<%BANNER%>

The Carotenoid Cleavage Dioxygenases of Arabidopsis thaliana


PAGE 1

THE CAROTENOID CLEAVAGE DIOXYGENASES OF ARABIDOPSIS THALIANA By MICHELE ELENA AULDRIDGE A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2004

PAGE 2

Copyright 2004 by Michele Elena Auldridge

PAGE 3

I dedicate this work to my parents who support me in every decision that I make.

PAGE 4

iv ACKNOWLEDGMENTS I would like to thank my advisor, Harry J. Klee, whose consistent belief in me made this possible, and my committee members, Donald McCarty, Andrew Hanson, and Steve Talcott for their critical advice. I am grateful for the assistance of Carole DabneySmith for work with chloroplast import, Eric Schmelz with hormone and ionone analysis and Anna Block for assistance with plant measurements and support with my project. I would also like to thank my parents for their love and support and Brian Burger who gave me the confidence and encouragement to get me through to the end.

PAGE 5

v TABLE OF CONTENTS page ACKNOWLEDGMENTS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . iv LIST OF TABLES . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . viii LIST OF FIGURES . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix ABSTRACT . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xi CHAPTER 1 INTRODUCTION . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 Carotenoid Cleavage Dioxygenase Family . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 Carotenoids . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4 Apocarotenoids . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8 Carotenoid Cleavage Dioxygenase Activity in Arabidopsis . . . . . . . . . . . . . . . . . . 10 In Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12 2 CAROTENOID CLEAVAGE DIOXYGENASE 1 (CCD1) . . . . . . . . . . . . . . . . . 14 Activity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14 Subcellular Localization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15 Expression Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16 Loss-of-Function Mutants . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19 Isolation of Mutant . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19 Morphological Analysis of ccd1-1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 20 b -ionone content of ccd1-1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22 Determination of Abscisic acid content within ccd1-1 plants . . . . . . . . . . . . . 24 In Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26 3 CAROTENOID CLEAVAGE DIOXYGENASE 7 (CCD7) . . . . . . . . . . . . . . . . . 28 Activity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28 Subcellular Localization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 31 Expression Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33 Loss-of-Function Mutants . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35 Isolation of Mutants . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35 Morphological Analysis of max3 Plants . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 37

PAGE 6

vi Complementation of max3 Phenotype . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 41 b -ionone Content of max3-10 and max4-11 . . . . . . . . . . . . . . . . . . . . . . . . . . 42 Determination of Indole Acetic Acid and Abscisic Acid Content within max3-10 Plants . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 45 In Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 46 4 CAROTENOID CLEAVAGE DIOXYGENASE 8 (CCD8) . . . . . . . . . . . . . . . . . 47 Activity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 47 Subcellular Localization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 47 Expression Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 49 Loss-of-Function Mutants . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 51 Isolation of Mutants . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 51 Morphological Analysis of max4 Plants . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 56 Complementation of max4 Phenotype . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 56 Determination of Indole Acetic Acid and Abscisic Acid Content within max4-6 Plants . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 58 In Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 59 5 GENETIC INTERACTION AMONG CCD1, CCD7, AND CCD8 . . . . . . . . . . . . 60 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 60 Characterization of ccd1max4 Plants . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 60 Characterization of max3max4 Plants . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63 Effect of Loss-of-Function Mutants on Expression of CCDs . . . . . . . . . . . . . . . . . 65 6 DISCUSSION . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 68 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 68 Carotenoid Cleavage Dioxygenase 1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 69 Carotenoid Cleavage Dioxygenase 7 and Carotenoid Cleavage Dioxygenase 8 . . . 70 7 MATERIALS AND METHODS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 75 Cloning of CCD1 CCD7 and CCD8 cDNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 75 CCD1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 75 CCD7 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 75 CCD8 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 76 Carotenoid/Apocarotenoid Extraction from E.coli . . . . . . . . . . . . . . . . . . . . . . . . . 76 Plant Growth Conditions and Measurements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 77 Subcellular Localization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 78 TNT . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 78 Chloroplast Import . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 78 Subfractionation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79 Real Time RT-PCR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 80 Isolation of Loss-of-Function Mutants . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81

PAGE 7

vii b -ionone Measurements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 83 IAA and Abscisic Acid Measurements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 84 LIST OF REFERENCES . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 85 BIOGRAPHICAL SKETCH . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 92

PAGE 8

viii LIST OF TABLES Table page 1-1 The CCD Gene Family of Arabidopsis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3 1-2 Comparison of the CCD and NCED gene structures and identities to VP14. . . . . . . . 4 3-1 CCD7 transcript abundance in whole seedlings. . . . . . . . . . . . . . . . . . . . . . . . . . . . 34 3-2 Petiole and leaf blade lengths and inflorescence number of max3 plants. . . . . . . . . 40 4-1 CCD8 transcript abundance in whole seedlings . . . . . . . . . . . . . . . . . . . . . . . . . . . 51 4-2 Petiole and leaf blade lengths and inflorescence number of max4 plants. . . . . . . . . 57 7-1 Primers used in Real Time RT-PCR reactions. . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81 7-2 Gene specific primers used to identify knock-out plants . . . . . . . . . . . . . . . . . . . . . 83

PAGE 9

ixLIST OF FIGURESFigure page 1-1 The Carotenoid Cleavage Dioxygenase (CCD) family .............................................21-2 Carotenoid biosynthetic pathway...........................................................................51-3b-carotene with its major sites of cleavage indicated by arrows..............................81-4Activity of the Arabidopsis CCD family members................................................112-1CCD1 activity with b-carotene as a substrate........................................................142-2Import of in vitro transcribed and translated CCD1..............................................162-3Organs of wild-type Arabidopsis used in morphological expression analysis........172-4Expression pattern of CCD1 as determined by quantitative Real Time RT-PCR...172-5Changes in CCD1 expression due to water stress..................................................182-6Location of T-DNA insert in CCD1.....................................................................192-7Schematic of T-DNA used for transformation to create SAIL population.............202-8Autoradiograph of Southern blot analysis of ccd1-1 plants...................................212-9Wild-type (Col) and ccd1-1 rosettes before bolting...............................................222-10Petiole and leaf blade lengths of wild-type (Wt) vs ccd1-1 plants.........................232-11b-ionone levels within wild-type (Col) and ccd1-1 plants.....................................252-10ABA content in ccd1-1 vs wild-type (Col) rosettes...............................................263-1E. coli lines accumulating lycopene, d-carotene, b-carotene or zeaxanthin +/-CCD7 expression.................................................................................................293-2Results from HPLC analysis of carotenoid content in each carotenoid accumulatingE. coli line +/co-expression of CCD7.................................................................293-3Analysis of carotenoid cleavage in E. coli expressing CCD7................................30

PAGE 10

x3-4Reaction scheme of CCD7 activity on b-carotene.................................................313-5Import of in vitro transcribed and translated CCD7..............................................323-6Time monitored plastid import assay with CCD7.................................................333-7Expression analysis of CCD7 trancript throughout wild-type Arabidopsis plants..333-8Location and orientation of T-DNA inserts in CCD7............................................363-9Schematic of T-DNA region of vectors used for transformation to create theBASTA population from University of Wisconsin and the Salk population..........373-10Autoradiograph of Southern blot analysis of max3 plants.....................................383-11Phenotypes of max3-11 plant compared to wild-type (Col)...................................393-12b-ionone content in max3 rosettes as compared to wild-type.................................433-13CCD7 expression in max3-10...............................................................................443-14 IAA and ABA content within max4-10 rosettes compared to wildtype (Ws).........464-1Proposed activity of CCD8...................................................................................484-2Import of in vitro transcribed and translated CCD8 precursor protein...................484-3Time monitored plastid import assay with CCD8.................................................494-4Expression pattern of CCD8 as determined by Real time PCR..............................504-5Positions of T-DNA insertions within CCD8........................................................534-6Schematic of T-DNA region of vectors used for transformation to create the Alphapopulation from University of Wisconsin and the Syngenta population................534-7Autoradiograph of Southern blot analysis of max4 plants.....................................554-8Phenotypes of max4-6 plant compared to wild-type (Col).....................................574-9IAA and ABA content in max4-6 rosettes compared to wild-type (Col)................585-1Analysis of ccd1max4 double mutant...................................................................625-2Analysis of max3max4 double mutant..................................................................645-3Effect of loss-of-function mutants on transcript abundance of all three CCDs.......66

PAGE 11

xi Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy THE CAROTENOID CLEAVAGE DIOXYGENASES OF ARABIDOPSIS THALIANA By Michele Elena Auldridge December 2004 Chair: Harry J. Klee Major Department: Plant Molecular and Cellular Biology Dioxygenases are critical players in essential metabolic pathways in both plants and animals. Several subclasses of dioxygenases exist, one of which is the recently discovered Carotenoid C leavage D ioxygenase (CCD) family that has been most studied in the plant species Arabidopsis thaliana Arabidopsis has nine CCDs, identified because of their similarity to the maize VP14 enzyme. VP14 was the first CCD cloned and is involved in the production of the phytohormone abscisic acid. Five of the Arabidopsis dioxygenases are involved in ABA biosynthesis. The remaining four family members seem less likely to be involved in ABA biosynthesis because of their sequence divergence from VP14. Here, three of the Arabidopsis CCDs, CCD1 7 and 8 were characterized biochemically and genetically. In vitro assays have confirmed the identification of CCD1 and CCD7 as carotenoid dioxygenases by demonstrating their capacity to cleave a variety of carotenoids. CCD8 possesses activity on one of the apocarotenoids resulting from

PAGE 12

xii CCD7s activity on b -carotene. Despite its confirmed activity on carotenoids, CCD1 was not localized to the plastid, whereas CCD7 and CCD8 were plastid localized. Loss-offunction mutants were isolated for each CCD studied and their associated phenotypes were analyzed. The CCD1 mutants showed a decrease in petiole and leaf blade lengths but were like wild-type in all other aspects of growth and development. CCD7 and CCD8 mutants exhibited identical phenotypes consisting of decreased petiole and leaf blade lengths and an increased branching pattern, found to be independent of the synthesis of auxin and abscisic acid (ABA). CCD7 and CCD8 are involved in the biosynthesis of a novel signaling molecule, which controls branching in Arabidopsis. The signaling molecule has not yet been identified but is derived from a carotenoid backbone by the sequential action of CCD7 and CCD8 activity.

PAGE 13

1 CHAPTER 1 INTRODUCTION Carotenoid Cleavage Dioxygenase Family Recently a new class of dioxygenases, Carotenoid C leavage D ioxygenases (CCD ), was discovered, with representatives found in both the plant and animal kingdoms. The first gene encoding a carotenoid cleavage dioxygenase was isolated from the maize abscisic acid deficient, viviparous mutant, vp14 VP14 encodes a CCD that catalyzes the first step in ab scisic a cid (ABA ) biosynthesis. ABA is a plant hormone necessary for resistance to drought and is also involved in dormancy such that mutants which lack appropriate ABA concentrations and/or sensitivity to ABA germinate precociously (Finkelstein et al., 2002). The members of this new family of dioxygenases share several characteristics: they contain five conserved histidines spread throughout their primary protein sequence, they all require Fe 2+ ions thought to be coordinated by the five histidine residues (Schwartz et al., 1997; Kiefer et al., 2001; Redmond et al., 2001) and they all contain a conserved polypeptide segment at their carboxy terminus that minimally constitutes a signature sequence for the family (Fig. 1-1A) (Redmond et al., 2001) Mechanistically, all CCDs of plant and animal origin are presumed to act similarly in that they incorporate both oxygen atoms from molecular oxygen into their substrates across a double bond resulting in the production of two aldehyde-containing cleavage products. The double bond broken is that of a carotenoid molecule and the resulting products are aldehyde-containing terpenoid compounds, called apocarotenoids.

PAGE 14

2 Figure 1-1 The Carotenoid Cleavage Dioxygenase (CCD) family. A) Conserved region at the carboxy terminus of all CCD family members. Four members from Arabidopsis (CCD1, NCED3, CCD7, and CCD8) and three from human ( dioxI, -dioxII, and RPE65) are shown. B) Phylogenetic tree of representative members from maize, avocado, bean, crocus, rice, pea, petunia, tomato and human. All Arabidopsis members (underlined) identified to date are shown. Alignment and phylogenetic tree were created with ClustalX and TreeView. Numbers at major nodes of tree are bootstrap values out of 1000 bootstrap trials and represent a confidence level for each grouping. B.

PAGE 15

3 CCDs have been found in several plant species including tomato (Burbidge et al., 1999; Simkin et al., 2004a), bean (Qin and Zeevaart, 1999) cowpea (Iuchi et al., 2000), avocado (Chernys and Zeevaart, 2000), bixa (Bouvier et al., 2003a), crocus (Bouvier et al., 2003b), and petunia (Simkin et al., 2004b). They have also been identified in drosophila, mouse, zebrafish and humans (von Lintig and Vogt, 2000; Kiefer et al., 2001; Redmond et al., 2001; Lindqvist and Andersson, 2002). Arabidopsis thaliana is a representative species for study of the CCD family because the entire family has been identified and many members have been well characterized both genetically and biochemically (Schwartz et al., 2001; Tan et al., 2003; Booker et al., 2004). Based on sequence homology to VP14, nine putative CCDs have been identified in the Arabidopsis genome. Figure 1-1B shows a phylogenetic tree containing the Arabidopsis CCDs. This tree illustrates the divergence found within the Arabidopsis CCD family. Five of the members group with the maize protein VP14, whereas the remaining four members are less similar to VP14. The CCD family members in Arabidopsis are listed in Table 1-1 along with their accession numbers, chromosome locations, and gene identifications. The family is divided into two groups, the carotenoid cleavage dioxygenases (CCDs) and the Table 1-1. The CCD Gene Family of Arabidopsis Gene Accession Chromosome Gene ID AtCCD1 AJ005813 3 At3g63520 AtNCED2 AL021710 4 At4g18350 AtNCED3 AB028617 3 At3g14440 AtCCD4 AL021687 4 At4g19170 AtNCED5 AC074176 1 At1g30100 AtNCED6 AB028621 3 At3g24220 AtCCD7 AC007659 2 At2g44990 AtCCD8 AL161582 4 At4g32810 AtNCED9 AC013430 1 At1g78390

PAGE 16

4 9-cis-epoxycarotenoid dioxygenases (NCEDs). These designations refer to the substrate preference of the enzyme. In this work, three members (CCD1, CCD7, and CCD8) of the CCD family in Arabidopsis are studied both molecularly and genetically. These three members were chosen for study because of their significant divergence from the remaining members in gene structure and sequence homology to VP14 (Table 1-2). CCD4 was originally thought to belong to the NCED subgroup in the CCD family mostly due to its gene structure and was not included in the present study. However, recent biochemical studies show that it belongs to the CCD subgroup (see Activity section in this chapter). Table 1-2. Comparison of the CCD and NCED gene structures and identities to VP14. Family Member Intron # % Identity to VP14 AtCCD1 13 37 AtNCED2 0 64 AtNCED3 0 67 AtCCD4 0 41 AtNCED5 0 66 AtNCED6 0 57 AtCCD7 5 21 AtCCD8 5 26 AtNCED9 0 67 Carotenoids The dioxygenases discussed here use carotenoids as substrates. Therefore, a brief discussion on carotenoid biosynthesis, function, and location within the cell is appropriate. Carotenoids are C 40 compounds, with a series of conjugated double bonds, produced in the plastids of plants. The condensation of two geranylgeranyl diphosphate molecules to form phytoene is the first committed step in the carotenoid biosynthetic pathway (Fig. 1-2). Geranylgeranyl diphosphate is a C 20 compound formed from the sequential addition of three molecules of the 5 carbon compound isopentenyl

PAGE 17

5 Figure 1-2. Carotenoid biosynthetic pathway. Abbreviations are as follows; Pds,phytoene desaturase; Zds, z-carotene desaturase; Lcy-e, lycopene e-cyclase;Lyc-b, lycopene b-cyclase; CrtR-b, b-ring hydroxylase; CrtR-e, e-ringhydroxylase;, Zep1, zeaxanthin epoxidase; Vde1, violaxanthin de-epoxidase;Nxs, neoxanthin synthase Adapted from (Hirschberg, 2001).pyrophosphate (IPP) to its isomer dimethylallyl diphosphate (DMADP). IPP is the basiccomponent of all isoprenoid compounds, including such diverse plant metabolites ascytokinins, chlorophylls, gibberellins, sesquiterpenes and sterols (Cunningham and Gantt,1998). There are two pathways leading to the synthesis of IPP, the cytosolicacetate/mevalonate (MVA) pathway and the plastid localized 1-deoxy-D-xylulose-5-phosphate (DOXP) pathway. In higher plants, sterols and sesquiterpenes are made up of

PAGE 18

6 IPP molecules formed via the MVA pathway in the cytosol, whereas carotenoids, cytokinins, chlorophylls and gibberellins consist of IPP molecules formed via the DOXP pathway in the plastid (Lichtenthaler, 1999). The formation of phytoene is followed by several desaturation steps, resulting in synthesis of the linear carotenoid lycopene. The cyclic carotenoids are produced through the sequential cyclization of lycopenes ends. Some carotenoid molecules contain oxygen as a consequence of subsequent hydroxylation and/or epoxidation reactions. These carotenoids are called xanthophylls. It has been hypothesized that the enzymes involved in carotenoid biosynthesis are part of a multi-enzyme complex associated with the thylakoid membrane (Cunningham and Gantt, 1998). A multi-enzyme complex would allow for concomitant regulation of the pathway, with each of its components being dependent on functional operation of the other components. This also would decrease the substrate available for degradation if, once the carotenoid precursors are fed into the complex, they do not emerge until formed into the carotenoid dictated by the final enzyme. If this were so, the substrates available for cleavage by dioxygenases would be tightly regulated. Carotenoids have two main functions in photosynthesis. Because of their system of conjugated double bonds, they are able to absorb energy from photons. The number of double bonds dictates the maximum absorption of the carotenoid molecule. The absorption maxima range from 400 to 500nm. Carotenoids are able to absorb energy from sunlight and pass it on to nearby chlorophyll molecules to be used in photosynthesis. In this way, they act as accessory pigments to chlorophyll and are part of the light harvesting complexes associated with the photosystems within the thylakoid

PAGE 19

7 membranes. They are also able to accept energy from excited triplet state chlorophyll molecules. If carotenoids were not present to receive this energy from the overly excited chlorophyll molecules, formation of singlet state oxygen radicals could result (van den Berg, 2000). Depending on the light environment, it may be necessary to adjust the carotenoid content of the photosystems. CCDs may degrade photosynthetic carotenoids in order to achieve the optimal carotenoid content necessary for a particular light environment. Carotenoids are also thought to function as membrane stabilizers. In general the thylakoid membranes are fairly fluid. This fluidity allows movement of the photosystems and light harvesting complexes, which is essential for maximizing photosynthesis and minimizing photo-oxidative damage in different light conditions. Most carotenoids found within the thylakoid membranes are associated with the light harvesting complexes. However, there are some carotenoids that are not, and may instead act to rigidify the thylakoid membrane. High solar irradiances are usually associated with increased heat. An increase in temperature can cause disorganization of lipid bilayers, allowing for breakdown of protein complexes such as those found in the photosystems and light harvesting complexes. Therefore, an increase in the concentration of stabilizing carotenoids in membranes could protect the thylakoid membranes during periods of increased solar irradiance. One carotenoid implicated in this process is zeaxanthin. With its polar hydroxyl groups at each end of the molecule, zeaxanthin inserts itself almost perpendicular to the thylakoid membrane, acting to decrease membrane fluidity (Havaux, 1998). A possible function of carotenoid cleavage dioxygenases in regulating membrane fluidity could be envisioned. In vitro alltrans -zeaxanthin is a possible substrate for

PAGE 20

8AtCCD1 (Schwartz et al., 2001). The action of a CCD could facilitate the xanthophyllcycle in zeaxanthin turnover resulting in a quick increase in membrane fluidity.Localization of the CCDs, not only within the plastid but also in association with thethylakoid membranes, will be integral in determining whether this function is apossibility in vivo.ApocarotenoidsProducts resulting from the degradation of a carotenoid at any of its double bondsare called apocarotenoids. To date, many apocarotenoids and, in some cases, thedioxygenases responsible for their production have been identified in plants and animals.Five major sites of cleavage are illustrated in Figure 1-3 by arrows pointing to the 7,8,9,10, 11,12, 13,14 and 15,15 double bonds of b-carotene. Alternatively, owing to thesymmetrical nature of carotenoid molecules, cleavage can also occur at the 7,8, 9,10,11,12 and 13,14 double bonds. Several examples of apocarotenoids are discussedbelow with respect to the carotenoid precursor and the site of its cleavage. Figure 1-3. b-carotene with its major sites of cleavage indicated by arrows.The most accessible double bonds of b-carotene to cleavage are numbered inFigure 1-3. However in linear carotenoids such as lycopene the 5,6 (5,6) double bond isopen for attack by a dioxygenase. Such is the case for the reaction at the start of bixinbiosynthesis (Bouvier et al., 2003a). Bixin is an apocarotenoid that is a valued foodcolorant. Cleavage at the 7,8 (7,8) double bond of zeaxanthin leads to the production of

PAGE 21

9 safranal, the most abundant constituent of saffron flavor (Bouvier et al., 2003b). Cyclic C 13 apocarotenoids result from cleavage at the 9,10 (9,10) double bond of carotenoids with cyclized ends. Due to their volatile nature, these C 13 apocarotenoids are constituents of the flavor and aroma of various fruits and vegetables. They include ionone derivatives (found in rose, tomato, tea), theaspirone (found in tea), and -damascenone (found in wine, rose, tomato) (Winterhalter and Rouseff, 2002). Interestingly, -ionone, formed by cleavage of -carotene, has been shown to have antifungal activities (Fester, 1999) Asymmetric cleavage of a carotenoid molecule at its 9,10 double bond produces both C 13 and C 27 apocarotenoids. An example of a C 27 apocarotenoid is the biologically active retinoic acid. In animals, retinoic acid regulates gene expression through its binding to two types of nuclear receptors, retinoic acid receptors (RARs) and retinoid X receptors (RXRs) (Mangelsdorf et al., 1993) In plants, cleavage at the 11,12 position (or 11,12 depending on carotenoid substrate) of 9-cis epoxycarotenoids produces xanthoxin, which is the precursor to the plant hormone ABA (Schwartz et al., 1997; Tan et al., 1997). Apocarotenoids resulting from cleavage at the 13,14 (13,14) double bond have not been reported. However, further cleavage of an apocarotenoid at this double bond was demonstrated for the Arabidopsis CCD8 enzyme (For further details, see next section as well as Chapter 4). Finally, central cleavage at the 15,15 double bond breaks the carotenoid molecule in half. With -carotene as a substrate, central cleavage gives rise to two molecules of retinal (C 20 ). Retinal interacts with the protein opsin in the eye and acts as the visual chromophore making vision possible (Saari, 1994).

PAGE 22

10 Carotenoid Cleavage Dioxygenase Activity in Arabidopsis The members of the CCD family in Arabidopsis share the sequence characteristics found in all CCDs but they diverge into two groups, the NCEDs and the CCDs, based on their characterized or inferred substrate preference. The acronym NCED refers to the substrate, 9cis -epoxycarotenoid, which is the preferred substrate for these dioxygenases. Figure 1-4 summarizes the enzymatic activity associated with all of the Arabidopsis CCDs. VP14 belongs to the NCED group. It acts specifically at the 11,12 double bond of either of two 9-cis-epoxycarotenoids, violaxanthin or neoxanthin, to produce xanthoxin, the precursor to ABA (Schwartz et al., 1997). Four of the nine Arabidopsis dioxygenases (NCED2, NCED3, NCED6, and NCED9) have been shown to possess the same activity as VP14 and are designated NCEDs (Iuchi et al., 2001). NCED5 displays high sequence homology to VP14, however its activity has yet to be determined. The remaining four proteins diverge from the family and have been given the general designation of CCD. Two of the CCDs, CCD1 (see Chapter 2) (Schwartz et al., 2001) and CCD7 (see Chapter 3) (Booker et al., 2004), have been shown to cleave various substrates. They do, however, cleave their substrates specifically at the 9,10 double bond. They differ in that CCD1 cleaves its substrates symmetrically, whereas CCD7 cleaves asymmetrically (Schwartz et al., 2004). For example with b -carotene as a substrate, CCD1 produces two C 13 products (both b -ionone) and one central C 14 dialdehyde. Conversely, CCD7 produces one b -ionone product and the C 27 product, 10-apob -carotenal. A possible explanation for this distinct set of cleavage reactions is that CCD1 acts as a dimeric protein (Schwartz et al., 2001). CCD4 has yet to be biochemically characterized.

PAGE 23

11 However, apocarotenoids such as 6-methyl-5-heptene-2-one have been found in tomato (Baldwin, 2000) and apple (Cunningham, 1986) These apocarotenoids result from cleavage at the 5,6 double bond. CCD4 orthologs may be the CCDs responsible for the production of these volatile apocarotenoids (B.C. Tan, personal communication). CCD8, along with CCD7, is involved in the synthesis of a biologically active compound (See Figure 1-4. Activity of the Arabidopsis CCD family members, showing their divergence in substrate specificity and cleavage site (indicated by small arrows). The NCEDs all cleave 9-cis-epoxycarotenoids at the 11,12 double bond, where as CCD1 and CCD7 cleave a variety of substrates ( b -carotene is shown as a representative substrate) at the 9,10 (and/or 9) double bond. CCD8 cleaves the C 27 product of CCD7s activity on b -carotene at the 13,14 double bond. The activity of CCD4 is unknown, however CCD4 has been hypothesized to be the unidentified 5,6 cleaver.

PAGE 24

12 Chapters 3 and 4). The compound has not been identified but CCD8 does show cleavage activity on the C 27 cleavage product resulting from the activity of CCD7 on b -carotene (Schwartz et al., 2004). In Summary Carotenoids are essential plant pigments. They act as both accessory pigments to increase the harvested light used for photosynthesis and as antioxidants to protect the components of the photosystems from oxidative damage (van den Berg, 2000). The catabolism of carotenoids leads not only to regulation of the above mentioned processes but also to the production of secondary metabolites, which may have equally important functions in the plant. These apocarotenoids include the biologically active compounds ABA, retinal and its derivatives, and -ionone. Although apocarotenoids are important metabolites in plants, animals and bacteria little is known about the mechanisms involved in their production. Arabidopsis provides an excellent model system for the study of genes whose products are involved in the production of apocarotenoids. Of the nine carotenoid cleavage dioxygenases identified in Arabidopsis, five have been linked to ABA synthesis (Iuchi et al., 2000; Tan et al., 2003) and one to the production of C 8 apocarotenoids (B.C. Tan, personal communication). The remaining three family members are studied here. The following three chapters discuss the characterization of CCD1, CCD7, and CCD8, respectively. Within each chapter the following topics will be discussed: 1) enzymatic activity of the CCD, either previously determined or elucidated in this study; 2) subcellular, and when appropriate suborganellar, localization of the protein product; 3) analysis of the CCD expression pattern on a whole plant level and as a consequence of

PAGE 25

13 exertion of environmental stimuli such as water stress or day length; and 4) the effect of loss of CCD function on plant development, metabolism, and growth. The subsequent chapter deals with the genetic and molecular interaction of all three CCDs studied and is followed by a discussion on results presented.

PAGE 26

14 CHAPTER 2 CAROTENOID CLEAVAGE DIOXYGENASE 1 (CCD1) Activity The Arabidopsis CCD1 cleaves a variety of carotenoid substrates (Schwartz et al., 2001). CCD1 is, however, specific in regard to the site of cleavage, which always occurs at the 9,10 (9,10) double bond irrespective of substrate. This activity was determined both in vitro with a recombinant CCD1 enzyme and in vivo by way of a heterologous E. coli based system (also used for CCD7, see Chapter 3). As an example of its activity, the use of b -carotene as a substrate produces two molecules of the cyclic C 13 compound, b ionone, and an acyclic C 14 dialdehyde, which corresponds to the central portion of the carotenoid molecule (Fig. 2-1). The C 14 dialdehyde accumulated in the reactions involving CCD1, indicating that it may act as a dimer cleaving both ends simultaneously (Schwartz et al., 2001). Figure 2-1. CCD1 activity with b -carotene as a substrate. CCD1 cleaves at the 9,10 and 9,10 double bonds of all its substrates. In the case of b -carotene (1), this activity produces two molecules of b -ionone (2) and a C 14 dialdehyde (3). 1 2 3 2

PAGE 27

15 Subcellular Localization The enzymes responsible for carotenoid biosynthesis are located within plastids (Cunningham and Gantt, 1998). Due to their hydrophobic nature carotenoids once synthesized for the most part remain in the plastid. Because CCD1 possesses carotenoid cleavage activity, the possible localization of CCD1 within the plastid was determined. Proteins destined for the plastid typically contain a sequence at their amino terminus called a transit sequence. The protein with its transit sequence attached is a preprotein. Soluble factors within the cytoplasm recognize the transit sequence and chaperone the preprotein to the outer membrane of the plastid. Translocation machinery on both the inner and outer membranes of the plastid inserts the preprotein into the plastid stroma. If the preprotein possesses a cleavable transit peptide, then it is processed into the mature protein by removal of the transit sequence. The mature protein can either remain in the stroma or it can be targeted to the thylakoid, or inner, or outer membranes (Soll and Schleiff, 2004). Although strong conservation in transit sequences does not exist, with the use of computer algorithms a set of general characteristics make it possible to theoretically predict the targeting of a protein into the plastid. CCD1 does not possess a plastid transit sequence, as predicted by the chloroplast prediction program TargetP (v 1.0) (Emanuelsson et al., 2000) In order to experimentally determine the subcellular localization of CCD1, chloroplast import assays were performed following the procedure of Cline et al. (Cline et al., 1993). Briefly, following in vitro transcription and translation, the precursor proteins were incubated with isolated pea chloroplasts. After import reactions, intact chloroplasts were treated with the protease, thermolysin. Import into the plastid would protect the proteins from degradation by thermolysin. No import

PAGE 28

16 would allow thermolysin to come into contact with the proteins thus degrading them. The small subunit of ribulose 1,5-bisphosphate carboxylase/oxygenase (ssRubisco), known to be targeted to the chloroplast stroma, was used as a control for import. VP14, the maize NCED, is also chloroplast localized and served as a second comparison. Previously, VP14 was localized to the stroma and, to a lesser extent, associated with the thylakoid membrane (Tan et al., 2001) CCD1 was not imported into the plastid as indicated by its sensitivity to thermolysin treatment (Fig. 2-2). In contrast, both VP14 and ssRubisco were resistant to thermolysin, confirming their import into plastids. Figure 2-2. Import of in vitro transcribed and translated CCD1 precursor protein (pP) into pea chloroplasts compared with ssRubisco (ssRub) and VP14. Following import, chloroplasts were treated with thermolysin (+T). Expression Analysis Although transcript expression does not equate with protein accumulation, it does provide information regarding the regulation of the gene in question, whether this be developmental, morphological or as a consequence of external stimuli. An expression

PAGE 29

17 analysis of CCD1 transcript was performed by a quantitative Real Time RT-PCR method, using Taqman primers and probes. First, the major organs of wild-type Arabidopsis Figure 2-3. Organs of wild-type Arabidopsis used in morphological expression analysis. RNA was extracted from petioles, leaf blades, and roots before bolting. Flowers, siliques, primary and secondary stems were harvested after bolting. Figure 2-4. Expression pattern of CCD1 as determined by quantitative Real Time RTPCR. Data represented as % mRNA after comparison to a standard curve of known quantity. Bars represent standard deviation of the mean.

PAGE 30

18 plants, Col umbia ecotype (Col ), were dissected and CCD1 transcript abundance within each was measured. These organs included root, petiole, leaf blade, primary stem, secondary stem, lateral stem, flower, and silique (Fig. 2-3). CCD1 transcript was present in all organs tested and accumulated to a greater extent in siliques and flowers (Fig. 2-4). To explore the possible effect of CCD function on ABA-related processes, the effect of drought stress on CCD1 expression was examined. An increase in expression of all NCEDs was seen following water stress with NCED3 showing the most prominent increase (Tan et al., 2003). The importance of NCED3 in drought stress tolerance was underlined by the observation that transgenic plants lacking NCED3 function were more sensitive to drought stress than wild-type (Iuchi et al., 2001). From activity data CCD1 does not appear to be involved in ABA biosynthesis; however, its expression may be regulated in a drought dependent manner in order to provide more substrates to the NCEDs for ABA production. A water stress was applied to wild-type seedlings by allowing them to lose 15% of their fresh weight. CCD1 expression did not change significantly as a result of the water stress (Fig. 2-5). Figure 2-5. Changes in CCD1 expression due to water stress. CCD1 expression ( S.E.) found in nonstressed seedlings (NS) and stressed seedlings (S).

PAGE 31

19 Loss-of-Function Mutants Isolation of Mutant The function of CCD1 in plant development, metabolism, and growth may be inferred by observations of the effect of its functional loss. A reverse genetics approach was taken to reach this end by isolating insertional mutants from the Wisconsin Knockout Population (Krysan et al., 1999) and Syngentas SAIL population (Sessions et al., 2002). See Materials and Methods (Chapter 7, Isolation of loss-of-function mutants) for further discussion on populations and screening process. The insertional mutant from the Wisconsin Knock-out Population was lost during the screening process. However, a mutant was successfully obtained from the SAIL population. The site of insertion of the T-DNA within CCD1 was verified by first cloning then sequencing the junction. A schematic showing the site of insertion in the 6 th intron of CCD1 is shown in Figure 2-6. As the only CCD1 loss-of-function mutant isolated this allele was designated ccd1-1 Figure 2-6. Location of T-DNA insert in CCD1 Exons are represented by black boxes and introns by intervening lines. The T-DNA insert (inverted triangle) was verified to be within the 6 th intron of CCD1 Restriction enzymes used for Southern analysis are shown (see below). Two transformation vectors were constructed for creation of the SAIL population. The pCSA110 vector was used in the transformation event that resulted in ccd1-1 The T-DNA present within this vector carries the BAR gene for resistance to BASTA, a GUS reporter gene driven by the pollen-specific promoter LAT52, and left and right borders

PAGE 32

20 for transformation with Agrobacterium tumefaciens (Fig. 2-7) (McElver et al., 2001). Plants homozygous for the insert were identified by PCR (See Chapter 7, Isolation of loss-of-function mutants). In order to determine T-DNA number within ccd1-1 plants, DNA from plants homozygous for the T-DNA insertion was extracted and digested for Southern blot analysis using a cloned BAR cDNA as the probe (Fig. 2-8). The following restriction enzymes were chosen for digestion of genomic DNA; Bgl II, Xba I, and Hind III. Each of these enzymes cuts within the T-DNA but outside of the BAR coding region. Therefore, one band on the Southern indicates a single insertion, two bands indicates two insertions, and so on. Three bands were visible on the autoradiograph in the regions corresponding to lanes containing DNA digested with Bgl II or Hind III indicating three insertions. Digestion with Xba I resulted in one band. This band was of greater intensity than the bands seen in the other lanes possibly as a result of co-migrating pieces of DNA but cannot be interpreted definitively. The Southern analysis indicates the presence of three T-DNA inserts within ccd1-1 plants. Figure 2-7. Schematic of T-DNA used for transformation to create SAIL population. Locations of restriction enzymes used in Southern analysis of ccd1-1 are shown. Morphological Analysis of ccd1-1 All mutants from the SAIL population are in the Col ecotype background so all measurements of ccd1-1 were compared to Col plants. Both Col and ccd1-1 seeds were planted in soil and grown in short days. Plants were grown until their rosettes

PAGE 33

21 Figure 2-8. Autoradiograph of Southern blot analysis of ccd1-1 plants. Wild-type (Col) was used as a negative control. Molecular weight markers are shown at left. Enzymes used for digestion are indicated at top. Three T-DNA inserts were found in ccd1-1 plants. DNA from ccd8-2 were done on same blot, see Chapter 4. contained 30-37 leaves at which time measurements of petiole and leaf blade length were taken from the 13 th through the 22 nd leaf. The ccd1-1 rosettes prior to bolting were smaller than Col (Fig. 2-9). An average of the 13 th through the 22 nd leaf ( S.E.) produced data showing ccd1-1 petioles were significantly shorter than Col (17.80 0.35 vs. 19.58 0.48, ANOVA P-value = 0.003), whereas leaf blades were not (21.27 0.40

PAGE 34

22 Figure 2-9. Wild-type (Col) and ccd1-1 rosettes before bolting. Plants were grown in short days until a leaf number of 30-37 was reached. ccd1-1 rosettes were smaller than wild-type. vs. 22.38 0.56, ANOVA P-value = 0.136). The significant decrease in petiole length was intriguing as CCD1 transcript was found to accumulate in petiole tissue (Fig. 2-4). However, upon further review of the measurements both petioles and leaf blades were only smaller than wild-type in the 13 th through 16 th leaves. The petiole and leaf blade lengths in ccd1-1 plants increases incrementally from leaf 17 to leaf 22 (Fig. 2-10). Plants were allowed to continue growing in short days until they made the transition to flowering. Infloresence number was counted two weeks following emergence of the primary inflorescence. The inflorescence number of ccd1-1 plants equaled that observed in wild-type plants (1 0.0). b -ionone Content of ccd1-1 CCD1 cleaves several carotenoids at their 9,10 double bonds. This activity was shown with the recombinant enzyme in vitro as well as in a heterologous E. coli based system (Schwartz et al., 2001). However it has not yet been demonstrated within the plant.

PAGE 35

23 Figure 2-10. Petiole and leaf blade lengths of wild-type (Wt) vs. ccd1-1 plants. Blade and petiole lengths ( S.E.) of ccd1-1 were on average smaller than wild-type from leaf number 13 to 16. The loss-of-function mutant was used to address this issue by determining if loss of a predicted product formed due to CCD1 activity corresponded to a loss in CCD1 function. The product chosen for measurement was b -ionone. CCD1 activity produces two molecules of b -ionone after cleavage of b -carotene at its 9,10 double bonds (Schwartz et al., 2001). b -ionone is a volatile apocarotenoid and as such is thought to be a major constituent of flavor in fruits and vegetables (Winterhalter and Rouseff, 2002). Because of its volatile nature, b -ionone is easily detected by gas chromatography/mass

PAGE 36

24 spectrometry (GC/MS). A method was developed for the extraction and detection of b ionone from Arabidopsis plants (see Chapter 7, b -ionone Measurements). b -ionone was found in very small quantities (ng/g tissue) within Arabidopsis rosettes therefore several trials were performed to get an accurate picture of b -ionone production within the plants. Trials consisted of plants grown several months apart but in similar controlled environments. Trial 1 showed a significant decrease in b -ionone within ccd1-1 plants as compared to Col. Trial 2 only showed a slight, non-significant decrease in b -ionone within ccd1-1 plants and finally trial 3 showed no change in b ionone within ccd1-1 plants (Fig. 2-11). The overall increase seen in Trial 2 plants compared to the other trials may be the result of a fungal gnat infestation within the growth chamber at that period. Increases in b -ionone production have been linked to pathogen infection (Wyatt, 1992). The ccd1-1 plants in all trials show accumulation of b ionone indicating the existence of a second CCD responsible for b -ionone production. CCD7 (see Chapter 3) does posses cleavage activity at the 9,10 double bond of b carotene (Booker et al., 2004; Schwartz et al., 2004). Although, not experimentally tested in the present study, CCD7 may be regulated such that its levels increase during pathogen infection. Presently, no antibody for CCD1 has been developed therefore the existence of a partially functional CCD1 cannot be overlooked. However, a truncated protein of only 192 amino acids would be possible due to the T-DNA insertion site within CCD1 Determination of Abscisic Acid Content within ccd1-1 Plants As a member of the CCD family, CCD1 has sequence homology to VP14, the ABA biosynthetic enzyme from maize. In vitro CCD1 does not posses the same activity as

PAGE 37

25 Figure 2-11. b -ionone levels within wild-type (Col) and ccd1-1 plants measured in three trials. Bars represent standard error of the mean. VP14 or the Arabidopsis NCEDs. It is unlikely that CCD1 function would have an affect on ABA production. However, the carotenoid substrates of CCD1 are metabolically linked to the carotenoid precursors of ABA in that the carotenoid precursors to ABA are possible CCD1 substrates (Schwartz et al., 2001). For example, a link between the auxin and glucosinolate biosynthetic pathways was discovered after a lesion in the glucosinolate pathway (at CYP83B1) not only resulted in loss of glucosinolates but also plants with auxin overexpression phenotypes (Bak et al., 2001). In a second more unfortunate example, researchers attempting to increase carotenoid content in tomatoes found that their transgenic plants were dwarfed due to a decrease in gibberellin synthesis. Carotenoids and gibberellins share a common precursor in geranyl-geranyl diphosphate such that changes through the carotenoid biosynthetic pathway affected flux through the gibberellin pathway (Fray, 1995). To determine the effect of loss of CCD1 function on ABA biosynthesis, ABA content in ccd1-1 plants was determined. No alteration in ABA content was seen in the ccd1-1 plants (Fig. 2-10).

PAGE 38

26 Figure 2-10. ABA content in ccd1-1 vs wild-type (Col) rosettes. Bars represent standard error of the mean. In Summary CCD1 possesses cleavage activity at the 9,10 (9,10) double bond of a variety of carotenoids (Schwartz et al., 2001). Its role in carotenoid catabolism is intriguing because it was not targeted to plastids, the major site of carotenoid accumulation. How CCD1 comes into contact with carotenoids is a further point of study. CCD1 may interact with the plastid outer envelope or may have access to carotenoids only during chloroplast degeneration. The high CCD1 transcript abundance in flower tissue suggests a biological function because b -ionone, a product of CCD1 cleavage activity on b carotene, is a known constituent of floral scent. The involvement of CCD1 in plant growth is suggested by the decrease in petiole and leaf blade lengths seen in the loss-offunction mutant. However, a true correlation can only be made after complementation of the petiole phenotype with a wild-type copy of CCD1 is shown. The ccd1-1 :CCD1OE plants are currently growing. A second on-going experiment concerns the effect of placing CCD1 inside the plastid. This experiment may further our understanding on the localization of CCD1 outside of the plastid as well as provide information regarding the

PAGE 39

27 carotenoid-derived signal found through the analysis of CCD7 loss-of-function mutants (See Chapter 3 and Chapter 6 for further discussion).

PAGE 40

28 CHAPTER 3 CAROTENOID CLEAVAGE DIOXYGENASE 7 (CCD7) Activity Originally designed to identify proteins involved in carotenoid biosynthesis, E. coli cells engineered to accumulate certain carotenoid molecules have been utilized as a screen for CCD activity (von Lintig and Vogt, 2000; Kiefer et al., 2001; Redmond et al., 2001; Schwartz et al., 2001). The foundation for these studies is if a protein metabolizes a carotenoid substrate then an observable loss of color would occur upon induction of the protein. The loss of color would be due to metabolism of the accumulating carotenoid and may correspond with an increase in apocarotenoid production. To determine its activity, CCD7 was expressed in E. coli engineered to over-express certain carotenoid biosynthetic genes. The strains utilized in this study accumulated the following carotenoids: phytoene, z -carotene, lycopene, d -carotene, b -carotene and zeaxanthin (Cunningham et al., 1994; Cunningham et al., 1996; Sun et al., 1996). The latter four produced an observable color. However, upon induction of CCD7, color development was diminished, suggesting metabolism of the carotenoid substrates (Fig. 3-1). In order to verify this metabolism, carotenoids were extracted from E. coli cultures and analyzed by HPLC (See Chapter 7, Carotenoid/Apocarotenoid Extraction from E.coli ). CCD7 induction resulted in significant decreases in the carotenoid substrates (Fig. 3-2). The HPLC chromatograms obtained with representative linear ( z -carotene) and cyclic ( b carotene) carotenoids are shown in Figure 3-3A and B.

PAGE 41

29 Figure 3-1. E. coli lines accumulating lycopene, d -carotene, b -carotene or zeaxanthin. Lines in which CCD7 expression was induced (I) was compared to those in which CCD7 was uninduced (UI). Figure 3-2. Results from HPLC analysis of carotenoid content in each carotenoid accumulating E. coli line plus (I) or minus (UI) co-expression of CCD7. Two trials were performed. Data from each trial is expressed as a percentage of uninduced samples. In order to determine the cleavage site within each carotenoid, GC-MS analysis was used to identify products. Products consistent with cleavage at the 9,10 or 9,10 position were identified in strains that accumulated z -carotene and b -carotene. Figure 33C and D show increases in geranyl acetone (the product of z -carotene cleavage) and b ionone (the product of b -carotene cleavage), respectively. Owing to the symmetrical nature of all of the tested carotenoids, these results do not address whether each substrate is cleaved symmetrically or asymmetrically. In each case, the small amounts of geranyl acetone and b -ionone present in the uninduced cultures is likely due to a low level of

PAGE 42

30 expression of CCD7 prior to induction. These data demonstrate that CCD7 has CCD activity. Schwartz et al. have since reported on the identification of a C 27 apocarotenoid product resulting from CCD7 activity on b -carotene (Schwartz et al., 2004). Here researchers reported optimal activity only when b -carotene was used as a substrate. Figure 3-3. Analysis of carotenoid cleavage in E. coli expressing CCD7. E. coli accumulating either z carotene (A,C) or b carotene (B,D), either uninduced (top of each panel) or induced (bottom of each panel), were assayed for catabolism of the carotenoid substrate by HPLC (A,B) and production of volatile cleavage products by gas chromatography (C,D). Identities of the indicated volatiles were verified by co-elution with known standards and mass spectrometry. These studies corroborate the above finding that CCD7 cleaves at the 9,10 double bond and further show that this cleavage is asymmetrical by the identification of the C 27 apocarotenoid, 10-apob -carotene (Fig. 3-4).

PAGE 43

31 Figure 3-4. Reaction scheme of CCD7 activity on b -carotene (1) as demonstrated by Schwartz et al. (Schwartz et al., 2004). This activity produces b -ionone (2) and 10-apob -carotenal (3). Subcellular Localization As with CCD1, the subcellular localization of CCD7 was determined. CCD7 was predicted by TargetP (v 1.0) to be chloroplast localized with a transit peptide of 31 amino acids. Chloroplast import assays were again performed following the procedure of Cline et al. (Cline et al., 1993) using the small subunit of ribulose 1,5-bisphospate carboxylase/oxygenase (ssRubisco) and VP14 as positive controls for import into the stoma and thylakoid. Following in vitro transcription and translation, the CCD7 precursor protein was incubated with isolated pea chloroplasts. After import reactions, intact chloroplasts were either treated with the protease, thermolysin, or fractionated into envelope, stroma, and thylakoid compartments. Results show that CCD7 was resistant to thermolysin treatment, indicating its location inside the chloroplast (Fig. 3-5A). Fractionation of the chloroplast revealed that CCD7 was localized to the stroma (Fig. 3-5B). In addition, the reduced size of the imported mature protein indicated the existence of a cleaved transit peptide. The doublet bands observed may indicate some form of post-import 1 2 3

PAGE 44

32 modification, similar to that observed for several of the Arabidopsis NCED proteins following import (Tan et al., 2003) Figure 3-5. Import of in vitro transcribed and translated CCD7 precursor protein (pP) into pea chloroplasts compared with ssRubisco (ssRub) and VP14 (A) Following import, chloroplasts were treated with thermolysin (+T). (B) Chloroplasts were further fractionated to determine suborganellar localization to the envelope (E), stroma (S) or thylakiod (Th). For further verification of plastid localization one additional experiment was performed. Import assays were done using various incubation times. In vitro transcribed and translated CCD7 precursor protein was incubated with fresh pea chloroplasts for the following time periods, 0, 1, 2, 4, 8, 15, and 30 minutes. At each time point in order to stop further import, cold import buffer was added to the incubation mixtures, which were then kept in the dark and treated with thermolysin. Figure 3-6 shows that with increasing incubation time CCD7 was more resistant to thermolysin treatment indicating that more of the protein was imported into the chloroplast and therefore protected from degradation by thermolysin.

PAGE 45

33 Figure 3-6. Time monitored plastid import assay with CCD7. In vitro transcribed and translated CCD7 precursor protein (pP) was incubated with fresh pea chloroplasts for 0, 1, 2, 4, 8, 15, and 30 mins. Following incubation each assay mixture was thermolysin treated. Expression Analysis CCD7 transcript abundance was measured by quantitative Realtime PCR using Taqman primers and probes. The tissue used for analysis of expression was dissected in the same way as described in Chapter 2 (Fig. 2-3) for analysis of CCD1 expression. CCD7 transcripts were detected throughout the plant. Highest expression was seen in root tissue followed by primary stem tissue and siliques (Fig. 3-7). Even at its highest, CCD7 trancript abundance was approximately 50-fold lower than the highest CCD1 expression. Figure 3-7. Expression analysis of CCD7 trancript throughout wild-type Arabidopsis plants. CCD7 expression was observed in all tissue types at very low levels and was found mostly in root issue.

PAGE 46

34 As a consequence of a phenotype seen in the loss-of-function mutants in response to day length (see next section), expression of CCD7 in whole seedlings grown on short days was compared to seedlings grown on long days. Seedlings were grown for 14 days on a short day light schedule. On the 14 th day, a portion of the seedlings was switched to a long day light schedule for five more days. The two groups of seedlings were then compared for any changes in CCD7 expression. No significant change in CCD7 expression was apparent (Table 3-1). Although even less related to VP14 than CCD1 (see Chapter 1), CCD7 does maintain some homology to the ABA biosynthetic proteins. Moreover, CCD7 was shown to have activity on b -carotene, whose content within the plant may affect the content of the epoxycarotenoids, the precursors to ABA. Therefore, CCD7 was also tested for a role in ABA production. As previously stated, all of the Arabidopsis NCEDs were shown to have increased expression levels in response to water stress (Tan et al., 2003). In contrast, expression of CCD7 in seedlings was not altered by a water stress treatment imposed by allowing a 15% loss of fresh weight (Table 3-1). Table 3-1. CCD7 transcript abundance in whole seedlings (SE). Treatment % mRNA Short days 5.57E-06 .38E-06 Long days 4.29E-06 .07E-06 Nonstressed 1.21E-05 .04E-05 Stressed 1.54E-05 .25E-05 ANOVA showed results not to be significant at an P-value=0.05

PAGE 47

35 Loss-of-Function Mutants Isolation of Mutants Insertional mutants of CCD7 were isolated from the Wisconsin Knockout population (Weigel et al., 2000) and the Salk population (Alonso et al., 2003). The alleles were named max3-10 and max3-11, respectively. MAX stands for m ore ax illary branching. Four independent MAX loci have been identified and are so named due to the increased number of inflorescences growing out from the axillary meristems of the loss of function mutants (See next section) (Stirnberg et al., 2002; Sorefan et al., 2003; Booker et al., 2004). MAX3 is CCD7 Nine max3 alleles were identified via an ethyl methane sulfonate (EMS) screen for auxin-associated phenotypes. The two alleles isolated here and reported in Booker et al. sequentially follow the allele designations of the EMS mutants (Booker et al., 2004). The max3-10 allele is in the Wassilewskija (Ws) background and max3-11 is in the Columbia (Col) background. The insertion sites are illustrated in Figure 3-8. A primer specific for the left border of the T-DNAs and either a primer specific for a region just upstream of CCD7s start codon (forward) or a primer specific for a region just downstream of its stop codon (reverse) were used to amplify the T-DNA/ CCD7 junction sequence. The junction was cloned then sequenced to verify the T-DNA location within CCD7 In max3-10 the left border and forward CCD7 primer resulted in a product approximately 500 bp in length. The resulting sequence showed that the insert is located within the first exon of CCD7 No product was seen using the T-DNA primer and the reverse CCD7 primer, indicating that the T-DNA and CCD7 are in the same orientation. In max3-11 products were obtained when the left border and either forward or reverse CCD7 primers were used. Subsequent sequencing placed the inserts within 10 bp of each

PAGE 48

36 other. This suggests the existence of two inserts in reverse orientation to each other. The Salk website used for searching their available insertional mutants illustrates the insert to be in opposite orientation to CCD7 The CCD7 forward and reverse primers used appropriately with the left border primers specific to each T-DNA were used to isolate plants homozygous for the insertion in a segregating population. The T-DNAs present within each mutant allele are shown in Figure 3-9. The TDNA within max3-10 carries a marker for BASTA resistance, four tandemly arranged enhancer elements, and left and right borders for transformation. This vector was constructed for use as an activation tag. However, when present inside the coding region of a gene it is thought to act as a vector for a traditional knock-out approach. The TDNA within the max3-11 allele carries a marker for kanamycin resistance as well as Figure 3-8. Location and orientation of T-DNA inserts in CCD7 Exons are represented by black boxes and introns by intervening lines. Sequencing of the TDNA/gene junction showed max3-10 contains an insertion (inverted triangle) within the 1 st exon and max3-11 has two insertions within the 5 th intron. Arrows indicate orientation of T-DNA in reference to CCD7 orientation. Location of enzymes used in Southern blot analysis are shown. components required for transformation. To test for T-DNA number within each mutant the appropriate resistance marker was used as a probe in a Southern blot analysis. The genomic DNA isolated from homozygous max3-10 plants was digested with Bgl II, Hind III, or BamH I and DNA isolated from homozygous max3-11 plants was digested

PAGE 49

37 with Hind III, Xba I, or BamH I. The enzymes chosen cut within the T-DNA but outside of the region used as a probe. Figure 3-9. Schematic of T-DNA region of vectors used for transformation to create the BASTA population from University of Wisconsin (pSKI015) and the Salk population (pROK2). Location of restriction enzymes used in Southern analysis of max3-10 and max3-11 are shown. Resistant markers (shown in blue) were used as probes in Southern analysis. The wild-type ecotypes were digested and run adjacent to the digestions of each mutant as a negative control. A single band was observed in the Southern of the max3-10 allele indicating the existence of one T-DNA insert (Fig. 3-10A). Hybridization was weak and was therefore repeated. The second trial gave the same banding pattern but was as weak as the first. Two closely migrating bands were observed for each digestion in the Southern of the max3-11 allele (Fig.3-10B). As suggested by the PCR results discussed above, Southern blotting indicates that two tandem T-DNA inserts in opposite orientation are present within max3-11 Morphological Analysis of max3 Plants The max3 alleles were grown in soil along with their wild-type counterparts in order to observe any alterations in growth or morphology as a result of the loss of CCD7 function.

PAGE 50

38 Figure 3-10. Autoradiograph of Southern blot analysis of max3 plants. Wild-type (Col or Ws) was used as a negative control. Molecular weight markers are shown at left. Enzymes used for digestion are indicated at top. Both mutant alleles exhibited a branching phenotype and appeared dwarfed in their rosette diameter. These phenotypes were most apparent when grown in short days (Fig. 3-11). To examine the extent of the phenotypes, petiole and leaf blade lengths were recorded from plants grown in short (8h light/16h dark) and long (16h light/8h dark) day conditions. The inflorescence number was also counted. The means and standard errors of all measurements are shown in Table 3-2. In a short day light schedule, the petioles of max3-10 and max3-11 were significantly shorter than wild-type. In a long day light schedule, only the petiole lengths

PAGE 51

39 Figure 3-11. Phenotypes of max3-11 plant compared to wild-type (Col). Plants grown in a short day light schedule (A and B) appeared to have an exaggerated phenotype compared to plants grown in a long day light schedule (C). of max3-10 were significantly shorter than wild-type. The max3-11 leaf blade lengths, although on average shorter, were not significantly different than wild-type in either light regime. The max3-10 leaf blade lengths were significantly different in short days only, although the difference was an increase in length instead of the expected decrease in length. Inflorescence number was significantly increased in both alleles regardless of light schedule. The increased inflorescence number in the mutants grown in short days was more dramatic than those grown in long days. However, this observation is more likely due to the increase in leaf number at the time of flowering in plants grown in short

PAGE 52

40 days compared to those grown in long days. The increase in leaf number equates to an increase in axillary meristems thus providing a source from which increased shoot growth can occur. Table 3-2. Petiole and leaf blade lengths and inflorescence number (SE) taken from max3 plants grown on short and long days a,b Petiole (mm) Leaf Blade (mm) Inflorescence # Day Length Short Long Short Long Short Long Ws 15.4 1.3 15.5 0.8 13.9 0.9 14.8 1.4 1.1 0.1 1.8 0.4 max3-10 11.3 0.6* 7.7 0.2* 17.8 1.3* 14.7 0.7 7.6 0.8* 4.5 0.2* Col (5/04) 16.3 1.3 17.4 0.8 14.8 1.4 29.4 1.7 1.0 0.0 1.0 0.2 max3-11 (5/04) 12.0 1.4* 15.9 1.3 11.0 1.6 26.9 2.8 9.3 1.7* 5.1 0.6* Col (8/04) 20.8 1.9 18.0 0.9 1.8 0.3 max3-9 (8/04) 10.7 0.6* 17.5 0.3 3.7 0.7* CCD7OE max3-9 (8/04) 15.2 1.2* 17.8 0.2 1.3 0.2 a. The dates in parentheses next to lines in the Col ecotype are planting dates such that measurements should only be compared between mutant and wild-type planted on same date. b. The asterisk indicates a significant difference of the mutant allele from its wild-type counterpart (ANOVA, P-value 0.05). The petiole and leaf blade phenotypes seen in max3-11 plants were proportionally greater in short days than in long days, thus explaining the enhanced phenotype seen in this growing condition. The max3-10 plants did not show a greater decrease in either petiole or leaf blade length in short days as compared to long days. This difference may be due to variation in ecotype background. Ws does in fact flower earlier than Col, a trait that has been linked to the natural occurrence of a mutation within the phyD coding region (Aukerman et al., 1997). PhyD plays a redundant and less dominant role to phyB in the shade avoidance response, which includes a decrease in time to flowering, increase in elongation growth, and increased apical dominance (Devlin et al., 1999). Although the data in Table 3-2 do not fit into a model suggesting a constitutive shade avoidance response in the max3-10 allele, the inherent phyD mutation may perturb plant growth

PAGE 53

41 such that the petiole and leaf blade lengths between the two mutants cannot be compared. On the other hand, the increase in inflorescence number is consistent between the two mutant alleles. Complementation of max3 Phenotype To confirm that the phenotypes reported above were due to loss of CCD7 function, a wild-type copy of CCD7 cDNA was cloned from Columbia tissue and put into the vector pDESTOE for Agrobacterium -mediated transformation into max3-9 plants. The max3-9 line was isolated from the EMS screen (Booker et al., 2004). pDESTOE contains the near-constitutive Figwort Mosaic Virus 35S promoter, the nos terminator, a selectable marker, and elements required for transformation by Agrobacterium The max39:CCD7 OE line used for analysis showed a 3:1 segregation pattern at the T 2 generation indicating the existence of one or multiple linked T-DNA(s). The max3-9:CCD7 OE plants were taken to homozygosity and were grown along side max3-9 and wild-type plants in a long day light schedule. Petiole length, leaf blade length, and infloresence number was recorded for all genotypes (Table 3-2). Leaf blade length remained unchanged from wild-type in max3-9:CCD7 OE plants. Inflorescence number returned to wild-type and petiole length increased from that seen in max3-9 but did not completely return to wild-type length. To check for high expression of CCD7 within max39:CCD7 OE plants, CCD7 transcript abundance was determined within leaves by Real Time RT-PCR. Compared to wild-type, CCD7 transcript abundance was 30-fold higher in max3-9:CCD7 OE. Thus, the wild-type copy of CCD7 complemented the inflorescence phenotype and partially complemented the petiole phenotype seen max3-9

PAGE 54

42 plants. Despite the large increase in CCD7 expression in max3-9:CCD7 OE no additional phenotypes were evident. b -ionone Content of max3-10 and max4-11 CCD7 possesses activity at the 9,10 double bond of several carotenoid substrates (Booker et al., 2004). This activity was demonstrated to be asymmetrical in nature, such that with b -carotene as a substrate one molecule of b -ionone results (Schwartz et al., 2004). As with ccd1-1 mutant alleles of CCD7 were analyzed for their b -ionone content and compared to their wild-type counterparts in order to assign an in vivo activity. Two independent trials were performed (Fig. 3-12B). Trial 1 showed an insignificant decrease and trial 2 showed an insignificant increase in the b -ionone content in max3-11 compared to wild-type. The changing b -ionone levels observed more than likely reflects a natural variation instead of a change due to loss of CCD7 function. Interestingly, max3-10 was markedly increased in b -ionone (Fig. 3-12A). The max3-10 allele contains a T-DNA within the first exon of CCD7 Due to the location of the insert within CCD7 the resulting truncated protein produced would contain 461 carboxy terminal amino acids. The wild-type CCD7 contains 618 amino acids, of which the first 56 are predicted to be a cleavable plastid transit sequence. Therefore, it is possible that a functional CCD7 enzyme is produced and led to the increase in b -ionone production seen in max3-10 rosettes. Schwartz et al. reported that CCD7 retained its activity without its transit sequence (Schwartz et al., 2004). The TDNA present within max3-10 is made up of several enhancer elements as it was designed as an activation tag (Weigel et al., 2000). Expression analysis of CCD7 within max3-10 rosettes and roots

PAGE 55

43 was compared to expression in Ws. Primers and probe for Real Time RT-PCR lie downstream of the insert location. CCD7 transcript was greatly increased in the max3-10 Figure 3-12. b -ionone content in max3 rosettes. A.) b -ionone content was increased in max3-10 compared to its wild-type counterpart (Ws) and B.) remained essentially unaltered in max3-11 compared to its wild-type (Col) counterpart as determined in two independent trials. tissues (Fig. 3-13). It is feasible that the increased expression of CCD7 within max3-10 followed with an increase in accumulation of a functional yet truncated version of CCD7 leading to an increase in b -ionone production. The truncated CCD7 would be without its transit sequence and would therefore not be translocated into the plastid but would contain the five histidines and seven residue sequence conserved among CCDs. Because max3-10 plants do show the same phenotype as all other CCD7 mutants, it seems that

PAGE 56

44 localization of CCD7 within the plastid is a requirement for maintenance of a wild-type growth habit. Figure 3-13. CCD7 expression in max3-10 Expression was measured in rosette and root tissue and compared to that seen in the rosette and root tissue of the wild-type background (Ws). The increase in max3-10 plants suggests that CCD7 is involved in b -ionone production in vivo Due to the likely mis-localization of CCD7 within max3-10 plants, it is not known what role CCD7 plays in b -ionone production when inside the plastid. The data from max3-11 is inconclusive. As mentioned in Chapter 2, the in vitro activity of CCD1 also produces b -ionone (Schwartz et al., 2001). The redundancy in activity of CCD1 and CCD7 may explain why b -ionone production was not greatly reduced in max3-11 A better genetic background for testing b -ionone production by CCD1 and CCD7 would be the double mutant. The double ccd1-1max3-11 mutant has been made and is presently being tested for homozygosity. On an additional note, an observable change in b -ionone production due to loss of CCD7 may be improbable due to the very low level of CCD7 expression (Fig. 3-7). In vivo activity of CCD7 may be better

PAGE 57

45confirmed with an overexpression line, which has been made but not studied for b-iononecontent.Determination of Indole Acetic Acid and Abscisic Acid Content Within max3-10PlantsIndole acetic acid (IAA) is an active auxin involved in the maintenance of apicaldominance in plants. Auxin originating from the apex of the plant promotes apicaldominance (Ward and Leyser, 2004). Lack of auxin perception has been linked to anincreased branching pattern in the axr1 mutants of Arabidopsis (Lincoln et al., 1990;Stirnberg et al., 1999). A direct link between auxin synthesis and branching has beendifficult to ascertain likely due to redundancy in the pathway (Cohen et al., 2003). Genesimplicated in auxin biosynthesis in plants have been discovered and their overexpressionresults in apically dominant plants (Zhao et al., 2001; Zhao et al., 2002). To determine ifaltered auxin content was the cause of the branching phenotype seen in max3 plants, freeIAA was measured in max3-10 rosettes. IAA levels were not significantly altered inmax3-10 rosettes. (Fig. 3-14).CCD7 was also tested for its possible involvement in ABA production byascertaining ABA content with the max3-10 mutant and comparing it to wild-type. WhileABA has been implicated in bud inhibition (Chatfield et al., 2000), none of the NCEDloss-of-function mutants display a shoot branching phenotype (B.C. Tan and W.T. Deng,personal communication). ABA levels were essentially equal to wild-type (Fig. 3-14).Therefore, CCD7 does not play a role in ABA synthesis.

PAGE 58

46 Figure 3-14. IAA and ABA content within max3-10 rosettes compared to wild-type (Ws).In SummaryCCD7 is a carotenoid cleavage dioxygenase with activity at the 9,10 double bondof a variety of carotenoid substrates (Booker et al., 2004). CCD7 is a soluble plastidlocalized protein that accumulates in the stroma. Its transcript was found highest in theroot tissue of adult plants but was low in expression compared to other CCDs studied.Expression was not altered by day length or by imposition of a water stress. Plantswithout a functional CCD7 lack the ability to maintain apical dominance and as a resultare bushy in appearance. Rosette size is also affected by the presence of CCD7 function.This functionality is dependent on localization of the protein product within the plastid.From these results, it seems CCD7 is involved in the production an apocarotenoidcompound that is required for the normal inhibition of shoot growth from axillarymeristems. It is not known whether the change in rosette size is a direct result of loss ofCCD7 function or if it is an indirect result of early growth from typically dormantmeristems.

PAGE 59

47 CHAPTER 4 CAROTENOID CLEAVAGE DIOXYGENASE 8 (CCD8) Activity Using the same heterologous E. coli system used to determine the activity of CCD1 and CCD7, Schwartz et al. determined CCD8 cleavage activity (Schwartz et al., 2004). CCD8 was shown to cleave at the 13,14 double bond of the apocarotenoid produced by the activity of CCD7 on b -carotene. When CCD8 was expressed alone in the b -carotene accumulating line no apocarotenoid products were observed. CCD8 activity was dependent on the presence of CCD7. Only upon induction of both CCD7 and CCD8 in the same b -carotene accumulating E. coli strain did the accumulation of 13-apob carotene and a C 18 dialdehyde product result (Fig. 4-1). These products were thought to be derived from the cleavage of 10-apob -carotene (the product of CCD7s activity on b -carotene) at its 13,14 double bond. Therefore, a biochemical pathway can be drawn in which b -carotene is metabolized to 13-apob -carotene and the C 9 dialdehyde product in a two-step reaction involving both CCD7 and CCD8 (Schwartz et al., 2004). Subcellular Localization Localization of CCD8 within plastids was determined following the same procedures as with CCD1 (Chapter 2) and CCD7 (Chapter 3). The chloroplast prediction program TargetP (v 1.0) (Emanuelsson et al., 2000) predicts CCD8 to be chloroplast localized and assigns a transit peptide of 56 amino acids. Chloroplast import assays with the use of the protease thermolysin (Cline et al., 1993) verified its localization to the

PAGE 60

48 Figure 4-1. Proposed activity of CCD8. CCD8 may act on the 13,14 double bond of 10apob -carotenal (3), one product resulting from CCD7s activity on b -carotene (1), the other product being b -ionone (2), to produce a C 9 dialdehyde (4) and 13-apob -carotene (5). chloroplast (Fig. 4-2A). Fractionation of the chloroplast revealed that CCD8 was localized to the stroma (Fig. 4-2B). In addition, the reduced size of the imported mature protein indicated the existence of a cleaved transit peptide. Figure 4-2. Import of in vitro transcribed and translated CCD8 precursor protein (pP) into pea chloroplasts compared with ssRubisco (ssRub) and VP14. (A) Following import, chloroplasts were treated with thermolysin (+T). (B) Chloroplasts were fractionated to determine suborganellar localization to the envelope (E), stroma (S) or thylakoid (Th). 1 2 3 4 5

PAGE 61

49 Incubation of in vitro transcribed and translated CCD8 precursor proteins with fresh pea chloroplasts for 0, 1, 2, 4, 8, 15, and 30 minutes showed that with increasing incubation time CCD8 was more resistant to thermolysin treatment (Fig. 4-3). It could then be concluded that, as with CCD7, CCD8 was imported into the chloroplast stroma. Figure 4-3. Time monitored plastid import assay with CCD8. In vitro transcribed and translated CCD8 precursor protein (pP) was incubated with fresh pea chloroplasts for 0, 1, 2, 4, 8, 15, and 30m. Following incubation each assay mixture was thermolysin treated. Expression Analysis As with CCD1 and CCD7 (Chapters 2 and 3, respectively), CCD8 transcript abundance was measured by quantitative Real Time RT-PCR using Taqman primers and probes. RNA was extracted from tissue dissected from wild-type adult plants in the same way as described in Chapter 2 (Fig. 2-3). Figure 4-4 shows transcript abundance as a percentage of mRNA calculated by comparison to a standard curve. CCD8 transcripts were detected in all tissues tested albeit at low levels. Interestingly, highest expression was seen in root tissue prior to bolting (Fig. 4-4A). Previously, it was shown that wildtype roots grafted onto CCD8 mutant shoots rescued the phenotype associated with loss of CCD8 function (Sorefan et al., 2003). Thus, the increased expression seen in roots relative to other tissue was intriguing. We therefore compared root expression before and after emergence of the primary inflorescence, and after emergence of secondary inflorescences (Fig. 4-4B). Transcript abundance in root tissue decreased by an average

PAGE 62

50 of 65% after the emergence of primary and secondary inflorescences. In contrast, the low level of transcript in leaf blade was not altered after axillary shoot emergence. Figure 4-4. Expression pattern of CCD8 as determined by Real Time PCR. A.) RNA was extracted from petioles, leaf blades, and roots before bolting. B.) Comparison of expression in leaf blade and root tissue at three developmental time points, B1, leaf blade before bolting; B2, leaf blade after emergence of primary inflorescence; B3, leaf blade after emergence of secondary inflorescences; R1, root before bolting; R2, root after emergence of primary inflorescence; R3, root after emergence of secondary inflorescences. CCD8 loss-of-function mutants showed a similarly enhanced phenotype as CCD7 mutants did in short day growth conditions (See next section). A day length effect on CCD8 expression was also tested. Expression of CCD8 in whole seedlings grown on

PAGE 63

51 short days was compared to seedlings grown on long days following the same procedure as in Chapter 3. In unison with CCD7 no significant change in CCD8 expression was apparent (Table 4-1). Therefore, the enhanced mutant phenotype seen in short days when compared to long days does not appear to be a consequence of CCD8 transcription and/or RNA turnover. Following suit with the relationship of CCD1 and CCD7 on ABA production, CCD8 was tested for its role in ABA biosynthesis by determining the effect of water stress on its expression. As with CCD1 and CCD7 expression of CCD8 in seedlings was not altered by a water stress treatment imposed by allowing a 15% loss of fresh weight (Table 4-1). Table 4-1. CCD8 transcript abundance in whole seedlings (SE). Treatment % mRNA Short days 2.13E-05 .23E-05 Long days 2.74E-05 .70E-05 Nonstressed 4.04E-05 .04E-05 Stressed 3.35E-05 .09E-05 ANOVA showed results not to be significant at an a =0.05 Loss-of-Function Mutants Isolation of Mutants Two independent loss-of-function mutants for CCD8 were isolated from the Wisconsin Knockout facility (Krysan et al., 1999) and the SAIL population (Sessions et al., 2002). Because mutants of CCD8 ( max4-1 through max4-4 ) have previously been isolated (Sorefan et al., 2003), the mutants discussed here will follow the established nomenclature for mutant designation, i.e. the mutant isolated from the Wisconsin Knock

PAGE 64

52 out facility was named max4-5 and the mutant obtained from Syngentas SAIL population was named max4-6 To verify the location of the T-DNA inserts, the junction of the T-DNA and CCD8 was amplified using a CCD8 forward or reverse specific primer and a primer specific for the left border of the T-DNA. DNA from max4-5 produced a product approximately 800 bp in size using the CCD8 reverse primer and left border primer. The amplified DNA was cloned and subsequent sequencing placed the insert within the fourth exon of CCD8 (Fig. 4-5). No product was obtained using the CCD8 forward primer indicating that the T-DNA was in reverse orientation relative to CCD8 A product approximately 3.2 kbp in size was amplified from max4-6 DNA when using the CCD8 forward primer and left border primer. Sequencing placed the insertion in the fifth exon of CCD8 (Fig. 4-5). A product of approximately 500 bp was obtained using a CCD8 reverse primer and left border primer. This fragment was also sequenced and placed the insert 17 bp downstream of the original placement. Positive amplification with both CCD8 forward and reverse primers indicates the presence of two tandem TDNAs in opposite orientation. For both alleles, the CCD8 forward or reverse primer used with the left border primer specific to each T-DNA was used to isolate a plant homozygous for the insertion in a segregating population. The T-DNAs present within each mutant allele are shown in Figure 4-6. The max4-5 allele was isolated from the University of Wisconsins Alpha population. The transformation vector used to create these lines is a derivative of pD991 and is called pD991-AP3. The T-DNA within this vector contains the left and right border sequences

PAGE 65

53 Figure 4-5. Positions of T-DNA insertions within CCD8 Black boxes are exons, intervening lines are introns, and inverted triangles represent T-DNA inserts. Sequencing of the T-DNA/gene junction showed max4-5 contains an insertion (inverted triangle) within the 4 th exon and max3-11 has two insertions within the 5 th exon. Locations of enzymes used in Southern blot analysis are shown. Arrows indicate orientation of T-DNA in reference to CCD8 orientation. Figure 4-6. Schematic of T-DNA region of vectors used for transformation to create the Alpha population from University of Wisconsin (pD991-AP3) and the Syngenta population (pDAP101). Location of restriction enzymes used in Southern analysis of max4-5 and max4-6 are shown. for transformation with Agrobacterium the nptII gene for resistance to kanamycin and a GUS gene driven by the AP3 promoter (Krysan et al., 1999). The max4-6 allele was obtained from the SAIL population. The vector used for transformation in this population is pDAP101. The T-DNA within this vector contains only the border sequences and a 35S driven BAR gene for resistance to BASTA. To test for T-DNA

PAGE 66

54 number within each mutant the appropriate resistance marker was used as a probe in a Southern blot analysis. The genomic DNA isolated from max4-5 plants was digested with Bgl II, Hind III, or BamH I and DNA isolated from max4-6 was digested with Bgl II, Hind III, or Xba I. The enzymes chosen cut within the T-DNA but outside of the region used as a probe with one exception, Bgl II does not cut within the T-DNA of pD991-AP3. The wild-type ecotypes were digested and run adjacent to the digestions of each mutant as a negative control. A single band was observed in the Southern of the max4-6 allele indicating the existence of one T-DNA insert (Fig. 4-7). However the PCR results discussed above argue for two T-DNA inserts. Rearrangements and partial insertions are common occurrences in Agrobacterium mediated transformation events (Meza et al., 2002; Windels et al., 2003). It is possible that a partial insertion occurred where enough of the left border sequence was inserted to allow for amplification by PCR of a junction sequence. Two bands were observed in the Southern of the max4-5 allele when digested with BamH I or Bgl II, indicating two T-DNAs within max4-5 Only one band was present in the Hind III digestion, however this band was of a greater intensity than the other bands, likely due to the presence of two bands of equal size (Fig. 4-7). It is possible that the second T-DNA is not within CCD8 but must be within a short distance from it as selection of a segregating population on kanamycin resulted in a 3:1 segregation of kanamycin resistant to sensitive seedlings (74 seedlings total, 57 kanamycin resistant: 17 kanamycin sensitive). Despite the 3 location of the T-DNAs within each mutant allele, activity of the truncated forms of these proteins is unlikely because the insertions disrupt CCD8 upstream of the codon for at least one of five histidine residues conserved in all

PAGE 67

55 Figure 4-7. Autoradiograph of Southern blot analysis of max4 plants. Wild-type (Col or Ws) was used as a negative control. Molecular weight markers are shown at left. Enzymes used for digestion are indicated at top. carotenoid cleavage dioxygenases. These five conserved histidines are thought to coordinate a non-heme iron. Dioxygenase activity of VP14 (Schwartz et al., 1997) and the Drosophila 15,15 dioxygenase (von Lintig and Vogt, 2000) has been shown to be dependent on the presence of iron. If a truncated version of CCD8 resulted in max4-5 plants it would be without two of the five conserved histidines and a highly conserved seven residue sequence found in plant and animal carotenoid cleavage dioxygenases. A truncated CCD8 in max4-6 plants would be without one of the histidine residues,

PAGE 68

56 highlighting the importance of each histidine in the fully functional protein as each mutant allele confers the same phenotype (see next section). Morphological Analysis of max4 Plants Seeds homozygous for T-DNA insertions were planted with their wild-types in soil. The plants of both CCD8 loss-of-function alleles were highly branched. The axillary buds, which are typically delayed in growth in wild-type plants, grew out to produce leaves and inflorescences, a phenotype almost identical to the CCD7 loss-of-function mutants. Again, the phenotype was most obvious when grown on short days (Fig. 4-8). Petiole length, leaf blade length and inflorescence number were recorded in short and long day growth conditions. Like the max3 mutants, the max4-5 and max4-6 plants had smaller rosette diameters due to a decrease in the lengths of petioles compared to wildtype plants (Table 4-2). The decrease in petiole length was significant in both growing conditions. Unlike max3 the leaf blade lengths were decreased in both max4-5 and max4-6 grown on long days and max4-6 grown on short days. Leaf blade lengths of max4-5 grown on short days were actually longer than wild-type, an observation consistent with the max3-10 mutant. Both max4-5 and max3-10 are in the Ws background. The increase in leaf blade length instead of the decrease seen in the max4-6 and max3-11 mutants may be due to ecotype variation. Inflorescence number was increased in both max4 alleles under short and long day conditions. In long days, the increase was similar to that seen in the max3 alleles but was stronger than max3 in short days. Complementation of max4 Phenotype The pDESTOE transformation vector was used to introduce a wild-type copy of the CCD8 cDNA under the control of the constitutive Figwort Mosaic Virus 35S promoter

PAGE 69

57 Figure 4-8. Phenotypes of max4-6 plant compared to wild-type (Col). Plants grown in a short day light schedule (A and B) appeared to have an exaggerated phenotype compared to plants grown in a long day light schedule (C). Table 4-2. Petiole and leaf blade lengths and inflorescence number (SE) taken from plants grown on short and long days. Petiole (mm) Leaf Blade (mm) Inflorescence # Day Length Short Long Short Long Short Long Ws 15.4 1.3 15.5 0.8 13.9 0.9 14.8 1.4 1.1 0.1 1.8 0.4 max4-5 10.4 0.6* 8.3 0.2* 16.8 0.8* 10.3 1.1* 10.0 2.1* 4.5 0.3* Col 15.2 0.6 20.8 1.9 14.6 1.2 18.0 0.9 1.0 0.0 1.8 0.3 max4-6 11.4 0.5* 10.3 0.6* 9.8 0.5* 13.8 0.5* 10.5 1.7* 5.2 0.4* CCD8OE max4-6 18.0 2.2 20.0 2.0 1.8 0.3 into max4-6 Transformed plants were grown on selection plates. Positive plants ( max46:CCD8 OE) were taken to homozygosity and were grown alongside max4-6 and wildtype plants in a long day light schedule. The max4-6:CCD8 OE line used for analysis showed a 3:1 segregation pattern at the T 2 generation indicating the existence of either

PAGE 70

58 one or multiple linked newly introduced T-DNA(s). The phenotypes associated with petiole length, leaf blade length, and inflorescence number were all rescued (Table 4-2). CCD8 transcript abundance was checked by Real Time RT-PCR in max4-6:CCD8 OE plants and was interestingly only half of what is seen typically in wild-type plants. Complementation with sub-wild-type levels of transcript suggests that only a low level of CCD8 expression is required. The complementation establishes that the phenotypes were a result of the loss of CCD8 function. Determination of Indole Acetic Acid and Abscisic Acid Content within max4-6 Plants Like max3 max4 alleles were found to have an altered branching pattern. This phenotype again evokes images of auxin biosynthetic and/or signaling mutants. Therefore, the level of auxin in the form of free IAA was measured. IAA levels were equal to wild-type (Fig. 4-9). CCD8 was also tested for its possible involvement in ABA production by ascertaining ABA content with the max4-6 mutant and comparing it to wild-type. ABA levels were equal to wild-type (Fig. 4-9). Therefore, CCD8 also does not play a role in ABA synthesis. Figure 4-9. IAA and ABA content in max4-6 rosettes compared to wild-type (Col). No difference in either hormone was seen.

PAGE 71

59 In Summary A recent study indicated that CCD8 has activity at the 13,14 double bond of 10apob -carotene, a product resulting from the activity of CCD7 on b -carotene (Schwartz et al., 2004). CCD8 is a plastid, specifically stroma, localized protein. Its transcript was most prominent in root tissue but was detectable in all other tissues tested. CCD8 expression was not affected by day length or water stress. Two independent CCD8 lossof-function alleles exhibit the same phenotype characterized by increased branching and decreased petiole and leaf blade (with the exception of max4-5 on short days) lengths. These phenotypes are similar to those seen in the CCD7 loss-of-function mutants. CCD7 and CCD8 are non-redundant carotenoid cleavage dioxygenases required for the production of an apocarotenoid, which either directly or indirectly controls shoot growth from axillary meristems.

PAGE 72

60 CHAPTER 5 GENETIC INTERACTION AMONG CCD1, CCD7, AND CCD8 Introduction CCD1 and CCD7 share activity at the 9,10 double bond of linear and cyclic carotenoids (Schwartz et al., 2001; Booker et al., 2004; Schwartz et al., 2004). CCD7 and CCD8 share similar phenotypes conferred by their loss-of-function (Sorefan et al., 2003; Booker et al., 2004). To ascertain the genetic interaction between the CCDs, the following crosses were performed, ccd1 x max4 and max3 x max4 A cross between ccd1 and max3 was also done, the progeny of which are at the F 1 generation and as such are not ready to be analyzed. The following two sections characterize the ccd1max4 and max3max4 double mutants by comparing them to wild-type and to each single mutant. The final section discusses results on transcript abundance of each CCD found within the CCD loss-of-function mutants. Characterization of ccd1max4 Plants CCD1 and CCD8 do not appear to have much in common with the exception that CCD8 cleaves a 9,10 cleavage product of b -carotene. CCD8 cleaves at the 13,14 double bond of 10-apob -carotene, an apocarotenoid produced by the 9,10 cleavage of b carotene. No 10-apob -carotene accumulated in the reactions involving CCD1 with b carotene as a substrate. Instead the C 14 dialdehyde corresponding to the central portion of b -carotene was identified, leading to the hypothesis that CCD1 may act as a dimer (Schwartz et al., 2004). It is not known if dimerization of CCD1 occurs in vivo If CCD1 is able to cleave asymmetrically, two interactions with CCD8 are possible. One reaction

PAGE 73

61 would begin with the cleavage of b -carotene by CCD1, the products of which are then cleaved by CCD8, much like the reactions involving CCD7. This is not likely due to the differential subcellular localization of CCD1 and CCD8. However, a second possibility remains in which b -carotene is cleaved by CCD7 to produce 10-apob -carotene which is cleaved by CCD8 to produce 13-apob -carotene. 13-apob -carotene may leave the plastid and be cleaved by CCD1 at its one 9,10 double bond. The biological significance of this is unknown and may be revealed by the ccd1max4 double mutant. ccd1-1 showed a subtle petiole phenotype (Chapter 2). The max4 background may provide a sensitized background in which to uncover further ccd1 related phenotypes. Due to constraints of selectable markers, the max4 allele chosen to cross to ccd1-1 was max4-5 The max4-5 allele is in the Ws background and the ccd1-1 allele is in the Columbia background. Comparisons were therefore made among each wild-type background, the single mutants, and the double mutant. Petiole length, leaf blade length and inflorescence number are shown in Fig. 5-1. Unfortunately, petiole and leaf blade length vary between Col and Ws making any conclusion regarding the effect of the double mutant difficult. The inflorescence number of Ws and Col was similar. The ccd1max4 double mutant was no different in inflorescence number than max4 The introduction of ccd1-1 into the max4-6 background had no effect on shoot growth from axillary meristems suggesting that CCD1 is not involved in the control of branching in Arabidopsis.

PAGE 74

62 Figure 5-1. Analysis of ccd1max4 double mutant. Measurements recorded include petiole and leaf blade lengths and inflorescence number.

PAGE 75

63 Characterization of max3max4 Plants The near identical phenotypes of the max3 and max4 mutants suggests a pathway leading to the production of a branch controlling factor (Sorefan et al., 2003; Booker et al., 2004). It is possible that CCD7 and CCD8 work in a single pathway leading to the synthesis of an inhibitor of bud outgrowth in Arabidopsis. It is also possible that CCD7 and CCD8 act in independent pathways both of which contribute to the production of a branch inhibiting compound(s). If the latter were true, then a double max3max4 mutant may be predicted to have an additive phenotype compared to either single mutant. Therefore, a cross between max3-11 and max4-6 was made. The double mutant will also give in vivo evidence for the existence of a linear pathway containing CCD7 and CCD8. The F 2 generation of the max3-11 max4-6 cross was analyzed for petiole length, leaf blade length, and inflorescence number (Fig. 5-2). Genotypes were ascertained by PCR. Petiole length was shortest in max4-6 and the double mutant. Only one copy of CCD8 was required for wild-type petiole length as shown in the plants genotyped as heterozygous for CCD8 ( max3/+ max4/+ and MAX3/MAX3 max4/+ ). Leaf blade length was indistinguishable among max3-11 max4-6 and max3-11max4-6 The max3-11max46 double mutant was also phenotypically indistinguishable from either single mutant in inflorescence number indicating a lack of genetic interaction between CCD7 and CCD8 consistent with both genes functioning in the same pathway. Interestingly, both classes of plants genotyped as heterozygous for CCD8 ( max3/+ max4/+ and MAX3/MAX3 max4/+ ) showed a slight increase in inflorescence number compared to wild-type (Pvalue=0.076 and P-value=0.029, respectively). This evidence of a quantitative dosage

PAGE 76

64 Figure 5-2. Analysis of max3max4 double mutant. Two classes of heterozygotes, heterozygous at both loci ( max3-1/+max4-6/+ ) and heterozygous at CCD8 MAX3/+max4-6/+ ) were included to show possible dosage effect of CCD8

PAGE 77

65 effect of CCD8 on inflorescence number suggests that CCD8 activity is a point of control in the pathway. Effect of Loss-of-Function Mutants on Expression of CCDs Due to the biochemical overlap of CCD1 and CCD7 and to the placement of CCD7 and CCD8 in the same biosynthetic pathway, transcriptional regulation of one CCD on another was tested. Real Time RT-PCR was used to measure transcript abundance of each CCD in the ccd1-1 max3-11 and max4-6 mutant backgrounds. Expression was measured at the seedling stage in two tissue types. The seedlings were extracted from plates and cut at the root hypocotyl junction to provide root sample and an aerial tissuesample consisting of hypocotyls and cotyledons (H/L). No large differences in expression were seen (Fig 5-3). However a few subtle changes should be noted. CCD1 expression was decreased in the max3 and max4 mutants as compared to wild-type. CCD7 expression was unchanged significantly in the root tissue of either ccd1 or max4 seedlings but was decreased in ccd1 and max4 H/L tissue. CCD8 transcript on the other hand was decreased in max3 root and H/L tissue. CCD8 expression was also decreased in ccd1 H/L tissue. It is unclear whether there is an interaction between CCD1 and CCD7 or CCD8. The role of CCD1 in plant physiology is also unclear but as a carotenoid cleavage dioxygenase present in the cytoplasm it is feasible CCD1 acts as a vehicle for recycling of carotenoid backbones from degenerated chloroplasts. If this is the case, plants with increased branch number may need more photosynthates than less branched plants. A larger store of carotenoids may allow for an increased photosynthetic rate. So, the decrease in CCD1 expression seen in the max3 and max4 mutants may be a consequence

PAGE 78

66 Figure 5-3. Effect of loss-of-function mutants on transcript abundance of CCD1 (A), CCD7 (B), and CCD8 (C). of the max phenotype. It is strange that the change in CCD7 expression among the mutant phenotypes was seen in H/L tissue instead of the root tissue, where in adult plants CCD7 transcript is highest. Nonetheless the decrease of CCD7 transcript in max4

PAGE 79

67 seedlings may point to a negative feedback regulatory mechanism. Furthermore, CCD8 transcript in max3 was decreased in both root and H/L tissue. CCD8 transcript was also decreased in ccd1 H/L tissue.

PAGE 80

68 CHAPTER 6 DISCUSSION Introduction The Arabidopsis CCD family consists of enzymes which not only range in substrate specificity and site of cleavage but also biological function. The NCEDs all cleave 9-cis-epoxycarotenoids at the 11,12 double bond to produce the hormone, ABA. CCD4 may cleave at the 5,6 double bond to produce volatile apocarotenoids which contribute to floral scent and to the flavor of fruits and vegetables (Winterhalter and Rouseff, 2002). CCD1 cleaves multiple carotenoid substrates symmetrically at their 9,10 (and 9,10) double bonds. With b -carotene as a substrate, CCD1 activity produces two b -ionone molecules (Schwartz et al., 2001). This is an apocarotenoid which has also been linked to floral aroma and flavor (Winterhalter and Rouseff, 2002). CCD7 has been shown to cleave multiple substrates at the 9,10 double bond (Booker et al., 2004). CCD7s biological function in plants is intriguing and appears to be linked with the activity of CCD8. CCD7 and CCD8 are required for the production of a novel signaling molecule which is involved in the inhibition of branching (Sorefan et al., 2003; Booker et al., 2004) but whose chemical identity has yet to be established. The following discussion on results presented thus far is divided into two sections, the first pertains to CCD1 in terms of its possible biological roles in plant physiology and the second combines CCD7 and CCD8 regarding their involvement in the production of a novel signaling compound.

PAGE 81

69 Carotenoid Cleavage Dioxygenase 1 It is difficult to assign a specific biological function to CCD1 because of its substrate promiscuity. However, the in vitro activity of CCD1 on b -carotene does produce b -ionone and a C 14 dialdehyde, both of which are known to contribute to floral scent and fruit flavor (Winterhalter and Rouseff, 2002) CCD1 expression was high in flowers as compared to other plant organs. The volatile compounds may act to attract insects for pollination as compounds such as b -ionone have been shown to lure insects to traps containing mixtures of b -ionone with other known volatile compounds from maize (Hammack, 2001). Pollination by insects is most probably not a typical means of fertilization for a self-pollinating plant like Arabidopsis. However, it may be beneficial to a plant like Arabidopsis to maintain a means by which diversity in genetic makeup could be obtained (Chen et al., 2003) Apocarotenoids have antifungal activities as well. When the roots of maize and wheat are infected with arbuscular mycorrhizal fungi, cyclic C 13 compounds and acyclic C 14 compounds accumulate, giving the roots a yellow color. The function of the carotenoid precurors and the apocarotenoid products in arbuscular mycorrhization is unknown. However, it is possible that apocarotenoids act to control fungal colonization because application of the isoprenoid cleavage product, blumenin, deters colonization (Fester, 1999). As carotenoids are synthesized and for the most part reside in plastids, it seems strange that a carotenoid cleavage dioxygenase not localized to the plastid exists. However, CCD1 clearly shows CCD activity but was not found to be plastid-localized. The presence of carotenoids in the outer envelope of the chloroplast has been reported in spinach (Douce et al., 1973) and pea (Markwell et al., 1992). The envelope fraction from

PAGE 82

70spinach contained mostly violaxanthin but lutein and zeaxanthin and in smaller quantitiesb-carotene were also isolated (Douce et al., 1973). All of these carotenoids are possibleCCD1 substrates (Schwartz et al., 2001). CCD1 may associate with the outer envelopeand act on the carotenoids found within it. In fact, a CCD1 orthologue from tomato wasfound in fractions containing the inner and outer chloroplast envelopes but was easilydegraded by treatment with a protease (Simkin et al., 2004a). Extensions of the plastidmembrane have also been discovered. Thought to take part in protein exchange betweenplastids (Kohler et al., 1997), these stroma filled tubules may also be a source ofcarotenoids available to CCD1.The subtle phenotype seen in ccd1-1 suggests that CCD1 may not be crucial tonormal growth and development or that redundancy exists in the genome. CCD7 doespossess the same cleavage activity as CCD1 yet they differ in their subcellularlocalization. Was CCD1 at one point redundant to CCD7 but through evolution lost itschloroplast transit sequence? Would CCD1 be able to rescue the max3 phenotype ifpresent within plastids? To answer these questions the transit peptide of the plastidlocalized small subunit of ribulose 1,5 carboxylase/oxygenase was placed in front ofCCD1. The construct encoding for the chimeric protein was transformed into max3-9plants. In a reciprocal experiment, the transit peptide-coding region of CCD7 wasremoved and put into max3-9 plants to test if plastid localization is in fact a requirementfor rescue of the max3 phenotype. Analysis of the resulting plants is in progress.Carotenoid Cleavage Dioxygenase 7 and Carotenoid Cleavage Dioxygenase 8Traditionally, apical dominance is thought of as a consequence of the effects of twoplant hormones, auxin and cytokinins. It has been postulated that auxins, produced in the

PAGE 83

71 apex of the plant, travel down the stem and inhibit growth of axillary meristems (Ward and Leyser, 2004). With the isolation of the max3 and max4 mutants, an as yet unidentified hormone player in the control of plant architecture is evident (Stirnberg et al., 2002; Sorefan et al., 2003; Booker et al., 2004). Studies in pea ( Pisum sativum ) (Beveridge et al., 1996; Beveridge et al., 2000; Morris et al., 2001; Rameau et al., 2002), and petunia ( Petunia hybrida ) (Napoli, 1996) (K. Snowden, personal communication) also point to a more complex mechanism controlling branching in plants. In each of these species phenotypes identical to that seen in the Arabidopsis loss-of-function mutants were discovered, demonstrating that this is a general phenomenon. Prominent among these studies were those done with the ramosus ( rms ) mutants in pea. There are six identified RMS loci. Mutations in any of the six loci confer an increased branching pattern. This phenotype exists despite the mutants possessing wild-type auxin content and transport (Beveridge et al., 2000; Morris et al., 2001; Rameau et al., 2002). Recently, it was shown that PsRMS1 is orthologous to AtCCD8 (Sorefan et al., 2003) As reported here, the max4-6 mutant, like rms1 also contains wild-type levels of auxin. However, auxin sensitivity may be altered as it was decreased in the max4-1 mutant (Sorefan et al., 2003) indicating a potential link to auxin signaling. Grafting studies done in both Arabidopsis (Turnbull et al., 2002; Sorefan et al., 2003) and pea (Foo et al., 2001) further implicate CCD7 and CCD8 and their orthologues in branching inhibition. In Arabidopsis, the max4 branching phenotype can be restored to wild-type by grafting at the seedling stage with either wild-type root or shoot tissue (Sorefan et al., 2003). Similar results have been reported for max3 (Turnbull et al., 2002) and rms1 (Foo et al., 2001). Y grafts, in which a shoot of one genotype is grafted onto

PAGE 84

72 the shoot of a second genotype, were performed using rms1 and wild-type tissue. Here, an rms1 shoot was grafted onto a wild-type shoot continuous with a wild-type root. Neither shoot developed excessive branching. On the other hand, when the wild-type shoot was grafted onto an rms1 shoot that was continuous with an rms1 root, the rms1 shoot but not the wild-type shoot developed extensive branching. These data show that the signal travels acropetally and therefore is more than likely transported through the xylem (Foo et al., 2001). Although CCD7 and CCD8 transcripts were present in all tissues they are, by far, most highly expressed in the roots. Sorefan et al. showed highest expression of CCD8 in the root tip using promoter GUS fusions (Sorefan et al., 2003) The available data strongly support the existence of a novel translocated phytohormone able to travel up through the xylem from the root to affect shoot branching. Branching mutants have also been identified in petunia. The dad1 mutant was characterized as having an increased branching pattern (Napoli, 1996) and Dad1 has now been shown to be orthologous to AtCCD8 (K. Snowden, personal communication). Orthologous proteins controlling identical functions as well as the existence of homologous sequences in the monocots maize and rice (B.C. Tan and D. R. McCarty, personal communication) indicate a broadly conserved mechanism for controlling lateral branching in plants. The order of action of CCD7 and CCD8 in this pathway is not known. Both CCD7 (Chapter 3) (Booker et al., 2004) and CCD8 (Chapter 4) localize to the stroma of chloroplasts, placing them in a cellular compartment that is enriched for carotenoids. CCD7 has been shown to cleave a variety of carotenoid molecules (Booker et al., 2004)

PAGE 85

73 whereas cleavage activity of CCD8 has been suggested using 10-apob -carotene as a substrate (Schwartz et al., 2004). Other participants in this pathway to date remain unidentified. However, two additional branching mutants in Arabidopsis, max1 and max2 have been identified but their role in the synthesis of the branch inhibiting compound is not yet known (Stirnberg et al., 2002). Six RMS loci have been identified in pea (Beveridge et al., 1996; Beveridge et al., 2000; Morris et al., 2001; Rameau et al., 2002). Reciprocal grafting experiments among the rms mutants show Rms3 and Rms4 to be more important in the shoot than in the root. Rms1 and Rms 5 appear to regulate the same signal emanating from the root (Morris et al., 2001) and Rms2 has been hypothesized to act as a shoot to root signal (Beveridge, 2000). From these studies it is obvious that branching control is regulated by a complex signaling network. To add to this complexity the recently discovered BYPASS1 (BPS1) was also shown to be involved in the control of apical growth. BYPASS1 does not possess strong homology to any known protein. Mutants of BPS1 do not grow past the production of two cotyledonary leaves, which have no vasculature or trichomes. bps1 plants also display a short root phenotype. The bps1 phenotypes are temperature sensitive in that they become less severe with increasing temperature. Interestingly a partial rescue of bps1 phenotypes are seen with fluridone treatment. Fluridone inhibits phytoene desaturase and therefore carotenoid biosynthesis. Furthermore, the aba1bps1 double mutant showed an enhanced bps1 phentoype. ABA1 converts zeaxanthin to violaxanthin. These results led authors to hypothesis the existence of a zeaxanthin-derived signal regulated by BPS1, which inhibits apical growth (Van Norman et al., 2004). CCD7 and CCD8 may be responsible for the synthesis of this

PAGE 86

74 carotenoid derived signaling molecule, without which apical growth is left uninhibited leading to the highly branched phenotypes seen in max3 and max4 The isolation of max rms dad and now bps1 strongly suggest that a carotenoid derived compound is a novel growth inhibiting phytohormone, which along with auxins and cytokinins represent a means by which plants control their pattern of growth.

PAGE 87

75 CHAPTER 7 MATERIALS AND METHODS Cloning of CCD1 CCD7 and CCD8 cDNA CCD1 The CCD1 cDNA in pBK-CMV (Stratagene, La Jolla, CA) was a gift from B. C. Tan. CCD1 cDNA was put into the Gateway pENTRD (Invitrogen, Carlsbad, CA ) using the following primers; Forward 5-caccatggcggagaaactcagtatggcag-3 and Reverse 5ttatataagagtttgttcctggagttgttc-3 and sequenced. From pENTRD, CCD1 cDNA was transferred to pDESTOE (Booker et al., 2004) by recombination for overexpression. The pDESTOE vector contains the constitutive Figwort Mosaic Virus promoter and NOS terminator as well as the plant selection gene, nptII CCD1 pBK-CMV was digested with Pst I/ Sma I and ligated into pSP6-PolyA (Promega, Madison, WI) for in vitro transcription and translation. CCD7 The CCD7 cDNA was obtained by a two-step RT-PCR reaction with RNA from Columbia tissue. Advantage RT-for-PCR reagents (BD Biosciences Clontech, Palo Alto, CA) were used according to the manufacturer and CCD7 was amplified from cDNA using the following primers; Foward 5-caccatggcggagaaactcagtgatggcag-3 and Reverse 5-ttatataagagtttgttcctggagttgttcctgtgaatacc-3. Full length cDNA was maintained in either the pCR-BluntII-TOPO vector or the pENTRD vector (both from Invitrogen) and sequenced. CCD7 cDNA was transferred from CCD7 pENTRD to pDESTOE (Booker et al., 2004) for overexpression by recombination, to pDEST14 (Invitrogen) for expression

PAGE 88

76 by recombination, and to pSP6-PolyA (Promega) by digestion with Pst I and Sac I for in vitro transcription and translation. CCD8 The CCD8 cDNA in pBlueScript (KS) was a gift from Steve Schwartz. A single nucleotide mutation was found in the cDNA clone and corrected using a BD Biosciences Clontech mutagenesis kit. The sequence matched that of the annotated gene in GenBank (At4g32810). CCD8 cDNA was amplified using the following primers F 5caccatggcttctttgatcacaaccaaagc3, R 5ttaatctttggggatccagcaaccatg-3, put into the Gateway pENTR2B vector (Invitrogen) and sequenced. CCD8 cDNA was transferred from CCD8 pENTR2B to pDESTOE (Booker et al., 2004) for overexpression by recombination and to pSP6-PolyA (Promega) by digestion with Sal I and Xba I for in vitro transcription and translation.. Carotenoid/Apocarotenoid Extraction from E.coli Plasmids containing the carotenoid biosynthetic genes (courtesy of F. Cunningham) for phytoene, z -carotene, lycopene, d -carotene, b -carotene, and zeaxanthin were cotransformed with CCD7 pDEST14 into the arabinose inducible E. coli strain, BL21-AI (Invitrogen). Cells were grown in LB with 0.1% glucose at 30 O C for varying amounts of time depending on the extraction procedure. Expression of CCD7 was induced by the addition of 0.1% arabinose when cells reached an A 600 of 1.0. For HPLC analysis, one preculture was grown and used to inoculate two 25 ml cultures, one of which was induced for CCD7 expression once an A 600 of 1.0 was reached. The 25 ml cultures were grown for an additional 24 h and carotenoids were extracted using the method of Fraser et al. (Fraser et al., 2000). Injection volumes for

PAGE 89

77 extracts from uninduced and induced cells were normalized for A 600 taken just prior to extraction to directly compare accumulation of the carotenoid substrate. Analysis was carried out on a Waters (Milford, MA) HPLC, equipped with a photodiode array detector and a reversed-phase YMC Carotenoid S-5 4.6x250 mm column (Waters). HPLC running parameters are as described in (Fraser et al., 2000). The apocarotenoid products were detected by gas chromatography and verified by gas chromatography/mass spectrometry, by the running parameters of (Engelberth et al., 2003). For apocarotenoid analysis, cell cultures (25 ml) were grown for no more than 12 h and apocarotenoids were extracted by the addition of an equal volume of hexane. Culture/hexane solutions were sonicated in a water bath sonicator for 5 m and vortexed for 1 m. The phases were separated by centrifugation and the hexane phase was retained. Apocarotenoid volatiles were collected onto a filter trap (containing 20 mg of SuperQ, Alltech Associations) by vapor-phase extraction as described in (Engelberth et al., 2003), with the exception that samples were dried to completion then heated to 75 O C to promote volatility. For the b carotene strain, a 100 ml culture was grown for 16h. Air was bubbled through the culture and volatiles were collected onto the SuperQ filter trap. In both apocarotenoid extraction procedures, volatiles were eluted off the trap with 150 m l of hexane, of which 5 m l were injected onto the GC. Injection volumes for extracts from uninduced and induced cells were normalized for A 600 Plant Growth Conditions and Measurements Plants were grown under Cool White and Gro-Lux (Sylvania) fluorescent tubes at 50 m mol m -2 s -1 Temperatures ranged from 19 O C to 22 O C. Short days consisted of 8 h light and 16 h dark, while long days consisted of 16 h light and 8 h dark. Measurements of

PAGE 90

78 petiole length and leaf blade length were taken from the 6 th leaf on the rosette. A combined inflorescence number was obtained by counting every inflorescence, emerging from the primary meristem and axillary meristems, one week in long days and two weeks in short days after observation of primary inflorescence emergence. For all measurements, data from at least 6 plants were averaged. Subcellular Localization TNT Transcription of each cDNA was under the control of the SP6 promoter in the pSP64-PolyA vector (Promega). In vitro transcription and translation was done using the coupled transcription/translation (TNT) wheat germ extract (for CCD1 and CCD8) or the rabbit reticulocyte lysate (for CCD7) system by Promega. A 100 m l reaction contained the following ingredients, 50 m l wheat germ extract or rabbit reticulocyte lysate, 4 m l TNT reaction buffer, 2 m l SP6 RNA polymerase, 2 m l amino acid mixture minus leucine, 28 m l 3 H-leucine, ribonuclease inhibitor (20 units/ml), and 6 m g of plasmid DNA. Reactions were incubated for 30m at 25 0 C. A 2 m l aliquot of TNT reaction products was set aside and the remaining reaction mix was brought to 200 m l with 60 mM leucine in 2X import buffer (IB) (1X IB = 50 mM HEPES/KOH pH 8.0, 0.33 M sorbitol). Chloroplast Import Chloroplasts were isolated from 9-11 day old pea seedlings (Laxtons Progress 9). Import assays were performed as described by Cline et al. (1993). Import assays were set up as follows, 200 m l precursor protein (TNT reaction products) were added to 200 m l chloroplasts (resuspended to ~1.0 mg Chlorophyll/ml), 25 m l 120mM Mg-ATP in 1X IB pH8.0, 30 m l 0.1 M DTT, and 145 m l 1X IB. Import was allowed to proceed for 30 m at

PAGE 91

79 25 O C under light and stopped by transferring tubes to ice. Chloroplasts were pelleted (1000xg for 6 m) and resuspended in 0.5 ml import buffer. Chloroplasts were then treated with 25 m l thermolysin (2 mg/ml in IB, 10 mM CaCl 2 ). Thermolysin treatment proceeded for 40 m at 4 O C. Chloroplasts were then repurified on a 35% Percoll cushion, washed with 1X IB, and resuspended in 10 mM Hepes-KOH/5 mM EDTA pH 8.0. Subfractionation Following import, chloroplasts were repurified on a 35% Percoll cushion, washed with 1X IB, lysed by resuspension in 10 mM Hepes-KOH/5 mM EDTA pH 8.0 and allowed to sit on ice for 5 m. To adjust the osmolarity of the solution, 20 m l of 2X IB/20 mM MgCl 2 was added. Thylakiods were isolated by spinning chloroplasts at 4000xg for 30 s at 4 0 C. The pellet was washed with 1ml 1X IB, spun at 8200 g for 3 m, and resuspended in 120 m l 10 mM Hepes-KOH/5 mM EDTA pH 8.0. The supernatant was removed and spun for 30 m at 50,000xg at 2 0 C to separate envelope inner and outer membranes from stroma. The supernatant (stromal fraction) was removed and the volume carefully measured. The pellet (envelope fraction) was resuspended in the same volume as the stromal fraction with 10 mM Hepes-KOH/5 mM EDTA pH 8.0. Thermolysin treated whole chloroplasts and chloroplast subfractions were mixed with 2X SDS sample buffer, heated to 80 0 C for 3 m, and run out on 12.5% SDSpolyacrylamide gels. The gels were incubated in DMSO for 5 m with shaking and then with enough 2,5-diphenyloxazole (PPO) in DMSO to cover the gel for 30 m with shaking. After washing in water, the gels were dried and the proteins were detected by fluorography.

PAGE 92

80 Real Time RT-PCR To determine the major sites of CCD expression, tissues for RNA were harvested from Columbia plants grown in soil on short days for 2.5 months. Plants were then switched to long days in order to promote flowering. Once plants bolted, primary inflorescence stem (primary inflorescence minus flowers and cauline leaves), flower and green silique tissues were collected. Secondary inflorescence stems were collected once they reached 8 cm in height. Primary inflorescence stem is the shoot originating from the primary shoot meristem whereas secondary inflorescence stems are the shoots originating from the axillary meristems. Total RNA was isolated as described in Chang et al. (1993). Tissue expression patterns were determined for three biological replicates. Data for one replicate is shown. Relative expression patterns for each replicate were equivalent. To determine day length effect on gene expression, RNA was harvested from 14 day-old seedlings. Two sets of seedlings were grown on agar plates containing Murashige and Skoog basal salt mixture (Sigma-Aldrich, St. Louis, MO) for 14 days on a short day light schedule, at which time half of the plates were switched to long days. Eight days later, both sets were collected and frozen and RNA was harvested. Averages and standard errors of three replicates are shown. For analysis of the effect of water stress on CCD expression, tissue was collected from 14 day-old seedlings (short day light cycle) harvested from MS plates and left on the bench until they lost 15% of their fresh weight. They were then sealed in plastic bags and put in the dark for 6 h. Nonstressed tissue was harvested in the same way but was sealed in plastic bags immediately after removal from plates, kept in the dark for 6 h, then

PAGE 93

81 frozen and RNA extracted. The above procedures are also detailed in Tan et al. (2003). Averages and standard errors of three replicates are shown. All RNA was DNaseI (Ambion, Austin, TX) treated at 37 O C for 30 m. DNase was removed using the RNeasy kit from Qiagen (Valencia, CA). RNA was visualized on agarose gels and quantified by spectrophotometry. An Applied Biosystems GeneAmp 5700 real-time PCR machine was used with TaqMan One-Step RT-PCR reagents (Applied Biosystems, Foster City, CA) and reaction conditions were as per manufacturer specifications using 250 ng RNA per reaction in a 25 m l reaction volume. Reactions were done in duplicate and quantities were averaged. The primer/probe set for each CCD are shown in Table 7-1. Transcript quantities were determined by comparison to a standard curve. Transcripts for use in production of standard curves were synthesized with T7 polymerase in vitro in the presence of [ 3 H]-UTP from CCD1 pBK-CMV (linearized with Not I), CCD7 pBluntII (linearized with Spe I), and CCD8 pENTR2B (linearized with Xba I). Quantities were then normalized to ribosomal RNA, which was detected using the Taqman Ribosomal RNA Control Reagents kit by Applied Biosystems. Table 7-1. Primers used in Real Time RT-PCR reactions. Forward Primer 5 Probe 5-FAME...TAMRA-3 Reverse Primer 5 CCD1 acaagagattgacccactccttca tgctcacccaaaagttgacccggt tgtttacattcggctattcgca CCD7 caaccgagtcaagcttaatcca aggttccatagcggctatgtgcgga aacgctgataccattggtgaca CCD8 tgataccatctgaaccattcttcgt 5cctcgacccggtgcaacccat cgatatcaccactccatcatcct Isolation of Loss-of-Function Mutants Three publically available populations were used to obtain mutants in this study, the Wisconsin Knock-out facility (Krysan et al., 1999; Weigel et al., 2000) the Syngenta

PAGE 94

82 Arabidopsis Insertion Library (SAIL) (Sessions et al., 2002) and the Salk Institute Genomic Analysis Laboratory (Alonso et al., 2003). Each population is a collection of mutants obtained via Agrobacterium -mediated insertional mutagenesis. The mutants resulting from this form of mutagenesis, which no longer express the gene of interest, are called knock-outs because either their promoter or coding region is disrupted by the TDNA insert (Krysan et al., 1999) At the time the mutants in this study were isolated the Wisconsin Knockout population organized their population of knock-outs in pools such that several, sequentially smaller pools must be screened before finding the one plant that is a knock-out for the gene of interest. Therefore, a pool of DNA was screened via PCR by the facility using primers listed in Table 7-2 and a primer specific for the left border sequence of the T-DNA (LB). Once supplied by the facility, PCR products were run out on an agrose gel and blotted for Southern analysis using full length cDNA clones as probes. Two populations from the Wisconsin Knock-out Facility exist, the Alpha (Krysan et al., 1999) and the Basta (Weigel et al., 2000) populations. Positive plants isolated from the Alpha population are resistant to kanamycin and those from the Basta population are resistant to glutamine synthetase inhibitors such as BASTA. The active ingredient in commercially available forms of BASTA is the glutamate analog, glufosinate-ammonium. Mutants from either the SAIL or Salk populations are obtained by searching a database for sequence matches. A positive match means that the population does contain a knock-out of your gene. The seeds are ordered and arrive as a segregating population. Recently, the Wisconsin Knock-out population and the SAIL population have been given to the Salk Institute Genomic Analysis Laboratory and are searchable through their database (signal.salk.edu).

PAGE 95

83 For each population PCR was used to identify a plant homozygous for the T-DNA insert. Gene specific primers used in these reactions are listed in Table 7-2. Amplification with the forward and reverse gene specific primers indicated a wild-type copy. Amplification using either forward or reverse gene specific primer and the LB primer indicated the presence of a T-DNA within the gene. Table 7-2. Gene specific primers used to identify knock-out plants Forward Primer Reverse Primer CCD1 5-cagagtgttggatcgttgctggaagaaag-3 5-tcctggagttgttcctgtgaataccagac-3 CCD7 5-gctcatgtcttccacaaaatcactcaact-3 5-aaccatgaaaacccatcggaaacgtcaaa-3 CCD8 5-aaaaccgcatcaaaacttaccgtcaaact-3 5-ttgcgaattgataggtggaaccagtgaac-3 b -ionone Measurements Plants were grown on short days until rosettes contained from 22 to 27 leaves. Whole rosettes were ground individually under liquid N 2 and approximately 200 mg of each sample was used for extraction. b -ionone was extracted following the method of Schmelz et al. (Schmelz et al., 2003), with the following exceptions. The extraction solution used was 1-propanol/H 2 O (2:1 vol/vol). Following shaking in a FastPrep FP 120 tissue homogenizer, hexanes were added to the samples and shaken again. The hexanes/1-propanol (top) phase was transferred to a new vial. No derivitization/neutralization step was necessary. b -ionone was collected by vapor-phase extraction as described in Schmelz et al. (2003). However, samples were heated to no higher than 70 O C until dry, then 2 m more. b -ionone was eluted from the filter trap with 150 m l of hexanes. Samples were injected onto a GC-MS, conditions of which are also

PAGE 96

84 described in Schmelz et al. (2003). Sample b -ionone quantities were determined by an external standard curve. IAA and Abscisic Acid Measurements Wild-type and mutant plants were grown on short days until their rosettes contained 15-20 leaves, at which time rosettes were frozen individually. ABA and IAA were quantified following the procedure of Schmelz et al. (2003). Samples were injected onto a GC-MS, conditions of which are also described in Schmelz et al. (2003). Tissue from six rosettes was analyzed individually and the measurements were averaged.

PAGE 97

85LIST OF REFERENCESAlonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK,Zimmerman J, Barajas P, Cheuk R, Gadrinab C, Heller C, Jeske A,Koesema E, Meyers CC, Parker H, Prednis L, Ansari Y, Choy N, Deen H,Geralt M, Hazari N, Hom E, Karnes M, Mulholland C, Ndubaku R, SchmidtI, Guzman P, Aguilar-Henonin L, Schmid M, Weigel D, Carter DE,Marchand T, Risseeuw E, Brogden D, Zeko A, Crosby WL, Berry CC, EckerJR (2003) Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science301: 653-657Aukerman MJ, Hirschfeld M, Wester L, Weaver M, Clack T, Amasino RM,Sharrock RA (1997) A deletion in the PHYD gene of the ArabidopsisWassilewskija ecotype defines a role for phytochrome D in red/far-red lightsensing. Plant Cell 9: 1317-1326Bak S, Tax FE, Feldmann KA, Galbraith DW, Feyereisen R (2001) CYP83B1, acytochrome P450 at the metabolic branch point in auxin and indole glucosinolatebiosynthesis in Arabidopsis. Plant Cell 13: 101-111Baldwin EA, Scott, J.W., Shewmaker, C.K., Schuch, W. (2000) Flavor trivia andtomato aroma: Biochemistry and possible mechanisms for control of importantaroma components. HortScience 35: 1013-1021Beveridge C (2000) Long-distance signalling and a mutational analysis of branching inpea. Plant Growth Reg 32: 193-203Beveridge CA, Ross JJ, Murfet IC (1996) Branching in pea (Action of genes Rms3 andRms4). Plant Physiol 110: 859-865Beveridge CA, Symons GM, Turnbull CG (2000) Auxin inhibition of decapitation-induced branching is dependent on graft-transmissible signals regulated by genesRms1 and Rms2. Plant Physiol 123: 689-698Booker J, Auldridge M, Wills S, McCarty D, Klee H, Leyser O (2004) MAX3/CCD7is a carotenoid cleavage dioxygenase required for the synthesis of a novel plantsignaling molecule. Curr Biol 14: 1232-1238Bouvier F, Dogbo O, Camara B (2003a) Biosynthesis of the food and cosmetic plantpigment bixin (annatto). Science 300: 2089-2091

PAGE 98

86Bouvier F, Suire C, Mutterer J, Camara B (2003b) Oxidative remodeling ofchromoplast carotenoids: identification of the carotenoid dioxygenase CsCCD andCsZCD genes involved in Crocus secondary metabolite biogenesis. Plant Cell 15:47-62Burbidge A, Grieve TM, Jackson A, Thompson A, McCarty DR, Taylor IB (1999)Characterization of the ABA-deficient tomato mutant notabilis and its relationshipwith maize Vp14. Plant J 17: 427-431Chang S, Puryear J, Cairney J (1993) A simple and efficient method for isolating RNAfrom pine trees. Plant Mol Biol Rep 11: 113-116Chatfield SP, Stirnberg P, Forde BG, Leyser O (2000) The hormonal regulation ofaxillary bud growth in Arabidopsis. Plant J 24: 159-169Chen F, Tholl D, D'Auria JC, Farooq A, Pichersky E, Gershenzon J (2003)Biosynthesis and emission of terpenoid volatiles from Arabidopsis flowers. PlantCell 15: 481-494Chernys JT, Zeevaart JA (2000) Characterization of the 9-cis-epoxycarotenoiddioxygenase gene family and the regulation of abscisic acid biosynthesis inavocado. Plant Physiol 124: 343-353Cline K, Henry R, Li C, Yuan J (1993) Multiple pathways for protein transport into oracross the thylakoid membrane. EMBO J 12: 4105-4114Cohen JD, Slovin JP, Hendrickson AM (2003) Two genetically discrete pathwaysconvert tryptophan to auxin: more redundancy in auxin biosynthesis. Trends PlantSci 8: 197-199Cunningham DG, Acree, T.E., Barnard, J., Butts, R., Braell, P. (1986) Analysis ofapple volatiles. Food Chem 19: 137-147Cunningham FX, Gantt E (1998) Genes and enzymes of carotenoid biosynthesis inplants. Annu Rev Plant Physiol Plant Mol Biol 49: 557-583Cunningham FX, Jr., Pogson B, Sun Z, McDonald KA, DellaPenna D, Gantt E(1996) Functional analysis of the beta and epsilon lycopene cyclase enzymes ofArabidopsis reveals a mechanism for control of cyclic carotenoid formation. PlantCell 8: 1613-1626Cunningham FX, Jr., Sun Z, Chamovitz D, Hirschberg J, Gantt E (1994) Molecularstructure and enzymatic function of lycopene cyclase from the cyanobacteriumSynechococcus sp strain PCC7942. Plant Cell 6: 1107-1121

PAGE 99

87 Devlin PF, Robson PR, Patel SR, Goosey L, Sharrock RA, Whitelam GC (1999) Phytochrome D acts in the shade-avoidance syndrome in Arabidopsis by controlling elongation growth and flowering time. Plant Physiol 119: 909-915 Douce R, Holtz RB, Benson AA (1973) Isolation and properties of the envelope of spinach chloroplasts. J Biol Chem 248: 7215-7222 Emanuelsson O, Nielsen H, Brunak S, von Heijne G (2000) Predicting subcellular localization of proteins based on their N-terminal amino acid sequence. J Mol Biol 300: 1005-1016 Engelberth J, Schmelz EA, Alborn HT, Cardoza YJ, Huang J, Tumlinson JH (2003) Simultaneous quantification of jasmonic acid and salicylic acid in plants by vapor-phase extraction and gas chromatography-chemical ionization-mass spectrometry. Anal Biochem 312: 242-250 Fester T, Maier, W., Strack, D. (1999) Accumulation of secondary compounds in barley and wheat roots in response to inoculation with an arbuscular mycorrhizal fungus and co-inoculation with rhizosphere bacteria. Mycorrhiza 8: 241-246 Finkelstein RR, Gampala SS, Rock CD (2002) Abscisic acid signaling in seeds and seedlings. Plant Cell 14 Suppl: S15-45 Foo E, Turnbull CG, Beveridge CA (2001) Long-distance signaling and the control of branching in the rms1 mutant of pea. Plant Physiol 126: 203-209 Fraser PD, Pinto ME, Holloway DE, Bramley PM (2000) Technical advance: application of high-performance liquid chromatography with photodiode array detection to the metabolic profiling of plant isoprenoids. Plant J 24: 551-558 Fray RG, Wallace, A., Fraser, P. D., Valero, D., Hedden, P., Bramley, P. M., Grierson, G. (1995) Constitutive expression of a fruit phytoene synthase gene in transgenic tomatoes causes dwarfism by redirecting metabloites from the gibberellin pathway. Plant J 8: 693-701 Hammack L (2001) Single and blended maize volatiles as attractants for diabroticite corn rootworm beetles. J Chem Ecol 27: 1373-1390 Havaux M (1998) Carotenoids as membrane stabilizers in chloroplasts. Trends Plant Sci 3: 147-151 Hirschberg J (2001) Carotenoid biosynthesis in flowering plants. Curr Opin Plant Biol 4: 210-218

PAGE 100

88 Iuchi S, Kobayashi M, Taji T, Naramoto M, Seki M, Kato T, Tabata S, Kakubari Y, Yamaguchi-Shinozaki K, Shinozaki K (2001) Regulation of drought tolerance by gene manipulation of 9-cis-epoxycarotenoid dioxygenase, a key enzyme in abscisic acid biosynthesis in Arabidopsis. Plant J 27: 325-333 Iuchi S, Kobayashi M, Yamaguchi-Shinozaki K, Shinozaki K (2000) A stressinducible gene for 9-cis-epoxycarotenoid dioxygenase involved in abscisic acid biosynthesis under water stress in drought-tolerant cowpea. Plant Physiol 123: 553-562 Kiefer C, Hessel S, Lampert JM, Vogt K, Lederer MO, Breithaupt DE, von Lintig J (2001) Identification and characterization of a mammalian enzyme catalyzing the asymmetric oxidative cleavage of provitamin A. J Biol Chem 276: 14110-14116 Kohler RH, Cao J, Zipfel WR, Webb WW, Hanson MR (1997) Exchange of protein molecules through connections between higher plant plastids. Science 276: 20392042 Krysan PJ, Young JC, Sussman MR (1999) T-DNA as an insertional mutagen in Arabidopsis. Plant Cell 11: 2283-2290 Lichtenthaler HK (1999) The 1-deoxy-D-xylulose-5-phosphate pathway of isoprenoid biosynthesis in plants. Annu Rev Plant Physiol Plant Mol Biol 50: 47-65 Lincoln C, Britton JH, Estelle M (1990) Growth and development of the axr1 mutants of Arabidopsis. Plant Cell 2: 1071-1080 Lindqvist A, Andersson S (2002) Biochemical properties of purified recombinant human beta-carotene 15,15'-monooxygenase. J Biol Chem 277: 23942-23948 Mangelsdorf DJ, Kliewer SA, Kakizuka A, Umesono K, Evans RM (1993) Retinoid receptors. Recent Prog Horm Res 48: 99-121 Markwell J, Bruce BD, Keegstra K (1992) Isolation of a carotenoid-containing submembrane particle from the chloroplastic envelope outer membrane of pea (Pisum sativum). J Biol Chem 267: 13933-13937 McElver J, Tzafrir I, Aux G, Rogers R, Ashby C, Smith K, Thomas C, Schetter A, Zhou Q, Cushman MA, Tossberg J, Nickle T, Levin JZ, Law M, Meinke D, Patton D (2001) Insertional mutagenesis of genes required for seed development in Arabidopsis thaliana. Genetics 159: 1751-1763

PAGE 101

89 Meza TJ, Stangeland B, Mercy IS, Skarn M, Nymoen DA, Berg A, Butenko MA, Hakelien AM, Haslekas C, Meza-Zepeda LA, Aalen RB (2002) Analyses of single-copy Arabidopsis T-DNA-transformed lines show that the presence of vector backbone sequences, short inverted repeats and DNA methylation is not sufficient or necessary for the induction of transgene silencing. Nucleic Acids Res 30: 4556-4566 Morris SE, Turnbull CG, Murfet IC, Beveridge CA (2001) Mutational analysis of branching in pea. Evidence that Rms1 and Rms5 regulate the same novel signal. Plant Physiol 126: 1205-1213 Napoli C (1996) Highly branched phenotype of the petunia dad1-1 mutant is reversed by grafting. Plant Physiol 111: 27-37 Qin X, Zeevaart JA (1999) The 9-cis-epoxycarotenoid cleavage reaction is the key regulatory step of abscisic acid biosynthesis in water-stressed bean. Proc Natl Acad Sci U S A 96: 15354-15361 Rameau C, Murfet IC, Laucou V, Floyd RS, Morris SE, Beveridge CA (2002) Pea rms6 mutants exhibit increased basal branching. Physiol Plant 115: 458-467 Redmond TM, Gentleman S, Duncan T, Yu S, Wiggert B, Gantt E, Cunningham FX, Jr. (2001) Identification, expression, and substrate specificity of a mammalian beta-carotene 15,15'-dioxygenase. J Biol Chem 276: 6560-6565 Saari JC (1994) Retinoids in photosensitive systems. In ABR M.B. Sporn, and D.S. Goodman, ed, The Retinoids: Biology, Chemistry, and Medicine, Ed 2nd. Raven Press, New York, pp 351-385 Schmelz EA, Engelberth J, Alborn HT, O'Donnell P, Sammons M, Toshima H, Tumlinson JH, 3rd (2003) Simultaneous analysis of phytohormones, phytotoxins, and volatile organic compounds in plants. Proc Natl Acad Sci U S A 100: 10552-10557 Schwartz SH, Qin X, Loewen MC (2004) The biochemical characterization of two carotenoid cleavage enzymes from arabidopsis indicates that a carotenoid-derived compound inhibits lateral branching. J Biol Chem 279: 46940-46945 Schwartz SH, Qin X, Zeevaart JA (2001) Characterization of a novel carotenoid cleavage dioxygenase from plants. J Biol Chem 276: 25208-25211 Schwartz SH, Tan BC, Gage DA, Zeevaart JA, McCarty DR (1997) Specific oxidative cleavage of carotenoids by VP14 of maize. Science 276: 1872-1874

PAGE 102

90Sessions A, Burke E, Presting G, Aux G, McElver J, Patton D, Dietrich B, Ho P,Bacwaden J, Ko C, Clarke JD, Cotton D, Bullis D, Snell J, Miguel T,Hutchison D, Kimmerly B, Mitzel T, Katagiri F, Glazebrook J, Law M, GoffSA (2002) A high-throughput Arabidopsis reverse genetics system. Plant Cell 14:2985-2994Simkin AJ, Schwartz SH, Auldridge M, Taylor MG, Klee HJ (2004) The tomatoCCD1 (Carotenoid Cleavage Dioxygenase 1) genes contribute to the formation ofthe flavor volatiles b-ionone, pseudoionone and geranylacetone. Plant J 40: 882-892Simkin AJ, Underwood BA, Auldridge ME, Loucas HM, Shibuya K, Clark DG,Klee HJ (2004) Circadian regulation of the PhCCD1 carotenoid dioxygenasecontrols emission of beta-ionone, a fragrance volatile of petunia flowers. PlantPhysiol 136: 3504-3514Soll J, Schleiff E (2004) Protein import into chloroplasts. Nat Rev Mol Cell Biol 5: 198-208Sorefan K, Booker J, Haurogne K, Goussot M, Bainbridge K, Foo E, Chatfield S,Ward S, Beveridge C, Rameau C, Leyser O (2003) MAX4 and RMS1 areorthologous dioxygenase-like genes that regulate shoot branching in Arabidopsisand pea. Genes Dev 17: 1469-1474Stirnberg P, Chatfield SP, Leyser HM (1999) AXR1 acts after lateral bud formation toinhibit lateral bud growth in Arabidopsis. Plant Physiol 121: 839-847Stirnberg P, van De Sande K, Leyser HM (2002) MAX1 and MAX2 control shootlateral branching in Arabidopsis. Development 129: 1131-1141Sun Z, Gantt E, Cunningham FX, Jr. (1996) Cloning and functional analysis of thebeta-carotene hydroxylase of Arabidopsis thaliana. J Biol Chem 271: 24349-24352Tan BC, Cline K, McCarty DR (2001) Localization and targeting of the VP14 epoxy-carotenoid dioxygenase to chloroplast membranes. Plant J 27: 373-382Tan BC, Joseph LM, Deng WT, Liu L, Li QB, Cline K, McCarty DR (2003)Molecular characterization of the Arabidopsis 9-cis epoxycarotenoid dioxygenasegene family. Plant J 35: 44-56Tan BC, Schwartz SH, Zeevaart JA, McCarty DR (1997) Genetic control of abscisicacid biosynthesis in maize. Proc Natl Acad Sci U S A 94: 12235-12240Turnbull CG, Booker JP, Leyser HM (2002) Micrografting techniques for testing long-distance signalling in Arabidopsis. Plant J 32: 255-262

PAGE 103

91van den Berg H, Faulks, R., Granado, H. F., Hirschberg, J., Olmedilla, B.,Sandmann, G., Southon, S., Stahl, W. (2000) The potential for the improvementof carotenoid levels in foods and the likely systemic effects. J Sci Food Agri 80:880-912Van Norman JM, Frederick RL, Sieburth LE (2004) BYPASS1 negatively regulates aroot-derived signal that controls plant architecture. Curr Biol 14: 1739-1746von Lintig J, Vogt K (2000) Filling the gap in vitamin A research. Molecularidentification of an enzyme cleaving beta-carotene to retinal. J Biol Chem 275:11915-11920Ward SP, Leyser O (2004) Shoot branching. Curr Opin Plant Biol 7: 73-78Weigel D, Ahn JH, Blazquez MA, Borevitz JO, Christensen SK, Fankhauser C,Ferrandiz C, Kardailsky I, Malancharuvil EJ, Neff MM, Nguyen JT, Sato S,Wang ZY, Xia Y, Dixon RA, Harrison MJ, Lamb CJ, Yanofsky MF, Chory J(2000) Activation tagging in Arabidopsis. Plant Physiol 122: 1003-1013Windels P, De Buck S, Van Bockstaele E, De Loose M, Depicker A (2003) T-DNAintegration in Arabidopsis chromosomes. Presence and origin of filler DNAsequences. Plant Physiol 133: 2061-2068Winterhalter P, Rouseff RL (2002) Carotenoid-derived Aroma Compounds. AmericanChemical Society : Distributed by Oxford University Press, Washington, DCWyatt SE, Kuc, J. (1992) The accumulation of b-ionone and 3-hydroxy esters of b-ionone in tobacco immunized by foliar inoculation with tobacco mosaic virus.Phytopathology 82: 580-582Zhao Y, Christensen SK, Fankhauser C, Cashman JR, Cohen JD, Weigel D, ChoryJ (2001) A role for flavin monooxygenase-like enzymes in auxin biosynthesis.Science 291: 306-309Zhao Y, Hull AK, Gupta NR, Goss KA, Alonso J, Ecker JR, Normanly J, Chory J,Celenza JL (2002) Trp-dependent auxin biosynthesis in Arabidopsis:involvement of cytochrome P450s CYP79B2 and CYP79B3. Genes Dev 16:3100-3112

PAGE 104

92BIOGRAPHICAL SKETCHMichele Auldridge was born in Washington, D.C., on November 7th, 1973. Shegrew up in Silver Spring, MD, with her parents Michael and Elise, and sister, Laura.Michele graduated from the University of Maryland as a zoology major in 1996 and wenton to work as a research assistant for the Biochemistry Department at GeorgeWashington University. She then went on to a research technician position at the USDA,making the switch to plants. Michele left the USDA in 2000 to begin her studies at theUniversity of Florida in plant molecular biology.


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20110114_AAAADI INGEST_TIME 2011-01-14T18:07:09Z PACKAGE UFE0008160_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 106113 DFID F20110114_AACANB ORIGIN DEPOSITOR PATH auldridge_m_Page_066.jp2 GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
2389499f6d968e947e8d4f26f35cd5fe
SHA-1
20d2e85cdba8380d8658a21c51028bf3fd3fb7f2
1051775 F20110114_AACAMN auldridge_m_Page_050.jp2
6b881c69ac004301f6cfc9d147c920d2
0a604dc5472f87cb67d7048e7c165609d0aaa2a1
1051939 F20110114_AACALY auldridge_m_Page_029.jp2
2f577069c7edd783d5615d1d08d77467
e89ef69812edc5c0dd524fa84624543c474d98ea
1051966 F20110114_AACANC auldridge_m_Page_067.jp2
e625ec6fe253930f04a339aec0d70ca4
0d77fb6d1ebe5bc49835f98fdb0e3878ea79ed8c
1051971 F20110114_AACAMO auldridge_m_Page_051.jp2
a8142305016b6636cca18ab3677cf1d6
db8080ed19880922143a6afbc0aa39067e1c7b1b
1018415 F20110114_AACALZ auldridge_m_Page_031.jp2
fa7360578993d6255259a6c038d4d8c3
556c8f41c1e02c62ae97f9efc27224ab5dea45be
1051982 F20110114_AACAND auldridge_m_Page_069.jp2
ad5d565c603c757a4b585391158a1ac7
1ccde962e40544c5b090041b697748285ad8dee2
116292 F20110114_AACAMP auldridge_m_Page_052.jp2
cd49d0b2304b0588ba37d57118d3a8c5
d7d9ef31e873f89dea48e23d35d2c273766fbb52
811222 F20110114_AACANE auldridge_m_Page_070.jp2
d3d903585858068dea141bc89b48ed70
7a206405d5d894a11e23d0951170b805509c2ad9
98984 F20110114_AACAMQ auldridge_m_Page_053.jp2
51b73cbfdd1c3a5c7229f7726625dd7d
354ea29c54b897d7e1a8b22b94def19ec1bfc28e
91984 F20110114_AACANF auldridge_m_Page_072.jp2
75023dc81267e762823b7e65ada78f64
9fabfef87d8797ef479b71fc27a75436016598e5
873156 F20110114_AACAMR auldridge_m_Page_055.jp2
a57585bc3321a14089fe91bc7da1e627
5e01f24a74ecb58f101b71e5a771936086b37331
828713 F20110114_AACAMS auldridge_m_Page_056.jp2
dbececbca6d0729c0c972b91845de685
c59116ba93fcfa0f1b5e7ec8d786ffcdc6390b70
90175 F20110114_AACANG auldridge_m_Page_073.jp2
201dead8485dd8f097edd5e042250449
651d3c5d0676f1becbc55a57e437bbfd477234dc
87411 F20110114_AACAMT auldridge_m_Page_057.jp2
17c3d623c2c1d41ad58cce6769430e5f
90648acd3c3c98c530ed1c409db4f01d6e133bb4
699855 F20110114_AACANH auldridge_m_Page_076.jp2
eb0b5975ed4eee75c984114cedf4671c
91f2bcb7badbf1a913efd48957a96f7940c5c9a3
800664 F20110114_AACAMU auldridge_m_Page_058.jp2
412c7ac2fac36fba6fcfb24bd749ede2
a6e6b91b8d2534804336ceabaaa2916b790967bf
102255 F20110114_AACANI auldridge_m_Page_077.jp2
d86538df892ffcb9c52adf2af88686ef
7a09ca979c9b2928d6b16402a3a0c94f0c58062a
88494 F20110114_AACAMV auldridge_m_Page_059.jp2
ec217f37d4a5d010d6ce7834db0793ac
1912d3d4ad2e067279b3f78cec8817e1770ce3fb
597300 F20110114_AACANJ auldridge_m_Page_078.jp2
89aede6f8b9f81eb99f76ce29eef2037
73ba3486931d00f7cf61d1135bb419e75778d81a
880181 F20110114_AACAMW auldridge_m_Page_060.jp2
ba4c10df9b5ce449d728bd2eeef02a5f
f6178d8495b794c546e75f7427316c77970bb663
15195 F20110114_AACANK auldridge_m_Page_079.jp2
26bd4b5b5b154abfa33d26cfbff54b61
4de20ddf8ed042ec36ccbff666e604cb11ea60c2
103715 F20110114_AACANL auldridge_m_Page_081.jp2
29cc4e0874c52a56f3c8716e4bef1d35
45245988615a18b0c7cb57266829e0d5aaad0375
688677 F20110114_AACAMX auldridge_m_Page_062.jp2
6ce44415d3f00d8e9c0a78cc96491271
20553c66b398ad7d4512e3c7cad5476b7b7c1153
119480 F20110114_AACAOA auldridge_m_Page_100.jp2
ddb342c4dc7bcd869bb728370b3b7bae
cf2919840145d263a6f28af6e9a2aecab07a2dff
109065 F20110114_AACANM auldridge_m_Page_083.jp2
317ec41580489bf11986f3fdeaf90913
c875c5bdb09f99d2f53820e3752513dc2ef4059e
85139 F20110114_AACAMY auldridge_m_Page_063.jp2
b900ab3c62c60a82e2b5938c13202101
dadc0e28d0e9ce89d9526cd71e3fee336fbcaeb4
127552 F20110114_AACAOB auldridge_m_Page_101.jp2
8f3700743f0a62b223f5100284ced568
758b517e011fc7e5f3ee2ab74db827658ad688aa
100534 F20110114_AACANN auldridge_m_Page_084.jp2
8a9205f563fbb69a998cb987ae81da04
8dffc6e6da699cab32b17af78b5a14593dcf5908
97792 F20110114_AACAMZ auldridge_m_Page_064.jp2
3110f72527a7b4aa085ebdc411f7534f
6e5eaeb06a284c3e30c42884b09925c191f84630
128516 F20110114_AACAOC auldridge_m_Page_102.jp2
719ec53c3bf91d6901fc3fbbf3fab372
44f4fe1d30bbe514249eaffa854c879be7958056
107367 F20110114_AACANO auldridge_m_Page_085.jp2
131104061f4b92fd19e7385cdb88d959
28bfa08d0520bbc907893077c579efd9c0f4ca3f
35601 F20110114_AACAOD auldridge_m_Page_104.jp2
cf05c7f22a6197bb41a71704809a6322
a539b9a12cac07b98a4b9617a893c33dfef67271
25664 F20110114_AACANP auldridge_m_Page_086.jp2
49bc7995708a0c9bbb3097653cd61b5e
1353b5419d32c777f18e52c189b066a722d9971f
1053954 F20110114_AACAOE auldridge_m_Page_001.tif
01ced3e716cbb27d79300af1be125b2e
79b1ff47fcc6ff6a560be4209c72e4c602d23d4d
97630 F20110114_AACANQ auldridge_m_Page_088.jp2
9314ca2f710c401cb65a07d584a9a115
970f38745073cfc7fcc87d9b6dd9f7471e3614cc
F20110114_AACAOF auldridge_m_Page_002.tif
d8315d5d6f54fa276376b2ca32a7b523
905b1331983325ae5a02b22e0fff74b7ecdf7aa2
105645 F20110114_AACANR auldridge_m_Page_089.jp2
c9abcd170b65daa1dedc9e1ae3b6227b
3c0bc37dcfa2b1b41ed6529e3136d94efbd654b6
F20110114_AACAOG auldridge_m_Page_004.tif
02143dc7df9d98dd94750b77e7c70390
5b89cf0ea38d33e632b2a7cf7d2652a271890294
97184 F20110114_AACANS auldridge_m_Page_090.jp2
6e80900bcf5f14a7aaa6088b53f7d208
339184a909d6056bbd2f90c64641068f74b66e56
25271604 F20110114_AACAOH auldridge_m_Page_005.tif
c64e363a2ef70bb087ff1a2dc59e5733
a40dbd583e9a1d907a03546ef9207521b26a6b98
101150 F20110114_AACANT auldridge_m_Page_092.jp2
fe71ffd1708d884bb5ea1e5016de9af3
f9f36ebb65e8e3f6af60481b4e4c78dff62e05f7
F20110114_AACAOI auldridge_m_Page_006.tif
7e12223f167d6f4f7a31a1b91738a6e1
9e01c377d7af5109ed2a798e852353b6aab55fd2
107044 F20110114_AACANU auldridge_m_Page_093.jp2
458def169c9ada736a29abfcf09488d2
8762662bb581144382e76eb9bb3b64ffeed0aef9
F20110114_AACAOJ auldridge_m_Page_008.tif
c9a1a60133231e518dc578b00b22ccbb
4f2632bbf4707f311c63fd84a849918dc90547fb
97207 F20110114_AACANV auldridge_m_Page_095.jp2
b21f4ca262205194a4d05e2315c7d02f
48c05b496026eb46eb593db1084ca6f164cfc846
F20110114_AACAOK auldridge_m_Page_009.tif
b5086aad4ee390078ab8991c04de2f22
31dbefee6f85d491a8e39ae24cc61b14ec640104
35932 F20110114_AACANW auldridge_m_Page_096.jp2
38c5fb3541af9c46588ce851b4633f4a
c54aafedd56f66979a84876a05659645d4b231e3
F20110114_AACAOL auldridge_m_Page_010.tif
a9ce5021a6d5963e091ac51e8c95a69f
36906a6e9250bdaf21804ced3b056e539392723b
112605 F20110114_AACANX auldridge_m_Page_097.jp2
f8c3be2764e1c865bdcf53a30ce1d44c
7d1b87126ea3c616f3f9bba6ad40522c3a043745
F20110114_AACAPA auldridge_m_Page_030.tif
c18fb55e3568b678c5dcee7f2443692e
cb827b01f0ba7a86a77668063b658f9b84f28bf4
F20110114_AACAOM auldridge_m_Page_011.tif
59c2ca8b842c52684ed21c2cd48e04eb
420e26928c1def15fb67ad326553a872fe38dfa1
F20110114_AACAPB auldridge_m_Page_031.tif
779cd448f5977413efabf3370d4cf94a
a5af543353a633b11137b91259f34eb196603c1e
F20110114_AACAON auldridge_m_Page_012.tif
6fa555fd35b161e72a659b2238a6aa86
cef15eaf3be4c32c68d336635d2f32e4158379be
119842 F20110114_AACANY auldridge_m_Page_098.jp2
ce69091756506e1108cefa1836f5b513
a1cb26f516aae2859ca5425951b69940013fafdf
F20110114_AACAPC auldridge_m_Page_032.tif
f84dbce13d196957d981a6486070b443
76260d1f62c8c42fc10a4b461ba81481085955f6
F20110114_AACAOO auldridge_m_Page_013.tif
b2e6b7dcb997ac9f3f86dbf80ff2c042
31755a233a672eeadc2bf7bb3f0f0f8a46755054
120810 F20110114_AACANZ auldridge_m_Page_099.jp2
8d9579020ead2a53a56b7a2bf0127607
c0be24f85d366aad94bc32fd3013423388715e18
F20110114_AACAPD auldridge_m_Page_034.tif
341872415651f08569e70ad7359fb745
82fcac34d1a9347bbd237a9b8560ebef34529572
F20110114_AACAOP auldridge_m_Page_015.tif
d45a5b77e0d05b39c406e79e2ff3ce57
7ea17f4bfa9540ac1a474d9df52624e829b990ca
F20110114_AACAPE auldridge_m_Page_035.tif
ffffa7cd550dd494871f471b06a5b2cf
8847247c462a1547976c9b062d27dce7c0f8918d
F20110114_AACAOQ auldridge_m_Page_016.tif
0515d6f6015b79cc4e2a53145e222cd0
85501214c4c46a12eca05c5551bd1b1f01b67812
F20110114_AACAPF auldridge_m_Page_036.tif
5afb1a78003972958fa7e4ae7e4f01a5
964e84ef2c9dce5afee434f26332a35444e19ae0
F20110114_AACAOR auldridge_m_Page_017.tif
1edf0ed75b65f2fd902b7968b8150173
2cdd3ed837ddabbad92f8516f1c8daffd9d254b8
F20110114_AACAPG auldridge_m_Page_037.tif
d56016cef6be607516df942c6d218316
c04510a4042db60311bdc27fa0e5345473edf1db
F20110114_AACAOS auldridge_m_Page_018.tif
e4c238e12000d1f1180b634973eca224
2d5182f664c1e413a397616cc516b2e0f4495379
F20110114_AACAPH auldridge_m_Page_038.tif
659f47870ee2c0113853bc4a7caa1a9c
54239cfdafe4ba243486f2be80668e068a477da2
F20110114_AACAOT auldridge_m_Page_019.tif
6231c5c18a5a0c9d1d1d0fec2ea84e62
e9a053a9877b478e990699b1e887f3475890010c
F20110114_AACAPI auldridge_m_Page_039.tif
12ddd9fb54453102aeab3c36cf557f31
76630a6b449ac72d0f0e9c4dd374276fe986fe38
F20110114_AACAOU auldridge_m_Page_020.tif
0271e5a328bd472b6ca11a0764749e9b
14d35838f4c273197e0d67e3383897834aa96779
F20110114_AACAPJ auldridge_m_Page_041.tif
fc65e0694fa2d15e38913434763cd9b8
4a371d45cf8cf87b0d83883d2829f75e56d8dcaf
F20110114_AACAOV auldridge_m_Page_021.tif
9800d12c7e20eac045369cb923d6b444
c3a2c474819a289984b1e71123cd71f7efc9e0c6
F20110114_AACAPK auldridge_m_Page_042.tif
1a8e7aad5f5401f766ce3e06bad1ac44
996d60c214c29b177331f0a5ef1f60a0854b86e3
F20110114_AACAOW auldridge_m_Page_023.tif
0ae96561db585165479a2726c940654c
cc3f1cb4d7647ad1fe71d629136e75fc0fae954a
F20110114_AACAPL auldridge_m_Page_043.tif
5156e52e9ab612fc1f9b16465d0e192a
ea713d220b4c3de38fe78d7bb63f2f73ef571e7a
F20110114_AACAOX auldridge_m_Page_025.tif
9cbb0f25ee23485b9ef0f2e22d8a5a51
e5cebc1119959c0bd0508b3714918b1d01996478
F20110114_AACAPM auldridge_m_Page_045.tif
87e603ec634a040f9517eacba8840ab6
d32f4334f8098c167f7cf7e6b393553c7087ca31
F20110114_AACAOY auldridge_m_Page_028.tif
a565669cbc71787307ca4ffe581d640d
5d11de71d79af83cc34e356a03cac761ea9b8fdf
F20110114_AACAQA auldridge_m_Page_059.tif
75ca9d31562d37ebc80d2deadec25bfc
cea2134be4a067d02ab0d5c4307b3ddef89527f9
F20110114_AACAPN auldridge_m_Page_046.tif
381f3bd2181883d6f734623b257185f4
1e3e801a29eaa64aa8a943b04dbd1bb9e3c6a878
F20110114_AACAQB auldridge_m_Page_061.tif
d1262ac278e872adc339703cb82f42c6
c6f724a0c6c84ab0557d9e0264eeba0b8c4a275a
F20110114_AACAPO auldridge_m_Page_047.tif
4af7a4fea5d26249d4fe1bfa1ea44e34
97c04eb85a45a2b291597f240b1a8fb4b4c9dcfa
F20110114_AACAOZ auldridge_m_Page_029.tif
b5be4c4a711e8f0dbf09e6bf1949ba94
147c25e8c87454b9f87c301def58bcf40ee9499f
F20110114_AACAQC auldridge_m_Page_062.tif
9c14a08d61bee5c405fece48c5b6963c
313331512cb7b7b5a96d9ae7a20a3551b35c1a91
F20110114_AACAPP auldridge_m_Page_048.tif
1d7e0f94bb3d6b49be23ec84b0d36715
0077e8a4baffb241e7449adbc8419cf1ccddd297
F20110114_AACAQD auldridge_m_Page_063.tif
aa4d0e9a8d5c4027b8267fe1a82c610c
12717f2b5050034e03db554e21a5378c1cedab91
F20110114_AACAPQ auldridge_m_Page_049.tif
dbb606957dc55919420e5d44659af2a5
73dfc02aeebc86ccf0aadd8491fdefbdf58733a2
F20110114_AACAQE auldridge_m_Page_064.tif
fcebdeaad7f86a2cf3ee43b3ebe9f3f7
d1f98cfaf511fb43daf3c701c5d105a1f3e0cdd9
F20110114_AACAPR auldridge_m_Page_050.tif
b6c1616d8fc7f4e3c63f4393a7f0c93c
ac8e1278616b01c912cf947ea0119129f97db18f
F20110114_AACAQF auldridge_m_Page_065.tif
8fcbe177f016133662ec95366b59576c
3be268907f6f99018ccfbaec76c2f99c8d7af105
F20110114_AACAPS auldridge_m_Page_051.tif
db5e1640d1e7045d8f557d4c3de3e722
d113b85bc9717af2d144907ad9de3e15d4cb60e7
F20110114_AACAQG auldridge_m_Page_066.tif
7056815938a10ae5c605e545bb14e341
81f092f34b7aa38d3c8747080198d3e112ae1e6e
F20110114_AACAPT auldridge_m_Page_052.tif
49115d63f82410660aa547c1d92a3099
452cc3254778b7b342871baacbf9ffe184aaf930
F20110114_AACAQH auldridge_m_Page_067.tif
011703909cc0130a6a68cda0aa6eabe1
f260416f0a76b3b1d204b4821bf48ee7f082c498
F20110114_AACAPU auldridge_m_Page_053.tif
1fb2ad5d5c99b131b5b7295fb18c0950
3c80c428bd23d8e8fa53e3c9d0e455aaaef7eba1
F20110114_AACAQI auldridge_m_Page_068.tif
f16ebdf7169e28e56bbc4d130fcbdc24
8f8ab6cbfe36827d6c83e37dcfd0c69b32261e2b
F20110114_AACAPV auldridge_m_Page_054.tif
bbcc8f827a2237b1a81c0393b3d3e92f
ddf59cb323b525a884a896a3af36ef8a20871f21
F20110114_AACAQJ auldridge_m_Page_069.tif
2fb12ee0b71198f83aa07a684f7e0552
ef9750bd102241ae01bfd80ebf3148208bb0d49c
F20110114_AACAPW auldridge_m_Page_055.tif
95bdb8c1ac190628f4e07c2464fedc32
093556d369701e33ec14d98f5a34f74aa4473543
F20110114_AACAQK auldridge_m_Page_070.tif
6751e4b41e946ed09c7552b60a90c2b5
15e5ca9cf17f3a1ac291344d38e0606abf4c3b83
F20110114_AACAPX auldridge_m_Page_056.tif
b23bc8c7593fab1c4ee83c739e84d14c
f8cdb1f317fc064adea5b75fc72bdcf741234878
F20110114_AACAQL auldridge_m_Page_071.tif
537a56e149585f0847e04e5ac578ee80
bfb3aeb65354e55736ed08f70cf01ff306734083
F20110114_AACAPY auldridge_m_Page_057.tif
f20cd39eea970a313ffd7f62f37f1e0e
7974c4a47b9ffc6aaa1fb1c7de8c13862d44d6e3
F20110114_AACARA auldridge_m_Page_087.tif
b4bc2d95a1a641ed12c9a5dc64955872
e4a99df549394f9b1bb738c2b2d409f052d0cc3c
F20110114_AACAQM auldridge_m_Page_072.tif
61c157929ecd7452e18e09af6fe411f1
47bd904cf213a48bd01316f2704abd16486b7646
F20110114_AACAPZ auldridge_m_Page_058.tif
21633df2d31794ec6981b05a46431c2d
bea290dab7b3c997c2e700be83652248db9d59fa
F20110114_AACARB auldridge_m_Page_089.tif
855f7a3623c28fca9655f50010c7aee8
6654ab755445697ad07f83d04d3211cd22938959
F20110114_AACAQN auldridge_m_Page_073.tif
4c9c7571b5cc5cf682732d9ded120c5a
359abc4b0278389650c09c476d1f59a17fef8ac3
F20110114_AACARC auldridge_m_Page_090.tif
d8e41319fcaeecda5a4d08c572852738
d77272f07d8f914ada127d22be3b6f03bd6b1f30
F20110114_AACAQO auldridge_m_Page_074.tif
e430c43b0e85dec7bd3d262de7bb2bdf
804f2b1b7e8101758e4c72b6f43271fb7f69c331
F20110114_AACARD auldridge_m_Page_091.tif
a688c37921bb385824521f63f0bf8636
bb68d5316f62ffe199265ff728b1ffcaa750c315
F20110114_AACAQP auldridge_m_Page_075.tif
952deb23726bd984a565d780254ff4ac
dfe938fdc3a81ae554cd4fa369f6b3fc38e95f0b
F20110114_AACARE auldridge_m_Page_092.tif
ccf39e186c07c9f9d872b7d89555de80
d511ae0a2d58ba73faf3dd724a184dd8d39ced28
F20110114_AACAQQ auldridge_m_Page_076.tif
5301ce1c1bb4afdf18a7a36048fd0148
6ffd3ff7d9dfc18290c79b32c060916a9b14222f
F20110114_AACARF auldridge_m_Page_093.tif
1b5ccebddedcf1f5aa250ade6384540c
5b45614670df08f95bb401e49e1e0fb1b22bd57c
F20110114_AACAQR auldridge_m_Page_077.tif
6599aa2bb3f3952554a6f373e56b2c5f
6f644ec165a35f09f8b712034bb5b60483cae3d0
F20110114_AACARG auldridge_m_Page_095.tif
678aa0d2fcda1e7496790ead1d85d8fe
806c2db013cc13b5819536bd9c3f90cf6d1695de
F20110114_AACAQS auldridge_m_Page_078.tif
8f292747acee2a9bab636c971fc2b6ab
499aaf288b30f05d2baa816f14a7a160a6897061
F20110114_AACARH auldridge_m_Page_098.tif
2a314f4b3deadf80781173c0c5068af1
4941a57df14c52de01cff1a9dcdeb096af87e575
F20110114_AACAQT auldridge_m_Page_079.tif
b493c07810f245c886af9c0365bafd1c
59ffc50d281f5c476224c95e3b37800b5bfa9d9a
F20110114_AACARI auldridge_m_Page_100.tif
e0adf10929cd37b83a9f2f6e6f8d489e
574d8df7807bab51d93c6c095b1e9e8ea8ad9890
F20110114_AACAQU auldridge_m_Page_080.tif
5839f8577db7520106f2d0d552d8d505
3cc2c1d64ccfb76f8dd333e5ca16cd40b977effe
F20110114_AACARJ auldridge_m_Page_101.tif
db6663dbd22a2f8e75524585f279a7a3
95dfefff86fd5fb9d88a68937449784e4df62060
F20110114_AACAQV auldridge_m_Page_081.tif
ae2dd3e4bc28190004217d556dbd1514
91d4dc8afddd17d958747a9c7dc0bf13b94aa82a
F20110114_AACARK auldridge_m_Page_103.tif
cdd9ecb3346605b8352b0592968baa20
17e8816a4b9c933ae671d5d13752d2d579eb1364
F20110114_AACAQW auldridge_m_Page_083.tif
ae3d217436a621d0ff7378eac0864021
29d1765b02ffb799435d521908da09bd983f911d
F20110114_AACARL auldridge_m_Page_104.tif
a45fb8730c6f163b5297f6f7c92876f0
6b13e2afe1c6798d01c196a0ae313fa27fba2538
F20110114_AACAQX auldridge_m_Page_084.tif
6796feccbb155f24d3bbc5c696c1bcef
aa9dcf5df8ce221753a8af92df94c49b1e49b603
48658 F20110114_AACASA auldridge_m_Page_018.pro
628cab7ed99e61be350b6d2ab7c102e4
ddc00d492595dc027cf12440bad1df09467538a1
1386 F20110114_AACARM auldridge_m_Page_002.pro
adb754a0ae9aa2620ca07b7a4e8ddb35
80c73fb835cb9a1817c6b0917a612a18e0c02d57
F20110114_AACAQY auldridge_m_Page_085.tif
b2bf3985e658bdef883d0bf4fabc755a
151f81c3d0784b96173fbf80ee5713d89cab9329
50540 F20110114_AACASB auldridge_m_Page_019.pro
f31c2fea8353f519d948c1900ef367b0
9cffb3afbb7b6fe85f0dab0d99f001270b3160f3
2370 F20110114_AACARN auldridge_m_Page_003.pro
1c2346043132827562568129e196d6e0
30bc6267e58385a44968a8e93a6a4e3d94c64800
F20110114_AACAQZ auldridge_m_Page_086.tif
49047e962c65f981b63ebbd2ddc43170
ebf109f80f1ac3cc3b2390b4be2b095c71532ebf
48150 F20110114_AACASC auldridge_m_Page_021.pro
4b93e1c5473cd056f9cabe285edf4be6
32a83a09432e2ae0cadd72ea58d984dfd09c5bc3
15813 F20110114_AACARO auldridge_m_Page_004.pro
cbd9fee0d0ffb5a0ed58009755429812
d9dc1e48614620ef22661b1d44465d8982ad9317
84009 F20110114_AACARP auldridge_m_Page_005.pro
f93c5f469525f6f389353ec38df02688
e894abd1e262cff96844af69a1733f144412f0c0
48794 F20110114_AACASD auldridge_m_Page_022.pro
ca74f5e6527eeb99ee0fa31352783794
dd907fbb0ecf76c88f808b03cb05daad6ed0eea7
111100 F20110114_AACARQ auldridge_m_Page_006.pro
bc2ac1d7a0d772b24e187cd67ad51ab7
9e2f8fd3495c3f2726c63b58f95fc9befc47f2be
39046 F20110114_AACASE auldridge_m_Page_023.pro
a6b34815eddecc9e1d69a6111b829aff
2dda820a0a657d8d5e3ff8c08e5daa15bc2705eb
12429 F20110114_AACARR auldridge_m_Page_007.pro
1d62a9ef0631daaa22f64b7373903a0e
9dac69d44eb357d6eee7e30529c72afb59547e65
47070 F20110114_AACASF auldridge_m_Page_024.pro
ce0e3c665c3bc8ff24fd3ef1af3122b3
1a9727fcab2027c416e4ee4dbde0f56b3424f647
23014 F20110114_AACARS auldridge_m_Page_008.pro
9eb71c34df26266b9508a79d890fa258
79c968905f2cec90d15736b215d908f2009e6e15
8455 F20110114_AACASG auldridge_m_Page_025.pro
525f67d756bc2a9ea0e2a657d88b5a1f
dc9b44eca534ce2de6ce6f3b2d0ae87dba5c2d2b
57212 F20110114_AACART auldridge_m_Page_009.pro
b7ea5dbe9e8b8ee8666b3e1a13c49f72
8be07a7e4f2c2c09cb14f46da945322a3850ae07
33046 F20110114_AACASH auldridge_m_Page_026.pro
182c2c6ee019a54b1b89166c02dccf58
af3c93ea3e2caae2cb8d2955eb9339a627abcc8a
36764 F20110114_AACARU auldridge_m_Page_011.pro
3ebb62066669446a722ab0ff4be85446
9a6e29fbfcaf696ed89177044bbd01a00f549b05
51733 F20110114_AACASI auldridge_m_Page_027.pro
c134adeb6aa9ad675f013368ade7f065
cf43020f8d5b504eb73190630daabd9c9aef359e
42365 F20110114_AACARV auldridge_m_Page_013.pro
0b9d6bb076cd528efc793ded0c4e281e
ef1eaf143bb060a63551bad37157741f08292f9a
32554 F20110114_AACASJ auldridge_m_Page_028.pro
3eabc843a89a264db8fecc8d1a2b417f
f950161dd23859dc9c5e89312e3faafc22028317
22916 F20110114_AACARW auldridge_m_Page_014.pro
dd3ad6e81be9ce2c9eb6c1a9c068b731
ce9332243ae5991782f2cbf3483645c6de457cf7
22500 F20110114_AACASK auldridge_m_Page_029.pro
d5a49f1f8f5bba6622600130bb9a1e58
c1398b98a2d05dd40f44cb94063a591d7db54b5d
49958 F20110114_AACARX auldridge_m_Page_015.pro
e44c9e599740d0026790e8794bf648c2
d355cd1a7fcacb90b78659efaa0f318c54cc34a2
38816 F20110114_AACASL auldridge_m_Page_030.pro
64edea2150f82cc6652f9b51d1bff3af
894a96c6380bb1c79c1046a621378d2dee9b08f8
44269 F20110114_AACARY auldridge_m_Page_016.pro
36ecac18b34afcbc7021de2e27221c9a
84d1c4f173f49aacf234b9ed161eea9307e5afd0
29682 F20110114_AACATA auldridge_m_Page_045.pro
302bae0f6b71b8b600f319672225eddb
18351a1006444262e47747f0bddc7838e86b0df9
45982 F20110114_AACASM auldridge_m_Page_031.pro
ebdd1ab216f0ba06daa427d001959ee8
46b24c98a879b7341eec0bad5bb4367e8594e6dd
33935 F20110114_AACARZ auldridge_m_Page_017.pro
9d5409c512645bf5db47d38ceca6b771
237fe2faee247e66625ec58314b3cc91e190a3fc
49508 F20110114_AACATB auldridge_m_Page_047.pro
7c47a7ee9406f18632f1f9e267db6e45
752d476ce49ff5d1397e27779d863e7d559040d7
44672 F20110114_AACASN auldridge_m_Page_032.pro
d405e47d284db89aad20aa51f7a4eac1
bf0faec7c905bf1a1175c2ea0902edd97138b7fd
47421 F20110114_AACATC auldridge_m_Page_048.pro
f4fc9011132d72d97644a855ebec2a86
5527c63d5192695a272d10f024e0b650e4826518
21309 F20110114_AACASO auldridge_m_Page_033.pro
25f5c605bc3f3fa721ccc0d548b3a4f6
a3377c97a755a9894c0a9cb215a09dd2ebf50951
40848 F20110114_AACATD auldridge_m_Page_049.pro
1b94644b8ce4f8a73579a417a1be82fd
3970a67cc63ee148148b5535611f428eaaeed457
32468 F20110114_AACASP auldridge_m_Page_034.pro
0ee0fefe06b3ae9b87a06ca69cc638fa
639db705e7056821409b04993eb6e995eed1ed3e
28551 F20110114_AACATE auldridge_m_Page_050.pro
cb8936f8ca7c6db219ffe13481c276ae
39cba7b72fd2b07babc39ead148ee9cebf0753aa
26844 F20110114_AACASQ auldridge_m_Page_035.pro
06dd66f37bccab5212cbf71dabb2e21a
a2c0632a1abaf72afc7e8881fc1271b4b61dce8d
25805 F20110114_AACATF auldridge_m_Page_051.pro
2f4908cad3f258dc537073afb6681fa3
0a7dd51ed8cbdce4d68c13cfaf8350f9d993f7d8
48990 F20110114_AACASR auldridge_m_Page_036.pro
79666f58e6e3b0cba349283ef1a0fd14
059f63aaf331e28db0fe6313ec0f83fc99d272d3
57057 F20110114_AACATG auldridge_m_Page_052.pro
3ae9a887f0d51a92fea7870d5913505d
e22e82fcfae743ca85832fcc35806d5e5270c571
37377 F20110114_AACASS auldridge_m_Page_037.pro
60f3c6c7a33adcdeaff85fca1659ea9a
4a6fd064470039d617af8bb313c9b2b271deafa4
47047 F20110114_AACATH auldridge_m_Page_054.pro
9fd81462acf002928b8bddd87254831c
9e0a990908b4fbf4add1bd513a534df18d844b64
36943 F20110114_AACAST auldridge_m_Page_038.pro
c25d02054bf5bc70b146ddd01d0ad23b
2b03f965b50c07f0022360d68262043d63edf114
30247 F20110114_AACATI auldridge_m_Page_055.pro
3d10a778db533acaf9246f7b18e145e5
95bad0dfe6446a3ae2c061b14a59212d23ea5784
4005 F20110114_AACASU auldridge_m_Page_039.pro
bd0339286e93313459618a35b4257c31
fe6c1c2ce9f9e7c0ce6277fc045876fe6f193454
40768 F20110114_AACATJ auldridge_m_Page_057.pro
c3d0c919e505a625aa13160fa37156d3
c97c9e4ced5a344763965296c2ea9814efe04e76
41873 F20110114_AACASV auldridge_m_Page_040.pro
a2658c36a75dcf4fcf8bc9c8d6ccf3a7
3e45a4172c0c803c5af9f6f94b474e565e6dc626
32226 F20110114_AACATK auldridge_m_Page_058.pro
20d817b60c959a9c0e154762201fc2d1
5ec5443418b0180843d396f6b94b184360bc8153
37210 F20110114_AACASW auldridge_m_Page_041.pro
4c9a50d48d16ae29f0fe0283a0990b76
0c522d0d86fa1999a61c2988de81618cd4f67f5c
40388 F20110114_AACATL auldridge_m_Page_059.pro
1b06db270c59a8101d22a924cf8d6a66
2a5a4c39de5568edbe5496b89bb512af1ed1c046
28623 F20110114_AACASX auldridge_m_Page_042.pro
a929b51481147b6a9fd67efea7c7453b
101ddf69fed5922de2ecdae90b0ccc59b65279ef
39766 F20110114_AACAUA auldridge_m_Page_080.pro
5955bc6f34e0f12e23ced11bc70e58b0
eabbdae5be9c9fef0cff90de79ecc72686ac9566
28786 F20110114_AACATM auldridge_m_Page_060.pro
2984e85567f063889e80b273a021b1aa
bcf2d86f5d110ea12415bb273a413841b2221d70
38376 F20110114_AACASY auldridge_m_Page_043.pro
4a126c76a34d09efe645dd67827a8b2d
7e0c4b0dff6e8842df53542e0e10bff4fdb1edce
49962 F20110114_AACAUB auldridge_m_Page_081.pro
2bed9f392b6ad4f51fb4599196a94361
ed35445685148af3c0b1b135d79c0e3ab178bd04
45352 F20110114_AACATN auldridge_m_Page_061.pro
aeea2821787fdc7e983a6bf66650af88
95e2de662e69ede36ddf711e888153b311f3420e
36020 F20110114_AACASZ auldridge_m_Page_044.pro
34529afef341ab83c4cb723d291b9c29
6b7f9b56cee18710de178139f54d12f4edab1264
50370 F20110114_AACAUC auldridge_m_Page_082.pro
385d282a6581e018351b1cd4405cfee7
641ff076dafd7dfcc07fd9e31c5706e50c749b02
30256 F20110114_AACATO auldridge_m_Page_062.pro
acaff1bb4c0436d7a462e20d9d360fa1
4ebf946456db69421a01e80188553309ced1a640
52188 F20110114_AACAUD auldridge_m_Page_083.pro
92456cb0fbfccff9fe69a8c7821e6b21
8d060b56abcbcea2d217e5c3d87dc4d14beccc62
39597 F20110114_AACATP auldridge_m_Page_063.pro
b4c0947ab6b6835aad3f91d632e05c82
cb62bfdf061eb10c7e748121531f036738004cc5
50358 F20110114_AACAUE auldridge_m_Page_085.pro
89b8ecec1c67171d76d996891f102432
1b14348613a42c5648e8c8de3225a394fc24e2c0
45815 F20110114_AACATQ auldridge_m_Page_064.pro
2fd32e64eedd0c8d502ed576536e8117
db9d087f8d6d78fc340dcde1952e6fc120f128aa
10732 F20110114_AACAUF auldridge_m_Page_086.pro
383a19777e1a368c57f135fe883052ae
c08de3348d47de2236d896076f416fe792083226
38546 F20110114_AACATR auldridge_m_Page_065.pro
e4c9e53eacba9043b53abe9dfb64ebbf
26d75ad942c8596ab4a50d26ae6f50faa2ca72f4
37457 F20110114_AACAUG auldridge_m_Page_087.pro
b9138af6c4b17ed21cf3ef20d8d44a02
4cae3d9e7d941882ed44f31d9dc9c2bcd65dc631
50454 F20110114_AACATS auldridge_m_Page_066.pro
81a6a1ead7cd130631d2df6c036ea6da
bacb6c7ffa8ed0922736a4ddbb279cae77f2a2e9
44179 F20110114_AACAUH auldridge_m_Page_088.pro
adf5eb14b4e4c7ed4a4cced3333b121c
f8abf72d5d40a4967f3cad67c2561045b6bddf4d
26048 F20110114_AACATT auldridge_m_Page_067.pro
8c3c4e30eef387be08c0bcb976da11a3
4a3777aff99305c01175afb159eaee8a2403956c
45401 F20110114_AACAUI auldridge_m_Page_090.pro
4dae1418f60078646237b510050b673c
71d25ab9458dc0cc5912a90f7a52587003c8bde0
48289 F20110114_AACATU auldridge_m_Page_068.pro
a1772e4fa510416f918e981b6cf44239
57ac596c29d58f92cb1e92db04f130d68a3306ac
43655 F20110114_AACAUJ auldridge_m_Page_091.pro
84ae1b85a79d054ebc743f514207d3bd
2924887474244469f9aa713a29c759887e68c441
23674 F20110114_AACATV auldridge_m_Page_071.pro
6748517842c6cf3f0fdc9046399681b0
89c0c0b3b86e3cea5f3da0c32f4c567d61aaec1a
F20110114_AACAUK auldridge_m_Page_092.pro
fb8bf5754986df55ba0d552b6d007739
56023575fd14200aa4284d14eccf2162765a59a2
42371 F20110114_AACATW auldridge_m_Page_072.pro
f79a185c1bad2824c1d3f78234ae9b28
299c0fac3075af2e541abbb462954b2dab7e4a01
51418 F20110114_AACAUL auldridge_m_Page_094.pro
b6339c0b3704a0ed41826b1a2ff9e2b0
be72cfc7d44b02fb6f8a2c1b52bfd235d7db7f19
10966 F20110114_AACATX auldridge_m_Page_076.pro
1b4b0359d2309f318f7f91a6a5f5fe3a
2a141f8e8470333d109172e3a10097273bab9e60
44548 F20110114_AACAUM auldridge_m_Page_095.pro
28955e3c5b419c0df195bf40cc1fbcd3
7489a7ad2a354b00227ebe146e58906569b65386
23970 F20110114_AACATY auldridge_m_Page_078.pro
308347befe2399297fbb9136e4a680fc
23f3f14538f7a42bcfa895f3c6851e872d6f0b39
1053 F20110114_AACAVA auldridge_m_Page_014.txt
d5ae0bc32517881fdd0273c62eef53a3
f33ea0d0a18fa909dcf237dc66f5baf3c20e8cd8
14989 F20110114_AACAUN auldridge_m_Page_096.pro
6c83f915de726183d8c2bb9878fccb35
828cd5b7590394dd54be01962880d4ef547041d8
5580 F20110114_AACATZ auldridge_m_Page_079.pro
0e0ba91aa133f44c59de8223b2535465
2c58fb208f603ebbbc362f60c52256f2d7790dc0
2150 F20110114_AACAVB auldridge_m_Page_015.txt
861a14ad4db7812b4b8a85a990bc7ae1
6899a24c327bfceb32315fd8e3af842f27edc710
51847 F20110114_AACAUO auldridge_m_Page_097.pro
5a954c3c828a628477bcf2b3435f21a7
d7c2f2b74ecb89ed87b2361a2681feda4f31a9a5
1982 F20110114_AACAVC auldridge_m_Page_019.txt
c1c3da693bcb346d75c0cce9c7d1c231
ee50a9382a615d25636d73a3dfae2016f9ff1952
58126 F20110114_AACAUP auldridge_m_Page_101.pro
e3e2ca41b1c4b8749435600a0f3142f9
746e3fef2031b3dc83afe69f85254d003e1e6c98
1843 F20110114_AACAVD auldridge_m_Page_020.txt
3012f4f87962da03a10c6f50c7ce8f10
85ba5a1b864e870f65cf634b46b91b1af8d057e5
59017 F20110114_AACAUQ auldridge_m_Page_102.pro
23a7ac001872aa1ceb1f3c2fbc4fa703
dcf0330a4a1c135eeda2729e0be34bec994c9144
1894 F20110114_AACAVE auldridge_m_Page_021.txt
5ea05c6437c489c7346064b638a158cb
da47fd850c8a82093ef928c34fb7104e55dd6ef5
15110 F20110114_AACAUR auldridge_m_Page_104.pro
c55369ee33cc5a21cf3a86d725928816
162952d1d14a1783dfb5de4e3259d314adb050c9
1934 F20110114_AACAVF auldridge_m_Page_022.txt
fa81065606173e212c42613ceadf3c47
fe7093256b1f579dd21603b7b752d953ae2d13f2
417 F20110114_AACAUS auldridge_m_Page_001.txt
074c28604b0e01b3bee410a116a7a07d
885ef98715a6646994ad97e343278f96d031d46b
1832 F20110114_AACAVG auldridge_m_Page_023.txt
b14b558241a42ee7f1299420fee724fb
a9377e39be6c8cd014a93ec306b8fe344c04568b
143 F20110114_AACAUT auldridge_m_Page_003.txt
9f3d5c1bcbe194bfce32b8cf3eae4c5c
5b1a3194ebd92d692528f3824496e9bda6b065a8
1890 F20110114_AACAVH auldridge_m_Page_024.txt
4014c62769610b6559a37deedb119339
89cfeb89a30eba32d853ed72712923666d20d0b5
678 F20110114_AACAUU auldridge_m_Page_004.txt
0895deee04e5305d0b719b0503b1833e
5fdd1f8be3e339597708f64ef2e4f2fa6a78a5d2
1656 F20110114_AACAVI auldridge_m_Page_026.txt
0aa17358e9f7045cec73c2d1f6c9dacf
a20fefa8e626bb22fd47ca7f1b1499a97131f804
4462 F20110114_AACAUV auldridge_m_Page_006.txt
8bf5bb98e96c3ce7bc472c83d3919d64
2a43d755a265f9352e258afda584be6a21e24d6e
1429 F20110114_AACAVJ auldridge_m_Page_028.txt
2a20bf8e27eadf10a45e880bac55eb98
4b340ecdf5c2f3f5ab4757fa7a2095afcc2f369c
956 F20110114_AACAUW auldridge_m_Page_008.txt
22b15b48806a5c17e4e1f8e7204025fe
2dbd758a7a2c90cc8041c8286c17c2441fd97696
1039 F20110114_AACAVK auldridge_m_Page_029.txt
c55c7d82ac7d0aa4574392dc96ae2b78
2e8c34e62925e3592ced22a48d3e186a73bcb43a
2280 F20110114_AACAUX auldridge_m_Page_009.txt
fb880e357d26791a71f8c07d273ebcde
070d6b531c8feb28a9ce864f8ccb7d00926ab3d1
1657 F20110114_AACAWA auldridge_m_Page_046.txt
aa095cd5a22a53cbc5d194655f482564
c3a102d692cbb66ab5b70884058536d76a5d64b8
1814 F20110114_AACAVL auldridge_m_Page_030.txt
8fd51b88805020caa317b8bce4d44135
9abc56329ea0f8b1588be09bd857961eeca23912
1610 F20110114_AACAUY auldridge_m_Page_011.txt
d82fa0b94c2cdcb53f89c673bdb3ac25
488fda96faaca99449651c9602db81d653ff4a36
2011 F20110114_AACAVM auldridge_m_Page_031.txt
32962e50647d8a58d5dbdc3b689a5394
55789a88d9d2e99c7e90ecd16ea927e43a4767c6
942 F20110114_AACAUZ auldridge_m_Page_012.txt
99a8b0c272198d61ea859574fba1f5bc
83c878ded0c5846ae65a48b302c359fa5b8b522b
2128 F20110114_AACAWB auldridge_m_Page_048.txt
227b4ef8dcf56e2f88e6da1dfe2bbc98
faf8700de150531b9fd74c843dcf3e891e70ea1b
1850 F20110114_AACAVN auldridge_m_Page_032.txt
befb9d33af0a3c87e0de28fada434577
142bb3615b88be277072135af5b2a7342d71106b
2058 F20110114_AACAWC auldridge_m_Page_049.txt
2143a7e8fed29e02727e52542a578198
50e896109ab1868add46702b6a53a1371777a41a
1034 F20110114_AACAVO auldridge_m_Page_033.txt
f165b49adc368fca2341c745dc3f66d3
c29e26cf1428fe606b8a9d2db2adb9c3775c062a
F20110114_AACAWD auldridge_m_Page_050.txt
3719bc01dbc66687bb30e211288102b5
04941f22aa52ffe14355c6333a9ee1d4f1637afd
1328 F20110114_AACAVP auldridge_m_Page_034.txt
f448694cd4375770b57b4fe920175b29
65753e9405d6d5ce9051d5532f37f2cf2e2586e8
1186 F20110114_AACAWE auldridge_m_Page_051.txt
feb490fcc13264fd81824caf5e500b48
8d9b731a8128b93f529049dd80d1e3cead849778
1508 F20110114_AACAVQ auldridge_m_Page_035.txt
f3307a7ed36fbe82676d1e3b04364d0f
4a2d98c54b46016fe0ed5cd52ba7f0560aa11ec3
2452 F20110114_AACAWF auldridge_m_Page_052.txt
ead8b6d4c0d83d0efaf622e23f528810
7f34f3a7908d24c21f512ba96f1c4de8c7e7657c
1936 F20110114_AACAVR auldridge_m_Page_036.txt
68c3f95b2ebf3e90eae48af3806efb5d
f477248bd6b6d0d09fca4bc196863b265a04b65f
1777 F20110114_AACAWG auldridge_m_Page_053.txt
af50d3d2cfaa850b1c329b17547e1192
7bce6ab85c20ec4fc0a344468435172c79917177
1638 F20110114_AACAVS auldridge_m_Page_037.txt
f015a43420f1d1e0653861f26fe5f6fe
bdf0393dadb4d19c4dbd3d292d40befc20d74fc4
1489 F20110114_AACAWH auldridge_m_Page_056.txt
e03c94db3990364470e7a3f6f5986d9e
8d55d1fce1ab388e6d21346b4e58fe944db6ab30
1678 F20110114_AACAVT auldridge_m_Page_038.txt
075ab9e9c6c59f7f3f655f5f142764d8
c425fdd5c0162edba260628062f93b52cb64ea7e
1633 F20110114_AACAWI auldridge_m_Page_057.txt
407af529bcc30f1f67aba7c13b2112d8
0555784bf6b11e0403a815327aef97d6de57df62
1746 F20110114_AACAVU auldridge_m_Page_040.txt
3b789ef7db4adea7a1a7a73560af66a3
5798483f447ce3dabef08796306fd71bae40e583
1584 F20110114_AACAWJ auldridge_m_Page_058.txt
c6974ac8325fb5e8b40963b3db50fe9b
2646c947566990ff5e109f2120bfa142944f2abb
1826 F20110114_AACAVV auldridge_m_Page_041.txt
95b1b39f247842e1531adc8769272f2e
5823e90cab33591fcd5d480526d7f6d4a9bf83e5
1718 F20110114_AACAWK auldridge_m_Page_059.txt
3be38d30281f26e78d04516a2b91598f
3640c6a22529b45a5b06fccc91aede6de3ba5e05
1197 F20110114_AACAVW auldridge_m_Page_042.txt
462b57c55726276309b35ee5cfa616c1
d56fb622d624b7a452e87f61ecf4b6034705a89b
264 F20110114_AACAXA auldridge_m_Page_079.txt
65c3c344347f58dfd40bdbade27824b9
0ef14bdda9560302b620535a9d124d4c0499dc61
1285 F20110114_AACAWL auldridge_m_Page_060.txt
07a1528b1f677b187907ba850482f048
b32a44fddc7a7ccb5d7a7bd310ff3ca8dad6e6a8
1684 F20110114_AACAVX auldridge_m_Page_043.txt
00c08006cee00bb9c8b3d0fe379472cc
cfaf019f51057a5aa1d3b734d6244430f61f7b25
1921 F20110114_AACAWM auldridge_m_Page_061.txt
d1a222a3b0973ee065ec962ff642fa5d
6be7fa53e8f55a1860d64372eca4c27106db65d4
1583 F20110114_AACAVY auldridge_m_Page_044.txt
132afd6fc55ccbc1afe62a3b2fb72d53
cddd7701e5fad39e2b6e6caaaefd4e8e28623cd3
1990 F20110114_AACAXB auldridge_m_Page_081.txt
19f8458cb21f240aac1155749b4eb26b
e2b73c8fb858f58679d6fa7b2fb5f02d8df264cf
1374 F20110114_AACAWN auldridge_m_Page_062.txt
eb39376240230d5b9dfb1632879d475f
791c6e4a21ad8f6fb8d180067595287b2320d9c3
1397 F20110114_AACAVZ auldridge_m_Page_045.txt
11f2f2fd70970d5b895c806a713cef17
189070235f2598d28da4642aaddea3a32563ce72
1662 F20110114_AACAWO auldridge_m_Page_063.txt
bbbb4007c857482cc0499a153499ed49
655444387ffb9011f1f0486aea05c89fed80259f
22225 F20110114_AACBAA auldridge_m_Page_081.QC.jpg
4bba97c0a67ec77dd08b78a34b18c015
b15759eb3aa1992f0aa154a46614fc0a5879a6ab
1984 F20110114_AACAXC auldridge_m_Page_082.txt
ad259f7b949784b560877545930ff28a
34348e9c399083b794e31d565125bff52a82fe85
F20110114_AACAWP auldridge_m_Page_064.txt
cedbe9abafc642fe9cb926b1f56f5a40
d7ae2f9693f43a26a5c25d2a0d319019527d606c
6325 F20110114_AACBAB auldridge_m_Page_089thm.jpg
e0035bfcabe4ee35abafcfec7ec25009
52c985ccf255b4cbcc7a70de281d384bf30fbd7a
2045 F20110114_AACAXD auldridge_m_Page_083.txt
f1a8916d093e05af18bfcf935a7f9fb4
8ca379e0fc0994e0a03836630406d9c8b8f02a1b
1649 F20110114_AACAWQ auldridge_m_Page_065.txt
b6368a448e2a600d0a4c4159e21ea9a4
2aa3ec679f9fcafa2b53f3011420e07c59462506
1465 F20110114_AACBAC auldridge_m_Page_003thm.jpg
756762025e5c3248572249df56eb738d
b5b2d70a65a39f701449247085f526371f8cb7cd
1976 F20110114_AACAXE auldridge_m_Page_085.txt
2ed07e9af195eb46573f0ced8e4eb7fe
86a35e465bbb04da2e6b5dccd67ec8556f985a6e
1992 F20110114_AACAWR auldridge_m_Page_066.txt
85385ab46faf79d6af8d3ed12e78adad
a3bab4a4f231de8939a2069087423bf32bb9a529
10194 F20110114_AACBAD auldridge_m_Page_008.QC.jpg
c3be341d9e6c2ddb7129ac35f25620d5
30536103cdb57c6cd5f1440f0bcc3038b2d37c76
1569 F20110114_AACAXF auldridge_m_Page_087.txt
0f5f47c0372041f1f21291bcab763398
72a176e366d8a9841c37c069dadd9e5fc4461848
1907 F20110114_AACAWS auldridge_m_Page_068.txt
132b57137b302b82baa63f1ddba80e1f
fe1bf9e482730858b7dbddf5ffedafbb80371bb2
22103 F20110114_AACBAE auldridge_m_Page_034.QC.jpg
0a5a3833ad037fa05ef21af0594b2c1c
308e90a07eaec7a74fb92bbe22ab3c9a268f9c72
1765 F20110114_AACAXG auldridge_m_Page_088.txt
cfa5085b1b1157b9cc9cfde49fcb4963
4c534bca4adb1ea3d623662ae2c71cac9b8f66aa
1536 F20110114_AACAWT auldridge_m_Page_069.txt
f56b75e3049af19ccf02b39c6c0b8456
7a9d915d7ae5ce747344117b97d27beba2a183cd
12049 F20110114_AACBAF auldridge_m_Page_071.QC.jpg
a8878069495e871dc0704d03df2bec73
726d62bc27ef38cf53647c176c9561b27556f0b4
1972 F20110114_AACAXH auldridge_m_Page_089.txt
6c77ffd32d9d69e6019b25860c324128
b1841f30293a7450242e12e5db7d35146aeae7cc
984 F20110114_AACAWU auldridge_m_Page_071.txt
fec19acdba233268ba4d30847ca3d9c5
d93a6560f1c407e3e26448a41f20c19edcf0166f
19733 F20110114_AACBAG auldridge_m_Page_040.QC.jpg
850dfa2358a982ad5b758f65d17950d0
b556c77ca139863c70205b526aaa179898e1f687
1820 F20110114_AACAXI auldridge_m_Page_090.txt
037d3d489d7a6a9ffc8431d95cbbf98a
99e959c820c5ee031a7bf3967ecff335502bbafc
1776 F20110114_AACAWV auldridge_m_Page_072.txt
9028477e59b62fab0e19cace6ebfeb03
c38416d0020d3267fb7afbc85fba3f7f817efd52
19864 F20110114_AACBAH auldridge_m_Page_069.QC.jpg
8c81f993bbc2795b10f58d31a1047d1c
c1712a6f4ad9c5537c9c554dea340d1013e400ff
1732 F20110114_AACAXJ auldridge_m_Page_091.txt
190aa4bfc88f6c66ea6b712f2bce639f
fa464e04e798c08d6b248789b2851142f9a3017f
645 F20110114_AACAWW auldridge_m_Page_074.txt
d5497bef0f94f314218374a77da705b0
fbc636748da4587ea3911e28b0304d47381bd89a
19624 F20110114_AACBAI auldridge_m_Page_035.QC.jpg
e44e53f3dbb6fc2be78858d4e0c2c78c
3a3d32fa67ceea350e2e2e95bbd87a4b1bf8538e
1911 F20110114_AACAXK auldridge_m_Page_092.txt
c880cca22acb6d94c69592989ff66660
5e708b5199bc4c3ab66852c79080f71f5407da3c
1901 F20110114_AACAWX auldridge_m_Page_075.txt
db3d2d9f7c31f3cc69d336daf50eb072
39de37486ec72a6ab83f78460667e789b43123b7
22553 F20110114_AACBAJ auldridge_m_Page_019.QC.jpg
d11a87a93a96c46b3bc305b80cff9457
c99e9d99ac538994fec4be12e7ecfc0768f2268a
23039 F20110114_AACAYA auldridge_m_Page_047.QC.jpg
6b164aa17b623d4b00546343a929851e
32c69bd5063374a1e14371896b347eb514ba61cd
F20110114_AACAXL auldridge_m_Page_093.txt
5257d69d7393c13f5559fd9708e4f2c7
ebe91df79bdaa03c1f24db9322cce649a489e9f3
841 F20110114_AACAWY auldridge_m_Page_076.txt
f74d79c2f2b24ffa0530f263d9d932cf
398cb7bbe5361497ed37e0fa2acae87837fa77b5
5220 F20110114_AACAYB auldridge_m_Page_080thm.jpg
06bfcb3c77766aa86d35a1a1be70fa64
9f5ad6e413435fc4c2b93f36a3ef75f871c5d3c2
664 F20110114_AACAXM auldridge_m_Page_096.txt
d5fa597f2b52b2ee5ca7486fb064a6a3
32a4debd6c59e24b6a0c61d236d9732907ff88c6
1859 F20110114_AACAWZ auldridge_m_Page_077.txt
38116d997baa4ef92cfe54eb8789bdf6
80822410cef52a21ecd698cff6f38e159f3177d5
5023 F20110114_AACBAK auldridge_m_Page_014thm.jpg
d2c4dc70cc15ff8d6a614a68151c760b
2bd6309a679d19fc0544a17d2e5de6a8d1b67385
6148 F20110114_AACAYC auldridge_m_Page_084thm.jpg
b6912d2b9d47d86f2440de0e54207c01
6d695cf0307392b06107f4cfa9a080fec611ab58
2141 F20110114_AACAXN auldridge_m_Page_097.txt
4415030672272dbb8d57528b2fc4e7f9
511f6136982080b9f0edfb69f8b8e18a84254bf0
1711 F20110114_AACBBA auldridge_m_Page_007thm.jpg
793dd6dfdaa3065e1a216cd318aca8ea
dbf64b93d223d5bb39c4803e9b94f8bdaddc7b1a
6079 F20110114_AACBAL auldridge_m_Page_021thm.jpg
3cf3502d3901a0016cea1dfdb2f3105a
8b7dd609da1d644f2bf6bbc47a7297b8d057b294
2307 F20110114_AACAXO auldridge_m_Page_098.txt
98b7cb3b05566da9739b73e2969ded78
c5e31553f061e9a67df1e02abfb9ca27c6283b73
5404 F20110114_AACBBB auldridge_m_Page_009thm.jpg
39a8ad8cd924f3c42c407d0ce1da47b9
286a37e671256c5312a134ef86647a1a329a7a96
6778 F20110114_AACBAM auldridge_m_Page_052thm.jpg
9d1c057803d1ec68283a710ff0ab15fb
8c5e6f347dcb447299f9d383733f3294146f5482
23692 F20110114_AACAYD auldridge_m_Page_075.QC.jpg
42b5f2d524bf0301070a0740623b7e1f
b83307ee79ece282efe858aafd94f65050b87aaf
2323 F20110114_AACAXP auldridge_m_Page_099.txt
67e965a6571d712153faaf32d6ac9d24
a1e5d1a3528b71e4975fb5d04cf5fb3f427d8f11
23259 F20110114_AACBBC auldridge_m_Page_010.QC.jpg
05d1d336b9786275e8584579c77d651c
4ffbe0cc94113565ad0b9b8f8ed07dd0ea137c3c
21968 F20110114_AACBAN auldridge_m_Page_036.QC.jpg
22343b6d05115988c039a8602682afdc
8cf12f7a6e0a8face12b89d847cc96b488db6700
22742 F20110114_AACAYE auldridge_m_Page_027.QC.jpg
b5c13f7c7ab5cf6f39efe6369b3c18f8
3d97fd8c0df471e4967fc87343fb8dd2d361fd7b
2247 F20110114_AACAXQ auldridge_m_Page_100.txt
dda6f4f11282e83e08d969e91f4ca0c6
361511e734afe48e0c843b23bdc1ed5c4774b019
5030 F20110114_AACBBD auldridge_m_Page_011thm.jpg
90c0ba9c54f7fd01d74ab40216b5dd74
3be05d29a175a9654a93577b64b5c743d4098ba9
7120 F20110114_AACBAO auldridge_m_Page_086.QC.jpg
11dce8d9858001ebe1948a3615acb408
b20e856fd1f724bbb0d1593c7bd33b2356f8fe1e
21487 F20110114_AACAYF auldridge_m_Page_090.QC.jpg
96caabadec1a6b0ebfdb00556c26a3c7
51a27c86d5803f9faf6fa74e07bb79960c9d74d5
2386 F20110114_AACAXR auldridge_m_Page_101.txt
0e44b0097d458827d70815533d44d29d
7eafa0a14f14f4d4d8d084f0e135b576a91254bf
12732 F20110114_AACBBE auldridge_m_Page_012.QC.jpg
b8f7c601ad418e68e0ef89ccd2121938
15eb87c01335aaa1fa3704f34f6444f306ccb2fa
17399 F20110114_AACBAP auldridge_m_Page_011.QC.jpg
9133e14cec68304ebd59843c56dab6d6
0cc452cd6fee3ed56d5cac6ea5b423b265a76b81
5170 F20110114_AACAYG auldridge_m_Page_058thm.jpg
38a9ec2cc0668957df650420a04e6525
db8cbf65c10e0b39408f77f1667c9dad2a9d8feb
16000953 F20110114_AACAXS auldridge_m.pdf
8c50cb3db9b9ae0132d127b7c6f0b8f3
5ffc5654ced7df14769226ae5ce3f6bde397f553
3728 F20110114_AACBBF auldridge_m_Page_012thm.jpg
ab0f8ad27eb0c8a30b89c825582962f9
baddc3bcf8a7c46bea3b3e29cf76104d0a98bf00
5618 F20110114_AACBAQ auldridge_m_Page_063thm.jpg
faff1cc1956aecdd78136f4a1c5a21b2
67e512d0baf824276b77d29ee113195850d352c6
22860 F20110114_AACAYH auldridge_m_Page_093.QC.jpg
2d965e7687180eea0234191bc07f4d83
8448f02c85bdaa59e75b8b69062d874e399d9bbe
8865 F20110114_AACAXT auldridge_m_Page_096.QC.jpg
d787ccecdd8d3d786b2eb605be3c1889
b0573f00b95dbeb68596261c1bb687d907ac8ee8
21762 F20110114_AACBBG auldridge_m_Page_015.QC.jpg
7516b740cb51f8ed67c20754fb1f81ac
b898cd1cffb07c298f41e8fe93d3a624a114164d
21375 F20110114_AACBAR auldridge_m_Page_064.QC.jpg
bd1c997440027c98014561fbe17a7e63
3711f04493779a39bf177098737513df839cdb51
5416 F20110114_AACAYI auldridge_m_Page_059thm.jpg
bc2b8b7e0b043e096a5a654341dc2809
52a931246ca1bb41c671bbb63539a0194dde8c87
16036 F20110114_AACAXU auldridge_m_Page_062.QC.jpg
b1f53cce19ec26081ef4dc51211252e0
12983402ed70237565855a845a000eb931380004
19500 F20110114_AACBBH auldridge_m_Page_016.QC.jpg
6b5e307b93772efc7471647488a073bf
982c8c412b8a7bf1273b13f6bd8afb1ad71cf40f
12830 F20110114_AACBAS auldridge_m_Page_033.QC.jpg
66e84a0f381e3293b17642af285d650d
64f5cfb672d7c49feb8845cf4bdd177790098916
6385 F20110114_AACAYJ auldridge_m_Page_047thm.jpg
76ec761e7b1bed78ddd673a2c213e26e
4c2d97f3dc349c95cc1144df16ed0cb9d896ac3a
5720 F20110114_AACAXV auldridge_m_Page_023thm.jpg
225f71ba773f741e67db5135de81b888
7a67aad9718e1bc11496194a93d628e4fa1aee33
5534 F20110114_AACBBI auldridge_m_Page_016thm.jpg
23fa4bef7f17ad9421f3264426c4b154
87248ff089048796e9708a8c08e497358230eea6
19506 F20110114_AACBAT auldridge_m_Page_042.QC.jpg
336612f408e6ca590fa0190d808c1c40
95da6e4266db08f0559a78cbaa4356bb8d12a967
5594 F20110114_AACAYK auldridge_m_Page_073thm.jpg
3d356bdc9d885742f94cb95d5351d404
260813b58d068a1759fd5562a01b7e6d14224dc1
21452 F20110114_AACAXW auldridge_m_Page_088.QC.jpg
5b07a31870e7325b73c95be7196de5e5
1eba998f57ba99d12db43fe5f66fa9ecb2a8dd4e
21442 F20110114_AACBBJ auldridge_m_Page_017.QC.jpg
f64e1d5df4a3564e05dfc9964e0092c0
65ebd1f78b31692673c437cdaa87be1f0c664934
6639 F20110114_AACAZA auldridge_m_Page_048thm.jpg
17f76354f74eac6cbe57581d85be3344
58742aa4dc26ae21c0894f250a87ea1c3e260ea5
20038 F20110114_AACBAU auldridge_m_Page_037.QC.jpg
ecbec7456ea6f6dbf082a4b64d682844
cacb199a93bfbddb52763f8ecf43c1d7bbda44c9
3974 F20110114_AACAYL auldridge_m_Page_033thm.jpg
544108d13c6ac97a5f121d76f9636a44
a368ee117d8044f1ff1dd3e5f87b9c838e83b143
6155 F20110114_AACAXX auldridge_m_Page_077thm.jpg
d2cf6b0b3bf2077ffca5ec53689cf805
641d148bcb919cddf6b3adf6dc91670c7199e824
6066 F20110114_AACBBK auldridge_m_Page_017thm.jpg
88d62738d9f6bb0743f30d3545515022
94d209906cdd5f18c9ecdd033f980fda6c507708
19928 F20110114_AACAZB auldridge_m_Page_013.QC.jpg
47029185993a280647b1ae50911ba48e
a41cd6dfdf981cbfe23b9c086c7a2b6a1238cb57
158712 F20110114_AACBAV UFE0008160_00001.xml FULL
797f7e7b3e87381e681301b5d2a8588d
cd79dd3fca2f508abfa4fd3a496fe4e9999ba4ce
5607 F20110114_AACAYM auldridge_m_Page_056thm.jpg
53cb2a3b1aeab1909690265f6c70d6b2
39dc1cc5cb2072fdad3b522ae3b9982219c79862
5322 F20110114_AACAXY auldridge_m_Page_026thm.jpg
5dae188de3792d135b1ecc49b4e5fbdc
f44b3cc005f4b4cab69d11f39129aa03048f8dfe
6169 F20110114_AACAZC auldridge_m_Page_025.QC.jpg
ee69f4a10e6518ea63f586083f3c6a05
513fd2e63b1b3cb86a3478fe8254b105a122e4a5
2928 F20110114_AACBAW auldridge_m_Page_004thm.jpg
5f3e7f73d9be167f6ab5433ba374a89e
c1cbd5a2412cb18b5c7d3587960af8b1dc2f0178
18222 F20110114_AACAYN auldridge_m_Page_014.QC.jpg
f94660b190c9e73062449115e3f439c9
91decbeda2122cb87132e1d8728f8ef92994c69f
1401 F20110114_AACAXZ auldridge_m_Page_002thm.jpg
fa46cd12f3ad8d5b482af790e7a8491a
0bf81e6d8f7149e90dcc5c08330fad927055f179
6285 F20110114_AACAZD auldridge_m_Page_022thm.jpg
9af1c18c14362136644239e2a208c5d8
82c158dd102e924bf43244baa9dfcc3132b438f0
16406 F20110114_AACBAX auldridge_m_Page_005.QC.jpg
d0d9642f72d3d8a50b06a8ea9d107074
5cb385911d8bad1cca975cee446627c8e87c5dc8
6448 F20110114_AACAYO auldridge_m_Page_068thm.jpg
2b3041956b94ca52123ff994bc87ca46
8878c19943b6c21b3fe548209d6b12de4f4b96de
20178 F20110114_AACBCA auldridge_m_Page_043.QC.jpg
c1687d948d82f0424bc5fef815cc2113
ba24a055624a37973c4c5d095557744aa68022f3
6364 F20110114_AACBBL auldridge_m_Page_018thm.jpg
b4d85cc17eae818c02bee2240b0b9c4e
24703d0ff984bb10f35fbdcf9b271c137c44f885
4243 F20110114_AACBAY auldridge_m_Page_005thm.jpg
f9b7aa2a8b68f0ef871c8c4cb7555f73
5a1944852fb11f1ffa44bd2561553840bd2bb6bf
23385 F20110114_AACAYP auldridge_m_Page_083.QC.jpg
87bd2efa86d79d2474f8d24e7abb496e
2be7a9961ab206a16d978706dd23aa12d90fc4ce
19028 F20110114_AACBCB auldridge_m_Page_044.QC.jpg
fced72e73a66371ddb61e86e46499bea
28b67f453ce0227eb4e4fc6000c055747610b649
F20110114_AACBBM auldridge_m_Page_019thm.jpg
62dedfd0a56a123a4b925917aa612e87
7df55cf57e334072dd43f33348dd60bc9bb9b4ef
11319 F20110114_AACAZE auldridge_m_Page_078.QC.jpg
0578f1d870d825f606476b27b40161b6
c2dfd784358e349bbbbec292b3a0fd8dce8f87c9
5424 F20110114_AACBAZ auldridge_m_Page_006thm.jpg
c2c998eda91727774e6318dc8f259e77
fccccd9f3a2e34d406b61d729f9aa4c55ab9ad96
18455 F20110114_AACAYQ auldridge_m_Page_063.QC.jpg
22eaef247379caff93abe58b0c48e949
e938aee9694c583fbfe54890a6c191df7d5aeca9
17386 F20110114_AACBCC auldridge_m_Page_045.QC.jpg
5d4986188861bb895cecc9d54b8affd9
42ee3151116014436754261efe6d651ac5c5b315
22399 F20110114_AACBBN auldridge_m_Page_022.QC.jpg
b5820ec08132dfa057bd93485c02ed62
e4175c24048be8b5669094ea713e4256c04458e4
3536 F20110114_AACAZF auldridge_m_Page_003.QC.jpg
076e6c8ccf2b6a1f88c8c8a7b872fb2a
3063cd8268e50c344b9791b7d133975b897d4951
22314 F20110114_AACAYR auldridge_m_Page_103.QC.jpg
2c5223adfaeb0542a3dd9e99d7fc0f14
e15b4dfa70563c402c4c8025e2fa2093e649ca66
23467 F20110114_AACBCD auldridge_m_Page_048.QC.jpg
825217d63811b49a1f20ca7e72a71ed7
50208249460cd829b4e0379cba7021bebb7ad2d0
18264 F20110114_AACBBO auldridge_m_Page_026.QC.jpg
6a63a35ed6d612669f204499d736dd81
171d42f75c4b8db5602bddeece967e310e9d156a
16611 F20110114_AACAZG auldridge_m_Page_055.QC.jpg
caeaf85249e60bd77c95abf28f23717e
fefbe8d65b63b11edc15795119465ad4d0d245c3
20740 F20110114_AACAYS auldridge_m_Page_049.QC.jpg
9551ab7fa8921c2a213659aa958706c8
3ea87a3a5a1823f79f03df3f691f5bbfdafadb73
4538 F20110114_AACBCE auldridge_m_Page_050thm.jpg
bcaccd2b1d189a9b1f12bdef5341eeb1
aa7b08f10bc2ee92984b2c8537f4583c42c0f298
6242 F20110114_AACBBP auldridge_m_Page_027thm.jpg
12b5c1dfe72165122bb3401041cefa2e
b013743e69b0957a62e30aacd0eee05a29c89b6e
5131 F20110114_AACAZH auldridge_m_Page_045thm.jpg
094a16b54022f9521fc890e394b07aae
a2f8a2d6a5056346b17ce304fa9e0a59ed68f3a2
9310 F20110114_AACAYT auldridge_m_Page_004.QC.jpg
223c0cf5ea1cfbd99ec952e800806596
0a504cabf428f2159ef409dfa3548386fa8f2ff5
18075 F20110114_AACBCF auldridge_m_Page_051.QC.jpg
cd68d749f3f743896f1218bed94318c9
0b534f701c937090f2eb542702de17197a9f3b04
5197 F20110114_AACBBQ auldridge_m_Page_029thm.jpg
e22904a9855142b46a7c148aafa401c6
a9197354a22935a126f57c8caff018b61533b85e
11680 F20110114_AACAZI auldridge_m_Page_074.QC.jpg
19c1cae1e511540c41f59a058b157664
55e99e4c1fa8d6bdd1616e266662ec5b30bde163
22021 F20110114_AACAYU auldridge_m_Page_021.QC.jpg
195838937e8e965abaa611f471ec805a
a86a5c3b57532b03a53b08ea748cb8f9b3c457e1
5501 F20110114_AACBCG auldridge_m_Page_051thm.jpg
1668286239b132e9d8f2cf752352308a
cd3b110c1b945005e86a7e019ada8d2175c87f11
20637 F20110114_AACBBR auldridge_m_Page_030.QC.jpg
a4b558f0e230a96d5108cd26146349bf
c09d976b8bdf1f367c0b6a041a07bf3f137e79a3
24161 F20110114_AACAZJ auldridge_m_Page_100.QC.jpg
3ed1797ffd653959775f1f19add35fa3
14d6b2d80acdc16a7fd72cb083f0e4060488c20a
6238 F20110114_AACAYV auldridge_m_Page_020thm.jpg
323a91ea6a266f4c195a49f0e387a7ea
0b293faecb61ce7fa7ab5c77e736d300d9720c13
47275 F20110114_AACACC auldridge_m_Page_084.pro
7066d96c1883d6c84eeeecd5e5e37626
c1322718dea4fa0ce940824e3abbf29952d8ebb5
25438 F20110114_AACBCH auldridge_m_Page_052.QC.jpg
652e9c55ac860591e2763221acf03429
2c65648d19e2cc19d5e751383935568827fd26a7
22558 F20110114_AACBBS auldridge_m_Page_031.QC.jpg
c2cb208a2954e75ebf090c143733f1eb
06ac0ebec7c1e6dac3132d417adeed4d9d425e0e
5544 F20110114_AACAZK auldridge_m_Page_013thm.jpg
9f917936cf2061cd4d47c37e6cb61cef
14c1c0c0375589a4152d6c7178448675faa7233c
2913 F20110114_AACAYW auldridge_m_Page_096thm.jpg
a42eccc0f868efd67b9b744081ec6a95
1d44379dc3f5d651eb6611ab6947015cdf887f2a
23711 F20110114_AACACD auldridge_m_Page_012.pro
2589e43f2563e65be049dc9734a80d60
9c6dcf0234ff45deee62d63978c5203990c253f5
21718 F20110114_AACBCI auldridge_m_Page_053.QC.jpg
aa9e12e5eb2f37e6c4d02efd30f61cf0
c33ec311ed845c6a01053ecb9c86472811cc325d
22599 F20110114_AACBBT auldridge_m_Page_032.QC.jpg
966ac220a843a8d6cb49f303a2f5bb37
b4f71e3cffa9b12717651416aee3b228d0edd30c
6312 F20110114_AACAZL auldridge_m_Page_103thm.jpg
86e1c89da632bf7649bb51a4ce982572
21f7e2333e409ae8391943432f60068da67d612c
7124 F20110114_AACAYX auldridge_m_Page_102thm.jpg
e7fcd57d2002455423b9a80f3a86a92c
64cb8bfade7923a0715103637c369283fb369950
8142 F20110114_AACACE auldridge_m_Page_003.jp2
52731c4f2710c3b68cf9e98ae4ac7a5e
dd5a0b39b788ec291f6c5318cfd4b251cfac0df5
4971 F20110114_AACBCJ auldridge_m_Page_055thm.jpg
cc8120da2ee242718fc4b065252ebe5a
07e641128622716176fdb8f57fab71730c0c33ba
5578 F20110114_AACBBU auldridge_m_Page_035thm.jpg
1dca64caa3fafb19b90e27fa5133ca5c
e5911a397992d07cd6877e1fc11112599741d257
6508 F20110114_AACAZM auldridge_m_Page_032thm.jpg
864cd1d74bae8b45637e8124e3a1c5fa
7b0515a14edbb487ae4187c8c082d7a1d7865375
21567 F20110114_AACAYY auldridge_m_Page_084.QC.jpg
7158f08a9edebda64d09a94269aa8298
1324a6a4692ce561def2875a8205ac085e654d37
5503 F20110114_AACACF auldridge_m_Page_044thm.jpg
4c3595cd3c28bf52cb304965f4ba5c9a
e2f9f68f3a982a48b08cae2a079e2d64662a12e8
19456 F20110114_AACBCK auldridge_m_Page_057.QC.jpg
d0fb76ea6623799cfdc8e36a605a7e87
61ab362bc92f679522869de092a4b73522adca1e
5779 F20110114_AACBBV auldridge_m_Page_037thm.jpg
f3d3c1196cb83e9ed1c5c252bbf10d38
c1b3489ebf7202ac51a0300e92de4c0f821f8ecf
18962 F20110114_AACAZN auldridge_m_Page_046.QC.jpg
bdd8ab5ff9a37e09fb946bbfca671f63
0a4f93721b78cef8fe19184dee9eb109cc5ee57f
6121 F20110114_AACAYZ auldridge_m_Page_010thm.jpg
ccb566246f6ece187785262a87a997b5
341ff5c37954d515f71be057f6b1b019137d59d1
43588 F20110114_AACACG auldridge_m_Page_020.pro
d90283f20bb5c098292d9bcb9872fecb
62907aed2c70b5638c9f4c108cd87e573816ac9e
16992 F20110114_AACBCL auldridge_m_Page_058.QC.jpg
3f49b8da66863109c5821d1a8730dc6b
5b659b672e7d56b51e11ae584ba4e82f025241b5
5800 F20110114_AACBBW auldridge_m_Page_038thm.jpg
cd7cfba558f983037aeacd25fa4a631b
fe4f42966b3f9c5737b7c0647acb5c8c489fc627
21526 F20110114_AACAZO auldridge_m_Page_092.QC.jpg
484243d712da1e1804a7e6787b1e9cfa
27831254655f2bd09c9bdd4e8089ccbefca83067
3590 F20110114_AACBDA auldridge_m_Page_071thm.jpg
74984b459f857b718f430db649e5af0f
317e91aaaf85fdd14efe2b97a1ab7dffead3a89a
F20110114_AACACH auldridge_m_Page_096.tif
b51b64c6aa2e77d4cb69e8d42845d68b
b3f4bb27a65284d5cd73eb670cd1ac3dbc062229
4622 F20110114_AACBBX auldridge_m_Page_039.QC.jpg
83a43b0fcb03c4020a8918323cf73a2a
f1573c893b7c0e10f22814390ea8c2d55a8cd5f9
5519 F20110114_AACAZP auldridge_m_Page_087thm.jpg
c8b7cab61938d99a25a450b499c2223c
68a1fd86c4d5fdfad5922f5d1b7595328c16e68f
5738 F20110114_AACBDB auldridge_m_Page_072thm.jpg
8dce5a40fe1677eca4e90e61f1aebebd
f9ea66a66bdb6cf46cb488143b65d2a75acec6c1
2361 F20110114_AACACI auldridge_m_Page_001thm.jpg
7e1da80ecc8feea72b5f52e192b5a4d4
246aaf9e2b59278002b3b3d046b0abc1e011e037
19481 F20110114_AACBCM auldridge_m_Page_059.QC.jpg
69745c566b2b4769c9dda07c10857a5d
e345c44ac9fe685152ae690c415a0c8ca26ee848
F20110114_AACBBY auldridge_m_Page_039thm.jpg
55f97e0f7b28282f0d0e0106452aee2f
c23fb356b1e6fdc894ed0b3bbc571dd80b684986
22675 F20110114_AACAZQ auldridge_m_Page_068.QC.jpg
eca40885cdd028d849dbb52f20ea8a63
649000e3b4be52232868da06fd565cbba0340e1e
20041 F20110114_AACBDC auldridge_m_Page_073.QC.jpg
2083038c52a65eb50389c28e1c06b508
9bbb4984dff65d9df87dd46d66a2b168c4073d34
1315 F20110114_AACACJ auldridge_m_Page_055.txt
f8931d5910a9fb1b9afe16a41b9f8f9e
09c882ae9e3ea27a92013acb93e77f73146e350d
17338 F20110114_AACBCN auldridge_m_Page_060.QC.jpg
f8f51a7f2dc9b4632da2a346f0280b4d
7c8e04d98dac2e82b5dc349fde3a582ae17535e2
6177 F20110114_AACBBZ auldridge_m_Page_041thm.jpg
5d3ee15233281c69ef796f6d4d8fb065
c7d58e9f94c2bf6da976a0f451fec50a7173daf7
18084 F20110114_AACAZR auldridge_m_Page_029.QC.jpg
c4cb9290a99b8bb5eda0d12e71b7b1c1
2704588c85c7fce9c58d6a47f253be50880e353f
6766 F20110114_AACBDD auldridge_m_Page_075thm.jpg
b1ab4816a1bb8e3f0bffffadac5b006d
edfc744f8cecb51783af90c06bf0bae22be2bd36
107439 F20110114_AACACK auldridge_m_Page_103.jp2
bdcb9b80767e166f3f1f0f15cd6cdd20
5618413628dff88a2630cc462a4d7e96920cc6fb
5381 F20110114_AACBCO auldridge_m_Page_060thm.jpg
aa8977c6c981b3481c35a19eb0b0e769
b14588b9c1a17af31a7c7eb6cc686515c303ecd2
6043 F20110114_AACAZS auldridge_m_Page_015thm.jpg
233543381ef5d340ede557c066110df3
93f100035753307f30d3eea1afbc7546d2bdf0ca
11583 F20110114_AACBDE auldridge_m_Page_076.QC.jpg
e78a553de3058dc4928fee4292cc61d8
77860f99c4a3d4762669c88f8c41e12d8b3332fd
126 F20110114_AACACL auldridge_m_Page_002.txt
4d3791fa21f713f1f0d9e33e707c9a07
41e346ba8fcab487d5a098c4f206f73c0583dc63
22884 F20110114_AACBCP auldridge_m_Page_061.QC.jpg
620e8d9dd1d89bb4916a2c49c1c337a8
1317c9288cf33df275d8d93f06c353efcd2f47b5
6019 F20110114_AACAZT auldridge_m_Page_024thm.jpg
b942861e258b386286301efbe2b969b0
6a23450001ef88d99000ee5921fa64553df81b50
30842 F20110114_AACADA auldridge_m_Page_069.pro
539b5826d9340fdd4a6256bcd4f26ece
3175a7aad77ea76db129880783961223056a8c4e
4092 F20110114_AACBDF auldridge_m_Page_076thm.jpg
c1fcb88f6ae27a74769bbffe2b0cb8b2
9785eb24a87f177443ec57a5721b2533742bca22
F20110114_AACACM auldridge_m_Page_097.tif
d9832216d3e029ae0be1f13d3697eb01
785a061d72821d3444eb8c3941512401de187f11
6338 F20110114_AACBCQ auldridge_m_Page_061thm.jpg
7587a7a793ba54b681ea63cab2b883c9
417273ba54296c89fd6f68ac23e4aa8a89d06265
6145 F20110114_AACAZU auldridge_m_Page_049thm.jpg
2bd4d49948ae3634dc8fed03762436ec
253e171b09a359c6557f2db038a9142a5ce125e4
F20110114_AACADB auldridge_m_Page_102.tif
a1e23dc1682a26ff497be35610843080
03200914adc5bd8ffe05a250f4debdecc5de5571
21704 F20110114_AACBDG auldridge_m_Page_077.QC.jpg
6da2da6d2d5422df80d05a29855ecb9b
6ad0d186af268a7e4829ed78e20446d844a04c7c
6057 F20110114_AACBCR auldridge_m_Page_064thm.jpg
7bab8dc2959bc5801de2e5302d177aba
0aef7a45db04c17ca85bedda931177b0acfafeba
6255 F20110114_AACAZV auldridge_m_Page_053thm.jpg
92b1dd1142ad8136877570c415e4b78c
4151d6042d3d8a00eb608b816d81f710a03abfa4
54671 F20110114_AACADC auldridge_m_Page_100.pro
5ada5bce193aa25c0b56fbb02dce0f2a
8e7976eaac3c059dcfd4626b2d21b06eb3d4454c
4032 F20110114_AACBDH auldridge_m_Page_078thm.jpg
0d706d70cafc667e28a7d96688e78f4b
dd184fa5beec774862c1bc783bb2daca9241f052
21896 F20110114_AACACN auldridge_m_Page_020.QC.jpg
8ec5d7ac21657f153f20cf2e0bfa177b
3459af39f48e8dc6618d75abbd6bbf4dec0bfbcd
19314 F20110114_AACBCS auldridge_m_Page_065.QC.jpg
1bc2dba6f4c29ac9653675d2e41e0b51
d1cf5528a1917fd7550e92a95b9b8756ff95325f
20510 F20110114_AACAZW auldridge_m_Page_023.QC.jpg
4b4a9b7c70bd9c15f43fe958abed7820
82f8ba9786a5c998f217512dc95b4dd188c6b85b
6270 F20110114_AACADD auldridge_m_Page_036thm.jpg
75e09623987d20b7836e0ee5cb387b56
580b4cb3bcc2c61f882b489ce5b10cc8d85b6917
5327 F20110114_AACBDI auldridge_m_Page_079.QC.jpg
7704b947e48358f585c2105706198926
55b870b9aa938fae5c6e70c1ac001c8f4e6ea74d
22912 F20110114_AACACO auldridge_m_Page_089.QC.jpg
57491bd2c7633c8b9404ae748bf7d5b8
29e22d3387f39792f970027c275a1c32e312f2cd
5917 F20110114_AACBCT auldridge_m_Page_065thm.jpg
d2b7bc84c722518d3fc3cd3fdfddda79
b2c08a6429bf118d8598e33d6da2db17d329e6a3
6256 F20110114_AACAZX auldridge_m_Page_034thm.jpg
1fc0f6922af04dc2b6a6abc3f3854ba4
7b0578a90270647477748b20fc451b19e72ba6d1
21196 F20110114_AACADE auldridge_m_Page_041.QC.jpg
4a4630c7c15dd58e3fbde3d6fc97b644
ddf77837b59e4fa2ccd31f9b2aa698fb008b8d07
1899 F20110114_AACBDJ auldridge_m_Page_079thm.jpg
29eb1cb3e78928e90d7a1441b177e487
215c711228819613777504ec3735c690ecc9a204
63952 F20110114_AACACP auldridge_m_Page_010.pro
b78259decc4c24c30ecfb45803698516
4da5af8c219bcfa0f7ff19c6a5f82d51a53dc058
22490 F20110114_AACBCU auldridge_m_Page_066.QC.jpg
6ca2c22579c6b1faea709c4f92e9f7f7
37587fdd1b03d944e5b7042f59ec35d1501c30d8
18889 F20110114_AACAZY auldridge_m_Page_038.QC.jpg
c70621d9af68ad25587d7539c47a5de4
fc1fd1da8d5866b0a33e259854a6be281729c0b7
49824 F20110114_AACADF auldridge_m_Page_089.pro
16c7b2de63780e4d903e36a81b5a6322
b6040977bcda22c43d79db34c503ed1576eb6f7b
6330 F20110114_AACBDK auldridge_m_Page_081thm.jpg
12e7339aae80a7a04a1c1c53eaa0f9c7
412343c3d44c18b95086829420a2d66262915319
F20110114_AACACQ auldridge_m_Page_014.tif
84de42425afefa48484302383710037d
eeb1b919761e11439a71cf69d1395d16fe2ce04a
6456 F20110114_AACBCV auldridge_m_Page_066thm.jpg
60ed62817c84292906d6fcbd54f1eae2
7bcddae04f3fe855ed7db2b500af1eba6ebc1271
48863 F20110114_AACADG auldridge_m_Page_103.pro
414696322ab5c9aafa2cdf65c965c6bc
d292c085f04d1483214fcf15dc009ce6e3b7bc96
23258 F20110114_AACBDL auldridge_m_Page_082.QC.jpg
5e24d74bf2acba394e7a03a3d4d0369e
fce61a2ba00e596fb27defd922af57e06d9e144e
5273 F20110114_AACACR auldridge_m_Page_042thm.jpg
4999688b63218ed7fb2203f7fcc91507
44a2248f7e3bdc4aee0f2d622acaedf0d69be79f
4469 F20110114_AACBCW auldridge_m_Page_067thm.jpg
6857d94ed6d8f0c14d214f789d0cd9b3
aa493985002822262679b2d1a5cbf4918299d07e
5843 F20110114_AACAZZ auldridge_m_Page_043thm.jpg
c8ba004d2d90967ac2f9ab956bb2a393
559b6ad9a64b5c9d724191f4cf1aff39670fd036
36324 F20110114_AACADH auldridge_m_Page_070.pro
bf5ae41275a94c7abbc690db93fe0909
be0614ff60e7c67510202fc9656ca25463526edd
6535 F20110114_AACBDM auldridge_m_Page_083thm.jpg
7f097233961c21baf49ea77dd0bc57e4
5ee52a2f3ff1df14456153d77dbe4730b4560a4a
1051976 F20110114_AACACS auldridge_m_Page_075.jp2
cebe9eadcd9de43deac44a58fecee93f
73a7f7f6ff100cad6f91785496b5063ad8ce9489
5568 F20110114_AACBCX auldridge_m_Page_069thm.jpg
11bdebaeba0511c4a52521a117cb29f1
9cb22dfea12233aa2b2d93debb9e2ce1e89790f4
23835 F20110114_AACBEA auldridge_m_Page_097.QC.jpg
453b3315a9eacbd97aab03c459efc083
164877ff79fd3b225a6708ab9424a364779af3c2
34630 F20110114_AACADI auldridge_m_Page_056.pro
d18509f60b14d8bed4bbf85c1aeda6fc
7ebf12e7ab87b56464a8368d454becff6ba4cffd
87860 F20110114_AACACT auldridge_m_Page_087.jp2
47b658b5f8d6804bb3e1cb4087b0f75b
b645679d9627aa36a48166800e301302a72e8177
20225 F20110114_AACBCY auldridge_m_Page_070.QC.jpg
d72ffbd7f6a8b28e8737f6f71e274958
29b549df77ee4b50966715ce79bd1908965abaa7
F20110114_AACBEB auldridge_m_Page_097thm.jpg
29b9a1bdc664cd826c0f6d196ef48c84
174d90420cbed278bee33aa46a5d647ad374fd39
96446 F20110114_AACADJ auldridge_m_Page_091.jp2
31db64f0919d0a7845b8818a21bcd871
d1f76488a8f8228b56afae521a65101d440247bf
22957 F20110114_AACBDN auldridge_m_Page_085.QC.jpg
543a6d6fabf80452034a75c8aaec99ba
e31ac70cda3fc204e1dd3745b03e05b93ea57fb1
914676 F20110114_AACACU auldridge_m_Page_030.jp2
4ce7edbe0121b077bf3e03a5164a6cc9
a1b1517f7ae3383414cbdeaed1823982fd2dfa93
5716 F20110114_AACBCZ auldridge_m_Page_070thm.jpg
3ab662ec908637e3bb35759e4b89072d
40947c67d752b39641506b8880b14200e14250d9
24287 F20110114_AACBEC auldridge_m_Page_098.QC.jpg
bcfa8dac6bed2e437baf89b3ec2e4ec6
b83f0ff92d17f01c048b8dbc5031f20f9456034b
67012 F20110114_AACADK auldridge_m_Page_092.jpg
d0ecde4b43439557aea39216b47423f8
0d787069a600d2cfa1b41e50fb681a96c3e27b5e
6383 F20110114_AACBDO auldridge_m_Page_085thm.jpg
46798982589236f854435ce7dd5efb9c
fffb65bc67df9549331ed5dcb0738485fdc11998
42047 F20110114_AACACV auldridge_m_Page_073.pro
12eec0535e40ff1e3054bd21b49f1d36
14cfaffb89b21463fc2690361ad1ef001178f5c8
7104 F20110114_AACBED auldridge_m_Page_098thm.jpg
a797c9bdffe9eabe2b1d1d152679c0da
374c0949d4032bf72939b72733c77e92c95d2666
47711 F20110114_AACADL auldridge_m_Page_075.pro
b499455bbc7cc82c268250c855df8262
d23e54919af58cbac274b6397c6134c9951613a2
2314 F20110114_AACBDP auldridge_m_Page_086thm.jpg
2feb80c1c1c9802dc1fcfdd2215a7612
774435a1308789b7b96a9268e23a893b415164be
69570 F20110114_AACACW auldridge_m_Page_068.jpg
473c818f4f82a20f14a262f73cb6b601
d76196452724cd82dba985d962af9080cd3ad423
24306 F20110114_AACBEE auldridge_m_Page_099.QC.jpg
63fc8406d190ae4305d38d4b6804f82d
4b05dd3d3978fab06744655a8f592d70412b1f4c
18890 F20110114_AACBDQ auldridge_m_Page_087.QC.jpg
dfcfb98badaf9cf3ff757b978031e566
f43c12a758f9a0283e8beaa9d9f06bcb8cc3ed9c
45055 F20110114_AACACX auldridge_m_Page_033.jpg
705443575ac872ef0a58d11b0dfacf14
4831677609687ba98278b638523419a5257011c3
69542 F20110114_AACAEA auldridge_m_Page_089.jpg
afbf50000eee109e6b42ecc00342c0f9
291e3ebe673fbb06619218ec9d70f98c327dbdbb
24896 F20110114_AACBEF auldridge_m_Page_101.QC.jpg
3c2d068df507387538e06895422e918c
530a7caaf3c5d10242be9eb6b8b7904412ab2cc1
107814 F20110114_AACADM auldridge_m_Page_094.jp2
8c20d2d341e0d02b5032edcf191e7762
b5a043babafab41b6cf6086bef442b4180c936d9
5947 F20110114_AACBDR auldridge_m_Page_088thm.jpg
67a6c90e2b26308f3c1f71eee08a75d0
7b17b8ae583ea66c7171f8f5684916129b7edf40
37490 F20110114_AACACY auldridge_m_Page_071.jpg
3a82eb7bedebb05d871e633e9be5eadb
824cb9432af6ffc6107aba539382726de9846929
18996 F20110114_AACAEB auldridge_m_Page_080.QC.jpg
a6d07343209a1dc4e3324dd74317bcc7
2a7f53dc6d871d345a279348168415a14a06c819
9112 F20110114_AACBEG auldridge_m_Page_104.QC.jpg
55ee42d45cee343446f4445114ccc670
cd6983eea710d41095baf658d1ce648ce20f7786
103433 F20110114_AACADN auldridge_m_Page_068.jp2
9e5c171fd76ab24be3c9c1cb7984c722
1247db710e5f9acc740611e9309f71c843043e92
21280 F20110114_AACBDS auldridge_m_Page_091.QC.jpg
10c993928960e4e6651292e681744ca6
fbc5f9afdcdbccdb04be5952d63b4d3a452d6ef1
4970 F20110114_AACACZ auldridge_m_Page_028thm.jpg
b605c420bc54bd29301d8a44f47d7fa6
c49b8f8123cf477ca4f5a091014b62009f8cbd7f
300377 F20110114_AACAEC auldridge_m_Page_007.jp2
1f3a193d8c85ef73ce2a20a2147dad48
4c70604b18f89325efb761f2d13107596c6b07dd
6034 F20110114_AACBDT auldridge_m_Page_091thm.jpg
da658347f59eeb89632b6fd68132a6fc
584252b178f74ea59d4ebd5e923bc8994dca7838
69970 F20110114_AACAED auldridge_m_Page_020.jpg
617cd6ba836f615c1972bbe135f26d60
c3bf0887e8f423980865d56cf3020d533f8d0d1b
6601 F20110114_AACADO auldridge_m_Page_099thm.jpg
63a19fd95feac1de3ae3d3bda19dcdeb
280a0d16e76190192568afbeb8672e4bd7f645f3
6202 F20110114_AACBDU auldridge_m_Page_092thm.jpg
0e7ffc5aa8c9f0410e50ebae51811ab1
977462771cc03154e150992f31fb6ebbbba0b798
59010 F20110114_AACAEE auldridge_m_Page_063.jpg
452e888e1a6906f031cb51b9b4c171df
ec8a422e784e4da2c3e5afa5f6e3d6a1fd0c63c9
201 F20110114_AACADP auldridge_m_Page_039.txt
4bb1e7fc2e9f5bef9923bced0ba68aa8
ca76a4dcfb3f4d8e00952bc56136cd47f536d43c
6520 F20110114_AACBDV auldridge_m_Page_093thm.jpg
ea669e45d9c3ddb6b4da7a1c18a47a43
dc797751e84edfbf1446fb9b561119bf8ac6fb57
1527 F20110114_AACAEF auldridge_m_Page_078.txt
8c6d425b7ce89924bd8a88934ec487e4
6a80156f16106d5cd7d8ab4b7699606cfd30dc3c
955050 F20110114_AACADQ auldridge_m_Page_038.jp2
06ab478a78bc781dd3231245af6c0ccc
17fcc16bc4f87952f827a97cb19cda4081547b00
23412 F20110114_AACBDW auldridge_m_Page_094.QC.jpg
4a9e60e1b8583c11b3fa3a30294e2eed
f5117728b35bbb7f72c33ff8eb4da7246398ebae
F20110114_AACAEG auldridge_m_Page_026.tif
d5a290d65678cd6583b0d03e5d9e550c
ff2cd7dfdfcf9665ed1b9b45d1f65ce308cf8b7a
7074 F20110114_AACADR auldridge_m_Page_001.QC.jpg
de4b6b3e5008de66782fcccb51193e01
02469f2ce9d56b420c8312a2cb68fcf24894d850
6530 F20110114_AACBDX auldridge_m_Page_094thm.jpg
0e84281bfbae5662824b4d03a30ac218
e12ec0f37c1fadbaafab36ced0588ca8f6c47876
2032 F20110114_AACAEH auldridge_m_Page_103.txt
5d2922677e3037715aa11657c56d97c8
bc17534203cb725c2f5fbf0cf35f2b9eb9ceb8b8
1867 F20110114_AACADS auldridge_m_Page_084.txt
b604385a9161d0ed091b0c986442905f
de000cc1282fda98c40c36f577f01bf66d6250bc
21608 F20110114_AACBDY auldridge_m_Page_095.QC.jpg
20529001f5c035affb29c09fdff60868
d3232f53ae74f02a5ef66e9cf86ffca0b067758c
F20110114_AACAEI auldridge_m_Page_060.tif
d6dd062ca8d60c0d69156192e4302413
26bb414854f1384ea517e526513e9fffe9571879
15700 F20110114_AACADT auldridge_m_Page_050.QC.jpg
3df98be5cdb01d6755e4e44415153cef
5f2ac4dd986b645fa2fa7c2c7f6da67b5b8c9f00
6078 F20110114_AACBDZ auldridge_m_Page_095thm.jpg
91b92b9e181e59fb8f73cb4f2831c543
de4a3ab7ac9c4a191bea76aefa4f27945fe9af0a
45037 F20110114_AACAEJ auldridge_m_Page_053.pro
8893ae275d09950a319dbc508b175662
01321f5d1369bfee3662e3382fde963fa24d69af
21627 F20110114_AACADU auldridge_m_Page_086.jpg
cdc6d3a5f0678cb9938193d6cb3e942b
a0fa00b4c27e83404ce4c23939e88d47cbdc3b05
6435 F20110114_AACAEK auldridge_m_Page_082thm.jpg
f0abeab1940221364c99e1099b4fe6cb
13b6a16ec200c9bc3e4a096c8ec843443693e514
60474 F20110114_AACADV auldridge_m_Page_038.jpg
1743577abf4c11c5feabd39b66211416
9899999f28a07705ee0e4a7822f65b617d729a7a
65332 F20110114_AACAEL auldridge_m_Page_088.jpg
2c05b458dfb81f08e4f3a3197531c65a
f755f1ae348e4f38c44381129c95587773cee6f6
4248 F20110114_AACADW auldridge_m_Page_074thm.jpg
e459e277d86dc0594ce8570101241b1a
46393b6d4dd6e7fb0e27c7efaafec6c7417f6c62
21874 F20110114_AACAFA auldridge_m_Page_024.QC.jpg
a37780eb40976efdf01fdffdd1c6429c
8097b138efc8cc71728277431c339300553aa1d7
5471 F20110114_AACAEM auldridge_m_Page_040thm.jpg
a4a3451b7a54158ff60fd93c9307f746
ec72883e562421f5f33863f40e3c240a04673079
7036 F20110114_AACADX auldridge_m_Page_101thm.jpg
d388dca5a0b88949cd256b0977c52f8e
3bd57f7651d27ce097867024b8372166fc658e6b
56055 F20110114_AACAFB auldridge_m_Page_099.pro
9a571cbf67571ba86fb2a5a73f082ac7
588feecb0bd24d02aca7a10d06f1086f1e1346f2
3059 F20110114_AACAEN auldridge_m_Page_008thm.jpg
7018f886602438a08bf1b771f890f8f7
ba64717ddb1b80ee29b07a1ea30b42cceee40c0d
64150 F20110114_AACADY auldridge_m_Page_005.jpg
6616cc60ad01a31398a12d13f7386b1f
d6b5d28e94baf8b7781359f456ec5020a664582a
2190 F20110114_AACAFC auldridge_m_Page_025thm.jpg
2d5fbbf69fe427eae2b1683771365810
abf4404d5e78e3a1653fc57dc476c35023f2e102
59392 F20110114_AACAEO auldridge_m_Page_059.jpg
6bb380ddcbb3101a6002b6337a4aa68b
d680ca140c2a34ebfa8d870fbf08f8af8eaf6d13
690600 F20110114_AACADZ auldridge_m_Page_074.jp2
25c4e22f768ef88c1e862436e5902530
d24755e6defcc6e488706e08d4d1874486582b89
1673 F20110114_AACAFD auldridge_m_Page_073.txt
f95f30cbc6992838e4d63a2ad2c7fc6a
e534fecd778c05218c164fc2cc2156ea0a5c3436
1766 F20110114_AACAFE auldridge_m_Page_013.txt
1a7dbf4932b3b76bdd1393ba8bee1305
6726f9b64b03d81442ec8625cf9737a1511eaf33
67379 F20110114_AACAEP auldridge_m_Page_077.jpg
69b44a1ee6dcbd5bc9f8adf92a6db4e5
a53f09dabd3b4cfc31f4953ddc315121ead90921
2499 F20110114_AACAFF auldridge_m_Page_010.txt
ce9ce0e826ee63ab2ba794df965d1838
dbb8a4be273436a491b7e0455c173ee11585eb1c
F20110114_AACAEQ auldridge_m_Page_040.tif
d15272df0df198fec48837b529d1200f
c6aec0d1d7f3fb97784b7f2d8a4da98ceb9b1ed5
15330 F20110114_AACAFG auldridge_m_Page_067.QC.jpg
ae7619d8f22462cd9337cac4563da4e9
1c71dc02dc2f9b3b376844929235365563d1e4ea
33368 F20110114_AACAER auldridge_m_Page_008.jpg
31b12d53f886ee1b30674512904ff6da
6d0543cce23ab37ed431c52757ec19448028b746
1051963 F20110114_AACAFH auldridge_m_Page_048.jp2
c5d46e64012d911239d7fa522a158c67
cc2d360ca8111b54c37805d32e93a820a9ce5595
5856 F20110114_AACAES auldridge_m_Page_090thm.jpg
7d73af34a42910b076275e9898d2b84d
51c0de4782ab57a2c608e27695fd838805ce4695
85465 F20110114_AACAFI auldridge_m_Page_046.jp2
b1574acac2d5dfa86a9cc8130cb0bd73
01d436cde609823a3f6c2a132b01cd12c3ec8a0f
39794 F20110114_AACAET auldridge_m_Page_046.pro
58d9485aadea14d214c3c43e16856a9b
cb9de4c78cebf1c1da7416334bb5b39d6234b5ed
2071 F20110114_AACAFJ auldridge_m_Page_017.txt
af9d0aeccc6b497cbdf39e405aa8d1f7
74b241496b1fc3e3d8c3718049bd4b56a94451df
105876 F20110114_AACAEU auldridge_m_Page_082.jp2
66d75e412f8e542f3f7b01975d70ed0f
2aac40d4bdba4fb1da883f49246e7313225f9422
1917 F20110114_AACAFK auldridge_m_Page_016.txt
0a354145a33f14d002a4d5a6ca2442d0
b3ae40723daf411ea2251ff3fb05745ce24ca7c4
F20110114_AACAEV auldridge_m_Page_027.tif
e3aebcb02366937e47cfcafea5631a99
25ce763044d8066eaf116593b77cf17e342f3bb2
52913 F20110114_AACAFL auldridge_m_Page_071.jp2
fd60c0bed427c1b29309484c3eee3b2a
6e839a27c6bfce756ab9f4613f174634c81ad0a5
1679 F20110114_AACAEW auldridge_m_Page_070.txt
1f41769d748e125b173f5a61ab039555
39708844297c284f7e5242db221056ad911137ee
27629 F20110114_AACAFM auldridge_m_Page_096.jpg
439e0afcf4b842d00af78d407b99289c
97a6104965317aeda79e7b5a8785c93516733ad4
2013 F20110114_AACAEX auldridge_m_Page_094.txt
c2acbe98a4e5625adb779c88e7d52688
d4b89c29f27582e4e770e21054f3ab236cfcea32
75426 F20110114_AACAGA auldridge_m_Page_103.jpg
aa182c20ab6959110dfbd7b99421bdda
c923b8022ce13051ea2d23ead54e1c5cf29e27b0
59380 F20110114_AACAFN auldridge_m_Page_051.jpg
34b8c30082db6dfea3c96d6c56a0928c
ac60975fb1565311eb5a7222ffa572f5e8245e4f
6808 F20110114_AACAEY auldridge_m_Page_100thm.jpg
27d337c336afd844c804173f9eb5701d
2ee34b3fc4a1762e644dcadc34b3702ed885b876
6061 F20110114_AACAGB auldridge_m_Page_054thm.jpg
3842fc0ca8c5da4ef613a3ba069e2ad0
7dc27e07b9081e91bc6364a5cc63623a0d9d05f4
21262 F20110114_AACAFO auldridge_m_Page_054.QC.jpg
b349816f0188190dcb566f7c29c525f4
40d43b64130bfb704498972835df3f7258708f3a
F20110114_AACAEZ auldridge_m_Page_082.tif
8628a5490952287b7f77da5748850734
5d93e03cf3f7c8aa42756b6dfb8c7cab9cee1494
2419 F20110114_AACAGC auldridge_m_Page_102.txt
99898519b077548dc9e4e269112d7cce
678503fc9dea62e986b04a46b661672cf422e67d
70408 F20110114_AACAFP auldridge_m_Page_027.jpg
1828d2a12403d0c40f4642bde6959d06
1cfbe92f0ece8314a90b653c2b12415a53c7a494
F20110114_AACAGD auldridge_m_Page_007.tif
f3c4cf674771da3160bf578a738131c4
d0f9cf95aac87068d35cb4c295a3de68e9332647
F20110114_AACAGE auldridge_m_Page_044.tif
0f358ce083d2d1276ead7f9493149208
a3497d673b68e19172a18a2bf371a7ee293d7e42
650 F20110114_AACAFQ auldridge_m_Page_104.txt
292f9ea9e3f5be4ca99bc4a420e37120
794700999140a27a965c477c832696e5473a9b48
5577 F20110114_AACAGF auldridge_m_Page_030thm.jpg
9981b5cb84edfbe2359770d47b61dcba
c74b455815e1ea9ac579a6b7c6e4a7493c4730e7
20184 F20110114_AACAFR auldridge_m_Page_072.QC.jpg
ed17f24a581709e026d6443c9ade3f90
1e8a8597d9b054c729c9d1993fbaf2c27211c0f3
84846 F20110114_AACAGG auldridge_m_Page_080.jp2
810aefbcbba17b403b987f0969576ddf
84440b3b6543523240f187a0fe867aacaa5a416f
22253 F20110114_AACAFS auldridge_m_Page_018.QC.jpg
2d41f8819bfc06a09a47bd0364451a62
b5859d1ac9e12425fb7ebf3bc9ddc524d938e6f3
803992 F20110114_AACAGH auldridge_m_Page_042.jp2
99abbf28563c0b7ed4cbf06a575f598a
25a178f904620bbc6765ff57ec5d9b80767516e1
17561 F20110114_AACAFT auldridge_m_Page_028.QC.jpg
eb96f4f7dd85c7ccc8984c25bcc77b41
6dea8c3aaf230d07e420f28297cd01a26282785b
71544 F20110114_AACAGI auldridge_m_Page_017.jpg
f8e607378d83079efa0c0507072643e8
24ce761b5172fe86dc974cdf25b77d9b7c961517
F20110114_AACAFU auldridge_m_Page_094.tif
57793bb9caa1a9a317b77a15523594a6
c017efcd2ed9afdb971e46379063f2b60ef0facd
4958 F20110114_AACAGJ auldridge_m_Page_007.QC.jpg
750dc4aa229ca24f9f43ecf2f5c80fa3
036b7ad7050df98ae29aa1df9d11b0380f094d5e
67088 F20110114_AACAFV auldridge_m_Page_021.jpg
902b4681035189e9f2fa95cdec08be88
07b158fa3d2ad67f3ca893f2d22409da93508311
F20110114_AACAGK auldridge_m_Page_088.tif
5ef29c70460b78d07cb4ba9bc0d4b0db
be476d8e4721ec9e73423b4cfa31d5709c426bd5
795212 F20110114_AACAFW auldridge_m_Page_045.jp2
e38e91655823eac3e4788a89fa277dc4
b9aa373da11936606d2606491eded5aafd8c2172
55768 F20110114_AACAGL auldridge_m_Page_098.pro
1adcadf6d4216e79d6a46f07e2fa98a4
4596564e1111d63afd8898d6e121a333ac927114
F20110114_AACAFX auldridge_m_Page_006.QC.jpg
0a34bc798fb16c1c658a50e21d18200a
fa85d0be1aae75d3bf6827c5ae10ad58bc60be8d
F20110114_AACAHA auldridge_m_Page_095.txt
82a5e5406c9ec8b72159a52c3eee2da4
deefc6f83fffbc41fd2112f3d5fda288bfcb07a6
19147 F20110114_AACAGM auldridge_m_Page_056.QC.jpg
9009bd741c1a748fe8589765c3e1784c
1637b0a7da5f172a9dda128acf4e83aa50fc9dd1
26316 F20110114_AACAFY auldridge_m_Page_102.QC.jpg
22869bf02b43839d89314247730903e9
680093e3ef3fa4bba61fbf3750eefbf3606ebdf0
1974 F20110114_AACAHB auldridge_m_Page_047.txt
e529a0c2a41549ec83008be0f942c572
d014f71db46986bc4fcb23493859e83fb4fc3aa5
F20110114_AACAGN auldridge_m_Page_018.txt
a263618600325083e324a5e9599d04e9
1fced801b7b65c75a67744589715dbf400c0be39
47106 F20110114_AACAFZ auldridge_m_Page_093.pro
3935d661195f4ec42058db0c997fd1ae
def2e07aa2d81f89c11dd4c323669e4cc5460f64
99824 F20110114_AACAHC auldridge_m_Page_054.jp2
a7c00b88bb3ed4b1d4a52b14587fef4a
90a5664dd0bac0b5b77e8eb8cc78f5b8fd152b6f
2860 F20110114_AACAGO auldridge_m_Page_104thm.jpg
33397a20ec3230969e2b3759734d265c
19f91430c5bc1a62d76f3c9131528e0f0786043f
F20110114_AACAHD auldridge_m_Page_033.tif
a692443acbf23b414cd73456ce1ca9db
6fb94c22549f3094104de73ec038c9e5f2592df4
47005 F20110114_AACAGP auldridge_m_Page_077.pro
4072a56617a61ba98e3e0603c9b78a34
6a60bac45cfcd9e6b06febe1dc982542887790c0
378 F20110114_AACAHE auldridge_m_Page_025.txt
f7b7451807aebff0dfb05b5261305d79
b689341a7b8aab10d1258f43937aa282efb584f0
3399 F20110114_AACAGQ auldridge_m_Page_002.QC.jpg
052a14ce6a07d73d7e664d49ff4ad5fe
40b4cb4be1ef93deb4b5f314adecf08bcf4e7168
F20110114_AACAHF auldridge_m_Page_022.tif
406975ec1fe4667c1da58b94586051eb
acecc2a3074c2f1eee4e8fc2e4349edc6773da28
2060 F20110114_AACAHG auldridge_m_Page_027.txt
2b8b48efcbee8614d6baadf36146657a
6a2e6bf2473895f859b3869aa68aee32a2009d02
3455 F20110114_AACAGR auldridge_m_Page_005.txt
ce9424d38222aae28c9fdb7eb762a8c1
64fed7bb928df381c7427b41c2aec40d681f0dc2
99899 F20110114_AACAHH auldridge_m_Page_024.jp2
dda9ec207672531b3ca73c483e17377d
4c9e64a8f1551a8b9e477c4e5105d3c648596437
F20110114_AACAGS auldridge_m_Page_003.tif
66551822fc31afa932f861fc802ee185
31260109d55f8e7e75e664c5f0aec67bd53e7f41
20227 F20110114_AACAHI auldridge_m_Page_009.QC.jpg
fddc8561940b8f21b74a1d010fed7f81
264d07cd9f3213501c4eff890104c60630d8f691
1010208 F20110114_AACAGT auldridge_m_Page_061.jp2
55cc2979f7334a5455430b2c2005f0d2
d6217fa4f690b909dbe9b830cbfa1c1d1e291132
6650 F20110114_AACAHJ auldridge_m_Page_031thm.jpg
7ee238efe361480be5d8c0deab569b23
5dc4f25173f1220790715b45dd37d9d25d1fe7f0
F20110114_AACAGU auldridge_m_Page_099.tif
6f016aab9b3d6fab2b329913868bd9e4
4e52494ab9398d2299d6aa7b791d7f7ca5395ccc
F20110114_AACAHK auldridge_m_Page_062thm.jpg
8d1a3d76277cceaa92d415cfcb5e64b9
a9b8884c8d8e8e8abd21d0d4f26156c1b6253047
20351 F20110114_AACAGV auldridge_m_Page_025.jp2
84a93cde46ec876f5979f0794cfdde55
0a3d1069f71b4d7f5eae38203c35659a0d4c659e
F20110114_AACAHL auldridge_m_Page_057thm.jpg
c3197e4956758048ae1881309545ca54
8f7c1e8d0b7eaf7da7462ba04e94d4a01a3fb3a9
F20110114_AACAGW auldridge_m_Page_024.tif
dd94c142bf145eff1e051258b29646d3
85fe67c382f5778fc1c804abfb5cdecffc248238
17679 F20110114_AACAIA auldridge_m_Page_007.jpg
e3f9b46b2bc85befcf11ef112863e306
a66bd9aeca2dd360a02656576c160b4447d1100a
8677 F20110114_AACAHM auldridge_m_Page_074.pro
fcec67883d3da5a1812799ff13c9d685
9549a1132a8c5fcd38ac1d9dc7de392d0da0b49d
7721 F20110114_AACAGX auldridge_m_Page_001.pro
3c8fca5af689556d7134a0b0ab4214fc
9046b51d37c9c937e5e53ddf05b3eb4bad7ec931
70024 F20110114_AACAIB auldridge_m_Page_009.jpg
57a97bafd5b87a77cb6c3349a41ee3de
18416acb0e58b81df6bfc6c76f179e1717338018
1562 F20110114_AACAHN auldridge_m_Page_067.txt
d1d0678370d221215406bbcbe2f32fee
0e3de5182de30767d97e02b9706bf174620b14b2
1686 F20110114_AACAGY auldridge_m_Page_080.txt
9f3b465f3d6177ef1a4381f40cecddac
a9f9681931ed6f42254709983121b03360a37446
82659 F20110114_AACAIC auldridge_m_Page_010.jpg
e4815af13cb619f423836d726dd551c7
a88f4eae204204a2be8728eed570ce0a070a7f18
467 F20110114_AACAHO auldridge_m_Page_086.txt
7ad76ed0ac1ff0ba570eb169d3ff7897
bd8b270e4a08afb0b9f145782b0cfb8b5bcc48d9
494 F20110114_AACAGZ auldridge_m_Page_007.txt
d1f1ec3a1de4cdca3290f78cfcaa155a
3f9bfa5a0c43597da7a43e31c2acca1611393a11
55708 F20110114_AACAID auldridge_m_Page_011.jpg
1c02f6076e43c7247598409cc1ef95ec
234f4aafa23c025c9e02bbf342c6b4fc24c8cd8e
F20110114_AACAHP auldridge_m_Page_010.jp2
f3ad05ff80c01cc70293a36e46fad2d1
31e2e8661620d32594369bd1671bde18142bec00
38743 F20110114_AACAIE auldridge_m_Page_012.jpg
1335b2463b7b4d3bd3323135ea244584
e904ad6df5657503d5b25d4dbd8dedd60816eb5c
1858 F20110114_AACAHQ auldridge_m_Page_054.txt
9282a7c5c49f9cec0175c99d262ce64c
ae84dffb9ac70c5bf3a06dfabe36588af16ac3f8
61060 F20110114_AACAIF auldridge_m_Page_013.jpg
2cd35335e8f1c6ff91047dd1e486cb64
50d0c85092d6fa1c5a465b3fc7c644de3beb31ac
5192 F20110114_AACAHR auldridge_m_Page_046thm.jpg
dcc8e3522200ead908f7a6359161ffb1
d71674137f1ff4a4761174897f908599388853fc
61254 F20110114_AACAIG auldridge_m_Page_014.jpg
ad6b2a331ca9aa5c40a9fb5db57c46e2
7c18755fb6f4275d62a1b402c1b0fb3398226b52
68512 F20110114_AACAIH auldridge_m_Page_015.jpg
1ac6b8c8e9f20a5d275470dcfa109989
dddce6fe974c68e907f93f5faf2066643a8c1bbc
122521 F20110114_AACAHS UFE0008160_00001.mets
8bb7bdc430f80821bd06c87ac39dbf4d
190c06b3e3ff5b57e56cf72d19ba56d2333a1ba2
61632 F20110114_AACAII auldridge_m_Page_016.jpg
898f0297a9f48cc1a474c90807bbf16a
9e035af719116a2c665ae67a8244100b6900ef5b
68115 F20110114_AACAIJ auldridge_m_Page_018.jpg
4bb314a666c34b286bc99e9ec46835e9
c3f582ee4e62b321110a9e738e9409cdd0f787e2
22216 F20110114_AACAHV auldridge_m_Page_001.jpg
b616b7d062a7aea62e94531d1ca9629d
279428681f5c87e2d59feb5fec485dbf6f69f1e9
69583 F20110114_AACAIK auldridge_m_Page_019.jpg
74f77ced018b4232ce22dba2a8bd1514
7aaeefbd7899c8355df7697b3cf54095593a6b75
10649 F20110114_AACAHW auldridge_m_Page_002.jpg
4cedc111b79930fb2d5686e8b8f86793
09f8fd340e602c85027b635b9822db3e70cc8339
69268 F20110114_AACAIL auldridge_m_Page_022.jpg
fc9ebed6ed59f1752bf3523a3fdd58d4
493c30f993e8a73447b875232de59c34b72aaa4e
11970 F20110114_AACAHX auldridge_m_Page_003.jpg
5a874ec74fdb28ef3f16ca93ea742aa3
2b7f28a67bd1cdaee5e417c6d224cd9054334fd1
61626 F20110114_AACAJA auldridge_m_Page_040.jpg
d8771135bcd47cd2a7c8b33368342c01
55caaef37385e02a175ffc137c4814ac77df3c8c
68993 F20110114_AACAIM auldridge_m_Page_023.jpg
c0be2d4557a725b51b47881ed5e3bafe
62d9f1e85e79ee57df2c6b08238dfa1477e4cffb
29132 F20110114_AACAHY auldridge_m_Page_004.jpg
8c26c253720ddf5b39b6a5b4f6951657
00dea63144f1db56cfc44bb206de74c4cfbb3f58
68946 F20110114_AACAJB auldridge_m_Page_041.jpg
4f95c32b7777a11e3d56a84a5b297bc3
54d8db269d0b988a210036ea7d0b08db03a11bb9
65910 F20110114_AACAIN auldridge_m_Page_024.jpg
efeae035fa8e52f47a377b3d9b271fe7
83cfc6a3c89b20a37b3472b1579e4a6febfb63e0
88752 F20110114_AACAHZ auldridge_m_Page_006.jpg
5785b5193a21ab9d5fecdaa144b7ab5c
abd0ed9007554839ff14123f5e2b043dac00c264
64329 F20110114_AACAJC auldridge_m_Page_042.jpg
5f47a083a2cc63b85155f87b9a65ef4c
aaad4da3de8eb078451540503346d824ae49d672
18818 F20110114_AACAIO auldridge_m_Page_025.jpg
eb5b4b7fd9e97b3f5085c8c0b156b70b
399b1d51f035065dc47ea32560e847b3dce2fafa
64613 F20110114_AACAJD auldridge_m_Page_043.jpg
34d7a8499b291ce264fe63dff34dd210
3c399475ea1fc4b5fba7cd97af886a9dbd144c5b
58409 F20110114_AACAIP auldridge_m_Page_026.jpg
38e139bfdd1530e0ff92544aaf05157d
763221622c9f1afe60a14098419c641337c596ac
60264 F20110114_AACAJE auldridge_m_Page_044.jpg
cdb254feacaa7374f491883de1c0b076
12bb89bd130599fac25f4f859495a7eb1c3e2dee
54852 F20110114_AACAIQ auldridge_m_Page_028.jpg
29df3f9d04d9457749c4f4524d4aa258
57514a4435fb0043e6350f2d915f2c4da8b3d8f7
54012 F20110114_AACAJF auldridge_m_Page_045.jpg
933703d616e43f93661e6a4de5718d02
44dd22da60b50dce9c5f59cc5f1d28d17979879f
61375 F20110114_AACAIR auldridge_m_Page_029.jpg
a9b6cb77c88e3a838335ccb5dbc91af2
099e314068c23cd4b95fb68a3b8b59fa9f9fb3c6
58859 F20110114_AACAJG auldridge_m_Page_046.jpg
22e6141e9941cfca9c5ec610bb130a88
6060a787559fff46fd6f549aac51e804dda87ea3
63320 F20110114_AACAIS auldridge_m_Page_030.jpg
b47e74c8324703fc250b0bf7873e489c
6cf5300972b933fc18bc88e0091c37432e2e573b
70810 F20110114_AACAJH auldridge_m_Page_047.jpg
c0c6ae3efe536afcdcd171f23223c38f
28b2cbd0c48cc25ecf1d85e5036ddb05a78db137
77552 F20110114_AACAJI auldridge_m_Page_048.jpg
ad509ad00fb212d48d2de174ee5d3232
57686c9a6397c9b66cb80975663563021d532146
74655 F20110114_AACAIT auldridge_m_Page_031.jpg
39f8cf67fa85e1deff1142325d7e2c39
240b59fc76eeafc74be0e863434967d5cf72d798
63452 F20110114_AACAJJ auldridge_m_Page_049.jpg
9612bc55f2721124a20199435ad9c8e0
f27177aef77cf5509c3ec5087ef7d3caba2e355a
71463 F20110114_AACAIU auldridge_m_Page_032.jpg
a97baa353c91966511c43f70fc6e962d
0ddfbc07e99242f05fb935b589ba8dad2606a398
50919 F20110114_AACAJK auldridge_m_Page_050.jpg
0408baf30be2ade165b849a969a3dde0
c0b416843a39f7dfa66e4b9c07f19b07b728a308
69209 F20110114_AACAIV auldridge_m_Page_034.jpg
74fd7538a8613910f6f2fd500433bde5
670d3395fb244604668f5f134d4f9c1d7be30441
83260 F20110114_AACAJL auldridge_m_Page_052.jpg
e25dd8d175491c30fc25edc4bb0005d1
ab96636ae8951b9c76fdf743bc3460cbb0f31254
64384 F20110114_AACAIW auldridge_m_Page_035.jpg
13537042b6afc54cc78b1376b15feb58
ceac35c7462e4b37115f411b80c87638657763c0
61860 F20110114_AACAKA auldridge_m_Page_070.jpg
9fd04e9760dd59fee21337587a6078e9
602f99c861394ee3f0532e19fea75a56c5fff222
66825 F20110114_AACAJM auldridge_m_Page_053.jpg
6f128ea3f0347f72da5b6207cc351622
343f98445e310aa5fca162095f796da26950f5bd
67670 F20110114_AACAIX auldridge_m_Page_036.jpg
9c9c56d9806749a93e9c2626ce269088
c22a1c874ca2542d2918d538edd9c7bc3d4bd8d5
61616 F20110114_AACAKB auldridge_m_Page_072.jpg
0be11c3992e9e12b2beb9e65211282f1
ad75a29bb44f3ca597527a860674b838ec462ec6
66771 F20110114_AACAJN auldridge_m_Page_054.jpg
ef231e32b4fe787b0755ae3c9d4c6590
cc86736ae9bde65c997beb401688001db5e14dcb
63861 F20110114_AACAIY auldridge_m_Page_037.jpg
d93368bfebde3e22fe00f6c526cb5001
7178be4c75a74565d3eeaabb352407e8f2e3d5bd
61326 F20110114_AACAKC auldridge_m_Page_073.jpg
28de53e604bf49b0a9e0edc6105739a0
59336076bf4b751ba32c60e4e36fe4e2a1ff8b86
52809 F20110114_AACAJO auldridge_m_Page_055.jpg
203e9f4ba47976a44f53fefdf8de1464
f9de35231cd7f5f26ece25e6549be844228b21b9
13691 F20110114_AACAIZ auldridge_m_Page_039.jpg
17de9b7a1d144c88eb0025ab2527ced9
e908b090f415963e4465fdbcf5853eb9fb980653
33340 F20110114_AACAKD auldridge_m_Page_074.jpg
ca0457d1c51d7812690be0389ee3a9b4
bdaca3b891d945fad6cda7df674b3fbd5368624b
58390 F20110114_AACAJP auldridge_m_Page_056.jpg
194182907d6fab9bb9aa12037c3c6a8f
442cd07b9d0268e3c9bfe82ae760859b5e5d2238
76989 F20110114_AACAKE auldridge_m_Page_075.jpg
9e1a9b62c23d1f7a07a77f97ac3a4365
0386b5dbaec9afd63049553182e44d171f3aa465
59198 F20110114_AACAJQ auldridge_m_Page_057.jpg
35a5471b0a3112ba5fd54da976bebf07
9336611e9a6f3657de3f1ace882d6c082dd10ec8
36016 F20110114_AACAKF auldridge_m_Page_076.jpg
1d030d63a1a0ab62d1a569121308a153
72605b7cdb7814f781fd042608d3172ced47a97e
54175 F20110114_AACAJR auldridge_m_Page_058.jpg
ccf2e5882d3ed61f263b78d816703689
40472c68b62a8a585ee776def322ce02e20feb8c
36754 F20110114_AACAKG auldridge_m_Page_078.jpg
4b7552181e8497e5e13a271daa613de8
207c76cabd1ccafcbaf3c6bb6962896dba322e5a
55652 F20110114_AACAJS auldridge_m_Page_060.jpg
2f23ef53ab62451a75239474e24e8c31
6157c9297f14f4254630239b6ac5ff68fd80fc8f
15645 F20110114_AACAKH auldridge_m_Page_079.jpg
3948038ab231f974e3053a7e80d20b1d
e3afc95ad2c0585ceecb714cbbe5efb6b94df7d6
73372 F20110114_AACAJT auldridge_m_Page_061.jpg
20c2f68caa47fd87234bd3fcbf25c40b
d1d453ffbdc07665c88bd3275ff9da59aa3d3266
58294 F20110114_AACAKI auldridge_m_Page_080.jpg
6b0ceec79266f949d38b97471edb1d4f
b24be3e4125c4a27e295948de5585db9da7ac81d
68874 F20110114_AACAKJ auldridge_m_Page_081.jpg
08eafdb7cd3aa64297e251386efff4b5
94d37f9b68320fd17c93a394184e607eebfe87aa
52937 F20110114_AACAJU auldridge_m_Page_062.jpg
da3c0a27054e56c2aba4a7a2c12271dd
d483fbbf19759c7e48ba1017089058b4b99348b3
69866 F20110114_AACAKK auldridge_m_Page_082.jpg
8f288b27c93f2153d0e25e03e809355e
f00979e640897f6b8a4258f9dc01abe0aa9bc219
65660 F20110114_AACAJV auldridge_m_Page_064.jpg
0cc82a5e5b1ab78a5d8197b8683eb7cf
0ea413f9fbebfeaba5f65724d633766ce253f3d0
71170 F20110114_AACAKL auldridge_m_Page_083.jpg
d8bccba39bde5b999a233279623ed082
8ceba9568764722640205fb4d14a749f50bd0f8f
65008 F20110114_AACAJW auldridge_m_Page_065.jpg
7b6ece004f9a07faae2b7cb9a1a46906
1fdf22772a741f1f2e33b0d4de07fb11a1dcf00d
66208 F20110114_AACAKM auldridge_m_Page_084.jpg
cbe55ca523a950c1e0bb2ecf16f0ec4e
06e898e4aa7eaaf2e0aeb154ada3d5049dc13213
69373 F20110114_AACAJX auldridge_m_Page_066.jpg
29ce21bec6a8ce673350e11fc5adbf8f
83401c9b058473f5efa496d0d157ef6b8b6e7465
28522 F20110114_AACALA auldridge_m_Page_104.jpg
9518c43174d2523dd0fe31b0197a8237
16fc7925a75b26d886745211b47cacefcf433491
70021 F20110114_AACAKN auldridge_m_Page_085.jpg
c56bbe3bca9e41fb6629ea4665149b8c
468a26b7812467d0dd151c980c569eceec571a90
51770 F20110114_AACAJY auldridge_m_Page_067.jpg
cd82c46738681f7df6f536e50183470c
af612e9003603eacc51d92e2644568841fc68a65
23873 F20110114_AACALB auldridge_m_Page_001.jp2
c88e2be7dc4a154140091e1863221e32
dcefc71b1f77322990abb24c5d0eb6163992713c
58503 F20110114_AACAKO auldridge_m_Page_087.jpg
d1196744d38472ad43252482854e3400
d43fa19ed830baa9063c8f3745f73302ab0d934e
67126 F20110114_AACAJZ auldridge_m_Page_069.jpg
aa9f3d24c58399bda133070187136902
087c5f0ab9f68396e3394b39a4a6037fd902e8e5
6160 F20110114_AACALC auldridge_m_Page_002.jp2
57b9bd4741463a8a811d500b7f532996
f327d2c08b8b15ef34e539f50d172ab9a4de50ec
66074 F20110114_AACAKP auldridge_m_Page_090.jpg
3f65b701049a79268bd02cf9295ca495
253c5a66b5042ab175e9113b8e62e07144c405b1
36607 F20110114_AACALD auldridge_m_Page_004.jp2
dafa59dc5ffc9a70afcb6ad6b5c9193d
a56c8f68578154641c492fd44a63d62090cb6e88
63839 F20110114_AACAKQ auldridge_m_Page_091.jpg
04df13234f2f98f5442b30a7d7aa3860
5c33be4febdd51650c42ff9ca43d393c206122d5
1051975 F20110114_AACALE auldridge_m_Page_005.jp2
b5960cf9ad1dae1f7db8ad9dcd68b645
1dc58b2d7e6b8090350bea37ed64cea3c67c9410
72832 F20110114_AACAKR auldridge_m_Page_093.jpg
f1aef0186dde1405ac67987531e1f163
3c96c436f6ce3b18f0b6d01cf10646e555da54fe
1051970 F20110114_AACALF auldridge_m_Page_006.jp2
13dca62c38b703e6ec95012e2ec64351
487000ff1345071489e8fdc5edd335a5cfee87a8
71604 F20110114_AACAKS auldridge_m_Page_094.jpg
28f6b7bb5e6cfb30623ccf0e0bd1f5d7
ac60f1fbf4a58d987bc10abe7046c3fd0c126ccd
832727 F20110114_AACALG auldridge_m_Page_008.jp2
5d650400a5c79ad9e2d4b5611134b721
18bfe80a7da5911eeaa7e7511081791bf30179c7
66547 F20110114_AACAKT auldridge_m_Page_095.jpg
6f6264e965bae9558efec70f12d7f033
fa9a2bda44cd08faa61dceb08a1f55667a98a9b3
1051986 F20110114_AACALH auldridge_m_Page_009.jp2
a96af75c8165136deabeb77fca3da5f9
0ebfda25ef86c9142773aed49594f2d966ad0969
77342 F20110114_AACAKU auldridge_m_Page_097.jpg
4baed37876cd8ceee96fe10833bfd325
71256b48f281084565f64418332a5f306fc0baa0
82418 F20110114_AACALI auldridge_m_Page_011.jp2
9866e8e5b30b368a8fd15b197244d4e0
db9220487b3c5f139488ec290de407c26fb36e4a
53835 F20110114_AACALJ auldridge_m_Page_012.jp2
2b24f805d9dba5520485b4a21f34a50a
4f6a537d97eb45b65d4dd2fefc9f53523403bd5a
85316 F20110114_AACAKV auldridge_m_Page_098.jpg
25f0d327fb9fe2d4c891a3d8a4dd342c
fdc2ea4023f1a70ce155c04fa77c4bfa3418b4f8
90573 F20110114_AACALK auldridge_m_Page_013.jp2
ad45aed25f8d001f7c0b17c918b9ae61
699014f61adaed554db0159569a33751c29b11b6
82919 F20110114_AACAKW auldridge_m_Page_099.jpg
8a7646084cf89a2c2dbf25e81ce6290f
c92e8205eaf801b7e3c8d5c03060e503ddece81b
795978 F20110114_AACALL auldridge_m_Page_014.jp2
ecc7f6787372cc4bcffc29aa63eeff5a
c9600fa59b6a9688fc638abb2be6b728a171c14a
84609 F20110114_AACAKX auldridge_m_Page_100.jpg
a6689080a0642c186f257b7eb0f03e95
e859de8cab18994d98ccb623ad1fb01687b5ffe4
1051866 F20110114_AACAMA auldridge_m_Page_032.jp2
df2ec6e7d2ebe15ed55e0dfb6acf9f4f
d81cbeb4d9192d80608f2d3933455b638df09230
101695 F20110114_AACALM auldridge_m_Page_015.jp2
0404377928e631e7faf523217db4c29a
952b85d7546a42ee6fa078e2be003535dc8a414c
85102 F20110114_AACAKY auldridge_m_Page_101.jpg
72b4795d582c539c799d9a1087863e4d
e1946cd7943cfc91d4e7fcc451edaa234242d048
795689 F20110114_AACAMB auldridge_m_Page_033.jp2
37bf48d3686403017e1cf27aa166b630
30538a9077c3bc3a5aef4e2ac272addf83623286
89684 F20110114_AACALN auldridge_m_Page_016.jp2
c84c7e9fda4dfa17c4db794783bea8dd
c2f2f73373da83c382acd3bc10aeb46b6f5c50fc
90952 F20110114_AACAKZ auldridge_m_Page_102.jpg
a530aef3df7a6adb56f19516d8901569
66fdcce305078ee9caee59a0127d722b7e21e4e8
1051956 F20110114_AACAMC auldridge_m_Page_034.jp2
57e084e77a91e3bdc84ef2a73aac2927
4df33af46e5ef516ce6eb1da4b0824f5a8b46fee
938709 F20110114_AACALO auldridge_m_Page_017.jp2
388c20b5ab3930310dbd75f455d3fcd3
5313d7dcca916670aa261aa2af3b33f14a90c6db
1051906 F20110114_AACAMD auldridge_m_Page_035.jp2
156b395ceba36c3df796f86ff7e6b920
ef89ac67057498eec2b5179fc5a5beb2cad4da10
103907 F20110114_AACALP auldridge_m_Page_018.jp2
8db347022b45886610b207c1aa65f993
5f31fc225b056d7e935dbf7221fe8562dc893f50
102704 F20110114_AACAME auldridge_m_Page_036.jp2
23b61ec3c72b1bbf6181441cc6c29937
1e202adc8aefca09fe60cea3f9db15c5d3b7125c
106003 F20110114_AACALQ auldridge_m_Page_019.jp2
1bfc517ea1ad4c81bec14f09a0b2897c
972a6e93c243705173c85c0bc2e5789d0360501d
999908 F20110114_AACAMF auldridge_m_Page_037.jp2
ba81dfd1bc497d7bec31c9e45e662755
680392137436a52448ee846994d0ea50c93dfeb9
962668 F20110114_AACALR auldridge_m_Page_020.jp2
f00ce2a51b43f488805d09c29ef98749
9a37f42a51506a7ff7cbc48079c5c4002ae8fe8f
11465 F20110114_AACAMG auldridge_m_Page_039.jp2
755ea362e199f73b51f40aa8d949163f
6238912dbfbd428144e49ebdfee85642484c7270
101117 F20110114_AACALS auldridge_m_Page_021.jp2
e950b886efac1409662781269e32996c
96e7ed80a371c5067a60b5166a0d1146ca7e58f0
89623 F20110114_AACAMH auldridge_m_Page_040.jp2
78c1a9d83c192f66f58426993bf32428
50c697640b7ac4c4f541ce20bdf83d9cde008942
104894 F20110114_AACALT auldridge_m_Page_022.jp2
f42f2b5441e2d68b195d8d351d41b4bf
9c74f2ccf0b9aa6c80fd8e8c8b98f1b9a81e0fd7
F20110114_AACAMI auldridge_m_Page_041.jp2
a76550406cac6c89e36482ebfb708805
c7202a28ba14f8377d782b024993700ef03f473e
959598 F20110114_AACALU auldridge_m_Page_023.jp2
c5cbfb184977f0ed7f048b77b7072c92
5834300e8743dd1b9dcca6974da78872dac5147c
888505 F20110114_AACAMJ auldridge_m_Page_043.jp2
c6ac824d8965c7b65bd9e791008d2cf3
a28fb48f9e1b932d1da944f21a4d6043d05fa58c
774263 F20110114_AACALV auldridge_m_Page_026.jp2
96affb831af99bb8764530c68415aa9d
8d971692795be3393b5453d2dd2af5cd5d2398da
989556 F20110114_AACAMK auldridge_m_Page_044.jp2
f7faa70073228e072984a86b9972c800
3702bd24f765583265d5635503b17c2dc5c6885e
103915 F20110114_AACAML auldridge_m_Page_047.jp2
80f7a2dd07cc150b7a15c870d892ce43
189f9abcdb2ec4ab02c0d35a6307ed9eea3fdd20
105789 F20110114_AACALW auldridge_m_Page_027.jp2
a372843b102dc40ee3e6f60d4e97bdf2
4fb0d54b57c898c6302c552bb7e3812a1755fe7c
976124 F20110114_AACANA auldridge_m_Page_065.jp2
c82da1e8e4b0a3c76909b0bd22a30aa4
1e7fc04c1e2250b5416b8eb34fdaf83d7aa0c6b3
983345 F20110114_AACAMM auldridge_m_Page_049.jp2
6f7b5dedc844e3acd24cf896dbd087a7
ad9d0773abe6b46208f803e87e7cf2849f23a54e
824161 F20110114_AACALX auldridge_m_Page_028.jp2
a2d750f0c56e25629454f77c3cc94d87
1c8d23d2b75071b4525cc62d27073fd599554013


Permanent Link: http://ufdc.ufl.edu/UFE0008160/00001

Material Information

Title: The Carotenoid Cleavage Dioxygenases of Arabidopsis thaliana
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0008160:00001

Permanent Link: http://ufdc.ufl.edu/UFE0008160/00001

Material Information

Title: The Carotenoid Cleavage Dioxygenases of Arabidopsis thaliana
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0008160:00001


This item has the following downloads:


Full Text












THE CAROTENOID CLEAVAGE DIOXYGENASES OF ARABIDOPSIS THALIANA


By

MICHELE ELENA AULDRIDGE













A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2004

































Copyright 2004

by

Michele Elena Auldridge
































I dedicate this work to my parents who support me in every decision that I make.
















ACKNOWLEDGMENTS

I would like to thank my advisor, Harry J. Klee, whose consistent belief in me

made this possible, and my committee members, Donald McCarty, Andrew Hanson, and

Steve Talcott for their critical advice. I am grateful for the assistance of Carole Dabney-

Smith for work with chloroplast import, Eric Schmelz with hormone and ionone analysis

and Anna Block for assistance with plant measurements and support with my project. I

would also like to thank my parents for their love and support and Brian Burger who gave

me the confidence and encouragement to get me through to the end.
















TABLE OF CONTENTS

page

A C K N O W L E D G M E N T S ..............................................................................................iv

L IS T O F T A B L E S .......................................................................................................v iii

L IS T O F F IG U R E S ........................................................................................................ix

ABSTRACT .................................................. ................. xi

CHAPTER

1 IN TRODU CTION .............................................................................. 1..................

Carotenoid Cleavage Dioxygenase Family ............................................. ................ 1
C arotenoids ....................................................................................... 4
A pocarotenoids .................................................................... .......................... 8
Carotenoid Cleavage Dioxygenase Activity in Arabidopsis .................................. 10
In Sum m ary ................................................................................................... 12

2 CAROTENOID CLEAVAGE DIOXYGENASE 1 (CCD1) ................................... 14

A c tiv ity .................................................................................................................. 1 4
Subcellular L ocalization ....................................................................................... 15
E expression A analysis .......................................................................................... 16
Loss-of-Function M utants ................................................................... .............. 19
Isolation of M utant ........................................................................... .............. 19
M orphological Analysis of ccd]- ................................................... .............. 20
L3-ionone content of ccd]-] .......................... ...... ....... ... ................ 22
Determination of Abscisic acid content within ccd]-] plants...........................24
In Sum m ary ............................................................................ . ................... 26

3 CAROTENOID CLEAVAGE DIOXYGENASE 7 (CCD7) ................................... 28

A c tiv ity .................................................................................................................. 2 8
Subcellular L ocalization ....................................................................................... 31
E expression A analysis .......................................................................................... 33
Loss-of-Function M utants ................................................................... .............. 35
Isolation of M utants................................ .............. .................... ............... 35
M orphological Analysis of max3 Plants ........................................... .............. 37
In S m m r .. ... .... .... ... .... .... ... .... .... ... .... .... ... .... .... ... .. 1









Complementation of max3 Phenotype.......................................................... 41
(3-ionone Content of max3-10 and max4-11 ................................................... 42
Determination of Indole Acetic Acid and Abscisic Acid Content within max3-10
P la n ts ...................................................................................................... . 4 5
In S u m m ary ........................................................................................................... 4 6

4 CAROTENOID CLEAVAGE DIOXYGENASE 8 (CCD8) .................................. 47

A c tiv ity .................................................................................................................. 4 7
Subcellular L ocalization ... ................................................................. .............. 47
E expression A analysis .......................................................................................... 49
L oss-of-Function M utants .................................... .......................... .............. 51
Isolation of Mutants ........................................................................................ 51
Morphological Analysis of max4 Plants....................................................... 56
Complementation of max4 Phenotype.......................................................... 56
Determination of Indole Acetic Acid and Abscisic Acid Content within max4-6
P la n ts ...................................................................................................... . 5 8
In S u m m ary .......................................................................................................... .. 5 9

5 GENETIC INTERACTION AMONG CCD1, CCD7, AND CCD8 ...................... 60

In tro d u c tio n ..................... .. ................................................ ................... 6 0
Characterization of ccdlmax4 Plants .................................................................. 60
Characterization of max3max4 Plants ................................................................... 63
Effect of Loss-of-Function Mutants on Expression of CCDs............................... 65

6 D IS C U S S IO N ........................................................................................................ 6 8

In tro d u c tio n ........................................................................................................... 6 8
Carotenoid Cleavage Dioxygenase 1 .............................................................. 69
Carotenoid Cleavage Dioxygenase 7 and Carotenoid Cleavage Dioxygenase 8....... 70

7 MATERIALS AND METHODS..................................................................... 75

Cloning of CCD1, CCD7 and CCD8 cDNA ....................................................... 75
C C D 1 ......................................................................................................... ... 7 5
C C D 7 ......................................................................................................... .. 7 5
CCD8 ................................. .. .... .. ..... ... ................ .............. 76
Carotenoid/Apocarotenoid Extraction from E.coli .............................................. 76
Plant Growth Conditions and Measurements ...................................................... 77
Subcellular L ocalization ... ................................................................. .............. 78
T N T ........................................................................................................... .. 7 8
C hloroplast Im port ..................................................................................... 78
Subfractionation ......................................................................................... 79
R eal T im e R T -P C R ............................................................................................... 80
Isolation of Loss-of-Function Mutants................................................................ 81









(3-ionone M easurem ents... .................................................................. .............. 83
IA A and Abscisic A cid M easurem ents ................................................. .............. 84

L IST O F R E FE R E N C E S................................................................................... 85

BIO GR A PH ICAL SK ETCH ... ................................................................. .............. 92















LIST OF TABLES


Table page

1-1 The CCD G ene Fam ily of A rabidopsis.................................................. .............. 3

1-2 Comparison of the CCD and NCED gene structures and identities to VP14 ............ 4

3-1 CCD 7 transcript abundance in whole seedlings .................................. ............... 34

3-2 Petiole and leaf blade lengths and inflorescence number of max3 plants...............40

4-1 CCD8 transcript abundance in whole seedlings ................................... .............. 51

4-2 Petiole and leaf blade lengths and inflorescence number of max4 plants............... 57

7-1 Primers used in Real Time RT-PCR reactions. .................................... .............. 81

7-2 Gene specific primers used to identify knock-out plants .................................... 83















LIST OF FIGURES


Figure page

1-1 The Carotenoid Cleavage Dioxygenase (CCD) family......................................2...

1-2 C arotenoid biosynthetic pathw ay ....................................................... .............. 5

1-3 P3-carotene with its maj or sites of cleavage indicated by arrows.............. ..............8

1-4 Activity of the Arabidopsis CCD family members.......................................... 11

2-1 CCD 1 activity with P3-carotene as a substrate.................................... .............. 14

2-2 Import of in vitro transcribed and translated CCD1 ........................................ 16

2-3 Organs of wild-type Arabidopsis used in morphological expression analysis........ 17

2-4 Expression pattern of CCD1 as determined by quantitative Real Time RT-PCR... 17

2-5 Changes in CCD1 expression due to water stress............................................ 18

2-6 Location of T-DN A insert in CCD 1 ................................................. .............. 19

2-7 Schematic of T-DNA used for transformation to create SAIL population ............ 20

2-8 Autoradiograph of Southern blot analysis of ccdl-1 plants............................. 21

2-9 Wild-type (Col) and ccdl-1 rosettes before bolting......................................... 22

2-10 Petiole and leaf blade lengths of wild-type (Wt) vs ccdl-1 plants...................... 23

2-11 P3-ionone levels within wild-type (Col) and ccdl-1 plants............................... 25

2-10 ABA content in ccdl-1 vs wild-type (Col) rosettes..........................................26

3-1 E. coli lines accumulating lycopene, 6-carotene, P3-carotene or zeaxanthin +/-
C CD 7 expression ........................................................................................... 29

3-2 Results from HPLC analysis of carotenoid content in each carotenoid accumulating
E. coli line +/- co-expression of CCD 7 ............................................ .............. 29

3-3 Analysis of carotenoid cleavage in E. coli expressing CCD7............................ 30









3-4 Reaction scheme of CCD7 activity on P3-carotene ........................................... 31

3-5 Import of in vitro transcribed and translated CCD7 ........................................ 32

3-6 Time monitored plastid import assay with CCD7 ........................................... 33

3-7 Expression analysis of CCD7 trancript throughout wild-type Arabidopsis plants.. 33

3-8 Location and orientation of T-DNA inserts in CCD7...................................... 36

3-9 Schematic of T-DNA region of vectors used for transformation to create the
BASTA population from University of Wisconsin and the Salk population.......... 37

3-10 Autoradiograph of Southern blot analysis of max3 plants ................................38

3-11 Phenotypes of max3-11 plant compared to wild-type (Col)............................. 39

3-12 P3-ionone content in max3 rosettes as compared to wild-type.............................. 43

3-13 C CD 7 expression in m ax3-10 .............................................................. .............. 44

3-14 IAA and ABA content within max4-10 rosettes compared to wildtype (Ws)......... 46

4-1 Proposed activity of C C D 8.................................... ........................ .............. 48

4-2 Import of in vitro transcribed and translated CCD8 precursor protein ................... 48

4-3 Time monitored plastid import assay with CCD8 ........................................... 49

4-4 Expression pattern of CCD8 as determined by Real time PCR............................. 50

4-5 Positions of T-DNA insertions within CCD 8 ....................................................... 53

4-6 Schematic of T-DNA region of vectors used for transformation to create the Alpha
population from University of Wisconsin and the Syngenta population ............. 53

4-7 Autoradiograph of Southern blot analysis of max4 plants ............................... 55

4-8 Phenotypes of max4-6 plant compared to wild-type (Col)............................... 57

4-9 IAA and ABA content in max4-6 rosettes compared to wild-type (Col)............. 58

5-1 Analysis of ccdlmax4 double m utant............................................... .............. 62

5-2 Analysis of max3max4 double m utant.............................................. .............. 64

5-3 Effect of loss-of-function mutants on transcript abundance of all three CCDs....... 66
















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

THE CAROTENOID CLEAVAGE DIOXYGENASES OF ARABIDOPSIS THALIANA

By

Michele Elena Auldridge

December 2004

Chair: Harry J. Klee
Major Department: Plant Molecular and Cellular Biology

Dioxygenases are critical players in essential metabolic pathways in both plants and

animals. Several subclasses of dioxygenases exist, one of which is the recently

discovered Carotenoid Cleavage Dioxygenase (CCD) family that has been most studied

in the plant species Arabidopsis thaliana. Arabidopsis has nine CCDs, identified

because of their similarity to the maize VP14 enzyme. VP14 was the first CCD cloned

and is involved in the production of the phytohormone abscisic acid. Five of the

Arabidopsis dioxygenases are involved in ABA biosynthesis. The remaining four family

members seem less likely to be involved in ABA biosynthesis because of their sequence

divergence from VP14.

Here, three of the Arabidopsis CCDs, CCD], 7 and 8, were characterized

biochemically and genetically. In vitro assays have confirmed the identification of CCD 1

and CCD7 as carotenoid dioxygenases by demonstrating their capacity to cleave a variety

of carotenoids. CCD8 possesses activity on one of the apocarotenoids resulting from









CCD7's activity on (3-carotene. Despite its confirmed activity on carotenoids, CCD1 was

not localized to the plastid, whereas CCD7 and CCD8 were plastid localized. Loss-of-

function mutants were isolated for each CCD studied and their associated phenotypes

were analyzed. The CCD1 mutants showed a decrease in petiole and leaf blade lengths

but were like wild-type in all other aspects of growth and development. CCD7 and

CCD8 mutants exhibited identical phenotypes consisting of decreased petiole and leaf

blade lengths and an increased branching pattern, found to be independent of the

synthesis of auxin and abscisic acid (ABA). CCD7 and CCD8 are involved in the

biosynthesis of a novel signaling molecule, which controls branching in Arabidopsis.

The signaling molecule has not yet been identified but is derived from a carotenoid

backbone by the sequential action of CCD7 and CCD8 activity.















CHAPTER 1
INTRODUCTION

Carotenoid Cleavage Dioxygenase Family

Recently a new class of dioxygenases, Carotenoid Cleavage Dioxygenases (CCD),

was discovered, with representatives found in both the plant and animal kingdoms. The

first gene encoding a carotenoid cleavage dioxygenase was isolated from the maize

abscisic acid deficient, viviparous mutant, vp]4. VP14 encodes a CCD that catalyzes the

first step in abscisic acid (ABA) biosynthesis. ABA is a plant hormone necessary for

resistance to drought and is also involved in dormancy such that mutants which lack

appropriate ABA concentrations and/or sensitivity to ABA germinate precociously

(Finkelstein et al., 2002). The members of this new family of dioxygenases share several

characteristics: they contain five conserved histidines spread throughout their primary

protein sequence, they all require Fe2+ ions thought to be coordinated by the five histidine

residues (Schwartz et al., 1997; Kiefer et al., 2001; Redmond et al., 2001), and they all

contain a conserved polypeptide segment at their carboxy terminus that minimally

constitutes a signature sequence for the family (Fig. 1-1A) (Redmond et al., 2001).

Mechanistically, all CCDs of plant and animal origin are presumed to act similarly in that

they incorporate both oxygen atoms from molecular oxygen into their substrates across a

double bond resulting in the production of two aldehyde-containing cleavage products.

The double bond broken is that of a carotenoid molecule and the resulting products are

aldehyde-containing terpenoid compounds, called apocarotenoids.










HsDIOXI
HsDIOXII
AtCCD8
HsRPE65
AtCCD1
AtCCD7
AtNCED3


A.








B.



L





Cs.



AtCCD4





LeCCD7





AtCCD7


EDEGVLI
IElDG
EY


ZmVP14
AtNCED6 .., AtNCED2


HsRPE65


HsDIOXII


Figure 1-1 The Carotenoid Cleavage Dioxygenase (CCD) family. A) Conserved region
at the carboxy terminus of all CCD family members. Four members from
Arabidopsis (CCD1, NCED3, CCD7, and CCD8) and three from human ([3-
dioxl, P3-dioxII, and RPE65) are shown. B) Phylogenetic tree of
representative members from maize, avocado, bean, crocus, rice, pea, petunia,
tomato and human. All Arabidopsis members (underlined) identified to date
are shown. Alignment and phylogenetic tree were created with ClustalX and
TreeView. Numbers at major nodes of tree are bootstrap values out of 1000
bootstrap trials and represent a confidence level for each grouping.









CCDs have been found in several plant species including tomato (Burbidge et al.,

1999; Simkin et al., 2004a), bean (Qin and Zeevaart, 1999), cowpea (luchi et al., 2000),

avocado (Chernys and Zeevaart, 2000), bixa (Bouvier et al., 2003a), crocus (Bouvier et

al., 2003b), and petunia (Simkin et al., 2004b). They have also been identified in

drosophila, mouse, zebrafish and humans (von Lintig and Vogt, 2000; Kiefer et al., 2001;

Redmond et al., 2001; Lindqvist and Andersson, 2002). Arabidopsis thaliana is a

representative species for study of the CCD family because the entire family has been

identified and many members have been well characterized both genetically and

biochemically (Schwartz et al., 2001; Tan et al., 2003; Booker et al., 2004). Based on

sequence homology to VP14, nine putative CCDs have been identified in the Arabidopsis

genome. Figure 1-1B shows a phylogenetic tree containing the Arabidopsis CCDs. This

tree illustrates the divergence found within the Arabidopsis CCD family. Five of the

members group with the maize protein VP14, whereas the remaining four members are

less similar to VP14. The CCD family members in Arabidopsis are listed in Table 1-1

along with their accession numbers, chromosome locations, and gene identifications. The

family is divided into two groups, the carotenoid cleavage dioxygenases (CCDs) and the

Table 1-1. The CCD Gene Family of Arabidopsis
Gene Accession Chromosome Gene ID
AtCCD1 AJ005813 3 At3g63520
AtNCED2 AL021710 4 At4gl8350
AtNCED3 AB028617 3 At3gl4440
AtCCD4 AL021687 4 At4gl9170
AtNCED5 AC074176 1 Atlg30100
AtNCED6 AB028621 3 At3g24220
AtCCD7 AC007659 2 At2g44990
AtCCD8 AL161582 4 At4g32810
AtNCED9 AC013430 1 Atlg78390









9-cis-epoxycarotenoid dioxygenases (NCEDs). These designations refer to the substrate

preference of the enzyme.

In this work, three members (CCD1, CCD7, and CCD8) of the CCD family in

Arabidopsis are studied both molecularly and genetically. These three members were

chosen for study because of their significant divergence from the remaining members in

gene structure and sequence homology to VP14 (Table 1-2). CCD4 was originally

thought to belong to the NCED subgroup in the CCD family mostly due to its gene

structure and was not included in the present study. However, recent biochemical studies

show that it belongs to the CCD subgroup (see Activity section in this chapter).

Table 1-2. Comparison of the CCD and NCED gene structures and identities to VP14.
Family Member Intron # % Identity to VP14
AtCCD1 13 37
AtNCED2 0 64
AtNCED3 0 67
AtCCD4 0 41
AtNCED5 0 66
AtNCED6 0 57
AtCCD7 5 21
AtCCD8 5 26
AtNCED9 0 67

Carotenoids

The dioxygenases discussed here use carotenoids as substrates. Therefore, a brief

discussion on carotenoid biosynthesis, function, and location within the cell is

appropriate. Carotenoids are C40 compounds, with a series of conjugated double bonds,

produced in the plastids of plants. The condensation of two geranylgeranyl diphosphate

molecules to form phytoene is the first committed step in the carotenoid biosynthetic

pathway (Fig. 1-2). Geranylgeranyl diphosphate is a C20 compound formed from the

sequential addition of three molecules of the 5 carbon compound isopentenyl












Phytoene Pds


S-carotene Zds


6-" Lcy-e Lycopene N* Lcy-b '* Cyc-B



6-Carotene Lcy-b y-Carotene Lcy-b Cyc-B



SCrtR-b
a-Carotene I
(CrtR-e) OH !-Carotene ^ CrtR-b OH


HO HO
Lutein Ze.i..Htn, Zepi Vde OH


HO
Antheraxanthin
Zep1 Vdel


HO
Violaxanthin Nxs


OH
HO OH
Neoxanthin

Figure 1-2. Carotenoid biosynthetic pathway. Abbreviations are as follows; Pds,
phytoene desaturase; Zds, -carotene desaturase; Lcy-e, lycopene e-cyclase;
Lyc-b, lycopene P3-cyclase; CrtR-b, p-ring hydroxylase; CrtR-e, e-ring
hydroxylase;, Zep1, zeaxanthin epoxidase; Vdel, violaxanthin de-epoxidase;
Nxs, neoxanthin synthase Adapted from (Hirschberg, 2001).

pyrophosphate (IPP) to its isomer dimethylallyl diphosphate (DMADP). IPP is the basic

component of all isoprenoid compounds, including such diverse plant metabolites as

cytokinins, chlorophylls, gibberellins, sesquiterpenes and sterols (Cunningham and Gantt,

1998). There are two pathways leading to the synthesis of IPP, the cytosolic

acetate/mevalonate (MVA) pathway and the plastid localized 1-deoxy-D-xylulose-5-

phosphate (DOXP) pathway. In higher plants, sterols and sesquiterpenes are made up of









IPP molecules formed via the MVA pathway in the cytosol, whereas carotenoids,

cytokinins, chlorophylls and gibberellins consist of IPP molecules formed via the DOXP

pathway in the plastid (Lichtenthaler, 1999).

The formation of phytoene is followed by several desaturation steps, resulting in

synthesis of the linear carotenoid lycopene. The cyclic carotenoids are produced through

the sequential cyclization of lycopene's ends. Some carotenoid molecules contain

oxygen as a consequence of subsequent hydroxylation and/or epoxidation reactions.

These carotenoids are called xanthophylls. It has been hypothesized that the enzymes

involved in carotenoid biosynthesis are part of a multi-enzyme complex associated with

the thylakoid membrane (Cunningham and Gantt, 1998). A multi-enzyme complex

would allow for concomitant regulation of the pathway, with each of its components

being dependent on functional operation of the other components. This also would

decrease the substrate available for degradation if, once the carotenoid precursors are fed

into the complex, they do not emerge until formed into the carotenoid dictated by the

final enzyme. If this were so, the substrates available for cleavage by dioxygenases

would be tightly regulated.

Carotenoids have two main functions in photosynthesis. Because of their system of

conjugated double bonds, they are able to absorb energy from photons. The number of

double bonds dictates the maximum absorption of the carotenoid molecule. The

absorption maxima range from 400 to 500nm. Carotenoids are able to absorb energy

from sunlight and pass it on to nearby chlorophyll molecules to be used in

photosynthesis. In this way, they act as accessory pigments to chlorophyll and are part of

the light harvesting complexes associated with the photosystems within the thylakoid









membranes. They are also able to accept energy from excited triplet state chlorophyll

molecules. If carotenoids were not present to receive this energy from the overly excited

chlorophyll molecules, formation of singlet state oxygen radicals could result (van den

Berg, 2000). Depending on the light environment, it may be necessary to adjust the

carotenoid content of the photosystems. CCDs may degrade photosynthetic carotenoids

in order to achieve the optimal carotenoid content necessary for a particular light

environment.

Carotenoids are also thought to function as membrane stabilizers. In general the

thylakoid membranes are fairly fluid. This fluidity allows movement of the photosystems

and light harvesting complexes, which is essential for maximizing photosynthesis and

minimizing photo-oxidative damage in different light conditions. Most carotenoids

found within the thylakoid membranes are associated with the light harvesting

complexes. However, there are some carotenoids that are not, and may instead act to

rigidify the thylakoid membrane. High solar irradiances are usually associated with

increased heat. An increase in temperature can cause disorganization of lipid bilayers,

allowing for breakdown of protein complexes such as those found in the photosystems

and light harvesting complexes. Therefore, an increase in the concentration of stabilizing

carotenoids in membranes could protect the thylakoid membranes during periods of

increased solar irradiance. One carotenoid implicated in this process is zeaxanthin. With

its polar hydroxyl groups at each end of the molecule, zeaxanthin inserts itself almost

perpendicular to the thylakoid membrane, acting to decrease membrane fluidity (Havaux,

1998). A possible function of carotenoid cleavage dioxygenases in regulating membrane

fluidity could be envisioned. In vitro, all-trans-zeaxanthin is a possible substrate for









AtCCD1 (Schwartz et al., 2001). The action of a CCD could facilitate the xanthophyll

cycle in zeaxanthin turnover resulting in a quick increase in membrane fluidity.

Localization of the CCDs, not only within the plastid but also in association with the

thylakoid membranes, will be integral in determining whether this function is a

possibility in vivo.

Apocarotenoids

Products resulting from the degradation of a carotenoid at any of its double bonds

are called apocarotenoids. To date, many apocarotenoids and, in some cases, the

dioxygenases responsible for their production have been identified in plants and animals.

Five major sites of cleavage are illustrated in Figure 1-3 by arrows pointing to the 7,8,

9,10, 11,12, 13,14 and 15,15' double bonds of P3-carotene. Alternatively, owing to the

symmetrical nature of carotenoid molecules, cleavage can also occur at the 7',8', 9', 10',

11',12' and 13',14' double bonds. Several examples of apocarotenoids are discussed

below with respect to the carotenoid precursor and the site of its cleavage.


\/ \ \14' 12' ,10' 8'
7 9 11 13 15
8 10 12 14 15'


Figure 1-3. 3-carotene with its major sites of cleavage indicated by arrows.

The most accessible double bonds of P3-carotene to cleavage are numbered in

Figure 1-3. However in linear carotenoids such as lycopene the 5,6 (5',6') double bond is

open for attack by a dioxygenase. Such is the case for the reaction at the start of bixin

biosynthesis (Bouvier et al., 2003a). Bixin is an apocarotenoid that is a valued food

colorant. Cleavage at the 7,8 (7',8') double bond of zeaxanthin leads to the production of









safranal, the most abundant constituent of saffron flavor (Bouvier et al., 2003b). Cyclic

C13 apocarotenoids result from cleavage at the 9,10 (9', 10') double bond of carotenoids

with cyclized ends. Due to their volatile nature, these C13 apocarotenoids are constituents

of the flavor and aroma of various fruits and vegetables. They include ionone derivatives

(found in rose, tomato, tea), theaspirone (found in tea), and a-damascenone (found in

wine, rose, tomato) (Winterhalter and Rouseff, 2002). Interestingly, 8-ionone, formed by

cleavage of 8-carotene, has been shown to have antifungal activities (Fester, 1999).

Asymmetric cleavage of a carotenoid molecule at its 9,10 double bond produces both C13

and C2 apocarotenoids. An example of a C2 apocarotenoid is the biologically active

retinoic acid. In animals, retinoic acid regulates gene expression through its binding to

two types of nuclear receptors, retinoic acid receptors (RARs) and retinoid X receptors

(RXRs) (Mangelsdorf et al., 1993). In plants, cleavage at the 11,12 position (or 11',12'

depending on carotenoid substrate) of 9-cis epoxycarotenoids produces xanthoxin, which

is the precursor to the plant hormone ABA (Schwartz et al., 1997; Tan et al., 1997).

Apocarotenoids resulting from cleavage at the 13,14 (13',14') double bond have not been

reported. However, further cleavage of an apocarotenoid at this double bond was

demonstrated for the Arabidopsis CCD8 enzyme (For further details, see next section as

well as Chapter 4). Finally, central cleavage at the 15,15' double bond breaks the

carotenoid molecule in half. With B3-carotene as a substrate, central cleavage gives rise to

two molecules of retinal (C20). Retinal interacts with the protein opsin in the eye and acts

as the visual chromophore making vision possible (Saari, 1994).









Carotenoid Cleavage Dioxygenase Activity in Arabidopsis

The members of the CCD family in Arabidopsis share the sequence characteristics

found in all CCDs but they diverge into two groups, the NCEDs and the CCDs, based on

their characterized or inferred substrate preference. The acronym NCED refers to the

substrate, 9-cis-epoxycarotenoid, which is the preferred substrate for these dioxygenases.

Figure 1-4 summarizes the enzymatic activity associated with all of the Arabidopsis

CCDs.

VP14 belongs to the NCED group. It acts specifically at the 11,12 double bond of

either of two 9-cis-epoxycarotenoids, violaxanthin or neoxanthin, to produce xanthoxin,

the precursor to ABA (Schwartz et al., 1997). Four of the nine Arabidopsis dioxygenases

(NCED2, NCED3, NCED6, and NCED9) have been shown to possess the same activity

as VP14 and are designated NCEDs (luchi et al., 2001). NCED5 displays high sequence

homology to VP14, however its activity has yet to be determined. The remaining four

proteins diverge from the family and have been given the general designation of CCD.

Two of the CCDs, CCD1 (see Chapter 2) (Schwartz et al., 2001) and CCD7 (see Chapter

3) (Booker et al., 2004), have been shown to cleave various substrates. They do,

however, cleave their substrates specifically at the 9,10 double bond. They differ in that

CCD1 cleaves its substrates symmetrically, whereas CCD7 cleaves asymmetrically

(Schwartz et al., 2004). For example with P3-carotene as a substrate, CCD1 produces two

C13 products (both P3-ionone) and one central C14 dialdehyde. Conversely, CCD7

produces one P3-ionone product and the C27 product, 10'-apo-3-carotenal. A possible

explanation for this distinct set of cleavage reactions is that CCD1 acts as a dimeric

protein (Schwartz et al., 2001). CCD4 has yet to be biochemically characterized.









However, apocarotenoids such as 6-methyl-5-heptene-2-one have been found in tomato

(Baldwin, 2000) and apple (Cunningham, 1986). These apocarotenoids result from

cleavage at the 5,6 double bond. CCD4 orthologs may be the CCDs responsible for the

production of these volatile apocarotenoids (B.C. Tan, personal communication). CCD8,

along with CCD7, is involved in the synthesis of a biologically active compound (See

NCED2
NCED3
NCED5
0 H5 A 0 NCED6
HO H NCED9

or 1 HO O CHO COoH
S HO X.mli',',in Abscisic aldehyde ABA


0


CCD1


1-0


P-ionone C14 dialdehyde p-ionone


P-carotene


CCD7
3-ionone


o Y. CCD8

10' -apo-p-carotenal C9 Dialdehyde


Lycne CCD4

Lycopene


0

I O'-apo-pI-carotenal


0 -

I 3'-apo-f3-carotenal


6-methyl -5-heptene-2-one


Figure 1-4. Activity of the Arabidopsis CCD family members, showing their divergence
in substrate specificity and cleavage site (indicated by small arrows). The
NCEDs all cleave 9-cis-epoxycarotenoids at the 11,12 double bond, where as
CCD1 and CCD7 cleave a variety of substrates (P3-carotene is shown as a
representative substrate) at the 9,10 (and/or 9' 10') double bond. CCD8
cleaves the C27 product of CCD7's activity on P3-carotene at the 13,14 double
bond. The activity of CCD4 is unknown, however CCD4 has been
hypothesized to be the unidentified 5,6 cleaver.


9-ci.,-% ioL."111111 III









Chapters 3 and 4). The compound has not been identified but CCD8 does show cleavage

activity on the C2 cleavage product resulting from the activity of CCD7 on (3-carotene

(Schwartz et al., 2004).

In Summary

Carotenoids are essential plant pigments. They act as both accessory pigments to

increase the harvested light used for photosynthesis and as antioxidants to protect the

components of the photosystems from oxidative damage (van den Berg, 2000). The

catabolism of carotenoids leads not only to regulation of the above mentioned processes

but also to the production of secondary metabolites, which may have equally important

functions in the plant. These apocarotenoids include the biologically active compounds

ABA, retinal and its derivatives, and 8-ionone. Although apocarotenoids are important

metabolites in plants, animals and bacteria little is known about the mechanisms involved

in their production.

Arabidopsis provides an excellent model system for the study of genes whose

products are involved in the production of apocarotenoids. Of the nine carotenoid

cleavage dioxygenases identified in Arabidopsis, five have been linked to ABA synthesis

(Iuchi et al., 2000; Tan et al., 2003) and one to the production of C8 apocarotenoids (B.C.

Tan, personal communication). The remaining three family members are studied here.

The following three chapters discuss the characterization of CCD1, CCD7, and CCD8,

respectively. Within each chapter the following topics will be discussed: 1) enzymatic

activity of the CCD, either previously determined or elucidated in this study; 2)

subcellular, and when appropriate suborganellar, localization of the protein product; 3)

analysis of the CCD expression pattern on a whole plant level and as a consequence of






13


exertion of environmental stimuli such as water stress or day length; and 4) the effect of

loss of CCD function on plant development, metabolism, and growth. The subsequent

chapter deals with the genetic and molecular interaction of all three CCDs studied and is

followed by a discussion on results presented.














CHAPTER 2
CAROTENOID CLEAVAGE DIOXYGENASE 1 (CCD1)

Activity

The Arabidopsis CCD1 cleaves a variety of carotenoid substrates (Schwartz et al.,

2001). CCD1 is, however, specific in regard to the site of cleavage, which always occurs

at the 9,10 (9', 10') double bond irrespective of substrate. This activity was determined

both in vitro with a recombinant CCD1 enzyme and in vivo by way of a heterologous E.

coli based system (also used for CCD7, see Chapter 3). As an example of its activity, the

use of P3-carotene as a substrate produces two molecules of the cyclic C13 compound, P3-

ionone, and an acyclic C14 dialdehyde, which corresponds to the central portion of the

carotenoid molecule (Fig. 2-1). The C4 dialdehyde accumulated in the reactions

involving CCD1, indicating that it may act as a dimer cleaving both ends simultaneously

(Schwartz et al., 2001).


/ | I |14' 12' ,10' 8'
&?7 9 11 13 15
| 8 10 12 14 15'


CCD1
0 ,JT


0
2 3 2
Figure 2-1. CCD1 activity with P3-carotene as a substrate. CCD1 cleaves at the 9,10 and
9',10' double bonds of all its substrates. In the case of P3-carotene (1), this
activity produces two molecules of P-ionone (2) and a C14 dialdehyde (3).









Subcellular Localization

The enzymes responsible for carotenoid biosynthesis are located within plastids

(Cunningham and Gantt, 1998). Due to their hydrophobic nature carotenoids once

synthesized for the most part remain in the plastid. Because CCD1 possesses carotenoid

cleavage activity, the possible localization of CCD1 within the plastid was determined.

Proteins destined for the plastid typically contain a sequence at their amino terminus

called a transit sequence. The protein with its transit sequence attached is a preprotein.

Soluble factors within the cytoplasm recognize the transit sequence and chaperone the

preprotein to the outer membrane of the plastid. Translocation machinery on both the

inner and outer membranes of the plastid inserts the preprotein into the plastid stroma. If

the preprotein possesses a cleavable transit peptide, then it is processed into the mature

protein by removal of the transit sequence. The mature protein can either remain in the

stroma or it can be targeted to the thylakoid, or inner, or outer membranes (Soll and

Schleiff, 2004). Although strong conservation in transit sequences does not exist, with

the use of computer algorithms a set of general characteristics make it possible to

theoretically predict the targeting of a protein into the plastid. CCD 1 does not possess a

plastid transit sequence, as predicted by the chloroplast prediction program TargetP (v

1.0) (Emanuelsson et al., 2000). In order to experimentally determine the subcellular

localization of CCD 1, chloroplast import assays were performed following the procedure

of Cline et al. (Cline et al., 1993). Briefly, following in vitro transcription and

translation, the precursor proteins were incubated with isolated pea chloroplasts. After

import reactions, intact chloroplasts were treated with the protease, thermolysin. Import

into the plastid would protect the proteins from degradation by thermolysin. No import









would allow thermolysin to come into contact with the proteins thus degrading them. The

small subunit of ribulose 1,5-bisphosphate carboxylase/oxygenase (ssRubisco), known to

be targeted to the chloroplast stroma, was used as a control for import. VP14, the maize

NCED, is also chloroplast localized and served as a second comparison. Previously,

VP14 was localized to the stroma and, to a lesser extent, associated with the thylakoid

membrane (Tan et al., 2001). CCD1 was not imported into the plastid as indicated by its

sensitivity to thermolysin treatment (Fig. 2-2). In contrast, both VP14 and ssRubisco

were resistant to thermolysin, confirming their import into plastids.

VP14 CCDI ssRub
pP +T pP +T pP +T
















Figure 2-2. Import of in vitro transcribed and translated CCD1 precursor protein (pP) into
pea chloroplasts compared with ssRubisco (ssRub) and VP 14. Following
import, chloroplasts were treated with thermolysin (+T).

Expression Analysis

Although transcript expression does not equate with protein accumulation, it does

provide information regarding the regulation of the gene in question, whether this be

developmental, morphological or as a consequence of external stimuli. An expression






17


analysis of CCD1 transcript was performed by a quantitative Real Time RT-PCR method,

using Taqman primers and probes. First, the major organs of wild-type Arabidopsis


Blade

Petiole


(Root)


Flower







Primary
Stem


Silique





Lateral
Stem

Secondary
Stem


Figure 2-3. Organs of wild-type Arabidopsis used in morphological expression analysis.
RNA was extracted from petioles, leaf blades, and roots before bolting.
Flowers, siliques, primary and secondary stems were harvested after bolting.

2 00E-03 -


1.50E-03


I OOE-03


5.00E-04


O.OOE+00


2 N
0
V


Figure 2-4. Expression pattern of CCD1 as determined by quantitative Real Time RT-
PCR. Data represented as % mRNA after comparison to a standard curve of
known quantity. Bars represent standard deviation of the mean.


rn


I i -











plants, Columbia ecotype (Col), were dissected and CCD1 transcript abundance within

each was measured. These organs included root, petiole, leaf blade, primary stem,


secondary stem, lateral stem, flower, and silique (Fig. 2-3). CCD1 transcript was present

in all organs tested and accumulated to a greater extent in siliques and flowers (Fig. 2-4).


To explore the possible effect of CCD function on ABA-related processes, the

effect of drought stress on CCD1 expression was examined. An increase in expression of


all NCEDs was seen following water stress with NCED3 showing the most prominent

increase (Tan et al., 2003). The importance of NCED3 in drought stress tolerance was


underlined by the observation that transgenic plants lacking NCED3 function were more

sensitive to drought stress than wild-type (luchi et al., 2001). From activity data CCD1


does not appear to be involved in ABA biosynthesis; however, its expression may be

regulated in a drought dependent manner in order to provide more substrates to the


NCEDs for ABA production. A water stress was applied to wild-type seedlings by

allowing them to lose 15% of their fresh weight. CCD1 expression did not change


significantly as a result of the water stress (Fig. 2-5).


1 20E-03

I OOE-03

S OOE-04

6 OOE-04

4 OOE-04

2 OOE-04

0 OOE+00
NS S


Figure 2-5. Changes in CCD1 expression due to water stress. CCD1 expression ( S.E.)
found in nonstressed seedlings (NS) and stressed seedlings (S).









Loss-of-Function Mutants

Isolation of Mutant

The function of CCD 1 in plant development, metabolism, and growth may be

inferred by observations of the effect of its functional loss. A reverse genetics approach

was taken to reach this end by isolating insertional mutants from the Wisconsin Knock-

out Population (Krysan et al., 1999) and Syngenta's SAIL population (Sessions et al.,

2002). See Materials and Methods (Chapter 7, Isolation of loss-of-function mutants) for

further discussion on populations and screening process. The insertional mutant from the

Wisconsin Knock-out Population was lost during the screening process. However, a

mutant was successfully obtained from the SAIL population. The site of insertion of the

T-DNA within CCD1 was verified by first cloning then sequencing the junction. A

schematic showing the site of insertion in the 6th intron of CCD1 is shown in Figure 2-6.

As the only CCD1 loss-of-function mutant isolated this allele was designated ccdl-1.

ccdl-1 (Syngenta)

ATG TAA
2956 bps

Hindlll(+73) Xbal(+ 1122) BglIIl(+2062)

Figure 2-6. Location of T-DNA insert in CCD1. Exons are represented by black boxes
and introns by intervening lines. The T-DNA insert (inverted triangle) was
verified to be within the 6th intron of CCD1. Restriction enzymes used for
Southern analysis are shown (see below).

Two transformation vectors were constructed for creation of the SAIL population.

The pCSA 110 vector was used in the transformation event that resulted in ccdl-1. The

T-DNA present within this vector carries the BAR gene for resistance to BASTA, a GUS

reporter gene driven by the pollen-specific promoter LAT52, and left and right borders










for transformation with Agrobacterium tumefaciens (Fig. 2-7) (McElver et al., 2001).

Plants homozygous for the insert were identified by PCR (See Chapter 7, Isolation of

loss-of-function mutants). In order to determine T-DNA number within ccdl-1 plants,

DNA from plants homozygous for the T-DNA insertion was extracted and digested for

Southern blot analysis using a cloned BAR cDNA as the probe (Fig. 2-8). The following

restriction enzymes were chosen for digestion of genomic DNA; BglII, XbaI, and

HindIII. Each of these enzymes cuts within the T-DNA but outside of the BAR coding

region. Therefore, one band on the Southern indicates a single insertion, two bands

indicates two insertions, and so on. Three bands were visible on the autoradiograph in

the regions corresponding to lanes containing DNA digested with BglII or HindIII

indicating three insertions. Digestion with XbaI resulted in one band. This band was of

greater intensity than the bands seen in the other lanes possibly as a result of co-migrating

pieces of DNA but cannot be interpreted definitively. The Southern analysis indicates the

presence of three T-DNA inserts within ccdl-1 plants.

Bglll
Xbal

ccdl-1


LB 35S-BAR pBluescript II LAT52pro-GUS RB p)

Figure 2-7. Schematic of T-DNA used for transformation to create SAIL population.
Locations of restriction enzymes used in Southern analysis of ccdl-1 are
shown.

Morphological Analysis of ccdl-1

All mutants from the SAIL population are in the Col ecotype background so all

measurements of ccdl-1 were compared to Col plants. Both Col and ccdl-1 seeds were

planted in soil and grown in short days. Plants were grown until their rosettes











Col ccdl-1 ccd8-2













-I.,-
-ioi






















Figure 2-8. Autoradiograph of Southern blot analysis of ccd]-] plants. Wild-type (Col)
was used as a negative control. Molecular weight markers are shown at left.
Enzymes used for digestion are indicated at top. Three T-DNA inserts were
found in ccd]-] plants. DNA from ccd8-2 were done on same blot, see
Chapter 4.

contained 30-37 leaves at which time measurements of petiole and leaf blade length were

taken from the 13th through the 22nd leaf. The ccd] -1 rosettes prior to bolting were

smaller than Col (Fig. 2-9). An average of the 13th through the 22d leaf (Wild-typ S.E.)

produced data showing ccdl-1 petioles were significantly shorter than Col (17.80 0.35

vs. 19.58 +0.48, ANOVA P-value = 0.003), whereas leaf blades were not (21.27 0.40
























Wild-type ccdl-1


Figure 2-9. Wild-type (Col) and ccdl-1 rosettes before bolting. Plants were grown in
short days until a leaf number of 30-37 was reached. ccdl-1 rosettes were
smaller than wild-type.

vs. 22.38 +0.56, ANOVA P-value = 0.136). The significant decrease in petiole length

was intriguing as CCD1 transcript was found to accumulate in petiole tissue (Fig. 2-4).

However, upon further review of the measurements both petioles and leaf blades were

only smaller than wild-type in the 13th through 16th leaves. The petiole and leaf blade

lengths in ccdl-1 plants increases incrementally from leaf 17 to leaf 22 (Fig. 2-10).

Plants were allowed to continue growing in short days until they made the transition to

flowering. Infloresence number was counted two weeks following emergence of the

primary inflorescence. The inflorescence number of ccdl-1 plants equaled that observed

in wild-type plants (1 _0.0).

P3-ionone Content of ccdl-1

CCD1 cleaves several carotenoids at their 9,10 double bonds. This activity was shown

with the recombinant enzyme in vitro as well as in a heterologous E. coli based system

(Schwartz et al., 2001). However it has not yet been demonstrated within the plant.












30.0
A



200 -
E
*Owt
F, 0 ccd] I

100 -- --




0.0
30.o0
B




200 0


iI ... 1l*w

100





0.0
13 14 15 16 17 18 19 20 21 22
# Leaf


Figure 2-10. Petiole and leaf blade lengths of wild-type (Wt) vs. ccdl-1 plants. Blade
and petiole lengths ( S.E.) of ccdl-1 were on average smaller than wild-type
from leaf number 13 to 16.


The loss-of-function mutant was used to address this issue by determining if loss of a


predicted product formed due to CCD 1 activity corresponded to a loss in CCD 1 function.


The product chosen for measurement was P-ionone. CCD 1 activity produces two


molecules of P-ionone after cleavage of P-carotene at its 9,10 double bonds (Schwartz et


al., 2001). P3-ionone is a volatile apocarotenoid and as such is thought to be a major


constituent of flavor in fruits and vegetables (Winterhalter and Rouseff, 2002). Because


of its volatile nature, 3-ionone is easily detected by gas chromatography/mass









spectrometry (GC/MS). A method was developed for the extraction and detection of [3-

ionone from Arabidopsis plants (see Chapter 7, P3-ionone Measurements).

P3-ionone was found in very small quantities (ng/g tissue) within Arabidopsis

rosettes therefore several trials were performed to get an accurate picture of P3-ionone

production within the plants. Trials consisted of plants grown several months apart but in

similar controlled environments. Trial 1 showed a significant decrease in P3-ionone

within ccdl-1 plants as compared to Col. Trial 2 only showed a slight, non-significant

decrease in P3-ionone within ccdl-1 plants and finally trial 3 showed no change in P3-

ionone within ccdl-1 plants (Fig. 2-11). The overall increase seen in Trial 2 plants

compared to the other trials may be the result of a fungal gnat infestation within the

growth chamber at that period. Increases in P3-ionone production have been linked to

pathogen infection (Wyatt, 1992). The ccdl-1 plants in all trials show accumulation of P3-

ionone indicating the existence of a second CCD responsible for P3-ionone production.

CCD7 (see Chapter 3) does posses cleavage activity at the 9,10 double bond of P3-

carotene (Booker et al., 2004; Schwartz et al., 2004). Although, not experimentally

tested in the present study, CCD7 may be regulated such that its levels increase during

pathogen infection. Presently, no antibody for CCD1 has been developed therefore the

existence of a partially functional CCD1 cannot be overlooked. However, a truncated

protein of only 192 amino acids would be possible due to the T-DNA insertion site within

CCD1.

Determination of Abscisic Acid Content within ccdl-1 Plants

As a member of the CCD family, CCD1 has sequence homology to VP14, the ABA

biosynthetic enzyme from maize. In vitro, CCD1 does not posses the same activity as











8.00

7.00

6.00

5.00
M Col
4.00

~3.00

2.00

1.00

0.00
Trial 1 Trial 2 Trial 3


Figure 2-11. (3-ionone levels within wild-type (Col) and ccdl-1 plants measured in three
trials. Bars represent standard error of the mean.

VP14 or the Arabidopsis NCEDs. It is unlikely that CCD1 function would have an affect

on ABA production. However, the carotenoid substrates of CCD 1 are metabolically

linked to the carotenoid precursors of ABA in that the carotenoid precursors to ABA are

possible CCD1 substrates (Schwartz et al., 2001). For example, a link between the auxin

and glucosinolate biosynthetic pathways was discovered after a lesion in the

glucosinolate pathway (at CYP83B 1) not only resulted in loss of glucosinolates but also

plants with auxin overexpression phenotypes (Bak et al., 2001). In a second more

unfortunate example, researchers attempting to increase carotenoid content in tomatoes

found that their transgenic plants were dwarfed due to a decrease in gibberellin synthesis.

Carotenoids and gibberellins share a common precursor in geranyl-geranyl diphosphate

such that changes through the carotenoid biosynthetic pathway affected flux through the

gibberellin pathway (Fray, 1995). To determine the effect of loss of CCD1 function on

ABA biosynthesis, ABA content in ccdl-1 plants was determined. No alteration in ABA

content was seen in the ccdl-1 plants (Fig. 2-10).











7.00

600

5.00

4.00

3.00

1.00

1.00

0.00
Col ccdl-1


Figure 2-10. ABA content in ccd]-1 vs wild-type (Col) rosettes. Bars represent standard
error of the mean.

In Summary

CCD1 possesses cleavage activity at the 9,10 (9',10') double bond of a variety of


carotenoids (Schwartz et al., 2001). Its role in carotenoid catabolism is intriguing

because it was not targeted to plastids, the major site of carotenoid accumulation. How


CCD1 comes into contact with carotenoids is a further point of study. CCD1 may

interact with the plastid outer envelope or may have access to carotenoids only during


chloroplast degeneration. The high CCD1 transcript abundance in flower tissue suggests

a biological function because P3-ionone, a product of CCD1 cleavage activity on P3-


carotene, is a known constituent of floral scent. The involvement of CCD1 in plant


growth is suggested by the decrease in petiole and leaf blade lengths seen in the loss-of-

function mutant. However, a true correlation can only be made after complementation of


the petiole phenotype with a wild-type copy of CCD1 is shown. The ccdl-]:CCDIOE

plants are currently growing. A second on-going experiment concerns the effect of


placing CCD 1 inside the plastid. This experiment may further our understanding on the

localization of CCD 1 outside of the plastid as well as provide information regarding the






27


carotenoid-derived signal found through the analysis of CCD7 loss-of-function mutants

(See Chapter 3 and Chapter 6 for further discussion).















CHAPTER 3
CAROTENOID CLEAVAGE DIOXYGENASE 7 (CCD7)

Activity

Originally designed to identify proteins involved in carotenoid biosynthesis, E. coli

cells engineered to accumulate certain carotenoid molecules have been utilized as a

screen for CCD activity (von Lintig and Vogt, 2000; Kiefer et al., 2001; Redmond et al.,

2001; Schwartz et al., 2001). The foundation for these studies is if a protein metabolizes

a carotenoid substrate then an observable loss of color would occur upon induction of the

protein. The loss of color would be due to metabolism of the accumulating carotenoid

and may correspond with an increase in apocarotenoid production. To determine its

activity, CCD7 was expressed in E. coli engineered to over-express certain carotenoid

biosynthetic genes. The strains utilized in this study accumulated the following

carotenoids: phytoene, ,-carotene, lycopene, 6-carotene, P3-carotene and zeaxanthin

(Cunningham et al., 1994; Cunningham et al., 1996; Sun et al., 1996). The latter four

produced an observable color. However, upon induction of CCD7, color development

was diminished, suggesting metabolism of the carotenoid substrates (Fig. 3-1). In order

to verify this metabolism, carotenoids were extracted from E. coli cultures and analyzed

by HPLC (See Chapter 7, Carotenoid/Apocarotenoid Extraction from E.coli). CCD7

induction resulted in significant decreases in the carotenoid substrates (Fig. 3-2). The

HPLC chromatograms obtained with representative linear (,-carotene) and cyclic ([3-

carotene) carotenoids are shown in Figure 3-3A and B.











UI I UI I UI I UI I





Lycopene 6-carotene P-carotene zeaxanthin


Figure 3-1. E. coli lines accumulating lycopene, 6-carotene, P3-carotene or zeaxanthin.
Lines in which CCD7 expression was induced (I) was compared to those in
which CCD7 was uninduced (UI).


120

100 -

80
| *UI
60 I Trial 1
D I Trial 2
40

20


Phytoene ;-carotene Lycopene 6-carotene P-carotene Zeaxanthin


Figure 3-2. Results from UPLC analysis of carotenoid content in each carotenoid
accumulating E. coli line plus (I) or minus (UI) co-expression of CCD7. Two
trials were performed. Data from each trial is expressed as a percentage of
uninduced samples.

In order to determine the cleavage site within each carotenoid, GC-MS analysis

was used to identify products. Products consistent with cleavage at the 9,10 or 9', 10'

position were identified in strains that accumulated -carotene and P3-carotene. Figure 3-

3C and D show increases in geranyl acetone (the product of -carotene cleavage) and P3-

ionone (the product of P3-carotene cleavage), respectively. Owing to the symmetrical

nature of all of the tested carotenoids, these results do not address whether each substrate

is cleaved symmetrically or asymmetrically. In each case, the small amounts of geranyl

acetone and P3-ionone present in the uninduced cultures is likely due to a low level of









expression of CCD7 prior to induction. These data demonstrate that CCD7 has CCD

activity. Schwartz et al. have since reported on the identification of a C27 apocarotenoid

product resulting from CCD7 activity on P-carotene (Schwartz et al., 2004). Here

researchers reported optimal activity only when 3-carotene was used as a substrate.


Figure 3-3. Analysis of carotenoid cleavage in E. coli expressing CCD7. E. coli
accumulating either -carotene (A,C) or P-carotene (B,D), either uninduced
(top of each panel) or induced (bottom of each panel), were assayed for
catabolism of the carotenoid substrate by HPLC (A,B) and production of
volatile cleavage products by gas chromatography (C,D). Identities of the
indicated volatiles were verified by co-elution with known standards and mass
spectrometry.

These studies corroborate the above finding that CCD7 cleaves at the 9,10 double bond

and further show that this cleavage is asymmetrical by the identification of the C27

apocarotenoid, 10'-apo-p-carotene (Fig. 3-4).


-caroten iV






P-carotene -*


4 j-inone










\ / 14' 122' 11,10'0 8' 7. 1



CCD7


2 3



Figure 3-4. Reaction scheme of CCD7 activity on P3-carotene (1) as demonstrated by
Schwartz et al. (Schwartz et al., 2004). This activity produces P3-ionone (2)
and 10'-apo-p-carotenal (3).

Subcellular Localization

As with CCD1, the subcellular localization of CCD7 was determined. CCD7 was

predicted by TargetP (v 1.0) to be chloroplast localized with a transit peptide of 31 amino

acids. Chloroplast import assays were again performed following the procedure of Cline

et al. (Cline et al., 1993) using the small subunit of ribulose 1,5-bisphospate

carboxylase/oxygenase (ssRubisco) and VP14 as positive controls for import into the

stoma and thylakoid.

Following in vitro transcription and translation, the CCD7 precursor protein was

incubated with isolated pea chloroplasts. After import reactions, intact chloroplasts were

either treated with the protease, thermolysin, or fractionated into envelope, stroma, and

thylakoid compartments. Results show that CCD7 was resistant to thermolysin

treatment, indicating its location inside the chloroplast (Fig. 3-5A). Fractionation of the

chloroplast revealed that CCD7 was localized to the stroma (Fig. 3-5B). In addition, the

reduced size of the imported mature protein indicated the existence of a cleaved transit

peptide. The doublet bands observed may indicate some form of post-import









modification, similar to that observed for several of the Arabidopsis NCED proteins

following import (Tan et al., 2003).

A B
VP14 CCD7 ssRub VP14 CCD7 ssRub
pP +T pP +T pP +T pP E S Th pP E S Th pP E S Th






I O




Figure 3-5. Import of in vitro transcribed and translated CCD7 precursor protein (pP) into
pea chloroplasts compared with ssRubisco (ssRub) and VP14 (A) Following
import, chloroplasts were treated with thermolysin (+T). (B) Chloroplasts
were further fractionated to determine suborganellar localization to the
envelope (E), stroma (S) or thylakiod (Th).

For further verification of plastid localization one additional experiment was

performed. Import assays were done using various incubation times. In vitro transcribed

and translated CCD7 precursor protein was incubated with fresh pea chloroplasts for the

following time periods, 0, 1, 2, 4, 8, 15, and 30 minutes. At each time point in order to

stop further import, cold import buffer was added to the incubation mixtures, which were

then kept in the dark and treated with thermolysin. Figure 3-6 shows that with increasing

incubation time CCD7 was more resistant to thermolysin treatment indicating that more

of the protein was imported into the chloroplast and therefore protected from degradation

by thermolysin.










Incubation time in mins.

pP 0 1 2 4 8 15 30


3 -dm

Figure 3-6. Time monitored plastid import assay with CCD7. In vitro transcribed and
translated CCD7 precursor protein (pP) was incubated with fresh pea
chloroplasts for 0, 1, 2, 4, 8, 15, and 30 mins. Following incubation each
assay mixture was thermolysin treated.

Expression Analysis

CCD7 transcript abundance was measured by quantitative Realtime PCR using

Taqman primers and probes. The tissue used for analysis of expression was dissected in

the same way as described in Chapter 2 (Fig. 2-3) for analysis of CCD1 expression.

CCD7 transcripts were detected throughout the plant. Highest expression was seen in

root tissue followed by primary stem tissue and siliques (Fig. 3-7). Even at its highest,

CCD7 trancript abundance was approximately 50-fold lower than the highest CCD1

expression.

4 00E-05


3.00E-05


2 200E-05


1.OOE-05


0.00E+00 --




Figure 3-7. Expression analysis of CCD7 trancript throughout wild-type Arabidopsis
plants. CCD7 expression was observed in all tissue types at very low levels
and was found mostly in root issue.









As a consequence of a phenotype seen in the loss-of-function mutants in response

to day length (see next section), expression of CCD7 in whole seedlings grown on short

days was compared to seedlings grown on long days. Seedlings were grown for 14 days

on a short day light schedule. On the 14th day, a portion of the seedlings was switched to

a long day light schedule for five more days. The two groups of seedlings were then

compared for any changes in CCD7 expression. No significant change in CCD7

expression was apparent (Table 3-1).

Although even less related to VP14 than CCD1 (see Chapter 1), CCD7 does

maintain some homology to the ABA biosynthetic proteins. Moreover, CCD7 was

shown to have activity on (3-carotene, whose content within the plant may affect the

content of the epoxycarotenoids, the precursors to ABA. Therefore, CCD7 was also

tested for a role in ABA production. As previously stated, all of the Arabidopsis NCEDs

were shown to have increased expression levels in response to water stress (Tan et al.,

2003). In contrast, expression of CCD7 in seedlings was not altered by a water stress

treatment imposed by allowing a 15% loss of fresh weight (Table 3-1).

Table 3-1. CCD7 transcript abundance in whole seedlings (SE).
Treatment % mRNA

Short days 5.57E-06 +2.38E-06
Long days 4.29E-06 1.07E-06

Nonstressed 1.21E-05 0.04E-05
Stressed 1.54E-05 0.25E-05

ANOVA showed results not to be significant at an P-value=0.05









Loss-of-Function Mutants

Isolation of Mutants

Insertional mutants of CCD7 were isolated from the Wisconsin Knockout

population (Weigel et al., 2000) and the Salk population (Alonso et al., 2003). The

alleles were named max3-10 and max3-11, respectively. MAX stands for more axillary

branching. Four independent MAX loci have been identified and are so named due to the

increased number of inflorescences growing out from the axillary meristems of the loss

of function mutants (See next section) (Stimberg et al., 2002; Sorefan et al., 2003;

Booker et al., 2004). MAX3 is CCD7. Nine max3 alleles were identified via an ethyl

methane sulfonate (EMS) screen for auxin-associated phenotypes. The two alleles

isolated here and reported in Booker et al. sequentially follow the allele designations of

the EMS mutants (Booker et al., 2004). The max3-10 allele is in the Wassilewskija (Ws)

background and max3-11 is in the Columbia (Col) background. The insertion sites are

illustrated in Figure 3-8. A primer specific for the left border of the T-DNAs and either a

primer specific for a region just upstream of CCD7's start codon (forward) or a primer

specific for a region just downstream of its stop codon (reverse) were used to amplify the

T-DNA/CCD7 junction sequence. The junction was cloned then sequenced to verify the

T-DNA location within CCD7.

In max3-10, the left border and forward CCD7 primer resulted in a product

approximately 500 bp in length. The resulting sequence showed that the insert is located

within the first exon of CCD7. No product was seen using the T-DNA primer and the

reverse CCD7 primer, indicating that the T-DNA and CCD7 are in the same orientation.

In max3-11, products were obtained when the left border and either forward or reverse

CCD7 primers were used. Subsequent sequencing placed the inserts within 10 bp of each









other. This suggests the existence of two inserts in reverse orientation to each other. The

Salk website used for searching their available insertional mutants illustrates the insert to

be in opposite orientation to CCD7. The CCD7 forward and reverse primers used

appropriately with the left border primers specific to each T-DNA were used to isolate

plants homozygous for the insertion in a segregating population.

The T-DNAs present within each mutant allele are shown in Figure 3-9. The T-

DNA within max3-10 carries a marker for BASTA resistance, four tandemly arranged

enhancer elements, and left and right borders for transformation. This vector was

constructed for use as an activation tag. However, when present inside the coding region

of a gene it is thought to act as a vector for a traditional knock-out approach. The T-

DNA within the max3-11 allele carries a marker for kanamycin resistance as well as

max3-10 (UW) max3-ll (Salk)


2396 bps

HindlII(+1218)
BamHI(+1768)
HindIll(+1568)

Figure 3-8. Location and orientation of T-DNA inserts in CCD7. Exons are represented
by black boxes and introns by intervening lines. Sequencing of the T-
DNA/gene junction showed max3-10 contains an insertion (inverted triangle)
within the 1st exon and max3-11 has two insertions within the 5th intron.
Arrows indicate orientation of T-DNA in reference to CCD7 orientation.
Location of enzymes used in Southern blot analysis are shown.

components required for transformation. To test for T-DNA number within each mutant

the appropriate resistance marker was used as a probe in a Southern blot analysis. The

genomic DNA isolated from homozygous max3-10 plants was digested with BgllI,

HindII, or BamHII and DNA isolated from homozygous max3-11 plants was digested










with HindII, XbaI, or BamHI. The enzymes chosen cut within the T-DNA but outside of

the region used as a probe.

Iglll
indIII
max3-10 BamHI


pSKI015
(6743 bp)
LB 35S-BAR pUC19 4X35S RB

Xbal

max3-ll HindIII BamHI


pROK2
LB NPTII pBIN19 RB (4530 bp)

Figure 3-9. Schematic of T-DNA region of vectors used for transformation to create the
BASTA population from University of Wisconsin (pSKI015) and the Salk
population (pROK2). Location of restriction enzymes used in Southern
analysis of max3-10 and max3-11 are shown. Resistant markers (shown in
blue) were used as probes in Southern analysis.

The wild-type ecotypes were digested and run adjacent to the digestions of each

mutant as a negative control. A single band was observed in the Southern of the max3-10

allele indicating the existence of one T-DNA insert (Fig. 3-10A). Hybridization was

weak and was therefore repeated. The second trial gave the same banding pattern but

was as weak as the first. Two closely migrating bands were observed for each digestion

in the Southern of the max3-11 allele (Fig.3-10B). As suggested by the PCR results

discussed above, Southern blotting indicates that two tandem T-DNA inserts in opposite

orientation are present within max3-11.

Morphological Analysis of max3 Plants

The max3 alleles were grown in soil along with their wild-type counterparts in order to

observe any alterations in growth or morphology as a result of the loss of CCD7 function.












Ws max3-10




Col max3-11




Kb
Kb 10.o- .0-
10.0 -
8.0- 5.0-
6.0-
5.0- 4.0-
4.0- 3.0-
2.5-
3.0-
2.0--
2.5-

2.0- 1.5

11.55-

1.0-

0.8-

1.0-
0.6-

0.8-



0.6-





Figure 3-10. Autoradiograph of Southern blot analysis of max3 plants. Wild-type (Col or
Ws) was used as a negative control. Molecular weight markers are shown at
left. Enzymes used for digestion are indicated at top.


Both mutant alleles exhibited a branching phenotype and appeared dwarfed in their


rosette diameter. These phenotypes were most apparent when grown in short days (Fig.


3-11). To examine the extent of the phenotypes, petiole and leaf blade lengths were


recorded from plants grown in short (8h light/16h dark) and long (16h light/8h dark) day


conditions. The inflorescence number was also counted. The means and standard errors


of all measurements are shown in Table 3-2.


In a short day light schedule, the petioles of max3-10 and max3-11 were


significantly shorter than wild-type. In a long day light schedule, only the petiole lengths










A







B









C









Col mcax3-11

Figure 3-11. Phenotypes of max3-11 plant compared to wild-type (Col). Plants grown in
a short day light schedule (A and B) appeared to have an exaggerated
phenotype compared to plants grown in a long day light schedule (C).

of max3-10 were significantly shorter than wild-type. The max3-11 leaf blade lengths,

although on average shorter, were not significantly different than wild-type in either light

regime. The max3-10 leaf blade lengths were significantly different in short days only,

although the difference was an increase in length instead of the expected decrease in

length. Inflorescence number was significantly increased in both alleles regardless of

light schedule. The increased inflorescence number in the mutants grown in short days

was more dramatic than those grown in long days. However, this observation is more

likely due to the increase in leaf number at the time of flowering in plants grown in short









days compared to those grown in long days. The increase in leaf number equates to an

increase in axillary meristems thus providing a source from which increased shoot growth

can occur.

Table 3-2. Petiole and leaf blade lengths and inflorescence number (SE) taken from
max3 plants grown on short and long daysa'b.
Petiole (mm) Leaf Blade (mm) Inflorescence #
Day Length Short Long Short Long Short Long
Ws 15.41.3 15.50.8 13.90.9 14.81.4 1.10.1 1.80.4
max3-10 11.30.6* 7.70.2* 17.81.3* 14.70.7 7.60.8* 4.50.2*
Col (5/04) 16.31.3 17.40.8 14.81.4 29.41.7 1.00.0 1.00.2
max3-11 (5/04) 12.01.4* 15.91.3 11.01.6 26.92.8 9.31.7* 5.10.6*
Col (8/04) 20.81.9 18.00.9 1.80.3
max3-9 (8/04) 10.70.6* 17.50.3 3.70.7*
CCD70Emax3-9 15.21.2* 17.80.2 1.30.2
(8/04)
a. The dates in parentheses next to lines in the Col ecotype are planting dates such that
measurements should only be compared between mutant and wild-type planted on same
date.
b. The asterisk indicates a significant difference of the mutant allele from its wild-type
counterpart (ANOVA, P-value<0.05).

The petiole and leaf blade phenotypes seen in max3-11 plants were proportionally

greater in short days than in long days, thus explaining the enhanced phenotype seen in

this growing condition. The max3-10 plants did not show a greater decrease in either

petiole or leaf blade length in short days as compared to long days. This difference may

be due to variation in ecotype background. Ws does in fact flower earlier than Col, a trait

that has been linked to the natural occurrence of a mutation within the phyD coding

region (Aukerman et al., 1997). PhyD plays a redundant and less dominant role to phyB

in the shade avoidance response, which includes a decrease in time to flo\\ cinig, increase

in elongation growth, and increased apical dominance (Devlin et al., 1999). Although the

data in Table 3-2 do not fit into a model suggesting a constitutive shade avoidance

response in the max3-10 allele, the inherent phyD mutation may perturb plant growth









such that the petiole and leaf blade lengths between the two mutants cannot be compared.

On the other hand, the increase in inflorescence number is consistent between the two

mutant alleles.

Complementation of max3 Phenotype

To confirm that the phenotypes reported above were due to loss of CCD7 function,

a wild-type copy of CCD7 cDNA was cloned from Columbia tissue and put into the

vector pDESTOE for Agrobacterium-mediated transformation into max3-9 plants. The

max3-9 line was isolated from the EMS screen (Booker et al., 2004). pDESTOE contains

the near-constitutive Figwort Mosaic Virus 35S promoter, the nos terminator, a selectable

marker, and elements required for transformation by Agrobacterium. The max3-

9:CCD70E line used for analysis showed a 3:1 segregation pattern at the T2 generation

indicating the existence of one or multiple linked T-DNA(s). The max3-9:CCD70E

plants were taken to homozygosity and were grown along side max3-9 and wild-type

plants in a long day light schedule. Petiole length, leaf blade length, and infloresence

number was recorded for all genotypes (Table 3-2). Leaf blade length remained

unchanged from wild-type in max3-9:CCD70E plants. Inflorescence number returned to

wild-type and petiole length increased from that seen in max3-9 but did not completely

return to wild-type length. To check for high expression of CCD7 within max3-

9:CCD70E plants, CCD7 transcript abundance was determined within leaves by Real

Time RT-PCR. Compared to wild-type, CCD7 transcript abundance was 30-fold higher

in max3-9:CCD7OE. Thus, the wild-type copy of CCD7 complemented the

inflorescence phenotype and partially complemented the petiole phenotype seen max3-9









plants. Despite the large increase in CCD7 expression in max3-9:CCD70E no additional

phenotypes were evident.

P-ionone Content of max3-10 and max4-11

CCD7 possesses activity at the 9,10 double bond of several carotenoid substrates

(Booker et al., 2004). This activity was demonstrated to be asymmetrical in nature, such

that with P3-carotene as a substrate one molecule of P3-ionone results (Schwartz et al.,

2004). As with ccdl-1, mutant alleles of CCD7 were analyzed for their P3-ionone content

and compared to their wild-type counterparts in order to assign an in vivo activity. Two

independent trials were performed (Fig. 3-12B). Trial 1 showed an insignificant decrease

and trial 2 showed an insignificant increase in the P3-ionone content in max3-11 compared

to wild-type. The changing P3-ionone levels observed more than likely reflects a natural

variation instead of a change due to loss of CCD7 function.

Interestingly, max3-10 was markedly increased in P3-ionone (Fig. 3-12A). The

max3-10 allele contains a T-DNA within the first exon of CCD7. Due to the location of

the insert within CCD7, the resulting truncated protein produced would contain 461

carboxy terminal amino acids. The wild-type CCD7 contains 618 amino acids, of which

the first 56 are predicted to be a cleavable plastid transit sequence. Therefore, it is

possible that a functional CCD7 enzyme is produced and led to the increase in P3-ionone

production seen in max3-10 rosettes. Schwartz et al. reported that CCD7 retained its

activity without its transit sequence (Schwartz et al., 2004). The T- DNA present within

max3-10 is made up of several enhancer elements as it was designed as an activation tag

(Weigel et al., 2000). Expression analysis of CCD7 within max3-10 rosettes and roots







43



was compared to expression in Ws. Primers and probe for Real Time RT-PCR lie


downstream of the insert location. CCD7 transcript was greatly increased in the max3-10


10 00


000 .00


IaVX3- 10


8.00
B
7.00

6.00

5.00

4.00

S3.00

2.00

1.00

0.00


M Col
O ccd7-2


Trial I Trial 2


Figure 3-12. P3-ionone content in max3 rosettes. A.) P3-ionone content was increased in
max3-10 compared to its wild-type counterpart (Ws) and B.) remained
essentially unaltered in max3-11 compared to its wild-type (Col) counterpart
as determined in two independent trials.

tissues (Fig. 3-13). It is feasible that the increased expression of CCD7 within max3-10


followed with an increase in accumulation of a functional yet truncated version of CCD7


leading to an increase in P3-ionone production. The truncated CCD7 would be without its


transit sequence and would therefore not be translocated into the plastid but would


contain the five histidines and seven residue sequence conserved among CCDs. Because


max3-10 plants do show the same phenotype as all other CCD7 mutants, it seems that










localization of CCD7 within the plastid is a requirement for maintenance of a wild-type

growth habit.


2.00E-03



1.50E-03



E 1.00E-03



5.00E-04


0.00E+00
Ws ros Ws rts max3-10 ros max3-10 rts


Figure 3-13. CCD7 expression in max3-10. Expression was measured in rosette and root
tissue and compared to that seen in the rosette and root tissue of the wild-type
background (Ws).

The increase in max3-10 plants suggests that CCD7 is involved in P3-ionone

production in vivo. Due to the likely mis-localization of CCD7 within max3-10 plants, it

is not known what role CCD7 plays in P3-ionone production when inside the plastid. The

data from max3-11 is inconclusive. As mentioned in Chapter 2, the in vitro activity of

CCD1 also produces P3-ionone (Schwartz et al., 2001). The redundancy in activity of

CCD 1 and CCD7 may explain why P3-ionone production was not greatly reduced in

max3-11. A better genetic background for testing P3-ionone production by CCD1 and

CCD7 would be the double mutant. The double ccdl-1max3-11 mutant has been made

and is presently being tested for homozygosity. On an additional note, an observable

change in P3-ionone production due to loss of CCD7 may be improbable due to the very

low level of CCD7 expression (Fig. 3-7). In vivo activity of CCD7 may be better









confirmed with an overexpression line, which has been made but not studied for (3-ionone

content.

Determination of Indole Acetic Acid and Abscisic Acid Content Within max3-10
Plants

Indole acetic acid (IAA) is an active auxin involved in the maintenance of apical

dominance in plants. Auxin originating from the apex of the plant promotes apical

dominance (Ward and Leyser, 2004). Lack of auxin perception has been linked to an

increased branching pattern in the axrl mutants of Arabidopsis (Lincoln et al., 1990;

Stimberg et al., 1999). A direct link between auxin synthesis and branching has been

difficult to ascertain likely due to redundancy in the pathway (Cohen et al., 2003). Genes

implicated in auxin biosynthesis in plants have been discovered and their overexpression

results in apically dominant plants (Zhao et al., 2001; Zhao et al., 2002). To determine if

altered auxin content was the cause of the branching phenotype seen in max3 plants, free

IAA was measured in max3-10 rosettes. IAA levels were not significantly altered in

max3-10 rosettes. (Fig. 3-14).

CCD7 was also tested for its possible involvement in ABA production by

ascertaining ABA content with the max3-10 mutant and comparing it to wild-type. While

ABA has been implicated in bud inhibition (Chatfield et al., 2000), none of the NCED

loss-of-function mutants display a shoot branching phenotype (B.C. Tan and W.T. Deng,

personal communication). ABA levels were essentially equal to wild-type (Fig. 3-14).

Therefore, CCD7 does not play a role in ABA synthesis.







46


2 0



15.0



S10A0 s-10
I II 10






00
1AA ABA


Figure 3-14. IAA and ABA content within max3-10 rosettes compared to wild-type (Ws).

In Summary

CCD7 is a carotenoid cleavage dioxygenase with activity at the 9,10 double bond

of a variety of carotenoid substrates (Booker et al., 2004). CCD7 is a soluble plastid

localized protein that accumulates in the stroma. Its transcript was found highest in the

root tissue of adult plants but was low in expression compared to other CCDs studied.

Expression was not altered by day length or by imposition of a water stress. Plants

without a functional CCD7 lack the ability to maintain apical dominance and as a result

are bushy in appearance. Rosette size is also affected by the presence of CCD7 function.

This functionality is dependent on localization of the protein product within the plastid.

From these results, it seems CCD7 is involved in the production an apocarotenoid

compound that is required for the normal inhibition of shoot growth from axillary

meristems. It is not known whether the change in rosette size is a direct result of loss of

CCD7 function or if it is an indirect result of early growth from typically dormant

meristems.















CHAPTER 4
CAROTENOID CLEAVAGE DIOXYGENASE 8 (CCD8)

Activity

Using the same heterologous E. coli system used to determine the activity of CCD1

and CCD7, Schwartz et al. determined CCD8 cleavage activity (Schwartz et al., 2004).

CCD8 was shown to cleave at the 13,14 double bond of the apocarotenoid produced by

the activity of CCD7 on P3-carotene. When CCD8 was expressed alone in the P3-carotene

accumulating line no apocarotenoid products were observed. CCD8 activity was

dependent on the presence of CCD7. Only upon induction of both CCD7 and CCD8 in

the same P3-carotene accumulating E. coli strain did the accumulation of 13'-apo-P3-

carotene and a C,1 dialdehyde product result (Fig. 4-1). These products were thought to

be derived from the cleavage of 10'-apo-p3-carotene (the product of CCD7's activity on

P3-carotene) at its 13,14 double bond. Therefore, a biochemical pathway can be drawn in

which P3-carotene is metabolized to 13'-apo-p3-carotene and the C9 dialdehyde product in

a two-step reaction involving both CCD7 and CCD8 (Schwartz et al., 2004).

Subcellular Localization

Localization of CCD8 within plastids was determined following the same

procedures as with CCD1 (Chapter 2) and CCD7 (Chapter 3). The chloroplast prediction

program TargetP (v 1.0) (Emanuelsson et al., 2000) predicts CCD8 to be chloroplast

localized and assigns a transit peptide of 56 amino acids. Chloroplast import assays with

the use of the protease thermolysin (Cline et al., 1993) verified its localization to the












SCCD'7


0
2


0 o3


CCD8


4


'o0 0o 5


Figure 4-1. Proposed activity of CCD8. CCD8 may act on the 13,14 double bond of 10'-
apo-p-carotenal (3), one product resulting from CCD7's activity on P3-carotene
(1), the other product being P3-ionone (2), to produce a C9 dialdehyde (4) and
13'-apo-p3-carotene (5).

chloroplast (Fig. 4-2A). Fractionation of the chloroplast revealed that CCD8 was

localized to the stroma (Fig. 4-2B). In addition, the reduced size of the imported mature

protein indicated the existence of a cleaved transit peptide.


A
VP14 CCD8 ssRub
pP +T pP +T pP +T
40 dmm


VP14 CCD8
pP E S Th pP E S Th



I-,w?


ssRubisco
pP E S Th


Figure 4-2. Import of in vitro transcribed and translated CCD8 precursor protein (pP) into
pea chloroplasts compared with ssRubisco (ssRub) and VP14. (A) Following
import, chloroplasts were treated with thermolysin (+T). (B) Chloroplasts
were fractionated to determine suborganellar localization to the envelope (E),
stroma (S) or thylakoid (Th).









Incubation of in vitro transcribed and translated CCD8 precursor proteins with

fresh pea chloroplasts for 0, 1, 2, 4, 8, 15, and 30 minutes showed that with increasing

incubation time CCD8 was more resistant to thermolysin treatment (Fig. 4-3). It could

then be concluded that, as with CCD7, CCD8 was imported into the chloroplast stroma.

Incubation time in mins.

pP 0 1 2 4 8 15 30




Figure 4-3. Time monitored plastid import assay with CCD8. In vitro transcribed and
translated CCD8 precursor protein (pP) was incubated with fresh pea
chloroplasts for 0, 1, 2, 4, 8, 15, and 30m. Following incubation each assay
mixture was thermolysin treated.

Expression Analysis

As with CCD1 and CCD7 (Chapters 2 and 3, respectively), CCD8 transcript

abundance was measured by quantitative Real Time RT-PCR using Taqman primers and

probes. RNA was extracted from tissue dissected from wild-type adult plants in the same

way as described in Chapter 2 (Fig. 2-3). Figure 4-4 shows transcript abundance as a

percentage of mRNA calculated by comparison to a standard curve. CCD8 transcripts

were detected in all tissues tested albeit at low levels. Interestingly, highest expression

was seen in root tissue prior to bolting (Fig. 4-4A). Previously, it was shown that wild-

type roots grafted onto CCD8 mutant shoots rescued the phenotype associated with loss

of CCD8 function (Sorefan et al., 2003). Thus, the increased expression seen in roots

relative to other tissue was intriguing. We therefore compared root expression before and

after emergence of the primary inflorescence, and after emergence of secondary

inflorescences (Fig. 4-4B). Transcript abundance in root tissue decreased by an average








50



of 65% after the emergence of primary and secondary inflorescences. In contrast, the low


level of transcript in leaf blade was not altered after axillary shoot emergence.


1.OOE-03


8.00E-04


6.00E-04


4.00E-04


2.00E-04


0.00E+00



1.OOE-03


8.00E-04


6.00E-04


4.00E-04


2.00E-04


0 OOE+00


<~.
~ d


40


BI B2 B3 R1 R2 R3


Figure 4-4. Expression pattern of CCD8 as determined by Real Time PCR. A.) RNA
was extracted from petioles, leaf blades, and roots before bolting. B.)
Comparison of expression in leaf blade and root tissue at three developmental
time points, B leaf blade before bolting; B2, leaf blade after emergence of
primary inflorescence; B3, leaf blade after emergence of secondary
inflorescences; RI, root before bolting; R2, root after emergence of primary
inflorescence; R3, root after emergence of secondary inflorescences.


CCD8 loss-of-function mutants showed a similarly enhanced phenotype as CCD7


mutants did in short day growth conditions (See next section). A day length effect on


CCD8 expression was also tested. Expression of CCD8 in whole seedlings grown on









short days was compared to seedlings grown on long days following the same procedure

as in Chapter 3. In unison with CCD7, no significant change in CCD8 expression was

apparent (Table 4-1). Therefore, the enhanced mutant phenotype seen in short days when

compared to long days does not appear to be a consequence of CCD8 transcription and/or

RNA turnover.

Following suit with the relationship of CCD1 and CCD7 on ABA production,

CCD8 was tested for its role in ABA biosynthesis by determining the effect of water

stress on its expression. As with CCD1 and CCD7, expression of CCD8 in seedlings was

not altered by a water stress treatment imposed by allowing a 15% loss of fresh weight

(Table 4-1).


Table 4-1. CCD8 transcript abundance in whole seedlings (SE).
Treatment % mRNA

Short days 2.13E-05 0.23E-05
Long days 2.74E-05 0.70E-05

Nonstressed 4.04E-05 1.04E-05
Stressed 3.35E-05 1.09E-05

ANOVA showed results not to be significant at an a=0.05


Loss-of-Function Mutants

Isolation of Mutants

Two independent loss-of-function mutants for CCD8 were isolated from the

Wisconsin Knockout facility (Krysan et al., 1999) and the SAIL population (Sessions et

al., 2002). Because mutants of CCD8 (max4-1 through max4-4) have previously been

isolated (Sorefan et al., 2003), the mutants discussed here will follow the established

nomenclature for mutant designation, i.e. the mutant isolated from the Wisconsin Knock-









out facility was named max4-5 and the mutant obtained from Syngenta's SAIL

population was named max4-6.

To verify the location of the T-DNA inserts, the junction of the T-DNA and CCD8

was amplified using a CCD8 forward or reverse specific primer and a primer specific for

the left border of the T-DNA. DNA from max4-5 produced a product approximately 800

bp in size using the CCD8 reverse primer and left border primer. The amplified DNA

was cloned and subsequent sequencing placed the insert within the fourth exon of CCD8

(Fig. 4-5). No product was obtained using the CCD8 forward primer indicating that the

T-DNA was in reverse orientation relative to CCD8.

A product approximately 3.2 kbp in size was amplified from max4-6 DNA when

using the CCD8 forward primer and left border primer. Sequencing placed the insertion

in the fifth exon of CCD8 (Fig. 4-5). A product of approximately 500 bp was obtained

using a CCD8 reverse primer and left border primer. This fragment was also sequenced

and placed the insert 17 bp downstream of the original placement. Positive amplification

with both CCD8 forward and reverse primers indicates the presence of two tandem T-

DNAs in opposite orientation. For both alleles, the CCD8 forward or reverse primer used

with the left border primer specific to each T-DNA was used to isolate a plant

homozygous for the insertion in a segregating population.

The T-DNAs present within each mutant allele are shown in Figure 4-6. The

max4-5 allele was isolated from the University of Wisconsin's Alpha population. The

transformation vector used to create these lines is a derivative of pD991 and is called

pD991-AP3. The T-DNA within this vector contains the left and right border sequences










max4-6 (Syngenta)


ATG


S2951 bps


BgIII(+2753)


HindIII(+


146)


I
BamHI(+2935)

HindlIT(+2843)


Figure 4-5. Positions of T-DNA insertions within CCD8. Black boxes are exons,
intervening lines are introns, and inverted triangles represent T-DNA inserts.
Sequencing of the T-DNA/gene junction showed max4-5 contains an insertion
(inverted triangle) within the 4th exon and max3-11 has two insertions within
the 5th exon. Locations of enzymes used in Southern blot analysis are shown.
Arrows indicate orientation of T-DNA in reference to CCD8 orientation.


max4-5


LB NPTII


pD991


Xbal
Hindill


max4-6



LB 35S-BAR


BamHI

HindIII


pD991 -AP3
AP3pro-GUS RB (5938 bp)


Figure 4-6. Schematic of T-DNA region of vectors used for transformation to create the
Alpha population from University of Wisconsin (pD991-AP3) and the
Syngenta population (pDAP101). Location of restriction enzymes used in
Southern analysis of max4-5 and max4-6 are shown.

for transformation with Agrobacterium, the nptlI gene for resistance to kanamycin and a

GUS gene driven by the AP3 promoter (Krysan et al., 1999). The max4-6 allele was

obtained from the SAIL population. The vector used for transformation in this

population is pDAP101. The T-DNA within this vector contains only the border

sequences and a 35S driven BAR gene for resistance to BASTA. To test for T-DNA


pBluescript II


I pDAP101
RB (4763 bp)


M









number within each mutant the appropriate resistance marker was used as a probe in a

Southern blot analysis. The genomic DNA isolated from max4-5 plants was digested

with BglII, HindIII, or BamHI and DNA isolated from max4-6 was digested with BglII,

HindIII, or Xbal. The enzymes chosen cut within the T-DNA but outside of the region

used as a probe with one exception, BglII does not cut within the T-DNA of pD991-AP3.

The wild-type ecotypes were digested and run adjacent to the digestions of each

mutant as a negative control. A single band was observed in the Southern of the max4-6

allele indicating the existence of one T-DNA insert (Fig. 4-7). However the PCR results

discussed above argue for two T-DNA inserts. Rearrangements and partial insertions are

common occurrences in Agrobacterium mediated transformation events (Meza et al.,

2002; Windels et al., 2003). It is possible that a partial insertion occurred where enough

of the left border sequence was inserted to allow for amplification by PCR of a junction

sequence. Two bands were observed in the Southern of the max4-5 allele when digested

with BamHI or BglII, indicating two T-DNAs within max4-5. Only one band was present

in the HindIII digestion, however this band was of a greater intensity than the other

bands, likely due to the presence of two bands of equal size (Fig. 4-7). It is possible that

the second T-DNA is not within CCD8 but must be within a short distance from it as

selection of a segregating population on kanamycin resulted in a 3:1 segregation of

kanamycin resistant to sensitive seedlings (74 seedlings total, 57 kanamycin resistant: 17

kanamycin sensitive).

Despite the 3' location of the T-DNAs within each mutant allele, activity of the

truncated forms of these proteins is unlikely because the insertions disrupt CCD8

upstream of the codon for at least one of five histidine residues conserved in all








55



Col ccdl-1 max4-6



Ws max4-5




Kb

100-- '"--
6.0-
5.0- 4.0-
4.0- 3.0-


2 :,

0.8--


1.0-




0.6-
0.8-


0.6- :





Figure 4-7. Autoradiograph of Southern blot analysis of max4 plants. Wild-type (Col or
Ws) was used as a negative control. Molecular weight markers are shown at
left. Enzymes used for digestion are indicated at top.


carotenoid cleavage dioxygenases. These five conserved histidines are thought to


coordinate a non-heme iron. Dioxygenase activity of VP14 (Schwartz et al., 1997) and


the Drosophila 15,15' dioxygenase (von Lintig and Vogt, 2000) has been shown to be


dependent on the presence of iron. If a truncated version of CCD8 resulted in max4-5


plants it would be without two of the five conserved histidines and a highly conserved


seven residue sequence found in plant and animal carotenoid cleavage dioxygenases. A


truncated CCD8 in max4-6 plants would be without one of the histidine residues,









highlighting the importance of each histidine in the fully functional protein as each

mutant allele confers the same phenotype (see next section).

Morphological Analysis of max4 Plants

Seeds homozygous for T-DNA insertions were planted with their wild-types in soil.

The plants of both CCD8 loss-of-function alleles were highly branched. The axillary

buds, which are typically delayed in growth in wild-type plants, grew out to produce

leaves and inflorescences, a phenotype almost identical to the CCD7 loss-of-function

mutants. Again, the phenotype was most obvious when grown on short days (Fig. 4-8).

Petiole length, leaf blade length and inflorescence number were recorded in short and

long day growth conditions. Like the max3 mutants, the max4-5 and max4-6 plants had

smaller rosette diameters due to a decrease in the lengths of petioles compared to wild-

type plants (Table 4-2). The decrease in petiole length was significant in both growing

conditions. Unlike max3, the leaf blade lengths were decreased in both max4-5 and

max4-6 grown on long days and max4-6 grown on short days. Leaf blade lengths of

max4-5 grown on short days were actually longer than wild-type, an observation

consistent with the max3-10 mutant. Both max4-5 and max3-10 are in the Ws

background. The increase in leaf blade length instead of the decrease seen in the max4-6

and max3-11 mutants may be due to ecotype variation. Inflorescence number was

increased in both max4 alleles under short and long day conditions. In long days, the

increase was similar to that seen in the max3 alleles but was stronger than max3 in short

days.

Complementation of max4 Phenotype

The pDESTOE transformation vector was used to introduce a wild-type copy of the

CCD8 cDNA under the control of the constitutive Figwort Mosaic Virus 35S promoter










A





B







C








Col max4-6

Figure 4-8. Phenotypes of max4-6 plant compared to wild-type (Col). Plants grown in a
short day light schedule (A and B) appeared to have an exaggerated phenotype
compared to plants grown in a long day light schedule (C).

Table 4-2. Petiole and leaf blade lengths and inflorescence number (SE) taken from
plants grown on short and long days.
Petiole (mm) Leaf Blade (mm) Inflorescence #
Day Length Short Long Short Long Short Long
Ws 15.41.3 15.50.8 13.90.9 14.81.4 1.10.1 1.80.4
max4-5 10.40.6* 8.30.2* 16.80.8* 10.31.1* 10.02.1* 4.50.3*
Col 15.20.6 20.81.9 14.61.2 18.00.9 1.00.0 1.80.3
max4-6 11.40.5* 10.30.6* 9.80.5* 13.80.5* 10.51.7* 5.20.4*
CCD8OEmax4-6 18.02.2 20.02.0 1.80.3


into max4-6. Transformed plants were grown on selection plates. Positive plants (max4-

6:CCD80E) were taken to homozygosity and were grown alongside max4-6 and

wildtype plants in a long day light schedule. The max4-6:CCD80E line used for analysis

showed a 3:1 segregation pattern at the T2 generation indicating the existence of either










one or multiple linked newly introduced T-DNA(s). The phenotypes associated with

petiole length, leaf blade length, and inflorescence number were all rescued (Table 4-2).

CCD8 transcript abundance was checked by Real Time RT-PCR in max4-6:CCD80E

plants and was interestingly only half of what is seen typically in wild-type plants.

Complementation with sub-wild-type levels of transcript suggests that only a low level of

CCD8 expression is required. The complementation establishes that the phenotypes were

a result of the loss of CCD8 function.

Determination of Indole Acetic Acid and Abscisic Acid Content within max4-6
Plants

Like max3, max4 alleles were found to have an altered branching pattern. This

phenotype again evokes images of auxin biosynthetic and/or signaling mutants.

Therefore, the level of auxin in the form of free IAA was measured. IAA levels were

equal to wild-type (Fig. 4-9). CCD8 was also tested for its possible involvement in ABA

production by ascertaining ABA content with the max4-6 mutant and comparing it to

wild-type. ABA levels were equal to wild-type (Fig. 4-9). Therefore, CCD8 also does

not play a role in ABA synthesis.


20.00


15.00 -


10.00 Col
O max4-6

5.00 -


0.00
IAA ABA


Figure 4-9. IAA and ABA content in max4-6 rosettes compared to wild-type (Col). No
difference in either hormone was seen.









In Summary

A recent study indicated that CCD8 has activity at the 13,14 double bond of 10'-

apo-p-carotene, a product resulting from the activity of CCD7 on P3-carotene (Schwartz et

al., 2004). CCD8 is a plastid, specifically stroma, localized protein. Its transcript was

most prominent in root tissue but was detectable in all other tissues tested. CCD8

expression was not affected by day length or water stress. Two independent CCD8 loss-

of-function alleles exhibit the same phenotype characterized by increased branching and

decreased petiole and leaf blade (with the exception of max4-5 on short days) lengths.

These phenotypes are similar to those seen in the CCD7 loss-of-function mutants. CCD7

and CCD8 are non-redundant carotenoid cleavage dioxygenases required for the

production of an apocarotenoid, which either directly or indirectly controls shoot growth

from axillary meristems.















CHAPTER 5
GENETIC INTERACTION AMONG CCD1, CCD7, AND CCD8

Introduction

CCD1 and CCD7 share activity at the 9,10 double bond of linear and cyclic

carotenoids (Schwartz et al., 2001; Booker et al., 2004; Schwartz et al., 2004). CCD7

and CCD8 share similar phenotypes conferred by their loss-of-function (Sorefan et al.,

2003; Booker et al., 2004). To ascertain the genetic interaction between the CCDs, the

following crosses were performed, ccdl x max4 and max3 x max4. A cross between ccdl

and max3 was also done, the progeny of which are at the F, generation and as such are

not ready to be analyzed. The following two sections characterize the ccdlmax4 and

max3max4 double mutants by comparing them to wild-type and to each single mutant.

The final section discusses results on transcript abundance of each CCD found within the

CCD loss-of-function mutants.

Characterization of ccdlmax4 Plants

CCD 1 and CCD8 do not appear to have much in common with the exception that

CCD8 cleaves a 9,10 cleavage product of P3-carotene. CCD8 cleaves at the 13,14 double

bond of 10'-apo-p-carotene, an apocarotenoid produced by the 9,10 cleavage of P3-

carotene. No 10'-apo-p3-carotene accumulated in the reactions involving CCD1 with P3-

carotene as a substrate. Instead the C14 dialdehyde corresponding to the central portion of

P3-carotene was identified, leading to the hypothesis that CCD 1 may act as a dimer

(Schwartz et al., 2004). It is not known if dimerization of CCD1 occurs in vivo. If CCD1

is able to cleave asymmetrically, two interactions with CCD8 are possible. One reaction









would begin with the cleavage of P3-carotene by CCD 1, the products of which are then

cleaved by CCD8, much like the reactions involving CCD7. This is not likely due to the

differential subcellular localization of CCD 1 and CCD8. However, a second possibility

remains in which P3-carotene is cleaved by CCD7 to produce 10'-apo-p-carotene which is

cleaved by CCD8 to produce 13'-apo-p3-carotene. 13'-apo-p3-carotene may leave the

plastid and be cleaved by CCD1 at its one 9,10 double bond. The biological significance

of this is unknown and may be revealed by the ccdlmax4 double mutant. ccdl-1 showed

a subtle petiole phenotype (Chapter 2). The max4 background may provide a sensitized

background in which to uncover further ccdl related phenotypes.

Due to constraints of selectable markers, the max4 allele chosen to cross to ccdl-1

was max4-5. The max4-5 allele is in the Ws background and the ccdl-1 allele is in the

Columbia background. Comparisons were therefore made among each wild-type

background, the single mutants, and the double mutant. Petiole length, leaf blade length

and inflorescence number are shown in Fig. 5-1. Unfortunately, petiole and leaf blade

length vary between Col and Ws making any conclusion regarding the effect of the

double mutant difficult. The inflorescence number of Ws and Col was similar. The

ccdlmax4 double mutant was no different in inflorescence number than max4. The

introduction of ccdl-1 into the max4-6 background had no effect on shoot growth from

axillary meristems suggesting that CCD1 is not involved in the control of branching in

Arabidopsis.








62




25.00



20.00


15.00



S10.00



5.00





25.00


20.00



S15.00



10.00


5.00



0.00

6.00


5.00


4.00


a 3,00
I-

2.00 -


1.00


0,00
Col Ws cdl-1 max4-5 ccdl-1max4-5



Figure 5-1. Analysis of ccdlmax4 double mutant. Measurements recorded include
petiole and leaf blade lengths and inflorescence number.









Characterization of max3max4 Plants

The near identical phenotypes of the max3 and max4 mutants suggests a pathway

leading to the production of a branch controlling factor (Sorefan et al., 2003; Booker et

al., 2004). It is possible that CCD7 and CCD8 work in a single pathway leading to the

synthesis of an inhibitor of bud outgrowth in Arabidopsis. It is also possible that CCD7

and CCD8 act in independent pathways both of which contribute to the production of a

branch inhibiting compoundss. If the latter were true, then a double max3max4 mutant

may be predicted to have an additive phenotype compared to either single mutant.

Therefore, a cross between max3-11 and max4-6 was made. The double mutant will also

give in vivo evidence for the existence of a linear pathway containing CCD7 and CCD8.

The F2 generation of the max3-11 max4-6 cross was analyzed for petiole length, leaf

blade length, and inflorescence number (Fig. 5-2). Genotypes were ascertained by PCR.

Petiole length was shortest in max4-6 and the double mutant. Only one copy of CCD8

was required for wild-type petiole length as shown in the plants genotyped as

heterozygous for CCD8 (max3/+, max4/+ and MAX3/MAX3, max4/+). Leaf blade length

was indistinguishable among max3-11, max4-6 and max3-11 max4-6. The max3-11max4-

6 double mutant was also phenotypically indistinguishable from either single mutant in

inflorescence number indicating a lack of genetic interaction between CCD7 and CCD8

consistent with both genes functioning in the same pathway. Interestingly, both classes

of plants genotyped as heterozygous for CCD8 (max3/+, max4/+ and MAX3/MAX3,

max4/+) showed a slight increase in inflorescence number compared to wild-type (P-

value=0.076 and P-value=0.029, respectively). This evidence of a quantitative dosage









64




20 00









1000




500




000
35.00


30.00 T


25.00


20.00


15.00


10.00


5.00



6


5 t


4

0.0 -- --- ----- -- --- -------------------- -- -


4





















Figure 5-2. Analysis of max3max4 double mutant. Two classes of heterozygotes,

heterozygous at both loci (max3-1/+max4-6/+) and heterozygous at CCD8

MAX3/+max4-6/+) were included to show possible dosage effect of CCD8.









effect of CCD8 on inflorescence number suggests that CCD8 activity is a point of control

in the pathway.

Effect of Loss-of-Function Mutants on Expression of CCDs

Due to the biochemical overlap of CCD1 and CCD7 and to the placement of CCD7 and

CCD8 in the same biosynthetic pathway, transcriptional regulation of one CCD on

another was tested. Real Time RT-PCR was used to measure transcript abundance of

each CCD in the ccdl-1, max3-11, and max4-6 mutant backgrounds. Expression was

measured at the seedling stage in two tissue types. The seedlings were extracted from

plates and cut at the root hypocotyl junction to provide root sample and an aerial

tissuesample consisting of hypocotyls and cotyledons (H/L). No large differences in

expression were seen (Fig 5-3). However a few subtle changes should be noted. CCD1

expression was decreased in the max3 and max4 mutants as compared to wild-type.

CCD7 expression was unchanged significantly in the root tissue of either ccdl or max4

seedlings but was decreased in ccdl and max4 H/L tissue. CCD8 transcript on the other

hand was decreased in max3 root and H/L tissue. CCD8 expression was also decreased

in ccdl H/L tissue.

It is unclear whether there is an interaction between CCD1 and CCD7 or CCD8.

The role of CCD 1 in plant physiology is also unclear but as a carotenoid cleavage

dioxygenase present in the cytoplasm it is feasible CCD1 acts as a vehicle for recycling

of carotenoid backbones from degenerated chloroplasts. If this is the case, plants with

increased branch number may need more photosynthates than less branched plants. A

larger store of carotenoids may allow for an increased photosynthetic rate. So, the

decrease in CCD1 expression seen in the max3 and max4 mutants may be a consequence








66





A
CCD1
1 50E-02



100E-02 IH/L



5 00E-03



0 OOE + 0 -------------------- ---------------

Col max3-11 max4-6

2 50E-05

B CCD7



1 50E-05

6 Roots



500 E-06 -


0 OOE+00
Col ccdl-1 max4-6




4 5OOE-04

4 00E-04 CCD8

3 50E-04
3 OOE-04
S2 50E.04 *H/L
2 5ORoots
2 00E-04
1 50E-04
I OOE-04
5 00E-05


Col ccdl-1 max3-11



Figure 5-3. Effect of loss-of-function mutants on transcript abundance of CCD 1 (A),
CCD7 (B), and CCD8 (C).


of the max phenotype. It is strange that the change in CCD7 expression among the


mutant phenotypes was seen in H/L tissue instead of the root tissue, where in adult plants


CCD7 transcript is highest. Nonetheless the decrease of CCD7 transcript in max4






67


seedlings may point to a negative feedback regulatory mechanism. Furthermore, CCD8

transcript in max3 was decreased in both root and H/L tissue. CCD8 transcript was also

decreased in ccdl H/L tissue.















CHAPTER 6
DISCUSSION

Introduction

The Arabidopsis CCD family consists of enzymes which not only range in

substrate specificity and site of cleavage but also biological function. The NCEDs all

cleave 9-cis-epoxycarotenoids at the 11,12 double bond to produce the hormone, ABA.

CCD4 may cleave at the 5,6 double bond to produce volatile apocarotenoids which

contribute to floral scent and to the flavor of fruits and vegetables (Winterhalter and

Rouseff, 2002). CCD1 cleaves multiple carotenoid substrates symmetrically at their 9,10

(and 9',10') double bonds. With P3-carotene as a substrate, CCD1 activity produces two

P3-ionone molecules (Schwartz et al., 2001). This is an apocarotenoid which has also

been linked to floral aroma and flavor (Winterhalter and Rouseff, 2002). CCD7 has been

shown to cleave multiple substrates at the 9,10 double bond (Booker et al., 2004).

CCD7's biological function in plants is intriguing and appears to be linked with the

activity of CCD8. CCD7 and CCD8 are required for the production of a novel signaling

molecule which is involved in the inhibition of branching (Sorefan et al., 2003; Booker et

al., 2004) but whose chemical identity has yet to be established. The following

discussion on results presented thus far is divided into two sections, the first pertains to

CCD1 in terms of its possible biological roles in plant physiology and the second

combines CCD7 and CCD8 regarding their involvement in the production of a novel

signaling compound.









Carotenoid Cleavage Dioxygenase 1

It is difficult to assign a specific biological function to CCD1 because of its

substrate promiscuity. However, the in vitro activity of CCD1 on P3-carotene does

produce P3-ionone and a C14dialdehyde, both of which are known to contribute to floral

scent and fruit flavor (Winterhalter and Rouseff, 2002). CCD1 expression was high in

flowers as compared to other plant organs. The volatile compounds may act to attract

insects for pollination as compounds such as P3-ionone have been shown to lure insects to

traps containing mixtures of P3-ionone with other known volatile compounds from maize

(Hammack, 2001). Pollination by insects is most probably not a typical means of

fertilization for a self-pollinating plant like Arabidopsis. However, it may be beneficial

to a plant like Arabidopsis to maintain a means by which diversity in genetic makeup

could be obtained (Chen et al., 2003). Apocarotenoids have antifungal activities as well.

When the roots of maize and wheat are infected with arbuscular mycorrhizal fungi, cyclic

C13 compounds and acyclic C14 compounds accumulate, giving the roots a yellow color.

The function of the carotenoid precurors and the apocarotenoid products in arbuscular

mycorrhization is unknown. However, it is possible that apocarotenoids act to control

fungal colonization because application of the isoprenoid cleavage product, blumenin,

deters colonization (Fester, 1999).

As carotenoids are synthesized and for the most part reside in plastids, it seems

strange that a carotenoid cleavage dioxygenase not localized to the plastid exists.

However, CCD1 clearly shows CCD activity but was not found to be plastid-localized.

The presence of carotenoids in the outer envelope of the chloroplast has been reported in

spinach (Douce et al., 1973) and pea (Markwell et al., 1992). The envelope fraction from









spinach contained mostly violaxanthin but lutein and zeaxanthin and in smaller quantities

(3-carotene were also isolated (Douce et al., 1973). All of these carotenoids are possible

CCD1 substrates (Schwartz et al., 2001). CCD1 may associate with the outer envelope

and act on the carotenoids found within it. In fact, a CCD1 orthologue from tomato was

found in fractions containing the inner and outer chloroplast envelopes but was easily

degraded by treatment with a protease (Simkin et al., 2004a). Extensions of the plastid

membrane have also been discovered. Thought to take part in protein exchange between

plastids (Kohler et al., 1997), these stroma filled tubules may also be a source of

carotenoids available to CCD1.

The subtle phenotype seen in ccdl-1 suggests that CCD1 may not be crucial to

normal growth and development or that redundancy exists in the genome. CCD7 does

possess the same cleavage activity as CCD 1 yet they differ in their subcellular

localization. Was CCD1 at one point redundant to CCD7 but through evolution lost its

chloroplast transit sequence? Would CCD1 be able to rescue the max3 phenotype if

present within plastids? To answer these questions the transit peptide of the plastid

localized small subunit of ribulose 1,5 carboxylase/oxygenase was placed in front of

CCD1. The construct encoding for the chimeric protein was transformed into max3-9

plants. In a reciprocal experiment, the transit peptide-coding region of CCD7 was

removed and put into max3-9 plants to test if plastid localization is in fact a requirement

for rescue of the max3 phenotype. Analysis of the resulting plants is in progress.

Carotenoid Cleavage Dioxygenase 7 and Carotenoid Cleavage Dioxygenase 8

Traditionally, apical dominance is thought of as a consequence of the effects of two

plant hormones, auxin and cytokinins. It has been postulated that auxins, produced in the









apex of the plant, travel down the stem and inhibit growth of axillary meristems (Ward

and Leyser, 2004). With the isolation of the max3 and max4 mutants, an as yet

unidentified hormone player in the control of plant architecture is evident (Stirnberg et

al., 2002; Sorefan et al., 2003; Booker et al., 2004). Studies in pea (Pisum sativum)

(Beveridge et al., 1996; Beveridge et al., 2000; Morris et al., 2001; Rameau et al., 2002),

and petunia (Petunia hybrida) (Napoli, 1996) (K. Snowden, personal communication)

also point to a more complex mechanism controlling branching in plants. In each of

these species phenotypes identical to that seen in the Arabidopsis loss-of-function

mutants were discovered, demonstrating that this is a general phenomenon. Prominent

among these studies were those done with the ramosus (rms) mutants in pea. There are

six identified RMS loci. Mutations in any of the six loci confer an increased branching

pattern. This phenotype exists despite the mutants possessing wild-type auxin content

and transport (Beveridge et al., 2000; Morris et al., 2001; Rameau et al., 2002). Recently,

it was shown that PsRMS1 is orthologous to AtCCD8 (Sorefan et al., 2003). As reported

here, the max4-6 mutant, like rmsl, also contains wild-type levels of auxin. However,

auxin sensitivity may be altered as it was decreased in the max4-1 mutant (Sorefan et al.,

2003) indicating a potential link to auxin signaling.

Grafting studies done in both Arabidopsis (Tumbull et al., 2002; Sorefan et al.,

2003) and pea (Foo et al., 2001) further implicate CCD7 and CCD8 and their orthologues

in branching inhibition. In Arabidopsis, the max4 branching phenotype can be restored to

wild-type by grafting at the seedling stage with either wild-type root or shoot tissue

(Sorefan et al., 2003). Similar results have been reported for max3 (Tumbull et al., 2002)

and rms] (Foo et al., 2001). Y grafts, in which a shoot of one genotype is grafted onto









the shoot of a second genotype, were performed using rms] and wild-type tissue. Here,

an rms] shoot was grafted onto a wild-type shoot continuous with a wild-type root.

Neither shoot developed excessive branching. On the other hand, when the wild-type

shoot was grafted onto an rms] shoot that was continuous with an rms] root, the rms]

shoot but not the wild-type shoot developed extensive branching. These data show that

the signal travels acropetally and therefore is more than likely transported through the

xylem (Foo et al., 2001). Although CCD7 and CCD8 transcripts were present in all

tissues they are, by far, most highly expressed in the roots. Sorefan et al. showed highest

expression of CCD8 in the root tip using promoter GUS fusions (Sorefan et al., 2003).

The available data strongly support the existence of a novel translocated phytohormone

able to travel up through the xylem from the root to affect shoot branching.

Branching mutants have also been identified in petunia. The dad] mutant was

characterized as having an increased branching pattern (Napoli, 1996) and Dadl has now

been shown to be orthologous to AtCCD8 (K. Snowden, personal communication).

Orthologous proteins controlling identical functions as well as the existence of

homologous sequences in the monocots maize and rice (B.C. Tan and D. R. McCarty,

personal communication) indicate a broadly conserved mechanism for controlling lateral

branching in plants.

The order of action of CCD7 and CCD8 in this pathway is not known. Both

CCD7 (Chapter 3) (Booker et al., 2004) and CCD8 (Chapter 4) localize to the stroma of

chloroplasts, placing them in a cellular compartment that is enriched for carotenoids.

CCD7 has been shown to cleave a variety of carotenoid molecules (Booker et al., 2004)









whereas cleavage activity of CCD8 has been suggested using 10'-apo-j3-carotene as a

substrate (Schwartz et al., 2004).

Other participants in this pathway to date remain unidentified. However, two

additional branching mutants in Arabidopsis, max] and max2, have been identified but

their role in the synthesis of the branch inhibiting compound is not yet known (Stirnberg

et al., 2002). Six RMS loci have been identified in pea (Beveridge et al., 1996;

Beveridge et al., 2000; Morris et al., 2001; Rameau et al., 2002). Reciprocal grafting

experiments among the rms mutants show Rms3 and Rms4 to be more important in the

shoot than in the root. Rms 1 and Rms 5 appear to regulate the same signal emanating

from the root (Morris et al., 2001) and Rms2 has been hypothesized to act as a shoot to

root signal (Beveridge, 2000). From these studies it is obvious that branching control is

regulated by a complex signaling network. To add to this complexity the recently

discovered BYPASS1 (BPS1) was also shown to be involved in the control of apical

growth. BYPASS1 does not possess strong homology to any known protein. Mutants of

BPS1 do not grow past the production of two cotyledonary leaves, which have no

vasculature or trichomes. bps] plants also display a short root phenotype. The bps]

phenotypes are temperature sensitive in that they become less severe with increasing

temperature. Interestingly a partial rescue of bps] phenotypes are seen with fluridone

treatment. Fluridone inhibits phytoene desaturase and therefore carotenoid biosynthesis.

Furthermore, the abalbps] double mutant showed an enhanced bps] phentoype. ABA1

converts zeaxanthin to violaxanthin. These results led authors to hypothesis the existence

of a zeaxanthin-derived signal regulated by BPS 1, which inhibits apical growth (Van

Norman et al., 2004). CCD7 and CCD8 may be responsible for the synthesis of this






74


carotenoid derived signaling molecule, without which apical growth is left uninhibited

leading to the highly branched phenotypes seen in max3 and max4. The isolation of max,

rms, dad and now bps] strongly suggest that a carotenoid derived compound is a novel

growth inhibiting phytohormone, which along with auxins and cytokinins represent a

means by which plants control their pattern of growth.















CHAPTER 7
MATERIALS AND METHODS

Cloning of CCD1, CCD7 and CCD8 cDNA

CCD1

The CCD1 cDNA in pBK-CMV (Stratagene, La Jolla, CA) was a gift from B. C.

Tan. CCD1 cDNA was put into the Gateway pENTRD (Invitrogen, Carlsbad, CA ) using

the following primers; Forward 5'-caccatggcggagaaactcagtatggcag-3' and Reverse 5'-

ttatataagagtttgttcctggagttgttc-3' and sequenced. From pENTRD, CCD] cDNA was

transferred to pDESTOE (Booker et al., 2004) by recombination for overexpression. The

pDESTOE vector contains the constitutive Figwort Mosaic Virus promoter and NOS

terminator as well as the plant selection gene, nptll. CCD]pBK-CMV was digested with

Pstl/Smal and ligated into pSP6-PolyA (Promega, Madison, WI) for in vitro transcription

and translation.

CCD7

The CCD7 cDNA was obtained by a two-step RT-PCR reaction with RNA from

Columbia tissue. Advantage RT-for-PCR reagents (BD Biosciences Clontech, Palo Alto,

CA) were used according to the manufacturer and CCD7 was amplified from cDNA

using the following primers; Foward 5'-caccatggcggagaaactcagtgatggcag-3' and Reverse

5'-ttatataagagtttgttcctggagttgttcctgtgaatacc-3'. Full length cDNA was maintained in

either the pCR-BluntlI-TOPO vector or the pENTRD vector (both from Invitrogen) and

sequenced. CCD7 cDNA was transferred from CCD7pENTRD to pDESTOE (Booker et

al., 2004) for overexpression by recombination, to pDEST14 (Invitrogen) for expression









by recombination, and to pSP6-PolyA (Promega) by digestion with PstI and SacI for in

vitro transcription and translation.

CCD8

The CCD8 cDNA in pBlueScript (KS) was a gift from Steve Schwartz. A single

nucleotide mutation was found in the cDNA clone and corrected using a BD Biosciences

Clontech mutagenesis kit. The sequence matched that of the annotated gene in GenBank

(At4g32810). CCD8 cDNA was amplified using the following primers F 5'-

caccatggcttctttgatcacaaccaaagc- 3', R 5'- ttaatctttggggatccagcaaccatg-3', put into the

Gateway pENTR2B vector (Invitrogen) and sequenced. CCD8 cDNA was transferred

from CCD8pENTR2B to pDESTOE (Booker et al., 2004) for overexpression by

recombination and to pSP6-PolyA (Promega) by digestion with Sall and Xbal for in vitro

transcription and translation..

Carotenoid/Apocarotenoid Extraction from E.coli

Plasmids containing the carotenoid biosynthetic genes (courtesy of F. Cunningham)

for phytoene, ,-carotene, lycopene, 6-carotene, (3-carotene, and zeaxanthin were co-

transformed with CCD7pDEST14 into the arabinose inducible E. coli strain, BL21-AI

(Invitrogen). Cells were grown in LB with 0.1% glucose at 300C for varying amounts of

time depending on the extraction procedure. Expression of CCD7 was induced by the

addition of 0.1% arabinose when cells reached an A600 of 1.0.

For HPLC analysis, one preculture was grown and used to inoculate two 25 ml

cultures, one of which was induced for CCD7 expression once an A600 of 1.0 was

reached. The 25 ml cultures were grown for an additional 24 h and carotenoids were

extracted using the method of Fraser et al. (Fraser et al., 2000). Injection volumes for









extracts from uninduced and induced cells were normalized for A600 taken just prior to

extraction to directly compare accumulation of the carotenoid substrate. Analysis was

carried out on a Waters (Milford, MA) HPLC, equipped with a photodiode array detector

and a reversed-phase YMC Carotenoid S-5 4.6x250 mm column (Waters). HPLC

running parameters are as described in (Fraser et al., 2000). The apocarotenoid products

were detected by gas chromatography and verified by gas chromatography/mass

spectrometry, by the running parameters of (Engelberth et al., 2003). For apocarotenoid

analysis, cell cultures (25 ml) were grown for no more than 12 h and apocarotenoids were

extracted by the addition of an equal volume of hexane. Culture/hexane solutions were

sonicated in a water bath sonicator for 5 m and vortexed for 1 m. The phases were

separated by centrifugation and the hexane phase was retained. Apocarotenoid volatiles

were collected onto a filter trap (containing 20 mg of SuperQ, Alltech Associations) by

vapor-phase extraction as described in (Engelberth et al., 2003), with the exception that

samples were dried to completion then heated to 750C to promote volatility. For the j3-

carotene strain, a 100 ml culture was grown for 16h. Air was bubbled through the culture

and volatiles were collected onto the SuperQ filter trap. In both apocarotenoid extraction

procedures, volatiles were eluted off the trap with 150 tl of hexane, of which 5 tl were

injected onto the GC. Injection volumes for extracts from uninduced and induced cells

were normalized for A600.

Plant Growth Conditions and Measurements

Plants were grown under Cool White and Gro-Lux (Sylvania) fluorescent tubes at 50

[imol m-2 s-. Temperatures ranged from 190C to 220C. Short days consisted of 8 h light

and 16 h dark, while long days consisted of 16 h light and 8 h dark. Measurements of









petiole length and leaf blade length were taken from the 6th leaf on the rosette. A

combined inflorescence number was obtained by counting every inflorescence, emerging

from the primary meristem and axillary meristems, one week in long days and two weeks

in short days after observation of primary inflorescence emergence. For all

measurements, data from at least 6 plants were averaged.

Subcellular Localization

TNT

Transcription of each cDNA was under the control of the SP6 promoter in the

pSP64-PolyA vector (Promega). In vitro transcription and translation was done using the

coupled transcription/translation (TNT) wheat germ extract (for CCD 1 and CCD8) or the

rabbit reticulocyte lysate (for CCD7) system by Promega. A 100 tl reaction contained

the following ingredients, 50 [tl wheat germ extract or rabbit reticulocyte lysate, 4 [tl

TNT reaction buffer, 2 [tl SP6 RNA polymerase, 2 [tl amino acid mixture minus leucine,

28 [tl 3H-leucine, ribonuclease inhibitor (20 units/ml), and 6 [tg of plasmid DNA.

Reactions were incubated for 30m at 250C. A 2 tl aliquot of TNT reaction products was

set aside and the remaining reaction mix was brought to 200 tl with 60 mM leucine in

2X import buffer (IB) (IX IB = 50 mM HEPES/KOH pH 8.0, 0.33 M sorbitol).

Chloroplast Import

Chloroplasts were isolated from 9-11 day old pea seedlings (Laxton's Progress 9).

Import assays were performed as described by Cline et al. (1993). Import assays were set

up as follows, 200 tl precursor protein (TNT reaction products) were added to 200 tl

chloroplasts (resuspended to -1.0 mg Chlorophyll/ml), 25tl 120mM Mg-ATP in IX IB

pH8.0, 30 tl 0.1 M DTT, and 145 [tl IX IB. Import was allowed to proceed for 30 m at









250C under light and stopped by transferring tubes to ice. Chloroplasts were pelleted

(1000xg for 6 m) and resuspended in 0.5 ml import buffer. Chloroplasts were then

treated with 25 tl thermolysin (2 mg/ml in IB, 10 mM CaCI2). Thermolysin treatment

proceeded for 40 m at 40C. Chloroplasts were then repurified on a 35% Percoll cushion,

washed with IX IB, and resuspended in 10 mM Hepes-KOH/5 mM EDTA pH 8.0.

Subfractionation

Following import, chloroplasts were repurified on a 35% Percoll cushion, washed

with IX IB, lysed by resuspension in 10 mM Hepes-KOH/5 mM EDTA pH 8.0 and

allowed to sit on ice for 5 m. To adjust the osmolarity of the solution, 20 tl of 2X IB/20

mM MgCl2 was added. Thylakiods were isolated by spinning chloroplasts at 4000xg for

30 s at 40C. The pellet was washed with lml IX IB, spun at 8200 g for 3 m, and

resuspended in 120 tl 10 mM Hepes-KOH/5 mM EDTA pH 8.0. The supernatant was

removed and spun for 30 m at 50,000xg at 20C to separate envelope inner and outer

membranes from stroma. The supernatant (stromal fraction) was removed and the

volume carefully measured. The pellet (envelope fraction) was resuspended in the same

volume as the stromal fraction with 10 mM Hepes-KOH/5 mM EDTA pH 8.0.

Thermolysin treated whole chloroplasts and chloroplast subfractions were mixed

with 2X SDS sample buffer, heated to 800C for 3 m, and run out on 12.5% SDS-

polyacrylamide gels. The gels were incubated in DMSO for 5 m with shaking and then

with enough 2,5-diphenyloxazole (PPO) in DMSO to cover the gel for 30 m with

shaking. After washing in water, the gels were dried and the proteins were detected by

fluorography.









Real Time RT-PCR

To determine the major sites of CCD expression, tissues for RNA were harvested

from Columbia plants grown in soil on short days for 2.5 months. Plants were then

switched to long days in order to promote flowering. Once plants bolted, primary

inflorescence stem (primary inflorescence minus flowers and cauline leaves), flower and

green silique tissues were collected. Secondary inflorescence stems were collected once

they reached 8 cm in height. Primary inflorescence stem is the shoot originating from the

primary shoot meristem whereas secondary inflorescence stems are the shoots originating

from the axillary meristems. Total RNA was isolated as described in Chang et al. (1993).

Tissue expression patterns were determined for three biological replicates. Data for one

replicate is shown. Relative expression patterns for each replicate were equivalent.

To determine day length effect on gene expression, RNA was harvested from 14

day-old seedlings. Two sets of seedlings were grown on agar plates containing

Murashige and Skoog basal salt mixture (Sigma-Aldrich, St. Louis, MO) for 14 days on a

short day light schedule, at which time half of the plates were switched to long days.

Eight days later, both sets were collected and frozen and RNA was harvested. Averages

and standard errors of three replicates are shown.

For analysis of the effect of water stress on CCD expression, tissue was collected

from 14 day-old seedlings (short day light cycle) harvested from MS plates and left on

the bench until they lost 15% of their fresh weight. They were then sealed in plastic bags

and put in the dark for 6 h. Nonstressed tissue was harvested in the same way but was

sealed in plastic bags immediately after removal from plates, kept in the dark for 6 h, then









frozen and RNA extracted. The above procedures are also detailed in Tan et al. (2003).

Averages and standard errors of three replicates are shown.

All RNA was DNasel (Ambion, Austin, TX) treated at 370C for 30 m. DNase was

removed using the RNeasy kit from Qiagen (Valencia, CA). RNA was visualized on

agarose gels and quantified by spectrophotometry. An Applied Biosystems GeneAmp

5700 real-time PCR machine was used with TaqMan One-Step RT-PCR reagents

(Applied Biosystems, Foster City, CA) and reaction conditions were as per manufacturer

specifications using 250 ng RNA per reaction in a 25 tl reaction volume. Reactions were

done in duplicate and quantities were averaged. The primer/probe set for each CCD are

shown in Table 7-1. Transcript quantities were determined by comparison to a standard

curve. Transcripts for use in production of standard curves were synthesized with T7

polymerase in vitro in the presence of [3H]-UTP from CCD]pBK-CMV linearizedd with

Notl), CCD7pBluntlI linearizedd with Spel), and CCD8pENTR2B linearizedd with Xbal).

Quantities were then normalized to ribosomal RNA, which was detected using the

Taqman Ribosomal RNA Control Reagents kit by Applied Biosystems.

Table 7-1. Primers used in Real Time RT-PCR reactions.
Forward Primer 5'.. .3' Probe 5'-FAME...TAMRA-3' Reverse Primer 5'...3'

CCD1 acaagagattgacccactccttca tgctcacccaaaagttgacccggt tgtttacattcggctattcgca

CCD7 caaccgagtcaagcttaatcca aggttccatagcggctatgtgcgga aacgctgataccattggtgaca

CCD8 tgataccatctgaaccattcttcgt 5cctcgacccggtgcaacccat cgatatcaccactccatcatcct



Isolation of Loss-of-Function Mutants

Three publically available populations were used to obtain mutants in this study,

the Wisconsin Knock-out facility (Krysan et al., 1999; Weigel et al., 2000), the Syngenta









Arabidopsis Insertion Library (SAIL) (Sessions et al., 2002) and the Salk Institute

Genomic Analysis Laboratory (Alonso et al., 2003). Each population is a collection of

mutants obtained via Agrobacterium-mediated insertional mutagenesis. The mutants

resulting from this form of mutagenesis, which no longer express the gene of interest, are

called knock-outs because either their promoter or coding region is disrupted by the T-

DNA insert (Krysan et al., 1999). At the time the mutants in this study were isolated the

Wisconsin Knockout population organized their population of knock-outs in pools such

that several, sequentially smaller pools must be screened before finding the one plant that

is a knock-out for the gene of interest. Therefore, a pool of DNA was screened via PCR

by the facility using primers listed in Table 7-2 and a primer specific for the left border

sequence of the T-DNA (LB). Once supplied by the facility, PCR products were run out

on an agrose gel and blotted for Southern analysis using full length cDNA clones as

probes. Two populations from the Wisconsin Knock-out Facility exist, the Alpha

(Krysan et al., 1999) and the Basta (Weigel et al., 2000) populations. Positive plants

isolated from the Alpha population are resistant to kanamycin and those from the Basta

population are resistant to glutamine synthetase inhibitors such as BASTA. The active

ingredient in commercially available forms of BASTA is the glutamate analog,

glufosinate-ammonium. Mutants from either the SAIL or Salk populations are obtained

by searching a database for sequence matches. A positive match means that the

population does contain a knock-out of your gene. The seeds are ordered and arrive as a

segregating population. Recently, the Wisconsin Knock-out population and the SAIL

population have been given to the Salk Institute Genomic Analysis Laboratory and are

searchable through their database (signal.salk.edu).









For each population PCR was used to identify a plant homozygous for the T-DNA

insert. Gene specific primers used in these reactions are listed in Table 7-2.

Amplification with the forward and reverse gene specific primers indicated a wild-type

copy. Amplification using either forward or reverse gene specific primer and the LB

primer indicated the presence of a T-DNA within the gene.

Table 7-2. Gene specific primers used to identify knock-out plants
Forward Primer Reverse Primer

CCD 1 5' -cagagtgttggatcgttgctggaagaaag-3' 5' -tcctggagttgttcctgtgaataccagac-3'

CCD7 5' -gctcatgtcttccacaaaatcactcaact-3' 5' -aaccatgaaaacccatcggaaacgtcaaa-3'

CCD8 5' -aaaaccgcatcaaaacttaccgtcaaact-3' 5' -ttgcgaattgataggtggaaccagtgaac-3'



P-ionone Measurements

Plants were grown on short days until rosettes contained from 22 to 27 leaves.

Whole rosettes were ground individually under liquid N2 and approximately 200 mg of

each sample was used for extraction. P3-ionone was extracted following the method of

Schmelz et al. (Schmelz et al., 2003), with the following exceptions. The extraction

solution used was 1-propanol/H20 (2:1 vol/vol). Following shaking in a FastPrep FP 120

tissue homogenizer, hexanes were added to the samples and shaken again. The

hexanes/1-propanol (top) phase was transferred to a new vial. No

derivitization/neutralization step was necessary. P3-ionone was collected by vapor-phase

extraction as described in Schmelz et al. (2003). However, samples were heated to no

higher than 700C until dry, then 2 m more. P3-ionone was eluted from the filter trap with

150 [tl of hexanes. Samples were injected onto a GC-MS, conditions of which are also






84


described in Schmelz et al. (2003). Sample (3-ionone quantities were determined by an

external standard curve.

IAA and Abscisic Acid Measurements

Wild-type and mutant plants were grown on short days until their rosettes

contained 15-20 leaves, at which time rosettes were frozen individually. ABA and IAA

were quantified following the procedure of Schmelz et al. (2003). Samples were injected

onto a GC-MS, conditions of which are also described in Schmelz et al. (2003). Tissue

from six rosettes was analyzed individually and the measurements were averaged.















LIST OF REFERENCES


Alonso JM, Stepanova AN, Leisse TJ, Kim CJ, Chen H, Shinn P, Stevenson DK,
Zimmerman J, Barajas P, Cheuk R, Gadrinab C, Heller C, Jeske A,
Koesema E, Meyers CC, Parker H, Prednis L, Ansari Y, Choy N, Deen H,
Geralt M, Hazari N, Hom E, Karnes M, Mulholland C, Ndubaku R, Schmidt
I, Guzman P, Aguilar-Henonin L, Schmid M, Weigel D, Carter DE,
Marchand T, Risseeuw E, Brogden D, Zeko A, Crosby WL, Berry CC, Ecker
JR (2003) Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science
301: 653-657

Aukerman MJ, Hirschfeld M, Wester L, Weaver M, Clack T, Amasino RM,
Sharrock RA (1997) A deletion in the PHYD gene of the Arabidopsis
Wassilewskija ecotype defines a role for phytochrome D in red/far-red light
sensing. Plant Cell 9: 1317-1326

Bak S, Tax FE, Feldmann KA, Galbraith DW, Feyereisen R (2001) CYP83B1, a
cytochrome P450 at the metabolic branch point in auxin and indole glucosinolate
biosynthesis in Arabidopsis. Plant Cell 13: 101-111

Baldwin EA, Scott, J.W., Shewmaker, C.K., Schuch, W. (2000) Flavor trivia and
tomato aroma: Biochemistry and possible mechanisms for control of important
aroma components. HortScience 35: 1013-1021

Beveridge C (2000) Long-distance signalling and a mutational analysis of branching in
pea. Plant Growth Reg 32: 193-203

Beveridge CA, Ross JJ, Murfet IC (1996) Branching in pea (Action of genes Rms3 and
Rms4). Plant Physiol 110: 859-865

Beveridge CA, Symons GM, Turnbull CG (2000) Auxin inhibition of decapitation-
induced branching is dependent on graft-transmissible signals regulated by genes
Rmsl and Rms2. Plant Physiol 123: 689-698

Booker J, Auldridge M, Wills S, McCarty D, Klee H, Leyser 0 (2004) MAX3/CCD7
is a carotenoid cleavage dioxygenase required for the synthesis of a novel plant
signaling molecule. Curr Biol 14: 1232-1238

Bouvier F, Dogbo 0, Camara B (2003a) Biosynthesis of the food and cosmetic plant
pigment bixin annattoo). Science 300: 2089-2091









Bouvier F, Suire C, Mutterer J, Camara B (2003b) Oxidative remodeling of
chromoplast carotenoids: identification of the carotenoid dioxygenase CsCCD and
CsZCD genes involved in Crocus secondary metabolite biogenesis. Plant Cell 15:
47-62

Burbidge A, Grieve TM, Jackson A, Thompson A, McCarty DR, Taylor IB (1999)
Characterization of the ABA-deficient tomato mutant notabilis and its relationship
with maize Vpl4. Plant J 17: 427-431

Chang S, Puryear J, Cairney J (1993) A simple and efficient method for isolating RNA
from pine trees. Plant Mol Biol Rep 11: 113-116

Chatfield SP, Stirnberg P, Forde BG, Leyser 0 (2000) The hormonal regulation of
axillary bud growth in Arabidopsis. Plant J 24: 159-169

Chen F, Tholl D, D'Auria JC, Farooq A, Pichersky E, Gershenzon J (2003)
Biosynthesis and emission of terpenoid volatiles from Arabidopsis flowers. Plant
Cell 15: 481-494

Chernys JT, Zeevaart JA (2000) Characterization of the 9-cis-epoxycarotenoid
dioxygenase gene family and the regulation of abscisic acid biosynthesis in
avocado. Plant Physiol 124: 343-353

Cline K, Henry R, Li C, Yuan J (1993) Multiple pathways for protein transport into or
across the thylakoid membrane. EMBO J 12: 4105-4114

Cohen JD, Slovin JP, Hendrickson AM (2003) Two genetically discrete pathways
convert tryptophan to auxin: more redundancy in auxin biosynthesis. Trends Plant
Sci 8: 197-199

Cunningham DG, Acree, T.E., Barnard, J., Butts, R., Braell, P. (1986) Analysis of
apple volatiles. Food Chem 19: 137-147

Cunningham FX, Gantt E (1998) Genes and enzymes of carotenoid biosynthesis in
plants. Annu Rev Plant Physiol Plant Mol Biol 49: 557-583

Cunningham FX, Jr., Pogson B, Sun Z, McDonald KA, DellaPenna D, Gantt E
(1996) Functional analysis of the beta and epsilon lycopene cyclase enzymes of
Arabidopsis reveals a mechanism for control of cyclic carotenoid formation. Plant
Cell 8: 1613-1626

Cunningham FX, Jr., Sun Z, Chamovitz D, Hirschberg J, Gantt E (1994) Molecular
structure and enzymatic function of lycopene cyclase from the cyanobacterium
Synechococcus sp strain PCC7942. Plant Cell 6: 1107-1121









Devlin PF, Robson PR, Patel SR, Goosey L, Sharrock RA, Whitelam GC (1999)
Phytochrome D acts in the shade-avoidance syndrome in Arabidopsis by
controlling elongation growth and flowering time. Plant Physiol 119: 909-915

Douce R, Holtz RB, Benson AA (1973) Isolation and properties of the envelope of
spinach chloroplasts. J Biol Chem 248: 7215-7222

Emanuelsson 0, Nielsen H, Brunak S, von Heijne G (2000) Predicting subcellular
localization of proteins based on their N-terminal amino acid sequence. J Mol
Biol 300: 1005-1016

Engelberth J, Schmelz EA, Alborn HT, Cardoza YJ, Huang J, Tumlinson JH (2003)
Simultaneous quantification ofjasmonic acid and salicylic acid in plants by
vapor-phase extraction and gas chromatography-chemical ionization-mass
spectrometry. Anal Biochem 312: 242-250

Fester T, Maier, W., Strack, D. (1999) Accumulation of secondary compounds in
barley and wheat roots in response to inoculation with an arbuscular mycorrhizal
fungus and co-inoculation with rhizosphere bacteria. Mycorrhiza 8: 241-246

Finkelstein RR, Gampala SS, Rock CD (2002) Abscisic acid signaling in seeds and
seedlings. Plant Cell 14 Suppl: S15-45

Foo E, Turnbull CG, Beveridge CA (2001) Long-distance signaling and the control of
branching in the rmsl mutant of pea. Plant Physiol 126: 203-209

Fraser PD, Pinto ME, Holloway DE, Bramley PM (2000) Technical advance:
application of high-performance liquid chromatography with photodiode array
detection to the metabolic profiling of plant isoprenoids. Plant J 24: 551-558

Fray RG, Wallace, A., Fraser, P. D., Valero, D., Hedden, P., Bramley, P. M.,
Grierson, G. (1995) Constitutive expression of a fruit phytoene synthase gene in
transgenic tomatoes causes dwarfism by redirecting metabloites from the
gibberellin pathway. Plant J 8: 693-701

Hammack L (2001) Single and blended maize volatiles as attractants for diabroticite
corn rootworm beetles. J Chem Ecol 27: 1373-1390

Havaux M (1998) Carotenoids as membrane stabilizers in chloroplasts. Trends Plant Sci
3: 147-151

Hirschberg J (2001) Carotenoid biosynthesis in flowering plants. Curr Opin Plant Biol
4: 210-218









luchi S, Kobayashi M, Taji T, Naramoto M, Seki M, Kato T, Tabata S, Kakubari Y,
Yamaguchi-Shinozaki K, Shinozaki K (2001) Regulation of drought tolerance
by gene manipulation of 9-cis-epoxycarotenoid dioxygenase, a key enzyme in
abscisic acid biosynthesis in Arabidopsis. Plant J 27: 325-333

luchi S, Kobayashi M, Yamaguchi-Shinozaki K, Shinozaki K (2000) A stress-
inducible gene for 9-cis-epoxycarotenoid dioxygenase involved in abscisic acid
biosynthesis under water stress in drought-tolerant cowpea. Plant Physiol 123:
553-562

Kiefer C, Hessel S, Lampert JM, Vogt K, Lederer MO, Breithaupt DE, von Lintig J
(2001) Identification and characterization of a mammalian enzyme catalyzing the
asymmetric oxidative cleavage of provitamin A. J Biol Chem 276: 14110-14116

Kohler RH, Cao J, Zipfel WR, Webb WW, Hanson MR (1997) Exchange of protein
molecules through connections between higher plant plastids. Science 276: 2039-
2042

Krysan PJ, Young JC, Sussman MR (1999) T-DNA as an insertional mutagen in
Arabidopsis. Plant Cell 11: 2283-2290

Lichtenthaler HK (1999) The 1-deoxy-D-xylulose-5-phosphate pathway of isoprenoid
biosynthesis in plants. Annu Rev Plant Physiol Plant Mol Biol 50: 47-65

Lincoln C, Britton JH, Estelle M (1990) Growth and development of the axrl mutants
of Arabidopsis. Plant Cell 2: 1071-1080

Lindqvist A, Andersson S (2002) Biochemical properties of purified recombinant
human beta-carotene 15,15'-monooxygenase. J Biol Chem 277: 23942-23948

Mangelsdorf DJ, Kliewer SA, Kakizuka A, Umesono K, Evans RM (1993) Retinoid
receptors. Recent Prog Horm Res 48: 99-121

Markwell J, Bruce BD, Keegstra K (1992) Isolation of a carotenoid-containing sub-
membrane particle from the chloroplastic envelope outer membrane of pea (Pisum
sativum). J Biol Chem 267: 13933-13937

McElver J, Tzafrir I, Aux G, Rogers R, Ashby C, Smith K, Thomas C, Schetter A,
Zhou Q, Cushman MA, Tossberg J, Nickle T, Levin JZ, Law M, Meinke D,
Patton D (2001) Insertional mutagenesis of genes required for seed development
in Arabidopsis thaliana. Genetics 159: 1751-1763