<%BANNER%>

Characterization of the Effects of Reduced Mutant Huntingtin in the R6/1 Model of Huntington's Disease

xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20101204_AAAAFH INGEST_TIME 2010-12-05T04:38:55Z PACKAGE UFE0010200_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 64529 DFID F20101204_AADHPF ORIGIN DEPOSITOR PATH rodriguez_e_Page_098.pro GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
61eedfcaffb4f933181379a6991f2d16
SHA-1
80b01eb475fac42eb760b8e2ed7752e2531cc9ce
26806 F20101204_AADHOR rodriguez_e_Page_076.pro
b3b34236cc54f7019e65f7f84d0c1bb3
7da60ab7589ae2a76705a3e3d2b5ac3eebce23ef
64253 F20101204_AADHPG rodriguez_e_Page_099.pro
1c6870707c7895191d7c338ed5438698
f4178a94c0cad22171c33b081cdc11e8ca37c5ea
90160 F20101204_AADHOS rodriguez_e_Page_077.pro
e8f8595623a92403067722f310166d5d
35a94e2e5a8c92a3a483109ff394fa2c22359c47
60532 F20101204_AADHPH rodriguez_e_Page_100.pro
f3027993c06f1a0bb0387a033c987d7b
da90a6770fae78276404a744fad740938f5f058c
66318 F20101204_AADHPI rodriguez_e_Page_101.pro
f7ab011f8591135ab5b4680dc6cf2077
f349d85c4c0b4af9d41ef4cc69fb936331d6a0e1
48157 F20101204_AADHOT rodriguez_e_Page_079.pro
137a91422c149e81ab0966fc4a718795
cadff2ee956b4c0b3f51fc7b4ffbd8e2d08cb810
64364 F20101204_AADHPJ rodriguez_e_Page_103.pro
c6ebd8e679a087c127d73a4dbf23b248
5d79c8d5908acd5955200154df57b1bb96124d2c
54023 F20101204_AADHOU rodriguez_e_Page_080.pro
aaba1d560654b73872eaaffecb3c712c
c3a96d1cebf3f289495c7dcca00bf57c8ca7c765
66917 F20101204_AADHPK rodriguez_e_Page_104.pro
b22472d06e87eb00763db84d1e2ae188
2b73907c195c64a49e877d4c2cbddd088f2ed8e2
47031 F20101204_AADHOV rodriguez_e_Page_081.pro
afd1b80b512823d0ba87e7598348f3b6
ab8009402b1caf120888f842e00a1be0aa2b0d73
22223 F20101204_AADHPL rodriguez_e_Page_106.pro
f665c8214a566b32637988111ae2cb83
a914270c801246cf3c157172d27ab99c6d317fcf
77773 F20101204_AADHOW rodriguez_e_Page_083.pro
de4b8aa87f2e0fc8008937a48d09116d
607233079a6a7f293c844606524cd10d67a7ff0d
1774 F20101204_AADHQA rodriguez_e_Page_023.txt
fca82f38167a26780b7ff2329a9a984e
920686667609bc394a0d4e092c06033c39210391
113 F20101204_AADHPM rodriguez_e_Page_002.txt
2cba1229df941b02944c0a4e86dddb88
3208e737da78b719c2608b9da1bb349b7c6d4173
47319 F20101204_AADHOX rodriguez_e_Page_084.pro
f64cca9eb5a87bd956f4ccbf372fb2fb
8b5b9aab771995e2921a578e60e2e35edfc98854
1910 F20101204_AADHQB rodriguez_e_Page_024.txt
f27a1f97231a7b4f00c5c832eb1a9767
5f7426457b5c704aa437c3df2d744696bdde47ca
217 F20101204_AADHPN rodriguez_e_Page_003.txt
74943398a641fee681c6083bb973b3a6
e21f086c2bbc31e0be4bdc30dd45f64416dc51ee
50595 F20101204_AADHOY rodriguez_e_Page_088.pro
d77db2ddaf713b1836821fbeeb14c783
8c780b8709cbec2225a56b59b1ce2e863a9ef2f8
1920 F20101204_AADHQC rodriguez_e_Page_027.txt
a96911b29c417886a9c2679d46691a02
26620282b3badaec6394acbefce406166c11c4ad
1424 F20101204_AADHPO rodriguez_e_Page_004.txt
c27b10fbf5acd8df2c41ca833bd11d89
772f6b30c248ba02d65b8e19ed73daac60a578cb
49149 F20101204_AADHOZ rodriguez_e_Page_089.pro
d519b535a6963755d1e4dcb3cad4cd2b
9c53f5cf578a94cb0c021d99be666081a45f1964
3511 F20101204_AADHPP rodriguez_e_Page_006.txt
bba9d067989c548340348aa2d5a04a5a
7d450b5fa572f78801d1412d89c23ebe4700dedc
927 F20101204_AADHQD rodriguez_e_Page_028.txt
a4665d12132d7d982919444040036c4f
d0837683cf7f4620861ccea32b6ed0a0eab76148
1824 F20101204_AADHPQ rodriguez_e_Page_007.txt
1c650866130b87fe08e06ad79ad96e5a
ccd346e3dd1db9a024504c45ae5c5a4b0ac31af8
1721 F20101204_AADHQE rodriguez_e_Page_029.txt
8d314c8fb8f2b4e05cc9136288e2930a
78a05791eba0f74b1932bd3cf47df5344b857963
1704 F20101204_AADHPR rodriguez_e_Page_008.txt
a3ac05ecdc1a039af431b3d9f56543eb
e2ae0f09aad1976e34c92f2f0d915e9f77ddaf4d
1948 F20101204_AADHQF rodriguez_e_Page_030.txt
25f21434a8476bfcef0f25900baf1005
60b295c9d2a1e4b2702cb64228c4c805a06b6f55
1303 F20101204_AADHPS rodriguez_e_Page_009.txt
73182412e4249f76e0a9d321a1a5d21a
6542625d8ec4ffc18fd7b7b1145b7185e6eb1ea5
2046 F20101204_AADHQG rodriguez_e_Page_032.txt
9f500ad2e84db8829ceeedb330cac247
d1577334df5fb536231facbd4d2339e19eeac4d9
1373 F20101204_AADHPT rodriguez_e_Page_011.txt
3aaae7d3697100028bf5d2531c050f67
f440407459aeea6dbabef63f0f1068b7f60ade46
1923 F20101204_AADHQH rodriguez_e_Page_033.txt
e0d24cb482abef061a08fc0909f6d850
a4c41f32489f36c406b9c232cd698898ca004765
1909 F20101204_AADHQI rodriguez_e_Page_034.txt
1b6b987c5b1bc92056f43e5626e8a7d8
fa3a84ccc2c89f9b8b35e148544e6376a5827ca7
1967 F20101204_AADHPU rodriguez_e_Page_014.txt
47e40382099a15df7cb47bc636635836
f864f93642492f3d1366605a80699c5271a14b24
1942 F20101204_AADHQJ rodriguez_e_Page_035.txt
21e16fa4f98469a33689d77cf9ded642
e2a32c5a1a22d03aebf06750419e1a07c983de64
2051 F20101204_AADHPV rodriguez_e_Page_015.txt
4c84e0516ac21875b6275b4e2f1065af
58cdf934c5e2d205e1090e7e3bb3751b80cb6f4b
F20101204_AADHQK rodriguez_e_Page_037.txt
52ba11ac4de6a68e64afd6ef21653aaa
53497ed3483936fbc88433476d7c494edd55f6be
2010 F20101204_AADHPW rodriguez_e_Page_016.txt
d682690549b73d6ed975b8b855b53af4
2987c53c76edce9a835b2bfc3a798e6867e94947
1869 F20101204_AADHQL rodriguez_e_Page_039.txt
5375110cd99a3b883ad951d1f228f645
ca24e5627e4d1be36e3ed5b780530b8cbdcee73c
1456 F20101204_AADHPX rodriguez_e_Page_019.txt
6fb70f8768fae01c4841fd876bf1f1c0
321c4168dbf55429d1674b43c5444ee129daeb27
1126 F20101204_AADHRA rodriguez_e_Page_067.txt
0ba21b84f043e851c81209647d85447e
fcc026c15d1c435e8d30a54af38a174e1537d6c7
1905 F20101204_AADHQM rodriguez_e_Page_040.txt
df706a4584b0ca4b1a12d30779e463d7
6fb75f99c549bc25a3462e602864d8937810f5be
1890 F20101204_AADHPY rodriguez_e_Page_020.txt
01e863eeb7f9766f485f3a7716917b30
c5a0b3499aa1ce139878cd3775521ceab28634e3
1461 F20101204_AADHRB rodriguez_e_Page_068.txt
c607e78c57491f2c6a4edb3807f579a7
1a221ad0c150979e182ac775ad65060a58c7d318
1354 F20101204_AADHQN rodriguez_e_Page_041.txt
cb2c1feac823afbf436d8ccd5f5a2380
6329e7cacfea792e9d27e09bd0a0edb76de7915c
1983 F20101204_AADHPZ rodriguez_e_Page_022.txt
b63e08bf686e2b00bd5fd71c09dff2dc
6b82b2dd82d904b695949da05bde8f7583611b7c
1458 F20101204_AADHRC rodriguez_e_Page_070.txt
85bee99400c1c1f0ba323682dd6c255b
28a6f3f1e3b26ece044571a24c76e3f627b0db78
1208 F20101204_AADHQO rodriguez_e_Page_042.txt
625e8dfc533d7940b0972bfefe23b0db
d82219e9a6ad97f0adde16bb1860fa34562581c5
1972 F20101204_AADHRD rodriguez_e_Page_071.txt
1f3ddb191bd90e5d2f2a869630bd6007
6125910b1955bf394af66d4ecf5aea5a09cace1e
1764 F20101204_AADHQP rodriguez_e_Page_043.txt
3348442d3369c395cf40b91e3fb3b193
dc2fe9ad03d0954e7f2239ad4ef0b19d4e612159
2339 F20101204_AADHRE rodriguez_e_Page_072.txt
6a17e0b1e1ffe3f40ee6ded1ccb5bacf
007d96bda1024a7f86463ce5f42791324e8eb23c
1254 F20101204_AADHQQ rodriguez_e_Page_046.txt
0894bea0bb420297352a7f865a4e8580
3ba7066adfc64bd3c1aa4ad9aa7ab75052fd7468
1555 F20101204_AADHRF rodriguez_e_Page_076.txt
cd9d4047bbb5b9b9264c448db9f9ff77
b58998954aa7931d7321c7cb05464eca694a7cc4
505 F20101204_AADHQR rodriguez_e_Page_050.txt
ea1eccb34a0535dbe200e68476e2a126
cba84e9971af8f55ace76ce9189f310cc50be050
3448 F20101204_AADHRG rodriguez_e_Page_077.txt
a310bcb9c6861571fe1c97e7c62c8db0
b2f5d2d0c125c643150788a0d457dc656a7ca353
1997 F20101204_AADHQS rodriguez_e_Page_051.txt
c2dee0bcf8de148a7a429e7a9041c49c
6a7bee0917407ce0f39cee627880e958318e888c
1943 F20101204_AADHRH rodriguez_e_Page_078.txt
318d6cae2469185f223473b8165e41e5
90accae9ecd99373ed42bf92ff7145d0ef9c5678
1835 F20101204_AADHQT rodriguez_e_Page_052.txt
173d5ea146cc8a9bf00f91c4ce7b4cad
c27c6d5e947cd3651d4219535ccdb00db57acefd
2121 F20101204_AADHRI rodriguez_e_Page_080.txt
ea7573d1d9b39ed20bb42723f43a92db
68d997b2664e349118d3515a1d85ddc80f6e9f0e
1837 F20101204_AADHQU rodriguez_e_Page_059.txt
11f40d451d2a62f6a3d720e0eb2ad8ce
cbe04a708d09b71cc2357a7e184960fe816575b3
1861 F20101204_AADHRJ rodriguez_e_Page_081.txt
abb2489c0e689b0cc7564becd5c7e43e
8e2e672691cffc386519eb751d6f29f8116905a4
1955 F20101204_AADHRK rodriguez_e_Page_082.txt
c51420f83209441d3a3a917b4d5ca075
7746bcc8263ffcff29040fc6757351b10fa359d9
1936 F20101204_AADHQV rodriguez_e_Page_061.txt
af749700c333ba692c66e5559d723797
fec2a897dab7f91f88d8cd7446df9f8578172e59
1878 F20101204_AADHRL rodriguez_e_Page_084.txt
0a12e855e841acdbf0117e14a138abbd
b78f8cd1ddca11c99e17c0cc61818d25c47c7eb5
1937 F20101204_AADHQW rodriguez_e_Page_062.txt
12695b68c8e8e804dae4caa10f4cf794
7643133f9195eff0ca2a5b6ed6c3a1cd69a6523a
2728 F20101204_AADHSA rodriguez_e_Page_104.txt
5c170f8ad970df44c7b79b74f1f44a99
323805e652ca300f8a5f007ff61c965a1a1f6163
2505 F20101204_AADHRM rodriguez_e_Page_085.txt
5897b27d746c7149d3c6e9f3d2044f34
bf511260f2bed5d0a7dc95352652e02762d48af9
1907 F20101204_AADHQX rodriguez_e_Page_064.txt
24bc2a327996e17bc1af41d3eae42e5d
c090bd015d2fbb860f729a83e2fdcc0676accc7b
646 F20101204_AADHSB rodriguez_e_Page_105.txt
c702de0766cee9bf17ea18937a7fe633
fd52a32792b2009cc8f87f44ce5401c6c5d17e09
F20101204_AADHRN rodriguez_e_Page_086.txt
1ef3e9c809327b89282fd4cf3bf27a5e
5ee0666890ef09fd808156d240a5e87ae5c58a3f
1852 F20101204_AADHQY rodriguez_e_Page_065.txt
9b1d162b922247db0ab040fb1981a245
82815882528c668122912006dd54ffce6f0acea2
933 F20101204_AADHSC rodriguez_e_Page_106.txt
ded2096a7416055fab74cd297a9f1b4d
561504c6b8e53a6b0e3fb1ece7bb4ab694989804
2032 F20101204_AADHRO rodriguez_e_Page_087.txt
69bfd9aa1cc9d81afbe681b3c14e0a5f
0579d5d18dccd8538c9741d6598dfb8648791a5d
2017 F20101204_AADHQZ rodriguez_e_Page_066.txt
65c72f7caf11c052a9bbbafc379d1c22
402bc4b82b992337ca8aa870f434561c925f2a4c
2554 F20101204_AADHSD rodriguez_e_Page_001thm.jpg
a6f77e6229764066ef1836964e2c2f1c
872d115905a6b11a765363bbd9cede3d393e9c67
1963 F20101204_AADHRP rodriguez_e_Page_090.txt
360d7998eebf7de030b91c248e20d7cd
cbef202eef1c56b4211986fc83176f1b8141ad92
7705 F20101204_AADHSE rodriguez_e_Page_001.QC.jpg
9ffd4eca6e651a3abffcfdf4fdc55df8
f41fe4568b60c0f604b6ca174a7c0663d3bc154b
1378 F20101204_AADHRQ rodriguez_e_Page_091.txt
d4d5b037f3eae3e533341376b8c5ea9e
3e6d49a701d85008eefc670bd275c3cb2c9d557e
3348 F20101204_AADHSF rodriguez_e_Page_002.QC.jpg
c360396706e66b6f36912557e05aa4e9
0542e44d3faca963b30c1167733cedc4c3101602
2024 F20101204_AADHRR rodriguez_e_Page_093.txt
2bed8aa2e5b090518dd25ebc76e90542
c89f263417b4272beeadef4099e6def9c3152e6c
1384 F20101204_AADHSG rodriguez_e_Page_002thm.jpg
7813b530b4585f5ed66cd67fddab0a2b
3f27470fceecb9a711123c6b12f4119690acb27b
2013 F20101204_AADHRS rodriguez_e_Page_094.txt
33309f094757aa0223573924cec7ae0a
4c50159425c426e9198aa06a608f6e364f904639
4011 F20101204_AADHSH rodriguez_e_Page_003.QC.jpg
e028fc5cc410151dcfc2eccad7e59b6d
1f622d4a46212000d4fe58d0336c62949629c5ad
2001 F20101204_AADHRT rodriguez_e_Page_095.txt
60dbfdaf8aa06c8b1180085b39f4cb14
e8a091688676d6c20fd7902e26e35759973334a4
1640 F20101204_AADHSI rodriguez_e_Page_003thm.jpg
cab3c358841a1b070716cc759623e23a
bda5f530b3441bc5636402028d61f40844da89b8
770 F20101204_AADHRU rodriguez_e_Page_096.txt
2b609e87561a35f7416167662e619b81
9e75f7b2b420ebd54fbb25a44c2a697aaebdd408
17495 F20101204_AADHSJ rodriguez_e_Page_004.QC.jpg
ef84278e0aa12725f1cf741086d25413
c18e2bcbdc5ab8a27cd27d7f21c7959810a4d7ce
2092 F20101204_AADHRV rodriguez_e_Page_097.txt
8fab9f63c31c4e1ae312a3774b425c3e
1b11cc45e588d388128b03e110d84dbfe571b139
5070 F20101204_AADHSK rodriguez_e_Page_004thm.jpg
f948fa0a218f0f3ce1b054abab5f2dee
c1568d13a509d1cc8cd803748e71bc16f02e2dd5
18394 F20101204_AADHSL rodriguez_e_Page_005.QC.jpg
06090eb7f730bfbbcc65c4a421a1fdb2
026de55259a9660a1baffd24c9e1461fb76a3758
2601 F20101204_AADHRW rodriguez_e_Page_099.txt
d8bec4b073605f78d92b5fce4b8a1c08
9472e2b02e1f03efafff5aa559f19dce3bdc919f
24439 F20101204_AADHSM rodriguez_e_Page_006.QC.jpg
bcbdae8f0be6c4054edb3e8d90f96051
c5460068a9f183beb430e67ff378c33c05abbf67
2462 F20101204_AADHRX rodriguez_e_Page_100.txt
aac1b46b44c1947347673f4eb8c4c1ee
0cfafd476d2326f34878bfe01a5981c99addc17f
6664 F20101204_AADHTA rodriguez_e_Page_017thm.jpg
67250eb5c330a759d35e699acdb62498
d006eb514acaa660ae9f9c10282aa7c88a0f354e
6072 F20101204_AADHSN rodriguez_e_Page_006thm.jpg
1aa8a617a6468f4068cb4a697d42f1e7
e83d007b6961ce0207f314e9d477712d8e6002ba
2682 F20101204_AADHRY rodriguez_e_Page_101.txt
e689aa78497778a0d8315e0289ffc4bb
4e91ea0295f3012f81cc7807f874f5618a11b444
22699 F20101204_AADHTB rodriguez_e_Page_018.QC.jpg
6d07e6c0fa02fd1d461c013848364319
8bbdf22032c7cd2a57336de1b02b54c4ab1be2c3
16923 F20101204_AADHSO rodriguez_e_Page_007.QC.jpg
065e56b790e6506547482be3662e0c4a
8f82897ca0b0c35cbaf1367ed69b776d64435a58
2218 F20101204_AADHRZ rodriguez_e_Page_102.txt
8eb17c8ded81f852bdbe6d2c17925938
3a20dd105a038db289ec3ec3ac4d91cbca4ced79
6450 F20101204_AADHTC rodriguez_e_Page_018thm.jpg
d861dcc66ebda784ea20bc9f99d7cbab
c571e0eaad63d0d80e81ab12e0b6f3c0a6f21d69
4848 F20101204_AADHSP rodriguez_e_Page_007thm.jpg
e1eccf072aa45b93c6d240ef83ec2286
fde3f990ce0afe1a5284b30eded9398e2a7e6b9d
6549 F20101204_AADHTD rodriguez_e_Page_019thm.jpg
f3c8a631bed9b201eef29234eeadd73d
a4f8b11ac247dd56efdda072a3f18c3ab3b424ec
18667 F20101204_AADHSQ rodriguez_e_Page_008.QC.jpg
34c6b938f7e759360be40b0a4ff7457a
d2279707d588f187b781540ae353f5e10cb6e2c7
22484 F20101204_AADHTE rodriguez_e_Page_020.QC.jpg
addf5ad2ee6ec04e5bf73f3b694a7037
86c6083daa20741ae989590dea9bc3722c834a26
5401 F20101204_AADHSR rodriguez_e_Page_008thm.jpg
791317af21775891cb428afc293c5444
8931ff99b9879bfb15f6b4845a6ed11ab034b598
6321 F20101204_AADHTF rodriguez_e_Page_020thm.jpg
498a8b47c88ab4f45ce3fd999100d1dc
1baee893c83c03f7d684d1dadc38983f0c7e6737
16172 F20101204_AADHSS rodriguez_e_Page_009.QC.jpg
5a35c8ddbe8d491237747feae17d92a8
edf1b3dcb7eac6d422237ca690acb753ccc51141
24098 F20101204_AADHTG rodriguez_e_Page_021.QC.jpg
db1828f67dfdfe9ff2d2098e498619ee
03e528f5cf02638cf2b785e1045b82f0211f4a14
4924 F20101204_AADHST rodriguez_e_Page_009thm.jpg
0413020eba82e6eede4f01ffeced8d8a
55d8293e14cc33c12ec41815a17cf35c08ba0fea
6531 F20101204_AADHTH rodriguez_e_Page_021thm.jpg
15333b399fb0dec3f8af8b2db947e6f6
ae1f52cdcd4e924d76269a7a29903e81a7d6543d
19593 F20101204_AADHSU rodriguez_e_Page_011.QC.jpg
1069bd0c230aa2a67e68fa398c77a08e
ac935ae6a68f2a30c8c12e5e432f97238b6552b9
20592 F20101204_AADHTI rodriguez_e_Page_023.QC.jpg
bd10ea33ccff65f1a9049a2d4690d52c
2dde1fda20d4ba76ba4c87f43aa67befcf0b5b85
5493 F20101204_AADHSV rodriguez_e_Page_011thm.jpg
00fd1f5d4d1d304db1946d4434db026a
34bf57fc449bcb7c9b78b1542fadf554b57ad0ce
5884 F20101204_AADHTJ rodriguez_e_Page_023thm.jpg
516b9e4a6fdb3e18a768d5b3918a0d35
95db2ed552f58f0a0878d50c8d08455c555ec024
6502 F20101204_AADHSW rodriguez_e_Page_012thm.jpg
242c355e76d9f3f40c687d8c6ca6d25a
1e65c0c445049f5e685f501649184345f75788a6
23326 F20101204_AADHTK rodriguez_e_Page_025.QC.jpg
9fe34aab7f166a1876405014c037a156
55d250b82a19612b38381efa6e93e9be9c05e312
6733 F20101204_AADHTL rodriguez_e_Page_025thm.jpg
9df81fdde24b0f6f42949ee65935944d
834431d2a35d71518e9cdaf9b8c5e085eb4442c9
23603 F20101204_AADHSX rodriguez_e_Page_015.QC.jpg
920c48ea6bc02d5904e09b3e6f874da7
24104b7a957ff0776a99e7f6b2780078adce5dd2
6540 F20101204_AADHUA rodriguez_e_Page_037thm.jpg
4406d24391dad9d6d221db0a5fe9fc55
c88140b3e69cdd17a1fe1048cb0a1a746a3dd440
23908 F20101204_AADHTM rodriguez_e_Page_026.QC.jpg
1f9d984742ead16a60814861378e5087
e512b7282635b9086ff240ec00b56cbf7c1b3eb2
6712 F20101204_AADHSY rodriguez_e_Page_015thm.jpg
2d5a35003c59879212da45ced7f4bdb5
e5942886d7cf6e7069a7e49082af6fac74a5fb8c
23879 F20101204_AADHUB rodriguez_e_Page_038.QC.jpg
bd0e45682798d258578d958de7b528d1
5693ed91a4ee39330c0f1efeb746277f7f824af5
6494 F20101204_AADHTN rodriguez_e_Page_026thm.jpg
f64e7e630db399e082c20f79440d4893
5b1186d35bb64f61da4b344d3bc81c2c423cf708
23745 F20101204_AADHSZ rodriguez_e_Page_016.QC.jpg
42de0d359f3ec35dcd4b93e8eb418752
571291c7cdd326d9e7ba18ffa5108e64ff9bb9e2
6468 F20101204_AADHUC rodriguez_e_Page_038thm.jpg
c85688632e8db9bfc18763257fb25ff4
c9decb12cdb84182a2d8a87252aff75ff23d8133
5697 F20101204_AADHTO rodriguez_e_Page_029thm.jpg
2b3167c56ca9b0d91c954a57d0949f61
5dd8cf9c14a5b1749d3e9a5f37f2ea125cb93dae
22888 F20101204_AADHUD rodriguez_e_Page_039.QC.jpg
6643ed13c907b5c40b88c1dcd5c58342
9148d15379a1c0f75088e8e1b11659438802ece6
23084 F20101204_AADHTP rodriguez_e_Page_030.QC.jpg
1e77ad3e1d2cb94ca94828d46c589214
bddda255900a0cff7a896b3d2ff0827265875fd7
6161 F20101204_AADHUE rodriguez_e_Page_039thm.jpg
23a35f0d9e7a2fd323756c199cb01950
6166acf9fcdc4a78024320e77b7357acdc0839d4
6386 F20101204_AADHTQ rodriguez_e_Page_030thm.jpg
6b2c1d6cdae8ff06a5ed33553eb906ef
70007e364d97e7ce32ccf4a9e510912d8626e121
6496 F20101204_AADHUF rodriguez_e_Page_040thm.jpg
abe31bad1a20528ed672e5bd01623562
354a049b42d2f311e1b418bd18d35a9ab41b6300
F20101204_AADHTR rodriguez_e_Page_031.QC.jpg
40770bbd0b9a37382d8582bd8b86e975
ac398b1533a3a013372fabded639ff796feb0e23
13231 F20101204_AADHUG rodriguez_e_Page_041.QC.jpg
108409d8d2e8f99256eb63e396314121
73d853c63dbcba7772bf5299c5c9cb6fbfea03a6
24971 F20101204_AADHTS rodriguez_e_Page_032.QC.jpg
4c5636ebfa3bbe406fba5fee446fe337
7e4ad3b24d5f3135b8b31c0be7675038fe13d416
3943 F20101204_AADHUH rodriguez_e_Page_041thm.jpg
22d99f233b725838996a0452263ae859
7e12de96fafd2535260f795f937809fc74fd2065
6772 F20101204_AADHTT rodriguez_e_Page_032thm.jpg
f3de538d0062f8dbe211f38430a73b13
b97cc87b5e4e367d76adf46e14866362d30f3342
11900 F20101204_AADHUI rodriguez_e_Page_042.QC.jpg
c2db4546c3fc675705aae042a71530aa
fbb548883ddc49286e821708dbae4028532da9e7
23671 F20101204_AADHTU rodriguez_e_Page_034.QC.jpg
9ba69c322a0f3e24ac6b265cbf8038d2
f477555f3880922604877631699cd674756ba0f5
3906 F20101204_AADHUJ rodriguez_e_Page_042thm.jpg
8d8952da308979e3e1fe8eb180cadbd4
a03a038c2eb2cc0f43533bcbbdfee8e2cf5c55e6
6648 F20101204_AADHTV rodriguez_e_Page_034thm.jpg
cfdb96af13b4dbc5c5161de96d7d3270
afd06427b095bea63f4362b32dd00b9508f0e96c
16959 F20101204_AADHUK rodriguez_e_Page_043.QC.jpg
9233ae2cc9f7b8d4e964edf8a8f243bd
92a77bb840373b4bc7b188e6bae8a0d8293d7a76
6626 F20101204_AADHTW rodriguez_e_Page_035thm.jpg
699dd71e67fa9570882ba8bdc440b201
51d82598363187ef0272f5baa38fb8b231b072a2
4547 F20101204_AADHUL rodriguez_e_Page_043thm.jpg
deea5572223355301664b02253557ca0
c8aa4d0d9dad0f2e009bd8245e4f9097f755efc5
21671 F20101204_AADHTX rodriguez_e_Page_036.QC.jpg
5c3e3c3dd021f7c83f0fbb115f7cd51f
7867dae6e660e90b9177f40f788c3605ce472cd6
5153 F20101204_AADHUM rodriguez_e_Page_044.QC.jpg
9796569e61c9b1549806e037e46856c4
295438aaf1251679052bc633afb18725387435c3
24145 F20101204_AADHVA rodriguez_e_Page_053.QC.jpg
938e746f6be8fd36d3cbaf4b26adde3b
87cf48105fb0cf1d3e48c480fc4039a6bad02378
24476 F20101204_AADHUN rodriguez_e_Page_045.QC.jpg
9fe5f1a5f562e3c7cf6a308e16d520c5
6d3a3511640a42f8f5b2b196c2baa92d6dd7a072
6116 F20101204_AADHTY rodriguez_e_Page_036thm.jpg
5264ef93f88b72512926821a024ff11f
db50b23b83afbaabd6aab1613bf4cfa33c299885
2310 F20101204_AADHVB rodriguez_e_Page_054thm.jpg
ae21aa9032936585ec4043c1f66b0574
c4323bcb23222b45539b94f65d62185cc3d509f0
6845 F20101204_AADHUO rodriguez_e_Page_045thm.jpg
a94ca533c4b5f2adff11b002cdea571d
f4503708b7907fc335a5e7c02435fd184f2ef576
23553 F20101204_AADHTZ rodriguez_e_Page_037.QC.jpg
6359bca7313a961126e508a08bee4432
74da72540447949ba0acae1c33783fc864c8fd44
21296 F20101204_AADHVC rodriguez_e_Page_055.QC.jpg
f19d022626d3451b31dbe4ca42039b33
3da1cad7ef4c84ecf95728457ae953fffe182891
16151 F20101204_AADHUP rodriguez_e_Page_046.QC.jpg
45fe41631eb53c108c923a394a529670
c45934236730c2eb381a0b97b6195feb6b229e43
5863 F20101204_AADHVD rodriguez_e_Page_055thm.jpg
9ea9a9a2bf3d4ada33086e70d68c0c46
0e923193c795858cde59b0fc21f84ff9a225a357
23283 F20101204_AADHUQ rodriguez_e_Page_047.QC.jpg
55a45ff613afb8039d58474a32b3f498
79a444d1eb9881b76dfceda2d1c0e58b27c4980d
22661 F20101204_AADHVE rodriguez_e_Page_056.QC.jpg
99f932e8f7296a1bb878497b3cf83dac
03bba7993ef4249ff1c099d694f74834be16d295
6420 F20101204_AADHUR rodriguez_e_Page_047thm.jpg
5165bfeac52924e2d263bb6a2432d2c5
ea556a1909fbddf297548a38ad87fc5d4fd2097a
25169 F20101204_AADHVF rodriguez_e_Page_057.QC.jpg
9bd33da99e35e04564d379ec85c3395a
36f6a6429852a44ee7b11456c01f80ccd78934a1
23961 F20101204_AADHUS rodriguez_e_Page_048.QC.jpg
c1822028041e00841a9b7088c0297f09
0bd23e3fa6044e7c3be636d25e435bf443ebf9a1
24273 F20101204_AADHVG rodriguez_e_Page_058.QC.jpg
c3c22fa700526e4de8a4329f7130f331
d474bad77eef565739d5b76b2d8fac0c60c60a78
6585 F20101204_AADHUT rodriguez_e_Page_048thm.jpg
0a0a8a7fde0ed3fca4aefd6bb13b2c8b
1a808355b10e268a99083390fceca110d09c641f
6474 F20101204_AADHVH rodriguez_e_Page_058thm.jpg
b74209c15b9c59935fb82cb364106d1b
d407c0c131911de68eb65895485b4c0120e04cba
4237 F20101204_AADHUU rodriguez_e_Page_049thm.jpg
d567ba31a7d24a09c1ec68a4a5126bea
ccee13016293400dd8abb12d91e2134db45564b3
6532 F20101204_AADHVI rodriguez_e_Page_060thm.jpg
92d2c5fbd9a10d8067618f6cd525acba
c12bf5c8d375cc2cba828ec50536e426ee8c3c0f
6736 F20101204_AADHUV rodriguez_e_Page_050.QC.jpg
c15a585f8c92dff8e4a8372d56c82d01
2cb0366df32e6f1735603be54ef73ab7dc02573a
23341 F20101204_AADHVJ rodriguez_e_Page_061.QC.jpg
33121858673415101cbb8f5ca741c4d3
1c45329512bc8be3a58b1204cec805ff05744e86
23540 F20101204_AADHUW rodriguez_e_Page_051.QC.jpg
bf6e8ee88f58ac6cdce89844306814b0
5cecbee4c7f08138a048d4db123654ead5126a04
6564 F20101204_AADHVK rodriguez_e_Page_061thm.jpg
61c2a7c0af1b09396fd4b7618c6ffde5
3e97e1167c938f45c7c3fd6db1d529eea238c539
F20101204_AADHUX rodriguez_e_Page_051thm.jpg
e0fe3b622af727b467ad38a5d21237b4
9b7a828ba9488a0ded846be95dbf76c817215c47
23650 F20101204_AADHVL rodriguez_e_Page_062.QC.jpg
81f965a3c9ff7a68be6b092b9c4cc1d5
05686a228cb4a57562b2b70aef5f325453ae4bcb
21665 F20101204_AADHUY rodriguez_e_Page_052.QC.jpg
8de181f5bfc7ae5b08adc7c575e445ce
0d2e114ce355cf43817c78160d4169cbda4376e7
6649 F20101204_AADHWA rodriguez_e_Page_071thm.jpg
6ebc10d9508f61f6d373ac60dd2640b2
bb1ae1eb39a8f59790ab2951ba0cbd6644f70659
6332 F20101204_AADHVM rodriguez_e_Page_062thm.jpg
336c6ecce155cf1a505c2a0fc6f2cf17
f5bce58f24b12435c3c45b013c02d7358e5d61c3
8892 F20101204_AADHWB rodriguez_e_Page_073.QC.jpg
57a55bfe6d6931c67114c8628ad3322e
c8d727549ded4aa329924d7944a0c62c7dac6873
22240 F20101204_AADHVN rodriguez_e_Page_063.QC.jpg
4a05e7c4f3d144742368de5a85836ebc
b42b80469ab209d3caae25c40e4e07eea0fcf4a9
6101 F20101204_AADHUZ rodriguez_e_Page_052thm.jpg
209345e603557b8dba6c323c5a5eac6b
9b62d05740e3157199f399dc2ff2cf6cc2cc68a1
23924 F20101204_AADHWC rodriguez_e_Page_075.QC.jpg
d8b5ab00b743f88dd345c83dc7ca0e2a
0078a8f512cb4479f7b723da7ea9a951174e31d8
F20101204_AADHVO rodriguez_e_Page_064thm.jpg
1f1572da8a45400116f1bd424310121b
55978f8bd44c2f8cdd7234337722fc0c9083e82f
6415 F20101204_AADHWD rodriguez_e_Page_075thm.jpg
9411955bb16b19c26c03bea28a981e3b
02069337d5f4b7678277220a7068386fc83b675b
23023 F20101204_AADHVP rodriguez_e_Page_065.QC.jpg
72078a76cee98566e292876ab9dfca1f
14c9bcdddd7b6e7ba66fec9e41af46b4ac8455a3
20280 F20101204_AADHWE rodriguez_e_Page_076.QC.jpg
4d6d1803200e67b45d6b2f992716abba
f6a326ef6310250e1c14792db3336bc8ce0990b5
6435 F20101204_AADHVQ rodriguez_e_Page_065thm.jpg
16671c7481e7f65fc5913e07caefb183
68d67ab5bb3d87c5478dd7299470d1314d022b99
5901 F20101204_AADHWF rodriguez_e_Page_076thm.jpg
dc660f62ce7dbd05e2c8906ca9093bfb
915731f41b6d940af4604cd00e834c05e7fe33e5
24206 F20101204_AADHVR rodriguez_e_Page_066.QC.jpg
d0a73108ad6b733a682cd1f1da0b1a4d
e055f2e735aec352a0f22ed845141b4afcdde995
29940 F20101204_AADHWG rodriguez_e_Page_077.QC.jpg
6ba5c1bf44c964c1211e88f346a9568d
a706508df499f23f2157eee3c8e05116d75ff59d
6698 F20101204_AADHVS rodriguez_e_Page_066thm.jpg
615bc6b89c5e3f78267223f7655bc529
eaa849c7d9d4affd7f61017fd9681fa51c07425a
18340 F20101204_AADHWH rodriguez_e_Page_078.QC.jpg
1328e7db649d69f222899fe52ef94290
f4a334208f5b268aa4341deedcd529b99870e0d2
16514 F20101204_AADHVT rodriguez_e_Page_067.QC.jpg
a7af794b96137c4c5c8910e9bd0de745
e8b491af74aec8ef01ff4ed64909164909f0b0fc
4415 F20101204_AADHWI rodriguez_e_Page_078thm.jpg
4eeed4ead85836a74561db1be6c952f7
7544f7d455fe89bd1c6743258967bfc8d330236e
5197 F20101204_AADHVU rodriguez_e_Page_067thm.jpg
92039ce21c51d763af72f3e44fb9be74
5437b81921773d6563a9f90889fd0797331d1802
23198 F20101204_AADHWJ rodriguez_e_Page_079.QC.jpg
a7a52bc401a7bb641c29662ae51ac390
bec8bd79c48d0edea0ffef20ddf9148f857eff54
3614 F20101204_AADHVV rodriguez_e_Page_068thm.jpg
f44bb856a6d295d10756ffa6ac949938
20dc969816b740a83f51792d7ae395ecdc34d7ff
25306 F20101204_AADHWK rodriguez_e_Page_080.QC.jpg
6fa1b12b25bab3212c14c1839e6d1248
0701d82988958a7c7946487e18638799ca06a473
24472 F20101204_AADHVW rodriguez_e_Page_069.QC.jpg
2182693c3e00d6de16d6525ecfef1e3b
5bda5df20aef9812d3e9a5e4942ccc2bcc639020
6138 F20101204_AADHWL rodriguez_e_Page_081thm.jpg
3221902abe3a6a51b2ad797cfc7da8eb
0c9996b2316ea31bc0e2560d1c7f7760fd638129
17431 F20101204_AADHVX rodriguez_e_Page_070.QC.jpg
378f8b10c82c9bfd1d87fb6520320e7f
6e6bff1c3563cf98c9a89bc235bf4dc1ede7b61c
23424 F20101204_AADHXA rodriguez_e_Page_090.QC.jpg
50d6aa6c2d0f0e06506c4fd487cbb63f
e559aae7ec49d447c945dc7d64e0c223656a7d77
26575 F20101204_AADHWM rodriguez_e_Page_082.QC.jpg
1998693fcccca75e8d33292f501bb3ae
3f03022d7dbcdf09cb27141908e0bec3f19f47d7
5373 F20101204_AADHVY rodriguez_e_Page_070thm.jpg
be919ddb629ce204fcd179e0b1de96cf
89007850d5fb2d3ed4f1752988f6cf8b145138d4
17399 F20101204_AADHXB rodriguez_e_Page_091.QC.jpg
6b2ef9c88113bc5f2746cf2d2135b94e
993f467d66c8c8d77985d28d89bc368e44ad7c3f
7777 F20101204_AADHWN rodriguez_e_Page_082thm.jpg
a3a3598a8b8d9d5c247c912b31941295
2b0bc2ffbd55303aed0a52c22d36656f2066e60e
24169 F20101204_AADHVZ rodriguez_e_Page_071.QC.jpg
49fe5df0f28e02807ae4b0b34eee8059
36204b6376cae9fdc2571be10660eee13c4a6f18
5110 F20101204_AADHXC rodriguez_e_Page_091thm.jpg
25f28f0b19b5f80912989a3bce5d69c3
29c59a0ba1e0ecd7af39ea7ec6ef836d7e1905c3
26691 F20101204_AADHWO rodriguez_e_Page_083.QC.jpg
6597c789ea1c738eb9f5d6c78ce2aca8
2cacbcfe999a9a2adb84d395184522a98a0dd2cf
19930 F20101204_AADHXD rodriguez_e_Page_092.QC.jpg
75c9f5d91292a37ae3b6b56081d803f4
137c98314d4849891d8a0c9e03aec89d79adaa9e
22735 F20101204_AADHWP rodriguez_e_Page_084.QC.jpg
7807e11e0cc2e2d14e0f90aa63b1a947
6716ab04d91f85a4cfe2962677c0ab050bb058d9
23719 F20101204_AADHXE rodriguez_e_Page_093.QC.jpg
6f6a49b25b5125cb16e72c4211c39655
9871317cb1867232d8cbe6ce0d192183df942300
6354 F20101204_AADHWQ rodriguez_e_Page_084thm.jpg
2dd71007f732081d373e5379fecb18a9
41a4b88fa28d5e911181ebc972abcfafd57f795f
6714 F20101204_AADHXF rodriguez_e_Page_093thm.jpg
50d44c8b03f692f14d63e24be4e133f2
4ba7e67fa143b4b9ede80fe9acf29f749ef8870c
23001 F20101204_AADHWR rodriguez_e_Page_085.QC.jpg
f03d0fb8493337ae2e695ecb5ceb530b
aae12accef4cd36ac3a2a781f52a017b4b55e989
24490 F20101204_AADHXG rodriguez_e_Page_094.QC.jpg
1938ffb30c82cc5c2509816d5e1fca9c
9906e301b8f4dc3446f87ac0fc6b53ac077f9315
5930 F20101204_AADHWS rodriguez_e_Page_085thm.jpg
9f54db3011700ca297921002b5b96c86
c7ded77ee5c982525e15e46cf744ef27e7b48236
6660 F20101204_AADHXH rodriguez_e_Page_094thm.jpg
3e54d2b8a9f120051c53ff0851896a88
2f24d2bfd8b517c873bedd18676bde67846817cc
6337 F20101204_AADHWT rodriguez_e_Page_086thm.jpg
ac4188f629fa8c41b985746747e6ec89
0aef7fa8b5cfb05e8b078cc118c4bdedd5da9ad2
76902 F20101204_AADHAA rodriguez_e_Page_068.jp2
17723150ee427e68e6c3cff1fee793ee
d40087665b4ef560636d25d2c42ff83c5e42cb12
23642 F20101204_AADHXI rodriguez_e_Page_095.QC.jpg
b3cc8be7141e76def2bb3d52b05c74d1
7e4bec058459461aa6d2e4223e6c48968e0f41a8
24344 F20101204_AADHWU rodriguez_e_Page_087.QC.jpg
47c227ecca821b7180be85d669b8987f
bd6ccb95029009b146a002e8603c43a3390a6af8
1051982 F20101204_AADHAB rodriguez_e_Page_025.jp2
977f7f46db92d6e93d591474620543ab
9744282e119ef9a21583b250c844ca05f654c75f
6581 F20101204_AADHXJ rodriguez_e_Page_095thm.jpg
5ed40fd5eade2c7c71f6833714b68ae9
90943d4f54d7e170313ca070ce72f683c766c36a
F20101204_AADHWV rodriguez_e_Page_087thm.jpg
ada22dc6284649aa0131ed9ee8a4e781
0e1432f54593e1b3675a09e4748bd3eac617f5ec
1828 F20101204_AADHAC rodriguez_e_Page_056.txt
c5275d69a090cf51c44064ec2862a057
2c0597bde8599ad8fb4861f7764a1b9eb564a2c6
10542 F20101204_AADHXK rodriguez_e_Page_096.QC.jpg
5d657d44a7ac7faa30f840c9d3e240b9
53ae76717584c5b8659ca17d1e39f01b222a0e58
23801 F20101204_AADHWW rodriguez_e_Page_088.QC.jpg
e1a14be00e020cbef56c22512aec2c8f
1c25b1316b1e2a5f91512a8219b085c427a95f9e
108265 F20101204_AADHAD rodriguez_e_Page_030.jp2
1214ef1325aceabe8368bfb5967c3723
460ed84e531e2ec5531516fdf288556c502238e9
6260 F20101204_AADHXL rodriguez_e_Page_097thm.jpg
2b7075c9a1587e39d9262f1a3c7d2edd
13e645241a07f19b3955eef5a912b3df1319eb65
6634 F20101204_AADHWX rodriguez_e_Page_088thm.jpg
a5cba9d0649bb744f2d9907410985c84
de9ff5706c1c0592755befa1a1823dc2622b12b1
479 F20101204_AADHAE rodriguez_e_Page_001.txt
3cd5f8777590675569c0d48e7c827dc3
ccb69a5220ab596cad3f2b82a72f76970b06e000
26965 F20101204_AADHXM rodriguez_e_Page_099.QC.jpg
0c49228e3cb255c2c9b919f0b44c4d3c
e9f80c0e297eed6aed3b9e2530ee2d4b99847b11
23318 F20101204_AADHWY rodriguez_e_Page_089.QC.jpg
81c132c172926a6ac3d7454c1eb85fa6
43e064904912f2f7adcf0bdb0aa61fded3051889
7307 F20101204_AADHXN rodriguez_e_Page_099thm.jpg
01f86c51a1b35968f2445d869d887948
ed7779922a46167bd7651ce410c0e739e6187e66
6457 F20101204_AADHWZ rodriguez_e_Page_089thm.jpg
264c61e4aa81ec5becae5fe1e098e45a
ba6564f53abc6568b018a39d8bb3f8f41a0f2aec
79197 F20101204_AADHAF rodriguez_e_Page_025.jpg
1a06b30fe0255f166ea3964557e02cbf
cf67882a8d2744375c71b5fe635b4638dafd62ae
26543 F20101204_AADHXO rodriguez_e_Page_100.QC.jpg
7f2882430d63d942ef82e947e45bded5
2a0b11338be0640d9f1b73bc04b5393098867ed0
1902 F20101204_AADHAG rodriguez_e_Page_038.txt
a8494bb42247783b6d23e6b52098d28e
9eecf73440e0012bd0b62a799d874c6f5c567902
7103 F20101204_AADHXP rodriguez_e_Page_100thm.jpg
5e9fefc6cbec6f9457b9b8eba2cf16bb
1c795946bc46220b76b73bdf0150d8a9467d92fb
26498 F20101204_AADHAH rodriguez_e_Page_013.QC.jpg
4ea135e226ec256e0a8897fa61027ae3
067fde1ae1405fd1ed2d7cc72a663284b36b1cff
28238 F20101204_AADHXQ rodriguez_e_Page_101.QC.jpg
31c7c19156418e7263a3a0bff47b8da3
96421ba4575af352fc91e7316ecb1fc524b4c364
6441 F20101204_AADHAI rodriguez_e_Page_090thm.jpg
b5714ee3400c63f6606cec6049f25233
80f6385f6a3290e8eca8d4d3ec9f78f1a935a727
7410 F20101204_AADHXR rodriguez_e_Page_101thm.jpg
9eb79dbc191ccef3e9b2780ed4128f02
6101b790150bbd6c4b408c03eddffc63b97688aa
106339 F20101204_AADHAJ rodriguez_e_Page_060.jp2
8be29e67af00e772572d28f15f9535b1
6b350e5ed118fb19314d4bf74fac7adbeae6522a
7467 F20101204_AADHXS rodriguez_e_Page_103thm.jpg
975b386e2ecb7ac59fb45fcec9312ed0
38f1044ca3f730e32fc82e718e24e5edd0311b20
50385 F20101204_AADHAK rodriguez_e_Page_066.pro
8808e0509e6e48056dc4296f5585c1e6
508c0eaedb6d1fd851a1d704d0579a37087debe3
28330 F20101204_AADHXT rodriguez_e_Page_104.QC.jpg
5f53caa356f50cd7f311bfdad9ba2d09
b032da0a0e08b7248b965d9805ccd11dcd097dbb
24178 F20101204_AADHBA rodriguez_e_Page_035.QC.jpg
19c4302596057479f0c3057e152c1847
76308191f3fe35728c984351b045a5f34a4f55d0
61641 F20101204_AADHAL rodriguez_e_Page_043.jpg
89cb4d4479ae58691541a7f622969a6c
9955ed554aba0dbd291a77ce1ac5c4be5a3f0d41
95790 F20101204_AADGVF rodriguez_e_Page_101.jpg
f52bdb238eefad3ac798987600f890b8
cabcdf5989eae735692ab0a49c4bdefda6b3b91c
7143 F20101204_AADHXU rodriguez_e_Page_104thm.jpg
5e6625a2453081ec5a2f2feec25c5d47
50c21c9b5ca6c42cd44a21fa47f9b93a71657943
6507 F20101204_AADHBB rodriguez_e_Page_022thm.jpg
d3c4a850b5a7421be5f30ee3b96402a8
8430d9f19693160ecac806d1e08b19ef70c81f2a
2065 F20101204_AADHAM rodriguez_e_Page_045.txt
d1a8167fde940af97a2a9bc2f987f0ec
ca59d20eb49b252be6fb7aa08e4ffaedd6d08f7f
1695 F20101204_AADGVG rodriguez_e_Page_092.txt
b3ec32e34c4512213420b1e06e95c12e
3fa39ed33fbc8b6a19c30c811d84ddc79ed7784e
2510 F20101204_AADHXV rodriguez_e_Page_105thm.jpg
ed161ba6203bb23006e6347badaaf048
f9afa104f4596ac643052fd2ea758a43e6a9f3a3
1053954 F20101204_AADHBC rodriguez_e_Page_098.tif
e4335f16cbcf37c82870d4454f70730c
8cb0914214fde61897d8dd31783700ddf51b3dce
26041 F20101204_AADHAN rodriguez_e_Page_041.pro
429bf971004940a108758db89f55f23c
be2796bdb20640cff7efd6bbc143335ca14a7178
14726 F20101204_AADGVH rodriguez_e_Page_105.pro
95ee7ef29304123176e778bb3ff80e95
26c4fd5d43fb585415c36401d1bfa3ab3966cafb
12527 F20101204_AADHXW rodriguez_e_Page_106.QC.jpg
e0bf49f5caf8d9270cd05d18496bcbed
498e995b929ce4c2901e8bfbf48e462a5a51fc19
49312 F20101204_AADHBD rodriguez_e_Page_035.pro
d089415a955d4b180126bafe9c89d777
78334afcda015c030fcd5d0ae507ba2e663e3566
42537 F20101204_AADHAO rodriguez_e_Page_007.pro
a41709c461fed246e39277a6f1b5f4e1
05604aa5e569ab94bc42afc25e76eb26d4e3e8c8
12340 F20101204_AADGVI rodriguez_e_Page_028.QC.jpg
6a30e9b044ac27e657602e35236e04ec
5b3c848f657ee9ce5f7adade7c4377f691032913
124929 F20101204_AADHXX UFE0010200_00001.mets FULL
f6114a931afda2539766317c18ad38d5
94dd5bf4f2e931f4e96fb22325950068c12b87e3
130274 F20101204_AADHBE rodriguez_e_Page_099.jp2
80aa5cb2a6773bcfdf282218ec04f1a8
f6f99e3a2d853270b6a4d0f928099818460727ae
23053 F20101204_AADHAP rodriguez_e_Page_102.QC.jpg
641ea585bda130f7bb9b0ef33c270c4f
c3fd3d518455e0aecc929019a7567c8f116ccab0
48346 F20101204_AADGVJ rodriguez_e_Page_040.pro
96fec39b5f9fed24071ac4f41d6c2f72
9ff0326155407212c52ff90a6a54148f23bdd4c1
F20101204_AADHBF rodriguez_e_Page_031thm.jpg
db326225b7c27eb39c2328f77100819d
db83acd7e30e4770cf6f33efc84f16393e50852f
49985 F20101204_AADHAQ rodriguez_e_Page_078.pro
cbd72faacbcad4d2c95529e5b5f7d4d4
930410e8ba3eba1b230092ab35e358b7206cb305
25035 F20101204_AADGVK rodriguez_e_Page_072.QC.jpg
bcec70ca04b5766885956c9979f06b0d
6907e0e43983162789194fbaefe8f60dc62e76fc
48729 F20101204_AADHAR rodriguez_e_Page_027.pro
2fd257c4ecdf3eab539cc926960bf11f
f06334f50af45ca2926c948b0c75b8dc1c934d33
72934 F20101204_AADGVL rodriguez_e_Page_088.jpg
a8608e391be1cb5ff489f1e72cd301d6
4f6ddbebbac0900c1d025cf53d5b760429848e79
107185 F20101204_AADHBG rodriguez_e_Page_027.jp2
cc6e52b1519b904c20869d857220d207
74076cb264ece091c81dc090f2402fa41d402438
110783 F20101204_AADGWA rodriguez_e_Page_053.jp2
120dd0e1238647c7a0ad2922806f33a5
c35bb3564031d489d6fd57ee4d95a30a53c13d99
1831 F20101204_AADHAS rodriguez_e_Page_055.txt
e0ee8c293a09657cd6d5bfa9ecfd22a3
69d0c0a67c776b583257b2cf856130be7e24b613
47094 F20101204_AADGVM rodriguez_e_Page_047.pro
f993e5400c3e8be2ddee9cd160a7d82c
5f98eb47a802ac2954de81379d2bd61c22de1d04
10457 F20101204_AADHBH rodriguez_e_Page_002.jpg
87417ee9823670c62030e47ebad80805
1ab52fd1fad8c87a7d5b0621a31f322a61f4382c
23020 F20101204_AADGWB rodriguez_e_Page_028.pro
069346a08dc532ac73a5780b7c31a6e4
bad39741f2f9486cff02beb9f73a1878f8c30d7f
130095 F20101204_AADHAT rodriguez_e_Page_103.jp2
489d84c06d2398f9d9283e7fbe7bc43e
1a09dd87c2a0dcefc6c77af6b25718048273de7a
50318 F20101204_AADGVN rodriguez_e_Page_060.pro
3966f4f780ef7e89d11d3dcc19bea346
444bf36a6a58f50b3a88f84d3265968d7f4c8502
75049 F20101204_AADHBI rodriguez_e_Page_094.jpg
92c274a2c53c69a0ed7b98af8dc4e4ad
b30c014115e5b3875a667dcefa82abbab8a152a5
5664 F20101204_AADGWC rodriguez_e_Page_092thm.jpg
09f543a17149b5a9bc9fc93b583bddf9
c53e6016e923a295895f51b31df233ee0cb60fd3
50968 F20101204_AADHAU rodriguez_e_Page_069.pro
d88f88b8cc14c8592bd9106fdf48a943
470c15c4b03e4e52543e71ec9df829243bb63a30
1893 F20101204_AADGVO rodriguez_e_Page_058.txt
21e1e60aa73cd0ef4b79d358db33c590
3b85a6ad851b6d09dcb49af998ba623af3578ad0
25271604 F20101204_AADHBJ rodriguez_e_Page_005.tif
e85f1a94beb88af39be626e3caa54503
b8d8ce53bbe019380177c88a4d5a1de269940c3b
1950 F20101204_AADGWD rodriguez_e_Page_074.txt
a2586a6426ad6d6e7c65ac93e919d42f
8826efea7c751ba4ca121a31d097d5cbfda3548d
40938 F20101204_AADHAV rodriguez_e_Page_092.pro
5109b253cc5914d1b73299dda0a6a9f0
4d364d40328ce9c6c3afb019d0586d52d243e43c
F20101204_AADGVP rodriguez_e_Page_041.tif
a7cc1e268dc55c47e0c2267249f2966f
fa85e9527ba77dcfffb61bdbc8e53a8a3587cb5e
97100 F20101204_AADHBK rodriguez_e_Page_055.jp2
d191645e794426e4fb002e7566435116
60edf5553d9cdc128949c9de2a4a480b2e92ec92
19889 F20101204_AADGWE rodriguez_e_Page_010.QC.jpg
5036246f50f7e262da61c2a8c392ffa3
78d5c3d5b6c508f58719ac56e9fcee13164c67fb
6172 F20101204_AADHAW rodriguez_e_Page_083thm.jpg
918160d5ad66bcc1855b13b23ca2447e
2714bb83f217d7b45eb8989d8ebe0d60a29bdcc2
113247 F20101204_AADGVQ rodriguez_e_Page_057.jp2
8678e8a5e15c1598b95da2dd90792f06
7940a0ba000645b57e85f8620047612ab9b23882
49268 F20101204_AADGWF rodriguez_e_Page_030.pro
e0b17ea4817c653a3e67f217deaf97a7
103f258092f9e6fc44161cef15b97df5bc53c17d
46561 F20101204_AADHAX rodriguez_e_Page_059.pro
92ba05435fa0b80337f2bfc9495aa55c
7860926c7994c66dacc8e325490e66f795377182
F20101204_AADGVR rodriguez_e_Page_024.tif
30baa0235b67deb9ea91d7c83099c216
970433216f5fb7a6b654a87fa7359350693376a8
3591 F20101204_AADHCA rodriguez_e_Page_028thm.jpg
9140b32c8f2ed470457103805d6a66c5
4c05142e2758796929bc7d6232212e0aa3a4b6fe
75984 F20101204_AADHBL rodriguez_e_Page_004.jp2
b922398c85eb8075994b8c8685c673dc
8c132c680553a4f1f3d92c9f687ceb91ddc53bb1
2002 F20101204_AADGWG rodriguez_e_Page_075.txt
be6cea310dca58bb0cf245fc237520df
7ba79a65a199ec6e929ef0cf4b51dbc0a30577d8
6405 F20101204_AADHAY rodriguez_e_Page_016thm.jpg
67a96fc96d35fbdeb4c3cd350cb53e69
937be63ae3778fd97a65e4309034bbbc68c06f27
F20101204_AADGVS rodriguez_e_Page_094.tif
ae762d69b9e55a05cb65cc0fd21df23c
7a1445e3e75d6dfc3315d219db48cf6b3569a2ed
3003 F20101204_AADHCB rodriguez_e_Page_083.txt
b381177489308ed446c578d1b49cfb80
97d267d779f43b4ac1e391613156eebc615d9bbb
46289 F20101204_AADHBM rodriguez_e_Page_052.pro
7f2887ef6383259fdb508962bafa5272
4e6ba6f7a7d6f42ab3bcb6375104b953840a59c5
24305 F20101204_AADGWH rodriguez_e_Page_074.QC.jpg
928d0a5d5f938f2a9d065993ac30b97f
e2f743ed95d9ceb24d152b7298554aa6cc4982fb
2605 F20101204_AADHAZ rodriguez_e_Page_103.txt
31d1aa7a75657f315de2da71b3f8ef18
69f500226a47097661ae1239e991744dbc6314bd
5494 F20101204_AADGVT rodriguez_e_Page_010thm.jpg
50b6f86b156c7e10151fc166f590e917
d76e66a017bce113aca638a4e2292aff17420672
110336 F20101204_AADHCC rodriguez_e_Page_015.jp2
b6f525e9d89e8c344f0ab7f5bb69f8e0
42539dff42d52cfdd9112878442b5b444f094fed
2007 F20101204_AADHBN rodriguez_e_Page_069.txt
e7321fac7f65f7bd614d89025140196b
85206b5fee659291ac5a9a22a2432e1d5d76012a
2602 F20101204_AADGWI rodriguez_e_Page_098.txt
8af4a2cfb3f53991b3676a373a92bc50
a89c4c72a685eba6227ba63fce852f114881b018
69088 F20101204_AADGVU rodriguez_e_Page_076.jpg
4bb41b925bcf3558ec03cfe3c208f237
befc92c97e01b29b0e520b3421d08db7344946e3
44463 F20101204_AADHCD rodriguez_e_Page_082.pro
2071eace5e9f5b0e5ca8b1a72600ff0e
30063c076ea89b3529dd0f65f6997fedce01e788
1960 F20101204_AADHBO rodriguez_e_Page_057.txt
33d337f68bf2e426f66292f54cc0b7ca
fcf035fc7ffe8998d7b276c30662951cb6739ac5
1962 F20101204_AADGWJ rodriguez_e_Page_048.txt
5b3bce075a86b4445758c0f77f83571a
b6afc4a5ac07a487d1c03674f3471a7112c20147
22999 F20101204_AADGVV rodriguez_e_Page_027.QC.jpg
3a00f63e3b7ca28fb09fdad60ecf193d
0f2be5d3c3fad8333acd932d0340b6254ca8ba4e
106813 F20101204_AADHCE rodriguez_e_Page_089.jp2
711d08aa79e94bb15938862d8f9f6232
fa40a2b65327274b6315dc65e08b73cfddcf1bdf
107237 F20101204_AADHBP rodriguez_e_Page_093.jp2
9d6d13347b7d66f851e03aca07e90c1d
ccea6d3420ecbb00bde4604bccb2f8a91c32a45f
69888 F20101204_AADGWK rodriguez_e_Page_024.jpg
54ef50486c034929a70852fcdf7d3c6c
2c8b48d1794ad4f8367ef93974f80aa6031ae711
49833 F20101204_AADGVW rodriguez_e_Page_090.pro
3dd19e3d8f1d8c249cddd50e09fd0737
1116d75a3219d435ea6474140ac315849e4fe4a9
1051986 F20101204_AADHCF rodriguez_e_Page_007.jp2
27bed9a12d6355d503e55712ba1284e5
baf1b0ce23c3c9a18a6ce896d937e2eee1542cdc
23646 F20101204_AADHBQ rodriguez_e_Page_042.pro
4888879561e1fa0a75e5b97daea4b557
b6a6d04438fd10680a61bda071727da16e4d5a27
6552 F20101204_AADGWL rodriguez_e_Page_053thm.jpg
6dfff4f67a0df97aab183c4630d29657
a57799a72f06f1d1c8880b24df1089d6afe7696f
F20101204_AADGVX rodriguez_e_Page_008.tif
7c082209310732f5864c4d60b2a46b30
a688122cb0247e1bd44ae0679a6c66aa7b191b9a
6809 F20101204_AADHCG rodriguez_e_Page_057thm.jpg
24290031862bc47bfc5be4a68ec1d535
7c877f6a993943b4f1d2df8e44eb2b51b412c204
6317 F20101204_AADHBR rodriguez_e_Page_024thm.jpg
c70f4a505b67599378e19fadcca4cf6b
5527d53e9336c46333e13e7cda7c085fb1e62ed4
6499 F20101204_AADGWM rodriguez_e_Page_059thm.jpg
6d364fe1273d823ac4f47c25e23c53c9
d45d27d266ca1bd8a3bfbd406afce0f7793b364c
23159 F20101204_AADGVY rodriguez_e_Page_064.QC.jpg
67d87ed3a09ec277da384b1252708cb2
30580ff4b13908c4962e6c8ea41fbf4bbb22b3ed
818 F20101204_AADGXA rodriguez_e_Page_025.txt
b819c697093d5cdb87a1b21f08121156
5615489dd56abc63d1ab33e8ad25922a888cb8c8
F20101204_AADHBS rodriguez_e_Page_033.tif
def07de35182f8be86925bbde2fd9640
c881b0c25957e8174190d4cbec0ae0683474fcc3
408 F20101204_AADGWN rodriguez_e_Page_054.txt
9d76f179faa9f792d50206e69a117598
a8620410fdc08f1b23ac6dc8ecfdec684656a388
1761 F20101204_AADGVZ rodriguez_e_Page_044thm.jpg
bf628d5c1c32173e30306c6fdf0b6e24
b9dc80e220401f38ed6df4751e48f6a8b8d3b985
72118 F20101204_AADHCH rodriguez_e_Page_086.jpg
dd51cd445f9a6325287d780b36a7f713
55fac8c96769553e64c4a547789f01b5564acd41
1051952 F20101204_AADGXB rodriguez_e_Page_085.jp2
10786eb692374bc222825587761f0722
056e6fe661f3ac4cdb0512a9bce91f54f098a477
50746 F20101204_AADHBT rodriguez_e_Page_087.pro
983dd183376db4de8c804c4b8d2777f4
e981859b9a7578a063af8423a442caa9e8a619ab
2035 F20101204_AADGWO rodriguez_e_Page_021.txt
96ebdd16b5f39e84c074da78003c64a9
e90abcce3901f092acd676bf89f4844a61c41377
61195 F20101204_AADHCI rodriguez_e_Page_010.jpg
a25129abc8e3032d2ee9b0303ebe0484
b79041c1bd5b90cb8d0425947688e8797b125c37
102982 F20101204_AADGXC rodriguez_e_Page_084.jp2
54ccda3d922fbc2153c675f637df8c01
979445755e991b97dcb38596979b227f863228c5
6363 F20101204_AADHBU rodriguez_e_Page_063thm.jpg
9fe56f77acc2cc63cd3f6391047fd890
95d3d8a47440233ed587e7e676ae6f0a81cfada6
F20101204_AADGWP rodriguez_e_Page_007.tif
1e332f0318f8063dad5b8326e5efae31
9c974a14ecc1db1ab72c9d032dd244ce3e38f55c
23101 F20101204_AADHCJ rodriguez_e_Page_012.QC.jpg
02d36d877df910bd12f569137cd0573e
29917733f8076bc0e50f11a5224f674558424271
22068 F20101204_AADGXD rodriguez_e_Page_097.QC.jpg
57fb464b5e94a30cce2949924d623a57
782537c3480c334350c8b9250b3c8ade1ecf1ec7
23590 F20101204_AADHBV rodriguez_e_Page_022.QC.jpg
44969e53f6bf1fad6001768204d40445
36b7c45da9e5275441d8183d1f74853f1fb9d9d2
1867 F20101204_AADGWQ rodriguez_e_Page_047.txt
a162c10d1ec3b9be499f63b05ae1eed8
b96a0b411e325624958410b555c5a16108aabda5
48538 F20101204_AADHCK rodriguez_e_Page_034.pro
ac3c9da561ea182a21e7d93ff496a0d6
264dd6a7f1c7689ca5eda61fffdf27baa296f8f1
23858 F20101204_AADGXE rodriguez_e_Page_060.QC.jpg
8e17637aafed9f3d405390d8f949b3cc
84f91e3a4f2ff42bbc790d04ee3773ada185f15b
929143 F20101204_AADHBW rodriguez_e_Page_011.jp2
9252c7cbb356c594322d15b9d2c8a22d
df40aef0b9afbf91f8f53c91a26ccea6c2eb6396
1903 F20101204_AADGWR rodriguez_e_Page_079.txt
60ea1e4ab3629c9946e299560e118225
f0ecb558b7334fa426f34f52056e3b65cbdc8602
6612 F20101204_AADHDA rodriguez_e_Page_102thm.jpg
5d9c3c4bb79505759dbf433602cbd4d7
defd2fff7bd41b82e2ccd9e83c78e1a28d27c4c9
72996 F20101204_AADHCL rodriguez_e_Page_026.jpg
943d6bef038d8f0ccfbcae85fdb51a9c
82cb3f2f7e38a6e90b2765872f0f9dc6e79d7035
F20101204_AADGXF rodriguez_e_Page_030.tif
a3deaae6b5c98384e370da6d73ac1a44
cb03efabb37ef590a6beb7487f985662147759b3
6700 F20101204_AADHBX rodriguez_e_Page_074thm.jpg
9e4ffffbe483613e367796819f85a73e
1012440a1f1be351e5f441dcb763078cabec6605
6990 F20101204_AADGWS rodriguez_e_Page_054.QC.jpg
44b9777dd033f0379d33688beaf000a7
a3de79a7506869ce05d5033ae937ddfac067bdcd
2019 F20101204_AADHDB rodriguez_e_Page_017.txt
5cc66b5ce27524e56db1efc04af55d22
924927dbefbb82de9fa5c6c58600fe43b1ec6040
67049 F20101204_AADHCM rodriguez_e_Page_052.jpg
19ba533963736dddcbca733cc086e74f
57ae0755ce44c6ed50b47e2ee125ea4910d53af9
23290 F20101204_AADGXG rodriguez_e_Page_040.QC.jpg
379b544ad92727a3c490db4cb59f41ae
ae4baab842cf43c1169d7d1c052be3d8588895cc
1999 F20101204_AADHBY rodriguez_e_Page_088.txt
b2a16ddcd3c5e5ae39dde529626eada2
a09722e019cb88fbeaa16715f1d7acc9cb6c94c0
6145 F20101204_AADGWT rodriguez_e_Page_056thm.jpg
f50ee80567e68a524b13be236b8a543d
ba6a589f89688d2fe2499df9178e9964844e9a6a
112394 F20101204_AADHDC rodriguez_e_Page_094.jp2
2ac99c85586823a2d3a4061e713e3fe6
bafc89b11b20ebb8496b5c87ed2a1446c48530da
2103 F20101204_AADHCN rodriguez_e_Page_050thm.jpg
fb88450b3101f820711ce78f474251d1
f19f61bd6df36ecbd115f931eb92a5d55c2079c2
22715 F20101204_AADGXH rodriguez_e_Page_014.QC.jpg
37ecb41d8e1810597c0777c3e01de050
b311f35cef822227b2ecfe198722db514b6c5e96
69264 F20101204_AADHBZ rodriguez_e_Page_078.jpg
969aee6f1aff0bb2d4eedcbf3a6288a7
b8d5090da187df80e277ebed4e53efc4aae589ce
23098 F20101204_AADGWU rodriguez_e_Page_050.jpg
2e1501eba7bdc0f517f9676a9b85a56c
8a34a29f8e3dcd8c5d67b1b3bb0acc413e1bd6f8
24609 F20101204_AADHDD rodriguez_e_Page_033.QC.jpg
513c09d0b53e8a7b106feb80e60f6f06
9d5bb96ee046967c721ab845001e3a50efe3cf34
48591 F20101204_AADHCO rodriguez_e_Page_014.pro
71fd10ce8162bca769f05a69f9ee42e2
a43fb7bc3478b7bbeb012e5115f602e8254e7d02
1051930 F20101204_AADGXI rodriguez_e_Page_082.jp2
c71347ded3fe29280e52881c3ed868b7
0a9c565c64ac0d3a845dcf952a5ead9fa2eeb2e2
F20101204_AADGWV rodriguez_e_Page_076.tif
2fc5b527f27bc00d6d045f56300e0c5c
e29a154015bf74f0e934d30a5abb24df2bb37420
72521 F20101204_AADHDE rodriguez_e_Page_095.jpg
95724c6476910afb6c1b18b6e47a1b28
755ad739866f890bbe5349016fbce22d69ffa4d2
51083 F20101204_AADHCP rodriguez_e_Page_097.pro
372215b40d02f74acd021b5b9dfe421d
4b126e20838fc76529dbd96db3b8b8a4bcacd686
870 F20101204_AADGXJ rodriguez_e_Page_073.txt
972a72db787b940002f01c1d8ac0b6ec
36bce145170a14ca15248de95e11455598487f31
83142 F20101204_AADGWW rodriguez_e_Page_006.pro
ec187e01670a02464c905f67fd18d33d
be8232e5408e652a560fc2c1c2822612f7b02725
2026 F20101204_AADHDF rodriguez_e_Page_012.txt
1b68d778ceaf7753f123e23f1d7c0048
e268841379a856462155580c5210708c229d58d9
105525 F20101204_AADHCQ rodriguez_e_Page_097.jp2
c9d0a73043218c564e133cd3edec7710
ebde0f09a13871f752a8b58e80819af0a8d26634
20259 F20101204_AADGXK rodriguez_e_Page_029.QC.jpg
c8ad6a299d48c58db2cc40b4db3f41c2
5edc07fc5755c5827ee1fe51bafc91c2fecad5f3
1984 F20101204_AADGWX rodriguez_e_Page_060.txt
320e71155cfcb6962227adb71c6c3916
848594344d66c4207989f4c0169e4875d42dd863
1658671 F20101204_AADHDG rodriguez_e.pdf
21084ad7a1974bcdec9e9fb6af126c38
797d4dfbeb4d7a24880f59c7de76c5ea06ed8091
10858 F20101204_AADHCR rodriguez_e_Page_003.jp2
e4a7fc88bf8e57373ce49c8ee8d8e6ec
1d9fb9722579ad6b777dd41d91a98585e9a6298c
69584 F20101204_AADGXL rodriguez_e_Page_023.jpg
2a2f07f9e3ec3c3ca2b60f7186998c4f
0c130351b6d49f3e8cc7f6827b307a4694159fbb
25400 F20101204_AADGWY rodriguez_e_Page_001.jp2
6d21b71ea410a222927f5ab2349c9de6
cdc9067fdc5c049d217c800e4e46d7d485dfa05d
51304 F20101204_AADHDH rodriguez_e_Page_072.pro
702b617dab1ba944ac295d3a5007c5ff
9eb18c40f6d7a448e02bdf5f026a7965dff25daf
104354 F20101204_AADGYA rodriguez_e_Page_047.jp2
8f8bb62f539e9e66f31b721a12db7221
13dcd9a1c88f5d1b13dd7296251e9fdb05bf01c6
48509 F20101204_AADHCS rodriguez_e_Page_031.pro
bdfe6226125f17d1566555bf9c9f10fb
2afcb989a4c83b5bb9a94aee2b4d80c5411bfd8a
6290 F20101204_AADGXM rodriguez_e_Page_079thm.jpg
dcea6487a59bfbe20275edb974d12c2a
191434230cf54e4d482a0f1414d144b58c2d2bae
49008 F20101204_AADGWZ rodriguez_e_Page_086.pro
15dbcf3b5642fda5ee33b30daeedd842
ed58530127d825434bc44153f5645ed04333f564
2145 F20101204_AADGYB rodriguez_e_Page_013.txt
77618f332386103822a2bcafe90912c8
97a1e245df4669a277b81059f56832747426b870
F20101204_AADHCT rodriguez_e_Page_089.txt
0c74535922b41a17aa44c0ac8e9701f9
e8cb6553848b107ef09c0783af7718d850f63d03
17330 F20101204_AADGXN rodriguez_e_Page_044.jp2
55fc351f03e276b37c7b778633eb4c19
45dfc938249fdb47b8d5d8f95b9ad23887b42d6f
20743 F20101204_AADHDI rodriguez_e_Page_067.pro
cec9bea73511f57287e63e5b30379c6c
c971e38ca843bf9b8eef8aec2dc1c9fb031b5f22
73016 F20101204_AADGYC rodriguez_e_Page_022.jpg
0a8f498ca2d32ee646e68889f13cb320
39f8875bf4edff253559f22ff42bd564f1f7b2f2
110377 F20101204_AADHCU rodriguez_e_Page_022.jp2
a3427beb62b12ff993630bc164c0de81
f4740a53fbe6240ee0609e290973b1c382982782
3789 F20101204_AADGXO rodriguez_e_Page_106thm.jpg
1aa305b4791b95cabcf20ad8425a3c6f
06186601efc827b02603e71e91f29555d13a0722
4809 F20101204_AADHDJ rodriguez_e_Page_046thm.jpg
43f1e759df337cdbe226b48b309417d7
16d6486d8ed272dd7cd24de25ced7ed458b7f464
73184 F20101204_AADGYD rodriguez_e_Page_097.jpg
45fff0bbfef8ee60fbef0851757079fb
ff86f5dfab3fd6e8ebd258e896d7fe53cfeace41
8328 F20101204_AADHCV rodriguez_e_Page_105.QC.jpg
b935e15129b7ba35cbe0c7c8252a4b88
15ccc62f0a02a37566d7c55755cafe11eb65fcd0
F20101204_AADGXP rodriguez_e_Page_042.tif
9afd277f85a153ecb61a183946c6df8e
ca2a289c180d8aad28b4e246539de4a8c5181c59
2052 F20101204_AADHDK rodriguez_e_Page_053.txt
ed9594f23b6381dec846b1650aa50feb
11299ee3c0e329c01575bcae3fcd316760fa431d
6453 F20101204_AADGYE rodriguez_e_Page_027thm.jpg
0f4bb44fb7f5d174914661c906080a39
e15f83d85bef582920fa721bd5402f63f347c84a
71132 F20101204_AADHCW rodriguez_e_Page_038.jpg
cc0ae9a87a2afc0a1f66f4ef8dc66720
354142353975629e37b35fbaed0de909298d4b5b
54668 F20101204_AADGXQ rodriguez_e_Page_102.pro
bbe6df9b77fb3dbc80fe9a4980684917
161cc65e7e1651d846fbc43453568fa8bc60303a
F20101204_AADHDL rodriguez_e_Page_038.tif
559fc152ae3725adae792aab3aebf630
ddf3c04c9ac09afc7457c1ebee6234564b9c4b76
26987 F20101204_AADGYF rodriguez_e_Page_050.jp2
a085f8295abfd0d5a609d31746e1e1a7
10d344c1418b5fd6d57f7970bab15f657a1bd9f5
27123 F20101204_AADHCX rodriguez_e_Page_098.QC.jpg
cf777f005d213b387548c431b1a62dde
cc056ca70a3f6d719c3d974a14cb40b4bb477b88
325 F20101204_AADGXR rodriguez_e_Page_044.txt
82bce5737f51b00604b0e6ce9d625e90
45dd427f9131e33cc50728d0e3a3d948163c6934
84784 F20101204_AADHEA rodriguez_e_Page_013.jpg
c6dc3bd822f211b29b861f0bfc40aa17
1757bb2e0438ddacb8cb73a37447dbe3ff4cd106
F20101204_AADHDM rodriguez_e_Page_032.tif
ba5b1f2affed4dcefd637ca5ea0ef5eb
b75bfd4e5ff993b7d091280ecc8d73e8a1af741c
47920 F20101204_AADGYG rodriguez_e_Page_020.pro
5475c1733b8a41e73137995d3fd9b63a
cdd88868f0b20a22877d7a5f42caf77864ddbd7f
4964 F20101204_AADHCY rodriguez_e_Page_005thm.jpg
259f40fefb6198e7801041c3ccebbb7d
1212679c62bbb08434345094ed61062bfead8ee3
51913 F20101204_AADGXS rodriguez_e_Page_091.jpg
a9eef4c81fe2e9574c9555f47964d3cb
6180dbcc7dcf0518c3a91b3de506e2c3a4bd3179
69718 F20101204_AADHEB rodriguez_e_Page_014.jpg
c89c782d9eb86c742c5a29e32fea3710
ad84204048445b82f9820b68a752fec46ec4eeec
F20101204_AADHDN rodriguez_e_Page_020.tif
25c0d4351ec0ec59e7738e4701b88f81
b8fbf955220b6654ac4e4977a2276eb8592cf5fd
F20101204_AADGYH rodriguez_e_Page_009.tif
7d188523291fd8b710e5acf5b85f9437
636992e16b1e05a302df25f7706a712c862b54d7
44199 F20101204_AADHCZ rodriguez_e_Page_055.pro
5b655397cf829459f116dc07b6322069
ecc94ded4ec57128fe70488ac9bd7a5af99177b8
6774 F20101204_AADGXT rodriguez_e_Page_077thm.jpg
8cfa1a6d7f7b3c50af3afbc2f5788268
ecf9dfc55f73e04ba9b420b5193be7a8245d38a3
72703 F20101204_AADHEC rodriguez_e_Page_015.jpg
ec366774183063f700d75ffa20f0ec96
29ecc00b197b11934756ab1e932b515e8af9aefe
161809 F20101204_AADHDO UFE0010200_00001.xml
359a7bd55d0090c78f9e26c202a41f59
b762ed88bf323c360140ecb2e57f237583ce922c
1051802 F20101204_AADGYI rodriguez_e_Page_076.jp2
95bb4b02c80879ae9d478c10ac7f5153
4107ef940479d52ca42656625ad332ca35db304e
76286 F20101204_AADGXU rodriguez_e_Page_080.jpg
970bb3dbb508fcd6e30b2448838bebbb
9878aa07b1ef6ee72def0d7ae1b795e52ff2d36b
72555 F20101204_AADHED rodriguez_e_Page_016.jpg
9aee2b6a778f2a5d8d795da817041da9
ea2a9b0c5f2b5111415d26b4005863d196294944
7004 F20101204_AADGYJ rodriguez_e_Page_013thm.jpg
e0fee5b2e490962632436d8238b07ba4
06ebf3e928bcfa131b000003dacfd86bb882a071
F20101204_AADGXV rodriguez_e_Page_031.tif
ad39a027727666a5787a2c4a1d2a4bc3
b2b17af2fc79d483b251e42653ab612e30e126b2
71849 F20101204_AADHEE rodriguez_e_Page_017.jpg
5b669223491a1893d0ae6a390d72d61f
777b74b6a32e5c2ded571392358b7691ba19093a
6939 F20101204_AADGYK rodriguez_e_Page_072thm.jpg
64c339297fac56099726eb073751bde8
d7b67c5ef48785cfdf263d1f759a68bd3eadb215
F20101204_AADGXW rodriguez_e_Page_080thm.jpg
fc4604c881030fa5c9063a10e51f22bf
d5bad22776499d4d261058f02ceb8e5cfa8170c4
70929 F20101204_AADHEF rodriguez_e_Page_018.jpg
80edbc7eede1aff32ac104a1fe7e0086
5abeb6b99ffdd25af01a1ba8f1505cb0c259b545
24385 F20101204_AADHDR rodriguez_e_Page_001.jpg
de93095f6e21af9274aa7afb27811fda
72cad6285f57b7e666758c2ef33ffd73f29cf751
2882 F20101204_AADGYL rodriguez_e_Page_005.txt
089da618eb5ac0fd82894f61919946f6
27348f4158144e3238f09c45257414d17c441a01
70695 F20101204_AADGXX rodriguez_e_Page_059.jpg
cab0f71db11139a483c5bba6664afa2d
82d031e0e7a89f487a12d7cfa25fde5c362eb1a2
80860 F20101204_AADHEG rodriguez_e_Page_019.jpg
5e6437f3b6ca73d5b3dc5f8090cdef3d
98fa3a80659fcc7a3f683ed82a378a5c39cc711f
1177 F20101204_AADGZA rodriguez_e_Page_049.txt
5571495ad061d7f3a34704a843ac9339
3027a2a3ad50825c5359b3238ba98e36d82a28be
13884 F20101204_AADHDS rodriguez_e_Page_003.jpg
b7a1f79049bf12a7b946c32993fee813
3f36d1e369d768629331669853dc176444674f2f
37139 F20101204_AADGYM rodriguez_e_Page_043.pro
d60c2f9439caf9ef75db9acab669c872
7f1c9adc878e738807cd9301b20dde6abc699fc1
F20101204_AADGXY rodriguez_e_Page_026.tif
7c11a43623fe38d7bdb7e40f778f419a
1a86591df06bb6ebc688a2057a3106e0de644a7f
69260 F20101204_AADHEH rodriguez_e_Page_020.jpg
5b0e2f4e69200e4469fe5eae3c7da487
016326dd0ff029b658ec458dc6997dc42f808ab8
14527 F20101204_AADGZB rodriguez_e_Page_068.QC.jpg
3aa564fada3b181f73e06a19e6f30e0d
ddcec2a6ff5ebc3ff5de2fc1709d64689a033502
53215 F20101204_AADHDT rodriguez_e_Page_004.jpg
71e28ea24af33a1b443594f73e02401c
09c5b3b0920f9e7f3864473f681c2f526ca303f1
71007 F20101204_AADGYN rodriguez_e_Page_060.jpg
ac57a5e217bdad7b68560ef0beef4489
c4f9f6b5cb0874fcd3b58f83c92d4d0da89a9aac
27075 F20101204_AADGXZ rodriguez_e_Page_103.QC.jpg
65854465a1c4910c4d167c065831bc81
a9b90fec7bdf37d9503442661a610ba545adb877
74036 F20101204_AADHEI rodriguez_e_Page_021.jpg
4725039c255883bb4a7536c8bb38cc85
e2a4b89f5229cfa58a45d488a190db4ef0a5f2ad
F20101204_AADGZC rodriguez_e_Page_090.tif
dbacb8d3384104ceccddbc9a5ca0207f
7040bb10f2b77559ad12b7ae5486b9382b4a2bc9
74790 F20101204_AADHDU rodriguez_e_Page_005.jpg
7373292cd1aac80e6ef9ead962b44c42
b7641542a48a78b71edde38a0a258dd1ef9ff91d
23118 F20101204_AADGYO rodriguez_e_Page_081.QC.jpg
963b0ddecbebd2323a5347ba091b13be
86d3450b5551f5f0886c67ce2ddd484d8ce57c81
1728 F20101204_AADGZD rodriguez_e_Page_010.txt
2167a5d82574a69524a48015a2297f2f
76678afa141acb81d135a426ac4f532ece9de3d7
100078 F20101204_AADHDV rodriguez_e_Page_006.jpg
383eb50262ae7a8bb45491fa7fd07ac9
248be72d25aafa206468f41aef74d50a268a35a8
24257 F20101204_AADGYP rodriguez_e_Page_019.QC.jpg
192da33b74eb6daa2c4ab99f6e56dae6
b3d6dc6f59a62aaa5dce8e6437b0fcec095bd85c
71075 F20101204_AADHEJ rodriguez_e_Page_027.jpg
d43124c2b2bd4b0699845e3d245cf356
737ee142edb16d0286ab67c4f8aa8a434130a9b3
F20101204_AADGZE rodriguez_e_Page_036.txt
f1a7ffdb71ac9de369143846e34712f0
9b2eb1a52c3c5bb5e307d0e39d8d5e47fa24c546
60188 F20101204_AADHDW rodriguez_e_Page_007.jpg
0648d257b882f748eb9c961843a8d998
ca68bdb04a53cd69bed0278e7892beda5d385528
61172 F20101204_AADGYQ rodriguez_e_Page_029.jpg
32d9ee59ceea43d5571e85c7161142a3
a4aa77ed8939fa0178106ae02985813983a76ce8
37793 F20101204_AADHEK rodriguez_e_Page_028.jpg
a4146097fb06f5f76f6cbba02f72a5ee
f18aa1c7985598ed7b717fdeef3e44cdea59083f
106999 F20101204_AADGZF rodriguez_e_Page_040.jp2
8ad2329bab87eacaae66c53a2b50cfe0
c282b4bcb1050f00fe719e18e7c7c5377a6a7824
59736 F20101204_AADHDX rodriguez_e_Page_008.jpg
c049887bedd8d3441cbb325d005e6949
db86287319f584b8b2dbe07794537059bdc17412
49106 F20101204_AADGYR rodriguez_e_Page_085.pro
4f94d8f086a78edd31709c34647fcae6
05238f78cf6c720e37866224bddfbc060726b6f8
51578 F20101204_AADHFA rodriguez_e_Page_049.jpg
4f05f199a85094d54f1b3a7d0040c749
0c587a8915c8d55c952cf2eff813af4955a44805
70801 F20101204_AADHEL rodriguez_e_Page_030.jpg
0a0cd13c49f96dff5d6e2c54d65de700
5c0e980f8c70b65dd850e48651860af89c080958
89952 F20101204_AADGZG rodriguez_e_Page_092.jp2
37c8eff8d8a2e7b7abbf789e7a8f2545
bd1b9c5e8f35b7ef3adb4c97f095ce402fc698d8
48176 F20101204_AADHDY rodriguez_e_Page_009.jpg
27fc35d7b4ec44e719b8dbf4f9d13e71
9d1c6d9f935449219c4c6477afa9cf54e5834cfe
F20101204_AADGYS rodriguez_e_Page_084.tif
fd9efc9beb16d597512aa23a7889b611
cbe963a109210de136bef969c8195f6345427220
72573 F20101204_AADHFB rodriguez_e_Page_051.jpg
90c0c336e7d63516e0950e455faea147
013d3f267c17ba35c6478b0fb6f5a931ed52e238
72448 F20101204_AADHEM rodriguez_e_Page_031.jpg
a509c1ff79e0d677637c8c990fed662f
6c08b6fab30b12c940161ee60610aa21e42933ba
F20101204_AADGZH rodriguez_e_Page_069thm.jpg
c0643c1c19359379ddbf50995d5cdbc7
a271fdedb329f139781e26781913abd2cd8f0012
72314 F20101204_AADHDZ rodriguez_e_Page_012.jpg
514b0e0228244bd685d603d5f37fdaec
be4748a734b22cac0d519cecedfff7db1391eede
23389 F20101204_AADGYT rodriguez_e_Page_086.QC.jpg
61c3791b07b116fd883d3730bbb56a39
d067d020a4b060a4934df06ed09cf418620ba061
74111 F20101204_AADHFC rodriguez_e_Page_053.jpg
1e607996c9c86b600740c91044cd1220
fd85ea8cbf3c4a1e234e3f5f52aa48f3fe99467c
76806 F20101204_AADHEN rodriguez_e_Page_032.jpg
69a4a07dd7ec7be4202db96277e782c3
3138821abec072921fdd7f83dd726fa9d1331423
F20101204_AADGZI rodriguez_e_Page_104.tif
ffad553f2410ae66e9ccf9d9ddd16c50
30529c18d782113d89661562b4c4b2f8c9d8ecf8
F20101204_AADGYU rodriguez_e_Page_022.tif
2cb94b7686997714c7440b25e15e03f9
8e46bbc4fd50abfad8aa3e777392d32ef541fe31
21311 F20101204_AADHFD rodriguez_e_Page_054.jpg
09a8caf2039deb1c507c5b751e94c6b3
bcf0e9ec3729d58b8d3ff9037fc53733bbc85d91
73026 F20101204_AADHEO rodriguez_e_Page_033.jpg
3c07c8ab978c699398011e119d78513d
d3ef2f733ed814e8733eccc11d6f7f4e54630e4b
109200 F20101204_AADGZJ rodriguez_e_Page_051.jp2
5b97ee4d18c82f91dcda29c0a9741c42
d904c4e09cdba437993cea0dea8486643f526fb2
6208 F20101204_AADGYV rodriguez_e_Page_014thm.jpg
e6c5b2d6d2d40b7f6159ce76ff34655a
b140cd9daaa7aa8a38dd6e890e4d416c491f5354
65975 F20101204_AADHFE rodriguez_e_Page_055.jpg
1f1ad97540c2b0464bdcd22eb2d081ad
25182713a772bd52892ca13b8caf7a9e2bf4e43c
72249 F20101204_AADHEP rodriguez_e_Page_034.jpg
7e2582800bc6858b2cbd8566424c4adb
c05f33aaf9fd570307d480e7e181a05640be59e2
F20101204_AADGZK rodriguez_e_Page_031.txt
4f72986e75d028cac036eed17333c1b9
a49140ae9b127c67c1405c7935f572c9869bcf53
F20101204_AADGYW rodriguez_e_Page_018.txt
24208cca19c598d06d2b92beb7c3f70e
ffc9f8c4891d5511f012364af4347acbdd20c7a8
69521 F20101204_AADHFF rodriguez_e_Page_056.jpg
4f54ef250d3d9d812c36f81ec014d7c7
3ee9e1797e53f42a2ccedbaa433fe7291a8d08e4
65849 F20101204_AADHEQ rodriguez_e_Page_036.jpg
fa08a7e88a315f37c8cdaa76cc793e79
182614559b853b55c90e4725c4d4527d972fe9cf
100316 F20101204_AADGYX rodriguez_e_Page_036.jp2
074e89541697e14e006d8da94d24fe4b
d1f05dda19c4867d36ee39170840ee820317d205
72631 F20101204_AADHFG rodriguez_e_Page_058.jpg
d6be2588af2bcbc40b21060c099dd293
20641ce40c8804d1fdbaf86c66fcc54812954c3b
70334 F20101204_AADHER rodriguez_e_Page_037.jpg
d29a8bbcbeb956a5264d725de7de5462
08be46c9024c95239ba6f01939c6b086bcfed3b4
7333 F20101204_AADGZL rodriguez_e_Page_098thm.jpg
6fc20e60282dd1b0536d2185f9c66b97
e87ee313c22d6ec0a6a7a7b8fe0cbce9af899a99
23179 F20101204_AADGYY rodriguez_e_Page_059.QC.jpg
ec743a9058bffaf558728a0e3c9f92fc
51f7cd4ce23af784910f6aa349355424bdbc58fc
71728 F20101204_AADHFH rodriguez_e_Page_061.jpg
da6a6096221ff7980c90d8aae0994ec8
58438cd3fe0af44ded90e9143c3b8e1249a3a1aa
71413 F20101204_AADHES rodriguez_e_Page_040.jpg
47e44162cd8cf514c1bd86275fc5be32
0a6006dabdfd01c37d819284bcedc7277a975fe3
3318 F20101204_AADGZM rodriguez_e_Page_096thm.jpg
a1f3b6f04b6d930491c40d51e60722b4
0efd06318b073df9f78a428f8cc2cf0e87359861
1922 F20101204_AADGYZ rodriguez_e_Page_063.txt
16a8052b1f2d0aeb72c82110c6230b1e
b14484443874f3fee68d8ccf16aabb2caee9e0b8
72292 F20101204_AADHFI rodriguez_e_Page_062.jpg
3f81eecbb4928994b7bb5ed6cb14ef37
fd8d3596658ad651393c0edf398fec6c2036c6c8
45687 F20101204_AADHET rodriguez_e_Page_041.jpg
63d618d650b06ad67a047eee992675f8
6e9b9176a45fce91d748f1fe0737900ce5e197bf
68799 F20101204_AADGZN rodriguez_e_Page_039.jpg
bc9d6a7804d56d814f530b07cb5e23d0
3161b8d03cfcaa622538f74555cbd19603e8a958
69163 F20101204_AADHFJ rodriguez_e_Page_063.jpg
cdbef5f95718abf51d7e75ba040290c0
46c4e9064c939f305575e1aad40c29fee1a46d33
40927 F20101204_AADHEU rodriguez_e_Page_042.jpg
347288c4fd0bf33e793e96f795a1941a
110edd3d27f222337be2e4f83aedad930137a1ac
75537 F20101204_AADGZO rodriguez_e_Page_057.jpg
e81d9198aed1930e2ca979048d8e8eef
732f16929e9569f4d3d85cfea9f6cdf0b29bc3cc
17258 F20101204_AADHEV rodriguez_e_Page_044.jpg
a43dc4b57b9a52f72f4329f5683425e7
7cc291f8c07e427d27a109ff419e196ac3de351a
72669 F20101204_AADGZP rodriguez_e_Page_090.jpg
0ad7a329a5f5251f5a18ce316f40be57
508be9f1ac2dfbeeb09a4bd594068c8c3c83ae4d
71997 F20101204_AADHFK rodriguez_e_Page_064.jpg
20d89129cc2e3b63e50c95aaf0489ffa
8da84d3108bdf2cd4e0adc6f497cde1ee70eaa08
76998 F20101204_AADHEW rodriguez_e_Page_045.jpg
9e7ab4ef9bd8aedbaae2336173762262
3adafb54749bae852562efacb59216f45856cdd2
96532 F20101204_AADGZQ rodriguez_e_Page_103.jpg
b423d62aacf864a8ca40dd330ef3ab6c
91b4aacbf87e60adc21110f68ef81fe7fcf67f8d
104396 F20101204_AADHGA rodriguez_e_Page_083.jpg
e40bfdad4446f9ac8d9ca1c2079063da
37fe81f48b8f3715f15d22521681c04a73bd8a7b
69794 F20101204_AADHFL rodriguez_e_Page_065.jpg
5e12b8de08aaaff2c6f5b25ec7c48000
5be4311a536c54d09c57a5adebf9f1dcf2e01047
55097 F20101204_AADHEX rodriguez_e_Page_046.jpg
0586885dcc878bf3eb1e8a553b30b005
0c6ed033ae3efa0cc63e52728af45843e2285f6d
2564 F20101204_AADGZR rodriguez_e_Page_073thm.jpg
9a7349fb6049d6119b20ed2560f44e9e
6d3513439dede1133508edb430eeade9ffc05385
71230 F20101204_AADHGB rodriguez_e_Page_084.jpg
b38a582e13b5379c3592a97010e49351
cf1e413c168e2621666097722d4ed37f36d40566
74677 F20101204_AADHFM rodriguez_e_Page_066.jpg
fc4599f64f0766cc916a2d6fd14f9248
4fc78106995d6749cd5620f045a699570c1ecc15
70345 F20101204_AADHEY rodriguez_e_Page_047.jpg
6ec68e340465efa4021cb1c3c5ad719b
fa90ef51f52f715e53453128313ec1621bba1278
6636 F20101204_AADGZS rodriguez_e_Page_033thm.jpg
f830de0c9075621a2939085bad68b4f9
c1b78cb2eead1318b62177e7a6ffe527e5cf0097
84215 F20101204_AADHGC rodriguez_e_Page_085.jpg
54b91d3028628493808adc86f9bcf0fb
893e5ff1e609500bb9bbd9a06b5d437eaa4eea7e
52404 F20101204_AADHFN rodriguez_e_Page_067.jpg
943a241750264d4af60d1a6cb008e9a2
eeadb6502bb771b0b0a0600317fd8fbc42f3ea85
73717 F20101204_AADHEZ rodriguez_e_Page_048.jpg
caf1d0f940124d0e7c0b89c5ab718553
0997ae25a468d81fed0254fc24c59d7492b24d0a
F20101204_AADGZT rodriguez_e_Page_078.tif
868e4004b3ec1fc8f1ae519b6fcfe5ad
158e81541d0beeb1f9a019258a443211026a864d
72686 F20101204_AADHGD rodriguez_e_Page_087.jpg
48fad2e38531ab837dc19f6f2d797775
e0bb5e1d3dbeefd1db65db68850379e6b0c7299b
55824 F20101204_AADHFO rodriguez_e_Page_068.jpg
6cccf8218deceb979d5d3f9d29dec4bf
1b672dd42b450b0cc807cccb76a7f030e7d745a5
23502 F20101204_AADGZU rodriguez_e_Page_017.QC.jpg
5f8c35b16c8c56d83923cc7c43e69a30
a83c076ec12ec61343394e48270c9d0d301475f5
72016 F20101204_AADHGE rodriguez_e_Page_089.jpg
a4b2658ecd46bb71f4f5c06ff29dfc5d
b4576889a6342119fee17e933bd481fe1fe43028
74137 F20101204_AADHFP rodriguez_e_Page_069.jpg
b083061e61519af7b740413edf0dc76d
5250e7ec4491633e2169e97a73d4db301275a8d9
73208 F20101204_AADGZV rodriguez_e_Page_035.jpg
16448bc4174036207d91e51091321501
dc2c36ec9d548d80d45323f735fed7b401ded0ff
60405 F20101204_AADHGF rodriguez_e_Page_092.jpg
7024317774d28eab265cb749c392c863
4bb03e1d55c0817a9ecd12bf3fd12b8d9ac17c00
57784 F20101204_AADHFQ rodriguez_e_Page_070.jpg
d1bfc767d1756b0e0efca04a8da441eb
ecaf95418d211388ad1440285a9bc6853580807f
14425 F20101204_AADGZW rodriguez_e_Page_049.QC.jpg
e3a8aa41b59563c622f63f0329c18c00
853ad1a6c9b2389918afc11fe07691f9db1aebff
72393 F20101204_AADHGG rodriguez_e_Page_093.jpg
971b18999ebc6d9ff749af04c0329691
c100a1a548b6a5b3fb5047db85d0214af2d1f49c
74529 F20101204_AADHFR rodriguez_e_Page_071.jpg
80d2a82e01542b39ae46d220bddc5ff4
577fcdc860b3106d7ac0fa3fd072e2ea3da87d22
F20101204_AADGZX rodriguez_e_Page_026.txt
2db1ac64ec9e97d80a8fced4f7b1ae9e
a79227ff146c41ce765a05529791d2be54c90534
32788 F20101204_AADHGH rodriguez_e_Page_096.jpg
765e6f7425160a68124b1dee0e5c5ad6
42d18f5bf65214345692f7b96f84a8fab7c202dc
91424 F20101204_AADHFS rodriguez_e_Page_072.jpg
f0966a0225de553bf50c9b4038831ea5
5f9ebe0164577e7438565039871b12d6712acba8
23027 F20101204_AADGZY rodriguez_e_Page_024.QC.jpg
55e32899fd6f970a43b240ac1369a085
af978e718c49a861bbc40e57bae10269a1183fd5
94944 F20101204_AADHGI rodriguez_e_Page_098.jpg
76126fc3234d1728fae3efaf66e11cd0
909de7f35a11c179b4941284bffc799ec15b6947
32541 F20101204_AADHFT rodriguez_e_Page_073.jpg
01b285ab310c1297d9e8fa194c7847d6
21b95505e04916b3afeeaa777d2eeb5d131b6fcf
62919 F20101204_AADGZZ rodriguez_e_Page_011.jpg
6d96ab8e848f8058ab1eedae56b6b170
fc43551075d02eb66f547628df3c339b4a21bf7e
72638 F20101204_AADHFU rodriguez_e_Page_074.jpg
880a62c4d3ae4b17357257be3de8b291
4920f1985e6176d2f5ab68e366c0eac6d43e8053
92498 F20101204_AADHGJ rodriguez_e_Page_099.jpg
494f0c690dd0c0eee03deda96ed7fe05
7d4f327c1b66b75888dc05953d683e5277b35621
73194 F20101204_AADHFV rodriguez_e_Page_075.jpg
0943b7d0e48e0557edc75b57cb4872d0
dbf0d3b5da21633b2fea486204ac33a0a194862b
91546 F20101204_AADHGK rodriguez_e_Page_100.jpg
189de4710f349621a81576a937c4faa4
196d97d8108d936fbf94ab49cc3e4ad019f6773f
117786 F20101204_AADHFW rodriguez_e_Page_077.jpg
84c3b25c24e61da956b64f942a0daf83
0c56cb3173715ec7d264f1fe25dc458f67d94929
70562 F20101204_AADHFX rodriguez_e_Page_079.jpg
406cd7a0e56f89a5cee4035d8851217f
74b1d51c9a645969ac6a192b93d4d02959c5bca8
106387 F20101204_AADHHA rodriguez_e_Page_018.jp2
b42e9d50fcbd8348062d60d824b87c20
55a3e074aaecf0cd7df737dd5aad90016ea5b4d0
72549 F20101204_AADHGL rodriguez_e_Page_102.jpg
16f69ff522ae3ee478ae8809ead16b4d
51bb1e049216c0fa0cb51b5dad948709c97da3c1
70640 F20101204_AADHFY rodriguez_e_Page_081.jpg
81a945f8c9354a4aea955bc90c48b415
214094ec461cd9a7ed7a02d7c30e93fdf592e236
F20101204_AADHHB rodriguez_e_Page_019.jp2
abac0bfd478b4cf2b2a1ba22d2772029
2e839208e1e7a969fc3d04dd60b4ddfec388d649
97590 F20101204_AADHGM rodriguez_e_Page_104.jpg
f7c3913b238366d796064c5af6c96901
687be89dfac96f217b5012cc343dba25d9f3b7dc
94258 F20101204_AADHFZ rodriguez_e_Page_082.jpg
9f7de21a0dee11a898753412c732b0db
ceaee2f42de23586f577da26a35df4cf74b9180b
101198 F20101204_AADHHC rodriguez_e_Page_020.jp2
8b4bbacc474ec4dfcd03a4cd1c460a32
e7c3a3c5c2e6dff051dac4b8664e768354bc77bd
28189 F20101204_AADHGN rodriguez_e_Page_105.jpg
64956eb4e751ddd9399e3ef6be320d0e
3854e64248c97ee314dc5352b7f601855fe70750
111213 F20101204_AADHHD rodriguez_e_Page_021.jp2
395044ad87754a18b628ec31d8f53101
617331bc3e30a3d63df9e3770f584e09e64415c8
37919 F20101204_AADHGO rodriguez_e_Page_106.jpg
acd652f24432373ab9f3d722d8dd9c2a
6512973537e9f6ae2aaad02e0314c538d3c7830f
976914 F20101204_AADHHE rodriguez_e_Page_023.jp2
bc0b5cd90025dfceedbfaa011fc1b480
b0dde4ff5d6e907cb234db0683511579f6c87296
5967 F20101204_AADHGP rodriguez_e_Page_002.jp2
311bdad43a99a57c6d4e86dd9dc88557
644b9aeff68f0c01ea28108da3e22e7b47b64438
106572 F20101204_AADHHF rodriguez_e_Page_024.jp2
8b7f24f3813bd2dcb6c19c06999485b6
167ccf3ce7901a3d715b740902ec8067c385daf4
1051901 F20101204_AADHGQ rodriguez_e_Page_005.jp2
6901c5dd958d1c1919e7e46b790a8315
6250046f8f97397554b5abb7868895218e675a80
111485 F20101204_AADHHG rodriguez_e_Page_026.jp2
fae9965ee94b61b0757d2d1b66a9602b
29960061d6ca9447adc00af5dac9efca4c35f4cb
1051980 F20101204_AADHGR rodriguez_e_Page_006.jp2
9c9a0f4bfc0257957eea6e40a5c649c0
555d93e307f2a766a8031b68f99f7e1c9afe69b0
52767 F20101204_AADHHH rodriguez_e_Page_028.jp2
7738ddd835ecc2e1c089f5f54bf8ab69
fe8d8bf1ea2944e4dbd46df66b62e46932c871f8
85359 F20101204_AADHGS rodriguez_e_Page_008.jp2
52e00fef56826ace63161d7c75b153a6
2fd13d7b77f9003a11ec616c6a2f7549193c0dcc
89667 F20101204_AADHHI rodriguez_e_Page_029.jp2
7512501a2ba3c266c7a9d2d653d8549d
d1c65b53232746fa387dba33197bdd793db85f2e
72066 F20101204_AADHGT rodriguez_e_Page_009.jp2
9cbad15a4abd780f4152b9a571c87751
88faa11b1fed72124d40c7f3552c6734a51fea8d
109071 F20101204_AADHHJ rodriguez_e_Page_031.jp2
3014154dca512d1b9aceec7d74f2c112
3c08f232fa39ca4f27ec04a9675060a738bb275e
90444 F20101204_AADHGU rodriguez_e_Page_010.jp2
829c495196c6d0538d64d875b914e291
523f43dc524c9eaf0a1c01f0f02d1b9cd00918f0
113330 F20101204_AADHHK rodriguez_e_Page_032.jp2
36d472384166c0cdb6151cc504c0f27d
794265d30fbddd7890d12d85da49d02a55646e6c
108208 F20101204_AADHGV rodriguez_e_Page_012.jp2
1dfca183b725d2c451a4e1597dfe566b
6cfad877b48ecd49ac87166dd9f807fbcad04852
110284 F20101204_AADHHL rodriguez_e_Page_033.jp2
f3937afa448dbc9dfab9d694f30e8bb0
431e62679b9e79d3c77bfd7f44c354fede622171
F20101204_AADHGW rodriguez_e_Page_013.jp2
9fe1caf10b7753771e28e6372e1e2bc7
09c880d2f8a4a1d680ecad95d70bf00bd05a038e
101701 F20101204_AADHIA rodriguez_e_Page_056.jp2
24c8e21a38f311674622be7b14a31379
a713b5670017cc5fa09cfcb85a2bdb3c7d9d3011
105891 F20101204_AADHGX rodriguez_e_Page_014.jp2
a29a934d264c8d191ab77cd9946cd9b1
e3282a9f8602fb95224cd12d61bab172cc8e4fef
108946 F20101204_AADHIB rodriguez_e_Page_058.jp2
925968628a6641340b262ed502af2455
c805132a2538acbafc2ececd96d176c77ab58afd
108178 F20101204_AADHHM rodriguez_e_Page_034.jp2
5400a3173cea7afd3976d4315fa6aa5a
0f1da249ddc9e2d870939121e4f611ae2fdd5f52
108883 F20101204_AADHGY rodriguez_e_Page_016.jp2
83b18469d325cff6baccf6985c06b475
c04917be92d9e222f45499f3baf8a2ad38bafbb2
106020 F20101204_AADHIC rodriguez_e_Page_059.jp2
1c1720907b6d9c52568bc808df628370
c899bf53d7da807061a9e0a14b230237e474dda5
110692 F20101204_AADHHN rodriguez_e_Page_035.jp2
489fde00e49f2e03d646b707591372d8
dd9249f55ba57c1d0da9e8ea65103e65b8f7f5c4
108947 F20101204_AADHGZ rodriguez_e_Page_017.jp2
5c60a7ed5079a0b250929bac7d214165
4a43abff484bb548440a88899334e9c44b4f26dc
107828 F20101204_AADHID rodriguez_e_Page_061.jp2
88e727a9108b4fc81851a21be5dca14c
516d3833dd7448d88f22c06451e2600139877757
103810 F20101204_AADHHO rodriguez_e_Page_037.jp2
1bffa6284097c80798470116f6be70af
65b7a32d01213986fa09121fe9135ff20ca0fca4
107677 F20101204_AADHIE rodriguez_e_Page_062.jp2
2b01f5d58b190cb50a0802b37cc13068
7dc62a5856977ebad10916153a3bac34c881b6ad
107468 F20101204_AADHHP rodriguez_e_Page_038.jp2
2029f941086d0e121931b8bb86cbc786
af9d5199c6ac41f803f94c77ca3a35d96c38a055
105514 F20101204_AADHIF rodriguez_e_Page_063.jp2
11baf90e8944ce6ae65c372ea755a9dc
d45993e4bf2ac0b27e013a4a540a85bc04a0d0fc
109131 F20101204_AADHHQ rodriguez_e_Page_039.jp2
0596cf5aadc935526209563022f09fca
9d89e65f15b20720d94312d8088b400250c8cdd8
108573 F20101204_AADHIG rodriguez_e_Page_064.jp2
bfb03881f53ea3a3c3c75d1ca52d2984
d3db180523dd472cc80d2d0bf0a0789478014f89
610533 F20101204_AADHHR rodriguez_e_Page_041.jp2
1e95ec6c718daad13a7183eb121ae5de
f5f422bf1bcb2a8d94e7a4a0c771b78a6d3f2231
104763 F20101204_AADHIH rodriguez_e_Page_065.jp2
2713bb1cbac10dad91d68ae1645521c9
c4ab54bf9eefa6b1ec9e53b99e68300e1b3cc0c7
551901 F20101204_AADHHS rodriguez_e_Page_042.jp2
977041972a9ffd5fc443d9a16d381f63
3eff8276b99d720d7085f33b0c2a6f82db2dbbe9
109040 F20101204_AADHII rodriguez_e_Page_066.jp2
f0190d0aafe7e59126de622edbd767ca
7defafd4cf764ff1b7e79d0486937300e839f746
867853 F20101204_AADHHT rodriguez_e_Page_043.jp2
36c706b89540be2d106fa56b885b63f0
51c50d3d039f1dd24e471db6a2368b904efba8c7
646962 F20101204_AADHIJ rodriguez_e_Page_067.jp2
ef48391ba5400db40058395a78be7981
039e3963d7990c837fa7218fbf835de78123268f
113239 F20101204_AADHHU rodriguez_e_Page_045.jp2
6398972186ef107a5a1049ff9efb9fa2
3b89571389a2e6e18f917ac40ec2a4b47f53347b
110326 F20101204_AADHIK rodriguez_e_Page_069.jp2
6d56973fc6da50606ff33f8a127029bb
d00e1b3493eeec9c80be2e24de351455b6672038
795089 F20101204_AADHHV rodriguez_e_Page_046.jp2
e8fc658126ab9ede2dad390a1137df21
9bab88ddc68edab0a8a8f0f152eb53f919f6c415
735879 F20101204_AADHIL rodriguez_e_Page_070.jp2
4f05ed8195a3921a50a97a031bf3cfab
6806fc6a3a2897347fbbeed5615ac5e26e7e228e
108632 F20101204_AADHHW rodriguez_e_Page_048.jp2
cfdfd1c46c7ff9eb18ea60f933a48347
5900632af5bb408d6e6c0a57fb4250c78f6710aa
109452 F20101204_AADHIM rodriguez_e_Page_071.jp2
ab612e6f21ed567a0797d55322cd65c8
6dc48b353491c7ac1fc0b4a97e22204513dc200d
741103 F20101204_AADHHX rodriguez_e_Page_049.jp2
f6f8a9b80b812b45ce3640fb22d8a49e
40388ce6a36f3fad9aef33af9bd201561a12165c
109001 F20101204_AADHJA rodriguez_e_Page_090.jp2
9d67d76ec3c47c4f7cce4bcbd29c4a59
c7c9ee4d8fbd6c26b169ad53c85aea146c844b08
101343 F20101204_AADHHY rodriguez_e_Page_052.jp2
d9e5fc538726abc460a5738ec19a14c6
ef6143f834cdfe6dfd456c01259122344b207e3e
77702 F20101204_AADHJB rodriguez_e_Page_091.jp2
1c85cb7d59541f243c9a43fe4bc3e026
f32cb3d0773d1de1fc076f01b9dc1f500032e3c6
1051979 F20101204_AADHIN rodriguez_e_Page_072.jp2
9488ad4f07d026e3599e4568f432ffff
9f297ea451b398aba80c85f91bbb74f83cf22ef6
25060 F20101204_AADHHZ rodriguez_e_Page_054.jp2
54e5f7c73695ba32df0480d4d5aa72aa
66d0daa3980c36745f9a996569d3b5d25fc04767
108135 F20101204_AADHJC rodriguez_e_Page_095.jp2
e7b67b8d3dbef4f2e4322084668e010e
98b307e7f1498cdd1928187d69626006cf714518
40720 F20101204_AADHIO rodriguez_e_Page_073.jp2
f54dffdffba002e77e76d917ced80292
87a4f024d24490954da7f1c70ece123f89a5f827
44435 F20101204_AADHJD rodriguez_e_Page_096.jp2
69ef986886716836813a994f2b301ccf
298951697a127938d515a9ce40a1b1849b5799c9
107202 F20101204_AADHIP rodriguez_e_Page_074.jp2
ab8d10c1339b2a3c48897c59d6551a84
34edcfaefcf25e0f20e84d234547c68183277ce2
129118 F20101204_AADHJE rodriguez_e_Page_098.jp2
4fef6d003e153ad4c2f7d62c1c542c00
8deb85fcb0c0fe7a663e80e6f415ee2d15e14161
107756 F20101204_AADHIQ rodriguez_e_Page_075.jp2
b82ee00c4de66aa4fbe54000a92e6ce0
4c2aca12e7705ec585edac7e61b77356db940ac3
123044 F20101204_AADHJF rodriguez_e_Page_100.jp2
0635e916717060e76235e682e10184f5
f721e9e59fc8cfd01b7739c52bb7bcd29ce59a91
172699 F20101204_AADHIR rodriguez_e_Page_077.jp2
45dd1184497ff202b5b1bf37e39b01d8
c015da1de19fa4f0a49173e9c80cc64d64b79453
132241 F20101204_AADHJG rodriguez_e_Page_101.jp2
93c740581315788a6253340b1569dcf9
6c00f064c2912101e36ed4faf72a2005f539fa42
98448 F20101204_AADHIS rodriguez_e_Page_078.jp2
5ff584f2f2ca976a3089b0040b48649e
8ba375d357bfe927bd81bee15b2e6c037842bd92
112571 F20101204_AADHJH rodriguez_e_Page_102.jp2
bea36f486de1a484b5510224b460f94e
86c1cf7b31a8f7eb974e3e78c00fae37cddd918b
103772 F20101204_AADHIT rodriguez_e_Page_079.jp2
214f72f0b7ab9bc64d13b86c90cd805b
2f14ba7fe5722b8aad587a6c5fbeccf1bbc54278
132992 F20101204_AADHJI rodriguez_e_Page_104.jp2
1a36f4459423dc16d5119bf8fc5c1cf1
c68291202ca014d04322f927b8ed8bd34ce2ff1e
114831 F20101204_AADHIU rodriguez_e_Page_080.jp2
2fca00ebe7622274f47580baaccee56e
7a87e95ac75b3ee71febab8ede93a2d7e00d6725
32845 F20101204_AADHJJ rodriguez_e_Page_105.jp2
f7b460627e752a2a29be3ead17402d14
eabcb89a30ff295f25100b9987ee345e72fe554c
105047 F20101204_AADHIV rodriguez_e_Page_081.jp2
39ca03938f372f4d9ddc542a5e370cef
90528d1772690c295dbfba6aec06ff8bed833d21
51219 F20101204_AADHJK rodriguez_e_Page_106.jp2
e653444beb752b084410587059b7d721
72a546365d614529a13359e9718d3eb352503d6b
149926 F20101204_AADHIW rodriguez_e_Page_083.jp2
b165f2136f0f438108b518fbbed146a7
20c4f5ed3ade5f7521eb6c6dd49f2dfc949a3e86
F20101204_AADHJL rodriguez_e_Page_001.tif
b64d19e93901d0e7f51c2cebc7a14217
e94a0a328b0f06f178fefc335c69ed5351ec5a9b
108025 F20101204_AADHIX rodriguez_e_Page_086.jp2
ee8a00679cdf1478483df33557e6ec25
2bab1f96b032225c883501b35caa91e48d410c21
F20101204_AADHKA rodriguez_e_Page_021.tif
05bc60b0e2ff584c170eeada137e1cb8
59431194c9647a435a04e542524771c2672e62c4
F20101204_AADHJM rodriguez_e_Page_002.tif
c4d8480407e472a248a3cdb845c15a41
9c9a06f4be338631250e8759df8a76cb9f533987
110535 F20101204_AADHIY rodriguez_e_Page_087.jp2
fc9bf7f503c5d7d511d293ede7f45067
54917daff02d02762b84a274c9411f7fe8be5edf
F20101204_AADHKB rodriguez_e_Page_023.tif
e3a3d1331861e72f077a070d0bab231c
b36f9f7e70615fbf7962cb16e92153d42fe8b6f7
F20101204_AADHJN rodriguez_e_Page_003.tif
05e57c6d22b0a3a5a8a68846385f8186
45288699202d499f04c0c349dc6e6d4444f8b1ad
108711 F20101204_AADHIZ rodriguez_e_Page_088.jp2
a58eaecef4ee3a3ec0e53fabdb168b6e
083e0fbc09dcc568982674bf71eb4248195b7b07
F20101204_AADHKC rodriguez_e_Page_025.tif
db05bde8f5dc1331dded3cab3245f4b4
17fba6e16d138481f1a3935fedde3fae825fd79a
F20101204_AADHKD rodriguez_e_Page_027.tif
679e13845591896fe8b79e7c9294c150
8e5a4ad599f664b1ae1846cb94f879f4104c2525
F20101204_AADHJO rodriguez_e_Page_004.tif
a1cbb40c6b3ec5020334be989a3d9f11
931f83d3a0f45add61fc0d03db035ad92a288792
F20101204_AADHKE rodriguez_e_Page_028.tif
19259d60ee52dcf80cc923b786f9abf8
fde2e67051e9b6ce63d28638a258e0b1f4461391
F20101204_AADHJP rodriguez_e_Page_006.tif
4bb2ba913da271f19b72456d705b6444
21c82062c5b304ec83d28a2e21f15c351ee30a3d
F20101204_AADHKF rodriguez_e_Page_029.tif
d04ed91011b511f221e51b003ed88952
2a743eb217cb86c0b213bf382ad3eae492bc325e
F20101204_AADHJQ rodriguez_e_Page_010.tif
a4bb55e0a9ff350a5c2f6ac9b0b709c0
e635fc80a7c93879b13e21f3cae95ce980e69436
F20101204_AADHKG rodriguez_e_Page_034.tif
79b86b5d3f235489987f283291b4e1b9
a67c975ae959a010101ed938d43a0b97f4eb3368
F20101204_AADHJR rodriguez_e_Page_011.tif
b69b1d9d55308cd417ae18b8d52aa8e7
fc812b1eec63d528e37bc975dc5a013489c50612
F20101204_AADHKH rodriguez_e_Page_035.tif
b405102ce838dd1330782ac6e5784158
38aa49b741e2d7a5e013f150e8c73cd3f801661a
F20101204_AADHJS rodriguez_e_Page_012.tif
3f41fce8ddf8b939b7982fab649c50b2
db87b0e473cefabf751add90963e2e797f7e638e
F20101204_AADHKI rodriguez_e_Page_036.tif
fb565d17dbed02046c5bc3a73af78358
8fdb06217b8614634c5226409b8b759980fd84b9
F20101204_AADHJT rodriguez_e_Page_013.tif
cf6782b85b2193bf2b6c654f62bd9750
0697800cad2d6da039f6ef8fcb9993d6be183927
F20101204_AADHKJ rodriguez_e_Page_037.tif
5ed19df9233a1689a40257150aedb1de
c067d295bd068602d3a4f565da83d99c64f639e3
F20101204_AADHJU rodriguez_e_Page_014.tif
9a61e91cc6334768c5ab17d8af2f0ce6
283c0ec5bb0b9e26ab6a0ba5f67f084bd8991a62
F20101204_AADHKK rodriguez_e_Page_039.tif
d5990b3df8f1fc33ff4c8c22463037ec
2b605f7707668987c3a2b27c96957f3276091d76
F20101204_AADHJV rodriguez_e_Page_015.tif
f63bed06381218080151480ca8c1024d
af68ff88088689c5ce6227f36ae3d5a1b12d699a
F20101204_AADHKL rodriguez_e_Page_040.tif
3820bd16625bccf8ed817bcc0a2d8cfe
047322c326879ab2d1661781fc4148d2ae90ca0c
F20101204_AADHJW rodriguez_e_Page_016.tif
91d0dbd50fb81882c9ae94e0d5443ffa
d741fc0ad0c641ec06cc6de6c90abf0e30b393ea
F20101204_AADHLA rodriguez_e_Page_057.tif
4142aafacb23c55f8c27481dc5733cd1
60033337aa44fc9e45a3508c149924ca95d24667
F20101204_AADHKM rodriguez_e_Page_043.tif
b8e24df41272596cf6bebf724b3f710a
51afe1cc10d8e5086d75d757e0b35c754050900d
F20101204_AADHJX rodriguez_e_Page_017.tif
b62181f9fbee971c0a39768a866415e9
da569f2f50dd5fb882c239a937b815b26f85d991
F20101204_AADHLB rodriguez_e_Page_058.tif
3f76096f36426dca4355c3ed8c929603
47652a52746fb47e8a77eb9ceb86a4d7aab47a8a
F20101204_AADHKN rodriguez_e_Page_044.tif
1fbc2a998d00d256f11fabb35bae306c
4c56baa4c1ef16a42a56a9e451eba5d6e642969a
F20101204_AADHJY rodriguez_e_Page_018.tif
c4f58b382db385f29956f03c40ad9919
74e20c4b8256966843e5ca360d7199f338579e34
F20101204_AADHLC rodriguez_e_Page_059.tif
5226c36f8f857e8179a900783ae6aad2
03b75adfd13bcb6c7e6e7daa85da494bdf765242
F20101204_AADHKO rodriguez_e_Page_045.tif
5c4a2de123071f540b0cb3b04fa3edac
aa4cd24b45534c5f5cee03c7e042a15dad0b71b2
F20101204_AADHJZ rodriguez_e_Page_019.tif
6c0251b7de74c2ec172b44ecd9f4f2f4
c169ae6a228dd2f9e748f3704602e06ec2ff2b85
F20101204_AADHLD rodriguez_e_Page_060.tif
1a4459da469ce9f712490c2fd1c17322
1e39421960c407f34b4966cccbc17e27b638bf06
F20101204_AADHLE rodriguez_e_Page_061.tif
f425a472f644adf06e58ae8fb00c4d50
e1cf13e778dc494671388033e5a02891b74ff421
F20101204_AADHKP rodriguez_e_Page_046.tif
8be642d7189048b8afbe620a429f7e2c
3e066d31c6de6643db32d792aeef4facbf4f4c4e
F20101204_AADHLF rodriguez_e_Page_062.tif
453461f67c0ad3af7e2399914a3f9a66
437da6fad2cd67b698b9598cf400d39d65e3ff65
F20101204_AADHKQ rodriguez_e_Page_047.tif
8822210651abaacd488c08d6dae1a63d
af15c189309ea218e36c6a98dde9aed7fbb5b6c7
F20101204_AADHKR rodriguez_e_Page_048.tif
493942c5580dfb1902e3e95c6916a2c8
ed6028864b594fac6ad79f7bf4453ffdb38c68ca
F20101204_AADHLG rodriguez_e_Page_063.tif
1d8c5d3bbdef98ac4288efc27561c0e6
8ba09fdca7b00cb466b76bda37490d0772ba6957
F20101204_AADHKS rodriguez_e_Page_049.tif
3365fad8b4485593dce8954dbd3c541f
3cf84d874103d7cb758edd1667b4b7d331c81d88
F20101204_AADHLH rodriguez_e_Page_064.tif
78c12f824893278838346d3512b733d1
6f4a8162da254183c23019f83ea4385854f1b988
F20101204_AADHKT rodriguez_e_Page_050.tif
4e2f7b0285b04d6c641f7bbc961fa7f0
748ecb28acb0036e480cefeb6b31cacdfa8ccd50
F20101204_AADHLI rodriguez_e_Page_065.tif
c603d8a915b3dd2adc827492f3c2c98d
69818ee7facc736bf75061de6a4e0bf26e009f65
F20101204_AADHKU rodriguez_e_Page_051.tif
6f5941ab52bdfed10685a83ecbf5c3b3
c4cec01efe86b90300075386ca99e03753aafdf1
F20101204_AADHLJ rodriguez_e_Page_066.tif
f7e05c28d59793b51b8fbad7a1367db7
c03ba84ad63458135ca410b29fd44afad2b40778
F20101204_AADHKV rodriguez_e_Page_052.tif
62a00ba68173d93f1e42e66a5a465f2e
2e7ea297065f12ca57f5c896f6aab0e529c6c07b
F20101204_AADHLK rodriguez_e_Page_067.tif
d1c8a01b320ee306acee6caf2e940b25
cefed400c33cba05862a0b51c81d6c68709b82e6
F20101204_AADHKW rodriguez_e_Page_053.tif
1cb907a05e631f23c3fe3ff7bb8ae28c
bafff01326acfe8d9ce2e87b09a62846f7a1f88e
F20101204_AADHLL rodriguez_e_Page_068.tif
ad2ecdf0a0f79ea1d3f2544667dc33f3
c7cd4017312864dddd0a0b87a2451e554f06375c
F20101204_AADHKX rodriguez_e_Page_054.tif
9af172486c3837b1601fe7c2638cc210
e06e76fa09a043624503545a7bc9f8d006ebc711
F20101204_AADHMA rodriguez_e_Page_086.tif
af5ef84fe378b8b3a88c1a093d3f7c8a
434411fac4c15913a62278034919a8bffa5cfc50
F20101204_AADHLM rodriguez_e_Page_069.tif
69494aa515a5e21ec5c1ddd76f6ea91a
fb03221518d57348c00c19748896d04dba97f061
F20101204_AADHKY rodriguez_e_Page_055.tif
a12f7b1bdc3eb3e8b10eb13e01a61571
e1a103644dd9fb4d4b4d49a63190b1c7a1381b55
F20101204_AADHMB rodriguez_e_Page_087.tif
a4a7ace93c9a6e6a95b60a8b6f1fb630
1ac39073a4db6368dfbfdb1735721e9fae6c0638
F20101204_AADHLN rodriguez_e_Page_070.tif
dfe3c997d95816d7d1f8d34292cfd9da
ca82823982a438bc4dd024138cba6d8bfff6d40c
F20101204_AADHKZ rodriguez_e_Page_056.tif
a5ab963c08efe349bbb48d88fe7c6a51
418f62f24062c972b6eebcec527c91f75756dfc4
F20101204_AADHMC rodriguez_e_Page_088.tif
9926e8d08bb97a1527ee9f387580825a
2be28588078141ca29db6dde69584dfa3804dec1
F20101204_AADHLO rodriguez_e_Page_071.tif
8f02948cc260cf207a9ee4efa1a6b1a7
0e5860557e3540a6cb41d8cd4fd01ea0e25ca579
F20101204_AADHMD rodriguez_e_Page_089.tif
b37ae605bf3cc8d19afdee4ec9be7c23
c87791c8bdaba404be93df05d7d79ec6a84d5947
F20101204_AADHLP rodriguez_e_Page_072.tif
45590bb7bf54922bbcca3f602177f00b
8f4cd63a3333b10a1d35aa135cd5cf563fb41bf8
F20101204_AADHME rodriguez_e_Page_091.tif
e023e7a9bba7d26f07629c953c7258e9
64fc9d52daf05ae9fdf2932eb0ac38fd94f4a319
F20101204_AADHMF rodriguez_e_Page_092.tif
52f3435403acaef1717e8d890f9e19fd
bde1d884112b674ddfa5b84fec0fd5df6c326f52
F20101204_AADHLQ rodriguez_e_Page_073.tif
031f4bdabbbc1ec6fd6e69569139b6c8
5c97000baeae9629fb008f3145111b17b50abb9b
F20101204_AADHMG rodriguez_e_Page_093.tif
2424acc1e9b1dc1d0c3d87fa447b21fa
03a2c3de13209ea0fba84203ac809631a3722908
F20101204_AADHLR rodriguez_e_Page_074.tif
e7f69a686d6a2bbf302fefa7a41156cb
76f9d7ceaadfec2cebf7206f1b94a626bada1e95
F20101204_AADHMH rodriguez_e_Page_095.tif
9a3069de1f7f161b55c7bbeee535d30e
dfc90772c63bccd1aa69659c6a467803bc06c610
F20101204_AADHLS rodriguez_e_Page_075.tif
edccbe8250905859606571a9047c2d68
ea1bcc12629a84a22eaaca815fa9919015f6f88f
F20101204_AADHMI rodriguez_e_Page_096.tif
92de5929ce177e287e242c6463d5e1f2
e26817b9be60afd54f1a21c09e9c0fb2273cb500
F20101204_AADHLT rodriguez_e_Page_077.tif
d9e173ffbd30233db83a1787fdc33072
be1f77f76bf0150a5324689e0b83587186ca674a
F20101204_AADHMJ rodriguez_e_Page_097.tif
897e531cd89e5716c6606bcea48ebb66
25fd91eb375ca3697aaf1902d2fa68d3ee721167
F20101204_AADHLU rodriguez_e_Page_079.tif
ac81bc2b51779020f4a74a5a177eb3d7
4cb2c7cef0d18868586e520b5852d18c20aa7b4c
F20101204_AADHMK rodriguez_e_Page_099.tif
767472b345c416d15b7ab9c2431acb8f
4dafdacf9c415e449a48e636a79e8ecd2fa4ada9
F20101204_AADHLV rodriguez_e_Page_080.tif
63b05022c23f28f0f30ffbf785e17d3b
181cc00a38907f4fe15851b6327db5fbbb213055
F20101204_AADHML rodriguez_e_Page_100.tif
f7644597937800d8ac8aec4b420638ce
391d8022e35d69f28923c7031f4612e07f7cfdf8
F20101204_AADHLW rodriguez_e_Page_081.tif
e84402969023e6a69fd7477eb4f4c13c
79b67dc9e71b7ba2b48a17e586523c5a6fcadb33
49410 F20101204_AADHNA rodriguez_e_Page_012.pro
6130ef573b5cdae0175d147c2b3e42fc
193ec6c802e651622dfd4df812375df1a503d45e
F20101204_AADHMM rodriguez_e_Page_101.tif
87d81a960393443cc4625d42fd7b2524
cd77b903535b64472475ff12e143005ef4150bb7
F20101204_AADHLX rodriguez_e_Page_082.tif
f5f375c5c9af44bc25f71007c4205ada
877236b267d7ac34a7b7f6b4180ef033fb6c32c6
52803 F20101204_AADHNB rodriguez_e_Page_013.pro
dbe2f8e0aeadfbd25c205328ea1a2b7c
77807f975a37f70d8288b74aa0ffe5dad2ea6419
F20101204_AADHMN rodriguez_e_Page_102.tif
82d467afe1ae93217103a9b850c16249
b97c63ea4be27e82573118c586a3143c1bfa7195
F20101204_AADHLY rodriguez_e_Page_083.tif
e13e0258181c1b6ab8ea2df00d226f1b
f92335133fbc774954489cc0bd1099128b167901
51464 F20101204_AADHNC rodriguez_e_Page_015.pro
2b41ee3cd91bab6d8070fdd251ee276a
b954b2666847b121189cabd74b5b681a9b576ec2
F20101204_AADHMO rodriguez_e_Page_103.tif
10764b6e6cfd6e8c142f8cf2973304f7
0c3561d058723b84a77b0bdbe977ecf2a40d0889
F20101204_AADHLZ rodriguez_e_Page_085.tif
795aaf544af2f1157c688e91ff0b1c15
894eae243779339a940a58cc02d4b266e6a76843
51127 F20101204_AADHND rodriguez_e_Page_016.pro
97695256107869e6f0dc69b3b1e0248c
4f81ce49f116bfa2b3981a7c657c09e52b18e4fe
F20101204_AADHMP rodriguez_e_Page_105.tif
073c612791fc9759ce0884d05e1dd867
cec25cdb1c8e6137c818b2ead98b86c878963e64
50398 F20101204_AADHNE rodriguez_e_Page_017.pro
af4117b794f477dd056e4a52a6d41906
4380cc8fac5290e8494331d2e20d59bef4415704
F20101204_AADHMQ rodriguez_e_Page_106.tif
5dde5e43e5bfa5e728bd0c2a2abe3ff5
e7c87a203b441634aa2bed9cc4d25b44f5ac5576
49194 F20101204_AADHNF rodriguez_e_Page_018.pro
64d30a209a566844be22045f9e4c4adb
ddd3c54fe14e3600c3191cdd333281af0bd0f8e2
32839 F20101204_AADHNG rodriguez_e_Page_019.pro
dbee57a33fb9e4e2b1d00fd4221e8223
aa46637c24f6b6e7c4803a741b5c41d1ddada07e
8768 F20101204_AADHMR rodriguez_e_Page_001.pro
2b2a34e2c7d07f19e2c38e6c62c6aea3
c17a24aa5a6b00b834144b324ea368a5cb6a742b
50055 F20101204_AADHNH rodriguez_e_Page_021.pro
6e78e49db29d38edb01064589edcbbb7
97e931c3503577929b1ac485f6e375149caa4f4f
1227 F20101204_AADHMS rodriguez_e_Page_002.pro
93f79ea74ef86140146a4b6268d58da3
fe4c83b6a2aec9171e5703b5d7b96f0409ab9af0
50382 F20101204_AADHNI rodriguez_e_Page_022.pro
087d5b7505565b70bb6d56ede1ea4f67
d7919990dfb5340bf8f5062458fd0c9180f2ddbd
3838 F20101204_AADHMT rodriguez_e_Page_003.pro
aab97c399dd127adde7fe0cff2288c37
f7024fb6c56abe01ba635fe0cffb06580dbecf8a
41616 F20101204_AADHNJ rodriguez_e_Page_023.pro
a30ccf26d3355d4702bc80ff5d246a1a
7f871948b2dff3933a8e8c4ce315a7a9492fbfd5
34415 F20101204_AADHMU rodriguez_e_Page_004.pro
ad37ba7a2d03c54f037611f7594bba4a
5032b2427f3430887302074d3845d27e71c90ffa
47523 F20101204_AADHNK rodriguez_e_Page_024.pro
299d4c5dcbd0b076c9faa89ee817f805
f3743e170c9c0d0f61f7f04c49d8355772d2a52a
66139 F20101204_AADHMV rodriguez_e_Page_005.pro
4096106cfbf690b49942cf0d5baeadcd
d188b90d081d1d2cb7f40abcb490593b8fc32a6a
17657 F20101204_AADHNL rodriguez_e_Page_025.pro
d4ae3d4d71a2627b15778ce79cb41c8b
b9e868e19f498c204791a7dfa36b43ac3f82d6fd
38800 F20101204_AADHMW rodriguez_e_Page_008.pro
fb4275d62f030e1601b2fb9f880a27cb
82408456c369c6eb5873e65cb1e3bf56df52ccaf
51306 F20101204_AADHNM rodriguez_e_Page_026.pro
411ba965cef4d21ac9d939fda4da307f
0fdb6d0c7ae5dfa073d3796f7a334ad7bdb7a213
32412 F20101204_AADHMX rodriguez_e_Page_009.pro
fd642565de53c4466600d240e542284f
7b74879d8f5581ff4e007eccb322cb9a39353047
49795 F20101204_AADHOA rodriguez_e_Page_051.pro
ea85868de8f4f2743b08ba456bdc966a
6887c2b7b154dfc76eea76b047ef3b101b64f683
40655 F20101204_AADHNN rodriguez_e_Page_029.pro
6d9f48e93c205c802931f129b6d41acc
d6a58d47af9ec54d06f5f93de9f2ebd9925eab9c
40943 F20101204_AADHMY rodriguez_e_Page_010.pro
36f170f52e3364ce380b7fe1dcc88e5d
c616e17ec152b4363c10f32f96ed63623106cee5
51229 F20101204_AADHOB rodriguez_e_Page_053.pro
a5eac102a0fa6b1dd33956e14a5b731a
932e7f049af7f98db5528b3d90a0562b08a3e308
52218 F20101204_AADHNO rodriguez_e_Page_032.pro
b724239ba52a2fcdc9cc933e92a1d8e7
706f0d1afdb9faad10c23bfa0d13c859cca2b795
33177 F20101204_AADHMZ rodriguez_e_Page_011.pro
48af0c8cd6ffb9917fc8cc7244c82fd9
e6d7fccf6314b710322b64270aa9c201d92e7480
10199 F20101204_AADHOC rodriguez_e_Page_054.pro
a88a450dd3d6bf84abf7a29bd94c3d7c
ab58595ae29c07a57e6c5a703b5837fe759e2a76
48695 F20101204_AADHNP rodriguez_e_Page_033.pro
f1cfe33410b3314418765ed67cce0822
d8b0740365560db664eebed4eeeb1b195eab24f5
45503 F20101204_AADHOD rodriguez_e_Page_056.pro
05770496e0467f6fb8a527f577f8179d
89049fc35cc9b4921a5e17826cfc02c8d2fa708c
43510 F20101204_AADHNQ rodriguez_e_Page_036.pro
9d3a1c848eecb9c6528776e374d34916
ab1a08fdf57156377cb0bf3aa8ce294c4aceefe2
49865 F20101204_AADHOE rodriguez_e_Page_057.pro
897745d9b966efb6df84709515cfcef2
652955aae705ed44443489b72ebe34a4357b1a04
48650 F20101204_AADHNR rodriguez_e_Page_037.pro
f2c60c3774c188f64e16c417756422e3
b2979c8e1e2f79bc3cd9dba64b61926fad425e2c
48170 F20101204_AADHOF rodriguez_e_Page_058.pro
3cf4282197f5a5e68dc0a481094a001a
607292a1740ca794499a32ea2f419eb450322458
49057 F20101204_AADHOG rodriguez_e_Page_061.pro
098be10c5029f8fc90426352142b3a06
413036b88a70c497488dd859be31eb9b0ce084f6
48345 F20101204_AADHNS rodriguez_e_Page_038.pro
4e3b308bbe842263b528068a13e10fdf
74ae7ef4b511b339a707444f6f5ca85b772da6a6
49140 F20101204_AADHOH rodriguez_e_Page_062.pro
098678ff42140e36e867d43b6987f9a3
f5776199e7e3c5665b3730cf20df4f27b57de6b6
46696 F20101204_AADHNT rodriguez_e_Page_039.pro
78830a48e0171606f864bcc3cdcfe425
468a1caf99f666921aa035239c5c7e4ac7bd0952
48846 F20101204_AADHOI rodriguez_e_Page_063.pro
d605fe977e7d1d662de3754eb0cda0e9
6489fd645879c0a9193848bdbd09619df2b0f0f8
7003 F20101204_AADHNU rodriguez_e_Page_044.pro
1b9d44decd1c4ff262946c0f82500256
5d1ef61f05a54a96bde0a615bc2dca71b456ddbf
48291 F20101204_AADHOJ rodriguez_e_Page_064.pro
5622a9ccc2ece1f2195cc19518405bda
23269c232fd7023e633a7bb49b4c83bea65a950d
52376 F20101204_AADHNV rodriguez_e_Page_045.pro
33e927fcfddefd7be4a8f432c1e08ac6
c843566ca9857f2f6245dc66ea08017a19e23511
46913 F20101204_AADHOK rodriguez_e_Page_065.pro
2b42a84fd442c2ac9b3d2e81fd400f88
e7e476a2b496be2ac8f64888ae53edf8535ada2b
28384 F20101204_AADHNW rodriguez_e_Page_046.pro
36ccb9e79eaffa339860c305c0ce6b53
8ef8d3db410ef35c9f1c1e2af1260a5b64868bcc
37572 F20101204_AADHOL rodriguez_e_Page_068.pro
e700194e9087e0e77e8d118aa0534374
fbac1fdc55b0ff53bc81498fcf4fb57cc556d7b2
49796 F20101204_AADHNX rodriguez_e_Page_048.pro
071041acd1f198652ce07a20e38c9ea8
d42ca16593f74289be09526db554ae5a65b02d37
34452 F20101204_AADHPA rodriguez_e_Page_091.pro
f02e057f4801585c558fc8b334568d41
c5b895e3a60a957507db37ee6e43c4f978f6b5d5
31998 F20101204_AADHOM rodriguez_e_Page_070.pro
6673da794fd7cd0c26d95e26e3963e6e
c8a01c8aec1c0e19d71d32fd067120ca81f1ea1c
26146 F20101204_AADHNY rodriguez_e_Page_049.pro
32353f95bf806887c44c55c3a048cbfd
03f5fb283b077849c9182b0ad77e36ae1b6ca904
50451 F20101204_AADHPB rodriguez_e_Page_093.pro
9af39d90c40a0b73f86791c10736491e
625440ec674b19ba55de9f8bf342a00a9d26323b
50120 F20101204_AADHON rodriguez_e_Page_071.pro
f59edfb91ae30c7ccd7bde9185d9fa0e
4b78176b01d07ccb27d4954b32141f7b537739c8
11294 F20101204_AADHNZ rodriguez_e_Page_050.pro
d3c84cd6989f8b67eac3cc4bc6486c15
ccf3d2a0af07a7c49f0fed3668b58f92ee0404fc
51315 F20101204_AADHPC rodriguez_e_Page_094.pro
89fab2bd7a458afcd2087bff2a30569a
e84aa2b3cdde13bc29c1c11d994df0ff369d8fe2
19645 F20101204_AADHOO rodriguez_e_Page_073.pro
92c8ac8750ac8e011bdabe9189d31fea
94f3955483acb14826910cddfefad5e51fa03005
50000 F20101204_AADHPD rodriguez_e_Page_095.pro
02432862f93e5b04a3d54b09abdb7ec7
3febdbcf0666defe4fd4e26fef7be336cd620aea
49445 F20101204_AADHOP rodriguez_e_Page_074.pro
2583e759e09034c9b8f58d4705a86990
09fa1814d2f106652c88a271322a95151327ff0b
19203 F20101204_AADHPE rodriguez_e_Page_096.pro
dc5af13fa2cb0ae42079f0f6bb5be1ed
d888d42c2d190f9bc965b25fabda9c01a473e23f
50997 F20101204_AADHOQ rodriguez_e_Page_075.pro
ace1471c0264e0a4bdea90a380fcdbe7
f6351cc92f720a230bb0b78c1e5c28ebd9cd5198



PAGE 1

CHARACTERIZATION OF THE EFFECTS OF REDUCED MUTANT HUNTINGTIN IN THE R6/1 MODEL OF HUNTINGTONS DISEASE By EDGARDO RODRIGUEZ A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2005

PAGE 2

Copyright 2005 by Edgardo Rodriguez

PAGE 3

I dedicate this work to my loving and ever-supportive wife Erica and my daughter Arianna; and to my parents, the inspiration of my life.

PAGE 4

ACKNOWLEDGMENTS I would like to acknowledge the support and enduring patience that my mentor, Dr. Ronald J. Mandel, had towards me from the beginning of this project. I also would like to make special mention of Dr. Alfred S. Lewin, whose wisdom and guidance made me the confident scientist that I am today. I would like to thank all of my committee members, Dr. Lucia Notterperk, Dr. Dennis Steindler and Dr. Nick Muzyczka for their insightfulness. I gratefully acknowledge the help and support from Dr. Eileen Denovan-Wright and her laboratory; she was that second pair of hands we all wish we had. I thank everyone at the Mandel laboratory, especially Izzie Williams, for her technical and moral support. Special thanks go to my beloved friend Carmen Peden. I gratefully acknowledge all of the members of the Lewin laboratory, past and present, for their unconditional friendship and support. I also would like to thank Dr. Corinna Burger and Dr. Kevin Nash for lending me their time and for their ideas. No words convey the gratitude that I have towards my parents. It is with much love that I acknowledge and deeply appreciate the sacrifices and difficulties that my loving wife, Erica, patiently endured. Lastly, but most importantly, I thank God for keeping us safe and healthy through it all. iv

PAGE 5

TABLE OF CONTENTS Page ACKNOWLEDGMENTS .................................................................................................iv LIST OF FIGURES ..........................................................................................................vii ABSTRACT .....................................................................................................................viii CHAPTERS 1 INTRODUCTION........................................................................................................1 Huntingtons Disease....................................................................................................1 Genetics of HD.............................................................................................................3 Huntingtin.....................................................................................................................3 CAG Triplet Repeat Disorders.....................................................................................5 Neuronal Inclusion Bodies...........................................................................................5 Transcriptional Dysregulation in HD...........................................................................6 Transgenic Models of HD............................................................................................8 Gain of Function vs. Loss of Function.......................................................................10 Nucleic Acid-Based Gene Therapy............................................................................12 Ribozymes..................................................................................................................12 RNA Interference........................................................................................................15 Gene Delivery in the CNS..........................................................................................17 2 RIBOZYME-MEDIATED REDUCTION OF STRIATAL MUTANT HUNTINGTIN IN VIVO...........................................................................................20 Introduction.................................................................................................................20 Materials and Methods...............................................................................................22 Defining Target Sites...........................................................................................22 Preparation of Short Ribonucleic Acid Target....................................................22 Time Course Analysis.........................................................................................23 In Vitro Transcription of m-Htt mRNA...............................................................24 Cloning of Ribozymes into rAAV Vectors.........................................................24 Human Embryonic Kidney 293 Cells..................................................................25 Transfections using Lipofectamine on HEK 293 Cells.......................................25 RNA Isolation and Northern Analysis................................................................26 rAAV Vector Production.....................................................................................26 R6/1 Transgenic Colony......................................................................................27 Surgical Procedures.............................................................................................28 v

PAGE 6

Tissue Processing................................................................................................28 In Situ Hybridization Analysis............................................................................29 Results.........................................................................................................................30 Time Course of Ribozyme Cleavage...................................................................30 HD6, HD7 and dsCAG1 Activity Against In Vitro Transcribed m-Htt mRNA.31 HD6 and HD7 Ribozyme Activity Against m-Htt mRNA In Vivo.....................36 In vivo Activity of rAAV-HD6 and rAAV-HD7 Ribozymes..............................36 Biological Effects of rAAV5-HD6 and HD7 Ribozyme Expression in the R6/1 Mouse Striatum.......................................................................................38 Discussion...................................................................................................................42 Ribozymes Can Modulate the Expression of Cellular Genes.............................42 In Vivo use of Ribozymes Directed Against the R6/1 Transgene.......................42 Conclusion..................................................................................................................44 3 RNA INTERFERENCE OF MUTANT HUNTINGTIN IN VIVO...........................46 Introduction.................................................................................................................46 Materials and Methods...............................................................................................47 rAAV-shRNA Plasmid Construction..................................................................47 Testing of shRNA Efficacy in Cultured Cells.....................................................48 Western Blot Analysis using Hum-1 Antibody...................................................49 rAAV Vector Production.....................................................................................50 Intrastriatal Injection of shRNA-Expressing AAV Vectors................................50 In Situ Hybridization Analysis............................................................................55 Effect of Anti-mHtt shRNA on Phenotype.........................................................56 Statistics...............................................................................................................56 Results.........................................................................................................................57 RNA Interference of Mutant Huntingtin In Vitro...............................................57 Long-Term Striatal Expression of rAAV5-shRNAs in the R6/1 Mouse............60 Reduction in the Size and Amount of NIIs is Observed in R6/1 Mice Treated with rAAV5-siHUNT-1 or rAAV5-siHUNT-2...............................................65 Reduced Levels of Striatal mHtt Affect Levels of Striatal-Specific Transcripts........................................................................................................71 Long-Term Bilateral Striatal Expression of rAAV5-siHUNT-1 in the R6/1 Mouse is Associated with a Delay in the Clasping Phenotype........................75 Discussion...................................................................................................................78 4 CONCLUSIONS........................................................................................................83 Unresolved Issues.......................................................................................................84 Future Studies.............................................................................................................86 LIST OF REFERENCES...................................................................................................88 BIOGRAPHICAL SKETCH.............................................................................................97 vi

PAGE 7

LIST OF FIGURES Figure page 1-1. Neuropathology in HD.................................................................................................2 1-2. Structure domains of huntingtin...................................................................................4 1-3. Molecular cascades in HD..........................................................................................10 1-4. The hammerhead ribozyme........................................................................................14 1-5. The RNAi pathway. ...................................................................................................16 2-1. Ribozyme design........................................................................................................32 2-2. Time course cleavage analysis...................................................................................33 2-3. Target accessibility.....................................................................................................34 2-4. In vivo expression of rAAV ribozyme vectors...........................................................37 2-5. rAAV5-HD7 expression results in a loss of striatal-specific transcripts....................40 3-1. rAAV-shRNA constructs mediate the silencing of m-Htt in vitro.............................58 3-2. Experimental design...................................................................................................61 3-3. Long-term in vivo striatal expression of rAAV5-siHUNT1 and rAAV-siHUNT2 decrease mHtt transgene mRNA expression............................................................63 3-4 Analysis of mHtt protein aggregates after expression of rAAV5-shRNAs. ...............67 3-5 In situ hybridization (ISH) analysis of ppEnk and DARPP-32 transcripts.................73 3-6 Bilateral long-term striatal expression of rAAV5-siHUNT-1 delays the clasping phenotype of R6/1 mice...........................................................................................76 vii

PAGE 8

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy CHARACTERIZATION OF THE EFFECTS OF REDUCED MUTANT HUNTINGTIN IN THE R6/1 MODEL OF HUNTINGTONS DISEASE By Edgardo Rodriguez August, 2005 Chair: Ronald J. Mandel Major Department: Neuroscience Huntingtons disease (HD) is a fatal, inherited, autosomal dominant neurological disorder that currently affects over 30,000 individuals in the United States alone. HD is characterized by motor impairment and psychological manifestations. Expression of an abnormally expanded poly-glutamine domain in the N-terminus of the protein called huntingtin is responsible for the genesis and progression of the disease. The aim of this thesis was to develop molecular tools that could mediate the reduction in the levels of mutant huntingtin in the striatum of the R6/1 mouse model of HD. We hypothesized that reduced levels of striatal mutant huntingtin would ameliorate the progressive HD-like phenotype that is observed in the R6/1 mouse. Our initial studies focused on the development of RNA enzymes, called ribozymes, and their ability to specifically target and efficiently knockdown the levels of mutant huntingtin in vivo. We found that, although anti-mutant huntingtin ribozymes were highly efficient in vitro, expression in the R6/1 striatum led to neuronal dysfunction in both viii

PAGE 9

wild-type and R6/1 mice. Attempts at re-designing new ribozymes were hindered by limitations in target site accessibility and availability. Thus, we focused our efforts towards developing a new gene knockdown strategy based on the RNA interference pathway. In vivo expression of anti-mutant huntingtin short-hairpin RNA molecules resulted in a significant reduction in the levels of striatal mutant huntingtin protein in the R6/1 mouse brain. This reduction was associated with a partial clearance of neuronal intranuclear inclusions. In addition, reduced levels of mutant huntingtin led to an increase in the levels of two neuronal-specific transcripts known to be downregulated in HD. Last, there was a delay in the onset of the rear paw clasping progressive phenotype observed in the R6/1 mouse. These results demonstrate that reduced levels of striatal mutant huntingtin are beneficial in a genetic model of HD. Furthermore, the studies presented here address the therapeutic potential of RNA interference in the treatment of dominant disease. Finally, our ribozyme studies suggest the existence of an unidentified gene, or genes, whose expression is critical for the proper function of striatal neurons in the mouse brain. ix

PAGE 10

CHAPTER 1 INTRODUCTION Huntingtons Disease In 1872 a young American physician named George Huntington Jr. accurately described the symptoms of chorea and dementia as well as the adult-onset and genetic inheritance associated with the disease that would ultimately come to bear his name (40, 62). HUNTINGTONS DISEASE (HD) is an inherited, autosomal dominant neurological disorder characterized by choreiform abnormal movements, cognitive deficits and pshychiatric manifestations associated with progressive striatal atrophy (3, 11). Formerly known as Huntingtons chorea, HD affects approximately 1 in every 10,000 individuals of Caucasian origin with close to 30,000 HD patients currently diagnosed in the United States alone. There are at least 150,000 individuals who currently live with a 50 percent chance of developing HD, as well as thousands of family members and friends that must take on the challenge of caring for those with such a chronic devastating disease. Although HD was first described over a century ago, there is currently no effective therapy and, in the case of adult onset HD, the disease always leads to death within 10 to 15 years after the onset of symptoms (11, 97). Huntingtons disease affects different brain regions to various degrees; however, the neuropathological hallmark of HD is the enlargement of the lateral ventricles (3). Expression of the HD mutant gene leads to the selective degeneration of the gamma-amino-butyric-acid (GABA) medium sized spiny neurons that reside in the caudate1

PAGE 11

2 Figure 1-1. Neuropathology in HD. Panel (A) is a coronal section obtained from the brain of an HD affected individual. Notice the striatal degeneration that results in enlarged ventricles. Panel (B) is shown to demonstrate the size of the striatum in a normal brain. putamen nucleus (striatum) (Fig. 1-1). This marked striatal susceptibility is not fully understood and although it results in gross neuroanatomical damage, it is only evident during the later stages of HD and it is not solely responsible for the etiology of the disease (45, 78). In fact, symptoms associated with HD are evident prior to any detectable striatal atrophy (45, 60). These symptoms, which include involuntary twitching, lack of coordination, depression, mood swings and forgetfulness, typically arise during mid-life (35-40 years of age) although close to 10 percent of affected individuals develop a more severe and aggressive form of the disease termed Juvenile HD, in which symptoms are evident before the age of 20 (94). The onset of symptoms prior to any significant cell loss, a phenomenon observed also in several animal models of the disease (7, 74, 84), suggests that neuronal dysfunction, and not cell death, is responsible for the initial stages of HD.

PAGE 12

3 Genetics of HD The advancements in modern molecular techniques during the 1980s and the unprecedented collaborative effort between groups of scientists from different institutions led to the discovery of the HD gene in 1993 (81). The study found that HD is caused by the inheritance of an unstable and excessively repeated cytosine-adenine-guanine (CAG) codon within the coding sequence in exon 1 of the IT-15 gene (HD gene). Unaffected individuals were found to have repeats with lengths of 34 CAGs or less, while HD affected individuals had anywhere between 40 to 121 repeats. In HD, the severity of symptoms seems to be correlated with the number of repeats while the age of onset appears to be inversely proportional to the repeat amount (69), however, recent data obtained from the largest known HD kindred (50,000 individuals in Lake Maracaibo, Venezuela) suggest that genetic modifiers influence both severity and age of onset (90). HD is developed when the CAG expansion is translated into a poly-glutamine (pQ) repeat domain in the N-terminus of the protein encoded by the HD gene named huntingtin (Htt) (81). Expression of expanded mutant Htt (m-Htt) results in the initiation of a cascade of events that progressively disrupt neuronal homeostasis. Importantly, expression of the expanded HD gene leads to activation of caspases, which in turn cleave m-Htt into small N-terminal pQ-containing fragments (46, 61). These fragments can readily cross through the nuclear pore and become aggregated inside the nucleus. Abnormal nuclear translocation of expanded m-Htt N-terminal fragments is required for the pQ-induced cell death observed in cellular models of HD (73). Huntingtin Huntingtin is a large, 348 kDa, cytoplasmic protein of unknown function. It is localized to many subcellular compartments and expressed in all tissues of the body with

PAGE 13

4 Figure 1-2. Structure domains of huntingtin. Shown above is a depiction of the structure domains present in huntingtin. The poly-glutamine domain (pQ) lies just upstream of a poly-proline rich domain (pp). A stretch of 36 HEAT-like domains is thought to serve as docking sites for cellular proteins. higher concentrations found in the brain and testis (24, 50). Htt has three major domains: a polymorphic poly-glutamine domain, a proline-rich domain and 36 HEAT-like repeat structures (Fig, 1-2); however, its amino-acid sequence has no major homology to any known protein (75). Even though Htts function has been difficult to elucidate, new insights have emerged from studies in culture and animal models of HD. Initially, approaches to the study of Htts function focused on the disruption of the murine HD homolog gene (Hdh). Ablation of the Hdh gene in the mouse results in embryonic lethality associated with aberrant brain development and increased apoptotic cell death while post-natal conditional deletion in the mouse forebrain leads to abnormal brain development and neurodegeneration reminiscent of HD (19, 95). These observations suggest a critical role for Htt during neurogenesis and development. Recent evidence suggests that Htt may function as a scaffolding protein (50, 66) and that it is involved in many cellular processes such as neuronal vesicle transport in both the endocytic and secretory pathways, protein trafficking and transcriptional regulation (13). Studies have demonstrated that Htt colocalizes with vesicles and that expression of m-Htt can interfere with normal neuronal vesicular transport (24). Additionally, Htt was found to be a crucial member of the dynactin complex and this interaction was required for the proper cortico-striatal anterograde transport of brain-derived neurotrophic factor (BDNF) (24, 38). Also, wild-type Htt is proposed to have anti-apoptotic properties and may play a

PAGE 14

5 role in neuronal survival (87). The abnormal level of apoptotic cells found in the Hdh knockout mouse supports this hypothesis. Finally, it was recently showed that Htt interacts with the REST-NRSF complex and that this interaction promotes the expression of neuron specific genes such as BDNF (97). Taken together, these data suggest a complex cellular role for Htt; however, what that specific role is, remains inadequately explained. CAG Triplet Repeat Disorders The presence of a pQ domain in m-Htt makes HD a member of a family of at least nine neurological disorders known as the CAG triplet repeat or pQ repeat disorders which include Dentato-rubral pallido-luysian atrophy (DRPLA), Spinobulbar muscular atrophy (SBMA) and the Spino-cerebellar ataxias (SCA) 1, 2, 3, 6, 7 and 17 (20, 23). Although all of these disorders differ in the context of the protein containing the pQ domain, they share many similarities including threshold CAG expansion lengths, genetic inheritance, adult-onset and progressive neurodegeneration (23, 28, 65). Additionally, all of these disorders are well characterized by the aberrant nuclear translocation of the mutant protein as well as by the abnormal aggregation of cellular proteins that results in the formation of intracellular bodies both in and outside the nucleus known as inclusion bodies (30, 71, 89). Neuronal Inclusion Bodies Many of the known neurodegenerative disorders such as HD, Parkinsons disease, Alzheimers disease and amyotrophic lateral sclerosis (ALS) are characterized by the presence of proteinaceous bodies readily visible under the light microscope. In the case of HD, insoluble protein aggregates are observed late in the progression of disease (7, 70, 85, 87). It has been suggested that this process is modulated by the activation of caspases

PAGE 15

6 that mediate the cleavage of m-Htt into small, toxic and aggregate-prone N-terminal fragments (88). m-Htt sequesters into these inclusions, proteins that are critical for maintaining neuronal homeostasis, i.e., transcription factors such as Sp1, effectively interfering with their proper cellular localization and function (14). This sequestration is proposed to take place via a variety of different mechanisms such as the formation of polar-zipper structures, transglutamination and SH3-domain dependent binding, all resulting in aberrant protein-protein interactions that take place in and are modulated by the pQ domain region of m-Htt (7, 66). Also, it has been suggested that inclusion bodies can lead to neurite and neuropil dystrophy and can physically interfere with cellular processes critical for neuronal function such as protein transport and proteosomal processing (11, 32, 49, 50). In contrast, other researchers have proposed that the formation of inclusion bodies in HD is a neuronal defense mechanism designed to neutralize the toxicity associated with the expanded pQ domain in m-Htt. In fact, a strong correlation between the formation of inclusion bodies and survival rate was recently observed in neurons engineered to express m-Htt in culture (2, 63). Whether the presence of inclusion bodies in HD forms an integral part of the disease process itself or is an attempt by neurons to cope with an otherwise toxic protein remains controversial. Nevertheless, many agree that inclusion bodies are a reliable marker of disease progression and suggest a common pathological mechanism amongst many neurological disorders (6, 63). Transcriptional Dysregulation in HD Transcriptional dysregulation has recently been suggested as an important pathogenic mechanimsm in HD (12, 14, 51, 79). Both HD models and patients display a progressive loss in steady-state mRNA levels of a subset of striatal neuronal transcripts

PAGE 16

7 (14, 79). Recent observations implicate the formation of intranuclear inclusions and the sequestration of transcription factors into aggregates as possible explanations for the loss in gene transcription (14). There is mounting evidence suggesting that soluble forms of mutant huntingtin alter the expression of specific genes by interacting with their transcriptional activators (55). X-ray diffraction studies have shown that the poly-glutamine domain in m-Htt can mediate the aberrant interaction between m-Htt and poly-glutamine-containing transcription factors via the formation of polar-zipper structures in vitro (66). In addition, yeast-two hybrid screens have illustrated m-Htts interaction with several transcription factors such as p53, SP1 and the CREB-binding protein (CBP) in vivo (74). This evidence suggests that the specific interaction of m-Htt with factors that control transcriptional activation results in the early and progressive loss of striatal-specific mRNAs in HD. The cyclicAMP-responsive element (CRE) -mediated transcription pathway is impaired in HD (11, 24, 75). CRE-mediated transcription is activated by the interaction between phosphorylated CREB and CBP. This results in the recruitment of the transcriptional machinery and initiates transcription. In HD, the transcriptional co-activator CBP is recruited into m-Htt aggregates and leads to inhibition of CBP-mediated transcription as well as cellular toxicity (41, 55). Overexpression of CBP can alleviate the toxicity associated with the expression of m-Htt in a neuroblastoma cell line. In addition, m-Htt can also sequester TAF II 130, a critical regulator of CBP, CRE-mediated transcription, into aggregates (14). These observations suggest that m-Htt expression can block the proper targeting of the transcriptional machinery to CRE-dependent promoters in affected neurons, resulting in the loss of transcriptional activity.

PAGE 17

8 The interaction between m-Htt and regulators of transcription may provide evidence of the gain of toxic function associated with the abnormally expanded pQ domain in Htt. However, although the interruption on neuronal transcription happens early in the evolution of the disease, the role that this plays in the molecular cascade initiated by expression of m-Htt remains unresolved. Transgenic Models of HD The characterization of the mutation responsible for the neurological phenotype observed in HD in 1993 led to the report of the first successful HD transgenic mouse line, the R6 line, three years later (54). Since then, several transgenic and knockin lines have been developed that accurately portray the progressive phenotype associated with HD (7, 72). All of these have in common the expression of an expanded CAG repeat although they differ in the genetic context in which the abnormal expansion is expressed. Importantly, the onset, rate of progression and severity of motor symptoms displayed by these models are dependent on the number of repeats and the levels of m-Htt protein expression. Of all the lines generated to date, the R6/1 and R6/2 transgenic lines remain the best characterized. In both patients and transgenic HD mice, the age of onset, disease progression and severity of symptoms are correlated with the expression of m-Htt and the length of the trinucleotide CAG repeat. The R6 HD transgenic lines, R6/1 and R6/2, were created by inserting a transgene containing the 5-untranslated region, exon1 with an expanded CAG repeat, and part of the first intron of the human HD gene. This transgene is under the control of the human HD promoter and generates a short N-terminal fragment with an expanded pQ domain. Differences between the R6/1 and the R6/2 transgenic lines include the length of the CAG repeat (R6/2 > R6/1) and the site of integration of the

PAGE 18

9 transgene, thought to result in differences in the amount of protein produced (R6/2>R6/1) (54, 72). R6/1 mice have a slower disease progression and a later onset of motor abnormalities than the R6/2 mice. Previous work demonstrated that levels of m-Htt protein are lower in the R6/1 mice compared to R6/2 and that neuronal intranuclear inclusions (NIIs) form more slowly throughout the brain tissue in R6/1 compared to R6/2 mice (7, 54, 72). Therefore, the length of the polyglutamine tract encoded by the human HD transgene and the relative levels of expression of the transgene affect the rate of HD progression in these mice. The relatively slower rate of disease progression and longer lifespan of the R6/1 mice make them more amenable for the study of slow acting interventions. In this study, we focus on the use of R6/1 mice. The R6/1 transgenic line is characterized by an early onset of pQ-associated changes in neuronal function and a slow progression of motor phenotype. These mice exhibit decreased striatal and total brain size; however reports of neuronal death have been contradictory (7, 38). R6/1 mice also display ubiquitinated nuclear and cytoplasmic neuronal inclusion bodies containing both mutant and wild-type Htt. Also, there is increasing evidence of transcriptional dysregulation, which is modulated by the CAG expansion and levels of transgene expression (36, 56). Finally, the expression of expanded m-Htt results in the development of a neurological phenotype in 15 week-old R6/1 mice, a much earlier time point than was initially reported. R6/1 mice exhibit several behavioral abnormalities including gait disturbances, progressive clasping of the hindlimbs and seizure activity, all associated with neuronal dysfunction (10, 58). Finally, a failure to maintain body weight, as well as muscle wasting, has been reported.

PAGE 19

10 Figure 1-3. Molecular cascades in HD. The interaction of expanded m-Htt with unknown cellular proteins leads to divergent pathways that ultimately result in neuronal pathology. Activation of caspases appears to be an early step in the progression of disease. m-Htt fragments lead to the formation of neuronal intranuclear inclusions (NII) which normally appear just prior to the onset of symptoms. A diagram of disease progression is shown in bottom of the figure. Gain of Function vs. Loss of Function Although HD is a monogenic disorder, it has proven difficult to unravel the pathological mechanism that results in the development of disease. Many molecular pathways that lead to neuronal dysfunction and cell death have been proposed; however, the temporal relationship between these mechanisms and disease progression remains controversial (6, 14, 72). Figure 1-3 is a pictorial representation of the downstream neuronal consequences of m-Htt expression. Independently from downstream effects, the expression of an expanded pQ in m-Htt is directly responsible for the development of HD. However, Htts normal function has remained elusive, greatly hindering the interpretation of data obtained from both cellular and animal models of disease. In order to identify the immediate downstream effectors of m-Htt action, we must gain a detailed understanding of the role that both wild-type and m-Htt play in neuronal function. The recent data on Htts wild type function and its role in neuronal development and survival support a model in which the loss of wild type function is responsible for the pathological molecular process that leads to HD. This model suggests that in homozygote

PAGE 20

11 individuals the absence of a wild-type HD allele may progressively lead to neuronal dysfunction and eventual susceptibility to insults, while in heterozygote patients, mutant Htt may act in a dominant negative fashion against the wild type allele, effectively interfering with the normal cellular function of wild-type Htt. This idea is further supported by the observation that wild-type Htt is also sequestered away into inclusion bodies by mutant Htt and appears to be depleted in both humans as well as animal models of HD (95). In contrast, others favor the idea that the mechanism underlying the pathogenesis of HD is the gain of a new toxic function associated with the pQ expansion in mutant Htt (53). In support of this theory is the fact that individuals with a deletion in one HD allele do not develop HD (Wolf-Hirschorn syndrome) (53) and the observation that there is no significant difference in the severity of symptoms between homozygote and heterozygote HD patients (3). In fact, there is a stronger correlation between the severity of symptoms and the number of CAGs in the HD gene (29, 53, 90). Furthermore, as described earlier, mutant Htt is involved in aberrant protein-protein interactions that result in a disruption of normal neuronal processes in a time dependent manner. The fact that Htts normal function remains elusive is a giant hurdle in the quest for the understanding of the molecular underpinnings of HD. It is likely that both models described above act in concert and are both responsible for the damage observed in HD. However, it is of vital importance to fully dissect the contributions of each during the disease process as this would lead to the development of more effective therapies such as those aimed at reducing the levels of Htt expression in the brain.

PAGE 21

12 Nucleic Acid-Based Gene Therapy The genesis and progression of disease in dominant genetic disorders require the expression of the mutant protein. In the case of HD, this concept was first demonstrated using a mouse model that carried an expanded HD allele engineered to shut down its expression under specific pharmacological conditions (91). This conditional model showed that the expression of m-Htt was necessary to maintain the progression of disease and that interruption of mutant Htt expression, while maintaining wild type levels of normal Htt, led to a reversal of HD-like symptoms including a clearance of inclusions and behavioral improvements. This observation led to the hypothesis that suppressing mutant Htt activity would ameliorate the HD phenotype in affected individuals. Although several pharmacology-based mechanisms may be employed to achieve suppression of gene expression, nucleic acid-based methods (NABM) are the most potent, specific and cost-effective way of achieving post-transcriptional suppression of m-Htt gene expression (18, 81, 82). Recent advances in molecular design and intracellular delivery of nucleic acids further enhance the application of NABM for the treatment of dominant neurological disorders. There are three different NABM that result in post-transcriptional gene silencing: anti-sense oligodeoxyribonucleotides (AODN), ribozymes and small-interfering RNAs (siRNA). This study focused on the use of small self-cleaving ribozymes and siRNAs in order to suppress m-Htt gene expression in vivo. Ribozymes Ribozymes are catalytic RNA molecules that mediate the sequence-specific cleavage of other RNA molecules (34, 35, 48). Ribonucleotide enzymes (ribozymes) catalyze the hydrolysis and phosphoryl exchange at the phosphodiester linkages between RNA bases resulting in cleavage of the substrate. There are three main groups of

PAGE 22

13 ribozymes which are classified as follows based on function and size: self-splicing introns, Rnase P and small self-cleaving ribozymes (96). This study focused on the use of small self-cleaving hammerhead ribozymes, naturally occurring enzymatic RNAs that can catalyze the cleavage of RNA molecules in reactions that are devoid of proteins. The most commonly studied small ribozymes include the hammerhead, the hairpin and the hepatitis delta virus ribozymes (22, 48, 96). Of these three the hammerhead ribozymes display great versatility as a tool for the study of gene function and disease. Hammerhead ribozymes are approximately 34 base-pairs in length and can mediate the cleavage of an RNA target in trans. The hammerhead ribozymes bind substrate to form a structure that consists of a stem and three loops and a catalytic core with a conserved ninenucleotide sequence (96) (Fig. 1-4). Point mutations within the conserved region prevent the cleavage of RNA. The hammerhead ribozyme cleaves the substrate by a trans-esterification reaction, which is dependent on the presence of magnesium and water. The enzymatic reaction results in the formation of two products with distinct 3 (2-3 cyclic phosphate group) and 5ends (5-hydroxyl group). Following the cleavage of the RNA backbone, the reaction products diffuse away from the active site leaving the ribozyme free to complete another reaction cycle. The hammerhead ribozyme recognizes substrate sequences on either side of a NUX triplet cleavage site, where N is any nucleotide and X is any nucleotide except G. The ribozyme anneals to the mRNA substrate by means of two flanking arms, which hybridize to form helices III and I (Fig 1-4). Cleavage occurs at the 3 end of the NUX site. There are varying degrees of cleavage efficiency associated with the sequence of the NUX triplet. Cleavage occurs at the 3 end of the NUX site.

PAGE 23

14 Figure 1-4. The hammerhead ribozyme. The hammerhead ribozyme binds substrate to form a structure, which consists of a stem and three loops and a catalytic core (shaded box) with a conserved nine-nucleotide sequence. The NUX cleavage site is indicated. The arrow denotes the site of bond cleavage. There are varying degrees of cleavage efficiency associated with the sequence of the NUX triplet. In general, the triplet GUC is the most efficient cleavage site, followed by CUC, UUC and AUC (78). Other cleavage sites are cleaved at least 10 times less efficiently than the GUC site (77). The turnover characteristic of ribozymes provides them with an advantage over standard antisense technology, which only inactivates the target RNA without degrading it. Due to their size, catalytic properties and lack of cellular toxicity, hammerhead ribozymes show great promise as tools in molecular medicine. In fact, the successful application of hammerhead and/or hairpin ribozymes in the treatment of dominant genetic disorders has been reported (48). Specifically, the use of hammerhead ribozymes against mutant rhodopsin was shown to effectively protect against photoreceptor degeneration in a mouse model of Retinitis Pigmentosa (47). Additionally, new gene regulation systems are being developed which incorporate the use of regulatory sequences called aptamers into existing hammerhead ribozymes (17, 68). This fusion of these technologies allows for the design of drug-responsive ribozymes, which only

PAGE 24

15 catalyze the cleavage of target RNA in the absence of a regulatory drug while becoming inactive in the presence of the drug. To date, ribozymes are being used in a variety of gene transfer strategies including the suppression of viral infection as well as in anti-oncogene strategies aimed at correcting cancer associated with genetic defect (22, 48, 96). The ease with which hammerhead ribozymes can be designed and regulated, coupled with the recent advances in viral gene delivery systems, give these small versatile molecules great potential as therapeutic agents. RNA Interference During recent years a new technology, called RNA interference (RNAi), has completely revolutionized the study of gene function and the design and application of nucleic acid-based therapies aimed at the silencing of disease-associated gene expression. RNA interference is an innate cellular process associated with immune surveillance as well as the regulation of gene expression during development in mammalian cells (82). This mechanism specifically responds to the presence of double-stranded RNA (dsRNA) molecules and directs the activity of post-transcriptional processes that lead to the sequence-specific inhibition of genes with complementary sequence to the dsRNA molecule (18). During RNAi, dsRNA molecules are rapidly processed by an enzyme called DICER into small duplex RNA molecules of 20 to 21-nucleotides in length called small-interfering RNAs (siRNA). Unidentified components of the RNAi machinery recognize and incorporate a single strand of the siRNA molecule into a ribonucleoprotein complex called the RNA-induced silencing comlex (RISC) (82, 83). RISC can then survey the mRNA population in order to mediate the sequence-specific cleavage of a target mRNA (Fig. 1-5).

PAGE 25

16 Figure 1-5. The RNAi pathway. Intracellular short-hairpin RNAs are processed by DICER (1) into small-interfering RNA molecules (siRNA). siRNAs are loaded into a ribonucleoprotein enzyme complex called RISC (2). The RISC/siRNA complex can mediate the sequence specific cleavage of an RNA molecule (3). This results in the degradation of the cleaved RNA by cellular nucleases. (Illustration by Erica L. Rodriguez) This process can be experimentally manipulated by introducing synthetic siRNAs into the cell, which are then incorporated into RISC and mediate the silencing of the experimental gene of interest (18). Importantly, in mammalian cells the size of the siRNA molecule must not exceed 30-nucleotides in length, since siRNAs that exceed this threshold have been shown to activate the innate interferon response and lead to cell death (83). Additionally, methods for the intracellular expression of short-hairpin RNAs (shRNA) delivered as plasmid vectors have been recently developed (16, 18). shRNAs are expressed as fold-back stem-loop structures comprised of a sense and an antisense

PAGE 26

17 strand and separated by a non-complimentary loop. The transcription of shRNAs is normally placed under the control of RNA polymerase III, which is capable of generating a transcript with a specified 3-end terminal shown to be required for efficient silencing activity (18). Once transcribed by the nuclear machinery, shRNAs are exported into the cytoplasm, processed by DICER into functional siRNAs and incorporated into RISC. Unlike anti-sense oligodeoxyribonucleotides (AODN) and ribozymes, siRNAs achieve the silencing of genes through an endogenous host-cell, anti-viral defense mechanism that has had the opportunity to evolve and become highly efficient over time. Additionally, siRNAs act in concert with the RISC protein complex, which results in increased stability and a more efficient capacity to turn over (18). Also, the stability of RNA duplexes allows for siRNAs to be readily delivered into cells and makes it possible to achieve biologically relevant concentrations inside the cell. Furthermore, low concentrations of highly active siRNAs have been shown to induce long-term gene silencing (82), making these molecules more pharmacologically attractive than either AODNs or ribozymes. However, although this is a potent molecular tool, RNAi is a relatively new and developing technology and unintended effects already known to be associated with it, such as changes in expression of non-targeted genes, must be carefully considered. Gene Delivery in the CNS Viral as well as non-viral vectors can be used to deliver therapeutic genes directly into the central nervous system (CNS) in a process termed in vivo gene transfer. Although non-viral vectors circumvent some of the potential toxic problems associated with viral vectors, it has been difficult to achieve and maintain high levels of transgene expression (43, 65). Viral vectors were designed based on the natural ability of viruses to infect,

PAGE 27

18 transfer and express their genetic material in host cells. When compared to non-viral delivery methods, viral vectors are capable of mediating longer, more widespread and intense transgene expression in the CNS (16, 42, 64). The successful application of viral vectors in the CNS depends on the vectors capacity to mediate long-term transgene expression in non-dividing cells. In addition, the immunogenecity associated with the natural life cycle of the chosen vector most be assessed. Although different viral vectors have been successfully used in the CNS, our study focused on the use of recombinant Adeno-Associated viruses (rAAV). The first rAAV vectors were described approximately 20 years ago (37). Since then, their use has revolutionized the study of genetic disease in the CNS by allowing the temporal and somatic regulation of gene expression (6, 8). AAV recombinant vectors are small, single-stranded DNA viruses capable of infecting both dividing and non-dividing cells (8, 37). Wild-type AAV is a non-pathological member of the parvoviridae family able to integrate its genome into the hosts DNA. In contrast to its wild-type counterpart, rAAV integration events seem to occur less frequently and more randomly (1, 21, 43). rAAV vectors promote stable, long-term transgene expression in the CNS (4, 8). Moreover, CNS exposure to rAAV capsid proteins does not lead to cellular toxicity. However, the presence of circulating antibodies can block rAAV transduction and can mediate a cellular immune response upon re-administration of the vector (86). Recently, three different pseudo-typed rAAV vectors (rAAV-1, rAAV-2 and rAAV-5) where found to efficiently transduce various regions of the rat CNS (13). The use of different pseudo-typed rAAV vectors allows for the development of protocols that can circumvent the

PAGE 28

19 immunological problems associated with circulating antibodies and vector re-administration. The remarkable ability of rAAV vectors to efficiently transduce and sustain the long-term expression of genes in neuronal tissue, with negligible induction of the immune response, have led to the development of a variety of clinical protocols aimed at the treatment of CNS disorders. Some of these gene transfer strategies include gene replacement in Canavans disease, Parkinsons disease and lysosomal storage disorders (15). Also, rAAV-based strategies for the delivery of neuroprotective factors in Alzheimers, Huntingtons and amyotrophic lateral sclerosis (ALS) have been reported (80). In conclusion, rAAV vectors can efficiently deliver genes into the CNS. rAAV holds the promise as the future vector of choice for the delivery of therapeutic genes in the clinic.

PAGE 29

CHAPTER 2 RIBOZYME-MEDIATED REDUCTION OF STRIATAL MUTANT HUNTINGTIN IN VIVO Introduction The progressive striatal pathology observed in Huntingtons disease patients is caused by the expression of an abnormally expanded poly-glutamine (pQ) domain in N-terminus of the ubiquitously expressed protein termed huntingtin (Htt) (29, 53). The uninterrupted expression of m-Htt is necessary for the genesis and evolution of HD as shown by a conditional transgenic mouse model expressing a CAG expanded HD transgene under the control of the tetracycline promoter (92). In this model, transcriptional suppression of m-Htt expression, in both cortical and striatal regions of the brain, led to a reversal of cellular and behavioral HD-like phenotype. However, the effect that reduced striatal levels of m-Htt would have on the phenotype of transgenic HD mice has not been assessed. We hypothesized that post-transcriptional knockdown of m-Htt should lead to an amelioration of the HD-like phenotype in the R6/1 transgenic mouse line. In vitro studies have demonstrated that anti-sense oligodeoxyribonucleotides directed against an expanded human HD allele can mediate the suppression of m-Htt protein expression in cultured cells (9, 33, 59). Similarly, DNA-enzymes, which are composed of a ribonucleotide catalytic frame placed in between deoxy-ribonucleotide hybridizing arms, were successfully used against m-Htt mRNA and resulted in specific suppression of m-Htt protein expression (93). These data suggest that, unlike other 20

PAGE 30

21 proteins such as those involved in cell signaling, reduced intracellular levels of m-Htt do not induce HD promoter activity. More importantly, they demonstrate that the secondary structure of m-Htt mRNA contains biologically accessible regions for Watson-Crick base pairing. However, the application of these two technologies in in vivo models of HD is limited. First, high intracellular concentrations of anti-sense oligo-deoxy-ribonucleotides are required in order to achieve significant reduction of protein expression in vivo (9, 96). This leads to cellular toxicity and the induction of the immune response. Addionally, anti-sense molecules are fairly unstable and the mechanism by which they mediate gene silencing is currently unknown. Also, the efficient in vivo delivery and long-term expression of anti-sense molecules and DNAenzymes, which cannot be encoded for, represents a challenge that is not easily surmounted. Hammerhead ribozymes are RNA enzymes that can be targeted to catalyze the cleavage of a specific RNA molecule (5, 48, 96). High intracellular concentrations of hammerhead ribozymes are not toxic and can be achieved with vector-based expression systems (34, 47, 48). Ribozymes against the untranslated 5end region of the HIV-1 genome have been shown to inhibit virus replication (5). Moreover, rAAV-mediated delivery of a hammerhead ribozyme against mutant rhodopsin mRNA resulted in the rescue of photoreceptors in a mouse model of retinitis pigmentosa (47). These results suggest that hammerhead ribozymes can efficiently mediate the knockdown of target RNAs in vivo. In this study, we examined the effects of ribozyme-mediated post-transcriptional suppression of striatal m-Htt in the R6/1 mouse. We specifically assessed whether rAAV-ribozyme expression could affect the transcriptional dysregulation phenotype that is

PAGE 31

22 associated with the expression of m-Htt in the R6/1 mouse striatum. In vitro screening of ribozymes against the HD transgene expressed in the R6/1 mouse resulted in the identification of two highly active ribozymes. Surprisingly, rAAV-mediated expression of these two ribozymes in the striatum of either R6/1 or age-matched wild-type mice resulted in a marked decrease in the steady-state levels of pre-pro-enkephalin (ppEnk), dompamineand cAMP-regulated phosphoprotein of 32 kDa (DARPP-32) and the dompamine receptor type-2 (D2R) mRNAs. We report that ribozymes targeting a region just upstream of the CAG repeat domain in the human Htt mRNA mediate the cleavage of an unidentified RNA molecule critical for neuronal function and survival. Materials and Methods Defining Target Sites Target sites containing a GUC (HD6 and HD7), CUC (dsCAG1) or UUC (dsCAG2) cleavage site were chosen from the human exon 1 Htt mRNA sequence (Genbank accession number L27350). Target regions with six nucleotides on either side of the arms consisting of a 50% GC content were selected since an ideal length for the target region is between 6-7 nucleotides. The presence of a U/A at the 3 cleavage site also enhances the kcat ten fold. Selected target regions were examined using the RNA folding algorithum designed by Micheal Zucker (REF) The folding program was used to fold 100-200 nucleotides on either side of the NUX cleavage site to determine whether the ribozyme binding location was acceptable. A BLAST search was also conducted to ensure the absence of target sites on any other known human or mouse mRNA sequence. Preparation of Short Ribonucleic Acid Target The target oligonucleotide to be used in the cleavage reactions was radioactively labeled at the 5end using T4 polynucleotide kinase (New England Biochmeicals;

PAGE 32

23 Beverly, MA). The reactions were set up as follows: 2l of the RNA target oligo (10pmol/l, 20pmol total)(Dharmacon, Boulder, CO) was added to a mixture containing 1ul of 10X polynucleotide kinase buffer (Promega, Madison, WI), 1ul RNASin (Promega, Madison, WI), 1ul 0.1M DTT (Sigma, St. Louis, MO), 3l water, 1l (gamma 32P) dATP (10uci) (ICN, Santa Clara CA) and 1l of polynucleotide kinase (5 units) (Sigma, St. Louis, MO). The reaction was incubated at 37 C for 30 minutes. 90l of TE (Fisher, Swanee, GA) was added to the reaction prior to extraction of the unincorporated nucleotides. A spin column (1ml syringe) was prepared with sterile glass wool and loaded with sephadex (Sigma, St. Louis, MO) saturated in water. The column was centrifuged at 1000 RPM for 5 minutes to remove any excess water and to further pack the sephadex. The 32 P labeled target (100l) was loaded on to the column. The column was sealed with parafilm and centrifuged again at 1000 RPM for 5 minutes. The labeled elute was collected in a 1.5ml Eppendorf tube (Fisher, Swanee, GA) and was stored at -20 C. Time Course Analysis Time course analysis was done by setting up a cleavage reaction as follows: 13l of 400mM Tris-HCL (Fisher, Swanee, GA), pH 7.4-7.5 were added to 1ul ribozyme (2pmol) (Dharmacon, Boulder, CO) and 88ul of water. In order to properly fold the ribozyme synthetic RNA, the above mixture was incubated at 65 C for 2 minutes and then left at room temperature for 10 minutes. 13l of a 1:10 ratio of RNasin: 0.1M DTT was added to the reaction mixture along with 13l of 200mM MgCl 2 (20mM final) (Sigma, St. Louis, MO). The reaction was incubated at 37 C for 10 minutes. 1l of the 32P labeled (0.2 pmol) and 1l of unlabeled target (20pmol total) were premixed and added to the reaction mixture at 37C. For each time point, 10 l of the reaction mixture was removed from 37 C and added to a tube containing 10ul of formamide dye mix

PAGE 33

24 (90% formamide (Sigma, St. Louis, MO), 50mM ehtylenediamine tetra acetic acid (EDTA) pH 8 (Fisher,Swanee, GA), 0.05% bromophenol blue (Sigma, St. Louis, MO), and 0.05% xylene cyanol (Sigma, St. Louis, MO). The samples were initially placed on ice and then heat denatured at 90 C for 3 minutes. The denatured samples were cooled on ice before loading 6 l onto a 10% PAGE-8M urea gel to separate the products. Bromophenol blue band was run about 2/3 down the gel. The gels were analyzed on a molecular dynamics phosphoimager. In Vitro Transcription of m-Htt mRNA The human expanded HD transgene expressed in R6/1 mice was amplified from genomic DNA using the sense primer HDPCR1 (5-agggctgtcaatcatgctggc-3) and antisense primer HDPCR1a (5-tctgggttgctgggtcactctg-3). This PCR fragment was cloned into the TOPO TA vector following manufacturers protocol (Invitrogen, San Diego, CA). A HindIII / NotI fragment from the TOPO-R6/1 vector was cloned into the pRC/CMV (Invitrogen, San Diego, CA) plasmid in the forward orientation with respect to the cytomegalorivus immediate early promoter and a putative bacterial T7 promoter sequence. Radio-labeled transcripts were generated using Ambions MAXIscript In Vitro Transcription Kit following manufacturers instructions (Ambion, Austin, Tx). Transcripts were kept frozen at -20 C. Time course analysis was done with a ratio of ribozyme to transcript of 5:1. Reaction conditions were similar to those described above. Cloning of Ribozymes into rAAV Vectors Two complimentary DNA oligonucleotides (Invitrogen, San Diego, CA) were annealed in order to produce a double stranded DNA fragment coding for each hammerhead ribozyme. All DNA oligonucleotides were synthesized with 5phosphate groups. The DNA oligonucleotides were designed to generate a cut HindIII site at the

PAGE 34

25 5end and a cut NsiI site at the 3 end after annealing. The DNA oligonucleotides were incubated at 90 C for 2 minutes and annealed by slow cooling to room temperature for 30 minutes. The resulting double stranded DNA fragment was ligated into the HindIII and NsiI sites of the rAAV vector pTRUF-12 (UF vector Core, http://www.gtc.ufl.edu/gtc-home.htm). A self cleaving hairpin ribozyme has been cloned downstream of the inserted hammerhead ribozymes into a downstream ClaI site. Expression of the ribozyme cassette was placed under the control of the CMV, chicken-beta-actin chimeric enhancer-promoter. The ligated plasmids were transformed into SURE electroporation competent cells (Stratagene, La Jolla, CA) in order to maintain the integrity of the rAAV inverted terminal repeats. Ribozyme clones were sequenced in the University of Floridas DNA sequencing core (ICBR). Human Embryonic Kidney 293 Cells HEK 293 cells were obtained from American Type Culture Collection (ATCC) (Manassas, VA) and plated onto a 150 mm tissue culture dish. The cells were allowed to attach and grow to about 80% confluency. To ensure a homogenous population of HEK cells, the morphology of the HEK cells was recorded using a Zeiss microscope (Zeiss, Goettingen, Germany). Transfections using Lipofectamine on HEK 293 Cells HEK 293 cells were obtained from the American Type Culture Collection (ATCC) (Manassas, VA) and plated onto a 150 mm tissue culture dish. HEK 293 cells were fed with 1X high glucose Dubellcos modified Eagle medium (Invitrogen, San Diego, CA) containing 5 % fetal bovine serum (Invitrogen, San Diego, CA) twice weekly. The cells were cultured at about 80% confluency at which time they would be split on a 1:10 ratio. For transfection experiments, HEK 293 cells (ATCC, Manassas, VA) were seeded onto a

PAGE 35

26 10-cm Corning tissue culture dish and allowed to attach and grow to 70-90% confluency. Lipofectamine and Plus reagents (Invitrogen, San Diego, CA) were used for the transient co-transfection of pCMV-R6/1 and rAAV-ribozyme expression vectors at a 1:5 or 1:10 pCMV-R6/1 to rAAV-ribozyme ratio. In order to control for transfection efficiency, 293 cells were also co-transfected with pCMV-R6/1 and a pTR-UF11 (rAAV-GFP) GFP vector at the same ratios. GFP expression was determined using a fluorescence microscope at 24hr and 48hr. Cells were harvested 48hr post-transfection RNA Isolation and Northern Analysis Total RNA was isolated from HEK 293 cells by using the TRIzol reagent (Invitrogen, San Diego, CA). Northern blot analysis was performed using standard techniques. Briefly, 25g of total RNA were separated on a formaldehyde-containing 1.2 % agarose gel. Fractionated RNA was then transfer unto Hybond N+ membranes using alkalize transfer and probed with a 32 P product of a HindIII/AgeI digest of the pCMV-R6/1 vector (~ 150-bp of sequence spanning the 5UTR and ATG translational start sites). Sample loading was normalized by stripping and re-probing the same membranes with a probe that recognizes nucleotides 150-270 of the human -actin mRNA. Blots were exposed to phosphoimager-ready intensifying screens and intensity of bands was measured using a Phosphoimager scanner (Molecular Dynamics) rAAV Vector Production All rAAV vector preparations used in this study were made by the University of Florida Vector Core facility (Powell Gene Therapy Center). Briefly, rAAV vector is produced in human HEK 293 cells by transient CaPO4 precipitation-mediated co-transfection of the rAAV expression vector plasmid and a helper-plasmid that encodes the AAV rep and cap genes along with certain adenovirus genes (26). After 72 hours,

PAGE 36

27 cells are harvested and stored at -80 C. Cell are resuspended in 0.5% sodium deoxycholate in 20 mM Tris, pH 8.0 and 150mM NaCl, treated with benzonase, and cellular membranes are disrupted by three cycles of repeated freeze-thaws. Crude lysates are purified using affinity chromatography, followed by cation exchange chromatography. The final product is concentrated to a final titer of 1-5 X 10 13 genome copies per ml. R6/1 Transgenic Colony Animal experiments were performed in the laboratory of Eileen Denovan-Wright, PhD (Dept of Pharmacology, Dalhousie University, Halifax, Nova Scotia, Canada). Transgenic R6/1 HD mice were originally obtained from Jackson Laboratories and breeding colonies were maintained at Dalhousie University. R6/1 males were crossed with unrelated CBAxC57BL/6 females. After weaning, the mice were group housed under 12 h light-dark cycle with ad libitum access to food and water. All mice were genotyped at 3 weeks of age and at the time of death by amplifying a region of the human huntingtin transgene using primers 5 AGG GCGT GTC AAT CAT GCT GG 3 and 5 GGA CTT GAG GGA CTC GAA 3. These primers correspond to a region upstream of the CAG repeat at nts 77-96 and 347-364, respectively, of human huntingtin (Genbank Accession number XM 003405). DNA was extracted from ear punches that were digested with Proteinase K and used as the substrate for PCR using the REDExtract-N-Amp Ready Mix (Sigma). Animal care and handling protocols were in accordance with the guidelines detailed by the Canadian Council on Animal Care and were approved by the Carleton Animal Care Committee at Dalhousie University.

PAGE 37

28 Surgical Procedures Isofluorane was delivered by inhalation to anesthetize the mice. After induction of anesthesia, the mice were placed into a sterotaxic frame (Kopf Instruments, Tujunga, CA). All injections were performed using a continuous infusion system (Carnegie Medicin, Sweden), attached to a 10 l Hamilton microsyringe fitted with a glass micropipette with an outer diameter of 60-80 m (Mandel et al., 1999). The anterior-posterior (AP) and medial-lateral (ML) stereotaxic coordinates were calculated from bregma and the dorso-ventral (DV) coordinates were calculated from the dural surface. A burr hole was drilled in the skull at the calculated AP and ML coordinates. Mice received intrastriatal injections of rAAV2 or rAAV5 expressing HD6 or HD7 or GFP suspended in phosphate-buffered saline (PBS) at a dose of 2 l/site and an infusion rate of 0.5 l/min. During the infusion of rAAV, the glass pipette was slowly retracted 1 mm every min. One minute after the cessation of the infusion, the micropipette was retracted an additional 1 mm, allowed to remain at this position for 4 min and then slowly retracted from the brain. The stereotaxic coordinates used for two injections within the same striatum were: Site 1: AP = +1.0, ML = 1.8, DV = -3.3; Site 2: AP = +0.4, ML = + 2.1, DV .4. The DV coordinate was calculated with the tooth bar set at 0.0 mm. Tissue Processing Ten-weeks after the intrastriatal infusion of rAAV, the mice were deeply anesthetized with sodium pentobarbital (65 mg/kg i.p.) and decapitated. The brains were removed and frozen at o C. Tissue sections (14 m) were cut using a Micron cryostat through the rostral-caudal axis of the striatum, thaw-mounted onto Fischer SuperFrost slides and stored at o C. For each slide, 5 sections, each separated by approximately

PAGE 38

29 350 m, were placed on a single slide. This distribution of tissue was used to ensure that each slide contained sections taken throughout the anterior-posterior regions of the mouse striatum. In Situ Hybridization Analysis In situ hybridization was performed on coronal sections (Bregma +1.70 to .50; Franklin and Paxinos, 1997) of mouse brains using radiolabeled antisense gene-specific oligonucleotide probes. Frozen sections were allowed to reach room temperature, fixed with 4% paraformaldehyde in 1X phosphate-buffered saline (PBS) for 5 min, rinsed twice for 3 min in 1X PBS, once for 20 min in 2X sodium chloride-sodium citrate (SSC), and then air dried. Each slide was covered in 200 ul of hybridization buffer (50% deionized formamide, 5X SSC, 1X Denhardts reagent, 0.02 M sodium phosphate, ph 6.8, 0.2% SDS, 5 mM Na2EDTA, 10 ug/ml Poly(A)n, 10% dextran sulfate, 50 ug/ml salmon sperm DNA, 50 ug/ml yeast tRNA) containing ~1 x 10 6 c.p.m./ml of oligonucletide probe that had been 3 end-labeled with [33 P]dATP for 90 min at 37 o C using terminal deoxynucleotidyl transferase (Promega). Prior to use, unincorporated nucleotides were removed from the labeled probes using a Sephadex G-25 spin column (Pharmacia). The slides were coverslipped with parafilm and incubated overnight at 42C in a humidified chamber. The coverslips were removed in 2X SSC and the slides were washed for four times for 30 min at 55C in 1X SSC, four times for 30 min at 55C in 0.5X SSC, two times for 30 min at 55C in 0.25X SSC, then rinsed briefly in H20 and allowed to air dry overnight. Slides were exposed to Kodak Biomax MR film for up to 4 weeks at room temperature. The hybridization signals were analyzed using Kodak 1D Image Analysis Software as described in Hebb et al. (2004). The sequences of the probes

PAGE 39

30 used were: ribozyme probe (5-cttacaccc cactcgtgcaggctgcccaggg-3), ppEnk (5tctgcatccttcttcatgaaaccgccatacctcttggcaaccat-3), DARPP-32 (5-tccacttggtcctcagagttgccatctctc-3), NGFi-A (5-ccgttgctcagcagcatgatgtc ctccagtttggggtagttgtcc-3), D2 receptor (5-ggcagggttggcaatgatacactcattctggtcttgatt-3), -actin (5-ggcgatccacacggagtacttgcgctcaggaggagcaatgatct-3). Results Time Course of Ribozyme Cleavage We initially screened ribozymes that were directed against four different regions along the mRNA sequence of the human HD transgene expressed in the R6/1 mouse. Figure 2-1A is a schematic of all four ribozymes and their target sequences. HD6 and HD7 ribozymes (Rbz) were targeted to unique and overlapping sequences that lie between the ATG translational start site and the polymorphic CAG repeat domain. dsCAG1 and dsCAG2 were targeted to unique sequences immediately downstream of the expanded CAG domain (Fig. 2-1B). Time course analysis of target cleavage was done for the HD6, HD7, dsCAG1 and dsCAG2 hammerhead ribozymes as described in the methods section. Figure 2-2 shows autoradiographs from 10% polyacrylamide-8M urea gels used to separate the products of cleavage of each of the four ribozymes and their targets following reactions performed at 37 C and at 20mM MgCl 2 The autoradiographs show an increase in the 5cleaved products over time and a corresponding decrease in the levels of target. Significant product accumulation was detected almost immediately after the addition of target to the reaction. Figure 2-2B shows a graphical representation of the percent of product cleaved as a function of time for all four ribozymes tested. This analysis demonstrated that HD6, HD7 and dsCAG1 could mediate the efficient cleavage

PAGE 40

31 (~90% at the 10 minute time point) of target RNA in vitro. In contrast, dsCAG2 Rbz was unable to cleave more than 5% of its target after 60 minutes of reaction time. HD6, HD7 and dsCAG1 Activity Against In Vitro Transcribed m-Htt mRNA Success of ribozyme-mediated suppression of gene expression requires the identification of RNA target sites that are not masked by intrinsic RNA secondary structures. Although algorithms such as the M-fold program predict RNA secondary structure, determining the bio-availability of target sites requires an experimental approach. To examine the accessibility of target sites, we cloned the expanded human HD transgene that is expressed in the R6/1 mouse into a pRC/CMV (Invitrogen) expression vector (pCMV-R6/1). This vector can drive both in vitro and in vivo transcription of the cloned gene. We generated in vitro transcripts of the R6/1 transgene and performed cleavage reactions under identical conditions as described for the short-target time course cleavage reaction (see methods section). Figure 2-3A shows autoradiographs from 5% polyacrylamide gels used to separate the products of cleavage of both HD6 and HD7 Rbz following incubation with the R6/1 derived m-Htt transcript. Significant product accumulation from the HD7 Rbz reaction was initially detected 15 minutes after the addition of Rbz to target (Fig 2-3A, HD7 Rbz lane 1). There was an increase in the accumulation of the expected size product over time. In contrast, HD6 Rz mediated cleavage of m-Htt mRNA in vitro was not as efficient as the one observed with HD7 Rz (Fig 2-3). Nevertheless, the accumulation of product of the expected size suggests that this target site is available for binding and cleavage. In fact, as shown in figure 3-1B, HD6 and HD7 Rz have overlapping sequences. The small but significant

PAGE 41

32 Figure 2-1. Ribozyme design. Four ribozymes were designed to target unique sequences in the human HD exon 1. In (A) ribozymes are shown annealing to their target sequences with the NUX triplet depicted in color. B. Illustration of the four target sites in relation to the CAG triplet repeat domain in human HD exon 1. difference in turnover activity between these two Rbz might be explained by factors influencing the release of product. dsCAG1 Rbz was unable to mediate the cleavage of m-Htt transcript in vitro. This lack of enzymatic activity was likely due to the inability of dsCAG1 Rbz to properly bind to its target site within the context of m-Htt RNAs secondary structure.

PAGE 42

33 Figure 2-2. Time course cleavage analysis. A. Autoradiographs from 10% acrylamide gels used to separate the product of the reaction from the target. Target signal decreased while a corresponding product signal accumulated as a function of time. B. Graphical representation of the reactions shown above. Data is presented as percent target cleaved. Ribozymes HD6 (closed circles), HD7 (open triangles) and dsCAG1 (closed triangles) were capable of cleaving > 80% 10 mins into the reaction while dsCAG2 was much slower (closed circles).

PAGE 43

34 Figure 2-3. Target accessibility. A. Autoradiographs from 5 % acrylamide gels separating the products of a time course analysis of two highly active ribozymes, HD6, HD7. Both ribozymes were incubated with an in vitro transcribed human HD exon1 transcript (top left arrow) to determine the accessibility of the target sites within the context of a folded RNA molecule. Lanes 2-through-4 are the 15, 30, and 60 min time points for each reaction. Lane 1, in both autoradriographs, is a 60 min time point of a reaction that was devoid of ribozyme. Expected size products for both HD6 and HD7 accumulated over time (top and bottom right arrows). HD6 Rbz was less active against the in vitro transcribed human HD exon1 transcript (Lane 5 is an overnight incubation time point). Panel (B) is a northern blot analysis (top autoradiograph) of m-Htt mRNA. Total RNA was obtained from HEK 293 cells that were transiently co-transfected with pCMV-R6/1 (m-Htt) and either a GFP, HD6 or HD7 expression plasmid. Increasing the concentration of HD6 Rbz vector from a 1:5, target to ribozyme ratio (lane 3), to a 1:10, target to ribozyme ratio (lane 4), resulted in an increase in activity as determined by the intensity of the m-Htt mRNA band. HD7 Rbz activity against m-Htt mRNA

PAGE 44

Figure 2-3 continued remained constant at either 1:5 (lane 5) or 1:10 (lane 6) target to ribozyme ratio. The same blot was probed with a -actin probe to normalize sample loading. Both ribozymes reduced m-Htt mRNA levels by > 60% when compared to controls.

PAGE 45

36 HD6 and HD7 Ribozyme Activity Against m-Htt mRNA In Vivo We next examined the activity of HD6 and HD7 Rbz against m-Htt mRNA in cultured HEK293 cells. HD6 and HD7 Rbz were cloned into a rAAV vector specifically engineered for the intracellular expression of HH Rbz (Figure 2-4A). This expression cassette generates a transcript that is processed by a self-cleaving hairpin ribozyme strategically placed downstream of the sequence encoding for either HD6 or HD7 Rbz. The self-cleaving activity of the hairpin ribozyme results in the release of a small HH Rbz-containing RNA and a transcript with an internal ribosomal entry site (IRES) sequence to facilitate the translation of the downstream GFP sequence. In order to test the activity of these Rbz against m-Htt mRNA in culture, HEK293 cells were transiently co-transfected with CMV-R6/1 and either rAAV-HD6 or rAAV-HD7 Rbz vectors. Northern blot analysis of total RNA obtained forty-eight hours post-transfection showed a significant decrease (>60% of control) in the levels of m-Htt mRNA in samples obtained from both rAAV-HD6 and rAAV-HD7 transfected cells (Fig. 2-3B). This decrease was not evident in cells that were co-transfected with a rAAV-GFP expressing vector. Interestingly, increasing the rAAV-HD6 Rbz to target ratio from 1:5 to 1:10 resulted in a significant increase in cleavage activity (Fig 2-3B lanes 3 and 4). In vivo Activity of rAAV-HD6 and rAAV-HD7 Ribozymes The focus of this study was to evaluate the effects that reduced striatal levels of m-Htt would have in the striatal-specific transcriptional dysregulation associated with the expression of m-Htt protein in the R6/1 mouse model of HD. Initially, we generated rAAV type 2 (rAAV2) particles encoding for HD6, HD7 or GFP control (see Methods). Intrastriatal injections of high-titer rAAV2 resulted in intense and localized transduction of the mouse striatum (Fig. 2-4B). Although the levels of viral expression attained with

PAGE 46

37 Figure 2-4. In vivo expression of rAAV ribozyme vectors. (A) Diagram depicting the ribozyme expression cassette that was packaged into rAAV viral particles. A hairpin self-cleaving ribozyme (self-cleaving Rz), placed immediately downstream from the HD6 and HD7 cloning sites, was used to mediate the processing of the primary Rbz-containing transcript. B. In situ hybridization analysis of the viral RNA transcript was done on coronal sections obtained from mice injected with either rAAV2 or rAAV5-HD7 vector. The ribozyme-specific probe was allowed to hybridize with the sections under identical conditions. rAAV2 were remarkably high, the feasibility of this study was dependent upon extensive striatal transduction. We therefore generated rAAV viral vectors pseudotyped with the capsid from rAAV serotype-5 (rAAV5) encoding for HD6 (rAAV5-HD6 Rbz), HD7 (rAAV5-HD7 Rbz) and GFP (rAAV5GFP). Our rationale was based on a recent elegant

PAGE 47

38 study showing that intrastriatal delivery of rAAV5 particles in the rat brain results in a larger transduced area when compared to rAAV2 vectors (13). Intrastriatal delivery of rAAV5-HD6 or HD7 Rz in R6/1 and age-matched wild-type mice resulted in a dramatic increase in the brain transduced area when compared to rAAV2 particles as demonstrated by in situ hybridization (ISH) analysis using a Rbz-specific probe (Fig. 2-4B). To determine the in vivo activity of rAAV5-HD6 and rAAV5-HD7, R6/1 and age-matched wild-type littermate controls were divided into the following experimental groups: rAAV5-HD6 (R6/1 n=8, wild-type n=5), rAAV5-HD7 (R6/1 n=8, wild-type n=5) and rAAV5-GFP (R6/1 n=5, wild-type n=5). Six week-old mice were injected unilaterally at two different striatal sites in the right hemisphere while the left hemisphere remained uninjected and served as control (Fig 2-4B). Ten weeks post-surgery fresh frozen brains were obtained, sectioned and maintained frozen throughout the remainder of the experiment. Biological Effects of rAAV5-HD6 and HD7 Ribozyme Expression in the R6/1 Mouse Striatum Alterations in gene transcription occur prior to the display of motor abnormalities in the R6/1 mouse of HD. Striatal-specific genes known to be downregulated in HD include the dopamine-, cAMP-regulated phosphoprotein of 32 kDa (DARPP-32), pre-pro-enkephalin (ppEnk), nerve growth factor-inducible A (NGFi-A) and the dopamine type-2 receptor (D2R).Reduction in the steady-state mRNA levels of these transcripts is both progressive and modulated by the length of the expansion repeat and the expression levels of m-Htt. Thus, ribozyme-mediated knockdown of m-Htt expression should lead to an increase in the transcript levels of ppEnk, DARPP-32, D2R and NGFi-A.

PAGE 48

39 To test this hypothesis, we performed in situ hybridization analysis with probes specific to either NGFi-A, DARPP-32, ppEnk and D2R mRNAs (Fig 2-5). Analysis of coronal sections obtained from R6/1 mice unilaterally injected with rAAV5-HD6 or -HD7 ribozyme showed an unexpected sharp decrease in the mRNA levels of ppEnk, DARPP-32 and D2R around the area of transduction. Unexpectedly, expression of either rAAV5-HD6 or HD7 Rz exacerbated the rate of mRNA loss for most of the analyzed transcripts in the R6/1 mouse striatum (Fig 2-5A bottom panel). In contrast, there was a significant induction of NGFi-A mRNA in the right injected striatum of the R6/1 mouse. To further characterize this loss in mRNA steady-state levels, we analyzed sections obtained from injected age-matched wild-type mice. ISH analysis revealed a similar pattern of loss in transcriptional activity, albeit to a lesser degree (Fig. 3-5A top panel). This effect was specific to the intracellular expression of Rbz in striatal tissue since cultured HEK293 cells did not exhibit any HD6 or HD7 Rbz-associated toxicity. Furthermore, analysis of sections from rAAV5-GFP animals showed that long-term expression of rAAV5-GFP does not lead to detectable changes in the steady-state levels of either NGFi-A or D-32 mRNA (Fig. 2-5B). We next investigated if this effect was associated with the expression of the self-cleaving hairpin ribozyme or the IRES-GFP transcript, which are encoded by our rAAV expression cassette (Fig. 2-4A). We injected wild-type mice with a rAAV2-HD7 Rz in the right hemisphere and rAAV2-hAAT Rz in the left hemisphere. hAAT Rz targets the human alpha-1 anti-trypsin (hAAT) liver enzyme which is not expressed in neuronal tissue. As shown by ISH analysis, rAAV2-HD7 Rz increased the steady-state levels of NGFi-A while causing a loss in the levels of D-32 mRNA (Fig. 2-5C).

PAGE 49

40 Figure 2-5. rAAV5-HD7 expression results in a loss of striatal-specific transcripts. A. In situ hybridization analysis of coronal sections obtained from a wild-type (WT) and a R6/1 (HD) mouse. Comparison between genotypes revealed a marked difference in the mRNA levels of NGFi-A, DARPP-32 (D-32), ppEnk and D2 receptor (left hemispheres). rAAV5-HD7 expression led to a remarkable loss in DARPP-32, ppEnk and D2 receptor mRNAs in both injected R6/1 and wild-type mice. In contrast, NGFi-A mRNA was increased to levels that were ~20% above wild-type in both wild-type and R6/1 injected mice. Panel (B) are coronal sections obtained from wild-type mice injected with a rAAV5-GFP vector. In situ hybridization analysis demonstrated that the loss in hybridization signal intensity of DARPP-32 and the increase in the levels of

PAGE 50

Figure 2-5 continued NGFi-A were specific to striatal expression of the HD7 ribozyme. C. Coronal sections obtained from wild-type animals expressing either rAAV2-HD7 ribozyme or a ribozyme targeting hAAT (rAAV2-hAAT). Analysis of DARPP-32 and NGFi-A expression revealed that the loss and gain in mRNA levels was specifically associated with the HD7 target sequence. Arrows on (A) and (C) denote the injected hemisphere.

PAGE 51

42 Discussion Ribozymes Can Modulate the Expression of Cellular Genes There are a number of reports on the ability of the hammerhead ribozymes to control expression of specific genes in cell culture. For example, a hammerhead ribozyme designed to cleave mRNA encoding C-Ha Ras mutation inhibited formation of foci of transformed cells by 50% (22). Hammerhead ribozymes have also been used to target oncogenes. The use of hammerhead ribozymes targeted to survivin, which is expressed in carcinoma cells, resulted in up to 74% reduction in the levels of surviving mRNA (76). Finally, hammerhead ribozymes have also been shown to effectively reduce the levels of a rhodopsin mutant protein in vivo (34, 47). Taken together these data demonstrate that hammerhead ribozymes are capable of modulating the expression levels of targeted genes. This study demonstrates that hammerhead ribozymes can also be designed to suppress the expression of m-Htt in culture. However, upon detailed examination, our in vivo results showed an off-target effect associated with the expression of both HD6 and HD7 hammerhead ribozymes. This effect raises questions concerning the efficiency and safety of ribozymes as tools in molecular medicine. In Vivo use of Ribozymes Directed Against the R6/1 Transgene HD is a progressively devastating neurological disorder that currently affects the lives of approximately 30,000 individuals in the United States alone. Although pharmacological interventions exist that are designed to alleviate some of the excruciating symptoms associated with this disorder, HD remains largely without an effective treatment (53). The overall goal of this project was to develop a gene transfer strategy based on the rAAV-mediated delivery of anti-m-Htt hammerhead ribozymes in the striatum of the R6/1 mouse model of HD. This strategy was aimed at reducing the

PAGE 52

43 levels of striatal m-Htt in order to prevent, reverse or ameliorate the symptoms associated with HD. Four hammerhead ribozymes directed against the HD transgene expressed in the R6/1 mouse were designed and characterized in vitro. We showed that co-expression of either rAAV5-HD6 or HD7 Rbz with a m-Htt expression vector (pCMV-R6/1) results in significant reduction in the relative levels of m-Htt mRNA (> 60%) as determined by densitometric analysis. However, in vivo expression of rAAV5-HD6 or HD7 Rbz in the striatum of R6/1 mice resulted in a loss in the mRNA levels of striatal-specific genes known to be critical for neuronal function. This reduction in striatal mRNA levels was not due to a global suppression of transcriptional activity since the steady-state levels of the NGFi-A transcript were induced to levels that were ~20% that of control. This result was unexpected and contrary to our initial hypothesis. Furthermore, in situ hybridization analysis of sections obtained from age-matched treated wild-type mice showed a reduction in the steady-state mRNA levels of the same striatal-specific genes. Since both of these ribozymes were directed against the human HD transgene in the R6/1 mouse and should not have cleaved any other known mouse RNA sequence, the loss of mRNA levels in wild-type animals lead us to conclude that there is an off-targeting effect associated with the striatal expression of HD6 or HD7 ribozymes which was not evident in cultured HEK293 cells. This off-targeting effect results in the cleavage of an unidentified RNA transcript that codes for a protein whose expression is necessary to neuronal function as evidenced by the loss of a subset of neuronal and striatal specific mRNAs in wild-type mice.

PAGE 53

44 In an attempt to identify this transcript, we performed BLAST searches for short, nearly exact matching sequences. We limited the search, to sequences exhibiting greater than 50% sequence similarity to the HD6 and HD7 target site. Additionally, we only analyzed sequences that contained the required GUC triplet cleavage site and are expressed in neural tissue. Initial screens did not yield any significant matches to the human HD sequence spanned by the HD6 and HD7 target sites. However, the inclusion of expressed sequence tags (ESTs) during the search resulted in the identification of 6 sequences that have up to 60% similarity with the ribozymes target sites, contained the GUC triplet and are expressed in cultured neurospheres. The identification of the gene, or genes, responsible for the loss in striatal-specific mRNA levels might lead to the elucidation of an unknown gene function. Conclusion In this study we limited the designed of hammerhead ribozymes to sequences that are contained within the human HD transgene expressed in the R6/1 mouse. This transgene contains approximately 1 kb of 5UTR sequence, an expanded exon 1 (117 CAG repeats) and 262 bases of intron 1. The design of ribozymes is limited by the NUX triplet rule where N is any nucleotide, U is uracil and X is any nucleotide but guanosine (Fig. 2-1). The small size of the transgene made the search for cleavage target sites extremely challenging. Furthermore, the identification of potential target sites does not necessarily correlate with the design of highly active hammerhead ribozymes as it was demonstrated in this study (Fig. 2-2A). These two factors limit our ability to test our underlying hypothesis using hammerhead ribozymes. Although the use of a full-length HD mouse model would increase the success probability of applying the use of hammerhead ribozymes to post-transcriptionally modulate the levels of m-Htt protein,

PAGE 54

45 these models have slow, late-onset phenotypes that have not been fully described. Recently, the use of RNAi in a neurological model of disease led to cellular and behavioral improvements (91). This new technology is not dependent on NUX target rules and results in a more stable and long-term silencing effect. The application of RNAi in HD will be the focus in the next chapter.

PAGE 55

CHAPTER 3 RNA INTERFERENCE OF MUTANT HUNTINGTIN IN VIVO Introduction The genesis and progression of disease in dominant genetic disorders, such as HD, require the presence and expression of a mutant allele. Nucleic acid-based molecules have been designed to inhibit gene expression by sequence-specific targeting of mutant mRNAs. It has been demonstrated that the expression of short, hairpin-like double-stranded RNA (shRNA) molecules in neuronal cells, both in vivo and in vitro, results in the sequence specific silencing of targeted genes (16). In fact, the successful in vitro application of synthetic siRNAs against members of the polyglutamine family of diseases, including HD, was recently reported (52, 57). This suppression was achieved by targeting siRNAs to either the CAG repeat region or to adjacent gene sequences and could even be designed to be allele-specific. RNAi has also proven to be an efficient therapeutic tool in in vivo models of pQ disease. A recent report demonstrated the full potential of this technology in a transgenic mouse model of SCA-1 (91). In this experiment, cerebellar long-term expression of an anti-ataxin-1 siRNA was achieved by delivering an shRNA expression cassette with a recombinant adeno-associated viral vector. shRNA expression resulted in greater than 50% reduction of ataxin-1 protein in the cerebellum. Reduction in ataxin-1 transgene expression was associated with a rescue of the Purkinke cells as well as significant behavioral improvements in this model of SCA-1. This elegant study, addressing the applicability of RNAi in neurological disease, suggests that the pathological mechanism 46

PAGE 56

47 associated with HD could be effectively halted or reversed by introducing siRNAs that can target the striatal expression of mutant Htt. In this study, we examined the effects of RNAi mediated post-transcriptional silencing of striatal m-Htt in the R6/1 mouse. We specifically assessed whether reduced levels of striatal m-Htt could affect the transcriptional dysregulation phenotype that is associated with the expression of m-Htt in the R6/1 mouse striatum. Long-term in vivo expression of two rAAV5-shRNA vectors lead to the significant reduction in striatal m-Htt mRNA and protein levels as determined by real-time quantitative RT-PCR, western blot and immunohistochemistry analysis. This reduction was concomitant with a decrease in both the size and number of neuronal intranuclear inclusions (NIIs). Finally, reduced levels of striatal m-Htt resulted in an increase in the steady-state levels of ppEnk and DARPP-32 transcripts as well as in mild-behavioral improvements. Materials and Methods rAAV-shRNA Plasmid Construction Two complimentary DNA oligonucleotides (Invitrogen, San Diego, CA) were allowed to anneal in order to produce a double-stranded DNA fragment coding for the sense strand, 9 nucleotide loop and antisense strand of both anti-huntingtin shRNAs tested. siHUNT-1 targeted nucleotides 262-281 (5-GCCGCGAGTCGGCCCGAGGC-3, Fig. 3-1B) and siHUNT-2 targeted nucleotides 342-363 (5-GGCCTTCGAGTCCCTCAAGTCC-3, Fig. 3-1B) of the human HD mRNA (Genbank accession no. L12392 ). Double-stranded DNA fragments were ligated into the Bgl2/HindIII sites of the rAAV vector pSOFF-H1p-hrGFP. This vector contains the human RNAse P H1 promoter downstream of the rAAV serotype-5 ITR and a cDNA

PAGE 57

48 encoding the humanized Renilla reniformis GFP (Stratagene, La Jolla, CA) protein under the control of the herpes simplex virus thymidine kinase (HSV-TK) promoter. Testing of shRNA Efficacy in Cultured Cells A portion of the mHtt transgene was PCR amplified from R6/1 mouse genomic DNA using forward (5-AGGGCTGTCAATCATGCTGG-3) and reverse (5-TCTGGGTTGCTGGGTCACTCTGTCTCTGCGGAGCCGGGGG-3) primers. The resulting product was cloned into pCR 2.1-TOPO TA cloning kit (Invitrogen, Carlsbad, CA), sequenced and subcloned into the HindIII/NsiI sites present in the pRC/CMV (Invitrogen, Carlsbad, CA) eukaryotic expression plasmid. The resultant plasmid (pCMV-R6/1) expressed part of the 5UTR, the coding region within exon 1 with ~115 contiguous CAG repeats, and part of intron 1 of the mHtt transgene under the control of the minimal cytomegalovirus (CMV) promoter. Human embryonic kidney 293T (HEK293) cells (ATCC, Manassas, VA) were seeded onto a 10-cm Corning tissue culture dish and allowed to attach and grow to 70-90% confluency. Lipofectamine and Plus reagents (Invitrogen, San Diego, CA) were used for transient co-transfection of HEK293 cells with pCMV-R6/1 and rAAV-shRNA vectors at a ratio of 1:4 and 1:8 respectively. In order to control for non-specific off-targeting effects, we performed co-transfection of the pCMV-R6/1 plasmid with a rAAV-shRNA vector targeting the dog rhodopsin mRNA (siRho-1). rAAV-siRho-1 has been shown to be active against its target both in vitro and in vivo (M. Gorbatyuk and A. Lewin manuscript submitted). Transfection efficiency was determined by analysis of GFP-positive cells and ranged from 70-80%. All transfected cells were harvested 48 hr post-transfection for northern and western analysis. Total RNA was isolated from transfected HEK293 cells using TRIzol reagent (Invitrogen, San Diego, CA). Northern

PAGE 58

49 blot analysis was performed using standard techniques (Current Protocols in Mol Biol, Wiley editing house). Briefly, 10 g of total RNA was fractionated on a 1.2 % formaldehyde agarose gel and transferred to Hybond N+ (Amersham, Piscataway, NJ) membrane by capillary action. pCMV-R6/1 was subjected to restriction enzyme digestion using HindIII and AgeI, the 150 bp fragment spanning the 5 UTR and ATG initiation codon of the mHtt transgene was gel-purified, radio-labeled using [32 P]dCTP (3000 mCi/ml; MP Biochemicals, Irvine, CA) and used as the hybridization probe. RNA loading was normalized by removing the mHtt-specific probe and re-probing the membrane with a radio-labeled fragment complementary to nucleotides 150-270 of the human -actin mRNA (Genbank accession no. BC002409). Blots were exposed to phosphoimager-ready intensifying screens and the intensity of labeled bands was determined using a Molecular Dynamics phosphoimager. Western Blot Analysis using Hum-1 Antibody A polyclonal antibody (Hum-1) was raised in New Zealand white rabbits against the human Htt-synthetic peptide Ac-PQLPQPPPQAQPLLPQPQC-OH and affinity-purified (New England Peptide, Gardner, Massachusetts ). Pre-immune serum was used as a control. Western blot analysis was performed by blocking the membranes for 2 hr at room temperature in 5% (w/v) skim milk powder in 20 mM Tris, 146 mM NaCl, 0.1% Tween-20 (TBST), incubating the membranes in a 1:500 dilution of affinity-purified polyclonal rabbit anti-human huntingtin transgene protein (Hum 1) antibody in 5% (w/v) skim milk powder/TBST at 4 C overnight. Membranes were washed 2 x 20 min in TBST. A peroxidase-labeled goat anti-rabbit IgG secondary antibody (1:2000, Vector Laboratories, Burlingame, CA) was incubated for 1 hr at room temperature in 5% skim

PAGE 59

50 milk powder/TBST. Interaction between the primary and secondary antibodies was detected using West Pico SuperSignal chemiluminescent substrate using the protocol recommended by the manufacturer (Pierce Biotechnology, Rockford, IL) and Hyperfilm ECLTM (Amersham Pharmacia Biotech, England) rAAV Vector Production All rAAV vector preparations used in this study were produced by the University of Florida Powell Gene Therapy CenterVector Core facility using the method described in [47]. The rAAV5 vector used in this study consisted of rAAV5 capsids and AAV5 ITRs and is therefore not a pseudotyped vector (13). A standard triple transfection method using the helper DNAs pDG [49] for required adenoviral proteins, our transgene plasmid described above and pAAV5.2 which has rep and cap from AAV5. Crude rAAV5 virus was then purified by iodixanol step gradients and Sepharose Q column chromatography as previously described (13). The final product is concentrated to final titers of 1 to 5 X 10 13 genome copies per ml. Intrastriatal Injection of shRNA-Expressing AAV Vectors. All animal care, handling and surgical protocols were in accordance with the guidelines established by the Canadian Council on Animal Care and were approved by the Carleton Animal Care Committee at Dalhousie University. Transgenic R6/1 HD mice were obtained from Jackson Laboratories and used to establish a breeding colony at Dalhousie University. R6/1 males were crossed with unrelated CBAxC57BL/6 females. After weaning, the mice were group housed under a 12 h light-dark cycle with ad libitum access to food and water. All mice were genotyped at 3 weeks of age and at the time of death by amplifying a region of the human HD transgene as described previously (36).

PAGE 60

51 Stereotaxic administration of AAV vectors were performed on 6 to 8 week-old wild-type and R6/1 mice under isofluorance anesthesia. The anterior-posterior (AP) and medial-lateral (ML) stereotaxic coordinates for injection were calculated from bregma and the dorso-ventral (DV) coordinates were calculated from the dural surface. Mice received intrastriatal injections of rAAV5 expressing siHUNT-1, siHUNT-2 or TRUF11 (rAAV5-hrGFP) suspended in phosphate-buffered saline (PBS) at a dose of 2 l/site and an infusion rate of 0.5 l/min using a continuous infusion pump, attached to a 10 l Hamilton microsyringe fitted with a glass micropipette with an outer diameter of 60-80 m. One minute after the cessation of the infusion, the micropipette was retracted an additional 1 mm, allowed to remain at this position for 4 min and then slowly retracted from the brain. The stereotaxic coordinates used for the two injections within the same striatum were: Site 1: AP = +1.0, ML = 1.8, DV = -3.3; Site 2: AP = +0.4, ML = + 2.1, DV .4 (All coordinates were measured with an empirically determined flat skull). The effect of shRNA and control vectors on mHtt mRNA and protein levels was assessed in a group of animals that received unilateral intrastriatal injections of rAAV vectors. In these experiments, the contralateral hemisphere was used as an internal control. Ten-weeks after the intrastriatal infusion of rAAV, mice were deeply anesthetized with sodium pentobarbital (65 mg/kg i.p.) and decapitated. The brains were removed and stored at oC. Tissue sections (14 m) were cut using a Micron cryostat through the rostral-caudal axis of the striatum, thaw-mounted onto Fisher SuperFrost slides and stored at oC. For each animal, 5 coronal brain sections, each separated by approximately 350 m, were placed on a single slide. This distribution of tissue was used

PAGE 61

52 to ensure that each slide contained sections taken throughout the transduced region of the striatum. To determine the levels of mHtt RNA and protein, striatal tissue was isolated from frozen sections that had been thaw-mounted on slides. Cortical tissue was removed using a razor blade and discarded. To collect tissue mainly from the transduction area, sections were first examined under epi-fluorescence to visualize the transduction area. The striatal tissue from the right and left sides of 5 brain sections per animal were then manually scraped from each slide taking only the approximate area of GFP positivity. RNA was extracted using Trizol (Invitrogen, San Diego, CA), quantified spectrophotometrically and used as the substrate for reverse-transcriptase (RT) reactions to generate single-stranded cDNA. The reaction was optimized to reverse transcribe the 5 end of the human Htt transgene. Briefly, 1 g of total RNA and 0.75 g of random hexamers were incubated with 1 l of 5X Q solution (Qiagen, Valencia, CA) in a total volume of 5.75 l at 70 o C for 3 min, mixed and placed on ice for 5 min. M-MLV RT buffer and dNTPs were added to a final concentration of 1X and 1.25 M, respectively, in a final reaction volume of 10 l. 20 Units of RNasin (Promega, Madison, WI) and 100 Units of M-MLV RT (Promega, Madison, WI) were added and the reaction was allowed to proceed at 48 o C for 60 min. The reaction was terminated by heating at 70 o C for 10 min. RT reactions differed from +RT reactions by the substitution of H 2 0 for RT in the reactions. Quantitative PCR (Lightcycler, Roche) was used to amplify a 115 bp region of mHtt cDNA from striatal tissue. The PCR reactions contained 1X QuantiTect SYBR Green PCR master mix (Qiagen), 500 nM each of sense (5AGAGCCCCATTCATTGCC3) and antisense (5-GGACTTGAGGGACTCGAA-3)

PAGE 62

53 primer. Cycling conditions included a denaturation step of 95C for 15 min, followed by 45 cycles of 94C for 15 s, 58C for 20 s, and 72C for 20 s, and ending with a melting step from 65C to 99C over 30 s. Total SYBR green fluorescence was measured at the end of each PCR cycle and continuously through the melting step. Known quantities of mHtt cDNA were simultaneously amplified with experimental samples and used to create a standard curve. The levels of cDNA in each sample were normalized to the levels of hypoxanthine ribosyl transferase. For western blot analysis, striatal tissue from 4-5 sections per animal were isolated and homogenized in 0.32 M sucrose, quantified using the BCA protein determination assay (Pierce), fractionated on SDS/PAGE gels using standard protocols and subjected to the immunoblotting conditions described for analysis of mHtt protein levels in transiently transfected HEK293 cells. For analysis of the distribution of immunoreactive inclusion bodies, fresh-frozen coronal brain sections on SuperFrost slides were allowed to come to room temperature, rinsed 3 x 10 min with phosphate-buffered saline (PBS: 100 mM phosphate, pH 7.4, and 0.9% NaCl) and the tissue was fixed in 4% (v/v) parafomaldehyde for 15 min. The tissue was incubated in 0.1% (v/v) H 2 O 2 10% methanol and PBS for 10 min and rinsed 3 x 10 min in PBS. Non-specific binding sites were blocked in a solution of 5% normal goat serum in 0.25% (v/v) Triton-X100/0.01 M PBS for 1 hr at room temperature. Immunostaining was performed using a 1:500 dilution of affinity-purified Hum 1 or 1:4000 dilution of polyclonal rabbit anti-ubiquitin (IgG) antibody (DakoCytomation, Carpinteria, CA) in 1% (v/v) normal goat serum, 0.25% (v/v) Triton-X100/ PBS. Tissues were incubated overnight at 4 C. A 1:500 dilution of goat anti-rabbit biotin-labeled

PAGE 63

54 secondary antibody (Vector, Burlingame, CA) was prepared in 1% (v/v) normal goat serum, 0.25% (v/v) Triton-X100/0.01 M PBS. Slides were incubated in secondary antibody solution for 2 hr at room temperature then rinsed 3 x 10 min in 0.01 M PBS. Interaction between the primary and secondary antibodies was detected using the Vectastain Elite ABC Kit (Vector, Burlingame, CA) and DAB using the companys standard protocol. The size and distribution of Hum-1 immunoreactive NIIs were determined by using the Analyze Particle function in the Image J NIH software (freeware available at http://rsb.info.nih.gov/ij/). Briefly, the relative size (m 2 ) and amount of NIIs were determined by analyzing coded digital images of four different regions (left motor cortex, right motor cortex, left medial striatum, right medial striatum) in coronal sections that were subjected to the stringent immunohistochemical procedure described above. Fourteen m sections were too thin for unbiased stereological estimates of NII number and the NIIs diameter was too small to use the rotator method of volume estimation [53]. The Image J software (NIH) was configured to detect particles of a specified size range (0.03 m 2 -0.5 m 2 ) and a constant upper and lower threshold value was used for all grayscale images from all areas analyzed. The mean relative size area (m 2 ) of particles (NIIs) as well as the mean number of particle counts within the specified size range was calculated by a blinded operator for each of the four different regions in all of the unilaterally injected R6/1 mice and reported as percent of the size and number of NIIs present in the left motor cortex. Since absolute numbers or areas are not reported and internal section controls were used to determine percent controls, this method of quantification of NIIs is valid.

PAGE 64

55 In Situ Hybridization Analysis In situ hybridization was performed on coronal mouse brain sections (Bregma +1.70 to .50) using radio-labeled antisense gene-specific oligonucleotide probes (Table 1). Frozen sections were allowed to reach room temperature, fixed with 4% paraformaldehyde in 1X PBS PBS for 5 min, rinsed twice for 3 min in 1X PBS, once for 20 min in 2X sodium chloride-sodium citrate (SSC, 0.15 M NaCl, 0.015M NaCitrate, pH 7.4), and then air dried. Each slide was covered in 200 l of hybridization buffer (50% deionized formamide, 5X SSC, 1X Denhardts reagent, 0.02 M sodium phosphate (pH 6.8), 0.2% SDS, 5 mM Na2EDTA, 10 g/ml Poly(A)n, 10% dextran sulfate, 50 g/ml sheared salmon sperm DNA, 50 g/ml yeast tRNA) containing ~1 x 106 c.p.m./ml of oligonucletide probe that had been 3 end-labeled with [-33P]dATP (2000 mCi/ml) for 90 min at 37oC using terminal deoxynucleotidyl transferase (Promega, Madison, WI). Prior to use, unincorporated nucleotides were removed from the labeled probes using a Sephadex G-25 spin column (Amersham Biosciences, Buckinghamshire, UK). The slides were coverslipped with parafilm and incubated overnight at 42oC in a humidified chamber. The coverslips were removed in 2X SSC and the slides were washed for four times for 30 min at 55oC in 1X SSC, four times for 30 min at 55oC in 0.5X SSC, two times for 30 min at 55oC in 0.25X SSC, then rinsed briefly in H20 and allowed to air dry overnight. Slides were exposed to Kodak Biomax MR film for up to 4 weeks at room temperature. The hybridization signals were analyzed using Kodak 1D Image Analysis Software as described in (36). For display purposes in order to make differences in hybridization signal easier to visualize, hybridized sections were scanned and false-colored in Adobe Photoshop 7.0

PAGE 65

56 by changing the image to RGB color and then a gradient map (as shown at the bottom of Fig. 3-5) was applied. This was done to all coronal sections shown in figure 3-5 without any further manipulation. Effect of Anti-mHtt shRNA on Phenotype The effect of anti-mHtt shRNA and control vectors on phenotype were assessed in animals that received bilateral injectons of siHUNT-1, siHUNT-2 and control rAAV vectors. Mice were weighed weekly following injection of rAAV. Average weight, grouped by genotype and treatment, was determined for each week, and significant differences determined using ANOVA Hind limb clasping behavior was assessed by suspending the mice 30 cm above a flat surface by their tail for 60 seconds or until the mice curled and clasped their hind limbs with their forelimbs and maintained the posture. The percentage of mice per group at each time point that exhibited clasping was recorded. Motor coordination was analyzed by placing the mice on rotarod that increased from 0 to 40 rpm over 1 min. The time from placing the mouse on the rotarod until the mouse fell off was recorded for each of 4 trials and the average time that each mouse remained on the rotarod was recorded. Statistics Analysis of variance (ANOVA) was used to evaluate the probability of differences between experimental groups. Where appropriate, one-way ANOVA was performed and individual post-hoc differences between groups was assessed using Fishers paired-least-significant-difference test (Fishers PLSD as available in Statview). Post-hoc differences in two-way ANOVA designs were assessed in a hierarchical fashion as described by Kirk et al (8) using simple main-effects analysis. The minimum probability accepted for significance ( level) was 0.05.

PAGE 66

57 Results RNA Interference of Mutant Huntingtin In Vitro R6/1 trangenic HD mice express exon 1 of human Htt with 115 CAG repeats [14]. We designed short-hairpin RNAs (shRNA) (20 to 21 nucleotides in length) that could target specific sequences of exon 1 of human Htt, but did not have significant sequence similarity to the endogenous mouse Htt mRNA. We generated rAAV5-based DNA constructs expressing two anti-mHtt shRNA molecules (Fig. 3-1A). The mHtt silencing activity of these constructs was tested in vitro by transiently co-transfecting each construct with a eukaryotic expression vector containing the R6/1 HD transgene (mHtt) into HEK293 cells. Transfections were performed using a 1:4 and a 1:8 target vector to shRNA vector ratio. Forty-eight hours post-transfection, we analyzed mHtt mRNA and protein expression levels. Northern blot analysis of total RNA obtained from HEK293 cells co-transfected with a shRNA vector targeting nucleotides in the 5-UTR of the mHtt mRNA (siHUNT-1) or a shRNA vector targeting a region immediately upstream of the CAG repeat domain (siHUNT-2) resulted in greater than 75% (p < 0.001) reduction of mHtt mRNA compared to samples from cells that expressed mHtt and a GFP-only vector (Fig. 3-1B). Co-transfection with a control shRNA vector targeted to the dog rhodopsin mRNA (siRho-1) did not affect the levels of mHtt mRNA (Fig. 3-1B). Immunoblot analysis of mHtt protein using a human amino-terminus specific Htt antibody (Hum-1) showed that the reduction in mRNA levels was associated with a significant decline in the levels of mHtt protein (Fig. 3-1C). Co-expression of the mHtt vector with siHUNT-1 shRNA reduced the levels of mHtt protein to 40% (p < 0.001) of that observed in cells co-transfected with either a GFP-only vector or the siRho-1 shRNA control vector. We also observed 55% (p < 0.001) reduction in the levels of mHtt

PAGE 67

58 Figure 3-1. rAAV-shRNA constructs mediate the silencing of m-Htt in vitro. A. The human H1 RNA promoter unit was used to drive the intracellular expression of 20 to 21-nucleotide long shRNAs directed against the R6/1 HD transgene (mHtt) from within the context of rAAV serotype-5 vectors. Expression of hrGFP was used to positively identify transduced cells. B. Schematic

PAGE 68

Figure 3-1 continued representation of the Htt gene graphically showing the region of the gene that is targeted by siHunt-1 and siHunt-2 shRNAs. C. Northern blot analysis of mHtt mRNA obtained from transiently co-transfected HEK293 cells. Co-expression of CMV-R6/1 (mHtt) with either siHUNT-1 or siHUNT-2 shRNA constructs, at either a 1:4 (lane 5 and 7) or 1:8 (lane 6 and 8) target to shRNA ratio, resulted in significantly reduced levels of mHtt mRNA when compared to co-transfection with a control shRNA, siRho-1, (lanes 3 and 4) or CMV-R6/1 alone (lanes 1 and 2). Comparisons of the average optical density signal from three independent experiments performed with a 1:8 target to shRNA ratio showed greater than 75% reduction in mHtt mRNA relative to levels of -actin mRNA (* = p<0.001, ** = p<0.001). D. Western blot analysis of total protein from HEK293 cells treated as above. mHtt protein was detected using a human-specific anti-Htt antibody (Hum-1). Analysis of the average (+ SEM) optical density signal revealed that mHtt was silenced by intracellular expression of both siHUNT-1 (>60% reduction, = p<0.0001) and siHUNT-2 (>55% reduction, ** = p<0.0001). Silencing of mHtt protein expression was not observed in cells co-transfected with siRho-1. The same blot was probed with an antibody to -actin in order to normalize for total protein load. Error bars represent + standard error of the mean (+SEM).

PAGE 69

60 protein in samples from cells transfected with siHUNT-2 shRNA. mHtt protein levels were unaffected by the expression of siRho-1 shRNA molecules (Fig. 3-1C). These in vitro results demonstrate that intracellular expression of both siHUNT-1 and siHUNT-2 results in the specific and efficient knockdown of mHtt mRNA and protein levels in cultured HEK293 cells. Long-Term Striatal Expression of rAAV5-shRNAs in the R6/1 Mouse We next investigated whether rAAV5-mediated long-term striatal expression of siHUNT-1 or siHUNT-2 shRNAs could induce RNA interference of the mHtt transgene in the R6/1 transgenic HD mouse. To test the in vivo activity of both shRNAs, 6-8 week old R6/1 mice and wild-type littermates were divided into four groups and injected unilaterally at two different sites in the right striatum. Each intrastriatal injection delivered 2 l of high-titer rAAV5-siHUNT-1 (R6/1 n=12, wild-type n=6 ) rAAV5siHUNT-2 (R6/1 n=13, wild-type n=5), rAAV5-siRho-1 (R6/1 n=4) or rAAV5-GFP (R6/1 n=5, wild-type n=5) viral vectors. Ten weeks post-surgery, fresh-frozen coronal brain sections were obtained and viral transduction, mHtt mRNA levels, and protein expression levels relative to the left untreated hemisphere were determined. Injection of rAAV5-GFP, rAAV5-siRho-1 and anti-mHtt rAAV5 shRNA vectors resulted in widespread and intense neuronal transduction as was previously observed in the rat striatum (13). In situ hybridization (ISH) analysis performed on coronal sections against the rAAV5-encoded hrGFP mRNA revealed a non-uniform but widespread rAAV5 transduction (Fig. 3-3A). hrGFP mRNA was efficiently expressed along the dorsal-ventral and rostral-caudal axis of the striatum. A strong hybridization signal was detected on either side of the corpus callosum but not in the white matter tracts (Fig. 3-3A) suggesting that the majority of hrGFP signal was concentrated in neuronal cell

PAGE 70

61 Figure 3-2. Experimental design. A. R6/1 and littermate control animals were injected unilaterally with either rAAV5-siHUNT-1, -siHUNT-2, -siRho-1 or -GFP viral vectors (annotated below the line). B. Experimental design for bilateral injections was identical to that shown above. Behavioral tests were performed weekly between the time points indicated by the arrows above and below the time-line. bodies. hrGFP protein expression was intense and paralleled the widespread pattern of rAAV5 transduction detected by ISH analysis (Fig. 3-3B). Native hrGFP epiflourescene was observed in all sections that contained rAAV5-transduced striatal tissue such as the one shown in figure 3-3B. Long-term striatal expression of control rAAV5 vectors (rAAV5-siRho-1, rAAV5-GFP) in the R6/1 mouse was not associated with any abnormal changes in cellular morphology or astrocyte activation as determined by cresyl violet and GFAP staining (data not shown). These observations demonstrated that the striatum of

PAGE 71

62 the R6/1 mouse can tolerate strong, wide-spread and long-term rAAV5-mediated expression of hrGFP and shRNA molecules. To evaluate the silencing activity of rAAV5-siHUNT-1 and rAAV5-siHUNT-2 in vivo, we extracted total cellular RNA from rAAV5-shRNA-transduced striatal regions and subjected the RNA to reverse-transcription reactions optimized to convert the GC-rich mHtt transgene mRNA to cDNA. The levels of mHtt mRNA were determined using real-time quantitative PCR. Baseline levels of striatal mHtt mRNA were established by analyzing total RNA from striatal tissue contralateral to the rAAV5-shRNA injection. mHtt mRNA levels from control and rAAV5-shRNA injected striatum were normalized to hypoxanthine phosphoribosyl transferase (HPRT) mRNA levels and subjected to one-way ANOVA. Long-term expression of rAAV5-siHUNT-1 or rAAV5-siHUNT-2 in the striatum of the R6/1 mouse resulted in highly significant reductions in the levels of mHtt mRNA (Fig. 3-3C) demonstrating that intrastriatal delivery of rAAV5 anti-mHtt shRNAs in the R6/1mouse can induce efficient knockdown of mHtt mRNA levels. Moreover, this reduction was specific to the expression of rAAV5-siHUNT-1 or siHUNT-2 since mHtt mRNA levels were unchanged following the expression of rAAV5-siRho-1 (Fig. 3-3C). To determine the levels of total striatal mHtt protein in the R6/1 mouse, we generated a rabbit polyclonal antibody against a specific peptide in the amino-terminus of human Htt (Hum-1). The Hum-1 antibody recognized a high molecular weight band of greater than 250 kDa that was enriched in nuclear fractions of protein extracts from R6/1 but not wild-type littermate controls (Fig. 3-4A). We measured the relative intensity of the high molecular weight Hum-1 immunoreactive band to compare the levels of mHtt protein in transduced and control R6/1 striatum. We normalized the levels of mHtt

PAGE 72

63 Figure 3-3. Long-term in vivo striatal expression of rAAV5-siHUNT1 and rAAV-siHUNT2 decrease mHtt transgene mRNA expression. A. In situ hybridization with a probe against the virally encoded hrGFP mRNA. Coronal sections were obtained 10 weeks post-surgery. The panel was arranged in a rostral-caudal axis to illustrate the extent of the transduced area as indicated by the arrow. Two separate injections were placed into the same hemisphere (arrows). These sections were obtained from one animal and are representative of all other study animals. Scale bar = 2mm. B. Photomicrograph of native hrGFP protein expression from the striatum of a representative injected animal demonstrates that the vector derived mRNA shown in (A) is transcribed into protein. Str = striatum, cc = corpus callosum, and CTX = cortex. Scale bar = 1mm. C. Real-time quantitative PCR analysis of mHtt mRNA knockdown. Total RNA was extracted from the striata of R6/1 mice. The levels of striatal mHtt mRNA on the uninjected (black bars) striata and injected striata with rAAV5 vectors (white bars). rAAV5-siHUNT-1, rAAV5-siHUNT-2, and rAAV5 siRho were measured, normalized to the levels of HPRT mRNA and reported as percent of control. Expression rAAV5-siHUNT-1 resulted in a significant 75% reduction of mHtt mRNA expression (F[1,11] = 40.0 = p<0.001). Striatal rAAV5-siHUNT-2 treatment resulted in significant 78% reduction of striatal mHtt mRNA expression (F[1.8] = 19.1, = p = 0.002). In contrast, striatal injection of the control shRNA rAAV5-siRho did not reduce striatal mHtt mRNA levels

PAGE 73

Figure 3-3 continued (F[1,8] = 0.71, p > 0.40). D. Similarly to striatal mRNA analysis in (C), total protein was obtained from the injected and untreated control striata of R6/1 mice. Similar to the mRNA levels, there was a significant rAAV5-sitHUNT-1 mediated 24.5% reduction in the levels of a Hum-1 immunoreactive high molecular weight band (simple main effects, F[1,18] = 5.2, = p < 0.04). The rAAV5-siHUNT-2 treated group displayed a significant 38% reduction of striatal mHtt (simple main effects, F[1,18] = 8.4, = p = 0.01) while the rAAV-siRho control groups did not have significant reductions of striatal mHtt (simple main effects, F[1,18] = 0.50, p > 0.40) when compared to R6/1 control striata. Error bars represent +SEM.

PAGE 74

65 protein to a cross-reactive band that was recognized by the Hum-1 antibody and was present at constant levels in protein extracts isolated from R6/1 and wild-type mice. rAAV5-siHUNT-1 and rAAV5-siHUNT-2 also reduced striatal mHtt protein levels but not to the same degree observed with striatal mHtt mRNA levels. Thus, striatal rAAV5-siHUNT-1 expression reduced striatal mHtt protein approximately 25% compared to control striata or rAAV5-siRho treated mice (Fig 3-3D). In addition, rAAV5-siHUNT-2 reduced striatal mHtt protein 38% relative to untreated control striata or rAAV5-siRho injected mice (Fig 3-3D.). Expression of the control shRNA, siRho had no effect on striatal mHtt expression. There is a clear discrepancy between the magnitude of si-HUNT-1 and si-HUNT-2 mediated mHtt mRNA reduction and the magnitude of reduction of mHtt protein from the same striata. One potential reason for this discrepancy between mRNA and protein is the differential kinetics of turnover of mRNA versus protein. Moreover, our tissue sampling protocol included both transduced and non-transduced cells, which would lead to an underestimate of the effectiveness of mHtt knock-down, although there is no reason why this would differentially affect measured protein levels compared to mRNA levels. In summary, long-term intrastriatal expression of rAAV5-siHUNT-1 and -siHUNT-2 shRNAs significantly reduced striatal mHtt mRNA levels and also resulted in diminished striatal mHtt protein expression. Reduction in the Size and Amount of NIIs is Observed in R6/1 Mice Treated With rAAV5-siHUNT-1 or rAAV5-siHUNT-2. One of the pathological markers of disease progression in mouse models of pQ-disease such as HD is the presence of NIIs. Studies have shown that suppressing the expression of the mutant pQ-containing protein in neurons results in the clearance of NIIs

PAGE 75

66 [12; 23]. We examined whether the Hum-1 antibody could detect the presence of NIIs in the R6/1 striatum. We reasoned that using an anti-Htt antibody instead of an anti-ubiquitin antibody would allow us to directly correlate the levels of mHtt with the presence or absence of NIIs. Immunohistochemical analysis of coronal brain sections from untreated R6/1 mice subjected to Hum-1 and anti-ubiquitin immunohistochemistry revealed a similar pattern of immunoreactivity between both antibodies with respect to the size and distribution of NIIs in the R6/1 mouse brain (Fig. 3-4A-D). Histological analysis of sections obtained from R6/1 mice of various ages showed that Hum-1-positive NIIs become visible in the light-microscope at about 8 weeks after birth (data not shown), in agreement with the time that ubiquitin-positive NIIs become visible in the R6/1 mouse [18]. Hum 1(data not shown) and anti-ubiquitin[18] immunoreactive NIIs increase in size and staining intensity during the progression of HD suggesting that protein deposition in NIIs is cumulative. We analyzed Hum-1 immunostained coronal sections from unilaterally injected R6/1 mice and compared the relative area and intensity of NIIs present in four brain regions including the left primary motor cortex, right primary motor cortex, left medial striatum and right medial striatum (Fig. 3-4F). Three of these regions, left primary motor cortex, right primary motor cortex and left medial striatum, corresponded to non-transduced control tissue while the right medial striatum exhibited strong rAAV5-mediated transduction (Fig. 3-3A,B & 3-4F). Comparison of Hum-1 staining in the left and right primary motor cortex revealed no differences in the area or intensity of NIIs in any of the R6/1 mice that were untreated or treated with either rAAV5-siHUNT-1 (Fig. 3-4G & H) or siHUNT-2 (Fig. 3-4M & N). Areas shown in figure 3-4I,J,K,L,O,P were

PAGE 76

67 Figure 3-4 Analysis of mHtt protein aggregates after expression of rAAV5-shRNAs. A-D. Immunohistochemistry showed that the human Htt amino-terminus-specific antibody Hum-1 antibody, like anti-Ubiquitin antibody, detects NIIs in R6/1 but not wild-type mice. Panels (A) and (B) were striatal sections immuno-stained using an anti-ubiquitin antibody. A. Striatal section from a 15 week-old wild-type mouse. B. Striatal section from a 15 week-old R6/1 mouse. Panels (C) and (D) were immuno-stained using the new Hum-1

PAGE 77

Figure 3-4 continued antibody. C. Striatal Hum-1 immuno-staining from the same 15 week-old wild-type mouse as shown in (A). D. Striatal Hum-1 immuno-staining from the same 15 week-old R6/1 mouse as shown in (B). Similar staining of NIIs was found in both anti-ubiquitin and Hum-1 immuno-stained sections. Cross-reactivity of Hum-1 antibody with cytoplasmic proteins in striatal neurons of both wild-type and R6/1 mice is apparent in (C) and (D). E. Western blot analysis of total (lanes 1 and 2), cytoplasmic (lanes 3 and 4) and nuclear (lanes 5 and 6) protein derived from 15 week-old wild-type (lanes 1, 3 and 5) and R6/1 mice (lanes 2, 4 and 6) using the Hum-1 demonstrated that the antibody detects a high-molecular weight aggregate in R6/1 transgenic mice. The lower panel shows a 170-kDa cross-reacting band that is present in all samples and was used as loading control. F. Coronal section from rAAV5-siHunt-1 injected R6/1 mouse processed for in situ hybridization with a probe against vector specific sequences (as shown in Fig. 3A) to demonstrate the transduction area. The boxes show the areas of Hum-1 staining used for analysis of NII number and size (panels G, H, M, N, Q, R) and the photomicrographs shown in panels (J-L), (O,P), (S,T). G-L. These panels contain the analysis of NII count and size for rAAV-siHUNT-1 injected R6/1 mice. NII analysis from all vector-treated mice took place by examining the transduction area using native hrGFP fluorescence in sections adjacent to the Hum-1 immuno-stained section in order to correctly choose the boxed area depicted in (F) for each section. G. Numbers of NIIs were estimated in cortex and striatum of long-term treated R6/1 mice, compared to identically determined NIIs in control striata and expressed as percent of control frequency. Cerebral cortex in either hemisphere was not transduced by rAAV (F) and served as a region control. Cortical NII numbers were unaffected by striatal injection of rAAV5-siHUNT1 (Fishers PLSD post hoc test, p = 0.8). The frequency of NIIs in cortex was generally greater than in the striatum of the R6/1 mouse (F[1,20] = 22.0, *p < 0.001). In addition, treatment with rAAV5-siHUNT1 significantly reduced the frequency of striatal NIIs by 31% compared to the control uninjected striatum (Fishers PLSD post hoc test, p = 0.04). Error bars in (G-H), (M-N) H. Similarly to NII numbers, NIIs are smaller on average in the striatum, regardless of treatment as compared to the NII size in cortex (F[1,20] = 38.4,* p < 0.001). rAAV5 mediated siHUNT-1 expression reduced the size of the remaining NIIs by 39% compared to the untreated control striatum (post-hoc, p = 0.0013). I. Photomicrograph of left cortical Hum-1 stained coronal section from the area shown in the box in (F) showing frequency of NIIs. J. Photomicrograph of the right cortical region shown in the box in (F). Scale bar = 50 m and applies to (I,J,L). M-P. These panels contain the data from rAAV-SiHUNT-2 treated R6/1 mice. M. The frequency of NIIs in the R6/1 cortex was, in general, greater than the frequency measured in the striatum (F[1,20] = 68.4, p < 0.0001). rAAV5 mediated siHUNT2 expression further significantly reduced the number of striatal NIIs by 47% compared to the left striatum (Fishers PLSD post hoc test, p < 0.0001). N. Similar to NII frequency, Hum-1 positive cortical NIIs

PAGE 78

Figure 3-4 continued are significantly larger than striatal NIIs (F[1,20] = 71.1, p < 0.0001). Striatal siHUNT-2 expression further reduced striatal NII size by 35% compared to the untreated striatum (Fishers PLSD post hoc test, p < 0.03). O. Photomicrograph from the control left striatal area depicted in (F) from a representative rAAV5-siHUNT-2 treated mouse. P. Photomicrograph from the right rAAV5-siHUNT-2 treated striatum from the same mouse depicted in (O) clearly demonstrating reduced NII frequency and size. It should be noted that untransduced striatal areas had Hum-1 positive NII frequency and size that was indistinguishable from those seen in the opposite control striatum. Q-T. These panels contain the NII analysis from the rAAV5-siRho treated mice that serve as the control shRNA experimental group. Q. Quantitative analysis of NIIs frequency of siRho treated mice. As with the other vector treated groups cortical NIIs were more frequent than Hum-1 positive striatal NIIs (F[1,12] = 20.5, p = 0.0007). However, there was no difference between NII number between treated and untreated striata (Fishers post hoc test, p > 0.2). R. Hum-1 positive NIIs are also smaller in striatum as compared to the R6/1 cortex (F[1,12] = 16.8, *p < 0.002). However, control rAAV5-siRho treated striatal Hum-1 positive NIIs were the same size as those measured in the left, control striatum (Fishers PLSD post hoc test, p > 0.5). S. Representative photomicrograph from the left, untreated cortex of a rAAV-siRho treated R6/1 mouse. T. Representative photomicrograph taken from the transduction area (F) from the right, injected striatum of the same mouse shown in (S). There is no apparent difference in striatal NII frequency and size when compared to the left striatum (S). Scale bar = 50 m and applies to (O,P, and S). Error bars represent +SEM in (G-H), (M-N), and (Q-R).

PAGE 79

70 taken from the same R6/1 mouse section and are representative of all other rAAV5-siHUNT-1 and -siHUNT-2 treated R6 mice. Hum-1 immunoreactive NIIs in the left (Fig. 3-4K & O) and right (Fig. 3-4O & P) medial striatum were smaller and had less intense staining than those present in the cortical regions of the same R6/1 mouse (Fig. 3-4I vs. 4K). This histological observation was also supported by the quantification of NII count (Fig. 3-4G) and area (Fig. 3-4H, see below). A comparison of the non-transduced left and transduced right medial striatum regions showed a marked reduction in the intensity of Hum-1 NII staining in the rAAV5-siHUNT-1 (Fig. 3-4L) and rAAV5-siHUNT-2 (Fig. 3-4P) transduced right medial striatum when compared to the left medial striatum (Fig. 3-4 K & P, respectively) of the same animal. This observation was corroborated by the quantification of NIIs (Fig. 3-4G&M) count and area (Fig. 3-4H & N, see below). The reduction in Hum-1 NII staining intensity was more pronounced in sections obtained from rAAV5-siHUNT-2-treated compared to siHUNT-1-treated R6/1 mice. Sections from R6/1 mice treated with either rAAV5-GFP (data not shown) or rAAV5-siRho-1 (Fig. 3-4Q-T) showed no significant difference in the pattern of Hum-1 NII staining between the left and right medial striatum regions (Fig. 3-4S versus 4T). The observation of rAAV5-siHUNT1and rAAV5-siHUNT-2mediated reduction of striatal Hum-1 NII staining further corroborates the immuno-blot data indicating reduced striatal mHtt protein in vector-treated striata. In order to quantify the relative area and amount of NIIs present in shRNA treated striata, we analyzed the same relative four regions shown in figure 3-4F in siHUNT-1 treated (n=11), siHUNT-2 treated (n=6) and siRho-1 (n=4) treated R6/1 mice. The mean

PAGE 80

71 relative area (m 2 ) and number of particle (NIIs) counts within a specified area range was calculated for each of the four regions in all of the unilaterally injected R6/1 mice using Image J software and reported as percent of the non-transduced corresponding area in the opposite hemisphere. Using different anatomical regions from individual coronal sections as internal controls revealed that medial striatal NIIs displayed reduced frequency as well as reduced two-dimensional area compared to NIIs in motor cortex regardless of vector treatment (Fig. 3-4G & H respectively). Long-term expression of rAAV5-siHUNT-1 resulted in a significant reduction in both the frequency (31%) and mean area (39%) of NIIs in the transduced right medial striatum when compared to the contralateral non-transduced left medial striatum in the same section (Fig. 3-4G&H respectively). Analysis of the right medial striatum in rAAV5-siHUNT-2 treated sections revealed a mean reduction of 47% in the estimated frequency and of 35% in the mean area of NII particles when compared to the left medial striatum (Fig. 3-4M). There was no significant difference in the number or area of NIIs between the right and left medial striatum of rAAV5-siRho-1 treated R6/1 mice (Fig. 3-4Q & R respectively). Our results show that long-term expression of rAAV5-siHUNT-1 or rAAV5-siHUNT-2 in the R6/1 striatum led to a significant reduction in the area and frequency of striatal NIIs present within the region of viral transduction. Reduced Levels of Striatal mHtt Affect Levels of Striatal-Specific Transcripts. Expression of exon 1 of mHtt leads to a decrease in the level of a subset of striatal-specific mRNAs of the R6/1 mouse [27] [28] [29-31]. These same transcripts are also reduced in HD patients. At the very least, evaluation of these striatal-specific transcripts can serve as an important metric of disease progression in R6/1 mice. To examine the effects that silencing striatal mHtt expression might have on this molecular phenotype,

PAGE 81

72 we performed in situ hybridization analysis of transcripts on coronal sections obtained from unilaterally injected wild-type and R6/1 mice. Sections were hybridized with oligonucleotide probes against preproenkephalin (ppEnk), dopamineand cAMP-responsive phosphoprotein, 32 kDa (DARPP-32), phosphodiesterase 10A (PDE10A), phosphodiesterase 1B (PDE1B), nerve growth factor inducible-A (NGFi-A) and the dopamine type 2 receptor (D2) receptor. Densitometric analysis of rAAV5-siHUNT-1 injected R6/1 mice showed an increase in the mean levels of striatal ppEnk (24%) and DARPP-32 (16%) mRNA in the transduced striatum (Fig. 3-5A & B) as compared to the contralateral uninjected side. There was no significant side-to-side difference in the levels of PDE10A, PDE-1B, NGFi-A or D2 receptor mRNAs in R6/1 mice treated with rAAV5-siHUNT-1 (data not shown). In contrast, expression of rAAV5-siHUNT-2 in R6/1 mice resulted in a marked decrease in the mean levels of both ppEnk (16%) and DARPP-32 (30%) mRNAs when compared to the uninjected left side (Fig. 3-5C & D). More importantly, this decrease was also evident in unilaterally injected wild-type mice for both ppEnk (75%) & DARPP-32 (56%) mRNAs (Fig. 3-5 panels C & D). This pronounced reduction in mRNA levels was also observed in all other transcripts tested (not shown), except for NGFi-A where the long-term expression of siHUNT-2 shRNA led to an increase in transcript levels that exceeded that of wild-type uninjected controls (not shown). The -actin-specific hybridization signal remained unchanged in all samples tested. Based on the comparable reduction in transcripts in wild-type and R6/1 mice, we attributed the reduction in the steady-state levels of these striatal-specific transcripts to a

PAGE 82

73 Figure 3-5 In situ hybridization (ISH) analysis of ppEnk and DARPP-32 transcripts. Coronal sections shown to the left of (A), (C), and (E) were hybridized to a ppEnk-specific oligonucleotide probe (Table 1) while sections in panels (B), (D) and (F) were hybridized to a DARPP-32-specific oligonucleotide probe (Table 1). The arrows above the coronal sections show the approximate vector injection site and the fill pattern of the arrows corresponds to the fill pattern of the histograms in each panel to show which treatment was received in each hemisphere. In order to better demonstrate the anatomical pattern of striatal transcripts the coronal sections were false colored. The scale is shown at the bottom of the figure. A. Evaluation of long-term intrastriatal rAAV-siHUNT-1 expression on striatal ppEnk levels in R6/1 mice and wild-type littermate controls. Quantitative analysis of normalized ppENK levels confirm that ppENK levels are reduced in 22 week old R6/1 mice (F[1,66] = 99.5, p < 0.0001). rAAV-siHUNT-1 injection into wild-type control striata does not lead to any alteration in striatal ppENK levels as compared to untreated

PAGE 83

Figure 3-5 continued control left striata (Fishers PLSD post hoc test, p > 0.7). In contrast, in R6/1 mice, striatal rAAV5-siHUNT-1 treatment led to a mild 24% increase in striatal ppEnk levels as compared to the ppEnk levels observed in the control striatum (Fishers PLSD post hoc test, p = 0.01). B. Evaluation of long-term intrastriatal rAAV-siHUNT-1 injection on steady state striatal DARPP-32 mRNA levels. Similar to ppENK mRNA levels, DARPP-32 mRNA was reduced in R6/1 animals as compared to littermate controls (F[1,66] = 114.1, p < 0.0001). rAAV5-siHUNT-1 injection did not affect striatal DARPP-32 levels in wild-type controls (Fishers PLSD post hoc test, p > 0.1). Striatal rAAV5-siHUNT-1 treatment resulted in a significant 16% increase in DARPP-32 mRNA levels (Fishers PLSD post hoc, p < 0.03) in R6/1 mice as compared to DARPP-32 mRNA levels in the untreated striatum. C. Analysis of the effect of intrastriatal injection of rAAV-siHUNT-2 on striatal ppEnk transcript levels. In stark contrast to the pattern seen with rAAV5-siHUNT-1 injection (A), rAAV5-siHUNT-2 long-term expression led to a 75% reduction of striatal ppENK levels in the injected striatum of wild-type littermate controls (Fishers PLSD post hoc test, *p < 0.0001). Likewise, rAAV5-siHUNT-2 treatment also resulted in a further 16% reduction in striatal ppENK levels in R6/1 mice (Fishers PLSD post hoc test, p < 0.05). D. Analysis of the effect of intrastriatal injection of rAAV-siHUNT-2 on striatal DARPP-32 mRNA levels. Similar to the pattern seen in response to rAAV5-siHUNT-2 expression striatal ppEnk levels (C), rAAV5-siHUNT-2 long-term expression led to a 44% reduction of striatal DARPP-32 mRNA levels in the injected striatum of wild-type littermate controls (Fishers PLSD post hoc test, *p = 0.0005). In addition, rAAV5-siHUNT-2 treatment resulted in a further 70% reduction in striatal DARPP-32 mRNA levels in R6/1 mice (Fishers PLSD post hoc test, p < 0.01). This further reduction in the treated striatum of the R6/1 mice is particularly apparently in the right side of the coronal section shown to the right of the histogram in this panel. E. Evaluation of the effect of the long-term expression of the control shRNA, siRho in the striatum of wild-type littermate controls and R6/1 mice on striatal ppEnk levels. rAAV5-siRho injections had no effect on striatal ppEnk transcript levels in either wild-type controls (Fishers PLSD post hoc test, p > 0.9) or R6/1 mice (Fishers PLSD post hoc test, p > 0.6). F. Evaluation of the effect of the long-term expression of the control shRNA, siRho in the striatum of wild-type littermate controls and R6/1 mice on striatal DARPP-32 mRNA levels. rAAV5-siRho injections had no effect on striatal DARPP-32 mRNA levels in either wild-type controls (Fishers PLSD post hoc test, p > 0.7) or R6/1 mice (Fishers PLSD post hoc test, p > 0.6). Error bars are + SEM.

PAGE 84

75 siHUNT-2 shRNA-mediated off-targeting effect. Further documentation of this important off-targeting finding is the subject of a separate study (Rodriguez et al., in preparation). Analysis of R6/1 mice injected unilaterally with the control rAAV5-siRho-1 shRNA revealed no significant differences in the levels of ppEnk, DARPP-32, PDE10A, PDE-1B, NGFi-A or D2 receptor mRNA between the left uninjected and right injected striatum (Fig. 3-5E & F). Additionally, there was no side-to-side difference in the steady-state levels of any of the transcripts analyzed in the striatum of wild-type mice injected unilaterally with rAAV5-siHUNT-1 (Fig 3-5A&B). We conclude that rAAV5-siHUNT-1 mediated reduction of mHtt levels in the striatum of R6/1 mice resulted in a small but significant increase in the steady-state levels of striatal ppEnk and DARPP-32 mRNAs relative to the levels observed in the untreated contralateral striatum. Long-Term Bilateral Striatal Expression of rAAV5-siHUNT-1 in the R6/1 Mouse is Associated With a Delay in the Clasping Phenotype. R6/1 mice display a progressive neurological phenotype that includes clasping of the hind limbs, and dyskinesias (10). Additionally, R6/1 fail to gain weight at a normal rate and show a progressive decrease in retention times in the rotarod when compared to age-matched wild-type littermate mice. In order to examine whether lowering the striatal levels of mHtt would prevent the progression of these phenotypes, 6-8 week old R6/1 and wild-type mice were injected bilaterally at two different striatal sites (4 injections total) with rAAV5-siHUNT-1 or rAAV5-GFP control. We initially assessed the progression of the HD-like phenotype in the R6/1 mice by recording weights weekly beginning at 1 week post-surgery.

PAGE 85

76 Figure 3-6 Bilateral long-term striatal expression of rAAV5-siHUNT-1 delays the clasping phenotype of R6/1 mice. A. Animal weight was recorded weekly starting at 1 week post-surgery (Fig. 2B). A. The mean (SEM) weight for wild-type littermate controls is shown. The symbol key is given in the lower right corner of the graph. There was no effect of rAAV-siHUNT-1 treatment on weight regardless of genetic background or vector treatment including rAAV5-GFP (rAAVrepeated measures ANOVA, F[2,22] = 0.63, p > 0.5). B. The mean (SEM) weight for R6/1 mice is shown. In general, R6/1 mice weighed less than aged-matched littermate controls (n = 5) over the period of the experiment (F[1,22] = 4.7, p = 0.04 A vs. B).C. Tail-suspension tests were performed weekly beginning at 6 weeks post-surgery (corresponding to 13 weeks of age) on age-matched control R6/1 mice (n=5) and R6/1 mice injected bilaterally with rAAV5-siHUNT-1 (n=5) or rAAV5-GFP (n=5). Data are presented as percent of animals scoring positive for the test as a function of time. Open circles denote age-matched control R6/1. Closed circles denote R6/1 rAAV5-GFP. Open triangles denote R6/1 rAAV5-siHUNT-1. As previously reported, we observed that R6/1 mice did not increase total body weight at the same rate over time compared to age-matched wild-type littermate mice

PAGE 86

77 (Fig. 3-6A versus B). Examination of the mean weekly weights of uninjected wild-type mice and wild-type mice injected with rAAV5-GFP or rAAV5-siHUNT-1 revealed that long-term expression of neither viral vector led to a significant change in the rate of weight gain over the experimental period (Fig.3-6A). Similarly, long-term expression of neither rAAV5-GFP nor rAAV5-siHUNT-1 in R6/1 mice resulted in a significant change in rate of weight gain when compared to untreated R6/1 (Fig. 3-6B). We also analyzed the progression of the clasping phenotype in uninjected, rAAV5-GFP or rAAV5-siHUNT-1 injected R6/1 mice by performing a weekly tail-suspension test beginning at 13 weeks of age. Uninjected and rAAV5-GFP injected R6/1 mice began to display clasping of the hind limbs at 20 weeks of age. In contrast, R6/1 mice expressing rAAV5-siHUNT-1 did not show evidence of clasping until 22 weeks of age, when only 20% overtly displayed the phenotype in comparison with up to 80% of uninjected and rAAV5-GFP injected R6/1 mice, which overtly displayed the hind limb clasping phenotype at this same time point. Finally, we examined the locomotor activity, as determined by total distance traveled, and rotarod retention times of both wild-type and R6/1 mice 16 weeks post-surgery (22 weeks of age). Although there were significant differences between wild-type and R6/1 mice in both tasks, we observed no significant differences among uninjected, rAAV5-GFP and rAAV5-siHUNT-1 injected R6/1 mice in either total distance traveled over time or rotarod retention times (data not shown). We conclude that 6-8 week old mice expressing rAAV5-siHUNT-1 bilaterally in the striatum for up to 14 weeks did not display any overt toxicity associated with our gene transfer approach. Furthermore, long-term expression of siHUNT-1 anti-mHtt

PAGE 87

78 shRNA resulted in a mild behavioral improvement of the R6/1 phenotype with respect to clasping behavior but did not affect body weight abnormalities or muscle-dependent activities such as rotorod retention and locomotion. Discussion The expression of one expanded HD allele initiates a cascade of events that leads to the neuronal dysfunction and pathology observed in HD (81). It has been hypothesized that ablating the expression of mHtt might protect against or even reverse the effects associated with poly-Q expanded Htt protein. In this study, we assessed the molecular and behavioral effects of long-term intrastriatal rAAV5-mediated expression of shRNAs designed to suppress the expression of the human mHtt transgene that is present in R6/1 mice. Our results demonstrate that post-transcriptional gene silencing of striatal mHtt in adult R6/1 mice by one of two shRNAs tested, siHUNT-1, has a mild positive effect on the rapid cellular and behavioral pathological changes that occur in this model. At the cellular level, improvement occurred in only 2 striatal specific transcripts and this amelioration was only found in the striatal subregion of rAAV5-mediated transduction. These data therefore suggest that greater transduction efficiency could improve the functional effects obtained here. Intrastriatal injections of rAAV5 vectors resulted in widespread transduction of the mouse striatum especially as compared to previously reported levels of transduction in mice (35; 36). Long-term expression of rAAV5-siHUNT-1 in the R6/1 mouse striatum resulted in mRNA levels that were reduced by 75% when compared to controls while reduction in protein levels ranged from 25-38%. Aggregated, but not soluble, mHtt was detected using our western blot protocol, which may have contributed to the discrepancy between the magnitude of reduction of mRNA and mHtt protein. In fact, even though we

PAGE 88

79 tested several published antibodies and a variety of extraction protocols, we were unable to detect measurable levels of soluble mHtt N-terminal fragments in total striatal protein samples from untreated adult R6/1 mice. In agreement with the data obtained from Hum-1 immuno-blots indicating reduced striatal mHtt in transduced regions, Hum-1 immunohistochemical analysis of sections from rAAV5-siHUNT-1 treated R6/1 mice revealed a marked decrease in the size and number of NIIs within the area of viral transduction. Thus, since aggregation of soluble mHtt fragments leads to the formation of inclusions in vivo, our data suggest that expression of rAAV5-siHUNT-1 significantly diminished the available cellular pool of soluble mHtt N-terminal fragments in the striatum of the R6/1 mouse. The functional significance of NIIs in HD mouse models is currently controversial. NIIs have been hypothesized to be a protective mechanism in cells by functioning to sequester detrimental toxic forms of Htt from damaging the cell (37). On the other hand, NIIs may also be a pathological feature causing transcriptional dysregulation via binding of vital transcription factors and sequestering these factors from regulatory sequences. Along these lines, mHtt has been shown to affect the cellular localization and function of several regulators of transcription known to be critical for proper neuronal function, which results in the specific down-regulation of a subset of striatal mRNAs (38). Expression of rAAV5-siHUNT-1 in the striatum of the R6/1 mouse resulted in a significant increase in the steady-state mRNA levels of both ppEnk and DARPP-32 mRNAs as demonstrated by in situ hybridization analysis. No significant changes were observed in either the dopamine type-2 receptor or NGFi-A mRNA levels. Additionally, expression of rAAV5-GFP or the inactive control shRNA, rAAV5-siRho-1, did not result

PAGE 89

80 in any detectable changes in the levels of any of the transcripts analyzed. The promoter for ppEnk is regulated by the cAMP-responsive element (CRE-) transcriptional pathway (39). The CRE-transcriptional pathway is extensively involved in the regulation of genes needed for neuronal function and survival, and expression of mHtt has been shown to interfere with this pathway (40-42). CRE-mediated transcription is modulated by TAF II 130, and the pQ domain of soluble mHtt N-terminal fragments can sequester TAF II 130, into aggregates. This aberrant protein-protein interaction is thought to negatively affect CRE-regulated transcription by affecting the proper localization and function of TAF II 130 (41). Therefore, reduced levels of striatal mHtt might have a direct effect on the activity of CRE-mediated transcription. In this study, while the frequency and size of NIIs were reduced and disease-affected striatal transcripts were improved by administration of siHUNT-1, the relationship between NIIs and disease progression and the exact role of mHtt in transcriptional dysregulation remains poorly understood. We have observed that the levels for both ppEnk and DARPP-32 mRNA begin to decrease at ~ 4-5 weeks of age and reach a minimum steady-state level around 12 weeks of age (Denovan-Wright, unpublished data). In this study, we initiated shRNA treatment to reduce striatal mHtt expression in R6/1 mice that were between 6 and 8 weeks of age. Since we did not fully restore ppENK and DARPP-32 mRNAs to wild-type levels, our data suggests that lowering the levels of striatal mHtt affected the rate of loss in steady-state mRNA levels. Alternatively, R6/1 striatal neurons expressing low levels of mHtt protein may have maintained an increased level of transcriptional activity when compared to striatal neurons expressing normal levels of mHtt.

PAGE 90

81 Finally, we investigated whether long-term expression of rAAV5-siHUNT-1 would affect the behavioral phenotype displayed in the R6/1 mouse. In this study, we evaluated a battery of physiological and behavioral tests including effect on weight loss, clasping phenotype, locomotor activity, and performance on the rotarod apparatus. There was no difference in weight among the groups of R6/1 mice bilaterally treated with rAAV5-siHUNT-1, rAAV5-GFP R6/1 and uninjected age-matched R6/1 controls. Additionally, locomotor activity remained unchanged in rAAV5-siHUNT-1 treated R6/1 when compared to controls. Analysis of retention times in the rotarod apparatus demonstrated a clear difference between genotype; however, we observed no differences between all of the three different R6/1 groups. In contrast, there was a delayed onset of the clasping-phenotype on R6/1 mice that were bilaterally injected with rAAV5-siHUNT-1 when compared to uninjected or rAAV5-GFP injected R6/1 mice. This mild behavioral improvement may suggest that suppression of mHtt expression in other regions of the brain, i.e. cortex, may be required in order to achieve a more explicit positive effect on behavior. Also, some of the behavioral phenotypes observed in the R6/1 mouse may be affected by dysfunction of other systems outside the CNS. In fact, problems with metabolism and muscle wasting have been observed in the R6 lines (43). These systemic abnormalities would not be expected to improve after suppression of striatal mHtt expression. In addition to the observation that siHUNT-1 reduced mHtt levels and had a positive effect on the cellular and behavioral phenotype of R6/1 mice, we observed that another active anti-mHtt shRNA, siHUNT-2, reduced levels of striatal-specific transcripts in wild-type and R6/1 mice indicating that this molecule had deleterious effects that were

PAGE 91

82 independent of mHtt knock-down. As shown by these results, extreme caution should be taken when interpreting data from shRNAs in vivo and that detailed analysis of cellular gene expression can detect off-targeting effects associated with the intracellular expression of shRNAs. In conclusion, long-term rAAV5-mediated striatal expression of an anti-mutant Htt shRNAs was well tolerated in both wild-type and R6/1 transgenic mice and leads to changes that are consistent with reduced expression levels of mHtt protein. Moreover, improved striatal transduction, use of a slower progressing HD mouse model, transduction in additional critical brain regions such as cerebral cortex, intervention earlier in the time-course of pathology, or a combination of these factors may lead to better shRNA-mediated striatal mHtt knock-down effects. Nevertheless, we have demonstrated that reduced levels of striatal mHtt can be achieved through the use of RNAi and that this treatment results in a mildly improved cellular and behavioral phenotype in the R6/1 line of HD. Since polymorphisms associated with the mHtt allele have been described (44-46), these results suggest that mutant allele specific gene silencing may be a clinically viable approach once remaining efficiency and safety issues are resolved (19,34).

PAGE 92

CHAPTER 4 CONCLUSIONS HUNTINGTONS DISEASE (HD) is a severe and fatal autosomal dominant neurological disorder characterized by a late onset of motor and cognitive deficits including involuntary movements and phsychiatric manifestations. Inheritance of an abnormally expanded CAG-triplet repeat region is the genetic factor responsible for HD. This expansion is translated into a poly-glutamine (pQ) domain in the N-terminus of a protein termed huntingtin. Expression of this protein initiates the pathological molecular cascade of events that leads, without remission, to death of the affected individual within 20 years after the presentation of symtpoms. At the time that these studies were completed, there existed no clinical treatment to successfully slow down disease progression. Progression of HD is dependent on sustained mutant huntingtin expression. Therefore, we hypothesized that reduced levels of striatal m-Htt would slow down the rate of disease progression in a transgenic mouse model of HD. In order to test this hypothesis, we tested the ability of anti-mutant huntingtin hammerhead ribozymes and anti-mutant huntingtin shRNAs to mediate post-transcriptional silencing of m-Htt expression in vivo. We specifically characterized the effect that the long-term expression of anti-mutant huntingtin hammerhead ribozymes and anti-mutant huntingtin shRNAs had on neuronal intranuclear inclusion (NIIs) bodies and the progressive transcriptional dysregulation phenotype displayed in the R6/1 transgenic HD mouse line. 83

PAGE 93

84 We have demonstrated that long-term expression of rAAV5-siHUNT-1 short-hairpin RNA against m-Htt RNA led to significant silencing of m-Htt expression in the striatum of the R6/1 mouse (Chapter 4). Furthermore, RNAi-mediated silencing of m-Htt expression led to a significant decrease in the size and numbers of neuronal intranuclear inclusions, a marker of disease progression in the R6/1 mouse. In addition, in situ hybridization analysis demonstrated that reduced striatal levels of m-Htt led to an increase in the steady-state mRNA levels of both ppEnk and DARPP-32 but not of the dopamine type-2 and NGFi-A transcripts. Finally, we showed that long-term bilateral striatal expression of rAAV5-siHUNT-1 led to a delayed in the onset of the clasping phenotype displayed by R6/1 mice. We are the first to demonstrate that long-term striatal expression of anti-mutant Htt shRNAs result in reduced levels of m-Htt protein in vivo in the R6/1 model of HD. We also showed that this reduction resulted in a decrease in the size and amount of NIIs, concomitant with an increase in the mRNA steady-state levels of ppEnk and DARPP-32 and a delayed in the clasping phenotype in the R6/1 mouse. Unresolved Issues The function of wild-type Htt remains unknown. Although there is data supporting a role for Htt in neuronal survival, these studies have focused on the ablation of Htt expression prior to neuronal survival. Our experimental approach tested the hypothesis that the specific knockdown of striatal m-Htt protein would lead to a slower progression of the HD phenotype in the R6/1 mouse. Allele-specific silencing of m-Htt, while plausible in a transgenic mouse line, will be extremely difficult to achieve within the context of the human genome. In HD, the inheritance and expression of one CAG-expanded allele leads to disease. shRNAs directed against the CAG domain in huntingtin,

PAGE 94

85 although efficient in silencing m-Htt expression, can not discriminate between the mutant and wild-type alleles. Silencing of wild-type Htt in adult neurons could lead to neurodegeneration. To circumvent these problems, synthetic siRNAs directed against polymorphisms linked with the mutant allele have successfully reduced the levels of the mutant allele while minimally affecting the levels of wild-type protein. However, this has yet to be proven in vivo where the effects of off-targeting remain relatively unknown. Long-term in vivo expression of both HD6 and HD7 hammerhead ribozymes as well as the siHUNT-2 shRNA resulted in the remarkable loss of ppEnk, DARPP-32 and dopamine type-2 receptor mRNA steady-state levels in both R6/1 and wild-type mice. This reduction if striatal-specific mRNAs was not due to a global reduction in transcriptional activity since NGFi-A mRNA was induced above wild-type levels (Chapter 3). These three molecules targeted a 22-nucleotide region of the human Htt mRNA. HD6 was designed to target nucleotides at positions 29-41 from the ATG start site of the human Htt mRNA (accession # L34020). HD7 targeted nucleotides at positions 38-49 from the ATG start site while the shRNA siHUNT-2 targeted nucleotides at positions 24-45 from ATG start site. BLAST searches have revealed no similarity to known mouse mRNA sequences, however, there are up to six expressed-sequence tags (ESTs) from adult mouse neurospheres that match the criteria required for the HD6, HD7 or siHUNT-2-mediated cleavage of the molecule. Because the phenotype associated with the expression of HD6 HD7 and siHUNT-2 was reminiscent to an HD-like phenotype, further studies into the gene or genes that are being directly affected by these molecules are warranted. One initial approach would be to isolate the genes from neurospheres using the EST sequences as probes. One could then design ribozymes or shRNAs against

PAGE 95

86 different and unique sequences within the gene or genes in order to determine their contribution to the HD-like phenotype that we observed. Future Studies We report a mild-behavioral improvement in the R6/1 mouse induced by the long-term expression of rAAV5-siHUNT-1. The R6/1 more accurately replicates Juvenile HD were the progression of disease is much faster and severe. Therefore, the fact that we only attained mild cellular and behavioral improvements in the R6/1 mice does not diminish the potential therapeutic value of shRNAs in HD, especially on the more slow-progressing, adult-onset type. In fact, others have evaluated the therapeutic potential of a variety of molecules and environmental enrichment in the R6/1 mouse. These studies have resulted in varying degrees of success that paralleled the findings in our study. For example, the administration of fatty acids led to motor improvements but no recovery in the levels of D1 or D2 mRNA levels. Also, environmentally enriched R6/1 mice have increased rotarod rentention times when compared to controls, however, levels of D1 or D2 mRNAs remained unchanged. Finally, cortical transplantation of wild-type donor cortical tissue results in a delayed in the rear paw clasping phenotype. Thus, the mild improvements attained in our study could translate into more profound effects in slower progressing models of HD. At the time of this study, RNAi was an exciting, albeit, relatively new and unknown mechanism. New understandings of the pathway and the biochemical properties of the RISC complex have paved the way for the development of more specific and more efficient short-hairpin RNAs. This in turn has greatly enhanced the application of shRNAs in animal models of neurological disease. However, issues concerning intracellular expression and delivery into target sites are just now beginning to be

PAGE 96

87 addressed. Developing drug-regulatable expression cassettes and enhancing the capacity of viral vectors to spread into and be contained within target structures will expand the application of RNAi from therapy into the study of gene function in vivo. The search for a cure to Huntingtons disease not only entails the development of therapies but also the design and application of molecular techniques that will allow the HD research community to unravel the molecular cascade of events that lead to death. This study demonstrated the therapeutic potential of RNAi-meditated knockdown of striatal m-Htt. In addition, we also demonstrate that shRNAs can be used to understand gene function in a temporal and spatial manner.

PAGE 97

LIST OF REFERENCES 1. Afione, S. A., J. Wang, S. Walsh, W. B. Guggino, and T. R. Flotte. 1999. Delayed expression of adeno-associated virus vector DNA. Intervirology 42:213-20. 2. Arrasate, M., S. Mitra, E. S. Schweitzer, M. R. Segal, and S. Finkbeiner. 2004. Inclusion body formation reduces levels of mutant huntingtin and the risk of neuronal death. Nature 431:805-10. 3. Aylward, E. H., A. M. Codori, A. Rosenblatt, M. Sherr, J. Brandt, O. C. Stine, P. E. Barta, G. D. Pearlson, and C. A. Ross. 2000. Rate of caudate atrophy in presymptomatic and symptomatic stages of Huntington's disease. Mov. Disord. 15:552-60. 4. Bankiewicz, K. S., S. E. Leff, D. Nagy, S. Jungles, J. Rokovich, K. Spratt, L. Cohen, M. Libonati, R. O. Snyder, and R. J. Mandel. 1997. Practical aspects of the development of ex vivo and in vivo gene therapy for Parkinson's disease. Exp. Neurol. 144:147-56. 5. Bartolome, J., I. Castillo, and V. Carreno. 2004. Ribozymes as antiviral agents. Minerva. Med. 95:11-24. 6. Bates, G. 2003. Huntingtin aggregation and toxicity in Huntington's disease. Lancet 361:1642-4. 7. Bates, G. P., L. Mangiarini, and S. W. Davies. 1998. Transgenic mice in the study of polyglutamine repeat expansion diseases. Brain Pathol. 8:699-714. 8. Bjorklund, A., D. Kirik, C. Rosenblad, B. Georgievska, C. Lundberg, and R. J. Mandel. 2000. Towards a neuroprotective gene therapy for Parkinson's disease: use of adenovirus, AAV and lentivirus vectors for gene transfer of GDNF to the nigrostriatal system in the rat Parkinson model. Brain Res. 886:82-98. 9. Boado, R. J., A. Kazantsev, B. L. Apostol, L. M. Thompson, and W. M. Pardridge. 2000. Antisense-mediated down-regulation of the human huntingtin gene. J. Pharmacol. Exp. Ther. 295:239-43. 10. Bolivar, V. J., K. Manley, and A. Messer. 2004. Early exploratory behavior abnormalities in R6/1 Huntington's disease transgenic mice. Brain Res. 1005:29-35. 88

PAGE 98

89 11. Bonilla, E. 2000. [Huntington disease. A review]. Invest. Clin. 41:117-41. 12. Boutell, J. M., P. Thomas, J. W. Neal, V. J. Weston, J. Duce, P. S. Harper, and A. L. Jones. 1999. Aberrant interactions of transcriptional repressor proteins with the Huntington's disease gene product, huntingtin. Hum. Mol. Genet. 8:1647-55. 13. Burger, C., O. S. Gorbatyuk, M. J. Velardo, C. S. Peden, P. Williams, S. Zolotukhin, P. J. Reier, R. J. Mandel, and N. Muzyczka. 2004. Recombinant AAV viral vectors pseudotyped with viral capsids from serotypes 1, 2, and 5 display differential efficiency and cell tropism after delivery to different regions of the central nervous system. Mol. Ther. 10:302-17. 14. Cha, J. H. 2000. Transcriptional dysregulation in Huntington's disease. Trends Neurosci. 23:387-92. 15. Daly, T. M. 2004. Overview of adeno-associated viral vectors. Methods Mol. Biol. 246:157-65. 16. Davidson, B. L., and H. L. Paulson. 2004. Molecular medicine for the brain: silencing of disease genes with RNA interference. Lancet Neurol. 3:145-9. 17. Deocaris, C. C., S. C. Kaul, K. Taira, and R. Wadhwa. 2004. Emerging technologies: trendy RNA tools for aging research. J. Gerontol. A. Biol. Sci. Med. Sci. 59:771-83. 18. Dorsett, Y., and T. Tuschl. 2004. siRNAs: applications in functional genomics and potential as therapeutics. Nat. Rev. Drug. Discov. 3:318-29. 19. Dragatsis, I., M. S. Levine, and S. Zeitlin. 2000. Inactivation of Hdh in the brain and testis results in progressive neurodegeneration and sterility in mice. Nat. Genet. 26:300-6. 20. Ferro, P., R. dell'Eva, and U. Pfeffer. 2001. Are there CAG repeat expansion-related disorders outside the central nervous system? Brain Res. Bull. 56:259-64. 21. Flotte, T. R., S. A. Afione, and P. L. Zeitlin. 1994. Adeno-associated virus vector gene expression occurs in nondividing cells in the absence of vector DNA integration. Am. J. Respir. Cell Mol. Biol. 11:517-21. 22. Funato, T. 2005. Utility of antioncogene ribozymes and antisense oligonucleotides in reversing drug resistance. Methods Mol. Med. 106:215-33. 23. Galvao, R., L. Mendes-Soares, J. Camara, I. Jaco, and M. Carmo-Fonseca. 2001. Triplet repeats, RNA secondary structure and toxic gain-of-function models for pathogenesis. Brain Res. Bull. 56:191-201. 24. Gardian, G., and L. Vecsei. 2004. Huntington's disease: pathomechanism and therapeutic perspectives. J. Neural. Transm. 111:1485-94.

PAGE 99

90 25. Gauthier, L. R., B. C. Charrin, M. Borrell-Pages, J. P. Dompierre, H. Rangone, F. P. Cordelieres, J. De Mey, M. E. MacDonald, V. Lessmann, S. Humbert, and F. Saudou. 2004. Huntingtin controls neurotrophic support and survival of neurons by enhancing BDNF vesicular transport along microtubules. Cell 118:127-38. 26. Grimm, D. 2002. Production methods for gene transfer vectors based on adeno-associated virus serotypes. Methods 28:146-57. 27. Grimm, D., and J. A. Kleinschmidt. 1999. Progress in adeno-associated virus type 2 vector production: promises and prospects for clinical use. Hum. Gene Ther. 10:2445-50. 28. Grunewald, T., and M. F. Beal. 1999. Bioenergetics in Huntington's disease. Ann. N. Y. Acad. Sci. 893:203-13. 29. Gusella, J. F., M. E. MacDonald, C. M. Ambrose, and M. P. Duyao. 1993. Molecular genetics of Huntington's disease. Arch. Neurol. 50:1157-63. 30. Hackam, A. S., J. G. Hodgson, R. Singaraja, T. Zhang, L. Gan, C. A. Gutekunst, S. M. Hersch, and M. R. Hayden. 1999. Evidence for both the nucleus and cytoplasm as subcellular sites of pathogenesis in Huntington's disease in cell culture and in transgenic mice expressing mutant huntingtin. Philos. Trans. R. Soc. Lond. B. Biol. Sci. 354:1047-55. 31. Hansson, O., J. Nylandsted, R. F. Castilho, M. Leist, M. Jaattela, and P. Brundin. 2003. Overexpression of heat shock protein 70 in R6/2 Huntington's disease mice has only modest effects on disease progression. Brain Res. 970:47-57. 32. Harjes, P., and E. E. Wanker. 2003. The hunt for huntingtin function: interaction partners tell many different stories. Trends Biochem. Sci. 28:425-33. 33. Hasholt, L., K. Abell, A. Norremolle, C. Nellemann, K. Fenger, and S. A. Sorensen. 2003. Antisense downregulation of mutant huntingtin in a cell model. J. Gene Med. 5:528-38. 34. Hauswirth, W. W., and A. S. Lewin. 2000. Ribozyme uses in retinal gene therapy. Prog. Retin. Eye Res. 19:689-710. 35. Hauswirth, W. W., Q. Li, B. Raisler, A. M. Timmers, K. I. Berns, J. G. Flannery, M. M. LaVail, and A. S. Lewin. 2004. Range of retinal diseases potentially treatable by AAV-vectored gene therapy. Novartis Found. Symp. 255:179-88; discussion 188-94. 36. Hebb, A. L., H. A. Robertson, and E. M. Denovan-Wright. 2004. Striatal phosphodiesterase mRNA and protein levels are reduced in Huntington's disease transgenic mice prior to the onset of motor symptoms. Neuroscience 123:967-81.

PAGE 100

91 37. Hermonat, P. L., and N. Muzyczka. 1984. Use of adeno-associated virus as a mammalian DNA cloning vector: transduction of neomycin resistance into mammalian tissue culture cells. Proc. Natl. Acad. Sci. U S A 81:6466-70. 38. Ho, L. W., J. Carmichael, J. Swartz, A. Wyttenbach, J. Rankin, and D. C. Rubinsztein. 2001. The molecular biology of Huntington's disease. Psychol. Med. 31:3-14. 39. Humbert, S., and F. Saudou. 2004. [Stimulation of BDNF transport by huntingtin]. Med. Sci. (Paris) 20:952-4. 40. Huntington, G. 2003. On chorea. George Huntington, M.D. J. Neuropsychiatry Clin. Neurosci. 15:109-12. 41. Jiang, H., F. C. Nucifora, Jr., C. A. Ross, and D. B. DeFranco. 2003. Cell death triggered by polyglutamine-expanded huntingtin in a neuronal cell line is associated with degradation of CREB-binding protein. Hum. Mol. Genet. 12:1-12. 42. Kamiya, H., H. Akita, and H. Harashima. 2003. Pharmacokinetic and pharmacodynamic considerations in gene therapy. Drug Discov. Today 8:990-6. 43. Kearns, W. G., S. A. Afione, S. B. Fulmer, M. C. Pang, D. Erikson, M. Egan, M. J. Landrum, T. R. Flotte, and G. R. Cutting. 1996. Recombinant adeno-associated virus (AAV-CFTR) vectors do not integrate in a site-specific fashion in an immortalized epithelial cell line. Gene Ther. 3:748-55. 44. Keene, C. D., C. M. Rodrigues, T. Eich, M. S. Chhabra, C. J. Steer, and W. C. Low. 2002. Tauroursodeoxycholic acid, a bile acid, is neuroprotective in a transgenic animal model of Huntington's disease. Proc. Natl. Acad. Sci. U. S. A. 99:10671-6. 45. Kim, J. S., S. A. Reading, T. Brashers-Krug, V. D. Calhoun, C. A. Ross, and G. D. Pearlson. 2004. Functional MRI study of a serial reaction time task in Huntington's disease. Psychiatry Res. 131:23-30. 46. Leavitt, B. R., C. L. Wellington, and M. R. Hayden. 1999. Recent insights into the molecular pathogenesis of Huntington disease. Semin. Neurol. 19:385-95. 47. Lewin, A. S., K. A. Drenser, W. W. Hauswirth, S. Nishikawa, D. Yasumura, J. G. Flannery, and M. M. LaVail. 1998. Ribozyme rescue of photoreceptor cells in a transgenic rat model of autosomal dominant retinitis pigmentosa. Nat. Med. 4:967-71. 48. Lewin, A. S., and W. W. Hauswirth. 2001. Ribozyme gene therapy: applications for molecular medicine. Trends Mol. Med. 7:221-8.

PAGE 101

92 49. Li, H., S. H. Li, Z. X. Yu, P. Shelbourne, and X. J. Li. 2001. Huntingtin aggregate-associated axonal degeneration is an early pathological event in Huntington's disease mice. J. Neurosci. 21:8473-81. 50. Li, S. H., and X. J. Li. 2004. Huntingtin and its role in neuronal degeneration. Neuroscientist 10:467-75. 51. Li, S. H., and X. J. Li. 2004. Huntingtin-protein interactions and the pathogenesis of Huntington's disease. Trends Genet. 20:146-54. 52. Li, Y., T. Yokota, R. Matsumura, K. Taira, and H. Mizusawa. 2004. Sequence-dependent and independent inhibition specific for mutant ataxin-3 by small interfering RNA. Ann. Neurol. 56:124-9. 53. MacDonald, M. E., S. Gines, J. F. Gusella, and V. C. Wheeler. 2003. Huntington's disease. Neuromolecular Med. 4:7-20. 54. Mangiarini, L., K. Sathasivam, M. Seller, B. Cozens, A. Harper, C. Hetherington, M. Lawton, Y. Trottier, H. Lehrach, S. W. Davies, and G. P. Bates. 1996. Exon 1 of the HD gene with an expanded CAG repeat is sufficient to cause a progressive neurological phenotype in transgenic mice. Cell 87:493-506. 55. McCampbell, A., J. P. Taylor, A. A. Taye, J. Robitschek, M. Li, J. Walcott, D. Merry, Y. Chai, H. Paulson, G. Sobue, and K. H. Fischbeck. 2000. CREB-binding protein sequestration by expanded polyglutamine. Hum. Mol. Genet. 9:2197-202. 56. McCaw, E. A., H. Hu, G. T. Gomez, A. L. Hebb, M. E. Kelly, and E. M. Denovan-Wright. 2004. Structure, expression and regulation of the cannabinoid receptor gene (CB1) in Huntington's disease transgenic mice. Eur. J. Biochem. 271:4909-20. 57. Miller, V. M., H. Xia, G. L. Marrs, C. M. Gouvion, G. Lee, B. L. Davidson, and H. L. Paulson. 2003. Allele-specific silencing of dominant disease genes. Proc. Natl. Acad. Sci. U. S. A. 100:7195-200. 58. Naver, B., C. Stub, M. Moller, K. Fenger, A. K. Hansen, L. Hasholt, and S. A. Sorensen. 2003. Molecular and behavioral analysis of the R6/1 Huntington's disease transgenic mouse. Neuroscience 122:1049-57. 59. Nellemann, C., K. Abell, A. Norremolle, T. Lokkegaard, B. Naver, C. Ropke, J. Rygaard, S. A. Sorensen, and L. Hasholt. 2000. Inhibition of Huntington synthesis by antisense oligodeoxynucleotides. Mol. Cell. Neurosci. 16:313-23. 60. Norflus, F., A. Nanje, C. A. Gutekunst, G. Shi, J. Cohen, M. Bejarano, J. Fox, R. J. Ferrante, and S. M. Hersch. 2004. Anti-inflammatory treatment with acetylsalicylate or rofecoxib is not neuroprotective in Huntington's disease transgenic mice. Neurobiol. Dis. 17:319-25.

PAGE 102

93 61. O'Brien, T., and D. Lee. 2004. Prospects for caspase inhibitors. Mini Rev. Med. Chem. 4:153-65. 62. Okun, M. S. 2003. Huntington's disease: what we learned from the original essay. Neurologist 9:175-9. 63. Orr, H. T. 2004. Neurodegenerative disease: neuron protection agency. Nature 431:747-8. 64. Pardridge, W. M. 2001. Brain drug targeting and gene technologies. Jpn. J. Pharmacol. 87:97-103. 65. Parniewski, P., and P. Staczek. 2002. Molecular mechanisms of TRS instability. Adv. Exp. Med. Biol. 516:1-25. 66. Perutz, M. F., T. Johnson, M. Suzuki, and J. T. Finch. 1994. Glutamine repeats as polar zippers: their possible role in inherited neurodegenerative diseases. Proc. Natl. Acad. Sci. U. S. A. 91:5355-8. 67. Petersen, A., K. Mani, and P. Brundin. 1999. Recent advances on the pathogenesis of Huntington's disease. Exp. Neurol. 157:1-18. 68. Qin, P. Z., and T. Dieckmann. 2004. Application of NMR and EPR methods to the study of RNA. Curr. Opin. Struct. Biol. 14:350-9. 69. Rosenblatt, A., M. H. Abbott, L. M. Gourley, J. C. Troncoso, R. L. Margolis, J. Brandt, and C. A. Ross. 2003. Predictors of neuropathological severity in 100 patients with Huntington's disease. Ann. Neurol. 54:488-93. 70. Ross, C. A., and M. A. Poirier. 2004. Protein aggregation and neurodegenerative disease. Nat. Med. 10 Suppl:S10-7. 71. Sanchez Mejia, R. O., and R. M. Friedlander. 2001. Caspases in Huntington's disease. Neuroscientist 7:480-9. 72. Sathasivam, K., C. Hobbs, L. Mangiarini, A. Mahal, M. Turmaine, P. Doherty, S. W. Davies, and G. P. Bates. 1999. Transgenic models of Huntington's disease. Philos. Trans. R. Soc. Lond. B. Biol. Sci. 354:963-9. 73. Saudou, F., S. Finkbeiner, D. Devys, and M. E. Greenberg. 1998. Huntingtin acts in the nucleus to induce apoptosis but death does not correlate with the formation of intranuclear inclusions. Cell 95:55-66. 74. Sawa, A. 2001. Mechanisms for neuronal cell death and dysfunction in Huntington's disease: pathological cross-talk between the nucleus and the mitochondria? J. Mol. Med. 79:375-81.

PAGE 103

94 75. Schaffar, G., P. Breuer, R. Boteva, C. Behrends, N. Tzvetkov, N. Strippel, H. Sakahira, K. Siegers, M. Hayer-Hartl, and F. U. Hartl. 2004. Cellular toxicity of polyglutamine expansion proteins: mechanism of transcription factor deactivation. Mol. Cell. 15:95-105. 76. Schubert, S., and J. Kurreck. 2004. Ribozymeand deoxyribozyme-strategies for medical applications. Curr. Drug Targets 5:667-81. 77. Shimayama, T., S. Nishikawa, and K. Taira. 1995. Generality of the NUX rule: kinetic analysis of the results of systematic mutations in the trinucleotide at the cleavage site of hammerhead ribozymes. Biochemistry 34:3649-54. 78. Sieradzan, K. A., and D. M. Mann. 2001. The selective vulnerability of nerve cells in Huntington's disease. Neuropathol. Appl. Neurobiol. 27:1-21. 79. Sugars, K. L., and D. C. Rubinsztein. 2003. Transcriptional abnormalities in Huntington disease. Trends Genet. 19:233-8. 80. Tenenbaum, L., A. Chtarto, E. Lehtonen, T. Velu, J. Brotchi, and M. Levivier. 2004. Recombinant AAV-mediated gene delivery to the central nervous system. J. Gene Med. 6 Suppl 1:S212-22. 81. The Huntington's Disease Collaborative Research Group.1993. A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington's disease chromosomes. Cell 72:971-83. 82. Tuschl, T. 2001. RNA interference and small interfering RNAs. Chembiochem. 2:239-45. 83. Tuschl, T., and A. Borkhardt. 2002. Small interfering RNAs: a revolutionary tool for the analysis of gene function and gene therapy. Mol. Interv. 2:158-67. 84. von Horsten, S., I. Schmitt, H. P. Nguyen, C. Holzmann, T. Schmidt, T. Walther, M. Bader, R. Pabst, P. Kobbe, J. Krotova, D. Stiller, A. Kask, A. Vaarmann, S. Rathke-Hartlieb, J. B. Schulz, U. Grasshoff, I. Bauer, A. M. Vieira-Saecker, M. Paul, L. Jones, K. S. Lindenberg, B. Landwehrmeyer, A. Bauer, X. J. Li, and O. Riess. 2003. Transgenic rat model of Huntington's disease. Hum. Mol. Genet. 12:617-24. 85. Walling, H. W., J. J. Baldassare, and T. C. Westfall. 1998. Molecular aspects of Huntington's disease. J. Neurosci. Res. 54:301-8. 86. Wang, C. H., D. W. Liu, Y. P. Tsao, X. Xiao, and S. L. Chen. 2004. Can genes transduced by adeno-associated virus vectors elicit or evade an immune response? Arch. Virol. 149:1-15. 87. Wanker, E. E. 2000. Protein aggregation in Huntington's and Parkinson's disease: implications for therapy. Mol. Med. Today 6:387-91.

PAGE 104

95 88. Wellington, C. L., and M. R. Hayden. 2000. Caspases and neurodegeneration: on the cutting edge of new therapeutic approaches. Clin. Genet. 57:1-10. 89. Wellington, C. L., B. R. Leavitt, and M. R. Hayden. 2000. Huntington disease: new insights on the role of huntingtin cleavage. J. Neural. Transm. Suppl.:1-17. 90. Wexler, N. S., J. Lorimer, J. Porter, F. Gomez, C. Moskowitz, E. Shackell, K. Marder, G. Penchaszadeh, S. A. Roberts, J. Gayan, D. Brocklebank, S. S. Cherny, L. R. Cardon, J. Gray, S. R. Dlouhy, S. Wiktorski, M. E. Hodes, P. M. Conneally, J. B. Penney, J. Gusella, J. H. Cha, M. Irizarry, D. Rosas, S. Hersch, Z. Hollingsworth, M. MacDonald, A. B. Young, J. M. Andresen, D. E. Housman, M. M. De Young, E. Bonilla, T. Stillings, A. Negrette, S. R. Snodgrass, M. D. Martinez-Jaurrieta, M. A. Ramos-Arroyo, J. Bickham, J. S. Ramos, F. Marshall, I. Shoulson, G. J. Rey, A. Feigin, N. Arnheim, A. Acevedo-Cruz, L. Acosta, J. Alvir, K. Fischbeck, L. M. Thompson, A. Young, L. Dure, C. J. O'Brien, J. Paulsen, A. Brickman, D. Krch, S. Peery, P. Hogarth, D. S. Higgins, Jr., and B. Landwehrmeyer. 2004. Venezuelan kindreds reveal that genetic and environmental factors modulate Huntington's disease age of onset. Proc. Natl. Acad. Sci. U. S. A. 101:3498-503. 91. Xia, H., Q. Mao, S. L. Eliason, S. Q. Harper, I. H. Martins, H. T. Orr, H. L. Paulson, L. Yang, R. M. Kotin, and B. L. Davidson. 2004. RNAi suppresses polyglutamine-induced neurodegeneration in a model of spinocerebellar ataxia. Nat. Med. 10:816-20. 92. Yamamoto, A., J. J. Lucas, and R. Hen. 2000. Reversal of neuropathology and motor dysfunction in a conditional model of Huntington's disease. Cell 101:57-66. 93. Yen, L., S. M. Strittmatter, and R. G. Kalb. 1999. Sequence-specific cleavage of Huntingtin mRNA by catalytic DNA. Ann. Neurol. 46:366-73. 94. Zdzienicka, E., M. Rakowicz, H. Mierzewska, D. Hoffman-Zacharska, T. Jakubowska, R. Poniatowska, A. Sulek, E. Waliniowska, U. Zalewska, J. Kulczycki, and J. Zaremba. 2002. [Clinical and genetic study of juvenile form of Huntington's disease]. Neurol. Neurochir. Pol. 36:245-58. 95. Zhang, Y., M. Li, M. Drozda, M. Chen, S. Ren, R. O. Mejia Sanchez, B. R. Leavitt, E. Cattaneo, R. J. Ferrante, M. R. Hayden, and R. M. Friedlander. 2003. Depletion of wild-type huntingtin in mouse models of neurologic diseases. J. Neurochem. 87:101-6. 96. Zhang, Y. C., M. M. Taylor, W. K. Samson, and M. I. Phillips. 2005. Antisense inhibition: oligonucleotides, ribozymes, and siRNAs. Methods Mol. Med. 106:11-34.

PAGE 105

96 97. Zielonka, D., M. de Mezer, A. Niezgoda, K. Reperowicz, W. Krzyzosiak, and W. Kozubski. 2002. [Clinical picture of patients with Huntington's disease in relation to the number of trinucleotide CAG repeats in IT-15 gene]. Neurol. Neurochir. Pol. 36:903-9. 98. Zuccato, C., M. Tartari, A. Crotti, D. Goffredo, M. Valenza, L. Conti, T. Cataudella, B. R. Leavitt, M. R. Hayden, T. Timmusk, D. Rigamonti, and E. Cattaneo. 2003. Huntingtin interacts with REST/NRSF to modulate the transcription of NRSE-controlled neuronal genes. Nat. Genet. 35:76-83.

PAGE 106

BIOGRAPHICAL SKETCH I was born in the small municipality of Arroyo, Puerto Rico in January 27 th of 1976. I graduated with honors from the University High School, Puerto Rico, after which I attended the University of Central Florida for four years. After receiving my Bachelor of Science degree from the University of Central Florida I worked for one year in the laboratory of Dr. Cristina Fernandez-Valle. In 1999 I began graduate studies in the Interdisciplinary Program for Biomedical Sciences at the University of Florida while also becoming the proud father of Arianna Lee Rodriguez. Under the guidance and mentoring of Dr. Ronald J. Mandel I began to pursue my doctoral degree during the spring of 2000 at which time I was also awarded a five-year pre-doctoral fellowship from National Institute of Neurological Disorders and Stroke. 97


Permanent Link: http://ufdc.ufl.edu/UFE0010200/00001

Material Information

Title: Characterization of the Effects of Reduced Mutant Huntingtin in the R6/1 Model of Huntington's Disease
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0010200:00001

Permanent Link: http://ufdc.ufl.edu/UFE0010200/00001

Material Information

Title: Characterization of the Effects of Reduced Mutant Huntingtin in the R6/1 Model of Huntington's Disease
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0010200:00001


This item has the following downloads:


Full Text











CHARACTERIZATION OF THE EFFECTS OF REDUCED MUTANT HUNTINGTIN
IN THE R6/1 MODEL OF HIUNTINGTON' S DISEASE














By

EDGARDO RODRIGUEZ


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2005
































Copyright 2005

by

Edgardo Rodriguez


































I dedicate this work to my loving and ever-supportive wife Erica and my daughter
Arianna; and to my parents, the inspiration of my life.
















ACKNOWLEDGMENTS

I would like to acknowledge the support and enduring patience that my mentor, Dr.

Ronald J. Mandel, had towards me from the beginning of this proj ect. I also would like to

make special mention of Dr. Alfred S. Lewin, whose wisdom and guidance made me the

confident scientist that I am today. I would like to thank all of my committee members,

Dr. Lucia Notterperk, Dr. Dennis Steindler and Dr. Nick Muzyczka for their

insightfulness. I gratefully acknowledge the help and support from Dr. Eileen Denovan-

Wright and her laboratory; she was that second pair of hands we all wish we had.

I thank everyone at the Mandel laboratory, especially Izzie Williams, for her

technical and moral support. Special thanks go to my beloved friend Carmen Peden. I

gratefully acknowledge all of the members of the Lewin laboratory, past and present, for

their unconditional friendship and support. I also would like to thank Dr. Corinna Burger

and Dr. Kevin Nash for lending me their time and for their ideas.

No words convey the gratitude that I have towards my parents. It is with much love

that I acknowledge and deeply appreciate the sacrifices and difficulties that my loving

wife, Erica, patiently endured. Lastly, but most importantly, I thank God for keeping us

safe and healthy through it all.




















TABLE OF CONTENTS

Page

ACKNOWLEDGMENT S ................. ................. iv.............


LIST OF FIGURES .............. ....................vii


AB S TRAC T ......_ ................. ..........._..._ viii..


CHAPTERS


1 INTRODUCTION ................. ...............1.......... ......


Huntington' s Disease ..........__._ .... ..._. ...............1....
Genetics of HD .............. ...............3.....
Huntingtin .........._.... ... ....__ ...............3.....
CAG Triplet Repeat Disorders .............. ...............5.....
Neuronal Inclusion Bodies ............... ...............5....
Transcriptional Dysregulation in HD .............. ...............6.....
Transgenic Models of HD .............. ...............8.....
Gain of Function vs. Loss of Function ............ ......__..... ..........1
Nucleic Acid-Based Gene Therapy .............. ...............12....
Ribozym es .............. ...............12....
RNA Interference............... ..............1
Gene Delivery in the CNS .............. ...............17....

2 RIBOZYME-MEDIATED REDUCTION OF STRIATAL MUTANT
HUNTINGTIN INT VIVO .............. ...............20....


Introducti on ................. ...............20.................
Materials and Methods .............. ...............22....
Defining Target Sites................ .... ...... .............2
Preparation of Short Ribonucleic Acid Target ................. ............... ...._...22
Time Course Analysis .......................... ..............2
In Vitro Transcription of m-Htt mRNA ................. ............. ........ .......24
Cloning of Ribozymes into rAAV Vectors ................. ................. ..........24
Human Embryonic Kidney 293 Cells................. ....... .............2
Transfections using Lipofectamine on HEK 293 Cells............... ..................2
RNA Isolation and Northern Analysis .............. ...............26....
rAAV Vector Production ........._....._ ...._.._......_._ ...........2
R6/1 Transgenic Colony ............._ ......__ ........._ ... .........2
Surgical Procedures ...._.. ................ ......._.. ..........2












Tissue Processing .............. ...............28...
In Situ Hybridization Analysis .............. ...............29....
R e sults............... ......... .. .... .............3
Time Course of Ribozyme Cleavage ................. .. ....... .... .........__ .......3
HD6, HD7 and dsCAG1 Activity Against hr Y7tro Transcribed m-Htt mRNA .31
HD6 and HD7 Ribozyme Activity Against m-Htt mRNA hIn Yvo ................... ..36
hr vivo Activity of rAAV-HD6 and rAAV-HD7 Ribozymes ................... ...........36
Biological Effects of rAAV5-HD6 and HD7 Ribozyme Expression in the
R6/1 Mouse Striatum .............. ...............3 8....
D discussion ............... .... ...... .... ..... ... ....... ... ........... .......4
Ribozymes Can Modulate the Expression of Cellular Genes .............................42
bI Vivo use of Ribozymes Directed Against the R6/1 Trans gene ................... ....42
Conclusion ................. ...............44..__.........


3 RNA INTERFERENCE OF MUTANT HUNTINGTIN INT VIVO ................... ........46


Introducti on ................. ...............46.................
Materials and Methods .............. ... ...............47.
rAAV-shRNA Plasmid Construction .............. ...............47....
Testing of shRNA Efficacy in Cultured Cells............... ...............48.
Western Blot Analysis using Hum-1 Antibody ................. ................. ......49
rAAV Vector Production ..........._..__.. ....._.._... ........_._ ............5
Intrastriatal Inj section of shRNA-Expressing AAV Vectors. .............. ..............50
In Situ Hybridization Analysis .............. ...............55....
Effect of Anti-mHtt shRNA on Phenotype ................. ............................56
Stati sti cs ................. ...............56........... ....
Re sults................. .............. ....... .. .... ..... .............5
RNA Interference of Mutant Huntingtin In Vitro ........._._......... .... ..............57
Long-Term Striatal Expression of rAAV5-shRNAs in the R6/1 Mouse ............60
Reduction in the Size and Amount of NIIs is Observed in R6/1 Mice Treated
with rAAV5-siHUNT-1 or rAAV5-siHUNT-2. ............. .... ..................6
Reduced Levels of Striatal mHtt Affect Levels of Striatal-Specific
Tran scri pts .................. ....... ....... ............... ..... ..... ..........7
Long-Term Bilateral Striatal Expression of rAAV5-siHUNT-1 in the R6/1
Mouse is Associated with a Delay in the Clasping Phenotype. ................... ....75
Discussion ................. ...............78........... ....


4 CONCLUSIONS .............. ...............83....


Unresolved Issues ................. ...............8.. 4..............
Future Studies ................. ...............86.......... .....


LIST OF REFERENCES ................. ...............88........... ....


BIOGRAPHICAL SKETCH ................ ............. ............ ..97..



















LIST OF FIGURES


Figure pg

1-1. Neuropathology in HD. ............. ...............2.....

1-2. Structure domains of huntingtin. ........._._._ ....___........ ........___.........4

1-3. Molecular cascades in HD. ..........._...... ._ ...............10.

1-4. The hammerhead ribozyme. ............. ...............14.....

1-5. The RNAi pathway. ............. ...............16.....

2-1. Ribozyme design. ............. ...............32.....

2-2. Time course cleavage analysis. ............. ...............33.....

2-3. Target accessibility ................ ...................... ............................34

2-4. In vivo expression of rAAV ribozyme vectors. ....._.__._ ... .....___ ........._......37

2-5. rAAV5-HD7 expression results in a loss of striatal-specific transcripts. .................. .40

3-1. rAAV-shRNA constructs mediate the silencing of m-Htt in vitro. ................... .........58

3-2. Experimental design. ............. ...............61.....

3-3. Long-term in vivo striatal expression of rAAV5-siHIUNT 1 and rAAV-siHIUNT2
decrease mHtt transgene mRNA expression. .............. ...............63....

3-4 Analysis of mHtt protein aggregates after expression of rAAV5-shRNAs. ...............67

3-5 In situ hybridization (ISH) analysis of ppEnk and DARPP-32 transcripts. ...............73

3-6 Bilateral long-term striatal expression of rAAV5-siHIUNT-1 delays the clasping
phenotype of R6/1 mice. ............. ...............76.....
















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

CHARACTERIZATION OF THE EFFECTS OF REDUCED MUTANT HUNTINGTIN
IN THE R6/1 MODEL OF HIUNTINGTON' S DISEASE

By

Edgardo Rodriguez

August, 2005

Chair: Ronald J. Mandel
Major Department: Neuroscience

Huntington's disease (HD) is a fatal, inherited, autosomal dominant neurological

disorder that currently affects over 30,000 individuals in the United States alone. HD is

characterized by motor impairment and psychological manifestations. Expression of an

abnormally expanded poly-glutamine domain in the N-terminus of the protein called

huntingtin is responsible for the genesis and progression of the disease. The aim of this

thesis was to develop molecular tools that could mediate the reduction in the levels of

mutant huntingtin in the striatum of the R6/1 mouse model of HD. We hypothesized that

reduced levels of striatal mutant huntingtin would ameliorate the progressive HD-like

phenotype that is observed in the R6/1 mouse.

Our initial studies focused on the development of RNA enzymes, called ribozymes,

and their ability to specifically target and efficiently knockdown the levels of mutant

huntingtin in vivo. We found that, although anti-mutant huntingtin ribozymes were highly

efficient in vitro, expression in the R6/1 striatum led to neuronal dysfunction in both










wild-type and R6/1 mice. Attempts at re-designing new ribozymes were hindered by

limitations in target site accessibility and availability. Thus, we focused our efforts

towards developing a new gene knockdown strategy based on the RNA interference

pathway .

In vivo expression of anti-mutant huntingtin short-hairpin RNA molecules resulted

in a significant reduction in the levels of striatal mutant huntingtin protein in the R6/1

mouse brain. This reduction was associated with a partial clearance of neuronal

intranuclear inclusions. In addition, reduced levels of mutant huntingtin led to an increase

in the levels of two neuronal-specific transcripts known to be downregulated in HD. Last,

there was a delay in the onset of the rear paw clasping progressive phenotype observed in

the R6/1 mouse.

These results demonstrate that reduced levels of striatal mutant huntingtin are

beneficial in a genetic model ofHD. Furthermore, the studies presented here address the

therapeutic potential of RNA interference in the treatment of dominant disease. Finally,

our ribozyme studies suggest the existence of an unidentified gene, or genes, whose

expression is critical for the proper function of striatal neurons in the mouse brain.















CHAPTER 1
INTTRODUCTION

Huntington's Disease

In 1872 a young American physician named George Huntington Jr. accurately

described the symptoms of chorea and dementia as well as the adult-onset and genetic

inheritance associated with the disease that would ultimately come to bear his name (40,

62). HIUNTINGTON' S DISEASE (HD) is an inherited, autosomal dominant neurological

disorder characterized by choreiform abnormal movements, cognitive deficits and

psychiatric manifestations associated with progressive striatal atrophy (3, 11). Formerly

known as Huntington's chorea, HD affects approximately 1 in every 10,000 individuals

of Caucasian origin with close to 30,000 HD patients currently diagnosed in the United

States alone. There are at least 150,000 individuals who currently live with a 50 percent

chance of developing HD, as well as thousands of family members and friends that must

take on the challenge of caring for those with such a chronic devastating disease.

Although HD was first described over a century ago, there is currently no effective

therapy and, in the case of adult onset HD, the disease always leads to death within 10 to

15 years after the onset of symptoms (11, 97).

Huntington's disease affects different brain regions to various degrees; however,

the neuropathological hallmark of HD is the enlargement of the lateral ventricles (3).

Expression of the HD mutant gene leads to the selective degeneration of the gamma-

amino-butyric-acid (GABA) medium sized spiny neurons that reside in the caudate-











A. B.














Figure 1-1. Neuropathology in HD. Panel (A) is a coronal section obtained from the brain
of an HD affected individual. Notice the striatal degeneration that results in
enlarged ventricles. Panel (B) is shown to demonstrate the size of the striatum
in a normal brain.

putamen nucleus (striatum) (Fig. 1-1). This marked striatal susceptibility is not fully

understood and although it results in gross neuroanatomical damage, it is only evident

during the later stages of HD and it is not solely responsible for the etiology of the

disease (45, 78). In fact, symptoms associated with HD are evident prior to any detectable

striatal atrophy (45, 60). These symptoms, which include involuntary twitching, lack of

coordination, depression, mood swings and forgetfulness, typically arise during mid-life

(35-40 years of age) although close to 10 percent of affected individuals develop a more

severe and aggressive form of the disease termed Juvenile HD, in which symptoms are

evident before the age of 20 (94). The onset of symptoms prior to any significant cell

loss, a phenomenon observed also in several animal models of the disease (7, 74, 84),

suggests that neuronal dysfunction, and not cell death, is responsible for the initial stages

of D.









Genetics of HD

The advancements in modern molecular techniques during the 1980s and the

unprecedented collaborative effort between groups of scientists from different institutions

led to the discovery of the HD gene in 1993 (81). The study found that HD is caused by

the inheritance of an unstable and excessively repeated cytosine-adenine-guanine (CAG)

codon within the coding sequence in exon 1 of the IT-15 gene (HD gene). Unaffected

individuals were found to have repeats with lengths of 34 CAGs or less, while HD

affected individuals had anywhere between 40 to 121 repeats. In HD, the severity of

symptoms seems to be correlated with the number of repeats while the age of onset

appears to be inversely proportional to the repeat amount (69), however, recent data

obtained from the largest known HD kindred (50,000 individuals in Lake Maracaibo,

Venezuela) suggest that genetic modifiers influence both severity and age of onset (90).

HD is developed when the CAG expansion is translated into a poly-glutamine (pQ)

repeat domain in the N-terminus of the protein encoded by the HD gene named

huntingtin (Htt) (81). Expression of expanded mutant Htt (m-Htt) results in the initiation

of a cascade of events that progressively disrupt neuronal homeostasis. Importantly,

expression of the expanded HD gene leads to activation of caspases, which in turn cleave

m-Htt into small N-terminal pQ-containing fragments (46, 61). These fragments can

readily cross through the nuclear pore and become aggregated inside the nucleus.

Abnormal nuclear translocation of expanded m-Htt N-terminal fragments is required for

the pQ-induced cell death observed in cellular models of HD (73).

Huntingtin

Huntingtin is a large, 348 kDa, cytoplasmic protein of unknown function. It is

localized to many subcellular compartments and expressed in all tissues of the body with









P 0 HEA Ts

N -**C

Figure 1-2. Structure domains of huntingtin. Shown above is a depiction of the structure
domains present in huntingtin. The poly-glutamine domain (pQ) lies just
upstream of a poly-proline rich domain (pp). A stretch of 36 HEAT-like
domains is thought to serve as docking sites for cellular proteins.

higher concentrations found in the brain and testis (24, 50). Htt has three maj or domains:

a polymorphic poly-glutamine domain, a proline-rich domain and 36 HEAT-like repeat

structures (Fig, 1-2); however, its amino-acid sequence has no major homology to any

known protein (75). Even though Htt's function has been difficult to elucidate, new

insights have emerged from studies in culture and animal models of HD.

Initially, approaches to the study of Htt' s function focused on the disruption of the

murine HD homolog gene (Hdh). Ablation of the Hdh gene in the mouse results in

embryonic lethality associated with aberrant brain development and increased apoptotic

cell death while post-natal conditional deletion in the mouse forebrain leads to abnormal

brain development and neurodegeneration reminiscent of HD (19, 95). These

observations suggest a critical role for Htt during neurogenesis and development. Recent

evidence suggests that Htt may function as a scaffolding protein (50, 66) and that it is

involved in many cellular processes such as neuronal vesicle transport in both the

endocytic and secretary pathways, protein trafficking and transcriptional regulation (13).

Studies have demonstrated that Htt colocalizes with vesicles and that expression of m-Htt

can interfere with normal neuronal vesicular transport (24). Additionally, Htt was found

to be a crucial member of the dynactin complex and this interaction was required for the

proper cortico-striatal anterograde transport of brain-derived neurotrophic factor (BDNF)

(24, 38). Also, wild-type Htt is proposed to have anti-apoptotic properties and may play a









role in neuronal survival (87). The abnormal level of apoptotic cells found in the Hdh

knockout mouse supports this hypothesis. Finally, it was recently showed that Htt

interacts with the REST-NRSF complex and that this interaction promotes the expression

of neuron specific genes such as BDNF (97). Taken together, these data suggest a

complex cellular role for Htt; however, what that specific role is, remains inadequately

explained.

CAG Triplet Repeat Disorders

The presence of a pQ domain in m-Htt makes HD a member of a family of at least

nine neurological disorders known as the CAG triplet repeat or pQ repeat disorders which

include Dentato-rubral pallido-luysian atrophy (DRPLA), Spinobulbar muscular atrophy

(SBMA) and the Spino-cerebellar ataxias (SCA) 1, 2, 3, 6, 7 and 17 (20, 23). Although

all of these disorders differ in the context of the protein containing the pQ domain, they

share many similarities including threshold CAG expansion lengths, genetic inheritance,

adult-onset and progressive neurodegeneration (23, 28, 65). Additionally, all of these

disorders are well characterized by the aberrant nuclear translocation of the mutant

protein as well as by the abnormal aggregation of cellular proteins that results in the

formation of intracellular bodies both in and outside the nucleus known as inclusion

bodies (30, 71, 89).

Neuronal Inclusion Bodies

Many of the known neurodegenerative disorders such as HD, Parkinson' s disease,

Alzheimer' s disease and amyotrophic lateral sclerosis (ALS) are characterized by the

presence of proteinaceous bodies readily visible under the light microscope. In the case of

HD, insoluble protein aggregates are observed late in the progression of disease (7, 70,

85, 87). It has been suggested that this process is modulated by the activation of caspases









that mediate the cleavage of m-Htt into small, toxic and aggregate-prone N-terminal

fragments (88). m-Htt sequesters into these inclusions, proteins that are critical for

maintaining neuronal homeostasis, i.e., transcription factors such as Spl, effectively

interfering with their proper cellular localization and function (14). This sequestration is

proposed to take place via a variety of different mechanisms such as the formation of

polar-zipper structures, transglutamination and SH3-domain dependent binding, all

resulting in aberrant protein-protein interactions that take place in and are modulated by

the pQ domain region of m-Htt (7, 66). Also, it has been suggested that inclusion bodies

can lead to neurite and neuropil dystrophy and can physically interfere with cellular

processes critical for neuronal function such as protein transport and proteosomal

processing (11, 32, 49, 50).

In contrast, other researchers have proposed that the formation of inclusion bodies

in HD is a neuronal defense mechanism designed to neutralize the toxicity associated

with the expanded pQ domain in m-Htt. In fact, a strong correlation between the

formation of inclusion bodies and survival rate was recently observed in neurons

engineered to express m-Htt in culture (2, 63). Whether the presence of inclusion bodies

in HD forms an integral part of the disease process itself or is an attempt by neurons to

cope with an otherwise toxic protein remains controversial. Nevertheless, many agree

that inclusion bodies are a reliable marker of disease progression and suggest a common

pathological mechanism amongst many neurological disorders (6, 63).

Transcriptional Dysregulation in HD

Transcriptional dysregulation has recently been suggested as an important

pathogenic mechanism in HD (12, 14, 51, 79). Both HD models and patients display a

progressive loss in steady-state mRNA levels of a subset of striatal neuronal transcripts










(14, 79). Recent observations implicate the formation of intranuclear inclusions and the

sequestration of transcription factors into aggregates as possible explanations for the loss

in gene transcription (14). There is mounting evidence suggesting that soluble forms of

mutant huntingtin alter the expression of specific genes by interacting with their

transcriptional activators (55). X-ray diffraction studies have shown that the poly-

glutamine domain in m-Htt can mediate the aberrant interaction between m-Htt and poly-

glutamine-containing transcription factors via the formation of polar-zipper structures in

vitro (66). In addition, yeast-two hybrid screens have illustrated m-Htt's interaction with

several transcription factors such as p53, SP1 and the CREB-binding protein (CBP) in

vivo (74). This evidence suggests that the specific interaction of m-Htt with factors that

control transcriptional activation results in the early and progressive loss of striatal-

specific mRNAs in HD.

The cyclicAMP-responsive element (CRE) -mediated transcription pathway is

impaired in HD (11, 24, 75). CRE-mediated transcription is activated by the interaction

between phosphorylated CREB and CBP. This results in the recruitment of the

transcriptional machinery and initiates transcription. In HD, the transcriptional co-

activator CBP is recruited into m-Htt aggregates and leads to inhibition of CBP-mediated

transcription as well as cellular toxicity (41, 55). Overexpression of CBP can alleviate the

toxicity associated with the expression of m-Htt in a neuroblastoma cell line. In addition,

m-Htt can also sequester TAFIIl30, a critical regulator of CBP, CRE-mediated

transcription, into aggregates (14). These observations suggest that m-Htt expression can

block the proper targeting of the transcriptional machinery to CRE-dependent promoters

in affected neurons, resulting in the loss of transcriptional activity.









The interaction between m-Htt and regulators of transcription may provide

evidence of the "gain of toxic" function associated with the abnormally expanded pQ

domain in Htt. However, although the interruption on neuronal transcription happens

early in the evolution of the disease, the role that this plays in the molecular cascade

initiated by expression of m-Htt remains unresolved.

Transgenic Models of HD

The characterization of the mutation responsible for the neurological phenotype

observed in HD in 1993 led to the report of the first successful HD transgenic mouse line,

the R6 line, three years later (54). Since then, several transgenic and knockin lines have

been developed that accurately portray the progressive phenotype associated with HD (7,

72). All of these have in common the expression of an expanded CAG repeat although

they differ in the genetic context in which the abnormal expansion is expressed.

Importantly, the onset, rate of progression and severity of motor symptoms displayed by

these models are dependent on the number of repeats and the levels of m-Htt protein

expression. Of all the lines generated to date, the R6/1 and R6/2 transgenic lines remain

the best characterized.

In both patients and transgenic HD mice, the age of onset, disease progression and

severity of symptoms are correlated with the expression of m-Htt and the length of the

trinucleotide CAG repeat. The R6 HD transgenic lines, R6/1 and R6/2, were created by

inserting a transgene containing the 5'-untranslated region, exon1 with an expanded CAG

repeat, and part of the first intron of the human HD gene. This transgene is under the

control of the human HD promoter and generates a short N-terminal fragment with an

expanded pQ domain. Differences between the R6/1 and the R6/2 transgenic lines

include the length of the CAG repeat (R6/2 > R6/1) and the site of integration of the









transgene, thought to result in differences in the amount of protein produced (R6/2>R6/1)

(54, 72). R6/1 mice have a slower disease progression and a later onset of motor

abnormalities than the R6/2 mice. Previous work demonstrated that levels of m-Htt

protein are lower in the R6/1 mice compared to R6/2 and that neuronal intranuclear

inclusions (NIIs) form more slowly throughout the brain tissue in R6/1 compared to R6/2

mice (7, 54, 72). Therefore, the length of the polyglutamine tract encoded by the human

HD transgene and the relative levels of expression of the transgene affect the rate of HD

progression in these mice. The relatively slower rate of disease progression and longer

lifespan of the R6/1 mice make them more amenable for the study of slow acting

interventions. In this study, we focus on the use of R6/1 mice.

The R6/1 transgenic line is characterized by an early onset of pQ-associated

changes in neuronal function and a slow progression of motor phenotype. These mice

exhibit decreased striatal and total brain size; however reports of neuronal death have

been contradictory (7, 38). R6/1 mice also display ubiquitinated nuclear and cytoplasmic

neuronal inclusion bodies containing both mutant and wild-type Htt. Also, there is

increasing evidence of transcriptional dysregulation, which is modulated by the CAG

expansion and levels of transgene expression (36, 56). Finally, the expression of

expanded m-Htt results in the development of a neurological phenotype in 15 week-old

R6/1 mice, a much earlier time point than was initially reported. R6/1 mice exhibit

several behavioral abnormalities including gait disturbances, progressive clasping of the

hindlimbs and seizure activity, all associated with neuronal dysfunction (10, 58). Finally,

a failure to maintain body weight, as well as muscle wasting, has been reported.









toxic function




..l Jvsfunctio dlsfnc1



prgeso of disease. m-Htt fragmets lead to the formaionofnuna
intanulea iclupsios (NI whic nomal appear js rort hosto
sypos A b diga fdsaeporsini shon pin boatictomo h iue

Gain of Funcion vs. Los of Functio




patolgica13.Mlmechlanis thsatesls in H the developments of dieas. anye -ttwt molecule

pathwaysla thatin lead toneroa dysucioegnt phand cldethhave beaeny propsed; however,
the te poareatioonshi between theapses mcanisms and die as el sprorsion reman

controversial 6 4,7) Figcure -3s aNI phict oriall repreenatino js ro the dowsteamo

neuona consequence. ig of m-Htts exp ression. Inepnenl frmownsibtream effcs the iue

expessonof n epadedpQin m-Htntio is. drclys rso Fnstib or heelpeto

HD.However Htt's nral fuognictdisonr has reaiedelsve, greaclttly hinderin the

ineprethiatino dathans othaine fromt both ceellular nd nmlmdl of disease. Inn orderla


unerthandn o herl that both widtp admHt lyi neuronal dyfunction.adcl et aebenpooe;hwvr

t Themoa reet ata ons Htt'swild typse fuchncion and itsrole inneronalsio deeloment




and esurivnfal suppota mdel p in whichth los o wcld yefncini responsible for the dvlpeto


iepaetthoogia molecular poctiesso thath leadsa tod HDTismodl suggests tha dinhomozyg ote









individuals the absence of a wild-type HD allele may progressively lead to neuronal

dysfunction and eventual susceptibility to insults, while in heterozygote patients, mutant

Htt may act in a dominant negative fashion against the wild type allele, effectively

interfering with the normal cellular function of wild-type Htt. This idea is further

supported by the observation that wild-type Htt is also sequestered away into inclusion

bodies by mutant Htt and appears to be depleted in both humans as well as animal models

of HD (95).

In contrast, others favor the idea that the mechanism underlying the pathogenesis of

HD is the gain of a new toxic function associated with the pQ expansion in mutant Htt

(53). In support of this theory is the fact that individuals with a deletion in one HD allele

do not develop HD (Wolf-Hirschorn syndrome) (53) and the observation that there is no

significant difference in the severity of symptoms between homozygote and heterozygote

HD patients (3). In fact, there is a stronger correlation between the severity of symptoms

and the number of CAGs in the HD gene (29, 53, 90). Furthermore, as described earlier,

mutant Htt is involved in aberrant protein-protein interactions that result in a disruption

of normal neuronal processes in a time dependent manner. The fact that Htt' s normal

function remains elusive is a giant hurdle in the quest for the understanding of the

molecular underpinnings of HD. It is likely that both models described above act in

concert and are both responsible for the damage observed in HD. However, it is of vital

importance to fully dissect the contributions of each during the disease process as this

would lead to the development of more effective therapies such as those aimed at

reducing the levels of Htt expression in the brain.









Nucleic Acid-Based Gene Therapy

The genesis and progression of disease in dominant genetic disorders require the

expression of the mutant protein. In the case of HD, this concept was first demonstrated

using a mouse model that carried an expanded HD allele engineered to shut down its

expression under specific pharmacological conditions (91). This conditional model

showed that the expression of m-Htt was necessary to maintain the progression of disease

and that interruption of mutant Htt expression, while maintaining wild type levels of

normal Htt, led to a reversal of HD-like symptoms including a clearance of inclusions

and behavioral improvements. This observation led to the hypothesis that suppressing

mutant Htt activity would ameliorate the HD phenotype in affected individuals. Although

several pharmacology-based mechanisms may be employed to achieve suppression of

gene expression, nucleic acid-based methods (NABM) are the most potent, specific and

cost-effective way of achieving post-transcriptional suppression of m-Htt gene expression

(18, 81, 82). Recent advances in molecular design and intracellular delivery of nucleic

acids further enhance the application of NABM for the treatment of dominant

neurological disorders. There are three different NABM that result in post-transcriptional

gene silencing: anti-sense oligodeoxyribonucleotides (AODN), ribozymes and small-

interfering RNAs (siRNA). This study focused on the use of small self-cleaving

ribozymes and siRNAs in order to suppress m-Htt gene expression in vivo.

Ribozymes

Ribozymes are catalytic RNA molecules that mediate the sequence-specific

cleavage of other RNA molecules (34, 35, 48). Ribonucleotide enzymes (ribozymes)

catalyze the hydrolysis and phosphoryl exchange at the phosphodiester linkages between

RNA bases resulting in cleavage of the substrate. There are three main groups of









ribozymes which are classified as follows based on function and size: self-splicing

introns, Rnase P and small self-cleaving ribozymes (96). This study focused on the use of

small self-cleaving hammerhead ribozymes, naturally occurring enzymatic RNAs that

can catalyze the cleavage of RNA molecules in reactions that are devoid of proteins. The

most commonly studied small ribozymes include the hammerhead, the hairpin and the

hepatitis delta virus ribozymes (22, 48, 96). Of these three the hammerhead ribozymes

display great versatility as a tool for the study of gene function and disease.

Hammerhead ribozymes are approximately 34 base-pairs in length and can

mediate the cleavage of an RNA target in trans. The hammerhead ribozymes bind

substrate to form a structure that consists of a stem and three loops and a catalytic core

with a conserved nine- nucleotide sequence (96) (Fig. 1-4). Point mutations within the

conserved region prevent the cleavage of RNA. The hammerhead ribozyme cleaves the

substrate by a trans-esterifieation reaction, which is dependent on the presence of

magnesium and water. The enzymatic reaction results in the formation of two products

with distinct 3' (2'-3' cyclic phosphate group) and 5'ends (5'-hydroxyl group). Following

the cleavage of the RNA backbone, the reaction products diffuse away from the active

site leaving the ribozyme free to complete another reaction cycle. The hammerhead

ribozyme recognizes substrate sequences on either side of a NUX triplet cleavage site,

where N is any nucleotide and X is any nucleotide except G. The ribozyme anneals to the

mRNA substrate by means of two flanking arms, which hybridize to form helices III and

I (Fig 1-4). Cleavage occurs at the 3' end of the NUX site. There are varying degrees of

cleavage efficiency associated with the sequence of the NUX triplet. Cleavage occurs at

the 3' end of the NUX site.










3' S'
N\i
N\
N\



A GCAC
A GCGC lN N N NN-5'
G AjG L





Figure 1-4. The hammerhead ribozyme. The hammerhead ribozyme binds substrate to
form a structure, which consists of a stem and three loops and a catalytic core
(shaded box) with a conserved nine-nucleotide sequence. The NUX cleavage
site is indicated. The arrow denotes the site of bond cleavage.

There are varying degrees of cleavage efficiency associated with the sequence of

the NUX triplet. In general, the triplet GUC is the most efficient cleavage site, followed

by CUC, UUC and AUC (78). Other cleavage sites are cleaved at least 10 times less

efficiently than the GUC site (77).

The turnover characteristic of ribozymes provides them with an advantage over

standard antisense technology, which only inactivates the target RNA without degrading

it. Due to their size, catalytic properties and lack of cellular toxicity, hammerhead

ribozymes show great promise as tools in molecular medicine. In fact, the successful

application of hammerhead and/or hairpin ribozymes in the treatment of dominant

genetic disorders has been reported (48). Specifically, the use of hammerhead ribozymes

against mutant rhodopsin was shown to effectively protect against photoreceptor

degeneration in a mouse model of Retinitis Pigmentosa (47). Additionally, new gene

regulation systems are being developed which incorporate the use of regulatory

sequences called aptamers into existing hammerhead ribozymes (17, 68). This fusion of

these technologies allows for the design of drug-responsive ribozymes, which only









catalyze the cleavage of target RNA in the absence of a regulatory drug while becoming

inactive in the presence of the drug.

To date, ribozymes are being used in a variety of gene transfer strategies including

the suppression of viral infection as well as in anti-oncogene strategies aimed at

correcting cancer associated with genetic defect (22, 48, 96). The ease with which

hammerhead ribozymes can be designed and regulated, coupled with the recent advances

in viral gene delivery systems, give these small versatile molecules great potential as

therapeutic agents.

RNA Interference

During recent years a new technology, called RNA interference (RNAi), has

completely revolutionized the study of gene function and the design and application of

nucleic acid-based therapies aimed at the silencing of disease-associated gene expression.

RNA interference is an innate cellular process associated with immune surveillance as

well as the regulation of gene expression during development in mammalian cells (82).

This mechanism specifically responds to the presence of double-stranded RNA (dsRNA)

molecules and directs the activity of post-transcriptional processes that lead to the

sequence-specific inhibition of genes with complementary sequence to the dsRNA

molecule (18). During RNAi, dsRNA molecules are rapidly processed by an enzyme

called DICER into small duplex RNA molecules of 20 to 21-nucleotides in length called

small-interfering RNAs (siRNA). Unidentified components of the RNAi machinery

recognize and incorporate a single strand of the siRNA molecule into a ribonucleo-

protein complex called the RNA-induced silencing complex (RISC) (82, 83). RISC can

then survey the mRNA population in order to mediate the sequence-specific cleavage of a

target mRNA (Fig. 1-5).





















Fiue15 h N iptwa.Itaellrsothiri N saepoesdb

DICR 1)int sml-itrfrin RN oeue sRA.sR 7r
loddinoarioulopoen nye op cale IC() h
RIS/iN copecameitthseuneseicclaaeo a n N
moeul 3) hi eulsinte erdain fth la ve N yclua

nuc leses (luta ionb rc .Rdiuz
Thsprcsscn eepeienalymnpuaedb itodcn snhei sR;

inote el wihae hninoprae no ICan eiaetesiecngo h

exeiena ee fitret(8. motnty nmamlncels the sizeo h iN






death (83). Adtio nA allmthods. fo intracellular exrsino short-hairpin RNAs aepoesdb
(shRNA) E deivre as t plsmaid vetrs ae beng rN ecnly eveoe (16,A) 18).~ shRN




art te exprsse asic fl-ack sthem-lnoropsructure nomprisadedit of a senseandano atisens









strand and separated by a non-complimentary loop. The transcription of shRNAs is

normally placed under the control of RNA polymerase III, which is capable of generating

a transcript with a specified 3'-end terminal shown to be required for efficient silencing

activity (18). Once transcribed by the nuclear machinery, shRNAs are exported into the

cytoplasm, processed by DICER into functional siRNAs and incorporated into RISC.

Unlike anti-sense oligodeoxyribonucleotides (AODN) and ribozymes, siRNAs

achieve the silencing of genes through an endogenous host-cell, anti-viral defense

mechanism that has had the opportunity to evolve and become highly efficient over time.

Additionally, siRNAs act in concert with the RISC protein complex, which results in

increased stability and a more efficient capacity to turn over (18). Also, the stability of

RNA duplexes allows for siRNAs to be readily delivered into cells and makes it possible

to achieve biologically relevant concentrations inside the cell. Furthermore, low

concentrations of highly active siRNAs have been shown to induce long-term gene

silencing (82), making these molecules more pharmacologically attractive than either

AODNs or ribozymes. However, although this is a potent molecular tool, RNAi is a

relatively new and developing technology and unintended effects already known to be

associated with it, such as changes in expression of non-targeted genes, must be carefully

considered.

Gene Delivery in the CNS

Viral as well as non-viral vectors can be used to deliver therapeutic genes directly

into the central nervous system (CNS) in a process termed in vivo gene transfer. Although

non-viral vectors circumvent some of the potential toxic problems associated with viral

vectors, it has been difficult to achieve and maintain high levels of transgene expression

(43, 65). Viral vectors were designed based on the natural ability of viruses to infect,









transfer and express their genetic material in host cells. When compared to non-viral

delivery methods, viral vectors are capable of mediating longer, more widespread and

intense transgene expression in the CNS (16, 42, 64). The successful application of viral

vectors in the CNS depends on the vector' s capacity to mediate long-term transgene

expression in non-dividing cells. In addition, the immunogenecity associated with the

natural life cycle of the chosen vector most be assessed. Although different viral vectors

have been successfully used in the CNS, our study focused on the use of recombinant

Adeno-Associated viruses (rAAV).

The first rAAV vectors were described approximately 20 years ago (37). Since

then, their use has revolutionized the study of genetic disease in the CNS by allowing the

temporal and somatic regulation of gene expression (6, 8). AAV recombinant vectors are

small, single-stranded DNA viruses capable of infecting both dividing and non-dividing

cells (8, 37). Wild-type AAV is a non-pathological member of the parvoviridae family

able to integrate its genome into the host' s DNA. In contrast to its wild-type counterpart,

rAAV integration events seem to occur less frequently and more randomly (1, 21, 43).

rAAV vectors promote stable, long-term transgene expression in the CNS (4, 8).

Moreover, CNS exposure to rAAV capsid proteins does not lead to cellular toxicity.

However, the presence of circulating antibodies can block rAAV transduction and can

mediate a cellular immune response upon re-administration of the vector (86). Recently,

three different pseudo-typed rAAV vectors (rAAV-1, rAAV-2 and rAAV-5) where found

to efficiently transduce various regions of the rat CNS (13). The use of different pseudo-

typed rAAV vectors allows for the development of protocols that can circumvent the










immunological problems associated with circulating antibodies and vector re-

admini strati on.

The remarkable ability of rAAV vectors to efficiently transduce and sustain the

long-term expression of genes in neuronal tissue, with negligible induction of the

immune response, have led to the development of a variety of clinical protocols aimed at

the treatment of CNS disorders. Some of these gene transfer strategies include gene

replacement in Canavan's disease, Parkinson's disease and lysosomal storage disorders

(15). Also, rAAV-based strategies for the delivery of neuroprotective factors in

Alzheimer' s, Huntington's and amyotrophic lateral sclerosis (ALS) have been reported

(80). In conclusion, rAAV vectors can efficiently deliver genes into the CNS. rAAV

holds the promise as the future vector of choice for the delivery of therapeutic genes in

the clinic.















CHAPTER 2
RIBOZYME-MEDIATED REDUCTION OF STRIATAL MUTANT HIUNTINGTIN INT
VIVO

Introduction

The progressive striatal pathology observed in Huntington's disease patients is

caused by the expression of an abnormally expanded poly-glutamine (pQ) domain in N-

terminus of the ubiquitously expressed protein termed huntingtin (Htt) (29, 53). The

uninterrupted expression of m-Htt is necessary for the genesis and evolution of HD as

shown by a conditional transgenic mouse model expressing a CAG expanded HD

transgene under the control of the tetracycline promoter (92). In this model,

transcriptional suppression of m-Htt expression, in both cortical and striatal regions of the

brain, led to a reversal of cellular and behavioral HD-like phenotype. However, the effect

that reduced striatal levels of m-Htt would have on the phenotype of transgenic HD mice

has not been assessed. We hypothesized that post-transcriptional knockdown of m-Htt

should lead to an amelioration of the HD-like phenotype in the R6/1 transgenic mouse

line. In vitro studies have demonstrated that anti-sense oligodeoxyribonucleotides

directed against an expanded human HD allele can mediate the suppression of m-Htt

protein expression in cultured cells (9, 33, 59). Similarly, DNA-enzymes, which are

composed of a ribonucleotide catalytic frame placed in between deoxy-ribonucleotide

hybridizing arms, were successfully used against m-Htt mRNA and resulted in specific

suppression of m-Htt protein expression (93). These data suggest that, unlike other










proteins such as those involved in cell signaling, reduced intracellular levels of m-Htt do

not induce HD promoter activity. More importantly, they demonstrate that the secondary

structure of m-Htt mRNA contains biologically accessible regions for Watson-Crick base

pairing. However, the application of these two technologies in in vivo models of HD is

limited. First, high intracellular concentrations of anti-sense oligo-deoxy-ribonucleotides

are required in order to achieve significant reduction of protein expression in vivo (9, 96).

This leads to cellular toxicity and the induction of the immune response. Addionally,

anti-sense molecules are fairly unstable and the mechanism by which they mediate gene

silencing is currently unknown. Also, the efficient in vivo delivery and long-term

expression of anti-sense molecules and DNAenzymes, which cannot be encoded for,

represents a challenge that is not easily surmounted.

Hammerhead ribozymes are RNA enzymes that can be targeted to catalyze the

cleavage of a specific RNA molecule (5, 48, 96). High intracellular concentrations of

hammerhead ribozymes are not toxic and can be achieved with vector-based expression

systems (34, 47, 48). Ribozymes against the untranslated 5'end region of the HIV-1

genome have been shown to inhibit virus replication (5). Moreover, rAAV-mediated

delivery of a hammerhead ribozyme against mutant rhodopsin mRNA resulted in the

rescue of photoreceptors in a mouse model of retinitis pigmentosa (47). These results

suggest that hammerhead ribozymes can efficiently mediate the knockdown of target

RNAs in vivo.

In this study, we examined the effects of ribozyme-mediated post-transcriptional

suppression of striatal m-Htt in the R6/1 mouse. We specifically assessed whether rAAV-

ribozyme expression could affect the transcriptional dysregulation phenotype that is









associated with the expression of m-Htt in the R6/1 mouse striatum. hz vitro screening of

ribozymes against the HD transgene expressed in the R6/1 mouse resulted in the

identification of two highly active ribozymes. Surprisingly, rAAV-mediated expression

of these two ribozymes in the striatum of either R6/1 or age-matched wild-type mice

resulted in a marked decrease in the steady-state levels of pre-pro-enkephalin (ppEnk),

dompamine- and cAMP-regulated phosphoprotein of 32 kDa (DARPP-32) and the

dompamine receptor type-2 (D2R) mRNAs. We report that ribozymes targeting a region

just upstream of the CAG repeat domain in the human Htt mRNA mediate the cleavage

of an unidentified RNA molecule critical for neuronal function and survival.

Materials and Methods

Defining Target Sites

Target sites containing a GUC (HD6 and HD7), CUC (dsCAGl) or UUC

(dsCAG2) cleavage site were chosen from the human exon 1 Htt mRNA sequence

(Genbank accession number L273 50). Target regions with six nucleotides on either side

of the arms consisting of a 50% GC content were selected since an ideal length for the

target region is between 6-7 nucleotides. The presence of a U/A at the 3' cleavage site

also enhances the kcat ten fold. Selected target regions were examined using the RNA

folding algorithum designed by Micheal Zucker (REF) The folding program was used to

fold 100-200 nucleotides on either side of the NUX cleavage site to determine whether

the ribozyme binding location was acceptable. A BLAST search was also conducted to

ensure the absence of target sites on any other known human or mouse mRNA sequence.

Preparation of Short Ribonucleic Acid Target

The target oligonucleotide to be used in the cleavage reactions was radioactively

labeled at the 5'end using T4 polynucleotide kinase (New England Biochmeicals;









Beverly, MA). The reactions were set up as follows: 2C1l of the RNA target oligo

(10pmol/CIl, 20pmol total)(Dharmacon, Boulder, CO) was added to a mixture containing

lul of 10X polynucleotide kinase buffer (Promega, Madison, WI), lul RNASin

(Promega, Madison, WI), lul 0.1M DTT (Sigma, St. Louis, MO), 3 Cl water, 1Cl1 (gamma

32P) dATP (10uci) (ICN, Santa Clara CA) and 1Cl1 of polynucleotide kinase (5 units)

(Sigma, St. Louis, MO). The reaction was incubated at 37 OC for 30 minutes. 90C1l of TE

(Fisher, Swanee, GA) was added to the reaction prior to extraction of the unincorporated

nucleotides. A spin column (1ml syringe) was prepared with sterile glass wool and loaded

with sephadex (Sigma, St. Louis, MO) saturated in water. The column was centrifuged at

1000 RPM for 5 minutes to remove any excess water and to further pack the sephadex.

The 32P labeled target (100pl1) was loaded on to the column. The column was sealed with

parafilm and centrifuged again at 1000 RPM for 5 minutes. The labeled elute was

collected in a 1.5ml Eppendorf tube (Fisher, Swanee, GA) and was stored at -20 OC.

Time Course Analysis

Time course analysis was done by setting up a cleavage reaction as follows: 13C1l of

400mM Tris-HCL (Fisher, Swanee, GA), pH 7.4-7.5 were added to lul ribozyme

(2pmol) (Dharmacon, Boulder, CO) and 88ul of water. In order to properly fold the

ribozyme synthetic RNA, the above mixture was incubated at 65 OC for 2 minutes and

then left at room temperature for 10 minutes. 13 Cl of a 1:10 ratio of RNasin: 0. 1M DTT

was added to the reaction mixture along with 13 Cl of 200mM MgCl2 (20mM final)

(Sigma, St. Louis, MO). The reaction was incubated at 37 OC for 10 minutes. 1Cl1 of the

32P labeled (0.2 pmol) and 1Cl1 of unlabeled target (20pmol total) were premixed and

added to the reaction mixture at 37oC. For each time point, 10 Cll of the reaction mixture

was removed from 37 OC and added to a tube containing 10ul of formamide dye mix










(90% formamide (Sigma, St. Louis, MO), 50mM ehtylenediamine tetra acetic acid

(EDTA) pH 8 (Fisher,Swanee, GA), 0.05% bromophenol blue (Sigma, St. Louis, MO),

and 0.05% xylene cyanol (Sigma, St. Louis, MO). The samples were initially placed on

ice and then heat denatured at 90 OC for 3 minutes. The denatured samples were cooled

on ice before loading 6 Cll onto a 10% PAGE-8M urea gel to separate the products.

Bromophenol blue band was run about 2/3 down the gel. The gels were analyzed on a

molecular dynamics phosphoimager.

In Vitro Transcription of m-Htt mRNA

The human expanded HD transgene expressed in R6/1 mice was amplified from

genomic DNA using the sense primer HDPCR1 (5' -agggctgtcaatcatgctggc-3 ') and

antisense primer HDPCRla (5' -tctgggttgctgggtcactctg-3 '). This PCR fragment was

cloned into the TOPO TA vector following manufacturer's protocol (Invitrogen, San

Diego, CA). A HindIII / NotI fragment from the TOPO-R6/1 vector was cloned into the

pRC/CMV (Invitrogen, San Diego, CA) plasmid in the forward orientation with respect

to the cytomegalorivus immediate early promoter and a putative bacterial T7 promoter

sequence. Radio-labeled transcripts were generated using Ambion's MAXIscript In Vitro

Transcription Kit following manufacturer's instructions (Ambion, Austin, Tx).

Transcripts were kept frozen at -20 oC. Time course analysis was done with a ratio of

ribozyme to transcript of 5:1. Reaction conditions were similar to those described above.

Cloning of Ribozymes into rAAV Vectors

Two complimentary DNA oligonucleotides (Invitrogen, San Diego, CA) were

annealed in order to produce a double stranded DNA fragment coding for each

hammerhead ribozyme. All DNA oligonucleotides were synthesized with 5'phosphate

groups. The DNA oligonucleotides were designed to generate a cut HindIII site at the









5'end and a cut Nsil site at the 3' end after annealing. The DNA oligonucleotides were

incubated at 90 OC for 2 minutes and annealed by slow cooling to room temperature for

30 minutes. The resulting double stranded DNA fragment was ligated into the HindIII

and Nsil sites of the rAAV vector pTRUF-12 (UF vector Core,

http://www.gtc.ufl .edu/gtc-home.htm). A self cleaving hairpin ribozyme has been cloned

downstream of the inserted hammerhead ribozymes into a downstream Clal site.

Expression of the ribozyme cassette was placed under the control of the CMV, chicken-

beta-actin chimeric enhancer-promoter. The ligated plasmids were transformed into

SURE electroporation competent cells (Stratagene, La Jolla, CA) in order to maintain the

integrity of the rAAV inverted terminal repeats. Ribozyme clones were sequenced in the

University of Florida' s DNA sequencing core (ICBR).

Human Embryonic Kidney 293 Cells

HEK 293 cells were obtained from American Type Culture Collection (ATCC)

(Manassas, VA) and plated onto a 150 mm tissue culture dish. The cells were allowed to

attach and grow to about 80% confluency. To ensure a homogenous population of HEK

cells, the morphology of the HEK cells was recorded using a Zeiss microscope (Zeiss,

Goettingen, Germany).

Transfections using Lipofectamine on HEK 293 Cells

HEK 293 cells were obtained from the American Type Culture Collection (ATCC)

(Manassas, VA) and plated onto a 150 mm tissue culture dish. HEK 293 cells were fed

with lX high glucose Dubellco's modified Eagle medium (Invitrogen, San Diego, CA)

containing 5 % fetal bovine serum (Invitrogen, San Diego, CA) twice weekly. The cells

were cultured at about 80% confluency at which time they would be split on a 1:10 ratio.

For transfection experiments, HEK 293 cells (ATCC, Manassas, VA) were seeded onto a









10-cm CorningTM tissue culture dish and allowed to attach and grow to 70-90%

confluency. LipofectamineTM and PlusTM reagents (Invitrogen, San Diego, CA) were used

for the transient co-transfection of pCMV-R6/1 and rAAV-ribozyme expression vectors

at a 1:5 or 1:10 pCMV-R6/1 to rAAV-ribozyme ratio. In order to control for transfection

efficiency, 293 cells were also co-transfected with pCMV-R6/1 and a pTR-UF 11

(rAAV-GFP) GFP vector at the same ratios. GFP expression was determined using a

fluorescence microscope at 24hr and 48hr. Cells were harvested 48hr post-transfection

RNA Isolation and Northern Analysis

Total RNA was isolated from HEK 293 cells by using the TRlzol reagent

(Invitrogen, San Diego, CA). Northern blot analysis was performed using standard

techniques. Briefly, 25 Cg of total RNA were separated on a formaldehyde-containing 1.2

% agarose gel. Fractionated RNA was then transfer unto Hybond N+ membranes using

alkalize transfer and probed with a 32P product of a Hindlll/Agel digest of the pCMV-

R6/1 vector (~ 150-bp of sequence spanning the 5'UTR and ATG translational start

sites). Sample loading was normalized by stripping and re-probing the same membranes

with a probe that recognizes nucleotides 150-270 of the human p-actin mRNA. Blots

were exposed to phosphoimager-ready intensifying screens and intensity of bands was

measured using a Phosphoimager scanner (Molecular Dynamics)

rAAV Vector Production

All rAAV vector preparations used in this study were made by the University of

Florida Vector Core facility (Powell Gene Therapy Center). Briefly, rAAV vector is

produced in human HEK 293 cells by transient CaPO4 precipitation-mediated co-

transfection of the rAAV expression vector plasmid and a helper-plasmid that encodes

the AAV rep and cap genes along with certain adenovirus genes (26). After 72 hours,









cells are harvested and stored at -80 oC. Cell are resuspended in 0.5% sodium

deoxycholate in 20 mM Tris, pH 8.0 and 150mM NaC1, treated with benzonase, and

cellular membranes are disrupted by three cycles of repeated freeze-thaws. Crude lysates

are purified using affinity chromatography, followed by cation exchange

chromatography. The Einal product is concentrated to a Einal titer of 1-5 X 1013 genOme

copies per ml.

R6/1 Transgenic Colony

Animal experiments were performed in the laboratory of Eileen Denovan-Wright,

PhD (Dept of Pharmacology, Dalhousie University, Halifax, Nova Scotia, Canada).

Transgenic R6/1 HD mice were originally obtained from Jackson Laboratories and

breeding colonies were maintained at Dalhousie University. R6/1 males were crossed

with unrelated CBAxC57BL/6 females. After weaning, the mice were group housed

under 12 h light-dark cycle with ad libitum access to food and water. All mice were

genotyped at 3 weeks of age and at the time of death by amplifying a region of the human

huntingtin transgene using primers 5' AGG GCGT GTC AAT CAT GCT GG 3' and 5'

GGA CTT GAG GGA CTC GAA 3'. These primers correspond to a region upstream of

the CAG repeat at nts 77-96 and 347-364, respectively, of human huntingtin (Genbank

Accession number XM 003405). DNA was extracted from ear punches that were

digested with Proteinase K and used as the substrate for PCR using the REDExtract-N-

Amp Ready Mix (Sigma). Animal care and handling protocols were in accordance with

the guidelines detailed by the Canadian Council on Animal Care and were approved by

the Carleton Animal Care Committee at Dalhousie University.










Surgical Procedures

Isofluorane was delivered by inhalation to anesthetize the mice. After induction of

anesthesia, the mice were placed into a sterotaxic frame (Kopf Instruments, Tujunga,

CA). All injections were performed using a continuous infusion system (Carnegie

Medicin, Sweden), attached to a 10 Cll Hamilton microsyringe fitted with a glass

micropipette with an outer diameter of 60-80 Clm (Mandel et al., 1999). The anterior-

posterior (AP) and medial-lateral (ML) stereotaxic coordinates were calculated from

bregma and the dorso-ventral (DV) coordinates were calculated from the dural surface.

A burr hole was drilled in the skull at the calculated AP and ML coordinates. Mice

received intrastriatal inj sections of rAAV2 or rAAV5 expressing HD6 or HD7 or GFP

suspended in phosphate-buffered saline (PB S) at a dose of 2 Cll/site and an infusion rate

of 0.5 Cll/min. During the infusion of rAAV, the glass pipette was slowly retracted 1 mm

every min. One minute after the cessation of the infusion, the micropipette was retracted

an additional 1 mm, allowed to remain at this position for 4 min and then slowly retracted

from the brain. The stereotaxic coordinates used for two injections within the same

striatum were: Site 1: AP = +1.0, ML = + 1.8, DV = -3.3; Site 2: AP = +0.4, ML = + 2.1i,

DV -3.4. The DV coordinate was calculated with the tooth bar set at 0.0 mm.

Tissue Processing

Ten-weeks after the intrastriatal infusion of rAAV, the mice were deeply

anesthetized with sodium pentobarbital (65 mg/kg i.p.) and decapitated. The brains were

removed and frozen at -70oC. Tissue sections (14 Clm) were cut using a Micron cryostat

through the rostral-caudal axis of the striatum, thaw-mounted onto Fischer SuperFrost

slides and stored at -70oC. For each slide, 5 sections, each separated by approximately










3 50 Clm, were placed on a single slide. This distribution of tissue was used to ensure that

each slide contained sections taken throughout the anterior-posterior regions of the mouse

stniatum.

In Situ Hybridization Analysis

In situ hybridization was performed on coronal sections (Bregma +1.70 to -0.50;

Franklin and Paxinos, 1997) of mouse brains using radiolabeled antisense gene-specific

oligonucleotide probes. Frozen sections were allowed to reach room temperature, fixed

with 4% paraformaldehyde in lX phosphate-buffered saline (PBS) for 5 min, rinsed

twice for 3 min in lX PB S, once for 20 min in 2X sodium chloride-sodium citrate (SSC),

and then air dried. Each slide was covered in 200 ul of hybridization buffer (50%

deionized formamide, 5X SSC, lX Denhardt' s reagent, 0.02 M sodium phosphate, ph

6.8, 0.2% SDS, 5 mM Na2EDTA, 10 ug/ml Poly(A)n, 10% dextran sulfate, 50 ug/ml

salmon sperm DNA, 50 ug/ml yeast tRNA) containing ~1 x 106 c.p.m./ml of

oligonucletide probe that had been 3' end-labeled with [ot-33P]dATP for 90 min at 37oC

using terminal deoxynucleotidyl transferase (Promega). Prior to use, unincorporated

nucleotides were removed from the labeled probes using a Sephadex G-25 spin column

(Pharmacia). The slides were coverslipped with parafilm and incubated overnight at 420C

in a humidified chamber. The coverslips were removed in 2X SSC and the slides were

washed for four times for 30 min at 550C in lX SSC, four times for 30 min at 550C in

0.5X SSC, two times for 30 min at 550C in 0.25X SSC, then rinsed briefly in H120 and

allowed to air dry overnight. Slides were exposed to Kodak Biomax MR film for up to 4

weeks at room temperature. The hybridization signals were analyzed using Kodak 1D

Image Analysis Software as described in Hebb et al. (2004). The sequences of the probes









used were: ribozyme probe (5'-cttacaccc cactcgtgcaggctgcccaggg-3 '), ppEnk

(5 'tctgcatccttcttcatgaaaccgccatacctcttggcaaca-'), DARPP-32 (5'-

tecacttggtcctcagagttgccatctctc-3 '), NGFi-A (5' -ccgttgctcagcagcatgatgtc

ctccagtttggggtagttgtcc-3 '), D2 receptor (5' -ggcagggttggcaatgatacactcattctggtcttgatt-',-

acti n (5 '-ggcgatccacacggagtacttgcgctcagg aggagcaatgatct-3 ') .

Results

Time Course of Ribozyme Cleavage

We initially screened ribozymes that were directed against four different regions along

the mRNA sequence of the human HD transgene expressed in the R6/1 mouse. Figure 2-

1A is a schematic of all four ribozymes and their target sequences. HD6 and HD7

ribozymes (Rbz) were targeted to unique and overlapping sequences that lie between the

ATG translational start site and the polymorphic CAG repeat domain. dsCAG1 and

dsCAG2 were targeted to unique sequences immediately downstream of the expanded

CAG domain (Fig. 2-1B). Time course analysis of target cleavage was done for the HD6,

HD7, dsCAG1 and dsCAG2 hammerhead ribozymes as described in the methods section.

Figure 2-2 shows autoradiographs from 10% polyacrylamide-8M urea gels used to

separate the products of cleavage of each of the four ribozymes and their targets

following reactions performed at 37 OC and at 20mM MgCl2. The autoradiographs show

an increase in the 5'cleaved products over time and a corresponding decrease in the levels

of target. Significant product accumulation was detected almost immediately after the

addition of target to the reaction. Figure 2-2B shows a graphical representation of the

percent of product cleaved as a function of time for all four ribozymes tested. This

analysis demonstrated that HD6, HD7 and dsCAG1 could mediate the efficient cleavage










(~90% at the 10 minute time point) of target RNA in vitro. In contrast, dsCAG2 Rbz was

unable to cleave more than 5% of its target after 60 minutes of reaction time.

HD6, HD7 and dsCAG1 Activity Against In Vitro Transcribed m-Htt mRNA

Success of ribozyme-mediated suppression of gene expression requires the identification

of RNA target sites that are not masked by intrinsic RNA secondary structures. Although

algorithms such as the M-fold program predict RNA secondary structure, determining the

bio-availability of target sites requires an experimental approach. To examine the

accessibility of target sites, we cloned the expanded human HD transgene that is

expressed in the R6/1 mouse into a pRC/CMV (Invitrogen) expression vector (pCMV-

R6/1). This vector can drive both in vitro and in vivo transcription of the cloned gene. We

generated in vitro transcripts of the R6/1 transgene and performed cleavage reactions

under identical conditions as described for the short-target time course cleavage reaction

(see methods section). Figure 2-3A shows autoradiographs from 5% polyacrylamide gels

used to separate the products of cleavage of both HD6 and HD7 Rbz following

incubation with the R6/1 derived m-Htt transcript. Significant product accumulation from

the HD7 Rbz reaction was initially detected 15 minutes after the addition of Rbz to target

(Fig 2-3A, HD7 Rbz lane 1). There was an increase in the accumulation of the expected

size product over time. In contrast, HD6 Rz mediated cleavage of m-Htt mRNA in vitro

was not as efficient as the one observed with HD7 Rz (Fig 2-3). Nevertheless, the

accumulation of product of the expected size suggests that this target site is available for

binding and cleavage. In fact, as shown in Eigure 3-1B, HD6 and HD7 Rz have

overlapping sequences. The small but significant














A.


UICGCAGUIICC CUCA
AGCUCA GGAGU
A CUG
^ G
AG AGU
CG
AU 1
OC
AGj CG
AA


HD 6



GCCUCCUUCACUUUC
CGGUGGA UCGAAG
A CUG
IA
AG AGU
CG
AU
GC
AA


dsCAG1


UCAAGUCCUUCC
AGUUICA GAAGG
A CG

UCG
AU
GC
AGCG
AA


HD7



CUCAGCUUCCUCAGC
GAGUCGAA GAGUCG
liA
AG AG
CG
AU
GjC
GCI
AG(
AA


dsCAG2


B.


Figure 2-1. Ribozyme design. Four ribozymes were designed to target unique sequences
in the human HD exon 1. In (A) ribozymes are shown annealing to their target

sequences with the NUX triplet depicted in color. B. Illustration of the four
target sites in relation to the CAG triplet repeat domain in human HD exon 1.


difference in turnover activity between these two Rbz might be explained by factors


influencing the release of product. dsCAG1 Rbz was unable to mediate the cleavage of


m-Htt transcript in vitro. This lack of enzymatic activity was likely due to the inability of


dsCAG1 Rbz to properly bind to its target site within the context of m-Htt RNA' s


secondary structure.






















































8 ~
P,


/
--
0' i 10' IS' 30' 60' 120'


Time (mins) O' 5' 10' 30' 60' 120' 180' O/N


Target L "


O' 5' 10' 30' 60' 120' 180 O/N


a



.@><**%-


HD7


goa **


Product


H"D 6


0' 15' 30' 60' 120' 180' O/N


Time (mins) O 2 5' 10 30' 60 120' 180' O/N



Target *r at


Product *




dsCAG1


Time (mins)


Figure 2-2. Time course cleavage analysis. A. Autoradiographs from 10% acrylamide
gels used to separate the product of the reaction from the target. Target signal
decreased while a corresponding product signal accumulated as a function of
time. B. Graphical representation of the reactions shown above. Data is
presented as percent target cleaved. Ribozymes HD6 (closed circles), HD7
(open triangles) and dsCAG1 (closed triangles) were capable of cleaving >
80% 10 mins into the reaction while dsCAG2 was much slower (closed
circles).


dsCAG2












HD6

m-Htt transcript









12 34 5


HD7












12 34


I 23456


m-Htt mRNA
1111I
GFP HD6 HD7

b-actin mnRNA L ---




Figure 2-3. Target accessibility. A. Autoradiographs from 5 % acrylamide gels separating
the products of a time course analysis of two highly active ribozymes, HD6,
HD7. Both ribozymes were incubated with an in vitro transcribed human HD
exon1 transcript (top left arrow) to determine the accessibility of the target
sites within the context of a folded RNA molecule. Lanes 2-through-4 are the
15, 30, and 60 min time points for each reaction. Lane 1, in both
autoradriographs, is a 60 min time point of a reaction that was devoid of
ribozyme. Expected size products for both HD6 and HD7 accumulated over
time (top and bottom right arrows). HD6 Rbz was less active against the in
vitro transcribed human HD exon1 transcript (Lane 5 is an overnight
incubation time point). Panel (B) is a northern blot analysis (top
autoradiograph) of m-Htt mRNA. Total RNA was obtained from HEK 293
cells that were transiently co-transfected with pCMV-R6/1 (m-Htt) and either
a GFP, HD6 or HD7 expression plasmid. Increasing the concentration of HD6
Rbz vector from a 1:5, target to ribozyme ratio (lane 3), to a 1:10, target to
ribozyme ratio (lane 4), resulted in an increase in activity as determined by the
intensity of the m-Htt mRNA band. HD7 Rbz activity against m-Htt mRNA












Figure 2-3 continued

remained constant at either 1:5 (lane 5) or 1:10 (lane 6) target to ribozyme
ratio. The same blot was probed with a p-actin probe to normalize sample
loading. Both ribozymes reduced m-Htt mRNA levels by > 60% when
compared to controls.









HD6 and HD7 Ribozyme Activity Against m-Htt mRNA Inz Vivo

We next examined the activity of HD6 and HD7 Rbz against m-Htt mRNA in

cultured HEK293 cells. HD6 and HD7 Rbz were cloned into a rAAV vector specifically

engineered for the intracellular expression of HH Rbz (Figure 2-4A). This expression

cassette generates a transcript that is processed by a self-cleaving hairpin ribozyme

strategically placed downstream of the sequence encoding for either HD6 or HD7 Rbz.

The self-cleaving activity of the hairpin ribozyme results in the release of a small HH

Rbz-containing RNA and a transcript with an internal ribosomal entry site (IRES)

sequence to facilitate the translation of the downstream GFP sequence.

In order to test the activity of these Rbz against m-Htt mRNA in culture, HEK293

cells were transiently co-transfected with CMV-R6/1 and either rAAV-HD6 or rAAV-

HD7 Rbz vectors. Northern blot analysis of total RNA obtained forty-eight hours post-

transfection showed a significant decrease (>60% of control) in the levels of m-Htt

mRNA in samples obtained from both rAAV-HD6 and rAAV-HD7 transfected cells (Fig.

2-3B). This decrease was not evident in cells that were co-transfected with a rAAV-GFP

expressing vector. Interestingly, increasing the rAAV-HD6 Rbz to target ratio from 1:5 to

1:10 resulted in a significant increase in cleavage activity (Fig 2-3B lanes 3 and 4).

In2 vivo Activity of rAAV-HD6 and rAAV-HD7 Ribozymes

The focus of this study was to evaluate the effects that reduced striatal levels of

m-Htt would have in the striatal-specific transcriptional dysregulation associated with the

expression of m-Htt protein in the R6/1 mouse model of HD. Initially, we generated

rAAV type 2 (rAAV2) particles encoding for HD6, HD7 or GFP control (see Methods).

Intrastriatal inj sections of high-titer rAAV2 resulted in intense and localized transduction

of the mouse striatum (Fig. 2-4B). Although the levels of viral expression attained with















GFP


IRES GFP


Self-Cleaving Rbz
Exon
/IRES

RbzC


J \u


rAAV5


Figure 2-4. In vivo expression of rAAV ribozyme vectors. (A) Diagram depicting the
ribozyme expression cassette that was packaged into rAAV viral particles. A
hairpin self-cleaving ribozyme (self-cleaving Rz), placed immediately
downstream from the HD6 and HD7 cloning sites, was used to mediate the
processing of the primary Rbz-containing transcript. B. In situ hybridization
analysis of the viral RNA transcript was done on coronal sections obtained
from mice inj ected with either rAAV2 or rAAV5-HD7 vector. The ribozyme-
specific probe was allowed to hybridize with the sections under identical
conditions.



rAAV2 were remarkably high, the feasibility of this study was dependent upon extensive

striatal transduction. We therefore generated rAAV viral vectors pseudotyped with the

capsid from rAAV serotype-5 (rAAV5) encoding for HD6 (rAAV5-HD6 Rbz), HD7

(rAAV5-HD7 Rbz) and GFP (rAAV5- GFP). Our rationale was based on a recent elegant


b-actin Exon1 Active Rbz












rAAV2










study showing that intrastriatal delivery of rAAV5 particles in the rat brain results in a

larger transduced area when compared to rAAV2 vectors (13). Intrastriatal delivery of

rAAV5-HD6 or HD7 Rz in R6/1 and age-matched wild-type mice resulted in a dramatic

increase in the brain transduced area when compared to rAAV2 particles as demonstrated

by in situ hybridization (ISH) analysis using a Rbz-specific probe (Fig. 2-4B).

To determine the in vivo activity of rAAV5-HD6 and rAAV5-HD7, R6/1 and

age-matched wild-type littermate controls were divided into the following experimental

groups: rAAV5-HD6 (R6/1 n=8, wild-type n=5), rAAV5-HD7 (R6/1 n=8, wild-type n=5)

and rAAV5-GFP (R6/1 n=5, wild-type n=5). Six week-old mice were injected

unilaterally at two different striatal sites in the right hemisphere while the left hemisphere

remained uninj ected and served as control (Fig 2-4B). Ten weeks post-surgery fresh

frozen brains were obtained, sectioned and maintained frozen throughout the remainder

of the experiment.

Biological Effects of rAAV5-HD6 and HD7 Ribozyme Expression in the R6/1 Mouse
Striatum

Alterations in gene transcription occur prior to the display of motor abnormalities

in the R6/1 mouse ofHD. Striatal-specific genes known to be downregulated in HD

include the dopamine-, cAMP-regulated phosphoprotein of 32 kDa (DARPP-32), pre-

pro-enkephalin (ppEnk), nerve growth factor-inducible A (NGFi-A) and the dopamine

type-2 receptor (D2R).Reduction in the steady-state mRNA levels of these transcripts is

both progressive and modulated by the length of the expansion repeat and the expression

levels of m-Htt. Thus, ribozyme-mediated knockdown of m-Htt expression should lead to

an increase in the transcript levels of ppEnk, DARPP-32, D2R and NGFi-A.









To test this hypothesis, we performed in situ hybridization analysis with probes

specific to either NGFi-A, DARPP-32, ppEnk and D2R mRNAs (Fig 2-5). Analysis of

coronal sections obtained from R6/1 mice unilaterally injected with rAAV5-HD6 or -

HD7 ribozyme showed an unexpected sharp decrease in the mRNA levels of ppEnk,

DARPP-32 and D2R around the area of transduction. Unexpectedly, expression of either

rAAV5-HD6 or HD7 Rz exacerbated the rate of mRNA loss for most of the analyzed

transcripts in the R6/1 mouse striatum (Fig 2-5A bottom panel). In contrast, there was a

significant induction of NGFi-A mRNA in the right inj ected striatum of the R6/1 mouse.

To further characterize this loss in mRNA steady-state levels, we analyzed sections

obtained from inj ected age-matched wild-type mice. ISH analysis revealed a similar

pattern of loss in transcriptional activity, albeit to a lesser degree (Fig. 3-5A top panel).

This effect was specific to the intracellular expression of Rbz in striatal tissue since

cultured HEK293 cells did not exhibit any HD6 or HD7 Rbz-associated toxicity.

Furthermore, analysis of sections from rAAV5-GFP animals showed that long-term

expression of rAAV5-GFP does not lead to detectable changes in the steady-state levels

of either NGFi-A or D-32 mRNA (Fig. 2-5B).

We next investigated if this effect was associated with the expression of the self-

cleaving hairpin ribozyme or the IRES-GFP transcript, which are encoded by our rAAV

expression cassette (Fig. 2-4A). We inj ected wild-type mice with a rAAV2-HD7 Rz in

the right hemisphere and rAAV2-hAAT Rz in the left hemisphere. hAAT Rz targets the

human alpha-1 anti-trypsin (hAAT) liver enzyme which is not expressed in neuronal

tissue. As shown by ISH analysis, rAAV2-HD7 Rz increased the steady-state levels of

NGFi-A while causing a loss in the levels of D-32 mRNA (Fig. 2-5C).











A.









151I Probe: Rz NGFiA D 32 ppEnk D2R b-actin



]B.





ISH Probe: GF;P NGFiA D -32


C.






ISH Probe: hkAAT/ HD7 N17ri : D-32





Figure 2-5. rAAV5-HD7 expression results in a loss of striatal-specific transcripts. A. Dr
situ hybridization analysis of coronal sections obtained from a wild-type (WT)
and a R6/1 (HD) mouse. Comparison between genotypes revealed a marked
difference in the mRNA levels of NGFi-A, DARPP-32 (D-32), ppEnk and D2
receptor (left hemispheres). rAAV5-HD7 expression led to a remarkable loss
in DARPP-32, ppEnk and D2 receptor mRNAs in both inj ected R6/1 and
wild-type mice. In contrast, NGFi-A mRNA was increased to levels that were
~20% above wild-type in both wild-type and R6/1 inj ected mice. Panel (B)
are coronal sections obtained from wild-type mice inj ected with a rAAV5-
GFP vector. Dr situ hybridization analysis demonstrated that the loss in
hybridization signal intensity of DARPP-32 and the increase in the levels of









Figure 2-5 continued

NGFi-A were specific to striatal expression of the HD7 ribozyme. C. Coronal
sections obtained from wild-type animals expressing either rAAV2-HD7
ribozyme or a ribozyme targeting hAAT (rAAV2-hAAT). Analysis of
DARPP-32 and NGFi-A expression revealed that the loss and gain in mRNA
levels was specifically associated with the HD7 target sequence. Arrows on
(A) and (C) denote the inj ected hemisphere.









Discussion

Ribozymes Can Modulate the Expression of Cellular Genes

There are a number of reports on the ability of the hammerhead ribozymes to

control expression of specific genes in cell culture. For example, a hammerhead ribozyme

designed to cleave mRNA encoding C-Ha Ras mutation inhibited formation of foci of

transformed cells by 50% (22). Hammerhead ribozymes have also been used to target

oncogenes. The use of hammerhead ribozymes targeted to survivin, which is expressed in

carcinoma cells, resulted in up to 74% reduction in the levels of surviving mRNA (76).

Finally, hammerhead ribozymes have also been shown to effectively reduce the levels of

a rhodopsin mutant protein in vivo (34, 47). Taken together these data demonstrate that

hammerhead ribozymes are capable of modulating the expression levels of targeted

genes. This study demonstrates that hammerhead ribozymes can also be designed to

suppress the expression of m-Htt in culture. However, upon detailed examination, our in

vivo results showed an off-target effect associated with the expression of both HD6 and

HD7 hammerhead ribozymes. This effect raises questions concerning the efficiency and

safety of ribozymes as tools in molecular medicine.

Inz Vivo use of Ribozymes Directed Against the R6/1 Transgene

HD is a progressively devastating neurological disorder that currently affects the

lives of approximately 30,000 individuals in the United States alone. Although

pharmacological interventions exist that are designed to alleviate some of the

excruciating symptoms associated with this disorder, HD remains largely without an

effective treatment (53). The overall goal of this project was to develop a gene transfer

strategy based on the rAAV-mediated delivery of anti-m-Htt hammerhead ribozymes in

the striatum of the R6/1 mouse model of HD. This strategy was aimed at reducing the









levels of striatal m-Htt in order to prevent, reverse or ameliorate the symptoms associated

with HD.

Four hammerhead ribozymes directed against the HD transgene expressed in the

R6/1 mouse were designed and characterized in vitro. We showed that co-expression of

either rAAV5-HD6 or HD7 Rbz with a m-Htt expression vector (pCMV-R6/1) results in

significant reduction in the relative levels of m-Htt mRNA (> 60%) as determined by

densitometric analysis. However, in vivo expression of rAAV5-HD6 or HD7 Rbz in the

striatum of R6/1 mice resulted in a loss in the mRNA levels of striatal-specific genes

known to be critical for neuronal function. This reduction in striatal mRNA levels was

not due to a global suppression of transcriptional activity since the steady-state levels of

the NGFi-A transcript were induced to levels that were ~20% that of control.

This result was unexpected and contrary to our initial hypothesis. Furthermore, in

situ hybridization analysis of sections obtained from age-matched treated wild-type mice

showed a reduction in the steady-state mRNA levels of the same striatal-specific genes.

Since both of these ribozymes were directed against the human HD transgene in the R6/1

mouse and should not have cleaved any other known mouse RNA sequence, the loss of

mRNA levels in wild-type animals lead us to conclude that there is an off-targeting effect

associated with the striatal expression of HD6 or HD7 ribozymes which was not evident

in cultured HEK293 cells. This off-targeting effect results in the cleavage of an

unidentified RNA transcript that codes for a protein whose expression is necessary to

neuronal function as evidenced by the loss of a subset of neuronal and striatal specific

mRNAs in wild-type mice.









In an attempt to identify this transcript, we performed BLAST searches for short,

nearly exact matching sequences. We limited the search, to sequences exhibiting greater

than 50% sequence similarity to the HD6 and HD7 target site. Additionally, we only

analyzed sequences that contained the required GUC triplet cleavage site and are

expressed in neural tissue. Initial screens did not yield any significant matches to the

human HD sequence spanned by the HD6 and HD7 target sites. However, the inclusion

of expressed sequence tags (ESTs) during the search resulted in the identification of 6

sequences that have up to 60% similarity with the ribozymes target sites, contained the

GUC triplet and are expressed in cultured neurospheres. The identification of the gene, or

genes, responsible for the loss in striatal-specific mRNA levels might lead to the

elucidation of an unknown gene function.

Conclusion

In this study we limited the designed of hammerhead ribozymes to sequences that

are contained within the human HD transgene expressed in the R6/1 mouse. This

transgene contains approximately 1 kb of 5'UTR sequence, an expanded exon 1 (117

CAG repeats) and 262 bases of intron 1. The design of ribozymes is limited by the NUX

triplet rule where N is any nucleotide, U is uracil and X is any nucleotide but guanosine

(Fig. 2-1). The small size of the transgene made the search for cleavage target sites

extremely challenging. Furthermore, the identification of potential target sites does not

necessarily correlate with the design of highly active hammerhead ribozymes as it was

demonstrated in this study (Fig. 2-2A). These two factors limit our ability to test our

underlying hypothesis using hammerhead ribozymes. Although the use of a full-length

HD mouse model would increase the success probability of applying the use of

hammerhead ribozymes to post-transcriptionally modulate the levels of m-Htt protein,









these models have slow, late-onset phenotypes that have not been fully described.

Recently, the use of RNAi in a neurological model of disease led to cellular and

behavioral improvements (91). This new technology is not dependent on NUX target

rules and results in a more stable and long-term silencing effect. The application of RNAi

in HD will be the focus in the next chapter.















CHAPTER 3
RNA INTERFERENCE OF MUTANT HIUNTINGTIN IN VIVO

Introduction

The genesis and progression of disease in dominant genetic disorders, such as HD,

require the presence and expression of a mutant allele. Nucleic acid-based molecules

have been designed to inhibit gene expression by sequence-specific targeting of mutant

mRNAs. It has been demonstrated that the expression of short, hairpin-like double-

stranded RNA (shRNA) molecules in neuronal cells, both in vivo and in vitro, results in

the sequence specific silencing of targeted genes (16). In fact, the successful in vitro

application of synthetic siRNAs against members of the polyglutamine family of

diseases, including HD, was recently reported (52, 57). This suppression was achieved by

targeting siRNAs to either the CAG repeat region or to adj acent gene sequences and

could even be designed to be allele-specific.

RNAi has also proven to be an efficient therapeutic tool in in vivo models of pQ

disease. A recent report demonstrated the full potential of this technology in a transgenic

mouse model of SCA-1 (91). In this experiment, cerebellar long-term expression of an

anti-ataxin-1 siRNA was achieved by delivering an shRNA expression cassette with a

recombinant adeno-associated viral vector. shRNA expression resulted in greater than

50% reduction of ataxin-1 protein in the cerebellum. Reduction in ataxin-1 transgene

expression was associated with a rescue of the Purkinke cells as well as significant

behavioral improvements in this model of SCA-1. This elegant study, addressing the

applicability of RNAi in neurological disease, suggests that the pathological mechanism









associated with HD could be effectively halted or reversed by introducing siRNAs that

can target the striatal expression of mutant Htt.

In this study, we examined the effects of RNAi mediated post-transcriptional

silencing of striatal m-Htt in the R6/1 mouse. We specifically assessed whether reduced

levels of striatal m-Htt could affect the transcriptional dysregulation phenotype that is

associated with the expression of m-Htt in the R6/1 mouse striatum. Long-term in vivo

expression of two rAAV5-shRNA vectors lead to the significant reduction in striatal m-

Htt mRNA and protein levels as determined by real-time quantitative RT-PCR, western

blot and immunohistochemistry analysis. This reduction was concomitant with a decrease

in both the size and number of neuronal intranuclear inclusions (NIIs). Finally, reduced

levels of striatal m-Htt resulted in an increase in the steady-state levels of ppEnk and

DARPP-32 transcripts as well as in mild-behavioral improvements.

Materials and Methods

rAAV-shRNA Plasmid Construction

Two complimentary DNA oligonucleotides (Invitrogen, San Diego, CA) were

allowed to anneal in order to produce a double-stranded DNA fragment coding for the

sense strand, 9 nucleotide loop and antisense strand of both anti-huntingtin shRNAs

tested. siHIUNT-1 targeted nucleotides 262-281 (5'-GCCGCGAGTCGGCCCGAGGC-

3', Fig. 3-1B) and siHIUNT-2 targeted nucleotides 342-363 (5'-

GGCCTTCGAGTCCCTCAAGTCC-3 ', Fig. 3-1B) of the human HD mRNA (Genbank

accession no. L12392). Double-stranded DNA fragments were ligated into the

Bgl2/HindlII sites of the rAAV vector pSOFF-Hlp-hrGFP. This vector contains the

human RNAse P H1 promoter downstream of the rAAV serotype-5 ITR and a cDNA









encoding the humanized Renilla reniformis GFP (Stratagene, La Jolla, CA) protein under

the control of the herpes simplex virus thymidine kinase (HSV-TK) promoter.

Testing of shRNA Efficacy in Cultured Cells

A portion of the mHtt transgene was PCR amplified from R6/1 mouse genomic

DNA using forward (5' -AGGGCTGTCAATCATGCTGG-3 ') and reverse (5'-

TCTGGGTTGCTGGGTCACTCTGTCTCTGCGGAGCCGGGGG-3') primers. The

resulting product was cloned into pCR 2. 1-TOPO TA cloning kit (Invitrogen, Carlsbad,

CA), sequenced and subcloned into the Hindlll/Nsil sites present in the pRC/CMV

(Invitrogen, Carlsbad, CA) eukaryotic expression plasmid. The resultant plasmid

(pCMV-R6/1) expressed part of the 5'UTR, the coding region within exon 1 with~-115

contiguous CAG repeats, and part of intron 1 of the mHtt transgene under the control of

the minimal cytomegalovirus (CMV) promoter.

Human embryonic kidney 293T (HEK293) cells (ATCC, Manassas, VA) were

seeded onto a 10-cm CorningTM tissue culture dish and allowed to attach and grow to 70-

90% confluency. LipofectamineTM and PlusTM reagents (Invitrogen, San Diego, CA) were

used for transient co-transfection of HEK293 cells with pCMV-R6/1 and rAAV-shRNA

vectors at a ratio of 1:4 and 1:8 respectively. In order to control for non-specific off-

targeting effects, we performed co-transfection of the pCMV-R6/1 plasmid with a rAAV-

shRNA vector targeting the dog rhodopsin mRNA (siRho-1). rAAV-siRho-1 has been

shown to be active against its target both in vitro and in vivo (M. Gorbatyuk and A.

Lewin manuscript submitted). Transfection efficiency was determined by analysis of

GFP-positive cells and ranged from 70-80%. All transfected cells were harvested 48 hr

post-transfection for northern and western analysis. Total RNA was isolated from

transfected HEK293 cells using TRlzolTM reagent (Invitrogen, San Diego, CA). Northern









blot analysis was performed using standard techniques ("Current Protocols in Mol Biol,

Wiley editing house). Briefly, 10 Clg of total RNA was fractionated on a 1.2 %

formaldehyde agarose gel and transferred to Hybond N+ (Amersham, Piscataway, NJ)

membrane by capillary action. pCMV-R6/1 was subj ected to restriction enzyme digestion

using HindlII and Agel, the 150 bp fragment spanning the 5' UTR and ATG initiation

codon of the mHtt transgene was gel-purified, radio-labeled using [ot-32P]dCTP (3000

mCi/ml; MP Biochemicals, Irvine, CA) and used as the hybridization probe. RNA

loading was normalized by removing the mHtt-specific probe and re-probing the

membrane with a radio-labeled fragment complementary to nucleotides 150-270 of the

human p-actin mRNA (Genbank accession no. BC002409). Blots were exposed to

phosphoimager-ready intensifying screens and the intensity of labeled bands was

determined using a Molecular Dynamics phosphoimager.

Western Blot Analysis using Hum-1 Antibody

A polyclonal antibody (Hum-1) was raised in New Zealand white rabbits against

the human Htt-synthetic peptide Ac-PQLPQPPPQAQPLLPQPQC-OH and affinity-

purified (New England Peptide, Gardner, Massachusetts ). Pre-immune serum was used

as a control. Western blot analysis was performed by blocking the membranes for 2 hr at

room temperature in 5% (w/v) skim milk powder in 20 mM Tris, 146 mM NaC1, 0.1%

Tween-20 (TBST), incubating the membranes in a 1:500 dilution of affinity-purified

polyclonal rabbit anti-human huntingtin transgene protein (Hum 1) antibody in 5% (w/v)

skim milk powder/TBST at 4o C overnight. Membranes were washed 2 x 20 min in

TBST. A peroxidase-labeled goat anti-rabbit IgG secondary antibody (1:2000, Vector

Laboratories, Burlingame, CA) was incubated for 1 hr at room temperature in 5% skim









milk powder/TBST. Interaction between the primary and secondary antibodies was

detected using West Pico SuperSignal@ chemiluminescent substrate using the protocol

recommended by the manufacturer (Pierce Biotechnology, Rockford, IL) and Hyperfilm

ECLTM (Amersham Pharmacia Biotech, England)

rAAV Vector Production

All rAAV vector preparations used in this study were produced by the University

of Florida Powell Gene Therapy CenterVector Core facility using the method described

in [47]. The rAAV5 vector used in this study consisted of rAAV5 capsids and AAV5

ITRs and is therefore not a pseudotyped vector (13). A standard triple transfection

method using the helper DNAs pDG [49] for required adenoviral proteins, our transgene

plasmid described above and pAAV5.2 which has rep and cap from AAV5. Crude

rAAV5 virus was then purified by iodixanol step gradients and Sepharose Q column

chromatography as previously described (13). The final product is concentrated to final

titers of 1 to 5 X 1013 genOme copies per ml.

Intrastriatal Injection of shRNA-Expressing AAV Vectors.

All animal care, handling and surgical protocols were in accordance with the

guidelines established by the Canadian Council on Animal Care and were approved by

the Carleton Animal Care Committee at Dalhousie University. Transgenic R6/1 HD

mice were obtained from Jackson Laboratories and used to establish a breeding colony at

Dalhousie University. R6/1 males were crossed with unrelated CBAxC57BL/6 females.

After weaning, the mice were group housed under a 12 h light-dark cycle with ad libitum

access to food and water. All mice were genotyped at 3 weeks of age and at the time of

death by amplifying a region of the human HD transgene as described previously (36).









Stereotaxic administration of AAV vectors were performed on 6 to 8 week-old

wild-type and R6/1 mice under isofluorance anesthesia. The anterior-posterior (AP) and

medial-lateral (ML) stereotaxic coordinates for inj section were calculated from bregma

and the dorso-ventral (DV) coordinates were calculated from the dural surface. Mice

received intrastriatal inj sections of rAAV5 expressing siHIUNT-1, siHIUNT-2 or TRUF 11

(rAAV5-hrGFP) suspended in phosphate-buffered saline (PBS) at a dose of 2 Cll/site and

an infusion rate of 0.5 Cll/min using a continuous infusion pump, attached to a 10 Cll

Hamilton microsyringe fitted with a glass micropipette with an outer diameter of 60-80

Clm. One minute after the cessation of the infusion, the micropipette was retracted an

additional 1 mm, allowed to remain at this position for 4 min and then slowly retracted

from the brain. The stereotaxic coordinates used for the two inj sections within the same

striatum were: Site 1: AP = +1.0, ML = + 1.8, DV = -3.3; Site 2: AP = +0.4, ML = + 2. 1,

DV -3.4 (All coordinates were measured with an empirically determined flat skull).

The effect of shRNA and control vectors on mHtt mRNA and protein levels was

assessed in a group of animals that received unilateral intrastriatal inj sections of rAAV

vectors. In these experiments, the contralateral hemisphere was used as an internal

control. Ten-weeks after the intrastriatal infusion of rAAV, mice were deeply

anesthetized with sodium pentobarbital (65 mg/kg i.p.) and decapitated. The brains were

removed and stored at -700C. Tissue sections (14 Clm) were cut using a Micron cryostat

through the rostral-caudal axis of the striatum, thaw-mounted onto Fisher SuperFrostTM

slides and stored at -700C. For each animal, 5 coronal brain sections, each separated by

approximately 3 50 Clm, were placed on a single slide. This distribution of tissue was used









to ensure that each slide contained sections taken throughout the transduced region of the

stniatum.

To determine the levels of mHtt RNA and protein, striatal tissue was isolated from

frozen sections that had been thaw-mounted on slides. Cortical tissue was removed using

a razor blade and discarded. To collect tissue mainly from the transduction area, sections

were first examined under epi-fluorescence to visualize the transduction area. The striatal

tissue from the right and left sides of 5 brain sections per animal were then manually

scraped from each slide taking only the approximate area of GFP positivity.

RNA was extracted using Trizol TM (Invitrogen, San Diego, CA), quantified

spectrophotometrically and used as the substrate for reverse-transcriptase (RT) reactions

to generate single-stranded cDNA. The reaction was optimized to reverse transcribe the

5' end of the human Htt transgene. Briefly, 1 Clg of total RNA and 0.75 Clg of random

hexamers were incubated with 1 Cll of 5X Q solution (Qiagen, Valencia, CA) in a total

volume of 5.75 Cll at 70oC for 3 min, mixed and placed on ice for 5 min. M-MLV RT

buffer and dNTPs were added to a final concentration of lX and 1.25 C1M, respectively,

in a final reaction volume of 10 Cll. 20 Units ofRNasin (Promega, Madison, WI) and 100

Units of M-MLV RT (Promega, Madison, WI) were added and the reaction was allowed

to proceed at 48oC for 60 min. The reaction was terminated by heating at 70oC for 10

min. -RT reactions differed from +RT reactions by the substitution of H20 for RT in the

reactions. Quantitative PCR (Lightcycler, Roche) was used to amplify a 115 bp region of

mHtt cDNA from striatal tissue. The PCR reactions contained lX QuantiTect SYBR

Green PCR master mix (Qiagen), 500 nM each of sense (5'-

AGAGCCCCATTCATTGCC- 3') and antisense (5' -GGACTTGAGGGACTCGAA-3 ')









primer. Cycling conditions included a denaturation step of 950C for 15 min, followed by

45 cycles of 940C for 15 s, 580C for 20 s, and 720C for 20 s, and ending with a melting

step from 650C to 990C over 30 s. Total SYBR green fluorescence was measured at the

end of each PCR cycle and continuously through the melting step. Known quantities of

mHtt cDNA were simultaneously amplified with experimental samples and used to create

a standard curve. The levels of cDNA in each sample were normalized to the levels of

hypoxanthine ribosyl transferase.

For western blot analysis, striatal tissue from 4-5 sections per animal were isolated

and homogenized in 0.32 M sucrose, quantified using the BCA protein determination

assay (Pierce), fractionated on SDS/PAGE gels using standard protocols and subj ected to

the immunoblotting conditions described for analysis of mHtt protein levels in transiently

transfected HEK293 cells.

For analysis of the distribution of immunoreactive inclusion bodies, fresh-frozen

coronal brain sections on SuperFrost slides were allowed to come to room temperature,

rinsed 3 x 10 min with phosphate-buffered saline (PBS: 100 mM phosphate, pH 7.4, and

0.9% NaC1) and the tissue was Eixed in 4% (v/v) parafomaldehyde for 15 min. The tissue

was incubated in 0.1% (v/v) H202, 10% methanol and PBS for 10 min and rinsed 3 x 10

min in PBS. Non-specifie binding sites were blocked in a solution of 5% normal goat

serum in 0.25% (v/v) Triton-X100/0.01 M PBS for 1 hr at room temperature.

Immunostaining was performed using a 1:500 dilution of affinity-purified Hum 1 or

1:4000 dilution of polyclonal rabbit anti-ubiquitin (IgG) antibody (DakoCytomation,

Carpinteria, CA) in 1% (v/v) normal goat serum, 0.25% (v/v) Triton-X100/ PBS. Tissues

were incubated overnight at 4o C. A 1:500 dilution of goat anti-rabbit biotin-labeled









secondary antibody (Vector, Burlingame, CA) was prepared in 1% (v/v) normal goat

serum, 0.25% (v/v) Triton-X100/0.01 M PBS. Slides were incubated in secondary

antibody solution for 2 hr at room temperature then rinsed 3 x 10 min in 0.01 M PBS.

Interaction between the primary and secondary antibodies was detected using the

Vectastain Elite ABC Kit (Vector, Burlingame, CA) and DAB using the company's

standard protocol.

The size and distribution of Hum-1 immunoreactive NIIs were determined by using

the Analyze Particle function in the Image JNIH software (freeware available at

http://rsb .info.nih.gov/ij/). Briefly, the relative size (Clm2) and amount of NIIs were

determined by analyzing coded digital images of four different regions (left motor cortex,

right motor cortex, left medial striatum, right medial striatum) in coronal sections that

were subj ected to the stringent immunohistochemical procedure described above.

Fourteen Clm sections were too thin for unbiased stereological estimates of NII number

and the NIIs diameter was too small to use the rotator method of volume estimation [53].

The Image J software (NIH) was configured to detect particles of a specified size range

(0.03 Clm2-0.5 Clm2) and a constant upper and lower threshold value was used for all

grayscale images from all areas analyzed. The mean relative size area (Clm2) Of particles

(NIIs) as well as the mean number of particle counts within the specified size range was

calculated by a blinded operator for each of the four different regions in all of the

unilaterally inj ected R6/1 mice and reported as percent of the size and number of NIIs

present in the left motor cortex. Since absolute numbers or areas are not reported and

internal section controls were used to determine percent controls, this method of

quantification ofNIIs is valid.









In Situ Hybridization Analysis

In situ hybridization was performed on coronal mouse brain sections (Bregma

+1.70 to -0.50) using radio-labeled antisense gene-specific oligonucleotide probes (Table

1). Frozen sections were allowed to reach room temperature, Eixed with 4%

paraformaldehyde in lX PBS PBS for 5 min, rinsed twice for 3 min in lX PBS, once for

20 min in 2X sodium chloride-sodium citrate (SSC, 0. 15 M NaC1, 0.015M NaCitrate, pH

7.4), and then air dried. Each slide was covered in 200 Cll of hybridization buffer (50%

deionized formamide, 5X SSC, lX Denhardt' s reagent, 0.02 M sodium phosphate (pH

6.8), 0.2% SDS, 5 mM Na2EDTA, 10 Clg/ml Poly(A)n, 10% dextran sulfate, 50 Clg/ml

sheared salmon sperm DNA, 50 Clg/ml yeast tRNA) containing ~1 x 106 c.p.m./ml of

oligonucletide probe that had been 3' end-labeled with [ot-33P]dATP (2000 mCi/ml) for

90 min at 370C using terminal deoxynucleotidyl transferase (Promega, Madison, WI).

Prior to use, unincorporated nucleotides were removed from the labeled probes using a

Sephadex G-25 spin column (Amersham Biosciences, Buckinghamshire, UK). The slides

were coverslipped with parafilm and incubated overnight at 420C in a humidified

chamber. The coverslips were removed in 2X SSC and the slides were washed for four

times for 30 min at 550C in lX SSC, four times for 30 min at 550C in 0.5X SSC, two

times for 30 min at 550C in 0.25X SSC, then rinsed briefly in H120 and allowed to air dry

overnight. Slides were exposed to Kodak Biomax MR fi1m for up to 4 weeks at room

temperature. The hybridization signals were analyzed using Kodak 1D Image Analysis

Software as described in (36).

For display purposes in order to make differences in hybridization signal easier to

visualize, hybridized sections were scanned and false-colored in Adobe Photoshop TM 7.0










by changing the image to RGB color and then a gradient map (as shown at the bottom of

Fig. 3-5) was applied. This was done to all coronal sections shown in figure 3-5 without

any further manipulation.

Effect of Anti-mHtt shRNA on Phenotype

The effect of anti-mHtt shRNA and control vectors on phenotype were assessed in

animals that received bilateral inj ectons of siHIUNT-1, siHIUNT-2 and control rAAV

vectors. Mice were weighed weekly following injection of rAAV. Average weight,

grouped by genotype and treatment, was determined for each week, and significant

differences determined using ANOVA Hind limb clasping behavior was assessed by

suspending the mice 30 cm above a flat surface by their tail for 60 seconds or until the

mice curled and clasped their hind limbs with their forelimbs and maintained the posture.

The percentage of mice per group at each time point that exhibited clasping was

recorded. Motor coordination was analyzed by placing the mice on rotarod that increased

from 0 to 40 rpm over 1 min. The time from placing the mouse on the rotarod until the

mouse fell off was recorded for each of 4 trials and the average time that each mouse

remained on the rotarod was recorded.

Statistics

Analysis of variance (ANOVA) was used to evaluate the probability of differences

between experimental groups. Where appropriate, one-way ANOVA was performed and

individual post-hoc differences between groups was assessed using Fisher' s paired-least-

significant-difference test (Fisher's PLSD as available in Statview). Post-hoc differences

in two-way ANOVA designs were assessed in a hierarchical fashion as described by Kirk

et al (8) using simple main-effects analysis. The minimum probability accepted for

significance (a level) was 0.05.









Results

RNA Interference of Mutant Huntingtin In Vitro

R6/1 trangenic HD mice express exon 1 of human Htt with -115 CAG repeats [14].

We designed short-hairpin RNAs (shRNA) (20 to 21 nucleotides in length) that could

target specific sequences of exon 1 of human Htt, but did not have significant sequence

similarity to the endogenous mouse Htt mRNA. We generated rAAV5-based DNA

constructs expressing two anti-mHtt shRNA molecules (Fig. 3-1A). The mHtt silencing

activity of these constructs was tested in vitro by transiently co-transfecting each

construct with a eukaryotic expression vector containing the R6/1 HD transgene (mHtt)

into HEK293 cells. Transfections were performed using a 1:4 and a 1:8 target vector to

shRNA vector ratio. Forty-eight hours post-transfection, we analyzed mHtt mRNA and

protein expression levels. Northern blot analysis of total RNA obtained from HEK293

cells co-transfected with a shRNA vector targeting nucleotides in the 5'-UTR of the mHtt

mRNA (siHIUNT-1) or a shRNA vector targeting a region immediately upstream of the

CAG repeat domain (siHIUNT-2) resulted in greater than 75% (p < 0.001) reduction of

mHtt mRNA compared to samples from cells that expressed mHtt and a GFP-only vector

(Fig. 3-1B). Co-transfection with a control shRNA vector targeted to the dog rhodopsin

mRNA (siRho-1) did not affect the levels of mHtt mRNA (Fig. 3-1B).

Immunoblot analysis of mHtt protein using a human amino-terminus specific Htt

antibody (Hum-1) showed that the reduction in mRNA levels was associated with a

significant decline in the levels of mHtt protein (Fig. 3-1C). Co-expression of the mHtt

vector with siHIUNT-1 shRNA reduced the levels of mHtt protein to 40% (p < 0.001) of

that observed in cells co-transfected with either a GFP-only vector or the siRho-1 shRNA

control vector. We also observed -55% (p < 0.001) reduction in the levels of mHtt































siHUNT-1


I 2 34 56 78 D




si-Rho-l aiHUNT I siHUNT-2


A C
GA


shRNA


rAAV Silencing Construct



sLHUNT2Z
ATG
CAG -r'


slHUNT-1
5'-GATCCCC CCCGCG~AGTCGGE;CCCGAGGTTCACACAGACCTCGGCGCCGACTCCGCCTGGCTTTGAAA-T
siHUNT-2
5`-GATCCCGGGCCTTCGAGTCCCTCAAGTCCTTCAAGAAGCTAGATGAGCTTGAA3


m-Htt mRNA


P-actin mRNA







41
e
o
u
ta

.o

a

~
Z
czl
E


N


.j; 3 3
'6;


Figure 3-1. rAAV-shRNA constructs mediate the silencing of m-Htt in vitro. A. The
human H1 RNA promoter unit was used to drive the intracellular expression

of 20 to 21-nucleotide long shRNAs directed against the R6/1 HD transgene

(mHtt) from within the context of rAAV serotype-5 vectors. Expression of
hrGFP was used to positively identify transduced cells. B. Schematic


rn-H~tt



B-actin









Figure 3-1 continued


representation of the Htt gene graphically showing the region of the gene that
is targeted by siHunt-1 and siHunt-2 shRNAs. C. Northern blot analysis of
mHtt mRNA obtained from transiently co-transfected HEK293 cells. Co-
expression of CMV-R6/1 (mHtt) with either siHUNT-1 or siHUNT-2 shRNA
constructs, at either a 1:4 (lane 5 and 7) or 1:8 (lane 6 and 8) target to shRNA
ratio, resulted in significantly reduced levels of mHtt mRNA when compared
to co-transfection with a control shRNA, siRho-1, (lanes 3 and 4) or CMV-
R6/1 alone (lanes 1 and 2). Comparisons of the average optical density signal
from three independent experiments performed with a 1:8 target to shRNA
ratio showed greater than 75% reduction in mHtt mRNA relative to levels of
p-actin mRNA (* = p<0.001, ** = p<0.001). D. Western blot analysis of total
protein from HEK293 cells treated as above. mHtt protein was detected using
a human-specific anti-Htt antibody (Hum-1). Analysis of the average (+ SEM)
optical density signal revealed that mHtt was silenced by intracellular
expression of both siHUNT-1 (>60% reduction, = p<0.0001) and siHUNT-2
(>55% reduction, **" = p<0.0001). Silencing of mHtt protein expression was
not observed in cells co-transfected with siRho-1. The same blot was probed
with an antibody to p-actin in order to normalize for total protein load. Error
bars represent + standard error of the mean (+SEM).










protein in samples from cells transfected with siHUNT-2 shRNA. mHtt protein levels

were unaffected by the expression of siRho-1 shRNA molecules (Fig. 3-1C). These in

vitro results demonstrate that intracellular expression of both siHUNT-1 and siHUNT-2

results in the specific and efficient knockdown of mHtt mRNA and protein levels in

cultured HEK293 cells.

Long-Term Striatal Expression of rAAV5-shRNAs in the R6/1 Mouse

We next investigated whether rAAV5-mediated long-term striatal expression of

siHUNT-1 or siHUNT-2 shRNAs could induce RNA interference of the mHtt transgene

in the R6/1 transgenic HD mouse. To test the in vivo activity of both shRNAs, 6-8 week

old R6/1 mice and wild-type littermates were divided into four groups and injected

unilaterally at two different sites in the right striatum. Each intrastriatal injection

delivered 2 Cll of high-titer rAAV5-siHUNT-1 (R6/1 n=12, wild-type n=6), rAAV5-

siHUNT-2 (R6/1 n=13, wild-type n=5), rAAV5-siRho-1 (R6/1 n=4) or rAAV5-GFP

(R6/1 n=5, wild-type n=5) viral vectors. Ten weeks post-surgery, fresh-frozen coronal

brain sections were obtained and viral transduction, mHtt mRNA levels, and protein

expression levels relative to the left untreated hemisphere were determined.

Inj section of rAAV5-GFP, rAAV5-siRho-1 and anti-mHtt rAAV5 shRNA vectors

resulted in widespread and intense neuronal transduction as was previously observed in

the rat striatum (13). In situ hybridization (ISH) analysis performed on coronal sections

against the rAAV5-encoded hrGFP mRNA revealed a non-uniform but widespread

rAAV5 transduction (Fig. 3-3A). hrGFP mRNA was efficiently expressed along the

dorsal-ventral and rostral-caudal axis of the striatum. A strong hybridization signal was

detected on either side of the corpus callosum but not in the white matter tracts (Fig. 3-

3A) suggesting that the maj ority of hrGFP signal was concentrated in neuronal cell









A
Onset of Motor Decficits
NIls Visiblei"


III I l l | I I I
Age 0 2 4 6 8' 10 12 14 .16
(weeks)

UnilaterallInjection Euthanasia
B
Body Weight






Bilatral Lct o como utio n ai



Figure 3-2. Experimental design. A. R6/1 and littermate control animals were injected
unilaterally with either rAAV5-siHUNT-1, -siHIUNT-2, -siRho-1 or -GFP
viral vectors (annotated below the line). B. Experimental design for bilateral
inj sections was identical to that shown above. Behavioral tests were performed
weekly between the time points indicated by the arrows above and below the
time-line.



bodies. hrGFP protein expression was intense and paralleled the widespread pattern of

rAAV5 transduction detected by ISH analysis (Fig. 3-3B). Native hrGFP epiflourescene

was observed in all sections that contained rAAV5-transduced striatal tissue such as the

one shown in figure 3-3B. Long-term striatal expression of control rAAV5 vectors

(rAAV5-siRho-1, rAAV5-GFP) in the R6/1 mouse was not associated with any abnormal

changes in cellular morphology or astrocyte activation as determined by cresyl violet and

GFAP staining (data not shown). These observations demonstrated that the striatum of









the R6/1 mouse can tolerate strong, wide-spread and long-term rAAV5-mediated

expression of hrGFP and shRNA molecules.

To evaluate the silencing activity of rAAV5-siHIUNT-1 and rAAV5-siHIUNT-2 in

vivo, we extracted total cellular RNA from rAAV5-shRNA-transduced striatal regions

and subj ected the RNA to reverse-transcription reactions optimized to convert the GC-

rich mHtt transgene mRNA to cDNA. The levels of mHtt mRNA were determined using

real-time quantitative PCR. Baseline levels of striatal mHtt mRNA were established by

analyzing total RNA from striatal tissue contralateral to the rAAV5-shRNA inj section.

mHtt mRNA levels from control and rAAV5-shRNA inj ected striatum were normalized

to hypoxanthine phosphoribosyl transferase (HPRT) mRNA levels and subj ected to one-

way ANOVA. Long-term expression of rAAV5-siHIUNT-1 or rAAV5-siHIUNT-2 in the

striatum of the R6/1 mouse resulted in highly significant reductions in the levels of mHtt

mRNA (Fig. 3-3C) demonstrating that intrastriatal delivery of rAAV5 anti-mHtt shRNAs

in the R6/1mouse can induce efficient knockdown of mHtt mRNA levels. Moreover, this

reduction was specific to the expression of rAAV5-siHIUNT-1 or -siHU7NT-2 since mHtt

mRNA levels were unchanged following the expression of rAAV5-siRho-1 (Fig. 3-3C).

To determine the levels of total striatal mHtt protein in the R6/1 mouse, we

generated a rabbit polyclonal antibody against a specific peptide in the amino-terminus of

human Htt (Hum-1). The Hum-1 antibody recognized a high molecular weight band of

greater than 250 kDa that was enriched in nuclear fractions of protein extracts from R6/1

but not wild-type littermate controls (Fig. 3-4A). We measured the relative intensity of

the high molecular weight Hum-1 immunoreactive band to compare the levels of mHtt

protein in transduced and control R6/1 striatum. We normalized the levels of mHtt





A 1~9
~ib
i-gSi"


d

C D


120 e 120
100 a 100
E 80 80
1 0 60 o60
S 40 -a 40
20 I 20
0 0
ctl vector ctl vector ctl vector ctl vector ctl vector ctl vector
siHunt-1 siHunt-2 siRho siHunt-1 siHunt-2 siRho

Figure 3-3. Long-term in vivo striatal expression of rAAV5-siHUNT1 and rAAV-
siHU7NT2 decrease mHtt transgene mRNA expression. A. In situ
hybridization with a probe against the virally encoded hrGFP mRNA. Coronal
sections were obtained 10 weeks post-surgery. The panel was arranged in a
rostral-caudal axis to illustrate the extent of the transduced area as indicated
by the arrow. Two separate inj sections were placed into the same hemisphere
(arrows). These sections were obtained from one animal and are
representative of all other study animals. Scale bar = 2mm. B.
Photomicrograph of native hrGFP protein expression from the striatum of a
representative inj ected animal demonstrates that the vector derived mRNA
shown in (A) is transcribed into protein. Str = striatum, cc = corpus callosum,
and CTX = cortex. Scale bar = Imm. C. Real-time quantitative PCR analysis
of mHtt mRNA knockdown. Total RNA was extracted from the striata of
R6/1 mice. The levels of striatal mHtt mRNA on the uninj ected (black bars)
striata and injected striata with rAAV5 vectors (white bars). rAAV5-
siHU7NT-1, rAAV5-siHUNT-2, and rAAV5 siRho were measured,
normalized to the levels of HPRT mRNA and reported as percent of control.
Expression rAAV5-siHUNT-1 resulted in a significant 75% reduction of mHtt
mRNA expression (F[1,11] = 40.0 = p<0.001). Striatal rAAV5-siHUNT-2
treatment resulted in significant 78% reduction of striatal mHtt mRNA
expression (F[1.8] = 19.1, = p = 0.002). In contrast, striatal injection of the
control shRNA rAAV5-siRho did not reduce striatal mHtt mRNA levels










Figure 3-3 continued

(F[1,8] = 0.71, p > 0.40). D. Similarly to striatal mRNA analysis in (C), total
protein was obtained from the inj ected and untreated control striata of R6/1
mice. Similar to the mRNA levels, there was a significant rAAV5-sitHUNT-1
mediated 24.5% reduction in the levels of a Hum-1 immunoreactive high
molecular weight band (simple main effects, F[1,18] = 5.2, = p < 0.04). The
rAAV5-siHUNT-2 treated group displayed a significant 38% reduction of
striatal mHtt (simple main effects, F[1,18] = 8.4, = p = 0.01) while the
rAAV-siRho control groups did not have significant reductions of striatal
mHtt (simple main effects, F [1,18] = 0.50, p > 0.40) when compared to R6/1
control striata. Error bars represent +SEM.










protein to a cross-reactive band that was recognized by the Hum-1 antibody and was

present at constant levels in protein extracts isolated from R6/1 and wild-type mice.

rAAV5-siHUNT-1 and rAAV5-siHUNT-2 also reduced striatal mHtt protein levels but

not to the same degree observed with striatal mHtt mRNA levels. Thus, striatal rAAV5-

siHUNT-1 expression reduced striatal mHtt protein approximately 25% compared to

control striata or rAAV5-siRho treated mice (Fig 3-3D). In addition, rAAV5-siHUNT-2

reduced striatal mHtt protein 38% relative to untreated control striata or rAAV5-siRho

injected mice (Fig 3-3D.). Expression of the control shRNA, siRho had no effect on

striatal mHtt expression.

There is a clear discrepancy between the magnitude of si-HUNT-1 and si-HUNT-2

mediated mHtt mRNA reduction and the magnitude of reduction of mHtt protein from

the same striata. One potential reason for this discrepancy between mRNA and protein is

the differential kinetics of turnover of mRNA versus protein. Moreover, our tissue

sampling protocol included both transduced and non-transduced cells, which would lead

to an underestimate of the effectiveness of mHtt knock-down, although there is no reason

why this would differentially affect measured protein levels compared to mRNA levels.

In summary, long-term intrastriatal expression of rAAV5-siHUNT-1 and -siHUNT-2

shRNAs significantly reduced striatal mHtt mRNA levels and also resulted in diminished

striatal mHtt protein expression.

Reduction in the Size and Amount of NIIs is Observed in R6/1 Mice Treated With
rAAV5-siHUNT-1 or rAAV5-siHUNT-2.

One of the pathological markers of disease progression in mouse models of pQ-

disease such as HD is the presence of NIIs. Studies have shown that suppressing the

expression of the mutant pQ-containing protein in neurons results in the clearance of NIIs









[12; 23]. We examined whether the Hum-1 antibody could detect the presence of NIIs in

the R6/1 striatum. We reasoned that using an anti-Htt antibody instead of an anti-

ubiquitin antibody would allow us to directly correlate the levels of mHtt with the

presence or absence of NIIs. Immunohistochemical analysis of coronal brain sections

from untreated R6/1 mice subj ected to Hum-1 and anti-ubiquitin immunohistochemistry

revealed a similar pattern of immunoreactivity between both antibodies with respect to

the size and distribution of NIIs in the R6/1 mouse brain (Fig. 3-4A-D). Histological

analysis of sections obtained from R6/1 mice of various ages showed that Hum-1-positive

NIIs become visible in the light-microscope at about 8 weeks after birth (data not shown),

in agreement with the time that ubiquitin-positive NIIs become visible in the R6/1 mouse

[18]. Hum 1- (data not shown) and anti-ubiquitin- [18] immunoreactive NIIs increase in

size and staining intensity during the progression of HD suggesting that protein

deposition in NIIs is cumulative.

We analyzed Hum-1 immunostained coronal sections from unilaterally inj ected

R6/1 mice and compared the relative area and intensity of NIIs present in four brain

regions including the left primary motor cortex, right primary motor cortex, left medial

striatum and right medial striatum (Fig. 3-4F). Three of these regions, left primary motor

cortex, right primary motor cortex and left medial striatum, corresponded to non-

transduced control tissue while the right medial striatum exhibited strong rAAV5-

mediated transduction (Fig. 3-3A,B & 3-4F). Comparison of Hum-1 staining in the left

and right primary motor cortex revealed no differences in the area or intensity of NIIs in

any of the R6/1 mice that were untreated or treated with either rAAV5-siHUNT-1 (Fig.

3-4G & H) or -siHUNT-2 (Fig. 3-4M & N). Areas shown in figure 3-4I,J,K,L,O,P were





































I


,

cr


_*


E









G


g ao
o

~~13
g =~
o


"1 2


3 4 5 6


F. .







aft right left right left riht left right.
Cortex S3triatum Cortex Striatum '

siHUNT-2 I,,


ri *
L ~I
.L
.~
-C
i
I;







:



''

.r
a
,F


~-, P


~


Q
~00
80
e
~ij60


g 20


..... ..
....
~lri ~' ''~
1. *, I 'r
I r C
`r -'~~ t
r *r
i t


Figure 3-4 Analysis of mHtt protein aggregates after expression of rAAV5-shRNAs. A-
D. Immunohistochemistry showed that the human Htt amino-terminus-

specific antibody Hum-1 antibody, like anti-Ubiquitin antibody, detects NIIs
in R6/1 but not wild-type mice. Panels (A) and (B) were striatal sections
immuno-stained using an anti-ubiquitin antibody. A. Striatal section from a 15
week-old wild-type mouse. B. Striatal section from a 15 week-old R6/1
mouse. Panels (C) and (D) were immuno-stained using the new Hum-1


,D
~i C
"is r rs~
1 ii 'L
PI *
k' i
P C
r
r.
r


F

O


205-

170- ggg (ll$ ,










Figure 3-4 continued


antibody. C. Striatal Hum-1 immuno-staining from the same 15 week-old
wild-type mouse as shown in (A). D. Striatal Hum-1 immuno-staining from
the same 15 week-old R6/1 mouse as shown in (B). Similar staining of NIIs
was found in both anti-ubiquitin and Hum-1 immuno-stained sections. Cross-
reactivity of Hum-1 antibody with cytoplasmic proteins in striatal neurons of
both wild-type and R6/1 mice is apparent in (C) and (D). E. Western blot
analysis of total (lanes 1 and 2), cytoplasmic (lanes 3 and 4) and nuclear
(lanes 5 and 6) protein derived from 15 week-old wild-type (lanes 1, 3 and 5)
and R6/1 mice (lanes 2, 4 and 6) using the Hum-1 demonstrated that the
antibody detects a high-molecular weight aggregate in R6/1 transgenic mice.
The lower panel shows a 170-kDa cross-reacting band that is present in all
samples and was used as loading control. F. Coronal section from rAAV5-
siHunt-1 inj ected R6/1 mouse processed for in situ hybridization with a probe
against vector specific sequences (as shown in Fig. 3A) to demonstrate the
transduction area. The boxes show the areas of Hum-1 staining used for
analysis of NII number and size (panels G, H, M, N, Q, R) and the
photomicrographs shown in panels (J-L), (O,P), (S,T). G-L. These panels
contain the analysis of NII count and size for rAAV-siHUNT-1 inj ected R6/1
mice. NII analysis from all vector-treated mice took place by examining the
transduction area using native hrGFP fluorescence in sections adj acent to the
Hum-1 immuno-stained section in order to correctly choose the boxed area
depicted in (F) for each section. G. Numbers ofNIIs were estimated in cortex
and striatum of long-term treated R6/1 mice, compared to identically
determined NIIs in control striata and expressed as percent of control
frequency. Cerebral cortex in either hemisphere was not transduced by rAAV
(F) and served as a region control. Cortical NII numbers were unaffected by
striatal injection of rAAV5-siHUNT 1 (Fisher' s PLSD post hoc test, p = 0.8).
The frequency of NIIs in cortex was generally greater than in the striatum of
the R6/1 mouse (F[1,20] = 22.0, *p < 0.001). In addition, treatment with
rAAV5-siHUNT 1 significantly reduced the frequency of striatal NIIs by 31%
compared to the control uninj ected striatum (Fisher' s PLSD post hoc test, Jf p
= 0.04). Error bars in (G-H), (M-N) H. Similarly to NII numbers, NIIs are
smaller on average in the striatum, regardless of treatment as compared to the
NII size in cortex (F[1,20] = 38.4,* p < 0.001). rAAV5 mediated siHUNT-1
expression reduced the size of the remaining NIIs by 39% compared to the
untreated control striatum (post-hoc, "f p = 0.0013). I. Photomicrograph of left
cortical Hum-1 stained coronal section from the area shown in the box in (F)
showing frequency of NIIs. J. Photomicrograph of the right cortical region
shown in the box in (F). Scale bar = 50 Clm and applies to (I,J,L). M-P. These
panels contain the data from rAAV-SiHUNT-2 treated R6/1 mice. M. The
frequency of NIIs in the R6/1 cortex was, in general, greater than the
frequency measured in the striatum (F[1,20] = 68.4, p < 0.0001). rAAV5
mediated siHUNT2 expression further significantly reduced the number of
striatal NIIs by 47% compared to the left striatum (Fisher's PLSD post hoc
test, Jf p < 0.0001). N. Similar to NII frequency, Hum-1 positive cortical NIIs










Figure 3-4 continued


are significantly larger than striatal NIIs (F [1,20] = 71.1, p < 0.0001).
Striatal siHUNT-2 expression further reduced striatal NII size by 35%
compared to the untreated striatum (Fisher' s PLSD post hoc test, Jf p < 0.03).
O. Photomicrograph from the control left striatal area depicted in (F) from a
representative rAAV5-siHUNT-2 treated mouse. P. Photomicrograph from
the right rAAV5-siHUNT-2 treated striatum from the same mouse depicted in
(0) clearly demonstrating reduced NII frequency and size. It should be noted
that untransduced striatal areas had Hum-1 positive NII frequency and size
that was indistinguishable from those seen in the opposite control striatum.
Q-T. These panels contain the NII analysis from the rAAV5-siRho treated
mice that serve as the control shRNA experimental group. Q. Quantitative
analysis of NIIs frequency of siRho treated mice. As with the other vector
treated groups cortical NIIs were more frequent than Hum-1 positive striatal
NIIs (F[1,12] = 20.5, p = 0.0007). However, there was no difference
between NII number between treated and untreated striata (Fisher' s post hoc
test, p > 0.2). R. Hum-1 positive NIIs are also smaller in striatum as
compared to the R6/1 cortex (F [1,12] = 16.8, *p < 0.002). However, control
rAAV5-siRho treated striatal Hum-1 positive NIIs were the same size as those
measured in the left, control striatum (Fisher' s PLSD post hoc test, p > 0.5).
S. Representative photomicrograph from the left, untreated cortex of a rAAV-
siRho treated R6/1 mouse. T. Representative photomicrograph taken from the
transduction area (F) from the right, inj ected striatum of the same mouse
shown in (S). There is no apparent difference in striatal NII frequency and
size when compared to the left striatum (S). Scale bar = 50 Clm and applies to
(O,P, and S). Error bars represent +SEM in (G-H), (M-N), and (Q-R).









taken from the same R6/1 mouse section and are representative of all other rAAV5-

siHUNT-1 and -siHUNT-2 treated R6 mice. Hum-1 immunoreactive NIIs in the left (Fig.

3-4K & O) and right (Fig. 3-40 & P) medial striatum were smaller and had less intense

staining than those present in the cortical regions of the same R6/1 mouse (Fig. 3-4I vs.

4K). This histological observation was also supported by the quantification ofNII count

(Fig. 3-4G) and area (Fig. 3-4H, see below).

A comparison of the non-transduced left and transduced right medial striatum

regions showed a marked reduction in the intensity of Hum-1 NII staining in the rAAV5-

siHUNT-1 (Fig. 3-4L) and rAAV5-siHUNT-2 (Fig. 3-4P) transduced right medial

striatum when compared to the left medial striatum (Fig. 3-4 K & P, respectively) of the

same animal. This observation was corroborated by the quantification ofNIIs (Fig. 3-

4G&M) count and area (Fig. 3-4H & N, see below). The reduction in Hum-1 NII

staining intensity was more pronounced in sections obtained from rAAV5-siHUNT-2-

treated compared to siHUNT-1-treated R6/1 mice. Sections from R6/1 mice treated with

either rAAV5-GFP (data not shown) or rAAV5-siRho-1 (Fig. 3-4Q-T) showed no

significant difference in the pattern of Hum-1 NII staining between the left and right

medial striatum regions (Fig. 3-4S versus 4T). The observation of rAAV5-siHUNT 1-

and rAAV5-siHUNT-2- mediated reduction of striatal Hum-1 NII staining further

corroborates the immuno-blot data indicating reduced striatal mHtt protein in vector-

treated striata.

In order to quantify the relative area and amount of NIIs present in shRNA treated

striata, we analyzed the same relative four regions shown in figure 3-4F in siHUNT-1

treated (n=11), siHUNT-2 treated (n=6) and siRho-1 (n=4) treated R6/1 mice. The mean









relative area (Clm2) and number of particle (NIIs) counts within a specified area range was

calculated for each of the four regions in all of the unilaterally inj ected R6/1 mice using

Image J software and reported as percent of the non-transduced corresponding area in the

opposite hemisphere. Using different anatomical regions from individual coronal sections

as internal controls revealed that medial striatal NIIs displayed reduced frequency as well

as reduced two-dimensional area compared to NIIs in motor cortex regardless of vector

treatment (Fig. 3-4G & H respectively).

Long-term expression of rAAV5-siHUNT-1 resulted in a significant reduction in

both the frequency (31%) and mean area (39%) of NIIs in the transduced right medial

striatum when compared to the contralateral non-transduced left medial striatum in the

same section (Fig. 3-4G&H respectively). Analysis of the right medial striatum in

rAAV5-siHIUNT-2 treated sections revealed a mean reduction of 47% in the estimated

frequency and of 3 5% in the mean area of NII particles when compared to the left medial

striatum (Fig. 3-4M). There was no significant difference in the number or area of NIIs

between the right and left medial striatum of rAAV5-siRho-1 treated R6/1 mice (Fig. 3-

4Q & R respectively). Our results show that long-term expression of rAAV5-siHIUNT-1

or rAAV5-siHIUNT-2 in the R6/1 striatum led to a significant reduction in the area and

frequency of striatal NIIs present within the region of viral transduction.

Reduced Levels of Striatal mHtt Affect Levels of Striatal-Specific Transcripts.

Expression of exon 1 of mHtt leads to a decrease in the level of a subset of striatal-

specific mRNAs of the R6/1 mouse [27] [28] [29-31i]. These same transcripts are also

reduced in HD patients. At the very least, evaluation of these striatal-specific transcripts

can serve as an important metric of disease progression in R6/1 mice. To examine the

effects that silencing striatal mHtt expression might have on this molecular phenotype,









we performed in situ hybridization analysis of transcripts on coronal sections obtained

from unilaterally inj ected wild-type and R6/1 mice. Sections were hybridized with

oligonucleotide probes against preproenkephalin (ppEnk), dopamine- and cAMP-

responsive phosphoprotein, 32 kDa (DARPP-32), phosphodiesterase 10A (PDE10A),

phosphodiesterase 1B (PDE1B), nerve growth factor inducible-A (NGFi-A) and the

dopamine type 2 receptor (D2) receptor.

Densitometric analysis of rAAV5-siHUNT-1 inj ected R6/1 mice showed an

increase in the mean levels of striatal ppEnk (24%) and DARPP-32 (16%) mRNA in the

transduced striatum (Fig. 3-5A & B) as compared to the contralateral uninj ected side.

There was no significant side-to-side difference in the levels of PDE 10A, PDE-1B,

NGFi-A or D2 receptor mRNAs in R6/1 mice treated with rAAV5-siHUNT-1 (data not

shown).

In contrast, expression of rAAV5-siHUNT-2 in R6/1 mice resulted in a marked

decrease in the mean levels of both ppEnk (16%) and DARPP-32 (30%) mRNAs when

compared to the uninj ected left side (Fig. 3-5C & D). More importantly, this decrease

was also evident in unilaterally inj ected wild-type mice for both ppEnk (75%) &

DARPP-32 (56%) mRNAs (Fig. 3-5 panels C & D). This pronounced reduction in

mRNA levels was also observed in all other transcripts tested (not shown), except for

NGFi-A where the long-term expression of siHUNT-2 shRNA led to an increase in

transcript levels that exceeded that of wild-type uninj ected controls (not shown).

The P-actin-specific hybridization signal remained unchanged in all samples tested.

Based on the comparable reduction in transcripts in wild-type and R6/1 mice, we

attributed the reduction in the steady-state levels of these striatal-specific transcripts to a











A



24
3
I r!
'3i L11


UtCorlI siHUnt-1
left _right
R6/1


ConRll siHunt-1 Control siHunt-1
left right left right
wild-type R6/I1


w....wI a...mII-.
left__right
wild-type


Control sinunt-a control Sinunt-
left _right leftriht
wild-type R6/1


left _right left right
wild-type R/11


control siRho
left rightt
wild-type


control siRho
Isr _rfiht
wild-type


control siRho
left_ right
R6/1


Figure 3-5 In situ hybridization (ISH) analysis of ppEnk and DARPP-32 transcripts.
Coronal sections shown to the left of (A), (C), and (E) were hybridized to a
ppEnk-specific oligonucleotide probe (Table 1) while sections in panels (B),
(D) and (F) were hybridized to a DARPP-32-specific oligonucleotide probe
(Table 1). The arrows above the coronal sections show the approximate vector
inj section site and the fill pattern of the arrows corresponds to the fill pattern of
the histograms in each panel to show which treatment was received in each
hemisphere. In order to better demonstrate the anatomical pattern of striatal
transcripts the coronal sections were false colored. The scale is shown at the
bottom of the figure. A. Evaluation of long-term intrastriatal rAAV-siHUNT-
1 expression on striatal ppEnk levels in R6/1 mice and wild-type littermate
controls. Quantitative analysis of normalized ppENK levels confirm that
ppENK levels are reduced in 22 week old R6/1 mice (F[1,66] = 99.5, p <
0.0001). rAAV-siHUNT-1 injection into wild-type control striata does not
lead to any alteration in striatal ppENK levels as compared to untreated


ppEnk


E





~t5


Rgy


DARPP-32


control siRho
left _ri~ght R6/"
.1
low high
mHtt mRNA levels










Figure 3-5 continued


control left striata (Fisher' s PLSD post hoc test, p > 0.7). In contrast, in R6/1
mice, striatal rAAV5-siHUNT-1 treatment led to a mild 24% increase in
striatal ppEnk levels as compared to the ppEnk levels observed in the control
striatum (Fisher's PLSD post hoc test, Jf p = 0.01). B. Evaluation of long-
term intrastriatal rAAV-siHUNT-1 injection on steady state striatal DARPP-
32 mRNA levels. Similar to ppENK mRNA levels, DARPP-32 mRNA was
reduced in R6/1 animals as compared to littermate controls (F[1,66] = 114. 1, *
p < 0.0001). rAAV5-siHUNT-1 injection did not affect striatal DARPP-32
levels in wild-type controls (Fisher' s PLSD post hoc test, p > 0. 1). Striatal
rAAV5-siHUNT-1 treatment resulted in a significant 16% increase in
DARPP-32 mRNA levels (Fisher' s PLSD post hoc, "f p < 0.03) in R6/1 mice
as compared to DARPP-32 mRNA levels in the untreated striatum. C.
Analysis of the effect of intrastriatal inj section of rAAV-siHUNT-2 on striatal
ppEnk transcript levels. In stark contrast to the pattern seen with rAAV5-
siHUNT-1 inj section (A), rAAV5-siHUNT-2 long-term expression led to a
75% reduction of striatal ppENK levels in the inj ected striatum of wild-type
littermate controls (Fisher' s PLSD post hoc test, *p < 0.0001). Likewise,
rAAV5-siHUNT-2 treatment also resulted in a further 16% reduction in
striatal ppENK levels in R6/1 mice (Fisher' s PLSD post hoc test, Jf p < 0.05).
D. Analysis of the effect of intrastriatal inj section of rAAV-siHUNT-2 on
striatal DARPP-32 mRNA levels. Similar to the pattern seen in response to
rAAV5-siHUNT-2 expression striatal ppEnk levels (C), rAAV5-siHUNT-2
long-term expression led to a 44% reduction of striatal DARPP-32 mRNA
levels in the inj ected striatum of wild-type littermate controls (Fisher' s PLSD
post hoc test, *p = 0.0005). In addition, rAAV5-siHUNT-2 treatment resulted
in a further 70% reduction in striatal DARPP-32 mRNA levels in R6/1 mice
(Fisher's PLSD post hoc test, Jf p < 0.01). This further reduction in the treated
striatum of the R6/1 mice is particularly apparently in the right side of the
coronal section shown to the right of the histogram in this panel. E.
Evaluation of the effect of the long-term expression of the control shRNA,
siRho in the striatum of wild-type littermate controls and R6/1 mice on striatal
ppEnk levels. rAAV5-siRho injections had no effect on striatal ppEnk
transcript levels in either wild-type controls (Fisher's PLSD post hoc test, p >
0.9) or R6/1 mice (Fisher's PLSD post hoc test, p > 0.6). F. Evaluation of the
effect of the long-term expression of the control shRNA, siRho in the striatum
of wild-type littermate controls and R6/1 mice on striatal DARPP-32 mRNA
levels. rAAV5-siRho injections had no effect on striatal DARPP-32 mRNA
levels in either wild-type controls (Fisher's PLSD post hoc test, p > 0.7) or
R6/1 mice (Fisher' s PLSD post hoc test, p > 0.6). Error bars are + SEM.









siHIUNT-2 shRNA-mediated "off-targeting" effect. Further documentation of this

important off-targeting finding is the subj ect of a separate study (Rodriguez et al., in

preparation).

Analysis of R6/1 mice inj ected unilaterally with the control rAAV5-siRho-1

shRNA revealed no significant differences in the levels of ppEnk, DARPP-32, PDE 10A,

PDE-1B, NGFi-A or D2 receptor mRNA between the left uninj ected and right inj ected

striatum (Fig. 3-5E & F). Additionally, there was no side-to-side difference in the steady-

state levels of any of the transcripts analyzed in the striatum of wild-type mice inj ected

unilaterally with rAAV5-siHIUNT-1 (Fig 3-5A&B). We conclude that rAAV5-siHIUNT-1

mediated reduction of mHtt levels in the striatum of R6/1 mice resulted in a small but

significant increase in the steady-state levels of striatal ppEnk and DARPP-32 mRNAs

relative to the levels observed in the untreated contralateral striatum.

Long-Term Bilateral Striatal Expression of rAAV5-siHUNT-1 in the R6/1 Mouse is
Associated With a Delay in the Clasping Phenotype.

R6/1 mice display a progressive neurological phenotype that includes clasping of

the hind limbs, and dyskinesias (10). Additionally, R6/1 fail to gain weight at a normal

rate and show a progressive decrease in retention times in the rotarod when compared to

age-matched wild-type littermate mice. In order to examine whether lowering the striatal

levels of mHtt would prevent the progression of these phenotypes, 6-8 week old R6/1 and

wild-type mice were inj ected bilaterally at two different striatal sites (4 injections total)

with rAAV5-siHIUNT-1 or rAAV5-GFP control. We initially assessed the progression of

the HD-like phenotype in the R6/1 mice by recording weights weekly beginning at 1

week post-surgery.







76


40 40
A B
S35~ -r I I I I I ~ I C 35 -





2 2 0 -( -[ W T co t o (n 5 B 2 0 5- R / o t o n 5

-g- VVT GFP (n=5) -$- R6/1 GFP (n=5)
0 ~ ~~ ~ -V siHunt (n--5) 0 R6/1 siHunt(n=5)
7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22
Age (weeks) Age (weeks)
100

r 80-

u, 60
m -0- R6/1 control (n=5)
E -$ R6/1 GFP (n=5)
ar 40
E R6/1 siHunt (n=5)



13 14 15 16 17 18 19 20 21 22
Age (weeks)

Figure 3-6 Bilateral long-term striatal expression of rAAV5-siHUNT-1 delays the
clasping phenotype of R6/1 mice. A. Animal weight was recorded weekly
starting at 1 week post-surgery (Fig. 2B). A. The mean (ASEM) weight for
wild-type littermate controls is shown. The symbol key is given in the lower
right corner of the graph. There was no effect of rAAV-siHUNT-1 treatment
on weight regardless of genetic background or vector treatment including
rAAV5-GFP (rAAVrepeated measures ANOVA, F [2,22] = 0.63, p > 0.5). B.
The mean (ASEM) weight for R6/1 mice is shown. In general, R6/1 mice
weighed less than aged-matched littermate controls (n = 5) over the period of
the experiment (F [1,22] = 4.7, p = 0.04 A vs. B).C. Tail-suspension tests were
performed weekly beginning at 6 weeks post-surgery (corresponding to 13
weeks of age) on age-matched control R6/1 mice (n=5) and R6/1 mice
inj ected bilaterally with rAAV5-siHUNT-1 (n=5) or rAAV5-GFP (n=5). Data
are presented as percent of animals scoring positive for the test as a function
of time. Open circles denote age-matched control R6/1. Closed circles denote
R6/1 rAAV5-GFP. Open triangles denote R6/1 rAAV5-siHUNT-1.




As previously reported, we observed that R6/1 mice did not increase total body

weight at the same rate over time compared to age-matched wild-type littermate mice









(Fig. 3-6A versus B). Examination of the mean weekly weights of uninj ected wild-type

mice and wild-type mice inj ected with rAAV5-GFP or rAAV5-siHIUNT-1 revealed that

long-term expression of neither viral vector led to a significant change in the rate of

weight gain over the experimental period (Fig.3-6A). Similarly, long-term expression of

neither rAAV5-GFP nor rAAV5-siHIUNT-1 in R6/1 mice resulted in a significant change

in rate of weight gain when compared to untreated R6/1 (Fig. 3-6B).

We also analyzed the progression of the clasping phenotype in uninj ected, rAAV5-

GFP or rAAV5-siHIUNT-1 inj ected R6/1 mice by performing a weekly tail-suspension

test beginning at 13 weeks of age. Uninj ected and rAAV5-GFP inj ected R6/1 mice began

to display clasping of the hind limbs at 20 weeks of age. In contrast, R6/1 mice

expressing rAAV5-siHUNT-1 did not show evidence of clasping until 22 weeks of age,

when only 20% overtly displayed the phenotype in comparison with up to 80% of

uninj ected and rAAV5-GFP inj ected R6/1 mice, which overtly displayed the hind limb

clasping phenotype at this same time point.

Finally, we examined the locomotor activity, as determined by total distance

traveled, and rotarod retention times of both wild-type and R6/1 mice 16 weeks post-

surgery (22 weeks of age). Although there were significant differences between wild-type

and R6/1 mice in both tasks, we observed no significant differences among uninj ected,

rAAV5-GFP and rAAV5-siHIUNT-1 inj ected R6/1 mice in either total distance traveled

over time or rotarod retention times (data not shown).

We conclude that 6-8 week old mice expressing rAAV5-siHIUNT-1 bilaterally in

the striatum for up to 14 weeks did not display any overt toxicity associated with our

gene transfer approach. Furthermore, long-term expression of siHIUNT-1 anti-mHtt









shRNA resulted in a mild behavioral improvement of the R6/1 phenotype with respect to

clasping behavior but did not affect body weight abnormalities or muscle-dependent

activities such as rotorod retention and locomotion.

Discussion

The expression of one expanded HD allele initiates a cascade of events that leads to

the neuronal dysfunction and pathology observed in HD (81). It has been hypothesized

that ablating the expression of mHtt might protect against or even reverse the effects

associated with poly-Q expanded Htt protein. In this study, we assessed the molecular

and behavioral effects of long-term intrastriatal rAAV5-mediated expression of shRNAs

designed to suppress the expression of the human mHtt transgene that is present in R6/1

mice. Our results demonstrate that post-transcriptional gene silencing of striatal mHtt in

adult R6/1 mice by one of two shRNAs tested, siHUNT-1, has a mild positive effect on

the rapid cellular and behavioral pathological changes that occur in this model. At the

cellular level, improvement occurred in only 2 striatal specific transcripts and this

amelioration was only found in the striatal subregion of rAAV5-mediated transduction.

These data therefore suggest that greater transduction efficiency could improve the

functional effects obtained here.

Intrastriatal inj sections of rAAV5 vectors resulted in widespread transduction of the

mouse striatum especially as compared to previously reported levels of transduction in

mice (35; 36). Long-term expression of rAAV5-siHUNT-1 in the R6/1 mouse striatum

resulted in mRNA levels that were reduced by 75% when compared to controls while

reduction in protein levels ranged from 25-38%. Aggregated, but not soluble, mHtt was

detected using our western blot protocol, which may have contributed to the discrepancy

between the magnitude of reduction of mRNA and mHtt protein. In fact, even though we









tested several published antibodies and a variety of extraction protocols, we were unable

to detect measurable levels of soluble mHtt N-terminal fragments in total striatal protein

samples from untreated adult R6/1 mice.

In agreement with the data obtained from Hum-1 immuno-blots indicating reduced

striatal mHtt in transduced regions, Hum-1 immunohistochemical analysis of sections

from rAAV5-siHUNT-1 treated R6/1 mice revealed a marked decrease in the size and

number of NIIs within the area of viral transduction. Thus, since aggregation of soluble

mHtt fragments leads to the formation of inclusions in vivo, our data suggest that

expression of rAAV5-siHUNT-1 significantly diminished the available cellular pool of

soluble mHtt N-terminal fragments in the striatum of the R6/1 mouse.

The functional significance of NIIs in HD mouse models is currently controversial.

NIIs have been hypothesized to be a protective mechanism in cells by functioning to

sequester detrimental toxic forms of Htt from damaging the cell (37). On the other hand,

NIIs may also be a pathological feature causing transcriptional dysregulation via binding

of vital transcription factors and sequestering these factors from regulatory sequences.

Along these lines, mHtt has been shown to affect the cellular localization and function of

several regulators of transcription known to be critical for proper neuronal function,

which results in the specific down-regulation of a subset of striatal mRNAs (3 8).

Expression of rAAV5-siHUNT-1 in the striatum of the R6/1 mouse resulted in a

significant increase in the steady-state mRNA levels of both ppEnk and DARPP-32

mRNAs as demonstrated by in situ hybridization analysis. No significant changes were

observed in either the dopamine type-2 receptor or NGFi-A mRNA levels. Additionally,

expression of rAAV5-GFP or the inactive control shRNA, rAAV5-siRho-1, did not result









in any detectable changes in the levels of any of the transcripts analyzed. The promoter

for ppEnk is regulated by the cAMP-responsive element (CRE-) transcriptional pathway

(39). The CRE-transcriptional pathway is extensively involved in the regulation of genes

needed for neuronal function and survival, and expression of mHtt has been shown to

interfere with this pathway (40-42). CRE-mediated transcription is modulated by

TAFIIl30, and the pQ domain of soluble mHtt N-terminal fragments can sequester

TAFIIl30, into aggregates. This aberrant protein-protein interaction is thought to

negatively affect CRE-regulated transcription by affecting the proper localization and

function of TAFIIl30 (41). Therefore, reduced levels of striatal mHtt might have a direct

effect on the activity of CRE-mediated transcription. In this study, while the frequency

and size of NIIs were reduced and disease-affected striatal transcripts were improved by

administration of siHUNT-1, the relationship between NIIs and disease progression and

the exact role of mHtt in transcriptional dysregulation remains poorly understood.

We have observed that the levels for both ppEnk and DARPP-32 mRNA begin to

decrease at ~ 4-5 weeks of age and reach a minimum steady-state level around 12 weeks

of age (Denovan-Wright, unpublished data). In this study, we initiated shRNA treatment

to reduce striatal mHtt expression in R6/1 mice that were between 6 and 8 weeks of age.

Since we did not fully restore ppENK and DARPP-32 mRNAs to wild-type levels, our

data suggests that lowering the levels of striatal mHtt affected the rate of loss in steady-

state mRNA levels. Alternatively, R6/1 striatal neurons expressing low levels of mHtt

protein may have maintained an increased level of transcriptional activity when

compared to striatal neurons expressing normal levels of mHtt.









Finally, we investigated whether long-term expression of rAAV5-siHUNT-1 would

affect the behavioral phenotype displayed in the R6/1 mouse. In this study, we evaluated

a battery of physiological and behavioral tests including effect on weight loss, clasping

phenotype, locomotor activity, and performance on the rotarod apparatus. There was no

difference in weight among the groups of R6/1 mice bilaterally treated with rAAV5-

siHUNT-1, rAAV5-GFP R6/1 and uninjected age-matched R6/1 controls. Additionally,

locomotor activity remained unchanged in rAAV5-siHUNT-1 treated R6/1 when

compared to controls. Analysis of retention times in the rotarod apparatus demonstrated a

clear difference between genotype; however, we observed no differences between all of

the three different R6/1 groups. In contrast, there was a delayed onset of the clasping-

phenotype on R6/1 mice that were bilaterally inj ected with rAAV5-siHUNT-1 when

compared to uninj ected or rAAV5-GFP inj ected R6/1 mice. This mild behavioral

improvement may suggest that suppression of mHtt expression in other regions of the

brain, i.e. cortex, may be required in order to achieve a more explicit positive effect on

behavior. Also, some of the behavioral phenotypes observed in the R6/1 mouse may be

affected by dysfunction of other systems outside the CNS. In fact, problems with

metabolism and muscle wasting have been observed in the R6 lines (43). These systemic

abnormalities would not be expected to improve after suppression of striatal mHtt

expression.

In addition to the observation that siHUNT-1 reduced mHtt levels and had a

positive effect on the cellular and behavioral phenotype of R6/1 mice, we observed that

another active anti-mHtt shRNA, siHUNT-2, reduced levels of striatal-specific transcripts

in wild-type and R6/1 mice indicating that this molecule had deleterious effects that were










independent of mHtt knock-down. As shown by these results, extreme caution should be

taken when interpreting data from shRNAs in vivo and that detailed analysis of cellular

gene expression can detect off-targeting effects associated with the intracellular

expression of shRNAs.

In conclusion, long-term rAAV5-mediated striatal expression of an anti-mutant Htt

shRNAs was well tolerated in both wild-type and R6/1 transgenic mice and leads to

changes that are consistent with reduced expression levels of mHtt protein. Moreover,

improved striatal transduction, use of a slower progressing HD mouse model,

transduction in additional critical brain regions such as cerebral cortex, intervention

earlier in the time-course of pathology, or a combination of these factors may lead to

better shRNA-mediated striatal mHtt knock-down effects. Nevertheless, we have

demonstrated that reduced levels of striatal mHtt can be achieved through the use of

RNAi and that this treatment results in a mildly improved cellular and behavioral

phenotype in the R6/1 line of HD. Since polymorphisms associated with the mHtt allele

have been described (44-46), these results suggest that mutant allele specific gene

silencing may be a clinically viable approach once remaining efficiency and safety issues

are resolved (19,34).















CHAPTER 4
CONCLUSIONS

HUNTINGTON' S DISEASE (HD) is a severe and fatal autosomal dominant

neurological disorder characterized by a late onset of motor and cognitive deficits

including involuntary movements and psychiatric manifestations. Inheritance of an

abnormally expanded CAG-triplet repeat region is the genetic factor responsible for HD.

This expansion is translated into a poly-glutamine (pQ) domain in the N-terminus of a

protein termed huntingtin. Expression of this protein initiates the pathological molecular

cascade of events that leads, without remission, to death of the affected individual within

20 years after the presentation of symtpoms. At the time that these studies were

completed, there existed no clinical treatment to successfully slow down disease

progression.

Progression of HD is dependent on sustained mutant huntingtin expression.

Therefore, we hypothesized that reduced levels of striatal m-Htt would slow down the

rate of disease progression in a transgenic mouse model of HD. In order to test this

hypothesis, we tested the ability of anti-mutant huntingtin hammerhead ribozymes and

anti-mutant huntingtin shRNAs to mediate post-transcriptional silencing of m-Htt

expression in vivo. We specifically characterized the effect that the long-term expression

of anti-mutant huntingtin hammerhead ribozymes and anti-mutant huntingtin shRNAs

had on neuronal intranuclear inclusion (NIIs) bodies and the progressive transcriptional

dysregulation phenotype displayed in the R6/1 transgenic HD mouse line.









We have demonstrated that long-term expression of rAAV5-siHIUNT-1 short-

hairpin RNA against m-Htt RNA led to significant silencing of m-Htt expression in the

striatum of the R6/1 mouse (Chapter 4). Furthermore, RNAi-mediated silencing of m-Htt

expression led to a significant decrease in the size and numbers of neuronal intranuclear

inclusions, a marker of disease progression in the R6/1 mouse. In addition, in situ

hybridization analysis demonstrated that reduced striatal levels of m-Htt led to an

increase in the steady-state mRNA levels of both ppEnk and DARPP-32 but not of the

dopamine type-2 and NGFi-A transcripts. Finally, we showed that long-term bilateral

striatal expression of rAAV5-siHIUNT-1 led to a delayed in the onset of the clasping

phenotype displayed by R6/1 mice.

We are the first to demonstrate that long-term striatal expression of anti-mutant Htt

shRNAs result in reduced levels of m-Htt protein in vivo in the R6/1 model of HD. We

also showed that this reduction resulted in a decrease in the size and amount of NIIs,

concomitant with an increase in the mRNA steady-state levels of ppEnk and DARPP-32

and a delayed in the clasping phenotype in the R6/1 mouse.

Unresolved Issues

The function of wild-type Htt remains unknown. Although there is data

supporting a role for Htt in neuronal survival, these studies have focused on the ablation

of Htt expression prior to neuronal survival. Our experimental approach tested the

hypothesis that the specific knockdown of striatal m-Htt protein would lead to a slower

progression of the HD phenotype in the R6/1 mouse. Allele-specific silencing of m-Htt,

while plausible in a transgenic mouse line, will be extremely difficult to achieve within

the context of the human genome. In HD, the inheritance and expression of one CAG-

expanded allele leads to disease. shRNAs directed against the CAG domain in huntingtin,









although efficient in silencing m-Htt expression, can not discriminate between the mutant

and wild-type alleles. Silencing of wild-type Htt in adult neurons could lead to

neurodegeneration. To circumvent these problems, synthetic siRNAs directed against

polymorphisms linked with the mutant allele have successfully reduced the levels of the

mutant allele while minimally affecting the levels of wild-type protein. However, this has

yet to be proven in vivo where the effects of off-targeting remain relatively unknown.

Long-term in vivo expression of both HD6 and HD7 hammerhead ribozymes as

well as the siHUNT-2 shRNA resulted in the remarkable loss of ppEnk, DARPP-32 and

dopamine type-2 receptor mRNA steady-state levels in both R6/1 and wild-type mice.

This reduction if striatal-specific mRNAs was not due to a global reduction in

transcriptional activity since NGFi-A mRNA was induced above wild-type levels

(Chapter 3). These three molecules targeted a 22-nucleotide region of the human Htt

mRNA. HD6 was designed to target nucleotides at positions 29-41 from the ATG start

site of the human Htt mRNA (accession # L34020). HD7 targeted nucleotides at positions

38-49 from the ATG start site while the shRNA siHUNT-2 targeted nucleotides at

positions 24-45 from ATG start site. BLAST searches have revealed no similarity to

known mouse mRNA sequences, however, there are up to six expressed-sequence tags

(ESTs) from adult mouse neurospheres that match the criteria required for the HD6, HD7

or siHUNT-2-mediated cleavage of the molecule. Because the phenotype associated with

the expression of HD6 HD7 and siHUNT-2 was reminiscent to an HD-like phenotype,

further studies into the gene or genes that are being directly affected by these molecules

are warranted. One initial approach would be to isolate the genes from neurospheres

using the EST sequences as probes. One could then design ribozymes or shRNAs against









different and unique sequences within the gene or genes in order to determine their

contribution to the HD-like phenotype that we observed.

Future Studies

We report a mild-behavioral improvement in the R6/1 mouse induced by the long-

term expression of rAAV5-siHIUNT-1. The R6/1 more accurately replicates Juvenile HD

were the progression of disease is much faster and severe. Therefore, the fact that we

only attained mild cellular and behavioral improvements in the R6/1 mice does not

diminish the potential therapeutic value of shRNAs in HD, especially on the more slow-

progressing, adult-onset type. In fact, others have evaluated the therapeutic potential of a

variety of molecules and environmental enrichment in the R6/1 mouse. These studies

have resulted in varying degrees of success that paralleled the findings in our study. For

example, the administration of fatty acids led to motor improvements but no recovery in

the levels of Dl or D2 mRNA levels. Also, environmentally enriched R6/1 mice have

increased rotarod rentention times when compared to controls, however, levels of Dl or

D2 mRNAs remained unchanged. Finally, cortical transplantation of wild-type donor

cortical tissue results in a delayed in the rear paw clasping phenotype. Thus, the mild

improvements attained in our study could translate into more profound effects in slower

progressing models of HD.

At the time of this study, RNAi was an exciting, albeit, relatively new and

unknown mechanism. New understandings of the pathway and the biochemical properties

of the RISC complex have paved the way for the development of more specific and more

efficient short-hairpin RNAs. This in turn has greatly enhanced the application of

shRNAs in animal models of neurological disease. However, issues concerning

intracellular expression and delivery into target sites are just now beginning to be









addressed. Developing drug-regulatable expression cassettes and enhancing the capacity

of viral vectors to spread into and be contained within target structures will expand the

application of RNAi from therapy into the study of gene function in vivo.

The search for a cure to Huntington's disease not only entails the development of

therapies but also the design and application of molecular techniques that will allow the

HD research community to unravel the molecular cascade of events that lead to death.

This study demonstrated the therapeutic potential of RNAi-meditated knockdown of

striatal m-Htt. In addition, we also demonstrate that shRNAs can be used to understand

gene function in a temporal and spatial manner.

















LIST OF REFERENCES


1. Afione, S. A., J. Wang, S. Walsh, W. B. Guggino, and T. R. Flotte. 1999.
Delayed expression of adeno-associated virus vector DNA. Intervirology 42:213-
20.

2. Arrasate, M., S. Mitra, E. S. Schweitzer, M. R. Segal, and S. Finkbeiner. 2004.
Inclusion body formation reduces levels of mutant huntingtin and the risk of
neuronal death. Nature 431:805-10.

3. Aylward, E. H., A. M. Codori, A. Rosenblatt, M. Sherr, J. Brandt, O. C. Stine,
P. E. Barta, G. D. Pearlson, and C. A. Ross. 2000. Rate of caudate atrophy in
presymptomatic and symptomatic stages of Huntington's disease. Mov. Disord.
15:552-60.

4. Bankiewicz, K. S., S. E. Leff, D. Nagy, S. Jungles, J. Rokovich, K. Spratt, L.
Cohen, M. Libonati, R. O. Snyder, and R. J. Mandel. 1997. Practical aspects of
the development of ex vivo and in vivo gene therapy for Parkinson's disease. Exp.
Neurol. 144:147-56.

5. Bartolome, J., I. Castillo, and V. Carreno. 2004. Ribozymes as antiviral agents.
Minerva. Med. 95: 11-24.

6. Bates, G. 2003. Huntingtin aggregation and toxicity in Huntington's disease.
Lancet 361:1642-4.

7. Bates, G. P., L. Mangiarini, and S. W. Davies. 1998. Transgenic mice in the
study of polyglutamine repeat expansion diseases. Brain Pathol. 8:699-714.

8. Bjorklund, A., D. Kirik, C. Rosenblad, B. Georgievska, C. Lundberg, and R. J.
Mandel. 2000. Towards a neuroprotective gene therapy for Parkinson's disease:
use of adenovirus, AAV and lentivirus vectors for gene transfer of GDNF to the
nigrostriatal system in the rat Parkinson model. Brain Res. 886:82-98.

9. Boado, R. J., A. Kazantsev, B. L. Apostol, L. M. Thompson, and W. M.
Pardridge. 2000. Antisense-mediated down-regulation of the human huntingtin
gene. J. Pharmacol. Exp. Ther. 295:239-43.

10. Bolivar, V. J., K. Manley, and A. Messer. 2004. Early exploratory behavior
abnormalities in R6/1 Huntington's disease transgenic mice. Brain Res. 1005:29-
35.










11. Bonilla, E. 2000. [Huntington disease. A review]. Invest. Clin. 41:117-41.

12. Boutell, J. M., P. Thomas, J. W. Neal, V. J. Weston, J. Duce, P. S. Harper, and
A. L. Jones. 1999. Aberrant interactions of transcriptional repressor proteins with
the Huntington's disease gene product, huntingtin. Hum. Mol. Genet. 8:1647-55.

13. Burger, C., O. S. Gorbatyuk, M. J. Velardo, C. S. Peden, P. Williams, S.
Zolotukhin, P. J. Reier, R. J. Mandel, and N. Muzyczka. 2004. Recombinant
AAV viral vectors pseudotyped with viral capsids from serotypes 1, 2, and 5
display differential efficiency and cell tropism after delivery to different regions of
the central nervous system. Mol. Ther. 10:302-17.

14. Cha, J. H. 2000. Transcriptional dysregulation in Huntington's disease. Trends
Neurosci. 23:387-92.

15. Daly, T. M. 2004. Overview of adeno-associated viral vectors. Methods Mol. Biol.
246:157-65.

16. Davidson, B. L., and H. L. Paulson. 2004. Molecular medicine for the brain:
silencing of disease genes with RNA interference. Lancet Neurol. 3: 145-9.

17. Deocaris, C. C., S. C. Kaul, K. Taira, and R. Wadhwa. 2004. Emerging
technologies: trendy RNA tools for aging research. J. Gerontol. A. Biol. Sci. Med.
Sci. 59:771-83.

18. Dorsett, Y., and T. Tuschl. 2004. siRNAs: applications in functional genomics
and potential as therapeutics. Nat. Rev. Drug. Discov. 3:318-29.

19. Dragatsis, I., M. S. Levine, and S. Zeitlin. 2000. Inactivation of Hdh in the brain
and testis results in progressive neurodegeneration and sterility in mice. Nat. Genet.
26:300-6.

20. Ferro, P., R. dell'Eva, and U. Pfeffer. 2001. Are there CAG repeat expansion-
related disorders outside the central nervous system? Brain Res. Bull. 56:259-64.

21. Flotte, T. R., S. A. Afione, and P. L. Zeitlin. 1994. Adeno-associated virus vector
gene expression occurs in nondividing cells in the absence of vector DNA
integration. Am. J. Respir. Cell Mol. Biol. 11:517-21.

22. Funato, T. 2005. Utility of antioncogene ribozymes and antisense oligonucleotides
in reversing drug resistance. Methods Mol. Med. 106:215-33.

23. Galvao, R., L. Mendes-Soares, J. Camara, I. Jaco, and M. Carmo-Fonseca.
2001. Triplet repeats, RNA secondary structure and toxic gain-of-function models
for pathogenesis. Brain Res. Bull. 56:191-201.

24. Gardian, G., and L. Vecsei. 2004. Huntington's disease: pathomechanism and
therapeutic perspectives. J. Neural. Transm. 111:1485-94.










25. Gauthier, L. R., B. C. Charrin, M. Borrell-Pages, J. P. Dompierre, H.
Rangone, F. P. Cordelieres, J. De Mey, M. E. MacDonald, V. Lessmann, S.
Humbert, and F. Saudou. 2004. Huntingtin controls neurotrophic support and
survival of neurons by enhancing BDNF vesicular transport along microtubules.
Cell 118:127-38.

26. Grimm, D. 2002. Production methods for gene transfer vectors based on adeno-
associated virus serotypes. Methods 28:146-57.

27. Grimm, D., and J. A. Kleinschmidt. 1999. Progress in adeno-associated virus
type 2 vector production: promises and prospects for clinical use. Hum. Gene Ther.
10:2445-50.

28. Grunewald, T., and M. F. Beal. 1999. Bioenergetics in Huntington's disease. Ann.
N. Y. Acad. Sci. 893:203-13.

29. Gusella, J. F., M. E. MacDonald, C. M. Ambrose, and M. P. Duyao. 1993.
Molecular genetics of Huntington's disease. Arch. Neurol. 50: 1157-63.

30. Hackam, A. S., J. G. Hodgson, R. Singaraja, T. Zhang, L. Gan, C. A.
Gutekunst, S. M. Hersch, and M. R. Hayden. 1999. Evidence for both the
nucleus and cytoplasm as subcellular sites of pathogenesis in Huntington's disease
in cell culture and in transgenic mice expressing mutant huntingtin. Philos. Trans.
R. Soc. Lond. B. Biol. Sci. 354: 1047-55.

31. Hansson, O., J. Nylandsted, R. F. Castilho, M. Leist, M. Jaattela, and P.
Brundin. 2003. Overexpression of heat shock protein 70 in R6/2 Huntington's
disease mice has only modest effects on disease progression. Brain Res. 970:47-57.

32. Harjes, P., and E. E. Wanker. 2003. The hunt for huntingtin function: interaction
partners tell many different stories. Trends Biochem. Sci. 28:425-33.

33. Hasholt, L., K. Abell, A. Norremolle, C. Nellemann, K. Fenger, and S. A.
Sorensen. 2003. Antisense downregulation of mutant huntingtin in a cell model. J.
Gene Med. 5:528-38.

34. Hauswirth, W. W., and A. S. Lewin. 2000. Ribozyme uses in retinal gene
therapy. Prog. Retin. Eye Res. 19:689-710.

35. Hauswirth, W. W., Q. Li, B. Raisler, A. M. Timmers, K. I. Berns, J. G.
Flannery, M. M. LaVail, and A. S. Lewin. 2004. Range of retinal diseases
potentially treatable by AAV-vectored gene therapy. Novartis Found. Symp.
255:179-88; discussion 188-94.

36. Hebb, A. L., H. A. Robertson, and E. M. Denovan-Wright. 2004. Striatal
phosphodiesterase mRNA and protein levels are reduced in Huntington's disease
transgenic mice prior to the onset of motor symptoms. Neuroscience 123:967-81.










37. Hermonat, P. L., and N. Muzyczka. 1984. Use of adeno-associated virus as a
mammalian DNA cloning vector: transduction of neomycin resistance into
mammalian tissue culture cells. Proc. Natl. Acad. Sci. U SA 81:6466-70.

38. Ho, L. W., J. Carmichael, J. Swartz, A. Wyttenbach, J. Rankin, and D. C.
Rubinsztein. 2001. The molecular biology of Huntington's disease. Psychol. Med.
31:3-14.

39. Humbert, S., and F. Saudou. 2004. [Stimulation of BDNF transport by
huntingtin]. Med. Sci. (Paris) 20:952-4.

40. Huntington, G. 2003. On chorea. George Huntington, M.D. J. Neuropsychiatry
Clin. Neurosci. 15:109-12.

41. Jiang, H., F. C. Nucifora, Jr., C. A. Ross, and D. B. DeFranco. 2003. Cell death
triggered by polyglutamine-expanded huntingtin in a neuronal cell line is
associated with degradation of CREB-binding protein. Hum. Mol. Genet. 12: 1-12.

42. Kamiya, H., H. Akita, and H. Harashima. 2003. Pharmacokinetic and
pharmacodynamic considerations in gene therapy. Drug Discov. Today 8:990-6.

43. Kearns, W. G., S. A. Afione, S. B. Fulmer, M. C. Pang, D. Erikson, M. Egan,
M. J. Landrum, T. R. Flotte, and G. R. Cutting. 1996. Recombinant adeno-
associated virus (AAV-CFTR) vectors do not integrate in a site-specific fashion in
an immortalized epithelial cell line. Gene Ther. 3:748-55.

44. Keene, C. D., C. M. Rodrigues, T. Eich, M. S. Chhabra, C. J. Steer, and W. C.
Low. 2002. Tauroursodeoxycholic acid, a bile acid, is neuroprotective in a
transgenic animal model of Huntington's disease. Proc. Natl. Acad. Sci. U. S. A.
99:10671-6.

45. Kim, J. S., S. A. Reading, T. Brashers-Krug, V. D. Calhoun, C. A. Ross, and G.
D. Pearlson. 2004. Functional MRI study of a serial reaction time task in
Huntington's disease. Psychiatry Res. 131:23-30.

46. Leavitt, B. R., C. L. Wellington, and M. R. Hayden. 1999. Recent insights into
the molecular pathogenesis of Huntington disease. Semin. Neurol. 19:385-95.

47. Lewin, A. S., K. A. Drenser, W. W. Hauswirth, S. Nishikawa, D. Yasumura, J.
G. Flannery, and M. M. LaVail. 1998. Ribozyme rescue of photoreceptor cells in
a transgenic rat model of autosomal dominant retinitis pigmentosa. Nat. Med.
4:967-71.

48. Lewin, A. S., and W. W. Hauswirth. 2001. Ribozyme gene therapy: applications
for molecular medicine. Trends Mol. Med. 7:221-8.