<%BANNER%>

Comparison of the Effects of a Processing Sequence and a Nuclear Export Element on Ribozyme Activity in Transfected Cells


PAGE 1

COMPARISON OF THE EFFECTS OF A PROCESSING SEQUENCE AND A NUCLEAR EXPORT ELEMENT ON RIBO ZYME ACTIVITY IN TRANSFECTED CELLS By EUN-JUNG CHOI A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2004

PAGE 2

ACKNOWLEDGMENTS I would like to thank Dr. Alfred Lewin for giving me the opportunity to join in his laboratory and for his advice, support, and trust during these projects. I would like to thank Dr. William Hauswirth for serving on my supervisory committee and for all of his guidance during completion of this thesis. I would like to thank Dr. Paul Oh for serving on my supervisory committee and for being an excellent mentor and confidant. I would especially like to thank my family in Korea, my mom and younger sister, as well as my mentors, Dr. Chang-Won Kang, Dr. Hoon-Taek Lee, Dr. Tae-Young Jung, Dr. Kil-Saeng Jung, and Dr. Hong-Yang Park, and friends here and Korea for their continuous support, cheer, and love over the years as I have pursued my dreams. I would especially like to thank my boyfriend, Koo Yung Jung, for his encouragement and love during my study. I would also like to thank all of my fellow laboratory colleagues for the advice, support, knowledge, and wisdom that they have bestowed upon me throughout the time that I have been in the masters program, especially Dr. Marina Gorbatyuk and James Thomas, who supervised most of the work presented in this thesis. ii

PAGE 3

TABLE OF CONTENTS page ACKNOWLEDGMENTS..................................................................................................ii LIST OF FIGURES.............................................................................................................v ABSTRACT......................................................................................................................vii CHAPTER 1 INTRODUCTION........................................................................................................1 2 MATERIALS AND METHODS...............................................................................15 ET-208 Design............................................................................................................15 Rz448-NHP-OHP, Rz448-ET208-OHP, and Rz448-OHP Constructs.......................15 Gel Purification of Oligonucleotides...................................................................16 Annealing Phosphorylated Oligonucleotides......................................................16 Digestion of the Circular AAV Packaging Vector with Proper Restriction Enzymes...........................................................................................................17 Gel Purification of Vector DNA..........................................................................17 Ligating Annealed DNA Oligonucleotide Insert and Vector DNA....................17 T4 Polymerase Treatment....................................................................................18 Bacterial Transformations..........................................................................................18 Large-Scale Cesium Chloride (CsCl) DNA Prep.......................................................19 Plasmid Labeling Reaction with Cy3 and Cy.......................................21 Co-transfection of HEK 293 Cells with Plasmids Expressing Target and Ribozyme...............................................................................................................21 Cell Preparation...................................................................................................21 Trnasfection.........................................................................................................22 Harvest of Co-Transfected Cells.........................................................................23 RNA Extraction from Co-Transfected HEK 293 Cells..............................................23 Analysis of Ribozyme Activity by Quantitative Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR).....................................................................................24 3 RESULTS...................................................................................................................27 Construction of Rz448-ET208-OHP Packaging Plasmid...........................................27 Construct of Rz448-OHP Packaging Plasmid............................................................28 iii

PAGE 4

The Co-Localization of Plasmids Expressing Target and Ribozyme within a Cell after Co-Transfection of HEK 293 Cells...............................................................28 Analysis of Ribozyme Activity by Quantitative RT-PCR..........................................28 Results from 1.5% Agarose Gels.........................................................................29 At a molar ratio of 1:4 of target to ribozyme...............................................29 At a molar ratio of 1:1 of target to ribozyme...............................................30 At a molar ratio of 1:2.2 of target to ribozyme............................................31 Results from 5% and 8% Polyacrylamide Gels Containing Urea.......................31 4 DISCUSSION AND FUTURE STUDIES.................................................................44 LIST OF REFERENCES...................................................................................................54 BIOGRAPHICAL SKETCH.............................................................................................60 iv

PAGE 5

LIST OF FIGURES Figure page 1-1 A contemporary view of gene expression................................................................10 1-2 Model for splicing coupled mRNA export in Metazoans........................................11 1-3 A model for the regulation of cargo binding and release by Ran............................12 1-4 The Ran cycle...........................................................................................................13 1-5 Hairpin and hammerhead ribozymes........................................................................14 2-1 Map of p21 NewHP packaging plasmid..................................................................25 2-2 Map of Rz448 cloned into p21 NewHP packaging plasmid....................................25 2-3 Map of ET-208 cloned into p21 NewHP Rz448 packaging plasmid.......................26 3-1 The Rz448 activity on the reduction of dog rhodopsin mRNA levels in transfected cells........................................................................................................34 3-2 Map of Rz448 and ET208 cloned into p21 NewHP packaging plasmid.................34 3-3 ET-208 PCR product from Rz448-ET208-OHP clones 1-6 NC= negative control.......................................................................................................................35 3-4 SmaI digest of Rz448-ET208-OHP clones 1-5 demonstrating presence of AAV ITRs..........................................................................................................................35 3-5 PCR amplification to confirm absence of ET-208 in Rz4448-OHP clones.............36 3-6 Plasmids containing ribozyme (Rz448-NHP-OHP, Rz448-ET208-OHP, and Rz448-OHP) were labeled with Cy3 (Red), while plasmids coding for target were treated with Cy5 (Blue)...............................................................................36 3-7 1:4 ratio of target to Rz separated on agarose gels...................................................37 3-8 Ratio of rhodopsin to beta-actin at a molar ratio of 1:4 (target: ribozyme).............38 3-9 1:1 ratio of target to Rz separated on agarose gels...................................................39 v

PAGE 6

3-10 Ratio of rhodopsin to beta-actin at a molar ratio of 1:1 (target: ribozyme).............40 3-11 Ratio of rhodopsin to beta-actin at a molar ratio of 1:2.2 (target: ribozyme)..........40 3-12 Picture of polyacrylamide gel containing urea stained with SYBR Green I and scanned by ImageQuant...........................................................................................41 3-13 Ratio of rhodopsin to beta-actin at a molar ratio of 1:4 (target: ribozyme).............41 3-14 Ratio of rhodopsin to beta-actin at a molar ratio of 1:1 (target: ribozyme).............42 3-15 Ratio of rhodopsin to beta-actin at a molar ratio of 1:2.2 (target: ribozyme)..........42 3-16 Picture of polyacrylamide gels containing urea stained with SYBR Green I and scanned by ImageQuant at a molar ratio of 1:2.2 (target: ribozyme)......................43 vi

PAGE 7

Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science COMPARISON OF THE EFFECTS OF A PROCESSING SEQUENCE AND A NUCLEAR EXPORT ELEMENT ON RIBOZYME ACTIVITY IN TRANSFECTED CELLS By Eun-Jung Choi December 2004 Chair: Alfred S. Lewin Major Department: Molecular Genetics and Microbiology Ribozyme-mediated gene therapy is an anti-sense approach to inactivate gene expression in order to reduce the accumulation of mutated proteins that cause diseases. Rhodopsin-linked autosomal dominant retinitis pigmentosa (ADRP) has been an optimal objective for ribozyme gene therapy for several reasons: 1) it is a slowly progressive disease, 2) it is easy to access the target tissue, and 3) the eye is an immunologically privileged site. Retinitis pigmentosa (RP) is a term that refers to a group of inherited disorders in which abnormalities of the photoreceptor cells (rods and cones) of the retina lead to blindness in approximately 1 in 3500 people in the U.S. In order for ribozyme therapy to be effective, it is critical that the ribozyme is expressed at high levels. Since efficient export of mRNAs from the nucleus into the cytoplasm plays an important role in their expression, the nuclear export element (NEE) can be beneficial to the field of ribozyme-mediated gene therapy. Transgene (i.e., ribozyme) expression can be regulated by both the transcriptional regulatory elements including the promoter, vii

PAGE 8

enhancer, intron, and poly(A) sequence and the post-transcriptional regulatory elements such as splice signal (SS), constitutive RNA transport element (CTE), and the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). The results of one of the studies being performed in our laboratory show that recombinant adeno-associated virus (rAAV)-delivered dog rod opsin-specific hammerhead ribozyme 448 (DogRhoRz448), which is an allele-independently designed ribozyme, can effectively reduce the levels of dog rhodopsin mRNA. The plasmid encoding DogRhoRz448 used in this previous study contains two self-cleaving hairpin ribozymes (new hairpin ribozyme [NHP] and old hairpin ribozyme [OHP]) as processing sequences. The function of the hairpin ribozyme is to free the hammerhead ribozyme 448 from the long primary transcript, thereby making Rz448 available to cleave its target. The matrix (M) protein of vesicular stomatitis virus (VSV) has been proposed to effectively inhibit Ran-dependent nucleocytoplasmic bidirectional transport of both RNA and proteins in Xenopus laevis oocytes. By using this inhibitor, the newly selected ET-RNAs (Exceptional Transport RNAs) were discovered. In this current study, we have replaced a self-cleaving hairpin ribozyme (NHP) in our Rz448 construct with ET-208, which is one of the ET-RNAs, to examine whether ET-208 could promote better expression of Rz448, resulting in greater knock down of dog rhodopsin expression. We found that ET-208 was able to enhance the ability of the Rz448 plasmid to reduce the levels of rhodopsin mRNA within co-transfected cells. viii

PAGE 9

CHAPTER 1 INTRODUCTION Many advances have been made in understanding the steps in the pathway of gene activation to synthesis of functional proteins. The contemporary view of gene expression proposes that several processes occurring in the nucleus and the cytoplasm are connected (1). According to this model, this pathway can be divided into 5 steps: transcription initiation (the beginning of RNA synthesis), transcription elongation (the extension of transcript), transcription termination, polyadenylation (the cleavage of RNA and the addition of a polyadenosine tail to the 3 end of the transcript) and translation (the synthesis of a protein from RNA). Growing evidence has revealed that these distinct stages of gene expression are functionally coupled (2-4) (Figure 1-1). The export of mRNA is coupled to other steps in gene expression involving splicing (5), transcription, and 3-end formation (2). For example, both splicing-dependent recruitment of the mRNA export machinery and exon-junction complex (EJC) formation are conserved in eukaryotic cell (2) (Figure 1-2). Spliced mRNAs are assembled into an individual spliced mRNP (ribonucleoprotein) complex that directs the mRNA for export (5,6). In addition to these export proteins, EJC contains numerous proteins involved in the cytoplasmic localization of mRNAs (2). EJC is made from that conserved mRNA export machinery and other components of the spliced mRNP are specifically recruited to a position 20 nucleotides upstream of exon-exon junctions (7). Once formed, the entire EJC is exported and then dissociates from the mRNA in the cytoplasm (8). Splicing is not essential for export but promotes the efficiency and/or 1

PAGE 10

2 fidelity of the process by increasing the more efficient recruitment of export factors (2) and generating a specific nucleoprotein complex (5). The mRNA export machinery and some components are also co-transcriptionally recruited (2). They interact with nucleoporins of the nuclear pore complex that are required for mRNA export and/or several mRNA export factors (2). 3-end formation is thought to be critical in co-transcriptional loading of the mRNA export machinery onto mRNAs (2). The nucleus and the cytoplasm are physically and functionally separated by the nuclear envelope in the eukaryotic cell. Genetic information is stored and transcribed from DNA to RNA in the nucleus, whereas the transfer of information from RNA to protein occurs in the cytoplasm (9). Therefore, the export of RNA to the cytoplasm is an important process. Additionally, the intracellular localizations of RNAs are essential for their correct processing as well as function (10). All major classes of RNA (mRNA, 5S rRNA, tRNA, snRNA, and rRNA) exit from the nucleus to the cytoplasm as RNA-protein complexes (9,11-13) via the nuclear pore complexes (NPCs) perforating the double-membraned nuclear envelope (14-16) using energy-dependent (17), carrier-mediated transport systems (18,19). The nuclear pore complex (125,000 kDa) is composed of 50-100 nucleoporin subunits. The subunits are arranged to produce a large central channel of 28nm and eight smaller peripheral channels of 9nm. The larger channel is used for active nucleocytoplasmic transport of large particles such as RNA-containing proteins and the smaller channels provide routes for passive diffusion of small molecules such as ions and metabolites (20,21). The distribution of RNA between the nucleus and the cytoplasm results from the interactions between RNAs and nuclear export elements (NEEs) or nuclear retention

PAGE 11

3 elements (NREs) as well as specific nuclear transport or localization factors (9,10,18,22-25). The export of RNA occurs in 3 steps. First, the RNA is transported to the nuclear envelope along the nuclear matrix and docked to specific nucleoporins at the nuclear entrance of the nuclear pore complex (15,18,26). Second, it is translocated through the central channel of the nuclear pore complex (27), and third it is transported along the cytoskeletal matrix (14). In addition, the Ran system is required for export of many RNAs dependent on Ran-GTPase and its associated binding, exchange, and activation factors (9,13,24,28,29) (Figure 1-3). The major guanine-nucleotide-exchange factor of Ran is the nuclear protein RCC1, whereas its main GTPase-activating protein, RanGAP1, is almost exclusively found in the cytoplasm (9) (Figure 1-4). This asymmetric distribution offers an attractive model to explain how direction could be achieved in nuclear transport (9). Binding of exportins to mRNAs is dependent on the presence of Ran-GTP. Export cargo release is accomplished by RanGTP hydrolysis, which is triggered in the cytoplasmic compartment by the RanGAP1 protein and additional factors (9). The Ran system is also needed for import of RNA export factors that must shuttle between the nucleus and the cytoplasm (18,30,31). Thus, mutation or inhibition of this system leads to obstruction of the export of most RNAs. Previous experiments have suggested that the matrix (M) protein of vesicular stomatitis virus (VSV) effectively inhibits Ran-dependent nucleocytoplasmic bidirectional transport of both RNA and proteins in Xenopus laevis oocytes (32) when it is in the nucleus and associated with the nuclear pore complexes (33). James E. Dahlbergs group used this inhibitor to select novel RNA sequences that overcome this block. Unlike typical transport of most RNAs, the newly selected ET-RNAs (exceptional

PAGE 12

4 transport RNAs) are exported efficiently even when the Ran system and related processes are disrupted (10). It means that export of these RNAs does not require protein factors and export pathways thought to be essential for export of most RNAs. The ET-RNAs were selected from a collection of RNAs containing 20 random nucleotides. Those that served as nuclear export elements fall into one of three sequences (10). In this study, we used ET-208, the strongest exporter of the selected ET-RNAs, in an attempt to enhance the expression of a ribozyme previously tested for gene therapy. Ribozymes are RNA molecules with enzymatic activities such as sequence-specific cleavage, ligation, and polymerization of nucleotides (34). Naturally occurring ribozymes have been grouped into several classes (34). Two of the more characterized ribozymes, which are from the group of self-cleaving viral agents, are the hairpin and hammerhead that naturally function as self-cleaving agents in viral replication (34,35). Their substrate specificity and small size provide therapeutic benefits for ribozyme-mediated gene therapies (34,36). Both ribozymes catalyze sequence-specific cleavage of RNA that results in products with 2, 3-cyclic phosphate and 5-hydroxyl termini (34,37). The hairpin ribozyme consists of a 34 nucleotide catalytic core, comprised of stems A and B that include all the nucleotides essential for hairpin ribozyme function (37), and four helices, of which helices I and II are responsible for target recognition (34) (Figure 1-5). The hammerhead ribozyme has a catalytic core of 11 nucleotides (37,38) that is stabilized by a hairpin structure and is flanked by two helices that are responsible for substrate recognition (34) (Figure 1-5). Both hairpin and hammerhead ribozymes can be designed to recognize substrates having a disease-causing point mutation (34,35). The hairpin ribozymes target gene transcripts containing a quintuple sequence 5YNGUC3,

PAGE 13

5 where N is any nucleotide and Y is a pyrimidine, while hammerhead ribozymes recognize less restricted sequences of substrate RNA containing a 5NUX3 triplet, where X is any nucleotide except guanosine (34-36). Ribozyme-mediated therapy is an anti-sense approach to inactivate gene expression in order to reduce the accumulation of mutated proteins that cause diseases such as rhodopsin-linked autosomal dominant retinitis pigmentosa (ADRP). Ribozymes have also been tested to block replication of RNA viruses or retroviruses and to inactivate dormant oncogenes such as ras or bcr-abl (36). There have been two kinds of therapeutic ribozyme design. One is that a ribozyme specifically targets and cleaves an mRNA substrate containing the nucleotide sequence of a point mutation, but fails to cleave an mRNA substrate containing the wild-type nucleotide sequence (allele-specific ribozymes) (35). The other is that a ribozyme targets the defective mRNA at site that is not altered by mutation (allele-independent ribozymes) (35). Such ribozymes could reduce the expression of both toxic (mutant) proteins and normal homologues encoded by the partner chromosome. This allele-independent approach is used as part of an RNA replacement strategy in which the ribozyme is accompanied by a ribozyme resistant mRNA encoding the wild-type protein. Retinitis pigmentosa (RP) is a term that refers to a group of inherited disorders in which abnormalities of the photoreceptor cells (rods and cones) of the retina (39) lead to blindness in approximately 1 in 3500 people in the U.S. (36). The disease is typically detected in the second decade of life as night blindness and loss of peripheral vision. The retinal degeneration is usually slowly progressive and may take decades before leading to legal blindness. Mutations affect the rod cells specifically, but later in the course of the

PAGE 14

6 disease, cone cells also undergo apoptosis and central vision is lost. Retinitis pigmentosa is caused by one of three types of a genetic defect: autosomal dominant inheritance, autosomal recessive inheritance, and X-linked inheritance. About 25% of RP is dominantly inherited (36). One of the causes of ADRP is a dominant negative mutation in rhodopsin where a histidine is substituted for a proline at codon 23 (P23H) in rhodopsin gene (39,40). This leads to the accumulation of abnormal rhodopsin proteins that ultimately results in the apoptotic death of photoreceptor cells (39) causing loss of vision (34,36). While P23H rhodopsin is most prevalent in North America, over 100 disease-causing mutations in rhodopsin lead to ADRP. In addition, mutations in over 25 other genes can lead to retinitis pigmentosa (40). One of the studies being conducted in our laboratory is to examine the therapeutic potential of recombinant adeno-associated virus (rAAV)-delivered hammerhead ribozymes targeting retinal mRNAs associated with ADRP. It is our hypothesis that ribozymes can diminish the production of mutated rhodopsin protein by selectively cleaving mRNA molecules encoding the aberrant forms of the proteins (34,36). The effectiveness of ribozyme-mediated reduction of mutant mRNAs that cause ADRP has been demonstrated in vivo in a P23H transgenic rat model. Eyes of rats that were injected with P23H specific ribozymes showed significant reduced rate of photoreceptor degeneration and vision loss (36,41,42). In order for ribozyme therapy to be effective, it is critical that the ribozyme is expressed at high levels. Since efficient export of mRNAs from the nucleus into the cytoplasm plays an important role in their expression, the nuclear export element (NEE) can be beneficial to the field of ribozyme-mediated gene therapy.

PAGE 15

7 The results of another study being preformed in our laboratory have shown that dog rod opsin-specific hammerhead ribozyme 448 (DogRhoRz448) can effectively reduce the levels of dog rhodopsin mRNA. This is a part of an RNA replacement strategy in which endogenous rhodopsin mRNA would be digested by ribozymes and replaced with a ribozyme resistant form of wild type mRNA. The ability of DogRhoRz448 to knock-down dog rod opsin was assessed in tissue cultured cells by co-transfecting HEK 293 cells with target (dog rhodopsin) cDNA and ribozyme 448 inserted in plasmids under the control of the chicken beta-actin (CBA) promoter coupled with the cytomegalovirus (CMV) enhancer. Ribozyme activity was assayed by quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) 48 hours post transfection. At a molar ratio of 1:4 and 1:6 of target to ribozyme, the level of dog rhodopsin mRNA was reduced by approximately 83% and 94% respectively compared to control. The significance of the study about the effectiveness of DogRhoRz448 is that dogs with a point mutation at T4R exhibit a retinal phenotype that closely imitates that in humans with rhodopsin mutations (43). Naturally occurring hereditary retinal degeneration in dog, which is caused by this mutation, is referred to progressive retinal atrophies (PRAs) (43). Therefore, using this nonhuman rhodopsin mutant large animal provides an inestimable tool to evaluate ribozyme-mediated therapies for ADRP before beginning of human clinical trials. Many examples of recombinant proteins whose expression in mammalian cells requires the presence of an intron (5,44,45). Especially, mRNAs that are transcribed from cDNAs are expressed poorly compared to the same mRNAs transcribed from a gene containing introns (5). For this reason, many available vectors contain an intron (5). The

PAGE 16

8 supporting evidence for a link between splicing and efficient mRNA export explains this intron requirement (5). Insertion of an intron into CMV expression cassettes greatly promotes gene expression in the cases that have been examined (5,46-48). In the absence of an intron within expression vectors, polyadenylation might target the mRNA lacking an intron for efficient export (5). The plasmid encoding dog rod opsin-specific hammerhead ribozyme 448 previously used in our research contains the ubiquitous chicken beta-actin promoter coupled with the CMV-enhancer driving high-level and stable expression of the ribozyme from AAV vector in vivo (49). Immediately downstream of the promoter is an intron, which should help in the accumulation and localization of ribozyme to cytoplasm (5). Two self-cleaving hairpin ribozymes are found immediately downstream of the ribozyme 448 which henceforth will be referred to as new hairpin ribozyme (NHP) and old hairpin ribozyme (OHP). The function of the hairpin ribozyme is to free the hammerhead ribozyme 448 from the long primary transcript, thereby making ribozyme 448 available to cleave its target. In addition, the plasmid contains two 145bp inverted terminal repeats (ITRs) of AAV2 that are absolutely required for packaging DNA into rAAV. Adeno-associated viruses (AAVs) contain a single-stranded, relatively small (~4.7kb) genome (50) which enables its manipulation in a plasmid to produce recombinant AAV in high titers (51). AAV is a good candidate for the ribozyme delivery with several features: 1) it has been shown to be able to infect a wide range of tissues including both dividing and non-dividing cells such as photoreceptors, 2) it does not induce an inflammatory immune response and has not been associated with any diseases in humans or animals, 3) it has a broad cell tropism, and 4) it can be integrated stably into

PAGE 17

9 the host cell genome or remain stable as an episome n non-dividing cells, leading to long-term expression of the delivered gene (52,53,54). It has been demonstrated that recombinant AAV injected subretinally was able to transduce all layers of the neuroretina as well as cells of the retinal pigment epithelium of adult nude mice (55). rAAV also has been shown to have no toxicity when injected subretinally into the eyes of rodents (54). rAAV vectors are deleted of both rep that encodes four regulatory proteins and cap that encodes three structural proteins genes (56), thus limiting its natural spread because both wild-type AAV and adenovirus would be required for its propagation (57). In this current study, we examined whether ET-208 could promote better expression of ribozyme 448, resulting in greater knock down of dog rod opsin expression. We have replaced a self-cleaving hairpin ribozyme (NHP) in our dog rod opsin-specific ribozyme 448 construct with ET-208. We discovered that this element enhanced the ability of the ribozyme plasmids to reduce accumulation of rhodopsin mRNA.

PAGE 18

10 Figure 1-1. A contemporary view of gene expression. Recent findings suggest that each step regulating gene expression is a subdivision of a continuous process. In this contemporary view of gene expression, each stage is physically and functionally connected to the next, ensuring that there is efficient transfer between manipulations and that no individual step is omitted (Source: Reference 1).

PAGE 19

11 Figure 1-2. Model for splicing coupled mRNA export in Metazoans. (A) UAP56 and Aly associate with the splicesome. Simplified pre-mRNA with a 5 cap, 2 exons and an intron, and a poly(A) tail, hnRNP proteins package the pre-mRNA, and SR proteins associate with exons. (B) The Tap-p15 heterodimer targets the mRNP to the nuclear pores. Aly acts as bridging protein between the exon-junction complex (EJC) and Tap-p15. (C) mRNA export factors dissociate from the mRNP after export to the cytoplasm. Factors involved in NMD (e.g. Upf3, Y14, and RNPS1) remain bound to the mRNP (Source: Reference 4).

PAGE 20

12 Figure 1-3. A model for the regulation of cargo binding and release by Ran. The asymmetric distribution of the two different Ran forms can be used to regulate the binding and release reactions between different carriers and their cargos. Binging of exportin to their export substrates is dependent on the presence of Ran-GTP. Cargo release is achieved by RanGTP hydrolysis, which is triggered in the cytoplasmic compartment by the RanGAP1 protein and additional factors (Source: Reference 5).

PAGE 21

13 Figure 1-4. The Ran cycle. The small nuclear GTPase Ran switches between a GDPand a GTP-bound state. Ran GTP/GDP cycle is regulated by Ran-guanine-Nucleotide-exchange factors (RanGEFs) and by Ran-GTPase-activating proteins (RanGAPs). The major RanGEF is RCC1, whereas the major RanGAP is RanGAP1 (Source: Reference 5).

PAGE 22

14 Figure 1-5. Hairpin and hammerhead ribozymes. Schematic diagram of hairpin and hammerhead ribozymes hybridized to their target sequences. Short bars represent conventional base pairs, and dots represent non-standard base pairings. Target sequences are shown in gray shading, and arrows indicate cleavage sites. Helices are numbered with roman numerals (Source: Reference 32).

PAGE 23

CHAPTER 2 MATERIALS AND METHODS ET-208 Design Sense and antisense DNA oligonucleotides coding for ET-208 and including a region of 20 nucleotides (5 TTGAGGGCCCTCATTGCCGC 3) that served as NEE were designed with flanking restriction sites, SpeI and NsiI and ordered from Invitrogen. The length of the sense and antisense strands are 45 and 37 nucleotides respectively, and the 5 ends of both oligonucleotides were phosphorylated. Rz448-NHP-OHP, Rz448-ET208-OHP, and Rz448-OHP Constructs The construct, Rz448-NHP-OHP (Figure 2-2) containing dog rod opsin-specific hammerhead ribozyme 448, was designed by inserting the sequence for Rz448 between the HindIII and SpeI restriction sites in the P21NHP plasmid (Figure 2-1). This plasmid contains the CMV enhancer coupled with the CBA promoter driving the expression of the ribozyme, an intron, two self-cleaving hairpin ribozymes (NHP and OHP) that are found immediately downstream of the RZ448, and two ITRs. The Rz448-ET208-OHP construct (Figure 2-3) was designed by removing the NHP ribozyme with an SpeI and NsiI digest and inserting the ET-208 sequence between those sites. The Rz448-OHP construct was made by removing the ET-208 sequence from the Rz448-ET208-OHP plasmid with an SpeI and NsiI digestion. The SpeI and NsiI cohesive ends were then treated with T4 DNA polymerase to blunt the ends and ligated to seal the plasmid. 15

PAGE 24

16 Gel Purification of Oligonucleotides The cloning efficiency of Rz448 and ET-208 can be improved by polyacrylamide gel purification of the oligonucleotides before using them in a ligation reaction. 900 picomoles of each sense and antisense oligonucleotide were mixed with 4ul of formamide loading dye [90% (w/v) formamide, 50mM EDTA, 0.4% (w/v) xylene cyanol, and 0.4% (w/v) bromphenol blue] and incubated at 90C for 1 min, and then loaded on the acrylamide gel. The oligos were separated on a 10% (w/v) acrylamide gel run in 1X TBE buffer [89mM Tris borate, pH 8.3, and 20mM EDTA]. The gel was run at 500-600V and no more than 40 mA. After the bromphenol blue tracking dye had run about two-thirds the length of a 20cm gel, the gel was transferred to a 2020 cm Fluor-coated TLC plate. In a dark room, a short-wavelength UV hand lamp was used to visualize the DNA band. The bands were then excised with a scalpel, crushed in 200ul of elution solution [1M ammonium acetate, 50mM Tris HCl (pH 7.5), 20mM EDTA, 0.5% (w/v) SDS] in a sterile 1.5ml microcentrifuge tube, and eluted overnight at 37C. The elution solution was then removed from the gel slices, and the DNA was ethanol (EtOH) precipitated, resuspended in 10ul of dH2O. Its concentration was determined by the absorbance at 260nm and stored at -20C. Annealing Phosphorylated Oligonucleotides In a sterile 1.5ml microcentrifuge tube, the following contents were combined 20ul of each oligonucleotide (sense and antisense), 10ul of 10X buffer (for restriction enzyme HindIII from Promega), and dH2O to 100ul. The final volume of reaction solution was 100ul. A reaction tube was then heated to 90C for 5 min and slow-cooled at 37C for another 10 min. The 10ul of the annealed DNA oligonucleotides, which was diluted in

PAGE 25

17 990ul of dH2O (diluted at 1:100). This dilution was then used for the subsequent cloning step. Digestion of the Circular AAV Packaging Vector with Proper Restriction Enzymes The reaction solution was composed of 10ul of resuspended circular plasmid, 1ul of a desired restriction enzyme (here, HindIII, SpeI, and NsiI), 2ul of 10X enzyme buffer, 2ul of 10X BSA, and dH2O to 20ul in a sterile 1.5ml microcentrifuge tube. The reaction tube was then incubated at 37C for 1 hr. The linearized AAV packaging plasmid DNA was ethanol precipitated, and then the second digestion was performed. Finally, the vector plasmid was ready for gel purification. Gel Purification of Vector DNA Before ligation, agarose gel purification of the linearized AAV packaging vector was performed by running the digest on a 1% agarose gel and staining with ethidium bromide (EtBr) [10mg/ml]. The proper band was then excised after visualization with low-intensity UV light. The excised band was then crushed in a sterile 1.5 ml microcentrifuge tube and mixed with an equal volume of phenol (~pH 8.0) to elute the DNA. The contents were mixed well by vortexing and then incubated at -70C for 1 hour and centrifuged for 5 minutes at 13,200 rpm. Next, the aqueous phase was extracted with an equal volume of phenol: chloroform: isoamyl alcohol (50:50:1, v/v/v) to eliminate all protein contamination. The linearized DNA was precipitated by the addition of two volumes of 100% EtOH. Finally, the sample is resuspended in 10ul of dH2O. Ligating Annealed DNA Oligonucleotide Insert and Vector DNA For different sized plasmid DNAs, the amount of oligonucleotide and linearized plasmid vector DNA should be adjusted to maintain an appropriate ratio of oligonucleotide: vector ends. Here, we used the ratio of annealed oligonucleotide and

PAGE 26

18 linearized vector plasmid DNA that is 3:1. The following components were combined in a sterile 1.5ml microcentrifuge tube: 3ul of DNA oligonucleotide inserts that had been phosphorylated and annealed, 1ul of vector DNA that has been linearized with the proper enzymes, 1ul (10units) of T4 DNA ligase, 2ul of 10 ligase buffer [500mM Tris-HCl (pH 7.5), 100mM MgCl2] (from BioLabs), and dH2O up to 20ul. The reaction is incubated at room temperature for 2 hr or 16C overnight. After incubation, the ligated plasmid DNAs (Rz448-NHP-OHP and Rz448-ET208-OHP) were ethanol precipitated, resuspended in 10ul of dH2O. T4 Polymerase Treatment The function of T4 DNA polymerase is to blunt cohesive ends on double-stranded DNA molecules with 5or 3protruding termini by 3 overhang removal and 3 recessed end fill-in. In a 1.5ml microcentrifuge tube, the following contents were combined: 10ul of digested DNA, 1ul of 2mM dNTPs, 2ul of T4 DNA polymerase, 2.5ul of 10X T4 DNA polymerase buffer, and dH2O to 25ul. A tube was then incubated at 22C for 30min and heated to 70C for 5 min to inactivate T4 DNA polymerase. Rz448-OHP was than ethanol precipitated and resuspended in 10ul of dH2O. Bacterial Transformations We use one of several recombination deficient strains of Escherichia coli, such as Sure cells (Stratagene), in order to prevent loss of the AAV inverted terminal repeat (ITR) sequences present in the AAV packaging vector. ITRs are critical for packaging plasmid inserts as recombinant AAV vectors (34). 2ul of the ligation reaction were used to transform electro-competent E.coli cells according to Sambrook and Russel (58). 20ul of Sure cells were mixed with 2ul of the ligated plasmids and electronically charged at

PAGE 27

19 1.5V. Transformed cells were suspended in 1ml of autoclaved LB media are incubated in a thermomixer at 37C shaking at 750 rpm for 1 hr to allow cell growth. Growing cells were then plated on LB/ ampicilin (Amp) plates for selection of colonies containing the ligated plasmid DNAs, and grown at 30C overnight to a low density to help preserve ITRs. After growing overnight, several colonies were picked out and inoculated in 5ml of LB media with ampicilin followed by another growing at 30C overnight with shaking. After overnight incubation, increased amounts of three constructs were extracted by using Perfectprep Plasmid Mini kit from Eppendorf. The Eppendorf mini prep kit was performed according to the manufacturers recommendations. All clones are screened for ITR retention by an SmaI digest followed by running 0.7% or 0.6% agarose gels. The plasmids were then sequenced for proper Rz448 and ET208 orientation. Large-Scale Cesium Chloride (CsCl) DNA Prep This procedure allows us to increase the amount of the three constructs and to accomplish a highly purified preparation of DNA for transfection. After sequencing the plasmids, Sure cells were transformed with these plasmids and spread on and LB/Amp plate. A colony was inoculated in 5ml of LB/Amp media, and then 2 ml of this preculture was inoculated and grown in 1L of LB/Amp media at 30C. After incubation for 14 hours, the culture was transferred to a bottle and centrifuged at 4000 rpm for 10 min to pellet the bacterial cells. The supernatant was decanted, making sure not to disturb the cell pellet. 30 ml of Tris-EDTA buffer was added to the cell pellet and completely resuspended. Cell lysis solution [0.2M NaOH, 1% SDS] is then added to the resuspension and mixed well. This resuspended mixture was incubated for 5 min at room temperature until the lysate is relatively clear with no visible clumps of cell material.

PAGE 28

20 After the addition of 30 ml of neutralizing solution [3M sodium acetate (NaAc) pH 5.2] to the lysate, it was mixed well and placed on ice for 10 min. The neutralized lysate was centrifuged at 10,000 rpm for 15 min and the aqueous phase was poured off through 3 layers cheesecloth. The volume was then determined, and 0.6 volumes of 2-isopropanol was added. The mixture was incubated on ice for 1 hour. After centrifugation at 10,000 rpm for 30 min, the supernatant was removed. The pellet was gently washed 1 time with 70% EtOH and air dried for 30 min. The DNA pellet was then resuspended in 8 ml of Tris-EDTA buffer. 8.4 g of CsCl was dissolved in the DNA, and 150ul of ethidium bromide (EtBr) [10mg/ml] was added to the CsCl-DNA mixture. The DNA was then transferred to an ultracentrifuge tube, and spun overnight (at least 16 hours) in NVT 65 at 55,000 rpm, 20C, and under vacuum. On the next day, the plasmid DNA band (lower band) was extracted using a short-wavelength UV hand light to visualize the DNA band stained with EtBr. Plasmid DNAs were transferred to a 15ml conical tube and the EtBr was removed from the DNA with a series of isoamyl alcohol extractions. 2.5 volumes of dH2O were added to DNA, followed by an addition of 2 volumes of 100% ethanol in 20ml Corex tubes. Tubes were incubated on ice for 1 hour. After incubation, plasmid DNAs were pelleted at 12,000 rpm for 15 minutes at 4C. The supernatant was removed, the DNA pellet was washed with 70% EtOH, and was dried in a speed vac. The DNA pellet was resuspended in 400ul of Tris-EDTA buffer, and then transferred to a sterile microcentrifuge tube. 40ul of neutralizing buffer [3M NaAc pH 5.2] and 1ml of 100% EtOH were added to the DNA and mixed well. The DNA is then incubated at room temperature for 10-15 minutes. The plasmid DNA was pelleted for 5 min at 13,200 rpm. The supernatant was decanted and washed with 70% EtOH followed by drying it in a

PAGE 29

21 speed vac. The DNA was resuspended in 400ul of dH2O and its concentration is determined by absorbance at 260nm. Plasmid DNAs were stored at -20C. Plasmid Labeling Reaction with Cy3 and Cy The use of the Cy and Cy dyes allows us to monitor the intracellular localization of plasmid DNA in cells following the transfection. According to manufactures description, the Label IT Reagents covalently attach marker molecules to nucleic acids in a chemical reaction. Prepare at least 25% more plasmid DNA in weight than needed to account for pipetting/transfer errors. In this study, three different constructs (Rz448-NHP-OHP, Rz448-ET208-OHP, and Rz448-OHP) were labeled with Cy, which gives you red color, and target plasmid DNA encoding dog rhodopsin are labeled with Cy, blue color. In a sterile 1.5ml microcentrifuge tube, the following components were combined for a 50ul plasmid labeling reaction: an appropriate volume of plasmid DNA in weight is diluted in dH2O to bring the DNA to the proper volume of labeling reaction, 2.5ul of Label IT Tracker Reagent (Cy or Cy dye), and 5ul 0f 10X labeling buffer A. The non-enzymatic Label IT Tracker Intracellular Nucleic Acid Localization Kit from Mirus was performed according to the manufacturers recommendations. After this, the concentration of labeled plasmid DNA is re-determined by absorbance at 260nm. Co-transfection of HEK 293 Cells with Plasmids Expressing Target and Ribozyme Cell Preparation We chose to use human embryonic kidney (HEK) 293 cells, because they do not express our target (dog rhodopsin) which should eliminate target background. For our experiments, we used that under passage 41. Cells were grown and maintained in Dulbeccos modified Eagles medium (DMEM, Sigma-Aldrich Co.) supplemented with

PAGE 30

22 10% fetal bovine serum (FBS, Sigma-Aldrich Co.), 100U/ml of penicillin, 100mg/ml of streptomycin (10X PenStrep, Mediatech, Cellgrow, VA). The day before transfections, the cells were trypsinized and counted on an hemacytometer so that they will be 90-95% confluent on the day of transfection. Trnasfection Transfections were preformed in triplicate or quadruplicate. To account for pipetting/transfer errors, all were prepared at least 25% more reaction volume than needed. DMEM media were removed from cells plated on day before transfection and replaced with fresh media lacking antibiotics (9ml for a 10cm dish or 1.5ml for 6-well [35mm] plate). Opti-Mem I Reduced Serum Medium (Sigma-Aldrich Co.) without serum is used to dilute plasmids carrying target and ribozymes and transfection Lipofectamine 2000 Reagent (Invitrogen). For multiple dishes, make a bulk mix of plasmids. For each 10cm tissue-culture dish, 10ug of total plasmid DNA (target + ribozyme) were diluted in 1ml of Opti-Mem. 4ug of total plasmid DNA were dissolved in 250ul of Opti-Mem for each well of a 6-well plate. The diluted target and ribozyme plasmid DNA were incubated separately for 5min at room temperature, and then mixed together and incubated for an additional 10 minutes. The diluted Lipofectamine 2000 Reagent was incubated at room temperature for 10 min. 3ul of Lipofectamine 2000 Reagent was used per 1ug of DNA. Once Lipofectamine 2000 Reagent was diluted, it was combined with the diluted plasmid DNA and incubated for 20 min at room temperature. The complexes were added directly to each dish or well containing cells and medium [DMEM with 10% FBS (without antibiotics)] and gently rocked. The plates

PAGE 31

23 were incubated with transfected cells in a 5% CO2 incubator at 37C to maintain growing cells for 48 hours. Harvest of Co-Transfected Cells 48 hours post-transfection, cells were trypsinized to remove them from culture plates and pelleted by centrifugation at 4000 rpm for 5 min at 4C. The trypsin supernatant was removed and the cell pellet was then washed with 500ul of 1X PBS twice. RNA Extraction from Co-Transfected HEK 293 Cells RNA was extracted by using GenElute Mammalian Total RNA kit from Sigma. The GenElute Mammalian Total RNA kit was performed according to the manufacturers recommendations. After RNA extraction, the eluted RNA is treated with DNase (DNAfree from Ambion) to remove contaminating DNA from RNA preparation. According to the product description, contaminating DNA is digested to levels below the limit of detection by routine PCR by using DNAfree. The concentration of DNase treated RNA was determined by absorbance at 260nm. PCR was conducted to verify that no DNA contaminants have been eliminated from the RNA preparation. In a sterile PCR tube, the following contents were combined: an appropriate volume of 1ug of RNA, 1ul of primer I [15 pmol/ul] (sense strand of dog rhodopsin oligonucleotide), 1ug of primer II [15pmol/ul] (antisensestrand of dog rhodopsin oligonucleotide), 2.5ul of 10X Mg free buffer, 2ul of MgCl2, 1ul of dNTPs [10mM], 0.5ul of Taq polymerase, and dH2O to bring the PCR solution to 25ul. After 20 or 30 cycles, PCR products are run on a 1.5% agarose gel, and then compared to the negative control. If nothing is amplified, we consider our RNA preparation to be free of DNA.

PAGE 32

24 Analysis of Ribozyme Activity by Quantitative Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) This allows for generating first-strand cDNA from an RNA template by using proper primers. We used First-Strand cDNA Synthesis kit from Amersham Bioscience to reverse transcribe RNA to cDNA. The reverse transcriptase reaction was set up as described the protocol of the kit to synthesize first-strand cDNAs of dog rhodopsin and beta-actin (2 ug of RNA used for 15ul reaction). To avoid pipetting variation, the reverse transcription reaction for both genes was done in the same tube using sequence-specific antisense primers [40 pmol/ul]. PCR reaction for dog rhodopsin and beta-actin control was set up separately, since their optimized amplification conditions (annealing temperature and extension time) are different. For detection of PCR products, 5ul or 10ul of each reaction was loaded on an 1.5% agarose gel or an polyacrylamide gel respectively. 5% and 8% polyacrylamide gels were used for beta-actin and dog rhodopsin respectively. For quantitating PCR products run on the 1.5% agarose gel, the Gel Quantification program from BioRad was used to quantitate. After the bromphenol blue tracking dye has run about two-thirds the length of a 30cm gel at 400V/ no more than 40mA, the gels were stained with a nucleic acid attain, SYBR Green I (Molecular Probes), which is diluted 1:10,000, for 15-20 min. The stained gels are analyzed to determine the volume of each PCR product using the PhosphoImager and Image Quant program. Numerical values were obtained and ratios of rhodopsin to beta-actin were calculated.

PAGE 33

25 p21NewHP Figure 2-1. Map of p21 NewHP packaging plasmid. Figure 2-2. Map of Rz448 cloned into p21 NewHP packaging plasmid.

PAGE 34

26 Figure 2-3. Map of ET-208 cloned into p21 NewHP Rz448 packaging plasmid.

PAGE 35

CHAPTER 3 RESULTS As discussed in the introduction, Dr. Marina Gorbatyuk had already tested a highly active ribozyme against dog rhodopsin mRNA. Ribozyme activity was assayed by quantitative RT-PCR 48 hours post transfection with HEK 293 cells. At a molar ratio of 1:4 and 1:6 of target to ribozyme, the level of dog rhodopsin mRNA was reduced by approximately 83% and 94% respectively compared to control (Figure 3-1). Therefore, we used this ribozyme (Rz448) to test the effects of the targeting sequences. Construction of Rz448-ET208-OHP Packaging Plasmid After inserting the ET-208 and dog rhodopsin Rz448 sequences into the p21NewHP plasmid, the presence of the ET-208 and Rz448 sequences in the cloned vector was examined by performing a 25 cycle PCR amplification of the sequences between SpeI and NsiI (Figure 3-2). PCR products were run on 1.5% agarose gel and stained with EtBr (Figure 3-3). In addition, the clones were screened for ITRs that are absolutely necessary for packaging of AAV. ITR retention was determined by performing a SmaI digest, and running the digested plasmid on a 0.6% agarose gel (Figure 3-4). Each AAV ITR contains two SmaI restriction sites within its sequence. If both ITRs are present, a SmaI digest yields two bands that are 3608bp and 3013bp in size (Figure 3-4). To verify proper orientation and correct sequence of ET208 and RZ448, all clones were examined by sequencing analysis. 27

PAGE 36

28 Construct of Rz448-OHP Packaging Plasmid The Rz448-OHP plasmid, which lacks both the NHP ribozyme and ET-208, was constructed to serve as a control plasmid in our comparison experiments. Since this construct is based on the Rz448-ET208-OHP plasmid, the absence of ET-208 was confirmed by performing a 30 cycle PCR with a sequence-specific sense primer for p21 NHP and the antisense strand of ET-208. Plasmids containing the ET-208 were also amplified to serve as positive controls (PC). Amplified PCR products were run on a 1.5% agarose gel and stained with EtBr (Figure 3-5). Rz448-OHP clones 1 and 2 do not have bands corresponding to the ET-208 band in the PC lanes (Figure 3-5). The Rz448-OHP clones were also screened for ITR and sequenced to confirm the absence of ET208 (Data not shown). The Co-Localization of Plasmids Expressing Target and Ribozyme within a Cell after Co-Transfection of HEK 293 Cells To visualize the co-localization of plasmids expressing target and ribozyme in co-transfected HEK 293 cells, plasmids were labeled with fluorescent dyes before transfection. Dyes were visualized with a confocal microscope (BioRad) at 48 hours post-transfection. In Figure 3-6 (X20), cells bearing plasmids encoding ribozyme are seen as a red dot and cells including a plasmid containing target are shown as a blue spot. In the case of cells holding both plasmids expressing target and ribozyme are indicated as a spot of violet color. Analysis of Ribozyme Activity by Quantitative RT-PCR The activity of ribozyme 448 targeting dog rod opsin RNA was assayed by quantitative RT-PCR 48 hours post transfection. For this, we extracted total RNA and compared the levels of target rhodopsin mRNA to an unchanged cellular mRNA, beta

PAGE 37

29 actin. The mRNAs for dog rhodopsin and beta-actin were reverse transcribed and their cDNAs were amplified. The PCR products from both templates were run on a 1.5% agarose and 5-8% polyacrylamide gel to quantitate the amount of beta-actin and dog rhodopsin mRNA levels. Results from 1.5% Agarose Gels At a molar ratio of 1:4 of target to ribozyme Cotransfection of HEK 293 cells was conducted in triplicate. On a 1.5% agarose gel, rhodopsin ran as a single band corresponding to ~350bp (Figure 3-7a), whereas a band corresponding to ~750bp was obtained from beta-actin (Figure 3-7b). A brighter band indicates that the lane has more rhodopsin cDNA than a faint band. In a faint band, the level of rhodopsin cDNA was decreased by the ribozyme activity. The control cells did not have a plasmid expressing a dog rhodopsin-specific ribozyme. As shown in Figure 3-7a, the control samples loaded in last three lanes are much brighter than the other variants. This suggests that the other three variants (Rz448-NHP-OHP, Rz448-ET208-OHP and Rz448-OHP from left to right) expressing ribozyme caused the significant reduction in rhodopsin mRNA. On the other hand, in the case of beta-actin, the intensity of each band is similar between experimental and control variants (Figure 3-7b). Since beta-actin is a should not be affected by the ribozyme in HEK 293 cells, its expression level should be unchanged and can therefore be used as an internal control for these experiments. Using Excel (Microsoft), the ratio of rhodopsin to beta-actin was averaged and indicated in a bar graph (Figure 3-8). According to these calculations, the level of dog rhodopsin mRNA from all experimental variants was equally reduced by approximately 90% as compared to the control cells lacking ribozyme. This finding confirms the previous results that the levels of dog rhodopsin mRNA in transfected cells

PAGE 38

30 can be decreased by the activity of dog opsin-specific ribozyme 448. However, since we could not see a difference among the three plasmids expressing the ribozyme, we could not ascertain whether ET-208 could promote better expression of ribozyme 448, and cause a resulting in greater knock-down of dog rod opsin mRNA expression at this ratio (1:4, target: ribozyme). At a molar ratio of 1:1 of target to ribozyme As stated above, since a significant decrease was observed in all experimental variants tested (NHP-OHP, ET-208-OHP, or OHP) (Figure 3-7a), we could not judge which one was best in reducing the levels of dog rhodopsin mRNA. For this reason, we decided that decreasing the molar ratios of target to ribozyme was necessary to see differences among the three experimental variants. To accomplish this, we designed a second transfection experiment done in quadruplicate, at a molar ratio of 1:1 (target to ribozyme). These cells were processed using the same procedures for post-transfection incubation times and RNA isolation. RT-PCR was performed and equal volumes of DNA products were loaded. Representative results for rhodopsin and beta-actin are shown in Figures 3-9a and 3-9b, respectively. Based on the intensity of the rhodopsin bands relative to the beta-actin bands, we can asses a greater or lesser efficacy in ribozyme function. Of the three plasmids tested, Rz448-ET208-OHP resulted in the highest reduction of rhodopsin mRNA. In contrast, with the Rz448-OHP plasmid, virtually the same level of rhodopsin mRNA was observed compared to untreated control (Figure 3-9a). As see in lanes 1-4 (Figure 3-9a), the plasmid having Rz448-NHP-OHP showed higher levels of rhodopsin as compared to lanes 9-12, Rz448-OHP used as a control for NHP and ET-208 (Figure 3-9a). Levels of beta-actin as seen of the agarose gel, mRNAs were determined to be equal from all variants and controls (Figure 3-9b). These findings

PAGE 39

31 demonstrated that ET-208 elevated the expression of the ribozyme 448 and resulted in the best knock-down of dog rhodopsin mRNA among the experimental variants. As illustrated in Figure 3-10, the averaged mRNA ratio of rhodopsin to beta-actin for Rz448-ET208-OHP was reduced by approximately 73% compared to control. Using Rz448 with just the old hairpin ribozyme (Rz448-OHP) the level of dog rhodopsin mRNA was decreased by approximately 36%. However, in the case of Rz448-NHP-OHP, almost no difference (reduction of ~9%) was observed. As a result of these findings, we propose that the ET-208 sequence can significantly reduce the amount of dog rhodopsin mRNA by the expression of ribozyme 448 at a high level. At a molar ratio of 1:2.2 of target to ribozyme An intermediate ratio of 1:2.2 was also examined to confirm our findings in the 1:1 ratio experiment. Cotransfections were performed in quadruplicate. The results are shown in Figure 3-11. Approximately 55% reduction in mRNA levels was obtained using Rz448-ET208-OHP, whereas an approximately 32% decrease was observed using Rz448-OHP. Although the reduction difference was not as high as in the 1:1 ratio experiment, ET-208 was still the most efficient in reducing levels of dog rhodopsin mRNA among the three experimental variants. This finding confirms the previous results that the most decreased level of dog rhodopsin mRNA was shown in cells transfected with plasmids containing the ET-208 element. Results from 5% and 8% Polyacrylamide Gels Containing Urea A 10ul portion of the same cDNA created for the agarose gel experiment was used for polyacrylamide gel electrophoresis. An 8% polyacrylamide gel was used to resolve the ~350bp rhodopsin PCR product, while an 5% gel was used for the ~750bp beta-actin product. These gels were stained with a nucleic acid stain, SYBR Green I (Molecular

PAGE 40

32 Probes). The fluorescence of the DNA bands was measured on the Storm Phosphorimager (Molecular Dynamics) using the program ImageQuant. Numerical values were obtained and ratios of rhodopsin to beta-actin were calculated (Figure 3-12). A graphical representation of the averaged ratios of rhodopsin to beta-actin using the three molar ratios of target to ribozyme (1:4, 1:1, and 1:2.2) is illustrated in Figure 3-13, 3-14, and 3-15, respectively. In the case of molar ratio 1:4, the pattern of reduction of all three experimental variants was similar to the results obtained from agarose gel. However the rate of reduction was slightly decreased from 90% to 75% (Figure 3-13). At a molar ratio of 1:1 (Figure 3-14), the amount of dog rhodopsin mRNA that was reduced is the same as that observed in agarose gel. The levels of rhodopsin mRNA were reduced by approximately 58% for both NHP and ET-208, while a reduction rate of about 31% was observed using OHP alone. Strikingly, there was no significant difference in the reduction between NHP and ET208 (Figure 3-14). The results based on the agarose gel demonstrated approximately 73% and 9% reduction rate for ET-208 and NHP respectively compared to control. Unexpected results were also obtained at the molar ratio of target: ribozyme, 1:2.2 and are shown in Figure 3-15. NHP showed a greater reduction of rhodopsin mRNA levels than ET-208. There was a decrease in the detected cleavage for the 1:2.2 ratio as compared to the 1:1. While the 1:1 ratio showed a decrease of 58% for both ET-208 and NHP, the 1:2.2 ratio showed a decrease of 20% and 43% respectively. From these observations, we concluded that ET-208 promotes the expression of Rz448 more efficiently when the target and ribozyme are expressed at equal molar ratios. This

PAGE 41

33 combination of 1:1 (target: ribozyme) results in the greatest reduction of dog rhodopsin mRNA.

PAGE 42

34 Figure 3-1. The Rz448 activity on the reduction of dog rhodopsin mRNA levels in transfected cells (Courtesy of Dr. M. Gorbatyuk). Figure 3-2. Map of Rz448 and ET208 cloned into p21 NewHP packaging plasmid.

PAGE 43

35 NC std 1 2 3 4 5 6
PAGE 44

36 < ET-208 PC PC std 1 2 3 Figure 3-5. PCR amplification to confirm absence of ET-208 in Rz4448-OHP clones. PC= positive control. Figure 3-6. Plasmids containing ribozyme (Rz448-NHP-OHP, Rz448-ET208-OHP, and Rz448-OHP) were labeled with Cy3 (Red), while plasmids coding for target were treated with Cy5 (Blue) (A confocal microscope by BioRad X20).

PAGE 45

37 A. C NHP ET208 OHP Con C std 1 2 3 4 5 6 7 8 9 10 11 12 B C NHP ET208 OHP Con C std 1 2 3 4 5 6 7 8 9 10 11 12 Figure 3-7. 1:4 ratio of target to Rz separated on agarose gels. A) Rhodopsin cDNA (~350 bp). Rz448-NHP-OHP clones 1-3, Rz448-ET208-OHP clones 4-6, Rz448-OHP clones 7-9, and control 10-12. C= control containing dog rhodopsin DNA for PCR. B) Beta-actin cDNA (~750 bp). Rz448-NHP-OHP clones 1-3, Rz448-ET208-OHP clones 4-6, Rz448-OHP clones 7-9, and control 10-12. C= control containing beta-actin DNA for PCR.

PAGE 46

38 At a Molar Ratio of 1:4(Target : Ribozyme)Control Rz448+NHP(OHP) Rz448+ET208(OHP) Rz448(OHP)00.40.81.2Ratio of RHO to b-Actin Figure 3-8. Ratio of rhodopsin to beta-actin at a molar ratio of 1:4 (target: ribozyme)

PAGE 47

39 A. C NHP ET208 OHP Con C std 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 B. C NHP ET208 OHP Con C std 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 Figure 3-9. 1:1 ratio of target to Rz separated on agarose gels. A) Rhodopsin cDNA (~350 bp). Rz448-NHP-OHP clones 1-4, Rz448-ET208-OHP clones 5-8, Rz448-OHP clones 9-12, and control 13-16. C= control containing dog rhodopsin DNA for PCR. B) Beta-actin cDNA (~750 bp). Rz448-NHP-OHP clones 1-4, Rz448-ET208-OHP clones 5-8, Rz448-OHP clones 9-12, and control 13-16. C= control containing beta-actin DNA for PCR.

PAGE 48

40 At a Molar Ratio of 1:1(Target : Ribozyme)Control Rz448+NHP(OHP) Rz448+ET208(OHP) Rz448(OHP)048121620Ratio of RHO to b-Actin Figure 3-10. Ratio of rhodopsin to beta-actin at a molar ratio of 1:1 (target: ribozyme) At a Molar Ratio of 1:2.2(Target : Ribozyme)Control Rz448+NHP(OHP) Rz448+ET208(OHP) Rz448(OHP)00.20.40.60.811.21.41.6Ratio of RHO to b-Actin Figure 3-11. Ratio of rhodopsin to beta-actin at a molar ratio of 1:2.2 (target: ribozyme)

PAGE 49

41 Figure 3-12. Picture of polyacrylamide gel containing urea stained with SYBR Green I and scanned by ImageQuant At a Molar Ratio of 1:4(Target to Ribozyme)Control Rz448+NHP(OHP) Rz448+ET208(OHP) Rz448(OHP)0481216Ratio of RHO to b-Actin Figure 3-13. Ratio of rhodopsin to beta-actin at a molar ratio of 1:4 (target: ribozyme)

PAGE 50

42 At a Molar Ratio of 1:1(Target to Ribozyme)Control Rz448+NHP(OHP) Rz448+ET208(OHP) Rz448(OHP)00.0050.010.0150.02Ratio of RHO to B-Actin Figure 3-14. Ratio of rhodopsin to beta-actin at a molar ratio of 1:1 (target: ribozyme) At a Molar Ratio of 1:2.2(Target to Ribozyme)Control Rz448+NHP(OHP) Rz448+ET208(OHP) Rz448(OHP)00.150.30.450.6Ratio of RHO to b-Actin Figure 3-15. Ratio of rhodopsin to beta-actin at a molar ratio of 1:2.2 (target: ribozyme)

PAGE 51

43 A NHP ET208 OHP Con B. NHP ET208 OHP Con Figure 3-16. Picture of polyacrylamide gels containing urea stained with SYBR Green I and scanned by ImageQuant at a molar ratio of 1:2.2 (target: ribozyme). A) Beta-actin (5%, ~750 bp). Rz448NHP-OHP clones 1-4, Rz448-ET208-OHP clones 5-8, Rz448-OHP clones 9-12, a nd control 13-16. B) Rhodopsin (8%, ~350 bp). Rz448-NHP-OHP clones 1-4, Rz448-ET208-OHP clones 5-8, Rz448-OHP clones 9-12, and control 13-16. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

PAGE 52

CHAPTER 4 DISCUSSION AND FUTURE STUDIES Two of the best characterized ribozymes that have been used in gene therapy are the hairpin and the hammerhead that act naturally as viral self-cleaving agents (34,35). Rhodopsin linked autosomal dominant retinitis pigmentosa (ADRP) has been an ideal target of ribozyme-mediated therapy for a number of reasons: (1) it is a slowly progressive disease; (2) it is easy to access the target tissue, and (3) the eye is an immunologically privileged site (34,36). There are over 100 mutations in the rhodopsin gene, leading to ADRP with the P23H mutation of rhodopsin being the most widespread in the U.S. One of the studies being performed in our laboratory is rAAV-mediated hammerhead ribozyme gene therapy for the T4R point mutation in dog rhodopsin that is associated with progressive retinal atrophies (PRAs) (43). The importance of PRAs is that dogs with this mutation display a retinal phenotype that mimics that in humans with dominant rhodopsin mutations (43). In order for gene therapy of genetic disorders to be effective, it is crucial that the transgene (i.e., ribozyme) is expressed at high levels. Transgene expression can be changed at both the transcriptional and post-transcriptional levels. In numerous previous studies, the transcriptional regulatory elements have been optimized for efficient transgene expression, including the promoter, enhancer, intron, and poly(A) sequence (59). To fulfill this, some researchers have begun to focus on the NEEs (nuclear export elements). Recent studies have investigated the post-transcriptional regulatory elements such as splice signals (SS), constitutive RNA transport elements (CTE), and the 44

PAGE 53

45 woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). All of these signals are known to increase RNA export from the nucleus. The best known example of stimulation at post-transcriptional level is the inclusion of an intron within the expression cassette (5,46,47,60). It has been reported that the addition of an intron can facilitate gene expression by causing the cytoplasmic accumulation of mRNA in vitro and in vivo (60). In this regard, splicing, which is biochemically linked to RNA export, promotes the efficiency of the process by formation of a specific nucleoprotein complex (2,61). However, both CTE and WPRE have the advantages of not requiring splicing events (60). These elements compensate for the lack of an intron in the transgene expression (61). Several studies have demonstrated the utility of these cis-acting RNA elements for increasing transgene expression in context of either plasmid or viral gene vectors (5,62,63). Retroviral replication requires the nuclear export unspliced forms of viral RNAs (61,64-67), because eukaryotic cells encode factors that inhibit the nuclear export of incompletely spliced mRNAs (67). To avoid the requirement for splicing prior to export, retroviruses have evolved mechanisms that allow their intron-containing RNAs to exit the nucleus (66). The constitutive transport element (CTE) of the simian type D retroviruses is cis-acting element and stem-loop structure (67) that promotes the nuclear export and cytoplasmic accumulation of incompletely spliced mRNAs (61). The CTE-mediated nuclear export involves the interaction between CTE and the host-encoded RNA binding protein TAP, a host factor which is thought to be required for export for cellular RNAs (63,66-69). Some studies have tested the utility of CTE in the creation of an antisense system (48,65,70). The CTE has also been proposed as an RNA motif that has the ability

PAGE 54

46 to interact with intracellular RNA helicase that unwinds target mRNAs and facilitates cleavage by ribozymes (48,65). Futami and coworkers connected the constitutive transport element (CTE) to an antisense sequence (65). According to their results, a hybrid antisense oligonucleotide (ODN) containing CTE and targeted to the bcl-2 gene suppressed the expression of this gene more effectively than did the antisense ODN alone (65). Warashinas group attached the CTE to their ribozyme (70). They hypothesized that an RNA helicase coupled to a ribozyme might efficiently guide the ribozyme to its target site by resolving any inhibitory mRNA structures, thereby leading to efficient substrate cleavage (70). This modification significantly enhanced ribozyme activity in vivo and permitted cleavage of sites previously found to be inaccessible, resulting in suppression on the expression of genes (70). From the findings from Liu et al., the CTE addition did not alter in vitro ribozyme activity (48). However, in vivo, Rz-coupled-CTEs were more than 20% more active than non-CTE Rz (48). In this experiment, the CTE probably assists ribozymes through RNA transport and not through RNA unwinding (48). Besides the SS and the CTE, the third RNA element that can significantly enhance transgene expression is the post-transcriptional regulatory element of hepadnaviruses, such as hepatitis B virus or woodchuck hepatitis virus (WPRE) (62), the latter being more efficient (48,71). Other post-transcriptional elements, such as SS and CTE, depend on the transgene of interest for their enhancing effect (48). On the other hand, the stimulatory ability of the cis-acting WPRE (63), when it is inserted into the 3 untranslated region of coding sequences (71), is transgene-, promoter-, and vector-independent (48,61). The 600 bp size of the WPRE contains at least three distinct cis

PAGE 55

47 acting sub-elements required for maximal function (48,62). The WPRE seems to act independently on transcription and splicing and may improve gene expression by facilitating RNA export (48,62). Since woodchuck hepatitis virus (WHV) encodes intronless messages (62,63), WPRE evolved to stimulate the expression of intronless viral messages (71). This element has been shown to enhance the transgene expression, which requires no viral proteins to function (63), from vectors of adeno-associated virus (AAV), lentivirus, and retrovirus (48,61,71) both in vitro and in vivo (60). To investigate the efficacy of the WPRE in enhancing transgene expression from adeno-virus vectors, some studies have tested the level and distribution of the green fluorescent protein (GFP) (71) and the luciferase expression encoded by a cDNA (60,72). Increases in the efficiency of AAV-directed expression both in vivo and in vitro were demonstrated (60,71,72). In an experimental rat glaucoma model, incorporation of WPRE into AAV improved GFP expression in retinal ganglion cells (RGCs) (64). Work done by Paternas group proposed that the WPRE, which was inserted into rAAVs, improved the production of certain neuroprotective proteins for human neurodegenerative diseases (73). As discussed above, efforts aimed at increasing the transgene expression have been developed the post-transcriptional enhancer elements associated with optimized transcriptional regulatory elements in several ways. Many researchers have used the CTE and WPRE to enhance the expression of mRNA and ribozymes. However, the CTE addition did not change in vitro ribozyme activity (48). Unpublished observations from Alan White, a graduate student from our laboratory, demonstrated that there was no significant improvement made by insertion of WPRE in a ribozyme expressing AAV

PAGE 56

48 vector. Despite all of these efforts, there still room for improvement in nuclear transport of ribozymes for gene therapy. Since efficient export of mRNAs from the nucleus into the cytoplasm plays an important role in their expression, the NEE can be beneficial. One of the AAV2 ribozyme vectors, p21NHP RZ448, previously used in our studies uses two self-cleaving hairpin ribozymes found immediately downstream of dog rhodopsin ribozyme 448 as a processing sequence to free ribozyme 448 from the polyA tail of the primary transcript. Additionally, expression of the ribozyme in this plasmid is under the control of CBA promoter paired with the CMV-enhancer and has an intron located immediately downstream of the promoter as well as two ITRs required for AAV packaging. As discussed in the introduction, it has been found that the matrix (M) protein of VSV effectively hinders Ran-dependent nucleocytoplasmic bidirectional transport of RNA and proteins in Xenopus laevis oocytes (32). In one of the studies conducted by James E. Dahlberg, they selected new RNA sequences that overcome the M protein mediated RNA transport inhibition. (10). These new RNA sequences function as NEE and fall into one of three sequences in a part of a collection of RNAs containing 20 random nucleotides (10). Of these ET-RNAs, ET-208 was recommended by James E. Dahlberg for our experiment. Here, we investigated whether ET-208 could increase export of ribozyme 448 to the cytoplasm, leading to greater knock-down of dog rhodopsin expression. We tested this by constructing three different plasmids (Rz448-NHP-OHP, Rz448-ET208-OHP, and Rz448-OHP) for our comparison experiments. The presence or absence and correct orientation of the ET-208 and the NHP ribozyme within these

PAGE 57

49 constructs were verified with PCR and sequencing analysis. The plasmids were also screened for ITRs. Large-scale cesium chloride (CsCl) preps were made of the constructs to get highly purified and large amount of DNA for transfection. Plasmids containing target and ribozyme sequences were labeled with fluorescent dyes. After the co-transfection of the plasmids, the localization of the two within the transfected cells was visualized with a confocal microscope. Ribozyme activity leading to the reduction of dog rhodopsin mRNA was analyzed by quantitative RT-PCR. To assay reduced levels of dog rod opsin mRNA, two kinds of gel (agarose gel and polyacrylamide gel containing urea) were used and stained with EtBr and SYBR Green I, respectively. First, rhodopsin and beta-actin RT-PCR products were run on 1.5% agarose gel. The ratio of rhodopsin to beta-actin was averaged. Transient co-transfetion at a molar ratio of 1:4 of target to three different ribozyme constructs, all showed a greater than 90% reduction compared to a control plasmid lacking ribozyme (Figure. 3-8). As described in the results, since we could not see a difference among the plasmids expressing ribozyme; we could not determine whether ET-208 could promote better expression of ribozyme 448. To overcome this obstacle, we tried decreasing target to ribozyme ratios during transfection to determine at which ratio a difference might appear among the variants. At a molar ratio of 1:1, a slightly decreased rate of reduction of the variants was observed (Rz448-ET208-OHP: ~73%, Rz448-OHP: ~36%) (Figure 3-10), but these results are consistent with findings from a ratio of 1:4 (Figure 3-8). Rz448-NHP-OHP variant showed a decreased amount of reduction (9%) (Figure 3-10). An interesting result was obtained at a ratio of 1:2.2. The level of target following transfection by Rz448-NHP

PAGE 58

50 OHP construct was not different than transfection with the control plasmid not carrying ribozyme (Figure 3-11). Approximately a 55% and 32% reduction was observed for Rz448-ET208-OHP and Rz448-OHP, respectively (Figure 3-11). In view of the results from the 1.5% agarose gel, which demonstrated that the levels of dog rhodopsin mRNA are markedly reduced by plasmid carrying ET-208 as its NEE, we can propose that the ET-208 can enhance the activity of ribozyme at a low ratio of target to ribozyme. However, at a high ratio, the extent of reduction is not significantly different between NHP and ET-208. Polyacrylamide gels were also used to quantitate the levels of dog rhodopsin target after treatment our various Rz448 constructs. The results based on this analysis were consistent with those obtained previously by 1.5% agarose gel assay. As expected, as ratios of target to ribozyme declined, the amount of reduction was also decreased. About 75% reduction was observed from all experimental variants at a molar ratio of 1:4 (Figure 3-12). In the case of a ratio of 1:1, around 58% reduction rate was obtained by both NHP and ET-208, whereas that of Rz448-OHP was 31%. Interestingly, there was no significant difference in reduction between NHP and ET208 at this ratio. But the error bars which represent the differences on data for each sample for NHP is greater than that for ET-208 (Figure 3-13). For this reason, although there was a small difference between NHP and ET-208, this assay system does not allow us to conclude that ET-208 promotes greater activity than the NHP ribozyme. Two results above provided direct evidence supporting our hypothesis that the Rz448-ET208-OHP construct works as well or better than Rz448-NHP-OHP. On the other hand, it was surprising to find that NHP resulted in the greatest knock down of dog rod opsin expression at a molar ratio of 1:2.2 (Figure 3

PAGE 59

51 14). The opposite was observed from the agarose gel. The decreased reduction rate of each was 43% for NHP and 20% for ET-208, respectively. There are several factors that could account for the observed differences. First, analyses by an agarose gel and a polyacrylamide gel containing urea are done by different methods. The agarose gels and polyacrylamide gels were stained with EtBr [10mg/ml] and SYBR Green I (diluted 1:10,000), respectively. The increased sensitivity of SYBR green increased the background fluoresnce in the gels and influenced the detection of bands, possibly resulting in incorrect estimation of RNA levels. Second, as shown in Figure 3-16, the bands were not as tightly formed as expected at a ratio of 1:2.2. Especially in the case of rhodopsin, all bands were very faint. As a result of this, the levels of rhodopsin cDNA might not be correctly detected. Finally, at a ratio of 1:2.2 of target to ribozyme, the error bars for NHP were much greater than those for ET-208 (Figure 3-15). Therefore, there is not enough direct evidence for us to interpret our data to mean that the NHP ribozyme is better than the NEE ET-208. In conclusion, we found that ET-208 was able to enhance the ability of ribozyme 448 to reduce the levels of rhodopsin mRNA within co-transfected cells. In order to truly compare the NEE ET-208 to the hairpin ribozyme processing sequence, we need to remove the OHP ribozyme in all of our constructs used in this experiment. This experiment will enable us to obtain direct evidence on whether the ET208 acting as an NEE is better on promoting high expression of our hammerhead ribozymes than the hairpin ribozyme that functions as a processing sequence in the separation of the hammerhead ribozyme from the long transcript. Since splicing is known to enhance nuclear-cytoplasmic transport of mRNA (2,5,44-47), we should also test ribozyme

PAGE 60

52 constructs that lack an intron sequence, to determine if RNA export is enhanced by ET208 in the absence of an intron. In addition, some issues regarding methods used for this experiment will be examined to get more information from the results. First, here, we used quantitative RT-PCR to assay the activity of Rz448 targeting dog rhodopsin RNA determined by the reduction of dog rhodopsin mRNA levels. Since RT-PCR is highly reproducible only in the exponential phase of amplification, it is necessary to collect quantitative data at a point in which every sample is in this phase to obtain the accuracy and precision. After the reaction rate ceases to be exponential, it enters a linear phase of amplification. The number of cycles of PCR used for this experiment was determined by being performed for a greater or lesser number of cycles 15 -30 (M. Gorbatyuk, personal communication). Real-time PCR automates this process by quantitating reaction products for each sample in every cycle (74). The advantage of real-time PCR is that the result is a broad dynamic range, with no user intervention required. Data analysis, including standard curve generation and copy number of calculation, is performed automatically. Because of this advantage, in the future experiments we will use real-time PCR to determine rhodopsin RNA levels in transfected cells. Second, when we took pictures of co-transfected cells by using a confocal microscope, we did not count the number of cells visualized as different colors (blue or red) depending on that they contain which plasmids (target or ribozyme). For this reason, we could not determine the efficiency of transfection from these pictures. In the future experiment, we will sort cells depending on their colors labeled with different fluorescent dyes to see the efficiency of our transfection.

PAGE 61

53 Lastly, in the field of antisense approaches to knock down the expression of mutated genes that cause diseases, small interfering RNA (siRNA) has also held promise for the development of therapeutic gene silencing. RNA interference (RNAi) is a post-transcriptional process triggered by the introduction of double-stranded RNA (dsRNA) which leads to gene silencing in a sequence-specific manner (75). siRNA typically consists of two 21-23 nucleotide single-stranded RNAs that form a 19 bp duplex with 2 nucleotide 3 overhangs (76). siRNAs are an intermediate of RNA interference the process by which double-stranded RNA inactivates homologous genes(76). Since siRNA target less specific sequences than ribozyme, it can be easily designed to recognize RNAs encoding aberrant proteins. Although ribozymes are also able to elicit strong and specific suppression of gene expression, they have limited target sequences, a quintuple sequence for hairpin ribozymes and a triplet sequence for hammerhead ribozymes (34-36). For this reason, siRNA has become popular in studying the biology of organisms ranging from unicellular protozoans to mammals (77). However, the effect of siRNA delivered as RNA is only transient and this fact severely limits the applications of siRNAs (78). To overcome this limitation, the construction of plasmids for better expression of siRNA within cells is necessary. With our findings from this experiment, we will examine whether ET-208 could promote better expression of siRNA, resulting in greater reduction of dog rhodopsin expression, by replacing Rz448 with siRNA sequence in our Rz448-ET208-OHP construct.

PAGE 62

LIST OF REFERENCES 1. George O, Danny R (2002) A unified theory of gene expression. Cell. 108:439-451. 2. Robin R (2003) Coupling transcription, splicing and mRNA export. Current Opnion in Cell Biology. 15:326-331. 3. Hammell CM, Gross S, Zenklusen D, Heath CV, Stutz F, Moore C, Cole CN (2002) Coupling of termination 3 processing, and mRNA export. Mol Cell Biol. 22(18):6441-6457. 4. Robin R, Ed H (2002) A conserved mRNA export machinery coupled to pre-mRNA splicing. Cell. 108:523-531. 5. Ming-juan L, Robin R (1999) Splicing is required for rapid and efficient mRNA export in metazoans. PNAS. 96(26):14937-14942. 6. Reed R, Hurt E (2002) A conserved mRNA export machinery coupled to pre-mRNA splicing. Cell. 108:523-531. 7. Reichert VL, Le Hir H, Jurica MS (2002) 5 exon interactions within the human splicesome establish a framework for exon junction complex structure and assembly. Genes Dev. 16:2778-2791. 8. Lejeune F, Shitakes Y, Li X (2002) The exon junction complex is detected on CBP80-bound but not elF4E-bound mRNA in mammalian cells: dynamics of mRNP remodeling. EMBO J. 21:3536-3545. 9. Karsten W (1998) Importins and exportins: how to get in and out of the nucleus. TIBS. 23:185-189. 10. Christian G, Elsebet L, James ED (1997) Selection and nuclear immobilization of exportable RNAs. Proc Natl Acad Sci USA. 94:10122-10127. 11. Michael WM, Choi M, Dreyfuss G (1995) A nuclear export signal in hnRNP A1: a signal-mediated, temperature-dependent nuclear protein export pathway. Cell. 83(3):415-422. 12. Gideon D, V Narry Kim, Naoyuki K (2002) MessengerRNA binding proteins and the messages they carry. Mol Cell Biol. 3:195-205. 54

PAGE 63

55 13. Elissa PL, Pamela AS (2002) Protein and RNA export from the nucleus. Developmental Cell. 2:261-272. 14. Steven ID, Carl MF (1998) Translocation of RNA-coated gold particles through the nuclear pores of oocytes. The Journal of Cell Biology. 106:575-584. 15. Katharine SU, Maureen AP (1997) Nuclear export receptors: From importin to exportin. Cell. 90:967-970. 16. Mattaj IW, Englmeier L (1998) Nucleocytoplasmic transport: the soluble phase. Annu Rev Biochem. 67:265-306. 17. Charles NC, Claudio S (1997) Export of mRNA from microinjected nuclei of Xenopus laevis oocytes. Cell & Developmental Biology. 8:71-78. 18. James ED, Elsebet L (1997) Coupling of nuclear RNA export and protein import in vertebrate cells. Cell & Developmental Biology. 8:65-70. 19. Zasloff M (1983) tRNA transport from the nucleus in a eukaryotic cell: carrier-mediated translocation process. Proc Natl Acad Sci USA. 80(21):6436-6440. 20. Hinshaw JE, Carragher BO, Milligan RA (1992) Architecture and design of the nuclear pore complex. Cell. 69(7):1133-1141. 21. Davis LI (1995) The nuclear pore complex. Annu Rev Biochem. 64:865-896. 22. Charles NC, Claudio S (1997) Regulation of the export of RNA from the nucleus. Cell & Developmental Biology. 8:71-78. 23. Mutsuhito O, Alexandra S, Scott K, Iain WM (2002) Identity elements used in export of mRNAs. Molecular Cell. 9:659-671. 24. Fabre E, Hurt EC (1994) Nuclear transport. Curr Opin Cell Biol. 6(3):335-342. 25. Jarmolowski A, Boelens WC, Izaurralde E, Mattaj IW (1994) Nuclear export of different classes of RNA is mediated by specific factors. J Cell Biol. 124(5):627-635. 26. Fischer T, Strasser K, Racz A, Rodriguez-Navarro S, Oppizzi M, Ihrig P, Lechner J, Hurt E (2002) The mRNA export machinery requires the novel Sac3p-Thp1p complex to dock at the nucleoplasmic entrance of the nuclear pores. EMBO J. 21(21):5843-5852. 27. Izaurralde E (2002) A novel family of nuclear transport receptors mediates the export of messenger RNA to the cytoplasm. Eur J Cell Biol. 81(11):577-584. 28. Gorlich D, Mattaj IW (1996) Nucleocytoplasmic tranport. Science. 271:1513-1518.

PAGE 64

56 29. Dahlberg JE, Lund E (1998) Functions of the GTPase Ran in RNA export from the nucleus. Curr Opin Cell Biol. 10(3):400-408. 30. Lee MS, Henry M, Silver PA (1996) A Protein that shuttles between the nucleus and the cytoplasm is an important mediator of RNA export. Genes Dev. 10(10):1233-1246. 31. Gorlich D, Pante N, Kutay U, Aebi U, Bischoff FR (1996) Identification of different roles for RanGDP and RanGTP in nuclear protein import. EMBO J. 15(20):5584-5594. 32. Her LS, Lund E, James ED (1997) Inhibition of Ran guanosine triphosphatase-dependent nuclear transport by the matrix protein of vesicular stomatitis virus. Science. 276:1845-1848. 33. Jeannine MP, Lu-Shuin H, Virgil V, Elsebet L, James ED (2000) The matrix protein of vesicular stomatitis virus inhibits nucleocytoplasmic transport when it is in the nucleus and associated with nuclear pore complexes. Molecular and cellular Biology. 20(22):8590-8601. 34. Jason JF, D Alan W, Alfred SL, William WH (2002) Designing and characterizing hammerhead ribozymes for use in AAV vector-mediated retinal gene therapies. Methods in Enzymology. 346:358-377. 35. Jason JF, Marina G, Alfred SL, William WH (2003) Design and validation of therapeutic hammerhead ribozymes for autosomal domianant disease. Methods in Molecular Biology. 252:221-236. 36. Alfred SL, William WH (2001) Ribozyme gene therapy: applications for molecular medicine. TRENDS Mol Med. 7(5):221-227. 37. Adrian R, Ferre D (2004) The hairpin ribozyme. Biopolymers. 73:71-78. 38. Anastasia K, Aurelie L, Eric W, Sumedha DJ (2003) Sequence elements outside the hammerhead ribozyme catalytic core enable intracellular activity. Nature Structural Biology. 10(9):708-712. 39. Naash MI, Hollyfield JG, al-Ubaidi MR (1993) Simulation of human autosomal dominant retinitis pigmentosa in transgenic mice expressing a mutated murine opsin gene. Proc Natl Acad Sci USA. 90(12):5499-5503. 40. Stephen PD, Lori SS, Sara JB (1996) RetNet: Retinal information network. The University of Texas Health Science Center. http:// www. sph.uth.tmc.edu/Retnet/. July 2004. 41. Lewin AS, Drenser KA, Hauswirth WW, Nishikawa S, Yasumura D, Flannery JG, LaVail MM (1998) Ribozyme rescue of photoreceptor cells in a transgenic rat model of autosomal dominant retinitis pigmentosa. Nat Med. 4(9):967-971.

PAGE 65

57 42. Hauswirth WW, Lewin AS (2000) Ribozyme rescue of photoreceptor cells in P23H transgenic rats: long-term survival and late-stage therapy. Prog Retinal Eye Res. 19:689. 43. James WK, Artur VC, Tomas SA, Michael JP, Susan EP, Brian JM, Samuel GJ, Gustavo DA, Gregory MA (2002) Naturally occurring rhodopsin mutation in the dog causes retinal dysfunction and degeneration mimicking human dominant retinitis pigmentosa. PNAS. 99(9):6328-6333. 44. Jonsson JJ, Foresman MD, Wilson N, Mclvor RS (1992) Intron requirement for expression of the human purine nucleoside phosphorylase gene. Nucleic Acids Res. 20(12):3191-3198. 45. Rafiq M, Suen CK, Choudhury N, Joannou CL, White KN, Evans RW (1997) Expression of recombinant human ceruloplasmin an absolute requirement for splicing signals in the expression cassette. FEBS Lett. 407(2):132-136. 46. Simari RD, Yang ZY, Ling X (1998) Requirement for enhanced transgene expression by untranslated sequences from the human cytomegalovirus immediateearly gene. Mol Med. 4(11):700-706. 47. DeYoung MB, Zamarron C, Lin AP, Qiu C, Driscoll RM, Dichek DA (1999) Optimizing vascular gene transfer of plasminogen activator inhibitor 1. Hum Gene Ther. 10(9):1469-1478. 48. Liu J, Timmers AM, Lewin AS, Hauswirth WW (2004) In vivo somatic knockdown of PDE RNA in normal mice using AAV-vectored ribozyme is enhanced by addition of a constitutive transport element (CTE). Presentation by the Association for Research in Vision and Ophthalmology. Inc. 49. Lingfei XU, Thomas D, Cuihua G, Terence RF, Sihong S, Barry JB, Mark SS, Katherine PP (2001) CMV-beta-actin promoter directs higher expression from an adeno-associated viral vector in the liver than the cytomegalovirus or elongation 1alpha promoter and results in therapeutic levels of human factor X in mice. Human Gene Therpy. 12:563-573. 50. Alexander P, Inder MV (2001) Gene therapy: Promises and problems. Annu Rev Genomics Hum. Genet. 2:177-211. 51. Carter PJ, Samulski RJ (2000) Adeno-associated viral vectors as gene delivery vehicles. Int J Mol Med. 6(1):17-27. 52. Bartlett J, Samulski RJ (1995) Genetics and biology of adeno-associated virus. Viral vectors: Gene therapy and neuroscience applications. Academic Press. 55-73. 53. Jean B, Albert MM, Maguire AV (1999) Stable transgene expression in rod photoreceptors after recombinant adeno-associated virus-mediated gene transfer to monkey retina. PNAS. 96:9920-9925.

PAGE 66

58 54. Grant CA, Ponnazhagan S, Wang X (1997) Evaluation of recombinant adeno-associated virus as a gene transfer vector for the retina. Curr Eye Res. 16:949-956. 55. Ali RR, Reichel MB, Thrasher AJ (1996) Gene transfer into the mouse retina mediated by an adeno-associated viral vector. Human Molecular Genetics. 5(5):591-594. 56. Berns KI (2001) Parvoviridae: the viruses and their replication, In B N Fields. DM Knipe, PM Howley (ed.) Fundamental virology. 4th ed. vol.2. Lippincott-Raven Publishers. Philadelphia. PA. 1007-1041. 57. Muzyczka N (1992) Use of adeno-associated virus as a general transduction vector for mammalian cells. Curr Top Microbiol Immunol. 158:97-129. 58. Sambrook J, Russel DW (2001) Molecular cloning: a laboratory manua. 3rd ed. Cold Spring Harbor Laboratory Press. New York. 184. 59. Xu ZL, Mizuguchi H, Mayumi T, Hayakawa T (2003) Woodchuck hepatitis virus post-transcriptional regulation element enhances transgene expression from adenovirus vectors. Biochim Biophys Acta. 1621:266-271. 60. Zufferey R, Donello JE, Trono D, Hope TJ (1999) Woodchuck hepatitis virus posttranscriptional regulatory element enhances expression of transgenes delivered by retroviral vectors. J Virol. 73:2886-2892. 61. Schambach A, Wodrich H, Hildinger M, Bohne J, Krausslich HG, Baum C (2000) Context dependence of different modules for posttranscriptional enhancement of gene expression from retroviral vectors. Mol Ther. 2:435-445. 62. Donello JE, Loeb JE, Hope TJ (1998) Woodchuck hepatitis virus contains a tripartite posttranscriptional regulatory element. J Virol. 72:5085-5092. 63. Popa I, Harris ME, Donello JE, Hope TJ (2002) CRM1-dependent function of a cis-acting RNA export element. Mol Cell Biol. 22:2057-2067. 64. Martin KR, Quigley HA, Zack DJ, Levkovitch-Verbin H, Kielczewski J, Valenta D, Baumrind L, Pease ME, Klein RL, Hauswirth WW (2003) Gene therapy with brain-deliverd neurotrophic factor as a protection: Retinal ganglion cells in a rat glaucoma model. Invest Ophthalmol Vis Sci. 44:4357-4365. 65. Foams T, Miyagishi M, Iwai S (2003) Stimulatory effect of an indirectly attached RNA helicase-recruiting sequence on the suppression of gene expression by antisense oligonucleotides. Antisense Nucleic Acid Drug Dev. 13:9-17. 66. Pasquinelli AE, Ernst RK, Lund E (1997) The constitutive transport element (CTE) of mason-pfizer monkey virus (MPMV) accesses a cellular mRNA export pathway. EMBO J. 16:7500-7510.

PAGE 67

59 67. Braun IC, Rohrbach E, Schmitt C, Izaurralde E (1999) TAP binds to the constitutive transport element (CTE) through a novel RNA-binding motif that is sufficient to promote CTE-dependent RNA export from the nucleus. EMBO J. 18:1953-1965. 68. Bear J, Tan W, Zolotukhin AS, Tabernero C, Hudson EA, Felber BK (1999) Identification of novel import and export signals of human TAP, the protein that binds to the constitutive transport element of the type D retrovirus mRNAs. Mol Cell Biol. 19:6306-6317. 69. Bogerd HP, Echarri A, Ross TM, Cullen BR (1998) Inhibition of human immunodeficiency virus Rev and human T-cell leukemia virus Rex function, but not mason-pfizer monkey virus constitutive transport element activity, by a mutant human neucleoporin targeted to Crm1. J Virol. 72:8627-8635. 70. Warashina M, Kuwabara T, Kato Y, Sano M, Taira K (2001) RNA-protein hybrid ribozymes that efficiently cleave any mRNA independently of the structure of the target RNA. Proc Natl Acad Sci USA. 98:5572-5577. 71. Loeb JE, Cordier WS, Harris ME, Weitzman MD, Hope TJ (1999) Enhanced expression of transgenes from adeno-associated virus vectors with the woodchuck hepatitis virus posttranscriptional regulatory element: implications for gene therapy. Hum Gene Ther. 10:2295-2305. 72. Lipshutz GS, Titre D, Brindle M (2003) Comparison of gene expression after intraperitoneal delivery of AAV2 or AAV5 in utero. Mol Ther. 8:90-98. 73. Paterna JC, Moccetti T, Mura A, Feldon J, Bueler H (2000) Influence of promoter and WHV post-transcriptional regulatory element in AAV-mediated trnasgene expression in the rat brain. Gene Ther. 7:1304-1311. 74. TechNotes from Ambion, (2004) Real-time PCR goes prime time. Ambion Inc. http:// www. ambion.com/techlib/tn/81/813.html. July 2004. 75. Cheng JC (2003) RNA interference and human disease. Mol Genet Metab. 80(1-2):121-128. 76. Michael TM, Phillip AS (2002) Gene silencing in mammals by small interfering RNAs. NATURE REVIEWS. 3:737-747. 77. Gregory JH (2002) RNA interference. NATURE. 418:244-251. 78. Overview from InvivoGen (2004) Small interfering RNA (siRNA): A revolution in functional genomics. InvivoGen. http:// www. invivogen.com/siRNA/siRNA_overview.htm. July 2004.

PAGE 68

BIOGRAPHICAL SKETCH Eun-Jung Choi was born November 21, 1976, in Seoul, Korea. She was educated in Korea from elementary to undergraduate schools. She obtained her bachelors degree in animal and life sciences from KonKuk University in February 2001. She was awarded scholarships and a research assistantship during her time in the college. She worked at a nutrition lab during her sophomore and junior years. Then, she worked at a genetic engineering lab. She spent about 1 year in the states for English training at the University of Tennessee. Then, she worked at the National Livestock Research Institute. She was admitted to the University of Florida, College of Medicine, for fall 2002 as a masters student. She majored in molecular genetics and microbiology and worked in Dr. Alfred Lewins lab with a focus on ribozyme-mediated gene therapy for eye diseases. Upon graduation from the masters program, she will attend the Interdisciplinary Program in Biomedical Sciences at the University of Florida to attain her degree of doctor of philosophy. 60


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20110114_AAAAGE INGEST_TIME 2011-01-15T05:02:26Z PACKAGE UFE0007401_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 71848 DFID F20110115_AAAADW ORIGIN DEPOSITOR PATH choi_e_Page_25.jpg GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
a82a23e2226cfc72284206d4e65ad85b
SHA-1
405062a8789103a21167bd09c5ea5eab6afd3ec1
6107 F20110115_AAAANR choi_e_Page_56thm.jpg
5cd9c8e3f980f8bd21da88e3a213fe01
02794df635c499df08a8e7ee1b1139abd4f1662e
1053954 F20110115_AAAAIT choi_e_Page_59.tif
0e42fc51cc381efb1ae6bdf62010ef4d
d1ad74686de116a1f62159d06814bdc362d9b540
76290 F20110115_AAAADX choi_e_Page_28.jpg
90f1baf5738f53989f2775591521c5ee
49a2427ede1bc8b0847c2f008e8d62ec1962d3e7
20745 F20110115_AAAANS choi_e_Page_62.QC.jpg
1358110788a5952c6492c97f09024022
4c279730b33047d8e021ab5030c2c91a788560ab
F20110115_AAAAIU choi_e_Page_60.tif
4e0ca61417f6c8c006ce75b22d810c05
69e8371dd81f85bf077e3f0d627192d39f11a82e
15274 F20110115_AAAABA choi_e_Page_20.pro
47f3609d394ab86ebc200312b52a5d2c
9a9251a609e752f5894f335458384b5d61bebe96
72614 F20110115_AAAADY choi_e_Page_29.jpg
d6f7398a49e9daa7c068114a6b0304a0
b7c6b48226a1c07f7a9961cd272b6b6722584cf8
26313 F20110115_AAAANT choi_e_Page_65.QC.jpg
9dc59444b0ff2c9c075886109d3ca43d
47653902de384a74ea56d16ce95e1286410edf76
F20110115_AAAAIV choi_e_Page_62.tif
25e78271be558a59183625d9e26a05c2
5dc6d6ea6a136e7cb7d78a0065a82d4db0114efe
56639 F20110115_AAAABB choi_e_Page_63.pro
1b9d7c8004a84277b72b2b72ed912493
d86efa96331b39c7820807d140e7973d54ef4ea4
67469 F20110115_AAAADZ choi_e_Page_30.jpg
19bb33c8d095dc8856a333d6f570221f
8ac93cadb4cd9cab383c72cd187c071f8931c349
6486 F20110115_AAAANU choi_e_Page_26thm.jpg
86c0e76bb57a261ecce7f3ae9546aaed
53af030545d2369bb70c05b61f52445fa01c90f2
F20110115_AAAAIW choi_e_Page_66.tif
7e1a699d6f10ebfd581f76b11e974080
a1051d9ec4e1c0eda2d4dbe2b1c889ab62c6a081
F20110115_AAAABC choi_e_Page_17.tif
803fcc27d02da934a14486e9c5cf15fd
a8e8fe347b3b9ca92f435c1a1cdcb8a76880dfb3
4666 F20110115_AAAANV choi_e_Page_02thm.jpg
79092cb422789fcd99fd3f8010675ef7
7cbeb0433b14b54a0de25b46c33cd0985e68e530
F20110115_AAAAIX choi_e_Page_67.tif
b13e552076745e255b05a4e44a2fcac7
fd1de2c3d22bac93b6b8ed6ed34083a3635fb895
6629 F20110115_AAAANW choi_e_Page_36thm.jpg
7c7325406d674825c557721866b5be76
f5a1906495015c948cd6a85c6870c49c155ff4e9
98373 F20110115_AAAAGA choi_e_Page_31.jp2
509d3f38021b43ac20077e9cebeaa854
59bffb3b1acd516bb22af5cc5969d6ddebdc37f9
F20110115_AAAAIY choi_e_Page_68.tif
c750ae300a8328042586a64f89ab896e
cdbe6e5b10bb30f4df30a2ae16221455fad8ee68
80468 F20110115_AAAABD choi_e_Page_10.jpg
46e34d2e080627979c80587a1e34dd00
8ed014bb5f18cb2fd1c66eccad31dcacd0c2f5d9
96196 F20110115_AAAAGB choi_e_Page_32.jp2
5784098c90b839b9494d640f59497321
d6d0bf5469de6b0e2c956407c2797d5d6e0adc03
9073 F20110115_AAAAIZ choi_e_Page_01.pro
b36c90565f1728961c12899c3257f52a
c591e98e9c4370211d3c302ab5261b2ab06441c8
18978 F20110115_AAAABE choi_e_Page_19.pro
565b8254a51d575d18d2b1363c8ee351
37b0c225a4e8fa62d5356570e1cdb4d2a08fbbdc
6570 F20110115_AAAANX choi_e_Page_63thm.jpg
83f1782e871b941bdc0389aab0f85216
f63761f98c3ca38d94176dbf78b719c21280edc2
834896 F20110115_AAAAGC choi_e_Page_33.jp2
0d923690d85381e25c897705fcfa5b51
364a7f8f1842f83586fc56d186901faa702cee86
F20110115_AAAABF choi_e_Page_52.tif
20df0e16547352739511793e1140cb78
cbb20ff03b709fe8d01b723c3d297ba1a12d07d4
1293 F20110115_AAAALA choi_e_Page_02.txt
09d35baf4273c5e940e4081a73cd3fd2
b301dda2d8bf8c3684748e441a2eb11f1a7e0938
6492 F20110115_AAAANY choi_e_Page_14thm.jpg
f33c6ae7634956ed45160bd788bc637e
d4f4c7a63a9c583dffd4eb80571d94ba43783ca6
729851 F20110115_AAAAGD choi_e_Page_34.jp2
49f573f5567fdb2694ba80610346691d
5e834303e3623b3bf16c96e7cf88118b6e1590f9
479 F20110115_AAAABG choi_e_Page_44.txt
b3ab0e3a5b8878a25b719625abf0fcc8
d4fd44ba5465bba0ef38f20fa1f34b093fc6f710
2949 F20110115_AAAALB choi_e_Page_03.txt
cec150a9154c65a111636547e191ae8e
79ae538656b62813fb913aa4d387fdb3ff4797ce
3958 F20110115_AAAANZ choi_e_Page_41.QC.jpg
59f8c8df57cbfb55e93243412c3237ce
f1252840cb583f1db5c6d2500e5efa15d75139f9
103800 F20110115_AAAAGE choi_e_Page_36.jp2
5186c225a1bfe7536d3d12d5fd1b7e56
ea724e95a8ff49d354dfa92b9aa1739d0967034a
11752 F20110115_AAAABH choi_e_Page_45.QC.jpg
55807a693a6fa1098c3bad553e2f7ee8
e7daa38796808e020477c422c850b52416615058
1136 F20110115_AAAALC choi_e_Page_04.txt
fe67d280b815662bce1654ee426e5328
7a302791f1d3f37adc823be0d5ce6f5b46af4ad3
113469 F20110115_AAAAGF choi_e_Page_38.jp2
62ea386e9821ce361d2ac5099768062d
8945886c51c30201338f69ec431eb763bcfdb8a0
11011 F20110115_AAAABI choi_e_Page_33.QC.jpg
7d682e8895b284d79bb70835ea59cda2
daff958ee36520d6f7e3add26fdd98c63a9a286b
3275 F20110115_AAAAQA choi_e_Page_06thm.jpg
a0dddeedfac922ef50e174dfe25ee805
e8cd8bef16dd7d7cf8db2b857607d48622582148
2190 F20110115_AAAALD choi_e_Page_05.txt
f4f1be4ca242c7750ea72385d7e2288e
9bb90915f36812ed0806d38e0ff44fdc98997dbd
9442 F20110115_AAAAGG choi_e_Page_41.jp2
a7c531ed6fe9f2365a6f556205c84a32
3a9be24ae8054b12e2afa551adf5f784da78b51f
70425 F20110115_AAAABJ choi_e_Page_60.jpg
abcd0624185e5142fc2e9c61820bbea0
1ce7884f5e717acc51070a3ee2b2c24fad11fcf5
6965 F20110115_AAAAQB choi_e_Page_66thm.jpg
d391f6553cb2269735dfdc8dbe13f2b5
c6dca2d81261c6674c7de0e3a0a6d05769318daf
890 F20110115_AAAALE choi_e_Page_06.txt
8e9ab6cd27a2150c523b49a0eb7ae43d
3cb480ad3816362bea37997bf9732af82effeb29
1051948 F20110115_AAAAGH choi_e_Page_42.jp2
d50abf6262cba90d6a432e8f1ec81040
5bbb3b324f428680bcfac6b89735963efc52e053
39221 F20110115_AAAABK choi_e_Page_06.jpg
781d93019ea64ed5a8546d88da228420
137d4bb3a84112931181806df5c9018a0ae8a919
23530 F20110115_AAAAQC choi_e_Page_59.QC.jpg
8580c1cc11c0008bb75a7fdb6d8c4748
aca73e4c1ed4fba9443312beba254c1325bda660
1802 F20110115_AAAALF choi_e_Page_07.txt
d7605df886c5e556be5f7a664c43374d
a50f5e42b83d88e8171b078ad551ebf101fa1873
552516 F20110115_AAAAGI choi_e_Page_43.jp2
4d7fa59c8b8adc9b0cea054a2135c155
9178acacd08c95385b71643c67c2551ead984150
21396 F20110115_AAAAQD choi_e_Page_61.QC.jpg
0be242c2d266a0f4571f4880545689a4
549f70f812e38b57c93452a03f7df89d94c2c89b
1702 F20110115_AAAALG choi_e_Page_08.txt
14eb69eb637cee0e94b1f98d416d1d85
77d6bbce3d293718181b96604762d4d56635dc79
777069 F20110115_AAAAGJ choi_e_Page_44.jp2
7660e93523b74df6d99e04ab67d8df51
6da12bc92613dbd312ccd705193ba374ae1e227c
1051945 F20110115_AAAABL choi_e_Page_20.jp2
aa5524a4d9d9a4bade343157dd65a32f
83dd134fe6e402fe24051f65aba07ff09cf6afb7
11130 F20110115_AAAAQE choi_e_Page_49.QC.jpg
ad598bf5e7b0daed2405a3df574f7185
f9bae7476fa29a3267b25154db768fe295418221
1858 F20110115_AAAALH choi_e_Page_09.txt
529aa48b8d66367dd2d18b67705295a0
c0e815797bc935c747cf5fb817eef759864afc9f
767313 F20110115_AAAAGK choi_e_Page_45.jp2
500e069c4378c2fe09520a9a9c23007a
b6881e3ca8b8f7dbfd1c4c3c64d7df9de8d7d167
109504 F20110115_AAAABM choi_e_Page_57.jp2
76bd621216139db37c2a176be9b35fb8
d6cceac6d0ae011fa8829aa57a66c03fb44df41d
19806 F20110115_AAAAQF choi_e_Page_07.QC.jpg
4d48b468ba5e661373e5217e45bdd303
71be4f438e638c992f475e2fe99db1808737d6f8
1967 F20110115_AAAALI choi_e_Page_10.txt
ab15973d9ea9038b5e6493cd92357bf2
0736985d6c0c901d0190e0fc09c3ef3e52244770
234653 F20110115_AAAAGL choi_e_Page_46.jp2
e44983df923e39f1f0d14010784b7e1d
8761a877c567bf213ce6f96685e64b71a5328b98
25271604 F20110115_AAAABN choi_e_Page_42.tif
20775afba2dc4b068c9590123fe604a4
d23a464d862bd8dc5f0b7814e1f7c0c951d4b2fa
22555 F20110115_AAAAQG choi_e_Page_14.QC.jpg
efbde1dfa7b8687da9aae5c2dc0edefb
8adbffd1390eb126138747899585bc1d5a6bf562
2055 F20110115_AAAALJ choi_e_Page_12.txt
a002c207442c2011d9ec2ba25b605556
8653ab3353892c542c4943a47e54d3247c11be4a
677416 F20110115_AAAAGM choi_e_Page_47.jp2
b8126f1a33c489df14760e64123c97e3
955f49b062b57fefffcb07d199ba5c91fbed9bdd
F20110115_AAAABO choi_e_Page_32.tif
289b9f62cf110886fad44baa10044af9
d47a2d3355370ad83f22b65f96280fff56100f44
24308 F20110115_AAAAQH choi_e_Page_29.QC.jpg
b16870c5537d37f2faa0ee5b06efd10f
2882311089e587d619fec126c3a563b095f7ad47
1971 F20110115_AAAALK choi_e_Page_13.txt
85634695e4b4cf4d64a9d9ac69833240
80ffe0b114a44597eebb5f75d4f27f40f785088c
468299 F20110115_AAAAGN choi_e_Page_50.jp2
0c285b72046a7faf534984e0757af09d
d036482b68f31d181fa98befef77c0cfe145ab47
72639 F20110115_AAAABP choi_e_Page_15.jpg
6f544e782b251494fa9b328cb999e4ad
0976634d31882915f563dca6c630715340f37abc
25733 F20110115_AAAAQI choi_e_Page_37.QC.jpg
8ad89e0503fb7deda3511fc92fea4b0f
9ac42e65f525e909e8634701e9d1bb261dca6a14
1945 F20110115_AAAALL choi_e_Page_15.txt
2ce1cd01bb74ab5a9b8252048daf25bc
d65fb0cad79e729ad7259304517e34083eb40730
431300 F20110115_AAAAGO choi_e_Page_51.jp2
956829c19d498c1b10d59793d2cf5c5a
4298b80cabefbc93ac7809a30b64660b53688b52
666 F20110115_AAAABQ choi_e_Page_45.txt
b2419bd274814a83be5106312292a15f
1fe9940b955eed76ba883bc75483e10cd460d090
6096 F20110115_AAAAQJ choi_e_Page_52thm.jpg
063c1abfc93979fcd2208321c756a0ab
6a73032531fe2c04fb007748518a7f10716489cb
98915 F20110115_AAAAGP choi_e_Page_52.jp2
386b45385a1f62db996da24ff8c9cf77
815f262aa2a4a660622df31ab65741b75d94d08f
F20110115_AAAABR choi_e_Page_28.tif
855d8ad6d219971f6a10ca9d5642b48a
c9ed8298b278b5ca0864c13f29f46574023c5fa9
1978 F20110115_AAAALM choi_e_Page_16.txt
aa1df2ff7b4d2fe0ee5d985e204a7366
00a49289f586514bb02bcf6cf119f443dba66313
15668 F20110115_AAAAQK choi_e_Page_18.QC.jpg
5fa8927a38399ebcff1cdc5ce8167367
873d86455b70523f8b533b434f9b3cfdf1fd4fff
6105 F20110115_AAAABS choi_e_Page_31thm.jpg
d184e2fe65e546f04ed8fab6c6f999f2
95e641d1312c8150430b50d5efda1dbcd657aa9e
1153 F20110115_AAAALN choi_e_Page_17.txt
ab8745a916b2f18907af2600a52ad893
8452e3407fccc43e74232ac07bc79175c8238dc3
22416 F20110115_AAAAQL choi_e_Page_30.QC.jpg
6decd2fc1e8cf36d5494ba46d21ae0b2
1be5fdb36e5117e76da07a5e8b16967aa337e216
110259 F20110115_AAAAGQ choi_e_Page_53.jp2
4829d98a33792f1da35989a3649eea46
92cb38111d5b81b7bf9deb227c7821481942b03d
1051855 F20110115_AAAABT choi_e_Page_18.jp2
4701eed23637e32e0222ffdeb5aeec59
3819c3c606a21457b53c3491987f5e89845c15ee
593 F20110115_AAAALO choi_e_Page_18.txt
915b1a23fa53d11a4711ed895b854222
1496a92805021e42e769c5468ef408ccd5ad81a5
102903 F20110115_AAAAQM UFE0007401_00001.xml FULL
5f485de1b9137d10cca66d1d73c4df0a
6a575b6466beda88285b1e6ed791fa67652520bd
109782 F20110115_AAAAGR choi_e_Page_54.jp2
404b1efd7ceffc618deebdedbd33e466
b0cfc6ac68a1f02525af65921db050782bf9d0ff
F20110115_AAAABU choi_e_Page_61.tif
42892de81c5690dc26de39c17a829742
4a33327603f0076e9fff5e6514fcba0644aa7fa2
1127 F20110115_AAAALP choi_e_Page_19.txt
a20308972bdab337f0d34728575a223b
48fdedab55fc2ea26891376bdbeba9ab63a7299b
19843 F20110115_AAAAQN choi_e_Page_03.QC.jpg
690e7ec28cd66a80c5fc0805c8c12bd4
b00141da3dd30757acd0a85c649b55f3364cb6d8
109159 F20110115_AAAAGS choi_e_Page_55.jp2
093ce0bc2d64267cb70b536f10b7ff23
e9f67116f112b769fe5e0f2f52b0d6ea122ebeb4
69444 F20110115_AAAABV choi_e_Page_26.jpg
87b6df471f5cc6745dbf3ab2275582b2
a524f29cf71f4d45dae481efa0fcc7139aac15ea
704 F20110115_AAAALQ choi_e_Page_20.txt
4d20577efe705fcefe159e1b28cdb27e
97a918ae0481940f0005fb72e841d8bd2c314ee8
2818 F20110115_AAAAQO choi_e_Page_04thm.jpg
537eda1c35890c2989eff5b341c5f234
d0002d1c8fa0419f59a7b495ed60930f67955938
110971 F20110115_AAAAGT choi_e_Page_58.jp2
c289dad4b613d8d6322d7439b7ddf4be
8ee079240a013cda31a1d29faf0c5a22e56852ec
6913 F20110115_AAAABW choi_e_Page_46.pro
db24a3b2cd01f564ca81b3202d723ef0
48b3481a8f00ca6826c0ceecd5abd9b6d0c844ab
659 F20110115_AAAALR choi_e_Page_21.txt
24a1ac4ec81c537dbb8a054ff5625222
8f7ff5bfb1c6f1b424728c1484d41c2d637cd859
5921 F20110115_AAAAQP choi_e_Page_08thm.jpg
d824813fec1da05c1b0eb3f9cd00b8c1
0f38eb9d135b045c80cef944d1b34d786e0ddea6
108914 F20110115_AAAAGU choi_e_Page_59.jp2
a440d83e72b95ddbfd622b15f0e2de59
46c467330e3e912674505044c233de57fde19537
F20110115_AAAABX choi_e_Page_29.tif
3df4827d8c75f52bdbeef25a74bcebff
0f0d117ab09469e1f49fd8fc64ff859f62e8a242
936 F20110115_AAAALS choi_e_Page_22.txt
c5f59d1a9b3c7da09c6eb54aa2c809c5
714c19cf72651c52066686619db2b910f6a4c784
21412 F20110115_AAAAQQ choi_e_Page_09.QC.jpg
0a783d51dba1c0bffd9ad03ed6f0f623
e11292455126732b3b25b658871efcfb84cb7a2e
104782 F20110115_AAAAGV choi_e_Page_60.jp2
6cb43ecd1c7da6296a3da8126456323a
36ffd503287c0b4254c0ebf626776a1099767781
F20110115_AAAABY choi_e_Page_20.tif
4531714798750b181730f5e3e059ae38
a85fe59a383cef8274b16b5adb9ab132d526eec5
1907 F20110115_AAAALT choi_e_Page_25.txt
6f5aff5a3036073e0c036aede4c326cd
bb7399968468bdf257cbf19e9b3861d555973058
6819 F20110115_AAAAQR choi_e_Page_10thm.jpg
02d76f67106c90b23b2f413633d7911a
888c49e7eb1a9a57cdebafb7653bd4c1d06872ee
97675 F20110115_AAAAGW choi_e_Page_61.jp2
44906f0a6caa4724d9b7c412e6264341
bcebc4d8a2651687b918ed6b91514620e56fabc3
F20110115_AAAABZ choi_e_Page_65.tif
205ed48650afbfdc458fd6d2e83d5c97
30987c6f0ca4c3aedc3878271402434b9dafe0fb
1850 F20110115_AAAALU choi_e_Page_26.txt
b0ed27ab8f978079ae336a40c6d656a3
aabc6ea8da859d5b2876e7e6930efea7c7933fea
6558 F20110115_AAAAQS choi_e_Page_16thm.jpg
ca90896a305f95c281f6d7c47362e070
f56f7bceeaaf3e88023dbd4e61d149727c0253cc
97636 F20110115_AAAAGX choi_e_Page_62.jp2
a9f4163f36d868159e129cc27fb0eb74
9621aa798ca6c83d8daca76b42f87a41ced13930
2714 F20110115_AAAAQT choi_e_Page_21thm.jpg
e323c7cad3095c0781b3243bf975c8cd
a84d882c9c36e24e4af9b18c31d1b33ac2c75288
121128 F20110115_AAAAGY choi_e_Page_63.jp2
7b0cbeadfb926164542fa38ea7681b20
9f77bacc5144014dbf7b4eb5a0a0ad74f13e1b14
2010 F20110115_AAAALV choi_e_Page_28.txt
3cf6b44180e28179efc239de9b82c06c
0513d78cd236c672b0c369d5f4ea8aca72d28388
66697 F20110115_AAAAEA choi_e_Page_31.jpg
4fa26c2cc9f37137d6b8eb3254b2230c
3aa60172bd438c3e065f324419c951dd2c2ef252
9354 F20110115_AAAAQU choi_e_Page_22.QC.jpg
984c8b49e20800bf55f0d6820f91c7f6
e11f9e698dce810ea4fe9bf845895d3e6b828740
130891 F20110115_AAAAGZ choi_e_Page_64.jp2
e022edda611975141ff9a8d8ee80c9e1
8813ec2d4bf4b89b500e3a396af685276ca7ebee
1909 F20110115_AAAALW choi_e_Page_29.txt
9ae2e2d38c4d0770f4dbe792d52d63cf
5335fdfabe09a1daf1bd63ae784f663daaf7fa28
64633 F20110115_AAAAEB choi_e_Page_32.jpg
64f0114c1daa455add693b82e95df6e8
9e25af10bc229c8519536004621f60186012df10
5333 F20110115_AAAAQV choi_e_Page_23thm.jpg
98871d7a8e76639247a8304b1e47aa22
13da6f476a3b028b75375e5b6aebf88d92b42ced
1783 F20110115_AAAALX choi_e_Page_30.txt
54086bfbf9fcc6c89c65d507e7dd3a86
dc7be1a5f25ef728d0cfdd5614f8139ededa63a0
35240 F20110115_AAAAEC choi_e_Page_33.jpg
fa09443f69008b1f2a24c9111998c1cf
cf91e07809f5ca14e53ec3555f2ea3ba35d13d5f
6739 F20110115_AAAAQW choi_e_Page_29thm.jpg
ae8b7cbae2c6f63908284e49e76ad31a
09534e53c99b70ff0922c194b6312bdd99997656
31408 F20110115_AAAAJA choi_e_Page_02.pro
fb552fb2f046eb61b8e0bc1b08045b49
59ee53914c65488a70f6f49bde17ec69834a838c
1747 F20110115_AAAALY choi_e_Page_31.txt
a646842a3f5e95c4a5b33557e122260c
e0c7c295e6e36e66248c73c83665b2d8fb40dbd8
22142 F20110115_AAAAED choi_e_Page_34.jpg
f56a1cfda8be8dd54c525006e593fb53
b255324f8892888cd30c78bde6cafdef65df88bd
7024 F20110115_AAAAQX choi_e_Page_34.QC.jpg
ce15d5fabc36ae089a4ff3a19851b2cb
4c5ca5fb35b72d64fcfac45359ed6fe915ba38ee
27394 F20110115_AAAAJB choi_e_Page_04.pro
5f396a6597f5e41bc3161fb80f3a470a
6094cea90f444363fe7b1d7442b07d95111ac71f
2193 F20110115_AAAALZ choi_e_Page_33.txt
123a4dd65464c241c3fdaa6b80cd8652
27ff30d0d14a3e410457ba6b5e8f49c6e127e01a
58712 F20110115_AAAAEE choi_e_Page_35.jpg
cf5abf9c7c80c44ae0dd8502c0d41fb0
08dec7d17da40c2913269213e2e906600b488e30
2479 F20110115_AAAAQY choi_e_Page_34thm.jpg
1d3ddab0d9ad0b6371b6fed0b0424e71
0ac4b1fe25d4d3886ad43f2a18cf031a2651eb10
22297 F20110115_AAAAJC choi_e_Page_06.pro
f514a92794bf4fc0e6949e8f3e381ae6
ae005b7f71ce515abb8a1775f291d9de1b6ff172
71092 F20110115_AAAAEF choi_e_Page_36.jpg
2a36e38ef994dcfb3ceffcc2d25c14f7
dd92203e89fa20515ad3cdbe02650a36b1c60961
7131 F20110115_AAAAQZ choi_e_Page_37thm.jpg
97441ac31684daf832005192a7073a17
a8a11ea245b018e70bb8499015bec220d3ec7b9a
6832 F20110115_AAAAOA choi_e_Page_38thm.jpg
898099e1fb1729a4646df3267a565191
33ff7810047e4b695952a47c4db92378b5ce7600
40576 F20110115_AAAAJD choi_e_Page_07.pro
cae9084fe2e7876acde6736931b0ab95
9a5d99717af4125187fe119ebbe3cd7accc1862e
81278 F20110115_AAAAEG choi_e_Page_37.jpg
214614e5ceb976994d1e3114b8fcfe19
fe62380642979e312b72def2957ef31f1724ff73
11701 F20110115_AAAAOB choi_e_Page_44.QC.jpg
8dbbd756a89a9937bf178f6cdd89a2c3
6d2e8c80c2accdae9b7736c485bca646071a0892
74665 F20110114_AADUEQ choi_e_Page_38.jpg
b962b3e69cab3aa3f4140b77e7463cef
a581d5354fc2922fcbab73d5f7c6f9eb9bcd3d69
42675 F20110115_AAAAJE choi_e_Page_08.pro
dface62893c00c6d3dfc164b894eee14
cea3306e747ad32539cfe864c6aa04c478264a4f
73586 F20110115_AAAAEH choi_e_Page_39.jpg
bf456f4d057141d157648f7881fd377c
8673e63a7306cbcc2be7de05607d03efd1314c10
5858 F20110115_AAAAOC choi_e_Page_05thm.jpg
133d54b288def9409de7a700edd2aaf6
4c8a74abff13db88859c5ddc6a4a3b3d27e1762e
6840 F20110114_AADUER choi_e_Page_27thm.jpg
ce3ab35563303c30f4597dfb401169e3
1999491b2f3480c815aef0eca4e13001ac9efa11
51003 F20110115_AAAAJF choi_e_Page_11.pro
d738327b59dd543417623668b30d0ce9
e4b2f2c76ceda4d06eaa80db7a1aa687e026f944
69721 F20110115_AAAAEI choi_e_Page_40.jpg
a54314dd40be526116cd46c7edecc0d7
02351074fa9d87ee2daf45f6181ebcdccd318a3d
6597 F20110115_AAAAOD choi_e_Page_24thm.jpg
68308b15523df03cfa9de28281b5343e
01d5716bbe8a8bbc341c33f92d3babf3bfa5d877
1878 F20110114_AADUES choi_e_Page_40.txt
fc9924c7d2402961470e78599930c7a9
440b082bb5ef11216acf0adf820bf6dffbe44431
52411 F20110115_AAAAJG choi_e_Page_12.pro
f206a3d7ac07934a4dbc425eda6f2d9c
7c9ec6cb1d247c7282b438826d6aa750702a1128
11775 F20110115_AAAAEJ choi_e_Page_41.jpg
15ba7cba04bccb95901a6ac751833b29
088eead98a41f017968e484c5463cea15c0e23c0
10098 F20110115_AAAAOE choi_e_Page_20.QC.jpg
942bf551b3c80ffdd79e019a342e7a6e
09ba3fa2b9cde367958ceb3223e4b2d83d0e605e
51549 F20110114_AADUET choi_e_Page_38.pro
6aeee289c0be36a5ec18984b7cfa9160
e2cd6f27373b16a95b8afe26a173406195f19c94
48894 F20110115_AAAAJH choi_e_Page_14.pro
1701d99ad8ca0ecb5ae91c116efd1fa8
fe6c5852609015153cbf2271db1a2f3dad170366
43124 F20110115_AAAAEK choi_e_Page_42.jpg
418326c42b73a6622ccd04e14b2b8b72
06855b51bb8f7b4ca40000ab03c45c2a49202032
25053 F20110115_AAAAOF choi_e_Page_63.QC.jpg
97d2426b2c57ae3de3dd9f4e39303205
38271780efd882936d3abff4ab0730a2c6cf5778
23172 F20110114_AADUEU choi_e_Page_25.QC.jpg
f98d78cc47a15ee87db4d9043be0ee58
8b9fe3d23a771707de17b24f3287e50e23ea4f65
49237 F20110115_AAAAJI choi_e_Page_15.pro
f3b3dd3e55f1e49151b49d91eba8ea16
fbd74cbd8402caf9287a29f78ae10bbc189bcfa7
28679 F20110115_AAAAEL choi_e_Page_43.jpg
2abf834bd8622da73ac34f1d34c69406
ae53ea9e5bd4897acfbd0ec596c12253aaad3165
16576 F20110115_AAAAOG choi_e_Page_02.QC.jpg
58820bbf9ec666413d2676fe8673679b
b24899316d3255a9f97ee234468f2a7f71a6b93e
9161 F20110114_AADUEV choi_e_Page_34.pro
a1c88b34f966dfea710ba619fcfc18c2
842c8a09991cab79f056cd9da5600c55e7473d4d
50258 F20110115_AAAAJJ choi_e_Page_16.pro
b73cfbaf380f80a1739518f138d0671c
b8a515a263d9d20a847023a028fea4d6df169935
35370 F20110115_AAAAEM choi_e_Page_44.jpg
762e94383c0fce01ae564ae5b843c31b
a395f48ce06724df3b9a9f03943e928b397d0c32
5447 F20110115_AAAAOH choi_e_Page_35thm.jpg
0e6aabe1a0a4ac0ff0894ea00ad40b28
6e4edac694667d9ec05a547fe31f0b55f0943d99
F20110114_AADUEW choi_e_Page_04.tif
8c981f9ea0d92a1313aa4f8c2f79bed9
a542549798935d7f6bc4554c1beaa29b72951188
28908 F20110115_AAAAJK choi_e_Page_17.pro
3ce7a78932f17ab1831ad27f7cde4a0c
3c1ee2a834674785f147ddc120ca0697f62e919a
22425 F20110115_AAAAEN choi_e_Page_46.jpg
b93b0b11d329a0e18990e37f5c08aeaa
18123b83c5484735b1331a591634f4bab6ee6826
45196 F20110114_AADUEX choi_e_Page_30.pro
0165ee78654836c5c4c14c5d5d7db985
a271f4dcde54262b1b04928349041b51d1605c3c
8833 F20110115_AAAAJL choi_e_Page_18.pro
cda5a9570577b2e2af4449d34febd474
d64ef5ab60d582e3830f2543be2224bbd410981d
3896 F20110115_AAAAOI choi_e_Page_45thm.jpg
45dbd35dd9e524351c3655cadcbcaac2
b91b9ee5ef2b9ab75b209405bd0b10a8d42d5c04
2721 F20110115_AAAAOJ choi_e_Page_22thm.jpg
03b278954f7fdae4154c4a07be857898
909cc16a3358af5cbc029f97b68446a67910655e
21850 F20110114_AADUEY choi_e_Page_31.QC.jpg
3f87b76b231f728bd1e63f7a8966cc83
410a5f16f6f254993be41908c7934a44142656f8
12419 F20110115_AAAAJM choi_e_Page_21.pro
f7f18486d62ea737a0fac99df03edd02
50ec386dcd70d357c27cb36f8a2aba4a02e17211
38800 F20110115_AAAAEO choi_e_Page_47.jpg
afea8002d06a108a3867a6376cc31e96
4348403728fb418b0bbc8bf5651366c7e39e7ec8
24118 F20110115_AAAAOK choi_e_Page_39.QC.jpg
825936d87e6d8dd4f141ea1ac81c6a22
91325bea460367c18c42dd51e87a41bdb846e2ab
39088 F20110114_AADUEZ choi_e_Page_45.jpg
f5e34055ffed268c56bf7049ff6c41e8
6f3c81713a7c45b295abb1a6a04efce33814d736
18663 F20110115_AAAAJN choi_e_Page_22.pro
db6b607765a93899ae872a5d86988fe4
99f34ba4926261bb31683a5df18731a36011d5b2
35705 F20110115_AAAAEP choi_e_Page_49.jpg
5a2866a4a3f36ab79bf3a495643896cd
6be96d32cd843655554e1a4c8029c5f808d49989
24586 F20110115_AAAAOL choi_e_Page_28.QC.jpg
f1c3c1317c843603d4298310982c8a4e
ce98bfc9222b33d1d5168b729d19fc5dfdad12f0
36811 F20110115_AAAAJO choi_e_Page_23.pro
e856aa2d527b61c386699fe1b3c79a4a
5a3c2c4dc02213356c911837f93fff9cc08eb5eb
35867 F20110115_AAAAEQ choi_e_Page_51.jpg
fbb1735c9636eb5659c336e5769638a2
10b63950f54f46783228884bdc730f119c969e5b
4488 F20110115_AAAAOM choi_e_Page_18thm.jpg
24cfe3afcabde5b7142fa1e76f2f6287
26fac494561917a36057977f8d4d64378e7fe862
47502 F20110115_AAAAJP choi_e_Page_24.pro
385fb6ffc24208fc706b1ca640734e72
4f89cdb443f2afe960177a02c1342a7ee9c64afb
66073 F20110115_AAAAER choi_e_Page_52.jpg
965d162c38d29086399c8991525e754a
a64fba3f7d4a8a404afeb90e9bfe4e008410bcce
24053 F20110115_AAAAON choi_e_Page_58.QC.jpg
abe296e7087a36f7dd99503e8e06899a
21d252ab206087d4be7dc5c168333165439ed46a
46267 F20110115_AAAAJQ choi_e_Page_26.pro
46cf4abe948d4fa5f7d51634cf919013
36c49f6b6d45f7f36669b7593e5b0c73c177e74a
73334 F20110115_AAAAES choi_e_Page_53.jpg
f5b7b1633f42d65d021325f2e4429500
2ba4a0e3bbef7245081c88969b064bb548eb1ff3
14272 F20110115_AAAAOO choi_e_Page_48.QC.jpg
f2b6b57942a9310f256e07ed0a9f4b8c
53cb1cde18905600fcb639d53a4f66c133d11ee9
50523 F20110115_AAAAJR choi_e_Page_27.pro
b81858e77251af391eb1693216817007
31e636c46ba61809b3e4200ddc7bcedbe5f173bf
72210 F20110115_AAAAET choi_e_Page_54.jpg
74548198bce3a413f4287bd4e028a919
db5308eacaa730ac477002b548b8c4a8d940d173
6433 F20110115_AAAAOP choi_e_Page_53thm.jpg
fce2e835ca097b0bc771433d987d47fb
7edf3e8b01bf62e54e8c8f4f3ebd036016b45d27
51368 F20110115_AAAAJS choi_e_Page_28.pro
15b6e3bded64ce5dae71084754a71720
626a56a63d00339b5c34e50cb7ded28ea8c18b2e
69324 F20110115_AAAAEU choi_e_Page_56.jpg
a30371fff5fca8b0e3073f350b244440
8a5eb7881c54435e023cf2bb02127975452608b1
6975 F20110115_AAAAOQ choi_e_Page_28thm.jpg
dd3aa5d6b2f513f35cb9c1ff9e5b361e
1bce9244dd673640a06798a74cbf873c744a9010
71968 F20110115_AAAAEV choi_e_Page_57.jpg
3973c145724d96bf7001c3df243cd845
b1c11337c52440cf029c7ca1ad2cf7c7102afdfc
5358 F20110115_AAAAOR choi_e_Page_07thm.jpg
df8faa872ed3a657f5e4afd7a638cf96
167ec75f73a9610fa6ba846dd3f963d8cfd450bd
48096 F20110115_AAAAJT choi_e_Page_29.pro
cd2e4adb278e47dfb1ffbc56b8c88b99
1ad5db775b5021fa23ca9805d6a32e3036610ff4
73329 F20110115_AAAAEW choi_e_Page_58.jpg
af65d3fec9e631bea4e94e7d050da80a
ee3b15b8b186294684e3128624a6d4e7931f5d42
6939 F20110115_AAAAOS choi_e_Page_65thm.jpg
6143c6dde6a080127619f3316c64557d
2692b4539409c1d4e3dd855e29db2310355fcb91
43859 F20110115_AAAAJU choi_e_Page_31.pro
9699f704f0a8d324c570ecb9a74dd18f
937a203eac681555692f8bd79bb0715eb9dc5b8d
65140 F20110115_AAAAEX choi_e_Page_62.jpg
067b15146c744cb62c18522d8d3614a9
94c90714f8ee62cc8b2a9bcdac009a3193d22e63
1570 F20110115_AAAAOT choi_e_Page_41thm.jpg
ed1ee9fb5d068816d9056fc9912c2934
0a73bf9584a1191921c3fddd40cb16f7bb17849f
42729 F20110115_AAAAJV choi_e_Page_32.pro
25a501dafd5b0fa4fef4888a71660967
c499245aaa6c6c810e28c7c927ece19a4c1d8586
73649 F20110115_AAAACA choi_e_Page_11.jpg
2f2b4cd9e7b79a017125a41850855682
4b7413dbeac25ac103864bcdb84655c63ceceaea
78832 F20110115_AAAAEY choi_e_Page_63.jpg
52175cf71d292d7b2ad1380ef6fdfe08
7899891631cf37997bb8a19956d2f86ee8518cb2
23737 F20110115_AAAAOU choi_e_Page_16.QC.jpg
de4a0fae5322d28b32f5f61e78fa5390
5dba950a8bf1e3542cf9740418f1a000568e1f67
19775 F20110115_AAAAJW choi_e_Page_33.pro
61436b0552971a32cd4f3b3b5d5a2c89
495f18354eaf88a4e29805f29ef81d706eeae6ee
54386 F20110115_AAAACB choi_e_Page_05.pro
8c2164acadbb6fe13d915baf05d0d6b8
7062f610211c454ae6d9d8d063e4d745365a1c9f
86844 F20110115_AAAAEZ choi_e_Page_64.jpg
94913610e9b73e2b503f79ccaa6d2370
be44ad0126d4ac8f7b43c4e6d5f78235aa2cc71e
6725 F20110115_AAAAOV choi_e_Page_39thm.jpg
2c5c523f26def3817d90ee95224cb702
e1fe95ec48b1f3b077d8c6f6ed7ddd95e1805ca1
37817 F20110115_AAAAJX choi_e_Page_35.pro
3e0e2734f8d88d46c59e2565458203b2
ff2526ab51a92091d5ad168a24311edd9b129cc2
F20110115_AAAACC choi_e_Page_02.tif
5f825e24f7816f0651134c2b1726841a
ae3b0243f848c0631afef958a2fa45fb69742b52
21329 F20110115_AAAAOW choi_e_Page_08.QC.jpg
bd693e95bdf730f72c9096a36d37beb6
602f2cb3a59ba91c19fc4baced452198e50a6001
46428 F20110115_AAAAJY choi_e_Page_36.pro
cd4bc366bbb45700dc35a1036cf7f497
96d5180e4a2158f9b319048513988d36bce6eddd
1729 F20110115_AAAACD choi_e_Page_32.txt
f12bc8d7c21cce9c65e0364a33268d3a
496740537a5cdc45ff4956182c9c151a5613b0a0
138058 F20110115_AAAAHA choi_e_Page_65.jp2
398b116f13638ad2aedd70992874693a
0b10f142eab6599e9d7755b5285df8e8519d7722
25462 F20110115_AAAAOX choi_e_Page_10.QC.jpg
92ae04756f48e632e57fdfc476286b3c
984be691e5dd1c93ff499399c189b2026e2f6ffe
50207 F20110115_AAAAJZ choi_e_Page_37.pro
f06b24420a8f86c2359705feeddc5e4a
0f35eaa50cbc62709ade5741cb7ca86ae16e8cbb
48277 F20110115_AAAACE choi_e_Page_25.pro
92c64e1154b1e16acb6aab03f275b0b2
c15b3a4a246234502b47b5d0eec865510f22c805
124578 F20110115_AAAAHB choi_e_Page_67.jp2
c6652821a24fd5a005daef1b7c1646c5
7e908802b0652bd5898791089df90c713133b641
49600 F20110115_AAAACF choi_e_Page_57.pro
57a1d87eccac30a0807cfd49966e4591
349869d0c7f0443ca365184614b76742d550516d
F20110115_AAAAHC choi_e_Page_01.tif
f82f3b2c3c284a691bc6a337416b37fd
766c640c0c311aa39a59f6c9b6cbd9fa4f4d25f0
21014 F20110115_AAAAOY choi_e_Page_32.QC.jpg
a5c32fdc89b74b73ea366057ad071e91
5a478248c6369bd8ef75a06f49cae72a8c8489a1
8291 F20110115_AAAACG choi_e_Page_21.QC.jpg
4e9661ad7b01a5a05d17cc9d603ad0cb
c7a6a4377a76fb9cbac7613d7ca1641a40a6bcff
712 F20110115_AAAAMA choi_e_Page_34.txt
62419d346de445a78257f5843d77fd56
65ebde9cc048497f5432b91bbf31f5edaf1dbee6
F20110115_AAAAHD choi_e_Page_03.tif
75859ffa3864f1e9b48efd016eac43d2
54aaebe277df1488575c81b8b66c42607f9bd3e9
14854 F20110115_AAAAOZ choi_e_Page_68.QC.jpg
25d62942713a541f0c31058f8c90cff4
16a2943244059708b66821104ecbfd6505193f22
50945 F20110115_AAAACH choi_e_Page_53.pro
6e5084138d65b9ca96cfaf51a0eda88a
9c130ed44d77dd4744d0f0910688fdbeafbe0351
1596 F20110115_AAAAMB choi_e_Page_35.txt
d36a5b89e52da224d6eafb007bf88248
3f79d155e1fe24bba1873303da2c70ac52d2be11
F20110115_AAAAHE choi_e_Page_05.tif
7379a1aac0823d1a5349fd3f0bcb9594
c1685801a48a9a12da5c0723439739308fb34832
49767 F20110115_AAAACI choi_e_Page_10.pro
c0aa3709fd9d821c9a02d5978e30aa45
b9331b7c6b05ae09ed01d27c43962350370b72c1
1894 F20110115_AAAAMC choi_e_Page_36.txt
bcffd6b55a310f70a295502a281c91d4
498bfc476fa222b202f57d154c2f0f30cf80ae81
F20110115_AAAAHF choi_e_Page_06.tif
a93929ea0849bd966f21ffe6675cdec0
e21b580353d33825a372d1b38d7d4b6037a22baa
10208 F20110115_AAAARA choi_e_Page_43.QC.jpg
a9dd980dddac6d0d6b11842171b4fb4c
fd495265d85aa30769086399e4ff5d633d264fdb
87352 F20110115_AAAACJ choi_e_Page_35.jp2
083343fecc36b8c467d3f1a26104ee2d
1dea8bcec0f71f715dd6e01f01075adea23f8819
1969 F20110115_AAAAMD choi_e_Page_37.txt
226f27326555e5f2566328dcf93125d4
3ebacea55a633db0c90bc7d32e9d50c627218f68
F20110115_AAAAHG choi_e_Page_07.tif
e556524a80684b3881ed0065556e3b54
c123b2ec19e59242f4c5aadc153d35cfde017e11
3513 F20110115_AAAARB choi_e_Page_43thm.jpg
16e53e41dc23bcf338ae7d37e23d6212
6c2330db8670016f35d38810db4df17ba36c3d78
41488 F20110115_AAAACK choi_e_Page_48.jpg
6498186b20e03792cf7383ed556c2eb1
76555139144a3163d0739c34a0dd1305c348d388
2018 F20110115_AAAAME choi_e_Page_38.txt
b20b457b25cea45d777706f4b0e962df
5aadb1d2785da63e05f6893e6003a00152576815
F20110115_AAAAHH choi_e_Page_08.tif
86e105a24cb349914a40afbd9357b200
11af5d2e35742a8a45c0aa697666d2d241328103
3524 F20110115_AAAARC choi_e_Page_49thm.jpg
896caccfce689b186be173c3467d2525
e7836d9310035cf267dc0d34b3c6a73173d0a326
72235 F20110115_AAAACL choi_e_Page_27.jpg
5557a6bdd37b9c20703cf3af2eb249ae
eba1928120dc80e5b832fa539f1fb6f280470738
1954 F20110115_AAAAMF choi_e_Page_39.txt
7a40cc225b94eca489e222087e324de1
9c713c1a6b102d97726fd9c38cf1cc7c39ee1f30
F20110115_AAAAHI choi_e_Page_09.tif
d58c23b03b0da51b978ae3360d49459c
34b0a854c35c4a744cdea00c8b51c3fa94011785
23069 F20110115_AAAARD choi_e_Page_55.QC.jpg
1e144114fb567278c5861ec605879dd0
e2ab82b63d12b361c1c4ba23673e749f8ce45cae
114 F20110115_AAAAMG choi_e_Page_41.txt
fc45f855ad80c21b16230f2fc0e6cdb3
fe7c0e7c0035b8db7ce01ead062155dc2d616192
F20110115_AAAAHJ choi_e_Page_10.tif
ecadf01444dc296da8a74bdd401501e5
8c35723e4dbe772328b080c0a342c5eb75c9e2dd
22676 F20110115_AAAARE choi_e_Page_56.QC.jpg
12f7132f05a94dab204d5626760c07b5
2552dc21da0c21263a205f67921f93a24a784c8a
1928 F20110115_AAAACM choi_e_Page_14.txt
664b52da2930610409f14f45881bb2f3
fcb0b6d1c88cbd716e0fb04079868e683b9ed81d
1068 F20110115_AAAAMH choi_e_Page_42.txt
482c033b6c6e7891dfd6faacd7284589
abc34b8e5ced20347a75ae7c0d4c627c59b893bc
F20110115_AAAAHK choi_e_Page_11.tif
ef274a0e0d6864ea568e0502ec67a3b4
7921ecc3d17fc0b49fc74d7026f8b2584a6dd42a
6550 F20110115_AAAARF choi_e_Page_58thm.jpg
0987a363424ee497e3d7a99a14b41b2b
35e84eaadbe549341865a0a7536e37ba17b3f27e
23475 F20110115_AAAACN choi_e_Page_36.QC.jpg
7b211ffba8d58a5ff70414a68dcd159f
3e83185600ba0dbe4a1915537213f7a28ad8f2e0
379 F20110115_AAAAMI choi_e_Page_43.txt
23d4f3e79505377ba4d64aae78079c0f
41f3c8c5fee0a99cfbc58ab6b333b76f8c9d1939
F20110115_AAAAHL choi_e_Page_12.tif
ae0d56f58e4c4e3c855824b5faece874
72504dc6d0a899ba9c62ebda01c7883db4e77001
22539 F20110115_AAAARG choi_e_Page_60.QC.jpg
ccd99864c2c6f6661c86f8dbebc342da
8be014b4d278e2593a63be78d0f71d26e4ca7127
6628 F20110115_AAAACO choi_e_Page_12thm.jpg
d5dabb114736e136d52f41a5098497a5
307da0c30537e21271eb726482b12ba4d71199ba
801 F20110115_AAAAMJ choi_e_Page_47.txt
d2c16d50c7d11c15aa169e862451d2a3
8235faedb306576e22b863a57ba72b05fba0ee08
F20110115_AAAAHM choi_e_Page_14.tif
3c837d611cb8536e288db63bae94de39
9ff01221467694061537bd441becdb4484aa941f
7051 F20110115_AAAARH choi_e_Page_64thm.jpg
ce98e3fc372b48a7faca97a44f4f155a
a426e7a10029e56f95ad8d3822e5d23e05852bcd
5812 F20110115_AAAACP choi_e_Page_32thm.jpg
6e757659743ab219f2b49d513a53fe07
c758e2730b8b8de0d2f3f9f3bd829455fc82d292
573 F20110115_AAAAMK choi_e_Page_48.txt
c0fdb2a8b917a15c1b96632ee6e3ae52
3ebf4674b61f59a78113be79a122c12dbb0d9eef
F20110115_AAAAHN choi_e_Page_15.tif
54dc4b5875f449a4cc55e8b5d3b1cff4
24cb0e2765b65a8e7bf09eb818e78b830b08b6be
24984 F20110115_AAAARI choi_e_Page_67.QC.jpg
b0787a4ac3b4b6f66022507ace550e4a
9b998176e8459be10455e5faca80906c509e2e07
6515 F20110115_AAAACQ choi_e_Page_40thm.jpg
210a3a3212fbdf4bb637ad309c8f0f3b
c87413a2b7b2de0ab76381f72d0698e1318c1a94
613 F20110115_AAAAML choi_e_Page_49.txt
85afd6a6cc835d660dc0b0683e4cfbd0
c8daeb8b8d76f9230c3a95f4abdd66b1cd645c30
F20110115_AAAAHO choi_e_Page_16.tif
7e12e293476930d7ddcc76e03c30d738
852d851c01873f85c67b2c1595e7c22d024de04a
4274 F20110115_AAAARJ choi_e_Page_68thm.jpg
edfecc20b053f65f03640e09df016645
460bd531d6bb1d59b6edb3b7124e71fb8237d971
11291 F20110115_AAAACR choi_e_Page_06.QC.jpg
c062d9b073136f5aa6e95dac7db45fb9
75b97b1175291989a920f921f0434f525f0456e5
530 F20110115_AAAAMM choi_e_Page_50.txt
98260923b3a9841c417a5294e110d782
455e2921012b42caabf733642373134dbc687c4d
F20110115_AAAAHP choi_e_Page_18.tif
a95b396d91a4a55d5e40d4e4034716bd
a71c40caf018a8f5df5afbaf7c84ab4193157235
63820 F20110115_AAAACS choi_e_Page_68.jp2
f63c947ba691a1842abbc12f94c1d3e8
e55c736e5a1b4aae4bef8f7eb4f52054d868510d
793 F20110115_AAAAMN choi_e_Page_51.txt
095574c717cff8f989f8176f40fabb17
baa43f9dcc11635d944f4facccb745b9625860dd
F20110115_AAAAHQ choi_e_Page_21.tif
f3c328f522717293acb68caf2000f901
6474780088eac456798338aa3aa8dfc4775fd7d5
111336 F20110114_AADUFA choi_e_Page_11.jp2
ba11e6556e969a413aacd0ce7b991c29
5b21fe6e9a89aef80a883a45a4f570853074e67b
25743 F20110115_AAAACT choi_e_Page_64.QC.jpg
fd22412e92105fd818f12ab81709d72f
3080aa936ab84db149c5017107a597a4663f0932
2005 F20110115_AAAAMO choi_e_Page_53.txt
3cb06d1d83f4f0a53d4bba9119a00dd8
82434b142785b22f51c84139571920814a121b4d
45299 F20110114_AADUFB choi_e_Page_09.pro
e0f9d0dbd257a890d4b1ccf457bb2c10
9bc677fcc7ab4a21c9157dd2fca95a0b89096e33
F20110115_AAAACU choi_e_Page_63.tif
f64c07a6701c6d0607e6f54f7dfc1a80
c9f782d18db4cf2d0d10f4a6597a58a18944bc6e
1965 F20110115_AAAAMP choi_e_Page_54.txt
0900f3ff0449e31edd68014332d96533
6793646fcffb6df6c600a54ca536f0e8c0ab2c70
F20110115_AAAAHR choi_e_Page_22.tif
3f43c08f4ab75a0525d05ae9df33e0f8
e6583c8c1244ea0d0e72849e6aed7f37e33deda5
6463 F20110114_AADUFC choi_e_Page_54thm.jpg
cd048a465456c7603a69dc688549a459
ba02fb28112dbd9b8d797f1d428c8b172ed900ac
1051952 F20110115_AAAACV choi_e_Page_37.jp2
6f010deabc7f81849b0a9da98d14e616
4fcd611bdceb8e3c868e68f4086391a195da0456
1919 F20110115_AAAAMQ choi_e_Page_55.txt
b3509f8cae094224f68a293c3d4ba227
00b1c230bc8c8a61424820b0557f1b6757a0dc2f
F20110115_AAAAHS choi_e_Page_23.tif
6a7af3448fc261a144088124a302e9cb
292b54a69517cadfda6bcf2683b63399c4f15147
72227 F20110114_AADUFD choi_e_Page_55.jpg
c77c079a0b29ade08272451ae09a15b4
806b71d931c3418b5746593c5fcd09d06c9b59e5
6498 F20110115_AAAACW choi_e_Page_59thm.jpg
64ffbd4516b825454075f3e0952420c7
fda867f05b529e352d687a41b9a458418e75470c
1856 F20110115_AAAAMR choi_e_Page_56.txt
916f4cc34c3282dad28b4917e170d7fa
9dccbbaecc1a00cd423d583a90ab3b4e0d56c070
F20110115_AAAAHT choi_e_Page_24.tif
9ed28a71dc2003f8c1b211e34654ff1a
d34ca064d4de2980fffe1fd24a010505c802bb87
104346 F20110114_AADUFE choi_e_Page_56.jp2
84b67722b8c8a87aef3f28656579c32c
329e22af1e5f369d6aca27f289cf2a80c925ffcd
1953 F20110115_AAAAMS choi_e_Page_57.txt
b72da2105a55074ada526b32a2fb4c18
053a9597d99a3d68b4474861311ffc0b87e6dc31
F20110115_AAAAHU choi_e_Page_25.tif
2a88b656f30850ed79ff9e45ce804471
7818ba2c220af46b0813e5e7f7e753dfce8ebc50
F20110114_AADUFF choi_e_Page_64.tif
3e38046b6ad29cd0c9a402a45467fd69
7ddd6f38cd2dacd8a9a00b9ca74b682d493c6a03
89154 F20110115_AAAACX choi_e_Page_65.jpg
3b4efa79513d5d9fb262bdd9823e00f4
7a050ee93092b522fe4ffc26a34a90dab4e9f57e
1984 F20110115_AAAAMT choi_e_Page_58.txt
c3e75cdf62a3673d922ed56588f133a6
e46c08a46d290e786a5b7a139a60fd83258e2e53
F20110115_AAAAHV choi_e_Page_27.tif
7fe80f3079b9f5ea97346db12f95330f
5ed7580d82646d495a2fcc137aa9dcd87cbc7f5d
F20110115_AAAAAA choi_e_Page_19.tif
168bb6d6260d3fca5997402f3169fabe
f497ce7acedfe4534d4c516baaeac3b28dbe0c65
13340 F20110114_AADUFG choi_e_Page_42.QC.jpg
6f7b5e19ff84a443734f465e1f65ef6b
927a1eb2aca88ec172d32b4afcca8f8c39047891
6313 F20110115_AAAACY choi_e_Page_60thm.jpg
4dbc597e94f22beec711ce1e382a9c8a
0222e79c0d2d161ee0c2c01a160ba41ff6c94301
1979 F20110115_AAAAMU choi_e_Page_59.txt
381c5eb363a3cee5d1fbeed8299d5eb6
7769f59894fa6b57e7e7c80332d27929e8b22360
F20110115_AAAAHW choi_e_Page_30.tif
6cbac7349424bd755876e9f495fd5f82
87c5802915666ef31b60b464fdfa68a8687f647a
72553 F20110115_AAAAAB choi_e_Page_59.jpg
4f844c3f2b6ebc4237119af40b06344f
48d8551057bf1b9f7e5ff7e06c93e89b9ecbf5a9
41270 F20110114_AADUFH choi_e_Page_50.jpg
35a234ab4cbd783d2285525827b6c27c
88680f9d7044335c7802f15233ba829cc4d3b17b
24058 F20110115_AAAACZ choi_e_Page_11.QC.jpg
d5761aae5172dd66f94362f5200f59d0
800b0a30f7c5190a8f3a548d06f06dae4dc48c69
1922 F20110115_AAAAMV choi_e_Page_60.txt
5a9673ac3498dcdef65b94d0cbd21737
6f1cdcbc5a78b2330f3ff70d942cf96a1ccc1fbb
F20110115_AAAAHX choi_e_Page_31.tif
ee715c09c42640b21963a31f89885ca0
a95ed43b77a93c5afaa6747b57f669272d0f4a01
673892 F20110115_AAAAAC choi_e_Page_49.jp2
f7b54189ce5051843f6f5ce398adc556
1558bc3d8b870c9cd0cd7923a482b4d226b8aea8
23886 F20110114_AADUFI choi_e_Page_26.QC.jpg
d3d8a4abe6348fbe69680f766e99ebc9
ac38c39852ce1df62dd3e31b9db846e99f3b28ea
95153 F20110115_AAAAFA choi_e_Page_66.jpg
62fc8bef652dc7110d0d60375d78f2c8
868f43dd1ce83b3b5341ad4597df55f445a3ffd4
F20110115_AAAAHY choi_e_Page_33.tif
dbe201a6fb4a3dfba3f843c3b1e725fb
ed6f7a191006632cab1cc8bd226c458071829d67
2001 F20110115_AAAAAD choi_e_Page_11.txt
badcdbd12ffa212297027a3771c78de7
e3de822594866984fd20dc9abfb90d2004c3e562
F20110114_AADUFJ choi_e_Page_44.tif
2eac19300560baa9aa8151547785d0e4
0c29fcc8acc9ba166a1cc708030764206b908364
1854 F20110115_AAAAMW choi_e_Page_62.txt
6507828b2c61497889a685f084fc805c
bde3e64e1888284ad39c875d7ac25581747136a6
85857 F20110115_AAAAFB choi_e_Page_67.jpg
575e43bc76bad5ae34058f06729d40c8
b38f9392ddd04b720ded453c51d82357fe23bc50
F20110115_AAAAHZ choi_e_Page_34.tif
de2ad5892d15634e0b7eb72c09c33126
192378e48ec151ed1f8a8c3c0733240fde5d7bd9
22781 F20110115_AAAAAE choi_e_Page_24.QC.jpg
5b0631a21694015d9be50eb55fbda1d4
d3d2d17677a8e3136209a3809eda64e304062ca3
F20110114_AADUFK choi_e_Page_13.tif
0343921ed39478e6337928144ff029c9
f8772e985edd1b6f26640496286c0ccbd45fa564
2343 F20110115_AAAAMX choi_e_Page_63.txt
222ac1b63deecbca8c07b12db357c4ee
b992e3ec72ee66d893dd2b7105fb59d5acb1c364
45441 F20110115_AAAAFC choi_e_Page_68.jpg
eb8ce6df043b0a0e768b39ecb0273244
e789dd0470bad50d277bfb256282fa97e04a3b35
23659 F20110115_AAAAAF choi_e_Page_53.QC.jpg
4542fb7701e58d98566dd4a28a933757
e03dc72031e61c408cc9fa518e0ae5b5b4951652
F20110114_AADUFL choi_e_Page_58.tif
81b0f7215d355d78c0efe15f788a519b
21cc86fc8cce916e06f08b3011ce060658b8f850
2576 F20110115_AAAAMY choi_e_Page_64.txt
526a2d2f53c560f13901a5a42db11f78
d0004fc06ec15ca23e885572245fc37b38fb4604
69989 F20110115_AAAAFD choi_e_Page_02.jp2
3d2c1592c567651a75848ad78c67a476
583506d50cdaeca527a8dd7b07a8041f17849703
331 F20110115_AAAAAG choi_e_Page_46.txt
fd3a48a5fc8f90f451176091e8a21c73
5b862c382587f6ee0745bcf918d2eaed85d17c82
50038 F20110114_AADUFM choi_e_Page_54.pro
4d39905649f4f10cbe24cccf814428e6
9bb46896d407be383da65d123bcdcef93b1d66bc
49700 F20110115_AAAAKA choi_e_Page_39.pro
e822ac348a11ecfe9af677b8d81bc72f
6f76a40cf17fbb2cf87d1b2540a895da3b113f9e
2700 F20110115_AAAAMZ choi_e_Page_65.txt
120d7f940427c7f3e329e1b403c2fbd6
7ef3860d349c4c0f052e8ef0a47215be998294d4
1051985 F20110115_AAAAFE choi_e_Page_03.jp2
82ab2ebc5a193140ddd7a3f8943d42a2
262ea6a6307b6583e1ba64e0fa643bde9342e685
65273 F20110115_AAAAAH choi_e_Page_61.jpg
574897a8c5d2a64dea04d9c983bf1e83
6cb41a47ec6553230d9b1667718978a0ea9128a5
1571 F20110114_AADUFN choi_e_Page_23.txt
baa12bdd41ef6a0e71b959ad36496025
632be515de68414b56c7a00275957b24b1f38535
47487 F20110115_AAAAKB choi_e_Page_40.pro
fe1a5a9744550480e0d1a4cae523717c
5fa3088964b35921352a7e241cafdc75713b1e54
893290 F20110115_AAAAFF choi_e_Page_04.jp2
9fbdb839a3abb4a3458bf830fb89ee25
efb1ec0f0495009b4b5320f83a8a76c0f0cdcc31
70877 F20110115_AAAAAI choi_e_Page_14.jpg
f2dc222af295d0b53567532f657b363d
4a5f3318102685f43b4c6dae7b740548acb52a52
F20110114_AADUFO choi_e_Page_26.tif
9ff5274adc8f53c611863023b7d1b1e5
76954a6fd06e6767d6aa3e5b793a63f6eb5f7031
2742 F20110115_AAAAKC choi_e_Page_41.pro
7d430b02cf0220cb12057cb8af55082a
bf73ff00abf69150ac05c0ff75147bfaf7cdc3cd
19725 F20110115_AAAAPA choi_e_Page_35.QC.jpg
b80b9213763d40ae2ad450d1561d1538
614bd746ea4685d0ea04206049d42254f18161ca
1051982 F20110115_AAAAFG choi_e_Page_05.jp2
0506b445c2cedb848592d175a03016cc
4c2ec4eda0ac889f736a6c3c2aee864c119a1abf
1871 F20110115_AAAAAJ choi_e_Page_24.txt
a59d1b288715469418878fff7ee34fb2
708dc71c4932c67b7daab9edceefab4dfb0c4938
27162 F20110114_AADUFP choi_e_Page_66.QC.jpg
3cc3132aa98f2cb7b0883bdfd50b0604
f9d88de380dd246153d5146ed8733fb39c4af7b1
14993 F20110115_AAAAKD choi_e_Page_42.pro
be6e626c9f423d335bd2aa231a593d40
4bb8ccb6063ff3bfa7e4f5fb4527cc15f743ec3a
24362 F20110115_AAAAPB choi_e_Page_12.QC.jpg
0be2cdbb4e86781694f02834fe053201
fe328c77f4ec1d5e18e33c6963d01a24104315e3
958035 F20110115_AAAAFH choi_e_Page_06.jp2
91f9aacb7486f283ce97c8d2a38d9958
67a612a5104ff2128d634cccac259df665ccdeaa
70524 F20110114_AADUFQ choi_e_Page_03.pro
9f279e6c486329816f26320fba6dbd6d
6f31aaefffd56c9b6d3defe03506913d3c511020
8128 F20110115_AAAAKE choi_e_Page_43.pro
49e2158d7e944a2ddca4d50e88c53349
916ebfd65d9472e7d699e6115905b5c675e47de5
14915 F20110115_AAAAPC choi_e_Page_17.QC.jpg
e15a65fabafe620cb2e6f28f414e96de
b8d6a0c4df90a4177106bdcc6feffb97533f5cc0
89346 F20110115_AAAAFI choi_e_Page_07.jp2
47265ce79f7ff211d5a8432f9319450b
e525a1a66bbaa11a1e71ccf1373d97fe19877dd1
26105 F20110115_AAAAAK choi_e_Page_01.jp2
74f0d194cfcee708fd11dab5ce387422
3eb03d3dbe432be9f497ead993be88ece55fbb76
3881 F20110114_AADUFR choi_e_Page_33thm.jpg
6541ec1dfd41ee49b6de8654373f8b37
1e1e476489a98029175dad4238fd5419ffc961ef
10427 F20110115_AAAAKF choi_e_Page_44.pro
22fa755e753067bb6ccb7be650723fe3
c3024ce4af247814da31c88899e68eb39eb231e6
23631 F20110115_AAAAPD choi_e_Page_13.QC.jpg
c9e6b55b35ea738f47695cd1b3052a83
4cd2b8ff5e305de547cf63b76baf83323d22b5b5
96522 F20110115_AAAAFJ choi_e_Page_08.jp2
88ee6a188e9fb422236cb6361cbdfd43
c1e989d8fe31f1c8b275a55822698acbb715e6dd
1718 F20110115_AAAAAL choi_e_Page_61.txt
e8042d19c7cd91889a7cce2434ae071c
0081b78a0b315fd0ad05f8c0a480cf9661583fdb
5896 F20110114_AADUFS choi_e_Page_61thm.jpg
28a5aa296dfe414aa8715f0b17ff29a3
35a86b2ddd3278161d1540b4330420de2dda9f12
15293 F20110115_AAAAKG choi_e_Page_45.pro
de80968c1cd1c1e3125335a27eb5499b
9641b77d087b526316761c47744dcea1c7108497
5979 F20110115_AAAAPE choi_e_Page_09thm.jpg
03b2000285af0fa32b13317af0028297
558ce57ebbd8f4a9b6e3e679020dcc71d67fec1f
114355 F20110115_AAAAFK choi_e_Page_12.jp2
31acf5e73b35bcca92e590a42139f15a
e26a41facff6be89a9fd1836643f6701f903b4eb
99082 F20110115_AAAAAM choi_e_Page_09.jp2
e0a8c2d29b19b0a211adc84f69c2758b
c66bff79926178c4f2c4948e5f0db6b4a01c0147
15504 F20110115_AAAAKH choi_e_Page_47.pro
9757fdd044aa1cea066fb189ac1baf16
c4428f42a812b5838823087a1349a01eeef31c25
11534 F20110115_AAAAPF choi_e_Page_51.QC.jpg
20647f0baba0c088846607dbfac9b22f
72ef0b7ac6f7ba8ea87d83cd7a969298f2831604
106973 F20110115_AAAAFL choi_e_Page_14.jp2
2a13b6f1391e7e941c986c1dc008b43d
7c7b7c99e93162d536164ffd42d2ea40db303bfc
137313 F20110115_AAAAAN choi_e_Page_66.jp2
979eba9270adad366dad51b1999e76f6
f443f8762a7589aab8bcbcf9a2693435dca2297d
12573 F20110115_AAAAKI choi_e_Page_48.pro
964ff8f9f2d81b3dd292b282bda6d238
6207c88626433de7627c5910ae96ab8511313e3e
4241 F20110115_AAAAPG choi_e_Page_44thm.jpg
3c4e5c5e91a0bc107568b6653127544a
7533e50bff5e224a3cd2560cbda085faed946f53
110122 F20110115_AAAAFM choi_e_Page_15.jp2
7206f144d4cf01bfd023a655371be875
50ceeac254c3fc2d3b182747968f3b0fafdd11ae
111083 F20110115_AAAAAO choi_e_Page_39.jp2
5c2a60642f2a358694e1b8c1e3288769
02ef7a3956a2384fd6c7a0a86cf728dec28e21a8
9907 F20110115_AAAAKJ choi_e_Page_49.pro
d3fec6feabd0a5c0559e2abc5a8cab8a
ffff764edeec949eaea1684bcbda2eb4698aeaed
6354 F20110115_AAAAPH choi_e_Page_30thm.jpg
48f5145a67674d17baf0c992e5a0176c
f82f2b7b180995c9137c465214c6c47e4304b011
110138 F20110115_AAAAFN choi_e_Page_16.jp2
57c34dd5ae13c363f572fa82c1331ba3
be199049be32cbe071e763474e6066c612ceeb75
1847 F20110115_AAAAAP choi_e_Page_52.txt
e0bb9cbc500230012dc427cc4a3647d0
d176dd8aefd88247f7c5b4ad1ac50cbe6478e6cc
12014 F20110115_AAAAKK choi_e_Page_50.pro
b82999a90a29b1c97a84c7d4e874b0d4
b6b580d296c25a4bf6a0cc47a056f24de023d0f5
21555 F20110115_AAAAPI choi_e_Page_52.QC.jpg
b78b64027c46c4be99f4242e1acd1145
2ef1a5cf3af026272a64ad9fc3a33ec80feed4af
65471 F20110115_AAAAFO choi_e_Page_17.jp2
26d0b090340d51ec8baf89fbdc5f1aba
86ce39aaecb0922e65a774934ac47626079da38d
6505 F20110115_AAAAAQ choi_e_Page_55thm.jpg
4dbbe30544340e747c62a82b6c3d8013
d95fcd1d6f7d698dc994b124cbd4e19cc1884fbd
15443 F20110115_AAAAKL choi_e_Page_51.pro
b7243aa971c9dd9f9a22ad296ed7a50d
2117d620a72da20ade4c5046bbd61fcf561eccd4
12329 F20110115_AAAAPJ choi_e_Page_47.QC.jpg
15a46a8a46716d039489b6054d58daf5
802cc780eeb0d95a2cc53f6b984f9689d8094e3f
492936 F20110115_AAAAAR choi_e_Page_48.jp2
79ebd0ab22cebe6282892872074be826
8175b619980dca5d77a71dc742a2eb83ce307824
45310 F20110115_AAAAKM choi_e_Page_52.pro
e68a15c1d371794b73c8526321231e41
804e0c3de9d03028853bbc55afab8d9471727713
24521 F20110115_AAAAPK choi_e_Page_38.QC.jpg
fd93d7f9f57443bc2a79cddd0d391353
1b492465c660170585ca735ec15f72f9fc2d1e2d
1051814 F20110115_AAAAFP choi_e_Page_19.jp2
91fda25367b408a34fa945ccb46e63f1
c6b5365607fffdf17e8e19ed5fdcd75e223d53a5
2000 F20110115_AAAAAS choi_e_Page_27.txt
8c0ba9b4929236fc252a8988571950f3
936b7ec3ebdadf867b11af19bc6bdf881f06b711
48727 F20110115_AAAAKN choi_e_Page_55.pro
53bbc0e2d28c6c1a7910a93e3e279400
4b3addf1c625dae274efdce0948034c867843ae8
7847 F20110115_AAAAPL choi_e_Page_46.QC.jpg
5d87b729dd0a858293cff3ec78c67f69
954ffd5e1aa1d76af0f7c9ef3b1d5d58aede8df8
425327 F20110115_AAAAFQ choi_e_Page_21.jp2
8d100952c2224a6b560efc82fc34ca2f
b01b34d42e36ffcff473449d97a46d1e7c3996da
66276 F20110115_AAAAAT choi_e_Page_09.jpg
64326b8211e9901a624b3c032754786a
30c5bd42897412f6149bd6e82a7fd569eae31072
46803 F20110115_AAAAKO choi_e_Page_56.pro
e7be8d3d9ca7e888c22a29cd9ac2926e
cd8b6cfb7d83263665a60a7470d5285cfb58fdc8
9763 F20110115_AAAAPM choi_e_Page_04.QC.jpg
d1870539b8df34803e69734e41fafb6c
f8b9addaf33f2ca1f2febef3fdc7d444051b100f
562938 F20110115_AAAAFR choi_e_Page_22.jp2
28a9a81188226c2aa17995615de80ba9
0f2e7a45fd3e864c2e54a1f5a92898397eaa3f32
109605 F20110115_AAAAAU choi_e_Page_13.jp2
dd6f9e2c58160e41c7bef799aaad18b0
576d3d6b7e3cbd6d6c0028bc3f9692d85caee7c2
50550 F20110115_AAAAKP choi_e_Page_58.pro
061f92f9dd57ab8eda99a7f0b44c4f06
bf04f91df120fe8d920d340a5bbcc29c5613fad2
4936 F20110115_AAAAPN choi_e_Page_48thm.jpg
b9620a3a3f2de2cb0e6269aa3a31e640
3d562d22ebef9855141eef8728e769e610928df5
85337 F20110115_AAAAFS choi_e_Page_23.jp2
0c747d013b5d2741b9a2d51f0c1be352
e4b515ef09e1f7bf44f57e2eb1f5ace3d188a33a
73353 F20110115_AAAAAV choi_e_Page_16.jpg
1627e47dd28b0cdcc9d55a7706ba658a
7955565c5878ff6e67c014e647ab8f8069faffc8
50223 F20110115_AAAAKQ choi_e_Page_59.pro
a39f3e49c615889dc56045e037945088
2224be55169573b86f8e9cf95373e79ae4de5ac8
3231 F20110115_AAAAPO choi_e_Page_20thm.jpg
5fac7c06104f87badc01b2bc9efaefdb
bc54120ab8fda259ca3a6769dfabd220e149fde3
50083 F20110115_AAAAAW choi_e_Page_13.pro
d66b67a1aef15ef01f2fc60f6abacbdb
1da57dc097d1f4e454c9dc8b7c6e228deabd03b8
48808 F20110115_AAAAKR choi_e_Page_60.pro
9c589f302ada9d6ea374fdab694548fb
0011898e1cbbf893bb24fefb9c93d1e2a54ea355
104924 F20110115_AAAAFT choi_e_Page_24.jp2
ae40cb9b8dff432bfd359d78b9a43b5f
b9cbae610b88619a4a125877b852c09a3de1728e
23232 F20110115_AAAAPP choi_e_Page_54.QC.jpg
afefdcd93760926f89e8114bab72cc8c
ef8462af8e0349164593e0fd1588f0d111b32fb3
104546 F20110115_AAAAAX choi_e_Page_40.jp2
4b7d5191ecf61c374f9544230ad2106b
c39c08290182b96f63a9efca4933bf980db36ea8
43217 F20110115_AAAAKS choi_e_Page_61.pro
b808cad40bc10733aa15e29ad07cf2d8
ca6c58c5cfdb7b333691e2b7ddabe6e7df970203
105088 F20110115_AAAAFU choi_e_Page_25.jp2
28aa5ce6de8a7eb810c0d2a809f098f3
c78a5dcea620f7497c368f65e9b7bb9d8ba3ec7e
2768 F20110115_AAAAPQ choi_e_Page_46thm.jpg
126870f9ad27b3b86b7c07c3db57bbe4
b097ad610a7e690b471bf699b21bd7b909fec835
F20110115_AAAAAY choi_e_Page_47.tif
7cc6059c33c65d3b6e307fb9c6258851
ab123fe3fb1926c2bc65fb4e56fb927395b4dfe7
44695 F20110115_AAAAKT choi_e_Page_62.pro
40dc029f503c01d20fc645a2f903d3a7
7b03f0cf6e8bfdaf9ae0ced585670a17d91c5699
102240 F20110115_AAAAFV choi_e_Page_26.jp2
dea901e57955417148ac0f50a8888f67
5ffda732f42e5918ba0e5eb4ffe1c1b04ba0337d
5884 F20110115_AAAAPR choi_e_Page_62thm.jpg
26e293db13c5b26e928fdcd2cfcb5d4d
a9e720963299df823b58c1e3f1ee20cfb2bd90f1
4084 F20110115_AAAAAZ choi_e_Page_19thm.jpg
cf7f1ae9087a8759f5056a2ad230b6e9
2abdb1e19d9c51f88a071f6db149889da9c5c4fb
109310 F20110115_AAAAFW choi_e_Page_27.jp2
4bb228093df60bb1722c2c0c7edbd808
139374e0981d9a95722b72cb1fbe0f53640f2575
6511 F20110115_AAAAPS choi_e_Page_13thm.jpg
9bfc063a9937b4cd0021b7caf40f3024
7112ff048623a0b5ab703c1876ea3d56b5ea4378
61835 F20110115_AAAAKU choi_e_Page_64.pro
ebcdee3482c560f89dc282be2974fd96
be1c09029c3d08206cbedb4b9edae8a59378b8a0
111945 F20110115_AAAAFX choi_e_Page_28.jp2
4e0eb15ec70d8824871731108c5fd80d
6709f50ef236d0c3a7a3b082a5077a3b966b1712
23986 F20110115_AAAAPT choi_e_Page_27.QC.jpg
d1da11803fe18ffeebb524ab1fed276a
3b13d6eae42c59d0cd1c44d10122e9e888a04809
64963 F20110115_AAAAKV choi_e_Page_65.pro
852fae43ffca77ac2710a64f4f6f3154
f77629f39d69caa2117c0fa4d5c98760b3d91c3a
1160 F20110115_AAAADA choi_e_Page_68.txt
84e322efa11d26ed13a8efa36f419061
38b6554724ec0518c8c9e36e82a29b6a85782970
107933 F20110115_AAAAFY choi_e_Page_29.jp2
4e14179a6cd88a6849e33648fc47d0d4
604e658dcc2bf99baf4d30f5b835dea66cba8a32
21535 F20110115_AAAAPU choi_e_Page_05.QC.jpg
1c5923770f0348c31633b68e1d449fc6
5ff388ca440e73325ba3ee3737eb6f4ad3d21cd1
65447 F20110115_AAAAKW choi_e_Page_66.pro
103da2a5d8d13b16a4a57836ac14fe79
9fa628a7e966891f9a832852000ca47f0fa41c4f
1051923 F20110115_AAAADB choi_e_Page_10.jp2
3f02b07fca13704370441e950d5af111
0519de1352e81da2fcfce55c22e8bd9a64497f26
101861 F20110115_AAAAFZ choi_e_Page_30.jp2
5e40b71d2e1a3111c5d8f923ea329660
904b7caeebd6f9eff6c43e28658e7c9b3717a26d
13544 F20110115_AAAAPV choi_e_Page_50.QC.jpg
26c2b0ae14ca321803eabfb374ecfa0c
cb6ef07e9a810a9ed44eb9c82ab71ee783c2964c
59028 F20110115_AAAAKX choi_e_Page_67.pro
124418cdbbe08696a03c7a811885f017
ef7e295d5ed260976cf074befb4399c3a7abaa54
79867 F20110115_AAAADC UFE0007401_00001.mets
afce9df15891a8d6d7f67269f5b8d390
96b250ae6912fdc878ebf397ccfc65b6a01efde7
4289 F20110115_AAAAPW choi_e_Page_47thm.jpg
9b0f52f229f0a40235723a0922c99c35
1503e8009b5bf7aa0fd44bcc277dfcee25dc8676
F20110115_AAAAIA choi_e_Page_35.tif
6c638047ff14807f3cd3d938b831919c
ceb1ce00ed6296f281c9c72be85c2eb3d1f8e753
27883 F20110115_AAAAKY choi_e_Page_68.pro
cfc471a480cfedc6983f2e8efcec0da9
0437431de0940792babc95641cee456b232f4628
4273 F20110115_AAAAPX choi_e_Page_17thm.jpg
084a373b6cae62efe0e19a0ae150a98f
c41f47e036db68154cbacea731d4e3b73e96905b
F20110115_AAAAIB choi_e_Page_36.tif
7844f47816eae3b6b4c4a0bc065665bc
7a8f13570adece7348113743040ecc483163da8f
514 F20110115_AAAAKZ choi_e_Page_01.txt
a20d3bca6649380944311f5e5feb589c
6effdf8d58d48bd94856c2d8555c8f2cce914bb7
4737 F20110115_AAAAPY choi_e_Page_50thm.jpg
add331bbcd6a426a79579bb64bcc5f7a
fc1fe889920703b24cb1d5312017033e5f88b403
F20110115_AAAAIC choi_e_Page_37.tif
5bda6be11331a2774e7600a4fd64123d
18bd5adcab92f6c41c3763e029f3aa6af46fae32
25453 F20110115_AAAADF choi_e_Page_01.jpg
3d800fed93478b64cbee6e5cb4821353
ca6ddfe90a0482ce231610fbcdbdfe1b75c22f81
F20110115_AAAAID choi_e_Page_38.tif
c91165a06ed505a546b4850363c3d5c3
f7bea43a32f049ef84d2dd24b595a43897bb3832
49609 F20110115_AAAADG choi_e_Page_02.jpg
e4073f48db80653a86e70f443d1fa413
ea284b600bee081d3552e561e29f2ef3e245ed7a
2709 F20110115_AAAANA choi_e_Page_66.txt
8f54aa47082da496c22357a3403cd0ff
bb0efd230ae9bc5b4c9f3b602e5c0a16f9f76269
6443 F20110115_AAAAPZ choi_e_Page_57thm.jpg
360fbba47640fe8aaf4513a6862f6bbf
f9fe8f386cfae48d07447902b3826a0bd1191f9a
F20110115_AAAAIE choi_e_Page_39.tif
2c1d748e1611598c5a3ee56cf4b3c407
d4fc7bd62f3f1bd9681eb2ff34c1096930a9d8c4
76105 F20110115_AAAADH choi_e_Page_03.jpg
5478546d13a0a419f41f530701b3dfa9
d8732af512faca494e6ed7d4889ff3d9ba99565c
2462 F20110115_AAAANB choi_e_Page_67.txt
de8828ccb22919b0ca17514aadfa437c
ae8ee3fe72b7657f62f9c8baadde7b5d60759b87
F20110115_AAAAIF choi_e_Page_40.tif
ce5030c19e6cb6dfb1e31548b7f28b69
545d04cc0948f9fdd1571220cef23127f453d78b
36809 F20110115_AAAADI choi_e_Page_04.jpg
54f784eea220b0acfd3aa1d31e4801ac
50ca05ee9d55b466114a298d015e8d498327490e
2472 F20110115_AAAANC choi_e_Page_01thm.jpg
30cc6581ec117c735a7de4ba219d8866
70f481eef19dafce4a67ad5aa3a3627180db401b
F20110115_AAAAIG choi_e_Page_41.tif
7b6d8a9b3165e019ca41c427f8f0286c
2c600604e74ad822b4988b74e3dbe72b101fc8a7
71599 F20110115_AAAADJ choi_e_Page_05.jpg
acd1ffcb7bf100f0d6d8a927234c5174
308f0401ba8f33ac4f24e795975deb8d612446c5
2680971 F20110115_AAAAND choi_e.pdf
c132ff51f9ff60dbddfb7ad144ea6f9a
1dafa7129c880c893d77c6bca1c7fa9edf642d3e
F20110115_AAAAIH choi_e_Page_43.tif
4d25a4f5c3a01d28180ba36aa1ca6d7b
44c7ff6d767f31624b2f2303453439b0766d9902
63381 F20110115_AAAADK choi_e_Page_07.jpg
4ad6e77191e72fd6c885b253b998eb7a
e70872167d81a04fff00830b630fbdaa6e81ac0b
3814 F20110115_AAAANE choi_e_Page_51thm.jpg
1925248bfdfd7837de58f226283f042d
90ba8767f2dda120b89271c65e095badc3c50874
F20110115_AAAAII choi_e_Page_45.tif
6f3928c30b77d9c7ee22e70da33321c6
8bb53f2402893bbc1ab517f9cc45b1ee3cfce44a
65130 F20110115_AAAADL choi_e_Page_08.jpg
19bb59c6c9b5fd4c9e4112e5e7c1ebb7
4f8160ff1cc0b309f93cdf6c9e6896c3c4f96faf
7769 F20110115_AAAANF choi_e_Page_01.QC.jpg
6aeafd6956646f43f537d0060f696ceb
99ce4a79ae52a6b77a1d011c1131654e871e7383
F20110115_AAAAIJ choi_e_Page_46.tif
c9db5856b70c27c74d5c0b4a8be4bcac
4eafca5c4a899fbd8dc3681045d04457ad99fcc7
75294 F20110115_AAAADM choi_e_Page_12.jpg
516ee64f084c700290b20db5807a071e
3272500faa9199bdbfd19071981f6284211af0ac
19449 F20110115_AAAANG choi_e_Page_23.QC.jpg
b989fdebfcecf3d5451152967a2e6441
7426af941201c3aaa385709794f3cfcad8a4f914
F20110115_AAAAIK choi_e_Page_48.tif
67fc867c49ed2259378309e63031b474
017af6effe8b3be323b21b318fff6e1dae21d260
23492 F20110115_AAAANH choi_e_Page_15.QC.jpg
37243f7a3e48f21ae4b15d09b0e615d0
87c92e86589ecefd34b39172626fc4441341d5fd
F20110115_AAAAIL choi_e_Page_49.tif
96bcfe6e72de2e0cb24d0a0f56b590f5
b6186423cadc4ee71434a7c3c07f60e6edb29229
71874 F20110115_AAAADN choi_e_Page_13.jpg
a122630f5849c0368225f72eed6b69de
5cbb1ea411e7799677ad7ba52db33ed75097e096
6560 F20110115_AAAANI choi_e_Page_25thm.jpg
dd3e042b7b9e61da6af8d6296117c8d7
24634002a453abe36e091f19d2bd7c5701c0b018
F20110115_AAAAIM choi_e_Page_50.tif
4a91b6edf15e1342629c60a9a5ecb5b8
d32617e7aa2ca9a73794705e02c3dd219558dec3
45487 F20110115_AAAADO choi_e_Page_17.jpg
c96d999e0aad38808c9af50f3c505c08
6b3184a7cf4bd2f5a6951648327453f0b6f71555
22538 F20110115_AAAANJ choi_e_Page_40.QC.jpg
9cfa084702945061a4eb78de54ee39b0
6e6f3217cf1a5e59c7dbfc0b25f460efe2364419
F20110115_AAAAIN choi_e_Page_51.tif
79f67846949479276a23d49c56dea73f
9b7f5c8faf6c1c8bd9a43700a97931874a5bdbd5
58179 F20110115_AAAADP choi_e_Page_18.jpg
c00fa0273dc0a05e42b36201cec536a1
f6039ea0e903deb2cb908eeb3d3fe7c047bcf918
23160 F20110115_AAAANK choi_e_Page_57.QC.jpg
a3ca4a08fd54c21f058ba7b16e5b00db
6e584b8b4d7f7fdd6fb82fff7db2c2b0fe812d49
F20110115_AAAAIO choi_e_Page_53.tif
8255344cfa3af35f118708d6c7c77a31
42b56e66d22b8db6163e76aeaa13e144ccbbdab7
47475 F20110115_AAAADQ choi_e_Page_19.jpg
5a78c65393493f14a746383d659c97a8
7c235245db3dcda1bce3ccc042adcab110d8cba7
14139 F20110115_AAAANL choi_e_Page_19.QC.jpg
9048710c8109d5ec2cae0dce30429cf4
eca6602cafa96db46e54bb0b22641d8a8c2c4dec
F20110115_AAAAIP choi_e_Page_54.tif
b2a92bef9155826aa2d57cb57252becd
60585551d5f8505278fe479525315a665749ee22
36467 F20110115_AAAADR choi_e_Page_20.jpg
7ccfca3230963fa2681fd48f77ac4069
6c8747d7e9afa9c17d90c0cb0bf2c48f4e684081
4439 F20110115_AAAANM choi_e_Page_42thm.jpg
ede8abff76c3d62c4643c00950f39d6f
6a5bc446cd8e8f981a1683645a1dccd3a01b28f4
28496 F20110115_AAAADS choi_e_Page_21.jpg
c5e4abe6df8c226b29abd7bcaddcefa4
17fdd11f1aa3ca792a87579543ba006f5385a7dd
6671 F20110115_AAAANN choi_e_Page_67thm.jpg
cdc0157d311d226d8c7a670683dc54ab
f4b6a71d0dd594b426e461602217da4f8ae51987
F20110115_AAAAIQ choi_e_Page_55.tif
dbaceab90c9f7ee1a093688f55ea958e
6f5757a888f267b5b004005906e8a7201f8cf697
32514 F20110115_AAAADT choi_e_Page_22.jpg
f2c6dca70afb75b6006b073dc77ea995
01d64ceba9e0e2db5df2a941c1d51f57a50f1504
6563 F20110115_AAAANO choi_e_Page_11thm.jpg
9bdc534cdd6344ee51ce1ee221cc59e4
d21136d5028e21a19428ac053c0d51d124b3f457
F20110115_AAAAIR choi_e_Page_56.tif
51314b4684dfafdd1401e8c70c29c07e
5fb078656c5958a8b13d576a354a65bcef744ba3
59462 F20110115_AAAADU choi_e_Page_23.jpg
74ad9ca5985945dfd6ec4461036c4b1d
ca3509fa05dfd87937797349367ea744f01c72d8
6389 F20110115_AAAANP choi_e_Page_15thm.jpg
2bb148dbfeec95edca1ec201929288f6
12cdd0d64a33ba28387294c536abc25c370295f5
71473 F20110115_AAAADV choi_e_Page_24.jpg
d09230d5ade25a40a75f42157cde2690
c103fbf94bd8eb54a4ece2c52bb894e7a2dbd0e6
5205 F20110115_AAAANQ choi_e_Page_03thm.jpg
55389748b79ffbc5ada86207cdbb22d6
8e67c874738ecc35c4a28d8610c73286a90eb864
F20110115_AAAAIS choi_e_Page_57.tif
9ec9dd6f0be512502f646eae0f378da8
c7c20c2916d42e5dfb4ba0941e6621731905f898


Permanent Link: http://ufdc.ufl.edu/UFE0007401/00001

Material Information

Title: Comparison of the Effects of a Processing Sequence and a Nuclear Export Element on Ribozyme Activity in Transfected Cells
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0007401:00001

Permanent Link: http://ufdc.ufl.edu/UFE0007401/00001

Material Information

Title: Comparison of the Effects of a Processing Sequence and a Nuclear Export Element on Ribozyme Activity in Transfected Cells
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0007401:00001


This item has the following downloads:


Full Text












COMPARISON OF THE EFFECTS OF A PROCESSING SEQUENCE AND A
NUCLEAR EXPORT ELEMENT ON RIBOZYME ACTIVITY IN TRANSFECTED
CELLS
















By

EUN-JUNG CHOI


A THESIS PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE

UNIVERSITY OF FLORIDA


2004















ACKNOWLEDGMENTS

I would like to thank Dr. Alfred Lewin for giving me the opportunity to join in his

laboratory and for his advice, support, and trust during these projects. I would like to

thank Dr. William Hauswirth for serving on my supervisory committee and for all of his

guidance during completion of this thesis. I would like to thank Dr. Paul Oh for serving

on my supervisory committee and for being an excellent mentor and confidant. I would

especially like to thank my family in Korea, my mom and younger sister, as well as my

mentors, Dr. Chang-Won Kang, Dr. Hoon-Taek Lee, Dr. Tae-Young Jung, Dr. Kil-Saeng

Jung, and Dr. Hong-Yang Park, and friends here and Korea for their continuous support,

cheer, and love over the years as I have pursued my dreams. I would especially like to

thank my boyfriend, Koo Yung Jung, for his encouragement and love during my study. I

would also like to thank all of my fellow laboratory colleagues for the advice, support,

knowledge, and wisdom that they have bestowed upon me throughout the time that I have

been in the master's program, especially Dr. Marina Gorbatyuk and James Thomas, who

supervised most of the work presented in this thesis.
















TABLE OF CONTENTS

page

A C K N O W L E D G M E N T S .................................................................................................. ii

LIST OF FIGURES ................................... ...... ... ................. .v

ABSTRACT .............. ..................... .......... .............. vii

CHAPTER

1 INTRODUCTION ............... ................. ........... ................. ... ..... 1

2 M ATERIALS AND M ETHOD S ........................................ ......................... 15

ET-208 D design ........................................ ............. ........ .. ..............15
Rz448-NHP-OHP, Rz448-ET208-OHP, and Rz448-OHP Constructs.......................15
G el Purification of O ligonucleotides................................................................ 16
Annealing Phosphorylated Oligonucleotides .................. ..............................16
Digestion of the Circular AAV Packaging Vector with Proper Restriction
Enzymes ............................. ..... .................. 17
Gel Purification of Vector DNA ...................................... ............ ............... 17
Ligating Annealed DNA Oligonucleotide Insert and Vector DNA ..................17
T4 Polym erase Treatm ent......................................................... ............... 18
Bacterial Transform nations ........................ .................... ................... 18
Large-Scale Cesium Chloride (CsC1) DNA Prep ..................................................19
Plasmid Labeling Reaction with CyTM3 and CyTM5 Dyes ......................................21
Co-transfection of HEK 293 Cells with Plasmids Expressing Target and
R ibozym e .............. ..... ........ ..................................................... 21
Cell Preparation ................ ....... .......... ......... 21
Tm asfection .................................................. ........ ......... ........ 22
Harvest of Co-Transfected Cells ................................................... 23
RNA Extraction from Co-Transfected HEK 293 Cells ........................................23
Analysis of Ribozyme Activity by Quantitative Reverse Transcriptase-Polymerase
Chain Reaction (RT-PCR) .............................................................................. 24

3 R E S U L T S .............................................................................2 7

Construction of Rz448-ET208-OHP Packaging Plasmid ....................................27
Construct of Rz448-OHP Packaging Plasmid ............................... .....................28









The Co-Localization of Plasmids Expressing Target and Ribozyme within a Cell
after Co-Transfection of HEK 293 Cells ....... ........... ...........................28
Analysis of Ribozyme Activity by Quantitative RT-PCR ............... .....................28
R results from 1.5% A garose G els.................................... ......................... 29
At a molar ratio of 1:4 of target to ribozyme ................... ....... .........29
At a molar ratio of 1:1 of target to ribozyme ......................... ............30
At a molar ratio of 1:2.2 of target to ribozyme ....................................31
Results from 5% and 8% Polyacrylamide Gels Containing Urea....................31

4 DISCUSSION AND FUTURE STUDIES ...................................... ............... 44

L IST O F R E F E R E N C E S ........................................................................ .....................54

BIO GRAPH ICAL SK ETCH .................................................. ............................... 60
















LIST OF FIGURES


Figure pge

1-1 A contemporary view of gene expression........ ............ ....................10

1-2 Model for splicing coupled mRNA export in Metazoans. ............. ..................11

1-3 A model for the regulation of cargo binding and release by Ran ..........................12

1-4 T h e R an cy cle ................................................... ................ 13

1-5 Hairpin and ham m erhead ribozym es................................... ......................... 14

2-1 Map of p21 NewHP packaging plasmid. ............................. ...........25

2-2 Map of Rz448 cloned into p21 NewHP packaging plasmid ...............................25

2-3 Map of ET-208 cloned into p21 NewHP Rz448 packaging plasmid....................26

3-1 The Rz448 activity on the reduction of dog rhodopsin mRNA levels in
transfected cells .................................... ............................... .........34

3-2 Map of Rz448 and ET208 cloned into p21 NewHP packaging plasmid. ...............34

3-3 ET-208 PCR product from Rz448-ET208-OHP clones 1-6. NC= negative
control ................ .... ....... ............... ............................35

3-4 Smal digest of Rz448-ET208-OHP clones 1-5 demonstrating presence of AAV
IT R s ............................................................................... 35

3-5 PCR amplification to confirm absence of ET-208 in Rz4448-OHP clones.............36

3-6 Plasmids containing ribozyme (Rz448-NHP-OHP, Rz448-ET208-OHP, and
Rz448-OHP) were labeled with CyTM3 (Red), while plasmids coding for target
w ere treated w ith CyTM 5 (Blue) ........................................ ......................... 36

3-7 1:4 ratio of target to Rz separated on agarose gels......... ... ............ ............... 37

3-8 Ratio of rhodopsin to beta-actin at a molar ratio of 1:4 (target: ribozyme) ............38

3-9 1:1 ratio of target to Rz separated on agarose gels............. ............ ............... 39









3-10 Ratio of rhodopsin to beta-actin at a molar ratio of 1:1 (target: ribozyme) ............40

3-11 Ratio of rhodopsin to beta-actin at a molar ratio of 1:2.2 (target: ribozyme) ..........40

3-12 Picture of polyacrylamide gel containing urea stained with SYBR Green I and
scanned by Im ageQ uant ................................................ ............................... 41

3-13 Ratio of rhodopsin to beta-actin at a molar ratio of 1:4 (target: ribozyme) ............41

3-14 Ratio of rhodopsin to beta-actin at a molar ratio of 1:1 (target: ribozyme) .............42

3-15 Ratio of rhodopsin to beta-actin at a molar ratio of 1:2.2 (target: ribozyme) ..........42

3-16 Picture of polyacrylamide gels containing urea stained with SYBR Green I and
scanned by ImageQuant at a molar ratio of 1:2.2 (target: ribozyme) ....................43















Abstract of Thesis Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Master of Science

COMPARISON OF THE EFFECTS OF A PROCESSING SEQUENCE AND A
NUCLEAR EXPORT ELEMENT ON RIBOZYME ACTIVITY IN TRANSFECTED
CELLS

By

Eun-Jung Choi

December 2004

Chair: Alfred S. Lewin
Major Department: Molecular Genetics and Microbiology

Ribozyme-mediated gene therapy is an anti-sense approach to inactivate gene

expression in order to reduce the accumulation of mutated proteins that cause diseases.

Rhodopsin-linked autosomal dominant retinitis pigmentosa (ADRP) has been an optimal

objective for ribozyme gene therapy for several reasons: 1) it is a slowly progressive

disease, 2) it is easy to access the target tissue, and 3) the eye is an immunologically

privileged site. Retinitis pigmentosa (RP) is a term that refers to a group of inherited

disorders in which abnormalities of the photoreceptor cells (rods and cones) of the retina

lead to blindness in approximately 1 in 3500 people in the U.S. In order for ribozyme

therapy to be effective, it is critical that the ribozyme is expressed at high levels.

Since efficient export of mRNAs from the nucleus into the cytoplasm plays an

important role in their expression, the nuclear export element (NEE) can be beneficial to

the field of ribozyme-mediated gene therapy. Transgene (i.e., ribozyme) expression can

be regulated by both the transcriptional regulatory elements including the promoter,









enhancer, intron, and poly(A) sequence and the post-transcriptional regulatory elements

such as splice signal (SS), constitutive RNA transport element (CTE), and the woodchuck

hepatitis virus post-transcriptional regulatory element (WPRE).

The results of one of the studies being performed in our laboratory show that

recombinant adeno-associated virus (rAAV)-delivered dog rod opsin-specific

hammerhead ribozyme 448 (DogRhoRz448), which is an allele-independently designed

ribozyme, can effectively reduce the levels of dog rhodopsin mRNA. The plasmid

encoding DogRhoRz448 used in this previous study contains two self-cleaving hairpin

ribozymes (new hairpin ribozyme [NHP] and old hairpin ribozyme [OHP]) as processing

sequences. The function of the hairpin ribozyme is to free the hammerhead ribozyme

448 from the long primary transcript, thereby making Rz448 available to cleave its target.

The matrix (M) protein of vesicular stomatitis virus (VSV) has been proposed to

effectively inhibit Ran-dependent nucleocytoplasmic bidirectional transport of both RNA

and proteins in Xenopus laevis oocytes. By using this inhibitor, the newly selected ET-

RNAs (Exceptional Transport RNAs) were discovered. In this current study, we have

replaced a self-cleaving hairpin ribozyme (NHP) in our Rz448 construct with ET-208,

which is one of the ET-RNAs, to examine whether ET-208 could promote better

expression of Rz448, resulting in greater knock down of dog rhodopsin expression. We

found that ET-208 was able to enhance the ability of the Rz448 plasmid to reduce the

levels of rhodopsin mRNA within co-transfected cells.














CHAPTER 1
INTRODUCTION

Many advances have been made in understanding the steps in the pathway of gene

activation to synthesis of functional proteins. The contemporary view of gene expression

proposes that several processes occurring in the nucleus and the cytoplasm are connected

(1). According to this model, this pathway can be divided into 5 steps: transcription

initiation (the beginning of RNA synthesis), transcription elongation (the extension of

transcript), transcription termination, polyadenylation (the cleavage of RNA and the

addition of a polyadenosine tail to the 3' end of the transcript) and translation (the

synthesis of a protein from RNA). Growing evidence has revealed that these distinct

stages of gene expression are functionally coupled (2-4) (Figure 1-1).

The export of mRNA is coupled to other steps in gene expression involving

splicing (5), transcription, and 3'-end formation (2). For example, both splicing-

dependent recruitment of the mRNA export machinery and exon-junction complex (EJC)

formation are conserved in eukaryotic cell (2) (Figure 1-2). Spliced mRNAs are

assembled into an individual spliced mRNP (ribonucleoprotein) complex that directs the

mRNA for export (5,6). In addition to these export proteins, EJC contains numerous

proteins involved in the cytoplasmic localization of mRNAs (2). EJC is made from that

conserved mRNA export machinery and other components of the spliced mRNP are

specifically recruited to a position 20 nucleotides upstream of exon-exon junctions (7).

Once formed, the entire EJC is exported and then dissociates from the mRNA in the

cytoplasm (8). Splicing is not essential for export but promotes the efficiency and/or









fidelity of the process by increasing the more efficient recruitment of export factors (2)

and generating a specific nucleoprotein complex (5). The mRNA export machinery and

some components are also co-transcriptionally recruited (2). They interact with

nucleoporins of the nuclear pore complex that are required for mRNA export and/or

several mRNA export factors (2). 3'-end formation is thought to be critical in co-

transcriptional loading of the mRNA export machinery onto mRNAs (2).

The nucleus and the cytoplasm are physically and functionally separated by the

nuclear envelope in the eukaryotic cell. Genetic information is stored and transcribed

from DNA to RNA in the nucleus, whereas the transfer of information from RNA to

protein occurs in the cytoplasm (9). Therefore, the export of RNA to the cytoplasm is an

important process. Additionally, the intracellular localizations of RNAs are essential for

their correct processing as well as function (10).

All major classes of RNA (mRNA, 5S rRNA, tRNA, snRNA, and rRNA) exit from

the nucleus to the cytoplasm as RNA-protein complexes (9,11-13) via the nuclear pore

complexes (NPCs) perforating the double-membraned nuclear envelope (14-16) using

energy-dependent (17), carrier-mediated transport systems (18,19). The nuclear pore

complex (125,000 kDa) is composed of 50-100 nucleoporin subunits. The subunits are

arranged to produce a large central channel of 28nm and eight smaller peripheral

channels of 9nm. The larger channel is used for active nucleocytoplasmic transport of

large particles such as RNA-containing proteins and the smaller channels provide routes

for passive diffusion of small molecules such as ions and metabolites (20,21).

The distribution of RNA between the nucleus and the cytoplasm results from the

interactions between RNAs and nuclear export elements (NEEs) or nuclear retention









elements (NREs) as well as specific nuclear transport or localization factors (9,10,18,22-

25). The export of RNA occurs in 3 steps. First, the RNA is transported to the nuclear

envelope along the nuclear matrix and docked to specific nucleoporins at the nuclear

entrance of the nuclear pore complex (15,18,26). Second, it is translocated through the

central channel of the nuclear pore complex (27), and third it is transported along the

cytoskeletal matrix (14). In addition, the Ran system is required for export of many

RNAs dependent on Ran-GTPase and its associated binding, exchange, and activation

factors (9,13,24,28,29) (Figure 1-3). The major guanine-nucleotide-exchange factor of

Ran is the nuclear protein RCC 1, whereas its main GTPase-activating protein, RanGAP1,

is almost exclusively found in the cytoplasm (9) (Figure 1-4). This asymmetric

distribution offers an attractive model to explain how direction could be achieved in

nuclear transport (9). Binding of exportins to mRNAs is dependent on the presence of

Ran-GTP. Export cargo release is accomplished by RanGTP hydrolysis, which is

triggered in the cytoplasmic compartment by the RanGAP protein and additional factors

(9). The Ran system is also needed for import of RNA export factors that must shuttle

between the nucleus and the cytoplasm (18,30,31). Thus, mutation or inhibition of this

system leads to obstruction of the export of most RNAs.

Previous experiments have suggested that the matrix (M) protein of vesicular

stomatitis virus (VSV) effectively inhibits Ran-dependent nucleocytoplasmic

bidirectional transport of both RNA and proteins in Xenopus laevis oocytes (32) when it

is in the nucleus and associated with the nuclear pore complexes (33). James E.

Dahlberg's group used this inhibitor to select novel RNA sequences that overcome this

block. Unlike typical transport of most RNAs, the newly selected ET-RNAs (exceptional









transport RNAs) are exported efficiently even when the Ran system and related processes

are disrupted (10). It means that export of these RNAs does not require protein factors

and export pathways thought to be essential for export of most RNAs. The ET-RNAs

were selected from a collection of RNAs containing 20 random nucleotides. Those that

served as nuclear export elements fall into one of three sequences (10). In this study, we

used ET-208, the strongest exporter of the selected ET-RNAs, in an attempt to enhance

the expression of a ribozyme previously tested for gene therapy.

Ribozymes are RNA molecules with enzymatic activities such as sequence-specific

cleavage, ligation, and polymerization of nucleotides (34). Naturally occurring

ribozymes have been grouped into several classes (34). Two of the more characterized

ribozymes, which are from the group of self-cleaving viral agents, are the hairpin and

hammerhead that naturally function as self-cleaving agents in viral replication (34,35).

Their substrate specificity and small size provide therapeutic benefits for ribozyme-

mediated gene therapies (34,36). Both ribozymes catalyze sequence-specific cleavage of

RNA that results in products with 2', 3'-cyclic phosphate and 5'-hydroxyl termini

(34,37). The hairpin ribozyme consists of a 34 nucleotide catalytic core, comprised of

stems A and B that include all the nucleotides essential for hairpin ribozyme function

(37), and four helices, of which helices I and II are responsible for target recognition (34)

(Figure 1-5). The hammerhead ribozyme has a catalytic core of 11 nucleotides (37,38)

that is stabilized by a hairpin structure and is flanked by two helices that are responsible

for substrate recognition (34) (Figure 1-5). Both hairpin and hammerhead ribozymes can

be designed to recognize substrates having a disease-causing point mutation (34,35). The

hairpin ribozymes target gene transcripts containing a quintuple sequence 5'YNGUC3',









where N is any nucleotide and Y is a pyrimidine, while hammerhead ribozymes

recognize less restricted sequences of substrate RNA containing a 5'NUX3' triplet, where

X is any nucleotide except guanosine (34-36).

Ribozyme-mediated therapy is an anti-sense approach to inactivate gene expression

in order to reduce the accumulation of mutated proteins that cause diseases such as

rhodopsin-linked autosomal dominant retinitis pigmentosa (ADRP). Ribozymes have

also been tested to block replication of RNA viruses or retroviruses and to inactivate

dormant oncogenes such as ras or bcr-abl (36). There have been two kinds of therapeutic

ribozyme design. One is that a ribozyme specifically targets and cleaves an mRNA

substrate containing the nucleotide sequence of a point mutation, but fails to cleave an

mRNA substrate containing the wild-type nucleotide sequence (allele-specific ribozymes)

(35). The other is that a ribozyme targets the defective mRNA at site that is not altered

by mutation (allele-independent ribozymes) (35). Such ribozymes could reduce the

expression of both toxic (mutant) proteins and normal homologues encoded by the

partner chromosome. This allele-independent approach is used as part of an RNA

replacement strategy in which the ribozyme is accompanied by a ribozyme resistant

mRNA encoding the wild-type protein.

Retinitis pigmentosa (RP) is a term that refers to a group of inherited disorders in

which abnormalities of the photoreceptor cells (rods and cones) of the retina (39) lead to

blindness in approximately 1 in 3500 people in the U.S. (36). The disease is typically

detected in the second decade of life as night blindness and loss of peripheral vision. The

retinal degeneration is usually slowly progressive and may take decades before leading to

legal blindness. Mutations affect the rod cells specifically, but later in the course of the









disease, cone cells also undergo apoptosis and central vision is lost. Retinitis pigmentosa

is caused by one of three types of a genetic defect: autosomal dominant inheritance,

autosomal recessive inheritance, and X-linked inheritance. About 25% of RP is

dominantly inherited (36). One of the causes of ADRP is a dominant negative mutation

in rhodopsin where a histidine is substituted for a proline at codon 23 (P23H) in

rhodopsin gene (39,40). This leads to the accumulation of abnormal rhodopsin proteins

that ultimately results in the apoptotic death of photoreceptor cells (39) causing loss of

vision (34,36). While P23H rhodopsin is most prevalent in North America, over 100

disease-causing mutations in rhodopsin lead to ADRP. In addition, mutations in over 25

other genes can lead to retinitis pigmentosa (40).

One of the studies being conducted in our laboratory is to examine the therapeutic

potential of recombinant adeno-associated virus (rAAV)-delivered hammerhead

ribozymes targeting retinal mRNAs associated with ADRP. It is our hypothesis that

ribozymes can diminish the production of mutated rhodopsin protein by selectively

cleaving mRNA molecules encoding the aberrant forms of the proteins (34,36). The

effectiveness of ribozyme-mediated reduction of mutant mRNAs that cause ADRP has

been demonstrated in vivo in a P23H transgenic rat model. Eyes of rats that were

injected with P23H specific ribozymes showed significant reduced rate of photoreceptor

degeneration and vision loss (36,41,42).

In order for ribozyme therapy to be effective, it is critical that the ribozyme is

expressed at high levels. Since efficient export of mRNAs from the nucleus into the

cytoplasm plays an important role in their expression, the nuclear export element (NEE)

can be beneficial to the field of ribozyme-mediated gene therapy.









The results of another study being preformed in our laboratory have shown that dog

rod opsin-specific hammerhead ribozyme 448 (DogRhoRz448) can effectively reduce the

levels of dog rhodopsin mRNA. This is a part of an RNA replacement strategy in which

endogenous rhodopsin mRNA would be digested by ribozymes and replaced with a

ribozyme resistant form of wild type mRNA. The ability of DogRhoRz448 to knock-

down dog rod opsin was assessed in tissue cultured cells by co-transfecting HEK 293

cells with target (dog rhodopsin) cDNA and ribozyme 448 inserted in plasmids under the

control of the chicken beta-actin (CBA) promoter coupled with the cytomegalovirus

(CMV) enhancer. Ribozyme activity was assayed by quantitative reverse transcriptase-

polymerase chain reaction (RT-PCR) 48 hours post transfection. At a molar ratio of 1:4

and 1:6 of target to ribozyme, the level of dog rhodopsin mRNA was reduced by

approximately 83% and 94% respectively compared to control.

The significance of the study about the effectiveness of DogRhoRz448 is that dogs

with a point mutation at T4R exhibit a retinal phenotype that closely imitates that in

humans with rhodopsin mutations (43). Naturally occurring hereditary retinal

degeneration in dog, which is caused by this mutation, is referred to progressive retinal

atrophies (PRAs) (43). Therefore, using this nonhuman rhodopsin mutant large animal

provides an inestimable tool to evaluate ribozyme-mediated therapies for ADRP before

beginning of human clinical trials.

Many examples of recombinant proteins whose expression in mammalian cells

requires the presence of an intron (5,44,45). Especially, mRNAs that are transcribed

from cDNAs are expressed poorly compared to the same mRNAs transcribed from a gene

containing introns (5). For this reason, many available vectors contain an intron (5). The









supporting evidence for a link between splicing and efficient mRNA export explains this

intron requirement (5). Insertion of an intron into CMV expression cassettes greatly

promotes gene expression in the cases that have been examined (5,46-48). In the absence

of an intron within expression vectors, polyadenylation might target the mRNA lacking

an intron for efficient export (5).

The plasmid encoding dog rod opsin-specific hammerhead ribozyme 448

previously used in our research contains the ubiquitous chicken beta-actin promoter

coupled with the CMV-enhancer driving high-level and stable expression of the ribozyme

from AAV vector in vivo (49). Immediately downstream of the promoter is an intron,

which should help in the accumulation and localization of ribozyme to cytoplasm (5).

Two self-cleaving hairpin ribozymes are found immediately downstream of the ribozyme

448 which henceforth will be referred to as new hairpin ribozyme (NHP) and old hairpin

ribozyme (OHP). The function of the hairpin ribozyme is to free the hammerhead

ribozyme 448 from the long primary transcript, thereby making ribozyme 448 available

to cleave its target. In addition, the plasmid contains two 145bp inverted terminal repeats

(ITRs) of AAV2 that are absolutely required for packaging DNA into rAAV.

Adeno-associated viruses (AAVs) contain a single-stranded, relatively small

(-4.7kb) genome (50) which enables its manipulation in a plasmid to produce

recombinant AAV in high titers (51). AAV is a good candidate for the ribozyme delivery

with several features: 1) it has been shown to be able to infect a wide range of tissues

including both dividing and non-dividing cells such as photoreceptors, 2) it does not

induce an inflammatory immune response and has not been associated with any diseases

in humans or animals, 3) it has a broad cell tropism, and 4) it can be integrated stably into









the host cell genome or remain stable as an episome n non-dividing cells, leading to long-

term expression of the delivered gene (52,53,54). It has been demonstrated that

recombinant AAV injected subretinally was able to transduce all layers of the neuroretina

as well as cells of the retinal pigment epithelium of adult nude mice (55). rAAV also has

been shown to have no toxicity when injected subretinally into the eyes of rodents (54).

rAAV vectors are deleted of both rep that encodes four regulatory proteins and cap that

encodes three structural proteins genes (56), thus limiting its natural spread because both

wild-type AAV and adenovirus would be required for its propagation (57).

In this current study, we examined whether ET-208 could promote better

expression of ribozyme 448, resulting in greater knock down of dog rod opsin expression.

We have replaced a self-cleaving hairpin ribozyme (NHP) in our dog rod opsin-specific

ribozyme 448 construct with ET-208. We discovered that this element enhanced the

ability of the ribozyme plasmids to reduce accumulation of rhodopsin mRNA.







10





-l &r PIn loidhM 0







Icc, o ,



z I r--w .-RN-U
ilr ir





ti cnmrary viwn of geei c


Refeenc 1)
I-9'-
1-5 -'f i r"^ M -










I-i r










this contemporary view of gene expression, each stage is physically and



Reference 1).
i~~ ~~~~ cl'Ja^1,-ri~oTAo













Reference 1).













Tap-pl5
Nup2 1 4


Upf3




V ";'^~-- UAP55

sp IICeoome^ A- -':


rhnRNP particles
intron

Figure 1-2. Model for splicing coupled mRNA export in Metazoans. (A) UAP56 and Aly
associate with the splicesome. Simplified pre-mRNA with a 5' cap, 2 exons
and an intron, and a poly(A) tail, hnRNP proteins package the pre-mRNA, and
SR proteins associate with exons. (B) The Tap-pl5 heterodimer targets the
mRNP to the nuclear pores. Aly acts as bridging protein between the exon-
junction complex (EJC) and Tap-pl5. (C) mRNA export factors dissociate
from the mRNP after export to the cytoplasm. Factors involved in NMD (e.g.
Upf3, Y14, and RNPS1) remain bound to the mRNP (Source: Reference 4).













Export






RaniGTP-hydror*ys and sxplri cargo release


Cylojlaam

tI~udeis


Figure 1-3. A model for the regulation of cargo binding and release by Ran. The
asymmetric distribution of the two different Ran forms can be used to regulate
the binding and release reactions between different carriers and their cargos.
Binging of exportin to their export substrates is dependent on the presence of
Ran-GTP. Cargo release is achieved by RanGTP hydrolysis, which is
triggered in the cytoplasmic compartment by the RanGAP protein and
additional factors (Source: Reference 5).


~









Cvtolasm


la---IGA
LanGAF1


.... :1 ,^ tr .DP --T
Pi GTPF RGrEF:
RCC1
H NucleusP

Nucleus
.oo Nuoos


Figure 1-4. The Ran cycle. The small nuclear GTPase Ran switches between a GDP- and
a GTP-bound state. Ran GTP/GDP cycle is regulated by Ran-guanine-
Nucleotide-exchange factors (RanGEFs) and by Ran-GTPase-activating
proteins (RanGAPs). The major RanGEF is RCC1, whereas the major
RanGAP is RanGAP1 (Source: Reference 5).

















II11 11IIII
3'A U-ANNNG NNNNNN 5'
G-C II AG
G-C
U-A in
C-G
C-A
A G
U A
A A
C
A A
U C
G A
G-C
U-A IV
G-C
U-A
C-G
U--A
G-C
A G
AU
Hairpin
TRENDS in Molecular Medicine


CU
G U S
G-C -/
C-G A/V
G-C /
C-G I
G.A A/
A.Gus, N
A.U C
A. A U
N-, G
N-,.
N-
N-.
N -
3'


Hammerhead


Figure 1-5. Hairpin and hammerhead ribozymes. Schematic diagram of hairpin and
hammerhead ribozymes hybridized to their target sequences. Short bars
represent conventional base pairs, and dots represent non-standard base
pairings. Target sequences are shown in gray shading, and arrows indicate
cleavage sites. Helices are numbered with roman numerals (Source:
Reference 32).














CHAPTER 2
MATERIALS AND METHODS

ET-208 Design

Sense and antisense DNA oligonucleotides coding for ET-208 and including a

region of 20 nucleotides (5' TTGAGGGCCCTCATTGCCGC 3') that served as NEE

were designed with flanking restriction sites, Spel and Nsil and ordered from Invitrogen.

The length of the sense and antisense strands are 45 and 37 nucleotides respectively, and

the 5' ends of both oligonucleotides were phosphorylated.

Rz448-NHP-OHP, Rz448-ET208-OHP, and Rz448-OHP Constructs

The construct, Rz448-NHP-OHP (Figure 2-2) containing dog rod opsin-specific

hammerhead ribozyme 448, was designed by inserting the sequence for Rz448 between

the HindIII and Spel restriction sites in the P21NHP plasmid (Figure 2-1). This plasmid

contains the CMV enhancer coupled with the CBA promoter driving the expression of

the ribozyme, an intron, two self-cleaving hairpin ribozymes (NHP and OHP) that are

found immediately downstream of the RZ448, and two ITRs. The Rz448-ET208-OHP

construct (Figure 2-3) was designed by removing the NHP ribozyme with an Spel and

Nsil digest and inserting the ET-208 sequence between those sites. The Rz448-OHP

construct was made by removing the ET-208 sequence from the Rz448-ET208-OHP

plasmid with an Spel and Nsil digestion. The Spel and Nsil cohesive ends were then

treated with T4 DNA polymerase to blunt the ends and ligated to seal the plasmid.









Gel Purification of Oligonucleotides

The cloning efficiency of Rz448 and ET-208 can be improved by polyacrylamide

gel purification of the oligonucleotides before using them in a ligation reaction. 900

picomoles of each sense and antisense oligonucleotide were mixed with 4ul of formamide

loading dye [90% (w/v) formamide, 50mM EDTA, 0.4% (w/v) xylene cyanol, and 0.4%

(w/v) bromphenol blue] and incubated at 900C for 1 min, and then loaded on the

acrylamide gel. The oligos were separated on a 10% (w/v) acrylamide gel run in IX TBE

buffer [89mM Tris borate, pH 8.3, and 20mM EDTA]. The gel was run at 500-600V and

no more than 40 mA. After the bromphenol blue tracking dye had run about two-thirds

the length of a 20cm gel, the gel was transferred to a 20x20 cm Fluor-coated TLC plate.

In a dark room, a short-wavelength UV hand lamp was used to visualize the DNA band.

The bands were then excised with a scalpel, crushed in 200ul of elution solution [1M

ammonium acetate, 50mM Tris HC1 (pH 7.5), 20mM EDTA, 0.5% (w/v) SDS] in a

sterile 1.5ml microcentrifuge tube, and eluted overnight at 370C. The elution solution

was then removed from the gel slices, and the DNA was ethanol (EtOH) precipitated,

resuspended in 10ul of dH20. Its concentration was determined by the absorbance at

260nm and stored at -200C.

Annealing Phosphorylated Oligonucleotides

In a sterile 1.5ml microcentrifuge tube, the following contents were combined 20ul

of each oligonucleotide (sense and antisense), 10ul of 10X buffer (for restriction enzyme

HindIII from Promega), and dH20 to 100ul. The final volume of reaction solution was

100ul. A reaction tube was then heated to 900C for 5 min and slow-cooled at 370C for

another 10 min. The 10ul of the annealed DNA oligonucleotides, which was diluted in









990ul of dH20 (diluted at 1:100). This dilution was then used for the subsequent cloning

step.

Digestion of the Circular AAV Packaging Vector with Proper Restriction Enzymes

The reaction solution was composed of 1Oul of resuspended circular plasmid, lul of

a desired restriction enzyme (here, HindIII, Spel, and Nsil), 2ul of 10X enzyme buffer,

2ul of 10X BSA, and dH20 to 20ul in a sterile 1.5ml microcentrifuge tube. The reaction

tube was then incubated at 370C for 1 hr. The linearized AAV packaging plasmid DNA

was ethanol precipitated, and then the second digestion was performed. Finally, the

vector plasmid was ready for gel purification.

Gel Purification of Vector DNA

Before ligation, agarose gel purification of the linearized AAV packaging vector

was performed by running the digest on a 1% agarose gel and staining with ethidium

bromide (EtBr) [10mg/ml]. The proper band was then excised after visualization with

low-intensity UV light. The excised band was then crushed in a sterile 1.5 ml

microcentrifuge tube and mixed with an equal volume of phenol (-pH 8.0) to elute the

DNA. The contents were mixed well by vortexing and then incubated at -700C for 1 hour

and centrifuged for 5 minutes at 13,200 rpm. Next, the aqueous phase was extracted with

an equal volume of phenol: chloroform: isoamyl alcohol (50:50:1, v/v/v) to eliminate all

protein contamination. The linearized DNA was precipitated by the addition of two

volumes of 100% EtOH. Finally, the sample is resuspended in lOul of dH20.

Ligating Annealed DNA Oligonucleotide Insert and Vector DNA

For different sized plasmid DNAs, the amount of oligonucleotide and linearized

plasmid vector DNA should be adjusted to maintain an appropriate ratio of

oligonucleotide: vector ends. Here, we used the ratio of annealed oligonucleotide and









linearized vector plasmid DNA that is 3:1. The following components were combined in

a sterile 1.5ml microcentrifuge tube: 3ul of DNA oligonucleotide inserts that had been

phosphorylated and annealed, lul of vector DNA that has been linearized with the proper

enzymes, lul (10units) of T4 DNA ligase, 2ul of 10 ligase buffer [500mM Tris-HCl (pH

7.5), 100mM MgC12] (from BioLabs), and dH20 up to 20ul. The reaction is incubated at

room temperature for 2 hr or 160C overnight. After incubation, the ligated plasmid

DNAs (Rz448-NHP-OHP and Rz448-ET208-OHP) were ethanol precipitated,

resuspended in 10ul of dH2O.

T4 Polymerase Treatment

The function of T4 DNA polymerase is to blunt cohesive ends on double-stranded

DNA molecules with 5'- or 3'- protruding termini by 3' overhang removal and 3'

recessed end fill-in. In a 1.5ml microcentrifuge tube, the following contents were

combined: 10ul of digested DNA, lul of 2mM dNTPs, 2ul of T4 DNA polymerase, 2.5ul

of 10X T4 DNA polymerase buffer, and dH20 to 25ul. A tube was then incubated at

220C for 30min and heated to 700C for 5 min to inactivate T4 DNA polymerase. Rz448-

OHP was than ethanol precipitated and resuspended in 10ul of dH2O.

Bacterial Transformations

We use one of several recombination deficient strains ofEscherichia coli, such as

Sure cells (Stratagene), in order to prevent loss of the AAV inverted terminal repeat

(ITR) sequences present in the AAV packaging vector. ITRs are critical for packaging

plasmid inserts as recombinant AAV vectors (34). 2ul of the ligation reaction were used

to transform electro-competent E.coli cells according to Sambrook and Russel (58). 20ul

of Sure cells were mixed with 2ul of the ligated plasmids and electronically charged at









1.5V. Transformed cells were suspended in Iml of autoclaved LB media are incubated in

a thermomixer at 370C shaking at 750 rpm for 1 hr to allow cell growth. Growing cells

were then plated on LB/ ampicilin (Amp) plates for selection of colonies containing the

ligated plasmid DNAs, and grown at 300C overnight to a low density to help preserve

ITRs. After growing overnight, several colonies were picked out and inoculated in 5ml

of LB media with ampicilin followed by another growing at 300C overnight with

shaking. After overnight incubation, increased amounts of three constructs were

extracted by using Perfectprep Plasmid Mini kit from Eppendorf The Eppendorf mini

prep kit was performed according to the manufacturer's recommendations. All clones are

screened for ITR retention by an Smal digest followed by running 0.7% or 0.6% agarose

gels. The plasmids were then sequenced for proper Rz448 and ET208 orientation.

Large-Scale Cesium Chloride (CsCI) DNA Prep

This procedure allows us to increase the amount of the three constructs and to

accomplish a highly purified preparation of DNA for transfection. After sequencing the

plasmids, Sure cells were transformed with these plasmids and spread on and LB/Amp

plate. A colony was inoculated in 5ml of LB/Amp media, and then 2 ml of this

preculture was inoculated and grown in 1L of LB/Amp media at 300C. After incubation

for 14 hours, the culture was transferred to a bottle and centrifuged at 4000 rpm for 10

min to pellet the bacterial cells. The supernatant was decanted, making sure not to

disturb the cell pellet. 30 ml of Tris-EDTA buffer was added to the cell pellet and

completely resuspended. Cell lysis solution [0.2M NaOH, 1% SDS] is then added to the

resuspension and mixed well. This resuspended mixture was incubated for 5 min at room

temperature until the lysate is relatively clear with no visible clumps of cell material.









After the addition of 30 ml of neutralizing solution [3M sodium acetate (NaAc) pH 5.2]

to the lysate, it was mixed well and placed on ice for 10 min. The neutralized lysate was

centrifuged at 10,000 rpm for 15 min and the aqueous phase was poured off through 3

layers cheesecloth. The volume was then determined, and 0.6 volumes of 2-isopropanol

was added. The mixture was incubated on ice for 1 hour. After centrifugation at 10,000

rpm for 30 min, the supernatant was removed. The pellet was gently washed 1 time with

70% EtOH and air dried for 30 min. The DNA pellet was then resuspended in 8 ml of

Tris-EDTA buffer. 8.4 g of CsCl was dissolved in the DNA, and 150ul of ethidium

bromide (EtBr) [10mg/ml] was added to the CsCl-DNA mixture. The DNA was then

transferred to an ultracentrifuge tube, and spun overnight (at least 16 hours) in NVT 65 at

55,000 rpm, 200C, and under vacuum. On the next day, the plasmid DNA band (lower

band) was extracted using a short-wavelength UV hand light to visualize the DNA band

stained with EtBr. Plasmid DNAs were transferred to a 15ml conical tube and the EtBr

was removed from the DNA with a series of isoamyl alcohol extractions. 2.5 volumes of

dH20 were added to DNA, followed by an addition of 2 volumes of 100% ethanol in

20ml Corex tubes. Tubes were incubated on ice for 1 hour. After incubation, plasmid

DNAs were pelleted at 12,000 rpm for 15 minutes at 40C. The supernatant was removed,

the DNA pellet was washed with 70% EtOH, and was dried in a speed vac. The DNA

pellet was resuspended in 400ul of Tris-EDTA buffer, and then transferred to a sterile

microcentrifuge tube. 40ul of neutralizing buffer [3M NaAc pH 5.2] and Iml of 100%

EtOH were added to the DNA and mixed well. The DNA is then incubated at room

temperature for 10-15 minutes. The plasmid DNA was pelleted for 5 min at 13,200 rpm.

The supernatant was decanted and washed with 70% EtOH followed by drying it in a









speed vac. The DNA was resuspended in 400ul of dH20 and its concentration is

determined by absorbance at 260nm. Plasmid DNAs were stored at -200C.

Plasmid Labeling Reaction with CyTM3 and CyT5 Dyes

The use of the CyTM3 and CyTM5 dyes allows us to monitor the intracellular

localization of plasmid DNA in cells following the transfection. According to

manufacture's description, the Label IT Reagents covalently attach marker molecules to

nucleic acids in a chemical reaction. Prepare at least 25% more plasmid DNA in weight

than needed to account for pipetting/transfer errors. In this study, three different

constructs (Rz448-NHP-OHP, Rz448-ET208-OHP, and Rz448-OHP) were labeled with

CyTM3, which gives you red color, and target plasmid DNA encoding dog rhodopsin are

labeled with CyTM5, blue color. In a sterile 1.5ml microcentrifuge tube, the following

components were combined for a 50ul plasmid labeling reaction: an appropriate volume

of plasmid DNA in weight is diluted in dH20 to bring the DNA to the proper volume of

labeling reaction, 2.5ul of Label IT TrackerTM Reagent (CyTM3 or CyTM5 dye), and 5ul Of

10X labeling buffer A. The non-enzymatic Label IT TrackerTM Intracellular Nucleic

Acid Localization Kit from Mirus was performed according to the manufacturer's

recommendations. After this, the concentration of labeled plasmid DNA is re-determined

by absorbance at 260nm.

Co-transfection of HEK 293 Cells with Plasmids Expressing Target and Ribozyme

Cell Preparation

We chose to use human embryonic kidney (HEK) 293 cells, because they do not

express our target (dog rhodopsin) which should eliminate target background. For our

experiments, we used that under passage 41. Cells were grown and maintained in

Dulbecco's modified Eagle's medium (DMEM, Sigma-Aldrich Co.) supplemented with









10% fetal bovine serum (FBS, Sigma-Aldrich Co.), 100U/ml of penicillin, 100mg/ml of

streptomycin (10X PenStrep, Mediatech, Cellgrow, VA). The day before transfections,

the cells were trypsinized and counted on an hemacytometer so that they will be 90-95%

confluent on the day of transfection.

Trnasfection

Transfections were preformed in triplicate or quadruplicate. To account for

pipetting/transfer errors, all were prepared at least 25% more reaction volume than

needed. DMEM media were removed from cells plated on day before transfection and

replaced with fresh media lacking antibiotics (9ml for a 10cm dish or 1.5ml for 6-well

[35mm] plate). Opti-Mem I Reduced Serum Medium (Sigma-Aldrich Co.) without

serum is used to dilute plasmids carrying target and ribozymes and transfection

LipofectamineTM 2000 Reagent (Invitrogen). For multiple dishes, make a bulk mix of

plasmids. For each 10cm tissue-culture dish, 10ug of total plasmid DNA (target +

ribozyme) were diluted in lml of Opti-Mem. 4ug of total plasmid DNA were dissolved

in 250ul of Opti-Mem for each well of a 6-well plate. The diluted target and ribozyme

plasmid DNA were incubated separately for 5min at room temperature, and then mixed

together and incubated for an additional 10 minutes. The diluted LipofectamineTM 2000

Reagent was incubated at room temperature for 10 min. 3ul of LipofectamineTM 2000

Reagent was used per lug of DNA. Once LipofectamineTM 2000 Reagent was diluted, it

was combined with the diluted plasmid DNA and incubated for 20 min at room

temperature. The complexes were added directly to each dish or well containing cells

and medium [DMEM with 10% FBS (without antibiotics)] and gently rocked. The plates









were incubated with transfected cells in a 5% C02 incubator at 370C to maintain growing

cells for 48 hours.

Harvest of Co-Transfected Cells

48 hours post-transfection, cells were trypsinized to remove them from culture

plates and pelleted by centrifugation at 4000 rpm for 5 min at 40C. The trypsin

supernatant was removed and the cell pellet was then washed with 500ul of IX PBS

twice.

RNA Extraction from Co-Transfected HEK 293 Cells

RNA was extracted by using GenEluteTM Mammalian Total RNA kit from Sigma.

The GenEluteTM Mammalian Total RNA kit was performed according to the

manufacturer's recommendations. After RNA extraction, the eluted RNA is treated with

DNase (DNA-freeTM from Ambion) to remove contaminating DNA from RNA

preparation. According to the product description, contaminating DNA is digested to

levels below the limit of detection by routine PCR by using DNA-free. The

concentration of DNase treated RNA was determined by absorbance at 260nm. PCR was

conducted to verify that no DNA contaminants have been eliminated from the RNA

preparation. In a sterile PCR tube, the following contents were combined: an appropriate

volume of lug of RNA, lul of primer I [15 pmol/ul] (sense strand of dog rhodopsin

oligonucleotide), lug of primer II [15pmol/ul] (antisensestrand of dog rhodopsin

oligonucleotide), 2.5ul of 1OX Mg free buffer, 2ul of MgC2, lul of dNTPs [10mM],

0.5ul of Taq polymerase, and dH20 to bring the PCR solution to 25ul. After 20 or 30

cycles, PCR products are run on a 1.5% agarose gel, and then compared to the negative

control. If nothing is amplified, we consider our RNA preparation to be free of DNA.









Analysis of Ribozyme Activity by Quantitative Reverse Transcriptase-Polymerase
Chain Reaction (RT-PCR)

This allows for generating first-strand cDNA from an RNA template by using

proper primers. We used First-Strand cDNA Synthesis kit from Amersham Bioscience to

reverse transcribe RNA to cDNA. The reverse transcriptase reaction was set up as

described the protocol of the kit to synthesize first-strand cDNAs of dog rhodopsin and

beta-actin (2 ug of RNA used for 15ul reaction). To avoid pipetting variation, the reverse

transcription reaction for both genes was done in the same tube using sequence-specific

antisense primers [40 pmol/ul]. PCR reaction for dog rhodopsin and beta-actin control

was set up separately, since their optimized amplification conditions (annealing

temperature and extension time) are different. For detection of PCR products, 5ul or 10ul

of each reaction was loaded on an 1.5% agarose gel or an polyacrylamide gel

respectively. 5% and 8% polyacrylamide gels were used for beta-actin and dog

rhodopsin respectively. For quantitating PCR products run on the 1.5% agarose gel, the

Gel Quantification program from BioRad was used to quantitate. After the bromphenol

blue tracking dye has run about two-thirds the length of a 30cm gel at 400V/ no more

than 40mA, the gels were stained with a nucleic acid attain, SYBR Green I (Molecular

Probes), which is diluted 1:10,000, for 15-20 min. The stained gels are analyzed to

determine the volume of each PCR product using the Phospholmager and Image Quant

program. Numerical values were obtained and ratios of rhodopsin to beta-actin were

calculated.













isB I (_9s)


CMV ie enhancer
Shicken b-actin promoter
exon
AMP-R Intran

p21NewHP '
p2I NewH HinLdIII (1921)
KtC2 Jp (1931)

Hairpin Rz
-.I (2014)
cI cl(2021)
&iwal('(263 '7.26) ^Extra Ha\pi n RZP
TR Cli/ l(2105)
SW l3715>) PYF441 enianWer
HSVtk promoter
neoR



Figure 2-1. Map of p21 NewHP packaging plasmid.




Smal (87)
TR
SSmaI (98)
CMV ie enhancer
chicken b-actin promoter
exon



p21NewHpRz 448
dog opsin 448
6681 bp
6681 bp HindIIl(1921)
Spel (1960)
Hairpin Rz


Small (3755) r extra hairpin Rz
TR neoR
Small (3744)



Figure 2-2. Map of Rz448 cloned into p21 NewHP packaging plasmid.













Small (87)

Small (98)

CMV ie enhancer
/ chicken b-actin promoter
exon


p21ET208Rz 448
6 dog opsin 448
6643 bp /
H3 bpindm (1921)
S- Spel (1960)
targeting seq 208
NsA (2005)
SmaI(3717) nR extra hairpin Rz


Smal (3706)


Figure 2-3. Map of ET-208 cloned into p21 NewHP Rz448 packaging plasmid.














CHAPTER 3
RESULTS

As discussed in the introduction, Dr. Marina Gorbatyuk had already tested a highly

active ribozyme against dog rhodopsin mRNA. Ribozyme activity was assayed by

quantitative RT-PCR 48 hours post transfection with HEK 293 cells. At a molar ratio of

1:4 and 1:6 of target to ribozyme, the level of dog rhodopsin mRNA was reduced by

approximately 83% and 94% respectively compared to control (Figure 3-1). Therefore,

we used this ribozyme (Rz448) to test the effects of the targeting sequences.

Construction of Rz448-ET208-OHP Packaging Plasmid

After inserting the ET-208 and dog rhodopsin Rz448 sequences into the

p21NewHP plasmid, the presence of the ET-208 and Rz448 sequences in the cloned

vector was examined by performing a 25 cycle PCR amplification of the sequences

between Spel and Nsil (Figure 3-2). PCR products were run on 1.5% agarose gel and

stained with EtBr (Figure 3-3). In addition, the clones were screened for ITRs that are

absolutely necessary for packaging of AAV. ITR retention was determined by

performing a Smal digest, and running the digested plasmid on a 0.6% agarose gel

(Figure 3-4). Each AAV ITR contains two Smal restriction sites within its sequence. If

both ITRs are present, a Smal digest yields two bands that are 3608bp and 3013bp in size

(Figure 3-4). To verify proper orientation and correct sequence of ET208 and RZ448, all

clones were examined by sequencing analysis.









Construct of Rz448-OHP Packaging Plasmid

The Rz448-OHP plasmid, which lacks both the NHP ribozyme and ET-208, was

constructed to serve as a control plasmid in our comparison experiments. Since this

construct is based on the Rz448-ET208-OHP plasmid, the absence of ET-208 was

confirmed by performing a 30 cycle PCR with a sequence-specific sense primer for p21

NHP and the antisense strand of ET-208. Plasmids containing the ET-208 were also

amplified to serve as positive controls (PC). Amplified PCR products were run on a

1.5% agarose gel and stained with EtBr (Figure 3-5). Rz448-OHP clones 1 and 2 do not

have bands corresponding to the ET-208 band in the PC lanes (Figure 3-5). The Rz448-

OHP clones were also screened for ITR and sequenced to confirm the absence of ET208

(Data not shown).

The Co-Localization of Plasmids Expressing Target and Ribozyme within a Cell
after Co-Transfection of HEK 293 Cells

To visualize the co-localization of plasmids expressing target and ribozyme in co-

transfected HEK 293 cells, plasmids were labeled with fluorescent dyes before

transfection. Dyes were visualized with a confocal microscope (BioRad) at 48 hours

post-transfection. In Figure 3-6 (X20), cells bearing plasmids encoding ribozyme are

seen as a red dot and cells including a plasmid containing target are shown as a blue spot.

In the case of cells holding both plasmids expressing target and ribozyme are indicated as

a spot of violet color.

Analysis of Ribozyme Activity by Quantitative RT-PCR

The activity of ribozyme 448 targeting dog rod opsin RNA was assayed by

quantitative RT-PCR 48 hours post transfection. For this, we extracted total RNA and

compared the levels of target rhodopsin mRNA to an unchanged cellular mRNA, beta-









actin. The mRNAs for dog rhodopsin and beta-actin were reverse transcribed and their

cDNAs were amplified. The PCR products from both templates were run on a 1.5%

agarose and 5-8% polyacrylamide gel to quantitate the amount of beta-actin and dog

rhodopsin mRNA levels.

Results from 1.5% Agarose Gels

At a molar ratio of 1:4 of target to ribozyme

Cotransfection of HEK 293 cells was conducted in triplicate. On a 1.5% agarose

gel, rhodopsin ran as a single band corresponding to -350bp (Figure 3-7a), whereas a

band corresponding to -750bp was obtained from beta-actin (Figure 3-7b). A brighter

band indicates that the lane has more rhodopsin cDNA than a faint band. In a faint band,

the level of rhodopsin cDNA was decreased by the ribozyme activity. The control cells

did not have a plasmid expressing a dog rhodopsin-specific ribozyme. As shown in

Figure 3-7a, the control samples loaded in last three lanes are much brighter than the

other variants. This suggests that the other three variants (Rz448-NHP-OHP, Rz448-

ET208-OHP and Rz448-OHP from left to right) expressing ribozyme caused the

significant reduction in rhodopsin mRNA. On the other hand, in the case of beta-actin,

the intensity of each band is similar between experimental and control variants (Figure 3-

7b). Since beta-actin is a should not be affected by the ribozyme in HEK 293 cells, its

expression level should be unchanged and can therefore be used as an internal control for

these experiments. Using Excel (Microsoft), the ratio of rhodopsin to beta-actin was

averaged and indicated in a bar graph (Figure 3-8). According to these calculations, the

level of dog rhodopsin mRNA from all experimental variants was equally reduced by

approximately 90% as compared to the control cells lacking ribozyme. This finding

confirms the previous results that the levels of dog rhodopsin mRNA in transfected cells









can be decreased by the activity of dog opsin-specific ribozyme 448. However, since we

could not see a difference among the three plasmids expressing the ribozyme, we could

not ascertain whether ET-208 could promote better expression of ribozyme 448, and

cause a resulting in greater knock-down of dog rod opsin mRNA expression at this ratio

(1:4, target: ribozyme).

At a molar ratio of 1:1 of target to ribozyme

As stated above, since a significant decrease was observed in all experimental

variants tested (NHP-OHP, ET-208-OHP, or OHP) (Figure 3-7a), we could not judge

which one was best in reducing the levels of dog rhodopsin mRNA. For this reason, we

decided that decreasing the molar ratios of target to ribozyme was necessary to see

differences among the three experimental variants. To accomplish this, we designed a

second transfection experiment done in quadruplicate, at a molar ratio of 1:1 (target to

ribozyme). These cells were processed using the same procedures for post-transfection

incubation times and RNA isolation. RT-PCR was performed and equal volumes of DNA

products were loaded. Representative results for rhodopsin and beta-actin are shown in

Figures 3-9a and 3-9b, respectively. Based on the intensity of the rhodopsin bands

relative to the beta-actin bands, we can asses a greater or lesser efficacy in ribozyme

function. Of the three plasmids tested, Rz448-ET208-OHP resulted in the highest

reduction of rhodopsin mRNA. In contrast, with the Rz448-OHP plasmid, virtually the

same level of rhodopsin mRNA was observed compared to untreated control (Figure 3-

9a). As see in lanes 1-4 (Figure 3-9a), the plasmid having Rz448-NHP-OHP showed

higher levels of rhodopsin as compared to lanes 9-12, Rz448-OHP used as a control for

NHP and ET-208 (Figure 3-9a). Levels of beta-actin as seen of the agarose gel, mRNAs

were determined to be equal from all variants and controls (Figure 3-9b). These findings









demonstrated that ET-208 elevated the expression of the ribozyme 448 and resulted in the

best knock-down of dog rhodopsin mRNA among the experimental variants. As

illustrated in Figure 3-10, the averaged mRNA ratio of rhodopsin to beta-actin for Rz448-

ET208-OHP was reduced by approximately 73% compared to control. Using Rz448

with just the old hairpin ribozyme (Rz448-OHP) the level of dog rhodopsin mRNA was

decreased by approximately 36%. However, in the case of Rz448-NHP-OHP, almost no

difference (reduction of -9%) was observed. As a result of these findings, we propose

that the ET-208 sequence can significantly reduce the amount of dog rhodopsin mRNA

by the expression of ribozyme 448 at a high level.

At a molar ratio of 1:2.2 of target to ribozyme

An intermediate ratio of 1:2.2 was also examined to confirm our findings in the 1:1

ratio experiment. Cotransfections were performed in quadruplicate. The results are

shown in Figure 3-11. Approximately 55% reduction in mRNA levels was obtained

using Rz448-ET208-OHP, whereas an approximately 32% decrease was observed using

Rz448-OHP. Although the reduction difference was not as high as in the 1:1 ratio

experiment, ET-208 was still the most efficient in reducing levels of dog rhodopsin

mRNA among the three experimental variants. This finding confirms the previous results

that the most decreased level of dog rhodopsin mRNA was shown in cells transfected

with plasmids containing the ET-208 element.

Results from 5% and 8% Polyacrylamide Gels Containing Urea

A 10ul portion of the same cDNA created for the agarose gel experiment was used

for polyacrylamide gel electrophoresis. An 8% polyacrylamide gel was used to resolve

the -350bp rhodopsin PCR product, while an 5% gel was used for the ~750bp beta-actin

product. These gels were stained with a nucleic acid stain, SYBR Green I (Molecular









Probes). The fluorescence of the DNA bands was measured on the Storm

Phosphorimager (Molecular Dynamics) using the program ImageQuant. Numerical

values were obtained and ratios of rhodopsin to beta-actin were calculated (Figure 3-12).

A graphical representation of the averaged ratios of rhodopsin to beta-actin using

the three molar ratios of target to ribozyme (1:4, 1:1, and 1:2.2) is illustrated in Figure 3-

13, 3-14, and 3-15, respectively. In the case of molar ratio 1:4, the pattern of reduction of

all three experimental variants was similar to the results obtained from agarose gel.

However the rate of reduction was slightly decreased from 90% to 75% (Figure 3-13). At

a molar ratio of 1:1 (Figure 3-14), the amount of dog rhodopsin mRNA that was reduced

is the same as that observed in agarose gel. The levels of rhodopsin mRNA were reduced

by approximately 58% for both NHP and ET-208, while a reduction rate of about 31%

was observed using OHP alone. Strikingly, there was no significant difference in the

reduction between NHP and ET208 (Figure 3-14). The results based on the agarose gel

demonstrated approximately 73% and 9% reduction rate for ET-208 and NHP

respectively compared to control.

Unexpected results were also obtained at the molar ratio of target: ribozyme, 1:2.2

and are shown in Figure 3-15. NHP showed a greater reduction of rhodopsin mRNA

levels than ET-208. There was a decrease in the detected cleavage for the 1:2.2 ratio as

compared to the 1:1. While the 1:1 ratio showed a decrease of 58% for both ET-208 and

NHP, the 1:2.2 ratio showed a decrease of 20% and 43% respectively. From these

observations, we concluded that ET-208 promotes the expression of Rz448 more

efficiently when the target and ribozyme are expressed at equal molar ratios. This









combination of 1:1 (target: ribozyme) results in the greatest reduction of dog rhodopsin

mRNA.











2.5 -


7 2-



1
S1.5

C.
0
V-
S1,
0O
o 0.5


rhod sin+Rz397 (1:6)

rhodopsin + Rz397(1:8)

rhodopsin + Rz 448 (1:4)
rhodopsin + Rz 448 (1:6:


Figure 3-1. The Rz448 activity on the reduction of dog rhodopsin mRNA levels in
transfected cells (Courtesy of Dr. M. Gorbatyuk).


Small (87)
TR
S-Smal (98)
CMV ie enhancer
(9" chicken b-actin promoter
exon


p21ET208Rz 448
6643 bp


dog opsin 448
IHindI (1921)
"', 5pe (1960)
targeting seq 208

extra hairpin Rz
neoR


Figure 3-2. Map of Rz448 and ET208 cloned into p21 NewHP packaging plasmid.


















NC std 1 2 3 4


5 6


Figure 3-3. ET-208 PCR product from Rz448-ET208-OHP clones 1-6. NC= negative
control.


< No ITRs

< ITRs


std 1 2 3 4 5


Figure 3-4. Small digest of Rz448-ET208-OHP clones
AAV ITRs.


1-5 demonstrating presence of


1 -4


rWOOMOOMLO ,






















< ET-208


PC PC std 1 2 3


Figure 3-5. PCR amplification to confirm
PC= positive control.


absence of ET-208 in Rz4448-OHP clones.


Figure 3-6. Plasmids containing ribozyme (Rz448-NHP-OHP, Rz448-ET208-OHP, and
Rz448-OHP) were labeled with CyTM3 (Red), while plasmids coding for
target were treated with CyTM5 (Blue) (A confocal microscope by BioRad
X20).











C NHP ET208 OHP


C std 1 2 3 4 5 6 7 8 9 10 11 12


C NHP ET208 OHP Con


C std 1 2 3 4 5 6 7 8 9 10 11 12



Figure 3-7. 1:4 ratio of target to Rz separated on agarose gels. A) Rhodopsin cDNA
(-350 bp). Rz448-NHP-OHP clones 1-3, Rz448-ET208-OHP clones 4-6,
Rz448-OHP clones 7-9, and control 10-12. C= control containing dog
rhodopsin DNA for PCR. B) Beta-actin cDNA (-750 bp). Rz448-NHP-OHP
clones 1-3, Rz448-ET208-OHP clones 4-6, Rz448-OHP clones 7-9, and
control 10-12. C= control containing beta-actin DNA for PCR.


go Ow


Con














At a Molar Ratio of 1:4
(Target: Ribozyme)


1.2

t
-

- 0.8




o
0


r
O.4
0


0


Rz448+NHP
(OHP)


Rz448+ET208
(OHP)


Control


Figure 3-8. Ratio of rhodopsin to beta-actin at a molar ratio of 1:4 (target: ribozyme)


Rz448
(OHP)


I I I I









A.

C NHP ET208 OHP Con











C std 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16



B.

C NHP ET208 OHP Con










C std 1 2 3 4 5 6 7 8 9 10 11 1213 1415 16


Figure 3-9. 1:1 ratio of target to Rz separated on agarose gels. A) Rhodopsin cDNA
(-350 bp). Rz448-NHP-OHP clones 1-4, Rz448-ET208-OHP clones 5-8,
Rz448-OHP clones 9-12, and control 13-16. C= control containing dog
rhodopsin DNA for PCR. B) Beta-actin cDNA (-750 bp). Rz448-NHP-OHP
clones 1-4, Rz448-ET208-OHP clones 5-8, Rz448-OHP clones 9-12, and
control 13-16. C= control containing beta-actin DNA for PCR.






40






At a Molar Ratio of 1:1
(Target: Ribozyme)


20

16

12

8

4


R- 44-e. HP
I,-HF i


l''HI-i


0 1


Figure 3-10. Ratio of rhodopsin to beta-actin at a molar ratio of 1:1 (target: ribozyme)


At a Molar Ratio of 1:2.2

(Target: Ribozyme)


Rz448
(OHP)


Rz448+ET208
(OHP)

Rz448+NHP
(OHP)
I I


Figure 3-11. Ratio of rhodopsin to beta-actin at a molar ratio of 1:2.2 (target: ribozyme)


1.6
1.4
1.2
1
0.8
0.6
0.4
0.2
0


control






41













Figure 3-12. Picture of polyacrylamide gel containing urea stained with SYBR Green I
and scanned by ImageQuant




At a Molar Ratio of 1:4
(Target to Ribozyme)
16
c
S12
o
S 8-
n Rz448+NHP Rz448+ET208 Rz448
0 (OHPi (OHPi (OHPi
.2 4


00
0 Control


Figure 3-13. Ratio ofrhodopsin to beta-actin at a molar ratio of 1:4 (target: ribozyme)







42







At a Molar Ratio of 1:1
(Target to Ribozyme)


Rz448
(OHP)


Control


Figure 3-14. Ratio of rhodopsin to beta-actin at a molar ratio of 1:1 (target: ribozyme)


At a Molar Ratio of 1:2.2

(Target to Ribozyme)


0.6
r
<, 0.45
o

S0.3
ro

.2 0.15


0
0--


Pz-4.-..E TI --.
i'-:.HP I


Control


Figure 3-15. Ratio of rhodopsin to beta-actin at a molar ratio of 1:2.2 (target: ribozyme)


0.02


0.015


0.01


0.005


0 1









A

NHP ET208 OHP Con







1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16



B.

NHP ET208 OHP Con







1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16


Figure 3-16. Picture of polyacrylamide gels containing urea stained with SYBR Green I
and scanned by ImageQuant at a molar ratio of 1:2.2 (target: ribozyme). A)
Beta-actin (5%, -750 bp). Rz448-NHP-OHP clones 1-4, Rz448-ET208-OHP
clones 5-8, Rz448-OHP clones 9-12, and control 13-16. B) Rhodopsin (8%,
-350 bp). Rz448-NHP-OHP clones 1-4, Rz448-ET208-OHP clones 5-8,
Rz448-OHP clones 9-12, and control 13-16.














CHAPTER 4
DISCUSSION AND FUTURE STUDIES

Two of the best characterized ribozymes that have been used in gene therapy are

the hairpin and the hammerhead that act naturally as viral self-cleaving agents (34,35).

Rhodopsin linked autosomal dominant retinitis pigmentosa (ADRP) has been an ideal

target of ribozyme-mediated therapy for a number of reasons: (1) it is a slowly

progressive disease; (2) it is easy to access the target tissue, and (3) the eye is an

immunologically privileged site (34,36). There are over 100 mutations in the rhodopsin

gene, leading to ADRP with the P23H mutation of rhodopsin being the most widespread

in the U.S. One of the studies being performed in our laboratory is rAAV-mediated

hammerhead ribozyme gene therapy for the T4R point mutation in dog rhodopsin that is

associated with progressive retinal atrophies (PRAs) (43). The importance of PRAs is

that dogs with this mutation display a retinal phenotype that mimics that in humans with

dominant rhodopsin mutations (43).

In order for gene therapy of genetic disorders to be effective, it is crucial that the

transgene (i.e., ribozyme) is expressed at high levels. Transgene expression can be

changed at both the transcriptional and post-transcriptional levels. In numerous previous

studies, the transcriptional regulatory elements have been optimized for efficient

transgene expression, including the promoter, enhancer, intron, and poly(A) sequence

(59). To fulfill this, some researchers have begun to focus on the NEEs (nuclear export

elements). Recent studies have investigated the post-transcriptional regulatory elements

such as splice signals (SS), constitutive RNA transport elements (CTE), and the









woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). All of these

signals are known to increase RNA export from the nucleus.

The best known example of stimulation at post-transcriptional level is the inclusion

of an intron within the expression cassette (5,46,47,60). It has been reported that the

addition of an intron can facilitate gene expression by causing the cytoplasmic

accumulation of mRNA in vitro and in vivo (60). In this regard, splicing, which is

biochemically linked to RNA export, promotes the efficiency of the process by formation

of a specific nucleoprotein complex (2,61). However, both CTE and WPRE have the

advantages of not requiring splicing events (60). These elements compensate for the lack

of an intron in the transgene expression (61). Several studies have demonstrated the

utility of these cis-acting RNA elements for increasing transgene expression in context of

either plasmid or viral gene vectors (5,62,63).

Retroviral replication requires the nuclear export unspliced forms of viral RNAs

(61,64-67), because eukaryotic cells encode factors that inhibit the nuclear export of

incompletely spliced mRNAs (67). To avoid the requirement for splicing prior to export,

retroviruses have evolved mechanisms that allow their intron-containing RNAs to exit the

nucleus (66). The constitutive transport element (CTE) of the simian type D retroviruses

is cis-acting element and stem-loop structure (67) that promotes the nuclear export and

cytoplasmic accumulation of incompletely spliced mRNAs (61). The CTE-mediated

nuclear export involves the interaction between CTE and the host-encoded RNA binding

protein TAP, a host factor which is thought to be required for export for cellular RNAs

(63,66-69). Some studies have tested the utility of CTE in the creation of an antisense

system (48,65,70). The CTE has also been proposed as an RNA motif that has the ability









to interact with intracellular RNA helicase that unwinds target mRNAs and facilitates

cleavage by ribozymes (48,65). Futami and coworkers connected the constitutive

transport element (CTE) to an antisense sequence (65). According to their results, a

hybrid antisense oligonucleotide (ODN) containing CTE and targeted to the bcl-2 gene

suppressed the expression of this gene more effectively than did the antisense ODN alone

(65). Warashina's group attached the CTE to their ribozyme (70). They hypothesized

that an RNA helicase coupled to a ribozyme might efficiently guide the ribozyme to its

target site by resolving any inhibitory mRNA structures, thereby leading to efficient

substrate cleavage (70). This modification significantly enhanced ribozyme activity in

vivo and permitted cleavage of sites previously found to be inaccessible, resulting in

suppression on the expression of genes (70). From the findings from Liu et al., the CTE

addition did not alter in vitro ribozyme activity (48). However, in vivo, Rz-coupled-

CTEs were more than 20% more active than non-CTE Rz (48). In this experiment, the

CTE probably assists ribozymes through RNA transport and not through RNA unwinding

(48).

Besides the SS and the CTE, the third RNA element that can significantly enhance

transgene expression is the post-transcriptional regulatory element of hepadnaviruses,

such as hepatitis B virus or woodchuck hepatitis virus (WPRE) (62), the latter being more

efficient (48,71). Other post-transcriptional elements, such as SS and CTE, depend on

the transgene of interest for their enhancing effect (48). On the other hand, the

stimulatory ability of the cis-acting WPRE (63), when it is inserted into the 3'

untranslated region of coding sequences (71), is transgene-, promoter-, and vector-

independent (48,61). The 600 bp size of the WPRE contains at least three distinct cis-









acting sub-elements required for maximal function (48,62). The WPRE seems to act

independently on transcription and splicing and may improve gene expression by

facilitating RNA export (48,62). Since woodchuck hepatitis virus (WHV) encodes

intronless messages (62,63), WPRE evolved to stimulate the expression of intronless

viral messages (71). This element has been shown to enhance the transgene expression,

which requires no viral proteins to function (63), from vectors of adeno-associated virus

(AAV), lentivirus, and retrovirus (48,61,71) both in vitro and in vivo (60). To investigate

the efficacy of the WPRE in enhancing transgene expression from adeno-virus vectors,

some studies have tested the level and distribution of the green fluorescent protein (GFP)

(71) and the luciferase expression encoded by a cDNA (60,72). Increases in the

efficiency of AAV-directed expression both in vivo and in vitro were demonstrated

(60,71,72). In an experimental rat glaucoma model, incorporation of WPRE into AAV

improved GFP expression in retinal ganglion cells (RGCs) (64). Work done by Paterna's

group proposed that the WPRE, which was inserted into rAAVs, improved the production

of certain neuroprotective proteins for human neurodegenerative diseases (73).

As discussed above, efforts aimed at increasing the transgene expression have been

developed the post-transcriptional enhancer elements associated with optimized

transcriptional regulatory elements in several ways. Many researchers have used the

CTE and WPRE to enhance the expression of mRNA and ribozymes. However, the CTE

addition did not change in vitro ribozyme activity (48). Unpublished observations from

Alan White, a graduate student from our laboratory, demonstrated that there was no

significant improvement made by insertion of WPRE in a ribozyme expressing AAV









vector. Despite all of these efforts, there still room for improvement in nuclear transport

of ribozymes for gene therapy.

Since efficient export of mRNAs from the nucleus into the cytoplasm plays an

important role in their expression, the NEE can be beneficial. One of the AAV2

ribozyme vectors, p21NHP RZ448, previously used in our studies uses two self-cleaving

hairpin ribozymes found immediately downstream of dog rhodopsin ribozyme 448 as a

processing sequence to free ribozyme 448 from the polyA tail of the primary transcript.

Additionally, expression of the ribozyme in this plasmid is under the control of CBA

promoter paired with the CMV-enhancer and has an intron located immediately

downstream of the promoter as well as two ITRs required for AAV packaging.

As discussed in the introduction, it has been found that the matrix (M) protein of

VSV effectively hinders Ran-dependent nucleocytoplasmic bidirectional transport of

RNA and proteins in Xenopus laevis oocytes (32). In one of the studies conducted by

James E. Dahlberg, they selected new RNA sequences that overcome the M protein

mediated RNA transport inhibition. (10). These new RNA sequences function as NEE

and fall into one of three sequences in a part of a collection of RNAs containing 20

random nucleotides (10). Of these ET-RNAs, ET-208 was recommended by James E.

Dahlberg for our experiment. Here, we investigated whether ET-208 could increase

export of ribozyme 448 to the cytoplasm, leading to greater knock-down of dog

rhodopsin expression.

We tested this by constructing three different plasmids (Rz448-NHP-OHP, Rz448-

ET208-OHP, and Rz448-OHP) for our comparison experiments. The presence or

absence and correct orientation of the ET-208 and the NHP ribozyme within these









constructs were verified with PCR and sequencing analysis. The plasmids were also

screened for ITRs. Large-scale cesium chloride (CsC1) preps were made of the constructs

to get highly purified and large amount of DNA for transfection. Plasmids containing

target and ribozyme sequences were labeled with fluorescent dyes. After the co-

transfection of the plasmids, the localization of the two within the transfected cells was

visualized with a confocal microscope.

Ribozyme activity leading to the reduction of dog rhodopsin mRNA was analyzed

by quantitative RT-PCR. To assay reduced levels of dog rod opsin mRNA, two kinds of

gel (agarose gel and polyacrylamide gel containing urea) were used and stained with EtBr

and SYBR Green I, respectively.

First, rhodopsin and beta-actin RT-PCR products were run on 1.5% agarose gel.

The ratio of rhodopsin to beta-actin was averaged. Transient co-transfetion at a molar

ratio of 1:4 of target to three different ribozyme constructs, all showed a greater than 90%

reduction compared to a control plasmid lacking ribozyme (Figure. 3-8). As described in

the results, since we could not see a difference among the plasmids expressing ribozyme;

we could not determine whether ET-208 could promote better expression of ribozyme

448. To overcome this obstacle, we tried decreasing target to ribozyme ratios during

transfection to determine at which ratio a difference might appear among the variants. At

a molar ratio of 1:1, a slightly decreased rate of reduction of the variants was observed

(Rz448-ET208-OHP: -73%, Rz448-OHP: -36%) (Figure 3-10), but these results are

consistent with findings from a ratio of 1:4 (Figure 3-8). Rz448-NHP-OHP variant

showed a decreased amount of reduction (9%) (Figure 3-10). An interesting result was

obtained at a ratio of 1:2.2. The level of target following transfection by Rz448-NHP-









OHP construct was not different than transfection with the control plasmid not carrying

ribozyme (Figure 3-11). Approximately a 55% and 32% reduction was observed for

Rz448-ET208-OHP and Rz448-OHP, respectively (Figure 3-11). In view of the results

from the 1.5% agarose gel, which demonstrated that the levels of dog rhodopsin mRNA

are markedly reduced by plasmid carrying ET-208 as its NEE, we can propose that the

ET-208 can enhance the activity of ribozyme at a low ratio of target to ribozyme.

However, at a high ratio, the extent of reduction is not significantly different between

NHP and ET-208.

Polyacrylamide gels were also used to quantitate the levels of dog rhodopsin target

after treatment our various Rz448 constructs. The results based on this analysis were

consistent with those obtained previously by 1.5% agarose gel assay. As expected, as

ratios of target to ribozyme declined, the amount of reduction was also decreased. About

75% reduction was observed from all experimental variants at a molar ratio of 1:4 (Figure

3-12). In the case of a ratio of 1:1, around 58% reduction rate was obtained by both NHP

and ET-208, whereas that of Rz448-OHP was 31%. Interestingly, there was no

significant difference in reduction between NHP and ET208 at this ratio. But the error

bars which represent the differences on data for each sample for NHP is greater than that

for ET-208 (Figure 3-13). For this reason, although there was a small difference between

NHP and ET-208, this assay system does not allow us to conclude that ET-208 promotes

greater activity than the NHP ribozyme. Two results above provided direct evidence

supporting our hypothesis that the Rz448-ET208-OHP construct works as well or better

than Rz448-NHP-OHP. On the other hand, it was surprising to find that NHP resulted in

the greatest knock down of dog rod opsin expression at a molar ratio of 1:2.2 (Figure 3-









14). The opposite was observed from the agarose gel. The decreased reduction rate of

each was 43% for NHP and 20% for ET-208, respectively.

There are several factors that could account for the observed differences. First,

analyses by an agarose gel and a polyacrylamide gel containing urea are done by different

methods. The agarose gels and polyacrylamide gels were stained with EtBr [10mg/ml]

and SYBR Green I (diluted 1:10,000), respectively. The increased sensitivity of SYBR

green increased the background fluoresnce in the gels and influenced the detection of

bands, possibly resulting in incorrect estimation of RNA levels. Second, as shown in

Figure 3-16, the bands were not as tightly formed as expected at a ratio of 1:2.2.

Especially in the case of rhodopsin, all bands were very faint. As a result of this, the

levels of rhodopsin cDNA might not be correctly detected. Finally, at a ratio of 1:2.2 of

target to ribozyme, the error bars for NHP were much greater than those for ET-208

(Figure 3-15). Therefore, there is not enough direct evidence for us to interpret our data

to mean that the NHP ribozyme is better than the NEE ET-208.

In conclusion, we found that ET-208 was able to enhance the ability of ribozyme

448 to reduce the levels of rhodopsin mRNA within co-transfected cells. In order to truly

compare the NEE ET-208 to the hairpin ribozyme processing sequence, we need to

remove the OHP ribozyme in all of our constructs used in this experiment. This

experiment will enable us to obtain direct evidence on whether the ET208 acting as an

NEE is better on promoting high expression of our hammerhead ribozymes than the

hairpin ribozyme that functions as a processing sequence in the separation of the

hammerhead ribozyme from the long transcript. Since splicing is known to enhance

nuclear-cytoplasmic transport of mRNA (2,5,44-47), we should also test ribozyme









constructs that lack an intron sequence, to determine if RNA export is enhanced by

ET208 in the absence of an intron.

In addition, some issues regarding methods used for this experiment will be

examined to get more information from the results. First, here, we used quantitative RT-

PCR to assay the activity of Rz448 targeting dog rhodopsin RNA determined by the

reduction of dog rhodopsin mRNA levels. Since RT-PCR is highly reproducible only in

the exponential phase of amplification, it is necessary to collect quantitative data at a

point in which every sample is in this phase to obtain the accuracy and precision. After

the reaction rate ceases to be exponential, it enters a linear phase of amplification. The

number of cycles of PCR used for this experiment was determined by being performed

for a greater or lesser number of cycles 15 -30 (M. Gorbatyuk, personal communication).

Real-time PCR automates this process by quantitating reaction products for each sample

in every cycle (74). The advantage of real-time PCR is that the result is a broad dynamic

range, with no user intervention required. Data analysis, including standard curve

generation and copy number of calculation, is performed automatically. Because of this

advantage, in the future experiments we will use real-time PCR to determine rhodopsin

RNA levels in transfected cells. Second, when we took pictures of co-transfected cells by

using a confocal microscope, we did not count the number of cells visualized as different

colors (blue or red) depending on that they contain which plasmids (target or ribozyme).

For this reason, we could not determine the efficiency of transfection from these pictures.

In the future experiment, we will sort cells depending on their colors labeled with

different fluorescent dyes to see the efficiency of our transfection.









Lastly, in the field of antisense approaches to knock down the expression of

mutated genes that cause diseases, small interfering RNA (siRNA) has also held promise

for the development of therapeutic gene silencing. RNA interference (RNAi) is a post-

transcriptional process triggered by the introduction of double-stranded RNA (dsRNA)

which leads to gene silencing in a sequence-specific manner (75). siRNA typically

consists of two 21-23 nucleotide single-stranded RNAs that form a 19 bp duplex with 2

nucleotide 3' overhangs (76). siRNAs are an intermediate of RNA interference the

process by which double-stranded RNA inactivates homologous genes(76). Since siRNA

target less specific sequences than ribozyme, it can be easily designed to recognize RNAs

encoding aberrant proteins. Although ribozymes are also able to elicit strong and specific

suppression of gene expression, they have limited target sequences, a quintuple sequence

for hairpin ribozymes and a triplet sequence for hammerhead ribozymes (34-36). For this

reason, siRNA has become popular in studying the biology of organisms ranging from

unicellular protozoans to mammals (77). However, the effect of siRNA delivered as

RNA is only transient and this fact severely limits the applications of siRNAs (78). To

overcome this limitation, the construction of plasmids for better expression of siRNA

within cells is necessary. With our findings from this experiment, we will examine

whether ET-208 could promote better expression of siRNA, resulting in greater reduction

of dog rhodopsin expression, by replacing Rz448 with siRNA sequence in our Rz448-

ET208-OHP construct.















LIST OF REFERENCES


1. George O, Danny R (2002) A unified theory of gene expression. Cell. 108:439-451.

2. Robin R (2003) Coupling transcription, splicing and mRNA export. Current
Opnion in Cell Biology. 15:326-331.

3. Hammell CM, Gross S, Zenklusen D, Heath CV, Stutz F, Moore C, Cole CN
(2002) Coupling of termination 3' processing, and mRNA export. Mol Cell Biol.
22(18):6441-6457.

4. Robin R, Ed H (2002) A conserved mRNA export machinery coupled to pre-
mRNA splicing. Cell. 108:523-531.

5. Ming-juan L, Robin R (1999) Splicing is required for rapid and efficient mRNA
export in metazoans. PNAS. 96(26):14937-14942.

6. Reed R, Hurt E (2002) A conserved mRNA export machinery coupled to pre-
mRNA splicing. Cell. 108:523-531.

7. Reichert VL, Le Hir H, Jurica MS (2002) 5' exon interactions within the human
splicesome establish a framework for exon junction complex structure and
assembly. Genes Dev. 16:2778-2791.

8. Lejeune F, Shitakes Y, Li X (2002) The exon junction complex is detected on
CBP80-bound but not elF4E-bound mRNA in mammalian cells: dynamics of
mRNP remodeling. EMBO J. 21:3536-3545.

9. Karsten W (1998) Importins and exportins: how to get in and out of the nucleus.
TIBS. 23:185-189.

10. Christian G, Elsebet L, James ED (1997) Selection and nuclear immobilization of
exportable RNAs. Proc Natl Acad Sci USA. 94:10122-10127.

11. Michael WM, Choi M, Dreyfuss G (1995) A nuclear export signal in hnRNP Al: a
signal-mediated, temperature-dependent nuclear protein export pathway. Cell.
83(3):415-422.

12. Gideon D, V Narry Kim, Naoyuki K (2002) Messenger-RNA binding proteins and
the messages they carry. Mol Cell Biol. 3:195-205.









13. Elissa PL, Pamela AS (2002) Protein and RNA export from the nucleus.
Developmental Cell. 2:261-272.

14. Steven ID, Carl MF (1998) Translocation of RNA-coated gold particles through the
nuclear pores of oocytes. The Journal of Cell Biology. 106:575-584.

15. Katharine SU, Maureen AP (1997) Nuclear export receptors: From importin to
exportin. Cell. 90:967-970.

16. Mattaj IW, Englmeier L (1998) Nucleocytoplasmic transport: the soluble phase.
Annu Rev Biochem. 67:265-306.

17. Charles NC, Claudio S (1997) Export of mRNA from microinjected nuclei of
Xenopus laevis oocytes. Cell & Developmental Biology. 8:71-78.

18. James ED, Elsebet L (1997) Coupling of nuclear RNA export and protein import in
vertebrate cells. Cell & Developmental Biology. 8:65-70.

19. ZasloffM (1983) tRNA transport from the nucleus in a eukaryotic cell: carrier-
mediated translocation process. Proc Natl Acad Sci USA. 80(21):6436-6440.

20. Hinshaw JE, Carragher BO, Milligan RA (1992) Architecture and design of the
nuclear pore complex. Cell. 69(7): 1133-1141.

21. Davis LI (1995) The nuclear pore complex. Annu Rev Biochem. 64:865-896.

22. Charles NC, Claudio S (1997) Regulation of the export of RNA from the nucleus.
Cell & Developmental Biology. 8:71-78.

23. Mutsuhito O, Alexandra S, Scott K, Iain WM (2002) Identity elements used in
export of mRNAs. Molecular Cell. 9:659-671.

24. Fabre E, Hurt EC (1994) Nuclear transport. Curr Opin Cell Biol. 6(3):335-342.

25. Jarmolowski A, Boelens WC, Izaurralde E, Mattaj IW (1994) Nuclear export of
different classes of RNA is mediated by specific factors. J Cell Biol. 124(5):627-
635.

26. Fischer T, Strasser K, Racz A, Rodriguez-Navarro S, Oppizzi M, Ihrig P, Lechner
J, Hurt E (2002) The mRNA export machinery requires the novel Sac3p-Thplp
complex to dock at the nucleoplasmic entrance of the nuclear pores. EMBO J.
21(21):5843-5852.

27. Izaurralde E (2002) A novel family of nuclear transport receptors mediates the
export of messenger RNA to the cytoplasm. Eur J Cell Biol. 81(11):577-584.

28. Gorlich D, Mattaj IW (1996) Nucleocytoplasmic transport. Science. 271:1513-1518.









29. Dahlberg JE, Lund E (1998) Functions of the GTPase Ran in RNA export from the
nucleus. Curr Opin Cell Biol. 10(3):400-408.

30. Lee MS, Henry M, Silver PA (1996) A Protein that shuttles between the nucleus
and the cytoplasm is an important mediator of RNA export. Genes Dev.
10(10):1233-1246.

31. Gorlich D, Pante N, Kutay U, Aebi U, Bischoff FR (1996) Identification of
different roles for RanGDP and RanGTP in nuclear protein import. EMBO J.
15(20):5584-5594.

32. Her LS, Lund E, James ED (1997) Inhibition of Ran guanosine triphosphatase-
dependent nuclear transport by the matrix protein of vesicular stomatitis virus.
Science. 276:1845-1848.

33. Jeannine MP, Lu-Shuin H, Virgil V, Elsebet L, James ED (2000) The matrix
protein of vesicular stomatitis virus inhibits nucleocytoplasmic transport when it is
in the nucleus and associated with nuclear pore complexes. Molecular and cellular
Biology. 20(22):8590-8601.

34. Jason JF, D Alan W, Alfred SL, William WH (2002) Designing and characterizing
hammerhead ribozymes for use in AAV vector-mediated retinal gene therapies.
Methods in Enzymology. 346:358-377.

35. Jason JF, Marina G, Alfred SL, William WH (2003) Design and validation of
therapeutic hammerhead ribozymes for autosomal dominant disease. Methods in
Molecular Biology. 252:221-236.

36. Alfred SL, William WH (2001) Ribozyme gene therapy: applications for molecular
medicine. TRENDS Mol Med. 7(5):221-227.

37. Adrian R, Ferre D (2004) The hairpin ribozyme. Biopolymers. 73:71-78.

38. Anastasia K, Aurelie L, Eric W, Sumedha DJ (2003) Sequence elements outside the
hammerhead ribozyme catalytic core enable intracellular activity. Nature Structural
Biology. 10(9):708-712.

39. Naash MI, Hollyfield JG, al-Ubaidi MR (1993) Simulation of human autosomal
dominant retinitis pigmentosa in transgenic mice expressing a mutated murine
opsin gene. Proc Natl Acad Sci USA. 90(12):5499-5503.

40. Stephen PD, Lori SS, Sara JB (1996) RetNet: Retinal information network. The
University of Texas Health Science Center. http:// www. sph.uth.tmc.edu/Retnet/.
July 2004.

41. Lewin AS, Drenser KA, Hauswirth WW, Nishikawa S, Yasumura D, Flannery JG,
LaVail MM (1998) Ribozyme rescue of photoreceptor cells in a transgenic rat
model of autosomal dominant retinitis pigmentosa. Nat Med. 4(9):967-971.









42. Hauswirth WW, Lewin AS (2000) Ribozyme rescue of photoreceptor cells in P23H
transgenic rats: long-term survival and late-stage therapy. Prog Retinal Eye Res.
19:689.

43. James WK, Artur VC, Tomas SA, Michael JP, Susan EP, Brian JM, Samuel GJ,
Gustavo DA, Gregory MA (2002) Naturally occurring rhodopsin mutation in the
dog causes retinal dysfunction and degeneration mimicking human dominant
retinitis pigmentosa. PNAS. 99(9):6328-6333.

44. Jonsson JJ, Foresman MD, Wilson N, Mclvor RS (1992) Intron requirement for
expression of the human purine nucleoside phosphorylase gene. Nucleic Acids Res.
20(12):3191-3198.

45. Rafiq M, Suen CK, Choudhury N, Joannou CL, White KN, Evans RW (1997)
Expression of recombinant human ceruloplasmin an absolute requirement for
splicing signals in the expression cassette. FEBS Lett. 407(2):132-136.

46. Simari RD, Yang ZY, Ling X (1998) Requirement for enhanced transgene
expression by untranslated sequences from the human cytomegalovirus immediate-
early gene. Mol Med. 4(11):700-706.

47. DeYoung MB, Zamarron C, Lin AP, Qiu C, Driscoll RM, Dichek DA (1999)
Optimizing vascular gene transfer of plasminogen activator inhibitor 1. Hum Gene
Ther. 10(9):1469-1478.

48. Liu J, Timmers AM, Lewin AS, Hauswirth WW (2004) In vivo somatic
knockdown of PDE RNA in normal mice using AAV-vectored ribozyme is
enhanced by addition of a constitutive transport element (CTE). Presentation by the
Association for Research in Vision and Ophthalmology. Inc.

49. Lingfei XU, Thomas D, Cuihua G, Terence RF, Sihong S, Barry JB, Mark SS,
Katherine PP (2001) CMV-beta-actin promoter directs higher expression from an
adeno-associated viral vector in the liver than the cytomegalovirus or elongation
1 alpha promoter and results in therapeutic levels of human factor X in mice.
Human Gene Therpy. 12:563-573.

50. Alexander P, Inder MV (2001) Gene therapy: Promises and problems. Annu Rev
Genomics Hum. Genet. 2:177-211.

51. Carter PJ, Samulski RJ (2000) Adeno-associated viral vectors as gene delivery
vehicles. Int J Mol Med. 6(1):17-27.

52. Bartlett J, Samulski RJ (1995) Genetics and biology of adeno-associated virus.
Viral vectors: Gene therapy and neuroscience applications. Academic Press. 55-73.

53. Jean B, Albert MM, Maguire AV (1999) Stable transgene expression in rod
photoreceptors after recombinant adeno-associated virus-mediated gene transfer to
monkey retina. PNAS. 96:9920-9925.









54. Grant CA, Ponnazhagan S, Wang X (1997) Evaluation of recombinant adeno-
associated virus as a gene transfer vector for the retina. Curr Eye Res. 16:949-956.

55. Ali RR, Reichel MB, Thrasher AJ (1996) Gene transfer into the mouse retina
mediated by an adeno-associated viral vector. Human Molecular Genetics.
5(5):591-594.

56. Berns KI (2001) Parvoviridae: the viruses and their replication, In B N Fields. DM
Knipe, PM Howley (ed.) Fundamental virology. 4th ed. vol.2. Lippincott-Raven
Publishers. Philadelphia. PA. 1007-1041.

57. Muzyczka N (1992) Use of adeno-associated virus as a general transduction vector
for mammalian cells. Curr Top Microbiol Immunol. 158:97-129.

58. Sambrook J, Russel DW (2001) Molecular cloning: a laboratory manua. 3rd ed.
Cold Spring Harbor Laboratory Press. New York. 184.

59. Xu ZL, Mizuguchi H, Mayumi T, Hayakawa T (2003) Woodchuck hepatitis virus
post-transcriptional regulation element enhances transgene expression from
adenovirus vectors. Biochim Biophys Acta. 1621:266-271.

60. Zufferey R, Donello JE, Trono D, Hope TJ (1999) Woodchuck hepatitis virus
posttranscriptional regulatory element enhances expression of transgenes delivered
by retroviral vectors. J Virol. 73:2886-2892.

61. Schambach A, Wodrich H, Hildinger M, Bohne J, Krausslich HG, Baum C (2000)
Context dependence of different modules for posttranscriptional enhancement of
gene expression from retroviral vectors. Mol Ther. 2:435-445.

62. Donello JE, Loeb JE, Hope TJ (1998) Woodchuck hepatitis virus contains a
tripartite posttranscriptional regulatory element. J Virol. 72:5085-5092.

63. Popa I, Harris ME, Donello JE, Hope TJ (2002) CRM1-dependent function of a
cis-acting RNA export element. Mol Cell Biol. 22:2057-2067.

64. Martin KR, Quigley HA, Zack DJ, Levkovitch-Verbin H, Kielczewski J, Valenta
D, Baumrind L, Pease ME, Klein RL, Hauswirth WW (2003) Gene therapy with
brain-deliverd neurotrophic factor as a protection: Retinal ganglion cells in a rat
glaucoma model. Invest Ophthalmol Vis Sci. 44:4357-4365.

65. Foams T, Miyagishi M, Iwai S (2003) Stimulatory effect of an indirectly attached
RNA helicase-recruiting sequence on the suppression of gene expression by
antisense oligonucleotides. Antisense Nucleic Acid Drug Dev. 13:9-17.

66. Pasquinelli AE, Ernst RK, Lund E (1997) The constitutive transport element (CTE)
of mason-pfizer monkey virus (MPMV) accesses a cellular mRNA export pathway.
EMBO J. 16:7500-7510.









67. Braun IC, Rohrbach E, Schmitt C, Izaurralde E (1999) TAP binds to the
constitutive transport element (CTE) through a novel RNA-binding motif that is
sufficient to promote CTE-dependent RNA export from the nucleus. EMBO J.
18:1953-1965.

68. Bear J, Tan W, Zolotukhin AS, Tabernero C, Hudson EA, Felber BK (1999)
Identification of novel import and export signals of human TAP, the protein that
binds to the constitutive transport element of the type D retrovirus mRNAs. Mol
Cell Biol. 19:6306-6317.

69. Bogerd HP, Echarri A, Ross TM, Cullen BR (1998) Inhibition of human
immunodeficiency virus Rev and human T-cell leukemia virus Rex function, but
not mason-pfizer monkey virus constitutive transport element activity, by a mutant
human neucleoporin targeted to Crml. J Virol. 72:8627-8635.

70. Warashina M, Kuwabara T, Kato Y, Sano M, Taira K (2001) RNA-protein hybrid
ribozymes that efficiently cleave any mRNA independently of the structure of the
target RNA. Proc Natl Acad Sci USA. 98:5572-5577.

71. Loeb JE, Cordier WS, Harris ME, Weitzman MD, Hope TJ (1999) Enhanced
expression of transgenes from adeno-associated virus vectors with the woodchuck
hepatitis virus posttranscriptional regulatory element: implications for gene
therapy. Hum Gene Ther. 10:2295-2305.

72. Lipshutz GS, Titre D, Brindle M (2003) Comparison of gene expression after
intraperitoneal delivery of AAV2 or AAV5 in utero. Mol Ther. 8:90-98.

73. Paterna JC, Moccetti T, Mura A, Feldon J, Bueler H (2000) Influence of promoter
and WHV post-transcriptional regulatory element in AAV-mediated trasgene
expression in the rat brain. Gene Ther. 7:1304-1311.

74. TechNotes from Ambion, (2004) Real-time PCR goes prime time. Ambion Inc.
http:// www. ambion.com/techlib/tn/81/813.html. July 2004.

75. Cheng JC (2003) RNA interference and human disease. Mol Genet Metab. 80(1-
2):121-128.

76. Michael TM, Phillip AS (2002) Gene silencing in mammals by small interfering
RNAs. NATURE REVIEWS. 3:737-747.

77. Gregory JH (2002) RNA interference. NATURE. 418:244-251.

78. Overview from InvivoGen (2004) Small interfering RNA (siRNA): A revolution in
functional genomics. InvivoGen. http:// www.
invivogen.com/siRNA/siRNAoverview.htm. July 2004.















BIOGRAPHICAL SKETCH

Eun-Jung Choi was born November 21, 1976, in Seoul, Korea. She was educated

in Korea from elementary to undergraduate schools. She obtained her bachelor's degree

in animal and life sciences from KonKuk University in February 2001. She was awarded

scholarships and a research assistantship during her time in the college. She worked at a

nutrition lab during her sophomore and junior years. Then, she worked at a genetic

engineering lab. She spent about 1 year in the states for English training at the University

of Tennessee. Then, she worked at the National Livestock Research Institute.

She was admitted to the University of Florida, College of Medicine, for fall 2002 as

a master's student. She majored in molecular genetics and microbiology and worked in

Dr. Alfred Lewin's lab with a focus on ribozyme-mediated gene therapy for eye diseases.

Upon graduation from the master's program, she will attend the Interdisciplinary

Program in Biomedical Sciences at the University of Florida to attain her degree of

doctor of philosophy.