<%BANNER%>

Role of Arabidopsis and Tomato Phytohormones in the Response to Bacterial Pathogens


PAGE 1

THE ROLE OF ARABIDOPSIS AND TOMATO PHYTOHORMONES IN THERESPONSE TO BACTERIAL PATHOGENSByANNA KATHERINE BLOCKA DISSERTATION PRESENTED TO THE GRADUATE SCHOOLOF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENTOF THE REQUIREMENTS FOR THE DEGREE OFDOCTOR OF PHILOSOPHYUNIVERSITY OF FLORIDA2004

PAGE 2

Copyright 2004byAnna Katherine Block

PAGE 3

This thesis is dedicated to my family who support me without question, no matter howunusual they think my choices are.

PAGE 4

ivACKNOWLEDGMENTSThis work was supported in part by a grant to Harry Klee from the NationalScience Foundation (IBN0091064) and the Florida Agricultural Experiment Station. Ithank my advisor Harry Klee and my committee members Jeffrey Jones, John Davis andShouguang Jin for their guidance; Eric Schmelz for the measurement of thephytohormones by GC-MS; the Klee lab for its support and advice; the Jones lab for theuse of its greenhouse and help in tomato plant maintenance and the Settles lab for use ofArabidopsis growth facilities and other equipment.

PAGE 5

vTABLE OF CONTENTSPage ACKNOWLEDGMENTS..............................................................................................ivLIST OF TABLES........................................................................................................viiLIST OF FIGURES......................................................................................................viiiABSTRACT....................................................................................................................xCHAPTER1INTRODUCTION....................................................................................................1Plant-Pathogen Interactions......................................................................................1Pathogenesis-Related (PR) Genes.............................................................................2Bacterial Pathogens..................................................................................................3The Role of Salicylic Acid in Arabidopsis Defense Responses.................................4The Role of Ethylene in Arabidopsis Defense Responses..........................................7The Role of Jasmonates in Arabidopsis....................................................................7The Interaction of Tomato and Xcv...........................................................................8Symptom Development and Systemic Responses in Tomato..................................122THE EFFECT OF THE REMOVAL OF SA ON PHYTOHORMONE SIGNALINGNETWORKS IN ARABIDOPSIS INFECTED WITH VIRULENT PST................14Differences in Disease Progression and Symptom Development in Salicyclic Acid-Deficient Arabidopsis Mutants infected with Pst................................................14SA and Jasmonate Induction in Response to Pst Infection......................................17The Effect of Coronatine Production by Pst............................................................19The Role of Ethylene in SA-Deficient Arabidopsis.................................................22Discussion..............................................................................................................233SYSTEMIC ACQUIRED TOLERANCE IN TOMATO.........................................28Introduction............................................................................................................28Virulent and Avirulent Xcv Led to Systemic Acquired Tolerance in Tomato...........31Prior Inoculation with Xcv Led to an Early Production of Ethylene upon Challengewith Virulent Xcv...............................................................................................34

PAGE 6

viPR Gene Expression Indicated the Necessity of Ethylene and SA in Systemic SignalGeneration.........................................................................................................37Avirulent Xcv Induced Greater Local and Systemic PR Gene Expression thanVirulent Xcv, but they Result in Similar PR Gene Induction During Challenge..39Discussion..............................................................................................................404DISCUSSION........................................................................................................46Phytohormone Networks in the Responses of Tomato and Arabidopsis to VirulentBacterial Pathogens............................................................................................46The Compatible Tomato-Virulent Xcv Interaction...................................................48The Compatible Arabidopsis-Virulent Pst Interaction.............................................49Systemic Responses to Infection.............................................................................515MATERIALS AND METHODS............................................................................53Plant Materials and Treatments...............................................................................53Bacterial Culture....................................................................................................54Ion Leakage............................................................................................................54Ethylene Measurements..........................................................................................55SA, Jasmonate and Coronatine Measurements........................................................55RNA Extraction......................................................................................................55RNA Gel Blot Analysis..........................................................................................56Real-time RT-PCR.................................................................................................56MCP Treatment......................................................................................................57LIST OF REFERENCES...............................................................................................58BIOGRAPHICAL SKETCH.........................................................................................66

PAGE 7

viiLIST OF TABLESTable page 4-1 Comparative phenotypes of phytohormone mutants in Arabidopsis and tomato......474-2 Comparative phytohormone profiles of Arabidopsis and tomato mutants ...............47

PAGE 8

viiiLIST OF FIGURESFigure page 1-1 The role of sid2 in SA biosynthesis and nahG in SA removal...................................61-2 Jasmonate biosynthesis.............................................................................................91-3 The structure of coronatine.....................................................................................101-4 Ethylene biosynthesis.............................................................................................112-1 Bacterial growth in Pst DC3000 infected Arabidopsis............................................152-2 PR1 and PDF1.2 gene expression in Pst infected Arabidopsis................................162-3 SA production in Pst infected Arabidopsis.............................................................172-4 JA and OPDA production in Pst infected Arabidopsis............................................182-5 Coronatine production in Pst infected Arabidopsis.................................................192-6 Bacterial growth at 72 hpi in Pst DC3000 and Pst DC3661infected Arabidopsis....202-7 Disease symptom development in Pst infected Arabidopsis....................................212-8 Ethylene production in Pst infected Arabidopsis.....................................................233-1 Symptom development of Xcv infected tomato.......................................................313-2 Cell death due to a second infection of tomato with virulent Xcv............................323-3 Bacterial growth during the first and second infections of tomato with Xcv............333-4 Local ethylene and SA production during the first and second infections of tomatowith Xcv...............................................................................................................353-5 Local and systemic PR gene induction in ethylene and SA deficient tomato lines inresponse to infection with virulent Xcv.................................................................383-6 The measurement of local and systemic PR gene expression in tomato duringinfections with virulent or avirulent Xcv...............................................................41

PAGE 9

ix3-7 Induction of PR genes during virulent Xcv infection in tomato plants in the presenceor absence of SAT................................................................................................424-1 A model for the signaling network in tomato in response to virulent Xcv................49

PAGE 10

xAbstract of Dissertation Presented to the Graduate Schoolof the University of Florida in Partial Fulfillment of theRequirements for the Degree of Doctor of Philosophy THE ROLE OF ARABIDOPSIS AND TOMATO PHYTOHORMONES IN THE RESPONSE TO BACTERIAL PATHOGENSByAnna Katherine BlockDecember 2004Chair: Harry KleeMajor Department: Plant Molecular and Cellular BiologyPhytohormone networks are used to regulate the plant response to virulent bacterialpathogens. In this work by the use of salicylic acid (SA) deficient lines it is shown thatSA, a major player in the interaction between Arabidopsis and virulent Pseudomonassyringae pv. tomato (Pst), down-regulates ethylene and jasmonates. SA influencesethylene production in an NPR1-independent manner and jasmonate production in anNPR1-dependent manner. Pst-produced coronatine, a jasmonate mimic, actsindependently of SA and does not compromise SA-dependent basal resistance. Thesethree phytohormones are also involved in the response of tomato to Xanthomonascampestris pv. vesicatoria (Xcv). However, the hormone network is dramaticallydifferent to that of Arabidopsis. It is demonstrated, by the use of phytohormone deficientplants and pathogenesis-related marker gene expression profiling, that a systemic signalis generated in tomato in response to an infection with virulent Xcv. This signal is SA-dependent and leads to the development of a systemic acquired tolerance in tomato to

PAGE 11

xisubsequent infections with virulent Xcv. This systemic acquired tolerance is similar to thesystemic response that is generated in response to avirulent Xcv.

PAGE 12

1CHAPTER 1INTRODUCTIONPlant-Pathogen InteractionsThe normal growth of a plant can be disrupted due to interactions with pathogenicorganisms such as bacteria, fungi, parasitic higher plants, nematodes, mycoplasmas andviruses. Pathogens live in or on another organism, from which they derive nutrients.Substances released by the pathogen, in order to penetrate plant cell walls and make thenutrients accessible for their use, cause damage to the host tissues. These substancesinclude enzymes, toxins, growth regulators and polysaccharides, some of which areinduced upon host recognition.Not all pathogens can cause disease on all hosts as some lack the necessary abilitiesto penetrate and survive that hosts endogenous structural and chemical defenses. Thehost range of a pathogen is defined as the host plants on which a particular pathogen canrecognize and grow successfully (Agrios, 1988). Resistant hosts can specifically recognize avirulent pathogens and cause anincompatible interaction. Incompatible interactions often include a hypersensitiveresponse HR that consists of a rapid induction of host defenses and the death of cells incontact with the pathogen. The faster this response occurs, the more resistant the plant isto the pathogen. Compatible interactions occur between susceptible plants and virulentpathogens, leading to successful invasion of host tissues (Ausubel et al., 1995;Hammond-Kosack and Jones, 1996).

PAGE 13

2In both compatible and incompatible interactions the plant attempts to limit damageand control pathogen growth. This is done by the production of toxic substances aroundthe site of injury, as well as by the formation of protective layers such as callus and cork.Some compounds are produced at high enough concentrations to limit pathogen growth.These compounds include phenolic compounds such as chlorogenic and caffic acids,oxidation products of phenolic compounds and phytoalexins (Agrios, 1988; Jackson andTaylor, 1996).Pathogenesis-Related (PR) GenesAs well as the production of substances and structures, several plant genes areinduced in response to pathogens. PR genes are used as markers of the disease responsein many plant species. They are defined as plant-encoded genes that are only expressed inthe tissue in response to a pathogen or related stress. PR genes are classified by functionand homology; these classes include PR-2 (!-1,3-glucanase), PR-6 (proteinase-inhibitor),PR-12 (defensin) and PR-1 whose function is unknown (Van Loon and Van Strien,1999).Although PR genes are induced during infection, only a few have been shown tohave a direct impact on pathogen growth. The most well characterized of these is the PR-1 family that has antifungal activities, although the mechanism by which it acts has yet tobe identified (Alexander et al., 1993; Niderman et al., 1995). The combined effect ofmany PR gene products may be required to have a significant effect on pathogen growth.Particular classes of PR genes have been linked to specific phytohormone inductionevents. For example the PR gene Thi 2.1 of Arabidopsis is induced during wounding in ajasmonate dependent manner (Bohlmann et al., 1998). The phytohormones, however,

PAGE 14

3affect one another to such an extent that any direct interpretation of the roles ofphytohormones from PR gene expression is inherently risky.The responses covered so far are induced at a local level by pathogen infection. Theplant, however, also shows a systemic response to infection that includes some of thesame response as those at the local level. For example pathogen infection can lead to theproduction of a systemic signal. This signal can induce resistance in uninfected tissues ofthe plant 2-3 days after infection. It can also induce the systemic expression of PR genes.This systemic induced resistance (SAR) can last several weeks and is effective against awide range of normally virulent pathogens.Bacterial PathogensThe response to pathogens varies depending on the host-pathogen interaction. Tosimplify the study of plant pathogen interactions the focus of this work will be limited tobacterial pathogens, specifically to Xanthomonas and Pseudomonas. These arenecrotizing biotrophic pathogens that live within the apoplast. They can multiply forsome time within host tissues before causing necrosis. They use a type III secretionsystem to introduce substances into host cells that cause the release of nutrients andsuppress host defense responses. They also produce toxins and other extracelluarsubstances, which affect the plant and cause disease symptom development (Alfano andCollmer, 1996).Xanthomonas and Pseudomonas are rod shaped gram negative bacteria of thefamily pseudomonadaceae. They use flagella to move through liquid and can enter hosttissues from water on the surface of the tissue. For example they can enter the leavesthrough wounds or stomatal openings. The symptoms these bacteria cause include the

PAGE 15

4formation of necrotic lesions on infected tissues. These lesions are sometimes surroundedby a chlorotic halo. The necrotic lesions may coalesce and form large necrotic regions oreven kill the entire tissue.Bacterial species can be further subdivided into subspecies or pathovars (pv),which are distinguished by their host range. The two pathogens this work will focus onare Pseudomonas syringae pv. tomato (Pst) that causes bacterial speck both in tomatoand in the model plant Arabidopsis and Xanthomonas campestris pv vesicatoria (Xcv)that causes bacterial spot in tomato and pepper (Agrios, 1988).Many of the plant responses to pathogens have been characterized. However, howthe plant forms and coordinates its defense response has yet to be fully elucidated(Glazebrook, 2001). One of the major tools in such studies is mutant screening for plantsaltered in their pathogen responses. The screens focus either on disease phenotype or onPR gene induction with the plant Arabidopsis thaliana as a favored model (Glazebrook etal., 1997). These screens have identified mutants that are compromised in their resistanceto avirulent pathogens. Some of these mutants also show enhanced susceptibility tovirulent pathogens and thus demonstrate the existence of a basal resistance, in which theplant limits the growth of virulent pathogens (Glazebrook et al., 1996). Such mutantsoften also have altered phytohormone profiles, indicating important roles forphytohormones in coordinating the defense responses to both virulent and avirulentpathogens (Dewdney et al., 2000; Nawrath et al., 2002).The Role of Salicylic Acid in Arabidopsis Defense ResponsesThe phytohormone salicylic acid (SA) is involved in maintenance of basalresistance, the response to avirulent pathogens and development of SAR in Arabidopsis.

PAGE 16

5Mutants that show enhanced susceptibility to virulent pathogens such as Pst DC3000often accumulate less SA than their wild type parents following infection. For examplepad4, which has enhanced susceptibility to virulent Pseudomonas syringae pv maculicolaES4326 (Psm), has reduced and delayed SA synthesis (Zhou et al., 1998).In several plant species the removal of SA has been accomplished by introductionof the nahG transgene encoding a Pseudomonas putida salicylate hydroxylase (EC1.14.13.1), which converts SA into catechol (Yamamoto et al., 1965). Arabidopsis plantscarrying this transgene have enhanced susceptibility to several pathogens including Pst(Delaney et al., 1994; Lawton et al., 1995).An Arabidopsis SA biosynthesis mutant, sid2-2, that fails to accumulate SA inresponse to pathogens has also been identified. This line contains a loss of functionmutation in the enzyme isochorismate synthase 1 (EC 5.4.4.2) that converts chorismate toisochorismate (Figure 1-1) (Wildermuth et al., 2001). sid2-2 has both enhancedsusceptibility to Pst and fails to accumulate SA in response to infection (Nawrath andMetraux, 1999).NahG and sid2-2 respond differently to the non-host pathogen Pseudomonassyringae pv. phaseolicola strain 3121, suggesting that the catechol produced by the nahGtransgene may influence the disease process (Van Wees and Glazebrook, 2003). Theconclusion that nahG has an effect beyond elimination of SA is further supported byglobal expression phenotyping of Arabidopsis in response to infection by virulent Psm(Glazebrook et al., 2003). This showed major differences between NahG and sid2-2 interms of the expression patterns of genes induced in the two lines by infection with Psm.

PAGE 17

6 Figure 1-1 .The role of sid2 in SA biosynthesis and nahG in SA removal.Signal transduction from SA can occur in an NPR1-dependent or independentfashion (Clarke et al., 1998). NPR1 is a protein with a BTB/BOZ domain and an ankyrinrepeat domain, both of which are involved in protein-protein interactions (Cao et al.,1997). Upon infection NPR1 is translocated to the nucleus where it interacts with bZIPtranscription factors that are involved in the SA-dependent activation of PR genes(Despres et al., 2000). NPR1 also has a role in suppressing jasmonate signaling in thecytoplasm (Spoel et al., 2003). However, nuclear localization of NPR1 is required for PR

PAGE 18

7gene expression (Kinkema et al., 2000). The loss of function mutant npr1-1 has enhancedsusceptibility to virulent Pseudomonas syringae and has reduced expression of PR genesafter infection (Cao et al., 1994).The Role of Ethylene in Arabidopsis Defense Responses The major role of SA in basal resistance is demonstrated by SA-deficientArabidopsis that are more susceptible to the virulent pathogen Pst. Acting eitheragonistically or antagonistically to SA in these interactions are other phytohormones suchas ethylene and jasmonic acid (JA). For example, the Arabidopsis ethylene insensitivemutant etr1-1 has faster disease progression than wild type plants in response to virulentXanthomonas campestris pv. campestris (Xcc). This suggests that ethylene negativelyregulates disease symptom development in this system. However, NahG is deficient inethylene production following Xcc infection, suggesting that these two phytohormonesact agonistically in this response (O'Donnell et al., 2003). The loss of ethylene in NahG isnot supported by sid2-2, which was shown to accumulate ethylene in response toinfection with Pst (Heck et al., 2003). Thus, the failure to produce ethylene in pathogeninfected NahG Arabidopsis may be a specific consequence of the nahG transgene and notdue to the failure to accumulate SA.The Role of Jasmonates in ArabidopsisTwo Arabidopsis mutants that are SA-deficient, eds4 and pad4, have increasedsensitivity to compounds that induce the expression of JA response genes (Gupta et al.,2000), and NahG and sid2 produce higher levels of JA in response to infection with Pstthan does Columbia (Heck et al., 2003; Spoel et al., 2003). JA is produced from alpha-linolenic acid via the active precursor 12-oxo-phytodieonic acid (OPDA). It can also beconverted into the volatile compound methyl-jasmonate (Figure 1-2). These two

PAGE 19

8compounds, in addition to JA and other oxylipins, are commonly referred to asjasmonates (Seo et al., 2001; Stintzi et al., 2001). Currently, little is known about theroles of individual jasmonates in pathogen defense.The evidence for a role for jasmonates in compromising the basal resistance ofArabidopsis to Pst is further supported by the involvement of Pst-produced coronatine.Coronatine is a phytotoxin that mimics OPDA (Weiler et al., 1994) (Figure 1-3). A Tn5transposon insertion into Pst DC3000 produced a coronatine-deficient Pst mutant, PstDC3661 (Moore, 1989). This mutant strain was shown to be less virulent than PstDC3000 in Arabidopsis in dip infections but not in injection inoculations. However, thedisease symptoms in both forms of infection were reduced when compared to the parentalstrain (Mittal and Davis, 1995).The hypothesis that coronatine is an important virulence factor for Pst is reinforcedby studies with the Arabidopsis coronatine insensitive mutant coi1 (Feys et al., 1994).COI1 is part of an E3 ubiquitin-ligase involved in a jasmonate response pathway (Xie etal., 1998). The coi1 mutants are both more resistant to Pst DC3000 and have higher SAlevels (Kloek et al., 2001). These data along with similar studies in tomato (Zhao et al.,2003) suggest that coronatine acts by stimulating the jasmonate-signaling pathway.The Interaction of Tomato and XcvNot all plants use phytohormones in the same way in their defense responses. Intomato phytohormones are involved in the response to both virulent and avirulent Xcv. Inthe response to virulent Xcv, there is an induction of ethylene followed by accumulationof SA.

PAGE 20

9 Figure 1-2 Jasmonate biosynthesis.

PAGE 21

10 Figure 1-3 The structure of coronatine.SA production in this response is dependent on the previous production of ethylene(O'Donnell et al., 2001), and both are dependent on the ability of the plant to producejasmonates.Antisense plants for the jasmonate biosynthesis enzyme allene oxide synthase (as-AOS) are resistant to virulent Xcv and show no production of either ethylene or SA(O'Donnell et al., 2003). Transgenic tomato plants that express 1-aminocyclopropane-1-carboxylate (ACC) deaminase (ACD) (EC 3.5.99.7) (Figure 1-4) do not produce ethyleneand are compromised in SA induction during infection. NahG plants, which do notproduce SA, have normal ethylene production. Both ACD and NahG are tolerant tovirulent Xcv and unaffected in their ability to produce jasmonates (O'Donnell et al.,2003).The tolerance of a plant to a pathogen can be defined as substantial growth of thepathogen within the host tissues combined with an absence of full symptom development.Another plant that is compromised in phytohormone signaling and shows tolerance is theethylene insensitive (ein2) mutant of Arabidopsis. It is tolerant to both Pst and Xcc (Bentet al., 1992).

PAGE 22

11 Figure 1-4 Ethylene biosynthesis.

PAGE 23

12The response of tomato to avirulent Xcv also involves phytohormone induction.There is a major early induction of ethylene that is larger than that seen in the susceptibleresponse. There is also an early induction of SA. Increased ethylene sensitivity in tomatocaused by reduced expression of an ethylene receptor LeETR4 enhances thehypersensitive response to avirulent Xcv (Ciardi et al., 2001). This demonstrates thatethylene is also important in the response to avirulent pathogens.Symptom Development and Systemic Responses in TomatoSymptom development in tomato infected with Xcv can be categorized into twostages. The primary response present in resistant, susceptible and tolerant interactionsconsists of localized lesion formation. The secondary phenotype, which is only present inthe susceptible response, consists of the development of chlorosis and necrosis thatspreads from the sites of the primary lesions (O'Donnell et al., 2003).Perhaps there is an advantage for the plant to produce these phytohormones and theconsequent chlorosis and necrosis development in response to virulent infections. Inaddition to the necrosis of the tissue effectively removing the pathogen from the plant, itis possible that this response produces a systemic signal that primes the plants defensesin case of repeat infections. It has been demonstrated in several systems, includingtobacco and cucumber that infections with virulent pathogens that produce high levels ofnecrosis can lead to the induction of SAR (Cohen and Kuc, 1981; Strobel et al., 1996).Therefore the phytohormones induced during the interaction with virulent Xcv andtomato may be involved in the development of SAR and this could be the reason whythey remain even though their absence would lead to tolerance. SAR is induced in tomato

PAGE 24

13by tobacco necrosis virus (TNV) (Jeun et al., 2000) and Phytophthora infestans (Enkerliet al., 1993) and leads to resistance to P. infestans.Here two different aspects of phytohormone signaling in response to infectionswith virulent bacterial pathogens are studied. The first, in chapter 2, investigates theeffect of the removal of SA accumulation on the synthesis of ethylene and jasmonatesduring the interaction between Pst and Arabidopsis. This chapter focuses onphytohormone networks in the local response to infection. The second, in chapter 3, is onthe interaction between tomato and Xcv. In this chapter the focus is the systemic responseto virulent bacterial infection and the possible roles of phytohormones in this response.Although in both cases the focus is on the role of phytohormones in response topathogens, it can clearly be seen that the phytohormones play different roles in the twosystems and therefore information gained from studying one plant-pathogen interaction isnot necessarily applicable to another.

PAGE 25

14CHAPTER 2THE EFFECT OF THE REMOVAL OF SA ON PHYTOHORMONE SIGNALINGNETWORKS IN ARABIDOPSIS INFECTED WITH VIRULENT PSTDifferences in Disease Progression and Symptom Development in Salicyclic Acid-Deficient Arabidopsis Mutants infected with PstPhytohormones do not act in a discrete fashion. The action often attributed to onephytohormone can be due to the combined action of several. SA plays an important rolein the basal resistance of Arabidopsis to virulent Pst. However, it is not the onlyphytohormone induced in response to Pst. Ethylene and jasmonates are also induced inthis response. The aim of this chapter is to determine the effect of removing SA on thephytohormone-signaling network in Arabidopsis in response to virulent Pst. This willprovide a clearer resolution of the complex relationships between the signaling pathwaysin this system.As a first step into understanding the effect of altered SA production or signaling,levels of basal resistance and the disease phenotypes in four different lines werecompared. These lines are the SA biosynthesis mutant sid2-2, the SA signaling mutantnpr1-1 and the transgenic line NahG that cannot accumulate SA. The infection ofColumbia (wild type), npr1-1, sid2-2 and NahG plants with virulent Pst led to differentialbacterial growth and disease phenotypes in the four lines.NahG supported significantly more bacterial growth than the other lines (Figure 2-1). The mutants sid2-2 and npr1-1 had bacterial growth that was intermediate betweenNahG and the wild type. The sid2-2 mutant is a better model for the loss of SAproduction than NahG due to the side effects of catechol production (Heck et al., 2003).

PAGE 26

15Therefore, as sid2-2 supports the same levels of bacterial growth as npr1-1, thisdemonstrates that the effect of SA on basal resistance is NPR1-dependent (Figure 2-1).The development of disease symptoms showed further differences between the fourlines. Columbia exhibited patchy chlorosis at 48 h post infection (hpi). These patchescoalesced at 96 hpi. NahG showed the most severe symptom development, withwidespread chlorosis followed by complete tissue collapse at 96 hpi. The sid2-2 mutantexhibited less severe symptoms than NahG, with widespread chlorosis and necrosis at 96hpi although it lacked the complete tissue collapse of NahG. The npr1-1 mutantdeveloped chlorosis but not necrosis and had an intermediate phenotype betweenColumbia and sid2-2. These data demonstrate that although sid2-2 and npr1-1 showedthe same level of basal resistance, sid2-2 exhibited necrosis and tissue collapse that didnot occur in npr1-1 under these conditions. This result indicates that the effect of SA onrepressing necrosis and tissue collapse is NPR1-independent. Figure 2-1 Bacterial growth in Pst DC3000 infected Arabidopsis. Columbia, npr1-1,sid2-2 and NahG were dip infected with Pst DC3000. Colony forming unitsper square centimeter were determined at the time points indicated.

PAGE 27

16The expression of the PR genes PR1 and PDF 1.2 was monitored during diseaseprogression in all four lines. PR1 was induced in Columbia and slightly induced at 96 hpiin npr1-1 but was not induced in the SA-deficient lines. PDF1.2 was induced to a similarextent in all lines upon pathogen infection (Figure 2-2). The reduction in PR1 geneexpression in NahG and sid2-2 is consistent with that seen upon infection with avirulentPst (Nawrath and Metraux, 1999) and the loss of localized expression of PR genes innpr1-1 as demonstrated by Cao et al. (1994). Consistent with my findings, PDF1.2expression was unaltered in NahG and sid2-2, when compared to wildtype, in response toinfection with Alternaria brassicicola (Nawrath and Metraux, 1999). Figure 2-2 PR1 and PDF1.2 gene expression in Pst infected Arabidopsis. Total RNA wasextracted from Columbia, npr1-1, sid2-2 and NahG plants dip infected withPst DC3000. Northern blot analysis was performed with 32P labeled PR1 andPDF1.2 on plants that were mock inoculated, or 48 and 96 hours postinfection.

PAGE 28

17SA and Jasmonate Induction in Response to Pst InfectionThe study of the effect of removal of SA accumulation or perception on theinduction of other hormones was the focus of this chapter. Therefore the pattern of SAinduction in the different lines was confirmed. SA levels increased during infection in theColumbia and npr1-1 lines, with npr1-1 accumulating significantly more SA thanColumbia. This is consistent with the results of Clarke et al. (2000), who demonstratedthat npr1-1 produces more SA than Columbia. SA remained at a low level in NahG andsid2-2 consistent with the findings of Nawrath and Metraux (1999) (Figure 2-3). Figure 2-3 SA production in Pst infected Arabidopsis. Columbia, npr1-1, sid2-2 andNahG dip infected with Pst DC3000. SA was measured at the time pointsindicated.The jasmonate response of a plant can be described in terms of an oxylipinsignature consisting of different forms of JA and its precursors (Kramell et al., 2000). Topartially characterize this oxylipin signature in Arabidopsis infected with Pst, theinduction of jasmonic acid (JA) and its active precursor 12-oxo-phytodienoic acid(OPDA) was measured. Both JA and OPDA were induced in all four lines. The highestamounts of induction were observed in NahG and sid2-2, followed by npr1-1 with

PAGE 29

18Columbia producing the lowest amounts of these jasmonates (Figure 2-4). It has beendemonstrated by Heck et al. (2003) that Pst infection leads to higher JA levels in sid2-2and NahG than in wild type Arabidopsis. Here, it can be seen that OPDA follows theprofile of JA expression and jasmonate production in npr1-1 is intermediate betweenthose of the SA-deficient lines and wild type. Figure 2-4 JA and OPDA production in Pst infected Arabidopsis. Columbia, npr1-1,sid2-2 and NahG were dip infected with Pst DC3000. The amount of (A) JAand (B) OPDA was quantified at the time points indicated.

PAGE 30

19The Effect of Coronatine Production by PstJasmonate accumulation was higher in Arabidopsis that showed enhancedsusceptibility due to SA-deficiency. Therefore, jasmonate signaling may also reducedefense responses. Pst produces the phytotoxin coronatine that is a mimic of OPDA andmay act by stimulating jasmonate responses (Weiler et al., 1994). The total jasmonateresponse consists of jasmonates and coronatine. Therefore, coronatine accumulationduring infection in the different lines was measured. NahG had a significantly higherlevel of coronatine accumulation than sid2-2, npr1-1 and Columbia (Figure 2-5). Figure 2-5 Coronatine production in Pst infected Arabidopsis. Columbia, npr1-1, sid2-2and NahG were dip infected with Pst DC3000. Coronatine was measured atthe time points indicated.Coronatines action as a virulence factor may utilize the jasmonate responsepathways to repress SA. To investigate if coronatines action is SA-dependent, SA-deficient lines were infected with Pst DC3661. Pst DC3661 is a Tn5 mutant that isdisrupted in its ability to produce coronatine (Mittal and Davis, 1995). Bacterial growthwas reduced by a factor of ten in all lines infected with Pst DC3661 compared to those

PAGE 31

20infected with Pst DC3000 but the relative differences in susceptibility between theArabidopsis lines remained (Figure 2-6). Figure 2-6 Bacterial growth at 72 hpi in Pst DC3000 and Pst DC3661 infectedArabidopsis. Columbia, npr1-1, sid2-2 and NahG were dip infected with Pst.The amount of bacteria in the tissues was determined at the time pointsindicated.Disease symptom development was also reduced in all lines infected with PstDC3661 when compared to those infected with Pst DC3000 (Figure 2-7). However, thecomparative severity of the disease in the different lines remained the same. These resultswere confirmed with an additional coronatine-deficient Pst mutant, Pst DC3118 (Moore,1989; Ma et al., 1991). These data demonstrate that coronatines action is independent ofSA, as coronatine-deficiency still reduced virulence on SA-deficient lines. These dataindicate that the JA and SA pathways act in an independent manner in the control of basalresistance.

PAGE 32

21 Figure 2-7 Disease symptom development in Pst infected Arabidopsis. Columbia, npr1-1, sid2-2 and NahG plants were dip infected with wild type Pst (DC3000) orcoronatine-deficient Pst (DC3661). Photographs were taken 96 hpi.

PAGE 33

22The Role of Ethylene in SA-Deficient ArabidopsisRecent work has demonstrated that the catechol produced by NahG has side effectsin the NahG plant that are not due to the loss of SA (Heck et al., 2003). NahG had beenused to demonstrate an agonistic relationship between SA and ethylene in the interactionbetween Arabidopsis and Xcc (O'Donnell et al., 2003). To verify this relationship in sid2-2 and to investigate the role of NPR1 in this interaction, ethylene evolution in response toPst infection was measured.Ethylene was induced to similar levels at 48 hpi in Columbia and npr1-1 indicatingthat the control of ethylene synthesis by SA is NPR1-independent. A large increase inethylene, also at 48 hpi, was observed in sid2-2. NahG showed no induction of ethyleneduring disease progression (Figure 2-8). These results indicate that catechol or its furthermetabolites suppress ethylene production and that there is an antagonistic relationshipbetween the synthesis of SA and ethylene, rather than the agonistic relationship suggestedby the NahG phenotype. These results are also consistent with the observation thatethylene insensitive plants synthesize more SA than wild type plants following pathogeninfection (O'Donnell et al., 2003).To investigate if it was this suppression of ethylene signaling that caused thedifferences in disease symptoms between sid2-2 and NahG, plants were treated with theethylene inhibitor 1-methylcyclopropene (MCP) 24 hours prior to infection and theresultant effects on disease were assessed. MCP blocks ethylene binding to it receptors,thus inhibiting its perception (Sisler and Serek, 1997). No differences in diseasedevelopment between those plants treated with MCP and untreated plants were observed(data not shown). These data indicate that although ethylene production is inhibited in

PAGE 34

23NahG, this absence of ethylene is not responsible for the enhanced disease phenotypeobserved in NahG plants relative to sid2-2. Figure 2-8 Ethylene production in Pst infected Arabidopsis. Columbia, npr1-1, sid2-2and NahG were dip infected with Pst DC3000. Ethylene production wasmeasured at the time points indicated.DiscussionThe effect of an inability to accumulate SA on the induction of ethylene andjasmonates during the interaction between Arabidopsis thaliana and the virulent bacterialpathogen Pst DC3000 was investigated. Two lines that do not accumulate SA duringinfection (NahG and sid2-2) were used to determine these effects. The effects of SA onethylene and jasmonates accumulation are believed to be NPR1-dependent (Clarke et al.,2000). Consequently the levels of ethylene and jasmonates in npr1-1, following infectionwere also measured.In accordance with previous reports (Cao et al., 1994; Delaney et al., 1994;Nawrath and Metraux, 1999) an enhanced susceptibility to Pst in NahG, sid2-2 and npr1-1 was observed, with more severe symptom development in NahG and sid2-2 than innpr1-1. This result correlates with the partial loss of SA signaling in npr1-1 compared to

PAGE 35

24the other two lines. NahG displayed a rapid and complete tissue collapse that did notoccur in sid2-2. NahG also supported more bacterial growth than sid2-2, although bothwere more susceptible to Pst than Columbia. This result, coupled with the recent dataproposing side effects in NahG associated with catechol (Van Wees and Glazebrook,2003), led to the comparasion of the NahG and sid2-2 lines for effects on ethylene andjasmonate accumulation.As has been reported previously, the SA levels in NahG and sid2-2 are roughlyequivalent following Pst infection (Nawrath and Metraux, 1999). The massive increase ofSA in npr1-1 compared to that of Columbia is probably due to a loss of feedbackinhibition on SA synthesis that relies on an NPR1-dependent SA pathway (Clarke et al.,2000).As well as SA, jasmonates have been reported to play a role in disease with both JAand its precursor OPDA believed to be active signaling compounds (Stintzi et al., 2001).It was therefore determined how the removal of SA affected the induction of thesejasmonates following infection. In Columbia, both JA and OPDA increase followinginfection. In the SA-deficient lines an increase in jasmonates was observed compared towild type, with NahG and sid2-2 producing the most jasmonates. npr1-1 producedintermediate jasmonate levels. This suggests that SA represses jasmonate production in apartially NPR1 dependent manner. As NahG and sid2-2 produce similar levels ofjasmonates catechol is unlikely to affect jasmonate production. The enhancedsusceptibility of SA-deficient Arabidopsis to Pst may be due to the combined effects ofreduced SA and increased jasmonates.

PAGE 36

25The use of PR gene expression is often used to investigate the roles of specificphytohormones in plant pathogen interactions. In order to determine the degree that twoof these markers represented the levels of the phytohormones produced, the expression ofPR1 and PDF1.2 was determined in the different lines during infection. The expression ofPR1 is absent in accordance with the loss of SA accumulation in both sid2-2 and NahG.It is also much reduced in npr1-1 when compared to Columbia. These results demonstratethat the loss of SA accumulation in these lines is sufficient to prevent the induction of SAresponse pathways and that PR1 is a good marker of SA signaling.There was also an induction of PDF1.2 to a similar extent in all lines. PDF1.2requires the activation of both ethylene and JA response pathways to be induced inresponse to Alteranria brassicicola (Penninckx et al., 1998). PDF1.2 is not visible insid2-2 or NahG at 96hpi due to the poor quality RNA obtained from this highly necrotictissue. These data indicate that although the absence of SA affects the levels of ethyleneand jasmonates this is not necessarily reflected in the expression of all downstream genes.This indicates that marker genes may not always be the best approach to mappinghormone networks.The production of coronatine by Pst in the different Arabidopsis lines wasmeasured to further study the relationship between SA and jasmonates. Coronatine is anon-host specific phytotoxin whose biological effects include induction of leaf chlorosis(Mittal and Davis, 1995). It has been suggested to act as a mimic of OPDA (Weiler et al.,1994). Coronatine production was observed in all of the lines infected with Pst, with themost production occurring in NahG. The coronatine levels were different to those ofjasmonates. This suggests that coronatine acts via jasmonate signaling rather than by

PAGE 37

26stimulating jasmonate biosynthesis. The production of coronatine was the same in sid2-2as Columbia so it is not directly related to bacteria levels. This suggests that host factorsor bacteria thresholds must be present to stimulate coronatine production.To determine if coronatine affects SA-dependent basal resistance, the lines wereinfected with the coronatine-deficient mutants Pst DC3661 and Pst DC3118. All linesinfected with coronatine-deficient Pst had reduced bacterial growth compared with thoseinfected with Pst DC3000 and consequently developed less severe disease symptoms.However, the relative differences in susceptibility between the lines remained. Thisindicates that role of coronatine as a virulence factor is independent of SA, as SA-deficient lines still show an enhanced susceptibility to coronatine-deficient Pst despite itsreduced virulence. It is then both the accumulation of coronatine and the loss of SAsignaling that lead to the severe disease phenotype observed in the SA deficient linesupon infection with Pst.Ethylene synthesis is transient during the post-infection period, peaking around 48hpi in Columbia in response to Pst. This induction does not occur in NahG. The fasterdevelopment of chlorosis in the ethylene insensitive mutant etr1-1 in response to Xccinfection (O'Donnell et al., 2003) suggests that ethylene is required to slow thedevelopment of chlorosis. The growth of Xcc in etr1-1 remains unchanged indicating thatethylene does not play a direct role in limiting pathogen growth in this interaction. As theArabidopsis response to Pst and Xcc are similar, it can be concluded that ethylene doesnot play a major role in basal resistance to either pathogen.A major difference between the two SA-deficient lines with respect to this ethyleneinduction was observed, with sid2-2 showing a two-fold increase in ethylene induction at

PAGE 38

2748 hpi relative to Columbia. These data agree with the recent study by Heck et al. (2003).The completely opposite nature of this response in NahG when compared to sid2-2suggests that catechol or a further metabolite negatively affects ethylene production.However, the treatment of sid2-2 and NahG with the ethylene inhibitor MCP beforeinfection caused no change in their respective phenotypes. This suggests that althoughethylene may play a role in fine-tuning the disease response in Arabidopsis, it is notresponsible for the difference in susceptibility between sid2-2 and NahG. Thesuppression of ethylene production by catechol in NahG therefore is independent of thechanges in susceptibility and disease phenotype.These data indicate that NahG is not always an appropriate model for studying therole of SA induction in plant-pathogen interactions. They also demonstrate anantagonistic relationship between SA and ethylene in this system, as the removal of SAincreases ethylene synthesis. As no difference in ethylene induction in npr1-1 comparedwith Columbia was observed, it might also be concluded that the effect of SA on ethyleneis NPR1-independent.

PAGE 39

28CHAPTER 3SYSTEMIC ACQUIRED TOLERANCE IN TOMATOIntroductionPathogens have a high negative impact on agriculture. In 1993, for example, anestimated 12% of crops were lost to disease (Agrios, 1997). The application of chemicalssuch as fungicides help to limit the damage they cause. However, utilizing plant defenseresponses remains an important research area for the limiting pathogen damage. Forinstance application of Benzothiadiazole stimulates plant defense responses and inducesresistance to several pathogens (Lawton et al., 1996). Infected plants can in manyinstances limit the extent of pathogen growth and symptom development. Resistanceoccurs via an incompatible interaction and results in rapid activation of defense responsesthat limit pathogen growth (Alfano and Collmer, 1996; Hammond-Kosack and Jones,1996). These responses include: strengthening of cell walls with hydroxy-Proline-richglycoproteins (Showalter et al., 1985), callose (Parker et al., 1993) and lignin(Moerschbacher et al., 1990); rapid expression of PR proteins (Linthorst, 1991); and thesynthesis of antimicrobial compounds (Hain et al., 1993; Epple et al., 1995; Penninckx etal., 1996).Tolerance is the repression of symptom development without restricting pathogengrowth. The visible phenotype of the two responses is similar. Resistance is a well-studied phenomenon yet tolerance remains an enigma. Tolerance has been identified inseveral phytohormone compromised plant lines. One of these is the ethylene-insensitiveein2 mutant of Arabidopsis, which has increased tolerance to several virulent bacterial

PAGE 40

29pathogens (Bent et al., 1992). Increased tolerance has also been demonstrated to virulentXcv in ethylene and SA-deficient tomato lines (Lund et al., 1998; O'Donnell et al., 2001).Disease development in tomato infected with virulent Xcv can be defined in twostages: primary and secondary disease development. Primary disease developmentconsists of localized lesion formation and it is unaltered in the tolerant lines. Secondarydisease development consists of chlorosis and necrosis that spreads from the primarylesions. These secondary disease symptoms require the cooperative action of ethyleneand SA and are abolished in tolerant lines. It remains a mystery why the plant retainsthese responses and thus increases the amount of tissue damage. Organized necrosis mayhelp the plant withdraw nutrients from the infected tissue. The phytohormones may alsobe required for the induction of a systemic response that allows the plant as a whole torespond to the increased pathogen presence. While tolerance due to phytohormones-deficiency might be a valuable outcome foragriculture, it is likely to have costs. Ethylene and SA are involved in many plant-pathogen interactions. For instance, ethylene is necessary for resistance to certain fungalpathogens and for the generation of induced systemic resistance (Knoester et al., 1998;Knoester et al., 1999). SA is necessary for resistance to avirulent pathogens and thegeneration of SAR in several species (Gaffney et al., 1993). SAR is the activation ofsystemic defense responses that occurs due to the formation of necrotic lesions (Ryals etal., 1996). The hypersensitive response during an incompatible interaction and tissuedeath during a compatible interaction can both induce SAR (Hunt and Ryals, 1996). SARresults in the development of a broad-spectrum, systemic resistance. It is not effectiveagainst, or induced by, all pathogens. For example, the infection of Arabidopsis with

PAGE 41

30Botrytis cinerea fails to induce SAR and inoculations with Pseudomonas syringae doesnot affect B. cinerea challenge (Govrin and Levine, 2002). In tomato SAR is induced bypathogens such as tobacco necrosis virus and Phytophthoria infestans (Enkerli et al.,1993; Jeun et al., 2000).It is important to understand the roles of phytohormones in systemic responses, asthe loss of these responses could reduce any advantage gained by reduced symptomdevelopment due to engineered ethylene or SA-deficiency, I focus here on tomato, as theabsence of ethylene and SA causes tolerance to virulent Xcv. The systemic response intomato to this pathogen has not been previously examined. I investigate if Xcv is capableof inducing systemic responses in tomato and possible roles of SA and ethylene in itsgeneration and action. To avoid confusion I will use the term inoculation for the firsttreatment of a tomato plant and the term challenge for the subsequent treatment ondistal leaves. I demonstrate that both virulent and avirulent Xcv generate a systemicresponse in tomato. I show that both virulent and avirulent Xcv cause an SA and ethylene-dependent PR gene induction and sensitize systemic defense responses. However, incontrast to the well-established SAR, the Xcv-induced response generates tolerance tosubsequent challenge with virulent Xcv. I term this response systemic acquired tolerance(SAT) and define it as prior pathogen exposure reducing necrosis in response to virulentpathogen infection in distal tissues without affected pathogen growth. SAT involves arapid increase in both PR gene expression and ethylene production in response tosubsequent challenges with virulent Xcv.

PAGE 42

31Virulent and Avirulent Xcv Led to Systemic Acquired Tolerance in TomatoTo investigate systemic responses to Xcv, wild type tomato plants at the three-leafstage were mock inoculated, inoculated with virulent Xcv strain 93-1 or avirulent Xcvstrain 87-7 (Bonas et al., 1993) on their lowest two leaves. The inoculations were thenpermitted to run their full course of around 14 days, at which point those leavesinoculated with virulent Xcv were fully necrotic and those inoculated with avirulent Xcvhad developed lesions associated with the hypersensitive response (Figure 3-1A). Figure 3-1 Symptom development of Xcv infected tomato. (A) Representative diseasesymptoms at 16 dpi of wild type tomato plants inoculated with avirulent andvirulent Xcv and (B) symptoms resulting from challenge with virulent Xcv.

PAGE 43

32To determine if this inoculation with Xcv affected responses to subsequentpathogen exposure, a challenge was performed with virulent Xcv on uninoculatedsystemic leaves. Prior inoculations with either virulent or avirulent Xcv, but not mockinoculations, reduced the necrotic development resulting from the challenge (Figure 3-1B). The primary symptoms such as lesion formation were unaffected and secondarysymptom development such as chlorosis and some confluent necrosis were still apparent.The major difference in secondary symptom development during challenge was reducednecrosis in plants with prior Xcv inoculation.As the response consists of two independent interactions between two biologicalentities a high degree of variation is to be expected. With this in mind the level ofnecrosis was determined in large population groups by measuring ion leakage at 16 daysafter challenge (Figure 3-2). Figure 3-2 Cell death due to challenge of tomato with virulent Xcv. Cell death wasmeasured in the form of percent ion leakage in plants with a mock challengeor challenged with virulent Xcv. The plants were exposed to a mockinoculation or inoculation with virulent (vir) or avirulent (avr) Xcv prior tochallenge.

PAGE 44

33Percent ion leakage, an indicator of cell death, was two-fold higher uponchallenge in plants previously mock inoculated than those with prior Xcv inoculations. Incontrast to previously mock-inoculated plants there was no significant difference betweensymptoms in plants with prior virulent or avirulent inoculations upon challenge withvirulent Xcv. The reduction of symptom development due to previous pathogen exposureis consistent with SAR generation. Bacterial growth measurements confirmed resistanceto avirulent Xcv but not virulent Xcv, as growth of avirulent Xcv was 10-fold lower thanthat of virulent Xcv (Figure 3-3A). Figure 3-3 Bacterial growth during inoculation and challenge of tomato with Xcv. (A)The growth of virulent (vir) and avirulent (avr) Xcv was measured duringinoculations. (B) A challenge with virulent Xcv was then performed on theseplants and mock-inoculated controls and the bacterial growth was measured.

PAGE 45

34When bacterial populations in challenge infections were determined there was nodifference in bacterial growth due to prior inoculation with either virulent or avirulentXcv compared with plants with prior mock inoculations (Figure 3-3B). This result leadsto the conclusion that avirulent and virulent Xcv induced SAT rather than SAR, as theyreduced symptom development but not bacterial growth due to challenge with virulentXcv. As to my knowledge SAT has not been previously described I defined it as the priorexposure to a pathogen leading to reduced necrosis development in response tosubsequent challenge with a virulent pathogen in distal tissues.Prior Inoculation with Xcv Led to an Early Production of Ethylene upon Challengewith Virulent XcvEthylene and SA are involved in the development of systemic responses in severalplants. Ethylene and SA were measured during inoculation and challenge with Xcv.Inoculation with virulent Xcv led to ethylene production in local tissues at 5 days postinfection (dpi), while avirulent Xcv caused a greater induction of ethylene at 4 dpi (Figure3-4A). Virulent Xcv induced SA at 10 dpi, while avirulent Xcv induced SA at 4 dpi thatpeaked at 10 dpi (Figure 3-4B). The induction of ethylene and SA was later and atreduced magnitude in response to virulent Xcv than avirulent Xcv. No systemicproduction of ethylene was observed in response to primary Xcv inoculations and at 16dpi no systemic induction of SA was observed in plants inoculated with Xcv (data notshown).Loss of secondary disease symptoms occurs in virulent Xcv-infected ethylene or SAdeficient tomato plants (Lund et al., 1998; O'Donnell et al., 2001). Therefore it is possiblethat SAT might similarly be the result of reduced phytohormone synthesis duringchallenge. To determine if SAT was due to loss of ethylene or SA, their accumulation

PAGE 46

35following challenge with virulent Xcv was determined. Results indicated that thetolerance associated with SAT is not due to reduced ethylene or SA accumulation.Instead, earlier ethylene induction upon challenge accompanies SAT (Figure 3-4). Figure 3-4 Local ethylene and SA production during inoculation and challenge of tomatowith Xcv. Tomato plants were mock inoculated or inoculated with virulent(vir) or avirulent (avr) Xcv and (A) ethylene and (B) SA were measured.Fourteen days later a challenge with virulent Xcv was performed onuninfected leaves and (C) ethylene and (D) SA induced by the challenge wasmeasured.

PAGE 47

36The ethylene induction in response to a challenge with virulent Xcv, following priormock inoculation, reached its maximum at 10 dpi. However, plants with prior Xcvinoculations produced additional ethylene around 5 dpi when challenged (Figure 3-4C).Although at a reduced magnitude, this induction resembles a response to avirulent Xcv.Challenge with virulent Xcv caused ethylene induction at 8 to 10 dpi in all plants, themagnitude of which was dependent on the prior inoculation. Plants with prior avirulentXcv inoculation produced the most ethylene when challenged. This ethylene inductionwas lower in plants with prior virulent Xcv inoculations and lowest in the mock-inoculated controls. However, the significant difference remains the early ethyleneinduction that is only present in plants with prior Xcv inoculations.Plants with prior mock or virulent Xcv inoculations produced similar SA inductionprofiles in response to challenge with virulent Xcv. However, a reduction in SAproduction was observed in plants with a prior avirulent Xcv inoculation. These plantsalso produced an early SA peak (Figure 3-4D) that resembled the response to avirulentXcv although reduced in magnitude. The following production of SA was delayed andresembled that caused by virulent Xcv although at reduced magnitude.The difference in SA production during a challenge and the increased strength andspeed of phytohormone induction during prior inoculations had no effect on the overallSAT phenotype. Therefore the early induction of ethylene upon challenge in plants withprior Xcv infections correlates with the tolerant phenotype, whereas SA induction doesnot. Despite the lack of correlation between SA induced during challenge and SAT, SAand ethylene induction during inoculation may be required for systemic signal formation.

PAGE 48

37PR Gene Expression Indicated the Necessity of Ethylene and SA in Systemic SignalGenerationAs ethylene or SA-deficient plants develop less secondary disease symptoms dueto virulent Xcv than plants displaying SAT, a direct approach to determining their role inSAT is difficult. Therefore PR gene expression was assayed instead of ion leakage as amarker for defense responses in phytohormone-deficient plants. To determine if ethyleneand SA are necessary for systemic signal transduction, two transgenic lines altered intheir ability to accumulate ethylene or SA were used. Loss of ethylene was achieved withtransgenic ACD plants. These plants do not accumulate the ethylene precursor ACC andthus under-produce ethylene. The ACD line was compared to its isogenic parent UC82B.The role of SA was determined using transgenic tomato plants expressing the bacterialsalicylate hydroxylase, nahG that cannot accumulate SA. The NahG line was comparedto its isogenic parent Money Maker (MM).Induction of PR genes is often used as an indicator of early defense responses.They show both local and systemic induction during SAR (Ward et al., 1991). Theexpression of PR1a and PR1b was induced in the local and systemic tissues of tomatoduring infection with virulent Xcv (Figure 3-5). PR1a expression was lower than PR1b.The local expression of both genes was induced in all lines in response to virulent Xcv.The timing and level of induction of PR1a varied between different cultivars, with anearlier and a greater induction in MM than UC82B. The expression of PR1b was alsohigher in MM than UC82B, although the timing of induction was the same. Whencompared to their isogenic parents, infected ACD and NahG plants had reduced localexpression of both genes. However, this reduction did not affect pathogen growth(O'Donnell et al., 2001).

PAGE 49

38 Figure 3-5 Local and systemic PR gene induction in ethylene and SA-deficient tomatolines in response to inoculation with virulent Xcv. Ethylene-deficient ACD,SA-deficient NahG and their isogenic parents were inoculated with virulentXcv. PR1a and PR1b expression levels were determined by real time RT-PCRin local and systemic tissues.

PAGE 50

39Virulent Xcv induced systemic expression of both genes in MM and UC82B. InMM systemic induction of PR1a and PR1b occurred at the same time, whereas in UC82Bthe expression of PR1b was later than PR1a. ACD and NahG did not show significantsystemic induction of PR gene expression in response to virulent Xcv. Disease symptomsin ACD and NahG are comparable to their isogenic parents up to 8 dpi (O'Donnell et al.,2001). As widespread necrosis does not occur before 8 dpi the lack of systemic PR geneexpression is due to loss of ethylene and SA accumulation rather than the loss ofwidespread necrosis in these lines. This lack of systemic PR gene induction indicates thatethylene and SA-deficient lines might be compromised in their systemic signaltransduction. However, the tolerant phenotype of these lines makes direct investigationdifficult.In UC82B systemic PR gene induction occurred within 6 dpi, whereas the majorlocal phytohormone induction occurred at 8 to 10 dpi in response to virulent Xcv.Measurable phytohormone induction, therefore, was not responsible for systemic PRgene induction. Direct damage to cells infected by the pathogen may cause local ethyleneand SA production limited to cells that are under attack. This phytohormone productionmay be involved in the induction of both local and systemic defense responses.Avirulent Xcv Induced Greater Local and Systemic PR Gene Expression thanVirulent Xcv, but they Result in Similar PR Gene Induction During ChallengeThe induction of ethylene and SA is more rapid in response to avirulent thanvirulent Xcv, yet the resulting systemic response to these two pathogens is the same. Todetermine if the early defense responses follow this trend, induction of PR geneexpression by avirulent and virulent Xcv inoculations was assayed. Avirulent Xcv inducedhigher levels and earlier local expression of PR genes than virulent Xcv (Figure 3-6). The

PAGE 51

40timing of systemic PR1b induction was similar in response to either pathogen, butsystemic PR1a induction was faster in response to avirulent Xcv. Faster and stronger localPR gene response to avirulent than virulent Xcv may reflect the increased defenseresponses that limit pathogen growth.Prior avirulent and virulent Xcv inoculations produced the same induction ofethylene and changes in symptom development during challenge. The levels of PR geneexpression were assayed to determine if increased systemic PR gene expressiontranslated into stronger PR gene induction upon challenge. The difference between thetwo prior Xcv inoculations in PR gene expression upon challenge was negligible. Bothcaused an early peak of PR gene expression at 1 dpi upon challenge that was absent inplants with prior mock inoculation (Figure 3-7). These results are consistent with therapid ethylene induction following challenge. These results lead to the hypothesis thatinoculation with Xcv primed the systemic defenses and caused a faster induction ofdefense responses upon challenge. This primed defense response led to the formation oftolerance upon challenge.DiscussionIn this chapter the systemic responses of tomato to both virulent and avirulent Xcvwere studied. A primary infection with virulent Xcv led to local as well as ethylene andSA-dependent systemic PR gene induction within 6 dpi. PR gene induction occurredprior to measurable ethylene or SA induction, indicating that undetectable localizedethylene and SA production occurred within days of infection with virulent Xcv and ledto the generation of a systemic signal. The systemic signal, as well as inducing PR geneexpression, altered the systemic defense response to challenge with virulent Xcv. This

PAGE 52

41altered defense response is tolerance and not resistance. It caused rapid PR geneexpression and ethylene induction in response to subsequent challenge, leading tosuppressed symptom development but not resistance. Figure 3-6 The measurement of local and systemic PR gene expression in tomato duringinoculations with virulent or avirulent Xcv. Wild type (UC82B) tomato plantswere mock inoculated or inoculated with virulent (vir) or avirulent (avr) Xcvand the local and systemic expression of PR1a and PR1b was determined byreal time RT-PCR.

PAGE 53

42 Figure 3-7 Induction of PR genes in tomato plants during challenge with virulent Xcv inthe presence or absence of SAT. Wild type (UC82B) tomato plants were mockinoculated or infected with virulent (vir) or avirulent (avr) Xcv. Fourteen dayslater a challenge was performed with virulent Xcv. The expression of PR1aand PR1b was determined with real time RT-PCR during this challenge.The ability of a plant to send a systemic signal in response to a biological stimulushas long been established. This communication allows separate tissues to act in concert tothe many stimuli they perceive. Systemic signals have been characterized in terms ofresponses to pathogens, symbionts and wounding. SA, ethylene, jasmonates and systeminare all involved in generating systemic signals (Pearce et al., 1991; Gaffney et al., 1993;Pieterse et al., 1998). SA is a key player in SAR in many species (Ryals et al., 1996).NahG plants are unable to mount SAR to bacterial, viral or fungal pathogens (Gaffney etal., 1993; Friedrich et al., 1995; Lawton et al., 1995) and exogenous SA can induce SAR

PAGE 54

43(Ward et al., 1991; Vernooij et al., 1995). However, grafting experiments with NahG andwild type tobacco indicate that although SA is required for SAR it is unlikely to be thetransmitted signal (Vernooij et al., 1994).The role of SA in the systemic responses of tomato may differ somewhat fromthat in other plant species. For example, the induction of SAR in tomato against P.infestans demonstrated neither systemic SA accumulation upon inoculation, nor increasedSA production upon challenge, both of which are common to SAR in other plant species(Jeun et al., 2000). While local induction of SA is observed in response to virulent andavirulent pathogens, its accumulation is only observed after the systemic induction of PRgenes (O'Donnell et al., 2001)In tomato, ethylene and SA are induced in response to both virulent and avirulentXcv, although in neither response are they involved in limiting bacterial growth (Lund etal., 1998; Ciardi et al., 2001; O'Donnell et al., 2001; O'Donnell et al., 2003). Loss ofethylene causes tolerance to virulent Xcv by reducing cell death and lesion size followinginfection with avirulent Xcv. SA loss also leads to tolerance to virulent Xcv. However,loss of SA increases cell death and lesion size in response to avirulent Xcv. Thedevelopment of systemic acquired tolerance to Xcv rather than resistance may be aspecific response to this pathogen and reflect the roles of ethylene and SA in thisinteraction.In agreement with the work of Ciardi et al. (2000), avirulent Xcv induces a rapidand more intense expression of PR genes than virulent Xcv. Here I show that thistranslates into an increased systemic PR gene induction. This increased PR geneexpression coupled with a faster and greater local induction of ethylene and SA may

PAGE 55

44affect SA production during challenge but it has no impact on SAT. Therefore, changesin SA production during challenge are not important for the formation of SAT.Interestingly the work of Jeun et al. (2000) demonstrates that changes in SA induction intomato during challenge with P. infestans are also not necessary for SAR.The PR gene induction and ethylene profiles caused by SAT during challengeresembled those of an incompatible interaction. However, they failed to develop with thespeed and intensity required for successful resistance to develop. Systemic induction ofdefense responses and PR genes that do not lead to SAR have been observed in theinteraction of Arabidopsis and the necrotizing fungal pathogen B. cinerea (Govrin andLevine, 2002). Virulent Pseudomonas syringae pv. tomato also fails to induce SAR inArabidopsis, but in this case there is no systemic induction of PR genes (Cameron et al.,1999). An incompatible-interaction between Arabidopsis and Pseudomonas syringae pv.syringae leads to a reduction of symptom development but no changes in bacterialgrowth during a repeat challenge with the same incompatible pathogen (Summermatter etal., 1995). These data suggest that systemic responses to pathogens exist as a continuumbetween no response, tolerance and resistance.Transgenic tobacco over-expressing PR1a show enhanced tolerance toPeronospora tabacina (Alexander et al., 1993). While tobacco plants deficient in catalaseshow that low level activation of defense responses, including PR gene induction, byH2O2 can lead to enhanced pathogen tolerance, higher H2O2 levels cause resistance(Chamnongpol et al., 1998). These data again suggest that a range of systemic responsesto pathogen invasion occur, with a moderate response repressing symptom developmentand a strong response suppressing both symptom development and pathogen growth.

PAGE 56

45Here I have described the phenomenon of systemic acquired tolerance that adds to theranges of known systemic responses induced by pathogens and suggests that plants arecapable of more diversity in their systemic responses than previously suspected.

PAGE 57

46CHAPTER 4DISCUSSIONPhytohormone Networks in the Responses of Tomato and Arabidopsis to VirulentBacterial PathogensPlant signaling networks utilize ethylene, SA and jasmonates to coordinate defenseresponses. Different plants use these phytohormones in a variety of ways to achieve thesame result. In this chapter I compare and contrast their roles of in the response ofArabidopsis and tomato to infection with virulent bacterial pathogens. Plantscompromised in production or signaling of a phytohormone were used to determine itseffects. However, phytohormones do not act in isolation the levels of one can often affectthe levels of another. Many studies do not look at the effects of altering the synthesis orperception of one phytohormone on others. They therefore cannot address whether thephenotype observed is strictly due to the phytohormone lost.Phytohormone measurements demonstrate if the altered phenotype is due to thecompromised phytohormone or if others may be involved. Table 4-1 shows thephenotypes of Arabidopsis and tomato phytohormone mutants infected with virulentbacterial pathogens. Table 4-2 shows the effect of these mutations or transgenes on theproduction of other phytohormones in response to infection. The Arabidopsis responsesare to virulent Pst and the tomato responses are to virulent Xcv.

PAGE 58

47Table 4-1 Comparative phenotypes of phytohormone mutants in Arabidopsis andtomato. Compatibleinteractions Salicylic acid Ethylene Jasmonates Arabidopsis and Pst Mutants sid2-2 etr1-1 coi 1 and fad3-2 fad7-2 fad8 (fad3) Local phenotype enhancedsusceptibility (1) increased symptoms(2) resistant (coi1)no effect fad3-2 fad7-2fad8)(3) Systemic phenotype normally none (4) ND ND Tomato and Xcv Mutants NahG ACD, Nr AOCas Local phenotype tolerant (5) tolerant (6) resistant (7) Systemic phenotype no SAT (8) no SAT (8) ND References are: 1 (Nawrath and Metraux, 1999); 2 (O'Donnell et al., 2003); 3 (Kloek etal., 2001); 5 (O'Donnell et al., 2001); 6 (Lund et al., 1998); 7 (O'Donnell et al., 2003); 8(chapter 3). ND = not determined.Table 4-2 Comparative phytohormone profiles of Arabidopsis and tomato mutants. Arabidopsis andPst Salicylic acid Ethylene Jasmonates Mutants sid2-2 etr1-1 coi 1 and fad3-2fad7-2 fad8 Salicylic acid none (1) ND increased (coi1)(2) Ethylene increased (3) insensitive (4) ND Jasmonates increased (5) ND insensitive (coi1)(6)none (fad3-2 fad7-2fad8)(7) Tomato and Xcv Mutants NahG ACD, Nr as-AOC Salicylic acid none (8) none (9) none (10) Ethylene normal (11) none (ACD) (9)insensitive (Nr) (12) none (10) Jasmonates normal (10) normal (10) none (13) References are: 1 (Nawrath and Metraux, 1999); 2 (Kloek et al., 2001); 3 (chapter 2); 4(Bleecker et al., 1988); 5 (Heck et al., 2003); 6 (Feys et al., 1994); 7 (McConn andBrowse, 1996); 18 (Oldroyd and Staskawicz, 1998);9 (O'Donnell et al., 2001); 10 (Lundet al., 1998); 11 (O'Donnell et al., 2003); 12 (Lanahan et al., 1994); 13 (Stenzel et al.,2003). ND = not determined.

PAGE 59

48Arabidopsis has many phytohormone mutants including those for SA (sid2-2),ethylene (etr1-1) and jasmonates (fad3-2 fad7-2 fad8 and coi1). The etr1-1 mutant is adominant-insensitive ethylene receptor mutant (Bleecker et al., 1988). The fad3-2 fad7-2fad8 mutant is a loss of function triple mutant of the three fatty acid desaturases. Due toits failure to synthesize linolenic acid, it has reduced jasmonate biosynthesis (McConnand Browse, 1996). The coi1 mutant is a jasmonate-insensitive ubiquitin E3 ligase mutant(Xie et al., 1998). Tomato also has mutants and transgenic lines compromised inphytohormones such as SA (NahG), ethylene (ACD and Nr) and jasmonates (as-AOC).Nr is a dominant ethylene-insensitive receptor mutant (Rick and Butler, 1956). Thetransgenic plant as-AOC is an antisense line of the jasmonate biosynthesis enzyme alleneoxide cyclase (Stenzel et al., 2003).These data allow the construction of signaling network models for these plantpathogen interactions. However, not all phenotype and phytohormone measurementshave been addressed in each system. These models are based on only two sets ofinteractions and may vary greatly in response to different pathogens or in different plantsystems.The Compatible Tomato-Virulent Xcv InteractionA model for the signaling network in tomato in response to virulent Xcv is shown inFigure 4-1. In the interaction of tomato with Xcv the relationship of these phytohormonesappears to be linear, with SA production dependent on ethylene production that is in turndependent on jasmonate signaling (Lund et al., 1998; O'Donnell et al., 2001; O'Donnell etal., 2003).

PAGE 60

49 Figure 4-1 A model for the signaling network in tomato in response to virulent Xcv.As demonstrated in chapter 3, systemic signaling in tomato is dependent uponethylene and SA. Their action appears to precede their measurable induction, in a mannersimilar to JA. JA-deficient lines show a loss of ethylene despite the fact that measurableJA production does not occur until after ethylene production (O'Donnell et al., 2003).This suggests that early, local phytohormone productions can have a profound impact ondisease response.It is clear in the case of the interaction between virulent Xcv and tomato thatjasmonates are the major players when it comes to the formation of susceptibility to Xcv.At the local level the induction of ethylene and SA are required for the formation ofsecondary disease symptoms (O'Donnell et al., 2003). The interaction between tomatoand virulent Pst also requires a functional jasmonate-signaling pathway for full Pstvirulence. This system, however, is strongly influenced by the phytotoxin coronatine(Zhao et al., 2003).The Compatible Arabidopsis-Virulent Pst InteractionSA-deficient Arabidopsis plants produce increased levels of jasmonates andethylene in response to infection with virulent Pst. The prevalent hypothesis forphytohormones in the response of Arabidopsis to pathogens proposes two pathogen-response pathways in Arabidopsis (Glazebrook et al., 2003). One pathway utilizes SA

PAGE 61

50and acts in response to necrotic bacterial pathogens and the other utilizes ethylene andjasmonates, acting in response to fungal and insect pathogens (Penninckx et al., 1998;Vijayan et al., 1998).SA, ethylene and jasmonates are all produced in the interaction betweenArabidopsis and virulent Pst. However, SA limits the production of both ethylene andjasmonates and is the major phytohormone controlling defense responses in thisinteraction. SA represses bacterial growth and thus also the development of chlorosis andnecrosis. Ethylene represses symptom development and jasmonates appear to act byrepressing defense responses.These data suggest that co-ordinate signaling determines the overall response to thepathogen. A combination of SA and jasmonates determine the level of bacterial growthwhile ethylene influences the level of symptom development. It is likely to be the ratiosand timing of the various phytohormone inductions that control the plant responses. Pstuses this network to its advantage by producing the jasmonate mimic coronatine.The reduced virulence of coronatine-deficient Pst on SA-deficient and wild typeArabidopsis demonstrated in chapter 2, suggests that coronatines action as a virulencefactor is SA-independent. Further experiments to confirm this include the measurementof SA in plants infected with coronatine-deficient Pst. Similar SA levels of these plantsand those infected with wild type Pst would support SA-independent coronatine action.The link between jasmonates and susceptibility could also be investigated using T-DNA knock-out mutants in jasmonate biosynthesis genes. A good candidate for this isallene oxide cyclase for which there is a single gene in Arabidopsis (Kubigsteltig et al.,1999; Park et al., 2002). This mutant would be more appropriate than the fad3-2 fad7-2

PAGE 62

51fad8 as it is less likely to affect the levels of other metabolites. These experiments requirethe coronatine-deficient Pst mutant, as coronatine masks jasmonate-deficiency (Kloek etal., 2001). Changes in bacterial growth in these lines would demonstrate if jasmonates aredefinitively involved in repressing defense responses in Arabidopsis.Systemic Responses to InfectionSystemic responses to virulent and avirulent pathogens have been previouslydescribed in both tomato and Arabidopsis, with SA playing a similar role in both plants.In both systems pathogen infections cause a local increase in SA (Nawrath and Metraux,1999; O'Donnell et al., 2001). SA is necessary for the induction of a systemic response,however, it is not itself believed to be the transmitted signal (Vernooij et al., 1994;Lawton et al., 1995). The systemic induction of SA differs between the two systems, asArabidopsis has strong systemic SA induction where as tomato does not (Summermatteret al., 1995). Arabidopsis also shows a strong induction of SA upon challenge that doesnot occur in tomato (Jeun et al., 2000).Ethylene is not required for the induction of SAR in Arabidopsis (Delaney et al.,1994; Lawton et al., 1995). However, both ethylene and SA appear to be involved theinduction of SAT in tomato (Chapter 3). Virulent pathogens can induce systemicresponses in Arabidopsis, however, SAR is not induced by virulent Pst (Cameron et al.,1999). Both avirulent and virulent Xcv induce systemic responses in tomato.Additional experiments are required to confirm the roles of ethylene and SA in thegeneration of systemic signaling in tomato. One approach to this could be the use ofgrafting to determine if a NahG stock is incapable of systemic signaling to a wild type

PAGE 63

52scion. The best approach to this would be to monitor PR gene expression in the scion inresponse to an inoculation of the stock.Further study is required in both systems before the complex roles ofphytohormones in these interactions can be fully understood. It is clear from this studythat information gained from studying one system will not necessarily be applicable toanother system. However, certain parallels and common responses exist. By the study ofa wide range of plant-pathogen interactions the common points and differences can bedetermined. This will eventually lead to a more complete understanding of generaldefense responses, perhaps allowing broad-spectrum engineering or breeding of plantswith increased resistance or reduced symptoms to a wide range of diseases.

PAGE 64

53CHAPTER 5MATERIALS AND METHODSPlant Materials and TreatmentsArabidopsis thaliana Columbia, the NahG line (Delaney et al., 1994), npr1-1 (Caoet al., 1994) and sid2-2 (courtesy of Julia Dewdney), all in the Columbia background,were grown in soil under long night conditions (8-h day; 16-h night) for six weeks toencourage vegetative growth. Forty-eight hours prior to infection, plants were transferredto long day conditions (16-h day; 8-h night). Twelve hours before infection, the plantswere enclosed in a humidity dome to aid bacterial entry. Plants were inoculated with Pstby submerging the aerial parts of the plant in 1x107 cfu ml-1 bacterial suspension,containing 10mM MgCl2 and 0.02% (v/v) Silwet L-77 (Lehle seeds, Round Rock, TX,U.S.A.), for 30 seconds. A vacuum was then applied to the plants for 2 min to aidbacterial entry and the plants were returned to the humidity chamber overnight.Lycopersicon esculentum cvs Moneymaker and UC82B are the parental lines forNahG (Oldroyd and Staskawicz, 1998) and ACD (Klee et al., 1991) respectively. Wildtype refers to UC82B only in all experiments except PR gene analysis of ethylene andSA-deficient lines. Plant growth and treatments were performed under ambienttemperature and lighting in a greenhouse. Plants were inoculated by submersion of theleaves for 15 seconds in a bacterial suspension of 1x107 cfu ml-1 of Xcv strain 93-1(virulent) or 87-7 (avirulent) containing 10mM MgCl2 and 0.02% (v/v) Silwet L-77.Mock inoculations were performed by dipping plants in buffered Silwet. For analysis ofthe systemic response to infection, inoculations were performed on three week-old plants

PAGE 65

54by dipping leaves 1 and 2 in infection media. Challenges were then performed on thesame plant 14 days later by dipping leaves 5 and 6 in the infection media containingvirulent Xcv. For PR gene analysis leaves 1 and 2 of six week-old plants were infectedand tissue from the local infection (leaves 1 and 2) and the systemic response (leaves 5and 6) were removed at the indicated time points and flash frozen in liquid nitrogen.Bacterial CulturePst and Xcv cultures were grown as previously described by ODonnell et al.(2001). Leaf colony counts were determined as previously described by Lund et al.(1998). Briefly, five 1cm2 leaf disks were sampled from each line at each time pointindicated. The disks were ground in 10mM MgCl2, and serial dilutions were incubated atroom temperature for 2 days on solid media. The average colony-forming unit per squarecentimeter (cfu cm-2) for each sample was determined by counting individual colonies.Ion LeakageAmount of cell death was estimated by measuring percentage of ion leakage. At 16dpi the 5th leaf of each plant was placed in 6 ml deionized water and a vacuum of 20 psiapplied for 5 min. The samples were then shaken at room temperature for one hour. 3 mlof the water was then removed and its conductivity was measured. The samples werethen placed in a boiling water bath for an hour and the conductance of the remaining 3 mlof water measured. Percent ion leakage was determined by conductivity of first 3 mldivided by conductivity of second 3 ml multiplied by 100. Measurements of tissuechallenged with virulent Xcv were made from 30 plants per treatment. Measurements onmock challenges were made for 10 plants per treatment. Each experiment was repeatedon at least two independent occasions.

PAGE 66

55Ethylene MeasurementsEthylene measurements were performed on a minimum of three independent biologicalreplicates. Each biological sample was replicated at least three times within anexperiment. Ethylene production was determined by sampling the headspace above eithera whole rosette for Arabidopsis or a single leaf for tomato, enclosed in 5cm3 tubes for 1hour as described by Lund et al. (1998). Ethylene concentration in a 1 ml sample wasdetermined by a gas chromatography (Model 5890, Hewlett-Packard, Palo Alto, CA).SA, Jasmonate and Coronatine MeasurementsSA, jasmonates and coronatine were extracted from Arabidopsis tissue and SAfrom tomato tissue and derivatized using trimethylsilyl-diazomethane. The volatilemethyl esters were collected from the complex matrix using vapor phase extraction andquantified by isobutene chemicalionization gas-chromatography/mass spectrometry asdescribed in Schmelz et al. (2003). Each biological sample was replicated at least twicewith a minimum of two independent experiments.RNA ExtractionTotal RNA was extracted from 1.0g of tissue from each genotype per time pointwith (phenol:chloroform:isoamyl alcohol (PCI) (25:24:1 (v/v/v))) : extraction buffer (1%triisopropylnaphthalene-sulfonic acid (w/v); 6% p-amino salicylic acid (w/v); 0.1M TrispH 8; 50 mM EGTA; 0.1M NaCl; 1% SDS (w/v); 0.039% -Mercaptoethanol (v/v)) (1:1).The extraction mixture was homogenized with a polytron and incubated at 50C for 20min. The phases were separated and an equal volume of PCI added to the aqueous phase.The RNA was precipitated overnight at -80C following the addition of 2.5 volumes ofethanol and 1/10 volume of sodium acetate. The nucleic acids were pelleted bycentrifugation, (14,000 g for 30 min) resuspended in water and precipitated in 2M LiCl.

PAGE 67

56The LiCl precipitation was repeated and a subsequent sodium acetate/ethanolprecipitation performed.RNA Gel Blot AnalysisRNA gel blot analysis was performed using 20 g total RNA for each sample asdescribed by Kneissl and Deikman (1996). The RNA was transferred onto a chargedmembrane (Hybond-N+; Amersham Life Science inc., Arlington Heights, IL). The PR1(Genbank accession AY117187) and PDF1.2 (full length cDNA from gene at5g44420)probes were obtained from The Arabidopsis information resource (Ohio StateUniversity). DNA probes were random primer labeled with 32P with the Prime-It IIlabeling kit (Stratagene, La Jolla, CA).Real-time RT-PCRPR1a (TC117463) and PR1b (TC115947) mRNA levels were quantified by Real-time quantitative RT-PCR using Taqman" one-step RT-PCR reagents (AppliedBiosystems, Foster City, CA) and an Applied Biosystems GeneAmp 5700 sequence-detection system. Each determination was performed using 250ng of Dnase-1 treatedtotal RNA isolated using an RNeasy" Plant mini kit (Qiagen, Valencia, CA), in a 25lreaction volume. RT-PCR conditions were: 48C for 30 min, 95C for 10 min followedby 40 cycles of 95C for 15 sec and 60C for 1 min. Absolute mRNA levels werequantified using synthesized sense strand RNAs as standards. Primers and probes weredesigned using PRIMER EXPRESS software (Applied Biosystems) and were as follows:PR1b probe 5-/56-FAM/CAACGGATGGTGGTTCATTTCTTGCA/3BQH_1/-3; PR1aprobe 5-/56-FAM/TGTGGGTGTCCGAGAGGCCAGA/3BHQ_1/-3;PR1b forwardprimer 5-GGTCGGGCACGTTGCA-3; PR1b reverse primer 5-GATCCAGTT-

PAGE 68

57GCCTACAGGACAT-A-3; PR1a forward primer 5-GAGGGCAGCCGTGCAA-3;PR1a reverse primer 5-CACATTTTTCCACCAACACATTG-3 (Intergrated DNATechnologies, Coralville, IA). Each sample was a minimum of two biological replicatesand each experiment was repeated at least twice.MCP TreatmentMCP treatment was performed 24 hours prior infection as described in Ciardi et al(2000).

PAGE 69

58LIST OF REFERENCESAgrios GN (1988) Plant pathology, Ed 3rd. Academic Press, San DiegoAgrios GN (1997) Plant pathology, Ed 4th. Academic Press, San DiegoAlexander D, Goodman RM, Gut-Rella M, Glascock C, Weymann K, Friedrich L,Maddox D, Ahl-Goy P, Luntz T, Ward E, et al. (1993) Increased tolerance totwo oomycete pathogens in transgenic tobacco expressing pathogenesis-relatedprotein 1a. Proc Natl Acad Sci U S A 90: 7327-7331Alfano JR, Collmer A (1996) Bacterial pathogens in plants: life up against the wall.Plant Cell 8: 1683-1698Ausubel FM, Katagiri F, Mindrinos M, Glazebrook J (1995) Use of Arabidopsisthaliana defense-related mutants to dissect the plant response to pathogens. ProcNatl Acad Sci U S A 92: 4189-4196Bent AF, Innes RW, Ecker JR, Staskawicz BJ (1992) Disease development inethylene-insensitive Arabidopsis thaliana infected with virulent and avirulentPseudomonas and Xanthomonas pathogens. Mol Plant Microbe Interact 5: 372-378Bleecker AB, Estelle MA, Somerville C, Kende H (1988) Insensitivity to ethyleneconferred by a dominant mutation in Arabidopsis-thaliana. Science 241: 1086-1089Bohlmann H, Vignutelli A, Hilpert B, Miersch O, Wasternack C, Apel K (1998)Wounding and chemicals induce expression of the Arabidopsis thaliana geneThi2.1, encoding a fungal defense thionin, via the octadecanoid pathway. FEBSLett 437: 281-286Bonas U, Conradsstrauch J, Balbo I (1993) Resistance in tomato to Xanthomonas-campestris pv vesicatoria is determined by alleles of the pepper-specific avirulencegene Avrbs3. Mol Gen Genet 238: 261-269Cameron RK, Paiva NL, Lamb CJ, Dixon RA (1999) Accumulation of salicylic acidand PR-1 gene transcripts in relation to the systemic acquired resistance (SAR)response induced by Pseudomonas syringae pv. tomato in Arabidopsis. PhysiolMol Plant P 55: 121-130

PAGE 70

59Cao H, Bowling SA, Gordon AS, Dong X (1994) Characterization of an Arabidopsismutant that is nonresponsive to inducers of systemic acquired resistance. Plant Cell6: 1583-1592Cao H, Glazebrook J, Clarke JD, Volko S, Dong X (1997) The Arabidopsis NPR1gene that controls systemic acquired resistance encodes a novel protein containingankyrin repeats. Cell 88: 57-63Chamnongpol S, Willekens H, Moeder W, Langebartels C, Sandermann H, Jr., VanMontagu M, Inze D, Van Camp W (1998) Defense activation and enhancedpathogen tolerance induced by H2O2 in transgenic tobacco. Proc Natl Acad Sci US A 95: 5818-5823Ciardi JA, Tieman DM, Jones JB, Klee HJ (2001) Reduced expression of the tomatoethylene receptor gene LeETR4 enhances the hypersensitive response toXanthomonas campestris pv. vesicatoria. Mol Plant Microbe Interact 14: 487-495Ciardi JA, Tieman DM, Lund ST, Jones JB, Stall RE, Klee HJ (2000) Response toXanthomonas campestris pv. vesicatoria in tomato involves regulation of ethylenereceptor gene expression. Plant Physiol 123: 81-92Clarke JD, Liu Y, Klessig DF, Dong X (1998) Uncoupling PR gene expression fromNPR1 and bacterial resistance: characterization of the dominant Arabidopsis cpr6-1mutant. Plant Cell 10: 557-569Clarke JD, Volko SM, Ledford H, Ausubel FM, Dong X (2000) Roles of salicylicacid, jasmonic acid, and ethylene in cpr-induced resistance in Arabidopsis. PlantCell 12: 2175-2190Cohen Y, Kuc J (1981) Evaluation of systemic resistance to blue mold induced intobacco-leaves by prior stem inoculation with Peronospora-hyoscyami F sptabacina. Phytopathology 71: 783-787Delaney TP, Uknes S, Vernooij B, Friedrich L, Weymann K, Negrotto D, Gaffney T,Gutrella M, Kessmann H, Ward E, Ryals J (1994) A central role of salicylic-acid in plant-disease resistance. Science 266: 1247-1250Despres C, DeLong C, Glaze S, Liu E, Fobert PR (2000) The ArabidopsisNPR1/NIM1 protein enhances the DNA binding activity of a subgroup of the TGAfamily of bZIP transcription factors. Plant Cell 12: 279-290Dewdney J, Reuber TL, Wildermuth MC, Devoto A, Cui J, Stutius LM, DrummondEP, Ausubel FM (2000) Three unique mutants of Arabidopsis identify eds locirequired for limiting growth of a biotrophic fungal pathogen. Plant J 24: 205-218Enkerli J, Gisi U, Mosinger E (1993) Systemic acquired-resistance to Phytophthora-infestans in tomato and the role of pathogenesis-related proteins. Physiol Mol PlantP 43: 161-171

PAGE 71

60Epple P, Apel K, Bohlmann H (1995) An Arabidopsis-thaliana thionin gene is induciblevia a signal-transduction pathway different from that for pathogenesis-relatedproteins. Plant Physiol 109: 813-820Feys B, Benedetti CE, Penfold CN, Turner JG (1994) Arabidopsis mutants selected forresistance to the phytotoxin coronatine are male sterile, insensitive to methyljasmonate, and resistant to a bacterial pathogen. Plant Cell 6: 751-759Friedrich L, Vernooij B, Gaffney T, Morse A, Ryals J (1995) Characterization oftobacco plants expressing a bacterial salicylate hydroxylase gene. Plant Mol Biol29: 959-968Gaffney T, Friedrich L, Vernooij B, Negrotto D, Nye G, Uknes S, Ward E,Kessmann H, Ryals J (1993) Requirement of salicylic-acid for the induction ofsystemic acquired-resistance. Science 261: 754-756Glazebrook J (2001) Genes controlling expression of defense responses in Arabidopsis--2001 status. Curr Opin Plant Biol 4: 301-308Glazebrook J, Chen W, Estes B, Chang HS, Nawrath C, Metraux JP, Zhu T,Katagiri F (2003) Topology of the network integrating salicylate and jasmonatesignal transduction derived from global expression phenotyping. Plant J 34: 217-228Glazebrook J, Rogers EE, Ausubel FM (1996) Isolation of Arabidopsis mutants withenhanced disease susceptibility by direct screening. Genetics 143: 973-982Glazebrook J, Rogers EE, Ausubel FM (1997) Use of Arabidopsis for geneticdissection of plant defense responses. Annu Rev Genet 31: 547-569Govrin EM, Levine A (2002) Infection of Arabidopsis with a necrotrophic pathogen,Botrytis cinerea, elicits various defense responses but does not induce systemicacquired resistance (SAR). Plant Mol Biol 48: 267-276Gupta V, Willits MG, Glazebrook J (2000) Arabidopsis thaliana EDS4 contributes tosalicylic acid (SA)-dependent expression of defense responses: evidence forinhibition of jasmonic acid signaling by SA. Mol Plant Microbe Interact 13: 503-511Hain R, Reif HJ, Krause E, Langebartels R, Kindl H, Vornam B, Wiese W,Schmelzer E, Schreier PH, Stocker RH, Stenzel K (1993) Disease resistanceresults from foreign phytoalexin expression in a novel plant. Nature 361: 153-156Hammond-Kosack KE, Jones JD (1996) Resistance gene-dependent plant defenseresponses. Plant Cell 8: 1773-1791

PAGE 72

61Heck S, Grau T, Buchala A, Metraux JP, Nawrath C (2003) Genetic evidence thatexpression of NahG modifies defense pathways independent of salicylic acidbiosynthesis in the Arabidopsis-Pseudomonas syringae pv. tomato interaction.Plant J 36: 342-352Hunt MD, Ryals JA (1996) Systemic acquired resistance signal transduction. Crit RevPlant Sci 15: 583-606Jackson AO, Taylor CB (1996) Plant-microbe interactions: life and death at theinterface. Plant Cell 8: 1651-1668Jeun YC, Siegrist J, Buchenauer H (2000) Biochemical and cytological studies onmechanisms of systemically induced resistance to Phytophthora infestans in tomatoplants. J Phytopathol 148: 129-140Kinkema M, Fan W, Dong X (2000) Nuclear localization of NPR1 is required foractivation of PR gene expression. Plant Cell 12: 2339-2350Klee HJ, Hayford MB, Kretzmer KA, Barry GF, Kishore GM (1991) Control ofethylene synthesis by expression of a bacterial enzyme in transgenic tomato plants.Plant Cell 3: 1187-1193Kloek AP, Verbsky ML, Sharma SB, Schoelz JE, Vogel J, Klessig DF, Kunkel BN(2001) Resistance to Pseudomonas syringae conferred by an Arabidopsis thalianacoronatine-insensitive (coi1) mutation occurs through two distinct mechanisms.Plant J 26: 509-522Kneissl ML, Deikman J (1996) The tomato E8 gene influences ethylene biosynthesis infruit but not in flowers. Plant Physiol 112: 537-547Knoester M, Pieterse CM, Bol JF, Van Loon LC (1999) Systemic resistance inArabidopsis induced by rhizobacteria requires ethylene-dependent signaling at thesite of application. Mol Plant Microbe Interact 12: 720-727Knoester M, van Loon LC, van den Heuvel J, Hennig J, Bol JF, Linthorst HJM(1998) Ethylene-insensitive tobacco lacks nonhost resistance against soil-bornefungi. Proc Natl Acad Sci U S A 95: 1933-1937Kramell R, Miersch O, Atzorn R, Parthier B, Wasternack C (2000) Octadecanoid-derived alteration of gene expression and the "oxylipin signature" in stressed barleyleaves. Implications for different signaling pathways. Plant Physiol 123: 177-188Kubigsteltig I, Laudert D, Weiler EW (1999) Structure and regulation of theArabidopsis thaliana allene oxide synthase gene. Planta 208: 463-471Lanahan MB, Yen HC, Giovannoni JJ, Klee HJ (1994) The never ripe mutationblocks ethylene perception in tomato. Plant Cell 6: 521-530

PAGE 73

62Lawton K, Weymann K, Friedrich L, Vernooij B, Uknes S, Ryals J (1995) Systemicacquired resistance in Arabidopsis requires salicylic acid but not ethylene. MolPlant Microbe Interact 8: 863-870Lawton KA, Friedrich L, Hunt M, Weymann K, Delaney T, Kessmann H, Staub T,Ryals J (1996) Benzothiadiazole induces disease resistance in Arabidopsis byactivation of the systemic acquired resistance signal transduction pathway. Plant J10: 71-82Linthorst HJM (1991) Pathogenesis-related proteins of plants. Crit Rev Plant Sci 10:123-150Lund ST, Stall RE, Klee HJ (1998) Ethylene regulates the susceptible response topathogen infection in tomato. Plant Cell 10: 371-382Ma SW, Morris VL, Cuppels DA (1991) Characterization of a DNA region required forproduction of the phytotoxin coronatine by Pseudomonas-syringae pv tomato. MolPlant Microbe Interact 4: 69-74McConn M, Browse J (1996) The critical requirement for linolenic acid is pollendevelopment, not photosynthesis, in an Arabidopsis mutant. Plant Cell 8: 403-416Mittal S, Davis KR (1995) Role of the phytotoxin coronatine in the infection ofArabidopsis thaliana by Pseudomonas syringae pv. tomato. Mol Plant MicrobeInteract 8: 165-171Moerschbacher BM, Noll U, Gorrichon L, Reisener HJ (1990) Specific-inhibition oflignification breaks hypersensitive resistance of wheat to stem rust. Plant Physiol93: 465-470Moore RA, Starratt, A.N., Ma, S.-W. (1989) Identification of a chromosomal regionrequired for biosynthesis of the phytotoxin coronatine by Pseudomonas syringaepv. tomato. Can J Microbiol 35: 910-917Nawrath C, Heck S, Parinthawong N, Metraux JP (2002) EDS5, an essentialcomponent of salicylic acid-dependent signaling for disease resistance inArabidopsis, is a member of the MATE transporter family. Plant Cell 14: 275-286Nawrath C, Metraux JP (1999) Salicylic acid induction-deficient mutants ofArabidopsis express PR-2 and PR-5 and accumulate high levels of camalexin afterpathogen inoculation. Plant Cell 11: 1393-1404Niderman T, Genetet I, Bruyere T, Gees R, Stintzi A, Legrand M, Fritig B,Mosinger E (1995) Pathogenesis-related PR-1 proteins are antifungal. Isolationand characterization of three 14-kilodalton proteins of tomato and of a basic PR-1of tobacco with inhibitory activity against Phytophthora infestans. Plant Physiol108: 17-27

PAGE 74

63O'Donnell PJ, Jones JB, Antoine FR, Ciardi J, Klee HJ (2001) Ethylene-dependentsalicylic acid regulates an expanded cell death response to a plant pathogen. Plant J25: 315-323O'Donnell PJ, Schmelz E, Block A, Miersch O, Wasternack C, Jones JB, Klee HJ(2003) Multiple hormones act sequentially to mediate a susceptible tomatopathogen defense response. Plant Physiol 133: 1181-1189O'Donnell PJ, Schmelz EA, Moussatche P, Lund ST, Jones JB, Klee HJ (2003)Susceptible to intolerance--a range of hormonal actions in a susceptibleArabidopsis pathogen response. Plant J 33: 245-257Oldroyd GED, Staskawicz BJ (1998) Genetically engineered broad-spectrum diseaseresistance in tomato. Proc Natl Acad Sci U S A 95: 10300-10305Park JH, Halitschke R, Kim HB, Baldwin IT, Feldmann KA, Feyereisen R (2002) Aknock-out mutation in allene oxide synthase results in male sterility and defectivewound signal transduction in Arabidopsis due to a block in jasmonic acidbiosynthesis. Plant J 31: 1-12Parker JE, Szabo V, Staskawicz BJ, Lister C, Dean C, Daniels MJ, Jones JDG(1993) Phenotypic characterization and molecular mapping of the Arabidopsis-thaliana locus Rpp5, determining disease resistance to Peronospora-parasitica.Plant J 4: 821-831Pearce G, Strydom D, Johnson S, Ryan CA (1991) A polypeptide from tomato leavesinduces wound-inducible proteinase-inhibitor proteins. Science 253: 895-898Penninckx IA, Eggermont K, Terras FR, Thomma BP, De Samblanx GW, BuchalaA, Metraux JP, Manners JM, Broekaert WF (1996) Pathogen-induced systemicactivation of a plant defensin gene in Arabidopsis follows a salicylic acid-independent pathway. Plant Cell 8: 2309-2323Penninckx IAMA, Thomma BPHJ, Buchala A, Metraux JP, Broekaert WF (1998)Concomitant activation of jasmonate and ethylene response pathways is requiredfor induction of a plant defensin gene in Arabidopsis. Plant Cell 10: 2103-2113Pieterse CMJ, van Wees SCM, van Pelt JA, Knoester M, Laan R, Gerrits N,Weisbeek PJ, van Loon LC (1998) A novel signaling pathway controllinginduced systemic resistance in Arabidopsis. Plant Cell 10: 1571-1580Rick CM, Butler L (1956) Cytogenetics of the tomato. Adv Genet 8: 267-382Ryals JA, Neuenschwander UH, Willits MG, Molina A, Steiner HY, Hunt MD(1996) Systemic acquired resistance. Plant Cell 8: 1809-1819

PAGE 75

64Schmelz EA, Engelberth J, Alborn HT, O'Donnell P, Sammons M, Toshima H,Tumlinson JH, 3rd (2003) Simultaneous analysis of phytohormones, phytotoxins,and volatile organic compounds in plants. Proc Natl Acad Sci U S A 100: 10552-10557Seo HS, Song JT, Cheong JJ, Lee YH, Lee YW, Hwang I, Lee JS, Choi YD (2001)Jasmonic acid carboxyl methyltransferase: A key enzyme for jasmonate-regulatedplant responses. Proc Natl Acad Sci U S A 98: 4788-4793Showalter AM, Bell JN, Cramer CL, Bailey JA, Varner JE, Lamb CJ (1985)Accumulation of hydroxyproline-rich glycoprotein messenger-RNAs in response tofungal elicitor and infection. Proc Natl Acad Sci U S A 82: 6551-6555Sisler EC, Serek M (1997) Inhibitors of ethylene responses in plants at the receptorlevel: Recent developments. Physiol Plantarum 100: 577-582Spoel SH, Koornneef A, Claessens SM, Korzelius JP, Van Pelt JA, Mueller MJ,Buchala AJ, Metraux JP, Brown R, Kazan K, Van Loon LC, Dong X, PieterseCM (2003) NPR1 modulates cross-talk between salicylateand jasmonate-dependent defense pathways through a novel function in the cytosol. Plant Cell 15:760-770Stenzel I, Hause B, Maucher H, Pitzschke A, Miersch O, Ziegler J, Ryan CA,Wasternack C (2003) Allene oxide cyclase dependence of the wound response andvascular bundle-specific generation of jasmonates in tomato amplification inwound signalling. Plant J 33: 577-589Stintzi A, Weber H, Reymond P, Browse J, Farmer EE (2001) Plant defense in theabsence of jasmonic acid: The role of cyclopentenones. Proc Natl Acad Sci U S A98: 12837-12842Strobel NE, Ji C, Gopalan S, Kuc JA, He SY (1996) Induction of systemic acquiredresistance in cucumber by Pseudomonas syringae pv syringae 61 HrpZ(Pss)protein. Plant J 9: 431-439Summermatter K, Sticher L, Metraux JP (1995) Systemic responses in Arabidopsisthaliana infected and challenged with Pseudomonas syringae pv syringae. PlantPhysiol 108: 1379-1385Van Loon LC, Van Strien EA (1999) The families of pathogenesis-related proteins,their activities, and comparative analysis of PR-1 type proteins. Physiol Mol PlantP 55: 85-97Van Wees SC, Glazebrook J (2003) Loss of non-host resistance of Arabidopsis NahG toPseudomonas syringae pv. phaseolicola is due to degradation products of salicylicacid. Plant J 33: 733-742

PAGE 76

65Vernooij B, Friedrich L, Goy PA, Staub T, Kessmann H, Ryals J (1995) 2,6-dichloroisonicotinic acid-induced resistance to pathogens without the accumulationof salicylic-acid. Mol Plant Microbe Interact 8: 228-234Vernooij B, Friedrich L, Morse A, Reist R, Kolditz-Jawhar R, Ward E, Uknes S,Kessmann H, Ryals J (1994) Salicylic acid is not the translocated signalresponsible for inducing systemic acquired resistance but is required in signaltransduction. Plant Cell 6: 959-965Vijayan P, Shockey J, Levesque CA, Cook RJ, Browse J (1998) A role for jasmonatein pathogen defense of Arabidopsis. Proc Natl Acad Sci U S A 95: 7209-7214Ward ER, Uknes SJ, Williams SC, Dincher SS, Wiederhold DL, Alexander DC,Ahl-Goy P, Metraux JP, Ryals JA (1991) Coordinate gene activity in response toagents that induce systemic acquired resistance. Plant Cell 3: 1085-1094Weiler EW, Kutchan TM, Gorba T, Brodschelm W, Niesel U, Bublitz F (1994) ThePseudomonas phytotoxin coronatine mimics octadecanoid signalling molecules ofhigher plants. FEBS Lett 345: 9-13Wildermuth MC, Dewdney J, Wu G, Ausubel FM (2001) Isochorismate synthase isrequired to synthesize salicylic acid for plant defence. Nature 414: 562-565Xie DX, Feys BF, James S, Nieto-Rostro M, Turner JG (1998) COI1: An Arabidopsisgene required for jasmonate-regulated defense and fertility. Science 280: 1091-1094Yamamoto S, Katagiri M, Maeno H, Hayaishi O (1965) Salicylate hydroxylase, amonooxygenase requiring flavin adenine dinucleotide. I. Purification and generalproperties. J Biol Chem 240: 3408-3413Zhao Y, Thilmony R, Bender CL, Schaller A, He SY, Howe GA (2003) Virulencesystems of Pseudomonas syringae pv. tomato promote bacterial speck disease intomato by targeting the jasmonate signaling pathway. Plant J 36: 485-499Zhou N, Tootle TL, Tsui F, Klessig DF, Glazebrook J (1998) PAD4 functionsupstream from salicylic acid to control defense responses in Arabidopsis. Plant Cell10: 1021-1030

PAGE 77

66BIOGRAPHICAL SKETCHAnna Block was born on the 13th of May 1978 in Nottingham, England. Shecompleted her GCSEs and A levels at John Mason School in Abingdon, Oxfordshire, in1994 and 1996 respectively. She then went on to receive her masters degree inbiochemistry from the University of Bath in 2000. During her masters degree sheaccomplished two 6-month internships. The first internship was in 1998 for Rhone-Poulenc in Essex and the second in 1999 in the laboratory of Harry Klee at the Universityof Florida. She returned to the University of Florida in 2000 for her doctoral studies inthe plant cellular and molecular biology program


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20110114_AAAADA INGEST_TIME 2011-01-14T15:27:58Z PACKAGE UFE0007381_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 15889 DFID F20110114_AABUHO ORIGIN DEPOSITOR PATH block_a_Page_17.QC.jpg GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
a6a817ffa916f2c0d195e2e6d9277785
SHA-1
066eecd29286a34e00c18cfe43ef82c424dbc863
18884 F20110114_AABTQW block_a_Page_30.QC.jpg
5412a16366ed1598a03a30d6f18b5997
fab2d771f03abaa873de73e0dd9a5c870b5c306f
61966 F20110114_AABUCR block_a_Page_72.pro
7499e41236623594ba790c3e7be2b8cf
198d4e6279852677c728f6bb272795b072ad91f0
104931 F20110114_AABTVT block_a_Page_37.jp2
7aaf1865e7559a46ae4ea50617307bba
752e9419452637d833337aa8a3cf409b0fb5dbb3
24166 F20110114_AABUHP block_a_Page_18.QC.jpg
360cc6a70c7c761fb990ab1ca98d54b5
d211a7a55aaa29e933880ff6613ca47503aae339
917988 F20110114_AABTQX block_a_Page_28.jp2
b66c6d8a12ab70500ead7da4bd99a307
a214b97b255ba4693b9c36bc9223538d9a1cd507
62346 F20110114_AABUCS block_a_Page_73.pro
3be457be65346693c68a2dea1609a002
f88e3a09d79bf92b1494466162453d4a4d2c3a2d
68016 F20110114_AABTVU block_a_Page_38.jp2
80477156a7096983054df15e8c0a947c
83f6f0c126ebf42ccdff353cf339913fc824b5de
20109 F20110114_AABUHQ block_a_Page_19.QC.jpg
bd3632e15ffd1897a29b955caacd0c79
b397f78109fc93c864804c6c6c7c4911edc96acb
61474 F20110114_AABUCT block_a_Page_74.pro
da74df83a78effee2a7b629f17396b07
dd62af86f2669b7523fcd9c19d5ede04fd87cad1
92961 F20110114_AABTVV block_a_Page_39.jp2
8fa3e0c54f2b61bee1ce299e723f07f4
ecfe300439841e5e01a930feb62ed4ed2b155de4
1053954 F20110114_AABTQY block_a_Page_67.tif
405fe1633e159b833df8d4fba089c13d
2b0a7805e47c7fd278b40b3b6e0e6ef0a74f5480
5946 F20110114_AABUHR block_a_Page_19thm.jpg
93d2c512d2357260e66f60016550f207
1a4f03b4efab4de508684e6d8f51f82437606ae9
61030 F20110114_AABUCU block_a_Page_75.pro
aa5be3e96d6eb1edd0bc13817bc7944c
1a4f1958369eb223284fbc3c4483f0f413a20175
109265 F20110114_AABTVW block_a_Page_40.jp2
fe71932a8c62d26c547dba67906ae5e9
ef300e7e2809b406a26868fceb642f5fa09622c7
66429 F20110114_AABTQZ block_a_Page_16.jpg
0ea681cf5cc1530b47057cd432f205a7
51e4f0a6e8938cffb8f9fd9fa1978d4e09a5db65
11782 F20110114_AABUHS block_a_Page_20.QC.jpg
48a0f96622e8609e5e3d804a04f09c0c
f964cc7411c72a95fccd2c4f4d60a2cdc2a0be6a
51865 F20110114_AABUCV block_a_Page_76.pro
73e0fdde6a2837c5f1b2e5f330be3637
1dcf994499974ea60ef275a1429f82424b6694fb
99514 F20110114_AABTVX block_a_Page_41.jp2
63a2d49ce14a769b4231283f951093ec
65333824849c4ff8be5f993ea97c963b1e1f9311
18023 F20110114_AABUHT block_a_Page_21.QC.jpg
992dcb09c51f99e516d82a28fd8bed4d
c78306b4c871d20cc74d2f378fa1c349174d8275
17196 F20110114_AABUCW block_a_Page_77.pro
5272609fde4864ae35eccdf0d06c64a1
c7cea339261df346afe6404b08f8bdf55aeea244
47762 F20110114_AABTTA block_a_Page_38.jpg
a4d59b8ec5df5f8f143e53ed00a66b90
b23f764019547299e2cc7296845bf99fdac4e3f0
1051942 F20110114_AABTVY block_a_Page_42.jp2
65948cda43d53b8146308c18c0bf7390
e7527279b7799e8eec978f9d3d6d5768a73be39c
5484 F20110114_AABUHU block_a_Page_21thm.jpg
b36cd8b7200f079dbc65f09c9dfd1d89
fe3229949f4bf467ad7cb7678a01eff01cc800ca
413 F20110114_AABUCX block_a_Page_01.txt
57b36266c9c5745b749fef90cd85897b
ca9155d6a3e709dc15b20c40f7e75e6ac41a3329
63901 F20110114_AABTTB block_a_Page_39.jpg
0d852503deac66bac5013bd44be89211
ae3fec279c182fe7ba69de275dee95558cac8e13
900688 F20110114_AABTVZ block_a_Page_43.jp2
18f879886de9543776eb888c92357739
a18a2bc133bc543c714039dd0dc12266df622195
2994 F20110114_AABUHV block_a_Page_22thm.jpg
bbc8828859ad6ecc67b1a83b11bcb634
5e756f003d91f7450eebaf805b24ea841f034ae5
72587 F20110114_AABTTC block_a_Page_40.jpg
8add3da75ffb2c5be1414a70510c56a0
05be1dd1b8b318cdd3fb8ccf0cd10a868c322404
22527 F20110114_AABUHW block_a_Page_23.QC.jpg
b3a49347bae7b7862227da571a4e8796
3239341887b2a9d78bcebdc59902767a14d7591e
120 F20110114_AABUCY block_a_Page_02.txt
e1e78a906c0e3da6f48bf3abfff944fb
f1c3957e3470503b3fe5a523152079a8cc068483
66757 F20110114_AABTTD block_a_Page_41.jpg
013fadff60826f612db18cacb2117a2c
56f0995a11bd423d7a2ccee7dccbf9e7e319af1d
25271604 F20110114_AABTYA block_a_Page_21.tif
68f9e4138f6f62d152e699ccbafca333
f9bd8b4e693f0e6e6933b01aa889fd121e4d1c78
F20110114_AABUAA block_a_Page_77.tif
947afdca784bec606d7151bea0409dcc
2787fd06e26bda8d18c8e37e7151d1e59f72cf0d
14220 F20110114_AABUHX block_a_Page_24.QC.jpg
3841dad3d884b3e49d6db63907dd74d3
a856413663627b7905d013e98bbd85df93037c26
210 F20110114_AABUCZ block_a_Page_03.txt
4caa3b6aad9a6691bd8fce01e27747ca
f23a553497fd86373524e26d29b7503fddb2c1c5
52428 F20110114_AABTTE block_a_Page_42.jpg
000457e9ffbf898395b8509c0d37f838
4ca02358f84bc37b7cc3fa03880b0f879cf84133
F20110114_AABTYB block_a_Page_22.tif
3de376a7871897c7de28e735c8ffba13
bed1933fb536a7f247f056606902d881c805edef
8462 F20110114_AABUAB block_a_Page_01.pro
4b5caf05bee37f95b56cece086f1d8db
425832b042fbe35819c8ed71d6cd3fa66b86358c
4121 F20110114_AABUHY block_a_Page_24thm.jpg
588eda3cb6b6198dcc18372e68e17814
272cfb3522c122378bbce70676bae64b17e03db0
62715 F20110114_AABTTF block_a_Page_43.jpg
0ecd179e146239ae31f18b6d0e504c6c
2e6ab7c2392bd7434af8b1a1684b71f70990a8d7
F20110114_AABTYC block_a_Page_23.tif
7a2154f15c03ac118a35a6b582920789
948161d13b345dbe346ec0cf2b47e82ef9dece49
1300 F20110114_AABUAC block_a_Page_02.pro
04fc046b9ead9c560aabc41f5b941635
2634c1c6215d346923bbbc892b325ce4869e26d9
22088 F20110114_AABUHZ block_a_Page_25.QC.jpg
a054b52525f06abaa0affd6fa29cbb30
1eb611f51190af67bd950c7d924667a97cb00b8e
54484 F20110114_AABTTG block_a_Page_44.jpg
a0ed3fa4c906076a6e1c1abd24bfe31f
d4164f951acbd5d2ceb7e3cf8ab37b1ba5982df1
1724 F20110114_AABUFA block_a_Page_60.txt
1976af5dddf822139f5a35bc6924e087
f9c9992438e19b463edf5d8f6d4db0fc10de91dc
F20110114_AABTYD block_a_Page_24.tif
1523d094b14e6a2f5f2e6e660e27306d
5e43aa928ff4e3ec6f935e3c028d5b94d2f6ab28
3391 F20110114_AABUAD block_a_Page_03.pro
dad4bf530d3403e1b0689f16c3d111d6
2148357159420af910d8baa186a5c1b986afec57
71793 F20110114_AABTTH block_a_Page_45.jpg
f71d953175179b6ab940383e544aeb89
7da258a777b90313b424cea44f42bb41b504ef7c
1947 F20110114_AABUFB block_a_Page_61.txt
5de245db6c95607b3b085108169c62cb
b69935331091ae4e1f53dfc37b996c842dd73a09
F20110114_AABTYE block_a_Page_25.tif
f9a2aa43c5bf6a1910823e9fd7f35261
289e6806855ba62d6f1d39b7cede4248986d999a
14921 F20110114_AABUAE block_a_Page_04.pro
ff1998b7ee2db2cce5a3bcc24d0f6e82
cc3f9784357fe5742a110cf2d7b4cc598d826ab0
50178 F20110114_AABTTI block_a_Page_46.jpg
e9ccba50976e831519887b9179e08ca5
32aa86479ece0b5089c7d962efca4f909c7a77f7
1898 F20110114_AABUFC block_a_Page_62.txt
a2a38afd34c972f67bcb654f6bd401c8
ca9d4857805b599a67bf12a40317f3745a4c3cb7
F20110114_AABTYF block_a_Page_26.tif
441b46c6719642ec66f4e4afcfb2828a
888fc89a37c7e35b46f00fdf386c6721378e2b09
57233 F20110114_AABUAF block_a_Page_05.pro
3e619d4a0ef9f3b2603e0a8d7e217165
60ff6067cfcc5ed439ac33cfbe702b1fc12704ec
6821 F20110114_AABUKA block_a_Page_55thm.jpg
5db3e2f3ea667fcf6e8658c426e72209
22b9b60cfb3f93689a50da7ad24b7b9be8083cb3
70000 F20110114_AABTTJ block_a_Page_47.jpg
7e51318ad3e686febc6c02f8c1e271d7
721decdd9c233557a457a8886474ef555e68ccaf
840 F20110114_AABUFD block_a_Page_63.txt
d278177e3a7901a4f6e7cc38e549c39e
2aa41db22e98283a0b99ff72cc6a05d969afb1e7
F20110114_AABTYG block_a_Page_28.tif
a9713e0aa92d233f41582d507f5d2357
ba6d09261f36ae4c0fb267c936d4bb2599c64c47
46857 F20110114_AABUAG block_a_Page_06.pro
95587d3aa1c664767429de10a4788e70
078467e1eab32f129478fae8ad3513b76eae8180
5916 F20110114_AABUKB block_a_Page_56.QC.jpg
51184d6330694415111ed922dfadaab2
697d883017e439a50436a0533a584d04201a36e8
1849 F20110114_AABUFE block_a_Page_64.txt
82bbb73e86955cdd88b723c21e108b9c
aeb56d7b084f88bf97ca540bac53d7c81d81c7de
F20110114_AABTYH block_a_Page_29.tif
fb6583206f4c707677ffa0a9acbfcc59
babc739cda9003143bc511575c0abd25620bfff0
5501 F20110114_AABUAH block_a_Page_07.pro
b689c08183e673997c1323098116dc00
1e6f7bb189eaceaddf2ba757e054298f376657a7
2017 F20110114_AABUKC block_a_Page_56thm.jpg
dd6cb7f71968b30011c5513d900b4ca7
4f6f1153f2d0ca813b742f95533288de77ac4529
71270 F20110114_AABTTK block_a_Page_48.jpg
b24c4a960ed7f02764362a57ea88fa90
a845282072444c70276f704c920807b865674116
1926 F20110114_AABUFF block_a_Page_65.txt
534d5620ea606e4494fc92a392e214af
69e803d0b0c5f0cef03cae6511674bcddb27faf6
F20110114_AABTYI block_a_Page_30.tif
cbac95225c315531808886f198aca38a
2a04538ff3c8785f3de68b0c2504ae919a2d094a
52567 F20110114_AABUAI block_a_Page_08.pro
c4b6cad42ccc8cdc766cd5bc413d6ddc
1c4d48c4cf234baeb1bb0575d14c73adcb8bfed4
23682 F20110114_AABUKD block_a_Page_58.QC.jpg
c806287cfacda051534f3b6c50cc448f
f708ed39cace757dc7d5133d28b45313c5eae490
52097 F20110114_AABTTL block_a_Page_49.jpg
ab3f67e09678e01d0f4220a2d45aab26
78f34e4860eb65dd8abdb73cd1704efce81d5331
1987 F20110114_AABUFG block_a_Page_66.txt
08be7ebc0b93dbf5bbaf65b4fcf5a03b
dd4238ef60241098b71a0bcfe0a6b79daaea3d57
F20110114_AABTYJ block_a_Page_31.tif
425cc6e093ba786fd6e375e801118177
22242e4a240b356f90662857c844ab8e218719a6
7335 F20110114_AABUAJ block_a_Page_09.pro
ead9a73878c0a18091930af535674422
57bd245b3063f966d2fe9c74fd09030eb1cdb8d9
6439 F20110114_AABUKE block_a_Page_58thm.jpg
a9b09597da39970e9b1021012d95c0e4
17e901d2663147e0a075d2d7674a49f143f34a5d
74007 F20110114_AABTTM block_a_Page_50.jpg
40a830e7385993ddf685ffd476b9c817
b70cbd5ec8c24a2e52c0b9993745f93284e20177
1729 F20110114_AABUFH block_a_Page_67.txt
703b558c983eb5b8391e4f92ea71a5b9
e9614fcf7c6bb563de7c33ca55f5f2cc2adae9d6
F20110114_AABTYK block_a_Page_32.tif
b65119a91f4391983ee083a13f5d916a
088d945d5f86d99bcdaad81116c403ae3fe550a0
39126 F20110114_AABUAK block_a_Page_10.pro
7211eee08702add36f286c83b4889eaf
9b2f04bbbf1ddf7fd7e7e6a18c6afa59f7ee5efb
6216 F20110114_AABUKF block_a_Page_59thm.jpg
2e849655706d25b354106f868b8d3975
52b61e50bd711c4773ede3e2229fe0cce0cb93ac
67339 F20110114_AABTTN block_a_Page_51.jpg
a7877910c5c36c690f674ff324f0a711
e9a3cc53d228ccd8254bdbcf87be2f20798f5cf7
476 F20110114_AABUFI block_a_Page_68.txt
a825f6895a03eabf26c6305e5817af4a
3a3490652ba10d830e8f52812a715c251be99f48
F20110114_AABTYL block_a_Page_34.tif
5d507a9b3ff473f578974de7518e0ac4
4fc65d1c8dd2f996c4e08e3261cce1c25b1b7997
4379 F20110114_AABUAL block_a_Page_11.pro
fe883f369a03effb81eb1ad9bdbddd2a
95882db57f2f3dd0ea9d71baf37319786cf8a1e4
6703 F20110114_AABUKG block_a_Page_60thm.jpg
b7f21e89d8e1e7bad3b692d550c0caf5
cb8bb1e8387445072c558810c3878ee7b5593b1d
46067 F20110114_AABTTO block_a_Page_52.jpg
3968ead435a47cb3b919cb47efc82524
ef541f3e0fa1872be50d0317124dcdba76cdf4c6
2000 F20110114_AABUFJ block_a_Page_69.txt
a30e38fdd181a68d844d3c28126d85a7
becb8b79d6f4bce5976cd92b6a9c18adc3363cee
F20110114_AABTYM block_a_Page_35.tif
cacbd96f1582ba1582bfb7f365377a8a
02f4b20539ce64a0a632758f42c116f1e5687af3
38676 F20110114_AABUAM block_a_Page_12.pro
6718ba8de11ed1e004c232545997bf1c
a16e062eafa1b980247e1d8b467e049353e1312e
22831 F20110114_AABUKH block_a_Page_61.QC.jpg
59b2fec2369e80eb3ac46c62ff72455b
2e3964735d907dd96265e337edbf077d55c2a06b
65720 F20110114_AABTTP block_a_Page_53.jpg
03383de85549edaed0a9f63d86f669d0
efdf8cface78e4955ae775ee9ce3af9ed1b73f86
2665 F20110114_AABUFK block_a_Page_70.txt
532f4a75ff2390554e3b027b2e597a45
b033452a2a738e4b1f36f24b02169d3170fb8cba
F20110114_AABTYN block_a_Page_36.tif
41e821a397cdb8a75a4b74fcb0248293
f52c19cab07ee8a9aebfad97540b0c080a57ca8f
47284 F20110114_AABUAN block_a_Page_13.pro
5acbeeb80156d10318c78afdd5339548
3ba99103e8e591dab314af919ed6292e6f1d34b3
6642 F20110114_AABUKI block_a_Page_61thm.jpg
f798eee94074ca8b9175e251a78c61b4
8bbb310f6a485e99a54aaa0e8d476ca6390f4054
68468 F20110114_AABTTQ block_a_Page_54.jpg
b1a44ffe63693554bbb29677e8fe88b5
6917041ea33faa65152e046244a9e3108355348c
2457 F20110114_AABUFL block_a_Page_71.txt
74cdd6fec1ca126c4f9773bff8b748d3
538b1f3cf383715cbbcb5b496a6e0ebb634bf308
F20110114_AABTYO block_a_Page_37.tif
a1ad10eb0c07cf1c40f64b728be3eb8d
033f9338043d17fce857880ab0803c75966a425e
46908 F20110114_AABUAO block_a_Page_14.pro
097231f6894faeed5e0661f81e8f4a98
36ca5dc81ab8402a32ecdc4c8214911b4382f064
21795 F20110114_AABUKJ block_a_Page_62.QC.jpg
50479b32dc702a62eebc0f062e7d712c
d89473972801dec6c0658423761fb87de2ae85a5
72163 F20110114_AABTTR block_a_Page_55.jpg
74112b8c3cf2572728792cb4fe8b73bf
50b8b9a19fb3c1af301801a959af47a7ae111a48
2539 F20110114_AABUFM block_a_Page_73.txt
fb494c7527605813ffd2b4dd4962b7a8
0a9a2b267a88a969040e6b27a33fc2bf14ca1450
48564 F20110114_AABUAP block_a_Page_15.pro
61f33091688d38955e3bc81afb4de428
c07888e373939c1f19cb39ef89b66b1ca216babc
6315 F20110114_AABUKK block_a_Page_62thm.jpg
0aeb9bf581adb3715abdca06ca381d22
f92586cc6103f2ced9fdd0f739f2d559ea79a3dc
17141 F20110114_AABTTS block_a_Page_56.jpg
33e216973948f3d8e9eead6761e2f32b
6d351bd18ce6a64f5a1a6da9f678486395522593
2498 F20110114_AABUFN block_a_Page_74.txt
daa142fae26da677277f382fe4277d94
6b76603e55538138cf3832480d17afeb004b051a
F20110114_AABTYP block_a_Page_39.tif
ab0132b7b19b0e007f74d3ebddc5d46d
70258264b572953c3e80ffdba57569a22cc090e2
46151 F20110114_AABUAQ block_a_Page_16.pro
fbc07bd75fda5e896d2f7e626c0130ed
130b201305f856dd862e21406b8dd4ed78f47543
11138 F20110114_AABUKL block_a_Page_63.QC.jpg
995bb5c0b8852b27abbeb73facdfd4dd
999e31760f1019acefa076420cb4f7f38626b2f2
54502 F20110114_AABTTT block_a_Page_57.jpg
33f73ecf1b4fcc6e615d98d052f22735
24d0df3f6dec3a8d401fe4651b5790304d69a4ff
2490 F20110114_AABUFO block_a_Page_75.txt
02835c14cdfc9fba1b4005dfbf65cd1d
23f0da1eea7e422989fda0ab02cf4f36ade50ec5
F20110114_AABTYQ block_a_Page_40.tif
211632cd17103cf330c43b04d73b84f7
06daff16605fae5bdd2a1039c030b6a789a691d1
23291 F20110114_AABUAR block_a_Page_17.pro
3fcf32017402bd540fa3b2c2f20f2f4c
676622b2a3ad6dc7f4fb67d5f6ea507f253c41a1
21418 F20110114_AABUKM block_a_Page_64.QC.jpg
b890b99bb0cce655693bcfd444c15db5
bfed25c25968a38a2fe3e787fd90e9ed26210ba7
2126 F20110114_AABUFP block_a_Page_76.txt
7f6828912d842768d7db7892127b156b
54a7d8778d2e53eb4acc8e0089591f01604abd18
F20110114_AABTYR block_a_Page_41.tif
8ca0948ada2b206f2a8766137a49bc40
de7a9d98d269281303ebf5b746cf2cff47910317
49977 F20110114_AABUAS block_a_Page_18.pro
013ce58ed38e03abf6c52ad3a8cdeaa3
3661871906f4e68d1e5bb536faa75a4e753cb6a3
81137 F20110114_AABTTU block_a_Page_58.jpg
d6e30dce14194b3d4f7e8a0dd0fb0e68
0825101c5a964423729702894ec3f0e443b81ab7
6091 F20110114_AABUKN block_a_Page_64thm.jpg
181f472c633477be664f0339a82fde7c
5374c101d75f6da69a6da993ebb6fde674b20cff
733 F20110114_AABUFQ block_a_Page_77.txt
4ae9abbaf259c8f0e644c8d74c00cfd7
bdac222b914652890bc430b7a32f2fb4efabc4a4
F20110114_AABTYS block_a_Page_42.tif
f699d9ef457523990ee5fabf727e5d46
60ee32c96eb60acf0692edce4ee50d22d1449796
44230 F20110114_AABUAT block_a_Page_19.pro
2b98ccc6ce802d2a439967e627a59b54
31f52dc3192769096991fb78d6a71b54e037b757
62776 F20110114_AABTTV block_a_Page_59.jpg
3ec38ff54b8377415c1c40a2deeec4c6
fec12efef6428b463fedfcd60f9983c4894c077a
22341 F20110114_AABUKO block_a_Page_65.QC.jpg
7bee9c6cd57fc9f23b0b90efed55a5d7
c388365ea2646f94ccae6ccbd98dd86937c7cb89
9890145 F20110114_AABUFR block_a.pdf
a9e7454b2e396b696b6b99fa359ee54d
fba1d2c8726f4849152515c68e5108ca47b61da4
F20110114_AABTYT block_a_Page_43.tif
e6cd9ca6a304cd214f371b591972d8e5
187052990cbc05a9351cf2c345c6114b2c966cd9
12505 F20110114_AABUAU block_a_Page_20.pro
9180635a5c33c227850f9065f09e5088
d16bb7cf5b4a81cfdc0734d361fe6a03986292bc
69493 F20110114_AABTTW block_a_Page_61.jpg
49291f135d74254aea7ca39b57967f76
f62a0856f8d07389ff11a4ed7a219e1ed3dfed3b
6212 F20110114_AABUKP block_a_Page_65thm.jpg
3b61b6532ef23632abebd2c028866a4c
2fe881a6285e48d8e4e7061e9ce93a53e135ddc9
3952 F20110114_AABUFS block_a_Page_20thm.jpg
477fe15b2028c326ca8ac71cae45e897
1a9fad667428aaf00aeb1c2e001f155e03cc2951
F20110114_AABTYU block_a_Page_44.tif
ca4b4fa033b33d4f2ef639181bcbff33
0e570eb42d7fbf605477618cf7b2e6418989187f
31719 F20110114_AABUAV block_a_Page_21.pro
3a1df359d230b9b249510fae477a348c
f5dd61f95e3859c0c2d689e7d5087073c69dea09
67981 F20110114_AABTTX block_a_Page_62.jpg
a8fcfdff640c35738cd1e5111c367f97
fa2e48f4cb724da8641d066f7f4f135aedf2aa9e
6588 F20110114_AABUKQ block_a_Page_66thm.jpg
d022783fbff4eec0ec2411b323520323
c28289493511e31e739588cca78ccf7c81581d86
14996 F20110114_AABUFT block_a_Page_06.QC.jpg
b727567138f70c9261361bc7f87fa86a
aa190b46bbc723bd214b6caf69f659f09ab564d6
F20110114_AABTYV block_a_Page_45.tif
b131783a11463e4fd1aad8d64aa1fc70
a4ad0fcf4178160c63a328111bce7a216e3bc39e
93384 F20110114_AABTRA block_a_Page_74.jpg
aba83be6696a43b648cd7a1bdd74f2d9
699d7614e8cfe7bf4a4ebbe5e8f310576b09057c
34692 F20110114_AABTTY block_a_Page_63.jpg
81fa5c6c16e82a2175b59f2a1e6cf0bf
57b8a7004cbb89532f169762733c20ccaaaee369
22409 F20110114_AABUKR block_a_Page_67.QC.jpg
398194303f403e2cd1ee99bc88fe1791
70b1042300616f1c45bbb1d64599d07398a086af
26427 F20110114_AABUFU block_a_Page_73.QC.jpg
a48a5bc6b07c3a09bcd6ab1d7a4e9286
fbb3d937c878b7a419a6f7caa75e42a8adc69df2
F20110114_AABTYW block_a_Page_46.tif
550a69f756686660d09236547dcd4c9a
1f0b347b5887081ac6f7f69bcd81460c14410390
6020 F20110114_AABUAW block_a_Page_22.pro
cbaf0affdaf0b1081e9959739f5fcb0a
0174bf4dc594d1649e033131050c2851db149f30
20004 F20110114_AABTRB block_a_Page_29.pro
ee2db6fe31e2e7be0fed29cc5725ede4
a7cccef5cdba5e83ed54a72dcbe64379ba67ae06
65418 F20110114_AABTTZ block_a_Page_64.jpg
3b596d25b7302b0adc012fb3b37c7509
00cae46af5e3030648f6d750ef4ca52780266ec4
F20110114_AABUKS block_a_Page_67thm.jpg
9ffd221c8a5036feacbd091516f910d1
d1fea4381818ef2c5dd7d0ec44ee8d93b9d7645c
6637 F20110114_AABUFV block_a_Page_36thm.jpg
53271b361de9f267f1d61e0be9a2a9b0
119c59417ce1bd025fa979f5a3a4ee20059ca3fa
F20110114_AABTYX block_a_Page_47.tif
f0f80d6679ea18a40bd5167aa527670e
4f13a6de0c8ddb0e2eb5878cea165bb4a0fe8d2e
48314 F20110114_AABUAX block_a_Page_23.pro
acd5b94b29afcbc8d6e3aa7ca05f9d39
2116bd944c14e39e198870d0ec816a52c237e700
1719 F20110114_AABTRC block_a_Page_30.txt
6e41095e383424a66e59e3bf5e0a0756
6a062aa09b9cb2b5a8476c3f8ba2e98a4949b1d7
8029 F20110114_AABUKT block_a_Page_68.QC.jpg
a4f839ccfd133f61128a0d14126feb24
0f9c220ff038850f86d154ad0a2812f49f94a860
21817 F20110114_AABUFW block_a_Page_16.QC.jpg
c20fc038e9c03070151b79b550d6b865
b286e0b39ca033d938444b3119420cf0b165308b
739560 F20110114_AABTWA block_a_Page_44.jp2
4dda1f6fa8cba826a1f71d41653bfb66
61b0f0a76d0e7a7ba165bb4e43a6ab24ff4e736c
F20110114_AABTYY block_a_Page_48.tif
510300e33c8b6dcd03d324b5a12320dd
04f78275de9e672a7ce3e167fb13d180b1d3ee9c
27477 F20110114_AABUAY block_a_Page_24.pro
d5667739de03187ee43f135601debd3b
8c2eeb0e4e70071e8e88482037f07d025f6f6410
F20110114_AABTRD block_a_Page_16.tif
3d75cb7e8d940144722e3d75ec0c071b
6a8c5a064d62873171161f212a3142f21a3d7322
21079 F20110114_AABUKU block_a_Page_69.QC.jpg
83c2530ae5094276327cb1ab3171e94e
87754a8e58ecdb238f719e0355c5b1fca9b65757
20721 F20110114_AABUFX block_a_Page_39.QC.jpg
e380ae9cf31935c59803855da9895d9a
416eabc069bdc10e816abb8cf7bad0cb5284edfc
104225 F20110114_AABTWB block_a_Page_45.jp2
b6004cc5e829178757343bec3bc4e984
ec34db366b4f84884e8060ea20ad66c122d42e79
F20110114_AABTYZ block_a_Page_49.tif
8b3fca3e49096010205f74c0b6e0cf5f
1867900721126d0541b189ce2407fc7dd819011e
45026 F20110114_AABUAZ block_a_Page_25.pro
2b0fa8ee38e37b0473e5ee5ccba74ee7
f15ad981dffcfc699617a4888b564b8e9aa796a7
1392 F20110114_AABTRE block_a_Page_02thm.jpg
d17b588a01f753cc386b9c02475e2cdb
47ab6645f3bc2e89dd4e65e899b6f43818b1b835
5996 F20110114_AABUKV block_a_Page_69thm.jpg
1854064c236fa880f4dece406942c535
e2de76e072781caf3f39ffdb3978a30521ee2460
5221 F20110114_AABUFY block_a_Page_57thm.jpg
3a02ecb67e730a44f7e948f896917f1b
ab98c28c05a1e26155a41aecb55f9bf0542dfd70
654922 F20110114_AABTWC block_a_Page_46.jp2
6d76b9c6f38dbb1821e303eebd1388b8
dc18731c25c9163a2f12084aa87f3db08525e76a
69454 F20110114_AABTRF block_a_Page_60.jpg
aff4a6ce256bfc8cdea5551686ecb062
c7c35d70c34efcb940bf6f8030cf39f3d8d977eb
27668 F20110114_AABUKW block_a_Page_70.QC.jpg
1e9b730becb6127cd32c277fb42cd182
e1d931cab2ea721ba900193e9dc01d7e3519ee92
8066 F20110114_AABUFZ block_a_Page_22.QC.jpg
bc9adea4ebe3b1d14b22612fb5b5c58e
782e961c4445f22b3cf4947ebb33cdbaa306451e
102090 F20110114_AABTWD block_a_Page_47.jp2
c8d8b870ef8d2e2294870a54b1b58d87
d6eeb470349205bff529cc9f8ef22e30f531f08a
269 F20110114_AABTRG block_a_Page_07.txt
cf1ba680caccab5d7211759342dff607
fe9205ebecfa1b4d5eb5fc6d078cd13fbc04ddaa
643 F20110114_AABUDA block_a_Page_04.txt
f8eb925fe69a77c32a510a087916f177
8d5a64e4eead146dd32ea83b747d98c9a110ac76
7393 F20110114_AABUKX block_a_Page_70thm.jpg
8054e840ab995998fec06f43ff10ed58
86f36129605083773e6c51e20c9dbeb09b880323
105630 F20110114_AABTWE block_a_Page_48.jp2
72e47a221309427168d3eeb25604fb16
420aa24224cc2edbf96d128b7227100c0a54b489
2507 F20110114_AABTRH block_a_Page_72.txt
92fe2f9c1c7e01562e7f295e4efd8e3a
e4c8ae4a487071792cfa4ffdc6672ccb1022cca5
2474 F20110114_AABUDB block_a_Page_05.txt
97dbd9031a896c9f23032d4696c5f8a1
38da7e1f38a2b92425355ce922561d4cdbc92f77
26285 F20110114_AABUKY block_a_Page_71.QC.jpg
143a8ff5d0d385aff98b5d185a5fc413
67cc9b495ae87d7e054818d016c063bfcca51e8b
717687 F20110114_AABTWF block_a_Page_49.jp2
4cbf51946a5fa23aee71f5cfe9560480
4a4fddf488c2f0e7019b9dfc4188610f4fcbcb19
2020 F20110114_AABUDC block_a_Page_06.txt
570cf3999bb6ffa725042e39a415350e
114ce10f0e2ea21609e1d2648155d9419133c502
6859 F20110114_AABUKZ block_a_Page_71thm.jpg
a2dec6d8051adc70cb5fc8000a2713ea
e6f9825260f232eda238c9e279a5daa12f937bfb
6303 F20110114_AABUIA block_a_Page_25thm.jpg
4581a68a0739781c933d31bc9ec3ec0c
a598107db353d40bc89112815bfa20501e5b2707
108415 F20110114_AABTWG block_a_Page_50.jp2
b80b880838a917f85563f380a7218941
5ec14a565eed29f158ee8a1e84aea7ac7ca84dea
2036 F20110114_AABTRI block_a_Page_50.txt
bf4f2f7ea62cfefe8fccf9a9425d55d2
4817a4f0406738254a6e9e4698e1cf9581086a30
2114 F20110114_AABUDD block_a_Page_08.txt
b2d36f77fb818132873376b23c799103
d09536e55b5f859c03589fa79686472e7a8070ec
20199 F20110114_AABUIB block_a_Page_26.QC.jpg
8f58ab4d21c80dd73d113e87a077f3c2
2ef4e1f0b5a218e1c46e08d9f06704bb2a240e3e
100970 F20110114_AABTWH block_a_Page_51.jp2
1532e1ca2267d517ee2032dbd22b84d6
464e66626ae79cea86a8d71e23d7e1b5cc5b2aaf
39866 F20110114_AABTRJ block_a_Page_77.jp2
293e84dfb954b0ee7bbcdb47ff892095
ddeeafa65af756ef58ced8da58866dc4b1593f49
312 F20110114_AABUDE block_a_Page_09.txt
de85b10f77d2042c3f55a00be207b5b0
e86be5eed201e10ccb9a97e346f0bff77ec39341
5737 F20110114_AABUIC block_a_Page_26thm.jpg
ef9677bff4964e0f8e3aec7caf0004b3
354b39d7db76367495ee4cf7ff46013c4c655a9a
593395 F20110114_AABTWI block_a_Page_52.jp2
1bb109779213fb4811950ef5b59694cc
a224d3d6e2cc8b2c88ef7794412afed554a74407
1526 F20110114_AABTRK block_a_Page_57.txt
e919092b440193bcfaa10627deea487d
3b8389d221cfa711db065fa78adf31bc869c475b
1713 F20110114_AABUDF block_a_Page_10.txt
7262f1ea2e268b71460eabb19bd456df
2094e8b3b8a1ff29125171cbefb2d231d9be08cd
17543 F20110114_AABUID block_a_Page_27.QC.jpg
6cad5f768c2cc2d34ee6935fb6556ee5
88e02167d97c87bd8e02d864dcde78320ef02a66
909592 F20110114_AABTWJ block_a_Page_53.jp2
e89f20c713aa495087319d0da4298184
a690a6c68e0b84e87c716ec24f2d9184b9d851ba
F20110114_AABTRL block_a_Page_33.tif
148c777db8d8d6c07ac4c1465072c797
17b94f0c7859e84ecd2cc0d5060cc2d40ab73c2c
179 F20110114_AABUDG block_a_Page_11.txt
722ad987aa2ec1d244cce782efbc807d
ac5ee55bfabee04b014c7fac901fecbcf16a2140
5208 F20110114_AABUIE block_a_Page_27thm.jpg
0012de45e9cdf89d197d684fbd5e3d13
5d43925e50c720264602afcdc57f5867e3b93a01
100094 F20110114_AABTWK block_a_Page_54.jp2
47c0d02863e80d1e73e32d2c60e0a748
ac72924f4e0b98e2313f811497c94b1f0c369232
6947 F20110114_AABTRM block_a_Page_73thm.jpg
a8d2b0d258d6141ad67ad18d29d19e45
4fe8dc47e31df46d6d81435fe221fc4be4b12aae
1645 F20110114_AABUDH block_a_Page_12.txt
4e16c5017d99511c3d4e848c8225bc3e
396ef7018dc895cf77b24e86b0021728215572b1
5952 F20110114_AABUIF block_a_Page_28thm.jpg
29fbebd500a0892510948bfd1f4a5ab3
692407992cf0d24f5fe92fccc64aa386a8ac9f9d
110240 F20110114_AABTWL block_a_Page_55.jp2
1902002b86c7224d5d0e225a111f4e79
eee5329617190374f211f377788556df81f57239
89866 F20110114_AABTRN UFE0007381_00001.mets FULL
815e4d241ae4f9082e1cab9d3c98f15a
0c27828c282f21389c5e7e84397579af5f98e3bd
1905 F20110114_AABUDI block_a_Page_13.txt
6be51b894d5184f6c9e56c5082a975e6
53488d6596f97d2d11c469b0729fbb2e3bb4d8c7
15098 F20110114_AABUIG block_a_Page_29.QC.jpg
ee0a81fef25b2f3b49fcc1273bc7c1d2
8037e0fd192235330fe3caeb50331a2f124371a3
18272 F20110114_AABTWM block_a_Page_56.jp2
81ab020d955f9856556e6550fa9983b0
4cca0f0b22d2ceb11196fb6494039392d5c6f1c2
1887 F20110114_AABUDJ block_a_Page_14.txt
e37247fb06733d77d688d418e4db3f78
dfa11388697a356028460af6af93d7a579d33d9d
4687 F20110114_AABUIH block_a_Page_29thm.jpg
b9862d113e1873e459fda274675b88d3
1dc013ede7cf6492f7282b330908a77d827ab522
1933 F20110114_AABUDK block_a_Page_15.txt
c347ed39b76aa993b51f44b27d208606
3ebff0a58f7e45b383c9fa31e97ebc20f6ebc02d
5748 F20110114_AABUII block_a_Page_30thm.jpg
9837a19917e78b251e9ed988e69fdea0
914da8f5296a2dec53395d8ab1a501d96142b710
77754 F20110114_AABTWN block_a_Page_57.jp2
65abf4551481019f0208b4e8f9f5bb2c
5dc79cb937dcfedefda30ad5374c3304abb4ee80
23267 F20110114_AABTRQ block_a_Page_01.jpg
e51592fcfbc0b5861d4d3a24243d7719
fceadcd1b6c053053f1224a344c9c8224a154570
1830 F20110114_AABUDL block_a_Page_16.txt
d51cc6b995629fb67d7a08b2f4277a92
3e46fc439d699dfa840c3c3c991c00eb4cdfdb57
17774 F20110114_AABUIJ block_a_Page_31.QC.jpg
995f8ac7bd56f8fc993bd6d7918c517c
91d7b0eaf0ee15d19854d604b9f53969c149f9be
1051981 F20110114_AABTWO block_a_Page_58.jp2
97d7d36567a72554a59127ab0350ef78
7e479b31e128f1b7d5bb3e79ecd864f8a42cc41e
10530 F20110114_AABTRR block_a_Page_02.jpg
2fd7eabaddc6658ce0e8fda02facd3bb
3ca5a3bbf54e29de2ce633aa0d305bbb439d05fb
1224 F20110114_AABUDM block_a_Page_17.txt
358fe601e7ae61305ca7d470809c74d1
3f20fac11fc913d101e82413f91188c8f2d03618
5174 F20110114_AABUIK block_a_Page_31thm.jpg
3be3f9d721a7f5d8cf19b50ca39a66ea
da51e3238fbacf433d47c5eb4eb0bd85a199711e
93813 F20110114_AABTWP block_a_Page_59.jp2
3bb7fbce48d531f8c1ece8013dde0b0f
8e66e2cea6f1b9dc3a74ba63ca4b461c76308261
13385 F20110114_AABTRS block_a_Page_03.jpg
fd92dcb36957176c4ac865f638ae4fe1
e8c1b0deec21cb82fb0cd49215fc79a7e4d585e3
2003 F20110114_AABUDN block_a_Page_18.txt
03f7911e63c858e83f01c9cdee97ac64
bc57cf55917a4ad20fbf664f246682a82274b8b9
14991 F20110114_AABUIL block_a_Page_32.QC.jpg
7b295bedf0f7a8ce6fe3359afd6684f9
c95c63bdc7cb79ab7ff9f42da79caf7006e55590
28714 F20110114_AABTRT block_a_Page_04.jpg
1aba36e249c69e3eafd8cfc80a8775a3
93b1483bfd6ac9bdfd266ffb3242735fe9bb2bc3
1789 F20110114_AABUDO block_a_Page_19.txt
1bada960c60b86ba57e3ed04aa17fbd3
6098e91e502835ad8579f345ddfe0aae7d3bf6b3
923990 F20110114_AABTWQ block_a_Page_60.jp2
e03374a8df50df46dd8f5826ff45ad25
cc61ad8de6b3f6627032451dc8ca086a6029da65
4920 F20110114_AABUIM block_a_Page_32thm.jpg
d856d0fe3e4734b5e27d1108f6b4f19c
c11768c07855ddc8ae206bb201fa8778d2fb115c
70707 F20110114_AABTRU block_a_Page_05.jpg
69d9313056b141c7dd4e60f727344cd6
0ac8a9985ffaab11e197982b55b67992553f5312
656 F20110114_AABUDP block_a_Page_20.txt
0371d0af6f48e1c772894572186ac06c
e5cbc9bed5b4bfd93bf4203cbf419afd7d015920
103990 F20110114_AABTWR block_a_Page_61.jp2
f0d2087514a8a17ef403150a6c789f32
0de31692e8f9278fc93163551872fd5e370c37b7
23115 F20110114_AABUIN block_a_Page_33.QC.jpg
c42d6b80bca25bb10cd5f49ed51f464d
7d4e81f37d9661e4171c890d13baecd42e38467b
57385 F20110114_AABTRV block_a_Page_06.jpg
3e191580aa844f8dd49d2c123d684193
961ee8d141bb009f3f82373e24f7ffa91c5fa161
1319 F20110114_AABUDQ block_a_Page_21.txt
44f9660aa82e5c2a5c462923c0aff0e5
15960bd8b94781d709e8fbc313c11163f4af8922
100014 F20110114_AABTWS block_a_Page_62.jp2
fea82fc419e0425ac9c1dae0c13a04f8
2f6a5b3f4ceacf73788ec99a442c0147d4e25567
6418 F20110114_AABUIO block_a_Page_33thm.jpg
9d836ffcb003fa66c65edd95131bcd6c
ab56d84c6b42043300ac83587cf5f739cb41542d
16119 F20110114_AABTRW block_a_Page_07.jpg
5335b2a5a8c6dc7193daaeba10720fdb
ed281b1cad9de1acf35b528676c9946f28254846
299 F20110114_AABUDR block_a_Page_22.txt
6e9508856aa4d75c4f7fe5b45a8dd2d7
7148c1e658c62fe47472467d01f43c566e7d329a
46865 F20110114_AABTWT block_a_Page_63.jp2
837f70e3f54044ab3bf856de9aac34ca
5ad678089f51316e1b50d435d0c5a3137c020bcf
19093 F20110114_AABUIP block_a_Page_34.QC.jpg
c7b916f841f29bbc399a82c730dbf95f
e0fef5fa3dde32b2d37249848d32d9cbee028321
70144 F20110114_AABTRX block_a_Page_08.jpg
b642472b26305536cf9a9b085aa54f61
c16488523cfef11e8d11bf7f097e3e29a7b0ecf8
1928 F20110114_AABUDS block_a_Page_23.txt
f578b29e3c9a8c882133e1dddfb0d0d3
7baab89cf1fce677625ea25850a71108e2c3d613
95518 F20110114_AABTWU block_a_Page_64.jp2
35acd4f5145155c444a968456f6484b5
83005e756e694fc1d7787a86401107466365f501
5866 F20110114_AABUIQ block_a_Page_34thm.jpg
437ce29f03364a09fa2c782a75acc08f
f66841ea5c2ff9125110edf80eb1025bb91a04ba
16769 F20110114_AABTRY block_a_Page_09.jpg
12a8b061e50272ec29942f0968766be7
13979f05d6a40ccb8ab98a6cd8d0858213d31bd6
1100 F20110114_AABUDT block_a_Page_24.txt
74ab690cb7be3b76c418e7fbe027dc78
277240bc8458c19e25e0974d938bba9d049661bd
100069 F20110114_AABTWV block_a_Page_65.jp2
b1533ff4a4399706ba48a2071798434b
061c09c565b3f471145e6c80b5e6e7c9ec0a998b
21070 F20110114_AABUIR block_a_Page_35.QC.jpg
7ba4f551a0b04cb9d2df0beb0573b99f
13acff962170aa548830d8c05634658c69832850
60061 F20110114_AABTRZ block_a_Page_10.jpg
e96830a5a181599e9da521f3db8aaff6
ec4a629f16da4588ddcddcbf9f2af790149f2bd6
1847 F20110114_AABUDU block_a_Page_25.txt
f654fb3dffc88e2b849c784836169125
f029d46cd95821788de4747a15a906d8903724d5
106826 F20110114_AABTWW block_a_Page_66.jp2
76f081b3d36ab3debd79ba3c342f51f8
889c50387f763edac4a25a4e73a30a2598084edf
6144 F20110114_AABUIS block_a_Page_35thm.jpg
7934ef52bbd97652247ccd1915ba8281
d37f72b9b2f07be1bdadd09590d87cc1805e99c8
1640 F20110114_AABUDV block_a_Page_26.txt
9b3c1446726c10ac0bf09122598bda83
cd5055bff10ce5c9bdd6f9f5bd58d18031818e71
97808 F20110114_AABTWX block_a_Page_67.jp2
9553a8f909ea1bfbea290ee97c20bffd
aefff5376aa178ac9957678b9b5d0e57139418a1
23271 F20110114_AABUIT block_a_Page_36.QC.jpg
f113ec762b56263e7cdd9e2c330f10bb
e447c552ded420bded8fe8aec53071e20d57c059
1135 F20110114_AABUDW block_a_Page_27.txt
d2e9333da109742642940aa1be0aa551
8cd23a118cf604c73d1d99e104820f44b7c88e8e
68245 F20110114_AABTUA block_a_Page_65.jpg
d8799066e9fde7cd994188b36ab18160
dc40561bbae9e74b47c0005d84e323d4a43ab69f
27448 F20110114_AABTWY block_a_Page_68.jp2
0d2505f34f486d9adce262e3e66adcd7
5cb9c7a6344d8532016d7dc43a1aa975a2fdf509
23290 F20110114_AABUIU block_a_Page_37.QC.jpg
53f089c3f63eb1a3bffb908dc6a95695
cffe14166bb1558bd46273c82556529aa073c75b
1862 F20110114_AABUDX block_a_Page_28.txt
7042dda2f07db4665a3e18baf26a2f9c
c20dfaadded2f0f06dba7fc186f1d74ae30bbf8f
72669 F20110114_AABTUB block_a_Page_66.jpg
bebdc3208bbf88a5900e9500f46ba3b5
9ff09e38967fe15f19ba9457e0a3f8996ec21c62
106957 F20110114_AABTWZ block_a_Page_69.jp2
d6e22d95a7ac1cdc730a80ad2e92c4bb
9cd93bb651d3e712df1170a477068f6f23e3843f
16079 F20110114_AABUIV block_a_Page_38.QC.jpg
5a3e0a011cc5f30b8c10d97433320b62
ebaeb100e79f00786115e3014f1c23c1b370f84a
932 F20110114_AABUDY block_a_Page_29.txt
2e8bf421ba19c29295315a0e556f01ba
ed459647fabca4e106e91371b64e841c613fe8d6
67232 F20110114_AABTUC block_a_Page_67.jpg
fd65ffbf22cb00b06b100001f78ce434
2e014218de0ed1474a4d2c4b28faa3069a505894
4700 F20110114_AABUIW block_a_Page_38thm.jpg
c36c8de8bb3f5e51054288ffb4682a9f
8ec7c7636103f4459290ad1c2fe8190e25dd5f6f
F20110114_AABTZA block_a_Page_50.tif
b646b9da5930d664e7ebdf29eb8aafda
c39bf0d6a71b1193980f16141f3b01076bdc76c5
36737 F20110114_AABUBA block_a_Page_26.pro
b2c3030dd9f2123fe0830d8b5edb7da5
1bcca765b77d49011b7c943675312be1b1bcd630
23451 F20110114_AABTUD block_a_Page_68.jpg
3181d278eb81e00909bbbab8d474cf64
4747923f7358b72626197350c8cb7dd99d534f12
5826 F20110114_AABUIX block_a_Page_39thm.jpg
64b7410a61d69d8556b1aa0a60f5e416
27a55ca0e048e123bde8e2b389ccaea3a9920c92
F20110114_AABTZB block_a_Page_51.tif
e0b4a4112cb5106962d2dd5589a0fc1a
b41e12e46a3c1d0fa5d7e9c540301118ebdc62be
38072 F20110114_AABUBB block_a_Page_28.pro
21b436e398d79850e72c05b986852e0e
dc0bc4121acf6b3577f26cd37b21618078f8c896
1259 F20110114_AABUDZ block_a_Page_31.txt
dd3f614b390ea5179b33ac4e791b2f5a
6df75f30523570ad819eff393fb653a67f3a9995
73084 F20110114_AABTUE block_a_Page_69.jpg
f711eb62599664a3a02f12f9de79d57a
f6e45f484963574476b8bd809263e9a3340ee975
23811 F20110114_AABUIY block_a_Page_40.QC.jpg
45bfc42446e0163075e1f89964b3eb3c
155ad74e8c19cb3e5f24a1a27e23970f0e155db3
F20110114_AABTZC block_a_Page_52.tif
cd4cd89e6b84dc92575ad750decb9d85
9f3c8b41898afe7c4a04ab7dd57a8af8f2640a7d
35403 F20110114_AABUBC block_a_Page_30.pro
031d27edab1efa39bdc65a5f7e8e9656
e3a6af2d262773bc7143ad65e918de93aa05d7ea
95115 F20110114_AABTUF block_a_Page_70.jpg
54e2bbab5fd8cddce7d019063b5d1840
82a5d456bb97d131b7a1c7b769332c4edfa62f4d
22392 F20110114_AABUIZ block_a_Page_41.QC.jpg
5f88231c908dabc32ef528603a750ebc
4a240374ea090f4c21ebdc770676d41a826667b4
F20110114_AABUGA block_a_Page_51thm.jpg
139be92dd4c128b522b4611945862198
aa33e3ed8f981f1537bc8f3155823d998c2ebe09
F20110114_AABTZD block_a_Page_53.tif
0ce430b673929f4c39e506bbbcac4d77
5d4d02cddee14cf769d24e101d4437ee1ddb3ba2
27478 F20110114_AABUBD block_a_Page_31.pro
2f134be51db27fe39cf49c689de1c5e3
731576ac33e9ae2e26d8aa51d39d725c09ababd4
88869 F20110114_AABTUG block_a_Page_71.jpg
c073ba0a837382d54b1b9aaa3d052adc
62ca660177e2bcd2722c0ea579293b8ad174892a
6706 F20110114_AABUGB block_a_Page_18thm.jpg
693cbf7954d074876665e96be6c5c496
64bc69d916bb4348831a32147e864137fa2fb5c2
F20110114_AABTZE block_a_Page_54.tif
3bf574a38019d11000fa5105deef6dc0
70342b270712b32e6ee7c50c48bd581127f05f5f
10404 F20110114_AABUBE block_a_Page_32.pro
9d8938f8608207f3f7729c22f8539cd2
32437408655b1aad43ea7c0abb7955e9e539ebff
92273 F20110114_AABTUH block_a_Page_72.jpg
7dbe2d1970d6be6fec019ab158a762aa
deebd434d6afd4ed46d476700304c42ca5995812
27042 F20110114_AABULA block_a_Page_72.QC.jpg
42340719dc066cc6e87f8e059476f764
538eeb3d22d3675ca9daedc4cc8141c8f5814d81
2571 F20110114_AABUGC block_a_Page_68thm.jpg
cd5d331975bf230a3b055c2d57e139a6
cccc4143081ccfef2bad2e75e2b40043e30fd4f5
F20110114_AABTZF block_a_Page_55.tif
6ad7d3aeea9c8c48e16a8ea50148871e
8487539ba5e9a45a17cfaf433a511089fbef58fd
49299 F20110114_AABUBF block_a_Page_33.pro
f178856d872dc1d5f38301a3275abb5f
da0b72f08046cee8e996c3b593de408c8978895f
91168 F20110114_AABTUI block_a_Page_73.jpg
4af4b2340f9996514925eea94ba93188
3df57f22ca5042d1edd90b603b46365b0a5c375d
21661 F20110114_AABUGD block_a_Page_60.QC.jpg
26f2051a437ccfd077621f4ad10aa160
49b802518cd736d1b1ee1e917fb0016960ece243
F20110114_AABTZG block_a_Page_56.tif
60a13e0337e226b89749c1e2aea19701
470a37c3467e689c8191960ea816842f546cca0e
34702 F20110114_AABUBG block_a_Page_34.pro
2ea6fad42d3aba7457b5b4b2f227f040
d108a4176b1914bbbdf3a69f6f98d60a61dd031f
88949 F20110114_AABTUJ block_a_Page_75.jpg
371344600e548144326848977c97c72e
df4746dc90e9a8bb7ef739fca80a9aaaa0bc26a3
26696 F20110114_AABULB block_a_Page_74.QC.jpg
c84bbfb2ebdcbd8cd93aae1bf622484d
ebc32370316bf6e28aa178b8870f1ae7fa54d6bb
6708 F20110114_AABUGE block_a_Page_40thm.jpg
99bfd7ee833377bc9751e32c6cdcbd8c
b1ac747c98a921214a718da37509ef8e7e7a0309
F20110114_AABTZH block_a_Page_57.tif
15a39f0eb17af036c55b34ff27f967ac
8e8554ca424841f666ace8672666f2df2673704c
44215 F20110114_AABUBH block_a_Page_35.pro
e4ebe53ecff54dce0c3f1cd6c2ffc13e
49d1095362fafa7ce34eca598c3fc73bcf87c7d6
77324 F20110114_AABTUK block_a_Page_76.jpg
0169831b9cb29e0b450606f92f5c0c96
3ed3d37fedc79e90e9d27bce599d393f0a20f647
7015 F20110114_AABULC block_a_Page_74thm.jpg
dacb036beaa87b718828a3de690f41d3
d6e6d91f2cfb32ccc5cee60f8a18c30ef684da8b
6329 F20110114_AABUGF block_a_Page_23thm.jpg
50dfdc3f17fd6c34bd0260b07abdd01d
d93e93a18c67c1c925e380f08a0777ed85784a2f
F20110114_AABTZI block_a_Page_58.tif
f0a419c00adfab769d301d924a263d5a
6081d45522256b512bb2e59fe6d4ad27c1cc5f12
50584 F20110114_AABUBI block_a_Page_36.pro
defc53610801b82ea59995b34bd5ec61
e22a27dbeaf04f1910ca91b1a3a3fdde92297c61
26420 F20110114_AABULD block_a_Page_75.QC.jpg
669cb779ff18b9c904a70c35b5d9f490
a3bffcbccc903cae0b21c575569f278c9afe19a5
20673 F20110114_AABUGG block_a_Page_59.QC.jpg
3a87f21332ee210501e70c332bf6ea71
dcf65c2194bd1c34a0514024075226edb141fdf9
F20110114_AABTZJ block_a_Page_59.tif
0a8bda52264440e5b10e40673d386fdd
0aeb4b37eead1ae852e4940f4c0eaf57a1349ddd
50504 F20110114_AABUBJ block_a_Page_37.pro
286899a2a641c9e7950a0f5be93b0d72
beeb37c9c682e63cf2498c68ca2298e0bf39e58d
31015 F20110114_AABTUL block_a_Page_77.jpg
e2ad2d60b0f802cf57a630aef980b671
22fca0c7fc8f4572da81142a3f4ff684d2e06d21
7118 F20110114_AABULE block_a_Page_75thm.jpg
84bd0073a69d362534666fd3b9117869
d7d7f767b4c6ab50722a77230f056b839f030b96
17802 F20110114_AABUGH block_a_Page_57.QC.jpg
cfc01cd3654e1cca433daeb216302a9a
e9cf86210f4973f61f09b1bcc3bc3b7dba3d04ff
F20110114_AABTZK block_a_Page_60.tif
58d33c9a204cf7efbf53c8d39f0bd00c
a8cec50de4bab26d1fa6fa991dec258103836239
30939 F20110114_AABUBK block_a_Page_38.pro
9d0bc4023aeb129e901a9e36acbb09aa
5a13085b5431db995efce4a01fb13e1867e6ba5b
25430 F20110114_AABTUM block_a_Page_01.jp2
c22f64293f1bc531632dd944c4db21d6
be6873d2460e0a7161e98e64ef33e3f2e0e4312a
23262 F20110114_AABULF block_a_Page_76.QC.jpg
922e5bdecd551dde197ce9eb6cbe6cce
a5f002d255c95978a8376dbe542611d9da803c3d
6376 F20110114_AABUGI block_a_Page_16thm.jpg
d147c1841289105c2ffd37b114e8191a
b459b5bbeb6e6aa423dece2a7a9e6cf5b7679779
F20110114_AABTZL block_a_Page_61.tif
5cf159d4fe66545ee7f4ef02591d8c11
6081a69fa99ceb19b4385f3cad4cc9846d9661fa
43204 F20110114_AABUBL block_a_Page_39.pro
775dd7c2736117b7787ddc34961b5f4c
5a4b348f1a4d903a675662ceee1d801a37e45c63
5977 F20110114_AABTUN block_a_Page_02.jp2
6a3a0efa47b3fc8b3f96e690e4a5e359
de3199625a6ee4e164fd956f420672a81c814a5b
6336 F20110114_AABULG block_a_Page_76thm.jpg
5d4df5ae893048e10f52deb5f74893c1
fdd41440e149d082ded4c2292ff7b8969df67cd6
23656 F20110114_AABUGJ block_a_Page_66.QC.jpg
ecc0e6928dd6386194176c9debd3c0d3
809bf57a332767b1a61421bc944f17e2a18cd967
F20110114_AABTZM block_a_Page_62.tif
faf7174c6bafc2c48c16fc71f9bb463e
0dc5f6d8ad23ee12352636a59dd3f2c01378ca41
51956 F20110114_AABUBM block_a_Page_40.pro
c7fc8ad563b426981df3303726b5ea19
38c55ada90583d8d8475f6e44e80d8d7b3ab4f87
10176 F20110114_AABTUO block_a_Page_03.jp2
8dc76525bc5e965b211372e31d5ddc27
dc4d5a9518cdaebb4ed8a11b2186bc0a2555a24a
9854 F20110114_AABULH block_a_Page_77.QC.jpg
3eb244beab5445bb02f33f605beab7ab
81643c186d89d1c5276c17e6f62e007c0324a4a5
4758 F20110114_AABUGK block_a_Page_17thm.jpg
35831d1af9a712d10ca8d06da740656b
640ebe01ecc3ab28c1f13106c372e78c8975333e
45055 F20110114_AABUBN block_a_Page_41.pro
5cbb9b970076faec47152abbf3712d66
619f6107b61dd5317e6a6c3ca96ede7e7f34113d
35472 F20110114_AABTUP block_a_Page_04.jp2
77f1bd39868e4a1dccd53ad588808a44
0eff7863fffdc38cb2c25e3269cecdc1ed102f2c
F20110114_AABTZN block_a_Page_63.tif
e1aee661ecd26ebe46ac2764becff716
c0e0fde5ef2342cb5535fc0cb0aa91f83a69f9e0
3100 F20110114_AABULI block_a_Page_77thm.jpg
7bc216b0ad718b15a4e0709bbf990523
b33a452239a03f7307570527f223341895a71d83
7313 F20110114_AABUGL block_a_Page_72thm.jpg
a1935d4ec64b4097885135c7b8071b16
6bf7d01b61009fa667b6383cf894bee9f4a3d17f
19013 F20110114_AABUBO block_a_Page_42.pro
0c762483e5c5a77ed9a3cfc9a48edb39
d830975b9ad1389c4a715b363532152b797699b0
1051984 F20110114_AABTUQ block_a_Page_05.jp2
0f34c0641e76809bd89d6bdeccf7f839
4b6eb7a9296cbc03daa20e288f00453d5cc7e17a
F20110114_AABTZO block_a_Page_64.tif
815497716e9c1d101fe13228631b6bf3
e8d207c38319626d51bc92e14e0867e28ea66da8
116196 F20110114_AABUGM UFE0007381_00001.xml
0cfa2312be01b726222eabd0cdd81a9a
a5271347a0f3cc276741f4cd239498aeed0419c6
35167 F20110114_AABUBP block_a_Page_43.pro
0bdc868512bc2e6bb692e4d3a689fa04
10fef839c9dcab3b7ed7afd59f24e85498c39bfc
1051952 F20110114_AABTUR block_a_Page_06.jp2
1af21dc394ae6178a5096f29a200a603
482ca684c88c0ab6848866a866c22f91ba79cdf0
F20110114_AABTZP block_a_Page_65.tif
dd22183b39171410f618d7d9ccd03340
1100e93b516bf2fd64792eb2160c918bc35712d3
7563 F20110114_AABUGN block_a_Page_01.QC.jpg
c3d45857f6ec6ea927c6855e6664db99
25b5284ce49c4d5300e21ff51c7e50e3f27a1a86
28384 F20110114_AABUBQ block_a_Page_44.pro
6d212e65394dd156cc2dacb38c8b9cb6
8d744bdcdfade51593124fca4ab0ca0ac48008bb
269708 F20110114_AABTUS block_a_Page_07.jp2
1819b9e02f920affe6d8d2484227b6c5
59f6314254aa31d70a4767f9d228f4373d68e715
2369 F20110114_AABUGO block_a_Page_01thm.jpg
90f89c926e0ba8e74c4c9ca2205b7940
57b7732b940e5838c89ecb00b5653641de65dd3d
49876 F20110114_AABUBR block_a_Page_45.pro
a99913109ac1a3fb8d125073b6287c33
9bba16f5aeaa578906f84600d20ecbc257d71852
1051979 F20110114_AABTUT block_a_Page_08.jp2
a8de61258b43de08d7946f28f621c390
d0007d7290743f30fc3a1eb176b4e5d39eea4395
F20110114_AABTZQ block_a_Page_66.tif
0b3f80fb0749c880dd754ce8598719df
f968817f3d9af4f4a623cad2c54cb50b4ea25e06
3369 F20110114_AABUGP block_a_Page_02.QC.jpg
656a8cced7a0118bef8930b36bb8ec55
44cbd300fac47485af17f4e4d804cd42fa00cc85
23101 F20110114_AABUBS block_a_Page_46.pro
31d5691b33e9e04aa09372278d02bc58
ede713d6a98368961a8225686b5f18997f0cd720
305783 F20110114_AABTUU block_a_Page_09.jp2
21710558e40330f2c24f2bf71055382b
65c48eb7ef55d17361b1223f26ffb79e30557701
F20110114_AABTZR block_a_Page_68.tif
9fa264843cb907ee537d1e687b7a73e4
d938b37c60a46801495822a70b1ef61bd076911d
3878 F20110114_AABUGQ block_a_Page_03.QC.jpg
295b72d552c1022f3e22656c0e61ed12
efd01bab4aadadee033ad095bac6aaa3829632d0
48805 F20110114_AABUBT block_a_Page_47.pro
59b2bf9a26b2493df7f3eeee3ec506d7
918e559a62cf75af7a42ea812474185633d83265
86323 F20110114_AABTUV block_a_Page_10.jp2
135e946a4ce71152e449488f196a59c2
acd27c941c5f5778ba4acb411ce7e597638c40a2
F20110114_AABTZS block_a_Page_69.tif
a190a25609bb3d190ccde1ad1fdb7591
d53f0c3680663398fe4ed310d5196f3a6afe6679
1628 F20110114_AABUGR block_a_Page_03thm.jpg
2c609f11535c0c6526a992202a931a20
70a9669cc2489250c35640ba153983b738a6a74d
12018 F20110114_AABTUW block_a_Page_11.jp2
2fdae4d8b97eb6afec6bf393c248aaec
6a0df8d1f9a06a7184cd3996e93bf749cde6e6ac
F20110114_AABTZT block_a_Page_70.tif
551e25180902535185d8154a7e56a24e
1759e1876ab4c7426303f760e40a3ca4afa88ab9
49158 F20110114_AABUBU block_a_Page_48.pro
30e943689a6d1c3f01067c0b8f4db21f
28a54f3e29898730395d3a1d364a3cf293466280
9303 F20110114_AABUGS block_a_Page_04.QC.jpg
1ee3a667d5b3b37cd5d9734722cc02d6
35c89c26aac398a5d93b52d8aca44ed42d8c77f9
82829 F20110114_AABTUX block_a_Page_12.jp2
f7d9227bbcd32272b502bfe48179d7ff
ea6e438b14202f43115739762c1a77e843fe1bd1
F20110114_AABTZU block_a_Page_71.tif
9e964a24e39cb09904ebb8c66733a02d
cf24e471d3af3e6f2c1ab150e0d31a29f24f344b
8192 F20110114_AABUBV block_a_Page_49.pro
646c89d05aa1e360a070b132b5f99091
5db20e58427d1016a0afd7d2810a0e7c0516ed7f
2905 F20110114_AABUGT block_a_Page_04thm.jpg
1dc7fa5c59193058748e6aef95896f0a
bc7a41e80f4ad895028f552811134061952faebe
101054 F20110114_AABTUY block_a_Page_13.jp2
78361877c0a105e31c0063fcf78ac5f4
1a37a424b3cf73e6fb9da451bcfe1972c5d6196d
F20110114_AABTZV block_a_Page_72.tif
1a170d1324432b22338091b2ab694de1
8f7db44593cb2bd624a7e95c94d38c2ae916ea63
47352 F20110114_AABUBW block_a_Page_51.pro
4a293c327fa5d47a0716fc7515d229f9
2f93f7cd7f9d8caee1b9663871c0d24da36d6532
14048 F20110114_AABTSA block_a_Page_11.jpg
6bb365cd2ac68c83343912daba3131ad
147dec5cf07c854faa033cbac117808426b91312
18506 F20110114_AABUGU block_a_Page_05.QC.jpg
df18cd68b19d3c2166fb5862afd81bff
0288dfcf186a4b0d91c29538709ede57181cf0cf
99957 F20110114_AABTUZ block_a_Page_14.jp2
f8e6cb83f0da0ee540a909f69d9f980c
0b78ba38d89a9629cea9d3832aa9e230604c9c64
F20110114_AABTZW block_a_Page_73.tif
db78ea498b9b57d20e255e29b6b428fe
ec81ee10596b93e8b8a1f084ed13cff7d766a58f
57303 F20110114_AABTSB block_a_Page_12.jpg
299bee6bee538677f01aa20da59dc3cf
962ec5fb457e0d203a8a59b7f3b3e36ac7cf9a9f
4750 F20110114_AABUGV block_a_Page_05thm.jpg
2ca266213c05c87c138607760c027ada
9497277b259c1999677e474d31d1c98474528870
F20110114_AABTZX block_a_Page_74.tif
60b2671299f1dd0eb5a037e335f93b2e
d45ff06a4a8246b74dd75b85749c8e3a9f50a966
17360 F20110114_AABUBX block_a_Page_52.pro
d2cb121329af7cb62b6ae8330e75f021
760fb11cd876b78135d6b7556b6a2dad24879a70
67931 F20110114_AABTSC block_a_Page_13.jpg
4dfe0bb4f33971b87831cca179f4d4f3
110fc05624b81e29b7611aebdd6cad4dadc5978c
3854 F20110114_AABUGW block_a_Page_06thm.jpg
4577cd69984f57d362f9e24190ba3356
dc578ff0773069563b35793e0e8fa8bb76654119
139109 F20110114_AABTXA block_a_Page_70.jp2
adeb8c19e05cb5c1f22659f0a3dd2a40
055d8af79a6a2c9120a29329151ce9e4da95a255
F20110114_AABTZY block_a_Page_75.tif
c8c7b98d2239d9390c9d013cff8e36d6
20407c0c2c5b28323f56eae2223ac9c3eda7bcd4
33304 F20110114_AABUBY block_a_Page_53.pro
83358ab40560616afb6b4cadceade61b
b3995ca78011a143fce1f9cb5606c5ec9c570f09
66493 F20110114_AABTSD block_a_Page_14.jpg
dfd7cc504e867193045cb2ab4b7f40a5
82bdab3b0550ae89fd01a53f91824905a6afb50b
5164 F20110114_AABUGX block_a_Page_07.QC.jpg
0da4db4a0a154fa875305ea794b6b161
8f9452d7677dec9eb1bf80d193b0b39c34780ff2
129271 F20110114_AABTXB block_a_Page_71.jp2
13d3e00cea5f27d9cbf4cb98868c3474
8eb1a7cc3faf90ff9c2ec17038bd1cd5f5fe983b
F20110114_AABTZZ block_a_Page_76.tif
6786ea6af52086a2d09bd87ae8604da5
bb3956b8c6a4bdd62768fe90cc157394adf98fb5
47834 F20110114_AABUBZ block_a_Page_54.pro
040bd0a3ee01e08e6ed7ef6a6c826bc0
d7b0767e241980ffcfe6f41cbd6f76307c536f26
68568 F20110114_AABTSE block_a_Page_15.jpg
3b37f6ece84801e14cf6b3ded457b75d
578192fec484e6c8cf29ef692993dc31472712ba
1931 F20110114_AABUGY block_a_Page_07thm.jpg
840aa3cc2bbee77e686ac5c30550d408
c210ce7cda03b4af6e75d4e3ad3270929ba8ba6e
131669 F20110114_AABTXC block_a_Page_72.jp2
0728d6cd4f6b6f12b29f19fad465cc89
5f5e3e9a7ad21d55e5ed22d08e61ea817567c986
48239 F20110114_AABTSF block_a_Page_17.jpg
2a0e307e47550476997db9d87346d1f2
b96f22b3b807dbec64832ae90567d70cc36ddabd
19600 F20110114_AABUGZ block_a_Page_08.QC.jpg
51be89e53a3a9c4d059875653fe2e384
698aa68c39e02a0b7b7cf74bfb1467ec82c81add
497 F20110114_AABUEA block_a_Page_32.txt
d345058aa3b319311477185a35d1dc46
04f00f9fe819caaf044e2d1750fa8acf47eb6023
130827 F20110114_AABTXD block_a_Page_73.jp2
7bd08b73d1f2833a0480b6d399fe55e7
68b3253595fbc61d42b99ddb4802357eae93549a
72029 F20110114_AABTSG block_a_Page_18.jpg
64395d1494ba373b7911df0af02502ad
b72d17327304f1bd88f1a0ad8959da7e18557053
1966 F20110114_AABUEB block_a_Page_33.txt
d534446f8f216b98eb4a69e38857228a
125bebd28f0d21810767d25cce8af357b53c081d
131290 F20110114_AABTXE block_a_Page_74.jp2
0cb4930819e538a301d13a4dd46a6262
9e9044833a5fd31274f1d9f623f0f3abf30883f5
62311 F20110114_AABTSH block_a_Page_19.jpg
69927a56701e32e2ccdc7dc6c48b0f5e
cfc8ba13f6c690a1994c8a5127688b2d39a04004
1648 F20110114_AABUEC block_a_Page_34.txt
4d00eef89c0fb4d9205c97af6c85829b
876bea8e8578ee03b8e4a4d39962dcd72723d244
131129 F20110114_AABTXF block_a_Page_75.jp2
fc058b4e0e6e52b7a7b0620b5c22c66c
d9a3646fe0e8d8e2e155ca1ad7fbbbbd7a691ba0
35693 F20110114_AABTSI block_a_Page_20.jpg
db01ccff0c5dd72d781925c756ac0363
f80b704477cda91c09d289be93ae5b89589af664
6300 F20110114_AABUJA block_a_Page_41thm.jpg
3d333299200b7888212fe9e0ac7a1cc6
8fea7a63a755f9ae6118d366501e6df5a5cc94c8
1756 F20110114_AABUED block_a_Page_35.txt
ed95d05fe3e353583e6a335c73272e7a
745f2c29d8f4a6eaa7b321288fac3e75de05595c
112863 F20110114_AABTXG block_a_Page_76.jp2
0f78ae229a903095c74a202cf40a8d2a
951a587d65935437fffb19a69ed0a35082ca61f1
16162 F20110114_AABUJB block_a_Page_42.QC.jpg
10b635914ff8fe24106b64af5d9eb3ec
dcaebc67943bd4229657d323b7d77fe4f3c89ab3
1998 F20110114_AABUEE block_a_Page_36.txt
166e70ddf126f0929915ec350b43942b
09141188d9849398b504279b384da955b2adf12c
F20110114_AABTXH block_a_Page_01.tif
619df07619e45c6cf31b2f1829726541
4214233be95f72d7007be7514b6d8094b068a3b3
56054 F20110114_AABTSJ block_a_Page_21.jpg
fb4f8ec28a7d28ad6511a89fd55ff984
3fed48350c7b3fb7ae550c052175986d123dc624
4918 F20110114_AABUJC block_a_Page_42thm.jpg
3de98b35c432354925c44c15136a71cc
cde71d4b5594d2dd8649a1e9c1056fac70cae0ec
1997 F20110114_AABUEF block_a_Page_37.txt
1513943905571bd59527974884b2ff99
4f9220d1aa44d2bb898e3dee5355a12da80976f5
F20110114_AABTXI block_a_Page_02.tif
4a78dc08545f8e694c2e1d2f72629c12
fdc8dfcd0757846ddeb3093a395778fa59ae400e
24626 F20110114_AABTSK block_a_Page_22.jpg
0371c5440399da8faf62818ae70b3ce4
390735233ab9d1c84ac77d19c2780cda06bed8dd
19646 F20110114_AABUJD block_a_Page_43.QC.jpg
064c861590e880da62b8c6cd3a6e56e6
41627d71aa1677c0ddd2701cdb89928a4f28855e
1237 F20110114_AABUEG block_a_Page_38.txt
a42256e745511f329ca61a4984df0d7a
467e1cb79a67645e20abfc87bc0c636609597366
F20110114_AABTXJ block_a_Page_03.tif
f71df2cbae3e1094d828112e6237aa78
3294c210c547487cbf7b1e25cafbde601e235925
69559 F20110114_AABTSL block_a_Page_23.jpg
37636721943779cd941f65331e8cf551
8d6d41292ec8192fc010fb48f967a4c22290871d
5419 F20110114_AABUJE block_a_Page_43thm.jpg
d1c8ac8d02c8dfecc3fc80669153148a
5b41fc2558d4fb3bec3948ec7a539ebf6f304521
1792 F20110114_AABUEH block_a_Page_39.txt
d6c7ffce6861d54ff5ba57ca7bbdc37f
5a91a3ab983028105b91147ea0f266cdf8732653
F20110114_AABTXK block_a_Page_04.tif
656a9d1d6f5a725acd730865ea85ce2f
124b08c63a07faffae007e8735935ac8b7178061
42412 F20110114_AABTSM block_a_Page_24.jpg
82632a6edc45442bcb970375f300497d
bbd8f9deed69a01318edde40bb0512c63e270de9
16936 F20110114_AABUJF block_a_Page_44.QC.jpg
f2a808b0c570ad5a9b93093a07c3135e
559c85abb0d8083a4854cef3e8e6e96e35429698
2045 F20110114_AABUEI block_a_Page_40.txt
2f8ffb56e17c05c1b12d98a2492b772b
7c29658546686ab1cbb250a278c9913d45ca3e5a
F20110114_AABTXL block_a_Page_05.tif
a2499bf467773c4f86514cfe4e08fc39
36e267a43473f543d11ebf7121acd570a9d70b1f
67464 F20110114_AABTSN block_a_Page_25.jpg
769789c30c265cd1da03fe36279875e9
c61d7a5659ed15b405f3b3b061de29ead60ab88f
4980 F20110114_AABUJG block_a_Page_44thm.jpg
76d6aac27aa77f0c708f905c2d9b36cc
5d88bb95e9071984f279c27c190e9a0c98f97e51
1788 F20110114_AABUEJ block_a_Page_41.txt
be8158c3a91618f3fe25a50d77de8bb1
2a0b2d00106479a601c1d2f0ad2ca49b4388fc38
F20110114_AABTXM block_a_Page_06.tif
9375132e8669f8eda20a3cdf4090971b
2b0f27f3d080fee95da521396b1a1fbc30f9b324
65427 F20110114_AABTSO block_a_Page_26.jpg
a8075105f1233186ec3fba7cd873daf0
37b5a41c04e35bcb0bee579e5a11f42495ab60db
23817 F20110114_AABUJH block_a_Page_45.QC.jpg
fc8a06fac016cc8bfe99bbe80f069f09
026bf0484a4bee9465b2e61efd3d008df324b08e
905 F20110114_AABUEK block_a_Page_42.txt
77c39624d2027da29eaacc23f1373879
d2c884ee90c90a82ca17e9f74ef24f03b105dc42
F20110114_AABTXN block_a_Page_07.tif
a0119d94db933b9e01408379b01b0cd9
d931cfde1bef4397f69bf1e162d5ee115c5a71b6
56820 F20110114_AABTSP block_a_Page_27.jpg
860760fde14b62888779bcce2f7f6cb3
5fd345d818c9d3ca67f9527f629e380428c1dd6f
6894 F20110114_AABUJI block_a_Page_45thm.jpg
6c194850b7a9ae185b27a76d1c028103
02794b4e6a5517921d24fb64ae9b2e19e09d62ac
1581 F20110114_AABUEL block_a_Page_43.txt
db9ce5204e4bec95bd5901c1c1b57289
91feb1210470403e8c7ab4797dcf4a7b9469c62b
66569 F20110114_AABTSQ block_a_Page_28.jpg
db02075e77edf1816da693e9719db9be
c800cb5cd431cf503bbd782d0e09b73c7a17b78f
15024 F20110114_AABUJJ block_a_Page_46.QC.jpg
8c1a63ec900750cf81771e3c82bf8048
bc119600b1fbb6290193c7e25a947bd261318109
1329 F20110114_AABUEM block_a_Page_44.txt
cbab9f2c5f6c6d37f27fd2d37d4003c5
595ad2f1271f223a6a7a9dfe99c0cd901fe06db4
F20110114_AABTXO block_a_Page_08.tif
2d07622da44a9fa8440df9e4b1025e44
1ec59ccb09499355ef964881ce2a7bb4289b3a90
48241 F20110114_AABTSR block_a_Page_29.jpg
8bc3c035c2f3dc018fc4f6e225af8ada
c18ac2fb73bb423cbe3aae9e80353583a8c3fd75
4340 F20110114_AABUJK block_a_Page_46thm.jpg
9c8023041c0720cee42c4de03224a7c4
58345644a6852914f73c27f47fa5910087b23e03
F20110114_AABUEN block_a_Page_45.txt
db7cf602107adf3a9aca52ca686abfab
12870ff2573a850b11cf39dcf371536eb55647bf
F20110114_AABTXP block_a_Page_09.tif
fad2391865fa0c72147600bf3468fded
e7379e6f9a6f3600a39a96535d2a955d31cfbcbe
61571 F20110114_AABTSS block_a_Page_30.jpg
5c9a43316ede40641304b795bfc02c32
7915d55357c366b73ab36fe83939af4546087596
22747 F20110114_AABUJL block_a_Page_47.QC.jpg
e549f000ebd01591075d4081ad20ee38
55334b1a7229405786ba83ae5bc16d7eb631c3c1
1437 F20110114_AABUEO block_a_Page_46.txt
93539eb8ab1926aefbc8b525a30e2a05
da914ff48922f3c01634b8e471f995222bdcdfe8
F20110114_AABTXQ block_a_Page_10.tif
75fabb36fd9d49d5b44707191a925c96
c1199ad35452a891b983cc1cb7365f32fb0aa20a
53676 F20110114_AABTST block_a_Page_31.jpg
4d3a72dffdbfe0df850cf07a9f36eec8
cd54517a539a0af18cdbc35a1012b36aa23473f9
6633 F20110114_AABUJM block_a_Page_47thm.jpg
241c505fb791b8188c614c1848a00022
d93e8e7475e73c719eeeced96ff94a1b50adf683
1930 F20110114_AABUEP block_a_Page_47.txt
8b2daf476af996edfdee2f1ead42bcea
6119fb2cc908b30d9c1b9ee9ffb7c50c3021eb30
F20110114_AABTXR block_a_Page_11.tif
7ab168e2ffa807dffcbbc6796db53343
cf1ccecb616ec53a445f67d78076e8151e6a3f07
46516 F20110114_AABTSU block_a_Page_32.jpg
537ef63e4c4c3dd82ccd45c1e66b5c60
dd164eff4dc042fa0352b9d47dd1ac0a09d715f6
23663 F20110114_AABUJN block_a_Page_48.QC.jpg
dbf4d98e44bb9a3de2f980284df45f4d
7515f8e7d98534fa5a263878eabddb6e4473292a
F20110114_AABTXS block_a_Page_12.tif
ee3bc10b215a95c569f75fb5973906ad
bfac46214bed1a511b1f8f06f016419bc5df7d1a
70760 F20110114_AABTSV block_a_Page_33.jpg
39811845b4d772910858a27b2778cf0b
fb9f843c0fcabbb30297273be5091f7856721a83
1981 F20110114_AABUEQ block_a_Page_48.txt
b1333385699bdacd9b260dcf83729845
326987d000a85e26ec0c1b1cac0d9d6ec4617f76
6725 F20110114_AABUJO block_a_Page_48thm.jpg
69a43cc51e68c9d51b104685f48d7101
b2c727429ed26e5085e0aaa81b639fb553b1c427
F20110114_AABTXT block_a_Page_13.tif
cd32f0b7f0c10bd9d9b78d0fa63216eb
f6e8a019b79eeb7fc9d2a6566b3beceeb080aa36
64698 F20110114_AABTSW block_a_Page_34.jpg
9194013a2fbbc0ca184f9dc51701bd40
fe19a823682753c516764f97e9c552198837dbe1
545 F20110114_AABUER block_a_Page_49.txt
f4be7a56fe19936458df5d67df752a43
c8bd55e58571b38e0f8f7e72ce3f5863429d5fe3
15680 F20110114_AABUJP block_a_Page_49.QC.jpg
57ee45be20a790f5be512a6a7b4abc08
fd1b71dee15dd71fd793f40519f79e7781137618
F20110114_AABTXU block_a_Page_14.tif
fbbdb38b01aca7f312c47dad47956976
c6b390322657503d5b2bc2d1b24bb41a86f62b75
64187 F20110114_AABTSX block_a_Page_35.jpg
8a3b32cdf631d9deb3a08ec51c787377
9989a9d1e8c04840e39b39bdefa8457c8be33a28
1906 F20110114_AABUES block_a_Page_51.txt
f9084258b9284a839845e10801fa89bc
60b83dc380c5479766f35697a5dcf85b854b80a1
4707 F20110114_AABUJQ block_a_Page_49thm.jpg
082167f14e3d0ede7341391b7e80e76e
81d4941c13bbe516840446e7c6a8d2752f24f3b6
F20110114_AABTXV block_a_Page_15.tif
3b8a5fa719084ff7c1b78fa0956bf60c
196859d6567c4348380ae68d810c6d2e8fc489fb
70714 F20110114_AABTSY block_a_Page_36.jpg
83a9fa7f4243307edfbe69bb462f871e
16cbc360825c46a6bd06869fb5245bbdf689fa28
919 F20110114_AABUET block_a_Page_52.txt
48488f53ee47c1190e2e51a24a9b4324
deaf3881a768bf935e95fa04e5fe603dcbfc3774
24206 F20110114_AABUJR block_a_Page_50.QC.jpg
9db37321f75ea605b4a535c0511534c2
e98999d961cc72ac7bc5db103b53935a69dca732
F20110114_AABTXW block_a_Page_17.tif
4a10735e3b1698373de579539625a081
68c6107b2afe242b534e7058b105230e29df42e8
70307 F20110114_AABTSZ block_a_Page_37.jpg
2764c5512716d92979d8e34637a1ce95
f0003ebbcf88a1d119f4c0182d9e5f0fb343b41c
1829 F20110114_AABUEU block_a_Page_53.txt
dbefcd25b36eeb4dc8dc50c2797336fe
b4f08d4484853bbe4c0c199abbcd9634546a634e
6908 F20110114_AABUJS block_a_Page_50thm.jpg
4e5ec3ec6af442ad17c0da6284ce7108
9bcb6f21642d42c2fe65ca54d2088ad9f3231d3d
F20110114_AABTXX block_a_Page_18.tif
2ff73e07f40ed894b5db1206f34ed4cb
cd87a5c991daf9ab5d6e259350686d7d8ed9d686
1896 F20110114_AABUEV block_a_Page_54.txt
46b6731089b406f7ccb5d2c4843990e6
f5b8b077a23d47a8576959f436367dd1f7186d71
22207 F20110114_AABUJT block_a_Page_51.QC.jpg
57861bbb9a383bfc2187b9d85dcbef22
1a63532bc9e72bc1c8e1499bff3e1e9f6cf4e8ff
F20110114_AABTXY block_a_Page_19.tif
5044734843a94ddba560e06341742095
71980950268f5966a64c2d35f3df3e9dce6896c7
1977 F20110114_AABUEW block_a_Page_55.txt
f500bcd346bba2f7f19dd70a1cf91dee
cf5ad28a9a40bea5730481c53e5e42b6b12b72ff
103754 F20110114_AABTVA block_a_Page_15.jp2
a71fe9f8125c996c759605934f2f2a22
be87c4e91a7dcec640e7eb1ad8fefd6593af6030
14245 F20110114_AABUJU block_a_Page_52.QC.jpg
93bc614b5cd15589fc6a508598e9b6c1
1c5979d742f9e4ce43473e588487493c132a6eef
F20110114_AABTXZ block_a_Page_20.tif
f66037b3044721f4dce886b44a00b789
fba4bf01a1f0fa0aa4b3675c6a48f7efe675175a
275 F20110114_AABUEX block_a_Page_56.txt
03a34562562247bf0f04345fd4465e2b
5b937f0e94a8ac642c956bf282350e8b09c01cd5
557480 F20110114_AABTVB block_a_Page_17.jp2
65a131af475a7b8922d3b8d2ea103e6a
d35ca068db62ef48ab1d54b0e78022ce64e311a2
4063 F20110114_AABUJV block_a_Page_52thm.jpg
4982ef819b07ff4b2c3fe9f0d52613c7
f47e9ec42340e5da3209fa7ca079600d2d698168
2195 F20110114_AABUEY block_a_Page_58.txt
71095eb2ee16e24f83ed2ebd01bc723d
3f5f8a3fac63ee53b19a7180bc247bf47aa7b181
107079 F20110114_AABTVC block_a_Page_18.jp2
c92178d8032cc05fd41c28d3b76e0a45
a1cd78dc024e3300008cf5dbd183d582f7a1cb22
19942 F20110114_AABUJW block_a_Page_53.QC.jpg
420cd17010f0196c2d9aea483bbabf08
44c8dc1750a2d9cb9fc040e532f15169edcdf746
50210 F20110114_AABUCA block_a_Page_55.pro
febe1747fce3ed277fd897698af69e4f
742d940f2e1cd4d9f3517cc1811726f1d0e0a776
1759 F20110114_AABUEZ block_a_Page_59.txt
a0c071970f884e6a23d7ab5655f9bdd3
cc356d73f976e6c491ac58eecffa2341f768d89e
403555 F20110114_AABTVD block_a_Page_20.jp2
40122dff01121f39d39081802757bc4a
c654a5f014fb95b494957409f8d2a6e2da8540d1
5598 F20110114_AABUJX block_a_Page_53thm.jpg
848b70b4d78ade0fc8d5b4ffc1f477fe
90aede25ceae4b09f509ff0b2fe51743797579e0
6811 F20110114_AABUCB block_a_Page_56.pro
a9d9eacd438a025aa494df320a005335
7601bab51536eb4130fde4b35dd14195c654240f
745556 F20110114_AABTVE block_a_Page_21.jp2
1c974499c0064004465100e895fa5530
dbae1cb227536dab688c2eeed5d4d805e02d0a10
6516 F20110114_AABUJY block_a_Page_54thm.jpg
edb8187440f9c513e26deac3a70a3587
8078b98015940b01f8551a621dff52e69cca8f65
35448 F20110114_AABUCC block_a_Page_57.pro
4d92312b3a96ca285c89a498bab94cca
3c48947fc9c0cd6fa2660828c68348ff61456646
200826 F20110114_AABTVF block_a_Page_22.jp2
7e5c0cfda8cf9e5dc32bb17c451df390
0e3ae97cf304b9e43df8685e002aabec9cfcf032
23664 F20110114_AABUJZ block_a_Page_55.QC.jpg
b7bce758379a063f3cfb0a90e4182819
fdbd50e076a526900cfb18f280a774cf2ca2738f
5355 F20110114_AABUHA block_a_Page_08thm.jpg
46979be92c495fa9f3617ef8ca91d8f0
76420960318887957bdd6abcc10650f1ee8070d2
44646 F20110114_AABUCD block_a_Page_58.pro
5dbc5f01a62c0acd1ad55b9fa76343f3
15e1ce3dc3c06fa47b5c1094484e557760cb8f02
101203 F20110114_AABTVG block_a_Page_23.jp2
46f6c2b0d274eb62d5aadb46e4aa20e3
9964ea99abbea22ae43a8f5dd02b1800d9cf4146
5000 F20110114_AABUHB block_a_Page_09.QC.jpg
5dd20d80578b3c495b4abe0bf413a1a7
39c93f3bc869a29943dc8d88bee455c36440bd4b
43647 F20110114_AABUCE block_a_Page_59.pro
a314562e1b3c8d554a68353dbebd2851
78f2f70191ae8b09f51c677fe8b55e747c82d28d
59503 F20110114_AABTVH block_a_Page_24.jp2
219104875baf5b5b5f29b1ac4a477192
a614ce4d2aabf3d32a3a234a4c615b693687369f
1797 F20110114_AABUHC block_a_Page_09thm.jpg
086d7b225af8adae8406d7f1ce801eef
baa32ede7af7759dcf7e1d0ad114524bd2dd82c3
40765 F20110114_AABUCF block_a_Page_60.pro
91e3c3421f726ece0d843a0499be3951
44539612843dd06137f776d9419899f70ed150ea
95433 F20110114_AABTVI block_a_Page_25.jp2
e2b4cc9029a4ae46c5d3cd4f7ebb5a08
733e4d9a88bb53eb095190ad99b9dce9c8988e97
19234 F20110114_AABUHD block_a_Page_10.QC.jpg
090704d85916333ac3bba3e13cd846dd
cc0b9bca6717b16f0a750d1c228fb1147c99cd29
92744 F20110114_AABTQL block_a_Page_19.jp2
994851722a40c2be9c624f10ecbffeb1
450f6ff9aa3075dad3a1799bf12b1717ed200555
49092 F20110114_AABUCG block_a_Page_61.pro
96144cbfa98504bc3ef9169b29e16ef2
7dd4c2a9abc626d40828a66c0a6ab333528ea03f
873608 F20110114_AABTVJ block_a_Page_26.jp2
fe57d8b5f81396795da3ccdc02713a17
39b468e0de71870f5114c37ad6d51797035dc5c9
5458 F20110114_AABUHE block_a_Page_10thm.jpg
91673a5283d6cbd0a5e1e1a9cd0cbd4e
7634b626d239e216248877a9a581a832d68e6d18
101122 F20110114_AABTQM block_a_Page_16.jp2
75998a21cb4bea440788e5c5d1173139
b14f29e6c277ce98bb456091d9dbf49379aed389
47047 F20110114_AABUCH block_a_Page_62.pro
cf8cb88df48bcb1384769348bdc5bfa4
501a80f1df0474be8b5ef732c949057d4ef3f1a0
832669 F20110114_AABTVK block_a_Page_27.jp2
1125c2418a3804bd9c1b83cc52f4c76e
656214b8dc1ad851f2241e2129a8ff291de4daa1
F20110114_AABUHF block_a_Page_11.QC.jpg
92e9a287e7fde7ee9da485cf9df57ce3
1a0cc83d742741ea8f8d47617a07dd8fc3b641b8
3554 F20110114_AABTQN block_a_Page_63thm.jpg
dc6838d1c11ef3e7af78c174c3c5855d
1c6cf0ebc787904aa23755c252a37940034cd021
20906 F20110114_AABUCI block_a_Page_63.pro
562454145c2cf263b392231f620e408e
cb226ea17c951f75c2d7b2ebc051656325cb465e
597743 F20110114_AABTVL block_a_Page_29.jp2
0e59ded8d36f2e868c96fee846207478
db6443464f8ab4c11b5daf0bed71ebf397cbc5fb
1698 F20110114_AABUHG block_a_Page_11thm.jpg
1f26a26ca61ab4e97d5ebc931c9fde1d
4762a911faba235d440ef7cb349ab146f3c4eae7
F20110114_AABTQO block_a_Page_27.tif
2b264be8819146b70091bac3dc5745ed
b0b285c4ee776d6f837476585219543a41ef480a
44662 F20110114_AABUCJ block_a_Page_64.pro
06038f5610adb1afef03cb7804046cf8
e0503359fac66889778e7c0fd0607309c533e910
18478 F20110114_AABUHH block_a_Page_12.QC.jpg
a64201af0f5fe7e9860355a1b7765daf
840ec37fa7bd227be4411565010f2ecd13607287
F20110114_AABTQP block_a_Page_38.tif
fba97adfd41b700cdbe2a69a24f9cbee
05536745222cbfcbbbfe3fc014204de826920401
47006 F20110114_AABUCK block_a_Page_65.pro
5d9644a628f0f2672d2f3a1c8cfe2256
d6ab7be8986a2933c752b629e3f1814ffa4e8d24
873012 F20110114_AABTVM block_a_Page_30.jp2
5ea10b67d34016c7895e417cbc581ade
a773f98b33c7b216961fb7f64e91487cab52e418
23019 F20110114_AABUHI block_a_Page_13.QC.jpg
56d3f6de161781cc676aa99b36cedad8
f59c61a85b1ed11b66f36823daaefe71c674fc7e
51324 F20110114_AABTQQ block_a_Page_50.pro
0b5ed8b16099ddc71e1d7d6d106df84c
a9330c490dfc2aec19201a40825bde2a45021b2b
48443 F20110114_AABUCL block_a_Page_66.pro
ca2720332b62ab401a776bfb877d30db
1bd119256699b4c0830d9cd2ac6625f04dff4397
655739 F20110114_AABTVN block_a_Page_31.jp2
fcc4784b6853ed75fe267bd2d034f835
9e2fed315fff607d8da397847cc3a2c7fcd10b51
6375 F20110114_AABUHJ block_a_Page_13thm.jpg
eb57a31b1e49543f69ee5fdcd8adf6a0
1a3405ead10e78e9405aef06b87ff76cc19054fd
22302 F20110114_AABTQR block_a_Page_54.QC.jpg
a3e083f8f5049eeac0aefea999376b02
d3cd1137fe721b47724e3d9bc52d2ed06f41ea3d
42124 F20110114_AABUCM block_a_Page_67.pro
5769893e892dea24c92a70f16d56abf0
7604e8ad11f437866e9fcfa34e96ac8281d3e592
1051944 F20110114_AABTVO block_a_Page_32.jp2
a191aa44a3ab12c0b7473c1b520ca033
8988d6e9a4d15e0e082dd2c5ac5f3d0558e8adaf
21191 F20110114_AABUHK block_a_Page_14.QC.jpg
80ae9411411c12be787c8fb4b00336ea
9a6237ca3091f8ee5c28948d4b2beb861b31f52a
6502 F20110114_AABTQS block_a_Page_37thm.jpg
6350abf02f900de15e922d71825330e1
b3946ecb7ccf0547e891772af1f05a7e36689875
10078 F20110114_AABUCN block_a_Page_68.pro
932cf654e2fb7913420209deeff3312f
fc9f3441c4c8c8c17b2371f7a318f4c295372dfe
104564 F20110114_AABTVP block_a_Page_33.jp2
054856271020a70f98ca9dee814ade8b
bf3ce1ffed0d15ef951ab4062db4668943d1a0d4
6178 F20110114_AABUHL block_a_Page_14thm.jpg
5f1b6a69b6ccfd97eb343370c53c8d30
dbf2e0fabb35803a34c09774ab6ac7f4fdb57902
25603 F20110114_AABTQT block_a_Page_27.pro
4c66046e3eb555daf60fff5b2d79873a
16ffe324ff3628a0c57dfb167a4023a17a865dde
49012 F20110114_AABUCO block_a_Page_69.pro
d636ed3c805bc65e4376aa89a38ce3cb
7107bfea7edd1417e37980bdf830915c95952215
869813 F20110114_AABTVQ block_a_Page_34.jp2
b3745a62c9409d77a0577de105a37a62
5031b04bd62a60036cfb1cda43f7aec5f4ab078e
22861 F20110114_AABUHM block_a_Page_15.QC.jpg
89eb487003618fa2218c8389a3780d29
5daf0ffb998dfe47c3459d0edc7acba82e739e0c
5348 F20110114_AABTQU block_a_Page_12thm.jpg
82bf9141b179edc496fc4fa68a909dc7
c91880299e45ad44ceb43bd462999abbe09a313e
65793 F20110114_AABUCP block_a_Page_70.pro
9fa2ba7ee1506c8ee8abe345ee3e3b36
2d2a612023ea298a5688bce8a1781b17aeb05fd5
96224 F20110114_AABTVR block_a_Page_35.jp2
7050634754f8ca24e3119c8cbd8abcde
8d8ad35842185d8a1de7b65e4ab0ad1bfe029ae9
6432 F20110114_AABUHN block_a_Page_15thm.jpg
c4604bf4d60ff5b0549573a5b9a3f762
48f706812abd99ceb8c5f4c77a693500ae7aceaf
20347 F20110114_AABTQV block_a_Page_28.QC.jpg
e5a7d3099e1a4acaed5366d8b866dca2
ebebc9779f84d1deb6d6f07731178f9aa450f026
60478 F20110114_AABUCQ block_a_Page_71.pro
e50b25cd36cce02069416a5adfcfd4e8
310d94ceccfec1cbb77cffa44bc8b08bf9c9eea2
105870 F20110114_AABTVS block_a_Page_36.jp2
aa7a4ced15f968339176249bc561700d
c682d4e7516937dd0e9a41bf4a676cb6eb1a188c


Permanent Link: http://ufdc.ufl.edu/UFE0007381/00001

Material Information

Title: Role of Arabidopsis and Tomato Phytohormones in the Response to Bacterial Pathogens
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0007381:00001

Permanent Link: http://ufdc.ufl.edu/UFE0007381/00001

Material Information

Title: Role of Arabidopsis and Tomato Phytohormones in the Response to Bacterial Pathogens
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0007381:00001


This item has the following downloads:


Full Text


















THE ROLE OF


ARABIDOPSIS AND TOMATO PHYTOHORMONES INT THE
RESPONSE TO BACTERIAL PATHOGENS


By

ANNA KATHERINE BLOCK


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA INT PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2004

































Copyright 2004

by

Anna Katherine Block


































This thesis is dedicated to my family who support me without question, no matter how
unusual they think my choices are.
















ACKNOWLEDGMENT S

This work was supported in part by a grant to Harry Klee from the National

Science Foundation (IBN0091064) and the Florida Agricultural Experiment Station. I

thank my advisor Harry Klee and my committee members Jeffrey Jones, John Davis and

Shouguang Jin for their guidance; Eric Schmelz for the measurement of the

phytohormones by GC-MS; the Klee lab for its support and advice; the Jones lab for the

use of its greenhouse and help in tomato plant maintenance and the Settles lab for use of

Arabidopsis growth facilities and other equipment.



















TABLE OF CONTENTS
Page

ACKNOWLEDGMENT S ........._.._ ..... ._._ ..............iv.....

LI ST OF T ABLE S ........._.. ..... ._ ._ ..............vii....

LI ST OF FIGURE S.............. ..............viii

AB S TRAC T .........._.._.._ ..............x...._.... ....

CHAPTER

1 INTRODUCTION ................ ................. 1...............


Plant-Pathogen Interactions ............ .....___ ......__ ... .. ......1
Pathogenesis-Related (PR) Genes ................ ................. 2......... ....
Bacterial Pathogens ................. ........... ........ ... .............. 3.....
The Role of Salicylic Acid in Arabidopsis Defense Responses ................. ..............4
The Role of Ethylene in Arabidopsis Defense Responses. ................ ............... ... 7
The Role of Jasmonates in Arabidopsis ................. ..............7.. .............
The Interaction of Tomato and Xcy ..........._..._ ....... ........._ ..........8
Symptom Development and Systemic Responses in Tomato ..........._..._ .............. 12

2 THE EFFECT OF THE REMOVAL OF SA ON PHYTOHORMONE SIGNALING
NETWORKS IN ARABIDOPSIS INFECTED WITH VIRULENT PST................ 14

Differences in Disease Progression and Symptom Development in Salicyclic Acid-
Deficient Arabidopsis Mutants infected with Pst. ..............._ ........... ......... 14
SA and Jasmonate Induction in Response to Pst Infection ................. ................. 17
The Effect of Coronatine Production by Pst.............. .................. 19
The Role of Ethylene in SA-Deficient Arabidopsis ................ ................ ...._ 22
Discussion ................ ................. 23..............



3 SYSTEMIC ACQUIRED TOLERANCE IN TOMATO ................ ............... ...28

Introduction ................... .. ........... .... .. .......... .. ...... ........2
Virulent and Avirulent Xcy Led to Systemic Acquired Tolerance in Tomato..........3 1
Prior Inoculation with Xcy Led to an Early Production of Ethylene upon Challenge
with Virulent Xcy ..........._.._ ....... .............._ 3 4...












PR Gene Expression Indicated the Necessity of Ethylene and SA in Systemic Signal
Generation. ........._... .... ... .. .._._ .. ....... ..... ... ........3
Avirulent Xcy Induced Greater Local and Systemic PR Gene Expression than
Virulent Xcy, but they Result in Similar PR Gene Induction During Challenge .. 39
Discussion ........._... ......___ .............._ 40...


4 DISCUS SION ........._... ......___ .............._ 46...


Phytohormone Networks in the Responses of Tomato and Arabidopsis to Virulent
Bacterial Pathogens. ........._........... ....._ ......_ ............ 4
The Compatible Tomato-Virulent Xcy Interaction. ..........._..._ ....._._ ............. 48
The Compatible Arabidopsis-Virulent Pst Interaction ................ ..................... 49
Systemic Responses to Infection.............. ............... 51


5 MATERIALS AND METHODS ................ ..............53. ..............


Plant Materials and Treatments.............. ............... 53
Bacterial Culture ................. ................. 54.............
Ion Leakage ................. .......... ................. 54....
Ethylene Measurements ................. .......... ................. 55....
SA, Jasmonate and Coronatine Measurements ................ ......... ................ 55
RNA Extraction.............. ............... 55
RNA Gel Blot Analysis ................ ................. 56.............
Real-time RT-PCR ................ ................. 56..............
MCP Treatment ................ ................. 57..............


LIST OF REFERENCE S.............. ............... 58


BIOGRAPHICAL SKETCH ................. ..............66.......... ......
















LIST OF TABLES

Table pag

4-1 Comparative phenotypes of phytohormone mutants in Arabidopsis and tomato......47

4-2 Comparative phytohormone profiles of Arabidopsis and tomato mutants ...............47


















LIST OF FIGURES


Finure pag

1-1 The role of sid2 in SA biosynthesis and nahG in SA removal ................. .............. .6

1-2 Jasmonate biosynthesis. ................ ..............9.. ......... ....

1-3 The structure of coronatine ................ ................. 10......... ...

1-4 Ethylene biosynthesis ................ ................. 11......... ....

2-1 Bacterial growth in Pst DC3000 infected Arabidopsis ................. ............. ...... 15

2-2 PR1 and PDF l.2 gene expression in Pst infected Arabidopsis .............. ... ........... 16

2-3 SA production in Pst infected Arabidopsis ................. .............. ......... .... 17

2-4 JA and OPDA production in Pst infected Arabidopsis ................ ............. ...... 18

2-5 Coronatine production in Pst infected Arabidopsis ................ ................ ...._ 19

2-6 Bacterial growth at 72 hpi in Pst DC3000 and Pst DC3661infected Arabidopsis .... 20

2-7 Disease symptom development in Pst infected Arabidopsis ................ ................ 21

2-8 Ethylene production in Pst infected Arabidopsis. ................ ... .............. .......23

3-1 Symptom development of Xcy infected tomato ................ ................ ........ 3 1

3-2 Cell death due to a second infection of tomato with virulent Xcy.. ..........._..... ......... 32

3-3 Bacterial growth during the first and second infections of tomato with Xcy. ........... 33

3-4 Local ethylene and SA production during the first and second infections of tomato
with Xcy. ..........._.._ ..............._ 3....._._ 5....

3-5 Local and systemic PR gene induction in ethylene and SA deficient tomato lines in
response to infection with virulent Xcy ..........._..._ ........._._ ...... 38._.__...

3-6 The measurement of local and systemic PR gene expression in tomato during
infections with virulent or avirulent Xcy .............._ ........._._ ...... 41._.__...











3-7 Induction of PR genes during virulent Xcy infection in tomato plants in the presence
or ab sence of S AT ................. ................. 42............

4-1 A model for the signaling network in tomato in response to virulent Xcy........._......49
















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

THE ROLE OF ARABIDOPSIS AND TOMATO PHYTOHORMONES INT THE
RESPONSE TO BACTERIAL PATHOGENS

By

Anna Katherine Block

December 2004

Chair: Harry Klee
Maj or Department: Plant Molecular and Cellular Biology

Phytohormone networks are used to regulate the plant response to virulent bacterial

pathogens. In this work by the use of salicylic acid (SA) deficient lines it is shown that

SA, a major player in the interaction between Arabidopsis and virulent Pseudomonas

syringae py. tomato (Pst), down-regulates ethylene and jasmonates. SA influences

ethylene production in an NPR1-independent manner and jasmonate production in an

NPR1-dependent manner. Pst-produced coronatine, a jasmonate mimic, acts

independently of SA and does not compromise SA-dependent basal resistance. These

three phytohormones are also involved in the response of tomato to Xanthomonas

campestris py. vesicatoria (Xcy). However, the hormone network is dramatically

different to that of Arabidopsis. It is demonstrated, by the use of phytohormone deficient

plants and pathogenesis-related marker gene expression profiling, that a systemic signal

is generated in tomato in response to an infection with virulent Xcy. This signal is SA-

dependent and leads to the development of a systemic acquired tolerance in tomato to










subsequent infections with virulent Xcy. This systemic acquired tolerance is similar to the

systemic response that is generated in response to avirulent Xcy.















CHAPTER 1
INTTRODUCTION

Plant-Pathogen Interactions

The normal growth of a plant can be disrupted due to interactions with pathogenic

organisms such as bacteria, fungi, parasitic higher plants, nematodes, mycoplasmas and

viruses. Pathogens live in or on another organism, from which they derive nutrients.

Substances released by the pathogen, in order to penetrate plant cell walls and make the

nutrients accessible for their use, cause damage to the host tissues. These substances

include enzymes, toxins, growth regulators and polysaccharides, some of which are

induced upon host recognition.

Not all pathogens can cause disease on all hosts as some lack the necessary abilities

to penetrate and survive that host's endogenous structural and chemical defenses. The

host range of a pathogen is defined as the host plants on which a particular pathogen can

recognize and grow successfully (Agrios, 1988).

Resistant hosts can specifically recognize avirulent pathogens and cause an

incompatible interaction. Incompatible interactions often include a hypersensitive

response HR that consists of a rapid induction of host defenses and the death of cells in

contact with the pathogen. The faster this response occurs, the more resistant the plant is

to the pathogen. Compatible interactions occur between susceptible plants and virulent

pathogens, leading to successful invasion of host tissues (Ausubel et al., 1995;

Hammond-Kosack and Jones, 1996).











In both compatible and incompatible interactions the plant attempts to limit damage

and control pathogen growth. This is done by the production of toxic substances around

the site of injury, as well as by the formation of protective layers such as callus and cork.

Some compounds are produced at high enough concentrations to limit pathogen growth.

These compounds include phenolic compounds such as chlorogenic and caffic acids,

oxidation products of phenolic compounds and phytoalexins (Agrios, 1988; Jackson and

Taylor, 1996).

Pathogenesis-Related (PR) Genes

As well as the production of substances and structures, several plant genes are

induced in response to pathogens. PR genes are used as markers of the disease response

in many plant species. They are defined as plant-encoded genes that are only expressed in

the tissue in response to a pathogen or related stress. PR genes are classified by function

and homology; these classes include PR-2 ((p-1,3-glucanase), PR-6 (proteinase-inhibitor) ,

PR-12 (defensin) and PR-1 whose function is unknown (Van Loon and Van Strien,

1999).

Although PR genes are induced during infection, only a few have been shown to

have a direct impact on pathogen growth. The most well characterized of these is the PR-

1 family that has antifungal activities, although the mechanism by which it acts has yet to

be identified (Alexander et al., 1993; Niderman et al., 1995). The combined effect of

many PR gene products may be required to have a significant effect on pathogen growth.

Particular classes of PR genes have been linked to specific phytohormone induction

events. For example the PR gene Thi 2. 1 of Arabidopsis is induced during wounding in a

jasmonate dependent manner (Bohlmann et al., 1998). The phytohormones, however,










affect one another to such an extent that any direct interpretation of the roles of

phytohormones from PR gene expression is inherently risky.

The responses covered so far are induced at a local level by pathogen infection. The

plant, however, also shows a systemic response to infection that includes some of the

same response as those at the local level. For example pathogen infection can lead to the

production of a systemic signal. This signal can induce resistance in uninfected tissues of

the plant 2-3 days after infection. It can also induce the systemic expression of PR genes.

This systemic induced resistance (SAR) can last several weeks and is effective against a

wide range of normally virulent pathogens.

Bacterial Pathogens

The response to pathogens varies depending on the host-pathogen interaction. To

simplify the study of plant pathogen interactions the focus of this work will be limited to

bacterial pathogens, specifically to Xanthomonas and Pseudomonas. These are

necrotizing biotrophic pathogens that live within the apoplast. They can multiply for

some time within host tissues before causing necrosis. They use a type III secretion

system to introduce substances into host cells that cause the release of nutrients and

suppress host defense responses. They also produce toxins and other extracelluar

substances, which affect the plant and cause disease symptom development (Alfano and

Collmer, 1996).

Xanthomonas and Pseudomonas are rod shaped gram negative bacteria of the

family pseudomonadaceaze. They use flagella to move through liquid and can enter host

tissues from water on the surface of the tissue. For example they can enter the leaves

through wounds or stomatal openings. The symptoms these bacteria cause include the









formation of necrotic lesions on infected tissues. These lesions are sometimes surrounded

by a chlorotic halo. The necrotic lesions may coalesce and form large necrotic regions or

even kill the entire tissue.

Bacterial species can be further subdivided into subspecies or pathovars (pv),

which are distinguished by their host range. The two pathogens this work will focus on

are Pseudomonas syringae py. tomato (Pst) that causes bacterial speck both in tomato

and in the model plant Arabidopsis and Xanthomonas campestris pv vesicatoria (Xcy)

that causes bacterial spot in tomato and pepper (Agrios, 1988).

Many of the plant responses to pathogens have been characterized. However, how

the plant forms and coordinates its defense response has yet to be fully elucidated

(Glazebrook, 2001). One of the major tools in such studies is mutant screening for plants

altered in their pathogen responses. The screens focus either on disease phenotype or on

PR gene induction with the plant Arabidopsis thaliana as a favored model (Glazebrook et

al., 1997). These screens have identified mutants that are compromised in their resistance

to avirulent pathogens. Some of these mutants also show enhanced susceptibility to

virulent pathogens and thus demonstrate the existence of a basal resistance, in which the

plant limits the growth of virulent pathogens (Glazebrook et al., 1996). Such mutants

often also have altered phytohormone profiles, indicating important roles for

phytohormones in coordinating the defense responses to both virulent and avirulent

pathogens (Dewdney et al., 2000; Nawrath et al., 2002).

The Role of Salicylic Acid in Arabidopsis Defense Responses

The phytohormone salicylic acid (SA) is involved in maintenance of basal

resistance, the response to avirulent pathogens and development of SAR in Arabidopsis.









Mutants that show enhanced susceptibility to virulent pathogens such as Pst DC3000

often accumulate less SA than their wild type parents following infection. For example

pad4, which has enhanced susceptibility to virulent Pseudomonas syringae pv maculicola

ES4326 (Psm), has reduced and delayed SA synthesis (Zhou et al., 1998).

In several plant species the removal of SA has been accomplished by introduction

of the nahG transgene encoding a Pseudomonas putida salicylate hydroxylase (EC

1.14. 13.1), which converts SA into catechol (Yamamoto et al., 1965). Arabidopsis plants

carrying this transgene have enhanced susceptibility to several pathogens including Pst

(Delaney et al., 1994; Lawton et al., 1995).

An Arabidopsis SA biosynthesis mutant, sid2-2, that fails to accumulate SA in

response to pathogens has also been identified. This line contains a loss of function

mutation in the enzyme isochorismate synthase 1 (EC 5.4.4.2) that converts chorismate to

isochorismate (Figure 1-1) (Wildermuth et al., 2001). sid2-2 has both enhanced

susceptibility to Pst and fails to accumulate SA in response to infection (Nawrath and

Metraux, 1999).

NahG and sid2-2 respond differently to the non-host pathogen Pseudomonas

syringae py. phaseolicola strain 3121, suggesting that the catechol produced by the nahG

transgene may influence the disease process (Van Wees and Glazebrook, 2003). The

conclusion that nahG has an effect beyond elimination of SA is further supported by

global expression phenotyping of Arabidopsis in response to infection by virulent Psm

(Glazebrook et al., 2003). This showed major differences between NahG and sid2-2 in

terms of the expression patterns of genes induced in the two lines by infection with Psm.










H--O O

,H isechorismale H
O' synthase

O w sic ~ 'h 0




ch ri smale i seho~rismale










I H-O O
O-

Q-OaH salicyclateO-
nah G

calchol salic~ic acid
Figure 1-1 .The role of sid2 in SA biosynthesis and nahG in SA removal.

Signal transduction from SA can occur in an NPR1-dependent or independent

fashion (Clarke et al., 1998). NPR1 is a protein with a BTB/BOZ domain and an ankyrin

repeat domain, both of which are involved in protein-protein interactions (Cao et al.,

1997). Upon infection NPR1 is translocated to the nucleus where it interacts with bZIP

transcription factors that are involved in the SA-dependent activation of PR genes

(Despres et al., 2000). NPR1 also has a role in suppressing jasmonate signaling in the

cytoplasm (Spoel et al., 2003). However, nuclear localization of NPR1 is required for PR










gene expression (Kinkema et al., 2000). The loss of function mutant nprl-1 has enhanced

susceptibility to virulent Pseudomonas syringae and has reduced expression of PR genes

after infection (Cao et al., 1994).

The Role of Ethylene in Arabidopsis Defense Responses

The major role of SA in basal resistance is demonstrated by SA-deficient

Arabidopsis that are more susceptible to the virulent pathogen Pst. Acting either

agonistically or antagonistically to SA in these interactions are other phytohormones such

as ethylene and jasmonic acid (JA). For example, the Arabidopsis ethylene insensitive

mutant etrl-1 has faster disease progression than wild type plants in response to virulent

Xanthomonas campestris py. campestris (Xcc). This suggests that ethylene negatively

regulates disease symptom development in this system. However, NahG is deficient in

ethylene production following Xcc infection, suggesting that these two phytohormones

act agonistically in this response (O'Donnell et al., 2003). The loss of ethylene in NahG is

not supported by sid2-2, which was shown to accumulate ethylene in response to

infection with Pst (Heck et al., 2003). Thus, the failure to produce ethylene in pathogen

infected NahG Arabidopsis may be a specific consequence of the nahG transgene and not

due to the failure to accumulate SA.

The Role of Jasmonates in Arabidopsis

Two Arabidopsis mutants that are SA-deficient, eds4 and pad4, have increased

sensitivity to compounds that induce the expression of JA response genes (Gupta et al.,

2000), and NahG and sid2 produce higher levels of JA in response to infection with Pst

than does Columbia (Heck et al., 2003; Spoel et al., 2003). JA is produced from alpha-

linolenic acid via the active precursor 12-oxo-phytodieonic acid (OPDA). It can also be

converted into the volatile compound methyl-jasmonate (Figure 1-2). These two










compounds, in addition to JA and other oxylipins, are commonly referred to as

jasmonates (Seo et al., 2001; Stintzi et al., 2001). Currently, little is known about the

roles of individual jasmonates in pathogen defense.

The evidence for a role for jasmonates in compromising the basal resistance of

Arabidopsis to Pst is further supported by the involvement of Pst-produced coronatine.

Coronatine is a phytotoxin that mimics OPDA (Weiler et al., 1994) (Figure 1-3). A Tn5

transposon insertion into Pst DC3000 produced a coronatine-deficient Pst mutant, Pst

DC3661 (Moore, 1989). This mutant strain was shown to be less virulent than Pst

DC3000 in Arabidopsis in dip infections but not in injection inoculations. However, the

disease symptoms in both forms of infection were reduced when compared to the parental

strain (Mittal and Davis, 1995).

The hypothesis that coronatine is an important virulence factor for Pst is reinforced

by studies with the Arabidopsis coronatine insensitive mutant coil (Feys et al., 1994).

COII is part of an E3 ubiquitin-ligase involved in a jasmonate response pathway (Xie et

al., 1998). The coil mutants are both more resistant to Pst DC3000 and have higher SA

levels (Kloek et al., 2001). These data along with similar studies in tomato (Zhao et al.,

2003) suggest that coronatine acts by stimulating the jasmonate-signaling pathway.

The Interaction of Tomato and Xcy

Not all plants use phytohormones in the same way in their defense responses. In

tomato phytohormones are involved in the response to both virulent and avirulent Xcy. In

the response to virulent Xcy, there is an induction of ethylene followed by accumulation

of SA.










Phospholipid?


Slipolytic enzyme (dadl)



O-

Alpha-linolenic acid



Lipoxygenase (Lox)



0O -1-
O--

13-hydroperoxy-linolenic acid


methyl-jasmonate


aliene oxide synthase


Jasmonic acid
carboxyl
methyltransferase
(JMT)


O--H


allene oxide


Saline oxide cyclase






12-oxo-phytodienoic acid (OPDA)


Jasmonic acid


beta oxidation


OPDA
reductase
(opr3)


O--H


3-oxo-2(2'-pentenyl)-cyclopentane-1l-octanoic acid


Figure 1-2 Jasmonate biosynthesis.






















Figure 1-3 The structure of coronatine.

SA production in this response is dependent on the previous production of ethylene

(O'Donnell et al., 2001), and both are dependent on the ability of the plant to produce

jasmonates.

Antisense plants for the jasmonate biosynthesis enzyme allene oxide synthase (as-

AOS) are resistant to virulent Xcy and show no production of either ethylene or SA

(O'Donnell et al., 2003). Transgenic tomato plants that express 1-aminocyclopropane- 1-

carboxylate (ACC) deaminase (ACD) (EC 3.5.99.7) (Figure 1-4) do not produce ethylene

and are compromised in SA induction during infection. NahG plants, which do not

produce SA, have normal ethylene production. Both ACD and NahG are tolerant to

virulent Xcy and unaffected in their ability to produce jasmonates (O'Donnell et al.,

2003).

The tolerance of a plant to a pathogen can be defined as substantial growth of the

pathogen within the host tissues combined with an absence of full symptom development.

Another plant that is compromised in phytohormone signaling and shows tolerance is the

ethylene insensitive (ein2) mutant of Arabidopsis. It is tolerant to both Pst and Xcc (Bent

et al., 1992).


O O-H






















S- Aden osy-L-rneth ion in e

ACC sqnthase


ACC chlarnin ase


2- Oxotutancate


1 -arninco ycl opro ene-1-car o:= ate (ACC)


ACC oxiciase


H H

eth ~ene


Figure 1-4 Ethylene biosynthesis.


N--H
H


.;;.aO










The response of tomato to avirulent Xcy also involves phytohormone induction.

There is a major early induction of ethylene that is larger than that seen in the susceptible

response. There is also an early induction of SA. Increased ethylene sensitivity in tomato

caused by reduced expression of an ethylene receptor LeETR4 enhances the

hypersensitive response to avirulent Xcy (Ciardi et al., 2001). This demonstrates that

ethylene is also important in the response to avirulent pathogens.

Symptom Development and Systemic Responses in Tomato

Symptom development in tomato infected with Xcy can be categorized into two

stages. The primary response present in resistant, susceptible and tolerant interactions

consists of localized lesion formation. The secondary phenotype, which is only present in

the susceptible response, consists of the development of chlorosis and necrosis that

spreads from the sites of the primary lesions (O'Donnell et al., 2003).

Perhaps there is an advantage for the plant to produce these phytohormones and the

consequent chlorosis and necrosis development in response to virulent infections. In

addition to the necrosis of the tissue effectively removing the pathogen from the plant, it

is possible that this response produces a systemic signal that primes the plant's defenses

in case of repeat infections. It has been demonstrated in several systems, including

tobacco and cucumber that infections with virulent pathogens that produce high levels of

necrosis can lead to the induction of SAR (Cohen and Kuc, 1981; Strobel et al., 1996).

Therefore the phytohormones induced during the interaction with virulent Xcy and

tomato may be involved in the development of SAR and this could be the reason why

they remain even though their absence would lead to tolerance. SAR is induced in tomato










by tobacco necrosis virus (TNV) (Jeun et al., 2000) and Phytophthora infestans (Enkerli

et al., 1993) and leads to resistance to P. infestans.

Here two different aspects of phytohormone signaling in response to infections

with virulent bacterial pathogens are studied. The first, in chapter 2, investigates the

effect of the removal of SA accumulation on the synthesis of ethylene and jasmonates

during the interaction between Pst and Arabidopsis. This chapter focuses on

phytohormone networks in the local response to infection. The second, in chapter 3, is on

the interaction between tomato and Xcy. In this chapter the focus is the systemic response

to virulent bacterial infection and the possible roles of phytohormones in this response.

Although in both cases the focus is on the role of phytohormones in response to

pathogens, it can clearly be seen that the phytohormones play different roles in the two

systems and therefore information gained from studying one plant-pathogen interaction is

not necessarily applicable to another.















CHAPTER 2
THE EFFECT OF THE REMOVAL OF SA ON PHYTOHORMONE SIGNALING
NETWORKS IN ARABIDOPSIS INFECTED WITH VIRULENT PST

Differences in Disease Progression and Symptom Development in Salicyclic Acid-
Deficient Arabidopsis Mutants infected with Pst

Phytohormones do not act in a discrete fashion. The action often attributed to one

phytohormone can be due to the combined action of several. SA plays an important role

in the basal resistance of Arabidopsis to virulent Pst. However, it is not the only

phytohormone induced in response to Pst. Ethylene and jasmonates are also induced in

this response. The aim of this chapter is to determine the effect of removing SA on the

phytohormone-signaling network in Arabidopsis in response to virulent Pst. This will

provide a clearer resolution of the complex relationships between the signaling pathways

in this system.

As a first step into understanding the effect of altered SA production or signaling,

levels of basal resistance and the disease phenotypes in four different lines were

compared. These lines are the SA biosynthesis mutant sid2-2, the SA signaling mutant

nprl-1 and the transgenic line NahG that cannot accumulate SA. The infection of

Columbia (wild type), nprl-1, sid2-2 and NahG plants with virulent Pst led to differential

bacterial growth and disease phenotypes in the four lines.

NahG supported significantly more bacterial growth than the other lines (Figure 2-

1). The mutants sid2-2 and nprl-1 had bacterial growth that was intermediate between

NahG and the wild type. The sid2-2 mutant is a better model for the loss of SA

production than NahG due to the side effects of catechol production (Heck et al., 2003).










Therefore, as sid2-2 supports the same levels of bacterial growth as nprl-1, this

demonstrates that the effect of SA on basal resistance is NPR1-dependent (Figure 2-1).

The development of disease symptoms showed further differences between the four

lines. Columbia exhibited patchy chlorosis at 48 h post infection (hpi). These patches

coalesced at 96 hpi. NahG showed the most severe symptom development, with

widespread chlorosis followed by complete tissue collapse at 96 hpi. The sid2-2 mutant

exhibited less severe symptoms than NahG, with widespread chlorosis and necrosis at 96

hpi although it lacked the complete tissue collapse of NahG. The nprl-1 mutant

developed chlorosis but not necrosis and had an intermediate phenotype between

Columbia and sid2-2. These data demonstrate that although sid2-2 and nprl-1 showed

the same level of basal resistance, sid2-2 exhibited necrosis and tissue collapse that did

not occur in nprl-1 under these conditions. This result indicates that the effect of SA on

repressing necrosis and tissue collapse is NPR1-independent.


-o-Col
-*-nprl-1
8 -1 -0--sid2-2
-m-NahG










0 20 40 60 80 100
hours post infection
Figure 2-1 Bacterial growth in Pst DC3000 infected Arabidopsis. Columbia, nprl-1,
sid2-2 and NahG were dip infected with Pst DC3000. Colony forming units
per square centimeter were determined at the time points indicated.










The expression of the PR genes PR1 and PDF 1.2 was monitored during disease

progression in all four lines. PR1 was induced in Columbia and slightly induced at 96 hpi

in nprl-1 but was not induced in the SA-deficient lines. PDF1.2 was induced to a similar

extent in all lines upon pathogen infection (Figure 2-2). The reduction in PR1 gene

expression in NahG and sid2-2 is consistent with that seen upon infection with avirulent

Pst (Nawrath and Metraux, 1999) and the loss of localized expression of PR genes in

nprl-1 as demonstrated by Cao et al. (1994). Consistent with my findings, PDF1.2

expression was unaltered in NahG and sid2-2, when compared to wildtype, in response to

infection with Alternaria brassicicola (Nawrath and Metraux, 1999).



p~cf 1.2 PR1










Fiur 2- R n D eeepeso nPs netdAaioss oa N a
extrcte fro Couba npl1 si22adNh lnt inetdwt









Figre -2PR DF l.2 o plantsta weresso mockst oculated, or 48 ad 96s hours post


infection.











SA and Jasmonate Induction in Response to Pst Infection

The study of the effect of removal of SA accumulation or perception on the

induction of other hormones was the focus of this chapter. Therefore the pattern of SA

induction in the different lines was confirmed. SA levels increased during infection in the

Columbia and nprl-1 lines, with nprl-1 accumulating significantly more SA than

Columbia. This is consistent with the results of Clarke et al. (2000), who demonstrated

that nprl-1 produces more SA than Columbia. SA remained at a low level in NahG and

sid2-2 consistent with the findings of Nawrath and Metraux (1999) (Figure 2-3).


7000
-o-Col
6000~ ---pri-1
-0- sid2-2
5000 -1 -m-NahG

~4000-

S3000-

2000

1000


0 20 40 60 80 100
hours post infection

Figure 2-3 SA production in Pst infected Arabidopsis. Columbia, nprl-1, sid2-2 and
NahG dip infected with Pst DC3000. SA was measured at the time points
indicated.

The jasmonate response of a plant can be described in terms of an oxylipin

signature consisting of different forms of JA and its precursors (Kramell et al., 2000). To

partially characterize this oxylipin signature in Arabidopsis infected with Pst, the

induction of jasmonic acid (JA) and its active precursor 12-oxo-phytodienoic acid


(OPDA) was measured. Both JA and OPDA were induced in all four lines. The highest

amounts of induction were observed in NahG and sid2-2, followed by nprl-1 with











Columbia producing the lowest amounts of these jasmonates (Figure 2-4). It has been

demonstrated by Heck et al. (2003) that Pst infection leads to higher JA levels in sid2-2

and NahG than in wild type Arabidopsis. Here, it can be seen that OPDA follows the


profile of JA expression and jasmonate production in nprl-1 is intermediate between

those of the SA-deficient lines and wild type.


-m-11NahG

600


400-


200-



0 20 40 60
hours post infection


80 100


2000


cnl500


, 1000


500


0 20 40 60 80 100
hours post infection

Figure 2-4 JA and OPDA production in Pst infected Arabidopsis. Columbia, nprl-1,
sid2-2 and NahG were dip infected with Pst DC3000. The amount of (A) JA
and (B) OPDA was quantified at the time points indicated.










The Effect of Coronatine Production by Pst

Jasmonate accumulation was higher in Arabidopsis that showed enhanced

susceptibility due to SA-deficiency. Therefore, jasmonate signaling may also reduce

defense responses. Pst produces the phytotoxin coronatine that is a mimic of OPDA and

may act by stimulating jasmonate responses (Weiler et al., 1994). The total jasmonate

response consists of jasmonates and coronatine. Therefore, coronatine accumulation

during infection in the different lines was measured. NahG had a significantly higher

level of coronatine accumulation than sid2-2, nprl-1 and Columbia (Figure 2-5).

500
-o-Col
-*-npri-1
40- -- sid2-2
-m-NahG


p" 300


S200-


100



0 20 40 60 80 100
hours post infection

Figure 2-5 Coronatine production in Pst infected Arabidopsis. Columbia, nprl-1, sid2-2
and NahG were dip infected with Pst DC3000. Coronatine was measured at
the time points indicated.

Coronatine's action as a virulence factor may utilize the jasmonate response

pathways to repress SA. To investigate if coronatine's action is SA-dependent, SA-

deficient lines were infected with Pst DC3661. Pst DC3661 is a Tn5 mutant that is

disrupted in its ability to produce coronatine (Mittal and Davis, 1995). Bacterial growth

was reduced by a factor of ten in all lines infected with Pst DC3661 compared to those










infected with Pst DC3000 but the relative differences in susceptibility between the

Arabidopsis lines remained (Figure 2-6).


0 DC3000
mDC3661
10-







S8-








Col nprl-1 sid2-2 NahG

Figure 2-6 Bacterial growth at 72 hpi in Pst DC3000 and Pst DC3661 infected
Arabidopsis. Columbia, nprl-1, sid2-2 and NahG were dip infected with Pst.
The amount of bacteria in the tissues was determined at the time points
indicated.

Disease symptom development was also reduced in all lines infected with Pst

DC3661 when compared to those infected with Pst DC3000 (Figure 2-7). However, the

comparative severity of the disease in the different lines remained the same. These results

were confirmed with an additional coronatine-deficient Pst mutant, Pst DC3118 (Moore,

1989; Ma et al., 1991). These data demonstrate that coronatine's action is independent of

SA, as coronatine-deficiency still reduced virulence on SA-deficient lines. These data

indicate that the JA and SA pathways act in an independent manner in the control of basal

resistance.








DC3000


DC3661


C r


1'-:~

~dP- "
1 ..


Columbia


~uia ,i~ii~
~c~~
:m


/P


npr l- 1







sid2-2


4"8~-5-~81a


Figure 2-7 Disease symptom development in Pst infected Arabidopsis. Columbia, nprl-
1, sid2-2 and NahG plants were dip infected with wild type Pst (DC3000) or
coronatine-deficient Pst (DC3661). Photographs were taken 96 hpi.


;;

~ ;;E"~i~


"(










The Role of Ethylene in SA-Deficient Arabidopsis

Recent work has demonstrated that the catechol produced by NahG has side effects

in the NahG plant that are not due to the loss of SA (Heck et al., 2003). NahG had been

used to demonstrate an agonistic relationship between SA and ethylene in the interaction

between Arabidopsis and Xce (O'Donnell et al., 2003). To verify this relationship in sid2-

2 and to investigate the role of NPR1 in this interaction, ethylene evolution in response to

Pst infection was measured.

Ethylene was induced to similar levels at 48 hpi in Columbia and nprl-1 indicating

that the control of ethylene synthesis by SA is NPR1-independent. A large increase in

ethylene, also at 48 hpi, was observed in sid2-2. NahG showed no induction of ethylene

during disease progression (Figure 2-8). These results indicate that catechol or its further

metabolites suppress ethylene production and that there is an antagonistic relationship

between the synthesis of SA and ethylene, rather than the agonistic relationship suggested

by the NahG phenotype. These results are also consistent with the observation that

ethylene insensitive plants synthesize more SA than wild type plants following pathogen

infection (O'Donnell et al., 2003).

To investigate if it was this suppression of ethylene signaling that caused the

differences in disease symptoms between sid2-2 and NahG, plants were treated with the

ethylene inhibitor 1 -methylcyclopropene (MCP) 24 hours prior to infection and the

resultant effects on disease were assessed. MCP blocks ethylene binding to it receptors,

thus inhibiting its perception (Sisler and Serek, 1997). No differences in disease

development between those plants treated with MCP and untreated plants were observed

(data not shown). These data indicate that although ethylene production is inhibited in










NahG, this absence of ethylene is not responsible for the enhanced disease phenotype

observed in NahG plants relative to sid2-2.


-o-- Col
-*-nprl-1
-0--sid2-2
20 I- -m-NahGI








~ 0



0 20 40 60 80 100
hours post infection

Figure 2-8 Ethylene production in Pst infected Arabidopsis. Columbia, nprl-1, sid2-2
and NahG were dip infected with Pst DC3000. Ethylene production was
measured at the time points indicated.

Discussion

The effect of an inability to accumulate SA on the induction of ethylene and

jasmonates during the interaction between Arabidopsis thaliana and the virulent bacterial

pathogen Pst DC3000 was investigated. Two lines that do not accumulate SA during

infection (NahG and sid2-2) were used to determine these effects. The effects of SA on

ethylene and jasmonates accumulation are believed to be NPR1-dependent (Clarke et al.,

2000). Consequently the levels of ethylene and jasmonates in nprl-1, follow ing infection

were also measured.

In accordance with previous reports (Cao et al., 1994; Delaney et al., 1994;

Naw'rath and Metraux, 1999) an enhanced susceptibility to Pst in NahG, sid2-2 and nprl-

1 was observed, with more severe symptom development in NahG and sid2-2 than in

nprl-1. This result correlates with the partial loss of SA signaling in nprl-1 compared to










the other two lines. NahG displayed a rapid and complete tissue collapse that did not

occur in sid2-2. NahG also supported more bacterial growth than sid2-2, although both

were more susceptible to Pst than Columbia. This result, coupled with the recent data

proposing side effects in NahG associated with catechol (Van Wees and Glazebrook,

2003), led to the comparasion of the NahG and sid2-2 lines for effects on ethylene and

jasmonate accumulation.

As has been reported previously, the SA levels in NahG and sid2-2 are roughly

equivalent following Pst infection (Nawrath and Metraux, 1999). The massive increase of

SA in nprl-1 compared to that of Columbia is probably due to a loss of feedback

inhibition on SA synthesis that relies on an NPR1-dependent SA pathway (Clarke et al.,

2000).

As well as SA, jasmonates have been reported to play a role in disease with both JA

and its precursor OPDA believed to be active signaling compounds (Stintzi et al., 2001).

It was therefore determined how the removal of SA affected the induction of these

jasmonates following infection. In Columbia, both JA and OPDA increase following

infection. In the SA-deficient lines an increase in jasmonates was observed compared to

wild type, with NahG and sid2-2 producing the most jasmonates. nprl-1 produced

intermediate jasmonate levels. This suggests that SA represses jasmonate production in a

partially NPR1 dependent manner. As NahG and sid2-2 produce similar levels of

jasmonates catechol is unlikely to affect jasmonate production. The enhanced

susceptibility of SA-deficient Arabidopsis to Pst may be due to the combined effects of

reduced SA and increased jasmonates.










The use of PR gene expression is often used to investigate the roles of specific

phytohormones in plant pathogen interactions. In order to determine the degree that two

of these markers represented the levels of the phytohormones produced, the expression of

PR1 and PDF1.2 was determined in the different lines during infection. The expression of

PR1 is absent in accordance with the loss of SA accumulation in both sid2-2 and NahG.

It is also much reduced in nprl-1 when compared to Columbia. These results demonstrate

that the loss of SA accumulation in these lines is sufficient to prevent the induction of SA

response pathways and that PR1 is a good marker of SA signaling.

There was also an induction of PDF1.2 to a similar extent in all lines. PDF1.2

requires the activation of both ethylene and JA response pathways to be induced in

response to Alteranria brassicicola (Penninckx et al., 1998). PDF1.2 is not visible in

sid2-2 or NahG at 96hpi due to the poor quality RNA obtained from this highly necrotic

tissue. These data indicate that although the absence of SA affects the levels of ethylene

and jasmonates this is not necessarily reflected in the expression of all downstream genes.

This indicates that marker genes may not always be the best approach to mapping

hormone networks.

The production of coronatine by Pst in the different Arabidopsis lines was

measured to further study the relationship between SA and jasmonates. Coronatine is a

non-host specific phytotoxin whose biological effects include induction of leaf chlorosis

(Mittal and Davis, 1995). It has been suggested to act as a mimic of OPDA (Weiler et al.,

1994). Coronatine production was observed in all of the lines infected with Pst, with the

most production occurring in NahG. The coronatine levels were different to those of

jasmonates. This suggests that coronatine acts via jasmonate signaling rather than by










stimulating jasmonate biosynthesis. The production of coronatine was the same in sid2-2

as Columbia so it is not directly related to bacteria levels. This suggests that host factors

or bacteria thresholds must be present to stimulate coronatine production.

To determine if coronatine affects SA-dependent basal resistance, the lines were

infected with the coronatine-deficient mutants Pst DC3661 and Pst DC3118. All lines

infected with coronatine-deficient Pst had reduced bacterial growth compared with those

infected with Pst DC3000 and consequently developed less severe disease symptoms.

However, the relative differences in susceptibility between the lines remained. This

indicates that role of coronatine as a virulence factor is independent of SA, as SA-

deficient lines still show an enhanced susceptibility to coronatine-deficient Pst despite its

reduced virulence. It is then both the accumulation of coronatine and the loss of SA

signaling that lead to the severe disease phenotype observed in the SA deficient lines

upon infection with Pst.

Ethylene synthesis is transient during the post-infection period, peaking around 48

hpi in Columbia in response to Pst. This induction does not occur in NahG. The faster

development of chlorosis in the ethylene insensitive mutant etrl-1 in response to Xcc

infection (O'Donnell et al., 2003) suggests that ethylene is required to slow the

development of chlorosis. The growth of Xcc in etrl-1 remains unchanged indicating that

ethylene does not play a direct role in limiting pathogen growth in this interaction. As the

Arabidopsis response to Pst and Xcc are similar, it can be concluded that ethylene does

not play a major role in basal resistance to either pathogen.

A major difference between the two SA-deficient lines with respect to this ethylene

induction was observed, with sid2-2 showing a two-fold increase in ethylene induction at










48 hpi relative to Columbia. These data agree with the recent study by Heck et al. (2003).

The completely opposite nature of this response in NahG when compared to sid2-2

suggests that catechol or a further metabolite negatively affects ethylene production.

However, the treatment of sid2-2 and NahG with the ethylene inhibitor MCP before

infection caused no change in their respective phenotypes. This suggests that although

ethylene may play a role in fine-tuning the disease response in Arabidopsis, it is not

responsible for the difference in susceptibility between sid2-2 and NahG. The

suppression of ethylene production by catechol in NahG therefore is independent of the

changes in susceptibility and disease phenotype.

These data indicate that NahG is not always an appropriate model for studying the

role of SA induction in plant-pathogen interactions. They also demonstrate an

antagonistic relationship between SA and ethylene in this system, as the removal of SA

increases ethylene synthesis. As no difference in ethylene induction in nprl-1 compared

with Columbia was observed, it might also be concluded that the effect of SA on ethylene

is NPR1-independent.















CHAPTER 3
SYSTEMIC ACQUIRED TOLERANCE INT TOMATO

Introduction

Pathogens have a high negative impact on agriculture. In 1993, for example, an

estimated 12% of crops were lost to disease (Agrios, 1997). The application of chemicals

such as fungicides help to limit the damage they cause. However, utilizing plant defense

responses remains an important research area for the limiting pathogen damage. For

instance application of Benzothiadiazole stimulates plant defense responses and induces

resistance to several pathogens (Lawton et al., 1996). Infected plants can in many

instances limit the extent of pathogen growth and symptom development. Resistance

occurs via an incompatible interaction and results in rapid activation of defense responses

that limit pathogen growth (Alfano and Collmer, 1996; Hammond-Kosack and Jones,

1996). These responses include: strengthening of cell walls with hydroxy-Proline-rich

glycoproteins (Showalter et al., 1985), callose (Parker et al., 1993) and lignin

(Moerschbacher et al., 1990); rapid expression of PR proteins (Linthorst, 1991); and the

synthesis of antimicrobial compounds (Hain et al., 1993; Epple et al., 1995; Penninckx et

al., 1996).

Tolerance is the repression of symptom development without restricting pathogen

growth. The visible phenotype of the two responses is similar. Resistance is a well-

studied phenomenon yet tolerance remains an enigma. Tolerance has been identified in

several phytohormone compromised plant lines. One of these is the ethylene-insensitive

ein2 mutant of Arabidopsis, which has increased tolerance to several virulent bacterial










pathogens (Bent et al., 1992). Increased tolerance has also been demonstrated to virulent

Xcy in ethylene and SA-deficient tomato lines (Lund et al., 1998; O'Donnell et al., 2001).

Disease development in tomato infected with virulent Xcy can be defined in two

stages: primary and secondary disease development. Primary disease development

consists of localized lesion formation and it is unaltered in the tolerant lines. Secondary

disease development consists of chlorosis and necrosis that spreads from the primary

lesions. These secondary disease symptoms require the cooperative action of ethylene

and SA and are abolished in tolerant lines. It remains a mystery why the plant retains

these responses and thus increases the amount of tissue damage. Organized necrosis may

help the plant withdraw nutrients from the infected tissue. The phytohormones may also

be required for the induction of a systemic response that allows the plant as a whole to

respond to the increased pathogen presence.

While tolerance due to phytohormones-deficiency might be a valuable outcome for

agriculture, it is likely to have costs. Ethylene and SA are involved in many plant-

pathogen interactions. For instance, ethylene is necessary for resistance to certain fungal

pathogens and for the generation of induced systemic resistance (Knoester et al., 1998;

Knoester et al., 1999). SA is necessary for resistance to avirulent pathogens and the

generation of SAR in several species (Gaffney et al., 1993). SAR is the activation of

systemic defense responses that occurs due to the formation of necrotic lesions (Ryals et

al., 1996). The hypersensitive response during an incompatible interaction and tissue

death during a compatible interaction can both induce SAR (Hunt and Ryals, 1996). SAR

results in the development of a broad-spectrum, systemic resistance. It is not effective

against, or induced by, all pathogens. For example, the infection of Arabidopsis with










Botrytis cinerea fails to induce SAR and inoculations with Pseudomonas syringae does

not affect B. cinerea challenge (Govrin and Levine, 2002). In tomato SAR is induced by

pathogens such as tobacco necrosis virus and Phytophthoria infestans (Enkerli et al.,

1993; Jeun et al., 2000).

It is important to understand the roles of phytohormones in systemic responses, as

the loss of these responses could reduce any advantage gained by reduced symptom

development due to engineered ethylene or SA-defieiency, I focus here on tomato, as the

absence of ethylene and SA causes tolerance to virulent Xcy. The systemic response in

tomato to this pathogen has not been previously examined. I investigate if Xcy is capable

of inducing systemic responses in tomato and possible roles of SA and ethylene in its

generation and action. To avoid confusion I will use the term "inoculation" for the first

treatment of a tomato plant and the term "challenge" for the subsequent treatment on

distal leaves. I demonstrate that both virulent and avirulent Xcy generate a systemic

response in tomato. I show that both virulent and avirulent Xcy cause an SA and ethylene-

dependent PR gene induction and sensitize systemic defense responses. However, in

contrast to the well-established SAR, the Xcy-induced response generates tolerance to

subsequent challenge with virulent Xcy. I term this response systemic acquired tolerance

(SAT) and define it as prior pathogen exposure reducing necrosis in response to virulent

pathogen infection in distal tissues without affected pathogen growth. SAT involves a

rapid increase in both PR gene expression and ethylene production in response to

subsequent challenges with virulent Xcy.










Virulent and Avirulent Xcy Led to Systemic Acquired Tolerance in Tomato

To investigate systemic responses to Xcy, wild type tomato plants at the three-leaf

stage were mock inoculated, inoculated with virulent Xcy strain 93-1 or avirulent Xcy

strain 87-7 (Bonas et al., 1993) on their lowest two leaves. The inoculations were then

permitted to run their full course of around 14 days, at which point those leaves

inoculated with virulent Xcy were fully necrotic and those inoculated with avirulent Xcy

had developed lesions associated with the hypersensitive response (Figure 3-1A).
















avirulent virulent


B r






moc-viulet vrulnt-irlen avrulnt-iruen





~~~~kvirulent Xcyand(B)symtom reuletin f vromcaleng-iue wth iuetXy










To determine if this inoculation with Xcy affected responses to subsequent

pathogen exposure, a challenge was performed with virulent Xcy on uninoculated

systemic leaves. Prior inoculations with either virulent or avirulent Xcy, but not mock

inoculations, reduced the necrotic development resulting from the challenge (Figure 3-

1B). The primary symptoms such as lesion formation were unaffected and secondary

symptom development such as chlorosis and some confluent necrosis were still apparent.

The major difference in secondary symptom development during challenge was reduced

necrosis in plants with prior Xcy inoculation.

As the response consists of two independent interactions between two biological

entities a high degree of variation is to be expected. With this in mind the level of

necrosis was determined in large population groups by measuring ion leakage at 16 days

after challenge (Figure 3-2).


35

30-

25 -2





g 10-




mock- vir-vir avr-vir mock- vir- avr-
vir mock mock mock


Figure 3-2 Cell death due to challenge of tomato with virulent Xcy. Cell death was
measured in the form of percent ion leakage in plants with a mock challenge
or challenged with virulent Xcy. The plants were exposed to a mock
inoculation or inoculation with virulent (vir) or avirulent (avr) Xcy prior to
chall enge.
































-o-Vlf















-=-- mock-vir

-*-avr-vir


Percent ion leakage, an indicator of cell death, was two-fold higher upon

challenge in plants previously mock inoculated than those with prior Xcy inoculations. In

contrast to previously mock-inoculated plants there was no significant difference between

symptoms in plants with prior virulent or avirulent inoculations upon challenge with

virulent Xcy. The reduction of symptom development due to previous pathogen exposure

is consistent with SAR generation. Bacterial growth measurements confirmed resistance

to avirulent Xcy but not virulent Xcy, as growth of avirulent Xcy was 10-fold lower than

that of virulent Xcy (Figure 3-3A).


A 12,
10 -



o


2-

]B




'4

2
1
0


9 11


1 35 7
days post infection


Figure 3-3 Bacterial growth during inoculation and challenge of tomato with Xcy. (A)
The growth of virulent (vir) and avirulent (avr) Xcy was measured during
inoculations. (B) A challenge with virulent Xcy was then performed on these
plants and mock-inoculated controls and the bacterial growth was measured.










When bacterial populations in challenge infections were determined there was no

difference in bacterial growth due to prior inoculation with either virulent or avirulent

Xcy compared with plants with prior mock inoculations (Figure 3-3B). This result leads

to the conclusion that avirulent and virulent Xcy induced SAT rather than SAR, as they

reduced symptom development but not bacterial growth due to challenge with virulent

Xcy. As to my knowledge SAT has not been previously described I defined it as the prior

exposure to a pathogen leading to reduced necrosis development in response to

subsequent challenge with a virulent pathogen in distal tissues.

Prior Inoculation with Xcy Led to an Early Production of Ethylene upon Challenge
with Virulent Xcy

Ethylene and SA are involved in the development of systemic responses in several

plants. Ethylene and SA were measured during inoculation and challenge with Xcy.

Inoculation with virulent Xcy led to ethylene production in local tissues at 5 days post

infection (dpi), while avirulent Xcy caused a greater induction of ethylene at 4 dpi (Figure

3-4A). Virulent Xcy induced SA at 10 dpi, while avirulent Xcy induced SA at 4 dpi that

peaked at 10 dpi (Figure 3-4B). The induction of ethylene and SA was later and at

reduced magnitude in response to virulent Xcy than avirulent Xcy. No systemic

production of ethylene was observed in response to primary Xcy inoculations and at 16

dpi no systemic induction of SA was observed in plants inoculated with Xcy (data not

shown).

Loss of secondary disease symptoms occurs in virulent Xcy-infected ethylene or SA

deficient tomato plants (Lund et al., 1998; O'Donnell et al., 2001). Therefore it is possible

that SAT might similarly be the result of reduced phytohormone synthesis during

challenge. To determine if SAT was due to loss of ethylene or SA, their accumulation
































3 5 7 9 11













4 6 8 10 12 14 16


following challenge with virulent Xcy was determined. Results indicated that the


tolerance associated with SAT is not due to reduced ethylene or SA accumulation.


Instead, earlier ethylene induction upon challenge accompanies SAT (Figure 3-4).


B 700
600
500
en400

g 300




0


0 1 23 45 67 891011
D 500
450 -m--rnock-vir
-o-I-VIf-V
400 *avr-vir
350-
,300
~250-
~200-
150-
100


O 2 4 6 8 10 12 14 16
days post infection
Figure 3-4 Local ethylene and SA production during inoculation and challenge of tomato
with Xcy. Tomato plants were mock inoculated or inoculated with virulent

(vir) or avirulent (avr) Xcy and (A) ethylene and (B) SA were measured.
Fourteen days later a challenge with virulent Xcy was performed on
uninfected leaves and (C) ethylene and (D) SA induced by the challenge was
measured.









The ethylene induction in response to a challenge with virulent Xcy, following prior

mock inoculation, reached its maximum at 10 dpi. However, plants with prior Xcy

inoculations produced additional ethylene around 5 dpi when challenged (Figure 3-4C).

Although at a reduced magnitude, this induction resembles a response to avirulent Xcy.

Challenge with virulent Xcy caused ethylene induction at 8 to 10 dpi in all plants, the

magnitude of which was dependent on the prior inoculation. Plants with prior avirulent

Xcy inoculation produced the most ethylene when challenged. This ethylene induction

was lower in plants with prior virulent Xcy inoculations and lowest in the mock-

inoculated controls. However, the significant difference remains the early ethylene

induction that is only present in plants with prior Xcy inoculations.

Plants with prior mock or virulent Xcy inoculations produced similar SA induction

profiles in response to challenge with virulent Xcy. However, a reduction in SA

production was observed in plants with a prior avirulent Xcy inoculation. These plants

also produced an early SA peak (Figure 3-4D) that resembled the response to avirulent

Xcy although reduced in magnitude. The following production of SA was delayed and

resembled that caused by virulent Xcy although at reduced magnitude.

The difference in SA production during a challenge and the increased strength and

speed of phytohormone induction during prior inoculations had no effect on the overall

SAT phenotype. Therefore the early induction of ethylene upon challenge in plants with

prior Xcy infections correlates with the tolerant phenotype, whereas SA induction does

not. Despite the lack of correlation between SA induced during challenge and SAT, SA

and ethylene induction during inoculation may be required for systemic signal formation.










PR Gene Expression Indicated the Necessity of Ethylene and SA in Systemic Signal
Generation

As ethylene or SA-deficient plants develop less secondary disease symptoms due

to virulent Xcy than plants displaying SAT, a direct approach to determining their role in

SAT is difficult. Therefore PR gene expression was assayed instead of ion leakage as a

marker for defense responses in phytohormone-deficient plants. To determine if ethylene

and SA are necessary for systemic signal transduction, two transgenic lines altered in

their ability to accumulate ethylene or SA were used. Loss of ethylene was achieved with

transgenic ACD plants. These plants do not accumulate the ethylene precursor ACC and

thus under-produce ethylene. The ACD line was compared to its isogenic parent UC82B.

The role of SA was determined using transgenic tomato plants expressing the bacterial

salicylate hydroxylase, nahG that cannot accumulate SA. The NahG line was compared

to its isogenic parent Money Maker (MM).

Induction of PR genes is often used as an indicator of early defense responses.

They show both local and systemic induction during SAR (Ward et al., 1991). The

expression of PRla and PRlb was induced in the local and systemic tissues of tomato

during infection with virulent Xcy (Figure 3-5). PRla expression was lower than PRlb.

The local expression of both genes was induced in all lines in response to virulent Xcy.

The timing and level of induction of PRla varied between different cultivars, with an

earlier and a greater induction in MM than UC82B. The expression of PRlb was also

higher in MM than UC82B, although the timing of induction was the same. When

compared to their isogenic parents, infected ACD and NahG plants had reduced local

expression of both genes. However, this reduction did not affect pathogen growth

(O'Donnell et al., 2001).













40 25
local PRla -M-M -*--UC82B I ncal PRla
35 -a-NahG -o-ACD






20



0I 1

E 12








losmca PRlb localM PRlt C2 sseib Pl

0. 01


0.08


012








4 0.08

00.0


00.0
0.1

10246 i I2468
days ~ ~ ~ ~ ~ ~~I potifeto ay otineto

Figur 3- oa n ytmcP gn nuto nehlneadS-eettmt







inlcladsystemi c tissues.16I~~I ytei Pl










Virulent Xcy induced systemic expression of both genes in MM and UC82B. In

MM systemic induction of PRla and PRlb occurred at the same time, whereas in UC82B

the expression of PRlb was later than PRla. ACD and NahG did not show significant

systemic induction of PR gene expression in response to virulent Xcy. Disease symptoms

in ACD and NahG are comparable to their isogenic parents up to 8 dpi (O'Donnell et al.,

2001). As widespread necrosis does not occur before 8 dpi the lack of systemic PR gene

expression is due to loss of ethylene and SA accumulation rather than the loss of

widespread necrosis in these lines. This lack of systemic PR gene induction indicates that

ethylene and SA-deficient lines might be compromised in their systemic signal

transduction. However, the tolerant phenotype of these lines makes direct investigation

difficult.

In UC82B systemic PR gene induction occurred within 6 dpi, whereas the major

local phytohormone induction occurred at 8 to 10 dpi in response to virulent Xcy.

Measurable phytohormone induction, therefore, was not responsible for systemic PR

gene induction. Direct damage to cells infected by the pathogen may cause local ethylene

and SA production limited to cells that are under attack. This phytohormone production

may be involved in the induction of both local and systemic defense responses.

Avirulent Xcy Induced Greater Local and Systemic PR Gene Expression than
Virulent Xcy, but they Result in Similar PR Gene Induction During Challenge

The induction of ethylene and SA is more rapid in response to avirulent than

virulent Xcy, yet the resulting systemic response to these two pathogens is the same. To

determine if the early defense responses follow this trend, induction of PR gene

expression by avirulent and virulent Xcy inoculations was assayed. Avirulent Xcy induced

higher levels and earlier local expression of PR genes than virulent Xcy (Figure 3-6). The










timing of systemic PRlb induction was similar in response to either pathogen, but

systemic PRla induction was faster in response to avirulent Xcy. Faster and stronger local

PR gene response to avirulent than virulent Xcy may reflect the increased defense

responses that limit pathogen growth.

Prior avirulent and virulent Xcy inoculations produced the same induction of

ethylene and changes in symptom development during challenge. The levels of PR gene

expression were assayed to determine if increased systemic PR gene expression

translated into stronger PR gene induction upon challenge. The difference between the

two prior Xcy inoculations in PR gene expression upon challenge was negligible. Both

caused an early peak of PR gene expression at 1 dpi upon challenge that was absent in

plants with prior mock inoculation (Figure 3-7). These results are consistent with the

rapid ethylene induction following challenge. These results lead to the hypothesis that

inoculation with Xcy primed the systemic defenses and caused a faster induction of

defense responses upon challenge. This primed defense response led to the formation of

tolerance upon challenge.

Discussion

In this chapter the systemic responses of tomato to both virulent and avirulent Xcy

were studied. A primary infection with virulent Xcy led to local as well as ethylene and

SA-dependent systemic PR gene induction within 6 dpi. PR gene induction occurred

prior to measurable ethylene or SA induction, indicating that undetectable localized

ethylene and SA production occurred within days of infection with virulent Xcy and led

to the generation of a systemic signal. The systemic signal, as well as inducing PR gene

expression, altered the systemic defense response to challenge with virulent Xcy. This












altered defense response is tolerance and not resistance. It caused rapid PR gene


expression and ethylene induction in response to subsequent challenge, leading to


suppressed symptom development but not resistance.


60


'45








S30

15



o


30




15


O


0.251-ev

S0.2


S0.1 -

S0.05




days post infection

Figure 3-6 The measurement of local and systemic PR gene expression in tomato during
inoculations with virulent or avirulent Xcy. Wild type (UC82B) tomato plants
were mock inoculated or inoculated with virulent (vir) or avirulent (avr) Xcy
and the local and systemic expression of PRla and PRlb was determined by
real time RT-PCR.











12
PRla -mmock-vir
-oVil-Vil
-* avr-vir
a 9












1 .2 -1 PRlb -w-mock-vir
-oi-VirVf
-* avr-vir

< 0.9



.0.6


0.3-


0.0
012345678
days post infection

Figure 3-7 Induction of PR genes in tomato plants during challenge with virulent Xcy in
the presence or absence of SAT. Wild type (UC82B) tomato plants were mock
inoculated or infected with virulent (vir) or avirulent (avr) Xcy. Fourteen days
later a challenge was performed with virulent Xcy. The expression of PRla
and PRlb was determined with real time RT-PCR during this challenge.

The ability of a plant to send a systemic signal in response to a biological stimulus


has long been established. This communication allows separate tissues to act in concert to


the many stimuli they perceive. Systemic signals have been characterized in terms of


responses to pathogens, symbionts and wounding. SA, ethylene, jasmonates and systemin

are all involved in generating systemic signals (Pearce et al., 1991; Gaffney et al., 1993;


Pieterse et al., 1998). SA is a key player in SAR in many species (Ryals et al., 1996).


NahG plants are unable to mount SAR to bacterial, viral or fungal pathogens (Gaffney et


al., 1993; Friedrich et al., 1995; Lawton et al., 1995) and exogenous SA can induce SAR










(Ward et al., 1991; Vernooij et al., 1995). However, grafting experiments with NahG and

wild type tobacco indicate that although SA is required for SAR it is unlikely to be the

transmitted signal (Vernooij et al., 1994).

The role of SA in the systemic responses of tomato may differ somewhat from

that in other plant species. For example, the induction of SAR in tomato against P.

infestans demonstrated neither systemic SA accumulation upon inoculation, nor increased

SA production upon challenge, both of which are common to SAR in other plant species

(Jeun et al., 2000). While local induction of SA is observed in response to virulent and

avirulent pathogens, its accumulation is only observed after the systemic induction of PR

genes (O'Donnell et al., 2001)

In tomato, ethylene and SA are induced in response to both virulent and avirulent

Xcy, although in neither response are they involved in limiting bacterial growth (Lund et

al., 1998; Ciardi et al., 2001; O'Donnell et al., 2001; O'Donnell et al., 2003). Loss of

ethylene causes tolerance to virulent Xcy by reducing cell death and lesion size following

infection with avirulent Xcy. SA loss also leads to tolerance to virulent Xcy. However,

loss of SA increases cell death and lesion size in response to avirulent Xcy. The

development of systemic acquired tolerance to Xcy rather than resistance may be a

specific response to this pathogen and reflect the roles of ethylene and SA in this

interaction.

In agreement with the work of Ciardi et al. (2000), avirulent Xcy induces a rapid

and more intense expression of PR genes than virulent Xcy. Here I show that this

translates into an increased systemic PR gene induction. This increased PR gene

expression coupled with a faster and greater local induction of ethylene and SA may










affect SA production during challenge but it has no impact on SAT. Therefore, changes

in SA production during challenge are not important for the formation of SAT.

Interestingly the work of Jeun et al. (2000) demonstrates that changes in SA induction in

tomato during challenge with P. infestans are also not necessary for SAR.

The PR gene induction and ethylene profiles caused by SAT during challenge

resembled those of an incompatible interaction. However, they failed to develop with the

speed and intensity required for successful resistance to develop. Systemic induction of

defense responses and PR genes that do not lead to SAR have been observed in the

interaction of Arabidopsis and the necrotizing fungal pathogen B. cinerea (Govrin and

Levine, 2002). Virulent Pseudomonas syringae py. tomato also fails to induce SAR in

Arabidopsis, but in this case there is no systemic induction of PR genes (Cameron et al.,

1999). An incompatible-interaction between Arabidopsis and Pseudomonas syringae py.

syringae leads to a reduction of symptom development but no changes in bacterial

growth during a repeat challenge with the same incompatible pathogen (Summermatter et

al., 1995). These data suggest that systemic responses to pathogens exist as a continuum

between no response, tolerance and resistance.

Transgenic tobacco over-expressing PRla show enhanced tolerance to

Peronospora tabacina (Alexander et al., 1993). While tobacco plants deficient in catalase

show that low level activation of defense responses, including PR gene induction, by

HO, can lead to enhanced pathogen tolerance, higher HO, levels cause resistance

(Chamnongpol et al., 1998). These data again suggest that a range of systemic responses

to pathogen invasion occur, with a moderate response repressing symptom development

and a strong response suppressing both symptom development and pathogen growth.










Here I have described the phenomenon of systemic acquired tolerance that adds to the

ranges of known systemic responses induced by pathogens and suggests that plants are

capable of more diversity in their systemic responses than previously suspected.















CHAPTER 4
DISCUSSION

Phytohormone Networks in the Responses of Tomato and Arabidopsis to Virulent
Bacterial Pathogens

Plant signaling networks utilize ethylene, SA and jasmonates to coordinate defense

responses. Different plants use these phytohormones in a variety of ways to achieve the

same result. In this chapter I compare and contrast their roles of in the response of

Arabidopsis and tomato to infection with virulent bacterial pathogens. Plants

compromised in production or signaling of a phytohormone were used to determine its

effects. However, phytohormones do not act in isolation the levels of one can often affect

the levels of another. Many studies do not look at the effects of altering the synthesis or

perception of one phytohormone on others. They therefore cannot address whether the

phenotype observed is strictly due to the phytohormone lost.

Phytohormone measurements demonstrate if the altered phenotype is due to the

compromised phytohormone or if others may be involved. Table 4-1 shows the

phenotypes of Arabidopsis and tomato phytohormone mutants infected with virulent

bacterial pathogens. Table 4-2 shows the effect of these mutations or transgenes on the

production of other phytohormones in response to infection. The Arabidopsis responses

are to virulent Pst and the tomato responses are to virulent Xcy.









Table 4-1 Comparative phenotypes of phytohormone mutants in Arabidopsis and
tomato.
Compatible Salicylic acid Ethylene Jasmonates
interactions
Arabidopsis and Pst
Mutants sid2-2 etrl -1 coi 1 and fad3-2 fad7-
2fa8(a)
Local phenotype enhanced increased symptoms resistant (coil)
susceptibility (1) (2) no effect fad3-2 fad7-2
fad8) (3)
Systemic phenotype normally none (4) ND ND
Tomato and Xcy
Mutants NahG ACD, Nr AOCas
Local phenotype tolerant (5) tolerant (6) resistant (7)
Systemic phenotype no SAT (8) no SAT (8) ND
References are: 1 (Nawrath and Metraux, 1999); 2 (O'Donnell et al., 2003); 3 (Kloek et
al., 2001); 5 (O'Donnell et al., 2001); 6 (Lund et al., 1998); 7 (O'Donnell et al., 2003); 8
(chapter 3). ND = not determined.


Table 4-2 Com 3arative phytohormone profiles of Arabidopsis and tomato mutants.
Arabidopsis and Salicylic acid Ethylene Jasmonates
Pst
Mutants sid2-2 etrl -1 coi 1 and fad3-2
fad7-2 fad8
Salicylic acid none (1) ND increased (coil)(2)
Ethylene increased (3) insensitive (4) ND
Jasmonates increased (5) ND insensitive (coil)(6)
none (fad3-2 fad7-2
fad8)(7)
Tomato and Xcy
Mutants NahG ACD, Nr as-AOC
Salicylic acid none (8) none (9) none (10)
Ethylene normal (11) none (ACD) (9) none (10)
insensitive (Nr) (12)
Jasmonates normal (10) normal (10) none (13)
References are: 1 (Nawrath and Metraux, 1999); 2 (Kloek et al., 2001); 3 (chapter 2); 4
(Bleecker et al., 1988); 5 (Heck et al., 2003); 6 (Feys et al., 1994); 7 (McConn and
Browse, 1996); 18 (Oldroyd and Staskawicz, 1998);9 (O'Donnell et al., 2001); 10 (Lund
et al., 1998); 11 (O'Donnell et al., 2003); 12 (Lanahan et al., 1994); 13 (Stenzel et al.,
2003). ND = not determined.










Arabidopsis has many phytohormone mutants including those for SA (sid2-2),

ethylene (etrl -1) and jasmonates (facd3-2 fad7-2 fad8 and coil). The etrl -1 mutant is a

dominant-insensitive ethylene receptor mutant (Bleecker et al., 1988). The fad3-2 fad7-2

fad8 mutant is a loss of function triple mutant of the three fatty acid desaturases. Due to

its failure to synthesize linolenic acid, it has reduced jasmonate biosynthesis (McConn

and Browse, 1996). The coil mutant is a jasmonate-insensitive ubiquitin E3 ligase mutant

(Xie et al., 1998). Tomato also has mutants and transgenic lines compromised in

phytohormones such as SA (NahG), ethylene (ACD and Nr) and jasmonates (as-AOC).

Nr is a dominant ethylene-insensitive receptor mutant (Rick and Butler, 1956). The

transgenic plant as-AOC is an antisense line of the jasmonate biosynthesis enzyme allene

oxide cyclase (Stenzel et al., 2003).

These data allow the construction of signaling network models for these plant

pathogen interactions. However, not all phenotype and phytohormone measurements

have been addressed in each system. These models are based on only two sets of

interactions and may vary greatly in response to different pathogens or in different plant

systems.

The Compatible Tomato-Virulent Xcy Interaction

A model for the signaling network in tomato in response to virulent Xcy is shown in

Figure 4-1. In the interaction of tomato with Xcy the relationship of these phytohormones

appears to be linear, with SA production dependent on ethylene production that is in turn

dependent on jasmonate signaling (Lund et al., 1998; O'Donnell et al., 2001; O'Donnell et

al., 2003).










JA ethylene SA
Primary Secondary
X~cy 4
symptoms symptoms




Resistance Tolerance
Figure 4-1 A model for the signaling network in tomato in response to virulent Xcy.

As demonstrated in chapter 3, systemic signaling in tomato is dependent upon

ethylene and SA. Their action appears to precede their measurable induction, in a manner

similar to JA. JA-deficient lines show a loss of ethylene despite the fact that measurable

JA production does not occur until after ethylene production (O'Donnell et al., 2003).

This suggests that early, local phytohormone productions can have a profound impact on

disease response.

It is clear in the case of the interaction between virulent Xcy and tomato that

jasmonates are the major players when it comes to the formation of susceptibility to Xcy.

At the local level the induction of ethylene and SA are required for the formation of

secondary disease symptoms (O'Donnell et al., 2003). The interaction between tomato

and virulent Pst also requires a functional jasmonate-signaling pathway for full Pst

virulence. This system, however, is strongly influenced by the phytotoxin coronatine

(Zhao et al., 2003).

The Compatible Arabidopsis-Virulent Pst Interaction

SA-deficient Arabidopsis plants produce increased levels of jasmonates and

ethylene in response to infection with virulent Pst. The prevalent hypothesis for

phytohormones in the response of Arabidopsis to pathogens proposes two pathogen-

response pathways in Arabidopsis (Glazebrook et al., 2003). One pathway utilizes SA










and acts in response to necrotic bacterial pathogens and the other utilizes ethylene and

jasmonates, acting in response to fungal and insect pathogens (Penninckx et al., 1998;

Vijayan et al., 1998).

SA, ethylene and jasmonates are all produced in the interaction between

Arabidopsis and virulent Pst. However, SA limits the production of both ethylene and

jasmonates and is the major phytohormone controlling defense responses in this

interaction. SA represses bacterial growth and thus also the development of chlorosis and

necrosis. Ethylene represses symptom development and jasmonates appear to act by

repressing defense responses.

These data suggest that co-ordinate signaling determines the overall response to the

pathogen. A combination of SA and jasmonates determine the level of bacterial growth

while ethylene influences the level of symptom development. It is likely to be the ratios

and timing of the various phytohormone inductions that control the plant responses. Pst

uses this network to its advantage by producing the jasmonate mimic coronatine.

The reduced virulence of coronatine-deficient Pst on SA-deficient and wild type

Arabidopsis demonstrated in chapter 2, suggests that coronatine's action as a virulence

factor is SA-independent. Further experiments to confirm this include the measurement

of SA in plants infected with coronatine-deficient Pst. Similar SA levels of these plants

and those infected with wild type Pst would support SA-independent coronatine action.

The link between jasmonates and susceptibility could also be investigated using T-

DNA knock-out mutants in jasmonate biosynthesis genes. A good candidate for this is

allene oxide cyclase for which there is a single gene in Arabidopsis (Kubigsteltig et al.,

1999; Park et al., 2002). This mutant would be more appropriate than the fad3-2 fad7-2










fad8 as it is less likely to affect the levels of other metabolites. These experiments require

the coronatine-deficient Pst mutant, as coronatine masks jasmonate-deficiency (Kloek et

al., 2001). Changes in bacterial growth in these lines would demonstrate if jasmonates are

definitively involved in repressing defense responses in Arabidopsis.

Systemic Responses to Infection

Systemic responses to virulent and avirulent pathogens have been previously

described in both tomato and Arabidopsis, with SA playing a similar role in both plants.

In both systems pathogen infections cause a local increase in SA (Nawrath and Metraux,

1999; O'Donnell et al., 2001). SA is necessary for the induction of a systemic response,

however, it is not itself believed to be the transmitted signal (Vernooij et al., 1994;

Lawton et al., 1995). The systemic induction of SA differs between the two systems, as

Arabidopsis has strong systemic SA induction where as tomato does not (Summermatter

et al., 1995). Arabidopsis also shows a strong induction of SA upon challenge that does

not occur in tomato (Jeun et al., 2000).

Ethylene is not required for the induction of SAR in Arabidopsis (Delaney et al.,

1994; Lawton et al., 1995). However, both ethylene and SA appear to be involved the

induction of SAT in tomato (Chapter 3). Virulent pathogens can induce systemic

responses in Arabidopsis, however, SAR is not induced by virulent Pst (Cameron et al.,

1999). Both avirulent and virulent Xcy induce systemic responses in tomato.

Additional experiments are required to confirm the roles of ethylene and SA in the

generation of systemic signaling in tomato. One approach to this could be the use of

grafting to determine if a NahG stock is incapable of systemic signaling to a wild type










scion. The best approach to this would be to monitor PR gene expression in the scion in

response to an inoculation of the stock.

Further study is required in both systems before the complex roles of

phytohormones in these interactions can be fully understood. It is clear from this study

that information gained from studying one system will not necessarily be applicable to

another system. However, certain parallels and common responses exist. By the study of

a wide range of plant-pathogen interactions the common points and differences can be

determined. This will eventually lead to a more complete understanding of general

defense responses, perhaps allowing broad-spectrum engineering or breeding of plants

with increased resistance or reduced symptoms to a wide range of diseases.















CHAPTER 5
MATERIALS AND METHODS

Plant Materials and Treatments

Arabidopsis thaliana Columbia, the NahG line (Delaney et al., 1994), nprl-1 (Cao

et al., 1994) and sid2-2 (courtesy of Julia Dew dney), all in the Columbia background,

were grow n in soil under long night conditions (8-h day; 16-h night) for six weeks to

encourage vegetative grow th. Forty-eight hours prior to infection, plants were transferred

to long day conditions (16-h day; 8-h night). Twelve hours before infection, the plants

were enclosed in a humidity dome to aid bacterial entry. Plants were inoculated with Pst

by submerging the aerial parts of the plant in 1x107 efu mll bacterial suspension,

containing 10mM MgC1, and 0.02% (v/v) Silw'et L-77 (Lehle seeds, Round Rock, TX,

U.S.A.), for 30 seconds. A vacuum w'as then applied to the plants for 2 min to aid

bacterial entry and the plants were returned to the humidity chamber overnight.

Lycopersicon esculentwn cvs Moneymaker and UC82B are the parental lines for

NahG (Oldroyd and Staskaw'icz, 1998) and ACD (Klee et al., 1991) respectively. Wild

type refers to UC82B only in all experiments except PR gene analysis of ethylene and

SA-deficient lines. Plant grow th and treatments were performed under ambient

temperature and lighting in a greenhouse. Plants were inoculated by submersion of the

leaves for 15 seconds in a bacterial suspension of 1x107 efu mll of Xcy strain 93-1

(virulent) or 87-7 (avirulent) containing 10mM MgC1, and 0.02% (v/v) Silw'et L-77.

Mock inoculations were performed by dipping plants in buffered Silwet. For analysis of

the systemic response to infection, inoculations were performed on three week-old plants










by dipping leaves 1 and 2 in infection media. Challenges were then performed on the

same plant 14 days later by dipping leaves 5 and 6 in the infection media containing

virulent Xcy. For PR gene analysis leaves 1 and 2 of six week-old plants were infected

and tissue from the local infection (leaves 1 and 2) and the systemic response (leaves 5

and 6) were removed at the indicated time points and flash frozen in liquid nitrogen.

Bacterial Culture

Pst and Xcy cultures were grown as previously described by O'Donnell et al.

(2001). Leaf colony counts were determined as previously described by Lund et al.

(1998). Briefly, five Icm2 leaf disks were sampled from each line at each time point

indicated. The disks were ground in 10mM MgCle, and serial dilutions were incubated at

room temperature for 2 days on solid media. The average colony-forming unit per square

centimeter (cfu cm 2) for each sample was determined by counting individual colonies.

Ion Leakage

Amount of cell death was estimated by measuring percentage of ion leakage. At 16

dpi the 5th leaf of each plant was placed in 6 ml deionized water and a vacuum of 20 psi

applied for 5 min. The samples were then shaken at room temperature for one hour. 3 ml

of the water was then removed and its conductivity was measured. The samples were

then placed in a boiling water bath for an hour and the conductance of the remaining 3 ml

of water measured. Percent ion leakage was determined by conductivity of first 3 ml

divided by conductivity of second 3 ml multiplied by 100. Measurements of tissue

challenged with virulent Xcy were made from 30 plants per treatment. Measurements on

mock challenges were made for 10 plants per treatment. Each experiment was repeated

on at least two independent occasions.










Ethylene Measurements

Ethylene measurements were performed on a minimum of three independent biological

replicates. Each biological sample was replicated at least three times within an

experiment. Ethylene production was determined by sampling the headspace above either

a whole rosette for Arabidopsis or a single leaf for tomato, enclosed in 5cm3 tubes for 1

hour as described by Lund et al. (1998). Ethylene concentration in a 1 ml sample was

determined by a gas chromatography (Model 5890, Hewlett-Packard, Palo Alto, CA).

SA, Jasmonate and Coronatine Measurements

SA, jasmonates and coronatine were extracted from Arabidopsis tissue and SA

from tomato tissue and derivatized using trimethylsilyl-diazomethane. The volatile

methyl esters were collected from the complex matrix using vapor phase extraction and

quantified by isobutene chemical- ionization gas-chromatography/mass spectrometry as

described in Schmelz et al. (2003). Each biological sample was replicated at least twice

with a minimum of two independent experiments.

RNA Extraction

Total RNA was extracted from 1.0g of tissue from each genotype per time point

with (phenol:chloroform: isoamyl alcohol (PCI) (25:24: 1 (v/v/v))) : extraction buffer (1%

triisopropylnaphthalene-sulfonic acid (w/v); 6% p-amino salicylic acid (w/v); 0. 1M Tris

pH 8; 50 mM EGTA; 0. 1M NaCl; 1% SDS (w/v); 0.039% -Mercaptoethanol (v/v)) (1:1).

The extraction mixture was homogenized with a polytron and incubated at 500C for 20

min. The phases were separated and an equal volume of PCI added to the aqueous phase.

The RNA was precipitated overnight at -800C following the addition of 2.5 volumes of

ethanol and 1/10 volume of sodium acetate. The nucleic acids were pelleted by

centrifugation, (14,000 g for 30 min) resuspended in water and precipitated in 2M LiC1.









The LiCl precipitation was repeated and a subsequent sodium acetate/ethanol

precipitation performed.

RNA Gel Blot Analysis

RNA gel blot analysis was performed using 20 Eog total RNA for each sample as

described by Kneiss1 and Deikman (1996). The RNA was transferred onto a charged

membrane (Hybond-N+; Amersham Life Science inc., Arlington Heights, IL). The PR1

(Genbank accession AY117187) and PDFl .2 (full length cDNA from gene at5g44420)

probes were obtained from The Arabidopsis information resource (Ohio State

University). DNA probes were random primer labeled with 32P with the Prime-It II

labeling kit (Stratagene, La Jolla, CA).

Real-time RT-PCR

PRla (TC117463) and PRlb (TC115947) mRNA levels were quantified by Real-

time quantitative RT-PCR using Taqman@ one-step RT-PCR reagents (Applied

Biosystems, Foster City, CA) and an Applied Biosystems GeneAmp 5700 sequence-

detection system. Each determination was performed using 250ng of Dnase-1 treated

total RNA isolated using an RNeasy@ Plant mini kit (Qiagen, Valencia, CA), in a 25ol1

reaction volume. RT-PCR conditions were: 480C for 30 min, 950C for 10 min followed

by 40 cycles of 950C for 15 sec and 600C for 1 min. Absolute mRNA levels were

quantified using synthesized sense strand RNAs as standards. Primers and probes were

designed using PRIMER EXPRESS software (Applied Biosystems) and were as follows:

PRlb probe 5'-/56-FAM/CAACGGATGGTGGTTCATTTCTTGCA/3B H1-'; PRla

Probe 5' -/56-FAM/TGTGGGTGTCCGGAGAGCCA GA/3BH _1/-3' PR Ib forward

primer 5'-GGTCGGGCACGTTGCA-3 '; PRlb reverse primer 5'-GATCCAGTT-






57


GCCTACAGGACAT-A-3'; PRla forward primer 5'-GAGGGCAGCCGTGCAA-3';

PRla reverse primer 5'-CACATTTTTCCACCAACACATTG-3 (Intergrated DNA

Technologies, Coralville, IA). Each sample was a minimum of two biological replicates

and each experiment was repeated at least twice.

MCP Treatment

MCP treatment was performed 24 hours prior infection as described in Ciardi et al

(2000).
















LIST OF REFERENCES


Agrios GN (1988) Plant pathology, Ed 3rd. Academic Press, San Diego

Agrios GN (1997) Plant pathology, Ed 4th. Academic Press, San Diego

Alexander D, Goodman RM, Gut-Rella M, Glascock C, Weymann K, Friedrich L,
Maddox D, Ahl-Goy P, Luntz T, Ward E, et al. (1993) Increased tolerance to
two oomycete pathogens in transgenic tobacco expressing pathogenesis-related
protein la. Proc Natl Acad Sci U SA 90: 7327-7331

Alfano JR, Collmer A (1996) Bacterial pathogens in plants: life up against the wall.
Plant Cell 8: 1683-1698

Ausubel FM, Katagiri F, Mindrinos M, Glazebrook J (1995) Use of Arabidopsis
thaliana defense-related mutants to dissect the plant response to pathogens. Proc
Natl Acad Sci U SA 92: 4189-4196

Bent AF, Innes RW, Ecker JR, Staskawicz BJ (1992) Disease development in
ethylene-insensitive Arabidopsis thaliana infected with virulent and avirulent
Pseudonzona~s and Xanthonzona~s pathogens. Mol Plant Microbe Interact 5: 372-378

Bleecker AB, Estelle MA, Somerville C, Kende H (1988) Insensitivity to ethylene
conferred by a dominant mutation in Arabidopsis-thaliana. Science 241: 1086-1089

Bohlmann H, Vignutelli A, Hilpert B, Miersch O, Wasternack C, Apel K (1998)
Wounding and chemicals induce expression of the Arabidopsis thaliana gene
Thi2.1, encoding a fungal defense thionin, via the octadecanoid pathway. FEBS
Lett 437: 281-286

Bonas U, Conradsstrauch J, Balbo I (1993) Resistance in tomato to Xanthonzona~s-
canspestris pv vesicatoria is determined by alleles of the pepper-specific avirulence
gene Avrbs3. Mol Gen Genet 238: 261-269

Cameron RK, Paiva NL, Lamb CJ, Dixon RA (1999) Accumulation of salicylic acid
and PR-1 gene transcripts in relation to the systemic acquired resistance (SAR)
response induced by Pseudomonas syringae py. tomato in Arabidopsis. Physiol
Mol Plant P 55: 121-130









Cao H, Bowling SA, Gordon AS, Dong X (1994) Characterization of an Arabidopsis
mutant that is nonresponsive to inducers of systemic acquired resistance. Plant Cell
6: 1583-1592

Cao H, Glazebrook J, Clarke JD, Volko S, Dong X (1997) The Arabidopsis NPR1
gene that controls systemic acquired resistance encodes a novel protein containing
ankyrin repeats. Cell 88: 57-63

Chamnongpol S, Willekens H, Moeder W, Langebartels C, Sandermann H, Jr., Van
Montagu M, Inze D, Van Camp W (1998) Defense activation and enhanced
pathogen tolerance induced by H1202 in transgenic tobacco. Proc Natl Acad Sci U
S A 95: 5818-5823

Ciardi JA, Tieman DM, Jones JB, Klee HJ (2001) Reduced expression of the tomato
ethylene receptor gene LeETR4 enhances the hypersensitive response to
XanthomonasXX~~XX~~~XX~~XX campestris py. vesicatoria. Mol Plant Microbe Interact 14: 487-495

Ciardi JA, Tieman DM, Lund ST, Jones JB, Stall RE, Klee HJ (2000) Response to
Xanthomona~s campestris py. vesicatoria in tomato involves regulation of ethylene
receptor gene expression. Plant Physiol 123: 81-92

Clarke JD, Liu Y, Klessig DF, Dong X (1998) Uncoupling PR gene expression from
NPR1 and bacterial resistance: characterization of the dominant Arabidopsis cpr6-1
mutant. Plant Cell 10: 557-569

Clarke JD, Volko SM, Ledford H, Ausubel FM, Dong X (2000) Roles of salicylic
acid, jasmonic acid, and ethylene in cpr-induced resistance in Arabidopsis. Plant
Cell 12: 2175-2190

Cohen Y, Kue J (1981) Evaluation of systemic resistance to blue mold induced in
tobacco-leaves by prior stem inoculation with Peronospora-hyoscyami F sp
tabacina. Phytopathology 71: 783-787

Delaney TP, Uknes S, Vernooij B, Friedrich L, Weymann K, Negrotto D, Gaffney T,
Gutrella M, Kessmann H, Ward E, Ryals J (1994) A central role of salicylic-
acid in plant-disease resistance. Science 266: 1247-1250

Despres C, DeLong C, Glaze S, Liu E, Fobert PR (2000) The Arabidopsis
NPR1/NIM1 protein enhances the DNA binding activity of a subgroup of the TGA
family of bZIP transcription factors. Plant Cell 12: 279-290

Dewdney J, Reuber TL, Wildermuth MC, Devoto A, Cui J, Stutius LM, Drummond
EP, Ausubel FM (2000) Three unique mutants of Arabidopsis identify eds loci
required for limiting growth of a biotrophic fungal pathogen. Plant J 24: 205-218

Enkerli J, Gisi U, Mosinger E (1993) Systemic acquired-resistance to Phytophthora-
infestans in tomato and the role of pathogenesis-related proteins. Physiol Mol Plant
P 43: 161-171










Epple P, Apel K, Bohlmann H (1995) An Arabidopsis-thaliana thionin gene is inducible
via a signal-transduction pathway different from that for pathogenesis-related
proteins. Plant Physiol 109: 813-820

Feys B, Benedetti CE, Penfold CN, Turner JG (1994) Arabidopsis mutants selected for
resistance to the phytotoxin coronatine are male sterile, insensitive to methyl
jasmonate, and resistant to a bacterial pathogen. Plant Cell 6: 751-759

Friedrich L, Vernooij B, Gaffney T, Morse A, Ryals J (1995) Characterization of
tobacco plants expressing a bacterial salicylate hydroxylase gene. Plant Mol Biol
29: 959-968

Gaffney T, Friedrich L, Vernooij B, Negrotto D, Nye G, Uknes S, Ward E,
Kessmann H, Ryals J (1993) Requirement of salicylic-acid for the induction of
systemic acquired-resi stance. Science 261: 754-756

Glazebrook J (2001) Genes controlling expression of defense responses in Arabidopsis--
2001 status. Curr Opin Plant Biol 4: 301-308

Glazebrook J, Chen W, Estes B, Chang HS, Nawrath C, Metraux JP, Zhu T,
Katagiri F (2003) Topology of the network integrating salicylate and j asmonate
signal transduction derived from global expression phenotyping. Plant J 34: 217-
228

Glazebrook J, Rogers EE, Ausubel FM (1996) Isolation of Arabidopsis mutants with
enhanced disease susceptibility by direct screening. Genetics 143: 973-982

Glazebrook J, Rogers EE, Ausubel FM (1997) Use of Arabidopsis for genetic
dissection of plant defense responses. Annu Rev Genet 31: 547-569

Govrin EM, Levine A (2002) Infection of Arabidopsis with a necrotrophic pathogen,
Botrytis cinerea, elicits various defense responses but does not induce systemic
acquired resistance (SAR). Plant Mol Biol 48: 267-276

Gupta V, Willits MG, Glazebrook J (2000) Arabidopsis thaliana EDS4 contributes to
salicylic acid (SA)-dependent expression of defense responses: evidence for
inhibition of jasmonic acid signaling by SA. Mol Plant Microbe Interact 13: 503-
511

Hain R, Reif HJ, Krause E, Langebartels R, Kindl H, Vornam B, Wiese W,
Schmelzer E, Schreier PH, Stocker RH, Stenzel K (1993) Disease resistance
results from foreign phytoalexin expression in a novel plant. Nature 361: 153-156

Hammond-Kosack KE, Jones JD (1996) Resistance gene-dependent plant defense
responses. Plant Cell 8: 1773-1791









Heck S, Grau T, Buchala A, Metraux JP, Nawrath C (2003) Genetic evidence that
expression of NahG modifies defense pathways independent of salicylic acid
biosynthesi s in the Arabidopsi s-Pseudoomonas syringae py. tomato interaction.
Plant J 36: 342-3 52

Hunt MD, Ryals JA (1996) Systemic acquired resistance signal transduction. Crit Rev
Plant Sci 15: 583-606

Jackson AO, Taylor CB (1996) Plant-microbe interactions: life and death at the
interface. Plant Cell 8: 1651-1668

Jeun YC, Siegrist J, Buchenauer H (2000) Biochemical and cytological studies on
mechanisms of systemically induced resistance to Phytophthora infestans in tomato
plants. J Phytopathol 148: 129-140

Kinkema M, Fan W, Dong X (2000) Nuclear localization of NPR1 is required for
activation of PR gene expression. Plant Cell 12: 2339-2350

Klee HJ, Hayford MB, Kretzmer KA, Barry GF, Kishore GM (1991) Control of
ethylene synthesis by expression of a bacterial enzyme in transgenic tomato plants.
Plant Cell 3: 1187-1193

Kloek AP, Verbsky ML, Sharma SB, Schoelz JE, Vogel J, Klessig DF, Kunkel BN
(2001) Resistance to Pseudoomonas syringae conferred by an Arabidopsis thaliana
coronatine-insensitive (coil1) mutation occurs through two distinct mechanisms.
Plant J 26: 509-522

Kneiss1 ML, Deikman J (1996) The tomato E8 gene influences ethylene biosynthesis in
fruit but not in flowers. Plant Physiol 112: 537-547

Knoester M, Pieterse CM, Bol JF, Van Loon LC (1999) Systemic resistance in
Arabidopsis induced by rhizobacteria requires ethylene-dependent signaling at the
site of application. Mol Plant Microbe Interact 12: 720-727

Knoester M, van Loon LC, van den Heuvel J, Hennig J, Bol JF, Linthorst HJM
(1998) Ethylene-insensitive tobacco lacks nonhost resistance against soil-borne
fungi. Proc Natl Acad Sci U SA 95: 1933-1937

Kramell R, Miersch O, Atzorn R, Parthier B, Wasternack C (2000) Octadecanoid-
derived alteration of gene expression and the "oxylipin signature" in stressed barley
leaves. Implications for different signaling pathways. Plant Physiol 123: 177-188

Kubigsteltig I, Laudert D, Weiler EW (1999) Structure and regulation of the
Arabidopsis thaliana allene oxide synthase gene. Planta 208: 463-471

Lanahan MB, Yen HC, Giovannoni JJ, Klee HJ (1994) The never ripe mutation
blocks ethylene perception in tomato. Plant Cell 6: 521-530










Lawton K, Weymann K, Friedrich L, Vernooij B, Uknes S, Ryals J (1995) Systemic
acquired resistance in Arabidopsis requires salicylic acid but not ethylene. Mol
Plant Microbe Interact 8: 863-870

Lawton KA, Friedrich L, Hunt M, Weymann K, Delaney T, Kessmann H, Staub T,
Ryals J (1996) Benzothiadiazole induces disease resistance in Arabidopsis by
activation of the systemic acquired resistance signal transduction pathway. Plant J
10: 71-82

Linthorst HJM (1991) Pathogenesis-related proteins of plants. Crit Rev Plant Sci 10:
123-150

Lund ST, Stall RE, Klee HJ (1998) Ethylene regulates the susceptible response to
pathogen infection in tomato. Plant Cell 10: 371-382

Ma SW, Morris VL, Cuppels DA (1991) Characterization of a DNA region required for
production of the phytotoxin coronatine by Pseudonzona;s-syringae pv tomato. Mol
Plant Microbe Interact 4: 69-74

McConn M, Browse J (1996) The critical requirement for linolenic acid is pollen
development, not photosynthesis, in an Arabidopsis mutant. Plant Cell 8: 403-416

Mittal S, Davis KR (1995) Role of the phytotoxin coronatine in the infection of
Arabidopsis thaliana by Pseudononoas syringae py. tomato. Mol Plant Microbe
Interact 8: 165-171

Moerschbacher BM, Noll U, Gorrichon L, Reisener HJ (1990) Specific-inhibition of
lignification breaks hypersensitive resistance of wheat to stem rust. Plant Physiol
93: 465-470

Moore RA, Starratt, A.N., Ma, S.-W. (1989) Identification of a chromosomal region
required for biosynthesis of the phytotoxin coronatine by Pseudononoas syringae
py. tomato. Can J Microbiol 35: 910-917

Nawrath C, Heck S, Parinthawong N, Metraux JP (2002) EDS5, an essential
component of salicylic acid-dependent signaling for disease resistance in
Arabidopsis, is a member of the MATE transporter family. Plant Cell 14: 275-286

Nawrath C, Metraux JP (1999) Salicylic acid induction-deficient mutants of
Arabidopsis express PR-2 and PR-5 and accumulate high levels of camalexin after
pathogen inoculation. Plant Cell 11: 1393-1404

Niderman T, Genetet I, Bruyere T, Gees R, Stintzi A, Legrand M, Fritig B,
Mosinger E (1995) Pathogenesis-related PR-1 proteins are antifungal. Isolation
and characterization of three 14-kilodalton proteins of tomato and of a basic PR-1
of tobacco with inhibitory activity against Phytophthora infestans. Plant Physiol
108: 17-27









O'Donnell PJ, Jones JB, Antoine FR, Ciardi J, Klee HJ (2001) Ethylene-dependent
salicylic acid regulates an expanded cell death response to a plant pathogen. Plant J
25: 315-323

O'Donnell PJ, Schmelz E, Block A, Miersch O, Wasternack C, Jones JB, Klee HJ
(2003) Multiple hormones act sequentially to mediate a susceptible tomato
pathogen defense response. Plant Physiol 133: 1181-1189

O'Donnell PJ, Schmelz EA, Moussatche P, Lund ST, Jones JB, Klee HJ (2003)
Susceptible to intolerance--a range of hormonal actions in a susceptible
Arabidopsis pathogen response. Plant J 33: 245-257

Oldroyd GED, Staskawicz BJ (1998) Genetically engineered broad-spectrum disease
resistance in tomato. Proc Natl Acad Sci U SA 95: 10300-10305

Park JH, Halitschke R, Kim HB, Baldwin IT, Feldmann KA, Feyereisen R (2002) A
knock-out mutation in allene oxide synthase results in male sterility and defective
wound signal transduction in Arabidopsis due to a block in jasmonic acid
biosynthesis. Plant J 31: 1-12

Parker JE, Szabo V, Staskawicz BJ, Lister C, Dean C, Daniels MJ, Jones JDG
(1993) Phenotypic characterization and molecular mapping of the Arabidopsis-
thaliana locus Rpp5, determining disease resistance to Peronospora~-p~arasitica.
Plant J 4: 821-831

Pearce G, Strydom D, Johnson S, Ryan CA (1991) A polypeptide from tomato leaves
induces wound-inducible proteinase-inhibitor proteins. Science 253: 895-898

Penninckx IA, Eggermont K, Terras FR, Thomma BP, De Samblanx GW, Buchala
A, Metraux JP, Manners JM, Broekaert WF (1996) Pathogen-induced systemic
activation of a plant defensin gene in Arabidopsis follows a salicylic acid-
independent pathway. Plant Cell 8: 2309-2323

Penninckx IAMA, Thomma BPHJ, Buchala A, Metraux JP, Broekaert WF (1998)
Concomitant activation of jasmonate and ethylene response pathways is required
for induction of a plant defensin gene in Arabidopsis. Plant Cell 10: 2103-21 13

Pieterse CMJ, van Wees SCM, van Pelt JA, Knoester M, Laan R, Gerrits N,
Weisbeek PJ, van Loon LC (1998) A novel signaling pathway controlling
induced systemic resistance in Arabidopsis. Plant Cell 10: 1571-1580

Rick CM, Butler L (1956) Cytogenetics of the tomato. Adv Genet 8: 267-3 82

Ryals JA, Neuenschwander UH, Willits MG, Molina A, Steiner HY, Hunt MD
(1996) Systemic acquired resistance. Plant Cell 8: 1809-1819










Schmelz EA, Engelberth J, Alborn HT, O'Donnell P, Sammons M, Toshima H,
Tumlinson JH, 3rd (2003) Simultaneous analysis of phytohormones, phytotoxins,
and volatile organic compounds in plants. Proc Natl Acad Sci U SA 100: 10552-
10557

Seo HS, Song JT, Cheong JJ, Lee YH, Lee YW, Hwang I, Lee JS, Choi YD (2001)
Jasmonic acid carboxyl methyltransferase: A key enzyme for j asmonate-regulated
plant responses. Proc Natl Acad Sci U SA 98: 4788-4793

Showalter AM, Bell JN, Cramer CL, Bailey JA, Varner JE, Lamb CJ (1985)
Accumulation of hydroxyproline-rich glycoprotein messenger-RNAs in response to
fungal elicitor and infection. Proc Natl Acad Sci U SA 82: 6551-6555

Sisler EC, Serek M (1997) Inhibitors of ethylene responses in plants at the receptor
level: Recent developments. Physiol Plantarum 100: 577-582

Spoel SH, Koornneef A, Claessens SM, Korzelius JP, Van Pelt JA, Mueller MJ,
Buchala AJ, Metraux JP, Brown R, Kazan K, Van Loon LC, Dong X, Pieterse
CM (2003) NPR1 modulates cross-talk between salicylate- and j asmonate-
dependent defense pathways through a novel function in the cytosol. Plant Cell 15:
760-770

Stenzel I, Hause B, Maucher H, Pitzschke A, Miersch O, Ziegler J, Ryan CA,
Wasternack C (2003) Allene oxide cyclase dependence of the wound response and
vascular bundle-specific generation of jasmonates in tomato amplification in
wound signalling. Plant J 33: 577-589

Stintzi A, Weber H, Reymond P, Browse J, Farmer EE (2001) Plant defense in the
absence of jasmonic acid: The role of cyclopentenones. Proc Natl Acad Sci US A
98: 12837-12842

Strobel NE, Ji C, Gopalan S, Kuc JA, He SY (1996) Induction of systemic acquired
resistance in cucumber by Pseudomona~s syringe pv syringe 61 HrpZ(Pss)
protein. Plant J 9: 431-439

Summermatter K, Sticher L, Metraux JP (1995) Systemic responses in Arabidopsis
thaliana infected and challenged with Pseudomona~s syringe pv syringe. Plant
Physiol 108: 1379-1385

Van Loon LC, Van Strien EA (1999) The families of pathogenesis-related proteins,
their activities, and comparative analysis of PR-1 type proteins. Physiol Mol Plant
P 55: 85-97

Van Wees SC, Glazebrook J (2003) Loss of non-host resistance of Arabidopsis NahG to
Pseudomona~s syringe py. pha~seolicola is due to degradation products of salicylic
acid. Plant J 33: 733-742









Vernooij B, Friedrich L, Goy PA, Staub T, Kessmann H, Ryals J (1995) 2,6-
dichloroi sonicotinic acid-induced resistance to pathogens without the accumulation
of salicylic-acid. Mol Plant Microbe Interact 8: 228-234

Vernooij B, Friedrich L, Morse A, Reist R, Kolditz-Jawhar R, Ward E, Uknes S,
Kessmann H, Ryals J (1994) Salicylic acid is not the translocated signal
responsible for inducing systemic acquired resistance but is required in signal
transduction. Plant Cell 6: 959-965

Vijayan P, Shockey J, Levesque CA, Cook RJ, Browse J (1998) A role for j asmonate
in pathogen defense of Arabidopsis. Proc Natl Acad Sci U SA 95: 7209-7214

Ward ER, Uknes SJ, Williams SC, Dincher SS, Wiederhold DL, Alexander DC,
Ahl-Goy P, Metraux JP, Ryals JA (1991) Coordinate gene activity in response to
agents that induce systemic acquired resistance. Plant Cell 3: 1085-1094

Weiler EW, Kutchan TM, Gorba T, Brodschelm W, Niesel U, Bublitz F (1994) The
Pseudoomonas phytotoxin coronatine mimics octadecanoid signalling molecules of
higher plants. FEBS Lett 345: 9-13

Wildermuth MC, Dewdney J, Wu G, Ausubel FM (2001) Isochorismate synthase is
required to synthesize salicylic acid for plant defence. Nature 414: 562-565

Xie DX, Feys BF, James S, Nieto-Rostro M, Turner JG (1998) COIl: An Arabidopsis
gene required for jasmonate-regulated defense and fertility. Science 280: 1091-
1094

Yamamoto S, Katagiri M, Maeno H, Haysishi O (1965) Salicylate hydroxylase, a
monooxygenase requiring flavin adenine dinucleotide. I. Purification and general
properties. J Biol Chem 240: 3408-3413

Zhao Y, Thilmony R, Bender CL, Schaller A, He SY, Howe GA (2003) Virulence
systems of Pseudoomonas syringae py. tomato promote bacterial speck disease in
tomato by targeting the jasmonate signaling pathway. Plant J 36: 485-499

Zhou N, Tootle TL, Tsui F, Klessig DF, Glazebrook J (1998) PAD4 functions
upstream from salicylic acid to control defense responses in Arabidopsis. Plant Cell
10: 1021-1030
















BIOGRAPHICAL SKETCH

Anna Block was born on the 13th Of May 1978 in Nottingham, England. She

completed her GCSE's and A levels at John Mason School in Abingdon, Oxfordshire, in

1994 and 1996 respectively. She then went on to receive her master's degree in

biochemistry from the University of Bath in 2000. During her master's degree she

accomplished two 6-month internships. The first internship was in 1998 for Rhone-

Poulenc in Essex and the second in 1999 in the laboratory of Harry Klee at the University

of Florida. She returned to the University of Florida in 2000 for her doctoral studies in

the plant cellular and molecular biology program