<%BANNER%>

Neurogenesis of Adult Stem Cells from the Liver and Bone Marrow


PAGE 1

NEUROGENESIS OF ADULT STEM CELLS FROM THE LIVER AND BONE MARROW By JIE DENG A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2005

PAGE 2

This work is dedicated to my daughter, Catherine L. Deng, from whom my life is being regenerated.

PAGE 3

ACKNOWLEDGMENTS I would like to express my gratitude to my mentor, Bryon Petersen, for almost four years of unfaltering guidance he has, finally, beat the word control into my brain. I feel very lucky to have spent my time in his laboratory to study stem cells, and have the opportunity to work with a group of intelligent and fun fellow lab-mates. Additionally, I need to thank all the wonderful people with whom I was lucky to interact in Steindlers lab, especially Eric Laywell who was my mentor by the bench. I would also like to thank the invaluable members of my dissertation committee, Edwin Meyer, Edward Scott, Naohiro Terada and especially Dennis Steindler who has provided not only the outstanding mentorship to my graduate education, but also funding for all the projects included in this dissertation. My thanks also go to Gerry Shaw and Ronald Mandel, who have opened me the doors to the neuroscience and neurodegenerative disorder research. Next I would like to thank my parents, Jialie Deng and Yeufang Yuan, who gave me not only a healthy body, but also a firm heart to sustain my unceasing curiosity. Also, I need to recognize my wife of ten years, Zhengqing Luo, for all the support and inspiration she provided to me during these years together. Last, but certainly not least, I need to thank my fellow students and friends during the course of my graduate study at the University of Florida. They were, and will continue to be my true treasure for life. iii

PAGE 4

TABLE OF CONTENTS Page ACKNOWLEDGMENTS.................................................................................................iii LIST OF TABLES...........................................................................................................viii LIST OF FIGURES...........................................................................................................ix ABSTRACT.......................................................................................................................xi CHAPTER 1 INTRODUCTION...1 1.1 Definition of Stem Cell ...2 1.1.1 Three Criteria of Stem Cell Definition............................................2 1.1.2 Embryonic Stem Cell.......................................................................5 1.1.3 Adult Stem Cell................................................................................5 1.1.4 Changing View on Stem Cell..........................................................6 1.2 Brief History of Stem Cell Research ...7 1.2.1 Early Research on Embryonic Stem Cell.........................................7 1.2.2 Early Research on Adult Stem Cell.................................................8 1.2.3 Recent Development of Adult Stem Cell Biology...........................9 1.2.4 A Time for Reappraisal..................................................................10 1.3 Bone Marrow Derived Msenchymal Stem Cells....11 1.3.1 Bone Marrow Niche.......................................................................11 1.3.2 Isolation and Characteristics of Mesenchymal Stem Cells............12 1.3.3 Mesengenesis of Mesenchymal Stem Cells...................................13 1.3.4 Trans-differentiation of Mesenchymal Stem Cells........................14 1.3.5 Multipotent Adult Progenitor Cells and Marrow-Isolated Adult Multilineage Inducible Cells................................................15 1.4 Hepatic Oval Cell.......................................................................................16 1.4.1 Hepatic Oval Cell As The Adult Stem Cell In The Liver..............17 1.4.2 Induction and Isolation of Hepatic Oval Cells...............................18 1.4.3 The Multipotency of Hepatic Oval Cells.......................................20 1.5 Developmental Neurogenesis iv

PAGE 5

1.5.1 Signaling Pathways during the Developmental Neurogenesis......21 1.5.1.1 Bone Morhgenetic Protein and Noggin/Cordin system ...............................................................................22 1.5.1.2 Retinoic Acid signaling......................................................23 1.5.1.3 Fibroblast Growth Factor in neurogenesis.........................24 1.5.2 Neurogenesis in the Adult Animal Brain.......................................25 1.5.2.1 Hippocampal neurogenesis................................................25 1.5.2.2 Subependymal zone/olfactory bulb neurogenesis..............26 1.6 Neural Induction In vitro...........................................................................27 1.6.1 Neural Induction in Embryonic Carcinoma and Embryonic Stem Cell Lines..............................................................................27 1.6.2 Neural Induction from Mesenchymal Stem Cell Lines.................28 1.6.2.1 Neurotrophic Growth Factor induction..............................29 1.6.2.2 Chemical induction............................................................31 1.6.2.3 Controversies in neural trans-differentiation from mesenchymal stem cells.....................................................32 1.7 Potential Application of Stem Cell Therapy in Parkinsons Disease 1.7.1 A New Hope for Parkinsons Disease Patients..............................34 1.7.2 Current Challenges of Embryonic Tissue and Cell Therapy in Parkinsons Disease Treatment......................................................35 1.7.3 Building an Adult Stem Cell Therapy for Parkinsons Disease....36 2 THE NEURAL PROPERTY OF BONE MARROW DERIVED CELLS FROM ADULT MOUSE.......................................................................................38 2.1 Backgrounds and Introduction...................................................................38 2.2 Materials and Methods...............................................................................41 2.2.1 BMDC Culture...............................................................................41 2.2.2 FACs Analysis of BMDCs...........................................................42 2.2.3 Immunolabeling and Cell Counting...............................................43 2.2.4 Neural Induction by Elevating Cytoplasmic camp........................43 2.2.5 In situ Hybridization for GFAP mRNA.........................................44 2.2.6 Western Blotting............................................................................44 2.2.7 Transplantation of BMDCs into Neonatal Mouse Brain.............. 45 2.2.8 Y-chromosome Painting for Cell Fusion Detection.......................45 2.3 Results........................................................................................................46 2.3.1 BMDC Cultures Can Be Derived from the Bone Marrow of Adult Mice.................................................................................46 2.3.2 BMDC Cultures Normally Express Neural Markers.....................47 2.3.3 Astrocyte, but not Neuronal Proteins, Are Upregulated by cAMP Elevation........................................................................47 2.3.4 Single-Cell BMDC Clones Show Plasticity by Generating Both Neuronal and Astrocytic Lineages........................................48 2.3.5 BMDCs Exhibit Neural Differentiation upon Grafting into the Neonatal Mouse Brain.............................................................48 v

PAGE 6

2.3.6 Chromosome Analysis Reveals no Evidence of BMDC Fusion.............................................................................................49 2.4 Conclusion and Discussion .......................................................................49 3 NEURAL TRANSDIFFERENTIATION OF MOUSE HEPATIC OVAL CELL IN VIVO......................................................................................................63 3.1 Background and Introduction....................................................................63 3.2 Materials and Methods...............................................................................65 3.2.1 Hepatic Oval Cell Induction and Enrichment from Mouse Liver...............................................................................................65 3.2.2 FACs Analysis for Purity on MACs Sorted Sca-1 + Oval Cells.....65 3.2.3 Immunocytochemistry of MACs Sorted Oval Cells......................65 3.2.4 Culture of Mouse Oval Cells.........................................................66 3.2.5 Cell Transplantation into Neonatal Mouse Brain..........................66 3.2.6 In vivo Phagocytosis Assay............................................................66 3.2.7 Immunolabeling of Brain Sections................................................67 3.2.8 Quantification of Grafted Cells......................................................67 3.3 Results........................................................................................................68 3.3.1 Hepatic Oval Cell Enrichment with Sca-1 Antibody.....................68 3.3.2 Hepatic Oval Cells Survive and Differentiate in the Neonatal Mouse Brain...................................................................................68 3.3.3 Grafted Hepatic Oval Cells Express Neural Antigens...................69 3.3.4 Donor-Derived Cells Have Functional Properties of Microglia........................................................................................70 3.4 Conclusion and Discussion........................................................................70 4 NEURAL INDUCTION OF HEPATIC OVAL CELLS IN VITRO.....82 4.1 Introduction................................................................................................82 4.2 Materials and Methods...............................................................................83 4.2.1 Culture of Rat Oval Cell................................................................83 4.2.2 Neurospheres Generation and Culture...........................................84 4.2.3 Organotypic Brain Slice Culture....................................................84 4.2.4 Immunocytochemistry...................................................................85 4.2.5 Neuronal Induction Using IBMX and dbcAMP............................86 4.2.6 Neural Induction Using BME, DMSO and BHA..........................86 4.2.7 Neural Induction Using Retinoic Acid RA under 4+/4Protocol..........................................................................................87 4.2.8 Neural induction of HOC by Over-Expressing Chordin and Noggin ....................................................................................87 4.2.9 Neural Induction of HOC by Co-Culturing with Differentiating Neurospheres.........................................................87 4.2.10 Neural Induction of HOC by Micro-injecting into Neurospheres .................................................................................88 vi

PAGE 7

4.2.11 Neural Induction of HOC by Incorporating into the Embryoid Body..............................................................................88 4.2.12 Neural Induction of HOC by Transplanting into and Explanting out of Neonatal Mouse Brain......................................88 4.2.13 Neural Induction Using 5-azacytidine...........................................89 4.3 Results........................................................................................................89 4.3.1 IBMX /dbcAMP Treatment to the HOC Causes Neural-like Morphological Change...................................................................89 4.3.2 BME/BHA Does not Induce Neural-like Change in HOC............89 4.3.3 Use of Retinoic Acid under 4+/4Protocol Treatment Does not Induce Neural Differentiation in HOC...........................90 4.3.4 Over-Expressing Chordin and Noggin Does not Induce Neural Differentiation in HOC......................................................90 4.3.5 Co-Culturing with Differentiating Neurospheres Does not Induce Neural Differentiation in HOC..........................................90 4.3.6 Internalization of HOC with Neuropheres Contribute Little to HOC Neural Differentiation......................................................91 4.3.7 Internalization of HOCs into the Embryoid Body Does not Lead to Neural Differentiation of HOCs.......................................92 4.3.8 Brain Tissue Transplantated with GFP + HOC Generate GFP + Neurospheres .......................................................................92 4.3.9 HOC Lives Poorly on Organotypic Brian Slice Culture................93 4.4 Conclusion and Discussion........................................................................93 5 SUMMARY AND CONCLUSION....107 LITERATURE CITED ...................................................................................................111 BIOGRAPHICAL SKETCH ..........................................................................................131 vi i

PAGE 8

LIST OF TABLES Table Page 3-1 Survival rate of transplanted HOCs in the neonatal mouse brain... 3-2 Composition of the neural markers in the transplanted HOCs in the neonatal mouse brain...................................................................................80 3-3 The percentage of cells taking up Microbeads among the total GFP+ Cell......................................................................................................81 v iii

PAGE 9

LIST OF FIGURES Figure Page 2-1 BMDC culture and characterization......................................................................56 2-2 BMDCs express neuron specific proteins spontaneously under normal culture condition.....57 2-3 Cytoplasmic cAMP elevation promote GFAP expression in BMDCs..................58 2-4 Single cell cloned BMDCs exhibit mutlipotency by generating progenies of different property through symmetric and asymmetric division...................................................................................................................59 2-5 BMDCs differentiate into neurons and astrocytes upon transplantation into the lateral ventricle of the neonatal mouse brain............................................60 2-6 Confocal scanning microscopic imagines demonstrate the immunolabeling of BMDCs with neuronal specific proteins..............................................61 2-7 Confocal scanning microscopic imagine evaluation of cell fusion between male animal derived BMDCs and endogenous cells of male recipient mouse in the brain...................................................................................62 3-1 Characteristics of mouse hepatic oval cells enriched using MACs magnetic beads.......................................................................................................75 3-2 Hepatic oval cells survive and differentiate in the neonatal mouse brain.......................................................................................................................76 3-3 Differentiated GFP + hepatic oval cells express neural-specific proteins in the neonatal mouse brain.....................................................................77 3-4 Oval cells acquire microglia phenotype and phagocytosis activity in the mouse brain..................................................................................................78 4-1 Neural induction of HOCs using Isobutyl-methylxanthine and dibutyryl cyclic AMP (IBMX /dcAMP.................................................................98 4-2 Neural induction of HOCs using Beta-Mercaptoethanol and Butylated Hydroxyanisole (BME/BHA)................................................................................99 ix

PAGE 10

4-3 Neural induction of HOC using Retinoic Acid (RA) under 4+/4protocol................................................................................................................100 4-4 Neural induction of HOC by over-expressing chordin and noggin.....................101 4-5 Neural induction of HOC by co-culturing with differentiating neurospheres........................................................................................................102 4-6 Neural induction of HOC by incorporating into the core of neurospheres..........103 4-7 Neural induction of HOC by incorporating into embyoid bodies (EBs).............104 4-8 Neural induction of HOCs by transplanting into and explanting out of the neonatal mouse brain.....................................................................................105 4-9 HOCs culture on organotypic brain slices...........................................................106 x

PAGE 11

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy NEUROGENESIS OF ADULT STEM CELLS FROM THE LIVER AND BONE MARROW By Jie Deng May 2005 Chairman: Bryon E. Petersen Major Department: Pathology, Immunology and Laboratory Medicine Recent reports of the adult stem cell multipotencies have generated tremendous interest regarding their potential therapeutic value, while bypassing ethical concerns surrounding the use of human embryonic stem cells. Among the different adult stem cells, the bone marrow-derived mesenchymal stem cells (MSCs) may represent the best hope for cell replacement therapy since, in addition to their multipotency and accessibility, MSCs may also be used in autologous transplantations to minimize immune rejection. The isolation of a large number of hepatic oval cells (HOCs) holds tremendous promise as a source for liver transplantation in treating both acute and chronic liver failure. With the recent reports of the trans-differentiation of oval cells into the insulin-producing pancreatic cells, as well as neural-like cells in vivo, using HOCs in treating diseased tissues other than liver may also be possible. The use of stem cell therapy in treating neurodegenerative disorders has attracted considerable attention lately. In Parkinsons disease (PD), the engraftment of fetal xi

PAGE 12

mesencephalic neurons, which are rich in postmitotic dopaminergic neurons, has significantly improved the patient symptoms. But limited by ethical issues as well as short of supplies in utilizing embryonic tissue, the alternative to use adult stem cells has moved to the forefront of the research. The trans-differentiation of MSCs into neural cell types has been explored extensively, with several groups reporting that these stem cells can trans-differentiate into neurons, astrocytes and microglias. However, controversies of the adult stem cell multipotency arose after reports of failures to repeat several significant previous experiments, as well as confounding factors of possible cell contamination or fusion. In an attempt to clarify these issues, I studied two types of adult stem cells, the mesenchymal bone marrow derived cells (BMDCs) and the hepatic oval cells. There is a significant difference between these two types of adult stem cell in their capability to differentiate into neural phenotypes. While the BMDCs spontaneously generate neurogenic and astrogenic progenitors, HOCs showed little sign of neural trans-differentiation capability in vitro. However, both BMDCs and HOCs differentiated and expressed neural specific proteins after they were grafted into the neurogenic subependymal zone of the neonatal mouse brains. xi i

PAGE 13

CHAPTER 1 INTRODUCTION Highlighted by several historical breakthroughs, stem cell biology saw its rebirth at the end of the last century. In 1997, the world was surprised by Wilmat et al. (1997), who demonstrated that the nucleus of a somatic cell showed full genetic potential by giving birth to Dolly sheep after injecting it into a denucleated oocyte. A year later, Thomson et al. (1998) developed an isolation and culture method to maintain human embryonic stem cells in vitro. In the field of adult stem cell research, Ferrari et al. (1998) first reported the trans-differentiation of bone marrow stem cells into muscle tissue in1998. The same year Shi et al. (1998) followed by reporting the endothelial tissue from bone marrow. A year later, Petersen et al. (1999) reported the bone marrow derived hepatocytes following hepatic injury, and in 2000, Brazelton et al. (2000) reported neural regeneration from bone marrow source. These reports of the adult stem cell multipotency changed the view of the old paradigm in cell biology and opened new possibilities for treating human diseases. With the findings of adult stem cell plasticity, it becomes possible to replace the injured, or senile tissues by either stimulating the proliferation of endogenous adult stem cells, or grafting allogenic progenitors derived from an exogenous source. However, questions about the genuineness and potential application of the adult stem cell trans-differentiation phenomenon quickly arose, and calls for re-evaluation began to appear (Holden & Vogel, 2002). The low number of trans-differentiation seen in vivo, as well as cell fusion and failure to repeat some experiments, puzzles scientists. 1

PAGE 14

2 From the initial wide-range of reported plasticity to the later reexamination of those findings with more stringent criteria, in the span of only five years, the study of stem cell biology experienced the usual ups-and-downs of a new scientific field. In spite of the unclear future of the adult stem cell biology, the closer and broader re-evaluations of various issues are generally agreed on and pursued by scientists. 1.1 The Definition of Stem Cell Defining stem cell is one of the most difficult tasks in the field of cell biology, because it is a cell type defined by its functional attributes to generate different cell types in making of organisms rather than the physical property. It immediately implies an inevitable paradox of maintaining cell stability in the process of functionality evaluation. Although still under debate, a working definition of stem cell is a clonal selfrenewing entity that is functionally multipotent and thus can generate multiple differentiated cell types (Melton & Cowan, 2004). Based on the development stages, there are embryonic stem (ES) cells and adult stem (AS) cells. ES cells exist in the embryogenesis stage that can eventually give rise to a whole animal. The term adult stem cell is used to refer to stem cells found in the tissue of an adult animal. Different names are normally given to AS cells following the tissue types in which they reside, such as hematopoietic stem cell (HSC), liver 'stem' cell, or neural stem cell (NSC), etc. 1.1.1 Three Criteria of Stem Cell Definition The self-renewal of a stem cell is the ability to maintain its own numbers without input from another cell stage. It is rather hard to evaluate this property under in vitro conditions since tissue culture itself may alter the maintenance of the cell being cultured. A vague criterion to use, in this case, is the extensive proliferation capability in base

PAGE 15

3 culture medium without apparent morphological change (Melton & Cowan, 2004). However, some somatic cells would appear to fit into this standard even in vivo but the number of the passages ( in vitro), or divisions ( in vivo ) is normally limited in somatic cells. Young cells that may be derived from stem cells have to replenish the senile cells to maintain a stable population in the tissue in vivo. For the stem cells, the in vitro passage number should be higher than eighty, an upper limit of most somatic cells (Melton & Cowan, 2004), to unlimited. In vivo stem cells should be able to last throughout the lifetime of the tissue in which they reside. Although clonality is regarded as the gold standard (Melton & Cowan, 2004) to evaluate a stem cell, it is practically difficult to use in defining AS cells. ES cells are clonogenic: the ability to create all the cell types of an animal that is demonstrated repeatedly by chimeric animals. With a careful experimental design, a single hematopoietic stem cell has also showed its clonogenicity by generating all the progenies of the hematopoietic lineage as well as many other cell types (Krause et al., 2001). Other AS cell types that reside in solid organs are much more difficult to be tested for their clonality, simply because it is impossible to repeat the developmental process of these solid organs in the adult animals. Some researchers argue that, although defined as stem cells by functional studies, mesenchymal stem cells from bone marrow will always be a heterogeneous population, because a portion of the cells differentiate spontaneously during normal culture (Quesenberry et al., 2004). Under these circumstances, they argue that the clonality is an idol standard and is logically impossible to achieve for these types of stem cells.

PAGE 16

4 Stem cell multipotency describes the functional aspect of this unique cell type that is distinct from that of a somatic cell. It refers to the multi-lineage differentiation capability of stem cells. It should be noticed that, in addition to the morphologic and immuno-phenotypic characteristics, the functional evaluation of a cell should be included to claim a successful differentiation. Different terms are normally used in corresponding to the potentiality hierarchies that exist in different types of stem cells. A fertilized egg is call totipotent because it can generate full functional organism, as well as the placenta and other supporting tissues. Embryonic stem cells are called pluripotent, illustrated by their capability to generate every tissue of an animal after being grafted into the ovary of a viable female foster animal. The term multipotent is used to describe the progenitors of different germ layers that have lost the ability to generate a whole embryo after ovary implantation. Finally, a group of terms such as bipotent, unipotent, or monopotent is used to describe stem cells with more restri cted potencies. Included in this group are most of the AS cells that are generally tissue specific, and only give rise to one or two mature cell types of the tissue they reside. For example, hepatic oval cells are usually called bipotential for the reasons that they only differentiate into hepatocytes and cholangiocytes in the adult liver. However, under the recent development of adult stem cell biology, the term trans-differentiation is adopted to describe the multipotency of AS cells demonstrated in vivo and in vitro. Trans-differentiation refers to the phenomenon that the progenitors of one cell lineage can differentiate into cell types of other lineages either being treated with specific, sometimes non-physiological level of induction reagents in vitro, or being grafted into tissue that is different from their origin in vivo In this context, the hepatic oval cells may also be called multipotent, because they have been

PAGE 17

5 shown to differentiate into pancreatic and neural lineages (Yang et al., 2002; Deng et al., 2003). 1.1.2 Embryonic Stem Cell Embryonic stem cells are derived directly from the inner cell mass of preimplantation embryos after the formation of a cystic blastocyst. The inner cell mass would normally produce the epiblast and eventually all adult tissues, which may help to explain the developmental plasticity exhibited by ES cells. In fact, ES cells appear to be the in vitro equivalent of the epiblast, as they have the capacity to contribute to all somatic lineages, and in mice, to produce germ line chimeras (Papaioannou, 2001). In animal species, in vivo differentiation can be assessed ri gorously by the ability of ES cells to contribute to all somatic lineages and produce germ line chimerism. In the purpose of obtaining suitable cell lines for the regenerative medicine, extensive efforts have been dedicated to generate different cell types in vitro from ES cells. However, the major obstacles are to isolate and purify the differentiated cells, and to eliminate the uncommitted ES cells after differentiation. As the result of their pluripotency, the uncommitted ES cells tend to give rise to teratomas when grafted in vivo 1.1.3 Adult Stem Cell The term adult stem cell refers to the cells found in adult animal that constantly replenish the somatic cells in the tissue of their origin. Although the existence of these AS cells is beyond doubt in most cases, the isolation and identification of these cells proved to be difficult. A rigorous assessment of the adult stem cells is to prospectively purify a population of cells using cell surface markers, transplant a single cell from the purified population into a syngeneic host without any intervening in vitro culture, and

PAGE 18

6 observe self-renewal and tissue, or organ regeneration for multipotency. However, as discussed above, this type of in vivo reconstitution assay is not well defined, and impossible to do for the cells in solid organs. Therefore, it is important to assess the in vitro differentiation capability of the AS cells, which may reflect their developmental potential. In recent studies, the concept of multipotency of AS cells has moved to the forefront of stem cell research. It is suggested that the restrictions in cell fate are not permanent, but flexible (trans-differentiation) or reversible (de-differentiation) (Ferrari et al. 1998; Shi et al., 1998; Petersen et al., 1999; Brazelton et al., 2000). This concept has generated new ideas in the adult stem cell research, and infused new avenues into the promising stem cell therapy. 1.1.4 A Changing View on Stem Cell Along with the findings of stem cells in various tissues in the adult animal, two models start to emerge that may be used to explain the origin and nature of the AS cells. The traditional model believes that there is a stem cell pool residing in the tissue of each organ of the adult animal that may have been preserved from the tissue specific progenitor cells during the development. The hematopoietic stem cell is an example that may be best explained by this model. Hepatologists also believe that the hepatic oval cells, the stem cells of the liver that have been known for over fifty years, originate locally within the canal of herring in the liver (Alison et al., 1996). However, recent findings of bone marrow derived hepatocytes suggest that oval cells may have derived from a bone marrow derived precursors (Petersen et al ., 1999; Lagasse et al ., 2000). These reports, along with many others that have demonstrated the bone marrow derived allogeneic tissues in solid organs, suggest a second model of the AS cell origin. This

PAGE 19

7 model proposed that there might be a master adult stem cell source in the bone marrow of the adult animal. These master cells can circulate and differentiate into lineage-specific progenitors, and eventually reconstitute the damaged tissue of the solid organ (Hennessy et al. 2004). 1.2 Brief History of Stem Cell Research 1.2.1 Early Research of Embryonic Stem Cell The systematic analysis of ES cells began in the1960s, when Finch and Ephrussii (1967) established the first pluripotent embryonic carcinoma (EC) cell line from the undifferentiated compartment of murine and human germ cell tumors (Andrews, 2002). Based on experience with the culture of EC cells, the first murine ES cells were isolated from the inner cell mass of the blastocyst in 1981 (Evans & Kaufman, 1981; Martin, 1981). Bradley et al. (1984) later developed a technique to reconstitute early mouse embryos by injecting ES cells into blastocyst, which has formed the basis for the hundreds of knock out and knock in transgenic animals (Thomas and Capecchi, 1987). Embryonic stem cells have also allowed in vitro studies of the initial stages of the mammalian development, without the need to harvest peri-implantation embryos, and dissection of the basic mechanisms underlying plauripotency and cell lineage specification. In the following years, significant efforts have been made to isolate ES cells from other species including rabbits (Graves and Moreadith, 1993), pigs (Li et al., 2003) and primates (Thomson et al., 1996), and highlighted by the isolation of human ES cell in 1998 (Thomson et al., 1998; Amit et al., 2000; Reubinoff et al., 2001; Richards et al. 2002; Hovatta et al., 2003). The establishment of various ES cell lines from different species has largely expanded our means to understand the mechanistical aspects of the

PAGE 20

8 stem cell self-renewal and differentiation in the culture dish. But the generation of human ES cell lines has sparked a great deal of controversy particularly in certain religious communities (Orive et al., 2003). 1.2.2 Early Development of Adult Stem Cell The history of AS cell research goes back to early studies of each individual stem cell type resides in different organs of the adult animal. These cells possess strong regenerative capability to replenish the senile or sick cells of the tissue in which they reside under physiological condition or injury, and the study of these stem cells appeared to be unrelated from each other. Hematopoietic stem cell (HSC) in bone marrow is one of the first-known and most-studied adult stem cells. It is also the most successful example of stem cell therapy, a term that has been give new meaning and hope in the past couple of years. The ground breaking work by Till and McCulloch (1961) in the early 1960s provided the first clear evidence that mouse bone marrow contained stem cells capable of repopulating hematopoietic tissues following cellular depletion by exposure to a cytotoxic agent, e.g., radiation. They demonstrated that grafted exogenous tissue can invade the hematopoietic organ spleen, and form colony-forming units (CFU). This experiment provided the scientific basis for subsequent human bone marrow transplant studies and dramatically expanded our knowledge of HSCs. Liver stem cell is another type of adult stem cell that has been well studied, but yet poorly understood. Grisham and Hartroft (1961) first described oval cells in the recovering liver in 1961. The rat oval cell model developed by Evarts et al. in 1987 (Evarts et al., 1987a) and the murine oval cell model by Preisegger et al. in 1999 (Preisegger et al., 1999) have dramatically enhanced our knowledge of HOCs. However, since oval cells cannot be found in large quantity

PAGE 21

9 under normal physiological condition, or most forms of liver injuries including partial hepatectomy, the precursors of oval cell become the focal point of the controversy surrounding the liver stem cells. Neural stem cell (NSC) in the adult brain is one of the latest stem cells to be identified. For years, the central nervous system in adult animals was regarded as mitotically dormant. In the early 1990s, Reynolds and Weiss (1992) first reported the neurogenesis in the subventricular zone of adult mouse brain. Subsequently, several reports showed that NSCs exist in the dentate gyrus of the hippocampus (Gage et al. 1995; Palmer et al., 1997), as well as in the spinal cord (Shihabuddin et al., 2000). Reynolds et al. (1992) also developed the widely used neurosphere culture system, which allows clonal NSCs to grow into sphere-like colonies. The use of neurospheres has given scientists a quantitative tool to study the function aspect of NSCs, and has, in some way, placed the research of NSCs ahead of many other AS cells. Utilizing neurosphere culture, Kondo and Raff (2000) and Laywell et al. (2000) reported that astrocytic stem cells might be the NSCs in the adult brain, and further revealed the identity of neural stem cells. 1.2.3 Recent Development of Adult Stem Cell Biology The recent development of multipotency exhibited by a variety of AS cells, especially the multipotency of bone marrow derived stem cells, has dramatically changed the course of stem cell research in the past five years. Several studies have made a significant contribution during this period. Utilizing the well established bone marrow reconstitution of irradiated recipient in combination of genetic tracing markers, Ferrari et al. (1998) first reported the transdifferentiation of bone marrow stem cells into muscle in1998. Later the same year, Shi et al. (1998) reported the endothelial generation from

PAGE 22

10 bone marrow following the similar design. Petersen et al. (1999) reported the bone marrow derived liver regeneration after injury in 1999, and Brazelton et al. (2000) reported neural regeneration from bone marrow source in 2000. Plasticity has also been found in cells isolated from other tissues including skeletal muscle (Jackson et al., 1999) and brain (Bjornson et al., 1999). The underlined impact of these paradigm-shifting work has changed our view on the long-believed forward development biology, the way the animal body function, as well as how we may be able to treat diseases in the future. 1.2.4 A Time for Reappraisal Despite the wide range of reports of AS cell plasticity from different tissue and species, the initial enthusiasm of the possible clinical application quickly gave way to rigorous critical evaluation of the trans-differentiation phenomenon. The genuineness of the newly found neurogenesis in the human neocortex (Shankle et al., 1998) was the first to be challenged by Korr and Schmitz in 1999, and followed by Rakic et al. in 2002. Several groups then showed that the hematopoietic cells that were proposed to have been derived from trans-differentiation of muscle cells were in fact bona fide hematopoietic cells resident within muscle tissue (McKinney-Freeman et al., 2002; Issarachai et al., 2002). Terada et al. (2002) and Ying et al. (2002) independently demonstrated that when bone marrow cells are cultured with ES cells, they fuse with each other, and the hybrid cells take on an ES cell phenotype. These studies may suggest that the adult stem cells thought to be trans-differentiating might have fused with host cells within various local tissue microenvironments. This was further confirmed when it was demonstrated that it might also be an event in vivo in the liver (Vassilopoulos et al., 2003; Wang et al., 2003), brain (Weimann et al., 2003a; Weimann et al., 2003b), and heart (Alvarez-Dolado et al.,

PAGE 23

11 2003). Recently, Zhang et al. ( 2004) demonstrated that trans-differentiation and cell fusion might co-exist in the process of cardiomyocyte regeneration from CD34 + bone marrow derived stem cells. Under the current circumstances, it is obvious that more serious evaluation of the trans-differentiation phenomenon with more stringent criteria is needed for the future of stem cell-based regenerative medicine. 1.3 Bone Marrow Derived Mesenchymal Stem Cells Bone marrow derived mesenchymal stem cell (MSC) was first described by Petrakova et al. (1963) some 40 years ago. It was demonstrated that pieces of bone marrow transplanted under the renal capsule of mice formed an osseous tissue over a period of several weeks that was invaded by hematopoietic cells (Petrakova et al., 1963). Mesenchymal stem cells can be extensively expanded in vitro and readily differentiate into mesenchymal lineage including osteocytes, chondrocytes and stromal cells with little to no specific inductions. In the recent development of regenerative medicine, MSCs have been the favorite cell source for transplantation because of their potent differentiation capability, and also because of the accessibility and possible autologous transplantation to eliminate immuno-rejection (Awad et al., 1999; Dezawa et al., 2004). Despite the great potential to differentiate into many useful cell types, the identity of MSCs, or even whether MSC are true stem cells or not, remains questionable (Javazon et al. 2004). Limited by our current knowledge of the MSC surface marker, there has not been a globally agreed context for characterizing MSCs. 1.3.1 The Bone Marrow Niche Bone marrow stroma is a complex tissue with the function of supporting hematopoiesis. It hosts a number of cell types and maintains the undifferentiated HSC

PAGE 24

12 and supports differentiation of erythroid, myeloid, and lymphoid lineages. There are adherent macrophages and other mononuclear cells of hematopoietic lineage, including some phagocytic cells and other antigen-presenting (dendritic) cells. There are mesenchymal cells, such as osteoblasts and adipoblasts. There are endothelial cells, which may arise from a hemangioblast or other endothelial cell precursor. Bone marrow stroma promotes cellular differentiation to these specific lineages while also maintaining stem and progenitor cells. Bone marrow also actively maintains the undifferentiated state of HSCs and MSCs. 1.3.2 Isolation and Characteristics of Mesencymal Stem Cells Mesenchymal stem cells can be isolated from a bone marrow aspirate, and readily cultured via methodology similar to that originally used by Friedenstein, and optimized by Caplan et al. in 1991, utilizing their adhesive properties (Goshima et al., 1991b; Friedenstein, 1995). Mesenchymal stem cells are spindle-shaped and fibroblast-like in their undifferentiated state of in vitro culture. In the rodent experimental animals, bone marrow aspirates are normally taken from the tibias and femurs. In human marrow donors, they are often harvested from the superior iliac crest of the pelvis. Frequently, the marrow sample is subjected to fractionation via density gradient centrifugation and cultured in a medium such as Dulbeccos modified Eagles medium (DMEM), containing 10-20% fetal bovine serum. Primary cultures are usually maintained for 12-16 days, and are then detached by trypsinization followed by sub-culturing. An important property, but not a defi ning feature, of the MSC population in vitro is their ability to form colonies after low-density plating or single-cell sorting (Brockbank et al. 1985; Kuznetsov et al., 1997; Colter et al., 2000; Javazon et al., 2001). As

PAGE 25

13 demonstrated by Owen and Friedenstein (1988) and DiGirolamo et al. (1999), colonies derived from CFU-F assays are extremely heterogeneous in both appearance (morphology and size) and differentiation potential. One of the difficulties in defining MSCs is that there are no immunophenotypic markers that are uniquely expressed by MSCs (Haynesworth et al., 1992; DiGirolamo et al., 1999). In order to identify a culture derived from whole bone marrow cell suspension as MSCs, an array of immunophenotypic profile has to be used. MSCs express neither a hematopoietic marker such as CD45, CD34, CD14, nor a endothelial marker such as CD31. They do express a large number of adhesion molecules such as CD44, SH-4, and some stromal cell markers such as SH-2, SH-3 and SH-4, with si gnificant variations reported by different laboratories (Haynesworth et al., 1992; Majumdar et al., 1998; Deans & Moseley, 2000; Peister et al., 2004). As discussed previously, perhaps the most useful approach for presumptive identification of the MSC remains functional. The capacity for induced in vitro differentiation of MSCs to bone, fat, and cartilage is perhaps the single critical requirement to identify putative MSC populations (Pereira et al., 1994; Pittenger et al., 1999). It is important to emphasize that currently all MSC populations analyzed by clonal assays are heterogeneous, with individual cells capable of varying differentiation potential and expansion capacity (Owen & Friedenstein, 1988; DiGirolamo et al., 1999). 1.3.3 Mesengenesis of Mesenchymal Stem Cells The differentiation of MSCs into bone, cartilage, and fat in vitro has been welldescribed (Barry, 2003). Osteogenic activation requires the presence of -glycerolphosphate, ascorbic acid-2-phosphate, dexamethasone, and fetal bovine serum (Barry, 2003). When cultured in monolayer in the presence of these supplements, the cells

PAGE 26

14 acquire an osteoblastic morphology with up-regulation of alkaline phosphatase activity and deposition of a hydroxyapatite mineralized extracellular matrix (Barry, 2003). Chondrogenic differentiation occurs when MSCs are cultured under certain conditions, including 1) a three-dimensional culture format, 2) a serum-free nutrient medium, and 3) the addition of a member of the transforming growth factorsuperfamily. MSCs cultured in monolayer in the presence of isobutylmethylxanthine become adipocytes with the production of large lipid-filled vacuoles (Suzawa et al., 2003). The in vivo differentiation capability of MSCs is demonstrated by their contribution to the repairing process of the injured tissue after transplantation. Mesenchymal stem cells implanted in an osseous defect, such as a large segmental gap in the femur, stimulate formation of new bone (Bruder et al., 1998). Similarly, Ponticiello et al. (2000) showed that scaffolds loaded with MSCs and implanted in an osteochondral lesion on the medial femoral condyle give rise to both cartilage and bone cells. In addition, Toma et al. (2002) reported that human MSCs, when delivered by infusion to an immunocompromised mouse, could engraft to the normal myocardium and differentiate into a cardiomyocyte phenotype. Significantly, greater injury-specific cardiac homing of infused MSCs occurs when the cells are delivered within 10 mins of infarction, compared to 2 weeks post-infarction (Toma et al., 2002). 1.3.4 Trans-differentiation of Mesenchymal Stem Cells In the past several years, various groups reported that bone marrow derived stem cells differentiate into hepatic, muscle, kidney, lung, as well as neural lineages in vivo (Factor et al., 1990; Ferrari et al., 1998; Brazelton et al., 2000; Orlic et al., 2003). However, since bone marrow contains both HSCs and MSCs, the use of whole bone

PAGE 27

15 marrow cells in most of these experiments cannot distinguish which of the two populations contributed to the newly generated tissue. In vitro experiment using cultured MSCs to induce differentiation may provide better demonstration of MSC plasticity, since HSC has not been described to endure long-term culture without differentiating toward a mature phenotype. However, it may be argued that multipotency demonstrated by in vitro experiments may not reflect the nature of MSCs in vivo since the culturing process normally involves a non-physiological level of growth factors or chemicals. Nevertheless, several groups have demonstrated that long-term cultured MSCs can be induced to differentiate into hepatic, pancreatic and neural lineages (Woodbury et al., 2000; Sanchez-Ramos et al., 2000; Deng et al., 2001; Lee et al., 2004; Shu et al., 2004; Tang et al., 2004). Furthermore, engraftment of cultured MSCs into neonatal or fetal mouse brain have demonstrated a migration a nd trans-differentiation of MSCs into neural lineage (Azizi et al., 1998; Kopen et al., 1999). 1.3.5 Multipotent Adult Progenitor Cells and Marrow-isolated Adult Multilineage Inducible Cells Jiang et al. (2002) reported bone marrow derived stem cells, namely multipotent adult progenitor cells (MAPCs) from the postnatal marrow of mice and rats, following the typical MSC isolation protocol. The MAPCs can be cultured indefinitely in a relatively nutrient-poor medium. They are highly plastic and differentiate into cells bearing endodermal, mesodermal, or ectodermal markers under induction in vitro. The MAPCs also display their broad differentiation potential in vivo For these assays, ROSA26-derived MAPCs injected into murine blastocysts resulted in chimeric mice with ROSA-26 cells contributing to nearly all somatic tissues, including brain, lung, myocardium, liver, intestine, and kidney. After intravenous administration into a

PAGE 28

16 sublethally irradiated immunodeficient mouse, MAPCs differentiate, in varying degrees, into hematopoietic cells in the marrow, blood and spleen, and into epithelial cells in liver, lung, and intestine. Similar to MAPC, DIppolito et al. (2002) isolated a bone marrow derived population of postnatal young and old human cells with extensive expansion and differentiation potential to generate chondrocyte, adipoctye, neuron, and insulin producing cells in vitro. They named their cells marrow-isolated adult multlineage inducible (MIAMI) cells. Like the MAPCs, the cell surface antigen profile of MIAMI cells demonstrate MSC characteristics, indicating both types belong to mesenchymal cells. Because of the concerns about the manipulation in cell culture process, critics may still question whether these highly potent stem cells are the real MSCs exist in the bone marrow of an animal or not. Nevertheless, the existence of MAPCs and MIAMIs may have proved the therapeutic value of bone marrow derived stem cells as the potential cell source in the stem cell therapy. 1.4 Hepatic Oval Cells Hepatic oval cell is a transit cell type during the liver regeneration when hepatocyte proliferation is impeded (Pack et al., 1993). Hepatic oval cells differentiate into hepatocytes and bile duct cells, and can be isolated from the animal models in large quantity. Cultured oval cells are self-renewable and have been shown to become pancreatic cells when challenged with high glucose in an in vitro system (Yang et al., 2002), and neural cells after transplantation into the mouse brain (Deng et al., 2003).

PAGE 29

17 1.4.1 Hepatic Oval Cell As The Adult Stem Cell In The Liver The potent regeneration ability of the liver after injuries has been known for centuries. The ancient legend of Prometheus should be mentioned to illustrate this historically well-known phenomenon. Prometheus was punished severely for stealing the secret of fire and giving it to man. Zeus bani shed him to Mt. Caucasus, where he endured the torture of a bird of prey pecking out his liver on a daily basis. Every night the liver would repair itself only to be pecked out the next day. Despite the mythic quality of this story, the liver does indeed have the remarkable ability to regenerate. In general, hepatocytes maintain their potential to divide and will respond to elevated growth factors such as hepatocyte growth factor (HGF), acidic fibroblast growth factor (aFGF) after liver injury (Kan et al., 1989; Lindroos et al., 1991). However, when hepatocyte proliferation is blocked by chemicals such as allyl alcohlol (AA) and carbon tetrachloride (CCl 4 ), stem cell-involved liver regeneration is initiated to recover the lost liver function (Rechnagel & Glende, Jr., 1973; Badr et al., 1986; Belinsky et al., 1986). Although no "hepatic stem cell" has been convincingly isolated from health animal liver, a "transit" type, the so-called hepatic oval cell has been successfully isolated in large quantity under protocols causing liver injuries while inhibiting the hepatocyte proliferation (Shinozuka et al. 1978; Evarts et al., 1987b; Evarts et al., 1989). Oval cells were first described by Grisham and Hartroft (1961) et al in the recovering liver. They are bi-potential in that they can differentiate into mature hepatocytes and biliary epithelial cells in vitro and in vivo (Sirica et al., 1990; Sirica, 1995). However, the progenitors of HOCs, the presumable "hepatic stem cell", remains enigmatic and under debate currently. There are two major ideologies: 1) Alison et al. (1996) detected so-called "facultative liver stem

PAGE 30

18 cells" at the canal of herring that could have given rise to the oval cells and thus they are native to the liver; and 2) Petersen et al. (1999) demonstrated that, after certain liver injuries, rats that received bone marrow transplantation hosted mature hepatocytes of donor cell origin, suggesting that oval cells may have derived from an extra hepatic source. Theise et al. (2000) also provided evidence that human hepatocyte could also derived from bone marrow. Crosbie et al. (1998) provided in vitro evidence to show that there are hematopoietic stem cells exist in the human liver. Besides the known observation of their bipotential differentiation ability, the oval cells express some proteins that mark its stem cell identity. Oval cells express many hematopoietic stem cell markers, such as Thy1, c-kit, and CD34 in the rat, and flt-3 in the mouse (Omori et al., 1997a; Omori et al., 1997b; Petersen et al., 1998a). Recently, it is also reported that mouse oval cells also express Sca-1 as well as CD34 (Petersen et al., 2003). 1.4.2 Induction and Isolation of Hepatic Oval Cells In the rat model, several protocols have been described to induce the oval cell proliferation (Evarts et al., 1989). The most common protocols are so-called two-step induction, in which rats are given a chemical such as 2-acetylaminofluorene (2AAF), which hinders hepatocyte proliferation, and physical damage such as PHx or CCl 4 (Petersen, 2001). 2-AAF is a chemical that, when metabolized by hepatocytes, blocks the cyclin D1 pathway in the cell cycle. The oval cells then arise in the periportal region of the liver. In the mouse, the HOC proliferation does not respond to 2-AAF/PHx protocol the same way as in the rat. Preisegger et al. (1999) developed a model using the chemical 3,5-diethoxycarbonyl-1,4-dihydrpcollodine (DDC) in a standard diet at a concentration of 0.1%. The mouse oval cells are also different from the rat oval cells in their marker

PAGE 31

19 expression profiles. Instead of OV6 antibody as that of rat, the mouse oval cells are positive to A6 antibody (Factor et al., 1990). The early methods to isolate the oval cells from the rat and mouse livers are based on gradient centrifugation of the non-parenc hymal cell (NPC) fraction after collagnease perfusion of the liver. Several other methods such as Metrizamide gradient (Sells et al., 1981), Percoll gradient (Sirica & Cihla, 1984) and centrifugal elutriation (Yaswen et al., 1984; Pack et al., 1993) have also been used in the past two decades. However, the purity of the oval cell population from these isolation techniques cannot exceed 90% based on marker testing. Recently, the oval cells have been found to highly express the hematopoietic stem cell marker Thy-1 in rat (Petersen et al., 1998a). Based on this finding, Petersen et al. (1998a) described an isolation method to utilize this feature of the oval cells, in combination of the flow cytometry technique. This method yields a 95-97% enriched population of Thy-1.1 + cells, which were also showed to express the traditional oval cell markers of -fetal protein (AFP), cytokine 19 (CK-19), gamma glutamyltransferase (GGT) and OV6. Using centrifugal elutriation, Pack et al. (1993) has been able to establish three cell lines from DL-ethionine-fed rats. They've demonstrated that the oval cells can be maintained in culture for at least two years. In their culture, rat HOCs have a size of about 10-15 m in diameter, positive for CK-19, GGT immunocytochemistry staining. However, CK-19 became negative after 10 passages, demonstrating a transformation of the oval cells at in vitro culture condition. In our culture medium that contains high level of stem cell growth factors, such as stem cell factor (SCF), leukemia inhibitory factor (LIF), IL-3 and IL-6, HOCs started to proliferate in about a week, and appear typical oval cell morphology. If lower the growth factor

PAGE 32

20 concentration by ten times, the oval cells transformed into a morphology resembling marrow stromal cells. Mouse oval cells can also be enriched by using their cell surface antigen such as Sca-1 (Petersen et al., 2003). The cells isolated with this method express the mouse oval cell specific proteins such as AFP and A6, and can be culture for about two months. 1.4.3 The Multipotency of Hepatic Oval Cells The multipotency of HOCs to differentiate into cell lineage other than hepatocyte and bile duct cells has not been explored adequately. A few studies showed that HOCs might adopt different cell types when cultured under various conditions (Pack et al., 1993). When co-cultured with porcine microvascular endothelial cells (PMEC), HOCs give a strong epithelial morphology. If the HOCs in culture (3-day colonies) are overlaid with Matrigel, they appear to become stellate cells 7 days later (Petersen, 2001). Recently, Yang et al (2002) trans-differentiated a purified rat oval cell line into endocrine pancreas capable of insulin-secretion in vitro, when challenged with high concentration of glucose and nicotinomide. It has also been demonstrated that the mouse HOCs express multiple neural specific proteins, and exhibit phgocytosis activity of functional microglias after transplanted into the mouse brain (Deng et al., 2003). 1.5 Developmental Neurogenesis The nervous system is the most complex of all the organ systems in the animal embryo. In mammals, for example, billions of neurons develop a highly organized pattern of connections, creating the neuronal network that makes up the functioning brain and the rest of the nervous system. During embryogenesi s, an orchestration of delicately balanced signaling molecules are involved to develop this complex network. And yet, recent

PAGE 33

21 evidences show that neurogenesis also exists in the adult brain, a concept against the long-held belief of developmenta l biologists and neurologists. As in other developing systems, nerve cell specification is governed both by external signals and by intrinsic differences generated through asymmetric cell division. During neurogenesis, multiple biological processes function in concert to ensure that the diverse neurons and glias proliferate, differentiate, migrate and form synapses at the appropriate time and place. These processes rely on the precise control of temporal and spatial expression of genes that encode secreted and membrane associated proteins. Proteins destined for secretion or for transport to locations within the membrane (e.g. neurotransmitters, growth factors, guidance cues, ion channels, etc.) convey fundamental information necessary for the cells to respond to the evolving intraand extra-cellular environments during development. 1.5.1 Singling Pathways during the Developmental Neurogenesis Vertebrate neurogenesis involves several progressive steps mediated by multiple signaling pathways that eventually sculpt the gene expression profile of specific subtypes of neuron. As the first step, the neural induction defines the neural plate, which consists of neural precursors that express pan-neural genes. In general, three signaling pathways have been implicated in the neural induc tion: repression of bone morphogenetic protein (BMP) signaling, and activation of the fibroblast growth factor (FGF) as well as Wnt pathways (Knecht & Harland, 1997; Baker et al., 1999). The apparently autonomous acquisition of neural character on removal of inhibitory BMP signaling in the frog has led to the proposal that the neural cell state occurs by default (Hemmati-Brivanlou & Melton, 1997; Tropepe et al. 2001). The well-known BMP signaling antagonists are secreting

PAGE 34

22 proteins encoded by noggin chordin follistatin and Xnr3 (Diez & Storey, 2001) Wnt pathway has also been shown to reduce BMP signaling, and promote neural cell fate (Baker et al., 1999). More recently, FGF signaling has been shown to initiate (Alvarez et al. 1998; Storey et al., 1998) and to be required (Wilson et al. 2000) for neural induction in chick, acting in part by suppressing BMP4 transcription (Streit et al., 1998). The second major event during the vertebrate developmental neurogenesis is the dorsoventral, anteroposterior, and segmentation patterning of the central nervous system. Signaling molecules at this stage include retinoic acid Krox20 eFGF for anteroposterior determination, and sonic hedgehog for dorsoventral determination (Franco et al., 1999). The last step is the neuron subtype specification, which involves a combination of homeodomain transcription factors such as Dbx1 Dbx2 Nkx2.2 Pax6 and Pax7 (Briscoe et al., 2000). As the neuron maturation reaches to the final stage, these transcription factors are down-regulated (Walther & Gruss, 1991; Scardigli et al., 2001), replaced by commonly known neuronal markers such as Tuj1 NF-L and NeuN (Diez & Storey, 2001). O verlaps of developmental stages may exist, and one signaling molecule may be involved in multiple pathways. 1.5.1.1 Bone Morphgenetic Protein and Noggin/Chordin system The bone morphgenetic protein 4 (BMP-4), and its inhibitors noggin and chordin forms one of the most important external signaling system throughout the embryonic neurogenesis (Hemmati-Brivanlou & Melton, 1997). An enormous amount of efforts in early twentieth century was devoted to identify the signals involved in neural induction in amphibians and birds (Waddington, 1950; Spemann & Mangold, 2001). The results indicated that the inducing molecules do not act directly on the cells that will form neural

PAGE 35

23 tissue, but act instead on molecules that inhibit the cells from forming neural tissue (Hemmati-Brivanlou & Melton, 1997). BMP-4 was later found to play a pivotal role in the neural induction, since it inhibits cells from forming neural tissue. The inhibitors of BMP signaling are proteins encoded by the genes noggin and chordin Noggin and chordin are secreted proteins unrelated to any of the known growth factor families. When added into isolated blastula animal caps, the noggin and chordin proteins induced neural markers expression in the culture (Hemmati-Brivanlou & Melton, 1997). 1.5.1.2 Retinoic Acid Signaling Retinoic acid (RA) is a small hydrophobic moleculea derivative of vitamin Awhich has an important role in local signaling in vertebrate development. The precursor of RA, retinol, has been described as a hormone, released from its storage sites in the liver and kidney. However, unlike other hormones, there are no reported regulatory factors that control retinols release into the circulation. Homeostatic controls exist solely to maintain steady levels of plasma retinol. During embryogenesis, RA play a critical role in patterning, segmentation, and neurogenesis of the posterior hindbrain and it has been proposed that they act as a posteriorizing signal during hindbrain development (Durston et al. 1997). The endogenous RA is a precisely regulated factor that controls many aspects of embryonic development. RA binds to and activates transcriptional regulators of the nuclear receptor family that also includes the receptors for thyroid and steroid hormones. Two types of binding proteins ar e thought to be involved in the intracellular regulation of retinoids; cellular retinol binding protein (CRBP) types I and II, and cellular retinoic acid binding protein (CRABP) types I and II (Ong et al., 2000). CRBP I binds retinol and is involved in the storage as well as in the oxidation of retinol via retinol to

PAGE 36

24 RA (Carson et al., 1984; Eriksson et al., 1987; Posch et al., 1992). The role of CRBP II, which is mainly found in the enterocytes of the gut, may be to handle retinoids after dietary uptake for further metabolism and transport to the liver (Porter et al., 1985). 1.5.1.3 Fibroblast Growth Factor in neurogenesis There are at least 23 different members of the fibroblast growth factor (FGF) family. These FGFs are classified as a family on the basis of a conserved 120 amino acid core region and share a 30-60% amino acid identity across the family. Fibroblast growth factor family members have diverse functions, being potent modulators of cell proliferation, migration, differentiation a nd survival (Goldfarb, 1996; Ornitz, 2000). There are four FGF receptor genes, FGFR-1-4, and within these, alternative splicing creates receptor isoforms with distinct speci ficities for different FGFs. Expression studies demonstrate that members of the FGF family are highly expressed early in the developing central nervous system (CNS) (Ford-Perriss et al., 2001). Among them, FGF-1, FGF-2 and FGF-15 are more generally expressed throughout the developing neural tube in both the embryonic and adult CNS. Noticeably, FGF-8 and FGF-17 are tightly localized to specific regions of the developing brain and are only expressed in the embryo during the early phases of proliferation and neurogenesis (Ford-Perriss et al., 2001). There is accumulating evidence that FGFs have a critical role in the initial generation of neural tissue at the stage of neural induction. Fibroblast growth factor-1 has been reported to stimulate neuronal process regrowth in retinal ganglion cell cultures (Lipton et al., 1988), spiral ganglion explants (Dazert et al., 1998) and adult dorsal root ganglion cells (Mohiuddin et al., 1996). Fibroblast growth factor-3 is down-regulated in the hindbrain

PAGE 37

25 by E11, but expression continues in the vestibular sensory epithelia and organ of Corti at later ages (Mansour et al., 1993; McKay et al. 1996). 1.5.2 Neurogenesis in the Adult Brain Increasing evidence has demonstrated that generation of new neurons is not entirely restricted to prenatal development, but continues throughout adult life in certain regions of the mammalian brain (Steindler et al., 1996; Gage, 2002). The demonstration of neurogenesis in the human brain makes this phenomenon of particular relevance to treating neurological injury and disease, with the hope that the ability to generate new neurons may be utilized for structural brain repair (Eriksson et al., 1998). Neurogenesis is not widespread within the adult mammalian brain, but restricted to the two germinal centers, the hippocampal dentate gyrus and the anterior subependymal zone (SEZ) of the lateral ventricles (Thomas et al., 1996; Peretto et al., 1999). Transient neurogenesis may also occur in the cerebral cortex (Gould et al., 2001). Similarly, limited neurogenesis may occur in the substantia nigra, although this is disputed (Lie et al., 2002; Frielingsdorf et al. 2004). As a preserved niche for neural stem cells, SEZ and hippocampus also provide an ideal environment for testing the neurogenecity of other adult stem cell recently in the postnatal and adult brain (Zheng et al., 2002; Deng et al ., 2003; Hudson et al., 2004). 1.5.2.1 Hippocampal neurogenesis In the hippocampus of the adult brain, a certain rate of cell proliferation has been described in the dentate gyrus granular layer, giving rise to granule neurons (Altman & Das, 1965; Kaplan & Bell, 1984). In the rat, such neurogenesis has been observed up to 11 months of age. Newly generated hippocampal granule cells extend dendrites and axons; the latter grow through the hilus and CA3 region of the Ammons horn (Stanfield

PAGE 38

26 and Trice, 1988), thus representing an example of long-distance axonal pathfinding through a mature brain neuropil. Unlike the olfactory receptor neurons, newly generated cells of the dentate gyrus substantially increase with age (Bayer et al., 1982). It has been proposed that hippocampal granule cells can originate during adulthood both from local proliferation in the granule cell layer and after short migration from the hilus (Cameron et al. 1993), in a manner similar to that described during postnatal development (Schlessinger et al., 1975). Despite accumulating evidence for the existence and modulation of adult neurogenesis, there is still limited data elucidating the functional contribution of these newly generated neurons (Kempermann et al., 2004). However, there is evidence that individual neurons can become functionally integrated (van Praag et al. 2002). In addition to forming appropriate anatomical connections (Markakis & Gage, 1999), newly generated hippocampal neurons have been shown to exhibit appropriate electrical activity (van Praag et al., 2002). 1.5.2.2 Subependymal zone/olfactory bulb neurogenesis The olfactory bulb is another area of the mammalian CNS where neurogenesis has been described during adulthood (Altman & Das, 1965; Hinds, 1968; Steindler et al., 1996). In early studies this neurogenesis was correlated with an adjacent region of the forebrain known as the subependymal zone (SEZ), a remnant of the primitive forebrain. Proliferating cells within the SEZ migrate along a defined pathway, the rostral migratory stream (RMS), where cell proliferation continues until reaching the olfactory bulb where they integrate into the granule and glomerular cell layers (Luskin, 1993; Lois & AlvarezBuylla, 1994). The SEZ, which undoubtedly constitutes the major site of cell proliferation in the adult mammalian brain (Tzeng et al., 2004), has been indicated as the

PAGE 39

27 source of cell precursors, known as brain marrow (Steindler et al., 1996). Thus, cell proliferation in the SEZ and neurogenesis in the olfactory bulb form a complex system spanning the length of the forebrain (about 5 mm in rodents (Altman & Das, 1965; Lois & Alvarez-Buylla, 1994)). The newly generated neurons in the olfactory bulb also show evidence of functional integration into neural circuitry involved in processing sensory input (Carleton et al., 2003). While these newly generated neurons appear capable of functioning and participating in established circuitry, recent studies carried out on this system provided evidence for several morphological and functional peculiarities. For example, the persistence of long-distance migration and multipotent stem cell compartment appear qualitatively and quantitatively different from those described in other neurogenetic areas of the adult mammalian nervous system (Peretto et al., 1999). 1.6 Neural Induction In vitro In vitro neural induction offers an ideal system for testing theories of neurogenesis during development. The recent progress within stem cell biology has infused a high interest in developing effective protocols to drive stem cells into a neural phenotype, in the hope that they may be used to replace the lost neural tissues in the neurodegenerative diseases. 1.6.1 Neural Induction from Embryonic Carc inoma and Embryonic Stem Cell Lines The early efforts of neural differentiation in vitro are mostly contained within ES and embryonic carcinoma (EC) cell types, in the purpose of understanding the basic mechanism of cell differentiation during neurogenesis. As discussed above, RA is an important growth factor during the embryogenesis, it is also commonly used to induce EC or ES cells into neuron phenotype in culture. Pleasure et al. (1992) used RA to treat NT2-N cells, a human teratocarcinoma cell line, and achieved a 95% pure neuron

PAGE 40

28 population. Bain et al. (1995) used a so-called +/4- protocol, in which ES cell aggregates were treated with RA for four da ys and cultured without RA for four days in non-adhesive culture condition. The cell aggregates were then plated on an adhesive substrate and were differentiated into neurons, while aggregates not treated with RA differentiate into various lineages (Bain et al. 1996). Gottlieb and Huettner (1999) found a significant upregulation of RA receptor(RAR) and RAR mRNA, but a rapid downregulation of RAR and retinoid X receptor(RXR) mRNA during RA-induced neuronal differentiation of mouse EC cells (Gottlieb & Huettner, 1999). These support the hypothesis that in vitro and in vivo pathways may be comparable. Besides RA, other pro-neuronal growth f actors have also been used, either by direct addition to the medium, or through gene transfer into the cells. Pevny et al. (1998) demonstrated that P19 cells started to express neuronal markers in 4-5 days after transfected with the sox1 gene. They also showed that Sox1 and neurofilament proteins are mutually exclusive in the mature neurons, a phenomenon also exists in the developing brain. Sox1 is expressed throughout the neural plate and early neural tube, but is down regulated in a stereotyped manner in cells along the dorsoventral axis of the neural tube later in the development stage (Pevny et al., 1998). As a potent antagonizing factor of BMP signaling, noggin has also been shown to convert embryonic stem cells into primitive neural stem cells by inhibiting BMP signaling (Gratsch & O'Shea, 2002). 1.6.2 Neural Induction from Mesenchymal Stem Cell Line Mesenchymal stem cells are the most-studied adult stem cells in terms of differentiation induction in vitro, because they are easy to obtain and culture (Azizi et al., 1998; Kopen et al., 1999; Brazelton et al., 2000). The neural induc tion methods of MSCs

PAGE 41

29 range widely, from the use of neurotrophic fact ors, co-culturing with neural tissue, to the so-called chemical inductions. 1.6.2.1 Neurotrophic Growth Factor induction Neurotrophic growth factors are polypeptide hormones that are essential for the development and maintenance of the central nervous system. During the period of target innervation, limiting amounts of neurotrophic factors regulate neuronal numbers by allowing survival of only some of the innervating neurons, the remaining being eliminated by apoptosis (Kirkland & Franklin, 2003; Yeo & Gautier, 2004; Wiese et al., 2004). Several lines of evidence indicate that various neurotrophic factors also influence the proliferation, survival and differentiation of precursors of a number of neuronal lineages (Kirkland & Franklin, 2003; Wiese et al. 2004). In the adult brain, neurons continue to be dependent on trophic factor support, which may be provided by the target or by the neurons themselves. Their ability to promote survival of peripheral and central neurons during development and after neuronal damage has stimulated the interest in these molecules as potential therapeutic agents for the treatment of nerve injuries and neurodegenerative diseases. They are also widely used in the neural induction from adult stem cells in vitro Sanchez-Ramos et al. (2000) treated mouse marrow stromal cells with epithelial growth factor (EGF) and brain derived neurotrophic factor (BDNF), as well as co-culture with fetal midbrain tissue, and successfully detected neuronal markers such as NeuN and MAP2 expression. In combination with 5-azacytidine, a demethylating agent capable of altering the gene expression pattern, Kohyama et al. (2001) treated the marrow stroma-derived mature osteoblasts with noggin, and induced neural

PAGE 42

30 differentiation. Several commonly utilized member s of the neurotrophic factors in neural differentiation protocols are listed below. Nerve growth factor (NGF) is the prototype for the neurotrophin family of polypeptides which are essential in the development and survival of certain sympathetic and sensory neurons in both the central and peripheral nervous systems. Nerve growth factor was discovered when mouse sarcoma tissue transplants into chicken embryos caused an increase in the size of spinal ganglia. In the course of attempting to characterize the agent responsible for this action, snake venom, used as a phosphodiesterase, was found to be a rich source of NGF (Angeletti et al ., 1968). Brain-Derived Neurotrophic Factor (BDNF) is important in development and maintenance of neuronal populations within the central nervous system or cells directly associated with it. BDNF has been shown to enhance the survival and differentiation of several classes of neurons in vitro, including neural crest and placode-derived sensory neurons, dopaminergic neurons in the substantia nigra, basal forebrain cholinergic neurons, hippocampal neurons, and retinal ganglial cells (Larsson et al., 2002; Gustafsson et al., 2003). Neurothophin3 (NT-3) is a member of the neurotrophin family. Neurothophin3 is important in development and maintenance of neuronal populations and promotes differentiation of neural crest derived sensory and sympathetic neurons. Neurothophin3 is critical for proprioceptive 1a afferent neurons, which relay information from peripheral muscle spindles to motorneurons, sending projections to spinocerebellar neurons. It is also critical in the superior cervical and nodose ganglia.

PAGE 43

31 1.6.2.2 Chemical induction The term chemical induction was first adopted by Lu et al. (2004) to describe a group of neural induction methods that use potent chemical reagents to achieve rapid and dramatic neuron-like morphology acquisition in adult stem cells. Woodbury et al. (2000) was the first to report that dimethylsulf oxide (DMSO) and butylated hydroxyanisole (BHA) could induce rat and human marrow stromal cells to differentiate into neurons. Deng et al. (2001) treated human marrow stromal cells with isobutyl mehtylxanthine (IBMX) and dibutyral cyclic AMP (dbcAMP) to elevate cytoplasm cAMP and observed morphological change from stromal cell-like to neuron-like (Deng et al., 2001). Since then, there have been many groups using similar methods to induce mesenchymal stem cells from a variety of sources with essentially the same observation (Lambeng et al., 1999; Black & Woodbury, 2001; Safford et al., 2002; Jori et al., 2004; Lopez-Toledano et al. 2004; Lu et al., 2004). However, the next section will discuss in depth the effect of chemical induction is currently very controversial. Several commonly used reagents listed below. Cell-permeable Dibutyryl Cyclic Adenosine Monophosphate (db cAMP) analog activates cAMP dependent protein kinase A (PKA). It affects cell growth and differentiation by altering gene expression. It can inhibit cell proliferation and induce apoptosis, yet reported to improve the survival of dopaminergic neurons in culture (Mourlevat et al ., 2003). It has been shown to block free radical production in response to parathyroid hormone, pertussis toxin or ionomycin (Graves and Moreadith, 1993). 3-Isobutyl-1-Methylxanthine is a non-specific inhibitor of cAMP and cGMP phosphodiesterase. The increase in cAMP level as a result of phosphodiesterase

PAGE 44

32 inhibition by IBMX activates PKA, leading to decreased proliferation, increased differentiation, and induction of apoptosis. 3-Isobutyl-1-Methylxanthine inhibits phenylephrine-induced release of 5-hydroxytryptamine from neuroendocrine epithelial cells of the airway mucosa (Li et al., 2003). Dimethyl Sulfoxid is a common cryoprotective agent to keep most mammalian cells from mechanical injury caused by ice crystals from freezing, concentration of electrolytes, dehydration, pH changes and denaturation of proteins. It has been shown that DMSO induces differentiation and function of leukemia cells of mouse (Thomson et al. 1996), rat (Amit et al., 2000), and human (Reubinoff et al., 2001). Dimethyl Sulfoxid is also found to stimulate albumin production in malignantly transformed hepatocytes of mouse and rat and to affect the membrane-associated antigen, enzymes, and glycoproteins in human rectal adenocarcinoma cells (Richards et al., 2002). 1.6.2.3 Controversies in neural trans-differe ntiation from mesenchymal stem cells Because of the inadequate characterization of the MSCs currently, there are significant inconsistency, even controversies among the reports of neural transdifferentiation from MSCs in different laborat ories. In spite of wide range reports of trans-differentiation of MSCs to generate neurons and astrocytes, Wehner et al. (2003) argued that bone marrow-derived cells do not generate astroctyes. They used a transgenic mouse strain that contains GFP gene expression cassette under GFAP promoter control, and failed to observe GFP expression in all three experiments both in cell culture and in vivo engraftment. Recently, two independent groups, Lu, et al. (2004) and Neuhuber, et al. (2004), re-evaluated the rapid and robust neural-like neurofilament formation in differentiated MSCs under the DMSO/BHA induction protocol reported earlier. They

PAGE 45

33 applied time lapse imaging analysis, and compared cells of different types including rat epidermal fibroblasts, PC12 in response to chemical stressers such as triton or sodium hydroxide, and observed identical changes in both MSCs and fibroblasts. They concluded that the neuron-like morphological and immunocytochemical changes of MSCs, following the so-called chemical induction, are not the result of genuine neurofilament extension but represent actin cytoskeleton retraction in response to chemical stresses (Lu et al. 2004). Summarizing recent work on neural trans-di fferentiation of MSCs, there are four uncertainties among the reported results: 1) the early reports rely the neuronalization conclusion mostly, if not only, on the immunophenotypic characteristics of the differentiated MSCs. As evidence start to show that stem cells express many markers spontaneously, to rely on this criterion solely may not reflect the real induction processes (Tondreau et al., 2004); 2) the process-bearing morphological characteristics has been overvalued to indicate the neuronal differentiation. Detailed inspection of the differentiated cells revealed little resemblance to typical neuron morphology in most of the reports (Lu et al., 2004; Neuhuber et al., 2004); and 3) many of the transdifferentiation clams rely only on in vitro data, few has reported the fate of cells upon transplanted into the CNS in vivo which makes it hard to evaluate the functionality, and therapeutic value of differentiated cells. 1.7 Potential Application of Stem Cell Therapy in Parkinsons Disease Neurodegenerative diseases belong to a group of neurological disorders that are caused by the loss of neurons in a defined fashion regionally, or globally in the central nervous system. Such diseases include Parkinsons Disease (PD), Alzheimers Disease

PAGE 46

34 (AD), stroke, amyotrophic lateral sclerosis (ALS) and Huntingtons Disease (HD) etc. Transplantation of stem cells or their derivatives and mobilization of endogenous stem cells within the adult brain, has been proposed as future therapies for neurodegenerative diseases. It may seem unrealistic to induce functional recovery by replacing cells lost through disease, considering the complexity of human brain structure and function. Studies in animal models have nevertheless demonstrated that neuronal replacement and partial reconstruction of damaged neuronal circuitry is possible (Piccini et al ., 2000). There is also evidence from clinical trials that cell replacement in the diseased human brain can lead to symptomatic relief (Lindvall et al., 2004). 1.7.1 A New Hope for Parkinsons Disease Patients Among the common neurodegenerative diseases, the pathology of PD is relatively better understood. The loss of dopaminergic (DA) neurons confined mostly to the relatively defined nigrostriatal pathway in the basal ganglia region of the brain. Parkinsons Disease is the second most-common neurodegenerative diseases affecting around 2% of the population over 65 years of age in the world. There are 500,000 new cases each year in the United States alone. As the PD onset has close connection with aging, the increase of number of incidences is expected due to continuous improvement of living standard in the future. Cell replacement therapy has come into sight along with the rapid development of the stem cell biology. Among the common aging related neurodegenerative disorders, PD patients hold the highest expectation to be benefited in the upcoming area of regenerative medicine. It has been shown that the symptoms of patient with severe PD can be significantly improved by using fetal mesencephalic neurons, which are rich in postmitotic dopaminergic neurons (Freed et al., 1992; Freed et al.,

PAGE 47

35 1993; Bjorklund et al., 2003). The use of fetal tissue has been one of the clinical options for the PD patient, but is unlikely to become a routine procedure due to the ethical concerns in using human embryos. More profoundly, the short of tissue supply largely limits the application of this approach at the moment. Under this situation, stem cells, perhaps adult stem cells, appear to be the best solution. Indeed, the easily accessible bone marrow derived stem cells have been extensive studied to differentiate into DA neuron phenotype, since the realization of the therapeutic potential of adult stem cells (Pavletic et al. 1996; Schwarz et al., 1999; Jiang et al., 2003; Yoshizaki et al., 2004; Hermann et al., 2004; Dezawa et al., 2004). The key issue is to identify a proper cell type that is capable to transform into DA neurons, and lacks the propensity to cause tumor. It has been shown that the risk of forming teratoma is reduced if the ES cells are differentiated in vitro before transplantation, which implies that somewhat committed adult stem cells may be safer in terms of tumorigenesis when used clinically (Erdo et al., 2003). 1.7.2 Current Challenges of Embryonic Tissue and Cell Therapy in Parkinsons Disease Treatment Although the use of fetal mesencephalic tissue has produced promising improvement for the PD patients, the present cell replacement procedures are still far from optimal (Freed et al., 1993; Bjorklund et al., 2003) Some recent sham surgerycontrolled trials showed only modest improvement in relief the patients symptoms, compare to some early reports (Freed et al., 2001; Olanow et al., 2003). After transplantation, 7% of grafted patients also developed dyskinesia (Hagell et al., 2002; Olanow et al., 2003), similar to the L-dopa therapy. However, this adverse effect is not due to dopaminergic overgrowth (Hagell et al., 2002), but may have been caused by uneven and patchy reinnervation (Ma et al., 2002), giving rise to low or intermediate

PAGE 48

36 amounts of striatal dopamine. Another major problem in using ES cells is the risk for teratoma after grafted into the brain. In one particular study, it was reported that implantation of mouse ES cells into rat striatum caused teratomas in 20% of the animals (Bjorklund et al. 2003), and ES cells seem more prone to generate tumors when allografted into the same species (Erdo et al., 2003). 1.7.3 Building an Adult Stem Cell Therapy For Parkinsons Disease While the use of ES cells encounters problems and needs to be improved dramatically, working towards applying adult stem cells in treating PD is certainly an appealing strategy. There have been reports to induce MSCs into tyrosine hydroxylase (TH) positive neurons in culture dish (Jiang et al., 2003; Tondreau et al., 2004), but the current work is too preliminary. To develop a clinically competitive adult stem cell therapy, it must provide advantages over current L-dopa treatments for PD. Cell-based approaches should induce long-term improvements of mobility and suppression of dyskinesia. On the basis of results obtained from fetal transplants in both animal and human studies, several aspects need to be considered for clinically suitable adult stem cell-derived DA neurons: i) the cells should release dopamine in a regulated manner and should show the molecular, morphological and electrophysiological properties of substantia nigra neurons; (ii) the cells must be able to reverse the motor deficits in animals that resemble the symptoms in persons with PD; (iii) the yield of cells should allow for at least 100,000 grafted dopaminergic neurons to survive over the long term in each human putamen; (iv) the grafted dopaminergic neurons should re-establish a dense terminal network throughout the striatum; and (v) the grafts must become functionally integrated into host neural circuitries (Hagell et al., 2002).

PAGE 49

37 Although controversies still exist in multipotency of adult stem cells, there is growing body of evidence points to the genuineness of these discoveries reported in the past few years. The issues of cell fusion or technical error that brought cautions to this field should be used wisely to move our de tection and evaluation methods forwards, not to deter further discoveries. After all, we cannot afford to ignore the potential of adult stem cells possible role in the future medical practice; the revolutionary idea of regenerative medicine may in large part depend on how much we know about adult stem cells either in their native niche, or in a grafted host environment. With the increasing number of experiments designed to test the therapeutic value of MSCs in the animal model of neurodegenerative diseases, our knowledge about their potential in both neural trans-differentiation and clinical application will certainly grow. For a field that is young and active as adult stem cell biology, we should let future to decide its fate while investing our best efforts.

PAGE 50

CHAPTER 2 THE NEURAL PROPERTY OF BONE MARROW DERIVED CELLS FROM ADULT MOUSE 2.1 Background and Introduction Previous studies have shown that adult stem cells exist in various tissues of adult animals, and that these tissue-specific stem cells may have the capacity for trans-differentiating into cell types of different lineages (Wetts & Fraser, 1988; Jones et al., 1995; Ferrari et al., 1998; Brazelton et al., 2000; Petersen, 2001; Hughes, 2002). The apparent multipotency of adult stem cells has generated tremendous interest regarding their potential therapeutic value, while bypassing ethical concerns surrounding the use of human embryonic stem cells. Furthermore, adult stem cells are more restricted in their differentiation potential, and thus are thought to be less tumorigenic than embryonic stem cells. However, because some laboratories failed to repeat several significant experiments (Wagers et al., 2002; Wehner et al., 2003), the early exuberance surrounding the first reports of adult stem cell plasticity has given way to serious concerns about whether what was being described was true trans-differentiation, or an epiphenomenona mediated, perhaps, by cell contamination or fusion (McKinney-Freeman et al., 2002; Terada et al., 2002; Ying et al., 2002; Issarachai et al., 2002). The bone marrow-derived mesenchymal stem cell (MSC) has been known since 1963, when Petrakova and colleagues (Petrakova et al., 1963) demonstrated that pieces of bone marrow transplanted under the renal capsule of mice formed an osseous tissue over a period of several weeks that was invaded by hematopoietic cells. The MSC may 38

PAGE 51

39 represent the best hope for stem cell-base replacement therapy since, in addition to their potency and accessibility, it may be possible to use MSCs in autologous transplantations to minimize immune rejection (Awad et al., 1999; Dezawa et al., 2004). For this reason, the MSC is one of the most extensively-studied adult stem cells with respect to transdifferentiation potential (Kadiyala et al., 1997; Ferrari et al., 1998; Bruder et al., 1998; Pittenger et al., 1999; Awad et al., 1999). However, despite this great interest the MSC remains enigmatic as both its identity and qualification as a true stem cell remains uncertain (Javazon et al., 2004; Baksh et al., 2004). This uncertainty results primarily from the lack of universally defined cell surface markers to characterize the MSC in the manner of the hematopoietic stem cell (Devine, 2002; Javazon et al., 2004; Baksh et al., 2004). Additionally, the relatively unrefined MSC isolation methodology, that has remained essentially unchanged for 40 years, has no doubt also contributed to the weak characterization of the MSC. The high incidence of age-related neurological disorders has spurred interest in the ability of the MSC to trans-differentiate into neural lineage (Torrente et al. 2002; Chopp & Li, 2002; Sugaya, 2003). Among vari ous protocols to induce neural transdifferentiation of MSCs, the use of chemicals including dimethylsulfoxiede (DMSO), butylated hydroxyanisole (BHA), butyl ated hydroxytoluene (BHT), as well as dibutyral cyclic AMP and isobutylmethylazanthine (IBMX) has become popular, as they induce a rapid and robust neuron-like morphological transformation from the normally flat, fibroblast-like appearance of MSCs (Woodbury et al., 2000; Sanchez-Ramos et al., 2000; Deng et al., 2003). Since then, there has been a series of studies using similar methods to induce neural differentiation of st em cells from a variety of other sources

PAGE 52

40 (Lodin et al., 1979; Lambeng et al., 1999; Safford et al., 2002; Lopez-Toledano et al., 2004). However, recent studies cast doubt on the 'neuralization' of bone marrow-derived stem cells. Wehner, et al. (2003) utilized a transgenic mouse line carrying a green fluorescence protein (GFP) expre ssion vector under the control of the glial fibrilary acidic protein (GFAP) promoter to examine the capacity of MSCs to undergo neuralization. After three in vivo and in vitro experiments, they concluded that bone marrow-derived cells could not differentiate along the astrocytic lineage. Recently two independent groups, Lu, et al. (2004) and Neuhuber, et al. (2004) reevaluated the rapid and robust neural-like neurofilament formation by MS Cs under the DMSO/BHA induction protocol reported earlier. They applied time lapse imaging analysis, and compared cells of different types including rat epidermal fibroblasts, PC12 in response to chemical stressers such as triton or sodium hydroxide, and observed identical changes in both MSCs and fibroblast. They concluded that the neur on-like morphological and immunocytochemical changes of MSCs following the treatments are not the result of genuine neurofilament extension but represent actin cytoskeleton retraction in response to chemical stress. Although these results can not account for all the neural trans-differentiation of MSCs reported so far, and they can not explain the in vivo neuralization of the MSCs, they do raise serious questions about the generality of the neural differentiation potential of the MSCs, and temper the hope of potentially applying MSCs in the treatment of brain disorders. In an attempt to further clarify these issues, we established long-term cultures of bone marrow-derived cells (BMDCs) from whole bone marrow, using a common protocol for mesenchymal stem cell culture (Goshima et al., 1991a; Friedenstein, 1995).

PAGE 53

41 We assessed BMDC stemness by examining the clonality, and cell division patterns (symmetric vs. asymmetric). To assess the previous protocol of using dbcAMP/IBMX (Deng et al., 2001) for rapid neuronal induction, we examined the expression of neural specific proteins in BMDCs and NIH3T3 preand post-treatment. To further test the multipotency, and their potential for cell-replacement therapy for neurological disorders, we transplanted BMDC into the neonatal mouse brain and exam their in vivo performance as a neuro-progenitor cell. We also applied confocal scanning imaging system, and Y-chromomsome painting technique to confirm the authenticity of immunolabeling of the neural specific protein expressions by BMDCs, and to assess the cell fusion events in vivo 2.2 Materials and Methods: 2.2.1 BMDC Culture Eight weeks old C57/B6 and C57/B6GFP mice were used to establish BMDC cultures, utilizing the physical property of plastic adherence (Goshima et al., 1991a; Friedenstein, 1995). In brief, mice were given a lethal dose of phenobarbital, and the tibias and femurs were removed. A 22-gauge needle filled with Dulbeccos Modified Eagles Medium (DMEM) was used to flush out whole bone marrow. The recovered cells were then mechanically dissociated, filtered through a 70 m mesh, and plated in 35mm tissue culture dishes containing DMEM supplemented with 20% fetal bovine serum (FBS), 0.5% gentamycin, and 1000units/ml of Leukemia Inhibitory Factor (LIF), as per Jiang, et al. (2002). After 24hrs, the non-adherent cells were removed, and the culture medium was completely replaced. After reaching confluency, BMDCs were passaged (1:3 dilution) twice a week with fresh medium.

PAGE 54

42 In order to generate clonal cultures, we grew single BMDCs, in conditioned medium collected from confluent BMDC cultures derived from whole bone marrow. Conditioned medium was centrifuged at 2,600 g for 10min., and then filtered through a 0.22 m mesh. We created a dilution series with BMDCs to reach a cell density of one to two cells per 5 L, and plated 5 L of the cell suspension in each well. Immediately after plating, we examined each well with phase microscopy, and excluded those wells containing more than one cell. We then added 100 L of mixed medium (50% conditioned medium + 50% fresh medium). In order to ensure single-cell clonality, we again examined each well after an additional 24 hours, and discarded those containing more than one cell. Clonal BMDC cultures were maintained in the mixed medium until confluent, at which point the cells were maintained in fresh, unconditioned medium. 2.2.2 FACs Analysis of BMDCs Immunofluorescence with a variety of antibodies against surface antigens was used to characterize BMDCs. These antibodies included directly-conjugated anti-Sca1, anti-CD34, anti-CD45, and directly-conjugated anti-mouse IgG 2a (PharMingen; 1:500) as a control. In addition, the following unconjugated antibodies were used: antic-Kit, antiCD9, anti-CD31, anti-CD105 (PharMingen; 1:500), anti-CD11b (Serotec; 1:300), and anti-rat IgG 2a (PharMingen; 1:500), as a control. Primary antibodies were applied for 30min. at room temperature, followed by washing and application of fluorescentlyconjugated secondary antibodies for an additional 30min for the un-conjugated antibodies. Cells were then centrifuged at 200 g, and washed twice in PBS to eliminate unbound antibodies. Approximately 10 6 cells/mL cell suspension was run through a flow cytometer (CELLQuest, Becton Dickinson FACScan).

PAGE 55

43 2.2.3 Immunolabeling and Cell Counting Immunolabeling was performed on glass coverslips plated with BMDCs. Cells were fixed in ETOH:acetic acid (95:5) for 15mins., washed with PBS containing 0.1% Triton (PBST), and blocked for 30min in PBST supplemented with 10%FBS. Cells were then incubated with primary antibodies overnight at 4 C, washed, and incubated in secondary antibodies for 1hr at RT. Free-floating, 40m brain sections were immunolabeled, as previously described (Deng et al., 2003), with the following antibodies: nestin (Developmental Studies Hybridoma Bank, University of Iowa; 1:250), g lial fibrillary acidic protein (GFAP; from Immunon (monoclonal and polyclonal; 1drop/0.5ml), neurofilament medium subunit (NFM; EnCor Biotech. Inc.; 1:500), III tubulin (Promega; 1:1500), S100 and MAP2ab (Sigma; 1:500), Polysailic Acid-NCAM (PSA-NCAM; Chemicon; 1:100). Confocal laser scanning microscopic analysis of the immunolabeling was done on the University of Florida Cancer Centers Leica TCS SP2 confocal laser imaging system (Leica Microsystems, Wetzlar, Germany). Cell counting was performed under a fluorescence microscope (Olympus BX51). The ratios of positive cells were obtained by averaging three different experiments for both control and treatment groups. In each experiment, five randomly chosen views were counted and averaged. 2.2.4 Neural Induction by Elevating Cytoplasmic cAMP Our protocol for neural induction by elevating intracellular cAMP was modified from Deng, et al. (2001). In addition to primary induction medium (0.5mM isobutylmethylxanthine (IBMX)/1mM dibutyryl cyclic AMP (dbcAM) (Sigma) in

PAGE 56

44 DMEM/F12) used for the first 24hrs of treament, a cocktail of growth factors (10ng/mL of Brain-Derived Neurotrophic Factor (B DNF; Pepro Tech.), Nerve Growth Factor (NGF; Invigtren), Epidermal Growth Factor (EGF; Pepro Tech) and basic Fibroblast Growth Factor (bFGF; Pepro Tech), and N2 Supplements (Gibco)) has been added to the primary induction medium for treatments longer than 24hrs. 2.2.5 In situ Hybridization for GFAP mRNA To generate the GFAP riboprobes, we used RT-PCR to amplify a 401bp DNA fragment of the GFAP gene (gi: 26080421) from mouse brain tissue with a pair of primers designed using the Primer 3 program (forward: GCCACCAGTAACATGCA AGA; reverse: ATGGTGATGCGGTTTTCTTC). The PCR product was then cloned into the PCR4 TOPO vector (Invitrogen). After lin earization, plasmids extracted from clones of both directions were used as templetes to synthesize digoxigenin (DIG)-labeled GFAP sense and antisense probes using T7 RNA polymerase. In situ hybridization followed the protocol of Braissant and Wahli (1998) (Braissant & Wahli.W, 1998) with small modifications. The probe concentration was 400ng/ml and the hybridization temperature was set at 45C. 2.2.6 Western Blotting For western blotting, approximately 20 g of protein from cell lysates was electrophoretically separated by 8% SDS-PAGE. After transfer to a nitrocellulose membrane, we applied anti-GFAP (Immunon; 1:30) antibody, and a chemiluminecence method for detection (ECL, Amersham). We then incubated the membrane in striping solution at 56 C for 30mins, and incubated it again using anti-actin (Abcam; 1:2,000) antibody.

PAGE 57

45 2.2.7 Transplantation of BMDCs into Neonatal Mouse Brain BMDCs were trypsinized and labeled with the fluorescent carbocyanine dye, DiI (Molecular Probes), according to a protocol adapted from Paramore et al. (1992). Briefly, cells were centrifuged for 5min. at 1000 rpm, and resuspended in fresh medium. DiI was dissolved in absolute ethanol (2.5mg/ml), and added to the cell suspension such that the final concentration of DiI was 40 g/mL. The cells were incubated in the DiI-containing medium for 30min. at 37 C before being washed three times in PBS. DiI-labeled BMDCs were transplanted into the lateral ventricle of postnatal day 14 wild-type C57BL6 mice as described previously (Deng et al., 2003). Approximately 10 5 BMDCs in 1 L of PBS were injected into the left lateral ventricle. After 10 days survival, mice were euthanized with an overdose of Avertin and perfused transcardially with 4% paraformaldehyde in PBS. The brai n tissue was excised, post-fixed overnight in perfusate, and sectioned through the coronal plane into 40 m slices with a vibratome. 2.2.8 Y-chromosome Painting for Cell Fusion Detection Twenty micron vibratome sections were used for assaying possible fusion events associated with DiI-labeled donor BMDCs in the neonatal mouse brain. Brain sections were first treated with 0.2N HCl for 30mins., and retrieved in 1M Sodium Thiocyanate (NaSCN) for 30mins. at 85 C. The sections were then digested with 4mg/mL pepsin (Sigma; diluted in 0.9% NaCl pH2.0) for 60mins. at 37 C. After equilibrating in 2X SSC for 1min., the sections where dehydrated through graded alcohols. The tissue was then incubated with FITC-conjugated Y-chromosome probes (Cambio, UK; denatured for 43mins at 37 C) using Hybrite (Vysis, IL) for 20.5hrs. following a denaturing step of 6mins. at 75 C. After hybridization, cells were washed first in 1:1 formamide:2xSSC,

PAGE 58

46 then in 2xSSC before being re-coverslipped in mountant containing DAPI (Vector, Burlingame, CA). 2.3 Results 2.3.1 BMDC Cultures Can Be Derived from the Bone Marrow of Adult Mice We established viable cultures of BMDCs, from the tibia and femur of adult mice according to the adhesive property of mesenchymal stem cells (MSC) described before (Goshima et al., 1991a; Friedenstein, 1995). About 30 days after plating, the appearance of fast growing BMDC with fibroblast-like morphology can be observed in amid of slow growing, round or polygonal cell types that appeared firstly in the initial bone marrow dissociates culture. At around day 45, stable fibroblast-like BMDC lines can be achieved (Fig. 2-1A). Besides the morphological ch ange, we also observed GFP silencing concomitantly in all of the three GFP transgenic mice we used to establish BMDCs, indicating there was also a change of gene expression profile in the process of establishing BMDC from its original cell types in the bone marrow (Fig. 2-1A). To characterize the BMDCs, we performed flow cytometry analysis using a battery of markers for characterizing mesenchymal stem cells (Fig. 2-1B). We found that BMDCs are negative for the hematopoietic markers CD34, CD45, and Mac1; negative for the stem cell marker c-kit, but partially positive (18.6%) for the stem cell marker Sca1; negative for the endothelial marker CD31, partially positive for CD105 (19.1%), and 97% positive for CD9. These results, along with morphological characteristics, indicate that BMDCs are mesenchymal stem cells, and are similar to the MAPCs isolated by Jiang et al. (2002).

PAGE 59

47 2.3.2 BMDC Cultures Normally Express Neural Markers To evaluate the neural property, we tested the BMDCs on the expression of several neural specific proteins, including th e neural progenitor marker nestin. We found that BMDCs are highly positive for nestin (close to 100%); partially positive for several neuron specific proteins, including III tubulin (12%), neurofilament-M (NFM; 13.2%) and Map2ab (9.6%); negative for PSA-NCAM, a surface protein expressed on migratory neuroblasts; partially positively for the astrocyte specific protein, S100 (15%), but negative for the astrocyte intermediate filament proteins, GFAP and Vimentin (Fig. 22B). 2.3.3 Astrocyte, but not Neuronal Proteins, Are Upregulated by cAMP Elevation Several studies have used cytoplasmic elevation of cAMP to induce neural differentiation from mesenchymal stem cells (Deng et al., 2001; Jori et al., 2004; Lambeng et al., 1999; Lopez-Toledano et al., 2004). To test the same protocol on our BMDCs, we treated the cells with 0.5mM IBMX/1mM dbcAMP. We found that, as reported (Deng et al., 2001), cytoplasmic cAMP elevation does induce a significant morphological change of BMDCs, where the cells become neural-like with rounded somas, and long processes. However, we saw no evidence for a change in the expression of most neural markers before and after the treatment (Fig. 2-2B). Furthermore, when we treated NIH 3T3 cells with the same protocol, we observed similar morphological change without detecting neural marker expression (Fig. 2-2B,C). A significant upregulation of GFAP was, however, observed after treatment with dbcAMP/IBMX (Fig. 2-3A). The enhanced expression of GFAP was confirmed using both in situ hybridization with

PAGE 60

48 digoxinin-labeled GFAP riboprobes (Fig. 2-3B), and western immuno-blotting (Fig. 23C). 2.3.4 Single-Cell BMDC Clones Show Plasticity by Generating both Neuronal and Astrocytic Lineages We cloned BMDCs from single cells by limiting dilution in conditioned medium. Single cell-derived BMDCs recapitulated the cell surface marker expression profile of their ancestor population by flow ctyometry analysis. When we tested the cloned BMDCs with NFM immunostaining, we did not observe any positivity in clones of smaller than five cells (n=10), but did see labeling with this marker in clones of ten or more cells (n=13) (Fig. 2-4A). This may imply that there is a symmetric and asymmetric division in BMDCs that is cell density or division number dependent (See working model in Figure 4Ab, and Discussion) Furthermore, when we performed double immunostaining, we found that both neuronal and astrocyte cells existed in the cloned population (Fig. 2-4B). 2.3.5 BMDCs Exhibit Neural Differentiation upon Grafting into the Neonatal Mouse Brain To test the in vivo trans-differentiation capacity of BMDCs, we grafted the cells into the neonatal mouse brain. We observed a migration of BMDCs along the rostral migratory stream (RMS) from the lateral ventricle to the olfactory bulb. While most of the grafted cells maintained a spindle-like appearance similar to their in vitro morphology, some cells exhibited morphological characteristics of astroctyes around the ventricle, and penetrated into the overlying parenchyma (Fig. 2-5A). Immunostaining shows that these cells are positive for GFAP antibody (Fig. 2-5B). A significant number of cells within the RMS were immunopositive for the neuronal marker III tubulin (Fig. 2-5B), and more significantly, we consistently observed a small number of BMDCs

PAGE 61

49 possessing typical characteristics of granule ce lls within the granule cell layer (GCL) of the olfactory bulb (Fig. 2-5A). Immunolabeling reveals that these cells are positive for PSA-NCAM (Fig. 2-5B). To confirm the expr ession of neuronal proteins by these donor BMDCs, we used confocal laser scanning microscopy to verify that the expression of the proteins are indeed in the same focal layers of the DiI used to label the cells (Fig. 2-6). To control for the possible leakage of the DiI, we grafted identically-labeled NIH3T3 cells into the ventricles of a different set of animals. In these cases, we only observed labeled cells within the subependymal zone of the lateral ventricle, near the site of injection where the cells where grafted (n=4). 2.3.6 Chromosome Analysis Reveals no Evidence of BMDC Fusion To evaluate the possibility that cell fusion between donor BMDC and differentiated host cells is responsible for the co-expression of neuronal proteins and DiI, we grafted DiI-labeled, male BMDCs into neonatal male mouse brain, and analyzed tissue sections for the presence of cells with more than one Y-chromosome. We optimized the Y-chromosome painting such that a high efficiency of detection (>99%) was achieved in cells with an intact nucle us, using Dapi counterstaining and confocal microscopy. From analysis of three different animals, we observed that all DiI labeled cells contain only one Y-chromosome, as shown in Figure 2-8. We therefore conclude that there is no sign of fusion of grafted cells. 2.4 Conclusion and Discussion We have demonstrated that BMDCs from adult mice constitutively express several neural markers in vitro under standard culture conditions. The neural induction protocol of applying dbcAMP/IBMX to elevate the cytoplasmic cAMP does not

PAGE 62

50 significantly result in the upregulation of neural specific proteins from their uninduced state in BMDCs. Single-cell BMDC clones undergo symmetric and asymmetric division with or without induction, generating neuronal marker expressing cell, and inducible astrocytic marker-expressing cells in vitro. Non-fused BMDCs also have the capacity to generate neurons and astrocytes upon grafting into the neonatal mouse brain. These cells seemingly behave normally, as donor cells are seen to migrate along the RMS to the olfactory bulb, where they differentiate into granule cells. We believe that the BMDC we described in the present study is equivalent to the MSC; however, we are reluctant to give it the name because of the current incomplete characterization of MSCs. The surface mark er expression profile accords well with previous studies (Colter et al., 2000; Javazon et al., 2001), and the absence of CD34, CD45, and CD11b has been widely accepted as the major difference between MSCs and hematopoietic stem cells (HSC) (Colter et al., 2000). The expression of some endothelial cell markers, including CD105 and CD9, has also been reported in MSCs (Tanio et al., 1999; Hayashi et al., 2000; Jones et al., 2002; Sun et al., 2003). While the expression of the stem cell marker Sca1 mirrors other reports (Jiang et al., 2002), the lack of c-kit expression by our BMDCs is anomalous (Sun et al., 2003). This discrepancy may reflect the loose definition of MSCs currently in vogue. While there is a wide range of surface markers that have been tested to characterize MSCs, there is currently no single set of phenotypic markers used to unequivocally identify a MSC. As a result, there may be subtypes of MSCs that differ slightly from each other, and this may account for the variation of marker expression, as well as the inconsistent results regarding the transdifferentiation of MSCs from different laboratories. The use of FBS as the main, and

PAGE 63

51 only, source for growth factors to establish the cell population has been adapted since the pioneering work of Petrakova (1963). It is simple and effective, but the lack of positive selection markers -as used for hematopoietic stem cellsmay result in the inclusion of undefined cell types, which may underlie the interlaboratory variability seen with these types of protocols. We noticed that BMDCs in culture have an irregular growth rate at different periods of the culture (data not shown). We also noticed that BMDCs derived from GFP transgenic mouse lose the GFP expression during the course of culture. The constitutive expression of neural specific proteins demonstrated by our BMDCs casts doubt on some previously reporte d protocols that claim neural induction, but fail to show the pre-induction level of neural specific proteins. However, this clarification did not weaken the recognition of MSC as a genuine stem cell type, but rather strengthen it by showing its vigorous, s pontaneous neural differentiation property. The neural property exhibited by BMDCs may be explained by the neural propensity of stem cells reflected in the development of nervous system during embryogenesis. It is generally believed that unspecified ectoderm cells differentiate into neural lineage by default unless inhibited by ventralizing fact ors, such as bone morphogenetic protein-4 (BMP4) (Wilson & Hemmati-Brivanlou, 1995). So-called neuralizing factors such as noggin, chordin, and follistatin promote ne uro-ectoderm specification by inhibiting BMP4 (Streit & Stern, 1999). The embryonic stem cell also shows active neural differentiation unless inhibited by BMP in vitro (Hemmati-Brivanlou & Melton, 1997; Finley et al., 1999). Therefore, it is not surprising that BMDCs, as multipotent stem cells, may partially exhibit a neural property in their default state of differentiation in vitro, where there are no pro-mesoderm inhibitors such as BMP4. The expression of some

PAGE 64

52 neural markers by uninduced MSCs is a matter of some controversy. Woodbury, et al. (Woodbury et al., 2000) did not observe any neural specific protein expression except neuron-specific enolase (NSE). Sanchez-Ramos, et al. (Sanchez-Ramos et al., 2000) reported low levels of NeuN, nestin and GFAP expression detectable with immunocytochemistry. Deng et al. (2001) have previously reported expression of vimentin, Map1b and -III tubulin, but no NFM, GFAP and S-100. A more recent paper by Tondreau, et al. (2004) corroborates our finding by reporting significant expression of several neuronal markers, including nestin, -III tubulin, Map2, and tyrosine hydroxylase (TH) flow cytometry analysis using non-induced MSCs. As pointed out above, the variation in MSC subtypes may be due to di ffering isolation and culturing protocols from different laboratories (Javazon et al., 2004). Despite causing a vigorous neuron-like morphological change, we have demonstrated that the use of the dbcAMP/IBMX induction protocol does not change the neuron-specific protein expression profile in BMDCs. Furthermore, we have also observed a rapid and dramatic morphological change in NIH3T3, similar to that of BMDCs upon dbcAMP/IBMX treatment, but wit hout expression of neuronal marker. In the initial paper describing the protocol (Deng et al., 2001), Deng et al. found no expression of NFM, which differs from our re sults, but they did report equal levels of MAP1b and III tubulin with and without induction, as we have found in our BMDCs. Tondreau, et al. (Tondreau et al., 2004) recently reported an over 90% unchanged nestin expression preand post-induction, as we have demonstrated, but reported a decreased III tubulin expression level from over 90% to about 30% after ten days of treatment with lower concentration of dbcAMP (5 M). Our results, together with previous reports,

PAGE 65

53 suggest that the dramatic neuron-like morphological transformation of MSCs under dbcAMP/IBMX treatment is an unreliable indicator of neuronalization, supporting a previous analysis of DMSO/BHA i nduction protocol reported by Neuhuber, et al. (2004) and Lu, et al. (2004). Along with many other inconsistent reports of neural specific protein expression with or without induction in MSCs, the expre ssion of GFAP has also been controversial. Despite the early findings of MSC trans-differentiation into GFAP expressing astrocyte in vitro and in vivo (Sanchez-Ramos et al., 2000; Jiang et al., 2002; Zhao et al., 2002), Wehner, et al. (2003) reported that there was no GFAP expression from MSCs derived from a mouse strain carrying a GFP expression vector driven by the GFAP promoter cassette. The original paper that described the cytoplasmic cAMP elevation to induce neural differentiation from MSCs did not de tect GFAP expression before or after the treatment (Deng et al., 2001), and this partially supported Wehner, et al. However, our data from immunolabeling, in situ hybridization as well as western blotting unequivocally demonstrates that GFAP expression is up-regulated by cytoplasmic cAMP elevation. In agreement with this, Tondreau, et al. (2004) also report the up-regulation by MSCs of GFAP following prolonged exposure to a low concentration of dbcAMP/IBMX Besides the demonstration of GFAP expression in vitro, we also observed BMDC differentiation into GFAP-expressing cells following transplantation into the neonatal mouse brain. As we showed in Fig. 1A, BMDC undergo GFP gene silencing during the establishment of the long-term culturing population. It, therefore, may be speculated that the genesilencing event could have interfered with the GFP expression cassette in the previous

PAGE 66

54 study of Wehner, et al. (2003), and thus resulted in a failure to detect GFAP expression in MSCs. We have shown that clonal BMDC cultures give rise to populations that are identical to the parent population. These clones exhibit multipotency by differentiating into cells of neuronal and astrocytic lineages. Pittenger, et al. (1999) reported a similar clonal property of bone marrow-derived multipotent human MSCs in differentiating into adipogenic, chondrogenic and osteogenic lineage. Based on the immunophenotyping of BMDC clones of different sizes, we propose a working model that may reflect the symmetric and asymmetric cell division pattern in the BMDCs (Fig 4Ab). We suggest that at least three cell types exist in the BMDC population, each with different potency: multipotent, neuron restricted, and astrocyte restricted. The fact that we did not observe neural marker expression in the small clones (<5 cells) may mean that only multipotent cells, not expressing neural markers, can renew themselves by symmetric division, while neuron restricted and astrocyte restricted cells do not survive or proliferate under clonal culture conditions. The fact that we start to observe neural-specific protein expression in larger clones (>10 cells) may mean that there is a cell division number, or cell density that triggers asymmetric division that generates cells with restricted potentials. Although the neural differentiation capability of MSCs in vitro has been widely explored, the in vivo response of this cell type upon direct engraftment into the brain has not been adequately assessed. Our finding that BMDCs integrate into the postnatal neurogenic pathway of the RMS/olfactory bul b system by migrating appropriately and differentiating into olfactory granule cells supports the conclusion that the bone marrow derived adult stem cell indeed possesses neural trans-differentiation capability under the

PAGE 67

55 influence of environment cues from the brain. The fact that BMDCs can migrate along RMS, and differentiate into mature neurons at a distant site may also imply their therapeutic potential in acting as neural progenitor cells and replacing lost neural tissue after injuries. Munoz-Elias et al. (2004) reported a wide scope of migration of MSCs after transplanted into the embryonic rat brain, and transplanted cells appeared to express the neuron marker calbindin at the olfactory bulb. Zhao, et al. (2002) demonstrated that human MSCs expressed astrocytic markers and some neuronal markers after grafting to the site of ischemic injury in rat brains. Further work in various injury models, designed to fully assess the ability of BMDCs to functionally integrate into neural circuitry, will determine the potential therapeutic value of these cells in the treatment of neurological injury and disease. In summary, we have demonstrated that BMDC, a MSC cell type, possesses neural progenitor-like property by expressing neuronand astrocytespecific proteins spontaneously or inducibly. Although the prev iously reported neural induction protocol using dbcAMP/IBMX does not seem to promote neuronal differentiation in BMDCs, it may be able to drive an astrocyte differentiation by showing a GFAP up-regulation. However, the neuron-like morphological transformation under the protocol may not be a reliable criterion for evaluating neuronalzation, due to the fact the NIH3T3 also acquired identical change without neuron-specific protei n expression. We have also used confocal scanning imagine system, and Y-chromosome painting techniques to demonstrate, unequivocally, that neural trans-differentiati on from stem cell of mesenchymal origin does exist, and may be able to develop into the ideal cell type for cell-replacement therapy in the future.

PAGE 68

56BMDC culture and characterization. Wild type and GFP transgenic C57/B6 mice of 8 weeks old have been used to isolate BMDCs. A) The establishment of long-term culturable BMDC. There is a clear transition from short p olygonal to long fibroblast-like morphology in BMDCs during the establishment stage. The bottom pictures are the GFP fluorescent imagines of the same picture above, showing the loss of GFP expression when fibroblastlike BMDCs appear in the culture while the unchanged cells retain the GFP expression. B) The flow cytometry analysis of BMDCs on the cell surface antigen characteristics. BMDCs of over 50 passages isolated from wt C57/B6 mice were incubated with different antibodies. The BMDCs are completely negative for CD34, CD45, CD 11b, CD31 and c-kit; partially positive for Sca1 (18.7%) and CD105 (19.1%); and strongly positive for CD9 (97.5%). The red line indicate IgG isotype control corresponding to the antibodies in which they are generated. The green lines are counts of cell population that is p ositive for the antibody indicated in the each individual figure. M1 is the gating. Figure 2-1. Day15Day35Day45A B CD34 CD45 Sca1 c-Kit CD9 CD105 CD31 CD11b Day15Day35Day45 Day15Day35Day45A B CD34 CD45 Sca1 c-Kit CD9 CD105 CD31 CD11b CD34 CD45 Sca1 c-Kit CD9 CD9 CD105 CD105 CD31 CD11b

PAGE 69

57Neural Specific Protein BMDCNIH3T3 CMDbcAMP/IBMXCMDbcAMP/IBMX nestin>99%>99%00 betaIII Tubulin12.0%11.4%00 NFM13.2%13.7%00 Map29.6%8.9%14.5%16.5%PSA-NCAM0000 GFAP010.3%00 S10015.0%15.5%00 Vimentin0000A NFM III Tub Nestin MAP2B no cAMP w/ cAMPCNeural Specific Protein BMDCNIH3T3 CMDbcAMP/IBMXCMDbcAMP/IBMX nestin>99%>99%00 betaIII Tubulin12.0%11.4%00 NFM13.2%13.7%00 Map29.6%8.9%14.5%16.5%PSA-NCAM0000 GFAP010.3%00 S10015.0%15.5%00 Vimentin0000A NFM III Tub Nestin MAP2 NFM NFM III Tub III Tub Nestin Nestin MAP2 MAP2B no cAMP w/ cAMP no cAMP no cAMP w/ cAMP w/ cAMPCBMDCs express neuron specific proteins spontaneously under normal culture condition. A) Immunocyto-labeling of BMDCs using antinestin, III tubulin, Map2ab, and NFM antibodies. B) The quantification of neural marker expression on BMDCs and NIH3T3 preand post dbcAMP/IBMX treatment for two days. Numbers in the table is the portion (in percentages) of cells positive for each antibody labeling. C) NIH3T3 acquisition of neuronal morphology after treated with dbcAMP/IBMX for two days. Figure 2-2.

PAGE 70

58A B C GFA P B NT 24hr 48hr 72hr 96hr Actin no cAMP / GFAP w/ cAMP / GFAP In Situ GFAPmRNA GFAPCytoplasmic cAMP elevation prom ote GFAP expression in BMDCs. A) GFAP immunolabeling of BM DCs preand postdbcAMP/ IBMX treatment. B) In situ hybridization in BMDCs treated with dbcAMP/IBMX for two days. The inset indicates the same cell (arrow) is also labeled with GFAP immuno-fluorescence (green). N oticed that not every in situ labeled cell is positive for GFAP immunolabeling; this is likely caused by the harsh treatment of in situ hybridization procedure. C) West ern immuno-blotting using GFAP monoclonal antibody in BMDC treated by dbcAMP/IBMX. Actin antibody has been used as internal control. BBrain tissue as positive control; NTno treatment; hrhours of treatment. Figure 2-3.

PAGE 71

59 GFAP / bIII TUB GFAP / N FM B A NFM A N N symmetric asymmetric A N A ab Single cell cloned BMDCs exhibit mutlipotency by generating progenies of different property through symmetric and asymmetric division. A) Cloned BMDCs exhibit symmetric and asymmetric division. a, immunolabelling of cloned BMDCs with anti-NFM antibody. Top: representative imagine of clones around five cells; no NFM positive cells are observed in these clones (n=10). Bottom: representative imagine of clones with more than ten cells; small portion of the cells start to express N FM as showing in the inset in these clones (n=13). b, a working model of the symmetric and asymmetric division of BMDCs: at least three different cell types existed in the original population, primitive cell with full potential (clear circle), neuron potential (filled circle denoted with N ), and astrocyte inducible (filled circle denoted with A). B) Double immuno-labeling of BMDCs treated with dbcAMP/IBMX using antibodies against neuronal and astrocyte specific proteins. The expression of GFAP is labeled with green fluorescence; III tubulin and N FM are labeled with red fluorescence; blue fluorescence is Dapi stain for nucleus. Figure 2-4.

PAGE 72

60 ASVZ OLB III Tub / DiI PSA-NCAM / DiI GFAP / DiIBBMDCs differentiate into neurons and astrocytes upon transplantation into the lateral ventricle of the neonatal mouse brain. A) Transplanted DiI-labeled BMDCs (red) exhibit morphological characteristics of astrocyte at the sub-ventricular zone (SVZ; top), and typical granule cell at the granule cell layer (GCL) of olfactory bulb (bottom). Picture at right shows the enlarged area of the framed inset at the. B) BMDCs (red) show immnuo-phenotypes of neurons and astrocyte in the brain. The neural specific protein III tubulin, PSA-NCAM, and GFAP are immuno-labeled with green fluorescence. Insets in each picture show individual channel. Figure 2-5.

PAGE 73

61 A B PSA-NCAM / DiI III Tub / DiIConfocal scanning microscopic imagines demonstrate the immuno-labeling of BMDCs with neuronal specific proteins. Confocal imaging analysis of BMDCs (DiI; red) immuno-labeled with PSA-NCAM (A) and III tubulin (B) (FITC; green). Left: merged confocal imagine in the GCL (A) and RMS (B) of olfactory bulb. Middle: separate channel of the cell indicated on the left picture, showing the green immuno-fluorescence labeling fall into the same plate of the BMDC (red); right: the side-view of the confocal imagine of the same cell on the left, showing the BMDC (red) site on the top of the tissue section, and it has been truncated at the mid-plane of the cell. Figure 2-6.

PAGE 74

62 A B *c *a *b ab c Z Y X z x y RMSSVZConfocal scanning microscopic imagine evaluation of cell fusion between male animal derived BMDCs and endogenous cells of male recipient mouse in the brain. A) Montage picture of confocal scanning imagines from two cells located at RMS and SVZ separately. There is only one Y-chromosome (FITC; green) within the cell boundary (DiI; red). Inset shows the overview of the cell location (arrowhead). B) Three-dimensional confocal analysis of Y-chromomsome locality in the nucleus of a BMDC shown in the left picture of A. X, Y and Z are the cross-section planes taken from three different angles indicated by x, y and z (arrowhead and gray lines); a, b and c are high magnification imagines of insets in X, Y and Z planes. The white dotted lines in a, b and c delineate the nucleus boundaries from different angle. Figure 2-7.

PAGE 75

CHAPTER 3 NEURAL TRANSDIFFERENTIATION OF MOUSE HEPATIC OVAL CELL IN VIVO 3.1 Background and Introduction: Stem cells have recently been characterized in a variety of tissues of adult animals, including liver, blood, skin, brain, and heart (Wetts & Fraser, 1988; Spangrude et al., 1988; Jones et al., 1995; Petersen, 2001; Hughes, 2002). Their plasticity, as demonstrated by the multipotency to differentiate into mature, tissue-specific cell types, may offer new therapeutic tools for a variety of diseases. Hepatic oval cells (HOCs) are considered the stem cells of the liver, having been shown to be capable of giving rise both to hepatocytes and bile duct cells (Petersen et al., 1998a). The majority of HOC studies have been conducted in various rat models; however, a mouse model was recently developed which allows for the isolation of large quantities of HOCs. This model incorporates the chemical 3,5-diethoxycarbonyl-1,4-dihydrocollidin (DDC) at a 0.1% concentration in the normal chow (Preisegger et al., 1999). Development of this mouse model also led to the characterization of an antibody -termed A6that recognizes a specific epitope on mouse HOCs (Factor et al., 1990). In conjunction with this new mouse oval cell model and the two step liver perfusion technique (Seglen, 1979), Petersen et al. have developed a enrichment protocol which allow us to isolate a greater than 90% pure Sca-1+ oval cell population from the DDC treated mouse liver (Petersen et al., 2003). 63

PAGE 76

64 Trans-differentiation -the ability of stem cells from one tissue to generate cells characteristic of an entirely different tissueis of interest not only because in it lies the true answer to the multipotent capabilities of the adult "stem" cells, but also because it may provide an easily accessible, non-controversial source of cells for future autologous transplantation therapies. The use of stem cell therapy in treating neurodegenerative disorders has attracted considerable attention lately. The trans-differentiation of bone marrow-derived stem cells (BMSC) into neural cell types has been explored extensively, with several groups reporting that these stem cells can trans-differentiate into neurons, astrocytes and microglia (Azizi et al., 1998; Kopen et al., 1999; Brazelton et al., 2000). The trans-differentiation of BMSC into microglia was thought to recapitulate microglia ontogeny (Rio-Hortega del, 1932; Eglitis & Mezey, 1997); however, the functionality of these trans-differentiated microglia cells has not been reported thus far. Yang et al. have recently reported that oval cells can trans-differentiate into insulin-producing pancreatic cells in culture when challenged with high glucose (Yang et al. 2002). In order to further characterize the HOC and its potential plasticity, we transplanted isolated HOCs derived from GFP transgenic miceinto the lateral ventricles of neonatal wild-type mouse brain, according to a model of intracerebral transplantation recently described for assaying stem cell behaviors of neural cells (Zheng et al. 2002). We asked whether the oval cells could trans-differentiate into cells of a neural phenotype.

PAGE 77

65 3.2 Materials and Methods 3.2.1 Hepatic Oval Cell Induction and Enrichment from Mouse Liver According to the protocol established by Preisegger et al. (1999), we fed adult C57BL6 /GFP +/+ transgenic mice a normal diet supplemented with 0.1% DDC (BioServe, Frenchtown NJ) for six weeks. To isolate HOCs, we performed a two step liver perfusion according to Seglen et al. (1979), collecting the non-parenchyma fraction (NPC) using gradient centrifugation. We incubated the NPC fraction with the Sca-1 antibody conjugated to micro-magnetic beads, processing the cell suspension through magnetic columns to enrich the oval cell population positive for Sca-1, the stem cell antigen-1 (MACs, Miltenyi Biotec). 3.2.2 FACs Analysis for Purity on MACs Sorted Sca-1 + Oval Cells Wild-type Sca-1 + and Sca-1 oval cells, obtained from MACs magnetic sorting, were incubated with Fluorescein Isothiocyanate (FITC)-Sca-1 and FITC-rat IgG 2a antibodies (PharMingen) (1:500) for 30mins at room temperature. Cells were then pelleted by centrifugation at 200g and washed twice in PBS to eliminate unbound antibodies. Approximately 10 6 cells/ml-cell suspension was run through a flow cytometer (CELLQuest, Becton Dickinson FACScan). 3.2.3 Immunocytochemistry of MACs Sorted Oval Cells Wild-type Sca-1 + oval cells, obtained from MACs magnetic cell sorter, were cytocentrifuged to slides, fixed with 4% paraformaldehyde in PBS, and examined for mouse oval cell markers as described (Petersen et al., 1998a). A6 antibody (a gift from Dr. Valentina Factor of the NIH) (1:20) and anti-fetal protein (AFP) (Santa Cruz Biotechnology) (1:200) were used for the immuno-characterization of oval cells.

PAGE 78

66 3.2.4 Culture of Mouse Oval Cells Approximately 10 6 Sca-1+ mouse oval cells, obtained from MACs cell sorting were cultured in a 35mm culture dish (Costar, Corning In.) in HOC culture medium (89% Iscove's Modified Dulbecco's Medium, 10% FBS, 1% Insulin, 1000 U/ml of leukemia inhibitory factor, 20ng/ml granulocyte m acrophage colony stimulating factor, 100ng/ml each of stem cell factor, interleukin-3 and interleukin-6). 3.2.5 Cell Transplantation into Neonatal Mouse Brain Sca-1 + MACs sorted primary dissociates of GFP + oval cells were transplanted into the lateral ventricle of postnatal day 1 w ild-type C57BL6 mice within the first 24 hours after birth. Briefly, newborn pups were anesthetized by hypothermia and placed in a clay mold. The head was trans-illuminated under a dissection microscope, and a Hamilton syringe with a beveled tip was lowered through the scalp and skull immediately anterior to bregma. Approximately 2.5x10 5 GFP + HOCs in 1 l volume of Dulbeccos Modified Eagle Medium/F12 (DMEM/F12, Gibco) were then slowly pressure-injected into the left lateral ventricle. Immediately after injection, pups were warmed in a 37 C incubator, and returned to the mother after approximately 30 min. At ten days post-transplantation, mice were sacrificed with an overdose of Aver tin, and perfused transcardially with 4% paraformaldehyde in PBS. The brain tissue was excised, post-fixed overnight in perfusate, and sectioned through the coronal plane into 40 m slices with a vibratome. 3.2.6 In vivo Phagocytosis Assay An in vivo phagocytosis assay of microglia was performed by adding fluorescent latex microbeads to the graft bolus immediately prior to transplantation. Latex microbeads (Sigma L-0530, 0.5 m in diameter, fluorescent blue conjugated) were added

PAGE 79

67 into the cell suspension (~2.5 x 10 5 cells/ l in DMEM/F12) at a concentration of 15% (0.15 l bead solution/0.85ul cell suspension). One microliter of cell/bead mixture was injected into the lateral ventricle of newborn pup brains as described above. Hosts were then allowed to survive for ten days before the brains were fixed and processed for immuno-characterization. 3.2.7 Immunolabeling of Brain Sections Forebrains were cut with a vibratome into 40 m coronal sections exhaustively, and processed free-floating for immuno-fluores cence. After blocking in PBS with 10% goat serum, sections were incubated overnight at 4 C in primary antibodies directed against the following proteins: nestin, a marker of neuronal stem and progenitor cells (Developmental Studies Hybridoma Bank, University of Iowa; 1:250); the astrocytespecific markers glial fibrillary acidic protein (GFAP; from Gerry Shaw University of Florida,1:200), and S100 (Sigma;1:250); the microglia marker CD11b (Serotec;1:200); and the neuronal markers neurofilament medium subunit (NFM; from Gerry Shaw University of Florida,1:500), -internexin ( -IN; from Gerry Shaw University of Florida,1:200), and MAP2ab (Sigma;1:500). The tissues were then washed in PBS, followed by incubation in appropriate secondary antibodies conjugated to Rphycoerythrin (R-PE) (Molecular Probes) at room temperature for 1hr. After a final wash in PBS, brain slices were mounted onto glass slides, viewed, and counted with a fluorescence microscope. 3.2.8 Quantification of Grafted Cells Cell counting was performed under a fluorescence microscope (Olympus BX51). Every sixth section through the forebrain was selected for counting of grafted cells. A

PAGE 80

68 cell was counted if the cell body could be identified. Total number of cells was then obtained by multiplying the counted result by a factor of six. The standard deviations were obtained using Microsoft Office Excel statistics software. 3.3 Results 3.3.1 Hepatic Oval Cell Enrichment with Sca-1 Antibody In order to verify the purity obtained with our sorting method, we performed FACs analysis on MACs sorted Sca-1 + cells. After MACs sorting, only 20% of the Sca-1 epitopes were occupied by the Sca-1 conjugated magnetic beads, which allowed us to use the remaining epitopes to perform the FACs analysis for purity. Figure 1A and B represent histograms of FACs analysis showing a distinct population of cells. MACs sorted cells are over 90% positive for Sca-1 antibody (Fig. 3-1A), while the flow-through cells were Sca-1 negative (Fig. 3-1B). Immunocytochemistry revealed that the Sca-1 + MACs sorted cell were also positive for A6 and AFPknown markers for mouse oval cells (Fig. 3-1C). When cultured in vitro, HOCs started to proliferate in about 5 days, and formed colonies after about two weeks (Fig. 3-1D). The HOCs in culture appeared to be a homogeneous and undifferentiated cell population. 3.3.2 Hepatic Oval Cells Survive and Differentiate in the Neonatal Mouse Brain Ten days after transplantation of HOCs, intensely fluorescent GFP + cells were seen within the host brain. The majority of surviving donor cells was located in periventricular areas in all of the mice with successful cell delivery (Fig. 3-2A, B and C). GFP + cells were most frequently observed superficially along the walls of the lateral ventricle, but numerous grafted cells were also found to migrate laterally within the white matter of the corpus callosum (data not shown). At points along the ventricular wall,

PAGE 81

69 grafted cells penetrated into the parenchyma of the brain, a phenomenon previously described following intraventricular transplantation of multipotent astrocytes (Zheng et al. 2002). The survival rate of the transplanted HOCs averaged 0.56% (SD=0.36%, n=9) of the total injected cells (Table 1). A pproximately 11.5% (SD=2.5%, n=3) of grafted cells remained undifferentiated, and were characterized by a small, rounded, non-process bearing morphology. The remainder displaye d varying degrees of differentiation and process extension. Seven of 36 animals receiving transplants did not contain any detectable donor cells. 3.3.3 Grafted Hepatic Oval Cells Express Neural Antigens The filament protein nestin has frequently been considered indicative of neural progenitor cells (Lendahl et al., 1990). We found that 22.1% (SD=11.6%, n=4) of surviving donor cells were immuno-positive for nestin (Fig. 3-3A, Table2), suggesting that HOCs may be able to assume the phenotype of early neural lineage. Of the donor cells that differentiated, the majority exhibited a typical amoeboid or ramified microglia morphology (Fig. 2D-G). A smaller fraction displayed the stellate, process-rich characteristics of astrocyte morphology (Fig. 3-2H-K). Immuno-labeling with the Mac-1 antibody, directed against the CD11b epitope characteristic of macrophages, showed that 60.6% (SD=10.5%, n=3) of the GFP + donor cells express this microglial marker (Fig. 4A and B, Table 2). Additionally, 34.7% (S D=9.0%, n=4) and 27.2% (SD=5.7%, n=3) of donor cells express the astrocyte specific proteins GFAP and S100, respectively (Fig. 33B-D, Table 2). Many of the cells expressing astrocyte proteins were located within the corpus callosum, and their processes could be seen intertwining with the processes of native astrocytes.

PAGE 82

70 A small number of donor cells were also seen to be immunopositive for neuron specific markers. 6.5% (SD=1.3%, n=3) of the grafted cells expressed the neuronal marker NF-M (Fig. 3-3E, Table 3-2), and a comparable number expressed -IN (Fig. 33F). A considerably larger percentage, 19.9% (SD=2.5%, n=3), of donor cells were immuno-positive for MAP2 (Fig. 3-3G, Table 3-2). Although these grafted cells do have an antigenic profile consistent with neurons, suggesting that HOCs can generate cells belonging to the neuronal lineage, their morphologies are ambiguous and do not resemble typical in vitro or in vivo neurons. 3.3.4 Donor-Derived Cells Have Functional Properties of Microglia Grafted cells with the antigenic profile of microglia also display appropriate phagocytic activity, since co-transplanted fluorescent microbeads were incorporated into their cytoplasm at high efficiency (Fi g. 3-4C, Table 3-3). 58.7% of grafted GFP + cells, as well as numerous indigenous microglia were seen to incorporate microbeads, and these cells were subsequently shown to express the CD11b antigen, characteristic of macrophages, including brain microglia. 3.4 Conclusion and Discussion Our results indicate that a portion of the HOCs from adult mouse liver can survive transplantation to the neonatal mouse brain, and can differentiate into cells that share certain phenotypic characteristics with neurons, astrocytes, and microglia. Furthermore, donor cells that express microglial antigens can also display functional properties characteristic of microglia, i.e. active phagocytosis. We believe that our quantification of donor cell survival and differentiation characteristics is extremely conservative, in light of the fact that we have observed that

PAGE 83

71 HOCs acutely isolated from the liver of the GFP transgenic C57BL6 have largely variable levels of GFP expression, with approximately 50% of them not expressing detectable GFP. We have also observed that long-term cultured GFP+ HOCs gradually lose GFP expression over a three-month period (data not shown). Therefore, the actual survival rate of grafted HOCs in our study may likely to be higher than that we have quantified. We also observed a large variation of HOC survival between different animals. Survival ranged from 0% (7 of 36 animals had no detectable GFP + cells) to 1.0%, with a standard deviation of 0.36%. This inconsistency is likely the result of technical failure during the transplant procedure. For instance, the lumen of the transplant needle can become fully or partially blocked during the penetration through the scalp and skull, resulting in reduced numbers of cells being delivered. Additionally, in some animals we observed extrusion of the graft bolus up the needle tract, which again would greatly decrease the delivery of cells to the ventricle. The fact that a percentage of donor cells was seen to be immunopositive for nestin is provocative since this protein has been considered to be a marker of primitive neural stem/progenitor cells (Lendahl et al., 1990), and it is reasonable to suggest that transdifferentiation from hepatic to brain lineage would involve a transition through an early neural stage. The adoption of microglial phenotype by grafted HOCs is clearly the most frequent occurrence in our transplantation paradigm, and seems intuitively consistent given the close relationship among hematopoietic cells, liver cells, and microglia. It has been shown that hematopoietic stem cells and HOCs share considerable antigenicity, and donor hematopoietic stem cells can contribute to liver regeneration (Omori et al. 1997a;

PAGE 84

72 Omori et al., 1997b; Petersen et al., 1998a; Petersen et al., 1999). Furthermore, it is generally accepted that most brain microglia originate from the hematopoietic system (Rio-Hortega del, 1932; Eglitis & Mezey, 1997). Recently, studies describing the trans-differentiation of bone marrow and other types of stem cell into neurons have come under criticism by Holden et al. (Holden & Vogel, 2002), with one of the concerns being the lack of complete neuron morphology. Previously reported trans-differentiated cells did not display long process-bearing morphology, with axons and dendrites. Morphological characteristics are still the primary criteria for assessing the neuron generating potential of a differentiating progenitor cell, since it is an integral part of neuronal function to efficiently and remotely transmit electric signals. Another weakness of these reports is the lack of functionality of the trans-differentiated cells. Unlike the use of stem cells to reconstitute the full function of an immune-deprived blood system in rodents, the functional assay for a single neuron in the brain is much more difficult. We have shown that a small portion of oval cells, which have been transplanted into the neonatal mouse brain express some neuronal markers and start to show limited neuron morphology. While additional morphological and electrophysiological data are required to definitively prove trans-differentiation, our results strongly indicate that liver-derived HOCs can, under certain environmental influences, adopt some characteristics of neuronal cells. The vastly greater number of MAP2 labeled donor cells could indicate that this marker is associated with neurons in a different stage of differentiation, or more lik ely reflects the fact that the Map-2 antigen can be expressed by non-neuronal cells under certain circumstances, such as brain injury

PAGE 85

73 which certainly occurs in our transplants due to the penetration of the needle (Lin & Matesic, 1994). The origin of the hepatic oval cells is still a controversial issue. A precursor cell type is believed to exist that generates oval cells when certain liver injury occurs. The traditional view holds that there is an endoderm-derived liver stem cell, possibly in the Canal of Hering (Theise et al., 1999). While another view is supported by recent reports showing that circulating stem cells originating from the bone marrow can contribute to the precursors of oval cells in the liver (Petersen et al., 1999). The second view is supported by the immunochemical characteristics that oval cells and hematopoietic stem cells have in common. Oval cells express many hematopoietic stem cell markers, such as Thy1, c-kit, and CD34 in the rat, and flt-3 in the mouse (Omori et al., 1997a; Omori et al. 1997b; Petersen et al., 1998a). Recent work from our laboratory has reported that mouse oval cells also express Sca-1 and CD34 (Petersen et al., 2003). Our present results show the trans-differentiation potential of oval cells in becoming cell types of the brain. We presented data that microglia differentiation from oval cells is possible, showing a complete morphology and the phagocytosis activity of the trans-differentiated cells. It is possible that nuclear fusion of donor cells with host astrocytes and neurons might be a factor in the putative trans-differentiation we observed, as we have reported previously in an in vitro model (Terada et al., 2002). However, since cell fusion involving stem or progenitor cells has not yet been confirmed in vivo and based upon the large number of GFP + cells we observed, it seems unlikely. Nevertheless, future studies will need to be conducted to rule out this phenomenon as a confounding factor. Sex mismatching of donors and hosts would allow us to detect fusion events via in situ

PAGE 86

74 hybridization for X and Y chromosomes, and we have used this technique successfully in looking at potential trans-differentiation events in archived human brain sections (unpublished observation). The isolation of large number of oval cells holds tremendous promise as a source for liver transplantation in treating both acute and chronic liver failure. With the recent report of the trans-differentiation of oval cells into the insulin-producing pancreatic cells, using this cell type in treating diseased tissues other than liver may be possible (Yang et al. 2002). Our studies show that these HOCs may also hold potential plasticity for becoming neural cells, which may help our understanding of stem cell differentiation. Since a large number of oval cells appear to differentiate into GFAP positive astrocytelike cells, and since astrocytes have been previously reported by us and others to exhibit multipotency under certain conditions (Laywell et al., 2000; Seri et al., 2001), it will be important to determine if oval cells might give rise to glial cells with neuronal differentiation potential. Future studies will be needed to further characterize this intriguing cell type, but the data presented here on oval cell behavior following intraventricular transplantation, in line with that described by others looking at bone marrow hematopoietic and stromal cells, suggest a potential common origin for these plastic cells.

PAGE 87

75 B 90%A D C AFP A6 20 m Day 5 Day 14 50 m Characteristics of mouse hepatic oval cells enriched using MACs magnetic beads. MACs sorted cells were subjected to FACs analysis to obtain purity levels. A) Histogram showing positive cells (green line) above the 90% level at the gate of maximum overlap with the control (blue fill). R1 in scatter plots demarcates the analyzed cell population. B) Negative flow through cells (green line) from the magnetic column are overlapped with the control (blue fill). Immunocytochemistry was p erformed to verify that the Sca-1+ cells isolated by MACs are indeed oval cells. C) MACs enriched cells are positive for the A6 epitope and AFP, known markers for murine oval cells. FITC conjugated (green) secondary antibody was used to visualize the positive cells with DAPI (blue) to show the nuclei of the cells. D) In vitro culture of HOCs. HOCs started to proliferate in about 5 days, and formed colonies in about two weeks. The HOCs in culture appear to be a homogeneous, undifferentiated cell population. Figure 3-1.

PAGE 88

76 DEFG HIJK 40 m A BC 500 m 250 m 50 mHepatic oval cells survive and differentiate in the neonatal mouse brain. A) Oval cells reside along the lateral ventricle ten days after transplantation. Most of the cells are clustered around the fimbria (Fi). Some are seen dispersed within forebrain parenchymal sites along the ventricular walls. B) Higher magnification of the box in A, showing the local distribution of the transplanted oval cells at the fimbria region. C) A n inset in B, showing differentiation of oval cells. D-K) Variety of differentiated oval cell morphologies: (D)-(E), amoeboid microglia-; (F)(G), ramified microglia-; (H)-(K), astrocyte-like morphology. The scale bar in (D) applies to (E)-(K). Figure 3-2.

PAGE 89

77 MAP2 GFPG GFAP GFPB 20 m GFP N estinA N FM GFPE GFAP GFP C 20 m -IN GFPF S100DGFPDifferentiated GFP+ hepatic oval cells express neural-specific proteins in the neonatal mouse brain. GFP expression of oval cells (green) colocalize with immunostaining with antibodies to neural-specific p roteins, visualized with secondary antibody conjugated to PE (red). A) Oval cells are positive for nestin, a marker of primitive neural stem/progenitor cells. B)-D) Oval cells are positive for the astrocytic markers GFAP and S100. Oval cells are seen to intertwine with native astrocytes in the surrounding tissue. Note in (C), only one of the two GFP+ cells expresses GFAP. E)-G) Oval cells are positive for antibodies against several neuron specific proteins NFM, -internexin ( -IN), and MAP2. The scale bar in (A) applies to (B) and (D)-(G). Figure 3-3.

PAGE 90

78 GFP Beads MAC1 MERGE 20 m MAC1 GFP MergeB 100 mC MAC1 GFP MAC1 GFPA 20 mOval cells acquire microglia phenotype and phagocytosis activity in the mouse brain. GFP expression of oval cells (green) colocalize with immunostaining with Mac1 antibody against mouse microglia specific protein CD11b, visualized with secondary antibody conjugated to PE (red). A) Mac1+ oval cells have amoeboidand ramified-microglia morphology. B) Many Mac1+ oval cells coexist with native microglias. C) Differentiated hepatic oval cells show phagocytosis activity. Latex microbeads, conjugated with florescent blue were co-injected into the mouse brain with the isolated oval cells. Brain sections were immunostained with Mac1 antibody. Two differentiated GFP+ oval cells (arrowheads) with ramified and amoeboid microglia morphology are co-localized with Mac1 staining (red, R-PE) and microbeads (blue). The native microglia are also seen to take up microbeads. Figure 3-4.

PAGE 91

79 Table 3-1. Survival Rate of Transplanted HOCs in the Neonatal Mouse Brain. Animal No.Number ofInjected Cells(x105)Number ofGFP+CellsPercentage ofSurvival 5.32.56800.27%13.12.53900.16%14.62.52,2500.90%14.72.54680.19%15.42.02,0221.01%15.52.01,9620.98%15.62.01,3020.65%15.72.01,5840.79%15.92.05460.27%Average2.21,2450.56% N ine mouse brains were counted. The GFP+ cells of every sixth sectionof the forebrain were counted for each brain. The total numbers ofsurvived HOCs were obtained by multiplying the counted results by afactor of six. The standard deviation is 0.36%.

PAGE 92

80 Table 3-2. Composition of the Neural Markers in the Transplanted HOCs in the Neonatal Mouse Brain MarkersNumber ofAnimalsNumber ofPositive CellsNumber ofGFP+ CellsPercentage ofPositive CellsStdV Nestin425.5115.322.1%11.6%Mac13102.7169.360.6%10.5%GFAP478.8227.034.7%9.0%S100368.0250.027.2%5.7%NFM311.0168.06.5%1.3%Map2355.0276.019.9%2.5%Every sixth section of the forebrain was counted for each animal. Theaverage numbers of cells positive for each marker, and the GFP+ cells, as well as the p ercentages of the number of positive cells among the total GFP+ cells, and theirstandard deviations (StdV) among all the mice inspected are shown.

PAGE 93

81 Table 3-3. The Percentage of Cells Taking up Microbeads among the Total GFP+ Cell. Animal No.GFP+ w/BeadsTotal GFP+% of GFP+w/ beads 21.5527866.7%21.6233762.2%21.7142556.0%21.8142850.0%Average264258.7% Every sixth section of the forebrain was inspected for each animal. The standard deviation is 7.3% among all four mice

PAGE 94

CHAPTER 4 NEURAL INDUCTION OF HEPATIC OVAL CELLS IN VITRO 4.1 Introduction The neural differentiation of hepatic oval cells in vitro is of interest, because it may provide information on the mechanisms of neural trans-differentiation observed in vivo previously reported by Deng et al (2003), and it may also reveal the correlations of HOC with MSC by comparing their responses to the previously used neural induction protocols in MSCs. The hypothesis of a bone marrow origin of HOCs has been suggested previously. Crosbie et al. (1998) provided in vitro evidence to show that there are hematopoietic stem cells exist in the human liver. Oval cells express many hematopoietic stem cell markers, such as Thy1, c-kit, and CD34 in the rat, and flt-3 in the mouse (Omori et al., 1997a; Omori et al., 1997b; Petersen et al., 1998a). Recent work from our laboratory has reported that mouse oval cells also express Sca-1 and CD34 (Petersen et al., 2003). Petersen et al. (1999) demonstrated that, after 2AAF/PHx liver injury, rats that received bone marrow transplantation had mature hepatocytes of donor cell origin within the regenerating liver, suggesting that oval cells may have also been derived from the bone marrow source. Theise et al. (2000) also provided evidence that human bone marrow can be transplant into liver directly and reconstitute its function. Under this context, it would be very interesting to compare the difference of HOC and MSC, in the purpose of understanding the genesis of these two types of stem cells. 82

PAGE 95

83 In vitro neural differentiation is a critical steps towards the future stem cell application in neurological disorders. Hepatic oval cell may not be the best choice as a candidate for the use in cell transplantation, because they do not exist in large quantity under normal condition, and to obtain HOCs involves invasive procedures. However because of the sheer numbers that can be obtained in experimental animal, it may provide some insights to the mechanisms of neural differentiation of adult stem cells in general. Yang et al. (2002) reported that rat HOCs can be indu ced to produce insulin in the culture condition, demonstrating the multipotency of HOCs in vitro. Deng et al (2003) demonstrated that mouse HOCs trans-differentiated into neural lineage when grafted in to the neonatal mouse brain. Trans-differentiation from HOCs to pancreatic lineage may not come out as a surprise, because both cell types are endoderm tissues. The effort of inducing HOCs into a neural phenotype in vitro, the ectoderm lineage phenotype would further prove HOC multipotency, which could qualify it as a true stem cell. Utilizing this rational, we applied a variety of methods which have been shown effective to induce a neural phenotype from MSCs, in the purpose of demonstrating the neural differentiation of HOCs in vitro. 4.2 Materials and Methods 4.2.1 Isolation and Culture of Oval Cell Rat HOCs (rHOCs) were induced by utilizing procedures as previously described by Petersen et al. (1998b) using the 2-acetylamino-fluorene/partial hepatectomy injury model. Oval cells were then isolated from the rat livers by using the two-step collagenase perfusion protocol of Seglen (1979), and purified by fluorescence activated cell (FAC) sorting for the Thy-1.1-positive cell population (Petersen et al., 1998a). The FITC-

PAGE 96

84 conjugated anti-rat Thy1.1 antibody was purchased from PharMingen. This technique resulted in hepatic oval cell populations with a purity of higher than 95%, and were tested to express the hepatic stem cell markers -fetoprotein, albumin, -glutamyl transpeptidase, cytokeratin-19, and OV6 (Petersen et al., 1998a). The purified Thy-1.1positive hepatic oval cells were cultured in serum-free Iscove's modified Delbeccos medium (IMEM; GIBCO/BRL) supplemented with leukemia inhibitory factor (10 ng/ml), IL-3 (10 ng/ml), stem cell factor (10 ng/ml), and Flt-3 ligand (10 ng/ml), and they have been culture over 50 passages (Yang et al., 2002). The mouse HOCs (mHOCs) induction and isolation have been described in the previous chapter (see 3.2.1 ) 4.2.2 Neurospheres Generation and Culture Neurospheres (NS) were generated from postnatal day 5-7 mouse or rat brains. In brief, the pups were decapitated under deep anesthesia (IP injection of sodium phenobarbital), and the brains were removed from the skull. After removed the olfactory bulb and the cerebellum, tissue was minced to small pieces, washed in PBS, and trysinized at 37 C for 10mins to dissociate the cells completely. After further washed, cells were re-suspended in 2% Methyl Cellulose which is dissolved in DMEM/F12 and supplemented with N2 and growth factor cocktail (10ng/ml basic FGF and 20ng/ml EGF). The cultures were maintained up to a month, during which time NSs would become visible and grow up to about 200 m in diameter. 4.2.3 Organotypic Brain Slice Culture Organotypic brain slice cultures were generated from postnatal E15.5 embryos, postnatal day 4, and 8 weeks adult mice. Briefly, animals were euthanized and quickly

PAGE 97

85 decapitated. The brains were cut into two saggital halves and immersed in a preparation medium (DMEM, L-ascorbic acid, L-glutamate, and pen/strep). The halves were then super-glued to the vibratome stage, medial surface down, and covered with cool molten 2% agar. The stage was then placed in the vibratome chamber and filled with preparation medium. Slices were cut between 300-400 M, placed in cold preparation medium. Slices from the appropriate levels were then immediately transferred to a transwell (Falcon), placed in a 6 well plate, and incubated at 35 degree C and 5% CO 2 Each transwell was suspended in 1.8 mL of A medium, DMEM F12 with B27 and N2 supplements containing 25 % serum. The medium was changed the next day and feeding was done every other day. For long-term cultures A medium was phased out replaced by a serum free B medium, DMEM F12, B27, and N2. To avoid serum deprivation effects, a mixture of 2/3s A and 1/3 B was used on day 3 and on day 5 a mixture of 2/3s B and 1/3 A was used. On day 7 medium was completely replaced with B medium and replaced every other day (Benninger et al., 2003; Scheffler et al., 2003). 4.2.4 Immunocytochemistry The cells, grown on coverslips or culture dishes, were fixed in 4% paraformaldehyde, or ETOH:acetic acid (95:5) for 15mins. After washed 3x5 mins with PBS, the cells were blocked in 10% goat serum in PBS for 30 mins. The cells were then incubated with primary antibodies for one hour at room temperature. Several antibodies have been used in the study, which included III tublin (Promega), NeuN (Phamingen), neurofilament associated protein medium (NFM; Encor), Nestin, -internexin ( -IN) and MAP2ab (Sigma) antibodies against neuron specific proteins, and glia fibrilary acidic protein (GFAP; Immunon), and S100 (Sigma) antibodies against astrocytes, and Mac1

PAGE 98

86 (Serotec) antibody against mouse microglia specific protein CD11b. After washed in PBS three times, the cells were then incubated with a florescent conjugated secondary antibody for one hour at room temperature. Finally, cells were washed in PBS three times before mounted with florescent mounting medium (Vectashild). 4.2.5 Neuronal Induction Using IBMX and dbcAMP One day before the experiment, rHOCs were replated into 35mm well plates at 60% confluence and grew overnight in the oval cell culture medium. For induction, the culture medium was replaced with induction medium which contained 0.5mM IBMX and 1mM dbcAMP. Cells were then cultured for 7, 14, 21days, during which time the medium was changed once a week. After terminating the inductions at the designated time points by fix the cells with 4% paraformaldehyde, immunocytolabeling were performed to detect neuronal specific proteins. 4.2.6 Neural Induction Using BME, DMSO and BHA One day before the induction, rHOCs were plated in 35mm dishes with a confluence of 60% in HOC culture medium. For the induction, the culture medium was first replaced with induction medium A, which contains IMDM (80%), FBS (20%) and BME (1mM), and culture for 24 hrs. The medium A was then replaced with medium B that contained only IMDM and BME (5mM) and culture for 24 hrs. Finally, the medium B was replaced with medium C that contains DMSO (2%) and BHA (0.2mM) in IMEM, and cells were treated for prolonged one to two weeks depending on the morphological changes.

PAGE 99

87 4.2.7 Neural Induction Using Retinoic Acid under 4+/4Protocol Rat HOC aggregates were induced by introducing scratches on an over-confluent rHOC monolayer culture. We then cultured the aggregates with 0.5 M RA to normal culture medium without LIF in an anti-adhesive petr idish for four days. The rHOC aggregates were then cultured in normal medium without RA for an additional four days. Finally, the aggregates were then moved onto cover slips coated with laminin to induce neural differentiation for 7-14 days. The neural differentiation was then evaluated by immunocytolabeling. 4.2.8 Neural induction of Hepatic Oval Cell by Over-Expressing Chordin and Noggin Chordin and noggin plasmid constructs were gifts from Dr. O'Shea of University of Michigan (Gratsch & O'Shea, 2002). FuGENE6 (Roche) transfection kit was used for the gene delivery. The cells were passed into a 35mm 6-well plate with a confluence of 50-80% the day before transfection. For transfeciton, 100 L of serum-free IMEM and 6 l FuGENE6 reagent were mixed in a sterile tube and incubated for 5 mins at room temperature. And then 2 g DNA were added into the reaction mixture, and incubated for 30 mins at room temperature. The reaction mixtures were then laid onto the cells with 2mL culture medium, and incubated for 48hrs. 4.2.9 Neural Induction of HOC by Co-Cultu ring with Differentiating Neurospheres Rat HOCs were induced to express green fluorescent protein (GFP) using lentiviral vectors developed in Dr. Razaida's laboratory at the Physiology Department of University of Florida. For the co-culture, the neurospheres derived from neonatal mouse brain were first induced to differentiate by plating on laminin coated cover slips. The

PAGE 100

88 GFP expressing rHOCs were then plated on the differentiating neurospheres for up to four weeks. 4.2.10 Neural Induction of HOCs by Micro-injecting into Neurospheres For this experiment, 10-20 GFP + rHOCs were injected into a neurosphere of 50100 m in diameter. The rHOCs were microinjected into the center of the neurospheres in the University of Florida Cancer Center. Following microinjection, the neurospheres were placed into the neurosphere culture medium, and cultured for two weeks. The neurospheres incorporated with GFP + rHOCs were then placed on laminin coated cover slips to induce neural differentiation. 4.2.11 Neural Induction of HOC by Incorporating into the Embryoid Body R1 ES cells:GFP + rHOC cells (3:1) were mixed in ES differentiation medium (20% FBS, 15 L Monothioglycerol (Sigma) in IMEM) with a density of 100cells/ L. Thirty micro liters of the cell mixture were gently laid on the cover of a petridish, and cultured in a hanging-drop to induce embryoid body (EB) formation. After two days culture, the EBs were removed from the hanging-drops, and maintained in ES culture medium for additional two days. The EBs incorporated with GFP + rHOCs were then cultured in the ES differentiation medium on an adhesive culture dish to induce differentiation. 4.2.12 Neural Induction of Hepatic Oval Cells by Implanting into and Explanting out of Neonatal Mouse Brain Freshly isolated mGFP + HOCs were grafted into the lateral ventricles of neonatal mouse brains as described in 3.2.5 Ten days post-transplantation, the mouse brains were processed to generate neurospheres. Using inverse fluorescence scope, GFP +

PAGE 101

89 neurospheres were selected for further culture. After growing into about 100 m in diameter, the GFP + neurospheres were induced to differentiate by growing on laminin coated cover slips. 4.2.13 Neural Induction Using 5-Azacytidine Rat HOCs were replated in a 35mm 6-well plate with a 60% confluence one day before the induction. Cells were then treated with 10 M 5-Azacytidine mixed in IMEM supplemented with 10% FBS containing 50ng/ml of NGF, BDNF and NT-3 for 96 hrs. After induction, the medium was replaced with N2-supplemented DMEM/F12 containing 50 ng/ml of NGF, BDNF and NT-3. 4.3 Results 4.3.1 IBMX /dbcAMP Treatment to the HOC Causes Neural-like Morphological Change After two days treatment in IBMX /dcAMP, rHOCs had dramatic morphological change from fibroblast-like to neural-like (Fig 4-1A). This phenomenon has been observed in stromal cells derived from bone marrow (Deng et al., 2001). However, immuno-labeled with neural specific protei ns, rHOCs were negative for most of the markers except III tubulin and S100 (Fig 4-1B). The Expression of III tubulin was also limited to very small portion of the cells, which included rHOCs with neural-like as well as non-neural-like cells. 4.3.2 BME/BHA Does not Induce Neural-like Change in HOC BME/BHA have been used to induce the bone marrow derived stem cells into neural differentiation (Woodbury et al., 2000; Black & Woodbury, 2001). After about two weeks treatment, significant morphological change was observed in the rHOCs (Fig

PAGE 102

90 4-2A). When tested with neural markers, rHOCs were not stained positive for any of the markers including III tubulin (Fig 4-2B). 4.3.3 4+/4Retinoic Acid Protocol Does not Induce Neural Differentiation in rHOC To test the neuronal trans-differentiation potential of HOCs, a previously reported 4+/4RA treatment protocol was used. This protocol has been shown to be affective to induce neuronal differentiation in various cell lines including embryonic cells (Bain et al. 1996). For induction, rHOC aggregations were induced to form by scratching the surface of a confluent HOC monolayer (Fig 4-3A). However, neither the morphological change nor the neural marker expression was observed in the rHOCs that have been treated with the protocol (Fig 4-3B). 4.3.4 Over-Expressing Chordin and Noggin Does not Induce Neural Differentiation in rHOC Rat HOCs were transfected with two plasmid constructs containing transcription factors chordin and noggin that are responsible for the embryonic nervous system development, following Kohyama et al. (Gratsch & O'Shea, 2002). Despite that the cells transfected with noggin and chordin had different morphology from cells with plain vector control (Fig 4-4A, B, C), no neuronal marker expression was observed in the cells in the subsequent immunocytochemistry (Fig 4-4D). 4.3.5 Co-Culturing with Differentiating Neurospheres Does not Induce Neural Differentiation in HOC Rat HOCs were co-cultured with the differentiating NSs, under the rational that the secreted growth factors or chemockines by the NSs would recourse the differentiation of rHOCs. After five days of co-culture we observed limited morphological change of rHOCs labeled with green fluorescent protein (GFP) (Fig 4-5A). The cells were also

PAGE 103

91 positive for -internexin, a protein reported to be highly up-regulated in regenerating neurons (Fig 4-5B) (Evans et al., 2002). The cells were not positive, however, for the immuno-staining of other neural specific proteins including NFM, III tubulin, Map2, GFAP. 4.3.6 Internalization of HOC with Neuropheres Contribute Little to HOC Neural Differentiation Neurospheres have been used to test various theories of neural stem cell (NSC) differentiation, and have been intensivel y studied in the past decade (Laywell et al. 1999; Kukekov et al., 1999). The outer layer of the NS contains partially committed progenitors and differentiated neural cells, while the center of the NS is believed to accommodate truly multipotent NSCs. There are rich growth factors to keep the NSC pool in the core area in the NSs. We hypothesized that the core of the NS is able to de-differentiate HOCs, and the neural differentiation condition of the NS after plated on a laminin coated substrate would drive HOCs into neural differentiation. To test this hypothesis, approximately ten GFP + rHOCs were injected into a NS with 50-100 m in diameter (Fig 4-6A). However, the experimental system proved to be a failure at the early stage, because of the poor survival of GFP + rHOCs inside of the packed NS core. Alternatively, the GFP + rHOCs were incorporated into the NS by co-culturing them with NSs in nonadhesive culture dish (Fig 4-6B). During five days incorporation co-culture period, the number of HOCs were seen to expand dramatically, but the subsequent differentiation induction yield no GFP+ neural cells judged by morphological criteria (data not shown).

PAGE 104

92 4.3.7 Internalization of HOCs into the Embryoid Body Does not lead to Neural Differentiation of HOCs Hybrid embryoid bodies (EBs) of ES cells and GFP + HOCs were generated by hanging-drop culture system (Fig 4-7A). However, despite the vigorous differentiation of ES cells within the hybrids to become various of tissues, including cardiomyocytes that exhibit synchronized pulsing, GFP + HOCs remained unchanged morphologically from normal culture state (Fig 4-7B). The immuno-phenotyping of the differentiated hybrid EBs reveals no GFP + neural cells, while non-GFP neural lineage derived from ES cells has been observed. 4.3.8 Brain Tissue Transplantated with GFP + HOC Generate GFP + Neurospheres Under the same rational of the previous experiments (see 4.3.6 and 4.3.7) we further test the de-differentiation and re-differentiation theory by grafting the GFP + mHOCs into the neonatal mouse brain, and generating NSs from the subventricle zone of the recipient brain (Fig 4-8A). In this system, HOCs were given the chance to live in the neural stem cell niche at the SEZ of the neonatal mouse brain, a region called brain marrow (Steindler et al., 1996) and believed to contain the NSC pools even in the adult animal. Ten days after transplantation, GFP + NSs were generated following typical neurosphere generating protocol (Fig 4-8B, C) However, after induced for differentiation by plating on laminin coated substrate, the differentiated cells at the outer rim of the NSs lost the GFP expression, while the core, where undifferentiated facultative NSCs reside, maintain the GFP expression (Fig 4-8D). Immunophenotyping showed that these GFP + NSs generated both neurons and astrocytes (data not showing).

PAGE 105

93 4.3.9 Hepatic Oval Cells Survive Poorly in the Organotypic Brian Slice Culture A key prerequisite for transplant-based neural repair strategies is the functional interaction of the grafted cells with host neurons and glias. Conventional transplant strategies provide only limited experimental access to donor cell migration, integration, and function. The organotypic brain slice culture system provides a direct visualization and functional analysis of transplanted GFP + HOCs. However, it was found that mHOCs survived poorly on the 350 m brain slices (Fig 4-9A, B) in our study. By day10 postgraftment, no GFP + mHOCs were observed in the slices processed from E15.5 mouse embryo, as well as adult animals (Fig4-9C). 4.4 Conclusion and Discussion Although engraftment of HOCs into the neonatal mouse brains has shown neural trans-differentiation of HOCs, the in vitro inductions tested in this study showed little sign of trans-differentiation (Deng et al., 2003). This difference may be explained by the complexity of signaling molecules involved in the cell lineage determination in vivo, which is difficult to be recapitulated in vitro. The use of chemical reagents such as IBMX, dbcAMP, BME and BHA has indeed induced neural morphological acquisition in HOCs, as has been reported in the MSCs after treated with similar induction protocols (Woodbury et al., 2000; Deng et al., 2001; Black & Woodbury, 2001). But as has been shown in the previous chapter, same effect was also observed when using same prot ocol in NIH3T3 fibroblast cells. Similar to what has been shown in NIH3T3, there is little to no sign of neural specific protein upregulation from HOCs under the induc tion of IBMX/dbcAMP and BME/BHA protocols, including the astrocyte specific GFAP that has been upregulated in response to

PAGE 106

94 the IBMX/dbcAMP treatment in BMDCs (see Chapter 2). The similar response to the socalled chemical induction exhibited in the BMDCs and HOCs, along with the observation from NIH3T3, may further support previous conclusion that the neuron-like morphological change under such treatment is the result of cell stress, rather than true neuronalization (Lu et al., 2004; Neuhuber et al., 2004). The use of RA to induce neuronal induction is effective in the ES cells (Bain et al. 1995; Shum et al., 1999), but has been ineffective in driving HOCs toward neural phenotype lineage in vitro. RA is an important growth factor for neural determination during the embryogenesis. The HOCs are progenitors of hepatocytes and cholangiocytes in the liver of adult animals. It is, therefore, not surprising that they are not responsive to the RA. Further work to exam the existen ce of RA receptors on the HOCs cell surface would be helpful to interpret the outcome. Chordin and noggin are proneural genes that can drive neuroplate formation from ectoderm by inhibiting BMP-4 signaling (HemmatiBrivanlou & Melton, 1997). Proteins encoded by these genes have been shown to been effective to drive ES cells to become neurons in vitro (Gratsch & O'Shea, 2002). It has also been reported that they could promote neural differentiation in MSCs (Kohyama et al. 2001). Retinoic acid binds to and activates transcriptional regulators of the nuclear receptor family, and noggin and chordin act as transcription factors themselves in the nucleus that regulate a set gene expressions at the early stage of the development to control the neurogenesis. The non-responsiveness of HOCs to RA, chordin and noggin may collectively reflect the different multipotency between HOCs and MSCs, and suggesting that HOCs are more determined than the ES cells and MSCs.

PAGE 107

95 The limited effect of neurosphere co-culturing in guiding HOCs toward neurallike morphology through may suggest a prelimin ary neural induction effect of neural stem cells (Fig 4-5). Co-culture with neural stem cells has been widely used to provide an in vitro neural induction environment that is impossible to completely recapitulated by synthetic culture medium (Llado et al., 2004). Alpha-internexin has been reported to associate with neuro-regeneration (McGraw et al., 2002; Evans et al., 2002). The expression of -internexin in HOCs seems suggest that there is indeed a neurodifferentiation of HOCs through co-culturing with the neural stem cells. However, the fact that only -internexin, but not other neural specifi c proteins has been detected in the GFP + rHOCs weakens this possibility. That GFP + rHOCs lived poorly, and eventually died inside the neurospheres through microinjection may be caused by the oxygen and nutrient deprivation at the center of the densely packed cells (Fig 46A). However, the healthy growth of HOCs inside of the neurospheres through spontaneous incorporation argues against this suggestion (Fig 4-6B). Rat HOCs also exhibit normal viability of inside embryoid bodies, which further indicates that the HOCs died of other causes after micro-injected into the neurospheres(Fig 4-7). The colony formation of stem cells may be one of the unique properties that have been observed in different types of stem cells. The NSCs develop into neurospheres, while colony-forming units (CFU) have been used to isolate mesenchymal stem cells regularly (Short et al., 2003). Hepatic oval cells will also aggregate when a confluent monolayer culture is maintain unpassaged over long period of time (unpublished observation). It may be speculated that the tight cell-cell contact creates a unique condition for stem cell maintenance. However, the failure of HOCs to

PAGE 108

96 respond to the internal environment of EB and NS may suggest that HOCs are not plastic enough, but it may also imply that stem cell aggregates, generated either by clonal growth (e.g. NS) or cell aggregation (e.g. EB), do not create an in vivo -like condition through cell cell contact. Further study to exam these cell cell contact signaling in those aggregates is of interesting to understand the nature of the colony forming property of stem cells. The generation of GFP + NS from young mouse brains after grafted with GFP + HOCs may suggests that hepatic oval cell experienced a de-differentiation to redifferentiation process to become a neural stem cells. It is an important and significant demonstration of the plasticity of HOCs, as well as the in vivo induction condition. However, the alternative explanation of this result may be cell fusion. It is possible that the GFP + mHOCs fused with endogenous NSCs after grafted into the neurogenic lateral ventricles, and enable the NSCs to express GFP. The loss of GFP expression in the HOC derived neurospheres after being induced for neural differentiation may have resulted from the reprogramming of genetic materials during the differentiation. Future studies to use X, Y-chromosome painting or other evaluation methods to further resolve the issue would be necessary for understanding the plasticity modulation of HOCs in the lateral ventricles of the neonatal mouse brains. The organotypic brain slice culture has been previously used to partially recapitulate the in vivo condition while allow in vitro manipulation (Benninger et al., 2003; Scheffler et al., 2003). However, the mHOCs survived poorly comparing to direct transplantation into the brain, and showed little sign of differentiation. The special medium that is required for maintaining the brain slices may have contributed to the poor

PAGE 109

97 survival of HOCs, since HOC requires rich growth factors for normal maintenance. More tests may be needed to justify this technique in culturing HOCs successfully. In summary, the in vitro neural trans-differentiate capability of HOCs is very restricted. Despite the variety of induction me thods tested that have been shown to be effective to induce ES or MSCs to differentiate into neural lineage, we only observed limited effect in driving HOCs to differentiate into neural phenotype. As has been suggested previously that HOCs may have derived from bone marrow stem cells (Petersen et al., 1999; Theise et al., 2000), this sheer difference in terms of in vitro neural trans-differentiation potency between them clearly put HOCs behind MSCs in the differentiation potential hierarchy. Our results may not negate the in vitro neural transdifferentiation capability of HOCs, but they certainly demonstrate that HOCs are restricted hepatic progenitors.

PAGE 110

98 N eural induction of HOCs using Isobutyl-methylxanthine and dibutyryl cyclic AMP (IBMX /dcAMP). A) Oval cells undergo neuron-like morphological change after one day of treatment. Picture at the right is the enlarged images of the framed area in the left imagine. B) Immunostaining of neuronal marker III tubulin. Small number of cells shows the positivity (red); Cells has been induced with GFP expression vector (green). C) Immunostaining of astrocyte marker S100. Blue shows the nucleus counterstaining. Figure 4-1.

PAGE 111

99 Day 6 Day 3 D6/ bTubIIIA B N eural induction of HOCs using Beta-Mercaptoethanol and Butylated Hydroxyanisole (BME/BHA). A) After 3 days treatment, elongated neuron-like cells can be observed. By day 6, more cells show neuron-like small cell body with long processes. B) Immunostaining of neuron specific protein III tubulin shows negativity (red). Nucleus has been counterstained with Dapi (blue). Figure 4-2.

PAGE 112

100 0.5uM 4+ 0.5uM 4-AB N eural induction of HOC using Retinoic Acid (RA) under 4+/4Protocol. A) GFP+ HOC aggregates were treated with 0.5 M RA for four days. B) After culture the HOC aggregates in anti-adhesive petridish for four days, cells were plated on adhesive culture dish to induce differentiation. Figure 4-3.

PAGE 113

101 Nog/ bTubIII Chordin/day5 Vector/day5 Noggin/day5AB CD N eural induction of HOC by ove r -expressing chordin and noggin (CHD/NOG). Five days after rat HOCs were transfected with CHD (A) and NOG (B), small number of cells showed neuron-like morphology. There was no similar change in the null vector transfected cells (C). D) NOG transfected HOCs did not express neuron specific protein III tubulin. Figure 4-4.

PAGE 114

102 Day 5 GFP -IN MergeA B N eural induction of HOC by co-culturing with differentiating neurospheres. A) Small number of GFP+HOCs form processes after five days co-culture with neural cells differentiated from NSs. Picture on the right shows the enlarged area in the inset on the left. B) Many cells express -internexin (red) after co-culturing. Figure 4-5.

PAGE 115

103 D3 D2 spontaneous incorp.A B N eural induction of HOC by incorporating into the core of neurospheres. A) Micro-injection of GFP+HOCs into the core of the N Ss. HOCs survived poorly inside of NSs, disappeared from the NSs in about a week. B) Spontaneous incorporation of GFP+HOCs into N S’s resulted in fast growing HOC aggregates inside of NSs. Figure 4-6.

PAGE 116

104 EB/ D2 Diff. Ind./D9 AB N eural induction of HOC by incorporating into embyoid bodies (EBs). A) Two days after plating the GFP+ HOCs incorporated EBs on to non-adhesive petridish. B) Nine days after inducing the EBs for differentiation. Morphologically, HOCs were not different from the normal culture condition. Figure 4-7.

PAGE 117

105 7 Days Generate NS Induce differentiation day1 post expl. day8 post expl. AB C D N eural induction of HOCs transplanting into and explanting out of the neonatal mouse brain. A) A schematic diagram of experimental procedure. B) Eight days post-explantation, GFP+ N S’s were observed in the culture. Two pictures on the right showing a GFP+ NS fused with a GFPNS by florescent and p hase-contrast imaging. C) A GFP+ cell and a GFPat day 1 postexplantation. D) Differentiation of a GFP+ NS and a GFPNS showing by phase-contrast (left) and florescent (right) imaging. The loss of GFP express is observed after cell differentiated and left the center of the GFP+ core. Figure 4-8.

PAGE 118

106 E15.5 /D5 IRAD/D5 Day5 Day10 Day15 E15.5 (n=3) +-PU1-/E15.5(n=3) +-PN (n=4) +-IRAD (n=3) -/+-N ormAD(n=4) -/+-AB CHOCs culture on organotypic brain slices. A) Five days after culturing HOCs on a brain slice processed from embryonic day 15.5 tissue. B) Five days after culturing HOCs on a brain slice from a sub-lethally irradiated, 8 weeks old mouse brain. C) A table to show the survival of HOCs on brain slices processed from different group of animals. ‘+’ –fair survival; ‘-/+’ –poor survival; ‘-‘ –no survival; E15.5 –embryonic day 15.5; PU1-/E15.5 –embryonic day 15.5 tissue from PU1 knockout mouse; PN – postnatal; IRAD –sublethally irradiated 8 weeks mouse; N ormAD –normal 8 weeks mouse. Figure 4-9.

PAGE 119

CHAPTER 5 SUMMARY AND CONCLUSIONS We have studied two types of adult stem cells, the bone marrow derived cells and the hepatic oval cells. There is a significant difference between these two types of AS cell in their capability to differentiate into neural cell type. While the BMDCs spontaneously generate neurogenic and astrogenic progenitors under normal culture, HOCs showed little sign of neural trans-differentiation capability in vitro. However, neurogenic subependymal zone (SEZ) provides strong induction incentives to stem cells, guiding both BMDCs and HOCs to express neural specific proteins after engraftment. Whether HOC or BMDC relate to each other or not is still a matter of debating, but what have been demonstrated in the current study show that BMDC is more potent, and probably more primitive than HOC. Despite the doubts and disbelieves surrounding the trans-differentiation phenonmenon of adult stem cells, We have demonstrated that the two types of adult stem cell, BMDC and HOC, indeed showed neural trans-differentiation capability in vivo or in vitro. In particular, the bone marrow derived BMDCs show neural property spontaneously, exhibiting an asymmetric division to become neurogenic and astrogenic progenitors, in addition to symmetric division to maintain the multipotent cell population. In vivo, both BMDC and HOC differentiated into neural lineage by expressing the neural specific proteins. Besides showing strong phenotypic and morphological characteristics of microglia, HOCs also exhibited vigorous phagocytosis capability, as did the functional 107

PAGE 120

108 endogenous microglias in the brain. The BMDCs have stronger neural transdifferentiation potential than HOCs, showing neural progenitor-like migration along rastrol migratory pathway (RMS), and differentiate into morphologically and phenotypically mature granule cells in the olfactory bulb. Evaluated by Y-chromosome painting technique, it can be concluded that cell fusion event did not contribute to the neural trans-differentiation of BMDCs in vivo Although they both are adult stem cells, BMDCs and HOCs have contrast difference in the differentiation plasticity. MSCs have also been reported to differentiate into most of the lineages including brain, liver, heart, skeletal muscle kidney, pancreas, lung, skin, gastrointestinal tract (Herzog et al., 2003). HOCs have only been reported to differentiate into pancreatic insulin-producing cells in vitro (Yang et al., 2002), and neural phenotypes in vivo (Deng et al., 2003), besides hepatic lineages. In the current study, we have not been able to show the neural differentiation capability of HOCs in vitro while the BMDCs demonstrated neural property spontaneously under normal culturing by expressing variety of neural specific proteins. Besides the different potentialities showing in the in vitro induction, BMDCs also had stronger performance after grafted into the neonatal mouse brain than HOCs. BMDCs were shown to migrate along RMS and differentiating into granule cells at the olfactory bulb, but HOCs mostly penetrated and retained at SEZ. As suggested previously that hepatic oval cells may have generated from progenitors reside in the bone marrow (Petersen et al. 1999; Theise et al. 2000), the exact nature of this facultative progenitor remains unclear. Krause, et al. (2001) reported that hematopoietic stem cells (HSC) could be the source for bile duct epithelial cells in the liver, which may suggest a HSC origin of hepatic oval cells, since

PAGE 121

109 the anatomical origin of oval cells was reported at the cannel of herring where bile duct terminated in the liver (Theise et al., 1999). Besides the differentiation potential between them, BMDCs is more accessible than HOCs, which makes them a better source for the purpose of clinical application. HOCs may be observed in large quantity only under certain injuries, and have to be isolated through invasive hepatectomy. Its unlikely to treat the brain disorder of a patient in the expanse of his liver. The BMDCs, on the other hand, are more obtainable from multiple sources of a patient without risking his life, and can be extensively expanded in culture. Although we have shown the perspectives of BMDCs as a possible source for neurological disorders treatment, many issues of the BMDCs have not yet understood for the application of this type of adult stem cells in clinical phase. The next step is to apply BMDCs, both induced or uninduced in vitro, into the animal models of different disease, such as the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) mouse model of Parkinsons disease (PD). In this step, MSCs could be either directly injected into the lesion sites alone, or engineered ex vivo to obtain functional units of the tissue before engraftment. The combination of stem cell ther apy with gene therapy is also one of the alternatives currently under investigations in many laboratories, and has shown promising results (Kurozumi et al., 2004). Li et al. (2001) delivered MSCs directly into the striatum of the MPTP mouse brain, and observed moderated reduction of PD symptom of the injured mice. But they observed very few exogenous dopaminergic neurons at the grafted site. Zhao et al. (2002) used a ischemic rat brain model to test their MSCs in repairing the damaged cortex, and also observed behavior improvements in limb placement test. Kurozumi et al. (2004) injected brain derived ne urotrophic factor (BDNF) expressing

PAGE 122

110 MSCs into a rat stroke model and observed functional recovery and reduced infarct size at the site of lesion. Lu et al. (2005) also used MSCs that have been transduced to express BDNF in a spinal cord injury model, and observed a significant increase in the extent and diversity of host axonal growth. All these work contribute significantly to the next phase of MSC research (Kurozumi et al., 2004). In summary, BMDCs are shown to be a promising candidate for the potential use in treating neurological disorders. With additional effort in testing the effect of this cell type in the animal model of various neurodegenerative diseases, their potential therapeutic value will come clear. In spite of the neural trans-differentiation in the neonatal mouse, HOCs are not likely to be developed into a therapeutic agent in treating brain disorders. However, the HOC transdifferentiation demonstration has largely increased our understanding of the neurogenicity potential of SEZ in guiding an endodermal progenitor cells into neural differentiation. Utilizing the large quantity of the uncultured HOCs that can be obtained form animal, additional experiments may be used to test the mechanistical aspect of the neurogenicity property of SEZ.

PAGE 123

REFERENCES Alison,M.R., Golding,M.H. & Sarraf,C.E. (1996). Pluripotential liver stem cells: facultative stem cells located in the biliary tree. Cell Prolif., 29: 373-402. Altman,J. & Das,G.D. (1965). Autoradiographic and histological evidence of postnatal hippocampal neurogenesis in rats. J. Comp Neurol., 124: 319-335. Alvarez,I.S., Araujo,M. & Nieto,M.A. (1998). Neural induction in whole chick embryo cultures by FGF. Dev. Biol., 199: 42-54. Alvarez-Dolado,M., Pardal,R., Garcia-Verdugo,J.M., Fike,J.R., Lee,H.O., Pfeffer,K., Lois,C., Morrison,S.J. & Alvarez-Buylla,A. (2003). Fusion of bone-marrow-derived cells with Purkinje neurons, cardiomyocytes and hepatocytes. Nature, 425(6961): 968-73. Amit,M., Carpenter,M.K., Inokuma,M.S., Chiu,C.P., Harris,C.P., Waknitz,M.A., Itskovitz-Eldor,J. & Thomson,J.A. (2000). Clonally derived human embryonic stem cell lines maintain pluripotency and proliferative potential for prolonged periods of culture. Dev. Biol., 227: 271-278. Andrews,P.W. (2002). From teratocarcinomas to embryonic stem cells. Philos. Trans. R. Soc. Lond B Biol. Sci., 357: 405-417. Angeletti PU, Levi-Montalcini R, Calissano P., (1968) The nerve growth factor (NGF): chemical properties and metabolic effects. Adv Enzymol Relat Areas Mol Biol., 31:51-75. Awad,H.A., Butler,D.L., Boivin,G.P., Smith,F.N., Malaviya,P., Huibregtse,B. & Caplan,A.I. (1999). Autologous mesenchymal stem cell-mediated repair of tendon. Tissue Eng, 5: 267-277. Azizi,S.A., Stokes,D., Augelli,B.J., DiGirolamo,C. & Prockop,D.J. (1998). Engraftment and migration of human bone marrow stromal cells implanted in the brains of albino rats--similarities to astrocyte grafts. Proc. Natl. Acad. Sci. U.S.A, 95: 3908-3913. Badr,M.Z., Belinsky,S.A., Kauffman,F.C. & Thurman,R.G. (1986). Mechanism of hepatotoxicity to periportal regions of the liver lobule due to allyl alcohol: role of oxygen and lipid peroxidation. J. Pharmacol. Exp.Ther., 238: 1138-1142. Bain,G., Kitchens,D., Yao,M., Huettner,J.E. & Gottlieb,D.I. (1995). Embryonic stem cells express neuronal properties in vitro. Dev. Biol., 168: 342-357. 111

PAGE 124

112 Bain,G., Ray,W.J., Yao,M. & Gottlieb,D.I. (1996) Retinoic acid promotes neural and represses mesodermal gene expression in mouse embryonic stem cells in culture. Biochem. Biophys. Res.Commun. 223: 691-694. Baker,J.C., Beddington,R.S. & Harland,R.M. (1999). Wnt signaling in Xenopus embryos inhibits bmp4 expression and activates neural development. Genes Dev. 13: 3149-3159. Baksh,D., Song,L. & Tuan,R.S. (2004). Adult mesenchymal stem cells: characterization, differentiation, and application in cell and gene therapy. J. Cell Mol. Med., 8: 301-316. Barry,F.P. (2003). Biology and clinical app lications of mesenchymal stem cells. Birth Defects Res. C. Embryo.Today 69: 250-256. Bayer,S.A., Yackel,J.W. & Puri,P.S. (1982). Ne urons in the rat dentate gyrus granular layer substantially increase during juvenile and adult life. Science 216: 890-892. Belinsky,S.A., Badr,M.Z., Kauffman,F.C. & Thurman,R.G. (1986). Mechanism of hepatotoxicity in periportal regions of the liver lobule due to allyl alcohol: studies on thiols and energy status. J. Pharmacol. Exp. Ther. 238: 1132-1137. Benninger,F., Beck,H., Wernig,M., Tucker,K.L., Brustle,O. & Scheffler,B. (2003). Functional integration of embryonic stem cell-derived neurons in hippocampal slice cultures. J. Neurosci. 23: 7075-7083. Bjorklund,A., Dunnett,S.B., Brundin,P., St oessl,A.J., Freed,C.R., Breeze,R.E., Levivier,M., Peschanski,M., Studer,L. & Barker,R. (2003). Neural transplantation for the treatment of Parkinson's disease. Lancet Neurol., 2: 437-445. Bjornson,C.R., Rietze,R.L., Reynolds,B.A., Ma gli,M.C. & Vescovi,A.L. (1999). Turning brain into blood: a hematopoietic fate adopted by adult neural stem cells in vivo. Science 283: 534-537. Black,I.B. & Woodbury,D. (2001). Adult rat and human bone marrow stromal stem cells differentiate into neurons. Blood Cells Mol.Dis. 27: 632-636. Bradley,A., Evans,M., Kaufman,M.H. & Robertson,E. (1984). Formation of germ-line chimaeras from embryo-derived teratocarcinoma cell lines. Nature, 309: 255-256. Braissant,O. & Wahli.W (1998). A simplified in situ hybridization protocol using nonradioactively labeled probes to detect abundant and rare mRNAs on Tissue Sections. Biochemica ,10:10-16. Brazelton,T.R., Rossi,F.M., Keshet,G.I. & Bl au,H.M. (2000). From marrow to brain: expression of neuronal phenotypes in adult mice. Science 290: 1775-1779. Briscoe,J., Pierani,A., Jessell,T.M. & Er icson,J. (2000). A homeodomain protein code specifies progenitor cell identity and neuronal fate in the ventral neural tube. Cell 101: 435-445.

PAGE 125

113 Brockbank,K.G., Piersma,A.H., Ploemacher,R.E. & Voerman,J.S. (1985). Stromal cells (CFU-F) in normal and genetically anemic mouse strains. Acta Haematol. 74: 75-80. Bruder,S.P., Kurth,A.A., Shea,M., Hayes,W.C., Jaiswal,N. & Kadiyala,S. (1998). Bone regeneration by implantation of purified, culture-expanded human mesenchymal stem cells. J. Orthop. Res. 16: 155-162. Cameron,H.A., Woolley,C.S., McEwen,B.S. & Gould,E. (1993). Differentiation of newly born neurons and glia in the dentate gyrus of the adult rat. Neuroscience, 56: 337-344. Carleton,A., Petreanu,L.T., Lansford,R., Al varez-Buylla,A. & Lledo,P.M. (2003). Becoming a new neuron in the adult olfactory bulb. Nat. Neurosci., 6: 507-518. Carson,D.D., Rosenberg,L.I., Blaner,W.S., Ka to,M. & Lennarz,W.J. (1984). Synthesis and secretion of a novel binding protein for retinol by a cell line derived from Sertoli cells. J. Biol. Chem., 259: 3117-3123. Chopp,M. & Li,Y. (2002). Treatment of neural injury with marrow stromal cells. Lancet Neurol. 1: 92-100. Colter,D.C., Class,R., DiGirolamo,C.M. & Prockop,D.J. (2000). Rapid expansion of recycling stem cells in cultures of plastic-adherent cells from human bone marrow. Proc. Natl. Acad. Sci. U.S.A 97(7):3213-8. Crosbie,O.M., Reynolds,M., McEntee,G., Traynor,O., Hegarty,J.E. & O'Farrelly,C. (1999). In vitro evidence for the presence of hematopoietic stem cells in the adult human liver. Hepatology 29: 1193-1198. D'Ippolito,G., Schiller,P.C., Perez-stable,C., Balkan,W., Roos,B.A. & Howard,G.A. (2002). Cooperative actions of hepatocyte growth factor and 1,25-dihydroxyvitamin D3 in osteoblastic differentiation of human vertebral bone marrow stromal cells. Bone 31: 269-275. Dazert,S., Kim,D., Luo,L., Aletsee,C., Garfunkel,S., Maciag,T., Baird,A. & Ryan,A.F. (1998). Focal delivery of fibroblast growth f actor-1 by transfected cells induces spiral ganglion neurite targeting in vitro. J. Cell Physiol, 177: 123-129. Deans,R.J. & Moseley,A.B. (2000). Mesenchymal stem cells: biology and potential clinical uses. Exp. Hematol. 28: 875-884. Deng,J., Steindler,D.A., Laywell,E.D. & Petersen,B.E. (2003). Neural transdifferentiation potential of hepatic oval cells in the neonatal mouse brain. Exp. Neurol., 182: 373-382. Deng,W., Obrocka,M., Fischer,I. & Prockop,D.J. (2001). In vitro differentiation of human marrow stromal cells into early progenitors of neural cells by conditions that increase intracellular cyclic AMP. Biochem. Biophys. Res.Commun. 282: 148-152.

PAGE 126

114 Devine,S.M. (2002). Mesenchymal stem cells: will they have a role in the clinic? J. Cell Biochem. Suppl 38:73-9.: 73-79. Dezawa,M., Kanno,H., Hoshino,M., Cho,H., Matsumoto,N., Itokazu,Y., Tajima,N., Yamada,H., Sawada,H., Ishikawa,H., Mimura,T ., Kitada,M., Suzuki,Y. & Ide,C. (2004). Specific induction of neuronal cells from bone marrow stromal cells and application for autologous transplantation. J. Clin. Invest 113: 1701-1710. Diez,d.C. & Storey,K.G. (2001). Markers in vertebrate neurogenesis. Nat.Rev.Neurosci. 2: 835-839. DiGirolamo,C.M., Stokes,D., Colter,D., Phinney,D.G., Class,R. & Prockop,D.J. (1999). Propagation and senescence of human marrow stromal cells in culture: a simple colonyforming assay identifies samples with the great est potential to propagate and differentiate. Br. J. Haematol. 107: 275-281. Durston,A.J., van der,W.J., Pijnappel,W.W., Schilthuis,J.G. & Godsave,S.F. (1997). Retinoid signalling and axial patterning during early vertebrate embryogenesis. Cell Mol. Life Sci. 53: 339-349. Eglitis,M.A. & Mezey,E. (1997). Hematopoietic cells differentiate into both microglia and macroglia in the brains of adult mice. Proc. Natl. Acad. Sci. U.S.A 94: 4080-4085. Erdo,F., Buhrle,C., Blunk,J., Hoehn,M., Xi a,Y., Fleischmann,B., Focking,M., Kustermann,E., Kolossov,E., Hescheler,J., Hossmann,K.A. & Trapp,T. (2003). Hostdependent tumorigenesis of embryonic stem ce ll transplantation in experimental stroke. J. Cereb. Blood Flow Metab, 23: 780-785. Eriksson,P.S., Perfilieva,E., Bjork-Erikss on,T., Alborn,A.M., Nordborg,C., Peterson,D.A. & Gage,F.H. (1998). Neurogenesis in the adult human hippocampus. Nat. Med., 4: 13131317. Eriksson,U., Hansson,E., Nordlinder,H., Busch,C., Sundelin,J. & Peterson,P.A. (1987). Quantitation and tissue localization of the cellular retinoic acid-binding protein. J. Cell Physiol 133: 482-490. Evans,J., Sumners,C., Moore,J., Huentelman,M.J., Deng,J., Gelband,C.H. & Shaw,G. (2002). Characterization of mitotic neurons derived from adult rat hypothalamus and brain stem. J. Neurophysiol. 87: 1076-1085. Evans,M.J. & Kaufman,M.H. (1981). Establishment in culture of pluripotential cells from mouse embryos. Nature, 292: 154-156. Evarts,R.P., Nagy,P., Marsden,E. & Thorgeirsson,S.S. (1987a). A precursor-product relationship exists between oval cells and hepatocytes in rat liver. Carcinogenesis, 8: 1737-1740.

PAGE 127

115 Evarts,R.P., Nagy,P., Marsden,E. & Thorgeirsson,S.S. (1987b). In situ hybridization studies on expression of albumin and alpha -fetoprotein during the early stage of neoplastic transformation in rat liver. Cancer Res. 47: 5469-5475. Evarts,R.P., Nagy,P., Nakatsukasa,H., Marsden,E. & Thorgeirsson,S.S. (1989). In vivo differentiation of rat liver oval cells into hepatocytes. Cancer Res. 49: 1541-1547. Factor,V.M., Engel'gardt,N.V., Iazova,A.K., Lazareva,M.N., Poltoranina,V.S. & Rudinskaia,T.D. (1990). Common antigens of oval cells and cholangiocytes in the mouse. Their detection by using monoclonal antibodies. Ontogenez, 21: 625-632. Ferrari,G., Cusella-De Angelis,G., Coletta,M ., Paolucci,E., Stornaiuolo,A., Cossu,G. & Mavilio,F. (1998). Muscle regeneration by bone marrow-derived myogenic progenitors. Science 279: 1528-1530. Finley,M.F., Devata,S. & Huettner,J.E. (1999). BMP-4 inhibits neural differentiation of murine embryonic stem cells. J.Neurobiol. 40: 271-287. Ford-Perriss,M., Abud,H. & Murphy,M. (2001). Fibroblast growth factors in the developing central nervous system. Clin. Exp. Pharmacol. Physiol, 28: 493-503. Franco,P.G., Paganelli,A.R., Lopez,S.L. & Carrasco,A.E. (1999). Functional association of retinoic acid and hedgehog signaling in Xenopus primary neurogenesis. Development 126: 4257-4265. Freed,C.R., Breeze,R.E., Rosenberg,N.L. & Schneck,S.A. (1993). Embryonic dopamine cell implants as a treatment for the second phase of Parkinson's disease. Replacing failed nerve terminals. Adv. Neurol., 60:721-8.: 721-728. Freed,C.R., Breeze,R.E., Rosenberg,N.L., Schneck,S.A., Kriek,E., Qi,J.X., Lone,T., Zhang,Y.B., Snyder,J.A. & Wells,T.H. (1992). Survival of implanted fetal dopamine cells and neurologic improvement 12 to 46 months after transplantation for Parkinson's disease. N. Engl. J. Med., 327: 1549-1555. Freed,C.R., Greene,P.E., Breeze,R.E., Tsai,W.Y., DuMouchel,W., Kao,R., Dillon,S., Winfield,H., Culver,S., Trojanowski,J.Q., Eidelberg,D. & Fahn,S. (2001). Transplantation of embryonic dopamine neurons for severe Parkinson's disease. N. Engl. J. Med., 344: 710-719. Friedenstein,A.J. (1995). Marrow stromal fibroblasts. Calcif.Tissue Int. 56 Suppl 1: S17. Frielingsdorf,H., Schwarz,K., Brundin,P. & Mohapel,P. (2004). No evidence for new dopaminergic neurons in the adult mammalian substantia nigra. Proc. Natl. Acad. Sci. U.S.A 101: 10177-10182. Gage,F.H. (2002). Neurogenesis in the adult brain. J. Neurosci. 22: 612-613.

PAGE 128

116 Gage,F.H., Coates,P.W., Palmer,T.D., Kuhn,H.G., Fisher,L.J., Suhonen,J.O., Peterson,D.A., Suhr,S.T. & Ray,J. (1995). Survival and differentiation of adult neuronal progenitor cells transplanted to the adult brain. Proc. Natl. Acad. Sci. U.S.A 92: 1187911883. Goldfarb,M. (1996). Functions of fibroblast growth factors in vertebrate development. Cytokine Growth Factor Rev. 7: 311-325. Goshima,J., Goldberg,V.M. & Caplan,A.I. (1991a). Osteogenic potential of cultureexpanded rat marrow cells as assayed in vivo with porous calcium phosphate ceramic. Biomaterials 12: 253-258. Goshima,J., Goldberg,V.M. & Caplan,A.I. (1991b). The origin of bone formed in composite grafts of porous calcium phosphate ceramic loaded with marrow cells. Clin. Orthop., 269: 274-283. Gottlieb,D.I. & Huettner,J.E. (1999). An in vitro pathway from embryonic stem cells to neurons and glia. Cells Tissues.Organs 165: 165-172. Gould,E., Vail,N., Wagers,M. & Gross,C.G. (2001). Adult-generated hippocampal and neocortical neurons in macaques have a transient existence. Proc. Natl. Acad. Sci. U.S.A 98: 10910-10917. Gratsch,T.E. & O'Shea,K.S. (2002). Noggin and chordin have distinct activities in promoting lineage commitment of mouse embryonic stem (ES) cells. Dev. Biol. 245: 8394. Graves,K.H. & Moreadith,R.W. (1993). Derivation and characterization of putative pluripotential embryonic stem cells from preimplantation rabbit embryos. Mol. Reprod. Dev. 36: 424-433. Grisham,J.W. & Hartroft,W.S. (1961). Morphologic identification by electron microscopy of "oval" cells in experimental hepatic degeneration. Lab Invest 10:317-32.: 317-332. Gustafsson,E., Andsberg,G., Darsalia,V., Moha pel,P., Mandel,R.J., Kirik,D., Lindvall,O. & Kokaia,Z. (2003). Anterograde delivery of brain-derived neurotrophic factor to striatum via nigral transduction of recombinant adeno-associated virus increases neuronal death but promotes neurogenic response following stroke. Eur. J. Neurosci., 17: 26672678. Hagell,P., Piccini,P., Bjorklund,A., Brundi n,P., Rehncrona,S., Widner,H., Crabb,L., Pavese,N., Oertel,W.H., Quinn,N., Brooks,D.J. & Lindvall,O. (2002). Dyskinesias following neural transplantation in Parkinson's disease. Nat. Neurosci., 5: 627-628. Hayashi,S., Miyake,K. & Kincade,P.W. (2000). The CD9 molecule on stromal cells. Leuk Lymphoma., 38(3-4): 265-70.

PAGE 129

117 Haynesworth,S.E., Baber,M.A. & Caplan,A.I. (1992). Cell surface antigens on human marrow-derived mesenchymal cells are detected by monoclonal antibodies. Bone 13: 6980. Hemmati-Brivanlou,A. & Melton,D. (1997). Vertebrate embryonic cells will become nerve cells unless told otherwise. Cell 88: 13-17. Hennessy,B., Korbling,M. & Estrov,Z. (2004). Circulating stem cells and tissue repair. Panminerva Med, 46(1): 1-11. Hermann,A., Gerlach,M., Schwarz,J. & Storch,A (2004). Neurorestoration in Parkinson's disease by cell replacement and endogenous regeneration. Expert. Opin. Biol. Ther. 4: 131-143. Herzog,E.L., Chai,L. & Krause,D.S. (2003). Plasticity of marrow-derived stem cells. Blood 102(10) : 3483-93. Hinds,J.W. (1968). Autoradiographic study of histogenesis in the mouse olfactory bulb. II. Cell proliferation and migration. J. Comp Neurol., 134: 305-322. Holden,C. & Vogel,G. (2002). Stem cells. Plasticity: time for a reappraisal? Science 296: 2126-2129. Hovatta,O., Mikkola,M., Gertow,K., Stromberg,A .M., Inzunza,J., Hreinsson,J., Rozell,B., Blennow,E., Andang,M. & Ahrlund-Richter,L. (2003). A culture system using human foreskin fibroblasts as feeder cells allows production of human embryonic stem cells. Hum. Reprod., 18: 1404-1409. Hudson,J.E., Chen,N., Song,S., Walczak,P., Jendelova,P., Sykova,E., Willing,A.E., Saporta,S., Bickford,P., Sanchez-Ramos,J. & Zigova,T. (2004). Green fluorescent protein bone marrow cells express hematopoietic and neural antigens in culture and migrate within the neonatal rat brain. J. Neurosci. Res., 76: 255-264. Hughes,S. (2002). Cardiac stem cells. J. Pathol. 197: 468-478. Isacson,O., Bjorklund,L.M. & Schumacher,J.M. (2003). Toward full restoration of synaptic and terminal function of the dopaminergic system in Parkinson's disease by stem cells. Ann. Neurol., 53 Suppl 3:S135-46. Issarachai,S., Priestley,G.V., Nakamoto,B. & Papayannopoulou,T. (2002). Cells with hemopoietic potential residing in muscle are itinerant bone marrow-derived cells. Exp. Hematol. 30: 366-373. Jackson,K.A., Mi,T. & Goodell,M.A. (1999). Hematopoietic potential of stem cells isolated from murine skeletal muscle. Proc. Natl. Acad. Sci. U.S.A 96: 14482-14486. Javazon,E.H., Beggs,K.J. & Flake,A.W. (2004). Mesenchymal stem cells: paradoxes of passaging. Exp. Hematol. 32: 414-425.

PAGE 130

118 Javazon,E.H., Colter,D.C., Schwarz,E.J. & Prockop,D.J. (2001). Rat marrow stromal cells are more sensitive to plating density and expand more rapidly from single-cellderived colonies than human marrow stromal cells. Stem Cells 19(3):219-25. Jiang,Y., Henderson,D., Blackstad,M., Chen,A., Miller,R.F. & Verfaillie,C.M. (2003). Neuroectodermal differentiation from mouse multipotent adult progenitor cells. Proc. Natl. Acad. Sci. U.S.A 100 Suppl 1:11854-60. Jiang,Y., Jahagirdar,B.N., Reinhardt,R.L., Schwartz,R.E., Keene,C.D., OrtizGonzalez,X.R., Reyes,M., Lenvik,T., Lund,T., Blackstad,M., Du,J., Aldrich,S., Lisberg,A., Low,W.C., Largaespada,D.A. & Verfaillie,C.M. (2002). Pluripotency of mesenchymal stem cells derived from adult marrow. Nature, 418: 41-49. Jones,E.A., Kinsey,S.E., English,A., Jones,R.A., Straszynski,L., Meredith,D.M., Markham,A.F., Jack,A., Emery,P. & McGonagle,D. (2002). Isolation and characterization of bone marrow multipotential mesenchymal progenitor cells. Arthritis Rheum. 46: 3349-3360. Jones,P.H., Harper,S. & Watt,F.M. (1995). Stem cell patterning and fate in human epidermis. Cell 80: 83-93. Jori,F.P., Napolitano,M.A., Melone,M.A., Cipollaro,M., Cascino,A., Altucci,L., Peluso,G., Giordano,A., Galderisi,U., Lopez-Toledano,M.A., Redondo,C., Lobo,M.V., Reimers,D., Herranz,A.S., Paino,C.L., Bazan,E., Tzeng,S.F., Tsai,M.J., Hung,S.C. & Cheng,H. (2004). Molecular pathways involved in neural in vitro differentiation of marrow stromal stem cells. J. Cell Biochem., 94 (4): 645-655. Kadiyala,S., Young,R.G., Thiede,M.A. & Bruder,S.P. (1997). Culture expanded canine mesenchymal stem cells possess osteochondrogenic potential in vivo and in vitro. Cell Transplant. 6: 125-134. Kan,M., Huang,J.S., Mansson,P.E., Yasumitsu,H., Carr,B. & McKeehan,W.L. (1989). Heparin-binding growth factor type 1 (aci dic fibroblast growth factor): a potential biphasic autocrine and paracrine regulator of hepatocyte regeneration. Proc. Natl. Acad. Sci. U.S.A 86: 7432-7436. Kaplan,M.S. & Bell,D.H. (1984). Mitotic neuroblasts in the 9-day-old and 11-month-old rodent hippocampus. J. Neurosci. 4: 1429-1441. Kempermann,G., Wiskott,L. & Gage,F.H. (2004). Functional significance of adult neurogenesis. Curr. Opin. Neurobiol., 14: 186-191. Kirkland,R.A. & Franklin,J.L. (2003). Bax, reactive oxygen, and cytochrome c release in neuronal apoptosis. Antioxid. Redox. Signal. 5: 589-596. Knecht,A.K. & Harland,R.M. (1997). Mechanisms of dorsal-ventral patterning in noggininduced neural tissue. Development 124: 2477-2488.

PAGE 131

119 Kohyama,J., Abe,H., Shimazaki,T., Koizumi,A., Nakashima,K., Gojo,S., Taga,T., Okano,H., Hata,J. & Umezawa,A. (2001). Brain from bone: efficient "metadifferentiation" of marrow stroma-derived mature osteoblasts to neurons with Noggin or a demethylating agent. Differentiation 68: 235-244. Kondo,T. & Raff,M. (2000). Oligodendrocyte precursor cells reprogrammed to become multipotential CNS stem cells. Science 289: 1754-1757. Kopen,G.C., Prockop,D.J. & Phinney,D.G. (1999). Marrow stromal cells migrate throughout forebrain and cerebellum, and they differentiate into astrocytes after injection into neonatal mouse brains. Proc. Natl. Acad. Sci. U.S.A 96: 10711-10716. Korr,H. & Schmitz,C. (1999). Facts and fictions regarding post-natal neurogenesis in the developing human cerebral cortex. J. Theor. Bio. 200(3): 291-7. Krause,D.S., Theise,N.D., Collector,M .I., Henegariu,O., Hwang,S., Gardner,R., Neutzel,S., Sharkis,S.J., Guthrie,S.M., Curtis,L.M., Mames,R.N., Simon,G.G., Grant,M.B. & Scott,E.W. (2001). Multi-organ, multi-lineage engraftment by a single bone marrow-derived stem cell. Cell 105(3): 369-77. Kukekov,V.G., Laywell,E.D., Suslov,O., Davies,K., Scheffler,B., Thomas,L.B., O'Brien,T.F., Kusakabe,M. & Steindler,D.A. (1999). Multipotent stem/progenitor cells with similar properties arise from two neurogenic regions of adult human brain. Exp. Neurol. 156: 333-344. Kurozumi,K., Nakamura,K., Tamiya,T., Kawano,Y., Kobune,M., Hirai,S., Uchida,H., Sasaki,K., Ito,Y., Kato,K., Honmou,O., Houki n,K., Date,I. & Hamada,H. (2004). BDNF gene-modified mesenchymal stem cells promote functional recovery and reduce infarct size in the rat middle cerebral artery occlusion model. Mol.Ther., 9: 189-197. Kuznetsov,S.A., Friedenstein,A.J. & Robey,P.G. (1997). Factors required for bone marrow stromal fibroblast colony formation in vitro. Br. J. Haematol. 97: 561-570. Lagasse,E., Connors,H., Al-Dhalimy, M., Reitsma, M., Dohse, M., Osborne, L., Wang, X., Finegold, M., Weissman, I.L., Grompe, M. (2000). Purified hematopoietic stem cells can differentiate into hepatocytes in vivo. Nat Med. 6(11):1229-34. Lambeng,N., Michel,P.P., Brugg,B., Agid,Y. & Ruberg,M. (1999). Mechanisms of apoptosis in PC12 cells irreversibly differentiated with nerve growth factor and cyclic AMP. Brain Res. 821(1): 60-8. Larsson,E., Mandel,R.J., Klein,R.L., Muzyczka,N., Lindvall,O. & Kokaia,Z. (2002). Suppression of insult-induced neurogenesis in adult rat brain by brain-derived neurotrophic factor. Exp. Neurol., 177: 1-8. Laywell,E.D., Kukekov,V.G. & Steindler,D.A (1999). Multipotent neurospheres can be derived from forebrain subependymal zone and spinal cord of adult mice after protracted postmortem intervals. Exp. Neurol., 156: 430-433.

PAGE 132

120 Laywell,E.D., Rakic,P., Kukekov,V.G., Holland,E.C. & Steindler,D.A. (2000). Identification of a multipotent astrocytic stem cell in the immature and adult mouse brain. Proc. Natl. Acad. Sci. U.S.A 97: 13883-13888. Lee,K.D., Kuo,T.K., Whang-Peng,J., Chung,Y.F., Lin,C.T., Chou,S.H., Chen,J.R., Chen,Y.P. & Lee,O.K. (2004). In vitro hepatic differentiation of human mesenchymal stem cells. Hepatology 40: 1275-1284. Lendahl,U., Zimmerman,L.B. & McKay,R.D. (1990). CNS stem cells express a new class of intermediate filament protein. Cell 60: 585-595. Li,M., Zhang,D., Hou,Y., Jiao,L., Zheng,X. & Wang,W.H. (2003). Isolation and culture of embryonic stem cells from porcine blastocysts. Mol. Reprod. Dev. 65: 429-434. Li,Y., Chen,J., Wang,L., Zhang,L., Lu,M. & Chopp,M. (2001). Intracerebral transplantation of bone marrow stromal cells in a 1-methyl-4-phenyl-1,2,3,6tetrahydropyridine mouse model of Parkinson's disease. Neurosci. Lett. 316: 67-70. Lie,D.C., Dziewczapolski,G., Willhoite,A.R ., Kaspar,B.K., Shults,C.W. & Gage,F.H. (2002). The adult substantia nigra contains progenitor cells with neurogenic potential. J. Neurosci. 22: 6639-6649. Lin,R.C. & Matesic,D.F. (1994). Immunohistoc hemical demonstration of neuron-specific enolase and microtubule-associated protein 2 in reactive astrocytes after injury in the adult forebrain. Neuroscience 60: 11-16. Lindroos,P.M., Zarnegar,R. & Michalopoulos,G .K. (1991). Hepatocyte growth factor (hepatopoietin A) rapidly increases in plasma before DNA synthesis and liver regeneration stimulated by partial hepatectomy and carbon tetrachloride administration. Hepatology 13: 743-750. Lindvall,O., Kokaia,Z. & Martinez-Serrano,A. (2004). Stem cell therapy for human neurodegenerative disorders-how to make it work. Nat. Med., 10 Suppl: S42-S50. Lipton,S.A., Wagner,J.A., Madison,R.D. & D' Amore,P.A. (1988). Acidic fibroblast growth factor enhances regeneration of processes by postnatal mammalian retinal ganglion cells in culture. Proc. Natl. Acad. Sci. U.S.A 85: 2388-2392. Llado,J., Haenggeli,C., Maragakis,N.J., Snyder,E.Y. & Rothstein,J.D. (2004). Neural stem cells protect against glutamate-induced excitotoxicity and promote survival of injured motor neurons through the secretion of neurotrophic factors. Mol. Cell Neurosci. 27: 322-331. Lodin,Z., Faltin,J. & Korinkova,P. (1979). The effect of dibutyryl cyclic AMP on cultivated glial cells from corpus callosum of 30-day-old rats. Physiol Bohemoslov. 28: 105-111.

PAGE 133

121 Lois,C. & Alvarez-Buylla,A. (1994). Long-distance neuronal migration in the adult mammalian brain. Science 264: 1145-1148. Lopez-Toledano,M.A., Redondo,C., Lobo,M.V., Reimers,D., Herranz,A.S., Paino,C.L., Bazan,E., Tzeng,S.F., Tsai,M.J., Hung,S.C. & Cheng,H. (2004). Tyrosine hydroxylase induction by basic fibroblast growth factor a nd cyclic AMP analogs in striatal neural stem cells: role of ERK1/ERK2 mitogen-activated protein kinase and protein kinase C. J. Histochem. Cytochem., 52(9): 1177-89. Lu,P., Blesch,A. & Tuszynski,M.H. (2004). Induction of bone marrow stromal cells to neurons: differentiation, transdifferentiation, or artifact? J. Neurosci. Res., 77: 174-191. Lu,P., Jones,L.L. & Tuszynski,M.H. (2005). BDNF-expressing marrow stromal cells support extensive axonal growth at sites of spinal cord injury. Exp. Neurol., 191: 344360. Luskin,M.B. (1993). Restricted proliferation and migration of postnatally generated neurons derived from the forebrain subventricular zone. Neuron, 11: 173-189. Ma,Y., Feigin,A., Dhawan,V., Fukuda,M., Shi,Q., Greene,P., Breeze,R., Fahn,S., Freed,C. & Eidelberg,D. (2002). Dyskinesia after fetal cell transplantation for parkinsonism: a PET study. Ann. Neurol., 52: 628-634. Majumdar,M.K., Thiede,M.A., Mosca,J.D., Moorman,M. & Gerson,S.L. (1998). Phenotypic and functional comparison of cultures of marrow-derived mesenchymal stem cells (MSCs) and stromal cells. J. Cell Physiol, 176: 57-66. Mansour,S.L., Goddard,J.M. & Capecchi,M.R. (1993). Mice homozygous for a targeted disruption of the proto-oncogene int-2 have developmental defects in the tail and inner ear. Development 117: 13-28. Markakis,E.A. & Gage,F.H. (1999). Adult-generated neurons in the dentate gyrus send axonal projections to field CA3 and are surrounded by synaptic vesicles. J. Comp Neurol. 406: 449-460. Martin,G.R. (1981). Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc. Natl. Acad. Sci. U.S.A 78: 7634-7638. McGraw,T.S., Mickle,J.P., Shaw,G. & Streit,W.J. (2002). Axonally transported peripheral signals regulate alpha-internexin expression in regenerating motoneurons. J. Neurosci. 22: 4955-4963. McKay,I.J., Lewis,J. & Lumsden,A. (1996). The role of FGF-3 in early inner ear development: an analysis in normal and kreisler mutant mice. Dev. Biol. 174: 370-378.

PAGE 134

122 McKinney-Freeman,S.L., Jackson,K.A., Camargo,F.D., Ferrari,G., Mavilio,F. & Goodell,M.A. (2002). Muscle-derived hematopoietic stem cells are hematopoietic in origin. Proc. Natl. Acad. Sci. U.S.A 99: 1341-1346. Melton DA & Cowan C. (2004). in: Handbook of Stem Cells (Vol1). Lanza R., Blau,H.M., Melton,D., Moore M, Thomas E.D, Verfaillie,C.M., Weissman,I.L. & West M, ed., Elsevier Academic Press, San Diego. Xxv-xxxi. Mohiuddin, L., Fernyhough, P. & Tomlinson, DR. (1996). Acidic fibroblast growth factor enhances neurite outgrowth and stim ulates expression of GAP-43 and T alpha 1 alpha-tubulin in cultured neurones fr om adult rat dorsal root ganglia. Neurosci. Lett. 215: 111-114. Mourlevat S, Troadec JD, Ruberg M, Michel PP. (2003). Prevention of dopaminergic neuronal death by cyclic AMP in mixed neuronal/glial mesencephalic cultures requires the repression of presumptive astrocytes. Mol Pharmacol 64(3): 578-86. Munoz-Elias,G., Marcus,A.J., Coyne,T.M., Woodbury,D. & Black,I.B. (2004). Adult bone marrow stromal cells in the embryonic brain: engraftment, migration, differentiation, and long-term survival. J. Neurosci. 24: 4585-4595. Neuhuber,B., Gallo,G., Howard,L., Kostura,L., Mackay,A. & Fischer,I. (2004). Reevaluation of in vitro differentiation protocols for bone marrow stromal cells: disruption of actin cytoskeleton induces rapid morphological changes and mimics neuronal phenotype. J. Neurosci. Res., 77: 192-204. Olanow,C.W., Goetz,C.G., Kordower,J.H., Stoessl,A.J., Sossi,V., Brin,M.F., Shannon,K.M., Nauert,G.M., Perl,D.P., G odbold,J. & Freeman,T.B. (2003). A doubleblind controlled trial of bilateral fetal nigral transplantation in Parkinson's disease. Ann. Neurol. 54: 403-414. Omori,M., Omori,N., Evarts,R.P., Teramoto,T. & Thorgeirsson,S.S. (1997a). Coexpression of flt-3 ligand/flt-3 and SCF/c-kit signal transduction system in bile-ductligated SI and W mice. Am. J. Pathol., 150: 1179-1187. Omori,N., Omori,M., Evarts,R.P., Teramoto,T., Miller,M.J., Hoang,T.N. & Thorgeirsson,S.S. (1997b). Partial cloning of rat CD34 cDNA and expression during stem cell-dependent liver regeneration in the adult rat. Hepatology 26: 720-727. Ong,D.E., Newcomer,M.E., Lareyre,J.J. & Orgebin-Crist,M.C. (2000). Epididymal retinoic acid-binding protein. Biochim. Biophys. Acta 1482: 209-217. Orive,G., Hernandez,R.M., Gascon,A.R., Igartua,M. & Pedraz,J.L. (2003). Controversies over stem cell research. Trends Biotechnol. 21: 109-112. Orlic,D., Kajstura,J., Chimenti,S., Bodine,D.M., Leri,A. & Anversa,P. (2003). Bone marrow stem cells regenerate infarcted myocardium. Pediatr. Transplant., 7 Suppl 3: 8688.

PAGE 135

123 Ornitz,D.M. (2000). FGFs, heparan sulfate and FGFRs: complex interactions essential for development. Bioessays 22: 108-112. Owen,M. & Friedenstein,A.J. (1988). Stromal stem cells: marrow-derived osteogenic precursors. Ciba Found. Symp., 136: 42-60. Pack,R., Heck,R., Dienes,H.P., Oesch,F. & Steinberg,P. (1993). Isolation, biochemical characterization, long-term culture, and phenotype modulation of oval cells from carcinogen-fed rats. Exp. Cell Res. 204: 198-209. Palmer,T.D., Takahashi,J. & Gage,F.H. (1997). The adult rat hippocampus contains primordial neural stem cells. Mol. Cell Neurosci. 8: 389-404. Papaioannou,V. (2001). Stem cells and Differentiation. Differentiation 68: 153-154. Paramore,C.G., Turner,D.A. & Madison,R.D. (1992). Fluorescent labeling of dissociated fetal cells for tissue culture. J. Neurosci. Methods 44: 7-17. Pavletic,Z.S., Bishop,M.R., Markopoulou,K. & Wszolek,Z.K. (1996). Drug-induced parkinsonism after allogeneic bone marrow transplantation. Bone Marrow Transplant. 17: 1185-1187. Peister,A., Mellad,J.A., Larson,B.L., Hall,B.M., Gibson,L.F. & Prockop,D.J. (2004). Adult stem cells from bone marrow (MSCs) isolated from different strains of inbred mice vary in surface epitopes, rates of proliferation, and differentiation potential. Blood 103: 1662-1668. Pereira,R., Halford,K., Sokolov,B.P., Khilla n,J.S. & Prockop,D.J. (1994). Phenotypic variability and incomplete penetrance of spontaneous fractures in an inbred strain of transgenic mice expressing a mutated collagen gene (COL1A1). J. Clin. Invest 93: 17651769. Peretto,P., Merighi,A., Fasolo,A. & Bonfanti,L. (1999). The subependymal layer in rodents: a site of structural plasticity and cell migration in the adult mammalian brain. Brain Res.Bull. 49: 221-243. Petersen,B.E. (2001). Hepatic "stem" cells: coming full circle. Blood Cells Mol. Dis. 27: 590-600. Petersen,B.E., Bowen,W.C., Patrene,K.D., Mars,W.M., Sullivan,A.K., Murase,N., Boggs,S.S., Greenberger,J.S. & Goff,J.P. (1999). Bone marrow as a potential source of hepatic oval cells. Science 284: 1168-1170. Petersen,B.E., Goff,J.P., Greenberger,J.S. & Michalopoulos,G.K. (1998a). Hepatic oval cells express the hematopoietic stem cell marker Thy-1 in the rat. Hepatology 27: 433445.

PAGE 136

124 Petersen,B.E., Grossbard,B., Hatch,H., Pi,L., Deng,J. & Scott,E.W. (2003). Mouse A6positive hepatic oval cells also express several hematopoietic stem cell markers. Hepatology 37: 632-640. Petersen,B.E., Zajac,V.F. & Michalopoulos,G.K. (1998b). Hepatic oval cell activation in response to injury following chemically induced periportal or pericentral damage in rats. Hepatology 27: 1030-1038. Petrakova,K.V., Tolmacheva,A.A. & Friedenstein,A.J. (1963). Bone formation occurring in bone marrow transplantation in diffusion chambers. Biull. Eksp. Biol. Med., 56:87-91.: 87-91. Pevny,L.H., Sockanathan,S., Placzek,M. & Lovell-Badge,R. (1998). A role for SOX1 in neural determination. Development 125: 1967-1978. Piccini P, Lindvall O, Bjorklund A, Brundin P, Hagell P, Ceravolo R, Oertel W, Quinn N, Samuel M, Rehncrona S, Widner H, Brooks DJ. (2000). Delayed recovery of movement-related cortical function in Parkinson's disease after striatal dopaminergic grafts. Ann Neurol., 48(5): 689-95. Pittenger,M.F., Mackay,A.M., Beck,S.C., Jaiswal,R.K., Douglas,R., Mosca,J.D., Moorman,M.A., Simonetti,D.W., Craig,S. & Marshak,D.R. (1999). Multilineage potential of adult human mesenchymal stem cells. Science 284:143-7. Pleasure,S.J., Page,C. & Lee,V.M. (1992). Pure, postmitotic, polarized human neurons derived from NTera 2 cells provide a system for expressing exogenous proteins in terminally differentiated neurons. J. Neurosci. 12: 1802-1815. Ponticiello,M.S., Schinagl,R.M., Kadiyala,S. & Barry,F.P. (2000). Gelatin-based resorbable sponge as a carrier matrix for human mesenchymal stem cells in cartilage regeneration therapy. J. Biomed. Mater. Res., 52: 246-255. Porter,S.B., Ong,D.E., Chytil,F. & Orgebin-Crist,M.C. (1985). Localization of cellular retinol-binding protein and cellular retinoic acid-binding protein in the rat testis and epididymis. J. Androl 6: 197-212. Posch,K.C., Burns,R.D. & Napoli,J.L. (1992). Bi osynthesis of all-trans-retinoic acid from retinal. Recognition of retinal bound to cellular retinol binding protein (type I) as substrate by a purified cytosolic dehydrogenase. J. Biol. Chem., 267: 19676-19682. Preisegger,K.H., Factor,V.M., Fuchsbichler,A., Stumptner,C., Denk,H. & Thorgeirsson,S.S. (1999). Atypical ductula r proliferation and its inhibition by transforming growth factor beta1 in th e 3,5-diethoxycarbonyl-1,4-dihydrocollidine mouse model for chronic alcoholic liver disease. Lab Invest 79: 103-109. Quesenberry,P.J., Abedi,M., Aliotta,J., Colvin,G., Demers,D., Dooner,M., Greer,D., Hebert,H., Menon,M.K., Pimentel,J. & Paggioli,D. (2004). Stem cell plasticity: an overview. Blood Cells Mol Dis. 32(1):1-4.

PAGE 137

125 Rakic,P. (2002). Neurogenesis in adult primate neocortex: an evaluation of the evidence. Nat. Rev. Neurosci., 3(1): 65-71. Rechnagel,R.O. & Glende,E.A., Jr. (1973). Carbon tetrachloride hepatotoxicity: an example of lethal cleavage. CRC Crit Rev.Toxicol. 2: 263-297. Reubinoff,B.E., Pera,M.F., Vajta,G. & Trouns on,A.O. (2001). Effective cryopreservation of human embryonic stem cells by the open pulled straw vitrification method. Hum. Reprod., 16: 2187-2194. Reyes,M., Dudek,A., Jahagirdar,B., Koodie,L., Marker,P.H. & Verfaillie,C.M. (2002). Origin of endothelial progenitors in human postnatal bone marrow. J.Clin.Invest 109: 337-346. Reynolds,B.A., Tetzlaff,W. & Weiss,S. (1992) A multipotent EGF-responsive striatal embryonic progenitor cell produces neurons and astrocytes. J.Neurosci. 12: 4565-4574. Reynolds,B.A. & Weiss,S. (1992). Generation of neurons and astrocytes from isolated cells of the adult mammalian central nervous system. Science 255: 1707-1710. Richards,M., Fong,C.Y., Chan,W.K., Wong,P.C. & Bongso,A. (2002). Human feeders support prolonged undifferentiated growth of human inner cell masses and embryonic stem cells. Nat. Biotechnol. 20: 933-936. Rio-Hortega del,P. Microglia. in: Cytology and Cellular Pathology of the Nervous System. W.Penfield, ed., Paul B.Hoeber, New York 2, 481-534. 1932. Safford,K.M., Hicok,K.C., Safford,S.D., Hal vorsen,Y.D., Wilkison,W.O., Gimble,J.M. & Rice,H.E. (2002). Neurogenic differentiation of murine and human adipose-derived stromal cells. Biochem. Biophys. Res. Commun. 294: 371-379. Sanchez-Ramos,J., Song,S., Cardozo-Pelaez,F., Hazzi,C., Stedeford,T., Willing,A., Freeman,T.B., Saporta,S., Janssen,W., Patel,N., Cooper,D.R. & Sanberg,P.R. (2000). Adult bone marrow stromal cells differentiate into neural cells in vitro. Exp. Neurol., 164: 247-256. Scardigli,R., Schuurmans,C., Gradwohl,G. & Guillemot,F. (2001). Crossregulation between Neurogenin2 and pathways specifying neuronal identity in the spinal cord. Neuron, 31: 203-217. Scheffler,B., Schmandt,T., Schroder,W., Steinf arz,B., Husseini,L., Wellmer,J., Seifert,G., Karram,K., Beck,H., Blumcke,I., Wiestler,O.D., Steinhauser,C. & Brustle,O. (2003). Functional network integration of embryonic stem cell-derived astrocytes in hippocampal slice cultures. Development 130: 5533-5541.

PAGE 138

126 Schlessinger,A.R., Cowan,W.M. & Gottlieb,D.I (1975). An autoradiographic study of the time of origin and the pattern of granule cell migration in the dentate gyrus of the rat. J. Comp Neurol., 159: 149-175. Schwarz,E.J., Alexander,G.M., Prockop,D.J. & Azizi,S.A. (1999). Multipotential marrow stromal cells transduced to produce L-DOPA: engraftment in a rat model of Parkinson disease. Hum. Gene Ther., 10: 2539-2549. Seglen,P.O. (1979). Hepatocyte suspensions and cultures as tools in experimental carcinogenesis. J. Toxicol. Environ. Health 5: 551-560. Sells,M.A., Katyal,S.L., Shinozuka,H., Estes,L.W., Sell,S. & Lombardi,B. (1981). Isolation of oval cells and transitional cells from the livers of rats fed the carcinogen DLethionine. J. Natl. Cancer Inst., 66: 355-362. Seri,B., Garcia-Verdugo,J.M., McEwen,B.S. & Alvarez-Buylla,A. (2001). Astrocytes give rise to new neurons in the adult mammalian hippocampus. J. Neurosci. 21: 71537160. Shankle,W.R., Landing,B.H., Rafii,M.S., Schiano,A., Chen,J.M. & Hara,J. (1998). Evidence for a postnatal doubling of neuron number in the developing human cerebral cortex between 15 months and 6 years. J. Theor. Bio. 191(2): 115-40. Shi,Q., Rafii,S., Wu,M.H., Wijelath,E.S ., Yu,C., Ishida,A., Fujita,Y., Kothari,S., Mohle,R., Sauvage,L.R., Moore,M.A., Storb,R.F. & Hammond,W.P. (1998). Evidence for circulating bone marrow-derived endothelial cells. Blood 92: 362-367. Shihabuddin,L.S., Horner,P.J., Ray,J. & Gage,F.H. (2000). Adult spinal cord stem cells generate neurons after transplantation in the adult dentate gyrus. J. Neurosci. 20: 87278735. Shinozuka,H., Lombardi,B., Sell,S. & Iamma rino,R.M. (1978). Early histological and functional alterations of ethionine liver carcinogenesis in rats fed a choline-deficient diet. Cancer Res. 38: 1092-1098. Short,B., Brouard,N., Occhiodoro-Scott,T., Ramakrishnan,A. & Simmons,P.J. (2003). Mesenchymal stem cells. Arch. Med. Res., 34: 565-571. Shu,S.N., Wei,L., Wang,J.H., Zhan,Y.T., Chen,H.S. & Wang,Y. (2004). Hepatic differentiation capability of rat bone marrow-derived mesenchymal stem cells and hematopoietic stem cells. World J. Gastroenterol. 10: 2818-2822. Shum,A.S., Poon,L.L., Tang,W.W., Koide,T., Chan,B.W., Leung,Y.C., Shiroishi,T. & Copp,A.J. (1999). Retinoic acid induces down -regulation of Wnt-3a, apoptosis and diversion of tail bud cells to a neural fate in the mouse embryo. Mech. Dev. 84: 17-30. Sirica,A.E. (1995). Ductular hepatocytes. Histol. Histopathol. 10: 433-456.

PAGE 139

127 Sirica,A.E. & Cihla,H.P. (1984). Isolation and partial characterizations of oval and hyperplastic bile ductular cell-enriched populations from the livers of carcinogen and noncarcinogen-treated rats. Cancer Res. 44: 3454-3466. Sirica,A.E., Mathis,G.A., Sano,N. & Elmore,L.W. (1990). Isolation, culture, and transplantation of intrahepatic biliary epithelial cells and oval cells. Pathobiology, 58: 4464. Spangrude,G.J., Heimfeld,S. & Weissman,I.L (1988). Purification and characterization of mouse hematopoietic stem cells. Science 241: 58-62. Spemann,H. & Mangold,H. (2001). Induction of embryonic primordia by implantation of organizers from a different species. 1923. Int. J. Dev. Biol., 45: 13-38. Stanfield,B.B. & Trice,J.E. (1988). Evidence that granule cells generated in the dentate gyrus of adult rats extend axonal projections. Exp. Brain Res. 72: 399-406. Steindler,D.A., Kadrie,T., Fillmore,H. & Thomas,L.B. (1996). The subependymal zone: "brain marrow." Prog. Brain Res. 108: 349-363. Storey,K.G., Goriely,A., Sargent,C.M., Brown,J.M., Burns,H.D., Abud,H.M. & Heath,J.K. (1998). Early posterior neural tissue is induced by FGF in the chick embryo. Development 125: 473-484. Streit,A., Lee,K.J., Woo,I., Roberts,C., Jessell,T.M. & Stern,C.D. (1998). Chordin regulates primitive streak development and the stability of induced neural cells, but is not sufficient for neural induction in the chick embryo. Development 125: 507-519. Streit,A. & Stern,C.D. (1999). Neural induction. A bird's eye view. Trends Genet. 15: 20-24. Sugaya,K. (2003). Potential use of stem cells in neuroreplacement therapies for neurodegenerative diseases. Int. Rev. Cytol. 228: 1-30. Sun,S., Guo,Z., Xiao,X., Liu,B., Liu,X., Tang,P.H & Mao,N. (2003). Isolation of mouse marrow mesenchymal progenitors by a novel and reliable method. Stem Cells 21: 527535. Suzawa,M., Takada,I., Yanagisawa,J., Ohtake ,F., Ogawa,S., Yamauchi,T., Kadowaki,T., Takeuchi,Y., Shibuya,H., Gotoh,Y., Matsumot o,K. & Kato,S. (2003). Cytokines suppress adipogenesis and PPAR-gamma function through the TAK1/TAB1/NIK cascade. Nat. Cell Biol. 5: 224-230. Tang,D.Q., Cao,L.Z., Burkhardt,B.R., Xia,C.Q., Litherland,S.A., Atkinson,M.A. & Yang,L.J. (2004). In vivo and in vitro character ization of insulin-producing cells obtained from murine bone marrow. Diabetes 53: 1721-1732.

PAGE 140

128 Tanio,Y., Yamazaki,H., Kunisada,T., Miyake,K. & Hayashi,S.I. (1999). CD9 molecule expressed on stromal cells is involved in osteoclastogenesis. Exp.Hematol., 27(5):853-9. Terada,N., Hamazaki,T., Oka,M., Hoki,M., Mastalerz,D.M., Nakano,Y., Meyer,E.M., Morel,L., Petersen,B.E. & Scott,E.W. (2002). Bone marrow cells adopt the phenotype of other cells by spontaneous cell fusion. Nature, 416: 542-545. Theise,N.D., Nimmakayalu,M., Gardner,R., Illei,P.B., Morgan,G., Teperman,L., Henegariu,O. & Krause,D.S. (2000). Liver from bone marrow in humans. Hepatology 32: 11-16. Theise,N.D., Saxena,R., Portmann,B.C., Thung,S.N., Yee,H., Chiriboga,L., Kumar,A. & Crawford,J.M. (1999). The canals of Hering and hepatic stem cells in humans. Hepatology 30: 1425-1433. Thomas,K.R. & Capecchi,M.R. (1987). Site-directed mutagenesis by gene targeting in mouse embryo-derived stem cells. Cell 51: 503-512. Thomas,L.B., Gates,M.A. & Steindler,D.A. (1996). Young neurons from the adult subependymal zone proliferate and migrate along an astrocyte, extracellular matrix-rich pathway. Glia 17: 1-14. Thomson,J.A., Itskovitz-Eldor,J., Shapiro,S.S., Waknitz,M.A., Swiergiel,J.J., Marshall,V.S. & Jones,J.M. (1998). Embryonic stem cell lines derived from human blastocysts. Science 282(5395):1827. Thomson,J.A., Kalishman,J., Golos,T.G., Durning,M., Harris,C.P. & Hearn,J.P. (1996). Pluripotent cell lines derived from common marmoset (Callithrix jacchus) blastocysts. Biol.Reprod. 55: 254-259. Till,J.E. & McCulloch,E.A. (1961). A direct measurement of the radiation sensitivity of normal mouse bone marrow cells. Radiat Res, 14:213-22 Toma,C., Pittenger,M.F., Cahill,K.S., Byrne,B.J. & Kessler,P.D. (2002). Human mesenchymal stem cells differentiate to a cardiomyocyte phenotype in the adult murine heart. Circulation 105: 93-98. Tondreau,T., Lagneaux,L., Dejeneffe,M., Massy,M., Mortier,C., Delforge,A., Bron,D., Bron,D., De Bruyn,C., Lagneaux,L., Tondreau,T. & Delforge,A. (2004). Bone marrowderived mesenchymal stem cells already expr ess specific neural proteins before any differentiation. Differentiation 72(7): 319-26. Torrente,Y., Belicchi,M., Pisati,F., Pagano,S .F., Fortunato,F., Sironi,M., D'Angelo,M.G., Parati,E.A., Scarlato,G. & Bresolin,N. (2002). Alternative sources of neurons and glia from somatic stem cells. Cell Transplant. 11: 25-34.

PAGE 141

129 Tropepe,V., Hitoshi,S., Sirard,C., Mak,T.W., Rossant,J. & van der,K.D. (2001). Direct neural fate specification from embryonic stem cells: a primitive mammalian neural stem cell stage acquired through a default mechanism. Neuron, 30: 65-78. Tzeng,S.F., Tsai,M.J., Hung,S.C. & Cheng,H. (2004). Neuronal morphological change of size-sieved stem cells induced by neurotrophic stimuli. Neurosci.Lett. 367(1):23-8. Van Praag,H., Schinder,A.F., Christie,B.R., Toni,N., Palmer,T.D. & Gage,F.H. (2002). Functional neurogenesis in the adult hippocampus. Nature, 415: 1030-1034. Vassilopoulos,G., Wang,P.R. & Russell,D.W. (2003). Transplanted bone marrow regenerates liver by cell fusion. Nature, 422(6934): 901-4. Waddington,C.H. (1950). Processes of induction in the early development of the chick. Annee.Biol. 54: 711-717. Wagers,A.J., Sherwood,R.I., Christensen,J.L. & Weissman,I.L. (2002). Little evidence for developmental plasticity of adult hematopoietic stem cells. Science 297: 2256-2259. Walther,C. & Gruss,P. (1991). Pax-6, a murine paired box gene, is expressed in the developing CNS. Development 113: 1435-1449. Wang,X., Willenbring,H., Akkari,Y., Torimaru,Y., Foster,M., Al Dhalimy,M., Lagasse,E., Finegold,M., Olson,S. & Grompe,M. (2003). Cell fusion is the principal source of bone-marrow-derived hepatocytes. Nature, 422(6934): 897-901. Wehner,T., Bontert,M., Eyupoglu,I., Prass,K., Prinz,M., Klett,F.F., Heinze,M., Bechmann,I., Nitsch,R., Kirchhoff,F., Kettenmann,H., Dirnagl,U. & Priller,J. (2003). Bone marrow-derived cells expressing green fluorescent protein under the control of the glial fibrillary acidic protein promoter do not differentiate into astrocytes in vitro and in vivo. J.Neurosci. 23: 5004-5011. Weimann,J.M., Charlton,C.A., Brazelton,T.R., Hackman,R.C. & Blau,H.M. (2003a). Contribution of transplanted bone marrow cells to Purkinje neurons in human adult brains. Proc. Natl. Acad. Sci. U.S.A 100(4): 2088-93. Weimann,J.M., Johansson,C.B., Trejo,A. & Blau,H.M. (2003b). Stable reprogrammed heterokaryons form spontaneously in Purkinje neurons after bone marrow transplant. Nat.Cell Biol. 5(11): 959-66. Wetts,R. & Fraser,S.E. (1988). Multipotent precurs ors can give rise to all major cell types of the frog retina. Science 239: 1142-1145. Wiese,S., Beck,M., Karch,C. & Sendtner,M. (2004). Signalling mechanisms for survival of lesioned motoneurons. Acta Neurochir. Suppl 89: 21-35. Wilmut,I., Schnieke,A.E., McWhir,J., Kind,A.J. & Campbell,K.H. (1997). Viable offspring derived from fetal and adult mammalian cells. Nature, 385(6619):810-3.

PAGE 142

130 Wilson,P.A. & Hemmati-Brivanlou,A. (1995). Induction of epidermis and inhibition of neural fate by Bmp-4. Nature, 376: 331-333. Wilson,S.I., Graziano,E., Harland,R., Jessell,T.M. & Edlund,T. (2000). An early requirement for FGF signalling in the acquisition of neural cell fate in the chick embryo. Curr.Biol. 10: 421-429. Woodbury,D., Schwarz,E.J., Prockop,D.J. & Black,I.B. (2000). Adult rat and human bone marrow stromal cells differentiate into neurons. J.Neurosci.Res. 61: 364-370. Yang,L., Li,S., Hatch,H., Ahrens,K., Cornelius,J.G., Petersen,B.E. & Peck,A.B. (2002). In vitro trans-differentiation of adult hepatic stem cells into pancreatic endocrine hormone-producing cells. Proc. Natl. Acad. Sci. U.S.A 99: 8078-8083. Yaswen,P., Hayner,N.T. & Fausto,N. (1984). Isolation of oval cells by centrifugal elutriation and comparison with other cell types purified from normal and preneoplastic livers. Cancer Res. 44: 324-331. Yeo,W. & Gautier,J. (2004). Early neural cell death: dying to become neurons. Dev.Biol. 274: 233-244. Ying,Q.L., Nichols,J., Evans,E.P. & Smith,A.G. (2002). Changing potency by spontaneous fusion. Nature, 416: 545-548. Yoshizaki,T., Inaji,M., Kouike,H., Shimazaki,T., Sawamoto,K., Ando,K., Date,I., Kobayashi,K., Suhara,T., Uchiyama,Y. & Oka no,H. (2004). Isolation and transplantation of dopaminergic neurons generated from mouse embryonic stem cells. Neurosci.Lett. 363: 33-37. Zhang,S., Wang,D., Estrov,Z., Raj,S., Willerson,J.T. & Yeh,E.T. (2004). Both cell fusion and transdifferentiation account for the transformation of human peripheral blood CD34positive cells into cardiomyocytes in vivo. Circulation 110(25): 3803-7. Zhao,L.R., Duan,W.M., Reyes,M., Keene,C.D., Verfaillie,C.M. & Low,W.C. (2002). Human bone marrow stem cells exhibit neural phenotypes and ameliorate neurological deficits after grafting into the ischemic brain of rats. Exp.Neurol. 174: 11-20. Zheng,T., Steindler,D.A. & Laywell,E.D. (2002). Transplantation of an indigenous neural stem cell population leading to hyperplasia and atypical integration. Cloning Stem Cells 4: 3-8.

PAGE 143

BIOGRAPHICAL SKETCH Jie Deng was born in Sichuan Province, the People's Republic of China, on March 13, 1967 (lunar calendar). From 1979 to 1984, he attended high school at the Fushuan No. 2 Middle School in Sichuan. In 1985 Jie began his college education at the SiChuan University in Chengdu, SiChuan. He was awarded a Bachelor of Science degree in zoology in 1989. From 1990 to 1993, Jie worked at National Bird Banding Center of China, serving as biologist. From 1994 to 1995, Jie worked at CITES Management Authority in China, serving as wildlife officer. In 1996, Jie was accepted by the graduate program of Wildlife Ecology and Conservation Department at the University of Florida to work on the masters degree, and graduated in May 1998. He then joined the Interdisciplinary Program (IDP) of the University of Florida, College of Medicine, to work on his Ph.D. degree in 1999. 131


Permanent Link: http://ufdc.ufl.edu/UFE0009700/00001

Material Information

Title: Neurogenesis of Adult Stem Cells from the Liver and Bone Marrow
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0009700:00001

Permanent Link: http://ufdc.ufl.edu/UFE0009700/00001

Material Information

Title: Neurogenesis of Adult Stem Cells from the Liver and Bone Marrow
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0009700:00001


This item has the following downloads:


Full Text













NEUROGENESIS OF ADULT STEM CELLS FROM
THE LIVER AND BONE MARROW
















By

JIE DENG


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2005
































This work is dedicated to my daughter, Catherine L. Deng,
from whom my life is being regenerated.















ACKNOWLEDGMENTS

I would like to express my gratitude to my mentor, Bryon Petersen, for almost four

years of unfaltering guidance he has, finally, beat the word "control" into my brain. I

feel very lucky to have spent my time in his laboratory to study stem cells, and have the

opportunity to work with a group of intelligent and fun fellow lab-mates. Additionally, I

need to thank all the wonderful people with whom I was lucky to interact in Steindler's

lab, especially Eric Laywell who was my mentor by the bench.

I would also like to thank the invaluable members of my dissertation committee,

Edwin Meyer, Edward Scott, Naohiro Terada and especially Dennis Steindler who has

provided not only the outstanding mentorship to my graduate education, but also funding

for all the projects included in this dissertation. My thanks also go to Gerry Shaw and

Ronald Mandel, who have opened me the doors to the neuroscience and

neurodegenerative disorder research.

Next I would like to thank my parents, Jialie Deng and Yeufang Yuan, who gave

me not only a healthy body, but also a firm heart to sustain my unceasing curiosity. Also,

I need to recognize my wife of ten years, Zhengqing Luo, for all the support and

inspiration she provided to me during these years together.

Last, but certainly not least, I need to thank my fellow students and friends during

the course of my graduate study at the University of Florida. They were, and will

continue to be my true treasure for life.















TABLE OF CONTENTS

Page

A C K N O W L E D G M E N T S ................................................................................................. iii

LIST OF TABLES .................................................... ............ .............. viii

LIST OF FIGURES ......... ............................... ........ ............ ix

ABSTRACT .............. .......................................... xi

CHAPTER

1 INTRODUCTION ................. ................................ .. ............ 1

1.1 Definition of Stem Cell ...................................................... ..2
1.1.1 Three Criteria of Stem Cell Definition .........................................2
1.1.2 Em bryonic Stem Cell .................................................................... 5
1.1.3 A dult Stem C ell......................................... ...... .. .......... .. .5
1.1.4 Changing V iew on Stem Cell ........................................ ...............6
1.2 Brief History of Stem Cell Research .................................... .......7
1.2.1 Early Research on Embryonic Stem Cell......................................7
1.2.2 Early Research on Adult Stem Cell ...........................................8
1.2.3 Recent Development of Adult Stem Cell Biology...........................9
1.2.4 A Time for Reappraisal ............................... ...............10
1.3 Bone Marrow Derived Msenchymal Stem Cells................... .......11
1.3.1 B one M arrow N iche....................................... ...... ..................... 11
1.3.2 Isolation and Characteristics of Mesenchymal Stem Cells............12
1.3.3 Mesengenesis of Mesenchymal Stem Cells...............................13
1.3.4 Trans-differentiation of Mesenchymal Stem Cells........................14
1.3.5 Multipotent Adult Progenitor Cells and Marrow-Isolated
Adult Multilineage Inducible Cells...................................... 15
1.4 H epatic O v al C ell ....................... .......... .. ........................ ... ....... ..... 16
1.4.1 Hepatic Oval Cell As The Adult Stem Cell In The Liver.............. 17
1.4.2 Induction and Isolation of Hepatic Oval Cells..............................18
1.4.3 The Multipotency of Hepatic Oval Cells.................. ............20
1.5 Developmental Neurogenesis ... ........................................20









1.5.1 Signaling Pathways during the Developmental Neurogenesis ......21
1.5.1.1 Bone Morhgenetic Protein and Noggin/Cordin
sy ste m ........................................................ 2 2
1.5.1.2 Retinoic Acid signaling........................... ..................23
1.5.1.3 Fibroblast Growth Factor in neurogenesis.......................24
1.5.2 Neurogenesis in the Adult Animal Brain...................................25
1.5.2.1 Hippocam pal neurogenesis..............................................25
1.5.2.2 Subependymal zone/olfactory bulb neurogenesis..............26
1.6 N eural Induction In vitro ............................................................27
1.6.1 Neural Induction in Embryonic Carcinoma and Embryonic
Stem C ell L ines............... .... ................ ...... ........ ....... ........ 27
1.6.2 Neural Induction from Mesenchymal Stem Cell Lines .................28
1.6.2.1 Neurotrophic Growth Factor induction............................29
1.6.2.2 Chemical induction .............. ...... .. ............. ...31
1.6.2.3 Controversies in neural trans-differentiation from
mesenchymal stem cells....................... ...............32
1.7 Potential Application of Stem Cell Therapy in Parkinson's Disease ......33
1.7.1 A New Hope for Parkinson's Disease Patients.............................34
1.7.2 Current Challenges of Embryonic Tissue and Cell Therapy in
Parkinson's Disease Treatment..................... .......................35
1.7.3 Building an Adult Stem Cell Therapy for Parkinson's Disease ....36

2 THE NEURAL PROPERTY OF BONE MARROW DERIVED CELLS
FR O M A D U L T M O U SE ............................................................ .....................38

2.1 Backgrounds and Introduction............................................. 38
2.2 M materials and M ethods......................................... .......................... 41
2.2.1 B M D C C ulture......................................... .......................... 41
2.2.2 FACs Analysis of BMDC's ........................................42
2.2.3 Immunolabeling and Cell Counting............... ...............43
2.2.4 Neural Induction by Elevating Cytoplasmic camp ......................43
2.2.5 In situ Hybridization for GFAP mRNA .........................................44
2.2.6 W western B lotting ....................................................... ................. 44
2.2.7 Transplantation of BMDCs into Neonatal Mouse Brain .............. 45
2.2.8 Y-chromosome Painting for Cell Fusion Detection.....................45
2.3 R results .................................. ... ................... ..... ..... ...............46
2.3.1 BMDC Cultures Can Be Derived from the Bone Marrow
of A dult M ice ................................... ... ..... .......... ... .. .......... ..46
2.3.2 BMDC Cultures Normally Express Neural Markers...................47
2.3.3 Astrocyte, but not Neuronal Proteins, Are Upregulated
by cAMP Elevation..................................................47
2.3.4 Single-Cell BMDC Clones Show Plasticity by Generating
Both Neuronal and Astrocytic Lineages................................ 48
2.3.5 BMDCs Exhibit Neural Differentiation upon Grafting into
the N eonatal M house Brain .................................. ............... 48









2.3.6 Chromosome Analysis Reveals no Evidence of BMDC
F u sion ........................................... ............ ....... 49
2.4 Conclusion and D discussion ............................................ ............... 49

3 NEURAL TRANSDIFFERENTIATION OF MOUSE HEPATIC OVAL
C E L L IN V IV O .............. ............................................................... 6 3

3.1 Background and Introduction ....................................... ............... 63
3.2 Materials and Methods................... .. .... ...................65
3.2.1 Hepatic Oval Cell Induction and Enrichment from Mouse
L iv e r ................... ....... ............................................ .......... .. 6 5
3.2.2 FACs Analysis for Purity on MACs Sorted Sca-1 Oval Cells.....65
3.2.3 Immunocytochemistry of MACs Sorted Oval Cells....................65
3.2.4 Culture of M house Oval Cells ........................................................66
3.2.5 Cell Transplantation into Neonatal Mouse Brain ........................66
3.2.6 In vivo Phagocytosis A ssay................................. ............... 66
3.2.7 Immunolabeling of Brain Sections .........................................67
3.2.8 Quantification of Grafted Cells.................... ............ ............... 67
3 .3 R esu lts ............................ ... .. ... ............ .. ................. . .............. 6 8
3.3.1 Hepatic Oval Cell Enrichment with Sca-1 Antibody....................68
3.3.2 Hepatic Oval Cells Survive and Differentiate in the Neonatal
M house B rain ......................... ................ ........ .. ............ 68
3.3.3 Grafted Hepatic Oval Cells Express Neural Antigens.................69
3.3.4 Donor-Derived Cells Have Functional Properties of
M icroglia.............. .... ....................... ............... 70
3.4 Conclusion and D discussion ................. ....... ...... ......... ............. ............... 70

4 NEURAL INDUCTION OF HEPATIC OVAL CELLS IN VITRO .................82

4 .1 Introdu action ................................................................................. 82
4.2 M materials and M ethods......................................... .......................... 83
4.2.1 Culture of Rat Oval Cell .... ........... ..................................... 83
4.2.2 Neurospheres Generation and Culture ...........................................84
4.2.3 Organotypic Brain Slice Culture............................ .....................84
4.2.4 Im m unocytochem istry ........................................ .....................85
4.2.5 Neuronal Induction Using IBMX and dbcAMP ............................86
4.2.6 Neural Induction Using BME, DMSO and BHA ........................86
4.2.7 Neural Induction Using Retinoic Acid RA under 4+/4-
Protocol ......... ................... ........... .. ..... ... ... ...............87
4.2.8 Neural induction of HOC by Over-Expressing Chordin
an d N o g g in ........................................................... .. 8 7
4.2.9 Neural Induction of HOC by Co-Culturing with
Differentiating Neurospheres..................................... 87
4.2.10 Neural Induction of HOC by Micro-injecting into
N eu ro sp h eres ....................................................... ................ .. 8 8









4.2.11 Neural Induction of HOC by Incorporating into the
E m bryoid B ody ............... ... .... ........... .......... .... ....................88
4.2.12 Neural Induction of HOC by Transplanting into and
Explanting out of Neonatal M house Brain ......................................88
4.2.13 Neural Induction Using 5-azacytidine ..........................................89
4 .3 R results ............................... ......................... ....... .. .. .. .. .... .......... 89
4.3.1 IBMX /dbcAMP Treatment to the HOC Causes Neural-like
M orphological Change............................... ..................... ... 89
4.3.2 BME/BHA Does not Induce Neural-like Change in HOC ............89
4.3.3 Use of Retinoic Acid under 4+/4- Protocol Treatment
Does not Induce Neural Differentiation in HOC.........................90
4.3.4 Over-Expressing Chordin and Noggin Does not Induce
N eural D ifferentiation in H O C ....................................................90
4.3.5 Co-Culturing with Differentiating Neurospheres Does not
Induce Neural Differentiation in HOC .........................................90
4.3.6 Internalization of HOC with Neuropheres Contribute Little
to H O C N eural D ifferentiation ...................................................91
4.3.7 Internalization of HOCs into the Embryoid Body Does not
Lead to Neural Differentiation of HOCs .................................. 92
4.3.8 Brain Tissue Transplantated with GFP+ HOC Generate
G FP+ N eurospheres ................. ..... ............... .................... 92
4.3.9 HOC Lives Poorly on Organotypic Brian Slice Culture...............93

4.4 Conclusion and Discussion ............................................... .................. 93

5 SUMMARY AND CONCLUSION ...............................................107


L ITER A TU R E C ITE D ....................................................... ................. ............... 111

BIOGRAPH ICAL SK ETCH ................................................. ............................. 131















LIST OF TABLES

Table Page

3-1 Survival rate of transplanted HOCs in the neonatal mouse brain .....................79

3-2 Composition of the neural markers in the transplanted HOCs
in the neonatal m house brain ............................................................................80

3-3 The percentage of cells taking up Microbeads among the
total G F P + C ell ..................................................................... 8 1















LIST OF FIGURES
Figure Page

2-1 BM DC culture and characterization ........................................... ............... 56

2-2 BMDCs express neuron specific proteins spontaneously under
normal culture condition. ............ ......... ...... ...5.........57

2-3 Cytoplasmic cAMP elevation promote GFAP expression in BMDCs ..................58

2-4 Single cell cloned BMDCs exhibit mutlipotency by generating
progenies of different property through symmetric and asymmetric
division..................................... .......................... ..... ..... ........ 59

2-5 BMDCs differentiate into neurons and astrocytes upon transplantation
into the lateral ventricle of the neonatal mouse brain................ .............. ....60

2-6 Confocal scanning microscopic imagines demonstrate the immuno-
labeling of BM DCs with neuronal specific proteins............................................61

2-7 Confocal scanning microscopic imagine evaluation of cell fusion
between male animal derived BMDCs and endogenous cells of male
recipient m house in the brain ................................................................................62

3-1 Characteristics of mouse hepatic oval cells enriched using MACs
m magnetic beads .................................... ............................... ........75

3-2 Hepatic oval cells survive and differentiate in the neonatal mouse
b ra in ............................................................................ 7 6

3-3 Differentiated GFP+ hepatic oval cells express neural-specific
proteins in the neonatal m house brain ........................................ .....................77

3-4 Oval cells acquire microglia phenotype and phagocytosis activity
in the m house brain .................. ...................................... .. ............ 78

4-1 Neural induction of HOCs using Isobutyl-methylxanthine and
dibutyryl cyclic AM P (IBM X /dcAM P ...................................... ............... 98

4-2 Neural induction of HOCs using Beta-Mercaptoethanol and Butylated
H ydroxyanisole (BM E/BH A ) ........................................ .......................... 99










4-3 Neural induction of HOC using Retinoic Acid (RA) under 4+/4-
p ro to c o l ........................................................................ 1 0 0

4-4 Neural induction of HOC by over-expressing chordin and noggin .....................101

4-5 Neural induction of HOC by co-culturing with differentiating
n eu ro sp h eres .................................................................... 10 2

4-6 Neural induction of HOC by incorporating into the core of neurospheres.......... 103

4-7 Neural induction of HOC by incorporating into embyoid bodies (EBs) .............104

4-8 Neural induction of HOCs by transplanting into and explanting out of
the neonatal m house brain ............................................. ............................ 105

4-9 H OCs culture on organotypic brain slices ..........................................................106















Abstract of Dissertation Presented to the Graduate School of the University of Florida in
Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy


NEUROGENESIS OF ADULT STEM CELLS FROM
THE LIVER AND BONE MARROW

By

Jie Deng

May 2005

Chairman: Bryon E. Petersen
Major Department: Pathology, Immunology and Laboratory Medicine

Recent reports of the adult stem cell multipotencies have generated tremendous

interest regarding their potential therapeutic value, while bypassing ethical concerns

surrounding the use of human embryonic stem cells. Among the different adult stem

cells, the bone marrow-derived mesenchymal stem cells (MSCs) may represent the best

hope for cell replacement therapy since, in addition to their multipotency and

accessibility, MSCs may also be used in autologous transplantations to minimize immune

rejection. The isolation of a large number of hepatic oval cells (HOCs) holds tremendous

promise as a source for liver transplantation in treating both acute and chronic liver

failure. With the recent reports of the trans-differentiation of oval cells into the insulin-

producing pancreatic cells, as well as neural-like cells in vivo, using HOCs in treating

diseased tissues other than liver may also be possible.

The use of stem cell therapy in treating neurodegenerative disorders has attracted

considerable attention lately. In Parkinson's disease (PD), the engraftment of fetal









mesencephalic neurons, which are rich in postmitotic dopaminergic neurons, has

significantly improved the patient symptoms. But limited by ethical issues as well as

short of supplies in utilizing embryonic tissue, the alternative to use adult stem cells has

moved to the forefront of the research. The trans-differentiation of MSCs into neural cell

types has been explored extensively, with several groups reporting that these stem cells

can trans-differentiate into neurons, astrocytes and microglias. However, controversies of

the adult stem cell multipotency arose after reports of failures to repeat several significant

previous experiments, as well as confounding factors of possible cell contamination or

fusion.

In an attempt to clarify these issues, I studied two types of adult stem cells, the

mesenchymal bone marrow derived cells (BMDCs) and the hepatic oval cells. There is a

significant difference between these two types of adult stem cell in their capability to

differentiate into neural phenotypes. While the BMDCs spontaneously generate

neurogenic and astrogenic progenitors, HOCs showed little sign of neural trans-

differentiation capability in vitro. However, both BMDCs and HOCs differentiated and

expressed neural specific proteins after they were grafted into the neurogenic

subependymal zone of the neonatal mouse brains.














CHAPTER 1
INTRODUCTION

Highlighted by several historical breakthroughs, stem cell biology saw its rebirth

at the end of the last century. In 1997, the world was surprised by Wilmat et al. (1997),

who demonstrated that the nucleus of a somatic cell showed full genetic potential by

giving birth to Dolly sheep after injecting it into a denucleated oocyte. A year later,

Thomson et al. (1998) developed an isolation and culture method to maintain human

embryonic stem cells in vitro. In the field of adult stem cell research, Ferrari et al. (1998)

first reported the trans-differentiation of bone marrow stem cells into muscle tissue

in1998. The same year Shi et al. (1998) followed by reporting the endothelial tissue from

bone marrow. A year later, Petersen et al. (1999) reported the bone marrow derived

hepatocytes following hepatic injury, and in 2000, Brazelton et al. (2000) reported neural

regeneration from bone marrow source. These reports of the adult stem cell multipotency

changed the view of the old paradigm in cell biology and opened new possibilities for

treating human diseases. With the findings of adult stem cell plasticity, it becomes

possible to replace the injured, or senile tissues by either stimulating the proliferation of

endogenous adult stem cells, or grafting allogenic progenitors derived from an exogenous

source. However, questions about the genuineness and potential application of the adult

stem cell trans-differentiation phenomenon quickly arose, and calls for re-evaluation

began to appear (Holden & Vogel, 2002). The low number of trans-differentiation seen in

vivo, as well as cell fusion and failure to repeat some experiments, puzzles scientists.









From the initial wide-range of reported plasticity to the later reexamination of

those findings with more stringent criteria, in the span of only five years, the study of

stem cell biology experienced the usual ups-and-downs of a new scientific field. In spite

of the unclear future of the adult stem cell biology, the closer and broader re-evaluations

of various issues are generally agreed on and pursued by scientists.

1.1 The Definition of Stem Cell

Defining stem cell is one of the most difficult tasks in the field of cell biology,

because it is a cell type defined by its functional attributes to generate different cell

types in making of organisms rather than the physical property. It immediately implies

an inevitable paradox of maintaining cell stability in the process of functionality

evaluation. Although still under debate, a working definition of stem cell is a clonal, self-

renewing entity that is functionally multipotent and thus can generate multiple

differentiated cell types (Melton & Cowan, 2004). Based on the development stages,

there are embryonic stem (ES) cells and adult stem (AS) cells. ES cells exist in the

embryogenesis stage that can eventually give rise to a whole animal. The term "adult

stem cell" is used to refer to stem cells found in the tissue of an adult animal. Different

names are normally given to AS cells following the tissue types in which they reside,

such as hematopoietic stem cell (HSC), liver 'stem' cell, or neural stem cell (NSC), etc.

1.1.1 Three Criteria of Stem Cell Definition

The self-renewal of a stem cell is the ability to maintain its own numbers without

input from another cell stage. It is rather hard to evaluate this property under in vitro

conditions since tissue culture itself may alter the maintenance of the cell being cultured.

A vague criterion to use, in this case, is the extensive proliferation capability in base









culture medium without apparent morphological change (Melton & Cowan, 2004).

However, some somatic cells would appear to fit into this standard even in vivo, but the

number of the passages (in vitro), or divisions (in vivo) is normally limited in somatic

cells. Young cells that may be derived from stem cells have to replenish the senile cells to

maintain a stable population in the tissue in vivo. For the stem cells, the in vitro passage

number should be higher than eighty, an upper limit of most somatic cells (Melton &

Cowan, 2004), to "unlimited." In vivo, stem cells should be able to last throughout the

lifetime of the tissue in which they reside.

Although clonality is regarded as the "gold standard" (Melton & Cowan, 2004) to

evaluate a stem cell, it is practically difficult to use in defining AS cells. ES cells are

clonogenic: the ability to create all the cell types of an animal that is demonstrated

repeatedly by chimeric animals. With a careful experimental design, a single

hematopoietic stem cell has also showed its clonogenicity by generating all the progenies

of the hematopoietic lineage as well as many other cell types (Krause et al., 2001). Other

AS cell types that reside in solid organs are much more difficult to be tested for their

clonality, simply because it is impossible to repeat the developmental process of these

solid organs in the adult animals. Some researchers argue that, although defined as stem

cells by functional studies, mesenchymal stem cells from bone marrow will always be a

heterogeneous population, because a portion of the cells differentiate spontaneously

during normal culture (Quesenberry et al., 2004). Under these circumstances, they argue

that the clonality is an idol standard and is logically impossible to achieve for these types

of stem cells.









Stem cell multipotency describes the functional aspect of this unique cell type that

is distinct from that of a somatic cell. It refers to the multi-lineage differentiation

capability of stem cells. It should be noticed that, in addition to the morphologic and

immuno-phenotypic characteristics, the functional evaluation of a cell should be included

to claim a successful differentiation. Different terms are normally used in corresponding

to the potentiality hierarchies that exist in different types of stem cells. A fertilized egg is

call 'totipotent' because it can generate full functional organism, as well as the placenta

and other supporting tissues. Embryonic stem cells are called "pluripotent," illustrated by

their capability to generate every tissue of an animal after being grafted into the ovary of

a viable female foster animal. The term "multipotent" is used to describe the progenitors

of different germ layers that have lost the ability to generate a whole embryo after ovary

implantation. Finally, a group of terms such as "bipotent, unipotent, or monopotent" is

used to describe stem cells with more restricted potencies. Included in this group are most

of the AS cells that are generally tissue specific, and only give rise to one or two mature

cell types of the tissue they reside. For example, hepatic oval cells are usually called

'bipotential' for the reasons that they only differentiate into hepatocytes and

cholangiocytes in the adult liver. However, under the recent development of adult stem

cell biology, the term trans-differentiation is adopted to describe the multipotency of AS

cells demonstrated in vivo and in vitro. Trans-differentiation refers to the phenomenon

that the progenitors of one cell lineage can differentiate into cell types of other lineages

either being treated with specific, sometimes non-physiological level of induction

reagents in vitro, or being grafted into tissue that is different from their origin in vivo. In

this context, the hepatic oval cells may also be called multipotent, because they have been









shown to differentiate into pancreatic and neural lineages (Yang et al., 2002; Deng et al.,

2003).

1.1.2 Embryonic Stem Cell

Embryonic stem cells are derived directly from the inner cell mass of

preimplantation embryos after the formation of a cystic blastocyst. The inner cell mass

would normally produce the epiblast and eventually all adult tissues, which may help to

explain the developmental plasticity exhibited by ES cells. In fact, ES cells appear to be

the in vitro equivalent of the epiblast, as they have the capacity to contribute to all

somatic lineages, and in mice, to produce germ line chimeras (Papaioannou, 2001). In

animal species, in vivo differentiation can be assessed rigorously by the ability of ES cells

to contribute to all somatic lineages and produce germ line chimerism. In the purpose of

obtaining suitable cell lines for the regenerative medicine, extensive efforts have been

dedicated to generate different cell types in vitro from ES cells. However, the major

obstacles are to isolate and purify the differentiated cells, and to eliminate the

uncommitted ES cells after differentiation. As the result of their pluripotency, the

uncommitted ES cells tend to give rise to teratomas when grafted in vivo.

1.1.3 Adult Stem Cell

The term adult stem cell refers to the cells found in adult animal that constantly

replenish the somatic cells in the tissue of their origin. Although the existence of these

AS cells is beyond doubt in most cases, the isolation and identification of these cells

proved to be difficult. A rigorous assessment of the adult stem cells is to prospectively

purify a population of cells using cell surface markers, transplant a single cell from the

purified population into a syngeneic host without any intervening in vitro culture, and









observe self-renewal and tissue, or organ regeneration for multipotency. However, as

discussed above, this type of in vivo reconstitution assay is not well defined, and

impossible to do for the cells in solid organs. Therefore, it is important to assess the in

vitro differentiation capability of the AS cells, which may reflect their developmental

potential. In recent studies, the concept of multipotency of AS cells has moved to the

forefront of stem cell research. It is suggested that the restrictions in cell fate are not

permanent, but flexible (trans-differentiation) or reversible (de-differentiation) (Ferrari et

al., 1998; Shi et al., 1998; Petersen et al., 1999; Brazelton et al., 2000). This concept has

generated new ideas in the adult stem cell research, and infused new avenues into the

promising stem cell therapy.

1.1.4 A Changing View on Stem Cell

Along with the findings of stem cells in various tissues in the adult animal, two

models start to emerge that may be used to explain the origin and nature of the AS cells.

The traditional model believes that there is a stem cell pool residing in the tissue of each

organ of the adult animal that may have been preserved from the tissue specific

progenitor cells during the development. The hematopoietic stem cell is an example that

may be best explained by this model. Hepatologists also believe that the hepatic oval

cells, the 'stem' cells of the liver that have been known for over fifty years, originate

locally within the canal of herring in the liver (Alison et al., 1996). However, recent

findings of bone marrow derived hepatocytes suggest that oval cells may have derived

from a bone marrow derived precursors (Petersen et al., 1999; Lagasse et al., 2000).

These reports, along with many others that have demonstrated the bone marrow derived

allogeneic tissues in solid organs, suggest a second model of the AS cell origin. This









model proposed that there might be a master adult stem cell source in the bone marrow of

the adult animal. These master cells can circulate and differentiate into lineage-specific

progenitors, and eventually reconstitute the damaged tissue of the solid organ (Hennessy

et al., 2004).

1.2 Brief History of Stem Cell Research

1.2.1 Early Research of Embryonic Stem Cell

The systematic analysis of ES cells began in thel960s, when Finch and Ephrussii

(1967) established the first pluripotent embryonic carcinoma (EC) cell line from the

undifferentiated compartment of murine and human germ cell tumors (Andrews, 2002).

Based on experience with the culture of EC cells, the first murine ES cells were isolated

from the inner cell mass of the blastocyst in 1981 (Evans & Kaufman, 1981; Martin,

1981). Bradley et al. (1984) later developed a technique to reconstitute early mouse

embryos by injecting ES cells into blastocyst, which has formed the basis for the

hundreds of "knock out" and "knock in" transgenic animals (Thomas and Capecchi,

1987). Embryonic stem cells have also allowed in vitro studies of the initial stages of the

mammalian development, without the need to harvest peri-implantation embryos, and

dissection of the basic mechanisms underlying plauripotency and cell lineage

specification. In the following years, significant efforts have been made to isolate ES

cells from other species including rabbits (Graves and Moreadith, 1993), pigs (Li et al.,

2003) and primates (Thomson et al., 1996), and highlighted by the isolation of human ES

cell in 1998 (Thomson et al., 1998; Amit et al., 2000; Reubinoff et al., 2001; Richards et

al., 2002; Hovatta et al., 2003). The establishment of various ES cell lines from different

species has largely expanded our means to understand the mechanistical aspects of the









stem cell self-renewal and differentiation in the culture dish. But the generation of human

ES cell lines has sparked a great deal of controversy particularly in certain religious

communities (Orive et al., 2003).

1.2.2 Early Development of Adult Stem Cell

The history of AS cell research goes back to early studies of each individual stem

cell type resides in different organs of the adult animal. These cells possess strong

regenerative capability to replenish the senile or sick cells of the tissue in which they

reside under physiological condition or injury, and the study of these stem cells appeared

to be unrelated from each other. Hematopoietic stem cell (HSC) in bone marrow is one of

the first-known and most-studied adult stem cells. It is also the most successful example

of "stem cell therapy," a term that has been give new meaning and hope in the past

couple of years. The ground breaking work by Till and McCulloch (1961) in the early

1960s provided the first clear evidence that mouse bone marrow contained stem cells

capable of repopulating hematopoietic tissues following cellular depletion by exposure to

a cytotoxic agent, e.g., radiation. They demonstrated that grafted exogenous tissue can

invade the hematopoietic organ spleen, and form colony-forming units (CFU). This

experiment provided the scientific basis for subsequent human bone marrow transplant

studies and dramatically expanded our knowledge of HSCs. Liver stem cell is another

type of adult stem cell that has been well studied, but yet poorly understood. Grisham and

Hartroft (1961) first described oval cells in the recovering liver in 1961. The rat oval cell

model developed by Evarts et al. in 1987 (Evarts et al., 1987a) and the murine oval cell

model by Preisegger et al. in 1999 (Preisegger et al., 1999) have dramatically enhanced

our knowledge of HOCs. However, since oval cells cannot be found in large quantity









under normal physiological condition, or most forms of liver injuries including partial

hepatectomy, the precursors of oval cell become the focal point of the controversy

surrounding the liver stem cells. Neural stem cell (NSC) in the adult brain is one of the

latest stem cells to be identified. For years, the central nervous system in adult animals

was regarded as mitotically dormant. In the early 1990s, Reynolds and Weiss (1992) first

reported the neurogenesis in the subventricular zone of adult mouse brain. Subsequently,

several reports showed that NSCs exist in the dentate gyms of the hippocampus (Gage et

al., 1995; Palmer et al., 1997), as well as in the spinal cord (Shihabuddin et al., 2000).

Reynolds et al. (1992) also developed the widely used neurosphere culture system, which

allows clonal NSCs to grow into sphere-like colonies. The use of neurospheres has given

scientists a quantitative tool to study the function aspect of NSCs, and has, in some way,

placed the research of NSCs ahead of many other AS cells. Utilizing neurosphere culture,

Kondo and Raff (2000) and Laywell et al. (2000) reported that astrocytic stem cells

might be the NSCs in the adult brain, and further revealed the identity of neural stem

cells.

1.2.3 Recent Development of Adult Stem Cell Biology

The recent development of multipotency exhibited by a variety of AS cells,

especially the multipotency of bone marrow derived stem cells, has dramatically changed

the course of stem cell research in the past five years. Several studies have made a

significant contribution during this period. Utilizing the well established bone marrow

reconstitution of irradiated recipient in combination of genetic tracing markers, Ferrari et

al. (1998) first reported the transdifferentiation of bone marrow stem cells into muscle

in1998. Later the same year, Shi et al. (1998) reported the endothelial generation from









bone marrow following the similar design. Petersen et al. (1999) reported the bone

marrow derived liver regeneration after injury in 1999, and Brazelton et al. (2000)

reported neural regeneration from bone marrow source in 2000. Plasticity has also been

found in cells isolated from other tissues including skeletal muscle (Jackson et al., 1999)

and brain (Bjornson et al., 1999). The underlined impact of these paradigm-shifting work

has changed our view on the long-believed forward development biology, the way the

animal body function, as well as how we may be able to treat diseases in the future.

1.2.4 A Time for Reappraisal

Despite the wide range of reports of AS cell plasticity from different tissue and

species, the initial enthusiasm of the possible clinical application quickly gave way to

rigorous critical evaluation of the trans-differentiation phenomenon. The genuineness of

the newly found neurogenesis in the human neocortex (Shankle et al., 1998) was the first

to be challenged by Korr and Schmitz in 1999, and followed by Rakic et al. in 2002.

Several groups then showed that the hematopoietic cells that were proposed to have been

derived from trans-differentiation of muscle cells were in fact bonafide hematopoietic

cells resident within muscle tissue (McKinney-Freeman et al., 2002; Issarachai et al.,

2002). Terada et al. (2002) and Ying et al. (2002) independently demonstrated that when

bone marrow cells are cultured with ES cells, they fuse with each other, and the hybrid

cells take on an ES cell phenotype. These studies may suggest that the adult stem cells

thought to be trans-differentiating might have fused with host cells within various local

tissue microenvironments. This was further confirmed when it was demonstrated that it

might also be an event in vivo in the liver (Vassilopoulos et al., 2003; Wang et al., 2003),

brain (Weimann et al., 2003a; Weimann et al., 2003b), and heart (Alvarez-Dolado et al.,









2003). Recently, Zhang et al. ( 2004) demonstrated that trans-differentiation and cell

fusion might co-exist in the process of cardiomyocyte regeneration from CD34+ bone

marrow derived stem cells. Under the current circumstances, it is obvious that more

serious evaluation of the trans-differentiation phenomenon with more stringent criteria is

needed for the future of stem cell-based regenerative medicine.

1.3 Bone Marrow Derived Mesenchymal Stem Cells

Bone marrow derived mesenchymal stem cell (MSC) was first described by

Petrakova et al. (1963) some 40 years ago. It was demonstrated that pieces of bone

marrow transplanted under the renal capsule of mice formed an osseous tissue over a

period of several weeks that was invaded by hematopoietic cells (Petrakova et al., 1963).

Mesenchymal stem cells can be extensively expanded in vitro and readily differentiate

into mesenchymal lineage including osteocytes, chondrocytes and stromal cells with little

to no specific inductions. In the recent development of regenerative medicine, MSCs

have been the favorite cell source for transplantation because of their potent

differentiation capability, and also because of the accessibility and possible autologous

transplantation to eliminate immuno-rejection (Awad et al., 1999; Dezawa et al., 2004).

Despite the great potential to differentiate into many useful cell types, the identity of

MSCs, or even whether MSC are true stem cells or not, remains questionable (Javazon et

al., 2004). Limited by our current knowledge of the MSC surface marker, there has not

been a globally agreed context for characterizing MSCs.

1.3.1 The Bone Marrow Niche

Bone marrow stroma is a complex tissue with the function of supporting

hematopoiesis. It hosts a number of cell types and maintains the undifferentiated HSC









and supports differentiation of erythroid, myeloid, and lymphoid lineages. There are

adherent macrophages and other mononuclear cells of hematopoietic lineage, including

some phagocytic cells and other antigen-presenting dendriticc) cells. There are

mesenchymal cells, such as osteoblasts and adipoblasts. There are endothelial cells,

which may arise from a hemangioblast or other endothelial cell precursor. Bone marrow

stroma promotes cellular differentiation to these specific lineages while also maintaining

stem and progenitor cells. Bone marrow also actively maintains the undifferentiated state

of HSCs and MSCs.

1.3.2 Isolation and Characteristics of Mesencymal Stem Cells

Mesenchymal stem cells can be isolated from a bone marrow aspirate, and readily

cultured via methodology similar to that originally used by Friedenstein, and optimized

by Caplan et al. in 1991, utilizing their adhesive properties (Goshima et al., 1991b;

Friedenstein, 1995). Mesenchymal stem cells are spindle-shaped and fibroblast-like in

their undifferentiated state of in vitro culture. In the rodent experimental animals, bone

marrow aspirates are normally taken from the tibias and femurs. In human marrow

donors, they are often harvested from the superior iliac crest of the pelvis. Frequently, the

marrow sample is subjected to fractionation via density gradient centrifugation and

cultured in a medium such as Dulbecco's modified Eagle's medium (DMEM), containing

10-20% fetal bovine serum. Primary cultures are usually maintained for 12-16 days, and

are then detached by trypsinization followed by sub-culturing.

An important property, but not a defining feature, of the MSC population in vitro

is their ability to form colonies after low-density plating or single-cell sorting (Brockbank

et al., 1985; Kuznetsov et al., 1997; Colter et al., 2000; Javazon et al., 2001). As









demonstrated by Owen and Friedenstein (1988) and DiGirolamo et al. (1999), colonies

derived from CFU-F assays are extremely heterogeneous in both appearance

(morphology and size) and differentiation potential. One of the difficulties in defining

MSCs is that there are no immunophenotypic markers that are uniquely expressed by

MSCs (Haynesworth et al., 1992; DiGirolamo et al., 1999). In order to identify a culture

derived from whole bone marrow cell suspension as MSCs, an array of

immunophenotypic profile has to be used. MSCs express neither a hematopoietic marker

such as CD45, CD34, CD14, nor a endothelial marker such as CD31. They do express a

large number of adhesion molecules such as CD44, SH-4, and some stromal cell markers

such as SH-2, SH-3 and SH-4, with significant variations reported by different

laboratories (Haynesworth et al., 1992; Majumdar et al., 1998; Deans & Moseley, 2000;

Peister et al., 2004). As discussed previously, perhaps the most useful approach for

presumptive identification of the MSC remains functional. The capacity for induced in

vitro differentiation of MSCs to bone, fat, and cartilage is perhaps the single critical

requirement to identify putative MSC populations (Pereira et al., 1994; Pittenger et al.,

1999). It is important to emphasize that currently all MSC populations analyzed by clonal

assays are heterogeneous, with individual cells capable of varying differentiation

potential and expansion capacity (Owen & Friedenstein, 1988; DiGirolamo et al., 1999).

1.3.3 Mesengenesis of Mesenchymal Stem Cells

The differentiation of MSCs into bone, cartilage, and fat in vitro has been well-

described (Barry, 2003). Osteogenic activation requires the presence of P-glycerol-

phosphate, ascorbic acid-2-phosphate, dexamethasone, and fetal bovine serum (Barry,

2003). When cultured in monolayer in the presence of these supplements, the cells









acquire an osteoblastic morphology with up-regulation of alkaline phosphatase activity

and deposition of a hydroxyapatite mineralized extracellular matrix (Barry, 2003).

Chondrogenic differentiation occurs when MSCs are cultured under certain conditions,

including 1) a three-dimensional culture format, 2) a serum-free nutrient medium, and 3)

the addition of a member of the transforming growth factor-P superfamily. MSCs

cultured in monolayer in the presence of isobutylmethylxanthine become adipocytes with

the production of large lipid-filled vacuoles (Suzawa et al., 2003).

The in vivo differentiation capability of MSCs is demonstrated by their

contribution to the repairing process of the injured tissue after transplantation.

Mesenchymal stem cells implanted in an osseous defect, such as a large segmental gap in

the femur, stimulate formation of new bone (Bruder et al., 1998). Similarly, Ponticiello et

al. (2000) showed that scaffolds loaded with MSCs and implanted in an osteochondral

lesion on the medial femoral condyle give rise to both cartilage and bone cells. In

addition, Toma et al. (2002) reported that human MSCs, when delivered by infusion to an

immunocompromised mouse, could engraft to the normal myocardium and differentiate

into a cardiomyocyte phenotype. Significantly, greater injury-specific cardiac homing of

infused MSCs occurs when the cells are delivered within 10 mins of infarction, compared

to 2 weeks post-infarction (Toma et al., 2002).

1.3.4 Trans-differentiation of Mesenchymal Stem Cells

In the past several years, various groups reported that bone marrow derived stem

cells differentiate into hepatic, muscle, kidney, lung, as well as neural lineages in vivo

(Factor et al., 1990; Ferrari et al., 1998; Brazelton et al., 2000; Orlic et al., 2003).

However, since bone marrow contains both HSCs and MSCs, the use of whole bone









marrow cells in most of these experiments cannot distinguish which of the two

populations contributed to the newly generated tissue. In vitro experiment using cultured

MSCs to induce differentiation may provide better demonstration of MSC plasticity,

since HSC has not been described to endure long-term culture without differentiating

toward a mature phenotype. However, it may be argued that multipotency demonstrated

by in vitro experiments may not reflect the nature of MSCs in vivo, since the culturing

process normally involves a non-physiological level of growth factors or chemicals.

Nevertheless, several groups have demonstrated that long-term cultured MSCs can be

induced to differentiate into hepatic, pancreatic and neural lineages (Woodbury et al.,

2000; Sanchez-Ramos et al., 2000; Deng et al., 2001; Lee et al., 2004; Shu et al., 2004;

Tang et al., 2004). Furthermore, engraftment of cultured MSCs into neonatal or fetal

mouse brain have demonstrated a migration and trans-differentiation of MSCs into neural

lineage (Azizi etal., 1998; Kopen etal., 1999).

1.3.5 Multipotent Adult Progenitor Cells and Marrow-isolated Adult Multilineage
Inducible Cells

Jiang et al. (2002) reported bone marrow derived stem cells, namely multipotent

adult progenitor cells (MAPCs) from the postnatal marrow of mice and rats, following

the typical MSC isolation protocol. The MAPCs can be cultured indefinitely in a

relatively nutrient-poor medium. They are highly plastic and differentiate into cells

bearing endodermal, mesodermal, or ectodermal markers under induction in vitro. The

MAPCs also display their broad differentiation potential in vivo. For these assays, ROSA-

26-derived MAPCs injected into murine blastocysts resulted in chimeric mice with

ROSA-26 cells contributing to nearly all somatic tissues, including brain, lung,

myocardium, liver, intestine, and kidney. After intravenous administration into a









sublethally irradiated immunodeficient mouse, MAPCs differentiate, in varying degrees,

into hematopoietic cells in the marrow, blood and spleen, and into epithelial cells in liver,

lung, and intestine.

Similar to MAPC, D'Ippolito et al. (2002) isolated a bone marrow derived

population of postnatal young and old human cells with extensive expansion and

differentiation potential to generate chondrocyte, adipoctye, neuron, and insulin

producing cells in vitro. They named their cells marrow-isolated adult multlineage

inducible (MIAMI) cells. Like the MAPCs, the cell surface antigen profile of MIAMI

cells demonstrate MSC characteristics, indicating both types belong to mesenchymal

cells. Because of the concerns about the manipulation in cell culture process, critics may

still question whether these highly potent stem cells are the real MSCs exist in the bone

marrow of an animal or not. Nevertheless, the existence of MAPCs and MIAMIs may

have proved the therapeutic value of bone marrow derived stem cells as the potential cell

source in the stem cell therapy.

1.4 Hepatic Oval Cells

Hepatic oval cell is a transit cell type during the liver regeneration when

hepatocyte proliferation is impeded (Pack et al., 1993). Hepatic oval cells differentiate

into hepatocytes and bile duct cells, and can be isolated from the animal models in large

quantity. Cultured oval cells are self-renewable and have been shown to become

pancreatic cells when challenged with high glucose in an in vitro system (Yang et al.,

2002), and neural cells after transplantation into the mouse brain (Deng et al., 2003).









1.4.1 Hepatic Oval Cell As The Adult Stem Cell In The Liver

The potent regeneration ability of the liver after injuries has been known for

centuries. The ancient legend of Prometheus should be mentioned to illustrate this

historically well-known phenomenon. Prometheus was punished severely for stealing the

secret of fire and giving it to man. Zeus banished him to Mt. Caucasus, where he endured

the torture of a bird of prey pecking out his liver on a daily basis. Every night the liver

would repair itself only to be pecked out the next day. Despite the mythic quality of this

story, the liver does indeed have the remarkable ability to regenerate. In general,

hepatocytes maintain their potential to divide and will respond to elevated growth factors

such as hepatocyte growth factor (HGF), acidic fibroblast growth factor (aFGF) after

liver injury (Kan et al., 1989; Lindroos et al., 1991). However, when hepatocyte

proliferation is blocked by chemicals such as allyl alcohol (AA) and carbon tetrachloride

(CC14), stem cell-involved liver regeneration is initiated to recover the lost liver function

(Rechnagel & Glende, Jr., 1973; Badr et al., 1986; Belinsky et al., 1986). Although no

"hepatic stem cell" has been convincingly isolated from health animal liver, a "transit"

type, the so-called hepatic oval cell has been successfully isolated in large quantity under

protocols causing liver injuries while inhibiting the hepatocyte proliferation (Shinozuka

et al., 1978; Evarts et al., 1987b; Evarts et al., 1989). Oval cells were first described by

Grisham and Hartroft (1961) et al in the recovering liver. They are bi-potential in that

they can differentiate into mature hepatocytes and biliary epithelial cells in vitro and in

vivo (Sirica et al., 1990; Sirica, 1995). However, the progenitors of HOCs, the

presumable "hepatic stem cell", remains enigmatic and under debate currently. There are

two major ideologies: 1) Alison et al. (1996) detected so-called "facultative liver stem









cells" at the canal of herring that could have given rise to the oval cells and thus they are

native to the liver; and 2) Petersen et al. (1999) demonstrated that, after certain liver

injuries, rats that received bone marrow transplantation hosted mature hepatocytes of

donor cell origin, suggesting that oval cells may have derived from an extra hepatic

source. Theise et al. (2000) also provided evidence that human hepatocyte could also

derived from bone marrow. Crosbie et al. (1998) provided in vitro evidence to show that

there are hematopoietic stem cells exist in the human liver. Besides the known

observation of their bipotential differentiation ability, the oval cells express some proteins

that mark its 'stem' cell identity. Oval cells express many hematopoietic stem cell

markers, such as Thyl, c-kit, and CD34 in the rat, and fit-3 in the mouse (Omori et al.,

1997a; Omori et al., 1997b; Petersen et al., 1998a). Recently, it is also reported that

mouse oval cells also express Sca-1 as well as CD34 (Petersen et al., 2003).

1.4.2 Induction and Isolation of Hepatic Oval Cells

In the rat model, several protocols have been described to induce the oval cell

proliferation (Evarts et al., 1989). The most common protocols are so-called two-step

induction, in which rats are given a chemical such as 2-acetylaminofluorene (2AAF),

which hinders hepatocyte proliferation, and physical damage such as PHx or CC14

(Petersen, 2001). 2-AAF is a chemical that, when metabolized by hepatocytes, blocks the

cyclin Dl pathway in the cell cycle. The oval cells then arise in the periportal region of

the liver. In the mouse, the HOC proliferation does not respond to 2-AAF/PHx protocol

the same way as in the rat. Preisegger et al. (1999) developed a model using the chemical

3,5-diethoxycarbonyl-1,4-dihydrpcollodine (DDC) in a standard diet at a concentration of

0.1%. The mouse oval cells are also different from the rat oval cells in their marker









expression profiles. Instead of OV6 antibody as that of rat, the mouse oval cells are

positive to A6 antibody (Factor et al., 1990).

The early methods to isolate the oval cells from the rat and mouse livers are based

on gradient centrifugation of the non-parenchymal cell (NPC) fraction after collagnease

perfusion of the liver. Several other methods such as Metrizamide gradient (Sells et al.,

1981), Percoll gradient (Sirica & Cihla, 1984) and centrifugal elutriation (Yaswen et al.,

1984; Pack et al., 1993) have also been used in the past two decades. However, the purity

of the oval cell population from these isolation techniques cannot exceed 90% based on

marker testing. Recently, the oval cells have been found to highly express the

hematopoietic stem cell marker Thy-1 in rat (Petersen et al., 1998a). Based on this

finding, Petersen et al. (1998a) described an isolation method to utilize this feature of the

oval cells, in combination of the flow cytometry technique. This method yields a 95-97%

enriched population of Thy-1.1+ cells, which were also showed to express the traditional

oval cell markers of a-fetal protein (AFP), cytokine 19 (CK-19), gamma glutamyl-

transferase (GGT) and OV6. Using centrifugal elutriation, Pack et al. (1993) has been

able to establish three cell lines from DL-ethionine-fed rats. They've demonstrated that

the oval cells can be maintained in culture for at least two years. In their culture, rat

HOCs have a size of about 10-15 |tm in diameter, positive for CK-19, GGT

immunocytochemistry staining. However, CK-19 became negative after 10 passages,

demonstrating a transformation of the oval cells at in vitro culture condition. In our

culture medium that contains high level of stem cell growth factors, such as stem cell

factor (SCF), leukemia inhibitory factor (LIF), IL-3 and IL-6, HOCs started to proliferate

in about a week, and appear typical oval cell morphology. If lower the growth factor









concentration by ten times, the oval cells transformed into a morphology resembling

marrow stromal cells. Mouse oval cells can also be enriched by using their cell surface

antigen such as Sca-1 (Petersen et al., 2003). The cells isolated with this method express

the mouse oval cell specific proteins such as AFP and A6, and can be culture for about

two months.

1.4.3 The Multipotency of Hepatic Oval Cells

The multipotency of HOCs to differentiate into cell lineage other than hepatocyte

and bile duct cells has not been explored adequately. A few studies showed that HOCs

might adopt different cell types when cultured under various conditions (Pack et al.,

1993). When co-cultured with porcine microvascular endothelial cells (PMEC), HOCs

give a strong epithelial morphology. If the HOCs in culture (3-day colonies) are overlaid

with Matrigel, they appear to become stellate cells 7 days later (Petersen, 2001).

Recently, Yang et al (2002) trans-differentiated a purified rat oval cell line into endocrine

pancreas capable of insulin-secretion in vitro, when challenged with high concentration

of glucose and nicotinomide. It has also been demonstrated that the mouse HOCs express

multiple neural specific proteins, and exhibit phgocytosis activity of functional

microglias after transplanted into the mouse brain (Deng et al., 2003).

1.5 Developmental Neurogenesis

The nervous system is the most complex of all the organ systems in the animal

embryo. In mammals, for example, billions of neurons develop a highly organized pattern

of connections, creating the neuronal network that makes up the functioning brain and the

rest of the nervous system. During embryogenesis, an orchestration of delicately balanced

signaling molecules are involved to develop this complex network. And yet, recent









evidences show that neurogenesis also exists in the adult brain, a concept against the

long-held belief of developmental biologists and neurologists.

As in other developing systems, nerve cell specification is governed both by

external signals and by intrinsic differences generated through asymmetric cell division.

During neurogenesis, multiple biological processes function in concert to ensure that the

diverse neurons and glias proliferate, differentiate, migrate and form synapses at the

appropriate time and place. These processes rely on the precise control of temporal and

spatial expression of genes that encode secreted and membrane associated proteins.

Proteins destined for secretion or for transport to locations within the membrane (e.g.

neurotransmitters, growth factors, guidance cues, ion channels, etc.) convey fundamental

information necessary for the cells to respond to the evolving intra- and extra-cellular

environments during development.

1.5.1 Singling Pathways during the Developmental Neurogenesis

Vertebrate neurogenesis involves several progressive steps mediated by multiple

signaling pathways that eventually sculpt the gene expression profile of specific subtypes

of neuron. As the first step, the neural induction defines the neural plate, which consists

of neural precursors that express pan-neural genes. In general, three signaling pathways

have been implicated in the neural induction: repression of bone morphogenetic protein

(BMP) signaling, and activation of the fibroblast growth factor (FGF) as well as Wnt

pathways (Knecht & Harland, 1997; Baker et al., 1999). The apparently autonomous

acquisition of neural character on removal of inhibitory BMP signaling in the frog has led

to the proposal that the neural cell state occurs by default (Hemmati-Brivanlou & Melton,

1997; Tropepe et al., 2001). The well-known BMP signaling antagonists are secreting









proteins encoded by noggin, chordin, follistatin and Xnr3 (Diez & Storey, 2001). Wnt

pathway has also been shown to reduce BMP signaling, and promote neural cell fate

(Baker et al., 1999). More recently, FGF signaling has been shown to initiate (Alvarez et

al., 1998; Storey et al., 1998) and to be required (Wilson et al., 2000) for neural induction

in chick, acting in part by suppressing BMP4 transcription (Streit et al., 1998). The

second major event during the vertebrate developmental neurogenesis is the dorsoventral,

anteroposterior, and segmentation patterning of the central nervous system. Signaling

molecules at this stage include retinoic acid, Krox20, eFGF for anteroposterior

determination, and sonic hedgehog for dorsoventral determination (Franco et al., 1999).

The last step is the neuron subtype specification, which involves a combination of

homeodomain transcription factors such as Dbxl, Dbx2, Nkx2.2, Pax6, and Pax7

(Briscoe et al., 2000). As the neuron maturation reaches to the final stage, these

transcription factors are down-regulated (Walther & Gruss, 1991; Scardigli et al., 2001),

replaced by commonly known neuronal markers such as Tuji, NF-L, and NeuN (Diez &

Storey, 2001). Overlaps of developmental stages may exist, and one signaling molecule

may be involved in multiple pathways.

1.5.1.1 Bone Morphgenetic Protein and Noggin/Chordin system

The bone morphgenetic protein 4 (BMP-4), and its inhibitors noggin and chordin

forms one of the most important external signaling system throughout the embryonic

neurogenesis (Hemmati-Brivanlou & Melton, 1997). An enormous amount of efforts in

early twentieth century was devoted to identify the signals involved in neural induction in

amphibians and birds (Waddington, 1950; Spemann & Mangold, 2001). The results

indicated that the inducing molecules do not act directly on the cells that will form neural









tissue, but act instead on molecules that inhibit the cells from forming neural tissue

(Hemmati-Brivanlou & Melton, 1997). BMP-4 was later found to play a pivotal role in

the neural induction, since it inhibits cells from forming neural tissue. The inhibitors of

BMP signaling are proteins encoded by the genes noggin and chordin. Noggin and

chordin are secreted proteins unrelated to any of the known growth factor families. When

added into isolated blastula animal caps, the noggin and chordin proteins induced neural

markers expression in the culture (Hemmati-Brivanlou & Melton, 1997).

1.5.1.2 Retinoic Acid Signaling

Retinoic acid (RA) is a small hydrophobic molecule- a derivative of vitamin A-

which has an important role in local signaling in vertebrate development. The precursor

of RA, retinol, has been described as a hormone, released from its storage sites in the

liver and kidney. However, unlike other hormones, there are no reported regulatory

factors that control retinol's release into the circulation. Homeostatic controls exist solely

to maintain steady levels of plasma retinol. During embryogenesis, RA play a critical role

in patterning, segmentation, and neurogenesis of the posterior hindbrain and it has been

proposed that they act as a posteriorizing signal during hindbrain development (Durston

et al., 1997). The endogenous RA is a precisely regulated factor that controls many

aspects of embryonic development. RA binds to and activates transcriptional regulators

of the nuclear receptor family that also includes the receptors for thyroid and steroid

hormones. Two types of binding proteins are thought to be involved in the intracellular

regulation of retinoids; cellular retinol binding protein (CRBP) types I and II, and cellular

retinoic acid binding protein (CRABP) types I and II (Ong et al., 2000). CRBP I binds

retinol and is involved in the storage as well as in the oxidation of retinol via retinol to









RA (Carson et al., 1984; Eriksson et al., 1987; Posch et al., 1992). The role of CRBP II,

which is mainly found in the enterocytes of the gut, may be to handle retinoids after

dietary uptake for further metabolism and transport to the liver (Porter et al., 1985).

1.5.1.3 Fibroblast Growth Factor in neurogenesis

There are at least 23 different members of the fibroblast growth factor (FGF)

family. These FGFs are classified as a family on the basis of a conserved 120 amino acid

core region and share a 30-60% amino acid identity across the family. Fibroblast growth

factor family members have diverse functions, being potent modulators of cell

proliferation, migration, differentiation and survival (Goldfarb, 1996; Ornitz, 2000).

There are four FGF receptor genes, FGFR-1-4, and within these, alternative splicing

creates receptor isoforms with distinct specificities for different FGFs. Expression studies

demonstrate that members of the FGF family are highly expressed early in the developing

central nervous system (CNS) (Ford-Perriss et al., 2001). Among them, FGF-1, FGF-2

and FGF-15 are more generally expressed throughout the developing neural tube in both

the embryonic and adult CNS. Noticeably, FGF-8 and FGF-17 are tightly localized to

specific regions of the developing brain and are only expressed in the embryo during the

early phases of proliferation and neurogenesis (Ford-Perriss etal., 2001). There is

accumulating evidence that FGFs have a critical role in the initial generation of neural

tissue at the stage of neural induction. Fibroblast growth factor-1 has been reported to

stimulate neuronal process regrowth in retinal ganglion cell cultures (Lipton et al., 1988),

spiral ganglion explants (Dazert et al., 1998) and adult dorsal root ganglion cells

(Mohiuddin et al., 1996). Fibroblast growth factor-3 is down-regulated in the hindbrain









by El 1, but expression continues in the vestibular sensory epithelia and organ of Corti at

later ages (Mansour et al., 1993; McKay et al., 1996).

1.5.2 Neurogenesis in the Adult Brain

Increasing evidence has demonstrated that generation of new neurons is not

entirely restricted to prenatal development, but continues throughout adult life in certain

regions of the mammalian brain (Steindler et al., 1996; Gage, 2002). The demonstration

of neurogenesis in the human brain makes this phenomenon of particular relevance to

treating neurological injury and disease, with the hope that the ability to generate new

neurons may be utilized for structural brain repair (Eriksson et al., 1998). Neurogenesis is

not widespread within the adult mammalian brain, but restricted to the two germinal

centers, the hippocampal dentate gyms and the anterior subependymal zone (SEZ) of the

lateral ventricles (Thomas et al., 1996; Peretto et al., 1999). Transient neurogenesis may

also occur in the cerebral cortex (Gould et al., 2001). Similarly, limited neurogenesis may

occur in the substantial nigra, although this is disputed (Lie et al., 2002; Frielingsdorf et

al., 2004). As a preserved niche for neural stem cells, SEZ and hippocampus also provide

an ideal environment for testing the neurogenecity of other adult stem cell recently in the

postnatal and adult brain (Zheng et al., 2002; Deng et al., 2003; Hudson et al., 2004).

1.5.2.1 Hippocampal neurogenesis

In the hippocampus of the adult brain, a certain rate of cell proliferation has been

described in the dentate gyms granular layer, giving rise to granule neurons (Altman &

Das, 1965; Kaplan & Bell, 1984). In the rat, such neurogenesis has been observed up to

11 months of age. Newly generated hippocampal granule cells extend dendrites and

axons; the latter grow through the hilus and CA3 region of the Ammon's horn (Stanfield









and Trice, 1988), thus representing an example of long-distance axonal pathfinding

through a mature brain neuropil. Unlike the olfactory receptor neurons, newly generated

cells of the dentate gyms substantially increase with age (Bayer et al., 1982). It has been

proposed that hippocampal granule cells can originate during adulthood both from local

proliferation in the granule cell layer and after short migration from the hilus (Cameron et

al., 1993), in a manner similar to that described during postnatal development

(Schlessinger et al., 1975). Despite accumulating evidence for the existence and

modulation of adult neurogenesis, there is still limited data elucidating the functional

contribution of these newly generated neurons (Kempermann et al., 2004). However,

there is evidence that individual neurons can become functionally integrated (van Praag

et al., 2002). In addition to forming appropriate anatomical connections (Markakis &

Gage, 1999), newly generated hippocampal neurons have been shown to exhibit

appropriate electrical activity (van Praag et al., 2002).

1.5.2.2 Subependymal zone/olfactory bulb neurogenesis

The olfactory bulb is another area of the mammalian CNS where neurogenesis has

been described during adulthood (Altman & Das, 1965; Hinds, 1968; Steindler et al.,

1996). In early studies this neurogenesis was correlated with an adjacent region of the

forebrain known as the subependymal zone (SEZ), a remnant of the primitive forebrain.

Proliferating cells within the SEZ migrate along a defined pathway, the rostral migratory

stream (RMS), where cell proliferation continues until reaching the olfactory bulb where

they integrate into the granule and glomerular cell layers (Luskin, 1993; Lois & Alvarez-

Buylla, 1994). The SEZ, which undoubtedly constitutes the major site of cell

proliferation in the adult mammalian brain (Tzeng et al., 2004), has been indicated as the









source of cell precursors, known as 'brain marrow' (Steindler et al., 1996). Thus, cell

proliferation in the SEZ and neurogenesis in the olfactory bulb form a complex system

spanning the length of the forebrain (about 5-6 mm in rodents (Altman & Das, 1965;

Lois & Alvarez-Buylla, 1994)). The newly generated neurons in the olfactory bulb also

show evidence of functional integration into neural circuitry involved in processing

sensory input (Carleton et al., 2003). While these newly generated neurons appear

capable of functioning and participating in established circuitry, recent studies carried out

on this system provided evidence for several morphological and functional peculiarities.

For example, the persistence of long-distance migration and multipotent stem cell

compartment appear qualitatively and quantitatively different from those described in

other neurogenetic areas of the adult mammalian nervous system (Peretto et al., 1999).

1.6 Neural Induction In vitro

In vitro neural induction offers an ideal system for testing theories of neurogenesis during

development. The recent progress within stem cell biology has infused a high interest in

developing effective protocols to drive stem cells into a neural phenotype, in the hope

that they may be used to replace the lost neural tissues in the neurodegenerative diseases.

1.6.1 Neural Induction from Embryonic Carcinoma and Embryonic Stem Cell Lines

The early efforts of neural differentiation in vitro are mostly contained within ES

and embryonic carcinoma (EC) cell types, in the purpose of understanding the basic

mechanism of cell differentiation during neurogenesis. As discussed above, RA is an

important growth factor during the embryogenesis, it is also commonly used to induce

EC or ES cells into neuron phenotype in culture. Pleasure et al. (1992) used RA to treat

NT2-N cells, a human teratocarcinoma cell line, and achieved a 95% pure neuron









population. Bain et al. (1995) used a so-called '4+/4-' protocol, in which ES cell

aggregates were treated with RA for four days and cultured without RA for four days in

non-adhesive culture condition. The cell aggregates were then plated on an adhesive

substrate and were differentiated into neurons, while aggregates not treated with RA

differentiate into various lineages (Bain et al., 1996). Gottlieb and Huettner (1999) found

a significant upregulation of RA receptor- (RAR) and RAR mRNA, but a rapid down-

regulation of RAR and retinoid X receptor- (RXR) mRNA during RA-induced neuronal

differentiation of mouse EC cells (Gottlieb & Huettner, 1999). These support the

hypothesis that in vitro and in vivo pathways may be comparable.

Besides RA, other pro-neuronal growth factors have also been used, either by

direct addition to the medium, or through gene transfer into the cells. Pevny et al. (1998)

demonstrated that P19 cells started to express neuronal markers in 4-5 days after

transfected with the soxl gene. They also showed that Soxl and neurofilament proteins

are mutually exclusive in the mature neurons, a phenomenon also exists in the developing

brain. Soxl is expressed throughout the neural plate and early neural tube, but is down

regulated in a stereotyped manner in cells along the dorsoventral axis of the neural tube

later in the development stage (Pevny et al., 1998). As a potent antagonizing factor of

BMP signaling, noggin has also been shown to convert embryonic stem cells into

primitive neural stem cells by inhibiting BMP signaling (Gratsch & O'Shea, 2002).

1.6.2 Neural Induction from Mesenchymal Stem Cell Line

Mesenchymal stem cells are the most-studied adult stem cells in terms of

differentiation induction in vitro, because they are easy to obtain and culture (Azizi et al.,

1998; Kopen et al., 1999; Brazelton et al., 2000). The neural induction methods of MSCs









range widely, from the use of neurotrophic factors, co-culturing with neural tissue, to the

so-called 'chemical inductions'.

1.6.2.1 Neurotrophic Growth Factor induction

Neurotrophic growth factors are polypeptide hormones that are essential for the

development and maintenance of the central nervous system. During the period of target

innervation, limiting amounts of neurotrophic factors regulate neuronal numbers by

allowing survival of only some of the innervating neurons, the remaining being

eliminated by apoptosis (Kirkland & Franklin, 2003; Yeo & Gautier, 2004; Wiese et al.,

2004). Several lines of evidence indicate that various neurotrophic factors also influence

the proliferation, survival and differentiation of precursors of a number of neuronal

lineages (Kirkland & Franklin, 2003; Wiese et al., 2004). In the adult brain, neurons

continue to be dependent on trophic factor support, which may be provided by the target

or by the neurons themselves. Their ability to promote survival of peripheral and central

neurons during development and after neuronal damage has stimulated the interest in

these molecules as potential therapeutic agents for the treatment of nerve injuries and

neurodegenerative diseases. They are also widely used in the neural induction from adult

stem cells in vitro. Sanchez-Ramos et al. (2000) treated mouse marrow stromal cells

with epithelial growth factor (EGF) and brain derived neurotrophic factor (BDNF), as

well as co-culture with fetal midbrain tissue, and successfully detected neuronal markers

such as NeuN and MAP2 expression. In combination with 5-azacytidine, a demethylating

agent capable of altering the gene expression pattern, Kohyama et al. (2001) treated the

marrow stroma-derived mature osteoblasts with noggin, and induced neural









differentiation. Several commonly utilized members of the neurotrophic factors in neural

differentiation protocols are listed below.

Nerve gi ,,\ iltfactor (NGF) is the prototype for the neurotrophin family of

polypeptides which are essential in the development and survival of certain sympathetic

and sensory neurons in both the central and peripheral nervous systems. Nerve growth

factor was discovered when mouse sarcoma tissue transplants into chicken embryos

caused an increase in the size of spinal ganglia. In the course of attempting to

characterize the agent responsible for this action, snake venom, used as a

phosphodiesterase, was found to be a rich source of NGF (Angeletti et al., 1968).

Brain-DerivedNeurotrophic Factor (BDNF) is important in development and

maintenance of neuronal populations within the central nervous system or cells directly

associated with it. BDNF has been shown to enhance the survival and differentiation of

several classes of neurons in vitro, including neural crest and placode-derived sensory

neurons, dopaminergic neurons in the substantial nigra, basal forebrain cholinergic

neurons, hippocampal neurons, and retinal ganglial cells (Larsson et al., 2002;

Gustafsson et al., 2003).

Neurothophin3 (NT-3) is a member of the neurotrophin family. Neurothophin3 is

important in development and maintenance of neuronal populations and promotes

differentiation of neural crest derived sensory and sympathetic neurons. Neurothophin3 is

critical for proprioceptive la afferent neurons, which relay information from peripheral

muscle spindles to motorneurons, sending projections to spinocerebellar neurons. It is

also critical in the superior cervical and nodose ganglia.









1.6.2.2 Chemical induction

The term "chemical induction" was first adopted by Lu et al. (2004) to describe a

group of neural induction methods that use potent chemical reagents to achieve rapid and

dramatic neuron-like morphology acquisition in adult stem cells. Woodbury et al. (2000)

was the first to report that dimethylsulfoxide (DMSO) and butylated hydroxyanisole

(BHA) could induce rat and human marrow stromal cells to differentiate into neurons.

Deng et al. (2001) treated human marrow stromal cells with isobutyl mehtylxanthine

(IBMX) and dibutyral cyclic AMP (dbcAMP) to elevate cytoplasm cAMP and observed

morphological change from stromal cell-like to neuron-like (Deng et al., 2001). Since

then, there have been many groups using similar methods to induce mesenchymal stem

cells from a variety of sources with essentially the same observation (Lambeng et al.,

1999; Black & Woodbury, 2001; Safford et al., 2002; Jori et al., 2004; Lopez-Toledano

et al., 2004; Lu et al., 2004). However, the next section will discuss in depth the effect of

chemical induction is currently very controversial. Several commonly used reagents

listed below.

Cell-permeable Dibutyryl Cyclic Adenosine Monophosphate (dbcAMP) analog

activates cAMP dependent protein kinase A (PKA). It affects cell growth and

differentiation by altering gene expression. It can inhibit cell proliferation and induce

apoptosis, yet reported to improve the survival of dopaminergic neurons in culture

(Mourlevat et al., 2003). It has been shown to block free radical production in response to

parathyroid hormone, pertussis toxin or ionomycin (Graves and Moreadith, 1993).

3-Isobutyl-1-Methylxanthine is a non-specific inhibitor of cAMP and cGMP

phosphodiesterase. The increase in cAMP level as a result of phosphodiesterase









inhibition by IBMX activates PKA, leading to decreased proliferation, increased

differentiation, and induction of apoptosis. 3-Isobutyl-l-Methylxanthine inhibits

phenylephrine-induced release of 5-hydroxytryptamine from neuroendocrine epithelial

cells of the airway mucosa (Li et al., 2003).

Dimethyl Sulfoxid is a common cryoprotective agent to keep most mammalian

cells from mechanical injury caused by ice crystals from freezing, concentration of

electrolytes, dehydration, pH changes and denaturation of proteins. It has been shown

that DMSO induces differentiation and function of leukemia cells of mouse (Thomson et

al., 1996), rat (Amit et al., 2000), and human (Reubinoff et al., 2001). Dimethyl Sulfoxid

is also found to stimulate albumin production in malignantly transformed hepatocytes of

mouse and rat and to affect the membrane-associated antigen, enzymes, and

glycoproteins in human rectal adenocarcinoma cells (Richards et al., 2002).

1.6.2.3 Controversies in neural trans-differentiation from mesenchymal stem cells

Because of the inadequate characterization of the MSCs currently, there are

significant inconsistency, even controversies among the reports of neural trans-

differentiation from MSCs in different laboratories. In spite of wide range reports of

trans-differentiation of MSCs to generate neurons and astrocytes, Wehner et al. (2003)

argued that bone marrow-derived cells do not generate astroctyes. They used a transgenic

mouse strain that contains GFP gene expression cassette under GFAP promoter control,

and failed to observe GFP expression in all three experiments both in cell culture and in

vivo engraftment. Recently, two independent groups, Lu, et al. (2004) and Neuhuber, et

al. (2004), re-evaluated the rapid and robust neural-like neurofilament formation in

differentiated MSCs under the DMSO/BHA induction protocol reported earlier. They









applied time lapse imaging analysis, and compared cells of different types including rat

epidermal fibroblasts, PC12 in response to chemical stressers such as triton or sodium

hydroxide, and observed identical changes in both MSCs and fibroblasts. They concluded

that the neuron-like morphological and immunocytochemical changes of MSCs,

following the so-called 'chemical induction', are not the result of genuine neurofilament

extension but represent actin cytoskeleton retraction in response to chemical stresses (Lu

et al., 2004).

Summarizing recent work on neural trans-differentiation of MSCs, there are four

uncertainties among the reported results: 1) the early reports rely the neuronalization

conclusion mostly, if not only, on the immunophenotypic characteristics of the

differentiated MSCs. As evidence start to show that stem cells express many markers

spontaneously, to rely on this criterion solely may not reflect the real induction processes

(Tondreau et al., 2004); 2) the process-bearing morphological characteristics has been

overvalued to indicate the neuronal differentiation. Detailed inspection of the

differentiated cells revealed little resemblance to typical neuron morphology in most of

the reports (Lu et al., 2004; Neuhuber et al., 2004); and 3) many of the trans-

differentiation clams rely only on in vitro data, few has reported the fate of cells upon

transplanted into the CNS in vivo, which makes it hard to evaluate the functionality, and

therapeutic value of differentiated cells.

1.7 Potential Application of Stem Cell Therapy in Parkinson's Disease

Neurodegenerative diseases belong to a group of neurological disorders that are

caused by the loss of neurons in a defined fashion regionally, or globally in the central

nervous system. Such diseases include Parkinson's Disease (PD), Alzheimer's Disease









(AD), stroke, amyotrophic lateral sclerosis (ALS) and Huntington's Disease (HD) etc.

Transplantation of stem cells or their derivatives and mobilization of endogenous stem

cells within the adult brain, has been proposed as future therapies for neurodegenerative

diseases. It may seem unrealistic to induce functional recovery by replacing cells lost

through disease, considering the complexity of human brain structure and function.

Studies in animal models have nevertheless demonstrated that neuronal replacement and

partial reconstruction of damaged neuronal circuitry is possible (Piccini et al., 2000).

There is also evidence from clinical trials that cell replacement in the diseased human

brain can lead to symptomatic relief (Lindvall et al., 2004).

1.7.1 A New Hope for Parkinson's Disease Patients

Among the common neurodegenerative diseases, the pathology of PD is relatively

better understood. The loss of dopaminergic (DA) neurons confined mostly to the

relatively defined nigrostriatal pathway in the basal ganglia region of the brain.

Parkinson's Disease is the second most-common neurodegenerative diseases affecting

around 2% of the population over 65 years of age in the world. There are 500,000 new

cases each year in the United States alone. As the PD onset has close connection with

aging, the increase of number of incidences is expected due to continuous improvement

of living standard in the future. Cell replacement therapy has come into sight along with

the rapid development of the stem cell biology. Among the common aging related neuro-

degenerative disorders, PD patients hold the highest expectation to be benefited in the

upcoming area of regenerative medicine. It has been shown that the symptoms of patient

with severe PD can be significantly improved by using fetal mesencephalic neurons,

which are rich in postmitotic dopaminergic neurons (Freed et al., 1992; Freed et al.,









1993; Bjorklund et al., 2003). The use of fetal tissue has been one of the clinical options

for the PD patient, but is unlikely to become a routine procedure due to the ethical

concerns in using human embryos. More profoundly, the short of tissue supply largely

limits the application of this approach at the moment. Under this situation, stem cells,

perhaps adult stem cells, appear to be the best solution. Indeed, the easily accessible bone

marrow derived stem cells have been extensive studied to differentiate into DA neuron

phenotype, since the realization of the therapeutic potential of adult stem cells (Pavletic et

al., 1996; Schwarz et al., 1999; Jiang et al., 2003; Yoshizaki et al., 2004; Hermann et al.,

2004; Dezawa et al., 2004). The key issue is to identify a proper cell type that is capable

to transform into DA neurons, and lacks the propensity to cause tumor. It has been shown

that the risk of forming teratoma is reduced if the ES cells are differentiated in vitro

before transplantation, which implies that somewhat committed adult stem cells may be

safer in terms of tumorigenesis when used clinically (Erdo et al., 2003).

1.7.2 Current Challenges of Embryonic Tissue and Cell Therapy in Parkinson's Disease
Treatment

Although the use of fetal mesencephalic tissue has produced promising

improvement for the PD patients, the present cell replacement procedures are still far

from optimal (Freed et al., 1993; Bjorklund et al., 2003). Some recent sham surgery-

controlled trials showed only modest improvement in relief the patients' symptoms,

compare to some early reports (Freed et al., 2001; Olanow et al., 2003). After

transplantation, 7-15% of grafted patients also developed dyskinesia (Hagell et al., 2002;

Olanow et al., 2003), similar to the L-dopa therapy. However, this adverse effect is not

due to dopaminergic overgrowth (Hagell et al., 2002), but may have been caused by

uneven and patchy reinnervation (Ma et al., 2002), giving rise to low or intermediate









amounts of striatal dopamine. Another major problem in using ES cells is the risk for

teratoma after grafted into the brain. In one particular study, it was reported that

implantation of mouse ES cells into rat striatum caused teratomas in 20% of the animals

(Bjorklund et al., 2003), and ES cells seem more prone to generate tumors when

allografted into the same species (Erdo et al., 2003).

1.7.3 Building an Adult Stem Cell Therapy For Parkinson's Disease

While the use of ES cells encounters problems and needs to be improved

dramatically, working towards applying adult stem cells in treating PD is certainly an

appealing strategy. There have been reports to induce MSCs into tyrosine hydroxylase

(TH) positive neurons in culture dish (Jiang et al., 2003; Tondreau et al., 2004), but the

current work is too preliminary. To develop a clinically competitive adult stem cell

therapy, it must provide advantages over current L-dopa treatments for PD. Cell-based

approaches should induce long-term improvements of mobility and suppression of

dyskinesia. On the basis of results obtained from fetal transplants in both animal and

human studies, several aspects need to be considered for clinically suitable adult stem

cell-derived DA neurons: i) the cells should release dopamine in a regulated manner and

should show the molecular, morphological and electrophysiological properties of

substantial nigra neurons; (ii) the cells must be able to reverse the motor deficits in

animals that resemble the symptoms in persons with PD; (iii) the yield of cells should

allow for at least 100,000 grafted dopaminergic neurons to survive over the long term in

each human putamen; (iv) the grafted dopaminergic neurons should re-establish a dense

terminal network throughout the striatum; and (v) the grafts must become functionally

integrated into host neural circuitries (Hagell et al., 2002).









Although controversies still exist in multipotency of adult stem cells, there is

growing body of evidence points to the genuineness of these discoveries reported in the

past few years. The issues of cell fusion or technical error that brought cautions to this

field should be used wisely to move our detection and evaluation methods forwards, not

to deter further discoveries. After all, we cannot afford to ignore the potential of adult

stem cells' possible role in the future medical practice; the revolutionary idea of

regenerative medicine may in large part depend on how much we know about adult stem

cells either in their native niche, or in a grafted host environment. With the increasing

number of experiments designed to test the therapeutic value of MSCs in the animal

model of neurodegenerative diseases, our knowledge about their potential in both neural

trans-differentiation and clinical application will certainly grow. For a field that is young

and active as adult stem cell biology, we should let future to decide its fate while

investing our best efforts.















CHAPTER 2
THE NEURAL PROPERTY OF BONE MARROW DERIVED
CELLS FROM ADULT MOUSE

2.1 Background and Introduction

Previous studies have shown that adult stem cells exist in various tissues of adult animals,

and that these tissue-specific stem cells may have the capacity for trans-differentiating

into cell types of different lineages (Wetts & Fraser, 1988; Jones et al., 1995; Ferrari et

al., 1998; Brazelton et al., 2000; Petersen, 2001; Hughes, 2002). The apparent

multipotency of adult stem cells has generated tremendous interest regarding their

potential therapeutic value, while bypassing ethical concerns surrounding the use of

human embryonic stem cells. Furthermore, adult stem cells are more restricted in their

differentiation potential, and thus are thought to be less tumorigenic than embryonic stem

cells. However, because some laboratories failed to repeat several significant experiments

(Wagers et al., 2002; Wehner et al., 2003), the early exuberance surrounding the first

reports of adult stem cell plasticity has given way to serious concerns about whether what

was being described was true trans-differentiation, or an epiphenomenona mediated,

perhaps, by cell contamination or fusion (McKinney-Freeman et al., 2002; Terada et al.,

2002; Ying et al., 2002; Issarachai et al., 2002).

The bone marrow-derived mesenchymal stem cell (MSC) has been known since

1963, when Petrakova and colleagues (Petrakova et al., 1963) demonstrated that pieces of

bone marrow transplanted under the renal capsule of mice formed an osseous tissue over

a period of several weeks that was invaded by hematopoietic cells. The MSC may

38









represent the best hope for stem cell-base replacement therapy since, in addition to their

potency and accessibility, it may be possible to use MSCs in autologous transplantations

to minimize immune rejection (Awad et al., 1999; Dezawa et al., 2004). For this reason,

the MSC is one of the most extensively-studied adult stem cells with respect to trans-

differentiation potential (Kadiyala et al., 1997; Ferrari et al., 1998; Bruder et al., 1998;

Pittenger et al., 1999; Awad et al., 1999). However, despite this great interest the MSC

remains enigmatic as both its identity and qualification as a true stem cell remains

uncertain (Javazon et al., 2004; Baksh et al., 2004). This uncertainty results primarily

from the lack of universally defined cell surface markers to characterize the MSC in the

manner of the hematopoietic stem cell (Devine, 2002; Javazon et al., 2004; Baksh et al.,

2004). Additionally, the relatively unrefined MSC isolation methodology, that has

remained essentially unchanged for 40 years, has no doubt also contributed to the weak

characterization of the MSC.

The high incidence of age-related neurological disorders has spurred interest in

the ability of the MSC to trans-differentiate into neural lineage (Torrente et al., 2002;

Chopp & Li, 2002; Sugaya, 2003). Among various protocols to induce neural

transdifferentiation of MSCs, the use of chemicals including dimethylsulfoxiede

(DMSO), butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), as well as

dibutyral cyclic AMP and isobutylmethylazanthine (IBMX) has become popular, as they

induce a rapid and robust neuron-like morphological transformation from the normally

flat, fibroblast-like appearance of MSCs (Woodbury et al., 2000; Sanchez-Ramos et al.,

2000; Deng et al., 2003). Since then, there has been a series of studies using similar

methods to induce neural differentiation of stem cells from a variety of other sources









(Lodin et al., 1979; Lambeng et al., 1999; Safford et al., 2002; Lopez-Toledano et al.,

2004). However, recent studies cast doubt on the 'neuralization' of bone marrow-derived

stem cells. Wehner, et al. (2003) utilized a transgenic mouse line carrying a green

fluorescence protein (GFP) expression vector under the control of the glial fibrilary acidic

protein (GFAP) promoter to examine the capacity of MSCs to undergo neuralization.

After three in vivo and in vitro experiments, they concluded that bone marrow-derived

cells could not differentiate along the astrocytic lineage. Recently two independent

groups, Lu, et al. (2004) and Neuhuber, et al. (2004), reevaluated the rapid and robust

neural-like neurofilament formation by MSCs under the DMSO/BHA induction protocol

reported earlier. They applied time lapse imaging analysis, and compared cells of

different types including rat epidermal fibroblasts, PC 12 in response to chemical stressers

such as triton or sodium hydroxide, and observed identical changes in both MSCs and

fibroblast. They concluded that the neuron-like morphological and immunocytochemical

changes of MSCs following the treatments are not the result of genuine neurofilament

extension but represent actin cytoskeleton retraction in response to chemical stress.

Although these results can not account for all the neural trans-differentiation of MSCs

reported so far, and they can not explain the in vivo neuralization of the MSCs, they do

raise serious questions about the generality of the neural differentiation potential of the

MSCs, and temper the hope of potentially applying MSCs in the treatment of brain

disorders.

In an attempt to further clarify these issues, we established long-term cultures of

bone marrow-derived cells (BMDCs) from whole bone marrow, using a common

protocol for mesenchymal stem cell culture (Goshima et al., 1991a; Friedenstein, 1995).









We assessed BMDC "sternness" by examining the clonality, and cell division patterns

(symmetric vs. asymmetric). To assess the previous protocol of using dbcAMP/IBMX

(Deng et al., 2001) for rapid neuronal induction, we examined the expression of neural

specific proteins in BMDCs and NIH3T3 pre- and post-treatment. To further test the

multipotency, and their potential for cell-replacement therapy for neurological disorders,

we transplanted BMDC into the neonatal mouse brain and exam their in vivo

performance as a neuro-progenitor cell. We also applied confocal scanning imaging

system, and Y-chromomsome painting technique to confirm the authenticity ofimmuno-

labeling of the neural specific protein expressions by BMDCs, and to assess the cell

fusion events in vivo.

2.2 Materials and Methods:

2.2.1 BMDC Culture

Eight weeks old C57/B6 and C57/B6GFP mice were used to establish BMDC

cultures, utilizing the physical property of plastic adherence (Goshima et al., 1991 a;

Friedenstein, 1995). In brief, mice were given a lethal dose of phenobarbital, and the

tibias and femurs were removed. A 22-gauge needle filled with Dulbecco's Modified

Eagle's Medium (DMEM) was used to flush out whole bone marrow. The recovered

cells were then mechanically dissociated, filtered through a 70[tm mesh, and plated in

35mm tissue culture dishes containing DMEM supplemented with 20% fetal bovine

serum (FBS), 0.5% gentamycin, and 1000units/ml of Leukemia Inhibitory Factor (LIF),

as per Jiang, et al. (2002). After 24hrs, the non-adherent cells were removed, and the

culture medium was completely replaced. After reaching confluency, BMDCs were

passage (1:3 dilution) twice a week with fresh medium.









In order to generate clonal cultures, we grew single BMDCs, in conditioned

medium collected from confluent BMDC cultures derived from whole bone marrow.

Conditioned medium was centrifuged at 2,600g for 10min., and then filtered through a

0.22[tm mesh. We created a dilution series with BMDCs to reach a cell density of one to

two cells per 5 tL, and plated 5 tL of the cell suspension in each well. Immediately after

plating, we examined each well with phase microscopy, and excluded those wells

containing more than one cell. We then added 100[tL of mixed medium (50%

conditioned medium + 50% fresh medium). In order to ensure single-cell clonality, we

again examined each well after an additional 24 hours, and discarded those containing

more than one cell. Clonal BMDC cultures were maintained in the mixed medium until

confluent, at which point the cells were maintained in fresh, unconditioned medium.

2.2.2 FACs Analysis of BMDCs

Immunofluorescence with a variety of antibodies against surface antigens was

used to characterize BMDCs. These antibodies included directly-conjugated anti-Scal,

anti-CD34, anti-CD45, and directly-conjugated anti-mouse IgG2a (PharMingen; 1:500), as

a control. In addition, the following unconjugated antibodies were used: anti- c-Kit, anti-

CD9, anti-CD31, anti-CD105 (PharMingen; 1:500), anti-CD lb (Serotec; 1:300), and

anti-rat IgG2a (PharMingen; 1:500), as a control. Primary antibodies were applied for

30min. at room temperature, followed by washing and application of fluorescently-

conjugated secondary antibodies for an additional 30min for the un-conjugated

antibodies. Cells were then centrifuged at 200g, and washed twice in PBS to eliminate

unbound antibodies. Approximately 106cells/mL cell suspension was run through a flow

cytometer (CELLQuest, Becton Dickinson FACScan).









2.2.3 Immunolabeling and Cell Counting

Immunolabeling was performed on glass coverslips plated with BMDCs. Cells

were fixed in ETOH:acetic acid (95:5) for 15mins., washed with PBS containing 0.1%

Triton (PBST), and blocked for 30min in PBST supplemented with 10%FBS. Cells were

then incubated with primary antibodies overnight at 40C, washed, and incubated in

secondary antibodies for lhr at RT.

Free-floating, 40tm brain sections were immunolabeled, as previously described

(Deng et al., 2003), with the following antibodies: nestin (Developmental Studies

Hybridoma Bank, University of Iowa; 1:250), glial fibrillary acidic protein (GFAP; from

Immunon (monoclonal and polyclonal; 1drop/0.5ml), neurofilament medium subunit

(NFM; EnCor Biotech. Inc.; 1:500), PIII tubulin (Promega; 1:1500), S100 and MAP2ab

(Sigma; 1:500), Polysailic Acid-NCAM (PSA-NCAM; Chemicon; 1:100). Confocal laser

scanning microscopic analysis of the immunolabeling was done on the University of

Florida Cancer Center's Leica TCS SP2 confocal laser imaging system (Leica

Microsystems, Wetzlar, Germany).

Cell counting was performed under a fluorescence microscope (Olympus BX51).

The ratios of positive cells were obtained by averaging three different experiments for

both control and treatment groups. In each experiment, five randomly chosen views were

counted and averaged.

2.2.4 Neural Induction by Elevating Cytoplasmic cAMP

Our protocol for neural induction by elevating intracellular cAMP was modified

from Deng, et al. (2001). In addition to primary induction medium (0.5mM

isobutylmethylxanthine (IBMX)/lmM dibutyryl cyclic AMP (dbcAM) (Sigma) in









DMEM/F 12) used for the first 24hrs of treatment, a cocktail of growth factors (10ng/mL

of Brain-Derived Neurotrophic Factor (BDNF; Pepro Tech.), Nerve Growth Factor

(NGF; Invigtren), Epidermal Growth Factor (EGF; Pepro Tech) and basic Fibroblast

Growth Factor (bFGF; Pepro Tech), and N2 Supplements (Gibco)) has been added to the

primary induction medium for treatments longer than 24hrs.

2.2.5 In situ Hybridization for GFAP mRNA

To generate the GFAP riboprobes, we used RT-PCR to amplify a 401bp DNA

fragment of the GFAP gene (gi: 26080421) from mouse brain tissue with a pair of

primers designed using the Primer 3 program (forward: GCCACCAGTAACATGCA

AGA; reverse: ATGGTGATGCGGTTTTCTTC). The PCR product was then cloned into

the PCR4 TOPO vector (Invitrogen). After linearization, plasmids extracted from clones

of both directions were used as templetes to synthesize digoxigenin (DIG)-labeled GFAP

sense and antisense probes using T7 RNA polymerase. In situ hybridization followed the

protocol of Braissant and Wahli (1998) (Braissant & Wahli.W, 1998) with small

modifications. The probe concentration was 400ng/ml and the hybridization temperature

was set at 450C.

2.2.6 Western Blotting

For western blotting, approximately 20[tg of protein from cell lysates was

electrophoretically separated by 8% SDS-PAGE. After transfer to a nitrocellulose

membrane, we applied anti-GFAP (Immunon; 1:30) antibody, and a chemiluminecence

method for detection (ECL, Amersham). We then incubated the membrane in striping

solution at 560C for 30mins, and incubated it again using anti-actin (Abcam; 1:2,000)

antibody.









2.2.7 Transplantation of BMDCs into Neonatal Mouse Brain

BMDCs were trypsinized and labeled with the fluorescent carbocyanine dye, Dil

(Molecular Probes), according to a protocol adapted from Paramore et al. (1992). Briefly,

cells were centrifuged for 5min. at 1000 rpm, and resuspended in fresh medium. Dil was

dissolved in absolute ethanol (2.5mg/ml), and added to the cell suspension such that the

final concentration of Dil was 40[tg/mL. The cells were incubated in the Dil-containing

medium for 30min. at 37C before being washed three times in PBS.

Dil-labeled BMDCs were transplanted into the lateral ventricle of postnatal day 1-

4 wild-type C57BL6 mice as described previously (Deng et al., 2003). Approximately

105 BMDCs in 1IlL of PBS were injected into the left lateral ventricle. After 10 days

survival, mice were euthanized with an overdose of Avertin and perfused transcardially

with 4% paraformaldehyde in PBS. The brain tissue was excised, post-fixed overnight in

perfusate, and sectioned through the coronal plane into 40[tm slices with a vibratome.

2.2.8 Y-chromosome Painting for Cell Fusion Detection

Twenty micron vibratome sections were used for assaying possible fusion events

associated with Dil-labeled donor BMDCs in the neonatal mouse brain. Brain sections

were first treated with 0.2N HC1 for 30mins., and retrieved in 1M Sodium Thiocyanate

(NaSCN) for 30mins. at 850C. The sections were then digested with 4mg/mL pepsin

(Sigma; diluted in 0.9% NaCl pH2.0) for 60mins. at 370C. After equilibrating in 2X SSC

for Imin., the sections where dehydrated through graded alcohols. The tissue was then

incubated with FITC-conjugated Y-chromosome probes (Cambio, UK; denatured for

43mins at 370C) using Hybrite (Vysis, IL) for 20.5hrs. following a denaturing step of

6mins. at 750C. After hybridization, cells were washed first in 1:1 formamide:2xSSC,









then in 2xSSC before being re-coverslipped in mountant containing DAPI (Vector,

Burlingame, CA).

2.3 Results

2.3.1 BMDC Cultures Can Be Derived from the Bone Marrow of Adult Mice

We established viable cultures of BMDCs, from the tibia and femur of adult mice

according to the adhesive property of mesenchymal stem cells (MSC) described before

(Goshima et al., 1991a; Friedenstein, 1995). About 30 days after plating, the appearance

of fast growing BMDC with fibroblast-like morphology can be observed in amid of slow

growing, round or polygonal cell types that appeared firstly in the initial bone marrow

dissociates culture. At around day 45, stable fibroblast-like BMDC lines can be achieved

(Fig. 2-1A). Besides the morphological change, we also observed GFP silencing

concomitantly in all of the three GFP transgenic mice we used to establish BMDCs,

indicating there was also a change of gene expression profile in the process of

establishing BMDC from its original cell types in the bone marrow (Fig. 2-1A).

To characterize the BMDCs, we performed flow cytometry analysis using a

battery of markers for characterizing mesenchymal stem cells (Fig. 2-1B). We found that

BMDCs are negative for the hematopoietic markers CD34, CD45, and Macl; negative

for the stem cell marker c-kit, but partially positive (18.6%) for the stem cell marker

Scal; negative for the endothelial marker CD31, partially positive for CD105 (19.1%),

and 97% positive for CD9. These results, along with morphological characteristics,

indicate that BMDCs are mesenchymal stem cells, and are similar to the MAPCs isolated

by Jiang et al. (2002).









2.3.2 BMDC Cultures Normally Express Neural Markers

To evaluate the neural property, we tested the BMDCs on the expression of

several neural specific proteins, including the neural progenitor marker nestin. We found

that BMDCs are highly positive for nestin (close to 100%); partially positive for several

neuron specific proteins, including 3III tubulin (12%), neurofilament-M (NFM; 13.2%)

and Map2ab (9.6%); negative for PSA-NCAM, a surface protein expressed on migratory

neuroblasts; partially positively for the astrocyte specific protein, S100 (15%), but

negative for the astrocyte intermediate filament proteins, GFAP and Vimentin (Fig. 2-

2B).

2.3.3 Astrocyte, but not Neuronal Proteins, Are Upregulated by cAMP Elevation

Several studies have used cytoplasmic elevation of cAMP to induce neural

differentiation from mesenchymal stem cells (Deng et al., 2001; Jori et al., 2004;

Lambeng et al., 1999; Lopez-Toledano et al., 2004). To test the same protocol on our

BMDCs, we treated the cells with 0.5mM IBMX/lmM dbcAMP. We found that, as

reported (Deng et al., 2001), cytoplasmic cAMP elevation does induce a significant

morphological change of BMDCs, where the cells become neural-like with rounded

somas, and long processes. However, we saw no evidence for a change in the expression

of most neural markers before and after the treatment (Fig. 2-2B). Furthermore, when we

treated NIH 3T3 cells with the same protocol, we observed similar morphological change

without detecting neural marker expression (Fig. 2-2B,C). A significant upregulation of

GFAP was, however, observed after treatment with dbcAMP/IBMX (Fig. 2-3A). The

enhanced expression of GFAP was confirmed using both in situ hybridization with









digoxinin-labeled GFAP riboprobes (Fig. 2-3B), and western immuno-blotting (Fig. 2-

3C).

2.3.4 Single-Cell BMDC Clones Show Plasticity by Generating both Neuronal and
Astrocytic Lineages

We cloned BMDCs from single cells by limiting dilution in conditioned medium.

Single cell-derived BMDCs recapitulated the cell surface marker expression profile of

their ancestor population by flow ctyometry analysis. When we tested the cloned BMDCs

with NFM immunostaining, we did not observe any positivity in clones of smaller than

five cells (n=10), but did see labeling with this marker in clones often or more cells

(n=13) (Fig. 2-4A). This may imply that there is a symmetric and asymmetric division in

BMDCs that is cell density or division number dependent (See working model in Figure

4Ab, and Discussion). Furthermore, when we performed double immunostaining, we

found that both neuronal and astrocyte cells existed in the cloned population (Fig. 2-4B).

2.3.5 BMDCs Exhibit Neural Differentiation upon Grafting into the Neonatal Mouse
Brain

To test the in vivo trans-differentiation capacity of BMDCs, we grafted the cells

into the neonatal mouse brain. We observed a migration of BMDCs along the rostral

migratory stream (RMS) from the lateral ventricle to the olfactory bulb. While most of

the grafted cells maintained a spindle-like appearance similar to their in vitro

morphology, some cells exhibited morphological characteristics of astroctyes around the

ventricle, and penetrated into the overlying parenchyma (Fig. 2-5A). Immunostaining

shows that these cells are positive for GFAP antibody (Fig. 2-5B). A significant number

of cells within the RMS were immunopositive for the neuronal marker 3III tubulin (Fig.

2-5B), and more significantly, we consistently observed a small number of BMDCs









possessing typical characteristics of granule cells within the granule cell layer (GCL) of

the olfactory bulb (Fig. 2-5A). Immunolabeling reveals that these cells are positive for

PSA-NCAM (Fig. 2-5B). To confirm the expression of neuronal proteins by these donor

BMDCs, we used confocal laser scanning microscopy to verify that the expression of the

proteins are indeed in the same focal layers of the Dil used to label the cells (Fig. 2-6). To

control for the possible leakage of the Dil, we grafted identically-labeled NIH3T3 cells

into the ventricles of a different set of animals. In these cases, we only observed labeled

cells within the subependymal zone of the lateral ventricle, near the site of injection

where the cells where grafted (n=4).

2.3.6 Chromosome Analysis Reveals no Evidence of BMDC Fusion

To evaluate the possibility that cell fusion between donor BMDC and

differentiated host cells is responsible for the co-expression of neuronal proteins and Dil,

we grafted Dil-labeled, male BMDCs into neonatal male mouse brain, and analyzed

tissue sections for the presence of cells with more than one Y-chromosome. We

optimized the Y-chromosome painting such that a high efficiency of detection (>99%)

was achieved in cells with an intact nucleus, using Dapi counterstaining and confocal

microscopy. From analysis of three different animals, we observed that all Dil labeled

cells contain only one Y-chromosome, as shown in Figure 2-8. We therefore conclude

that there is no sign of fusion of grafted cells.

2.4 Conclusion and Discussion

We have demonstrated that BMDCs from adult mice constitutively express

several neural markers in vitro under standard culture conditions. The neural induction

protocol of applying dbcAMP/IBMX to elevate the cytoplasmic cAMP does not









significantly result in the upregulation of neural specific proteins from their uninduced

state in BMDCs. Single-cell BMDC clones undergo symmetric and asymmetric division

with or without induction, generating neuronal marker expressing cell, and inducible

astrocytic marker-expressing cells in vitro. Non-fused BMDCs also have the capacity to

generate neurons and astrocytes upon grafting into the neonatal mouse brain. These cells

seemingly behave normally, as donor cells are seen to migrate along the RMS to the

olfactory bulb, where they differentiate into granule cells.

We believe that the BMDC we described in the present study is equivalent to the

MSC; however, we are reluctant to give it the name because of the current incomplete

characterization of MSCs. The surface marker expression profile accords well with

previous studies (Colter et al., 2000; Javazon et al., 2001), and the absence of CD34,

CD45, and CD1 Ib has been widely accepted as the major difference between MSCs' and

hematopoietic stem cells (HSC) (Colter et al., 2000). The expression of some endothelial

cell markers, including CD105 and CD9, has also been reported in MSCs (Tanio et al.,

1999; Hayashi et al., 2000; Jones et al., 2002; Sun et al., 2003). While the expression of

the stem cell marker Scal mirrors other reports (Jiang et al., 2002), the lack of c-kit

expression by our BMDCs is anomalous (Sun et al., 2003). This discrepancy may reflect

the loose definition of MSCs currently in vogue. While there is a wide range of surface

markers that have been tested to characterize MSCs, there is currently no single set of

phenotypic markers used to unequivocally identify a MSC. As a result, there may be

subtypes of MSCs that differ slightly from each other, and this may account for the

variation of marker expression, as well as the inconsistent results regarding the trans-

differentiation of MSCs from different laboratories. The use of FBS as the main, and









only, source for growth factors to establish the cell population has been adapted since the

pioneering work of Petrakova (1963). It is simple and effective, but the lack of positive

selection markers -as used for hematopoietic stem cells- may result in the inclusion of

undefined cell types, which may underlie the interlaboratory variability seen with these

types of protocols. We noticed that BMDCs in culture have an irregular growth rate at

different periods of the culture (data not shown). We also noticed that BMDCs derived

from GFP transgenic mouse lose the GFP expression during the course of culture.

The constitutive expression of neural specific proteins demonstrated by our

BMDCs casts doubt on some previously reported protocols that claim neural induction,

but fail to show the pre-induction level of neural specific proteins. However, this

clarification did not weaken the recognition of MSC as a genuine stem cell type, but

rather strengthen it by showing its vigorous, spontaneous neural differentiation property.

The neural property exhibited by BMDCs may be explained by the neural propensity of

stem cells reflected in the development of nervous system during embryogenesis. It is

generally believed that unspecified ectoderm cells differentiate into neural lineage by

default unless inhibited by ventralizing factors, such as bone morphogenetic protein-4

(BMP4) (Wilson & Hemmati-Brivanlou, 1995). So-called neuralizing factors such as

noggin, chordin, and follistatin promote neuro-ectoderm specification by inhibiting

BMP4 (Streit & Stem, 1999). The embryonic stem cell also shows active neural

differentiation unless inhibited by BMP in vitro (Hemmati-Brivanlou & Melton, 1997;

Finley et al., 1999). Therefore, it is not surprising that BMDCs, as multipotent stem cells,

may partially exhibit a neural property in their default state of differentiation in vitro,

where there are no pro-mesoderm inhibitors such as BMP4. The expression of some









neural markers by uninduced MSCs is a matter of some controversy. Woodbury, et al.

(Woodbury et al., 2000) did not observe any neural specific protein expression except

neuron-specific enolase (NSE). Sanchez-Ramos, et al. (Sanchez-Ramos et al., 2000)

reported low levels ofNeuN, nestin and GFAP expression detectable with

immunocytochemistry. Deng et al. (2001) have previously reported expression of

vimentin, Maplb and P-III tubulin, but no NFM, GFAP and S-100. A more recent paper

by Tondreau, et al. (2004) corroborates our finding by reporting significant expression of

several neuronal markers, including nestin, P-III tubulin, Map2, and tyrosine hydroxylase

(TH) flow cytometry analysis using non-induced MSCs. As pointed out above, the

variation in MSC subtypes may be due to differing isolation and culturing protocols from

different laboratories (Javazon et al., 2004).

Despite causing a vigorous neuron-like morphological change, we have

demonstrated that the use of the dbcAMP/IBMX induction protocol does not change the

neuron-specific protein expression profile in BMDCs. Furthermore, we have also

observed a rapid and dramatic morphological change in NIH3T3, similar to that of

BMDCs upon dbcAMP/IBMX treatment, but without expression of neuronal marker. In

the initial paper describing the protocol (Deng et al., 2001), Deng et al. found no

expression of NFM, which differs from our results, but they did report equal levels of

MAPlb and PIII tubulin with and without induction, as we have found in our BMDCs.

Tondreau, et al. (Tondreau et al., 2004) recently reported an over 90% unchanged nestin

expression pre- and post-induction, as we have demonstrated, but reported a decreased

PIII tubulin expression level from over 90% to about 30% after ten days of treatment

with lower concentration of dbcAMP (5[LM). Our results, together with previous reports,









suggest that the dramatic neuron-like morphological transformation of MSCs under

dbcAMP/IBMX treatment is an unreliable indicator of neuronalization, supporting a

previous analysis of DMSO/BHA induction protocol reported by Neuhuber, et al. (2004)

and Lu, et al. (2004).

Along with many other inconsistent reports of neural specific protein expression

with or without induction in MSCs, the expression of GFAP has also been controversial.

Despite the early findings of MSC trans-differentiation into GFAP expressing astrocyte

in vitro and in vivo (Sanchez-Ramos et al., 2000; Jiang et al., 2002; Zhao et al., 2002),

Wehner, et al. (2003) reported that there was no GFAP expression from MSCs derived

from a mouse strain carrying a GFP expression vector driven by the GFAP promoter

cassette. The original paper that described the cytoplasmic cAMP elevation to induce

neural differentiation from MSCs did not detect GFAP expression before or after the

treatment (Deng et al., 2001), and this partially supported Wehner, et al. However, our

data from immunolabeling, in situ hybridization as well as western blotting unequivocally

demonstrates that GFAP expression is up-regulated by cytoplasmic cAMP elevation. In

agreement with this, Tondreau, et al. (2004) also report the up-regulation by MSCs of

GFAP following prolonged exposure to a low concentration of dbcAMP/IBMX. Besides

the demonstration of GFAP expression in vitro, we also observed BMDC differentiation

into GFAP-expressing cells following transplantation into the neonatal mouse brain. As

we showed in Fig. 1A, BMDC undergo GFP gene silencing during the establishment of

the long-term culturing population. It, therefore, may be speculated that the gene-

silencing event could have interfered with the GFP expression cassette in the previous









study of Wehner, et al. (2003), and thus resulted in a failure to detect GFAP expression in

MSCs.

We have shown that clonal BMDC cultures give rise to populations that are

identical to the parent population. These clones exhibit multipotency by differentiating

into cells of neuronal and astrocytic lineages. Pittenger, et al. (1999) reported a similar

clonal property of bone marrow-derived multipotent human MSCs in differentiating into

adipogenic, chondrogenic and osteogenic lineage. Based on the immunophenotyping of

BMDC clones of different sizes, we propose a working model that may reflect the

symmetric and asymmetric cell division pattern in the BMDCs (Fig 4Ab). We suggest

that at least three cell types exist in the BMDC population, each with different potency:

multipotent, neuron restricted, and astrocyte restricted. The fact that we did not observe

neural marker expression in the small clones (<5 cells) may mean that only multipotent

cells, not expressing neural markers, can renew themselves by symmetric division, while

neuron restricted and astrocyte restricted cells do not survive or proliferate under clonal

culture conditions. The fact that we start to observe neural-specific protein expression in

larger clones (>10 cells) may mean that there is a cell division number, or cell density

that triggers asymmetric division that generates cells with restricted potentials.

Although the neural differentiation capability of MSCs in vitro has been widely

explored, the in vivo response of this cell type upon direct engraftment into the brain has

not been adequately assessed. Our finding that BMDCs integrate into the postnatal

neurogenic pathway of the RMS/olfactory bulb system by migrating appropriately and

differentiating into olfactory granule cells supports the conclusion that the bone marrow

derived adult stem cell indeed possesses neural trans-differentiation capability under the









influence of environment cues from the brain. The fact that BMDCs can migrate along

RMS, and differentiate into mature neurons at a distant site may also imply their

therapeutic potential in acting as neural progenitor cells and replacing lost neural tissue

after injuries. Munoz-Elias et al. (2004) reported a wide scope of migration of MSCs

after transplanted into the embryonic rat brain, and transplanted cells appeared to express

the neuron marker calbindin at the olfactory bulb. Zhao, et al. (2002) demonstrated that

human MSCs expressed astrocytic markers and some neuronal markers after grafting to

the site of ischemic injury in rat brains. Further work in various injury models, designed

to fully assess the ability of BMDCs to functionally integrate into neural circuitry, will

determine the potential therapeutic value of these cells in the treatment of neurological

injury and disease.

In summary, we have demonstrated that BMDC, a MSC cell type, possesses

neural progenitor-like property by expressing neuron- and astrocyte- specific proteins

spontaneously or inducibly. Although the previously reported neural induction protocol

using dbcAMP/IBMX does not seem to promote neuronal differentiation in BMDCs, it

may be able to drive an astrocyte differentiation by showing a GFAP up-regulation.

However, the neuron-like morphological transformation under the protocol may not be a

reliable criterion for evaluating neuronalzation, due to the fact the NIH3T3 also acquired

identical change without neuron-specific protein expression. We have also used confocal

scanning imagine system, and Y-chromosome painting techniques to demonstrate,

unequivocally, that neural trans-differentiation from stem cell of mesenchymal origin

does exist, and may be able to develop into the ideal cell type for cell-replacement

therapy in the future.









































o 041118,002
c-Kit

8 M1

i1c io1 iF ,o3 io4
FL1-HFITG


CD105
S-
SM1
,:. P,-T 1


BMDC culture and characterization. Wild type and GFP transgenic C57/B6
mice of 8 weeks old have been used to isolate BMDCs. A) The establishment
of long-term culturable BMDC. There is a clear transition from short
polygonal to long fibroblast-like morphology in BMDCs during the
establishment stage. The bottom pictures are the GFP fluorescent imagines of
the same picture above, showing the loss of GFP expression when fibroblast-
like BMDCs appear in the culture while the unchanged cells retain the GFP
expression. B) The flow cytometry analysis of BMDCs on the cell surface
antigen characteristics. BMDCs of over 50 passages isolated from wt C57/B6
mice were incubated with different antibodies. The BMDCs are completely
negative for CD34, CD45, CD 1 lb, CD31 and c-kit; partially positive for
Scal (18.7%) and CD105 (19.1%); and strongly positive for CD9 (97.5%).
The red line indicate IgG isotype control corresponding to the antibodies in
which they are generated. The green lines are counts of cell population that is
positive for the antibody indicated in the each individual figure. Ml is the
gating.


Figure 2-1.






























Neural Specific
Protein


BMDC

CM DbcAMP/IBMX


NIH3T3


CM DbcAMP/IBMX


nestin
betalll Tubulin
NFM
Map2
PSA-NCAM
GFAP
S100
Vimentin


C m


>99%
12.0%
13.2%
9.6%
0
0
15.0%
0


>99%
11.4%
13.7%
8.9%
0
10.3%
15.5%
0


0
0
0
14.5%
0
0
0
0


0
0
0
16.5%
0
0
0
0


BMDCs express neuron specific proteins spontaneously under normal
culture condition. A) Immunocyto-labeling of BMDCs using anti- nestin,
PIII tubulin, Map2ab, and NFM antibodies. B) The quantification of neural
marker expression on BMDCs and NIH3T3 pre- and post dbcAMP/IBMX
treatment for two days. Numbers in the table is the portion (in percentages)
of cells positive for each antibody labeling. C) NIH3T3 acquisition of
neuronal morphology after treated with dbcAMP/IBMX for two days.


Figure 2-2.


Nestin







MAP2


P III Tub




















In Situ GFAPmRNA

*' c: ^


.


r 4- GFA
P


4-- Actin


B NT 24hr 48hr 72hr 96hr


Cytoplasmic cAMP elevation promote GFAP expression in BMDCs.
A) GFAP immunolabeling of BMDCs pre- and post- dbcAMP/
IBMX treatment. B) In situ hybridization in BMDCs treated with
dbcAMP/IBMX for two days. The inset indicates the same cell
(arrow) is also labeled with GFAP immuno-fluorescence (green).
Noticed that not every in situ labeled cell is positive for GFAP
immunolabeling; this is likely caused by the harsh treatment of in situ
hybridization procedure. C) Western immuno-blotting using GFAP
monoclonal antibody in BMDC treated by dbcAMP/IBMX. Actin
antibody has been used as internal control. B- Brain tissue as positive
control; NT- no treatment; hr- hours of treatment.


aI


Figure 2-3.


no cAMP/


w/ cAMP/








00
to




symmetri65

asymmetric
O0
0^


Single cell cloned BMDCs exhibit mutlipotency by generating progenies
of different property through symmetric and asymmetric division. A)
Cloned BMDCs exhibit symmetric and asymmetric division, a,
immunolabelling of cloned BMDCs with anti-NFM antibody. Top:
representative imagine of clones around five cells; no NFM positive cells
are observed in these clones (n=10). Bottom: representative imagine of
clones with more than ten cells; small portion of the cells start to express
NFM as showing in the inset in these clones (n=13). b, a working model
of the symmetric and asymmetric division of BMDCs: at least three
different cell types existed in the original population, primitive cell with
full potential (clear circle), neuron potential (filled circle denoted with
N), and astrocyte inducible (filled circle denoted with A). B) Double
immuno-labeling of BMDCs treated with dbcAMP/IBMX using
antibodies against neuronal and astrocyte specific proteins. The
expression of GFAP is labeled with green fluorescence; P3II tubulin and
NFM are labeled with red fluorescence; blue fluorescence is Dapi stain
for nucleus.


Figure 2-4.








A


SVZ







OLB


BMDCs differentiate into neurons and astrocytes upon transplantation
into the lateral ventricle of the neonatal mouse brain. A) Transplanted
Dil-labeled BMDCs (red) exhibit morphological characteristics of
astrocyte at the sub-ventricular zone (SVZ; top), and typical granule cell
at the granule cell layer (GCL) of olfactory bulb (bottom). Picture at
right shows the enlarged area of the framed inset at the. B) BMDCs (red)
show immnuo-phenotypes of neurons and astrocyte in the brain. The
neural specific protein 3III tubulin, PSA-NCAM, and GFAP are
immuno-labeled with green fluorescence. Insets in each picture show
individual channel.


Figure 2-5.


pill
Tub/


PSA-NCAM/


























B


Confocal scanning microscopic imagines demonstrate the
immuno-labeling of BMDCs with neuronal specific proteins.
Confocal imaging analysis of BMDCs (Dil; red) immuno-labeled
with PSA-NCAM (A) and PIII tubulin (B) (FITC; green). Left:
merged confocal imagine in the GCL (A) and RMS (B) of
olfactory bulb. Middle: separate channel of the cell indicated on
the left picture, showing the green immuno-fluorescence labeling
fall into the same plate of the BMDC (red); right: the side-view
of the confocal imagine of the same cell on the left, showing the
BMDC (red) site on the top of the tissue section, and it has been
truncated at the mid-plane of the cell.


Figure 2-6.









A














B



xu














Figure 2-7.


Confocal scanning microscopic imagine evaluation of cell fusion
between male animal derived BMDCs and endogenous cells of
male recipient mouse in the brain. A) Montage picture of confocal
scanning imagines from two cells located at RMS and SVZ
separately. There is only one Y-chromosome (FITC; green) within
the cell boundary (Dil; red). Inset shows the overview of the cell
location (arrowhead). B) Three-dimensional confocal analysis of
Y-chromomsome locality in the nucleus of a BMDC shown in the
left picture of A. X, Y and Z are the cross-section planes taken
from three different angles indicated by x, y and z (arrowhead and
gray lines); a, b and c are high magnification imagines of insets in
X, Y and Z planes. The white dotted lines in a, b and c delineate
the nucleus boundaries from different angle.















CHAPTER 3
NEURAL TRANSDIFFERENTIATION OF MOUSE
HEPATIC OVAL CELL IN VIVO

3.1 Background and Introduction:

Stem cells have recently been characterized in a variety of tissues of adult

animals, including liver, blood, skin, brain, and heart (Wetts & Fraser, 1988; Spangrude

et al., 1988; Jones et al., 1995; Petersen, 2001; Hughes, 2002). Their plasticity, as

demonstrated by the multipotency to differentiate into mature, tissue-specific cell types,

may offer new therapeutic tools for a variety of diseases. Hepatic oval cells (HOCs) are

considered the stem cells of the liver, having been shown to be capable of giving rise

both to hepatocytes and bile duct cells (Petersen et al., 1998a). The majority of HOC

studies have been conducted in various rat models; however, a mouse model was recently

developed which allows for the isolation of large quantities of HOCs. This model

incorporates the chemical 3,5-diethoxycarbonyl-1,4-dihydrocollidin (DDC) at a 0.1%

concentration in the normal chow (Preisegger et al., 1999). Development of this mouse

model also led to the characterization of an antibody -termed A6- that recognizes a

specific epitope on mouse HOCs (Factor et al., 1990). In conjunction with this new

mouse oval cell model and the two step liver perfusion technique (Seglen, 1979),

Petersen et al. have developed a enrichment protocol which allow us to isolate a greater

than 90% pure Sca-l+ oval cell population from the DDC treated mouse liver (Petersen et

al., 2003).









Trans-differentiation -the ability of stem cells from one tissue to generate cells

characteristic of an entirely different tissue- is of interest not only because in it lies the

true answer to the multipotent capabilities of the adult "stem" cells, but also because it

may provide an easily accessible, non-controversial source of cells for future autologous

transplantation therapies. The use of stem cell therapy in treating neurodegenerative

disorders has attracted considerable attention lately. The trans-differentiation of bone

marrow-derived stem cells (BMSC) into neural cell types has been explored extensively,

with several groups reporting that these stem cells can trans-differentiate into neurons,

astrocytes and microglia (Azizi et al., 1998; Kopen et al., 1999; Brazelton et al., 2000).

The trans-differentiation of BMSC into microglia was thought to recapitulate microglia

ontogeny (Rio-Hortega del, 1932; Eglitis & Mezey, 1997); however, the functionality of

these trans-differentiated microglia cells has not been reported thus far.

Yang et al. have recently reported that oval cells can trans-differentiate into

insulin-producing pancreatic cells in culture when challenged with high glucose (Yang et

al., 2002). In order to further characterize the HOC and its potential plasticity, we

transplanted isolated HOCs derived from GFP transgenic mice- into the lateral

ventricles of neonatal wild-type mouse brain, according to a model of intracerebral

transplantation recently described for assaying stem cell behaviors of neural cells (Zheng

et al., 2002). We asked whether the oval cells could trans-differentiate into cells of a

neural phenotype.









3.2 Materials and Methods

3.2.1 Hepatic Oval Cell Induction and Enrichment from Mouse Liver

According to the protocol established by Preisegger et al. (1999), we fed adult

C57BL6 /GFP+/+ transgenic mice a normal diet supplemented with 0.1% DDC (BioServe,

Frenchtown NJ) for six weeks. To isolate HOCs, we performed a two step liver perfusion

according to Seglen et al. (1979), collecting the non-parenchyma fraction (NPC) using

gradient centrifugation. We incubated the NPC fraction with the Sca-1 antibody

conjugated to micro-magnetic beads, processing the cell suspension through magnetic

columns to enrich the oval cell population positive for Sca-1, the stem cell antigen-1

(MACs, Miltenyi Biotec).

3.2.2 FACs Analysis for Purity on MACs Sorted Sca-1+ Oval Cells

Wild-type Sca-1 and Sca-1- oval cells, obtained from MACs magnetic sorting,

were incubated with Fluorescein Isothiocyanate (FITC)-Sca-1 and FITC-rat IgG2a

antibodies (PharMingen) (1:500) for 30mins at room temperature. Cells were then

pelleted by centrifugation at 200g and washed twice in PBS to eliminate unbound

antibodies. Approximately 106cells/ml-cell suspension was run through a flow cytometer

(CELLQuest, Becton Dickinson FACScan).

3.2.3 Immunocytochemistry of MACs Sorted Oval Cells

Wild-type Sca-1 oval cells, obtained from MACs magnetic cell sorter, were

cytocentrifuged to slides, fixed with 4% paraformaldehyde in PBS, and examined for

mouse oval cell markers as described (Petersen et al., 1998a). A6 antibody (a gift from

Dr. Valentina Factor of the NIH) (1:20) and anti-a-fetal protein (AFP) (Santa Cruz

Biotechnology) (1:200) were used for the immuno-characterization of oval cells.









3.2.4 Culture of Mouse Oval Cells

Approximately 106 Sca-l+ mouse oval cells, obtained from MACs cell sorting

were cultured in a 35mm culture dish (Costar, Coming In.) in HOC culture medium (89%

Iscove's Modified Dulbecco's Medium, 10% FBS, 1% Insulin, 1000 U/ml of leukemia

inhibitory factor, 20ng/ml granulocyte macrophage colony stimulating factor, 100ng/ml

each of stem cell factor, interleukin-3 and interleukin-6).

3.2.5 Cell Transplantation into Neonatal Mouse Brain

Sca-1 MACs sorted primary dissociates of GFP+ oval cells were transplanted into

the lateral ventricle of postnatal day 1 wild-type C57BL6 mice within the first 24 hours

after birth. Briefly, newborn pups were anesthetized by hypothermia and placed in a clay

mold. The head was trans-illuminated under a dissection microscope, and a Hamilton

syringe with a beveled tip was lowered through the scalp and skull immediately anterior

to bregma. Approximately 2.5x105 GFP HOCs in l[l volume of Dulbecco's Modified

Eagle Medium/F 12 (DMEM/F 12, Gibco) were then slowly pressure-injected into the left

lateral ventricle. Immediately after injection, pups were warmed in a 370C incubator, and

returned to the mother after approximately 30 min. At ten days post-transplantation, mice

were sacrificed with an overdose of Avertin, and perfused transcardially with 4%

paraformaldehyde in PBS. The brain tissue was excised, post-fixed overnight in

perfusate, and sectioned through the coronal plane into 40[tm slices with a vibratome.

3.2.6 In vivo Phagocytosis Assay

An in vivo phagocytosis assay of microglia was performed by adding fluorescent

latex microbeads to the graft bolus immediately prior to transplantation. Latex

microbeads (Sigma L-0530, 0.5[tm in diameter, fluorescent blue conjugated) were added









into the cell suspension (-2.5 x 105 cells/[tl in DMEM/F 12) at a concentration of 15%

(0.15[tl bead solution/0.85ul cell suspension). One microliter of cell/bead mixture was

injected into the lateral ventricle of newborn pup brains as described above. Hosts were

then allowed to survive for ten days before the brains were fixed and processed for

immuno-characterization.

3.2.7 Immunolabeling of Brain Sections

Forebrains were cut with a vibratome into 40[tm coronal sections exhaustively,

and processed free-floating for immuno-fluorescence. After blocking in PBS with 10%

goat serum, sections were incubated overnight at 40C in primary antibodies directed

against the following proteins: nestin, a marker of neuronal stem and progenitor cells

(Developmental Studies Hybridoma Bank, University of Iowa; 1:250); the astrocyte-

specific markers glial fibrillary acidic protein (GFAP; from Gerry Shaw University of

Florida,1:200), and S1003 (Sigma; 1:250); the microglia marker CD lb (Serotec; 1:200);

and the neuronal markers neurofilament medium subunit (NFM; from Gerry Shaw

University of Florida, 1:500), a-internexin (a-IN; from Gerry Shaw University of

Florida,1:200), and MAP2ab (Sigma; 1:500). The tissues were then washed in PBS,

followed by incubation in appropriate secondary antibodies conjugated to R-

phycoerythrin (R-PE) (Molecular Probes) at room temperature for lhr. After a final wash

in PBS, brain slices were mounted onto glass slides, viewed, and counted with a

fluorescence microscope.

3.2.8 Quantification of Grafted Cells

Cell counting was performed under a fluorescence microscope (Olympus BX51).

Every sixth section through the forebrain was selected for counting of grafted cells. A









cell was counted if the cell body could be identified. Total number of cells was then

obtained by multiplying the counted result by a factor of six. The standard deviations

were obtained using Microsoft Office Excel statistics software.

3.3 Results

3.3.1 Hepatic Oval Cell Enrichment with Sca-1 Antibody

In order to verify the purity obtained with our sorting method, we performed

FACs analysis on MACs sorted Sca-1 cells. After MACs sorting, only 20% of the Sca-1

epitopes were occupied by the Sca-1 conjugated magnetic beads, which allowed us to use

the remaining epitopes to perform the FACs analysis for purity. Figure 1A and B

represent histograms of FACs analysis showing a distinct population of cells. MACs

sorted cells are over 90% positive for Sca-1 antibody (Fig. 3-1A), while the flow-through

cells were Sca-1 negative (Fig. 3-1B). Immunocytochemistry revealed that the Sca-1+,

MACs sorted cell were also positive for A6 and AFP- known markers for mouse oval

cells (Fig. 3-1C). When cultured in vitro, HOCs started to proliferate in about 5 days, and

formed colonies after about two weeks (Fig. 3-1D). The HOCs in culture appeared to be a

homogeneous and undifferentiated cell population.

3.3.2 Hepatic Oval Cells Survive and Differentiate in the Neonatal Mouse Brain

Ten days after transplantation of HOCs, intensely fluorescent GFP+ cells were

seen within the host brain. The majority of surviving donor cells was located in

periventricular areas in all of the mice with successful cell delivery (Fig. 3-2A, B and C).

GFP+ cells were most frequently observed superficially along the walls of the lateral

ventricle, but numerous grafted cells were also found to migrate laterally within the white

matter of the corpus callosum (data not shown). At points along the ventricular wall,









grafted cells penetrated into the parenchyma of the brain, a phenomenon previously

described following intraventricular transplantation of multipotent astrocytes (Zheng et

al., 2002). The survival rate of the transplanted HOCs averaged 0.56% (SD=0.36%, n=9)

of the total injected cells (Table 1). Approximately 11.5% (SD=2.5%, n=3) of grafted

cells remained undifferentiated, and were characterized by a small, rounded, non-process

bearing morphology. The remainder displayed varying degrees of differentiation and

process extension. Seven of 36 animals receiving transplants did not contain any

detectable donor cells.

3.3.3 Grafted Hepatic Oval Cells Express Neural Antigens

The filament protein nestin has frequently been considered indicative of neural

progenitor cells (Lendahl et al., 1990). We found that 22.1% (SD=11.6%, n=4) of

surviving donor cells were immuno-positive for nestin (Fig. 3-3A, Table2), suggesting

that HOCs may be able to assume the phenotype of early neural lineage. Of the donor

cells that differentiated, the majority exhibited a typical amoeboid or ramified microglia

morphology (Fig. 2D-G). A smaller fraction displayed the stellate, process-rich

characteristics of astrocyte morphology (Fig. 3-2H-K). Immuno-labeling with the Mac-1

antibody, directed against the CD1 Ib epitope characteristic of macrophages, showed that

60.6% (SD=10.5%, n=3) of the GFP+ donor cells express this microglial marker (Fig. 4A

and B, Table 2). Additionally, 34.7% (SD=9.0%, n=4) and 27.2% (SD=5.7%, n=3) of

donor cells express the astrocyte specific proteins GFAP and S100, respectively (Fig. 3-

3B-D, Table 2). Many of the cells expressing astrocyte proteins were located within the

corpus callosum, and their processes could be seen intertwining with the processes of

native astrocytes.









A small number of donor cells were also seen to be immunopositive for neuron

specific markers. 6.5% (SD=1.3%, n=3) of the grafted cells expressed the neuronal

marker NF-M (Fig. 3-3E, Table 3-2), and a comparable number expressed ca-IN (Fig. 3-

3F). A considerably larger percentage, 19.9% (SD=2.5%, n=3), of donor cells were

immuno-positive for MAP2 (Fig. 3-3G, Table 3-2). Although these grafted cells do have

an antigenic profile consistent with neurons, suggesting that HOCs can generate cells

belonging to the neuronal lineage, their morphologies are ambiguous and do not resemble

typical in vitro or in vivo neurons.

3.3.4 Donor-Derived Cells Have Functional Properties of Microglia

Grafted cells with the antigenic profile of microglia also display appropriate

phagocytic activity, since co-transplanted fluorescent microbeads were incorporated into

their cytoplasm at high efficiency (Fig. 3-4C, Table 3-3). 58.7% of grafted GFP+ cells, as

well as numerous indigenous microglia were seen to incorporate microbeads, and these

cells were subsequently shown to express the CD1 lb antigen, characteristic of

macrophages, including brain microglia.

3.4 Conclusion and Discussion

Our results indicate that a portion of the HOCs from adult mouse liver can survive

transplantation to the neonatal mouse brain, and can differentiate into cells that share

certain phenotypic characteristics with neurons, astrocytes, and microglia. Furthermore,

donor cells that express microglial antigens can also display functional properties

characteristic of microglia, i.e. active phagocytosis.

We believe that our quantification of donor cell survival and differentiation

characteristics is extremely conservative, in light of the fact that we have observed that









HOCs acutely isolated from the liver of the GFP transgenic C57BL6 have largely

variable levels of GFP expression, with approximately 50% of them not expressing

detectable GFP. We have also observed that long-term cultured GFP+ HOCs gradually

lose GFP expression over a three-month period (data not shown). Therefore, the actual

survival rate of grafted HOCs in our study may likely to be higher than that we have

quantified. We also observed a large variation of HOC survival between different

animals. Survival ranged from 0% (7 of 36 animals had no detectable GFP+ cells) to

1.0%, with a standard deviation of 0.36%. This inconsistency is likely the result of

technical failure during the transplant procedure. For instance, the lumen of the

transplant needle can become fully or partially blocked during the penetration through the

scalp and skull, resulting in reduced numbers of cells being delivered. Additionally, in

some animals we observed extrusion of the graft bolus up the needle tract, which again

would greatly decrease the delivery of cells to the ventricle.

The fact that a percentage of donor cells was seen to be immunopositive for nestin

is provocative since this protein has been considered to be a marker of primitive neural

stem/progenitor cells (Lendahl et al., 1990), and it is reasonable to suggest that trans-

differentiation from hepatic to brain lineage would involve a transition through an early

neural stage.

The adoption of microglial phenotype by grafted HOCs is clearly the most

frequent occurrence in our transplantation paradigm, and seems intuitively consistent

given the close relationship among hematopoietic cells, liver cells, and microglia. It has

been shown that hematopoietic stem cells and HOCs share considerable antigenicity, and

donor hematopoietic stem cells can contribute to liver regeneration (Omori et al., 1997a;









Omori et al., 1997b; Petersen et al., 1998a; Petersen et al., 1999). Furthermore, it is

generally accepted that most brain microglia originate from the hematopoietic system

(Rio-Hortega del, 1932; Eglitis & Mezey, 1997).

Recently, studies describing the trans-differentiation of bone marrow and other

types of stem cell into neurons have come under criticism by Holden et al. (Holden &

Vogel, 2002), with one of the concerns being the lack of complete neuron morphology.

Previously reported trans-differentiated cells did not display long process-bearing

morphology, with axons and dendrites. Morphological characteristics are still the

primary criteria for assessing the neuron generating potential of a differentiating

progenitor cell, since it is an integral part of neuronal function to efficiently and remotely

transmit electric signals. Another weakness of these reports is the lack of functionality of

the trans-differentiated cells. Unlike the use of stem cells to reconstitute the full function

of an immune-deprived blood system in rodents, the functional assay for a single neuron

in the brain is much more difficult. We have shown that a small portion of oval cells,

which have been transplanted into the neonatal mouse brain express some neuronal

markers and start to show limited neuron morphology. While additional morphological

and electrophysiological data are required to definitively prove trans-differentiation, our

results strongly indicate that liver-derived HOCs can, under certain environmental

influences, adopt some characteristics of neuronal cells. The vastly greater number of

MAP2 labeled donor cells could indicate that this marker is associated with neurons in a

different stage of differentiation, or more likely reflects the fact that the Map-2 antigen

can be expressed by non-neuronal cells under certain circumstances, such as brain injury









which certainly occurs in our transplants due to the penetration of the needle (Lin &

Matesic, 1994).

The origin of the hepatic oval cells is still a controversial issue. A precursor cell

type is believed to exist that generates oval cells when certain liver injury occurs. The

traditional view holds that there is an endoderm-derived liver stem cell, possibly in the

Canal of Hering (Theise et al., 1999). While another view is supported by recent reports

showing that circulating stem cells originating from the bone marrow can contribute to

the precursors of oval cells in the liver (Petersen et al., 1999). The second view is

supported by the immunochemical characteristics that oval cells and hematopoietic stem

cells have in common. Oval cells express many hematopoietic stem cell markers, such as

Thyl, c-kit, and CD34 in the rat, and fit-3 in the mouse (Omori et al., 1997a; Omori et

al., 1997b; Petersen et al., 1998a). Recent work from our laboratory has reported that

mouse oval cells also express Sca-1 and CD34 (Petersen et al., 2003). Our present results

show the trans-differentiation potential of oval cells in becoming cell types of the brain.

We presented data that microglia differentiation from oval cells is possible, showing a

complete morphology and the phagocytosis activity of the trans-differentiated cells.

It is possible that nuclear fusion of donor cells with host astrocytes and neurons

might be a factor in the putative trans-differentiation we observed, as we have reported

previously in an in vitro model (Terada et al., 2002). However, since cell fusion

involving stem or progenitor cells has not yet been confirmed in vivo, and based upon the

large number of GFP+ cells we observed, it seems unlikely. Nevertheless, future studies

will need to be conducted to rule out this phenomenon as a confounding factor. Sex

mismatching of donors and hosts would allow us to detect fusion events via in situ









hybridization for X and Y chromosomes, and we have used this technique successfully in

looking at potential trans-differentiation events in archived human brain sections

(unpublished observation).

The isolation of large number of oval cells holds tremendous promise as a source

for liver transplantation in treating both acute and chronic liver failure. With the recent

report of the trans-differentiation of oval cells into the insulin-producing pancreatic cells,

using this cell type in treating diseased tissues other than liver may be possible (Yang et

al., 2002). Our studies show that these HOCs may also hold potential plasticity for

becoming neural cells, which may help our understanding of stem cell differentiation.

Since a large number of oval cells appear to differentiate into GFAP positive astrocyte-

like cells, and since astrocytes have been previously reported by us and others to exhibit

multipotency under certain conditions (Laywell et al., 2000; Seri et al., 2001), it will be

important to determine if oval cells might give rise to glial cells with neuronal

differentiation potential. Future studies will be needed to further characterize this

intriguing cell type, but the data presented here on oval cell behavior following

intraventricular transplantation, in line with that described by others looking at bone

marrow hematopoietic and stromal cells, suggest a potential common origin for these

plastic cells.










A






.1 -,o P-0 17 i' -1 iu .7411
S56 14 U
B






.1 y, ij Ir.. : '. "
SdeSceer
C
IJ w- 1 --

~am~ur I


Figure 3-1. Characteristics of mouse hepatic oval cells enriched using MACs
magnetic beads. MACs sorted cells were subjected to FACs analysis to
obtain purity levels. A) Histogram showing positive cells (green line)
above the 90% level at the gate of maximum overlap with the control
(blue fill). R1 in scatter plots demarcates the analyzed cell population.
B) Negative flow through cells (green line) from the magnetic column
are overlapped with the control (blue fill). Immunocytochemistry was
performed to verify that the Sca-1 cells isolated by MACs are indeed
oval cells. C) MACs enriched cells are positive for the A6 epitope and
AFP, known markers for murine oval cells. FITC conjugated (green)
secondary antibody was used to visualize the positive cells with DAPI
(blue) to show the nuclei of the cells. D) In vitro culture of HOCs. HOCs
started to proliferate in about 5 days, and formed colonies in about two
weeks. The HOCs in culture appear to be a homogeneous,
undifferentiated cell population.















































Hepatic oval cells survive and differentiate in the neonatal mouse brain.
A) Oval cells reside along the lateral ventricle ten days after
transplantation. Most of the cells are clustered around the fimbria (Fi).
Some are seen dispersed within forebrain parenchymal sites along the
ventricular walls. B) Higher magnification of the box in A, showing the
local distribution of the transplanted oval cells at the fimbria region. C) An
inset in B, showing differentiation of oval cells. D-K) Variety of
differentiated oval cell morphologies: (D)-(E), amoeboid microglia-; (F)-
(G), ramified microglia-; (H)-(K), astrocyte-like morphology. The scale
bar in (D) applies to (E)-(K).


Figure 3-2.










U


M


Differentiated GFP hepatic oval cells express neural-specific proteins
in the neonatal mouse brain. GFP expression of oval cells (green) co-
localize with immunostaining with antibodies to neural-specific
proteins, visualized with secondary antibody conjugated to PE (red). A)
Oval cells are positive for nestin, a marker of primitive neural
stem/progenitor cells. B)-D) Oval cells are positive for the astrocytic
markers GFAP and S100. Oval cells are seen to intertwine with native
astrocytes in the surrounding tissue. Note in (C), only one of the two
GFP+ cells expresses GFAP. E)-G) Oval cells are positive for
antibodies against several neuron specific proteins NFM, a-internexin
(a-IN), and MAP2. The scale bar in (A) applies to (B) and (D)-(G).


Figure 3-3.









-EC

Elf


Eu

UAC


Figure 3-4. Oval cells acquire microglia phenotype and phagocytosis activity
in the mouse brain. GFP expression of oval cells (green) co-
localize with immunostaining with Mac antibody against mouse
microglia specific protein CD1 lb, visualized with secondary
antibody conjugated to PE (red). A) Macl oval cells have
amoeboid- and ramified-microglia morphology. B) Many Macl
oval cells coexist with native microglias. C) Differentiated hepatic
oval cells show phagocytosis activity. Latex microbeads,
conjugated with florescent blue were co-injected into the mouse
brain with the isolated oval cells. Brain sections were immuno-
stained with Mac antibody. Two differentiated GFP+ oval cells
(arrowheads) with ramified and amoeboid microglia morphology
are co-localized with Mac staining (red, R-PE) and microbeads
(blue). The native microglia are also seen to take up microbeads.


Bead
















Table 3-1. Survival Rate of Transplanted HOCs in the Neonatal
Mouse Brain.


Animal No.


5.3
13.1
14.6
14.7
15.4
15.5
15.6
15.7
15.9
Average


Number of
Injected Cells (xio)

2.5
2.5
2.5
2.5
2.0
2.0
2.0
2.0
2.0
2.2


Number of
GFP+ Cells

680
390
2,250
468
2,022
1,962
1,302
1,584
546
1,245


Percentage of
Survival

0.27%
0.16%
0.90%
0.19%
1.01%
0.98%
0.65%
0.79%
0.27%
0.56%


Nine mouse brains were counted. The GFP cells of every sixth section
of the forebrain were counted for each brain. The total numbers of
survived HOCs were obtained by multiplying the counted results by a
factor of six. The standard deviation is 0.36%.

















Table 3-2. Composition of the Neural Markers in the Transplanted HOCs
in the Neonatal Mouse Brain


Markers Number of
Animals


Nestin
Mac1
GFAP
S100
NFM
Map2


Number of
Positive Cells

25.5
102.7
78.8
68.0
11.0
55.0


Number of
GFP+ Cells

115.3
169.3
227.0
250.0
168.0
276.0


Percentage of StdV
Positive Cells


22.1%
60.6%
34.7%
27.2%
6.5%
19.9%


11.6%
10.5%
9.0%
5.7%
1.3%
2.5%


Every sixth section of the forebrain was counted for each animal. The
average numbers of cells positive for each marker, and the GFP+ cells, as well as the
percentages of the number of positive cells among the total GFP+ cells, and their
standard deviations (StdV) among all the mice inspected are shown.

















Table 3-3. The Percentage of Cells Taking up Microbeads
among the Total GFP+ Cell.


Animal No.


21.5
21.6
21.7
21.8
Average


GFP+ w/
Beads


Total GFP+


% of GFP+
w/ beads


66.7%
62.2%
56.0%
50.0%
58.7%


Every sixth section of the forebrain was inspected for each
animal. The standard deviation is 7.3% among all four mice















CHAPTER 4
NEURAL INDUCTION OF HEPATIC OVAL CELLS IN VITRO

4.1 Introduction

The neural differentiation of hepatic oval cells in vitro is of interest, because it

may provide information on the mechanisms of neural trans-differentiation observed in

vivo previously reported by Deng et al (2003), and it may also reveal the correlations of

HOC with MSC by comparing their responses to the previously used neural induction

protocols in MSCs.

The hypothesis of a bone marrow origin of HOCs has been suggested previously.

Crosbie et al. (1998) provided in vitro evidence to show that there are hematopoietic stem

cells exist in the human liver. Oval cells express many hematopoietic stem cell markers,

such as Thyl, c-kit, and CD34 in the rat, and fit-3 in the mouse (Omori et al., 1997a;

Omori et al., 1997b; Petersen et al., 1998a). Recent work from our laboratory has

reported that mouse oval cells also express Sca-1 and CD34 (Petersen et al., 2003).

Petersen et al. (1999) demonstrated that, after 2AAF/PHx liver injury, rats that received

bone marrow transplantation had mature hepatocytes of donor cell origin within the

regenerating liver, suggesting that oval cells may have also been derived from the bone

marrow source. Theise et al. (2000) also provided evidence that human bone marrow can

be transplant into liver directly and reconstitute its function. Under this context, it would

be very interesting to compare the difference of HOC and MSC, in the purpose of

understanding the genesis of these two types of stem cells.









In vitro neural differentiation is a critical steps towards the future stem cell

application in neurological disorders. Hepatic oval cell may not be the best choice as a

candidate for the use in cell transplantation, because they do not exist in large quantity

under normal condition, and to obtain HOCs involves invasive procedures. However

because of the sheer numbers that can be obtained in experimental animal, it may provide

some insights to the mechanisms of neural differentiation of adult stem cells in general.

Yang et al. (2002) reported that rat HOCs can be induced to produce insulin in the culture

condition, demonstrating the multipotency of HOCs in vitro. Deng et al. (2003)

demonstrated that mouse HOCs trans-differentiated into neural lineage when grafted in to

the neonatal mouse brain. Trans-differentiation from HOCs to pancreatic lineage may not

come out as a surprise, because both cell types are endoderm tissues. The effort of

inducing HOCs into a neural phenotype in vitro, the ectoderm lineage phenotype would

further prove HOC multipotency, which could qualify it as a "true stem" cell.

Utilizing this rational, we applied a variety of methods which have been shown

effective to induce a neural phenotype from MSCs, in the purpose of demonstrating the

neural differentiation of HOCs in vitro.

4.2 Materials and Methods

4.2.1 Isolation and Culture of Oval Cell

Rat HOCs (rHOCs) were induced by utilizing procedures as previously described

by Petersen et al. (1998b) using the 2-acetylamino-fluorene/partial hepatectomy injury

model. Oval cells were then isolated from the rat livers by using the two-step collagenase

perfusion protocol of Seglen (1979), and purified by fluorescence activated cell (FAC)

sorting for the Thy-1.1-positive cell population (Petersen et al., 1998a). The FITC-









conjugated anti-rat Thy 1.1 antibody was purchased from PharMingen. This technique

resulted in hepatic oval cell populations with a purity of higher than 95%, and were tested

to express the hepatic stem cell markers ca-fetoprotein, albumin, y-glutamyl

transpeptidase, cytokeratin-19, and OV6 (Petersen et al., 1998a). The purified Thy-1.1-

positive hepatic oval cells were cultured in serum-free Iscove's modified Delbecco's

medium (IMEM; GIBCO/BRL) supplemented with leukemia inhibitory factor (10 ng/ml),

IL-3 (10 ng/ml), stem cell factor (10 ng/ml), and Flt-3 ligand (10 ng/ml), and they have

been culture over 50 passages (Yang et al., 2002).

The mouse HOCs (mHOCs) induction and isolation have been described in the

previous chapter (see 3.2.1)

4.2.2 Neurospheres Generation and Culture

Neurospheres (NS) were generated from postnatal day 5-7 mouse or rat brains. In

brief, the pups were decapitated under deep anesthesia (IP injection of sodium

phenobarbital), and the brains were removed from the skull. After removed the olfactory

bulb and the cerebellum, tissue was minced to small pieces, washed in PBS, and

trysinized at 370C for 10mins to dissociate the cells completely. After further washed,

cells were re-suspended in 2% Methyl Cellulose which is dissolved in DMEM/F 12 and

supplemented with N2 and growth factor cocktail (10ng/ml basic FGF and 20ng/ml

EGF). The cultures were maintained up to a month, during which time NSs would

become visible and grow up to about 200[tm in diameter.

4.2.3 Organotypic Brain Slice Culture

Organotypic brain slice cultures were generated from postnatal E15.5 embryos,

postnatal day 4, and 8 weeks adult mice. Briefly, animals were euthanized and quickly









decapitated. The brains were cut into two saggital halves and immersed in a preparation

medium (DMEM, L-ascorbic acid, L-glutamate, and pen/strep). The halves were then

super-glued to the vibratome stage, medial surface down, and covered with cool molten

2% agar. The stage was then placed in the vibratome chamber and filled with preparation

medium. Slices were cut between 300-400 ptM, placed in cold preparation medium.

Slices from the appropriate levels were then immediately transferred to a transwell

(Falcon), placed in a 6 well plate, and incubated at 35 degree C and 5% CO2. Each

transwell was suspended in 1.8 mL of"A" medium, DMEM F12 with B27 and N2

supplements containing 25 % serum. The medium was changed the next day and feeding

was done every other day. For long-term cultures "A" medium was phased out replaced

by a serum free "B" medium, DMEM F12, B27, and N2. To avoid serum deprivation

effects, a mixture of 2/3's "A" and 1/3 "B" was used on day 3 and on day 5 a mixture of

2/3's "B" and 1/3 "A" was used. On day 7 medium was completely replaced with "B"

medium and replaced every other day (Benninger et al., 2003; Scheffler et al., 2003).

4.2.4 Immunocytochemistry

The cells, grown on coverslips or culture dishes, were fixed in 4%

paraformaldehyde, or ETOH:acetic acid (95:5) for 15mins. After washed 3x5 mins with

PBS, the cells were blocked in 10% goat serum in PBS for 30 mins. The cells were then

incubated with primary antibodies for one hour at room temperature. Several antibodies

have been used in the study, which included PIII tublin (Promega), NeuN (Phamingen),

neurofilament associated protein medium (NFM; Encor), Nestin, a-intemexin (ca-IN) and

MAP2ab (Sigma) antibodies against neuron specific proteins, and glia fibrilary acidic

protein (GFAP; Immunon), and S100 (Sigma) antibodies against astrocytes, and Mac









(Serotec) antibody against mouse microglia specific protein CD1 Ib. After washed in PBS

three times, the cells were then incubated with a florescent conjugated secondary

antibody for one hour at room temperature. Finally, cells were washed in PBS three times

before mounted with florescent mounting medium (Vectashild).

4.2.5 Neuronal Induction Using IBMX and dbcAMP

One day before the experiment, rHOCs were related into 35mm well plates at

60% confluence and grew overnight in the oval cell culture medium. For induction, the

culture medium was replaced with induction medium which contained 0.5mM IBMX and

ImM dbcAMP. Cells were then cultured for 7, 14, 21days, during which time the

medium was changed once a week. After terminating the inductions at the designated

time points by fix the cells with 4% paraformaldehyde, immunocytolabeling were

performed to detect neuronal specific proteins.

4.2.6 Neural Induction Using BME, DMSO and BHA

One day before the induction, rHOCs were plated in 35mm dishes with a

confluence of 60% in HOC culture medium. For the induction, the culture medium was

first replaced with induction medium A, which contains IMDM (80%), FBS (20%) and

BME (ImM), and culture for 24 hrs. The medium A was then replaced with medium B

that contained only IMDM and BME (5mM) and culture for 24 hrs. Finally, the medium

B was replaced with medium C that contains DMSO (2%) and BHA (0.2mM) in IMEM,

and cells were treated for prolonged one to two weeks depending on the morphological

changes.









4.2.7 Neural Induction Using Retinoic Acid under 4+/4- Protocol

Rat HOC aggregates were induced by introducing scratches on an over-confluent rHOC

monolayer culture. We then cultured the aggregates with 0.5 [tM RA to normal culture

medium without LIF in an anti-adhesive petridish for four days. The rHOC aggregates

were then cultured in normal medium without RA for an additional four days. Finally, the

aggregates were then moved onto cover slips coated with laminin to induce neural

differentiation for 7-14 days. The neural differentiation was then evaluated by

immunocytolabeling.

4.2.8 Neural induction of Hepatic Oval Cell by Over-Expressing Chordin and Noggin

Chordin and noggin plasmid constructs were gifts from Dr. O'Shea of University

of Michigan (Gratsch & O'Shea, 2002). FuGENE6 (Roche) transfection kit was used for

the gene delivery. The cells were passed into a 35mm 6-well plate with a confluence of

50-80% the day before transfection. For transfeciton, 100[tL of serum-free IMEM and

6[tl FuGENE6 reagent were mixed in a sterile tube and incubated for 5 mins at room

temperature. And then 2[tg DNA were added into the reaction mixture, and incubated for

30 mins at room temperature. The reaction mixtures were then laid onto the cells with

2mL culture medium, and incubated for 48hrs.

4.2.9 Neural Induction of HOC by Co-Culturing with Differentiating Neurospheres

Rat HOCs were induced to express green fluorescent protein (GFP) using

lentiviral vectors developed in Dr. Razaida's laboratory at the Physiology Department of

University of Florida. For the co-culture, the neurospheres derived from neonatal mouse

brain were first induced to differentiate by plating on laminin coated cover slips. The









GFP expressing rHOCs were then plated on the differentiating neurospheres for up to

four weeks.

4.2.10 Neural Induction of HOCs by Micro-injecting into Neurospheres

For this experiment, 10-20 GFP rHOCs were injected into a neurosphere of 50-

100[tm in diameter. The rHOCs were microinjected into the center of the neurospheres in

the University of Florida Cancer Center. Following microinjection, the neurospheres

were placed into the neurosphere culture medium, and cultured for two weeks. The

neurospheres incorporated with GFP+ rHOCs were then placed on laminin coated cover

slips to induce neural differentiation.

4.2.11 Neural Induction of HOC by Incorporating into the Embryoid Body

R1 ES cells:GFP rHOC cells (3:1) were mixed in ES differentiation medium

(20% FBS, 15[tL Monothioglycerol (Sigma) in IMEM) with a density of 100cells/[tL.

Thirty micro liters of the cell mixture were gently laid on the cover of a petridish, and

cultured in a hanging-drop to induce embryoid body (EB) formation. After two days

culture, the EBs were removed from the hanging-drops, and maintained in ES culture

medium for additional two days. The EBs incorporated with GFP+ rHOCs were then

cultured in the ES differentiation medium on an adhesive culture dish to induce

differentiation.

4.2.12 Neural Induction of Hepatic Oval Cells by Implanting into and Explanting out of
Neonatal Mouse Brain


Freshly isolated mGFP+HOCs were grafted into the lateral ventricles of neonatal

mouse brains as described in 3.2.5. Ten days post-transplantation, the mouse brains were

processed to generate neurospheres. Using inverse fluorescence scope, GFP+