection model, postulates that genomic region undergoes de novo DNA methylation in the absence of protection from transcription factors (Table 1-1). Such a model does not require the existence of proper de novo activity, since DNA methylation maintenance activity could be responsible for all DNA methylation events. In support of this model, the Hsiesh group provided evidence that DNA methylation of the Lac operon occurs in the absence of transcription. Independent study into molecular mechanisms of imprinting within H19/Igf2 IC also support protection model (71). The Bartolomei group provided evidence that CCCTC-binding factor (CTCF) protects the maternal allele from constitutive action of Dnmts, thereby acting as a protection molecule (72). Consistent with this idea, the Karlsson group showed that lentivirus proviral sequences are more resistant to differentiation-dependent repression when transcriptional activator, stimulatory protein 1 (Sp1), binding site is introduced into the promoter region (73). Finally, it is entirely possible that there could be several de novo DNA methlyation mechanisms, each operating independently and requiring distinct molecules. Drugs That Affect DNA Methylation Historically, one of the most frequently used drugs for disrupting DNA methylation has been 5-aza-2'-deoxycytidine (5-aza-dC). This 5-aza-dC drug is a nucleotide analog and has multiple effects on both DNA and RNA metabolism; however, its effect on disruption of genomic DNA methylation patterns is mediated through covalent trapping of DNA methyltransferase proteins (74). It is important to note that human Dnmt1 null


16 and Dnmt 3 double null cells exhibit sensitivity to 5-aza-dC, even though their genomes are virtually devoid of any detectable methylated cytidines (49). A molecule with opposing effects, S-adenosyl methionine (SAM) has been used to increase genome wide DNA methylation by providing ample methyl groups in cells. The SAM molecule can also be used to delay genome wide demethylation processes (75). Nutrients That Affect DNA Methylation A lack of numerous molecules, mainly SAM and folate, has been causally related to genomic wide hypomethylation. A low availability of these nutrients can serve as an initiator for localized disruption of DNA methylation (76). Also, deficiencies of zinc and selenium can lead to genome wide hypomethylation and a greater incidence of cancer (77). Gene-to-nutrient interactions have been documented for methylenetetrahydrofolate reductase (MRHF), an enzyme important in methyl group metabolism. This gene has been associated with a loss-of-activity point mutation that leads to inadequate levels of methyl groups and an elevation of blood homocysteine levels. Furthermore, MTHF mutations are implicated in numerous pathological processes such as carcinogenesis, netural tube defects, cardiovascular diseases, and colorectal cancer (76). Additional Comments Changes in DNA methylation during cellular differentiation and even cellular transformation towards cancer has been recognized for nearly two decades (78). DNA methylation is a heritable and stable form of epigenetic modification that is used in the reprogramming of germ cells and in a developing embryo. In fact, one of the major issues in reprogramming somatic cells towards pluripotency is a genome wide DNA methylation instability (79).


17 Still, little is known as to how such genome wide changes occur. Currently it is suggested that epigenetic inheritence is maintained by the histone code, an array of post-translation modifications of histone molecules (80). DNA methylation is a dominant factor involved in the formation and propagation of heterochromatin, a condensed form of chromatin. Characteristics of heterochromatin include histone hypoacetylation and methylation (81). The causality between two forms of epigenetic memory, DNA methylation and histone modification, remains to be determined. Experiments indicate the presence of either independent or combined pathways of heterochromatin formation (34,81). A more complete understanding of the genomic targets of such epigenetic machineries will help to elucidate the pathways by which DNA methylation exerts its role on cellular differentiation. Study Design and Rationale An in vitro ES cell differentiation model has served as an invaluable tool in studies of early development. During differentiation, ES cells can give rise to multiple cell lineages, which can be purified and used for transplantation studies or functional analysis. Such developmental plasticity is thought to depend, at least in part, on the unique epigenetic state of ES cells. Thus far, little is known about the molecular targets of such ES-derived epigenetic machinery. To that end, we tried to identify genomic regions that are the targets of ES associated DNA methylation activities. Using a methylation sensitive restriction fingerprinting (MSRF) method, we identified 10 unique genomic loci, which undergo ES cell differentiation dependent DNA methylation. In the second portion of our study, we focused our attention on a single genomic locus corresponding to a newly identified gene, adenine nucleotide translocase 4 (Ant4). We showed that DNA methylation plays a


18 primary role in Ant4 regulation, both in an ES cell differentiation model and in an adult animal model. In conclusion, the overall goal of our study was to identify genomic targets of ES cell associated epigenetic machinery, mainly DNA methylation. The knowledge of such genomic targets would broaden our understanding concerning the unique epigenetic state of ES cells (82).


19 Table1-1 Molecular mechanisms of de novo DNA methylation Recruitment Model (via) c-mycFuks et al., 2005 siRNATaira & Kawasaki, 2004 PRL-RARPellici et al., 2002 PWWP domainLi et al., 2004 Dnmt3LLi et al., 2002 NSRF/RESTRosenfeld et al., 2002Protection Model (via) Lac RepressorHsieh et al., 2001 Promoter activityBoon et al., 2004 CTCFBartolomei et al., 2004


CHAPTER 2 METHODS AND MATERIALS In Vitro ES Cell Differentiation ES cells (R1, J1, Dnmt3a Dnmt3b double null) were maintained on a gelatin-coated dish in ES maintenance medium containing 1000 U/ml recombinant mouse LIF (ESGRO; Chemicon International, Temecula, CA) as described previously (83). ES cells were differentiated using a hanging drop method. Briefly, ES cells were trypsinized, washed twice with ES differentiation medium and suspended in the same medium at a concentration of 100 cells/ml. Approximately fifty drops were plated on the lid of a 10 cm petri dish and cultured as hanging drops. After 72 hours, 25 drops containing embryoid bodies (EBs) were collected and cultured in a 6-well plate. Media was then replaced every other day. ES differentiation medium consists of Iscove's modified Dulbecco's medium (Invitrogen, Carlsbad, CA), 20% fetal calf serum, 2 mM L-glutamine, 100 U/ml penicillin, 100 g/ml streptomycin (Invitrogen), 300 M monothioglycerol. Methylation Sensitive Restriction Fingerprinting (MSRF) The MSRF method was performed according to the original method established by the Huang group (84). Briefly, ES cells and EBs were harvested by gentle cell scraping followed by a 5 minute centrifugation in a bench-top centrifuge. Genomic DNA was extracted using Wizard Genomic DNA Purification Kit (Promega, Madison, WI). Extracted DNA was digested with a methylation-insensitive restriction enzyme, MseI, either by itself or in combination with a methylation-sensitive restriction enzyme, BstUI, 20


21 at 10 units / 1 mg of DNA for each enzyme. Digestion with BstUI was performed for 2 hours at 60C, followed by overnight incubation with MseI at 37C. The PCR reaction was performed in 20 l reaction mixtures containing 2 l of digested DNA (50 -100 ng), 0.4 M primers, 1.25 U of HotMasterTaq DNA polymerase (Eppendorf, Hamburg Germany), 200 M deoxynucleotide triphosphates, 1 mCi/l [a-32P] dCTP (3000 Ci/mmol, Amersham, Piscataway, NJ), and 2 l of 10X reaction buffer. The primers were the following: Bs-1 5'-AGCGGCCGCG-3', Bs-2 5'-GCCCCCGCGA-3', Bs-3 5'-CGGGGCGCGA-3', and Bs-4 5'-ACCCCACCCG-3'. Following mixing of PCR reagents, samples were overlayered with mineral oil. The PCR reaction consisted of initial denaturation step for 5 minutes at 94C. Following thirty cycles were made up of denaturation for 2 minutes at 94C, annealing for 1 minute at 40C and extention for 2 minutes at 72C. The final extention step lasted for 8 minutes. After PCR amplification, 5 liters of each sample was mixed with 1 liter of 6X loading dye solution. 2.5 liters duplicates of each sample were loaded using extrafine ("sequencing type") gel tips. A 4.5 % non-denaturing polyacrylamide gel with sharktooth combs to separate each loading lane were used. Sequencing aparata used were either BRL Gibco Models S2 or SA. Samples were ran for approximately 4 hours at 200 Volts and 25 miliAmpers. All reactions were run as duplicates to account for loading error. Wet gels were laid on 3M filter paper cut slightly larger than the gel itself. Gels were then wrapped with plastic wrap and exposed to Kodak X-OMAT film for 24-48 hours at -80C. MSRF Cloning and Sequencing Positive fragments from MSRF screening were excised from polyacrylamide gels using a sterile scalpel. DNA was eluted by incubation of gel fragments in 50 ml sterile deionized water for 10 minutes at 100C. Eluted DNA was re-amplified by the identical


22 primers and PCR conditions as used in the MSRF method. Re-amplified DNA fragments were then ran on a 2% agarose gel and excised from the gel. Fragments were ligated into a TA-cloning vector using pCRII-Topo Cloning Kit (Invitrogen), and sequenced. To determine the identity of resulting DNA sequences, searches were performed against mouse genomic databases: www.ensambl.org, http:/genome.ucsc.edu, and http://www.ncbi.nlm.nih.gov/genome/seq/MmBlast.html. 5'RACE RNA from undifferentiated ES cells (R1 strain) was used as a template for 5RACE experiments. A 5'RACE reaction was performed using FirstChoicetm RLM-RACE Kit according to the manufacturer's instructions (Ambion, Inc.). Primers used were Ant4 gene specific primer 1 (5'-TCCAGAAGCCAGGTTTGCTA-3), and Ant4 gene specific primer 2 (5'-AGTCCAGCATGCCCTTGTAG-3). Construction and in vitro Methylation of Reporter Vectors Deletion fragments of the mouse Ant4 promoter were PCR amplified from the mouse ES cells derived genomic DNA with a common antisense primer that spans -105 bp from the translational start site, (5'-CTCCCAGCATCCTCAGCGCCC-3'). We introduced a HinDIII restriction enzyme at the 3end of this primer. We made various sense primers into which an XhoI restriction site was introduced ( bp, 5'-GCAGGCTTGTTGAGCTGAGC-3'; bp, 5'-ACACTCTAGAGGCCGTGATGGG-3'; and bp, 5'-ACACCAATTTAAACAAACCAAC-3, -503bp, 5-CAACAAGTCCAGGGTGACT-3, and -285bp, 5-GCAGGAGCACTCCGCGC-3'). We constructed an Ant4 fragment lacking the predicted promoter region using ( bp, 5'-GCAGGCTTGTTGAGCTGAGC-3', and -503bp, 5TAGTCACCCTGGACTTGTTG -3). The PCR products were digested with HinDIII


23 and XhoI restriction enzymes, gel extracted and ligated into the pGL2-Basic (Promega) promoterless and enhancerless vector. Reporter vectors were in vitro methylated using Sss I methylase (CpG methylase) according to manufacturers instructions (New England Biolabs, Ipswich, MA). Chromatin Immunoprecipitation The Chromatin Immunoprecipitation protocol is essentially a modification of the Upstate Company protocol. Briefly, cells were treated with a 1% formaldehyde solution for 10 minutes at room temperature, with gentle rotation. Formaldehyde crosslinking was quenched by addition of glycine solution to 0.125M glycine final. Following glycine addition, cells were left on a rotating plate for 5 minutes. Cells were then gently scraped, resuspended in ice cold PBS with protease inhibitors ( 0.1 PMSF, 1g/ml aprotinin and leupeptin). Cells were pelleted by 5 minute centrifugation at 1500 g. Supernatant was discarded and cell pellets were resuspended in 200-300 liters of RIPA cell lysis solution, with protease inhibitors. Cells were kept on ice for 20 minutes, and cells were resuspended by pipetting and brief vortexing, intermintendly. Nuclei were pelleted by 5 minute centrifugation at 5000 rpms, at 4C. Nuclear pellets were resuspended in Upstate Lysis buffer, supplemented with protease inhibitors. Pellets were generally resuspended in 1.5-2 mls Upstate lysis buffer, as such volume was empirically determined to cause the least bubbling during a subsequent sonication step. Following a 10 minute incubation on ice, nuclear resuspentions were sonicated by two 30 second sonications, at power 7, using Sonic Dismembrentor model 100, from Fisher Scientific Company. Such sonication conditions would consistently yield smear bands between 300-1000 bp size. A 200 liters of sonicated chromatin was aliquoted into separate tubes, and further processed according to the Upstate protocol as total input chromatin. An additional


24 aliquot was used to quantify the amount of DNA per sample by hoefer dye based flourometry. Following DNA concentration adjustment, equal amounts of chromatin were used for the immunoprecipitation step. Usually 12.5-15 g of sonicated chromatin was used. Dilution of sonicate DNA was done by using 2X volume of Upstate Dilution buffer solution. Next, 80 liters of salmon sperm protein-A-50% slurry was added to each sample. The sample was then incubated on a rotating platform for 2 hours at 4C. After brief centrifugation, the supernatant was taken and added to 5 l of anti-H3 L9 acetylated antibodies or 5 l of anti-H3 L9 dimethylated antibodies. The sample was incubated on a rotating platform overnight at 4C. Next day, 60 l of protein-A slurry was added to precipitate bound chromatin. After brief centrifugation ( 1 minute at maximum speed in a table-top microcentrifuge), supernatant was discarded and bound chromatin pellet washed with following washes: one time with low salt buffer (0.1% SDS, 1% Triton X-100, 2mM EDTA, 20mM Tris-HCl, pH 8.1, 150mM NaCl), one time with high salt buffer (0.1% SDS, 1% Triton X-100, 2mM EDTA, 20mM Tris-HCl, pH 8.1, 500mM NaCl), one time with LiCl buffer (0.25M LiCl, 1% NP40, 1% deoxycholate, 1mM EDTA, 10mM Tris-HCl), and two times with TE buffer (10mM Tris-HCl, 1mM EDTA, pH 8.0). Every wash lasted for 10 minutes on rotating platform, at 4C. One-minute centrifugation was performed using Ultrafree-MC 45 m pore, Millipore column to separate bound chromatin slurry from wash solutions. This prevented uneven separation of bound chromatin between samples. Elution of bound chromatin was done with elution buffer (1% SDS, 0.1M NaHCO3). Samples were placed on a rotating platform at room temperature for 15 minutes, and intermitently vortexed. Protein-DNA crosslinks were reversed by treatment with 5M NaCl for 4 hours at 60C. Samples were


25 further treated with proteinase solution (0.5 M EDTA, 1M Tris-HCl pH 6.5, Proteinase K 10mg/ml) for one hour at 45C. DNA was extracted by Quiagen PCR purification kit according to manufacturer's instructions. FLAG Tagget Ant4 Protein Overexpression Full length Ant4 cDNA was amplified using following the primers: pTYF_ant3.f 5'-CGCGGATCCATGTCGAACGAATCCTCCAA-3' and pTYF_ant3.r 5'-CTAGACTAGTTTAATCTCCTGATGAACTAC-3'. The DNA fragment corresponding to the predicted size of Ant4 was digested with BamHI and SpeI restriction ezymes, and the fragment was cloned into a pTYF-EF vector. The PTYF -EF vector contains a constitutive CMV promoter and 2XFLAG sequences in the N-terminal region. Transient transfection into NIH3T3 mouse fibroblast cells was performed using Fugene 6 reagent according to manufacturer's instructions (Rosche, Inc). Two days following transfections cells were collected by centrifugation. Untagged Ant4 Protein Overexpression J1 ES cell RNA was used as a template for reverse transcription polymerase chain reaction to obtain the cDNAs of mouse Ant isoforms: Ant1.f (5-ATAAGAATGCGGCCGCAGCATGGGGGATCAGGCTTTGAG-3), Ant1.r (5-GCGGGATCCTTACACATATTTTTTGATCTCATC-3), Ant2.f (5-ATAAGAATGCGGCCGC TTTCAACATGACAGATGC -3 ), Ant2.r (5GCGGGATCCTTATGTGTATTTCTTGATCTCATC-3 ), Ant4.f (5CCGCTCGAGAACATGTCGAACGAATCCTCC-3 ), and Ant4.r (5GCGGGATCCTTAATCTCCTGATGAACTACCTCC-3 ). Full length cDNAs were cloned into the pcDNA3.1-Hygromycin(-) vector (Invitrogen). The DNA sequencing was used to confirm positive clones.


26 Western Blotting Cell pellets are dissociated in RIPA buffer (1M KPO4, 250 mM EDTA, pH8.0, 200 mM EGTA, pH8.0, 1 M MgCl2, 1 M B-GP, 10 % NP-40, 0.1 M Na3VO4) with protease inhibitors (1M dTT, 17.4 mg/ml PMSF, 2 mg/ml aprotinin, 2 mg/ml pepstatin) for 20 minutes at 4C. Cells were then briefly spun and the pellet was discarded. Following the addition of loading buffer, supernatant was boiled for 5 minutes. Protein was transferred onto a nitrocellulose membrane using the BioRad transfer apparatus. The membrane was preincubated in blocking solution (4 % BSA or 5 % nonfat dry milk), on a rotating platform, for one hour at room temperature. Two l of primary mouse anti-FLAG antibodies in 10 mls of 1X TBST were added to the membrane, which was left on a rotating platform for one hour at room temperature. Next, five brief rinses in 1 X TBST solution (1 % Tween 20) were performed. Two l of secondary anti-mouse antibody was added, and the membrane was rotated for 30 minutes at room temperature. Finally, five brief rinses with 1X TBST were performed, and the membrane was developed using Kodak X-OMAT film in a dark room. Immunohistochemistry The full length Ant4 cDNA was amplified using the following primers: forward (5'-CGCGGATCCATGTCGGAACGAATCCTCCAA-3), and reverse (5'-CTAGACTAGTTTAATCTCCTGATGAACTAC-3) and cloned into pTYF-EF-FLAG, which possesses two repeats of FLAG-tagged sequences under the control of the EF-1 promoter. The vector was co-transfected with pTK-Hyg to isolate stable NIH3T3 clones expressing N-terminally FLAG-tagged Ant4 protein. Stably transfected cells were washed with ice cold PBS and fixed with pre-chilled 100% methanol for 10 min. After the fixation, cells were washed with PBS, and incubated with primary antibodies (anti


27 FLAG, Stratagene, Inc; anti-HSP60 Santa Cruz, Inc) at room temperature for 1 hour. After the first incubation, cells were washed with PBS, and incubated with secondary anti-mouse or goat IgG antibodies conjugated with rhodamine or fluorescein isothiocyanate (Jackson Immunoresearch Laboratories, West Grove, PA) for 45 min at room temperature. Immunostained cells were examined using inverted flourescence microscopy (Olympus, Inc.). Bisulfite Sequencing and Combined Bisulfite Restriction Analysis (COBRA) Genomic DNA was extracted from ES cells, EBs and adult tissues using the DNA Wizard Genomic DNA Purification Kit (Promega). Mouse testis were decapsulated and seminiferous tubules were collected for analysis. A bisulfite reaction was performed using EZ DNA Methylation Kit (Zymo Research, Orange, CA). A genomic DNA, 2 g, was used for conversion with the bisulfite reagent. Approximately 80 ng of precipitated bisulfite converted DNA was used as a template for each PCR analysis. Primers used for Ant4 cobra analysis and for bisulfite sequencing were 5'-TTGTTGTGTATTGATTGAGTATG-3 and 5'-ACACTAAAAAAAACTAAAAAACC-3 (40 cycles). Primers used for extensive bisulfite mapping were: 5'-AAGGTGTGTGTTATTATTGTTTGATGT-3, 5'-TACCCCTCATCTATCATATTCCCTA-3; 5'-TTGAGGAGGAGTTAATAAGTTTAGGG-3, 5'-CCAAAAAACACACTCTAACCAAATAC-3; 5'-GTAGGTAAATTAATTGTGGATTAAATAGTA-3, 5'-TACACAACAACTTTTACAAAAAAAC-3; 5'-AGTTGTTGTGTATTGATTGAGTATG-3, 5'-TCTTTAAAAACTACTTCTTAAAAAATTC-3, 5'


28 TTTTTAAGAAGTAGTTTTTAAAGAAGG-3, 5'-AAACAATCCAACATACCCTTATAAC-3. Primers used for Rnf17 and Piwil2 bisulfite sequencing were: bsRnf17 (5'GGGTTTAGTTTTTTTGTTTTTTGATT-3, 5'ACCAATCCCAAACTCCTCAC-3) and bsPiwil2 (5'TTTTAGGTTTGGTGTTATTGAGTTT-3, 5'CCCACCCTTTTAAATTAACATCTAC-3). PCR fragments were ran on a 2 % agarose gel to check for presence of unique band. Fragments were subsequently cloned into pCRII-TOPO cloning vector (Invitrogen) and individual clones were sequenced. Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) Total RNA was isolated from ES cells and EBs using RNAqueous kit (Ambion, Austin, TX). Two mg of RNA was used as a template for RT reactions using SuperScript Synthesis for First Strand Synthesis Kit (Invitrogen). Sequences of forward and reverse primer pairs were as follows: Ant4 (5'-TGGAGCAACATCCTTGTGTG-3, 5'-AGAAATGGGGTTTCCTTTGG-3), Oct4 (5'-TGGAGACTTTGCAGCCTGAG-3, 5'-TGAATGCATGGGAGAGCCCA-3), Ttr (5'-CTCACCACAGATGAGAAG-3, 5'-CCGTGAGTCTCTCAATTC-3), Fgf-5 (5'-AAAGTCAATGGCTCCCACGAA-3, 5'-CTTCAGTCTGTACTTCACTGG-3), -actin (5'-TTCCTTCTTGGGTATGGAAT-3, 5'-GAGCAATGATCTTGATCTTC-3), Gapdh (5'-CCCTTCATTGACCTCACTACATGG-3, 5'-CCTGCTTCACCACCTTCTTGATGTC-3), Hprt (5'-GCTGGTGAAAAGGACCTCT-3, 5'-CACAGG ACTAGAACACCTGC-3), Nr4A1 (5'-CACACGTGGTGCTCTTCTGT-3, 5'-AACCCCCATCTCAACCTCTT-3), AK005608 (5'-GGTTGGTCAACGGTCGTATT -3, 5'CATCACTGGTACCCCATTCC-3). Primers for Rnf17, Dazl, and Piwil2 transcripts were identical as in reference (85). The PCR reaction consisted of initial denaturation


29 step for 5 minutes at 94C. Following thirty cycles (twenty five for -actin transcript detection) were made up of denaturation for 1 minutes at 94C, annealing for 1 minute at 40C and extention for 1 minutes at 72C. Northern Blotting Northern blotting was performed using multiple pre-made blots (Clontech, Palo Alto, CA; Rnway, South Korea). Briefly, the membrane was pre-incubated with 5 ml of ExpressHybrid Hybridization Solution at 68C for 1 hour. Seventy five ng of the full length Ant4 or -actin cDNA fragment was radio-labeled with [-32P] dCTP nucleotides. The Ant1 and Ant2 probes were PCR amplified using following primers: Ant1 (5'-GGCGCTACTTTGCTGGTAAC-3, 5'-GCAATCTTCCTCCAGCAGTC-3), Ant2 (5'-CAGCTGGATGATTGCACAGT-3, 5'-CAAGCCCAGAGAATCTGTCC-3). Unincorporated nucleotides were removed using ProbeQuant G-50 Micro Column (Amersham). Heat denatured and briefly chilled probe (~20 ng/ml) was added to the hybridization solution. The membrane was incubated with gentle shaking for 24 hours at 68C, and washed twice for half an hour per wash in 2 X SSC/0.05% SDS at room temperature, and twice in 0.1 X SSC/0.1 % SDS at 50C. The membrane was wrapped with plastic wrap and exposed to X-OMAT Kodak film at -80C for 18-24 hours. In situ RNA Hybridization Digoxigenin labeled Ant4 riboprobes were prepared from linearized plasmid DNA using a DIG RNA labeling kit (Roche, Basel, Switzerland). The resulting 600 bp sense and antisense riboprobes were quantitated by OD260 and checked for digoxigenin incorporation by dot blot. Liver pieces and whole testes were harvested from adult male mice and quickly frozen in OCT (Global Medical Instrumentation, Ramsey, MN). Tissues were cut at 10 mm and immediately fixed for 15 minutes in 4%


30 paraformaldehyde made in DEPC treated 1XPBS. Sections were pre-hybridized for 3 hours in 50% formamide, 5x SSC and 40 mg/ml salmon sperm DNA prior to addition of either Ant4 sense or antisense riboprobe at a final concentration of 500 ng/ml. Hybridizations were performed overnight at 55C under glass cover slips sealed with rubber cement. Post hybridization washes consisted of 30 minutes in room temperature 2x SSC, one hour in 2x SSC at 65C and one hour in 0.1x SSC at 65C. Following equilibration in Buffer 1 (Tris 100mM / NaCl 150mM, pH 7.5), slides were blocked in Buffer 1 containing 5% normal sheep serum for 30 minutes at room temperature. This was replaced with 1:5000 alkaline phosphatase coupled anti-digoxigenin (Roche) in fresh blocking solution and incubated for 2 hours. Slides were washed in Buffer 1 twice for 15 minutes before equilibration in freshly prepared detection buffer (Tris 100 mM / NaCl 100 mM / MgCl 50 mM, pH 9.5). Slides were transferred to chromagenic substrate (100 mg/ml NBT / 50 mg/ml BCIP X-Phosphate / 3.6 mg/ml levamisole in detection buffer) and monitored for color development. The reaction was stopped after 4 hours by submerging the slides in TE buffer (Tris 10 mM / EDTA 1 mM, pH 8.0) for 15 minutes. In order to remove non-specific background, slides were placed in 95% EtOH for one hour and rinsed for 15 minutes in water. Sections were counter-stained in nuclear fast red and mounted in Vectamount (Vector Labs, Burlingame, CA). Images were captured on an Olympus BX 51 microscope equipped with an Optronics Magnafire digital camera system. Immunostaining for Ant4 Mouse ovary, testes and liver were harvested from 3 months old BALB/c mice, and immediately frozen into OCT (Optimal Cutting Temperature) blocks (Tissue-Tek, Torrance, CA). Frozen sections were cut at 5 m, air dried for 2 hours then fixed in


31 acetone for 10 minutes, before being rehydrated, and blocked for endogenous peroxidase activity. Following a serum blocking step, affinity purifed rabbit anti-Ant4 (Sigma Genosys, The Woodlands, TX) was applied at 2 g/ml and incubated overnight at 4C. Staining was achieved using the EnVision+ HRP kit (DakoCytomation, Glostrup, Denmark) following the manufacturers directions. Positive signal was detected with DAB+ (DakoCytomation) and slides were counterstained using Light Green SF Yellowish (Sigma, St. Louis MO). Primordial Germ Cell Preparation Primordial germ cells were obtained from timed matings of B6C3F1 mice purchased from Jackson Labs. Noon of the day on which a mating plug was first observed is taken to be 0.5 days post coitus (dpc). The PGCs were immunomagnetically purified using anti-SSEA1 antibody from isolated urogenital ridges as described (16). The 12.5 dpc genital ridges were sex separated by visual inspection for testis cords. The immunodepleted fraction refers to cells not retained on the magnetic column. Targeted Disruption of Mouse Ant4 gene A targeting construct was designed to replace exons 2 through 5 of the mouse Ant4 gene with an IRES (internal ribosome entry site)-B geo-Neo r cassette of pNF-SIBN targeting vector. A 2.1 kb fragment containing exon 1 and a 5.3 kb fragment containing exons 5 and 6 were amplified from mouse ES cells (R1 strain) genomic DNA and used as the 5 and 3 homologous arms of the targeting construct. Targeting arms were amplified by LA Taq PCR system (Takara, Madison, WI) with following primers Ant45.f (5-CCGCTCGAGCTCTCATTGTTTTAACTGGATACGTG-3), Ant45.r (5-GCGTGTCGACTGGCCCTGCACATTCTCCAAAACACC-3), Ant43.f (5-CCGCTCGAGGAGCCATCGCCCCGTCATATACTCTG-3) and Ant43.r (5


32 CCCGCTCGAGTAATTGGTGACTTTAAGTGGGTC-3). Either targeting arm was individually cloned into pCR 2.1-TOPO vector (Invitrogen, Carlsbad, CA). Following excision from pCR2.1-TOPO vectors, the 5 targeting arm was ligated into a unique XhoI site, and a 3 targeting arm was ligated into a unique SalI site, of pNF-SIBN targeting vector. The resulting targeting vector was linearized with SalI digestion and introduced into ES cells by electroporation. Genomic DNA from G418-resistant colonies was screened for homologous recombination by Southern blot analysis.


CHAPTER 3 RESULTS Introduction It is becoming increasingly clear that epigenetic modifications play a critical role in the regulation of gene expression in many cellular processes (86,87). Studying changes in epigenetic modifications during stem cell differentiation will help us to understand how cells maintain or lose differentiation potentials. In the present study, we attempted to identify differentially methylated loci that are hypomethylated in undifferentiated ES cells and become hypermethylated after differentiation. Murine embryonic stem (ES) cells are originally derived from the inner cell mass of a developing blastocyst and have the ability to differentiate into all cell types of an adult animal (88). Pluripotency of ES cells can be maintained in vitro when the cells are cultured in a serum-containing medium supplemented with leukemia inhibitory factor (LIF) (89). When LIF is removed from the medium, the ES cells begin to differentiate in vitro into all three embryonic germ layers. An in vitro ES cell differentiation system serves as an excellent model to study the regulation of gene expression required for stem cell self-renewal and pluripotency (17-19). Recent studies on molecules involved in epigenetic modifications have revealed a unique expression pattern of DNA methyltransferases (90), histone deacetylases (23), and methyl-binding proteins (91) in ES cells. ES cells also have a differential genome wide DNA methylation pattern when compared to their descendant differentiated cells (20,21). However, the exact genomic loci of such differentially methylated regions remain unknown. 33


34 Using methylation-sensitive restriction fingerprinting (MSRF) method to screen for genome wide changes in DNA methylation patterns during ES cell differentiation, we identified 10 differentially methylated genomic loci. One of the differentially methylated regions corresponds to a promoter region of a novel gene encoding an adenine nucleotide translocase homolog that is specifically expressed in undifferentiated embryonic stem cells and germ cells. Furthermore, we show that DNA methylation, but not the availability of transcription factors, is the main restricting factor of gene expression. Identification of Differentially Methylated Genomic Regions A Survey of DNA Methylation Screeing Methods In a search to identify exact genomic position of differentially methylated loci during ES cell differentiation we first underwent a literature search for a suitable screening method. The first method, restriction landmark genomic scanning (RLGS), entails global, genome wide screen for differentially methylated NotI-EcoRV-HinfI digested fragments. The RLGS method has several advantages: (i) differentially methylated NotI sites are enriched in the CpG island containing fraction of DNA, (ii) highly reproducible banding patterns can be obtained (ie, tissue specific, tumor specific), (iii) RLGS is a high throughput method, allowing for simultaneous identification of around ~ 1000 differentially methylated fragments (92). However, due to the low DNA concentration of differentially methylated DNA, the RLGS method cannot be used for nucleotide sequencing of newly identified fragments (84). Recently, the Plass group developed improved RLGS cloning conditions, allowing for nucleotide sequencing of differentially methylated fragments (93). The second method, originally developed by the Huang group, is a PCR based methylation sensitive restriction fingerprinting (MSRF) method for the identification of


35 differentially methylated regions (84). Two DNA samples suspected of containing differential genome wide DNA methylation patterns (ex. normal vs disease, wild type vs knockout sample) are subjected to a two step process, which allows for a genomic assignment of differentially methylated regions. Similarly to RLGS, the DNA sample is first digested with MseI/BstUI restriction enzymes. Then next step entails PCR amplification of digested DNAs with CpG rich ten-mer primers under low stringency and low cycle number PCR conditions. The PCR amplified DNAs are subsequently separated on an acrylamide gel, allowing for visualizations of amplified DNAs. The MSRF method has been used to identify differentially methylated regions in a variety of carcinomas, including breast carcinomas (84), prostate carcinomas (94), and nasopharyngeal carcinomas (95). Some MSRF limitations include: (i) fewer absolute numbers of newly identified differential regions, mostly 1 to 3 per study and (ii) a high rate of false positive signal. In spite of these limitations, the MSRF method was the only method that could assign a genomic location to differentially methylated fragments. Methylation Sensitive Restriction Fingerprinting (MSRF) Method The DNA samples were prepared from either undifferentiated mouse ES cells or differentiated embryoid bodies (Figure 3-1A). Mouse ES cells were differentiated in a culture medium without LIF using a hanging drop method. DNA was extracted from undifferentiated ES cells (day 0) and differentiated embryoid bodies (EBs) (days 5 and 10). The DNA was then digested by a combination of methylation-sensitive (BstUI) and insensitive (MseI) restriction enzymes, and amplified using CpG-rich 10-mer primers (Figure 3-1B). Following the original method established by the Huang group, we used a combination of 4 different CpG-rich primers. Primer pairs used in our study included combinations of different sets of primers, single primer combinations, or a combination


36 of three primers simultaneously. The PCR amplification step entails the use of radioactively labeled dCTP nucleotides, allowing for simultaneous and highly sensitive detection of PCR generated fragments. We underwent careful visual inspections of radiograph sensitive films and identified a total of ten DNA fragments that exhibited differential methylation patterns during ES cell differentiation. Fragments of interest were then manually excised from gels, and cloned into pCR2.1-TOPO cloning vectors prior to sequencing. The nucleotide sequences of eight out of ten fragments could unambiguously be assigned to distinct genomic locations with the use of web-based publicly accessible mouse genome sequence servers (Table 3-1). We used three mouse genomic databases: www.ensambl.org, http:/genome.ucsc.edu, and http://www.ncbi.nlm.nih.gov/genome/seq/MmBlast.html Using these genomic databases methylated fragment (MF) 1 and MF 6 could not be locilized to a single genomic site. MF 1 corresponded with 100% nucleotide identity to two genomic sites: (i) located on mouse chromosome 13 (genomic location of the first nucleotide is chr13_random 570600) and (ii) located on mouse chromosome 3 (genomic location of the first nucleotide is chr3 + 40460682). According to genomic databases, a region approximately 250 kb in size, surrounding MF 1, is duplicated, with 100% sequence conservation, on both mouse chromosome 13 and 3. Since the conservation of such extended genomic region appears unlikely, we underwent a literature search to look for genes that were included in this 250 kb region. We found 4 validated genes two of which are well studied and characterized. The literature search revealed that one of these well studied genes, serine/threonine-protein kinase (PLK4), has been assigned to mouse


37 chromosome 13 (96). Thus, we conclude that MF 1 corresponds to a distinct genomic locus on mouse chromosome 13. The MF 6 nucleotide sequence had greater than 98% nucleotide sequence identity with multiple genomic sites across the mouse genome (genomic location of the first three hits is chr9: 26109765, chr3: 10936716, and chr8: 72282211). The MF 6 nucleotide sequence spanned 209 nucleotides overlapping the LTR region of highly repetitive LINE element. The remainder of differentially methylated MFs were localized to unique single copy genomic regions in the mouse genome (Table 3-1). All MFs were randomly distributed with respect to their chromosomal position, tissue specific expression and general gene architecture of cognate neighboring genes. In agreement with genome wide de novo DNA methylation by gastrulation the majority of MFs were found in differentiated cells rather than in ES cells. Curiously, MFs 1, 9, and 10, spanned across the CpG island region of testis-specific genes. As predicted, we observed a non-random distribution of MFs with respect to their genomic location, with an apparent propensity for these differentially methylated regions to be positioned in the 5end proximity of cognate neighboring genes. We found considerable variation between individual MFs and between the genomic distances to cognate neighboring genes. Five out of ten MFs were localized within a CpG island region, and six out of ten MFs were localized in the 5end vicinity of cognate neighboring genes. Identification of DNA Methylation Controlled Genes To further investigate the significance of MFs differential methylation during ES cell differentiation, we conducted an in silico analysis of cognate neighboring genes. We collected data regarding the expression pattern of neighboring genes by careful analysis of expressed sequence tags (EST). This data was available on the University of California


38 genome web browser. As mentioned previously, tissue specific expression of neighboring genes varied considerably. We concluded that the majorities of genes are expressed in various adult tissues, during multiple stages of embryonic development, and are potentially controlled by independent mechanisms. Next, we analyzed the expression patterns of cognate neighboring genes using semi-quantitative RT-PCR analysis with template cDNAs from undifferentiated ES cells, and day 5 and 10 embryoid bodies (refered to as differentiated cells). As an internal control for this experiment, we analyzed -actin mRNA levels, which were found to be constant during ES cell differentiation. To confirm the timely differentiation of ES cells cultures, we analyzed mRNA levels of Oct4, a well characterized ES cell marker and Brachyury, a mesodermal marker (data not shown). We were successful in correlating the appearance of differentiation and a loss of the cognate neighboring gene for 3 out of 10 MFs (Figure 3-2A and B). The mRNA expression for the remainder of cognate neighboring genes was found to be independent of MF methylation. Curiously, MFs 1 (RikencDNA 1700034J06) and 10 (AK005608) were associated with testis-specific genes that followed a similar expression pattern. Both testis-specific genes were found to be expressed in undifferentiated ES cells and downregulated following ES cells differentiation. We considered whether the relative abundance of testis-specific genes as MF cognate neighboring genes, signifies a general tendency for all testis-specific genes. Analysis of literature revealed that well characterized germ cell genes, such as deleted in azoospermia like (Dazl) gene, mouse ortholog of piwi domain containing (Piwil2) gene, and non-bHLH-ZIP (Rnf17/Mmip2) gene are known to be expressed in undifferentiated ES cells and downregulated following ES cell


39 differentiation (97) and (Figure 3-3A). To our knowledge, there were no studies showing that the expression of such germ cell-specific genes is regulated by DNA methylation during ES cell differentiation. To approach such a question, we examined the expression patterns of germ cell-specific genes during ES cell differentiation in Dnmt3a and Dnmt3b double null ES cells. To our surprise, downregulation of Dazl, Piwil2 and Rnf17 genes was inhibited in Dnmt3a and Dnmt3b double null ES cells (Figure 3-3B). To further solidify evidence that the expression of germline-specific genes in an ES cell model is DNA methylation dependent, we treated day 8 embryoid bodies with a generalized DNA methylation inhibitor drug, 5-aza-2'-deoxycitidine (5-aza-dC). After 48 hours of 5-aza-dC treatment, mRNA samples were collected from day 10 embryoid bodies. Our data indicates that 5-aza-dC relieved downregulation of germ cell-specific genes (Figure 3-3C). Using NIH3T3 somatic cell line treated with varying concentration of 5-aza-dC we detected re-expression of of RikencDNA 1700034J06, Dazl, Piwil2 and Rnf17 transcripts (Figure 3-4). However, 5-aza-dC failed to relieve downregulation of the Oct4 gene, which is highly expressed in testis in adult mice, indicating that not all germ cell-specific genes are controlled by DNA methylation during ES cell differentiation (Figures 3-3C and 3-4). Next, we analyzed DNA methylation levels of several germ-specific promoters during ES cell differentiation. We detected uniform increase in DNA methylation levels following ES cell differentiation (Figure 3-5). Thus, we conclude that during ES cell differentiation a subset of germ cell-specific genes is repressed in a DNA methylation dependent manner.


40 Identification of a Novel ES and Germ Cell-Specific Gene Using the MSRF Method In order to carefully examine changes in DNA methylation at a single genomic locus, we had to choose between the newly identified MFs. A 199-bp MF 1 (Figure 3-6B) was evaluated by MSRF analyses and was found to be hypomethylated in undifferentiated ES cells when compared to day 5 and day 10 embryoid bodies (Figure 3-6A). Database searches revealed that MF 1 (Figure 3-7), mapped to the exon 1/intron 1 boundary of a previously uncharacterized gene. Computational sequence analyses showed that the identified MF 1 is part of a putative 543-bp CpG island with a GC content of 63.4% and an observedexpected CpG ratio of 0.88. The MF 1 nucleotide sequence is identical to the exon1/intron 1 boundary of a novel, previously uncharacterized transcript, RIKENcDNA 1700034J06, with GenBank accession number, BC050810 (Figure 3-7). Several reasons prompted us to focus our attention on the MF 1 cognate neighboring gene, RIKENcDNA 1700034J06. First, in silico analysis of tissue-specific expression revealed that RIKENcDNA 1700034J06 is expressed at various stages of embryonic development and in adult mice, RIKENcDNA 1700034J06 expression is testis-restricted. A recent breakthrough paper on molecular mechanisms of ES cell maintenance by the Yamanaka group, identified nine genes whose expression is high in murine ES cells (98). Eight out of nine genes identified by Yamanaka are also found to be expressed in mouse germ line (unpublished, personal communication). Second, the RIKENcDNA 1700034J06 predicted amino acid composition, revealed that RIKENcDNA 1700034J06encodes a novel member of nucleus encoded ADP/ATP carrier proteins. Members of the ADP/ATP carrier gene family are known to play an essential role in the


41 maintenance of ADP/ATP influx/efflux equilibrium and mitochondrial dependent apoptosis (99). Lastly, RIKENcDNA 1700034J06 belongs to a small group of candidate neighboring genes whose expression pattern correlates inversely with MF DNA methylation, thus lending itself to a more detailed analysis. RIKENcDNA 1700034J06 Computational Analysis The MF 1 BLAT analysis, indicated that a cognate neighboring gene, RIKENcDNA 1700034J06, is a novel, and previously uncharacterized member of the mitochondrial carrier (MC) family of genes. Most MCs are localized in the inner mitochondrial membrane, where they play an essential role in providing a solubility link between the cytosol and mitochondrial matrix for a variety of solutes, including H+, aspartate, glutamate, carnithine, and ATP. All MCs form homodimers and exibit a sequence structure of around 300 amino acids. Such a primary amino acid sequence is in essence, a triple repeat of an 100 amino acid domain, such that each domain contains two highly hydrophobic amino acids (Figure 3-8C). We named RIKENcDNA 1700034J06 adenine nucleotide transporter 4 (Ant4), since a third Ant isoform has previously been reported in humans. The Ant4 protein also contains the signature sequence motif, P-h-D/E-X-h-K/R-X-R/K-(20 residues)-D/E-G-(4 residues)-a-K/R-G, where h represents a hydrophobic and a represents an aromatic residue. Such signature motifs are characteristic of all adenine nucleotide transporters (Figure 3-8A). The Ant4 amino acid sequence exhibits significant similarity to two other known mouse isoforms, adenine nucleotide transporter 1 (Ant1) and adenine nucleotide transporter 2 (Ant2) (Figure 3-8A). Amino acid similarity is roughly equally distributed across the entire amino acid sequence structure. However, the Ant4 has an extended N-terminal region (first 17 amino acids) and C-terminal region (last 5 amino acids) both of


42 which are absent in Ant1 and Ant2 isoforms. Using publicly available genome sequences, we identified the presence of Ant4 orthologous sequences in rat, dog, donkey, and chimpanzee genomes (data not shown). The Ant4 human ortholog is present in human chromosome 4, which has previously been reported to be in synteny with mouse chromosome 13 (96). The human ANT4 deduced amino acid sequence shares 85.9% overall amino acid identity with mouse Ant4 (Figure 3-8B). In addition, the genomic architecture of 6 exons is conserved between mouse and human (data not shown). It is notable that the human genome contains at least seven ANT pseudogenes on the X chromosome (100). However, in contrast to Ant4, such pseudogenes do not reveal the conserved exon/intron architecture or translatable coding regions. All known mammalian Ant isoforms (unlike plant adenine nucleotide translocases) lack an N-terminal mitochondrial localization sequence, yet they all localize to the mitochondria (101). In agreement with this observation, Ant4 also does not contain a classical mitochondrial localization sequence; however it does localize to mitochondria when N-terminal FLAG-tagged Ant4 is expressed in NIH3T3 fibroblasts (Figure 3-8D). In conclusion, we report the identification of a novel member of the MC family of genes, Ant4. 5RACE The Ant4 promoter region did not contain a classical TATA box sequence in its 5'-flanking region. To further characterize the 5end region of the Ant4 gene, we mapped the transcription start site (TSS) of Ant4 mRNA by employing a 5RACE protocol. One antisense extension primer, gene-specific primer 1, 5-TCCAGAAGCCAGGTTTGCTA-3, was designed complementary to position +399 relative to the translation start site. Another primer, gene-specific primer 2, 5-AGTCCAGCATGCCCTTGTAG-3, was designed complimentary to position +208 downstream of the translation start site. Gene


43 specific primer 2 was also used to generate the final PCR product. An initial PCR generated fragment was obtained by gene-specific primer 1and 5RACE adapter primer in the presence of total RNA from undifferentiated ES cells. Gene-specific primer 2 and 5RACE adapter primer were then used to generate the final PCR product. Gel analysis of our PCR product indicated a smeared band roughly 350 bp in size. PCR products were subsequently cloned into a pCR-II cloning vector, and individual clones were sequenced. In accordance with the sequencing results, the TSS was mapped to multiple sites at -209, -129, -118, -103, and -77 relative to the translation start site, indicating that the CpG island of Ant4 gene spans the putative promoter region, exon 1, and part of intron 1. Figure 3-9 depicts the presence of multiple TSS relative to the translation start site. Ant4 Promoter Transcription is Inhibited by DNA Methylation We used the Proscan program ( http://thr.cit.nih.gov/molbio/proscan/ ) that predicts promoter regions based on scoring homologies with putative eukaryotic Pol II promoter sequences. Using the 5end region of the Ant4 locus, the Proscan program predicted that the promoter region spanned from -285 to -35 nucleotides relative to the translation start site. We also used a TFSEARCH computer program ( http://www.cbrc.jp/research/db/TFSEARCHJ.html ) to identify putative binding sites for any transcription factors located in the Ant4 5end region. It is noteworthy that an imperfect myeloblastosis associated oncogene (c-myb) binding sequence, 5-CGCCAAGG CCGTTGGGCG-3, was located immediately upstream beginning at -184 relative to the translation start site. We also detected a myelocytomatosis associated oncogene (c-myc) binding sequence, beginning at 5-AA ACACGTGTT-3, located -217 relative to the translation start site. We could not identify a classical TATA binding sequence. To confirm the predicted Ant4 promoter region and to establish that the


44 repression of the Ant4 proximal promoter could be mediated by DNA methylation, we generated several Ant4 promoter reporter constructs. Using PCR technology, we amplified DNA fragments corresponding to various Ant4 upstream regions. We created several PCR products: (i) starting at nucleotide positions -2186 to -105 (named pGL2-2), (ii) -1166 to -105 (named pGL2-1), (iii) -645 to -105 (named pGL2-0.5), (iv) -503 to -105 (named pGL2-0.3), (v) -285 to -105 (named pGL2-0.1), (vi) and no promoter control construct, -2186 to -503 (pGL2-no promoter). Each Ant4 promoter fragment was ligated into a pGL2-basic vector, which lacks SV40 promoter and enhancer region, using XhoI and HinDIII restriction enzymes. Such a ligation approach placed the Ant4 promoter fragments in the immediate upstream position relative to the luciferase reporter gene (luc). These reporter constructs were introduced into undifferentiated ES cells and into NIH3T3 somatic cell line by means of Fugene 6 dependent transient transfection. To further define the presence of any ES specific enhancer elements in the Ant4 5end region, we compared the expression of various promoter constructs in ES cells and NIH3T3 cells. We were able to detect that the pGL2-0.1 fragment was able to enhance luciferase activity in undifferentiated ES cells, but not in NIH 3T3 cells, relative to the pGL2-basic vector (Figure 3-10). Using a reporter construct lacking the predicted promoter region, the pGL2-no promoter, we confirmed that a region up to -503 nucleotides upstream of the translation start site, serves as the Ant4 promoter (Figure 3-10). We cannot exclude the possibility that other promoter regions exist in the downstream region of the Ant4 locus (ex. promoter in intron 1). However, in light of our northern blot analysis (we detected only a single band ~1.6 kb) such possibility seems unlikely.


45 Next, we examined whether methylation of the Ant4 5end region affects the transcriptional activity of the Ant4 gene. An in vitro DNA methylation of the Ant4 promoter reporter constructs showed that DNA methylation of the CpG residues suppressed transcription (Figure 3-11). Our findings indicate that methylation of the Ant4 associated CpG island could potentially serve as an important transcriptional regulatory mechanism in the Ant4 promoter region. Ant4 Genomic Locus Undergoes Epigenetic Restructuring During ES cell Differentiation To carefully analyze DNA methylation changes associated with the Ant4 genomic locus, we undertook a comprehensive bisulfite sequencing analysis of the Ant4 5end region. We also examined changes in a covalent modification of the nucleosomal histone proteins in the vicinity of Ant4 multiple transcription start sites. Our data indicates extensive and selective DNA methylation of the Ant4 promoter region following ES cell differentiation. To determine the DNA methylation patterns across the Ant4 promoter locus during ES cell differentiation, genomic DNA from ES cells or day 10 EBs were treated with bisulfite reagent and individual clones were subjected to sequence analysis. We analyzed the Ant4 promoter region that encompasses a total of 47 CpG dinucleotides, from -516 bp upstream of the translation initiation site to the 3-end of exon 1, +212 bp downstream of the translation initiation site. Sequencing of individual bisulfite-converted genomic DNAs revealed that the Ant4 promoter and associated CpG island region were mostly unmethylated in undifferentiated ES cells (Figure 3-12). In contrast, EBs at day 10 showed significant hypermethylation around the Ant4 promoter region indicating that following ES cell differentiation the Ant4 promoter undergoes de novo DNA methylation (Figure 3-13). A further upstream region (>1kb) of the Ant4 promoter


46 outside of the CpG island revealed cytosine hypermethylation regardless of the differentiation status of ES cells (Figures 3-12 and 3-13). The Ant4 promoter region, from -483 to -239 nucleotides relative to the translation start site, was found virtually devoid of any methylated residues in undifferentiated ES cells. However, following differentiation, the percentage of methylated CpGs rose to 70-80%. Next, we employed a chromatin immunopreciptiation protocol to analyze covalent modification of nucleosomal histones during ES cells differentiation. We detected a binary pattern of histone modification of the Ant4 promoter region (Figure 3-14A). In undifferentiated ES cells, Ant4 promoter was associated with hyperacetylated histone 3 (H3) at lysine 9 (Figure 3-14B), while in differentiated cells Ant4 promoter region was associated preferentially with hyper methylated H3 at Lys 9 (Figure 3-14B). In conclusion, we detected that the Ant4 promoter region and its surrounding chromatin undergo dynamic restructuring during ES cell differentiation, and this includes extensive de novo DNA methylation of the Ant4 promoter region as well as differential covalent modification of the surrounding histone molecules. Semi-quantitative RT-PCR Analysis of the Ant4 Transcript During ES cells Differentiation We next measured the levels of Ant4 mRNA using a semiquantitative RTPCR to determine the association between silencing of Ant4 transcription and the appearance of de novo DNA methylation within the Ant4 genomic locus. Using semiquantitative RT-PCR, relative levels of Ant4 mRNA were found to be high in undifferentiated ES cells (detectable after 24 cycles), but downregulated (detectable after 30 cycles) following ES cell differentiation (Figure 3-15A). In parallel, we measured transcript levels of two other known genes, Oct4 and -actin, in order to determine whether the loss of Ant4


47 expression is a gene-specific event. As expected, the relative mRNA levels of the Oct4 transcript decreased following ES cells differentiation (Figure 3-15B), while -actin relative mRNA levels remained unchanged (Figure 3-15B). Thus, we conclude that Ant4 transcript levels correlate inversely with the appearance of DNA methylation during ES cell differentiation. Our results are in agreement with the widely accepted principle that single copy gene DNA methylation in eukaryotes correlates with transcriptional inactivation. 5-aza-dC Treatment Reactivates Ant4 Transcript Expression Analysis of transcript levels showed only trace amounts of Ant4 mRNA expression in differentiated embryoid bodies. However, after 2-day treatment with either 0.1, 1, or 10 micromolar of 5-aza-2'-deoxycitidine (5-aza-dC), Ant4 mRNA was rexpressed in these differentiated cells (Figure 3-15B). On the contrary, 5-aza-dC treatment did not have any measurable effect on the level of Oct4 and -actin mRNA expression in differentiated embryoid bodies. In parallel, we analyzed the effect of 5-aza-dC treatment on Ant4 transcript levels in the NIH3T3 mouse somatic cell line. Similarly, 5-aza-dC treatment reactivated Ant4 transcription in this cell line (data not shown). Our results indicate that DNA methylation could play a dominant role in Ant4 transcriptional repression in both ES cells and in somatic cells. Dnmt3 Activity Is Required for Ant4 Repression DNA methyltransferase 3a and 3b (Dnmt3a, Dnmt3b) has been proposed to play a primary role in de novo methylation during murine embryonic development (10). In order to investigate the role of the Dnmt3 proteins in the establishment of DNA methylation of the Ant4 promoter during ES cell differentiation, we utilized ES cells homozygously deleted for both the Dnmt3a and Dnmt3b genes. The Dnmt3a Dnmt3b


48 double null ES cells were subjected to the same differentiation protocol as parental (wild type) J1 ES cells. In all of the null cells, we detected aberrant downregulation of the Ant4 transcript following ES cells differentiation (Figure 3-16A). Of interest, Ant4 expression was not suppressed, but rather increased in differentiated double null cells (Figure 3-16A). It is noteworthy that Dnmt3a and Dnmt3b single null cells, but not Dnmt3a Dnmt3b double null cells, exhibited partial downregulation of the Ant4 transcript. Such downregulation could be due to partial or low de novo DNA methylation levels across the entire Ant4 5end region. In contrast, the pluripotent ES cell marker Oct4 was downregulated, while the primitive ectoderm marker, fibroblast growth factor (Fgf-5) and endoderm marker, transthyretin (Ttr) were upregulated following ES cell differentiation. These results indicate that Dnmt3a Dnmt3b double null ES cells proceed with a normal differentiation pattern. The COBRA assays confirmed that there was an absence of DNA methylation at the Ant4 promoter region in the double null ES cells (Figure 3-16B). Using a stable lentiviral expression vector we re-expressed Dnmt3a and Dnmt3b proteins in Dnmt3a Dnmt3b double null ES cells. We detected partial recovery of de novo DNA methylation activity following such reconstitution (Figure 3-17). These results indicate that functional Dnmt3a and Dnmt3b are required for repression of the Ant4 gene during ES cell differentiation. We conclude that Dnmt3 activity is responsible for DNA methylation-dependent transcriptional repression of the Ant4 promoter region during ES cell differentiation. Ant4 is a Germ Cell-specific Gene To determine whether the Ant4 transcript is specifically expressed in undifferentiated ES cells, we initially used a BLAST search against EST databases. An in silico analysis of available EST data (http://www.ncbi.nlm.nih.gov/BLAST/) revealed


49 that Ant4 expression is highly restricted to male germ cells. We used full-length Ant4 cDNA as a query sequence and found a total of 8 EST derived cDNA clones (with scores of >200 bits). All clones identified were from adult testis. We then investigated expression patterns of Ant4 in adult mouse organs using northern blot analysis. The Ant4 mRNA was found specifically in testes, at the predicted ~1.6 kb transcript size (Figure 3-18), while the previously identified Ant isoforms, Ant1 and Ant2, were expressed in all other non-germ cell organs, but absent in testes. More significantly, our data indicates that Ant4 could be the dominant ADP/ATP carrier in the male germ line. The Ant4 mRNA was undetectable in other organs including stomach, small intestine, skeletal muscle, ovary, thymus, uterus, and placenta (data not shown). In conclusion, Ant4 expression as analyzed by northern blot, indicates a male germ cell-specific expression of the Ant4 gene. We then examined which cells within the testes expressed the Ant4 transcript using in situ RNA hybridization (Figure 3-19). The results obtained from in situ hybridization with riboprobes confirmed the presence of Ant4 mRNA within testicular tissue. The strong cytoplasmic staining of spermatogonia, spermatocytes and spermatids within the seminiferous tubules, coupled with the lack of signal in interstitial, capillary and capsular cells suggests that Ant4 transcripts are localized in testicular germ cells. Of interest, it appears that Ant4 expression is absent in mature sperm. Staining performed on liver sections was negative, and the sense probe did not hybridize to either tissue type as expected. These data indicate that Ant4 is specifically expressed in murine testicular germ cells.


50 Northern blot analyses using whole ovaries did not detect any Ant4 gene expression (described above). To evaluate Ant4 expression in the developing female germ cells, mainly primordial germ follicles, we performed immunohistochemistry in adult mice ovaries. Ovaries were collected from female mouse animals, and fresh sections were frozen in liquid nitrogen. We stained ovary sections using Ant4 purified antibodies, and found that the Ant4 protein is selectively expressed in the cytoplasm of the growing oocytes (Figure 3-20). In contrast, staining performed on liver sections was negative. Additionally, we did not detect any Ant4 signal in oocytes nuclei nor in any other cell type within the ovaries (ex. follicular cells, fibrocytes, endothelial cells). The Ant4 staining was readily detected in primordial follicular, multilaminar primary follicular, and secondary follicular stages of oocyte development. In conclusion, we found that Ant4 is strongly expressed in developing gametes in both testis and ovary. Similar data were obtained using in situ RNA hybridization with riboprobes against Ant4 transcript (data not shown). Additionally, Ant4 was found to be expressed in pluripotent primordial germ cells (PGCs), obtained from E11.5 and 12.5 days post coitum (dpc) genital ridges and purified using anti-SSEA1 magnetic beads (Figure 3-21). This indicates that Ant4 is expressed in premeiotic fetal germ cells. Ant4 Promoter DNA Methylation in Normal Adult Organs Since CpG-rich promoters are typically hypomethylated in all adult cells, it is important to find out whether the Ant4 promoter region is also hypomethylated in normal adult tissues, which do not express the Ant4 gene. To that end, we used bisulfite sequencing to analyze the Ant4 promoter for methylation patterns between nucleotides


51 -250 to -55 relative to the translation start site. We collected DNAs from four adult mouse organs. Our findings demonstrate that the Ant4 promoter sequences were uniformly and heavily methylated in the majority of adult somatic tissues (Figure 3-22). However, Ant4 promoter sequences obtained from testis were nearly completely unmethylated, while a small minority was heavily methylated. This minority could potentially represent testicular somatic parenchymal cells, such as Sertoli cells or fibroblasts. Since the adult murine testicular tissue contains a majority of germ line cells and a minority (<15%) of somatic cells (102), our findings are in agreement with the notion that Ant4 is selectively expressed only in germ line cells, and unmethylated only in germ cells. Using a combined bisulfite restricton analysis (COBRA) method, we detected a uniform, albeit lower methylation of the methylation sensitive HhaI restriction site located in the Ant4 promoter (Figure 3-23). To conclude, our findings are consistent with the notion that DNA methylation is the primary mechanism controlling Ant4 expression in adult mouse organs.


52 ES EBMseIBstuI MseI MseIBstuI MseI Methylation, unchangedMethylation, decreasedafter differentiationMethyaltion, increasedafter differentiationA B Figure 3-1 Morphology of ES cells and methylation sensitive restriction fingerprinting (MSRF) method outline. A, The ES cells grow as uniform compact colonies, while differentiated cells form cystic outgrowths with many cell types. B, MSRF outline: genomic DNA is either digested with BstuI or BstuI/MseI restriction enzymes. Diagram depicts several outcomes that can be screened for using the MSRF method.


53 Table 3-1 Characteristics of MSRF derived differentially methylated fragments in ES differentiation model. MF ES EB 5 EB 10 Chromosomal Position of BstUI Homology GenBank Acession number Context CpGisland 1 chr13_random: 570600 RIKENcDNA 1700034J06 BC050810 5end Yes 2 chr2: 158,677,844 Viaat BC052020 5end Yes 3 chr5: 105028251 Stx18 AK007700 Body Yes 4 chr19: 54784281 Vti1a BC019386 Body Yes 5 chr15: 101767270 Nr4A1 BC004770 3end Yes 6 chr9: 26109765 chr3: 10936716 chr8: 72282211 7 chr9: 61676565 Tle3 AK122524 5end No 8 crh6: 85732846 EST AK129466 Body Yes 9 chr1: 22511570 EST BC055294 Body No 10 chr15: 83722470 EST AK005608 Body Yes BLAT search results using April 2005 freeze. MF, methylated fragment. White squares, no methylation. Black squares, high methylation. 5end, the MF is found in the 5end region of a gene or in its first exon. 3end, the MF is found in the 3end region of a gene or in its last exon. Body, the MF is found within the genomic structure of a gene. -, data not available.


54 RIKEN cDNA 1700034J06-actinNr4A1 ES cellsEB 5EB 10 AK005608 RIKEN cDNA 1700034J06Nr4A1AK005608 0.1 kb 0.1kb 10kb A B Figure 3-2 RT-PCR analyses of levels of RIKENcDNA 1700034J06, Nr4A1, AK005608, and -actin transcripts during ES cell differentiation. A, Schematic diagram of four genomic regions frequently methylated during ES cell differentiation. The open rectangular boxes indicate exons. Arrows indicate the MF fragments identified during MSRF analysis. B, RT-PCR analysis of RIKENcDNA 1700034J06, Viaat, AK005608, and -actin transcripts following ES cell differentiation. Total RNA was extracted from undifferentiated ES cells and differentiating embryoid bodies (days 5 and 10).


55 dO EB 5 EB 1O dO EB 5 EB 1O WTDnmt3a,3b -/-(double knockout) Ant4-ActinOct4DazlPiwil2Rnf17EB 1O O O.1 1 1O 1OO M 5-aza-dCWT ABC Figure 3-3 Germ cell-specific genes are repressed by DNA methylation during ES cells differentiation. A, Expression of the Ant4, Dazl, Piwil2, Rnf17, and Oct4 genes in wild type ES cells and B, Dnmt3a Dnmt3b double null ES cells. Oct4, is a marker for undifferentiated ES cells. C, Germ cell-specific gene re-expression by 5-aza-dC. EBs were treated with various concentrations (0-10M) of 5-aza-dC for 2 days prior to cell harvesting (day 10).


56 RIKEN cDNA 1700034J06DazlPiwil2Rnf17 O 1 1O 1OO M 5-aza-dCNIH3T3s -ActinOct4 Figure 3-4 Germ cell-specific genes are repressed by DNA in NIH3T3 somatic cell line. Expression of the RikencDNA 1700034J06, Dazl, Piwil2, Rnf17, and Oct4 genes in NIH3T3 somatic cell line. NIH3T3 somatic cells were treated with various concentrations (0-100M) of 5-aza-dC for 2 days prior to cell harvesting.


57 Ant4Piwil2ES cellsEBs -250-55 -88 Rnf17 -130+135+145 Figure 3-5 Germ cell-specific promoters are repressed by DNA methylation during ES cell differentiation. DNA methylation of the Ant4, Piwil2 and Rnf17 promoters in wild type ES cells and differentiated embryoid bodies (day 10) assayed by bisulfite sequencing of individual clones.


58 MseIMseI/BstUI MseIMseIMseI/BstUI ES CellsEB 5EB 10MF1 MseI/BstUI AGCGGCCGCG GTGTCGAAGACAGCTGTGGCGCCCATCGAGCGTGTGAAGCTGCTGCTGCAGGTACAGGCGTCCTCCAAGCAGATAAGCCCTGAGGCGCG CTACAAGGGCATGCTGGACTGCCTGGTGCGCATTCCTCGTGAGCAAGGTGCGTATGGCGCCGTGCTTGGCCTTAGCATCCCATACACGGGTGGGGTA B Figure 3-6 Identification of differentially methylated CpG-rich fragment in ES cells and EBs. A, Methylation sensitive restriction fingerprinting (MSRF): Genomic DNA was prepared from undifferentiated ES cells and in vitro differentiated to EBs (day 5 and day 10). DNA was digested either by MseI alone or MseI and BstUI, and subjected to PCR amplification using CpG rich 10-mer primers in the presence of radiolabeled dCTP. Amplified DNA fragments were separated in 4.5% polyacrylamide gels. A methylated fragment (MF1, arrowhead) appeared in EBs (day 5 and 10). B, Nucleotide sequence of MF1. Bold, primer sequence. Underlined, BstUI sites.


59 1 2 3 4 5 6 Exon 1CpG Island +151+345 234+ 310 + 295+ 0 MF 1 Ant4 (RIKEN cDNA 1700034J06) 16.7 kb Figure 3-7 MF1 genomic localization. MF1 nucleotide sequence is identical to exon 1/intron 1 boundry region of a previously unknown sequence, RIKEN cDNA 1700034J06. Due to significant amino acid similarity with other adenine nucleotide translocase genes, the novel gene was termed, adenine nucleotide translocase 4 (Ant4). Arrow represents translation initiation site. BLAT search results using April 2005 freeze.






62 Relative value to pGL2-control123456 -105-2186 -2186 -105-1166 -105-645 -105-503 -105-285 -503LUCLUCLUCLUCLUCLUC LUC SV40ENH R1 ES CellsNIH3T3 Figure 3-10 Analysis of Ant4 promoter activity by a luciferase reporter assay in R1 ES and NIH3T3 cells. Different portions of the Ant4 promoter were tested for luciferase activity. Relative luciferase activity is shown for each construct relative to the activity of the pGL2 control vector. Luciferase activity was assayed 24 hours after direct transfection of cells and is reported relative to the pGL2 control construct and Renilla Luciferase construct.


63 Relative value to pGL2-control0.250.50.7511.251.5 LUC SV40ENH -105-2186LUC UnmethylatedMethhylated Figure 3-11 Promoter hypermethylation silences expression of Ant4. Analysis of Ant4 promoter activity by a luciferase reporter assays in R1 ES cells. Relative luciferase activity is shown for 2kb Ant4 construct relative to the activity of the pGL2-control vector. The promoter insert and pGL2 basic vector were treated with SssI methylase. Luciferase activity was assayed 24 hours after direct transfection of cells and is reported relative to the unmethylated (open rectangle) pGL2-control construct.


64 0102030405060708090100% Methylation 0102030405060708090100% MethylationES Cells % Methylation% Methylation -1429-1196 -516+212 Figure 3-12 Ant4 promoter region is hypomethyated in undifferentiated ES cells. Summary of Ant4 methylation levels in ES cells is shown. For each primer pair, up to 14 clones were bisulfite sequenced to determine the percentage of methylation. The y-axis represents percentage methylation per CpG residue. Diagram at the bottom of the figure represents relative position of CpG residues within the 5-end regulatory region of the Ant4 gene. Arrow represents a major translation start site, black rectangle represents the first exon, and vertical lines mark the location of individual CpG residues.


65 0102030405060708090100% Methylation 0102030405060708090100% MethylationEB 10 % Methylation % Methylation -516+212 -1429-1196 9 x Figure 3-13 Ant4 promoter region undergoes DNA methylation in differentiated EB cells. Summary of Ant4 methylation levels in EB cells is shown. For each primer pair, up to 20 clones were bisulfite sequenced to determine the percentage of methylation. The y-axis represents percentage methylation per CpG residue. Diagram at the bottom of the figure represents relative position of CpG residues within the 5-end regulatory region of the Ant4 gene. Arrow represents a major translation start site, black rectangle represents the first exon, and vertical lines mark the location of individual CpG residues.


66 Ant4Ab + + + + Inputd0 d5 d0 d5 d0 d5Anti-Ac L9H3Anti-DiM L9H3IP -111 +99 -516+212 AB Figure 3-14 Ant4 promoter region undergoes covalent histone 3 changes during ES cell differentiation. A, Diagram represents relative position of primer pair used for this study. B, Genomic DNA from either undifferentiated ES cells of EB (day 5) was processed according to chromatin immunoprecipitation (Chip) protocol. Antibodies used in this study were either anti-acetylated lysine-9 histone-3 antibodies, or anti-dimethylated lysine-9 histone 3 antibodies. Input, non-immunoprecipitated genomic DNA.


67 222426283022242620 -actinAnt4ES cellsEB 5EB 10 O O.1 1 1O M 5-aza-dCAnt4-actinOct4ES cellsEB 5EB 10 Nanog AB Figure 3-15 Ant4 is repressed by DNA methylation during ES cell differentiation. A, Total RNA was extracted from ES cells and EBs. RNA expression levels of Ant4 and -actin were examined by RT-PCR (20 30 cycles). B, Ant4 derepression by 5-aza-dC. EBs were treated with various concentrations (0-10M) of 5-aza-dC for 2 days prior to cell harvesting (day 10). RNA expression levels of Ant4, Oct4, Nanog and -actin genes were examined by RT-PCR.


68 WTDnmt3a, 3b -/-Ant4-actin Oct4TtrFgf-5ES cellsEB 5EB 10 ES cellsEB 5EB 10 ES cellsEB 5EB 10 200 bp 100 bp Marker Methylation (%) 1 49 74 ES cellsEB 5EB 10 Dnmt3a -/-Dnmt3b -/ES cellsEB 5EB 10 ES cellsEB 5EB 10 ES cellsEB 5EB 10 ES cellsEB 5EB 10 AB Figure 3-16 Dnmt3 is required for Ant4 repression during ES cell differentiation. A, Expression of the Ant4 gene in wild type ES cells, Dnmt3a Dnmt3b double null ES cells, Dnmt3a null ES cells and Dnmt3b null ES cells. Oct4, Ttr, Fgf-5 are markers for undifferentiated ES cells, early visceral endoderm, and early ectoderm, respectively. B, Ant4 promoter DNA methylation determined by COBRA assay. DNA was extracted from wild type ES cells and Dnmt3a Dnmt3b null ES cells and treated with bisulfite. The Ant4 promoter region was amplified and subjected to overnight digestion with HhaI restriction enzyme, which cuts GCGC sites. DNA methylation of the CpG protects the site from bisulfite conversion. The digested DNA samples were separated in 4.5% polyacrylamide gels and visualized using a SyBr-green dye.


69 ES cellsEB ES cellsEB EB+3AB WTDnmt3a, 3b -/Figure 3-17 Dnmt3 is required for Ant4 repression during ES cell differentiation. DNA was extracted from wild type ES cells, Dnmt3a Dnmt3b null ES cells, and Dnmt3a Dnmt3b null ES cells stably transfected with Dnmt3a and Dnmt3b lentiviral expression vectors. Extracted DNAs were treated with bisulfite reagent. The Ant4 promoter region was amplified and subjected to overnight digestion with HhaI restriction enzyme, which cuts GCGC sites. DNA methylation of the CpG protects the site from bisulfite conversion. The digested DNA samples were separated in 4.5% polyacrylamide gels and visualized using a SyBr-green dye.


70 Ant2-actin LungLiverKidneySkeletal MuscleBrainSpleenHeartTestis 2.41.35 Ant1Ant4 2.41.35 2.41.35 2.41.35(kb) Figure 3-18 Ant4 is expressed selectively in testis. Northern blot analysis of Ant4 mRNA expression in various organs from adult mice (8 weeks old). The blot was hybridized to specific cDNA probes for Ant4, Ant1, Ant2 and -actin.


71 Antisense SenseLiverTestis Figure 3-19 Localization of Ant4 demonstrated by in situ hybridization. Digoxigenin-labeled riboprobes were applied to 10 micrometer freshly frozen murine testes and liver sections (8 weeks old). A positive signal is indicated by the presence of a blue deposit (BCIP-NBT) within the cytoplasm. Slides were counter-stained in nuclear fast red (pink). Germ cells within the seminiferous tubules stained positive with the anti-sense probe but not with the sense probe. Ant4 was not detected in any of the liver tissue, nor was it found to be in the interstitial cells, capillaries or capsules of the testes.


72 LiverTestisOvary10X40X Figure 3-20 Ant4 is expressed in male and female germ cells. Immunohistochemical analysis of Ant4 expression in testis, ovary and liver. Mouse ovary, testis and liver were harvested from 3 month old mice, and frozen sections were stained with affinity-purified rabbit polyclonal anti-Ant4 antibodies raised against the N-terminal Ant4 peptide (1-MSNESSKKQSSKKALFD-17) and visualized using horse radish peroxidase (brown). Slides were counterstained using Light Green SF Yellowish.


73 Ant4HPRT Figure 3-21 Ant4 is expressed in primordial germ cells. Ant4 mRNA is expressed in purified primordial germ cells. Primordial germ cells were obtained from E11.5 and 12.5 dpc genital ridges and purified using anti-SSEA1 magnetic beads. The immunodepleted fraction (dep) refers to cells not retained on the magnetic column. Individual samples were subjected to RT-PCR analysis. +/indicates whether reverse transcriptase was added to reaction mixture.


74 -250-55 0102030405060708090100% Methylation 0102030405060708090100% MethylationBrainTestis 0102030405060708090100% Methylation 0102030405060708090100% MethylationKidneyLung Figure 3-22 Bisulfite analysis of the Ant4 promoter in various organs from adult mice (8 weeks old). DNA samples were extracted from the indicated mice organs and subjected to bisulfite conversion. Several clones, usually 7 to 8 individual clones were sequenced for each samples.


75 Testis LungLiverKidneySmall IntestineSkeletal MuscleBrain Spleen Heart 63 51 83 77 9.225 54 67 63 Methylation (%) Figure 3-23 COBRA analysis of the Ant4 promoter for DNA methylation levels in various adult mice organs. DNA samples were extracted from the indicated murine organs and subjected to bisulfite conversion.


CHAPTER 4 DISCUSSION On Newly Identified Differentially Methylated Genomic Regions Although previous DNA methylation studies in ES cells have accumulated considerable knowledge concerning the enumeration of differentially methylated regions and the cooperativity requirement for Dnmts, little is known about the genomic position of differentially methylated regions, and subsequently about the nature of target genes. We employed a powerful genome wide screening method, termed MSRF, to identify differentially methylated genomic regions during ES cell differentiation. In the past, MSRF has been used to isolate aberrantly methylated DNA fragments in prostate, breast, and nasopharyngeal cancers. Similar methods, such as methylation-sensitive arbitrarily primed PCR (AP-PCR), have been developed to determine how repetitive DNA elements become methylated (55). In our current study, we identified ten genomic loci that exhibit differential DNA methylation patterns between undifferentiated ES cells and differentiated embryoid bodies. On a genome wide scale, our data likely represents less than 5% of all differentially methylated regions in ES cells and differentiated embryoid bodies. According to earlier studies, 247 differentially methylated regions exist between ES cells and differentiated embryoid bodies (103). However, the data generated from such studies, due to assay limitations of utilizing only certain restriction enzymes (ie NotI), most likely underrepresented the absolute number of differentially methylated regions. The DNA methylation of selected genomic regions, such as CpG islands, requires the cooperative action of Dnmt1, Dnmt3a, and Dnmt3b enzymes in 76


77 undifferentiated ES cells. In absence of Dnmt1 or Dnmt3a and Dnmt3b proteins by genomic homozygous deletion, ES cells lose their DNA methylation in an identical set of 236 genomic loci. Similarly, methylation of the class II retroviral sequence CII-d and the type A repeats in the LINE repetitive elements require cooperativity between the DNA methyltransferases (55). On Newly Identified DNA Methylation Controlled Genes To extend our MSRF findings, we studied the effects of MF associated differential methylation on transcriptional activity of neighboring genes. Using semi-quantitative RT-PCR, we established an inverse relationship between mRNA expression and hypermethylation of the 4 cognate neighboring genes. Although our findings are modest in light of the great number of differentially methylated fragments on a genome wide scale, current knowledge regarding genomic location of MFs is insufficient. To date, the vast majority of DNA methlylation screening studies did not look at the effects of DNA methylation on cognate neighboring genes. To our knowledge, such an inverse relationship has been shown for only two other genes, Sall3 (104), and PMP4 (105). Our findings indicate that transcripts RIKENcDNA 1700034J06, Nr4A1, and AK005608 expression correlates inversely with DNA methylation of neighboring differentially methylated regions. To that extent, we believe our findings are significant. Our findings also indicate that less than half of cognate neighboring genes is potentially regulated by DNA methylation. Such data indicates that there could be a high rate of false positive results associated with genome wide DNA methylation screening methods. In fact, a recent independent study points to a similar conclusion (93).


78 On the Link Between DNA Methylation and Germ-specific Genes Undifferentiated ES cells are known to be transcriptionally permissive to the expression of certain germ line cell specific genes (85). This is most likely due to a conserved mode of transcriptional regulation between ES and germ cells, but it might just reflect the fact that ES cells are derived from largely unmethylated pre-implantation embryos (ex. blastocyst). Our results indicate that DNA methylation plays a role in the regulation of a subgroup of germ cell-specific genes during ES cells differentiation. We confirmed that Dazl, Piwil2, and Rnf17 transcripts undergo downregulation in a DNA methylation dependent fashion. We have also analyzed the expression of other germ cell-specific genes, such as cytochrome c (Cyt cT), melanoma associated antigens (MAGE), Acrosin, and Sry (data not shown). We found their expression to be either low in undifferentiated ES cells (for Sry) or upregulated after differentiation (for the remainder). We believe that at least two criteria are useful when determining whether germ cell-specific gene expression is controlled by DNA methylation in ES cell derived differentiated cells. First, the suspected gene must be expressed in ES cell. Second, the suspected gene must be expressed in both female and male germ cells. DNA methylation acts as a primary mechanism to control transcription in a subset of testis specific genes. One such group is MAGE genes, which are selectively hypomethylated in testis, at the location where transcription from MAGE promoters occurs. In light of the fact that the majority of CpG islands are unmethhylated in adult somatic cells, it is particularly unusual that MAGE promoters are hypermethylated in all but germ cells. DNA methylation of such germ cell-specific promoters maintains transcriptional repression, since 5-aza-dC treatment readily causes re-expression of the gene. The exact molecular mechanisms responsible for such widespread DNA


79 methlyation are beginning to be elucidated. In a recent report, the Boon group showed that transcriptional activity, mediated by ubiquitous transcription factors, can protect MAGE promoters from DNA methylation (106). Such an elegant promoter-dependent mechanism would be consistent with the major role that DNA methylation exerts on MAGE promoters. More importantly, the presence of transcription factors as a ubiquitous cellular program is not testis-specific and thus fails to explain the tissue-restricted expression of MAGE genes. Nevertheless, it appears likely that a promoter-dependent mechanism could be activated following treatment by ubiquitous DNA methylation inhibiting agents, such as 5-aza-dC. After 5-aza-dC, demethylated promoters would remain unmethylated due to the transcription activity of ubiquitous transcription factors. Recent reports also demonstrate that DNA methylation is involved in the transcriptional regulation of several other germ cell-specific genes, including testis-specific phosphoglycerate kinase 2 (pgk2) (107), pyruvate dehydrogenase alpha-subunit (pdha-2) (108), and testis specific gene, Tact1/Actl7b (109). Since Ant4 is expressed exclusively in the testis and developing oocytes in the adult mouse, the regulation of Ant4 transcription may be closely related to that of other germ cell-specific genes. Of interest, the promoter region of Ant4 contains the chicken ovalbumin upstream promoter transcription factor (COUP-TF) binding element at -586 bp, which has been implicated in the selective silencing of the proto-oncogene,c-mos, in somatic cells (110,111). In addition, the Ant4 promoter has multiple elements that potentially bind to Sox/Sry factors, which have also been implicated in germ cell-specific transcription. By elucidating the role of DNA methylation in the regulation of gene expression in pluripotent cells, we


80 may uncover common genetic regulatory pathways underlying the transition between pluripotent stem/germ cells and somatic cells. On the Newly Identified Adenine Nucleotide Translocase, Ant4 We have identified a novel isoform of the adenine nucleotide translocase genes, termed Ant4, using a screen of differential DNA methylation patterns in ES cells and embryoid bodies. The selective expression status of Ant4 in undifferentiated ES cells, primordial germ cells, and germ cells, indicates that Ant4 is a pluripotent cell specific isoform of the adenine nucleotide translocase family. This is in contrast with the previously identified isoforms, Ant1 and Ant2, which are predominately expressed in somatic cells. The deduced amino acid sequence predicts Ant4 as a functional adenine nucleotide translocase. Like the other Ant isoforms, the Ant4 protein localizes to the mitochondria. Additionally, both coding sequences and genomic architecture are conserved between mouse and human orthologs. Concurrently with our own investigation, the Palmieri group has reported an independent discovery of the human Ant4 gene. Human Ant4 was shown to (i) catalyze obligatory antiport between ADP and ATP, (ii) catalyze electrophoretic exchange between ADP and ATP, (iii) and have tissue restricted expression with high expression in testis and liver, while Ant4 mRNA was not detectable in any of the other tissues (112). It is intriguing that ES and germ cells have a specific isoform for Ant. This finding might indicate a unique mitochondrial energy metabolism in such pluripotent cells. Developing spermatocytes are known to express testis-specific isoforms of pyruvate dehydrogenase complex E1a subunit, Pdha-2 (108), testis specific cytochrome c, Cyt cT (113), and subunit VIb of cytochrome c oxidase (114). Interestingly, Cyt cT null mice exhibit early testicular atrophy and apoptosis. Male germ cells respire by oxidative


81 phosphorylation, mainly utilizing lactate as an energy source. Thus, Ant4 could play a pivotal role in supplying ATP from the mitochondrial matrix to the cytosol in germ cells. Some major consequence of Ant4 deletion could be (i) an accumulation of ATP nucleotides in mitochondria, (ii) hyperpolarization of the inner mitochonrial membrane, (iii) lactic acedemia within the testis, (iv) or a compensatory increase in mitochondrial biosynthesis. Our future studies utilizing Ant4 null ES cells and Ant4 null mice will elucidate the in vivo function of the Ant4 protein in spermatogenesis and ES cell maintenance (Figure 4-1). The present data indicate that de novo DNA methylation, mediated by Dnmt3a and Dnmt3b, plays a pivotal role in gene repression of Ant4 during ES cell differentiation. In adult organs, as well as during in vitro ES cell differentiation, Ant4 expression levels inversely correlate with the DNA methylation status of the gene. Further, Ant4 is readily derepressed by the addition of the demethylating agent 5-aza-dC. In contrast, Oct4, a gene specifically expressed in pluripotent stem cells and primordial germ cells, is not derepressed by 5-aza-dC. This implies that transcription factors involved in Ant4 gene expression are present and active in differentiated EBs, and that DNA methylation may play a primary role in the suppression of the Ant4 gene in somatic cells. We confirmed derepression of Ant4, but not Oct4, by addition of 5-aza-dC into two other somatic cell lines. Further, this hypothesis was supported by the fact that a functional deletion of Dnmt3a and Dnmt3b led to failure of Ant4 gene suppression, but not Oct4, during ES cell differentiation. Taken together, these data suggest that DNA methylation is required for the transcriptional repression of the Ant4 gene.


82 Recent evidence suggests that there is a deregulation of the DNA methylation apparatus during cancer development. Indeed, the genome wide hypomethylation that is frequently observed in cancer cells can lead to the reactivation of genes silenced by DNA methylation (115). Members of the cancer-testis family of antigens or associated genes (CTAs) are encoded by genes expressed by cancers of diverse histological origin. These genes are typically absent in normal adult tissues, with the exception of male germ cells. Epigenetic events may represent the unique mechanism regulating the expression of CTAs in cancer cells, with DNA methylation playing a the major role. In fact, a correlation between hypomethylated CpG dinucleotides in MAGE promoters and their expression has been found in neoplastic cell lines (106) and tissues (116). Based on how Ant4s expression parallels that of CTAs such as MAGE, we examined whether Ant4 gene was also expressed in human cancer cell lines. The Ant4 gene was indeed expressed in some cancer cell lines, implicating that the gene is aberrantly derepressed in malignant cells. Since accelerated ATP turnover would be beneficial to rapidly proliferating cancer cells, Ant4 derepression might be involved in cancer progression. As a future direction, providing insights into how Ant4 functions in cancer cells would be of significant benefit.


83 NH2COOH TMTMTMTMTMTM Ant4 locus(6.3kb) 1 kbTargeting construct 1 2 3 4 5 6 1 5 6 DT IRES-Gal PGK-Neoprobe IRES-Gal PGK-Neo1 5 6Targeted allele(4.9kb) BBBBBA B Figure 4-1 Disruption of Ant4. A, The Ant4 protein, arrow indicates relative insertion sites of the targenting construct. Transmembrane (TM) domain. B, Targeted disruption of Ant4. DT, diptheria toxin; IRES-Gal, internal ribosomal entry site-beta galactosidase; PGK-Neo, phosphoglycerate kinase promoter-neomycin. B-BamHI site used for screening targeted allele.


LIST OF REFERENCES 1. Morgenegg, G., Celio, M. R., Malfoy, B., Leng, M., and Kuenzle, C. C. (1983) Nature 303, 540-543 2. Adams, R. L. P., and Burdon, R. H. (1985) Molecular Biology of DNA Methylation. Springer Series in Molecular Biology (Rich, A., Ed.), Springer-Verlag, New York 3. Kuo, T. T., Huang, T. C., and Teng, M. H. (1968) J. Mol. Biol. 34, 373-375 4. Sager, R., and Kitchin, R. (1975) Science 189, 426-433 5. Dodge, J. E., Ramsahoye, B. H., Wo, Z. G., Okano, M., and Li, E. (2002) Gene 289, 41-48 6. Doerfler, W. (1984) Curr. Top. Microbiol. Immunol. 108, 79-98 7. Ramsahoye, B. H., Biniszkiewicz, D., Lyko, F., Clark, V., Bird, A. P., and Jaenisch, R. (2000) Proceedings of the National Academy of Sciences of the United States of America 97, 5237-5242 8. Li, E., Bestor, T. H., and Jaenisch, R. (1992) Cell 69, 915-926 9. Lei, H., Oh, S. P., Okano, M., Juttermann, R., Goss, K. A., Jaenisch, R., and Li, E. (1996) Development 122, 3195-3205 10. Okano, M., Bell, D. W., Haber, D. A., and Li, E. (1999) Cell 99, 247-257 11. Szyf, M., Rouleau, J., Theberge, J., and Bozovic, V. (1992) Journal of Biological Chemistry 267, 12831-12836 12. Maatouk, D. M., and Resnick, J. L. (2003) Developmental Biology 258, 201-208 13. Razin, A., Webb, C., Szyf, M., Yisraeli, J., Rosenthal, A., Naveh-Many, T., Sciaky-Gallili, N., and Cedar, H. (1984) Proc. Natl. Acad. Sci. U S A 81, 2275-2279 14. Gidekel, S., and Bergman, Y. (2002) J.Biol. Chem. 277, 34521-34530 15. Reik, W., Dean, W., and Walter, J. (2001) Science 293, 1089-1093 16. Durcova-Hills, G., Ainscough, J., and McLaren, A. (2001) Differentiation 68, 220-226 17. Niwa, H., Miyazaki, J., and Smith, A. G. (2000) Nat. Genet. 24, 372-376 18. Chambers, I., Colby, D., Robertson, M., Nichols, J., Lee, S., Tweedie, S., and Smith, A. (2003) Cell 113, 643-655 84


85 19. Mitsui, K., Tokuzawa, Y., Itoh, H., Segawa, K., Murakami, M., Takahashi, K., Maruyama, M., Maeda, M., and Yamanaka, S. (2003) Cell 113, 631-642 20. Shiota, K., Kogo, Y., Ohgane, J., Imamura, T., Urano, A., Nishino, K., Tanaka, S., and Hattori, N. (2002) Genes Cells 7, 961-969 21. Kremenskoy, M., Kremenska, Y., Ohgane, J., Hattori, N., Tanaka, S., Hashizume, K., and Shiota, K. (2003) Biochem. Biophys. Res. Commun. 311, 884-890 22. Ohgane, J., Hattori, N., Oda, M., Tanaka, S., and Shiota, K. (2002) Biochem. Biophys. Res. Commun. 290, 701-706 23. Lee, J. H., Hart, S. R. L., and Skalnik, D. G. (2004) Genesis 38, 32-38 24. Humpherys, D., Eggan, K., Akutsu, H., Hochedlinger, K., Rideout, W. M., Biniszkiewicz, D., Yanagimachi, R., and Jaenisch, R. (2001) Science 293, 95-97 25. Tweedie, S., Charlton, J., Clark, V., and Bird, A. (1997) Mol. Cell. Biol. 17, 1469-1475 26. Chen, C., Yang, M. C. K., and Yang, T. P. (2001) Journal of Biological Chemistry 276, 320-328 27. Santoro, R., and Grummt, I. (2001) Molecular Cell 8, 719-725 28. Lorincz, M. C., Schubeler, D., Hutchinson, S. R., Dickerson, D. R., and Groudine, M. (2002) Molecular and Cellular Biology 22, 7572-7580 29. Siegfried, Z., Eden, S., Mendelsohn, M., Feng, X., Tsuberi, B. Z., and Cedar, H. (1999) Nature Genetics 22, 203-206 30. Hejnar, J., Hajkova, P., Plachy, J., Elleder, D., Stepanets, V., and Svoboda, J. (2001) Proc. Natl. Acad. Sci. U S A 98, 565-569 31. Hashimshony, T., Zhang, J., Keshet, I., Bustin, M., and Cedar, H. (2003) Nat. Genet. 34, 187-192 32. Schubeler, D., Lorincz, M. C., Cimbora, D. M., Telling, A., Feng, Y. Q., Bouhassira, E. E., and Groudine, M. (2000) Mol. Cell. Biol. 20, 9103-9112 33. Takizawa, T., Nakashima, K., Namihira, M., Ochiai, W., Uemura, A., Yanagisawa, M., Fujita, N., Nakao, M., and Taga, T. (2001) Dev. Cell. 1, 749-758 34. Lunyak, V. V., Burgess, R., Prefontaine, G. G., Nelson, C., Sze, S. H., Chenoweth, J., Schwartz, P., Pevzner, P. A., Glass, C., Mandel, G., and Rosenfeld, M. G. (2002) Science 298, 1747-1752 35. Mal, A., and Harter, M. L. (2003) Proc. Natl. Acad. Sci. U S A 100, 1735-1739


86 36. Ben-Shushan, E., Pikarsky, E., Klar, A., and Bergman, Y. (1993) Mol. Cell. Biol. 13, 891-901 37. Hershko, A. Y., Kafri, T., Fainsod, A., and Razin, A. (2003) Gene 302, 65-72 38. Tremblay, K. D., Saam, J. R., Ingram, R. S., Tilghman, S. M., and Bartolomei, M. S. (1995) Nat. Genet. 9, 407-413 39. Hata, K., Okano, M., Lei, H., and Li, E. (2002) Development 129, 1983-1993 40. Pant, V., Mariano, P., Kanduri, C., Mattsson, A., Lobanenkov, V., Heuchel, R., and Ohlsson, R. (2003) Genes. Dev. 17, 586-590 41. Bakin, A. V., and Curran, T. (1999) Science 283, 387-390 42. Eden, A., Gaudet, F., Waghmare, A., and Jaenisch, R. (2003) Science 300, 455 43. Nguyen, C. T., Weisenberger, D. J., Velicescu, M., Gonzales, F. A., Lin, J. C., Liang, G., and Jones, P. A. (2002) Cancer. Res. 62, 6456-6461 44. Liang, G., Gonzales, F. A., Jones, P. A., Orntoft, T. F., and Thykjaer, T. (2002) Cancer. Res. 62, 961-966 45. Velicescu, M., Weisenberger, D. J., Gonzales, F. A., Tsai, Y. C., Nguyen, C. T., and Jones, P. A. (2002) Cancer. Res. 62, 2378-2384 46. Di Croce, L., Raker, V. A., Corsaro, M., Fazi, F., Fanelli, M., Faretta, M., Fuks, F., Lo Coco, F., Kouzarides, T., Nervi, C., Minucci, S., and Pelicci, P. G. (2002) Science 295, 1079-1082 47. Zardo, G., Reale, A., Passananti, C., Pradhan, S., Buontempo, S., De Matteis, G., Adams, R. L., and Caiafa, P. (2002) Faseb J. 16, 1319-1321 48. Rountree, M. R., Bachman, K. E., and Baylin, S. B. (2000) Nat. Genet. 25, 269-277 49. Rhee, I., Bachman, K. E., Park, B. H., Jair, K. W., Yen, R. W., Schuebel, K. E., Cui, H., Feinberg, A. P., Lengauer, C., Kinzler, K. W., Baylin, S. B., and Vogelstein, B. (2002) Nature 416, 552-556 50. Rhee, I., Jair, K. W., Yen, R. W., Lengauer, C., Herman, J. G., Kinzler, K. W., Vogelstein, B., Baylin, S. B., and Schuebel, K. E. (2000) Nature 404, 1003-1007 51. Okano, M., Bell, D. W., Haber, D. A., and Li, E. (1999) Cell 99, 247-257 52. Chen, T., Ueda, Y., Xie, S., and Li, E. (2002) J. Biol. Chem. 277, 38746-38754 53. Weisenberger, D. J., Velicescu, M., Preciado-Lopez, M. A., Gonzales, F. A., Tsai, Y. C., Liang, G., and Jones, P. A. (2002) Gene 298, 91-99


87 54. Fatemi, M., Hermann, A., Gowher, H., and Jeltsch, A. (2002) Eur. J. Biochem. 269, 4981-4984 55. Liang, G., Chan, M. F., Tomigahara, Y., Tsai, Y. C., Gonzales, F. A., Li, E., Laird, P. W., and Jones, P. A. (2002) Mol. Cell. Biol. 22, 480-491 56. Aapola, U., Lyle, R., Krohn, K., Antonarakis, S. E., and Peterson, P. (2001) Cytogenet. Cell. Genet. 92, 122-126 57. Bourc'his, D., Xu, G. L., Lin, C. S., Bollman, B., and Bestor, T. H. (2001) Science 294, 2536-2539 58. Chedin, F., Lieber, M. R., and Hsieh, C. L. (2002) Proc. Natl. Acad. Sci. U S A 99, 16916-16921 59. Jones, P. L., Veenstra, G. J., Wade, P. A., Vermaak, D., Kass, S. U., Landsberger, N., Strouboulis, J., and Wolffe, A. P. (1998) Nat. Genet. 19, 187-191 60. Lembo, F., Pero, R., Angrisano, T., Vitiello, C., Iuliano, R., Bruni, C. B., and Chiariotti, L. (2003) Mol. Cell. Biol. 23, 1656-1665 61. Festenstein, R., Sharghi-Namini, S., Fox, M., Roderick, K., Tolaini, M., Norton, T., Saveliev, A., Kioussis, D., and Singh, P. (1999) Nat. Genet. 23, 457-461 62. Hwang, K. K., and Worman, H. J. (2002) Biochem. Biophys. Res. Commun. 293, 1217-1222 63. Lo, W. S., Duggan, L., Tolga, N. C., Emre, Belotserkovskya, R., Lane, W. S., Shiekhattar, R., and Berger, S. L. (2001) Science 293, 1142-1146 64. Noma, K., Allis, C. D., and Grewal, S. I. (2001) Science 293, 1150-1155 65. Hall, I. M., Shankaranarayana, G. D., Noma, K., Ayoub, N., Cohen, A., and Grewal, S. I. (2002) Science 297, 2232-2237 66. Cai, S., Han, H. J., and Kohwi-Shigematsu, T. (2003) Nat. Genet. 34, 42-51 67. Hamaguchi, I., Woods, N. B., Panagopoulos, I., Andersson, E., Mikkola, H., Fahlman, C., Zufferey, R., Carlsson, L., Trono, D., and Karlsson, S. (2000) J. Virol. 74, 10778-10784 68. Brenner, C., Deplus, R., Didelot, C., Loriot, A., Vire, E., De Smet, C., Gutierrez, A., Danovi, D., Bernard, D., Boon, T., Pelicci, P. G., Amati, B., Kouzarides, T., de Launoit, Y., Di Croce, L., and Fuks, F. (2005) Embo. J. 24, 336-346 69. Jeffery, L., and Nakielny, S. (2004) Journal of Biological Chemistry 279, 49479-49487 70. Kawasaki, H., and Taira, K. (2004) Nature 431, 878-878


88 71. Lin, I. G., Tomzynski, T. J., Ou, Q. L., and Hsieh, C. L. (2000) Molecular and Cellular Biology 20, 2343-2349 72. Fedoriw, A. M., Stein, P., Svoboda, P., Schultz, R. M., and Bartolomei, M. S. (2004) Science 303, 238-240 73. Robbins, P. B., Yu, X. J., Skelton, D. M., Pepper, K. A., Wasserman, R. M., Zhu, L., and Kohn, D. B. (1997) J. Virol. 71, 9466-9474 74. Juttermann, R., Li, E., and Jaenisch, R. (1994) Proc. Natl. Acad. Sci. U S A 91, 11797-11801 75. Fuso, A., Cavallaro, R. A., Orru, L., Buttarelli, F. R., and Scarpa, S. (2001) FEBS Lett. 508, 337-340 76. Friso, S., and Choi, S. W. (2002) J. Nutr. 132, 2382S-2387S 77. Poirier, L. A. (2002) J. Nutr. 132, 2336S-2339S 78. Jones, P. A., Taylor, S. M., Mohandas, T., and Shapiro, L. J. (1982) Proceedings of the National Academy of Sciences of the United States of America-Biological Sciences 79, 1215-1219 79. Humpherys, D., Eggan, K., Akutsu, H., Hochedlinger, K., Rideout, W. M., 3rd, Biniszkiewicz, D., Yanagimachi, R., and Jaenisch, R. (2001) Science 293, 95-97 80. Schreiber, S. L., and Bernstein, B. E. (2002) Cell 111, 771-778 81. Richards, E. J., and Elgin, S. C. (2002) Cell 108, 489-500 82. Pannell, D., Osborne, C. S., Yao, S., Sukonnik, T., Pasceri, P., Karaiskakis, A., Okano, M., Li, E., Lipshitz, H. D., and Ellis, J. (2000) Embo. J. 19, 5884-5894 83. Oka, M., Tagoku, K., Russell, T. L., Nakano, Y., Hamazaki, T., Meyer, E. M., Yokota, T., and Terada, N. (2002) Molecular Biology of the Cell 13, 1274-1281 84. Huang, T. H., Laux, D. E., Hamlin, B. C., Tran, P., Tran, H., and Lubahn, D. B. (1997) Cancer Res. 57, 1030-1034 85. Geijsen, N., Horoschak, M., Kim, K., Gribnau, J., Eggan, K., and Daley, G. Q. (2004) Nature 427, 148-154 86. Grewal, S. I., and Moazed, D. (2003) Science 301, 798-802 87. Bird, A. P., and Wolffe, A. P. (1999) Cell 99, 451-454 88. Tada, M., Takahama, Y., Abe, K., Nakatsuji, N., and Tada, T. (2001) Curr. Biol. 11, 1553-1558

PAGE 100

89 89. Evans, M. J., and Kaufman, M. H. (1981) Nature 292, 154-156 90. Okano, M., Xie, S., and Li, E. (1998) Nat. Genet. 19, 219-220 91. Huntriss, J., Hinkins, M., Oliver, B., Harris, S. E., Beazley, J. C., Rutherford, A. J., Gosden, R. G., Lanzendorf, S. E., and Picton, H. M. (2004) Mol. Reprod. Dev. 67, 323-336 92. Yu, L., Liu, C., Vandeusen, J., Becknell, B., Dai, Z., Wu, Y. Z., Raval, A., Liu, T. H., Ding, W., Mao, C., Liu, S., Smith, L. T., Lee, S., Rassenti, L., Marcucci, G., Byrd, J., Caligiuri, M. A., and Plass, C. (2005) Nat. Genet. 37, 265-274 93. Yu, L., Liu, C. H., Vandeusen, J., Becknell, B., Dai, Z. Y., Wu, Y. Z., Raval, A., Liu, T. H., Ding, W., Mao, C., Liu, S. J., Smith, L. T., Lee, S., Rassenti, L., Marcucci, G., Byrd, J., Caligiuri, M. A., and Plass, C. (2005) Nature Genetics 37, 265-274 94. Wu, M. C., and Ho, S. M. (2004) Oncogene 23, 250-259 95. Lo, K. W., Tsang, Y. S., Kwong, J., To, K. F., Teo, P. M. L., and Huang, D. P. (2002) International Journal of Cancer 98, 651-655 96. Hudson, J. W., Chen, L. Y., Fode, C., Binkert, C., and Dennis, J. W. (2000) Gene 241, 65-73 97. Geijsen, N., Horoschak, M., Kim, K., Gribnau, J., Eggan, K., and Daley, G. Q. (2004) Nature 427, 148-154 98. Mitsui, K., Tokuzawa, Y., Itoh, H., Segawa, K., Murakami, M., Takahashi, K., Maruyama, M., Maeda, M., and Yamanaka, S. (2003) Cell 113, 631-642 99. Bauer, M. K. A., Schubert, A., Rocks, O., and Grimm, S. (1999) Journal of Cell Biology 147, 1493-1501 100. Chen, S. T., Chang, C. D., Huebner, K., Ku, D. H., McFarland, M., DeRiel, J. K., Baserga, R., and Wurzel, J. (1990) Somat. Cell. Mol. Genet. 16, 143-149 101. Mozo, T., Fischer, K., Flugge, U. I., and Schmitz, U. K. (1995) Plant. J. 7, 1015-1020 102. De Smet, C., Loriot, A., and Boon, T. (2004) Mol. Cell. Biol. 24, 4781-4790 103. Hattori, N., Abe, T., Suzuki, M., Matsuyama, T., Yoshida, S., Li, E., and Shiota, K. (2004) Genome Res. 14, 1733-1740 104. Ohgane, J., Wakayama, T., Senda, S., Yamazaki, Y., Inoue, K., Ogura, A., Marh, J., Tanaka, S., Yanagimachi, R., and Shiota, K. (2004) Genes Cells 9, 253-260 105. Wu, M., and Ho, S. M. (2004) Oncogene 23, 250-259

PAGE 101

90 106. De Smet, C., Lurquin, C., Lethe, B., Martelange, V., and Boon, T. (1999) Mol. Cell. Biol. 19, 7327-7335 107. Zhang, L. P., Stroud, J. C., Walter, C. A., Adrian, G. S., and McCarrey, J. R. (1998) Biol. Reprod. 59, 284-292 108. Iannello, R. C., Young, J., Sumarsono, S., Tymms, M. J., Dahl, H. H., Gould, J., Hedger, M., and Kola, I. (1997) Mol. Cell. Biol. 17, 612-619 109. Hisano, M., Ohta, H., Nishimune, Y., and Nozaki, M. (2003) Nucleic Acids Research 31, 4797-4804 110. Xu, W., and Cooper, G. M. (1995) Mol. Cell. Biol. 15, 5369-5375 111. Lin, H. B., Jurk, M., Gulick, T., and Cooper, G. M. (1999) J. Biol. Chem. 274, 36796-36800 112. Dolce, V., Scarcia, P., Iacopetta, D., and Palmieri, F. (2005) FEBS Lett. 579, 633-637 113. Narisawa, S., Hecht, N. B., Goldberg, E., Boatright, K. M., Reed, J. C., and Millan, J. L. (2002) Mol. Cell. Biol. 22, 5554-5562 114. Huttemann, M., Jaradat, S., and Grossman, L. I. (2003) Mol. Reprod. Dev. 66, 8-16 115. Karpf, A. R., Lasek, A. W., Ririe, T. O., Hanks, A. N., Grossman, D., and Jones, D. A. (2004) Mol. Pharmacol. 65, 18-27 116. Sigalotti, L., Coral, S., Altomonte, M., Natali, L., Gaudino, G., Cacciotti, P., Libener, R., Colizzi, F., Vianale, G., Martini, F., Tognon, M., Jungbluth, A., Cebon, J., Maraskovsky, E., Mutti, L., and Maio, M. (2002) Br. J. Cancer. 86, 979-982

PAGE 102

BIOGRAPHICAL SKETCH Nemanja Rodi was born in Sabac, Serbia, Eastern Europe. He immigrated to the United States of America in fall 1997. As an undergraduate student, he attended the University of Florida where he graduated in 2001 with the highest honors. He joined the Interdisciplinary Program in Biomedical Sciences at the University of Florida College of Medicine in 2001 where he began his doctoral study under the guidance of Dr. Naohiro Terada in the Department of Molecular and Cell Biology. 91