<%BANNER%>

Genetic Diversity and Population Structure of Peach Palm (Bactris gasipaes Kunth) in Agroforestry Systems of the Peruvia...


PAGE 1

GENETIC DIVERSITY AND PO PULATION STRUCTURE OF PEACH PALM ( Bactris gasipaes Kunth) IN AGROFORESTRY SYSTEMS OF THE PERUVIAN AMAZON By DAVID MICHAEL COLE A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2004

PAGE 2

Copyright 2004 by David Michael Cole

PAGE 3

ACKNOWLEDGMENTS My thesis committee, co-chaired by P.K.R. Nair and Tim White with Rongling Wu, are acknowledged for both financial assistance during my two years in Gainesville (full-time assistantship with the School of Forest Resources/IFAS) as well as for priming my understanding of the fundamentals of population genetics. Funding for field research during the fall semester of 2003 was provided by the University of Floridas Center for Latin American Studies, Tropical Conservation and Development Program. In addition, generous research grants from both the International Palm Society and the South Florida Palm Society were used to offset expenses accrued during the laboratory portion of the investigation. Pam and Doug Soltis, along with their lab manager Matt Gitzendanner, are to be thanked for providing lab facilities and for their invaluable assistance with mysterious bio-chemical recipes. Special thanks go to Jonathan Cornelius with the World Agroforestry Centre in Lima Peru, for his help in securing the initial permits needed to collect genetic material; to Italo Cardama Vsquez and Sixto Iman with the Instituto Nacional de Investigacin Agraria in Iquitos Peru, for providing the use of their cold storage facilities and coordinating collection of germplasm from their collection; and to the staff at the Biodiversity office of Instituto Nacional de Recursos Naturales in Lima Peru, for hastening their authorization process for a gringo who had run short on time. iii

PAGE 4

TABLE OF CONTENTS page ACKNOWLEDGMENTS.................................................................................................iii LIST OF TABLES.............................................................................................................vi LIST OF FIGURES..........................................................................................................vii ABSTRACT.....................................................................................................................viii CHAPTER 1 INTRODUCTION........................................................................................................1 Vulnerability of Genetic Diversity in Peach Palm Agroforestry Systems...................2 Genetic Forces Preserving Diversity within Peach Palm Populations.........................4 Main Objectives of Study.............................................................................................4 2 REVIEW OF THE LITERATURE..............................................................................5 Domestication Process in Peach Palm..........................................................................5 Molecular Analyses of Bactris gasipaes Landraces.....................................................7 Farmer Selection of Tree Seed.....................................................................................9 Bora Swidden-Fallow Agroforestry...........................................................................10 Metapopulation Dynamics..........................................................................................11 Artificial Selection within the Metapopulation...................................................13 Reduced Gene Flow within the Metapopulation.................................................13 Pollen-Based Gene Flow within the Metapopulation..........................................13 Migration within the Metapopulation..................................................................14 Population Turnover within the Metapopulation................................................15 Overlapping Generations and Remnant Trees within the Metapopulation.........17 Microsatellite Molecular Markers..............................................................................19 The Mechanics of PCR and Microsatellite Markers...................................................19 3 MATERIALS AND METHODS...............................................................................21 Populations and Sampling..........................................................................................21 Informal Farmer Surveys.....................................................................................23 Collection and Extraction of DNA......................................................................24 Microsatellite Marker Genetic Analysis.....................................................................24 iv

PAGE 5

Microsatellite Loci for Bactris gasipaes.............................................................24 PCR Amplification..............................................................................................25 DNA Sequencing.................................................................................................26 Statistical Analyses..............................................................................................27 4 RESULTS AND DISCUSSION.................................................................................29 Farmers Seed Selection, Sourcing and Management of Palms.................................29 Molecular Marker Results..........................................................................................32 Genetic Diversity and Hardy-Weinberg Equilibrium..........................................32 Genetic Differentiation........................................................................................34 Isolation-by-Distance..........................................................................................36 Discussion...................................................................................................................39 Seed Migration within a Metapopulation............................................................39 Population Structuring and Genetic Differentiation............................................41 Maintenance of Remnant Trees on the Indigenous Farms..................................42 Comparing Genetic Diversity and Heterozygosity Estimates.............................45 General Discussion.....................................................................................................46 Conclusion..................................................................................................................47 Epilogue: Participatory Domestication of Peach Palm in Peru..................................48 APPENDIX A EXACT ORIGINS OF POPULATIONS ANALYZED.............................................51 B DNA EXTRACTION PROTOCOL...........................................................................53 Stock Solutions...........................................................................................................54 C PAIRWISE GENETIC DIFFERENTIATION AMONG POPULATIONS AND TESTS OF SIGNIFICANCE WITH BONFERRONI CORRECTIONS...................56 LIST OF REFERENCES...................................................................................................58 BIOGRAPHICAL SKETCH.............................................................................................67 v

PAGE 6

LIST OF TABLES Table page 3-1 Microsatellite primer pairs used for population genetic analysis of peach palm.....25 4-1 Average age of peach palms sampled from colonist and indigenous metapopulations.......................................................................................................31 4-2 Microsatellite diversity and heterozygote deficiency in colonist and indigenous peach palm metapopulations; landraces sampled from El Dorado collection included for comparison...........................................................................................33 4-3 Weighted allele frequencies at individual loci for colonist and indigenous metapopulation study areas......................................................................................35 4-4 Unbiased estimates of Wright F-statistics for colonist/indigenous metapopulations; landrace populations sampled from El Dorado collection included for comparison...........................................................................................37 A-1 Exact origins of the 221 colonist (Tamshiyacu-Tahuayo) samples.........................51 A-2 Exact origins of the 165 indigenous (Yahuasyacu-Ampiyacu) samples..................51 A-3 Exact origins of the 8 populations from 5 landraces sampled from El Dorado collection..................................................................................................................52 C-1 Pairwise genetic differentiation within colonist metapopulation.............................56 C-2 Pairwise genetic differentiation within indigenous metapopulation........................56 C-3 Pairwise genetic differentiation of eight populations of five peach palm landraces sampled from El Dorado collection.........................................................................57 vi

PAGE 7

LIST OF FIGURES Figure page 2-1. Approximate distribution of Bactris gasipaes landraces in the lowland Neotropics..................................................................................................................6 3-1. Relative locations of two study areas, metapopulations (communities) and farms sampled.....................................................................................................................22 4-1. Seed sourcing for peach palms sampled from the colonist and indigenous metapopulations.......................................................................................................30 4-2. Testing for an isolation-by-distance relationship among farms within each of the two metapopulations and among populations analyzed from the El Dorado collection. ...............................................................................................................38 vii

PAGE 8

Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science GENETIC DIVERSITY AND PO PULATION STRUCTURE OF PEACH PALM ( Bactris gasipaes Kunth) IN AGROFORESTRY SYSTEMS OF THE PERUVIAN AMAZON By David Michael Cole December 2004 Chair: P.K.R. Nair Cochair: Timothy L. White Major Department: School of Forest Resources and Conservation Peach palm (Bactris gasipaes Kunth) is an important component in Peruvian agroforestry systems, and is cultivated for its fruit and heart of palm. Based on observations of farming practices in the Peruvian Amazon, the genetic diversity of peach palm appears to be vulnerable to farmer selection, inbreeding and founder effects in traditional swidden-fallow agroforestry systems. This study used microsatellite molecular markers to assess the genetic diversity and population structure of peach palm in the agroforestry systems of eight riverine communities in northeastern Peru, comprising two study areas 160 km apart (four colonist and four indigenous communities per study area). In addition, an analysis of a peach palm germplasm collection of diverse geographical origin provided a basis of comparison for estimates of genetic variability and population structuring. Farmers were surveyed on their seed selection practices for peach palm in swidden-fallow agroforestry systems. An average of only four maternal parent palms were reported to have been selected to provide seed for the establishment of the swiddens and fallows sampled in both study areas. However, seeds of peach palm obtained from viii

PAGE 9

different regions have recently been migrating into populations in the two study areas at contrasting rates. A metapopulation approach was used to describe migration within and among regions, implying a hierarchical structure of gene flow which could maintain relative levels of genetic diversity in peach palm over time offsetting founder effects and strong phenotypic selection observed in traditional agroforestry systems. Seed migration was occurring over larger distances and at a higher frequency in the indigenous metapopulation, and a proportionally greater number of alleles were found (with respect to the colonist metapopulation). The indigenous farmers were also preserving remnant peach palms through successive swidden generations, which may contribute to the maintenance of alleles within the metapopulation by reducing founder effects. Population differentiation was reduced in the indigenous study area with respect to both the colonist metapopulation and the comparison sampling from the peach palm germplasm collection. In general, all groups of populations sampled had relatively limited genetic structure, which is believed to result from the interand intra-regional exchange of seeds over long periods of time. Pollen flow, over distances greater than expected, has probably played a role in reducing population differentiation as well. The facilitation of long distant seed migration among populations in the recent past is believed to have attributed to levels of neutral microsatellite diversity observed at present; thus, the preservation of evolutionary processes which actively create and maintain general levels of genetic diversity on-farm seems warranted. ix

PAGE 10

CHAPTER 1 INTRODUCTION Bactris gasipaes Kunth (syn. Guilielma gasipaes Kunth), also known as peach palm, is well adapted to the nutrient-poor acid soils of the Neotropics. This fully domesticated palm reaches heights of over 20 m at maturity, and is cultivated as an upper-story component in agroforestry systems for its starchy, nutritious fruit (Clement 1989). The fruit is consumed after cooking, or processed into a variety of products depending on variations in texture, flavor, oil and starch content of the fruit mesocarp. Processed products include fermented beverages, flour for infant formula and baked goods, cooking oil and animal feed (Clement et al. 2004b). The palm is also managed in high-density plantations for its meristem, or heart of palm, which was a profitable international export for both Costa Rica and Ecuador in the recent past (Mora-Urp and Echeverra 1999), but which is now suffering from over-production (C.R. Clement, March 2003, personal communication). Profits from the sale of peach palm fruit in subsistence-based markets make it one of the most valuable crops currently grown in the Peruvian Amazon (Weber et al. 1997, Labarta and Weber 1998). Bactris gasipaes was listed as the number-one priority tree species for agroforestry research and development in the Peruvian Amazon during the late 1990s based on farmer-preference surveys conducted by the International Centre for Research in Agroforestry (Sotelo-Montes and Weber 1997). 1

PAGE 11

2 Vulnerability of Genetic Diversity in Peach Palm Agroforestry Systems Biodiversity is defined as the sum total of all biotic variation, including all flora and fauna species from the scale of an ecosystem down to that of individual genes and alleles (Purvis and Hector 2000). Genetic diversity within a species is thus at the lowest hierarchy of biodiversity which enhances, not diminishes, its importance. Without genetic diversity, a plant population loses its ability to adapt to its environment and evolve with changing climates or cultural systems. Such concerns are vitally important for a multipurpose tree like peach palm. It has been estimated that Bactris gasipaes has been in the process of domestication for the past 10,000 years (Clement 1988, 1992). Based on observations of farmer practices in the Peruvian Amazon, the genetic diversity of peach palm appears to be vulnerable to farmer selection and founder effects in traditional swidden-fallow agroforestry systems. Swidden-fallow agroforestry, or shifting agriculture, has been the main mode of peach palm cultivation in post-contact Amazonia (Patio 1963). These agroforestry systems contain spatial, genetic and cultural factors that have the potential to diminish the palms diversity and alter its genetic architecture (Clement 1988). Over time, the combined forces of genetic drift, selection and inbreeding in the context of domestication decrease genetic diversity in those traits being selected and increase divergence among populations if selection is differential. The reproductive biology of Bactris gasipaes is an important factor when considering its population genetic distribution, as pollen gene flow is believed to be limited and local. Anthesis of male and female flowers is not normally synchronous within a given palm, thus selfing occurs very rarely (Listabarth 1996). The principal pollinators of Bactris gasipaes in the Peruvian Amazon, beetles of the genus Phyllotrox

PAGE 12

3 (Curculionidae) and Epurea (Nitidulidae), have a flight range believed to be only 150 to 200 m between palms (Mora-Urp and Solis 1980, Mora-Urp 1982, Listabarth 1996), and the pollen has a relatively short viability period of 1 to 2 days (Miranda and Clement 1990). A molecular marker investigation using progeny arrays within a completely genotyped isolated population is currently underway, which will help to determine a more accurate pollen-dispersal distance for this species (C.R. Clement, June 2004, personal communication). Patterns of seed dispersal produced by forest wildlife (e.g. avian predators in the Psittacidae family) have not been investigated, but the dispersal distance is thought to be limited. If the scattered isolation of peach palm populations in the forest inhibits pollen-mediated gene flow, the relatively small size of the swidden-fallow clearings (1 to 3 hectares on average) would also limit the breeding population sizes of this allogamous palm (Clement 1988). When preparing to plant a new swidden, farmers tend to choose seed for the next generation of palms from a small selection of preferred individuals from a base population that is limited in number to begin with. Few farmers realized that genetic quality might decline through repeated selection of only the best trees (Weber et al. 1997). Thus, a loss of within-population heterozygosity is expected to occur with each founding event (Nei et al. 1975, Maruyama and Fuerst 1985), with particular impact on the elimination of rare recessive alleles and those not favored by selection. Since there is a high likelihood that half or full sibs will be planted together in groups (Clement 1988), in subsequent generations inbreeding or sib-mating occurs; increasing the frequency of homozygous genotypes at the expense of the heterozygous genotypes which can lead to inbreeding depression (Hartl 2000).

PAGE 13

4 Genetic Forces Preserving Diversity within Peach Palm Populations Farmers sometimes collect seed from palms on neighboring farms, and select desirable palm fruits in the local markets to obtain seed for planting (Weber et al. 1997). This results in migration of genetic material among neighbouring or even distant populations, and may counteract genetic drift, selection and inbreeding, which work to reduce genetic variation within populations and increase divergence among them. Thus, migration could produce sufficient gene flow to restore relative levels of genetic diversity, through a process that resembles interaction within a metapopulation loosely defined as a population of interacting subpopulations (Hanski 1999). This phenomenon was discussed by Louette (2000) in terms of the management of Mexican maize (Zea mays spp. mays) landraces. Recent genetic analysis of peach palm growing in the Yurimaguas region of Peru found moderate to high levels of genetic diversity with low population differentiation, lending support to the theory that seed exchange is countering the genetic divergence and fixation of populations (Adin et al. 2004). Main Objectives of Study We do not know to what extent farmer seed selection, seed sourcing and management of agroforestry systems in general lead to a reduction or maintenance of genetic diversity in peach palm; yet, this knowledge is fundamental in any effort to preserve crop genetic resources in situ. This study employs microsatellite molecular markers to examine the genetic diversity and population structuring of peach palm cultivated in swidden-fallow agroforestry systems of the northeastern Peruvian Amazon. An exploration of the interplay between farmer seed selection and seed migration (interaction within and among metapopulations) was the underlying thread of this investigation, which compared the agroforestry management practices of two study areas.

PAGE 14

CHAPTER 2 REVIEW OF THE LITERATURE Domestication Process in Peach Palm It has been estimated that Bactris gasipaes has been in the process of domestication for the past 10,000 years (Clement 1988, 1992). The species has historically been cultivated from central Bolivia to northeastern Honduras and from the mouth of the Amazon River to the Pacific coast of Ecuador and Columbia (Mora-Urp and Clement 1988). The analysis of Rodrigues et al. (2004a) suggested two migration routes out of a possible source area in southwestern Amazonia where the purported wild progenitor Bactris gasipaes var. chichagu is found (Henderson 2000). The first route is to the northeast, in the direction of eastern Amazonia; the second is to the northwest, in the direction of western Amazonia, eventually crossing the Andes to reach Central America. The lack of consistent preferences driving traditional in situ breeding for fruit and stem characteristics, coupled with extensive germplasm exchanges (seed migration), has served to maintain a wide range of variation in Bactris gasipaes (Clement 1988). Mora-Urp and Clement (1988) have morphologically characterized and mapped a complex landrace pattern divided into oriental and occidental subcomplexes, based principally on vegetative differences as well as a 3-tier hierarchy to discriminate landraces by the weight of their fruit: Microcarpa: 10 to 30 g per fruit Mesocarpa: 30 to 70 g per fruit Macrocarpa: 70 to 250 g per fruit 5

PAGE 15

6 Rodrigues et al. (2004a) further clarified these landrace classifications with molecular genetic analyses (2-1). Figure 2-1. Approximate distribution of Bactris gasipaes landraces in the lowland Neotropics (light shading indicates general distribution of species). A) Microcarpa landraces 4. Temb, 5. Juru, 6. Par. B) Mesocarpa landraces 1. Rama, 2. Utilis, 3. Cauca, 7. Pampa Hermosa, 8. Tigre, 9. Pastaza, 10. Inirida. C) Macrocarpa landraces 11. Putumayo, 12. Vaups. Source: Rodrigues D.P. 2001. Anlise das morfo-raas primitivas de pupunha (Bactris gasipaes Kunth) mantidas no banco ativo de germoplasma de pupunha com marcadores moleculares RAPDs. Masters Thesis, Universidade de Braslia, Braslia. The size and starchiness of the fruit reflect the degree of modification that occurred during the course of domestication of Bactris gasipaes from its wild progenitor, B. gasipaes var. chichagu (Clement 1988, Rodrigues et al. 2004a). Macrocarpa fruits are extremely starchy and dry, which helps to account for their large increase in size relative to the smaller, oilier fruits of microcarpa Bactris gasipaes and B. gasipaes var. chichagu (Clement 1992). Other expected attributes of domestication found in macrocarpa include an increased pulp-to-fruit ratio (97% in macrocarpa vs. 85% in microcarpa), increased

PAGE 16

7 bunch weight (8 kg in macrocarpa vs. 3 kg in microcarpa), an increased fruit to bunch ratio (95% in macrocarpa vs. 90% in microcarpa) and an increased frequency of spineless leaves and trunks (Clement and Mora-Urp 1988a). These modifications in Bactris gasipaes illustrate that a repetitive, continual process of artificial selection (domestication) has the capacity to extend the phenotypic extremes occurring in a plant well beyond the range of variation found in its natural progenitors (Hartl 2000). At the same time a general loss of heterozygosity, and the associated genetic variation often occurs during the domestication of any species as a direct result of selecting for these phenotypic extremes (Doebley 1989). A reduction in the frequencies of those alleles not favored by selection should only occur at loci affecting selected traits (Hartl 2000). Molecular Analyses of Bactris gasipaes Landraces The first molecular analysis of Bactris gasipaes on any significant scale used isozymes (Clement 1995). Isozyme analyses observe allelic variation at isozyme loci using electrophoretic techniques (Weeden and Wendel 1989). The bands in the gels represent the protein products of specific alleles, usually at loci involved in intermediary metabolism (Newberry and Ford-Lloyd 1997). Clement (1995) analyzed 270 plants from nine progenies of the Putumayo macrocarpa landrace variety, sampled from the germplasm collection of Instituto Nacional de Pesquisas da Amaznia (INPA) in Manaus, Brazil (established as a result of the 1983-84 USAID expeditions, which collected seed of Bactris gasipaes from farms throughout the geographical range of the palm). He found an extremely low mean heterozygosity and moderate to high inbreeding coefficients, evidently due to recent selection for spinelessness in the palm. He then went on to infer

PAGE 17

8 that the experimental collection sampled was established using a limited genetic base to begin with (Clement 1995). In 1997, Clement et al. examined isozyme variation in three spineless populations of Bactris gasipaes (361 plants) maintained in INPAs germplasm collection, and identified the apical meristem of a lateral shoot for optimal extraction of enzymes (and subsequently, DNA). The low mean heterozygosity in the results obtained was attributed to the management history (apparent inbreeding) of the germplasm, prior to its collection in the experimental population sampled (Clement et al. 1997). The first molecular analysis of DNA from Bactris gasipaes was carried out in 2001 by Sousa et al. using RAPD (Random Amplified Polymorphic DNA) markers, followed by an AFLP (Amplified Fragment Length Polymorphism) marker analysis by Clement et al. in 2002. RAPD and AFLP techniques use arbitrary primers with PCR (polymerase chain reaction), resulting in DNA fragments that are then separated on agarose gels. Genetic diversity in RAPD and AFLP data is visualized on the gels as the presence or absence of band fragments resulting from sequence differences in primer binding sites (Karp et al. 1997, Hartl 2000). Genetic difference between any two plants is indicated by the dissimilarity of their banding patterns (Karp et al. 1997). In these two studies, which both used germplasm obtained from INPAs collection, the marker analysis revealed that populations which were morphologically determined to represent three separate landrace types by Mora-Urp and Clement (1988) corresponded to only two genetically differentiated landraces (Sousa et al. 2001, Clement et al. 2002, Rodrigues et al. 2004a. Rodrigues et al. (2004a) confirmed this same revision of landrace differentiation using a RAPD analysis of seven landraces from INPAs collection, and also went on to

PAGE 18

9 estimate the partitioning of genetic diversity among the different landraces sampled as 15% among landraces and 85% within them, suggesting that the different landraces are closely related. These values are similar to those estimated for other allogamous plant species in the tropics (Bawa 1992). However, it remained to be determined how the 85% gets distributed throughout the various populations that constitute a given landrace of Bactris gasipaes. Mora-Urp et al. (1997) hypothesized that most of the genetic variation within a landrace may occur among numerous small sub-populations due to genetic drift and differential selection, and that within these sub-populations there may be relatively low diversity due to founder effects and selection. Recently, genetic analysis of Pampa Hermosa landrace populations using AFLP markers has suggested otherwise, finding low genetic differentiation among populations with relatively high levels of genetic diversity within them (Adin et al. 2004). When population genetic structure is established using molecular methods, the extent to which population subdivision and inbreeding influence patterns of variability within and between populations can be inferred (Loveless and Hamrick 1984). Farmer Selection of Tree Seed In Peru, some farmers discriminate peach palm varieties by the color of the fruit mesocarp, for the qualitative traits of the fruit associated with each color. For instance, fruits with a red waxy coat are said to be higher in oil than are fruits with a yellow (or red) non-waxy coat (Weber et al. 2001). If farmers who prefer the palm as a source of starch are only planting out seed from yellow non-waxy fruit, their selection might be dramatically eroding diversity at loci influencing this trait (especially as yellow fruits occur less frequently than red).

PAGE 19

10 Brodie et al. (1997) surveyed farmers in two separate regions of the Peruvian Amazon in an investigation of the origins of fruit and timber tree germplasm on-farm. They found that 87% of the fruit trees were planted from seed the farmer had personally selected. Sixty percent of these seeds were selected from on-farm germplasm and the rest were obtained from off-farm sources in the near vicinity. Lengkeek (2003) conducted similar surveys amongst farmers in Kenya and found that an influx of germplasm from a distant source occurred only rarely for both indigenous and non-indigenous tree species. Brodie et al. (1997) reported that the farmers selection criteria focused on the size, sweetness, texture, taste and seed characteristics rather than on overall yield of the tree. Since the sources of germplasm for the first generation of trees were primarily local, with presumably low levels of diversity, this study concluded that the farms were at risk of experiencing reduced yields (via inbreeding depression) and pest or pathogen outbreaks as a result of the narrow genetic base of their trees. They also concluded that farmers perceptions are short-term and that they generally do not appreciate the value of variation in the tree species they cultivate. Few farmers realized that genetic quality might decline through repeated selection of only the best trees (Weber et al. 1997, Lengkeek 2003). Bora Swidden-Fallow Agroforestry A swidden is an agricultural field that is cleared from out of the forest, usually by hand with axes, saws and fire, and then planted for one or a few years with nutrient demanding crops before being left fallow for a period of time (Conklin 1957). The indigenous Bora farmers living near Pebas Peru have been reported to manage their swiddens and fallows by protecting useful vegetation, both spontaneously occurring and intentionally planted, from the encroachment of the surrounding forest. A substantial

PAGE 20

11 proportion of the useful vegetation occurring in a given fallow was not necessarily planted by the farmer in the previous swidden (Denevan and Treacy 1987). Bactris gasipaes was listed by Denevan and Treacy (1987) as a planted or protected perennial species in the Bora swiddens and fallows, and recent field research in 2002 and 2003 corroborates this claim. A large proportion of the palms sampled for the current study were claimed to be over 50 years old, originally planted in previous generations of swiddens. These palms re-sprout and maintain production over the years as a result of the farmers systematic clearing of the same land again and again. Ten to twenty years was reported to be the minimum length of fallowing used by the farmers (Denevan and Treacy 1987). If left to compete with the rapid regeneration of secondary forest vegetation, Bactris gasipaes perishes from a lack of photosynthetic activity after about 20 years (Clement 1990). The palm was present in Denevan and Treacys (1987) sampling of a 19-year old fallow, albeit at a lower density compared to the younger fallows sampled. Metapopulation Dynamics Many populations of plant species are subdivided into local breeding units, a situation which has the potential to lead to the genetic differentiation among these units through differential selection and drift. Theories of population structuring often contrast the trend toward differentiation with the rate of gene flow among sub-populations (Slatkin 1985, Hartl 2000). The exchange of genes in plants takes place through direct migration via seed dispersal or flow of pollen. This movement of genetic material plays an influential role in determining the spatial scale of observed genetic differentiation in populations (Slatkin 1985).

PAGE 21

12 Gene flow in the context of metapopulation dynamics is a useful way to model the effects of seed dispersal, or migration, in the genetic structuring of Bactris gasipaes populations. The term metapopulation was originally coined to describe a population of populations a higher hierarchical level of the population concept (Levins 1970). While populations are defined as assemblages of interacting individuals each with its own finite lifetime, metapopulations are assemblages of interacting populations with distinct finite lifetimes, or expected time to population extinction (Hanski and Glipin 1991). In this manner an assemblage of populations can persist for a much longer period of time than the lifetime of any one individual population. The classical metapopulation concept described by Levins is strictly associated with the dynamics of population turnover, involving both the extinction and recolonization or establishment of new sub-populations. Subsequently, the use of the metapopulation concept has broadened to include any assemblage of populations in which genes are exchanged among discrete sub-populations through migration or dispersal (Hanski 1998). A metapopulation landscape is conceptualized as a network of idealized habitat patches or fragments, surrounded by uniformly unsuitable habitat, in which species are distributed in discrete local populations linked through dispersal among them (Hanski 1998). In this thesis, the concept of a metapopulation landscape will be extended to describe the population structure of the domesticated tree crop peach palm, which is unable to indefinitely survive outside of managed agricultural environments (Clement 1990) and whose sub-populations turnover at irregular intervals. In this case, the subpopulation turnover is caused by the swidden-fallow cycle of rainforest farming, in which areas of fallowed land are intermittently cleared and replanted over and over.

PAGE 22

13 Migration occurs when a new tree crop is planted after clearing the forest fallow and new seeds are brought in from distinct sub-populations. This will inherently involve a degree of artificial selection taking place during population founder events. Artificial Selection within the Metapopulation The role of artificial selection in the process of diverging sub-populations is obvious, as any calculation of changes in gene frequency in a population due to selection will show (e.g. Falconer 1996, pp.30). When population size is > 15-30 individuals, the role of random genetic drift in diverging sub-populations can largely be ignored relative to selection (Hartl 2000). Strong selection regimes are important for the maintenance of genetic variation in a metapopulation when gene flow among sub-populations is irregular and unequal in reciprocal directions (Jain and Bradshaw 1966). Reduced Gene Flow within the Metapopulation The theoretical models of Sewall Wright (1943, 1946) show that strong gene flow between sub-populations relative to selection pressures would homogenize the set of sub-populations, while the complete absence of gene flow would allow the sub-populations to exhibit the deleterious effects of inbreeding. A reduced level of gene flow between partially isolated populations is necessary for the long-term persistence of genetic variability (Wright 1946, Nagylaki 1976, Zhivotovsky and Feldman 1992). Slatkin (1981) simulated the efficiency of selection in a subdivided population with migration between populations and found that the time to fixation through genetic drift always increased with decreasing migration between populations to a minimum. Pollen-Based Gene Flow within the Metapopulation It is generally assumed that for out-crossing species, pollen-based gene flow will have a greater impact on population differentiation or homogenization than will gene

PAGE 23

14 flow by seed dispersal; yet, it is often difficult to distinguish between the effects of each (Levin and Kerster 1974, Ennos 1994). Individual sub-populations within a metapopulation often receive pollen from several neighboring sub-populations, and even if the levels of gene flow are limited from each source, they are additive, so their sum has the potential to have considerable impact on genetic structure (Levin 1981). Pollen dispersal is likely to be taking place to varying degrees even among populations that appear to be completely isolated by distance from one another; this would be particularly true for tree species with taller statures and longer life spans (Hamrick and Godt 1996). According to Hamrick and Nason (2000), pollen flow can often be quite extensive at distances as great as one kilometer for most temperate and tropical species. Gaiotto et al. (2003) found pollination distances of up to 22 km for another Amazonian heart of palm species (Euterpe edulis), when the main pollinator was previously thought to be a bee with a relatively limited flight distance. Since the actual pollination dispersal distance is unknown for Bactris gasipaes, we cannot underestimate the role pollen flow might play in the dynamic nature of peach palm metapopulations. Migration within the Metapopulation Varvio et al. (1986) modeled the effects of migration among sub-populations and found that the values of total population heterozygosity and measures of subpopulation differentiation depend not only on migration rates but also on the subdivision pattern, and on the interaction between the two factors. Li (1976) showed that the effect of an individuals migration between two sub-populations is smaller when the number of sub-populations increases. The larger n is within a subpopulation, the greater the genetic composition of the immigrants diverges from that of nonimmigrant individuals (Varvio et al. 1986). Therefore, smaller sized sub-populations with higher rates of migration lose

PAGE 24

15 differentiation among sub-populations more rapidly. Levin (1988) concluded that a variable migration rate homogenizes neutral allele frequencies less effectively than does a uniform rate of migration with the same mean. Another factor to consider is that if individuals from a given population immigrate into a nearby subpopulation, their gene frequencies would differ less from the target subpopulation than would immigrants originating from farther away. This violates a commonly used model of population structure, the stepping stone model of Kimura (1953) in which only adjacent populations exchange migrants. Kin-structured migration, in which individuals disperse amidst their relatives, will similarly disrupt the assumptions of this model (Levin 1988). Population Turnover within the Metapopulation The recurrent turnover of populations is a chronic disturbance capable of keeping a metapopulation from obtaining the theoretical equilibrium between drift and gene flow (Wright 1931). Slatkin (1977) modeled this effect assuming that for an assemblage of interacting populations, a proportion e of populations go extinct at random each generation and are immediately replaced by an equal number of new populations, each founded by k individuals. The populations then immediately grow to a constant size N, denoted in Wrights Nm. Wade and McCauley (1988) found that the relative number of founders (k) to the number of migrants exchanged among populations (Nm) plays a substantial role in determining the effects of extinction-recolonization cycles. These models also assume that fitness of the colonizing and pre-existent individuals in a population are more or less equal. Of course, a more likely metapopulation structure is one in which the extinction rate depends upon the size of individual sub-populations,

PAGE 25

16 which most certainly are not of a constant, equivalent size, yet this classical model is still a useful starting point from which to assess the associated genetic implications. Pannell and Charlesworth (1999, 2000) state that population turnover in a metapopulation will decrease genetic diversity both within populations and in the total metapopulation measured as a whole. Gilpin (1991) purports that in a metapopulation with both gene flow into existing populations and extinction-recolonization from adjacent populations, genetic variation will be depleted at a rate close to the population half-life of the large local populations in the system. Yet Gilpins calculations do not account for the effects of recolonization from discrete and non-adjacent sub-populations, which is sometimes the case with peach palm. In addition, with peach palm the founders (k) sometimes originate from well outside the metapopulation (another region altogether perhaps). Slatkin (1977) contrasts two modes of colony formation, an important consideration when evaluating the consequences of these repeated colonization bottlenecks. The migrant pool mode is when a colonizing group represents a mix of genotypes drawn from the metapopulation at large. Variation among new populations is derived from the binomial sampling of the genetic variation contained within the entire metapopulation, and is proportional to k. At the other extreme, the propagule pool mode of colony formation, each set of genotypes involved in founding a new population is drawn from just one possible source population (Slatkin 1977). Whitlock and McCauley (1990) illustrated an intermediate mode between migrant and propagule pool. They introduced the term as the probability that two gene copies present in the founding group are drawn from the same source population, such that of zero equals the

PAGE 26

17 migrant pool, of one the propagule pool, and 1>>0 cases that are intermediate between the two extremes (Whitlock and McCauley 1990). With propagule pool colonization, extinction-recolonization increases genetic differentiation and erodes genetic variation (under most conditions) much more intensely than occurs with migrant pool colonization (McCauley 1991, 1993). However, these models will not adequately describe cases in which founding events occur successively in the absence of extinctions (Le Corre and Kremer 1998). In such cases, the cumulative effects of founding events depends as much on the counterbalancing action of gene flow, i.e. the number of migrants (Nm) exchanged among existing populations, as it does on the strength of each founding event, i.e. the number of colonists founding new populations. It is also affected by the relative contributions of populations of different ages constituting both the migrant and colonist pools of individuals, with the cumulative effect having the most impact when colonists arrive only from recently founded populations and migrants originate strictly from populations of similar ages (Le Corre and Kremer 1998). Overlapping Generations and Remnant Trees within the Metapopulation Overlapping generations slow the rate of loss through genetic drift (Hamrick and Nason 1996). The effect of generational overlap is amplified by the longevity of tree species and the maintenance of remnant individuals from previous generations, which reduces the effects of bottlenecking. In addition, the occurrence and the associated implications of inbreeding in a population (i.e. increase in homozygosity) are postponed (Johnson 1977, Choy and Weir 1978). The relevance of this storage effect (Chesson 1985, Seger and Brockman 1987) for the maintenance of genetic variation is that the recessive alleles of heterozygotes are preserved in long-lived individuals, where hidden

PAGE 27

18 variation may reside and flow into more recently founded populations over multiple generations of fluctuating selection (Hairston et al. 1996). Long-lived woody perennial species have a higher proportion of polymorphic loci, more alleles per locus and more genetic diversity than other vegetative life forms. Hamrick et al. (1992) reviewed the studies published over a 20 years period reporting allozyme variation for woody plant species with different life history characteristics. They found that the mean genetic diversity for long-lived woody perennial species is 55% higher than that of short-lived woody species, 42% greater than of herbaceous perennials and 15% higher than of annual species (Hamrick et al. 1992). In addition, long-lived woody perennials have more genetic diversity within their populations as well 38% higher than annuals and 51% to 80% higher than short-lived herbaceous and woody species (Hamrick et al. 1992). These higher rates of genetic diversity within individuals and populations may partially be due to the fact that long-lived out-crossing tree species generally have a higher potential to be receptors for long-range gene flow (Nybom and Bartish 2000), which they then incorporate into the local gene pool of multiple, overlapping generations. Austerlitz et al. (2000) also conclude that the effects of founder events can be substantially reduced when the specific life cycle of tree species is taken into account, even under conditions of limited gene flow. However, they emphasize that this is not due to the overlapping generations of trees as much as to their delayed reproduction, which allows for an increase in the number of founders of the breeding population before reproduction actually begins (Austerlitz et al. 2000). The effective size of a population bottleneck is often estimated using only the genetic diversity contained in the initial

PAGE 28

19 colonists of a given area. These estimates will be biased low because they do not include the cumulative effects of successive founding events in the colonization of new habitat (see Easteal 1985, Baker and Moeed 1987). Microsatellite Molecular Markers Microsatellites are currently the predominant marker system for population genetic analysis (Newbury and Ford-Lloyd 1997, Goldstein and Schtterer 1999). Data acquired from microsatellite markers is much more informative than data obtained from either a RAPD or AFLP analysis. Microsatellite primers are designed to amplify specific targets in the genome through PCR (polymerase chain reaction) by flanking the targeted sequence (Karp et al. 1997). These targets are core repeating sequences of two to nine base pairs which vary in the number of repeats occurring between plants this variation serves as the measurement for genetic diversity by coding for discrete alleles at a given locus (Karp et al. 1997, Karp 2002). Microsatellites are co dominant markers, which is a major advantage over RAPD markers because heterozygous and homozygous genotypes can be distinguished. This allows direct calculation of all genotype and allele frequencies without the assumption of Hardy-Weinberg equilibrium The Mechanics of PCR and Microsatellite Markers Amplification of targeted sequences is carried out through polymerase chain reaction (PCR) technology in a thermocycler. This involves a series of automated temperature changes that unravel the DNA, and then the microsatellite primers are combined with the enzyme Taq polymerase to isolate and amplify the specific sequences we want to analyze for their variability (Sobral and Honeycutt 1994). The PCR product obtained from each DNA sample-primer pair combination is then run through an automated gene sequencer for analysis.

PAGE 29

20 Genetic polymorphisms are visualized in the sequence data as differences in the length of PCR products, representing the subtraction or addition of simple sequence repeat units within each sample. Since microsatellites are multi-allelic and co dominant, each allele yields a distinct allele peak in the data output; genotypes that are heterozygous yield two allele peaks (identified within an expected allele size range), those genotypes that are homozygous yield only one allele peak (Karp et al. 1997, Karp 2002).

PAGE 30

CHAPTER 3 MATERIALS AND METHODS Populations and Sampling Leaf material for DNA extraction was collected from Bactris gasipaes grown in four sub-populations (agricultural communities) from each of two river drainages in the Peruvian Amazon. Both drainages fall within the geographical territory of the Putumayo peach palm landrace (Rodrigues 2001). The Tamshiyacu-Tahuayo Rivers both join the Amazon River near Tamshiyacu, Peru (40 km southeast of Iquitos) (Figure 3-1A, Table A-1). The Yahuasyacu-Ampiyacu Rivers both join the Amazon River at Pebas, Peru (120 km northeast of the city of Iquitos) (Figure 3-1B, Table A-2). Ten farms (farmers) were sampled in each of the two river systems (metapopulations), two or three farms per community or population. Between 24 and 81 palms were sampled from each community 221 palms from the Tamshiyacu-Tahuayo communities and 165 palms from the Yahuasyacu-Ampiyacu communities, for a total of 386 plant samples. An average of 22.1 (between 14 and 30) DNA samples were collected from Tamshiyacu-Tahuayo farms and an average of 16.5 (between 5 and 34) DNA samples from Yahuasyacu-Ampiyacu farms. Communities within each of the two study areas were separated between five and twenty-five km apart. Given that the flight range of the pollinators is believed to be a maximum of only 150 to 200 m (Mora-Urp and Solis 1980, Mora-Urp 1982), the probability of long distance pollen flow occurring between any two communities is very low. 21

PAGE 31

22 Figure 3-1. Relative locations of two study areas, metapopulations (communities) and farms sampled. A) Colonist and B) indigenous metapopulations. C) Eight populations of 5 peach palm landraces sampled from El Dorado collection. Numbers 1-10 on maps A and B indicate location of farms sampled and numbers 171-334 on map C indicate source location for germplasm sampled from El Dorado collection.

PAGE 32

23 The Tamshiyacu-Tahuayo study area is inhabited by people whose ancestors are a mix of both recent immigrants as well as those indigenous to the region, who for the most part do not affiliate themselves with any one particular ethnicity. The Yahuasyacu-Ampiyacu study area lies within the boundaries of an indigenous federation of Huitoto, Bora, Yahua and Ocaina peoples, Federacin de Comunidades Nativas del Ampiyacu (FECONA). Therefore, the Tamshiyacu-Tahuayo communities, farmers and palms will hereafter be referred to as colonist and the Yahuasyacu-Ampiyacu communities, farmers and palms indigenous. These labels, colonist and indigenous, are for the purpose of identification only. This study does not intend to imply that there is anything intrinsically better about the indigenous nature of a particular style of agroforestry management. In fact, both the colonist and indigenous styles of management observed were remarkably similar. In addition to the samples collected from the colonist and indigenous communities, a control comparison of 37 samples was collected from the Bactris gasipaes germplasm reservoir maintained by Instituto Nacional de Investigacin Agraria (INIA) at their El Dorado station located near Iquitos. These individuals were collected during the 1983-84 USAID expeditions from eight populations of five peach palm landraces in Peru, Ecuador and Colombia (Figure 3-1C, Table A-3), and will provide a baseline of a broader genetic sampling against which to compare the results obtained from the two study areas. Informal Farmer Surveys Before collecting DNA tissue of peach palm, each farmer was informally surveyed to determine their seed selection criteria (preferred palm and fruit types) and the average number of maternal parent palms used to establish swidden-fallow agroforestry systems. When collecting DNA tissue with these farmers, the recollected origin of the seed (which

PAGE 33

24 grew into the palms sampled) and the approximate age of all palms (whose tissue was sampled) were recorded. Sampled palms perceived by a farmer to have been planted during a pre-existing cycle were identified, to infer the degree of generational overlap taking place on a given farm. Collection and Extraction of DNA The DNA was collected as 8 cm leaf cuttings from lateral shoots, for ease and efficacy of extraction according to previously documented experience (Clement et al. 1997, Rodrigues 2001). When lateral shoots were not present, juvenile leaf tissue was used. Each sample was placed in a separate paper envelope and zip lock bag with silica gel desiccant in an airtight container, and the samples were then periodically transferred into cold storage (4 to 8oC) at the facilities at INIA, San Roque (Iquitos), during the duration of fieldwork. Upon returning to the Soltis Molecular Systematics Lab on the University of Florida campus, genomic DNA extraction followed a standard CTAB (Cetyltrimethyl ammonium bromide) procedure (Doyle and Doyle 1987) with minor revisions (Appendix B). DNA quantification was carried out by comparison with known concentrations of a DNA standard (-Hind III) in ethidium bromide-stained 2% agarose gels. Microsatellite Marker Genetic Analysis Microsatellite Loci for Bactris gasipaes Ten microsatellite markers have recently been isolated, optimized and characterized for Bactris gasipaes at Universidade Federal do Amazonas in Manaus, Brazil (Rodrigues et al. 2004b) in addition to a different set of 18 markers previously developed at the Biotechnology Research Unit of Centro Internacional de Agricultura Tropical (CIAT) in Bogota, Colombia (Martnez et al. 2002). At first, six of these microsatellite marker loci

PAGE 34

25 were chosen to genotype all individuals sampled. Three of these markers were labeled with blue florescent dye, and three with green, at the five-prime end of the forward primer. This allowed multiplexing of multiple marker loci during sequencing by distinguishing loci and alleles in the data output whose size ranges overlapped one another. In the end, only three of these marker pairs could be used due to inconsistent PCR (polymerase-chain reaction) products for the three additional loci originally chosen (Table 3-1). Table 3-1. Microsatellite primer pairs used for population genetic analysis of peach palm Allele Expected Locus Primer sequence (5'-3') Repeat motif size range product Bg02-19 F: GCGTTCAGACTTGCATACACA (CT)23(CA)6 149-205 bp 182 bp R: CCCACATGCAGGAGTCGTAT Bg02-24 F: AAACCTGATCCGATTGGCTA (GA)17 119-155 bp 135 bp R: CACCACCACCACCTCCAC Bg55 F: TTCTGGGTGCGGTGGTAG (GT)2GC(GT)3GC(GT)5 281-306 bp 278 bp R: ATGATGGACTGAAGAGATGGAATAG Isolation and characterization of Bg02-19 and Bg02-24 described in: Rodrigues D.P., Vinson C., Ciampi A.Y., Farias I.P., Lemes M.R., Astolfi-Filho S. and Clement C.R. 2004. Ten new microsatellite markers for Bactris gasipaes Kunth (Palmae). Mol. Ecol. Notes, in press; Bg55 described in: Martnez A.K., Gaitn-Solis E., Duque M.C., Bernal R. and Tohme J. 2002. Microsatellite loci in Bactris gasipaes (Arecaceae): their isolation and characterization. Mol. Ecol. Notes 2, 408-410. PCR Amplification Separate PCR amplifications were performed for each of the three primer pairs, for each of the 423 DNA samples (a total of 1,269 reactions), in a 25.0 L volume containing (prepared in order listed): 1 M each of forward and reverse primers, 1X PCR Buffer (Promega), 2.5 mM MgCl2, 250 mM dNTPs, 1 unit Taq polymerase (Promega), 2.5 L 1:50 DNA dilution was then added.

PAGE 35

26 PCR amplifications of Bg02-19 and Bg02-24 loci were performed separately for each DNA sample-primer pair combination using a Biometra T3 thermocycler with the following conditions: initial denaturation at 94C for 2 min; 25 cycles of 94C for 10 s, the primer specific annealing temperature (58C for Bg02-19 and 64C for Bg02-24) for 10 s, 72C for 30 s; 10 cycles of 94C for 10 s, 50C for 10 s, 72C for 30 s; ending with 72C for 30 min. PCR amplification of Bg55 locus was performed separately for each DNA sample-primer pair combination on the Biometra T3 with the following conditions: initial denaturation at 94C for 3 min; 35 cycles of 94C for 15 s, the primer specific annealing temperature (50C for Bg55) for 15 s, 72C for 15 s; ending with 72C for 5 min. These conditions were optimized by Rodrigues et al. (2004b) and Martinez et al. (2002) to minimize stutter banding (PCR artifacts that could be misidentified as actual alleles) in the sequence results. DNA Sequencing For each of the three DNA sample-primer pair combinations, 2.0 L of PCR product was added to 25.0 L SLS sequence buffer + 0.5 L 400 base pair size standard. This 3-primer pair multiplex was then visualized on a Beckman-Coulter CEQ 8000 automated capillary sequencer, one lane for each DNA sample. Allele sizes were estimated using the CEQ 8000 version 7.0 software, and then visually inspected taking into consideration the expected allele size in base pairs for each of the three loci and the original DNA clones from which the microsatellite loci were developed. Stutter bands were identified distinct from the actual alleles, to correct any errors made when the software called and sized the alleles.

PAGE 36

27 Statistical Analyses To estimate genetic diversity, the following measures were calculated for all populations using Microsatellite Analyser MSA v. 3.15 (Dieringer and Schltter 2003): expected (He) and observed (Ho) heterozygosity per locus and the number of alleles and allele frequency distribution per locus. These populations were tested for departure from Hardy-Weinberg equilibrium, performed with GENEPOP v. 3.4 (updated from Raymond and Rousset 1995) using the U-test for a hypothesis of heterozygote deficiency; exact P values were determined by a Markov chain method (Guo and Thompson 1992). The extent and significance of the genetic differentiation among populations was also investigated with MSA, which provided unbiased estimates of Wright F-statistics (Weir and Cockerham 1984) at each locus, and averaged over multiple loci. Estimates were obtained for the following parameters: F, the overall inbreeding coefficient or the correlation of allele frequencies within individuals in different populations; f, the within population inbreeding coefficient or the correlation of allele frequencies among individuals within populations; and an estimator of Wrights fixation index Fst, measuring the correlation of allele frequencies between individuals within populations, calculated over all populations and for each pairwise population comparison (Cockerham 1969, Weir and Cockerham 1984). Statistical significance of F, f and was tested by bootstrapping over loci with a 95% confidence interval. To test the significance of pairwise -values, MSA permuted genotypes among groups with Bonferroni corrections (Dieringer and Schltter 2003). Isolation by Distance version 1.52 (Bohonok 2002) was used to test for the presence of an isolation-by-distance relationship using the pairwise -values, as was demonstrated by Rousset (1997). Significance in the isolation-by-distance relationship

PAGE 37

28 was tested using a Mantel test. This test assesses whether the pairwise genetic distance matrix is correlated with the pairwise geographic distance matrix. Reduced Major Axis (RMA) regression techniques were then used to estimate the slope and intercept of the isolation-by-distance relationship. Reduced Major Axis (RMA) regression is more appropriate than Ordinary Least Squares (OLS) regression when the independent variable x is measured with error (Sokal and Rohlf 1981). Error in the independent variable leads to biased estimates of slope. Hellberg (1994) specifically suggested that for analysis of isolation-by-distance, RMA is a more appropriate estimator of slope than OLS. SAS (SAS Institute) was used to characterize multilocus genotypic associations within each population overall and among 2 and 3 loci within each population (Yang 2000, 2002). These genotypic (zygotic) associations were defined on the basis of gametic and allelic frequencies (Yang 2002). Most contemporary studies using microsatellite loci report Rst (), an estimator of genetic differentiation accounting for variance in allele size and defined for genetic markers (like microsatellites) undergoing a stepwise mutation model (Slatkin, 1995). Since there is no way to be certain that mutation in any species follows a strict stepwise mutation model, Rst has limitations to its use (Slatkin 1995, Balloux et al. 2000). In addition, Balloux and Goudet (2002) report that when populations are very weakly structured with high rates of gene flow, Weir and Cockerhams Fst (1984), provides a more accurate estimator than Slatkins Rst (1995). Therefore, this study relied solely on F-statistics for an analysis of population structure.

PAGE 38

CHAPTER 4 RESULTS AND DISCUSSION Farmers Seed Selection, Sourcing and Management of Palms Within the two metapopulation study areas there was a strong tendency among both groups of farmers to limit the number of founding individuals per population. The average number of maternal parent palms reported to have been selected to provide seed for the establishment of the swiddens and fallows sampled was 4.3 (range 1 to 10) palms among the 10 colonist farmers, and 1.5 (range 1 to 2) palms among the 10 indigenous farmers. In addition, 19 % of all palms sampled from both study areas (N= 386 palms) grew in swiddens and fallows established by a given farmer using only one maternal parent palm as a seed source. As a point of comparison, Brown and Marshall (1995) recommend using a minimum of 50 maternal parents to minimize founder effects when establishing a new population. Therefore, the practices of these farmers could potentially lead to founder effects, genetic bottlenecks and drift. The dynamic movement of peach palm seed and the distances over which it had taken place in the recent past appeared to be an important variable between the two metapopulation study areas (Figure 4-1). Within the colonist metapopulation, fifty-one percent of peach palms sampled (113 out of 221 palms) grew from seed selected from a farmers own swidden or fallow, and an additional 20% (44 out of 221 palms) grew from seed selected from an immediate neighbor (within the same community). Fifteen percent of the sampled palms (33 out of 221 palms) grew from seed that had originated from one 29

PAGE 39

30 A51%20%8%15%6% Seed sourced from farmers' own swidden or fallow Seed sourced by farmer, in neighbors' swidden or fallow Direct descendants of palms from pre-existing fallow ofunknown origin Seed sourced by farmer, in swidden/fallow 1-2 hourswalking distance away Direct descendants of the seed sourced 1-2 hours walking distance away B30%24%13%33% Seed sourced from farmers' own swidden or fallow Seed sourced by farmer, in neighbors' swidden or fallow Seed which originated from 120 km and 600 km away Direct descendants of seed brought during tribes' (1937)migration from Colombia (250 km away) Figure 4-1. Seed sourcing for peach palms sampled from the colonist and indigenous metapopulations. A) 221 colonist palms. B) 165 indigenous palms. All palm seed for a given planting event was reportedly obtained from only one single source location at a time. to two hours walking distance away, and an additional 6% (13 out of 221 palms) were direct descendants (progeny) of that 15% (Figure 4-1A). In sharp contrast, within the indigenous metapopulation the scale of the movement of genetic material was much larger; thirteen percent of the palms sampled (21 out of 165 palms) grew from seed that had originated from 120 to 600 km away (Figure 4-1B). Of these 21 palms, two were spineless whose seed had originated in Iquitos, 120 km upriver. An additional 19 palms were sampled which were found growing in the context of a

PAGE 40

31 Peruvian governmental program (Fondo Nacional de Compensacin y Desarrollo Social) to promote spineless heart of palm cultivation in the area using peach palm seed originating from the Yurimaguas region, almost 600 km upriver from the communities. In addition, within the indigenous metapopulation 33% of the palms sampled (55 out of 165 palms) were said to be descendants of seed originating from the homeland of the grandparents and parents of the farmers, 250 km to the north in the Putumayo region of Colombia (Figure 4-1B). These people fled in 1937 with their families (along with seeds and cuttings of their traditional crops) to their present location in Peru to escape the lingering slave trade that had decimated the regions tribes at that time. The average age of these 55 palms sampled was 33.3 (range 3 to 50+) years. A comparison of the average age of all palms sampled from the two metapopulation study areas exhibits a divergence in their age distribution (Table 4-1). Twenty-eight percent of all palms sampled (47 out of 165 palms) from indigenous farms were attributed to planting events 30 to 50 years earlier, compared to only 1% of all palms sampled (3 out of 221 palms) from previous (unknown) planting events observed and sampled on colonist farms. Most of the colonist farmers claimed that the production of peach palm fruit deteriorates in fallow over time (as discussed in Clement 1990), so they made little effort to maintain (protect) older remnant palms from previous Table 4-1. Average age of peach palms sampled from colonist and indigenous metapopulations Ten colonist farms Ten indigenous farms Number of palms sampled 221 palms 165 palms Average age of all palms sampled 6.0 years (range <1-17 years) 19.2 years (range <1-50+ years)

PAGE 41

32 generations once the palms had been overcome by forest re-growth. These farmers preferred to simply plant a new generation of palms, if possible. Thus, palms managed by the colonist farmers rarely survived through the fallow period until the next swidden clearing cycle. While this may have been a factor somewhat enthusiastically over-exaggerated by the indigenous farmers surveyed, a strong divisional trend in management practices is apparent over all twenty farms sampled. Molecular Marker Results Genetic Diversity and Hardy-Weinberg Equilibrium The three microsatellite marker loci carried 49 alleles in the indigenous metapopulation (n = 165), while only 43 alleles were found in the colonist metapopulation (n = 221). The frequency of observed heterozygosity averaged over loci was somewhat higher in the indigenous metapopulation as well (Table 4-2). Expected heterozygosities throughout both metapopulations were generally higher than observed heterozygosities at individual loci, with one minor exception where a landrace population consisted of only two individuals (Table 4-2). Of the 19 tests of conformity to Hardy-Weinberg proportions, 12 groups of populations showed a significant deficiency of heterozygotes at the 0.01% level, and 3 groups were deficient at the 1% and 5% levels (Table 4-2). This is also apparent in the values obtained for the inbreeding coefficient f, an estimator measuring the effects of nonrandom mating within populations on a scale of -1, indicating an excess of heterozygotes, to 1, indicating an excess of homozygotes, relative to proportions expected in a Hardy-Weinberg equilibrium population. Within the two metapopulation study areas, observed heterozygosities in the colonist communities ranged from 0.639 to 0.698, while those of the indigenous

PAGE 42

33 Table 4-2. Microsatellite diversity and heterozygote deficiency in colonist and indigenous peach palm metapopulations; landraces sampled from El Dorado collection included for comparison. # of # of alleles per locus Heterozygosity N pops. Bg02-19 Bg02-24 Bg55 Expected Observed f Colonist Metapopulation: Communities 221 4 21 14 8 0.833 0.678 0.194*** Community: Nuevo Tarapaca 42 3 17 7 7 0.823 0.698 0.156*** San Carlos 81 3 15 13 8 0.806 0.639 0.210*** Nuevo Triunfo 60 2 15 11 8 0.824 0.684 0.171*** Nuevo San Juan 38 2 13 11 7 0.847 0.697 0.191*** Indigenous Metapopulation: Communities 165 4 22 16 11 0.806 0.693 0.152*** Community: Brillo Nuevo 55 3 15 13 5 0.758 0.664 0.121** Puerto Isango 24 2 13 9 6 0.826 0.741 0.107* Pucaurquillo 58 3 21 14 10 0.802 0.625 0.207*** Sa. Lucia de Pro 28 2 14 12 7 0.792 0.708 0.105** El Dorado Collection: Landraces 37 5 17 14 7 0.766 0.713 0.155*** Landrace: Putumayo 7 1 9 7 6 0.869 0.746 n.a. Pampa Hermosa 7 2 7 7 5 0.848 0.833 0.024 Pastaza 6 2 7 6 3 0.793 0.667 0.09 Tigre 15 2 11 8 6 0.809 0.619 0.248*** Vaups 2 1 2 2 3 0.5 0.667 n.a. Each metapopulation analyzed among communities and farms (populations) pooled within communities; sampling from El Dorado germplasm collection analyzed among geographical landraces and populations of origin pooled within landraces. Expected (He) and observed (Ho) heterozygosities averaged over all three loci. The unbiased measure of inbreeding f (Weir and Cockerham 1984) considers the effects of nonrandom mating within populations (averaged over loci). Significant heterozygote deficiency over all loci, relative to Hardy-Weinberg expectations at: *P<0.05, **P<0.01, ***P<0.0001.

PAGE 43

34 communities ranged from 0.625 to 0.741 (Table 4-2). As a point of comparison, the 37 individuals of 5 different landraces sampled from the El Dorado germplasm collection revealed similar numbers of alleles per locus, and a larger observed heterozygosity (0.713) than was estimated for either of the two metapopulation study areas (Table 4-2). Private alleles in the context of this study are alleles found only in one of the two study metapopulations; all of the other alleles totaled in Table 4-2 were shared between them. There were more than twice as many private alleles, occurring at a higher average weighted frequency in the indigenous metapopulation than in the colonist. However, in general these private alleles were rare in both metapopulations, all occurring at frequencies of 0.028 or less (Table 4-3). Testing for a genotypic association among all three loci within the two metapopulations and the El Dorado populations found no significant association using chi-square (P values 0.12 and higher). However, within the colonist metapopulation there was a significant association (at the 0.01% level) between loci Bg02-19 and Bg02-24. Genetic Differentiation In an analysis of the genotypes observed at marker loci, genetic differentiation estimated among colonist farms was low (Fst = 0.03) yet significantly different from zero (P<0.0001) (Table 4-4). The genetic differentiation estimated among indigenous farms was even lower (Fst = 0.017), yet still significant (P<0.001). Genetic differentiation among the eight El Dorado populations of five landraces (Vaups, Pampa Hermosa, Pastaza, Putumayo and Tigre) appeared greater (Fst = 0.05), revealing more moderate levels of significant (P<0.01) population differentiation consistent with the relatively larger geographical scale of this particular sampling (Table 4-4). Analyzing the farms in

PAGE 44

Table 4-3. Weighted allele frequencies at individual loci for colonist and indigenous metapopulation study areas. Private alleles, alleles unique to one or the other metapopulation study areas, are shown in bold. 35 Colonist Metapopulation: N = 221 Indigenous Metapopulation: N = 165 Bg02-19 Freq. Bg02-24 Freq. Bg55 Freq. Bg02-19 Freq. Bg02-24 Freq. Bg55 Freq. 152 0.002 128 0.002 282 0.061 152 0.028 114 0.003 282 0.006 154 0.236 130 0.009 286 0.207 154 0.15 130 0.012 284 0.019 156 0.037 132 0.064 288 0.293 156 0.034 132 0.037 286 0.18 158 0.002 134 0.025 290 0.039 160 0.003 134 0.019 288 0.559 162 0.062 136 0.169 296 0.011 162 0.097 136 0.118 290 0.009 164 0.122 138 0.139 300 0.098 164 0.038 138 0.199 294 0.003 166 0.002 140 0.112 302 0.075 166 0.019 140 0.115 296 0.006 168 0.005 142 0.059 304 0.216 170 0.006 142 0.115 298 0.003 170 0.03 144 0.071 172 0.103 144 0.118 300 0.087 172 0.073 146 0.014 174 0.006 146 0.019 302 0.028 174 0.011 148 0.002 176 0.019 148 0.009 304 0.099 176 0.034 150 0.041 178 0.053 150 0.025 178 0.14 152 0.014 180 0.028 152 0.006 182 0.007 158 0.279 182 0.034 154 0.009 184 0.014 184 0.094 156 0.012 186 0.039 186 0.088 158 0.183 188 0.057 188 0.022 190 0.05 190 0.122 192 0.048 192 0.047 194 0.025 198 0.003 198 0.002 200 0.003 204 0.003 Two private alleles, allele 200 at Bg02-19 (indigenous) and allele 128 at Bg02-24 (colonist), were also found in the El Dorado populations at low weighted frequencies (0.014 and 0.029 respectively).

PAGE 45

36 the two metapopulation study areas as two discrete panmictic populations, the genetic differentiation between them was estimated as Fst = 0.027, which is low but still significant (P<0.0001) for these two groups of farms located approximately 160 km apart. Isolation-by-Distance Pairwise estimates of Fst (Weir and Cockerham 1984) were plotted against the geographical distance between populations, performed separately for each of the two metapopulation study areas. Genetic material was assumed to travel linearly along the trails and rivers to obtain estimates of geographical distance. The absence of a statistically significant isolation-by-distance relationship up to 27 km distance in the indigenous metapopulation further stresses low population genetic differentiation (Figure 4-2A). Accordingly, the values of pairwise estimators were low for the indigenous populations, and only 4% of these were significant (P<0.05) (Table C-2). In contrast, the colonist farms exhibited a significant (P<0.01) isolation-by-distance relationship up to 35 km distance (Figure 4-2A). The pairwise values obtained for the colonist populations were generally higher than those obtained for the indigenous populations, and a higher percentage of these values (29%) were significant at the 1% and 5% levels (Table C-1). The values of pairwise population genetic differentiation among the 8 El Dorado populations of 5 landraces were higher than those of either of the two metapopulations. These populations illustrated a significant (P<0.01) isolation-by-distance relationship up to 1250 km, calculated as the shortest linear distances along rivers, which in a few cases included trails connecting watersheds (Figure 4-2B). However, none of these pairwise Fst values were significant (P<0.01) when testing for population differentiation, probably due to the small population sizes analyzed (Table C-3).

PAGE 46

Table 4-4. Unbiased estimates of Wright F-statistics for colonist/indigenous metapopulations; landrace populations sampled from El Dorado collection included for comparison. F-statistics at individual loci F-statistics # of Bg02-19 Bg02-24 Bg55 over all loci N pops. F f F f F f F f Colonist farms 221 10 0.202 0.181 0.026 0.127 0.088 0.042 0.308 0.292 0.023 0.211 0.186 0.03*** Colonist communities 221 4 0.204 0.189 0.019 0.129 0.108 0.023 0.312 0.291 0.03 0.213 0.194 0.024*** Indigenous farms 165 10 0.151 0.129 0.024 0.19 0.181 0.01 0.136 0.121 0.016 0.161 0.146 0.017** Indigenous communities 165 4 0.152 0.14 0.014 0.191 0.184 0.009 0.138 0.125 0.014 0.162 0.152 0.012** El Dorado populations 37 8 0.283 0.266 0.024 0.05 -0.02 0.066 0.243 0.195 0.059 0.192 0.15 0.05* El Dorado landraces 37 5 0.284 0.272 0.017 0.061 -0.02 0.08 0.247 0.206 0.052 0.197 0.155 0.05* Colonist vs. Indigenous 386 2 0.195 0.178 0.02 0.159 0.151 0.009 0.286 0.244 0.056 0.21 0.188 0.027*** Colonist vs. Indigenous 423 3 0.203 0.187 0.019 0.149 0.146 0.009 0.279 0.243 0.049 0.208 0.188 0.025*** vs. El Dorado Colonist and Indigenous 423 2 0.204 0.195 0.02 0.149 0.146 0.003 0.275 0.262 0.017 0.207 0.198 0.011* vs. El Dorado 37 Weir and Cockerhams (1984) unbiased estimates of Wright F-statistics defined as follows: F = total heterozygote deficiency (overall inbreeding coefficient), f = deficiency within individuals within populations (inbreeding coefficient) and = deficiency among populations (an estimate of fixation index or Wrights Fst). Each metapopulation analyzed among farms and among farms pooled within communities; El Dorado germplasm analyzed among populations of origin and among populations pooled within geographical landraces. Estimates of F-statistics also calculated between groups of populations (colonist, indigenous, El Dorado). Significant population differentiation at: *P<0.01, **P<0.001, ***P<0.0001.

PAGE 47

38 AGeographic Distance (km)4035302520151050Pairwise Population Differentiation.08.06.04.020.00-.02 Indigenous....................ColonistBGeographic Distance (km)1400120010008006004002000Pairwise Population Differentiation.4.3.2.10.0-.1 Figure 4-2. Testing for an isolation-by-distance relationship among farms within each of the two metapopulations and among populations analyzed from the El Dorado collection. A) Correlation between unbiased estimates of pairwise population genetic differentiation [Fst () over all loci] and geographic distance, R2 = 0.1948 and Mantel test of correlation, P<0.0029 for colonist populations; R2 = 0.0301 and P<0.0896 for indigenous populations. B) Correlation, R2 = 0.3346 and Mantel test, P<0.009 for El Dorado populations.

PAGE 48

39 Discussion The high inbreeding coefficients (f) calculated for both metapopulations (Table 4-2) are the result of recurrent sib-mating occurring over many generations, as inbreeding coefficients measure the probability that two alleles are identical by descent (Hartl 2000). Clement et al. (1997) and Clement (1995) both reported similar levels of inbreeding in populations of Bactris gasipaes. This kind of selection is the very essence of crop domestication, necessary to amplify the specific traits one prefers in a given species (Doebley 1989), yet ideally there should be a balancing factor in the agroecosystem to allow for a continuation of the crops evolution. This balance appears to be facilitated in part by the migration of genetic material with and among metapopulations. Seed Migration within a Metapopulation The migration of seed has the potential to introduce new alleles into a population, thereby increasing its genetic diversity and slowing the rate of divergence within the metapopulation. Additional migration across time via the descendants of introduced seed is taking place among 6% (13 palms) and 33% (55 palms) of the total palms sampled from the colonist and indigenous study areas respectively (Figure 4-1). These palms might still carry alleles introduced into the population by their immigrant ancestors, and could contribute to their continued maintenance. Yet the impact that the immigration of genetic material has on a metapopulation will primarily depend upon the scale of distance from which it originated, as a comparison of isolation-by-distance relationships in Figures 4-2A and 4-2B reveals. Migration within a peach palm metapopulation occurs among a group of populations in both the immediate (neighbors swidden) and close vicinity (1 to 2 hours away), as well when seed is brought in from another distant metapopulation (120 to 600

PAGE 49

40 km away) (Figure 4-1). In other words, the boundaries of seemingly localized metapopulations are in fact permeable, open to immigration from outside. At a greater scale, the swiddens and fallows comprising entire regions of Peru, Ecuador and Colombia would theoretically form one massive peach palm metapopulation, connected by the historic flow of seed over large distances. Rodrigues et al. (2004a) use the genetic relationships among landraces to discuss the possible migration of peach palm seeds throughout South America and up through Honduras out of a single source area of domestication, previously proposed for southwestern Amazonia (Huber 1904, Ferreira 1999). As illustrated in this study and elsewhere, a certain degree of seed migration continues even today at a similarly extensive scale, particularly concerning genetic material of the spineless Pampa Hermosa landrace from the Yurimaguas region of Peru (Figure 4-1B) (Adin et al. 2004). Although the seed for planting a new swidden generation was always obtained from just one source population (Figure 4-1), and sometimes comprised groups of half-sib individuals originating from only one maternal parent, each farm sampled within a given community is assumed to be an interacting unit of a metapopulation (i.e. colonist community) within a larger group of metapopulations (i.e. colonist metapopulation study area). This is due to the relative proximity of neighboring farms (between 250 and 500 m apart; see Figure 3-1), which are potentially interchanging genetic material via long-distant pollen-mediated flow within the community metapopulation. And as previously discussed, farmers are also directly exchanging genetic material among neighbors, and presumably between communities. Therefore a given source of seed is a mix of

PAGE 50

41 genotypes drawn from the metapopulation at large, and the migration of seed resembles the migrant pool mode of gene immigration (Slatkin 1977). Population Structuring and Genetic Differentiation One direct consequence of migration within a metapopulation, particularly via the migrant pool mode, is that population genetic differentiation is substantially reduced. A comparison of the overall Fst estimates for colonist and indigenous farms (Table 4-4) has little meaning, however these estimates are both consistent with high rates of gene flow among populations, i.e. exchange of genetic material among farmers along the course of the two river systems over a long period of time. Indeed, in Figure 4-1 there appears to be comparably high rates of exchange among neighboring farmers in both of the two study areas. Adin et al. (2004) came to similar conclusions regarding Gst estimates obtained for two riverine groups of peach palm populations from the Yurimaguas region of Peru, which were similarly low (Gst is an equivalent estimator of the parameter Fst which considers the ratio of inter-population genetic variation to the total variation). Pairwise population differentiation was higher in the colonist metapopulation than in the indigenous (Table C-1 and C-2), and there exists a statistically significant isolation-by-distance relationship among them (Figure 4-2A) thus there is some indication that the structure of the colonist metapopulation is more defined than the indigenous. The high incidence of seed migration into the indigenous metapopulation (Figure 4-1B) might be causing this discrepancy, as genetic divergence among sub-populations would be reduced if immigrant seeds were a pool of genotypes from the larger (regional) metapopulation structure. The overall Fst estimate obtained among the eight El Dorado populations of five landraces (Fst = 0.05, P<0.01; Table 4-4) was somewhat lower than the among population

PAGE 51

42 differentiation estimated for regional-scale samplings of other allogamous plant species in the tropics (typically between 0.10 and 0.15; Bawa 1992, Hamrick et al. 1992). However, it was still substantially higher than the population differentiation estimated for the two metapopulation study areas. Therefore, as distances increased between populations the gene flow among them was less. For instance, Rodrigues et al. (2004a) analyzed 220 peach palms from a much larger geographical selection of six landraces, representing close to the entire range of the species (from Central America through Peru to the mouth of the Amazon in Brazil), and estimated genetic differentiation among populations as Gst = 0.16. It is interesting to note that the lowest Fst estimate overall was obtained in a grouping analysis between the two metapopulation study areas (Group 1) and the El Dorado populations (Group 2) (Fst = 0.011, P<0.01) (Table 4-4). The low genetic differentiation between the study areas when considered as two discrete panmictic populations is relevant here as well (Fst = 0.027, P<0.001). Mora-Urp and Clement (1988) proposed that populations near Iquitos and Pebas might represent heterogeneous mixtures of Putumayo, Pampa Hermosa, Pastaza and Tigre landraces, among others. This is because the region is at the crossroads of several major river systems, which would have facilitated the exchange of different landraces over long periods of time; the results presented here would seem to support their hypothesis. Maintenance of Remnant Trees on the Indigenous Farms As competition for light and nutrients increases, older palms in fallow do not produce the fruit yields of younger palms in swidden clearings (Clement 1990). Yet in northwest Amazonian indigenous cultures, remnant peach palms provide a sense of generational continuity and play an important role in revisiting memories of the people

PAGE 52

43 (often direct ancestors) who planted them. This symbolic association with peach palm has been reported by anthropologists (e.g. Chaumeil 2001, Erickson 2001 and Rival 2002) as being broadly shared by at least five specific tribes of the northwest Amazon. One of these ethnographies (Chaumeil 2001) took place in the same indigenous communities sampled for this population genetic analysis of peach palm. It is more a matter of custom with the indigenous than with the colonist farmers surveyed, regardless of the utilitarian value of the remnant palms. Yet this is not to generalize that only indigenous Amazonians would find the preservation of remnant palms worthwhile; if other groups of indigenous and non-indigenous farmers were sampled perhaps the results would have been different. The maintenance of remnant palms from previous generations of swiddens may be helping to preserve genetic diversity within the indigenous metapopulation, by reducing founder effects and loss of alleles. Since changes in the genetic composition of a population require a generational turnover, maintaining remnant palms from previous swidden generations would potentially lessen the negative consequences of founder effects. In addition, these remnant palms are quite possibly an important cohesive factor in metapopulations; for instance, Chase et al. (1996) found that isolated trees could act as stepping stones, facilitating gene flow among larger populations. Intermittently throughout the secondary forest and fallows sampled, peach palms from previous swidden generations extended up through the canopy ( 2 to 3 palms per hectare) in search of light in the midst of encroaching vegetation. The indigenous farmers of the particular area under investigation have been reported to clear and reuse the same plot of land after fallowing periods lasting 20 years

PAGE 53

44 (Denevan and Treacy 1987). Given the current shortage of land available to each family, these farmers are very rarely able to wait any longer for fallowed land to replenish itself (Manuel Nibeco, October 2003, personal communication). This period of time is short enough to prevent the complete extinction of peach palms planted during previously cultivated swiddens (Clement 1990), especially considering that during the first five years these swidden-fallows are managed by the farmers for the long term growth of the fruit trees in the weeding out of competing secondary vegetation (Denevan and Treacy 1987). Some of the farmers claimed that they clear the vegetation around their palms when harvesting fruit; more or less every year throughout the entire fallowing period. In addition, management of the common Amazonian agroforestry intercrop manioc (Manihot esculenta) and peach palm differed in a slight yet significant manner between the indigenous and colonist farmers. Indigenous farmers in the northwest Amazon are known to predominately cultivate highly toxic manioc varieties (McKey and Beckerman 1993), and the farmers indicated they were used to produce their traditional bread. They also claimed that these varieties mature relatively slowly, preserving well in the soil for 5 years or more. On the other hand, the colonist farmers all grew a non-cyanogenous variety of manioc (to be eaten boiled, unprocessed), which produces yields in less than three years. The soil would then be exhausted for root crop cultivation and management of the entire swidden would taper off into fallow. Thus the choice of manioc varieties determines the amount of years a swidden will be regularly cleared of undesirable secondary vegetation, which relates to the amount of time peach palm will accumulate biomass in an open environment the extra years conferring an advantage for the palms once the fallow period begins.

PAGE 54

45 The older palms that persist in indigenous fallows are spared during subsequent forest clearings and survive the burning of slash to sprout up from their bases (a trait characteristic of Bactris gasipaes); fueled by the nutrient flush they soon are producing fruit again. Thus the supportive effect of generational overlap on the maintenance of genetic variability and structure within peach palm populations is facilitated by the longevity of highly managed palms. Comparing Genetic Diversity and Heterozygosity Estimates Considering the historical-ecological context of the two study locations, observed heterozygosity and levels of genetic variability (Tables 4-2 and 4-3) provide a broad evaluation of the effects of migration and the preservation of remnant individuals in maintaining diversity in peach palm. It is important to note that the 165 indigenous palms represent a sample size that is 25% less than that of the 221 colonist palms, yet there were still more alleles per locus observed in the indigenous metapopulation (Table 4-2). The additional private alleles in Table 4-3 might have been obtained (introduced) through the increased rates of seed immigration from afar (Figure 4-1), although extensive sampling in source areas would be needed in order to prove this. Yet alleles are extremely sensitive to population bottlenecks; therefore, the preservation of remnant individuals might be playing a role in maintaining these private alleles, albeit at extremely low frequencies. Evidence (or the lack thereof) of genotypic disequilibrium is important in making inferences about the history of a population and the evolutionary forces governing allele frequencies at these loci. In this case, a lack of strong evidence for genotypic associations within the peach palm populations sampled corresponds with the fact that migration among peach palm populations is occurring among gene pools that are

PAGE 55

46 somewhat closely related, as we would expect strong zygotic associations if this were not the case (Barton and Gale 1993). General Discussion The allelic components of peach palms diversity, such as those sampled from the farms surveyed for this study, fluctuate over time. Through the migration of genetic material, farmers seem to be managing general levels of diversity within a metapopulational matrix, more than they are managing individual genes in isolation (Louette 2000). This study offers insight into developing strategies to preserve the evolutionary processes that actively create and maintain general levels of genetic diversity on-farm. If participatory domestication projects are able to preserve the actual genes underlying the more useful phenotypes (like the ongoing program with peach palm in Peru; see Weber et al. 2001), then it is important that there is a degree of movement of this improved genetic material within and between regions to maintain general levels of useful diversity. The problem then lies in preventing the frequency of these targeted genes from becoming excessively diluted on-farm and within the metapopulation over the long run. It is difficult to generalize about farmer behavior and assume that this kind of genetic migration (crucial to the metapopulations dynamics) is taking place often enough, throughout the entire geographical distribution of peach palm, to prevent a degree of genetic erosion in the species as a whole. In Peru, the flow of peach palm seed is highly decentralized and sporadic, oftentimes dependent solely upon individual farmers perceptions about the use and value of specific palm types. And since both the number of populations and their sizes are never held perfectly constant, the effects of migration within and among metapopulations are likely to be highly variable and site

PAGE 56

47 specific. Therefore, formal institutionalized support is needed to develop a network capable of guiding an appropriate degree of exchange of genetic material. It is believed that in developing markets for improved peach palm seed, this exchange will be facilitated (Clement et al. 2004a). Yet it would be helpful to monitor changes in measures of genetic diversity in recipient populations over time, to gauge an appropriate scale for this migration to take place on a case-by-case basis. Finally, it is important to keep in mind when reviewing any study of tropical crop genetic resources, whose centers of diversity are often located in lesser-developed regions of the world, that they are often managed in the context of immediate subsistence irrespective of long-term genetic consequences. Subsistence farmers tend to do what they need to feed their families in the short run. In the context of genetic resources this often translates into making a conscious decision to use limited time and resources to cultivate only the most productive and appealing varieties of a given crop at the expense of all others, thereby eroding the underlying genetic diversity. While it is true that even in the darkest reaches of Amazonian backwaters one might find an occasional crop connoisseur growing a wide variety of types, he or she will always be the exception. Conclusion Based on the molecular results presented, and the contrasting management of palm germplasm observed between the two groups of farmers, what conclusions can realistically be made? The palm populations sampled have a long evolutionary history, which is not addressed when asking farmers about recent management of the genetic resource. Nonetheless, the amount of neutral genetic variation and heterozygosity observed in both the indigenous and colonist metapopulations was high.

PAGE 57

48 These relatively high levels of diversity were not expected, considering the seed selection practices of the farmers and the high inbreeding within both metapopulations. Although these particular microsatellite loci are only representative of neutral genetic variation, founder effects and selection in the 10,000 year process of peach palm domestication are expected to have reduced overall allelic diversity. Yet these neutral marker loci are extremely sensitive to gene flow (migration). These results suggest long-distance seed migration events in the relatively recent past have attributed to the genetic variability and heterozygosity observed at present in the indigenous populations. Since migration is taking place on a reduced scale in the colonist metapopulation, the same is true to a lesser extent. In turn, the extremely low genetic differentiation observed within and between the two metapopulations suggests that seed exchange (migration) has been extensive throughout the region over long periods of time. It cannot be ruled out that an unforeseen potential of the species for pollination among populations might have played a role here as well, over larger than expected distances by nonspecialist insect vectors. In addition, the preservation of remnant palms has the potential to maintain alleles introduced into the indigenous metapopulation for longer periods of time than would be possible otherwise. Barring any sudden change in traditional agroforestry management strategies, this factor should continue to play a role in the composition of the indigenous metapopulations genetic diversity, yet the frequency and extent of future genetic migration within and among regions will remain crucial. Epilogue: Participatory Domestication of Peach Palm in Peru ICRAF (International Centre for Research in Agroforestry) and INIA (Instituto Nacional de Investigacin Agraria) initiated a participatory domestication project for Bactris gasipaes in Peru in 1997. Farmers in the Yurimaguas region wanted to conserve

PAGE 58

49 the phenotypic diversity of their palms, and produce seeds for sale to other regions and countries where there was a demand for their spineless type to establish heart-of-palm plantations. This region is known to possess the most economically valuable landrace of the species, Pampa Hermosa, with a high frequency of spineless trunks and leaves, and rapid growth for heart-of-palm production (Mora Urp and Echeverra 1999). There is high phenotypic variability and relatively high genotypic variability in this particular landrace (Rodrigues 2001), so it would benefit the farmers if this project produced seed with relatively uniform trait characters. This is always the trade off with the domestication of crops, and lesser-known crops in particular; those genetic resources which fall outside of the domesticated type perceived as the most economically promising will always erode. Researchers asked 142 farmers from 16 different communities to select their best spineless palms based on preferred fruit characteristics, expecting to create dual-purpose populations (fruit for food security; heart-of-palm seeds for export). They then collected at least 300 seed from each of these palms to establish on-farm progeny trials in the Yurimaguas and Pucallpa regions (Weber et al. 2001). Each trial replication consisted of two progeny plants of the 400 selected mother palms. The trials were rogued after 5 years, leaving the best plant from each progeny for the production of selected seed. To maintain as much variability as possible at every step in the domestication process, no selection among progenies took place. The heritability of fruit traits in peach palm is unknown at present and those for heart-of-palm growth and yield are low (Clement 1995). Nonetheless, genetic gain under this scenario of selection might be improved if the trials were rogued among progenies as

PAGE 59

50 well, rather than only within. Especially since the principal objective of both the farmers and the researchers was to collect and conserve valuable phenotypes, and they did not presume their project would conserve the underlying molecular diversity. They focused instead on collecting palms that the farmers themselves identified as useful to them, rather than collecting a wide range of randomly selected palms or palms identified through molecular analysis as rare and valuable for genetic preservation. The farmers are the owners of their replications, and they received periodic stipends to finance the maintenance and fertilization of the trials. They certainly expect INIA to help them export seed to Brazil and other Latin American heart-of-palm producers, but it is not yet clear that INIA is organized for this task.

PAGE 60

APPENDIX A EXACT ORIGINS OF POPULATIONS ANALYZED Table A-1. Exact origins of the 221 colonist (Tamshiyacu-Tahuayo) samples # of palm samples Farm Community Lat. Long. 14 Farm 1 Nuevo Tarapaca 04 05' S 73 06' W 14 Farm 2 Nuevo Tarapaca 04 05' S 73 06' W 14 Farm 3 Nuevo Tarapaca 04 05' S 73 06' W 28 Farm 4 San Carlos 04 13' S 73 11' W 27 Farm 5 San Carlos 04 13' S 73 11' W 26 Farm 6 San Carlos 04 13' S 73 11' W 30 Farm 7 Nuevo Triunfo 04 08' S 73 09' W 30 Farm 8 Nuevo Triunfo 04 08' S 73 09' W 22 Farm 9 Nuevo San Juan 04 05' S 73 04' W 16 Farm 10 Nuevo San Juan 04 05' S 73 04' W Table A-2. Exact origins of the 165 indigenous (Yahuasyacu-Ampiyacu) samples # of palm samples Farm Community Lat. Long. 14 Farm 1 Brillo Nuevo 03 15' S 71 55' W 16 Farm 2 Brillo Nuevo 03 15' S 71 55' W 25 Farm 3 Brillo Nuevo 03 15' S 71 55' W 11 Farm 4 Puerto Isango 03 20' S 71 55' W 13 Farm 5 Puerto Isango 03 20' S 71 55' W 5 Farm 6 Pucaurquillo 03 24' S 71 50' W 19 Farm 7 Pucaurquillo 03 24' S 71 50' W 34 Farm 8 Pucaurquillo 03 24' S 71 50' W 13 Farm 9 Santa Lucia de Pro 03 24' S 71 48' W 15 Farm 10 Santa Lucia de Pro 03 24' S 71 48' W 51

PAGE 61

52 Table A-3. Exact origins of the 8 populations from 5 landraces sampled from El Dorado collection Collection # Landrace Pop. Location collected Lat. Long. 171-177 Putumayo 1 Mazn-Ro Napo 03 43 S 73 04 W 180-182, 185 Pampa Hermosa 2 Barranquita-Ro Huallaga 06 15 S 75 45 W 223, 228, 235 Pampa Hermosa 3 Lagunas-Ro Huallaga 05 45 S 76 05 W 194 Pastaza 4 Lago Agrio-Ro Napo 00 05 N 76 50 W 199 Pastaza 4 Chuchufindi-Ro Napo 00 05 S 76 02 W 244, 246-248 Pastaza 5 Ro Napo 00 50 S 77 15 W 201, 203-204, 206-210 Tigre 6 Intuto-Ro Tigre 04 00 S 74 25 W 213, 215-216, 219-222 Tigre 7 Quebrada Intuto 04 00 S 74 45 W 333 Vaupes 8 Ro Papuri 00 40 N 70 10 W 334 Vaupes 8 Ro Papuri 00 40 N 70 15 W Collection #s 194 and 199 were combined to form population 4 and #s 333 and 334 were combined to form population 8 in order to include these individuals in F-statistic estimates.

PAGE 62

APPENDIX B DNA EXTRACTION PROTOCOL Extraction Protocol Adapted from Doyle and Doyle (1987) 1. CTAB buffer prepared daily a. Polyvinylpyrrolidone (PVP) added to b-mercaptoethanol (b-merc) in CTAB solution and stirred to dissolve right before starting extractions. Used 0.5 ml CTAB + 0.02 g PVP + 2.5 l b-merc per plant sample. 2. 15 mg of silica-dried plant tissue weighed out 3. Tissue ground with mortar and pestles a. Pestles were stored in 10% bleach solution and rinsed well with DI purified water before they were used on a new plant sample b. Grinding was done with a pinch of autoclaved sand 4. 500 L of CTAB buffer added to ground tissue sample in separate eppendorf tubes 5. Sample tubes incubated at 55 C for 1 h 6. 500 L of 24:1 chloroform:iso-amyl alcohol added to sample tubes which were then vortexed (mixed) 7. Tubes centrifuged for 10 minutes at maximum speed (13000 rpm). a. Following centrifugation, there were three layers; top: aqueous phase, middle: debris and proteins, bottom: chloroform 8. Pipetted off the aqueous phase taking care not to suck up any of the middle or chloroform phases. Pipetting slowly helped with this 9. Placed each of the aqueous phases into new labeled eppendorf tubes 10. Estimated the volume of the aqueous phases 11. Added 0.08 volumes of cold 7.5 M ammonium acetate into the new tubes 12. Added 0.54 volumes (using the combined volume of aqueous phase and added AmAc) of cold isopropanol (= 2-propanol) into the new tubes 13. Mixed (vortexed) tubes well 53

PAGE 63

54 14. Placed tubes in freezer for 15 min 15. Centrifuged tubes for 3 min at maximum speed 16. Poured off the liquid in each tube, being careful not to lose the DNA pellets 17. Added 700 L of cold 70% Ethanol to each tube and mixed 18. Centrifuged tubes for 1 min at maximum speed 19. Poured off the liquid in each tube, being careful not to lose the DNA pellet 20. Added 700 L of cold 95% Ethanol to each tube and mixed 21. Centrifuged tubes for 1 min at maximum speed 22. Poured off the liquid in each tube, being careful not to lose the DNA pellets 23. Dried the pellets in the speed vacuum centrifuge for 20 min 24. Re-suspended DNA sample pellets with 100L of TE buffer overnight in refrigerator Stock Solutions CTAB: for 1L of CTAB buffer 100 mL of 1 M Tris, pH 8.0 280 mL of 5 M NaCl 40 mL of 0.5 M EDTA 20 g of CTAB (Cetyltrimethyl ammonium bromide) TE buffer: for 1L 10 m 10 ml of 1 M Tris, pH 8.0 1 m 2 ml of 0.5 M EDTA 1 M Tris, pH 8.0: for 1 L 121.1 g Tris (Fisher Cat#: BP152-5) 700 ml ddH2O Dissolved Tris and brought to 900 ml. pH brought to 8.0 with concentrated HCl (~50ml) Brought to 1 L

PAGE 64

55 0.5 M EDTA pH 8.0: for 1 L 186.12 g of EDTA 750 ml ddH2O Added about 20 g of NaOH pellets Slowly added more NaOH until pH was 8.0 5 M NaCl: for 1 L 292.2 g of NaCl 700 ml ddH2O Dissolved and brought to 1 L

PAGE 65

APPENDIX C PAIRWISE GENETIC DIFFERENTIATION AMONG POPULATIONS AND TESTS OF SIGNIFICANCE WITH BONFERRONI CORRECTIONS Table C-1. Pairwise genetic differentiation within colonist metapopulation POP 1 2 3 4 5 6 7 8 9 10 1 0 0.0192 0.0179 0.0578 0.0586 0.0388 0.0449 0.0331 0.0052 0.0205 2 n.s. 0 0.0096 0.0579 0.0379 0.0236 0.0174 0.0258 -0.009 0.0035 3 n.s. n.s. 0 0.0613 0.0344 0.0245 0.0115 0.0109 0.0051 0.0136 4 0.0045 0.009 0.009 0 0.0497 0.0451 0.0547 0.0489 0.0491 0.0513 5 0.0225 n.s. n.s. 0.0045 0 0.0158 0.0501 0.0430 0.0301 0.0085 6 n.s. n.s. n.s. 0.0045 n.s. 0 0.0245 0.0335 0.0240 0.0133 7 n.s. n.s. n.s. 0.0045 0.0045 n.s. 0 0.0054 0.0250 0.0202 8 n.s. n.s. n.s. 0.0045 0.0045 0.045 n.s. 0 0.0213 0.0277 9 n.s. n.s. n.s. 0.0045 n.s. n.s. n.s. n.s. 0 0.0012 10 n.s. n.s. n.s. 0.009 n.s. n.s. n.s. n.s. n.s. 0 Pairwise -values (Weir and Cockerham 1984) averaged over loci on top half of matrix, P-values (Bonferroni corrections) on bottom. Bold pairwise -values correspond to significant P-values (P<0.05) listed in bottom half of matrix; n.s. indicates non-significance. Table C-2. Pairwise genetic differentiation within indigenous metapopulation POP 1 2 3 4 5 6 7 8 9 10 1 0 0.017 0.0131 0.0384 0.0038 0.071 0.0368 0.0091 0.0447 0.0246 2 n.s. 0 -0.0047 0.0575 -0.0167 0.0084 0.0083 0.0033 0.0091 0.0264 3 n.s. n.s. 0 0.0665 0.0068 0.0395 0.0246 0.0021 0.0296 0.0307 4 n.s. 0.0315 0.018 0 0.0215 0.0652 0.0323 0.0369 0.0372 0.0211 5 n.s. n.s. n.s. n.s. 0 -0.0065 -0.0149 -0.0042 0.0061 0.0115 6 n.s. n.s. n.s. n.s. n.s. 0 0.0037 0.0164 0.0043 0.0423 7 n.s. n.s. n.s. n.s. n.s. n.s. 0 0.0115 0.0222 0.0202 8 n.s. n.s. n.s. n.s. n.s. n.s. n.s. 0 0.0128 0.0083 9 n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. 0 0.0072 10 n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. 0 56

PAGE 66

57 Table C-3. Pairwise genetic differentiation of eight populations of five peach palm landraces sampled from El Dorado collection POP 1 2 3 4 5 6 7 8 1 0 0.02927 0.0016 -0.0506 0.0038 -0.0031 -0.0142 0.1905 2 n.s. 0 0.0818 0.1144 0.1417 0.0868 0.0613 0.3213 3 n.s. n.s. 0 -0.0525 0.0949 0.004 -0.058 0.2386 4 n.s. n.s. n.s. 0 -0.0427 -0.0222 -0.0522 0.2609 5 n.s. n.s. n.s. n.s. 0 0.0308 0.0713 0.3364 6 n.s. n.s. n.s. n.s. n.s. 0 0.0055 0.2122 7 n.s. n.s. n.s. n.s. n.s. n.s. 0 0.1222 8 n.s. n.s. n.s. n.s. n.s. n.s. n.s. 0

PAGE 67

LIST OF REFERENCES Adin A., Weber J.C., Sotelo-Montes C., Vidaurre H., Vosman B. and Smulders M.J.M. 2004. Genetic differentiation and trade among populations of peach palm (Bactris gasipaes Kunth) in the Peruvian Amazonimplications for genetic resource management. Theor. App. Genet. 108, 1564-1573. Austerlitz F., Mariette S., Machon N., Gouyon P.-H. and Godelle B. 2000. Effects of colonization processes on genetic diversity: differences between annual plants and trees species. Genetics 154, 1309-1321. Baker A.J. and Moeed A. 1987. Rapid genetic differentiation and founder effect in colonization populations of common mynas (Acridotheres tristis). Evolution 41, 525-538. Balloux F, Brnner H., Lugon-Moulin N., Hausser J and Goudet J. 2000. Microsatellites can be misleading: an empirical and simulation study. Evolution 54, 1414-1422. Balloux F and Goudet J. 2002. Statistical properties of population differentiation estimators under stepwise mutation in a finite island model. Mol. Ecol. 11, pp. 771-783. Barton N.H. and Gale K.S. 1993. Genetic analysis of hybrid zones. In: Harrison R.G. (ed), Hybrid Zones and the Evolutionary Process. Oxford Univ. Press, New York, pp. 13. Bawa K.S. 1992. Mating systems, genetic differentiation and speciation in tropical rain forest plants. Biotropica 24, 250-255. Bohonak A.J. 2002. IBD (Isolation by Distance): a program for analyses of isolation by distance. J. Heredity 93, 153-154. Brodie A.W., Labarta-Chvarri R.A. and Weber J.C. 1997. Tree germplasm management and use on-farm in the Peruvian Amazon: a case study from the Ucayali region, Peru. Research report, Overseas Development Institute, London and International Centre for Research in Agroforestry, Nairobi, 65 pp. Brown A.H.D. and Marshall D.R. 1995. A basic sampling strategy: theory and practice. In: Guarino L., Rasmanaths Rao V. and Reid R. (eds), Collecting plant genetic diversity-technical guidelines. CAB International, Wallingford, pp. 75-91. 58

PAGE 68

59 Chase M.R., Moller C., Kesseli R. and Bawa K.S. 1996. Distant gene flow in tropical trees. Nature 383, 398-399. Chaumeil J.-P. 2001. The blowpipe Indians: variations on the theme of blowpipe and tube among the Yahua Indians of the Peruvian Amazon. In: Rival, L.M. and Whitehead N.L. (eds), Beyond the visible and the material: the amerindianization of society in the work of Peter Rivire. Oxford Univ. Press, New York, pp. 81-100. Chesson P.L. 1985. Coexistence of competitors in spatially and temporally varying environments: a look at the combined effects of different sorts of variability. Theor. Pop. Biol. 28, 263-287. Choy S.C. and Weir B.S. 1978. Exact inbreeding coefficients in populations with overlapping generations. Genetics 89, 591-614. Clement C.R. 1988. Domestication of the pejibaye palm (Bactris gasipaes): past and present. Adv. Econ. Bot. 6, 155-174. Clement C.R. and Mora-Urp J. 1988. Phenotypic variation in peach palm observed in the Amazon basin. In: Clement C.R. and Coradin L. (eds), Final report (revised): Peach palm (Bactris gasipaes H.B.K.) germplasm bank. U.S. Agency for International Development, Manaus, pp. 20-54. Clement C.R. 1989. The potential use of the pejibaye palm in agroforestry systems. Agrof. Syst. 7, 201-212. Clement C.R. 1990. Regenerao natural de pupunha (Bactris gasipaes). Acta Amazonica 20, 399-403. Clement C.R. 1992. Domesticated palms. Principes 36, 70-78. Clement C.R. 1995. Growth and genetic analysis of pejibaye (Bactris gasipaes Kunth, Palmae) in Hawaii. Ph.D. Dissertation, Univ. Hawaii Manoa, Honolulu, 221 pp. Clement C.R., Mallikarjuna K.A. and Manshardt R.M. 1997. Allozyme variation in spineless pejibaye (Bactris gasipaes Palmae). Econ. Bot. 51, 149-157. Clement C.R., Nelcimar R.S., Rodrigues D.P., Astolfi-Filho S., Moreno Y.N., Pascual V.T. and Rodriguez F.J.G. 2002. Use of AFLPs to distinguish landraces of pejibaye (Bactris gasipaes) in Brazilian Amazonia. Scientia Agricola 59, 749-753. Clement C.R., Rocha S.F.R., Cole D.M. and Vivan J.L. 2004a. Conservao on farm. In: Nass L.L. (ed), Recursos genticos vegetais. Embrapa Recursos Genticos e Biotecnologia, Braslia, in press.

PAGE 69

60 Clement C.R., Weber J.C., Van Leeuwen J., Astorga Domian C., Cole D.M., Arvalo Lopez L.A. and Argello H. 2004b. Why extensive research and development did not promote use of peach palm fruit in Latin America. In: Nair P.K.R., Rao M.R. and Buck L.E. (eds), New vistas in agroforestry: a compendium for the First World Congress of Agroforestry, Advan. Agrofor. Vol. 1. Kluwer, Dordrecht, pp. 195-206. Cockerham C.C. 1969. Variance of gene frequencies. Evolution 23, 72-84. Conklin H. 1957. Hanuno agriculture in the Philippines. Food and Agriculture Organization of the United Nations, Rome. Denevan W.M. and Treacy J.M. 1987. Young managed fallows at Brillo Nuevo. In: Denevan W.M. and Padoch C. (eds), Swidden-fallow agroforestry in the Peruvian Amazon. Advan. Econ. Bot. 5. New York Botanical Garden, Bronx, pp. 8-46. Dieringer D. and Schltter C. 2003. Microsatellite analyzer (MSA): a platform independent analysis tool for large microsatellite data sets. Mol. Ecol. Notes 3, 167-169. Doebley J. 1989. Isozymic evidence and the evolution of crop plants. In: Soltis D. and Soltis P. (eds), Isozymes in plant biology. Dioscorides Press, Portland, pp. 165-191. Doyle J.J. and Doyle J.L. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemistry Bulletin 19, 11-15. Easteal S. 1985. The ecological genetics of introduced populations of the giant toad Bufo marinus. II. Effective population sizes. Genetics 110, 107-122. Ennos R.A. 1994. Estimating the relative rates of pollen and seed migration among plant populations. Heredity 72, 250-259. Erikson P. 2001. Myth and material culture: Matis blowguns, palm trees, and ancestors. In: Rival, L.M. and Whitehead N.L. (eds), Beyond the visible and the material: the amerindianization of society in the work of Peter Rivire. Oxford Univ. Press, New York, pp. 101-122. Excoffier L., Smouse P.E. and Quattro J.M. 1992. Analysis of molecular variance inferred from metric distances among DNA haplotypes: applications to human mitochondria DNA restriction data. Genetics 131, 479-491. Falconer D.S. and Mackay T.F.C. 1996. Introduction to quantitative genetics. Fourth edition. Longman, Essex, 464 pp. Ferreira E. 1999. The phylogeny of pupunha (Bactris gasipaes Kunth, Palmae) and allied species. In: Henderson A. and Borchsenius F. (eds), Evolution, variation and classification of palms. Memoirs of the New York Botanical Garden vol. 83. New York Botanical Garden Press, Bronx, pp. 225-236.

PAGE 70

61 Gaiotto F.A., Grattapaglia D. and Vencovsky R. 2003. Genetic structure, mating system, and long-distance gene flow in heart of palm (Euterpe edulis Mart.). Heredity 94, 399-406. Gilpin M. 1991. The genetic effective size of a metapopulation. Biol. Jour. Linn. Soc. 42, 165-175. Goldstein, D.B. and Schtterer, C. (eds) 1999. Microsatellites: evolution and applications. Oxford University Press; Oxford, New York, 352 pp. Guo S.W. and Thompson E.A. 1992. Performing the exact test for Hardy-Weinberg proportions for multiple alleles. Biometrics 48, 2868-2872. Hairston N.G., Ellner S. and Kearns C.M. 1996. Overlapping generations: the storage effect and the maintenance of biotic diversity. In: Rhodes O.E. Jr., Chesser R.K. and Smith M.H. (eds), Population dynamics in ecological space and time. Univ. Chicago Press, Chicago, pp. 109-145. Hamrick J.L., Godt M.J.W. and Sherman-Broyles S.L. 1992. Factors influencing levels of genetic diversity in woody plant species. New Forests 6, 95-124. Hamrick J.L. and Godt M.J.W. 1996. Effects of life history traits on genetic diversity in plant species. Phil. Trans. Royal Soc. London B. 351, 1291-1298. Hamrick J.L. and Nason J.D. 1996. Consequences of dispersal in plants. In: Rhodes O.E. Jr., Chesser R.K. and Smith M.H. (eds), Population dynamics in ecological space and time. Univ. Chicago Press, Chicago, pp. 203-236. Hamrick J.L. and Nason J.D. 2000. Gene flow in forest trees. In: Young A., Boshier D. and Boyle T. (eds), Forest conservation genetics: principles and practice. CSIRO Publ. and CABI Publ., Collingwood and Wallingford, pp. 81-90. Hanski I. and Gilpin M. 1991. Metapopulation dynamics: brief history and conceptual domain. Biol. Jour. Linnean Soc. 42, 3-16. Hanski I. 1998. Metapopulation dynamics. Nature 396, 41-49. Hanski I. 1999. Metapopulation ecology. Oxford Univ. Press, Oxford, New York, 313 pp. Hartl D.L. 2000. A primer of population genetics. Third edition. Sinauer Assoc. Publ., Sunderland, 221 pp. Hellberg M.E. 1994. Relationships between inferred levels of gene flow and geographic distance in a philopatric coral, Balanophyllia elegans. Evolution 48, 1829-1854. Henderson A. 2000. Bactris (Palmae). Flora neotropica monograph 79. New York Botanical Garden Press, Bronx, 181 pp.

PAGE 71

62 Hill W.G. 1972. Effective size of populations with overlapping generations. Theor. Pop. Biol. 3, 278-289. Huber J. 1904. A origem da pupunha. Boletim do Museu Paraense Emilio Goeldi 4, 474-476. Jain S.K. and Bradshaw A.D. 1966. Evolutional divergence among adjacent plant populations. I. The evidence and its theoretical analysis. Heredity 21, 407-441. Johnson D.L. 1977. Inbreeding in populations with overlapping generations. Genetics 87, 581-591. Karp A. 2002. The new genetic era: will it help us in managing genetic diversity? In: J.M.M. Engels, V.R. Rao, A.H.D. Brown and M.T. Jackson (eds.) Managing plant genetic diversity. CAB Int. Publ., Wallingford, pp. 43-56. Karp A., Kresovich S., Bhat K.V., Ayad W.G. and Hodgkin T. 1997. Molecular tools in plant genetic resources conservation: a guide to the technologies. International Plant Genetic Resource Institute; Rome, 112 pp. Kimura M. 1953. Stepping stone model of population. Ann. Rept. Nat. Inst. Genetics Japan 3, 62-63. Labarta R.A. and Weber J.C. 1998. Valorizacin econmica de bienes tangibles de cinco especies arbreas agroforestales en la Cuenca Amaznica Peruana. Rev. Forestal Centroamericana 23, 12. Le Corre V. and Kremer A. 1998. Cumulative effects of founding events during colonization on genetic diversity and differentiation in an island and stepping-stone model. J. Evol. Biol. 11, 495-512. Lengkeek, A.G. 2003. Diversity makes a differencefarmers managing interand intra-specific tree species diversity in Meru Kenya. Ph.D. Thesis, Wageningen University, Wageningen. Levin D.A. 1981. Dispersal vs. gene flow in plants. Ann. Mis. Bot. Garden 68, 233-253. Levin D.A. 1988. Consequences of stochastic elements in plant migration. Am. Nat. 132, 643-651. Levin D.A. and Kerster H.W. 1974. Gene flow in seed plants. Evol. Biol. 7, 139-220. Levins R. 1970. Extinction. In: Gerstenhaber M. (ed), Some mathematical problems in biology. Am. Math. Soc., Providence, pp. 77-107. Li W.-H. 1976. Effects of migration on genetic distance. Am. Nat. 110, 841-847.

PAGE 72

63 Listabarth C. 1996. Pollination of Bactris by Phyllotrox and Epurea. Implications of the palm breeding beetles on pollination at the community level. Biotropica 28, 69-81. Louette D. 2000. Traditional management of seed and genetic diversity: what is a landrace? In: Brush S.B. (ed), Genes in the field: on-farm conservation of crop diversity. Lewis Publ., International Development Research Centre, International Plant Genetic Resource Institute, Boca Raton, pp. 109-142. Loveless M.D. and Hamrick J.L. 1984. Ecological determinants of genetic structure in plant populations. Ann. Rev. Ecol. Syst. 15, 65-95. McCauley D.E. 1991. Genetic consequences of local population extinction and recolonization. Trends Ecol. Evol. 6, 5-8. McCauley D.E. 1993. Genetic consequences of extinction and recolonization in fragmented habitats. In: Kareiva P.M., Kingsolver J.G. and Huey R.B. (eds), Biotic interactions and global change. Sinauer Assoc., Sunderland, pp. 217-233. Martnez A.K., Gaitn-Solis E., Duque M.C., Bernal R. and Tohme J. 2002. Microsatellite loci in Bactris gasipaes (Arecaceae): their isolation and characterization. Mol. Ecol. Notes 2, 408-410. Maruyama T. and Fuerst P.A. 1985. Population bottlenecks and nonequilibrium models in population genetics. III. Genic homozygosity in populations which experience periodic bottlenecks. Genetics 111, 691-703. McKey D. and Beckerman S. 1993. Chemical ecology, plant evolution and traditional cassava cultivation systems. In: Hladik C.M., Linares O.F., Pagezy H., Semple A. and Hadley M. (eds), Food and nutrition in tropical forests: biocultural interactions. Man in the Biosphere Series vol. 13. UNESCO, Paris, pp. 83-112. Miranda, I.P. de and Clement C.R. 1990. Germinacin y almacenamiento del polen de pejibaye (Bactris gasipaes H.B.K., Palmae). Rev. Biol. Trop. 38, 29. Mora-Urp J. and Solis E.M. 1980. Polinizacin en Bactris gasipaes H.B.K. (Palmae). Rev. Biol. Trop. 28, 153-174. Mora-Urp J. 1982. Polinizacin en Bactris gasipaes H.B.K. (Palmae): nota adicional. Rev. Biol. Trop. 30, 174-176. Mora-Urp J. and Clement C.R. 1988. Races and populations of peach palm found in the Amazon basin. In: Clement C.R. and Coradin L. (eds), Final report (revised): Peach palm (Bactris gasipaes H.B.K.) germplasm bank. U.S. Agency Int. Develop., Manaus, pp. 78-94. Mora-Urp J., Weber J.C. and Clement C.R. 1997. Peach palm (Bactris gasipaes Kunth): promoting the conservation and use of underutilized and neglected crops. International Plant Genetic Resource Institute, Rome.

PAGE 73

64 Mora-Urp J and Echeverra J.G. (eds) 1999. Palmito de pejibaye (Bactris gasipaes Kunth): su cultivo e industrializacin. Univ. Costa Rica Press, San Jos, 260 pp. Nei M., Maruyama T. and Chakraborty P. 1975. The bottleneck effect and genetic variability in populations. Evolution 29, 1-10. Newbury H.J. and Ford-Lloyd B.V. 1997. Estimation of genetic diversity. In: Maxted N., Ford-Lloyd B.V. and Hawkes J.G. (eds), Plant genetic conservation: the in situ approach. Chapman and Hall, London, pp. 192-206. Nybom H. and Bartish I.V. 2000. Effects of history traits and sampling strategies on genetic diversity estimates obtained with RAPD markers in plants. Persp. Plant Ecol. Evol. and Syst. 3, 93-114. Pannell J.R. and Charlesworth B. 1999. Neutral genetic diversity in a metapopulation with recurrent local extinction and recolonization. Evolution 53, 664-676. Pannell J.R. and Charlesworth B. 2000. Effects of metapopulation processes on measures of genetic diversity. Phil. Trans. Royal Soc. London B. 355, 1851-1964. Patio V.M. 1963. Plantas cultivadas y animales domsticos en Amrica equinoccial. Tomo I. Frutales. Imprenta Departmental, Cali, 547 pp. Purvis A. and Hector A. 2000. Getting the measure of biodiversity. Nature 405, 212-219. Raymond M. and Rousset F. 1995a. GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism. J. Heredity 86, 248-249. Rival L.M. 2002. Trekking through history: the Huaorani of Amazonian Ecuador. Columbia Univ. Press, New York, pp. 84-93. Rodrigues D.P. 2001. Anlise das morfo-raas primitivas de pupunha (Bactris gasipaes Kunth) mantidas no banco ativo de germoplasma de pupunha com marcadores moleculares RAPDs. Masters Thesis, Universidade de Braslia, Braslia. Rodrigues D.P., Astolfi-Filho S. and Clement C.R. 2004a. Molecular marker-mediated validation of morphologically defined landraces of pejibaye (Bactris gasipaes) and their phylogenetic relationships. Genetic Resources and Crop Evolution, in press. Rodrigues D.P., Vinson C., Ciampi A.Y., Farias I.P., Lemes M.R., Astolfi-Filho S. and Clement C.R. 2004b. Ten new microsatellite markers for Bactris gasipaes Kunth (Palmae). Mol. Ecol. Notes, in press. Rousset F. 1997. Genetic differentiation and estimation of gene flow from F-statistics under isolation by distance. Genetics 145, 1219-1228.

PAGE 74

65 Seger J and Brockmann J.H. 1987. What is bet-hedging? In: Harvey P.H. and Partridge L. (eds), Oxford Surveys in Evolutionary Biology Vol. 4. Oxford Univ. Press, Oxford, New York, pp. 182-211. Slatkin M. 1977. Gene flow and genetic drift in a species subject to frequent local extinctions. Theor. Pop. Biol. 12, 253-262. Slatkin M. 1981. Fixation probabilities and fixation times in a subdivided population. Evolution 35, 477-488. Slatkin M. 1985. Gene flow in natural populations. Ann. Rev. Ecol. and Syst. 16, 393-430. Slatkin M. 1995. A measure of population subdivision based on microsatellite allele frequencies. Genetics 139, 457-462. Sobral B.W.S. and Honeycutt R.J. 1994. Genetics, plants and the polymerase chain reaction. In: Mullis K.B., Ferr F. and Gibbs R.A. (eds), The polymerase chain reaction. Birkhauser, Boston, pp. 304-319. Sokal R.R. and Rohlf F.J. 1981. Biometry. Second edition. Freeman, New York. Sotelo-Montes C. and Weber J.C. 1997. Priorizacin de especies arbreas para sistemas agroforestales en las selva baja del Peru. Agroforesteria en las Amricas 4, 12-17. Sousa N.R., Rodrigues D.P., Clement C.R., Nagao E.O. and Astolfi-Filho S. 2001. Discriminao de raas primitivas de pupunha (Bactris gasipaes) na Amaznia Brasileira por meio de marcadores moleculares (RAPDs). Acta Amazonica 31, 539-545. Varvio S.-L., Chakraborty R and Nei M. 1986. Genetic variation in subdivided populations and conservation genetics. Heredity 57, 189-198. Wade M.J. and McCauley D.E. 1988. Extinction and recolonization: their effects on the genetic differentiation of local populations. Evolution 42, 995-1005. Weber J.C., Labarta-Chvarri R., Sotelo-Montes C., Brodie A.W., Cromwell E., Schreckenberg K. and Simons A.J. 1997. Farmers use and management of tree germplasm: case studies from the Peruvian Amazon Basin. In: Simons A.J., Kindt R. and Place F. (eds.), Proceedings of an international workshop on policy aspects of tree germplasm demand and supply. International Centre for Research in Agroforestry, Nairobi, pp. 57-63. Weber J.C., Sotelo-Montes C., Vidaurre H., Dawson I.K. and Simons A.J. 2001. Participatory domestication of agroforestry trees: an example from the Peruvian Amazon. Development in Practice 11, 425-433.

PAGE 75

66 Weeden N.F. and Wendel J.F. 1989. Genetics of plant isozymes. In: Soltis D. and Soltis P. (eds), Isozymes in plant biology. Dioscorides Press, Portland, pp. 46-72. Weir B.S. and Cockerham C.C. 1984. Estimating F-statistics for the analysis of population structure. Evolution 38, 1358-1370. Whitlock M.C. and McCauley D.E. 1990. Some population genetic consequences of colony formation and extinction: genetic correlations within founding groups. Evolution 44, 1717-1724. Wright S. 1931. Evolution in Mendelian populations. Genetics 16, 97-259. Wright S. 1943. Isolation by distance. Genetics 28, 114-138. Wright S. 1946. Isolation by distance under diverse mating systems. Genetics 31, 39-59. Yang R.-C. 2000. Zygotic associations and multilocus statistics in a nonequilibrium diploid population. Genetics 155, 1449-1458. Yang R.-C. 2002. Analysis of multilocus zygotic associations. Genetics 161, 435-445. Zhivotovsky L.A. and Feldman M.W. 1992. On models of quantitative genetic variability: a stabilizing selection-balance model. Genetics 130, 947-955.

PAGE 76

BIOGRAPHICAL SKETCH David M. Cole was born and raised in Rochester, New York. He first attended the Utah State University School of Forestry, from 1992 until 1994. He continued pursuit of a bachelors degree in 1997, at the University of California at Santa Cruz, and graduated with college honors in August 1999, with a Bachelor of Arts in Environmental Studies (with an agroecology emphasis). 67


xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20110114_AAAAFO INGEST_TIME 2011-01-15T02:14:05Z PACKAGE UFE0007363_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 23676 DFID F20110114_AADKBK ORIGIN DEPOSITOR PATH cole_d_Page_28.QC.jpg GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
b1cb6b0deb3328a3271627b076171117
SHA-1
e7a46951ad6d005773003a3bf11e6b4f8a7dcd5d
6335 F20110114_AADJZK cole_d_Page_56thm.jpg
47119389efc04cdb07187e003995132d
a83d05e36ddc0bdd5d651d0258681123820b64f7
94836 F20110114_AADJKS cole_d_Page_72.jpg
fa061c60d0234845333fdae073703096
d41dce5d6a600f70368a0def2287b55fcb1e450f
1054428 F20110114_AADJUN cole_d_Page_44.tif
ccb9ef5b52ea7573b34caf0a0f83dc61
d91c7c7b787caef924c8542a389cc048d61b77b3
1053954 F20110114_AADJPQ cole_d_Page_29.tif
7235c187a01d2ee12ace8a1d9b0d1a66
2dbf359e93d270d0eb1335f89014f653307cc9c7
22087 F20110114_AADKBL cole_d_Page_35.QC.jpg
dfea3ee9dd12274b8dc8970b86e7d1c3
d60177b29646d665c512d55a191bf62009783dc5
2298 F20110114_AADJZL cole_d_Page_66thm.jpg
5917df90f9e9fb58ad09bfd533459ca1
44f92b6136937bbe00235992bb929359f43f757c
1051968 F20110114_AADJKT cole_d_Page_06.jp2
97cf5cc56ce597620fbbf91fb50cd5ae
71fd54920f765dac7ef1e53ef28e9b63757a6431
F20110114_AADJUO cole_d_Page_45.tif
8d7c6e2d52d6cbd9dbba85d5f9fe8cc6
4531d4807c93f6b9b1d765aaaa94a9655e08a0e2
107325 F20110114_AADJPR cole_d_Page_56.jp2
8a1b1171718303666ea2f8c10a35b974
38b2339872092ff26ecf2be8411e4caa3a873c3c
5967 F20110114_AADKBM cole_d_Page_35thm.jpg
55aafe6994e8e95ccc3982f6a2fac464
d2d877a4d29999ac1eef28e7599458828d74d5ac
20939 F20110114_AADJZM cole_d_Page_38.QC.jpg
8e44c420282f2accd12109e8b154ef77
bec64f750bc77e514031d9dae6f9a573518aaa09
73650 F20110114_AADJKU cole_d_Page_21.jpg
e624cc6f807e8fa307335e4e1d23835f
9b0713a13a2165669b71051d1858eb95f8223388
8423998 F20110114_AADJUP cole_d_Page_47.tif
0036f23114631dfc16ae9e7c19475074
97ddbd102c38c510a3943b2139aab22ff04dc4c2
6568 F20110114_AADKBN cole_d_Page_36thm.jpg
b6b52108603d60e1cf05066df2ef3a4d
844191309afcab4f53f6ab938b7e2dc6c16a66ba
24247 F20110114_AADJZN cole_d_Page_13.QC.jpg
eab0e93fe42d1c38528471a759b06da7
6c648d613e5aa9f2133cac6f2268f33af20ea1ee
88065 F20110114_AADJKV cole_d_Page_69.jpg
66fe3e2fa6a670ce21dafb5f93f3aa87
1306b7f2a0daf0224f81c57ce8a35ef398954eb5
F20110114_AADJUQ cole_d_Page_48.tif
75a1d47db6c878c89527c5442f50a028
83dcc590eeb85283f5142b5df582633c5296c57f
112447 F20110114_AADJPS cole_d_Page_32.jp2
a1f12ea8dfa4063f8ee4281d11f0677f
de94d4d0736510287052c87ca2c61eb8e2bfdbce
21420 F20110114_AADKBO cole_d_Page_37.QC.jpg
8415cfbdc3812074ac47748723f12c06
1974d486db8e4462986567c16f8242e2ed18732b
1393 F20110114_AADJZO cole_d_Page_02thm.jpg
c7bb06d2cf40534f70b71f8da33b0a00
2e2786f9d062bc07e3fa2642a1390cec905b85e6
40417 F20110114_AADJKW cole_d_Page_62.pro
fb2fa38b059c73a92a9cd3f9cb85d6fe
d68bd7d4c1dd6bc239cabcc966ebc957fc8315e7
25271604 F20110114_AADJUR cole_d_Page_49.tif
2b365ab1616e6f671a60ecb33b0c6539
d1b39400a7c0e524ae5a33858082486a170af77b
2030 F20110114_AADJPT cole_d_Page_26.txt
71c7b408b3b5167f231cc7751a335549
098cc09a2bd2c7c23629116f08fd9527e7c64cc3
6122 F20110114_AADKBP cole_d_Page_37thm.jpg
e34c610d37cc9cc106062f41454562a3
ae83db9bf513c1013ad62113687fec4c5b739f38
6439 F20110114_AADJZP cole_d_Page_54thm.jpg
7ba0c81c1e580d9e2ccdc346573171f6
4261f982f9f3a0816f42bc02e168486b729cca81
14423 F20110114_AADJKX cole_d_Page_60.QC.jpg
20e580c04e02ee3a337592fb54bd1cf1
2081c81146d65e5d963955fe350f8e9a92bb9583
F20110114_AADJUS cole_d_Page_52.tif
ac1946f6e1bbedeac0bbaa4e48ff6a01
e64e339958a6aab195db711d6810195612ad2959
39244 F20110114_AADJPU cole_d_Page_10.pro
3abbce3cc8a0b4359e0b1c12615a2f99
461fa775fd73964442c75183dc385d5429884d9d
6293 F20110114_AADKBQ cole_d_Page_39thm.jpg
e3f6415382f44eb1433b97503b47af62
a3338d1598102117cb32e52408e93918c8d6938b
25453 F20110114_AADJZQ cole_d_Page_68.QC.jpg
a6c4fb38c6f7d21b5d18c6401aca9a00
ac177ea128ef88b855ef2d1f84af21319204805a
6326 F20110114_AADJKY cole_d_Page_18thm.jpg
5a7c92405b606bdb66ee80cc758dab84
e0e9a8f069d42c97cec0bb2d05ccb3c56bae0fe8
F20110114_AADJUT cole_d_Page_53.tif
d86ddea69af4f1744331d26600269393
f8819ffe7fedaccf8bee3c305aff0d8ccfaa45e2
74071 F20110114_AADJPV cole_d_Page_36.jpg
23332fdc0417b350c843b489e7b8d4e9
c361891c6e65d80c54061e6469b06e87c52d69b0
22307 F20110114_AADJIA cole_d_Page_20.QC.jpg
8c0d9562ec896a0e415f359d3f2e660e
bc45f38df8d110f1712b0ab173dada6b609cbd5f
23998 F20110114_AADKBR cole_d_Page_45.QC.jpg
0e0e4f183f7b4abc6bd44df0cc68c866
f32c20b002064edccb73b895ce650e1da34428e7
6494 F20110114_AADJZR cole_d_Page_68thm.jpg
d42d38985f87b9f061c0e1bc1aca40a0
7f0a5c09332ba59cea59c94401cf2a1ce471aeeb
23087 F20110114_AADJKZ cole_d_Page_43.QC.jpg
43fb5e47072fbd920be76037974a873e
14a43da39fedfdba322c6d9629af0198c86cf686
F20110114_AADJUU cole_d_Page_54.tif
8386dc1d659c757ba86447db87d16917
83edfc79349bde0a0d9a218873b5394a60440604
45642 F20110114_AADJPW cole_d_Page_37.pro
3cc4eaae744eb853845ea539655438f0
d7aed6f23c08f750651a5bc697f2a86a57f2a8df
47200 F20110114_AADJIB cole_d_Page_06.pro
64fa0540ec581a7d214e818ef60e713c
02e1a54790df39cb3f09b0a03887ab14d69aff9c
24316 F20110114_AADKBS cole_d_Page_50.QC.jpg
68af64e95b84f5100919489052239181
af5c171f7957774340d4a1b6145918464e912512
6228 F20110114_AADJZS cole_d_Page_34thm.jpg
451c877bc0797459bb75e49ee18bf6b7
9ec8559a401b9c2795c8dc482f35037c6243bacc
F20110114_AADJUV cole_d_Page_55.tif
a6fa6c6c1715aaf002fb5ff94933130f
b79755c06771c4b5106f5bd395ff6c6503cda6f0
23873 F20110114_AADJPX cole_d_Page_21.QC.jpg
d7bee8a1673c2f39e61e2cc7f1dd3abc
4fa5b1533ee3a55fdb4cc98f442ef26f769c4178
6794 F20110114_AADJIC cole_d_Page_57thm.jpg
0dd901fa3e2180e83d54ab44d99fe475
a1c106882fe4d4dc5af9f9f86de2155cd2af3831
23810 F20110114_AADKBT cole_d_Page_53.QC.jpg
287f85b668462a01f531aa708e2fe010
adca9148c7b906cfc70001aa058a37d6da4debe8
22485 F20110114_AADJZT cole_d_Page_33.QC.jpg
51d8a2ce892f712415097fcb1ba1ebed
d707d84d813751be8a9a498a827869f5b4b4c2c1
F20110114_AADJUW cole_d_Page_56.tif
dd38e5f1fdd27addfaf9b1aa1f1db2dc
9b2394605387efde6ed35e2ac53e71b1d3b52d8a
1051921 F20110114_AADJNA cole_d_Page_15.jp2
39f075f9cc8f2c10fb164c42255e34c2
10a2e0e39d988d2c9badb66f2172c8304a75f309
24811 F20110114_AADJPY cole_d_Page_61.pro
2c3a423ded41766130560336e1aaa544
b3c42a5a992345ebbac92ff8ad694339aa33cf66
54307 F20110114_AADJID cole_d_Page_71.pro
50beb85de72e59fde2facf8149ae02d6
8ba43b709cd352875fc6ace9b222833a20e7f7d9
23521 F20110114_AADKBU cole_d_Page_54.QC.jpg
1b9ba44a2b5621e0b6f068048a65acd9
14ac2fee5abd7f01d0945300f1a6a41ad0898c76
7529 F20110114_AADJZU cole_d_Page_76.QC.jpg
c813e545c79664b02e803b7a3f28dfe3
80ffa9334ae7bdfd88bbb7741e649b7377074a18
597 F20110114_AADJNB cole_d_Page_29.txt
26b7f020dd44f2ec231522617c82fe05
5aa27c21b4af7d6c6f1c7f87ea6dc8b8e856de3f
1051983 F20110114_AADJPZ cole_d_Page_04.jp2
9e40b484edcac00d15e29ba39c2ddfeb
5bb146930abc99ccee39e56763a79b397da80a38
F20110114_AADJIE cole_d_Page_51.tif
f768e1915cbe4ae2c07038f18c9d6e4e
76805de3fd356f96e534af77a7a4cdd691a773dc
3580 F20110114_AADKBV cole_d_Page_59thm.jpg
fc5e7149d3cf9c0f8b3ab6ceadadc0c8
df13317ffdf418759907e2afa3071c3da4c52e3c
7170 F20110114_AADJZV cole_d_Page_69thm.jpg
3b893b506424c3599485b657171649b0
9ecdbf4cba62a226f31cee5ca8bef732d2703fcd
F20110114_AADJUX cole_d_Page_59.tif
e36da031e43379c7b0a7bf1d3f55b561
186b36870b34f838ea28dfdceffef0d064710b41
128905 F20110114_AADJNC cole_d_Page_73.jp2
9de4f3096843b805dfa0a41d295f3388
b85b559570997753058d16983a405aa8d6a53fc8
27145 F20110114_AADJIF cole_d_Page_76.jp2
2bbbeeee221969f8c1d4dfbe84b8ee42
ff33b71f31d42339ad08f95021c3631fe029562d
4062 F20110114_AADKBW cole_d_Page_60thm.jpg
193c9af0d695f8c54ad30a3d8a43368a
d5a879e0bc01d8db458b7ca0c7254b99aab1b7e5
6839 F20110114_AADJZW cole_d_Page_23thm.jpg
149294823a44397f70f873b67b66b58c
1df956ac154816a29172533cf52ea572163b67c9
F20110114_AADJUY cole_d_Page_60.tif
d1e161e0111bd4252c6b1e4d05e050b1
68a524465cf62b73acd962820420545d3f5b8923
51904 F20110114_AADJND cole_d_Page_50.pro
33644e4d635cec139025e39e0bd5186e
2fa6f6168984ae50809f99ec76092fa80e2c4ad4
F20110114_AADJIG cole_d_Page_73.tif
ce9b7895c45ee29fafd6f905ea5acee8
2dee26cad24a60463cfab4f90e06132571bf2154
1051963 F20110114_AADJSA cole_d_Page_05.jp2
ae39cfc5006a75f992063452f5ca144b
54fb0f8eda4180232c22d2ac57c9ecfcdc901cb1
4847 F20110114_AADKBX cole_d_Page_65thm.jpg
c310985c55843a8ba659f527d5bd5aaa
a4c7a88b89dc34be724aafca6d82725cd61e99fa
16230 F20110114_AADJZX cole_d_Page_31.QC.jpg
5706c00e7f1a1522be65d198a48f3d6b
eb757ac0bae373087b643256593553be87d31119
F20110114_AADJUZ cole_d_Page_62.tif
001cde06aaed984cac55108f20a435ff
d03cbe13400f1a85af2bfb6800f986d137026d82
42255 F20110114_AADJNE cole_d_Page_38.pro
52625a3ddc69c0ac56f712703d8b50e2
ba74cece8c30bfd3c5f0a8614b600996d484710d
2532 F20110114_AADJIH cole_d_Page_76thm.jpg
0095398762be058a97f4ed8e6a9f5881
ea576f5cc62a05b05acef690c055ecc0f8f43803
98185 F20110114_AADJSB cole_d_Page_09.jp2
33ed2190b06d6f3a0829b460815b4011
7aaee270a1059ea7bb3b2bc74c800b2e91812733
5568 F20110114_AADJZY cole_d_Page_30thm.jpg
ce5c996e451a27b2e1e80911a29ccd11
4a2a0c36a3c4dbd53bdcab958eb61dbdebc03915
51531 F20110114_AADJNF cole_d_Page_21.pro
43abac5f9b91e0c59cdffcab4b3ce486
a4e8a4b084310f071783bc64567eca5a0b51b88c
7005 F20110114_AADJII cole_d_Page_66.QC.jpg
0208caf89e75b6473b979f28dc0cf2f8
1c86bea32ff6b85493c413d155691d7d2d553817
113020 F20110114_AADJSC cole_d_Page_11.jp2
3c33ec5d7a1b3a0b419427528fb53894
9713a5127c2f009f73867152cb6f0afd625039ab
4973 F20110114_AADJZZ cole_d_Page_06thm.jpg
c2d2f859fc9cd5aebbf6cacfe43ec709
7aa821fffc800bcb927ea817d42f5e444022b36d
116 F20110114_AADJXA cole_d_Page_02.txt
8d17dab6988e94815c5a8dd42c81c9e3
113cf5608056c5feb63c6884d4cf4506d452ec6a
1748 F20110114_AADJNG cole_d_Page_38.txt
363ee388265d8f1f5192806a97f710e9
f00cc81e93b54382eee8d4b6e6a2b639e2c34db3
24501 F20110114_AADJIJ cole_d_Page_32.QC.jpg
914f9298adb46723eed18efee36bd04e
f2bbd1abb4ee79dbb2921c81837411ca1c599877
109328 F20110114_AADJSD cole_d_Page_12.jp2
3449d5ebceef1f9167a70367e1d13ee7
7bdb02d96748b7dc518ba39b45cdc4be828c93a1
2669 F20110114_AADJXB cole_d_Page_05.txt
49950717ba21383a20a9062701b0ecb3
bc8b71b95fd660a21a8aff899b4ab809eb1ffd93
1294 F20110114_AADJNH cole_d_Page_63.txt
67484873e16c2c12dd29e396beca4990
503d3f8a5abc8a35be1b6bb24c2a1edd0b6a5344
1982 F20110114_AADJIK cole_d_Page_12.txt
44773a00c1335712d3f93eaaaa962473
10c878ff863c72ea9b9c643e1010d09f16ffaaf1
87174 F20110114_AADJSE cole_d_Page_14.jp2
b5fc04703593cbb1f81b3e0a57f53a87
2a4d84ab30cbeeda7716d93c4a3e0b479b299628
1960 F20110114_AADJXC cole_d_Page_06.txt
10a94cc905fe93dc250dbf9c634ee670
816c803eeb20e01e3efd25ad40806b1c7653b7fe
49371 F20110114_AADJNI cole_d_Page_59.jp2
6bada3a4d62f9469360a7b9d9c7919db
c00c3fd4fb67b165f340b427f4b51a1a1bc76cb7
110350 F20110114_AADJSF cole_d_Page_17.jp2
66bc30483046d9fc204107092f9d9d65
ce969f7de2d428ec3c5b5f998d545c8bfa235533
976 F20110114_AADJXD cole_d_Page_07.txt
d2933b450ad82e1a2037b0883f543016
325af67a9d9727075532b2a41f5c4e8335e66eab
1976 F20110114_AADJNJ cole_d_Page_58.txt
7b2649b787dd6296f105b19788ef4072
5530afa9551b10e2a5844b2917bd3a76c84dcb53
10442 F20110114_AADJIL cole_d_Page_02.jpg
70fc8018bdfc9cedc5aaa90187fa90d2
ec02c5d56dae81f4d4a0ba16db6cf14ccf85c593
103697 F20110114_AADJSG cole_d_Page_20.jp2
fae42863952caffc97f6f6f3b7f8eb93
973f74ef0bd30d2bba0dbcbae519b4da1f6afc7a
1933 F20110114_AADJXE cole_d_Page_08.txt
0bf452315d63c9c293f1f367a4c54321
f9aeee6095ca04792b029818c17cd12a15d3669b
F20110114_AADJNK cole_d_Page_39.tif
358a051f7acaaad36d8fc98625742765
6812b5942007b2bef7074a8fc047567d063df9cb
53025 F20110114_AADJIM cole_d_Page_46.pro
d5f21cbdefe71cd7e4a6a42e74e10563
ca716851fcc7226e1902b294ea963a32b8e4d286
111716 F20110114_AADJSH cole_d_Page_21.jp2
90f9a0325e3f80b78635bd59eed4efb9
1edc15a8452647cd33d5c5aeeca0c3a49baba06a
1769 F20110114_AADJXF cole_d_Page_09.txt
ad025c6b21b152e00cbc0585f5b269d9
c2603bf1e1c0583f426fe725c217aaf4cd6e2e40
F20110114_AADJNL cole_d_Page_50.tif
2982c7e3032eca52c8ee8cf476c70a2d
ba54907c0015f332b1701602265bbe7b0a1aaa9a
85030 F20110114_AADJIN cole_d_Page_15.jpg
95a318d3ac6b4c221a5d2f1e2defa02b
53e315664edc54d9f139d30fd460726aa8d0fe07
110603 F20110114_AADJSI cole_d_Page_22.jp2
8ae65fc632dfd51218cb6b25f11fb52e
d0d66f665c318f766fab51a475833733fe2580d5
1632 F20110114_AADJXG cole_d_Page_10.txt
1f6c31ba450c0c9f168ae22618c056f4
b108ad3eaa8281bed346accb1ae929e728cdf4af
94743 F20110114_AADJNM cole_d_Page_38.jp2
0a9ab0bec35161b5b6f9aa0e461cd9a0
f5df095052cc19ac5d19ddbf2092eaccd9d86a49
25072 F20110114_AADJIO cole_d_Page_01.jpg
c3381ceba18527433b7a09c41a469c69
3a09dc5988583a7739ec3c5e42b760f688536fe1
105724 F20110114_AADJSJ cole_d_Page_24.jp2
8365243f0b7156e5cfe07833e4bbc01a
548b34ea10659ea2f1f5412b0002a1c1e519d108
2073 F20110114_AADJXH cole_d_Page_11.txt
ad0fa988a641f7eadaeb6f7586afa717
0d23e4e0e5ce1ad89eb535a706345ccfe119105c
F20110114_AADJNN cole_d_Page_61.tif
cb98938bb58d81d52b604afba9c38c1d
56810f75fd759f53b481c753ac77156c27d61906
11515 F20110114_AADJIP cole_d_Page_61.QC.jpg
267ff8dbd4d152c993a27c36d0ddf4dd
720dc498405c88c7437fba5db12e1231d96a3184
112966 F20110114_AADJSK cole_d_Page_26.jp2
90bcbc86b41638706e048404ac054f30
37d4c9fd62a00b8afa431fd635a0ee7c974a544f
2055 F20110114_AADJXI cole_d_Page_13.txt
5d82073217e941b71b25b1e4b1017394
b2febe6b36c3c38606e2ccc57807acdbb23d6232
106224 F20110114_AADJNO cole_d_Page_18.jp2
3b599894d3dfd1cd4c85411b7c0c003c
03b443dada7aac69fe2c944a9c2d006cf3861d28
22822 F20110114_AADJIQ cole_d_Page_40.QC.jpg
7294ae0242a3a23752b01633f032cdd6
dba768c9f11ba8d0cf824a24aaf54cf1b5f36997
109674 F20110114_AADJSL cole_d_Page_27.jp2
3a079e7d3c17e275aa558ac7bf85e07e
21d37a4d3046aebb6719161538914fc4e8bfa3d0
1955 F20110114_AADJXJ cole_d_Page_18.txt
14f478f049adaa85162bff87b4732d8d
13a6bc94a4ff5af78c724e10de98436f55c0becf
2017 F20110114_AADJNP cole_d_Page_54.txt
06f4ff2677826c042ce2b64d3dd331be
9b850ddc13dca8d1f2d86cd8c84a3c4d6902783b
2496 F20110114_AADJIR cole_d_Page_42.txt
b07c84aefda68bdfe2a8c7ec22520791
aca2bc66ade31372cccaeff7e77cae4d8cd398ba
108848 F20110114_AADJSM cole_d_Page_28.jp2
7f415fc1e9a50b57f24fe6274549e82e
6cf84488a7393f6b2a9505f8f08612c019f07b5e
1904 F20110114_AADJXK cole_d_Page_20.txt
483f9c0069e8282f2b1be26516c605f0
26ef59865be897e636c08c6ff70231d0585bfaad
1969 F20110114_AADJIS cole_d_Page_25.txt
10b67884cf927f0b85e041c4512f6dc3
01b4223b1e35d6d678bb4ec4183ac410c831117a
32631 F20110114_AADJSN cole_d_Page_29.jp2
8af545c4672d1dc68ab576f84fdb1531
57c0b739014e3e50832f70a61ee1638f737a46e3
2028 F20110114_AADJXL cole_d_Page_21.txt
504e0e264c9e4b5c6385da19fa5f8bd6
a76e8954e3756e8f76e7bc652d6c2857cf0391b1
782444 F20110114_AADJNQ cole_d_Page_07.jp2
4ed748ea7febbb8a3ddbeb7c417fe3cc
f453f76efdd18e3ff4d9a18fb9897059b9bc9c34
39173 F20110114_AADJIT cole_d_Page_14.pro
8f5059e66b590adb695d0be66dc10f9c
8a0a86d35c64c7357d677815090aa82d56fa5236
89323 F20110114_AADJSO cole_d_Page_30.jp2
c44c4ab79587e551656fec89a3f2bab3
e449234ae10f9fc9998c87aeed8ba8968db0c489
2102 F20110114_AADJXM cole_d_Page_23.txt
5bed595c1100cd1a96229ca688c73f30
1f7b586c204ccffc7bd90f7bfc91f3585ad9620a
102968 F20110114_AADJNR cole_d_Page_40.jp2
576f621404c2193147666be7c2c30bf8
b19b872c5e677f787c4dcd610f883aaf345dd39d
56261 F20110114_AADJIU cole_d_Page_65.jpg
3de42a7ea3a15ff17b95c91bb68adde6
5a4fae6a7bcd04509fa8df38ccb59cd8abdca5ca
1041585 F20110114_AADJSP cole_d_Page_31.jp2
a5426862cba28ef841432d71e935758c
357e2a62c54e0b8c576a1ab5602af07476761a25
1915 F20110114_AADJXN cole_d_Page_24.txt
abb53d2a565c06b8eff6d6762dc0a2c3
86992a19587e4f06488fc752ef5a29ff9c5adbf9
24995 F20110114_AADJNS cole_d_Page_57.QC.jpg
4bc504936d81d49d3323dcafe88c6dbd
5e16bbff186bd06f3874aeaa55b7170d56117319
F20110114_AADJIV cole_d_Page_36.tif
c91b9a4098a5e0190b271281362fd021
d1dc460725abc5f5b3f784f5a2aabd9816532a72
105259 F20110114_AADJSQ cole_d_Page_33.jp2
04bbec39b1c09ddd33911eb0a95a831a
5254d7b2e5ff94ad7aa33b98641627b42180e350
1964 F20110114_AADJXO cole_d_Page_28.txt
d376bd144d3650157a37acc2600f276c
a8c5f9948d5906e755a11957f98ec9c1229ad3bd
6442 F20110114_AADJNT cole_d_Page_21thm.jpg
92ff71744826a9f260b47380eef68621
b690568a0c59823ad482f75959c2224623b15895
20211 F20110114_AADJIW cole_d_Page_42.QC.jpg
dfbca4869303787d4542693a6a8e5af3
8cb18985635d05c4c4c304544ae93332079d5860
106564 F20110114_AADJSR cole_d_Page_34.jp2
04516e761670452207d6205adea34ecc
d6fb421193006971d22cc002405929c186139d3a
1658 F20110114_AADJXP cole_d_Page_30.txt
50896bf99ec5a12417dc8ec67fb656d8
91a21ef7374fdbba5ec63df0e23eb228b7f6e40e
48949 F20110114_AADJNU cole_d_Page_18.pro
b8814d1a2394717b171c71c2e5fe9df1
735582ffa4207bf870457f72dbdba9e7edf99b8c
7106 F20110114_AADJIX cole_d_Page_72thm.jpg
225494aa013598e2c38e80bfa2285a9b
e0d56fbc7756044ef6202780a78a550df5d4fb29
99574 F20110114_AADJSS cole_d_Page_35.jp2
e48cd7ffb2e224ea06b3aaad0248e685
959edd41b6f03c140063d78ab73c242823fce1bb
1027 F20110114_AADJXQ cole_d_Page_31.txt
7dce38184ef73d98ec8a5e42297a16d7
a2bbeabd416e27fbc3e0a1e77e07e96526966fa9
50112 F20110114_AADJNV cole_d_Page_58.pro
eee34a812ded20c64611f4b8e0e9d5bd
011f4facd574dedbb5d705165500d3a70e8e8f6b
20452 F20110114_AADJIY cole_d_Page_47.pro
bf88b70a586694fa9040f157de6b12eb
0ab12a1221d250cfd3c8c922c046166be97fe895
112705 F20110114_AADJST cole_d_Page_36.jp2
521aa701a3daab65345722617438d315
b9203fce7f18c2dbc754a745b588efa282739a39
2034 F20110114_AADJXR cole_d_Page_32.txt
2acac6be2a51835e741b8fdd72062041
8037535c7cc3372f3863016ce695cc489a471e3b
23056 F20110114_AADJNW cole_d_Page_24.QC.jpg
dfe3e7bca273d91acef07364a1eb5f3f
52c28a0bf562ce46b70c6ebe0c814f79e6b44b69
6317 F20110114_AADJIZ cole_d_Page_41thm.jpg
491de9aa373335513320a6d98431dec0
b1de7e0ad62fede22eb2ca2c3422ef3984af20ab
1051980 F20110114_AADJSU cole_d_Page_39.jp2
238e7f740122f17d19a374860387ca0b
ca29b61eb1e733b6545ccd3deee651ec57d5e7c7
1811 F20110114_AADJXS cole_d_Page_35.txt
424cb81ec0a38083e1c75d91272f71ea
6b14050a1b6c21357add1eb243e858c9a38c011f
2670 F20110114_AADJNX cole_d_Page_69.txt
766660aabcecdc4cf037706614b0d031
d7eb61946415f8f0467a012ca3cbee2ddf737b4f
2006 F20110114_AADJXT cole_d_Page_36.txt
d592cd68db9cc6739ad7abee4c7e8c1e
106978718414b77eed49e165213b4abfdc2aecf0
52428 F20110114_AADJNY cole_d_Page_11.pro
5290457f1ef0f1ac1b68616119421293
71c6ab8a52fbd6b2545938a254d2740bf0b08160
106022 F20110114_AADJSV cole_d_Page_41.jp2
0e6a43dc19eb6bbcae534bc01dcca22e
6b9df99ac3022628da3c03734f299d27f1e10316
5171 F20110114_AADJLA cole_d_Page_64.QC.jpg
40187e46a9e319144ac65bea25a91d95
c1908da7cf831fd9aabf1354b5014cf5893588f5
2066 F20110114_AADJXU cole_d_Page_39.txt
ee2cf498fe3579b63458821bf201462a
6bead5832c6114be03d3340099ba8ee9322a4a7f
108050 F20110114_AADJSW cole_d_Page_43.jp2
b87d559bd1abfc666c3ae6d6911a5428
065bf2a26ae0e8fb49b01311d266c94cf2826800
F20110114_AADJLB cole_d_Page_10.tif
9d969f77b5fee358937b8f3672aa1896
5e62c06f6a933ef52c117b8c24731f4f2827db51
2147 F20110114_AADJNZ cole_d_Page_57.txt
908a235ded057c3bcbcc3311e3b23d08
e53cb78690736579b8fcacc01ba69fc7c639bf53
1916 F20110114_AADJXV cole_d_Page_41.txt
aad621491054fd6540637cab6f91104d
002502588009585356d6c1a8413a4123bc81f5ba
105326 F20110114_AADJSX cole_d_Page_46.jp2
d260a82e8ca844eb3fee6c100242d271
befb4638a290c562a9a18df6b872dbd891ffd20d
72081 F20110114_AADJLC cole_d_Page_27.jpg
26e67040d5cb6dc00f63713f663f3aa7
ad6a31e29a72f0e6e294c21d5b731606d9cc7335
3254 F20110114_AADJXW cole_d_Page_44.txt
68eb0bfa9299ea573ce59a49b08d8cae
b46571c2fb557909d8b8cfc040a904aa36fbe11a
18281 F20110114_AADJQA cole_d_Page_06.QC.jpg
5e0a8e497a097cdef111d6d757f7ce28
1a21e5dc5e6a33c44418a5590e391f328ca7579a
548686 F20110114_AADJSY cole_d_Page_47.jp2
22b002a579e26cafe39f57469dd7abc7
90ea4162768cc88775168b92b5b7c097c02ef4a8
F20110114_AADJLD cole_d_Page_46.tif
add2c7fbe05ef5f99ff4e5dc74ec56b3
c09017479cdb58cebf334db3191c544520d1886f
1994 F20110114_AADJXX cole_d_Page_45.txt
70c23c8106c9914a4e5d12137ef9db62
208cf6174dc08f24bbfd1cc7de2189d439837cbe
6688 F20110114_AADJQB cole_d_Page_28thm.jpg
bfaedee9ac25d40149c09842d588f962
cfffc7a2707b531cec70da4302e5d5cd1f8332a7
1051976 F20110114_AADJSZ cole_d_Page_49.jp2
bbbdec186db3aaaf1d73534ba2277791
bfb9d53b8ff6428973d46f97b4785666e3560f8c
101863 F20110114_AADJLE cole_d_Page_37.jp2
a11b06d66ba2538e5068062050a9ed1a
ea6031faaa3c7036ad4ab4cc79e72b564461e352
925 F20110114_AADJXY cole_d_Page_47.txt
6f3495eb653a77665c5c5161631f6bdf
f6d799a7fb5b6cba6120c61956bc6023fdc30d1b
18675 F20110114_AADJQC cole_d_Page_62.QC.jpg
4b0f9ce38acbb40df9359862906f918e
71a869e5a442703a607109bf7b68f331eae77d30
F20110114_AADJLF cole_d_Page_43.tif
15d4777003ee1b0b034a74407b8fb73d
5ad0f2b41697d3ecbb2eba906ba70842148bdd30
2022 F20110114_AADJXZ cole_d_Page_48.txt
0419bcf347556594b671c3e4eb795ca8
276acfd6df17628eabdab58cff515a379115113f
88518 F20110114_AADJQD UFE0007363_00001.mets FULL
29cfb8de206255b4c730147675aff83b
bc51fcd48ed08467f28203ac977231c1ca5f0e74
5911 F20110114_AADJLG cole_d_Page_09thm.jpg
5e6817961f8219dadb5af91aab3b91b5
74e86699e3e311fce75a5fd96cdbc4d88745c717
F20110114_AADJVA cole_d_Page_63.tif
f4f63d4c948fefb5848b4f19a55ea1d2
41f2facd8607785c16d4f004a8591f48d254465f
111763 F20110114_AADJLH cole_d_Page_19.jp2
a797ebbf30ee38ea235516377ed4cee0
50429e96c61fb46c44c65f9f1c488cce91473ea7
F20110114_AADJVB cole_d_Page_64.tif
7a0aa24902ba36cd20bedbab333ace66
9ee966ed5f301146c30f6824bfba275edebb164b
80537 F20110114_AADJLI cole_d_Page_51.jpg
d7b024067e53b6d50e69b86aa3d647dd
acf1b8c4a601198360d9564ead4409b818efd69c
F20110114_AADJVC cole_d_Page_66.tif
ebeddee867769f9714cd9ff90031b5ac
3ead801020958fc02c72185cbed7f42320a446d6
62273 F20110114_AADJQG cole_d_Page_06.jpg
29b5d148bda763975d90ee0f179b8653
89afdbd532d8b791bc44cd94efd560d1772d0955
60996 F20110114_AADJLJ cole_d_Page_62.jpg
95ab877bb5967da3f5a631f72bc3d6c6
38e6c551caa02067d96cc06298dbbdc870df06b3
F20110114_AADJVD cole_d_Page_67.tif
9a38d79fb85133001d406e0797120b10
6d50a0bbfb937b5812153ff1fc78766285d59f4d
31174 F20110114_AADJQH cole_d_Page_07.jpg
881f267fd0ed617358564fa6814647ef
af8a2477ac8e810fc05ed8c019f140551c57a20a
3031 F20110114_AADJLK cole_d_Page_04.txt
e96d9118465f5a37d929bd02533029ac
1b5d8857851f878532fda1839d897aae3d83c18b
F20110114_AADJVE cole_d_Page_68.tif
65154cc5ddcc9c45a205041460b66286
ba3e7a010d251efa4590e9c9e4933dfd210837b4
67036 F20110114_AADJQI cole_d_Page_08.jpg
f84ecc7d09cfec3f00e5109c7f86dfe8
ce7dcbbcc4f56ddb58e9255d2c8a6e5e6c94e124
2000 F20110114_AADJLL cole_d_Page_22.txt
ff521b972cb26229170d94bfc3ebf78a
51c12e690ce41c39e9e8ed5809dd2bb2009a096c
F20110114_AADJVF cole_d_Page_69.tif
d702e4c94e996332f6d8882c047af945
561755ae5177e9ab19203efcefcf6b1a45e587b3
65528 F20110114_AADJQJ cole_d_Page_09.jpg
f75d22ccc5e2e9ad9e23df913ffdf036
e31fcb9600e3af0b7287ea1e20d635e78edc4fd7
1550 F20110114_AADJLM cole_d_Page_15.txt
bdd4f70ccd06d0ccc21373e5d8520f31
d925d78fa8368321a7b7418d2c306b9a294f9d11
F20110114_AADJVG cole_d_Page_70.tif
4655a4e8b65690a278777846b99ec5c4
cb6505bb309bdb90363a5d2bdeb80f3ed5ac3426
58437 F20110114_AADJQK cole_d_Page_10.jpg
fae99aea642c00503470dea0d1f5f173
0bc89f81609a458ef382241764011d08698225d4
17433 F20110114_AADJLN cole_d_Page_05.QC.jpg
bf8fb699ca1c9cef9d1b24ef1dcb0aed
5e0879212a5a5cab1024430727e10eed9c683fb3
F20110114_AADJVH cole_d_Page_74.tif
e06ca1e41dded3dce7f24523b98cea70
a1fa335ab0c781c4ed3035b86daddc0695109a19
73985 F20110114_AADJQL cole_d_Page_11.jpg
a4df7c44e088123ce134d2234ad3edf0
b22e91ef4e1c18c994e8541650db9ef8856decce
9428 F20110114_AADJVI cole_d_Page_01.pro
7413a9ec15dd9c7a796bc72e833c1753
41d4c416ba930cec08b3657e9f8123aa8e6e1c9e
71967 F20110114_AADJQM cole_d_Page_12.jpg
326a321f0d43d87158f7889c08f40c71
a5a23844be19ca215866bd2b8bd7f1f8e5541298
1881 F20110114_AADJLO cole_d_Page_33.txt
601a50ea6057e7b52fa9c3bba5df260d
fcb31c208efecf65dce5350c28ec3975925ecacf
1250 F20110114_AADJVJ cole_d_Page_02.pro
f5a1e88381c1a1932e2e097b7ec7568d
21524fd343b8dae489a380efd92a9290f4d06e25
74467 F20110114_AADJQN cole_d_Page_13.jpg
b3ed12952a57b6922818846c12df0bef
80e6453ba76779cc0f0191a1ede0d72f884de021
109005 F20110114_AADJLP cole_d_Page_58.jp2
98d8fb116133a46a44832a446a2cd590
bb59f9442694b3f059d5397c12c71bb49f5ecbf6
72924 F20110114_AADJVK cole_d_Page_04.pro
26a395108f4c8b89c5d55ce37daebce8
8e700fdcecf864e3d16889d417eaffb99942139e
59283 F20110114_AADJQO cole_d_Page_14.jpg
0722164d0aac36692425048ce99d08a5
3d848ee75b693f3a575e6305cba74de4fa549ebb
1975 F20110114_AADJLQ cole_d_Page_17.txt
8b274e43db7047e190a86aab6e2d1e77
7c9470761b6163daeaa85a01c018398d1ea12f28
63696 F20110114_AADJVL cole_d_Page_05.pro
a310c6ab1d084103fb697cb9e562f8f5
465120c62b32d296e31b8a44c6c03b7d08b4b67f
70882 F20110114_AADJQP cole_d_Page_16.jpg
916d7c31d7ccae834ee874486bbc4791
115371a4ccf0c45dbf2c17e9d4dc32eae86e68f2
59653 F20110114_AADJLR cole_d_Page_03.jpg
54cb7f061b2c7139c64f9824f9f5bb84
ecea9738d7a760f58a5819194aba9375c0ce46b9
43909 F20110114_AADJVM cole_d_Page_08.pro
db88eeccc48deaecf60140561b89ec33
80ed807dbb325328c5d84b944f44eb482aefe071
72621 F20110114_AADJQQ cole_d_Page_17.jpg
a8f8f2b90c9d749205c6f5595cc38a8c
c5554338200388610b556a1a19eb70809633e0ba
3914 F20110114_AADJLS cole_d_Page_75thm.jpg
de1df18a595468c9086e4769255e1e9d
daa99024808c111099e7aca08a2b0e8b495ae4be
50412 F20110114_AADJVN cole_d_Page_12.pro
6655ad2d38067a97c78093bdab648a5f
ca9a559ce332114613b8b323601f43d1ece5267e
68971 F20110114_AADJQR cole_d_Page_18.jpg
1e0780517c92127a5f07e8ecde736dac
8348b197d0f485750499c8c3395c338981cd89d9
F20110114_AADJLT cole_d_Page_38.tif
9db31e85b9c78e8dfa44ee22d61e21e3
479310b022d52e57847e35c77c348c46b3389271
51308 F20110114_AADJVO cole_d_Page_13.pro
6a8959949833b507f86dc9c5f744626c
bbfae4ab8dc7f5be9efc51d631b015890e49daa1
73329 F20110114_AADJQS cole_d_Page_19.jpg
0060894ecd7c3f96691c339360265916
74418a5d36a36aca27a67cae93d7de1ca54ccfb6
24224 F20110114_AADJLU cole_d_Page_26.QC.jpg
ad10685735acc3a01443bd6f5ed1ab2c
0722a702e2c4a76df08684312cebf01d2e0610fa
35931 F20110114_AADJVP cole_d_Page_15.pro
d5a5b8316b5588037a5360099a316051
c13924465a0ebd654a75cf24aef4ea4b421414a0
23452 F20110114_AADJLV cole_d_Page_48.QC.jpg
903df2034bfa41f55de6e2a5179df527
ef2750d8d1d9757b2afbbf5695c0a2a577e0945b
49178 F20110114_AADJVQ cole_d_Page_16.pro
eaffe11e8c554f7a1d5c6bb12d9099cb
1d9faca1fb5cfc1a42db20d38f4429427514a306
73383 F20110114_AADJQT cole_d_Page_22.jpg
a6ff4b495e6b2484578988d68298df18
039de8dbcc3f9616a4e01cee54ae99e211d8bd62
2085 F20110114_AADJLW cole_d_Page_40.txt
ef2495fa53427718d129f4dece4dc322
6392849913a1689994f279c32d3bd21ea39a0938
49981 F20110114_AADJVR cole_d_Page_17.pro
2f9eea9181a1842ea01133e12dd65f14
a257d8e4f49855c210ca78eece8bad76abf83d63
71730 F20110114_AADJQU cole_d_Page_25.jpg
9c0acee1cb792c795728d512dfc17fe8
dd47d7dfc523144de129e6c381c5c9145ccef9d6
23257 F20110114_AADJLX cole_d_Page_55.QC.jpg
1f3cd99364612a0829ae90e89098adc9
96fe0ed3ddbe90a6ad8abb80aad0c22d965774fe
51877 F20110114_AADJVS cole_d_Page_19.pro
78e38aeb501e8bf151a8b4870e623d52
2fdaaa4a7b8d489b38284dce6f36235961c7a6bb
F20110114_AADJJA cole_d_Page_33thm.jpg
941b5c488ab20a88b27c3927fde4948c
635c816911423eb18264f72fecd9b6e16ff4ea63
F20110114_AADJLY cole_d_Page_75.tif
573a390e53dac256a3fb67b63d041a06
fb4724d17f303a3c14e60a8e0c118e1c0bb5e966
53561 F20110114_AADJVT cole_d_Page_23.pro
101118e3d7a8b39bd77113e145c52ae7
067f094a5f8908ca1c6c193f78df067e56ab7f52
73819 F20110114_AADJQV cole_d_Page_26.jpg
531aebbf38f1f4b86f2695fb69513f9a
100a43273e21db0d8ad86a35a31c55227ee564b7
23356 F20110114_AADJJB cole_d_Page_25.QC.jpg
a262fbe54bfc08c062fdd909f99a0cc6
be6d1628d6135ec45945fd04a6ef6ec4ead151d7
F20110114_AADJLZ cole_d_Page_30.tif
114921479490e4de41e10771eef379bb
f39d013439a50e060273d76034c2e820e988db48
49992 F20110114_AADJVU cole_d_Page_25.pro
bf958c280f2e07312be393c42c269e32
20763e89156a0757c0831c8664d9b5933a3d658c
25689 F20110114_AADJQW cole_d_Page_29.jpg
90c63b48657f82c17966e45b63e6762e
8a777c44cdb7f28598d09e505514ff21f061b71a
112565 F20110114_AADJJC cole_d_Page_50.jp2
e2b68b8bb333f3424768e01b2819c0b0
6e4308b382fe276424a322f76251f168b8813e41
50435 F20110114_AADJVV cole_d_Page_27.pro
3d6b384024330864fa92ab3607b69ea9
e4d79dbbd1076e622d6b2ccbd777febebac39f70
61039 F20110114_AADJQX cole_d_Page_30.jpg
35c98ed9cf2f1f1bc4a61fd02816cffa
fd5fd232fee69102859f6f726869371356dd0944
6656 F20110114_AADJJD cole_d_Page_71thm.jpg
cc5bbfb1261e7a15298c28151a7388f0
f1d61ec9c202de3cf3eee1f97d8a06408142939c
48768 F20110114_AADJVW cole_d_Page_28.pro
4b37e6ad191c432a7af8d17dd2a334b8
a4ffb884bcfb9d851a2d7258bab46d9c533617b1
1615 F20110114_AADJOA cole_d_Page_03.txt
5b75ff5eba658e30250e97c8144e9c50
6e2f248a7b08469e2075a72bf388d9d0e4928f3b
74216 F20110114_AADJQY cole_d_Page_32.jpg
7c63da7adbc00975809b01c8b3f8e94a
bfd1036a5da830a3555f2c7c05e5dd2e90afdf28
41070 F20110114_AADJJE cole_d_Page_39.pro
a1d03eff6543a088d5d12b49630d3175
3c64477aaa06285b66da32f4bc8594854396bfe2
13835 F20110114_AADJVX cole_d_Page_29.pro
f518b07ca8aa12395a51fb00f7d23b80
da854963a28511001f1b693de8069ed71d9c237e
1956 F20110114_AADJOB cole_d_Page_43.txt
c8d42f81fdd91015dc9a721623e29145
6c086ec5546cf864bf9a3b7b6c80b2afaa9c22fd
69334 F20110114_AADJQZ cole_d_Page_33.jpg
9298687ad47ed279b3207c07ac0a3ac0
b1a98e91161db4484ceeac07d6d7ef1ca582a0ac
22770 F20110114_AADJJF cole_d_Page_41.QC.jpg
f72c8525f67992b38d678bebea52e7ad
c00951f2c0682b767151c854f935996d88e4172e
108260 F20110114_AADJOC cole_d_Page_25.jp2
5b9a9593c43a1700057ca5fe49848d26
6aa15133639b84aeda3f3134ffc89a78abc782c6
46532 F20110114_AADJJG cole_d_Page_46.jpg
c9a1567ce5b290d2fc6c6f8233bfec7c
b4fd9998b0a41d01ed5b0fc301d3e03f8bd99e93
111541 F20110114_AADJTA cole_d_Page_53.jp2
101322e976334e49475475c050266880
37b83be50d38187f0b86c027230cc1ce790d36e2
39470 F20110114_AADJVY cole_d_Page_30.pro
94240abaeeb5e9904ac6bc98f5473de6
7dc7d60520be29187b7fffe743f12d82b75bb4fb
46635 F20110114_AADJOD cole_d_Page_60.jpg
270feb7b3c531fc64f26e09bcd6044a7
906fce67d028a5260cd39777a4a18d2dae6dc96e
F20110114_AADJJH cole_d_Page_65.tif
195988e981138809e8dd9abac4d2cf64
a8bbe5b31e25063480a0df4817c9b60e7e972c6b
108052 F20110114_AADJTB cole_d_Page_55.jp2
96a69c8c7558eba1c7ace42f234a787a
ca58f5591b577ad60c54e0f85dcaba5585a759cd
47204 F20110114_AADJVZ cole_d_Page_33.pro
3c8bafa63b48655f77087c701dfe45f9
b2a7994cd0ce90a7d14bde835e114eb5c9d4e9c1
6726 F20110114_AADJOE cole_d_Page_49thm.jpg
3e62edd2976dcae15e5637e989c52578
542b6208fbbe197b5a2c6666f50564289aae15a3
6667 F20110114_AADKAA cole_d_Page_19thm.jpg
0a8b4c07115110a1937664c1dfe8d086
d8198aefb462b7fa4244baf6fed0e8fd4dfab0de
97979 F20110114_AADJJI cole_d_Page_08.jp2
4605d4aa0396cc1a26aa0a0cd9d5661c
b37b7a21c04c565fae8bb9e482b89f425a4605ee
116135 F20110114_AADJTC cole_d_Page_57.jp2
f99eab41c4b896f510d06052ab71faca
fa5f620a796c4989c19eee2b9e3c13288bab45f7
54834 F20110114_AADJOF cole_d_Page_31.jpg
27f12bae83e43dff18913e8df9f41e60
15087aa0d8ec73a4e1db2f13577feb5fabdced54
6554 F20110114_AADKAB cole_d_Page_74thm.jpg
83cf20fe33eb5310561317008267fc63
c4d63d71b94d8e36cd9bb1b59a15ba09788407ab
2050 F20110114_AADJYA cole_d_Page_50.txt
5396259a6ee15e90bd93c3ad48f66223
beb5ff35316f41e73d29028d7dfa07b4c67a9c92
59940 F20110114_AADJTD cole_d_Page_60.jp2
4b82ee88d0d976f3f61caccaaf3141f9
e6fa979d35ab6f64a5f38a20d46c34153a06363d
6866 F20110114_AADJOG cole_d_Page_70thm.jpg
1e895c1a2fcb2358a9bfc3e630cae00f
5f85bb1c668bcaf52372f823b90b57b1681d15b1
108896 F20110114_AADJJJ cole_d_Page_16.jp2
ad829e1007b339e49e155f97c36a9cca
9c4d4e822806ab7015c4030df942055c7c76bb0f
F20110114_AADJYB cole_d_Page_51.txt
703f3e12a70dcb62613330aead6b9add
c07d1721bb5e3fae9158f752ccea9ff01bda3c0a
50228 F20110114_AADJTE cole_d_Page_61.jp2
8a05208ffc176cd68f8274bd46c85700
6d10827601e5aaa7cee518a908955b21619c9c33
74237 F20110114_AADJOH cole_d_Page_04.jpg
0d50bf73dea81410a7152cf4099f98c0
1a9aa43fc4fb47672a7c5c86a28502d82655f70b
77921 F20110114_AADJJK cole_d_Page_67.jpg
4f8ff10ca955cf149217d3fdf4d6c590
78aa1585cf6138e13b621b5f8e88d9dd60dd8289
5785 F20110114_AADKAC cole_d_Page_42thm.jpg
b461d2258081f4de553d86eaf5bc8d6a
0e23267436130eb07b6c4dcb2ea4e70cc4e46276
1953 F20110114_AADJYC cole_d_Page_52.txt
a871bd9db64b330f4ea597b78550379f
0a44af4e5d4fc204e6f1770d7f20adde5d4e9447
87788 F20110114_AADJTF cole_d_Page_62.jp2
bf9757816d6251efe2ef77261565c8e3
2f388fd5abf4082702f2a7ab1f2ed93ac0dcb5f9
69326 F20110114_AADJOI cole_d_Page_56.jpg
c46fc4cab628baa62511941799974964
b237926b765b378b5d6748b4ebfdbc1470e40413
F20110114_AADJJL cole_d_Page_28.tif
5f9164e60853a0633df7d96013f1daa9
a74222d9e63a2c79d46841e3ac21b82963c28f4f
6601 F20110114_AADKAD cole_d_Page_32thm.jpg
1d774308e307e706b8ddda59b04ded3b
8909abb146efc2726fb618b0bdf0f3301521c47f
2011 F20110114_AADJYD cole_d_Page_53.txt
607423d1d36a7814da070d818f970fcb
3d926d19e740e52a8f6eda16567bbedb94507e6b
15881 F20110114_AADJTG cole_d_Page_64.jp2
2d3b6ca53153987355667eab11c5f901
421aeeb0543872789eecd54f3e451cd932a94dee
8619 F20110114_AADJOJ cole_d_Page_29.QC.jpg
0e1a9b3353e48a0bdc365a830cceafdd
2223216e7276aa518d31f0aec34cc5a1d48de539
22279 F20110114_AADKAE cole_d_Page_67.QC.jpg
19aad1c74721a9c39e0db45fa2c4981d
94a43c4c1d246ca7ace8f8fcb4fcddb9bb271932
F20110114_AADJYE cole_d_Page_56.txt
fa2edf58e0512efc9bd67ff5a668ee21
ba97348d58e871d60d9d1c9b54716861e2fec27e
79932 F20110114_AADJTH cole_d_Page_65.jp2
e4a232e43a923320820a0a2d86a726d1
97f90b8dc9e8114e07125ba1f1043004d9fe6aa3
26074 F20110114_AADJOK cole_d_Page_69.QC.jpg
3be14375c0aeb427f8cef36ada13d692
f86abb92e2c0cc9d0f66ddc3035a60bd813b1b1c
6449 F20110114_AADJJM cole_d_Page_24thm.jpg
300d038f7751fe5b111561d230475a94
3563e0d44b2396dd967b862e90cb1f142c2e356d
5270 F20110114_AADKAF cole_d_Page_62thm.jpg
2ddc9d3012d792a7e6330309fca0290a
e9936e9116472f78f40730cc1e2adb63e22787a9
876 F20110114_AADJYF cole_d_Page_59.txt
6562620718e47e1691a05b4c2d89e1ef
ef933f2ef39cb9775e55803896a4f3310eba411f
25258 F20110114_AADJTI cole_d_Page_66.jp2
2558a1691e8f8638642518f576637068
ec9a71c1865b96998a39d69472496eca813a82ff
1885 F20110114_AADJOL cole_d_Page_49.txt
556938adc13ad670b2b844df61505d95
a2210a7fcde9c3f15e117b3da3b3140f9caa99fb
135799 F20110114_AADJJN cole_d_Page_69.jp2
6f54304b69728d5a5297a7a116648220
f506f28e2e3bb01bc0f9781f8995bbf1a549def7
24968 F20110114_AADKAG cole_d_Page_70.QC.jpg
93822bc176249e617f9b80850e22960f
0390ad0fb087fd54744a6d2a1c7188181c0969f6
1028 F20110114_AADJYG cole_d_Page_61.txt
6280603fc3a4aafbe9e66fea8d557b1c
02d3454ff92e2a8121b3c305d4595ae9eceabe13
110201 F20110114_AADJTJ cole_d_Page_67.jp2
6b5afc728539d7ab6df088011b7e9263
8998a6da379481fd54a8c2f47228f74c16f068f4
71645 F20110114_AADJOM cole_d_Page_45.jpg
4129c9d6f18572cee097ba67dc7af7bf
7234d6a4bfa8d63fc4d4e200544fed6cf959ee06
71186 F20110114_AADJJO cole_d_Page_24.jpg
be62667c970029836171bc96895eb8fb
1fbcee47d4146614deddc08e3862fef2c5fecd9b
27163 F20110114_AADKAH cole_d_Page_72.QC.jpg
1f86b55039cbf49e6400493bc56f5c16
5512052b200710db1dec2acaa205410b3be26d1d
992 F20110114_AADJYH cole_d_Page_66.txt
3edd3180c0c98301a2975223b6f592eb
596649e3ddca2b617cb593ea215ffc6b3da8187a
1051982 F20110114_AADJTK cole_d_Page_68.jp2
71cb2bd90184dc056cb785fdec236318
09c2e7bf3c006d72ee25d4e4cfd2b2ddc90e54a9
25444 F20110114_AADJON cole_d_Page_51.QC.jpg
e19fe6c2ec08a9afc91acde4a69fa0cd
12ae3352889bc2695eacfb34092713d7dd488e8c
6394 F20110114_AADJJP cole_d_Page_17thm.jpg
8bec932f9f93bafc0ff8c632ff93210e
b37b6c2e48306f264288e568006fb0db40258cf3
6759 F20110114_AADKAI cole_d_Page_26thm.jpg
211b297e391f6ad0d53b315888043272
beec17ae4a74bce4e0418c37f2372e8b1125262f
2146 F20110114_AADJYI cole_d_Page_67.txt
7d5d49b60467574e4a2725ee1cfd8c66
c7c351f3d7dde097b04b1bc03d6c3b3a20e027b3
125823 F20110114_AADJTL cole_d_Page_70.jp2
7cd515bf681dd2970a891b5a05444edb
31f93597cebec8f83b8dedf02b48a1a56a561601
50788 F20110114_AADJOO cole_d_Page_36.pro
1c1823890d73a5686df28bde1e6031ef
6e740b7d46b84ab76e2681615dbf0fc50574e1c7
F20110114_AADJJQ cole_d_Page_03.tif
e0598c5492cc703250ffbc5d997d21ee
c0381f6fd7cc10a160ffbc84e54ba5dc93c0e4ba
11858 F20110114_AADKAJ cole_d_Page_47.QC.jpg
eae3c3f89df5be19e6a54352adaeeb96
17f996304fd1e46cec095a0cbf3cb617648515c8
2325 F20110114_AADJYJ cole_d_Page_68.txt
d2b56d46014fd367c3e6f71d90a496a0
385a8900f1423bea57eaf772f2338d0352b80dee
114474 F20110114_AADJTM cole_d_Page_71.jp2
5c2dd5d5222adca38914386fe5d18b12
bd65ec4af67585adf720d349471f316f380dc961
1990 F20110114_AADJOP cole_d_Page_55.txt
3457b813c51d4b289002ab84e6bec9a9
ab561d7caa45f93351f07c91f703167b88d3d3d9
110895 F20110114_AADJJR cole_d_Page_45.jp2
0f058f7ffe35ff70bfe63071c1d6f5e0
ae2d27469e53f5749b963a905199acda057a4d88
23212 F20110114_AADKAK cole_d_Page_58.QC.jpg
e5371c93b3e0c5b747a5e5ef2d4d7b58
07c3695f8774aad798cf9603c309107a0e38c3a5
2201 F20110114_AADJYK cole_d_Page_71.txt
3a0358315a2daea20a14b8aa7c7a8b2f
1c3c1114ca368750a97bf4e4f03d841deb263e83
137496 F20110114_AADJTN cole_d_Page_72.jp2
c87d3a13e874377d1168673064dd7263
9e11952233978d57b8543fe12d621d57ad654627
1137 F20110114_AADJOQ cole_d_Page_75.txt
63ad019102f1c0b821ad916b1d4de5d4
01a11716fc8260ac15662d1f33922012089b4f14
61864 F20110114_AADJJS cole_d_Page_73.pro
f9f1b40666f2262a19d2af3596e422d4
1a215cd5c480dd06d48758ffa694fe7b0f83c295
6429 F20110114_AADKAL cole_d_Page_52thm.jpg
e8a87d46af1e5d757bc71deec9911e32
abdae017da663bb7fc65c9c5e148b8d9a370b7d6
2501 F20110114_AADJYL cole_d_Page_73.txt
6ce413bf4474ac370bfebe3ec84e6434
761a0121cab6546f3c1028c5a5790081e5ee2cc3
125510 F20110114_AADJTO cole_d_Page_74.jp2
9c31241b5b7da334c44ed9bfdf8119bf
de481e8d6f1af5896c2fa64eb92170f1a1441a7f
72082 F20110114_AADJJT cole_d_Page_28.jpg
a6ab07d460d4682e52ffefbb8eaa356c
e1fff73f6ce37d07e5ccf251f1f1b258e1862ad7
17275 F20110114_AADKAM cole_d_Page_65.QC.jpg
b4e3fcce2d1140e3cd4365560a2233a1
548f1197dc61b5f2707dfda20878e17c9a9d8644
2435 F20110114_AADJYM cole_d_Page_74.txt
e61dcfe33a0a84ee4b8aeb0755181ff6
f1c07663cc4c1645146d91e6e9876075ced9c388
F20110114_AADJTP cole_d_Page_01.tif
5cfabf8a83e7f7a315c4a0950b9ce1fa
4adeb40fc1ef2f42454b0ea2d54e59a755401faa
1724 F20110114_AADJOR cole_d_Page_62.txt
b6f10bb5b563c6d3068547ac77f44a49
419c74f3d2fd75e47178ed3dd5e575018e33dd21
36230 F20110114_AADJJU cole_d_Page_44.jpg
0b9a13f6b30d647f507559725ff8e234
2eb569d5c826e035befdfcf92266f2b68e1c4cbf
4959 F20110114_AADKAN cole_d_Page_04thm.jpg
c35d434f84c860fc3ca671396fd0d080
ca53ac6912e2a330ff696753c63482e3765f210c
470 F20110114_AADJYN cole_d_Page_76.txt
049e83d234fff3caabaff1df20894439
19aa7fe295a2f1cf591bd1e8d58e9d726164e6f5
F20110114_AADJTQ cole_d_Page_04.tif
f55e9ce49ab14e5b7ec8fcb8c662db9e
89eb3b798087857c12c36ed31d59d57af3bbc76c
48596 F20110114_AADJOS cole_d_Page_24.pro
4c8bbb91c2b022b4e8f169f3a94e9a2d
f3874230687c88d629c1f1519c12311e0e6a9337
1814 F20110114_AADJJV cole_d_Page_37.txt
806731fa373588b226f607a291de66d8
12f6f401cf763f993ab768ce1c8e4722aca51982
114367 F20110114_AADKAO UFE0007363_00001.xml
fbd5cfd5637743791cc1fd6b1e952759
51fdbfda99334356c7c1a96d83c4e0024ff1ec5a
1728743 F20110114_AADJYO cole_d.pdf
aa29193e9c092e688afd8839d98735d4
a5c3726414fcacace705a0d7f558454bc0e5d6af
F20110114_AADJTR cole_d_Page_05.tif
43b7b5b4f4096def17d893809c874915
6365c21e1667b652332d6a0bce15e98d5651e4e8
35998 F20110114_AADJOT cole_d_Page_59.jpg
e59bd3cdbd0494e8cedce93d645ff78a
b764b284cbb6e3a44b618cc73fddd85f29c84a62
20854 F20110114_AADJJW cole_d_Page_08.QC.jpg
be54e9d7c29296c761c954a8e7299ba6
2354de12f4c1c1464f339a6f6b808de17c383bf4
7595 F20110114_AADKAP cole_d_Page_01.QC.jpg
f8f58e4dd9d3bc741124ebaddc4da158
45f51e46de2b0e1b59a5da4ee23c6e01594f918a
4576 F20110114_AADJYP cole_d_Page_31thm.jpg
1942de5495e19fa3923bc7298206e603
dcac9776bdc50fbca1c2f5cbf5120825284fc0e7
24641 F20110114_AADJOU cole_d_Page_74.QC.jpg
9b17aac868a2c5d58f639ade6a718f50
b440a7aef4efc5169e34726c55fbf303f5a336c8
6692 F20110114_AADJJX cole_d_Page_13thm.jpg
a01c58862710e4298a7f95ac6906196e
4bd7586c7a4e5f72db81289c40cbf60751ac7342
F20110114_AADJTS cole_d_Page_07.tif
c072327bc70386818615e839288abaa0
b58cbc6888edcefffd516a192850ac01ba7babab
3345 F20110114_AADKAQ cole_d_Page_02.QC.jpg
d2dcb0c750f6ff64574dcb20ebcbc524
8d93ceb61c183c8c255419dc77b3efea1c5700e4
4532 F20110114_AADJYQ cole_d_Page_63thm.jpg
2f2dc162351e77f05ba8b0e99ef0e3c8
cd7a09ea91b0213e2dafbe34451b64e510292087
6441 F20110114_AADJOV cole_d_Page_40thm.jpg
f28950cb642e933a838cc352971b905f
bd8720001ebf60e4f5645a48fdf2859ab244af57
1669 F20110114_AADJJY cole_d_Page_14.txt
7a94373d289a08d4604b51aa80a1348d
6962ebec507b0a21855b4511066f811840d0cc15
F20110114_AADJTT cole_d_Page_09.tif
3a3f5665ca47ce2e0091d133a9d4ef82
d6fcf38072df40a2a857077f5333ec7663103bd7
19656 F20110114_AADKAR cole_d_Page_03.QC.jpg
ce8d6d3aa55ee775183dc6c6dbcad151
173d5fe4118fdcf2c8876eb63f9ca11f20c1b413
11424 F20110114_AADJYR cole_d_Page_44.QC.jpg
8d00252e81fa6b8b6779316ea69218c7
044f477ff22b0be6f4f779ee6e390a610ea1bb65
F20110114_AADJOW cole_d_Page_37.tif
d475211605c1fbbef5a6a361c9c830ab
e2db0b25b95aa187d7c497ab445fbcef00c02154
6579 F20110114_AADJJZ cole_d_Page_55thm.jpg
5f103c266e3450abbbe1087093edb3ab
77919372cd5bea44d44f86be14cece549a3cfcf0
F20110114_AADJTU cole_d_Page_11.tif
f17247c27ecfb17817cc73103f13f627
e8f8d151fe3c662b06beac02123e624f29061f93
4742 F20110114_AADKAS cole_d_Page_05thm.jpg
fd2b87b11a26b645c753f8605726a5b6
95c7b22e698f313b2a952b9e52dfe701cf6492b8
25190 F20110114_AADJYS cole_d_Page_73.QC.jpg
2ceb3886e9d76abed8e73bf64be238c7
621e7e665005ac28dec6dc572b6577e2061a81dc
19047 F20110114_AADJOX cole_d_Page_04.QC.jpg
2db34ce8ba2c64ba0d1cb9363f900dff
f34edc28dfb94a817f1812d5588e79f4c9d58d59
F20110114_AADJTV cole_d_Page_12.tif
96afafdf62696b876b60a3a0fb2376a8
bf1409b7e2161ac7f4a26ee9d7eae387cd3cb48c
9869 F20110114_AADKAT cole_d_Page_07.QC.jpg
b6ea20c4a361e9f77de911c1e2940303
857f60668614858a2cbdb7ceb410b13d500623ee
6025 F20110114_AADJYT cole_d_Page_67thm.jpg
41ce14172de1e7c508850547cc18a21f
38ae4ef430078cfcdcf969a4d205ed7a4a7d068f
932832 F20110114_AADJMA cole_d_Page_42.jp2
59357d0768dd1dcc327eda4d0574e216
833a92b5177709f13ac32212e9aec0354825c937
44611 F20110114_AADJOY cole_d_Page_09.pro
6c78a0d9f473f2735bfc6b181ae5483f
27cdb7cdba6052aeffaf7e5afd38dae6bddeb3e8
5996 F20110114_AADKAU cole_d_Page_08thm.jpg
b9c0df9dcaea773d71a5be4f90d0b58b
61426e257e59eb8ec1694da74ec202a79e1e6b7b
2450 F20110114_AADJYU cole_d_Page_01thm.jpg
9b515ffa4c22a9aac7976350f3a87292
99fe38ab4a7b9db2d9dad002cded449f27143c20
15955 F20110114_AADJMB cole_d_Page_31.pro
918d1a1bea4ff9c931fd387d27a5dc48
2434526be831e33cf185a524187829bcf4075d5c
314 F20110114_AADJOZ cole_d_Page_64.txt
fdda48dddf5c23854814fbbb03bc9c6e
93a0d332c028e03a7dfc309d45246fbb897abec7
F20110114_AADJTW cole_d_Page_13.tif
d944167e4c240736f4edc894d32b0ecf
23612f61df5b88154f0535b4c995ec87da3e7c1e
21435 F20110114_AADKAV cole_d_Page_09.QC.jpg
3f3f493ffe3d34faaa11e0e65eb177fc
4ad6c9c7f52c4b6f99bdc0fd831489b501ed9658
5362 F20110114_AADJYV cole_d_Page_14thm.jpg
82005f337171adf7bc61bce2f12dd8c5
4689a0ae1f4dfa2be21251a7f41c8aea1eb7ffa8
22944 F20110114_AADJMC cole_d_Page_52.QC.jpg
7003f14aea0cdc16437e020736fc1db2
551af72717effa387f8f6bd52c430e39955e1c16
F20110114_AADJTX cole_d_Page_14.tif
b60bcbf4755c88ffbaf95daedfa472db
f60f88ef6ff89be97d9dbb4bc6e5ab0a0882ff9c
19160 F20110114_AADKAW cole_d_Page_10.QC.jpg
db7a38495b07cb8a4ac55e2529350c2c
722cc827983d23d9ed14ba67987c92196ed26e6d
23947 F20110114_AADJYW cole_d_Page_36.QC.jpg
5dda7aa7f03adc9b6341a3f78cef8aaa
c44db61682e6ef73834c9b5c0bd34d7bfb98f561
F20110114_AADJMD cole_d_Page_27.tif
7b174405f8f0457fddbef85cbb74d42b
45c89cfd34ed73a10713bf24f594ac43484e3780
73196 F20110114_AADJRA cole_d_Page_34.jpg
14ea3fac96fcfb7825139c5f5ea2125e
b7462a542f9e3cb2247b1603c1c275ca18d0a30a
F20110114_AADJTY cole_d_Page_15.tif
7dfd85ec2032ef23612e282f7e5070d2
59b5405d955fd1dc72ea596d4bf6b6c3c99daf63
5489 F20110114_AADKAX cole_d_Page_10thm.jpg
2e552ebb53aded64edeefed7d6b9faca
dcd907f73d273485cd1f8819190643e2ffdd5116
23395 F20110114_AADJYX cole_d_Page_27.QC.jpg
ca866bf1f9182218d3b2587ac3b6ea36
0eb5b6d68d05bc7bfa0a228351c3f4183cf84322
65903 F20110114_AADJME cole_d_Page_63.jp2
7ee866446b2cc318b63e4c1072d6db15
05b5242ffbbbac507687027a2b84520aa7e308bd
3354 F20110114_AADJHH cole_d_Page_61thm.jpg
a33db25385914fc3add305d24440c7cb
46f59e00b39ede5b5bc396fa4b275f4ad970da6a
67357 F20110114_AADJRB cole_d_Page_35.jpg
aac63218851710f76cd9d599b9409d2c
f2b0cda625f1640c7eb20272f6ed0f45abd85e72
F20110114_AADJTZ cole_d_Page_16.tif
1e06915016e5685779852dcdffd38087
2e7d6be97c7dd72f6fc17c2ebc07010f043e67cb
24230 F20110114_AADKAY cole_d_Page_11.QC.jpg
5ce5f018e78687c18ee112949435d5d5
dd283322346c862bee8ce3ca9fd2529c10915b7c
13864 F20110114_AADJYY cole_d_Page_46.QC.jpg
8c195b330ead3e468bc9a42abc4b5309
6ab0fd3885122d9fbb75b14f300d211da180303f
66526 F20110114_AADJHI cole_d_Page_37.jpg
ab19fc943c1f1c4288b7d6e0ac3b7ea7
a0abebc90d7cc744c4ef1ea01a470c2bdcc4d48e
64366 F20110114_AADJRC cole_d_Page_38.jpg
4ab5eaf4a7585cdc82ee7db135d32dc5
582a5a1270c34ed0545db0e48c2eed83218fb810
17354 F20110114_AADJMF cole_d_Page_66.pro
ccb85743b445d1f126e2f2e28c0639ce
c4b7f1d2d6f0cd15e02bcc8af0b2e4c596a2bf57
6535 F20110114_AADKAZ cole_d_Page_11thm.jpg
989c20777db76878f9c541250d9bdb1f
665f06e3510779e06f245bd7ac45566921f450cd
20281 F20110114_AADJYZ cole_d_Page_30.QC.jpg
0c7164fa961fbf1b9430dfa520f63ef7
a2605148dc723d05d492a286fbc21fdb77ed9a19
48249 F20110114_AADJWA cole_d_Page_40.pro
625168a4d81c4bed9563b0763e770aba
44c3f043a3bc6a3324f5fc6a67788d0ebd0fcb74
1863 F20110114_AADJHJ cole_d_Page_64thm.jpg
a658b26655b566844f26aa584c66d659
97143671586c02ec6e238b8a9446359e50feba31
67848 F20110114_AADJRD cole_d_Page_39.jpg
5496f4f0ffcbdce330fdb9a5c2ef4c13
b19b09ea70a1dfbb3069680aefd182de9e439d21
F20110114_AADJMG cole_d_Page_48thm.jpg
ce8c0112675d969ff81cbd840a8b7d7d
6b14279fa309da0f3d1f0aa02c13aeda1f5e5e3d
47819 F20110114_AADJWB cole_d_Page_41.pro
6e717e1a8726af6ff9ddcc4e8877f2c4
b12ef89bd7fa985a50a59f21882287ec5f780996
70141 F20110114_AADJRE cole_d_Page_40.jpg
873f46956cb623c18c682ea11fe25094
9e797fadd4ee7aae8c4bb8c2e592399dc3c075fa
13539 F20110114_AADJMH cole_d_Page_75.QC.jpg
a525b782899cf0ee9533467bc242f453
ed0ceaee076bf23fd6b6161f5ef60cff78eed506
53700 F20110114_AADJWC cole_d_Page_42.pro
bd6a0f232cd25a25052bc45fce31f140
f19d0258472c976d72a106eaaaac3e1bf1ba6ed0
F20110114_AADJHK cole_d_Page_19.txt
ee5c90784fba48537e5f5afcd47d8b4e
e4f6985b4138d0058bd95410c6a1c8c79548df38
69230 F20110114_AADJRF cole_d_Page_41.jpg
7d9d88ea4c1f38103039e22f1a6209ab
99e8c5b5bbc57e88fe73ec5f15cad3466116eb89
108434 F20110114_AADJMI cole_d_Page_52.jp2
eed2539c7cb571053f8fdcbd9440da4a
d6f3ea6af60a56be91826c02e858060500953eb2
49596 F20110114_AADJWD cole_d_Page_43.pro
e9d343493342abab707279eccd9d9774
4e4bdd8f51608caa560b15ec428bbac7c8fc9bc8
109308 F20110114_AADJHL cole_d_Page_48.jp2
92f6528ccdacf33050d0a75a94c7ac19
b05c59ff9223ad9dd768d7a150d54bec2f0d4c0c
69688 F20110114_AADJRG cole_d_Page_42.jpg
55e1bcb712b0d31e183362e307397a45
266da5a78acf4fe398d1592856fe96b37faa838f
2597 F20110114_AADJMJ cole_d_Page_65.txt
5ec3a35cff224bb7edf8d023b2684cdf
de5ed4429151ea777b3d48c015e8b53838d74037
55397 F20110114_AADJWE cole_d_Page_44.pro
05d137a10abbb7e261d3dffce91769be
aabab414e263d5ae5acd78868d8a6c28156be8f2
40718 F20110114_AADJHM cole_d_Page_47.jpg
30996dee8790a6ff88694a992d815eb1
b9c63fd75b2e0e4998226e1dfd7eaa20d0092f44
70519 F20110114_AADJRH cole_d_Page_43.jpg
5c556b143457b8d8a7ee4453ded9bd92
b6c89c4495618eb2ae504ff09f3b9016392e65dc
F20110114_AADJMK cole_d_Page_22thm.jpg
4baca1fc7bdacd88b1518b42059f2e00
78343e00256f26a5ba78b65dc4b6c25f857b75b8
50551 F20110114_AADJWF cole_d_Page_45.pro
9516583172b87b4c5f6e173d274840e9
b7bfe0add93329a94a0b4b73f5982e033f53f2ef
21896 F20110114_AADJHN cole_d_Page_59.pro
3e5721dbd8679b387ecd2724216e9d27
ccfdd98a892c3fd141d34459dc5636e99125c1cb
71680 F20110114_AADJRI cole_d_Page_48.jpg
85c5bd8a731d0ad9559060308eb82210
94a987e44cd7e63750c4c1325e474db077e267eb
87057 F20110114_AADJML cole_d_Page_10.jp2
987eca8e0660a56badc2cef8943c2b37
4037f96e19bb4005323c819168b030d34b35473b
50150 F20110114_AADJWG cole_d_Page_48.pro
90d9048a3156930e32f6c749e4f7f3ed
3024babe3da47b65c217ed2a8a9bbeb9c7e00aeb
49798 F20110114_AADJHO cole_d_Page_34.pro
a7bc2095436f7e9b06510eb6ac5e4d3c
9a3012af028dfeca3891e893f71f7e86dc477f86
74201 F20110114_AADJRJ cole_d_Page_50.jpg
d038400f931db8c5c1fe6e1478259309
043e5928e56fbc1c22816b8daa93e31441e879a8
27925 F20110114_AADJMM cole_d_Page_75.pro
3fa3dedfb44f588daf0c97b4ce9de5b7
608133ea3950cad89f756216c53a54c53eefa431
47847 F20110114_AADJWH cole_d_Page_49.pro
d47a48c3af89724719b372301da7088e
3bf25dd760eec9077d18164afc9b2fb74e519564
F20110114_AADJHP cole_d_Page_58.tif
e1b6a367aaa5e312d1c8672893a6a38c
a8db7a460c4c599d822ada03f0caf924dd431cc0
70775 F20110114_AADJRK cole_d_Page_52.jpg
b376ce093c68ae49d3fc0b52f21310ce
fddfcf40caaac4e3b2d4e83d1997437f74e443b9
F20110114_AADJMN cole_d_Page_76.tif
f15f87926178cdd8be5271a6f9347405
b16e402eef0e3ab2a09ed31e9c569549741a7ff9
50998 F20110114_AADJWI cole_d_Page_51.pro
85a6f18cf0ed875ebaeb132a79afaad2
7129aa34fe0075417c95b85856f776f1f0feca89
3844 F20110114_AADJHQ cole_d_Page_46thm.jpg
7862b119e541c3f3de66d12dfa5f7377
9b9232e3bb6a56181065ab809ee39874f7b6e1ef
73541 F20110114_AADJRL cole_d_Page_53.jpg
c6628099dad3cd1df4d05efe2e63d800
b54556058b18028186f54fd76444b97db354307f
2732 F20110114_AADJMO cole_d_Page_72.txt
5d67c48d421bf75163bbd1b61ceb6811
5ee0c822a58268b5ba4034e7c6fc8507d38e062c
49359 F20110114_AADJWJ cole_d_Page_52.pro
b0b04e14f4347d4fdc8ec18ed5133c72
8274d43844383022a319a53dd4e6acb4084f4173
F20110114_AADJHR cole_d_Page_72.tif
9942324240043631f2299fc22c677b6c
7473138f122fad87d7252bb560876d6a8a3a1954
72397 F20110114_AADJRM cole_d_Page_54.jpg
3ee5aee91d27bc06f922b5aebaf6e8cd
0525cd3c4075c0cc37356f5e6b02f526d603db2a
51132 F20110114_AADJWK cole_d_Page_53.pro
7d6a9893adbd2a8bfaf4befe8d829437
2fca892bed1c897ea4bf6973423cd263b3da5fae
7112 F20110114_AADJHS cole_d_Page_51thm.jpg
8315598921609c0bf3ea0bbde42cb52f
b9a14e01fd24eceffe23ebe32e95fbe4389d957e
76100 F20110114_AADJRN cole_d_Page_57.jpg
77cf4d51ec8ebb9affb705ffd934ff97
8d0a6c6ea594a53f021c02ddca1c36968ba1ea04
1985 F20110114_AADJMP cole_d_Page_27.txt
1bcd6cd98b9c5adfb7bc669b2e9171a6
0ab4fdfe0508564cbea46c25ffad5648e5eb9a95
51169 F20110114_AADJWL cole_d_Page_54.pro
0006c3508bbca75238ea7e3ad7419692
ce41ad1cceaa67856c2b0f318b4ac8926c88f4d6
68120 F20110114_AADJHT cole_d_Page_20.jpg
a7d8b646384bfc754136d6c60f90ab15
94ea2fca2fdba4b70cf9e880b34873b036a908cf
71179 F20110114_AADJRO cole_d_Page_58.jpg
9aba8301f5dd7bf650d22867d5de6083
575589d5c2c859a93ecf99967d49a09d6bd73474
109872 F20110114_AADJMQ cole_d_Page_54.jp2
9b60c2da6108c3e429acf7516b779c80
8f7252c7ee9553c5e8d3f2a5ea296c13c58df442
49809 F20110114_AADJWM cole_d_Page_55.pro
f9a4faedc4e770e421958219500e3d5d
6a0e4c04d10ae81744bcbc354a4b840d0a831572
51689 F20110114_AADJHU cole_d_Page_26.pro
8d4634bef0e7e120a3eee449a48c4aba
85ebcd47d086254091761207e2b3a64b19e5259f
38822 F20110114_AADJRP cole_d_Page_61.jpg
c4b1a100f9e83ea7b6cac087c96e2ddd
2b0c89464a9b93f51f478b6c7da974873ac0f4ba
75209 F20110114_AADJMR cole_d_Page_23.jpg
ad4e5884e479e160d04f37d64a4fc075
46eb5c4ce537e1316b44cd8c52477adab3c8c63d
49175 F20110114_AADJWN cole_d_Page_56.pro
0a1cfc0a4a351858fcffd6de0a2b9493
2a80a72c62f7b701493dc436278ea5ab0678032e
F20110114_AADJHV cole_d_Page_07.pro
cbd6f9c4297d00867922fb368b1dcdc0
b7eb147fab0ec5fb49f32f6fe479b76761e54308
47601 F20110114_AADJRQ cole_d_Page_63.jpg
b045a4e4857c835736febba42285a14a
22dcdcfb8778d3aa4aea6b10285e92bcccd9ff10
60087 F20110114_AADJMS cole_d_Page_70.pro
1b50e3076005dfa1493b446841a0ec79
93ed4e578644e84c8bb136c5c2b3356de68baf55
6620 F20110114_AADJHW cole_d_Page_43thm.jpg
717f26de7be872cd4c894fa2ece284c5
9479d719e21874004fb8ac277fa0db933f302913
16815 F20110114_AADJRR cole_d_Page_64.jpg
516c1009b20748a915a1265024baf3ef
865705ea6414f7598c8f8671dec6fc50799573b6
2139 F20110114_AADJMT cole_d_Page_34.txt
32cb67acd0351e54afa10a7405d64a18
369fe0482b94070982a8442d996ae5e9be30dd04
54156 F20110114_AADJWO cole_d_Page_57.pro
f9682536ee2cebee409b30d0f960f96c
475cb6e5334d31be9805d4a487ad55c462641a6d
F20110114_AADJHX cole_d_Page_20.tif
26845ad8637e2fec908726bda0aba1d3
0dc6bb45183fbfe3d67e8c39876279764eb3e0c2
93282 F20110114_AADJRS cole_d_Page_68.jpg
426716d3df546473003c948301574911
55a5394f8f8cafcc0c8de05ee4a4ec2f4e00082b
69923 F20110114_AADJMU cole_d_Page_05.jpg
19415f40845d9e7ca72e1f12fae345c3
f0d5c14edb2ab2eaef36653c659027bbe947b1f4
35597 F20110114_AADJWP cole_d_Page_60.pro
f9c4825030ac67fe046cc7b67d4ee0c1
0eba7a555e3fadc1602b01d7a1aa3f2b81880859
50587 F20110114_AADJHY cole_d_Page_22.pro
bbb68c44147adee71305c1a622897c45
bd9ae60c5f52d1d528bcde97c710ccc4af26fe53
75997 F20110114_AADJRT cole_d_Page_71.jpg
a0d35ab566c375968291372f1d96464b
399d6fdb7e6464a528bb2bd0b4ed8c5849dafadb
83582 F20110114_AADJMV cole_d_Page_44.jp2
404647b0029bf2b577ce0b6ef0116a7c
507a6438c0520e25465ce2be9b0da92ae0711084
29743 F20110114_AADJWQ cole_d_Page_63.pro
9cede22276befa65aaf74ee2d3afdb5d
fc976720627076cab5d46fe10235532bc9d9c453
F20110114_AADJHZ cole_d_Page_19.tif
d8189537f23b88f95b15ab25347ad281
1be1905af9db87fd231c30ff5b538daee2666a19
F20110114_AADJMW cole_d_Page_16.txt
8cc3b8e0177d5db8cff988dabcdc2b84
584c885cfc2c7ed2011b400b117b017ac75f739b
5795 F20110114_AADJWR cole_d_Page_64.pro
071fc5f670de4a5ab957a72116e7bea4
832572951037006aeb7c9f418177d65e2f277c7b
85004 F20110114_AADJRU cole_d_Page_73.jpg
3eb12a8131ed417e227b5d21f697f16f
8a6e802d25cba684c2ac280e2e54688fc6dc6161
15285 F20110114_AADJMX cole_d_Page_63.QC.jpg
d169d8efb77f68ccccad0ea88a26442b
47d53c0dc76a9522f235f5cc481c5ca4985ce9ad
56943 F20110114_AADJWS cole_d_Page_65.pro
41c8af9e7fda8dc16d35ee9e00c6cab1
56a705196148cbc0488f90e7ba98f552b5441f27
52851 F20110114_AADJWT cole_d_Page_67.pro
1ecbec02d27c35d6cd695da2242e77d5
7839c6cc40474e09abe1bcb80bdbfa94759a9bf4
43545 F20110114_AADJRV cole_d_Page_75.jpg
f5ccccd1430c04658d5ea9d3e316b761
dd8261223cf78e73bca888f36be8eddb44ba920d
6823 F20110114_AADJKA cole_d_Page_50thm.jpg
7b89ddce255a8a6ddc79394ae2c0fde0
11ab0b979ee081de12564068212217ebe66bdad0
1051902 F20110114_AADJMY cole_d_Page_51.jp2
1c536fb23c65730a106e0b64bf0b185e
d62fd48d7dfb1f458fb33aeb7e6a51789eb84ed3
57326 F20110114_AADJWU cole_d_Page_68.pro
40e0a0e1be66009024d5cc91f297ade5
9a2ee44ce81a2011b0277e37e68508dc93545026
22934 F20110114_AADJRW cole_d_Page_76.jpg
f19180d53560102d120baedad3b30fa1
4e7c1b9c1a26c015e6325b4449336478172f2dda
23276 F20110114_AADJKB cole_d_Page_15.QC.jpg
a2fd47fb02067c4a2337607ee6e194a5
5420f7b845f47aae3e5454121247b1f2b151298b
F20110114_AADJMZ cole_d_Page_40.tif
1ffa7d95d4957cd7fab0ed0dfb244855
12ee0ab671fc7dd5b0e0cc50ce48b3ae0978f7e8
66095 F20110114_AADJWV cole_d_Page_69.pro
bb67c8a7aee353b3468957d43e4c82f6
e4e79f86c402c8a021bc79269b092bee0fb5585d
27245 F20110114_AADJRX cole_d_Page_01.jp2
14ad9122d40a2367baf0de82abf05b71
08dda65e3b64363d5b47fa23db457add736878c5
F20110114_AADJKC cole_d_Page_06.tif
8c2bc7d727c1f99c34b3c243cfc15eb5
eb65a150d9be0694ef79ad4aea9fd477303872f4
67589 F20110114_AADJWW cole_d_Page_72.pro
ad0aa658a95f0112e273378f977e2937
646c06b60227df19a151bfa9618a6f987eb1884f
24512 F20110114_AADJPA cole_d_Page_19.QC.jpg
83174cd3258a5dde3837c77a23564137
be332cfe4043097448d1defae1884cde4ffffd30
5908 F20110114_AADJRY cole_d_Page_02.jp2
a8b80eced4f40c02352f0ac7e7e61303
67f405e0133a4d2c9c52d3ee15f9470364e657c1
6340 F20110114_AADJKD cole_d_Page_25thm.jpg
af8d2c376a6bda6d63700ff41920f184
b63556f60ed1a2d83118e0637f6ccc9951370a0a
59888 F20110114_AADJWX cole_d_Page_74.pro
baa9457ecc38949702e1754e1aa94762
b7898deb4e2f336ec3cb0c2d56b2042f0779bfa8
87456 F20110114_AADJRZ cole_d_Page_03.jp2
afe170f4cfad2546252c0dacdd067418
82015d0f05e88188b94601b1c34d7826179801d7
F20110114_AADJKE cole_d_Page_02.tif
1954112938e324b79c77f5a5651facfc
fc84aa11574e1d69afe22ba678cc58781b93f90e
112923 F20110114_AADJPB cole_d_Page_13.jp2
8adb2bac69ad336378046e083e8c1fcb
d6cc47e08371505e7878dbec67c52259d19da60d
10603 F20110114_AADJWY cole_d_Page_76.pro
90f35b960384d0ace856bfeeb9ab1353
c42f0eefe1e8a37c75cf3f41544fa893aea31855
70888 F20110114_AADJKF cole_d_Page_55.jpg
e3da5ff065168a9d3504492c2f99ce4d
500dff33f7d2ac10ff9dbaece8b8f20afb0b6b2c
2649 F20110114_AADJPC cole_d_Page_29thm.jpg
fc824ac36184fbdb07e2d648e70d4d8b
5a68025952cc0a7878470faa40a09ddf29c6a060
39701 F20110114_AADJKG cole_d_Page_03.pro
d32a107e2e913b97cd55c08d3b4b7061
caa5af2b525c6bed22f3ae8aa89b007430b08dda
F20110114_AADJUA cole_d_Page_17.tif
72317c7f80c5976d14f943dc521a6067
5579511b2aa02c97f3e13850baa919b58c1aa61b
2260 F20110114_AADJPD cole_d_Page_46.txt
02f5dbcc06dfcc627cda168c3cea7ca9
c07741523988d077ce0176dd6dad2fae82cd6725
491 F20110114_AADJWZ cole_d_Page_01.txt
a38c291f635e378307b20de47b2647eb
49dc610f36110326d4819728011649fce8ba2137
F20110114_AADJKH cole_d_Page_71.tif
bfce5eac1f13c0d517ec9bcf5891a769
6e20baff65c151f837bd666578c314b3ac9b43a0
F20110114_AADJUB cole_d_Page_18.tif
8c2ddd9560d76779a88b847fabd0921b
945c3ad19cf35fa3894a1a15c811955017483f93
23280 F20110114_AADJPE cole_d_Page_16.QC.jpg
fdf1ee7a0901c0722eb3a9b310ad1087
708c7565092d904f61b3cff821b4bc8a17b4be25
23519 F20110114_AADKBA cole_d_Page_12.QC.jpg
34a1e49474d760272fe3e4cbb67ef302
50a1ab1f3cc64c4287bd65aaf24fd46512019d55
88388 F20110114_AADJKI cole_d_Page_70.jpg
0bbd125b8f1de515867da9499648c1c4
f2039919158804adfd01b07b5448d8c89a36074c
F20110114_AADJUC cole_d_Page_21.tif
f83312ede6890985befe823711003fbc
a285dff134291fe91fbd991b3dee5afc2b7e941d
F20110114_AADJPF cole_d_Page_57.tif
84087b3039e3b5e1a8d4aeb75a8b9427
e946f96c8a4639a3fbbf7d46a9b4557149e53cc2
6567 F20110114_AADKBB cole_d_Page_12thm.jpg
2d8295b937d1976f63bd10a140d15e36
24f72919fd76e684b85b76e99f5aca075226d941
2907 F20110114_AADJZA cole_d_Page_07thm.jpg
4d40efcec16788295f83cc80294f7f6c
6aab602c375a8d7946a14906f182750f26f827a9
F20110114_AADJKJ cole_d_Page_08.tif
9964f6a69a1ca87e29f15d5f8d905226
05fc2b1e1886bb217d08b5252361b5b434aa2728
F20110114_AADJUD cole_d_Page_22.tif
b1664589986cbbbaff17c97c4d05448c
81e5cb8a3155c9532da84acf19cf7a629c1a1209
51393 F20110114_AADJPG cole_d_Page_32.pro
f3f36d3e27338d958dd53bd687280bc6
53e095e46eea2ab7fc6d1cc5af5b825ef7d92436
19063 F20110114_AADKBC cole_d_Page_14.QC.jpg
d249c3d391c982d01a55c1ea503ee3e5
e98d466cc93f3402b6f4b5a2700c99e0de257b13
11702 F20110114_AADJZB cole_d_Page_59.QC.jpg
8d8990cb2c96026480e29dc013478dd4
4701f2c535013d1340627205a5740f48d7272736
2039 F20110114_AADJKK cole_d_Page_60.txt
70b9cb9d2f3df94f5d25eb37f56c04ae
b75b841d21ad76f1eec5b290ea5287cfef2ae386
F20110114_AADJUE cole_d_Page_23.tif
c20fc081ef718a82f7161f5dee4e49b4
92a91e9149fc95df986be8ba16c03a90a70aca3f
47292 F20110114_AADJPH cole_d_Page_20.pro
c294eca66c834560525fe8ff72e8eb43
9c3fa9f271da8ddb5a49f793336663d37285ca45
24183 F20110114_AADJZC cole_d_Page_49.QC.jpg
c1d3dfd82ecb4b1ff60dec76cd7a2f5a
83f46ce90568f9966afa0163ee7724f0267bdbf4
114772 F20110114_AADJKL cole_d_Page_23.jp2
e23b166d918dba9003b233a79aa972b0
b3bbdd2fe5ddb5d3d65324bfcd858a98801e6ca3
F20110114_AADJUF cole_d_Page_24.tif
32e8ca11d0ce774d08ebeae18aaf3889
e32a116a294ae73b1378bd5f8d08c56071d37447
6595 F20110114_AADJPI cole_d_Page_73thm.jpg
722e8f74f3769b3b88165e15cc7046a5
02412f732bec1db36e8e13f3e453e41018f7265c
6193 F20110114_AADKBD cole_d_Page_15thm.jpg
dd7c568a705b6d2dd020eb00c4216dac
3857d3084f45a188c5eaac4137e828b4ccad1ee7
6475 F20110114_AADJZD cole_d_Page_58thm.jpg
b0012b133070061807afcef26f4e8974
fbcd1f78aac80ea223e61c1cf5c5333b9f99d00c
23906 F20110114_AADJKM cole_d_Page_22.QC.jpg
a474e1cbc555dd8df54c124e06c7b7f5
5270b59bb9023ba485f05c8c85eeef7c0d9d26ed
F20110114_AADJUG cole_d_Page_25.tif
63527c5a6eeed19da2d3b0c22f01ca8a
182bc887747162bd06fbd7c475ee8a103ce8e3f9
23362 F20110114_AADJPJ cole_d_Page_34.QC.jpg
a24d0d00dbb1dabaa8ab52f9674f1fb1
db26054883b505cba0863e497beb59930db04353
6395 F20110114_AADKBE cole_d_Page_16thm.jpg
fb96908f41c8eeb6711b12fcf0b71a80
593a8412da396818cea66cd627881c53cd388f88
5857 F20110114_AADJZE cole_d_Page_38thm.jpg
2fc44e9df78c22098e600dd297619c9b
6c98c3a533d4ce7ff149c2c0e4030087214122a8
F20110114_AADJUH cole_d_Page_26.tif
2ea4121b7caea65845c9ff89b3d4dd8c
e3e4bbbbf042f5909cca8319a6fc4121d65538fe
3483 F20110114_AADJPK cole_d_Page_47thm.jpg
b15d552759b61ae5e8852f35a92acd4e
994cb0dcf080447741bd3fde3f8e3f26545eb1cf
23826 F20110114_AADKBF cole_d_Page_17.QC.jpg
c0d3cd57efbb9fd4c827edf813052286
acd3f7964a2005dce3601e9097230c517a8295a7
23217 F20110114_AADJZF cole_d_Page_71.QC.jpg
7e3f79f3ec09ff2f3511c937df8d51c2
3c96c1a4b0c4f7a454b5648de2b0cc589e7d1cf8
21843 F20110114_AADJKN cole_d_Page_66.jpg
b935bc231a80823e7bd5f2c76e22dcd0
b9de29cfd6030363782e0822bde8a38772f9a408
F20110114_AADJUI cole_d_Page_32.tif
dd7f60f428e683271c3ea8d847383737
0773d2adea65ba25ca0b541951db7cfd847c2fad
62193 F20110114_AADJPL cole_d_Page_75.jp2
70999f810572fc34e501c17905995aec
beda9fef1ec4fd873f954f47635498a604672cc4
23002 F20110114_AADKBG cole_d_Page_18.QC.jpg
add470e6bf50d6dcef416a83bc6a36c1
2c922103565f5dee8fb9031e2964eb02dff3ef30
6686 F20110114_AADJZG cole_d_Page_53thm.jpg
ce1bbbbb4d11bf90aad2c03c8b70cea1
cf493bafb5e0c55c150788fa71612e5e518caf32
2427 F20110114_AADJKO cole_d_Page_70.txt
fd4060e4f9786b10a252951b53a4c474
d7115fadfbf8cc34b79d48dee92b077349413aef
F20110114_AADJUJ cole_d_Page_33.tif
4dd97ef65c67e5650084222e934f9560
9c83677f3b996f4511ac7968c06603b7394390a7
77573 F20110114_AADJPM cole_d_Page_49.jpg
1b369ccb4948f409af90915d8cab02d8
b9cd6353ed203d3b94c590fce3ccfeb13eae9a13
6294 F20110114_AADKBH cole_d_Page_20thm.jpg
5baa39eba02a54ed3602f88a5db7cee6
fd0082c23ae89843a41c57ec8b0482864705426d
23238 F20110114_AADJZH cole_d_Page_56.QC.jpg
ca46e92d7e560fa1048d02784fca9200
c400cd8c7ff267d8171ae9e69f0913138aa03b7f
F20110114_AADJKP cole_d_Page_42.tif
7162e4077dec2e74fd0f3877dd1d81a2
3c54d72518c6683da1b1b9fa760b4bd67cc1bb50
F20110114_AADJUK cole_d_Page_34.tif
599ee35c0b86278ba35f354ccf0d9903
b8794632fbfe83dda2310dc3e46021a8ea7ef91c
21056 F20110114_AADJPN cole_d_Page_39.QC.jpg
7380c3a06f6cd045c5a2ffb25f12116d
59315f20b417c6670636a49e18c2db9745fdf8c9
25030 F20110114_AADKBI cole_d_Page_23.QC.jpg
90f1da029eb30cbbd4146ecbdbf09163
c45866404658db00ed42dd7b7ce62c28be87e58c
3541 F20110114_AADJZI cole_d_Page_44thm.jpg
e090f4321d8a8941b27dd8dd55e1afc8
b97f948212f3e92c75b8c7d77ac69f7b45b59f4f
81419 F20110114_AADJKQ cole_d_Page_74.jpg
9518284bb97904c61301aa33497f7853
171a02a4b7146e32100a11460ff8f0519d25eb63
F20110114_AADJUL cole_d_Page_35.tif
4c763a87f5530e0f4d60059de32d4c9c
c2bcf7b3eb2478336a42e3727afa1d06eeeea40e
6544 F20110114_AADJPO cole_d_Page_45thm.jpg
27f9ec09ef1d5a6ea191bca33efbc00a
68d179fd4e04a5669414696dcf080bcadb76321d
6478 F20110114_AADKBJ cole_d_Page_27thm.jpg
216077c68b0f680491d15968feea76bc
2e25e88b3a881587f3dd6e89aaab1f7e97801acb
5492 F20110114_AADJZJ cole_d_Page_03thm.jpg
accde8b57d5c4bfbe8bb3848ac43d247
07ed94598c0d346248ca0661deff6cdd6a3e1061
45179 F20110114_AADJKR cole_d_Page_35.pro
890a20813479664f33d0439dc7531072
42b054eb9292505da9b0d3d2a17d69f48538aae8
F20110114_AADJUM cole_d_Page_41.tif
464a7ed382e0c75034713a37d4aebeae
1303b2335926ed61df0e045f397ac08567e7c5b5
F20110114_AADJPP cole_d_Page_31.tif
601ace187cbbd26830b3e64aa8140b4d
74bcfb5a862101f9924b93e0bab80170e2fc0424


Permanent Link: http://ufdc.ufl.edu/UFE0007363/00001

Material Information

Title: Genetic Diversity and Population Structure of Peach Palm (Bactris gasipaes Kunth) in Agroforestry Systems of the Peruvian Amazon
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0007363:00001

Permanent Link: http://ufdc.ufl.edu/UFE0007363/00001

Material Information

Title: Genetic Diversity and Population Structure of Peach Palm (Bactris gasipaes Kunth) in Agroforestry Systems of the Peruvian Amazon
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0007363:00001


This item has the following downloads:


Full Text












GENETIC DIVERSITY AND POPULATION STRUCTURE OF
PEACH PALM (Bactris gasipaes Kunth) IN AGROFORESTRY
SYSTEMS OF THE PERUVIAN AMAZON















By

DAVID MICHAEL COLE


A THESIS PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE

UNIVERSITY OF FLORIDA


2004

































Copyright 2004

by

David Michael Cole















ACKNOWLEDGMENTS

My thesis committee, co-chaired by P.K.R. Nair and Tim White with Rongling Wu,

are acknowledged for both financial assistance during my two years in Gainesville (full-

time assistantship with the School of Forest Resources/IFAS) as well as for priming my

understanding of the fundamentals of population genetics. Funding for field research

during the fall semester of 2003 was provided by the University of Florida's Center for

Latin American Studies, Tropical Conservation and Development Program. In addition,

generous research grants from both the International Palm Society and the South Florida

Palm Society were used to offset expenses accrued during the laboratory portion of the

investigation. Pam and Doug Soltis, along with their lab manager Matt Gitzendanner, are

to be thanked for providing lab facilities and for their invaluable assistance with

mysterious bio-chemical recipes.

Special thanks go to Jonathan Cornelius with the World Agroforestry Centre in

Lima Peru, for his help in securing the initial permits needed to collect genetic material;

to Italo Cardama Vasquez and Sixto Iman with the Instituto Nacional de Investigaci6n

Agraria in Iquitos Peru, for providing the use of their cold storage facilities and

coordinating collection of germplasm from their collection; and to the staff at the

Biodiversity office of Instituto Nacional de Recursos Naturales in Lima Peru, for

hastening their authorization process for a gringo who had run short on time.
















TABLE OF CONTENTS

page

A C K N O W L E D G M E N T S ................................................................................................. iii

LIST OF TABLES ....................................................... ............ .. ............ vi

LIST OF FIGURE S ......... ..................................... ........... vii

A B STR A C T ..................... ................................... ........... ................. viii

CHAPTER

1 IN T R O D U C T IO N ............................................................................. .....................

Vulnerability of Genetic Diversity in Peach Palm Agroforestry Systems .................2
Genetic Forces Preserving Diversity within Peach Palm Populations .....................4
M ain O objectives of Study ............................................................................. ..... .4

2 REV IEW OF TH E LITERA TU RE .......................................................... .............5

D om estication Process in Peach Palm .................................. ..................................... 5
Molecular Analyses of Bactris gasipaes Landraces.....................................7
Farm er Selection of Tree Seed .................................. .....................................9
Bora Sw idden-Fallow A groforestry ........................................ ........ ............... 10
M etapopulation Dynamics ............. ....... ... .. ...... ...... ............... 11
Artificial Selection within the Metapopulation ............................................13
Reduced Gene Flow within the M etapopulation............. ................................. 13
Pollen-Based Gene Flow within the Metapopulation.................................13
Migration within the Metapopulation...... ....................... ............14
Population Turnover within the Metapopulation ....................................15
Overlapping Generations and Remnant Trees within the Metapopulation .........17
M icrosatellite M olecular M arkers .................... .............................. 19
The Mechanics of PCR and Microsatellite Markers................................................19

3 M ATERIALS AND M ETHOD S ........................................ ......................... 21

Populations and Sam pling ................................................ .............................. 21
Inform al Farm er Surveys.......................................................... ............... 23
Collection and Extraction of DNA ....................................... ...............24
M icrosatellite M arker Genetic Analysis................................ ....................... 24









M icrosatellite Loci for Bactris gasipaes .................................. ..................24
P C R A m plification ............................................... ........................... .............. 2 5
D N A Sequencing ............................................................... .. ...... 26
Statistical A n aly ses........... ................................................ .......... ..... .... .... 2 7

4 RESULTS AND DISCU SSION ........................................... .......................... 29

Farmers' Seed Selection, Sourcing and Management of Palms.............................29
M molecular M arker R results ..................... .. ........................... ............... .....32
Genetic Diversity and Hardy-Weinberg Equilibrium........................................32
Genetic Differentiation ........... .. ......... ........ ............... 34
Isolation-by-D instance ................................................... ..................... .... 36
Discussion ................... ............. ..........................39
Seed Migration within a Metapopulation .....................................................39
Population Structuring and Genetic Differentiation .......................................41
Maintenance of Remnant Trees on the Indigenous Farms .............. ...............42
Comparing Genetic Diversity and Heterozygosity Estimates.............................45
G general D discussion ............. ................. ................... .. ............ 46
Conclusion ................. .............................. ... ............. 47
Epilogue: Participatory Domestication of Peach Palm in Peru ..............................48

APPENDIX

A EXACT ORIGINS OF POPULATIONS ANALYZED........................ ...............51

B DNA EXTRACTION PROTOCOL................................................................ 53

S to c k S o lu tio n s ..................................................................................................... 5 4

C PAIRWISE GENETIC DIFFERENTIATION AMONG POPULATIONS AND
TESTS OF SIGNIFICANCE WITH BONFERRONI CORRECTIONS...................56

LIST OF REFEREN CES ........ ......................................................... ............... 58

B IO G R A PH IC A L SK E TCH ..................................................................... ..................67
















v
















LIST OF TABLES


Table page

3-1 Microsatellite primer pairs used for population genetic analysis of peach palm .....25

4-1 Average age of peach palms sampled from colonist and indigenous
m etapopulations .................... .... .............................. ...... .......... ........ . .. 1

4-2 Microsatellite diversity and heterozygote deficiency in colonist and indigenous
peach palm metapopulations; landraces sampled from El Dorado collection
included for com prison ................................................. .............................. 33

4-3 Weighted allele frequencies at individual loci for colonist and indigenous
m etapopulation study areas. ..... ........................... ......................................35

4-4 Unbiased estimates of Wright F-statistics for colonist/indigenous
metapopulations; landrace populations sampled from El Dorado collection
included for com prison ................................................. .............................. 37

A-i Exact origins of the 221 colonist (Tamshiyacu-Tahuayo) samples .........................51

A-2 Exact origins of the 165 indigenous (Yahuasyacu-Ampiyacu) samples.................. 51

A-3 Exact origins of the 8 populations from 5 landraces sampled from El Dorado
co llectio n ............................................................................. 52

C-1 Pairwise genetic differentiation within colonist metapopulation...........................56

C-2 Pairwise genetic differentiation within indigenous metapopulation.....................56

C-3 Pairwise genetic differentiation of eight populations of five peach palm landraces
sam pled from El D orado collection .............................................. ............... 57
















LIST OF FIGURES

Figure page

2-1. Approximate distribution ofBactris gasipaes landraces in the lowland
N e o tro p ic s .......................................................... ................ .. 6

3-1. Relative locations of two study areas, metapopulations (communities) and farms
sa m p le d ....................................................................... 2 2

4-1. Seed sourcing for peach palms sampled from the colonist and indigenous
m etapopulations. ......................................................................30

4-2. Testing for an isolation-by-distance relationship among farms within each of
the two metapopulations and among populations analyzed from the El Dorado
collection ................................................................................38










Abstract of Thesis Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Master of Science

GENETIC DIVERSITY AND POPULATION STRUCTURE OF
PEACH PALM (Bactris gasipaes Kunth) IN AGROFORESTRY
SYSTEMS OF THE PERUVIAN AMAZON

By

David Michael Cole

December 2004

Chair: P.K.R. Nair
Cochair: Timothy L. White
Major Department: School of Forest Resources and Conservation

Peach palm (Bactris gasipaes Kunth) is an important component in Peruvian

agroforestry systems, and is cultivated for its fruit and 'heart of palm.' Based on

observations of farming practices in the Peruvian Amazon, the genetic diversity of peach

palm appears to be vulnerable to farmer selection, inbreeding and founder effects in

traditional swidden-fallow agroforestry systems.

This study used microsatellite molecular markers to assess the genetic diversity and

population structure of peach palm in the agroforestry systems of eight riverine

communities in northeastern Peru, comprising two study areas 160 km apart (four

colonist and four indigenous communities per study area). In addition, an analysis of a

peach palm germplasm collection of diverse geographical origin provided a basis of

comparison for estimates of genetic variability and population structuring.

Farmers were surveyed on their seed selection practices for peach palm in swidden-

fallow agroforestry systems. An average of only four maternal parent palms were

reported to have been selected to provide seed for the establishment of the swiddens and

fallows sampled in both study areas. However, seeds of peach palm obtained from









different regions have recently been migrating into populations in the two study areas at

contrasting rates. A metapopulation approach was used to describe migration within and

among regions, implying a hierarchical structure of gene flow which could maintain

relative levels of genetic diversity in peach palm over time- offsetting founder effects

and strong phenotypic selection observed in traditional agroforestry systems.

Seed migration was occurring over larger distances and at a higher frequency in the

indigenous metapopulation, and a proportionally greater number of alleles were found

(with respect to the colonist metapopulation). The indigenous farmers were also

preserving remnant peach palms through successive swidden generations, which may

contribute to the maintenance of alleles within the metapopulation by reducing founder

effects. Population differentiation was reduced in the indigenous study area with respect

to both the colonist metapopulation and the comparison sampling from the peach palm

germplasm collection. In general, all groups of populations sampled had relatively

limited genetic structure, which is believed to result from the inter- and intra-regional

exchange of seeds over long periods of time. Pollen flow, over distances greater than

expected, has probably played a role in reducing population differentiation as well. The

facilitation of long distant seed migration among populations in the recent past is

believed to have attributed to levels of neutral microsatellite diversity observed at

present; thus, the preservation of evolutionary processes which actively create and

maintain general levels of genetic diversity on-farm seems warranted.














CHAPTER 1
INTRODUCTION

Bactris gasipaes Kunth (syn. Guilielma gasipaes Kunth), also known as peach

palm, is well adapted to the nutrient-poor acid soils of the Neotropics. This fully

domesticated palm reaches heights of over 20 m at maturity, and is cultivated as an

upper-story component in agroforestry systems for its starchy, nutritious fruit (Clement

1989). The fruit is consumed after cooking, or processed into a variety of products

depending on variations in texture, flavor, oil and starch content of the fruit mesocarp.

Processed products include fermented beverages, flour for infant formula and baked

goods, cooking oil and animal feed (Clement et al. 2004b). The palm is also managed in

high-density plantations for its meristem, or 'heart of palm,' which was a profitable

international export for both Costa Rica and Ecuador in the recent past (Mora-Urpi and

Echeverria 1999), but which is now suffering from over-production (C.R. Clement,

March 2003, personal communication).

Profits from the sale of peach palm fruit in subsistence-based markets make it one

of the most valuable crops currently grown in the Peruvian Amazon (Weber et al. 1997,

Labarta and Weber 1998). Bactris gasipaes was listed as the number-one priority tree

species for agroforestry research and development in the Peruvian Amazon during the

late 1990s based on farmer-preference surveys conducted by the International Centre for

Research in Agroforestry (Sotelo-Montes and Weber 1997).









Vulnerability of Genetic Diversity in Peach Palm Agroforestry Systems

Biodiversity is defined as the sum total of all biotic variation, including all flora

and fauna species from the scale of an ecosystem down to that of individual genes and

alleles (Purvis and Hector 2000). Genetic diversity within a species is thus at the lowest

hierarchy of biodiversity- which enhances, not diminishes, its importance. Without

genetic diversity, a plant population loses its ability to adapt to its environment and

evolve with changing climates or cultural systems. Such concerns are vitally important

for a multipurpose tree like peach palm.

It has been estimated that Bactris gasipaes has been in the process of domestication

for the past 10,000 years (Clement 1988, 1992). Based on observations of farmer

practices in the Peruvian Amazon, the genetic diversity of peach palm appears to be

vulnerable to farmer selection and founder effects in traditional swidden-fallow

agroforestry systems. Swidden-fallow agroforestry, or shifting agriculture, has been the

main mode of peach palm cultivation in post-contact Amazonia (Patifio 1963). These

agroforestry systems contain spatial, genetic and cultural factors that have the potential to

diminish the palm's diversity and alter its genetic architecture (Clement 1988). Over

time, the combined forces of genetic drift, selection and inbreeding in the context of

domestication decrease genetic diversity in those traits being selected and increase

divergence among populations if selection is differential.

The reproductive biology of Bactris gasipaes is an important factor when

considering its population genetic distribution, as pollen gene flow is believed to be

limited and local. Anthesis of male and female flowers is not normally synchronous

within a given palm, thus selfing occurs very rarely (Listabarth 1996). The principal

pollinators of Bactris gasipaes in the Peruvian Amazon, beetles of the genus Phyllotrox









(Curculionidae) and Epurea (Nitidulidae), have a flight range believed to be only 150 to

200 m between palms (Mora-Urpi and Solis 1980, Mora-Urpi 1982, Listabarth 1996),

and the pollen has a relatively short viability period of 1 to 2 days (Miranda and Clement

1990). A molecular marker investigation using progeny arrays within a completely

genotyped isolated population is currently underway, which will help to determine a

more accurate pollen-dispersal distance for this species (C.R. Clement, June 2004,

personal communication). Patterns of seed dispersal produced by forest wildlife (e.g.

avian predators in the Psittacidae family) have not been investigated, but the dispersal

distance is thought to be limited.

If the scattered isolation of peach palm populations in the forest inhibits pollen-

mediated gene flow, the relatively small size of the swidden-fallow clearings (1 to 3

hectares on average) would also limit the breeding population sizes of this allogamous

palm (Clement 1988). When preparing to plant a new swidden, farmers tend to choose

seed for the next generation of palms from a small selection of preferred individuals from

a base population that is limited in number to begin with. Few farmers realized that

genetic quality might decline through repeated selection of only the best trees (Weber et

al. 1997). Thus, a loss of within-population heterozygosity is expected to occur with

each founding event (Nei et al. 1975, Maruyama and Fuerst 1985), with particular impact

on the elimination of rare recessive alleles and those not favored by selection. Since

there is a high likelihood that half or full sibs will be planted together in groups (Clement

1988), in subsequent generations inbreeding or sib-mating occurs; increasing the

frequency of homozygous genotypes at the expense of the heterozygous genotypes which

can lead to inbreeding depression (Hartl 2000).









Genetic Forces Preserving Diversity within Peach Palm Populations

Farmers sometimes collect seed from palms on neighboring farms, and select

desirable palm fruits in the local markets to obtain seed for planting (Weber et al. 1997).

This results in migration of genetic material among neighboring or even distant

populations, and may counteract genetic drift, selection and inbreeding, which work to

reduce genetic variation within populations and increase divergence among them. Thus,

migration could produce sufficient gene flow to restore relative levels of genetic

diversity, through a process that resembles interaction within a metapopulation- loosely

defined as a population of interacting subpopulations (Hanski 1999). This phenomenon

was discussed by Louette (2000) in terms of the management of Mexican maize (Zea

mays spp. mays) landraces. Recent genetic analysis of peach palm growing in the

Yurimaguas region of Peru found moderate to high levels of genetic diversity with low

population differentiation, lending support to the theory that seed exchange is countering

the genetic divergence and fixation of populations (Adin et al. 2004).

Main Objectives of Study

We do not know to what extent farmer seed selection, seed sourcing and

management of agroforestry systems in general lead to a reduction or maintenance of

genetic diversity in peach palm; yet, this knowledge is fundamental in any effort to

preserve crop genetic resources in situ. This study employs microsatellite molecular

markers to examine the genetic diversity and population structuring of peach palm

cultivated in swidden-fallow agroforestry systems of the northeastern Peruvian Amazon.

An exploration of the interplay between farmer seed selection and seed migration

(interaction within and among metapopulations) was the underlying thread of this

investigation, which compared the agroforestry management practices of two study areas.














CHAPTER 2
REVIEW OF THE LITERATURE

Domestication Process in Peach Palm

It has been estimated that Bactris gasipaes has been in the process of domestication

for the past 10,000 years (Clement 1988, 1992). The species has historically been

cultivated from central Bolivia to northeastern Honduras and from the mouth of the

Amazon River to the Pacific coast of Ecuador and Columbia (Mora-Urpi and Clement

1988). The analysis of Rodrigues et al. (2004a) suggested two migration routes out of a

possible source area in southwestern Amazonia where the purported wild progenitor

Bactris gasipaes var. chichagu is found (Henderson 2000). The first route is to the

northeast, in the direction of eastern Amazonia; the second is to the northwest, in the

direction of western Amazonia, eventually crossing the Andes to reach Central America.

The lack of consistent preferences driving traditional in situ breeding for fruit and stem

characteristics, coupled with extensive germplasm exchanges (seed migration), has

served to maintain a wide range of variation in Bactris gasipaes (Clement 1988).

Mora-Urpi and Clement (1988) have morphologically characterized and mapped a

complex landrace pattern divided into oriental and occidental subcomplexes, based

principally on vegetative differences as well as a 3-tier hierarchy to discriminate

landraces by the weight of their fruit:

Microcarpa: 10 to 30 g per fruit
Mesocarpa: 30 to 70 g per fruit
Macrocarpa: 70 to 250 g per fruit









Rodrigues et al. (2004a) further clarified these landrace classifications with molecular

genetic analyses (2-1).


10





















Figure 2-1. Approximate distribution of Bactris gasipaes landraces in the lowland
Neotropics (light shading indicates general distribution of species). A)
Microcarpa landraces 4. Tembe, 5. Jurua, 6. Para. B) Mesocarpa landraces -
1. Rama, 2. Utilis, 3. Cauca, 7. Pampa Hermosa, 8. Tigre, 9. Pastaza, 10.
Inirida. C) Macrocarpa landraces 11. Putumayo, 12. Vaupes.
Source: Rodrigues D.P. 2001. Analise das morfo-racas primitivas de pupunha
(Bactris gasipaes Kunth) mantidas no banco ativo de germoplasma de
pupunha com marcadores moleculares RAPDs. Master's Thesis, Universidade
de Brasilia, Brasilia.

The size and starchiness of the fruit reflect the degree of modification that occurred

during the course of domestication of Bactris gasipaes from its wild progenitor, B.

gasipaes var. chichagu (Clement 1988, Rodrigues et al. 2004a). Macrocarpa fruits are

extremely starchy and dry, which helps to account for their large increase in size relative

to the smaller, oilier fruits ofmicrocarpa Bactris gasipaes and B. gasipaes var. chichagu

(Clement 1992). Other expected attributes of domestication found in macrocarpa include

an increased pulp-to-fruit ratio (97% in macrocarpa vs. 85% in microcarpa), increased









bunch weight (8 kg in macrocarpa vs. 3 kg in microcarpa), an increased fruit to bunch

ratio (95% in macrocarpa vs. 90% in microcarpa) and an increased frequency of spineless

leaves and trunks (Clement and Mora-Urpi 1988a).

These modifications in Bactris gasipaes illustrate that a repetitive, continual

process of artificial selection (domestication) has the capacity to extend the phenotypic

extremes occurring in a plant well beyond the range of variation found in its natural

progenitors (Hartl 2000). At the same time a general loss of heterozygosity, and the

associated genetic variation often occurs during the domestication of any species as a

direct result of selecting for these phenotypic extremes (Doebley 1989). A reduction in

the frequencies of those alleles not favored by selection should only occur at loci

affecting selected traits (Hartl 2000).

Molecular Analyses of Bactris gasipaes Landraces

The first molecular analysis ofBactris gasipaes on any significant scale used

isozymes (Clement 1995). Isozyme analyses observe allelic variation at isozyme loci

using electrophoretic techniques (Weeden and Wendel 1989). The bands in the gels

represent the protein products of specific alleles, usually at loci involved in intermediary

metabolism (Newberry and Ford-Lloyd 1997). Clement (1995) analyzed 270 plants from

nine progenies of the Putumayo 'macrocarpa' landrace variety, sampled from the

germplasm collection of Instituto Nacional de Pesquisas da Amaz6nia (INPA) in Manaus,

Brazil (established as a result of the 1983-84 USAID expeditions, which collected seed of

Bactris gasipaes from farms throughout the geographical range of the palm). He found

an extremely low mean heterozygosity and moderate to high inbreeding coefficients,

evidently due to recent selection for spinelessness in the palm. He then went on to infer









that the experimental collection sampled was established using a limited genetic base to

begin with (Clement 1995).

In 1997, Clement et al. examined isozyme variation in three spineless populations

of Bactris gasipaes (361 plants) maintained in INPA's germplasm collection, and

identified the apical meristem of a lateral shoot for optimal extraction of enzymes (and

subsequently, DNA). The low mean heterozygosity in the results obtained was attributed

to the management history (apparent inbreeding) of the germplasm, prior to its collection

in the experimental population sampled (Clement et al. 1997).

The first molecular analysis of DNA from Bactris gasipaes was carried out in 2001

by Sousa et al. using RAPD (Random Amplified Polymorphic DNA) markers, followed

by an AFLP (Amplified Fragment Length Polymorphism) marker analysis by Clement et

al. in 2002. RAPD and AFLP techniques use arbitrary primers with PCR (polymerase

chain reaction), resulting in DNA fragments that are then separated on agarose gels.

Genetic diversity in RAPD and AFLP data is visualized on the gels as the presence or

absence of band fragments resulting from sequence differences in primer binding sites

(Karp et al. 1997, Hartl 2000). Genetic difference between any two plants is indicated by

the dissimilarity of their banding patterns (Karp et al. 1997). In these two studies, which

both used germplasm obtained from INPA's collection, the marker analysis revealed that

populations which were morphologically determined to represent three separate landrace

types by Mora-Urpi and Clement (1988) corresponded to only two genetically

differentiated landraces (Sousa et al. 2001, Clement et al. 2002, Rodrigues et al. 2004a.

Rodrigues et al. (2004a) confirmed this same revision of landrace differentiation

using a RAPD analysis of seven landraces from INPA's collection, and also went on to









estimate the partitioning of genetic diversity among the different landraces sampled as

15% among landraces and 85% within them, suggesting that the different landraces are

closely related. These values are similar to those estimated for other allogamous plant

species in the tropics (Bawa 1992). However, it remained to be determined how the 85%

gets distributed throughout the various populations that constitute a given landrace of

Bactris gasipaes.

Mora-Urpi et al. (1997) hypothesized that most of the genetic variation within a

landrace may occur among numerous small sub-populations due to genetic drift and

differential selection, and that within these sub-populations there may be relatively low

diversity due to founder effects and selection. Recently, genetic analysis of Pampa

Hermosa landrace populations using AFLP markers has suggested otherwise, finding low

genetic differentiation among populations with relatively high levels of genetic diversity

within them (Adin et al. 2004). When population genetic structure is established using

molecular methods, the extent to which population subdivision and inbreeding influence

patterns of variability within and between populations can be inferred (Loveless and

Hamrick 1984).

Farmer Selection of Tree Seed

In Peru, some farmers discriminate peach palm varieties by the color of the fruit

mesocarp, for the qualitative traits of the fruit associated with each color. For instance,

fruits with a red waxy coat are said to be higher in oil than are fruits with a yellow (or

red) non-waxy coat (Weber et al. 2001). If farmers who prefer the palm as a source of

starch are only planting out seed from yellow non-waxy fruit, their selection might be

dramatically eroding diversity at loci influencing this trait (especially as yellow fruits

occur less frequently than red).









Brodie et al. (1997) surveyed farmers in two separate regions of the Peruvian

Amazon in an investigation of the origins of fruit and timber tree germplasm on-farm.

They found that 87% of the fruit trees were planted from seed the farmer had personally

selected. Sixty percent of these seeds were selected from on-farm germplasm and the rest

were obtained from off-farm sources in the near vicinity. Lengkeek (2003) conducted

similar surveys amongst farmers in Kenya and found that an influx of germplasm from a

distant source occurred only rarely for both indigenous and non-indigenous tree species.

Brodie et al. (1997) reported that the farmers' selection criteria focused on the size,

sweetness, texture, taste and seed characteristics rather than on overall yield of the tree.

Since the sources of germplasm for the first generation of trees were primarily local, with

presumably low levels of diversity, this study concluded that the farms were at risk of

experiencing reduced yields (via inbreeding depression) and pest or pathogen outbreaks

as a result of the narrow genetic base of their trees. They also concluded that farmers'

perceptions are short-term and that they generally do not appreciate the value of variation

in the tree species they cultivate. Few farmers realized that genetic quality might decline

through repeated selection of only the best trees (Weber et al. 1997, Lengkeek 2003).

Bora Swidden-Fallow Agroforestry

A swidden is an agricultural field that is cleared from out of the forest, usually by

hand with axes, saws and fire, and then planted for one or a few years with nutrient

demanding crops before being left fallow for a period of time (Conklin 1957). The

indigenous Bora farmers living near Pebas Peru have been reported to manage their

swiddens and fallows by protecting useful vegetation, both spontaneously occurring and

intentionally planted, from the encroachment of the surrounding forest. A substantial









proportion of the useful vegetation occurring in a given fallow was not necessarily

planted by the farmer in the previous swidden (Denevan and Treacy 1987).

Bactris gasipaes was listed by Denevan and Treacy (1987) as a "planted or

protected perennial species" in the Bora swiddens and fallows, and recent field research

in 2002 and 2003 corroborates this claim. A large proportion of the palms sampled for

the current study were claimed to be over 50 years old, originally planted in previous

generations of swiddens. These palms re-sprout and maintain production over the years

as a result of the farmers' systematic clearing of the same land again and again.

Ten to twenty years was reported to be the minimum length of fallowing used by

the farmers (Denevan and Treacy 1987). If left to compete with the rapid regeneration of

secondary forest vegetation, Bactris gasipaes perishes from a lack of photosynthetic

activity after about 20 years (Clement 1990). The palm was present in Denevan and

Treacy's (1987) sampling of a 19-year old fallow, albeit at a lower density compared to

the younger fallows sampled.

Metapopulation Dynamics

Many populations of plant species are subdivided into local breeding units, a

situation which has the potential to lead to the genetic differentiation among these units

through differential selection and drift. Theories of population structuring often contrast

the trend toward differentiation with the rate of gene flow among sub-populations

(Slatkin 1985, Hartl 2000). The exchange of genes in plants takes place through direct

migration via seed dispersal or flow of pollen. This movement of genetic material plays

an influential role in determining the spatial scale of observed genetic differentiation in

populations (Slatkin 1985).









Gene flow in the context of metapopulation dynamics is a useful way to model the

effects of seed dispersal, or migration, in the genetic structuring of Bactris gasipaes

populations. The term metapopulation was originally coined to describe a population of

populations- a higher hierarchical level of the population concept (Levins 1970). While

populations are defined as assemblages of interacting individuals each with its own finite

lifetime, metapopulations are assemblages of interacting populations with distinct finite

lifetimes, or expected time to population extinction (Hanski and Glipin 1991). In this

manner an assemblage of populations can persist for a much longer period of time than

the lifetime of any one individual population. The 'classical' metapopulation concept

described by Levins is strictly associated with the dynamics of population turnover,

involving both the extinction and recolonization or establishment of new sub-populations.

Subsequently, the use of the metapopulation concept has broadened to include any

assemblage of populations in which genes are exchanged among discrete sub-populations

through migration or dispersal (Hanski 1998).

A metapopulation landscape is conceptualized as a network of idealized habitat

patches or fragments, surrounded by uniformly unsuitable habitat, in which species are

distributed in discrete local populations linked through dispersal among them (Hanski

1998). In this thesis, the concept of a metapopulation landscape will be extended to

describe the population structure of the domesticated tree crop peach palm, which is

unable to indefinitely survive outside of managed agricultural environments (Clement

1990) and whose sub-populations turnover at irregular intervals. In this case, the

subpopulation turnover is caused by the swidden-fallow cycle of rainforest farming, in

which areas of fallowed land are intermittently cleared and replanted over and over.









Migration occurs when a new tree crop is planted after clearing the forest fallow and new

seeds are brought in from distinct sub-populations. This will inherently involve a degree

of artificial selection taking place during population 'founder events'.

Artificial Selection within the Metapopulation

The role of artificial selection in the process of diverging sub-populations is

obvious, as any calculation of changes in gene frequency in a population due to selection

will show (e.g. Falconer 1996, pp.30). When population size is > 15-30 individuals, the

role of random genetic drift in diverging sub-populations can largely be ignored relative

to selection (Hartl 2000). Strong selection regimes are important for the maintenance of

genetic variation in a metapopulation when gene flow among sub-populations is irregular

and unequal in reciprocal directions (Jain and Bradshaw 1966).

Reduced Gene Flow within the Metapopulation

The theoretical models of Sewall Wright (1943, 1946) show that strong gene flow

between sub-populations relative to selection pressures would homogenize the set of sub-

populations, while the complete absence of gene flow would allow the sub-populations to

exhibit the deleterious effects of inbreeding. A reduced level of gene flow between

partially isolated populations is necessary for the long-term persistence of genetic

variability (Wright 1946, Nagylaki 1976, Zhivotovsky and Feldman 1992). Slatkin

(1981) simulated the efficiency of selection in a subdivided population with migration

between populations and found that the time to fixation through genetic drift always

increased with decreasing migration between populations to a minimum.

Pollen-Based Gene Flow within the Metapopulation

It is generally assumed that for out-crossing species, pollen-based gene flow will

have a greater impact on population differentiation or homogenization than will gene









flow by seed dispersal; yet, it is often difficult to distinguish between the effects of each

(Levin and Kerster 1974, Ennos 1994). Individual sub-populations within a

metapopulation often receive pollen from several neighboring sub-populations, and even

if the levels of gene flow are limited from each source, they are additive, so their sum has

the potential to have considerable impact on genetic structure (Levin 1981).

Pollen dispersal is likely to be taking place to varying degrees even among

populations that appear to be completely isolated by distance from one another; this

would be particularly true for tree species with taller statures and longer life spans

(Hamrick and Godt 1996). According to Hamrick and Nason (2000), pollen flow can

often be quite extensive at distances as great as one kilometer for most temperate and

tropical species. Gaiotto et al. (2003) found pollination distances of up to 22 km for

another Amazonian heart of palm species (Euterpe edulis), when the main pollinator was

previously thought to be a bee with a relatively limited flight distance. Since the actual

pollination dispersal distance is unknown for Bactris gasipaes, we cannot underestimate

the role pollen flow might play in the dynamic nature of peach palm metapopulations.

Migration within the Metapopulation

Varvio et al. (1986) modeled the effects of migration among sub-populations and

found that the values of total population heterozygosity and measures of subpopulation

differentiation depend not only on migration rates but also on the subdivision pattern, and

on the interaction between the two factors. Li (1976) showed that the effect of an

individual's migration between two sub-populations is smaller when the number of sub-

populations increases. The larger n is within a subpopulation, the greater the genetic

composition of the immigrants diverges from that of nonimmigrant individuals (Varvio et

al. 1986). Therefore, smaller sized sub-populations with higher rates of migration lose









differentiation among sub-populations more rapidly. Levin (1988) concluded that a

variable migration rate homogenizes neutral allele frequencies less effectively than does a

uniform rate of migration with the same mean.

Another factor to consider is that if individuals from a given population immigrate

into a nearby subpopulation, their gene frequencies would differ less from the target

subpopulation than would immigrants originating from farther away. This violates a

commonly used model of population structure, the stepping stone model of Kimura

(1953) in which only adjacent populations exchange migrants. Kin-structured migration,

in which individuals disperse amidst their relatives, will similarly disrupt the assumptions

of this model (Levin 1988).

Population Turnover within the Metapopulation

The recurrent turnover of populations is a chronic disturbance capable of keeping a

metapopulation from obtaining the theoretical equilibrium between drift and gene flow

(Wright 1931). Slatkin (1977) modeled this effect assuming that for an assemblage of

interacting populations, a proportion e of populations go extinct at random each

generation and are immediately replaced by an equal number of new populations, each

founded by k individuals. The populations then immediately grow to a constant size N,

denoted in Wright's Nm. Wade and McCauley (1988) found that the relative number of

founders (k) to the number of migrants exchanged among populations (Nm) plays a

substantial role in determining the effects of extinction-recolonization cycles. These

models also assume that fitness of the colonizing and pre-existent individuals in a

population are more or less equal. Of course, a more likely metapopulation structure is

one in which the extinction rate depends upon the size of individual sub-populations,









which most certainly are not of a constant, equivalent size, yet this classical model is still

a useful starting point from which to assess the associated genetic implications.

Pannell and Charlesworth (1999, 2000) state that population turnover in a

metapopulation will decrease genetic diversity both within populations and in the total

metapopulation measured as a whole. Gilpin (1991) purports that in a metapopulation

with both gene flow into existing populations and extinction-recolonization from adjacent

populations, genetic variation will be depleted at a rate close to the population half-life of

the large local populations in the system. Yet Gilpin's calculations do not account for the

effects of recolonization from discrete and non-adjacent sub-populations, which is

sometimes the case with peach palm. In addition, with peach palm the founders (k)

sometimes originate from well outside the metapopulation (another region altogether

perhaps).

Slatkin (1977) contrasts two modes of colony formation, an important

consideration when evaluating the consequences of these repeated colonization

bottlenecks. The 'migrant pool' mode is when a colonizing group represents a mix of

genotypes drawn from the metapopulation at large. Variation among new populations is

derived from the binomial sampling of the genetic variation contained within the entire

metapopulation, and is proportional to 12k. At the other extreme, the propagulee pool'

mode of colony formation, each set of genotypes involved in founding a new population

is drawn from just one possible source population (Slatkin 1977). Whitlock and

McCauley (1990) illustrated an intermediate mode between 'migrant' and propagulee

pool.' They introduced the term 0 as the probability that two gene copies present in the

founding group are drawn from the same source population, such that o of zero equals the









'migrant pool', 0 of one the propagulee pool', and 1>o>0 cases that are intermediate

between the two extremes (Whitlock and McCauley 1990). With propagulee pool'

colonization, extinction-recolonization increases genetic differentiation and erodes

genetic variation (under most conditions) much more intensely than occurs with 'migrant

pool' colonization (McCauley 1991, 1993).

However, these models will not adequately describe cases in which founding

events occur successively in the absence of extinctions (Le Corre and Kremer 1998). In

such cases, the cumulative effects of founding events depends as much on the

counterbalancing action of gene flow, i.e. the number of migrants (Nm) exchanged

among existing populations, as it does on the strength of each founding event, i.e. the

number of colonists founding new populations. It is also affected by the relative

contributions of populations of different ages constituting both the migrant and colonist

pools of individuals, with the cumulative effect having the most impact when colonists

arrive only from recently founded populations and migrants originate strictly from

populations of similar ages (Le Corre and Kremer 1998).

Overlapping Generations and Remnant Trees within the Metapopulation

Overlapping generations slow the rate of loss through genetic drift (Hamrick and

Nason 1996). The effect of generational overlap is amplified by the longevity of tree

species and the maintenance of remnant individuals from previous generations, which

reduces the effects of bottlenecking. In addition, the occurrence and the associated

implications of inbreeding in a population (i.e. increase in homozygosity) are postponed

(Johnson 1977, Choy and Weir 1978). The relevance of this 'storage effect' (Chesson

1985, Seger and Brockman 1987) for the maintenance of genetic variation is that the

recessive alleles of heterozygotes are preserved in long-lived individuals, where hidden









variation may reside and flow into more recently founded populations over multiple

generations of fluctuating selection (Hairston et al. 1996).

Long-lived woody perennial species have a higher proportion of polymorphic loci,

more alleles per locus and more genetic diversity than other vegetative life forms.

Hamrick et al. (1992) reviewed the studies published over a 20 years period reporting

allozyme variation for woody plant species with different life history characteristics.

They found that the mean genetic diversity for long-lived woody perennial species is

55% higher than that of short-lived woody species, 42% greater than of herbaceous

perennials and 15% higher than of annual species (Hamrick et al. 1992). In addition,

long-lived woody perennials have more genetic diversity within their populations as

well- 38% higher than annuals and 51% to 80% higher than short-lived herbaceous and

woody species (Hamrick et al. 1992). These higher rates of genetic diversity within

individuals and populations may partially be due to the fact that long-lived out-crossing

tree species generally have a higher potential to be receptors for long-range gene flow

(Nybom and Bartish 2000), which they then incorporate into the local gene pool of

multiple, overlapping generations.

Austerlitz et al. (2000) also conclude that the effects of founder events can be

substantially reduced when the specific life cycle of tree species is taken into account,

even under conditions of limited gene flow. However, they emphasize that this is not due

to the overlapping generations of trees as much as to their delayed reproduction, which

allows for an increase in the number of founders of the breeding population before

reproduction actually begins (Austerlitz et al. 2000). The effective size of a population

bottleneck is often estimated using only the genetic diversity contained in the initial









colonists of a given area. These estimates will be biased low because they do not include

the cumulative effects of successive founding events in the colonization of new habitat

(see Easteal 1985, Baker and Moeed 1987).

Microsatellite Molecular Markers

Microsatellites are currently the predominant marker system for population genetic

analysis (Newbury and Ford-Lloyd 1997, Goldstein and Schotterer 1999). Data acquired

from microsatellite markers is much more informative than data obtained from either a

RAPD or AFLP analysis. Microsatellite primers are designed to amplify specific targets

in the genome through PCR (polymerase chain reaction) by flanking the targeted

sequence (Karp et al. 1997). These targets are core repeating sequences of two to nine

base pairs which vary in the number of repeats occurring between plants- this variation

serves as the measurement for genetic diversity by coding for discrete alleles at a given

locus (Karp et al. 1997, Karp 2002). Microsatellites are co dominant markers, which is a

major advantage over RAPD markers because heterozygous and homozygous genotypes

can be distinguished. This allows direct calculation of all genotype and allele frequencies

without the assumption of Hardy-Weinberg equilibrium

The Mechanics of PCR and Microsatellite Markers

Amplification of targeted sequences is carried out through polymerase chain

reaction (PCR) technology in a thermocycler. This involves a series of automated

temperature changes that unravel the DNA, and then the microsatellite primers are

combined with the enzyme Taq polymerase to isolate and amplify the specific sequences

we want to analyze for their variability (Sobral and Honeycutt 1994). The PCR product

obtained from each DNA sample-primer pair combination is then run through an

automated gene sequencer for analysis.






20


Genetic polymorphisms are visualized in the sequence data as differences in the

length of PCR products, representing the subtraction or addition of simple sequence

repeat units within each sample. Since microsatellites are multi-allelic and co dominant,

each allele yields a distinct allele peak in the data output; genotypes that are heterozygous

yield two allele peaks (identified within an expected allele size range), those genotypes

that are homozygous yield only one allele peak (Karp et al. 1997, Karp 2002).














CHAPTER 3
MATERIALS AND METHODS

Populations and Sampling

Leaf material for DNA extraction was collected from Bactris gasipaes grown in

four sub-populations (agricultural communities) from each of two river drainages in the

Peruvian Amazon. Both drainages fall within the geographical territory of the

'Putumayo' peach palm landrace (Rodrigues 2001). The Tamshiyacu-Tahuayo Rivers

both join the Amazon River near Tamshiyacu, Peru (40 km southeast of Iquitos) (Figure

3-1A, Table A-i). The Yahuasyacu-Ampiyacu Rivers both join the Amazon River at

Pebas, Peru (120 km northeast of the city of Iquitos) (Figure 3-1B, Table A-2). Ten

farms (farmers) were sampled in each of the two river systems (metapopulations), two or

three farms per community or population. Between 24 and 81 palms were sampled from

each community- 221 palms from the Tamshiyacu-Tahuayo communities and 165

palms from the Yahuasyacu-Ampiyacu communities, for a total of 386 plant samples.

An average of 22.1 (between 14 and 30) DNA samples were collected from Tamshiyacu-

Tahuayo farms and an average of 16.5 (between 5 and 34) DNA samples from

Yahuasyacu-Ampiyacu farms.

Communities within each of the two study areas were separated between five and

twenty-five km apart. Given that the flight range of the pollinators is believed to be a

maximum of only 150 to 200 m (Mora-Urpi and Solis 1980, Mora-Urpi 1982), the

probability of long distance pollen flow occurring between any two communities is very

low.





































































Figure 3-1. Relative locations of two study areas, metapopulations (communities) and
farms sampled. A) Colonist and B) indigenous metapopulations. C) Eight
populations of 5 peach palm landraces sampled from El Dorado collection.
Numbers 1-10 on maps A and B indicate location of farms sampled and
numbers 171-334 on map C indicate source location for germplasm sampled
from El Dorado collection.


A .Tamshiyacu

3
1'2.

10.
.-- 9 ..


7".8



S.5
sewn .* .


B o I ig



.^- *

213





4.5.


91O Pet?
_fliatartSB_

S- "' j- j"^









The Tamshiyacu-Tahuayo study area is inhabited by people whose ancestors are a

mix of both recent immigrants as well as those indigenous to the region, who for the most

part do not affiliate themselves with any one particular ethnicity. The Yahuasyacu-

Ampiyacu study area lies within the boundaries of an indigenous federation of Huitoto,

Bora, Yahua and Ocaina peoples, Federaci6n de Comunidades Nativas del Ampiyacu

(FECONA). Therefore, the Tamshiyacu-Tahuayo communities, farmers and palms will

hereafter be referred to as 'colonist' and the Yahuasyacu-Ampiyacu communities,

farmers and palms 'indigenous.'

These labels, 'colonist' and 'indigenous,' are for the purpose of identification only.

This study does not intend to imply that there is anything intrinsically better about the

indigenous nature of a particular style of agroforestry management. In fact, both the

colonist and indigenous styles of management observed were remarkably similar.

In addition to the samples collected from the colonist and indigenous communities,

a control comparison of 37 samples was collected from the Bactris gasipaes germplasm

reservoir maintained by Instituto Nacional de Investigaci6n Agraria (INIA) at their El

Dorado station located near Iquitos. These individuals were collected during the 1983-84

USAID expeditions from eight populations of five peach palm landraces in Peru, Ecuador

and Colombia (Figure 3-1C, Table A-3), and will provide a baseline of a broader genetic

sampling against which to compare the results obtained from the two study areas.

Informal Farmer Surveys

Before collecting DNA tissue of peach palm, each farmer was informally surveyed

to determine their seed selection criteria (preferred palm and fruit types) and the average

number of maternal parent palms used to establish swidden-fallow agroforestry systems.

When collecting DNA tissue with these farmers, the recollected origin of the seed (which









grew into the palms sampled) and the approximate age of all palms (whose tissue was

sampled) were recorded. Sampled palms perceived by a farmer to have been planted

during a pre-existing cycle were identified, to infer the degree of generational overlap

taking place on a given farm.

Collection and Extraction of DNA

The DNA was collected as 8 cm leaf cuttings from lateral shoots, for ease and

efficacy of extraction according to previously documented experience (Clement et al.

1997, Rodrigues 2001). When lateral shoots were not present, juvenile leaf tissue was

used. Each sample was placed in a separate paper envelope and zip lock bag with silica

gel desiccant in an airtight container, and the samples were then periodically transferred

into cold storage (4 to 80C) at the facilities at INIA, San Roque (Iquitos), during the

duration of fieldwork. Upon returning to the Soltis Molecular Systematics Lab on the

University of Florida campus, genomic DNA extraction followed a standard CTAB

(Cetyltrimethyl ammonium bromide) procedure (Doyle and Doyle 1987) with minor

revisions (Appendix B). DNA quantification was carried out by comparison with known

concentrations of a DNA standard (X-Hind III) in ethidium bromide-stained 2% agarose

gels.

Microsatellite Marker Genetic Analysis

Microsatellite Loci for Bactris gasipaes

Ten microsatellite markers have recently been isolated, optimized and characterized

for Bactris gasipaes at Universidade Federal do Amazonas in Manaus, Brazil (Rodrigues

et al. 2004b) in addition to a different set of 18 markers previously developed at the

Biotechnology Research Unit of Centro Internacional de Agricultura Tropical (CIAT) in

Bogota, Colombia (Martinez et al. 2002). At first, six of these microsatellite marker loci









were chosen to genotype all individuals sampled. Three of these markers were labeled

with blue florescent dye, and three with green, at the five-prime end of the forward

primer. This allowed multiplexing of multiple marker loci during sequencing by

distinguishing loci and alleles in the data output whose size ranges overlapped one

another. In the end, only three of these marker pairs could be used due to inconsistent

PCR (polymerase-chain reaction) products for the three additional loci originally chosen

(Table 3-1).

Table 3-1. Microsatellite primer pairs used for population genetic analysis of peach palm


Allele Expected
Locus Primer sequence (5'-3') Repeat motif size range product

Bg02-19 F: GCGTTCAGACTTGCATACACA (CT)23(CA)6 149-205 bp 182 bp
R: CCCACATGCAGGAGTCGTAT

Bg02-24 F: AAACCTGATCCGATTGGCTA (GA)17 119-155 bp 135 bp
R: CACCACCACCACCTCCAC

Bg55 F: TTCTGGGTGCGGTGGTAG (GT)2GC(GT)3GC(GT)5 281-306 bp 278 bp
R: ATGATGGACTGAAGAGATGGAATAG


Isolation and characterization of Bg02-19 and Bg02-24 described in: Rodrigues D.P.,
Vinson C., Ciampi A.Y., Farias I.P., Lemes M.R., Astolfi-Filho S. and Clement C.R.
2004. Ten new microsatellite markers for Bactris gasipaes Kunth (Palmae). Mol. Ecol.
Notes, in press; Bg55 described in: Martinez A.K., Gaitan-Solis E., Duque M.C., Bemal
R. and Tohme J. 2002. Microsatellite loci in Bactris gasipaes (Arecaceae): their isolation
and characterization. Mol. Ecol. Notes 2, 408-410.

PCR Amplification

Separate PCR amplifications were performed for each of the three primer pairs, for

each of the 423 DNA samples (a total of 1,269 reactions), in a 25.0 iL volume containing

(prepared in order listed): 1 [iM each of forward and reverse primers, IX PCR Buffer

(Promega), 2.5 mM MgC12, 250 mM dNTPs, 1 unit Taq polymerase (Promega), 2.5 [L

1:50 DNA dilution was then added.









PCR amplifications of Bg02-19 and Bg02-24 loci were performed separately for

each DNA sample-primer pair combination using a Biometra T3 thermocycler with the

following conditions: initial denaturation at 940C for 2 min; 25 cycles of 94C for 10 s,

the primer specific annealing temperature (580C for Bg02-19 and 64C for Bg02-24) for

10 s, 72C for 30 s; 10 cycles of 94C for 10 s, 50C for 10 s, 72C for 30 s; ending with

72C for 30 min. PCR amplification of Bg55 locus was performed separately for each

DNA sample-primer pair combination on the Biometra T3 with the following conditions:

initial denaturation at 940C for 3 min; 35 cycles of 94C for 15 s, the primer specific

annealing temperature (50C for Bg55) for 15 s, 72C for 15 s; ending with 720C for 5

min. These conditions were optimized by Rodrigues et al. (2004b) and Martinez et al.

(2002) to minimize stutter banding (PCR artifacts that could be misidentified as actual

alleles) in the sequence results.

DNA Sequencing

For each of the three DNA sample-primer pair combinations, 2.0 [iL of PCR

product was added to 25.0 [tL SLS sequence buffer + 0.5 [tL 400 base pair size standard.

This 3-primer pair multiplex was then visualized on a Beckman-Coulter CEQ 8000

automated capillary sequencer, one lane for each DNA sample. Allele sizes were

estimated using the CEQ 8000 version 7.0 software, and then visually inspected taking

into consideration the expected allele size in base pairs for each of the three loci and the

original DNA clones from which the microsatellite loci were developed. Stutter bands

were identified distinct from the actual alleles, to correct any errors made when the

software called and sized the alleles.









Statistical Analyses

To estimate genetic diversity, the following measures were calculated for all

populations using Microsatellite Analyser MSA v. 3.15 (Dieringer and Schlotter 2003):

expected (He) and observed (Ho) heterozygosity per locus and the number of alleles and

allele frequency distribution per locus. These populations were tested for departure from

Hardy-Weinberg equilibrium, performed with GENEPOP v. 3.4 (updated from Raymond

and Rousset 1995) using the U-test for a hypothesis of heterozygote deficiency; exact P

values were determined by a Markov chain method (Guo and Thompson 1992).

The extent and significance of the genetic differentiation among populations was

also investigated with MSA, which provided unbiased estimates of Wright F-statistics

(Weir and Cockerham 1984) at each locus, and averaged over multiple loci. Estimates

were obtained for the following parameters: F, the overall inbreeding coefficient or the

correlation of allele frequencies within individuals in different populations;f the within

population inbreeding coefficient or the correlation of allele frequencies among

individuals within populations; and 0, an estimator of Wright's fixation index Fst,

measuring the correlation of allele frequencies between individuals within populations,

calculated over all populations and for each pairwise population comparison (Cockerham

1969, Weir and Cockerham 1984). Statistical significance ofF, fand 0 was tested by

bootstrapping over loci with a 95% confidence interval. To test the significance of

pairwise 0-values, MSA permuted genotypes among groups with Bonferroni corrections

(Dieringer and Schlotter 2003).

Isolation by Distance version 1.52 (Bohonok 2002) was used to test for the

presence of an isolation-by-distance relationship using the pairwise 0-values, as was

demonstrated by Rousset (1997). Significance in the isolation-by-distance relationship









was tested using a Mantel test. This test assesses whether the pairwise genetic distance

matrix is correlated with the pairwise geographic distance matrix.

Reduced Major Axis (RMA) regression techniques were then used to estimate the

slope and intercept of the isolation-by-distance relationship. Reduced Major Axis (RMA)

regression is more appropriate than Ordinary Least Squares (OLS) regression when the

independent variable x is measured with error (Sokal and Rohlf 1981). Error in the

independent variable leads to biased estimates of slope. Hellberg (1994) specifically

suggested that for analysis of isolation-by-distance, RMA is a more appropriate estimator

of slope than OLS.

SAS (SAS Institute) was used to characterize multilocus genotypic associations

within each population overall and among 2 and 3 loci within each population (Yang

2000, 2002). These genotypic zygoticc) associations were defined on the basis of

gametic and allelic frequencies (Yang 2002).

Most contemporary studies using microsatellite loci report Rst (p), an estimator of

genetic differentiation accounting for variance in allele size and defined for genetic

markers (like microsatellites) undergoing a stepwise mutation model (Slatkin, 1995).

Since there is no way to be certain that mutation in any species follows a strict stepwise

mutation model, Rst has limitations to its use (Slatkin 1995, Balloux et al. 2000). In

addition, Balloux and Goudet (2002) report that when populations are very weakly

structured with high rates of gene flow, Weir and Cockerham's Fst (1984), provides a

more accurate estimator than Slatkin's Rst (1995). Therefore, this study relied solely on

F-statistics for an analysis of population structure.














CHAPTER 4
RESULTS AND DISCUSSION

Farmers' Seed Selection, Sourcing and Management of Palms

Within the two metapopulation study areas there was a strong tendency among both

groups of farmers to limit the number of founding individuals per population. The

average number of maternal parent palms reported to have been selected to provide seed

for the establishment of the swiddens and fallows sampled was 4.3 (range 1 to 10) palms

among the 10 colonist farmers, and 1.5 (range 1 to 2) palms among the 10 indigenous

farmers. In addition, 19 % of all palms sampled from both study areas (N= 386 palms)

grew in swiddens and fallows established by a given farmer using only one maternal

parent palm as a seed source. As a point of comparison, Brown and Marshall (1995)

recommend using a minimum of 50 maternal parents to minimize founder effects when

establishing a new population. Therefore, the practices of these farmers could potentially

lead to founder effects, genetic bottlenecks and drift.

The dynamic movement of peach palm seed and the distances over which it had

taken place in the recent past appeared to be an important variable between the two

metapopulation study areas (Figure 4-1). Within the colonist metapopulation, fifty-one

percent of peach palms sampled (113 out of 221 palms) grew from seed selected from a

farmers' own swidden or fallow, and an additional 20% (44 out of 221 palms) grew from

seed selected from an immediate neighbor (within the same community). Fifteen percent

of the sampled palms (33 out of 221 palms) grew from seed that had originated from one











O Seed sourced from farmers' own swidden or fallow

15%
8 .. .- -.. o Seed sourced by farmer, in neighbors' swidden or fallow


20% O Direct descendants of palms from pre-existing fallow of
unknown origin


51% O Seed sourced by farmer, in swidden/fallow 1-2 hours
walking distance away

A Direct descendants of the seed sourced 1-2 hours
walking distance away


O Seed sourced from farmers' own swidden or fallow
33%
13% .. Seed sourced by farmer, in neighbors' swidden or fallow


2H Seed which originated from 120 km and 600 km away
24%
30%
M Direct descendants of seed brought during tribes' (1937)
B migration from Colombia (250 km away)



Figure 4-1. Seed sourcing for peach palms sampled from the colonist and indigenous
metapopulations. A) 221 colonist palms. B) 165 indigenous palms. All palm
seed for a given planting event was reportedly obtained from only one single
source location at a time.

to two hours walking distance away, and an additional 6% (13 out of 221 palms) were

direct descendants (progeny) of that 15% (Figure 4-1A).

In sharp contrast, within the indigenous metapopulation the scale of the movement

of genetic material was much larger; thirteen percent of the palms sampled (21 out of 165

palms) grew from seed that had originated from 120 to 600 km away (Figure 4-1B). Of

these 21 palms, two were spineless whose seed had originated in Iquitos, 120 km upriver.

An additional 19 palms were sampled which were found growing in the context of a









Peruvian governmental program (Fondo Nacional de Compensacion y Desarrollo Social)

to promote spineless heart of palm cultivation in the area using peach palm seed

originating from the Yurimaguas region, almost 600 km upriver from the communities.

In addition, within the indigenous metapopulation 33% of the palms sampled (55

out of 165 palms) were said to be descendants of seed originating from the homeland of

the grandparents and parents of the farmers, 250 km to the north in the Putumayo region

of Colombia (Figure 4-1B). These people fled in 1937 with their families (along with

seeds and cuttings of their traditional crops) to their present location in Peru to escape the

lingering slave trade that had decimated the region's tribes at that time. The average age

of these 55 palms sampled was 33.3 (range 3 to 50+) years.

A comparison of the average age of all palms sampled from the two

metapopulation study areas exhibits a divergence in their age distribution (Table 4-1).

Twenty-eight percent of all palms sampled (47 out of 165 palms) from indigenous farms

were attributed to planting events 30 to 50 years earlier, compared to only 1% of all

palms sampled (3 out of 221 palms) from previous (unknown) planting events observed

and sampled on colonist farms. Most of the colonist farmers claimed that the production

of peach palm fruit deteriorates in fallow over time (as discussed in Clement 1990), so

they made little effort to maintain (protect) older remnant palms from previous

Table 4-1. Average age of peach palms sampled from colonist and indigenous
metapopulations


Ten colonist farms Ten indigenous farms

Number of palms sampled 221 palms 165 palms

6.0 years 19.2 years
Average age of all palms sampled 6.0 years 19.2 years
(range <1-17 years) (range <1-50+ years)









generations once the palms had been overcome by forest re-growth. These farmers

preferred to simply plant a new generation of palms, if possible. Thus, palms managed

by the colonist farmers rarely survived through the fallow period until the next swidden

clearing cycle. While this may have been a factor somewhat enthusiastically over-

exaggerated by the indigenous farmers surveyed, a strong divisional trend in management

practices is apparent over all twenty farms sampled.

Molecular Marker Results

Genetic Diversity and Hardy-Weinberg Equilibrium

The three microsatellite marker loci carried 49 alleles in the indigenous

metapopulation (n = 165), while only 43 alleles were found in the colonist

metapopulation (n = 221). The frequency of observed heterozygosity averaged over loci

was somewhat higher in the indigenous metapopulation as well (Table 4-2). Expected

heterozygosities throughout both metapopulations were generally higher than observed

heterozygosities at individual loci, with one minor exception where a landrace population

consisted of only two individuals (Table 4-2). Of the 19 tests of conformity to Hardy-

Weinberg proportions, 12 groups of populations showed a significant deficiency of

heterozygotes at the 0.01% level, and 3 groups were deficient at the 1% and 5% levels

(Table 4-2). This is also apparent in the values obtained for the inbreeding coefficient

an estimator measuring the effects of nonrandom mating within populations on a scale of

-1, indicating an excess of heterozygotes, to 1, indicating an excess of homozygotes,

relative to proportions expected in a Hardy-Weinberg equilibrium population.

Within the two metapopulation study areas, observed heterozygosities in the

colonist communities ranged from 0.639 to 0.698, while those of the indigenous










Table 4-2. Microsatellite diversity and heterozygote deficiency in colonist and
indigenous peach palm metapopulations; landraces sampled from El Dorado
collection included for comparison.


# of # of alleles per locus Heterozygosity
N pops. Bg02-19 Bg02-24 Bg55 Expected Observed f


Colonist
Metapopulation:

Communities 221 4 21 14 8 0.833 0.678 0.194***

Community:
Nuevo Tarapaca 42 3 17 7 7 0.823 0.698 0.156***
San Carlos 81 3 15 13 8 0.806 0.639 0.210***
Nuevo Triunfo 60 2 15 11 8 0.824 0.684 0.171***
Nuevo San Juan 38 2 13 11 7 0.847 0.697 0.191***

Indigenous
Metapopulation:

Communities 165 4 22 16 11 0.806 0.693 0.152***

Community:
Brillo Nuevo 55 3 15 13 5 0.758 0.664 0.121**
Puerto Isango 24 2 13 9 6 0.826 0.741 0.107*
Pucaurquillo 58 3 21 14 10 0.802 0.625 0.207***
Sa. Lucia de Pro 28 2 14 12 7 0.792 0.708 0.105**

El Dorado
Collection:

Landraces 37 5 17 14 7 0.766 0.713 0.155***

Landrace:
Putumayo 7 1 9 7 6 0.869 0.746 n.a.
Pampa Hermosa 7 2 7 7 5 0.848 0.833 0.024
Pastaza 6 2 7 6 3 0.793 0.667 0.09
Tigre 15 2 11 8 6 0.809 0.619 0.248***
Vaup6s 2 1 2 2 3 0.5 0.667 n.a.


Each metapopulation analyzed among communities and farms (populations) pooled
within communities; sampling from El Dorado germplasm collection analyzed among
geographical landraces and populations of origin pooled within landraces. Expected (He)
and observed (Ho) heterozygosities averaged over all three loci. The unbiased measure of
inbreedingf(Weir and Cockerham 1984) considers the effects of nonrandom mating
within populations (averaged over loci). Significant heterozygote deficiency over all
loci, relative to Hardy-Weinberg expectations at: *P<0.05, **P<0.01, ***P<0.0001.









communities ranged from 0.625 to 0.741 (Table 4-2). As a point of comparison, the 37

individuals of 5 different landraces sampled from the El Dorado germplasm collection

revealed similar numbers of alleles per locus, and a larger observed heterozygosity

(0.713) than was estimated for either of the two metapopulation study areas (Table 4-2).

Private alleles in the context of this study are alleles found only in one of the two

study metapopulations; all of the other alleles totaled in Table 4-2 were shared between

them. There were more than twice as many private alleles, occurring at a higher average

weighted frequency in the indigenous metapopulation than in the colonist. However, in

general these private alleles were rare in both metapopulations, all occurring at

frequencies of 0.028 or less (Table 4-3).

Testing for a genotypic association among all three loci within the two

metapopulations and the El Dorado populations found no significant association using

chi-square (P values 0.12 and higher). However, within the colonist metapopulation

there was a significant association (at the 0.01% level) between loci Bg02-19 and Bg02-

24.

Genetic Differentiation

In an analysis of the genotypes observed at marker loci, genetic differentiation

estimated among colonist farms was low (Ft= 0.03) yet significantly different from zero

(P<0.0001) (Table 4-4). The genetic differentiation estimated among indigenous farms

was even lower (Ft= 0.017), yet still significant (P<0.001). Genetic differentiation

among the eight El Dorado populations of five landraces (Vaupes, Pampa Hermosa,

Pastaza, Putumayo and Tigre) appeared greater (Ft = 0.05), revealing more moderate

levels of significant (P<0.01) population differentiation consistent with the relatively

larger geographical scale of this particular sampling (Table 4-4). Analyzing the farms in














Table 4-3. Weighted allele frequencies at individual loci for colonist and indigenous metapopulation study areas.
alleles unique to one or the other metapopulation study areas, are shown in bold.


'Private alleles',


Colonist Metapopulation: N= 221 Indigenous Metapopulation: N = 165
Bg02-19 Freq. Bg02-24 Freq. Bg55 Freq. Bg02-19 Freq. Bg02-24 Freq. Bg55 Freq.


152 0.002 128 0.002 282 0.061 152 0.028 114 0.003 282 0.006
154 0.236 130 0.009 286 0.207 154 0.15 130 0.012 284 0.019
156 0.037 132 0.064 288 0.293 156 0.034 132 0.037 286 0.18
158 0.002 134 0.025 290 0.039 160 0.003 134 0.019 288 0.559
162 0.062 136 0.169 296 0.011 162 0.097 136 0.118 290 0.009
164 0.122 138 0.139 300 0.098 164 0.038 138 0.199 294 0.003
166 0.002 140 0.112 302 0.075 166 0.019 140 0.115 296 0.006
168 0.005 142 0.059 304 0.216 170 0.006 142 0.115 298 0.003
170 0.03 144 0.071 172 0.103 144 0.118 300 0.087
172 0.073 146 0.014 174 0.006 146 0.019 302 0.028
174 0.011 148 0.002 176 0.019 148 0.009 304 0.099
176 0.034 150 0.041 178 0.053 150 0.025
178 0.14 152 0.014 180 0.028 152 0.006
182 0.007 158 0.279 182 0.034 154 0.009
184 0.014 184 0.094 156 0.012
186 0.039 186 0.088 158 0.183
188 0.057 188 0.022
190 0.05 190 0.122
192 0.048 192 0.047
194 0.025 198 0.003
198 0.002 200 0.003
204 0.003



Two private alleles, allele 200 at Bg02-19 (indigenous) and allele 128 at Bg02-24 (colonist), were also found in the El Dorado
populations at low weighted frequencies (0.014 and 0.029 respectively).









the two metapopulation study areas as two discrete panmictic populations, the genetic

differentiation between them was estimated as Fst = 0.027, which is low but still

significant (P<0.0001) for these two groups of farms located approximately 160 km apart.

Isolation-by-Distance

Pairwise estimates of Fst (Weir and Cockerham 1984) were plotted against the

geographical distance between populations, performed separately for each of the two

metapopulation study areas. Genetic material was assumed to travel linearly along the

trails and rivers to obtain estimates of geographical distance. The absence of a

statistically significant isolation-by-distance relationship up to 27 km distance in the

indigenous metapopulation further stresses low population genetic differentiation (Figure

4-2A). Accordingly, the values of pairwise estimators were low for the indigenous

populations, and only 4% of these were significant (P<0.05) (Table C-2).

In contrast, the colonist farms exhibited a significant (P<0.01) isolation-by-distance

relationship up to 35 km distance (Figure 4-2A). The pairwise values obtained for the

colonist populations were generally higher than those obtained for the indigenous

populations, and a higher percentage of these values (29%) were significant at the 1%

and 5% levels (Table C-1).

The values of pairwise population genetic differentiation among the 8 El Dorado

populations of 5 landraces were higher than those of either of the two metapopulations.

These populations illustrated a significant (P<0.01) isolation-by-distance relationship up

to 1250 km, calculated as the shortest linear distances along rivers, which in a few cases

included trails connecting watersheds (Figure 4-2B). However, none of these pairwise Fst

values were significant (P<0.01) when testing for population differentiation, probably due

to the small population sizes analyzed (Table C-3).














Table 4-4. Unbiased estimates of Wright F-statistics for colonist/indigenous metapopulations; landrace populations sampled from El
Dorado collection included for comparison.


F-statistics at individual loci


Colonist farms
Colonist communities

Indigenous farms
Indigenous communities

El Dorado populations
El Dorado landraces

Colonist vs. Indigenous

Colonist vs. Indigenous
vs. El Dorado

Colonist and Indigenous
vs. El Dorado


# of
N pops.


221 10
221 4


386 2

423 3


423 2


Bg02-19
F f


Bg02-24 Bg55
0 F f 0 F f


0 F


F-statistics
over all loci
f


0.202 0.181 0.026 0.127 0.088 0.042 0.308 0.292 0.023 0.211 0.186 0.03***
0.204 0.189 0.019 0.129 0.108 0.023 0.312 0.291 0.03 0.213 0.194 0.024***

0.151 0.129 0.024 0.19 0.181 0.01 0.136 0.121 0.016 0.161 0.146 0.017**
0.152 0.14 0.014 0.191 0.184 0.009 0.138 0.125 0.014 0.162 0.152 0.012**

0.283 0.266 0.024 0.05 -0.02 0.066 0.243 0.195 0.059 0.192 0.15 0.05*
0.284 0.272 0.017 0.061 -0.02 0.08 0.247 0.206 0.052 0.197 0.155 0.05*


0.195 0.178 0.02 0.159 0.151 0.009 0.286 0.244 0.056 0.21


0.188 0.027***


0.203 0.187 0.019 0.149 0.146 0.009 0.279 0.243 0.049 0.208 0.188 0.025***


0.204 0.195 0.02 0.149 0.146 0.003 0.275 0.262 0.017 0.207 0.198 0.011*


Weir and Cockerham's (1984) unbiased estimates of Wright F-statistics defined as follows: F = total heterozygote deficiency (overall
inbreeding coefficient),f= deficiency within individuals within populations (inbreeding coefficient) and 0 = deficiency among
populations (an estimate of fixation index or Wright's Fst). Each metapopulation analyzed among farms and among farms pooled
within communities; El Dorado germplasm analyzed among populations of origin and among populations pooled within geographical
landraces. Estimates of F-statistics also calculated between groups of populations (colonist, indigenous, El Dorado). Significant
population differentiation at: *P<0.01, **P<0.001, ***P<0.0001.

























Indigenous


Colonist


0 5 10 15 20 25 30 35 40


Geographic Distance (km)


0 200


400 600 800 1000

Geographic Distance (km)


Figure 4-2. Testing for an isolation-by-distance relationship among farms within each of
the two metapopulations and among populations analyzed from the El Dorado
collection. A) Correlation between unbiased estimates of pairwise population
genetic differentiation [Fst (0) over all loci] and geographic distance, R2
0.1948 and Mantel test of correlation, P<0.0029 for colonist populations; R2
0.0301 and P<0.0896 for indigenous populations. B) Correlation, R2 = 0.3346
and Mantel test, P<0.009 for El Dorado populations.


1200


1400


S ........


S...........
"









Discussion

The high inbreeding coefficients (f) calculated for both metapopulations (Table 4-

2) are the result of recurrent sib-mating occurring over many generations, as inbreeding

coefficients measure the probability that two alleles are identical by descent (Hartl 2000).

Clement et al. (1997) and Clement (1995) both reported similar levels of inbreeding in

populations of Bactris gasipaes. This kind of selection is the very essence of crop

domestication, necessary to amplify the specific traits one prefers in a given species

(Doebley 1989), yet ideally there should be a balancing factor in the agroecosystem to

allow for a continuation of the crop's evolution. This balance appears to be facilitated in

part by the migration of genetic material with and among metapopulations.

Seed Migration within a Metapopulation

The migration of seed has the potential to introduce 'new' alleles into a population,

thereby increasing its genetic diversity and slowing the rate of divergence within the

metapopulation. Additional migration across time via the descendants of introduced seed

is taking place among 6% (13 palms) and 33% (55 palms) of the total palms sampled

from the colonist and indigenous study areas respectively (Figure 4-1). These palms

might still carry alleles introduced into the population by their immigrant ancestors, and

could contribute to their continued maintenance. Yet the impact that the immigration of

genetic material has on a metapopulation will primarily depend upon the scale of distance

from which it originated, as a comparison of isolation-by-distance relationships in

Figures 4-2A and 4-2B reveals.

Migration within a peach palm metapopulation occurs among a group of

populations in both the immediate (neighbor's swidden) and close vicinity (1 to 2 hours

away), as well when seed is brought in from another distant metapopulation (120 to 600









km away) (Figure 4-1). In other words, the boundaries of seemingly localized

metapopulations are in fact permeable, open to immigration from outside. At a greater

scale, the swiddens and fallows comprising entire regions of Peru, Ecuador and Colombia

would theoretically form one massive peach palm metapopulation, connected by the

historic flow of seed over large distances. Rodrigues et al. (2004a) use the genetic

relationships among landraces to discuss the possible migration of peach palm seeds

throughout South America and up through Honduras out of a single source area of

domestication, previously proposed for southwestern Amazonia (Huber 1904, Ferreira

1999). As illustrated in this study and elsewhere, a certain degree of seed migration

continues even today at a similarly extensive scale, particularly concerning genetic

material of the spineless Pampa Hermosa landrace from the Yurimaguas region of Peru

(Figure 4-1B) (Adin et al. 2004).

Although the seed for planting a new swidden generation was always obtained

from just one source population (Figure 4-1), and sometimes comprised groups of half-

sib individuals originating from only one maternal parent, each farm sampled within a

given community is assumed to be an interacting unit of a metapopulation (i.e. colonist

community) within a larger group of metapopulations (i.e. colonist metapopulation study

area). This is due to the relative proximity of neighboring farms (between 250 and 500 m

apart; see Figure 3-1), which are potentially interchanging genetic material via long-

distant pollen-mediated flow within the community metapopulation. And as previously

discussed, farmers are also directly exchanging genetic material among neighbors, and

presumably between communities. Therefore a given source of seed is a mix of









genotypes drawn from the metapopulation at large, and the migration of seed resembles

the 'migrant pool' mode of gene immigration (Slatkin 1977).

Population Structuring and Genetic Differentiation

One direct consequence of migration within a metapopulation, particularly via the

'migrant pool' mode, is that population genetic differentiation is substantially reduced. A

comparison of the overall Fst estimates for colonist and indigenous farms (Table 4-4) has

little meaning, however these estimates are both consistent with high rates of gene flow

among populations, i.e. exchange of genetic material among farmers along the course of

the two river systems over a long period of time. Indeed, in Figure 4-1 there appears to

be comparably high rates of exchange among neighboring farmers in both of the two

study areas. Adin et al. (2004) came to similar conclusions regarding Gst estimates

obtained for two riverine groups of peach palm populations from the Yurimaguas region

of Peru, which were similarly low (Gst is an equivalent estimator of the parameter Fst

which considers the ratio of inter-population genetic variation to the total variation).

Pairwise population differentiation was higher in the colonist metapopulation than

in the indigenous (Table C-l and C-2), and there exists a statistically significant isolation-

by-distance relationship among them (Figure 4-2A) thus there is some indication that

the structure of the colonist metapopulation is more defined than the indigenous. The

high incidence of seed migration into the indigenous metapopulation (Figure 4-1B) might

be causing this discrepancy, as genetic divergence among sub-populations would be

reduced if immigrant seeds were a pool of genotypes from the larger (regional)

metapopulation structure.

The overall Fst estimate obtained among the eight El Dorado populations of five

landraces (Fst = 0.05, P<0.01; Table 4-4) was somewhat lower than the among population









differentiation estimated for regional-scale samplings of other allogamous plant species

in the tropics (typically between 0.10 and 0.15; Bawa 1992, Hamrick et al. 1992).

However, it was still substantially higher than the population differentiation estimated for

the two metapopulation study areas. Therefore, as distances increased between

populations the gene flow among them was less. For instance, Rodrigues et al. (2004a)

analyzed 220 peach palms from a much larger geographical selection of six landraces,

representing close to the entire range of the species (from Central America through Peru

to the mouth of the Amazon in Brazil), and estimated genetic differentiation among

populations as Gst = 0.16.

It is interesting to note that the lowest Fst estimate overall was obtained in a

grouping analysis between the two metapopulation study areas (Group 1) and the El

Dorado populations (Group 2) (Fst= 0.011, P<0.01) (Table 4-4). The low genetic

differentiation between the study areas when considered as two discrete panmictic

populations is relevant here as well (Fst= 0.027, P<0.001). Mora-Urpi and Clement

(1988) proposed that populations near Iquitos and Pebas might represent heterogeneous

mixtures of Putumayo, Pampa Hermosa, Pastaza and Tigre landraces, among others.

This is because the region is at the crossroads of several major river systems, which

would have facilitated the exchange of different landraces over long periods of time; the

results presented here would seem to support their hypothesis.

Maintenance of Remnant Trees on the Indigenous Farms

As competition for light and nutrients increases, older palms in fallow do not

produce the fruit yields of younger palms in swidden clearings (Clement 1990). Yet in

northwest Amazonian indigenous cultures, remnant peach palms provide a sense of

generational continuity and play an important role in revisiting memories of the people









(often direct ancestors) who planted them. This symbolic association with peach palm

has been reported by anthropologists (e.g. Chaumeil 2001, Erickson 2001 and Rival

2002) as being broadly shared by at least five specific tribes of the northwest Amazon.

One of these ethnographies (Chaumeil 2001) took place in the same indigenous

communities sampled for this population genetic analysis of peach palm.

It is more a matter of custom with the indigenous than with the colonist farmers

surveyed, regardless of the utilitarian value of the remnant palms. Yet this is not to

generalize that only indigenous Amazonians would find the preservation of remnant

palms worthwhile; if other groups of indigenous and non-indigenous farmers were

sampled perhaps the results would have been different.

The maintenance of remnant palms from previous generations of swiddens may be

helping to preserve genetic diversity within the indigenous metapopulation, by reducing

founder effects and loss of alleles. Since changes in the genetic composition of a

population require a generational turnover, maintaining remnant palms from previous

swidden generations would potentially lessen the negative consequences of founder

effects. In addition, these remnant palms are quite possibly an important cohesive factor

in metapopulations; for instance, Chase et al. (1996) found that isolated trees could act as

stepping stones, facilitating gene flow among larger populations. Intermittently

throughout the secondary forest and fallows sampled, peach palms from previous

swidden generations extended up through the canopy (z 2 to 3 palms per hectare) in

search of light in the midst of encroaching vegetation.

The indigenous farmers of the particular area under investigation have been

reported to clear and reuse the same plot of land after fallowing periods lasting 20 years









(Denevan and Treacy 1987). Given the current shortage of land available to each family,

these farmers are very rarely able to wait any longer for fallowed land to 'replenish' itself

(Manuel Nibeco, October 2003, personal communication). This period of time is short

enough to prevent the complete extinction of peach palms planted during previously

cultivated swiddens (Clement 1990), especially considering that during the first five years

these swidden-fallows are managed by the farmers for the long term growth of the fruit

trees in the weeding out of competing secondary vegetation (Denevan and Treacy 1987).

Some of the farmers claimed that they clear the vegetation around their palms when

harvesting fruit; more or less every year throughout the entire fallowing period.

In addition, management of the common Amazonian agroforestry intercrop manioc

(Manihot esculenta) and peach palm differed in a slight yet significant manner between

the indigenous and colonist farmers. Indigenous farmers in the northwest Amazon are

known to predominately cultivate highly toxic manioc varieties (McKey and Beckerman

1993), and the farmers indicated they were used to produce their traditional bread. They

also claimed that these varieties mature relatively slowly, preserving well in the soil for 5

years or more. On the other hand, the colonist farmers all grew a non-cyanogenous

variety of manioc (to be eaten boiled, unprocessed), which produces yields in less than

three years. The soil would then be exhausted for root crop cultivation and management

of the entire swidden would taper off into fallow. Thus the choice of manioc varieties

determines the amount of years a swidden will be regularly cleared of undesirable

secondary vegetation, which relates to the amount of time peach palm will accumulate

biomass in an open environment- the extra years conferring an advantage for the palms

once the fallow period begins.









The older palms that persist in indigenous fallows are spared during subsequent

forest clearings and survive the burning of slash to sprout up from their bases (a trait

characteristic of Bactris gasipaes); fueled by the nutrient flush they soon are producing

fruit again. Thus the supportive effect of generational overlap on the maintenance of

genetic variability and structure within peach palm populations is facilitated by the

longevity of highly managed palms.

Comparing Genetic Diversity and Heterozygosity Estimates

Considering the historical-ecological context of the two study locations, observed

heterozygosity and levels of genetic variability (Tables 4-2 and 4-3) provide a broad

evaluation of the effects of migration and the preservation of remnant individuals in

maintaining diversity in peach palm. It is important to note that the 165 indigenous

palms represent a sample size that is 25% less than that of the 221 colonist palms, yet

there were still more alleles per locus observed in the indigenous metapopulation (Table

4-2). The additional private alleles in Table 4-3 might have been obtained (introduced)

through the increased rates of seed immigration from afar (Figure 4-1), although

extensive sampling in source areas would be needed in order to prove this. Yet alleles

are extremely sensitive to population bottlenecks; therefore, the preservation of remnant

individuals might be playing a role in maintaining these private alleles, albeit at

extremely low frequencies.

Evidence (or the lack thereof) of genotypic disequilibrium is important in making

inferences about the history of a population and the evolutionary forces governing allele

frequencies at these loci. In this case, a lack of strong evidence for genotypic

associations within the peach palm populations sampled corresponds with the fact that

migration among peach palm populations is occurring among gene pools that are









somewhat closely related, as we would expect strong zygotic associations if this were not

the case (Barton and Gale 1993).

General Discussion

The allelic components of peach palm's diversity, such as those sampled from the

farms surveyed for this study, fluctuate over time. Through the migration of genetic

material, farmers seem to be managing general levels of diversity within a

metapopulational matrix, more than they are managing individual genes in isolation

(Louette 2000). This study offers insight into developing strategies to preserve the

evolutionary processes that actively create and maintain general levels of genetic

diversity on-farm. If participatory domestication projects are able to preserve the actual

genes underlying the more useful phenotypes (like the ongoing program with peach palm

in Peru; see Weber et al. 2001), then it is important that there is a degree of movement of

this 'improved' genetic material within and between regions to maintain general levels of

'useful' diversity. The problem then lies in preventing the frequency of these targeted

genes from becoming excessively diluted on-farm and within the metapopulation over the

long run.

It is difficult to generalize about farmer behavior and assume that this kind of

genetic migration (crucial to the metapopulation's dynamics) is taking place often

enough, throughout the entire geographical distribution of peach palm, to prevent a

degree of genetic erosion in the species as a whole. In Peru, the flow of peach palm seed

is highly decentralized and sporadic, oftentimes dependent solely upon individual

farmers' perceptions about the use and value of specific palm types. And since both the

number of populations and their sizes are never held perfectly constant, the effects of

migration within and among metapopulations are likely to be highly variable and site-









specific. Therefore, formal institutionalized support is needed to develop a network

capable of guiding an appropriate degree of exchange of genetic material. It is believed

that in developing markets for improved peach palm seed, this exchange will be

facilitated (Clement et al. 2004a). Yet it would be helpful to monitor changes in

measures of genetic diversity in recipient populations over time, to gauge an appropriate

scale for this migration to take place on a case-by-case basis.

Finally, it is important to keep in mind when reviewing any study of tropical crop

genetic resources, whose centers of diversity are often located in lesser-developed regions

of the world, that they are often managed in the context of immediate subsistence

irrespective of long-term genetic consequences. Subsistence farmers tend to do what

they need to feed their families in the short run. In the context of genetic resources this

often translates into making a conscious decision to use limited time and resources to

cultivate only the most productive and appealing varieties of a given crop at the expense

of all others, thereby eroding the underlying genetic diversity. While it is true that even

in the darkest reaches of Amazonian backwaters one might find an occasional crop

connoisseur growing a wide variety of types, he or she will always be the exception.

Conclusion

Based on the molecular results presented, and the contrasting management of palm

germplasm observed between the two groups of farmers, what conclusions can

realistically be made? The palm populations sampled have a long evolutionary history,

which is not addressed when asking farmers about recent management of the genetic

resource. Nonetheless, the amount of neutral genetic variation and heterozygosity

observed in both the indigenous and colonist metapopulations was high.









These relatively high levels of diversity were not expected, considering the seed

selection practices of the farmers and the high inbreeding within both metapopulations.

Although these particular microsatellite loci are only representative of neutral genetic

variation, founder effects and selection in the 10,000 year process of peach palm

domestication are expected to have reduced overall allelic diversity. Yet these neutral

marker loci are extremely sensitive to gene flow (migration). These results suggest long-

distance seed migration events in the relatively recent past have attributed to the genetic

variability and heterozygosity observed at present in the indigenous populations. Since

migration is taking place on a reduced scale in the colonist metapopulation, the same is

true to a lesser extent. In turn, the extremely low genetic differentiation observed within

and between the two metapopulations suggests that seed exchange (migration) has been

extensive throughout the region over long periods of time. It cannot be ruled out that an

unforeseen potential of the species for pollination among populations might have played

a role here as well, over larger than expected distances by nonspecialist insect vectors.

In addition, the preservation of remnant palms has the potential to maintain alleles

introduced into the indigenous metapopulation for longer periods of time than would be

possible otherwise. Barring any sudden change in traditional agroforestry management

strategies, this factor should continue to play a role in the composition of the indigenous

metapopulation's genetic diversity, yet the frequency and extent of future genetic

migration within and among regions will remain crucial.

Epilogue: Participatory Domestication of Peach Palm in Peru

ICRAF (International Centre for Research in Agroforestry) and INIA (Instituto

Nacional de Investigaci6n Agraria) initiated a participatory domestication project for

Bactris gasipaes in Peru in 1997. Farmers in the Yurimaguas region wanted to conserve









the phenotypic diversity of their palms, and produce seeds for sale to other regions and

countries where there was a demand for their spineless type to establish heart-of-palm

plantations. This region is known to possess the most economically valuable landrace of

the species, Pampa Hermosa, with a high frequency of spineless trunks and leaves, and

rapid growth for heart-of-palm production (Mora Urpi and Echeverria 1999). There is

high phenotypic variability and relatively high genotypic variability in this particular

landrace (Rodrigues 2001), so it would benefit the farmers if this project produced seed

with relatively uniform trait characters. This is always the trade off with the

domestication of crops, and lesser-known crops in particular; those genetic resources

which fall outside of the domesticated type perceived as the most economically

promising will always erode.

Researchers asked 142 farmers from 16 different communities to select their best

spineless palms based on preferred fruit characteristics, expecting to create dual-purpose

populations (fruit for food security; heart-of-palm seeds for export). They then collected

at least 300 seed from each of these palms to establish on-farm progeny trials in the

Yurimaguas and Pucallpa regions (Weber et al. 2001). Each trial replication consisted of

two progeny plants of the 400 selected mother palms. The trials were rogued after 5

years, leaving the best plant from each progeny for the production of selected seed. To

maintain as much variability as possible at every step in the domestication process, no

selection among progenies took place.

The heritability of fruit traits in peach palm is unknown at present and those for

heart-of-palm growth and yield are low (Clement 1995). Nonetheless, genetic gain under

this scenario of selection might be improved if the trials were rogued among progenies as









well, rather than only within. Especially since the principal objective of both the farmers

and the researchers was to collect and conserve valuable phenotypes, and they did not

presume their project would conserve the underlying molecular diversity. They focused

instead on collecting palms that the farmers themselves identified as useful to them,

rather than collecting a wide range of randomly selected palms or palms identified

through molecular analysis as rare and valuable for genetic preservation.

The farmers are the owners of their replications, and they received periodic

stipends to finance the maintenance and fertilization of the trials. They certainly expect

INIA to help them export seed to Brazil and other Latin American heart-of-palm

producers, but it is not yet clear that INIA is organized for this task.
















APPENDIX A
EXACT ORIGINS OF POPULATIONS ANALYZED

Table A-1. Exact origins of the 221 colonist (Tamshiyacu-Tahuayo) samples


# of palm samples Farm Community Lat. Long.


14 Farm 1 Nuevo Tarapaca 040 05' S 730 06' W
14 Farm 2 Nuevo Tarapaca 040 05' S 730 06' W
14 Farm 3 Nuevo Tarapaca 040 05' S 730 06' W
28 Farm 4 San Carlos 040 13' S 73 11' W
27 Farm 5 San Carlos 040 13' S 73 11' W
26 Farm 6 San Carlos 040 13' S 73 11' W
30 Farm 7 Nuevo Triunfo 040 08' S 730 09' W
30 Farm 8 Nuevo Triunfo 040 08' S 730 09' W
22 Farm 9 Nuevo San Juan 040 05' S 730 04' W
16 Farm 10 Nuevo San Juan 04 05' S 730 04' W




Table A-2. Exact origins of the 165 indigenous (Yahuasyacu-Ampiyacu) samples


# of palm samples Farm Community Lat. Long.


14 Farm 1 Brillo Nuevo 030 15' S 710 55'W
16 Farm 2 Brillo Nuevo 030 15' S 710 55'W
25 Farm 3 Brillo Nuevo 030 15' S 710 55'W
11 Farm 4 Puerto Isango 030 20' S 710 55' W
13 Farm 5 Puerto Isango 030 20' S 710 55' W
5 Farm 6 Pucaurquillo 030 24' S 710 50' W
19 Farm 7 Pucaurquillo 030 24' S 710 50' W
34 Farm 8 Pucaurquillo 030 24' S 710 50' W
13 Farm 9 Santa Lucia de Pro 030 24' S 710 48'W
15 Farm 10 Santa Lucia de Pro 030 24' S 71 48' W











Table A-3. Exact origins of the 8 populations from 5 landraces sampled from El Dorado
collection


Landrace Pop.


Location collected


Lat. Long.


171-177
180-182, 185
223,228,235
194
199
244, 246-248
201,203-204,206-210
213,215-216,219-222
333
334


Putumayo
Pampa Hermosa
Pampa Hermosa
Pastaza
Pastaza
Pastaza
Tigre
Tigre
Vaupes
Vaupes


Mazin-Rio Napo
Barranquita-Rio Huallaga
Lagunas-Rio Huallaga
Lago Agrio-Rio Napo
Chuchufindi-Rio Napo
Rio Napo
Intuto-Rio Tigre
Quebrada Intuto
Rio Papuri
Rio Papuri


Collection #'s 194 and 199 were combined to form population 4 and #'s 333 and 334
were combined to form population 8 in order to include these individuals in F-statistic
estimates.


Collection #


030 43' S
060 15' S
050 45' S
000 05' N
000 05' S
000 50' S
040 00' S
040 00' S
000 40' N
000 40' N


730 04' W
750 45' W
760 05' W
760 50' W
760 02' W
770 15' W
740 25' W
740 45' W
700 10' W
700 15' W














APPENDIX B
DNA EXTRACTION PROTOCOL

Extraction Protocol Adapted from Doyle and Doyle (1987)

1. CTAB buffer prepared daily
a. Polyvinylpyrrolidone (PVP) added to b-mercaptoethanol (b-merc) in CTAB
solution and stirred to dissolve right before starting extractions. Used 0.5 ml
CTAB + 0.02 g PVP + 2.5 [l b-merc per plant sample.

2. 15 mg of silica-dried plant tissue weighed out

3. Tissue ground with mortar and pestles
a. Pestles were stored in 10% bleach solution and rinsed well with DI
purified water before they were used on a new plant sample
b. Grinding was done with a pinch of autoclaved sand

4. 500 iL of CTAB buffer added to ground tissue sample in separate eppendorf tubes

5. Sample tubes incubated at 550 C for 1 h

6. 500 [L of 24:1 chloroform:iso-amyl alcohol added to sample tubes which were then
vortexed (mixed)

7. Tubes centrifuged for 10 minutes at maximum speed (13000 rpm).
a. Following centrifugation, there were three layers; top: aqueous phase,
middle: debris and proteins, bottom: chloroform

8. Pipetted off the aqueous phase taking care not to suck up any of the middle or
chloroform phases. Pipetting slowly helped with this

9. Placed each of the aqueous phases into new labeled eppendorf tubes

10. Estimated the volume of the aqueous phases

11. Added 0.08 volumes of cold 7.5 M ammonium acetate into the new tubes

12. Added 0.54 volumes (using the combined volume of aqueous phase and added
AmAc) of cold isopropanol (= 2-propanol) into the new tubes

13. Mixed (vortexed) tubes well









14. Placed tubes in freezer for 15 min

15. Centrifuged tubes for 3 min at maximum speed

16. Poured off the liquid in each tube, being careful not to lose the DNA pellets

17. Added 700 [L of cold 70% Ethanol to each tube and mixed

18. Centrifuged tubes for 1 min at maximum speed

19. Poured off the liquid in each tube, being careful not to lose the DNA pellet

20. Added 700 iL of cold 95% Ethanol to each tube and mixed

21. Centrifuged tubes for 1 min at maximum speed

22. Poured off the liquid in each tube, being careful not to lose the DNA pellets

23. Dried the pellets in the speed vacuum centrifuge for 20 min

24. Re-suspended DNA sample pellets with 100[L of TE buffer overnight in refrigerator

Stock Solutions


CTAB: for 1L of CTAB buffer

100 mL of 1 M Tris, pH 8.0
280 mL of 5 M NaCl
40 mL of 0.5 M EDTA
20 g of CTAB (Cetyltrimethyl ammonium bromide)

TE buffer: for 1L

10 mM 10 ml of 1 M Tris, pH 8.0
1 mM 2 ml of 0.5 M EDTA

1 M Tris, pH 8.0: for 1 L

121.1 g Tris (Fisher Cat#: BP152-5)
700 ml ddH20
Dissolved Tris and brought to 900 ml.
pH brought to 8.0 with concentrated HC1 (-50ml)
Brought to 1 L






55


0.5 M EDTA pH 8.0: for 1 L

186.12 g of EDTA
750 ml ddH20
Added about 20 g of NaOH pellets
Slowly added more NaOH until pH was 8.0

5M NaCl: for 1 L

292.2 g of NaCl
700 ml ddH20
Dissolved and brought to 1 L

















APPENDIX C
PAIRWISE GENETIC DIFFERENTIATION AMONG POPULATIONS AND TESTS
OF SIGNIFICANCE WITH BONFERRONI CORRECTIONS

Table C-1. Pairwise genetic differentiation within colonist metapopulation



POP 1 2 3 4 5 6 7 8 9 10
1 0 0.0192 0.0179 0.0578 0.0586 0.0388 0.0449 0.0331 0.0052 0.0205
2 n.s. 0 0.0096 0.0579 0.0379 0.0236 0.0174 0.0258 -0.009 0.0035
3 n.s. n.s. 0 0.0613 0.0344 0.0245 0.0115 0.0109 0.0051 0.0136
4 0.0045 0.009 0.009 0 0.0497 0.0451 0.0547 0.0489 0.0491 0.0513
5 0.0225 n.s. n.s. 0.0045 0 0.0158 0.0501 0.0430 0.0301 0.0085
6 n.s. n.s. n.s. 0.0045 n.s. 0 0.0245 0.0335 0.0240 0.0133
7 n.s. n.s. n.s. 0.0045 0.0045 n.s. 0 0.0054 0.0250 0.0202
8 n.s. n.s. n.s. 0.0045 0.0045 0.045 n.s. 0 0.0213 0.0277
9 n.s. n.s. n.s. 0.0045 n.s. n.s. n.s. n.s. 0 0.0012
10 n.s. n.s. n.s. 0.009 n.s. n.s. n.s. n.s. n.s. 0



Pairwise 0-values (Weir and Cockerham 1984) averaged over loci on top half of matrix,
P-values (Bonferroni corrections) on bottom. Bold pairwise 0-values correspond to
significant P-values (P<0.05) listed in bottom half of matrix; n.s. indicates non-
significance.



Table C-2. Pairwise genetic differentiation within indigenous metapopulation



POP 1 2 3 4 5 6 7 8 9 10
1 0 0.017 0.0131 0.0384 0.0038 0.071 0.0368 0.0091 0.0447 0.0246
2 n.s. 0 -0.0047 0.0575 -0.0167 0.0084 0.0083 0.0033 0.0091 0.0264
3 n.s. n.s. 0 0.0665 0.0068 0.0395 0.0246 0.0021 0.0296 0.0307
4 n.s. 0.0315 0.018 0 0.0215 0.0652 0.0323 0.0369 0.0372 0.0211
5 n.s. n.s. n.s. n.s. 0 -0.0065 -0.0149 -0.0042 0.0061 0.0115
6 n.s. n.s. n.s. n.s. n.s. 0 0.0037 0.0164 0.0043 0.0423
7 n.s. n.s. n.s. n.s. n.s. n.s. 0 0.0115 0.0222 0.0202
8 n.s. n.s. n.s. n.s. n.s. n.s. n.s. 0 0.0128 0.0083
9 n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. 0 0.0072
10 n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. n.s. 0







57


Table C-3. Pairwise genetic differentiation of eight populations of five peach palm
landraces sampled from El Dorado collection



POP 1 2 3 4 5 6 7 8
1 0 0.02927 0.0016 -0.0506 0.0038 -0.0031 -0.0142 0.1905
2 n.s. 0 0.0818 0.1144 0.1417 0.0868 0.0613 0.3213
3 n.s. n.s. 0 -0.0525 0.0949 0.004 -0.058 0.2386
4 n.s. n.s. n.s. 0 -0.0427 -0.0222 -0.0522 0.2609
5 n.s. n.s. n.s. n.s. 0 0.0308 0.0713 0.3364
6 n.s. n.s. n.s. n.s. n.s. 0 0.0055 0.2122
7 n.s. n.s. n.s. n.s. n.s. n.s. 0 0.1222
8 n.s. n.s. n.s. n.s. n.s. n.s. n.s. 0















LIST OF REFERENCES


Adin A., Weber J.C., Sotelo-Montes C., Vidaurre H., Vosman B. and Smulders M.J.M.
2004. Genetic differentiation and trade among populations of peach palm (Bactris
gasipaes Kunth) in the Peruvian Amazon- implications for genetic resource
management. Theor. App. Genet. 108, 1564-1573.

Austerlitz F., Mariette S., Machon N., Gouyon P.-H. and Godelle B. 2000. Effects of
colonization processes on genetic diversity: differences between annual plants and
trees species. Genetics 154, 1309-1321.

Baker A.J. and Moeed A. 1987. Rapid genetic differentiation and founder effect in
colonization populations of common mynas (Acridotheres tristis). Evolution 41,
525-538.

Balloux F, Brunner H., Lugon-Moulin N., Hausser J and Goudet J. 2000. Microsatellites
can be misleading: an empirical and simulation study. Evolution 54, 1414-1422.

Balloux F and Goudet J. 2002. Statistical properties of population differentiation
estimators under stepwise mutation in a finite island model. Mol. Ecol. 11, pp. 771-
783.

Barton N.H. and Gale K.S. 1993. Genetic analysis of hybrid zones. In: Harrison R.G.
(ed), Hybrid Zones and the Evolutionary Process. Oxford Univ. Press, New York,
pp. 13-45.

Bawa K.S. 1992. Mating systems, genetic differentiation and speciation in tropical rain
forest plants. Biotropica 24, 250-255.

Bohonak A.J. 2002. IBD (Isolation by Distance): a program for analyses of isolation by
distance. J. Heredity 93, 153-154.

Brodie A.W., Labarta-Chavarri R.A. and Weber J.C. 1997. Tree germplasm management
and use on-farm in the Peruvian Amazon: a case study from the Ucayali region,
Peru. Research report, Overseas Development Institute, London and International
Centre for Research in Agroforestry, Nairobi, 65 pp.

Brown A.H.D. and Marshall D.R. 1995. A basic sampling strategy: theory and practice.
In: Guarino L., Rasmanaths Rao V. and Reid R. (eds), Collecting plant genetic
diversity-technical guidelines. CAB International, Wallingford, pp. 75-91.









Chase M.R., Moller C., Kesseli R. and Bawa K.S. 1996. Distant gene flow in tropical
trees. Nature 383, 398-399.

Chaumeil J.-P. 2001. The blowpipe Indians: variations on the theme of blowpipe and tube
among the Yahua Indians of the Peruvian Amazon. In: Rival, L.M. and Whitehead
N.L. (eds), Beyond the visible and the material: the amerindianization of society in
the work of Peter Riviere. Oxford Univ. Press, New York, pp. 81-100.

Chesson P.L. 1985. Coexistence of competitors in spatially and temporally varying
environments: a look at the combined effects of different sorts of variability. Theor.
Pop. Biol. 28, 263-287.

Choy S.C. and Weir B.S. 1978. Exact inbreeding coefficients in populations with
overlapping generations. Genetics 89, 591-614.

Clement C.R. 1988. Domestication of the pejibaye palm (Bactris gasipaes): past and
present. Adv. Econ. Bot. 6, 155-174.

Clement C.R. and Mora-Urpi J. 1988. Phenotypic variation in peach palm observed in the
Amazon basin. In: Clement C.R. and Coradin L. (eds), Final report (revised): Peach
palm (Bactris gasipaes H.B.K.) germplasm bank. U.S. Agency for International
Development, Manaus, pp. 20-54.

Clement C.R. 1989. The potential use of the pejibaye palm in agroforestry systems.
Agrof Syst. 7, 201-212.

Clement C.R. 1990. Regeneracgo natural de pupunha (Bactris gasipaes). Acta
Amazonica 20, 399-403.

Clement C.R. 1992. Domesticated palms. Principes 36, 70-78.

Clement C.R. 1995. Growth and genetic analysis of pejibaye (Bactris gasipaes Kunth,
Palmae) in Hawaii. Ph.D. Dissertation, Univ. Hawaii Manoa, Honolulu, 221 pp.

Clement C.R., Mallikarjuna K.A. and Manshardt R.M. 1997. Allozyme variation in
spineless pejibaye (Bactris gasipaes Palmae). Econ. Bot. 51, 149-157.

Clement C.R., Nelcimar R.S., Rodrigues D.P., Astolfi-Filho S., Moreno Y.N., Pascual
V.T. and Rodriguez F.J.G. 2002. Use of AFLPs to distinguish landraces of pejibaye
(Bactris gasipaes) in Brazilian Amazonia. Scientia Agricola 59, 749-753.

Clement C.R., Rocha S.F.R., Cole D.M. and Vivan J.L. 2004a. Conservacgo on farm. In:
Nass L.L. (ed), Recursos geneticos vegetais. Embrapa Recursos Geneticos e
Biotecnologia, Brasilia, in press.









Clement C.R., Weber J.C., Van Leeuwen J., Astorga Domian C., Cole D.M., Arevalo
Lopez L.A. and Arguello H. 2004b. Why extensive research and development did
not promote use of peach palm fruit in Latin America. In: Nair P.K.R., Rao M.R.
and Buck L.E. (eds), New vistas in agroforestry: a compendium for the First World
Congress of Agroforestry, Advan. Agrofor. Vol. 1. Kluwer, Dordrecht, pp. 195-
206.

Cockerham C.C. 1969. Variance of gene frequencies. Evolution 23, 72-84.

Conklin H. 1957. Hanun6o agriculture in the Philippines. Food and Agriculture
Organization of the United Nations, Rome.

Denevan W.M. and Treacy J.M. 1987. Young managed fallows at Brillo Nuevo. In:
Denevan W.M. and Padoch C. (eds), Swidden-fallow agroforestry in the Peruvian
Amazon. Advan. Econ. Bot. 5. New York Botanical Garden, Bronx, pp. 8-46.

Dieringer D. and Schlotter C. 2003. Microsatellite analyzer (MSA): a platform
independent analysis tool for large microsatellite data sets. Mol. Ecol. Notes 3,
167-169.

Doebley J. 1989. Isozymic evidence and the evolution of crop plants. In: Soltis D. and
Soltis P. (eds), Isozymes in plant biology. Dioscorides Press, Portland, pp. 165-191.

Doyle J.J. and Doyle J.L. 1987. A rapid DNA isolation procedure for small quantities of
fresh leaf tissue. Phytochemistry Bulletin 19, 11-15.

Easteal S. 1985. The ecological genetics of introduced populations of the giant toad Bufo
marinus. II. Effective population sizes. Genetics 110, 107-122.

Ennos R.A. 1994. Estimating the relative rates of pollen and seed migration among plant
populations. Heredity 72, 250-259.

Erikson P. 2001. Myth and material culture: Matis blowguns, palm trees, and ancestors.
In: Rival, L.M. and Whitehead N.L. (eds), Beyond the visible and the material: the
amerindianization of society in the work of Peter Riviere. Oxford Univ. Press, New
York, pp. 101-122.

Excoffier L., Smouse P.E. and Quattro J.M. 1992. Analysis of molecular variance
inferred from metric distances among DNA haplotypes: applications to human
mitochondria DNA restriction data. Genetics 131, 479-491.

Falconer D.S. and Mackay T.F.C. 1996. Introduction to quantitative genetics. Fourth
edition. Longman, Essex, 464 pp.

Ferreira E. 1999. The phylogeny of pupunha (Bactris gasipaes Kunth, Palmae) and allied
species. In: Henderson A. and Borchsenius F. (eds), Evolution, variation and
classification of palms. Memoirs of the New York Botanical Garden vol. 83. New
York Botanical Garden Press, Bronx, pp. 225-236.









Gaiotto F.A., Grattapaglia D. and Vencovsky R. 2003. Genetic structure, mating system,
and long-distance gene flow in heart of palm (Euterpe edulis Mart.). Heredity 94,
399-406.

Gilpin M. 1991. The genetic effective size of a metapopulation. Biol. Jour. Linn. Soc. 42,
165-175.

Goldstein, D.B. and Schotterer, C. (eds) 1999. Microsatellites: evolution and
applications. Oxford University Press; Oxford, New York, 352 pp.

Guo S.W. and Thompson E.A. 1992. Performing the exact test for Hardy-Weinberg
proportions for multiple alleles. Biometrics 48, 2868-2872.

Hairston N.G., Ellner S. and Kearns C.M. 1996. Overlapping generations: the storage
effect and the maintenance of biotic diversity. In: Rhodes O.E. Jr., Chesser R.K.
and Smith M.H. (eds), Population dynamics in ecological space and time. Univ.
Chicago Press, Chicago, pp. 109-145.

Hamrick J.L., Godt M.J.W. and Sherman-Broyles S.L. 1992. Factors influencing levels of
genetic diversity in woody plant species. New Forests 6, 95-124.

Hamrick J.L. and Godt M.J.W. 1996. Effects of life history traits on genetic diversity in
plant species. Phil. Trans. Royal Soc. London B. 351, 1291-1298.

Hamrick J.L. and Nason J.D. 1996. Consequences of dispersal in plants. In: Rhodes O.E.
Jr., Chesser R.K. and Smith M.H. (eds), Population dynamics in ecological space
and time. Univ. Chicago Press, Chicago, pp. 203-236.

Hamrick J.L. and Nason J.D. 2000. Gene flow in forest trees. In: Young A., Boshier D.
and Boyle T. (eds), Forest conservation genetics: principles and practice. CSIRO
Publ. and CABI Publ., Collingwood and Wallingford, pp. 81-90.

Hanski I. and Gilpin M. 1991. Metapopulation dynamics: brief history and conceptual
domain. Biol. Jour. Linnean Soc. 42, 3-16.

Hanski I. 1998. Metapopulation dynamics. Nature 396, 41-49.

Hanski I. 1999. Metapopulation ecology. Oxford Univ. Press, Oxford, New York, 313 pp.

Hartl D.L. 2000. A primer of population genetics. Third edition. Sinauer Assoc. Publ.,
Sunderland, 221 pp.

Hellberg M.E. 1994. Relationships between inferred levels of gene flow and geographic
distance in a philopatric coral, Balanophyllia elegans. Evolution 48, 1829-1854.

Henderson A. 2000. Bactris (Palmae). Flora neotropica monograph 79. New York
Botanical Garden Press, Bronx, 181 pp.









Hill W.G. 1972. Effective size of populations with overlapping generations. Theor. Pop.
Biol. 3, 278-289.

Huber J. 1904. A origem da pupunha. Boletim do Museu Paraense Emilio Goeldi 4, 474-
476.

Jain S.K. and Bradshaw A.D. 1966. Evolutional divergence among adjacent plant
populations. I. The evidence and its theoretical analysis. Heredity 21, 407-441.

Johnson D.L. 1977. Inbreeding in populations with overlapping generations. Genetics 87,
581-591.

Karp A. 2002. The new genetic era: will it help us in managing genetic diversity? In:
J.M.M. Engels, V.R. Rao, A.H.D. Brown and M.T. Jackson (eds.) Managing plant
genetic diversity. CAB Int. Publ., Wallingford, pp. 43-56.

Karp A., Kresovich S., Bhat K.V., Ayad W.G. and Hodgkin T. 1997. Molecular tools in
plant genetic resources conservation: a guide to the technologies. International
Plant Genetic Resource Institute; Rome, 112 pp.

Kimura M. 1953. "Stepping stone" model of population. Ann. Rept. Nat. Inst. Genetics
Japan 3, 62-63.

Labarta R.A. and Weber J.C. 1998. Valorizaci6n econ6mica de bienes tangibles de cinco
species arb6reas agroforestales en la Cuenca Amaz6nica Peruana. Rev. Forestal
Centroamericana 23, 12-21.

Le Corre V. and Kremer A. 1998. Cumulative effects of founding events during
colonization on genetic diversity and differentiation in an island and stepping-stone
model. J. Evol. Biol. 11, 495-512.

Lengkeek, A.G. 2003. Diversity makes a difference- farmers managing inter- and intra-
specific tree species diversity in Meru Kenya. Ph.D. Thesis, Wageningen
University, Wageningen.

Levin D.A. 1981. Dispersal vs. gene flow in plants. Ann. Mis. Bot. Garden 68, 233-253.

Levin D.A. 1988. Consequences of stochastic elements in plant migration. Am. Nat. 132,
643-651.

Levin D.A. and Kerster H.W. 1974. Gene flow in seed plants. Evol. Biol. 7, 139-220.

Levins R. 1970. Extinction. In: Gerstenhaber M. (ed), Some mathematical problems in
biology. Am. Math. Soc., Providence, pp. 77-107.

Li W.-H. 1976. Effects of migration on genetic distance. Am. Nat. 110, 841-847.









Listabarth C. 1996. Pollination of Bactris by Phyllotrox and Epurea. Implications of the
palm breeding beetles on pollination at the community level. Biotropica 28, 69-81.

Louette D. 2000. Traditional management of seed and genetic diversity: what is a
landrace? In: Brush S.B. (ed), Genes in the field: on-farm conservation of crop
diversity. Lewis Publ., International Development Research Centre, International
Plant Genetic Resource Institute, Boca Raton, pp. 109-142.

Loveless M.D. and Hamrick J.L. 1984. Ecological determinants of genetic structure in
plant populations. Ann. Rev. Ecol. Syst. 15, 65-95.

McCauley D.E. 1991. Genetic consequences of local population extinction and
recolonization. Trends Ecol. Evol. 6, 5-8.

McCauley D.E. 1993. Genetic consequences of extinction and recolonization in
fragmented habitats. In: Kareiva P.M., Kingsolver J.G. and Huey R.B. (eds), Biotic
interactions and global change. Sinauer Assoc., Sunderland, pp. 217-233.

Martinez A.K., Gaitan-Solis E., Duque M.C., Bernal R. and Tohme J. 2002.
Microsatellite loci in Bactris gasipaes (Arecaceae): their isolation and
characterization. Mol. Ecol. Notes 2, 408-410.

Maruyama T. and Fuerst P.A. 1985. Population bottlenecks and nonequilibrium models
in population genetics. III. Genic homozygosity in populations which experience
periodic bottlenecks. Genetics 111, 691-703.

McKey D. and Beckerman S. 1993. Chemical ecology, plant evolution and traditional
cassava cultivation systems. In: Hladik C.M., Linares O.F., Pagezy H., Semple A.
and Hadley M. (eds), Food and nutrition in tropical forests: biocultural interactions.
Man in the Biosphere Series vol. 13. UNESCO, Paris, pp. 83-112.

Miranda, I.P. de and Clement C.R. 1990. Germinaci6n y almacenamiento del polen de
pejibaye (Bactris gasipaes H.B.K., Palmae). Rev. Biol. Trop. 38, 29-33.

Mora-Urpi J. and Solis E.M. 1980. Polinizaci6n en Bactris gasipaes H.B.K. (Palmae).
Rev. Biol. Trop. 28, 153-174.

Mora-Urpi J. 1982. Polinizaci6n en Bactris gasipaes H.B.K. (Palmae): nota adicional.
Rev. Biol. Trop. 30, 174-176.

Mora-Urpi J. and Clement C.R. 1988. Races and populations of peach palm found in the
Amazon basin. In: Clement C.R. and Coradin L. (eds), Final report (revised): Peach
palm (Bactris gasipaes H.B.K.) germplasm bank. U.S. Agency Int. Develop.,
Manaus, pp. 78-94.

Mora-Urpi J., Weber J.C. and Clement C.R. 1997. Peach palm (Bactris gasipaes Kunth):
promoting the conservation and use of underutilized and neglected crops.
International Plant Genetic Resource Institute, Rome.









Mora-Urpi J and Echeverria J.G. (eds) 1999. Palmito de pejibaye (Bactris gasipaes
Kunth): su cultivo e industrializaci6n. Univ. Costa Rica Press, San Jose, 260 pp.

Nei M., Maruyama T. and Chakraborty P. 1975. The bottleneck effect and genetic
variability in populations. Evolution 29, 1-10.

Newbury H.J. and Ford-Lloyd B.V. 1997. Estimation of genetic diversity. In: Maxted N.,
Ford-Lloyd B.V. and Hawkes J.G. (eds), Plant genetic conservation: the in situ
approach. Chapman and Hall, London, pp. 192-206.

Nybom H. and Bartish I.V. 2000. Effects of history traits and sampling strategies on
genetic diversity estimates obtained with RAPD markers in plants. Persp. Plant
Ecol. Evol. and Syst. 3, 93-114.

Pannell J.R. and Charlesworth B. 1999. Neutral genetic diversity in a metapopulation
with recurrent local extinction and recolonization. Evolution 53, 664-676.

Pannell J.R. and Charlesworth B. 2000. Effects of metapopulation processes on measures
of genetic diversity. Phil. Trans. Royal Soc. London B. 355, 1851-1964.

Patifo V.M. 1963. Plantas cultivadas y animals domesticos en America equinoccial.
Tomo I. Frutales. Imprenta Departmental, Cali, 547 pp.

Purvis A. and Hector A. 2000. Getting the measure of biodiversity. Nature 405, 212-219.

Raymond M. and Rousset F. 1995a. GENEPOP (version 1.2): population genetics
software for exact tests and ecumenicism. J. Heredity 86, 248-249.

Rival L.M. 2002. Trekking through history: the Huaorani of Amazonian Ecuador.
Columbia Univ. Press, New York, pp. 84-93.

Rodrigues D.P. 2001. Analise das morfo-racas primitivas de pupunha (Bactris gasipaes
Kunth) mantidas no banco ativo de germoplasma de pupunha com marcadores
moleculares RAPDs. Master's Thesis, Universidade de Brasilia, Brasilia.

Rodrigues D.P., Astolfi-Filho S. and Clement C.R. 2004a. Molecular marker-mediated
validation of morphologically defined landraces of pejibaye (Bactris gasipaes) and
their phylogenetic relationships. Genetic Resources and Crop Evolution, in press.

Rodrigues D.P., Vinson C., Ciampi A.Y., Farias I.P., Lemes M.R., Astolfi-Filho S. and
Clement C.R. 2004b. Ten new microsatellite markers for Bactris gasipaes Kunth
(Palmae). Mol. Ecol. Notes, in press.

Rousset F. 1997. Genetic differentiation and estimation of gene flow from F-statistics
under isolation by distance. Genetics 145, 1219-1228.









Seger J and Brockmann J.H. 1987. What is bet-hedging? In: Harvey P.H. and Partridge L.
(eds), Oxford Surveys in Evolutionary Biology Vol. 4. Oxford Univ. Press, Oxford,
New York, pp. 182-211.

Slatkin M. 1977. Gene flow and genetic drift in a species subject to frequent local
extinctions. Theor. Pop. Biol. 12, 253-262.

Slatkin M. 1981. Fixation probabilities and fixation times in a subdivided population.
Evolution 35, 477-488.

Slatkin M. 1985. Gene flow in natural populations. Ann. Rev. Ecol. and Syst. 16, 393-
430.

Slatkin M. 1995. A measure of population subdivision based on microsatellite allele
frequencies. Genetics 139, 457-462.

Sobral B.W.S. and Honeycutt R.J. 1994. Genetics, plants and the polymerase chain
reaction. In: Mullis K.B., Ferre F. and Gibbs R.A. (eds), The polymerase chain
reaction. Birkhauser, Boston, pp. 304-319.

Sokal R.R. and RohlfF.J. 1981. Biometry. Second edition. Freeman, New York.

Sotelo-Montes C. and Weber J.C. 1997. Priorizaci6n de species arb6reas para sistemas
agroforestales en las selva baja del Peru. Agroforesteria en las Americas 4, 12-17.

Sousa N.R., Rodrigues D.P., Clement C.R., Nagao E.O. and Astolfi-Filho S. 2001.
Discriminaqco de racas primitivas de pupunha (Bactris gasipaes) na Amaz6nia
Brasileira por meio de marcadores moleculares (RAPDs). Acta Amazonica 31, 539-
545.

Varvio S.-L., Chakraborty R and Nei M. 1986. Genetic variation in subdivided
populations and conservation genetics. Heredity 57, 189-198.

Wade M.J. and McCauley D.E. 1988. Extinction and recolonization: their effects on the
genetic differentiation of local populations. Evolution 42, 995-1005.

Weber J.C., Labarta-Chavarri R., Sotelo-Montes C., Brodie A.W., Cromwell E.,
Schreckenberg K. and Simons A.J. 1997. Farmers' use and management of tree
germplasm: case studies from the Peruvian Amazon Basin. In: Simons A.J., Kindt
R. and Place F. (eds.), Proceedings of an international workshop on policy aspects
of tree germplasm demand and supply. International Centre for Research in
Agroforestry, Nairobi, pp. 57-63.

Weber J.C., Sotelo-Montes C., Vidaurre H., Dawson I.K. and Simons A.J. 2001.
Participatory domestication of agroforestry trees: an example from the Peruvian
Amazon. Development in Practice 11, 425-433.









Weeden N.F. and Wendel J.F. 1989. Genetics of plant isozymes. In: Soltis D. and Soltis
P. (eds), Isozymes in plant biology. Dioscorides Press, Portland, pp. 46-72.

Weir B.S. and Cockerham C.C. 1984. Estimating F-statistics for the analysis of
population structure. Evolution 38, 1358-1370.

Whitlock M.C. and McCauley D.E. 1990. Some population genetic consequences of
colony formation and extinction: genetic correlations within founding groups.
Evolution 44, 1717-1724.

Wright S. 1931. Evolution in Mendelian populations. Genetics 16, 97-259.

Wright S. 1943. Isolation by distance. Genetics 28, 114-138.

Wright S. 1946. Isolation by distance under diverse mating systems. Genetics 31, 39-59.

Yang R.-C. 2000. Zygotic associations and multilocus statistics in a nonequilibrium
diploid population. Genetics 155, 1449-1458.

Yang R.-C. 2002. Analysis of multilocus zygotic associations. Genetics 161, 435-445.

Zhivotovsky L.A. and Feldman M.W. 1992. On models of quantitative genetic
variability: a stabilizing selection-balance model. Genetics 130, 947-955.















BIOGRAPHICAL SKETCH

David M. Cole was born and raised in Rochester, New York. He first attended the

Utah State University School of Forestry, from 1992 until 1994. He continued pursuit of

a bachelor's degree in 1997, at the University of California at Santa Cruz, and graduated

with college honors in August 1999, with a Bachelor of Arts in Environmental Studies

(with an agroecology emphasis).