<%BANNER%>

Biological Functions and Molecular Mechanisms of the Interleukin-4 Signaling Pathways in Autoimmune Exocrinopathy Using ...


PAGE 1

BIOLOGICAL FUNCTIONS AND MOLECULAR MECHANISMS OF THE INTERLEUKIN-4 SIGNALING PATHWAYS IN AUTOIMMUNE EXOCRINOPATHY USING THE NOD.B10. H2b MOUSE MODEL OF SJGRENS SYNDROME By JUEHUA GAO A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2004

PAGE 2

Copyright 2004 by Juehua Gao

PAGE 3

Dedicated to my husband Zhan; and to my parents, Aizhu Yu and Zhangxiao Gao.

PAGE 4

iv ACKNOWLEDGMENTS I would like to express my deepest gratitude to my advisor, Dr. Ammon B. Peck, for his guidance and support during my graduate studies. He constantly encourages me to explore new ideas and shows me how to pursue these ideas scientifically. He is a knowledgeable and wise person, and gives me lots of invaluable advice on the project, science and life in general. Dr. Michael Humphrey-Beher left us three years ago, but his courage will always inspire me to follow my dreams. I would like to thank my supervisory committee (Drs Wayne McCormack, Laurence Morel, Edward Chan, and Maria Grant) and former committee members (Drs Sheldon Schuster and Andrew Muir) for their great suggestions and comments over the past few years. I am truly, deeply grateful for all the help of Janet Cornelius. Janet teaches me everything, and she makes sure I have everything I need for the experiments on time. She gives me tremendous technical help as well as suggestions in everyday life. I thank Dr. Sally Litherland for her input and help on this project; Dr. Seunghee Cha for many enjoyable discussions and emotional support during my most difficult times; Dr. Smruti Killedar for tremendous help on preparations for many experiments. I thank the entire laboratory, Cuong, Woosuk, Joy, Lori, Vinette, Danny, Brian, Jin, Eric, and many former students to make my graduate study a very special memory in my life. I would like to express my sincere gratitude to my parents for always supporting me, and praying for me no matter where I am and what I am doing; to my brother Wenda, who inspired my interest in science in the first place; and last but not least, to my husband Zhan, without whose love, understanding and support, I would not be here today.

PAGE 5

v TABLE OF CONTENTS page ACKNOWLEDGMENTS..................................................................................................iv LIST OF TABLES............................................................................................................vii LIST OF FIGURES..........................................................................................................viii ABSTRACT....................................................................................................................... xi CHAPTER 1 INTRODUCTION.......................................................................................................1 Sjgrens Syndrome ....................................................................................................1 Etiology and Pathogenesis....................................................................................2 Sjgrens Syndrome Mouse Model......................................................................4 NOD Strain.......................................................................4 NOD Congenic and Knockout Strains.............. .....5 B cells and Sjgrens Syndrome .................................................................................7 Autoantibodies and Patho g e n esi s ................................................................................. 9 IL4 and Its Signal Transduction Pathway..................................................................11 IL4 and IL4 Receptor. ........................................................................................12 IL4 Pathways...................... IL4/Stat-6 Pathway.......... IL4/IRS Pathway............. Specific Aims.....................................................................................................16 2 GENERATION OF A CELL LINE THAT STABLY EXPRESSES MOUSE TYPE-3 MUSCARINIC ACETYLCHOLINE RECEPTOR FOR DETECTION OF AUTOANTIBODIES...........................................................................................19 Introduction............................................................................................19 Materials and Methods...........................................................................21 Results....................................................................................................25 Conclusion and Discussion ...................................................................27 3 GENERATION AND CHARACTERIZATION OF NOD.B10H2b .IL4-/MOUSE..................................................................................................35

PAGE 6

vi Introduction............................................................................................35 Materials and Methods . ......................................................................... 3 7 Results. .................................................................................................. 4 3 Conclusion and Discussion ...................................................................51 4 IL4: THE CONTROLING ELEMENT FOR DEVELOPMENT OF CLINICAL DISEASE IN MOUSE MODEL OF SJOGREN'S SYNDROME.........69 Introduction............................................................................................69 Materials and Methods . ......................................................................... 71 Results....................................................................................................73 Conclusion and Discussion ...................................................................75 5 IL-4 SIGNAL TRASDUCTION PATHWAYS: DIFFERENTIAL EXPRESSION OF THE STAT-6 PATHWAY CONTROLLING IG ISOTYPE SWITCH IN SJS-LIKE DISEASE IN NOD MICE................................................................84 Introduction............................................................................................84 Materials and Methods...........................................................................85 Results....................................................................................................89 Conclusion and Discussion ...................................................................92 6 DETECTION OF ANTI TYPE-3 MUSCARINIC ACETYLCHOLINE RECEPTOR AUTOANTIBODIES IN SJOGREN'S SYNDROME PATIENTS' SERA...................................................................................................111 Introduction..........................................................................................111 Materials and Methods.........................................................................113 Results. ................................................................................................ 11 6 Conclusion and Discussion . ............................................................... 11 8 7 CONCLUSION..................................................................................124 LIST OF REFERENCES................................................................................................131 BIOGRAPHICAL SKETCH..........................................................................................140

PAGE 7

vii LIST OF TABLES Table page 3-1 L i st of murine c y toki n e p r imer seque n ce used in P CR........44 3-2 List of murine transcription factor primers sequence used in PCR.. 5-1 L i st of murine S T AT6 and neo m y c in disr u pted STAT6 primer used in PCR g e no t y pi n g ... ... 5-2 Detection of PSP cleav a ge products in saliva of NOD. B 10 H2b. C129S2-STAT6+/ +, NOD.B10. H2b. C129S2-STAT6+/and NOD.B10. H2b. C129S2-STAT6-/-.....100 5-3 Analysis of saliva of various strains ...................104

PAGE 8

viii LIST OF FIGURES Figure page 1-1 IL4 receptor signaling through STAT6 pathway.....................................................17 1-2 IL4 receptor signaling through IRS pathway..........................................................18 2-1 Generation of Flp-In CHO stably express gene of interest.....................................29 2-2 PCR amplification of mM3R from submandibular glands of C57BL/6.................30 2-3 Restriction enzyme digestion of plasmid DNA from transformed clones...............31 2-4 The expression of fusion protein confirmed with westernblot................................32 2-5 Immunoflourescent staining of Flp-In CHO and Flp-In CHO mM3R with mouse sera................................................................................................................ 33 2-6 FACS analysis of M3 receptor autoantibodies in NOD.B10. H2b and Balb/c........34 3-1 Genotyping of NOD.B10 -H2b .IL4-/by PCR..........................................................55 3-2 Lymphocytic infiltration of the salivary and lacrimal glands in the NOD.B10 H2b .IL4-/mouse......................................................................................................56 3-3 Saliva volume and protein concentration from NOD.B10. H2b NOD.IL4-/-, NOD.B10 -H2b .IL4-/mice.......................................................................................57 3-4 Saliva amylase activity from NOD.B10. H2b NOD.IL4-/-, NOD.B10H2b .IL4-/mice.........................................................................................................................58 3-5 Detection of PSP cleavage products from 20 wk old NOD.B10. H2b Balb/c, NOD.IL4-/and NOD.B10 -H2b .IL4-/by HPLC .....................................................59 3-6 Reverse transcription polymerase chain reaction analysis of cytokine of submandibular glands of NOD.B10. H2b and NOD.B10 -H2b .IL4-/-.......................60 3-7 Reverse transcrition polymerase chain reaction analysis of transcription factors of submandibular glands of NOD.B10 .H2b and NOD.B10 -H2b.IL4-/-...................61 3-8 Typic FACS histogram profile with StemSepTM murine B cell enrichment. .........62

PAGE 9

ix 3-9 cDNA GEArray mouse signal transduction gene arrays were hybridized with labeled cRNA generated from spleen B cells extracted from 12 wk old NOD.B10. H2b and NOD.B10 -H2b .IL4-/-. .............................................................63 3-10 Spleen IgM and IgG1 isotypic B lymphocyte populations in NOD.B10. H2b and NOD.B10H2b .IL4-/mice.......................................................................................65 3-11 Detection of antinuclear antibodies in mouse serum from 20 wk old Balb/c, NOD.B10. H2b NOD.IL4-/and NOD.B10H2b .IL4-/-............................................66 3-12 FACS analysis of anti-M3R autoantibodies present in the sera of Balb/c, NOD.B10 .H2b NOD.B10 -H2b .IL4-/and NOD.IL4-/-...........................................67 3-13 Immunofluorescent staining of submandibular glands from NOD.B10. H2b and NOD.B10H2b. IL4-/mice.......................................................................................68 4-1 FACS analysis of CD4+GFP+ cell population before and after sorting .. ................78 4-2 FACS analysis of intracellular IL4 in transferred GFP+ cells 2 wk after adoptive transfer.....................................................................................................................79 4-3 Alterations in saliva volume in NOD.B10. H2b. IL4-/after adoptive transfer CD4+ T cells from NOD.B10H2b Gfp .................................................................................80 4-4 FACS analysis of IgM and IgG1 isotypic spleen B lymphocyte populations NOD.B10 H2b I L 4/ a f ter a doptive t r a n sf e r CD 4+ cells from NOD B1 0 H 2 b Gfp .81 4-5 Immunofluorescent staining of isotypic antibodies in submandibular glands of NOD.B10. H2b. IL4-/after adoptive transfer CD4+ T cells from NOD.B10H2b Gfp .................................................................................................................................82 4-6 Flow cytometry analysis of anti-M3R autoantibodies in the sera of 20 wk old NOD.B10. H2b. IL4-/after adoptive transfer CD4+ T cells from NOD.B10 -H2b Gfp .................................................................................................................................83 5-1 Genotyping of NOD.B10H2b. C129S2 STAT6+/+, NOD.B10H2b. C129S2 STAT6+/-, NOD.B10H2b .C129S2-STAT6-/mice by PCR ..................................99 5-2 Morphological changes in the salivary glands of NOD.B10H2b. C129S2 STAT6+/+, NOD.B10H2b. C129S2 STAT6+/and NOD.B10H2b. C129S2-STAT6-/... .......101 5-3 Immunofluorescent staining of infiltrating lymphocytes in salivary glands ........102 5-4 Analysis of cytokine and IL-4 related transcription factor mRNA expression in the submandibular and lachrymal glands ..........................................................103

PAGE 10

x 5-5 Temporal changes in the total saliva volume from NOD.B10H2b .C129S2STAT6+/+, NOD.B10H2b .C129S2-STAT6+/-, and NOD.B10H2b .C129S2-STAT6-/mice ... ..................................................................................................................105 5-6 Total saliva volume from various strains at age 20 w k ........................................106 5-7 Total saliva protein concentration from various strains at age 4 and 20 wk .... .....107 5-8 Saliva amylase activity from NOD.B10H2b .C129S2-STAT6+/+, NOD.B10H2b .C129S2-STAT6+/-, and NOD.B10H2b .C129S2-STAT6-/mice..................108 5-9 Detection of antinuclear antibodies in mouse serum.............................................109 5-10 FACS analysis of anti-M3R autoantibodies present in the sera of 20 weeks old NOD.B10-H2b .C129S2-STAT6+/+, NOD.B10H2b .C129S2-STAT6+/-, and NOD.B10-H2b .C129S2-STAT6-/mice................................................................110 6-1 Expression of human type-3 muscarinic acetylcholine receptors in transfected Flp-In CHO cells...................................................................................................121 6-2 Representative flow cytometric analysis of M3R autoantibody in sera ...............122 6-3 Isotype analysis of M3R autoantibodies in sera of Sjgrens syndrome patients.123

PAGE 11

xi Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy BIOLOGICAL FUNCTIONS AND MOLECULAR MECHANISMS OF THE INTERLEUKIN-4 SIGNALING PATHWAYS IN AUTIMMUNE EXOCRINOPATHY USING THE NOD.B10. H2b MOUSE MODEL OF SJ GRENS SYNDROME By Juehua Gao December 2004 Chair: Ammon B. Peck Major Department: Pathology, Immunology and Laboratory Medicine Sjgrens syndrome (SjS) is a chronic inflammatory disease of the exocrine glands resulting from an aberrant immunological attack against the salivary and lacrimal glands leading to dry mouth and dry eye disease. The non-obese diabetic (NOD) mouse has been identified as an excellent laboratory model to study SjS. The NOD congenic partner strain, NOD.B10.H2b has been shown to exhibit many features of primary SjS in humans. Recent studies have revealed that the Th-2 cytokine, interleukin-4 (IL-4), plays an integral role in the production of autoantibodies reactive against salivary and lacrimal gland cells and subsequent onset of secretory dysfunction. The primary goal of the present research has been to examine the role of IL-4 in development of SjS-like disease using two newly constructed mouse strains, NOD.B10H2b .IL4-/and NOD.B10H2b .C129S2-STAT6-/-.

PAGE 12

xii NOD.B10H2b .IL4-/mice, carrying a dysfunctional IL-4 gene, showed a heightened leukocytic infiltration of the salivary and lacrimal glands, as well as an elevated expression of pro-inflammatory cytokines. Nevertheless, these mice failed to develop a secretory dysfunction. Most importantly, the sera of NOD.B10H2b .IL4-/mice did not contain anti-type-3 muscarinic acetylcholine receptor (anti-M3R) autoantibodies of the IgG1 subclass. Adoptive transfers of IL-4-producing CD4+ T cells into NOD.B10H2b .IL4-/-mice resulted in development of SjS-like disease, further supporting the idea that IL4 is the controlling effector in SjS-like disease present in these animals. NOD.B1 0 H2 b .C129S2 STAT6/ mi c e ca r r y i n g a d y s f u n c tion a l Stat6 g e n e manifested the loss of s e creto r y fu n c tion, howev e r to a lesser d e g r e e as com p ared to their wild t y p e counter p a rt; this suggests that tho u g h STAT6 mediated IL-4 dependent IgG1 autoantibody production, especially anti-M3R, may contribute to disease manifestations, but the clinical disease in NOD mouse model is not m e di a t e d th r o u g h I g G1 i so t y p e spe c i f ic pathogenesis. This will lead us to reexamine the role of I L 4 in non STA T 6 pathw a y s such as its direct B cell effect as as a potential mechanism to drive auto i mmune B cells e x pansion. L a st l y to transla t e these findin g s to SjS patients, anti-M3R autoantibodies were detected in s e ra of SjS p a tients, but not control su b j ects, supporting the concept that the observations made in the NOD mouse model are pertinent to the human disease and point out the future direction on more expanded clinical study and further determining the association between detection of anti-M3R autoantibodies and the prediction and severity of disease.

PAGE 13

1 CHAPTER 1 INTRODUCTION Autoimmune disease is a complex of physiological disorders resulting in unwanted destruction of self tissue due to a breakdown in self-tolerance, which is strictly regulated during lymphocyte development by multiple mechanisms. Many cell type such as B-cells, T-cells, dendritic cells, NK cells, etc. participate in and contribute to the autoimmune disorders. The autoimmune response is driven not only by direct cell–cell interaction but also mediated via soluble molecules such as antibodies, cytokines and chemokines. Sjgren’s Syndrome Sjgren’s syndrome (SjS) is an autoimmune disease affecting primarily the salivary and lacrimal glands leading to dry mouth and dry eye disease. It displays a broad spectrum of clinical manifestations that range from organ-specific exocrinopathy to systemic disorder involving cardiovascular, renal, respiratory, and central nervous system, etc. Recent studies referred the prevalence in US at 500,000 to 2 million, depending on the classification criteria (Timsic and Rozman, 1999; Jonsson et al ., 2001). Although identification of SjS patients has been historically somewhat arbitrary due to the use of multiple classification criteria world-wide for clinical diagnosis (Manthorpe et al ., 2002), a recent joint effort by American and European researchers has now established a more standardized set of diagnostic markers including ocular symptoms, oral symptoms, histopathology, objective evidences of ocular and salivary glands involvement and the presence of autoantibodies (Vitali et al ., 2002).

PAGE 14

2 Etiology and Pathogenesis Although the precise mechanisms of remain unclear, multiple factors such as genetic, hormonal, environmental, viral and immunological factors are all believed to be involved. Genetic studies have established a correlation between autoimmune disease and certain major histocompatibility complex (MHC) loci. SS correlated to HLA-DR3 and DQ2 in Caucasian, HLA-DR8 and DR5 in Chinese, Japanese and Greek ethnic population. (Arnett et al ., 1988; Kang et al ., 1993; Papasteriades et al ., 1988). Animal studies using the NODscid congenic strain, which lack the functional T and B cells, failed to develop spontaneous sialadenitis, insulitis and diabetes. However, a number of biochemical markers for exocrine differentiation, for instance, amylase, epidermal growth factor (EGF) and parotid secretory protein (PSP) expression, are still aberrantly expressed in the exocrine glands. Generation of C57BL/6.NOD Aec1Aec2 congenic mice demonstrated an onset of Sjgren’s syndrome like pathophysiology characterized by focal lymphocytic infiltration, and followed by loss of secretory function. NOD aec1 and aec 2 intervals provide susceptible genes involved in the genetic control of Sjgren’s syndrome. The predominant female patients in the SjS population raise the possibility of hormone influence in the disease pathogenesis. Though there is no consensus about how hormonal factors influence the disease, several theories suggest that hormonal environment could influence lymphocytes recognize autoantigens, whether differentiate into effector cells or regulatory cells. It has been reported that dihydrotestosterone (DHT), an androgen metabolite, could enhance secretory function and suppress lymphocytic infiltration in mouse model, because DHT favors the development of

PAGE 15

3 regulatory cells through paracrine mediators (Sullivan and Edwards, 1997). On the other hand, ovariectomy has been found to initiate the apoptosis in the infiltrating lymphocytes and plasma cells, which can be prevented by administration of DHT or estradiol (Azzarolo et al 1999a; Azzarolo et al ., 1999b). The implication of viruses in the development of Sjgren's syndrome has long been suspected. However there is no clear evidence so far that links viral infection with induction of Sjgren's syndrome. It has been shown that Sjgren's syndrome patients display an increased content of EBV-DNA in their saliva, and also express EBVassociated antigens in their salivary glands. A recent study showed coxsackie viral RNA is present in tissues and cultured salivary gland epithelium cells from SjS patients but not in normals (Liakos et al ., 2004). In several popular theories the virus remains latent following infection in genetically predisposed individuals, and later coincidently exposes the tissue specific antigen to the immune system. Autoimmunity may also occur when the immune system responds to eradicate the pathogen which contains a protein similar to a host protein, and leads to the autoimmune response and tissue damage that characterize Sjgren's syndrome. During recent years, many studies reported that salivary gland epithelial cells are active players that participate in the initiation and the development of SS lesions. These cells express various molecules involved in lymphoid cell homing and the amplification of epithelial-immune cells interactions, including proinflammatory cytokines chemokines, apoptosis and adhesion molecules such as MHC class I and II molecules, functional B7 costimulatory molecules and CD40 (Dimitriou et al ., 2002;Manoussakis et al ., 1999).

PAGE 16

4 Sjgren’s Syndrome Mouse Model Various mouse models have been studied for their resemblance to autoimmune connective disease in humans, including MRL/lpr, NZB/W, NFS/sld and NOD. NOD Strain NOD mice have been established as an animal model for type I diabetes since 1980. Immune infiltration of the pancreas, starting as early as 2 weeks of age, leads to the destruction of the -cells of the islets and loss of insulin secretion, manifested as a loss of blood glucose regulation. These mice not only develop lymphocytic infiltration in pancreatic islets, but also show obvious infiltration of the exocrine tissues. The observation that the loss of secretory function in NOD mice is independent of the loss of blood glucose regulation implies that there are two independent disease processes involved: the distribution of the pancreatic beta cells resulting in diabetes and the distribution of exocrine gland tissue resulting in an exocrinopathy similar to Sjgren’s syndrome. The evidence that a locus on chromosome 17 Idd1 is essential for diabetes and insulitis but not for the development of autoimmune exocrinopathy further supports the dichotomy between these 2 diseases. A congenic strain, NOD.B10. H2b in which the NOD MHC I-A g7 locus has been replaced by non-diabetogenic MHC locus of C57BL/10, showed autoimmune excrinopathy accompanied by loss of secretory function, but no diabetes. Thus this strain has become an interesting model for primary Sjgren’s syndrome (Robinson et al ., 1998). Studies from NOD and its congenic strain NOD.B10. H2b showed these two strains result a condition mimic human disease, Sjgren’s syndrome, characterized by a temporal lymphocytic infiltration accompanied by a loss of secretory function. Periductal and perivascular lymphocytic infiltration into the submandibular and lacrimal glands begins

PAGE 17

5 around 8-10 weeks and 10-12 weeks of age, respectively. By 18 weeks of age, focal lymphocytic infiltration can be easily found in the exocrine glands and followed by a loss of saliva flow and tear flow (Humphrey-Beher et al ., 1994). Similar to human disease, infiltrates in the salivary glands comprised 45% CD4 T cells, 10-15% CD8 T cells and 20% B cells. There are several reports suggesting macrophage and dendritic cells are also found in the infiltrating cells within the exocrine tissue (Robinson et al ., 1998; Xanthou et al ., 1999). In addition, ductal and acinar epithelial cells from SS patients express the co-stimulatory molecules B7.1 and B7.2 (Manoussakis et al ., 1999). Temporal analysis of cytokine mRNA expression in the submandibular glands of NOD mouse indicated an elevated level of proinflammatory cytokine including IL-1 TNF" IL-6, IL-10, IFN# between 10-12 weeks of age (Robinson et al ., 1998b). Th2 cytokine such as IL-4 and IL-5 are only occasionally detected and in association with strong B cell accumulation (Ohyama et al ., 1996). Similarly, SS patients reveal the expression of IL-1 IL-2, IL-6, IL-10, IL-12, IL-18, TNF" TGF! and IFN# in the minor salivary glands (Boumba et al ., 1995; Kolkowski et al ., 1999). NOD Congenic and Knockout Strains Other NOD congenic and knockout strains provide important tools in dissecting immune or non-immune components contributing to the autoimmune excrinopathy. One of the studies using NOD. scid mouse showed disrupted salivary gland morphology, despite a lack of immune attack on the exocrine tissue. In addition, NOD.Ig null mice, lack functional B cells but still develop histological and physiological changes similar to NOD. Furthermore, development abnormality and abnormal morphogenesis in NOD genetic background mice was observed at the time of birth (Cha et al ., 2001). These observations support the involvement of non-immune factors in the disease pathogeneses

PAGE 18

6 before onset of autoimmunity. A number of biochemical markers such as amylase, epidermal growth factor (EGF), and parotid secretory protein (PSP) were either diminished or aberrantly expressed in exocrine of NOD mouse in the absence of functional lymphocytes (Robinson et al ., 1996). Parotid secretory protein, which appears to be a nonimmune antimicrobial agent capable of modulating bacterial growth and colonization, is aberrantly expressed in the glands of mice with NOD genetic background (Robinson et al ., 1997a). The aberrant PSP was identified as an internally cleaved 27KD isoform at the particular NL-NL site due to the presence of a proteolytic activity in the saliva of older mice with NOD background but not in the young ones or other disease free C57BL/6 and Balb/c (Robinson et al ., 1997b). Though the exact function of this protease is not fully identified yet, the temporal changes in its expression correlate, though independent of the lymphocytic infiltration. Thus it has been used as a biochemical marker related to the disease. A recently developed highly sensitive HPLC assay used a synthetic PSP peptide which includes the specific NL-NL cleavage site as a substrate to detect the presence of protease in the saliva sample. Recent studies on isolation of genetic intervals involved in the autoimmune excrinopathy use repeated backcrossing to place resistant intervals onto a disease prone strain, or susceptible intervals onto a resistant strain. C57BL/6.NOD Aec1Aec2 congenic mouse was generated by transferring the NOD Idd3 and Idd5 susceptibility alleles onto the C57BL/6 disease free mouse, showing a more rapid progression to SS-like symptoms, characterized by focal lymphocytic infiltration in the submandibular glands, and loss of secretory function (Brayer et al ., 2000). Generation of C57BL/6.NOD Aec1Aec2 provides an unique model to study the genetic control of Sjgren’s syndrome.

PAGE 19

7 Study from the NOD.IL4-/showed the exacerbation of inflammatory response with no loss of secretory function, indicating the importance of this neglected cytokine in the disease pathogenesis. Though lack of IL10 also results in an exacerbated inflammatory aspect, lack of IL10 does not significantly influence the onset of disease. The observation that NOD.IFN#-/mouse does not develop inflammation in the salivary glands past 35 weeks of age, while lacrimal showed normal disease progression and lymphocytic infiltration, suggesting IFN# is critical for the development of autoimmune excrinopathy by promoting salivary gland autoreactivity (Brayer et al unpublished observation). In conclusion, studies from various mouse models of Sjgren’s syndrome support the concept that autoimmune excrinopathy progresses in multiple phases, an asymptomatic phase characterized by abnormal differentiation in exocrine tissue accompanied by biochemical changes between 8-12 weeks of age, followed by an immune response against the target organ, generation of autoantibodies and results in the clinical manifestation of loss of secretory function at about 16-20 weeks of age. The development of various cytokine knockout mouse strains further explored components of the inflammatory and humoral phases of the autoimmune response. B cells and Sjgren’s Syndrome It has been recognized that Sjgren’s syndrome begins as benign polyclonal lymphocytic infiltration of the salivary and lacrimal glands, but a small percent of patients may end up with malignant lymphoaggessive disease such as lymphoma. Approximately 45% of primary Sjgren’s syndromes patients are in stage I, described as present only sicca syndrome without any systemic manifestation and laboratory abnormalities. Stage II patients (50%) experience systemic symptoms involving the

PAGE 20

8 pulmonary, renal, hepatic, hematologic, and/or dermatologic systems. Only 5% of patients develop lymphoaggressive disorder such as MALT (mucosa-associated lymphoid tissue) lymphoma and high-grade malignant lymphoma (Skopouli et al ., 2000). Many studies have attempted to identify the factors trigger and drive disease progression; for instance a decrease in the level of serum immunoglobulin, the disappearance of rheumatoid factor, parotid gland enlargement, lymphadenopathy, splenomegaly, etc. A recent study suggested that the presence of parotid enlargement, palpable purpura and low C4 levels during the first examination of a Sjgren’s syndrome patient is associated with the development of lymphoma in the long-term follow-up (Ioannidis et al ., 2002). Chronic stimulation with exogenous antigen or autoantigens has been shown to be involved in the transition from a polyclonal to a monoclonal lesion by increasing frequency of transformation (Kipps et al ., 1989; Bahler et al ., 1997). The transition from polyclonal lymphoproliferation to monoclonal lymphoproliferation, and finally to malignant lymphoma is considered to be a multi-step process involving many important factors such as specific B cell stimulation through surface Ig binding of exogenous antigen or autoantigens, B cell activation, usage of particular VH genes and VL genes and inhibition of apoptosis by over-expression of bcl-2 or related proteins (Masaki et al ., 2003). B lymphocyte development starts in the bone marrow where developing B cells undergo an ordered V(D)J recombination process leading to productive assembly of V, D and J genes at the heavy chain locus, and assembly of V and J genes at the light chain locus. Immature B cells express surface IgM, undergo positive and negative selection events promote the formation of competent non-autoimmune repertoire. The final stage

PAGE 21

9 of B lymphocyte development takes place in the germinal center where activated B cells undergo somatic hyper mutation, affinity maturation, and class switch recombination to express non-IgM receptors. This process depends on the presence of antigenic stimulation and appropriate T-cell help provided by CD40-ligand. Peripheral tolerance occurs when activated B cells undergo Fas-mediated apoptosis in the absence of T cell help (Rajewsky et al ., 1996). Studies with IgG and IgM transgenic mouse models have shown IgM receptors efficiently function for development and tolerance establishment, whereas IgG receptors promote signal for proliferative burst and memory formation (Pogue et al ., 2000; Melamed et al ., 1997) through distinct signaling pathways (Wakabayashi et al ., 2002; Martin et al ., 2002). It is generally thought that although pathogenic autoantibodies detected in autoimmne disorders are predominantly IgG isotypes, these autoantibodies arise from IgM-precursors. But it is not completely understood how autoreactive cells are generated and escape central and/or peripheral tolerance mechanisms. Autoantibodies and pathogenesis Various autoantibodies have been described as being associated with autoimmune excrinopathy. The first autoantibodies identified were directed against nuclear antigens, including anti-Ro/SS-A and anti-La/SS-B, which have been found in 50~70% of patient sera. There have been reports that Ro/SS-A and La/SS-B are over expressed in the cytoplasm and appear on the membrane in the cells infected with virus, in the presence of cytokine, or under oxidative stress (Clark et al ., 1994; Casciola-Rosen et al ., 1994). A variety of autoantibodies have been reported to be present in the sera of primary and secondary SjS patients, including antibodies directed against carbonic anhydrase (Kino-Ohsaki et al. 1996) and proteosome (Feist et al ., 1999), as well as beta-adrenergic receptors (Bacman et al., 1996). Interestingly, the prevalence of the cholinergic antibody

PAGE 22

10 has been reported to be nearly 100% in primary SjS patients and was independent of the presence of anti-SS-A/Ro and anti-SS-B/La autoantibodies (Borda et al. 1996). Recent studies have provided evidence that antibodies reactive with the type-3 muscarinic acetylcholine receptor (M3R) may be the primary underlying cause for the loss of secretory function leading to dry mouth, a common complaint described by patients (Nguyen et al ., 2000; Brayer et al ., 2001). And this specific autoantibody may be an effector of the glandular dysfunction, possibly by blocking the normal signal transduction pathways or desensitization of acinar cells to normal neural stimulations. This concept is supported now by studies showing that the IgG fractions of sera obtained from SjS patients or NOD mice suppress stimulated salivary flow rates when infused into mice. (Robinson et al ., 1998) One hypothesis is surface proteins such as M3R are susceptible to shedding and may be further taken up by antigen presenting cells. Another mechanism is autoantigens can be presented in apoptotic bodies, normally presented to CD4+ T cells (Nagaraju et al ., 2001). The type 3 muscarinic receptor, one of the five muscarinic acetylcholine receptor subtypes that mediate the effects of acetylcholine, is responsible for detrusor smooth muscle contraction and exocrine function in the salivary and lacrimal glands. The M3 subtype, which contains 7 transmembrane domains, interacts with the hetertrimeric G protein Gq to activate the effector enzyme phospholipase C (PLC). PLC cleaves phosphoinositol bis-phosphate (PIP2) into inositol-(1,4,5)-trisphosphate (Ins(1,4,5)P3) and diacylglycerol (DAG). Cytosolic Ca2+ concentration increases after IP3 binding to its receptor on intracellular Ca2+ storage and further activates Ca2+ dependent K+ and Cl-

PAGE 23

11 channels in the basolateral membrane and apical plasma membrane, contributing to fluid secretion (Baum et al ., 1993). Furthermore, the increase in cytosolic Ca2+ is also known to induce the translocation of aquaporins (AQP) to the apical plasma membrane (Ishikawa et al ., 1998). Unlike the many intracellular antigens that give rise to autoantibodies (e.g., SSA/Ro, SS-B/La, Sm and alpha-fodrin), the M3R is a membrane-bound protein directly involved in the parasympathetic neuro-stimulation of exocrine and some non-exocrine cells. Thus, the anti-muscarinic receptor antibody could be potentially responsible for the manifestation of clinical symptoms by interfering with signaling for AQP activation or target secretory cell destruction. IL4 and Its Signaling Pathway IL-4 is a pleiotropic cytokine involved in cell activation, proliferation, and differentiation. IL-4 is mainly produced by a subset of T cells, designated as Th2 cells, by mast cells and by basophilic cells. IL-4 is an important cytokine, which exerts distinct functions on different cells. For B-lymphocytes, IL-4 appears to promote cell survival and proliferation. Although not a growth factor by itself for resting lymphocytes, it can substantially prolong the lives of T and B lymphocytes in culture (Hu-Li et al ., 1987), and it also acts as a co-mitogen for B cell growth (Howard et al ., 1982). It is also known as a switch factor for the IgG1 and IgE isotype switch in mouse and IgG4 and IgE isotype switch in humans. IL-4 leads to the class switch and the production of a different isotype by stimulating the transcription of heavy chain germline genes. It also has a variety of other affects in hematopoietic tissues, including increasing the expression of CD23 and class II MHC molecules (Defrance et al. 1987; Noelle et al. 1984). The different

PAGE 24

12 biological roles IL-4 initiates depends on the activation of different signal pathways (Pesu et al ., 2000). IL-4 and IL-4 Receptor IL-4 is an important cytokine which exerts distinct functions on different cells. For B-lymphocytes, IL-4 appears to promote cell survival and proliferation. Although not a growth factor by itself for resting lymphocytes, it can substantially prolong the lives of T and B lymphocytes in culture (Hu-Li et al. 1987), and also acts as a co-mitogen for B cell growth (Howard et al ., 1982). It is also known as a switch factor for the IgG1 and IgE isotype switch in mouse and in humans. IL-4 leads to the class switch and the production of a different isotype by stimulating the transcription of heavy chain germline genes. It also has a variety of other affects in hematopoietic tissues, including increasing the expression of CD23 and class II MHC molecules (Defrance et al ., 1987; Noelle et al ., 1984). The different biological roles IL-4 initiates depend on the activation of different signal pathways (Pesu et al ., 2000). IL-4R consists of 2 chains: the chain is a 140KD ligand-binding chain that binds IL-4 with high affinity, and a chain shared by other cytokines such as IL-2, IL-7, IL-9 and IL-15 receptors. The cytoplasmic domain of IL-4R chain contains 5 tyrosine residues that are highly conserved among different species. The most proximal tyrosine residue is critical for generating a proliferating signal, and the second, third and fourth tyrosine residues are within a conserved sequence motif for the activation of Stat-6. And the distal tyrosine residue is within an ITIM (immunoreceptor tyrosine-based inhibitory motif) motif that serves as a docking site for different phosphatases. (Fig. 1-1)

PAGE 25

13 IL-4 Pathways IL-4 has 2 main signal transduction pathways: (1) STAT-6 and (2) Insulin Receptor Substrate (IRS). The biological effects result from the activation of downstream signal transduction pathways. IL4/Stat-6 pathway The IL-4R chain associates with JAK-1, whereas the c chain associates with JAK3. In certain cell lines, JAK2 is also reported to associate with IL-4R The binding of IL-4 to its receptor causes tyrosine phosphorylation of IL-4 receptor in the cytoplasmic region and further activation of other adaptor molecules such as JAK1 and JAK3 (Kotanides et al ., 1993). Stat-6 then binds to the phosphorylated receptor through a highly conserved SH2 (Src homology 2 domain) domain, enabling the activated kinases to phosphorylate Stat-6 at a C terminal tyrosine residue. Once phosphorylated, the Stat-6 molecules disengage from the receptor and form the homodimers that translocate into the nucleus to bind to specific DNA motifs in the promoter of IL-4 responsive elements, including CD23, class II MHC or germline immunoglubin g and IL-4R chain (Hou et al ., 1994). (Fig.1-1) Isotype switching is associated with IL-4 transcription induction of germline CH 1 and CH g RNA. Switching to a particular immunoglobulin class is always preceded by the appearance of germline RNA corresponding to that particular class and demonstrates the essential role of transcription induction in the isotype switch. IL-4 activates the tyrosine kinases JAK1 and JAK3 and phosphorylates a number of signaling molecules including transcription factor Stat-6. The observations that B cells from Stat-6 deficient mice are unable to complete the isotype switch to IgE emphasize the possible role of the JAK-Stat-

PAGE 26

14 6 pathway in the development of Th2 immune responses and isotype switching (Takeda et al ., 1996; Kaplan et al ., 1996; Shimoda et al ., 1996; Linchan et al ., 1998). IL-4/IRS Pathway IRS proteins play an important role in maintaining cellular function such as cell growth and metabolism. Four members of IRS family have been identified (Sun et al ., 1991; Sun et al. 1995; Lavan et al ., 1997a; Lavan et al ., 1997b). IRS1 and IRS2 are cytoplasmic proteins involved in regulation of cell proliferation and prevention of apoptosis in response to IL-4. The sequence surrounding the proximal tyrosine residue in the cytoplasmic region of the IL-4R chain is highly homologous to the sequence of the cytoplasmic region of the insulin receptor and IGF-1 receptor and shares the same IRS1/2 signaling pathways. This sequence is termed as the insulin IL-4 receptor motif (I4R). IRSs are recruited to the IL-4R complex by the phosphorylation of the tyrosine residues in the IL-4R chain I4R domain through an N-terminal PTB domain (phosphotyrosine binding domain). JAK1 is critical for IL-4 stimulated induction of IRS-1 phosphorylation through the direct action of JAK1 on IRS-1 (Wang et al ., 1997). The phosphorylated IRS proteins provide docking sites for SH2 domain-containing signaling proteins such as regulatory subunit p85 of PI3-K and Grb-2 (Pesu et al. 2000). These interactions lead to the activation of the PI3-K and Ras/MAPK signaling pathways respectively. PI3-K consists of 2 subunits, an 85 KD regulatory subunit (p85) and a 110 KD catalytic (p110) subunit. Interaction of the p85 subunit with phosphorylated IRS-1/2 molecules results in a conformational change and leads to the activation of the p110 catalytic subunit, which further activates membrane lipids, as well as serine/threonine residues of proteins. Among the membrane lipids, phosphotidylinositol-(3,4,5)-triphosphate (IP3) and

PAGE 27

15 phosphotidylinositol-(3,4)-bisphosphate (PIP2) are the most important ones. These molecules act as secondary messengers for activation of downstram kinases, including serine/threonine kinase Akt (protein kinase B) and other molecules involved in cell survival and prevention of apoptosis. Phosphorylated IRS-1/2 has also been proposed to interact with adapter molecule Grb-2 using its SH2 domain. Grb-2 is constitutively complexed with the guanine nucleotide exchange protein, Sos, which is capable of catalyzing the exchange of GDP for GTP in inactive Ras, producing the active GTP complexed form of Ras. The MAPK pathway is initiated by the serine/threonine kinase Raf following its activation by RasGTP (Fantin et al ., 1999; Nelms et al ., 1999). (Fig.1-2) Thus, IL-4R chain cytoplasmic region has 3 functionally distinct domains: one acts as an interaction site for Janus kinase (JAK1 and JAK3), one is required for activation of proliferative pathways, and a third is involved in the activation of gene expression. IL-4 stimulates 2 independent and bifurcating signal pathways that can direct mitogenesis via the IRS-signaling proteins and specific gene expression via the JAK/STAT-6 pathway for nuclear activated factor ( Kotanides et al ., 1993). Although the exact role of the cytokine IL-4 in the autoimmune exocrinopathy is still unclear, it is observed that the absence of IL-4 prevents the clinical disease. NOD IL4 KO mice show lymphocytic infiltration, increases of proinflammatory cytokines in the salivary glands but do not develop clinical disease. The onset of clinical disease is probably due to the IL-4 dependent production of IgG1 anti-M3R autoantibodies, which are responsible for the final loss of secretory function. Or it is a result of B cell proliferation and clonal expansion.

PAGE 28

16 Specific Aims The primary goal of the studies described in this dissertation has been to investigate the functional importance and molecular mechanisms of the cytokine interleukin-4 (IL-4) in the development of anti-type-3 muscarinic acetylcholine receptor (anti-M3R) autoantibodies in SjS utilizing the NOD.B10. H2b mouse model. Specifically, the studies have been designed to (1) evaluate the role of the cytokine IL-4 in production of anti-M3R autoantibodies capable of effecting clinical SjS-like disease, (2) identify which of the major IL-4 signaling transduction pathways is (are) primarily involved in this process, and (3) determine if the findings in the mouse model have validity in the human disease. To address these three issues, I have Constructed a transfected cell line that stably expresses mouse M3R in order to detect the presence of anti-M3R autoantibodies Generated three new congenic mouse lines: the NOD.B10H2b .IL4-/mouse (an IL4 gene knockout mouse), the NOD.B10H2b Gfp mouse (a mouse expressing the GFP protein), and the NOD.B10H2b. C129S2-STAT6-/mouse (a STAT6 gene knockout mouse) Characterized the phenotype of SjS-like disease in the NOD.B10H2b .IL4-/mouse Defined the influence of IL-4 on the generation of anti-M3R autoantibodies and the subsequent development of autoimmune excrinopathy following adoptive transfer of immune cells capable of providing IL-4 exogenously Evaluated the role of the IL-4-dependent Stat-6 pathway in the onset of secretory dysfunction in the NOD.B10H2b. C129S2-STAT6-/mouse Investigated the presence of anti-M3R autoantibodies in the sera of human SjS patients The results of these studies are presented in individual chapters that follow.

PAGE 29

17 Figure. 1-1. IL4 receptor signaling through STAT6 pathway. The IL-4R chain associates with JAK-1, whereas the c chain associates with JAK3. The binding of IL-4 to its receptor causes tyrosine phosphorylation of IL-4 receptor in the cytoplasmic region and further activation of other adaptor molecules such as JAK1 and JAK3. Stat-6 then binds to the phosphorylated receptor through a highly conserved SH2 domain, enabling the activated kinases to phosphorylate Stat-6 at a C terminal tyrosine residue. Once phosphorylated, the Stat-6 molecules disengage from the receptor and form the homodimers that translocate into the nucleus to bind to specific DNA motifs in the promoter of IL-4 responsive elements, including CD23, class II MHC or germline immunoglubin g and IL-4R chain.

PAGE 30

18 Figure 1-2. IL4 receptor signaling through IRS pathway. IRSs are recruited to the IL-4R complex by the phosphorylation of the tyrosine residues in the IL-4R chain in response to IL4. The phosphorylated IRS proteins provide docking sites for SH2 domain-containing signaling proteins such as regulatory subunit p85 of PI3-K and Grb-2, leading to the activation of the PI3-K and Ras/MAPK signaling pathways respectively. These molecules act as secondary messengers for activation of downstram kinases, including serine/threonine kinase Akt (protein kinase B) and other molecules involved in cell survival and prevention of apoptosis.

PAGE 31

19 CHAPTER 2 GENERATION OF A CELL LINE THAT STABLY EXPRESSES MOUSE TYPE-3 MUSCARINIC ACETYLCHOLINE RECEPTOR FOR DETECTION OF AUTOANTIBODIES Introduction A variety of autoantibodies have been reported to be present in the sera of primary and secondary SjS patients. In the past decade, a growing list of autoantigens has been identified. Though none of them have definitely been associated with autoimmune excrinopathy and loss of secretory function, type 3 muscarinic acetylcholine receptor (M3R) antibody could potentially cause the manifestation of clinical symptoms. The presence of anti-muscarinic acetylcholine receptor antibody was first introduced from the observation that immunoglobulin G from sera of patients with primary Sjgren’s syndrome could recognize and activate muscarinic acetylcholine receptor of rat exorbital lacrimal glands (Bacman et al. 1996). Interestingly, the presence of autoantibodies to exorbital lacrimal gland M3R acts as an "agonist-like agent," which could be responsible for a primary, organ-specific dysfunction (Bacman et al ., 2001). Similarly, this functional assay has shown that immunoglobulin fractions from both primary and secondary SjS inhibit carbachol evoked bladder smooth cell contraction by 50% (Waterman et al. 2000). Synthetic peptides corresponding to the extracellular loops of human M3 muscarinic acetylcholine receptor were used as antigens in Enzyme-linked immunosorbent assay (ELISA) to determine autoantibodies against acinar cells and M3R. However, sera from primary or secondary SjS patients tested by ELISA fail to recognize

PAGE 32

20 the synthetic peptides corresponding to the first, second and third extracellular loops of M3R (Cavill et al. 2002). In a recent study, antibody raised against a short region on the second extracellular loop of the M3R was shown to react with the native receptor on colon smooth muscle and profoundly inhibit postsynaptic M3R-mediated cholinergic neurotransmission in a concentration-dependent manner (Cavill et al. 2004). One possible reason for the lack of reactivity with the M3R is that human anti-M3R autoantibodies could be directed against conformational epitopes created by the disulfidelinkage between first and second extracellular loops or against epitopes created by intermolecular disulfide bonding. Such conformational epitopes would not be expressed by linear synthetic peptides corresponding to the second extracellular loop (Cavill et al. 2004). To better detect autoantibodies against tertiary epitope created by extracellular domains of membrane bound receptor proteins, we have generated a cell line expressing M3R on the surface membrane to use in a cell based assay to detect the presence of autoantibodies. Investigations on whether circulating autoantibodies against M3R could be a new marker for diagnosis for primary and secondary Sjgren’s syndrome have not provided enough evidence for clinical classification due to controversial findings with current detection methods. Generation of mammalian cell lines expressing a gene of interest is often not efficient or stable because the integration of transfected expression vectors at random sites in the genome. Integration into a transcriptionally silent locus could result in little or no expression. This negative or positive effect could also cause significant clonal variations, compromising the comparison of expressed constructs. Our previous efforts

PAGE 33

21 with random integration also failed to result in a long-term stable line (unpublished results). Flp-In targeted integration system provided by Invitrogen is used to generate isogenic stable cell lines. Flp-In host cells, which contain a single Flp recombinase target site in a transcriptionally active genome locus, are used for a site-specific recombination to facilitate integration of the gene of interest into the genome of mammalian cells. Stable cell lines are generated by co-transfecting the host cells with the Flp-In expression vector and Flp-In recombinase expression vector. The expression of recombinase enables the integration of expression vector at the genomic target site. In this part of the study, I have used the Flp-In targeted integration system to generate an isogenic cell line stably express mouse M3R and detect the presence of autoantibodies against M3R using a cell based assay (Gao et al ., 2004). Materials and Methods Generation of Flp-In CHO cells stably expressing mM3R. Cloning of full length mouse M3R coding region was carried out following the protocol as previously shown (Nguyen et al ., 2000). In brief, RT-PCR was performed using mRNA isolated from C57BL/6 submandibular glands (Fast-Track 2.0 mRNA Isolation Kit, Invitrogen, Carlsbad, CA). The PCR was carried out with synthesized forward and reverse oligonucleotide primers whose respective sequences are mM3Rf: 5'CACAATGACCTTGCACAGTAACA-3' and mM3Rr: 5'TGTTACTGTGCAAGGTCATTGTG-3'. PCR was performed as an initial dissociation of the cDNA by heating the reaction mix to 94oC for 3 min, the reaction was carried out for 34 cycles with each cycle consisting of 94oC for 30 seconds, 54C for 30 seconds and

PAGE 34

22 72oC for 30 seconds. After 34 cycles the reaction was held at 72oC for 2 min, then cooled to 4C until removed from the thermocycler. The expected 1773bp PCR products were purified using Qiagen's Gel extraction kit (Qiagen, Valencia, CA) and ligated into the pcDNA5/FRT/V5-His Topo TA cloning vector (Invitrogen, Carlsbad, CA) containing the ampicillin-resistance gene. Ligation and transformation of E. coli were performed according to the manufacture's protocol. The transformed bacteria were plated onto LB agar plates, supplemented with 50 g/ml ampicilin for selection, overnight in a shaking incubator (250rpm) at 37 oC. Several transformed colonies were picked and each colony was grown overnight in 3ml LB broth, supplemented with 50 g/ml ampicilin, while shaking at 250rpm at a 37 oC incubator. Construction of the M3R cloning vector Plasmid DNA was extracted from the cultures using Mini-Preps DNA Purification kit (Qiagen) following manufacture’s protocol. A restriction enzyme digestion was performed with BamH I and Hind III (Roche Diagnostics, Boehringer Mannheim, Germany) at 37 oC for 2 hours and run on an ethidium bromide stained 0.9% agarose gel to determine insert orientation. Plasmid DNA extracted from the bacterial colonies containing the vectors in the right orientation was sequenced to ensure gene fidelity prior to transfection. Maintenance of Flp-In CHO cells and cell transfection. Flp-In CHO cell line (Invitrogen) contains a single integrated Flp Recombination site from pFRT/lacZeo vector, expressing the lacZ-Zeocin fusion gene. Flp-In CHO cells are maintained in UltraCHO Medium (BioWhittaker Cell Biology, Walkersville, MD) with 0.1% zeocin (Research Products International Corp). Cells transfection was performed with Invitrogen Lipofectamine. Co-transfect Flp-In CHO cells with 9:1 ratio of Flp

PAGE 35

23 recombinase expression plasmid pOG44 to pcDNA5/FRT/V5-His vector inserted with mM3R. Flp recombinase mediates insertion of Flp-In expression construct into the genome at the integrated FRT site through site specific DNA recombination. Briefly, 1x105 Flp-In CHO cells were seeded into 6 well plates in UltraCHO growth medium (BioWhittaker Cell Biology) with 5% FBS the day before transfection. Serum free UltraCHO growth medium was added to 1 g of plasmid DNA, 9 g of pOG44 and 25 l Lipofectamine transfection reagents (Invitrogen, CA) to make to 500 l and transfer to the cells in 6 well plates after incubating for 20 min. The cells were incubated at 37oC and 5%CO2. The transfection reagents were removed in 7 hours, and cells were washed and added with new UltraCHO growth medium with 5% FBS. Selection of Flp-In CHO cells expressing constructed vector. After cotransfection with PcDNA5/FRT/V5-His vector containing mouse M3 receptor and pOG44, cells were incubated for 24 hours to allow for expression of the resistance gene. Then change to growth medium ProCHO 4 (BioWhittaker Cell Biology, Walkersville, MD) containing 5% FBS (Fetal Bovine Serum) and 0.80mg/ml hygromycin B (Research Products International Corp. Mt. Prospect, Illinois) for selection. The cells were fed every 5 days. If necessary, adherent CHO cells were digested with 0.05% Trypsin-EDTA (Life Technology) and splited. When a stable hygromycin resistant cell line was established, cells were transferred to suspension culture growth medium in serum free ProCHO 4 (BioWhittaker Cell Biology, Walkersville, MD). Once hygromycin-resistant cell lines were established, the transfected cells were transferred to serum-free ProCHO4 suspension growth medium supplemented with 0.8mg/ml hygromycin and grown in 75 cm2 culture flasks. Theoretically, all the selected clones are isogenic with the

PAGE 36

24 pcDNA5/FRT/V5-His M3R vector integrated into the same genomic locus in every clone. No further subclone is conducted. M3 receptor production in transfected Flp-in CHO cells. Membrane protein was extracted for detection of M3 receptor. The transfected and non transfected Flp-In CHO cells were collected by centrifugation and lysed by adding 1ml of 50mM Tris HCl, pH 7.5, followed by repeated freeze and thawing of the pellet in an ethanol/dry ice bath, and finally passing the lysed cells through 18 and 26 gauge needles. The membrane pellet was prepared by centrifugation at 40,000g for 20 minutes at 4oC in 1ml of 50 mM Tris HCl buffer, pH 7.5, and centrifuged again for 15 minutes at 40,000g at 4oC for a total of 2 washes. Following the last wash, the pellet containing was resuspended in 1ml of pH 7.5 Tris HCl buffer saline, and saved at –80oC for further experiments. The expression of fusion protein was confirmed with western blot. 3 g of membrane proteins from transfected and non transfected Flp-In CHO were loaded and separated on a 12% SDSPAGE followed by transfering to nitrocellular membrane at 18 volts overnight. After transfer, membrane was incubated in 5% non-fat milk blocking buffer for 1 hour and incubated with 1:2000 dilution of anti-His-AKP (Invitrogen, CA) and by color development with Nitroblue Tetrozolium (Sigma, MO) and Bromocholroindolyl Phosphate (Sigma, MO). Detection of anti-mM3R autoantibodies and its isotypes in mouse sera using transfected Flp-In CHO cells. Sera were collected from NOD/LtJ, NOD.B10. H2b C57BL/6 and Balb/c mice at 4 or 20 weeks of age, stored at –80 oC for future experiments. 10 l sera were pre-absorbed with 5x106 Flp-In CHO at room temperature for 2 hours. Plate mM3R Flp-In CHO or Flp-In CHO cell at a concentration of

PAGE 37

25 105/chamber on 8 well chamber slide (Lab-Tek chamber slide system, Nunc., Denmark), allow cells to grow till reach confluent. Cells were washed 3 times with Phosphatebuffered saline (PBS) and fixed in 10% formalin for 10 minutes. After 3 times wash with PBS, cells were incubated with preabsorbed sera at 1:50 dilution with Ca++ and Mg++ free 1xPBS. Cells were washed again and incubated with 1:100 diluted FITC labeled anti mouse polyvalent immunoglobulin (Sigma, St. Louis, MO) in Ca++ and Mg++ free 1xPBS. After final wash, slides were visualized with fluorescent microscope under 200 x magnifications. To further identify the isotypes of the autoantibodies, pcDNA5/FRT/V5His mM3R-transfected Flp-In CHO cells were collected from culture, washed once with phosphate-buffered saline (PBS), and resuspended in FACS buffer (PBS, 2% ABS, 0.01%NaN3) at a density of 1 x 105 cells/0.1 ml. Aliquots of cells were incubated 2 hrs at 4C with 10 l sera from 20 weeks old Balb/c and NOD.B10. H2b Cells were washed once with FACS buffer and stained with either FITC-conjugated goat anti-mouse IgG (PharMingen, San Diego, CA) or FITC-conjugated goat anti-mouse IgA, IgG1, IgG2, IgG3, IgG4, IgE and IgM (Accurate Chemical Corp., Westbury, NY) for 45 min at 4oC. After a final wash with FACS buffer, the cells were resuspended and analyzed using a FACScan cytometer (Becton Dickinson, Mountain View, CA). Results Construction of a transfected cell line stably expressing mouse M3R. Earlier studies from our laboratory (Nguyen et al ., 2000) indicated the feasibility of using a cell line transfected with M3R to detect anti-M3R autoantibodies in sera of Sjgren's syndrome patients. However, in those studies, the assay utilized COS-7 cells transfected with rat M3R expressed from a vector system not integrated into the genome, resulting in

PAGE 38

26 two concerns. First, the reactivity of human autoantibodies towards rat M3R molecules proved quite weak, raising issues as to the levels of specificity and detection with a crossreactive antigen. Second, expression of the transfected rat M3R gene from the epigenetic vector proved unstable and transient, requiring constant subcloning and re-transfections. To circumvent these problems, I constructed a cell line that is transfected with the mouse M3R (mM3R) gene incorporated directly into the cells' genomes. To accomplish this, cDNA of the ORF for the mM3R gene was generated from mRNA isolated from the C57BL/6 submandibular glands. The resulting PCR product (Figure 2-2) was isolated and ligated into the PcDNA5/FRT/V5-His TOPO vector used to transform E. coli. Plasmid DNA were extracted and digested to screen for a single plasmid carrying the huM3R gene in the correct orientation (Figure 2-3). Following sequencing of the insert for fidelity and orientation, genetically-manipulated Flp-In CHO cells were co-transfected with the recombinant mM3R-pcDNA5/FRT/V5-His TOPO and pOG44 plasmids for the generation of a stably transfected cell line. To determine if the transfected cells express mM3R as a membrane protein, membrane fractions were prepared from both transfected and non-transfected Flp-In CHO cells undergoing expansion as suspension cultures. Proteins from the membrane preparations were screened by Western blotting using an anti-His antibody. The expected 65 kD protein band was observed in the membrane fraction of the mM3R transfected Flp-In CHO cells, but not in the non-transfected Flp-In CHO cells (Figure 2-4). Thus, I have successfully constructed a system consisting of a parental CHO cell line that does not express a muscarinic acetylcholine receptor (control) plus a CHO cell line that constitutively expresses the mM3R (experimental).

PAGE 39

27 Detection of anti-mM3R autoantibodies and its isotypes in mouse sera using transfected Flp-In CHO cells. To identify the presence of anti-mM3R autoantibodies in the sera, mM3R Flp-In CHO or Flp-In CHO cell were seeded at a concentration of 105/chamber on 8 well chamber slide and grow to reach confluence. Cells were incubated with preabsorbed sera and followed by FITC labeled anti mouse polyvalent immunoglobulin. Slides were visualized with fluorescent microscope under 200x magnification. As shown in Figure 2-5, only Flp-In CHO expressing mM3R showed positive staining after incubation with 20 weeks old NOD sera, indicating the presence of anti-mM3R. No staining was visualized on cells incubated with 4 weeks old NOD or C57BL/6 sera. To further identify the anti-mM3R autoantibodies and its isotypes in mouse model of SS, sera isolated from NOD.B10. H2b and control Balb/c mice (n=5~6) at 20 weeks of age were preabsorbed with Flp-In CHO cells and incubated with mM3Rtransfected Flp-In CHO cells (1 x 105). Cells stained with either FITC-conjugated goat anti-mouse IgG or FITC-conjugated goat anti-mouse IgA, IgG1, IgG2a, IgG2b, IgG3, IgE, IgM and analyzed using a FACScan cytometer. As observed in Figure 2-6, in the disease stage, total IgG and IgG1, IgG2a, IgG2b and IgG3 isotypic anti M3R antibodies can be detected in NOD.B10 sera, while in control age matched Balb/c mice, no antiM3R autoantibody was detected. Discussion and Conclusion In the present study, detection of anti-mM3R autoantibodies in mouse model of Sjgren’s syndrome was facilitated by the construction of a transgenic cell line expressing the mouse M3R protein, as proposed earlier by Konttinen et al (Konttinen et al. 1999). Unlike our earlier M3R-transfected cell lines that were constructed with the

PAGE 40

28 rat M3R gene (Nguyen et al ., 2000) the model presented in the current study expresses the mouse M3R from a gene stably incorporated within the cell line’s genome as opposed to an epigenetic element. This has been made possible through the use of the Flp-In CHO cell system, and has resulted in a stable M3R gene-expression system. Because this system has been designed to use flow cytometric analysis, I have been able to evaluate additional aspects, e.g., the isotype of the anti-M3R autoantibodies. This system establishes the methodology for a quick and simple diagnostic test with possible significance in identification of clinical disease in SjS. My preliminary studies provide the evidence that anti-M3R autoantibodies are present in sera of Sjgren’s syndrome mouse model NOD and NOD.B10. H2b NOD and its congenic strain NOD.B10. H2b have been used as a model for SjS based on same criteria, including the presence of focal lymphocytic infiltration in the exocrine tissues, detection of sera antibodies and loss of exocrine secretory capacity. My observations on the presence of anti-M3R autoantibody in these models provide evidence that our mouse model of SjS may share the same underlying pathogenesis lead to the loss of secretory function. And this cell based assay makes it possibly to identify autoantibodies generated to tertiary epitopes created by the extra-cellular domains.

PAGE 41

29 Figure 2-1. Generation of Flp-In CHO cells stably expressing gene of interest. Flp-In host cells, which contain a single Flp recombinase target site in a transcriptionally active genome locus, are used for a site-specific recombination to facilitate integration of the gene of interests into the genome of mammalian cells. Stable cell lines are easily generated by co-transfecting the host cells with the Flp-In expression vector and Flp-In recombinase expression vector pOG44. The expression of recombinase enables the integration of expression vector at the genomic target site. pOG 44 Flp Recombinase ATC SV40pA Gene of Interest BGHpA SV40 pA

PAGE 42

30 Figure 2-2. PCR Amplification of mM3R from submandibular glands of C57BL/6. RTPCR with the mM3f and mM3r primers produced 1.7 kilobase pair M3R amplicon (lane 1). 1 kb DNA Ladder (Promega Corporation) was used as a marker (lane M). 2500 2000 1500 1000 750 500 250

PAGE 43

31 Figure 2-3. Restriction enzyme digestion of plasmid DNA from transformed clones. Plasmid DNA was extracted from the cultures using Qiagen's Mini-Preps DNA and restriction enzyme digested BamH I and Hind III at 37 oC for 2 hours and run on 0.9%agarose gel to determine insert orientation. After digestion, vectors with inserts in the right orientation yielded approximately 567 bp and 6296 bp DNA bands (lane 3,5) while vectors with the opposite directionally insertion yielded 1254 bp and 5609 bp bands(lane 1,2,4). 100bp DNA ladder (Promega Corporation) was used as a marker (lane M). 1254 bp 567 bp 2000 1500 1000 500

PAGE 44

32 Figure 2-4. The expression of fusion protein confirmed with western blot. Membrane proteins were separated on a 12% SDS-PAGE gel and transferred to a nitrocellular membrane and probed with 1:2000 anti-His-AKP. A 65KD protein was showed in transfected Flp-In CHO but not in the control Flp-In CHO cells. Prestained Presicion Plus Protein Standard (BioRad Laboratories) was used as a marker. 100 75 50 37 25

PAGE 45

33 1 Figure 2-5. Immunofluorescent staining of Flp-In CHO and Flp-In CHO mM3R with mouse sera. Plate mM3R Flp-In CHO or Flp-In CHO cell at a concentration of 105/chamber on 8 well chamber slide; allow cells to grow till reach confluent. Cells were washed 3 times with PBS and fixed in 10% formalin for 10 minutes. After 3 times wash with 1xPBS, cells were incubated with preabsorbed sera at 1:50 dilution with Ca++ and Mg++ free PBS. Cells were washed again and incubated with 1:100 diluted FITC labeled anti mouse polyvalent immunoglobulin (Sigma, St. Louis, MO) in Ca++ and Mg++ free 1xPBS. After final wash, slides were visualized with fluorescent microscope under 200 x magnifications. B6 5wks B6 20wks NOD 4wks NOD 20wks B6 5wks B6 20wks NOD 4wks NOD 20 wks Flp-In CHO Flp-In CHO mM3R

PAGE 46

34 Figure 2-6. FACS analysis of M3 receptor autoantibodies in NOD.B10. H2b and Balb/c. Sera from NOD.B10. H2b and Balb/c mice at 4 ( ) and 20 weeks of age ( ) were pre-absorbed with 5x106 Flp-In CHO and incubated with 10 ul preabsorbed sera. Cells were washed once with FACS buffer and stained with either FITC-conjugated goat anti-mouse IgG or FITC-conjugated goat antimouse IgM, IgG1, IgG2a, IgG2b, IgG3, IgA, IgE and analyzed using a FACScan cytometer. IgG IgM IgG1 IgG2a IgG2b IgG3 IgA I gE NOD.B10 .H2b Balb/c

PAGE 47

35 CHAPTER 3 GENERATION AND CHARACTERIZATION OF NOD.B10H2B .IL4-/MOUSE Introduction The underlying etiology of autoimmune excrinopathy remains elusive, a number of studies using the NOD mouse and its congenic strains have led to the concept that autoimmune excrinopathy progresses in multiple phases. A physiological and biochemical phase characterized by retarded salivary gland organogenesis and aberrant protein expressions occurs well before the actual immune attack. With the onset of lymphocytic infiltration and a concomitant increase in the expression of inflammatory cytokines, an immune response is initiated against the acinar cells of salivary and lacrimal glands. Finally, the production of autoantibodies correlates with the loss of secretory function and actual clinical disease. Autoantibodies appear to play an important role in the pathogenesis of Sjgren’s syndrome. The anti-nuclear autoantibodies, anti-SS-A/Ro and anti-SS-B/La have been found in about 40~70% of patient sera. Recent studies have shown that the type 3 muscarinic acetylcholine receptor (M3R) is a candidate autoantigen and that anti-M3R autoantibodies are also present in human patients with SjS (Gao et al ., 2004). It is postulated that the constant binding of anti-M3R to autoantibodies to muscarinic acetylcholine type 3 receptors causes desensitization, or functions as an antagonist, interfering with normal signal transduction. In any case, the presence of antibodies to M3R would affect the rate of fluid secretion.

PAGE 48

36 Recent studies showed that IL-4, a cytokine actively involved in humoral immune responses, plays an integral role in the production of autoantibodies and the onset of loss of secretory function (Brayer et al ., 2000). Although the exact role of the cytokine IL-4 in the autoimmune exocrinopathy is still unclear, it has been observed that the absence of IL-4 prevents the loss of secretory function in NOD.IL4-/mice, in spite of lymphocytic infiltration and upregulated proinflammatory cytokines in the salivary glands. IL-4 is a pleiotropic cytokine involved in cell proliferation, activation, and differentiation. For B-lymphocytes, IL-4 appears to promote cell survival and proliferation. Although it is not a growth factor by itself for resting lymphocytes, it can substantially prolong the lives of T and B lymphocytes in culture (Hu-Li et al ., 1987), and acts as a co-mitogen for B cell growth (Howard et al 1982). It is also well established that it can regulate isotype switching. In the mouse, IL-4 stimulates germline # 1 and $ immunoglobulin gene transcription. In combination with costimuli, especially CD40L, IL4 induces switching to IgG1 and IgE in vivo. The exact role of IL-4 in autoimmune exocrinopathy of NOD mice is still unknown. IL-4 dependent production of specific isotypic autoantibodies, or IL4 mediated cell activation and proliferation, could allow the survival and expansion of a small populations of autoimmue B cells later involved in the disease process. In the present study, I have examined how the lack of IL4 affects the development of clinical manifestations and lack of secretory function in NOD.IL4-/and NOD.B10H2b .IL4-/mice, especially focusing on the presence of autoantibodies against M3R and analyses of their subclasses.

PAGE 49

37 Materials and Methods Animals. NOD/LtJ, NOD.B10. H2b and NOD.IL4-/mice were purchased from Jackson Laboratories (Bar Harbor, ME) and maintained under specific pathogen free conditions in the mouse facility of the Department of Pathology, University of Florida, Gainesville, FL. NOD.B10H2b .IL4-/mice were generated by crossing a NOD.IL4-/(full strain name: NOD.H2g7.IL4-/-) male with a NOD.B10. H2b female moue. The F1 heterzygotes were intercrossed to produce a F2 generation that were screened by PCR for the presence and/or absence of the disrupted IL-4 gene and the presence of MHC H-2b locus by microsatellite marker genotyping. Microsatellite marker primers were purchased from Research Genetics Invitrogen Life Technologies (Carlsbad, CA). (Mit17-21 MapPair: Forward Primer: CCTTGAGGGCCACGGTTGTC Reverse Primer: TGAGAGGCTCTGGGGGTATC) PCR primers for IL4 gene were obtained from The Jackson Laboratory (Bar Harbor, Maine). Mice homozygous for both the neomycindisrupted IL-4 gene and the MHC I Ab gene were bred to obtain the founder mice. The NOD.B10H2b .IL4-/line is being carried as a single descent line through brother-sister matings. Genomic DNA from NOD.B10H2b .IL4-/failed to amplify a 444bp IL4 band (Fig.3-1A), but with neomycin and IL4 primer set amplified a 576bp DNA fragment from the disrupted allele (Fig.3-1B). Homozygous MHC I-A locus was confirmed by a microsatelite typing with, which generated a 137bp of the H2b and 122bp of H2g7 locus, respectively. (Fig.3-1C) Measurement of salivary flow rates. To measure stimulated flow rates of saliva, individual mice were given an intraperitoneal injection of isoproterenol (0.1 mg / ml) plus pilocarpine (0.2 mg / ml) dissolved in PBS. Saliva samples were collected from each

PAGE 50

38 mouse for 10 min starting 1 min after injection of the secretagogue. The volume of each saliva sample was measured and adjusted by body weight. The saliva samples were then frozen at –80oC until analyzed for protein concentrations and proteolytic activities. Saliva amylase activity analysis. The decrease in saliva output by NOD and NOD.B10. H2b mice is accompanied by a temporal decline in amylase activity (Humphreys-Beher et al ., 1999). Saliva amylase was determined by Infinity TM Liquid Amylase Kit (Thermo Trace) using the starch as the substrate described by Bernfeld (Bernfeld, 1955). In brief, 250 dilutions of saliva sample in DI H2O were added to 1ml Infinity TM Amylase Liquid Stable Reagent. Absorbance was measured at wavelength of 405nm after 1 minute and 2 minutes’ incubation at 37oC. Amylase activity was calculated following manufacture’s protocol: Amylase activity (u/L) = % A/2 x 5140x dilution factor. Histology. Submandibular and lacrimal glands were surgically removed from euthanized mice at 20 weeks of age. The tissues were fixed in 10% phosphate buffered formalin for 24 hrs, embedded in paraffin, sectioned (5 / section) and stained with Mayer’s hematoxylin and eosin (H/E) dye. Stained specimens were observed at 40X and 200X magnification. Immunofluorescent staining. Submandibular and lacrimal glands were surgically removed from NOD.B10. H2b and NOD.B10 -H2b .IL4-/mice at 12 and 20 wks of age. The tissues were placed in O.C.T. Tissue Tek compound (Sakura Finetek, CA) to make frozen blocks. Frozen sections (5 m thickness) were cut on an OTF cryostat (Bright Instrument Company) and mounted on coated slides. Following a brief washing with PBS, sections were covered with a blocking solution (FBS supplemented to 2.5% with fetal bovine serum) for 1 hr prior to incubation with primary antibody. Primary

PAGE 51

39 antibodies were non-conjugated rat anti-mouse IgG1, IG2a, Ig2b, IgG3, and IgA used at a 1:20 dilution. Following 1.5 hr incubation in a humidity chamber, the primary antibodies were washed from the slides and FITC-conjugated goat anti-rat whole Ig at a 1:20 dilution was applied for 30 min. The slides were washed 4 times with PBS, then mounted in Vectashield mounting medium (Vector, Burlingham, CA). Negative controls consisted of tissue sections stained only with secondary antibody. Slides were visualized on an immunofluorescent microscope at 200X magnification. Proteolysis of parotid secretory protein (PSP). Detection of PSP proteolysis was carried out by incubating saliva with a synthesized oligopeptide corresponding to amino acids 20 through 34 of the published sequence for the PSP protein. This oligopeptide contains the proteolytic site for an enzyme present in the salivary gland that is activated during onset of SjS-like disease in the NOD mouse (Robinson et al ., 1997b). 42 l PSP oligopeptide (2.5mg/ml) was incubated at 42oC for 2 hrs with aliquotes of whole saliva (8 l ) collected from individual mice. Controls consisted of 50 l PSP oligopeptide. Following incubation, 50 l Tris-HCl buffer (50 mM, pH 8.0) was added and the mixture centrifuged through Micro-spin filter tubes at 14,000 rpm for 10 min. The filtrates were analyzed by HPLC (Dionex Systems) for the presence of PSP cleavage products. Preparation of mononuclear cells. Spleens were freshly explanted from euthanized mice and gently minced through a steel sieve. Following a single wash with PBS, the red blood cells were lysed by a 7 min exposure to 0.84% NH4Cl, and the resulting cell suspension washed two times in PBS. Lymphocytes present in the submandibular glands were prepared as detailed elsewhere (Robinson et al ., 1998b). Briefly, the submandibular or lacrimal glands were obtained from euthanized mice and

PAGE 52

40 minced into small pieces using scissors. The minced tissues were washed with PBS, then incubated in a solution of collagenase type V (2 mg/ml; Sigma Chemicals, St. Louis, MO) containing DNase Type II (100 U/ml; Sigma Chemicals). The mixture was placed in a shaking water bath set at 37oC until the glandular tissue was digested to single cells. The mononuclear cells were enriched by centrifugation on a 55% Percoll gradient (Sigma Chemicals). Each mononuclear cell fraction was washed with PBS, counted and resuspened to 1 x 106 cells/ml. Isotype analysis of B lymphocytes. Aliquotes of mononuclear cells (1x 106 cells) were resuspended in 100 l of FACS buffer and incubated with PE-conjugated goat anti-mouse CD19 and either FITC-conjugated goat anti mouse IgG1, IgG2a, IgG2b, IgG3, IgM, IgA or IgE for 45 min at 4oC. The cells were washed once with FACS buffer and analyzed using a FACScan unit. Detection of transcription factor and cytokine mRNA expressions. Total RNA was prepared from the submandibular glands of NOD.B10. H2b and NOD.B10 -H2b .IL4-/mice aged 4, 8, 12 or 20 wks of age using the RNeazy Mini Kit according to the manufacturer’s protocol (Qiagen, Valencia,CA). cDNA was synthesized using 4 g of total RNA, Superscript II reverse transcriptase (Invitrogen Life Technologies, Carlsbad, CA ), and pd(T)12-18 oligomeric DNA (Amersham Pharmacia, Piscataway, NJ). The cDNA was quantified by spectrophotometry. Semi-quantitative PCRs were carried out using 1 g of cDNA as template. Following an initial denaturation at 94C for 4 min, each PCR was carried out for 40 cycles consisting of 94oC for 1 min, 60C for 45 sec and 72oC for 2 min. PCR products were size separated by electrophoresis using a 0.9%

PAGE 53

41 agarose gels and visualized with ethidium bromide staining. The primer sequences used were listed in Table 3-1 and 3-2. B cell Signaling Transduction Gene SuperArray. GEArray Q series mouse JAKSTAT and Insulin signaling transduction gene array kits was obtained from SuperArray Inc. (Bethesda, MD). These arrays included 96 genes involved in either JAK-STAT or Insulin signaling pathway. (See www.superarray.com for details.) Spleen B cells from NOD.B10. H2b and NOD.B10H2b .IL4-/were extracted with StemSep Mouse B Cell Enrichment Kit (Stem Cell Technology, Vancouver, Canada). Purity of B cell separation was tested by Flow Cytometric analysis after incubating with CD19-PE antibody for 30 minutes. Total RNA was isolated with the use of an RNeasy Mini Kit (Qiagen Inc., Valencia, CA, USA), and 2 g RNA was used as a template to generate Biotin-16-dUTPlabeled cDNA probes according to the manufacturer’s instructions. The cDNA probes were denatured and hybridized at 60C with the SuperArray membrane, which was washed and exposed with the use of a chemiluminescent substrate. To analyze the SuperArray membrane, we scanned the x-ray film and imported it into Adobe Photoshop as a TIFF file. The image file was inverted, and the spots were digitized with the use of ScanAlyze software (shareware, http://rana.lbl.gov/EisenSoftware.htm ), and normalized by subtraction of the background as the average intensity value of 3 spots containing plasmid DNA (PUC18). The averages of 2 GAPDH or 4 cyclophilin A spots were used as positive controls and set as baseline values with which the signal intensity of other spots was compared. Using these normalized data, we compared the signal intensity from the membranes using the GEarray analyzer program (SuperArray Corp., http://www.superarray.com ).

PAGE 54

42 Antinuclear antibody (ANA). ANA was detected by indirect immunofluorescence staining with Sigma Diagnostics Antinuclear Antibody Kits (Sigma, St.Louis, MO) using human epithelial (HEp-2) cells. Tested sera were diluted 1:50 with 1xPBS (Phosphate Buffered Saline Solution). 50 l diluted sera was added to separate wells for a 3-hourincubation in a humidity chamber. After a brief rinse with PBS followed by 2 5 minutes wash, FITC-conjuagated goat anti-mouse whole Ig at a 1:200 dilution was applied to individual wells for 45 minutes. The slides were washed in PBS, then mounted and visualized on an immunofluorescent microscope at 100X magnification. Detection of anti-mM3R autoantibodies and its isotypes in mouse sera using tra n s f ected F l p In C H O ce ll s Sera w e re coll ec t ed from NOD B 10.H2b, N O D. B 10H2 b I L 4/ and B a lb/c m i ce at 4 or 20 weeks o f a ge, stored at oC f o r fu t u re experiments. 10 l sera were pre-absorbed with 5x106 Flp-In CHO at room temperature for 2 hours pcDNA5/FRT/V5-His mM3R-transfected Flp-In CHO cells were collected from culture, washed once with phosphate-buffered saline (PBS), and resuspended in FACS buffer (PBS, 2% ABS, 0.01%NaN3) at a density of 1 x 105 cells/0.1 ml. Aliquots of cells we r e incuba t e d 2 hrs at 4C with 10 l sera from 20 w e eks old N O D. B 10.H2b, NOD.B10. H2b .IL4-/mice or 20 weeks old Balb/c. Cells were washed once with FACS buffer and stained with either FITC-conjugated goat anti-mouse IgG (PharMingen, San Die g o, C A ) or F I TC-con j u g a t ed g o at anti-mouse I g A, I gG1, I g G2a, I gG2b, I g G3, I g E and IgM (Accurate Chemical Corp., Westbury, NY) for 45 min at 4oC. After a final wash with FACS buffer, the cells were resuspended and analyzed using a FACScan cytometer (Becton Dickinson, Mountain View, CA).

PAGE 55

43 Results Mononuclear cell infiltration of the salivary and lacrimal glands in NOD.B10 -H2b .IL4-/mice. Diagnosis of SjS in humans includes complaints of dry eyes and/or dry mouth, detection of leukocytic infiltrates in the minor salivary glands, the presence of hypergammaglobulinemia and specific anti-nuclear autoantibodies, objective evidence of loss of fluid secretions, and desiccation of the ocular epithelial cell surface. Over the past several years, the NOD mouse has been shown to exhibit a number of these disease manifestations, including loss of stimulated fluid secretion concomitant with the appearance of leukocytic infiltrates in the salivary and lacrimal glands. In addition, the NOD mouse produces a variety of autoantibodies reactive with nuclear, cellular and secreted proteins of the exocrine glands, mimicking the humoral response observed in the human disease. To determine the impact of IL-4 gene expression on the SjS-like disease in the NOD mouse in the absence of potentially confounding factors associated with diabetes in this mouse line, we have generated the NOD.B10H2b .IL4-/mouse, a line that exhibits no diabetes (due to the absence of the Idd1 locus) and contains a disrupted IL-4 gene. Histological analysis of the exocrine glands of this NOD.B10H2b .IL4-/mouse, presented in Figure 3-2, revealed that both the submandibular and lacrimal glands show significant focal leukocytic infiltrates. This was true for the glands of both male and female mice. Furthermore, the levels of infiltration were visibly greater than historically observed in either parental NOD/LtJ or NOD.B10. H2b mice. Lack of immune-mediated secretory dysfunction in the NOD.B10H2b .IL4-/mouse. To examine whether NOD.B10H2b .IL4-/mice retain the secretory dysfunction

PAGE 56

44 Table 3-1 List of murine cytokine primer sequences used in PCR Primers Sequence size IFN5’ TGA ACG CTA CAC ACT GCA TCT TGG 460bp IFN3’ CGA CTC CTT TTC CGC TTC CTG AG IL-1 5’ ATG GCC AAA GTT CCT GAC TTG TTT 625bp IL-1 3’ CCT TCA GCA ACA CGG GCT GGT C IL-2 5’ ATGTAC AGC ATG CAG CTC GCA TC 502bp IL-2 3’ GGC TTG TTG AGA TGA TGC TTT GAC A IL-4 5’ ATG GGT CTC AAC CCC CAG CTA GT 399bp IL-4 3’ GCT CTT TAG GCT TTC CAG GAA GTC IL-6 5’ ATG AAG TTC CTC TCT GCA AGA GAC T 638bp IL-6 3’ CAC TAG GTT TGC CGA GTA GAT CTC IL-10 5’ GCA GGG GCC AGT ACA GCC GGG AA 479bp IL-10 3’ GCT TTT CAT TTT GAT CAT CAT GT IL-12 5’ ATG ACA TGG TGA AGA CGG CCA GAG 476bp IL-12 3’ TCA CGA CGC GGG TGC TGA AGG CGT G G3PDH 5’ TGA AGG TCG GTG TGA ACG GAT TTG GC 983bp G3PDH 3’ CAT GTA GGC CAT GAG GTC CAC CAC Table 3-2 List of murine transcription factor primer sequences used in PCR Primers Sequence size NF & B 5’ TCCACGCTGGCTGAAAATCC 580bp NF & B 3’ CACGGGAGACACAGACGAACAGTT STAT6 5’ TCTGTCCTTGGTGGTCATCGTG 643bp STAT6 3’ GGAGATGGGGTTCTTTGGGTTT SOS 5’ TCCTCATCCTATTGATAAATGGGC 684bp SOS 3’ CCAAGGGCACATAGTGACAACC PI3Kp85 5’ ACAGACTGGTCCCTGAGTGACTTG 623bp PI3Kp85 3’ GGAGTCCTTTCCGCCCTTGTTGTT RAF 5’ AGCACCACCTTCTTTCCCAATGC 654bp RAF 3’ CCGCTAACACTGAGTCACCACACT

PAGE 57

45 that develops in parental NOD/LtJ or NOD.B10. H2b mice, temporal changes in the saliva flow rates were compared among NOD.B10. H2b NOD.IL4-/and NOD.B10H2b .IL4-/mice. Saliva secretion was stimulated by an intra-peritoneal injection of isoproterenol/pilocarpine solution. As presented in Figure 3-3, at 20 wks of age, a time point at which secretory dysfunction is exhibited in NOD/LtJ and NOD.B10. H2b mice, only NOD.B10. H2b mice showed a statistically significant decrease by student t test ( p <0.05) when compared to salivary flow rates at 4 wks of age, prior to onset of disease. Neither NOD.IL4-/nor NOD.B10H2b .IL4-/mice exhibited a statistically significant loss of secretory activity. Furthermore, NOD.B10H2b .IL4-/mice retained normal salivary flow rates to 36 wks of age (data not shown). Loss of secretory function in NOD/LtJ and NOD.B10. H2b mice is associated with temporal increases in protein concentrations in saliva and tears (Humphrey-Beher et al., 1994). As expected, saliva collected from either NOD.IL4-/or NOD.B10H2b .IL4-/mice showed consistently normal protein concentrations over time. Thus, the lack of a functional IL-4 gene resulted in retention of normal secretory flow rates and no measurable temporal changes in the levels of salivary proteins, despite having little effect on leukocytic infiltration of the submandibular and lacrimal glands. Likewise, amylase activity in both NOD.B10H2b .IL4-/and NOD.IL4-/increased slightly between 4 and 20 weeks of age, from 181.4425.22 u/ml to 250.7026.90 u/ml, and 234.9026.67 to 291.5759.27 u/ml respectively, whereas the NOD.B10. H2b mice showed a decline from 386.9149.53 to 288.8733.67 u/ml during this time frame (Figure 3-4). Abnormal proteolytic activity in the saliva of NOD.B10H2b .IL4-/mice. In addition to the development of xerostomia and a concommitant increase in the

PAGE 58

46 concentration of salivary proteins, parental NOD/LtJ and NOD.B10. H2b mice also exhibit a number of altered biochemical and physiological properties associated with the salivary glands (Robinson et al ., 1997b). These include measurable decreases in epidermal growth factor and amylase activities, as well as the appearance of an aberrant expression of parotid secretory protein (PSP) in the submandibular and lacrimal glands. Increased proteolytic activities are also observed, one of which is the proteolysis of PSP at a unique NLNL sequence site within the N-terminal region of the molecule. This proteolysis of PSP is used as a marker of SjS-like disease in the NOD mouse model. To determine if NOD.B10H2b .IL4-/mice retain this phenotypic marker of SjSlike disease, saliva collected from individual mice were tested for the presence of PSPproteolytic activity using HPLC to detect the cleavage of a synthetic oligopeptide carrying an NLNL amino acid sequence. As presented in Figure 3-5, when the synthetic peptide is degraded by the proteolytic activity in the saliva of parental NOD.B10. H2b mice, two products are generated that are eluted by HPLC at approximately 9.2 and 12.8 min. Interestingly, the saliva from both NOD.IL4-/or NOD.B10H2b .IL4-/mice possessed the same proteolytic activity (Figure 3-4 D,E). In contrast, no enzymatic activity was detected in ageand sex-matched BALB/c mice (Figure 3-4B). Cytokine and major IL4 dependent transcription factor mRNA expression in the submandibular glands of NOD.B10H2b .IL4-/mice. A comparison of cytokine mRNA expression in the submandibular glands between NOD.B10. H2b and NOD.B10H2b .IL4-/mice from 4 to 20 wks of age was carried out using a semi-quantitative RTPCR analysis. As presented in Figure 3-6, the cytokine mRNA profiles proved quite different. In the SjS-like disease-prone NOD.B10. H2b mice at 4 wks of age, when little

PAGE 59

47 or no leukocytic infiltration is present in the submandubular glands, only IL-10 mRNA could be detected of the relatively small, but representative number of cytokines tested. By 8 wks of age, the time at which leukocytes first begin invading the submandibular glands, IL-6 mRNA was detected (suggesting tissue injury is occurring), as well as low levels of IFN! and IL-12 By 12 wks of age, when leukocytic infiltrations are clearly present in the submandibular glands, mRNA for each cytokine tested, including IFN! IL-1 IL-2 IL-4 IL6 IL-10 and IL-12 was detected. By 20 wks of age, many of the cytokines appeared to be expressed at lower levels. In contrast, in the NOD.B10H2b .IL4-/mice, cytokine mRNA profiles indicated that all these cytokines could be detected at a much earlier age than NOD.B10. H2b This is in line with our findings that NOD.B10H2b .IL4-/mice have more severe and earlier infiltrates in the target organs. Lymphocytic infiltration can be observed as early as 6 weeks of age in NOD.B10H2b .IL4-/mice. Upregulation of IFN! and IL-6 preceding the infiltration may suggest involvement of epithelial cells in the initiation of the disease. Interestingly, IL-4 was only transiently expressed in submandibular glands at 12 weeks of age NOD.B10 mouse, and as expected, no IL4 was detected in NOD.B10H2b .IL4-/(Figure 3-6). The major IL4 downstream transcription factors expression were very similar at mRNA level for NOD.B10. H2b and NOD.B10H2b .IL4-/-, except Stat6 can still be detected at mRNA level at 20 weeks old NOD.B10. H2b but not in NOD.B10H2b .IL4-/-(Figure 3-7). JAK-STAT6 pathway was suppressed in NOD.B10H2b .IL4-/-. A comparison of IL4 dependent signaling transduction pathways such as JAK-STAT6 and IRS at mRNA level was conducted using GEArray Q series mouse JAK-STAT and Insulin

PAGE 60

48 signaling transduction gene array kits. Spleen B cells from NOD.B10. H2b and NOD.B10H2b .IL4-/were isolated and purity of the cell population were above 90% with Flow Cytometric analysis (Figure 3-8). Regulation of genes involved B cell IL4 signaling transduction pathways was studied using array technology. With a cut off ratio (>2 or <0.5) and a signaling intensity threshold ( >1E-1 or <-1E-1), I was able to identify 21 genes from the JAK-STAT pathway that were down-regulated at the messenger RNA level in NOD.B10H2b .IL4-/compared to NOD.B10. H2b. Such genes involved in STAT6 signaling pathway included IL4 Stat6 GATA binding protein, C/EBP and NFB SOCS2 (Suppressor of cytokine signaling 2) was the only gene to be found up regulated (Table 3-2). However, for genes involved in the Insulin Signaling pathway (IRS), a mixture of up regulation and down regulation at the messenger RNA transcription level was observed in NOD.B10H2b .IL4-/compared to NOD.B10. H2b These observations suggest that IL4 appears to have a very specific effect on the JAK-STAT6 pathway, while IRS pathway was far more complicatedly to interpret. The suppression of gene transcription involved in the JAK-STAT pathway could be a phenotype of the cytokine knockout mouse model or secondary to the lack of clinical disease in this knockout model. Spleen lymphocytes population. IL-4 has been shown to have at least two major effects on B lymphocytes: first, this cytokine can enhance B cell proliferation during ontogeny via an IRS-1 signal transduction pathway, or second, this cytokine can participate in the isotypic switch from IgM to IgG1 B cells via a STAT6 transduction pathway. To determine the influence of a dysfunctional IL-4 gene on the major lymphocyte populations in the spleens of NOD.B10H2b .IL4-/mice, splenic lymphocyte profiles were followed temporally by flow cytometric analyses from 4 to 20 wks of age.

PAGE 61

49 Spleens were excised from euthanized NOD.B10. H2b and NOD.B10H2b .IL4-/mice, the mononuclear cells isolated, then incubated with monoclonal antibodies (mAbs) defining several major lymphocytic populations. These mAbs included anti-CD3, antiCD4, anti-CD8 and anti-CD19, as well as mAbs reactive with the surface immunoglobulins IgG1, IgG2a, IgG2b, IgG3, IgM, IgA and IgE. As presented in Figure 3-10, a small, but significant, increase in the relative number of B cells was observed over time in the spleens of NOD.B10. H2b mice. In addition, there appeared to be a concomitant increase in the relative number of IgM and IgG1 B lymphocytes: IgMpositive splenocytes increased from 34.49% of the spleen population at 8 wks of age to 37.97% at 20 wks of age, while IgG1-positive cells increased from 8.2% to 11.037%. In contrast, the relative number of B lymphocytes in the spleens of NOD.B10H2b .IL4-/mice. In submandibular glands, CD4+, CD8+ and CD19+ infiltrating lymphocytes were detected in both NOD.B10. H2b and NOD.B10H2b .IL4-/mice at 20 wks of age. No significant differences in these major populations were observed in submandibular infiltrating lymphocytes in these two strains (Data not shown). In spite of the lack of IL4, a potent inducer for IgG1 B cells production, a significant number of IgG1 B cell could still be detected in the submandibular glands and spleen of NOD.B10H2b .IL4-/and NOD.IL4-/mouse either because other redundant pathways exist or the reagent cross react. Detection of ANA in sera The serological presence of ANA or rheumatoid factor is a major criteria for diagnosis of SS. To test whether antibodies in the serum of these congenic mice could recognize nuclear components. Sera from NOD.B10H2b .IL4-/-,

PAGE 62

50 NOD.IL4-/as well as positive control NOD.B10. H2b and negative control Balb/c mice were diluted 1:50 and incubated with HEp-2 cells fixed to slides. The presence of ANA was detected by indirect immunofluoresence. Results from this assay indicated both NOD.B10H2b .IL4-/and NOD.IL4-/mice possess ANA in their sera by 20 weeks of age (Figure 311) Presence of anti-M3R autoantibodies in the sera of NOD.B10H2b .IL4-/mice. Recent studies have provided evidence supporting the possibility that antibody reactive with the type-3 muscarinic acetylcholine receptor is the effector molecule leading to exocrine gland acinar cell dysfunction (Nguyen et al ., 2000; Cavill et al ., 2004). To determine if anti-M3R autoantibodies are produced by NOD.B10H2b .IL4-/mice, sera collected from NOD.B10H2b .IL4-/mice of various ages were tested for the presence of anti-M3R antibodies using non-transfected and mouse M3R-transfected CHO cells and compared with sera collected from ageand sex-matched NOD.B10. H2b and BALB/c mice. CHO cells were incubated with individual sera, followed by either FITCconjugated goat anti-mouse IgG or FITC-conjugated goat anti-mouse IgA, IgG1, IgG2a, IgG2b, IgG3, IgE and IgM, then analyzed using flow cytometry. As shown in Figure 312, anti-M3R antibodies of several isotypes (including IgG1, IgG2a, IgG2b and IgG3) were detected in the sera of NOD.B10. H2b mice at 20 wks of age, but not in the sera of BALB/c mice at any age. For NOD.B10H2b .IL4-/mice, anti-M3R antibodies were detected, but these antibodies were restricted to the IgG2a and IgG3 isotypes. As expected, there was an absence of IgG1 antibodies in the NOD.B10H2b .IL4-/mice with a concomitant elevation in the IgG3 fraction.

PAGE 63

51 Detection of antibody depositions in the submandibular glands of NOD.B10H2b and NOD.B10H2b .IL4-/mice. To detect the presence of antibodies in the exocrine glands of SjS-like disease-prone mice, frozen sections of submandibular glands from 12 and 20 wks old NOD.B10. H2b and NOD.B10H2b .IL4-/mice were incubated with rat anti-mouse IgG1, IgG2a, IgG2b, and IgG3 antibody, followed by incubation with FITCconjugated goat anti-rat IgG. As shown in Figure 3-13, the submanduluar glands of NOD.B10. H2b mice at 12 wks of age revealed the presence of IgG1, IgG2b, and IgG3 antibody depositions. By 20 wks, even IgG2a antibodies were detected. In contrast, the submandibular glands of NOD.B10H2b .IL4-/mice, while showing the presence of IgG antibody depositions, had no IgG1 antibody present at either 12 or 20 wks of age (Figure 3-13). Discussion and Conclusion Recent research has shown B cells are essential in the pathology of the exocrine tissue in NOD mice. B cell-deficient NOD mice retain full secretory capacity on stimulation with autonomic receptor agonists. As a cytokine directly involved in B cell function, such as cell growth and proliferation, regulation of isotypic switch, and production of antibodies in immune responses, IL4 can play important roles in the pathogenesis of Sjgren’s syndrome. Previous work showed the interesting observation that NOD.IL4-/mice exhibited lymphocytic infiltration and elevation of inflammatory cytokines in the salivary glands, but do not lose secretory function. To further investigate the role of IL4 in the process of clinical manifestation of primary Sjgren’s syndrome in a mouse model in the absence of diabetogenic locus, I generated an IL4 knockout strain on the NOD.B10. H2b genetic background, by crossing NOD.IL4-/with NOD.B10. H2b mice.

PAGE 64

52 In the present study, I compared the autoimmune exocrinopathy in the NOD.B10H2b .IL4-/and its parental stains NOD.B10. H2b and NOD.IL4-/-. Similar to NOD.IL4-/-, NOD.B10.IL4-/exhibited the same disease phenotype. These phenotypic characteristics include lymphocyte infiltration, expression of immune associated cytokines in the target salivary glands and normal secretory function characterized by maintenance of saliva volume and saliva protein concentration, and increase of amylase activity, indicating that NOD.B10H2b .IL4-/-, as well as NOD.B10.IL4-/-, manifest changes in physiological homeostasis of the exocrine tissue which result in tissue specific recruitment and activation of lymphocytes. However, the autoimmune exocrinopathy mediated directly by the lymphocyte compartment responsible for loss of fluid secretion was disrupted. This observation supports the concept that the lack of SjS-like disease in the NOD.IL4-/mouse was not due to the influence of diabetes but a direct consequence of the absence of IL4. I also observed that NOD.B10. H2b mice examined at 20 wks of age, showed an increased number of spleen B cells, especially IgM and IgG1 B cells, while age matched NOD.IL4/and NOD.B10H2b .IL4-/showed no significant expansion of cells that are positive for IgM and IgG1. The proliferation of IgM and IgG1 B cells in NOD.B10. H2b mice correlated with the over-activation of the immune system and increased disease severity. The lack of functional IL4 in the NOD.B10H2b .IL4-/mice results in a reversal of the disease process and IgM or IgG1 B cell proliferation, resulting in normal secretory funtion. Surprisingly, a significant number of IgG1 B cells, whose proliferation are usually induced by IL4, still can be detected in the absence of IL4. These observations raise an interesting question as to whether there are a small but significant fraction of preprogrammed autoimmune B cells in the NOD mouse that can be induced to proliferate

PAGE 65

53 and produce IgG1 isotypic autoantibodies even in the absence of IL4. Other cytokines, such as IL-13, share many characteristics with IL-4 and are known to be involved in maintenance of IgG1 B cells. It has also been observed in many studies with cell lines that IL4 downstream transcription factors can also be phosphorylated and activated in response to IL-13, as well as to IL-4. (Murata et al ., 1997; Keegan et al ., 1995; Welham et al ., 1995) The role of IL4 on the salivary dysfunction occurring between 8 and 20 wks of age correlates with an IL-4 dependent isotype switch to IgG1. To detect the presence of antiM3R autoantibodies and its subclasses in the knockout mouse, I cloned the mouse muscarinic type 3 receptor, believed to be the autoantigen inducing the loss of secretory function in Sjgren’s syndrome. My data showed IgG1, IgG2a, IgG2b and IgG3 isotypic anti-mM3R antibodies can be detected in NOD.B10. H2b sera at 20 wks of age; however, no IgG1 anti-mM3R antibodies were found in either NOD.B10H2b .IL4-/or NOD.IL4-/-mice. The presence of other IgG isotypic antibodies and the lack of disease phenotype in these mice suggest that IgG1 may be critical in the generation of clinical manifestations associated with dry mouth. This is probably due to different capability of isotypic antibodies in interfering with normal cellular and immunological responses mediated by the constant region of immunoglobulins. How the anti-M3R autoantibodies function in inducing dryness is still not confirmed despite numerous studies. The presence of IgG1subclass autoantibody may also be an accompanying result by the functioning Th2 cytokine IL4, and has little to do with the manifestation of clinical disease. Though our data so far support the concept that production of isotypic autoantibodies against M3R is very important in the initiation of clinical disease, this

PAGE 66

54 does not rule out the possibility that IL4 plays a role in the early stage of B cell development, possibly by stimulating polyclonal expansion, proliferation, and the survival of a small group of autoimmune B cells. IL-4 could also alter the cytokine balance in the microenvironment of the submandibular glands in the prediseased stage. As I show here, IFN! IL-2 IL6 IL-10 and IL-12 were all detected as early as 4 weeks of age in NOD.B10H2b .IL4-/-. However, at 12 weeks of age, a time point when active lymphocytic infiltrations occur and proinflammatory cytokine expression escalates in NOD.B10. H2b submandibular glands, most of the cytokines were downregulated, unfavorable for maintaining a sustained immune response which eventually leads to the loss of secretory function. In conclusion, studies using NOD.B10H2b .IL4-/mice showed the lack of clinical symptoms in spite of an active lymphocyte attack against the target glands. These observations further support the idea that the initial inflammatory infiltration of the gland is followed by secretory dysfunction, and IL4 may play different roles in different stages of the disease process. This study showed that failure to produce IgG1 anti-M3R autoantibodies in response to the absence of IL4, may explain the maintenance of secretory function in NOD.B10H2b .IL4-/and NOD.IL4-/mice. Nevertheless, IL-4 may also be involved in the expansion of autoreactive cells during the initial stage of disease by permitting a small population of autoimmune B cells to breach the establishment of immune tolerance reactive with the M3R moleculars.

PAGE 67

55 Figure 3-1. Genotyping of NOD.B10H2b .IL4-/by PCR. NOD.B10H2b .IL4-/mice were generated by crossing NOD. H2g7.IL4-/with NOD.B10. H2b strain. F1 heterzygotes were inbreeded and F2 screened by PCR and microsatelite type of the IL4 and MHC loci. Genomic DNA was extracted with DNeasy Tissue Kit (Qiagen). IL4 locus genotyping PCR was performed by following Jackson Lab protocol. Genomic DNA from NOD.B10H2b .IL4-/failed to amplify a 444bp IL4 band (Fig.3-1A, lane 1-4), but with neomycin and IL4 primer set it amplified a 576bp DNA fragment from the disrupted allele (Fig.3-1B, lane 1-4). 100bp DNA ladder (Promega Corporation) was used as a marker. Homozygous MHC I-A locus from was confirmed by a microsatelite typing with Mit17-21 MapPair, which generated a 137bp of the H2b (lane 1-4) and 122bp of H2g7 locus (lane 5) respectively (Fig.3-1C). 25bp DNA ladder (Promega Corporation) was used as a marker. 1-4 NOD.B10H2b. IL4-/5 NOD/LtJ 1000 500 1000 500 150 125 100 50 25

PAGE 68

56 Figure 3-2. Lymphocytic infiltration of the salivary and lacrimal glands in the NOD.B10H2b. IL4-/mouse. Submandibular and lacrimal glands were surgically removed from NOD.B10H2b .IL4-/mice at 20 weeks of age. The tissue was fixed in 10% formalin, embedded in paraffin, sectioned and stained with hematoxylin and eosin dye (40x). Submandibular glands Lacrimal glands Submandibular glands Lacrimal glands Submandibular glands Lacrimal glands C57BL/6 NOD/LtJ NOD.B10H2b .IL4-/-

PAGE 69

57 Figure 3-3. Saliva volume and protein concentration from NOD.B10. H2b NOD.IL4-/-, NOD.B10H2b .IL4-/mice. (A) Saliva volume from NOD.B10. H2b NOD.IL4-/-, NOD.B10H2b .IL4-/mice. Saliva volume was adjusted by mg body weight. (B) Saliva total protein concentration from NOD.B10. H2b NOD.IL4-/-, NOD.B10H2b .IL4-/mice. (* p <0.05 unpaired student t test). B A

PAGE 70

58 Saliva amylase activity0 50 100 150 200 250 300 350 400 450 5004 wks20 wks4 wks20 wks4 wks 20 wksgroupsamylase activity (u/m l Figure 3-4. Saliva amylase activity from NOD.B10. H2b NOD.IL4-/-, NOD.B10H2b .IL4-/mice. Saliva amylase activity was determined by Infinity TM Liquid Amylase Kit following manufacturer’s protocol. Amylase activity (u/L) was calculated as % Absorbance/2 x 5140x dilution factor. Values are expressed as means of 5 experimental animals the standard deviation. p <0.05 (unpaired student t test) NOD.B10. H2b NOD.B10 -H2b .IL4-/NOD.IL4-/* *

PAGE 71

59 Figure 3-5. Detection of PSP cleavage products from 20 wks old NOD.B10. H2b Balb/c, NOD.IL4-/and NOD.B10 -H2b .IL4-/by HPLC. The PSP cleavage products were detected at elution time 9.25 and 12.8 min or 9.23 and 12.82 min, after incubated with saliva from 20 wks old NOD.B10H2b .IL4-/-, NOD.IL4-/respectively. And the same cleavage products can be eluted at 9.27 and 12.8 min after incubating with 20 wks old NOD.B10. H2b saliva, indicating the presence of an unknown protease in these strains.( Fig. 3-4C,D,E). No enzyme activity was present in 20 wks old Balb/c saliva as indicated by presence of intact PSP peptide at elution time 13.3 min. (Fig. 3-4B) A C E B D

PAGE 72

60 Figure 3-6. Reverse transcription-polymerase chain reaction analyses of cytokine in submandibular glands of NOD.B10. H2b and NOD.B10H2b .IL4-/-. Total RNA was extracted from submandibular glands from NOD.B10. H2b and NOD.B10H2b .IL4-/at 4, 8, 12 and 20 weeks of age. CDNA was synthesized and PCR reaction was performed with different cytokine primer sets.

PAGE 73

61 Figure 3-7. Reverse transcription-polymerase chain reaction analyses of some IL4 downstream transcription submandibular glands of NOD.B10. H2b and NOD.B10H2b .IL4-/-. Total RNA was extracted from submandibular glands from NOD.B10. H2b and NOD.B10H2b .IL4-/at 4, 8, 12 and 20 weeks of age. cDNA was synthesized and PCR reaction was performed with different transcription factor primer sets.

PAGE 74

62 Figure 3-8. Typic FACS histogram profile with StemSepTM murine B cell enrichment. Mouse spleen B cells were enriched by negative selection with StemSep murine B cell enrichment kit. The B cell content of the enriched fraction typically ranges from 80 to 90% after enrichment. A) FACS analysis before B cell enrichment. B) FACS analysis after B cell enrichment. A B

PAGE 75

63 Figure 3-9. cDNA GEArray mouse signal transduction gene arrays were hybridized with labeled cRNA generated from spleen B cells extracted from 12 weeks old NOD.B10. H2b and NOD.B10 -H2b .IL4-/-. cDNA GEArray was analyzed by a chemiluminescent method of detection.

PAGE 76

64 Table 3-1 Signaling Transduction Gene SuperArray JAK-STAT6 Signaling Pathway Insulin Signaling Pathway Down Regulated Up Regulated Down Regulated Up Regulated CBP SOCS2(Cish) AKT-2 ERCC1 IL-3R B-raf Insr EGFR Eif4e Nck1 Fcgr1 G6pd2 PI3Kp85a IFN R1 Gab1 Prkcl IFN # GSK3 Ptpn1 IL-10R Kras2 PAI-1 IL-10R ERK2 Srebf1 CD25 Pk3 Tgn IL-2 Rg Retn ISGF-3y Ucp2 JAK1 Smad3 Smad4/DPC4 Progelatinase Mpl Oas1g prolactin receptor A1m Saa3 Stat1

PAGE 77

65 Figure 3-10. Spleen IgM and IgG1 isotypic B lymphocyte populations in NOD.B10. H2b and NOD.B10H2b .IL4-/mice. (A) FACS dot plots of spleen IgG1 and IgM isotypic B cells from NOD.B10. H2b and NOD.B10 -H2b .IL4-/-. (B)-(C) FACS analysis of spleen IgG1 and IgM isotypic B cells from NOD.B10. H2b and NOD.B10 -H2b .IL4-/-. Values are mean SE of four animals per group. p < 0.05 by unpaired t test. NOD.B10H2b .IL4-/NOD.B10. H2b A B C CD19 CD19 CD19 Isot yp e ctr I g M I g G1

PAGE 78

66 Figure 3-11. Detection of antinuclear antibodies in mouse serum from 20 weeks old Balb/c, NOD.B10. H2b NOD.IL4-/and NOD.B10H2b .IL4-/-. Sera were diluted 1:50 in 1xPBS and reacted with HEp-2 cells. Preparations were washed and then incubated with a FITC-conjugated goat anti mouse IgG secondary antibody and visualized using a fluorescent microscope (100X). Balb/c NOD.IL4-/-NOD.B10H2b .IL4-/-NOD.B10 Positive Control Negative Control

PAGE 79

67 Figure3-12. FACS analysis of anti-M3R autoantibodies present in the sera of Balb/c, NOD.B10. H2b NOD.B10H2b .IL4-/and NOD.IL4-/-. Sera isolated from NOD.B10. H2b NOD.B10H2b .IL4-/-, NOD.IL4-/and Balb/c mice (n=5~6) at 4 ( ) and 20 weeks of age( ) were preabsorbed with Flp-In CHO cells and incubated with mM3R-transfected Flp-In CHO cells (5 x 105). Cells stained with either FITC-conjugated goat anti-mouse IgG or FITC-conjugated goat anti-mouse IgA, IgG1, IgG2a, IgG2b, IgG3, IgE, IgM and analyzed using a FACScan cytometer. IgG IgM IgG1 IgG2a IgG2b IgG3 IgA IgE Balb/c NOD.B10. H2b NOD.B10H2b .IL4-/NOD.IL4-/

PAGE 80

68 Fig 3-13. Immunoflouresent staining of submandibular glands from NOD.B10. H2b and NOD.B10H2b .IL4-/mice. Submandibular glands from 12 and 20 weeks old NOD.B10. H2b and NOD.B10H2b .IL4-/were incubated with rat anti-mouse IgG1, IgG2a, IgG2b, IgG3, followed by goat anti-rat IgG FITC, and visualized with a fluorescent microscope with a blue filter (200X). C57BL/6 NOD.B10. H2b NOD.B10H2b .IL4-/NOD.B10. H2b NOD.B10H2b .IL4-/20wks 12wks 12wks 20wks 20wks

PAGE 81

69 CHAPTER 4 IL4: THE CONTROLLING ELEMENT FOR DEVELOPMENT OF CLINICAL DISEASE IN MOUSE MODEL OF SJOGREN’S SYNDROME Introduction Autoimmune diseases are complex disorders characterized by inappropriate adaptive immune responses directed against self-tissues. Lymphoproliferation and hypergammaglobulinemia are two striking clinical manifestations of Sjgren’s syndrome (SjS). B cells in Sjgren’s syndrome are important contributors in the pathogenesis of autoimmunity for their ability to produce autoantibodies. Numerous autoantibodies have been detected in patients’ serum. The loss of gland function has been achieved in normal animals by passive transfer of serum IgG from either NOD mice or human SjS patients, an observation that led to the discovery that there is a critical dependence on autoantibodies for the clinical symptoms of the disease to be manifested (Robinson et al. 1998). Recent developments on important cellular and signaling components involved in B cell development and the maintenance of normal humoral immune responses provide new insight into the role of B cells in autoimmune disease. Defects that alter B cell longevity and alter thresholds for cellular activation could lead to autoantibody production. Cytokines that are particularly important in B cell growth, differentiation, and survival could allow autoreactive B cells to escape the screening for reactivity with peripheral self-antigens resulting in apoptosis, receptor editing or anergy. Signals generated through the B cell antigen receptor (BCR) are also critical for B cell responses

PAGE 82

70 to a n ti g e n. T h e B CR is a multip r o t e in c o mpl e x c o nt a ining a n a n tig e n b inding m e mbr a ne immunoglobulin (Ig) assembly of heavy and light chains, which are non-covalently associated with the s i g n a l transduction elements I g a lpha (CD7 9 a ) and I g beta (CD79b). These phosphorylation events of the cytoplasmic domains of Ig alpha and beta facilitates downstream signaling cascades that promote B cell activation (Benschop et al. 1999). The characterization of NOD.B10H2b .IL4-/has provided significant evidence to support the critical role of IL4, a cytokine actively involved in cell activation, proliferation and differentiation, in humoral immune responses and in the loss of secretory capacity associated with autoimmune excrinopathy. My observations utilizing the NOD.B10-H2b .IL4-/mouse model indicated that the presence of autoimmune B cells capable of making anti-M3R antibodies, except IgG1 isotype, persists in the absence of IL4. This finding supports the hypothesis that IL4 functions in autoimmune exocrinopathy as a signaling molecule between immune cells, driving the expansion of clonal expansion and production of pathogenic isotypic autoantibodies, as oppose to promoting B cell lymphopoiesis and the survival of autoimmune B cell population through positive and negative selection events in the first place. In this study, I have attempted to further characterize our model of the NOD.B10-H2b .IL4-/mouse by adoptively transferring splenic CD4+ T lymphocytes capable of expressing IL4 at time points corresponding to different disease stages. The goal has been to dissect the critical stage(s) for possible IL4 involvement in the immunological alterations taking place before the onset of clinical disease.

PAGE 83

71 Materials and Methods Ani m als. NOD B10H2 b I L 4/ mice (n=4 / g rou p ) were b r ed and m a intain e d under specific pathogen free condition in the mouse facility at the University of Florida, Gainesville, FL. NOD.B10H2b Gfp mice, generated from crossing parental strains NOD.B10. H2b and NOD.B6Gfp F1 heterzygotes were inbreeded and F2 screened by PCR of microsatelite MHC loci with D17-Mit21 MapPair primer set. Gfp phenotype was identified by observing under UV light. Adoptive transfer. Spleens were collected from NOD.B10H2b Gfp at 4, 10 and 16 weeks of age. Single spleen cell suspensions were prepared as described before. Cell populations were incubated with PE labeled CD4 antibody at a concentration of 1g/106. CD4+GFP+ cells were sorted with FACS. 106 cells (0.1ml) were adoptively transferred into sexand age-matched NOD.B10H2b .IL4-/mice (n=4/group) via tail vein injections once a week for 2 weeks. Animals were then monitored for salivary secretory function, and killed once they developed clinical disease, otherwise to 36 weeks old. Measurement of salivary flow rates. To stimulate secretion of saliva, mice were given an intraperitoneal injection of 0.2mg/ml isoproterenol and 0.1mg/ml pilocarpine dissolved in 1x phosphate buffered saline. Saliva samples were collected from each mouse for 10 min and their volumes measured. Detection of intracellular IL4 from peripheral blood GFP+ lymphocytes after adoptive transfer. Two weeks after adoptive transfer, peripheral blood lymphocytes were isolated from 10 0 l whole heparini z e d blood b y densi t y g r adient cent r ifu g ation using Lympholyte-M as recommended by the manufacturer (Cedarlane, Ontario, Canada). Cells were fixed and permeablized in 250 l Cytofix/Cytoperm solution (BD

PAGE 84

72 Bioscience) for 10-20 min at 4C, followed by two washes with 1xPerm/Wash™ solutions (BD Bioscience). Fixed cells were then stained with PE labeled IL4 for 45 minutes at 4C. Data acquisition and analysis were performed with FACScan cytometer. Detection of IgM and IgG1 isotypic B lymphocyte populations in the spleen after adoptively transferring CD4+ T cells into NOD.B10H2b .IL4-/mice. Spleens were gently minced on a steel sieve, and the resulting red blood cells were lysed by a 7 minutes’ exposure to 0.83% NH4Cl. Aliquotes of cell populations were suspended in 100 l of FACS buffer with fluorescent labeled antibody at a concentration of 1x 106/tube for 45 minutes at 4 oC. Ten thousand events were counted per sample. Flow cytometric analysis on IgG1, IgG2a, IgG2b, IgG3, IgM, IgA, and IgE were performed on a CD19 gate. Immunofluoresent staining. Submandibular glands were surgically removed and placed in O.C.T. Tissue Tek compound to make frozen blocks. All sections were cut at 5 m thickness using an OTF cryostat and mounted on coated slides. Following brief washing with PBS, sections were covered with 2.5%FBS/PBS block solution for 1 hour and incubated with primary antibody (rat anti-mouse IgG1, G2a, G2b,G3, M) at 1:20 dilution for 1.5 hour in a humidity chamber. FITC conjugated oat anti-rat IgG at 1:20 was applied for about 30 min following washing the slides with PBS 4 times. Sections were washed and then mounted in Vectashield mounting medium (Vector Laboratory, Burlingame, CA). Negative controls without primary antibodies were run with each experiment. Slides were visualized under immunofluorescent microscope at x200 magnification.

PAGE 85

73 Detection of anti-mM3R autoantibodies and its isotypes in NOD.B10H2b .IL4/recipients after adoptive transfer. Sera were collected from NOD.B10H2b .IL4-/recipients and stored at –80 oC for future experiments. 10 l sera were pre-absorbed with 5x106 Flp-In CHO at room temperature for 2 hours. pcDNA5/FRT/V5-His mM3Rtransfected Flp-In CHO cells were collected from culture, washed once with phosphatebuffered saline (PBS), and resuspended in FACS buffer (PBS, 2% ABS, 0.01%NaN3) at a density of 1 x 105 cells/0.1 ml. Aliquots of cells were incubated 2 hrs at 4C with 10 l sera from 20 weeks old NOD.B10. H2b NOD.B10H2b .IL4-/mice or 20 weeks old Balb/c. Cells were washed once with FACS buffer and stained with either FITCconjugated goat anti-mouse IgG or FITC-conjugated goat anti-mouse IgA, IgG1, IgG2a, IgG2b, IgG3, IgE and IgM for 45 min at 4oC. After a final wash with FACS buffer, cells were resuspended and analyzed using a FACScan cytometer (Becton Dickinson, Mountain View, CA). Results Adoptive transfer of splenic CD4+ T lymphocytes of NOD.B10H2b.Gfp to NOD.B10H2b .IL4-/mice. Based on the study of NOD.B10H2b .IL4-/mouse, IL4 is essential for the initiation of secretory dysfunction. To further explore the influence of IL4 on the disease course, splenic CD4+ T lymphocytes capable of expressing IL4 were transferred into sexand age-matched NOD.B10H2b .IL4 -/mice at 4, 10, and 16 weeks of age. To provide the same MHC loci necessary for intracellular communication between T and B cells, NOD.B10H2b.Gfp were generated from crossing parental strains NOD.B10. H2b and NOD.B6Gfp. Gfp phenotype was identified under UV light. A set of microsatellite marker D17mit21 was employed to confirm the inheritance of H2b alleles (Data not presented). Once homozygosity was identified, brother sister mating was

PAGE 86

74 carried out to establish the line. CD4+GFP+ cells from NOD.B10H2b.Gfp mice were isolated by FACS-sorting (Fig. 4-1) and transferred into age and sex matched NOD.B10H2b .IL4-/recipients via i.v. injection. Two weeks after transfer, IL4 production in the GFP+ donor cells was confirmed by intracellular staining with PE labeled anti-IL4 and analyzed by FACScan. (Fig.4-2) Salivary flow rates. NOD.B10H2b .IL4-/recipients were monitored for salivary secretory function. Figure 4-3 shows the results of evaluation of salivary volumes generated after chemical stimulation over a 10-minute period from each recipient group at the indicated ages. NOD.B10H2b .IL4 -/mice that received NOD.B10H2b Gfp T cells at 4 or 10 weeks of age exhibited a similar Sjgren’s syndrome like loss of secretory function by 20 weeks of age. By 26 weeks of age, these animals had saliva volumes reflective of NOD.B10. H2b In contrast, recipients that received T cells at 16 weeks of age failed to show significant loss of saliva secretion (Fig 4-3A,B) even if measured at later time points. Detection of spleen IgM and IgG1 isotypic B lymphocyte populations in the recipients after adoptive transfer. The initiation of clinical disease in NOD.B10. H2b mice is accompanied by a proliferation of IgM and IgG1 isotypic B cells in the spleen between 8 and 20 weeks of age. This does not occur in NOD.B10H2b .IL4-/mice. To further explore the critical time period of IL4 function, NOD.B10H2b Gfp T cells, capable of expressing IL4, were adoptively transferred into NOD.B10H2b .IL4-/recipients. As expected, after transfer, recipient NOD.B10H2b .IL4-/mice had elevated level of IgM and IgG1 B cells. This level was comparable to that observed in NOD.B10. H2b mice with onset of autoimmune disease. Interestingly, recipients

PAGE 87

75 receiving the T cells at 16 weeks of age showed a less dramatic IgG1 proliferation than those receiving at 4 and 10 weeks of age. (Fig 4-4A,B) Immunoflouresent staining of antibody deposits. Staining of frozen sections of submandibular glands from recipient NOD.B10H2b .IL4-/mice that received the T cells at 4 and 10 weeks of age revealed the presence of although to a lesser extent compared to that observed in NOD.B10. H2b Very few antibody deposits were found in NOD.B10H2b. IL4-/mice that received the T cells at 16 weeks of age, showing a staining pattern comparable to untreated NOD.B10H2b. IL4-/mice (Fig 4-5). Analysis of anti-M3R autoantibodies. As the loss of secretory function is largely dependent on the production of autoantibodies, anti-M3R and its isotypic forms were measured using Flow cytometric analysis. As shown in Figure 4-6, while NOD.B10H2b .IL4-/fail to make any IgG1, and very few IgM isotypic anti-M3R antibodies. These mice after receiving CD4+ T cells capable of IL4 production exhibited substantial production of IgM anti-M3R autoantibodies. However, the presence of IgG1 anti-M3R antoantibodies was only observed in recipients that received T cells at 4 or 10 weeks of age, not at 16 weeks of age (Figure 4-9). Discussion and Conclusions The humoral immune response has been well documented to drive the glandular dysfunction in the NOD model of Sjgren’s syndrome. Transferring human SjS patients IgG fraction into NOD.Ig null mice provided evidence that autoantibodies produced by the autoreactive B cells are the culprits driving the loss of secretory function (Robinson et al ., 1998b). The physiologic function of IL4 includes controlling the specificity of immunoglobulin class switching and recruitment of mediators of cell growth and resistance to apoptosis. Interestingly, studies in IL4 deficient mice showed the presence

PAGE 88

76 of all isotypic classes of anti-M3R autoantibodies, with the exception of IgG1, suggesting the possibility that the lack of IL4 does not deplete autoimmune B cells, but that IL4 may be required for the production of a possible pathogenic isotype, which leads to loss of secretory function, or promote the clonal expansion of this autoimmune B cell population. To further explore the role of IL4 in the development of exocrine dryness, T cells capable of IL4 production were transferred to NOD.B10H2b .IL4-/at 4, 10 and 16 weeks of age, corresponding to pre-disease stage, active lymphocytic infiltration stage, and exocrine dysfunction stage, respectively. The work presented here points to a critical time for IL4 to function in the development of autoimmune exocrinopathy: between 12 and 16 weeks of age, which corresponds with active lymphocytic infiltration into the target tissue observed in SjS-prone mouse lines. Antigen specific B cells are characterized by surface expressing of immunoglobulins and associated B cell receptor molecules. Activation of B cells require antigenic signals from B cell receptors, as well as a second signal provided by a helper T cell, for example CD40 expressed on B cell surface and CD40L on the helper T cell. T helper cells involved in B cell activation are capable of making IL4. IL4 causes antigen to stimulate nave T cells development into cells capable of producing IL4 plus a series of other cytokines including IL5, 10 and 13 to promote B cell activation and differentiation (Seder et al ., 1992; Hsieh et al ., 1992). As previous studies documented, there is an increased expression of cytokines IL 1 IL-2, IL-6 IL-10, IL-12 TNF# TGF" and IFN! on the mRNA levels in the submandibular and lacrimal glands at this stage (Sutcliffe et al ., 1998; Yanagi et al ., 1998; Mustafa et al ., 1998). Interestingly, IL4 was reported to be occasionally detected, often

PAGE 89

77 associated with strong B cell accumulation in the glands (Ohyama et al ., 1996). My data also confirmed that proinflammatory cytokines peaked at 12 weeks of age and waned by 20 weeks of age in NOD.B10. H2b submandibular glands; in addition, IL4 was detected in the submandibular glands at 12 weeks old NOD.B10. H2b mice. Though only transiently detected, the presence of IL4 could significantly change the disease course. Transferring T cells that produce IL4 into NOD.B10H2b .IL4-/mice at 16 weeks of age resulted only a marginal decline of secretory function and antibody production in the recipients. These findings suggest, first, that IL4 is critical for autoantigenic B cell activation in a highly activated microenvironment, and second, that the presence of IL4 also leads to the production of IgG1 isotypic anti-M3R antibodies, which appears to be more pathogenic than other isotypes. In summary, these results suggests that IL4 may be less important as a growth factor in the clonal expansion of autoimmune B cells at the early stage of development than as an intracellular signaling molecule during development of the autoimmune attack. In addition, the timing of IL4 function seems critical; IL4 appears to function as a cytokine directly involved in the disease process by promoting IgG1 B cell proliferation and production of isotypic autoantibodies.

PAGE 90

78 Figure 4-1. FACS analysis of CD4+GFP+ cell population before (left) and after (right) sorting. Single spleen cell suspensions were incubated with PE labeled CD4 antibody at a concentration of 1 g/106. CD4+GFP+ cells were sorted with FACS. FACS analysis showed CD4+GFP+ cell purity is greater than 90%. GFP CD4-PE

PAGE 91

79 Figure 4-2. FACS analysis of intracellular IL4 in transferred GFP+ cells 2 weeks after adoptive transfer. Peripheral blood lymphocytes were isolated from heparinized blood by density gradient centrifugation using Lympholyte-M. Cells were fixed and permeablized. Fixed cells were then stained with PE labeled IL4 and analyzed with FACScan cytometer. (Left: before adoptive transfer Right: 2 weeks after adoptive transfer) IL4-PE GFP

PAGE 92

80 Figure 4-3. Alterations in saliva volume in NOD.B10 -H2b .IL4-/after adoptive transfer CD4+ T cells from NOD.B10H2b.Gfp (A) Temporal changes in saliva volume in NOD.B10H2b .IL4-/after adoptive transfer CD4+ T cells from NOD.B10H2b.Gfp (n=4) (B) Saliva volume in NOD.B10 -H2b .IL4-/after adoptive transfer CD4+ T cells from NOD.B10 -H2b.Gfp All values were collected when clinical disease occurred or till 36 weeks of age. 0 2 4 6 8 10 12 14Saliva Volume/body weight (ul/g)AT 4-26 AT 10-26 AT 16-36 NOD.B10. H2b 20wks NOD.B10H2b .IL4/ -20wks 0 1 2 3 4 5 6 7 8 9 10 4wks10wks16wks20wks26wks30wks36wks A g e Saliva volume/ body weight (ul/g) 4 wks group 10 wks group 16 wks group B A

PAGE 93

81 IgM / Splenocytes 05 10152025303540 8 wk s 1 2 w k s 1 6 w k s 20 w k s 8w k s 12 w k s 1 6 w k s 2 0 w k s A T 42 6 AT 1 0 -2 6 A T 16 3 6Percentage of splenocytes (%) IgG1 / Splenocytes 0369 12 8 wk s 12 w k s 16 w k s 2 0 w k s 8 wk s 12 w k s 16 w k s 2 0 w k s AT 4 2 6 AT 1 0 2 6 AT 16 36Percentage of CD19 cells Figure 4-4. FACS analysis of IgM and IgG1 isotypic spleen B lymphocyte populations NOD.B1 0 H2 b I L 4/ af t e r adop ti v e t r ans f er C D 4+ cells from NOD B10H2b.Gfp NOD.B10H2b .IL4-/NOD.B10. H2b NOD.B10H2b .IL4-/NOD.B10. H2b A B

PAGE 94

82 Figure 4-5. Immunofluorescent staining of isotypic antibodies in submandibular glands of NOD.B10. H2b. IL4-/after adoptive transfer CD4+ T cells from NOD.B10H2b Gfp All sections were stained with primary antibody (rat anti-mouse IgG1, G2a, 2b, G3, A) at 1:20 dilution for 1.5 hour in a humidity chamber. FITC conjugated oat anti-rat IgG at 1:20 was applied for about 30 min following washing the slides with 1xPBS 4 times. Sections were washed and then mounted in Vectashield mounting medium. Negative controls without mary antibodies were run with each experiment. Slides were visualized under immunofluorescent microscope at x200 magnification. IgG3 IgG2a IgG1 IgM IgG2b IgG3 IgG2a IgG1 IgG1 IgG2a IgG2b IgG3 AT 4-26 AT 10-26 AT 16-36 I g M I g M IgG2b

PAGE 95

83 F i g u re 4-6. F low cytometric ana l y s is of anti-M3R autoantibodies in sera of N OD B 1 0 H2 b I L 4/ after adoptive transfer CD4+ T cells from NOD.B10H2b.Gfp Sera from 4 weeks old NOD.B10H2b .IL4-/( ) and different adoptive transfer groups ( ) were pre-absorbed with 5x106 Flp-In CHO and incubated with 10 l preabsorbed sera. Cells were washed once with FACS buffer and stained with either FITC-conjugated goat anti-mouse IgG or FITC-conjugated goat anti-mouse IgM, IgG1, IgG2a, IgG2b, IgG3, IgA, IgE and analyzed using a FACScan cytometer. A T 16 36 A T 10 26 A T 4 2 6 IgM IgG1 IgG2a IgG2b IgG3 IgA IgE

PAGE 96

84 CHAPTER 5 IL-4 SIGNAL TRANSDUCTION PATHWAYS: DIFFERENTIAL EXPRESSION OF THE STAT-6 PATHWAY IN SJS-LIKE DISEASE OF NOD MICE Introduction Over the past several years, a good correlation between Sjgren’s syndrome in humans and autoimmune exocrinopathy in the NOD mouse has been established. Accumulating evidence on congenic partner strains and cytokine knockout strains of the NOD model, especially the NOD.B10. H2b NODscid NOD.Ig -/-, NOD.IFN #-/-, NOD.IL4-/and NOD.B10. H2b .IL4-/-, showed autoimmune excrinopathy develops in multiple, independent and sequential phases. The first phase is characterized by pathophysiologic and biochemical changes in the exocrine glands that includes delayed organogenesis, aberrant protein expressions, proteolytic processing, and increased cell apoptosis. A second phase is characterized by the appearance of leukocytic infiltration in the salivary and lacrimal glands, elevation of cytokine production, and the production of autoantibodies. While aberrant physiological and biochemical process indicate glandular abnormalities, it is the immune attack that precipitates secretory dysfunction of the exocrine glands. The presence of phase 1 physiological and biochemical abnormalities and the lack of phase 2 immune attack and secretory dysfunction in NODscid and NOD.Ig -/mouse strains indicated the essential role of immune cells, especially B cells, in the pathogenesis of autoimmune exocrinopathy, supporting these are two independent and apparently sequencial phases in the disease process.

PAGE 97

85 Studies from NOD.IL4-/and NOD.B10. H2b .IL4-/showed intact pathophysiologic and biochemical changes followed by exacerbation of leukocytic infiltration in the exocrine glands. However, no loss of secretory function in these mice suggest the presence of IL4 is required for the development of clinical disease, possibly by its ability to induce the production of pathogenic autoantibodies. Since IL4 can activate two distinct signal transduction pathways following IL4 receptor binding, the critical role of IL4 in autoimmune excrinopathy maybe to control isotype switching in B lymphocytes by activating the STAT6 pathway, or to induce autoimmune B cell clonal expansion and survival by activating the IRS pathway. In this study, I have generated a new congenic mouse strain (still in construction) NOD.B10. H2b. C129S2-STAT6-/-, in order to document its autoimmune phenotype. By comparing this phenotype with NOD.B10. H2b and NOD.B10H2b .IL4-/mouse, I should be able to determine through which transduction pathway IL4 elicits its regulation of the autoimmune response in the autoimmune excrinopathy of the NOD mouse model of Sjgren’s syndrome. Materials and Methods Construction of the NOD.B10H2b. C129S2 STAT6-/mouse One male C129S2 STAT6tm1Gru mouse was purchased from Jackson Laboratory. Construction of NOD.B10. H2b-C129S2. STAT6-/mouse was initiated by breeding a NOD.B10. H2b female to a C.129S2STAT6tm1Gru male mouse to obtain F1 generation. A F1 mouse was then bred back to a NOD.B10. H2b parental strain mouse to obtain BC1 generation.BC1 mice were genotyped to identify a male mouse homozygous for H-2b and heterozygous for the disrupted STAT6 gene. DNA was extracted from mouse tail using DNeasy Tissue

PAGE 98

86 Kit (Qiagen Corp.) PCR was performed on the DNA isolated from BC1 generation mouse. MapPair primers capable of differentiating between the H-2IAb and H-2IAd were ordered from Research Genetics (Invitrogen Corp). Primers capable of identifying the STAT-6 gene and neo-gene disrupted STAT-6 gene were listed in Table 5-1. PCR was performed as an initial dissociation of the genomic DNA by heating the reaction mix to 94C for 3 min, the reaction was carried out for 34 cycles with each cycle consisting of 94C for 1 min, a step-down of 64 61C for 1 min (i.e., a 0.3C step-down every 6 seconds) and 72C for 3 min. After 34 cycles the reaction was held at 72C for 10 min, and then cooled to 4C until removed. The male identified as being homozygous for H2b and heterozygous for the disrupted STAT-6 gene was then bred to a NOD.B10. H2b parental female mouse to generate a BC2 generation. This BC2 generation was genotyped and selected a male mouse homozygous for H-2b and heterozygous for the disrupted STAT-6 gene. With each backcross, genetic material from the C129S2 mouse decrease by 50%. The 3rd BC generation theoretically contains 93.75% genetic material from NOD.B10. H2b parental strain. Preliminary study was conducted on inbreds of 3rd BC, which were genotyped as NOD.B10H2b. C129S2 STAT6+/+, NOD.B10H2b .C129S2-STAT6+/-, and NOD.B10H2b .C129S2-STAT6-/-. Measurement of salivary flow rates. To measure stimulated flow rates of saliva, individual mice were given intraperitoneally a secretagogue cocktail of isoproterenol (0.1mg/ml) plus pilocarpine (0.2mg/ml) dissolved in phosphate buffered saline (PBS). Saliva samples were collected from each mouse for 10 min starting 1 min after injection. The volume of each saliva sample was measured and adjusted to body weight. The saliva

PAGE 99

87 samples were then frozen at –80oC until analyzed for protein concentrations and proteolytic activities. Histology. Submandibular and lacrimal glands were surgically removed from euthanized mice at 20 weeks of age. The tissues were fixed in 10% phosphate buffered formalin for 24 hrs, embedded in paraffin, sectioned (5 / section) and stained with Mayer’s hematoxylin and eosin (H/E) dye. Stained specimens were observed at 40X and 100X magnification. Immunofluoresent staining of infiltrating lymphocytes. Mouse submandibular tissue sections (5 m) mounted on electroStatically treated slides were processed for antigen retrieval, which included deparaffinization and rehydration. Briefly, paraffin sections were dewaxed and re-hydrated by placing them in 2 changes of xylene for 5 minutes each, followed by 2 changes of ethanol for 2 minutes each, followed by briefly wash in tap water. The slides were immersed in the Trilogy reagent and heated to 95C for 30 min. For immunofluorescent staining of T and B cells, sections were incubated with rabbit serum (1:67 diluted in PBS) for 1 hour. After a wash in PBS, the sections were covered with goat anti mouse CD3 (1:10) and rat anti mouse CD45/B220 (1:10) antibodies diluted in antibody diluting buffer (DAKO Cytomation, Carpinteria, CA) for 1 hour. Subsequently, slides were stained with FITC conjugated Rabbit anti Goat antibody (1:25) for 1 hour followed by TexasRed labeled rabbit anti rat antibody (1:25) for another hour with complete washes between and after staining. Sections mounted using Vectashield Mounting Media with nuclear marker Dapi (Vector Laboratory, Burlingame, CA), and analyzed by transmission or fluorescence microscopy.

PAGE 100

88 Proteolysis of parotid secretory protein (PSP). 42 l PSP oligopeptide (2.5mg/ml) was incubated at 42oC for 2 hrs with aliquotes of whole saliva (8 l ) collected from individual mice. Controls consisted of 50 l PSP oligopeptide. Following incubation, 50 l Tris-HCl buffer (50 mM, pH 8.0) was added and the mixture centrifuged through Micro-spin filter tubes at 14,000 rpm for 10 min. The filtrates were analyzed by HPLC (Dionex Systems) for the presence of cleavage products. Antinuclear antibody (ANA). ANA was detected by indirect immunofluorescence staining with Sigma Diagnostics Antinuclear Antibody Kits. Tested sera were diluted 1:50 with PBS. 50 l diluted sera was added to separate wells for a 3 hours’ incubation in a humidity chamber. After a brief rinse with PBS followed by 2 5 minutes’ wash, FITC-conjuagated goat anti-mouse whole Ig at a 1:200 dilution was applied to individual wells for 45 minutes. The slides were washed in 1xPBS, then mounted and visualized on an immunofluorescent microscope at 100X magnification. Detection of anti-mM3R autoantibodies and its isotypes in NOD.B10H2b C129S2-STAT6+/+, NOD.B10H2b .C129S2-STAT6+/-, and NOD.B10H2b .C129S2STAT6-/-mouse. Sera were collected from and stored at –80 oC for future experiments. 10ul sera were pre-absorbed with 5x106 Flp-In CHO at room temperature for 2 hours. pcDNA5/FRT/V5-His mM3R-transfected Flp-In CHO cells were collected from culture, washed once with PBS, and resuspended in FACS buffer (PBS, 2% ABS, 0.01%NaN3) at a density of 1 x 105 cells/0.1 ml. Aliquots of cells were incubated 2 hrs at 4C with 10 l sera from 20 weeks old NOD.B10H2b. C129S2-STAT6+/+, NOD.B10H2b. C129S2STAT6+/-, and NOD.B10H2b .C129S2-STAT6-/mouse. Cells were washed once with FACS buffer and stained with either FITC-conjugated goat anti-mouse IgG or FITC-

PAGE 101

89 conjugated goat anti-mouse IgA, IgG1, IgG2a, IgG2b, IgG3, IgE and IgM for 45 min at 4oC. After a final wash with FACS buffer, cells were resuspended and analyzed using a FACScan cytometer (Becton Dickinson, Mountain View, CA). Results Construction of the STAT-6 knockout mouse The NOD.B10H2b. C129S2STAT6-/mouse has been generated thus far by breeding a NOD.B10. H2b female to a C.129S2 -STAT6tm1Gru male mouse to obtain the F1 generation. A F1 male mouse was then bred back to a female NOD.B10. H2b parental strain mouse for 3 generations. In each generation, the breeder male mouse was identified as homozygous for H-2b and heterozygous for the disrupted STAT6 gene. The mice from the 3rd backcross generations were genotyped following Jackson Lab protocol. As shown in Figure 5-1, while genomic DNA from NOD.B10H2b .C129S2-STAT6+/+ (BC3F1) failed to amplified a 275bp wide type STAT6 band, and genomic DNA from NOD.B10H2b .C129S2-STAT6-/(BC3F1) amplify a 172bp DNA fragment from the disrupted STAT6 allele. Both bands can be identified in NOD.B10H2b .C129S2 STAT6+/-. Homozygous MHC I-A loci were confirmed by microsatelite typing with Mit17-21 MapPair, which generates a 137bp of the H2b (data not shown). NOD.B10H2b .C129S2-STAT6+/+ (BC3F1), NOD.B10H2b .C129S2 STAT6+/(BC3F1) and NOD.B10H2b .C129S2-STAT6-/(BC3F1) mice were identified and used in the following experiments, even though they are estimated to be only 94% NOD genotype. Mononuclear cell infiltration of the salivary and lacrimal glands in NOD.B10H2b .C129S2-STAT6+/+, NOD.B10H2b .C129S2 STAT6+/and NOD.B10H2b. C129S2 STAT6-/mice. Lacrimal and submandibular glands were surgically

PAGE 102

90 removed from NOD.B10H2b. C129S2 STAT6+/+, NOD.B10H2b. C129S2-STAT6+/and NOD.B10H2b. C129S2-STAT6-/mice at 12 and 20 weeks of age. A small piece of each tissue was stained with hematoxylin and eosin (H&E) and examined for leukocyte infiltration. In contrast to NOD.B10H2b .IL4-/and NOD.IL4-/with exacerbated inflammation of the exocrine tissue, NOD.B10H2b .C129S2-STAT6+/+, NOD.B10H2b. C129S2-STAT6+/and NOD.B10H2b. C129S2-STAT6-/did not show any sign of focal infiltrates at 12 weeks of age. By 20 weeks, submandibular glands from all three groups were heavily infiltrated in both male and female mice. Focal lymphocytic infiltration was also easily seen in lacrimal glands. Representative histological profiles of glandular infiltrations are shown in Figure 5-2. Both T cells (CD3+) and B cells (B220+) were identified in the infiltrating cells in submandibular glands and lacrimal glands by indirect immunofluorescent staining (Figure 5-3A). Furthermore, like their parental NOD.B10. H2b strain, submandibular glands of female mice of NOD.B10H2b. C129S2 STAT6+/+, NOD.B10H2b. C129S2-STAT6+/and NOD.B10H2b. C129S2-STAT6-/exhibited more severe infiltration than males; while lacrimal glands of male mice developed exacerbated infiltrates. Figure 5-3B showed severe lymphocytic infiltration predominant by B220+ B cells in the lacrimal glands of a male NOD.B10H2b. C129S2 STAT6+/mouse. Aberrant expression of parotid secretory protein. The appearance of an aberrant isoform of parotid secretory protein (PSP) in the submandibular and lacrimal glands is one of the altered biochemical and physiological properties associated with the salivary glands of NOD mice (Robinson et al ., 1997b). PSP is detected in saliva of all strains, but the unique aberrant 25KDa isoform is associated only with NOD mice. Saliva collected

PAGE 103

91 from NOD.B10H2b. C129S2-STAT6+/+, NOD.B10H2b. C129S2-STAT6+/and NOD.B10 .H2bC129S2-STAT6-/mice were tested for the presence of PSP-proteolytic activity using HPLC methodology. As indicated in Table 5-1, about 1/2 to 2/3 of 12 weeks old mice tested showed the presence of cleaved PSP peptide, with the percentage increasing to 3/4 by 20 weeks of age. Measurement of salivary flow rates. To determine the impact of the STAT6 signal transduction pathway for IL4 on salivary function in the Sjgren’s syndrome NOD mouse, total stimulated saliva volumes were measured temporally from 4 till 20 weeks of age on a monthly basis in NOD.B10H2b. C129S2-STAT6+/+, NOD.B10H2b. C129S2 STAT6+/and NOD.B10H2b. C129S2-STAT6-/mice. As presented in Figure 5-5, all three groups of mice showed a significant decline over time in secretory function compared to volumes measured at 4 weeks of age. NOD.B10H2b. C129S2-STAT6+/+ showed a 48% decline compared to 36% and 38% in NOD.B10H2b. C129S2-STAT6+/and NOD.B10H2b. C129S2-STAT6-/mice respectively. PSP proteolytic activity, which is used as a predisease marker suggestive of a loss of homeostasis in exocrine gland epithelial cells before actual immune attack, showed in 3/4 of animals after three generations of backcrossing. A comparison of secretory function between animals with positive or negative PSP proteolytic activities showed that, in animals with positive proteolytic activity, NOD.B10H2b.C129S2STAT6+/+ mice showed significant decrease in saliva volume compare to NOD.B10H2b.C129S2STAT6-/mice. In contrast, in animals with negative proteolytic activity, no significant differences were observed among NOD.B10. H2bC129S2-STAT6+/+, NOD.B10H2b. C129S2-STAT6+/and NOD.B10H2b. C129S2-STAT6-/mice (Figure 5-6). As expected, NOD.B10H2b. C129S2-

PAGE 104

92 STAT6+/+ showed a significant increase in saliva protein concentration, though there were similar increases in NOD.B10H2b. C1292S2-STAT6+/and NOD.B10H2b. C129S2STAT6-/animals ( p >0.05) (Figure 5-7). Likewise, the loss of saliva amylase activity in NOD.B10H2b. C129S2-STAT6+/+ was of statistical significance (Figure 5-8), but not in NOD.B10H2b. C1292S2-STAT6+/and NOD.B10H2b. C129S2-STAT6-/-. Detection of anti-M3R autoantibodies in the sera of NOD.B10H2b. C129S2STAT6+/+, NOD.B10H2b. C129S2-STAT6+/and NOD.B10H2b. C129S2-STAT6-/mice. To determine if anti-M3R autoantibodies are produced by NOD.B10H2b. C129S2STAT6+/+, NOD.B10H2b. C129S2-STAT6+/and NOD.B10H2b. C129S2-STAT6-/mice, sera collected at 20 weeks of age were tested for the presence of anti-M3R antibodies using mouse M3R-transfected CHO cells, followed by either FITC-conjugated goat antimouse IgG or FITC-conjugated goat anti-mouse IgA, IgG1, IgG2a, IgG2b, IgG3, IgE and IgM. Analyzsis was completed using flow cytometry. As shown in Figure 5-7, anti-M3R antibodies of several isotypes (including IgM, IgG1, IgG2a) were detected in the sera of NOD.B10H2b. C129S2-STAT6+/+ and NOD.B10H2b. C129S2-STAT6+/at 20 wks of age. As expected, there was an absence of IgG1 isotypic anti-M3R antibodies in the NOD.B10H2b. C129S2-STAT6-/mice. Conclusion and Discussion Incomplete deletion and inappropriate activation of self reactive T and/or B cells are thought to be major causes of autoimmune disease. Autoantibodies produced by autoreactive B cells can cause or contribute to autoimmune disorders such as Sjgren’s syndrome. Experiments with transgenic mice overexpressing proto-oncogenes such as bcl-2 have been shown to elicit autoimmune disease (Strasser et al. 1991). Other

PAGE 105

93 examples are fas or fas-ligand deficient mice, which manifested inappropriate apoptosis of T and B cells which lead to SLE-like symptoms (Singer et al ., 1994). Of major interests are the studies of Brines in which IL-4 can rescue apoptotic B cells from cell death (Brines, 1993). The IL4 transgenic mice in which IL-4 expression is under the control of a major histocompatibility complex (MHC) class I promoter develop anemia, glomerulonephritis with complement and immune deposition in the glomeruli, and accompanied by an increase in production of autoantibodies. The observed disorders were accompanied by elevated responsiveness of B cells to polyclonal stimulation and increased IgG1 and IgE serum levels (Erb et al ., 1997). Studies from NOD.B10H2b .IL4-/-, NOD.IL4 -/and their parental strain NOD.B10. H2b suggested the onset of salivary gland dysfunction in the NOD mouse model of Sjgren’s syndrome is an IL-4 dependent event. The increased production of autoantibodies and the autoimmune-like disorders could be a direct action of IL-4 on autoreactive B cells by expanding them in a polyclonal manner through the IRS pathway. Alternatively, this autoimmune process may solely rely on the production of certain pathogenic isotypic autoantibodies through activation of the STAT-6 signaling pathway. To evaluate the possible role of the JAK-STAT6 pathway, a major pathway involved in the IL4 dependent isotypic switch, in the Sjgren’s syndrome animal model, the NOD.B10H2b .C129S2-STAT6 -/mouse was generated by backcrossing the C.129S2STAT6tm1Gru mouse of the C129S2 background with NOD.B10H2b through 3 generations prior to inbreeding while keeping the truncated Stat6 gene. Characterization of the inbred of the third generation of backcrossing NOD.B10H2b .C129S2-STAT6 +/+, NOD.B10H2b .C129S2-STAT6 +/and NOD.B10H2b .C129S2-STAT6 -/showed the

PAGE 106

94 unique proteolytic enzymatic activity on PSP, a marker for the loss of homeostasis taking place in the exocrine tissue. Significant lymphocytic infiltration is also very common in the submandibular and lacrimal glands of these mice, especially 20 weeks of age. Similar to their NOD.B10. H2b parental strains, female animals exhibited more severe infiltration in the submandibular glands, while male mice manifested more severe lymphocytic infiltration in the lacrimal glands. However, no significant difference among NOD.B10H2b .C129S2-STAT6 +/+, NOD.B10H2b .C129S2-STAT6 +/and NOD.B10H2b .C129S2-STAT6 -/was observed. Cytokine mRNA expression profiles of the submandibular glands also showed the similar pattern observed in age-matched NOD.B10. H2b mice with increased level of IFN! IL-1 IL-10 These observations indicated that in most of the animal, physiological and biochemical alterations are occurring as a result of loss of homeostasis in the exocrine glands occurred, followed by immune attack characterized by lymphocytic infiltration and elevation of proinflammatory cytokines. These events are independent of the IL4 dependent STAT6 pathway. These observations also suggested that despite only 3 generations of backcrossings, the majority of the disease associated genes involved in these events have been transferred into the NOD.B10H2b .C129S2-STAT6 mice. Though three generations of backcrossing is far from ideal to introduce the disease related genes of NOD.B10. H2b onto C129S2 background, the inbreeds of the third generation of backcrossing NOD.B10H2b .C129S2-STAT6 +/+, NOD.B10H2b .C129S2-STAT6 +/and NOD.B10H2b .C129S2-STAT6 -/have already showed the capability of developing physiological and immunological changes similar to their NOD.B10. H2b parental strains.

PAGE 107

95 Secretory function was determined by measuring saliva volume after i.p injection of the secretagogue. All three groups of NOD.B10H2b .C129S2-STAT6 +/+, NOD.B10H2b .C129S2-STAT6 +/and NOD.B10H2b .C129S2-STAT6 -/mice showed a significant decline over time compared to the amount measured at 4 weeks of age. However, analysis of secretory function indicated that only those animals with positive proteolytic activity on PSP showed a significant reduction in saliva volume in NOD.B10-H2b .C129S2 STAT6+/+ mice compare to NOD.B10H2b. C129S2 STAT6-/mice. In contrast, animals with negative proteolytic activity did not reveal any difference in secretory function with or without a functioning Stat6 gene. This may be a result of not inheriting the disease susceptibility genes or inheriting the disease resistance genes through 3 generations of backcrossing; therefore, the role of Stat6 in the development of clinical disease could not be fully evaluated. Results of this preliminary study indicated that after three generations of backcrossing, the animals, which contained 93.5% of their genome from NOD.B10. H2b parent developed all the hallmark manifestation of autoimmune excrinopathy such as focal lymphocytic infiltration, PSP enzymatic proteolysis, the presence of anti-M3R autoantibody, and most importantly the loss of secretory function. The analysis of secretory function in the 3 different groups strains revealed that NOD.B10H2b .C129S2STAT6-/mice also exhibited a reduced secretory volume, suggesting non STAT6 pathways involved in the disease progression. Nevertheless, in animals with positive PSP proteolytic activity, NOD.B10H2b .C129S2-STAT6+/+ mice manifested more severe secretory dysfunction than NOD.B10H2b .C129S2-STAT6-/mice, supporting the

PAGE 108

96 hypothesis that the STAT6 pathway which participates in the generation of IgG1 isotypic anti-M3R autoantibody may also contribute to the loss of saliva volume. The lack of IL4 profoundly alters disease progression in that IL4 deficient animals do not lose the secretory function even though they develop all the other disease manifestations. The observed changes in disease pathogenesis in the NOD.B10H2b .IL4/and NOD.B10H2b .C129S2-STAT6-/provide insights as how IL4 may be involved in the mouse model of Sjgren’s syndrome. IL-4 exerts distinct functions through different signaling pathways. IL4 dependent STAT6 signaling pathway is involved in promoting the expression of IL-4 responsive elements, including CD23, class II MHC or germline immunoglubin g and IL-4R chain (Hou et al ., 1994). IL4 also acts as a co-mitogen for B cell growth (Howard et al ., 1982) through the IRS pathway. Although the exact role of the cytokine IL-4 in the autoimmune exocrinopathy is unclear, it has been postulated that onset of clinical disease is probably due to the IL-4 dependent production of IgG1 anti-M3R autoantibodies, which are responsible for the final loss of secretory function. On the other hand, it may be a result of IL4 driving autoimmune B cell proliferation and clonal expansion. My observation from STAT6 deficiency in the NOD.B10. H2b mouse thus far suggests two findings: first, though earlier studies established a controlling role of IL4 in the progression from the initial autoimmune infiltration of the exocrine glands to the dysfunctional stage of the disease, JAK-STAT6 pathway is not the only pathogenic pathway responsible for the role IL4 plays in this disease model. Second, connection has been suggested between the loss of secretory function and the presence of IgG1 isotypic anti M3R autoantibodies, even though studies from NOD.B10H2b .C129S2-STAT6-/argue against the hypothesis that

PAGE 109

97 the clinical symptoms in the mouse model of Sjgren’s syndrome is mediated by isotype specific IgG1 autoantibodies. The presence of IgG1 isotypic anti-M3R antibody in the secretory dysfunctional NOD.B10. H2b mice but not in disease free NOD.B10H2b .IL4-/mice is clearly due to the presence of IL4. A question that remains is whether IgG1 antiM3R autoantibodies are the only pathogenic antibody. In conclusion, this study suggests that IL-4 may serve multiple roles in the development of Sjgren’s syndrome other than merely enhancing IgG1 isotypic autoantibody production via its isotype switch function, and the clinical manifestations in NOD model of Sjgren’s syndrome are not always IgG1 isotype specific. The characterization of NOD.B10H2b .C129S2-STAT6-/mice forces us to reexamine the role of IL4 in non STAT6 pathways such as the IRS pathway involved in B cell proliferation and survival. Interestingly, a recent study reported 73 novel IL-4-inducible genes and 18 novel STAT6-regulated genes by studying differential expression with Affymetrix oligonucleotide arrays in STAT6-/and IL4-/mice (Chen et al ., 2003). The function of these unknown genes may challenge our view of IL4 signaling and its role in the autoimmune excrinopathy.

PAGE 110

98 Table 5-1 List of murine STAT6 and neomycin disrupted STAT6 primer used in PCR genotyping Primer gene Sequence IMR0158 Neomycin 5'CTG AAT GAA CTG CAG GAC GA -3' IMR0158 Neomycin 5'ATA CTT TCT CGG CAG GAG CA -3' IMR0731 widetype STAT6 5'CTG GAC CTC ACC AAA CGC -3' IMR0732 widetype STAT6 5'CCC GGA TGA CGT GTG C -3'

PAGE 111

99 Figure 5-1. Genotyping of NOD.B10H2b. C129S2-STAT6+/+, NOD.B10H2b. C129S2STAT6+/-NOD.B10H2b. C129S2-STAT6-/mice by PCR. NOD.B10H2b. C129S2-STAT6-/mice were generated by backcrossing F1 generation of NOD.B10. H2b and C.129S2STAT6tm1Gru with NOD.B10. H2b strain. The inbreds of 3rd backcross generations were genotyped following Jackson Lab protocol. STAT6 primer amplify a 275bp wide type STAT6 band from NOD.B10H2b .C129S2-STAT6+/+, neomycin primer set amplify a 172bp DNA fragment from the disrupted STAT6 allele. Genomic DNA extracted from NOD.B10H2b .C129S2-STAT6+/has both 275 and 172bp bands. 100bp DNA ladder (Promega Corporation) was used as a marker. 1000 500 200

PAGE 112

100 Table 5-2. Detection of PSP cleavage products in saliva of NOD.B10H2b .C129S2STAT6+/+, NOD.B10H2b .C129S2-STAT6+/+ and NOD.B10H2b .C129S2STAT6+/+. Cleavage Products Strains Age (weeks) Yes No Percentage (Number of animals) (%) NOD.B10H2b .C129S2-STAT6+/+ 12 3 5 37.5 NOD.B10 -H2b .C129S2-STAT6+/12 11 7 61.1 NOD.B10 -H2b .C129S2-STAT6-/12 3 6 33.3 NOD.B10H2b .C129S2-STAT6+/+ 20 6 4 60.0 NOD.B10 -H2b .C129S2-STAT6+/20 5 3 62.5 NOD.B10 -H2b .C129S2-STAT6-/20 9 3 75.0

PAGE 113

101 Figure 5-2. Morphological changes in the salivary glands of NOD.B10. H2bC129S2.STAT6+/+, NOD.B10. H2bC129S2.STAT6+/and NOD.B10 .H2bC129S2.STAT6-/-. Hematoxylin/eosin stained tissue sections of submandibular and lacrimal glands from 12 and 20 wk old animals (100X). Focal lymphocytic infiltrates were identified as aggregates of > 50 lymphocytes. 12 wks 20 wks SMG LAC SMG LAC STAT6 +/+ STAT6 + / STAT6 / -

PAGE 114

102 Figure 5-3. Immunofluorescent staining of infiltrating lymphocytes in salivary glands. (A) Immunofluorescent staining of infiltrating lymphocytes in the submandibular glands of NOD.B10H2b. C129S2-STAT6+/+, NOD.B10H2b. C129S2STAT6+/and NOD.B10H2b. C129S2-STAT6-/(100X). (B) Immunofluorescent staining of severe lymphocytic infiltration in the lacrimal glands of a male NOD.B10H2b. C129S2-STAT6+/(40X). T cells (green/FITC) and B cells (red/Texas Red) were stained by indirect immunofluorescent staining. DAPI DAPI DAPI STAT6+/+ STAT6+/STAT6-/FITC+TR FITC+TR FITC+TR DAPI A B FITC+TR

PAGE 115

103 Figure 5-4. Analysis of cytokine and IL-4 related transcription factor mRNA expression in the submandibular glands. Glandular total RNA was isolated and amplified by RT-PCR. Cytokine and transcription factor specific primers were used to detect mRNA expression in the salivary glands of NOD.B10. H2b. C129S2STAT6+/+, NOD.B10. H2b. C129S2-STAT6+/and NOD.B10 .H2b. C129S2STAT6-/-. G3PDH was detected as an internal control.

PAGE 116

104 Table 5-3 Analysis of saliva of various strains Strains Age (wks) Total saliva volumea Total Proteinab ( l/gram body weight) (mg/ml) NOD.B1 0 H2 b .C129S 2 S T A T 6+ / + 4 10.73 5 0.4595 3.878 0.3419 NOD.B10H2b .C129S2-STAT6+/4 9.7150.8087 3.5250.2589 NOD.B1 0 H2 b .C129S 2 S T A T 6-/4 10.57 2 0.6161 3.910 0.4592 NOD.B10. H2b 4 8.20920.5619 3.7960.2193 NOD.B10H2b .IL4 -/4 8.68751.0235 3.020.2359 NOD.IL4 -/4 8.72330.6801 3.2980.0731 NOD.B10H2b .C129S2-STAT6+/+ 20 5.6320.596 5.28140.2370* NOD.B10H2b .C129S2-STAT6+/20 6.2330.477 4.19290.1739 NOD.B10H2b .C129S2-STAT6-/20 6.6180.505 4.67250.1726 NOD.B10. H2b 20 5.9800.662 4.0990.2188 NOD.B10H2b .IL4 -/20 8.7110.659 3.560.3334 NOD.IL4 -/20 7.8680.443 3.390.2934 a : values are given as the mean S.E. b : measured by Pierce Coomassie Plus Protein Assay Kit. p <0.05

PAGE 117

105 Figure 5-5. Temporal changes in the total saliva volume from NOD.B10H2b .C129S2ST A T 6+ / +, NOD.B10 H 2 b .C129S2-STAT6+ / and NOD.B1 0 H2 b .C129S2STAT6-/mice. Saliva samples were collected from each mouse for 10 min starting 1 min after injection of the secretagogue. The volume of each saliva sample was measured. All values represent mean S.E. (n= 5~10) Measurement of Saliva Volume23456789 101112 48121620 age (weeks)Saliva volume / body weight (ul/g) NOD.B10-H2b.C129S2-STAT6+/+ NOD.B10-H2b.C129S2-STAT6+/NOD.B10-H2b.C129S2-STAT6-/NOD.B10-H2b.IL4-/NOD.IL4-/-

PAGE 118

106 Figure 5-6. Total saliva volume from NOD.B10H2b .C129S2-STAT6+/+, NOD.B10H2 b .C129S2-STAT6+ / and NOD B10 H2 b .C1 2 9S2-STAT6/ mi ce at 20 weeks of age. Saliva samples were collected from each mouse for 10 min starting 1 min after injection of the secretagogue. The volume of each saliva sample was measured. All values were expressed as volume collected from individual mouse. p <0.05 (unpaired student t test)

PAGE 119

107 Figure 5-7. Total saliva protein concentration from various strains at 4 and 20 weeks of age. Total protein concentration was determined by Pierce Coomassie Plus Protein Assay Kit follow manufacturer’s instructions. Values were recorded using a microplate reader. All values are given as the mean S.E. (* p <0.05 unpaired student t -test)

PAGE 120

108 Figure 5-8. Saliva amylase activity from NOD.B10H2b .C129S2-STAT6+/+, NOD.B10H2b .C129S2-STAT6+/-, and NOD.B10H2b .C129S2-STAT6-/mice. Saliva amylase activity was determined by Infinity TM Liquid Amylase Kit following manufacturer’s protocol. Amylase activity (u/L) was calculated as % Absorbance/2 x 5140x dilution factor. Values are expressed as means of 5 experimental animals the standard deviation. p <0.05 (unpaired student t test)

PAGE 121

109 Figure 5-9. Detection of antinuclear antibodies in mouse serum. Serum from 20 weeks old Balb/c, NOD.B10. H2b NOD.B10H2b .C129S2-STAT6+/+, NOD.B10H2b .C129S2-STAT6+/-, and NOD.B10H2b .C129S2-STAT6-/mice were diluted 1:50 in PBS and reacted with HEp-2 cells. Preparations were washed and then incubated with a FITC-conjugated goat anti mouse IgG secondary antibody and visualized using a fluorescent microscope (100X). STAT6-/STAT6+/+ STAT6+/Balb/c NOD.B10. H2b Positive Control Negative Control

PAGE 122

110 F i g u re 5-10. F A CS ana l y s is of anti-M3R autoantibodies present in the se r a of 20 weeks old NOD.B10H2b .C129S2-STAT6+/+, NOD.B10H2b .C129S2-STAT6+/-, and NOD.B10H2b .C129S2-STAT6-/mice. Sera isolated from 20weeks old ( ) or 4 weeks old animals ( ) were preabsorbed with Flp-In CHO cells and incubated with mM3R-transfected Flp-In CHO cells (5 x 105). Cells stained with either FITC-conjugated goat anti-mouse IgG or FITC-conjugated goat anti-mouse IgA, IgG1, IgG2a, IgG2b, IgG3, IgE, IgM and analyzed using a FACScan cytometer. I g M I g G1 I g G2a I g G2b I g G3 I g A I g E NOD.B10H2b C129S2-STAT6+/+ NOD.B10H2b C129S2-STAT6+/NOD.B10H2b C129S2-STAT6-/-

PAGE 123

1 11 CHAPTER 6 DETECTION OF ANTI-TYPE 3 MUSCARNIC ACETYLCHOINE RECEPTOR AUTOANTIBODIES IN SERA OF SJOGRENS SYNDROME PATIENTS Introduction Diagonsis of Sjgrens syndrome has been historically somewhat arbitrary due to the use of multiple classification criteria world-wide for clinical diagnosis (Manthorpe et al. 2000), a recent joint effort by American and European researchers has now established a more standardized set of diagnostic markers (Vitali et al. 2002). Although recommending either histological evidence of inflammation in a minor salivary gland biopsy and/or detection of circulating autoantibodies against the nuclear antigens, SS-A/Ro and/or SS-B/La, be demonstrated, this new standardized classification scheme still relies on subjective criteria and abnormal values for ocular and salivary gland function. A variety of autoantibodies have been reported to be present in the sera of primary and secondary SjS patients including anti cholinergic autoantibodies (Gordon et al ., 2002). Recent studies from our laboratory (Brayer et al ., 2001; Nguyen et al ., 2000) have provided evidence that antibodies reactive with the type-3 muscarinic acetylcholine receptor (M3R) may be the primary underlying cause for the loss of secretory function leading to dry mouth, a common complaint described by patients. Unlike the many intracellular antigens that give rise to autoantibodies, the M3R is a membrane-bound protein involved in the parasympathetic neuro-stimulation of exocrine and some non-exocrine cells. Although indirect, studies showing that sera from either primary or secondary SjS patients can inhibit smooth muscle contraction in isolated bladder strips

PAGE 124

1 12 support the concept that autoantibodies can interfere with parasympathetic neuro-transmission (Waterman et al. 2000). Another persistent problem in identifying SjS patients is that the autoantibodies currently being detected in patient sera are not specific for SjS per se and their relevance to disease remains unclear, despite the fact that the majority of classification criteria rely on their detection. For example, only 40-60% of primary SjS patients have detectable anti-SS-B/La autoantibodies while 50-60% have anti-SS-A/Ro; however, these autoantibodies can be prevalent in other connective tissue disorders, like SLE, as well (Reichlin et al. 1998). Furthermore, the frequencies of antiSS-A/Ro and anti-SS-B/La antibodies in SjS patients often depend on the detection methods and setting of the study. Identification of autoantibodies against M3Rs in the sera of SjS patients, together with studies showing the probable importance of these autoantibodies in the disease pathology, has raised interest in attempts to measure anti-M3R autoantibodies in patient sera. To this end, studies using synthetic peptides homologous with the M3R have proven disappointing, especially by failing to show specificity (Cavill et al ., 2002) despite a report on the positive reactivity of sera toward a 25-mer synthesized peptide (Bacman et al. 2001), however these authors used a synthetic peptide corresponding to the type 4 muscarinic receptor rather than type 3, due to an incorrect entry in GenPept. (Bonner et al ., 1987; Cavill et al ., 2002) This raises the possibility that anti-M3R autoantibodies recognize an epitope created by the tertiary structure of the transmembrane segments created by intermolecular disulfide bonding. In our mouse system, we have successfully cloned mouse M3R and expressed the protein in the CHO cell line in order to maintain inherent folding of the membrane-

PAGE 125

1 1 3 associated protein. In the present study, my goal has been to attempt the same strategy to examine the ability to detect anti-M3R autoantibodies in the sera of primary and secondary SjS patients using a human M3R transfected cell line. Materials and Methods Sera specimens. Sera used in this study were obtained and prepared by Dr. Roland Jonsson from either healthy normal individuals or patients living in Norway. Primary and secondary SjS were diagnosed using the European criteria for SjS and the ACR criteria for SLE or rheumatoid arthritis. Sera were collected under a research protocol approved by the Regional Committee for Medical Research Ethics of Western Norway. The current studies were carried out under the University of Florida IRB-approved protocol #605-2000. Amplification of M3R from Jurkat cells. The coding region for human M3R was amplified by reverse transcriptase-polymerase chain reaction (RT-PCR) using mRNA isolated from 1 x 106 Jurkat cells (ATCC # TIB-152) a cell line known to express the M3R (Hellstrom-Lindahl and Nordberg). The PCR was carried out as described elsewhere (Nguyen et al. 2000) with synthesized forward and reverse oligonucleotide primers 5'-CGGAATTCGAGTCACAATGACCTTGCACAA-3' and 5'-CAAGGCCTGCTCGGGTGC-3'. A 1.7 Kbp sequence encoding theM3R open reading frame (ORF) was purified using Qiagen's Gel extraction kit (Qiagen, Valencia, CA) and quantified by spectrophotometric analysis (optical density measured at 260 nm). Construction of the M3R cloning vector. The isolated PCR product was ligated into the pcDNA5/FRT/V5-His Topo TA cloning vector (Invitrogen, Carlsbad, CA) containing the ampicillin-resistance gene. Ligation and transformation of E. coli were performed according to the manufacture's protocol. Several transformed colonies were

PAGE 126

1 14 selected and each colony was grown overnight in LB broth supplemented with 50 ug/ml ampicillin. Plasmid DNA was extracted (Mini-Preps DNA Purification Kit, Qiagen) and a restriction enzyme digestion was performed with Nhe I and Bfr I (Roche Diagnostics, Boehringer Mannheim, Germany) to identify which plasmids possessed the ORF of the M3R gene in the correct orientation. Transfection of Flp-In CHO cells with M3R The Flp-In CHO cell line (Invitrogen) was maintained in UltraCHO Medium BioWhittaker Cell Biology, Walkersville, MD) supplemented with 0.1% zeocin (Research Products International Corp., Mount Prospect, IL). Flp-In CHO cells in growth phase were co-transfected with the recombinant PcDNA5/FRT/V5-His Topo TA vector containing the M3R gene and the pOG44 plasmid expressing the Flp-recombinase gene, as described in the manufacturers instructions (Invitrogen). Flp-In CHO cells were incubated for 24 hrs to allow for expression of the hygromycin-resistance gene, then selected in growth medium ProCHO 4 (BioWhittaker Cell Biology, Walkersville, MD) supplemented with 0.80 mg/ml hygromycin B (Research Products International Corp.) and 5% FBS. M3R expression in transfected Flp-in CHO cells. Transfected and nontransfected Flp-In CHO cells were collected, pelleted by centrifugation, and the cell pellet lysed by adding 1 ml of 50 mM Tris buffer (pH 7.5 using HCl). This mixture was sequentially frozen in an ethanol/dry ice bath and thawed in warm water three times. The lysate was then drawn through 18 and 26 gauge needles to dissociate mechanically any aggregated material. Membrane fractions were prepared by centrifugation of the lysate first at 500 x g for 5 min, then the supernate at 40,000 x g for 20 min at 4oC. The pelleted membrane fraction was washed twice with 50 mM Tris-HCl buffer (pH 7.5) and

PAGE 127

1 15 resuspended in 1 ml of Tris-HCl buffer (pH 7.5). The membrane proteins from each membrane fraction isolated from transfected and non-transfected Flp-In CHO cells were size separated using 12% SDS-PAGE, transferred to nitrocellulose membranes, and the M3R-His-tagged fusion protein visualized with an alkaline phosphatase-conjugated anti-His antibody and nitroblue tetrazolium / bromochloroindolyl phosphate solution (Sigma Chemicals, St. Louis, MO). To further confirm the expression of huM3R on the surface of transfected cells, transfected and nontransfected cell were plated on 8 well chamber slide (Lab-Tek chamber slide system, Nunc., Denmark) to grow to near confluent. Cells were washed 3 times and fixed in 10% formalin for 10 minutes and incubated first with rabbit anti-human M3R antibody (Research and Diagnostic Antibodies, Berkeley, CA) then with 1:100 diluted TITC conjugated goat anti rabbit immunoglobulin (Sigma, St. Louis, MO). The cells were washed 5 times followed by visualization with fluorescent microscope under 200 x magnifications. Detection of anti-M3R autoantibodies in sera using transfected Flp-In CHO cells. Non-transfected and pcDNA5/FRT/V5-His M3R-transfected Flp-In CHO cells were collected from culture, washed once with PBS, and resuspended in FACS buffer (PBS, 2% ABS, 0.01%NaN3) at a density of 1 x 107 cells/ml. Aliquots of cells were incubated 2 hrs at 4C with 5 ul sera from SjS patients or healthy donors. Cells were washed once with FACS buffer and stained with either FITC-conjugated goat anti-human IgG (PharMingen, San Diego, CA) or FITC-conjugated goat anti-human IgA, IgG1, IgG2, IgG3, IgG4, IgE, and IgM (Accurate Chemical Corp., Westbury, NY) for 30 min at 4oC. After a final wash with FACS buffer, the cells were resuspended and analyzed using a FACScan cytometer (Becton Dickinson, Mountain View, CA).

PAGE 128

1 16 Results Construction of a transfected cell line stably expressing human M3R. For this study, I constructed a cell line that is transfected with the human M3R (huM3R) gene expressed from a vector system incorporated directly into the cells' genomes. To accomplish this, cDNA of the ORF for the huM3R gene was generated by PCR, ligated into the pcDNA5/FRT/V5-His TOPO vector, and used to transform E. coli. Following sequencing of the insert for fidelity and orientation, genetically-manipulated Flp-In CHO cells were co-transfected with the recombinant huM3R-PcDNA5/FRT/V5-His TOPO plasmid and the Flp-recombinase-containing pOG44 plasmid for the generation of a stably transfected cell line. To determine if the transfected cells express huM3R as a membrane protein, an aliquot of transfected and non-transfected cells were stained with anti-human M3R antibody (Figure 6-1A). In addition, membrane fractions were prepared from both transfected and non-transfected Flp-In CHO cells undergoing expansion as suspension cultures. Proteins from the membrane preparations, separated by electrophoresis and screened by Western blotting using an anti-His antibody (Figure 6-1B). As presented in Figure 1, transfected Flp-In CHO cells, stained positively with the anti-M3R antibody, while Western blots of membrane preparations showed the expected 65 kDa protein band in the huM3R transfected Flp-In CHO cells, but not in the non-transfected Flp-In CHO cells. Thus, we have constructed a system consisting of a parental CHO cell line that does not express a muscarinic acetylcholine receptor (control) plus a CHO cell line that constitutively expresses the huM3R (experimental). Detection of M3R autoantibodies and isotypes in sera of Sjgrens syndrome patients. Sera collected from primary SjS patients (n=5), secondary SjS patients (n=6) and normal, healthy individuals (n=11) were examined for the presence of detectable

PAGE 129

1 17 anti-M3R autoantibodies using the huM3R-transfected Flp-In CHO system. Patients were classified using the European criterium for SjS and the ACR criterium for SLE and RA (Doria et al, 1994). Individual sera were incubated with either 1 x 106 huM3Rtransfected or 1 x 106 non-transfected Flp-In CHO cells, followed by treatment with FITC-conjugated goat anti-human IgG secondary antibody. Flow cytometric analyses of each reaction pair, as presented in part in Figure 2, indicate that 3 of 5 sera from primary SjS patients, 6 of 6 sera from secondary SjS patients, but 0 of 11 sera from normal, healthy controls reacted with the huM3R-transfected Flp-In CHO cells. No sera reacted with the non-transfected Flp-In CHO cells. To determine if the present assay system can distinguish the individual isotypes of anti-huM3R autoantibodies in human sera, SjS patient sera were incubated with either 1 x 106 huM3R-transfected or 1 x 106 nontransfected Flp-In CHO cells, followed by treatment with FITC-conjugated goat anti-human Ig isotype-specific secondary antibody. Flow cytometric analyses, shown in Figure 6-3, revealed that there may be anti-huM3R autoantibodies of any Ig isotype present in any individual sera, but that IgG1, IgG3 and IgA isotypic autoantibodies proved to be most consistently detected (Figure 6-3). However, in some patients, IgG4 isotypic autoantibody was also significant. Little or no IgE was detected, while neither IgM nor IgG2 isotypes proved consistently significant. No functional studies have been completed using the individual isotypic autoantibodies. Stability of the huM3R-transfected Flp-in CHO cells in expressing M3R protein. To determine the long-term stability of this huM3R-transfected Flp-In CHO cell system to express membrane-associated huM3R protein, flow cytometric analyses using each of the sera from SjS patients and normal, healthy individuals were performed at

PAGE 130

1 18 weekly intervals over a 10-week period. In all cases, no differences in responses were observed, suggesting good stability in expression of huM3R by the Flp-In system, as well as reproducibility in detection of anti-huM3R autoantibodies (data not presented). Conclusion and Discussion In the present study, I present preliminary data indicating a high prevalence of antiM3R autoantibodies in the sera of patients classified, according to the European criterium, with SjS, but not in the sera of normal, healthy individuals. Detection of anti-M3R autoantibodies in SjS patients was facilitated by the construction of a transgenic cell line expressing the human M3R protein, as proposed earlier by Konttinen et al (Konttinen et al. 1999). Unlike earlier M3R-transfected cell lines that were constructed with the rodent M3R gene (Nguyen et al. 2000) the model presented in the current study not only expresses the human M3R gene, but also expresses the M3R protein from a gene incorporated within the cell lines genome as opposed to an epigenetic element. This has been made possible through the use of the commercially available Flp-In CHO cell system (Invitrogen), and has resulted in a stable M3R gene-expression system. Because this system has been designed to use flow cytometric analysis, we have been able to evaluate additional aspects, e.g., the isotypes of the anti-M3R autoantibodies present within individual sera. The M3R-transfected CHO cell system establishes the methodology for a quick and simple diagnostic test with both a positive and negative-expressing cell line. Therotically, the Flp-In system allows a site specific integration resulting in all cells being isogenic after selection thus no subcloning is required for pure populations. However, not all cells appear to express M3R at the same time or

PAGE 131

1 19 intensity. While this may suggest heterogeneity in protein expression related to cell cycle, this aspect must be further investigated. In previous studies using the NOD mouse and its congenic strains as a model system for human SjS, it has been possible to dissect the pathogenesis and clinical onset of disease into three distinct but interdependent phases. The first phase involves a series of physiological and biochemical changes in the exocrine tissues independent of the immune system. The second phase involves a progressive immune attack against the exocrine tissues, apparently in response to the cellular damage resulting from the phase 1 events and characterized by lymphocytic infiltration of the exocrine glands. The third phase is the loss of secretory function, an event dependent on the production of IgG anti-M3R antibodies (Cha et al ., 2002; Brayer et al ., 2000; Yamachika et al ., 1998; Yamachika et al. 2000). A correlation between the appearance of anti-M3R autoantibodies and development of clinical disease, which is under active investigations, has led to recent attempts to develop a simple test using anti-M3R autoantibodies present in patient sera as a disease marker (Bacman et al ., 1996; Borda et al ., 1996; Nguyen et al ., 2000; Waterman et al ., 2000). Blockage of neurosecretory pathways by anti-M3R antibodies could explain not only interference with receptor and post-receptor signaling pathways that manifest as secretory dysfunction of the salivary and lacrimal glands, but also the many other complications seen in SjS patients, e.g., mucosal dryness, arthralgia, fatigue and fibromyalgia. Although the number of samples tested in the preliminary analysis presented here is relatively small, two observations are of interest. The first is the fact that the vast majority of the autoantibodies most consistently detected were of the IgG1, IgG3 and IgA

PAGE 132

1 20 isotypes. This is in line with our earlier observations in the NOD mouse model in which the anti-M3R autoantibodies are of the IgG1 isotype and in which knocking out the IL-4 gene (thereby preventing isotype switching to IgG1) eliminated subsequent manifestation of clinical disease. In addition, this is also in line with discussions by others suggesting that the pathogenic IgG autoantibodies in SjS patients might be of the IgG1 and IgG3 isotypes. The second observation is the fact that anti-M3R autoantibodies could not be detected in two of the five patients classified as primary SjS, yet all six sera from secondary SjS patients showed positive reactions. This raises several interesting possibilities, including (a) the diagnostic criteria used in classifying primary SjS remains inexact, (b) the primary SjS patients included in the present study may be at different stages of disease, some of which have levels of anti-M3R autoantibodies below detection, and/or (c) not all SjS patients will have detectable levels of anti-M3R autoantibodies. With the recent agreement on a consensus criteria to classify SjS patients (3), it may be possible that patient identification may narrow those classified as primary SjS patients and this could have an impact on the results of using this huM3R-transfected Flp-In CHO system for analytical and clinical testing. Future studies will focus on determining the association between detection of anti-M3R autoantibodies and the prediction and severity of disease. Such an expanded study is required for more conclusive findings; nonetheless, our attempts to develop a simple, non-surgical, SjS-specific diagnostic test presented here should be a welcome advancement for the patient, physician and clinical laboratory.

PAGE 133

121 Figure 6-1. Expression of human type-3 muscarinic acetylcholine receptors in transfected Flp-In CHO cells. The expression of hM3R fusion protein in transfected Flp-In CHO cells was confirmed by staining with anti-human M3R antibody (200X)(A) and by western blot (B). For western blots, membrane proteins from lysed cells were separated on a 12% SDS-PAGE gel and transferred to a nitrocellulose membrane and probed with 1:2000 anti-HisAKP. A 65KD protein was showed in transfected Flp-In CHO, but not in the control Flp-In CHO cells Precision Plus Dual Color Protein Standard (BioRad Laboratories) was used as a marker (lane M). Flp-In CHO Flp-In CHO hM3R 65KD M huM3R Flp-In CHO Flp-In CHO A B 100 75 50 37 25 20 15 150

PAGE 134

122 Figure 6-2. Representative flow cytometric analysis of M3R autoantibody in sera. AntiM3R autoantibodies were detected in all sera of secondary SjS patients diagnosed with SLE and most primary SjS patients when incubated with with Flp-In CHO cells transfected with the huM3R gene, but not with nontransfected control Flp-In CHO cells. Also presented are the results using a serum from a primary SjS patient that failed to show detectable autoantibody. All analyses are compared with normal donor sera as control. huM3R Flp-In Flp-In CHO CHO Control 1o SjS #Hb1 1o SjS #48257 2o SjS w/ SLE #310 2o SjS w/ SLE #303

PAGE 135

123 Figure 6-3. Isotype analysis of M3R autoantibodies in sera of Sjgrens syndrome patients. Transfected and non-transfected Flp-In CHO cells were incubated with sera from patients and normal healthy controls for 2 hr at 4oC. Cells were washed and counter-stained with FITC conjugated goat anti-human IgA, IgG1, IgG2, IgG3, IgG4, IgE, or IgM for an additional 30 min. After two washes with FACS buffer, the cells were resuspended in FACS buffer and analyzed using FACScan cytometer. Isotype analysis from 3 primary SjS, 2 secondary SjS with S L E and/or RA are shown. Anti-huM3R a utoantibodies belon g i n g t o the IgG1, IgG3 and IgA isotypes were consistently detected. Other isotypes were occassionally observed. 1o SjS #29028 1o SjS #48257 1o SjS #34176 o SjS w/ SLE #310 S jS w/ SLE + RA #46254 IgM IgG1 IgG2 IgG3 IgG4 IgA IgE

PAGE 136

124 CHAPTER 7 CONCLUSIONS In recent years, the advances of our understanding of Sjgren’s syndrome have made this disease an interesting model for studying autoimmunity. Though the cause of the human disease is still largely unknown, numerous mouse models have become increasingly important to elucidate the pathogenesis of human disease. More fascinatingly, these models provide insight into the underlying factors and components that, hopefully, will eventually lead to overt secretory dysfunction. Sjgren’s syndrome is classically defined as an autoimmune attack against the salivary and lacrimal glands, often with extra-glandular manifestations including the cardiovascular, renal and central nervous systems. The NOD mouse develops a condition similar to human Sjgren’s syndrome patients corresponding to immune infiltration of salivary and lacrimal glands. Nearly 90% of secretory function is lost between 12 and 20 weeks of age in NOD mice. Other NOD congenic and knockout strains also provide important tools in dissecting immune or non-immune components contributing to the autoimmune excrinopathy. It is now known that B cells are critical for the development of secretory dysfunction in Sjgren’s syndrome animal model. B cells may contribute to autoimmune disease as antigen presenting cells or as effector cells producing autoantibodies. Various autoantibodies associated with autoimmune excrinopathy have been described, including anti-Ro/SS-A, anti-La/SS-B and antibodies directed against carbonic anhydrase, proteosome, and beta-adrenergic receptors. Over the past few years, type-3 muscarinic

PAGE 137

125 acetylcholine receptor (M3R) has received great attention as a possible autoantigen in Sjgren’s syndrome patients. Synthetic peptide of human M3R has been used in Enzymelinked immunosorbent assays (ELISA) to determine the prevalence of autoantibodies in primary or secondary SS patients. However, the results are not consistent partly due to fact that antibodies raised against membrane proteins such as M3R are often directed against conformational epitopes created by the disulfide-links between extracellular loops or against epitopes created by intermolecular bonding. To circumvent this disadvantage of synthetic peptides, in this study, I generated cell lines expressing either mouse or human M3R on the surface membrane, which allowed me to detect the anti-M3R autoantibodies present in sera of Sjgren’s syndrome human patients as well as the mouse model, NOD.B10. H2b IL4, an important cytokine involved in humoral immune responses, play multiple roles in the development of autoimmune disease. IL-4 can rescue B cells from apoptosis and enhance their survival (Illera et al. 1993; Mori et al. 2000). Increased expression of IL-4 may therefore result in the expansion and activation of autoreactive B cells and thus contribute to the development or aggravation of autoantibody-mediated diseases. In this regard, a previous study showed transgenic C3H mice that overexpress IL-4 develop a lupus like autoimmunity characterized by increased antinuclear antibody levels and nephritis with glomerular deposition of complement, and immunoglobulins in these mice correlated with a polyclonal B-cell expansion, an elevated responsiveness of the B cells to polyclonal stimulation, and increased IgG1 and IgE serum levels (Erb et al ., 1997). IL4 also promotes Th2 immune responses and isotype switching. IgG2a and IgG3 subclasses are predominantly dependent on type 1 cytokines such as IFN# and are suppressed by the type 2 cytokines, like IL-4. (Ohnishi et al ., 1004; Takahashi et al .,

PAGE 138

126 1996; Shimoda et al. 1996; Coffman et al ., 1988) On the contrary, type 2 cytokines such as IL4 promotes the production of IgG1 subclass of antobodies. In the mouse model of lupus, overexpression of IL-4 by B cells of (NZW C57BL/6. Yaa ) F1 transgenic mice results in a lack of IgG3, a decrease of IgG2a, and an increase in IgG1 subclasses of antiDNA antibodies, but the overall levels of IgG anti-DNA antibodies remains unchanged. (Santiago et al. 1997) To dissect the role of IL4 in the pathogenesis of primary Sjgren’s syndrome animal model, I examined how the lack of IL4 affects the disease progression, especially development of clinical manifestations in the NOD.B10H2b .IL4-/mice. Interestingly, observations from NOD.B10H2b .IL4-/and NOD.IL4-/showed the exacerbation of inflammatory responses but no loss of secretory function, indicating the secretory dysfunction is independent of many inflammatory events. The study of NOD.B10H2b .IL4-/mice showed the lack of clinical symptoms in spite of an antoimmune attack against the target glands. NOD.B10H2b .IL4-/mice also showed little spleen IgG1 and IgM isotypic B cell expansion during 12 and 20 weeks of age, though the lack of IL4 did not change the proportion of infiltrating T and B cells in the salivary glands. The interesting observation is the lack of IgG1 anti-M3R antibodies in the NOD.IL4-/and NOD.B10H2b .IL4-/mice, while other isotypic autoantibodies were still detected. These observations support the concept that the initial inflammatory infiltration of the gland is followed by secretory dysfunction, and IL4 plays a critical role in the clinical stage of the disease process, and that IgG1 subclass of anti-M3R antibodies may mediate the disease process. This hypothesis was further confirmed by the fact that adoptively transferring T cells that produce IL4 into NOD.B10H2b .IL4-/between 12 and 16 weeks of age led to

PAGE 139

127 the decline of secretory function and IgG1 isotypic antibody production in recipients that otherwise would have maintained secretory function.. The possible role of an IL4 dependent isotype switch in this disease model leads to the question whether there is a specific isotypic mediated pathogenesis. A skewed pattern of IgG subclass of autoantibodies in autoimmune disease is not uncommon. Anti double stranded DNA has been consistently shown to be limited to IgG1 and IgG3 isotypes (Bonfa et al ., 1988). IgG1 and IgG3 are also the predominant autoantibodies for anticardiolipin (Gharavi et al ., 1988), antineutrophil cytoplasmic antigens ( Jayne et al., 1991), and anti-denatured type II collagen (Collins, et al ., 1988), anti-mitochondria ( Zhang et al. 1992), anti-keratin antibodies (Vincent, et al. 1990). It has been reported that anti-Ro/SS-A is restricted to IgG1 isotype while the anti-La/SS-B subclass varies among patients (Maran et al ., 1993). A recent study showed that children with untreated coeliac disease had a particularly high ratio of IgG1 antigliadin antibodies compared with healthy references or coeliac children in remission. In contrast, children who had high serum antigliadin antibody activity but no histological signs of enteropathy showed significantly lower proportions of IgG1 antigliadin antibodies subclass compared with healthy references or untreated coeliac children. These results support the concept that IgG1 subclass of gliadin-specific antibodies may contribute to the tissue-damaging immune reactions in the disease process of coeliac disease through antibody dependent cellular cytotoxicity (ADCC) (Saalman et al ., 2001). NOD.B10.C129S2-STAT6 -/mice were generated to evaluate the roles of JAKSTAT6 pathway, a major pathway involved in the IL4 dependent isotypic switch, in the Sjgren’s syndrome animal model. NOD.B10.C129S2-STAT6 -/was generated by

PAGE 140

128 interbreeding the C129S2 mouse with NOD.B10H2b while keeping the truncated Stat6 gene. Characterization of the 3rd backcrossing generations showed lymphocytic infiltrates and the unique PSP proteolytic enzyme activity as a marker for the physiological changes taking place in the exocrine tissue. These observations indicated that at least some of the disease-associated genes have already become homozygous in the NOD.B10 -H2b C129S2-STAT6 mice. Though my study on these mice was very preliminary, I noticed a decline of secretory function from all three groups of NOD.B10H2b .C129S2-STAT6+/+, NOD.B10H2b .C129S2-STAT6 +/and NOD.B10H2b .C129S2-STAT6 -/mice over time compared to that measured at 4 weeks of age. However, in animals with positive PSP proteolytic activity, a marker used to monitor the physiological and biochemical changes taking place before the immune attack, NOD.B10H2b .C129S2-STAT6+/+ showed a statistically significant loss of secretory function compare to NOD.B10H2b .C129S2STAT6+/+, while in animals with negative PSP proteolytic activity, no significant difference was observed. This observation is consistent with our earlier hypothesis that physiological and biochemical alterations in the exocrine glands, though not fully understood, preceded the immune attack and the development of clinical disease. In animals with these changes, the deficiency of Stat6 gene seemed to ameliorate the development of secretory dysfunction. Our observation from STAT6 deficiency in the NOD.B10. H2b mouse suggested two findings: first, though earlier studies established a controlling role of IL4 in the progression from the initial autoimmune infiltration of the exocrine glands to the dysfunctional stage of the disease, JAK-STAT6 pathway is not the only pathogenic pathway responsible for the role IL4 plays in this disease model. Second,

PAGE 141

129 a connection has been suggested between the loss of secretory function and the presence of IgG1 isotypic anti M3R autoantibodies, and IgG1 isotypic antiM3R autoantibodies may contribute to the clinical disease, even though, the decline of secretory function in NOD.B10H2b .C129S2-STAT6-/does not support the idea that clinical symptoms of Sjgren’s syndrome in NOD mice are affected solely by an IgG1 isotypic antibody. The similarity of anti-M3R autoantibody profiles and the differences of clinical manifestations between NOD.B10H2b .IL4-/and NOD.B10H2b .C129S2-STAT6-/suggested that the earlier hypothesis that the mere presence of IgG1 anti-M3R autoantibody leads to secretory dysfunction was far too simplified. Titers and affinities of these antibodies may also contribute to their roles in determining the disease manifestation or lack there of. The intact IL4 dependent IRS pathway in NOD.B10H2b .C129S2-STAT6-/mice may also contribute to the disease pathogenesis. In conclusion, my studies suggested that IL-4 may serve multiple roles in the development of Sjgren’s syndrome and clinical manifestations in NOD model of Sjgren’s syndrome, including enhancement of IgG1 isotypic autoantibody production via its isotype switch function. The characterization of NOD.B10H2b .C129S2-STAT6-/led us to reexamine the role of IL4 in non STAT6 pathways such as its direct B cell effect as a potential mechanism to drive autoimmune B cells expansion. Though we established a methodology for detection of antiM3R autoantibodies in human patients, my study using a limited number of human subjects is consistent with observations in the mouse model. Though anti-M3R autoantibodies were common, especially IgG1, IgG3 and IgA subclasses, in some primary and secondary Sjgren’s syndrome patients, they were not always detected. Future studies using a more expanded

PAGE 142

130 population, might focus on further determining the association between detection of antiM3R autoantibodies and the prediction and severity of disease. As we begin to understand the mechanisms leading to the overt clinical manifestations, it may be possible to develop strategies to interfere with disease progression.

PAGE 143

131 LIST OF REFERENCES Arnett F, Goldstein R, Duvic M, Reveille J. Major histocompatibility complex genes in systemic lupus erythematosus, Sjgrens syndrome, and polymyositis. Am J Med 1988;85: 38-41. Azzarolo AM, Wood RL, Mircheff AK, Richters A, Olsen E, Berkowitz M, Bachmann M, Huang ZM, Zolfagari R, Warren DW. Androgen influence on lacrimal gland apoptosis, necrosis, and lymphocyte infiltration. Invest Ophthalmol Vis Sci 1999;40:592-602. Azzarolo AM, Grove R, Huang ZM. Estrogen prevents apoptosis of interstitial cells and lymphocyte infiltration in ovariectomized rabbitlacrimal glands (abstract). Invest Ophthalmol Vis Sci 1999;39(suppl):S554. Bacman S, Sterin-Borda L, Camusso JJ, Arana R, Hubscher O, Borda E. Circulating antibodies against rat parotid gland M3 muscarinic receptors in primary Sjgrens syndrome. Clin Exp Immunol 1996; 104:454-9. Bacman S, Berra A, Sterin-Borda L, Borda E. Muscarinic acetylcholine receptor antibodies as a new marker of dry eye Sjogren syndrome. Invest Ophthalmol Vis Sci 2001; 42:321-7. Bahler DW, Miklos JA, Swerdlow SH. Ongoing Ig gene hypermutation in salivary gland mucosaassociated lymphoid tissue-type lymphomas. Blood 1997; 89: 3335. Baum BJ. Principles of salivary secretion. Ann N Y Acad Sci 1993; 694:17-23. Benschop RJ, Cambier JC. B cell development: signal transduction by antigen receptors and their surrogates. Curr Opin Immunol 1999; 11:143. Bern f e ld P. A m y l ases, a l p h a and b e t a M e tho d s En z y m ol 19 5 5; 1 : 149 58. Bonner TI, Buckley NJ, Young AC, Brann MR. Identification of a family of muscarinic acetylcholine receptor genes. Science 1987; 237:527-32. Bonfa E, Llovet R,Elkon KB. Immunoblot analysis of IgG subclasses of multiple lupus autoantibodies. J Immunol 1988; 140:2231-6. Borda E, Camusso JJ, PerezLeiros C. Circulating antibodies against neonatal cardiac muscarinic acetylcholine receptor in patients with Sjgrens syndrome. Mol Cell Biochem 1996; 163:335-341. Boumba M, Skopouli FN, Moutsopoulos HM. Cytokine mRNA expression in the labial salivary gland tissues from patients with primary Sjgrens syndrome. Brit J Rheum 1995; 24: 326-333.

PAGE 144

132 Brayer JB, Cha S, Nagashima H, Yasunar U, Lindberg A, Diggs S, Martinez J, Gao J, Humphreys-Beher MG, Peck AB. IL-4-dependent effector phase in autoimmune exocrinopathy as defined by the NOD.IL-4-gene knockout mouse model of Sjgrens syndrome. Scand J Immunol 2001; 54:133-40. Brayer JB, Lowry J, Cha S, Robinson CP, Yamachika S, Peck AB, Humphreys-Beher MG. Alleles from chromosomes 1 and 3 of NOD mice combine to influence Sjgrens syndrome like autoimmune exocrinopathy. J Rheumatol 2000; 27:1896-904. Brines RD, Klaus GG. Polyclonal activation of immature B cells by preactivated T cells: the role of I L 4 and CD40 li g and. I nt I m m unol 1993; 5 : 14 4 5 50. Casciola-Rosen LA, Anhalt G, Rosen A. Autoantigens targeted in systemic lupus erythematosus are clustered in two populations of surface structures on apoptotic keratinocytes. J Exp Med 1994; 179:1317-30. Cavill D, Waterman SA, Gordon TP. Antibodies Raised Against the Second Extracellular Loop of the Human Muscarinic M3 Receptor Mimic Functional Autoantibodies in Sjgren's Syndrome Scand J Immunol 2004; 59: 261-6. Cavill D, Waterman SA, Gordon TP. Failure to detect antibodies to extracellular loop peptides of the muscarinic M3 receptor in primary Sjgren's syndrome. J Rheumatol 2002; 29:1342-4. Chen Z, Lund R, Aittokallio T, Kosonen M, Nevalainen O, Lahesmaa R. Identification of Novel IL-4/Stat6-Regulated Genes in T Lymphocytes. J Immunol 2003;171: 3627-35. Cha S, Blockland SC, Versnel MA, Homo-Delarche F, Nagashima H, Brayer J, Peck AB, Humphreys-Beher MG. Abnormal organogenesis in salivary gland development may initiate adult onset of autoimmune excrinopathy Exp Clin Immunogenet 2001;18:143-160. Cha S, Peck AB, Humphreys-Beher MG. Progress in understanding autoimmune exocrinopathy using the non-obese diabetic mouse: an update. Crit Rev Oral Biol Med 2002;13:5-16. Clark DA, Lamey PJ, Jarrett RF, Onions DE. A model to study viral and cytokine involvement in Sjogrens syndrome. Autoimmunity 1994; 18:7-14. Coffman RL, Seymour BW, Lebman DA, Hiraki DD, Christiansen JA, Shrader B, Cherwinski HM, Savelkoul HFJ, Finkelman FD, Bond MW, Mosmann TR. The role of helper T cell produ c ts in m ouse B c e ll d i ff e re n t i a t i on a nd i sot y p e r e g u lati o n. I m m unol Rev 1 9 88; 102:5-28. Collins I, Morgan K, Clague RB, Brenchley PE, Holt PJ. IgG subclass distribution of antinative type II collagen and antidenatured type II collagen antibodies in patients with rheumatoid art h r it i s. J R h eu m atol 1 98 8 ; 15 : 770 4. Defrance T, Aubry JP, Rousset F, Vanbervliet B, Bonnefoy JY, Arai N, Takebe Y, Yokota T, Lee F, Arai K. Human recombinant interleukin 4 induces Fc epsilon receptors (CD23) on normal human B lymphocytes. J Exp Med 1987;165:1459-67.

PAGE 145

133 Dimitriou ID, Kapsogeorgou EK, Moutsopoulos HM, Manoussakis MN. CD40 on salivary gland epithelial cells: high constitutive expression by cultured cells from Sjogren's syndrome patients indicating their intrinsic activation. Clin Exp Immunol 2002; 127:38692. Doria A, Vesco P, Zulian F, Gambari PF. The 1982 ARA/ACR criteria for the classification of systemic lupus erythematosus in pediatric and adult patients. Clin Exp Rheumatol 1994; 12:689-690. Erb KJ, Beate R, Brevern V, Ryffel B, Schimpl A, Rivett K. Constitutive expression of interleukin-4 (IL-4) in vivo causes autoimmune-type disorders in mice. J Exp Med 1997; 185: 3 2 9-39. Fantin VR, Keller SR, Liehard GE, Wang LM. Insulin receptor substrate 4 supports insulinand interleukin 4-stimulated proliferation of hematopoietic cells. Biochem Biophys Res Co m m un 1999; 260: 7 18 2 3. Felder CC, Bymaster FP, Ward J, DeLapp N. Therapeutic opportunities for muscarinic receptors in the central nervous system. J Med Chem 2000; 43: 4333-53. Feist E, Kuckelkorn U, Dorner T, Donitz H, Scheffler S, Hiepe F, Kloetzel PM, Burmester GR. Autoantibodies in primary Sjgrens syndrome are directed against proteasomal subunits of the alpha and beta type. Arthritis Rheum 1999; 42:697-702. Gao J Cha S, J on s son R, Opal k o J Peck AB. Det e c t i on of a n t i t y pe 3 m uscar i n i c ac e t y lch o li n e receptor autoantibodies in the sera of Sjgrens syndrome patients by use of a transfected cell line assay. Arthritis Rheum 2004;50:2615-21. Gharavi AE, Harris EN, Lockslin MD, Hughes GR, Elkon KB. IgG subclass and light chain distribution of anticardiolipin and anti-DNA antibodies in systemic lupus erythematosus. Ann. Rheum Dis 1988; 47:286-90. Gordon TP, Bolstad AI, Rischmueller M, Jonsson R, Waterman SA. Autoantibodies in primary Sjgren's syndrome: new insights into mechanisms of autoantibody diversification and disease pathogenesis. Autoimmunity 2001;34:123-32. Hellstrom-Lindahl E, Nordberg A. Muscarinic receptor subtypes in subpopulations of human blood mononuclear cells as analyzed by RT-PCR techniques. J Neuroimmunol 1996; 68:139-44. Hou J, Schindler U, Henzel WJ, Ho TC, Brasseur M, McKnight SL. An interleukin-4 induced transcription factor IL-4 Stat. Science 1994; 265: 1701. Hsieh CS, Heimberge, AB, Gold JS, OGarra A., Murphy, K.M. Differential regualation of Thelper phenotype development by interleukin-4 and interleukin-10 in an alpha-beta-T-cell-receptor transgenic system. Proc Natl Acad Sci1992; 89:6065-9. Hu-Li J, Shevach EM, Mizuguchi J, Ohara J, Mosmann T, Paul WE. B cell stimulatory factor 1 ( interleukin 4) is a potent costimulant for normal resting T lymphocytes. J Exp Med 1987;165:157-72.

PAGE 146

134 Howard M, Farrar J, Hilfiker M, Johnson B, Takatsu K, Hamaoka T, Paul WE. Identification of a T cell derived B cell growth factor distinct from interleukin 2. J Exp Med 1982; 155:914-23. Humphrey-Beher MG, Hu Y, Nakagawa Y, Wang P, Purushotham K. Utilization of the NOD mouse as a model for the study of secondary Sjgren syndrome. Adv Exp Med Biol 1994; 350:631-6. Humphrey-Beher MG, Peck AB. New concepts for the development of autoimmune exocrinopathy derived from studies with the NOD mouse model. Arch Oral Biol 1999; 44:S21-5. I llera V A Pe r a ndo n es CE, Stunz LL, Mow e r D J As h m an RF. Apoptos i s in sp l e nic Blymphocytes: regulation by protein kinase C and IL-4. J Immunol 1993; 151:2965. Ioannidis JP, Vassiliou VA, Moutsopoulos HM. Long-term risk of mortality and lymphoproliferative disease and predictive classification of primary Sjgrens syndrome. Arth r i t i s R h eum 2002; 4 6 : 7 41-7. Jayne DR, Weetman AP, and Lockwood CM. IgG subclass distribution of autoantibodies to neutrophil cytoplasmic antigens in systemin vasculitis. Clin Exp Immunol 1991; 84:476-81. Jonsson R, Haga H-J, Gordon TP. Sjgren's syndrome. In: Koopman W, ed. Arthritis and Allied Conditions-A Textbook of Rheumatology. 14th ed. editor: Koopman WJ; Philadelphia, USA; Lippincott Williams & Wilkins 2001:1736-59. Ishikawa Y, Eguchi T, Skowronski, MT, Ishida H. Acetylcholine acts on M3 muscarinic receptors and induces the translocation of aquaporin5 water channel via cytosolic Ca2+ elevation in rat parotid glands. Biochem Biophys Res Comm 1998; 245:835-40. Kang HI, Fei HM, Saito I, Sawada S, Chen SL, Yi D, Chan E, Peebles C, Bugawan TL, Erlich HA, Fox RI. Comparison of HLA class II genes in Caucasoid, Chinese, and Japanese patients with primary Sjgren syndrome. J Immunol 1993; 150:3615-23. Kaplan MH, Schindler U, Smiley ST, Grusby MJ. Stat6 is required for mediating responses to IL4 and development of Th2 cells. Immunity 1996; 4:313-9. Keegan AD, Johnston JA, Tortolani PJ, McReynolds LJ, Kinzer C, O'Shea JJ, Paul WE. Similarities and differences in signal transduction by interleukin 4 and intereukin 13: analysisof Janus kinase activation. Proc Natl Acad Sci 1995;92:7681-5. Kino-Ohsaki J, Nishimori I, Morita M. Serum antibodies to carbonic anhydrase I and II in patients with idiopathic chronic pancreatitis and Sjgrens syndrome. Gastroenterology 1996;110:1579-86. Kipps TJ, Tomhave E, Chen PP, Fox RI. Molecular characterization of a major autoantibodyassociated cross-reactive idiotype in Sjgren's syndrome. J Immunol 1989;142:4261. Kolkowski EC, Reth P, Pelusa F, Bosch J, Pujol-Borrell R, Coll J, Jaraquemada D. Th1 predominance and perforin expression in minor salivary glands from patients with primary Sjgren syndrome. J Autoimmun 1999; 13:155-62.

PAGE 147

135 KonttinenY, Tensing E, Tornwall J, Kitti U, Ceponis A. Neurogenic factors in the pathogenesis of Sjgrens syndrome. In: The 100 year anniversary of Henrik Sjgrens. editors: Eriksson P and Jonsson R. Jonkoping, Sweden; Hygiea Publication 1999; 80-85. Kotanides H and Reich NC. Requirement of tyrosine phosphorylation for rapid activation of a DNA binding receptor of IL-4. Science 1993; 262:1265. Lavan BE, Lane WS, Lienhard GE. The 60 kDa phosphotyrosine protein in insulin treated adipocytes is a new member of the insulin receptor substrate family. J Biol Chem 1997a; 272:11439-43. Lavab BE, Fantin VR, Chang ET, Lan WS, Keller SR, Lienhard GE. A novel 160-kDa phosphotyrosine protein in insulin treated embryonic kidney cells is a new member of the insulin receptor substrate family. J Biol Chem 1997b; 272:21403-7. Liakos DA, Triantafyllopoulou A, Kapsogeorgou EK, Moutsopoulos HM. Autoimmune diseases: role of coxsackieviruses in their pathogenesis. Autoimmun Rev 2004; 3(suppl):S71-3. Linehan LA, Warren WD, Thompson PA, Grusby MJ, Berton MT. Stat6 is required for IL-4 induced germline Ig gene transcription and switch recombination. J Immunol 1998;161:302-310. Manthorpem R, Jacobsson L, Manthorpe T. Overview of classification criteria for Sjgren Syndrome. In: Sjgren's syndrome-State of the Art. Editors:Homma M, Sugai S, Tojo T, Miyasaka N, Akizuki M. Amsterdam; Kugler Publication 1999:69-72. Manoussakis MN, Dimitriou ID, Kapsogeorgou EK, Xanthou G, Palikos S, Polihronis M., Moutsopoulos HM. Expression of B7 costimulatory molecules by salivary gland epithelial ce l ls in p a t i en t s w i th S j g r e n s s y ndr o m e. Arth r i t i s Rh e um 1999; 42:2 2 9-39. Maran R, Dueymes M, Pennec YL, Casburn-Budd R, Shoenfeld Y, Youinou P. Predominance of IgG1 subclass of anti-Ro/SSA but not anto-la/SSB antibodies in primary Sjgrens syndrome. J Autoimmun 1993; 6:379-87. Martin SW and Goodnow CC. Burst-enhancing role of the IgG membrane tail as a molecular determinant of memory. Nat Immunol 2002;3:182-8. Masaki Y and Sugai S. Lymphoproliferative disorders in Sjgren's syndrome Autoimmunity Reviews 2004; 3: 175-82. Melamed D, Kench JA, Grabstein K, Rolink A, Nemazee D. A functional B cell receptor transgene allows efficient IL-7-independent maturation of B cell precursors. J Immunol 1997;159:1233-9. Mori M, Morris SC, Orekhova T, Marinaro M, Giannini E, Finkelman FD. IL-4 promotes the migration of circulating B cells to the spleen and increases splenic B cell survival. J I mm unol 2000;1 6 4:5 7 041 2. Mustafa W, Zhu J, Deng G, Diab A, Link H, Frithiof L, Klinge B. Augmented levels of macrophage and Th1 cell-related cytokine mRNA in submandibular glands of MRL/lpr mice with autoimmune sialoadenitis. Clin Exp Immunol 1998; 112:389-96.

PAGE 148

136 Murata T, Obiri NI, Puri RK. Human ovarian carcinoma cell lines express IL-4 and IL-13 receptors: comparison between IL-4 and IL-13 induced signal transduction. Int J Cancer 1997; 70:230-40. Nagaraju K, Cox A, Casciola-Rosen L, Rosen A. Novel fragments of the Sjogrens syndrome autoantigens alpha-fodrin and type 3 muscarinic acetylcholine receptor generated during cytotoxic lymphocyte granule-induced cell death. Arthritis Rheum 2001; 44:2376-86. Nelms K, Keegan AD, Zamorano J, Ryan JJ, Paul WE. The IL-4 receptor: signaling mechanisms and biologic function. Annu Rev Immunol 1999; 17:701-38. Nguyen KH, Brayer J, Cha S, Diggs S, Yasunari U, Hilal G, Peck AB, Humphreys-Beher MG. Evidence for antimuscarinic acetylcholine receptor antibody-mediated secretory dysfunction in nod mice. Arthritis Rheum 2000; 43:2297-306. Noelle R, Krammer PH, Ohara J, Uhr JW, Vitetta ES. Increased expression of Ia antigens on resting B cells: an additional role for B-cell growth factor. Proc Natl Acad Sci 1984; 81:6149-53. Ohyama Y, Nakamura S, Matsuzaki G, Shinohara M, Hiroki A, Fujimura T, Yamada A, Itoh K, Nomoto K. Cytokine messenger RNA expression in the labial salivary glands of patients with S j g ren s s y ndro m e. Arth r i t i s R h eum 1996; 4 3 : 2 297 306. Ohnishi K, Ebling FM, Mitchell B, Singh RR, Hahn BH, Tsao BP. Comparison of pathogenic and nonpathogenic murine antibodies to DNA: antigen binding and structural characteristics. Int Immunol. 1994; 6:817-30. Papasteriades CA, Skopouli FN, Drosos AA, Andronopoulos AP, Moutsopoulos HM. HLAalloantigen associations in Greek patients with Sjgrens syndrome. J Autoimmun 1988; 1:85 90. Pesu M, Takaluma K, Aittomaki S, Lagerstedt A, Saksela K, Kovanen PE, Silvennoinen O. Interleukin-4-induced transcriptional activation by stat6 involves multiple serine/threonine kinase pathways and serine phosphorylation of stat6. Blood 2000; 95:494-502. Pogue SL, and Goodnow CC. Gene dose-dependent maturation and receptor editing of B cells expressing immunoglobulin (Ig)G1 or IgM/IgG1 tail antigen receptors. J Exp Med 2000;191:1031-44. Rajewsky K. Clonal selection and learning in the antibody system. Nature 1996;381:751 Reichlin M. Antibodies to Ro and La. Ann Med Interne (Paris) 1998;149:34-41. Robinson CP, Yamamoto H, Peck AB, Humphreys-Beher MG. Genetically programmed development of salivary gland abnormalities in the NOD (nonobese diabetic)-scid mouse in the absence of detectable lymphocytic infiltration: a potential trigger for sialoadenitis of NOD mice. Clin Immunol Immunopathol 1996; 79: 50-9. Robinson CP, Bounous DI, Alford CE, Nguyen KH, Nanni JM, Peck AB, Humphreys-Beher MG. PSP expression in murine lacrimal glands and function as a bacteria binding protein in exocrine secretions. Am J Physiol 1997a;272(4Pt1): G863-71.

PAGE 149

137 Robinson CP, Yamachika S, Alford CE, Cooper C, Pichardo EL, Shah N, Peck AB, HumphreysBeher MG. Elevated levels of cysteine protease activity in saliva and salivary glands of nonobese diabetic (NOD) mouse model for Sjgrens syndrome. Proc Natl Acad Sci 1997b;94:5767-71. Robinson CP, Yamachika S, Bounous DI, Brayer J, Jonsson R, Holmdahl R, Peck AB, Humphreys-Beher MG. A novel NOD derived murine model for primary Sjgrens syndrome. Arthritis Rheum 1998a;41:150-6. Robinson CP, Cornelius J, Bounous DE, Yamamoto H, Humphreys-Beher MG, Peck AB. Characterization of the changing lymphocyte populations and cytokine expression in the exocrine tissues of autoimmune NOD mice. Autoimmunity 1998b; 27:29-44. Robinson CP, Brayer J, Yamachika S, Peck AB, Stewart CA, Jonsson R, Humphreys-Beher MG. Transfer of human serum IgG to nonobese diabetic Igmu null mice reveals a role for autoantibodies in the loss of secretory function of exocrine tissues in Sjgrens syndrome. Proc Natl Acad Sci 1998c;95:7538-43. Saalman R, Dahlgren UI, Fallsrom SP, Hanson LA, Ahlsted S, Wold AE. IgG Subclass Profile of Serum Antigliadin Antibodies and Antibody-Dependent Cell-Mediated Cytotoxicity in Young Children with Coeliac Disease. Scand J Immunol 2001; 53:92-8. Santiago ML, Fossati L, Jacquet C, Muller W, Izui S, Reininger L. Interleukin-4 protects against a genetically linked lupus like syndrome. J Exp Med 1997; 185 : 65-70. Skopouli FN, Dafni U, Ioannidis JP, Moutsopoulos HM. Clinical evolution and morbidity and mortality of primary Sjgrens syndrome. Semin Arthritis Rheum 2000; 29: 296-304. Seder RA, Paul WE, Davis MM, De ST, Groth BF. The presence of interleukin-4 during in vitro priming determines the lymphokine-producing potential of CD4+ T cell receptor transgenic mice. J Exp Med 1992;176:1091-8. Shimoda K, Van Deursen J, Sangster MY, Sarawar SR, Carson RT, Tripp RA, Chu C, Ouelle FW, Nosaka T, Vignali DA, Doherty PC, Grosyeld G, Paul WE, Ihle JN. Lack of IL-4 induced Th2 responses and IgE class switching in mice with disrupted Stat6 gene. Nature 1996; 380: 630-3. Singer GG, Carrera AC, Marshak RA, Martinez C, Abbas AK. Apoptosis, Fas and systemic autoimmunity: the MRL-lpr/lpr model. Curr Opin Immunol 1994; 6: 913-20. Str a ss e r A, W h i t t i n g ham S V a u x DL, Bath ML, A d a m s J M C o ry S, Har r is A W Enfo r ced b c l 2 expression in B-lymphoid cells prolongs antibody responses and elicits autoimmune disease. Proc Natl Acad Sci 1991;88: 8661-5. Sullivan DA, Edwards JA. Androgen stimulation of lacrimal gland function in mouse model of Sjgren syndrome. J Steroid Biochem Mol Biol 1997;60:237-45. Sun XJ, Rothenberg P, Kahn CR, Baker JM, Araki E, Wilden PA., Cahill DA., Goldstein BJ, White MF. Structure of the insulin receptor substrate IRS-1 defines a unique signal transduction protein. Nature 1991; 352:73-7.

PAGE 150

138 Sun XJ, Wang LM, Zhang Y, Yenush L, Myers MG Jr, Glasheen E, Lane WS, Pierce JH, White MF. Role of IRS-2 in insulin and cytokine signaling. Nature 1995; 377:173-7. Sutcliffe N, Inanc M, Speight P, Isenberg D. Predictors of lymphoma development in primary S j g ren s y ndro m e. Se m i n Arth r i t i s R h eum 1998; 2 8 : 8 0 7. Takahashi S, Fossati L, Iwamoto M, Merino R, Motta R, Kobayakawa T, Izui S. Imbalance towards Th1 predominance is associated with acceleration of lupus-like autoimmune syndrome in MRL mice. J Clin Invest 1996; 97:1597604. Takeda K, Tanaka T, Shi W, Matsumoto M, Minami M, Kashiwamura S, Nakanishi K, Yoshida N, Kishimoto T, Akira S. Essential role stat6 in IL-4 signaling. Nature 1996; 380: 627-30. Timsic M, Rozman B. Sjgren syndrome: a community-based study of prevalence and impactcomment on the article by Thomas et al [letter commet]. Rheumatology (Oxfard) 1999;38: 685-6. Wakabayashi C, Adachi T, Wienands J, Tsubata T. A distinct signaling pathway used by the IgG-containing B cell antigen receptor. Science 2002; 298:2392. Waterman SA, Gordon TP, Rischmueller M. Inhibitory affects of muscarinic receptor autoantibodies on parasympathetic neurotransmission in Sjgrens syndrome. Arthritis Rheum 2000; 43:1647-54. Wang HY, Zamorano J, Yoerkie JL, Paul WE, Keegan AD. The IL-4 induced tyrosine phosphorylation of the insulin receptor substrate is dependent on JAK1 expression in human fibrosarcoma cells. J Immunol 1997; 158:1037-40. Welham MJ, Learmonth L, Bone H, Schrader JW. Interleukin-13 signal transduction in lymphohemopietic cells. Similarities and differences in signal transduction with interleukin-4 and insulin. J Biol Chem 1995; 270:12286-96. Vincent C, Serre G, Basilc JP, Lestra HC, Girbal E, Sebbag M, Soleihavoup JP. Subclass distribution of IgG antibodies to the rat oesophagus stratum corneum (so-called anti-keratin antibodies) in rheumatoid arthritis. Clin Exp Immunol 1990; 81:83-9. Vitali C, Bombardieri S, Jonsson R. Classification criteria for Sjgren syndrome: a revised version of the European criteria proposed by the American-European Consensus Group. Ann Rheum Dis 2002; 61:554-8. Xanthou G, Tapions NI, Polihronis M, Nezis IP, Margaritis LH, Moutsopoulos HM. CD4 cytotoxic and dendritic cells in the immunopathologic lesion of Sjgren's syndrome. Clin Exp Immunol 1999;118:154. Yanagi K, Ishimaru N, Haneiji N, Saegusa K, Saito I, Hayashi Y. Anti-120-kDa alpha-fodrin immune response with Th1-cytokine profile in the NOD mouse model of Sjgren syndrome. Eur J Immunol 1998; 28:3336-45.

PAGE 151

139 Yamachika S, Nanni JM, Nguyen KH, Garces L, Lowry JM, Robinson CP, Brayer J, Oxford GE, da Silveira A, Kerr M, Peck AB, Humphreys-Beher MG. Excessive synthesis of matrix metalloproteinases in exocrine tissues of NOD mouse models for Sjgren’s syndrome. J Rheumatol 1998; 25:2371-80. Yamachika S, Brayer J, Oxford GE, Peck AB, Humphreys-Beher MG. Aberrant proteolytic digestion of biglycan and decorin by saliva and exocrine gland lysates from the NOD mouse model for autoimmune exocrinopathy. Clin Exp Rheumatol 2000;18:233-40. Zhang L, Weetman AP, Jayne DR, Turner I, Yeaman SJ, Basseneline MF, Oliveira DB. Antimitochondrial antibody IgG subclass distribution and affinity in primary biliary cirrhosis. Clin Exp Immunol 1992; 88:56-61.

PAGE 152

140 BIOGRAPHICAL SKETCH Juehua Gao was born in Shanghai, P.R.China, on February 16th, 1973, daughter of Aizhu Yu and Zhangxiao Gao. After graduation from high school in 1991, she started her training in cl i n i c al m edi c i ne at the S h an g h ai M ed i c a l U n i v er s it y w h e r e s h e r ec e i v ed her B ach e l o r of Me d i c i ne de g r ee i n 1996 and Ma s t er of M ed i ci n e de g r ee in 1 99 8 Aft e r o n e y ear o f r e si d e n cy in in ternal med i ci n e a t H u a s han H o s p i t al, S h an g h ai Me d i c al U n i v er s it y she j o ined the I n te r d is c i p l in a r y Pro g ram in Bio m edic a l Sc i ence a t the U n i v ers i ty of F l o r i d a in Au g u st, 1999, w h ere s he pu r sued her docto r al st u d i e s in mi c r ob i olo g y and im m unology concen t r a tion und e r t h e co m e n to r sh i p of D r Ammon B. Peck in the Department of Pathology and Dr. Michael Humphreys-Beher (deceased) in the Department of Oral Biology. In September 2001, Juehua Gao married Zhan Chen in Gainesville, FL. After graduation, she will continue her work in the research or clinical field of medical science.


Permanent Link: http://ufdc.ufl.edu/UFE0006639/00001

Material Information

Title: Biological Functions and Molecular Mechanisms of the Interleukin-4 Signaling Pathways in Autoimmune Exocrinopathy Using the NOD.B10.H2b Mouse Model of Sjogren's Syndrome
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0006639:00001

Permanent Link: http://ufdc.ufl.edu/UFE0006639/00001

Material Information

Title: Biological Functions and Molecular Mechanisms of the Interleukin-4 Signaling Pathways in Autoimmune Exocrinopathy Using the NOD.B10.H2b Mouse Model of Sjogren's Syndrome
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0006639:00001


This item has the following downloads:


Full Text











BIOLOGICAL FUNCTIONS AND MOLECULAR MECHANISMS OF THE
INTERLEUKIN-4 SIGNALING PATHWAYS IN AUTOIMMUNE
EXOCRINOPATHY USING THE NOD.B 10.H2b MOUSE MODEL OF
SJOjGREN'S SYNDROME












By

JUEHUA GAO


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2004

































Copyright 2004

by

Juehua Gao




































Dedicated to my husband Zhan; and to my parents, Aizhu Yu and Zhangxiao Gao.

















ACKNOWLEDGMENTS

I would like to express my deepest gratitude to my advisor, Dr. Ammon B. Peck, for his

guidance and support during my graduate studies. He constantly encourages me to explore new

ideas and shows me how to pursue these ideas scientifically. He is a knowledgeable and wise

person, and gives me lots of invaluable advice on the proj ect, science and life in general.

Dr. Michael Humphrey-Beher left us three years ago, but his courage will always inspire me to

follow my dreams. I would like to thank my supervisory committee (Drs. Wayne McCormack,

Laurence Morel, Edward Chan, and Maria Grant) and former committee members (Drs. Sheldon

Schuster and Andrew Muir) for their great suggestions and comments over the past few years.

I am truly, deeply grateful for all the help of Janet Cornelius. Janet teaches me everything,

and she makes sure I have everything I need for the experiments on time. She gives me

tremendous technical help as well as suggestions in everyday life. I thank Dr. Sally Litherland

for her input and help on this project; Dr. Seunghee Cha for many enjoyable discussions and

emotional support during my most difficult times; Dr. Smruti Killedar for tremendous help on

preparations for many experiments. I thank the entire laboratory, Cuong, Woosuk, Joy, Lori,

Vinette, Danny, Brian, Jin, Eric, and many former students to make my graduate study a very

special memory in my life.

I would like to express my sincere gratitude to my parents for always supporting me, and

praying for me no matter where I am and what I am doing; to my brother Wenda, who inspired my

interest in science in the first place; and last but not least, to my husband Zhan, without whose

love, understanding and support, I would not be here today.




















TABLE OF CONTENTS


page


ACKNOWLEDGMENT S............. .............. iv


LIST OF TABLES ................. ...............vii...............


LIST OF FIGURES ................. ...............viii...............


AB STRACT ................. ..............xi........ ......


CHAPTER


1 INTRODUCTION .............. .................... 1


Sjiigren's Syndrome .............. .................... 1
Etiology and Pathogenesis ................ ................. 2......... ....
Sj igren' s Syndrome Mouse Model ................. ................. 4.............
NOD Strai n............ .... ... ......... ................. 4....
NOD Congenic and Knockout Strains ............... .......... ..............5
B cells and Sjiigren's Syndrome ............. .....................7
Autoantibodies and Pathogenesis............... ............. 9
IL4 and Its Signal Transduction Pathway ............ ......_..._ ......._. .........1
IL4 and IL4 Receptor. ............. .................... 12
IL4 Pathways ............... ...........13...................
IL4/Stat-6 Pathway ............... .......... ......... .........13
IL4/IRS Pathway .....__.....___ ........__ ...........1
Specific Aims...... ....... ....................... 16


2 GENERATION OF A CELL LINE THAT STABLY EXPRESSES MOUSE
TYPE-3 MUSCARINIC ACETYLCHOLINE RECEPTOR FOR DETECTION
OF AUTOANTIBODIES............... ............ 19


Introducti on .............. ................. 19..............
Materials and Methods ............... ................. 21......... ....
Results. ................ ................. 25..............
Conclusion and Discussion ............... ..................... ................... 27


3 GENERATION AND CHARACTERIZATION OF NOD.B 10-H2b.IL4-/-
MOUSE .. ............. ................. 35..............












Introducti on ...._ ._ ............... ................. 35....
Materials and Methods ............... ................. 37......... ....
Results. ................ ................. 43..............
Conclusion and Discussion ............... ..................... ................... 51


4 IL4: THE CONTROLLING ELEMENT FOR DEVELOPMENT OF CLINICAL
DISEASE IN MOUSE MODEL OF SJOGREN'S SYNDROME. ................... .... 69


Introduction. ............... ..............69. ...............
Materials and Methods ............... ..............71. .......... ....
Results ............... ..............73. ...............
Conclusion and Discussion ............... ................ ........ ......... .... 75


5 IL-4 SIGNAL TRASDUCTION PATHWAYS: DIFFERENTIAL EXPRESSION
OF THE STAT-6 PATHWAY CONTROLLING IG ISOTYPE SWITCH IN
SJS-LIKE DISEASE IN NOD MICE. ....._._._ .... .._.. ...._._ ...........8


Introduction. ............... ................. 84..............
Materials and Methods ............... ................. 85......... ....
Results ............... ................. 89..............
Conclusion and Discussion ............... ..................... ................... 92


6 DETECTION OF ANTI TYPE-3 MUSCARINIC ACETYLCHOLINE
RECEPTOR AUTOANTIBODIES IN SJOGREN'S SYNDROME PATIENTS'
SERA. ............ ........................... 111


Introducti on .............. ................. 111........ .....
Materials and Methods ............... ................. 113........ ....
Results ................ ................. 116........ .....
Conclusion and Discussion ............... ...................... ................. 118


7 CONCLUSION. .............. ............. ........ ......... ........ ...... 124


LIST OF REFERENCES .............. .................... 131


BIOGRAPHICAL SKETCH ............. .................... 140

















LIST OF TABLES


Table pg

3-1 List of murine cytokine primer sequence used in PCR ................ ........._..44

3-2 List of murine transcription factor primers sequence used in PCR. ........._.......44

5-1 List of murine STAT6 and neomycin disrupted STAT6 primer used in PCR
genotyping. ........._ .. ............98.......... ......

5-2 Detection of P SP cleavage products in saliva of NOD.B 10.H2b. C129 S2- STAT6+
NOD.B 10.H2b. C129S2-STAT6 -~ and NOD.B 10.H2b. C129S2-STAT6"-. ..........100

5-3 Analysis of saliva of various strains ............... ............... ......... .104

















LIST OF FIGURES


Fiare pg

1-1 IL4 receptor signaling through STAT6 pathway. ................ ...._.._ .............. 17

1-2 IL4 receptor signaling through IRS pathway. ............. .................. .. 18

2-1 Generation of Flp-In CHO stably express gene of interest. ........._._ ... .............. 29

2-2 PCR amplification of mM3R from submandibular glands of C57BL/6. ............_._ 30

2-3 Restriction enzyme digestion of plasmid DNA from transformed clones.. ............ 3 1

2-4 The expression of fusion protein confirmed with westernblot. .............. .... .......... 32

2-5 Immunoflourescent staining of Flp-In CHO and Flp-In CHO mM3R with
m house sera............... ................. 33

2-6 FACS analysis of M3 receptor autoantibodies in NOD.B 10.H2b and Balb/c ........ 34

3-1 Genotyping of NOD.B 10-H2b.IL4"-by PCR ................. ... .............. ......... 55

3-2 Lymphocjytic infiltration of the salivary and lacrimal glands in the NOD.B 10-
H2b.IL4- mouse............... ................. 56

3-3 Saliva volume and protein concentration from NOD.B 10.HZb, NOD.L4 ,
NOD.B 10-H2b. I4- mice ................. ................. 57......... ..

3-4 Saliva amylase activity from NOD.B 10.H2b, NOD.IL4"-, NOD.B10-H2b.IL4"
m ice .............. .................... 58

3-5 Detection of PSP cleavage products from 20 wk old NOD.B 10.H2b, Balb/c,
NOD.IL4"- and NOD.B 10-H2b.IL4- by HPLC ..........._......._ ............. 59

3-6 Reverse transcription polymerase chain reaction analysis of cytokine of
submandibular glands of NOD.B 10.H2b and NOD.B 10-H2b.IL4" -............._._. .... 60

3-7 Reverse transcrition polymerase chain reaction analysis of transcription factors
of submandibular glands of NOD.B 10.H2b and NOD.B 10-H2b.IL4"-.............._._. 61

3-8 Typic FACS histogram profile with StemSepTM murine B cell enrichment. ......... 62










3-9 cDNA GEArray@ mouse signal transduction gene arrays were hybridized with
labeled cRNA generated from spleen B cells extracted from 12 wk old
NOD.B10.H2b and NOD.B10-H2b.IL4"-. ......... ...................... 63

3-10 Spleen IgM and IgG1 isotypic B lymphocyte populations in NOD.B10.H2b and
NOD.B 10-H2b. I4"- mice ................. ..............65. .......... ..

3-11 Detection of antinuclear antibodies in mouse serum from 20 wk old Balb/c,
NOD.B 10.H2b, NOD.IL4-" and NOD.B 10-H2b.IL4"-................. ................ .. 66

3-12 FACS analysis of anti-M3R autoantibodies present in the sera of Balb/c,
NOD.B 10.H2b, NOD.B 10-H2b.IL4"- and NOD.IL4"-. .........._.._ ........._..._.... 67

3-13 Immunofluorescent staining of submandibular glands from NOD.B10.H2b and
NOD.B 10-H2b. I4- ^ mice ................. ................. 68......... ...

4-1 FACS analysis of CD4 GFP+ cell population before and after sorting ........._.......78

4-2 FACS analysis of intracellular 1L4 in transferred GFP+ cells 2 wk after adoptive
transfer.. ............. .................... 79

4-3 Alterations in saliva volume in NOD.B 10.H2b.IL4"- after adoptive transfer CD4+ T
cells from NOD.B 10-H2b.@~ ................. ................. 80......... .

4-4 FACS analysis of IgM and IgG1 isotypic spleen B lymphocyte populations
NOD.B 10.H2b.IL4- after adoptive transfer CD4+ cells from NOD.B 10-H2b.@~.81

4-5 Immunofluorescent staining of isotypic antibodies in submandibular glands of
NOD.B 10.H2b.IL4- after adoptive transfer CD4+ T cells from NOD.B 10-H2b.@~.
............................... 82

4-6 Flow cytometry analsis of anti-M3R autoantibodies in the sera of 20 wk old
NOD.B 10.H2b.IL4- after adoptive transfer CD4+ T cells from NOD.B 10-H2b.@~.
............................... 83

5-1 Genotypmng of NOD.B 10-H2b. C129S2-STAT6 /, NOD.B 10-H2b. C129S2-
STAT6 -~, NOD.B10-H2b.C129S2-STAT6-- mice by PCR ................. .............. 99

5-2 Morphological changes in the salivary glands of NOD.B 10-H2b. C129S2-STAT6 ,
NOD.B 10-H2b. C129S2-STAT6 and NOD.B 10-H2b. C129S2-STAT6" -.......... 101

5-3 Immunofluorescent staining of infiltrating lymphocytes in salivary glands ........ 102

5-4 Analysis of cytokine and IL-4 related transcription factor mRNA expression
in the submandibular and lachrymal glands .............. ................... 103










5-5 Temporal changes in the total saliva volume from NOD.B 10-H2b.C129S2-
STAT6 /, NOD.B 10-H2b.C 129S2-STAT6 '-, and NOD.B 10-H2b.C 129S2-STAT6-/
m ice ........... ..... ._ .............. 105...

5-6 Total saliva volume from various strains at age 20 wk .............. .................... 106

5-7 Total saliva protein concentration from various strains at age 4 and 20 wk .........107

5-8 Saliva amylase activity from NOD.B 10-H2b.C 129 S2- STAT6 /, NOD.B10-
H2b.C129S2-STAT6 '-, and NOD.B10-H2b.C129S2-STAT6~/ mice.. .............__ 108

5-9 Detection of antinuclear antibodies in mouse serum. ........._._.... ......_._....... 109

5-10 FACS analysis of anti-M3R autoantibodies present in the sera of 20 weeks old
NOD.B10-H2b.C129S2-STAT6 /, NOD.B10-H2b.C129S2-STAT6 '-, and
NOD.B10-H2b.C129S2-STAT6~/ mice .................... .............. 110

6-1 Expression of human type-3 muscarinic acetylcholine receptors in transfected
Flp-In CHO cells ................................... 121

6-2 Representative flow cytometric analysis of M3R autoantibody in sera ............... 122

6-3 Isotype analysis of M3R autoantibodies in sera of Sjoigren' s syndrome patients. 123
















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

BIOLOGICAL FUNCTIONS AND MOLECULAR MECHANISMS OF THE
INTERLEUKIN-4 SIGNALING PATHWAYS IN AUTIMMUNE EXOCRINOPATHY
USING THE NOD.B 10.H2b MOUSE MODEL OF SJOjGREN' S SYNDROME

By

Juehua Gao

December 2004

Chair: Ammon B. Peck
Major Department: Pathology, Immunology and Laboratory Medicine

Sjoigren' s syndrome (Sj S) is a chronic inflammatory disease of the exocrine glands

resulting from an aberrant immunological attack against the salivary and lacrimal glands

leading to dry mouth and dry eye disease. The non-obese diabetic (NOD) mouse has been

identified as an excellent laboratory model to study Sj S. The NOD congenic partner

strain, NOD.B10.H2b, has been shown to exhibit many features of primary Sj S in

humans. Recent studies have revealed that the Th-2 cytokine, interleukin-4 (IL-4), plays

an integral role in the production of autoantibodies reactive against salivary and lacrimal

gland cells and subsequent onset of secretary dysfunction. The primary goal of the

present research has been to examine the role of IL-4 in development of Sj S-like disease

using two newly constructed mouse strains, NOD.B 10-H2b IL4-'- and NOD.B 10-

H2b.C129S2-STAT6"









NOD.B10-H2b.IL4-' mice, carrying a dysfunctional IL-4 gene, showed a

heightened leukocytic infiltration of the salivary and lacrimal glands, as well as an

elevated expression of pro-inflammatory cytokines. Nevertheless, these mice failed to

develop a secretary dysfunction. Most importantly, the sera of NOD.B10-H2b.IL4"- mice

did not contain anti-type-3 muscarinic acetylcholine receptor (anti-M3R) autoantibodies

of the IgG1 subclass. Adoptive transfers of IL-4-producing CD4' T cells into NOD.B10-

H2b.IL4 "~mice resulted in development of Sj S-like disease, further supporting the idea

that 1L4 is the controlling effector in Sj S-like disease present in these animals.

NOD.B 10-H2b.C1 29S2-STAT6" mice carrying a dysfunctional Stat6 gene

manifested the loss of secretary function, however to a lesser degree as compared to their

wild type counterpart; this suggests that though STAT6 mediated IL-4 dependent IgG1 auto-

antibody production, especially anti-M3R, may contribute to disease manifestations, but the

clinical disease in NOD mouse model is not mediated through IgG1 isotype specific

pathogenesis. This will lead us to reexamine the role of IL4 in non STAT6 pathways such as

its direct B cell effect as as a potential mechanism to drive autoimmune B cells expansion.

Lastly, to translate these findings to Sj S patients, anti-M3R autoantibodies were

detected in sera of Sj S patients, but not control subj ects, supporting the concept that

the observations made in the NOD mouse model are pertinent to the human disease and

point out the future direction on more expanded clinical study and further determining the

association between detection of anti-M3R autoantibodies and the prediction and severity

of disease.















CHAPTER 1
INTRODUCTION

Autoimmune disease is a complex of physiological disorders resulting in unwanted

destruction of self tissue due to a breakdown in self-tolerance, which is strictly regulated

during lymphocyte development by multiple mechanisms. Many cell type such as B-cells,

T-cells, dendritic cells, NK cells, etc. participate in and contribute to the autoimmune

disorders. The autoimmune response is driven not only by direct cell-cell interaction but

also mediated via soluble molecules such as antibodies, cytokines and chemokines.

Sjilgren's Syndrome

Sjoigren' s syndrome (Sj S) is an autoimmune disease affecting primarily the salivary

and lacrimal glands leading to dry mouth and dry eye disease. It displays a broad

spectrum of clinical manifestations that range from organ-specific exocrinopathy to

systemic disorder involving cardiovascular, renal, respiratory, and central nervous system,

etc. Recent studies referred the prevalence in US at 500,000 to 2 million, depending on

the classification criteria (Timsic and Rozman, 1999; Jonsson et al., 2001). Although

identification of Sj S patients has been historically somewhat arbitrary due to the use of

multiple classification criteria world-wide for clinical diagnosis (Manthorpe et al., 2002),

a recent j oint effort by American and European researchers has now established a more

standardized set of diagnostic markers including ocular symptoms, oral symptoms,

histopathology, obj ective evidences of ocular and salivary glands involvement and the

presence of autoantibodies (Vitali et al., 2002).









Etiology and Pathogenesis

Although the precise mechanisms of remain unclear, multiple factors such as

genetic, hormonal, environmental, viral and immunological factors are all believed to be

involved.

Genetic studies have established a correlation between autoimmune disease and

certain major histocompatibility complex (1VHC) loci. SS correlated to HLA-DR3 and

DQ2 in Caucasian, HLA-DR8 and DR5 in Chinese, Japanese and Greek ethnic

population. (Arnett et al., 1988; Kang et al., 1993; Papasteriades et al., 1988). Animal

studies using the NOD-scid congenic strain, which lack the functional T and B cells,

failed to develop spontaneous sialadenitis, insulitis and diabetes. However, a number of

biochemical markers for exocrine differentiation, for instance, amylase, epidermal growth

factor (EGF) and parotid secretary protein (PSP) expression, are still aberrantly expressed

in the exocrine glands. Generation of C57BL/6.NOD AeclAec2 congenic mice

demonstrated an onset of Sjoigren' s syndrome like pathophysiology characterized by

focal lymphocytic infiltration, and followed by loss of secretary function. NOD aec1 and

aec 2 intervals provide susceptible genes involved in the genetic control of Sjoigren' s

syndrome.

The predominant female patients in the Sj S population raise the possibility of

hormone influence in the disease pathogenesis. Though there is no consensus about how

hormonal factors influence the disease, several theories suggest that hormonal

environment could influence lymphocytes recognize autoantigens, whether differentiate

into effector cells or regulatory cells. It has been reported that dihydrotestosterone

(DHT), an androgen metabolite, could enhance secretary function and suppress

lymphocytic infiltration in mouse model, because DHT favors the development of










regulatory cells through paracrine mediators (Sullivan and Edwards, 1997). On the other

hand, ovariectomy has been found to initiate the apoptosis in the infiltrating lymphocytes

and plasma cells, which can be prevented by administration of DHT or estradiol

(Azzarolo et al. 1999a; Azzarolo et al., 1999b).

The implication of viruses in the development of Sj igren's syndrome has long been

suspected. However there is no clear evidence so far that links viral infection with

induction of Sjiigren's syndrome. It has been shown that Sjiigren's syndrome patients

display an increased content of EBV-DNA in their saliva, and also express EBV-

associated antigens in their salivary glands. A recent study showed coxsackie viral RNA

is present in tissues and cultured salivary gland epithelium cells from Sj S patients but not

in normals (Liakos et al., 2004). In several popular theories the virus remains latent

following infection in genetically predisposed individuals, and later coincidently exposes

the tissue specific antigen to the immune system. Autoimmunity may also occur when the

immune system responds to eradicate the pathogen which contains a protein similar to a

host protein, and leads to the autoimmune response and tissue damage that characterize

Sjiigren's syndrome.

During recent years, many studies reported that salivary gland epithelial cells are

active players that participate in the initiation and the development of SS lesions. These

cells express various molecules involved in lymphoid cell homing and the amplification

of epithelial-immune cells interactions, including proinflammatory cytokines chemokines,

apoptosis and adhesion molecules such as IVHC class I and II molecules, functional B7

costimulatory molecules and CD40 (Dimitriou et al., 2002;Manoussakis et al., 1999).










Sjilgren's Syndrome Mouse Model

Various mouse models have been studied for their resemblance to autoimmune

connective disease in humans, including MRL/lpr, NZB/W, NFS/sld and NOD.

NOD Strain

NOD mice have been established as an animal model for type I diabetes since 1980.

Immune infiltration of the pancreas, starting as early as 2 weeks of age, leads to the

destruction of the p-cells of the islets and loss of insulin secretion, manifested as a loss of

blood glucose regulation. These mice not only develop lymphocytic infiltration in

pancreatic islets, but also show obvious infiltration of the exocrine tissues. The

observation that the loss of secretary function in NOD mice is independent of the loss of

blood glucose regulation implies that there are two independent disease processes

involved: the distribution of the pancreatic beta cells resulting in diabetes and the

distribution of exocrine gland tissue resulting in an exocrinopathy similar to Sjiigren' s

syndrome. The evidence that a locus on chromosome 17 Idd1 is essential for diabetes and

insulitis but not for the development of autoimmune exocrinopathy further supports the

dichotomy between these 2 diseases. A congenic strain, NOD.B10.H2b, in which the

NOD MHC I-A g7 locus has been replaced by non-diabetogenic MHC locus of

C57BL/10, showed autoimmune excrinopathy accompanied by loss of secretary function,

but no diabetes. Thus this strain has become an interesting model for primary Sjiigren' s

syndrome (Robinson et al., 1998).

Studies from NOD and its congenic strain NOD.B10.H2b showed these two strains

result a condition mimic human disease, Sjiigren's syndrome, characterized by a temporal

lymphocytic infiltration accompanied by a loss of secretary function. Periductal and

perivascular lymphocytic infiltration into the submandibular and lacrimal glands begins









around 8-10 weeks and 10-12 weeks of age, respectively. By 18 weeks of age, focal

lymphocytic infiltration can be easily found in the exocrine glands and followed by a loss

of saliva flow and tear flow (Humphrey-Beher et al., 1994). Similar to human disease,

infiltrates in the salivary glands comprised 45% CD4 T cells, 10-15% CD8 T cells and

20% B cells. There are several reports suggesting macrophage and dendritic cells are also

found in the infiltrating cells within the exocrine tissue (Robinson et al., 1998; Xanthou

et al., 1999). In addition, ductal and acinar epithelial cells from SS patients express the

co-stimulatory molecules B7.1 and B7.2 (Manoussakis et al., 1999).

Temporal analysis of cytokine mRNA expression in the submandibular glands of

NOD mouse indicated an elevated level of proinflammatory cytokine including IL-1P,

TNF-a, IL-6, IL-10, IFN- y between 10-12 weeks of age (Robinson et al., 1998b). Th2

cytokine such as IL-4 and IL-5 are only occasionally detected and in association with

strong B cell accumulation (Ohyama et al., 1996). Similarly, SS patients reveal the

expression of I-1P, IL-2, IL-6, IL-10, IL-12, IL-18, TNF-a, TGF-P, and IFN-y in the

minor salivary glands (Boumba et al., 1995; Kolkowski et al., 1999).

NOD Congenic and Knockout Strains

Other NOD congenic and knockout strains provide important tools in dissecting

immune or non-immune components contributing to the autoimmune excrinopathy. One

of the studies using NOD.scid mouse showed disrupted salivary gland morphology,

despite a lack of immune attack on the exocrine tissue. In addition, NOD.IgCI null mice,

lack functional B cells but still develop histological and physiological changes similar to

NOD. Furthermore, development abnormality and abnormal morphogenesis in NOD

genetic background mice was observed at the time of birth (Cha et al., 2001). These

observations support the involvement of non-immune factors in the disease pathogeneses









before onset of autoimmunity. A number of biochemical markers such as amylase,

epidermal growth factor (EGF), and parotid secretary protein (PSP) were either

diminished or aberrantly expressed in exocrine of NOD mouse in the absence of

functional lymphocytes (Robinson et al., 1996). Parotid secretary protein, which appears

to be a nonimmune antimicrobial agent capable of modulating bacterial growth and

colonization, is aberrantly expressed in the glands of mice with NOD genetic background

(Robinson et al., 1997a). The aberrant PSP was identified as an internally cleaved 27KD

isoform at the particular NL-NL site due to the presence of a proteolytic activity in the

saliva of older mice with NOD background but not in the young ones or other disease

free C57BL/6 and Balb/c (Robinson et al., 1997b). Though the exact function of this

protease is not fully identified yet, the temporal changes in its expression correlate,

though independent of the lymphocytic infiltration. Thus it has been used as a

biochemical marker related to the disease. A recently developed highly sensitive HPLC

assay used a synthetic PSP peptide which includes the specific NL-NL cleavage site as a

substrate to detect the presence of protease in the saliva sample.

Recent studies on isolation of genetic intervals involved in the autoimmune

excrinopathy use repeated backcrossing to place resistant intervals onto a disease prone

strain, or susceptible intervals onto a resistant strain. C57BL/6.NOD AeclAec2 congenic

mouse was generated by transferring the NOD Idd3 and Idd5 susceptibility alleles onto

the C57BL/6 disease free mouse, showing a more rapid progression to SS-like symptoms,

characterized by focal lymphocytic infiltration in the submandibular glands, and loss of

secretary function (Brayer et al., 2000). Generation of C57BL/6.NOD Aecl1Aec2

provides an unique model to study the genetic control of Sjoigren' s syndrome.









Study from the NOD.IL4-'- showed the exacerbation of inflammatory response

with no loss of secretary function, indicating the importance of this neglected cytokine in

the disease pathogenesis. Though lack of IL10 also results in an exacerbated

inflammatory aspect, lack of IL 10 does not significantly influence the onset of disease.

The observation that NOD.IFN-y- mouse does not develop inflammation in the salivary

glands past 35 weeks of age, while lacrimal showed normal disease progression and

lymphocytic infiltration, suggesting IFN-y is critical for the development of autoimmune

excrinopathy by promoting salivary gland autoreactivity (Brayer et al, unpublished

observation).

In conclusion, studies from various mouse models of Sj igren' s syndrome support

the concept that autoimmune excrinopathy progresses in multiple phases, an

asymptomatic phase characterized by abnormal differentiation in exocrine tissue

accompanied by biochemical changes between 8-12 weeks of age, followed by an

immune response against the target organ, generation of autoantibodies and results in the

clinical manifestation of loss of secretary function at about 16-20 weeks of age. The

development of various cytokine knockout mouse strains further explored components of

the inflammatory and humoral phases of the autoimmune response.

B cells and Sjilgren's Syndrome

It has been recognized that Sjiigren's syndrome begins as benign polyclonal

lymphocytic infiltration of the salivary and lacrimal glands, but a small percent of

patients may end up with malignant lymphoaggessive disease such as lymphoma.

Approximately 45% of primary Sj igren' s syndromes patients are in stage I, described as

present only sicca syndrome without any systemic manifestation and laboratory

abnormalities. Stage II patients (50%) experience systemic symptoms involving the










pulmonary, renal, hepatic, hematologic, and/or dermatologic systems. Only 5% of

patients develop lymphoaggressive disorder such as MALT (mucosa-associated lymphoid

tissue) lymphoma and high-grade malignant lymphoma (Skopouli et al., 2000). Many

studies have attempted to identify the factors trigger and drive disease progression; for

instance a decrease in the level of serum immunoglobulin, the disappearance of

rheumatoid factor, parotid gland enlargement, lymphadenopathy, splenomegaly, etc. A

recent study suggested that the presence of parotid enlargement, palpable purpura and

low C4 levels during the first examination of a Sjoigren' s syndrome patient is associated

with the development of lymphoma in the long-term follow-up (loannidis et al., 2002).

Chronic stimulation with exogenous antigen or autoantigens has been shown to be

involved in the transition from a polyclonal to a monoclonal lesion by increasing

frequency of transformation (Kipps et al., 1989; Bahler et al., 1997). The transition from

polyclonal lymphoproliferation to monoclonal lymphoproliferation, and Einally to

malignant lymphoma is considered to be a multi-step process involving many important

factors such as specific B cell stimulation through surface Ig binding of exogenous

antigen or autoantigens, B cell activation, usage of particular VH genes and VL genes

and inhibition of apoptosis by over-expression of bcl-2 or related proteins (Masaki et al.,

2003).

B lymphocyte development starts in the bone marrow where developing B cells

undergo an ordered V(D)J recombination process leading to productive assembly of V, D

and J genes at the heavy chain locus, and assembly of V and J genes at the light chain

locus. Immature B cells express surface IgM, undergo positive and negative selection

events promote the formation of competent non-autoimmune repertoire. The Einal stage









of B lymphocyte development takes place in the germinal center where activated B cells

undergo somatic hyper mutation, affinity maturation, and class switch recombination to

express non-IgM receptors. This process depends on the presence of antigenic stimulation

and appropriate T-cell help provided by CD40-ligand. Peripheral tolerance occurs when

activated B cells undergo Fas-mediated apoptosis in the absence of T cell help (Raj ewsky

et al., 1996). Studies with IgG and IgM transgenic mouse models have shown IgM

receptors efficiently function for development and tolerance establishment, whereas IgG

receptors promote signal for proliferative burst and memory formation (Pogue et al.,

2000; Melamed et al., 1997) through distinct signaling pathways (Wakabayashi et al.,

2002; Martin et al., 2002). It is generally thought that although pathogenic autoantibodies

detected in autoimmne disorders are predominantly IgG isotypes, these autoantibodies

arise from IgM-precursors. But it is not completely understood how autoreactive cells are

generated and escape central and/or peripheral tolerance mechanisms.

Autoantibodies and pathogenesis

Various autoantibodies have been described as being associated with autoimmune

excrinopathy. The first autoantibodies identified were directed against nuclear antigens,

including anti-Ro/SS-A and anti-La/SS-B, which have been found in 50~70% of patient

sera. There have been reports that Ro/SS-A and La/SS-B are over expressed in the

cytoplasm and appear on the membrane in the cells infected with virus, in the presence of

cytokine, or under oxidative stress (Clark et al., 1994; Casciola-Rosen et al., 1994).

A variety of autoantibodies have been reported to be present in the sera of primary

and secondary Sj S patients, including antibodies directed against carbonic anhydrase

(Kino-Ohsaki et al., 1996) and proteosome (Feist et al., 1999), as well as beta-adrenergic

receptors (Bacman et al., 1996). Interestingly, the prevalence of the cholinergic antibody









has been reported to be nearly 100% in primary Sj S patients and was independent of the

presence of anti-SS-A/Ro and anti-SS-B/La autoantibodies (Borda et al., 1996). Recent

studies have provided evidence that antibodies reactive with the type-3 muscarinic

acetylcholine receptor (M3R) may be the primary underlying cause for the loss of

secretary function leading to dry mouth, a common complaint described by patients

(Nguyen et al., 2000; Brayer et al., 2001). And this specific autoantibody may be an

effector of the glandular dysfunction, possibly by blocking the normal signal transduction

pathways or desensitization of acinar cells to normal neural stimulations. This concept is

supported now by studies showing that the IgG fractions of sera obtained from SjS

patients or NOD mice suppress stimulated salivary flow rates when infused into mice.

(Robinson et al., 1998)

One hypothesis is surface proteins such as M3R are susceptible to shedding and

may be further taken up by antigen presenting cells. Another mechanism is autoantigens

can be presented in apoptotic bodies, normally presented to CD4' T cells (Nagaraju et al.,

2001).

The type 3 muscarinic receptor, one of the five muscarinic acetylcholine receptor

subtypes that mediate the effects of acetylcholine, is responsible for detrusor smooth

muscle contraction and exocrine function in the salivary and lacrimal glands. The M3

subtype, which contains 7 transmembrane domains, interacts with the hetertrimeric G

protein Gq to activate the effector enzyme phospholipase C (PLC). PLC cleaves

phosphoinositol bis-phosphate (PIP2) into inositol-(1,4, 5)-trisphosphate (Ins(1,4,5)P3)

and diacylglycerol (DAG). Cytosolic Ca2+ COncentration increases after IP3 binding to its

receptor on intracellular Ca2+ Storage and further activates Ca2+ dependent K+ and C1Y









channels in the basolateral membrane and apical plasma membrane, contributing to fluid

secretion (Baum et al., 1993). Furthermore, the increase in cytosolic Ca2'is also known

to induce the translocation of aquaporins (AQP) to the apical plasma membrane

(Ishikawa et al., 1998).

Unlike the many intracellular antigens that give rise to autoantibodies (e.g., SS-

A/Ro, SS-B/La, Sm and alpha-fodrin), the M3R is a membrane-bound protein directly

involved in the parasympathetic neuro-stimulation of exocrine and some non-exocrine

cells. Thus, the anti-muscarinic receptor antibody could be potentially responsible for the

manifestation of clinical symptoms by interfering with signaling for AQP activation or

target secretary cell destruction.

1IL4 and Its Signaling Pathway

IL-4 is a pleiotropic cytokine involved in cell activation, proliferation, and

differentiation. IL-4 is mainly produced by a subset of T cells, designated as Th2 cells, by

mast cells and by basophilic cells. IL-4 is an important cytokine, which exerts distinct

functions on different cells. For B-lymphocytes, IL-4 appears to promote cell survival

and proliferation. Although not a growth factor by itself for resting lymphocytes, it can

substantially prolong the lives of T and B lymphocytes in culture (Hu-Li et al., 1987),

and it also acts as a co-mitogen for B cell growth (Howard et al., 1982). It is also known

as a switch factor for the IgG1 and IgE isotype switch in mouse and IgG4 and IgE isotype

switch in humans. IL-4 leads to the class switch and the production of a different isotype

by stimulating the transcription of heavy chain germline genes. It also has a variety of

other affects in hematopoietic tissues, including increasing the expression of CD23 and

class II MHC molecules (Defrance et al., 1987; Noelle et al., 1984). The different









biological roles 1L-4 initiates depends on the activation of different signal pathways (Pesu

et al., 2000).

IL-4 and IL-4 Receptor

IL-4 is an important cytokine which exerts distinct functions on different cells. For

B-lymphocytes, IL-4 appears to promote cell survival and proliferation. Although not a

growth factor by itself for resting lymphocytes, it can substantially prolong the lives of T

and B lymphocytes in culture (Hu-Li et al., 1987), and also acts as a co-mitogen for B

cell growth (Howard et al., 1982). It is also known as a switch factor for the IgG1 and

IgE isotype switch in mouse and in humans. IL-4 leads to the class switch and the

production of a different isotype by stimulating the transcription of heavy chain germline

genes. It also has a variety of other affects in hematopoietic tissues, including increasing

the expression of CD23 and class Il lVHC molecules (Defrance et al., 1987; Noelle et

al., 1984). The different biological roles IL-4 initiates depend on the activation of

different signal pathways (Pesu et al., 2000).

IL-4R consists of 2 chains: the a chain is a 140KD ligand-binding chain that binds

IL-4 with high affinity, and a y chain shared by other cytokines such as IL-2, IL-7, IL-9

and IL-15 receptors. The cytoplasmic domain of IL-4Ra chain contains 5 tyrosine

residues that are highly conserved among different species. The most proximal tyrosine

residue is critical for generating a proliferating signal, and the second, third and fourth

tyrosine residues are within a conserved sequence motif for the activation of Stat-6. And

the distal tyrosine residue is within an ITIM (immunoreceptor tyrosine-based inhibitory

motif) motif that serves as a docking site for different phosphatases. (Fig. 1-1)









IL-4 Pathways

IL-4 has 2 main signal transduction pathways: (1) STAT-6 and (2) Insulin Receptor

Substrate (IRS). The biological effects result from the activation of downstream signal

transduction pathways.

IL4/Stat-6 pathway

The IL-4Ra chain associates with JAK-1, whereas the 70 chain associates with

JAK3. In certain cell lines, JAK2 is also reported to associate with IL-4Ru. The binding

of IL-4 to its receptor causes tyrosine phosphorylation of IL-4 receptor in the cytoplasmic

region and further activation of other adaptor molecules such as JAK1 and JAK3

(Kotanides et al., 1993). Stat-6 then binds to the phosphorylated receptor through a

highly conserved SH2 (Src homology 2 domain) domain, enabling the activated kinases

to phosphorylate Stat-6 at a C terminal tyrosine residue. Once phosphorylated, the Stat-6

molecules disengage from the receptor and form the homodimers that translocate into the

nucleus to bind to specific DNA motifs in the promoter of IL-4 responsive elements,

including CD23, class Il lVHC or germline immunoglubin e and IL-4Ra chain (Hou et

al., 1994). (Fig.1-1)

Isotype switching is associated with IL-4 transcription induction of germline CHyl

and CHe RNA. Switching to a particular immunoglobulin class is always preceded by the

appearance of germline RNA corresponding to that particular class and demonstrates the

essential role of transcription induction in the isotype switch. IL-4 activates the tyrosine

kinases JAK1 and JAK3 and phosphorylates a number of signaling molecules including

transcription factor Stat-6. The observations that B cells from Stat-6 deficient mice are

unable to complete the isotype switch to IgE emphasize the possible role of the JAK-Stat-









6 pathway in the development of Th2 immune responses and isotype switching (Takeda

et al., 1996; Kaplan et al., 1996; Shimoda et al., 1996; Linchan et al., 1998).

IL-4/IRS Pathway

IRS proteins play an important role in maintaining cellular function such as cell

growth and metabolism. Four members of IRS family have been identified (Sun et al.,

1991; Sun et al., 1995; Lavan et al., 1997a; Lavan et al., 1997b). IRS1 and IRS2 are

cytoplasmic proteins involved in regulation of cell proliferation and prevention of

apoptosis in response to IL-4. The sequence surrounding the proximal tyrosine residue in

the cytoplasmic region of the IL-4R a chain is highly homologous to the sequence of the

cytoplasmic region of the insulin receptor and IGF-1 receptor and shares the same IRS-

1/2 signaling pathways. This sequence is termed as the insulin IL-4 receptor motif (I4R).

IRSs are recruited to the IL-4R complex by the phosphorylation of the tyrosine residues

in the IL-4R a chain I4R domain through an N-terminal PTB domain (phosphotyrosine

binding domain). JAK1 is critical for IL-4 stimulated induction of IRS-1 phosphorylation

through the direct action of JAK 1 on IRS-1 (Wang et al., 1997). The phosphorylated IRS

proteins provide docking sites for SH2 domain-containing signaling proteins such as

regulatory subunit p85 of PI3-K and Grb-2 (Pesu et al., 2000). These interactions lead to

the activation of the PI3-K and Ras/MAPK signaling pathways respectively. PI3-K

consists of 2 subunits, an 85 KD regulatory subunit (p85) and a 1 10 KD catalytic (p 110)

subunit. Interaction of the p85 subunit with phosphorylated IRS-1/2 molecules results in

a conformational change and leads to the activation of the pi 10 catalytic subunit, which

further activates membrane lipids, as well as serine/threonine residues of proteins.

Among the membrane lipids, phosphotidylinositol-(3,4,5)-triphosphate (IP3) and









phosphotidylinositol-(3,4)-bisphosphate (PIP2) are the most important ones. These

molecules act as secondary messengers for activation of downstram kinases, including

serine/threonine kinase Akt (protein kinase B) and other molecules involved in cell

survival and prevention of apoptosis.

Phosphorylated IRS-1/2 has also been proposed to interact with adapter molecule

Grb-2 using its SH2 domain. Grb-2 is constitutively completed with the guanine

nucleotide exchange protein, Sos, which is capable of catalyzing the exchange of GDP

for GTP in inactive Ras, producing the active GTP completed form of Ras. The MAPK

pathway is initiated by the serine/threonine kinase Raf following its activation by Ras-

GTP (Fantin et al., 1999; Nelms et al., 1999). (Fig. 1-2)

Thus, IL-4Rcchain cytoplasmic region has 3 functionally distinct domains: one

acts as an interaction site for Janus kinase (JAK1 and JAK3), one is required for

activation of proliferative pathways, and a third is involved in the activation of gene

expression. IL-4 stimulates 2 independent and bifurcating signal pathways that can direct

mitogenesis via the IRS-signaling proteins and specific gene expression via the

JAK/STAT-6 pathway for nuclear activated factor ( Kotanides et al., 1993).

Although the exact role of the cytokine IL-4 in the autoimmune exocrinopathy is

still unclear, it is observed that the absence of IL-4 prevents the clinical disease. NOD IL-

4 KO mice show lymphocytic infiltration, increases of proinflammatory cytokines in the

salivary glands but do not develop clinical disease. The onset of clinical disease is

probably due to the IL-4 dependent production of IgG1 anti-M3R autoantibodies, which

are responsible for the final loss of secretary function. Or it is a result of B cell

proliferation and clonal expansion.









Specific Aims

The primary goal of the studies described in this dissertation has been to

investigate the functional importance and molecular mechanisms of the cytokine

interleukin-4 (IL-4) in the development of anti-type-3 muscarinic acetylcholine receptor

(anti-M3R) autoantibodies in Sj S utilizing the NOD.B10.H2b mouse model. Specifically,

the studies have been designed to (1) evaluate the role of the cytokine IL-4 in production

of anti-M3R autoantibodies capable of effecting clinical SjS-like disease, (2) identify

which of the maj or IL-4 signaling transduction pathways is (are) primarily involved in

this process, and (3) determine if the findings in the mouse model have validity in the

human disease. To address these three issues, I have

* Constructed a transfected cell line that stably expresses mouse M3R in order to detect
the presence of anti-M3R autoantibodies

* Generated three new congenic mouse lines: the NOD.B 10-H2b.IL4- mouse (an IL4
gene knockout mouse), the NOD.B 10-H2b.Gfp mouse (a mouse expressing the GFP
protein), and the NOD.B 10-H2b. C129 S2- STAT6-'- mouse (a STA T6 gene knockout
mouse)

* Characterized the phenotype of Sj S-like disease in the NOD.B 10-H2b.IL4"- mouse

* Defined the influence of IL-4 on the generation of anti-M3R autoantibodies and the
subsequent development of autoimmune excrinopathy following adoptive transfer of
immune cells capable of providing IL-4 exogenously

* Evaluated the role of the IL-4-dependent Stat-6 pathway in the onset of secretary
dysfunction in the NOD.B10-H2b.C129S2-STAT6-' mouse

* Investigated the presence of anti-M3R autoantibodies in the sera of human Sj S
patients

The results of these studies are presented in individual chapters that follow.



















IIIII~CIIIICCCC~LmCL


1 1111111IIIllll i i


~________~~~~IIYYYYYYYYYYYYYYYLLLLLLLI _~~~~~~~~~YYYYYYYYYYYY


IL4 responsive genes transcription
IGE, IGG, CD23, MHC II, IL4R-alpha


cT ILd )


lI l l I l I


II .I I II


I


I I I I I I I I II II II II II II II II II II II II II II II II II I
I I I I I I I I II II II II II II II II II II II II II II II II II II I I I I I I I I


164~T~C~~Ez~

Llj


I II II II II II II II II II II II II II
I II II II II II II II II II II II II II


~'IATL r


i: r.
.r ~'1.4TL 9~-
eF~lcj-


~i~n



_-~sic~---------~-~






\y~Uhui~ih~l~\:
~hyAY~lhY'h~
~y~V~V~F~N~


Figure. 1-1. 1L4 receptor signaling through STAT6 pathway. The IL-4Ra chain
associates with JAK-1, whereas the y, chain associates with JAK3. The
binding of IL-4 to its receptor causes tyrosine phosphorylation of IL-4
receptor in the cytoplasmic region and further activation of other adaptor
molecules such as JAK1 and JAK3. Stat-6 then binds to the phosphorylated
receptor through a highly conserved SH2 domain, enabling the activated
kinases to phosphorylate Stat-6 at a C terminal tyrosine residue. Once
phosphorylated, the Stat-6 molecules disengage from the receptor and form
the homodimers that translocate into the nucleus to bind to specific DNA
motifs in the promoter of IL-4 responsive elements, including CD23, class II
MHC or germline immunoglubin e and IL-4Ra chain.


u nII 1 I I

















IIIIIII rrT--, ~ ~m.TI'" I'P' ff "II |[| 111II1|I11III1I
II I I II I I I I I I I I I I II I I I II I I I II I I I


IL4


~IIIII PII I II II


III I I I I I II I I I I I I I'III IIIIIII


PIP2


IP3


SGrb2 P3
C3ell glex-tlh
L- llid


Anti-apoptotic pathway


Figure 1-2. IL4 receptor signaling through IRS pathway. IRSs are recruited to the IL-4R
complex by the phosphorylation of the tyrosine residues in the IL-4R oc chain
in response to 1L4. The phosphorylated IRS proteins provide docking sites for
SH2 domain-containing signaling proteins such as regulatory subunit p85 of
PI3-K and Grb-2, leading to the activation of the PI3-K and Ras/MAPK
signaling pathways respectively. These molecules act as secondary
messengers for activation of downstram kinases, including serine/threonine
kinase Akt (protein kinase B) and other molecules involved in cell survival
and prevention of apoptosis.


\-~"Oor















CHAPTER 2
GENERATION OF A CELL LINE THAT STABLY EXPRESSES MOUSE TYPE-3
MUSCARINIC ACETYLCHOLINE RECEPTOR FOR DETECTION OF AUTOANTIBODIES

Introduction

A variety of autoantibodies have been reported to be present in the sera of primary

and secondary Sj S patients. In the past decade, a growing list of autoantigens has been

identified. Though none of them have definitely been associated with autoimmune

excrinopathy and loss of secretary function, type 3 muscarinic acetylcholine receptor

(M3R) antibody could potentially cause the manifestation of clinical symptoms. The

presence of anti-muscarinic acetylcholine receptor antibody was first introduced from the

observation that immunoglobulin G from sera of patients with primary Sjoigren' s

syndrome could recognize and activate muscarinic acetylcholine receptor of rat exorbital

lacrimal glands (Bacman et al., 1996). Interestingly, the presence of autoantibodies to

exorbital lacrimal gland M3R acts as an "agonist-like agent," which could be responsible

for a primary, organ-specific dysfunction (Bacman et al., 2001). Similarly, this

functional assay has shown that immunoglobulin fractions from both primary and

secondary Sj S inhibit carbachol evoked bladder smooth cell contraction by 50%

(Waterman et al., 2000).


Synthetic peptides corresponding to the extracellular loops of human M3

muscarinic acetylcholine receptor were used as antigens in Enzyme-linked

immunosorbent assay (ELISA) to determine autoantibodies against acinar cells and M3R.

However, sera from primary or secondary Sj S patients tested by ELISA fail to recognize









the synthetic peptides corresponding to the first, second and third extracellular loops of

M3R (Cavill et al., 2002). In a recent study, antibody raised against a short region on the

second extracellular loop of the M3R was shown to react with the native receptor on

colon smooth muscle and profoundly inhibit postsynaptic M3R-mediated cholinergic

neurotransmission in a concentration-dependent manner (Cavill et al., 2004). One

possible reason for the lack of reactivity with the M3R is that human anti-M3R

autoantibodies could be directed against conformational epitopes created by the disulfide-

linkage between first and second extracellular loops or against epitopes created by

intermolecular disulfide bonding. Such conformational epitopes would not be expressed

by linear synthetic peptides corresponding to the second extracellular loop (Cavill et al.,

2004). To better detect autoantibodies against tertiary epitope created by extracellular

domains of membrane bound receptor proteins, we have generated a cell line expressing

M3R on the surface membrane to use in a cell based assay to detect the presence of

autoantibodies.


Investigations on whether circulating autoantibodies against M3R could be a new

marker for diagnosis for primary and secondary Sjoigren's syndrome have not provided

enough evidence for clinical classification due to controversial findings with current

detection methods. Generation of mammalian cell lines expressing a gene of interest is

often not efficient or stable because the integration of transfected expression vectors at

random sites in the genome. Integration into a transcriptionally silent locus could result in

little or no expression. This negative or positive effect could also cause significant clonal

variations, compromising the comparison of expressed constructs. Our previous efforts









with random integration also failed to result in a long-term stable line (unpublished

results).


Flp-In targeted integration system provided by Invitrogen is used to generate

isogenic stable cell lines. Flp-In host cells, which contain a single Flp recombinase target

site in a transcriptionally active genome locus, are used for a site-specific recombination

to facilitate integration of the gene of interest into the genome of mammalian cells.

Stable cell lines are generated by co-transfecting the host cells with the Flp-In expression

vector and Flp-In recombinase expression vector. The expression of recombinase enables

the integration of expression vector at the genomic target site. In this part of the study, I

have used the Flp-In targeted integration system to generate an isogenic cell line stably

express mouse M3R and detect the presence of autoantibodies against M3R using a cell

based assay (Gao et al., 2004).

Materials and Methods


Generation of Flp-In CHO cells stably expressing mM3R. Cloning of full

length mouse M3R coding region was carried out following the protocol as previously

shown (Nguyen et al., 2000). In brief, RT-PCR was performed using mRNA isolated

from C57BL/6 submandibular glands (Fast-Track 2.0 mRNA Isolation Kit, Invitrogen,

Carlsbad, CA). The PCR was carried out with synthesized forward and reverse

oligonucleotide primers whose respective sequences are mM3Rf: 5'-

CACAATGACCTTGCACAGTAACA-3' and mM3Rr: 5'-

TGTTACTGTGCAAGGTCATTGTG-3'. PCR was performed as an initial dissociation

of the cDNA by heating the reaction mix to 94oC for 3 min, the reaction was carried out

for 34 cycles with each cycle consisting of 94oC for 30 seconds, 540C for 30 seconds and









720C for 30 seconds. After 34 cycles the reaction was held at 720C for 2 min, then cooled

to 40C until removed from the thermocycler. The expected 1773bp PCR products were

purified using Qiagen's Gel extraction kit (Qiagen, Valencia, CA) and ligated into the

pcDNA5/FRT/V5-His Topo TA cloning vector (Invitrogen, Carlsbad, CA) containing the

ampicillin-resi stance gene. Ligation and transformation of E. coli were performed

according to the manufacture's protocol. The transformed bacteria were plated onto LB

agar plates, supplemented with 50Cpg/ml ampicilin for selection, overnight in a shaking

incubator (250rpm) at 37 oC. Several transformed colonies were picked and each colony

was grown overnight in 3ml LB broth, supplemented with 50Cpg/ml ampicilin, while

shaking at 250rpm at a 37 oC incubator. Construction of the M3R cloning vector

Plasmid DNA was extracted from the cultures using Mini-Preps DNA Purification kit

(Qiagen) following manufacture's protocol. A restriction enzyme digestion was

performed with BamH I and Hind III (Roche Diagnostics, Boehringer Mannheim,

Germany) at 37 oC for 2 hours and run on an ethidium bromide stained 0.9% agarose gel

to determine insert orientation. Plasmid DNA extracted from the bacterial colonies

containing the vectors in the right orientation was sequenced to ensure gene fidelity prior

to transfection.


Maintenance of Flp-In CHO cells and cell transfection. Flp-In CHO cell line

(Invitrogen) contains a single integrated Flp Recombination site from pFRT/lacZeo

vector, expressing the lacZ-Zeocin fusion gene. Flp-In CHO cells are maintained in

UltraCHO Medium (BioWhittaker Cell Biology, Walkersville, MD) with 0.1% zeocin

(Research Products International Corp). Cells transfection was performed with

Invitrogen Lipofectamine. Co-transfect Flp-In CHO cells with 9: 1 ratio of Flp









recombinase expression plasmid pOG44 to pcDNA5/FRT/V5-His vector inserted with

mM3R. Flp recombinase mediates insertion of Flp-In expression construct into the

genome at the integrated FRT site through site specific DNA recombination. Briefly,

lx105 Flp-In CHO cells were seeded into 6 well plates in UltraCHO growth medium

(BioWhittaker Cell Biology) with 5% FBS the day before transfection. Serum free

UltraCHO growth medium was added to 1 Cpg of plasmid DNA, 9 Cpg of pOG44 and 25 Cl1

Lipofectamine transfection reagents (Invitrogen, CA) to make to 500Cl and transfer to the

cells in 6 well plates after incubating for 20 min. The cells were incubated at 370C and

5%CO2. The transfection reagents were removed in 7 hours, and cells were washed and

added with new UltraCHO growth medium with 5% FBS.

Selection of Flp-In CHO cells expressing constructed vector. After

cotransfection with PcDNA5/FRT/V5-His vector containing mouse M3 receptor and

pOG44, cells were incubated for 24 hours to allow for expression of the resistance gene.

Then change to growth medium ProCHO 4 (BioWhittaker Cell Biology, Walkersville,

MD) containing 5% FBS (Fetal Bovine Serum) and 0.80mg/ml hygromycin B (Research

Products International Corp. Mt. Prospect, Illinois) for selection. The cells were fed every

5 days. If necessary, adherent CHO cells were digested with 0.05% Trypsin-EDTA (Life

Technology) and splited. When a stable hygromycin resistant cell line was established,

cells were transferred to suspension culture growth medium in serum free ProCHO 4

(BioWhittaker Cell Biology, Walkersville, MD). Once hygromycin-resistant cell lines

were established, the transfected cells were transferred to serum-free ProCHO4

suspension growth medium supplemented with 0.8mg/ml hygromycin and grown in 75

cm2 culture flasks. Theoretically, all the selected clones are isogenic with the









pcDNA5/FRT/V5-His M3R vector integrated into the same genomic locus in every clone.

No further subclone is conducted.


M3 receptor production in transfected Flp-in CHO cells. Membrane protein

was extracted for detection of M3 receptor. The transfected and non transfected Flp-In

CHO cells were collected by centrifugation and lysed by adding Iml of 50mM Tris HC1,

pH 7.5, followed by repeated freeze and thawing of the pellet in an ethanol/dry ice bath,

and finally passing the lysed cells through 18 and 26 gauge needles. The membrane pellet

was prepared by centrifugation at 40,000g for 20 minutes at 4oC in 1ml of 50 mM Tris

HCI buffer, pH 7.5, and centrifuged again for 15 minutes at 40,000g at 4oC for a total of 2

washes. Following the last wash, the pellet containing was resuspended in 1ml of pH 7.5

Tris HCI buffer saline, and saved at -800C for further experiments. The expression of

fusion protein was confirmed with western blot. 3 Cpg of membrane proteins from

transfected and non transfected Flp-In CHO were loaded and separated on a 12% SDS-

PAGE followed by transferring to nitrocellular membrane at 18 volts overnight. After

transfer, membrane was incubated in 5% non-fat milk blocking buffer for 1 hour and

incubated with 1:2000 dilution of anti-His-AKP (Invitrogen, CA) and by color

development with Nitroblue Tetrozolium (Sigma, MO) and Bromocholroindolyl

Phosphate (Sigma, MO).

Detection of anti-mM3R autoantibodies and its isotypes in mouse sera using

transfected Flp-In CHO cells. Sera were collected from NOD/LtJ, NOD.B10.H2b,

C57BL/6 and Balb/c mice at 4 or 20 weeks of age, stored at -80 oC for future

experiments. 10Cl1 sera were pre-absorbed with 5x106 Flp-In CHO at room temperature

for 2 hours. Plate mM3R Flp-In CHO or Flp-In CHO cell at a concentration of









10 /chamber on 8 well chamber slide (Lab-Tek chamber slide system, Nunc., Denmark),

allow cells to grow till reach confluent. Cells were washed 3 times with Phosphate-

buffered saline (PBS) and fixed in 10% formalin for 10 minutes. After 3 times wash with

PBS, cells were incubated with preabsorbed sera at 1:50 dilution with Car and Mg" free

lxPBS. Cells were washed again and incubated with 1:100 diluted FITC labeled anti

mouse polyvalent immunoglobulin (Sigma, St. Louis, MO) in Ca" and Mg" free lxPBS.

After final wash, slides were visualized with fluorescent microscope under 200 x

magnifications. To further identify the isotypes of the autoantibodies, pcDNA5/FRT/V5-

His mM3R-transfected Flp-In CHO cells were collected from culture, washed once with

phosphate-buffered saline (PBS), and resuspended in FACS buffer (PBS, 2% ABS,

0.01%NaN3) at a density of 1 x 105 cells/0. 1 ml. Aliquots of cells were incubated 2 hrs at

40C with 10 Cl1 sera from 20 weeks old Balb/c and NOD.B 10.H2b. Cells were washed

once with FACS buffer and stained with either FITC-conjugated goat anti-mouse IgG

(PharMingen, San Diego, CA) or FITC-conjugated goat anti-mouse IgA, IgG1, IgG2,

IgG3, IgG4, IgE and IgM (Accurate Chemical Corp., Westbury, NY) for 45 min at 4oC.

After a final wash with FACS buffer, the cells were resuspended and analyzed using a

FACScan cytometer (Becton Dickinson, Mountain View, CA).

Results


Construction of a transfected cell line stably expressing mouse M3R. Earlier

studies from our laboratory (Nguyen et al., 2000) indicated the feasibility of using a cell

line transfected with M3R to detect anti-M3R autoantibodies in sera of Sjoigren's

syndrome patients. However, in those studies, the assay utilized COS-7 cells transfected

with rat M3R expressed from a vector system not integrated into the genome, resulting in









two concerns. First, the reactivity of human autoantibodies towards rat M3R molecules

proved quite weak, raising issues as to the levels of specificity and detection with a cross-

reactive antigen. Second, expression of the transfected rat M3R gene from the epigenetic

vector proved unstable and transient, requiring constant subcloning and re-transfections.

To circumvent these problems, I constructed a cell line that is transfected with the mouse

M3R (mM3R) gene incorporated directly into the cells' genomes. To accomplish this,

cDNA of the ORF for the mM3R gene was generated from mRNA isolated from the

C57BL/6 submandibular glands. The resulting PCR product (Figure 2-2) was isolated and

ligated into the PcDNA5/FRT/V5-His TOPO vector used to transform E. coli. Plasmid

DNA were extracted and digested to screen for a single plasmid carrying the huM3R

gene in the correct orientation (Figure 2-3). Following sequencing of the insert for

fidelity and orientation, genetically-manipulated Flp-In CHO cells were co-transfected

with the recombinant mM3R-pcDNA5/FRT/V5 -Hi s TOPO and pOG44 plasmids for the

generation of a stably transfected cell line. To determine if the transfected cells express

mM3R as a membrane protein, membrane fractions were prepared from both transfected

and non-transfected Flp-In CHO cells undergoing expansion as suspension cultures.

Proteins from the membrane preparations were screened by Western blotting using an

anti-His antibody. The expected 65 kD protein band was observed in the membrane

fraction of the mM3R transfected Flp-In CHO cells, but not in the non-transfected Flp-In

CHO cells (Figure 2-4). Thus, I have successfully constructed a system consisting of a

parental CHO cell line that does not express a muscarinic acetylcholine receptor (control)

plus a CHO cell line that constitutively expresses the mM3R (experimental).









Detection of anti-mM3R autoantibodies and its isotypes in mouse sera using

transfected Flp-In CHO cells. To identify the presence of anti-mM3R autoantibodies in

the sera, mM3R Flp-In CHO or Flp-In CHO cell were seeded at a concentration of

10S/chamber on 8 well chamber slide and grow to reach confluence. Cells were incubated

with preabsorbed sera and followed by FITC labeled anti mouse polyvalent

immunoglobulin. Slides were visualized with fluorescent microscope under 200x

magnification. As shown in Figure 2-5, only Flp-In CHO expressing mM3R showed

positive staining after incubation with 20 weeks old NOD sera, indicating the presence of

anti-mM3R. No staining was visualized on cells incubated with 4 weeks old NOD or

C57BL/6 sera. To further identify the anti-mM3R autoantibodies and its isotypes in

mouse model of SS, sera isolated from NOD.B10.H2b and control Balb/c mice (n=5~6)

at 20 weeks of age were preabsorbed with Flp-In CHO cells and incubated with mM3R-

transfected Flp-In CHO cells (1 x 10 ). Cells stained with either FITC-conjugated goat

anti-mouse IgG or FITC-conjugated goat anti-mouse IgA, IgG1, IgG2a, IgG2b, IgG3,

IgE, IgM and analyzed using a FACScan cytometer. As observed in Figure 2-6, in the

disease stage, total IgG and IgGl, IgG2a, IgG2b and IgG3 isotypic anti M3R antibodies

can be detected in NOD.B 10 sera, while in control age matched Balb/c mice, no anti-

M3R autoantibody was detected.

Discussion and Conclusion


In the present study, detection of anti-mM3R autoantibodies in mouse model of

Sjoigren' s syndrome was facilitated by the construction of a transgenic cell line

expressing the mouse M3R protein, as proposed earlier by Konttinen et al (Konttinen et

al., 1999). Unlike our earlier M3R-transfected cell lines that were constructed with the









rat M3R gene (Nguyen et al., 2000) the model presented in the current study expresses

the mouse M3R from a gene stably incorporated within the cell line's genome as opposed

to an epigenetic element. This has been made possible through the use of the Flp-In

CHO cell system, and has resulted in a stable M3R gene-expression system. Because this

system has been designed to use flow cytometric analysis, I have been able to evaluate

additional aspects, e.g., the isotype of the anti-M3R autoantibodies. This system

establishes the methodology for a quick and simple diagnostic test with possible

significance in identification of clinical disease in Sj S.

My preliminary studies provide the evidence that anti-M3R autoantibodies are

present in sera of Sjoigren' s syndrome mouse model NOD and NOD.B 10.H2b. NOD and

its congenic strain NOD.B10.H2b have been used as a model for Sj S based on same

criteria, including the presence of focal lymphocytic infiltration in the exocrine tissues,

detection of sera antibodies and loss of exocrine secretary capacity. My observations on

the presence of anti-M3R autoantibody in these models provide evidence that our mouse

model of Sj S may share the same underlying pathogenesis lead to the loss of secretary

function. And this cell based assay makes it possibly to identify autoantibodies generated

to tertiary epitopes created by the extra-cellular domains.











g)

Isq


pOG 44
Flp Recombinase ATC


SV40pA Gene of Interest BGHpA


SV40 pA


F ln


~m~'


Figure 2-1. Generation of Flp-In CHO cells stably expressing gene of interest. Flp-In host
cells, which contain a single Flp recombinase target site in a transcriptionally
active genome locus, are used for a site-specific recombination to facilitate
integration of the gene of interests into the genome of mammalian cells.
Stable cell lines are easily generated by co-transfecting the host cells with the
Flp-In expression vector and Flp-In recombinase expression vector pOG44.
The expression of recombinase enables the integration of expression vector at
the genomic target site.


S


"Ic "4caS~3~C ~s ~cnr FVC~ ~II
'~' ""~c
~ qr NR .I;:FRT~

Fl~ln' e~pcessi~n c~ll line
~l~y~omycil~l~~is~arrr. 7~k~irr-~e~;ili~r~1















*- 1773b p


Figure 2-2. PCR Amplification of mM3R from submandibular glands of C57BL/6. RT-
PCR with the mM3f and mM3r primers produced 1.7 kilobase pair M3R
amplicon (lane 1). 1 kb DNA Ladder (Promega Corporation) was used as a
marker (lane M).



















M1I2 3 4 5



2000
1500 +-- -- 1254 bp
1000 .
500 567 bp







Figure 2-3. Restriction enzyme digestion of plasmid DNA from transformed clones.
Plasmid DNA was extracted from the cultures using Qiagen's Mini-Preps
DNA and restriction enzyme digested BamH I and Hind III at 37 oC for 2
hours and run on 0.9%agarose gel to determine insert orientation. After
digestion, vectors with inserts in the right orientation yielded approximately
567 bp and 6296 bp DNA bands (lane 3,5) while vectors with the opposite
directionally insertion yielded 1254 bp and 5609 bp bands(lane 1,2,4). 100bp
DNA ladder (Promega Corporation) was used as a marker (lane M).

















100
75

50


37

25








Figure 2-4. The expression of fusion protein confirmed with western blot. Membrane
proteins were separated on a 12% SDS-PAGE gel and transferred to a
nitrocellular membrane and probed with 1:2000 anti-His-AKP. A 65KD
protein was showed in transfected Flp-In CHO but not in the control Flp-In
CHO cells. Prestained Presicion Plus Protein Standard (BioRad Laboratories)
was used as a marker.





I


Flp-In
CHO





Flp-In
CHO
mM3R


Figure 2-5. Immunofluorescent staining of Flp-In CHO and Flp-In CHO mM3R with
mouse sera. Plate mM3R Flp-In CHO or Flp-In CHO cell at a concentration
of 10S/chamber on 8 well chamber slide; allow cells to grow till reach
confluent. Cells were washed 3 times with PBS and fixed in 10% formalin for
10 minutes. After 3 times wash with 1xPBS, cells were incubated with
preabsorbed sera at 1:50 dilution with Car' and Mg" free PBS. Cells were
washed again and incubated with 1:100 diluted FITC labeled anti mouse
polyvalent immunoglobulin (Sigma, St. Louis, MO) in Ca++ and Mg++ free
lxPBS. After final wash, slides were visualized with fluorescent microscope
under 200 x magnifications.
















IgGb Ig g1IG: g:gG g g


Figure -.FC analyi of M3 reepo autantbod es in NO .H and Balb/ .

Serasr fro NOD.B0.Hb and Balb/c mic at. 4r (- and: 20 week ofag
(-) weepeasre ih516Fp-nC Oadicbtdwt 0u
preabsorbed6 sea el ee ahdoc it ASbfe adsandwt

mous IgM, IgG1, IgG2a, IgG2b, IgG3, IgA, IgE adaaye sn


Fiur 26.FACScanayi cyofmeter. tratatbde n O.1.~ n abc















CHAPTER 3
GENERATION AND CHARACTERIZATION OF NOD.B 10-H2B.IL4" MOUSE

Introduction

The underlying etiology of autoimmune excrinopathy remains elusive, a number of

studies using the NOD mouse and its congenic strains have led to the concept that

autoimmune excrinopathy progresses in multiple phases. A physiological and

biochemical phase characterized by retarded salivary gland organogenesis and aberrant

protein expressions occurs well before the actual immune attack. With the onset of

lymphocytic infiltration and a concomitant increase in the expression of inflammatory

cytokines, an immune response is initiated against the acinar cells of salivary and

lacrimal glands. Finally, the production of autoantibodies correlates with the loss of

secretary function and actual clinical disease.

Autoantibodies appear to play an important role in the pathogenesis of Sjoigren' s

syndrome. The anti-nuclear autoantibodies, anti-SS-A/Ro and anti-SS-B/La have been

found in about 40~70% of patient sera. Recent studies have shown that the type 3

muscarinic acetylcholine receptor (M3R) is a candidate autoantigen and that anti-M3R

autoantibodies are also present in human patients with SjS (Gao et al., 2004). It is

postulated that the constant binding of anti-M3R to autoantibodies to muscarinic

acetylcholine type 3 receptors causes desensitization, or functions as an antagonist,

interfering with normal signal transduction. In any case, the presence of antibodies to

M3R would affect the rate of fluid secretion.









Recent studies showed that IL-4, a cytokine actively involved in humoral immune

responses, plays an integral role in the production of autoantibodies and the onset of loss

of secretary function (Brayer et al., 2000). Although the exact role of the cytokine IL-4 in

the autoimmune exocrinopathy is still unclear, it has been observed that the absence of

IL-4 prevents the loss of secretary function in NOD.1L4"- mice, in spite of lymphocytic

infiltration and upregulated proinflammatory cytokines in the salivary glands.

IL-4 is a pleiotropic cytokine involved in cell proliferation, activation, and

differentiation. For B-lymphocytes, IL-4 appears to promote cell survival and

proliferation. Although it is not a growth factor by itself for resting lymphocytes, it can

substantially prolong the lives of T and B lymphocytes in culture (Hu-Li et al., 1987),

and acts as a co-mitogen for B cell growth (Howard et al, 1982). It is also well

established that it can regulate isotype switching. In the mouse, IL-4 stimulates germline

yl and a immunoglobulin gene transcription. In combination with costimuli, especially

CD40L, IL4 induces switching to IgG1 and IgE in vivo.

The exact role of IL-4 in autoimmune exocrinopathy of NOD mice is still unknown.

IL-4 dependent production of specific isotypic autoantibodies, or IL4 mediated cell

activation and proliferation, could allow the survival and expansion of a small

populations of autoimmue B cells later involved in the disease process. In the present

study, I have examined how the lack of IL4 affects the development of clinical

manifestations and lack of secretary function in NOD.IL4-'- and NOD.B 10-H2b.IL4"

mice, especially focusing on the presence of autoantibodies against M3R and analyses of

their subclasses.









Materials and Methods

Animals. NOD/LtJ, NOD.B10.H2b and NOD.14- mice were purchased from

Jackson Laboratories (Bar Harbor, ME) and maintained under specific pathogen free

conditions in the mouse facility of the Department of Pathology, University of Florida,

Gainesville, FL. NOD.B10-H2b.IL4- mice were generated by crossing a NOD.IL4"~

(full strain name: NOD.H2g .IL4"-) male with a NOD.B10.H2b female moue. The Fl

heterzygotes were intercrossed to produce a F2 generation that were screened by PCR for

the presence and/or absence of the di srupted IL-4 gene and the presence of MHC H-2b

locus by microsatellite marker genotyping. Microsatellite marker primers were purchased

from Research Genetics Invitrogen Life Technologies (Carlsbad, CA). (Mitl7-21

MapPair: Forward Primer: CCTTGAGGGCCACGGTTGTC Reverse Primer:

TGAGAGGCTCTGGGGGTATC) PCR primers for IL4 gene were obtained from The

Jackson Laboratory (Bar Harbor, Maine). Mice homozygous for both the neomycin-

disrupted IL-4 gene and the M~HC IAb gene were bred to obtain the founder mice. The

NOD.B 10-H2b.IL4"- line is being carried as a single descent line through brother-sister

matmngs.

Genomic DNA from NOD.B 10-H2b.IL4"- failed to amplify a 444bp IL4 band

(Fig.3-1A), but with neomycin and IL4 primer set amplified a 576bp DNA fragment from

the disrupted allele (Fig.3-1B). Homozygous MHC I-A locus was confirmed by a

microsatelite typing with, which generated a 137bp of the H2b and 122bp of H2g locus,

respectively. (Fig.3-1C)

Measurement of salivary flow rates. To measure stimulated flow rates of saliva,

individual mice were given an intraperitoneal injection of isoproterenol (0. 1 mg / ml) plus

pilocarpine (0.2 mg / ml) dissolved in PBS. Saliva samples were collected from each









mouse for 10 min starting 1 min after inj section of the secretagogue. The volume of each

saliva sample was measured and adjusted by body weight. The saliva samples were then

frozen at -800C until analyzed for protein concentrations and proteolytic activities.

Saliva amylase activity analysis. The decrease in saliva output by NOD and

NOD.B10.H2b mice is accompanied by a temporal decline in amylase activity

(Humphreys-Beher et al., 1999). Saliva amylase was determined by Infinity TAI Liquid

Amylase Kit (Thermo Trace) using the starch as the substrate described by Bernfeld

(Bernfeld, 1955). In brief, 250 dilutions of saliva sample in DI H120 were added to 1ml

Infinity TAI Amylase Liquid Stable Reagent. Absorbance was measured at wavelength of

405nm after 1 minute and 2 minutes' incubation at 370C. Amylase activity was calculated

following manufacture's protocol: Amylase activity (u/L) = A A/2 x 5140x dilution factor.

Histology. Submandibular and lacrimal glands were surgically removed from

euthanized mice at 20 weeks of age. The tissues were fixed in 10% phosphate buffered

formalin for 24 hrs, embedded in paraffin, sectioned (5 CL / section) and stained with

Mayer' s hematoxylin and eosin (H/E) dye. Stained specimens were observed at 40X and

200X magnification.

Immunofluorescent staining. Submandibular and lacrimal glands were surgically

removed from NOD.B 10.H2b and NOD.B 10-H2b.IL4-' mice at 12 and 20 wks of age.

The tissues were placed in O.C.T. Tissue Tek compound (Sakura Finetek, CA) to make

frozen blocks. Frozen sections (5 Cpm thickness) were cut on an OTF cryostat (Bright

Instrument Company) and mounted on coated slides. Following a brief washing with

PBS, sections were covered with a blocking solution (FBS supplemented to 2.5% with

fetal bovine serum) for 1 hr prior to incubation with primary antibody. Primary









antibodies were non-conjugated rat anti-mouse IgGl, IG2a, Ig2b, IgG3, and IgA used at a

1:20 dilution. Following 1.5 hr incubation in a humidity chamber, the primary antibodies

were washed from the slides and FITC-conjugated goat anti-rat whole Ig at a 1:20

dilution was applied for 30 min. The slides were washed 4 times with PBS, then mounted

in Vectashield mounting medium (Vector, Burlingham, CA). Negative controls consisted

of tissue sections stained only with secondary antibody. Slides were visualized on an

immunofluorescent microscope at 200X magnification.

Proteolysis of parotid secretary protein (PSP). Detection of PSP proteolysis was

carried out by incubating saliva with a synthesized oligopeptide corresponding to amino

acids 20 through 34 of the published sequence for the PSP protein. This oligopeptide

contains the proteolytic site for an enzyme present in the salivary gland that is activated

during onset of Sj S-like disease in the NOD mouse (Robinson et al., 1997b). 42Cl PSP

oligopeptide (2.5mg/ml) was incubated at 420C for 2 hrs with aliquotes of whole saliva (8

Cl1 ) collected from individual mice. Controls consisted of 50Cl1 PSP oligopeptide.

Following incubation, 50 Cl1 Tris-HCI buffer (50 mM, pH 8.0) was added and the mixture

centrifuged through Micro-spin filter tubes at 14,000 rpm for 10 min. The filtrates were

analyzed by HPLC (Dionex Systems) for the presence of PSP cleavage products.

Preparation of mononuclear cells. Spleens were freshly explanted from

euthanized mice and gently minced through a steel sieve. Following a single wash with

PBS, the red blood cells were lysed by a 7 min exposure to 0.84% NH4C1, and the

resulting cell suspension washed two times in PBS. Lymphocytes present in the

submandibular glands were prepared as detailed elsewhere (Robinson et al., 1998b).

Briefly, the submandibular or lacrimal glands were obtained from euthanized mice and









minced into small pieces using scissors. The minced tissues were washed with PBS, then

incubated in a solution of collagenase type V (2 mg/ml; Sigma Chemicals, St. Louis, MO)

containing DNase Type II (100 U/ml; Sigma Chemicals). The mixture was placed in a

shaking water bath set at 370C until the glandular tissue was digested to single cells. The

mononuclear cells were enriched by centrifugation on a 55% Percoll gradient (Sigma

Chemicals). Each mononuclear cell fraction was washed with PBS, counted and

resuspened to 1 x 106 CellS/ml.

Isotype analysis of B lymphocytes. Aliquotes of mononuclear cells (lx 106 CellS)

were resuspended in 100 Cl1 of FACS buffer and incubated with PE-conjugated goat

anti-mouse CD19 and either FITC-conjugated goat anti mouse IgGl, IgG2a, IgG2b, IgG3,

IgM, IgA or IgE for 45 min at 4oC. The cells were washed once with FACS buffer and

analyzed using a FACScan unit.

Detection of transcription factor and cytokine mRNA expressions. Total RNA

was prepared from the submandibular glands of NOD.B 10.H2b and NOD.B 10-H2b IL4"~

mice aged 4, 8, 12 or 20 wks of age using the RNeazy Mini Kit according to the

manufacturer's protocol (Qiagen, Valencia,CA). cDNA was synthesized using 4 Cpg of

total RNA, Superscript II reverse transcriptase (Invitrogen Life Technologies, Carlsbad,

CA ), and pd(T)12-18 oligomeric DNA (Amersham Pharmacia, Piscataway, NJ). The

cDNA was quantified by spectrophotometry. Semi-quantitative PCRs were carried out

using 1 Cgg of cDNA as template. Following an initial denaturation at 940C for 4 min,

each PCR was carried out for 40 cycles consisting of 94oC for 1 min, 600C for 45 sec and

720C for 2 min. PCR products were size separated by electrophoresis using a 0.9%










agarose gels and visualized with ethidium bromide staining. The primer sequences used

were listed in Table 3-1 and 3-2.

B cell Signaling Transduction Gene SuperArray. GEArray Q series mouse JAK-

STAT and Insulin signaling transduction gene array kits was obtained from SuperArray

Inc. (Bethesda, MD). These arrays included 96 genes involved in either JAK-STAT or

Insulin signaling pathway. (See www.superarray.com for details.) Spleen B cells from

NOD.B 10.H2b and NOD.B 10-H2b.IL4"- were extracted with StemSep Mouse B Cell

Enrichment Kit (Stem Cell Technology, Vancouver, Canada). Purity of B cell separation

was tested by Flow Cytometric analysis after incubating with CD 19-PE antibody for 30

minutes. Total RNA was isolated with the use of an RNeasy Mini Kit (Qiagen Inc.,

Valencia, CA, USA), and 2 Cpg RNA was used as a template to generate Biotin-16-dUTP-

labeled cDNA probes according to the manufacturer' s instructions. The cDNA probes

were denatured and hybridized at 600C with the SuperArray membrane, which was

washed and exposed with the use of a chemiluminescent substrate. To analyze the

Super Array membrane, we scanned the x-ray film and imported it into Adobe Photoshop

as a TIFF file. The image file was inverted, and the spots were digitized with the use of

ScanAlyze software (shareware, http://rana.1bl .gov/EisenSoftware.htm), and normalized

by subtraction of the background as the average intensity value of 3 spots containing

plasmid DNA (PUC 18). The averages of 2 GAPDH or 4 cyclophilin A spots were used as

positive controls and set as baseline values with which the signal intensity of other spots

was compared. Using these normalized data, we compared the signal intensity from the

membranes using the GEarray analyzer program (SuperArray Corp.,

http://www. superarray.com).









Antinuclear antibody (ANA). ANA was detected by indirect

immunofluorescence staining with Sigma Diagnostics Antinuclear Antibody Kits (Sigma,

St.Louis, MO) using human epithelial (HEp-2) cells. Tested sera were diluted 1:50 with

lxPBS (Phosphate Buffered Saline Solution). 50 Cl1 diluted sera was added to separate

wells for a 3-hour- incubation in a humidity chamber. After a brief rinse with PBS

followed by 2 5 minutes' wash, FITC-conjuagated goat anti-mouse whole Ig at a 1:200

dilution was applied to individual wells for 45 minutes. The slides were washed in PBS,

then mounted and visualized on an immunofluorescent microscope at 100X

magnification.

Detection of anti-mM3R autoantibodies and its isotypes in mouse sera using

transfected Flp-In CHO cells. Sera were collected from NOD.B10.H2b, NOD.B10-

H2b.IL4- and Balb/c mice at 4 or 20 weeks of age, stored at -80 oC for future

experiments. 10Cl1 sera were pre-absorbed with 5x106 Flp-In CHO at room temperature

for 2 hours pcDNA5/FRT/V5-His mM3R-transfected Flp-In CHO cells were collected

from culture, washed once with phosphate-buffered saline (PBS), and resuspended in

FACS buffer (PBS, 2% ABS, 0.01%NaN3) at a density of 1 x 105 cells/0.1 ml. Aliquots

of cells were incubated 2 hrs at 40C with 10 Cll sera from 20 weeks old NOD.B 10.H2b,

NOD.B10.H2b.IL4-" mice or 20 weeks old Balb/c. Cells were washed once with FACS

buffer and stained with either FITC-conjugated goat anti-mouse IgG (PharMingen, San

Diego, CA) or FITC-conjugated goat anti-mouse IgA, IgG1, IgG2a, IgG2b, IgG3, IgE and

IgM (Accurate Chemical Corp., Westbury, NY) for 45 min at 4oC. After a final wash

with FACS buffer, the cells were resuspended and analyzed using a FACScan cytometer

(Becton Dickinson, Mountain View, CA).









Results

Mononuclear cell infiltration of the salivary and lacrimal glands in

NOD.B10-H2b.IL4' mice. Diagnosis of Sj S in humans includes complaints of dry eyes

and/or dry mouth, detection of leukocytic infiltrates in the minor salivary glands, the

presence of hypergammaglobulinemia and specific anti-nuclear autoantibodies, objective

evidence of loss of fluid secretions, and desiccation of the ocular epithelial cell surface.

Over the past several years, the NOD mouse has been shown to exhibit a number of these

disease manifestations, including loss of stimulated fluid secretion concomitant with the

appearance of leukocytic infiltrates in the salivary and lacrimal glands. In addition, the

NOD mouse produces a variety of autoantibodies reactive with nuclear, cellular and

secreted proteins of the exocrine glands, mimicking the humoral response observed in the

human disease.

To determine the impact of IL-4 gene expression on the Sj S-like disease in the

NOD mouse in the absence of potentially confounding factors associated with diabetes in

this mouse line, we have generated the NOD.B 10-H2b.IL4"- mouse, a line that exhibits

no diabetes (due to the absence of the Idd1 locus) and contains a disrupted IL-4 gene.

Histological analysis of the exocrine glands of thi s NOD.B 10-H2b.IL4"- mouse,

presented in Figure 3-2, revealed that both the submandibular and lacrimal glands show

significant focal leukocytic infiltrates. This was true for the glands of both male and

female mice. Furthermore, the levels of infiltration were visibly greater than historically

observed in either parental NOD/LtJ or NOD.B 10.H2b mice.

Lack of immune-mediated secretary dysfunction in the NOD.B10-H2b.IL4-I

mouse. To examine whether NOD.B 10-H2b.IL4"- mice retain the secretary dysfunction











































Table 3-2 List of murine transcription factor primer sequences used in PCR
Primers Sequence size
NFKB 5' TCCACGCTGGCTGAAAATCC 580bp
NFKB 3' CACGGGAGACACAGACGAACAGTT
STAT6 5' TCTGTC CTTGGTGGTCATCGTG 643bp
STAT6 3' GGAGATGGGGTTCTTTGGGTTT
SOS 5' TCCTCATCCTATTGATAAATGGGC 684bp
SOS3' CCAAGGGCACATAGTGACAACC
PI3Kp85 5' ACAGACTGGTC CCTGAGTGACTTG 623bp
PI3Kp85 3' GGAGTCCTTTCCGCCCTTGTTGTT
RAF 5' AGCACCACCTTCTTTCCCAATGC 654bp
RAF 3' CCGCTAACACTGAGTCACCACACT


Table 3-1 List of murine cvtokine primer sequences used in PCR


Primers
IFN-y 5'
IFN-y 3'
IL-1 5'
IL-1 3'
IL-2 5'
IL-2 3'
IL-4 5'
IL-4 3'
IL-6 5'
IL-6 3'
IL-10 5'
IL-10 3'
IL-12 5'
IL-12 3'
G3PDH 5'
G3PDH 3'


Sequence
TGA ACG CTA CAC ACT GCA TCT TGG
CGA CTC CTT TTC CGC TTC CTG AG
ATG GCC AAA GTT CCT GAC TTG TTT
CCT TCA GCA ACA CGG GCT GGT C
ATGTAC AGC ATG CAG CTC GCA TC
GGC TTG TTG AGA TGA TGC TTT GAC A
ATG GGT CTC AAC CCC CAG CTA GT
GCT CTT TAG GCT TTC CAG GAA GTC
ATG AAG TTC CTC TCT GCA AGA GAC T
CAC TAG GTT TGC CGA GTA GAT CTC
GCA GGG GCC AGT ACA GCC GGG AA
GCT TTT CAT TTT GAT CAT CAT GT
ATG ACA TGG TGA AGA CGG CCA GAG
TCA CGA CGC GGG TGC TGA AGG CGT G
TGA AGG TCG GTG TGA ACG GAT TTG GC
CAT GTA GGC CAT GAG GTC CAC CAC


size
460bp

625bp

502bp

399bp

638bp

479bp

476bp

983bp









that develops in parental NOD/LtJ or NOD.B 10.H2b mice, temporal changes in the saliva

flow rates were compared among NOD.B 10.H2b, NOD.IL4"- and NOD.B 10-H2b.IL4"~

mice. Saliva secretion was stimulated by an intra-peritoneal inj section of

isoproterenol/pilocarpine solution. As presented in Figure 3-3, at 20 wks of age, a time

point at which secretary dysfunction is exhibited in NOD/LtJ and NOD.B10.H2b mice,

only NOD.B 10.H2b mice showed a statistically significant decrease by student t test

(p<0.05) when compared to salivary flow rates at 4 wks of age, prior to onset of disease.

Neither NOD.14- nor NOD.B 10-H2b.IL4-'- mice exhibited a statistically significant loss

of secretary activity. Furthermore, NOD.B10-H2b.IL4"- mice retained normal salivary

flow rates to 36 wks of age (data not shown).

Loss of secretary function in NOD/LtJ and NOD.B10.H2b mice is associated with

temporal increases in protein concentrations in saliva and tears (Humphrey-Beher et al.,

1994). As expected, saliva collected from either NOD.1L4"- or NOD.B 10-H2b.IL4"~

mice showed consistently normal protein concentrations over time. Thus, the lack of a

functional IL-4 gene resulted in retention of normal secretary flow rates and no

measurable temporal changes in the levels of salivary proteins, despite having little effect

on leukocytic infiltration of the submandibular and lacrimal glands. Likewise, amylase

activity in both NOD.B 10-H2b.IL4- and NOD.1L4"-' increased slightly between 4 and 20

weeks of age, from 181.44125.22 u/ml to 250.70126.90 u/ml, and 234.90126.67 to

291.57159.27 u/ml respectively, whereas the NOD.B10.H2b mice showed a decline from

386.91149.53 to 288.87133.67 u/ml during this time frame (Figure 3-4).

Abnormal proteolytic activity in the saliva of NOD.B10-H2b.IL4- mice. In

addition to the development of xerostomia and a concommitant increase in the









concentration of salivary proteins, parental NOD/LtJ and NOD.B10.H2b mice also

exhibit a number of altered biochemical and physiological properties associated with the

salivary glands (Robinson et al., 1997b). These include measurable decreases in

epidermal growth factor and amylase activities, as well as the appearance of an aberrant

expression of parotid secretary protein (PSP) in the submandibular and lacrimal glands.

Increased proteolytic activities are also observed, one of which is the proteolysis of PSP

at a unique NLNL sequence site within the N-terminal region of the molecule. This

proteolysis of PSP is used as a marker of Sj S-like disease in the NOD mouse model.

To determine if NOD.B 10-H2b.IL4- mice retain this phenotypic marker of Sj S-

like disease, saliva collected from individual mice were tested for the presence of PSP-

proteolytic activity using HPLC to detect the cleavage of a synthetic oligopeptide

carrying an NLNL amino acid sequence. As presented in Figure 3-5, when the synthetic

peptide is degraded by the proteolytic activity in the saliva of parental NOD.B10.H2b

mice, two products are generated that are eluted by HPLC at approximately 9.2 and 12.8

min. Interestingly, the saliva from both NOD.1L4"- or NOD.B 10-H2b.IL4"- mice

possessed the same proteolytic activity (Figure 3-4 D,E). In contrast, no enzymatic

activity was detected in age- and sex-matched BALB/c mice (Figure 3-4B).

Cytokine and major IL4 dependent transcription factor mRNA expression in

the submandibular glands of NOD.B10-H2b.IL4-'- mice. A comparison of cytokine

mRNA expression in the submandibular glands between NOD.B10.H2b and NOD.B10-

H2b.IL4- mice from 4 to 20 wks of age was carried out using a semi-quantitative RT-

PCR analysis. As presented in Figure 3-6, the cytokine mRNA profiles proved quite

different. In the Sj S-like disease-prone NOD.B10.H2b mice at 4 wks of age, when little









or no leukocytic infiltration is present in the submandubular glands, only IL-10 mRNA

could be detected of the relatively small, but representative number of cytokines tested.

By 8 wks of age, the time at which leukocytes first begin invading the submandibular

glands, IL-6 mRNA was detected (suggesting tissue injury is occurring), as well as low

levels of IFN-7 and IL-12. By 12 wks of age, when leukocytic infiltrations are clearly

present in the submandibular glands, mRNA for each cytokine tested, including IFN-7I,

IL-1, IL-2, IL-4, IL6, IL-10 and IL-12, was detected. By 20 wks of age, many of the

cytokines appeared to be expressed at lower levels.

In contrast, in the NOD.B 10-H2b.IL4"- mice, cytokine mRNA profiles indicated

that all these cytokines could be detected at a much earlier age than NOD.B 10.H2b. This

is in line with our findings that NOD.B 10-H2b.IL4-' mice have more severe and earlier

infiltrates in the target organs. Lymphocytic infiltration can be observed as early as 6

weeks of age in NOD.B 10-H2b.IL4- mice. Upregulation oflIFN-7I and IL-6 preceding the

infiltration may suggest involvement of epithelial cells in the initiation of the disease.

Interestingly, IL-4 was only transiently expressed in submandibular glands at 12 weeks of

age NOD.B 10 mouse, and as expected, no IL4 was detected in NOD.B 10-H2b.IL4"-

(Figure 3 -6). The maj or IL4 downstream transcription factors expression were very

similar at mRNA level for NOD.B 10.H2b and NOD.B 10-H2b.IL4"-, except Stat6 can still

be detected at mRNA level at 20 weeks old NOD.B10.H2b but not in NOD.B 10-

H2b.IL4"-(Figure 3-7).

JAK-STAT6 pathway was suppressed in NOD.B10-H2b.IL4-'-. A comparison

of IL4 dependent signaling transduction pathways such as JAK-STAT6 and IRS at

mRNA level was conducted using GEArray Q series mouse JAK-STAT and Insulin









signaling transduction gene array kits. Spleen B cells from NOD.B10.H2b and

NOD.B 10-H2b.IL4"- were isolated and purity of the cell population were above 90%

with Flow Cytometric analysis (Figure 3-8). Regulation of genes involved B cell IL4

signaling transduction pathways was studied using array technology. With a cut off ratio

(>2 or <0.5) and a signaling intensity threshold ( >1E-1 or <-1E-1), I was able to identify

21 genes from the JAK-STAT pathway that were down-regulated at the messenger RNA

level in NOD.B 10-H2b.IL4"- compared to NOD.B 10.H2b. Such genes involved in

STAT6 signaling pathway included IL4, Stat6, GA TA binding protein, C/EBP and NF7B.

SOCS2 (Suppressor of cytokine signaling 2) was the only gene to be found up regulated

(Table 3-2). However, for genes involved in the Insulin Signaling pathway (IRS), a

mixture of up regulation and down regulation at the messenger RNA transcription level

was observed in NOD.B 10-H2b.IL4-' compared to NOD.B 10.H2b. These observations

suggest that 1L4 appears to have a very specific effect on the JAK-STAT6 pathway,

while IRS pathway was far more complicatedly to interpret. The suppression of gene

transcription involved in the JAK-STAT pathway could be a phenotype of the cytokine

knockout mouse model or secondary to the lack of clinical disease in this knockout model.

Spleen lymphocytes population. IL-4 has been shown to have at least two maj or

effects on B lymphocytes: first, this cytokine can enhance B cell proliferation during

ontogeny via an IRS-1 signal transduction pathway, or second, this cytokine can

participate in the isotypic switch from IgM to IgG1 B cells via a STAT6 transduction

pathway. To determine the influence of a dysfunctional IL-4 gene on the maj or

lymphocyte populations in the spleens of NOD.B 10-H2b.IL4"^ mice, splenic lymphocyte

profiles were followed temporally by flow cytometric analyses from 4 to 20 wks of age.









Spleens were excised from euthanized NOD.B 10.H2b and NOD.B 10-H2b.IL4"

mice, the mononuclear cells isolated, then incubated with monoclonal antibodies (mAbs)

defining several maj or lymphocytic populations. These mAbs included anti-CD3, anti-

CD4, anti-CD8 and anti-CD19, as well as mAbs reactive with the surface

immunoglobulins IgGl, IgG2a, IgG2b, IgG3, IgM, IgA and IgE. As presented in Figure

3-10, a small, but significant, increase in the relative number of B cells was observed

over time in the spleens of NOD.B10.H2b mice. In addition, there appeared to be a

concomitant increase in the relative number of IgM and IgG1 B lymphocytes: IgM-

positive splenocytes increased from 34.49% of the spleen population at 8 wks of age to

37.97% at 20 wks of age, while IgGl-positive cells increased from 8.2% to 1 1.037%. In

contrast, the relative number of B lymphocytes in the spleens of NOD.B 10-H2b.IL4"-

mice.

In submandibular glands, CD4 CD8+ and CD19+ infiltrating lymphocytes were

detected in both NOD.B 10.H2b and NOD.B 10-H2b.IL4" mice at 20 wks of age. No

significant differences in these maj or populations were observed in submandibular

inHiltrating lymphocytes in these two strains (Data not shown). In spite of the lack of 1L4,

a potent inducer for IgG1 B cells production, a significant number of IgG1 B cell could

still be detected in the submandibular glands and spleen of NOD.B 10-H2b.IL4- and

NOD.IL4"- mouse either because other redundant pathways exist or the reagent cross

react.

Detection of ANA in sera. The serological presence of ANA or rheumatoid factor

is a maj or criteria for diagnosis of SS. To test whether antibodies in the serum of these

congenic mice could recognize nuclear components. Sera from NOD.B 10-H2b.IL4 ,









NOD.IL4-'- as well as positive control NOD.B10.H2b and negative control Balb/c mice

were diluted 1:50 and incubated with HEp-2 cells fixed to slides. The presence of ANA

was detected by indirect immunofluoresence. Results from this assay indicated both

NOD.B 10-H2b.IL4"- and NOD.1L4"- mice possess ANA in their sera by 20 weeks of age

(Figure 3- 11)

Presence of anti-M3R autoantibodies in the sera of NOD.B10-H2b.IL4"- mice.

Recent studies have provided evidence supporting the possibility that antibody reactive

with the type-3 muscarinic acetylcholine receptor is the effector molecule leading to

exocrine gland acinar cell dysfunction (Nguyen et al., 2000; Cavill et al., 2004). To

determine if anti-M3R autoantibodies are produced by NOD.B 10-H2b.IL4-' mice, sera

collected from NOD.B 10-H2b.IL4-' mice of various ages were tested for the presence of

anti-M3R antibodies using non-transfected and mouse M3R-transfected CHO cells and

compared with sera collected from age- and sex-matched NOD.B10.H2b and BALB/c

mice. CHO cells were incubated with individual sera, followed by either FITC-

conjugated goat anti-mouse IgG or FITC-conjugated goat anti-mouse IgA, IgG1, IgG2a,

IgG2b, IgG3, IgE and IgM, then analyzed using flow cytometry. As shown in Figure 3-

12, anti-M3R antibodies of several isotypes (including IgG1, IgG2a, IgG2b and IgG3)

were detected in the sera of NOD.B10.H2b mice at 20 wks of age, but not in the sera of

BALB/c mice at any age. For NOD.B 10-H2b.IL4-' mice, anti-M3R antibodies were

detected, but these antibodies were restricted to the IgG2a and IgG3 isotypes. As

expected, there was an absence of IgG1 antibodies in the NOD.B10-H2b.IL4"- mice with

a concomitant elevation in the IgG3 fraction.









Detection of antibody depositions in the submandibular glands of NOD.B10-

H2b and NOD.B10-H2b.IL4-'- mice. To detect the presence of antibodies in the exocrine

glands of Sj S-like disease-prone mice, frozen sections of submandibular glands from 12

and 20 wks old NOD.B 10.H2b and NOD.B 10-H2b.IL4-' mice were incubated with rat

anti-mouse IgGl, IgG2a, IgG2b, and IgG3 antibody, followed by incubation with FITC-

conjugated goat anti-rat IgG. As shown in Figure 3-13, the submanduluar glands of

NOD.B 10.H2b mice at 12 wks of age revealed the presence of IgG1, IgG2b, and IgG3

antibody depositions. By 20 wks, even IgG2a antibodies were detected. In contrast, the

submandibular glands of NOD.B 10-H2b.IL4"- mice, while showing the presence of IgG

antibody depositions, had no IgG1 antibody present at either 12 or 20 wks of age (Figure

3-13).

Discussion and Conclusion

Recent research has shown B cells are essential in the pathology of the exocrine

tissue in NOD mice. B cell-deficient NOD mice retain full secretary capacity on

stimulation with autonomic receptor agonists. As a cytokine directly involved in B cell

function, such as cell growth and proliferation, regulation of isotypic switch, and

production of antibodies in immune responses, IL4 can play important roles in the

pathogenesis of Sjoigren' s syndrome.

Previous work showed the interesting observation that NOD.14- mice exhibited

lymphocytic infiltration and elevation of inflammatory cytokines in the salivary glands,

but do not lose secretary function. To further investigate the role of IL4 in the process of

clinical manifestation of primary Sjoigren' s syndrome in a mouse model in the absence of

diabetogenic locus, I generated an 1L4 knockout strain on the NOD.B10.H2b genetic

background, by crossing NOD.IL4"- with NOD.B 10.H2b mice.









In the present study, I compared the autoimmune exocrinopathy in the NOD.B10-

H2b.IL4- and its parental stains NOD.B10.H2b and NOD.14- -. Similar to NOD.14 ~,

NOD.B 10.IL4"- exhibited the same disease phenotype. These phenotypic characteristics

include lymphocyte infiltration, expression of immune associated cytokines in the target

salivary glands and normal secretary function characterized by maintenance of saliva

volume and saliva protein concentration, and increase of amylase activity, indicating that

NOD.B 10-H2b.IL4"-, as well as NOD.B 10.IL4"-, manifest changes in physiological

homeostasis of the exocrine tissue which result in tissue specific recruitment and

activation of lymphocytes. However, the autoimmune exocrinopathy mediated directly by

the lymphocyte compartment responsible for loss of fluid secretion was disrupted. This

observation supports the concept that the lack of Sj S-like disease in the NOD.IL4"' mouse

was not due to the influence of diabetes but a direct consequence of the absence of 1L4. I

also observed that NOD.B 10.H2b mice examined at 20 wks of age, showed an increased

number of spleen B cells, especially IgM and IgG1 B cells, while age matched NOD.IL4-

/-and NOD.B 10-H2b.IL4-'- showed no significant expansion of cells that are positive for

IgM and IgGl. The proliferation of IgM and IgG1 B cells in NOD.B 10.H2b mice

correlated with the over-activation of the immune system and increased disease severity.

The lack of functional 1L4 in the NOD.B 10-H2b.IL4"- mice results in a reversal of the

disease process and IgM or IgG1 B cell proliferation, resulting in normal secretary

function. Surprisingly, a significant number of IgG1 B cells, whose proliferation are

usually induced by 1L4, still can be detected in the absence of 1L4. These observations

raise an interesting question as to whether there are a small but significant fraction of

preprogrammed autoimmune B cells in the NOD mouse that can be induced to proliferate









and produce IgG1 isotypic autoantibodies even in the absence of 1L4. Other cytokines,

such as 1L-13, share many characteristics with IL-4 and are known to be involved in

maintenance of IgG1 B cells. It has also been observed in many studies with cell lines

that 1L4 downstream transcription factors can also be phosphorylated and activated in

response to IL-13, as well as to IL-4. (Murata et al., 1997; Keegan et al., 1995; Welham

et al., 1995)

The role of IL4 on the salivary dysfunction occurring between 8 and 20 wks of age

correlates with an IL-4 dependent isotype switch to IgGl. To detect the presence of anti-

M3R autoantibodies and its subclasses in the knockout mouse, I cloned the mouse

muscarinic type 3 receptor, believed to be the autoantigen inducing the loss of secretary

function in Sjoigren's syndrome. My data showed IgGl, IgG2a, IgG2b and IgG3 isotypic

anti-mM3R antibodies can be detected in NOD.B 10.H2b sera at 20 wks of age; however,

no IgG1 anti-mM3R antibodies were found in either NOD.B 10-H2b.IL4"- or NOD.1L4"~

mice. The presence of other IgG isotypic antibodies and the lack of disease phenotype in

these mice suggest that IgG1 may be critical in the generation of clinical manifestations

associated with dry mouth. This is probably due to different capability of isotypic

antibodies in interfering with normal cellular and immunological responses mediated by

the constant region of immunoglobulins. How the anti-M3R autoantibodies function in

inducing dryness is still not confirmed despite numerous studies. The presence of

IgGlsubclass autoantibody may also be an accompanying result by the functioning Th2

cytokine IL4, and has little to do with the manifestation of clinical disease.

Though our data so far support the concept that production of isotypic

autoantibodies against M3R is very important in the initiation of clinical disease, this









does not rule out the possibility that IL4 plays a role in the early stage of B cell

development, possibly by stimulating polyclonal expansion, proliferation, and the

survival of a small group of autoimmune B cells. IL-4 could also alter the cytokine

balance in the microenvironment of the submandibular glands in the prediseased stage.

As I show here, IFN-7I, IL-2, IL6, IL-10 and IL-12 were all detected as early as 4 weeks of

age in NOD.B 10-H2b.IL4"_- However, at 12 weeks of age, a time point when active

lymphocytic infiltrations occur and proinflammatory cytokine expression escalates in

NOD.B10.H2b submandibular glands, most of the cytokines were downregulated,

unfavorable for maintaining a sustained immune response which eventually leads to the

loss of secretary function.

In conclusion, studies using NOD.B 10-H2b.IL4"^ mice showed the lack of clinical

symptoms in spite of an active lymphocyte attack against the target glands. These

observations further support the idea that the initial inflammatory infiltration of the gland

is followed by secretary dysfunction, and IL4 may play different roles in different stages

of the disease process. This study showed that failure to produce IgG1 anti-M3R

autoantibodies in response to the absence of 1L4, may explain the maintenance of

secretary function in NOD.B 10-H2b.IL4"- and NOD.14- mice. Nevertheless, IL-4 may

also be involved in the expansion of autoreactive cells during the initial stage of disease

by permitting a small population of autoimmune B cells to breach the establishment of

immune tolerance reactive with the M3R moleculars.










B


ML1


U -l-bp 1000
500


c ?rihp~


a31 3 .1 .


1-4 NOD.B10-H2b. IL4~
5 NOD/LtJ


S137sp
"" 121bp


Figure 3-1. Genotyping of NOD.B10-H~b.14-- by PCR. NOD.B10-H~b.IL4- mice w-ere
generated by crossing NOD.H2g .IL4- with NOD.B10.H2b strain. Fl
heterzygotes. were inbreeded and F2 screened by PCR and microsatelite type
of the IL4 and MHC loci. Genomic DNA was extracted with DNeasy Tissue
Kit (Qiagen). 1L4 locus genotyping PCR was performed by following
Jackson Lab protocol. Genomic DNA from NOD.B 10-H2b.IL4-'- failed to
amplify a 444bp IL4 band (Fig.3-1A, lane 1-4), but with neomycin and 1L4
primer set it amplified a 576bp DNA fragment from the disrupted allele
(Fig.3-1B, lane 1-4). 100bp DNA ladder (Promega Corporation) was used as a
marker. Homozygous MHC I-A locus from was confirmed by a microsatelite
typing with Mitl7-21 MapPair, which generated a 137bp of the H2b (lane 1-4)
and 122bp of H2g locus (lane 5) respectively (Fig.3-1C). 25bp DNA ladder
(Promega Corporation) was used as a marker.





,,
'-~C~
~L. ii ~c~

~ i~'
L; ..+~'
,~ i E
"
r s ~'*
~. ~ zr
3a;'~:;: r'
";?,

Submandibular glands Lacrimal glands



a"ip~ ~-*
'tici-; ,C 1~ s~Tfi

:
~"
,:~
,,.. ,. ;a,...E
-~~- ~
~
,.... ''
,.~L

Submandibular glands Lacrimal glands


C57BL/6













NOD/LtJ













NOD.B10-H2b.IL4~I


Submandibular glands


Lacrimal glands


Figure 3-2. Lymphocytic infiltration of the salivary and lacrimal glands in the NOD.B 10-
H2b.IL4-'- mouse. Submandibular and lacrimal glands were surgically
removed from NOD.B10-H2b.IL4-'- mice at 20 weeks of age. The tissue was
fixed in 10% formalin, embedded in paraffin, sectioned and stained with
hematoxylin and eosin dye (40x).




















14


12















NOD.B10.HI~b NOD.,B10I-H~b.IL4- NOD.IL4-C
4wks 20wIks 4wks 20~wks 4wks 20)wks










I


C)
h

s-5
e
Lt
4
8
O ?
u
.j
o
o ?


NODI.B10~H~b
4wks al


NODB10I-H~hb.L4
4wfks Ds e


NOD.IL4;
4wks 20wvks


Figure 3-3. Saliva volume and protein concentration from NOD.B10.H~b, NOD.14 ~,
NOD.B 10-H2b.IL4 mice. (A) Saliva volume from NOD.B10.H2b,
NOD.IL4"-, NOD.B 10-H2b.IL4"- mice. Saliva volume was adjusted by mg

body weight. (B) Saliva total protein concentration from NOD.B10.H2b,
NOD.IL4- -, NOD.B10-H2b.IL4"- mice. (* p<0.05 unpaired student t test).
















ii II II


58

Saliva amylase activity


4 wks 20 wks
NOD.B10.H2b


4 wks 20 wks
NOD.B10-H2b.IL4 '


4 wks 20 wks
NOD.IL4-'~


groups


Figure 3-4. Saliva amylase activity from NOD.B10.H2b, NOD.14-'-, NOD.B10-
H2b.IL4- mice. Saliva amylase activity was determined by Infinity TM
Liquid Amylase Kit following manufacturer's protocol. Amylase activity (u/L)
was calculated as a Absorbance/2 x 5140x dilution factor. Values are
expressed as means of 5 experimental animals + the standard deviation. *
p<0.05 (unpaired student t test)




























rl
1;

C^Ji,: .
L1 ~Di II 21 I~Di 131r 111

'"i
~61D.BLCclBZILIL1~;- ~LOi~p~


1 i J

asEi
i
?1 I:
r- h-
I
I 11 lr Pt. 51 IFQ 1;3 li(D


P~pU~i~


B~,e 1QnbF


lr?-

r


~I rr ~r ;I i'i 111~

h~D. PCA~L ~O~vl;r




I Ije


rl ~1 10 iUO id]


'i
r
E 31; (i Lji :Q1


CQ II)


NODi.B1O~Y6 ~(b~clrs


Figure 3-5. Detection of PSP cleavage products from 20 wks old NOD.B 10.H2b, Balb/c,
NOD.IL4"- and NOD.B 10-H2b.IL4- by HPLC. The PSP cleavage products
were detected at elution time 9.25 and 12.8 min or 9.23 and 12.82 min, after
incubated with saliva from 20 wks old NOD.B 10-H2b.IL4--, NOD.IL4"-
respectively. And the same cleavage products can be eluted at 9.27 and 12.8
min after incubating with 20 wks old NOD.B 10.H2b saliva, indicating the
presence of an unknown protease in these strains.( Fig. 3 -4C,D,E). No enzyme
activity was present in 20 wks old Balb/c saliva as indicated by presence of
intact PSP peptide at elution time 13.3 min. (Fig. 3-4B)












1 Il. I


II. II1. 1 I I, n


II. III II. 1 2 ~ lfi


j i...:::iiiiiiiiiiiiiiiiiiiiiiiiii

t 1


NOD.B lO.IC b 1211145

NOD.B1IO.IED20111is


NOD.B 10-H-~Zb.IL4' 4wlrks



NOn.EllO-H;"b.IL4-' 11aks



NOD.B10 II~:~b.IL4-' lowk;


Figure 3-6. Reverse transcription-polymerase chain reaction analyses of cytokine in
submandibular glands of NOD.B 10.H2b and NOD.B 10-H2b.IL4- -. Total
RNA was extracted from submandibular glands from NOD.B10.H2b and
NOD.B10-H2b.IL4"- at 4, 8, 12 and 20 weeks of age. CDNA was synthesized
and PCR reaction was performed with different cytokine primer sets.


E~~::""'i~~~:~i~~Ii
~-


~1


~::~ ~IIIIIIII j /:I~I: t .~ :IIII~::::::: tlllllllllllllllj ~llllll~--






61


NF rcB Statii SOS GlRB P1: RAF


G3~PDH


~


NOD 810 HZh 3wl:s


NOil:C Eril: Hhyl H52


NGE:~C E11:I-H~h IL4 4wl7;
NaOD BI0-HZhIL4" 811tEs



NaOD B10-HZb IL4" 208isd


Figure 3-7. Reverse transcription-polymerase chain reaction analyses of some 1L4
downstream transcr ~tion submandibular glands of NOD.B10.H2b and
NOD.B 10-H2b.IL4 Total RNA was extracted from submandibular glands
from NOD.B10.H2b and NOD.B10-H2b.IL4- at 4, 8, 12 and 20 weeks of age.
cDNA was synthesized and PCR reaction was performed with different
transcription factor primer sets.


E~


~i ~"i:""'% ~

: ~ ~e~ ~ tB~B~

:f.::: : : r-, ...- :::r...:.....:.ii..-












A B












CD13,1 0-PE




Figure 3-8. Typic FACS histogram profile with StemSepTIM murine B cell enrichment.
Mouse spleen B cells were enriched by negative selection with StemSep
murine B cell enrichment kit. The B cell content of the enriched fraction
typically ranges from 80 to 90% after enrichment. A) FACS analysis before B
cell enrichment. B) FACS analysis after B cell enrichment.











































Figure 3-9. cDNA GEArray@ mouse signal transduction gene arrays were hybridized
with labeled cRNA generated from spleen B cells extracted from 12 weeks old
NOD.B 10.H2b and NOD.B 10-H2b.IL4- -. cDNA GE Array@ was analyzed by
a chemiluminescent method of detection.


NOD.B10O.HZh


NOD.B;10-HZh.IL4 --













































L 1I1II


Table 3-1 Signaling Transduction Gene SuperArray


JAK-STAT6 Signaling Pathway
Down Regulated Up Regulated
CBP SOCS2(Cish)
IL-3R
EGFR
Fcgrl
IFNuR1
IFN y
IL-10Ra
IL-10RO
CD25
IL-2 Rg
ISGF-3y
JAK1
Smad3
Smad4/DPC4
Progelatinase
Mpl
Oaslg
prolactin receptor
Alm
Saa3


Insulin Signaling Pathway
Down Regulated Up Regulated
AKT-2 ERCC1
B-raf Insr
Eif4e Nck1
G6pd2 PI3Kp85a
Gab1 Prkel
GSK3 Ptpn1
Kras2 PAl-1
ERK2 Srebfl
Pk3 Tgn
Retn
Ucp2
































____


-CC CC






12~D
LO"n",r 6 $L~ t


C:19


IC r -nlll
B
-i
.'F
P I
:: ~LCrl"l i-; 1 ~" "I"
h r
Xi :" i P~ LtT ~I K
I

:j 'gl,
7'1 ~

2


""


20-
15


10


5
0


r~
o~
~cc\
L


Figure 3-10. Spleen IgM and IgG1 isotypic B lymphocyte populations in NOD.B10.H2b
and NOD.B 10-H2b IL4"- mice. (A) FACS dot plots of spleen IgG1 and IgM
isotypic B cells from NOD.B10.H2b and NOD.B 10-H2b.IL4 ~. (B)-(C)
FACS analysis of spleen IgG1 and IgM isotypic B cells from NOD.B10.H2b
and NOD.B 10-H2b IL4- -. Values are mean +SE of four animals per group. p
< 0.05 by unpaired t test.


D1 C1





Figure 3-11i. Detection of antinuclear antibodies in mouse serum from 20 weeks old
Balb/c, NOD.B10.H2b, NOD.14-'- and NOD.B 10-H2b.IL4"_- Sera were
diluted 1:50 in 1xPBS and reacted with HEp-2 cells. Preparations were
washed and then incubated with a FITC-conjugated goat anti mouse IgG
secondary antibody and visualized using a fluorescent microscope (100X).

































IgG


Balb/c


NOD.B10.H2b



NOD.B10-H2b.IL4~



NOD.IL4 '


L,


-- -


IgM


Figure3-12. FACS analysis of anti-M3R autoantibodies present in the sera of Balb/c,
NOD.B 10.H2b, NOD.B 10-H2b.IL4- and NOD.IL4- -. Sera isolated from
NOD.B 10.H2b, NOD.B10-H2b.IL4"-, NOD.IL4"- and Balb/c mice (n=5~6) at
4 (-) and 20 weeks of age(-) were preabsorbed with Flp-In CHO cells
and incubated with mM3R-transfected Flp-In CHO cells (5 x 10 ). Cells
stained with either FITC-conjugated goat anti-mouse IgG or FITC-conjugated
goat anti-mouse IgA, IgG1, IgG2a, IgG2b, IgG3, IgE, IgM and analyzed using
a FACScan cytometer.


:Lji it... !IL_1


.


Lk
~r i d


IgA IgE


1 i

i:L
-
-- -
.; ia~~
IgG2a IgG2b IgG3


IgG1








NOD.B10-H2b.IL4 ~
12wks


NOD.B10-H2b.IL4~
20wyks


C57BL/6
20wyks


NOD.B10.H2b
12wks


NOD.B10.H2b
20wks


Fig 3-13. Immunoflouresent staining of submandibular glands from NOD.B10.H2b and
NOD.B10-H2b.IL4"^ mice. Submandibular glands from 12 and 20 weeks old
NOD.B 10.H2b and NOD.B 10-H2b.IL4"- were incubated with rat anti-mouse
IgG1, IgG2a, IgG2b, IgG3, followed by goat anti-rat IgG FITC, and
visualized with a fluorescent microscope with a blue filter (200X).


I











I















CHAPTER 4
IL4: THE CONTROLLING ELEMENT FOR DEVELOPMENT OF CLINICAL DISEASE IN
MOUSE MODEL OF SJOGREN'S SYNDROME

Introduction

Autoimmune diseases are complex disorders characterized by inappropriate

adaptive immune responses directed against self-tissues. Lymphoproliferation and

hypergammaglobulinemia are two striking clinical manifestations of Sjoigren' s syndrome

(SjS). B cells in Sjoigren's syndrome are important contributors in the pathogenesis of

autoimmunity for their ability to produce autoantibodies. Numerous autoantibodies have

been detected in patients' serum. The loss of gland function has been achieved in normal

animals by passive transfer of serum IgG from either NOD mice or human Sj S patients,

an observation that led to the discovery that there is a critical dependence on

autoantibodies for the clinical symptoms of the disease to be manifested (Robinson et al.,

1998).

Recent developments on important cellular and signaling components involved in

B cell development and the maintenance of normal humoral immune responses provide

new insight into the role of B cells in autoimmune disease. Defects that alter B cell

longevity and alter thresholds for cellular activation could lead to autoantibody

production. Cytokines that are particularly important in B cell growth, differentiation, and

survival could allow autoreactive B cells to escape the screening for reactivity with

peripheral self-antigens resulting in apoptosis, receptor editing or energy. Signals

generated through the B cell antigen receptor (BCR) are also critical for B cell responses









to antigen. The BCR is a multiprotein complex containing an antigen-binding membrane

immunoglobulin (Ig) assembly of heavy and light chains, which are non-covalently

associated with the signal transduction elements Ig-alpha (CD79a) and Ig-beta (CD79b).

These phosphorylation events of the cytoplasmic domains of Ig alpha and beta facilitates

downstream signaling cascades that promote B cell activation (Benschop et al., 1999).

The characterization of NOD.B 10-H2b.IL4- has provided significant evidence to support

the critical role of IL4, a cytokine actively involved in cell activation, proliferation and

differentiation, in humoral immune responses and in the loss of secretary capacity

associated with autoimmune excrinopathy. My observations utilizing the NOD.B10-

H2b.IL4- mouse model indicated that the presence of autoimmune B cells capable of

making anti-M3R antibodies, except IgG1 isotype, persists in the absence of IL4. This

finding supports the hypothesis that 1L4 functions in autoimmune exocrinopathy as a

signaling molecule between immune cells, driving the expansion of clonal expansion and

production of pathogenic isotypic autoantibodies, as oppose to promoting B cell

lymphopoiesis and the survival of autoimmune B cell population through positive and

negative selection events in the first place.

In this study, I have attempted to further characterize our model of the NOD.B 10-

H2b.IL4- mouse by adoptively transferring splenic CD4+ T lymphocytes capable of

expressing 1L4 at time points corresponding to different disease stages. The goal has

been to dissect the critical stages) for possible IL4 involvement in the immunological

alterations taking place before the onset of clinical disease.









Materials and Methods

Animals. NOD.B 10-H2b.IL4"- mice (n=4/group) were bred and maintained under

specific pathogen free condition in the mouse facility at the University of Florida,

Gainesville, FL. NOD.B 10-H2b.@~ mice, generated from crossing parental strains

NOD.B10.H2b and NOD.B6-@~. Fl heterzygotes were inbreeded and F2 screened by

PCR of microsatelite MHC loci with D17-Mit21 MapPair primer set. @~ phenotype was

identified by observing under UV light.

Adoptive transfer. Spleens were collected from NOD.B 10-H2b.@~ at 4, 10 and

16 weeks of age. Single spleen cell suspensions were prepared as described before. Cell

populations were incubated with PE labeled CD4 antibody at a concentration of 1Clg/106.

CD4 GFP+ cells were sorted with FACS. 106 CellS (0.1Iml) were adoptively transferred

into sex- and age-matched NOD.B 10-H2b.IL4"^ mice (n=4/group) via tail vein inj sections

once a week for 2 weeks. Animals were then monitored for salivary secretary function,

and killed once they developed clinical disease, otherwise to 36 weeks old.

Measurement of salivary flow rates. To stimulate secretion of saliva, mice were

given an intraperitoneal inj section of 0.2mg/ml isoproterenol and 0.1Img/ml pilocarpine

dissolved in lx phosphate buffered saline. Saliva samples were collected from each

mouse for 10 min and their volumes measured.

Detection of intracellular IL4 from peripheral blood GFP+ lymphocytes after

adoptive transfer. Two weeks after adoptive transfer, peripheral blood lymphocytes

were isolated from 100 Cll whole heparinized blood by density gradient centrifugation

using Lympholyte-M as recommended by the manufacturer (Cedarlane, Ontario, Canada).

Cells were fixed and permeablized in 250 Cll Cytofix/CytopermTM solution (BD









Bioscience) for 10-20 min at 40C, followed by two washes with 1xPerm/WashTM

solutions (BD Bioscience). Fixed cells were then stained with PE labeled IL4 for 45

minutes at 40C. Data acquisition and analysis were performed with FACScan cytometer.

Detection of IgM and IgG1 isotypic B lymphocyte populations in the spleen

after adoptively transferring CD4+ T cells into NOD.B10-H2b.IL4-'- mice. Spleens

were gently minced on a steel sieve, and the resulting red blood cells were lysed by a 7

minutes' exposure to 0.83% NH4C1. Aliquotes of cell populations were suspended in

100Cl of FACS buffer with fluorescent labeled antibody at a concentration of lx 106/tube

for 45 minutes at 4 OC. Ten thousand events were counted per sample. Flow cytometric

analysis on IgG1, IgG2a, IgG2b, IgG3, IgM, IgA, and IgE were performed on a CD19

gate.

Immunofluoresent staining. Submandibular glands were surgically removed and

placed in O.C.T. Tissue Tek compound to make frozen blocks. All sections were cut at 5

Cpm thickness using an OTF cryostat and mounted on coated slides. Following brief

washing with PBS, sections were covered with 2.5%FBS/PBS block solution for 1 hour

and incubated with primary antibody (rat anti-mouse IgGl, G2a, G2b,G3, M) at 1:20

dilution for 1.5 hour in a humidity chamber. FITC conjugated oat anti-rat IgG at 1:20 was

applied for about 30 min following washing the slides with PBS 4 times. Sections were

washed and then mounted in Vectashield mounting medium (Vector Laboratory,

Burlingame, CA). Negative controls without primary antibodies were run with each

experiment. Slides were visualized under immunofluorescent microscope at x200

magnification.









Detection of anti-mM3R autoantibodies and its isotypes in NOD.B10-H2b.IL4~

/-recipients after adoptive transfer. Sera were collected from NOD.B 10-H2b.IL4"

recipients and stored at -80 oC for future experiments. 10Cl1 sera were pre-absorbed with

5x106 Flp-In CHO at room temperature for 2 hours. pcDNA5/FRT/V5-His mM3R-

transfected Flp-In CHO cells were collected from culture, washed once with phosphate-

buffered saline (PBS), and resuspended in FACS buffer (PBS, 2% ABS, 0.01%NaN3) at

a density of 1 x 105 cells/0. 1 ml. Aliquots of cells were incubated 2 hrs at 40C with 10 Cl1

sera from 20 weeks old NOD.B 10.H2b, NOD.B 10-H2b.IL4- mice or 20 weeks old

Balb/c. Cells were washed once with FACS buffer and stained with either FITC-

conjugated goat anti-mouse IgG or FITC-conjugated goat anti-mouse IgA, IgG1, IgG2a,

IgG2b, IgG3, IgE and IgM for 45 min at 4oC. After a final wash with FACS buffer, cells

were resuspended and analyzed using a FACScan cytometer (Becton Dickinson,

Mountain View, CA).

Results

Adoptive transfer of splenic CD4+ T lymphocytes of NOD.B10-H2b. Gfp to

NOD.B10-H2b.IL4-'- mice. Based on the study of NOD.B10-H2b.IL4"- mouse, IL4 is

essential for the initiation of secretary dysfunction. To further explore the influence of

IL4 on the disease course, splenic CD4' T lymphocytes capable of expressing 1L4 were

transferred into sex- and age-matched NOD.B10-H2b.IL4 mice at 4, 10, and 16 weeks

of age. To provide the same MHC loci necessary for intracellular communication

between T and B cells, NOD.B 10-H2b. @ were generated from crossing parental strains

NOD.B10.H2b and NOD.B6-@~. Gfp phenotype was identified under UV light. A set of

microsatellite marker D17mit21 was employed to confirm the inheritance of H2b alleles

(Data not presented). Once homozygosity was identified, brother sister mating was









carried out to establish the line. CD4 GFP' cells from NOD.B 10-H2b. @ mice were

isolated by FACS-sorting (Fig. 4-1) and transferred into age and sex matched NOD.B 10-

H2b.IL4"- recipients via i.v. inj section. Two weeks after transfer, IL4 production in the

GFP' donor cells was confirmed by intracellular staining with PE labeled anti-1L4 and

analyzed by FACScan. (Fig.4-2)

Salivary flow rates. NOD.B 10-H2b.IL4"- recipients were monitored for salivary

secretary function. Figure 4-3 shows the results of evaluation of salivary volumes

generated after chemical stimulation over a 10-minute period from each recipient group

at the indicated ages. NOD.B 10-H2b.IL4 "- mice that received NOD.B 10-H2b.@~ T

cells at 4 or 10 weeks of age exhibited a similar Sjoigren' s syndrome like loss of secretary

function by 20 weeks of age. By 26 weeks of age, these animals had saliva volumes

reflective ofNOD.B10.H2b. In contrast, recipients that received T cells at 16 weeks of

age failed to show significant loss of saliva secretion (Fig 4-3A,B) even if measured at

later time points.

Detection of spleen IgM and IgG1 isotypic B lymphocyte populations in the

recipients after adoptive transfer. The initiation of clinical disease in NOD.B 10.H2b

mice is accompanied by a proliferation of IgM and IgG1 isotypic B cells in the spleen

between 8 and 20 weeks of age. This does not occur in NOD.B 10-H2b.IL4- mice. To

further explore the critical time period of IL4 function, NOD.B10-H2b.@~ T cells,

capable of expressing IL4, were adoptively transferred into NOD.B 10-H2b.IL4"

recipients. As expected, after transfer, recipient NOD.B 10-H2b.IL4"- mice had elevated

level of IgM and IgG1 B cells. This level was comparable to that observed in

NOD.B10.H2b mice with onset of autoimmune disease. Interestingly, recipients









receiving the T cells at 16 weeks of age showed a less dramatic IgG1 proliferation than

those receiving at 4 and 10 weeks of age. (Fig 4-4A,B)

Immunoflouresent staining of antibody deposits. Staining of frozen sections of

submandibular glands from recipient NOD.B 10-H2b.IL4-' mice that received the T cells

at 4 and 10 weeks of age revealed the presence of although to a lesser extent compared to

that observed in NOD.B 10.H2b. Very few antibody deposits were found in NOD.B 10-

H2b.IL4- mice that received the T cells at 16 weeks of age, showing a staining pattern

comparable to untreated NOD.B 10-H2b.IL4"- mice (Fig 4-5).

Analysis of anti-M3R autoantibodies. As the loss of secretary function is largely

dependent on the production of autoantibodies, anti-M3R and its isotypic forms were

measured using Flow cytometric analysis. As shown in Figure 4-6, while NOD.B 10-

H2b.IL4"- fail to make any IgG1, and very few IgM isotypic anti-M3R antibodies. These

mice after receiving CD4+ T cells capable of 1L4 production exhibited substantial

production of IgM anti-M3R autoantibodies. However, the presence of IgG1 anti-M3R

antoantibodies was only observed in recipients that received T cells at 4 or 10 weeks of

age, not at 16 weeks of age (Figure 4-9).

Discussion and Conclusions

The humoral immune response has been well documented to drive the glandular

dysfunction in the NOD model of Sjoigren's syndrome. Transferring human Sj S patients

IgG fraction into NOD.Igpn"Ul mice provided evidence that autoantibodies produced by

the autoreactive B cells are the culprits driving the loss of secretary function (Robinson et

al., 1998b). The physiologic function of IL4 includes controlling the specificity of

immunoglobulin class switching and recruitment of mediators of cell growth and

resistance to apoptosis. Interestingly, studies in IL4 deficient mice showed the presence









of all isotypic classes of anti-M3R autoantibodies, with the exception of IgGl, suggesting

the possibility that the lack of 1L4 does not deplete autoimmune B cells, but that 1L4 may

be required for the production of a possible pathogenic isotype, which leads to loss of

secretary function, or promote the clonal expansion of this autoimmune B cell population.

To further explore the role of 1L4 in the development of exocrine dryness, T cells

capable of IL4 production were transferred to NOD.B 10-H2b.IL4- at 4, 10 and 16 weeks

of age, corresponding to pre-disease stage, active lymphocytic infiltration stage, and

exocrine dysfunction stage, respectively. The work presented here points to a critical

time for 1L4 to function in the development of autoimmune exocrinopathy: between 12

and 16 weeks of age, which corresponds with active lymphocytic infiltration into the

target tissue observed in Sj S-prone mouse lines.

Antigen specific B cells are characterized by surface expressing of

immunoglobulins and associated B cell receptor molecules. Activation of B cells require

antigenic signals from B cell receptors, as well as a second signal provided by a helper T

cell, for example CD40 expressed on B cell surface and CD40L on the helper T cell. T

helper cells involved in B cell activation are capable of making IL4. IL4 causes antigen to

stimulate naive T cells development into cells capable of producing 1L4 plus a series of

other cytokines including 1L5, 10 and 13 to promote B cell activation and differentiation

(Seder et al., 1992; Hsieh et al., 1992).

As previous studies documented, there is an increased expression of cytokines IL-

If, L-2, L-6, -10, -12, TNF-a, TGF-B and IFN-7I on the mRNA levels in the

submandibular and lacrimal glands at this stage (Sutcliffe et al., 1998; Yanagi et al., 1998;

Mustafa et al., 1998). Interestingly, IL4 was reported to be occasionally detected, often









associated with strong B cell accumulation in the glands (Ohyama et al., 1996). My data

also confirmed that proinflammatory cytokines peaked at 12 weeks of age and waned by

20 weeks of age in NOD.B 10.H2b submandibular glands; in addition, IL4 was detected

in the submandibular glands at 12 weeks old NOD.B10.H2b mice. Though only

transiently detected, the presence of L4 could significantly change the disease course.

Transferring T cells that produce IL4 into NOD.B 10-H2b.IL4-'- mice at 16 weeks

of age resulted only a marginal decline of secretary function and antibody production in

the recipients. These findings suggest, first, that 1L4 is critical for autoantigenic B cell

activation in a highly activated microenvironment, and second, that the presence of 1L4

also leads to the production of IgG1 isotypic anti-M3R antibodies, which appears to be

more pathogenic than other isotypes.

In summary, these results suggests that 1L4 may be less important as a growth

factor in the clonal expansion of autoimmune B cells at the early stage of development

than as an intracellular signaling molecule during development of the autoimmune attack.

In addition, the timing of 1L4 function seems critical; IL4 appears to function as a

cytokine directly involved in the disease process by promoting IgG1 B cell proliferation

and production of isotypic autoantibodies.






78






GFP"







CD4-PE

Figure 4-1. FACS analysis of CD4 GFP+ cell population before (left) and after (right)
sorting. Single spleen cell suspensions were incubated with PE labeled CD4
antibody at a concentration of 1Cpg/106. CD4 GFP+ cells were sorted with
FACS. FACS analysis showed CD4 GFP+ cell purity is greater than 90%.


















IL4-PE l




GF

Figur 4-2 FASaayi fitaellr1 n rnfre F el ek fe
adotiv trnse. Peihrlbodlm hctswr sltdfo






Figu trasfe Right 2AG weekssi oitaftelr adoptive transferred F+cls ek fe







































































Figure 4-3. Alterations in saliva volume in NOD.B 10-H2b.IL4-' after adoptive transfer
CD4 T cells from NOD.B 10-H2b. fp. (A) Temporal changes in saliva
volume in NOD.B 10-H2b.IL4"- after adoptive transfer CD4+ T cells from
NOD.B 10-H2b. fp. (n=4) (B) Saliva volume in NOD.B 10-H2b.IL4" after
adoptive transfer CD4+ T cells from NOD.B 10-H2b. fp. All values were
collected when clinical disease occurred or till 36 weeks of age.


10





6
5
4
-4-4 wks yroup
3 -C- 10 wks yroup
2 -A-- 16 wks yroup

1
0
4wks 10wks 16wks 20wks 26wks 30wks 36wks

Age




4

2

0


0


1
1


AT 4-26 AT 10-26 AT 16-36 NOD.B10.H2b 20wks NOD.B10-H2b.IL4 20wks










IgM / Splenocytes


40-








25
20


9;"" c~,~" b~\i'~ ~c~i
1 1 ?r


b~" ~rb 1~96
IC 1 1
s-^~^~d


NOD.B10-H2b.IL4~I NOD.B10.H2b

IgG1 / Spleno cyte s


12






6-


3-


0



NOD.B10-H2b.IL4 I


NOD.B10.H2b


39kbp~


Figure 4-4. FACS analysis of IgM and IgG1 isotypic spleen B lymphocyte populations
NOD.B 10-H2b.IL4" after adoptive transfer CD4+ cells from NOD.B 10-
H2b.Gfp.





AT 4-26


AT 10-26


AT 16-36


Figure 4-5. Immunofluorescent staining of isotypic antibodies in submandibular glands of
NOD.B 10.H2b.IL4- after adoptive transfer CD4+ T cells from NOD.B 10-
H2b.Gfp. All sections were stained with primary antibody (rat anti-mouse
IgG1, G2a, 2b, G3, A) at 1:20 dilution for 1.5 hour in a humidity chamber.
FITC conjugated oat anti-rat IgG at 1:20 was applied for about 30 min
following washing the slides with 1xPBS 4 times. Sections were washed and
then mounted in Vectashield mounting medium. Negative controls without
mary antibodies were run with each experiment. Slides were visualized under
immunofluorescent microscope at x200 magnification.


I


I


I


~sl
























C ~Ig IgG1 IGaIGb IG gg




(- wer preabsrbe w1ith 5x106 Fl-I CH n nuae it 0l
prebsrbd sra Cllswee ashdoc ihFC ufradsandwt
either ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ 1 FICcojgae goat ant-mus IgG or FICcnuaedgani


mueIgM, IgG1 IgG2a IgG2b, IgG3, IgA, IgE adaaye sn


Fiur 46.FACoca cytometer.caayi fat-3 uoniode nsr fNDB1-~.L















CHAPTER 5
EL-4 SIGNAL TRANSDUCTION PATHWAYS: DIFFERENTIAL EXPRESSION OF
THE STAT-6 PATHWAY IN SJS-LIKE DISEASE OF NOD MICE

Introduction

Over the past several years, a good correlation between Sjoigren's syndrome in

humans and autoimmune exocrinopathy in the NOD mouse has been established.

Accumulating evidence on congenic partner strains and cytokine knockout strains of the

NOD model, especially the NOD.B 10.H2b, NOD-scid, NOD.IgCL -, NOD.IFNy ~,

NOD.IL4"- and NOD.B10.H2b.IL4--, showed autoimmune excrinopathy develops in

multiple, independent and sequential phases. The first phase is characterized by

pathophysiologic and biochemical changes in the exocrine glands that includes delayed

organogenesis, aberrant protein expressions, proteolytic processing, and increased cell

apoptosis. A second phase is characterized by the appearance ofleukocytic infiltration in

the salivary and lacrimal glands, elevation of cytokine production, and the production of

autoantibodies. While aberrant physiological and biochemical process indicate glandular

abnormalities, it is the immune attack that precipitates secretary dysfunction of the

exocrine glands.

The presence of phase 1 physiological and biochemical abnormalities and the lack

of phase 2 immune attack and secretary dysfunction in NOD-scid and NOD.IgCL mouse

strains indicated the essential role of immune cells, especially B cells, in the pathogenesis

of autoimmune exocrinopathy, supporting these are two independent and apparently

sequencial phases in the disease process.









Studies from NOD.14-'- and NOD.B 10.H2b.IL4-' showed intact pathophysiologic

and biochemical changes followed by exacerbation of leukocytic infiltration in the

exocrine glands. However, no loss of secretary function in these mice suggest the

presence of 1L4 is required for the development of clinical disease, possibly by its ability

to induce the production of pathogenic autoantibodies.

Since IL4 can activate two distinct signal transduction pathways following IL4

receptor binding, the critical role of IL4 in autoimmune excrinopathy maybe to control

isotype switching in B lymphocytes by activating the STAT6 pathway, or to induce

autoimmune B cell clonal expansion and survival by activating the IRS pathway.

In this study, I have generated a new congenic mouse strain (still in construction)

NOD.B 10.H2b. C129S2-STAT6- -, in order to document its autoimmune phenotype. By

comparing this phenotype with NOD.B 10.H2b and NOD.B 10-H2b.IL4"- mouse, I should

be able to determine through which transduction pathway IL4 elicits its regulation of the

autoimmune response in the autoimmune excrinopathy of the NOD mouse model of

Sjoigren's syndrome.

Materials and Methods

Construction of the NOD.B10-H2b. C129S2-STAT6-'- mouse. One male C129S2-

STAT~tmlGm mouse was purchased from Jackson Laboratory. Construction of

NOD.B 10.H2b-C129S2. STAT6"- mouse was initiated by breeding a NOD.B 10.H2b

female to a C.129S2-STAT6tmlGru male mouse to obtain Fl generation. A Fl mouse was

then bred back to a NOD.B 10.H2b parental strain mouse to obtain BC1 generation.BC 1

mice were genotyped to identify a male mouse homozygous for H-2b and heterozygous

for the disrupted STA T6 gene. DNA was extracted from mouse tail using DNeasy Tissue









Kit (Qiagen Corp.) PCR was performed on the DNA isolated from BC1 generation

mouse. MapPair primers capable of differentiating between the H-2IAb and H-2IAd wr

ordered from Research Genetics (Invitrogen Corp). Primers capable of identifying the

STA T-6 gene and neo-gene disrupted STA T-6 gene were listed in Table 5-1. PCR was

performed as an initial dissociation of the genomic DNA by heating the reaction mix to

940C for 3 min, the reaction was carried out for 34 cycles with each cycle consisting of

940C for 1 min, a step-down of 640 610C for 1 min (i.e., a 0.30C step-down every 6

seconds) and 720C for 3 min. After 34 cycles the reaction was held at 720C for 10 min,

and then cooled to 40C until removed.

The male identified as being homozygous for H2b and heterozygous for the

disrupted STA T-6 gene was then bred to a NOD.B 10.H2b parental female mouse to

generate a BC2 generation. This BC2 generation was genotyped and selected a male

mouse homozygous for H-2b and heterozygous for the disrupted STA T-6 gene. With each

backcross, genetic material from the C129S2 mouse decrease by 50%. The 3rd BC

generation theoretically contains 93.75% genetic material from NOD.B10.H2b parental

strain. Preliminary study was conducted on inbreds of 3rd BC, which were genotyped as

NOD.B 10-H2b. C129S2-STAT6'", NOD.B 10-H2b.C 129S2-STAT6 -~, and NOD.B 10-

H2b.C129S2-STAT6"-

Measurement of salivary flow rates. To measure stimulated flow rates of saliva,

individual mice were given intraperitoneally a secretagogue cocktail of isoproterenol

(0.1mg/ml) plus pilocarpine (0.2mg/ml) dissolved in phosphate buffered saline (PBS).

Saliva samples were collected from each mouse for 10 min starting 1 min after injection.

The volume of each saliva sample was measured and adjusted to body weight. The saliva









samples were then frozen at -800C until analyzed for protein concentrations and

proteolytic activities.

Histology. Submandibular and lacrimal glands were surgically removed from

euthanized mice at 20 weeks of age. The tissues were fixed in 10% phosphate buffered

formalin for 24 hrs, embedded in paraffin, sectioned (5 CL / section) and stained with

Mayer' s hematoxylin and eosin (H/E) dye. Stained specimens were observed at 40X and

100X magnification.

Immunofluoresent staining of infiltrating lymphocytes. Mouse submandibular

tissue sections (5 Cpm) mounted on electroStatically treated slides were processed for

antigen retrieval, which included deparaffinization and rehydration. Briefly, paraffin

sections were dewaxed and re-hydrated by placing them in 2 changes of xylene for 5

minutes each, followed by 2 changes of ethanol for 2 minutes each, followed by briefly

wash in tap water. The slides were immersed in the Trilogy reagent and heated to 950C

for 30 min. For immunofluorescent staining of T and B cells, sections were incubated

with rabbit serum (1:67 diluted in PBS) for 1 hour. After a wash in PBS, the sections

were covered with goat anti mouse CD3 (1:10) and rat anti mouse CD45/B220 (1:10)

antibodies diluted in antibody diluting buffer (DAKO Cytomation, Carpinteria, CA) for 1

hour. Subsequently, slides were stained with FITC conjugated Rabbit anti Goat antibody

(1:25) for 1 hour followed by TexasRed labeled rabbit anti rat antibody (1:25) for another

hour with complete washes between and after staining. Sections mounted using

Vectashield Mounting Media with nuclear marker Dapi (Vector Laboratory, Burlingame,

CA), and analyzed by transmission or fluorescence microscopy.









Proteolysis of parotid secretary protein (PSP). 42Cl PSP oligopeptide (2.5mg/ml)

was incubated at 420C for 2 hrs with aliquotes of whole saliva (8 Cl1 ) collected from

individual mice. Controls consisted of 50Cl1 PSP oligopeptide. Following incubation, 50

Cl1 Tris-HCI buffer (50 mM, pH 8.0) was added and the mixture centrifuged through

Micro-spin filter tubes at 14,000 rpm for 10 min. The filtrates were analyzed by HPLC

(Dionex Systems) for the presence of cleavage products.

Antinuclear antibody (ANA). ANA was detected by indirect

immunofluorescence staining with Sigma Diagnostics Antinuclear Antibody Kits. Tested

sera were diluted 1:50 with PBS. 50 Cl1 diluted sera was added to separate wells for a 3

hours' incubation in a humidity chamber. After a brief rinse with PBS followed by 2 5

minutes' wash, FITC-conjuagated goat anti-mouse whole Ig at a 1:200 dilution was

applied to individual wells for 45 minutes. The slides were washed in 1xPBS, then

mounted and visualized on an immunofluorescent microscope at 100X magnification.

Detection of anti-mM3R autoantibodies and its isotypes in NOD.B10-H2b.

C129S2-STAT6 ", NOD.B10-H2b.C 129S2-STAT6 '-, and NOD.B10-H2b.C129S2-

STAT6-'-mouse. Sera were collected from and stored at -80 oC for future experiments.

10ul sera were pre-absorbed with 5x106 Flp-In CHO at room temperature for 2 hours.

pcDNA5/FRT/V5-His mM3R-transfected Flp-In CHO cells were collected from culture,

washed once with PBS, and resuspended in FACS buffer (PBS, 2% ABS, 0.01%/NaN3) at

a density of 1 x 105 cells/0. 1 ml. Aliquots of cells were incubated 2 hrs at 40C with 10 Cl1

sera from 20 weeks old NOD.B 10-H2b. C129 S2- STATG+/, NOD.B 10-H2b. C129 S2-

STAT6 -~, and NOD.B 10-H2b.C 129S2-STAT6"- mouse. Cells were washed once with

FACS buffer and stained with either FITC-conjugated goat anti-mouse IgG or FITC-