<%BANNER%>

Recruitment of Transcription Complexes to the Beta-Globin Locus In Vivo and In Vitro

xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20110115_AAAABV INGEST_TIME 2011-01-15T13:04:58Z PACKAGE UFE0008363_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 38047 DFID F20110115_AABHGU ORIGIN DEPOSITOR PATH vieira_k_Page_012.QC.jpg GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
241b9bd468fa2711fc9263f9d991d211
SHA-1
9d1799829aa0bda0793ce85c8d156f3566f8b54f
84522 F20110115_AABHHJ vieira_k_Page_074.QC.jpg
10ee7a6688f9bf133d2d9144297f01b4
3d616dc217849189da48be1c1523adb6ac7e936d
113716 F20110115_AABHGV vieira_k_Page_074.jp2
001e1dd3b97c4bd7279126e5c02ff4e9
ed0e77ed45e252eca90ec87f5b14262c2b077c7c
78106 F20110115_AABHHK vieira_k_Page_037.QC.jpg
f4e02c2e69085359bc12ce1e624acf6d
55bec6573a18ccd30352692e0e02dc2c2d933089
52093 F20110115_AABHGW vieira_k_Page_090.pro
e7876293a8b5fab099dca429e98cc795
9d77aae2d665458cdba6dbf3e0058b9f5de15044
960765 F20110115_AABHGX vieira_k_Page_087.jp2
58ffd84757a9184c1f41674ab80b4038
fb563b9078c0430a66cb8d6d01f971a5055e782d
97409 F20110115_AABHIA vieira_k_Page_067.jp2
7dc8256840ef1469181ceb1645383182
8ad9279c984ca2d67a0e0495a854d903afa2eab8
1053954 F20110115_AABHHL vieira_k_Page_086.tif
80d3bb8ee8bd1af9115f7528fe316134
f1bab05c6f72dab2936b62904430b9a6afa4f5a1
124464 F20110115_AABHGY vieira_k_Page_124.jp2
87f35857c7786ff44968ac4177e387e2
1fcfef7b8154120ec65c626062662366836fffbc
F20110115_AABHIB vieira_k_Page_103.tif
c389cbad0e404218294ee5a2e2a481d3
50f6aa47ee3f4aa8071b84b8ef732166523c61c6
263717 F20110115_AABHHM vieira_k_Page_113.jpg
159a6dab10eda3ca154fbd030c20ea93
9436a9edb54e0416ef0bcb6efc23484e9e82acb8
63064 F20110115_AABHGZ vieira_k_Page_125.QC.jpg
2c472e4702d3844cd2086e8bf2d34805
1f833170507aa9e6bcf705fd4ce633699a12e05a
104128 F20110115_AABHIC vieira_k_Page_016.jp2
77e86e9ffd927c8137b0714df2cd06c3
ec33b6c322fec22f60f537de98fecbc89a035483
43708 F20110115_AABHHN vieira_k_Page_104.pro
b5e8a660d77955b1774a8276793aebd8
730503eea6772f104130c32be8f99a8a752c9bad
78935 F20110115_AABHID vieira_k_Page_047.QC.jpg
d612a8c9144ed8e1d4cd86d9ae4d0e55
11f7e0d85b9879a7ae59668c07e0f2a96c5ec1f2
1711 F20110115_AABHHO vieira_k_Page_033.txt
723b36fc6d2102a2a534ea2fcef3ee52
a82f50f351e5a38fc018b58e882b0794ba722abf
67698 F20110115_AABHIE vieira_k_Page_106.QC.jpg
9ccb7f3789d14a7e15fd2badac901ee6
064e874d6cba1d13f6ce5f88d3dff4ac103c357e
25271604 F20110115_AABHHP vieira_k_Page_082.tif
636c60ddf9b1e300cf01634aea583262
b4fe97244b2216c78aa0983a10cff3bea9306f08
50690 F20110115_AABHIF vieira_k_Page_089.pro
6be50ed3aeb9bcbfee4e56fcdc8af303
3fa546168545448118dd298ced583a6baac5dd34
46307 F20110115_AABHHQ vieira_k_Page_066thm.jpg
11483fcd9ecaaed2738857a2d58f6396
13e0b760092aedcc6f58e5b8ad0bee370f32f8b4
138887 F20110115_AABHIG vieira_k_Page_110.jp2
7c988d4779dcfb60e4604a51d24cef4d
16042d9bf518f5eb367a434fa7cfbbb5eb8ec1f8
67587 F20110115_AABHHR vieira_k_Page_088.QC.jpg
a09089e03ee23830375c87d294fdfaa8
d6bebdcf578a06e54697b906cfb454d4bb0fe3a0
22925 F20110115_AABHIH vieira_k_Page_045thm.jpg
32a12eaa7cf116c5892c240c3a3e0b6e
b21d3eacb1db33c9d684bfc7f900678fc101ecc5
81934 F20110115_AABHHS vieira_k_Page_027.QC.jpg
f94d5b0058d0def7450f479e199f41f3
98ec628a4738a3c2c7eee385166475b52a07b819
1753 F20110115_AABHII vieira_k_Page_083.txt
90211d037e5314fa0716d94555acfbdc
3ecea6772f9c3aea6c7c7caf154191d4208dad38
912441 F20110115_AABHHT vieira_k_Page_094.jp2
607f7bbc33e2cabe34be11a78584f02a
844bcd84ab011bf34e15ca032ba8c2605ad93167
21989 F20110115_AABHIJ vieira_k_Page_088thm.jpg
25a07533ab04fcf6b717dd6d64e73fcc
08bfd38203946efd6b61f16dbe1d4d1248de33b5
63053 F20110115_AABHHU vieira_k_Page_110.pro
b68e2acd085ba7e160918d73ed879745
6fcbd784ba3742f104c74648c586e07c53ba969a
45910 F20110115_AABHIK vieira_k_Page_046.pro
9456c4ac0e08731fadf514846a8c6cd8
fbf461f98461a9cbacb9f9e9e416f58f9ac4bb83
2493 F20110115_AABHHV vieira_k_Page_109.txt
c5a29f88b6bb0af3c201b6a835a39aa6
3e39691f9962da97e51af037e217a641e841925c
25543 F20110115_AABHIL vieira_k_Page_039thm.jpg
b6e74241cbae54e23a9e9e4b14bfeef2
4f33fcf3a1c88b5264c56d71ac8b81c3d643de6c
1894 F20110115_AABHHW vieira_k_Page_026.txt
77cca1f4dec5564d8c028aa3c8031e8d
38e4747752451da99341a0883da188abd553106c
45079 F20110115_AABHJA vieira_k_Page_038.pro
3a83f2bd978897872061683cbcbc47b1
2611821f365d6a66360888903f38a45b39919b9c
43216 F20110115_AABHHX vieira_k_Page_025.pro
661542beb48370810eec71dd2048c935
bfe452a8ab070d5e116bc65535e90fafe42a124d
1884 F20110115_AABHJB vieira_k_Page_019.txt
0ee0f28afcc1da4456abce575501583e
61f8d9c0b7c42d76a5c9ccc41c6cac9a02f6d704
264117 F20110115_AABHIM vieira_k_Page_116.jpg
3a895370ec0b2e5132b37e2b98bb612a
1b4d447583f36be233531bff462a52da7568a137
1026521 F20110115_AABHHY vieira_k_Page_025.jp2
5835fb122842fe8c5d289f4d5d5fb77b
91750a260815962d1aa62b04f4f524ba5bd1551a
46182 F20110115_AABHJC vieira_k_Page_036.pro
657c3b3553a93dbe2d9a47145eccc7bf
11c36f0979686a2793e8a90f1ce7f53f1b14ba5d
89623 F20110115_AABHIN vieira_k_Page_099.jp2
298516b706853937ee188d3fa78205e7
c4bf74e4c6a43f87d1ccfc759e0b69c048e969e7
40110 F20110115_AABHHZ vieira_k_Page_077.pro
b94443773b7bcd5adea58b735f7e0521
db44ab3615f770a40b90eb4f98b22fa7256eba70
F20110115_AABHJD vieira_k_Page_071.tif
19f36ddc39cd5c4c002c10fae435bcb9
ef5d10a697dc3e4e18f6f1f8a07de9b832797a3e
210682 F20110115_AABHIO vieira_k_Page_093.jpg
354d051ea1ceda2db9fdbbdaba0aa929
ba542d824f98326ddd29394e09bed6cbcf5b63fe
24934 F20110115_AABHJE vieira_k_Page_005thm.jpg
e8f3c7461846a04b03f3b5a10ca2d2f2
2c810a7208cf6db71eb9233f502f7aa19265999a
44875 F20110115_AABHIP vieira_k_Page_084thm.jpg
dc33b62b9037faba3ba863d9b0703929
b249bc37ee6d0c24ab0ea6b65b8878166285d94a
191142 F20110115_AABHJF vieira_k_Page_060.jpg
4d485243c1c769c99efa0f96db44a97d
d1125795f9a4322002f7a7ff536bc40c80bb8b8c
1901 F20110115_AABHIQ vieira_k_Page_047.txt
fc35d354cc2144d6340d72235cacd870
16be8c8b3f59c0a7ad15c0bba80a751fe8a24a61
1025 F20110115_AABHJG vieira_k_Page_032.txt
46f0d5ca0446b8ec8380813b980643db
2d9e56977d13ea5bebdbae08862ef2309f47d0b7
50680 F20110115_AABHIR vieira_k_Page_044.pro
0fc575d3adca86eea4e4b5835fb05558
1c71f53600a7e4af4299287ee14aa997c0c2d2eb
211510 F20110115_AABHJH vieira_k_Page_041.jpg
704c9ea14455972a67eebb316ae74f94
685a6e76885785d98f84ff1ebad9fd686286778b
45831 F20110115_AABHIS vieira_k_Page_030thm.jpg
ff3585f9b4d0376a90b4410f0a08e257
0485c530e3a2be764da9e5618491cf7b9c864cdf
1949 F20110115_AABHJI vieira_k_Page_024.txt
cbd056ee151cea74c1942d574e2cefe6
0f81009bad11067f8c1c6e20bce07b159b60d6fe
248483 F20110115_AABHIT vieira_k_Page_035.jpg
9eb3ef58825b3817de0a75697a74dfc1
188dbe8d3c1069c76af0920d67ea81425ff6d7d1
50073 F20110115_AABHJJ vieira_k_Page_018.pro
44e1ed46dbe4f3c199a7271296e5c2e5
678eb691bde303d543f7693fe662a906db8a1f1a
214295 F20110115_AABHIU vieira_k_Page_101.jpg
75aca8248ff25e32c03314dafab05b28
4cbfc106983647bfcf69dc25b53cf9328ec09507
109496 F20110115_AABHJK vieira_k_Page_005.jp2
75bff5e38dd1002dac298eb0f1c4e56a
d90e757fee28c9674b8c45fe8954691356fd55ab
24395 F20110115_AABHIV vieira_k_Page_086thm.jpg
411ae24451b8e68ec9e2f1be78ca659d
bcaf6f3fafbc4c857f898292c6a17e25657b9e43
50583 F20110115_AABHJL vieira_k_Page_005.pro
25b9094411bb54b07a419a075f2bfe5f
811ba17c1df77adaab1263379475b53ea9e3e52b
82193 F20110115_AABHIW vieira_k_Page_056.QC.jpg
4e055ae2480fea35537189ead25e1581
935d8f3122bdafba351411c17cf0e99ae2e4e062
268071 F20110115_AABHJM vieira_k_Page_114.jpg
992ba4b9196f674ddee09e03f051c5d7
89f7413052beefef482c48b8a3ba4968c287fede
94138 F20110115_AABHIX vieira_k_Page_104.jp2
10c59d29bca864b05fbe28b6935f4765
becbacb0dddb5faed7d0982364edbd226feed11f
61650 F20110115_AABHKA vieira_k_Page_123.pro
7797fd9c9abbe9448285fc0784203ce6
0fbc47e37e415607c233c71d451cf5471df346c3
893118 F20110115_AABHIY vieira_k_Page_062.jp2
93e42a1787587e79e5b108aba7acb76e
651f12734561624d58955c3992ef76f13b106d95
136176 F20110115_AABHKB vieira_k_Page_108.jp2
e1769fedc71781f63ca78773e50d9883
c8bf53e082bfdff4f4879c2199e4be67f3972b78
79503 F20110115_AABHJN vieira_k_Page_021.QC.jpg
d1f409efb0c28781176a1d3666e8bb57
5a9ac24a9522a708fa131ca23cdf0fbf1535a7a7
1851 F20110115_AABHIZ vieira_k_Page_029.txt
9138961766354b76de3bad3c49988576
1e0986a1016b81d326dccdcdb2fff5603d64b022
40286 F20110115_AABHKC vieira_k_Page_045.pro
a2ea00db16cfb8ea7c9b35c75fc50283
9178f3cfe98bc59e8623bb8f55e6f3b7c8be780d
8527 F20110115_AABHJO vieira_k_Page_001.pro
68c29eb95e1e4d2e584c40783d77e788
b0196e3a1dd31fcf6d5969934d52e105b06a9076
44712 F20110115_AABHKD vieira_k_Page_060.pro
40f9c4329bc55460e2ff0645ddd95342
bea9c0222bcca7894ca90e139ff7ff8dd3b2c166
F20110115_AABHJP vieira_k_Page_005.tif
1a787ed9dac449d967ef6c898793e025
accdd69592c9a4ba43b49a93ab2d9cc1affbfbcd
73645 F20110115_AABHKE vieira_k_Page_024.QC.jpg
4c373e7e811b5ef7e3fa1357a3a56ca5
dc180081792685c0e485576d97bdfa8387a36279
208404 F20110115_AABHJQ vieira_k_Page_072.jpg
f7b32ecbed5f1f5f1cf8ae3b27a5554c
8123648e8396bafd3f15381a0a1a770bb75b4c8a
43782 F20110115_AABHKF vieira_k_Page_054thm.jpg
087a6a22bc22845ecd66d9bb49004e19
0d76987d7bb7348f9443499b36a7bec8f733cd69
103715 F20110115_AABHJR vieira_k_Page_037.jp2
42dabca57852012b1201aaa87f9ac050
fedda6a2f54f3491b1535d349a06085906ac9990
42850 F20110115_AABHKG vieira_k_Page_064.pro
364e2f927028b9b984d537bd0545e9fd
5201609d306415da0286e3184c3ea397b718a670
F20110115_AABHKH vieira_k_Page_101.tif
055dcc23190997aa185dedd2591da3dc
e43b7ab6f46de818dc6f7a3af714304cf0eed96e
1051970 F20110115_AABHJS vieira_k_Page_010.jp2
9e885a3a7da0e0e25cfe14ee6b208445
e1ae28f72d995d0d2f2eb75e8a00821f41c06a3a
19791 F20110115_AABHKI vieira_k_Page_125thm.jpg
6ef8db084b0f2022bbfbd14a341991fd
93be2bfd61bf951b0d86a718bad35b2e1a1cea04
45219 F20110115_AABHJT vieira_k_Page_064thm.jpg
bb2d43ad275bcac528e45689ac8a00da
99df83861f4e356116f09c62b312412f33cc4e21
218163 F20110115_AABHKJ vieira_k_Page_063.jpg
261559df39671b8d7fa7b550da6d45fe
6dcf2562309701c65a0499264fe75e7942b37aa0
63505 F20110115_AABHJU vieira_k_Page_116.pro
0e756e50a7fc6d085a01982a26ed6423
09076bdd7df08cc7726c7aee394224da8a8e5d4c
90345 F20110115_AABHKK vieira_k_Page_049.jp2
731f52f9804ba79b1806d65c6b84e27b
32b7cf54008140f479364b49f4b1de9031e49ece
36387 F20110115_AABHJV vieira_k_Page_083.pro
54de93401020fdb0d3707cb93e38a4e9
032dd3a38020f70dae5b2cce818993455a2364f6
1945 F20110115_AABHKL vieira_k_Page_091.txt
734399b442e2f3dc174232ee71882ffc
6dd62770cf4d07db5be6ab49845cfe45ecaf57d5
111371 F20110115_AABHJW vieira_k_Page_044.jp2
f69434c1927d1acf19fb54628e7bb29d
ce55631808c6120a7297921a3491c8d8e95a7c6f
259872 F20110115_AABHLA vieira_k_Page_115.jpg
26107e6ff70db9c91cc9c436a59bf66c
57ccf095544f30825918ab21e80c5027fe830850
F20110115_AABHKM vieira_k_Page_028.tif
23e7724409ca21636aa492bd5f5cad98
0ba6f60233d103bfb6d591515b6e0318a4277f25
1997 F20110115_AABHJX vieira_k_Page_027.txt
03966c38e411bfecf3d062a43d237722
a2b60f5079b62474b7384f57e4a61b5f68af19b0
191823 F20110115_AABHLB vieira_k_Page_023.jpg
bb4eb0a2876eedc2fd318d6c22d868af
20902026df1cbed9811caf021dd274a13009de2f
274811 F20110115_AABHKN vieira_k_Page_117.jpg
0b62df1bf803c48bb9e6f2388f1fd373
a2cc741a7ed0b9bd31288b21c557700121c5f6a4
F20110115_AABHJY vieira_k_Page_038.tif
f387f6e679df0da6c9f934e9db803291
d0666cf9d461f5f18fb31d76c3733b646398adf4
1638 F20110115_AABHLC vieira_k_Page_093.txt
e8d26ae5eda20644c657d8e4cc486fd0
53f40cdbec85fe5898b91b81d52cf74051ec3bc9
1559 F20110115_AABHJZ vieira_k_Page_056.txt
560c49b8845de8ab8f0e5dfc0a7a399c
f5630de319e95cd49daf6b523c37119b28b249b8
71997 F20110115_AABHLD vieira_k_Page_124.QC.jpg
fcc765b559d3aec0b91840c73c3d1c03
e9cdcea6906e36428c3d19e1a138ecd2f8c8cad4
2540 F20110115_AABHKO vieira_k_Page_111.txt
7adf6968b78f482deaf42256db6516fd
a8bc199b087de248911b09c7c81cd10d6b61e959
35116 F20110115_AABHLE vieira_k_Page_066.pro
1b5c89f9d1c4b9714867b506486c3fff
0dfb57daff803c13f9a5e921ebd6e5af7f89a231
79395 F20110115_AABHKP vieira_k_Page_015.QC.jpg
aad5a37b41bab9c59076296863b33e4c
9bf183754e9b0b1847c53d81c4e49ff4fe0e5269
6375 F20110115_AABHLF vieira_k_Page_008.pro
17532002304c7300e4dc8dc57f89d214
1968de75649ce0aadc503d76e87a3a902fe0157e
79663 F20110115_AABHKQ vieira_k_Page_118.QC.jpg
d6a5afd163b15a446760ed6688c14801
2d9ff694abe82ec357ef0da0a8529db53ac24068
F20110115_AABHLG vieira_k_Page_092.tif
aedd267a49ab300da40eea100ae74463
2cb06470efad0b9fc7c5fa6384eb0a00378387aa
87720 F20110115_AABHKR vieira_k_Page_013.jp2
654d1b31ac7d5643c5fc582e6ba57b47
8f3b81497ee8bf2830259048e1ab078a9ad734de
109521 F20110115_AABHLH vieira_k_Page_027.jp2
ab603d5dbd0ea791fcd81f88f2b1f3a4
619b09898e102c3f611c80befc1d372603705f68
49829 F20110115_AABHKS vieira_k_Page_081.pro
f30f69ba3597b29dc9ac82b19451a564
97bf68b9b008f8e5d46cd965a7a3c31ff7d10836
52366 F20110115_AABHLI vieira_k_Page_063.pro
2fb6ee866af89636519255d7d261f06f
2b5fb29fa55bc6999cda09fc63db867f28f95059
182071 F20110115_AABHKT vieira_k_Page_088.jpg
8b14ce518b1ee70a985e4f29f431f0da
592cd6ba12647d45f47cc9dc31dd1576d2ce01f2
46745 F20110115_AABHLJ vieira_k_Page_037.pro
72a294b6f95317b784cb441f875c1a95
151a6cede9147fb5a01e2ebce5b6bf5be7949a20
40606 F20110115_AABHKU vieira_k_Page_099.pro
f2685e2a6ed6ebc10e1bd19062dce3c5
e4f5520ef193b8de7dd630e18885e40b11ccbc3a
87176 F20110115_AABHLK vieira_k_Page_058.jp2
268ec889cbf29f9392c4c0a73282fcf4
8d78c66480ffc3a93abd80722a4bf4582af05129
F20110115_AABHKV vieira_k_Page_017.tif
84c9ffa9e5c936b7fc5e7dd0687ec02c
522e8ee407e26b4bb99d2952000579bcc26c20e8
F20110115_AABHLL vieira_k_Page_044.tif
08191cb1228c1471ad2df9f9065a3a83
7d671c9913cf6bae3d91a5d578149a399f615407
68293 F20110115_AABHKW vieira_k_Page_004.QC.jpg
a14064d9b4afc28cf567d7a15f2e2db2
32f6c0fb23c4424542ccb539ea78cf7e6f4d2f31
255 F20110115_AABHLM vieira_k_Page_008.txt
22c0516fa562213a4a183880e1d5338b
ff0c1ffeb175b13137537c2aa2e374ef2bdd7b1c
84451 F20110115_AABHKX vieira_k_Page_115.QC.jpg
63d6c160fc63c7b37d649768d6d4eb18
1c10382d8ee275ee86dee38bad8ab41e22c65289
154324 F20110115_AABHMA vieira_k_Page_008.jp2
cce88a213276e79ffda94b25ad987b47
c21d17dc76c705d9df6fa7f27d688fda874708fd
137590 F20110115_AABHLN vieira_k_Page_113.jp2
e9d65d6e931679bd8bb94fcaaed322d5
4164baee9f78ce5f00335d328981094e8407ecc3
91212 F20110115_AABHKY vieira_k_Page_088.jp2
afe5a1254829b51db252a3181578722b
32eb83307a006c69b85e514b49f4956431b3e5a7
25930 F20110115_AABHMB vieira_k_Page_071thm.jpg
c825798d67cdb94f14a864e7f796e515
0f4f4495ba1bf381ad7057fc0759462d638530d6
1953 F20110115_AABHLO vieira_k_Page_080.txt
0724d1c366e935650eae1f3a0454e272
cc8a293a49a7561feaab7207be89c5bfa8e7fcd8
44586 F20110115_AABHKZ vieira_k_Page_055thm.jpg
717202aa2e774eef80ade9106d8495c8
f2a923ef0c1e5ff2c83e50c918a4955b35a92ed4
96020 F20110115_AABHMC vieira_k_Page_040.jp2
7effdbcfe2a5aa9ae07d37ec6027d704
b3d42c4d2a7100fad468f6ec98c8d7c360d42082
59174 F20110115_AABHMD vieira_k_Page_118.pro
7a10c96029545da9d9587c5e24f0d799
b4a33e08fed0ad1863d7cb020dfbc1a7528a3473
216243 F20110115_AABHLP vieira_k_Page_064.jpg
46d741185384eab20bb533be86aade63
6fc4c95bed6b6e734fab89e8577816ec8bdd71b3
19804 F20110115_AABHME vieira_k_Page_011thm.jpg
4a3b4c8f79db5f89225b24306b5c04ad
88c75d1a9336ca687b6b3f76c5a87e6e579263e6
23094 F20110115_AABHLQ vieira_k_Page_097thm.jpg
ed919a941d5a4f0af8a926e9402a10df
af8dac0b3ab5fe577f74794684d2c8367d78b2b8
1944 F20110115_AABHMF vieira_k_Page_014.txt
7b4fe2e971657e50ec33e04d53703df3
2d07d5270bd79176c05ef8ff78c3bd81b95a10fd
1883 F20110115_AABHLR vieira_k_Page_017.txt
c732a6dc3cb760a8443fb1931b8a8d17
3453106fb185692d1c4fdf2561e5282f53c45f47
25360 F20110115_AABHMG vieira_k_Page_024thm.jpg
c17bb1a8cf3b63cfe351017009a0015f
c27afc444b9151794cc3425d03321eaba54bd2b9
106223 F20110115_AABHLS vieira_k_Page_081.jp2
967cbfd15b04cd581a247ecd67a6d1c7
c8b4c7e20ecd90669fc101b1dab653ce38e255e8
101725 F20110115_AABHMH vieira_k_Page_022.jp2
4e602b20efb7dac5ae2ba7bc49dc6319
99ce965c98ef778ce36d993740bb508a8130f3a5
101402 F20110115_AABHLT vieira_k_Page_046.jp2
1f0301d1061a3eabfaa31d4e893f4d1b
63c591699a1dd4e0a86a3755e1900560602f3015
118450 F20110115_AABHMI vieira_k_Page_035.jp2
c89969f88d216496a2526957c27de9b7
46daa15a70e2750e4ca03976f778399685fdb6c4
64188 F20110115_AABHLU vieira_k_Page_115.pro
6ee5e10c10c871ceb9cc3671db054224
a6a18733c330ba7305251b7739f5bba8d25fa3fd
131534 F20110115_AABHMJ vieira_k_Page_118.jp2
68ce5ea3a694fbaf281c1e04abc526a2
8153aa2a02cfe0f0f331597d3f73c4d6d70696fe
198034 F20110115_AABHLV vieira_k_Page_029.jpg
351a1fdff5fc8840ebf012c23747d5ac
5977fa1d444b605ad2182205e4030be1c9499602
F20110115_AABHMK vieira_k_Page_077.tif
3165d69b5f583b201d78c42885ce3131
80352967472bf75d81cc78d443060541e751e98c
49151 F20110115_AABHLW vieira_k_Page_039.pro
aa4f1a10ac31e1e7b453400ee18d6ba0
b18277ebcfd25946a0f86966a8dca2dc7cde1a91
80957 F20110115_AABHML vieira_k_Page_051.QC.jpg
c2bc1ab7f0f99c8252224157b0bb3206
941a32d2cbb48580bf9658aa0d8e0d94b94c2688
F20110115_AABHLX vieira_k_Page_016.tif
ab7c47d7df25e469323a2dc611580a09
b01734f3b516a0dbe957cd99652cf4d64d3c0851
80679 F20110115_AABHNA vieira_k_Page_119.QC.jpg
3108053bb4587c08b5e771cb1b7f6cbd
bafa148bb9d540a00919ba083e3f1dc73439027a
211071 F20110115_AABHMM vieira_k_Page_052.jpg
d136310e8aec302e37d8d9a96e2da962
0deed1a75515d00b325e4561300d86d0e7f2c437
106218 F20110115_AABHLY vieira_k_Page_101.jp2
5348cd067545e3edf2c76105462c0d6d
c92c7970ceaa3f7f80b540fad5349d97c26949ec
931 F20110115_AABHNB vieira_k_Page_012.txt
7c871812b73d0dd935b165bb56908377
2b93cb45cc42a8b1b333a250aa7bb7bfdedeacf7
261434 F20110115_AABHMN vieira_k_Page_110.jpg
8fd99ffd0c94b7adfb9bfa4ac673705b
ecc0b7c92dbfc8787c15e13a53c2d15c8f4f4e75
24515 F20110115_AABHLZ vieira_k_Page_065thm.jpg
a1846021b8346da755ea6a0c338ba92b
54a75c449d2abcf9e21b54c2810c98223fbe4d5d
1581 F20110115_AABHNC vieira_k_Page_049.txt
b7fac68d37f851bd66c3b72c7b7756c2
3578284fd21280c10dc5c0193e5ea3e085cd7605
F20110115_AABHMO vieira_k_Page_023.tif
3fffe7fc9abc44b9a777d68dc3dbfc44
c4656932606c69f47dbfa3cd367610543363feeb
106380 F20110115_AABHND vieira_k_Page_041.jp2
222f9b9c2230a462d99d254646d89574
154bc52d198d8f00b6e1e16982993ebf10a58f61
F20110115_AABHMP vieira_k_Page_066.tif
adc2bf71edb9a9bf189c058575776982
6d744670ff2f2a1f28ae014dddd45ef4af648d0b
80394 F20110115_AABHNE vieira_k_Page_071.QC.jpg
a30e0660373b26b76e4bfffca37e7aab
7cfd63fbe76685ced49167ec4a2d2187ba02289b
52352 F20110115_AABHNF vieira_k_Page_071.pro
297d400093741a14a985abb31a633ea5
1b0e23d3255d2fd60586d7aeb4c90afbfc8b0528
39823 F20110115_AABHMQ vieira_k_Page_098thm.jpg
3ecacbae721233320743b095e4765f52
13d581e2f2d12bb0559fd1aae45e9204f32ce019
252493 F20110115_AABHNG vieira_k_Page_109.jpg
a1682060e207e1f3a7c9608ec70ae6d4
fb6bb1a092788f54e2d8e093d1f524ffa7b6b4a1
81816 F20110115_AABHMR vieira_k_Page_111.QC.jpg
c8bebf816bc963b81be0ccbdd5cedebb
1180c1545acde455e26858e88b7896e5fb71b219
182868 F20110115_AABHNH vieira_k_Page_033.jpg
29308836bd62769a14a0931164018bb3
91e12d019ef404fe07ff1be577cef6cd36ac1699
F20110115_AABHMS vieira_k_Page_039.tif
7622131d07bb00a1b4a5346a949cd8a1
8b6f79633cb3332f72bf1f87a4b0e1a424e4930a
86507 F20110115_AABHNI vieira_k_Page_055.QC.jpg
e872f96d9a6773bdcf8a9435e3247282
71887e5ccdcf661ac1d1f8080cf7cb33ac796388
104043 F20110115_AABHMT vieira_k_Page_038.jp2
99ef20f41a1d700ec303bfe95dbba6bf
8068cc0412c8b7e63fc079260b482e9a27fa877d
13987 F20110115_AABHNJ vieira_k_Page_032thm.jpg
067795a10acbb5e77b48b4e783c25b5a
661ab9f2a6a4bea8a2c86f424b923888844e61e7
25111 F20110115_AABHMU vieira_k_Page_113thm.jpg
3ba529e3785da0e2488a4b652f5a7824
abe9b3d542bb169a1db6b8b06ae911d924763cfa
71943 F20110115_AABHNK vieira_k_Page_097.QC.jpg
57c011a617b7d5cf303023110f867b9b
f68b1f2aec617d78f71b96d16771c0625939bdef
24095 F20110115_AABHMV vieira_k_Page_037thm.jpg
d4e93968d0c5eab48216fd186c86c182
26d8c7ecfd144cf0349a7679bc637bcc38c1b2a6
F20110115_AABHNL vieira_k_Page_018.tif
2f73da1ed86232a89939d411a4d30982
b7ae6bfc32033d8ad35a77cb7bf7bcaa534ea231
F20110115_AABHMW vieira_k_Page_025.tif
92ce582186b41a3720505c9e9c6e7e6f
fa1a8ea98151b902fdb9987b92776675ff71d8eb
154733 F20110115_AABHOA vieira_k_Page_098.jpg
de03f3c0fedc6fb363bc14547ae0340c
ccd839ee45bdc2ad910a86dfad62cc37dfe14dc4
37237 F20110115_AABHNM vieira_k_Page_085.pro
33167fde2bd84d1e22c4736fc910b6b5
4988292fd99322aa0cb46c3a98bed818a8b9253b
62068 F20110115_AABHMX vieira_k_Page_112.pro
c95ceb139baadbe4634705d0be37883c
15614e65bb0c75acb420701f80bcf6cc36b74e12
228560 F20110115_AABHOB vieira_k_Page_025.jpg
13549af0d307fad2de17c9535d12628b
1f7e49f224b7fab7b83d9dcb5540238ff647b494
947263 F20110115_AABHNN vieira_k_Page_055.jp2
d5c63a9adfdf52ab309b31364696dcab
0f1bfa8026e4730dd830b5899c0b7b40686dceab
2025 F20110115_AABHMY vieira_k_Page_059.txt
220189885da6e08107c42cb569efbb24
ca86c4425ce2b94c04ac45dcb2eb141c8c03013b
49005 F20110115_AABHOC vieira_k_Page_096.pro
57c5cb0ce2aff756c4ee8e55f3a02866
f2e52b1943cd665eedd178e8edfeadeb5b3440d6
13902 F20110115_AABHNO vieira_k_Page_076.QC.jpg
80ec807298976a0e4ac30fab3526291a
744ee9cc223385169fe1774bfe38e5e7c3f17960
238086 F20110115_AABHMZ vieira_k_Page_124.jpg
3e69f811bc0671cc42ed1ae1eda7063f
5379aaa061313c37e06333fd146ef31c082b1aeb
F20110115_AABHOD vieira_k_Page_012.tif
46f2eea18ee167ce2f2433a44e8a8d20
93d287b8a96b379bbfaf2bba34e11dcf948ec9ab
94467 F20110115_AABHNP vieira_k_Page_061.QC.jpg
fe8e90246d9f29cd75b5087d567b8cca
721dc37dd161f4670f3c39b76040174cf90837ef
75934 F20110115_AABHOE vieira_k_Page_103.QC.jpg
e5c4f9c11cf7474ab0ed8ccf88546d7b
15d8b97b362981f23d1e47e0e960487552fbb8e2
51875 F20110115_AABHNQ vieira_k_Page_007thm.jpg
c43b13ccecbb8edc86cc0400a6adc634
79d4cb491b9fd0d1789338c82a1496820627baf4
258138 F20110115_AABHOF vieira_k_Page_111.jpg
7ea29eb19531f3e8567b604b6615e19c
f59b443234d82c262707b3c781e33c85388d2e21
1959 F20110115_AABHOG vieira_k_Page_103.txt
3617d78daf6a29e9052ad863b01a3c45
db2c1b0cd8a323db206091c3471ad3a430c571d1
F20110115_AABHNR vieira_k_Page_085.tif
45f3d03e3dd2cb1bfe5ca0dac7da64f7
036bdb280a00fa45661e0e359c52315ff74cbbdf
86016 F20110115_AABHOH vieira_k_Page_062.QC.jpg
ed08f190ee795316bd71e82a2d30c88d
1a17d6ccb5e3c993518f46df45a52a5fd8522eab
78740 F20110115_AABHNS vieira_k_Page_006.pro
c2bcea1b7e8913e9458238f3f24fa384
5ae2e3da75c073ce37aa6a59f71afae6f2143080
F20110115_AABHOI vieira_k_Page_054.tif
40510c30621cab894cc681328c5a0fb9
8de06d676eed0bbee34ce325b49c03f9268757e5
197830 F20110115_AABHNT vieira_k_Page_043.jpg
5cdf179fde81e702a325dbfce07bfca7
699cfdb6a72e9f11edc740bcdb3e57d740c99171
41340 F20110115_AABHOJ vieira_k_Page_032.QC.jpg
4388f8ccb1b0873192df2aabf535c1c6
8a3e6d8dcf51d216f78cfbd0ff5a19f1bda7d02e
97275 F20110115_AABHNU vieira_k_Page_068.QC.jpg
a632f0503d3733b605c45a700b67b4d2
f94aa579788222b1d91b8e5ed9eea7bbfb8632d0
75674 F20110115_AABHOK vieira_k_Page_048.QC.jpg
b741e37fd219ce01090965220208c18b
60d1b584825bd140e7187b7498346508077c6153
F20110115_AABHNV vieira_k_Page_067.tif
a83f72ac074a52befadc70953a851fa0
983a4fc4f8e70ff19c384e7d53d75ac6f0385c7c
32572 F20110115_AABHOL vieira_k_Page_076.jpg
3e144c6e4594f77f0921c9be3ff28b8f
9cecf1d249670b9698caa12a33dfe853aa26efd4
204639 F20110115_AABHNW vieira_k_Page_106.jpg
e522a3b15ee8e40059f4dd2169a01c4b
7fc7d414a438cb431018b1892b9e75f98acb6f41
25646 F20110115_AABHOM vieira_k_Page_032.pro
96ff2bbe1e41d1de48d9ce22a5049be4
0835b434501848ae5559e0d8d385fca74fbc6f01
60506 F20110115_AABHNX vieira_k_Page_109.pro
74d946ecfaf1cf1694c59711db3d07a1
571751fd98ee13b811755561d0de8de9b4272213
F20110115_AABHPA vieira_k_Page_011.tif
3e03027e36671f4a97c90597342a7564
d9e25eb624195fa304bd0d406f038dc5d7e8e3a4
24474 F20110115_AABHON vieira_k_Page_112thm.jpg
b2b0e5ccff4062a9685a33d9406889a7
d81e39b9e99b50a7514ea38dd8bd418cfd6bb5c8
51884 F20110115_AABHNY vieira_k_Page_073.pro
68117850f7f4ffb0e0e3c73808885354
37a3ff8b9856e70cabd5cf40306350e469484e11
221123 F20110115_AABHPB vieira_k_Page_071.jpg
72fa94121b779af6968bc589f892db19
08ccc781335b87a0a35184dcc0842c52fba51ce1
114385 F20110115_AABHOO vieira_k_Page_009.QC.jpg
1595978d5d07d8f0de7e531b0fc09bae
2c70a111ee063c09ea12d54c4641b7293b3bd097
1882 F20110115_AABHNZ vieira_k_Page_028.txt
d68539dab869f5e26dbc3a11a8fb7776
775c0f7d5b499c434cf7ed72786ec1900bdca948
208137 F20110115_AABHPC vieira_k_Page_095.jpg
cf77c1b5e326e1a62a16fc7ab1f667c6
a51241f135c44afc16491015eabb1c67a07e3c27
41574 F20110115_AABHOP vieira_k_Page_004.pro
8e5564b07f1561f208bfac9f0cc93718
0a73074299bdb8af672cf61420f0f53c0993fd11
50716 F20110115_AABHPD vieira_k_Page_027.pro
938e56b82dad18cff0d41b0a88ee5a6b
ab92d6fa0f867da688037d1155f227940aaa0d39
89880 F20110115_AABHPE vieira_k_Page_094.QC.jpg
bc9c2e184ad50e07d705d78c1abbb61f
10a32a1dbfb9b0b9c9097e647b5ac4f86a718ee6
82363 F20110115_AABHOQ vieira_k_Page_112.QC.jpg
64ce0188134687a6079dfc3d119a36a6
04efa9257c727aac6ff9cd7cd361630856264cf9
2436 F20110115_AABHPF vieira_k_Page_118.txt
0e860fcd16b9e5f139cd1acfff4e582d
04768ca3adbe850d95320c53a456de2d817e9e13
177375 F20110115_AABHOR vieira_k_Page_004.jpg
7ab57f0cc12569051092b214fad05930
d35ba14d5a7621cb5b22e02a4b8cb3cf531af845
88536 F20110115_AABHPG vieira_k_Page_084.QC.jpg
b0c491bbe0b802f6afe598cefad0668a
d26d4bd351999d1dba20228d5a600b8db1ef6920
102094 F20110115_AABHPH vieira_k_Page_029.jp2
2f904e31a32921ffc84b4a19aecbfd7c
747f9fc147e047c70f9f816e2e8286114ddf0930
24986 F20110115_AABHOS vieira_k_Page_095thm.jpg
19208ad0f665f979eed8369033b35bae
1091226898f785c312d410d635d27973b76e62cc
57326 F20110115_AABHPI vieira_k_Page_001.jpg
6b8d421a6d2652ef9ec51a48832f61ed
51f0235359bf573b9f5d2c6130f88185d1f4370f
47188 F20110115_AABHOT vieira_k_Page_097.pro
d333715f59b97c860643af603e8c8ddb
9d1228ba1de52f822fea8a69b2a6b6108766d880
2634 F20110115_AABHPJ vieira_k_Page_115.txt
3e407d6a3dc317912b6daa16e2ccecdf
fa9105680b52272145b8ae96b11d93dca6691fcb
253169 F20110115_AABHOU vieira_k_Page_120.jpg
0bfc1c98fc087fbfbfd6e0e158882592
6a4575d0b13742e61cec60c423a96082d76b2b73
106993 F20110115_AABHPK vieira_k_Page_047.jp2
9fe055a88d28cf5ac9d617f284602d11
c0fca62a0112f52034b5e11ceb684a9dc6572a63
140396 F20110115_AABHOV vieira_k_Page_116.jp2
d3d86c90882773589598231bd99091ad
8e0d0b1626656fdc07479cb1d1ae736caf9f805f
20899 F20110115_AABHPL vieira_k_Page_077thm.jpg
08211c67e0bb9bff0f1b9b6dbe5dc8c8
08264f9ffaa58e4be682a1538f613f2e4df2ed8c
1841 F20110115_AABHOW vieira_k_Page_036.txt
70bb5ee76369927ea2f5bc22124e26c4
5b472c037a8a94381682f5c6ee14f904c03f69fb
22561 F20110115_AABHQA vieira_k_Page_040thm.jpg
f052fd6232cda6225b74570b06a4254f
a51bf9355b5de842ba4dd602a1d62a373653ed4a
143951 F20110115_AABHPM vieira_k_Page_107.jp2
ad72e2b54c280068bd984edc370e79d0
a3ec902567dc1f448db953f05902519b184476c6
F20110115_AABHOX vieira_k_Page_120.tif
0305ce3dc8628319a11921ebdcd94a86
b2a5a286da7b0acfea1114b3792a55e284dd3643
175023 F20110115_AABHQB vieira_k_Page_011.jpg
2c57fb25cda87bcce4a3fea4968a25b6
f1b62710d567276d63e8b72c2f4b986687f8dde3
226512 F20110115_AABHPN vieira_k_Page_044.jpg
e8a331a798decc0d1add5a5d3b84c33d
36bad1ed6723f179c582f290119d18af8af9ebaa
75349 F20110115_AABHOY vieira_k_Page_102.QC.jpg
9c07efd546b043160c430bc6b1e6cb5a
268d1b031026d259692a1a5592af4ce9fbe2f30c
1816 F20110115_AABHQC vieira_k_Page_023.txt
66e6fb2082f4dc9eb52772004bf33127
6c279b521228f2ea0c9e7ba8762703e9ade8b5fe
25429 F20110115_AABHPO vieira_k_Page_041thm.jpg
baf72e2a771483b91d8a31efa43a66b6
25b2bfac1391f85ec9435b9092954488aa6d232b
24065 F20110115_AABHOZ vieira_k_Page_019thm.jpg
6a195e08265dcc24d06c38615fd9d2b7
7e06c9d700883447c2507307660b4f7cad59df32
2001 F20110115_AABHQD vieira_k_Page_089.txt
7324228575d950a3b7b60fdc712380ab
bbb591040b74c3caf9f7073e93701dc34b6ee540
F20110115_AABHPP vieira_k_Page_102.tif
6097a8beb772efefa1b575567c29232a
6d297b9d52f8de0add96e96443e76f1526db1c06
23988 F20110115_AABHQE vieira_k_Page_035thm.jpg
9c42f0be850951fcb090afeb88a292db
14fc7628837e944342adfd488f0736f2fd68c29f
89339 F20110115_AABHPQ vieira_k_Page_077.jp2
efce6ad06529ff872b973954f05d6b94
f252d67771d426fdcf316a1d950e0bdf8796e01a
46982 F20110115_AABHQF vieira_k_Page_028.pro
0fa6d24ecee755e525a2cf4f376bddca
704bff6eac9bd227bc502686f83037efe633a16f
1701 F20110115_AABHPR vieira_k_Page_010.txt
70b44a2885ac0a69eb45cf9bc4df481c
a5df2d91262ed93fca5d14f99a4197862153e97a
80878 F20110115_AABHQG vieira_k_Page_044.QC.jpg
00ce202b9d550fd870ce77e77fa379b7
c5da2d6b454be605343e51250e4850c6ddd19ed1
72783 F20110115_AABHPS vieira_k_Page_057.QC.jpg
6e5d90a4268c5bd7dc934b466b500cdc
064d06a7df0b66686786578d5e9a8330b3019a3f
24587 F20110115_AABHQH vieira_k_Page_017thm.jpg
84a6edf171b7d0582fbeb5e3cfb85176
5b528e296d940db38ece29680f55d96fbd054bbd
53764 F20110115_AABHQI vieira_k_Page_074.pro
66df11e5a01aefa0d4136b5dbb5a5ab2
275984dfc98665ce56f8892f2378218586d42a5a
26344 F20110115_AABHPT vieira_k_Page_122thm.jpg
f2d07efe3dc75bd6e7f6d2a4468d7471
eadfefda9744314ddaaff9d091ba7f6df2c5545c
119 F20110115_AABHQJ vieira_k_Page_002.txt
c434dfe14d08f617b407f1b2bef2a56a
433528a670b629556cad93fb88f7e5edc88e734c
39635 F20110115_AABHPU vieira_k_Page_049.pro
dc1cc3b2a4740ab270f17953f4358450
1ea00a4d6c5ba384a3076d6ea4defadf2337c7ea
81288 F20110115_AABHQK vieira_k_Page_069.QC.jpg
d11d6b7d39b6b479fcb5bff7aa5d489e
c48eb8bb8d422378b0400da263a99b0c56179967
21127 F20110115_AABHPV vieira_k_Page_099thm.jpg
b247b66a485d7374726ec41921477bcd
ef7dd488f09eb617df2e4f923d5d31b86895837f
75645 F20110115_AABHQL vieira_k_Page_026.QC.jpg
b0f7885a1f120236c87e48d77c7d5d62
38fd1723a1da36ab11a8e3c105a3c885fbe6b647
F20110115_AABHPW vieira_k_Page_022.tif
ea8f0bba6e5f06ecd45b0f3b6635cfe2
061e5224bde19c896bcd6f1c009d0888d9c22b6a
21400 F20110115_AABHQM vieira_k_Page_050thm.jpg
9fab0f3373178e203755bca4446be346
1b0385920c32faaf1cf3d5d1f1b01fd0ed6dc4b8
2502 F20110115_AABHPX vieira_k_Page_119.txt
d8871c313eff533fb3ab3f3e4bfa77ed
c29060f13aec25e1fe9ab561d7ea571dfb6ed98e
21882 F20110115_AABHRA vieira_k_Page_104thm.jpg
542743322f86eed1b1307a45f403cd29
f1925f7b884c9ad2e526be275250383ebaa7faa5
103073 F20110115_AABHQN vieira_k_Page_031.jp2
75680fd377a8ffecaa78aec9ee6aca8a
875f018719eaba83b0054984fda7f81a3ecf2a57
34381 F20110115_AABHPY vieira_k_Page_105.jp2
ac207de96a51c2569778adca117d486d
e401f8f3aea5a14b593ec4c702ab256323649e54
F20110115_AABHRB vieira_k_Page_097.tif
af017107d5214f2e989f4d19a9ead834
fccedabdcfc6b224abdb98288d43d59fa472edd4
F20110115_AABHQO vieira_k_Page_118.tif
ec38399c894db9d9aeca3b6c7dae2006
3217d59094de8477f57ea99983063b7887395d21
F20110115_AABHPZ vieira_k_Page_069.tif
4cc7d824bf1dd4e2926c32b23fc009d9
9cb3d35e8169cfb0cfac5e8314af9e484af7919e
2558 F20110115_AABHRC vieira_k_Page_112.txt
b980690c1505e3f05c5f30cf836f06d3
893bd365960485d8e91dcea6c36bd0456a3dd49f
25632 F20110115_AABHQP vieira_k_Page_044thm.jpg
1f574c796969bc252161aa7ca8674252
92851f83e7119078790866061787e8cfdf69241c
187703 F20110115_AABHRD UFE0008363_00001.xml FULL
509ca529729309773fc7dcb0e741cec2
64929075b47cd6a6767ad2d40a962b77e7b5db33
143316 F20110115_AABHQQ vieira_k_Page_117.jp2
894fd36f7c269a00b8e662bd650244c9
9d5e53f92fc7b8ae57570e8155970450b6e28984
84098 F20110115_AABHQR vieira_k_Page_121.QC.jpg
07cb43598ecbd0b1aaf7a88774f655ab
ebd6c2b29de4c17dbcd590a256e14ee14d2ff79f
44562 F20110115_AABHQS vieira_k_Page_010thm.jpg
5df430b42a0aa92d1b911c71eaffae64
1446111ea7449ba1d268d852edfcf617bb88ad8b
27904 F20110115_AABHRG vieira_k_Page_003.jpg
55247992608f58f7b414d1fa4ec08114
fd4234b206b09e19afa2b74a7633a18ea497881e
F20110115_AABHQT vieira_k_Page_056.tif
276ddd1b610a666508fa67eebbe69a3d
f394d41c92c320681248f2405d8fa9a58d2ce40f
214906 F20110115_AABHRH vieira_k_Page_005.jpg
fe14358ebf6664a0b45773d1ec6f0f05
a863f92f06e977091ca098752b5a3f0b234dcf9a
204635 F20110115_AABHRI vieira_k_Page_014.jpg
d644e01d65fa570d9f2630c14cc9a13b
7821c87d5df7a0dc6fd41c4b469d1e78b86182c8
F20110115_AABHQU vieira_k_Page_015.tif
6b2892996a3efa67e4a20bee21ff8ecf
6150c4fc8ccc34ac6be18fb855c4e0b4efb2784e
199819 F20110115_AABHRJ vieira_k_Page_016.jpg
f6c0398787a2de9a244ff529f26cfd4c
3301a24cf1502c7d3bc94743f0af3692d2b2669e
20520 F20110115_AABHQV vieira_k_Page_004thm.jpg
b9947f7416c7a29c5973336f7777f07e
e4d836a4ab5f7f0a3a2a532db12d0503a3c33b44
201607 F20110115_AABHRK vieira_k_Page_017.jpg
be6df0b1d4fd845bd2e353569d82c4f7
f9567df828db337920d1ebdd36488caf67065389
87519 F20110115_AABHQW vieira_k_Page_030.QC.jpg
e29c8ac3c8b43aa5f37c9492540112e6
bf7b097d9d9414359cd66da5dbe7a49f6379c92a
199216 F20110115_AABHRL vieira_k_Page_026.jpg
767fcf08677f2b0482fa7a9b38ba2483
14c5ec50d553257f7a8698f8d38cb902fb95d0dc
97791 F20110115_AABHQX vieira_k_Page_090.QC.jpg
7c184516fa840f49493724332d36f23d
04f66e017163c7cd11ed8bcad9727bb06356eb27
211664 F20110115_AABHSA vieira_k_Page_089.jpg
33e313240913a4fdd8de6c64fca35d33
42c2245426a5e6a74dd6b3f5f56caa4cd29dc77c
203635 F20110115_AABHRM vieira_k_Page_031.jpg
f2747ca9cd9f37ace3a5f6568d088191
1ae7a3fe71044ad36b4fc0a5d09864d1e472f89c
F20110115_AABHQY vieira_k_Page_124.tif
344a631c0c1da0bf0554880cd4e5bf09
473bb57d7ca3438016946a3259ba1a100ee120d7
238194 F20110115_AABHSB vieira_k_Page_090.jpg
92594ccdc7d3657ec7d624cb49d8f53f
9d26ed7b732a7f9c70667784f8a4a5d9013b43d2
221169 F20110115_AABHRN vieira_k_Page_034.jpg
cc9952b17e6091a22b054924a90371f5
376c0324af99cc3e8f1bfc3e8df205c2287cf154
47959 F20110115_AABHQZ vieira_k_Page_065.pro
6f845ea629a38bdf35b75b510f12b810
5851e5c6c17468dd580f3cdfd9a67703d337bc16
242200 F20110115_AABHSC vieira_k_Page_092.jpg
2e5862e0d4c172c32aafd5aee133c013
672a928549b195ad4ac2d4ebbe35c0b833818adc
191894 F20110115_AABHRO vieira_k_Page_045.jpg
3c490fe741e06c7864f57aef823b8d89
c8d77491d5fb0da18a6f930cb6e8fc4dfaea23f2
197026 F20110115_AABHSD vieira_k_Page_102.jpg
9deb702def749b8733ddb8db3fb7ed7f
2cae281eaf97041515dee248868e08467824b39c
215805 F20110115_AABHRP vieira_k_Page_051.jpg
0973a027413dca0b0f61d9fb73d16978
c171feb64adbdbb74556b14e3cd4f7c375aaa118
203585 F20110115_AABHSE vieira_k_Page_103.jpg
2e90b4f4f1bb98038cc77d2d2f0aa4d2
7489baeec4351239fe7e0059b1e4de52d96653c0
195363 F20110115_AABHRQ vieira_k_Page_056.jpg
166c8a59ec840c8a67d258b4da0e500d
1ab75d95b8df05488773bb28f3a1284e2a6e80ba
261860 F20110115_AABHSF vieira_k_Page_119.jpg
4518fa8effe3fbf2a1ec9b37fb119aa3
06c6cfc8c9f8c44b8f68e2e3b64cb86a891de7ec
175515 F20110115_AABHRR vieira_k_Page_058.jpg
d3ca44141870e5d7ee888e4630f19792
3f19e713a3cdfe08f7e28a82fb7b356fb3cc2f22
282251 F20110115_AABHSG vieira_k_Page_122.jpg
094c46fa4977937b6a4ac846f78346d9
4ddd9d039e19c81610cc72db898e3ebd22463a8e
211688 F20110115_AABHRS vieira_k_Page_059.jpg
646b5ec989521eac02b3aa60d91cffac
1024176a9d2d72d837cb09b43679f399fbf5ffea
272918 F20110115_AABHSH vieira_k_Page_123.jpg
c514bdd37d0154debfb4dafd71fe4bfc
bcbed8a408e23507d06257ddee04097887ec1b22
197570 F20110115_AABHRT vieira_k_Page_062.jpg
e61ba3f7f269fbac7063575a8196ce40
ee23fbb54f13b9981b0e02050d65e5255676b252
1051948 F20110115_AABHSI vieira_k_Page_006.jp2
7f77e2c255083b782d78e5e41aeba8f6
3454142d6db4ea67580babbdc5f4f3b3a656b2fc
237008 F20110115_AABHRU vieira_k_Page_068.jpg
4de20fde9aa0ecf37a552d661337cd04
a6441758e270b901892ad8f66a3d99c26ff6d279
1051985 F20110115_AABHSJ vieira_k_Page_007.jp2
77b4a5a1d9b2edd42fc8128d59dfbbf6
865b5ead41042a4a3211748c5fbba747e3dc6cd6
105403 F20110115_AABHSK vieira_k_Page_015.jp2
8d2579d4e6055f0a5a9e7b093d5c724e
ba15d58f343a384bb4ca7a6ac0d11536834fec11
207558 F20110115_AABHRV vieira_k_Page_078.jpg
c791e0996a030123db602b43c57ca1f2
2250f0c068a75e3c8b65b60d9103ca6df718cdd7
105265 F20110115_AABHSL vieira_k_Page_020.jp2
e4e54ee1037aee4ec28425ee02177c9a
a5ab68bc99a325a86c7b813c1299df8f5b99ccc6
230465 F20110115_AABHRW vieira_k_Page_080.jpg
725b5218f2aef683abd07fb020f9b74f
edc9fe2f1ce93aef67c80011d7407bfbf60e082b
104864 F20110115_AABHTA vieira_k_Page_078.jp2
c5a5a801ae04e54864a650fff8357111
fb987236a9e85516a854ca00582bb00335600c46
104616 F20110115_AABHSM vieira_k_Page_021.jp2
9e8b4155a6030940bb40b2c6b5c03ad2
e125d168bfda0c602bdceaf240e384cd55943d4f
192817 F20110115_AABHRX vieira_k_Page_082.jpg
178c687daf59370915db31c5b2c89879
ac4893b5863bfbc17ef7617df8aa8a71b9a168a1
879515 F20110115_AABHTB vieira_k_Page_083.jp2
776122fac6ffe4eb5110601f69eaab04
b737f67dd6e733948d1a17ae4dfdb51d6a522093
105304 F20110115_AABHSN vieira_k_Page_024.jp2
4ab207e23ffa5b8ed04e7f7785cd12db
f60b4aa436f1c38370d6f2b5d6b9e8c19f91e8d4
213796 F20110115_AABHRY vieira_k_Page_084.jpg
2c60b513645e73f931d1d1e9f86eac94
9dc5758d7134e2de8dda1dcb4c3baac43aad34a3
839545 F20110115_AABHTC vieira_k_Page_085.jp2
85260431c2ce726bf0882d6460b03503
959039c638a6dd6e619bd191e6a958dfceb1e133
1051978 F20110115_AABHSO vieira_k_Page_030.jp2
891a31b5792da352115cd3632a8e0ccd
85f5c05f39ae1025c2a5d5eeddbd5eee1387c7d6
192524 F20110115_AABHRZ vieira_k_Page_087.jpg
e33e64bc7481d8937571b24327a68d6c
430269bb1f8efeb7fa0fda5b315474082e046dea
107984 F20110115_AABHTD vieira_k_Page_089.jp2
7e3b909f7bee9d645c0839f53cd1da0a
d458befb5504a26effe874b57b8ba66ae39d409b
57316 F20110115_AABHSP vieira_k_Page_032.jp2
a9eb581b2b907c3d58c96910ea521c86
7e6109de95c8cf0c08cbf6707d5381dfa8fc9409
105123 F20110115_AABHTE vieira_k_Page_091.jp2
23773edf48273e8246d05ec5e8c315ee
7a61a2e440b60e1506d02b46b8e5016529dbd412
110795 F20110115_AABHSQ vieira_k_Page_051.jp2
7492c15978d6a624ecc6962bed10c9a6
408af4e7805a20eb3c77262349814c89fc7154e6
960979 F20110115_AABHTF vieira_k_Page_093.jp2
b5d5b467850ea90560a733b2c7a274ad
bfac526222fd54aac24dc83901a32639fed55d28
97482 F20110115_AABHSR vieira_k_Page_057.jp2
91061cfd2ae0c36bf1a37bde6ed2cd75
0458ae7b786ca239d7d87995d76a95e2ee7e4c8c
104966 F20110115_AABHTG vieira_k_Page_095.jp2
e24d2db01dc16883ee5eb58a16284207
e279417be880768396f31afda0d41c5547f14806
110071 F20110115_AABHSS vieira_k_Page_059.jp2
9e901c0310a395d61815e8934af8db2e
5744db67dfd96ccf3f02e7e4d379188471325222
102188 F20110115_AABHTH vieira_k_Page_096.jp2
a659429962852796b8bdec90e648fae5
8749d225844d1342487c434b8a3ccdb997269659
97508 F20110115_AABHST vieira_k_Page_060.jp2
3b19942afeda1a6cced1da877d5fdee3
6cb87480c1ebc347f386ca9eb463d9f72cf067d6
101604 F20110115_AABHTI vieira_k_Page_097.jp2
a55bed4cff67b500a858c93b870e56d0
9737ec3868a747ad923ee805514b43d58a8d0abf
1002576 F20110115_AABHSU vieira_k_Page_064.jp2
f6dc177c9ae7dd7fc05662c0c57deef1
b076ca034ecda2c23b02d9a6d5cf523b4665ae9b
111256 F20110115_AABHTJ vieira_k_Page_106.jp2
c1ab7b1048dd70370f3763b332eae38d
5b152f62becf24612b7644f03861c8fa14c6f14c
850060 F20110115_AABHSV vieira_k_Page_069.jp2
245f2185ce6090bfec85a5251bb9680f
4479f32580a0a9a5b852e6ae3dbf92ffffc36540
140537 F20110115_AABHTK vieira_k_Page_112.jp2
6c721acc726f1e5b496a96c852a5e713
423449bbbdb0003934c971c0abd12919f4fad3b5
150872 F20110115_AABHTL vieira_k_Page_122.jp2
74ce5ccc2bb47f66767ba60848fac9b5
855d3fc60ad3746784a2dcda28e5c45ab135f552
973644 F20110115_AABHSW vieira_k_Page_070.jp2
8f196fa5b49c7323d86adcb4cf14a354
33b959d4e5047902f14a70355f2bc8da4b0bada9
84826 F20110115_AABHTM vieira_k_Page_125.jp2
c0888634179487a0c8f300f6fcaeb0e6
b45bac45beb82687bcf047684c115d5b91644ef3
108110 F20110115_AABHSX vieira_k_Page_073.jp2
e874748eb346d345cd9ce122bfc404ac
f0898f9bd304733ec62cef1de2cb746592b0ca05
F20110115_AABHUA vieira_k_Page_053.tif
cdb7424b3e81b9c2f4aa57ab5eefb96b
1e434da70f2b1069d82191542ab4cfe059e2d3c5
108361 F20110115_AABHSY vieira_k_Page_075.jp2
6c852bab576ba1c471e3659bdef1c502
250f32d97d5919ef03fe292202b191998b4b05b2
F20110115_AABHUB vieira_k_Page_058.tif
dc7d2dbe9688a01dfc87279d51c03b18
c3a35b68992121b065c5cae5ecbe8e1677b6fe65
F20110115_AABHTN vieira_k_Page_008.tif
77c3e51ac80afa238634f02e19bd1ca0
d9bcf484d2176bb6df4628ba279f68f79de26899
15924 F20110115_AABHSZ vieira_k_Page_076.jp2
2d7a9f29b12567d15a4773eb87ad1b6f
241b58b8607a1e9a4c8c2894e996d6b98206d8b6
F20110115_AABHUC vieira_k_Page_060.tif
6f4eb303fb3b1ce33c7757c49f047e67
607928f53d4c585ed9a6030f70bfe2e94ea7afc2
F20110115_AABHTO vieira_k_Page_021.tif
c2c7ddd58ce59044739324a35065f495
7c5d8649da351a4ff69bbc2f333c702e1b9cdcb4
F20110115_AABHUD vieira_k_Page_073.tif
4e3ac773553f788240b134bd8020ae12
126e2fe2440fd38f1cf80ea141215193c94d8ad0
F20110115_AABHTP vieira_k_Page_024.tif
4a40f02cfd8ea228daed13eee6570281
d76aea65e5ae48fa50ab9bc59f517c2e8e70a026
F20110115_AABHUE vieira_k_Page_075.tif
c871caf0ec0c0149b6ca584531c1c38b
ad19462fa7bd091b1cfcbb3c3e8af5cd68c45ab4
F20110115_AABHTQ vieira_k_Page_029.tif
deb69f4ab492a3e4eaae35eb59aafbeb
994aaf9cdcdf81f1846a25e31f769c59333f3c32
F20110115_AABHUF vieira_k_Page_087.tif
093e4aaf4e8d160dea5fae98598cca03
ec1a5f57142d49a0845e3f2b0fb874daf2084e64
F20110115_AABHTR vieira_k_Page_032.tif
a264fd69da92a0e945d18476e5f4b313
c98c2e2ee27a82ac519a934034c615d19f075fc8
F20110115_AABHUG vieira_k_Page_088.tif
9aa0fdc925f3ea1798436cc2c4972dc5
366f742705ea8c8da2fbbe6a3fca70717d568521
F20110115_AABHTS vieira_k_Page_033.tif
97120c5b78b893394d18b694eb5b0189
cbc8f9ed5c75d46be4f09e385e0a70bd1d4f70ec
F20110115_AABHUH vieira_k_Page_089.tif
46956c2f2667d34238e38a88ac60a6b9
dc8dd1621e76bdb6297a17fdc8c7f250f45725da
F20110115_AABHTT vieira_k_Page_036.tif
ea786d73ae5eb17712fe01079381e3a8
5737c3a6c06c99f31417b81b8af200cac43d3996
F20110115_AABHUI vieira_k_Page_099.tif
388f14f29d40f68f57471106f263d320
3221ed343c1991d8253a1ec60c72ee16ffc6faaa
F20110115_AABHTU vieira_k_Page_041.tif
cfe700cfb1dee556cb37eb8a65008e6e
cc0fb4a99bf68d88976cada2b119f9085d99c228
F20110115_AABHUJ vieira_k_Page_100.tif
c6ac76a3b7467f0a15131eea36832765
6d971ccf984de14e952adb7ea543c3655957d8a6
F20110115_AABHTV vieira_k_Page_043.tif
807b8d8360a0eebcc1b9317154030a8c
49fa25378386a5aecbc84785937f764fb08a5f6d
F20110115_AABHUK vieira_k_Page_104.tif
4e8b54a09168d2b96b501f6f9511e42e
805b8ae84a679a2217e50d4753c484d091605787
F20110115_AABHTW vieira_k_Page_046.tif
cb29090bba4951686867e0b04a2b9783
80624426d92b8a067857e43fb83bc871850039b6
F20110115_AABHUL vieira_k_Page_105.tif
d58319c133613d7061ee92e1f21a2299
aa34b957d540d9b35e3ce145074c952a7f5cb322
43417 F20110115_AABHVA vieira_k_Page_050.pro
bbd3fa6508e0f9c3494cfd4e75292356
ebc7626f000e510c3c55e53c5901c4a8876126d0
F20110115_AABHUM vieira_k_Page_106.tif
55f09866dde468a1acf0149a2ee45900
451ad0cf15eeb19a33cf54534d3dc024b7824fbc
F20110115_AABHTX vieira_k_Page_047.tif
9304a90b770df4a0f2179332ead64e2b
afad47772f18b25823d2df98a551102f0346816d
50112 F20110115_AABHVB vieira_k_Page_052.pro
dac84f1c9faf5bfb59abce01358c2231
eb4a558512bb6db8188c694d66ca86c6a8e15ccd
193934 F20110115_AABGRL vieira_k_Page_042.jpg
c15eb07fa5e1193a58af0546cf4d9ff6
4e93d434d6cd72e175a79aecbbdc7b18f5196fe7
F20110115_AABHUN vieira_k_Page_107.tif
04fb8392ddd044f846a054a24ef4578b
76011d3f0a8bb8391797dd90d4817a98b544f205
F20110115_AABHTY vieira_k_Page_049.tif
9ed7b12288a40f1d6d9273ea65b68acc
6eac3a342dd5108810d5067f43e8170fbcb4f8c5
3266 F20110115_AABGSA vieira_k_Page_006.txt
2b8a46815c081c929c2f74e4b8fd1324
7fe26df376a07192c3d3e93aacfb8ace1dbfa86d
44359 F20110115_AABHVC vieira_k_Page_053.pro
5bdea4a0afc80bf52724538c40f25805
7f7c7c0b3c589a36af6674a450053cf6e8dfada2
1687 F20110115_AABGRM vieira_k_Page_013.txt
fb9bf8790a93909b8fca1e1b217299f6
2cf736e9241d7c3a7506bb95a117c93a9230009e
F20110115_AABHUO vieira_k_Page_108.tif
6df0b53704511e3dd25a80a4dba584b9
6e4f58760810f998e525c9621d7306647cf25db3
F20110115_AABHTZ vieira_k_Page_051.tif
0945bed67511f0a1a76f2403a5734098
e45d1425329056ce7ddec649cb586b33bc2f8336
2648 F20110115_AABGSB vieira_k_Page_117.txt
80773ff6fd7f89a3a1d1eac1712d0dbc
160360d109ab8087fb7cb4e548431bebd2c701dd
45407 F20110115_AABHVD vieira_k_Page_057.pro
1fad46c6fe874cd397ab21839b168723
953538e28b444eb53c0be6ea4c86afb599aa499d
39554 F20110115_AABGRN vieira_k_Page_011.pro
0ac82ec8eaadf8e0674496d7d5c064f8
d2e32b2df013c13478d591f86b9a5eb85bb8c753
F20110115_AABHUP vieira_k_Page_109.tif
e09b32a72c44d05e05327dca30719ee1
ae63bbcc135e1dd17d1fdddcda8720bebb676cea
1004951 F20110115_AABGSC vieira_k_Page_066.jp2
be60d44f0132c81b63edcfc2eaa855b1
8d4029cf87f3eb6eb493d430f72820de266919ab
39440 F20110115_AABHVE vieira_k_Page_058.pro
4ae08469b4776617e411d2a2487e92c9
743774d9cfd8781f18a3068c66863ecad00871bd
42810 F20110115_AABGRO vieira_k_Page_082thm.jpg
73896dd69c402b9fa8eb0ac1491204f2
44e6e7fa4eea1bed87f58d6c76d9031eed25384d
F20110115_AABHUQ vieira_k_Page_112.tif
8f97ec5923f893beec1edf02a1737cc6
13686fa3a5c8d45362a2ff059bea35c07d167373
40377 F20110115_AABGSD vieira_k_Page_055.pro
4d466aa008257c5292c7bba64b375b1e
5bb781ebd2553d4351e7fd2f469af0be400f5202
46284 F20110115_AABHVF vieira_k_Page_061.pro
c6fc4f8eb56d5d9aa3ccf90a3011d073
57553e59ab09002619139c83b7c1ef84123b1031
192832 F20110115_AABGRP vieira_k_Page_057.jpg
8c1e07a274274281dd957f3391b1033d
c29a90d9dc72d5c939c03debc94ee321cd06c772
F20110115_AABHUR vieira_k_Page_113.tif
4b45f65079ef010c387aa18261432d4e
ca1056c0b6cd900bb5f80a08a2b33a6ccfd7f747
F20110115_AABGSE vieira_k_Page_002.tif
69d3c630d595873789859aecb6e1192e
f0c63a4a8d27d318383ec7efe1c09a61cbbccde8
40994 F20110115_AABHVG vieira_k_Page_068.pro
6d7c71a66c5859131425d1a83b1ce662
474d13de3faec2de891491db9e438288003bd5c0
F20110115_AABGRQ vieira_k_Page_078.tif
8ec98e6a5a449dbe2b2c5e4e20dad149
c308d2c97bd9173d5b75365d8b0ab9b29e88576f
F20110115_AABHUS vieira_k_Page_114.tif
4fd15ae24f1170f0a01f22532c2e1d0f
7a0b90be7c9b1933886dcabcc1b218e33e887402
40341 F20110115_AABGSF vieira_k_Page_033.pro
9d2f1a2873da36eeb8233cd5eae8ea06
cf642e1504558c377586272f976db6133e2afb53
40236 F20110115_AABHVH vieira_k_Page_070.pro
e67cf40c46d61704d0f68e69b957d38e
c3eec4d00a1249c060414fa43eafadf6c9d393cb
138811 F20110115_AABGRR vieira_k_Page_114.jp2
36b8a2d3f47d1d2dade0f20bbc3c9d54
c1a799cbfb0cf962f3624f001923ae28e12f73b8
91132 F20110115_AABHUT vieira_k_Page_007.pro
890493b82e4f6178ad7b5c5e9bb2a05c
9216a521d17815f083bce51016183f8b59521921
26002 F20110115_AABGSG vieira_k_Page_027thm.jpg
1c1bf203cd4a901ff7c114b1e7b7830f
08875de5ae2099b0ec00d0f8b290b1e1853438d2
48328 F20110115_AABHVI vieira_k_Page_080.pro
8db436c24944c47e11c28d29674553fd
4d51cc4926c625381547f7ce54b6d309e43988c3
F20110115_AABGRS vieira_k_Page_094.tif
112a53a7c608e30ed8a774562e14df08
5108e0a4a71cc8b5d0de121bee3dd98ea1718f11
48126 F20110115_AABHUU vieira_k_Page_016.pro
3d7291c18a53d56b1c157984cbe42a32
1fd71fb838e31f957524b8b4521bceb9aa1f1b99
212771 F20110115_AABGSH vieira_k_Page_075.jpg
9d0fdddba3055765522a81fd35bac8fc
4636ad6230b98b42305e296fcb73c4d582f21897
49020 F20110115_AABHVJ vieira_k_Page_086.pro
9a81b0549d3f2c3e2c5dd2443f0d2d33
b364eee7347bccb69b9728e7ee864e1a1ee4d012
78601 F20110115_AABGRT vieira_k_Page_073.QC.jpg
72c8fd227e58d952337232c2589c711e
e5b94eef8edfdbdf7500ab267a380a01a659fb1f
47050 F20110115_AABHUV vieira_k_Page_022.pro
fa5b83c7f0c65eb34ce737e685508688
a7af91fda8abd6e730067e6a3a4a6a18c0a545e1
25052 F20110115_AABGSI vieira_k_Page_114thm.jpg
d3e9fb3b18db07ccd70ac3614a89c72a
b85d206c415e8871f4fcd95a0ad0d2e2c7f7694f
33467 F20110115_AABHVK vieira_k_Page_087.pro
c22712be3d7a4c5921f6519ec4bc099c
b362c08fc3b07c80dc90475f858a20dde68f2b8d
57898 F20110115_AABGRU vieira_k_Page_009.pro
f69d45406bc826edda4a1164d453f8d8
d10496ace710ca08afb1e2d14a043f06275c3bb2
48854 F20110115_AABHUW vieira_k_Page_035.pro
8b67cff5f8965ede907a621103bfbf44
1e4baf68d65c9806136a6b88615a11c367fc4f03
105642 F20110115_AABGSJ vieira_k_Page_072.jp2
09450299a07b96c9dbfaaafa5d817ed6
46aec4ee9bb569f9d12d5607b56891c092a07340
49289 F20110115_AABHVL vieira_k_Page_091.pro
b0fe8ddb104c71c71c9cf10fa6b65256
5498e989ec078b62fa913007aad20ed9c475e2d2
134861 F20110115_AABGRV vieira_k_Page_119.jp2
9c1c7c0837f0942d8815075754044ede
8147dfa51e98e5451e36f60a79b859845313c1fd
41055 F20110115_AABHUX vieira_k_Page_040.pro
d4710fbfa8136853d452d17bed9e88c1
28bfe6796a34330f07ff623c293481d508e8c4b4
1772 F20110115_AABHWA vieira_k_Page_030.txt
f923aa5d51025b334605eab3678648b9
463047d2e1fe5d311a115cf36dd4f90e586d30c7
23553 F20110115_AABGSK vieira_k_Page_102thm.jpg
822596f20a5542d0b292a0727bb3d869
48fb76c7d065697ed1bc4f59e342e1f1556352a9
50214 F20110115_AABHVM vieira_k_Page_095.pro
595020beb57de4a0b822fda615412e7e
3a89a1b5914f5a22d9bbfdc101c1a9242f229fc8
1898 F20110115_AABHWB vieira_k_Page_031.txt
edae91bb27cbc1e453c99535c3202b81
7dc6c7ea418c082db0df59349c0ec8a971f05ae8
90677 F20110115_AABGSL vieira_k_Page_004.jp2
ea14520275cdc84784499747960e557c
6c9b64906c76ffd84ca1dffbc2280f8389ae5c2f
26360 F20110115_AABHVN vieira_k_Page_098.pro
8d5dcdf684b4c1dd223402a4de494682
8ff4788cee6438637193adb6fdfc406fbf9042f1
F20110115_AABGRW vieira_k_Page_004.tif
aefe5e31f2e791182d84dbcf9a0f80bd
a25bc2a4bd1426955e22e8f914c7b33e6c01eb03
48252 F20110115_AABHUY vieira_k_Page_047.pro
21556e8a072657aa2461a5515007518e
c0db08e004014980bbd0c0969a44b7884b75b1ec
1947 F20110115_AABHWC vieira_k_Page_034.txt
33693f602461a74b6bc17a324e83aad0
f3d7c985f5a5d87255ae51bb6449e9806c8a65a9
25040 F20110115_AABGSM vieira_k_Page_111thm.jpg
89845e583680fd12895280864efad8a9
ae7ce14706bedd280a84eb92c6628ab7ff5dc127
49658 F20110115_AABHVO vieira_k_Page_101.pro
4bba6b6f753ba78d0e087702e398f272
a6b6fd04399bbd570f6750f0c616f067ad4d10a9
212599 F20110115_AABGRX vieira_k_Page_081.jpg
d5950529c90cfa1391ddff031eececb2
4c4ceb669261dfb02b58c6990c0ecc4b00f4e08d
47580 F20110115_AABHUZ vieira_k_Page_048.pro
4511703bea11152caa69553acdcfb3ac
aa01b0234c65348d38a793b423717173cfb43a7c
48040 F20110115_AABGTA vieira_k_Page_090thm.jpg
aa222028604f6ccc81926df02c19bed4
988dec1d24b2288a347a5d38c7dcfa60bd7ea6a1
1787 F20110115_AABHWD vieira_k_Page_038.txt
17eb319ca52b95e6079520b07b756f18
3ab35bf9b35d573ab0e73cb9ab3bac6b7d005645
8553 F20110115_AABGSN vieira_k_Page_105thm.jpg
f9e57bda5433e87677bd572d3d3ff8e9
998a4dd776350b6ce122e237e6088616bd8ba341
47049 F20110115_AABHVP vieira_k_Page_102.pro
d3d47a9f6f6283e793a593511f77fb5c
b5eda6df0da785b34e808752ec15e1dabca80656
F20110115_AABGRY vieira_k_Page_027.tif
817066ae753a456bcd4a6d75c3916212
cabb91a1edec0d5dbd2d10130eca18621e56cc87
108288 F20110115_AABGTB vieira_k_Page_018.jp2
753bd664bb70ad7e5a30276fa45376a1
66b39c5f09a639c2b4ffede57582d9a36ce1ad4d
1634 F20110115_AABHWE vieira_k_Page_040.txt
c35c43606e6b48bc4c9527670a2226c3
1e18a4a4416cf184ce9d0e7e7b01c31a0860f237
73518 F20110115_AABGSO vieira_k_Page_022.QC.jpg
4adfc145a27e3f1a67be9d106ab7d7bc
c887c84e7a991794badaca286944e457d14ebcb8
49336 F20110115_AABHVQ vieira_k_Page_106.pro
66cccf4dd8b49607672a4796537fcab3
101cd74750017a7382149e186db4531962d2dbe6
78332 F20110115_AABGRZ vieira_k_Page_089.QC.jpg
5d1512af29f93c7a63c43f4b28543953
91d08e41a9bec1d2e34becbcdeb833098f7ed659
F20110115_AABGTC vieira_k_Page_093.tif
31a917fbcfeec56b758eda1240b500e5
1f452a21c66365600951b61eec297449cc6b5d27
1782 F20110115_AABHWF vieira_k_Page_042.txt
aff3849ce8bd023f43ec6b47f43466fb
82fb70fb8f9ca63250ca1c17fb141625066ce664
61725 F20110115_AABHVR vieira_k_Page_111.pro
a44947ffa9f2c9ffe78a76298b1a0c8f
84b54d5a0ee3a77d95856ee0431ac9f5ef40acf8
242473 F20110115_AABGSP vieira_k_Page_118.jpg
954c879861b638b81dff68c61392c1cc
dcabe620b1ca6573a99173954c69c201c57e01ec
1666 F20110115_AABGTD vieira_k_Page_058.txt
ecda71de33bcba446909f3826427394a
54f9f19d8be0c89b976fcdf1b3a3f00c082d13bc
1651 F20110115_AABHWG vieira_k_Page_045.txt
cd4e495da3a8daa30ff97d5184eac469
d0ae3097507791ad56331c7ad688dcf9025c7ca3
64636 F20110115_AABHVS vieira_k_Page_117.pro
49c58db1df2b5261b94901787e239c43
3abb42008f9f81747cb2e7c55fa11fa2f6078e70
24019 F20110115_AABGSQ vieira_k_Page_060thm.jpg
60314fb4fc8612e684ad5d4ec14f4d10
58340359fc536196c6e5604dd82042ee06468f4e
82182 F20110115_AABGTE vieira_k_Page_085.QC.jpg
d3ee766433b7c5bb5edcc09a1b8b2ab2
bf5d3220a7a54b0be25f6580491a0c6260eb507d
2055 F20110115_AABHWH vieira_k_Page_051.txt
bb9575e4e740e2ca1b93a0ac7f3cf822
5f5c5c279e405d6112ad053a70c0f8d1a9ecb151
64622 F20110115_AABHVT vieira_k_Page_121.pro
727821a0c1cd75be29fee5b16024472e
0507922eadd01589a78812b03f58b5e8f128fb0d
83460 F20110115_AABGSR vieira_k_Page_054.QC.jpg
78ec080da609f691d51e5229cef40af4
3b6082a6e6ab937f0c47084581c160ee995e1a30
25173 F20110115_AABGTF vieira_k_Page_123thm.jpg
c0bd674ab62fe63fbc7474e41c4b672e
73cf5f222145d522b8a8e09b93a817b60489cbe3
2004 F20110115_AABHWI vieira_k_Page_052.txt
969e06882c02f6b68e7310b4d99957e1
f1e22cdfd3bb652d941f9ad7b97d69f1116338e1
68178 F20110115_AABHVU vieira_k_Page_122.pro
64fc9e31196d1005c711ed73f9262f40
0bac0bba1f4506548fa36d0e94789735cc6a3a17
F20110115_AABGSS vieira_k_Page_076.tif
bf7cc766eeefd272ced5dd567d5bf651
5a9f97758e59c4129fb833a51870a4d6ddef5beb
216317 F20110115_AABGTG vieira_k_Page_073.jpg
9b6f082b2a832d805fe34b9a7cd13cc9
9ba88c16f4967daa4c33b1683c4cbae87d7f192b
1802 F20110115_AABHWJ vieira_k_Page_057.txt
3225b6931a2b80a57ef644472da21dd8
d1eefd057efedf6746680d9089e4ea29c5f461c1
37665 F20110115_AABHVV vieira_k_Page_125.pro
1027ef8192462d30ade8e250b1213221
0de9738dcdad9f2aaecf1949881d1c634ec6d593
101702 F20110115_AABGST vieira_k_Page_043.jp2
27a6ad0c8a82647dc49a9f041d9c4e15
c7259595069d252c52594eb9ab3adfb8b6ac2434
F20110115_AABGTH vieira_k_Page_034.tif
deb6bcf36fe29f1011949555f8e1a9a8
1da68fe3a11cc892c5a18b9219ef8ea890eda45f
1755 F20110115_AABHWK vieira_k_Page_064.txt
4c188ca5a98463345465893b16079ab6
739a1e7d2cb6d2d6a85f25283c7946475dec8685
1747 F20110115_AABHVW vieira_k_Page_011.txt
a1b43087c5557b5d06e9629c53d1ca8f
83f05ba25cab5a1ea19b3459e4201ee7a6f06412
268748 F20110115_AABGSU vieira_k_Page_112.jpg
cad2e628dd5522d351cfa62f91f37a91
8680ee3401cf5350a50ecb1aaccd0dd0cde934c5
F20110115_AABGTI vieira_k_Page_084.tif
bcc91ca99891a4e8cce4cf6df05c6b93
3e83b6b1000d1967ddf81f2339f625dde816a230
1731 F20110115_AABHWL vieira_k_Page_066.txt
7e6dfec58b7b78284ee3ed6bf1328f87
8162056b9cc80cea1b782d3d9def5c492a8c050d
1936 F20110115_AABHVX vieira_k_Page_015.txt
18b94df40cac4e994a5360eb88900055
400dd0d75186fb88efe5e7d6d0db1832fde540b3
2607 F20110115_AABGSV vieira_k_Page_116.txt
3c068a815fdfa6b82b90daff5e8c69d4
75790fa3bdeaff3c87f8ca067567280022e6b2aa
168353 F20110115_AABGTJ vieira_k_Page_125.jpg
3003dc562452702822f408700ea12763
0e115919b339263ee56737472a0def01778f828d
661 F20110115_AABHXA vieira_k_Page_105.txt
3cd76ac322b9f676778ab430dcc5a318
62d8d452a02384d68c53654346153f4760e828cc
1805 F20110115_AABHWM vieira_k_Page_067.txt
dea78cdd2fecd8d94b55a6fc0c5bde5f
c259b1b62de1fbde7d102100eec80cd6736a0921
1932 F20110115_AABHVY vieira_k_Page_020.txt
75015b9208baf62eb0c109645044d7c0
842b33dfd140413bc135bb938074cac726a2b413
141458 F20110115_AABGSW vieira_k_Page_121.jp2
69aa3b3c22713680fd6ad21defef2bbf
1e1e092d76a8fbe360d86c80b5cc41b6e496e488
46831 F20110115_AABGTK vieira_k_Page_053thm.jpg
082016475f4f27c18b571f3cbca24ff5
eee4b253686d61f4e00ecce0ea525f683f651a57
2522 F20110115_AABHXB vieira_k_Page_108.txt
3f86ade0bafbf0ee6d98644f1313b2fe
584121a7e202c9f3a0f670f4e0eee976cc989a91
F20110115_AABHWN vieira_k_Page_068.txt
6fd1ce2e7a370c541a2542d7cc307b32
df205981af170e52b160f975d448c20a9bffe357
51340 F20110115_AABGTL vieira_k_Page_059.pro
86835cf044f3582ca4af06541e53989d
c21cdd530676156ba6f8b8896e528ff751d981f3
2810 F20110115_AABHXC vieira_k_Page_122.txt
b71013433ab6999b8bea7b31d915f676
c6fa273606135fea20cdf2005c4b60dce5220dd4
1725 F20110115_AABHWO vieira_k_Page_069.txt
e83ac8bc8c8b0e4e3ea0bee4f5ceccc9
9c7d00b49cca7e2a009039a5412609604fb1ef84
1955 F20110115_AABHVZ vieira_k_Page_021.txt
bc78647a159ec6fbf05b2a278715afba
f441f47fa7f46807344ff1901c2c67d12d0c73f9
4149 F20110115_AABGSX vieira_k_Page_003.pro
ac525e91d58f0c23655abcfdfa25a458
c6d12dc3b6e6eb68b882a68abc5695cdc885e3aa
203162 F20110115_AABGUA vieira_k_Page_020.jpg
4b4bb2c75e0cfab8649d23e7d83d7106
c812198d686848a91376ded36a381efc8ffc20d5
F20110115_AABGTM vieira_k_Page_045.tif
92123d3c08c8754f1110ef7c8f43acfa
658f62fa3df63eca2b9598e60612bb2f7c9b93bc
F20110115_AABHXD vieira_k_Page_123.txt
436ae971406a5651261b7717a65209de
08f76a816dc2a05655b5204458913b660aa02785
1965 F20110115_AABHWP vieira_k_Page_072.txt
20333e25030d1271de2105814cb3c633
7ebb711d5ab807f9df8ac82049798dd8f6e4552f
F20110115_AABGSY vieira_k_Page_096.tif
3aabf2c464d61bd04d892ec1ccbbd9c0
c4302ccee0dabf76b25c50326bd84446f4d62474
49860 F20110115_AABGUB vieira_k_Page_072.pro
133e96ec1a4fabda17e88dad21472706
03ceb97c8c67aea5e0d419cf9dce53c0c3dcf7b4
F20110115_AABGTN vieira_k_Page_039.txt
76d826d6ee442884d2d6164eed4368c6
7b148a854fc82d57d26dcbfb199a6caef8d90864
7224 F20110115_AABHXE vieira_k_Page_001thm.jpg
fc4b147279192b2f888f4b3b51fc24b3
88113babb035e4805461253e1b22b3849c37b3fc
1987 F20110115_AABHWQ vieira_k_Page_078.txt
af880f0448aa073e64ca0667ca19828e
f17a16b5cc65b1a6bf67b986fa508214513ea6a7
82542 F20110115_AABGSZ vieira_k_Page_109.QC.jpg
ae0ee0d0178810a324946e252f68c9cd
848d6e385d8ead11b4e4b0186660ff7fbe861251
46716 F20110115_AABGUC vieira_k_Page_029.pro
52f864fc0dfab06fd9c03f65c42b5b34
1c52dcc89b062eefd8e6ff872d7f7d78a0cc1f5a
85581 F20110115_AABGTO vieira_k_Page_010.QC.jpg
fdf01cd3b8e502ad969c5a139fdf52de
90ac65617e251f30e8bbe4524548ca2f8368c3cb
1293146 F20110115_AABHXF vieira_k.pdf
a5107a4630408c6e259cee9bab354c4b
f9c6e6971debbde57c0cf2812d62f6fec6435921
1524 F20110115_AABHWR vieira_k_Page_079.txt
13f8572f3f89b3e4bdc2294d9287fc7d
d75836adaf82d68adc94494e5b93ecc17445c232
188956 F20110115_AABGUD vieira_k_Page_050.jpg
9b4ea48f721d729e67ad54762b67fd07
66f3845db074221f27c0018377b592f5c777bfb8
84306 F20110115_AABGTP vieira_k_Page_035.QC.jpg
24824569e0009c7b10b09062c34530db
305f3292cb8301c3f80c03393e0add68177b9eb3
80450 F20110115_AABHXG vieira_k_Page_005.QC.jpg
1ab1be4c319cb3a123f749e2bb6d7991
7d45e9c653cb0268f5e1bbb4209fd730459bd5da
1481 F20110115_AABHWS vieira_k_Page_082.txt
fb7ef91178deaef6a05849a0fb9d3be0
eb121a7498f41507ee09904e2a457a8f3334ed6d
75105 F20110115_AABGUE vieira_k_Page_029.QC.jpg
231b0df7ada16012431fa0b48da5a4de
504a86ca5781080b72ef59f030ee7a7e9696a83a
49634 F20110115_AABGTQ vieira_k_Page_021.pro
dc55de60a09ec6eab4612d6acac80954
0f1215f09f429f4dc5807ec653419135ff7a8f55
97538 F20110115_AABHXH vieira_k_Page_007.QC.jpg
99842eb2bef1514493a57e8c5218d477
c983191506fc425bcb683d8a0f191a30e5f03d2b
1874 F20110115_AABHWT vieira_k_Page_085.txt
ca12f08d7bcdb2a18ad929724e17e5f5
60f2d236d70652ef4cbc868c98dc099be38eccc2
46244 F20110115_AABGUF vieira_k_Page_092.pro
ec68e47b9edea4af5e69996ac62015e0
2e9965b4465af98b55bbed88adde6d6cbc1aa752
F20110115_AABGTR vieira_k_Page_086.txt
20cb46ec6592920b8f6bafbe516d8840
3056d5133088dda496108a59fc6c03d0bd100f7d
321020 F20110115_AABHAA vieira_k_Page_007.jpg
6b4489b585f1e54ee37f23ec6808e104
35ecf0407604f7818278195d2876fa4b6b273b64
51643 F20110115_AABHXI vieira_k_Page_009thm.jpg
50eb9c0841bd3d3728dad9be1695aa04
03fa870c0b92a1fa455d0971ffba169ebc4240aa
1760 F20110115_AABHWU vieira_k_Page_088.txt
d20e4f4fab45d3a4c8f005409fe0f9a3
3249961944b45bffe7818e0c80f86d1932775e17
49510 F20110115_AABGUG vieira_k_Page_034.pro
06892219546dd78c06043dc97ffbba42
e896d4c95fb3ff4886e338b2b31497a75629b96e
174796 F20110115_AABGTS vieira_k_Page_099.jpg
15f7465e4390af35715bea46f99785e3
82c853ec9e8e0c10cdb929daefc81dda32a46e7f
1845 F20110115_AABHAB vieira_k_Page_037.txt
cb2660905be8eb09e34cd1fc335bbc71
5c85bdf820024dddde32bb0325b0e3bde39f76bb
58855 F20110115_AABHXJ vieira_k_Page_011.QC.jpg
accdd1e76d3bb3c82484c28919d1e33f
df892fddca43253714826b4b3cda22e7d3ceeb08
2089 F20110115_AABHWV vieira_k_Page_092.txt
57751895596a87f2859aa062eac7e2b2
22c753ae22d0f07cf63742f73d4a1c96f1d364d7
35600 F20110115_AABGUH vieira_k_Page_030.pro
42b21ddc37e6e1c1b8b145e50f659b89
4115276ccb08356cfcae7bfba72ba5a9ae7a1e99
1051979 F20110115_AABGTT vieira_k_Page_092.jp2
2b8120706704d29eed576df29046ad94
a09b4126f07ce56594e1a807d6d22d428ea22d53
24659 F20110115_AABHAC vieira_k_Page_043thm.jpg
47c1463a7e8ed106211846554bad63fc
0af9899192dc13845dd6be1deb2746c61f58ba7d
21182 F20110115_AABHXK vieira_k_Page_013thm.jpg
51575264832e780ee8f0d261d67fc5f5
da439d152d29762141d50ade7ec70ab153cbc947
1934 F20110115_AABHWW vieira_k_Page_096.txt
c46b13bd12a2df865e26423107c05e73
e68224222b1d2729a9258b192d11c3d15c474e94
33269 F20110115_AABGUI vieira_k_Page_008.QC.jpg
eb46a6f0817d885cd59659357dddcd47
4a2c3f65e6efc5e199bed2d3dfc4e2371696ae80
24617 F20110115_AABGTU vieira_k_Page_107thm.jpg
f26547bd581c442257b447c7b8bd2505
04ff447fc8f2eac9fbc555631184c9a501d150fb
93578 F20110115_AABHAD vieira_k_Page_100.jp2
c01b2616947029cdef7cf2d6eddffc3f
c958dcf980f0c2ef042f26d13cc866a9809cbae3
79036 F20110115_AABHXL vieira_k_Page_014.QC.jpg
f07b1f826042defe224ca5bdb8f797f0
f6a91d324b732f6298e4e9898dd57441f3951987
1347 F20110115_AABHWX vieira_k_Page_098.txt
76bd2a155a5f309f2196555494a6f83e
581e1e518250406095c3d4ebe39fae4669c2eff9
1862 F20110115_AABGUJ vieira_k_Page_022.txt
ccf15ab1196f74a166a879eda307bcd6
407399c4e5ab2726dbaaf213b6aa26ee4b1b78eb
47396 F20110115_AABGTV vieira_k_Page_026.pro
ca19b5bb8febef44f1049f2f451f9551
d923ae5dc8a40f3dce41999b59c0a55fbc26520b
23603 F20110115_AABHYA vieira_k_Page_038thm.jpg
142b61264f85ff0306aa2bf96bf3904b
ea843b773b85f309959968764fe74a862928259e
76732 F20110115_AABHXM vieira_k_Page_017.QC.jpg
7266952331b32f8209b7cbe202859796
6725bfd292d865df75e34cf5812f819c1a658cd7
1992 F20110115_AABHWY vieira_k_Page_101.txt
7beafbc2ba0b6323c7aec64bddf1b252
933c5072d897b5716e9d77a23cffea229e5f81b1
F20110115_AABGUK vieira_k_Page_068.tif
ba72fc3c5b29bc47bae95543c4b5fccf
ea77694d53e16a558b330d88558a06020e9ca18b
20509 F20110115_AABGTW vieira_k_Page_058thm.jpg
63e32bbf3e365f18246e4c524455276d
4ffc713109eaf47a32f7eb5c61774f9b15828cc7
1722 F20110115_AABHAE vieira_k_Page_100.txt
722b9d7835b20b531fbef0e0274e044b
7631b1ea3b9abbd80422b6ed004a3fc44ef34145
23688 F20110115_AABHYB vieira_k_Page_046thm.jpg
69e751db33690f0154d8f043fdedb28d
ab804c95a3addba2a990af37825f343871768395
23429 F20110115_AABHXN vieira_k_Page_018thm.jpg
e280544c3159d7de32265ab186158539
33200bfc3845927d3aa33c6dbe78be0e5e26dc68
1754 F20110115_AABHWZ vieira_k_Page_104.txt
8cff91f2e19300b9e18c8e89f0c8e353
66cc4d63090110a99787da36982163cf8a325194
112819 F20110115_AABGUL vieira_k_Page_071.jp2
b4638bbe5904bb47f5c9ddf4cece714e
d2b1293feddf0a944ac9f15eebd93a3bb9123486
181920 F20110115_AABGTX vieira_k_Page_054.jpg
1fd7e1715a8290085e5c6cb70c626ca3
fa9e6eb72a25814fa9bfc14529de36f676429fb0
F20110115_AABHAF vieira_k_Page_048.tif
d915edaeb970680bbd83f0dda7a854bb
9851773d29272031e0a43753074dd08c0af55938
67663 F20110115_AABHYC vieira_k_Page_050.QC.jpg
308b5333c55e2792f0154a8acd4ff1f8
0e77c15da6b80e6ee08ab14b908c6e93055817bb
78808 F20110115_AABHXO vieira_k_Page_018.QC.jpg
b6f8367f986c1374f0d29f41cab6bacd
77330705c7c41774146f974605d282f51dacbcb2
35639 F20110115_AABGUM vieira_k_Page_054.pro
9d30cb079c47907917bae6fd802743f7
9a55dfbd7106ad7c5e34bce7f5fbc1773fbda84b
107906 F20110115_AABHAG vieira_k_Page_039.jp2
de59de808497fe80f19dd5bafc1eee35
bd7e2a9384130f3e6fc011fa342f70f14437ea6d
62447 F20110115_AABGVA vieira_k_Page_120.pro
2bae962eee146facefba54475cdba089
2e71c4c067a266ca810e879d8f8a2095c5bc2f05
95859 F20110115_AABHYD vieira_k_Page_053.QC.jpg
38c8c152f130ac06b50ca9b488eaab47
fda50e57f8c57dda86104bb19a768f8804abdf32
76937 F20110115_AABHXP vieira_k_Page_019.QC.jpg
9b7898396e77458a24b371fd73dbf911
ccc81c49192ba4099a2e4578794214b9b66e490c
24296 F20110115_AABGUN vieira_k_Page_091thm.jpg
57d4eadba4886ebbc745e189431606fc
7f1657e9c4a6a0e9d4b1bbe93a61843cc636a313
60762 F20110115_AABGTY vieira_k_Page_119.pro
62dd4165fab4bca882deca4d25d97f94
cd3dfdbd103405feff3c19f286339edbf2ded449
203563 F20110115_AABHAH vieira_k_Page_097.jpg
f6aa87b2810dee0ce744b0ed6c47ce12
4af9c0271964c50d37b6c8ca8a7e4d7fc62c4bc6
3183 F20110115_AABGVB vieira_k_Page_002thm.jpg
3a32bdcee77d972cd3e0103b2b3a660f
c8c311c4602d784b7a3f68d7cc62cd10d57116ca
64081 F20110115_AABHYE vieira_k_Page_058.QC.jpg
29712464545c6509e9d03fea10ce52be
b37bf51a49129aa73c3308fe274501ac20e0c01b
24167 F20110115_AABHXQ vieira_k_Page_020thm.jpg
958f9134d0cd3a0fd69c10166086494f
9c96e8f1eec315df4533a1ebd76fc055670a68c2
2059 F20110115_AABGUO vieira_k_Page_106.txt
128fbb49441b7b51acd4748aca7b3ce9
dc30dd9cd3ac6e3cd6f9193ca7f00bc234c352f2
15202 F20110115_AABGTZ vieira_k_Page_002.jpg
58145355c4aa82ca6014107f93aca0af
01e287c921f31b69f27c73fcd8e2a9fc788173f7
211541 F20110115_AABHAI vieira_k_Page_018.jpg
f96c991828135259cd24b6e81baa81bf
650f239cf9f561ac5deff1efe26a00c8f3217e53
25205 F20110115_AABGVC vieira_k_Page_108thm.jpg
ced141a389740ed1c0363dd2e4e44e0b
3bc6e8ed37b202aedefda10bfd77f1dd10212e6d
78145 F20110115_AABHYF vieira_k_Page_059.QC.jpg
e90facf8f61be4a8e63d88ee12cbe90b
71eef88b94dee9a11583626f44e8da64bb4035c0
79012 F20110115_AABHXR vieira_k_Page_020.QC.jpg
334eae56c6324b8daa52925aaad2c72d
309c80aca211114411ce29fcbcd270616e0f79a6
38099 F20110115_AABGUP vieira_k_Page_062.pro
889287201deb9c176180a462b9dd376f
d8cb01879e07b42b3b1b655f2568e93fa20a0382
F20110115_AABHAJ vieira_k_Page_055.txt
e7dd9d09098b171e0416855e40f347da
926ed1fd198c08d35cfd77a276295f6465021bc8
21216 F20110115_AABGVD vieira_k_Page_049thm.jpg
82267d8922269c12a8cd6ebfbb6e2e9f
59f017e01d4d441b9ff860793bd32ee2b19a215f
65174 F20110115_AABHYG vieira_k_Page_060.QC.jpg
712cabfa965c398d8c98e741b6ab2656
92bc75d5ab6bc4316375f0e440cfc602048a5afa
24356 F20110115_AABHXS vieira_k_Page_022thm.jpg
96f6f4f4c029ca9ad32ee188e0a3680b
f08933ab78dd0ea50beb62aae2a03063d6edd698
24022 F20110115_AABGUQ vieira_k_Page_105.QC.jpg
5766091833a5191b2d9869911388af49
ce27187db8cd319036086599a8cf42bd918ccbc7
843247 F20110115_AABHAK vieira_k_Page_054.jp2
5817ecd6e8f5910a695e8b9db59b3252
c927ff95d349c10f3b41c1d07a755853c5df3e1d
5966 F20110115_AABGVE vieira_k_Page_076.pro
a4571f59a658a20c380524d0d6e0e896
e602c820e61d0ff5735d3876a85e9b3ddefa770b
44246 F20110115_AABHYH vieira_k_Page_062thm.jpg
df7892c9d1aca1eb6d2d8cebc80cba9f
841fe910b340fa09682c0fafe7fc1eceb6a3255c
68399 F20110115_AABHXT vieira_k_Page_023.QC.jpg
7f941736249e506690a9046c3f217504
56bc7b04a7bf99b351af84e12e4e738b19ba6ff6
F20110115_AABGUR vieira_k_Page_031.tif
5c3aa18ef49d91e2de551618d9882c53
0acbee9591ef533158f5cada9c700321feb2c60f
80725 F20110115_AABHBA vieira_k_Page_039.QC.jpg
e88678c1a2e446e8cd567979ba4cafa7
e08153f528afccd83180217502358bfa65cc7a09
48626 F20110115_AABHAL vieira_k_Page_041.pro
f7965b3a8ade0bc03912f359bc5faf1e
92d433631143140f68743b91a46698497cbf9e61
1749 F20110115_AABGVF vieira_k_Page_084.txt
6a615d22956c0514167f6b5bcd791786
5ada3b545d7a69632e60d2100404b3b202b995cc
81677 F20110115_AABHYI vieira_k_Page_063.QC.jpg
aac8fcc76580bfe78363f798804409b8
03debff88e1bc18be3d28fabfd8bed91993742f2
48255 F20110115_AABHXU vieira_k_Page_025thm.jpg
7d7d07e857ebec20b10ba0706cbb06b4
9ff30302ee190972fd5d8c565d6ee2d7605e37c9
277381 F20110115_AABGUS vieira_k_Page_107.jpg
124203d601be3fc615a0cc064d8f91d5
dd225009b3fd3bdfcc41cf0d23bbdee6a6cae2d4
224681 F20110115_AABHBB vieira_k_Page_010.jpg
13dd0cdcfbd2e53028987c39c3909548
8008d3254a9180782c4148ef40d495c6f97e1e6c
78095 F20110115_AABHAM vieira_k_Page_065.QC.jpg
97ef827c6bb03d0a8c971fc7947b5b28
39ec265e29019308047ce775ef46a6813725cfe1
F20110115_AABGVG vieira_k_Page_050.tif
a29548f2b19682c197c22e1722909eb4
04cf6f2d3a8de0864f323ae775ec53a439a13679
93198 F20110115_AABHYJ vieira_k_Page_066.QC.jpg
76e870b8f8c3b48896959a8440c8aeb5
b77fd088c1fe23bf5941b3f4cc52e7d47f2a0ed9
24594 F20110115_AABHXV vieira_k_Page_026thm.jpg
f08873bfd93bdb34b6ae8d576296d8ed
a46213b44397cf2a015854e918ada08b0b59e8c4
195166 F20110115_AABGUT vieira_k_Page_083.jpg
561a387640bd90bb469560cf7cd0f012
0fd9d02a42accb2e5ce04195e933ffec2ff29e26
F20110115_AABHBC vieira_k_Page_072.tif
23a138cda4c61e38a64757f923de05b9
f4b1534c2d5502cc331122cfe38527b94e9c036c
286441 F20110115_AABHAN vieira_k_Page_009.jpg
6303d4ecb3b74697de1228fef76d29a1
448749a4f5e0c19cc465e90295f70ae87ba638f8
107211 F20110115_AABGVH vieira_k_Page_014.jp2
7258b5641a2c69061182f9a8a6ec586e
784e4f12e2fe20997ac88fe43bb8fe37374dff8d
43491 F20110115_AABHYK vieira_k_Page_069thm.jpg
6623571e6e5dafe1e2bc00206a582db8
38ef39bd76d628fc2fb96f1b20fbc66105572cc1
73310 F20110115_AABHXW vieira_k_Page_028.QC.jpg
bb0ab9e340c3dc4d37a5c0d358292928
81ac84facd0a3c02451704da65a4444372002c5e
F20110115_AABGUU vieira_k_Page_026.tif
06e2dd5a09fcadf8a1e512b9c94c9f1a
d7bf066d87d7dafdd4b1fe0b5b90037674453b70
F20110115_AABHBD vieira_k_Page_020.tif
8a4dce1d082d620ed102c951907ef67c
5b64e0fd08dc363cc460324266baf444752fd6eb
89157 F20110115_AABHAO vieira_k_Page_070.QC.jpg
b018e1838bf611be9f4f86e23a9ab53c
ff8a590ef35c9e8b2390e068635e20cbdb347920
140918 F20110115_AABGVI vieira_k_Page_115.jp2
3cba762f53e7731731b36a954b9fe9fb
713cc218c4ff1c627dacce5bb909acc7afd8f908
25413 F20110115_AABHYL vieira_k_Page_073thm.jpg
e7544784012ac44d96a4b5557fcb6340
64891ead95d6e2f99656181e7fd5a12f25e133eb
73798 F20110115_AABHXX vieira_k_Page_031.QC.jpg
a78669e3a0b9e8ebcd6eb648836c0e22
37374b9f63ed234003a7287eacea6ec5c9672cc9
F20110115_AABGUV vieira_k_Page_037.tif
613e3458d3d7e1a13095fdd9133a2f6f
5e446b4f66b6b83c735411466b0f6f269e7a7100
36158 F20110115_AABHBE vieira_k_Page_069.pro
e215e1fab49c2d546e3d8f302239fc1e
d8895b3018470f2e9d8147c6dea9eb1dad1011d6
F20110115_AABHAP vieira_k_Page_098.tif
64d0eeae2c7cd53378e856ac483e388b
acdcfcd994672e77d7d4b831b066b286dfb3e545
20696 F20110115_AABGVJ vieira_k_Page_033thm.jpg
c93e5b76b0fb31a7908fd4ce47224cf7
85abf9067c5ce43e147a646efe2660393cdee084
20117 F20110115_AABHZA vieira_k_Page_106thm.jpg
7e4937e8c0548aca007a1f70343c0523
5525318a49e658c872e05b9ac921d70004f0e5d5
75887 F20110115_AABHYM vieira_k_Page_075.QC.jpg
661ba1fd873ca75c163527958c3103d3
79c49ec34ccab4afd2668ef5b6bc56b6bde56b33
66109 F20110115_AABHXY vieira_k_Page_033.QC.jpg
5edbb3e8542613f7a55d7e361c7bac69
4bc69e4ca9cf1a23b26ed926e2d1c086c3aaceda
F20110115_AABGUW vieira_k_Page_063.tif
72fe452e432934de2016a694bf2027a4
d6620eed26317e3d3a537aa7c1df6c94ee0e431e
258986 F20110115_AABHAQ vieira_k_Page_006.jpg
6151edcab0f847a47f41d1514ac56ab4
59e784aa95c515808267c6431de4932dec951237
105358 F20110115_AABGVK vieira_k_Page_017.jp2
a64bea02aeaec04292761584f6b293b4
50284420f310cc2d5b2f5ddc15ab10e74a322196
85068 F20110115_AABHZB vieira_k_Page_107.QC.jpg
50fca71268b681b5bf61843c71a08f58
ca206410c431b2e22f89824691ea65aa4ab19128
45359 F20110115_AABHYN vieira_k_Page_080thm.jpg
e3b10cdd5487ae9c630b73f2414e9506
b863aeb273f3e6b6c349531c283bb3eab89be2ac
75202 F20110115_AABHXZ vieira_k_Page_036.QC.jpg
cb4b23f098c5fecf7be64c489044877a
2c7e8d9271ea2ae0670b29db90dc33c0f3c40cd6
1534 F20110115_AABGUX vieira_k_Page_125.txt
52e3ad90ffc345a93adb962fa6f20b6d
b14e862bd5fbdf149c63ab5145462a2c4c946063
45177 F20110115_AABHBF vieira_k_Page_083thm.jpg
96481dbd9a217b23c669267996b6155f
3efe60ca535cf69aa1c37df1072387f429450f25
F20110115_AABHAR vieira_k_Page_040.tif
0a204f946249675e5751eb8117a29379
8e0ad1eb89d1646014909bf20eab89649e512de7
F20110115_AABGVL vieira_k_Page_062.tif
bcb1aa3db52b3d2f69da107495530423
1eeab8b343be55709d8af543cb831bdb53f00e14
80287 F20110115_AABHZC vieira_k_Page_108.QC.jpg
1c53b9758debb69cedaa7085e7077fdf
19de70e13f474bb01b41bfa021d7b76c9c2c2071
73949 F20110115_AABHYO vieira_k_Page_086.QC.jpg
9bfda452f48b818128ee4d6d93fe42e6
5f71208cae7d214d65b225dfd629877d1eeec76a
102007 F20110115_AABGUY vieira_k_Page_026.jp2
698fc3b7a2d2bc480af24ddc90997f35
6b12f1c8f1bbc0856f9a720635676a4f4ba0ab3c
74436 F20110115_AABHBG vieira_k_Page_016.QC.jpg
8ef3bee3fd60a73cc6a0654e885a88ac
65c2f592d1764c7a73839159e71a8746ad402e4b
75117 F20110115_AABGWA vieira_k_Page_072.QC.jpg
0b3a36bc9b71e4ec08c5586ae7f39033
0c361dd70f93d3beef028deacb4b1f54e3199ad9
F20110115_AABHAS vieira_k_Page_074.tif
f9af18aef1075a24e71c6b2484f8269c
8b9acf3c3ac752b6eecd7f215cca5c78df6eb8dc
46558 F20110115_AABGVM vieira_k_Page_068thm.jpg
ba784b5d7ce56f7b32d0fd444d46e379
e58238f7fd083a67e1d03c356d1b86af76325835
25026 F20110115_AABHZD vieira_k_Page_109thm.jpg
f9387221787880e3cfff65b3e1ba4206
3b744dd517cfb29f27c406334186bdfde33ff95b
43836 F20110115_AABHYP vieira_k_Page_087thm.jpg
eb2a943825e71286460b3806978e6cbb
6aac3bd87f5cf539d9fd3650cdb1f65cace29cfb
24480 F20110115_AABHBH vieira_k_Page_078thm.jpg
72cfb8808a6929a4c4206b1d637ba0b1
3dc38c779bd259c551d35a54cd7681b58846f2fa
468 F20110115_AABGWB vieira_k_Page_001.txt
740e00e161de4be69ff3d3735cb03e0b
44802947d8af868a344bc115a51b92f2eb678348
F20110115_AABHAT vieira_k_Page_115.tif
9af73ead0c31ff3165baddae28bffe3a
4dbe98e58c2a5a7057d85f035b975984bcdbfad3
F20110115_AABGVN vieira_k_Page_059.tif
439a697b737fc91606c09d3b83447fc6
6b79562c748d91083f51f45e0f30a76644c45afd
83318 F20110115_AABHZE vieira_k_Page_110.QC.jpg
6f76596eeb893aa8404c35909d437ed2
7ad2f417264ba5bc4853f235c7769b302c93c79b
84234 F20110115_AABHYQ vieira_k_Page_087.QC.jpg
8e4319d6210d3dc1fc0a40b8b1b34633
527e31d6de4fccc6e244c9a0d5f697f28e3d605e
2041 F20110115_AABGUZ vieira_k_Page_073.txt
82a5f11cc6159baaa49b1c8d020d66cf
0266c5ba37fe6aeb30b9ced44b5f643bb42fcd76
96210 F20110115_AABHBI vieira_k_Page_025.QC.jpg
715f5a2eb0dccccd78ed311eddb806f8
08e7824cb83986d1e59329d0f8f596db4b448f10
1897 F20110115_AABGWC vieira_k_Page_048.txt
40c3edb940fb7179755c7ada2cc650ba
e05027c08b11390a979e848b9a997c3799934375
77846 F20110115_AABHAU vieira_k_Page_041.QC.jpg
73b72418f98fd2eec5e184eb8f232a63
d3cd4aaaf848145ceb57abdb83095b4a4a7d4e67
102526 F20110115_AABGVO vieira_k_Page_103.jp2
e243e566dcfe3776978f471236df8016
74a768b7874b467e80ca6bde6d55cf08cd3eec6e
87597 F20110115_AABHZF vieira_k_Page_122.QC.jpg
8a56ef8ed2d55b435e47708212d53256
63bb04daac0ee19e4e236f48c5ea3c7f6e00c2a2
25295 F20110115_AABHYR vieira_k_Page_089thm.jpg
cecd5034b72c99ac2d91f74633f59d6c
3222104103fff2349c8ecc6d00beed72b3df5496
25034 F20110115_AABHBJ vieira_k_Page_120thm.jpg
bde526089d811c08cc3091a8c5de338b
c007ff2ca30ba834259a19148339c73adb8b9d96
24160 F20110115_AABGWD vieira_k_Page_028thm.jpg
ed66c83e09782f62dd3443e70524f7c8
264b368906e0106cfac8eefc9a3d2f6202d19de9
40018 F20110115_AABHAV vieira_k_Page_013.pro
0068d22f1d99921c1df81c63eed1cb5c
e20ce325c7a0c8e1e0cf05a2ded378c2b3bc16b9
81930 F20110115_AABGVP vieira_k_Page_034.QC.jpg
fed0773ec37753e20779b4cf4df8c90a
796591a4b09549d0b9e25d49ab301076e2f8d1e8
144926 F20110115_AABHZG UFE0008363_00001.mets
0698f2282206b2aec97bc69186c86900
24867deae0a475682151897b16a2396edbb7554d
76715 F20110115_AABHYS vieira_k_Page_091.QC.jpg
be332ea38d96c0af8d6e37dde6f1a719
6cc6445ebe5839e37fd3331be6c3b41fa350f20e
75997 F20110115_AABHBK vieira_k_Page_078.QC.jpg
2d3412a55e8a25fabbd9c7ea9f46c15c
a7d505e216bbfbedba52dd2b30c6c82adb3b8c61
F20110115_AABGWE vieira_k_Page_097.txt
35a09a1cc2db20a873f57734d4d9796c
c31c1332a85e547d0a63462f9a7e917e09856dec
25000 F20110115_AABHAW vieira_k_Page_016thm.jpg
bee6b4f8708b49fcd5967bbbd2de0ec1
1498d592552e74ef2cf3f6a25ab10c26cf5f8003
87108 F20110115_AABGVQ vieira_k_Page_064.QC.jpg
fb43df1b44eaceae99c27183dbed785c
afcb6e9395e1ddbef24e3a5b48cc0a44557b5e2a
47143 F20110115_AABHYT vieira_k_Page_093thm.jpg
cdec1d420f45674db74511b29f87bc1b
2ae359e1f36f237b561f73aece5cf0972b377a5b
2338 F20110115_AABHBL vieira_k_Page_009.txt
0abaceffc5a91c81b6c1b8e3366c6b30
7a5ae2c1153d5cd2fa9975f0799f5303c82a390f
1607 F20110115_AABGWF vieira_k_Page_094.txt
0837afa0704e61660af4a70f16722c7e
a3f714e7af139ef94b7db54ff0fc2bae3b5a8516
5607 F20110115_AABHAX vieira_k_Page_076thm.jpg
68ee796d1c70116e382baa7214dac1eb
d4f0856cc8a7b927d851c8a7a1ca8a7cce0ac0db
2013 F20110115_AABGVR vieira_k_Page_044.txt
5c058a48a8e6cb4889b0d02f4773f6d5
4d82c7fa3997025931af294d5d52366bef3dade7
2003 F20110115_AABHCA vieira_k_Page_075.txt
1ecc62e8b37ebe8251ae0da1cf6aca34
196919c145dab0f7add89ed044fd110bc9f3a846
91080 F20110115_AABHYU vieira_k_Page_093.QC.jpg
ef3114baca3eeb6f2fe409da4ab04029
c57e1606592f78047565b85df39a69afe6de91cf
220303 F20110115_AABHBM vieira_k_Page_039.jpg
64e497e06b02163467dabeecb81bc9eb
c46781d48fedc2753565e7da30611f18cacfd2e2
40766 F20110115_AABGWG vieira_k_Page_084.pro
0381e1b0cd47dbb56786defcec977750
c2a4f31eeee03f636947ef0d05c2b0be42922ed0
68633 F20110115_AABHAY vieira_k_Page_049.QC.jpg
f375617f61f58e7965039c261251d448
eb972ef11e00a88547ee3a9a1a12e072af75f31a
94259 F20110115_AABGVS vieira_k_Page_092.QC.jpg
061f21208cdc8289386921c6fc719e58
208131539f7db7f944c4d6570681aad1084e4a87
90231 F20110115_AABHCB vieira_k_Page_006.QC.jpg
da1c49ced6f275bce2a55728a519a08b
3ffd1786ee03985e3bb28275647de5cd9c4c1717
47155 F20110115_AABHYV vieira_k_Page_094thm.jpg
c0d4ebb0da9f1c21906c276e02a47b3c
a9a5f6421517ff75847fff8543196b5d72528de5
203379 F20110115_AABHBN vieira_k_Page_028.jpg
f9472de62e90003090c0dc09d4e5659b
1b7473581c1945cff1a2098a777d11ffc11781da
24790 F20110115_AABGWH vieira_k_Page_021thm.jpg
1edebcaef1c7d2f0decb546428cf4c0b
cd8b998fcbe637c705aa42bff7c1defc4555c674
138115 F20110115_AABHAZ vieira_k_Page_111.jp2
6a2b542cbba60d89c3321ee4e53344c1
c5cc07cc3219803e6d3344bc9abbb31d9757fb5b
48853 F20110115_AABGVT vieira_k_Page_103.pro
d350bf6d1f68d6040831bd9ffb7b200b
67eac0bd6573346a6eecbb77a455551a2731eaa8
F20110115_AABHCC vieira_k_Page_035.tif
47f5fcdd676e4842a2bae5391a4abf82
432977adcb355abf884adfb5765a3d3af377b4f2
72385 F20110115_AABHYW vieira_k_Page_098.QC.jpg
87306183095329d8506676f0a0d7e902
f1afb1672c75d221566dd9b6f9dff4ba72cab73e
280 F20110115_AABHBO vieira_k_Page_076.txt
181a2fe613da65693bae673fd0d907a7
2dda50314c3bb6aec49fd79c6e547ceb8d483113
F20110115_AABGWI vieira_k_Page_117.tif
0571f5a5d5866e52541d1ebd067483c2
21acc6f6927804f0bffcba6a16033c874e3104ec
97622 F20110115_AABGVU vieira_k_Page_023.jp2
a2f1b3bb77ea5bf67fe625e67c41aa2c
ef0f0a740870e6bbd68e08d549234bf3adfc8c36
1843 F20110115_AABHCD vieira_k_Page_046.txt
a1ff794d5ee7251767a46c2029cc5b81
ddcac170a0f7ca5ba02d07c85568b2d5aa02c30e
65245 F20110115_AABHYX vieira_k_Page_099.QC.jpg
5bb850f7bf1e4d0a036975582200c419
4d4a2df744b30e3951d6ca16ace01b0e647b7ffa
21786 F20110115_AABHBP vieira_k_Page_100thm.jpg
0d73a67bd6ac9218f6fc41f5c438f27e
fe49055382e4ffca0ff6bbb458fca942b6ef3204
23540 F20110115_AABGWJ vieira_k_Page_042thm.jpg
b3d344eff6c73c31b61d7e90ff9cc679
5e021328173aae2aecd6e757cd263fe312d9ab8c
60701 F20110115_AABGVV vieira_k_Page_108.pro
d36a2f62ca1e95f4e35c130194ecf249
806adbab849dc5425da9922a7e50011ed3a94303
73508 F20110115_AABHCE vieira_k_Page_038.QC.jpg
a7ce105928ea681b252f337a017a81b5
9a4d05f8b39b0a395e8fb9406e0c4722316d7f22
24802 F20110115_AABHYY vieira_k_Page_101thm.jpg
305e5979ed1efa2f9991aed8daa11c37
77d4bd35e2151d260a24ae616b9f3f4fd419b4a5
100371 F20110115_AABHBQ vieira_k_Page_102.jp2
440151325dac7c0503e80f3da6109817
297f6e23c68c5d2ce49d9ca227bcb9cc19700e95
F20110115_AABGWK vieira_k_Page_123.tif
e733bc610b98505ffa4a8f34b041159d
401e9c0eec7125d9f1aa267bb43414eda91bc84a
102658 F20110115_AABGVW vieira_k_Page_065.jp2
544452497c08425a9191015495ad850a
18243d7e693e102e1bea556477fc1c27885f1873
23652 F20110115_AABHCF vieira_k_Page_036thm.jpg
a6dea083638073b6b0a9f5be042c9899
673ca1cbf9a3f9271d6bfb40a974ebdde40474cf
23930 F20110115_AABHYZ vieira_k_Page_103thm.jpg
759ac4721549434a3b8105a64ea79790
2a88a49189531a88c2acb2738bf44ab391ff228d
F20110115_AABHBR vieira_k_Page_007.tif
485ccec53d43bbdb54cb9d4ce1844ac3
c9f451bafb6f9a4663dfe518c1c49125d17cc62f
65152 F20110115_AABGWL vieira_k_Page_107.pro
d81b9f630a72f8479825304378465310
f34b4371acd2569f5423e58c0ab54efc945d6ff2
F20110115_AABGVX vieira_k_Page_006.tif
1137de9f73621ffda99e9afc55895efa
f1951d6932362377e0904091d209799884f1879c
76573 F20110115_AABGXA vieira_k_Page_043.QC.jpg
97413fe3d50fde39661ac8dda591bc39
ea2352dbcdebc6d822d193bd0474008498163ff6
F20110115_AABHBS vieira_k_Page_042.tif
ae2b6f4bb1eee616eda15a26410ee7db
d0fe2a0e6e8232e30f51717d5b073f5b5fe70d15
975397 F20110115_AABGWM vieira_k_Page_084.jp2
f112b89e1263f88e4fab268402d08ef7
37d3f3ceedf6fdcb2adcf49200b7ccec6f867436
65749 F20110115_AABGVY vieira_k_Page_013.QC.jpg
3f4a1f7cdaef372215b2f95178c6ccd6
ac7c967944cf177042739a38f84672a3266f5806
F20110115_AABHCG vieira_k_Page_061.txt
b597dc372184c63c1f9c30bd7400d5c0
553a52289e23fc67886359c697c2cdca5a1f0b2b
26021 F20110115_AABGXB vieira_k_Page_063thm.jpg
a77d4e0b7459c4ae16e1565af980fdfe
1d86153133e2ca6f9b7f3254ee12054378e9fe51
207029 F20110115_AABHBT vieira_k_Page_038.jpg
53dad9f3ab6d9283281eb8f39b6a1128
735e0ea31d38f777a179374f9593a65dd798fb63
102441 F20110115_AABGWN vieira_k_Page_036.jp2
3b012da930c7846b8991db09c65f3581
065882940c2734338f7ac812f34ce7e4049b1ed3
84084 F20110115_AABGVZ vieira_k_Page_120.QC.jpg
973c98d06dbcc9ab0ee92906a4e17795
aed31736210d983b5230310e5a24e5facca3a7c5
37063 F20110115_AABHCH vieira_k_Page_093.pro
303385abc6f6cc40a77682d2b3d37018
5ff8d8027201f282200ae8739037a9eeb6d7efc5
F20110115_AABGXC vieira_k_Page_063.txt
37d2fc5ce59aba2d1bea575f1008f95f
9d9fdc9f60eb5ca163b4daf6db47f3644509b573
37487 F20110115_AABHBU vieira_k_Page_094.pro
a121697748bc5204a47129b75e53d0b5
f4faa8415a7c5c6e6be6f18d43da175f08b90b5b
191202 F20110115_AABGWO vieira_k_Page_040.jpg
13cde38f748388bc0c21526d17ddf666
4e18cd6be1e2b988af893584ed3e27ce87aeac68
F20110115_AABHCI vieira_k_Page_025.txt
2a3349fb99bb37fd4111e4b10570034f
1726257cc966c77452611c874ab6758046af2b08
99671 F20110115_AABGXD vieira_k_Page_028.jp2
f7e9e53df8e5213d1751e8a9a2b91ac3
47a02ffc2f5bbbf36bd71cd6cf170340c82ae95d
45365 F20110115_AABHBV vieira_k_Page_079thm.jpg
ea04893b610fc844d081771a7dbc8f03
eec1d20ae527071d0ea5da773e2c1ae2a406e3a3
1927 F20110115_AABGWP vieira_k_Page_062.txt
af33cbd6040001914dc94a7b0f46189b
4183b933b87d1155268a47b5ab30d97cad00bd12
42601 F20110115_AABHCJ vieira_k_Page_100.pro
89f36550a4ddb9fcc44be536eb83b4f6
ad672aad210217c60d463c5f6c5b5fc1ac797996
1708 F20110115_AABGXE vieira_k_Page_099.txt
cea974aa7c90ebd820cfabca6d191cbd
fb1b15dd278c7df8025c024bbdf3e9189dc06a15
213503 F20110115_AABHBW vieira_k_Page_048.jpg
336c305d2fcf0abc26f2bd9e858ca2f7
4c0aac8243cc163c59e6296d1d9458f7ab6e2d71
92272 F20110115_AABGWQ vieira_k_Page_080.QC.jpg
16100bc0b8585f05bebacf985c66f578
412b6c954e8332042488b23e9f59488987e743f6
F20110115_AABHCK vieira_k_Page_065.tif
67191eddd7b3194fd04832d24a6c36a6
736540377ed643fa59d3e83590e6519799b5a356
182005 F20110115_AABGXF vieira_k_Page_077.jpg
c8b91914a7965df5d9c59556657db0ad
b321ed5e4a28fda4907557062e46feb91bee9bd6
202259 F20110115_AABHBX vieira_k_Page_065.jpg
82839ca3ab62e7268a2d3dc824d7416e
1463f461608255a71c27cfa6f03c98592d7443b3
49182 F20110115_AABGWR vieira_k_Page_014.pro
0a89ed110dfa72ad13df90a30a0dc9ea
5989de13b0dc4109a1fffab821311f06275cf06f
25513 F20110115_AABHDA vieira_k_Page_051thm.jpg
1f25d246b196a12b540c92dabc152f6f
2d330c7cc7203213688c542c435973e9ed8fb389
213194 F20110115_AABHCL vieira_k_Page_047.jpg
68891877a1d0914ab3aa65d1d128ea60
e0568657f5a068df70ccc319acc4e2fe3397581a
49180 F20110115_AABGXG vieira_k_Page_078.pro
c839f309bd953b1b63216ca9bdc5fdc5
293f9192757d8f76d5742da730c3a25b1eb4390b
2589 F20110115_AABHBY vieira_k_Page_114.txt
8dd5d70c923d120766a6950d983fc369
a9f0845918dbf00f6d179d84f11274c17eaecf03
183891 F20110115_AABGWS vieira_k_Page_104.jpg
57f30b7f7825fcd6de260079d124c6c0
8c12189225dce87a88bed0e7c38cbefda2ec863c
F20110115_AABHDB vieira_k_Page_014.tif
886a1de6b27d0bc17607a8bb173fc67a
58b7e448935f3a754c0d5cc6b3fa071f55db2c5b
2238 F20110115_AABHCM vieira_k_Page_090.txt
7afa700216642553284368840db2113e
b9703d17c80465912117916597df39207888b8a5
F20110115_AABGXH vieira_k_Page_010.tif
4abd71d4416529ef67822fe6dc57f361
acfee3eedec54c3d46204e19cf68a1ccd428b02a
209841 F20110115_AABHBZ vieira_k_Page_021.jpg
da566ec716fe8dbfd375e81ac45d7c7e
9c20743bd57f927fc3283e23ac9613f04cfb6daa
1051980 F20110115_AABGWT vieira_k_Page_068.jp2
5092fdb46f998b0c21c551db35a276c0
32dc8b08c6ab974c795f57ae790ce6b99bd862b2
45262 F20110115_AABHDC vieira_k_Page_085thm.jpg
646820404cc09cac14dc0d78ff97e7f1
902a31cf72af314188e1c1ec932a7d65b969fe07
46385 F20110115_AABHCN vieira_k_Page_043.pro
623facabdc12ebb80a4d9ee8ef05aa0d
7715b756f1d768411bfaaa0e8d8e2da6a3ae97f3
64842 F20110115_AABGXI vieira_k_Page_105.jpg
61ba4a2fe44b6cfe4d48f842aa06e1a9
9dda605f7c51be7bf1be90bd99b1bb9dc7ecccd5
200865 F20110115_AABGWU vieira_k_Page_019.jpg
a3b63ec105f5b6a2139bfc3808bf3ca4
8176b18be69e07556a2d13b647f4788aa0d8bbf7
100294 F20110115_AABHDD vieira_k_Page_012.jpg
9a06858fd2e5f2af2018c3f050908f76
6044d8925589107469eb11677200aedf577fadfe
202863 F20110115_AABHCO vieira_k_Page_015.jpg
6d1b90d0d8968162ceb203e55eaa6bd9
97c07c50eba6fa7d84e6507ef36c0da520e2d1cb
F20110115_AABGXJ vieira_k_Page_091.tif
23dd0da1f39586786a5602e5640e8f28
7ab803e02977826cc3f1b14e1d4b067b02e24f70
107680 F20110115_AABGWV vieira_k_Page_052.jp2
c26a00c575ff422b8692530096220325
bd3e57bb07839bb8696340081241a8e65aecba9d
44832 F20110115_AABHDE vieira_k_Page_023.pro
5d360bea69b0d676ad495726c413d83d
a7b1bca384c04ceadd43d5de477d155f6030d363
1828 F20110115_AABHCP vieira_k_Page_043.txt
a34b92e7874480130a6e091a5ba3a91c
dec87dca4c12c5b7306f4f6fd4386371915890af
202451 F20110115_AABGXK vieira_k_Page_046.jpg
8165472d82d36fce2ffb92a2f12c4c25
5577b8cd805cde8042963b97e1638b36751717be
89983 F20110115_AABGWW vieira_k_Page_083.QC.jpg
b337404a9f48dd4c0b1828a90ce52ee9
210c79e49cf07d01ac73df9567b5d1a9c9439ff4
65781 F20110115_AABHDF vieira_k_Page_077.QC.jpg
9466091c0f172666b333363af29e4026
5451374b57a76ccd22d040cd54cb08275911be8a
75414 F20110115_AABHCQ vieira_k_Page_096.QC.jpg
e570d747836f1dd949aceecb5c0071ac
53acbc9c8f8c64b8e04c6319c985189d03914447
200508 F20110115_AABGXL vieira_k_Page_070.jpg
62d7d20c01c00aa3818d2063030abd13
5a10f860408bb90baee0cf4212bcb5b0cb01750c
82022 F20110115_AABGWX vieira_k_Page_116.QC.jpg
e3b14ef42e2d07de3afce9353495d1a2
257eb5811b5c6d2230f1608d84302fb69053d1de
77719 F20110115_AABHDG vieira_k_Page_101.QC.jpg
07dcb03743fccd1257c05166b9872fbd
a4400f673d3c87c60ab86159a146c0e4845ce69a
24763 F20110115_AABHCR vieira_k_Page_059thm.jpg
f7162d8c8f667e3ebfd809de2361a6e0
a2bb3687055e9783e5a67d6eb7ab898b0bd4dc9a
47232 F20110115_AABGXM vieira_k_Page_031.pro
234b9f10ab696c55e01a0d6a91a33b1c
9a78bdd4b369ca6f8e98a3b1fdc037addcd68c03
109801 F20110115_AABGWY vieira_k_Page_034.jp2
f543939a2025a74424bcefe240916469
76a0717e813fea7dabbe2a550020532f93238cba
11761 F20110115_AABGYA vieira_k_Page_003.jp2
47e47d60f45471b8730854d0c6a55411
2287011348a87f951712506fd8595a1e4d4b60be
F20110115_AABHCS vieira_k_Page_019.tif
2c9d868af7477c014887647d662f368d
738976bf37808f8dfd8fb9b953f7e4457e90aefe
24398 F20110115_AABGXN vieira_k_Page_072thm.jpg
258beecdbac986c526350bbad527cc91
1aaeb3f4312593b6744464247f7cbdcb48906d6d
203628 F20110115_AABGWZ vieira_k_Page_096.jpg
c554785b1482602323944991a826798b
37d7b99dba005f787e92a651313586b0df3a40fc
25489 F20110115_AABHDH vieira_k_Page_047thm.jpg
80010e4e3a46e0488025a425e40944ae
3241b8789124bcb1ff3a609cf72c61574a1d62aa
2637 F20110115_AABGYB vieira_k_Page_121.txt
6ded1e956e082f67be24c86a463faf60
c5aca66546907a838d58159b07f3a5b05e5164c4
24985 F20110115_AABHCT vieira_k_Page_075thm.jpg
3a64fabd152450d3be5e89c2ccc534c5
f93fd12a3e11d3ac8cfd9f571a37c132ee6d5b2b
22102 F20110115_AABGXO vieira_k_Page_023thm.jpg
0a61cd5f2cd91e7d10bb1782f18f07bb
03e30941e52c6d08ecfaef611d3574c0a3493332
F20110115_AABHDI vieira_k_Page_061.tif
e3519fb7acdb4f9f8965061153f89770
2721655dd166cd6da16f933a89277d148e980e67
44622 F20110115_AABGYC vieira_k_Page_070thm.jpg
dcb0f729423cf259b74a1055e904fb38
c700379f83dc566c9cefc00734527345688e2cdf
1051957 F20110115_AABHCU vieira_k_Page_080.jp2
b64abd9377201c61db03c303ec482090
d295e65d9f05d8f4ca91fde4447758f017a0c620
47259 F20110115_AABGXP vieira_k_Page_092thm.jpg
1a524a607a91fbf9970f29221b3bf7cb
e2db011a35d286bd25514ae005e20efe0d0543e5
F20110115_AABHDJ vieira_k_Page_125.tif
46b250579e121665ef91639890c5cefd
c9f17abdb8484be94dc7d23d7c4f0c6b54faea8b
42172 F20110115_AABGYD vieira_k_Page_056thm.jpg
b4a17ffd021397d78050f57c65d2fda9
700123dc1bf2395fbf8e490215c2f916e20a53c8
F20110115_AABHCV vieira_k_Page_102.txt
e2d2fc5733145abb48319f7a9a79f87f
4c1bcb8140d424e1eeb411300924865473372803
181292 F20110115_AABGXQ vieira_k_Page_049.jpg
13d3bcfbccfd11f35787f69ad44a1d79
c00b4d52d5fb4971e371157024759fd6b89d8b90
208439 F20110115_AABHDK vieira_k_Page_030.jpg
bfed73abbccd8c8b47f2208530e60d95
b080e83875a9d09e61796caf945f4f7c90a526a0
F20110115_AABGYE vieira_k_Page_030.tif
b64b8af724972ca89559be1a5acf183d
600002eb7fdbd77483ad407f8c06b94d847ef5a9
2562 F20110115_AABHCW vieira_k_Page_113.txt
ba7d0e61fd9af8933498928a3e779ec3
7a2d7b87b0bbc991a3fa77776582e40b79158017
219285 F20110115_AABGXR vieira_k_Page_027.jpg
7067c8f7b9952aefa42ebbab44707e91
55f0a60f70d0dc6703fb36aabf1eeb93f06024b2
F20110115_AABHEA vieira_k_Page_079.tif
71aaa327b73485a302c9926581bbec91
d0e7a69124d6164c048adeee3f0d8571d258b12b
22187 F20110115_AABHDL vieira_k_Page_124thm.jpg
6ee24cc58cfa87af6370b506dff79d3f
faf741270fef82d30b1bba7ce0dcd4b854078fd1
1688 F20110115_AABGYF vieira_k_Page_004.txt
e338ecbb60cc1a40f4f972d294d46afb
8230c892d02bc26aeff45deef7d7adb0fe56ff3f
1025902 F20110115_AABHCX vieira_k_Page_053.jp2
b03f24275dcb69607d06a9ddaf74840d
c33859cf6511ff1a6ccac417e9003969095b5d05
93985 F20110115_AABGXS vieira_k_Page_050.jp2
319c947d781f21d84fb6fbbeb9fa7911
58875933a5ba039cf7b7cb83922abb4afb422d20
1416 F20110115_AABHEB vieira_k_Page_087.txt
5a6f90c69b9a4570ce80bf168049d3b2
5f634b0bba5096a859f6e63afa970fdbc8d8b9de
72261 F20110115_AABHDM vieira_k_Page_040.QC.jpg
60b8456a6442d713fa762f767a49c1b0
d0010457856305e62e22257792a1b7cf10998a01
F20110115_AABGYG vieira_k_Page_052.tif
4d7f5248fb5f65d3d276569f37e88092
8e8059a6f92b692abe3f98796709afecdb0f386d
957996 F20110115_AABHCY vieira_k_Page_079.jp2
d962db86f719b6edfc2874a235c0e360
971a97a4aeaf41bb6761793175db8068d58bbfce
23109 F20110115_AABGXT vieira_k_Page_012.pro
0c6598be2586598f076378fdd6bacc86
55412ccd859077bf6012781945e9735a412b8dd4
25843 F20110115_AABHEC vieira_k_Page_115thm.jpg
cbb503097978640ac131eaa6abd4ee79
1ee6e229898e57419c58596739e87505254f8849
14349 F20110115_AABHDN vieira_k_Page_012thm.jpg
a0b9807faa0605b744d7d2b78e61ec06
b457e4e8c95993142b95841bffb40ce56b0cbe52
1973 F20110115_AABGYH vieira_k_Page_018.txt
3c2f3033b8f9b98ac9cf20510b133c38
22ec96b6d6394f32445eabe32b576c7c5e0061dc
41880 F20110115_AABHCZ vieira_k_Page_088.pro
5350422a6915864e55d73bd6d541453d
be37cd3566c782b5fe6c0ef568477a215aecbb76
F20110115_AABGXU vieira_k_Page_061.jp2
99c0a3f02763ab9fefd55fd7ed5ae755
ac74f25da2f7fb5fd268ba03d42cb0abe570043b
201594 F20110115_AABHED vieira_k_Page_024.jpg
913c479bfda84066d44fcf05f68cf187
f5cc7926a6a6c4d9a8c4ee8f4e47539d543f7230
F20110115_AABHDO vieira_k_Page_122.tif
4832c279ee1e4a0541a667c91a151b55
33f9bbb118061dcf0172b7cd59e05d6f18f5aeab
F20110115_AABGYI vieira_k_Page_110.tif
483e3c35a235f46b37778494c9e46dbe
09f2050443e9bb6577c5a0a9086fcfe744354db0
85158 F20110115_AABGXV vieira_k_Page_123.QC.jpg
57b3df6a13ce1a9bd5b5cacfa40d9e8b
56756178d3af195a5b3840e77d95827f2b1eba0d
102652 F20110115_AABHEE vieira_k_Page_019.jp2
4d4cb94f90f071e2728f040114769e7f
408fdf5e66d21dc33b71c4d3c28e934995b30601
2715 F20110115_AABHDP vieira_k_Page_107.txt
8023c3715a76592fab6308e2912010a5
83ef10a20338e88afdfbfbc6a5fdc259e5eccd42
79031 F20110115_AABGYJ vieira_k_Page_081.QC.jpg
10c997a5b0118c3640e3b90df447e62c
7fe6957a5d0d9f56664e2baee4fd928d6434596a
F20110115_AABGXW vieira_k_Page_050.txt
173806a9618e012ef9dd97cdbbbd988b
9ce31f3b89071de762c57583bee84a1b6a853e79
26320 F20110115_AABHEF vieira_k_Page_074thm.jpg
63c839993aaca72564d4695833e08311
1f4c72d811e42783d80b5c088ff473a37ab07854
193337 F20110115_AABHDQ vieira_k_Page_094.jpg
18e9bfbca0300db9837edabdc711aa28
550205bceaec7cc2fb90d88661b8067c6ec92a25
202195 F20110115_AABGYK vieira_k_Page_036.jpg
7f7ddd2b468b02d045b0eb6fdd8b6800
334df67349fd7b79fa8e746b5ddc711f304d9aca
1682 F20110115_AABGXX vieira_k_Page_077.txt
6676c015f6e9810742cd8d9b82cd14ae
4ff0e463f2cf23cea6224f480610708f4c7c3a6b
5933 F20110115_AABHEG vieira_k_Page_002.jp2
016c27f2c20ff26219b8a4e151fac96f
ee24a1372e1744d5db666cbf03576f90eb8fe511
22627 F20110115_AABHDR vieira_k_Page_057thm.jpg
e1681723b74cebf2a6a113152fa497ed
1ca44458ce2603db4adfbd0e1f3df731b1bef223
F20110115_AABGYL vieira_k_Page_083.tif
50e667b029325e77adc6bf970dda7cd7
45e4d39bb093668c7b6155200dcbf71ab39d9cfd
6139 F20110115_AABHEH vieira_k_Page_002.QC.jpg
161e10ec5832865396bef3fc0dc92256
f3feef02c9eb4e81e4b115e94696fc39cc951200
134973 F20110115_AABGZA vieira_k_Page_109.jp2
2e12a1c4409b2a9d38167135d8f06752
64370c906687dc665537b559217067a700cfe9c3
139449 F20110115_AABHDS vieira_k_Page_120.jp2
dc245b0645821b0b6db6df9f8fa77fd8
9c1861a10494f224ca8798eb02728f642cd0e788
2597 F20110115_AABGYM vieira_k_Page_110.txt
abb2828540e8766ea173381ba9f14862
dbf2ab423a6f6504652505d4c963e8432b6358cb
F20110115_AABGXY vieira_k_Page_116.tif
205f104c61ee339e8662e7df2dc73387
1165a78aa5aeb83e9a8f521a7a9029f0eaff2e46
62624 F20110115_AABGZB vieira_k_Page_114.pro
41d4bdd497241220f9bd096025c13cb7
9b99d8679841486bb981b6e47e23104f51c0741f
23379 F20110115_AABHDT vieira_k_Page_014thm.jpg
2f03328d32c5b4f0390f18847dbc0bbd
81ebf815ac0ec9bda9577164f7de59936448b3e1
49144 F20110115_AABGYN vieira_k_Page_015.pro
34aeb8d2ab26b2c8d5cd318b6bd16ffd
67149a5fd95eaec6cabf0adf2a270224531244ed
F20110115_AABGXZ vieira_k_Page_081.tif
284621515129615ec6fbac38cfcb5038
02a85651f84d59f1d79fe7b000597767b3b2796d
48070 F20110115_AABHEI vieira_k_Page_020.pro
edf4706f932a74c1f87f5dd925f9afcc
d194bca941d28cbe8662fc57605dc23de1319734
45128 F20110115_AABGZC vieira_k_Page_006thm.jpg
1898e701d8845cf032f4e15c6a78666a
c95487aeac48710f8bb10384305568f8634bae29
98052 F20110115_AABHDU vieira_k_Page_042.jp2
24f1f2e632961e007fb8f65a5e6de7ea
b33d92078fa17cc3f1dc2c140d61ac03f5bf5f58
856229 F20110115_AABGYO vieira_k_Page_082.jp2
10db28170b0010199d69a0de083ba6ef
983536c7a40920b6a3df8bd6767dc60715816acb
182468 F20110115_AABHEJ vieira_k_Page_100.jpg
d7690b323046b7bb17deb8376eb31887
d34682b952cf43381734674338d7d691e1731fff
74806 F20110115_AABGZD vieira_k_Page_095.QC.jpg
60c2d0d9756231636c41fe2fcf8aa84e
d66f8aa68560bf3a345bf7ad9b503e9ade381898
247329 F20110115_AABHDV vieira_k_Page_108.jpg
1c6719cbb4f76e63d496f735d50d73cf
85e86ce609d492da77aea14a727cb9a4aa055356
F20110115_AABGYP vieira_k_Page_121.tif
9d13266591800af03104e9ff2854c390
0590e8bf1a94174ae2c5a32acd7683cfdf86a8b4
4448 F20110115_AABHEK vieira_k_Page_003thm.jpg
fce7b201ba6aab1dcf7adb87157d9777
91433a4151c1bb162103f1ccbc6049653102f30a
75051 F20110115_AABGZE vieira_k_Page_067.QC.jpg
a7d8b89227ba8f58fb2cd5a7da4ebcbe
c5182b3212cec4bf754be5eb524e0b86a228d445
25916 F20110115_AABHDW vieira_k_Page_110thm.jpg
78d9c14eee17ce1cf64feb7ef993d572
b24e2e1d27b9422e04f251b489f3feed16e8e50e
37965 F20110115_AABGYQ vieira_k_Page_082.pro
2f73fca107fe77d1e931a2f82cf70a49
3b222ac23b359393f0d997e6bfd4becddb57659d
110930 F20110115_AABHEL vieira_k_Page_063.jp2
067de16c02d1198748992432fa081e36
97a8607220e0c62d5a10448c89e2662245d779d2
52213 F20110115_AABGZF vieira_k_Page_012.jp2
8c3cba842d2905d9c484ef7c0b9823f8
493329f01dc3052ba618c432c4fbfb86c068f1f6
F20110115_AABHDX vieira_k_Page_055.tif
dd06229756d085d2e3f01452911bc999
c98242b473b283f1a5b8355f530f7d88480f2ed3
23982 F20110115_AABGYR vieira_k_Page_118thm.jpg
4293657f0a0a266c1b95a7a5f907c40b
17d8fa3f52c92f9deae5f83ea9eb936ccc3fad0a
F20110115_AABHFA vieira_k_Page_009.tif
5e0f1c2cc2725c0a491a86ff7edcb6b2
a50fcab05185402324e1ef16f6fbb5184f9549c2
2060 F20110115_AABHEM vieira_k_Page_071.txt
a6bc39aeed1ab57b756b53ec7a8e39cb
e1c8fe710bbe7db41fb904a905ca0e2637105c25
F20110115_AABGZG vieira_k_Page_064.tif
4164678913202c5a2110c0797717fa53
d0539f10b6d5b03eeb7f7d38e63a39fe006dfbe8
24775 F20110115_AABHDY vieira_k_Page_001.jp2
eaa7a38d23156e9c73deb0fdf6b10aa6
a15c413902786782f29a873d66834ba748cdd53b
8652 F20110115_AABGYS vieira_k_Page_003.QC.jpg
0ddef36b116cc2115f196cbaaff22565
fb1d98cdc7a3d809614dfa483b3b5d4ba7e3e7f3
234928 F20110115_AABHFB vieira_k_Page_061.jpg
ac9c792154282c2bc4d82e859a48cc8f
db3719ce3c8e86726dc39a6531cd2ba81298973e
F20110115_AABHEN vieira_k_Page_111.tif
8001bb073b08c9a45f2f439def3c4f46
a2da194c545eed8e3bcb0e448e5d9bc709564b17
172150 F20110115_AABGZH vieira_k_Page_013.jpg
83e801bc90c6678fbc4b27ddfae113ae
7d8ca949fee771a3501b6b3b2ef77d4b623a77b7
226402 F20110115_AABHDZ vieira_k_Page_066.jpg
e9610e5453d43c7fa1603519f46fac81
52fdf627e20d538c7a67a77d4e25d0c247191484
F20110115_AABGYT vieira_k_Page_054.txt
e1a86524e3a48e86efb1e79b6dbdd729
f4c785e985e960eebd1024945b4c585d711700ef
14439 F20110115_AABHFC vieira_k_Page_105.pro
87d3fd58069b82b2e24f22783161b1c5
f250ebc65a1c34d42ed02b3d539715d7363a4dcf
25313 F20110115_AABHEO vieira_k_Page_034thm.jpg
b92f3046d4af794a37b401bf1e76b985
447dbad2e45b08198bc10c01ca9b2d62274058c5
29286 F20110115_AABGZI vieira_k_Page_008thm.jpg
d24db9c15774b6b2317ad313622abc2c
c09ce4dae15985c43ab2b4f40c56982f0fccc8da
F20110115_AABGYU vieira_k_Page_001.tif
db0895962712f48f334bc5ba86912e5f
fff15541986931e132cc1a3b587d8c3b89c84df8
47473 F20110115_AABHFD vieira_k_Page_019.pro
31c130e6db02640aacf9521fe37c7688
ac3a30615a93fd4f6d2b3ec07603fb086c7890c2
24958 F20110115_AABHEP vieira_k_Page_052thm.jpg
a0ce1decd5cc4f9406e417477074ac10
296ff5af90f8939fade7497e3750af43f3b32ea1
F20110115_AABGZJ vieira_k_Page_095.tif
c231059873128232ab72543657630195
a65e6d3126af03faed6ca56ba26add792ec21f5a
1996 F20110115_AABGYV vieira_k_Page_005.txt
019d78e6f04d49e39964672613d15c00
f3c728594f28b86335c55e1fc44bc6db416879bf
43793 F20110115_AABHFE vieira_k_Page_042.pro
25245664c5cf70a82c27188db41d1c15
4e54bd300cf80bf88128f66736750fe0d2e56f6e
F20110115_AABHEQ vieira_k_Page_041.txt
179dfd3b90d89e339dae780d45d31958
824c342a426ebd3bf6accb4901daed3bf213ffe1
888374 F20110115_AABGZK vieira_k_Page_056.jp2
68ad346b4e670a38bf792804ce4da574
37e3eea6d113bd0daada2e89437d1b2b7f370ea8
61873 F20110115_AABGYW vieira_k_Page_113.pro
a3d0427249b85adaf595a1a450287d29
193685dd8e5b270595a5354f982ef3e2ffc0f8be
33914 F20110115_AABHFF vieira_k_Page_056.pro
39495b8bce78762549e0dd6b4fb2afe1
a5cf943cd6e5004c3e049df07a49cd82c1319b9b
F20110115_AABHER vieira_k_Page_003.tif
8dc4bcba1260f1ae4e2be0c49ff7f5ab
c9e3e0ca76d699fd65eb16a8d003df58551e8369
684700 F20110115_AABGZL vieira_k_Page_098.jp2
2ea049c5816528642b71178aa22b9d81
908135819d8c5294d7923acc36790797ecd1aa53
25275 F20110115_AABGYX vieira_k_Page_121thm.jpg
cc1eb96d4e0974f00f90362a0ba5ef96
f18544f3edee1407a884fca5beba22694fc4f3fc
1899 F20110115_AABHFG vieira_k_Page_065.txt
cf5fd6e0a066c29893a30b6d705d68a9
1da9fd0acb12c1b109e2d831dd6786ba256564a9
1968 F20110115_AABHES vieira_k_Page_081.txt
20116d9fdfa99037fdfa0bae65cbed27
e5f26949abeb56ab48a88ac96b413241e299f25b
F20110115_AABGZM vieira_k_Page_057.tif
053d3b707f4aa5b169c15cfa6d9eac4b
4e4a8f96b6966432421b0cabc64c277962fac394
F20110115_AABGYY vieira_k_Page_070.tif
36b35ed952bc98bdb744b2d7eb790f2f
3c51470e71fe8c055b82d427e34d9b057a91e7cd
F20110115_AABHFH vieira_k_Page_119.tif
9076e555a694c2bd3654d6e3dbcb3f2e
4329fdaf0d415e4145a045580fe02d0bc729644a
187964 F20110115_AABHET vieira_k_Page_067.jpg
dba63dab7f211b3a09e01ec0065bdaf1
0cd55dea67e801a02d1c6371d991f68e003ecffe
1918 F20110115_AABGZN vieira_k_Page_053.txt
d97aef097e9ef58286de1fdb026f04fe
e7acbcdfbfd610bc43b10f0590dc14361a9eb77d
68314 F20110115_AABGYZ vieira_k_Page_100.QC.jpg
5f6170fe5d07af0400a1aaf70a3dc80b
50b486fdba618fbc01507376772c0282620e90fc
25197 F20110115_AABHFI vieira_k_Page_048thm.jpg
d20dce8327e4949ba2da12e4e7ded9f4
1a42e66b1de65a4249fd2a35f20eda4a91809d06
187753 F20110115_AABHEU vieira_k_Page_069.jpg
ade1776c7c0cc47da8e497d481ff5e36
199ea88ea06b6e8fac790fc641b91691b686be60
49168 F20110115_AABGZO vieira_k_Page_024.pro
36c50c456118a219d1e5f1e41f5b63a3
edc109931278cbd8eb41224eefaca624947bfc32
185151 F20110115_AABGZP vieira_k_Page_085.jpg
3d11065ac357b8ba2f4ae3641565d156
a6163e7353faa2f431f20d27258208ced892d8c0
224 F20110115_AABHFJ vieira_k_Page_003.txt
208aed2086df470f88b726946e2f84a7
2c52c04210a2930a7fccba25a5c3d4f8646a4663
F20110115_AABHEV vieira_k_Page_080.tif
6b944d90563b9e332b57815171e12ebd
240f4bd712b26fe8b0153548b755045f3a37c18d
83712 F20110115_AABGZQ vieira_k_Page_082.QC.jpg
a1012b1aabb1b128fd0df576c58d8d2a
0c8637879445bd5eba002855667e0db4431336dd
96960 F20110115_AABHFK vieira_k_Page_045.jp2
7cd606088acd97846661fd7bff4b8886
c24654a347fbd646dc45033961bbcb1a355dd23b
203228 F20110115_AABHEW vieira_k_Page_055.jpg
8ad8a61c3d154e02b459f8def5ac315b
3aa7e6cdb5819a192007cba2aea6ce58042f4c7f
1304 F20110115_AABGZR vieira_k_Page_002.pro
c9eafa04d78a99e354080ccc40a6602c
b452cd430a137eecfbbf36a2250302e432c995d6
22968 F20110115_AABHGA vieira_k_Page_067thm.jpg
8b27c06cfbf60425784a187205806503
ae73721227e06bf12953379b442bbc71906ed78f
20188 F20110115_AABHFL vieira_k_Page_001.QC.jpg
48fc3e8d858c9063bee5de19592fc948
5f0323d78f41e6e7481f449c58c37b85e9dac937
83158 F20110115_AABHEX vieira_k_Page_113.QC.jpg
4011cf68b4d9d0655c4a14de5d2f3ffa
b2e985fb2e3fddc807c8fd78e01cfe6f245d36c3
23582 F20110115_AABGZS vieira_k_Page_029thm.jpg
4ad7d48e83afad33bf84d603fe856463
170d280370abe54a44530e6e648f1af6b6e3d201
70730 F20110115_AABHGB vieira_k_Page_104.QC.jpg
dde1e9341555e0833de1f2aad4614ff9
9cca469c32c1d28bfaca4d36788783ab19cc48e7
1942 F20110115_AABHFM vieira_k_Page_016.txt
215a703975269e248f3a133dc55d9f21
ae6ab25b0449ceb3e1c369ab8982cbf4185c14b2
1981 F20110115_AABHEY vieira_k_Page_095.txt
f371edfb53b8035c221f32340307ddac
810b8eb58fad5bb112ace71e75a2b8636103a062
85263 F20110115_AABGZT vieira_k_Page_114.QC.jpg
4d4c3c68a881671c73441306c87f5136
cc1b2eab8f725ff8d40bf84803cda2fb13e2a257
111614 F20110115_AABHGC vieira_k_Page_032.jpg
38f2edcd7b3718995847122ed4d83790
cff3f37d3c7967713660c17124859d1538840bc4
47736 F20110115_AABHFN vieira_k_Page_017.pro
b9d6f9338c0c5780781a16c27536c473
846319549f5752afd40a00e7fa883306cbc4c053
F20110115_AABHEZ vieira_k_Page_009.jp2
c03b5aea6a150dc5a4164cbef9195f30
cba26f3d36aed5466ab42200b7d92d2bbb06cc9d
206859 F20110115_AABGZU vieira_k_Page_037.jpg
cfd1486f433d218bc2aa32309a6bdcac
be9bbf7ec121e3f776ef2a7fc5a3c6efa315b089
F20110115_AABHGD vieira_k_Page_070.txt
0949b3bd93c52e185751a2272014f27c
f9d8edcfad8886af07f2b513ad5a751b3f28279f
85708 F20110115_AABHFO vieira_k_Page_117.QC.jpg
67ff42553b48bf616efc510f55130457
550d0a2d5cc7651e45732d6d83cd0bb73443f916
24116 F20110115_AABGZV vieira_k_Page_081thm.jpg
a5e62425b0a7089b567562d2da1580fc
5f1cdf3959a529462e5e07fdb9da038848b1a610
104555 F20110115_AABHGE vieira_k_Page_086.jp2
670f4b3602d19cd191780b2914261e88
f2a2780a40c50083a9643112e32e2d062e4aca5f
137504 F20110115_AABHFP vieira_k_Page_123.jp2
991ccc2881d19a67c2dd5baf659e66a3
d73b2ffe1f1d9172f68794396fcc69b25019252b
1051986 F20110115_AABGZW vieira_k_Page_090.jp2
5622bcd8fab911707eeb352f54a1767e
eacfbb8c4b4e5105bced6a747a62877e57ee159a
42518 F20110115_AABHGF vieira_k_Page_010.pro
f543c51849dedc7704545fdecbaa0314
448ee740675da5d3d01d605b185c7ac09a03ed7b
45411 F20110115_AABHFQ vieira_k_Page_067.pro
36df7ce694aaddab8decf71fb48af6da
caac7b15d83b40e1e48ac94cf676fbe6026898a3
70660 F20110115_AABGZX vieira_k_Page_042.QC.jpg
d5d102f1efd36f56fba144c448ae90db
6ff68fa6396b482fab241d47db7ed713e29256c3
69187 F20110115_AABHGG vieira_k_Page_046.QC.jpg
d3051b5249f0898cc91aa08873a39a78
3f248a5b91ad1ce52b63190311c5fb095803d891
F20110115_AABHFR vieira_k_Page_090.tif
2babed39455beb2fac221929e5ac488c
29df71a360d60624f1853d2e046d8da316624d0a
2107 F20110115_AABGZY vieira_k_Page_074.txt
3df8e71d059cb928dcae262307979a43
8bce851d2456fdd328b008a0d2b6bd91aff42bfd
77554 F20110115_AABHGH vieira_k_Page_052.QC.jpg
50d42a4178515adc886e38f585f9ddd6
828dd9abcadb15c47f3639ff6c1bf7457702f436
213877 F20110115_AABHFS vieira_k_Page_053.jpg
2d8ced1766b14a5f00cefdaf12451620
e47638d056f352bab63d3434f31ddc07dee3762b
84628 F20110115_AABGZZ vieira_k_Page_079.QC.jpg
250e8a6b9e564d39d3f1c7182539d041
973f3bac5ae416e20c91bfddb42d5cf235d6f433
54799 F20110115_AABHGI vieira_k_Page_124.pro
2c74e1425e31cdbc52f4360aff00b970
8321ec57f2c62dd0e46344fd8f48e4a1a46e19b4
52051 F20110115_AABHFT vieira_k_Page_051.pro
7ae82667ed8a7a47c69b22e24b34bedb
f1bf4fa8c53d0b15fe306089528fd58592dab10e
3611 F20110115_AABHGJ vieira_k_Page_007.txt
cbc9495c66d493710c12ce75eb8ec681
4a2ee350734d026d25ef300063d62e4f1b6d2aa0
259913 F20110115_AABHFU vieira_k_Page_121.jpg
958c9b497bca3cb9757a10a867c877f2
ed52d40bd1d3e39c4cdb47250f713fb6eca37850
74967 F20110115_AABHFV vieira_k_Page_045.QC.jpg
f53e21e978192f3ee7d9e9ecebd7d3ba
49dab2a5aaeff18fdcc6adaa63a62ef490601de0
23503 F20110115_AABHGK vieira_k_Page_096thm.jpg
9fcc6870bacebc17e4c5db23c265af67
f7fe594057d61729c89ae1f538d52f95d3b07b25
1814 F20110115_AABHFW vieira_k_Page_060.txt
5518ec0bd48208f28c38824c203361b9
7465a4d005ff18f8c7fb659cb1ac36b6757c5fa2
F20110115_AABHGL vieira_k_Page_013.tif
608a42979b25e601596389a8d7341d6d
2586bebfcf0a428d425bad2f12a3ffedfd9d16ee
48407 F20110115_AABHFX vieira_k_Page_061thm.jpg
504b7bb5ed80d87d24d1d6bb729de116
58e2411313b58c9ace1dcc385ed243cb61a70d47
199880 F20110115_AABHHA vieira_k_Page_086.jpg
817d293e5d7d2435b3f5a2acf75b26bd
421f6deca8ac6bedfdc3e59a458c2e9ba76a6e1e
23621 F20110115_AABHGM vieira_k_Page_119thm.jpg
2d466e31b17943d6bce8483df15d49b0
a16c7b6d1e7199355c0b645aa6c130391bfc542b
105044 F20110115_AABHFY vieira_k_Page_048.jp2
1d56710ecc96522aa3376cb21e5ab6cc
ad5f3d9fc3b1e8ef65171652d8f06a64315c845f
50654 F20110115_AABHHB vieira_k_Page_075.pro
50d6ad06ad4f2e594aa6af6b6c1fc03c
77abce04675d9f2ce5b43bca5206be457742fa07
38224 F20110115_AABHGN vieira_k_Page_079.pro
47123b11465489431b838747772e3fd1
f282bba747f03debbfb9045b198a762b50394e61
24559 F20110115_AABHFZ vieira_k_Page_015thm.jpg
a7390ff6b8ac2d8be0f46b6fb01b45cf
a8b7278807db048bde40ae18052018f40ac7b1bc
53765 F20110115_AABHHC vieira_k_Page_008.jpg
1116c719f98771fc3c12028c7c05b732
3b0890a91c7ece5705227eef915618d9c89c990c
2552 F20110115_AABHGO vieira_k_Page_120.txt
015db99297f2cd2447db1227b23de768
681d16d4106d63a588123dcae8dee0880a1e4ce5
223894 F20110115_AABHHD vieira_k_Page_074.jpg
b4a60ecd6ecbbe8a35394060ca0cbd3d
439790a6316e9af06380be55c4b83d43c1243e2a
24851 F20110115_AABHGP vieira_k_Page_116thm.jpg
d9a26e4365765cc61372b49c45601200
2d48227ef942abd6a78d6d0b0fe9dbda7ac541d8
2306 F20110115_AABHHE vieira_k_Page_124.txt
6a6e62cfb2bd7556f1182694881dcbc3
9e98574989b54b44cc383ae25f8ee60c9d2e764b
196000 F20110115_AABHGQ vieira_k_Page_022.jpg
42e4d45a7192d009b2535dc0cb7c18e6
6e928ee141a27b5ea7ee45a7933025eb10991e73
90358 F20110115_AABHHF vieira_k_Page_033.jp2
c3f44b2ec035f3ea2c0bc910e664b9b6
c10e3ecc7f5b2ee310b58a1561a40ced30584fca
87814 F20110115_AABHGR vieira_k_Page_011.jp2
a5c6e519f7c0e8d3d63001dc23097bd6
3e6979740d2091f92194481dba11e1a1765b93be
209199 F20110115_AABHHG vieira_k_Page_091.jpg
5c2379780643d134252ad230b32aeede
ee0c3763b150999c7d72d0b62d6e8bb5712caba1
1943 F20110115_AABHGS vieira_k_Page_035.txt
df629f9c86babec450e056e2fc517b8f
f805d7739a54d43426a94a3da7dd2b727ffcc8d4
201428 F20110115_AABHHH vieira_k_Page_079.jpg
bdff4f86c6fddb1d51a318f76fa2ac14
d3547eec862a18e1a64faad1db24f10df7e8facd
24712 F20110115_AABHGT vieira_k_Page_117thm.jpg
c912bf9497ca137bc9e086b96c014687
71aae390c22f0c627f015f547cf4dafa47cfc03f
24149 F20110115_AABHHI vieira_k_Page_031thm.jpg
ed8c01df2905adb58afe66b64eca8cbf
6dc5197480a52128ee5930006159ab6cf68008fa



PAGE 1

RECRUITMENT OF TRANSCRIPTION COMPLEXES TO THE BETA-GLOBIN LOCUS IN VIVO AND IN VITRO By KAREN FRANCES VIEIRA A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2004

PAGE 2

Copyright 2004 by Karen Frances Vieira

PAGE 3

This document is dedicated to my mother a nd sister who have been there for me every step of the way, and to my father who is gone but not forgotten.

PAGE 4

iv ACKNOWLEDGMENTS I would like to first acknowledge God as th e guiding light in my life, for without Him my world would be empty. I owe a huge thanks to my mentor, Dr. Jrg Bungert, for the opportunity to work in his lab and for receiving the excellent traini ng that I did. He has been a great mentor, motivator, advisor and teacher. He has been patient with me and very supportive of my alternate career choices. He is the hallmark of a good scientist, and I respect and am inspired by his commitment and dedication. I thank all of my committee members, Dr s. Michael Kilberg, Thomas Yang, Linda Bloom, Hideko Kasahara, and James Resnick. They have all been a great help in providing suggestions and direc tions for my experiments and career. Drs. Kilberg and Yang have been especially supportive and encouraging throughout my time at the University of Florida, and have always had insightful comments during my committee meetings and presentations. I need to thank them as well as Dr. Brian Cain for critically evaluating and helping me with my presentation that won first place in the 2004 Medical Guild Research Competition. I appreciate Dr Resnick joining my committee at such short notice, and also providing useful inform ation to help me get on track for graduation. I extend my appreciation to Dr. James B. Flanegan, the department chair, and all the administrative and secretarial staff that has made me at home in the department. I would like to say a special thanks to Brad ley Moore who always shares a smile or a compliment to brighten my day.

PAGE 5

v I thank all of the past and present members of the Bungert lab. When I first started in the laboratory, Kelly Leach and Padraic Le vings instantly made me feel comfortable and were great mentors to me. I appreciate Ke lly for setting the standards, which I have since tried to meet or surpa ss. Sung-Hae Lee Kang also was a mentor and a great source of encouragement and advice as well as a gr eat friend. Ara Aslanian is the post-doctoral researcher who, upon leaving, passed on his protoc ols and projects to me. Since that was the first step in my successes here at the Un iversity of Florida, I owe Ara many thanks. Christof Dame was a post-doc in the laborat ory that encouraged me with helpful, thoughtful and sometimes amusing discussions. I would like to thank Valerie Crusselle for being a great colleague and also a frie nd. I wish her many blessings. Takeesha Roland has been the best labora tory technician I know and I appreciate her help, patience and sincere friendship. I need to thank th e many other members of the lab including Boris Thurisch, Felicie Ande rsen, Meredith Hill, and th e many undergraduates and high school students who have helped and entertained me along the way. I thank the members of Dr. Yang’s lab who have always been helpful and friendly, especially Christine Kiefer and Sara Rodri guez, who both helped me with footprinting experiments. I would like to say a special thanks to the members of Dr. Kilberg’s lab, especially Hong Chen who has been a great source of knowledge. I would like to thank my family and frie nds who have been very supportive. My mother and sister have always been my best source of support and encouragement, and I want them to know that I love and appr eciate them. I thank my boyfriend and many friends, who have helped me tremendously through the stresses of graduate school, and have been patient with my ma ny moods during this long journey.

PAGE 6

vi TABLE OF CONTENTS page ACKNOWLEDGMENTS.................................................................................................iv LIST OF FIGURES...........................................................................................................ix ABSTRACT....................................................................................................................... xi CHAPTER 1 INTRODUCTION........................................................................................................1 Hemoglobin and Sickle Cell Disease...........................................................................1 Overview of Sickle Ce ll and Thalassemia.............................................................1 Symptoms and Treatments....................................................................................2 Current Research on Therapies.............................................................................3 Chromatin Structure......................................................................................................4 Histone Modifications...........................................................................................6 Chromatin Remodeling.........................................................................................7 Mechanism of Transcription.........................................................................................8 Preinitiation Complex Assembly...........................................................................9 Initiation................................................................................................................9 Elongation............................................................................................................10 The -Globin Gene Locus..........................................................................................11 Location and Organization..................................................................................11 Locus Control Region..........................................................................................12 Proteins Associated with the -Globin Locus............................................................14 Model for -Globin Gene Regulation.........................................................................16 Questions to Be Addressed.........................................................................................19 2 MATERIALS AND METHODS...............................................................................21 Cell Culture.................................................................................................................21 Chromatin Immunoprecipitation (ChIP).....................................................................21 Chromatin Immunoprecipitation and DMS Footprinting...........................................24 DMS Treatment...................................................................................................26 Linker LMPCR....................................................................................................26 Western Blotting.........................................................................................................29 Cell Synchronization..................................................................................................30

PAGE 7

vii PCR-Based DNA Replication Analysis......................................................................30 DNA Isolation.....................................................................................................30 Semi-Quantitative PCR.......................................................................................31 In Vitro Polymerase Transfer Analysis.......................................................................32 MEL Cell DMSO Differentiation...............................................................................33 Semi-Quantitative RT-PCR........................................................................................33 Double Immunoprecipitation......................................................................................34 Co-Immunoprecipitation.............................................................................................36 3 CHROMATIN IMMUNOPRECIPITATION AND DMS FOOTPRINTING...........38 Introduction.................................................................................................................38 Results........................................................................................................................ .40 Discussion...................................................................................................................43 4 INTERACTION OF RNA POLYMERASE II AND TRANSCRIPTION FACTORS WITH THE -GLOBIN LOCUS...............................................................................46 Introduction.................................................................................................................46 Results........................................................................................................................ .48 Discussion...................................................................................................................58 5 ANALYSIS OF THE MECHANISM OF RNA POLYMERASE II TRANSFER FROM THE LCR TO THE -GLOBIN GENE PROMOTER..................................65 Introduction.................................................................................................................65 Results........................................................................................................................ .66 Discussion...................................................................................................................72 6 DETERMINING THE FUNCTION OF THE USF, TFII-I AND HDAC3 PROTEINS IN -GLOBIN GENE REGULATION..................................................76 Introduction.................................................................................................................76 Results........................................................................................................................ .78 Discussion...................................................................................................................82 7 CONCLUSIONS AND FUTURE DIRECTIONS.....................................................87 ChIP Footprinting.......................................................................................................87 ChIP within the -Globin Locus.................................................................................88 Cell Synchronization..................................................................................................89 Chromosome Conformation Capture..........................................................................90 In Vitro Pol II Transfer...............................................................................................91 USF, TFII-I and HDAC3 Function in -Globin Regulation......................................92 Summary.....................................................................................................................93

PAGE 8

viii LIST OF REFERENCES...................................................................................................94 BIOGRAPHICAL SKETCH...........................................................................................113

PAGE 9

ix LIST OF FIGURES Figure page 1-1. The human and mouse -globin loci........................................................................13 1-2. Multistep model for human -globin gene regulation..............................................18 3-1. Sequence alignment of the adult -globin downstream promoter region................41 3-2. Analysis of protein–DNA interactions in the murine -globin downstream promoter region by a combination of chromatin immunopreci pitation and DMS footprinting...............................................................................................................42 3-3. ChIP experiment showing the interac tion of USF1 and NF-E2 with the murine maj-globin promoter in MEL cells.........................................................................43 3-4. LMPCR footprint analysis of non-se lected or ChIP-selected chromatin.................44 4-1. Diagrammatic representati on of the human and murine -globin gene locus.........49 4-2. Interaction of transcription factor s and RNA polymerase II with the human globin locus and the human necdin gene.................................................................50 4-3. Interaction of transcription factors with and transcription in the murine -globin locus in MEL cells....................................................................................................52 4-4. Interactions of transcription factor s and RNA polymerase II with the human globin locus during early S phase in synchronized K562 cells................................54 4-5. Interactions of transcription factor s and RNA polymerase II with the human globin locus during early S phase in synchronized MEL cells................................56 4-6. Semi-quantitative PCR analysis of DNA content of synchronized K562 cells.......57 4-7. Semi-quantitative PCR analysis of DNA content of synchronized MEL cells........58 5-1. A schematic representation of the in vitro Pol II transfer expe rimental procedure.67 5-2. Transfer of RNA polymerase II from immobilized LCR constructs to the -globin gene............................................................................................................68

PAGE 10

x 5-3. Analysis of the specificity of Pol II transfer............................................................70 5-4. Comparison of Pol II transfer using the wild-type -globin gene (lane 1) and a mutant -globin gene (lane 2) in which an E-box at +60 was altered......................70 5-5. Transfer of RNA polymerase II to the -globin gene in the presence of NF-E2 or BSA..........................................................................................................................71 5-6. Analysis of NF-E2 mediated transfer to the -globin gene......................................72 5-7. Quantitative summary of the transfer experiments..................................................73 5-8. Model of transcription complex recruitment to the -globin gene..........................75 6-1. Sequence alignment of the human -globin downstream promoter region.............78 6-2. Characterization of protein– DNA interactions in the human -globin downstream promoter region in vivo ........................................................................80 6-3. Chromatin double immu noprecipitation (ChDIP) expe riment analyzing the interaction of TFII-I and HDAC3 at di fferent regions within the human -globin locus.........................................................................................................................8 1 6-4. Co-immunoprecipitation experiment analyzing the interaction of TFII-I and HDAC3 as a complex...............................................................................................82 6-5. Summary and model of protein– DNA interactions at the human -globin promoter...................................................................................................................86

PAGE 11

xi Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy RECRUITMENT OF TRANSCRIPTION COMPLEXES TO THE BETA-GLOBIN LOCUS IN VIVO AND IN VITRO By Karen Frances Vieira December 2004 Chair: Jrg Bungert Major Department: Biochemi stry and Molecular Biology The -globin gene locus is the site of ma ny mutations and deletions that cause sickle cell disease and -thalassemias. Erythroid-specific, high-level expression of the globin genes is regulated by the locus control region, located far upstream of the genes. Recent studies show that locus control region core elements recruit RNA polymerase II. Here, we developed and optimized met hods to study protein-DNA interactions within the -globin locus. These techniques were used to analyze the interaction of transcription factors and RNA polymerase II with the -globin locus in erythroleukemia cell lines. The data show that transcription initiation complexes are recruited to the LCR and to the genes. Moreover, RNA polymer ase II dissociates during early S phase in synchronized erythroid cells s uggesting that replication di srupts the association of transcription complexes with the globin lo cus. The interactio n of NF-E2 and USF2 precedes the re-association of RNA polymerase II implicating these proteins in a process regulating the recruitment of RNA polymerase to the glob in locus during replication.

PAGE 12

xii Furthermore, we demonstrate transfer of transcription complexes from immobilized LCR constructs to the human -globin gene in vitro Our data are consistent with the hypothesis that the LCR and the genes cooperate to recruit transcription complexes to the globin gene locus. Studies on the interaction of proteins with the adult -globin gene promoter demonstrate that the helix-loop-helix prot eins USF and TFII-I associate with DNAregulatory elements located at or downstream of the transcription initiation site. TFII-I interacts with histone deacetylase 3 and binds mo re efficiently in erythroid cells that do not express the -globin gene. In contrast, USF, known to interact with chromatinopening activities, associates with the globi n gene when it is expressed. These data suggest that USF and TFII-I regulate -globin gene expression in an antagonistic fashion.

PAGE 13

1 CHAPTER 1 INTRODUCTION Hemoglobin and Sickle Cell Disease Hemoglobin is the molecule in red blood cells that transports oxygen to all the tissues of mammalian organisms. Hem oglobin is composed of two alpha ( ) globin chains and two beta ( ) globin chains, each carrying a heme molecule [1]. The heme molecule contains an iron atom and is responsible for binding the oxygen that is transported. The and -globin chains are important for the overall structure of hemoglobin, and thus contribute to its essential functions in gas transport. Overview of Sickle Cell and Thalassemia More than 80 point mutations and deletions in the -globin genes are known to cause -thalassemia [2]. These thalassemias have the highest incidence in India, Africa, and Arabic countries [3]. Similarly, more than 200 mutations and deletions in the globin genes cause sickle cell anemia, sickle SC disease, sickle SD disease (collectively called sickle cell disease), and -thalassemias [2]. Sickle cell disease and the thalassemias are the most common monogenetic diseases worldwide, with an estimated 80 million -thalassemia carriers [4]. There ar e over 10,000 African-Americans with sickle cell anemia in the USA alone. In African, Asian, Indian and Middle Eastern communities, sickle cell disease and -thalassemia are widespread. Because some mutations associated with the and -globin gene loci provide protection from malaria, inciden ce for thalassemias and sickle-cell disease are historically

PAGE 14

2 more common in areas affected by malaria. These regions include Africa, India, and Mediterranean countries. Heterozygous indivi duals carrying th e sickle cell allele have a survival advantage since these individuals ar e generally healthy but reveal resistance to malaria. In the past individuals homozygous for the disease genera lly did not live past childhood. These diseased individuals now bene fit from an extended lifespan due to the increased level of worldwide healthcare. Symptoms and Treatments Sickle hemoglobin polymerizes when deoxygenated. The hemoglobin polymers form alpha helical bundles, which deform re d blood cells into a sickle-shape. These sickle cells that give the di sease its name are more rigid than normal red blood cells and cannot pass through small blood vessels. The resulting blockage of blood vessels causes intense pain and other side effects. Patients with sickle cell disease experi ence a range of complications, including painful crises, acute chest syndrome, priapism in males, stroke, bone damage, and lung damage. Many patients undergo monthly blood tr ansfusions to lower the percentage of sickle red blood cells in their system. This reduces the frequency of painful crises, but also increases iron concentra tions to sometimes-toxic leve ls. Therefore, along with transfusions, sickle cell patients undergo ir on chelation therapy. Unfortunately, since chelation therapy is performed by daily intr avenous injections there is a low patient compliance. Though, the recent development of new oral iron-chelating agents may allow for better compliance [5]. Currently, the only cure for severe hema globinopathies is hematopoietic stem cell transplantation (HSCT). About 71% of thalassemia patients given HSCT from a matched donor have been cured of their disease [6]. Due to the high risks a ssociated with this

PAGE 15

3 procedure, patients receive HSCT only if sickle-related death is imminent [5]. Encouragingly, of the sickle cell patients that have received HSCT, 85% survived disease-free [7]. Since only about 1% of si ckle cell patients meet the criteria for HSCT and have a suitable donor, alternative therapies are highly sought after. Current Research on Therapies Many current trials are performed with dr ugs that increase the levels of fetal hemoglobin (HbF) since HbF inhibits the polym erization of sickle hemoglobin (HbS). The drug 5-azacytidine, which inhibits DNA met hyltransferases, has been used in the past but due to serious side effects is now rarely used. Sodium butyrate acts synergistically with 5-azacytidine and reactivates -globin expression for the production of HbF [8]. Hydroxyurea, which is known to inhibit DNA synthesis and alter chromatin structure, is currently the drug of choice to raise HbF in sickle cell patients and to reduce symptoms associated with the disease [ 9, 10]. The main known side effect of hydroxyurea treatment is myelotoxicity, or dest ruction of the bone marrow. Its long-term toxicity and effects on survival are yet to be determined. For this and other reasons, hydroxyurea is reserved only for patien ts with severe complications. For patients that do not meet the cr iteria for HSCT or do not respond to pharmacological therapies, gene therapy ma y provide a promising alternative in the future. Sickle cell disease is caused by a point mutation in the coding region of the globin gene and it was the first genetic disorder in which such point mutations have been found [11]. Due to the relative simple gene tic defect and the ab ility to isolate and transfect hematopoietic stem ce lls, it was anticipated that glob in gene disorders would be among the first for which gene therapy approaches are feasible.

PAGE 16

4 Several viruses are being tested as vector s for therapeutic gene transfer of the globin genes to mammalian cells. These include murine retroviruses [12], lentiviruses [13], human foamy virus [14], and adeno-asso ciated virus [15-18]. Promising results were obtained using lentivirus-based gene therapy in a mouse model for -thalassemia [19], though there is still much to be done be fore it can become approved as a safe form of gene therapy for sickle cell and -thalassemia. One of the obstacles of using lentivirus is the fact that the DNA integrates into the genome and there is some evidence that integration into open transcriptionally active regions is preferred [20, 21]. This enhances the risk of gene disr uption (e.g., of tumor suppressor genes) or activati on of endogenous genes (e.g., oncogenes). Adeno-associated virus is considered to be the safest virus used in gene th erapy trials because it does not appear to cause strong immune reactions and in many reports the DNA remained episomal [22-25]. The limitation of usi ng AAV for globin gene therapy is the low packaging capacity. As outlined below, appropriate control of -globin gene regulation is complex and requires the presence of ma ny cis-acting DNA elements. Alternative approaches are to optimize HSCT for making it more broadly applicable and to use novel mechanisms to induce a high level of fetal globin gene expression. Chromatin Structure To comprehend the regulation of the globin genes and potential in teractions within the -globin gene locus, it is important to unde rstand the chromatin st ructure in the locus and its relevance to gene expression. In order to fit the entire genome into th e nucleus of each living cell DNA is highly constrained and compacted through interactions with proteins called histones. Histones

PAGE 17

5 are small basic proteins consisting of a globular domain and a more flexible N-terminus. DNA organization in the nuclei of eukaryotes involves repetitive packaging into nucleosomes, which are composed of two each of the histone core proteins H2A, H2B, H3 and H4 arranged in an octamer around wh ich 146 base pairs of DNA is wrapped [26, 27]. Nucleosomal DNA and its a ssociated proteins interact wi th other proteins to form higher order structures in th e nucleus; the combination of DNA and associated factors in the nucleus is termed chromatin. Nucleosomal arrays along the DNA are pr oposed to fold into a 30 nm fiber upon incorporation of the linker histone H1, though the mechanism of this compaction remains unclear. Higher levels of compaction may occur in genomic domains termed heterochromatin. Genes located in these dense chromatin domains are generally not accessible for interacting with transcription factors and are thus suppressed [28, 29]. Even further compaction is required during m itosis, and a protein called condensin helps convert chromatin into condensed mitotic chromosomes [30]. C onversely, there are regions of the genome, termed euchromatin, in which the genes are not highly compacted, leaving them accessible to tran scription complexes required for gene expression. Although the details of chromatin folding are still unclear, the relative compaction of any region of the genome can be measured by determining the susceptibility of that region to digestion by the endonuclease deoxyr ibonuclease (DNaseI). Regions of the genome are described as being DNaseI insensitive, sensitive, or hypersensitive. Insensitive regions like heterochromatin are highly condensed and inaccessible to DNaseI. Sensitive regions such as euchromatin exhibit a less compacted chromatin

PAGE 18

6 structure and are accessible to DNaseI [31] Transcribed regions of the genome are usually DNaseI sensitive and may be organi zed as a 30 nm chromatin fiber. DNaseI hypersensitive sites are usually 200 to 400 bps l ong and probably reflec t regions in which nucleosomes have been removed or modified. Th ese sites contain clusters of transcription factor binding sites and are generally associated with th e function of regulatory DNA regions, e.g., enhancers or promoters [32]. Nucleosomes and other forms of DNA comp action modulate transc ription and thus represent an important factor in gene regulation [33]. Enzy mes that modify and remodel chromatin play an important role in activ ation and repression of gene expression. Chromatin modifications are post-transla tional modifications of the histones. Alternatively, chromatin remodeling include s changing the locati on of nucleosomes, altering histone-DNA interactions, removal of histones, and histone exchange [34-39]. Histone Modifications Histones can be acetylated, methylated, phosphorylated, ubiquitylated, sumoylated, and ADP-ribosylated [40]. Originally it was thought that modifications occurred only on the N-terminal tails of histone s that protrude from the nucle osome core, but recent work has identified modifications within the core regions as well as on the C-terminal tails [41]. Lysine acetylation by histone acetyltransfera ses (HATs) has so far been the most studied of all histone modifi cations [42-44]. There are 5 families of HATs that are all large multiprotein complexes. Histone acetylation is a reversible process, catalyzed by histone deacetylases (HDACs) [45], of which there are 3 distinct families. Several lysine residues are known to be acetylated, including lysines 9, 14, 18 and 23 on H3, and lysines 5, 8, 12 and 16 on H4. Acetylated histones are usually localized to regions of actively

PAGE 19

7 transcribed DNA, therefore making them a ma rk of active or open chromatin domains, although there are instances where this is not true [46, 47]. Histone acetylation can also be associated with transcrip tional repression and silencing, as well as recombination [4851]. Certain lysine residues can also be me thylated by histone methyltransferases (HMTs). Similarly to HATs and HDACs, there are several families of HMTs, which can mono-, di-, or tri-methylate lysine residues. Recently, a histone demethylase called PAD4 has been identified [52], disprovi ng the theory that methylation may be irreversible [53]. Specific hi stone methylation patterns correla te with gene activation, as is the case with methylated lysine 4 on H3 (H3K4) [54]. But hi stone methylation can also result in gene repression and hete rochromatin formation, as with lysine 9 methylation on H3 (H3K9) [55, 56]. There are several other histone modifications as mentioned at the beginning of this section, the function of which has not all b een determined. A recent model, called the histone code hypothesis, postu lates that the combinations of histone modifications interact with other proteins that use this c ode to execute specific ge ne expression patterns [47]. This model explains how the same modification on different residues can have different outcomes. It also explains how the same modification on the same residue but in the context of different surrounding modi fications can have different consequences, such as H3 with acetylated lysines correlati ng with both activation a nd repression of gene expression [46]. Chromatin Remodeling The energy from ATP hydrolysis can be us ed to loosen DNA-histone contacts in order to mobilize histones. For this reas on, all chromatin remodeling complexes contain

PAGE 20

8 an ATPase subunit, which is critical for nuc leosome mobilization. Thus far there are 3 known families of ATP-utilizing chromatin remodeling complexes, and possibly many more to be discovered [57]. Though the mechanism of nucleosome moveme nt has not been established, there have been several models proposing that the mechanism involves DNA dissociating from the nucleosome and being replaced by a nei ghboring piece of DNA. This would yield a DNA loop that moves in a wave across the su rface of the nucleosome, ensuring that as the histone moves only a small region of contac t with the DNA is broken at any one time. This could also apply to hi stone contacts being disrupted with one piece of DNA and reestablished simultaneously on another piece of DNA as histones are relocated within the genome [57]. Chromatin remodeling complexes also have the ability to improve the accessibility of chromatin to proteins. This woul d conceivably be achieved by modifying DNAhistone contacts. Work with the glucocor ticoid receptor Gal4-VP16 and some other transcriptional activators demonstrated that th e activators bind chromatin and then recruit the chromatin remodeling complexes [58-60]. Other studies show that chromatin needs to be remodeled before transcri ption factors interact with th eir binding sites in regulatory regions [61]. Further work has provided eviden ce that there is specifi city of activators or repressors for certain chromatin remodeli ng complexes (possibly for those they can physically interact with) [62-65]. Mechanism of Transcription Activation of gene expression ultimately re sults in the stable association of RNA polymerase II (Pol II) and other components of the transcription complex with gene promoters. The first step of transcripti on for any gene involves assembly of the pre-

PAGE 21

9 initiation complex (PIC). After PIC formation and recruitment of Pol II, the C-terminal domain (CTD) of Pol II is phosphorylated l eading to the progression from initiation to elongation competent tran scription complexes. Preinitiation Complex Assembly PIC formation often begins with the binding of the TBP subunit of TFIID to the TATA box. The binding of TFIID to the TA TA box is stimulated by TFIIA, and the TFIID/TFIIA/DNA complex is recognized by TF IIB, which serves as a bridge between the pre-initiation complex and Pol II. Pol II is recruited to the PIC together with its associated factor TFIIF followed by the in teraction of TFIIE and TFIIH [66-68]. Evidence suggests that some activators act by recruiting TFIID and TFIIA to the promoter, and these in turn recruit the Pol II holoenzyme containing RNA Pol II and other general transcription f actors (GTFs) that may alrea dy be pre-assembled [69, 70]. Because genes differ in their promoter struct ure, the formation of the initiation complex likely varies between genes. For example TATA-less genes use additional proteins to recruit Pol II and general tran scription factors. Th ere may be a stepwise recruitment of factors to some promoters and recruitment of a Pol II holoenzyme to other promoters. Initiation Phosphorylation of the CTD of Pol II signals the transition from preinitiation to initiation of transcription. CTD phosphorylation is carried out by TFIIH (at serine 5) and pTEFb (at serine 2), and is thought to be re gulated by the mediator complex in yeast or the CRSP complex in higher eukaryotes [71, 72]. It has been postulated that the phosphorylation of the CTD breaks contacts between Pol II and some of the GTFs, therefore allowing Pol II to initiate transc ription [68]. Phosphorylation at the two different serines play different functional roles, since the serine-5 and serine-2

PAGE 22

10 phosphorylated Pol II complexes are observed in the early initiation and elongation stages respectively [73, 74]. It is thought that the phosp horylation status of the CTD allows association with proteins i nvolved in transcription elongati on, histone modification, and RNA processing. For some genes chromatin remodeling play s a significant role in transcription, either for PIC formation or after PIC forma tion for transcription initiation and elongation [59, 74-77]. Chromatin alterations involved in transcriptional activat ion are often limited to acetylation of histone tail s by HATs, though other modifications may also be involved but have not yet been identified. Elongation Efficient elongation requires that the Pol II CTD remains phosphorylated during the entire elongation process. A hyper-phosphorylat ed CTD is important for the interaction of Pol II with RNA processing factors such as capping enzyme, splicing factors and proteins for transcription termination [ 78, 79]. The CTD becomes de-phosphorylated after transcription termination and is then again able to interact with the promoter [68]. A CTD phosphatase Fcp1 has been identified that dephosphorylates the CTD [80-85], though the mechanism of dephosphor ylation remains elusive. Several other parameters have been disc overed that contribute to transcription elongation. Histone acetylation is required for efficient tran scription elongation in yeast [86], and seems to be lost immediately afte r the passage of Pol II [87, 88]. There are several classes of elongation factors that ha ve been identified. For example, SII reactivates arrested Pol II by inducing the Po l II’s endonucleolytic activity [89-92]. Paf1 associates with elongating Pol II to re cruit histone-modifyi ng activities [93].

PAGE 23

11 The -Globin Gene Locus The human -globin genes are expressed in a developmental stage and tissuespecific manner. Regulation of chromatin st ructure and stage-spec ific recruitment of transcription complexes play imminent role s in the expression of the globin genes. Location and Organization The -globin chains of hemoglobin are coded for by the -globin gene locus located on chromosome 11p15.5 in humans and ch romosome 7 in mice [94]. The human -globin locus contains five genes arrange d in the order of their developmental expression in erythroid ce lls (Figure 1-1) [95, 96]. At the 5’ end is the -globin gene, which is expressed first during the embryonic st age in erythroid cells in the yolk sac. Next are the Gand A-globin genes that are activated during the fetal stage when the site of hematopoiesis switches from the embryonic yolk sac to the fe tal liver. After birth, the site of hematopoiesis undergoes a second switc h to the bone marrow, coincident with the expression of the and -globin genes. The -globin gene is expressed in adults at less than 5% of the level of -globin expression. This is due to a mutation in the pr omoter that prevents high-level expression. Also, there are two -globin genes, which arose by gene duplication during evolution and their sequences only differ at amino acid 136 [97]. Similar to the human -globin locus, the mouse -globin locus has 4 genes whose expression is switched during development (Figure 1-1). The and h1 genes are expressed during the embryonic stage of mouse developmen t in the yolk sac. The maj and min genes are expressed in fetal and adult mice in the fetal liver and later in the bone marrow.

PAGE 24

12 The globin genes are relatively small, w ith three coding exons and two introns each. The exons of all -like globin genes code for a to tal of 146 amino acids. These exons correspond to the functional domains of the proteins [98, 99]. The introns are between 117 bp to 1264 bp in size [100]. The entire locus is relatively sensitive to DNaseI in erythroid ce lls (the only cells that express the -globin genes), compared to its DNaseI insensitivity in non-erythroid cells [101]. DNaseI sensitivity around the individual genes changes based on the developmental stage, such that expressed ge nes reveal an increase in DNaseI sensitivity [102]. Specific histone modification patterns have been detected in the -globin gene locus and distinguish active from inactiv e domains [103], suggesting that chromatin remodeling activities play a role in the stagespecific transcription of the globin genes. Locus Control Region In both the human and mouse -globin locus there is a prominent element located from 6 to 22 kb upstream of the -globin gene called the locu s control region (LCR) [104, 105]. As seen in Figure 1-1, it contains 5 core regions that reveal extremely high sensitivity to DNaseI in eryt hroid cells; these are called hypersensitive sites (HS1-5). LCRs are defined by their ability to enhance expression of linked genes in a tissuespecific, position-independent and copy nu mber-dependent manner [106]. The -globin LCR is required for high-level expression of the genes in erythroid cells. It has been speculated that one function of the LCR is to provide an open accessible chromatin structure to the globin genes. However, removal of the human or mouse LCR does not affect the overall DNaseI sensitivity of the locus [107-109]. Therefore, in the endogenous locus the LCR does not appear to be responsible for generating a DNaseI

PAGE 25

13 sensitive domain. However, it is feasible that the LCR regulates chromatin structure not through setting up DNaseI sensitivity but thr ough histone modifications and chromatin remodeling [110]. This is furthe r supported by data showing that -globin constructs without the LCR suffer from position-of-integrati on effects when integrated as transgenes into heterochromatin, whereas -globin constructs with the LCR do not suffer from these position effects [111]. Figure 1-1. The human and mouse -globin loci. The 5’ hypersensitive sites of the LCR and the 3’ hypersensitive sites ar e shown as blue boxes. The genes expressed during the embryonic stage of development are shown as light blue boxes. The genes expressed duri ng the fetal stage of development are shown as green boxes. The genes expr essed during adulthood are shown as yellow boxes. The genes expressed in both the fetal and adult stages are shown as orange boxes. The locus as shown here is greater than 100 kb in size and is not drawn to scale. Stage-specific expression of the genes in the -globin locus is dependent on their order relative to the LCR [112, 113]. When th e genes were reversed relative to the LCR in transgenic mice the -globin gene was expressed at the embryonic stage, whereas globin expression was abolished [114]. It has been suggested that the genes in the locus are competitively regulated, where only one ge ne from the locus can be transcribed at a

PAGE 26

14 time [115, 116]. This has recently been hypothesi zed to be due to the fact that only one active gene can interact with the LCR at a given time [117]. Evidence suggests that in tissues where -globin genes are expressed the HS cores interact to form an LCR holocomplex [20, 118-122]. Due to the high density of protein binding sites within the HS cores of the LCR, there are many factors that interact with these regions. The interactions of the protei ns, not only with the HS cores but also with other proteins in other cores, may be respons ible for mediating the formation of the LCR holocomplex. The HS core flanking regions contribute to the activity of the LCR and may stabilize interactions be tween core elements [123]. Proteins Associated with the -Globin Locus GATA. The zinc finger proteins GATA-1 and GATA-2 are the only two members of the GATA family of transcri ption factors that are known to be expressed in erythroid cells [124]. GATA-1 is one of the first er ythroid proteins expressed during red cell differentiation and it is known to associate with proteins containing histone acetylase activity [125]. This suggest s that GATA-1 may be involved in the initial opening of the chromatin in the -globin locus. There are many GATA-binding sequences in LCR HS sites and in the globin gene promoters. These sites can be bound by either GATA-1 or GATA-2. Maf and p45 proteins. Small maf proteins interact with p45 like proteins and bind to MAREs (maf recognition elements) located within HS2, HS3 and HS4. Small maf proteins contain DNA binding a nd protein-protein interactio n domains but lack transactivation domains. They heterodimerize w ith the related proteins NF-E2 (p45), Bach1, NRF1 or NRF2 [126-130] via the leucine zipper. The p45-like proteins are all

PAGE 27

15 structurally different, and ther efore may have varying functi ons. Studies suggest that p45 plays an important role in th e function of the LCR and in tr anscription of the genes [127, 131, 132]. Maf/Bach1 heterodimers have b een shown to simultaneously bind HS2, HS3 and HS4 and bring these cores together in vitro The interaction between Bach1 heterodimers is mediated by the BTB/Poz dom ain and deletion of this domain inhibited HS site interactions in this assay [13 3, 134]. Bach1/maf heterodimers function as transcriptional repressors, whereas p45/ma f dimers activate transcription. Recent evidence suggests that MAREs in the globin locus are firs t bound by Bach1 heterodimers. Heme mediates the dissociation of these dime rs and thus allows th e interaction of the activator p45/maf to interact wi th regulatory elements [135]. EKLF. CACCC sequences, also known as KLF (krppel like factor) binding sites in HS2, HS3 and globin gene promoters are c onserved across many sp ecies [136]. These sites are bound by EKLF (eryth roid krppel like factor). EKLF is required for human globin gene expression and the formation of a DNaseI hypersensitive site in the -globin gene promoter [137-140]. This is due to the fact that EKLF binds to the -globin gene promoter and recruits chromatin remodeling f actors, thus causing expression of the gene [141]. Similarly, there is an EKLF binding site in the -globin gene promoter, but at the adult stage there are proteins bound at the promoter that prevent EKLF binding and therefore opening of the promoter for -globin expression [142]. USF. An E-box, which is a CANNTG consen sus sequence, located in HS2 is known to interact with HLH (helix loop he lix) proteins such as the USF (upstream stimulatory factor) family of proteins and Tal1 [143, 144]. USF is a ubiquitously expressed transcriptional activ ator and usually binds to DNA as a heterodimer consisting

PAGE 28

16 of USF1 and USF2. USF can also help recr uit RNA polymerase II (Pol II) transcription complexes to initiator elements [145, 146]. Tal1 is an eryt hroid specific member of the HLH family of proteins, which has been s hown to function during the differentiation of hematopoietic progenitor cells, and it has recently been show n to interact with TFIIH, a member of the basal tran scription complex [147, 148]. TFII-I. The transcription factor TFII-I binds to two separate elements. First is the pyrimidine-rich initiator (Inr) el ement with a consensus of YYA+1NT/AYY located over transcription start sites [149-151]. Second is the USF recognition site, the E-box. TFII-I has a unique structure that allows for multiple protein-protein and protein-DNA interactions [152]. At In r and E-box elements TFII-I interacts both physically and functionally with USF [152]. Model for -Globin Gene Regulation Our lab has proposed a multi-step model for human -globin gene regulation (Figure 1-2) [96]. The first step towards act ivating the globin gene s involves generating a highly accessible LCR holocomplex. Replicat ion may or may not be required for this region to become DNaseI sensit ive. If this step is mediated by replication, then erythroid-specific proteins may bind to the locus after replication to prevent the formation of inaccessible chromatin domains and perhaps to also modify histone tails. It is known that GATA-1 is one of the earliest markers of red cell differentiation [125] and associates with histone acetyltransferases; therefore GATA factors may be involved in the first step of obtaining an open chromatin structure. Ot her proteins such as NF-E2 may then bind the LCR HS sites and bend or disturb the DNA structure, leading to a highly accessible region.

PAGE 29

17 The second step is the recruitment of chromatin-remodeling and transcription complexes to the LCR. The proteins bound at the LCR holocomplex will recruit chromatin remodeling complexes, coactivators, and RNA polymerase II. The recruitment of Pol II may be mediated by HLH proteins, which are known to be involved in transcription complex formation on several TATA-less genes [145, 146] First ‘pioneer’ RNA polymerases may associate with chromatin-remodeling activities to modify the nucleosome structure in the locus [153]. Next, elongation incompetent polymerases may be recruited to the LCR to be transferred to the gene promoters where they would become phosphorylated at the C-terminal domain and be rendered elongation competent [154]. Step three is the es tablishment of chromatin domains permissive for transcription. The globin locus has been separated into developmental stage-specific chromatin domains based on changes in chromatin structure, DNaseI sensitivity, histone acetylation patterns, and the presence of intergenic tr anscripts [102, 103, 155]. In tergenic transcripts are non-coding transcripts found over the entire LCR and between the globin genes [102, 156]. Intergenic transcripts of the LCR initia te upstream of or within the LCR (for example within HS2 [104]) and proceed to wards the genes [102, 156, 157]. If the region containing the site of initiati on of adult-specific intergenic transcripts is deleted then DNaseI sensitivity is decreased in that region and -globin gene expression is decreased [102]. If the before mentioned ‘pionee r’ polymerases associ ate with chromatinmodifying factors then those complexes can in itiate intergenic transcription and modify the chromatin structure so as to cr eate open chromatin domains [153].

PAGE 30

18 Figure 1-2. Multistep model for human -globin gene regulation. The model proposes four steps involved in the regulation of gene expression in the human globin locus. (A) Generation of a highly accessible LCR holocomplex. (B) Recruitment of necessary complexes. (C) Establishment of chromatin domains permissive for transcripti on. (D) Transfer of macromolecular protein complexes to indivi dual globin gene promoters. The last step is the transfer of transc ription complexes to the individual globin genes. There are two feasible models of how this is accomplished. The first is the

PAGE 31

19 linking model, where complexes recruited to the LCR would be tran sferred to the genes via proteins bound along the DNA [101, 115]. The looping model hypothesizes that the LCR interacts with the individual gene s by looping out intervening DNA [101, 115]. Recent evidence supporting the looping model within the -globin locus and in other parts of the genome came from results of experiments using the chromosome conformation capture (3C) technique [117, 120, 158-162]. Results from our lab demonstrating that Pol II, recruited to the LCR, can be loaded onto a downstream globin promoter is compatible with the looping model [132]. There are possibly many factors regulating which gene promoter the LCR transfers transcription complexes to. Due to the comp lexity involved in tran scriptional switching, our model does not postulate what causes th e signals for switching from embryonic to fetal and fetal to adult. Questions to Be Addressed The -globin gene locus is one of the most highly studied eukaryotic gene loci. This is in part due to the pr ospects of developing gene therap y strategies for sickle cell disease and -thalassemia. The presence of the LCR also makes the -globin locus a good model system for studying long-range ge ne regulation. Though there is a large body of knowledge about this gene locus, there are still many unanswere d questions. It is expected that resolving these problems will cont ribute to successful gene therapy trials as well as to our understanding of long-range gene regulation. The mechanism by which the LCR activates the genes remains to be determined. We proposed a multi-step mechanism of LCR f unction leading to the activation of globin gene expression in a developmental-stage specif ic manner [96]. To test this model, we

PAGE 32

20 propose to determine the order of recruitment of transcription factors, Pol II and specific histone modification marks to the locu s during transcriptional activation. The goals of this work were all rela ted to addressing the mechanism of LCRmediated activation of the -globin genes. The first goa l was to develop and optimize methods of investigating protei n-DNA interactions within the -globin locus in vivo and in vitro The next goal was to use these methods to compare and contrast the proteins and complexes interacting with the LCR, active genes, and inactive genes within the locus. The third goal was to use synchronized er ythroid cells to analyze recruitment of transcription factors and Pol II during repl ication. The next goal was to use an in vitro system to investigate the mechanism of Pol II transfer from the LCR to the -globin gene promoter. The last goal was to elucidate the role of USF, TF II-I and HDAC3 in the regulation of the -globin genes.

PAGE 33

21 CHAPTER 2 MATERIALS AND METHODS Cell Culture All cell culture reagents were purchased from Cellgro. MEL cells were grown in RPMI 1640 with L-glutamine supplemented with 10% fetal bovine serum and 1% antibiotic-antimycotic (ABAM) in 5% CO2 at 37 C. K562 cells were obtained from ATCC, Coriell Repositories, and DSMZ. K 562 cells were grown in RPMI 1640 with Lglutamine supplemented with 15% fetal bovine serum and 1% penicillin-streptomycin in 5% CO2 at 37 C. Chromatin Immunoprecipitation (ChIP) The ChIP assay was performed as described by Forsberg et al [103] with minor modifications. MEL and K562 cells (107 cells per antibody used) were grown in RPMI medium. Crosslinking of proteins and DNA was induced by incubating the cells in 1% formaldehyde with rocking at room temperature for 10 minutes. The crosslinking was quenched with 0.125 M glycine for 5 minutes. Cells were washed twice with cold 1 x PBS with Complete protease inhi bitors (Roche), resuspended in swelling buffer (5 mM PIPES pH 8.0, 85 mM KCl, 0.5% NP-40, pr otease inhibitors) and incubated on ice for 10 minutes. The nuclei were pelleted by cen trifugation for 5 minutes at 5000 rpm and 4 C. Nuclei were lysed by in cubation in lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris– HCl pH 8.1, protease inhibitors) on ice for 10 minutes. DNA was sonicated in an ice water bath using a Fisher model 100 sonicato r at power 5 for 4 pulses of 10 seconds to yield an average size of ~500 bp. After centrifugation for 10 minutes at 14000 rpm and

PAGE 34

22 4 C, the supernatant was diluted in dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 167 mM Tris–HCl pH 8.1, 167 mM NaCl, protease inhibitors) to a final volume of x ml where x = # of antibody samples needed. 50 l of Protein A–Sepharose beads (Amersham) per 107 cells used were added to the diluted lysate and incubated for 2 hours with rotation at 4C. The beads were pelleted and 5 l of appropriate antibody was added to each ml of aliquoted supernatant and incubated overnight wi th rotation at 4C. The antibodies used were TFIIB sc-225, TF IID (TBP) sc-273, Pol II (N-20) sc-899, NFE2 (C-19) sc-291, USF2 (C-20) sc-862 (all purchased from Santa Cruz), phospho-Pol II 05-623 and acetyl-H3 06-599 (Upstate). All an tibodies were tested in Western blotting experiments using MEL or K562 nucl ear extracts as described by Leach et al [163]. Protein A–Sepharose beads were blocked by resuspending them in blocking buffer (3% BSA, 0.05% Na azide in 10 mM Tris–HCl pH 8.1, 1 mM EDTA) a nd incubated overnight with rotation at 4C. The next day, the samples were rotated for 2 hours at 4C with 60 l blocked Protein A–Sepharose beads. The beads were pelleted and supernatants removed. 500 l of the supernatant of the ‘no antibody’ sample was kept and labeled ‘input’. The pelleted beads were washed with low salt wash (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 200 mM Tris–HCl pH 8.1, 150 mM NaCl), high salt wash (0.1% SDS 1% Triton X-100, 2 mM EDTA, 200 mM Tris–HCl pH 8.1, 500 mM NaCl), LiCl wash (0.25 M LiCl, 1% NP40, 1% Na deoxycholate, 1 mM EDTA, 100 mM Tris–HCl pH 8.1) and two washes with TE pH 8. DNA was eluted off the beads with two volumes of 250 l 1% SDS and 0.1 M NaHCO3 at 65C for 15 minutes each. The eluate s were pooled together and NaCl was added to the eluates to a final concentration of 200 mM. Crosslinking was reversed by

PAGE 35

23 incubation at 65C for 4 hours. RNA was digested by incubation with 40 g/ml RNase cocktail for 30 minutes at 37C. Proteins were then digested with 40 g/ml proteinase K in 10 mM EDTA, 40 mM Tris–HCl pH 6.5 at 37C for 1 hour. DNA was purified using a purification kit (Qiagen) and eluted in 100 l TE pH 7.4. 2.5 l DNA was used as a template for PCR with 50 pM primers and 10 l PCR mix (Eppendorf) in a total volume of 25 l. Primer pairs were used against all ar eas of interest (Table 2-1). Primers for the human -globin genes were published by Schreiber et al [164]. Table 2-1. Names and sequences of primer pairs used for ChIP Primers Sequence Human -globin US 5’ GCTCCTTTATAT GAGGCTTTCTTGG 3’ DS 5’ AATGCACCATGATGCCAGG 3’ Human -globin US 5’ TATCTTAGAG GGA GGGCTGAGGGTTTG 3’ DS 5’ CCAACTTCATCCACGTTCACCTTGC 3’ Human HS2 US 5’ TGTGTGTCTCCATTAGTGACCTCCC 3’ DS 5’ TTTTGCCATCTGCCCTGTAAGC 3’ Human -globin US 5’ CTCAATGCAAATATCTGTCTG 3’ DS 5’ TCTGGACTAGGAGCTTATTG 3’ Human HS2 5' flank US 5’ TGGGGACTCGAAAATCAAAG 3’ DS 5’ AGTAAGAAGC AAGGGCCACA 3’ Human Necdin US 5’ GTGTTATGTGCGTGCAAACC 3’ DS 5’ CTCTTCCCGGGTTTCTTCTC 3’ Mouse maj-globin US 5’ TAATTTGTCAG TAGTTTAAGGTTGC 3’ DS 5’ CAT TGTTC ACAGGCAAGAGCAGG Mouse -globin US 5’ CAAAGAGAGT TTTTGTTGAAGGAGGAG 3’ DS 5’ AAAGTTCACCATGATGGCAAGTCTGG 3’ Mouse HS2 US 5’ TTCCTAC ACATTAACGAGCCTCTGC 3’ DS 5’AACATCTGGCCACACACCCTAAGC 3’ Mouse HS2 5'flank US 5’ CT ATTTGCTAACAGTCTGACAATAGAGTAG 3’ DS 5’ GTTACATATGCAGCTAAAGCCACAAATC 3’ Mouse necdin US 5’TTTACATA AGCCTAGTGGTACCCTTCC 3’ DS 5’ATCGCTGTCCTGCATCTCACAGTCG 3’ Titration of cycle numbers was performed with the different primer pairs to determine the range of linear amplification. After the optimal number of PCR cycles, DNA was run in 5% TBE polyacrylamide gels. The gels were stained with SyBr-green

PAGE 36

24 and analyzed by fluorescence scanning on a Storm scanner. Quantitations were performed using ImageQuant. Chromatin Immunoprecipitat ion and DMS Footprinting ChIP was performed as described above with the following modifications. Approximately 3.33 x 107 MEL cells were collected per antibody to be used. Crosslinking was induced by adding 1% (v/v) formaldehyde and incubation for 10 minutes at room temperature on a shaker. After stopping the crosslinking reaction by adding 0.125 M glycine and incubation for 5 minutes (with shaking at room temperature), the cells were pelleted at 2000 rpm. The cells were then washed twice in 25 ml ice-cold phosphate-buffered saline (PBS) including protease inhibitors. Nu clei were isolated by resuspending the cell pellet in 1 ml ice-cold swelling buffer (5 mM PIPES pH 8.0, 85 mM KCl, 0.5% NP-40, and protease inhibitors), split into two aliquots and incubated on ice for 10 minutes. Chromatin was fragmented by subjecting the nuclei to restriction enzyme digestion with 200 U Pst I for 4 hours at 37C and 100 U Pst I for an additional 16 hours at 37C. The nuclei were then incubated with 200 U RNase cocktail (Ambion) and an additional 100 U aliquot of Pst I for 2 hours at 37C. Nuclei were pelleted at 4C for 5 minutes at 5000 rpm and lysed in 1 ml lysis buffer (1% SDS, 10 mM EDTA and 50 mM Tris–HCl pH 8.1, protease inhibitors) on ice for 20 minut es. Restriction enzyme digestion was verified by electrophoresis on a 2% agarose gel followed by Southern blotting using a radioactive probe hybridizing to the human -globin gene. The lysate was combined and transferred to a 15 ml conical tube and diluted with 9 ml dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 16.7 mM Tris–HCl

PAGE 37

25 pH 8.1, 167 mM NaCl and protease inhibitors ). An aliquot of 500 l protein A– Sepharose beads (Amersham) was added to the diluted nuclear lysate and incubated for 2 hours at 4C while rotating. The beads were pelleted for 10 minutes at 2000 rpm and the supernatant was divide d into three aliquots. An aliquot of 25 l of the appropriate antibody (USF1 sc-229 or NF-E2 sc-291; Santa Cruz Biotechnology) or no antibody was added to the aliquoted supernatant and incubated at 4C overnight while rotating. Protein A–Sepharose beads were blocked overnight ro tating at 4C in a 1:1 ratio of beads to blocking buffer [3% BSA and 0.05% sodium azide in 1 x TE (10 mM Tris–HCl pH 8.1, 1 mM EDTA)]. The chromatin was then immunoprecipitated with 600 l blocked protein A– Sepharose beads for 2 hours at 4C on a rotator. The immunoprecipitates were pelleted at 13000 rpm for 30 seconds and 1 ml of the no antibody supernatant was saved and labeled as ‘input’. Half of the input chromatin was ethanol precipitated and resuspended in two aliquots of 20 l ddH2O and 800 l DMS buffer (50 mM sodium cacodylate, 1 mM EDTA) and the other half was saved for the ChIP PCR analysis. The supernatants of the samples precipitated with USF1 and NF-E2 antibodies were discarded and the pellets were washed by rotating at 4C for 5 minutes with 1 ml each of low salt wash (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris–HCl pH 8.1, 150 mM NaCl), high salt wash (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris–H Cl pH 8.1, 500 mM NaCl), LiCl wash (0.25 M LiCl, 1% NP-40, 1% sodium deoxycholate, 1 mM EDTA, 10 mM Tris–HCl pH 8.1) and twice with 1 x TE pH 8. Of the immunoprecipitates, 80% was resuspended in 800 l DMS buffer and 20% was left in TE buffer for the ChIP/PCR analysis.

PAGE 38

26 DMS Treatment DMS treatment of the immunoprecipitated chromatin was performed using the Maxam and Gilbert guanine-s pecific sequencing reaction with 0.1% DMS for 15, 45 or 90 seconds at room temperature [165]. The reaction was stopped by adding 50 l DMS stop buffer (1.5 M sodium acetate pH 7.0, 1 M 2-mercaptoethanol), followed by two ethanol precipitations in a dr y ice bath. The DMS-treated and non-DMS-treated chromatin was then eluted from the beads by incubating twice with 250 l elution buffer (1% SDS, 0.1 M NaHCO3), shaking at 950 rpm for 15 minutes at 65C, each time saving the supernatant. An aliquot of 200 mM NaCl was added to the eluates and crosslinking was reversed by incubation at 65C for 5 hours. Proteins we re digested with 40 g/ml proteinase K in 10 mM EDTA and 40 mM Tris pH 6.5 for 1 hour at 37C. Immunoprecipitated DNA was purified using a Qiagen kit and eluted with 180 l ddH2O. To cleave the DMS-treated DNA, 20 l piperidine were added and incubated at 95C for 30 minutes. The DNA was washed twice by adding 1 ml ddH2O, dried in a Speed Vac and resuspended in 50 l 1 x TE. Of the DMS-treated immunoprecipitated DNA, 10% was used for ligation-mediated PCR (LMPCR)-assisted in vivo footprinting. An aliquot of the precipitated DNA was also analyzed by PCR using primers specific for the murine -globin downstream promoter region (forward primer, 5'GACAAACATTATTCAGAGGGAGT ACCC; reverse primer, 5'AGGTGCACCATGATGTCTGTTTCTGG) using a protocol previously published by Forsberg et al [131]. Linker LMPCR LMPCR was essentially performed as described by Hornstra and Yang [166] with the following modifications. Approximately 2 g DMS-treated genomic DNA or 10%

PAGE 39

27 immunoprecipitated DNA was annealed to 0.6 pmol gene-specific primer (MPA 1) by denaturing at 96C for 10 minutes followed by anneali ng at 47C for 30 minutes in a 15 l solution of 1 x Vent buffer (10 mM Tris–HCl pH 8.9 and 40 mM NaCl). Primer extension was performed by adding a 15 l solution of 10 mM Tris–HCl pH 8.9, 40 mM NaCl, 0.5 mM dNTPs and 2 U Vent polymerase (New England Biolabs) and incubating at 53C for 1 minute, 55C for 1 minute, 57C for 1 minute, 60C for 1 minute, 62C for 1 minute, 66C for 1 minute, 68C for 3 minutes and 76C for 3 minutes. A 20 l dilution solution (110 mM Tris–HCl pH 7.5, 18 mM MgCl2, 50 mM DTT, 0.0125% BSA) was then added to the extension reaction. Blunt-end ligation was performed by adding a 25 l solution of 100 pmol asymmetric double-stranded linker, 10 mM MgCl2, 20 mM DTT, 3 mM ATP, 0.005% BSA and 4.5 U T4 ligase (Ambion) to the reaction and incubating at 17C overnight. The ligation products were purified by standard phenol/chloroform extractions and ethanol precipitation including 10 g/l tRNA. The ligated DNA was resuspended in 20 l ddH2O and added to 80 l PCR mix [ 10 mM Tris–HCl pH 8.9, 40 mM NaCl, 3 mM MgCl2, 0.25 mM dNTPs, 20 pmol gene-specific PCR primer (MPA 3), 20 pmol linker primer 2 and 0.5 U Taq polymerase; Gibco BRL]. This PCR mixture was initially denatured at 95C for 5 minutes and then subjected to 20 cycles of PCR under the following conditions: 95C for 20 seconds, 65C for 1 minute, 72C for 1 minute with an increase of 5 seconds/cycle and an additional 5 cycles of 95C for 20 seconds, 65C for 1 minute, 72C for 2 minutes 30 seconds, followed by a final extension at 72C for 15 minutes. The PCR products were puri fied by phenol/chloroform extraction and ethanol precipitation and resuspended in 30 l ddH2O. Initially, 3 l of the PCR products were

PAGE 40

28 size-fractionated on a 0.4 mm thick 5% polyacryl amide gel made with 8 g/ml ammonium persulfate, then electr otransfered for 30 minutes to a nylon membrane (Hybond N+; Amersham). Radiolabeled probes were synt hesized using the Prime-a-Probe kit (Ambion) from a gel-purified PCR product (PCR primers: -maj FWD, 5'GACAAACATTATTCAGAGGGAGTACCC-3'; MPB 1, 5'TCTGTCTCCAAGCACCCAA-3') containing the region of inte rest. To radiolabel the probe, 150 ng template DNA was mixe d with 0.3 g gene-specific primer (MPA 3), used in the PCR step of the LMPCR protocol, and brought up to 8 l in ddH2O. This primer plus template mixture was denatured at 95C for 10 minutes and immediately placed on dry ice to snap freeze. Then 5 l of 5 x Decaprime buffer containing dATP, dGTP and dTTP (Ambion) was incubated with 10 l [ -32P] dCTP (3000 Ci/mmol) and 1 U/l Klenow fragment at 37C for 30 mi nutes. The reaction was quenched on ice and stopped by adding 35 l formamide loading dye. The probe was denatured at 95C for 10 minutes and purified on a 5% denaturing polyacrylamide gel. After exposing the gel to film (Type 57; Polaroid) the probe was cut out of the gel, crushed and soaked in 4 ml hybridization buffer (250 mM Na2PO4 pH 7.2, 7% SDS, 1% BSA). The probe was hybridized to the blots at 65C overnight. The blots were washed three times at 65C in washing solution (20 mM Na2PO4 pH 7.2, 1% SDS) and visualized by autoradiography. The following primers were used for LMPCR: MPA 1, 5'-ATGTCCAGGGAGAAATATCG-3'; MPA 3, 5'TGAAGGGCCAATCTGCTCACACAGG-3'.

PAGE 41

29 Western Blotting To 19 parts Laemmli sample buffer (Bio-Rad) was added 1 part -mercaptoethanol. 2 volumes of this buffer were added to each nuc lear protein extract or whole cell extract and the mixture heated at 95 C for 10 minutes. 25 l of each sample was loaded on a 10% Tris-HCl Ready Gel (Bio-Rad) and run at 150V in cold tank buffer (25 mM Tris, 192 mM glycine, 0.1% SDS) until the dye reached the bottom. The gel, membrane (Bio-Rad), filter paper (Bio-Rad), and fiber pads (Bio-Rad Mini Protean apparatus) were soaked in cold transfer buffer (10 mM NaHCO3, 3 mM NaCO3, and 20% methanol, pH 9.9) for 15 minutes and then set up in a transfer sandwich with a fiber pad, filter paper, the gel, membrane, filter paper, and fiber pad. Th e transfer was run overnight at 30V at 4 C with constant stirring in the Mini Protean apparatus (Bio-Rad). The transfer was disassembled and the memb rane was stained with Fast Green for 5 minutes and washed twice in destain soluti on (50% methanol, 10% acetic acid). It was then rinsed in TBS-Tween (30 mM Tris 150 mM NaCl, 0.1% Tween 20, pH 7.6) and blocked 1 hour in 5% milk in TBS-Tween sh aking at room temperature. The membrane was rinsed twice in TBS-Tween, washed once in TBS-Tween for 15 minutes while shaking at room temperature, and washed twice for 5 minutes in TBS-Tween while shaking at room temperature. It was inc ubated 1 hour in 10 ml 5% milk in TBS-Tween containing 1:500 anti-HDAC3 while shaking at room temperature. The membrane was rinsed twice in TBS-Tween, washed once in TBS-Tween for 15 minutes while shaking at room temperature, and washed twice for 5 mi nutes in TBS-Tween while shaking at room temperature. It was incubated 1 hour in 15 ml 5% milk in TBS-Tween containing 1:50000 anti-rabbit while shaking at room temper ature. The membrane was rinsed twice

PAGE 42

30 in TBS-Tween, washed once in TBS-Tween for 15 minutes while shaking at room temperature, and washed twice for 5 minut es in TBS-Tween while shaking at room temperature. ECL reagents (Amersham) were mixed according to the manufacturer’s recommendations and added to the membrane The membrane was then exposed to Kodak MS film for varying times. Cell Synchronization K562 cells were synchronized at the borde r of G1 and S phase by incubating the cells with complete growth medium in th e presence of 2 mM t hymidine for 17 hours, washing twice with complete medium, inc ubating in complete medium for 12 hours and blocking the cells in complete medium w ith 2 mM thymidine for another 17 hours [167, 168]. Blocked cells were fixed with etha nol, digested with RNase, stained with propidium iodide and subjected to flow cy tometry to verify synchronization. Blocked cells were taken as “time 0” and subjected to ChIP and PCR analysis. The blocked cells were then washed twice with complete me dium to release them from the block and allowed to grow in complete medium. Cells were taken for flow cytometry, ChIP, and PCR analysis at specific time point s after release from the arrest. PCR-Based DNA Replication Analysis DNA Isolation Added to lysis solution (50 mM KCl, 10 mM Tris-HCl pH 8, 1.25 mM MgCl2, 0.45% NP-40, 0.45% Tween 20) was 75 l of 10mg/ml proteinase K per ml of lysis solution (added fresh every time). Synchronized cells we re counted and 106 cells were collected, washed with 1x PBS and resuspended in 100 l lysis solution per 105 cells. The cells were incubated in the lysis solution overnight. The next day, 500 l phenol was

PAGE 43

31 added and vortexed for 1 minute. The r eaction was centrifuged fo r 5 minutes at 14000 rpm and room temperature. Then 500 l phenol/chloroform/isoamyl alcohol was added to the supernatant and it was vortexed for 1 minute. The samples were centrifuged for 5 minutes at 14000 rpm and room temperature. Then, 500 l chloroform/isoamyl alcohol was added to the supernatant, the reaction wa s vortexed for 1 minute and centrifuged for 5 minutes at 14000 rpm and room temperature. Next 100% ethanol was added to the supernatant, incubated for 15 minutes at room temperature, and centrifuged 30 minutes at 14000 rpm and room temperature. The supernatant was discarded and 500 l of 70% ethanol was added to the pellet. The sa mple was centrifuged for 10 minutes at 14000 rpm and room temperature. The supernatant was removed and the pe llet allowed to air dry. The pellet was then resuspended in 50 l TE pH 7.4. 1 l RNase was added and it was incubated for 30 minutes in a 37C water bath. The DNA was used for PCR and the rest stored at –20C. Semi-Quantitative PCR 2.5 l DNA was used as a template for PCR with 50 pM primers and 10 l PCR mix (Eppendorf) in a total volume of 25 l. Primer pairs were used against the human globin, human necdin, mouse maj-globin and mouse necdin, as described in Table 2-1. PCR was performed with cycle numbers 18, 20, 22, 24, 26, 28, and 30. DNA was run in 5% TBE polyacrylamide gels. The gels were stained with SyBr-green and analyzed by fluorescence scanning on a Storm scanner. Qu antitations were performed using ImageQuant. The ratios of human -globin to human necdin and mouse maj-globin to mouse necdin were calculated for samples from all time points at a cycle number within the linear range.

PAGE 44

32 In Vitro Polymerase Transfer Analysis A plasmid containing the wild-type human -globin LCR was linearized and immobilized on streptavidin coated magnetic beads as described by Leach et al [169] The immobilized LCR (200 ng) was incubated for 30 minutes at 30C with 50 g MEL nuclear protein extract (10 l) and 15 l 2x binding buffer (36 mM HEPES, pH 7.9, 160 mM KCl, 40 mM MgCl2, 4 mM DTT, 10 mM PM SF, 20% glycerol) in a total volume of 100 l. The tubes were placed on a magnet, th e supernatant removed, and the beads were washed three times with 1x binding buffer. The beads were then resuspended in 1x binding buffer and incubated for 10 minutes at 30C in the presence or absence of 50 ng of the plasmid pRS A/X containing the wild-type or mutant -globin gene [163]. The supernatants were removed and samples containing the wild type or mutant -globin gene were crosslinked by incubation for 10 minut es in 0.5 % formaldehyde at RT. The crosslinking reaction was st opped by the addition of 0.125 M glycine and incubation for 5 minutes at RT. The supernatan t of reactions not containing the -globin gene were incubated for 10 minutes at 30C in the presence of pRS A/X, after which these samples were crosslinked as well. All samples were dialyzed against ChIP dilution buffer and subjected to immunoprecipitation using Pol II specific antibodies and PCR analysis as described by Leach et al [163]. In some experiments recombinant NF-E2 [163] or BSA (0.3 g/ l) was added to the transf er reactions. The plasmid maxi was used as a positive control for the PCR and was generated by lig ating an 800 bp Pml1 restriction fragment from the human LCR into the Pml1 site of pRS A/X. The -globin PCR primers span the Pml1 site present in the -globin gene thus generating a PCR product that is 800 bp larger than the PCR product from the wild type -globin gene. The TK-HGH plasmid contains

PAGE 45

33 the human growth hormone gene under th e control of the Herpes Simplex Virus thymidine kinase promoter [163]. The HS2 pl asmid contains the HS2 core plus flanking sequence as previously described [122]. The following primers were used in these experiments: -globin US: 5’ CCTGAGGAGAAGT CTGCCGTTACTG 3’ and DS: 5’ TCCTATGACATGAACTTAACCATAG 3’; TK-HGH: US: 5’ GGAGGCTGGAAGATGGCA 3’; DS: 5’ AGTAGTGCGTCATCGTTGTGTG 3’; human HS2: as described in Table 2-1. MEL Cell DMSO Differentiation MEL cells were incubated in RPMI 1640 with L-glutamine supplemented with 10% fetal bovine serum, 1% antibiotic-ant imycotic (ABAM) and 1% DMSO in 5% CO2 at 37 C for three days. RNA was isolated from the cells for semi-quantitative RT-PCR. Semi-Quantitative RT-PCR RNA was isolated for RT-PCR using an R NA Isolation Kit (Gentra) according to the manufacturer’s protocol. Reverse Tran scription was performed using 200 to 250 ng RNA and the first strand cDNA synthesi s Kit (Bio-Rad) as described by the manufacturers protocol PCR amplification was perfor med using PCR Mastermix from Eppendorf and primer sequences specific for the murine -globin and -actin gene with 15 and 16 cycles as indicated. The mouse -actin primers used were: US 5’ GGACGACATGGAGAAGAT 3’ and DS 5’ ATCTCCTGCTCGAAGTCT 3’. The mouse -globin primers used were: US 5’ AAAGGTGAACTCCGATGAAGTTGG 3’ and DS 5’ TTCTGGAAGGCAGCCTGTGC 3’. After electrophoresis the gels were stained with SyBr Green, scanned using a st orm scanner, and quantitated with Image Quant.

PAGE 46

34 Double Immunoprecipitation Approximately 2 x 107 K562 cells were collected pe r immunoprecipitate reaction. The cells were incubated in 1% formaldehyde with rocking at room temperature for 10 minutes to induce crosslinking. Crosslinking was quenched with 0.125 M glycine for 5 minutes shaking at room temperat ure. Cells were washed twice with cold 1 x PBS with Complete Protease Inhibitors (Roche), resuspended in swelling buffer (5 mM PIPES pH 8.0, 85 mM KCl, 0.5% NP-40, protease inhibitors), and incubated on ice for 10 minutes. Nuclei were pelleted by centrifuga tion for 5 minutes at 5000 rpm and 4 C. Nuclei were lysed by resuspending in lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris–HCl pH 8.1, protease inhibitors) and incubating on ice for 10 minutes. DNA was sonicated in an ice water bath using a Fisher model 100 sonicato r at power 5 with 5 pulses of 10 seconds each with 1 minute cooling in between, to yi eld an average size of ~500 bp. The sample was then centrifuged for 10 minutes at 14000 rpm and 4 C. The supernatant was diluted in dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 167 mM Tris–HCl pH 8.1, 167 mM NaCl, protease inhibitors) to a final volume of x ml where x = # of antibody samples needed. Then 50 l of Protein A–Sepharose beads (Amersham) per 2 x 107 cells used were added to the diluted lysate and incubated for 2 hours with rotation at 4C. The beads were pelleted and 5 l of appropriate antibody was added to each ml of aliquoted supernatant and incubated overnight with rotati on at 4C. The antibodies used were TFII-I (a gift from R. Roeder, Rockefeller Un iversity) and HDAC3 (a gift from E. Seto, University of South Flor ida). Protein A–Sepharose beads were blocked by resuspension

PAGE 47

35 in blocking buffer (3% BSA, 0.05% Na azide in 10 mM Tris–HCl pH 8.1, 1 mM EDTA) and incubated overnight with rotation at 4C. The next day, the samples were rotated for 2 hours at 4C with 60 l blocked Protein A–Sepharose beads. The beads were pelleted and supernatants removed. Then 500 l of the supernatant of the ‘no antibody’ sample was kept and labeled ‘input’. The pelleted beads were washed with low salt wash (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 200 mM Tris–HCl pH 8.1, 150 mM NaCl), high salt wash (0.1% SDS 1% Triton X-100, 2 mM EDTA, 200 mM Tris–HCl pH 8.1, 500 mM NaCl), LiCl wash (0.25 M LiCl, 1% NP-40, 1% Na deoxycholate, 1 mM EDTA, 100 mM Tris–HCl pH 8.1) and two washes with TE pH 8. DNA was eluted off the beads with two 250 l 1% SDS and 0.1 M NaHCO3 washes at 65C for 15 minutes each shak ing at 950 rpm. The two elutions were pooled together and then dial yzed against 200 ml of diluti on buffer with Complete Mini protease inhibitors using Slide-A-Lyzer Mini Dialysis units (Pierce) at 4 C with constant stirring for 2 hours. After samples were taken out of dialysis units and placed in 1.5 ml tubes, 500 l dilution buffer was added to each. For the second imm unoprecipitation 5 l of antibody was added to each and incubated overnight at 4 C rotating. Protein A– Sepharose beads were blocked by resuspending them in blocking buffer and incubated overnight with rotation at 4C. The next day, the samples were rotated for 2 hours at 4C with 60 l blocked Protein A–Sepharose beads. The beads were pelleted and supernatants removed. The pelleted beads were washed with low salt wash, high salt wash, LiCl wash and two washes with TE pH 8. DNA was eluted off the beads with two 250 l 1% SDS and 0.1 M NaHCO3 washes shaking at 65C for 15 minutes each. The two elutions were pooled

PAGE 48

36 together and NaCl was added to the eluates to a final concentration of 200 mM and crosslinking was reversed by incubation at 65 C for 4 hours. RNA was digested by incubation with 40 g/ml RNase cockta il (Ambion) for 30 minutes at 37C. Proteins were then digested with 40 g/ml proteinase K in 10 mM EDTA, 40 mM Tris–HCl pH 6.5 at 37C for 1 hour. DNA was purified using a column purification kit (Qiagen) and eluted in 100 l TE pH 7.4. Then 2.5 l DNA was used as a template for PCR with 50 pM primers and 10 l PCR mix (Eppendorf) in a total volume of 25 l. The human globin, -globin and HS2&3 linker primer pairs were used for PCR (see Table 2-1). PCR was performed for 28 cycles, and DNA was run in a 5% TBE polyacrylamide gel. The gels were stained with SyBr-gr een and analyzed by fluorescence scanning on a Storm scanner. Co-Immunoprecipitation 107 K562 cells were collected per immunopreci pitate reaction. Cells were washed twice with cold 1 x PBS with Complete protease inhi bitors (Roche), resuspended in swelling buffer (5 mM PIPES pH 8.0, 85 mM KCl, 0.5% NP-40, prot ease inhibitors) and incubated on ice for 10 minutes. Nuclei were pelle ted by centrifugation for 5 minutes at 5000 rpm and 4 C. Nuclei were lysed by resuspending in lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris–HCl pH 8.1, protease inhibitors) and incubating on ice for 10 minutes. DNA was sonicated in an ice water bath with a Fisher model 100 sonicator at power 5 with 5 pulses of 10 seconds each with 1 minute cooling in between, to yield an average size of ~500 bp. The samples were then centrifuged for 10 minutes at 14000 rpm and 4 C. The supernatant was diluted in dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 167 mM Tris–HCl pH 8.1, 167 mM NaCl, protease inhibitors) to a final

PAGE 49

37 volume of x ml where x = # of antibody samples needed. 50 l of Protein A–Sepharose beads (Amersham) per 107 cells used were added to the diluted lysate and incubated for 2 hours with rotation at 4C. The beads were pelleted and 5 l of appropriate antibody was added to the aliquoted supernatant and incubated overnight with rotation at 4C. The antibodies used were USF1 sc-229, USF2 sc -862, Pol II sc-899 (all from Santa Cruz) TFII-I (a gift from R. Roeder, Rockefeller Un iversity) and HDAC3 (a gift from E. Seto, University of South Flor ida). Protein A–Sepharose beads were blocked by resuspension in blocking buffer (3% BSA, 0.05% Na azide in 10 mM Tris–HCl pH 8.1, 1 mM EDTA) and incubation overnight with rotation at 4C. The next day, the samples were rotated for 2 hours at 4C with 60 l blocked Protein A–Sepharose beads. The beads were pelleted and supernatants removed. The pelleted beads were washed with low salt wash (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 200 mM Tris–HCl pH 8.1, 150 mM NaCl), high salt wash (0.1% SDS 1% Triton X-100, 2 mM EDTA, 200 mM Tris–HCl pH 8.1, 500 mM NaCl), LiCl wash (0.25 M LiCl, 1% NP-40, 1% Na deoxycholate, 1 mM EDTA, 100 mM Tris–HCl pH 8.1) and two washes with TE pH 8. DNA was eluted off the beads with two 250 l 1% SDS and 0.1 M NaHCO3 washes shaking at 65C for 15 minutes each. The two elutions were pooled together and concentrated in the Speed V ac for about 1 hour. The samples were then subjected to Western blotting pr ocedures as described above.

PAGE 50

38 CHAPTER 3 CHROMATIN IMMUNOPRECIPITATION AND DMS FOOTPRINTING Introduction Transcription in eukaryotes is a complex process involving the binding of proteins to the promoter, recruitment of transcription complexes, initiation, elongation and termination [170]. This process is dynamic and controlled at each step by proteins that bind to the DNA, to the RNA polymerase holocomplex, or both. Although knowledge about transcription complex formation in vitro is extensive, the mechanisms leading to transcription in the context of higher order chromatin in vivo are not understood in detail. Many nuclear processes including tr anscription, DNA replication, homologous recombination, DNA repair, and others are re gulated by proteins th at interact with specific DNA sequences or structures in the c ontext of chromatin. Therefore, there is a great demand for new and better techniques to investigate proteinDNA interactions. A number of techniques ar e available to study the interaction of protei ns with specific segments of DNA in vivo ; each of these techniques has distinct limitations [166, 171174]. Chromatin immunoprecipitation (ChIP) is a powerful method to analyze the interaction of proteins with specific chromatin regions in vivo [171, 172]. This technique involves crosslinking protein-DNA and protein-protein interactions in live cells, followed by immunoprecipitation of the lysed nuclear contents to is olate segments of DNA that are bound to the protein of interest in vivo Combined with PCR, the ChIP assay is very sensitive in detecting proteins that crosslink to a specific region in chromatin. There are

PAGE 51

39 at least two limitations of the ChIP assay. First, ChIP does not provide information regarding the specific sequen ce a protein interacts with in vivo The size of the ChIP fragments is on average 500bp, so the correspon ding binding site for a specific protein can be within a region of up to 1 kb of DNA. Second, ChIP does not reveal whether a protein directly binds to th e DNA or is recruited to DNA by protein/protein interactions. Another method commonly used to examine the interaction of proteins and DNA is in vivo footprinting [166, 173, 174]. In footprin ting experiments enzymes like DNaseI or chemicals like DMS/piperidine are used to cleave the DNA. Nucleotides that are bound by proteins are normally protec ted from cleavage. The cleavage pattern can be visualized either directly or after PCR using electr ophoresis in combination with radioactive labeling techniques and autora diography. The limitation of in vivo footprinting is that it does not reveal what the protei n is that is causing the prot ection of particular bases. Another problem with the in vivo footprinting technique is that it fails to provide clear results in situations where a pr otein is bound in a sequence-specific manner in only a small fraction of cells, in other words, if the protein-DNA interaction is transient. We have combined the ChIP and in vivo footprinting techniques and developed a novel method for analyzing protein–DNA interactions in vivo This new technique is similar in concept to an in vitro protocol developed by Gallarda et al [175]. These authors used a monoclonal antibody-based DNa seI footprint selec tion technique, which unambiguously identifies proteins res ponsible for particular footprints. The technique we have de veloped here is aimed at analyzing sequence-specific interactions of pa rticular proteins in vivo In the process of developing and optimizing the technique, we have anal yzed the interaction of proteins with the mouse -globin

PAGE 52

40 downstream promoter region in unsynchronized MEL (m ouse erythroleukemia) cells. We show that chromatin fragments precipitated with antibodie s against USF1 or NF-E2 reveal strikingly different footprint patterns on a specific -globin gene promoter region. The USF1-selected templates show no footprin t in this region, but the NF-E2-selected fragments show a footprint at a non-consensus MARE. This result indicates that this novel method will allow investigators to select specific templates for in vivo footprinting, and determine exactly where thei r protein of interest binds. Results The developmental stage-specific expression of the human -globin gene is regulated primarily by transcri ption factors that interact with gene-proximal cis DNA elements [95]. We have shown that USF1 and USF2 interact w ith a downstream promoter element of the human -globin gene in vitro [163]. In the same study we have shown that these proteins are crosslinked to the -globin gene in erythroid cells in vivo In addition, data published by Sawado et al [176], as well as our own experiments revealed that NFE2 can be crosslinked to the -globin gene in vivo The crosslinking of NF-E2 to the globin promoter is somewhat surprising as there is no consensus DNA-binding site in the globin gene. However, a sequence located downstream of the transcription start site reveals partial homology to the NF-E2 consensus element, also referred to as the MARE (maf recognition element, Figure 3-1; [126, 177, 178]. The NF-E2 consensus sequence is 5'-TGCTGASTCAY-3' (S = G or C; Y = T or C; [178]). The sequence in the mouse globin downstream promoter region differs in one position (the third) from the consensus sequence. Conventional in vivo footprinting did not reveal significant protection of the NF-E2-binding site in MEL cells (Figure 3-4, lanes 1 and 2). To analyze the possibility

PAGE 53

41 that NF-E2 interacts with the -globin downstream element in vivo in only a fraction of erythroid cells, we have developed a novel method that combines the ChIP assay with DMS footprinting. Figure 3-1. Sequence alignment of the adult -globin downstream promoter region. Shown are three sequences of the -globin downstream promoter region from human (H), mouse (M) and rabbit (R) [177]. The shaded box highlights the position of the MA RE/Ap1-like sequence and the arrow points to the transcription start site. The procedure (outlined in Figur e 3-2) involves the crosslinking of proteins and DNA using formaldehyde (1%), followed by digestion of permeabilized nuclei with restriction enzymes, precipitation with specific antibodies, treatment and cleavage of precipitated chromatin restriction fragments with DMS and piperidine and analysis of the cleavage pattern by LMPCR (for details see Materials and Methods Chapter). Figure 3-3 shows that anti bodies against USF1 and NF-E2 precipitate crosslinked chromatin fragments containing the murine adult -globin gene, as expected from previous data [163, 176]. The subsequent DMS footprint of the precipitat ed chromatin fragments revealed interesting characteristics of the precipitated fragments (Figure 3-4). First, the overall footprint pattern of fragments selected with USF antibodies is different from those precipitated with NF-E2 antibodies (compare Figure 3-4, lanes 3 and 4). This is

PAGE 54

42 particularly obvious over the MARE-like sequence, which shows clear protection only in templates selected by NF-E2 precipitation. Figure 3-2. Analysis of protei n–DNA interactions in the murine -globin downstream promoter region by a combination of chromatin immunoprecipitation and DMS footprinting. Diagram outlining the experimental procedure for footprinting ChIP-selected templates. The difference in the cleavage pattern between the templates selected by USF or NF-E2 antibodies could reflect th e possibility that the proteins interact with the globin gene at different stages of the transcription cycle. Alternatively, the results could reflect the possibility that low occupancy of these s ites would strongly reduce the probability of selecting templates wh ich have both proteins bound simultaneously. Second, the overall footprint pattern of fragments precipitated with USF antibodies is similar to the pattern found in unselected templates, whereas the footprint pattern for NF-E2-selected fragments is different. This result suggests that only a small fraction of cells may have NF-E2 bound at the -globin gene.

PAGE 55

43 Figure 3-3. ChIP experiment showing the interaction of USF1 and NF-E2 with the murine maj-globin promoter in MEL ce lls. MEL cells were grown under standard conditions and crossli nked with formaldehyde. After fragmentation, the chromatin was precip itated with no antibodies (lane 2), antibodies against USF1 ( USF, lane 3) or antibodies against the p45 subunit of NF-E2 ( NF-E2, lane 4). Lane 1 shows the PCR result of the input, which serves as a positive control. It is important to note that formaldehyde crosslinking does not appear to change the cleavage pattern in the DNA region analyzed in these experiments; the overall pattern is similar between untreated cells (Figure 34, lanes 1 and 2) and crosslinked cells (lanes 3 and 4). In addition, we found that incubation of genomic DNA with 1% formaldehyde (with subsequent reversal of the crosslink) does not change the overall DMS cleavage pattern in the DNA region that we have an alyzed by LMPCR (data not shown). Discussion We examined the interaction of NF-E2 with the non-c onsensus MARE-binding site in the downstream promoter region in detail using a novel in vivo method. The potential sequence-specific interaction of NF-E2 with the -globin downstream promoter region is interesting in light of the fact that Johnson et al [179] previously showed that RNA polymerase II is recruited to both the LCR and to the adult -globin gene and that the transfer of the polymerase from the LCR to the globin gene depends on the presence of

PAGE 56

44 NF-E2 (p45). In this respect it is possible that NF-E2 is part of the recruitment process that mediates the interaction of RNA polymerase II with the -globin promoter. Figure 3-4. LMPCR fo otprint analysis of non-selected or ChIP-selected chromatin. Chromatin was precipitated with USF or NF-E2 antibodies. The precipitates were subjected to DMS f ootprinting (lane 3, USF-se lected chromatin; lane 4, NF-E2-selected chromatin). In vivo footprinting was also performed on MEL cells that were not treated with formaldehyde (lane 2). Lane 1 shows the DMS/piperidine cleavage pattern in in vitro treated MEL genomic DNA. Lane 5 shows the G-ladder of the -globin downstream promoter region. Indicated on the right are the positions of the initiator and MARE-like sequences, as well as the start site an d direction of transcription. Open circles indicate protected G resi dues in NF-E2-selected chromatin. Several methods are available to fragment crosslinked chromatin for ChIP, including sonication, MNase digestion and restriction enzyme digestion [171, 172, 180, 181]. We reasoned that sonication or MNase digestion might fragment the chromatin in a

PAGE 57

45 way that not all of the resulting templates would be amplifiable by LMPCR and in addition may result in a high background. We therefore chose to fragment the crosslinked chromatin by restriction enzyme digestion [180]. The disadvantage in using this method is that long incubation with the restriction enzyme allows endogenous nucleases to attack the chroma tin in accessible regions. In some of our experiments, we observed inconsistent LMPCR banding patterns in ChIP-selected templates in the higher molecular weight ranges (data not shown). This problem can be solved by incubating the nuclei for shorter periods of time with higher concentrations of rest riction enzyme [181] or by following similar restriction dige st protocols from other groups [182]. Another issue that has to be considered is the fact that the precipitation of templates using ChIP results in different concentrations of templates. It is thus important to perform a titration of the templates precipitated with different antibodies. Similarly, we were unsure whether the steps of the ChIP assay leave the protein in a native structure to give a true footprint in all cases test ed. Though it could be postulated, that once a footprint such as NF-E2 at an NF-E2 bindi ng site has been observed that a similar treatment will leave other proteins in a conf ormation that makes a footprint detectable. Lastly, it was suggested that the antibody might remain bound and contribute to the footprint observed. Therefore, to remove this possibility it would be possible to change the elution buffer to one that is known for disrupting the antibody-an tigen interactions, such as the ImmunoPure Gentle Ag/Ab Elution Buffer available from Pierce Biotechnology.

PAGE 58

46 CHAPTER 4 INTERACTION OF RNA POLYMERASE II AND TRANSCRIPTION FACTORS WITH THE -GLOBIN LOCUS Introduction The five genes of the human -globin locus are expressed in erythroid cells in a tissueand developmental-stage specific ma nner [183]. Appropriate expression of the globin genes is regulated by ma ny DNA elements that are loca ted proximal or distal to the genes. The human -globin locus control region (L CR) is a powerful regulatory DNA element located far upstream of the genes and required for high-level expression of all the globin genes throughout developmen t [136, 183]. The LCR, unlike classical enhancer elements, operates in an orientati on dependent manner [114]. There is currently no consensus on how the LCR acts to stimul ate globin gene transcription but it is generally believed that it involves some form of comm unication between the LCR and the globin genes [101, 115, 184]. The LCR is co mposed of several regions that exhibit extremely high sensitivity to DNaseI in erythroi d cells (hypersensitive HS sites 1 to 5). The core HS sites contain clusters of transc ription factor binding sites and are separated from each other by 2 to 4 kbp of DNA [136 ]. Results from analyzing human LCR function at ectopic sites in the context of transgenic mice suggest s that the HS sites synergistically enhance globin gene tran scription [19, 20, 119, 121-123], whereas studies in the endogenous murine locus show that the core HS sites function additively [109, 185, 186].

PAGE 59

47 Recent models view the LCR as a holocompl ex in which the individual HS sites interact via extensive prot ein-DNA and protein-pr otein interactions [118, 119, 134]. The LCR holocomplex may provide a highly accessibl e region for the efficient recruitment of macromolecular complexes involved in chroma tin modification and tr anscription [96]. Indeed, it has been shown that RNA polymer ase II (Pol II) transcription complexes are recruited to LCR HS sites in vitro and in vivo [169, 187-189], suggesting that transcription complexes are first recruited to the LCR and subsequently transferred to the globin genes [96]. Sawado et al. [190] recently demonstrated that another important function of the LCR is to regulate transcription elongation at the adult -globin gene. An interesting aspect of gene regulati on is the question of how transcriptional activity is maintained during th e process of replication [191]. Activation of at least some gene loci depends on replication, and it is possible that replica tion could provide a window of opportunity for tran scription factors to gain acc ess to regulatory sequences before repressive chromatin is formed. Generally, transcriptionally active regions of the genome replicate early, whereas repressed parts of the genome replicate late. A recent study showed that plasmids injected into cells at different time point s during replication a dopt an open chromatin conformation at earlier time points and a re pressed conformation at later time points suggesting that early replication favors th e assembly of accessible chromatin, or that accessible chromatin is replicated early [192] Accordingly, the globin locus replicates late in non-erythroid cells and early in cells expressing the globin genes. Transgenic studies have shown that the timing of replic ation is regulated by th e LCR [193], however, this activity, like the chromatin opening act ivity, appears to be redundant in the

PAGE 60

48 endogenous -globin locus [194]. It is not known how or if replication affects the association of transcription factors and Pol II with the globin locus. Here, we analyzed the interaction of tr anscription complexes with the human and murine -globin loci in erythroi d cells expressing either the human embryonic/fetal and -globin (K562 cells) or the murine adult -globin genes (MEL cells) using chromatin immunoprecipitation (ChIP). Results We began our studies by examining th e interaction of va rious components of transcription complexes and erythroi d transcription factors with the -globin gene locus in murine and human erythroleukemia cell lines. Figure 4-1 shows a diagram of the human and murine -globin loci and the localization of primers used in the ChIP experiments. We used chromatin immunoprecipitation (ChI P) and PCR to analyze the interaction of RNA Pol II (Pol II), TB P, TFIIB, NF-E2 (p45), and acetylated histone H3 with different regions of the -globin gene locus. As a negativ e control we also analyzed the interaction of the proteins with the necdin gene, which is not active in erythroid cells. NF-E2 is a hematopoietic specific transcripti on factor composed of a large (p45) and a small (p18) subunit [126] and known to interact with several sequences in the human and murine -globin loci [136, 195]. We i nvestigated the inte raction of these proteins in two cell lines; a human erythroleukemia ce ll line (K562) expressing the embryonic and fetal -globin genes but not the adult -globin gene, and a murine erythroleukemia cell line (MEL), in which the adult majand min-globin genes are expressed but not the embryonic and h1 genes.

PAGE 61

49 Figure 4-1. Diagrammatic repres entation of the human and murine -globin gene locus. The human -globin gene locus: the embryonic -globin gene, the two fetal -globin genes, and the adult and -globin genes. The LCR is located upstream of the -globin gene and composed of at least 5 HS sites. The murine -globin locus: the and h1 globin genes, which are co-expressed in the embryonic yolk sac and the maj and min globin genes, which are expressed during the fetal and adult st ages of erythropoiesis. The overall organization of the LCR is highly co nserved between the murine and the human -globin locus. PCR fragments an alyzed in the ChIP experiments are indicated as lines (horizontal ba rs) below the respective regions. The data show that RNA polymerase II is efficiently crosslinked to LCR HS2 in K562 cells (Figure 4-2). The interaction of Pol II with the globin genes is consistent with the expression pattern in these cells. Pol II is detectable at the embryonic but not at the adult -globin gene. The results further show th at Pol II does not interact with the HS2 5’flanking region, demonstrating th at Pol II specifically intera cts with the core of HS2. We also detected interactions of phosphorylated Pol II with HS2 and the -globin gene in K562 cells, indicating ongoing transcription in these regions. Because extragenic transcripts have b een detected over the entire LCR in the human -globin locus we analyzed th e interaction of basal transcription factors that are

PAGE 62

50 not associated with the transcription elonga tion complex. The results show that both TFIIB as well as TBP can be crosslinke d to HS2 in K562 cells. These results demonstrate that Pol II and other basal tr anscription factors, which are part of transcription initiation complexes, are associated with the LCR element HS2 in vivo The presence of components of the PIC indicates th at the crosslinking of Pol II to HS2 is not solely due to elongating polymerase. NF-E2 is clearly detectable at HS2 in K562 cells, whereas the signal representing the -globin gene is very weak None of the proteins interact with the necdin gene. Figure 4-2. Interaction of transcription factors and RNA polymerase II with the human -globin locus and the human necdin gene. Antibodies used were specific for RNA polymerase II ( Pol II), RNA polymerase II phosphorylated at the C-terminal domain ( Pol II Phosph.), TBP, TFIIB, NF-E2 p45, and acetyl histone H3 ( histone H3 acet.). PCR was performed with primers to regions in the -globin locus as indicated (see Figure 4-1). No antibody samples are negative controls. Input represents the positive PCR control taken from the no antibody sample. The observation that Pol II is not detectable at th e HS2 5’flanking region is interesting and suggests that tr anscription initiates within th e HS2 core enhancer and not

PAGE 63

51 upstream of HS2. In order to analyze this que stion in more detail, Padraic Levings in the laboratory used nuclear run-on experiments to determine regions of active transcription in the human -globin locus in K562 cells. He found that ongoing transcription is detectable in a region upstream of HS5, in the HS2 core, and in the globin gene, but not in the HS2 5’ flanking region. These results are consistent with our ChIP analysis and suggest that transcripts in itiating far upstream of HS2 do not elongate beyond the HS2 5’flanking region analyzed here, consistent w ith data published by Kim and Dean [196]. Because the nuclear run-on HS2 probe is specific for the core region his data suggest that transcription initiates within HS2 and not, or not exclusively, downstream of HS2 as proposed by Routledge et al. [188]. Transcription upstream of HS5 probably initiates within the LTR of a retrovirus as previously described [197]. We also analyzed the interaction of tran scription factors and Pol II with regulatory elements in the murine -globin locus in MEL cells (Figur e 4-3A). The results of these experiments are very similar to those in the K562 cells and show that Pol II, TBP, and TFIIB can be crosslinked to both HS2 and the -globin gene promoter but not to a region 5’ of HS2. The precipitation of proteins crosslinked to the -globin gene is extremely inefficient. The inefficiency in cross linking phosphorylated Pol II to HS2 and the globin promoter in the murine locus is cons istent and may be due to species-specific differences in the ability of the antibo dy to precipitate crosslinked polymerase. In contrast to the results in K562 cells, NF-E2 (p45) can be crosslinked to HS2 and to the -globin gene promoter. We have shown previously that NF-E2 interacts with a NF-E2 like sequence located downstream of the murine maj-globin transcription start site [195]. This sequence deviates in one pos ition from what is considered the consensus

PAGE 64

52 NF-E2 binding site, but it is identical to th e NF-E2 interaction sequence present in human LCR HS3 [126, 136]. Figure 4-3. Interaction of transcription factors with and transcription in the murine globin locus in MEL cells. A) Interac tion of transcripti on factors and RNA polymerase II with the murine -globin locus and the murine necdin gene. Antibodies used were specific for RNA polymerase II ( Pol II), RNA polymerase II phosphorylated at the C-terminal domain ( Pol II-Ph), TBP, TFIIB, NF-E2 p45, and acetylated histone H3 ( Acetyl-H3). PCR was carried out with primers correspond ing to regions in the murine -globin locus as indicated (see Figure4-1). Th e no antibody and input controls were processed as described in the legend to Figure 4-2. B) Semi-quantitative RTPCR analysis of -globin gene transcription in DMSO induced and uninduced MEL cells. Relative expression of -globin mRNA compared to expression of -actin was found to be 3-fold lower in uninduced MEL cells. The NRO analysis in MEL cells performe d by Padraic Levings demonstrates that while HS2 and the -globin gene are transcribed, a regi on upstream of HS5 is not. This result is likely due to the fact that the retr ovirus element present upstream of HS5 in the human locus is not present in the murine -globin gene locus. The MEL cells employed in th ese experiments express the -globin gene, and thus no induction (with DMSO) was used. Moreove r, interactions betw een Pol II and NF-E2

PAGE 65

53 with the globin locus can be detected by Ch IP assay in the absen ce of DMSO. We found that incubating the cells with 1% DMSO for 3 days led to an increase in globin gene transcription ( and -globin) less than 5-fold compar ed to uninduced cells (Figure 4-3 B). If the model according to which Pol II is re cruited first to the LCR, modified and transferred to the globin genes is correct [96], one may predic t that Pol II associates with the LCR and the globin genes at different time points during activ ation of the globin locus in the cell-cycle. To address this question, we examined the interaction of transcription complexes with the LCR and globin genes during S phase in K562 cells (Figure 4-4). Cells were synchronized using the double t hymidine block method, which arrests the cells at the G1/S pha se border [167]. At specific time points after release from cell-cycle arrest, cells were subjected to formaldehyde crosslinking and ChIP analysis. In these experiments, we used antibodies against Pol II, NF-E2 (p45) and USF2. We have shown that USF2 interacts with the human -globin promoter in K562 cells (described in Chapter 6) and hypothesized that it may contribute to the repression of the -globin gene [163]. We analyzed the association of these pr oteins with four different regions of the human -globin locus. Cells were cro sslinked at time 0, and 15 minutes, 45 minutes, 2 hours, and 6 hours after release from cell cycle arrest. At time 0, Pol II interacts with HS2, the -, and -globin genes, but not with the globin gene. There is no interaction of NF -E2 or USF2 with the regions of the globin locus at this time point. The only change afte r 15 minutes into S phase is the association of NF-E2 with HS2. After 45 minutes, Po l II is no longer de tectable at the -globin gene

PAGE 66

54 but remains associated with HS2 and the -globin genes. At this time point, NF-E2 interacts with the -globin genes. Figure 4-4. Interactions of tr anscription factors and RNA pol ymerase II with the human -globin locus during early S phase in synchronized K562 cells. Synchronized K562 cells were analyzed for DNA content by flow cytometry (shown on top). The remaining cells were harvested at time 0 or at specific time points after release from cell cycle arrest (as indicate d), and subjected to ChIP using antibodies sp ecific for RNA polymerase II ( Pol II), the p45 subunit of NF-E2 ( NF-E2), and USF2 ( USF2); time 0 represents the status of the blocked ce lls at the G1/S phase boundary. PCR was performed using primers specific for HS2, the -globin gene, the -globin gene, and the -globin gene as indicated (see Figu re 4-1). The no antibody and input controls were processed as descri bed in the legend to Figure 4-2.

PAGE 67

55 After 2 hours, Pol II no longer in teracts with the LCR or the and -globin genes. At this time there is a clear interac tion of NF-E2 and USF2 with HS2 and the and globin genes. The interaction of NF-E2 with the -globin gene is less pronounced. After 6 hrs, Pol II re-associates with HS2 and the -globin genes, but not with the -globin gene. Accompanied with the reappearance of Pol II is the dissociati on of USF2 from the genes and HS2. We also analyzed the interaction of tran scription factors with the murine globin locus during S phase in synchronized MEL ce lls (Figure 4-5). We used antibodies specific for Pol II, TFIIB, NF-E2, and acetylated histone H3. At time zero, Pol II, TFIIB, NF-E2 and acetylated histone H3 can be detected at LCR HS2 and the -globin promoter. After 7 minutes, NF-E2 and acetylated H3 but not Pol II can be detected at HS2 and weaker at the -globin gene. A similar pattern was observed after 45 minutes, except that now Pol II is beginning to re-associate with HS2 and the -globin promoter. Finally, after 2 hours, Pol II, TFIIB, NF-E2, and acetylated H3 are associated with HS2 and the globin promoter. The results show that Pol II dissociates and re-associates with the globin locus during early S phase in MEL ce lls. In contrast to the re sults with K562 cells, NF-E2 appears to remain associated with the globin locus at all the time points analyzed here. All experiments have been repe ated several times with essentially the same results. The only exception is that in some experiments NF-E2 (p45) can be crosslinked to HS2 in synchronized K562 cells at time 0. The varia tion may be due to subtle changes in the status of the cells during synchronization.

PAGE 68

56 Figure 4-5. Interactions of transcription factors and RNA polymerase II with the human -globin locus during early S phase in synchronized MEL cells. The cells were analyzed for DNA content by flow cytometry at each time point (shown at left). The remaining cells were harvested at time 0 or at specific time points after release from cell cycle arrest (as indicate d), and subjected to ChIP using antibodies sp ecific for RNA polymerase II ( Pol II), TBP ( TBP), TFIIB ( TFIIB), the p45 subunit of NF-E2 ( NF-E2), and acetylated histone H3 ( H3acetylated); time 0 represents the status of the blocked cells at the G1/S phase boundary. PCR was performed using primers specific for HS2 and the maj-globin gene as indicated (see Figure 4-1). The no antibody and input controls were processed as described in the legend to Figure 4-2. We next analyzed how dissociation and re-association of Pol II to the -globin locus in K562 and MEL cells correlates with the timing of replication. Since the cells are blocked at the border of G1 and S phase, it is assumed that when the cells are released from the block they will synchronously en ter S phase. They should then undergo replication early in S phase since the -globin locus is early rep licating in erythroid cells such as K562 and MEL [198]. As a late repl icating control, we used the necdin gene,

PAGE 69

57 which is a brain-specific imprinted gene that replicates late in S phase in all tissues except brain. In this experiment, the cells were blocke d at the border of G1 and S phase, cells collected at time 0, released from the block and cells collected at the same time points as for the flow cytometry and ChIP experiments. DNA was extracted and used as a template for PCR with primers against -globin and necdin for K562 cells (Figure 4-6), -globin and necdin for MEL cells (Figure 47). Based on the calcu lated ratios it was estimated that K562 cells complete replication of the -globin locus by 2 hours after release from the block (Figure 4-6). For MEL cells it was es timated that replication of the -globin locus is also complete by 2 hours af ter release from the block (Figure 4-7). Figure 4-6. Semi-quantitative PCR analysis of DNA content of synchronized K562 cells. Cells were isolated at each time poi nt, DNA extracted and PCR performed with primers to -globin and necdin promoters. Equal amounts of the two PCR products were run in the same lane and gels were stained with SyBr Green. Bands were quantitated wi th Image Quant and the ratio of -globin to necdin was calculated.

PAGE 70

58 Discussion Expression of the -globin genes is regulated by the LCR [183, 199]. Whereas studies using transgenic mice demonstrate that the LCR has both chromatin opening and enhancer activities [111], studi es in the endogenous murine lo cus show that the function of the LCR is limited to stimulating high-le vel globin gene transcription [200]. The ability of the LCR to regulate chromatin structure is thought to be important for conferring protection from position effects at ectopic sites in transgenic studies, a defining activity for locus control regions [199] It is not known at what level the LCR opens chromatin structure, e.g., unfolding of higher order structure and modification of histones, or whether chromatin opening is a secondary event and the consequence of LCR mediated re-location of the globin locus into a transcriptionally active site in the nucleus [201]. Figure 4-7. Semi-quantitative PCR analysis of DNA content of synchronized MEL cells. Cells were isolated at each time point, DNA was extracted and PCR was performed with primers to -globin and necdin promoters. Equal amounts of the two PCR products were run in the sa me lane and gels were stained with SyBr Green. Bands were quantitated with Image Quant and the ratio of globin to necdin was calculated.

PAGE 71

59 Recently extragenic transcripts were de tected over the LCR and in between the globin genes [156, 187, 202]. The generation of these transcripts was found to correlate with stage-specific transcriptional activity and DNaseI sensitivity of -globin locus subdomains [102]. This led to the hypothesis that transcri ption complexes are recruited to various regions in the globin locus and track along the DNA in a unidirectional manner thereby modifying chromatin structure. This is a plausible model because Pol II transcription complexes are known to be asso ciated with chromatin modifying activities [203], and transcription through regulatory memory elements has been shown to be the initial event in setting up activating or repressing functions of these elements in Drosophila [204]. Extragenic transcripts have also been detected in other complex gene loci suggesting a broader role in the modulation of chroma tin domains [205]. The role of the LCR in media ting high-level expression of the -globin genes is unquestionable. The LCR and the genes appe ar to be in close proximity in cells expressing the globin genes, suggesting physical contacts between ac tivities associated with the LCR and proteins in teracting with the promoter [120, 206]. How this contact aides in stimulating transcrip tion is not known, but could involv e the transfer of activities from the LCR to the globin genes [96]. In the experiments described in this chapter we analyzed the interaction of tr anscription complexes with LCR HS core elements and the globin genes during S phase. The data dem onstrate that RNA Pol II dissociates and reassociates with the globin genes during re plication, showing th at the replication machinery is capable of displacing transcrip tion complexes. Interactions of NF-E2 and USF appear to precede the re-association of Pol II with the globin locus suggesting that these proteins assist in the recruitment of Pol II during S phase. The data thus support a

PAGE 72

60 model in which the LCR and the globin ge nes cooperate in recr uiting transcription complexes to the globin locus. We began our studies by addressing th e question of whether RNA Pol II is recruited to the LCR independent from its known interactions with the globin genes. The ChIP assay per se does not differentiate between direct or indirect intera ctions. We show here, that Pol II intera cts with the HS2 core region toge ther with other components of the transcription initiation complex. This result shows that the crosslinking of Pol II to the core is not solely due to elongating transcri ption complexes that ar e in the process of generating the extragenic transcripts, but inst ead is due to Pol II that may be poised to start extragenic transcription or ready for tran sfer to the gene promot ers. This conclusion is also supported by our observation that Pol II is not detectable in a region between the HS2 and HS3 cores. How does the polymerase interact with the LCR core HS sites? Is the crosslinking to these sites due to interacti ons between HS2 and the globin genes, which would be fixed in the ChIP assay, or is it due to direct associa tion of transcription complexes with the LCR HS core regions? We believe that the latter is true for the following reasons: If the associ ation of polymerase II with th e HS2 core is due to protein mediated interactions with the globin promoter s, all proteins detect ed at the promoter regions may also be detectable at the LCR and vice versa This is clearly not the case. For example, NF-E2 interacts strongly with HS2 in unsynchronized K562 cells, but only weakly with the -globin promoter. If the interaction of Pol II with HS2 is indirect and caused by interactions with the -globin promoter then antib odies against NF-E2 should also efficiently precipitate the -globin gene, as it is likely part of the same complex.

PAGE 73

61 Although it is possible, but highly unlikely, that the mechanism of looping sequesters proteins at either side of the interaction such that they are not detected on the other side by formaldehyde crosslinking. The results from the NRO analysis are consistent with the ChIP data and demonstrate that transcription is ongoing at places where transcription complexes are detected; supporting the notion that Pol II is recr uited to the LCR independent from interactions with the promoter regions. It is also interesting to note that while HS2 is transcribed in both MEL and K562 cells, the HS 2 5’ flanking region in K562 cells is not, consistent with the lack of Pol II binding to this region. This result suggests that extragenic transcripts over the LCR do not represent long continuous transcripts but are due to multiple transcription initiation sites in HS2, HS3, and possibly other regions of the LCR. Our results are largely consistent with data recently published by Johnson et al. [189] demonstrating that Pol II re cruitment to the LCR is restri cted to the core HS sites. Sawado et al. [190] recently presented data de monstrating that an important function of the mouse LCR is to stimulate globin gene expressi on at the level of transcription elongation. The interpretation is ba sed on the fact that in the absence of the LCR no elongating transcription complexes were found in the transcribed region of the maj-globin gene. If transcripti on complexes are stalled at the -globin promoter in the absence of the LCR, one might predict that more -globin promoter bound Pol II is detected in the mutant locus, compared w ith the wild-type locus. However, Sawado et al. [190] found a two-fold reduction in promoter bound Pol II in the mutant allele suggesting that another important function of the LCR is to mediate the recruitment of Pol II to the -globin genes. It is difficult to estimate the contribution of the LCR in recruiting Pol II

PAGE 74

62 to the genes by comparing promoter-bound Pol II in promoters in which elongation takes place with those in which elongation does not ta ke place. It is thus possible that the contribution of LCR mediated delivery of Pol II to the -globin gene may have been underestimated in these studies. Another possibility that should be considered is that in the absence of the LCR unproductive transcript ion complexes are recruited to the globin genes but that in the presence of the LCR thes e complexes are first recruited to the LCR, rendered transcriptionally competent, and transferred to the gl obin genes [96]. The results from the cell synchronization/ ChIP experiment described here are consistent with a model proposing that an impor tant function of the LCR is to represent a reservoir of transcription and maybe other protein complexes, which may be used to provide these activities to the globin genes during various stag es of the cell cycle. NF-E2 may play a major role in directing these activit ies to the globin genes. In K562 cells NFE2 interacts directly or i ndirectly with HS2 and both and -globin genes at specific stages during S phase. Not surprisingly, the interaction of NF-E2 w ith the globin locus precedes the re-association of Pol II, consistent with the notion that factors are needed to recruit Pol II back to the locus after replic ation. We observed a similar pattern at the globin gene in MEL cells, although NF-E2 remains associated with HS2 and the -globin promoter, at least at the time points analyzed here. These data sugge st an important role of NF-E2 in recruiting Pol II to the globin locus, consistent with results from Johnson et al. [179] demonstrating an impairment in Pol II/ -globin gene interactions in MEL cells lacking NF-E2. In addition, it was recently sh own that NF-E2 interacts with the human -globin locus control region before chromatin is re-modeled [207]. The summary data suggest that NF-E2 interacts with the globin locus at specific stages during the cell cycle,

PAGE 75

63 prevents the formation of repressive chromatin structure, and facilitates the interaction of transcription complexes with the globin locus. Another interesting observation in these e xperiments is the inte raction pattern of USF2 during S phase in synchronized K562 cells Previous studies have shown that USF interacts with LCR core elements and with the -globin promoter [143, 144, 163]. Our data show that USF2 only inte racts with HS2 and the globin genes at a stage at which Pol II is not bound. It is con ceivable that USF2, in conjunc tion with NF-E2, prepares specific regions in the globin locus for the re -association of transcri ption complexes after replication. Tolhuis et al. [120] recently proposed a model according to which all HS sites in the globin locus part icipate in forming a specific chromatin conformation, called the active chromatin hub (ACH). The interactions of NF -E2 and USF with the locus control region and the genes at a stage in which Pol II is not bound in K562 cells (Figure 4-4, 2 hour time point) could i ndeed suggest that the LCR HS sites and the globin gene promoters together orchestrate the recruitmen t of transcription complexes to the globin gene locus, consistent with previous obser vations showing that enhancer and promoter elements cooperate in the form ation of DNaseI HS sites [208]. In summary, we have observed recruitmen t of Pol II directly to LCR HS2. We also observed dynamic changes in the intera ction of transcript ion factors and RNApolymerase II with the -globin gene locus during S phase of the cell cycle. These changes in interactions correlate with th e occurrence of replication in these cells. The results from the synchronization expe riments are reproducible, with some notable exceptions. In some experiments we detect NF-E 2 at LCR HS2 at time 0 in K562 cells. In addition, the re cruitment of Pol II to the -globin gene in K562 cells is

PAGE 76

64 somewhat variable and we have performed expe riments in which Pol II is crosslinked to the -globin gene after 6 hours. Th e variability may be due to s ubtle changes in the status of the cells during synchronization.

PAGE 77

65 CHAPTER 5 ANALYSIS OF THE MECHANISM OF RN A POLYMERASE II TRANSFER FROM THE LCR TO THE -GLOBIN GENE PROMOTER Introduction Erythroid-specific, high-l evel expression of the -globin genes is regulated by the locus control region (LCR), composed of mu ltiple DNaseI hypersensitive (HS) sites and located far upstream of the genes. Our lab and others have shown that the LCR core elements recruit RNA Pol II [132, 169, 187189]. The LCR HS sites are known to interact with each other to form the LCR holocomplex. We proposed a model suggesting that the LCR recruits Pol II and later transfers it to the gene promot ers that are expressed at specific developmental stages [96]. Recent evidence obtained by the 3C technique show that the LCR holocomplex interacts with whichever gene is transcriptionally active at a particular stage in erythroid cells [117, 120, 158]. The 3C technology mentioned above is a method in which protein mediated DNA interactions in live cells ar e captured by formaldehyde cros slinking. The crosslinked chromatin is fragmented by re striction enzyme digestion a nd subsequently ligated under conditions that favor intra-molecular liga tion. These conditions allow DNA segments that are normally located far away from each ot her to be ligated if they associate via protein-protein and pr otein-DNA interactions. If thes e segments do not interact, the probability of generating ligation products be tween these fragments is very low. Formation of the ligation products is monitored by PCR.

PAGE 78

66 Tolhuis et al. determined using 3C technol ogy that the LCR HS sites interact with each other, with the 3’ HS site and with the active globin genes in globin expressing cells [120]. The authors call the structure in wh ich the LCR holocomplex interacts with an active gene the active chromatin hub, while th e intervening DNA loops out in agreement with previously proposed looping models [ 101, 115]. The authors further showed that during erythroid development in mice the 5’, 3’, and LCR hypersensi tive sites interact first to form a chromatin hub. The interaction of the genes with this structure then leads to the formation of the active chromatin hub [158]. The data described above together with our own results from the synchronization experiments support the LCR recruitment and tran sfer model. To test the Pol II transfer hypothesis directly, we have developed a novel in vitro assay in which Pol II is first recruited to an immobilized LCR construct and then transferred to a -globin gene promoter. We provide eviden ce that RNA polymerase can be transferred from the LCR to a -globin gene in vitro and demonstrate that the transfer is sensitive to mutations in the -globin gene promoter and facilitated by erythroid transcri ption factor NF-E2. Results As a first attempt to examine the possibility that Pol II can be recruited to the LCR and transferred to the -globin gene, we established an in vitro system utilizing immobilized LCR templates and nuclear extracts from MEL cells (Figure 5-1). A plasmid containing the entire human -globin LCR was linearized, biotinylated and immobilized to streptavidin coated magnetic beads as described by Leach et al. [169]. After incubation with MEL nuclear extract the protein/DNA complex was washed several times in binding buffer on a magnet. Then a plasmid containing the wild-type -

PAGE 79

67 globin gene was added to the LCR and incubated for 10 minutes at 30C in binding buffer. The supernatant containing the -globin gene was then removed from the immobilized LCR, and subjected to crossli nking with formaldehyde and ChIP analysis using a Pol II specific antibody as described in the Materials and Me thods chapter (Figure 5-2 lane 2). Figure 5-1. A schematic representation of the in vitro Pol II transfer experimental procedure. The plasmid pLCR was linearized, biotin labeled, and immobilized on streptavidin coated ma gnetic beads. After incubation with MEL protein extracts, the LCR was pl aced on a magnet and all material not interacting with the LCR was remo ved. The immobilized LCR/protein complex was washed, resuspended in binding buffer and incubated in the presence or absence of the -globin gene. After placing the samples on the magnet, the supernatant was removed and the sample containing the globin gene was crosslinked and subject ed to ChIP analysis using an RNA polymerase II specific antibody. A second sample was processed in the sa me manner except that no Pol II specific antibodies were added; this sample served as a negative control (Fig ure 5-2 lane 4). To control for diffusion, we incubated 50 l binding buffer with the protein/LCR complex in

PAGE 80

68 the absence of the -globin template for 10 minutes at 30 C. The reaction was placed on a magnet and the supernatant was removed and incubated with the -globin template for 10 minutes at 30C, after which formaldehyde was added to the reaction to induce crosslinking. The sample was then subjected to ChIP analysis with Pol II antibodies (Figure 5-2, lane 1). Figure 5-2. Transfer of RNA polymerase II from immobilized LCR constructs to the globin gene. The sample containing the -globin gene was crosslinked and subjected to ChIP analysis using an RNA polymerase II specific antibody (Lane 2). The supernatant of th e sample incubated without the -globin gene for 10 minutes was later incubated with the -globin gene template and subjected to crosslinking and ChIP an alysis using an RNA polymerase II specific antibody (Lane 1). Lane 3 repr esents a reaction processed in the same manner as described for lane 2 except that recombinant NF-E2 was added to the reaction. Lane 4 repres ents a negative control in which no antibody was added. Lane 5 represents the positive control in which the globin gene was incubated with MEL pr otein extract and subjected to ChIP and PCR. Samples were processed as described in Fig 5-1 and subjected to PCR analysis using a set of primers specific for the human -globin coding region. The maxi gene differs from the wild-type -globin gene by 800 bp and served as a PCR contro l in these experiments. As a positive control, we incubated the -globin gene for 30 minutes at 30C with MEL protein extract and subjected the sample to crosslinking and ChIP analysis (Figure 5-2, lane 5). After reversal of the crosslink and purification of the DNA, the samples

PAGE 81

69 were analyzed by PCR using primers specific for the coding region of the -globin gene. The maxi gene was added after the immunoprecipita tion and served as a PCR control. The result of this experiment demonstrat es that Pol II can indeed be transferred from the LCR to a -globin template in trans (Figure 5-2, lane 2). The control experiment shows that diffusion is neglig ible during the incuba tion time and does not contribute significantly to the transf er of Pol II from the LCR to the -globin gene (Figure 5-2, lane 1). The inclusion of r ecombinant NF-E2 consistently enhanced the transfer of Pol II from the LCR to the -globin gene (Figure 5-2, lane 3) supporting previous conclusions that NF -E2 is required for the recrui tment of Pol II to the globin gene. In order to examine whether Pol II is specifically transferred to the -globin gene and not to sequences elsewhere in the pl asmid we have performed the transfer experiments in the presence of two re striction fragments derived from pRS A/X, one fragment containing the -globin gene and the other containing the bacterial ampicillin gene. The results are shown in Figure 5-3 a nd demonstrate that Pol II is specifically transferred to the -globin gene and not to other sequences present in the plasmid. In this experiment we have increased the cycle num ber to visualize the signal corresponding to the ampicillin gene and the -globin gene in the no antibody control (lane 2). The data show that the intensity of the -globin signal increases in the presence of Pol II antibodies, whereas the signal of the ampicillin gene remains unaltered. To further analyze the specificity of the tr ansfer, we performed the experiment with several -globin promoter mutants (described in [163]). In this experiment the maxi gene was added during the incubation with the protei n/LCR complex and served as an internal

PAGE 82

70 control. The results show that a mutant pr omoter in which the E-box element at +60 is altered is impaired in recr uiting Pol II (Figure 5-4). Figure 5-3. Analysis of the specific ity of Pol II transfer. The plasmid pRS A/X was digested with KpnI and SacI, incuba ted with the LCR/protein complex, and processed as described in Figure 5-1 a nd 5-2. The precipitate was analyzed by PCR using primers specific for the -globin ( ) or the bacterial ampicillin gene (Amp), which are presen t on different restriction fragments. Lane 1 shows a 100bp ladder. Figure 5-4. Comparison of Po l II transfer using the wild-type -globin gene (lane 1) and a mutant -globin gene (lane 2) in whic h an E-box at +60 was altered. The samples were processed and analyz ed as described in Fig 5-2 except that the maxi gene was added together w ith the wildtype or mutant globin gene and incubated with th e immobilized LCR/protein complex. The addition of BSA at the same concen tration as NF-E2 did not enhance Pol II transfer (Figure 5-5, lane 5), i ndicating that stimulation of Po l II transfer by NF-E2 is not an unspecific effect due to increased protein content. To further examine whether Pol II transfer is specific for the -globin gene we have performe d transfer experiments in the presence of a -globin gene lacking the TATA box. We have previously shown that this

PAGE 83

71 mutant is inefficiently transcribed in vitro [163]. We found that the -globin TATA box is necessary for Pol II recruitment (Figure 5-5, lane 6) demonstrating that Pol II is specifically transferred to the -globin gene and not to se quences elsewhere in the plasmid. Figure 5-5. Transfer of RNA polymerase II to the -globin gene in the presence of NFE2 or BSA. Samples were prepared and analyzed as described in panels Figure 5-2 except that NF-E2, lane 4, or BSA, lane 5, were added during the transfer step. Lane 6 represents transfer to a mutant -globin gene template lacking the TATA box. To further test the specificity of the tran sfer we performed an experiment in which we simultaneously incubated LCR/protein co mplexes with two different plasmids, one containing LCR element HS2 and another containing the -globin gene. The results in Figure 5-6 show that Pol II is preferentially transferred to HS2 (lane 2), which could be due to interactions between HS2 and th e LCR/protein complex. Importantly, we observed that in the presence of NF-E2, Pol II is preferen tially transferred to the -globin gene and not to HS2 (lane 3). We also anal yzed the transfer to the thymidine kinase promoter and found that Pol II is not transfer red to this template (compare Figure 5-6

PAGE 84

72 lanes 1 and 4). We hypothesized that protei ns in our erythroid cell extracts would bind the thymidine kinase promoter since there are ubiquitously expressed proteins present in these extracts that should bind other mammalian promoters su ch as the proteins of the PIC. This again demonstrates that the transfer is specific for the -globin gene. The graph in Figure 5-7 summarizes the results of multiple experiments. Figure 5-6. Analysis of NF-E2 mediated transfer to the -globin gene. Samples were processed as described in panel Figure 5-2 except that in lanes 2 and 3 the transfer was carried out in the presence of both -globin and HS2 containing plasmids. In lane 3, NF-E2 was added to the transfer reac tion. In lane 4, transfer to the thymidine kinase/ human growth hormone gene (TK-HGH) construct was analyzed. Lane 1 repr esents the reaction of the no antibody control containing a ll three plasmids ( -globin, HS2, and TK-HGH). Lanes 5, 6, and 7 represent positive PCR controls for -globin (lane 5), HS2 (lane 6) and TK-HGH (lane 7). Discussion It was proposed that one function of the LCR could be to recruit macromolecular protein complexes including Pol II, which ar e subsequently transf erred to individual globin genes in a developmental stag e specific manner [96, 169, 179]. Similar conclusions were derived from studies on the TCR locus, which show that coactivators

PAGE 85

73 and components of the transcri ption initiation complex are firs t recruited to an enhancer element and subsequently delivered to the promoter [209]. We have developed an in vitro system to test the polym erase transfer hypothesis and show that Pol II can indeed be transfe rred from an immobilized LCR template to the -globin gene (Figure 5-1). Moreover, the transfer of Pol II was enhanced by recombinant NF-E2, supporting previous studies that implicate NF-E2 in the recruitment of Pol II to the -globin gene [179]. The NF-E2 mediat ed stimulation of Pol II transfer is not due to an increase in protein concentra tion as the same concentration of BSA had no effect. Figure 5-7. Quantitative summary of the transfer experiments. The experiments were repeated several times and the data we re quantitated afte r gel electrophoresis using SyBr green, Storm scanner, and Image Quant. The bars represent the mean of the results of tw o to three experiments. The observation that Pol II was not transfe rred to either the bacterial ampicillin resistance gene or to the TK /HGH gene demonstrates that transfer is specific for the globin gene promoter (Figure 5-3 and Figure 5-6) when usi ng extracts from erythroid cells. It is likely that transfer would occu r to other promoters as well if they contain

PAGE 86

74 binding sites for proteins that mediate the transf er process, as I have shown to be the case for NF-E2. I also analyzed elements required for Pol II transfer to the -globin promoter. There was no transfer to the -globin gene with a mutation at the TATA box and reduced transfer to a promoter with a mutant + 60 E-box (Figs. 5-4 and 5-5). This supports previous data from our lab showing that the TATA box and +60 E-box are required for in vitro transcription and suggest that these elements exert at le ast part of their function by recruiting the polymerase [163]. The combined data suggest that the -globin LCR, like other enhancer elements [210], act in trans to assist in the recruitment of transcription complexes to the globin genes. Although this in vitro system completely ignores nucleosome and higher order chromatin structure, we believe that it does re veal some aspects of LCR function. It was previously shown that specific characteri stics of HS site formation and function, including the recruitment of transcrip tion complexes, can be recapitulated in vitro in the absence of chromatin assembly [169]. This demonstrates th at chromatin is not directly involved in recruiting transcrip tion complexes to the globin locus but rather regulates a preceding step, which is to render regulatory and functional sites available or unavailable for the interaction with transc ription factors and polymerase. I show that Pol II can be transferred fr om immobilized LCR templates to globin gene constructs in vitro and have established in vitro conditions for the analysis of RNA polymerase transfer in the -globin locus. In summary, we propose that transcription complexes are first recruited to a highly accessible LCR holocomplex (Figure 5-8). The genes are subsequently brought in contact wi th the LCR holocomplex, consistent with

PAGE 87

75 data from conformational studies [120, 158], a nd transcription complexes are transferred from the LCR to the promoter regions. Th is process is mediated by NF-E2 and possibly other proteins (e.g. USF2). It is also facilitated by bri nging strong globin gene promoters (with high affinities for the transcription complex) in close proximity to LCR bound transcription complexes. Figure 5-8. Model of transcripti on complex recruitment to the -globin gene. The LCR and other HS sites have been shown to interact to form a chromatin hub. In the active chromatin hub, the expressed gene s interact with the HS sites. We propose that transcription a nd other protein complexes are first recruited to a highly accessible LCR holocomplex in th e context of the proposed chromatin hub. The genes come in close proximity to the LCR holocomplex by as yet unknown mechanisms that may involve local remodeling of chromatin structure at the active promoters. Transcriptions complexes are then transferred from the LCR to high affin ity binding sites at the globin gene promoters. This transfer is facil itated by NF-E2 and/or related proteins.

PAGE 88

76 CHAPTER 6 DETERMINING THE FUNCTION OF THE USF, TFII-I AND HDAC3 PROTEINS IN -GLOBIN GENE REGULATION Introduction At least two modes of regulat ion control the stage-specific expression of the globin genes. The first parameter regulating stage-specific expression is the relative location of the genes with respect to the LCR. When the order of the genes relative to the LCR is reversed, the -globin gene is inappropriately expressed at the embryonic stage [114]. The second parameter is the binding of stage-specific trans -acting factors to the individual globin promoter regions leading to activation of transcription at the appropriate times during development. A well-characterized example for this mode of regulation is represented by the transcription factor EKLF, which specifically activates expression of the adult -globin gene during defi nitive erythropoiesis [137-139, 142]. EKLF exerts part of its activating function by recruiting chromatin-remodeling complexes to the -globin gene promoter, which leads in turn to a local change in nucleosome organization [141]. The basal promoter of the human adult -globin gene is composed of a TATA-like element and an initiator sequence, both of which were shown to interact with the TFII-D protein complex [211, 212]. In addition to components of the TFIID complex (specifically, TAFII250 and TAF II150), a diverse group of other proteins can also interact with initia tor sequences [150, 170]. Notable among these are the helix–loop– helix proteins USF and TFII-I, because both proteins have been implicated in the

PAGE 89

77 recruitment of transcription complexes to TATA-less promoters and in the stabilization of transcription complexes in TATA-box-containing promoters [145, 146, 213]. Regulatory DNA elements located downstream of transcription initiation sites (downstream promoter elements, DPE) that contribute significantly to the formation of stable transcription complexes have been well characterized in a variety of Drosophila genes [214]. In some cases these downs tream promoter elements function in the absence of TATA elements and c ooperate with initiator sequences to recruit transcription complexes. The transcription cofactor NC2 (negative cofactor 2), originally identified as a repressor of RNA Pol II transc ription, activates transcription of DPE-containing promoters and inhibits transc ription of TATA-box-containing promoters in vitro [215]. The human -globin gene contains two conserved E-box motifs located 3' to the initiator sequence. The first E-box overlaps the initiator wh ile the second E-box is located 60 bp 3' to the transcription in itiation site (Figure 6-1). Previous results in the lab demonstrate that the human -globin promoter’s TATA-like motif, initiator and downstream E-box element are all required fo r high level transcription in vitro [163]. This indicates that E-box motif s contribute to the efficien t formation of transcription complexes on the adult -globin gene. The same study al so indicated that USF1 and TFII-I interact with th e initiator and overlapping E-box, wh ile USF1 and USF2 interact with the downstream E-box in vitro [163]. Here I investigated the interactions of the HLH proteins in vivo The data show that USF1, USF2, TFII-I and p45 interact with the -globin promoter in vivo supporting the previous in vitro results [163]. By comparing the protein-DNA interactions on expressed and non-expressed -globin gene promoters, it was discovered that USF2 and

PAGE 90

78 TFII-I interact more efficiently with the nonexpressed than with the expressed gene. The interactions of USF1 and p45 with the -globin promoter are re stricted to erythroid cells expressing the -globin gene. Further, TFII-I wa s implicated in recruiting HDAC3 to the human -globin gene promoter in cells that are not expressing the gene. The results indicate that helix–loop–helix proteins contribute to the form ation of transcription complexes on the adult human -globin gene, and suggest that the differential association of HLH proteins with the basal promoter contribute to the stage-specific expression of the gene. Figure 6-1. Sequence alignment of the human -globin downstream promoter region. Shown are three sequences of the adult -globin downstream promoter region from human (H), mouse (M) and rabbit (R). Shaded boxes highlight the position of E-box motifs (CANNTG). Two of these E-boxes, the one overlapping the initiator and the dist al E-box, are conserved in all three species, whereas the E-box located at +20 is only present in the human and rabbit genes. The open box delineate s the position of the MARE-like sequence. Results In these studies I used two erythroid cell lines, MEL, a murine erythroleukemia cell line expressing the adult -globin gene, and K562, a human erythroleukemia cell line expressing the embryonic -type globin genes. I examined whether USF1, USF2 or TFII-I interact with the -globin gene in vivo by performing ChIP experiments in MEL and in K562 cells. The results of these experiments are shown in Figure 6-2 and demonstrate that both USF1 and USF2 could be crosslinked to the -globin gene

PAGE 91

79 promoter in MEL cells in vivo (Figure 6-2, lanes 4 and 5). TFII-I could also be crosslinked to the globin promot er (Figure 6-2, lane 6); however, the signal for TFII-I was consistently weaker in MEL versus K562 cells. Antibodies recognizing the p45 subunit of NF-E2 and acetylated histone H3 also precipitated the -globin gene in MEL cells (Figure 6-2, lanes 7 and 8, respectively). The precipitation with acetylated H3 antibodies was expected from previous studies [103]. To analyze whether the interaction of USF proteins with the -globin promoter could be correlated with the transcriptional activity of the gene I carried out ChIP analyses in K562 cells, in which the -globin gene is not expressed. In contrast to our observations in MEL cells, USF1 does not interact with the -globin gene in K562 cells, whereas TFII-I and USF2 do interact (Figure 6-2, lanes 5 and 6). The interactions of p45 (NF-E2) and acetylated H3 with the -globin gene were also less efficient in K562 cells when compared to MEL cells (compare Figure 6-2, lanes 7 and 8, MEL versus K562). In control experiments I amplified a region within the LCR located upstream of HS2 (HS2 5' flank; Figure 6-2, lanes 10–16). The results demonstrate that the observed interactions of USF1, USF2, TFII-I and p45 in erythroid cells are specific for the -globin gene. To analyze the possibility th at the differential binding of USF1, NF-E2 and, to a lesser extent, TFII-I is due to differential expression of these proteins in the two cell lines, Kelly Leach in our laboratory carried out western blotting expe riments using antibodies specific for USF1, USF2, TFII-I and NF-E2. The results show that USF1 and USF2 are expressed at similar le vels in K562 and MEL cells. However, TFII-I is expressed at higher levels in K562 cells and p45 (NF-E2) is expressed at higher levels in MEL cells.

PAGE 92

80 Figure 6-2. Characterization of pr otein–DNA interactions in the human -globin downstream promoter region in vivo Chromatin immunoprecipitation (ChIP) experiment analyzing the in teraction of proteins with the murine/human -globin gene or the HS2 5' flanking region in MEL and K562 cells in vivo Complexes were precipita ted with either no antibody (lanes 3 and 11) or with antibodies sp ecific for USF1 (lanes 4 and 12), USF2 (lanes 5 and 13), TFII-I (lanes 6 a nd 14), NF-E2 (p45, lanes 7 and 15) or acetylated histone H3 (lanes 8 a nd 16). DNA was purified from the precipitate and analyzed by PCR for th e presence of the murine or human globin gene (210 and 321 bp, respective ly, lanes 2–8) or the murine or human HS2 5'flank (336 and 565 bp, resp ectively, lanes 10–16 ). As positive controls, the input DNA was also anal yzed by PCR (lanes 2 and 10). Lanes 1 and 9 show 100 bp markers. Based on previously published data [216] I investigated potential interactions between TFII-I and HDAC3 with each other and the promoter of the silenced -globin gene in K562 cells. For this, I carri ed out chromatin double immunoprecipitation (ChDIP) experiments, in which two subse quent ChIP reactions with two different antibodies are performed. In the ChDIP, th e first ChIP assay was performed with an antibody against TFII-I. The protein-DNA comp lexes eluted from the beads were then used as substrate for another CHIP assay using an antibody against HDAC3. The results show that in the first round of immunoprecipitation TFII-I was bound to the -globin gene promoter at levels above that of the no antibody bac kground (Figure 6-3). In the

PAGE 93

81 subsequent round of immunoprecipi tation, HDAC3 was detected in -globin templates bound by TFII-I. In contrast there were no -globin promoter templates detected in both TFII-I and HDAC3 precipitates. As a negative control, I also analyzed the linker region between HS2 and HS3 and conclude that TFII-I and HDAC3 do not interact with this region. The no antibody background after the second round of immunoprecipitation was drastically decreased compared to the first one, probably due to the loss of nonspecific interactions with the beads. Figure 6-3. Chromatin doubl e immunoprecipitation (ChDIP) experiment analyzing the interaction of TFII-I and HDAC3 at di fferent regions within the human globin locus. Complexes were fi rst immunoprecipitated with an antibody against TFII-I and then these TFII-I selected complexes were immunoprecipitated with an antibody against HDAC3. Although the ChDIP experiment showed that TFII-I and HDAC3 are both bound to the promoter of the non-expressed -globin gene, it did not provide evidence of direct interactions between these proteins. In or der to examine the possibility that TFII-I directly interacts with HDAC 3, we carried out co-immunoprec ipitation experiments. Whole cell extracts from K562 cells were im munoprecipitated with antibodies against

PAGE 94

82 USF1, TFII-I, Pol II, USF2, HDAC3 and a no antibody negative control. The complexes eluted off the beads were separated by SDSPAGE and transferred to a nylon membrane for Western blot analysis. An antibo dy against HDAC3 was used for the Western blotting detection. Supporting our previous observation, we de tected HDAC3 only in complexes first immunoprecipitated with antibodies against TF II-I (Figure 6-4). In contrast, HDAC3 was not detected in the samples containing U SF1, USF2 or Pol II. This shows that TFII-I and HDAC3 directly interact in K562 cells. Figure 6-4. Co-immunoprecipitation experime nt analyzing the interaction of TFII-I and HDAC3. Whole cell extracts fr om K562 cells were first immunoprecipitated with the indicated antibodies then th e complexes pulled down were run on SDS-PAGE and probe d by with HDAC3 antibodies in a Western Blot. Discussion The promoter of the human -globin gene is characterized by the presence of a noncanonical TATA-box (CATAAA) located 25–30 bp upstream of the transcription start site [217]. Deviation from consensus TATA sequences often weakens promoters and leads to the requirement of additional elements for the efficient recruitment or stabilization of transcription complexes. For example, a recent re port demonstrated that the TBP/TFII-A pre-initiation complex interacts only weakly with the CATAA motif

PAGE 95

83 [218]. An additional sequen ce that contributes to high level -globin gene transcription is an initiator element located at the transcription start site. Lewis et al [211, 212] have shown that this element interacts with the TFII-D complex in vitro and that mutations in this sequence reduce transcription efficiency. In addition to the initiator element, the -globin gene contains se veral E-box motifs downstream of the transcription start site [177] (Figure 6-1). Two of these elements are conserved across species. Because previous studies have shown that E-box-binding proteins can participate in the fo rmation of transcription complexes on both TATAcontaining and TATA-less genes [145, 146, 213], we were interested in examining the functional role of these proteins in -globin gene transcription. The -globin initiator/E-box interacts with TFII-I and USF1, whereas the distal Ebox at +60 interacts with USF1 and USF2 in vitro [163]. There are a number of reports in the literature documenting the interaction of USF and TFII-I with sequence elements in the vicinity, mostly downstream, of transcription initiation sites [219-222]. Hsieh et al [223] recently identified an E-box motif located downstream of the APEG-1 gene from +39 to +44. This element interacts with USF proteins and mutation of this E-box dramatically reduces transcription. TFII-I interacts with the -globin initiator in vitro and in vivo and may play a role in activating transcription of the -globin gene in MEL cells. However, several observations suggest that TFII-I is not required for -globin gene transcription. First, antibodies against TFII-I were not able to inhibit transcription of the -globin gene in vitro [163]. Secondly, crosslinking of TFII-I to the -globin gene in adult erythroid cells is inefficient compared to USF1 and USF2 (Figure 6-2). The ChIP assay does not provide

PAGE 96

84 information as to what fraction of cells have a specific prot ein bound at a specific site. It is thus possible that the weak PCR signal from TFII-I-selected MEL chromatin fragments indicates that only a small fraction of cells have TFII-I bound at the initiator. This fraction of cells could represent non-expres sing cells. This is consistent with our observation that TFII-I cro sslinks more efficiently to the -globin gene in K562 cells (Figure 6-2A), suggesting that TFII-I may only be able to interact with the -globin gene in the absence of transc ription complex formation. We have performed RT–PCR (not shown) and western blotting experiments to characterize the expression pattern of TFII-I in K562 versus MEL cells. The RT–PCR analysis revealed that TFII-I is transcribed with equal efficiency in both cell types. However, western blots of nuc lear extracts consistently showed that full-length TFII-I protein is present at higher levels in K562 than it is in MEL nuclear extracts. The reason for the lower amount of TFII-I in MEL nuclear extracts may be due to posttranscriptional mechanisms. This lower le vel of TFII-I in MEL cells may contribute to the lower level of TFII-I bound to the -globin gene promoter in these cells. Whether the binding of TFII-I to the -globin promoter in erythroid cells with embryonic phenotype contributes to repression of the -globin gene or simply reflects the absence of TFII-D binding was an issue that we sought to resolve. A recent report shows that TFII-I interacts with histone deacetylase 3 [216]. It is thus possible that TFII-I interacts with the -globin gene in embryonic erythroi d cells, recruits histone deacetylases and contributes to the repression of -globin gene expression by rendering the chromatin structure inaccessible. Our ChIP data clearly show a strong reduction of

PAGE 97

85 acetylated H3 binding to the -globin promoter in K562 cells compared to MEL cells (Figure 6-2, lane 8). The combination of ChDIP and co-immunopr ecipitation experiments indicated that TFII-I and HDAC3 interact with eac h other and associate with the -globin gene in nonexpressing erythroid cells. The data suppor t a model according to which TFII-I recruits HDAC3 to alter the chromatin struct ure and therefore to silence the -globin gene expression. Our data led us to formulat e a hypothesis on the function of proteins interacting with the -globin downstream promoter during development (Figure 6-5). We propose that TFII-D, NF-E2, USF1 and USF2 interact with the globin promoter in adult erythroid cells and provide a platform for the efficient recruitment of transcription complexes [179, 195, 211, 212]. The functional role of NF-E2 in this process remains to be established, but other data presented before (Chapter 5) suggest that it ma y be involved in the transfer of RNA Pol II from the LCR to the gene promoter. The interaction of TFII-I and USF2 with the -globin promoter in K562 cells could contribute to the repression of this gene at the embryonic st age of erythroid development by recruiting histone deacetylase ac tivities. Other studies also implicate USF2 as a potential transcripti onal repressor [224]. However, in adult cells, USF2 and USF1 interact with the E-box at +60 and stimulate transcripti on. This conclusion is supported by our previous observation that in vitro transcription of the -globin gene is inhibited by pre-incubating the protein extracts with USF2 antibodies [163]. In summary, our data provide evidence th at HLH proteins diffe rentially interact with the initiator and downstream promoter during erythroid development. The

PAGE 98

86 combination of USF1, USF2, NF-E2 and, perh aps, TFII-I contribute to expression of the -globin gene. Conversely, interactions of TFII-I along with USF2 recruit HDAC3 within the -globin gene, leading to the repression of the -globin gene. Figure 6-5. Summary and model of pr otein–DNA interactions at the human -globin promoter. The human -globin promoter consists of a TATA-box and an initiator. These sequences are bound by the TFII-D complex in cells expressing the -globin gene (active). Additional sequences required for the formation of active transcription co mplexes are MARE and E-box elements located in the downstream promoter region. These sequences are bound by NF-E2 (p45 and p18) and USF, respectively. It is proposed that in cells not expressing the -globin gene (inactive), TFII-D is not bound and the initiator sequence is occupied by prot ein complexes consisting of TFII-I and USF2.

PAGE 99

87 CHAPTER 7 CONCLUSIONS AND FUTURE DIRECTIONS ChIP Footprinting We have established a novel technique that allows the identification of sequences to which a specific protein binds in the contex t of chromatin. This represents a powerful tool for discovering binding site s of proteins not only in the -globin locus but also in other areas of the genome. We used this t echnique to demonstrate that NF-E2 binds to a non-consensus MARE in the mouse -globin downstream promoter region. This technique could be refined by optim izing the restriction enzyme digestion step. I noticed the appearance of unsp ecific DNA degradation products after long incubation times with the restriction enzyme s. The Grosveld group followed a similar digestion protocol for their 3C experiments ex cept that they utilized SDS to remove any non-crosslinked proteins from the DNA a nd Triton X-100 to sequester SDS for more efficient digestion [182]. However, whether this is applicable fo r the ChIP footprint technique is questionable because the following step after fragmentation is immunoprecipitation and not, as is the case in the 3C method, DNA ligation. The ChIP footprinting techni que could be used to furt her identify binding sites for several of the proteins our la b investigates. For example, we could analyze whether TFIII binds to the -globin initiator or to the downstream E-box elements in vivo Similarly we could investigate a possible difference in USF binding between -globin promoters of expressing and non-expressing cells.

PAGE 100

88 ChIP within the -Globin Locus Using the ChIP assay, I showed that RNA Po l II is directly recruited to HS2 of the LCR. As expected, Pol II and associated tr anscription factors are also present at the promoters of expressed genes in MEL and K 562 cells. Acetylated histone H3 was also present at the expressed genes, as has b een previously documented [103, 155]. NF-E2 was consistently seen to associate with the promoters of the active genes in the locus. Having optimized the ChIP assay for use within the mouse and human -globin locus of MEL and K562 cells respectively, there are many more experiments that can be carried out utilizing this assay. Another group using a MEL cell line that needs DMSO induction for high level globin expression has shown that NF-E2 only bi nds to the LCR and gene promoter after DMSO induction [176]. It appears that our ME L cells are quite different since DMSO is not required for -globin gene expression or NF-E2 bi nding as shown in Figure 4-3. It would be interesting to repeat the ChIP experiment shown in Figure 4-3 with DMSO induced MEL cells to see if there are any differences in binding between induced and uninduced cells. There is currently data available on the binding of the f actors Bach1, GATA1, GATA2, CREB binding pr otein (CBP), EKLF, Sp1 and YY1 to the -globin locus. It may be possible to use the ChIP assay in a ssociation with real-time quantitative PCR to elucidate differences in binding of thes e factors between th e transcribed and nontranscribed regions of the locus in eith er MEL and K562 cells that has not been previously documented.

PAGE 101

89 Another interesting project using the ChIP assay would be to analyze specific histone modifications present with in the different regions of the -globin locus. It has been shown that the domains of active transcription have hyper-acetylated histones H3 and H4. The availability of quantitative real time PCR a nd antibodies against specific histone modifications that have not been an alyzed here would allow us to quantitate a range of histone modifications across the globin loci in both MEL and K562 cells. Cell Synchronization In this work, I synchronized cells at th e border of G1 and S phase using the double thymidine block method. The analysis of tr anscription factor in teractions in these synchronized cells revealed a dynamic pattern of dissociation and re -association of Pol II and transcription factors that correlated with the timing of DNA replication in the globin loci. It appears th at both in K562 and MEL cells, NF-E2 remains bound at the active genes and LCR element HS2 even wh en Pol II and the other factors were dissociated (Figure 4-4). This implicates NF -E2 in playing a role in the recruitment of Pol II back to the locus afte r replication is completed. Similarly, USF2 was found to associate with the transcript ionally active regions of the -globin locus only when Pol II has dissociated. Thus, USF2 may also pa rticipate in recruiting the transcription complexes back to the locus after replication. The cell synchronization experiments were designed according to the hypothesis that during replication the transcription comp lexes will be displaced to allow the passage of the replication fork, and that after replication transc ription complexes would reassociate with the globin locus in an ordere d fashion. According to our hypothesis that the LCR serves as the primary attachment site for transcription complexes in the globin

PAGE 102

90 locus (Figure 1-2), we expected that the tran scription complexes woul d first be recruited to the LCR and subsequently transferred to the active genes. However, our experiments did not capture time points that allowed this or der of recruitment to be revealed. It is possible that the genes and the LCR cooperate in the recruitment of Pol II to the globin locus. On the other hand, it is also possible that the proces ses leading to dissociation and re-association of Pol II are fast, making it unlikel y to select a time point at which Pol II is detectable at the LCR but not at the genes. Mitosis is another phase of the cell cycl e where transcription factors and RNA Pol II are known to dissociate and later re-asso ciate with the chromatin [225, 226]; though a recent study showed that TFIID and TFIIB remain associated with active gene promoters during mitosis when Pol II is displaced [227]. It would be possible to synchronize MEL and K562 cells at mitosis, and conduct ChIP experiments at several time points as the cells synchronously progress through mitosis an d into G1. These time points may reveal an order of recruitment of Pol II back to the -globin locus. Chromosome Conformation Capture The Grosveld group has performed severa l studies on the conformation of the globin locus using the 3C technique. First, they showed that the LCR and actively transcribed genes cluster toge ther into what they term the active chromatin hub (ACH) [120]. Next, they used transgenic mice car rying the wild type or a mutant human globin locus to show that the deleti on of HS3 (but not HS2) and the -globin promoter together cause the disruption of the ACH [117 ]. Most recently, they demonstrated that the transcription factor EKLF is required for ACH formation [162].

PAGE 103

91 During our cell synchronization studies, it wa s observed that Pol II dissociates from the locus during replication, and later re-associates. Replicat ion occurs very rapidly in mammalian cells. Therefore, if Pol II is displaced by the replication fork and reassociates immediately after re plication, it would be reason able to presume that our experiments would not have been likely to capture this short window of time when Pol II is absent from the locus. The results from the synchronization expe riments suggest that Pol II does not immediately re-associate with the globin locus afte r the completion of replication. A reasonable explan ation of why there is a delay is re-association of Poll II to the locus could be that dur ing replication the ACH is disr upted and that it takes some time for the ACH to reform. This may be the cause of the window of time when there is no Pol II present at the locus. Based on th is assumption, the 3C technique could be carried out with cells synchronously progressi ng through S phase. This would allow us to analyze if the ACH is disrupted du ring replication, and later reformed. In Vitro Pol II Transfer This novel assay revealed that Pol II transfer from the LCR to the -globin gene promoter can be recapitulated and demonstrated that the transfer process is sensitive to mutations within the -globin gene promoter and stimulated by NF-E2. As a further control, the transfer specificity to other ma mmalian promoters could be tested. This may reveal critical elements for Pol II transfer. Th ere are other erythroid specific transcription factors that may also facilita te the transfer of Pol II from the LCR to the genes; e.g. GATA1 and EKLF. In contrast, Bach1 preven ts NF-E2 from inter acting with MAREs in the -globin locus and could repress the transfer of Pol II to the -globin gene [128].

PAGE 104

92 USF, TFII-I and HDAC3 Function in -Globin Regulation The ChIP analysis revealed an increased level of USF2 and TFII-I interactions with the -globin gene in erythroid cells in whic h expression of the gene is repressed. Recently it was shown that TF II-I can interact ph ysically and functionally with HDAC3 [216]. Our studies revealed that HDAC3 intera cts with TFII-I in K 562 cells, and they cooccupy the non-expressed -globin gene. This has opened the door for functi onal studies on USF, TFII-I and HDAC3 proteins within the -globin locus. Another student in the laboratory, Valerie Crusselle, has embarked on a project to knock down these proteins in erythroid cells and mice using RNA interference. We have also started projects using inducible dominant negative mutants of the USF and TFII-I proteins to further investigate their function. In the event that stable cell lines are created where dominant negative protein expression can be induced to alter the expressi on levels of the globin genes, there are many other studies that can follow. First, the ChIP assay can be used to investigate how th e presence of the dominant negative proteins affect the bindi ng of other transcription factor s to the locus. In addition to analyzing changes in the presence of the affected proteins between transfected and control cells, other factors to investigate include CBP and PCAF, which have recently been shown to interact with USF in the chicken -globin insulator sequence [228], NFE2, TFIIB, and Pol II. Next, the 3C technique can be utilized to reveal any structural changes or disruption of the ACH resu lting from inhibiting these proteins.

PAGE 105

93 Summary Taken together, the data in this work pr ovide novel and intere sting characteristics of protein-DNA interactions within -globin loci of mouse an d human erythroid cells. The data are consistent with a model proposi ng that RNA Pol II is fi rst recruited to the LCR and subsequently transferre d to the globin gene promoter s. The recently described active hub model may provide a context in which transfer to the globin genes is facilitated. Future experiments will be direct ed at testing the Pol II transfer/ACH model in more detail.

PAGE 106

94 LIST OF REFERENCES 1. Perutz, MF, Structure of hemoglobin. Brookhaven Symp Biol, 1960. 13 : p. 16583. 2. Weatherall, DJ, Thalassaemia: the long road from bedside to genome. Nat Rev Genet, 2004. 5 (8): p. 625-31. 3. Bernini, LF, Geographic Distribution of alpha-Thalassemia in Disorders of Hemoglobin: Genetics, Pathophysi ology, and Clinical Management M.H. Steinberg, Forget, B.G., Higgs, D.R., Nagel, R.L., Editor. 2001, Cambridge University Press: New York. p. 878-894. 4. Weatherall, DJ and JB Clegg, Thalassemia--a global public health problem. Nat Med, 1996. 2 (8): p. 847-9. 5. Locatelli, F and PD Stefano, New insights into haematopoietic stem cell transplantation for patient s with haemoglobinopathies. Br J Haematol, 2004. 125 (1): p. 3-11. 6. Angelucci, E, and G Lucarelli, Bone Marrow Transplantation in BetaThalassemia in Disorders of Hemoglobin: Ge netics, Pathophysiology, and Clinical Management M.H. Steinberg, Forget, B.G., Higgs, D.R., Nagel, R.L., Editor. 2001, Cambridge Univ ersity Press: New York. 7. Vermylen, C, Bone Marrow Transplantation in Sickle Cell Anemia in Disorders of Hemoglobin: Genetics, Pat hophysiology, and Clinical Management M.H. Steinberg, Forget, B.G., Higgs, D.R., Nagel, R.L., Editor. 2001, Cambridge University Press: New York. p. 1073-1083. 8. Pace, B, Q Li, K Peterson, and G Stamatoyannopoulos, alpha-Amino butyric acid cannot reactivate the silenced gamma ge ne of the beta locus YAC transgenic mouse. Blood, 1994. 84 (12): p. 4344-53. 9. Rodgers, GP, and MH Steinberg, Pharmacologic Treatment of Sickle Cell Disease and Thalassemia: The Augmentation of Fetal Hemoglobin in Disorders of Hemoglobin: Genetics, Pat hophysiology, and Clinial Management M. Steinberg, Forget, BG, Higgs, DR, Na gel, RL, Editor. 2001, Cambridge University Press: New York. p. 1028-1051.

PAGE 107

95 10. Charache, S, ML Terrin, RD Moore, GJ Dover, FB Barton, SV Eckert, RP McMahon, and DR Bonds, Effect of hydroxyurea on the frequency of painful crises in sickle cell anemia. Investigators of the Multicenter Study of Hydroxyurea in Sickle Cell Anemia. N Engl J Med, 1995. 332 (20): p. 1317-22. 11. Pauling, L, Itano, H, Singer, SJ and Wells, IC, Sickle cell anemia: A molecular disease. Science, 1949. 110 : p. 543. 12. Miller, AD and GJ Rosman, Improved retroviral vect ors for gene transfer and expression. Biotechniques, 1989. 7 (9): p. 980-2, 984-6, 989-90. 13. Naldini, L and IM Verma, Lentiviral vectors. Adv Virus Res, 2000. 55 : p. 599609. 14. Hirata, RK, AD Miller, RG Andrews, and DW Russell, Transduction of hematopoietic cells by foamy virus vectors. Blood, 1996. 88 (9): p. 3654-61. 15. Walsh, CE, JM Liu, X Xiao, NS Young, AW Nienhuis, and RJ Samulski, Regulated high level expression of a hum an gamma-globin gene introduced into erythroid cells by an adeno-associated virus vector. Proc Natl Acad Sci U S A, 1992. 89 (15): p. 7257-61. 16. Hargrove, PW, EF Vanin, GJ Kurtzman, and AW Nienhuis, High-level globin gene expression mediated by a recombi nant adeno-associated virus genome that contains the 3' gamma globin gene regul atory element and integrates as tandem copies in erythroid cells. Blood, 1997. 89 (6): p. 2167-75. 17. Miller, JL, CE Walsh, PA Ney, RJ Samulski, and AW Nienhuis, Single-copy transduction and expression of human gamma -globin in K562 erythroleukemia cells using recombinant adeno-a ssociated virus vectors: th e effect of mutations in NF-E2 and GATA-1 binding motifs within th e hypersensitivity site 2 enhancer. Blood, 1993. 82 (6): p. 1900-6. 18. Einerhand, MP, M Antoniou, S Zolotukhin, N Muzyczka, KI Berns, F Grosveld, and D Valerio, Regulated high-level human beta -globin gene expression in erythroid cells following recombinant adeno-associated virus-mediated gene transfer. Gene Ther, 1995. 2 (5): p. 336-43. 19. May, C, S Rivella, J Callegari, G He ller, KM Gaensler, L Luzzatto, and M Sadelain, Therapeutic haemoglobin synthesi s in beta-thalassaemic mice expressing lentivirus-e ncoded human beta-globin. Nature, 2000. 406 (6791): p. 82-6. 20. Milot, E, J Strouboulis, T Trimborn, M Wijgerde, E de Boer, A Langeveld, K Tan-Un, W Vergeer, N Yannoutsos, F Grosveld, and P Fraser, Heterochromatin effects on the frequency and duration of LCR-mediat ed gene transcription. Cell, 1996. 87 (1): p. 105-14.

PAGE 108

96 21. Stathopulos, PB, Taking the good out of the bad: len tiviral-based gene therapy of the hemoglobinopathies. Biotechnol Adv, 2003. 21 (6): p. 513-26. 22. Xiao, X, W Xiao, J Li, and RJ Samulski, A novel 165-base-pair terminal repeat sequence is the sole cis requirement fo r the adeno-associated virus life cycle. J Virol, 1997. 71 (2): p. 941-8. 23. Sun, L, J Li, and X Xiao, Overcoming adeno-associated virus vector size limitation through viral DN A heterodimerization. Nat Med, 2000. 6 (5): p. 599602. 24. Yan, Z, Y Zhang, D Duan, and JF Engelhardt, Trans-splicing vectors expand the utility of adeno-associated virus for gene therapy. Proc Natl Acad Sci U S A, 2000. 97 (12): p. 6716-21. 25. Duan, D, P Sharma, J Yang, Y Yue, L Dudus, Y Zhang, KJ Fisher, and JF Engelhardt, Circular intermediates of recomb inant adeno-associated virus have defined structural characte ristics responsible for longterm episomal persistence in muscle tissue. J Virol, 1998. 72 (11): p. 8568-77. 26. Kornberg, RD, Chromatin structure: a repeat ing unit of histones and DNA. Science, 1974. 184 (139): p. 868-71. 27. Luger, K, AW Mader, RK Richmond, DF Sargent, and TJ Richmond, Crystal structure of the nucleosome co re particle at 2.8 A resolution. Nature, 1997. 389 (6648): p. 251-60. 28. Pal-Bhadra, M, BA Leibovitch, SG Ga ndhi, M Rao, U Bhadra, JA Birchler, and SC Elgin, Heterochromatic silencing and HP1 localization in Drosophila are dependent on the RNAi machinery. Science, 2004. 303 (5658): p. 669-72. 29. Horn, PJ and CL Peterson, Molecular biology. Chromatin higher order folding-wrapping up transcription. Science, 2002. 297 (5588): p. 1824-7. 30. Hirano, T, R Kobayashi, and M Hirano, Condensins, chromosome condensation protein complexes containing XCAP-C, XCAP-E and a Xenopus homolog of the Drosophila Barren protein. Cell, 1997. 89 (4): p. 511-21. 31. Kornberg, RD and Y Lorch, Twenty-five years of the nucleosome, fundamental particle of the eukaryote chromosome. Cell, 1999. 98 (3): p. 285-94. 32. Elgin, SC, The formation and function of DNas e I hypersensitive sites in the process of gene activation. J Biol Chem, 1988. 263 (36): p. 19259-62. 33. Cheung, P, CD Allis, and P Sassone-Corsi, Signaling to chromatin through histone modifications. Cell, 2000. 103 (2): p. 263-71.

PAGE 109

97 34. Becker, PB and W Horz, ATP-dependent nucleosome remodeling. Annu Rev Biochem, 2002. 71 : p. 247-73. 35. Boeger, H, J Griesenbeck, JS Strattan, and RD Kornberg, Nucleosomes unfold completely at a transcrip tionally active promoter. Mol Cell, 2003. 11 (6): p. 158798. 36. Reinke, H and W Horz, Histones are first hyperacetylat ed and then lose contact with the activated PHO5 promoter. Mol Cell, 2003. 11 (6): p. 1599-607. 37. Kobor, MS, S Venkatasubrahmanyam, MD Meneghini, JW Gin, JL Jennings, AJ Link, HD Madhani, and J Rine, A Protein Complex Containing the Conserved Swi2/Snf2-Related ATPase Swr1p De posits Histone Variant H2A.Z into Euchromatin. PLoS Biol, 2004. 2 (5): p. E131. 38. Krogan, NJ, MC Keogh, N Datta, C Sa wa, OW Ryan, H Ding, RA Haw, J Pootoolal, A Tong, V Canadien, DP Rich ards, X Wu, A Emili, TR Hughes, S Buratowski, and JF Greenblatt, A Snf2 family ATPase complex required for recruitment of the histone H2A variant Htz1. Mol Cell, 2003. 12 (6): p. 1565-76. 39. Mizuguchi, G, X Shen, J La ndry, WH Wu, S Sen, and C Wu, ATP-driven exchange of histone H2AZ variant cata lyzed by SWR1 chromatin remodeling complex. Science, 2004. 303 (5656): p. 343-8. 40. Jenuwein, T and CD Allis, Translating the histone code. Science, 2001. 293 (5532): p. 1074-80. 41. Zhang, L, EE Eugeni, MR Parthun, and MA Freitas, Identification of novel histone post-translational modifications by peptide mass fingerprinting. Chromosoma, 2003. 112 (2): p. 77-86. 42. Brownell, JE, J Zhou, T Ranalli, R Koba yashi, DG Edmondson, SY Roth, and CD Allis, Tetrahymena histone acetyltransferas e A: a homolog to yeast Gcn5p linking histone acetylation to gene activation. Cell, 1996. 84 (6): p. 843-51. 43. Roth, SY, JM Denu, and CD Allis, Histone acetyltransferases. Annu Rev Biochem, 2001. 70 : p. 81-120. 44. Grunstein, M, Histone acetylation in chroma tin structure and transcription. Nature, 1997. 389 (6649): p. 349-52. 45. Taunton, J, CA Hassig, and SL Schreiber, A mammalian histone deacetylase related to the yeast trans criptional regulator Rpd3p. Science, 1996. 272 (5260): p. 408-11. 46. De Nadal, E, M Zapater, PM Al epuz, L Sumoy, G Mas, and F Posas, The MAPK Hog1 recruits Rpd3 histone deacetylas e to activate osmoresponsive genes. Nature, 2004. 427 (6972): p. 370-4.

PAGE 110

98 47. Strahl, BD and CD Allis, The language of covalent histone modifications. Nature, 2000. 403 (6765): p. 41-5. 48. Vogelauer, M, J Wu, N Suka, and M Grunstein, Global histone acetylation and deacetylation in yeast. Nature, 2000. 408 (6811): p. 495-8. 49. Zhang, W, JR Bone, DG Edmonds on, BM Turner, and SY Roth, Essential and redundant functions of histone acetylation revealed by mu tation of target lysines and loss of the Gcn5p acetyltransferase. Embo J, 1998. 17 (11): p. 3155-67. 50. Krebs, JE, MH Kuo, CD Allis, and CL Peterson, Cell cycle-regulated histone acetylation required for express ion of the yeast HO gene. Genes Dev, 1999. 13 (11): p. 1412-21. 51. Berger, SL, Gene regulation. Local or global? Nature, 2000. 408 (6811): p. 412-3, 415. 52. Wang, Y, J Wysocka, J Sayegh, YH Lee, JR Perlin, L Leonelli, LS Sonbuchner, CH McDonald, RG Cook, Y Dou, RG Roed er, S Clarke, MR Stallcup, CD Allis, and SA Coonrod, Human PAD4 regulates histone ar ginine methylation levels via demethylimination. Science, 2004. 306 (5694): p. 279-83. 53. Ehrenhofer-Murray, AE, Chromatin dynamics at DNA replication, transcription and repair. Eur J Biochem, 2004. 271 (12): p. 2335-49. 54. Santos-Rosa, H, R Schneider, AJ Bannister, J Sherriff, BE Bernstein, NC Emre, SL Schreiber, J Mellor, and T Kouzarides, Active genes are tri-methylated at K4 of histone H3. Nature, 2002. 419 (6905): p. 407-11. 55. Bannister, AJ, P Zegerman, JF Partridge EA Miska, JO Thomas, RC Allshire, and T Kouzarides, Selective recognition of methylat ed lysine 9 on histone H3 by the HP1 chromo domain. Nature, 2001. 410 (6824): p. 120-4. 56. Lachner, M, D O'Carroll, S R ea, K Mechtler, and T Jenuwein, Methylation of histone H3 lysine 9 creates a binding site for HP1 proteins. Nature, 2001. 410 (6824): p. 116-20. 57. Tyler, JK and JT Kadonaga, The "dark side" of chromatin remodeling: repressive effects on transcription. Cell, 1999. 99 (5): p. 443-6. 58. Neely, KE, AH Hassan, AE Wallberg, DJ St eger, BR Cairns, AP Wright, and JL Workman, Activation domain-mediated targeting of the SWI/SNF complex to promoters stimulates transcri ption from nucleosome arrays. Mol Cell, 1999. 4 (4): p. 649-55. 59. Cosma, MP, T Tanaka, and K Nasmyth, Ordered recruitment of transcription and chromatin remodeling factors to a cell cycleand developmentally regulated promoter. Cell, 1999. 97(3): p. 299-311.

PAGE 111

99 60. Di Croce, L, R Koop, P Venditti, HM We stphal, KP Nightingale, DF Corona, PB Becker, and M Beato, Two-step synergism between the progesterone receptor and the DNA-binding domain of nuclear factor 1 on MMTV minichromosomes. Mol Cell, 1999. 4 (1): p. 45-54. 61. Holstege, FC, EG Jennings, JJ Wyrick, TI Lee, CJ Hengartner, MR Green, TR Golub, ES Lander, and RA Young, Dissecting the regulat ory circuitry of a eukaryotic genome. Cell, 1998. 95 (5): p. 717-28. 62. Kal, AJ, T Mahmoudi, NB Zak, and CP Verrijzer, The Drosophila brahma complex is an essential coactivator for the trithorax group protein zeste. Genes Dev, 2000. 14 (9): p. 1058-71. 63. Kadam, S, GS McAlpine, ML Phelan, RE Kingston, KA Jones, and BM Emerson, Functional selectivity of recomb inant mammalian SWI/SNF subunits. Genes Dev, 2000. 14 (19): p. 2441-51. 64. Lemon, B, C Inouye, DS King, and R Tjian, Selectivity of chromatin-remodelling cofactors for ligand-activated transcription. Nature, 2001. 414 (6866): p. 924-8. 65. Boyer, LA, C Logie, E Bonte, PB B ecker, PA Wade, AP Wolffe, C Wu, AN Imbalzano, and CL Peterson, Functional delineation of three groups of the ATPdependent family of chro matin remodeling enzymes. J Biol Chem, 2000. 275 (25): p. 18864-70. 66. Kornberg, RD, The eukaryotic gene transcription machinery. Biol Chem, 2001. 382 (8): p. 1103-7. 67. Roeder, RG, Role of general and gene-specific cofactors in th e regulation of eukaryotic transcription. Cold Spring Harb Symp Quant Biol, 1998. 63 : p. 20118. 68. Svejstrup, JQ, The RNA polymerase II transcri ption cycle: cycling through chromatin. Biochim Biophys Acta, 2004. 1677 (1-3): p. 64-73. 69. Koleske, AJ and RA Young, The RNA polymerase II holoenzyme and its implications for gene regulation. Trends Biochem Sci, 1995. 20 (3): p. 113-6. 70. Gill, G, Regulation of the initiation of eukaryotic transcription. Essays Biochem, 2001. 37 : p. 33-43. 71. Kim, YJ, S Bjorklund, Y Li, MH Sayre, and RD Kornberg, A multiprotein mediator of transcriptional activation and its interaction with the C-terminal repeat domain of RNA polymerase II. Cell, 1994. 77 (4): p. 599-608. 72. Naar, AM, DJ Taatjes, W Zh ai, E Nogales, and R Tjian, Human CRSP interacts with RNA polymerase II CTD and adopt s a specific CTD-bound conformation. Genes Dev, 2002. 16 (11): p. 1339-44.

PAGE 112

100 73. Komarnitsky, P, EJ Cho, and S Buratowski, Different phosphorylated forms of RNA polymerase II and associated mRNA pr ocessing factors during transcription. Genes Dev, 2000. 14 (19): p. 2452-60. 74. Soutoglou, E and I Talianidis, Coordination of PIC assembly and chromatin remodeling during differentiati on-induced gene activation. Science, 2002. 295 (5561): p. 1901-4. 75. Struhl, K, Fundamentally different logic of ge ne regulation in eukaryotes and prokaryotes. Cell, 1999. 98 (1): p. 1-4. 76. Lemon, B and R Tjian, Orchestrated response: a symphony of transcription factors for gene control. Genes Dev, 2000. 14 (20): p. 2551-69. 77. Hatzis, P and I Talianidis, Dynamics of enhancer-promoter communication during differentiation-in duced gene activation. Mol Cell, 2002. 10 (6): p. 1467-77. 78. Bentley, D, The mRNA assembly line: transcription and processing machines in the same factory. Curr Opin Cell Biol, 2002. 14 (3): p. 336-42. 79. Proudfoot, NJ, A Furger, and MJ Dye, Integrating mRNA processing with transcription. Cell, 2002. 108 (4): p. 501-12. 80. Kobor, MS, J Archambault, W Lester, FC Holstege, O Gileadi, DB Jansma, EG Jennings, F Kouyoumdjian, AR Davids on, RA Young, and J Greenblatt, An unusual eukaryotic protein phosphatase required for transcription by RNA polymerase II and CTD dephosphor ylation in S. cerevisiae. Mol Cell, 1999. 4 (1): p. 55-62. 81. Chambers, RS and ME Dahmus, Purification and characterization of a phosphatase from HeLa cells which dephosphor ylates the C-terminal domain of RNA polymerase II. J Biol Chem, 1994. 269 (42): p. 26243-8. 82. Chambers, RS, BQ Wang, ZF Burton, and ME Dahmus, The activity of COOHterminal domain phosphatase is regulate d by a docking site on RNA polymerase II and by the general transcri ption factors IIF and IIB. J Biol Chem, 1995. 270 (25): p. 14962-9. 83. Lin, PS, MF Dubois, and ME Dahmus, TFIIF-associating carboxyl-terminal domain phosphatase dephosphorylates phosphoserines 2 and 5 of RNA polymerase II. J Biol Chem, 2002. 277 (48): p. 45949-56. 84. Archambault, J, RS Chambers, MS Kobor, Y Ho, M Cartier, D Bolotin, B Andrews, CM Kane, and J Greenblatt, An essential component of a C-terminal domain phosphatase that interacts with tran scription factor IIF in Saccharomyces cerevisiae. Proc Natl Acad Sci U S A, 1997. 94 (26): p. 14300-5.

PAGE 113

101 85. Chambers, RS and CM Kane, Purification and characterization of an RNA polymerase II phosphatase from yeast. J Biol Chem, 1996. 271 (40): p. 24498-504. 86. Kristjuhan, A, J Walker, N Suka, M Gr unstein, D Roberts, BR Cairns, and JQ Svejstrup, Transcriptional inhibition of genes with severe histone h3 hypoacetylation in the coding region. Mol Cell, 2002. 10 (4): p. 925-33. 87. Wang, A, SK Kurdistani, and M Grunstein, Requirement of Hos2 histone deacetylase for gene activity in yeast. Science, 2002. 298 (5597): p. 1412-4. 88. Svejstrup, JQ, Transcription. Histones face the FACT. Science, 2003. 301 (5636): p. 1053-5. 89. Reines, D and J Mote, Jr., Elongation factor SII-depende nt transcription by RNA polymerase II through a sequencespecific DNA-binding protein. Proc Natl Acad Sci U S A, 1993. 90 (5): p. 1917-21. 90. Ito, T, Q Xu, H Takeuchi, T Kubo, and S Natori, Spermatocyte-specific expression of the gene for mouse testis -specific transcription elongation factor SII. FEBS Lett, 1996. 385 (1-2): p. 21-4. 91. Reines, D, P Ghanouni, W Gu, J Mote, Jr., and W Powell, Transcription elongation by RNA polymerase II: mechanism of SII activation. Cell Mol Biol Res, 1993. 39 (4): p. 331-8. 92. Mote, J, Jr., P Ghanouni, and D Reines, A DNA minor groove-binding ligand both potentiates and arrests transcription by RNA polymerase II. Elongation factor SII enables readthrough at arrest sites. J Mol Biol, 1994. 236 (3): p. 725-37. 93. Gerber, M and A Shilatifard, Transcriptional elongation by RNA polymerase II and histone methylation. J Biol Chem, 2003. 278 (29): p. 26303-6. 94. Deisseroth, A, A Nienhuis, J Lawrence, R Giles, P Turner, and FH Ruddle, Chromosomal localization of human beta globin gene on human chromosome 11 in somatic cell hybrids. Proc Natl Acad Sci U S A, 1978. 75 (3): p. 1456-60. 95. Stamatoyannopoulos, G, and A. Nienhuis, Hemoglobin switching in The molecular basis of blood diseases 1994, W. B. Saunders: Philadelphia, PA. p. 107-155. 96. Levings, PP and J Bungert, The human beta-globin locus control region. Eur J Biochem, 2002. 269 (6): p. 1589-99. 97. Schroeder, WA, TH Huisman, JR Shelt on, JB Shelton, EF Kleihauer, AM Dozy, and B Robberson, Evidence for multiple structural genes for the gamma chain of human fetal hemoglobin. Proc Natl Acad Sci U S A, 1968. 60 (2): p. 537-44.

PAGE 114

102 98. Eaton, WA, The relationship between c oding sequences and function in haemoglobin. Nature, 1980. 284 (5752): p. 183-5. 99. Go, M, Correlation of DNA exonic regions w ith protein structural units in haemoglobin. Nature, 1981. 291 (5810): p. 90-2. 100. Stamatoyannopoulos, G, and F. Grosveld, Hemoglobin switching in The molecular basis of blood diseases H. Varmus, Editor. 2001, W. B. Saunders: Philadelphia, PA. p. 135-182. 101. Bulger, M and M Groudine, Looping versus linking: toward a model for longdistance gene activation. Genes Dev, 1999. 13 (19): p. 2465-77. 102. Gribnau, J, K Dideri ch, S Pruzina, R Calzolari, and P Fraser, Intergenic transcription and developmental remodeling of chromatin subdomains in the human beta-globin locus. Mol Cell, 2000. 5 (2): p. 377-86. 103. Forsberg, EC, KM Downs, HM Christen sen, H Im, PA Nuzzi, and EH Bresnick, Developmentally dynamic histone acetyl ation pattern of a tissue-specific chromatin domain. Proc Natl Acad Sci U S A, 2000. 97 (26): p. 14494-9. 104. Tuan, D, W Solomon, Q Li, and IM London, The "beta-like-globin" gene domain in human erythroid cells. Proc Natl Acad Sci U S A, 1985. 82 (19): p. 6384-8. 105. Forrester, WC, S Takegawa, T Pa payannopoulou, G Stamatoyannopoulos, and M Groudine, Evidence for a locus activati on region: the formation of developmentally stable hypersensitive sites in globin-expressing hybrids. Nucleic Acids Res, 1987. 15 (24): p. 10159-77. 106. Li, Q, KR Peterson, X Fang, and G Stamatoyannopoulos, Locus control regions. Blood, 2002. 100 (9): p. 3077-86. 107. Epner, E, A Reik, D Cimbora, A Tell ing, MA Bender, S Fiering, T Enver, DI Martin, M Kennedy, G Keller, and M Groudine, The beta-globin LCR is not necessary for an open chromatin struct ure or developmentally regulated transcription of the nati ve mouse beta-globin locus. Mol Cell, 1998. 2 (4): p. 44755. 108. Reik, A, A Telling, G Zitnik, D Ci mbora, E Epner, and M Groudine, The locus control region is necessary for gene exp ression in the human beta-globin locus but not the maintenance of an open chro matin structure in erythroid cells. Mol Cell Biol, 1998. 18 (10): p. 5992-6000. 109. Bender, MA, M Bulger, J Close, and M Groudine, Beta-globin gene switching and DNase I sensitivity of the endogenous beta-globin locus in mice do not require the locus control region. Mol Cell, 2000. 5 (2): p. 387-93.

PAGE 115

103 110. Rice, JC and CD Allis, Histone methylation versus histone acetylation: new insights into epig enetic regulation. Curr Opin Cell Biol, 2001. 13 (3): p. 263-73. 111. Higgs, DR, Do LCRs open chromatin domains? Cell, 1998. 95 (3): p. 299-302. 112. Dillon, N, T Trimborn, J Strouboulis, P Fraser, and F Grosveld, The effect of distance on long-range chromatin interactions. Mol Cell, 1997. 1 (1): p. 131-9. 113. Peterson, KR and G Stamatoyannopoulos, Role of gene order in developmental control of human gammaand beta-globin gene expression. Mol Cell Biol, 1993. 13 (8): p. 4836-43. 114. Tanimoto, K, Q Liu, J Bungert, and JD Engel, Effects of altered gene order or orientation of the locus control regi on on human beta-globin gene expression in mice. Nature, 1999. 398 (6725): p. 344-8. 115. Engel, JD and K Tanimoto, Looping, linking, and chroma tin activity: new insights into beta-globin locus regulation. Cell, 2000. 100 (5): p. 499-502. 116. Choi, OR and JD Engel, Developmental regulation of beta-globin gene switching. Cell, 1988. 55 (1): p. 17-26. 117. Patrinos, GP, M de Krom, E de Boer, A Langeveld, AM Imam, J Strouboulis, W de Laat, and FG Grosveld, Multiple interactions between regulatory regions are required to stabilize an active chromatin hub. Genes Dev, 2004. 18 (12): p. 1495509. 118. Wijgerde, M, F Grosveld, and P Fraser, Transcription complex stability and chromatin dynamics in vivo. Nature, 1995. 377 (6546): p. 209-13. 119. Bungert, J, U Dave, KC Lim, KH Lieu w, JA Shavit, Q Liu, and JD Engel, Synergistic regulation of human beta-gl obin gene switching by locus control region elements HS3 and HS4. Genes Dev, 1995. 9 (24): p. 3083-96. 120. Tolhuis, B, RJ Palstra, E Splin ter, F Grosveld, and W de Laat, Looping and interaction between hypersensitive s ites in the active beta-globin locus. Mol Cell, 2002. 10 (6): p. 1453-65. 121. Navas, PA, KR Peterson, Q Li, E Skar pidi, A Rohde, SE Shaw, CH Clegg, H Asano, and G Stamatoyannopoulos, Developmental specificity of the interaction between the locus control region and em bryonic or fetal globin genes in transgenic mice with an HS3 core deletion. Mol Cell Biol, 1998. 18 (7): p. 418896. 122. Bungert, J, K Tanimoto, S Patel, Q Liu, M Fear, and JD Engel, Hypersensitive site 2 specifies a unique function within the human beta-globin locus control region to stimulate globin gene transcription. Mol Cell Biol, 1999. 19 (4): p. 3062-72.

PAGE 116

104 123. Molete, JM, H Petrykowska, EE Bouhassira, YQ Feng, W Miller, and RC Hardison, Sequences flanking hypers ensitive sites of the beta-globin locus control region are required for synergistic enhancement. Mol Cell Biol, 2001. 21 (9): p. 2969-80. 124. Leonard, MW, KC Lim, and JD Engel, Expression of the chicken GATA factor family during early erythroid development and differentiation. Development, 1993. 119 (2): p. 519-31. 125. Hu, M, D Krause, M Greaves, S Sharkis, M Dexter, C Heyworth, and T Enver, Multilineage gene expression precedes commitment in the he mopoietic system. Genes Dev, 1997. 11 (6): p. 774-85. 126. Motohashi, H, JA Shavit, K Igarashi, M Yamamoto, and JD Engel, The world according to Maf. Nucleic Acids Res, 1997. 25 (15): p. 2953-59. 127. Andrews, NC, H Erdjument-Bromage, MB Davidson, P Tempst, and SH Orkin, Erythroid transcription factor NF-E2 is a haematopoietic-specific basic-leucine zipper protein. Nature, 1993. 362 (6422): p. 722-8. 128. Oyake, T, K Itoh, H Motohashi, N Hayashi, H Hoshino, M Nishizawa, M Yamamoto, and K Igarashi, Bach proteins belong to a novel family of BTB-basic leucine zipper transcription factors t hat interact with MafK and regulate transcription through the NF-E2 site. Mol Cell Biol, 1996. 16 (11): p. 6083-95. 129. Chan, JY, XL Han, and YW Kan, Cloning of Nrf1, an NF-E2-related transcription factor, by ge netic selection in yeast. Proc Natl Acad Sci U S A, 1993. 90 (23): p. 11371-5. 130. Moi, P, K Chan, I Asunis, A Cao, and YW Kan, Isolation of NF-E2-related factor 2 (Nrf2), a NF-E2-like basic leucine zipper transcriptional activator that binds to the tandem NF-E2/AP1 repeat of th e beta-globin locus control region. Proc Natl Acad Sci U S A, 1994. 91 (21): p. 9926-30. 131. Forsberg, EC, KM Downs, and EH Bresnick, Direct interaction of NF-E2 with hypersensitive site 2 of the beta-globi n locus control regi on in living cells. Blood, 2000. 96 (1): p. 334-9. 132. Vieira, KF, PP Levings, MA Hill, VJ Crusselle, SH Kang, JD Engel, and J Bungert, Recruitment of transcription complexes to the beta -globin gene locus in vivo and in vitro. J Biol Chem, 2004. 133. Igarashi, K, H Hoshino, A Muto, N Su wabe, S Nishikawa, H Nakauchi, and M Yamamoto, Multivalent DNA binding complex ge nerated by small Maf and Bach1 as a possible biochemical basis for be ta-globin locus control region complex. J Biol Chem, 1998. 273 (19): p. 11783-90.

PAGE 117

105 134. Yoshida, C, F Tokumasu, KI Hohmura, J Bungert, N Hayashi, T Nagasawa, JD Engel, M Yamamoto, K Takeyasu, and K Igarashi, Long range interaction of cisDNA elements mediated by archit ectural transcription factor Bach1. Genes Cells, 1999. 4 (11): p. 643-55. 135. Sun, J, M Brand, Y Zenke, S Tash iro, M Groudine, and K Igarashi, Heme regulates the dynamic exchange of Bac h1 and NF-E2-related factors in the Maf transcription factor network. Proc Natl Acad Sci U S A, 2004. 101 (6): p. 1461-6. 136. Hardison, R, JL Slightom, DL Gumu cio, M Goodman, N Stojanovic, and W Miller, Locus control regions of mammalian be ta-globin gene clusters: combining phylogenetic analyses and experimental resu lts to gain func tional insights. Gene, 1997. 205 (1-2): p. 73-94. 137. Miller, IJ and JJ Bieker, A novel, erythroid cell-spec ific murine transcription factor that binds to the CACCC element and is related to the Kruppel family of nuclear proteins. Mol Cell Biol, 1993. 13 (5): p. 2776-86. 138. Nuez, B, D Michalovich, A Bygrav e, R Ploemacher, and F Grosveld, Defective haematopoiesis in fetal li ver resulting from inacti vation of the EKLF gene. Nature, 1995. 375 (6529): p. 316-8. 139. Perkins, AC, AH Sharpe, and SH Orkin, Lethal beta-thalassaemia in mice lacking the erythroid CACCC-transcription factor EKLF. Nature, 1995. 375 (6529): p. 318-22. 140. Wijgerde, M, J Gribnau, T Trimborn, B Nuez, S Philipsen, F Grosveld, and P Fraser, The role of EKLF in human beta-globin gene competition. Genes Dev, 1996. 10 (22): p. 2894-902. 141. Armstrong, JA, JJ Bieker, and BM Emerson, A SWI/SNF-related chromatin remodeling complex, E-RC1, is require d for tissue-specific transcriptional regulation by EKLF in vitro. Cell, 1998. 95 (1): p. 93-104. 142. Tanimoto, K, Q Liu, F Grosveld, J Bungert, and JD Engel, Context-dependent EKLF responsiveness defines the developm ental specificity of the human epsilonglobin gene in erythroid cel ls of YAC transgenic mice. Genes Dev, 2000. 14 (21): p. 2778-94. 143. Elnitski, L, W Miller, and R Hardison, Conserved E boxes function as part of the enhancer in hypersensitive site 2 of the beta-globin locus control region. Role of basic helix-loop-helix proteins. J Biol Chem, 1997. 272 (1): p. 369-78. 144. Bresnick, EH and G Felsenfeld, Evidence that the transcription factor USF is a component of the human beta-globin locus control region heteromeric protein complex. J Biol Chem, 1993. 268(25): p. 18824-34.

PAGE 118

106 145. Du, H, AL Roy, and RG Roeder, Human transcription factor USF stimulates transcription through the initiator el ements of the HIV-1 and the Ad-ML promoters. Embo J, 1993. 12 (2): p. 501-11. 146. Bungert, J, I Kober, F During, and KH Seifart, Transcription factor eUSF is an essential component of isolated transc ription complexes on the duck histone H5 gene and it mediates the inte raction of TFIID with a TATA-deficient promoter. J Mol Biol, 1992. 223 (4): p. 885-98. 147. Shivdasani, RA, EL Mayer, and SH Orkin, Absence of blood formation in mice lacking the T-cell leukaemi a oncoprotein tal-1/SCL. Nature, 1995. 373 (6513): p. 432-4. 148. Zhao, XF and PD Aplan, The hematopoietic transcription factor SCL binds the p44 subunit of TFIIH. J Biol Chem, 1999. 274 (3): p. 1388-93. 149. Breathnach, R and P Chambon, Organization and expressi on of eucaryotic split genes coding for proteins. Annu Rev Biochem, 1981. 50 : p. 349-83. 150. Smale, ST, A Jain, J Kaufmann, KH Emami, K Lo, and IP Garraway, The initiator element: a paradigm for core promoter heterogeneity within metazoan protein-coding genes. Cold Spring Harb Symp Quant Biol, 1998. 63 : p. 21-31. 151. Javahery, R, A Khachi, K Lo, B Zenzie-Gregory, and ST Smale, DNA sequence requirements for transcriptional initiator activity in mammalian cells. Mol Cell Biol, 1994. 14 (1): p. 116-27. 152. Roy, AL, H Du, PD Gregor, CD No vina, E Martinez, and RG Roeder, Cloning of an inrand E-box-binding protein, TF II-I, that interacts physically and functionally with USF1. Embo J, 1997. 16 (23): p. 7091-104. 153. Orphanides, G and D Reinberg, RNA polymerase II elongation through chromatin. Nature, 2000. 407 (6803): p. 471-5. 154. Riedl, T and JM Egly, Phosphorylation in transcription: the CTD and more. Gene Expr, 2000. 9 (1-2): p. 3-13. 155. Schubeler, D, C Francastel, DM Cimbor a, A Reik, DI Martin, and M Groudine, Nuclear localization and histone acetyla tion: a pathway for chromatin opening and transcriptional activation of the human beta-globin locus. Genes Dev, 2000. 14 (8): p. 940-50. 156. Ashe, HL, J Monks, M Wijgerde P Fraser, and NJ Proudfoot, Intergenic transcription and transinduction of the human beta-globin locus. Genes Dev, 1997. 11 (19): p. 2494-509.

PAGE 119

107 157. Kong, S, D Bohl, C Li, and D Tuan, Transcription of the HS2 enhancer toward a cis-linked gene is independent of the orientation, position, and distance of the enhancer relative to the gene. Mol Cell Biol, 1997. 17 (7): p. 3955-65. 158. Palstra, RJ, B Tolhuis, E Splinter, R Nijmeijer, F Grosveld, and W de Laat, The beta-globin nuclear compartment in d evelopment and erythroid differentiation. Nat Genet, 2003. 35 (2): p. 190-4. 159. O'Sullivan, JM, SM Tan-Wong, A Morillon, B Lee, J Coles, J Mellor, and NJ Proudfoot, Gene loops juxtapose promoters and terminators in yeast. Nat Genet, 2004. 36 (9): p. 1014-8. 160. Murrell, A, S Heeson, and W Reik, Interaction between differentially methylated regions partitions the imprinted gene s Igf2 and H19 into parent-specific chromatin loops. Nat Genet, 2004. 36 (8): p. 889-93. 161. Osborne, CS, L Chakalova, KE Brow n, D Carter, A Horton, E Debrand, B Goyenechea, JA Mitchell, S Lopes, W Reik, and P Fraser, Active genes dynamically colocalize to shared sites of ongoing transcription. Nat Genet, 2004. 36 (10): p. 1065-71. 162. Drissen, R, RJ Palstra, N Gillemans, E Splinter, F Grosveld, S Philipsen, and W de Laat, The active spatial organization of th e beta-globin locus requires the transcription factor EKLF. Genes Dev, 2004. 18 (20): p. 2485-90. 163. Leach, KM, KF Vieira, SH Kang, A Asla nian, M Teichmann, RG Roeder, and J Bungert, Characterization of the human beta-globin downstream promoter region. Nucleic Acids Res, 2003. 31 (4): p. 1292-301. 164. Schreiber, R, MS Goncalves, ML Junque ira, ST Saad, JE Krieger, and FF Costa, The Agamma-195 (C-->G) mutation in hered itary persistence of fetal hemoglobin is not associated w ith activation of a reporter gene in vitro. Braz J Med Biol Res, 2001. 34 (4): p. 489-92. 165. Maxam, AM and W Gilbert, Sequencing end-labeled DNA with base-specific chemical cleavages. Methods Enzymol, 1980. 65 (1): p. 499-560. 166. Hornstra, IK and TP Yang, In vivo footprinting a nd genomic sequencing by ligation-mediated PCR. Anal Biochem, 1993. 213 (2): p. 179-93. 167. Dubrez, L, F Goldwasser, P Ge nne, Y Pommier, and E Solary, The role of cell cycle regulation and apoptosis triggering in determining the sensitivity of leukemic cells to topoisomerase I and II inhibitors. Leukemia, 1995. 9 (6): p. 1013-24.

PAGE 120

108 168. Knehr, M, M Poppe, M Enulescu, W Eick elbaum, M Stoehr, D Schroeter, and N Paweletz, A critical appraisal of synchroni zation methods applied to achieve maximal enrichment of HeLa ce lls in specific cell cycle phases. Exp Cell Res, 1995. 217 (2): p. 546-53. 169. Leach, KM, K Nightingale, K Igarashi, PP Levings, JD Engel, PB Becker, and J Bungert, Reconstitution of human beta-globin locus control region hypersensitive sites in the absence of chromatin assembly. Mol Cell Biol, 2001. 21 (8): p. 262940. 170. Roeder, RG, The role of general initiation factors in transcription by RNA polymerase II. Trends Biochem Sci, 1996. 21 (9): p. 327-35. 171. Solomon, MJ, PL Larsen, and A Varshavsky, Mapping protein-DNA interactions in vivo with formaldehyde : evidence that histone H4 is retained on a highly transcribed gene. Cell, 1988. 53 (6): p. 937-47. 172. Orlando, V and R Paro, Mapping Polycomb-repressed domains in the bithorax complex using in vivo formal dehyde cross-linked chromatin. Cell, 1993. 75 (6): p. 1187-98. 173. Church, GM and W Gilbert, Genomic sequencing. Proc Natl Acad Sci U S A, 1984. 81 (7): p. 1991-5. 174. Becker, PB, F Weih, and G Schutz, Footprinting of DNAbinding proteins in intact cells. Methods Enzymol, 1993. 218 : p. 568-87. 175. Gallarda, JL, KP Foley, ZY Yang, and JD Engel, The beta-globin stage selector element factor is erythroid-specific promoter/enhancer binding protein NF-E4. Genes Dev, 1989. 3 (12A): p. 1845-59. 176. Sawado, T, K Igarashi, and M Groudine, Activation of beta-major globin gene transcription is associated with recru itment of NF-E2 to the beta-globin LCR and gene promoter. Proc Natl Acad Sci U S A, 2001. 98 (18): p. 10226-31. 177. Globin Gene Server 2001, Pennsylvania State University. 178. Wingender, E, X Chen, R Hehl, H Karas, I Liebich, V Matys, T Meinhardt, M Pruss, I Reuter, and F Schacherer, TRANSFAC: an integrated system for gene expression regulation. Nucleic Acids Res, 2000. 28 (1): p. 316-9. 179. Johnson, KD, HM Christensen, B Zhao, and EH Bresnick, Distinct mechanisms control RNA polymerase II recruitment to a tissue-specific locus control region and a downstream promoter. Mol Cell, 2001. 8 (2): p. 465-71. 180. Boyd, KE and PJ Farnham, Myc versus USF: discriminat ion at the cad gene is determined by core promoter elements. Mol Cell Biol, 1997. 17 (5): p. 2529-37.

PAGE 121

109 181. Dekker, J, K Rippe, M Dekker, and N Kleckner, Capturing chromosome conformation. Science, 2002. 295 (5558): p. 1306-11. 182. Splinter, E, F Grosveld, and W de Laat, 3C technology: analy zing the spatial organization of genomic loci in vivo. Methods Enzymol, 2004. 375 : p. 493-507. 183. Grosveld, F, Activation by locus control regions? Curr Opin Genet Dev, 1999. 9 (2): p. 152-7. 184. McDowell, JC and A Dean, Structural and functional cro ss-talk between a distant enhancer and the epsilon-globin gene prom oter shows interdependence of the two elements in chromatin. Mol Cell Biol, 1999. 19 (11): p. 7600-9. 185. Fiering, S, E Epner, K Robinson, Y Zhuang, A Telling, M Hu, DI Martin, T Enver, TJ Ley, and M Groudine, Targeted deletion of 5'HS2 of the murine betaglobin LCR reveals that it is not essential for proper regulation of the beta-globin locus. Genes Dev, 1995. 9 (18): p. 2203-13. 186. Hug, BA, RL Wesselschmidt, S Fiering, MA Bender, E Epner, M Groudine, and TJ Ley, Analysis of mice containing a targ eted deletion of beta-globin locus control region 5' hypersensitive site 3. Mol Cell Biol, 1996. 16 (6): p. 2906-12. 187. Tuan, D, S Kong, and K Hu, Transcription of the hypersensitive site HS2 enhancer in erythroid cells. Proc Natl Acad Sci U S A, 1992. 89 (23): p. 1121923. 188. Routledge, SJ and NJ Proudfoot, Definition of transcripti onal promoters in the human beta globin locus control region. J Mol Biol, 2002. 323 (4): p. 601-11. 189. Johnson, KD, JA Grass, C Park, H Im, K Choi, and EH Bresnick, Highly restricted localization of RNA polymerase II within a locus control region of a tissue-specific chromatin domain. Mol Cell Biol, 2003. 23 (18): p. 6484-93. 190. Sawado, T, J Halow, MA Bender, and M Groudine, The beta -globin locus control region (LCR) functions primar ily by enhancing the transition from transcription initiation to elongation. Genes Dev, 2003. 17 (8): p. 1009-18. 191. Gilbert, DM, Replication timing and transcriptio nal control: beyond cause and effect. Curr Opin Cell Biol, 2002. 14 (3): p. 377-83. 192. Zhang, J, F Xu, T Hashimshony, I Keshet, and H Cedar, Establishment of transcriptional competence in early and late S phase. Nature, 2002. 420 (6912): p. 198-202. 193. Aladjem, MI, M Groudine, LL Brody, ES Dieken, RE Fournier, GM Wahl, and EM Epner, Participation of the human beta-g lobin locus control region in initiation of DNA replication. Science, 1995. 270 (5237): p. 815-9.

PAGE 122

110 194. Cimbora, DM, D Schubeler, A Reik, J Hamilton, C Francastel, EM Epner, and M Groudine, Long-distance control of origin ch oice and replication timing in the human beta-globin locus are independ ent of the locus control region. Mol Cell Biol, 2000. 20 (15): p. 5581-91. 195. Kang, SH, K Vieira, and J Bungert, Combining chromatin immunoprecipitation and DNA footprinting: a novel method to analyze protein-DNA interactions in vivo. Nucleic Acids Res, 2002. 30 (10): p. e44. 196. Kim, A and A Dean, Developmental stage differences in chromatin subdomains of the beta-globin locus. Proc Natl Acad Sci U S A, 2004. 101 (18): p. 7028-33. 197. Long, Q, C Bengra, C Li, F Kutlar, and D Tuan, A long terminal repeat of the human endogenous retrovirus ERV-9 is located in the 5' boundary area of the human beta-globin locus control region. Genomics, 1998. 54 (3): p. 542-55. 198. Epner, E, WC Forrester, and M Groudine, Asynchronous DNA replication within the human beta-globin gene locus. Proc Natl Acad Sci U S A, 1988. 85 (21): p. 8081-5. 199. Grosveld, F, GB van Assendelft, DR Greaves, and G Kollias, Positionindependent, high-level expression of the human beta-globin gene in transgenic mice. Cell, 1987. 51 (6): p. 975-85. 200. Bulger, M, MA Bender, JH van Doorninck, B Wertman, CM Farrell, G Felsenfeld, M Groudine, and R Hardison, Comparative structural and functional analysis of the olfactory receptor genes flanking the human and mouse betaglobin gene clusters. Proc Natl Acad Sci U S A, 2000. 97 (26): p. 14560-5. 201. Francastel, C, MC Walters, M Groudine, and DI Martin, A functional enhancer suppresses silencing of a transgene a nd prevents its localization close to centrometric heterochromatin. Cell, 1999. 99 (3): p. 259-69. 202. Plant, KE, SJ Routledge, and NJ Proudfoot, Intergenic transcription in the human beta-globin gene cluster. Mol Cell Biol, 2001. 21 (19): p. 6507-14. 203. Wittschieben, BO, G Otero, T de Bizemont J Fellows, H Erdjument-Bromage, R Ohba, Y Li, CD Allis, P Tempst, and JQ Svejstrup, A novel histone acetyltransferase is an integral s ubunit of elongating RNA polymerase II holoenzyme. Mol Cell, 1999. 4 (1): p. 123-8. 204. Rank, G, M Prestel, and R Paro, Transcription through intergenic chromosomal memory elements of the Drosophila bithorax complex correlates with an epigenetic switch. Mol Cell Biol, 2002. 22 (22): p. 8026-34. 205. Masternak, K, N Peyraud, M Kr awczyk, E Barras, and W Reith, Chromatin remodeling and extragenic transcription at the MHC class II locus control region. Nat Immunol, 2003. 4 (2): p. 132-7.

PAGE 123

111 206. Carter, D, L Chakalova, CS Os borne, YF Dai, and P Fraser, Long-range chromatin regulatory in teractions in vivo. Nat Genet, 2002. 32 (4): p. 623-6. 207. Onishi, Y and R Kiyama, Interaction of NF-E2 in the human beta-globin locus control region before chromatin remodeling. J Biol Chem, 2003. 278 (10): p. 8163-71. 208. Reitman, M, E Lee, H Westphal, and G Felsenfeld, An enhancer/locus control region is not sufficient to open chromatin. Mol Cell Biol, 1993. 13 (7): p. 3990-8. 209. Spicuglia, S, S Kumar, JH Yeh, E Vachez, L Chasson, S Gorbatch, J Cautres, and P Ferrier, Promoter activation by enhancer-d ependent and -independent loading of activator and coactivator complexes. Mol Cell, 2002. 10 (6): p. 1479-87. 210. Muller, HP and W Schaffner, Transcriptional enhancers can act in trans. Trends Genet, 1990. 6 (9): p. 300-4. 211. Lewis, BA, TK Kim, and SH Orkin, A downstream element in the human betaglobin promoter: evidence of extended se quence-specific transcription factor IID contacts. Proc Natl Acad Sci U S A, 2000. 97 (13): p. 7172-7. 212. Lewis, BA and SH Orkin, A functional initiator element in the human beta-globin promoter. J Biol Chem, 1995. 270 (47): p. 28139-44. 213. Roy, AL, M Meisterernst, P Pognonec, and RG Roeder, Cooperative interaction of an initiator-binding transcription init iation factor and th e helix-loop-helix activator USF. Nature, 1991. 354 (6350): p. 245-8. 214. Kutach, AK and JT Kadonaga, The downstream promoter element DPE appears to be as widely used as the TATA box in Drosophila core promoters. Mol Cell Biol, 2000. 20 (13): p. 4754-64. 215. Willy, PJ, R Kobayashi, and JT Kadonaga, A basal transcription factor that activates or represses transcription. Science, 2000. 290 (5493): p. 982-5. 216. Tussie-Luna, MI, D Bayarsaihan, E Seto, FH Ruddle, and AL Roy, Physical and functional interactions of histone deacet ylase 3 with TFII-I family proteins and PIASxbeta. Proc Natl Acad Sci U S A, 2002. 99 (20): p. 12807-12. 217. Wobbe, CR and K Struhl, Yeast and human TATA-binding proteins have nearly identical DNA sequence requireme nts for transcription in vitro. Mol Cell Biol, 1990. 10 (8): p. 3859-67. 218. Stewart, JJ and LA Stargell, The stability of the TFIIA-TBP-DNA complex is dependent on the sequence of the TATAAA element. J Biol Chem, 2001. 276 (32): p. 30078-84.

PAGE 124

112 219. Manzano-Winkler, B, CD Novina, and AL Roy, TFII is required for transcription of the naturally TATA-less but in itiator-containing Vbeta promoter. J Biol Chem, 1996. 271 (20): p. 12076-81. 220. Goetz, TL, TL Lloyd, and MD Griswold, Role of E box and initiator region in the expression of the rat follicle-stimulating hormone receptor. J Biol Chem, 1996. 271 (52): p. 33317-24. 221. Breen, GA and EM Jordan, Upstream stimulatory factor 2 stimulates transcription through an initiator elem ent in the mouse cytochrome c oxidase subunit Vb promoter. Biochim Biophys Acta, 2000. 1517 (1): p. 119-27. 222. Clark, MP, CW Chow, JE Rinaldo, and R Chalkley, Multiple domains for initiator binding proteins TFII-I and YY-1 are present in the initiator and upstream regions of the rat XDH/XO TATA-less promoter. Nucleic Acids Res, 1998. 26 (11): p. 2813-20. 223. Hsieh, CM, SF Yet, MD Layne, M Wata nabe, AM Hong, MA Perrella, and ME Lee, Genomic cloning and promoter analysis of aortic prefer entially expressed gene-1. Identification of a vascular smooth muscle-specific promoter mediated by an E box motif. J Biol Chem, 1999. 274 (20): p. 14344-51. 224. Chen, YH, MD Layne, M Watana be, SF Yet, and MA Perrella, Upstream stimulatory factors regulate aortic pref erentially expressed gene-1 expression in vascular smooth muscle cells. J Biol Chem, 2001. 276 (50): p. 47658-63. 225. Martinez-Balbas, MA, A Dey, SK Rabindran, K Ozato, and C Wu, Displacement of sequence-specific tr anscription factors from mitotic chromatin. Cell, 1995. 83 (1): p. 29-38. 226. Parsons, GG and CA Spencer, Mitotic repression of RNA polymerase II transcription is accompanied by release of transcription elongation complexes. Mol Cell Biol, 1997. 17 (10): p. 5791-802. 227. Christova, R and T Oelgeschlager, Association of human TFIID-promoter complexes with silenced mitotic chromatin in vivo. Nat Cell Biol, 2002. 4 (1): p. 79-82. 228. West, AG, S Huang, M Gaszner, MD Litt, and G Felsenfeld, Recruitment of Histone Modifications by USF Proteins at a Vertebrate Barrier Element. Mol Cell, 2004. 16 (3): p. 453-63.

PAGE 125

113 BIOGRAPHICAL SKETCH Karen Frances Vieira was born in Bridgetown, Barbados, on October 1st, 1978 to Ronald F. and Rosemary L. Vieira of St. Ge orge Barbados. She lived and attended high school in Barbados, where she graduated w ith an Exhibition schol arship from Queen’s College in 1997. Her undergraduate studies we re partially funded by the Government of Barbados and an academic scholarship from Florida Institute of Technology. Karen was awarded a B.S. degree in biological sciences with a concentration in molecular biology from Florida Institute of Technology with hi gh honors in May of 2000. She started in the IDP in the College of Medicine at the Univ ersity of Florida in August of 2000, where she received the Alumni Fellowship. She rece ived many honors, awards and travel grants during this degree program, including first place in the Medical Guild research competition. While enrolled in the IDP she c oncurrently pursued a M.S. in management from the University of Florida Warrington Co llege of Business, which she finished in December of 2003. She graduated with her Ph D from the Department of Biochemistry and Molecular Biology in December of 2004. Af ter graduation, Karen has plans of using her scientific and business educational back grounds to work with in the biotechnology industry in the short term and to get involve d in starting a sickle cell disease Research Foundation in her island nation, Barbados.


Permanent Link: http://ufdc.ufl.edu/UFE0008363/00001

Material Information

Title: Recruitment of Transcription Complexes to the Beta-Globin Locus In Vivo and In Vitro
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0008363:00001

Permanent Link: http://ufdc.ufl.edu/UFE0008363/00001

Material Information

Title: Recruitment of Transcription Complexes to the Beta-Globin Locus In Vivo and In Vitro
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0008363:00001


This item has the following downloads:


Full Text












RECRUITMENT OF TRANSCRIPTION COMPLEXES TO THE BETA-GLOBIN
LOCUS IN VIVO AND IN VITRO















By

KAREN FRANCES VIEIRA


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2004

































Copyright 2004

by

Karen Frances Vieira

































This document is dedicated to my mother and sister who have been there for me every
step of the way, and to my father who is gone but not forgotten.















ACKNOWLEDGMENTS

I would like to first acknowledge God as the guiding light in my life, for without

Him my world would be empty.

I owe a huge thanks to my mentor, Dr. Jorg Bungert, for the opportunity to work in

his lab and for receiving the excellent training that I did. He has been a great mentor,

motivator, advisor and teacher. He has been patient with me and very supportive of my

alternate career choices. He is the hallmark of a good scientist, and I respect and am

inspired by his commitment and dedication.

I thank all of my committee members, Drs. Michael Kilberg, Thomas Yang, Linda

Bloom, Hideko Kasahara, and James Resnick. They have all been a great help in

providing suggestions and directions for my experiments and career. Drs. Kilberg and

Yang have been especially supportive and encouraging throughout my time at the

University of Florida, and have always had insightful comments during my committee

meetings and presentations. I need to thank them as well as Dr. Brian Cain for critically

evaluating and helping me with my presentation that won first place in the 2004 Medical

Guild Research Competition. I appreciate Dr. Resnickjoining my committee at such

short notice, and also providing useful information to help me get on track for graduation.

I extend my appreciation to Dr. James B. Flanegan, the department chair, and all

the administrative and secretarial staff that has made me at home in the department. I

would like to say a special thanks to Bradley Moore who always shares a smile or a

compliment to brighten my day.









I thank all of the past and present members of the Bungert lab. When I first started

in the laboratory, Kelly Leach and Padraic Levings instantly made me feel comfortable

and were great mentors to me. I appreciate Kelly for setting the standards, which I have

since tried to meet or surpass. Sung-Hae Lee Kang also was a mentor and a great source

of encouragement and advice as well as a great friend. Ara Aslanian is the post-doctoral

researcher who, upon leaving, passed on his protocols and projects to me. Since that was

the first step in my successes here at the University of Florida, I owe Ara many thanks.

Christof Dame was a post-doc in the laboratory that encouraged me with helpful,

thoughtful and sometimes amusing discussions. I would like to thank Valerie Crusselle

for being a great colleague and also a friend. I wish her many blessings. Takeesha

Roland has been the best laboratory technician I know and I appreciate her help, patience

and sincere friendship. I need to thank the many other members of the lab including

Boris Thurisch, Felicie Andersen, Meredith Hill, and the many undergraduates and high

school students who have helped and entertained me along the way.

I thank the members of Dr. Yang's lab who have always been helpful and friendly,

especially Christine Kiefer and Sara Rodriguez, who both helped me with footprinting

experiments. I would like to say a special thanks to the members of Dr. Kilberg's lab,

especially Hong Chen who has been a great source of knowledge.

I would like to thank my family and friends who have been very supportive. My

mother and sister have always been my best source of support and encouragement, and I

want them to know that I love and appreciate them. I thank my boyfriend and many

friends, who have helped me tremendously through the stresses of graduate school, and

have been patient with my many moods during this long journey.
















TABLE OF CONTENTS

page

A C K N O W L E D G M E N T S ................................................................................................. iv

LIST OF FIGURES ......... ......................... ...... ........ ............ ix

ABSTRACT .............. .......................................... xi

CHAPTER

1 IN TR OD U CTION ............................................... .. ......................... ..

H em oglobin and Sickle Cell D disease ........................................ ....................... 1
Overview of Sickle Cell and Thalassemia.................................. ...............
Sym ptom s and Treatm ents ............................................................................2
Current R research on Therapies ........................................ ......... ............... 3
C hrom atin Structure........ ....... .............................................................. ....... .. .. ....
H stone M modifications ....................... ............................ .. ........ ............ .....
C hrom atin R em odeling ............................................................................. 7
M echanism of Transcription............................................................ ............... 8
Preinitiation Com plex A ssem bly.................................................. .................. 9
In itia tio n ................................................................................................................ 9
Elongation ......................................................10
The P-G lobin G ene Locus ............................ ............... ..................... 1
L location and O organization ............. .............................................. ... ............. 11
Locus Control Region..................................................... 12
Proteins Associated with the P-Globin Locus ......... .......... .....................14
Model for 3-Globin Gene Regulation......... ................. ...........................16
Questions to Be Addressed........... .......... ........... .................. ............... 19

2 M ATERIALS AND M ETHOD S ........................................ ......................... 21

Cell Culture........................................ ......... 21
Chrom atin Im m unoprecipitation (ChIP) ......... ..... ............ ................ ..................21
Chromatin Immunoprecipitation and DMS Footprinting ..........................................24
D M S Treatm ent ....... ........ ....................... .......... ..... ........ ........ .... 26
Linker LM PCR ....... ............................ .......... ... .. ................. 26
W western Blotting ........................ ....... ......... ................ ....... .. 29
C ell Synchronization .............................................................30









PCR-Based DNA Replication Analysis................................... ....................... 30
D N A Isolation ............................................ .. .. ............. ......... 30
Sem i-Q uantitative PCR ......................................................... ..................... 31
In Vitro Polym erase Transfer Analysis.................................... ....................... 32
MEL Cell DMSO Differentiation..................... ....... ............................ 33
Sem i-Q uantitative R T-PCR ............................................. .............................. 33
D double Im m unoprecipitation........................................................... ............... 34
Co-Im m unoprecipitation..............................................................................36

3 CHROMATIN IMMUNOPRECIPITATION AND DMS FOOTPRINTING ...........38

In tro d u ctio n ............................ ....................................... ................ 3 8
R e su lts ............................................................................................ 4 0
D iscu ssio n ......................................................................................... 4 3

4 INTERACTION OF RNA POLYMERASE II AND TRANSCRIPTION FACTORS
W ITH THE P-GLOBIN LOCU S ........................................ ......................... 46

In tro d u ctio n .......................................................................................4 6
R e su lts ...........................................................................................4 8
D isc u ssio n ............................................................................................................. 5 8

5 ANALYSIS OF THE MECHANISM OF RNA POLYMERASE II TRANSFER
FROM THE LCR TO THE 3-GLOBIN GENE PROMOTER ................65

In tro d u ctio n ........................................................................................................... 6 5
R e su lts ...........................................................................................6 6
D isc u ssio n ............................................................................................................. 7 2

6 DETERMINING THE FUNCTION OF THE USF, TFII-I AND HDAC3
PROTEINS IN 3-GLOBIN GENE REGULATION ................................................76

Introdu action ............... ................ ................................................................... 76
Results ................... ..................................78
D discussion ............... ...... ...................................................... ........82

7 CONCLUSIONS AND FUTURE DIRECTIONS ...................................... 87

C h IP F o o tp rin tin g ......................... ....................................................................... 8 7
ChIP w within the 3-G lobin Locus................................................. 88
C ell Synchronization ............................................................ 89
Chromosome Conformation Capture ....... ...................... .......... ............ 90
In Vitro Pol II Transfer ....................... .... .................. 91
USF, TFII-I and HDAC3 Function in 3-Globin Regulation .....................................92
Summary ................... .................................. 93









L IST O F R E F E R E N C E S ...................................... .................................... ....................94

BIOGRAPHICAL SKETCH ............................................................. ..................113
















LIST OF FIGURES


Figure page

1-1. The hum an and m house P-globin loci ..................................................................... 13

1-2. Multistep model for human 3-globin gene regulation.............................................18

3-1. Sequence alignment of the adult P-globin downstream promoter region. ...............41

3-2. Analysis of protein-DNA interactions in the murine P-globin downstream
promoter region by a combination of chromatin immunoprecipitation and DMS
footprinting.......................................... .................... ...... ......... 42

3-3. ChIP experiment showing the interaction of USF and NF-E2 with the murine
pmaj-globin promoter in M EL cells............................ ...... ............. .... 43

3-4. LMPCR footprint analysis of non-selected or ChIP-selected chromatin ...............44

4-1. Diagrammatic representation of the human and murine P-globin gene locus. ........49

4-2. Interaction of transcription factors and RNA polymerase II with the human 3-
globin locus and the human necdin gene. ..................................... ............... 50

4-3. Interaction of transcription factors with and transcription in the murine P-globin
locu s in M E L cells............ ... ........................................................ .......... .. .... 52

4-4. Interactions of transcription factors and RNA polymerase II with the human 3-
globin locus during early S phase in synchronized K562 cells..............................54

4-5. Interactions of transcription factors and RNA polymerase II with the human 3-
globin locus during early S phase in synchronized MEL cells. ............................56

4-6. Semi-quantitative PCR analysis of DNA content of synchronized K562 cells. ......57

4-7. Semi-quantitative PCR analysis of DNA content of synchronized MEL cells........58

5-1. A schematic representation of the in vitro Pol II transfer experimental procedure. 67

5-2. Transfer of RNA polymerase II from immobilized LCR constructs to the
P -g lo b in g en e ............ ...... ... .... ................. ............. ................ 6 8









5-3. Analysis of the specificity of Pol II transfer. ............. .............................................70

5-4. Comparison of Pol II transfer using the wild-type P-globin gene (lane 1) and a
mutant P-globin gene (lane 2) in which an E-box at +60 was altered....................70

5-5. Transfer of RNA polymerase II to the P-globin gene in the presence of NF-E2 or
B SA ............................................................................... 7 1

5-6. Analysis ofNF-E2 mediated transfer to the P-globin gene...................................72

5-7. Quantitative summary of the transfer experiments. .............................................. 73

5-8. Model of transcription complex recruitment to the P-globin gene .......................75

6-1. Sequence alignment of the human 3-globin downstream promoter region. ...........78

6-2. Characterization of protein-DNA interactions in the human 3-globin
downstream promoter region in vivo........ ..................................... ............... 80

6-3. Chromatin double immunoprecipitation (ChDIP) experiment analyzing the
interaction of TFII-I and HDAC3 at different regions within the human 3-globin
lo cu s. .............................................................................. 8 1

6-4. Co-immunoprecipitation experiment analyzing the interaction of TFII-I and
H D A C3 as a com plex ............................................... .. ...... .. ............ 82

6-5. Summary and model of protein-DNA interactions at the human 3-globin
prom other. ............................................................................86















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

RECRUITMENT OF TRANSCRIPTION COMPLEXES TO THE BETA-GLOBIN
LOCUS IN VIVO AND IN VITRO

By

Karen Frances Vieira

December 2004

Chair: Jorg Bungert
Major Department: Biochemistry and Molecular Biology

The P-globin gene locus is the site of many mutations and deletions that cause

sickle cell disease and P-thalassemias. Erythroid-specific, high-level expression of the 3-

globin genes is regulated by the locus control region, located far upstream of the genes.

Recent studies show that locus control region core elements recruit RNA polymerase II.

Here, we developed and optimized methods to study protein-DNA interactions

within the P-globin locus. These techniques were used to analyze the interaction of

transcription factors and RNA polymerase II with the P-globin locus in erythroleukemia

cell lines. The data show that transcription initiation complexes are recruited to the LCR

and to the genes. Moreover, RNA polymerase II dissociates during early S phase in

synchronized erythroid cells suggesting that replication disrupts the association of

transcription complexes with the globin locus. The interaction of NF-E2 and USF2

precedes the re-association of RNA polymerase II implicating these proteins in a process

regulating the recruitment of RNA polymerase to the globin locus during replication.









Furthermore, we demonstrate transfer of transcription complexes from immobilized

LCR constructs to the human 3-globin gene in vitro. Our data are consistent with the

hypothesis that the LCR and the genes cooperate to recruit transcription complexes to the

globin gene locus.

Studies on the interaction of proteins with the adult P-globin gene promoter

demonstrate that the helix-loop-helix proteins USF and TFII-I associate with DNA-

regulatory elements located at or downstream of the transcription initiation site. TFII-I

interacts with histone deacetylase 3 and binds more efficiently in erythroid cells that do

not express the P-globin gene. In contrast, USF, known to interact with chromatin-

opening activities, associates with the globin gene when it is expressed. These data

suggest that USF and TFII-I regulate P-globin gene expression in an antagonistic fashion.














CHAPTER 1
INTRODUCTION

Hemoglobin and Sickle Cell Disease

Hemoglobin is the molecule in red blood cells that transports oxygen to all the

tissues of mammalian organisms. Hemoglobin is composed of two alpha (a) globin

chains and two beta (3) globin chains, each carrying a heme molecule [1]. The heme

molecule contains an iron atom and is responsible for binding the oxygen that is

transported. The a- and P-globin chains are important for the overall structure of

hemoglobin, and thus contribute to its essential functions in gas transport.

Overview of Sickle Cell and Thalassemia

More than 80 point mutations and deletions in the a-globin genes are known to

cause a-thalassemia [2]. These thalassemias have the highest incidence in India, Africa,

and Arabic countries [3]. Similarly, more than 200 mutations and deletions in the 3-

globin genes cause sickle cell anemia, sickle SC disease, sickle SD disease (collectively

called sickle cell disease), and P-thalassemias [2]. Sickle cell disease and the 3-

thalassemias are the most common monogenetic diseases worldwide, with an estimated

80 million P-thalassemia carriers [4]. There are over 10,000 African-Americans with

sickle cell anemia in the USA alone. In African, Asian, Indian and Middle Eastern

communities, sickle cell disease and P-thalassemia are widespread.

Because some mutations associated with the a- and P-globin gene loci provide

protection from malaria, incidence for thalassemias and sickle-cell disease are historically









more common in areas affected by malaria. These regions include Africa, India, and

Mediterranean countries. Heterozygous individuals carrying the sickle cell allele have a

survival advantage since these individuals are generally healthy but reveal resistance to

malaria. In the past individuals homozygous for the disease generally did not live past

childhood. These diseased individuals now benefit from an extended lifespan due to the

increased level of worldwide healthcare.

Symptoms and Treatments

Sickle hemoglobin polymerizes when deoxygenated. The hemoglobin polymers

form alpha helical bundles, which deform red blood cells into a sickle-shape. These

sickle cells that give the disease its name are more rigid than normal red blood cells and

cannot pass through small blood vessels. The resulting blockage of blood vessels causes

intense pain and other side effects.

Patients with sickle cell disease experience a range of complications, including

painful crises, acute chest syndrome, priapism in males, stroke, bone damage, and lung

damage. Many patients undergo monthly blood transfusions to lower the percentage of

sickle red blood cells in their system. This reduces the frequency of painful crises, but

also increases iron concentrations to sometimes-toxic levels. Therefore, along with

transfusions, sickle cell patients undergo iron chelation therapy. Unfortunately, since

chelation therapy is performed by daily intravenous injections there is a low patient

compliance. Though, the recent development of new oral iron-chelating agents may

allow for better compliance [5].

Currently, the only cure for severe hemaglobinopathies is hematopoietic stem cell

transplantation (HSCT). About 71% ofthalassemia patients given HSCT from a matched

donor have been cured of their disease [6]. Due to the high risks associated with this









procedure, patients receive HSCT only if sickle-related death is imminent [5].

Encouragingly, of the sickle cell patients that have received HSCT, 85% survived

disease-free [7]. Since only about 1% of sickle cell patients meet the criteria for HSCT

and have a suitable donor, alternative therapies are highly sought after.

Current Research on Therapies

Many current trials are performed with drugs that increase the levels of fetal

hemoglobin (HbF) since HbF inhibits the polymerization of sickle hemoglobin (HbS).

The drug 5-azacytidine, which inhibits DNA methyltransferases, has been used in the

past but due to serious side effects is now rarely used. Sodium butyrate acts

synergistically with 5-azacytidine and reactivates y-globin expression for the production

of HbF [8]. Hydroxyurea, which is known to inhibit DNA synthesis and alter chromatin

structure, is currently the drug of choice to raise HbF in sickle cell patients and to reduce

symptoms associated with the disease [9, 10]. The main known side effect of

hydroxyurea treatment is myelotoxicity, or destruction of the bone marrow. Its long-term

toxicity and effects on survival are yet to be determined. For this and other reasons,

hydroxyurea is reserved only for patients with severe complications.

For patients that do not meet the criteria for HSCT or do not respond to

pharmacological therapies, gene therapy may provide a promising alternative in the

future. Sickle cell disease is caused by a point mutation in the coding region of the 3-

globin gene and it was the first genetic disorder in which such point mutations have been

found [11]. Due to the relative simple genetic defect and the ability to isolate and

transfect hematopoietic stem cells, it was anticipated that globin gene disorders would be

among the first for which gene therapy approaches are feasible.









Several viruses are being tested as vectors for therapeutic gene transfer of the 3-

globin genes to mammalian cells. These include murine retroviruses [12], lentiviruses

[13], human foamy virus [14], and adeno-associated virus [15-18]. Promising results

were obtained using lentivirus-based gene therapy in a mouse model for P-thalassemia

[19], though there is still much to be done before it can become approved as a safe form

of gene therapy for sickle cell and P-thalassemia.

One of the obstacles of using lentivirus is the fact that the DNA integrates into the

genome and there is some evidence that integration into open transcriptionally active

regions is preferred [20, 21]. This enhances the risk of gene disruption (e.g., of tumor

suppressor genes) or activation of endogenous genes (e.g., oncogenes). Adeno-associated

virus is considered to be the safest virus used in gene therapy trials because it does not

appear to cause strong immune reactions and in many reports the DNA remained

episomal [22-25]. The limitation of using AAV for globin gene therapy is the low

packaging capacity. As outlined below, appropriate control of P-globin gene regulation

is complex and requires the presence of many cis-acting DNA elements. Alternative

approaches are to optimize HSCT for making it more broadly applicable and to use novel

mechanisms to induce a high level of fetal globin gene expression.

Chromatin Structure

To comprehend the regulation of the globin genes and potential interactions within

the P-globin gene locus, it is important to understand the chromatin structure in the locus

and its relevance to gene expression.

In order to fit the entire genome into the nucleus of each living cell DNA is highly

constrained and compacted through interactions with proteins called histones. Histones









are small basic proteins consisting of a globular domain and a more flexible N-terminus.

DNA organization in the nuclei of eukaryotes involves repetitive packaging into

nucleosomes, which are composed of two each of the histone core proteins H2A, H2B,

H3 and H4 arranged in an octamer around which 146 base pairs of DNA is wrapped [26,

27]. Nucleosomal DNA and its associated proteins interact with other proteins to form

higher order structures in the nucleus; the combination of DNA and associated factors in

the nucleus is termed chromatin.

Nucleosomal arrays along the DNA are proposed to fold into a 30 nm fiber upon

incorporation of the linker histone H1, though the mechanism of this compaction remains

unclear. Higher levels of compaction may occur in genomic domains termed

heterochromatin. Genes located in these dense chromatin domains are generally not

accessible for interacting with transcription factors and are thus suppressed [28, 29].

Even further compaction is required during mitosis, and a protein called condensin helps

convert chromatin into condensed mitotic chromosomes [30]. Conversely, there are

regions of the genome, termed euchromatin, in which the genes are not highly

compacted, leaving them accessible to transcription complexes required for gene

expression.

Although the details of chromatin folding are still unclear, the relative compaction

of any region of the genome can be measured by determining the susceptibility of that

region to digestion by the endonuclease deoxyribonuclease (DNaseI). Regions of the

genome are described as being DNaseI insensitive, sensitive, or hypersensitive.

Insensitive regions like heterochromatin are highly condensed and inaccessible to

DNaseI. Sensitive regions such as euchromatin exhibit a less compacted chromatin









structure and are accessible to DNaseI [31]. Transcribed regions of the genome are

usually DNaseI sensitive and may be organized as a 30 nm chromatin fiber. DNaseI

hypersensitive sites are usually 200 to 400 bps long and probably reflect regions in which

nucleosomes have been removed or modified. These sites contain clusters of transcription

factor binding sites and are generally associated with the function of regulatory DNA

regions, e.g., enhancers or promoters [32].

Nucleosomes and other forms of DNA compaction modulate transcription and thus

represent an important factor in gene regulation [33]. Enzymes that modify and remodel

chromatin play an important role in activation and repression of gene expression.

Chromatin modifications are post-translational modifications of the histones.

Alternatively, chromatin remodeling includes changing the location of nucleosomes,

altering histone-DNA interactions, removal of histones, and histone exchange [34-39].

Histone Modifications

Histones can be acetylated, methylated, phosphorylated, ubiquitylated, sumoylated,

and ADP-ribosylated [40]. Originally it was thought that modifications occurred only on

the N-terminal tails of histones that protrude from the nucleosome core, but recent work

has identified modifications within the core regions as well as on the C-terminal tails

[41].

Lysine acetylation by histone acetyltransferases (HATs) has so far been the most

studied of all histone modifications [42-44]. There are 5 families of HATs that are all

large multiprotein complexes. Histone acetylation is a reversible process, catalyzed by

histone deacetylases (HDACs) [45], of which there are 3 distinct families. Several lysine

residues are known to be acetylated, including lysines 9, 14, 18 and 23 on H3, and lysines

5, 8, 12 and 16 on H4. Acetylated histones are usually localized to regions of actively









transcribed DNA, therefore making them a mark of active or open chromatin domains,

although there are instances where this is not true [46, 47]. Histone acetylation can also

be associated with transcriptional repression and silencing, as well as recombination [48-

51].

Certain lysine residues can also be methylated by histone methyltransferases

(HMTs). Similarly to HATs and HDACs, there are several families of HMTs, which can

mono-, di-, or tri-methylate lysine residues. Recently, a histone demethylase called

PAD4 has been identified [52], disproving the theory that methylation may be

irreversible [53]. Specific histone methylation patterns correlate with gene activation, as

is the case with methylated lysine 4 on H3 (H3K4) [54]. But histone methylation can

also result in gene repression and heterochromatin formation, as with lysine 9

methylation on H3 (H3K9) [55, 56].

There are several other histone modifications, as mentioned at the beginning of this

section, the function of which has not all been determined. A recent model, called the

histone code hypothesis, postulates that the combinations of histone modifications

interact with other proteins that use this code to execute specific gene expression patterns

[47]. This model explains how the same modification on different residues can have

different outcomes. It also explains how the same modification on the same residue but

in the context of different surrounding modifications can have different consequences,

such as H3 with acetylated lysines correlating with both activation and repression of gene

expression [46].

Chromatin Remodeling

The energy from ATP hydrolysis can be used to loosen DNA-histone contacts in

order to mobilize histones. For this reason, all chromatin remodeling complexes contain









an ATPase subunit, which is critical for nucleosome mobilization. Thus far there are 3

known families of ATP-utilizing chromatin remodeling complexes, and possibly many

more to be discovered [57].

Though the mechanism of nucleosome movement has not been established, there

have been several models proposing that the mechanism involves DNA dissociating from

the nucleosome and being replaced by a neighboring piece of DNA. This would yield a

DNA loop that moves in a wave across the surface of the nucleosome, ensuring that as

the histone moves only a small region of contact with the DNA is broken at any one time.

This could also apply to histone contacts being disrupted with one piece of DNA and

reestablished simultaneously on another piece of DNA as histones are relocated within

the genome [57].

Chromatin remodeling complexes also have the ability to improve the accessibility

of chromatin to proteins. This would conceivably be achieved by modifying DNA-

histone contacts. Work with the glucocorticoid receptor Gal4-VP16 and some other

transcriptional activators demonstrated that the activators bind chromatin and then recruit

the chromatin remodeling complexes [58-60]. Other studies show that chromatin needs

to be remodeled before transcription factors interact with their binding sites in regulatory

regions [61]. Further work has provided evidence that there is specificity of activators or

repressors for certain chromatin remodeling complexes (possibly for those they can

physically interact with) [62-65].

Mechanism of Transcription

Activation of gene expression ultimately results in the stable association of RNA

polymerase II (Pol II) and other components of the transcription complex with gene

promoters. The first step of transcription for any gene involves assembly of the pre-









initiation complex (PIC). After PIC formation and recruitment of Pol II, the C-terminal

domain (CTD) of Pol II is phosphorylated leading to the progression from initiation to

elongation competent transcription complexes.

Preinitiation Complex Assembly

PIC formation often begins with the binding of the TBP subunit of TFIID to the

TATA box. The binding of TFIID to the TATA box is stimulated by TFIIA, and the

TFIID/TFIIA/DNA complex is recognized by TFIIB, which serves as a bridge between

the pre-initiation complex and Pol II. Pol II is recruited to the PIC together with its

associated factor TFIIF followed by the interaction of TFIIE and TFIIH [66-68].

Evidence suggests that some activators act by recruiting TFIID and TFIIA to the

promoter, and these in turn recruit the Pol II holoenzyme containing RNA Pol II and

other general transcription factors (GTFs) that may already be pre-assembled [69, 70].

Because genes differ in their promoter structure, the formation of the initiation complex

likely varies between genes. For example TATA-less genes use additional proteins to

recruit Pol II and general transcription factors. There may be a stepwise recruitment of

factors to some promoters and recruitment of a Pol II holoenzyme to other promoters.

Initiation

Phosphorylation of the CTD of Pol II signals the transition from preinitiation to

initiation of transcription. CTD phosphorylation is carried out by TFIIH (at serine 5) and

pTEFb (at serine 2), and is thought to be regulated by the mediator complex in yeast or

the CRSP complex in higher eukaryotes [71, 72]. It has been postulated that the

phosphorylation of the CTD breaks contacts between Pol II and some of the GTFs,

therefore allowing Pol II to initiate transcription [68]. Phosphorylation at the two

different series play different functional roles, since the serine-5 and serine-2









phosphorylated Pol II complexes are observed in the early initiation and elongation stages

respectively [73, 74]. It is thought that the phosphorylation status of the CTD allows

association with proteins involved in transcription elongation, histone modification, and

RNA processing.

For some genes chromatin remodeling plays a significant role in transcription,

either for PIC formation or after PIC formation for transcription initiation and elongation

[59, 74-77]. Chromatin alterations involved in transcriptional activation are often limited

to acetylation of histone tails by HATs, though other modifications may also be involved

but have not yet been identified.

Elongation

Efficient elongation requires that the Pol II CTD remains phosphorylated during the

entire elongation process. A hyper-phosphorylated CTD is important for the interaction

of Pol II with RNA processing factors such as capping enzyme, splicing factors and

proteins for transcription termination [78, 79]. The CTD becomes de-phosphorylated

after transcription termination and is then again able to interact with the promoter [68]. A

CTD phosphatase Fcpl has been identified that dephosphorylates the CTD [80-85],

though the mechanism of dephosphorylation remains elusive.

Several other parameters have been discovered that contribute to transcription

elongation. Histone acetylation is required for efficient transcription elongation in yeast

[86], and seems to be lost immediately after the passage of Pol II [87, 88]. There are

several classes of elongation factors that have been identified. For example, SII

reactivates arrested Pol II by inducing the Pol II's endonucleolytic activity [89-92]. Pafl

associates with elongating Pol II to recruit histone-modifying activities [93].









The P-Globin Gene Locus

The human 3-globin genes are expressed in a developmental stage and tissue-

specific manner. Regulation of chromatin structure and stage-specific recruitment of

transcription complexes play imminent roles in the expression of the globin genes.

Location and Organization

The P-globin chains of hemoglobin are coded for by the P-globin gene locus

located on chromosome 11 p5.5 in humans and chromosome 7 in mice [94]. The human

P-globin locus contains five genes arranged in the order of their developmental

expression in erythroid cells (Figure 1-1) [95, 96]. At the 5' end is the e-globin gene,

which is expressed first during the embryonic stage in erythroid cells in the yolk sac.

Next are the YG- and yA-globin genes that are activated during the fetal stage when the site

of hematopoiesis switches from the embryonic yolk sac to the fetal liver. After birth, the

site of hematopoiesis undergoes a second switch to the bone marrow, coincident with the

expression of the 6- and P-globin genes.

The 6-globin gene is expressed in adults at less than 5% of the level of P-globin

expression. This is due to a mutation in the promoter that prevents high-level expression.

Also, there are two y-globin genes, which arose by gene duplication during evolution and

their sequences only differ at amino acid 136 [97].

Similar to the human 3-globin locus, the mouse P-globin locus has 4 genes whose

expression is switched during development (Figure 1-1). The sy and 3hl genes are

expressed during the embryonic stage of mouse development in the yolk sac. The pmaj

and pmin genes are expressed in fetal and adult mice in the fetal liver and later in the

bone marrow.









The globin genes are relatively small, with three coding exons and two introns

each. The exons of all P-like globin genes code for a total of 146 amino acids. These

exons correspond to the functional domains of the proteins [98, 99]. The introns are

between 117 bp to 1264 bp in size [100].

The entire locus is relatively sensitive to DNaseI in erythroid cells (the only cells

that express the P-globin genes), compared to its DNaseI insensitivity in non-erythroid

cells [101]. DNaseI sensitivity around the individual genes changes based on the

developmental stage, such that expressed genes reveal an increase in DNaseI sensitivity

[102]. Specific histone modification patterns have been detected in the P-globin gene

locus and distinguish active from inactive domains [103], suggesting that chromatin

remodeling activities play a role in the stage-specific transcription of the globin genes.

Locus Control Region

In both the human and mouse P-globin locus there is a prominent element located

from 6 to 22 kb upstream of the e-globin gene called the locus control region (LCR) [104,

105]. As seen in Figure 1-1, it contains 5 core regions that reveal extremely high

sensitivity to DNaseI in erythroid cells; these are called hypersensitive sites (HS1-5).

LCRs are defined by their ability to enhance expression of linked genes in a tissue-

specific, position-independent and copy number-dependent manner [106]. The P-globin

LCR is required for high-level expression of the genes in erythroid cells. It has been

speculated that one function of the LCR is to provide an open accessible chromatin

structure to the globin genes. However, removal of the human or mouse LCR does not

affect the overall DNaseI sensitivity of the locus [107-109]. Therefore, in the

endogenous locus the LCR does not appear to be responsible for generating a DNaseI









sensitive domain. However, it is feasible that the LCR regulates chromatin structure not

through setting up DNaseI sensitivity but through histone modifications and chromatin

remodeling [110]. This is further supported by data showing that P-globin constructs

without the LCR suffer from position-of-integration effects when integrated as transgenes

into heterochromatin, whereas P-globin constructs with the LCR do not suffer from these

position effects [111].

Human $-Globin Gene Locus


LCRHS5 4 3 2 1 e Gy Ay 8 p 3' HS1





Murine --Globin Gene Locus


LCR HS 5 4 3 2 1 Ey phl pmaj pmin 3' HS 1




Figure 1-1. The human and mouse P-globin loci. The 5' hypersensitive sites of the LCR
and the 3' hypersensitive sites are shown as blue boxes. The genes
expressed during the embryonic stage of development are shown as light
blue boxes. The genes expressed during the fetal stage of development are
shown as green boxes. The genes expressed during adulthood are shown as
yellow boxes. The genes expressed in both the fetal and adult stages are
shown as orange boxes. The locus as shown here is greater than 100 kb in
size and is not drawn to scale.

Stage-specific expression of the genes in the P-globin locus is dependent on their

order relative to the LCR [112, 113]. When the genes were reversed relative to the LCR

in transgenic mice the P-globin gene was expressed at the embryonic stage, whereas s-

globin expression was abolished [114]. It has been suggested that the genes in the locus

are competitively regulated, where only one gene from the locus can be transcribed at a









time [115, 116]. This has recently been hypothesized to be due to the fact that only one

active gene can interact with the LCR at a given time [117].

Evidence suggests that in tissues where P-globin genes are expressed the HS cores

interact to form an LCR holocomplex [20, 118-122]. Due to the high density of protein

binding sites within the HS cores of the LCR, there are many factors that interact with

these regions. The interactions of the proteins, not only with the HS cores but also with

other proteins in other cores, may be responsible for mediating the formation of the LCR

holocomplex. The HS core flanking regions contribute to the activity of the LCR and

may stabilize interactions between core elements [123].

Proteins Associated with the P-Globin Locus

GATA. The zinc finger proteins GATA-1 and GATA-2 are the only two members

of the GATA family of transcription factors that are known to be expressed in erythroid

cells [124]. GATA-1 is one of the first erythroid proteins expressed during red cell

differentiation and it is known to associate with proteins containing histone acetylase

activity [125]. This suggests that GATA-1 may be involved in the initial opening of the

chromatin in the P-globin locus. There are many GATA-binding sequences in LCR HS

sites and in the globin gene promoters. These sites can be bound by either GATA-1 or

GATA-2.

Maf and p45 proteins. Small maf proteins interact with p45 like proteins and bind

to MAREs (maf recognition elements) located within HS2, HS3 and HS4. Small maf

proteins contain DNA binding and protein-protein interaction domains but lack trans-

activation domains. They heterodimerize with the related proteins NF-E2 (p45), Bachl,

NRF1 or NRF2 [126-130] via the leucine zipper. The p45-like proteins are all









structurally different, and therefore may have varying functions. Studies suggest that p45

plays an important role in the function of the LCR and in transcription of the genes [127,

131, 132]. Maf/Bachl heterodimers have been shown to simultaneously bind HS2, HS3

and HS4 and bring these cores together in vitro. The interaction between Bachl

heterodimers is mediated by the BTB/Poz domain and deletion of this domain inhibited

HS site interactions in this assay [133, 134]. Bachl/maf heterodimers function as

transcriptional repressors, whereas p45/maf dimers activate transcription. Recent

evidence suggests that MAREs in the globin locus are first bound by Bachl heterodimers.

Heme mediates the dissociation of these dimers and thus allows the interaction of the

activator p45/maf to interact with regulatory elements [135].

EKLF. CACCC sequences, also known as KLF (kruppel like factor) binding sites

in HS2, HS3 and globin gene promoters are conserved across many species [136]. These

sites are bound by EKLF (erythroid kruppel like factor). EKLF is required for human 3-

globin gene expression and the formation of a DNaseI hypersensitive site in the P-globin

gene promoter [137-140]. This is due to the fact that EKLF binds to the P-globin gene

promoter and recruits chromatin remodeling factors, thus causing expression of the gene

[141]. Similarly, there is an EKLF binding site in the e-globin gene promoter, but at the

adult stage there are proteins bound at the F promoter that prevent EKLF binding and

therefore opening of the promoter for e-globin expression [142].

USF. An E-box, which is a CANNTG consensus sequence, located in HS2 is

known to interact with HLH (helix loop helix) proteins such as the USF (upstream

stimulatory factor) family of proteins and Tall [143, 144]. USF is a ubiquitously

expressed transcriptional activator and usually binds to DNA as a heterodimer consisting









of USF and USF2. USF can also help recruit RNA polymerase II (Pol II) transcription

complexes to initiator elements [145, 146]. Tall is an erythroid specific member of the

HLH family of proteins, which has been shown to function during the differentiation of

hematopoietic progenitor cells, and it has recently been shown to interact with TFIIH, a

member of the basal transcription complex [147, 148].

TFII-I. The transcription factor TFII-I binds to two separate elements. First is the

pyrimidine-rich initiator (Inr) element with a consensus of YYA+ NT/AYY located over

transcription start sites [149-151]. Second is the USF recognition site, the E-box. TFII-I

has a unique structure that allows for multiple protein-protein and protein-DNA

interactions [152]. At Inr and E-box elements TFII-I interacts both physically and

functionally with USF [152].

Model for P-Globin Gene Regulation

Our lab has proposed a multi-step model for human P-globin gene regulation

(Figure 1-2) [96]. The first step towards activating the globin genes involves generating

a highly accessible LCR holocomplex. Replication may or may not be required for this

region to become DNaseI sensitive. If this step is mediated by replication, then

erythroid-specific proteins may bind to the locus after replication to prevent the formation

of inaccessible chromatin domains and perhaps to also modify histone tails. It is known

that GATA-1 is one of the earliest markers of red cell differentiation [125] and associates

with histone acetyltransferases; therefore GATA factors may be involved in the first step

of obtaining an open chromatin structure. Other proteins such as NF-E2 may then bind

the LCR HS sites and bend or disturb the DNA structure, leading to a highly accessible

region.









The second step is the recruitment of chromatin-remodeling and transcription

complexes to the LCR. The proteins bound at the LCR holocomplex will recruit

chromatin remodeling complexes, coactivators, and RNA polymerase II. The recruitment

of Pol II may be mediated by HLH proteins, which are known to be involved in

transcription complex formation on several TATA-less genes [145, 146]. First 'pioneer'

RNA polymerases may associate with chromatin-remodeling activities to modify the

nucleosome structure in the locus [153]. Next, elongation incompetent polymerases may

be recruited to the LCR to be transferred to the gene promoters where they would become

phosphorylated at the C-terminal domain and be rendered elongation competent [154].

Step three is the establishment of chromatin domains permissive for transcription.

The globin locus has been separated into developmental stage-specific chromatin

domains based on changes in chromatin structure, DNaseI sensitivity, histone acetylation

patterns, and the presence of intergenic transcripts [102, 103, 155]. Intergenic transcripts

are non-coding transcripts found over the entire LCR and between the globin genes [102,

156]. Intergenic transcripts of the LCR initiate upstream of or within the LCR (for

example within HS2 [104]) and proceed towards the genes [102, 156, 157]. If the region

containing the site of initiation of adult-specific intergenic transcripts is deleted then

DNaseI sensitivity is decreased in that region and P-globin gene expression is decreased

[102]. If the before mentioned 'pioneer' polymerases associate with chromatin-

modifying factors then those complexes can initiate intergenic transcription and modify

the chromatin structure so as to create open chromatin domains [153].










A. Generslmn of a hiuehl arresible LCR hobomplen

DNmecIbud hntive d 111

I IATA-1, HATP
LCFUUS 5d 3 3*
ONMuel r sirE dakna
-CATA-1, EKLF. NF-2, HtIH prmsL .i'ntn
-trutan of HiS uopmek prm ncmprss am4
sm nerifn r if1 a it IoaL hmufer~naiust 4h




B, Rnclitnient orchromllin rEun nodaiL, rctiartr. ind iranscription completes
I I rmhalm remihrie ccln
SerlartVe ctalmpir rnmuripaCO tkmps
olmjnpk


"-tMn


C. Eitmihblhrnt orthrnsomr domaln permflu ite for t i sriplio


Embhroui


- krrk.l.I cr..eA ip
- I-WrK&MnrdpSI


Adull


DL Transfer or maromaleculmr proelin cDmplkxns to InIdr idnl Elobii rnc promot rs


Embryrmir


. chrielm mntik all pli

* ructivhir cneptkE


Adult


i- -\ -a


Multistep model for human P-globin gene regulation. The model proposes
four steps involved in the regulation of gene expression in the human 3-
globin locus. (A) Generation of a highly accessible LCR holocomplex. (B)
Recruitment of necessary complexes. (C) Establishment of chromatin
domains permissive for transcription. (D) Transfer of macromolecular
protein complexes to individual globin gene promoters.


The last step is the transfer of transcription complexes to the individual globin

genes. There are two feasible models of how this is accomplished. The first is the


Figure 1-2.









linking model, where complexes recruited to the LCR would be transferred to the genes

via proteins bound along the DNA [101, 115]. The looping model hypothesizes that the

LCR interacts with the individual genes by looping out intervening DNA [101, 115].

Recent evidence supporting the looping model within the P-globin locus and in other

parts of the genome came from results of experiments using the chromosome

conformation capture (3C) technique [117, 120, 158-162]. Results from our lab

demonstrating that Pol II, recruited to the LCR, can be loaded onto a downstream 3-

globin promoter is compatible with the looping model [132].

There are possibly many factors regulating which gene promoter the LCR transfers

transcription complexes to. Due to the complexity involved in transcriptional switching,

our model does not postulate what causes the signals for switching from embryonic to

fetal and fetal to adult.

Questions to Be Addressed

The P-globin gene locus is one of the most highly studied eukaryotic gene loci.

This is in part due to the prospects of developing gene therapy strategies for sickle cell

disease and P-thalassemia. The presence of the LCR also makes the P-globin locus a

good model system for studying long-range gene regulation. Though there is a large

body of knowledge about this gene locus, there are still many unanswered questions. It is

expected that resolving these problems will contribute to successful gene therapy trials as

well as to our understanding of long-range gene regulation.

The mechanism by which the LCR activates the genes remains to be determined.

We proposed a multi-step mechanism of LCR function leading to the activation of globin

gene expression in a developmental-stage specific manner [96]. To test this model, we









propose to determine the order of recruitment of transcription factors, Pol II and specific

histone modification marks to the locus during transcriptional activation.

The goals of this work were all related to addressing the mechanism of LCR-

mediated activation of the P-globin genes. The first goal was to develop and optimize

methods of investigating protein-DNA interactions within the P-globin locus in vivo and

in vitro. The next goal was to use these methods to compare and contrast the proteins and

complexes interacting with the LCR, active genes, and inactive genes within the locus.

The third goal was to use synchronized erythroid cells to analyze recruitment of

transcription factors and Pol II during replication. The next goal was to use an in vitro

system to investigate the mechanism of Pol II transfer from the LCR to the P-globin gene

promoter. The last goal was to elucidate the role of USF, TFII-I and HDAC3 in the

regulation of the 3-globin genes.














CHAPTER 2
MATERIALS AND METHODS

Cell Culture

All cell culture reagents were purchased from Cellgro. MEL cells were grown in

RPMI 1640 with L-glutamine supplemented with 10% fetal bovine serum and 1%

antibiotic-antimycotic (ABAM) in 5% CO2 at 370C. K562 cells were obtained from

ATCC, Coriell Repositories, and DSMZ. K562 cells were grown in RPMI 1640 with L-

glutamine supplemented with 15% fetal bovine serum and 1% penicillin-streptomycin in

5% CO2 at 370C.

Chromatin Immunoprecipitation (ChIP)

The ChIP assay was performed as described by Forsberg et al. [103] with minor

modifications. MEL and K562 cells (107 cells per antibody used) were grown in RPMI

medium. Crosslinking of proteins and DNAwas induced by incubating the cells in 1%

formaldehyde with rocking at room temperature for 10 minutes. The crosslinking was

quenched with 0.125 M glycine for 5 minutes. Cells were washed twice with cold lx

PBS with Complete protease inhibitors (Roche), resuspended in swelling buffer (5 mM

PIPES pH 8.0, 85 mM KC1, 0.5% NP-40, protease inhibitors) and incubated on ice for 10

minutes. The nuclei were pelleted by centrifugation for 5 minutes at 5000 rpm and 40C.

Nuclei were lysed by incubation in lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris-

HC1 pH 8.1, protease inhibitors) on ice for 10 minutes. DNA was sonicatedin an ice

water bath using a Fisher model 100 sonicator at power 5 for 4 pulses of 10 seconds to

yield an average size of -500 bp. After centrifugation for 10 minutes at 14000 rpm and









4C, the supernatant was diluted in dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2

mM EDTA, 167 mM Tris-HCl pH 8.1, 167 mM NaC1, protease inhibitors) to a final

volume of x ml where x = # of antibody samples needed. 50 pl of Protein A-Sepharose

beads (Amersham) per 107 cells used were added to the diluted lysate and incubated for 2

hours with rotation at 40C. The beads were pelleted and 5 pl of appropriate antibody was

added to each ml of aliquoted supernatant and incubated overnight with rotation at 40C.

The antibodies used were TFIIB sc-225, TFIID (TBP) sc-273, Pol II (N-20) sc-899, NF-

E2 (C-19) sc-291, USF2 (C-20) sc-862 (all purchased from Santa Cruz), phospho-Pol II

05-623 and acetyl-H3 06-599 (Upstate). All antibodies were tested in Western blotting

experiments using MEL or K562 nuclear extracts as described by Leach et al [163].

Protein A-Sepharose beads were blocked by resuspending them in blocking buffer (3%

BSA, 0.05% Na azide in 10 mM Tris-HCl pH 8.1, 1 mM EDTA) and incubated overnight

with rotation at 40C.

The next day, the samples were rotated for 2 hours at 40C with 60 ptl blocked

Protein A-Sepharose beads. The beads were pelleted and supernatants removed. 500 ptl

of the supernatant of the 'no antibody' sample was kept and labeled 'input'. The pelleted

beads were washed with low salt wash (0.1% SDS, 1% Triton X-100, 2 mM EDTA, 200

mM Tris-HCl pH 8.1, 150 mM NaC1), high saltwash (0.1% SDS 1% Triton X-100, 2

mM EDTA, 200 mM Tris-HCl pH 8.1, 500 mM NaC1), LiCl wash (0.25 M LiC1, 1% NP-

40, 1% Na deoxycholate, 1 mM EDTA, 100 mM Tris-HCl pH 8.1) and two washes with

TE pH 8. DNA was eluted off the beads with two volumes of 250 tl 1% SDS and 0.1 M

NaHCO3 at 65C for 15 minutes each. The eluates were pooled together and NaCl was

added to the eluates to a final concentration of 200 mM. Crosslinking was reversed by









incubation at 650C for 4 hours. RNA was digested by incubation with 40 pg/ml RNase

cocktail for 30 minutes at 370C. Proteins were then digested with 40 .g/ml proteinase K

in 10 mM EDTA, 40 mM Tris-HCl pH 6.5 at 370C for 1 hour. DNA was purified using a

purification kit (Qiagen) and eluted in 100 [l TE pH 7.4. 2.5 pl DNA was used as a

template for PCR with 50 pM primers and 10 pl PCR mix (Eppendorf) in a total volume

of 25 pl. Primer pairs were used against all areas of interest (Table 2-1). Primers for the

human y-globin genes were published by Schreiber et al [164].

Table 2-1. Names and sequences of primer pairs used for ChIP


Primers


Sequence


Human e-globin

Human 3-globin

Human HS2

Human y-globin

Human HS2 5' flank

Human Necdin

Mouse pmaj-globin

Mouse sy-globin

Mouse HS2

Mouse HS2 5'flank

Mouse necdin


US 5' GCTCCTTTATATGAGGCTTTCTTGG 3'


DS 5'
US 5'
DS5'
US 5'
DS 5'
US 5'
DS 5'
US 5'
DS 5'
US 5'
DS5'
US 5'
DS 5'
US 5'
DS 5'
US 5'


AATGCACCATGATGCCAGG 3'
TATCTTAGAG GGAGGGCTGAGGGTTTG 3'
CCAACTTCATCCACGTTCACCTTGC3'
TGTGTGTCTCCATTAGTGACCTCCC 3'
TTTTGCCATCTGCCCTGTAAGC 3'
CTCAATGCAAATATCTGTCTG 3'
TCTGGACTAGGAGCTTATTG 3'
TGGGGACTCGAAAATCAAAG 3'
AGTAAGAAGCAAGGGCCACA 3'
GTGTTATGTGCGTGCAAACC 3'
CTCTTCCCGGGTTTCTTCTC 3'
TAATTTGTCAGTAGTTTAAGGTTGC 3'
CAT TGTTCACAGGCAAGAGCAGG
CAAAGAGAGTTTTTGTTGAAGGAGGAG 3'
AAAGTTCACCATGATGGCAAGTCTGG 3'
TTCCTACACATTAACGAGCCTCTGC 3'


DS 5'AACATCTGGCCACACACCCTAAGC 3'
US 5' CTATTTGCTAACAGTCTGACAATAGAGTAG 3'
DS 5'GTTACATATGCAGCTAAAGCCACAAATC 3'
US 5'TTTACATAAGCCTAGTGGTACCCTTCC 3'
DS 5'ATCGCTGTCCTGCATCTCACAGTCG 3'


Titration of cycle numbers was performed with the different primer pairs to

determine the range of linear amplification. After the optimal number of PCR cycles,

DNA was run in 5% TBE polyacrylamide gels. The gels were stained with SyBr-green









and analyzed by fluorescence scanning on a Storm scanner. Quantitations were

performed using ImageQuant.

Chromatin Immunoprecipitation and DMS Footprinting

ChIP was performed as described above with the following modifications.

Approximately 3.33 x 107 MEL cells were collected per antibody to be used.

Crosslinking was induced by adding 1% (v/v) formaldehyde and incubation for 10

minutes at room temperature on a shaker. After stopping the crosslinking reaction by

adding 0.125 M glycine and incubation for 5 minutes (with shaking at room temperature),

the cells were pelleted at 2000 rpm. The cells were then washed twice in 25 ml ice-cold

phosphate-buffered saline (PBS) including protease inhibitors. Nuclei were isolated by

resuspending the cell pellet in 1 ml ice-cold swelling buffer (5 mM PIPES pH 8.0, 85 mM

KC1, 0.5% NP-40, and protease inhibitors), split into two aliquots and incubated on ice

for 10 minutes.

Chromatin was fragmented by subjecting the nuclei to restriction enzyme digestion

with 200 U PstI for 4 hours at 370C and 100 U PstI for an additional 16 hours at 370C.

The nuclei were then incubated with 200 URNase cocktail (Ambion) and an additional

100 U aliquot of Pstlfor 2 hours at 370C. Nuclei were pelleted at 40C for 5 minutes at

5000 rpm and lysed in 1 ml lysis buffer (1% SDS, 10 mMEDTA and 50 mM Tris-HCl

pH 8.1, protease inhibitors) on ice for 20 minutes. Restriction enzyme digestion was

verified by electrophoresis on a 2% agarose gel followed by Southern blotting using a

radioactive probe hybridizing to the human P-globin gene.

The lysate was combined and transferred to a 15 ml conical tube and diluted with 9

ml dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 16.7 mM Tris-HCl









pH 8.1, 167 mM NaCl and protease inhibitors). An aliquot of 500 [l protein A-

Sepharose beads (Amersham) was added to the diluted nuclear lysate and incubated for 2

hours at40C while rotating. The beads were pelleted for 10 minutes at 2000 rpm and the

supernatant was divided into three aliquots. An aliquot of 25 [il of the appropriate

antibody (USF 1 sc-229 or NF-E2 sc-291; Santa Cruz Biotechnology) or no antibody was

added to the aliquoted supernatant and incubated at 40C overnight while rotating. Protein

A-Sepharose beads were blocked overnight rotating at 40C in a 1:1 ratio of beads to

blocking buffer [3% BSA and 0.05% sodium azide in lx TE (10 mM Tris-HCl pH 8.1, 1

mM EDTA)].

The chromatin was then immunoprecipitated with 600 pl blocked protein A-

Sepharose beads for 2 hours at 40C on a rotator. The immunoprecipitates were pelleted at

13000 rpm for 30 seconds and 1 ml of the no antibody supernatant was saved and labeled

as 'input'. Half of the input chromatin was ethanol precipitated and resuspended in two

aliquots of 20 pl ddH20 and 800 pl DMS buffer (50 mM sodium cacodylate, 1 mM

EDTA) and the other half was saved for the ChIP PCR analysis. The supernatants of the

samples precipitated with USF1 and NF-E2 antibodies were discarded and the pellets

were washed by rotating at 40C for 5 minutes with 1 ml each of low salt wash (0.1% SDS,

1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl pH 8.1, 150 mM NaC1), high salt wash

(0.1% SDS, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl pH 8.1, 500 mM NaC1),

LiClwash (0.25 M LiC1, 1% NP-40, 1% sodium deoxycholate, 1 mMEDTA, 10 mM

Tris-HCl pH 8.1) and twice with lx TE pH 8. Of the immunoprecipitates, 80% was

resuspended in 800 pl DMS buffer and 20% was left in TE buffer for the ChIP/PCR

analysis.









DMS Treatment

DMS treatment of the immunoprecipitated chromatin was performed using the

Maxam and Gilbert guanine-specific sequencing reaction with 0.1% DMS for 15, 45 or

90 seconds at room temperature [165]. The reaction was stopped by adding 50 il DMS

stop buffer (1.5 M sodium acetate pH 7.0, 1 M 2-mercaptoethanol), followed by two

ethanol precipitations in a dry ice bath. The DMS-treated and non-DMS-treated

chromatin was then eluted from the beads by incubating twice with 250 Cl elution buffer

(1% SDS, 0.1 M NaHCO3), shaking at 950 rpm for 15 minutes at 650C, each time saving

the supernatant. An aliquot of 200 mM NaCl was added to the eluates and crosslinking

was reversed by incubation at 650C for 5 hours. Proteins were digested with 40 pg/ml

proteinase K in 10 mM EDTA and 40 mM Tris pH 6.5 for 1 hour at 370C.

Immunoprecipitated DNA was purified using a Qiagen kit and eluted with 180 pl ddH2O.

To cleave the DMS-treated DNA, 20 pl piperidine were added and incubated at 950C for

30 minutes. The DNA was washed twice by adding 1 ml ddH20, dried in a Speed Vac

and resuspended in 50 dl lx TE. Of the DMS-treated immunoprecipitated DNA, 10%

was used for ligation-mediated PCR (LMPCR)-assisted in vivo footprinting. An aliquot

of the precipitated DNA was also analyzed by PCR using primers specific for the murine

P-globin downstream promoter region (forward primer, 5'-

GACAAACATTATTCAGAGGGAGTACCC; reverse primer, 5'-

AGGTGCACCATGATGTCTGTTTCTGG) using a protocol previously published by

Forsberg et al [131].

Linker LMPCR

LMPCR was essentially performed as described by Hornstra and Yang [166] with

the following modifications. Approximately 2 [g DMS-treated genomic DNA or 10%









immunoprecipitated DNA was annealed to 0.6 pmol gene-specific primer (MPA 1) by

denaturing at 960C for 10 minutes followed by annealing at 470C for 30 minutes in a 15

pl solution of lx Vent buffer (10 mM Tris-HCl pH 8.9 and 40 mM NaC1). Primer

extension was performed by adding a 15 pl solution of 10 mM Tris-HCl pH 8.9, 40 mM

NaC1, 0.5 mM dNTPs and 2 U Vent polymerase (New England Biolabs) and incubating

at 53C for 1 minute, 55C for 1 minute, 57C for 1 minute, 600C for 1 minute, 620C for

1 minute, 66C for 1 minute, 680C for 3 minutes and 76C for 3 minutes. A 20 il

dilution solution (110 mM Tris-HCl pH 7.5, 18 mM MgC12, 50 mM DTT, 0.0125%

BSA) was then added to the extension reaction.

Blunt-end ligation was performed by adding a 25 pl solution of 100 pmol

asymmetric double-stranded linker, 10 mM MgC12, 20 mM DTT, 3 mM ATP, 0.005%

BSA and 4.5 U T4 ligase (Ambion) to the reaction and incubating at 170C overnight. The

ligation products were purified by standard phenol/chloroform extractions and ethanol

precipitation including 10 pg/pl tRNA. The ligated DNA was resuspended in 20 pl

ddH20 and added to 80 il PCR mix [10 mM Tris-HCl pH 8.9, 40 mM NaC1, 3 mM

MgC12, 0.25 mM dNTPs, 20 pmol gene-specific PCRprimer (MPA 3), 20 pmol linker

primer 2 and 0.5 U Taq polymerase; Gibco BRL]. This PCR mixture was initially

denatured at 950C for 5 minutes and then subjected to 20 cycles of PCR under the

following conditions: 95C for 20 seconds, 65C for 1 minute, 720C for 1 minute with an

increase of 5 seconds/cycle and an additional 5 cycles of 95C for 20 seconds, 65C for 1

minute, 720C for 2 minutes 30 seconds, followed by a final extension at 720C for 15

minutes. The PCR products were purified by phenol/chloroform extraction and ethanol

precipitation and resuspended in 30 ul ddH20. Initially, 3 ll of the PCR products were









size-fractionated on a 0.4 mm thick 5% polyacrylamide gel made with 8 .g/ml

ammonium persulfate, then electrotransfered for 30 minutes to a nylon membrane

(Hybond N+; Amersham).

Radiolabeled probes were synthesized using the Prime-a-Probe kit (Ambion) from a

gel-purified PCR product (PCR primers: P-maj FWD, 5'-

GACAAACATTATTCAGAGGGAGTACCC-3'; MPB 1, 5'-

TCTGTCTCCAAGCACCCAA-3') containing the region of interest. To radiolabel the

probe, 150 ng template DNA was mixed with 0.3 pg gene-specific primer (MPA 3), used

in the PCR step of the LMPCR protocol, and brought up to 8 pl in ddH20. This primer

plus template mixture was denatured at 950C for 10 minutes and immediately placed on

dry ice to snap freeze. Then 5 il of 5x Decaprime buffer containing dATP, dGTP and

dTTP (Ambion) was incubated with 10 pl [a-32P] dCTP (3000 Ci/mmol) and 1 U/pl

Klenow fragment at 370C for 30 minutes. The reaction was quenched on ice and stopped

by adding 35 il formamide loading dye.

The probe was denatured at 950C for 10 minutes and purified on a 5% denaturing

polyacrylamide gel. After exposing the gel to film (Type 57; Polaroid) the probe was cut

out of the gel, crushed and soaked in 4 ml hybridization buffer (250 mMNa2PO4 pH 7.2,

7% SDS, 1% BSA). The probe was hybridized to the blots at 650C overnight. The blots

were washed three times at 650C in washing solution (20 mM Na2PO4 pH 7.2, 1% SDS)

and visualized by autoradiography. The following primers were used for LMPCR: MPA

1, 5'-ATGTCCAGGGAGAAATATCG-3'; MPA 3, 5'-

TGAAGGGCCAATCTGCTCACACAGG-3'.









Western Blotting

To 19 parts Laemmli sample buffer (Bio-Rad) was added 1 part P-mercaptoethanol.

2 volumes of this buffer were added to each nuclear protein extract or whole cell extract

and the mixture heated at 950C for 10 minutes. 25 [tl of each sample was loaded on a

10% Tris-HCl Ready Gel (Bio-Rad) and run at 150V in cold tank buffer (25 mM Tris, 192

mM glycine, 0.1% SDS) until the dye reached the bottom. The gel, membrane (Bio-Rad),

filter paper (Bio-Rad), and fiber pads (Bio-Rad Mini Protean apparatus) were soaked in

cold transfer buffer (10 mM NaHCO3, 3 mM NaCO3, and 20% methanol, pH 9.9) for 15

minutes and then set up in a transfer sandwich with a fiber pad, filter paper, the gel,

membrane, filter paper, and fiber pad. The transfer was run overnight at 30V at 40C with

constant stirring in the Mini Protean apparatus (Bio-Rad).

The transfer was disassembled and the membrane was stained with Fast Green for 5

minutes and washed twice in destain solution (50% methanol, 10% acetic acid). It was

then rinsed in TBS-Tween (30 mM Tris, 150 mM NaC1, 0.1% Tween 20, pH 7.6) and

blocked 1 hour in 5% milk in TBS-Tween shaking at room temperature. The membrane

was rinsed twice in TBS-Tween, washed once in TBS-Tween for 15 minutes while

shaking at room temperature, and washed twice for 5 minutes in TBS-Tween while

shaking at room temperature. It was incubated 1 hour in 10 ml 5% milk in TBS-Tween

containing 1:500 anti-HDAC3 while shaking at room temperature. The membrane was

rinsed twice in TBS-Tween, washed once in TBS-Tween for 15 minutes while shaking at

room temperature, and washed twice for 5 minutes in TBS-Tween while shaking at room

temperature. It was incubated 1 hour in 15 ml 5% milk in TBS-Tween containing

1:50000 anti-rabbit while shaking at room temperature. The membrane was rinsed twice









in TBS-Tween, washed once in TBS-Tween for 15 minutes while shaking at room

temperature, and washed twice for 5 minutes in TBS-Tween while shaking at room

temperature. ECL reagents (Amersham) were mixed according to the manufacturer's

recommendations and added to the membrane. The membrane was then exposed to

Kodak MS film for varying times.

Cell Synchronization

K562 cells were synchronized at the border of G1 and S phase by incubating the

cells with complete growth medium in the presence of 2 mM thymidine for 17 hours,

washing twice with complete medium, incubating in complete medium for 12 hours and

blocking the cells in complete medium with 2 mM thymidine for another 17 hours [167,

168]. Blocked cells were fixed with ethanol, digested with RNase, stained with

propidium iodide and subjected to flow cytometry to verify synchronization. Blocked

cells were taken as "time 0" and subjected to ChIP and PCR analysis. The blocked cells

were then washed twice with complete medium to release them from the block and

allowed to grow in complete medium. Cells were taken for flow cytometry, ChIP, and

PCR analysis at specific time points after release from the arrest.

PCR-Based DNA Replication Analysis

DNA Isolation

Added to lysis solution (50 mM KC1, 10 mM Tris-HCl pH 8, 1.25 mM MgCl2,

0.45% NP-40, 0.45% Tween 20) was 75 [tl of 10mg/ml proteinase K per ml oflysis

solution (added fresh every time). Synchronized cells were counted and 106 cells were

collected, washed with lx PBS and resuspended in 100 [tl lysis solution per 105 cells.

The cells were incubated in the lysis solution overnight. The next day, 500 [tl phenol was









added and vortexed for 1 minute. The reaction was centrifuged for 5 minutes at 14000

rpm and room temperature. Then 500 [tl phenol/chloroform/isoamyl alcohol was added

to the supernatant and it was vortexed for 1 minute. The samples were centrifuged for 5

minutes at 14000 rpm and room temperature. Then, 500 [tl chloroform/isoamyl alcohol

was added to the supernatant, the reaction was vortexed for 1 minute and centrifuged for

5 minutes at 14000 rpm and room temperature. Next 100% ethanol was added to the

supernatant, incubated for 15 minutes at room temperature, and centrifuged 30 minutes at

14000 rpm and room temperature. The supernatant was discarded and 500 [tl of 70%

ethanol was added to the pellet. The sample was centrifuged for 10 minutes at 14000

rpm and room temperature. The supernatant was removed and the pellet allowed to air

dry. The pellet was then resuspended in 50 [tl TE pH 7.4. 1 [tl RNase was added and it

was incubated for 30 minutes in a 370C water bath. The DNA was used for PCR and the

rest stored at -200C.

Semi-Quantitative PCR

2.5 pl DNA was used as a template for PCR with 50 pM primers and 10 tl PCR

mix (Eppendorf) in a total volume of 25 [il. Primer pairs were used against the human E-

globin, human necdin, mouse pmaj-globin and mouse necdin, as described in Table 2-1.

PCR was performed with cycle numbers 18, 20, 22, 24, 26, 28, and 30. DNA was run in

5% TBE polyacrylamide gels. The gels were stained with SyBr-green and analyzed by

fluorescence scanning on a Storm scanner. Quantitations were performed using

ImageQuant. The ratios of human e-globin to human necdin and mouse pmaj-globin to

mouse necdin were calculated for samples from all time points at a cycle number within

the linear range.









In Vitro Polymerase Transfer Analysis

A plasmid containing the wild-type human 3-globin LCR was linearized and

immobilized on streptavidin coated magnetic beads as described by Leach et al [169].

The immobilized LCR (200 ng) was incubated for 30 minutes at 300C with 50 tg MEL

nuclear protein extract (10 itl) and 15 [tl 2x binding buffer (36 mM HEPES, pH 7.9, 160

mM KC1, 40 mM MgC12, 4 mM DTT, 10 mM PMSF, 20% glycerol) in a total volume of

100 ptl. The tubes were placed on a magnet, the supernatant removed, and the beads were

washed three times with lx binding buffer. The beads were then resuspended in lx

binding buffer and incubated for 10 minutes at 300C in the presence or absence of 50 ng

of the plasmid pRS3A/X containing the wild-type or mutant P-globin gene [163]. The

supernatants were removed and samples containing the wild type or mutant P-globin gene

were crosslinked by incubation for 10 minutes in 0.5 % formaldehyde at RT. The

crosslinking reaction was stopped by the addition of 0.125 M glycine and incubation for

5 minutes at RT. The supernatant of reactions not containing the P-globin gene were

incubated for 10 minutes at 300C in the presence of pRS3A/X, after which these samples

were crosslinked as well. All samples were dialyzed against ChIP dilution buffer and

subjected to immunoprecipitation using Pol II specific antibodies and PCR analysis as

described by Leach et al [163]. In some experiments recombinant NF-E2 [163] or BSA

(0.3 [tg/jtl) was added to the transfer reactions. The plasmid Pmaxi was used as a positive

control for the PCR and was generated by lighting an 800 bp Pmll restriction fragment

from the human LCR into the Pmll site of pRS 3A/X. The P-globin PCR primers span the

Pmll site present in the P-globin gene thus generating a PCR product that is 800 bp larger

than the PCR product from the wild type P-globin gene. The TK-HGH plasmid contains









the human growth hormone gene under the control of the Herpes Simplex Virus

thymidine kinase promoter [163]. The HS2 plasmid contains the HS2 core plus flanking

sequence as previously described [122]. The following primers were used in these

experiments: P-globin US: 5' CCTGAGGAGAAGTCTGCCGTTACTG 3' and DS: 5'

TCCTATGACATGAACTTAACCATAG 3'; TK-HGH: US: 5'

GGAGGCTGGAAGATGGCA 3'; DS: 5' AGTAGTGCGTCATCGTTGTGTG 3';

human HS2: as described in Table 2-1.

MEL Cell DMSO Differentiation

MEL cells were incubated in RPMI 1640 with L-glutamine supplemented with

10% fetal bovine serum, 1% antibiotic-antimycotic (ABAM) and 1% DMSO in 5% CO2

at 37C for three days. RNA was isolated from the cells for semi-quantitative RT-PCR.

Semi-Quantitative RT-PCR

RNA was isolated for RT-PCR using an RNA Isolation Kit (Gentra) according to

the manufacturer's protocol. Reverse Transcription was performed using 200 to 250 ng

RNA and the first strand cDNA synthesis Kit (Bio-Rad) as described by the

manufacturers protocol. PCR amplification was performed using PCR Mastermix from

Eppendorf and primer sequences specific for the murine P-globin and P-actin gene with

15 and 16 cycles as indicated. The mouse P-actin primers used were: US 5'

GGACGACATGGAGAAGAT 3' and DS 5' ATCTCCTGCTCGAAGTCT 3'. The

mouse P-globin primers used were: US 5' AAAGGTGAACTCCGATGAAGTTGG 3'

and DS 5' TTCTGGAAGGCAGCCTGTGC 3'. After electrophoresis the gels were

stained with SyBr Green, scanned using a storm scanner, and quantitated with Image

Quant.









Double Immunoprecipitation

Approximately 2 x 107 K562 cells were collected per immunoprecipitate reaction.

The cells were incubated in 1% formaldehyde with rocking at room temperature for 10

minutes to induce crosslinking. Crosslinking was quenched with 0.125 M glycine for 5

minutes shaking at room temperature. Cells were washed twice with cold lx PBS with

Complete Protease Inhibitors (Roche), resuspended in swelling buffer (5 mM PIPES pH

8.0, 85 mM KC1, 0.5% NP-40, protease inhibitors), and incubated on ice for 10 minutes.

Nuclei were pelleted by centrifugation for 5 minutes at 5000 rpm and 40C. Nuclei were

lysed by resuspending in lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl pH 8.1,

protease inhibitors) and incubating on ice for 10 minutes. DNA was sonicated in an ice

water bath using a Fisher model 100 sonicator at power 5 with 5 pulses of 10 seconds

each with 1 minute cooling in between, to yield an average size of -500 bp. The sample

was then centrifuged for 10 minutes at 14000 rpm and 40C. The supernatant was diluted

in dilution buffer (0.01% SDS, 1.1% Triton X-100, 1.2 mM EDTA, 167 mM Tris-HCl

pH 8.1, 167 mM NaC1, protease inhibitors) to a final volume ofx ml where x = # of

antibody samples needed. Then 50 pl of Protein A-Sepharose beads (Amersham) per 2 x

107 cells used were added to the diluted lysate and incubated for 2 hours with rotation at

4C. The beads were pelleted and 5 il of appropriate antibody was added to each ml of

aliquoted supernatant and incubated overnight with rotation at 40C. The antibodies used

were

TFII-I (a gift from R. Roeder, Rockefeller University) and HDAC3 (a gift from E. Seto,

University of South Florida). Protein A-Sepharose beads were blocked by resuspension









in blocking buffer (3% BSA, 0.05% Na azide in 10 mM Tris-HC1 pH 8.1, 1 mM EDTA)

and incubated overnight with rotation at 40C.

The next day, the samples were rotated for 2 hours at 40C with 60 pl blocked

Protein A-Sepharose beads. The beads were pelleted and supernatants removed. Then

500 pl of the supernatant of the 'no antibody' sample was kept and labeled 'input'. The

pelleted beads were washed with low salt wash (0.1% SDS, 1% Triton X-100, 2 mM

EDTA, 200 mM Tris-HCl pH 8.1, 150 mM NaC1), high salt wash (0.1% SDS 1% Triton

X-100, 2 mM EDTA, 200 mM Tris-HC1 pH 8.1, 500 mM NaC1), LiCl wash (0.25 M

LiC1, 1% NP-40, 1% Nadeoxycholate, 1 mM EDTA, 100 mM Tris-HCl pH 8.1) and two

washes with TE pH 8. DNA was eluted off the beads with two 250 ll 1% SDS and 0.1 M

NaHCO3 washes at 650C for 15 minutes each shaking at 950 rpm. The two elutions were

pooled together and then dialyzed against 200 ml of dilution buffer with Complete Mini

protease inhibitors using Slide-A-Lyzer Mini Dialysis units (Pierce) at 40C with constant

stirring for 2 hours. After samples were taken out of dialysis units and placed in 1.5 ml

tubes, 500 [tl dilution buffer was added to each. For the second immunoprecipitation 5 dtl

of antibody was added to each and incubated overnight at 40C rotating. Protein A-

Sepharose beads were blocked by resuspending them in blocking buffer and incubated

overnight with rotation at 40C.

The next day, the samples were rotated for 2 hours at 40C with 60 pl blocked

Protein A-Sepharose beads. The beads were pelleted and supernatants removed. The

pelleted beads were washed with low salt wash, high salt wash, LiCl wash and two

washes with TE pH 8. DNA was eluted off the beads with two 250 pll 1% SDS and 0.1 M

NaHCO3 washes shaking at 650C for 15 minutes each. The two elutions were pooled









together and NaC1 was added to the eluates to a final concentration of 200 mM and

crosslinking was reversed by incubation at 650C for 4 hours. RNA was digested by

incubation with 40 pg/ml RNase cocktail (Ambion) for 30 minutes at 370C. Proteins

were then digested with 40 pg/ml proteinase K in 10 mM EDTA, 40 mM Tris-HCl pH

6.5 at 370C for 1 hour. DNA was purified using a column purification kit (Qiagen) and

eluted in 100 pl TE pH 7.4. Then 2.5 pl DNA was used as a template for PCR with 50

pM primers and 10 pl PCR mix (Eppendorf) in a total volume of 25 il. The human 3-

globin, e-globin and HS2&3 linker primer pairs were used for PCR (see Table 2-1). PCR

was performed for 28 cycles, and DNA was run in a 5% TBE polyacrylamide gel. The

gels were stained with SyBr-green and analyzed by fluorescence scanning on a Storm

scanner.

Co-Immunoprecipitation

107 K562 cells were collected per immunoprecipitate reaction. Cells were washed

twice with cold lx PBS with Complete protease inhibitors (Roche), resuspended in

swelling buffer (5 mM PIPES pH 8.0, 85 mM KC1, 0.5% NP-40, protease inhibitors) and

incubated on ice for 10 minutes. Nuclei were pelleted by centrifugation for 5 minutes at

5000 rpm and 40C. Nuclei were lysed by resuspending in lysis buffer (1% SDS, 10 mM

EDTA, 50 mM Tris-HCl pH 8.1, protease inhibitors) and incubating on ice for 10

minutes. DNA was sonicated in an ice water bath with a Fisher model 100 sonicator at

power 5 with 5 pulses of 10 seconds each with 1 minute cooling in between, to yield an

average size of -500 bp. The samples were then centrifuged for 10 minutes at 14000 rpm

and 40C. The supernatant was diluted in dilution buffer (0.01% SDS, 1.1% Triton X-100,

1.2 mM EDTA, 167 mM Tris-HCl pH 8.1, 167 mM NaC1, protease inhibitors) to a final









volume of x ml where x = # of antibody samples needed. 50 pl of Protein A-Sepharose

beads (Amersham) per 107 cells used were added to the diluted lysate and incubated for 2

hours with rotation at 40C. The beads were pelleted and 5 pl of appropriate antibody was

added to the aliquoted supernatant and incubated overnight with rotation at 40C. The

antibodies used were USF1 sc-229, USF2 sc-862, Pol II sc-899 (all from Santa Cruz)

TFII-I (a gift from R. Roeder, Rockefeller University) and HDAC3 (a gift from E. Seto,

University of South Florida). Protein A-Sepharose beads were blocked by resuspension

in blocking buffer (3% BSA, 0.05% Na azide in 10 mM Tris-HCl pH 8.1, 1 mM EDTA)

and incubation overnight with rotation at 40C.

The next day, the samples were rotated for 2 hours at 40C with 60 pl blocked

Protein A-Sepharose beads. The beads were pelleted and supernatants removed. The

pelleted beads were washed with low salt wash (0.1% SDS, 1% Triton X-100, 2 mM

EDTA, 200 mM Tris-HCl pH 8.1, 150 mM NaC1), high salt wash (0.1% SDS 1% Triton

X-100, 2 mM EDTA, 200 mM Tris-HC1 pH 8.1, 500 mM NaC1), LiCl wash (0.25 M

LiC1, 1% NP-40, 1% Nadeoxycholate, 1 mM EDTA, 100 mM Tris-HCl pH 8.1) and two

washes with TE pH 8. DNA was eluted off the beads with two 250 pl 1% SDS and 0.1 M

NaHCO3 washes shaking at 650C for 15 minutes each. The two elutions were pooled

together and concentrated in the Speed Vac for about 1 hour. The samples were then

subjected to Western blotting procedures as described above.














CHAPTER 3
CHROMATIN IMMUNOPRECIPITATION AND DMS FOOTPRINTING

Introduction

Transcription in eukaryotes is a complex process involving the binding of proteins

to the promoter, recruitment of transcription complexes, initiation, elongation and

termination [170]. This process is dynamic and controlled at each step by proteins that

bind to the DNA, to the RNA polymerase holocomplex, or both. Although knowledge

about transcription complex formation in vitro is extensive, the mechanisms leading to

transcription in the context of higher order chromatin in vivo are not understood in detail.

Many nuclear processes including transcription, DNA replication, homologous

recombination, DNA repair, and others are regulated by proteins that interact with

specific DNA sequences or structures in the context of chromatin. Therefore, there is a

great demand for new and better techniques to investigate protein-DNA interactions. A

number of techniques are available to study the interaction of proteins with specific

segments of DNA in vivo; each of these techniques has distinct limitations [166, 171-

174].

Chromatin immunoprecipitation (ChIP) is a powerful method to analyze the

interaction of proteins with specific chromatin regions in vivo [171, 172]. This technique

involves crosslinking protein-DNA and protein-protein interactions in live cells, followed

by immunoprecipitation of the lysed nuclear contents to isolate segments of DNA that are

bound to the protein of interest in vivo. Combined with PCR, the ChIP assay is very

sensitive in detecting proteins that crosslink to a specific region in chromatin. There are









at least two limitations of the ChIP assay. First, ChIP does not provide information

regarding the specific sequence a protein interacts with in vivo. The size of the ChIP

fragments is on average 500bp, so the corresponding binding site for a specific protein

can be within a region of up to 1 kb of DNA. Second, ChIP does not reveal whether a

protein directly binds to the DNA or is recruited to DNA by protein/protein interactions.

Another method commonly used to examine the interaction of proteins and DNA is

in vivo footprinting [166, 173, 174]. In footprinting experiments enzymes like DNaseI or

chemicals like DMS/piperidine are used to cleave the DNA. Nucleotides that are bound

by proteins are normally protected from cleavage. The cleavage pattern can be visualized

either directly or after PCR using electrophoresis in combination with radioactive

labeling techniques and autoradiography. The limitation of in vivo footprinting is that it

does not reveal what the protein is that is causing the protection of particular bases.

Another problem with the in vivo footprinting technique is that it fails to provide clear

results in situations where a protein is bound in a sequence-specific manner in only a

small fraction of cells, in other words, if the protein-DNA interaction is transient.

We have combined the ChIP and in vivo footprinting techniques and developed a

novel method for analyzing protein-DNA interactions in vivo. This new technique is

similar in concept to an in vitro protocol developed by Gallarda et al. [175]. These

authors used a monoclonal antibody-based DNaseI footprint selection technique, which

unambiguously identifies proteins responsible for particular footprints.

The technique we have developed here is aimed at analyzing sequence-specific

interactions of particular proteins in vivo. In the process of developing and optimizing the

technique, we have analyzed the interaction of proteins with the mouse P-globin









downstream promoter region in unsynchronized MEL (mouse erythroleukemia) cells.

We show that chromatin fragments precipitated with antibodies against USF 1 or NF-E2

reveal strikingly different footprint patterns on a specific P-globin gene promoter region.

The USF 1-selected templates show no footprint in this region, but the NF-E2-selected

fragments show a footprint at a non-consensus MARE. This result indicates that this

novel method will allow investigators to select specific templates for in vivo footprinting,

and determine exactly where their protein of interest binds.

Results

The developmental stage-specific expression of the human P-globin gene is

regulated primarily by transcription factors that interact with gene-proximal cis DNA

elements [95]. We have shown that USF1 and USF2 interact with a downstream promoter

element of the human 3-globin gene in vitro [163]. In the same study we have shown that

these proteins are crosslinked to the P-globin gene in erythroid cells in vivo. In addition,

data published by Sawado et al. [176], as well as our own experiments revealed that NF-

E2 can be crosslinked to the P-globin gene in vivo. The crosslinking of NF-E2 to the

globin promoter is somewhat surprising as there is no consensus DNA-binding site in the

globin gene. However, a sequence located downstream of the transcription start site

reveals partial homology to the NF-E2 consensus element, also referred to as the MARE

(maf recognition element, Figure 3-1; [126, 177, 178]. The NF-E2 consensus sequence is

5'-TGCTGASTCAY-3' (S = G or C; Y = T or C; [178]). The sequence in the mouse P-

globin downstream promoter region differs in one position (the third) from the consensus

sequence. Conventional in vivo footprinting did not reveal significant protection of the

NF-E2-binding site in MEL cells (Figure 3-4, lanes 1 and 2). To analyze the possibility










that NF-E2 interacts with the P-globin downstream element in vivo in only a fraction of

erythroid cells, we have developed a novel method that combines the ChIP assay with

DMS footprinting.

Initiasor MARE/APl-like element
I I
H:ttgct*tcatttgcttctgacacaactg gttcactagcaacctcaaacaga
M:ctcctctcatttgcttctgacatagttgtgttgactcaacccccagaaaca
R: ctgcttgeacttgcttttgacacaact tgtttacttgcaatccccccaaaac

-* transcription


Figure 3-1. Sequence alignment of the adult P-globin downstream promoter region.
Shown are three sequences of the P-globin downstream promoter region
from human (H), mouse (M) and rabbit (R) [177]. The shaded box
highlights the position of the MARE/Ap -like sequence and the arrow
points to the transcription start site.

The procedure (outlined in Figure 3-2) involves the crosslinking of proteins and

DNA using formaldehyde (1%), followed by digestion of permeabilized nuclei with

restriction enzymes, precipitation with specific antibodies, treatment and cleavage of

precipitated chromatin restriction fragments with DMS and piperidine and analysis of the

cleavage pattern by LMPCR (for details see Materials and Methods Chapter).

Figure 3-3 shows that antibodies against USF1 and NF-E2 precipitate crosslinked

chromatin fragments containing the murine adult P-globin gene, as expected from

previous data [163, 176].

The subsequentDMS footprint of the precipitated chromatin fragments revealed

interesting characteristics of the precipitated fragments (Figure 3-4). First, the overall

footprint pattern of fragments selected with USF antibodies is different from those

precipitated withNF-E2 antibodies (compare Figure 3-4, lanes 3 and 4). This is










particularly obvious over the MARE-like sequence, which shows clear protection only in

templates selected by NF-E2 precipitation.









Crosslinkchromatin
Incubale with restriction enzyme X
Isolate chromatin



Precipitate with antibody
Specific for protein A Y


100
X X
x x
Treat with DMS
Reverse Crosalink
Treat with Piperidene
LMPCR




Figure 3-2. Analysis of protein-DNA interactions in the murine P-globin downstream
promoter region by a combination of chromatin immunoprecipitation and
DMS footprinting. Diagram outlining the experimental procedure for
footprinting ChIP-selected templates.

The difference in the cleavage pattern between the templates selected by USF or

NF-E2 antibodies could reflect the possibility that the proteins interact with the globin

gene at different stages of the transcription cycle. Alternatively, the results could reflect

the possibility that low occupancy of these sites would strongly reduce the probability of

selecting templates which have both proteins bound simultaneously. Second, the overall

footprint pattern of fragments precipitated with USF antibodies is similar to the pattern

found in unselected templates, whereas the footprint pattern for NF-E2-selected

fragments is different. This result suggests that only a small fraction of cells may have

NF-E2 bound at the 3-globin gene.



















1 2 3 4

Figure 3-3. ChIP experiment showing the interaction of USF 1 and NF-E2 with the
murine pmaj-globin promoter in MEL cells. MEL cells were grown under
standard conditions and crosslinked with formaldehyde. After
fragmentation, the chromatin was precipitated with no antibodies (lane 2),
antibodies against USF 1 (u.USF, lane 3) or antibodies against the p45
subunit of NF-E2 (ucNF-E2, lane 4). Lane 1 shows the PCR result of the
input, which serves as a positive control.

It is important to note that formaldehyde crosslinking does not appear to change the

cleavage pattern in the DNA region analyzed in these experiments; the overall pattern is

similar between untreated cells (Figure 3-4, lanes 1 and 2) and crosslinked cells (lanes 3

and 4). In addition, we found that incubation of genomic DNA with 1% formaldehyde

(with subsequent reversal of the crosslink) does not change the overall DMS cleavage

pattern in the DNA region that we have analyzed by LMPCR (data not shown).

Discussion

We examined the interaction of NF-E2 with the non-consensus MARE-binding site

in the downstream promoter region in detail using a novel in vivo method. The potential

sequence-specific interaction of NF-E2 with the 3-globin downstream promoter region is

interesting in light of the fact that Johnson et al. [179] previously showed that RNA

polymerase II is recruited to both the LCR and to the adult 3-globin gene and that the

transfer of the polymerase from the LCR to the globin gene depends on the presence of






44


NF-E2 (p45). In this respect it is possible that NF-E2 is part of the recruitment process

that mediates the interaction of RNA polymerase II with the P-globin promoter.


1


Figure 3-4.


Le







1 A.
A T

TTA

I A
A T

A T


wllm &

i .i A T







1 2 3 4 5


LMPCR footprint analysis of non-selected or ChIP-selected chromatin.
Chromatin was precipitated with USF or NF-E2 antibodies. The precipitates
were subjected to DMS footprinting (lane 3, USF-selected chromatin; lane
4, NF-E2-selected chromatin). In vivo footprinting was also performed on
MEL cells that were not treated with formaldehyde (lane 2). Lane 1 shows
the DMS/piperidine cleavage pattern in in vitro treated MEL genomic DNA.
Lane 5 shows the G-ladder of the P-globin downstream promoter region.
Indicated on the right are the positions of the initiator and MARE-like
sequences, as well as the start site and direction of transcription. Open
circles indicate protected G residues in NF-E2-selected chromatin.


Several methods are available to fragment crosslinked chromatin for ChIP,

including sonication, MNase digestion and restriction enzyme digestion [171, 172, 180,

181]. We reasoned that sonication or MNase digestion might fragment the chromatin in a


:1









way that not all of the resulting templates would be amplifiable by LMPCR and in

addition may result in a high background. We therefore chose to fragment the

crosslinked chromatin by restriction enzyme digestion [180]. The disadvantage in using

this method is that long incubation with the restriction enzyme allows endogenous

nucleases to attack the chromatin in accessible regions. In some of our experiments, we

observed inconsistent LMPCR banding patterns in ChIP-selected templates in the higher

molecular weight ranges (data not shown). This problem can be solved by incubating the

nuclei for shorter periods of time with higher concentrations of restriction enzyme [181]

or by following similar restriction digest protocols from other groups [182].

Another issue that has to be considered is the fact that the precipitation of

templates using ChIP results in different concentrations of templates. It is thus important

to perform a titration of the templates precipitated with different antibodies. Similarly,

we were unsure whether the steps of the ChIP assay leave the protein in a native structure

to give a true footprint in all cases tested. Though it could be postulated, that once a

footprint such as NF-E2 at an NF-E2 binding site has been observed that a similar

treatment will leave other proteins in a conformation that makes a footprint detectable.

Lastly, it was suggested that the antibody might remain bound and contribute to the

footprint observed. Therefore, to remove this possibility it would be possible to change

the elution buffer to one that is known for disrupting the antibody-antigen interactions,

such as the ImmunoPure Gentle Ag/Ab Elution Buffer available from Pierce

Biotechnology.














CHAPTER 4
INTERACTION OF RNA POLYMERASE II AND TRANSCRIPTION FACTORS
WITH THE P-GLOBIN LOCUS

Introduction

The five genes of the human 3-globin locus are expressed in erythroid cells in a

tissue- and developmental-stage specific manner [183]. Appropriate expression of the

globin genes is regulated by many DNA elements that are located proximal or distal to

the genes. The human P-globin locus control region (LCR) is a powerful regulatory

DNA element located far upstream of the genes and required for high-level expression of

all the globin genes throughout development [136, 183]. The LCR, unlike classical

enhancer elements, operates in an orientation dependent manner [114]. There is currently

no consensus on how the LCR acts to stimulate globin gene transcription but it is

generally believed that it involves some form of communication between the LCR and

the globin genes [101, 115, 184]. The LCR is composed of several regions that exhibit

extremely high sensitivity to DNaseI in erythroid cells (hypersensitive HS sites 1 to 5).

The core HS sites contain clusters of transcription factor binding sites and are separated

from each other by 2 to 4 kbp of DNA [136]. Results from analyzing human LCR

function at ectopic sites in the context of transgenic mice suggests that the HS sites

synergistically enhance globin gene transcription [19, 20, 119, 121-123], whereas studies

in the endogenous murine locus show that the core HS sites function additively [109, 185,

186].









Recent models view the LCR as a holocomplex in which the individual HS sites

interact via extensive protein-DNA and protein-protein interactions [118, 119, 134]. The

LCR holocomplex may provide a highly accessible region for the efficient recruitment of

macromolecular complexes involved in chromatin modification and transcription [96].

Indeed, it has been shown that RNA polymerase II (Pol II) transcription complexes are

recruited to LCR HS sites in vitro and in vivo [169, 187-189], suggesting that

transcription complexes are first recruited to the LCR and subsequently transferred to the

globin genes [96]. Sawado et al. [190] recently demonstrated that another important

function of the LCR is to regulate transcription elongation at the adult P-globin gene.

An interesting aspect of gene regulation is the question of how transcriptional

activity is maintained during the process of replication [191]. Activation of at least some

gene loci depends on replication, and it is possible that replication could provide a

window of opportunity for transcription factors to gain access to regulatory sequences

before repressive chromatin is formed.

Generally, transcriptionally active regions of the genome replicate early, whereas

repressed parts of the genome replicate late. A recent study showed that plasmids

injected into cells at different time points during replication adopt an open chromatin

conformation at earlier time points and a repressed conformation at later time points

suggesting that early replication favors the assembly of accessible chromatin, or that

accessible chromatin is replicated early [192]. Accordingly, the globin locus replicates

late in non-erythroid cells and early in cells expressing the globin genes. Transgenic

studies have shown that the timing of replication is regulated by the LCR [193], however,

this activity, like the chromatin opening activity, appears to be redundant in the









endogenous P-globin locus [194]. It is not known how or if replication affects the

association of transcription factors and Pol II with the globin locus.

Here, we analyzed the interaction of transcription complexes with the human and

murine P-globin loci in erythroid cells expressing either the human embryonic/fetal e-

and y-globin (K562 cells) or the murine adult P-globin genes (MEL cells) using

chromatin immunoprecipitation (ChIP).

Results

We began our studies by examining the interaction of various components of

transcription complexes and erythroid transcription factors with the P-globin gene locus

in murine and human erythroleukemia cell lines. Figure 4-1 shows a diagram of the

human and murine P-globin loci and the localization of primers used in the ChIP

experiments.

We used chromatin immunoprecipitation (ChIP) and PCR to analyze the interaction

of RNA Pol II (Pol II), TBP, TFIIB, NF-E2 (p45), and acetylated histone H3 with

different regions of the P-globin gene locus. As a negative control we also analyzed the

interaction of the proteins with the necdin gene, which is not active in erythroid cells.

NF-E2 is a hematopoietic specific transcription factor composed of a large (p45) and a

small (p 18) subunit [126] and known to interact with several sequences in the human and

murine P-globin loci [136, 195]. We investigated the interaction of these proteins in two

cell lines; a human erythroleukemia cell line (K562) expressing the embryonic s and fetal

y-globin genes but not the adult P-globin gene, and a murine erythroleukemia cell line

(MEL), in which the adult Pmaj- and pmin-globin genes are expressed but not the

embryonic sy and 3hl genes.









Human p-globin gene locus


LCR HS 5 4 3 2 1


E Gy Ay


hHS2 5'flank hHS2 he hy hy hp

Mouse p-globin gene locus

LCR HS 5 4 3 2 1 sy ph1 pmaj pmin


mHS2 5'flank mHS2 mEy mpmaj


Figure 4-1.


Diagrammatic representation of the human and murine P-globin gene locus.
The human 3-globin gene locus: the embryonic s-globin gene, the two fetal
y-globin genes, and the adult 6- and P-globin genes. The LCR is located
upstream of the s-globin gene and composed of at least 5 HS sites. The
murine P-globin locus: the sy and 3hl globin genes, which are co-expressed
in the embryonic yolk sac and the pmaj and 3min globin genes, which are
expressed during the fetal and adult stages of erythropoiesis. The overall
organization of the LCR is highly conserved between the murine and the
human 3-globin locus. PCR fragments analyzed in the ChIP experiments
are indicated as lines (horizontal bars) below the respective regions.


The data show that RNA polymerase II is efficiently crosslinked to LCR HS2 in

K562 cells (Figure 4-2). The interaction of Pol II with the globin genes is consistent with

the expression pattern in these cells. Pol II is detectable at the embryonic s- but not at the

adult P-globin gene. The results further show that Pol II does not interact with the HS2

5'flanking region, demonstrating that Pol II specifically interacts with the core of HS2.

We also detected interactions of phosphorylated Pol II with HS2 and the s-globin gene in

K562 cells, indicating ongoing transcription in these regions.

Because extragenic transcripts have been detected over the entire LCR in the

human P-globin locus we analyzed the interaction of basal transcription factors that are


a p










not associated with the transcription elongation complex. The results show that both

TFIIB as well as TBP can be crosslinked to HS2 in K562 cells. These results

demonstrate that Pol II and other basal transcription factors, which are part of

transcription initiation complexes, are associated with the LCR element HS2 in vivo. The

presence of components of the PIC indicates that the crosslinking of Pol II to HS2 is not

solely due to elongating polymerase. NF-E2 is clearly detectable at HS2 in K562 cells,

whereas the signal representing the e-globin gene is very weak. None of the proteins

interact with the necdin gene.


0
a
a.



S hHS2
5'flank

..... hHS2




Shp


-- hNecdin


Figure 4-2. Interaction of transcription factors and RNA polymerase II with the human
P-globin locus and the human necdin gene. Antibodies used were specific
for RNA polymerase II (aPol II), RNA polymerase II phosphorylated at the
C-terminal domain (aPol II Phosph.), TBP, TFIIB, NF-E2 p45, and acetyl
histone H3 (ahistone H3 acet.). PCR was performed with primers to
regions in the P-globin locus as indicated (see Figure 4-1). No antibody
samples are negative controls. Input represents the positive PCR control
taken from the no antibody sample.

The observation that Pol II is not detectable at the HS2 5'flanking region is

interesting and suggests that transcription initiates within the HS2 core enhancer and not









upstream of HS2. In order to analyze this question in more detail, Padraic Levings in the

laboratory used nuclear run-on experiments to determine regions of active transcription in

the human P-globin locus in K562 cells. He found that ongoing transcription is

detectable in a region upstream of HS5, in the HS2 core, and in the ; globin gene, but not

in the HS2 5' flanking region. These results are consistent with our ChIP analysis and

suggest that transcripts initiating far upstream of HS2 do not elongate beyond the HS2

5'flanking region analyzed here, consistent with data published by Kim and Dean [196].

Because the nuclear run-on HS2 probe is specific for the core region his data suggest that

transcription initiates within HS2 and not, or not exclusively, downstream of HS2 as

proposed by Routledge et al. [188]. Transcription upstream of HS5 probably initiates

within the LTR of a retrovirus as previously described [197].

We also analyzed the interaction of transcription factors and Pol II with regulatory

elements in the murine P-globin locus in MEL cells (Figure 4-3A). The results of these

experiments are very similar to those in the K562 cells and show that Pol II, TBP, and

TFIIB can be crosslinked to both HS2 and the P-globin gene promoter, but not to a region

5' of HS2. The precipitation of proteins crosslinked to the e-globin gene is extremely

inefficient. The inefficiency in crosslinking phosphorylated Pol II to HS2 and the 3-

globin promoter in the murine locus is consistent and may be due to species-specific

differences in the ability of the antibody to precipitate crosslinked polymerase.

In contrast to the results in K562 cells, NF-E2 (p45) can be crosslinked to HS2 and

to the P-globin gene promoter. We have shown previously that NF-E2 interacts with a

NF-E2 like sequence located downstream of the murine pmaj-globin transcription start

site [195]. This sequence deviates in one position from what is considered the consensus







52


NF-E2 binding site, but it is identical to the NF-E2 interaction sequence present in human

LCRHS3 [126, 136].


g fl%'g'5 ii











Em-
.9z


mHS2
5'flank

mHS2


00 00
Co
Ul VIV
00 $P


p-actin



B-globin


15 16


pmaj

mNecdin


Interaction of transcription factors with and transcription in the murine 3-
globin locus in MEL cells. A) Interaction of transcription factors and RNA
polymerase II with the murine P-globin locus and the murine necdin gene.
Antibodies used were specific for RNA polymerase II (cPol II), RNA
polymerase II phosphorylated at the C-terminal domain (cPol II-Ph), TBP,
TFIIB, NF-E2 p45, and acetylated histone H3 (cAcetyl-H3). PCR was
carried out with primers corresponding to regions in the murine P-globin
locus as indicated (see Figure4-1). The no antibody and input controls were
processed as described in the legend to Figure 4-2. B) Semi-quantitative RT-
PCR analysis of P-globin gene transcription in DMSO induced and
uninduced MEL cells. Relative expression of P-globin mRNA compared to
expression of P-actin was found to be 3-fold lower in uninduced MEL cells.


The NRO analysis in MEL cells performed by Padraic Levings demonstrates that

while HS2 and the P-globin gene are transcribed, a region upstream of HS5 is not. This

result is likely due to the fact that the retrovirus element present upstream of HS5 in the

human locus is not present in the murine P-globin gene locus.


The MEL cells employed in these experiments express the P-globin gene, and thus

no induction (with DMSO) was used. Moreover, interactions between Pol II and NF-E2


Figure 4-3.









with the globin locus can be detected by ChIP assay in the absence of DMSO. We found

that incubating the cells with 1% DMSO for 3 days led to an increase in globin gene

transcription (ca- and P-globin) less than 5-fold compared to uninduced cells (Figure 4-3

B).

If the model according to which Pol II is recruited first to the LCR, modified and

transferred to the globin genes is correct [96], one may predict that Pol II associates with

the LCR and the globin genes at different time points during activation of the globin

locus in the cell-cycle. To address this question, we examined the interaction of

transcription complexes with the LCR and globin genes during S phase in K562 cells

(Figure 4-4). Cells were synchronized using the double thymidine block method, which

arrests the cells at the G1/S phase border [167]. At specific time points after release from

cell-cycle arrest, cells were subjected to formaldehyde crosslinking and ChIP analysis.

In these experiments, we used antibodies against Pol II, NF-E2 (p45) and USF2.

We have shown that USF2 interacts with the human 3-globin promoter in K562 cells

(described in Chapter 6) and hypothesized that it may contribute to the repression of the

P-globin gene [163]. We analyzed the association of these proteins with four different

regions of the human P-globin locus. Cells were crosslinked at time 0, and 15 minutes,

45 minutes, 2 hours, and 6 hours after release from cell cycle arrest.

At time 0, Pol II interacts with HS2, the e-, and y-globin genes, but not with the 3-

globin gene. There is no interaction of NF-E2 or USF2 with the regions of the globin

locus at this time point. The only change after 15 minutes into S phase is the association

of NF-E2 with HS2. After 45 minutes, Pol II is no longer detectable at the e-globin gene







54


but remains associated with HS2 and the y-globin genes. At this time point, NF-E2


interacts with the y-globin genes.


Ui ychm airte d





DNAC nint
45 Milm





DNA COlnt


The o




D N AC.n"nt'
2Hr





DNA Conntnt


DNA Contnt
6 Mr





DNA Connt


HS2
in


Time 6- 5


0 inin -


15 inin


45 min -


2hrs E- ^_


6 hrs


E-globin


N

n = ,, w ,
I-= LJ-

ZEEZ



ra ---
I_1-1I



-fI


y-globin


t N













glK-IE
w. LO
Z^


p-globin



Xl= LL




r
kJ- ------
, u -----



I M *-

^^


Figure 4-4. Interactions of transcription factors and RNA polymerase II with the human
P-globin locus during early S phase in synchronized K562 cells.
Synchronized K562 cells were analyzed for DNA content by flow cytometry
(shown on top). The remaining cells were harvested at time 0 or at specific
time points after release from cell cycle arrest (as indicated), and subjected
to ChIP using antibodies specific for RNA polymerase II (cPol II), the p45
subunit ofNF-E2 (cNF-E2), and USF2 (cUSF2); time 0 represents the
status of the blocked cells at the G1/S phase boundary. PCR was performed
using primers specific for HS2, the e-globin gene, the y-globin gene, and the
P-globin gene as indicated (see Figure 4-1). The no antibody and input
controls were processed as described in the legend to Figure 4-2.









After 2 hours, Pol II no longer interacts with the LCR or the e- and y-globin genes.

At this time there is a clear interaction of NF-E2 and USF2 with HS2 and the e- and y-

globin genes. The interaction of NF-E2 with the P-globin gene is less pronounced. After

6 hrs, Pol II re-associates with HS2 and the y-globin genes, but not with the e-globin

gene. Accompanied with the reappearance of Pol II is the dissociation of USF2 from the

genes and HS2.

We also analyzed the interaction of transcription factors with the murine globin

locus during S phase in synchronized MEL cells (Figure 4-5). We used antibodies

specific for Pol II, TFIIB, NF-E2, and acetylated histone H3. At time zero, Pol II, TFIIB,

NF-E2 and acetylated histone H3 can be detected at LCR HS2 and the P-globin promoter.

After 7 minutes, NF-E2 and acetylated H3 but not Pol II can be detected at HS2 and

weaker at the P-globin gene. A similar pattern was observed after 45 minutes, except that

now Pol II is beginning to re-associate with HS2 and the P-globin promoter. Finally,

after 2 hours, Pol II, TFIIB, NF-E2, and acetylated H3 are associated with HS2 and the 3-

globin promoter.

The results show that Pol II dissociates and re-associates with the globin locus

during early S phase in MEL cells. In contrast to the results with K562 cells, NF-E2

appears to remain associated with the globin locus at all the time points analyzed here.

All experiments have been repeated several times with essentially the same results. The

only exception is that in some experiments NF-E2 (p45) can be crosslinked to HS2 in

synchronized K562 cells at time 0. The variation may be due to subtle changes in the

status of the cells during synchronization.













I-
F L& Unsync.




11l l7a


w] h 7rin
o
d
Z o

aW 45min



iZ hours


LCR


0C'n
Z Z








towt
S P, E i d




a





^N --


prnaj-globin gene

0 -





1B-m --


DNA Content


Figure 4-5.


Interactions of transcription factors and RNA polymerase II with the human
P-globin locus during early S phase in synchronized MEL cells. The cells
were analyzed for DNA content by flow cytometry at each time point
(shown at left). The remaining cells were harvested at time 0 or at specific
time points after release from cell cycle arrest (as indicated), and subjected
to ChIP using antibodies specific for RNA polymerase II (cPol II), TBP
(aTBP), TFIIB (cTFIIB), the p45 subunit of NF-E2 (cNF-E2), and
acetylated histone H3 (aH3acetylated); time 0 represents the status of the
blocked cells at the G1/S phase boundary. PCR was performed using
primers specific for HS2 and the pmaj-globin gene as indicated (see Figure
4-1). The no antibody and input controls were processed as described in the
legend to Figure 4-2.


We next analyzed how dissociation and re-association of Pol II to the P-globin

locus in K562 and MEL cells correlates with the timing of replication. Since the cells are

blocked at the border of G1 and S phase, it is assumed that when the cells are released

from the block they will synchronously enter S phase. They should then undergo

replication early in S phase since the P-globin locus is early replicating in erythroid cells

such as K562 and MEL [198]. As a late replicating control, we used the necdin gene,









which is a brain-specific imprinted gene that replicates late in S phase in all tissues

except brain.

In this experiment, the cells were blocked at the border of G1 and S phase, cells

collected at time 0, released from the block and cells collected at the same time points as

for the flow cytometry and ChIP experiments. DNA was extracted and used as a

template for PCR with primers against e-globin and necdin for K562 cells (Figure 4-6),

P-globin and necdin for MEL cells (Figure 4-7). Based on the calculated ratios it was

estimated that K562 cells complete replication of the P-globin locus by 2 hours after

release from the block (Figure 4-6). For MEL cells it was estimated that replication of

the P-globin locus is also complete by 2 hours after release from the block (Figure 4-7).

cycle# it # Ratio of /Necdin at cycle 28
s-globin ..
-n Time 0 =0.32
Necdin ..J

,15 min = 0.42


S45 in = 0.52


2 hr = 0.86


-6 hr = 0.87

Figure 4-6. Semi-quantitative PCR analysis of DNA content of synchronized K562 cells.
Cells were isolated at each time point, DNA extracted and PCR performed
with primers to e-globin and necdin promoters. Equal amounts of the two
PCR products were run in the same lane and gels were stained with SyBr
Green. Bands were quantitated with Image Quant and the ratio of e-globin to
necdin was calculated.










Discussion

Expression of the P-globin genes is regulated by the LCR [183, 199]. Whereas

studies using transgenic mice demonstrate that the LCR has both chromatin opening and

enhancer activities [111], studies in the endogenous murine locus show that the function

of the LCR is limited to stimulating high-level globin gene transcription [200]. The

ability of the LCR to regulate chromatin structure is thought to be important for

conferring protection from position effects at ectopic sites in transgenic studies, a

defining activity for locus control regions [199]. It is not known at what level the LCR

opens chromatin structure, e.g., unfolding of higher order structure and modification of

histones, or whether chromatin opening is a secondary event and the consequence of LCR

mediated re-location of the globin locus into a transcriptionally active site in the nucleus

[201].


DNA Analysis Using Ratio of P3/Necdin in MEL


Time 0 7 Min 45 Min 2 Hr
Cycle # 20 22 2426 20 22 2426 2022 2426 20222426
Necdin

p-globin -

Ratio of
P/Necdin 1.27 1.29 1.68 2.68
at cycle 20

Figure 4-7. Semi-quantitative PCR analysis of DNA content of synchronized MEL cells.
Cells were isolated at each time point, DNA was extracted and PCR was
performed with primers to P-globin and necdin promoters. Equal amounts of
the two PCR products were run in the same lane and gels were stained with
SyBr Green. Bands were quantitated with Image Quant and the ratio of 3-
globin to necdin was calculated.









Recently extragenic transcripts were detected over the LCR and in between the

globin genes [156, 187, 202]. The generation of these transcripts was found to correlate

with stage-specific transcriptional activity and DNaseI sensitivity of P-globin locus

subdomains [102]. This led to the hypothesis that transcription complexes are recruited

to various regions in the globin locus and track along the DNA in a unidirectional manner

thereby modifying chromatin structure. This is a plausible model because Pol II

transcription complexes are known to be associated with chromatin modifying activities

[203], and transcription through regulatory memory elements has been shown to be the

initial event in setting up activating or repressing functions of these elements in

Drosophila [204]. Extragenic transcripts have also been detected in other complex gene

loci suggesting a broader role in the modulation of chromatin domains [205].

The role of the LCR in mediating high-level expression of the P-globin genes is

unquestionable. The LCR and the genes appear to be in close proximity in cells

expressing the globin genes, suggesting physical contacts between activities associated

with the LCR and proteins interacting with the promoter [120, 206]. How this contact

aides in stimulating transcription is not known, but could involve the transfer of activities

from the LCR to the globin genes [96]. In the experiments described in this chapter we

analyzed the interaction of transcription complexes with LCR HS core elements and the

globin genes during S phase. The data demonstrate that RNA Pol II dissociates and re-

associates with the globin genes during replication, showing that the replication

machinery is capable of displacing transcription complexes. Interactions of NF-E2 and

USF appear to precede the re-association of Pol II with the globin locus suggesting that

these proteins assist in the recruitment of Pol II during S phase. The data thus support a









model in which the LCR and the globin genes cooperate in recruiting transcription

complexes to the globin locus.

We began our studies by addressing the question of whether RNA Pol II is

recruited to the LCR independent from its known interactions with the globin genes. The

ChIP assay per se does not differentiate between direct or indirect interactions. We show

here, that Pol II interacts with the HS2 core region together with other components of the

transcription initiation complex. This result shows that the crosslinking of Pol II to the

core is not solely due to elongating transcription complexes that are in the process of

generating the extragenic transcripts, but instead is due to Pol II that may be poised to

start extragenic transcription or ready for transfer to the gene promoters. This conclusion

is also supported by our observation that Pol II is not detectable in a region between the

HS2 and HS3 cores.

How does the polymerase interact with the LCR core HS sites? Is the

crosslinking to these sites due to interactions between HS2 and the globin genes, which

would be fixed in the ChIP assay, or is it due to direct association of transcription

complexes with the LCR HS core regions? We believe that the latter is true for the

following reasons: If the association of polymerase II with the HS2 core is due to protein

mediated interactions with the globin promoters, all proteins detected at the promoter

regions may also be detectable at the LCR and vice versa. This is clearly not the case.

For example, NF-E2 interacts strongly with HS2 in unsynchronized K562 cells, but only

weakly with the e-globin promoter. If the interaction of Pol II with HS2 is indirect and

caused by interactions with the e-globin promoter then antibodies against NF-E2 should

also efficiently precipitate the e-globin gene, as it is likely part of the same complex.









Although it is possible, but highly unlikely, that the mechanism of looping sequesters

proteins at either side of the interaction such that they are not detected on the other side

by formaldehyde crosslinking.

The results from the NRO analysis are consistent with the ChIP data and

demonstrate that transcription is ongoing at places where transcription complexes are

detected; supporting the notion that Pol II is recruited to the LCR independent from

interactions with the promoter regions. It is also interesting to note that while HS2 is

transcribed in both MEL and K562 cells, the HS2 5' flanking region in K562 cells is not,

consistent with the lack of Pol II binding to this region. This result suggests that

extragenic transcripts over the LCR do not represent long continuous transcripts but are

due to multiple transcription initiation sites in HS2, HS3, and possibly other regions of

the LCR. Our results are largely consistent with data recently published by Johnson et al.

[189] demonstrating that Pol II recruitment to the LCR is restricted to the core HS sites.

Sawado et al. [190] recently presented data demonstrating that an important

function of the mouse LCR is to stimulate globin gene expression at the level of

transcription elongation. The interpretation is based on the fact that in the absence of the

LCR no elongating transcription complexes were found in the transcribed region of the

pmaj-globin gene. If transcription complexes are stalled at the P-globin promoter in the

absence of the LCR, one might predict that more P-globin promoter bound Pol II is

detected in the mutant locus, compared with the wild-type locus. However, Sawado et al.

[190] found a two-fold reduction in promoter bound Pol II in the mutant allele suggesting

that another important function of the LCR is to mediate the recruitment of Pol II to the

P-globin genes. It is difficult to estimate the contribution of the LCR in recruiting Pol II









to the genes by comparing promoter-bound Pol II in promoters in which elongation takes

place with those in which elongation does not take place. It is thus possible that the

contribution of LCR mediated delivery of Pol II to the P-globin gene may have been

underestimated in these studies. Another possibility that should be considered is that in

the absence of the LCR unproductive transcription complexes are recruited to the globin

genes but that in the presence of the LCR these complexes are first recruited to the LCR,

rendered transcriptionally competent, and transferred to the globin genes [96].

The results from the cell synchronization/ChIP experiment described here are

consistent with a model proposing that an important function of the LCR is to represent a

reservoir of transcription and maybe other protein complexes, which may be used to

provide these activities to the globin genes during various stages of the cell cycle. NF-E2

may play a major role in directing these activities to the globin genes. In K562 cells NF-

E2 interacts directly or indirectly with HS2 and both e- and y-globin genes at specific

stages during S phase. Not surprisingly, the interaction of NF-E2 with the globin locus

precedes the re-association of Pol II, consistent with the notion that factors are needed to

recruit Pol II back to the locus after replication. We observed a similar pattern at the 3-

globin gene in MEL cells, although NF-E2 remains associated with HS2 and the P-globin

promoter, at least at the time points analyzed here. These data suggest an important role

of NF-E2 in recruiting Pol II to the globin locus, consistent with results from Johnson et

al. [179] demonstrating an impairment in Pol II/P-globin gene interactions in MEL cells

lacking NF-E2. In addition, it was recently shown that NF-E2 interacts with the human

P-globin locus control region before chromatin is re-modeled [207]. The summary data

suggest that NF-E2 interacts with the globin locus at specific stages during the cell cycle,









prevents the formation of repressive chromatin structure, and facilitates the interaction of

transcription complexes with the globin locus.

Another interesting observation in these experiments is the interaction pattern of

USF2 during S phase in synchronized K562 cells. Previous studies have shown that USF

interacts with LCR core elements and with the P-globin promoter [143, 144, 163]. Our

data show that USF2 only interacts with HS2 and the globin genes at a stage at which

Pol II is not bound. It is conceivable that USF2, in conjunction with NF-E2, prepares

specific regions in the globin locus for the re-association of transcription complexes after

replication. Tolhuis et al. [120] recently proposed a model according to which all HS

sites in the globin locus participate in forming a specific chromatin conformation, called

the active chromatin hub (ACH). The interactions of NF-E2 and USF with the locus

control region and the genes at a stage in which Pol II is not bound in K562 cells (Figure

4-4, 2 hour time point) could indeed suggest that the LCR HS sites and the globin gene

promoters together orchestrate the recruitment of transcription complexes to the globin

gene locus, consistent with previous observations showing that enhancer and promoter

elements cooperate in the formation of DNaseI HS sites [208].

In summary, we have observed recruitment of Pol II directly to LCR HS2. We

also observed dynamic changes in the interaction of transcription factors and RNA-

polymerase II with the P-globin gene locus during S phase of the cell cycle. These

changes in interactions correlate with the occurrence of replication in these cells.

The results from the synchronization experiments are reproducible, with some

notable exceptions. In some experiments we detect NF-E2 at LCR HS2 at time 0 in

K562 cells. In addition, the recruitment of Pol II to the e-globin gene in K562 cells is






64


somewhat variable and we have performed experiments in which Pol II is crosslinked to

the e-globin gene after 6 hours. The variability may be due to subtle changes in the status

of the cells during synchronization.














CHAPTER 5
ANALYSIS OF THE MECHANISM OF RNA POLYMERASE II TRANSFER FROM
THE LCR TO THE P-GLOBIN GENE PROMOTER

Introduction

Erythroid-specific, high-level expression of the P-globin genes is regulated by the

locus control region (LCR), composed of multiple DNaseI hypersensitive (HS) sites and

located far upstream of the genes. Our lab and others have shown that the LCR core

elements recruit RNA Pol II [132, 169, 187-189]. The LCR HS sites are known to

interact with each other to form the LCR holocomplex. We proposed a model suggesting

that the LCR recruits Pol II and later transfers it to the gene promoters that are expressed

at specific developmental stages [96]. Recent evidence obtained by the 3C technique

show that the LCR holocomplex interacts with whichever gene is transcriptionally active

at a particular stage in erythroid cells [117, 120, 158].

The 3C technology mentioned above is a method in which protein mediated DNA

interactions in live cells are captured by formaldehyde crosslinking. The crosslinked

chromatin is fragmented by restriction enzyme digestion and subsequently ligated under

conditions that favor intra-molecular ligation. These conditions allow DNA segments

that are normally located far away from each other to be ligated if they associate via

protein-protein and protein-DNA interactions. If these segments do not interact, the

probability of generating ligation products between these fragments is very low.

Formation of the ligation products is monitored by PCR.









Tolhuis et al. determined using 3C technology that the LCR HS sites interact with

each other, with the 3' HS site, and with the active globin genes in globin expressing cells

[120]. The authors call the structure in which the LCR holocomplex interacts with an

active gene the active chromatin hub, while the intervening DNA loops out in agreement

with previously proposed looping models [101, 115]. The authors further showed that

during erythroid development in mice the 5', 3', and LCR hypersensitive sites interact

first to form a chromatin hub. The interaction of the genes with this structure then leads

to the formation of the active chromatin hub [158].

The data described above together with our own results from the synchronization

experiments support the LCR recruitment and transfer model. To test the Pol II transfer

hypothesis directly, we have developed a novel in vitro assay in which Pol II is first

recruited to an immobilized LCR construct and then transferred to a P-globin gene

promoter. We provide evidence that RNA polymerase can be transferred from the LCR

to a P-globin gene in vitro and demonstrate that the transfer is sensitive to mutations in

the P-globin gene promoter and facilitated by erythroid transcription factor NF-E2.

Results

As a first attempt to examine the possibility that Pol II can be recruited to the LCR

and transferred to the P-globin gene, we established an in vitro system utilizing

immobilized LCR templates and nuclear extracts from IMEL cells (Figure 5-1).

A plasmid containing the entire human 3-globin LCR was linearized, biotinylated

and immobilized to streptavidin coated magnetic beads as described by Leach et al.

[169]. After incubation with MEL nuclear extract the protein/DNA complex was washed

several times in binding buffer on a magnet. Then a plasmid containing the wild-type 3-









globin gene was added to the LCR and incubated for 10 minutes at 30 C in binding

buffer. The supernatant containing the P-globin gene was then removed from the

immobilized LCR, and subjected to crosslinking with formaldehyde and ChIP analysis

using a Pol II specific antibody as described in the Materials and Methods chapter (Figure

5-2 lane 2).


Immobilize LCR




Incubate with
protein extract and
remove unbound proteins




Incubate with
p-globin gene





ChIP and PCR


Figure 5-1.


A schematic representation of the in vitro Pol II transfer experimental
procedure. The plasmid pLCR was linearized, biotin labeled, and
immobilized on streptavidin coated magnetic beads. After incubation with
MEL protein extracts, the LCR was placed on a magnet and all material not
interacting with the LCR was removed. The immobilized LCR/protein
complex was washed, resuspended in binding buffer and incubated in the
presence or absence of the P-globin gene. After placing the samples on the
magnet, the supernatant was removed and the sample containing the 3-
globin gene was crosslinked and subjected to ChIP analysis using an RNA
polymerase II specific antibody.


A second sample was processed in the same manner except that no Pol II specific

antibodies were added; this sample served as a negative control (Figure 5-2 lane 4). To

control for diffusion, we incubated 50 [tl binding buffer with the protein/LCR complex in










the absence of the P-globin template for 10 minutes at 30 C. The reaction was placed on

a magnet and the supernatant was removed and incubated with the P-globin template for

10 minutes at 30 C, after which formaldehyde was added to the reaction to induce

crosslinking. The sample was then subjected to ChIP analysis with Pol II antibodies

(Figure 5-2, lane 1).


LU
LL.
0 C
+ 0 0
.1 h h.. I
to n '''t
C
I |in L"*

Q I- I- Z a.
-P-maxi
S-g5obin
1 2 3 4 5


Figure 5-2.


Transfer of RNA polymerase II from immobilized LCR constructs to the 3-
globin gene. The sample containing the P-globin gene was crosslinked and
subjected to ChIP analysis using an RNA polymerase II specific antibody
(Lane 2). The supernatant of the sample incubated without the P-globin
gene for 10 minutes was later incubated with the P-globin gene template and
subjected to crosslinking and ChIP analysis using an RNA polymerase II
specific antibody (Lane 1). Lane 3 represents a reaction processed in the
same manner as described for lane 2 except that recombinant NF-E2 was
added to the reaction. Lane 4 represents a negative control in which no
antibody was added. Lane 5 represents the positive control in which the 3-
globin gene was incubated with MEL protein extract and subjected to ChIP
and PCR. Samples were processed as described in Fig 5-1 and subjected to
PCR analysis using a set of primers specific for the human 3-globin coding
region. The Pmaxi gene differs from the wild-type P-globin gene by 800 bp
and served as a PCR control in these experiments.


As a positive control, we incubated the P-globin gene for 30 minutes at 30 C with

MEL protein extract and subjected the sample to crosslinking and ChIP analysis (Figure

5-2, lane 5). After reversal of the crosslink and purification of the DNA, the samples









were analyzed by PCR using primers specific for the coding region of the P-globin gene.

The Pmaxi gene was added after the immunoprecipitation and served as a PCR control.

The result of this experiment demonstrates that Pol II can indeed be transferred

from the LCR to a P-globin template in trans (Figure 5-2, lane 2). The control

experiment shows that diffusion is negligible during the incubation time and does not

contribute significantly to the transfer of Pol II from the LCR to the P-globin gene

(Figure 5-2, lane 1). The inclusion of recombinant NF-E2 consistently enhanced the

transfer of Pol II from the LCR to the P-globin gene (Figure 5-2, lane 3) supporting

previous conclusions that NF-E2 is required for the recruitment of Pol II to the globin

gene.

In order to examine whether Pol II is specifically transferred to the P-globin gene

and not to sequences elsewhere in the plasmid we have performed the transfer

experiments in the presence of two restriction fragments derived from pRSPA/X, one

fragment containing the P-globin gene and the other containing the bacterial ampicillin

gene. The results are shown in Figure 5-3 and demonstrate that Pol II is specifically

transferred to the P-globin gene and not to other sequences present in the plasmid. In this

experiment we have increased the cycle number to visualize the signal corresponding to

the ampicillin gene and the P-globin gene in the no antibody control (lane 2). The data

show that the intensity of the P-globin signal increases in the presence of Pol II

antibodies, whereas the signal of the ampicillin gene remains unaltered.

To further analyze the specificity of the transfer, we performed the experiment with

several P-globin promoter mutants (described in [163]). In this experiment the Pmaxi gene

was added during the incubation with the protein/LCR complex and served as an internal









control. The results show that a mutant promoter in which the E-box element at +60 is

altered is impaired in recruiting Pol II (Figure 5-4).


- Amp


1 2 3


Figure 5-3.


Analysis of the specificity of Pol II transfer. The plasmid pRSPA/X was
digested with KpnI and SacI, incubated with the LCR/protein complex, and
processed as described in Figure 5-1 and 5-2. The precipitate was analyzed
by PCR using primers specific for the P-globin (3) or the bacterial
ampicillin gene (Amp), which are present on different restriction fragments.
Lane 1 shows a 100bp ladder.


- p-maxi

- p-g&bin


I 2


Figure 5-4.


Comparison of Pol II transfer using the wild-type P-globin gene (lane 1)
and a mutant P-globin gene (lane 2) in which an E-box at +60 was altered.
The samples were processed and analyzed as described in Fig 5-2 except
that the Pmaxi gene was added together with the wildtype or mutant 3-
globin gene and incubated with the immobilized LCR/protein complex.


The addition of BSA at the same concentration as NF-E2 did not enhance Pol II

transfer (Figure 5-5, lane 5), indicating that stimulation of Pol II transfer by NF-E2 is not

an unspecific effect due to increased protein content. To further examine whether Pol II

transfer is specific for the P-globin gene we have performed transfer experiments in the

presence of a P-globin gene lacking the TATA box. We have previously shown that this






71


mutant is inefficiently transcribed in vitro [163]. We found that the P-globin TATA box

is necessary for Pol II recruitment (Figure 5-5, lane 6) demonstrating that Pol II is

specifically transferred to the P-globin gene and not to sequences elsewhere in the

plasmid.


(Y
Z E
0 + +




A-- P-m axi



w ., -g lob in


1 2 3 4 5 6

Figure 5-5. Transfer of RNA polymerase II to the P-globin gene in the presence of NF-
E2 or BSA. Samples were prepared and analyzed as described in panels
Figure 5-2 except that NF-E2, lane 4, or BSA, lane 5, were added during the
transfer step. Lane 6 represents transfer to a mutant P-globin gene template
lacking the TATA box.

To further test the specificity of the transfer we performed an experiment in which

we simultaneously incubated LCR/protein complexes with two different plasmids, one

containing LCR element HS2 and another containing the P-globin gene. The results in

Figure 5-6 show that Pol II is preferentially transferred to HS2 (lane 2), which could be

due to interactions between HS2 and the LCR/protein complex. Importantly, we

observed that in the presence of NF-E2, Pol II is preferentially transferred to the P-globin

gene and not to HS2 (lane 3). We also analyzed the transfer to the thymidine kinase

promoter and found that Pol II is not transferred to this template (compare Figure 5-6






72


lanes 1 and 4). We hypothesized that proteins in our erythroid cell extracts would bind

the thymidine kinase promoter since there are ubiquitously expressed proteins present in

these extracts that should bind other mammalian promoters such as the proteins of the

PIC. This again demonstrates that the transfer is specific for the P-globin gene. The

graph in Figure 5-7 summarizes the results of multiple experiments.


N 0
SLU
uC1
0 Z
.1-.-
C C C C
0 Mi e 0 0 0
Z IMI U U


2 W




1 2 3 4 5 6 7


- p-globin

- HS2


- TK-HGH


Figure 5-6.


Analysis of NF-E2 mediated transfer to the P-globin gene. Samples were
processed as described in panel Figure 5-2 except that in lanes 2 and 3 the
transfer was carried out in the presence of both P-globin and HS2 containing
plasmids. In lane 3, NF-E2 was added to the transfer reaction. In lane 4,
transfer to the thymidine kinase/human growth hormone gene (TK-HGH)
construct was analyzed. Lane 1 represents the reaction of the no antibody
control containing all three plasmids (P-globin, HS2, and TK-HGH). Lanes
5, 6, and 7 represent positive PCR controls for 3-globin (lane 5), HS2 (lane
6) and TK-HGH (lane 7).


Discussion

It was proposed that one function of the LCR could be to recruit macromolecular

protein complexes including Pol II, which are subsequently transferred to individual

globin genes in a developmental stage specific manner [96, 169, 179]. Similar

conclusions were derived from studies on the TCRP locus, which show that coactivators







73


and components of the transcription initiation complex are first recruited to an enhancer

element and subsequently delivered to the promoter [209].

We have developed an in vitro system to test the polymerase transfer hypothesis

and show that Pol II can indeed be transferred from an immobilized LCR template to the

P-globin gene (Figure 5-1). Moreover, the transfer of Pol II was enhanced by

recombinant NF-E2, supporting previous studies that implicate NF-E2 in the recruitment

of Pol II to the P-globin gene [179]. The NF-E2 mediated stimulation of Pol II transfer is

not due to an increase in protein concentration as the same concentration ofBSA had no

effect.


Lu C
I-
5 Z -D
o + +
S I- I- iT



Q 20 z
o
z 15-
10


XLL
X 0 K


Figure 5-7. Quantitative summary of the transfer experiments. The experiments were
repeated several times and the data were quantitated after gel electrophoresis
using SyBr green, Storm scanner, and Image Quant. The bars represent the
mean of the results of two to three experiments.

The observation that Pol II was not transferred to either the bacterial ampicillin

resistance gene or to the TK/HGH gene demonstrates that transfer is specific for the 3-

globin gene promoter (Figure 5-3 and Figure 5-6) when using extracts from erythroid

cells. It is likely that transfer would occur to other promoters as well if they contain









binding sites for proteins that mediate the transfer process, as I have shown to be the case

for NF-E2.

I also analyzed elements required for Pol II transfer to the P-globin promoter.

There was no transfer to the P-globin gene with a mutation at the TATA box and reduced

transfer to a promoter with a mutant +60 E-box (Figs. 5-4 and 5-5). This supports

previous data from our lab showing that the TATA box and +60 E-box are required for in

vitro transcription and suggest that these elements exert at least part of their function by

recruiting the polymerase [163].

The combined data suggest that the P-globin LCR, like other enhancer elements

[210], act in trans to assist in the recruitment of transcription complexes to the globin

genes. Although this in vitro system completely ignores nucleosome and higher order

chromatin structure, we believe that it does reveal some aspects of LCR function. It was

previously shown that specific characteristics of HS site formation and function,

including the recruitment of transcription complexes, can be recapitulated in vitro in the

absence of chromatin assembly [169]. This demonstrates that chromatin is not directly

involved in recruiting transcription complexes to the globin locus but rather regulates a

preceding step, which is to render regulatory and functional sites available or unavailable

for the interaction with transcription factors and polymerase.

I show that Pol II can be transferred from immobilized LCR templates to globin

gene constructs in vitro and have established in vitro conditions for the analysis of RNA

polymerase transfer in the P-globin locus. In summary, we propose that transcription

complexes are first recruited to a highly accessible LCR holocomplex (Figure 5-8). The

genes are subsequently brought in contact with the LCR holocomplex, consistent with









data from conformational studies [120, 158], and transcription complexes are transferred

from the LCR to the promoter regions. This process is mediated by NF-E2 and possibly

other proteins (e.g. USF2). It is also facilitated by bringing strong globin gene promoters

(with high affinities for the transcription complex) in close proximity to LCR bound

transcription complexes.


LCR


s Gy Ay 6 p


LCR holocomplex
LCR holocomplex


Th RNA polymerase II

SNF-E2

PV Preinitiation complex


Figure 5-8. Model of transcription complex recruitment to the P-globin gene. The LCR
and other HS sites have been shown to interact to form a chromatin hub. In
the active chromatin hub, the expressed genes interact with the HS sites. We
propose that transcription and other protein complexes are first recruited to a
highly accessible LCR holocomplex in the context of the proposed chromatin
hub. The genes come in close proximity to the LCR holocomplex by as yet
unknown mechanisms that may involve local remodeling of chromatin
structure at the active promoters. Transcriptions complexes are then
transferred from the LCR to high affinity binding sites at the globin gene
promoters. This transfer is facilitated by NF-E2 and/or related proteins.














CHAPTER 6
DETERMINING THE FUNCTION OF THE USF, TFII-I AND HDAC3 PROTEINS IN
P-GLOBIN GENE REGULATION

Introduction

At least two modes of regulation control the stage-specific expression of the globin

genes. The first parameter regulating stage-specific expression is the relative location of

the genes with respect to the LCR. When the order of the genes relative to the LCR is

reversed, the P-globin gene is inappropriately expressed at the embryonic stage [114].

The second parameter is the binding of stage-specific trans-acting factors to the

individual globin promoter regions leading to activation of transcription at the appropriate

times during development. A well-characterized example for this mode of regulation is

represented by the transcription factor EKLF, which specifically activates expression of

the adult P-globin gene during definitive erythropoiesis [137-139, 142]. EKLF exerts part

of its activating function by recruiting chromatin-remodeling complexes to the P-globin

gene promoter, which leads in turn to a local change in nucleosome organization [141].

The basal promoter of the human adult P-globin gene is composed of a TATA-like

element and an initiator sequence, both of which were shown to interact with the TFII-D

protein complex [211, 212]. In addition to components of the TFIID complex

(specifically, TAFII250 and TAFII150), a diverse group of other proteins can also

interact with initiator sequences [150, 170]. Notable among these are the helix-loop-

helix proteins USF and TFII-I, because both proteins have been implicated in the









recruitment of transcription complexes to TATA-less promoters and in the stabilization of

transcription complexes in TATA-box-containing promoters [145, 146, 213].

Regulatory DNA elements located downstream of transcription initiation sites

(downstream promoter elements, DPE) that contribute significantly to the formation of

stable transcription complexes have been well characterized in a variety of Drosophila

genes [214]. In some cases these downstream promoter elements function in the absence

of TATA elements and cooperate with initiator sequences to recruit transcription

complexes. The transcription cofactor NC2 (negative cofactor 2), originally identified as

a repressor of RNA Pol II transcription, activates transcription of DPE-containing

promoters and inhibits transcription of TATA-box-containing promoters in vitro [215].

The human 3-globin gene contains two conserved E-box motifs located 3' to the

initiator sequence. The first E-box overlaps the initiator while the second E-box is

located 60 bp 3' to the transcription initiation site (Figure 6-1). Previous results in the lab

demonstrate that the human P-globin promoter's TATA-like motif, initiator and

downstream E-box element are all required for high level transcription in vitro [163].

This indicates that E-box motifs contribute to the efficient formation of transcription

complexes on the adult P-globin gene. The same study also indicated that USF 1 and

TFII-I interact with the initiator and overlapping E-box, while USF 1 and USF2 interact

with the downstream E-box in vitro [163].

Here I investigated the interactions of the HLH proteins in vivo. The data show

that USF 1, USF2, TFII-I and p45 interact with the P-globin promoter in vivo, supporting

the previous in vitro results [163]. By comparing the protein-DNA interactions on

expressed and non-expressed P-globin gene promoters, it was discovered that USF2 and










TFII-I interact more efficiently with the non-expressed than with the expressed gene.

The interactions of USF 1 and p45 with the P-globin promoter are restricted to erythroid

cells expressing the P-globin gene. Further, TFII-I was implicated in recruiting HDAC3

to the human P-globin gene promoter in cells that are not expressing the gene. The

results indicate that helix-loop-helix proteins contribute to the formation of transcription

complexes on the adult human 3-globin gene, and suggest that the differential association

of HLH proteins with the basal promoter contribute to the stage-specific expression of the

gene.

INII Mi *2 FI -bs +60 E-bra
Initiator MAREJAPl-likeclkminnt
BE: ttGCijt tc ttcq*ev u cl iq3ttticactaLa DDtcaacag- -Ciaao ct L
H:ctcCt Ua Ltt gLat Lgac&t tngLltu taatiact n.cgaaCaSr -gt-cA tcatqi;trcct
Pr-ctqckt tttMoc-fg ^tccalcjaact tttactgZC* tcccuca cgai'm cgq t: cncta
Trrnnrnipliin

Figure 6-1. Sequence alignment of the human 3-globin downstream promoter region.
Shown are three sequences of the adult P-globin downstream promoter
region from human (H), mouse (M) and rabbit (R). Shaded boxes highlight
the position of E-box motifs (CANNTG). Two of these E-boxes, the one
overlapping the initiator and the distal E-box, are conserved in all three
species, whereas the E-box located at +20 is only present in the human and
rabbit genes. The open box delineates the position of the MARE-like
sequence.

Results

In these studies I used two erythroid cell lines, MEL, a murine erythroleukemia cell

line expressing the adult P-globin gene, and K562, a human erythroleukemia cell line

expressing the embryonic 3-type globin genes. I examined whether USF 1, USF2 or

TFII-I interact with the P-globin gene in vivo by performing ChIP experiments in MEL

and in K562 cells. The results of these experiments are shown in Figure 6-2 and

demonstrate that both USF1 and USF2 could be crosslinked to the P-globin gene









promoter in MEL cells in vivo (Figure 6-2, lanes 4 and 5). TFII-I could also be

crosslinked to the globin promoter (Figure 6-2, lane 6); however, the signal for TFII-I

was consistently weaker in MEL versus K562 cells. Antibodies recognizing the p45

subunit of NF-E2 and acetylated histone H3 also precipitated the P-globin gene in MEL

cells (Figure 6-2, lanes 7 and 8, respectively). The precipitation with acetylated H3

antibodies was expected from previous studies [103].

To analyze whether the interaction ofUSF proteins with the P-globin promoter

could be correlated with the transcriptional activity of the gene I carried out ChIP

analyses in K562 cells, in which the P-globin gene is not expressed. In contrast to our

observations in MEL cells, USF 1 does not interact with the P-globin gene in K562 cells,

whereas TFII-I and USF2 do interact (Figure 6-2, lanes 5 and 6). The interactions of p45

(NF-E2) and acetylated H3 with the P-globin gene were also less efficient in K562 cells

when compared to MEL cells (compare Figure 6-2, lanes 7 and 8, MEL versus K562). In

control experiments I amplified a region within the LCR located upstream ofHS2 (HS2 5'

flank; Figure 6-2, lanes 10-16). The results demonstrate that the observed interactions of

USF1, USF2, TFII-I and p45 in erythroid cells are specific for the P-globin gene.

To analyze the possibility that the differential binding ofUSF1, NF-E2 and, to a

lesser extent, TFII-I is due to differential expression of these proteins in the two cell lines,

Kelly Leach in our laboratory carried out western blotting experiments using antibodies

specific for USF1, USF2, TFII-I and NF-E2. The results show that USF1 and USF2 are

expressed at similar levels in K562 and MEL cells. However, TFII-I is expressed at

higher levels in K562 cells and p45 (NF-E2) is expressed at higher levels in MEL cells.










P-globin HS2 5'flank




MEL o S


K562 -SS

1 2 3 4 5 6 7 8 9 10111213141516

Figure 6-2. Characterization of protein-DNA interactions in the human P-globin
downstream promoter region in vivo. Chromatin immunoprecipitation
(ChIP) experiment analyzing the interaction of proteins with the
murine/human P-globin gene or the HS2 5'flanking region in MEL and
K562 cells in vivo. Complexes were precipitated with either no antibody
(lanes 3 and 11) or with antibodies specific for USF1 (lanes 4 and 12), USF2
(lanes 5 and 13), TFII-I (lanes 6 and 14), NF-E2 (p45, lanes 7 and 15) or
acetylated histone H3 (lanes 8 and 16). DNA was purified from the
precipitate and analyzed by PCR for the presence of the murine or human P-
globin gene (210 and 321 bp, respectively, lanes 2-8) or the murine or
human HS2 5'flank (336 and 565 bp, respectively, lanes 10-16). As positive
controls, the input DNA was also analyzed by PCR (lanes 2 and 10). Lanes
1 and 9 show 100 bp markers.

Based on previously published data [216], I investigated potential interactions

between TFII-I and HDAC3 with each other and the promoter of the silenced P-globin

gene in K562 cells. For this, I carried out chromatin double immunoprecipitation

(ChDIP) experiments, in which two subsequent ChIP reactions with two different

antibodies are performed. In the ChDIP, the first ChIP assay was performed with an

antibody against TFII-I. The protein-DNA complexes eluted from the beads were then

used as substrate for another CHIP assay using an antibody against HDAC3. The results

show that in the first round of immunoprecipitation TFII-I was bound to the P-globin

gene promoter at levels above that of the no antibody background (Figure 6-3). In the









subsequent round of immunoprecipitation, HDAC3 was detected in P-globin templates

bound by TFII-I.

In contrast there were no e-globin promoter templates detected in both TFII-I and

HDAC3 precipitates. As a negative control, I also analyzed the linker region between

HS2 and HS3 and conclude that TFII-I and HDAC3 do not interact with this region. The

no antibody background after the second round of immunoprecipitation was drastically

decreased compared to the first one, probably due to the loss of non-specific interactions

with the beads.

P gene a gene HS2&3 Linker



IS I 4


L_ A.






Figure 6-3. Chromatin double immunoprecipitation (ChDIP) experiment analyzing the
interaction of TFII-I and HDAC3 at different regions within the human 3-
globin locus. Complexes were first immunoprecipitated with an antibody
against TFII-I and then these TFII-I selected complexes were
immunoprecipitated with an antibody against HDAC3.

Although the ChDIP experiment showed that TFII-I and HDAC3 are both bound to

the promoter of the non-expressed 3-globin gene, it did not provide evidence of direct

interactions between these proteins. In order to examine the possibility that TFII-I

directly interacts with HDAC3, we carried out co-immunoprecipitation experiments.

Whole cell extracts from K562 cells were immunoprecipitated with antibodies against









USF 1, TFII-I, Pol II, USF2, HDAC3 and a no antibody negative control. The complexes

eluted off the beads were separated by SDS-PAGE and transferred to a nylon membrane

for Western blot analysis. An antibody against HDAC3 was used for the Western

blotting detection.

Supporting our previous observation, we detected HDAC3 only in complexes first

immunoprecipitated with antibodies against TFII-I (Figure 6-4). In contrast, HDAC3

was not detected in the samples containing USF USF2 or Pol II. This shows that TFII-I

and HDAC3 directly interact in K562 cells.







1 ^ ..4 HDAC3



Figure 6-4. Co-immunoprecipitation experiment analyzing the interaction of TFII-I and
HDAC3. Whole cell extracts from K562 cells were first
immunoprecipitated with the indicated antibodies then the complexes pulled
down were run on SDS-PAGE and probed by with HDAC3 antibodies in a
Western Blot.

Discussion


The promoter of the human P-globin gene is characterized by the presence of a non-

canonical TATA-box (CATAAA) located 25-30 bp upstream of the transcription start

site [217]. Deviation from consensus TATA sequences often weakens promoters and

leads to the requirement of additional elements for the efficient recruitment or

stabilization of transcription complexes. For example, a recent report demonstrated that

the TBP/TFII-A pre-initiation complex interacts only weakly with the CATAA motif









[218]. An additional sequence that contributes to high level P-globin gene transcription is

an initiator element located at the transcription start site. Lewis et al. [211, 212] have

shown that this element interacts with the TFII-D complex in vitro and that mutations in

this sequence reduce transcription efficiency.

In addition to the initiator element, the P-globin gene contains several E-box motifs

downstream of the transcription start site [177] (Figure 6-1). Two of these elements are

conserved across species. Because previous studies have shown that E-box-binding

proteins can participate in the formation of transcription complexes on both TATA-

containing and TATA-less genes [145, 146, 213], we were interested in examining the

functional role of these proteins in P-globin gene transcription.

The P-globin initiator/E-box interacts with TFII-Iand USF1, whereas the distal E-

box at +60 interacts with USF1 and USF2 in vitro [163]. There are a number of reports

in the literature documenting the interaction of USF and TFII-I with sequence elements in

the vicinity, mostly downstream, of transcription initiation sites [219-222]. Hsieh et al.

[223] recently identified an E-box motif located downstream of the APEG-1 gene from

+39 to +44. This element interacts with USF proteins and mutation of this E-box

dramatically reduces transcription.

TFII-I interacts with the P-globin initiator in vitro and in vivo and may play a role

in activating transcription of the P-globin gene in MEL cells. However, several

observations suggest that TFII-I is not required for P-globin gene transcription. First,

antibodies against TFII-I were not able to inhibit transcription of the P-globin gene in

vitro [163]. Secondly, crosslinking of TFII-I to the P-globin gene in adult erythroid cells

is inefficient compared to USF 1 and USF2 (Figure 6-2). The ChIP assay does not provide









information as to what fraction of cells have a specific protein bound at a specific site. It

is thus possible that the weak PCR signal from TFII-I-selected MEL chromatin fragments

indicates that only a small fraction of cells have TFII-I bound at the initiator. This

fraction of cells could represent non-expressing cells. This is consistent with our

observation that TFII-I crosslinks more efficiently to the P-globin gene in K562 cells

(Figure 6-2A), suggesting that TFII-I may only be able to interact with the P-globin gene

in the absence of transcription complex formation.

We have performed RT-PCR (not shown) and western blotting experiments to

characterize the expression pattern of TFII-I in K562 versus VMEL cells. The RT-PCR

analysis revealed that TFII-I is transcribed with equal efficiency in both cell types.

However, western blots of nuclear extracts consistently showed that full-length TFII-I

protein is present at higher levels in K562 than it is in VMEL nuclear extracts. The reason

for the lower amount of TFII-I in MEL nuclear extracts may be due to post-

transcriptional mechanisms. This lower level of TFII-I in VMEL cells may contribute to

the lower level of TFII-I bound to the P-globin gene promoter in these cells.

Whether the binding of TFII-I to the P-globin promoter in erythroid cells with

embryonic phenotype contributes to repression of the P-globin gene or simply reflects the

absence of TFII-D binding was an issue that we sought to resolve. A recent report shows

that TFII-I interacts with histone deacetylase 3 [216]. It is thus possible that TFII-I

interacts with the P-globin gene in embryonic erythroid cells, recruits histone

deacetylases and contributes to the repression of P-globin gene expression by rendering

the chromatin structure inaccessible. Our ChIP data clearly show a strong reduction of









acetylated H3 binding to the P-globin promoter in K562 cells compared to MEL cells

(Figure 6-2, lane 8).

The combination of ChDIP and co-immunoprecipitation experiments indicated that

TFII-I and HDAC3 interact with each other and associate with the P-globin gene in non-

expressing erythroid cells. The data support a model according to which TFII-I recruits

HDAC3 to alter the chromatin structure and therefore to silence the P-globin gene

expression.

Our data led us to formulate a hypothesis on the function of proteins interacting

with the P-globin downstream promoter during development (Figure 6-5). We propose

that TFII-D, NF-E2, USF 1 and USF2 interact with the globin promoter in adult erythroid

cells and provide a platform for the efficient recruitment of transcription complexes [179,

195, 211, 212]. The functional role of NF-E2 in this process remains to be established,

but other data presented before (Chapter 5) suggest that it may be involved in the transfer

of RNA Pol II from the LCR to the gene promoter.

The interaction of TFII-I and USF2 with the P-globin promoter in K562 cells could

contribute to the repression of this gene at the embryonic stage of erythroid development

by recruiting histone deacetylase activities. Other studies also implicate USF2 as a

potential transcriptional repressor [224]. However, in adult cells, USF2 and USF1

interact with the E-box at +60 and stimulate transcription. This conclusion is supported

by our previous observation that in vitro transcription of the P-globin gene is inhibited by

pre-incubating the protein extracts with USF2 antibodies [163].

In summary, our data provide evidence that HLH proteins differentially interact

with the initiator and downstream promoter during erythroid development. The










combination of USF 1, USF2, NF-E2 and, perhaps, TFII-I contribute to expression of the

P-globin gene. Conversely, interactions of TFII-I along with USF2 recruit HDAC3

within the P-globin gene, leading to the repression of the P-globin gene.



TATA Initiator MARE +60Ebox

MEL: Expressed

NF-EZ USF





K562: Non-expressed

HDAC3 TFII I/USF2



Figure 6-5. Summary and model of protein-DNA interactions at the human P-globin
promoter. The human 3-globin promoter consists of a TATA-box and an
initiator. These sequences are bound by the TFII-D complex in cells
expressing the P-globin gene (active). Additional sequences required for the
formation of active transcription complexes are MARE and E-box elements
located in the downstream promoter region. These sequences are bound by
NF-E2 (p45 and p18) and USF, respectively. It is proposed that in cells not
expressing the P-globin gene (inactive), TFII-D is not bound and the
initiator sequence is occupied by protein complexes consisting of TFII-I and
USF2.














CHAPTER 7
CONCLUSIONS AND FUTURE DIRECTIONS

ChIP Footprinting

We have established a novel technique that allows the identification of sequences to

which a specific protein binds in the context of chromatin. This represents a powerful

tool for discovering binding sites of proteins not only in the P-globin locus but also in

other areas of the genome. We used this technique to demonstrate that NF-E2 binds to a

non-consensus MARE in the mouse P-globin downstream promoter region.

This technique could be refined by optimizing the restriction enzyme digestion

step. I noticed the appearance of unspecific DNA degradation products after long

incubation times with the restriction enzymes. The Grosveld group followed a similar

digestion protocol for their 3C experiments except that they utilized SDS to remove any

non-crosslinked proteins from the DNA and Triton X-100 to sequester SDS for more

efficient digestion [182]. However, whether this is applicable for the ChIP footprint

technique is questionable because the following step after fragmentation is

immunoprecipitation and not, as is the case in the 3C method, DNA ligation.

The ChIP footprinting technique could be used to further identify binding sites for

several of the proteins our lab investigates. For example, we could analyze whether TFII-

I binds to the P-globin initiator or to the downstream E-box elements in vivo. Similarly

we could investigate a possible difference in USF binding between 3-globin promoters of

expressing and non-expressing cells.









ChIP within the P-Globin Locus

Using the ChIP assay, I showed that RNA Pol II is directly recruited to HS2 of the

LCR. As expected, Pol II and associated transcription factors are also present at the

promoters of expressed genes in MEL and K562 cells. Acetylated histone H3 was also

present at the expressed genes, as has been previously documented [103, 155]. NF-E2

was consistently seen to associate with the promoters of the active genes in the locus.

Having optimized the ChIP assay for use within the mouse and human P-globin locus of

MEL and K562 cells respectively, there are many more experiments that can be carried

out utilizing this assay.

Another group using a MEL cell line that needs DMSO induction for high level 3-

globin expression has shown that NF-E2 only binds to the LCR and gene promoter after

DMSO induction [176]. It appears that our MEL cells are quite different since DMSO is

not required for 3-globin gene expression or NF-E2 binding as shown in Figure 4-3. It

would be interesting to repeat the ChIP experiment shown in Figure 4-3 with DMSO

induced MEL cells to see if there are any differences in binding between induced and

uninduced cells.

There is currently data available on the binding of the factors Bachl, GATA1,

GATA2, CREB binding protein (CBP), EKLF, Spl and YY1 to the P-globin locus. It

may be possible to use the ChIP assay in association with real-time quantitative PCR to

elucidate differences in binding of these factors between the transcribed and non-

transcribed regions of the locus in either MEL and K562 cells that has not been

previously documented.