Transcriptional profiling on trees affected by citrus blight and identification of an etiological contrast potentially a...

University of Florida Institutional Repository




Copyright 2004 by Eduardo Fermino Carlos


This work is dedicated to my wife Darlen e, to my daughters Lusa and Lgia, to my parents Norival and Maria, to my aunt Josefa, and to all my friends and family that shared their love and care. Along the way, many things were surpassed and our dear aunt Neula, uncles Otvio and Waldemar, and friend Beatri z Nielsen will always be in our hearts.


ACKNOWLEDGMENTS I thank my family and friends for the unconditional support and encouragement during all the steps of the program. I thank CNPq, a Brazilian Federal Agency, for sponsoring most of my graduate studies abroad and for their overall attention with the fellows. I thank Dr. Gloria Moore, my major professor, for the outstanding support during the whole process. During my academic and professional life I have been fortunate to meet people that helped me not only as scientific mentors but also as examples of positive attitudes. I especially thank my friends Eliana Lemos, Luiz Carlos Donadio, Marcos Machado, Julia Beretta, Ken Derrick, Gene Albrigo, Steve Futch and Jos Eduardo Lima, among others. I also thank Dr. Chris Chase and Dr. Nancy Denslow for their intelligent insights and enthusiasm, which always brought positive perspectives about the ongoing work and essential source of stimulus. I thank Dr. Ken Cline for his suggestions and scientific argumentation. A regular student life normally requires patience, patience and dedication. Fifield Hall demanded the same efforts, and more. I thank all my friends that shared their care and friendships. I specially want to thank Gary Barthe, Mukaddes Kayim, Marty Dekkers, Abdul Al-Saadi, Basma El Yacoubi, Ufuk Koca, Karen Champ, Kim Niblett, Manjunath Keremane, Methap Sahin, Vicente Febres, Abeer Khalaf, Maureen Meyerson, Juliana and Gustavo Monge, Ricardo Harakava, Cristina Moreira, Dirceu Mattos, Maria Luisa Targon, Eduardo Stuchi, Otvio Sempionato, Jos Antonio da Silva, Aline and iv


Marcelo Carvalho, Georgia and Jos Carlos Dubeux, Lvia and Steel Vasconcelos, Jos Carlos Rodrigues, Juliana and Flavio Silvestre, Camila and L. Augusto de Paula, Ana Carolina and Vitor Lira, Carolina and Antonio Martins, Eliezer Martins, Maria de Lurdes Mendes, Marisol dAvila, Tania Querido, Nancy Velasquez, David Moraga, Li Liu, Bill Farmerie, Jason Blum, Natalia, Duy Nguyen, Patrick Larkin, Jannet Kocerha, Vishal Patel, Mike McCaffery, Carole Dabney-Smith, Fabien Garard, Richard Berger, Denise Tombolato, Fabricio Rodrigues, Gisele Martins, Angela and Wayne M. Jurick II, Adrianna Castaeda, Ronald French and many other friends. There is no end to this list... Thanks to all my friends. I started in the Department of Plant Pathology and I thank Dr. Bill Zettler and Dr. George Agrios for the attention and dedication that I received during the application process and as a new graduate student. v


TABLE OF CONTENTS page ACKNOWLEDGMENTS .................................................................................................iv LIST OF TABLES ...........................................................................................................viii LIST OF FIGURES ...........................................................................................................ix ABSTRACT .......................................................................................................................xi CHAPTER 1 INTRODUCTION........................................................................................................1 Importance of Citriculture............................................................................................1 Citrus in So Paulo and Florida....................................................................................3 2 IMPORTANCE OF CITRUS BLIGHT AND REASONS FOR ITS CONTROL.......5 Citrus Blight Etiology...................................................................................................6 Citrus Blight is Affected by the Employed Rootstock...............................................10 Objectives...................................................................................................................12 3 BUILDING THE CITRUS BLIGHT SUBTRACTED LIBRARIES........................13 Root Samples and cDNA Synthesis...........................................................................13 Building the Suppressive Subtracted cDNA Libraries................................................14 Sequence Analysis and Selection of Clones...............................................................17 4 IDENTIFICATION OF DIFFERENTIALLY TRANSCRIBED GENES UNDER NON AND CITRUS BLIGHT CONDITIONS...........................................20 Experimental Design..................................................................................................21 Array Design and Spot Features .................................................................................21 Sample Preparation and Labeling...............................................................................22 Hybridizations and Parameters...................................................................................24 Measurements and Specifications...............................................................................24 Normalization and Controls........................................................................................26 The Visual Evaluation of the Membranes..................................................................27 vi


The Cluster Analysis...................................................................................................29 The Contrast of Means Analysis.................................................................................31 Comparing the Evaluation Methods...........................................................................36 Combining the Results for the Selected Clones.........................................................36 5 THE RELATIVE TRANSCRIPTIONAL RESPONSES OF THE SELECTED GENES UNDER DIFFERENT INCIDENCES OF CITRUS BLIGHT....................43 Quantitative Real Time PCR was the Method of Choice...........................................43 The Selected Clones and the Characteristics of the Probes........................................45 Collecting and Preparing the Samples........................................................................49 Reverse Transcriptase (RT) and PCR Reactions........................................................50 Relative Quantification of the Transcriptional Levels of the Selected Genes............51 The Potential Biological Meaning of the Clone 109..................................................57 A Tentative Test to Verify the Effect of Cold and Drought Stresses.........................58 The Potential Effect of Redundancy and Gene Families............................................61 6 IDENTIFICATION OF AN ETIOLOGICAL CONTRAST POTENTIALLY ASSOCIATED WITH THE CITRUS BLIGHT DISEASE.......................................63 The First Screening of the Subtracted Libraries.........................................................64 Other CTV Genes were also Found in both Subtracted Libraries..............................68 Quantitative Evaluation of the P27 Candidate Gene in the Blighted Trees...............68 7 CONCLUSIONS........................................................................................................71 APPENDIX: B LAST ANALYSIS BASED ON NUCLEOTIDE SEQUENCES ...........................73 LIST OF REFERENCES...................................................................................................84 BIOGRAPHICAL SKETCH.............................................................................................91 vii


LIST OF TABLES Table page 4-1. Transcriptional pattern of the selected clones. ..........................................................37 4-2. Blast search analysis for some clones. .......................................................................38 5-1. Characteristics of the chosen probes. ........................................................................47 6-1. The clone E8-13 had homolog sequences matching different isolates of the citrus tristeza virus (CTV)........................................................................................66 6-2. Other sequences with homology to CTV genes found in the blighted minus healthy (B-H) and healthy minus blighted (H-B) subtracted libraries.....................68 A-1. Blast analysis based on nucleotide sequences of each individual clone....................73 viii


LIST OF FIGURES Figure page 1-1. Citrus around the world................................................................................................2 1-2. The citrus belts in Florida and So Paulo.....................................................................3 2-1. Characteristics and symptoms of citrus blight..............................................................7 2-2. Transmission of citrus blight........................................................................................9 3-1. cDNA synthesis enriching for mRNA........................................................................15 3-2. Making the subtracted healthy and blighted libraries..........................................16 3-3. Analyses performed for each sequenced clone...........................................................18 4-1. Preparing individual clones for the cDNA array. ......................................................22 4-2. Array design. .............................................................................................................23 4-3. Quality parameter for each membrane. .....................................................................26 4-4. Visual evaluation of the membrane pairs. .................................................................28 4-5. Transcriptional profiling of the candidate genes. ......................................................30 4-6. Contrast of means analysis of selected clones............................................................35 4-7. Blast-X of the clone 6 using the non-redundant protein database..............................37 4-8. Clone 38 has sequence homology to citrus chitinases. ..............................................39 4-9. Transcriptional profiling of the clone 38 (a chitinase homolog) and other clones.......................................................................................................................40 4-10. The clone 109 had sequence homology to citrus ESTs. ..........................................41 5-1. Designing a candidate sequence for the P5 gene. ......................................................46 5-2. Relative PCR efficiency plot of the clone 109 against the normalizer 18S...............48 ix


5-3. Examples of real time PCR reactions. .......................................................................52 5-4. Relative transcriptional levels of the selected genes. ................................................54 5-5. Contrasts comparing the effect of cold and drought treatments on the relative transcriptional level of the clone 109 and other clones. ..........................................60 6-1. The virtual northern blot of the B H clones. ...........................................................65 6-2. The transcripts of the p27 candidate gene were abundant in the roots.......................69 x


Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy TRANSCRIPTIONAL PROFILING ON TREES AFFECTED BY CITRUS BLIGHT AND IDENTIFICATION OF AN ETIOLOGICAL CONTRAST POTENTIALLY ASSOCIATED WITH THE DISEASE By Eduardo Fermino Carlos August 2004 Chair: Dr. Gloria A. Moore Cochair: Dr. Kenneth S. Derrick Major Department: Plant Molecular and Cellular Biology Citrus blight is an important citrus disease in Florida (USA) and So Paulo (Brazil), primarily affecting yield in adult plants and compromising maintenance of entire commercial blocks. Blight is associated with rootstock choice, but, at present, is of unknown etiology. Therefore, the objectives of this study were to identify differentially transcribed genes and uncover etiological contrasts under non and citrus blight conditions. Roots of healthy and blighted Rough lemon (Citrus jambhiri Lush) rootstock supporting Valencia sweet orange (Citrus sinensis L. Osbeck cv. Valencia) canopy were collected from a central Florida area. Total RNA was obtained and RT-PCR was performed enriching for messenger transcripts. Subtracted cDNA libraries were created and around 140 clones were arrayed onto nylon membranes. Independent RNA sources from feeder roots of ten healthy and ten blighted trees were labeled with P33, hybridized overnight with the membranes and analyzed under an imager system. Selected clones xi


were validated by RT quantitative real time PCR. The results indicated that citrus blight was able to affect the transcriptional levels of certain genes in a similar pattern among different replicates. The level of response was dependent of the assessed group of plants. One of the clones had sequence similarities to a citrus EST and to a potential ubiquitin subunit. Another one had similarities to a citrus chitinase, helping to deduce a candidate sequence for the blight associated P5 gene. Three genes had higher transcriptional levels under blight condition and did not respond to cold and drought stresses. The blight associated P12 had higher levels in mildly than in fully blighted trees. Further characterization of these genes may contribute to the understanding and control of citrus blight. In another experiment, citrus tristeza virus (CTV) genes were observed in the libraries. The transcriptional level of the P27 gene (divergent coat protein gene) of CTV was far more abundant in roots of blighted than in healthy Carrizo citrange, which is considered to be resistant to variant forms of CTVs. It remains to be investigated if CTV causes or enhances blight, or only grows better in feeder roots of already affected trees. xii


CHAPTER 1 INTRODUCTION The importance of one industry in the agriculture segment and the context where science exists to help society were considered in this study. The result was a true excitement not only because the focus of this research is (still) an unresolved real problem of citrus, but also because the search for information involved molecular biology and related fields. Importance of Citriculture In addition to tasting good, citrus is a well known source of vitamin C and antioxidants. It is also believed to have anti-cancer properties (Rafter, 2002), and processed peel and pulp are frequently used for animal feed (Fegeros et al., 1995). Because of its nutritional relevance, citrus is an important industry world-wide, raising economies at macro and local levels by supporting social development directly with jobs and with secondary industries and services. Citrus is commercially present in more than a hundred countries in all five continents, primarily within tropical and subtropical regions. The total production has consistently increased in the last 40 years, and, more recently, reached one hundred million tons yearly (Figure 1-1). The early citrus pioneers would probably be astonished by this level of production, but the modern industry has through the years achieved efficiency, flexibility and high quality standards. Citrus was first brought to the new world by the Portuguese and Spanish explorers at the beginning of the XVI century (Moreira, 1980; Allen, 2000). By the second half of the XIX century, the USA and Brazil had established fresh fruit companies, and the 1


2 frozen concentrated technology, developed in the 1940s in Florida (Lewandowski, 2000), increased the demand for citrus juices. A) Total production of citrus from 1961 to 2000 020406080100120616570758085909500YearsMillions of tons Brazil USA China Spain Others B) 102 million tons of citrus were produced in 2003 18%13%12%6%6%4%4%3%3%2%2%2%2%2%1%1%1%1%14% Brazil United States of America China Mexico Spain India Iran, Islamic Rep of Nigeria Italy Egypt Argentina Turkey Pakistan South Africa Japan Greece Morocco Thailand Others Figure 1-1. Citrus around the world. A) The total production of citrus has increased almost 5 fold in the last 40 years. Brazil took the lead in production over the USA only after the Florida freezes during the 1980s. B) Citrus is commercially present in 138 countries according to FAO, with China, Mexico and Spain ranking respectively 3 rd 4 th and 5 th in total production in 2003. (Source: FAOSTAT data, 2004, http://apps.fao.org last accessed April 07, 2004). Many changes in production systems have been necessary to meet the ongoing needs of growing markets and the demands of new challenges, such as changes in organoleptical concerns, unexpected drought and cold stresses, outbreaks of pests and diseases and raises of political barriers, to name just a few. Consequently, production constraints have been overcome by the use of grafted plants to replace seedlings, changes in rootstocks, selection of new cultivars, relocation of production fields and charges in diplomatic battles (Fawcett and Lee, 1926; Moreira, 1980; and others). Literature is available for all transitions suggesting that the need for research in citriculture is not a


3 recent event. In fact, despite frequent new challenges, in the last decades citrus has surpassed other important fruit crops such as bananas, apples and grapes in production according to FAO (Source: FAOSTAT data, 2004, http://apps.fao.org last accessed April 07, 2004). Citrus in So Paulo and Florida The two major citrus producing areas in Brazil and the USA are the states of So Paulo and Florida (Figure 1-2). A) Florida B) So Paulo N Figure 1-2. The citrus belts in Florida and So Paulo. A) The industry in Florida has moved to warmer southern areas after the freezes of the 1980s, and the major producers are nowadays Polk and Hendry counties, respectively, in the central and southwestern regions. B) In So Paulo, the northern region is drier and warmer than the southeastern areas and the major citrus companies have their headquarters around Araraquara city. Supported by good environmental conditions, efficient systems and high quality products, both Florida and So Paulo have industries primarily devoted to processed citrus juice, especially oranges, supplying most of the world demand for this commodity.


4 While Florida has focused its efforts on the North America market, So Paulo dominates the European one. The social and economic consequences of abrupt changes in the citrus industry of both So Paulo and Florida would affect, at least to a certain extent, the around 400,000 jobs and 3 billion dollars in exports yearly in Brazil, and the 89,000 jobs and 4 billion dollars in sales in the United States. More details and other statistics can be seen at ABECITRUS (Source: http://www.abecitrus.com.br last accessed April 07, 2004), FUNDECITRUS (Source: http://www.fundecitrus.com.br last accessed April 07, 2004), CREC (Source: http://www.lal.ufl.edu last accessed April 07, 2004), and USDA (Source: http://www.nass.usda.gov/fl last accessed April 07, 2004). Both socially and economically, there are similarities and also differences in citrus industries worldwide. However, all contribute to supply different markets with distinguished quality fruits: citrus fruits. Therefore, citrus is an important segment of agriculture and demanding of research, which, ultimately, may help in the stabilization of society.


CHAPTER 2 IMPORTANCE OF CITRUS BLIGHT AND REASONS FOR ITS CONTROL There are many constraints to citrus production around the world and citrus blight, in Portuguese declnio, is one of them. It has caused impressive annual losses of around 60 million dollars in So Paulo and 100 million dollars in Florida (Derrick and Timmer, 2000). Since its appearance in Florida during the second half of the 1800s, it has been a top concern for the Florida citrus industry, probably only approached by the damage caused by freezes in the past. Swingle and Webber mentioned that blight was first reported by Underwood in 1891, and also, that affected trees had been seen two decades earlier (Swingle and Webber, 1896). Symptomatic plants undergo a slow tree decline, rather than a sudden disruption in development, as suggested by the given name in English. Citrus blight has distinct characteristics not observed in declines caused by other diseases, such as Phytophthora sp., Tristeza, and others. Early symptoms, which occur in mature productive trees normally older than five to six years, include loss of the intense color of leaves and other green tissues; the expression of specific proteins (Bausher, 1990; Derrick et al., 1990; Taylor et al., 1996; Paiva et al., 1997); and complexation and translocation of zinc from leaves to trunk bark tissues (Albrigo and Young, 1980);(Taylor et al., 2002). Affected plants have their xylem vessels gradually blocked by amorphous and filamentous particles (Cohen et al., 1983), which probably leads to the visual symptoms of overall decline: smaller tree size, twig die back, smaller yield and fruit size and general mineral unbalance (with the clear pattern for zinc deficiency on leaves). 5


6 Major physiological changes also occur (Albrigo et al., 1986), such as off season flowering, longer flowering periods and shooting of sprouts inside of the canopy, as if the affected plant was attempting to keep its vital functions (under normal levels). It is common to have less water uptake into the trunk of the affected plants due to xylem blockage (Cohen, 1974; Lee et al., 1984). Affected plants rarely die but are often pushed out and replaced by a young tree. Thus, not only direct losses because of tree failure and replacement, but other costs in grove management are always incurred. Reset groves pose serious difficulties in horticultural maintenance programs, since they now have trees of different ages, sizes and possibly on different rootstocks, all with different needs. They have also increased the risk of other diseases that can be spread on the new young trees. The Figure 2-1 displays the described progress of citrus blight often seen in Florida and in So Paulo groves. In addition to the noted annual losses, a simple and dramatic way to see the impact of citrus blight is by just driving through the citrus areas in Florida and So Paulo and paying attention to symptomatic trees and reset groves. Citrus blight also occurs in many other countries (Wutscher et al., 1980), except those with Mediterranean and desert climates where it has not yet been reported. Citrus Blight Etiology Citrus blight is an unresolved problem and its origin and etiology are still matters of debate. Several characteristics of a plant disease, meaning the outcome between a host and a pathogen under a proper environment, are present in affected trees, except the presence of a confirmed pathogen. However, it is worthy to note that (Agrios, 1997)


7 Figure 2-1. Characteristics and symptoms of citrus blight. A) Zinc deficiency on leaves. B) Water uptake test into the trunk of the affected plant. C) Xylem blockage. D) Overall plant decline. E) Off season flowering. F) A reset grove has trees with different ages and needs.


8 defines plant disease as: .whenever the ability of the cells of a plant or plant part to carry out one or more of these essential functions is interfered with by either a pathogenic microorganism or an adverse environmental factor, the activities of the cells are disrupted, altered, or inhibited, the cells malfunction or die, and the plant become diseased. Thus, this study considers blight as a plant disease of citrus. In addition, the process seems to be infectious in nature (Timmer et al., 1992), since transmission by root grafting was achieved in experiments done in the USA (Tucker et al., 1984), in South Africa (Marais and Lee, 1990) and in Brazil (Rossetti et al., 1991). However, the etiology remains unconfirmed and transmission has not occurred by either grafting canopy branches (Albrigo et al., 1993), by bud grafting, or by soil replacement (Timmer and Graham, 1992). Figure 2-2 summarizes the experimental transmission of citrus blight obtained by root but not by canopy grafting. Citrus blight is also present in mature seedling trees, eliminating the possibility of scion/rootstock incompatibility as a cause. The pattern of spreading seems to be towards adjacent trees in the same planted row, rather than across rows, as often noted by farmers and also by (Swingle and Webber, 1896), who first raised the hypothesis of infectious spreading pattern. Over time, the progression of the disease seems not epidemic, following a pattern of incidence that can be described by a linear model, which is closer to abiotic abnormalities (Berger, 1998). (Swingle and Webber, 1896) recommended eradication of affected trees, fearing further spread of the problem. That was not implemented. Since then, candidates for causal agent and other theories have been examined, such as a non-parasitic origin (Rhoads, 1936), the initial transmission trials


9 Figure 2-2. Transmission of citrus blight. A) Layout of the work done by (Albrigo et al., 1993), where the receptor trees that were root grafted to blighted trees displayed symptoms 6 years after that, while no limb grafted plant displayed symptoms during the same period; B) Receptor trees used by (Rossetti et al., 1991) showing symptoms of blight after the root grafting work done in Brazil, confirming that blight is transmitted by roots as first demonstrated by (Tucker et al., 1984).


10 (Cohen, 1968), soil born candidate pathogens (Nemec, 1994), the vascular limited bacterium Xylella fastidiosa (Hopkins, 1987), nutritional related factors (Wutscher and Hardesty, 1979), and others, but all remain unconfirmed (Derrick and Timmer, 2000). Citrus Blight is Affected by the Employed Rootstock Resistance to citrus blight is dependent upon rootstock choice, and even though rootstock replacement has been a necessity for decades, the overall solution for citrus blight has not yet been achieved. Resistance to citrus blight is apparently less common than initially thought (Young et al., 1982). Rough lemon (Citrus jambhiri Lush), having excellent yield and drought tolerance but susceptible to citrus blight, was once the major rootstock in central Florida. Extensive plantings on this rootstock in the 1940s, replacing sour orange (Citrus aurantium L.), was probably the reason blight has ranked as one of the most common citrus diseases in the state since then. Volkamer Lemon (Citrus volkameriana Ten. and Pasq.) was another rootstock option in the past for similar reasons. However, replacement of both with other rootstocks more resistant to citrus blight contributed to major changes in citriculture, since the replacements were normally less vigorous and sustained lower yields (Young et al., 1982). Among other consequences were increases in grove maintenance needs such as more attention to grove fertilization, to tree density per area, to other disease susceptibility, and to increases in irrigation, which ultimately contributed to the urbanist concerns in water usage in Florida (Callies, 2000). In Florida, replacement of Rough lemon (Citrus jambhiri Lush) by Carrizo citrange (Citrus sinensis L. Osb. x Poncirus trifoliata L. Raf.) was not as effective as anticipated because Carrizo proved to be almost as susceptible to blight as Rough lemon (Young et al., 1982). Sour orange (Citrus aurantium L.) never matched Rough lemon yield in


11 central Florida, and it also succumbs to citrus tristeza virus. Cleopatra mandarin (Citrus reticulata Blanco) yields fruit later than Rough lemon and when in full production the fruit is smaller and the yield lower, primarily when supporting sweet orange and grapefruit cultivars. Sweet orange (Citrus sinensis L. Osbeck) and Sunki tangerine (Citrus sunki L.) are considered more resistant to citrus blight, but are not widely used because of high susceptibility to gummosis of Phytophthora sp. and also to drought. Swingle citrumelo (Citrus paradisi Macf. x Poncirus trifoliata L. Raf.), largely used nowadays, will probably be of restricted use in the near future because some groves on this rootstock have become affected by citrus blight. In So Paulo, rootstock replacement is also an unresolved issue, with no obvious alternative to Rangpur lime (Citrus limonia Osbeck), another rootstock susceptible to citrus blight, and more recently to citrus sudden death disease. Able to grow on non-irrigated areas, on soils with high aluminum, and in low input production systems, Rangpur lime is still the rootstock of choice in more than 80% of groves in the So Paulo area, despite citrus blight losses (Pompeu JR., 2001). Thus, groves that normally would last naturally for 50 years or more are being replaced within 10 to 15 years, or less. The consequence is a fast and expensive turnover of trees for big companies and the end of business for medium and small farmers. Just the return on investment in citrus normally takes 8 to 9 years after planting. Therefore in all aspects examined, citrus blight is an important concern for citrus industries, wherever it happens. The complexity and importance of citrus blight demands broad inter-institutional scientific cooperation on efforts to examine its etiology and gain insights into what causes the plant to block its own xylem and decline, what is transmitted from plant to plant (and why only by roots), how the plant responds and what


12 is changed in the metabolism of the affected plant, why young non-bearing plants are normally not affected, and more. But these are overwhelming questions. The present study, more conservatively, seeks to uncover molecular and etiological contrasts between healthy and blighted trees. Objectives The major objectives of this study were to identify differentially transcribed genes under non and citrus blight conditions and contribute to its understanding and control, which is the long term goal of the citrus blight research at this institution. The specific objectives were to build subtracted cDNA libraries from root samples of non and blighted trees. to identify differentially transcribed genes using cDNA arrays. to obtain quantitative information about the transcriptional level of the selected genes using reverse transcriptase real time PCR. to evaluate the presence of potential causal agents found in the subtracted libraries.


CHAPTER 3 BUILDING THE CITRUS BLIGHT SUBTRACTED LIBRARIES For research on citrus blight, several promising technologies were considered. Genome wide approaches and microarrays have offered great perspectives in several biological systems, but sequence information is limited for citrus. Thus, cDNA subtractive hybridization (Diatchenko et al., 1996) was undertaken, with the objective to obtain enriched cDNA libraries for each considered condition: healthy and blighted plants. Subtracted libraries can uncover genes up or down regulated under a specific condition, thus being a useful source of candidate clones for further studies. Similar approaches taken with rice (Xiong et al., 2001) and soybean (Colebatch et al., 2002) encourage such efforts, because genes differentially regulated under disease pressure and protein synthesis responses were identified. Root Samples and cDNA Synthesis Since blight dissemination is associated with the root system (Timmer et al., 1992) and morphological changes are seen in the roots of affected plants (Lindbeck and Brlansky, 1998), molecular responses are also expected to happen; therefore, root tissues were chosen for subsequent procedures. Superficial roots of Rough lemon (Citrus jambhiri Lush) rootstock supporting Valencia sweet orange (Citrus sinensis L. Osbeck cv. Valencia) canopy were collected and total RNA was extracted the same day from feeder root tissues using Qiagen RNeasy protocol, with DNase digestion (Source: http://www1.qiagen.com last accessed July 15, 2001). It was done during the summer of 2001. Rough lemon was chosen because of its known susceptibility to citrus blight. 13


14 Feeder roots, also called fibrous roots, of around 2 to 4 mm in diameter, were chosen because they display xylem plugging and internal anatomic differences in affected trees compared with healthy ones (Lindbeck and Brlansky, 2000), similar to what happens in canopy tissues, suggesting that molecular contrasts may also be present. Samples were taken from healthy and fully blighted trees previously diagnosed by typical visual symptoms, by the water uptake test (Lee et al., 1984), and by the P12 based immunoassays on leaf tissues (Derrick et al., 1990). The chosen trees were in a 10-year-old block in the Lake Alfred area, Florida (USA). Reverse transcriptase (RT) polymerase chain reaction (PCR) was performed and cDNA was synthesized using Clontech procedures, enriching for messenger RNA transcripts (Source: http://www.bdbiosciences.com/clontech/ last accessed September 15, 2001). An experiment was performed to determine the number of PCR cycles necessary to normalize the cDNA synthesis of both samples (Figure 3-1). Building the Suppressive Subtracted cDNA Libraries The healthy and blighted cDNA samples were digested with Rsa I restriction enzyme to remove the Clontech Smart oligos at the terminal ends of the amplified cDNAs, generating blunt ends. After purification, different Clontech adaptors (1 and 2R) were ligated to split sets of cut healthy and blighted cDNAs. Healthy cDNAs ligated to each adaptor were hybridized with an excess adaptor-free blighted cDNA and with each other. The same procedure was done with blighted cDNA samples and PCRs were performed in both cases, enriching for differentially transcribed genes under each condition, following the Clontech PCR-Select cDNA subtraction procedures (Source:


15 A B Figure 3-1. cDNA synthesis enriching for mRNA. A) Scheme of cDNA synthesis following the Clontech Smart cDNA procedures (Source: http://www.bdbiosciences.com/clontech/ last accessed April, 15, 2004). The 3-PolyT-oligo-5 binds to the poly-A tail of the mRNA and the final extension of the 1st cDNA strand leaves an overhang of Cs, which is bound by the 5-oligo-GGG-3. After template switching both ends are filled by polymerization of the complementary strands, and PCR starts, using the primer extension sites present at both oligos. B) Different cycles of PCR were performed on each sample to achieve tentative uniform cDNA accumulation before reaching the plateau of the reaction, following the manufacturer recommendations. Healthy samples were considered optimized at the 17th cycle, while for blighted ones, 23 cycles were run. http://www.bdbiosciences.com/clontech/ last accessed September 15, 2001). After PCR, only molecules with different adaptors were exponentially amplified, in theory, while others could only have linear amplifications or impaired products due to hairpin structures. This technique was developed by Diatchenko et al. (1996). Thus, subtracted healthy minus blighted (H B) and blighted minus healthy (B H) libraries were generated, in contrast to unsubtracted ones ( H and B) and controls ( + and ), Figure 3-2. PCR Cycles 15 18 21 24 15 18 21 24 Healthy Blighted 17 cycles 23 cycles


16 A B Figure 3-2. Making the subtracted healthy and blighted libraries. A) Scheme of cDNA subtractive hybridizations following Diatchenko et al. (1996). Two sets of the same cDNA (called tester) are ligated to different adaptors and hybridized with in excess adaptor free cDNA (called driver) and with each other. PCR was performed in both cases, enriching for differentially expressed genes in both directions (called forward and reverse libraries). B) The same procedure was done with blighted and healthy cDNA samples. Thus, subtracted Healthy minus Blighted (H B) and Blighted minus Healthy (B H) libraries were generated, in contrast to unsubtracted ones ( H and B) and controls ( + and ). H-B B-H + B H Health y Blighted= Healthy__Adaptor 1 Healthy__ Adaptor 2R Blighted PCR ( H B ) In theory, Healthy only BBlliigghhtteeddHHeeaalltthhy y == BBlliigghhtteedd____AAddaappttoorr 11 BBlliigghhtteedd____ AAddaappttoorr 22RR HHeeaalltthhyy PPCCRR (( BB HH )) IInn tthheeoorryy,, BBlliigghhtteedd oonnllyy


17 The differentially enriched cDNAs, (H B) and (B H), were cloned following the Promega protocol for the pGMTeasy vector (Source: http://www.promega.com/vectors/ last accessed on September 15, 2001) and around 500 clones were randomly selected for sequencing from both libraries (400 from the B-H library and 100 from the H-B library). Sequence Analysis and Selection of Clones The obtained sequences were trimmed of vector and adaptor sequences used for cloning until no more matches were found using the VecScreen search software (Source: http://www.ncbi.nlm.nih.gov/VecScreen/ last accessed April 10, 2002). The sequences were run in the automated system of the University of Florida sequencing core (Source: http://www.biotech.ufl.edu/ last accessed April, 15, 2003) but the Clontech adaptors were not hidden in many cases, requiring manual trimming to avoid contamination of vector sequences. To reduce redundancy of clones that may represent the same gene, the sequences were analyzed using all available Genebank sequences (all-sequences and non-human non-mouse ESTs) and the Brazilian Citrus-EST project as reference sequences for Blast searches (Altschul et al., 1997). With all sequences individually grouped by similar blasted match outcomes, further clusterization and alignment assemblies were made using the Vector NTI software assisted by Microsoft Office applications and other web-based tools (Source: http://searchlauncher.bcm.tmc.edu/seq-util/seq-util.html last accessed April, 10, 2003). The Figure 3-3 displays examples of the four steps performed for trimming and clustering all the 500 individual sequences. After that, the longest clone within the homolog group was the one considered for further studies.


18 A) >CitrusBlight-K5R2-E09.g folder=CitrusBlight length=672 XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXGAATTCACTAGTGATTAGCGTGGTCGCGGCCGAGGTACAAGATTGTTCACTGTCCTTCCGTTTGCGAATCCTGTGTATCTTTATGCAATGATGTTGGGGTTTCTAACGATCATGCTCGACGTTTGGCTCTCACTAATGGGCGCGCGCTTGCTGTTGTTCTAGTCCCTGGTAACGAGAGATCAGCCTCATGTGCGTCTTGAATGCCCTTGTATCATTACTCTAAATAATGGATCGGGCTAGCTCCTTGACGCTTATAACATAAACAAAAATGTCATTGCTAGCTAGCCTGTGTACCTGCCCGGGCGGCCGCTCGAAATCGAATTCCCGCGGCCXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX B) Match to Vector: Strong Moderate Weak C) clone bp Database Highest match description e-values 152 250 All Genebank 1,367,736 sequences >gi|19747177|gb|AC113414.2| Homo sapiens chromosome 5 clone RP11-541P9, complete sequence 1.2 Brazilian citrus CCSM ESTs 13,610 clusterized sequences CXContig831 3e-92 ESTs Genebank non-human non-mouse 4,893,238 sequences 1 gb|BM376262.2|BM376262 EBma01_SQ002_N11_R maternal, 4 DPA, no tr... 80 1e-12 1e-12 D) LEA,Z46824,EST,FASTA,599: 1 632 k1-25,: 69 481 K5-F9,: 83 352 K5-G5,: 83 352 (complementary) K5-C10,: 83 352 k1-5,: 84 361 (complementary) 1 50 100 150 200 250 300 350 400 450 500 550 600 262 bp, 1e-60 270 bp, 1e-127 270 bp, 1e-129 270 bp, 1e-129 400 bp, 2e-90 Citrus EST Reference, 599 bp Figure 3-3. Analyses performed for each sequenced clone. A) Looking for vector sequences, such as the Clontech adaptors highlighted in blue and red letters, after the sequences had been masked by the sequencing core system as Xs. B) VecScreen analysis were run for all available clones, confirming in many cases the need of further trimming. C) Blast-N analysis in 3 databases. Many clones had only poor matches in the Genbank search, but had good sequence homology in the citrus and in the non-human-non-mouse EST databases. D) Alignment of the homolog clones against a reference sequence. The green plot, underneath the bars representing the clones, reflects the sequence variability per region.


19 This step was an intensive computational effort aimed at reducing potential future nonspecific variation from different clones that, in reality, might be representing a transcriptional pattern of only one gene. The average length of the selected clones reached 240 base pairs. Then, it was possible to narrow down all sequences to around 140 tentative unique clones. The Table A-1 in the appendix contains information about these clones and displays the tentative functions and other characteristics based on blast analysis of homolog sequences. It is worthy to note that several clones had high matches with different genes of citrus tristeza virus.


CHAPTER 4 IDENTIFICATION OF DIFFERENTIALLY TRANSCRIBED GENES UNDER NON AND CITRUS BLIGHT CONDITIONS In order to evaluate the transcriptional pattern of the genes represented by the clones selected from the subtracted libraries, a cDNA array experiment was assembled and run. The major objective was to compare those clones under non and citrus blight conditions. The DNA array technology has been used in plants with success. There are examples studying defense reactions (Scheideler et al., 2002), stress responses (Rizhsky et al., 2002), and others. Reviews can also be seen at Seki et al. (2003) and at Donson et al. (2002). However, in general, one arduous step in DNA array technologies is to compare information between different experiments (Stoeckert et al., 2002). With a similar concern, Brazma et al. (2001) proposed the MIAME protocol, which stands for Minimum Information About Microarray Experiment. The intrinsic principles of the MIAME apply primarily to define the information that should always be included in microarray repository databases, allowing other researchers to understand the experiment and the data. The ultimate goal of the MIAME protocol is to establish a standard for recording and reporting microarray data based on detailed annotation of six experimental sections: 1) experimental design; 2) array design and spot features; 3) sample preparation and labeling; 4) hybridizations and parameters; 5) measurements and specifications; and 6) normalization and controls. The MIAME protocol does not specify the format in which the information should be provided, but only its content. In the present cDNA array 20


21 study, much more modest than the commercially available microarrays, those guidelines were observed attempting to induce uniform experimental conditions and effective ways to analyze the data. Annotations during all experimental steps were recorded and are summarized below. Experimental Design The tentative non-redundant clones from the subtracted libraries, (H B) and (B H), described at the appendix A, plus ribosomal clones and other tentative controls, were standardized at the same concentration (160ng/ul) after PCR and purification steps. That was possible because all the clones had the same flanking sequences at the Clontech 1 and 2R adaptor regions. Figure 4-1 displays the initial PCR efforts for some of the clones used in this study. Most of the PCR products were in the range from 200 to 400 bp, and some clones had to be amplified more than once to achieve the standards above. Array Design and Spot Features The clones were uniformly arrayed on nylon membranes, by printing duplicated sets of each using the robot printer of the ICBR-UF (Interdisciplinary Center for Biotechnology Research of the University of Florida). Each membrane contained 188 double spotted probes ready for further quantitative assays (Figure 4-2). The description of each clone is given in the appendix. For positional landmarking, ribosomal genes were used. They were clones with sequence homology to a citrus ribosomal gene, Accession X05910.1. Controls for quality evaluations included detection of water spots for background assessments, plasmid with GFP for nonspecific hybridizations and aerial plant stress related genes, such as the cold responsive gene CORc115 (panel G12, spot 180), for variation determinations. Membranes were UV-cross linked and stored at around 6 o C.


22 12 3 456 7 8 LW 9 10 11 12 ABEF1 2 3 4 5 6 7 8 LW 9 10 11 1212 3 4 5 6 7 8 LW 9 10 11 12CDGH (-) (-) 1 2 3 4 56 78 910 11 12 1 2 34 5 67 8 9 10 11 12 12 345 6789 10 11 12 12 3 4 5 6 7 8 LW 9 10 11 12 1 234 5 678 LW 9 10 11 12LW (bp)----2000----1200----800----400----200----100 Figure 4-1. Preparing individual clones for the cDNA array. Selected clones were amplified by PCR from the subtractred libraries and prepared to be arrayed on nylon membranes (LW for low DNA mass ladder from Invitrogen; (-) for no-template control). Sample Preparation and Labeling The membranes were hybridized with independent healthy and blighted RNA sources. Total RNA samples were extracted under the same conditions from feeder roots from adult groves of Valencia sweet orange (Citrus sinensis L. Osbeck cv. Valencia) on Rough lemon (Citrus jambhiri Lush), Carrizo citrange (Citrus sinensis L. Osb. x Poncirus trifoliata L. Raf.), and Swingle citrumelo (Citrus paradisi Macf. x Poncirus trifoliata L. Raf.) rootstocks from the central Florida region, using Qiagen RNeasy procedures with DNase treatment. Plants had been previously diagnosed using the visual


23 188 187186185 LM H2O LM LM969594939291908988878685H 180 179 178 177 176 175 174 173 172 17117016984838281807978777675 LM H2OG168167166165164163162161160159158157 LM LM70696867666564636261F156155154153152151150149148147146145605958575655545352515049E144143142141140139138137136135134133484746454443424140393837D132131130 LM H2O LM LM125124123122121363534333231302928272625C120119118117116115114113112111110109242322212019181716151413B108107106105104103102101100999897 12 11 10 9 8 765 LM H2O LM LMA121110987654321Clones ABCDEFGH GFP GFP Figure 4-2. Array design. Colored spots indicate different types of clones or controls: pink (LM) for landmark positing; blue (H2O) for water controls; yellow (spots 7 to 12) for probes from citrus leaf tissue; orange (spots 171 to 180) for probes from stress related genes; and green (GFP) for hybridization control. Those controls accounted for thirty four spots. Other spots were printed with clones from the subtracted libraries of citrus root tissue. Seventeen clones were from the H B library (spots 5 and 6; from 53 to 63; and from 67 to 70). All the remaining one hundred and fifty four clones were from the B H library. identification of typical symptoms in the canopy and the water injection test in the trunk (Lee et al., 1984). All samples were uniformly handled, using tissues from pairs of healthy and fully blighted trees of the same genotype, grown under the same condition and from the same grove. Some membranes were used to determine the best amount of RNA, type of primer for RT (reverse transcriptase) reaction, and RNA sources, comparing total versus messenger RNAs. After optimizations, samples with 2ug of total RNA had the 1 st strand cDNA labeled with dATP33 using random primers following procedures similar to that of the Ambion Strip-EZ kit (Source: http://www.ambion.com/


24 last accessed Octpber 10, 2003). The RT efficiency was evaluated by counting the scintillation of the labeled samples. Hybridizations and Parameters All membranes were exposed to the same amount of labeled probe, based on the scintillation reading of one million counts/minute/ml of buffer. The samples were hybridized overnight at 64 o C with individual membranes, washed, and analyzed under the Typhoon Phosphoscreen Imager System (Source: http://www.amershambiosciences.com last accessed April 15, 2004), always uniformly manipulated in pairs of healthy and blighted samples to allow further pairwise comparisons. The employed imager system evaluates the fluorescence of each spot represented on the screen. Changes of the oxi-reductive status of a screen component, made by crystals of barium (Ba), fluorine (F), bromine (Br) and europium (Eu), are induced by the radiation of the samples after overnight exposure. Then, a laser beam from the reader induces excitation and subsequent fluorescence of each spot represented on the screen, proportionally to the initial radiation emitted from the labeled sample. The image of each membrane was captured by the scanner and the quantitative information was obtained using the software ImageQuant (Source: http://www.amershambiosciences.com last accessed April 15, 2004). All membranes were treated as uniformly as possible to minimize other sources of variation in the subsequent analyses. Measurements and Specifications The membranes were framed and had the image contrast optimized for better visualization using the ImageQuant, Microsoft PhotoEditor and PowerPoint softwares. The quantitative information of each clone was then evaluated. The parameter for quality


25 of each membrane was verified looking at the ratio (Ratio) between the averaged absolute values, intensity of the fluorescence per pixel in the screen, of all the genes (AveGene) represented by the clones, over the average of all the water spots (AveH2O), used as negative controls for the hybridizations, and therefore considered as background or noise, as Ratio = AveGene / AveH2O Seventy-one membranes were printed and run. The expected true ratio was calculated to be within the confidence interval of 2.33 and 3.27, for p < 0.01. Therefore, individual membranes with a ratio smaller than the low limit of 2.33 were considered inappropriate for analysis and were discarded. One membrane that had nonspecific hybridization, measured by the spots with GFP genes, was also discarded. Forty unbiased membranes passed those criteria and were saved. Among those, twenty individual membranes represented ten pairs of uniformly manipulated healthy and blighted sampled trees. Each pair of samples was collected at the same day, from the same grove, and had their RNA extracted, labeled and hybridized under the same conditions, as uniformly as possible. Thus, membranes of any considered pair of healthy and blighted samples displayed an averaged absolute value (intensity/pixel) for all clones similar to the other membrane, in most of the cases, and both were respectively higher than their background and nonspecific hybridization controls by at least 2.33 fold. Root samples from trees on Carrizo were used on the pairs made by the membranes 1x2, 5x6, 67x54 and 65x66.


26 From Lemon, on the pairs 9x10 and 61x58. From Swingle, on the pairs 29x30, 31x34, 51x52 and 69x70 (Figure 4-3). 024612566754656691061582930313451526970Cutoff AveGene/AveH2O 2.33 Ratiomembranes Carrizo Lemon Swingle Figure 4-3. Quality parameter for each membrane. The unitless ratio represents the proportion between the averaged absolute value for all clones (AveGene) in the membrane over the averaged absolute reading for the background level (AveH2O) of the same membrane. Membranes with a ratio smaller than 2.33 were discarded. Normalization and Controls The readings of the duplicated spots for each clone were averaged. All water spots (AveH2O), previously calculated for each membrane, were used to subtract the background from each clone (C). Negative values implied that the reading of the clone was smaller than the background value. Those values were discarded. Then, each clone was normalized (n) against the new mean of the clones (MeClone) in the membrane, rather than against one or two genes, such as a ribosomal or other ones, as follows: n = [ ( C AveH2O ) / MeClone ] 100


27 The normalization method should reflect similar results comparing to the visual evaluation of the studied membranes. The mean of the clones was used in this study because it met this criteria better than other measures of central tendency, such as the median of the numbers. Normalization against a measure of variance, using the standard deviation, was also tried but no improvements were observed either. Besides the visual evaluation of the membranes, two other types of analyses were performed. To study the relative levels of transcription of the same clone comparing healthy and blighted samples from uniform conditions, cluster analysis was done. To study the variance of each clone, contrast of means analysis was done. The Visual Evaluation of the Membranes The tentative visual differences for each clone were highlighted in each framed membrane. This procedure helped to identify clones not previously seen under the initial visual evaluations. The three evaluated genotypes (a lemon, a citrange and a citrumelo) displayed differences across the species. But looking at one rootstock per time, some visual differences between healthy and blighted samples were also seen (Figure 4-4). Under the citrus blight condition, Carrizo citrange displayed stronger signal for the genes represented by the clones on the panels B1 (clone 109), C1 (clone 25), D4 (clone 136), F1 (clone 157), G7 (clone 79), and maybe others. Lemon had differences on the panels C1 (clone 25), C10 (clone 34), G7 (clone 79) and G8 (clone 80). Swingle had differences mainly on the panel C1 (clone 25). Very few clones displayed more signal on the healthy than on blighted samples: the panel A6 (clone 6) shows a tentative candidate of that on Carrizo and the panels E8 (clone 152) and E9 (clone 153) on Lemon.


28 A) Carrizo roots healthy tree 1-15 blighted tree 1-11 B) Lemon roots healthy tree 3-11 blighted tree 6-9C) Swingle roots healthy tree H8R blighted tree B7R Figure 4-4. Visual evaluation of the membrane pairs. Membranes were hybridized with samples labeled with P33, using feeder roots of Valencia tree on different rootstocks. A) on Carrizo citrange (Citrus sinensis L. Osb. x Poncirus trifoliata L. Raf.). B) on Rough lemon (Citrus jambhiri Lush). C) on Swingle citrumelo (Citrus paradisi Macf. x Poncirus trifoliata L. Raf.). Each panel has two clones horizontally replicated. Red arrows represent potential more signal on blighted samples. Blue arrows, on healthy samples. Green arrows, near identical. Blue circles represent spots filled only with water, for background control. Green circles, with GFP, for non-specific hybridization control. Black circles, with CORc115, for observations of a strees related gene.


29 Nearly unchanged genes were seen in all samples and the panels D9 (clone 141) and E5 (clone 149) represent examples of those, in all three rootstocks. The Figure 4-4 shows one pair of membranes for each rootsctock. The Cluster Analysis The transcriptional levels of the normalized Healthy (nH) and Blighted (nB) samples were compared following the Log2 function, to allow equidistant visualization of the fold (F) induction or repression for each gene, as: F = Log2 [ (nB+0.01) / (nH+0.01) ] Gaasterland and Bekiranov (2000) describe two major types of analysis, the supervised and the unsupervised approach. In the supervised analysis, a particular context of each measurement is known and the end result is a list of individual genes behaving differently in each of the different contexts. In this study, the supervised model was accepted and the null hypothesis considered no differences in the transcriptional levels of the candidate gene under healthy and blighted conditions. Then, the cluster analysis and the graphic visualization for each clone was done employing respectively the Cluster and the TreeView softwares (Eisen et al., 1998). The Cluster software works on a random assignment of vectors for similarities found within the numbers. Subsequent new layers of vectors allow further clusterization of all samples. To test the significance of the differences, t-Tests were employed. Induced and repressed candidate clones were nominated, after analyzing the outcome of the ten independent pairs of healthy and blighted trees (Figure 4-5).


30 GroupsIVIVIII II< -1 -0.75-0.5-0.25000.250.50.75> 1A) Cluster analysisB) Selected clones spring 03summer 02winter 03spring 03Clone t-Test p<0.307p<0.014p<0.156p<0.089p<0.368p<0.005p<0.832p<0.617p<0.269p<0.153p<0.450p<0.580p<0.007 Membrane pairs Figure 4-5. Transcriptional profiling of the candidate genes. A) Outcome of the ten pairs of trees under healthy and blighted conditions, being four pairs on Carrizo citrange, two on Rough Lemon and four on Swingle citrumelo rootstock. Each spot represented the ratio of the normalized blighted (nB) over the healthy (nH) sample given by Log2[(nB+0.01)/(nH+0.01). Green indicates negative ratio (more healthy than blighted) and red positive ratio (more blighted than healthy). B) Visualization of the individual clones and their p values for the t-Test, with the significant ones (p<0.05) being highlighted with a nearby star.


31 After the cluster analysis, all membranes were visually re-evaluated. Clones that had p<0.05 from the group I, mostly upregulated candidates under the citrus blight condition, were located again. This process helped to spot differences not previously seen in the membranes. Similar approach was taken for the clones of the groups II, III and IV, mostly downregulated candidates under the citrus blight condition. However, it is possible that, for these clones, a more sensitive detection method would be more effective, because few visual differences were re-confirmed. The nearly unchanged genes of the group V, displayed the expected clones 141 and 149. Albeit small, the clone 141 did have a significant variation, with p<0.007, leaving the clone 149 alone as a candidate for an unchanged gene under citrus blight condition. These ten paired samples were collected and run from July of 2002 to May of 2003. Closer patterns can be observed comparing the Carrizo and Swingle samples from the summer of 2002 and the spring of 2003. However, more replicates would be needed to better study the real contribution of the season of the year on the studied model. The Contrast of Means Analysis Although the previous analysis is powerful for initial screening, it brings a natural chance of error by selecting potential false positives, since a clone with initial reading value (C) that approaches the background level (W) will generate a normalized number (nH or nB) that approaches zero, complicating any further conclusions for the pairwise or cluster analyses. On the other hand, simply discarding those clones may penalize the final outcome by leaving behind clones that may be indeed positives. Thus, besides exercising caution on apparently extremely induced or repressed clones, those were the reasons to perform the contrast of means analysis. For that, each clone was assessed individually


32 within each uniform pair of plants (healthy and blighted), from the same rootstock type and from the same block of trees, as previously described. The assumed model for variance in this case implies that the variance of a clone (x) is a function of its averaged value (^x), plus the contribution of the membrane (M), plus the contribution of the uncontrolled residual factors (e), as x = ^x + M + e Other assumptions for the model above were also considered, as having additive factors, normal distribution of the data, independence between treatments and homocedasticity-also called uniformity of variance (Banzatto and Kronka, 1992). Additive contributions of each factor can be explained by the assumed model itself, since the outcome of each clone was the sum of those factors. Normality was only partially observed because the data aggregated around the mean, for the most part, but not perfectly. Independence of treatments in this biological system could not be fully accepted because that implies that the genes assessed by each clone operate independently from each other. Since metabolic pathways are complexes and regulated by counterpart genes, this is probably not true in this system either. Homocedasticity was not verified and the data was checked for transformation options, such as, RootSquare, Log and other functions. The smallest discrepancy in variances was obtained using the Log transformation of the previous normalized data (n), giving to each clone its final value (V), as


33 V = Log2 (n + 1.5) The normalization for the contrast of means was similar to the initial normalization for the cluster analysis (nH and nB) previously described, except for considering individual values of all spots and adding the value 1.5 to avoid zeros in the computation. Once the transformation was observed, t-Test was employed on the established contrast of means, where the estimate of the healthy mean (Hm) and the estimate of the blighted mean (Bm) generated the estimate of the contrast (^Y) for each clone, as ^Y = Hm Bm Then, the relation between the absolute value for the estimate of the contrast (^Y) and its standard error, which is a function of the number of replicates (rH or rB) and the standard deviations (sH or sB) for healthy and blighted samples, gives the t-Test value (t) for each clone (Banzatto and Kronka, 1992). Subsequent comparisons against standard t-values determined at which level of probability (p) the null hypothesis, claiming no difference in the transcriptional level of the studied clone, can be accepted or rejected, in favor of the alternative hypothesis, claiming significant differences between healthy and blighted transcriptional levels for each clone. Some of the clones were variable but not at a level considered significant (t-Test) for this cDNA array system (p<0.05). However, other clones displayed significant


34 response to citrus blight, suggesting that citrus blight is apparently able to affect the transcriptional level of certain genes in affected plants (Figure 4-6). In plants with citrus blight, the clone 6 was significantly downregulated (p<0.05) in three out of the ten pairs of evaluated trees. However, it was also significantly upregulated twice, implying in a great non-specific variation. The clone 25 was significantly upregulated (p<0.05) only in two studied pairs, but displayed higher averaged values on blighted samples in nine pairs of plants, and a strong significant difference on the pair 51x52. The clone 38 was significantly upregulated in two pairs of plants. It also had a higher averaged transcriptional value in three other pairs of plants. The clone 109 was significantly upregulated (p<0.05) in three out of the ten pairs, and had other three higher averaged values on blighted than on healthy samples. The clone 149 was nearly unchanged, however it had one significant difference (p<0.05) comparing the affected and the healthy plants on the pair 9x10. The clone 153 was significantly downregulated (p<0.05) in only two paired samples, but had higher averaged values on healthy than on blighted samples in other five pairs. The clone 157 had a higher averaged transcriptional level on affected than on healthy plants, but a large variance too, being significantly downregulated (p<0.05) in one pair of plants.


35 02468Cz1x2Cz5x6Cz65x66Cz67x54Le61x58Le9x10Sw29x30Sw31x34Sw51x52Sw69x70AveH2OAveClone healthy blightedClone 6 02468Cz1x2Cz5x6Cz65x66Cz67x54Le61x58Le9x10Sw29x30Sw31x34Sw51x52Sw69x70AveH2OAveClone 02468Cz1x2Cz5x6Cz65x66Cz67x54Le61x58Le9x10Sw29x30Sw31x34Sw51x52Sw69x70AveH2OAveCloneClone 109 02468Cz1x2Cz5x6Cz65x66Cz67x54Le61x58Le9x10Sw29x30Sw31x34Sw51x52Sw69x70AveH2OAveCloneClone 149 02468Cz1x2Cz5x6CZ65x66CZ67x54Le61x58Le9x10Sw29x30Sw31x34Sw51x52Sw69x70AveH2OAveCloneClone 153 02468Cz1x2Cz5x6Cz65x66Cz67x54Le61x58Le9x10Sw29x30Sw31x34Sw51x52Sw69x70AveH2OAveCloneClone 157Clone 6Clone 25 Carrizo Lemon Swingle p<0.013p<0.015p<0.004 p<0.010 p<0.019 p<0.010 p<0.000p<0.057 p<0.124p<0.095p<0.009p<0.068p<0.071p<0.001p<0.038p<0.009p<0.083p<0.000p<0.006p<0.129p<0.035p<0.063p<0.001 02468 Clone 38p<0.021p<0.000 Log2(n+1.5) Figure 4-6. Contrast of means analysis of selected clones. Pairs of healthy (blue columns) and blighted (purple columns) trees on Carrizo (Cz), Lemon (Le) and Swingle (Sw). The p value represents the significance of the t-Test, helping in the decision of rejecting or accepting the null hypothesis. The blue stars indicate significant differences when p<0.05. The bars are the standard deviation of each studied condition: healthy or blighted samples.


36 Comparing the Evaluation Methods All three methods used to evaluate the transcriptional pattern of the genes represented by the clones displayed positive and negative aspects. The visual evaluation of the membranes required neither normalization nor computation and it was good for the major differences, besides confirming, or not, the results of the quantitative analysis. However it did not allow an easy identification of all the candidate clones in the first attempts. The cluster analysis was good for combining all clones from the available samples under the pairwise based approach. Inferences about the averaged fold induction, or repression, and about the aggregation group of each gene could be estimated. But not all quantitative information matched the visual evaluation of the membranes. The contrast of means was positive to reveal the significance of the differences within each pair of trees. It represented an unfolded view of the cluster analysis replicates. However, since the data was transformed, further inferences on the relative transcriptional levels within each pair of plants were no longer precise. Combining the Results for the Selected Clones Several clones displayed either visual or quantitative differences between the evaluated samples. The Table 4-1 displays the summarized results for those selected clones. Among the clones that displayed some differences in the cDNA array experiment, the clone 6 is from the healthy minus blighted (H-B) enriched library and displayed mostly lower transcriptional levels under the citrus blight condition. It is 325 bases long and has sequence homology (Table 4-2) with an Arabidopsis thaliana EST (e-value of


37 Table 4-1. Transcriptional pattern of the selected clones. Observations from the three different types of analysis, comparing healthy (H) and blighted (B) samples. Clone (library) Visual differences Cluster analysis (averaged Log2*; p-value) Contrast of means analysis (number of significant differences, for p<0.05) 6 (H-B) H > B -0.46; p<0.153 3 (H > B) and 2 (H < B) 25 (B-H) H < B +1.82; p<0.156 2 (H < B) 38 (B-H) rare +2.44; p<0.089 2 (H < B) 109 (B-H) H < B + 3.12; p<0.014 3 (H < B) 149 (B-H) H ~ B +0.05; p<0.580 1 (H > B) 153 (B-H) H > B -3.13; p<0.005 2 (H > B) 157 (B-H) H < B +1.13; p<0.307 1 (H > B) and 1 (H < B) Log2 stands for Log2[(nB+0.01)/(nH+0.01)] 1e-180) in the Genbank and with a citrus EST (7e-11) in the Brazilian databank. It has an unknown function based on the translated query (Figure 4-7) to the protein databank (4e-30) and a high nucleotide homology to a mitochondrial sequence (1e-180), raising the question whether the clone 6 represents an open reading frame (ORF) of a gene or not. Figure 4-7. Blast-X of the clone 6 using the non-redundant protein database. Sequence of an environmental protein Accession EAI39113.1 (subject), with unknown function, had similarities (4e-30) to the translated version of the clone 6 (query). But because of its variance (Figure 4-6), the clone 6 is considered to represent a false positive outcome, not representing a true downregulated gene under the citrus blight condition.


38 The Table 4-2 displays the accession numbers of the first match on the blast search analysis, using different databases, for the selected clones. Table 4-2. Blast search analysis for some clones. The search for homolog sequences was done using different databases. Clones e-values Highest match on sequence search analysis 6 1e -180 7e -11 4e -30 1e -180 Arabidopsis thaliana EST, Accession CF653082 Citrus EST, CCSM, Brazil, Contig 204 unknown protein, environmental sequence, Accession EAI39113.1 Arabidopsis thaliana mitochondrial genome, part A, Accession Y08501.1 25 1e -91 Citrus EST, CCSM, Brazil, Contig 416 38 8e -88 1e -88 3e -95 Citrus chitinase class II, Accession Z70032.1 Citrus chitinase class I, Accession AB081944.1 Citrus EST, CCSM, Brazil, Contig 1434 109 9e -56 9e -44 (2e -65 )* Citrus EST, Accession CK935651 Citrus EST, Accession CB293790 Arabidopsis thaliana, ubiquitin ligase SCF complex subunit, Accession NP568603.1 149 2e -54 Citrus EST, CCSM, Brazil, Contig CXJE02 153 Poor sequence information 157 Poor matches in the searched databases e-value of the citrus EST Accession CK935651 translated query on the protein databank The clone 25 is from the blighted minus healthy (B-H) enriched library and displayed higher transcriptional levels under the citrus blight condition in some of the tested pairs of plants. It is 300 bases long and has sequence homology with a citrus EST (1e-91) in the Brazilian databank, but only poor matches in Genbank. It also had a strong visual difference on the membranes of Swingle (panel C1, figure 4-4C). That difference was significant (p<0.05) in one out of the four tested pairs of plants on Swingle (Figure 4-6). However, considering all rootstocks, the overall transcriptional fold induction under the blight condition was around three and a half times, Log2[(nB+0.01)/(nH+0.01)=1.82, but with a poor p value of only 0.156 (Table 4-1 and Figure 4-5B). It is possible that the


39 clone 25 represents a true upregulated gene under the citrus blight condition, but with higher transcriptional responses in Swingle citrumelo. The clone 38 is from the B-H library and is 235 base pairs long. It represents a citrus chitinase gene (Figure 4-8). Chitinase-I: 1 935 Clone38: 681 906 (complementary) 1 100 200 300 400 500 600 700 800 900 Chitinase-II: 1 1082 Clone38: 586 811 (complementary) 1 500 1000 A)B) e-value = 1e-88 e-value = 8e-88(Accession Z70032.1) (Accession AB081944.1) Figure 4-8. Clone 38 has sequence homology to citrus chitinases. Blast-N showed high similarities to (A) a class II chitinase; and to (B) a class I chitinase. The clone 38 had a transcriptional fold induction under the blight condition of around five times, Log2[(nB+0.01)/(nH+0.01)=2.44 (Table 4-1); but a strong visual difference within the membranes was not seen (panel D2, Figure 4-4A). Looking at the


40 contrast of means (Figure 4-6), two pairs of trees displayed significantly (p<0.05) more transcripts of the gene represented by the clone 38 in blighted than in healthy trees. However, five pairs of trees responded only at a very low level, close to the background (AveH2O). It is possible that the clone 38 represents a responsive gene to citrus blight, but had poor printing on the membrane surfaces for those five abnormal readings. To test that hypothesis, a new series of membranes were printed and run. The figure 4-9 displays the results. 74-H76-B78-H80-BRibosomal LEA Others Chitinase Rep. 1Rep.2 Figure 4-9. Transcriptional profiling of the clone 38 (a chitinase homolog) and other clones. The membranes were manipulated and hybridized under similar conditions, using 5ug of total RNA labeled with P33, from feeder roots samples of a healthy (H) and a blighted (B) tree on Carrizo citrange. The process was repeated twice (rep.1 and 2) generating four membranes. The quantitative difference for the chitinase homolog clone, comparing the healthy and blighted samples (t-Test), was significant (p<0.01). Therefore, the clone 38 is considered to represent a true upregulated gene under the citrus blight condition. The clone 109 is also from the B-H enriched library and displayed mostly higher transcriptional levels under the citrus blight condition. It is 176 bases long and has sequence homology with citrus ESTs in the Genbank using the non-mouse and non


41 human entry (Figure 4-10), but only poor direct matches as a translated query on the protein databank. CB293790,: 1 753 CK935651,: 78 828 CLONE109,: 662 847 (complementary) 1 50 100 150 200 250 300 350 400 450 500 550 600 650 700 750 800 e-value=9e-56 e-value=9e-44 Figure 4-10. The clone 109 had sequence homology to citrus ESTs. The citrus EST Accession CK935651 was obtained from a library using citrus fruit developing tissues. The CB293790, from a library using citrus cold acclimated tissues. However, blasting the longer citrus EST homolog (Accession CK935651) as a translated query gives a high match (2e-65) with an E3 ubiquitin ligase SCF complex subunit SKP1/ASK1 (At2)/UFO-binding protein (UIP2) of Arabidopsis thaliana (Accession NP568603.1). The clone 109 had visual differences in the membranes (panel B1, Figure 4-4A); had an averaged transcriptional fold induction of around eight times, Log2[(nB+0.01)/(nH+0.01)] =3.12, with p<0.014 (Table 4-1 and Figure 4-5B); and it was significantly upregulated in three out of the ten studied pairs of samples. Therefore, the clone 109 is considered to represent a true upregulated gene under the citrus blight condition. The clone 149 is 144 bases long and has only poor matches in Genbank either as a nucleotide query or as a translated query, but it has a good match with a citrus EST (2e-54) in the Brazilian databank. It is from the B-H enriched library. The clone 149 probably


42 represents an unchanged gene under the citrus blight condition, considering the three methods used to evaluate its transcriptional pattern. The clone 153 is from the B-H enriched library, but probably represents a true downregulated gene under the citrus blight condition. It displayed visual differences in the membranes (panel E9, Figure 4-4B); significant differences in the cluster analysis with p<0.005 (Figure 4-5B); and two significant differences in the contrast of mean analysis (Table 4-1 and Figure 4-6). However, the sequence information available was poor, with low phred-quality parameter. It was re-sequenced twice with no further improvements. The clone 157 is 195 bases long but had no good match in all three searched databases. Because of its variance (Figure 4-6), it is considered to be another false positive outcome, not representing a true upregulated gene under the citrus blight condition.


CHAPTER 5 THE RELATIVE TRANSCRIPTIONAL RESPONSES OF THE SELECTED GENES UNDER DIFFERENT INCIDENCES OF CITRUS BLIGHT The process of building cDNA arrays is marked by many steps that go from the collection of samples to make the libraries until the manipulation of the membranes. As a consequence, the final data can carry cumulative sources of nonspecific variation, which may compress or hide legitimate up or down regulated genes under study. With that concern, Chuaqui et al. (2002) stated that researchers must be aware whether the results in microarray based experiments are accurate and the data fundamentally describe the phenomenon being investigated. In addition to employing replicates as used in this study, Chuaqui et al. (2002) considers the need of a validation process. Therefore, an independent RNA assessment method was used to confirm, or not, the transcriptional level of the previously identified genes under non and citrus blight conditions. The effect of cold and drought stresses was also tested. Quantitative Real Time PCR was the Method of Choice Among the available methods, quantitative real time PCR was the method of choice, because of its sensitivity and reliability. It has been used under different platforms and for different purposes, such as confirmation of microarray data in human cancer research (van den Boom et al., 2003), and quantification of a citrus pathogen (Oliveira et al., 2002). It is based on the determination of a fluorescent signal produced during the PCR cycles, allowing the quantification of the amplified product at a real time and the subsequent estimation of its relative original template concentration (Mackay et al., 43


44 2002). According to Dorak (source: http://dorakmt.tripod.com/genetics/realtime.html last accessed on January 10, 2004), real time PCR is a preferable alternative to study transcription to other forms of reverse transcriptase (RT) PCR, which only detect the final amount of the amplified product. The chemistry employed in real time PCR detection system is the key to the process. There are two general methods for the quantification of the PCR product: the DNA binding reagents (i.e. SYBR Green) and the fluorescent probes (i.e. TaqMan). Characteristics of each detection type and more details about the technique can be seen in Mackay et al. (2002). The TaqMan probe relies on the fluorescence resonance energy transfer (FRET) for quantification. TaqMan probes are oligonucleotides that contain a fluorescent dye, typically on the 5' base, and a quenching dye, typically located on the 3' base. When irradiated, the excited fluorescent dye transfers energy to the nearby quenching dye molecule rather than fluorescing, resulting in a nonfluorescent substrate. TaqMan probes are designed to hybridize to an internal region of a PCR product. During PCR, when the polymerase replicates a template on which a TaqMan probe is bound, the 5' exonuclease activity of the polymerase cleaves the probe. This separates the fluorescent and quenching dyes and FRET no longer occurs. Fluorescence increases in each cycle, proportional to the rate of probe cleavage. Normalization is done against an active internal control such as a ribosomal or other gene. Passive controls, compounds that do not participate in the PCR reaction, are used to adjust the reaction level and background. Other important parameter is the threshold cycle, or Ct, obtained by an arbitrary threshold line chosen within the linear phase of the PCR reaction, that gives the PCR cycle for that fluorescence value. The Ct values are


45 used to compare different PCR reactions, allowing the quantitative estimation of the initial target template. Compared to DNA dyes, the TaqMan method also has the benefit of producing an amplified target with longer sequence specificity, since it is the product of the hybridization of two primers plus a probe, in a total length that normally stays around 150 bases. Real time PCR using dyes (i.e. SYBER Green) relies only on the specificity of the primers. Considering the described characteristics, the TaqMan probe was the method of choice to validate (or not) the initial results of the cDNA array experiment. The Selected Clones and the Characteristics of the Probes The selected clones observed in the cDNA array were used in this experiment. The clones considered to represent up-regulated genes under the citrus blight condition were the clones 25, 38 and 109. The clone 149 appeared to be nearly unchanged. The clone 153 was considered to be down-regulated; however the sequence information for this clone was poor, even after re-sequencing. Thus, the clone 6 was included in this experiment as a candidate to represent a down-regulated gene under the citrus blight condition. Those clones were chosen because genes with altered transcriptional levels under the citrus blight condition can be valuable tools on further comprehensive experiments. Genes with unaltered patterns can be useful references for normalizations or for other biological needs as well. Based on sequence homology, the clone 38 represents a citrus chitinase gene (Table 4-2, chapter 4). Chitinases are known to respond to different forms of stresses, such as fungal pathogens in citrus plants (Fanta et al., 2003). Citrus blight causes mineral unbalance with a clear pattern for zinc deficiency in leaves. Taylor et al. (1996), identified a small protein, named P5 (Accession AAB46813), that has sequence


46 similarities to chitin binding proteins and functions complexing zinc in affected plants. It is probably associated with the known translocation of zinc from leaves to trunk tissues (Albrigo and Young, 1981). In addition to the clone 38, chitinase homologs were found in our libraries and in combination with the class I Chitinase (Accession AB081944.1) as reference, a putative nucleotide sequence for a P5 candidate gene was deduced and was used in this validation experiment (Figure 5-1). Citrus chitinaseclass I, Accession AB081944.1 1e-05 true P5 Highest match on sequence search analysis e-values protein 22 residues22 residues true P5AB081944.1 e-value=1e-05 Chitinase-I: 1 935 p5-candidate: 70 135 Clone38: 681 906 (complementary) 1 100 200 300 400 500 600 700 800 900 region of the citrus chitinasegene used in the real time PCR A)B)C) Figure 5-1. Designing a candidate sequence for the P5 gene. A) The true P5 protein has homology to the translated version of the citrus chitinase class I Accesion AB081944.1. B) The aminoacid identities was 80%, with an e-value of 1e-05. C) Based on the reference chitinase class I (Accession AB081944.1), which also had high homology to the clone 38, a candidate sequenced was designed for the P5 gene and was used in the real time PCR experiment.


47 Another gene associated to citrus blight is the P12 (Accession AF015782). It is up-regulated in affected plants (Derrick et al., 1990) and has sequence similarities to expansins (Ceccardi et al., 1998), but has so far an unknown role in the decline of the trees. P12 was also included in this experiment. The Table 5-1 displays the characteristics of the chosen probes for each of the candidate clones and P12. Table 5-1. Characteristics of the chosen probes. The primers and probes were designed using the PrimerExpress Software (Source: Applied Biosystems Resources, http://www.appliedbiosystems.com/index.cfm last accessed December 10, 2003). Clone name Start (bp) Length (bp) Tm ( o C) GC (%) Taqman probe architecture (flourochrome-5sequence 3-quencher) 6 136 29 69 45 fam6-TCGCTACTTATGCGACAAGGAATTTCGCT-tamra 25 192 32 69 41 Fam6-TTGAAGGCAAGTTAGGAAATTAGCAAAGCCAG-tamra 109 94 39 69 33 fam6-ATGATACAGAGAAGGTTGGGATGATATGACATTAAAACA-tamra 149 213 26 69 42 fam6-CTGTATCATCTTACTTTACGCTTCCC-tamra P5 candidate 78 18 68 67 fam6-AAGCGGCGTTGTGTGCCC-tamra P12 179 25 69 56 tet-TGGAGTCATGATAGCCGCAGCAAGC-tamra Two major calculation methods are possible, the absolute and the relative quantification of the target gene (Source: bulletin # 2, Applied Biosystem, http://www.appliedbiosystems.com/index.cfm last accessed December 10, 2003). This study employed the relative method. Then, the 18S gene was chosen as the active internal control, or normalizer, because it is considered to be non altered under different conditions (Dorak, 2004, source: http://dorakmt.tripod.com/genetics/realtime.html last accessed on January 10, 2004). However, no previous information was seen about the 18S levels in feeder root samples of citrus hybrids under non and citrus blight conditions. It was assumed that the transcriptional level of the 18S gene was not altered by citrus blight.


48 To test the efficiency of the amplification between the target gene and the normalizer, a RNA 2 fold dilution series was evaluated, from 3.9 to 1000 ng of a mixed pool of RNA templates. Under a similar efficiency, the graphic of the log input amount of the total RNA and Ct (difference between the chosen thresholds, the Ct of the target minus the Ct of the normalizer) would give a straight line, nearly parallel to the abscissa. Small deviations from that are accepted and the bulletin # 2 of Applied Biosystem (Source: http://www.appliedbiosystems.com/index.cfm last accessed December 10, 2003) recommends that the absolute value of the slope (of the estimated linear function) should be equal or smaller than 0.1. Figure 5-2 displays the outcome for the clone 109, which had a slope of 0.1055, for the tested range of 3.9 to 1000ng of RNA template. A) Plot of log input amount versus Ct y = 0.1055x + 26.138 2224262830-2.4-2.1-1.8-1.5-1.2-0.9-0.6-0.30.0 clone 109 x 18S Linear (clone 109 x 18S)CtLog ng Total RNA Figure 5-2. Relative PCR efficiency plot of the clone 109 against the normalizer 18S. In the same type of analysis, the clone 6 had a slope of 0.0104; the clone 25, 0.1029; the clone149, 0.0602; the P5 candidate, 0.0811; and the P12, 0.0196.


49 Collecting and Preparing the Samples The same citrus groves in central Florida area, used to collect root samples for the cDNA array experiment, were revisited, with the expectation to re-assess the same trees. However, most of the previously healthy trees had started to display some blight symptoms and some of the affected trees had been pushed out. Therefore, some other plants were used in the real time PCR experiment, after verification of the typical symptoms and the water test (Lee et al., 1984) for diagnostic purposes. Three classes of plants were sampled: Healthy: with no visual symptoms in the canopy, and with a minimum uptake of water, manually injected into the trunk by a syringe, of 3 ml/10 seconds. Mildly affected: initial symptoms in the canopy, such as opaqueness of leaves and few twig dye backs on the top. Uptake of water from 1 to 2 ml/10 seconds. Blighted: fully symptomatic canopy. Uptake of water smaller than 0.5ml/10 seconds. Tentative different stages of the process (healthy, mildly and fully affected trees) were used because they may offer more information than only comparing healthy and fully declined trees, as done on the cDNA array experiment. Feeder root tissues from each tree were once again collected and the RNA extraction procedures had this time double DNA digestion step, using an adaptation of the Qiagen RNeasy kit (Source: Qiagen, http://www1.qiagen.com/Default.aspx last assessed January 4, 2004). No DNA contamination was observed when verifying RNA quality on formaldehyde gels. All sampling and extracting procedures were done as uniformly as possible. The sampled trees were Valencia sweet orange (Citrus sinensis L. Osbeck cv. Valencia) on the rootstock Carrizo citrange (Citrus sinensis L. Osb. x Poncirus trifoliata L. Raf.) of around 10 years old. This choice was considered because


50 trees of Valencia on Carrizo have been largely used in the Florida citrus industry. The combinations of Valencia on Rough lemon and on Swingle citrumelo were also initially considered. But the sampled trees were of different ages and had other non uniform conditions. Therefore, they were no longer considered. Reverse Transcriptase (RT) and PCR Reactions Duplicated RT reactions and two PCR reaction sets per each sample were used to minimize pipeting and other reaction errors, resulting initially, in four mechanical replicates per each biological sample. Both RT reactions for each sample were done at the same time and under the same conditions, using a 96 well plate and the protocol given by the Applied Biosystem RT kit (Source: http://www.appliedbiosystems.com/index.cfm last accessed January 10, 2004). Other conditions were also as uniform as possible. The RT plate was then stored at -20 o C. The 7700 Applied Biosystem sequence detection system was employed for all set of PCR reactions. The PCR conditions were 50 o C/2minutes, 95 o C/10minutes, and 45 cycles of 95 o C/15seconds plus 60 o C/1minute. An arbitrary threshold cycle (Ct) was chosen for each amplification plot. The data was analyzed using the baseline computation method on the Apple based Sequence Detection System (SDS) v1.9 software (Source: http://www.appliedbiosystems.com/index.cfm last accessed April 10, 2004). Three controls were employed in all real time PCR plates: the NTC (no template control, to verify non specific amplifications), the NRT (no reverse transcriptase control, to verify DNA contamination) and the NAC (no amplification control, to verify non specific readings). After the reactions, none of the NACs gave integral fluorescent readings. The great majority of the NTCs did not reach the chosen threshold level (Ct) for


51 the target gene at the 40 th PCR cycle. The reactions that did, were discarded. All samples that had a difference in the Ct (the Ct of the sample minus the Ct of the NRT) for the reading of the 18S gene, smaller than 10 cycles were also discarded. The Applied Biosystem (Source: Taqman ribosomal RNA control reagents protocol, http://www.appliedbiosystems.com/index.cfm last accessed April 10, 2004) recommends this cut off level to avoid significant contribution of non-target templates to the measured gene. The remaining healthy, mildly affected and blighted samples were further analyzed. Figure 5-3 displays examples of amplification plots for the clone 109, P5 candidate and P12. Relative Quantification of the Transcriptional Levels of the Selected Genes All samples were analyzed in groups according to their similar levels of 18S, measured by the threshold (Ct) in each reaction. Four replicates, groups of independent healthy, mildly affected, and blighted trees, were analyzed, in a total number of twelve different sampled trees. Each clone was evaluated individually. The contrast to compare healthy-mildly affected-fully blighted conditions is not orthogonal. Therefore, the t-Test can not be used. The residual standard deviation (s) was chosen to indicate the non specific variation within each group of plants, or replicates. This measure of variation indicates the effect of non controlled factors, and therefore, seems adequate to estimate the contribution of errors in the experiments. It was calculated using the mean square of the residue (MSres), after the ANOVA (analysis of variance) for each group of plants, as: s = (MSres)


52 A) The clone 109 probe used the fluorochromes FAM6 and TAMRAB) The P5 probe used the fluorochromes FAM6 and TAMRARnRnPCR cyclesPCR cyclesC) The P12 probe used the fluorochromes TET and TAMRA RnPCR cycles Figure 5-3. Examples of real time PCR reactions. A) For the clone 109. B) For the P5 candidate gene. C) For the P12. The reactions were done with samples from all the tested conditions and reflect the differences in the transcriptional level of the target gene according to each sample.


53 Figure 5-4 displays the relative transcriptional levels of the selected clones. Within each group of plants, regression analysis was performed and a polynomial equation was shown. The three evaluated stages of the disease (healthy, mildly and fully blighted trees) are certainly not enough for better inferences about the progress of the disease, neither blight can be precisely estimated, since no pathogen is known to cause the problem. But an initial tendency of the relative transcriptional levels compared to the healthy samples, was observed for some of the clones. The clone 6 can probably be considered a mistaken choice taken from the cDNA array experiment. The tentative down-regulated pattern was not observed in the real time PCR experiment. Moreover, it seems to be up-regulated in affected comparing to healthy plants. More replicates, or maybe other techniques, would probably be needed for further elucidation The clone 25 was considered to be up-regulated in affected plants, especially when Swingle rootstock was used (panel C1, Figure4-4C). This pattern was also observed in the real time PCR experiment using Carrizo rootstock, confirming the previous expectation. In the group D of plants, the fully blighted tree displayed similar transcriptional levels to the healthy tree, but both were lower than the mildly affected one. It is possible that fully blighted trees reduce some of their metabolism affecting the transcriptional level of certain genes. That was apparently the case for this gene in this studied blighted tree. In the other three groups of plants, the relative amount of the transcripts of the gene represented by the clone 25 were more abundant in fully blighted than in healthy or mildly affected plants. Therefore, the clone 25 was considered to represent an up-regulated gene under citrus blight conditions.


54 1.004,779.65 10,779.11 y = 610.4x2 + 2947.4x 3556.8R2 = 1-4,000.00-2,000.000.002,000.004,000.006,000.008,000.0010,000.0012,000.0014,000.00HczMczBcz P5 candi date-A Poly. (P5 candidate-A) 1.0 0 1.0 2 4.21Mcz y = 1.5845x2 4.7342x + 4.1497R2 = 10.000.501.001.502.002.503.003.504.004.505.00HczBcz P5 candidate-B Poly. (P5 candidat e-B) 1.000.27y = 2.5281x2 8.3178x + 6.7896R2 = 1- 4.59 P5 candidate-C Poly. (P5 candidate-C ) 1.001.2910.29y = 4.352x2 12.764x + 9.41212 = 1-4.00- R P5 candidate-D Poly. (P5 candidate-D) 1.009.10y = -327.09x2 + 1312.4x 984.33R2 = 1-50.000.0050.00100.00150.00200.00250.00300.00350.00400.00HczMczBcz 332.14 P12-A Pol y. (P12-A) 1.002.02y = -11.321x2 + 45.794x 33.473R2 = 12.83 P12B Poly. (P 12-B) 1.00241.94195.73y = -143.58x2 + 671.68x 527.R2 = 1-100.00-50.000.0050.00100.00150.00200.00250.00300.00350.00HczMczBcz 1 P12-C Poly. (P12-C) 1.00205.642.28y = -204x2 + 816.63x 611.R2 = 1-100.00-50.000.0050.00100.00150.00200.00250.00300.00HczMczBcz 63 P12-D Poly. (P12-D)10.28+/-0.50 13.50+/-1.74 15.82+/-2.40 22.39+/-2.02 18S Ct +/-StDev P5 candidateP12Hcz Mcz Bcz Hcz Mcz Bcz Hcz Mcz Bcz Hcz Mcz Bcz trees 205 223 404 201 225 402 203 227 406 265 229 454 1.440.9900y = 0.224 0.6798x + 1.45510.000.200.400.600.801.001.201.401.601.80HczMcz 1.7x2 -R2 = 1Bcz c6-A Poly. (c 6-A) 2.541.0Bcz 1.360y = 0.4118x2 0.8761x + 1.4643R2 = 10.000.501.001.502.002.503.00HczMcz c6-B Poly. (c6-B) 4.501.551.00y = 1.2039x2 3.0645x + 2.8606R2 = Bcz c6 -c Poly (c6-c) 15.3133.611.00y = -25.451x2 + 108.96x 82.507-20.00-10.000.0010.0020.0030.0040.0050.00HczMczBcz R2 = 1 c6-D Poly. (c6-D)rep. A rep. B rep. Crep. D 3.401.311.00y = 0.887x2 2.3489x + 2.4619R2 = 1- c25-A Poly. (c2 5-A) 4.031.621.00y = 0.8955x2 2.0653x + 2.1698R2 = 10.000.501.001.502.002.503.003.504.004.505.00HczMcz c25-B Poly. (c 25-B) 9.971.311.00y = 4.1736x2 12.21x + 9.0362R2 = 1-4.00- c25-C Poly. (c25-C) Bcz 3.3325.701.00y = -23.538x2 + 95.317x 70.779R2 = 1-10.00- c25-D Poly. (c25-D) 1.000.340.41y = 0.36R2 = 44x2 1.7513x + 2.3869Bcz c109-A Poly. (c 109-A) 1.001.714.50y = 1.039x2 2.4045x + 2.3655R2 = c109-B Poly. (c109-B) 1.0 0 3.8 5 21.2 0 y = 7.2564x218.924x + 12.66 7 R2 = 1-10.00- c109 -C Poly (c109-C) Bcz 1.0 0 53.4 9 25.4 8 y = -40.246x2 + 173.22x 131.9 8 R2 = 1-20.00-10.000.0010.0020.0030.0040.0050.0060.0070.00HczMczBcz c109-D Poly. (c109-D) 1.002 0.000.02y = 0.5072x 2.5177x + 3.0105R2 = 1- c149-A Poly. (c149-A) 1.001.873.05y = 0.1618x2 + 0.3797x + 0.4585 = 1-0.500.000.501.001.502.002.503.003.504.004.50HczMcz c149-B Poly. (c149-B) 1.000.1226.11y = 13.437x2 41.196x + 28.759R2 = 1-15.00-10.00- c149R2Bcz C Poly. (c149-C) 1.0016.815.96y = -13.331x2 + 55.805x 41.475R2 = 1-10.00- c149-D Poly. (c149-D) clone 6clone 25clone 109clone 149 y = 0.7867x2 2.9304x + 3.1437R2 = Bcz 33212241204107794.214.5910.290.023.0526.115.961.424.5021.2025.483.404.039.973.331.442.544.5015.31111111111111111111111111 fold change to healthy (1x) Figure 5-4. Relative transcriptional levels of the selected genes. Twelve individual plants were analyzed in four groups (rep. A, B, C and D), based on similar Ct values for the 18S readings. Feeder root samples of healthy (H), mildly affected (M) and fully blighted (B) trees on Carrizo (cz) rootstock were numbered (201 to 454) and used in this experiment. The columns represent the relative transcriptional level of each clone, comparing to healthy samples. The bars represent the residual standard deviation estimated for each group of plants.


55 The clone 109 was up-regulated in three out of the four replicates, comparing the healthy to any of the two blighted conditions. The pattern was similar in the groups B and C. The mildly affected plant of the fourth replicate (group D) displayed even higher transcriptional level than the fully blighted tree. In addition, this pattern of the second and third replicates (groups B and C of plants) may represent only an initial or partial outcome for a latter blight development that has yet to come, and could reduce the transcripts of the gene represented by the clone 109 to a similar level observed in the group D of plants. That seems possible because citrus blight can not be precisely quantified so far, and therefore, the progression of the disease can not be completely pursued either. The first replicate (group A of plants) displayed a non expected result. The relative transcriptional level of the mildly affected plants was reduced to a range of 40% comparing to the healthy trees. To test whether or not that was an artifact of the method, a new RT and PCR reactions were run with the same RNA samples. No further discrimination was observed, however the residual standard deviation was higher. The mildly affected tree still had around 40% of the transcripts compared to the healthy sample while the blighted reached 1.4 the healthy sample. It is possible that this result may represent noise caused by blight itself, or by another factor not studied in the system. New samples from the field were not collected and tested because that would add a contribution of the season of the year and temperature to the present model. In addition, the sampled plants are probably in different stages of blight at this point, because all studied samples were collected and processed six months ago, from January 9th to the 15th of this year.


56 Considering that the clone 109 was up-regulated in three out of four replicates; that a similar pattern was observed; and that the level of induction compared to healthy plants was above twenty fold in the groups C and D of plants; the clone 109 was considered to represent a gene that is upregulated under citrus blight conditions, confirming the expectation from the cDNA array experiment. The clone 149 was variable but with no defined pattern considering the outcome of the four groups of plants. On the cDNA array, the transcriptional level of the gene represented by this clone was nearly unchanged by citrus blight. However, since the real time PCR is more sensitive, discrepancies towards either way, being up or down-regulated according to individual organisms, could be unfolded because in the cDNA arrays the data tends to be compressed. That was apparently the case, and the clone 149 does seem variable, but according to other factor not studied. The P5 candidate gene was responsive to citrus blight with a similar pattern in all four replicates. It was more abundant in fully blighted trees than in any other studied condition. Apparently the gene represented by the P5 candidate displays an ascendant transcriptional response towards the fully blighted tree. This result may not parallel the initial complexation of zinc seen in leaves and trunks of mildly affected trees (Albrigo and Young, 1980). Therefore, the chitinase gene represented by the P5 candidate is considered to be upregulated under citrus blight condition, confirming the similar expectation observed with the clone 38 in the cDNA array experiment; however, it remains to be investigated whether or not this candidate gene is the true P5 identified by Taylor et al. (1996). It is worthy to note that the behavior of the true P5 is not known in feeder root tissues, as used in this experiment.


57 The P12 displayed a significantly higher transcriptional level on mildly affected plants compared to healthy or fully blighted trees. The pattern was similar in all four groups of tested plants. It is possible that if more stages of blight were available, a wider range of conditions would be better evaluated, and maybe a different polynomial equation would better describe the phenomenon. But the pattern for a higher transcriptional level in mildly affected trees was clear. The lower amount of P12 transcripts in fully blighted trees may account for the previous failure in detecting P12 in the subtracted libraries and also in the cDNA array experiment. Both procedures employed samples from fully symptomatic trees. Although patterns were observed, the intensity of the responses was related to the group of studied plants. Therefore, a general, or averaged, transcriptional level for each gene was not estimated, because it may not meaningful. The Potential Biological Meaning of the Clone 109 Regardless of what causes citrus blight, affected plants visually go to a declining condition during the whole process. A closer look at the clone 109 reveals sequence homology to a citrus EST annotated as a cold acclimated responsive gene from the Washington Navel sweet orange (Citrus sinensis L. Osbeck cv. Bahia), in experiments done in California (Close et al., 2003; in press; assession number CB293790.1), shown in Figure 4-10 (Chapter 4), with an e-value of 9e-44. It is known that plants respond to cold and to drought periods activating and repressing responsive genes. Seki et al. (2001) found 5 drought specific inducible genes, 2 cold specific inducible genes and 16 drought and cold inducible genes using a microarray with around 1,300 full length cDNAs of Arabidopsis thaliana. Citrus blight is a xylem blockage problem, which ultimately may lead to water deficiency, and maybe,


58 that gene represented by the clone 109 is involved in this process. In addition, the clone 109 displayed mostly higher transcriptional levels under citrus blight condition, using samples from different seasons of the year. An alternative hypothesis could claim specific response to the citrus blight process, rather than being induced only as an indirect effect of the internal water stress caused by citrus blight. The clone 109 also had potential similarities to an ubiquitin subunit (Table 4-2, chapter 4) of the SCF complex (Skp1-Cullin-F-box protein). This complex is involved in the ubiquitination of proteins and cell cycle regulation. The citrus blight process can be seen as an accelerator of senescence. Young affected trees, of 5 to 10 years old, start to display an overall decline and lack of vigor, normally only seen on healthy trees older than 50 years. The clone 109 could function in the ubiquitination process, targeting other proteins for degradation, and or, impairing the normal cell cycle in affected trees. Experimental confirmation is certainly needed either way regarding its function and involved pathways. But in the first scenario, if cold acclimation is a feasible goal in plant genetic engineering programs, maybe hardening rootstocks for citrus blight could be as well. In the second scenario, experimental effort on the cell cycle regulatory process in citrus can eventually offer perspectives to control citrus blight. A Tentative Test to Verify the Effect of Cold and Drought Stresses In order to evaluate whether or not the gene represented by the clone 109 responds to cold and drought stresses, another experiment was assembled and run. Other clones were also included. The major objective was to compare the transcriptional levels of the selected genes, and determine whether they seem to be a specific response to citrus blight, or only a secondary effect of the stress caused by the disease. However, moving


59 adult citrus plants to controlled conditions was not attempted. Greenhoused young trees, of about one year old were used instead. They were exposed to cold (4 o C for 52 hours) and drought stresses (no water for one week plus additional root airing for 24 hours). Seedlings of Carrizo citrange (Citrus sinensis L.. Osb. x Poncirus trifoliata L. Raf.) were chosen to equal the genotype evaluated in the previous real time PCR experiment. The references, or control plants, were from the same lot of seedlings, but kept under normal greenhouse conditions for the same period of time. Four independent replicates (i.e. different seedling plants) were evaluated for each treatment. Feeder root tissues were once again used. Figure 5-5 shows the results. The contrast of interest, to compare the control, cold and drought treatments, is not orthogonal, and therefore, the t-Test can not be used. However, the number of replicates was uniform, allowing the application of a test to compare the means. Among the options, the Tuckey test was employed because of the better discrimination of the means compared to other tests, like Sheffe, Dunnett or Duncan (Banzatto and Kronka, 1992). The null hypothesis was no difference among the treatments. The clone 109 did not respond to cold and drought stresses under the studied conditions. No significant effect (p<0.05) was seen for most of the other clones either, including P12. The drought treatment only affected the gene represented by the clone 25. Its transcriptional level was reduced to around one-third compared to the control. This level of significance (p<0.05) implies that the maximum estimated chance of having similar results caused only by chance is of only 5%. Lowering this probability to 1% (p<0.01) makes this difference became not significant. In spite of which level of probability should be considered, this reduction of the transcriptional level was not


60 expected. Blight induces xylem blockage; and consequently, a potential internal water stress. Since the clone 25 was considered to be up-regulated in the cDNA array and in the real time PCR experiment, it would also be expected to be unchanged or up-regulated 0.831. c6-A 0.900.381. c25-A 1.000.841. c109-A 0.640.661. c149-A 1.000.690.650.000.200.400.600.801.001.201.401.601.80seedlingsdroughtcold P5 candidate-A 1.000.321.23-1.50-1.00-0.500.000.501.001.502.002.503.00seedlingsdroughtcold P12-A clone 6clone 109P5 candidate clone 25clone 149P12 =0.41 =1.15=2.44=1.16=0.48=0.77 Figure 5-5. Contrasts comparing the effect of cold and drought treatments on the relative transcriptional level of the clone 109 and other clones. The Tuckey test was employed and an observed significant difference was highlighted with a star. The bars represent the minimum significant difference for the contrast ( values, for p<0.05) of each clone. under drought stress. Another experiment using adult trees under controlled conditions may address this question. Similar reasoning may be considered for the other genes as well. A definitive answer about the effect of major stresses would need adult trees under


61 controlled conditions. Therefore, the responsive genes to citrus blight, and apparently not affected by drought and cold stresses, seem to be at this point, only the clone 109, the P5 candidate and the P12. The Potential Effect of Redundancy and Gene Families The selected clone 38 represents a citrus chitinase gene. Two genes (chitinase class I, accession AB081944.1; and chitinase class II accession Z70032.1) were matched to the 235 bases of the clone 38 with the same e-value of 1e-87. The homology was seen towards the 3end of the subjected sequences (Figure 4-8, chapter 4). Chitinases are enzymes that catalyze hydrolysis of chitin polymers, acting against plant intruders by destroying chitin-containing cell walls. The difference between the class I and the class II is based in the presence (I) or absence (II) of a N-terminal chitin binding domain (source: http://us.expasy.org/cgi-bin/prosite-search-ac?pdoc00620 last accessed June 1, 2004). Therefore, the clone 38 arrayed in the cDNA array membranes (chapter 4) could represent any of the two described genes. The 22 aminoacids of the P5 protein (accession AAB46813) had 80% identity to the same chitinase class I, accession AB081944.1, with an e-value of 7e-05. The matched region was however in the conserved 5 end of the subjected sequence. The Taqman probe and primers were designed to span this region, covering 88 nucleotides long. The Figure 5-1 displays the homolog regions between the sequences of the reference chitinase, clone 38 and P5 candidate. Therefore, it is not possible to discern precisely if the clone 38 and the P5 candidate represent the same gene, or not, within the chitinase family. In addition, the sequence for citrus is limited, but searching the genome of the model plant Arabidopsis thaliana, the reference chitinase class I, accession AB081944.1, had 15 matches in the protein


62 databank (source: TAIR, http://www.arabidopsis.org/ last accessed June 1, 2004), with e-values varying from 3e-7 to 4e-95. It is possible that this situation is similar for citrus, with a high number of redundant genes, imposing another level of difficulty in the evaluation of transcriptomes. The situation can be similar for P12, which had 17 matches in the protein database of TAIR, all expansins, with e-values from 2e-04 to 5e-30. There are two gama expansins with noted similarity to P12. Therefore, it is possible that more copies of homolog P12 genes are also present in citrus plants.


CHAPTER 6 IDENTIFICATION OF AN ETIOLOGICAL CONTRAST POTENTIALLY ASSOCIATED WITH THE CITRUS BLIGHT DISEASE A crucial question in citrus blight research is the origin of the problem. Several causal agent candidates and other theories have been examined, but none has proved to be definitive for blight. Each reported theory has been based on observed characteristics of the disease; however blight is a complex problem, and different views and perspectives are possible under different circumstances. For instances, the non-transmissibility of citrus blight by canopy tissues was observed long ago (Rhoads, 1936; and COHEN, 1968), but transmission by root grafting was later obtained (Tucker et al., 1984). Soils with higher pH and levels of Ca were associated with severe incidences of blight in Florida (Wutscher, 1989); however, blight does occur in acidic soils and examples are common, especially in the So Paulo citrus belt. Soil born pathogens were associated to blight (Nemec et al., 1982); but transmission of blight by soil replacement was not obtained (Timmer and Graham, 1992). Xylella fastidiosa was considered to be the causal agent of blight (Hopkins, 1988); but this xylem limited bacterium is naturally present in many vascular plants, including citrus. A higher incidence of blight was observed after the implementation of the nucellar programs in Florida and in So Paulo (Derrick and Timmer, 2000), probably reflecting the new endophytic balance in the nucellar plants but blight has also a high incidence on certain old line trees, and examples on Olmpia, and on other clones of the Pera sweet orange that were not pre-immunized against citrus 63


64 tristeza virus (CTV) are commons in So Paulo. The theory about a molecular origin for blight suggested the involvement of defective signals transmitted from plant to plant (Carlos et al,2000), but no experimental evidence for that have been found. Strains of citrus tristeza virus (CTV) were reported to be associated with a potential variant of blight (named Rangpur lime decline) and to citrus sudden death diseases in Brazil (Derrick et al., 2003), but CTV is commonly present in stem-pitted sweet orange plants in So Paulo causing no major disturbances (Costa et al., 1954). In spite of the merit and investigations of each theory, one characteristic initially proposed by Swingle and Webber (1896) seems difficult still to be denied: citrus blight apparently has an infectious nature and dissemination. In order to investigate a potential causal agent for citrus blight, qualitative and quantitative experiments were performed. The First Screening of the Subtracted Libraries When the subtracted libraries were made (chapter 3), during the summer of 2001, the following question regarding which genes were represented there was first addressed using a virtual northern blot experiment. The differentially enriched cDNAs from the blighted minus healthy (B H) library were cloned and grown in the E. coli vector and plated on LB medium. Ninety six clones were randomly selected for re-growing on two equally printed nylon membranes. After growth, the membranes were rinsed with extensive washes and hybridized overnight with P32 labeled probes. The probes were also made from the subtracted blighted (B H) and healthy (H B) enriched cDNA libraries, uncovering tentatively more abundant transcripts represented there. A B H clone when revealed by the B H probes and not by the H B probes implied a larger presence of the transcript of that gene in the blighted samples that originated the library, from the affected trees. To the contrary, a B H clone


65 when revealed by both types of probes ( B H and H B ) indicated similar amounts of the transcript in both libraries, and therefore, were of no interest. Virtual northern blots can be effective to reveal abundant transcripts in enriched libraries (Source: http://www.bdbiosciences.com/clontech/ last accessed January 15, 2004), which may include those of RNA based viruses, such as the majority of the plant viruses. Figure 6-1 displays the results for the virtual northern blot experiment. Among others, the arrows indicate that the clones E8-13 and E8-14 were far more abundant in the B H library. B -H probes H -B probesB H clones E8-13E8-14 Figure 6-1. The virtual northern blot of the B H clones. Each clone was printed in two membranes that were respectively probed with B H and H B probes labeled with P32. The subtracted libraries were made using the superficial roots of Rough lemon (Citrus jambhiri Lush) collected in the central Florida area, during the summer of 2001. The green arrows indicate the clones E8-13 and E8-14. Sixteen clones were considered to be differentially transcribed in the B H library and were selected for sequencing. Among the plant genes, possible up regulated ones included clones with similarities to metallothionein and several unknowns. However,


66 based on sequence homology, the clones E8-13 and E8-14 were not plant genes, but part of the 3end of the P27 divergent citrus tristeza virus (CTV) coat protein gene. The clone E8-13 was 311 base pairs long and the E8-14 was revealed to be only a shorter and redundant version of the same gene, with 155 base pairs. Table 6-1 displays the first four nucleotide based homolog sequences found in all databases of Genbank for clone E8-13, using the Blast-N search analysis (Altschul et al., 1997). Similar results were found using the translated query searches. Table 6-1. The clone E8-13 had homolog sequences matching different isolates of the citrus tristeza virus (CTV). The clone E8-13 is 311 base pair long and was found in the citrus blighted minus healthy (B-H) subtracted library made from superficial roots of Rough lemon (Citrus jambhiri Lush). clone Homolog gene e-values E8-13 > gi|1732493|gb|U56902.1|CTU56902 Citrus tristeza virus p346, 54-kDa RNA dependent RNA polymerase, p33, p6, p65, p61, p27, 25-kDa coat protein (CPG), p18, p13, p20, and p23 genes, complete cds e-162 > gi|11414863|dbj|AB046398.1| Citrus tristeza virus genomic RNA, complete genome, seedling yellows strain e-147 > gi|2098825|gb|AF001623.1|CTAF001623 Citrus tristeza virus, complete genome e-136 > gi|3550999|dbj|AB011189.1| Citrus tristeza virus genomic RNA for 27K protein and coat protein, partial cds, isolate KS3A2 2e-87 Looking at the homolog sequences, the first match, accession number U56902, was isolated in Israel and represents the coat protein gene of CTV (Mawassi et al., 1993). The second, accession AB046398, was a seedling yellows strain from Japan (Suastika et al.,


67 unpublished). The third, accession AF001623, was isolated in Texas causing severe symptoms in sweet orange (Yang et al., 1999). The fourth, accession AB011189 is the P27 gene also isolated from strains of Japan (Kano et al., unpublished). Sequence information is limited for citrus, but to verify other potential origins for the clone E8-13, other databases were searched. Homolog sequences were not found in different plant databases. The first matched outcome in the blast searches (Altschul et al., 1997) using the non-mouse and non-human ESTs and the viridiplantae databases of the Genebank yielded respectively matched sequences with e-values of only 5.7 and 1.1. Using the Brazilian citrus EST database, the result was not different, with an e-value of only 0.18 for the first outcome. Therefore, the clone E8-13 was considered to be part of the P27 gene of the CTV genome. The highest matched sequence indicated similarities to an Israeli isolate. In addition, both clones, E8-13 and E8-14, displayed polyadenylated 3ends in their sequences. The question whether that was an artifact of the method used to build the cDNA libraries (Smart cDNA kit, source: http://www.bdbiosciences.com/clontech/ last accessed June 20, 2001), or an adaptation of the CTV to the molecular machine of citrus remains to be investigated. The presence of CTV in citrus plants is not novel, and the solution for the Tristeza disease in sweet orange groves was reported long ago (Costa et al., 1954). However, the presence of CTV strains in roots of citrus plants affected by blight is intriguing. This result was similar to previous observations made by Derrick et al.(unpublished). It is also necessary to review that Rough lemon is susceptible to CTV and those findings alone may not add novelty to what is already known about CTV and citrus host interactions.


68 Other CTV Genes were also Found in both Subtracted Libraries Later, around four hundred clones randomly selected from the blighted minus healthy (B-H) and 100 from the healthy minus blighted (H B) enriched libraries were sequenced. Clones with sequence similarities to other CTV genes were relatively common, matching different isolates and strains. Redundancy was observed, and normally, more than one clone matched the same analyzed gene. The Table 6-2 displays examples of pieces of CTV genes found in both libraries. Table 6-2. Other sequences with homology to CTV genes found in the blighted minus healthy (B-H) and healthy minus blighted (H-B) subtracted libraries. library CTV gene e-value clone B H p23 e-153 M1H7 p346RDRPol 6e-70 M2E2 p33 3e-43 M3A1 H B p61 e-131 E8-28 hsp90 p61 e-158 E8-21 p65 0.000 E8-22 Quantitative Evaluation of the P27 Candidate Gene in the Blighted Trees In order to evaluate the presence of the transcripts of the P27 candidate gene, reverse transcriptase quantitative real time PCR was run. The chosen Taqman probe employed the Fam6-5sequence 3-Tamra architecture and had an accepted PCR efficiency (Chapter 5). The absolute value for the slope of the linear function (y= -0.1008x +22.13), that described the log input amount of the total RNA (x) against the Ct (y) between the target and the normalizer 18S, was 0.1008. The tested range was a 2 fold dilution series from 3.9 to 1000 ng of total RNA. The


69 comparative Ct method was used to avoid the need of in vitro synthesis and purification of the P27 RNA for absolute quantifications. For calculation purposes, reactions that did not display amplifications were considered having a Ct value of 45 cycles. To minimize non-specific variations, two reactions per sample were run. The same healthy, mildly affected and fully blighted plants that were used to evaluate other genes (Chapter 5) were used here. They were Valencia sweet orange (Citrus sinensis L.. Osbeck cv. Valencia) on Carrizo citrange (Citrus sinensis L. Osb. x Poncirus trifoliata L.. Raf.) of around 10 years and from the central Florida area. Four groups of plants, or replicates, were evaluated. The transcripts of the P27 candidate gene were present in far larger amounts in affected than in healthy trees (Figure 6-2). The fully blighted trees on the group B of plants still have around eight times more P27 transcripts than the healthy plants. 1.00.8 713,720-100,000.0200,000.0300,000.0400,000.0500,000.0600,000.0700,000.0800,000.0HczMczBcz P27-A 1.08.8 205,674-50,000.0100,000.0150,000.0200,000.0250,000.0300,000.0350,000.0400,000.0HczMczBcz P27-B 1.0142.5270.6-50.0100.0150.0200.0250.0300.0350.0400.0HczMczBcz P27-C P27-DCt18S: 10.09+/-0.29 12.93+/-1.58 16.49+/-1.28 21.27+/-0.19 Figure 6-2. The transcripts of the p27 candidate gene were abundant in the roots of the affected trees, Carrizo citrange (Citrus sinensis L. Osb. x Poncirus trifoliata L. Raf.). The Ct levels for the 18S were displayed below the graphics; columns of the blighted (B) and mildly affected (M) were compared to healthy (H) Carrizo (cz) trees.


70 It is worthy to note that Poncirus trifoliata and its hybrids are considered to be resistant to CTV (Deng et al., 2001). The overall comparative amounts of the P27 transcripts indicated that CTV is present in feeder roots of Carrizo citrange affected by citrus blight. Further experiments can elucidate whether or not CTV causes or enhances citrus blight, or only grows better in roots of already debilitated plants. Eventual synergistic or antagonistic effect on the real causal agent of blight may also be investigated. Another possibility would be to consider the clone E8-13 as part of another virus, with sequence similarities to CTV. Another closterovirus would probably be the immediate suspect.


CHAPTER 7 CONCLUSIONS Citrus blight has imposed consistent losses and changes to the citrus industry since its origin, in the late of the XIX century (Swingle and Webber, 1896). The molecular mechanisms involved in the plant responses are still unknown at this point. Evidences for differentially transcribed genes, under different citrus blight incidences, were observed in this study. Three genes, represented by the clones studied in this work, had higher transcriptional level in blighted than in healthy trees. The level of response was dependent of the evaluated group of plants but patterns were observed. This study employed transcriptional assessment of citrus genes in feeder roots of healthy, mildly affected and fully blighted trees. Under these studied conditions, P12 had higher transcriptional level in mildly than in fully blighted trees. The chitinase(s) represented by the P5 candidate sequence and by the clone 38 had higher levels in fully blighted than in mildly or healthy trees. The clones 25 and 109 showed higher levels in fully blighted compared to healthy samples. Research is needed to reveal the function of the P12 gene and the genes represented by the other clones. Cloning of the true P5 gene and the genes represented by the other clones can also be another task for future efforts. It is also possible that more clones from the cDNA array experiment are truly differentially transcribed under non and blighted plants, but more confirmation is needed. In addition, the created subtracted libraries can be a wealthy source of clones for further experiments. The suppressive subtraction method was an effective way to create enriched cDNA libraries. 71


72 The finding of transcripts of CTV genes in roots of a blight-susceptible-CTV-resistant rootstock immediately raises further etiological questions. Under this context, CTV can intuitively be associated with citrus blight. However, whether or not it has a synergistic or antagonistic effect on blight, it is not known yet. Another potential consequence of this finding is regarded to options for tolerant rootstocks to be used not only for blight but also against citrus tristeza disease. Carrizo citrange may fall in discredit, contributing to the already known need of research on citrus rootstocks. Finally, it is possible to say that the end is certainly not near for blight. Research in roots seems the logical alternative to study the problem. In this way, it is hoped that the knowledge gained during this study can be of some use, helping to understand and control citrus blight.


APPENDIX BLAST ANALYSIS BASED ON NUCLEOTIDE SEQUENCES OF EACH INDIVIDUAL CLONE Table A-1. Blast analysis based on nucleotide sequences of each individual clone. The clones were obtained from the subtracted libraries (chapter 3) and used in the cDNA array experiment (chapter 4). Three databases were used for the search and the outcomes were highlighted in black (for the All Genebank with 1,367,736 sequences), blue (for the Brazilian citrus CCSM ESTs with 13,610 clusterized sequences) and green (for ESTs of the non-human non-mouse Genebank with 4,893,238 sequences). The clones 7 to 12 were obtained from other libraries of citrus leaf tissues, and all the others were from the subtracted libraries of root tissues, as described in chapter 3. Clone Highest match description/score/e-value e-values Organism Function 5 >gi|806738|gb|U16304.1|CTU16304 Citrus tristeza virus complete genome e-132 CTV p61 6 >gi|1785673|emb|Y08501.1|MIATGENA A.thaliana mitochondrial genome, part A 0 Arabidopsis mitochondrial Contig204 7e-11 Citrus 7 >gi|167366|gb|L08199.1|COTPROXDS Gossypium hirsutum peroxidase mRNA, complete cds 6E-68 Gossypium peroxidase Contig373 e-173 Citrus 1 gb|BQ624415.1|BQ624415 USDA-FP_01506 Ridge pineapple sweet orange e-171 Citrus 8 >gi|6469118|emb|AJ275306.1|CAR275306 Cicer arietinum partial mRNA for mitochondrial phosphate 4E-26 Cicer mitochondrial CSJE01-038D08.g 6e-88 Citrus 1 gb|BQ623911.1|BQ623911 USDA-FP_00991 Ridge pineapple sweet orange 6e-83 Citrus 9 >gi|18401634|ref|NM_112657.1| Arabidopsis thaliana chromosome 3 CHR3v07142002 genomic sequence 6E-43 Arabidopsis unknown 73


74 Contig1602 e-153 Citrus 1 dbj|C22180.1|C22180 C22180 Miyagawa-wase satsuma mandarin orange 4e-84 Citrus 10 cxContig94 e-146 Citrus 1 gb|BQ623982.1|BQ623982 USDA-FP_01073 Ridge pineapple sweet orange e-145 Citrus 11 CSJE01-038D08.g 2e-94 Citrus 1 gb|BQ623911.1|BQ623911 USDA-FP_00991 Ridge pineapple sweet orange 2e-84 Citrus 12 Contig2919 8e-27 Citrus 1 gb|BQ623455.1|BQ623455 USDA-FP_00546 Ridge pineapple sweet orange 3e-65 Citrus 13 Poor matches unknown 14 Poor matches unknown 15 CSContig70 2e-20 Citrus 16 cxAC01-022F03.g 52 7e-08 7e-08 Citrus 1 dbj|C22172.1|C22172 C22172 Miyagawa-wase satsuma mandarin orange... 1e-13 Citrus 17 Poor matches unknown 18 Poor matches unknown 19 Poor matches unknown 20 Contig1687 7e-64 Citrus 1 gb|BQ625123.1|BQ625123 USDA-FP_02214 Ridge pineapple sweet orange 9e-66 Citrus 21 1 gb|BQ624910.1|BQ624910 USDA-FP_02001 Ridge pineapple sweet orange e-135 Citrus 22 cxContig1377 6e-71 Citrus


75 23 Poor matches unknown 24 Poor matches unknown 25 Contig416 1e-91 Citrus 26 Poor matches unknown 27 Poor matches unknown 28 LPAC00-013G11.g 2e-06 Citrus 29 Poor matches unknown 30 Poor matches unknown 31 Contig416 e-101 Citrus 32 Poor matches Human unknown 33 Contig2752 1e-10 Citrus 34 >gi|7228328|emb|Y18788.1|MSY18788 Medicago sativa mRNA for putative TFIIIA (or kruppel)-like zinc finger protein 2E-14 Medicago Zn finger cxContig1077 6e-07 Citrus 35 Contig2879 0.0 Citrus 36 Contig2919 9e-65 Citrus 37 Contig2879 3e-53 Citrus 38 Contig1434 3e-95 Citrus 39 Poor matches unknown 40 Poor matches unknown 41 Poor matches unknown 42 >gi|1220143|emb|Z70032.1|CSACHIT2 C.sinensis mRNA for class II acidic chitinase 6E-79 Citrus chitinase Contig1512 1e-81 Citrus


76 43 >gi|1220143|emb|Z70032.1|CSACHIT2 C.sinensis mRNA for class II acidic chitinase 8E-40 Citrus chitinase Contig1434 1e-43 Citrus 44 Contig2879 2e-62 Citrus 45 FCContig127 5e-56 Citrus 46 Contig2919 2e-34 Citrus 47 Contig2879 5e-63 Citrus 48 Contig2879 6e-50 Citrus 49 Poor matches unknown 50 >gi|599725|emb|Z46824.1|CSLEA5PMB C.sinensis mRNA for Lea5 protein 2E-90 Citrus LEA Contig3802 4e-86 Citrus 51 No significant similarity found unknown 52 Contig2879 e-100 Citrus 53 Contig2919 2e-53 Citrus 54 >gi|5917784|gb|AF184068.1|AF184068 Citrus limon vacuolar membrane ATPase subunit G (LVMA10) mRNA, 2E-28 Citrus ATPase Contig2879 e-107 Citrus 55 Contig308 e-121 Citrus 56 Contig2879 e-130 Citrus 57 >gi|20809305|gb|BC029618.1| Homo sapiens, glyceraldehyde-3-phosphate dehydrogenase, clone e-128 Human G3PDH Contig80 1e-04 Citrus


77 58 >gi|5815312|gb|AF176034.1|AF176034 Coliphage phiX174 isolate Anc, complete genome e-171 Coliphage unknown 59 cxJE01-111G08.g 0.0 Citrus 60 CXAC02-065D12.g 1e-42 Citrus 61 cxJE01-085A10.g 0.0 Citrus 62 >gi|21206806|gb|AY103728.1| Zea mays PCO142212 mRNA sequence 5E-19 Zea unknown Contig1287 e-162 Citrus 63 >gi|6653735|gb|AF209908.1|AF209908 Prunus dulcis unknown mRNA 3E-07 Prunus unknown Contig16 e-110 Citrus 64 >gi|1732493|gb|U56902.1|CTU56902 Citrus tristeza virus p346, 54-kDa RNA dependent RNA polymerase, p33, p6, p65, p61, p27, 25-kDa coat protein (CPG), p18, p13,p20, and p23 genes, complete cds, p20, and p23 genes, complete cds e-162 CTV p27 65 >gi|3308979|dbj|AB008100.1| Citrus unshiu mRNA for metallothionein-like protein, complete cds e-138 Citrus metallothionein Contig3121 e-142 Citrus 66 Poor matches unknown 67 >gi|806738|gb|U16304.1|CTU16304 Citrus tristeza virus complete genome e-130 CTV p25/p27 68 >gi|806738|gb|U16304.1|CTU16304 Citrus tristeza virus complete genome e-160 CTV hsp90 p61 69 >gi|4239714|emb|Y18420.1|CITV18420 Citrus tristeza virus complete genome, isolate T385 0 CTV p65 70 >gi|806738|gb|U16304.1|CTU16304 Citrus tristeza virus complete genome e-127 CTV p65


78 75 Poor matches unknown 77 cxContig629 8e-90 Citrus 1 gb|BQ623985.1|BQ623985 USDA-FP_01076 Ridge pineapple sweet orange 3e-96 Citrus 78 Poor matches unknown 79 Poor matches unknown 80 Poor matches unknown 81 Poor matches unknown 82 Poor matches unknown 83 Poor matches unknown 84 Poor matches unknown 85 Poor matches unknown 86 Poor matches unknown 87 Poor matches unknown 88 Poor matches unknown 89 Contig2919 1e-31 Citrus 90 Poor matches unknown 91 Poor matches unknown


79 92 Poor matches unknown 93 Poor matches unknown 94 Contig2919 2e-46 Citrus 1 gb|BQ623148.1|BQ623148 USDA-FP_00239 Ridge pineapple sweet orange 1e-77 Citrus 95 >gi|6728952|gb|AC020576.2|T12C22 Sequence of BAC T12C22 from Arabidopsis thaliana chromosome 1, complete 1E-08 Arabidopsis unknown 96 Poor matches unknown 97 Poor matches unknown 98 Poor matches unknown 99 >gi|9087297|dbj|AP000397.1|AP000396S2 Beta vulgaris mitochondrial genomic DNA, complete sequence, section 2/2 e-125 Beta unknown 100 >gi|9087297|dbj|AP000397.1|AP000396S2 Beta vulgaris mitochondrial genomic DNA, complete sequence, section 2/2 e-114 Beta mitochondrial 101 Poor matches unknown 102 Poor matches unknown 103 Poor matches unknown 104 Poor matches unknown 105 Poor matches unknown 106 Poor matches unknown 107 Poor matches unknown


80 108 Poor matches unknown 109 >gi|28619247|gb|CB293790.1|CB293790 UCRCS01_06cg09_g1 Washington Navel orange cold acclimated flavedo & albedo cDNA library Citrus sinensis cDNA clone...8e-44 8e-44 Citrus 110 Poor matches unknown 111 Poor matches unknown 112 Poor matches unknown 113 Poor matches unknown 114 Poor matches unknown 115 1 dbj|C95562.1|C95562 C95562 Citrus unshiu Miyagawa-wase maturatio... 331 2e-88 2e-88 Citrus 117 Poor matches unknown 118 Poor matches unknown 119 Poor matches unknown 120 Poor matches unknown 121 Poor matches unknown 122 Poor matches unknown 123 Poor matches unknown 124 Poor matches unknown


81 125 Poor matches unknown 131 Poor matches unknown 132 Poor matches unknown 134 Poor matches unknown 135 Poor matches unknown 136 FAAC01-035B05.g 1e-30 Citrus 137 >gi|12249|emb|X03775.1|CHSOATP1 Spinach plastid genes atpI-H-F for ATP synthase CF(O) subunits IV, 6E-86 Spinach ATP synthase 138 Poor matches unknown 139 Poor matches unknown 140 1 gb|BQ623784.1|BQ623784 USDA-FP_00875 Ridge pineapple sweet orang... 220 6e-55 6e-55 Citrus 141 >gi|6693795|gb|AF112970.1|AF112970 Daucus carota strain Imperator STS3A mitochondrial DNA segment 3E-74 Daucus mitochondrial 1 gb|BE460852.1|BE460852 EST412271 tomato breaker fruit, TIGR Lyco... 5e-68 Tomato 142 1-gb|BM371429.2|BM371429 EBma08_SQ002_L04_R maternal, 28 DPA, no t... 9e-11 unknown 143 Poor matches unknown 144 Poor matches unknown 145 Poor matches unknown


82 146 >gi|18857892|dbj|AB061306.1| Citrus jambhiri mitochondrial ACRS gene for ACR toxin-sensitivity 4E-48 Citrus ACR toxin-sen. Contig4126 3e-16 Citrus 1 gb|BM358396.1|BM358396 GA__Ea0008M10r Gossypium arboreum 7-10 dp... 351 2e-94 2e-94 Gossypium 147 Poor matches unknown 148 >gi|5688942|dbj|AB017426.1| Oryza sativa (japonica cultivar-group) mitochondrial gene for ribosomal protein L5, complete cds 2E-59 Oryza mitochondrial 1 dbj|AV420567.1|AV420567 AV420567 Lotus japonicus young plants (t... 315 7e-84 7e-84 Lotus 149 CXJE02-097F04.g 2e-54 Citrus 150 CXJM02-089E08.g 2e-19 Citrus 151 1 gb|BM371381.2|BM371381 EBma08_SQ002_I05_R maternal, 28 DPA, no t... 86 1e-14 1e-14 152 CXContig831 3e-92 Citrus 153 Poor matches unknown 154 Poor matches unknown 155 1 gb|BI180911.1|BI180911 TY3H09 hepatocellular carcinoma expressio... 90 1e-15 1e-15 156 Poor matches unknown 157 1 gb|BI180911.1|BI180911 TY3H09 hepatocellular carcinoma expressio... 3e-14 158 1 gb|BM376133.1|BM376133 EBma01_SQ002_H07_R maternal, 4 DPA, no tr... 4e-12


83 159 1 gb|BM371429.2|BM371429 EBma08_SQ002_L04_R maternal, 28 DPA, no t... 7e-08 160 Poor matches unknown 161 1 gb|T44610.1|T44610 7873 Lambda-PRL2 Arabidopsis thaliana cDNA cl... 359 1e-96 1e-96 unknown 162 1 gb|BM371429.2|BM371429 EBma08_SQ002_L04_R maternal, 28 DPA, no t... 84 9e-14 9e-14 163 1 gb|BM371429.2|BM371429 EBma08_SQ002_L04_R maternal, 28 DPA, no t... 72 2e-10 2e-10 164 >gi|12830831|gb|AF320906.1|AF320906 Citrus unshiu metallothionein-like protein (MT45) gene, complete cds 3E-90 Citrus metallothionein Contig2243 2e-92 Citrus 1 gb|BQ624047.1|BQ624047 USDA-FP_01138 Ridge pineapple sweet orang... 1e-86 Citrus 165 1 gb|BQ623549.1|BQ623549 USDA-FP_00640 Ridge pineapple sweet orang... 80 3e-13 3e-13 Citrus unknown 166 1 gb|BQ624621.1|BQ624621 USDA-FP_01712 Ridge pineapple sweet orange 1e-96 Citrus 167 Poor matches unknown 168 1 emb|AL729032.1|AL729032 AL729032 Danio rerio embryonic inner ear... 58 3e-06 3e-06 169 1 gb|BQ414420.1|BQ414420 GA__Ed0086E05r Gossypium arboreum 7-10 dp... 60 2e-07 170 Poor matches unknown


LIST OF REFERENCES Agrios GN (1997) Introduction to plant pathology. In GN Agrios, ed, Plant Pathology, Ed 4. Academic Press Inc, pp 3-41 Albrigo LG, Syvertsen JP, Young RH (1986) Stress symptoms of citrus trees in successive stages of decline due to blight. J. Am. Soc.Hort. Sci. 111: 465-470 Albrigo LG, Timmer LW, Derrick KS, Tucker DPH, Graham JH (1993) Failure to transmit citrus blight by limb grafts. In International Organization of Citrus Virologists, Vol 12. University of California, New Delhi, pp 127-130 Albrigo LG, Young RH (1980) Phloem zinc accumulation in citrus trees with blight. Hortscience 15: 394-394 Albrigo LG, Young RH (1981) Phloem zinc accumulation in citrus trees affected with blight. Hortscience 16: 158-160 Allen M (2000) A seed is planted. In: The history of Florida citrus. In Florida Grower, Vol mid-August edition, pp 10-13 Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25: 3389-3402 Banzatto DA, Kronka SN (1992) Experimentao Agrcola. FUNEP-UNESP, Jaboticabal Berger R (1998) A causa e o controle do declnio dos Citros. Laranja 19: 91-105 Brazma A, Hingamp P, Quackenbush J, Sherlock G, Spellman P, Stoeckert C, Aach J, Ansorge W, Ball CA, Causton HC, Gaasterland T, Glenisson P, Holstege FC, Kim IF, Markowitz V, Matese JC, Parkinson H, Robinson A, Sarkans U, Schulze-Kremer S, Stewart J, Taylor R, Vilo J, Vingron M (2001) Minimum information about a microarray experiment (MIAME)-toward standards for microarray data. Nat Genet 29: 365-371 84


85 Bausher MG (1990) Electrophoretic and immunological evidence of unique proteins in leaves of citrus trees: application to citrus blight detection. Electrophoresis 11: 830-834 Callies T (2000) Reclaiming Florida's water. In Florida Grower, Vol September edition, pp 8-12 Ceccardi TL, Barthe GA, Derrick KS (1998) A novel protein associated with citrus blight has sequence similarities to expansin. Plant Mol Biol 38: 775-783 Chuaqui RF, Bonner RF, Best CJ, Gillespie JW, Flaig MJ, Hewitt SM, Phillips JL, Krizman DB, Tangrea MA, Ahram M, Linehan WM, Knezevic V, Emmert-Buck MR (2002) Post-analysis follow-up and validation of microarray experiments. Nat Genet 32 Suppl: 509-514 Cohen M (1968) Citrus blight and blight-like diseases. Citrus Industry 47: 12-26 Cohen M (1974) Diagnosis of young tree decline, blight and sand hill decline of citrus by measurement of water uptake using gravity injection. Plant Disease Reporter 58: 801-805 Cohen M, Pelosi RR, Brlansky RH (1983) Nature and location of xylem blockage structures in trees with citrus blight. Phytopathology 73: 1125-1130 Colebatch G, Kloska S, Trevaskis B, Freund S, Altmann T, Udvardi MK (2002) Novel aspects of symbiotic nitrogen fixation uncovered by transcript profiling with cDNA arrays. Mol Plant Microbe Interact 15: 411-420 Costa AS, Grant TJ, Moreira S (1954) Behavior of various citrus rootstock-scion combinations following inoculation with mild and severe strains of tristeza virus. In Florida State Horticultural Society, Vol 67, Miami Beach, pp 26-30 Deng Z, Huang S, Ling P, Yu C, Tao Q, Chen C, Wendell MK, Zhang HB, Gmitter FG, Jr. (2001) Fine genetic mapping and BAC contig development for the citrus tristeza virus resistance gene locus in Poncirus trifoliata (Raf.). Mol Genet Genomics 265: 739-747 Derrick KS, Beretta MJ, Barthe GA, Kayim M (2003) Strains of citrus tristeza virus predominately found in roots with implications for citrus blight and citrus sudden death. Phytopathology 93: S20 Derrick KS, Beretta MJ, Barthe GA, Kayim M, Harakava R (2003) Identification of strains of Citrus tristeza virus by subtraction hybridization. Plant Disease 87: 1355-1359


86 Derrick KS, Lee RF, Brlansky RH, Timmer LW, Hewitt BG, Barthe GA (1990) Proteins associated with citrus blight. Plant Disease 74: 168-170 Derrick KS, Timmer LW (2000) Citrus blight and other diseases of recalcitrant etiology. Annu Rev Phytopathol 38: 181-205 Diatchenko L, Lau YF, Campbell AP, Chenchik A, Moqadam F, Huang B, Lukyanov S, Lukyanov K, Gurskaya N, Sverdlov ED, Siebert PD (1996) Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries. Proc Natl Acad Sci U S A 93: 6025-6030 Donson J, Fang Y, Espiritu-Santo G, Xing W, Salazar A, Miyamoto S, Armendarez V, Volkmuth W (2002) Comprehensive gene expression analysis by transcript profiling. Plant Mol Biol 48: 75-97 Eisen MB, Spellman PT, Brown PO, Botstein D (1998) Cluster analysis and display of genome-wide expression patterns. Proc Natl Acad Sci U S A 95: 14863-14868 Fanta N, Ortega X, Perez LM (2003) The development of Alternaria alternata is prevented by chitinases and beta-1,3-glucanases from citrus limon seedlings. Biol Res 36: 411-420 Fawcett HS, Lee HA (1926) Citrus Diseases and their Control, 1st. Ed. McGraw-Hill New York. [etc.] Fegeros K, Zervas G, Stamouli S, Apostolaki E (1995) Nutritive value of dried citrus pulp and its effect on milk yield and milk composition of lactating ewes. J Dairy Sci 78: 1116-1121 Gaasterland T, Bekiranov S (2000) Making the most of microarray data. Nat Genet 24: 204-206 Hopkins DL (1987) Xylem-limited bacteria cause blight symptoms in citrus. Phytopathology 77: 641-641 Hopkins DL (1988) Production of diagnostic symptoms of blight in citrus inoculated with Xylella fastidiosa. Plant Disease 72: 432-435 Lee RF, Marais LJ, Timmer LW, Graham JH (1984) Syringe injection of water into the trunk a rapid diagnostic-test for citrus blight. Plant Disease 68: 511-513 Lewandowski M (2000) Formulating frozen concentrate. In: The history of Florida Citrus. In Florida Grower, Vol mid-august edition, pp 44-48


87 Lindbeck AGC, Brlansky RH (1998) Xylem plugging in feeder roots from blight-affected citrus trees. Phytopathology 88: S54 Lindbeck AGC, Brlansky RH (2000) Cytology of fibrous roots from citrus blight-affected trees. Plant Disease 84: 164-167 Mackay IM, Arden KE, Nitsche A (2002) Real-time PCR in virology. Nucleic Acids Res 30: 1292-1305 Marais LJ, Lee RF (1990) Experimental transmission of citrus blight in South Africa. In International organization of citrus virologists. University of California, pp 261-264 Mawassi M, Gafny R, Bar-Joseph M (1993) Nucleotide sequence of the coat protein gene of citrus tristeza virus: comparison of biologically diverse isolates collected in Israel. Virus Genes 7: 265-275 Moreira S (1980) Histria da citricultura no Brasil. In O Rodriguez, Vigas, F, ed, Citricultura Brasileir. Fund. Cargill, Campinas, pp 1-28 Nemec S (1994) Stress-related compounds in blight-diseased citrus xylem fluid associated with Fusarium solani naphthazarin toxins. Phytopathology 84: 870 Nemec S, Bustillo B, Obannon JH, Patterson M (1982) Effects of fungicides and nematicides on citrus blight in Florida. Phytopathology 72: 360-360 Oliveira AC, Vallim MA, Semighini CP, Araujo WL, Goldman GH, Machado MA (2002) Quantification of Xylella fastidiosa from citrus trees by real-time polymerase chain reaction assay. Phytopathology 92: 1048-1054 Paiva LV, DeSouza M, Lopes MA, Paiva E (1997) Identification and isolation of proteins found only in plants with citrus decline. Pesq. Agr. Bras. 32: 559-564 Pompeu JR. J (2001) Rootstocks and scions in the citriculture of the So Paulo state. In World Congress of the International Society of Citrus Nurseryman, 6th., pp 75-82 Rafter JJ (2002) Scientific basis of biomarkers and benefits of functional foods for reduction of disease risk: cancer. The British Journal of Nutrition 88: s219-s224 Rhoads AS (1936) Blight: a non-parasitic disease of citrus trees. University of Florida Agricultural Experiment Station, Gainesville, Fla. Rizhsky L, Liang H, Mittler R (2002) The combined effect of drought stress and heat shock on gene expression in tobacco. Plant Physiol 130: 1143-1151

PAGE 100

88 Rossetti VV, Beretta MJG, Teixeira ARR (1991) Experimental transmission of declinio by approach-root-grafting in So Paulo State, Brazil. In International organization of citrus virologists, Vol 11. University of California, Orlando, pp 250-255 Scheideler M, Schlaich NL, Fellenberg K, Beissbarth T, Hauser NC, Vingron M, Slusarenko AJ, Hoheisel JD (2002) Monitoring the switch from housekeeping to pathogen defense metabolism in Arabidopsis thaliana using cDNA arrays. J Biol Chem 277: 10555-10561 Seki M, Narusaka M, Abe H, Kasuga M, Yamaguchi-Shinozaki K, Carninci P, Hayashizaki Y, Shinozaki K (2001) Monitoring the expression pattern of 1300 Arabidopsis genes under drought and cold stresses by using a full-length cDNA microarray. Plant Cell 13: 61-72 Seki M, Shinozaki K, Ishida J, Nakajima M, Enju A, Sakurai T, Satou M, Akiyama K, Iida K, Oono Y (2003) [Arabidopsis functional genomics using full-length cDNAs]. Tanpakushitsu Kakusan Koso 48: 1890-1898 Stoeckert CJ, Jr., Causton HC, Ball CA (2002) Microarray databases: standards and ontologies. Nat Genet 32 Suppl: 469-473 Swingle WT, Webber HJ (1896) The principal diseases of citrus fruits in Florida. In GP Office, ed. USDA, p 50 Taylor KC, Albrigo LG, Chase CD (1996) Purification of a Zn-binding phloem protein with sequence identity to chitin-binding proteins. Plant Physiol 110: 657-664 Taylor KC, Ellis DR (1995) A zinc-binding protein in citrus with homology to plant chitinases. Hortscience 30: 900 Taylor KC, Ellis DR, Paiva LV (2002) Purification of a zinc binding protein from xylem of Citrus jambhiri. Journal of the Am. Soc. Hort. Sci. 127: 718-723 Timmer LW, Graham JH (1992) Nontransmission of citrus blight by soil. Plant Disease 76: 323-323 Timmer LW, Lee RF, Brlansky RH, Graham JH, L.G. A, Derrick KS, Tucker DPH (1992) The infectious nature of citrus blight. In Florida State Horticultural Society Annual Meeting, Vol 105, Orlando, pp 21-26 Tucker DPH, Lee RF, Timmer LW, Albrigo LG, Brlansky RH (1984) Experimental Transmission of Citrus Blight. Plant Disease 68: 979-980 van den Boom J, Wolter M, Kuick R, Misek DE, Youkilis AS, Wechsler DS, Sommer C, Reifenberger G, Hanash SM (2003) Characterization of gene

PAGE 101

89 expression profiles associated with glioma progression using oligonucleotide-based microarray analysis and real-time reverse transcription-polymerase chain reaction. Am J Pathol 163: 1033-1043 Wutscher HK (1989) Soil Ph and extractable elements under blight-affected and healthy citrus trees on six Florida USA soils. J. Am. Soc. for Hort. Sci. 114: 611-614 Wutscher HK, Hardesty CA (1979) Ammonium, nitrite, and nitrate nitrogen levels in the soil under blight-affected and healthy citrus trees. Co. in Soil Sci. Plant Anal. 10: 1495-1503 Wutscher HK, Schwarz RE, Campiglia HG, Moreira CS, Rossetti V (1980) Blight-like citrus tree declines in south-america and South-Africa. Hortscience 15: 588-590 Xiong LZ, Lee MW, Qi M, Yang YN (2001) Identification of defense-related rice genes by suppression subtractive hybridization and differential screening. Mol. Plant-Mic. Int. 14: 685-692 Yang ZN, Mathews DM, Dodds JA, Mirkov TE (1999) Molecular characterization of an isolate of citrus tristeza virus that causes severe symptoms in sweet orange. Virus Genes 19: 131-142 Young RH, Albrigo LG, Cohen M, Castle WS (1982) Rates of blight incidence in trees on Carrizo citrange and other rootstocks. Proc. of the Fl. State Hort. Soc. 95: 76-78 List of web-pages ABECITRUS (Source: http://www.abecitrus.com.br last accessed April 07, 2004). AMBION (Source: http://www.ambion.com/ last accessed Octpber 10, 2003). APPLIED BIOSYSTEMS RESOURCES (Source: http://www.appliedbiosystems.com/index.cfm last accessed December 10, 2003). BCM TOOLS (Source: http://searchlauncher.bcm.tmc.edu/seq-util/seq-util.html last accessed April, 10, 2003). CLONTECH (Source: http://www.bdbiosciences.com/clontech/ last accessed September 15, 2001).

PAGE 102

90 CREC (Source: http://www.lal.ufl.edu last accessed April 07, 2004). DORAK (Source: http://dorakmt.tripod.com/genetics/realtime.html last accessed on January 10, 2004). EXPASY CHITIN BINDING DOMAIN (source: http://us.expasy.org/cgi-bin/prosite-search-ac?pdoc00620 last accessed June 1, 2004). FAO (Source: http://apps.fao.org last accessed April 07, 2004). FUNDECITRUS (Source: http://www.fundecitrus.com.br last accessed April 07, 2004). IMAGER SYSTEM (Source: http://www.amershambiosciences.com last accessed April 15, 2004). PROMEGA (Source: http://www.promega.com/vectors/ last accessed on September 15, 2001) QIAGEN (Source: http://www1.qiagen.com last accessed July 15, 2001). TAIR DATABANK (source: http://www.arabidopsis.org/ last accessed June 1, 2004). UNIVERSITY OF FLORIDA SEQUENCING CORE (Source: http://www.biotech.ufl.edu/ last accessed April, 15, 2003). USDA (Source: http://www.nass.usda.gov/fl last accessed April 07, 2004). VECSCREEN SEARCH SOFTWARE (Source: http://www.ncbi.nlm.nih.gov/VecScreen/ last accessed April 10, 2002).

PAGE 103

BIOGRAPHICAL SKETCH Eduardo Fermino Carlos was born on February 27, 1967, in Votuporanga, State of So Paulo, Brazil. He was actively exposed to routine farming life and discovered a great interest in agriculture and general science. He graduated in 1990 in agronomic engineering at the University of Londrina (UEL), and started to work as consultant for citrus and other fruit growers. He received a master degree in 1996 at the State University of So Paulo (UNESP) working with molecular techniques in citrus, and a plant breeding specialist degree at the University of Wageningen (IAC) in 1998. He worked as scientific researcher for Fundecitrus from 1995 to 1998 and for Sylvio Moreira Citrus Center in 1998, before receiving a scholarship from CNPq, a Brazilian federal agency, to accomplish doctoral training abroad. This manuscript details his work in the Plant Molecular and Cellular Biology program at the University of Florida, under the supervision of Dr. Gloria Moore and Dr. Kenneth Derrick. 91

xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20110114_AAAABC INGEST_TIME 2011-01-14T09:21:29Z PACKAGE UFE0006602_00001
1051975 F20110114_AAASTX carlos_e_Page_020f.jp2
6512 F20110114_AAASVA carlos_e_Page_043thm.jpg
9140 F20110114_AAASUL carlos_e_Page_031.QC.jpg
5359 F20110114_AAASTY carlos_e_Page_021thm.jpg
19125 F20110114_AAASVB carlos_e_Page_044.QC.jpg
21847 F20110114_AAASUM carlos_e_Page_032.QC.jpg
1051922 F20110114_AAASTZ carlos_e_Page_021f.jp2
5287 F20110114_AAASVC carlos_e_Page_044thm.jpg
5858 F20110114_AAASUN carlos_e_Page_032thm.jpg
19170 F20110114_AAASVD carlos_e_Page_046.QC.jpg
23045 F20110114_AAASUO carlos_e_Page_033.QC.jpg
844137 F20110114_AAASVE carlos_e_Page_046f.jp2
4777 F20110114_AAASUP carlos_e_Page_034thm.jpg
21204 F20110114_AAASVF carlos_e_Page_047.QC.jpg
23075 F20110114_AAASUQ carlos_e_Page_036.QC.jpg
998421 F20110114_AAASVG carlos_e_Page_048f.jp2
6289 F20110114_AAASUR carlos_e_Page_036thm.jpg
24671 F20110114_AAASVH carlos_e_Page_050.QC.jpg
1043408 F20110114_AAASUS carlos_e_Page_036f.jp2
6584 F20110114_AAASVI carlos_e_Page_050thm.jpg
5633 F20110114_AAASUT carlos_e_Page_037thm.jpg
1051822 F20110114_AAASVJ carlos_e_Page_050f.jp2
4918 F20110114_AAASUU carlos_e_Page_038thm.jpg
543009 F20110114_AAASVK carlos_e_Page_051f.jp2
22291 F20110114_AAASUV carlos_e_Page_039.QC.jpg
20627 F20110114_AAASVL carlos_e_Page_052.QC.jpg
6275 F20110114_AAASUW carlos_e_Page_039thm.jpg
983042 F20110114_AAASWA carlos_e_Page_063f.jp2
26171 F20110114_AAASUX carlos_e_Page_040.QC.jpg
4012 F20110114_AAASWB carlos_e_Page_064thm.jpg
5516 F20110114_AAASVM carlos_e_Page_052thm.jpg
20304 F20110114_AAASUY carlos_e_Page_041.QC.jpg
960589 F20110114_AAASWC carlos_e_Page_064f.jp2
5615 F20110114_AAASVN carlos_e_Page_053thm.jpg
21829 F20110114_AAASUZ carlos_e_Page_042.QC.jpg
1051952 F20110114_AAASWD carlos_e_Page_065f.jp2
859756 F20110114_AAASVO carlos_e_Page_053f.jp2
1036130 F20110114_AAASWE carlos_e_Page_066f.jp2
6006 F20110114_AAASVP carlos_e_Page_055thm.jpg
1051958 F20110114_AAASWF carlos_e_Page_067f.jp2
23675 F20110114_AAASVQ carlos_e_Page_056.QC.jpg
1051984 F20110114_AAASWG carlos_e_Page_068f.jp2
1051979 F20110114_AAASVR carlos_e_Page_056f.jp2
24579 F20110114_AAASWH carlos_e_Page_069.QC.jpg
23432 F20110114_AAASVS carlos_e_Page_057.QC.jpg
1051939 F20110114_AAASWI carlos_e_Page_069f.jp2
6478 F20110114_AAASVT carlos_e_Page_057thm.jpg
1051960 F20110114_AAASWJ carlos_e_Page_070f.jp2
1051969 F20110114_AAASVU carlos_e_Page_057f.jp2
23752 F20110114_AAASWK carlos_e_Page_071.QC.jpg
19600 F20110114_AAASVV carlos_e_Page_058.QC.jpg
5762 F20110114_AAASVW carlos_e_Page_059thm.jpg
6460 F20110114_AAASWL carlos_e_Page_071thm.jpg
18436 F20110114_AAASVX carlos_e_Page_060.QC.jpg
416012 F20110114_AAASXA carlos_e_Page_082f.jp2
1051943 F20110114_AAASWM carlos_e_Page_071f.jp2
6471 F20110114_AAASVY carlos_e_Page_062thm.jpg
5820 F20110114_AAASXB carlos_e_Page_083thm.jpg
20911 F20110114_AAASVZ carlos_e_Page_063.QC.jpg
11936 F20110114_AAASXC carlos_e_Page_084.QC.jpg
5400 F20110114_AAASWN carlos_e_Page_072thm.jpg
4974 F20110114_AAASXD carlos_e_Page_085thm.jpg
23661 F20110114_AAASWO carlos_e_Page_073.QC.jpg
930875 F20110114_AAASXE carlos_e_Page_085f.jp2
5880 F20110114_AAASWP carlos_e_Page_075thm.jpg
14673 F20110114_AAASXF carlos_e_Page_086.QC.jpg
25609 F20110114_AAASWQ carlos_e_Page_076.QC.jpg
527807 F20110114_AAASXG carlos_e_Page_086f.jp2
19047 F20110114_AAASWR carlos_e_Page_077.QC.jpg
484520 F20110114_AAASXH carlos_e_Page_087f.jp2
5280 F20110114_AAASWS carlos_e_Page_077thm.jpg
4134 F20110114_AAASXI carlos_e_Page_088thm.jpg
859965 F20110114_AAASWT carlos_e_Page_077f.jp2
2018 F20110114_AAASAA carlos_e_Page_089.txt
17322 F20110114_AAASXJ carlos_e_Page_089.QC.jpg
21817 F20110114_AAASWU carlos_e_Page_078.QC.jpg
1781 F20110114_AAASAB carlos_e_Page_094.txt
4868 F20110114_AAASXK carlos_e_Page_089thm.jpg
5940 F20110114_AAASWV carlos_e_Page_078thm.jpg
34934 F20110114_AAASAC carlos_e_Page_094.pro
12772 F20110114_AAASXL carlos_e_Page_090.QC.jpg
6345 F20110114_AAASWW carlos_e_Page_079thm.jpg
2893 F20110114_AAASAD carlos_e_Page_030.txt
3887 F20110114_AAASYA carlos_e_Page_103thm.jpg
3784 F20110114_AAASXM carlos_e_Page_090thm.jpg
5734 F20110114_AAASWX carlos_e_Page_080thm.jpg
8423998 F20110114_AAASAE carlos_e_Page_041.tif
98528 F20110114_AAASYB UFE0006602_00001.mets FULL
4035 F20110114_AAASXN carlos_e_Page_092thm.jpg
921509 F20110114_AAASWY carlos_e_Page_080f.jp2
890623 F20110114_AAASAF carlos_e_Page_047f.jp2
5767 F20110114_AAASWZ carlos_e_Page_081thm.jpg
9538 F20110114_AAASAG carlos_e_Page_082.QC.jpg
14792 F20110114_AAASXO carlos_e_Page_093.QC.jpg
16973 F20110114_AAASAH carlos_e_Page_045.QC.jpg
4384 F20110114_AAASXP carlos_e_Page_093thm.jpg
F20110114_AAASAI carlos_e_Page_086.tif
481054 F20110114_AAASXQ carlos_e_Page_093f.jp2
21851 F20110114_AAASAJ carlos_e_Page_080.QC.jpg
571843 F20110114_AAASXR carlos_e_Page_094f.jp2
F20110114_AAASAK carlos_e_Page_030.tif
14669 F20110114_AAASXS carlos_e_Page_095.QC.jpg
4310 F20110114_AAASAL carlos_e_Page_087thm.jpg
3912 F20110114_AAASXT carlos_e_Page_095thm.jpg
48683 F20110114_AAASBA carlos_e_Page_062.pro
F20110114_AAASAM carlos_e_Page_050.tif
6539 F20110114_AAASXU carlos_e_Page_098thm.jpg
F20110114_AAASBB carlos_e_Page_044.tif
52664 F20110114_AAASAN carlos_e_Page_076.pro
1051977 F20110114_AAASXV carlos_e_Page_098f.jp2
5781 F20110114_AAASBC carlos_e_Page_004thm.jpg
1242 F20110114_AAASAO carlos_e_Page_088.txt
6776 F20110114_AAASXW carlos_e_Page_099thm.jpg
F20110114_AAASBD carlos_e_Page_039.tif
37868 F20110114_AAASAP carlos_e_Page_046.pro
1051985 F20110114_AAASXX carlos_e_Page_099f.jp2
5998 F20110114_AAASBE carlos_e_Page_063thm.jpg
F20110114_AAASAQ carlos_e_Page_091.tif
15708 F20110114_AAASXY carlos_e_Page_102.QC.jpg
67667 F20110114_AAASBF carlos_e_Page_011.jpg
20524 F20110114_AAASAR carlos_e_Page_013.QC.jpg
687846 F20110114_AAASXZ carlos_e_Page_102f.jp2
3635 F20110114_AAASBG carlos_e_Page_005thm.jpg
50778 F20110114_AAASAS carlos_e_Page_059.pro
F20110114_AAASBH carlos_e_Page_084.tif
6757 F20110114_AAASAT carlos_e_Page_076thm.jpg
F20110114_AAASBI carlos_e_Page_064.tif
14614 F20110114_AAASAU carlos_e_Page_091.QC.jpg
40389 F20110114_AAASBJ carlos_e_Page_053.pro
21665 F20110114_AAASAV carlos_e_Page_048.QC.jpg
24899 F20110114_AAASBK carlos_e_Page_023.QC.jpg
1829 F20110114_AAARWE carlos_e_Page_025.txt
17699 F20110114_AAASAW carlos_e_Page_038.QC.jpg
75683 F20110114_AAASBL carlos_e_Page_057.jpg
F20110114_AAARWF carlos_e_Page_063.tif
74956 F20110114_AAASCA carlos_e_Page_014.jpg
1164 F20110114_AAASBM carlos_e_Page_102.txt
46269 F20110114_AAARWG carlos_e_Page_017.pro
4126 F20110114_AAASAX carlos_e_Page_016thm.jpg
19659 F20110114_AAASCB carlos_e_Page_027.QC.jpg
5885 F20110114_AAASBN carlos_e_Page_035thm.jpg
22225 F20110114_AAARWH carlos_e_Page_075.QC.jpg
776432 F20110114_AAASAY carlos_e_Page_006f.jp2
90385 F20110114_AAASCC carlos_e_Page_097.jpg
34935 F20110114_AAASBO carlos_e_Page_060.pro
39427 F20110114_AAARWI carlos_e_Page_058.pro
996410 F20110114_AAASAZ carlos_e_Page_096f.jp2
26598 F20110114_AAASCD carlos_e_Page_103.pro
888038 F20110114_AAASBP carlos_e_Page_044f.jp2
3779 F20110114_AAARWJ carlos_e_Page_006thm.jpg
755 F20110114_AAASCE carlos_e_Page_082.txt
50659 F20110114_AAASBQ carlos_e_Page_069.pro
74828 F20110114_AAARWK carlos_e_Page_078.jpg
24120 F20110114_AAASCF carlos_e_Page_043.QC.jpg
1294 F20110114_AAASBR carlos_e_Page_012.txt
6577 F20110114_AAARWL carlos_e_Page_023thm.jpg
51704 F20110114_AAASCG carlos_e_Page_034.jpg
1051982 F20110114_AAARXA carlos_e_Page_039f.jp2
F20110114_AAASBS carlos_e_Page_029.tif
F20110114_AAARWM carlos_e_Page_042.tif
983872 F20110114_AAASCH carlos_e_Page_052f.jp2
F20110114_AAARXB carlos_e_Page_049.tif
18096 F20110114_AAASBT carlos_e_Page_085.QC.jpg
925821 F20110114_AAARWN carlos_e_Page_041f.jp2
57043 F20110114_AAASCI carlos_e_Page_006.jpg
1952 F20110114_AAARXC carlos_e_Page_020.txt
6224 F20110114_AAASBU carlos_e_Page_033thm.jpg
1925 F20110114_AAASCJ carlos_e_Page_010thm.jpg
2434 F20110114_AAARXD carlos_e_Page_100.txt
1104 F20110114_AAASBV carlos_e_Page_103.txt
1025276 F20110114_AAARWO carlos_e_Page_018f.jp2
1051944 F20110114_AAASCK carlos_e_Page_043f.jp2
46043 F20110114_AAARXE carlos_e_Page_085.pro
805757 F20110114_AAASBW carlos_e_Page_045f.jp2
693866 F20110114_AAARWP carlos_e_Page_089f.jp2
1856 F20110114_AAASCL carlos_e_Page_083.txt
F20110114_AAARXF carlos_e_Page_033.tif
6179 F20110114_AAASBX carlos_e_Page_065thm.jpg
722309 F20110114_AAARWQ carlos_e_Page_012f.jp2
39766 F20110114_AAASCM carlos_e_Page_011.pro
1534 F20110114_AAARXG carlos_e_Page_060.txt
21316 F20110114_AAARWR carlos_e_Page_010.jpg
514393 F20110114_AAASDA carlos_e_Page_084f.jp2
F20110114_AAASCN carlos_e_Page_082.tif
F20110114_AAARXH carlos_e_Page_075.tif
551971 F20110114_AAASBY carlos_e_Page_005f.jp2
F20110114_AAARWS carlos_e_Page_048.tif
52998 F20110114_AAASDB carlos_e_Page_081.pro
16264 F20110114_AAASCO carlos_e_Page_012.QC.jpg
2479 F20110114_AAARXI carlos_e_Page_081.txt
21341 F20110114_AAASBZ carlos_e_Page_035.QC.jpg
F20110114_AAARWT carlos_e_Page_014.tif
6055 F20110114_AAASDC carlos_e_Page_029thm.jpg
2590 F20110114_AAASCP carlos_e_Page_002.QC.jpg
3567 F20110114_AAARXJ carlos_e_Page_054thm.jpg
1935 F20110114_AAARWU carlos_e_Page_067.txt
57155 F20110114_AAASDD carlos_e_Page_060.jpg
4019 F20110114_AAASCQ carlos_e_Page_094thm.jpg
45139 F20110114_AAARXK carlos_e_Page_095.jpg
F20110114_AAARWV carlos_e_Page_067.tif
1702 F20110114_AAASDE carlos_e_Page_041.txt
17228 F20110114_AAASCR carlos_e_Page_034.QC.jpg
57214 F20110114_AAARXL carlos_e_Page_097.pro
68890 F20110114_AAARWW carlos_e_Page_083.jpg
5773 F20110114_AAASDF carlos_e_Page_041thm.jpg
799283 F20110114_AAASCS carlos_e_Page_060f.jp2
22668 F20110114_AAARXM carlos_e_Page_017.QC.jpg
76271 F20110114_AAARWX carlos_e_Page_071.jpg
23336 F20110114_AAASDG carlos_e_Page_030.QC.jpg
15011 F20110114_AAARYA carlos_e_Page_016.QC.jpg
F20110114_AAASCT carlos_e_Page_057.tif
6291 F20110114_AAARXN carlos_e_Page_019thm.jpg
349080 F20110114_AAARWY carlos_e_Page_074f.jp2
22987 F20110114_AAASDH carlos_e_Page_008.pro
1051859 F20110114_AAARYB carlos_e_Page_049f.jp2
6256 F20110114_AAASCU carlos_e_Page_067thm.jpg
1051964 F20110114_AAARXO carlos_e_Page_097f.jp2
1755 F20110114_AAARWZ carlos_e_Page_063.txt
21435 F20110114_AAASDI carlos_e_Page_081.QC.jpg
F20110114_AAARYC carlos_e_Page_021.tif
F20110114_AAASCV carlos_e_Page_035.tif
21309 F20110114_AAASDJ carlos_e_Page_049.QC.jpg
23302 F20110114_AAARYD carlos_e_Page_061.QC.jpg
2380 F20110114_AAARXP carlos_e_Page_099.txt
66969 F20110114_AAASDK carlos_e_Page_027.jpg
32671 F20110114_AAARYE carlos_e_Page_012.pro
5616 F20110114_AAASCW carlos_e_Page_066thm.jpg
2397 F20110114_AAARXQ carlos_e_Page_007.txt
2209 F20110114_AAASDL carlos_e_Page_049.txt
85467 F20110114_AAARYF carlos_e_Page_050.jpg
543804 F20110114_AAASCX carlos_e_Page_054f.jp2
1954 F20110114_AAARXR carlos_e_Page_101.txt
987419 F20110114_AAASEA carlos_e_Page_083f.jp2
F20110114_AAASDM carlos_e_Page_096.tif
9167 F20110114_AAARYG carlos_e_Page_074.QC.jpg
44935 F20110114_AAASCY carlos_e_Page_048.pro
15912 F20110114_AAARXS carlos_e_Page_087.QC.jpg
44937 F20110114_AAASEB carlos_e_Page_083.pro
20035 F20110114_AAASDN carlos_e_Page_096.QC.jpg
51054 F20110114_AAARYH carlos_e_Page_071.pro
300099 F20110114_AAARXT carlos_e_Page_001f.jp2
14643 F20110114_AAASEC carlos_e_Page_094.QC.jpg
43996 F20110114_AAASDO carlos_e_Page_032.pro
23705 F20110114_AAARYI carlos_e_Page_068.QC.jpg
43404 F20110114_AAASCZ carlos_e_Page_040.pro
F20110114_AAARXU carlos_e_Page_018.tif
F20110114_AAASED carlos_e_Page_065.tif
F20110114_AAASDP carlos_e_Page_006.tif
14143 F20110114_AAARYJ carlos_e_Page_088.QC.jpg
F20110114_AAARXV carlos_e_Page_103.tif
4425 F20110114_AAASEE carlos_e_Page_102thm.jpg
1179 F20110114_AAASDQ carlos_e_Page_016.txt
29525 F20110114_AAARYK carlos_e_Page_016.pro
33681 F20110114_AAARXW carlos_e_Page_095.pro
2273 F20110114_AAASEF carlos_e_Page_001thm.jpg
1301 F20110114_AAASDR carlos_e_Page_015.txt
F20110114_AAARYL carlos_e_Page_092.tif
672 F20110114_AAARXX carlos_e_Page_074.txt
24058 F20110114_AAASEG carlos_e_Page_098.QC.jpg
74171 F20110114_AAARZA carlos_e_Page_101.jpg
2876 F20110114_AAASDS carlos_e_Page_082thm.jpg
21857 F20110114_AAARYM carlos_e_Page_083.QC.jpg
F20110114_AAARXY carlos_e_Page_045.tif
16334 F20110114_AAASEH carlos_e_Page_010.pro
41886 F20110114_AAARZB carlos_e_Page_037.pro
8985 F20110114_AAASDT carlos_e_Page_019.pro
1813 F20110114_AAARYN carlos_e_Page_096.txt
1827 F20110114_AAARXZ carlos_e_Page_048.txt
24035 F20110114_AAASEI carlos_e_Page_005.pro
F20110114_AAARZC carlos_e_Page_020.tif
843 F20110114_AAASDU carlos_e_Page_021.txt
24987 F20110114_AAARYO carlos_e_Page_070.QC.jpg
18721 F20110114_AAASEJ carlos_e_Page_003.jpg
6268 F20110114_AAARZD carlos_e_Page_061thm.jpg
2220 F20110114_AAASDV carlos_e_Page_098.txt
1795 F20110114_AAARYP carlos_e_Page_032.txt
1826 F20110114_AAASEK carlos_e_Page_058.txt
5993 F20110114_AAARZE carlos_e_Page_047thm.jpg
5596 F20110114_AAASDW carlos_e_Page_030thm.jpg
51436 F20110114_AAASEL carlos_e_Page_012.jpg
509681 F20110114_AAARZF carlos_e_Page_088f.jp2
91907 F20110114_AAASDX carlos_e_Page_040.jpg
22318 F20110114_AAARYQ carlos_e_Page_055.QC.jpg
6315 F20110114_AAASEM carlos_e_Page_040thm.jpg
72692 F20110114_AAARZG carlos_e_Page_026.jpg
4978 F20110114_AAASDY carlos_e_Page_045thm.jpg
22105 F20110114_AAARYR carlos_e_Page_059.QC.jpg
F20110114_AAASFA carlos_e_Page_034.tif
74546 F20110114_AAASEN carlos_e_Page_061.jpg
77309 F20110114_AAARZH carlos_e_Page_069.jpg
F20110114_AAASDZ carlos_e_Page_058.tif
23474 F20110114_AAARYS carlos_e_Page_084.pro
5328 F20110114_AAASFB carlos_e_Page_060thm.jpg
2705 F20110114_AAASEO carlos_e_Page_031thm.jpg
5023 F20110114_AAARZI carlos_e_Page_028thm.jpg
54315 F20110114_AAARYT carlos_e_Page_014.pro
968059 F20110114_AAASFC carlos_e_Page_081f.jp2
41692 F20110114_AAASEP carlos_e_Page_041.pro
F20110114_AAARZJ carlos_e_Page_010.tif
47621 F20110114_AAARYU carlos_e_Page_016.jpg
323935 F20110114_AAASFD carlos_e_Page_090f.jp2
1024 F20110114_AAASEQ carlos_e_Page_034.txt
36590 F20110114_AAARZK carlos_e_Page_045.pro
13594 F20110114_AAARYV carlos_e_Page_092.QC.jpg
1051909 F20110114_AAASFE carlos_e_Page_101f.jp2
77007 F20110114_AAASER carlos_e_Page_070.jpg
71297 F20110114_AAARZL carlos_e_Page_096.jpg
4269 F20110114_AAARYW carlos_e_Page_051thm.jpg
42435 F20110114_AAASFF carlos_e_Page_051.jpg
F20110114_AAASES carlos_e_Page_099.tif
23018 F20110114_AAARZM carlos_e_Page_019.QC.jpg
571309 F20110114_AAARYX carlos_e_Page_095f.jp2
2006 F20110114_AAASFG carlos_e_Page_071.txt
1020493 F20110114_AAASET carlos_e_Page_055f.jp2
855509 F20110114_AAARZN carlos_e_Page_072f.jp2
F20110114_AAARYY carlos_e_Page_076.tif
942345 F20110114_AAASFH carlos_e_Page_037f.jp2
41890 F20110114_AAASEU carlos_e_Page_004.pro
60171 F20110114_AAARZO carlos_e_Page_077.jpg
1994 F20110114_AAARYZ carlos_e_Page_078.txt
44020 F20110114_AAASFI carlos_e_Page_063.pro
20331 F20110114_AAASEV carlos_e_Page_021.QC.jpg
1756 F20110114_AAARZP carlos_e_Page_053.txt
67735 F20110114_AAASFJ carlos_e_Page_063.jpg
338382 F20110114_AAASEW carlos_e_Page_008f.jp2
F20110114_AAARZQ carlos_e_Page_062f.jp2
15907 F20110114_AAASFK carlos_e_Page_074.pro
18606 F20110114_AAASEX carlos_e_Page_072.QC.jpg
6497 F20110114_AAASFL carlos_e_Page_069thm.jpg
2244 F20110114_AAASEY carlos_e_Page_085.txt
15864 F20110114_AAARZR carlos_e_Page_007.QC.jpg
5824 F20110114_AAASGA carlos_e_Page_101thm.jpg
47583 F20110114_AAASFM carlos_e_Page_033.pro
F20110114_AAASEZ carlos_e_Page_001.tif
1508 F20110114_AAARZS carlos_e_Page_003thm.jpg
F20110114_AAASGB carlos_e_Page_073.tif
F20110114_AAASFN carlos_e_Page_061f.jp2
61285 F20110114_AAARZT carlos_e_Page_044.jpg
1818 F20110114_AAASGC carlos_e_Page_075.txt
1431 F20110114_AAASFO carlos_e_Page_066.txt
50543 F20110114_AAARZU carlos_e_Page_043.pro
1051938 F20110114_AAASGD carlos_e_Page_040f.jp2
67931 F20110114_AAASFP carlos_e_Page_081.jpg
6436 F20110114_AAARZV carlos_e_Page_073thm.jpg
2678 F20110114_AAASGE carlos_e_Page_035.txt
23834 F20110114_AAASFQ carlos_e_Page_079.QC.jpg
57817 F20110114_AAARZW carlos_e_Page_038.jpg
1917 F20110114_AAASGF carlos_e_Page_072.txt
F20110114_AAASFR carlos_e_Page_056.tif
2091 F20110114_AAARZX carlos_e_Page_076.txt
73090 F20110114_AAASGG carlos_e_Page_039.jpg
32515 F20110114_AAASFS carlos_e_Page_042.pro
F20110114_AAARZY carlos_e_Page_026.tif
F20110114_AAASGH carlos_e_Page_094.tif
20713 F20110114_AAASFT carlos_e_Page_101.QC.jpg
75615 F20110114_AAARZZ carlos_e_Page_065.jpg
F20110114_AAASGI carlos_e_Page_040.tif
198837 F20110114_AAASFU carlos_e_Page_003f.jp2
22123 F20110114_AAASGJ carlos_e_Page_029.QC.jpg
F20110114_AAASFV carlos_e_Page_022.tif
F20110114_AAASGK carlos_e_Page_013.tif
494425 F20110114_AAASFW carlos_e_Page_091f.jp2
72345 F20110114_AAASGL carlos_e_Page_035.jpg
F20110114_AAASFX carlos_e_Page_003.tif
F20110114_AAASHA carlos_e_Page_032.tif
1051900 F20110114_AAASGM carlos_e_Page_059f.jp2
56269 F20110114_AAASFY carlos_e_Page_035.pro
1903 F20110114_AAASHB carlos_e_Page_052.txt
F20110114_AAASGN carlos_e_Page_062.tif
49313 F20110114_AAASFZ carlos_e_Page_079.pro
61256 F20110114_AAASHC carlos_e_Page_009.pro
71850 F20110114_AAASGO carlos_e_Page_017.jpg
1045322 F20110114_AAASHD carlos_e_Page_029f.jp2
7432 F20110114_AAASGP carlos_e_Page_100thm.jpg
66471 F20110114_AAASHE carlos_e_Page_004.jpg
6749 F20110114_AAASGQ carlos_e_Page_097thm.jpg
49595 F20110114_AAASHF carlos_e_Page_061.pro
19328 F20110114_AAASGR carlos_e_Page_053.QC.jpg
1949 F20110114_AAASHG carlos_e_Page_065.txt
46247 F20110114_AAASGS carlos_e_Page_026.pro
55863 F20110114_AAASHH carlos_e_Page_045.jpg
F20110114_AAASGT carlos_e_Page_026f.jp2
979238 F20110114_AAASHI carlos_e_Page_035f.jp2
47439 F20110114_AAASGU carlos_e_Page_094.jpg
4475 F20110114_AAASHJ carlos_e_Page_012thm.jpg
57339 F20110114_AAASGV carlos_e_Page_099.pro
845933 F20110114_AAASHK carlos_e_Page_058f.jp2
21705 F20110114_AAASGW carlos_e_Page_091.pro
18659 F20110114_AAASHL carlos_e_Page_082.pro
4346 F20110114_AAASGX carlos_e_Page_086thm.jpg
18058 F20110114_AAASHM carlos_e_Page_092.pro
558817 F20110114_AAASGY carlos_e_Page_024f.jp2
416 F20110114_AAASIA carlos_e_Page_003.txt
13425 F20110114_AAASHN carlos_e_Page_005.QC.jpg
783809 F20110114_AAASGZ carlos_e_Page_028f.jp2
43879 F20110114_AAASIB carlos_e_Page_093.jpg
F20110114_AAASHO carlos_e_Page_023.tif
F20110114_AAASIC carlos_e_Page_088.tif
45354 F20110114_AAASHP carlos_e_Page_086.jpg
26887 F20110114_AAASID carlos_e_Page_047.pro
1030619 F20110114_AAASHQ carlos_e_Page_078f.jp2
53058 F20110114_AAASIE carlos_e_Page_050.pro
41601 F20110114_AAASHR carlos_e_Page_072.pro
980 F20110114_AAASIF carlos_e_Page_054.txt
760945 F20110114_AAASHS carlos_e_Page_034f.jp2
89564 F20110114_AAASIG carlos_e_Page_099.jpg
77375 F20110114_AAASIH carlos_e_Page_042.jpg
61210 F20110114_AAASHT carlos_e_Page_064.jpg
F20110114_AAASII carlos_e_Page_076f.jp2
65714 F20110114_AAASHU carlos_e_Page_013.jpg
66059 F20110114_AAASIJ carlos_e_Page_052.jpg
22317 F20110114_AAASHV carlos_e_Page_018.QC.jpg
F20110114_AAASIK carlos_e_Page_047.tif
26969 F20110114_AAASHW carlos_e_Page_100.QC.jpg
75728 F20110114_AAASIL carlos_e_Page_068.jpg
17697 F20110114_AAASHX carlos_e_Page_028.QC.jpg
F20110114_AAASJA carlos_e_Page_101.tif
53250 F20110114_AAASIM carlos_e_Page_098.pro
62019 F20110114_AAASHY carlos_e_Page_072.jpg
63569 F20110114_AAASJB carlos_e_Page_007.jpg
5866 F20110114_AAASIN carlos_e_Page_049thm.jpg
1051978 F20110114_AAASHZ carlos_e_Page_030f.jp2
3977 F20110114_AAASJC carlos_e_Page_091thm.jpg
44888 F20110114_AAASIO carlos_e_Page_055.pro
43471 F20110114_AAASJD carlos_e_Page_096.pro
53037 F20110114_AAASIP carlos_e_Page_023.pro
5842 F20110114_AAASJE carlos_e_Page_042thm.jpg
20225 F20110114_AAASIQ carlos_e_Page_037.QC.jpg
4408 F20110114_AAASJF carlos_e_Page_009thm.jpg
383532 F20110114_AAASIR carlos_e_Page_092f.jp2
42915 F20110114_AAASJG carlos_e_Page_013.pro
2496 F20110114_AAASIS carlos_e_Page_014.txt
1016195 F20110114_AAASJH carlos_e_Page_075f.jp2
741120 F20110114_AAASIT carlos_e_Page_038f.jp2
17292 F20110114_AAASJI carlos_e_Page_031.pro
17873 F20110114_AAASIU carlos_e_Page_015.QC.jpg
698 F20110114_AAASJJ carlos_e_Page_031.txt
1912 F20110114_AAASIV carlos_e_Page_039.txt
967 F20110114_AAASJK carlos_e_Page_008.txt
F20110114_AAASIW carlos_e_Page_017.tif
13672 F20110114_AAASJL carlos_e_Page_051.QC.jpg
6205 F20110114_AAASIX carlos_e_Page_017thm.jpg
940470 F20110114_AAASKA carlos_e_Page_013f.jp2
27798 F20110114_AAASJM carlos_e_Page_074.jpg
15438 F20110114_AAASIY carlos_e_Page_064.QC.jpg
F20110114_AAASJN carlos_e_Page_097.tif
5062 F20110114_AAASIZ carlos_e_Page_058thm.jpg
54758 F20110114_AAASKB carlos_e_Page_009.jpg
6474 F20110114_AAASJO carlos_e_Page_056thm.jpg
6598 F20110114_AAASKC carlos_e_Page_070thm.jpg
3410 F20110114_AAASJP carlos_e_Page_084thm.jpg
F20110114_AAASKD carlos_e_Page_085.tif
1030100 F20110114_AAASJQ carlos_e_Page_017f.jp2
F20110114_AAASKE carlos_e_Page_102.tif
2698 F20110114_AAASJR carlos_e_Page_006.txt
1009748 F20110114_AAASKF carlos_e_Page_032f.jp2
F20110114_AAASJS carlos_e_Page_081.tif
2545 F20110114_AAASKG carlos_e_Page_074thm.jpg
1549 F20110114_AAASJT carlos_e_Page_047.txt
6386 F20110114_AAASKH carlos_e_Page_068thm.jpg
979606 F20110114_AAASJU carlos_e_Page_027f.jp2
75901 F20110114_AAASKI carlos_e_Page_073.jpg
974427 F20110114_AAASJV carlos_e_Page_015f.jp2
5807 F20110114_AAASKJ carlos_e_Page_048thm.jpg
F20110114_AAASJW carlos_e_Page_037.tif
1161 F20110114_AAASKK carlos_e_Page_051.txt
F20110114_AAASJX carlos_e_Page_062.txt
2250 F20110114_AAASLA carlos_e_Page_050.txt
14154 F20110114_AAASKL carlos_e_Page_103.QC.jpg
735 F20110114_AAASJY carlos_e_Page_090.txt
F20110114_AAASLB carlos_e_Page_054.tif
67758 F20110114_AAASKM carlos_e_Page_006.pro
1051980 F20110114_AAASJZ carlos_e_Page_079f.jp2
70663 F20110114_AAASKN carlos_e_Page_018.jpg
8007 F20110114_AAASLC carlos_e_Page_001.QC.jpg
F20110114_AAASKO carlos_e_Page_090.tif
F20110114_AAASLD carlos_e_Page_066.tif
F20110114_AAASKP carlos_e_Page_053.tif
F20110114_AAASLE carlos_e_Page_033f.jp2
24647 F20110114_AAASKQ carlos_e_Page_097.QC.jpg
40151 F20110114_AAASLF carlos_e_Page_027.pro
12739 F20110114_AAASKR carlos_e_Page_054.QC.jpg
54925 F20110114_AAASLG carlos_e_Page_089.jpg
44640 F20110114_AAASKS carlos_e_Page_075.pro
1051949 F20110114_AAASLH carlos_e_Page_100f.jp2
F20110114_AAASKT carlos_e_Page_091.txt
384943 F20110114_AAASLI carlos_e_Page_031f.jp2
910 F20110114_AAASKU carlos_e_Page_064.txt
23727 F20110114_AAASLJ carlos_e_Page_065.QC.jpg
F20110114_AAASKV carlos_e_Page_002.tif
F20110114_AAASLK carlos_e_Page_073f.jp2
80202 F20110114_AAASKW carlos_e_Page_076.jpg
1973 F20110114_AAASMA carlos_e_Page_056.txt
69792 F20110114_AAASLL carlos_e_Page_025.jpg
F20110114_AAASKX carlos_e_Page_004.tif
23242 F20110114_AAASMB carlos_e_Page_020.QC.jpg
22978 F20110114_AAASLM carlos_e_Page_067.QC.jpg
2080 F20110114_AAASKY carlos_e_Page_022.txt
69436 F20110114_AAASMC carlos_e_Page_048.jpg
2020 F20110114_AAASLN carlos_e_Page_069.txt
5285 F20110114_AAASKZ carlos_e_Page_046thm.jpg
33665 F20110114_AAASLO carlos_e_Page_090.jpg
20958 F20110114_AAASMD carlos_e_Page_066.QC.jpg
971061 F20110114_AAASLP carlos_e_Page_042f.jp2
38330 F20110114_AAASME carlos_e_Page_084.jpg
1883 F20110114_AAASLQ carlos_e_Page_018.txt
F20110114_AAASMF carlos_e_Page_083.tif
1594 F20110114_AAASLR carlos_e_Page_044.txt
23536 F20110114_AAASMG carlos_e_Page_034.pro
609561 F20110114_AAASLS carlos_e_Page_103f.jp2
530 F20110114_AAASMH carlos_e_Page_001.txt
23559 F20110114_AAASLT carlos_e_Page_062.QC.jpg
28303 F20110114_AAASMI carlos_e_Page_001.jpg
2104 F20110114_AAASLU carlos_e_Page_040.txt
151173 F20110114_AAASMJ UFE0006602_00001.xml
24955 F20110114_AAASLV carlos_e_Page_099.QC.jpg
5492 F20110114_AAASLW carlos_e_Page_096thm.jpg
1011812 F20110114_AAASLX carlos_e_Page_025f.jp2
70381 F20110114_AAASNA carlos_e_Page_032.jpg
8399 F20110114_AAASMM carlos_e_Page_002.jpg
F20110114_AAASLY carlos_e_Page_078.tif
73272 F20110114_AAASNB carlos_e_Page_033.jpg
41171 F20110114_AAASMN carlos_e_Page_005.jpg
1674 F20110114_AAASLZ carlos_e_Page_086.txt
70699 F20110114_AAASNC carlos_e_Page_036.jpg
26679 F20110114_AAASMO carlos_e_Page_008.jpg
65682 F20110114_AAASND carlos_e_Page_037.jpg
61879 F20110114_AAASMP carlos_e_Page_015.jpg
64727 F20110114_AAASNE carlos_e_Page_041.jpg
79364 F20110114_AAASMQ carlos_e_Page_019.jpg
76036 F20110114_AAASNF carlos_e_Page_043.jpg
74991 F20110114_AAASMR carlos_e_Page_020.jpg
58820 F20110114_AAASNG carlos_e_Page_046.jpg
69530 F20110114_AAASMS carlos_e_Page_021.jpg
71724 F20110114_AAASNH carlos_e_Page_047.jpg
78796 F20110114_AAASMT carlos_e_Page_022.jpg
78142 F20110114_AAASNI carlos_e_Page_049.jpg
78770 F20110114_AAASMU carlos_e_Page_023.jpg
63061 F20110114_AAASNJ carlos_e_Page_053.jpg
41812 F20110114_AAASMV carlos_e_Page_024.jpg
39830 F20110114_AAASNK carlos_e_Page_054.jpg
56871 F20110114_AAASMW carlos_e_Page_028.jpg
37512 F20110114_AAASOA carlos_e_Page_092.jpg
71432 F20110114_AAASNL carlos_e_Page_055.jpg
72243 F20110114_AAASMX carlos_e_Page_029.jpg
83486 F20110114_AAASOB carlos_e_Page_098.jpg
76716 F20110114_AAASNM carlos_e_Page_056.jpg
82327 F20110114_AAASMY carlos_e_Page_030.jpg
96482 F20110114_AAASOC carlos_e_Page_100.jpg
63410 F20110114_AAASNN carlos_e_Page_058.jpg
30262 F20110114_AAASMZ carlos_e_Page_031.jpg
50487 F20110114_AAASOD carlos_e_Page_102.jpg
77474 F20110114_AAASNO carlos_e_Page_059.jpg
45412 F20110114_AAASOE carlos_e_Page_103.jpg
74494 F20110114_AAASNP carlos_e_Page_062.jpg
73636 F20110114_AAASNQ carlos_e_Page_066.jpg
F20110114_AAASOF carlos_e_Page_005.tif
74613 F20110114_AAASNR carlos_e_Page_067.jpg
F20110114_AAASOG carlos_e_Page_007.tif
71341 F20110114_AAASNS carlos_e_Page_075.jpg
F20110114_AAASOH carlos_e_Page_008.tif
74432 F20110114_AAASNT carlos_e_Page_079.jpg
F20110114_AAASOI carlos_e_Page_009.tif
69897 F20110114_AAASNU carlos_e_Page_080.jpg
F20110114_AAASOJ carlos_e_Page_011.tif
31819 F20110114_AAASNV carlos_e_Page_082.jpg
F20110114_AAASOK carlos_e_Page_012.tif
65463 F20110114_AAASNW carlos_e_Page_085.jpg
F20110114_AAASOL carlos_e_Page_015.tif
47259 F20110114_AAASNX carlos_e_Page_087.jpg
F20110114_AAASPA carlos_e_Page_059.tif
F20110114_AAASOM carlos_e_Page_016.tif
42136 F20110114_AAASNY carlos_e_Page_088.jpg
F20110114_AAASPB carlos_e_Page_060.tif
F20110114_AAASON carlos_e_Page_019.tif
44645 F20110114_AAASNZ carlos_e_Page_091.jpg
F20110114_AAASPC carlos_e_Page_061.tif
F20110114_AAASOO carlos_e_Page_024.tif
F20110114_AAASPD carlos_e_Page_068.tif
F20110114_AAASOP carlos_e_Page_025.tif
F20110114_AAASPE carlos_e_Page_069.tif
F20110114_AAASOQ carlos_e_Page_027.tif
F20110114_AAASPF carlos_e_Page_070.tif
F20110114_AAASOR carlos_e_Page_028.tif
F20110114_AAASOS carlos_e_Page_031.tif
F20110114_AAASPG carlos_e_Page_071.tif
F20110114_AAASOT carlos_e_Page_036.tif
F20110114_AAASPH carlos_e_Page_072.tif
F20110114_AAASOU carlos_e_Page_038.tif
F20110114_AAASPI carlos_e_Page_074.tif
F20110114_AAASOV carlos_e_Page_043.tif
F20110114_AAASPJ carlos_e_Page_077.tif
F20110114_AAASOW carlos_e_Page_046.tif
F20110114_AAASPK carlos_e_Page_079.tif
F20110114_AAASOX carlos_e_Page_051.tif
52363 F20110114_AAASQA carlos_e_Page_022.pro
F20110114_AAASPL carlos_e_Page_080.tif
F20110114_AAASOY carlos_e_Page_052.tif
25273 F20110114_AAASQB carlos_e_Page_024.pro
F20110114_AAASPM carlos_e_Page_087.tif
F20110114_AAASOZ carlos_e_Page_055.tif
44073 F20110114_AAASQC carlos_e_Page_025.pro
F20110114_AAASPN carlos_e_Page_089.tif
31628 F20110114_AAASQD carlos_e_Page_028.pro
F20110114_AAASPO carlos_e_Page_093.tif
46237 F20110114_AAASQE carlos_e_Page_029.pro
F20110114_AAASPP carlos_e_Page_095.tif
60213 F20110114_AAASQF carlos_e_Page_030.pro
F20110114_AAASPQ carlos_e_Page_098.tif
45846 F20110114_AAASQG carlos_e_Page_036.pro
F20110114_AAASPR carlos_e_Page_100.tif
10099 F20110114_AAASPS carlos_e_Page_001.pro
32168 F20110114_AAASQH carlos_e_Page_038.pro
1357 F20110114_AAASPT carlos_e_Page_002.pro
47599 F20110114_AAASQI carlos_e_Page_039.pro
9302 F20110114_AAASPU carlos_e_Page_003.pro
39770 F20110114_AAASQJ carlos_e_Page_044.pro
59401 F20110114_AAASPV carlos_e_Page_007.pro
49631 F20110114_AAASQK carlos_e_Page_049.pro
31010 F20110114_AAASPW carlos_e_Page_015.pro
31681 F20110114_AAASRA carlos_e_Page_086.pro
27178 F20110114_AAASQL carlos_e_Page_051.pro
46698 F20110114_AAASPX carlos_e_Page_018.pro
26819 F20110114_AAASRB carlos_e_Page_087.pro
42519 F20110114_AAASQM carlos_e_Page_052.pro
49606 F20110114_AAASPY carlos_e_Page_020.pro
25340 F20110114_AAASRC carlos_e_Page_088.pro
24258 F20110114_AAASQN carlos_e_Page_054.pro
20146 F20110114_AAASPZ carlos_e_Page_021.pro
39968 F20110114_AAASRD carlos_e_Page_089.pro
50327 F20110114_AAASQO carlos_e_Page_056.pro
14837 F20110114_AAASRE carlos_e_Page_090.pro
50484 F20110114_AAASQP carlos_e_Page_057.pro
28523 F20110114_AAASRF carlos_e_Page_093.pro
14054 F20110114_AAASQQ carlos_e_Page_064.pro
58613 F20110114_AAASRG carlos_e_Page_100.pro
49292 F20110114_AAASQR carlos_e_Page_065.pro
46091 F20110114_AAASRH carlos_e_Page_101.pro
29811 F20110114_AAASQS carlos_e_Page_066.pro
49121 F20110114_AAASQT carlos_e_Page_067.pro
28103 F20110114_AAASRI carlos_e_Page_102.pro
50000 F20110114_AAASQU carlos_e_Page_068.pro
124 F20110114_AAASRJ carlos_e_Page_002.txt
52168 F20110114_AAASQV carlos_e_Page_070.pro
1693 F20110114_AAASRK carlos_e_Page_004.txt
50195 F20110114_AAASQW carlos_e_Page_073.pro
962 F20110114_AAASRL carlos_e_Page_005.txt
35054 F20110114_AAASQX carlos_e_Page_077.pro
1662 F20110114_AAASSA carlos_e_Page_037.txt
2457 F20110114_AAASRM carlos_e_Page_009.txt
45386 F20110114_AAASQY carlos_e_Page_078.pro
1467 F20110114_AAASSB carlos_e_Page_038.txt
41807 F20110114_AAASQZ carlos_e_Page_080.pro
1648 F20110114_AAASSC carlos_e_Page_042.txt
651 F20110114_AAASRN carlos_e_Page_010.txt
2021 F20110114_AAASSD carlos_e_Page_043.txt
1741 F20110114_AAASRO carlos_e_Page_011.txt
1481 F20110114_AAASSE carlos_e_Page_045.txt
1806 F20110114_AAASRP carlos_e_Page_013.txt
F20110114_AAASSF carlos_e_Page_046.txt
1865 F20110114_AAASRQ carlos_e_Page_017.txt
1836 F20110114_AAASSG carlos_e_Page_055.txt
392 F20110114_AAASRR carlos_e_Page_019.txt
2003 F20110114_AAASSH carlos_e_Page_057.txt
2079 F20110114_AAASRS carlos_e_Page_023.txt
2158 F20110114_AAASSI carlos_e_Page_059.txt
1073 F20110114_AAASRT carlos_e_Page_024.txt
1840 F20110114_AAASRU carlos_e_Page_026.txt
2005 F20110114_AAASSJ carlos_e_Page_061.txt
1916 F20110114_AAASRV carlos_e_Page_027.txt
1977 F20110114_AAASSK carlos_e_Page_068.txt
1566 F20110114_AAASRW carlos_e_Page_028.txt
20610 F20110114_AAASTA carlos_e_Page_004.QC.jpg
2063 F20110114_AAASSL carlos_e_Page_070.txt
1851 F20110114_AAASRX carlos_e_Page_029.txt
950668 F20110114_AAASTB carlos_e_Page_004f.jp2
2001 F20110114_AAASSM carlos_e_Page_073.txt
1941 F20110114_AAASRY carlos_e_Page_033.txt
14820 F20110114_AAASTC carlos_e_Page_006.QC.jpg
1484 F20110114_AAASSN carlos_e_Page_077.txt
1867 F20110114_AAASRZ carlos_e_Page_036.txt
4174 F20110114_AAASTD carlos_e_Page_007thm.jpg
1948 F20110114_AAASSO carlos_e_Page_079.txt
848961 F20110114_AAASTE carlos_e_Page_007f.jp2
1961 F20110114_AAASSP carlos_e_Page_080.txt
8008 F20110114_AAASTF carlos_e_Page_008.QC.jpg
945 F20110114_AAASSQ carlos_e_Page_084.txt
2356 F20110114_AAASTG carlos_e_Page_008thm.jpg
1374 F20110114_AAASSR carlos_e_Page_087.txt
16048 F20110114_AAASTH carlos_e_Page_009.QC.jpg
873 F20110114_AAASSS carlos_e_Page_092.txt
749919 F20110114_AAASTI carlos_e_Page_009f.jp2
1462 F20110114_AAASST carlos_e_Page_093.txt
6034 F20110114_AAASTJ carlos_e_Page_010.QC.jpg
F20110114_AAASSU carlos_e_Page_095.txt
2387 F20110114_AAASSV carlos_e_Page_097.txt
241091 F20110114_AAASTK carlos_e_Page_010f.jp2
2232659 F20110114_AAASSW carlos_e.pdf
19824 F20110114_AAASTL carlos_e_Page_011.QC.jpg
947 F20110114_AAASSX carlos_e_Page_002thm.jpg
25393 F20110114_AAASUA carlos_e_Page_022.QC.jpg
5312 F20110114_AAASTM carlos_e_Page_011thm.jpg
32062 F20110114_AAASSY carlos_e_Page_002f.jp2
6628 F20110114_AAASUB carlos_e_Page_022thm.jpg
927704 F20110114_AAASTN carlos_e_Page_011f.jp2
5321 F20110114_AAASSZ carlos_e_Page_003.QC.jpg
F20110114_AAASUC carlos_e_Page_022f.jp2
5639 F20110114_AAASTO carlos_e_Page_013thm.jpg
1051913 F20110114_AAASUD carlos_e_Page_023f.jp2
23061 F20110114_AAASTP carlos_e_Page_014.QC.jpg
13593 F20110114_AAASUE carlos_e_Page_024.QC.jpg
6178 F20110114_AAASTQ carlos_e_Page_014thm.jpg
3913 F20110114_AAASUF carlos_e_Page_024thm.jpg
1031575 F20110114_AAASTR carlos_e_Page_014f.jp2
22395 F20110114_AAASUG carlos_e_Page_025.QC.jpg
5118 F20110114_AAASTS carlos_e_Page_015thm.jpg
5896 F20110114_AAASUH carlos_e_Page_025thm.jpg
661351 F20110114_AAASTT carlos_e_Page_016f.jp2
22550 F20110114_AAASUI carlos_e_Page_026.QC.jpg
5991 F20110114_AAASTU carlos_e_Page_018thm.jpg
6278 F20110114_AAASUJ carlos_e_Page_026thm.jpg
1051880 F20110114_AAASTV carlos_e_Page_019f.jp2
5373 F20110114_AAASUK carlos_e_Page_027thm.jpg

Permanent Link: http://ufdc.ufl.edu/UFE0006602/00001

Material Information

Title: Transcriptional profiling on trees affected by citrus blight and identification of an etiological contrast potentially associated with the disease
Physical Description: Mixed Material
Language: English
Creator: Carlos, Eduardo Fermino ( Dissertant )
Moore, Gloria A. ( Thesis advisor )
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2004
Copyright Date: 2004


Subjects / Keywords: Plant Molecular and Cellular Biology thesis, Ph.D
Dissertations, Academic -- UF -- Plant Molecular and Cellular Biology


Abstract: Citrus blight is an important citrus disease in Florida (USA) and São Paulo (Brazil), primarily affecting yield in adult plants and compromising maintenance of entire commercial blocks. Blight is associated with rootstock choice, but, at present, is of unknown etiology. Therefore, the objectives of this study were to identify differentially transcribed genes and uncover etiological contrasts under non and citrus blight conditions. Roots of healthy and blighted Rough lemon (Citrus jambhiri Lush) rootstock supporting Valencia sweet orange (Citrus sinensis L. Osbeck cv. Valencia) canopy were collected from a central Florida area. Total RNA was obtained and RT-PCR was performed enriching for messenger transcripts. Subtracted cDNA libraries were created and around 140 clones were arrayed onto nylon membranes. Independent RNA sources from feeder roots of ten healthy and ten blighted trees were labeled with P33, hybridized overnight with the membranes and analyzed under an imager system. Selected clones were validated by RT quantitative real time PCR. The results indicated that citrus blight was able to affect the transcriptional levels of certain genes in a similar pattern among different replicates. The level of response was dependent of the assessed group of plants. One of the clones had sequence similarities to a citrus EST and to a potential ubiquitin subunit. Another one had similarities to a citrus chitinase, helping to deduce a candidate sequence for the blight associated P5 gene. Three genes had higher transcriptional levels under blight condition and did not respond to cold and drought stresses. The blight associated P12 had higher levels in mildly than in fully blighted trees. Further characterization of these genes may contribute to the understanding and control of citrus blight. In another experiment, citrus tristeza virus (CTV) genes were observed in the libraries. The transcriptional level of the P27 gene (divergent coat protein gene) of CTV was far more abundant in roots of blighted than in healthy Carrizo citrange, which is considered to be resistant to variant forms of CTVs. It remains to be investigated if CTV causes or enhances blight, or only grows better in feeder roots of already affected trees.
General Note: Title from title page of source document.
General Note: Document formatted into pages; contains 103 pages.
General Note: Includes vita.
Thesis: Thesis (Ph.D.)--University of Florida, 2004.
Bibliography: Includes bibliographical references.
General Note: Text (Electronic thesis) in PDF format.

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0006602:00001

Permanent Link: http://ufdc.ufl.edu/UFE0006602/00001

Material Information

Title: Transcriptional profiling on trees affected by citrus blight and identification of an etiological contrast potentially associated with the disease
Physical Description: Mixed Material
Language: English
Creator: Carlos, Eduardo Fermino ( Dissertant )
Moore, Gloria A. ( Thesis advisor )
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Publication Date: 2004
Copyright Date: 2004


Subjects / Keywords: Plant Molecular and Cellular Biology thesis, Ph.D
Dissertations, Academic -- UF -- Plant Molecular and Cellular Biology


Abstract: Citrus blight is an important citrus disease in Florida (USA) and São Paulo (Brazil), primarily affecting yield in adult plants and compromising maintenance of entire commercial blocks. Blight is associated with rootstock choice, but, at present, is of unknown etiology. Therefore, the objectives of this study were to identify differentially transcribed genes and uncover etiological contrasts under non and citrus blight conditions. Roots of healthy and blighted Rough lemon (Citrus jambhiri Lush) rootstock supporting Valencia sweet orange (Citrus sinensis L. Osbeck cv. Valencia) canopy were collected from a central Florida area. Total RNA was obtained and RT-PCR was performed enriching for messenger transcripts. Subtracted cDNA libraries were created and around 140 clones were arrayed onto nylon membranes. Independent RNA sources from feeder roots of ten healthy and ten blighted trees were labeled with P33, hybridized overnight with the membranes and analyzed under an imager system. Selected clones were validated by RT quantitative real time PCR. The results indicated that citrus blight was able to affect the transcriptional levels of certain genes in a similar pattern among different replicates. The level of response was dependent of the assessed group of plants. One of the clones had sequence similarities to a citrus EST and to a potential ubiquitin subunit. Another one had similarities to a citrus chitinase, helping to deduce a candidate sequence for the blight associated P5 gene. Three genes had higher transcriptional levels under blight condition and did not respond to cold and drought stresses. The blight associated P12 had higher levels in mildly than in fully blighted trees. Further characterization of these genes may contribute to the understanding and control of citrus blight. In another experiment, citrus tristeza virus (CTV) genes were observed in the libraries. The transcriptional level of the P27 gene (divergent coat protein gene) of CTV was far more abundant in roots of blighted than in healthy Carrizo citrange, which is considered to be resistant to variant forms of CTVs. It remains to be investigated if CTV causes or enhances blight, or only grows better in feeder roots of already affected trees.
General Note: Title from title page of source document.
General Note: Document formatted into pages; contains 103 pages.
General Note: Includes vita.
Thesis: Thesis (Ph.D.)--University of Florida, 2004.
Bibliography: Includes bibliographical references.
General Note: Text (Electronic thesis) in PDF format.

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0006602:00001

This item has the following downloads:

Full Text







Copyright 2004


Eduardo Fermino Carlos

This work is dedicated to my wife Darlene, to my daughters Luisa and Ligia, to my
parents Norival and Maria, to my aunt Josefa, and to all my friends and family that shared
their love and care. Along the way, many things were surpassed and our dear aunt Neula,
uncles Otavio and Waldemar, and friend Beatriz Nielsen will always be in our hearts.


I thank my family and friends for the unconditional support and encouragement

during all the steps of the program. I thank CNPq, a Brazilian Federal Agency, for

sponsoring most of my graduate studies abroad and for their overall attention with the

fellows. I thank Dr. Gloria Moore, my major professor, for the outstanding support

during the whole process.

During my academic and professional life I have been fortunate to meet people that

helped me not only as scientific mentors but also as examples of positive attitudes. I

especially thank my friends Eliana Lemos, Luiz Carlos Donadio, Marcos Machado, Julia

Beretta, Ken Derrick, Gene Albrigo, Steve Futch and Jose Eduardo Lima, among others. I

also thank Dr. Chris Chase and Dr. Nancy Denslow for their intelligent insights and

enthusiasm, which always brought positive perspectives about the ongoing work and

essential source of stimulus. I thank Dr. Ken Cline for his suggestions and scientific


A regular student life normally requires patience, patience and dedication. Fifield

Hall demanded the same efforts, and more. I thank all my friends that shared their care

and friendships. I specially want to thank Gary Barthe, Mukaddes Kayim, Marty

Dekkers, Abdul Al-Saadi, Basma El Yacoubi, Ufuk Koca, Karen Champ, Kim Niblett,

Manjunath Keremane, Methap Sahin, Vicente Febres, Abeer Khalaf, Maureen Meyerson,

Juliana and Gustavo Monge, Ricardo Harakava, Cristina Moreira, Dirceu Mattos, Maria

Luisa Targon, Eduardo Stuchi, Otavio Sempionato, Jose Antonio da Silva, Aline and

Marcelo Carvalho, Georgia and Jose Carlos Dubeux, Livia and Steel Vasconcelos, Jose

Carlos Rodrigues, Juliana and Flavio Silvestre, Camila and L. Augusto de Paula, Ana

Carolina and Vitor Lira, Carolina and Antonio Martins, Eliezer Martins, Maria de Lurdes

Mendes, Marisol d'Avila, Tania Querido, Nancy Velasquez, David Moraga, Li Liu, Bill

Farmerie, Jason Blum, Natalia, Duy Nguyen, Patrick Larkin, Jannet Kocerha, Vishal

Patel, Mike McCaffery, Carole Dabney-Smith, Fabien Garard, Richard Berger, Denise

Tombolato, Fabricio Rodrigues, Gisele Martins, Angela and Wayne M. Jurick II,

Adrianna Castafieda, Ronald French and many other friends. There is no end to this list...

Thanks to all my friends.

I started in the Department of Plant Pathology and I thank Dr. Bill Zettler and Dr.

George Agrios for the attention and dedication that I received during the application

process and as a new graduate student.


A C K N O W L E D G M E N T S ................................................................................................. iv

LIST OF TABLES .............................................. viii

LIST OF FIGURES ........................................ .............. ix

ABSTRACT .................................................... ................. xi


1 IN TRODU CTION .................................................................. .. ...... ... ............... 1

Im portance of C itriculture ....................... ........................................................1......
C itrus in Sdo P aulo and F lorida ...................................... ...................... ...............3...


C itru s B light E tiology .. ......... ............... .......... ................................. ... ... 6
Citrus Blight is Affected by the Employed Rootstock .........................................10
O b je ctiv e s ............................................................................................................... .. 12


R oot Sam ples and cD N A Synthesis ........................ ....................... .....................13
Building the Suppressive Subtracted cDNA Libraries...........................................14
Sequence Analysis and Selection of Clones ................ ................................... 17

UNDER NON AND CITRUS BLIGHT CONDITIONS ................ ..................... 20

E xperim mental D design ............... ................ .............................................. 21
A rray D esign and Spot Features............................................................ ................ 2 1
Sam ple Preparation and Labeling.................. .................................................... 22
H ybridizations and P aram eters .............................................................. ................ 24
M easurem ents and Specifications.......................................................... ................ 24
N orm alization and C controls ................................................................... ................ 26
The Visual Evaluation of the M em branes ............................................. ................ 27

T he C lu ster A naly sis ... ..................................................................... .. .......... ... 29
The C contrast of M eans A nalysis............................................................ ................ 31
Com paring the Evaluation M ethods ...................................................... ................ 36
Combining the Results for the Selected Clones .................................... ................ 36


Quantitative Real Time PCR was the Method of Choice......................................43
The Selected Clones and the Characteristics of the Probes...................................45
Collecting and Preparing the Sam ples................................................... ................ 49
Reverse Transcriptase (RT) and PCR Reactions................................... ................ 50
Relative Quantification of the Transcriptional Levels of the Selected Genes............51
The Potential Biological M meaning of the Clone 109 ............................. ................ 57
A Tentative Test to Verify the Effect of Cold and Drought Stresses...................... 58
The Potential Effect of Redundancy and Gene Families.......................................61

ASSOCIATED WITH THE CITRUS BLIGHT DISEASE ..................................... 63

The First Screening of the Subtracted Libraries.................................... ................ 64
Other CTV Genes were also Found in both Subtracted Libraries...........................68
Quantitative Evaluation of the P27 Candidate Gene in the Blighted Trees ...............68

7 C O N C L U SIO N S .................................................. .............................................. 7 1



L IST O F R E F E R E N C E S ...................................................................................................84

BIO GR APH ICAL SK ETCH .................................................................... ................ 91


Table page

4-1. Transcriptional pattern of the selected clones. .................................... ................ 37

4-2. Blast search analysis for som e clones ................................................... ................ 38

5-1. Characteristics of the chosen probes. ............................................... ................ 47

6-1. The clone E8-13 had homolog sequences matching different isolates of the
citrus tristeza virus (C T V ) ....................................... ........................ ................ 66

6-2. Other sequences with homology to CTV genes found in the blighted minus
healthy (B-H) and healthy minus blighted (H-B) subtracted libraries ..................68

A-1. Blast analysis based on nucleotide sequences of each individual clone.................73


Figure page

1-1. C itrus around the w orld ...................................................................... ...............2...

1-2. The citrus belts in Florida and Sdo Paulo ............................................... ...............3...

2-1. Characteristics and sym ptom s of citrus blight......................................... ...............7...

2-2. T ransm mission of citrus blight ....................................... ........................ ...............9...

3-1. cDN A synthesis enriching for m RN A ................................................... ................ 15

3-2. Making the subtracted "healthy" and "blighted" libraries.................................... 16

3-3. Analyses performed for each sequenced clone............... .....................................18

4-1. Preparing individual clones for the cDNA array. ............................. ................22

4 -2 A rray d e sig n ............................................................................................................. 2 3

4-3. Quality param eter for each m em brane ................................................. ................ 26

4-4. V isual evaluation of the m em brane pairs ............................................. ................ 28

4-5. Transcriptional profiling of the candidate genes. ............................. ................30

4-6. Contrast of m eans analysis of selected clones....................................... ................ 35

4-7. Blast-X of the clone 6 using the non-redundant protein database...........................37

4-8. Clone 38 has sequence homology to citrus chitinases ..........................................39

4-9. Transcriptional profiling of the clone 38 (a chitinase homolog) and other
clo n e s.................................................................................................... ....... .. 4 0

4-10. The clone 109 had sequence homology to citrus ESTs. .....................................41

5-1. Designing a candidate sequence for the P5 gene. .................................................46

5-2. Relative PCR efficiency plot of the clone 109 against the normalizer 18S. .............48

5-3. Exam ples of real tim e PCR reactions ................................................... ................ 52

5-4. Relative transcriptional levels of the selected genes. ..........................................54

5-5. Contrasts comparing the effect of cold and drought treatments on the relative
transcriptional level of the clone 109 and other clones. .....................................60

6-1. The virtual northern blot of the B H clones. ..................................... ................ 65

6-2. The transcripts of the p27 candidate gene were abundant in the roots....................69

Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy



Eduardo Fermino Carlos

August 2004

Chair: Dr. Gloria A. Moore
Cochair: Dr. Kenneth S. Derrick
Major Department: Plant Molecular and Cellular Biology

Citrus blight is an important citrus disease in Florida (USA) and Sao Paulo (Brazil),

primarily affecting yield in adult plants and compromising maintenance of entire

commercial blocks. Blight is associated with rootstock choice, but, at present, is of

unknown etiology. Therefore, the objectives of this study were to identify differentially

transcribed genes and uncover etiological contrasts under non and citrus blight

conditions. Roots of healthy and blighted Rough lemon (Citrus jambhiri Lush) rootstock

supporting Valencia sweet orange (Citrus sinensis L. Osbeck cv. Valencia) canopy were

collected from a central Florida area. Total RNA was obtained and RT-PCR was

performed enriching for messenger transcripts. Subtracted cDNA libraries were created

and around 140 clones were arrayed onto nylon membranes. Independent RNA sources

from feeder roots of ten healthy and ten blighted trees were labeled with P33, hybridized

overnight with the membranes and analyzed under an imager system. Selected clones

were validated by RT quantitative real time PCR. The results indicated that citrus blight

was able to affect the transcriptional levels of certain genes in a similar pattern among

different replicates. The level of response was dependent of the assessed group of plants.

One of the clones had sequence similarities to a citrus EST and to a potential ubiquitin

subunit. Another one had similarities to a citrus chitinase, helping to deduce a candidate

sequence for the blight associated P5 gene. Three genes had higher transcriptional levels

under blight condition and did not respond to cold and drought stresses. The blight

associated P12 had higher levels in mildly than in fully blighted trees. Further

characterization of these genes may contribute to the understanding and control of citrus

blight. In another experiment, citrus tristeza virus (CTV) genes were observed in the

libraries. The transcriptional level of the P27 gene (divergent coat protein gene) of CTV

was far more abundant in roots of blighted than in healthy Carrizo citrange, which is

considered to be resistant to variant forms of CTVs. It remains to be investigated if CTV

causes or enhances blight, or only grows better in feeder roots of already affected trees.


The importance of one industry in the agriculture segment and the context where

science exists to help society were considered in this study. The result was a true

excitement not only because the focus of this research is (still) an unresolved real

problem of citrus, but also because the search for information involved molecular biology

and related fields.

Importance of Citriculture

In addition to tasting good, citrus is a well known source of vitamin C and

antioxidants. It is also believed to have anti-cancer properties (Rafter, 2002), and

processed peel and pulp are frequently used for animal feed (Fegeros et al., 1995).

Because of its nutritional relevance, citrus is an important industry world-wide, raising

economies at macro and local levels by supporting social development directly with jobs

and with secondary industries and services. Citrus is commercially present in more than a

hundred countries in all five continents, primarily within tropical and subtropical regions.

The total production has consistently increased in the last 40 years, and, more recently,

reached one hundred million tons yearly (Figure 1-1). The early citrus pioneers would

probably be astonished by this level of production, but the modern industry has through

the years achieved efficiency, flexibility and high quality standards.

Citrus was first brought to the new world by the Portuguese and Spanish explorers

at the beginning of the XVI century (Moreira, 1980; Allen, 2000). By the second half of

the XIX century, the USA and Brazil had established fresh fruit companies, and the

frozen concentrated technology, developed in the 1940s in Florida (Lewandowski, 2000),

increased the demand for citrus juices.

A) Total production of citrus from 1961
to 2000


1 00

60 -

40 -


61 65 70 75 80 85 90 95 00

* Brazil


B) 102 million tons of citrus were produced
in 2003
o United States of America
14% 8% 0 China
4 U Mexico
ao Spain
1% 11 9 India
2% rtU Iran Islamic Rep of
2% 4wq [] Nigeria
o2 9% Italy
2% 13% Egypt
2% / Argentina
3% 5 Turkey
U Pakistan
3% South Africa
4% 5 12% Japan
4% U Greece
6% 6% U Morocco
o Thailand

Figure 1-1. Citrus around the world. A) The total production of citrus has increased
almost 5 fold in the last 40 years. Brazil took the lead in production over the
USA only after the Florida freezes during the 1980s. B) Citrus is
commercially present in 138 countries according to FAO, with China, Mexico
and Spain ranking respectively 3rd, 4th and 5th in total production in 2003.
(Source: FAOSTAT data, 2004, http://apps.fao.org, last accessed April 07,

Many changes in production systems have been necessary to meet the ongoing

needs of growing markets and the demands of new challenges, such as changes in

organoleptical concerns, unexpected drought and cold stresses, outbreaks of pests and

diseases and raises of political barriers, to name just a few. Consequently, production

constraints have been overcome by the use of grafted plants to replace seedlings, changes

in rootstocks, selection of new cultivars, relocation of production fields and charges in

diplomatic battles (Fawcett and Lee, 1926; Moreira, 1980; and others). Literature is

available for all transitions suggesting that the need for research in citriculture is not a

recent event. In fact, despite frequent new challenges, in the last decades citrus has

surpassed other important fruit crops such as bananas, apples and grapes in production

according to FAO (Source: FAOSTAT data, 2004, http://apps.fao.org, last accessed

April 07, 2004).

Citrus in Sao Paulo and Florida

The two major citrus producing areas in Brazil and the USA are the states of Sao

Paulo and Florida (Figure 1-2).

A) Florida

B) Sao Paulo


Figure 1-2. The citrus belts in Florida and Sao Paulo. A) The industry in Florida has
moved to warmer southern areas after the freezes of the 1980s, and the major
producers are nowadays Polk and Hendry counties, respectively, in the central
and southwestern regions. B) In Sao Paulo, the northern region is drier and
warmer than the southeastern areas and the major citrus companies have their
headquarters around Araraquara city.

Supported by good environmental conditions, efficient systems and high quality

products, both Florida and Sao Paulo have industries primarily devoted to processed

citrus juice, especially oranges, supplying most of the world demand for this commodity.

While Florida has focused its efforts on the North America market, Sao Paulo dominates

the European one. The social and economic consequences of abrupt changes in the citrus

industry of both Sao Paulo and Florida would affect, at least to a certain extent, the

around 400,000 jobs and 3 billion dollars in exports yearly in Brazil, and the 89,000 jobs

and 4 billion dollars in sales in the United States. More details and other statistics can be

seen at ABECITRUS (Source: http://www.abecitrus.com.br, last accessed April 07,

2004), FUNDECITRUS (Source: http://www.fundecitrus.com.br, last accessed April 07,

2004), CREC (Source: http://www.lal.ufl.edu, last accessed April 07, 2004), and USDA

(Source: http://www.nass.usda.gov/fl, last accessed April 07, 2004).

Both socially and economically, there are similarities and also differences in citrus

industries worldwide. However, all contribute to supply different markets with

distinguished quality fruits: citrus fruits. Therefore, citrus is an important segment of

agriculture and demanding of research, which, ultimately, may help in the stabilization of



There are many constraints to citrus production around the world and citrus blight,

in Portuguese "declinio", is one of them. It has caused impressive annual losses of around

60 million dollars in Sdo Paulo and 100 million dollars in Florida (Derrick and Timmer,

2000). Since its appearance in Florida during the second half of the 1800s, it has been a

top concern for the Florida citrus industry, probably only approached by the damage

caused by freezes in the past. Swingle and Webber mentioned that blight was first

reported by Underwood in 1891, and also, that affected trees had been seen two decades

earlier (Swingle and Webber, 1896). Symptomatic plants undergo a slow tree decline,

rather than a sudden disruption in development, as suggested by the given name in


Citrus blight has distinct characteristics not observed in declines caused by other

diseases, such as Phytophthora sp., Tristeza, and others. Early symptoms, which occur in

mature productive trees normally older than five to six years, include loss of the intense

color of leaves and other green tissues; the expression of specific proteins (Bausher,

1990; Derrick et al., 1990; Taylor et al., 1996; Paiva et al., 1997); and complexation and

translocation of zinc from leaves to trunk bark tissues (Albrigo and Young, 1980);(Taylor

et al., 2002). Affected plants have their xylem vessels gradually blocked by amorphous

and filamentous particles (Cohen et al., 1983), which probably leads to the visual

symptoms of overall decline: smaller tree size, twig die back, smaller yield and fruit size

and general mineral unbalance (with the clear pattern for zinc deficiency on leaves).

Major physiological changes also occur (Albrigo et al., 1986), such as off season

flowering, longer flowering periods and shooting of sprouts inside of the canopy, as if the

affected plant was attempting to keep its vital functions (under normal levels). It is

common to have less water uptake into the trunk of the affected plants due to xylem

blockage (Cohen, 1974; Lee et al., 1984). Affected plants rarely die but are often pushed

out and replaced by a young tree. Thus, not only direct losses because of tree failure and

replacement, but other costs in grove management are always incurred. Reset groves pose

serious difficulties in horticultural maintenance programs, since they now have trees of

different ages, sizes and possibly on different rootstocks, all with different needs. They

have also increased the risk of other diseases that can be spread on the new young trees.

The Figure 2-1 displays the described progress of citrus blight often seen in Florida and

in Sao Paulo groves.

In addition to the noted annual losses, a simple and dramatic way to see the impact

of citrus blight is by just driving through the citrus areas in Florida and Sao Paulo and

paying attention to symptomatic trees and reset groves.

Citrus blight also occurs in many other countries (Wutscher et al., 1980), except

those with Mediterranean and desert climates where it has not yet been reported.

Citrus Blight Etiology

Citrus blight is an unresolved problem and its origin and etiology are still matters

of debate. Several characteristics of a plant disease, meaning the outcome between a host

and a pathogen under a proper environment, are present in affected trees, except the

presence of a confirmed pathogen. However, it is worthy to note that (Agrios, 1997)


t .. k

rZMt. .

Figure 2-1. Characteristics and symptoms of citrus blight. A) Zinc deficiency on leaves.
B) Water uptake test into the trunk of the affected plant. C) Xylem blockage.
D) Overall plant decline. E) Off season flowering. F) A reset grove has trees
with different ages and needs.

defines plant disease as: "....whenever the ability of the cells of a plant or plant part to

carry out one or more of these essential functions is interfered with by either a pathogenic

microorganism or an adverse environmental factor, the activities of the cells are

disrupted, altered, or inhibited, the cells malfunction or die, and the plant become

diseased...". Thus, this study considers blight as a plant disease of citrus. In addition, the

process seems to be infectious in nature (Timmer et al., 1992), since transmission by root

grafting was achieved in experiments done in the USA (Tucker et al., 1984), in South

Africa (Marais and Lee, 1990) and in Brazil (Rossetti et al., 1991). However, the etiology

remains unconfirmed and transmission has not occurred by either grafting canopy

branches (Albrigo et al., 1993), by bud grafting, or by soil replacement (Timmer and

Graham, 1992). Figure 2-2 summarizes the experimental transmission of citrus blight

obtained by root but not by canopy grafting.

Citrus blight is also present in mature seedling trees, eliminating the possibility of

scion/rootstock incompatibility as a cause. The pattern of spreading seems to be towards

adjacent trees in the same planted row, rather than across rows, as often noted by farmers

and also by (Swingle and Webber, 1896), who first raised the hypothesis of infectious

spreading pattern. Over time, the progression of the disease seems not epidemic,

following a pattern of incidence that can be described by a linear model, which is closer

to abiotic abnormalities (Berger, 1998). (Swingle and Webber, 1896) recommended

eradication of affected trees, fearing further spread of the problem. That was not

implemented. Since then, candidates for causal agent and other theories have been

examined, such as a non-parasitic origin (Rhoads, 1936), the initial transmission trials

A) ALBRIGO et al., 1993


Receptor trees:
0 soil barrier, total physical exclusion
:soil barrier and limb grafted --...----........
no soil barrier, root grafted ............
no soil barrier, no root grafts

Figure 2-2. Transmission of citrus blight. A) Layout of the work done by (Albrigo et al.,
1993), where the receptor trees that were root grafted to blighted trees
displayed symptoms 6 years after that, while no limb grafted plant displayed
symptoms during the same period; B) Receptor trees used by (Rossetti et al.,
1991) showing symptoms of blight after the root grafting work done in Brazil,
confirming that blight is transmitted by roots as first demonstrated by (Tucker
et al., 1984).


(Cohen, 1968), soil born candidate pathogens (Nemec, 1994), the vascular limited

bacterium Xylellafastidiosa (Hopkins, 1987), nutritional related factors (Wutscher and

Hardesty, 1979), and others, but all remain unconfirmed (Derrick and Timmer, 2000).

Citrus Blight is Affected by the Employed Rootstock

Resistance to citrus blight is dependent upon rootstock choice, and even though

rootstock replacement has been a necessity for decades, the overall solution for citrus

blight has not yet been achieved. Resistance to citrus blight is apparently less common

than initially thought (Young et al., 1982).

Rough lemon (Citrus jambhiri Lush), having excellent yield and drought tolerance

but susceptible to citrus blight, was once the major rootstock in central Florida. Extensive

plantings on this rootstock in the 1940s, replacing sour orange (Citrus aurantium L.), was

probably the reason blight has ranked as one of the most common citrus diseases in the

state since then. Volkamer Lemon (Citrus volkameriana Ten. and Pasq.) was another

rootstock option in the past for similar reasons. However, replacement of both with other

rootstocks more resistant to citrus blight contributed to major changes in citriculture,

since the replacements were normally less vigorous and sustained lower yields (Young et

al., 1982). Among other consequences were increases in grove maintenance needs such

as more attention to grove fertilization, to tree density per area, to other disease

susceptibility, and to increases in irrigation, which ultimately contributed to the urbanist

concerns in water usage in Florida (Callies, 2000).

In Florida, replacement of Rough lemon (Citrus jambhiri Lush) by Carrizo citrange

(Citrus sinensis L. Osb. x Poncirus trifoliata L. Raf.) was not as effective as anticipated

because Carrizo proved to be almost as susceptible to blight as Rough lemon (Young et

al., 1982). Sour orange (Citrus aurantium L.) never matched Rough lemon yield in

central Florida, and it also succumbs to citrus tristeza virus. Cleopatra mandarin (Citrus

reticulata Blanco) yields fruit later than Rough lemon and when in full production the

fruit is smaller and the yield lower, primarily when supporting sweet orange and

grapefruit cultivars. Sweet orange (Citrus sinensis L. Osbeck) and Sunki tangerine

(Citrus sunki L.) are considered more resistant to citrus blight, but are not widely used

because of high susceptibility to gummosis of Phytophthora sp. and also to drought.

Swingle citrumelo (Citrus paradise Macf. x Poncirus trifoliata L. Raf.), largely used

nowadays, will probably be of restricted use in the near future because some groves on

this rootstock have become affected by citrus blight. In Sao Paulo, rootstock replacement

is also an unresolved issue, with no obvious alternative to Rangpur lime (Citrus limonia

Osbeck), another rootstock susceptible to citrus blight, and more recently to citrus sudden

death disease. Able to grow on non-irrigated areas, on soils with high aluminum, and in

low input production systems, Rangpur lime is still the rootstock of choice in more than

80% of groves in the Sao Paulo area, despite citrus blight losses (Pompeu JR., 2001).

Thus, groves that normally would last naturally for 50 years or more are being replaced

within 10 to 15 years, or less. The consequence is a fast and expensive turnover of trees

for big companies and the end of business for medium and small farmers. Just the return

on investment in citrus normally takes 8 to 9 years after planting.

Therefore in all aspects examined, citrus blight is an important concern for citrus

industries, wherever it happens. The complexity and importance of citrus blight demands

broad inter-institutional scientific cooperation on efforts to examine its etiology and gain

insights into what causes the plant to block its own xylem and decline, what is

transmitted from plant to plant (and why only by roots), how the plant responds and what

is changed in the metabolism of the affected plant, why young non-bearing plants are

normally not affected, and more. But these are overwhelming questions. The present

study, more conservatively, seeks to uncover molecular and etiological contrasts between

healthy and blighted trees.


The major objectives of this study were to identify differentially transcribed genes

under non and citrus blight conditions and contribute to its understanding and control,

which is the long term goal of the citrus blight research at this institution.

The specific objectives were

* to build subtracted cDNA libraries from root samples of non and blighted trees.

* to identify differentially transcribed genes using cDNA arrays.

* to obtain quantitative information about the transcriptional level of the selected
genes using reverse transcriptase real time PCR.

* to evaluate the presence of potential causal agents found in the subtracted libraries.


For research on citrus blight, several promising technologies were considered.

Genome wide approaches and microarrays have offered great perspectives in several

biological systems, but sequence information is limited for citrus. Thus, cDNA

subtractive hybridization (Diatchenko et al., 1996) was undertaken, with the objective to

obtain enriched cDNA libraries for each considered condition: healthy and blighted

plants. Subtracted libraries can uncover genes up or down regulated under a specific

condition, thus being a useful source of candidate clones for further studies. Similar

approaches taken with rice (Xiong et al., 2001) and soybean (Colebatch et al., 2002)

encourage such efforts, because genes differentially regulated under disease pressure and

protein synthesis responses were identified.

Root Samples and cDNA Synthesis

Since blight dissemination is associated with the root system (Timmer et al., 1992)

and morphological changes are seen in the roots of affected plants (Lindbeck and

Brlansky, 1998), molecular responses are also expected to happen; therefore, root tissues

were chosen for subsequent procedures. Superficial roots of Rough lemon (Citrus

jambhiri Lush) rootstock supporting Valencia sweet orange (Citrus sinensis L. Osbeck

cv. Valencia) canopy were collected and total RNA was extracted the same day from

feeder root tissues using Qiagen RNeasy protocol, with DNase digestion (Source:

http://wwwl.qiagen.com, last accessed July 15, 2001). It was done during the summer of

2001. Rough lemon was chosen because of its known susceptibility to citrus blight.

Feeder roots, also called fibrous roots, of around 2 to 4 mm in diameter, were chosen

because they display xylem plugging and internal anatomic differences in affected trees

compared with healthy ones (Lindbeck and Brlansky, 2000), similar to what happens in

canopy tissues, suggesting that molecular contrasts may also be present. Samples were

taken from healthy and fully blighted trees previously diagnosed by typical visual

symptoms, by the water uptake test (Lee et al., 1984), and by the P12 based

immunoassays on leaf tissues (Derrick et al., 1990). The chosen trees were in a 10-year-

old block in the Lake Alfred area, Florida (USA). Reverse transcriptase (RT) polymerase

chain reaction (PCR) was performed and cDNA was synthesized using Clontech

procedures, enriching for messenger RNA transcripts (Source:

http://www.bdbiosciences.com/clontech/, last accessed September 15, 2001). An

experiment was performed to determine the number of PCR cycles necessary to

normalize the cDNA synthesis of both samples (Figure 3-1).

Building the Suppressive Subtracted cDNA Libraries

The healthy and blighted cDNA samples were digested with Rsa I restriction

enzyme to remove the Clontech Smart oligos at the terminal ends of the amplified

cDNAs, generating blunt ends. After purification, different Clontech adaptors (1 and 2R)

were ligated to split sets of cut healthy and blighted cDNAs. Healthy cDNAs ligated to

each adaptor were hybridized with an excess adaptor-free blighted cDNA and with each

other. The same procedure was done with blighted cDNA samples and PCRs were

performed in both cases, enriching for differentially transcribed genes under each

condition, following the Clontech PCR-Select cDNA subtraction procedures (Source:


FFrsi-stram syad hesis
oyled wi th (dC) tailing by RT
,rr.5' % f f poiyA

Ten plate swalching
and extenoeen by RI
5" GGG r JJ.raJr p lyA
I Prvm extension st Ib e

following the Clontech Smart cDNA procedures (Source:
http://www.bdbiosciences.com/clontech/, last accessed April, 15, 2004). The
3'-PolyT-oligo-5' binds to the poly-A tail of the mRNA and the final
extension of the 1 st cDNA strand leaves an overhang of Cs, which is bound
by the 5'-oligo-GGG-3'. After template switching both ends are filled by
polymerization of the complementary strands, and PCR starts, using the
primer extension sites present at both oligos. B) Different cycles of PCR were
performed on each sample to achieve tentative uniform cDNA accumulation
before reaching the plateau of the reaction, following the manufacturer
recommendations. Healthy samples were considered optimized at the 17th
cycle, while for blighted ones, 23 cycles were run.

http://www.bdbiosciences.com/clontech/, last accessed September 15, 2001). After PCR,

only molecules with different adaptors were exponentially amplified, in theory, while

others could only have linear amplifications or impaired products due to hairpin

structures. This technique was developed by Diatchenko et al. (1996). Thus, subtracted

healthy minus blighted (H B) and blighted minus healthy (B H) libraries were

generated, in contrast to unsubtracted ones ( H and B) and controls ( + and ), Figure 3-2.

Totl MA

Poly A- RM

SMART' Convnertionu
cOA!yth~ A cNAsyntwshu

Tutu. cD94A withi Ad@PW~ I OrlywcDPIA (kI asemi) TesM c0Awhh AdaPtwr2N

FinrIy:16: =zIon

b ME- -

kb~c~d. e
Fil In the ends



-I 0

b-. W wanoWpdmion
c Wer mWficatofl

Figure 3-2. Making the subtracted "healthy" and "blighted" libraries. A) Scheme of
cDNA subtractive hybridizations following Diatchenko et al. (1996). Two sets
of the same cDNA (called 'tester') are ligated to different adaptors and
hybridized with in excess adaptor free cDNA (called 'driver') and with each
other. PCR was performed in both cases, enriching for differentially expressed
genes in both directions (called 'forward' and 'reverse' libraries). B) The
same procedure was done with blighted and healthy cDNA samples. Thus,
subtracted Healthy minus Blighted (H B) and Blighted minus Healthy (B -
H) libraries were generated, in contrast to unsubtracted ones ( H and B) and
controls ( + and ).

.Adaptor I

Adaptor 211


In theory,


Ell h Adaptor I

Adaptor 2R

,J zJj hy


In theory,
Ell -h only

2 ISM--


The differentially enriched cDNAs, (H B) and (B H), were cloned following the

Promega protocol for the pGMTeasy vector (Source: http://www.promega.com/vectors/,

last accessed on September 15, 2001) and around 500 clones were randomly selected for

sequencing from both libraries (400 from the B-H library and 100 from the H-B library).

Sequence Analysis and Selection of Clones

The obtained sequences were trimmed of vector and adaptor sequences used for

cloning until no more matches were found using the VecScreen search software (Source:

http://www.ncbi.nlm.nih.gov/VecScreen/, last accessed April 10, 2002). The sequences

were run in the automated system of the University of Florida sequencing core (Source:

http://www.biotech.ufl.edu/, last accessed April, 15, 2003) but the Clontech adaptors

were not hidden in many cases, requiring manual trimming to avoid contamination of

vector sequences. To reduce redundancy of clones that may represent the same gene, the

sequences were analyzed using all available Genebank sequences (all-sequences and non-

human non-mouse ESTs) and the Brazilian Citrus-EST project as reference sequences for

Blast searches (Altschul et al., 1997). With all sequences individually grouped by similar

blasted match outcomes, further clusterization and alignment assemblies were made

using the Vector NTI software assisted by Microsoft Office applications and other web-

based tools (Source: http://searchlauncher.bcm.tmc.edu/seq-util/seq-util.html last

accessed April, 10, 2003). The Figure 3-3 displays examples of the four steps performed

for trimming and clustering all the 500 individual sequences. After that, the longest clone

within the homolog group was the one considered for further studies.

>CitrusBlight-K5R2-E09.g folder-CitrusBlight length-672

1 a3 _1"_ 249

Match to Vector: U Strong U Moderate LII Weak

clone bp Database Highest match description e-values
All Genebank 1,367,736 -_ I- 1- I '113414.2| Homo sapiens
152 250 sequences chromosome 5 clone RP11-541P9, complete sequence 1.2
Brazilian citrus CCSM ESTs CXContig831
13,610 clusterized sequences 3e-92
ESTs Genebank non-human 1 gb|BM376262.2|BM376262 EBma01 SQ002 N11 R
non-mouse 4,893,238 maternal, 4 DPA, no tr... 80 le-12 le-12
kl-5,: 84 << 361 (complementary)
SI 262 bp, le-60
K5-C10,: 83 >> 352
I 270 bp, 1 e-127
K5-G5,: 83 << 352 (complementary)
C | 270 bp, 1 e-129
K5-F9,: 83 >> 352
| 270 bp, 1 e-129
kl-25,: 69 >> 481______ 270 b,
I 400 bp, 2e-90
LEA,Z46824,EST,FASTA599: 1 >>632 Citrus EST Reference, 599 bp
I -

11 r,50) ,100 150 ,200 )250 r300 350 (1400 (50 500 r550 00

Figure 3-3. Analyses performed for each sequenced clone. A) Looking for vector
sequences, such as the Clontech adaptors highlighted in blue and red letters,
after the sequences had been masked by the sequencing core system as Xs. B)
VecScreen analysis were run for all available clones, confirming in many
cases the need of further trimming. C) Blast-N analysis in 3 databases. Many
clones had only poor matches in the Genbank search, but had good sequence
homology in the citrus and in the non-human-non-mouse EST databases. D)
Alignment of the homolog clones against a reference sequence. The green
plot, underneath the bars representing the clones, reflects the sequence
variability per region.

This step was an intensive computational effort aimed at reducing potential future

nonspecific variation from different clones that, in reality, might be representing a

transcriptional pattern of only one gene. The average length of the selected clones

reached 240 base pairs. Then, it was possible to narrow down all sequences to around 140

tentative unique clones. The Table A-1 in the appendix contains information about these

clones and displays the tentative functions and other characteristics based on blast

analysis of homolog sequences. It is worthy to note that several clones had high matches

with different genes of citrus tristeza virus.


In order to evaluate the transcriptional pattern of the genes represented by the

clones selected from the subtracted libraries, a cDNA array experiment was assembled

and run. The major objective was to compare those clones under non and citrus blight


The DNA array technology has been used in plants with success. There are

examples studying defense reactions (Scheideler et al., 2002), stress responses (Rizhsky

et al., 2002), and others. Reviews can also be seen at Seki et al. (2003) and at Donson et

al. (2002). However, in general, one arduous step in DNA array technologies is to

compare information between different experiments (Stoeckert et al., 2002). With a

similar concern, Brazma et al. (2001) proposed the MIAME protocol, which stands for

'Minimum Information About Microarray Experiment'. The intrinsic principles of the

MIAME apply primarily to define the information that should always be included in

microarray repository databases, allowing other researchers to understand the experiment

and the data. The ultimate goal of the MIAME protocol is to establish a standard for

recording and reporting microarray data based on detailed annotation of six experimental

sections: 1) experimental design; 2) array design and spot features; 3) sample preparation

and labeling; 4) hybridizations and parameters; 5) measurements and specifications; and

6) normalization and controls. The MIAME protocol does not specify the format in which

the information should be provided, but only its content. In the present cDNA array

study, much more modest than the commercially available microarrays, those guidelines

were observed attempting to induce uniform experimental conditions and effective ways

to analyze the data. Annotations during all experimental steps were recorded and are

summarized below.

Experimental Design

The tentative non-redundant clones from the subtracted libraries, (H B) and (B -

H), described at the appendix A, plus ribosomal clones and other tentative controls, were

standardized at the same concentration (160ng/ul) after PCR and purification steps. That

was possible because all the clones had the same flanking sequences at the Clontech 1

and 2R adaptor regions. Figure 4-1 displays the initial PCR efforts for some of the clones

used in this study. Most of the PCR products were in the range from 200 to 400 bp, and

some clones had to be amplified more than once to achieve the standards above.

Array Design and Spot Features

The clones were uniformly arrayed on nylon membranes, by printing duplicated

sets of each using the robot printer of the ICBR-UF (Interdisciplinary Center for

Biotechnology Research of the University of Florida). Each membrane contained 188

double spotted probes ready for further quantitative assays (Figure 4-2). The description

of each clone is given in the appendix.

For positional landmarking, ribosomal genes were used. They were clones with

sequence homology to a citrus ribosomal gene, Accession X05910.1. Controls for quality

evaluations included detection of water spots for background assessments, plasmid with

GFP for nonspecific hybridizations and aerial plant stress related genes, such as the cold

responsive gene CORcl 15 (panel G12, spot 180), for variation determinations.

Membranes were UV-cross linked and stored at around 6C.

Figure 4-1. Preparing individual clones for the cDNA array. Selected clones were
amplified by PCR from the subtractred libraries and prepared to be arrayed on
nylon membranes (LW for low DNA mass ladder from Invitrogen; (-) for no-
template control).

Sample Preparation and Labeling

The membranes were hybridized with independent "healthy" and "blighted" RNA

sources. Total RNA samples were extracted under the same conditions from feeder roots

from adult groves of Valencia sweet orange (Citrus sinensis L. Osbeck cv. Valencia) on

Rough lemon (Citrus jambhiri Lush), Carrizo citrange (Citrus sinensis L. Osb. x

Poncirus trifoliata L. Raf.), and Swingle citrumelo (Citrus paradisi Macf. x Poncirus

trifoliata L. Raf.) rootstocks from the central Florida region, using Qiagen RNeasy

procedures with DNase treatment. Plants had been previously diagnosed using the visual

1 2 3 4 5 6 7 8 9 10 11 12
5 6 7 8 9 10 11 12
97 98 99 100 101 102 103 104 105 106 107 108
13 14 15 16 17 18 19 20 21 22 23 24
109 110 111 112 113 114 115 116 117 118 119 120
25 26 27 28 29 30 31 39 33 34 35 36
121 122 123 124 125 130 131 132
37 38 39 40 41 42 43 44 45 46 47 48

133 134 135 136 137 138 139 140 141 142 143 144
E 49 50 51 52 53 54 55 56 57 58 59 60
145 146 147 148 149 150 151 152 153 154 155 156
F 61 62 63 64 65 66 67 68 69 70

157 158 159 160 161 162 163 164 165 166 167 168
G 7.5 76 77 7A 7P An AI A? A3 A4

169 170
H 85 86 87 88 89 90 91 92 93 94 95 96

185 186 GFP GFP

Figure 4-2. Array design. Colored spots indicate different types of clones or controls:
pink (LM) for landmark positing; blue (H20) for water controls; yellow (spots
7 to 12) for probes from citrus leaf tissue; orange (spots 171 to 180) for probes
from stress related genes; and green (GFP) for hybridization control. Those
controls accounted for thirty four spots. Other spots were printed with clones
from the subtracted libraries of citrus root tissue. Seventeen clones were from
the H B library (spots 5 and 6; from 53 to 63; and from 67 to 70). All the
remaining one hundred and fifty four clones were from the B H library.

identification of typical symptoms in the canopy and the water injection test in the trunk

(Lee et al., 1984). All samples were uniformly handled, using tissues from pairs of

healthy and fully blighted trees of the same genotype, grown under the same condition

and from the same grove. Some membranes were used to determine the best amount of

RNA, type of primer for RT (reverse transcriptase) reaction, and RNA sources,

comparing total versus messenger RNAs. After optimizations, samples with 2ug of total

RNA had the 1st strand cDNA labeled with dATP33 using random primers following

procedures similar to that of the Ambion Strip-EZ kit (Source: http://www.ambion.com/,

last accessed Octpber 10, 2003). The RT efficiency was evaluated by counting the

scintillation of the labeled samples.

Hybridizations and Parameters

All membranes were exposed to the same amount of labeled probe, based on the

scintillation reading of one million counts/minute/ml of buffer. The samples were

hybridized overnight at 64C with individual membranes, washed, and analyzed under

the Typhoon Phosphoscreen Imager System (Source:

http://www.amershambiosciences.com, last accessed April 15, 2004), always uniformly

manipulated in pairs of healthy and blighted samples to allow further pairwise

comparisons. The employed imager system evaluates the fluorescence of each spot

represented on the screen. Changes of the oxi-reductive status of a screen component,

made by crystals of barium (Ba), fluorine (F), bromine (Br) and europium (Eu), are

induced by the radiation of the samples after overnight exposure. Then, a laser beam from

the reader induces excitation and subsequent fluorescence of each spot represented on the

screen, proportionally to the initial radiation emitted from the labeled sample. The image

of each membrane was captured by the scanner and the quantitative information was

obtained using the software ImageQuant (Source:

http://www.amershambiosciences.com, last accessed April 15, 2004). All membranes

were treated as uniformly as possible to minimize other sources of variation in the

subsequent analyses.

Measurements and Specifications

The membranes were framed and had the image contrast optimized for better

visualization using the ImageQuant, Microsoft PhotoEditor and PowerPoint software.

The quantitative information of each clone was then evaluated. The parameter for quality

of each membrane was verified looking at the ratio (Ratio) between the averaged absolute

values, intensity of the fluorescence per pixel in the screen, of all the genes (AveGene)

represented by the clones, over the average of all the "water" spots (AveH20), used as

negative controls for the hybridizations, and therefore considered as background or noise,


Ratio = AveGene / AveH20

Seventy-one membranes were printed and run. The expected true ratio was

calculated to be within the confidence interval of 2.33 and 3.27, for p < 0.01. Therefore,

individual membranes with a ratio smaller than the low limit of 2.33 were considered

inappropriate for analysis and were discarded. One membrane that had nonspecific

hybridization, measured by the spots with GFP genes, was also discarded. Forty unbiased

membranes passed those criteria and were saved. Among those, twenty individual

membranes represented ten pairs of uniformly manipulated healthy and blighted sampled

trees. Each pair of samples was collected at the same day, from the same grove, and had

their RNA extracted, labeled and hybridized under the same conditions, as uniformly as

possible. Thus, membranes of any considered pair of healthy and blighted samples

displayed an averaged absolute value (intensity/pixel) for all clones similar to the other

membrane, in most of the cases, and both were respectively higher than their background

and nonspecific hybridization controls by at least 2.33 fold. Root samples from trees on

Carrizo were used on the pairs made by the membranes lx2, 5x6, 67x54 and 65x66.

From Lemon, on the pairs 9x10 and 61x58. From Swingle, on the pairs 29x30, 31x34,

51x52 and 69x70 (Figure 4-3).

Ratio 6
4ai 6-- ----------- ------- ---------------------------
H AveGene/AveH20

membranes 1 2 5 6 67 54 65 66 9 10 61 58 29 30 31 34 51 52 69 70 Cutoff

Carrizo Lemon Swingle

Figure 4-3. Quality parameter for each membrane. The unitless ratio represents the
proportion between the averaged absolute value for all clones (AveGene) in
the membrane over the averaged absolute reading for the background level
(AveH20) of the same membrane. Membranes with a ratio smaller than 2.33
were discarded.

Normalization and Controls

The readings of the duplicated spots for each clone were averaged. All "water"

spots (AveH20), previously calculated for each membrane, were used to subtract the

background from each clone (C). Negative values implied that the reading of the clone

was smaller than the background value. Those values were discarded. Then, each clone

was normalized (n) against the new mean of the clones (MeClone) in the membrane,

rather than against one or two genes, such as a ribosomal or other ones, as follows:

n = [ ( C AveH20 ) / MeClone ] 100

The normalization method should reflect similar results comparing to the visual

evaluation of the studied membranes. The mean of the clones was used in this study

because it met this criteria better than other measures of central tendency, such as the

median of the numbers. Normalization against a measure of variance, using the standard

deviation, was also tried but no improvements were observed either.

Besides the visual evaluation of the membranes, two other types of analyses were

performed. To study the relative levels of transcription of the same clone comparing

healthy and blighted samples from uniform conditions, cluster analysis was done. To

study the variance of each clone, contrast of means analysis was done.

The Visual Evaluation of the Membranes

The tentative visual differences for each clone were highlighted in each framed

membrane. This procedure helped to identify clones not previously seen under the initial

visual evaluations. The three evaluated genotypes (a lemon, a citrange and a citrumelo)

displayed differences across the species. But looking at one rootstock per time, some

visual differences between healthy and blighted samples were also seen (Figure 4-4).

Under the citrus blight condition, Carrizo citrange displayed stronger signal for the

genes represented by the clones on the panels Bl (clone 109), Cl (clone 25), D4 (clone

136), Fl (clone 157), G7 (clone 79), and maybe others. Lemon had differences on the

panels Cl (clone 25), C10 (clone 34), G7 (clone 79) and G8 (clone 80). Swingle had

differences mainly on the panel Cl (clone 25). Very few clones displayed more signal on

the healthy than on blighted samples: the panel A6 (clone 6) shows a tentative candidate

of that on Carrizo and the panels E8 (clone 152) and E9 (clone 153) on Lemon.

healthy tree 1-15

C *
o f...__.. _,9. @

F .. ** ". .-

e )ee *. ** ** --
H .* .
.9_ oS I __I

B) Lemon roots healthy tree 3-11
S 1 2 3 14 5 6 7 8 10in 11 12

C *

9. to 0
09 0* n 9 09 n n _* ..

5 1 2 3 14 6 17 9 10 11 12
9 *9

99'. .9_ __
A .9_W * *
*_ 99_9_ _9_ 9_

E- y .

A) Carrizo roots

Figure 4-4. Visual evaluation of the membrane pairs. Membranes were hybridized with
samples labeled with P33, using feeder roots of 'Valencia' tree on different
rootstocks. A) on Carrizo citrange (Citrus sinensis L. Osb. x Poncirus
trifoliata L. Raf.). B) on Rough lemon (Citrus jambhiri Lush). C) on Swingle
citrumelo (Citrus paradisi Macf. x Poncirus trifoliata L. Raf.). Each panel
has two clones horizontally replicated. Red arrows represent potential more
signal on blighted samples. Blue arrows, on healthy samples. Green arrows,
near identical. Blue circles represent spots filled only with water, for
background control. Green circles, with GFP, for non-specific hybridization
control. Black circles, with CORcl 15, for observations of a streets related

blighted tree 1-11
6 1 2 a 4 a 6 7 8 9 10 i 1 12

A ie(94

"'i"" "?^"-- t-------
C ** *. -

St *

A ** **a
0 ** .
** *" 9-
blighted tree 6-9

16 1 2 2 4 0 0 7 8 9 I0 11 12

. .
--- a---- -- ---_J _- --_

F 2 -. 5 6 .
F'* '40 .. 4o

Ho I W


-- -- -- -- -- -- -- --

F 9 .9

Nearly unchanged genes were seen in all samples and the panels D9 (clone 141)

and E5 (clone 149) represent examples of those, in all three rootstocks. The Figure 4-4

shows one pair of membranes for each rootsctock.

The Cluster Analysis

The transcriptional levels of the normalized Healthy (nH) and Blighted (nB)

samples were compared following the Log2 function, to allow equidistant visualization of

the fold (F) induction or repression for each gene, as:

F = Log2 [ (nB+0.01) / (nH+0.01) ]

Gaasterland and Bekiranov (2000) describe two major types of analysis, the

supervised and the unsupervised approach. In the supervised analysis, a particular context

of each measurement is known and the end result is a list of individual genes behaving

differently in each of the different contexts. In this study, the supervised model was

accepted and the null hypothesis considered no differences in the transcriptional levels of

the candidate gene under healthy and blighted conditions.

Then, the cluster analysis and the graphic visualization for each clone was done

employing respectively the Cluster and the TreeView software (Eisen et al., 1998). The

Cluster software works on a random assignment of vectors for similarities found within

the numbers. Subsequent new layers of vectors allow further clusterization of all samples.

To test the significance of the differences, t-Tests were employed. Induced and repressed

candidate clones were nominated, after analyzing the outcome of the ten independent

pairs of healthy and blighted trees (Figure 4-5).

A) Cluster analysis

A -








B) Selected clones

winter spring summer spring
03m 03 02 l03

M M .
u4D CD

C2 2 C



N N @h
W9~ CD4
Q x'm c

2 Membrane pairs

a f

nO Clone t-Test

v W,, U, W U -
t' N .0 A
9 0 90 C 0 0;

Figure 4-5. Transcriptional profiling of the candidate genes. A) Outcome of the ten pairs
of trees under healthy and blighted conditions, being four pairs on Carrizo
citrange, two on Rough Lemon and four on Swingle citrumelo rootstock. Each
spot represented the ratio of the normalized blighted (nB) over the healthy
(nH) sample given by Log2[(nB+0.01)/(nH+0.01). Green indicates negative
ratio (more healthy than blighted) and red positive ratio (more blighted than
healthy). B) Visualization of the individual clones and their 'p' values for the
t-Test, with the significant ones (p<0.05) being highlighted with a nearby star.



Ca Ln
04 C2


After the cluster analysis, all membranes were visually re-evaluated. Clones that

had p<0.05 from the group I, mostly upregulated candidates under the citrus blight

condition, were located again. This process helped to spot differences not previously seen

in the membranes. Similar approach was taken for the clones of the groups II, III and IV,

mostly downregulated candidates under the citrus blight condition. However, it is

possible that, for these clones, a more sensitive detection method would be more

effective, because few visual differences were re-confirmed. The nearly unchanged genes

of the group V, displayed the expected clones 141 and 149. Albeit small, the clone 141

did have a significant variation, with p<0.007, leaving the clone 149 alone as a candidate

for an unchanged gene under citrus blight condition.

These ten paired samples were collected and run from July of 2002 to May of 2003.

Closer patterns can be observed comparing the Carrizo and Swingle samples from the

summer of 2002 and the spring of 2003. However, more replicates would be needed to

better study the real contribution of the season of the year on the studied model.

The Contrast of Means Analysis

Although the previous analysis is powerful for initial screening, it brings a natural

chance of error by selecting potential false positives, since a clone with initial reading

value (C) that approaches the background level (W) will generate a normalized number

(nH or nB) that approaches zero, complicating any further conclusions for the pairwise or

cluster analyses. On the other hand, simply discarding those clones may penalize the final

outcome by leaving behind clones that may be indeed positives. Thus, besides exercising

caution on apparently extremely induced or repressed clones, those were the reasons to

perform the contrast of means analysis. For that, each clone was assessed individually

within each uniform pair of plants (healthy and blighted), from the same rootstock type

and from the same block of trees, as previously described.

The assumed model for variance in this case implies that the variance of a clone (x)

is a function of its averaged value (Ax), plus the contribution of the membrane (M), plus

the contribution of the uncontrolled residual factors (e), as

x= Ax+M+e

Other assumptions for the model above were also considered, as having additive

factors, normal distribution of the data, independence between treatments and

homocedasticity-also called uniformity of variance (Banzatto and Kronka, 1992).

Additive contributions of each factor can be explained by the assumed model itself, since

the outcome of each clone was the sum of those factors. Normality was only partially

observed because the data aggregated around the mean, for the most part, but not

perfectly. Independence of treatments in this biological system could not be fully

accepted because that implies that the genes assessed by each clone operate

independently from each other. Since metabolic pathways are complexes and regulated

by counterpart genes, this is probably not true in this system either. Homocedasticity was

not verified and the data was checked for transformation options, such as, RootSquare,

Log and other functions. The smallest discrepancy in variances was obtained using the

Log transformation of the previous normalized data (n), giving to each clone its final

value (V), as

V = Log2 (n + 1.5)

The normalization for the contrast of means was similar to the initial normalization

for the cluster analysis (nH and nB) previously described, except for considering

individual values of all spots and adding the value 1.5 to avoid zeros in the computation.

Once the transformation was observed, t-Test was employed on the established contrast

of means, where the estimate of the healthy mean (Hm) and the estimate of the blighted

mean (Bm) generated the estimate of the contrast (AY) for each clone, as

AY = Hm Bm

Then, the relation between the absolute value for the estimate of the contrast (AY)

and its standard error, which is a function of the number of replicates (rH or rB) and the

standard deviations (sH or sB) for healthy and blighted samples, gives the t-Test value (t)

for each clone (Banzatto and Kronka, 1992).

Subsequent comparisons against standard t-values determined at which level of

probability (p) the null hypothesis, claiming no difference in the transcriptional level of

the studied clone, can be accepted or rejected, in favor of the alternative hypothesis,

claiming significant differences between healthy and blighted transcriptional levels for

each clone.

Some of the clones were variable but not at a level considered significant (t-Test)

for this cDNA array system (p<0.05). However, other clones displayed significant

response to citrus blight, suggesting that citrus blight is apparently able to affect the

transcriptional level of certain genes in affected plants (Figure 4-6).

In plants with citrus blight, the clone 6 was significantly downregulated (p<0.05) in

three out of the ten pairs of evaluated trees. However, it was also significantly

upregulated twice, implying in a great non-specific variation.

The clone 25 was significantly upregulated (p<0.05) only in two studied pairs, but

displayed higher averaged values on blighted samples in nine pairs of plants, and a strong

significant difference on the pair 5 l1x52.

The clone 38 was significantly upregulated in two pairs of plants. It also had a

higher averaged transcriptional value in three other pairs of plants.

The clone 109 was significantly upregulated (p<0.05) in three out of the ten pairs,

and had other three higher averaged values on blighted than on healthy samples.

The clone 149 was nearly unchanged, however it had one significant difference

(p<0.05) comparing the affected and the healthy plants on the pair 9x10.

The clone 153 was significantly downregulated (p<0.05) in only two paired

samples, but had higher averaged values on healthy than on blighted samples in other five


The clone 157 had a higher averaged transcriptional level on affected than on

healthy plants, but a large variance too, being significantly downregulated (p<0.05) in

one pair of plants.

Log2(n+.5) p<0.013 p<0.015 8

2 Clone 6

p<0.010 p<0. 057 p.OOO

48 ------- ---------------- -- -- --------- -- -- ------------------------ - -----
,, p<0.000

Sp<09 p< 068 p


6 --------------- -------- -- ---------------------

p<0.063 p<0.035
6 - -- - - - -- - - - - -- -

2 Clone 157

2 x2 Cz5x6 Cz65x66 Cz67x54 Le61x58 Le9x10 Sw29x30 Sw31x34 Sw51x52 Sw69x7 AveH20 AveClone

and blighted (purple columns) trees on Carrizo (Cz), Lemon (Le) and Swingle
(Sw). The 'p' value represents the significance of the t-Test, helping in the
decision of rejecting or accepting the null hypothesis. The blue stars indicate
significant differences when p<0.05. The bars are the standard deviation of
each studied condition: healthy or blighted samples.

Comparing the Evaluation Methods

All three methods used to evaluate the transcriptional pattern of the genes

represented by the clones displayed positive and negative aspects. The visual evaluation

of the membranes required neither normalization nor computation and it was good for the

major differences, besides confirming, or not, the results of the quantitative analysis.

However it did not allow an easy identification of all the candidate clones in the first

attempts. The cluster analysis was good for combining all clones from the available

samples under the pairwise based approach. Inferences about the averaged fold induction,

or repression, and about the aggregation group of each gene could be estimated. But not

all quantitative information matched the visual evaluation of the membranes. The contrast

of means was positive to reveal the significance of the differences within each pair of

trees. It represented an unfolded view of the cluster analysis replicates. However, since

the data was transformed, further inferences on the relative transcriptional levels within

each pair of plants were no longer precise.

Combining the Results for the Selected Clones

Several clones displayed either visual or quantitative differences between the

evaluated samples. The Table 4-1 displays the summarized results for those selected


Among the clones that displayed some differences in the cDNA array experiment,

the clone 6 is from the healthy minus blighted (H-B) enriched library and displayed

mostly lower transcriptional levels under the citrus blight condition. It is 325 bases long

and has sequence homology (Table 4-2) with an Arabidopsis thaliana EST (e-value of

Table 4-1. Transcriptional pattern of the selected clones. Observations from the three
different types of analysis, comparing healthy (H) and blighted (B) samples.
Clone Visual Cluster analysis Contrast of means analysis
(library) differences (averaged Log2*; (number of significant differences,
p-value) for p<0.05)
6 (H-B) H>B -0.46; p<0.153 3 (H > B) and 2 (H 25 (B-H) H 38 (B-H) rare +2.44; p<0.089 2 (H < B)
109 (B-H) H 149 (B-H) H ~ B +0.05; p<0.580 1 (H > B)
153 (B-H) H>B -3.13; p<0.005 2 (H > B)
157 (B-H) H B) and 1 (H * Log2 stands for Log2[(nB+0.01)/(nH+0.01)]

le-180) in the Genbank and with a citrus EST (7e-11) in the Brazilian databank. It has an

unknown function based on the translated query (Figure 4-7) to the protein databank (4e-

30) and a high nucleotide homology to a mitochondrial sequence (le-180), raising the

question whether the clone 6 represents an open reading frame (ORF) of a gene or not.



Figure 4-7. Blast-X of the clone 6 using the non-redundant protein database. Sequence of
an environmental protein Accession EAI39113.1 (subject), with unknown
function, had similarities (4e-30) to the translated version of the clone 6

But because of its variance (Figure 4-6), the clone 6 is considered to represent a

false positive outcome, not representing a true downregulated gene under the citrus blight


The Table 4-2 displays the accession numbers of the first match on the blast search

analysis, using different databases, for the selected clones.

Table 4-2. Blast search analysis for some clones. The search for homolog sequences was
done using different databases.
Clones e-values Highest match on sequence search analysis
6 le-'1o Arabidopsis thaliana EST, Accession CF653082
7e-'1 Citrus EST, CCSM, Brazil, Contig 204
4e-30 unknown protein, environmental sequence, Accession EAI39113.1
le-180 Arabidopsis thaliana mitochondrial genome, part A, Accession
25 1e-91 Citrus EST, CCSM, Brazil, Contig 416
38 8e-88 Citrus chitinase class II, Accession Z70032.1
Se-88 Citrus chitinase class I, Accession AB081944.1
I3e-95 Citrus EST, CCSM, Brazil, Contig 1434
109 9e-56 Citrus EST, Accession CK935651
9e-44 Citrus EST, Accession CB293790
(2e-65)* Arabidopsis thaliana, ubiquitin ligase SCF complex subunit,
Accession NP568603.1
149 2e-4 Citrus EST, CCSM, Brazil, Contig CXJE02
153 Poor sequence information
157 Poor matches in the searched databases
* e-value of the citrus EST Accession CK935651 translated query on the protein databank

The clone 25 is from the blighted minus healthy (B-H) enriched library and

displayed higher transcriptional levels under the citrus blight condition in some of the

tested pairs of plants. It is 300 bases long and has sequence homology with a citrus EST

(le-91) in the Brazilian databank, but only poor matches in Genbank. It also had a strong

visual difference on the membranes of Swingle (panel Cl, figure 4-4C). That difference

was significant (p<0.05) in one out of the four tested pairs of plants on Swingle (Figure

4-6). However, considering all rootstocks, the overall transcriptional fold induction under

the blight condition was around three and a half times, Log2[(nB+0.01)/(nH+0.01)=1.82,

but with a poor 'p' value of only 0.156 (Table 4-1 and Figure 4-5B). It is possible that the

clone 25 represents a true upregulated gene under the citrus blight condition, but with

higher transcriptional responses in Swingle citrumelo.

The clone 38 is from the B-H library and is 235 base pairs long. It represents a

citrus chitinase gene (Figure 4-8).

A) Cone38: 586 ( 811 (corrplerrentary)

Chitinase-ll: 1 > 1082
(Accession Z70032.1)

i 5C00 ,1000

aone38: 681 << 906 (corrplenentary)

e-value = le-88

Chitinase-1: 1 > 935
1 > (Accession AB081944.1)

11 ,100 ,23 r300 1400 P 00 ,700 800 00

Figure 4-8. Clone 38 has sequence homology to citrus chitinases. Blast-N showed high
similarities to (A) a class II chitinase; and to (B) a class I chitinase.

The clone 38 had a transcriptional fold induction under the blight condition of

around five times, Log2[(nB+0.01)/(nH+0.01)=2.44 (Table 4-1); but a strong visual

difference within the membranes was not seen (panel D2, Figure 4-4A). Looking at the

e-value = 8e-88

contrast of means (Figure 4-6), two pairs of trees displayed significantly (p<0.05) more

transcripts of the gene represented by the clone 38 in blighted than in healthy trees.

However, five pairs of trees responded only at a very low level, close to the background

(AveH20). It is possible that the clone 38 represents a responsive gene to citrus blight,

but had poor printing on the membrane surfaces for those five abnormal readings. To test

that hypothesis, a new series of membranes were printed and run. The figure 4-9 displays

the results.

74-H Rep.

76-B 1

80-B 2

Ribosomal LEA Others Chitinase

Figure 4-9. Transcriptional profiling of the clone 38 (a chitinase homolog) and other
clones. The membranes were manipulated and hybridized under similar
conditions, using 5ug of total RNA labeled with P33, from feeder roots
samples of a healthy (H) and a blighted (B) tree on Carrizo citrange. The
process was repeated twice (rep. 1 and 2) generating four membranes. The
quantitative difference for the chitinase homolog clone, comparing the healthy
and blighted samples (t-Test), was significant (p<0.01).

Therefore, the clone 38 is considered to represent a true upregulated gene under the

citrus blight condition.

The clone 109 is also from the B-H enriched library and displayed mostly higher

transcriptional levels under the citrus blight condition. It is 176 bases long and has

sequence homology with citrus ESTs in the Genbank using the non-mouse and non-

human entry (Figure 4-10), but only poor direct matches as a translated query on the

protein databank.

CLO~E1 09,: 662 <<847 (corrplerentary)

QC935651,: 78 > 828
1 e-value=9e-56
CB293790,: 1 > 753
1 -e-value=9e-44

,1 PO 100 1150 0 250 300 3 50 P0 0T P600 6 ,700 1,750 0

Figure 4-10. The clone 109 had sequence homology to citrus ESTs. The citrus EST
Accession CK935651 was obtained from a library using citrus fruit
developing tissues. The CB293790, from a library using citrus cold acclimated

However, blasting the longer citrus EST homolog (Accession CK935651) as a

translated query gives a high match (2e-65) with an 'E3 ubiquitin ligase SCF complex

subunit SKP1/ASK1 (At2)/UFO-binding protein (UIP2)' of Arabidopsis thaliana

(Accession NP568603.1). The clone 109 had visual differences in the membranes (panel

B 1, Figure 4-4A); had an averaged transcriptional fold induction of around eight times,

Log2[(nB+0.01)/(nH+0.01)] =3.12, with p<0.014 (Table 4-1 and Figure 4-5B); and it was

significantly upregulated in three out of the ten studied pairs of samples. Therefore, the

clone 109 is considered to represent a true upregulated gene under the citrus blight


The clone 149 is 144 bases long and has only poor matches in Genbank either as a

nucleotide query or as a translated query, but it has a good match with a citrus EST (2e-

54) in the Brazilian databank. It is from the B-H enriched library. The clone 149 probably

represents an unchanged gene under the citrus blight condition, considering the three

methods used to evaluate its transcriptional pattern.

The clone 153 is from the B-H enriched library, but probably represents a true

downregulated gene under the citrus blight condition. It displayed visual differences in

the membranes (panel E9, Figure 4-4B); significant differences in the cluster analysis

with p<0.005 (Figure 4-5B); and two significant differences in the contrast of mean

analysis (Table 4-1 and Figure 4-6). However, the sequence information available was

poor, with low phred-quality parameter. It was re-sequenced twice with no further


The clone 157 is 195 bases long but had no good match in all three searched

databases. Because of its variance (Figure 4-6), it is considered to be another false

positive outcome, not representing a true upregulated gene under the citrus blight



The process of building cDNA arrays is marked by many steps that go from the

collection of samples to make the libraries until the manipulation of the membranes. As a

consequence, the final data can carry cumulative sources of nonspecific variation, which

may compress or hide legitimate up or down regulated genes under study. With that

concern, Chuaqui et al. (2002) stated that researchers must be aware whether the results

in microarray based experiments are accurate and the data fundamentally describe the

phenomenon being investigated. In addition to employing replicates as used in this study,

Chuaqui et al. (2002) considers the need of a validation process. Therefore, an

independent RNA assessment method was used to confirm, or not, the transcriptional

level of the previously identified genes under non and citrus blight conditions. The effect

of cold and drought stresses was also tested.

Quantitative Real Time PCR was the Method of Choice

Among the available methods, quantitative real time PCR was the method of

choice, because of its sensitivity and reliability. It has been used under different platforms

and for different purposes, such as confirmation of microarray data in human cancer

research (van den Boom et al., 2003), and quantification of a citrus pathogen (Oliveira et

al., 2002). It is based on the determination of a fluorescent signal produced during the

PCR cycles, allowing the quantification of the amplified product at a real time and the

subsequent estimation of its relative original template concentration (Mackay et al.,

2002). According to Dorak (source: http://dorakmt.tripod.com/genetics/realtime.html, last

accessed on January 10, 2004), real time PCR is a preferable alternative to study

transcription to other forms of reverse transcriptase (RT) PCR, which only detect the final

amount of the amplified product. The chemistry employed in real time PCR detection

system is the key to the process. There are two general methods for the quantification of

the PCR product: the DNA binding reagents (i.e. SYBR Green) and the fluorescent

probes (i.e. TaqMan). Characteristics of each detection type and more details about the

technique can be seen in Mackay et al. (2002). The TaqMan probe relies on the

fluorescence resonance energy transfer (FRET) for quantification. TaqMan probes are

oligonucleotides that contain a fluorescent dye, typically on the 5' base, and a quenching

dye, typically located on the 3' base. When irradiated, the excited fluorescent dye

transfers energy to the nearby quenching dye molecule rather than fluorescing, resulting

in a nonfluorescent substrate. TaqMan probes are designed to hybridize to an internal

region of a PCR product. During PCR, when the polymerase replicates a template on

which a TaqMan probe is bound, the 5' exonuclease activity of the polymerase cleaves

the probe. This separates the fluorescent and quenching dyes and FRET no longer occurs.

Fluorescence increases in each cycle, proportional to the rate of probe cleavage.

Normalization is done against an active internal control such as a ribosomal or other

gene. Passive controls, compounds that do not participate in the PCR reaction, are used to

adjust the reaction level and background. Other important parameter is the threshold

cycle, or Ct, obtained by an arbitrary threshold line chosen within the linear phase of the

PCR reaction, that gives the PCR cycle for that fluorescence value. The Ct values are

used to compare different PCR reactions, allowing the quantitative estimation of the

initial target template.

Compared to DNA dyes, the TaqMan method also has the benefit of producing an

amplified target with longer sequence specificity, since it is the product of the

hybridization of two primers plus a probe, in a total length that normally stays around 150

bases. Real time PCR using dyes (i.e. SYBER Green) relies only on the specificity of the

primers. Considering the described characteristics, the TaqMan probe was the method of

choice to validate (or not) the initial results of the cDNA array experiment.

The Selected Clones and the Characteristics of the Probes

The selected clones observed in the cDNA array were used in this experiment. The

clones considered to represent up-regulated genes under the citrus blight condition were

the clones 25, 38 and 109. The clone 149 appeared to be nearly unchanged. The clone

153 was considered to be down-regulated; however the sequence information for this

clone was poor, even after re-sequencing. Thus, the clone 6 was included in this

experiment as a candidate to represent a down-regulated gene under the citrus blight

condition. Those clones were chosen because genes with altered transcriptional levels

under the citrus blight condition can be valuable tools on further comprehensive

experiments. Genes with unaltered patterns can be useful references for normalizations or

for other biological needs as well.

Based on sequence homology, the clone 38 represents a citrus chitinase gene (Table

4-2, chapter 4). Chitinases are known to respond to different forms of stresses, such as

fungal pathogens in citrus plants (Fanta et al., 2003). Citrus blight causes mineral

unbalance with a clear pattern for zinc deficiency in leaves. Taylor et al. (1996),

identified a small protein, named P5 (Accession AAB46813), that has sequence

similarities to chitin binding proteins and functions completing zinc in affected plants. It

is probably associated with the known translocation of zinc from leaves to trunk tissues

(Albrigo and Young, 1981). In addition to the clone 38, chitinase homologs were found

in our libraries and in combination with the class I Chitinase (Accession AB081944.1) as

reference, a putative nucleotide sequence for a P5 candidate gene was deduced and was

used in this validation experiment (Figure 5-1).

true P5 Query: 2 CGKSWCPGGECCSRFGWCGL 22 22 residues
AB081944.1 Sbjct: 25 CGSGWCPGGECCSQYGWCGL 45 e-value=le-05

C) region of the citrus chitinase gene used in the real time PCR
SClone38: 681 (< 906 (corrplementary)
< I
p5-candidate: 70 ) 135
Chitinase-I: 1 ) 935
I >

,1 ,100 O200 30O0 ,400 ,500 PO0 ,700 POO ,900

Figure 5-1. Designing a candidate sequence for the P5 gene. A) The true P5 protein has
homology to the translated version of the citrus chitinase class I Accesion
AB081944.1. B) The aminoacid identities was 80%, with an e-value of le-05.
C) Based on the reference chitinase class I (Accession AB081944.1), which
also had high homology to the clone 38, a candidate sequenced was designed
for the P5 gene and was used in the real time PCR experiment.

protein e-values Highest match on sequence search analysis

true P5 le-05 Citrus chitinase class I, Accession AB081944.1

Another gene associated to citrus blight is the P12 (Accession AF015782). It is up-

regulated in affected plants (Derrick et al., 1990) and has sequence similarities to

expansins (Ceccardi et al., 1998), but has so far an unknown role in the decline of the

trees. P12 was also included in this experiment.

The Table 5-1 displays the characteristics of the chosen probes for each of the

candidate clones and P12.

Table 5-1. Characteristics of the chosen probes. The primers and probes were designed
using the PrimerExpress Software (Source: Applied Biosystems Resources,
http://www.appliedbiosystems.com/index.cfm, last accessed December 10,
Clone Start Length Tm GC Taqman probe architecture
(bp) (bp) (C) (%)
name (flourochrome-5'sequence 3'-quencher)

149 213 26 69 42 fam6-CTGTATCATCTTACTTTACGCTTCCC-tamra
P5 candidate 78 18 68 67 fam6-AAGCGGCGTTGTGTGCCC-tamra
P12 179 25 69 56 tet-TGGAGTCATGATAGCCGCAGCAAGC-tamra

Two major calculation methods are possible, the absolute and the relative

quantification of the target gene (Source: bulletin # 2, Applied Biosystem,

http://www.appliedbiosystems.com/index.cfm, last accessed December 10, 2003). This

study employed the relative method. Then, the 18S gene was chosen as the active internal

control, or normalizer, because it is considered to be non altered under different

conditions (Dorak, 2004, source: http://dorakmt.tripod.com/genetics/realtime.html, last

accessed on January 10, 2004). However, no previous information was seen about the

18S levels in feeder root samples of citrus hybrids under non and citrus blight conditions.

It was assumed that the transcriptional level of the 18S gene was not altered by citrus


To test the efficiency of the amplification between the target gene and the

normalizer, a RNA 2 fold dilution series was evaluated, from 3.9 to 1000 ng of a mixed

pool of RNA templates. Under a similar efficiency, the graphic of the log input amount of

the total RNA and ACt (difference between the chosen thresholds, the Ct of the target

minus the Ct of the normalizer) would give a straight line, nearly parallel to the abscissa.

Small deviations from that are accepted and the bulletin # 2 of Applied Biosystem

(Source: http://www.appliedbiosystems.com/index.cfm, last accessed December 10,

2003) recommends that the absolute value of the slope (of the estimated linear function)

should be equal or smaller than 0.1. Figure 5-2 displays the outcome for the clone 109,

which had a slope of 0.1055, for the tested range of 3.9 to 1000ng of RNA template.

A) Plot of log input amount versus ACt
30 ACt


26 -

clone 109 x 18S
S= 0.1055x + 26.138 Linear (clone 109 x 18S)
22 -....
-2.4 -2.1 -1.8 -1.5 -1.2 -0.9 -0.6 -0.3 0.0
Log ng Total RNA

Figure 5-2. Relative PCR efficiency plot of the clone 109 against the normalizer 18S.

In the same type of analysis, the clone 6 had a slope of 0.0104; the clone 25,

0.1029; the clonel49, 0.0602; the P5 candidate, 0.0811; and the P12, 0.0196.

Collecting and Preparing the Samples

The same citrus groves in central Florida area, used to collect root samples for the

cDNA array experiment, were revisited, with the expectation to re-assess the same trees.

However, most of the previously healthy trees had started to display some blight

symptoms and some of the affected trees had been pushed out. Therefore, some other

plants were used in the real time PCR experiment, after verification of the typical

symptoms and the water test (Lee et al., 1984) for diagnostic purposes. Three classes of

plants were sampled:

* Healthy: with no visual symptoms in the canopy, and with a minimum uptake of
water, manually injected into the trunk by a syringe, of 3 ml/10 seconds.

* Mildly affected: initial symptoms in the canopy, such as opaqueness of leaves and
few twig dye backs on the top. Uptake of water from 1 to 2 ml/10 seconds.

* Blighted: fully symptomatic canopy. Uptake of water smaller than 0.5ml/10

Tentative different stages of the process (healthy, mildly and fully affected trees)

were used because they may offer more information than only comparing healthy and

fully declined trees, as done on the cDNA array experiment.

Feeder root tissues from each tree were once again collected and the RNA

extraction procedures had this time double DNA digestion step, using an adaptation of

the Qiagen RNeasy kit (Source: Qiagen, http://wwwl.qiagen.com/Default.aspx, last

assessed January 4, 2004). No DNA contamination was observed when verifying RNA

quality on formaldehyde gels. All sampling and extracting procedures were done as

uniformly as possible. The sampled trees were Valencia sweet orange (Citrus sinensis L.

Osbeck cv. Valencia) on the rootstock Carrizo citrange (Citrus sinensis L. Osb. x

Poncirus trifoliata L. Raf.) of around 10 years old. This choice was considered because

trees of Valencia on Carrizo have been largely used in the Florida citrus industry. The

combinations of Valencia on Rough lemon and on Swingle citrumelo were also initially

considered. But the sampled trees were of different ages and had other non uniform

conditions. Therefore, they were no longer considered.

Reverse Transcriptase (RT) and PCR Reactions

Duplicated RT reactions and two PCR reaction sets per each sample were used to

minimize pipeting and other reaction errors, resulting initially, in four mechanical

replicates per each biological sample. Both RT reactions for each sample were done at

the same time and under the same conditions, using a 96 well plate and the protocol given

by the Applied Biosystem RT kit (Source: http://www.appliedbiosystems.com/index.cfm,

last accessed January 10, 2004). Other conditions were also as uniform as possible. The

RT plate was then stored at -20C.

The 7700 Applied Biosystem sequence detection system was employed for all set

of PCR reactions. The PCR conditions were 50C/2minutes, 95C/10minutes, and 45

cycles of 95C/15seconds plus 60C/1minute.

An arbitrary threshold cycle (Ct) was chosen for each amplification plot. The data

was analyzed using the baseline computation method on the Apple based Sequence

Detection System (SDS) vl.9 software (Source:

http://www.appliedbiosystems.com/index.cfm, last accessed April 10, 2004).

Three controls were employed in all real time PCR plates: the NTC (no template

control, to verify non specific amplifications), the NRT (no reverse transcriptase control,

to verify DNA contamination) and the NAC (no amplification control, to verify non

specific readings). After the reactions, none of the NACs gave integral fluorescent

readings. The great majority of the NTCs did not reach the chosen threshold level (Ct) for

the target gene at the 40th PCR cycle. The reactions that did, were discarded. All samples

that had a difference in the ACt (the Ct of the sample minus the Ct of the NRT) for the

reading of the 18S gene, smaller than 10 cycles were also discarded. The Applied

Biosystem (Source: Taqman ribosomal RNA control reagents protocol,

http://www.appliedbiosystems.com/index.cfm, last accessed April 10, 2004) recommends

this cut off level to avoid significant contribution of non-target templates to the measured

gene. The remaining healthy, mildly affected and blighted samples were further analyzed.

Figure 5-3 displays examples of amplification plots for the clone 109, P5 candidate and


Relative Quantification of the Transcriptional Levels of the Selected Genes

All samples were analyzed in groups according to their similar levels of 18S,

measured by the threshold (Ct) in each reaction. Four replicates, groups of independent

healthy, mildly affected, and blighted trees, were analyzed, in a total number of twelve

different sampled trees.

Each clone was evaluated individually. The contrast to compare 'healthy-mildly

affected-fully blighted conditions' is not orthogonal. Therefore, the t-Test can not be

used. The residual standard deviation (s) was chosen to indicate the non specific variation

within each group of plants, or replicates. This measure of variation indicates the effect of

non controlled factors, and therefore, seems adequate to estimate the contribution of

errors in the experiments. It was calculated using the mean square of the residue (MSres),

after the ANOVA (analysis of variance) for each group of plants, as:

s = (MSres)

A) The clone 109 robe used the fluorochromes FAM6 and TAMRA


PCR cycles

B) The P12 probe used the fluorochromes FAM6 and TAMRA


PCR cycles

C) The P12 probe used the fluorochromes TET and TAMRA


PCR cycles

Figure 5-3. Examples of real time PCR reactions. A) For the clone 109. B) For the P5
candidate gene. C) For the P12. The reactions were done with samples from
all the tested conditions and reflect the differences in the transcriptional level
of the target gene according to each sample.

Figure 5-4 displays the relative transcriptional levels of the selected clones. Within

each group of plants, regression analysis was performed and a polynomial equation was

shown. The three evaluated stages of the disease (healthy, mildly and fully blighted trees)

are certainly not enough for better inferences about the progress of the disease, neither

blight can be precisely estimated, since no pathogen is known to cause the problem. But

an initial tendency of the relative transcriptional levels compared to the healthy samples,

was observed for some of the clones.

The clone 6 can probably be considered a mistaken choice taken from the cDNA

array experiment. The tentative down-regulated pattern was not observed in the real time

PCR experiment. Moreover, it seems to be up-regulated in affected comparing to healthy

plants. More replicates, or maybe other techniques, would probably be needed for further


The clone 25 was considered to be up-regulated in affected plants, especially when

Swingle rootstock was used (panel Cl, Figure4-4C). This pattern was also observed in

the real time PCR experiment using Carrizo rootstock, confirming the previous

expectation. In the group D of plants, the fully blighted tree displayed similar

transcriptional levels to the healthy tree, but both were lower than the mildly affected

one. It is possible that fully blighted trees reduce some of their metabolism affecting the

transcriptional level of certain genes. That was apparently the case for this gene in this

studied blighted tree. In the other three groups of plants, the relative amount of the

transcripts of the gene represented by the clone 25 were more abundant in fully blighted

than in healthy or mildly affected plants. Therefore, the clone 25 was considered to

represent an up-regulated gene under citrus blight conditions.

rep. D 15.31

4K t clone 6


clone 25

--- clone 109

1 0.02 3.05 26.11 5.9c
--------- 2-4 -2O4

A A 10.29

332 9. 12 .. 241 .204
- --

clone 149

P5 candidate


Hcz Mcz Bcz
205 223 404


Hcz Mcz Bcz
201 225 402


Hcz Mcz Bcz
203 227 406


Hcz Mcz Bcz trees
265 229 454

22.39+/-2.02 18S Ct +/-StDev

Figure 5-4. Relative transcriptional levels of the selected genes. Twelve individual plants
were analyzed in four groups (rep. A, B, C and D), based on similar Ct values
for the 18S readings. Feeder root samples of healthy (H), mildly affected (M)
and fully blighted (B) trees on Carrizo (cz) rootstock were numbered (201 to
454) and used in this experiment. The columns represent the relative
transcriptional level of each clone, comparing to healthy samples. The bars
represent the residual standard deviation estimated for each group of plants.

rep. A 1.44

rep. B




The clone 109 was up-regulated in three out of the four replicates, comparing the

healthy to any of the two blighted conditions. The pattern was similar in the groups B and

C. The mildly affected plant of the fourth replicate (group D) displayed even higher

transcriptional level than the fully blighted tree. In addition, this pattern of the second and

third replicates (groups B and C of plants) may represent only an initial or partial

outcome for a latter blight development that has yet to come, and could reduce the

transcripts of the gene represented by the clone 109 to a similar level observed in the

group D of plants. That seems possible because citrus blight can not be precisely

quantified so far, and therefore, the progression of the disease can not be completely

pursued either. The first replicate (group A of plants) displayed a non expected result.

The relative transcriptional level of the mildly affected plants was reduced to a range of

40% comparing to the healthy trees. To test whether or not that was an artifact of the

method, a new RT and PCR reactions were run with the same RNA samples. No further

discrimination was observed, however the residual standard deviation was higher. The

mildly affected tree still had around 40% of the transcripts compared to the healthy

sample while the blighted reached 1.4 the healthy sample. It is possible that this result

may represent noise caused by blight itself, or by another factor not studied in the system.

New samples from the field were not collected and tested because that would add a

contribution of the season of the year and temperature to the present model. In addition,

the sampled plants are probably in different stages of blight at this point, because all

studied samples were collected and processed six months ago, from January 9th to the

15th of this year.

Considering that the clone 109 was up-regulated in three out of four replicates; that

a similar pattern was observed; and that the level of induction compared to healthy plants

was above twenty fold in the groups C and D of plants; the clone 109 was considered to

represent a gene that is upregulated under citrus blight conditions, confirming the

expectation from the cDNA array experiment.

The clone 149 was variable but with no defined pattern considering the outcome of

the four groups of plants. On the cDNA array, the transcriptional level of the gene

represented by this clone was nearly unchanged by citrus blight. However, since the real

time PCR is more sensitive, discrepancies towards either way, being up or down-

regulated according to individual organisms, could be unfolded because in the cDNA

arrays the data tends to be compressed. That was apparently the case, and the clone 149

does seem variable, but according to other factor not studied.

The P5 candidate gene was responsive to citrus blight with a similar pattern in all

four replicates. It was more abundant in fully blighted trees than in any other studied

condition. Apparently the gene represented by the P5 candidate displays an ascendant

transcriptional response towards the fully blighted tree. This result may not parallel the

initial complexation of zinc seen in leaves and trunks of mildly affected trees (Albrigo

and Young, 1980). Therefore, the chitinase gene represented by the P5 candidate is

considered to be upregulated under citrus blight condition, confirming the similar

expectation observed with the clone 38 in the cDNA array experiment; however, it

remains to be investigated whether or not this candidate gene is the true P5 identified by

Taylor et al. (1996). It is worthy to note that the behavior of the true P5 is not known in

feeder root tissues, as used in this experiment.

The P12 displayed a significantly higher transcriptional level on mildly affected

plants compared to healthy or fully blighted trees. The pattern was similar in all four

groups of tested plants. It is possible that if more stages of blight were available, a wider

range of conditions would be better evaluated, and maybe a different polynomial

equation would better describe the phenomenon. But the pattern for a higher

transcriptional level in mildly affected trees was clear. The lower amount of P12

transcripts in fully blighted trees may account for the previous failure in detecting P12 in

the subtracted libraries and also in the cDNA array experiment. Both procedures

employed samples from fully symptomatic trees.

Although patterns were observed, the intensity of the responses was related to the

group of studied plants. Therefore, a general, or averaged, transcriptional level for each

gene was not estimated, because it may not meaningful.

The Potential Biological Meaning of the Clone 109

Regardless of what causes citrus blight, affected plants visually go to a declining

condition during the whole process. A closer look at the clone 109 reveals sequence

homology to a citrus EST annotated as a cold acclimated responsive gene from the

Washington Navel sweet orange (Citrus sinensis L. Osbeck cv. Bahia), in experiments

done in California (Close et al., 2003; in press; assession number CB293790.1), shown in

Figure 4-10 (Chapter 4), with an e-value of 9e-44.

It is known that plants respond to cold and to drought periods activating and

repressing responsive genes. Seki et al. (2001) found 5 drought specific inducible genes,

2 cold specific inducible genes and 16 drought and cold inducible genes using a

microarray with around 1,300 full length cDNAs ofArabidopsis thaliana. Citrus blight is

a xylem blockage problem, which ultimately may lead to water deficiency, and maybe,

that gene represented by the clone 109 is involved in this process. In addition, the clone

109 displayed mostly higher transcriptional levels under citrus blight condition, using

samples from different seasons of the year.

An alternative hypothesis could claim specific response to the citrus blight process,

rather than being induced only as an indirect effect of the internal water stress caused by

citrus blight. The clone 109 also had potential similarities to an ubiquitin subunit (Table

4-2, chapter 4) of the SCF complex (Skpl-Cullin-F-box protein). This complex is

involved in the ubiquitination of proteins and cell cycle regulation. The citrus blight

process can be seen as an accelerator of senescence. Young affected trees, of 5 to 10

years old, start to display an overall decline and lack of vigor, normally only seen on

healthy trees older than 50 years. The clone 109 could function in the ubiquitination

process, targeting other proteins for degradation, and or, impairing the normal cell cycle

in affected trees.

Experimental confirmation is certainly needed either way regarding its function and

involved pathways. But in the first scenario, if cold acclimation is a feasible goal in plant

genetic engineering programs, maybe 'hardening' rootstocks for citrus blight could be as

well. In the second scenario, experimental effort on the cell cycle regulatory process in

citrus can eventually offer perspectives to control citrus blight.

A Tentative Test to Verify the Effect of Cold and Drought Stresses

In order to evaluate whether or not the gene represented by the clone 109 responds

to cold and drought stresses, another experiment was assembled and run. Other clones

were also included. The major objective was to compare the transcriptional levels of the

selected genes, and determine whether they seem to be a specific response to citrus

blight, or only a secondary effect of the stress caused by the disease. However, moving

adult citrus plants to controlled conditions was not attempted. Greenhoused young trees,

of about one year old were used instead. They were exposed to cold (4C for 52 hours)

and drought stresses (no water for one week plus additional root airing for 24 hours).

Seedlings of Carrizo citrange (Citrus sinensis L.. Osb. x Poncirus trifoliata L. Raf.) were

chosen to equal the genotype evaluated in the previous real time PCR experiment. The

references, or control plants, were from the same lot of seedlings, but kept under normal

greenhouse conditions for the same period of time. Four independent replicates (i.e.

different seedling plants) were evaluated for each treatment. Feeder root tissues were

once again used. Figure 5-5 shows the results. The contrast of interest, to compare the

control, cold and drought treatments, is not orthogonal, and therefore, the t-Test can not

be used. However, the number of replicates was uniform, allowing the application of a

test to compare the means. Among the options, the Tuckey test was employed because of

the better discrimination of the means compared to other tests, like Sheffee, Dunnett or

Duncan (Banzatto and Kronka, 1992). The null hypothesis was no difference among the


The clone 109 did not respond to cold and drought stresses under the studied

conditions. No significant effect (p<0.05) was seen for most of the other clones either,

including P12. The drought treatment only affected the gene represented by the clone 25.

Its transcriptional level was reduced to around one-third compared to the control. This

level of significance (p<0.05) implies that the maximum estimated chance of having

similar results caused only by chance is of only 5%. Lowering this probability to 1%

(p<0.01) makes this difference became not significant. In spite of which level of

probability should be considered, this reduction of the transcriptional level was not


expected. Blight induces xylem blockage; and consequently, a potential internal water

stress. Since the clone 25 was considered to be up-regulated in the cDNA array and in the

real time PCR experiment, it would also be expected to be unchanged or up-regulated

120 o 1o
100 0- -_---- -
060 ----- ----- -

seedlings drought cold

1 60
1 40 -------- ------- ---
120 ---- ------ 113
100 --- 100 084
080 -- -- -
060 ---
040 --- -------- -
020 ---- --- -
seedlings drought cold
1l i -------------------


I 069

clone 6


clone 109


065 candidate
0-- A=1.15



80 038

seedlings drought cold

1 00
1 00 -
100 --- --- ..
00 60
040 -
020 --- ----
seedlings drought cold

Figure 5-5. Contrasts comparing the effect of cold and drought treatments on the relative
transcriptional level of the clone 109 and other clones. The Tuckey test was
employed and an observed significant difference was highlighted with a star.
The bars represent the minimum significant difference for the contrast (A
values, for p<0.05) of each clone.

under drought stress. Another experiment using adult trees under controlled conditions

may address this question. Similar reasoning may be considered for the other genes as

well. A definitive answer about the effect of major stresses would need adult trees under

clone 25


clone 149




controlled conditions. Therefore, the responsive genes to citrus blight, and

apparently not affected by drought and cold stresses, seem to be at this point, only the

clone 109, the P5 candidate and the P12.

The Potential Effect of Redundancy and Gene Families

The selected clone 38 represents a citrus chitinase gene. Two genes (chitinase class

I, accession AB081944.1; and chitinase class II, accession Z70032.1) were matched to

the 235 bases of the clone 38 with the same e-value of le-87. The homology was seen

towards the 3'end of the subjected sequences (Figure 4-8, chapter 4). Chitinases are

enzymes that catalyze hydrolysis of chitin polymers, acting against plant intruders by

destroying chitin-containing cell walls. The difference between the class I and the class II

is based in the presence (I) or absence (II) of a N-terminal chitin binding domain (source:

http://us.expasy.org/cgi-bin/prosite-search-ac?pdoc00620, last accessed June 1, 2004).

Therefore, the clone 38 arrayed in the cDNA array membranes (chapter 4) could

represent any of the two described genes.

The 22 aminoacids of the P5 protein (accession AAB46813) had 80% identity to

the same chitinase class I, accession AB081944.1, with an e-value of 7e-05. The matched

region was however in the conserved 5' end of the subjected sequence. The Taqman

probe and primers were designed to span this region, covering 88 nucleotides long. The

Figure 5-1 displays the homolog regions between the sequences of the reference

chitinase, clone 38 and P5 candidate.

Therefore, it is not possible to discern precisely if the clone 38 and the P5 candidate

represent the same gene, or not, within the chitinase family. In addition, the sequence for

citrus is limited, but searching the genome of the model plant Arabidopsis thaliana, the

reference chitinase class I, accession AB081944.1, had 15 matches in the protein


databank (source: TAIR, http://www.arabidopsis.org/, last accessed June 1, 2004), with

e-values varying from 3e-7 to 4e-95. It is possible that this situation is similar for citrus,

with a high number of redundant genes, imposing another level of difficulty in the

evaluation of transcriptomes. The situation can be similar for P12, which had 17 matches

in the protein database of TAIR, all expansins, with e-values from 2e-04 to 5e-30. There

are two gama expansins with noted similarity to P12. Therefore, it is possible that more

copies of homolog P12 genes are also present in citrus plants.


A crucial question in citrus blight research is the origin of the problem. Several

causal agent candidates and other theories have been examined, but none has proved to

be definitive for blight.

Each reported theory has been based on observed characteristics of the disease;

however blight is a complex problem, and different views and perspectives are possible

under different circumstances. For instances, the non-transmissibility of citrus blight by

canopy tissues was observed long ago (Rhoads, 1936; and COHEN, 1968), but

transmission by root grafting was later obtained (Tucker et al., 1984). Soils with higher

pH and levels of Ca were associated with severe incidences of blight in Florida

(Wutscher, 1989); however, blight does occur in acidic soils and examples are common,

especially in the Sao Paulo citrus belt. Soil born pathogens were associated to blight

(Nemec et al., 1982); but transmission of blight by soil replacement was not obtained

(Timmer and Graham, 1992). Xylellafastidiosa was considered to be the causal agent of

blight (Hopkins, 1988); but this xylem limited bacterium is naturally present in many

vascular plants, including citrus. A higher incidence of blight was observed after the

implementation of the nucellar programs in Florida and in Sao Paulo (Derrick and

Timmer, 2000), probably reflecting the new endophytic balance in the nucellar plants but

blight has also a high incidence on certain old line trees, and examples on 'Olimpia', and

on other clones of the 'Pera' sweet orange that were not pre-immunized against citrus

tristeza virus (CTV) are commons in Sao Paulo. The theory about a molecular origin for

blight suggested the involvement of defective signals transmitted from plant to plant

(Carlos et al,2000), but no experimental evidence for that have been found. Strains of

citrus tristeza virus (CTV) were reported to be associated with a potential variant of

blight (named Rangpur lime decline) and to citrus sudden death diseases in Brazil

(Derrick et al., 2003), but CTV is commonly present in stem-pitted sweet orange plants in

Sao Paulo causing no major disturbances (Costa et al., 1954).

In spite of the merit and investigations of each theory, one characteristic initially

proposed by Swingle and Webber (1896) seems difficult still to be denied: citrus blight

apparently has an infectious nature and dissemination. In order to investigate a potential

causal agent for citrus blight, qualitative and quantitative experiments were performed.

The First Screening of the Subtracted Libraries

When the subtracted libraries were made (chapter 3), during the summer of 2001,

the following question regarding which genes were represented there was first addressed

using a virtual northern blot experiment.

The differentially enriched cDNAs from the blighted minus healthy (B H) library

were cloned and grown in the E. coli vector and plated on LB medium. Ninety six clones

were randomly selected for re-growing on two equally printed nylon membranes. After

growth, the membranes were rinsed with extensive washes and hybridized overnight with

P32 labeled probes. The probes were also made from the subtracted blighted (B H) and

healthy (H B) enriched cDNA libraries, uncovering tentatively more abundant

transcripts represented there. A B H clone when revealed by the B H probes and not

by the H B probes implied a larger presence of the transcript of that gene in the blighted

samples that originated the library, from the affected trees. To the contrary, a B H clone

when revealed by both types of probes ( B H and H B ) indicated similar amounts of

the transcript in both libraries, and therefore, were of no interest. Virtual northern blots

can be effective to reveal abundant transcripts in enriched libraries (Source:

http://www.bdbiosciences.com/clontech/, last accessed January 15, 2004), which may

include those of RNA based viruses, such as the majority of the plant viruses.

Figure 6-1 displays the results for the virtual northern blot experiment. Among

others, the arrows indicate that the clones E8-13 and E8-14 were far more abundant in the

B H library.

B H probes H B probes


Figure 6-1. The virtual northern blot of the B H clones. Each clone was printed in two
membranes that were respectively probed with B H and H B probes labeled
with P32. The subtracted libraries were made using the superficial roots of
Rough lemon (Citrus jambhiri Lush) collected in the central Florida area,
during the summer of 2001. The green arrows indicate the clones E8-13 and

Sixteen clones were considered to be differentially transcribed in the B H library

and were selected for sequencing. Among the plant genes, possible up regulated ones

included clones with similarities to metallothionein and several unknowns. However,

based on sequence homology, the clones E8-13 and E8-14 were not plant genes, but part

of the 3'end of the P27 divergent citrus tristeza virus (CTV) coat protein gene. The clone

E8-13 was 311 base pairs long and the E8-14 was revealed to be only a shorter and

redundant version of the same gene, with 155 base pairs. Table 6-1 displays the first four

nucleotide based homolog sequences found in all databases of Genbank for clone E8-13,

using the Blast-N search analysis (Altschul et al., 1997). Similar results were found using

the translated query searches.

Table 6-1. The clone E8-13 had homolog sequences matching different isolates of the
citrus tristeza virus (CTV). The clone E8-13 is 311 base pair long and was
found in the citrus blighted minus healthy (B-H) subtracted library made from
sup erficial roots of Rough lemon (Citrus jambhiri Lush).
clone Homolog gene e-values

E8-13 >gil1732493 gb|U56902.1|CTU56902 Citrus tristeza e-162
virus p346, 54-kDa RNA dependent RNA polymerase,
p33, p6, p65, p61, p27, 25-kDa coat protein (CPG),
p18, p13, p20, and p23 genes, complete cds

>gil 11414863|dbj|AB046398.11 Citrus tristeza virus e-147
genomic RNA, complete genome, seedling yellows

>gi|20988251gblAF001623.1|CTAF001623 Citrus e-136
tristeza virus, complete genome

>gi|3550999|dbj|AB011189.1| Citrus tristeza virus 2e-87
genomic RNA for 27K protein and coat protein, partial
cds, isolate KS3A2

Looking at the homolog sequences, the first match, accession number U56902, was

isolated in Israel and represents the coat protein gene of CTV (Mawassi et al., 1993). The

second, accession AB046398, was a seedling yellows strain from Japan (Suastika et al.,

unpublished). The third, accession AF001623, was isolated in Texas causing severe

symptoms in sweet orange (Yang et al., 1999). The fourth, accession AB011189 is the

P27 gene also isolated from strains of Japan (Kano et al., unpublished).

Sequence information is limited for citrus, but to verify other potential origins for

the clone E8-13, other databases were searched. Homolog sequences were not found in

different plant databases. The first matched outcome in the blast searches (Altschul et al.,

1997) using the non-mouse and non-human ESTs and the viridiplantae databases of the

Genebank yielded respectively matched sequences with e-values of only 5.7 and 1.1.

Using the Brazilian citrus EST database, the result was not different, with an e-value of

only 0.18 for the first outcome. Therefore, the clone E8-13 was considered to be part of

the P27 gene of the CTV genome. The highest matched sequence indicated similarities to

an Israeli isolate.

In addition, both clones, E8-13 and E8-14, displayed polyadenylated 3'ends in their

sequences. The question whether that was an artifact of the method used to build the

cDNA libraries (Smart cDNA kit, source: http://www.bdbiosciences.com/clontech/, last

accessed June 20, 2001), or an adaptation of the CTV to the molecular machine of citrus

remains to be investigated.

The presence of CTV in citrus plants is not novel, and the solution for the Tristeza

disease in sweet orange groves was reported long ago (Costa et al., 1954). However, the

presence of CTV strains in roots of citrus plants affected by blight is intriguing. This

result was similar to previous observations made by Derrick et al.(unpublished). It is also

necessary to review that Rough lemon is susceptible to CTV and those findings alone

may not add novelty to what is already known about CTV and citrus host interactions.

Other CTV Genes were also Found in both Subtracted Libraries

Later, around four hundred clones randomly selected from the blighted minus

healthy (B-H) and 100 from the healthy minus blighted (H B) enriched libraries were

sequenced. Clones with sequence similarities to other CTV genes were relatively

common, matching different isolates and strains. Redundancy was observed, and

normally, more than one clone matched the same analyzed gene. The Table 6-2 displays

examples of pieces of CTV genes found in both libraries.

Table 6-2. Other sequences with homology to CTV genes found in the blighted minus
healthy (B-H) and healthy minus blighted (H-B) subtracted libraries.

library CTV gene e-value clone

B H p23 e-153 M1H7
p346RDRPol 6e-70 M2E2
p33 3e-43 M3A1

H B p61 e-131 E8-28
hsp90 p61 e-158 E8-21
p65 0.000 E8-22

Quantitative Evaluation of the P27 Candidate Gene in the Blighted Trees

In order to evaluate the presence of the transcripts of the P27 candidate gene,

reverse transcriptase quantitative real time PCR was run.

The chosen Taqman probe employed the 'Fam6-5'sequence 3'-Tamra' architecture

and had an accepted PCR efficiency (Chapter 5). The absolute value for the slope of the

linear function (y= -0.1008x +22.13), that described the log input amount of the total

RNA (x) against the ACt (y) between the target and the normalizer 18S, was 0.1008. The

tested range was a 2 fold dilution series from 3.9 to 1000 ng of total RNA. The


comparative ACt method was used to avoid the need of in vitro synthesis and purification

of the P27 RNA for absolute quantifications. For calculation purposes, reactions that did

not display amplifications were considered having a Ct value of 45 cycles. To minimize

non-specific variations, two reactions per sample were run. The same healthy, mildly

affected and fully blighted plants that were used to evaluate other genes (Chapter 5) were

used here. They were Valencia sweet orange (Citrus sinensis L.. Osbeck cv. Valencia) on

Carrizo citrange (Citrus sinensis L. Osb. x Poncirus trifoliata L.. Raf.) of around 10 years

and from the central Florida area. Four groups of plants, or replicates, were evaluated.

The transcripts of the P27 candidate gene were present in far larger amounts in

affected than in healthy trees (Figure 6-2). The fully blighted trees on the group B of

plants still have around eight times more P27 transcripts than the healthy plants.

800,0000 400 0000 4000 300
70000000 350,000 - 3500 -
250 --
6,0,000 -- 300,0000 - - 3000 0 -

50000000 ---------- 250,0000 --- -- -2500 200 -------- 76
400,0000 -- 200,0000 - -74 200 0 - - 150 -
300,000 - - 150,0000 - 1500 142
100 -
200,000 ---------- 100,0000 ----- ----- 1000 ----- --
100,0000 ---------- 50,0000 ----- 500----- -- 50 -- --
10 08 10 88 10 10 05
Hcz Mcz Bcz Hcz Mcz Bcz Hcz Mcz Bczcz Mc B

Ct18S: 10.09+/-0.29 12.93+/-1.58 16.49+/-1.28 21.27+/-0.19

Figure 6-2. The transcripts of the p27 candidate gene were abundant in the roots of the
affected trees, Carrizo citrange (Citrus sinensis L. Osb. x Poncirus trifoliata
L. Raf.). The Ct levels for the 18S were displayed below the graphics;
columns of the blighted (B) and mildly affected (M) were compared to healthy
(H) Carrizo (cz) trees.

It is worthy to note that Poncirus trifoliata and its hybrids are considered to be

resistant to CTV (Deng et al., 2001).

The overall comparative amounts of the P27 transcripts indicated that CTV is

present in feeder roots of Carrizo citrange affected by citrus blight. Further experiments

can elucidate whether or not CTV causes or enhances citrus blight, or only grows better

in roots of already debilitated plants. Eventual synergistic or antagonistic effect on the

real causal agent of blight may also be investigated. Another possibility would be to

consider the clone E8-13 as part of another virus, with sequence similarities to CTV.

Another closterovirus would probably be the immediate suspect.


Citrus blight has imposed consistent losses and changes to the citrus industry since

its origin, in the late of the XIX century (Swingle and Webber, 1896). The molecular

mechanisms involved in the plant responses are still unknown at this point.

Evidences for differentially transcribed genes, under different citrus blight

incidences, were observed in this study. Three genes, represented by the clones studied in

this work, had higher transcriptional level in blighted than in healthy trees. The level of

response was dependent of the evaluated group of plants but patterns were observed. This

study employed transcriptional assessment of citrus genes in feeder roots of healthy,

mildly affected and fully blighted trees. Under these studied conditions, P12 had higher

transcriptional level in mildly than in fully blighted trees. The chitinase(s) represented by

the P5 candidate sequence and by the clone 38 had higher levels in fully blighted than in

mildly or healthy trees. The clones 25 and 109 showed higher levels in fully blighted

compared to healthy samples. Research is needed to reveal the function of the P12 gene

and the genes represented by the other clones. Cloning of the true P5 gene and the genes

represented by the other clones can also be another task for future efforts.

It is also possible that more clones from the cDNA array experiment are truly

differentially transcribed under non and blighted plants, but more confirmation is needed.

In addition, the created subtracted libraries can be a wealthy source of clones for further

experiments. The suppressive subtraction method was an effective way to create enriched

cDNA libraries.

The finding of transcripts of CTV genes in roots of a blight-susceptible-CTV-

resistant rootstock immediately raises further etiological questions. Under this context,

CTV can intuitively be associated with citrus blight. However, whether or not it has a

synergistic or antagonistic effect on blight, it is not known yet. Another potential

consequence of this finding is regarded to options for tolerant rootstocks to be used not

only for blight but also against citrus tristeza disease. Carrizo citrange may fall in

discredit, contributing to the already known need of research on citrus rootstocks.

Finally, it is possible to say that the end is certainly not near for blight. Research in

roots seems the logical alternative to study the problem. In this way, it is hoped that the

knowledge gained during this study can be of some use, helping to understand and

control citrus blight.


Table A-1. Blast analysis based on nucleotide sequences of each individual clone. The
clones were obtained from the subtracted libraries (chapter 3) and used in the
cDNA array experiment (chapter 4). Three databases were used for the search
and the outcomes were highlighted in black (for the All Genebank with
1,367,736 sequences), blue (for the Brazilian citrus CCSM ESTs with 13,610
clusterized sequences) and green (for ESTs of the non-human non-mouse
Genebank with 4,893,238 sequences). The clones 7 to 12 were obtained from
other libraries of citrus leaf tissues, and all the others were from the subtracted
libraries of root tissues, as described in chapter 3.

Clone Highest match description/score/e-value values Organism Function

>gi|806738|gb|U16304.1|CTU16304 Citrus
5 tristeza virus complete genome e-132 CTV p61

>gi|1785673 emb|YO8501.1|MIATGENA
6 A.thaliana mitochondrial genome, part A 0 Arabidopsis mitochondrial

Contig204 7e-11 Citrus

>gi|1673661gb|L08199.1| COTPROXDS
Gossypium hirsutum peroxidase mRNA,
7 complete cds 6E-68 Gossypium peroxidase

Contig373 e-173 Citrus

1 gb|BQ624415.1|BQ624415 USDA-
FP_01506 Ridge pineapple sweet orange e-171 Citrus

Cicer arietinum partial mRNA for
8 mitochondrial phosphate 4E-26 Cicer mitochondrial

CSJE01-038D08.g 6e-88 Citrus

1 gblBQ623911.1|BQ623911 USDA-
FP_00991 Ridge pineapple sweet orange 6e-83 Citrus

>gi|184016341reflNM 112657.11
Arabidopsis thaliana chromosome 3
9 CHR3v07142002 genomic sequence

6E-43 Arabidopsis unknown


1 dbj|C22180.1|C22180 C22180 Miyagawa-
wase satsuma mandarin orange

e-153 Citrus

4e-84 Citrus

10 cxContig94 e-146 Citrus

1 gb|BQ623982.1|BQ623982 USDA-
FP_01073 Ridge pineapple sweet orange e-145 Citrus

11 CSJE01-038D08.g 2e-94 Citrus

1 gb|BQ623911.1|BQ623911 USDA-
FP_00991 Ridge pineapple sweet orange 2e-84 Citrus

12 Contig2919 8e-27 Citrus

1 gb|BQ623455.1|BQ623455 USDA-
FP_00546 Ridge pineapple sweet orange 3e-65 Citrus

13 Poor matches unknown

14 Poor matches unknown

15 CSContig70 2e-20 Citrus

16 52 7e-08 7e-08 Citrus

1 dbj|C22172.1|C22172 C22172 Miyagawa-
wase satsuma mandarin orange... le-13 Citrus

17 Poor matches unknown

18 Poor matches unknown

19 Poor matches unknown

20 Contigl687 7e-64 Citrus

1 gb|BQ625123.1|BQ625123 USDA-
FP_02214 Ridge pineapple sweet orange 9e-66 Citrus

1 gb|BQ624910.1|BQ624910 USDA-
21 FP_02001 Ridge pineapple sweet orange e-135 Citrus

22 cxContigl377

6e-71 Citrus

23 Poor matches

24 Poor matches

25 Contig416

26 Poor matches

27 Poor matches

28 LPACOO-013G11.g

29 Poor matches

30 Poor matches

31 Contig416

32 Poor matches

33 Contig2752

>gi|7228328|emb|Y18788.1| MSY18788
Medicago sativa mRNA for putative TFIIIA
34 (or kruppel)-like zinc finger protein




le-91 Citrus



2e-06 Citrus



e-101 Citrus


le-10 Citrus

2E-14 Medicago

6e-07 Citrus


Zn finger

35 Contig2879 0.0 Citrus

36 Contig2919 9e-65 Citrus

37 Contig2879 3e-53 Citrus

38 Contig1434 3e-95 Citrus

39 Poor matches unknown

40 Poor matches unknown

41 Poor matches unknown

>gi| 1220143 emb|Z70032.1| CSACHIT2
42 C.sinensis mRNA for class II acidic chitinase 6E-79 Citrus chitinase

Contigl512 le-81 Citrus

>gi| 1220143 emb|Z70032.1| CSACHIT2
43 C.sinensis mRNA for class II acidic chitinase


44 Contig2879

45 FCContigl27

46 Contig2919

47 Contig2879

48 Contig2879

49 Poor matches

>gi|599725|emb|Z46824. 1|CSLEA5PMB
50 C.sinensis mRNA for Lea5 protein


51 No significant similarity found

52 Contig2879

53 Contig2919

Citrus limon vacuolar membrane ATPase
54 subunit G (LVMA10) mRNA,


55 Contig308

56 Contig2879

>gi|208093051gb|BC029618.11 Homo
sapiens, glyceraldehyde-3 -phosphate
57 dehydrogenase, clone
















2E-90 Citrus

4e-86 Citrus









2E-28 Citrus ATPase

e-107 Citrus

e-121 Citrus

e-130 Citrus

e-128 Human G3PDH

le-04 Citrus

Coliphage phiX174 isolate Anc, complete
58 genome e-171 Coliphage unknown

59 cxJE01-111G08.g 0.0 Citrus

60 CXAC02-065D12.g le-42 Citrus

61 cxJE01-085A10.g 0.0 Citrus

>gi|21206806|gb|AY103728.11 Zea mays
62 PCO142212 mRNA sequence 5E-19 Zea unknown

Contig1287 e-162 Citrus

63 Prunus dulcis unknown mRNA 3E-07 Prunus unknown

Contigl6 e-110 Citrus

>gi|17324931gb|U56902.1|CTU56902 Citrus
tristeza virus p346, 54-kDa RNA dependent
RNA polymerase, p33, p6, p65, p61, p27, 25-
kDa coat protein (CPG), p18, p I p2 1 and
p23 genes, complete cds, p20, and p23 genes,
64 complete cds e-162 CTV p27

>gi|3308979|dbj|ABOO8100.1| Citrus unshiu
mRNA for metallothionein-like protein,
65 complete cds e-138 Citrus metallothionein

Contig3121 e-142 Citrus

66 Poor matches unknown

>gi|806738|gb|U16304.1|CTU16304 Citrus
67 tristeza virus complete genome e-130 CTV p25/p27

>gi|806738|gb|U16304.1|CTU16304 Citrus
68 tristeza virus complete genome e-160 CTV hsp90 p61

>gi|4239714|emblY18420.1| CITV18420
Citrus tristeza virus complete genome, isolate
69 T385 0 CTV p65

>gi|806738|gb|U16304.1|CTU16304 Citrus
70 tristeza virus complete genome e-127 CTV p65


8e-90 Citrus

3e-96 Citrus

75 Poor matches

77 cxContig629

1 gb|BQ623985.1|BQ623985 USDA-
FP_01076 Ridge pineapple sweet orange

78 Poor matches

79 Poor matches

80 Poor matches

81 Poor matches

82 Poor matches

83 Poor matches

84 Poor matches

85 Poor matches

86 Poor matches

87 Poor matches

88 Poor matches

89 Contig2919

90 Poor matches

91 Poor matches

le-31 Citrus














Poor matches

Poor matches


1 gb|BQ623148.1|BQ623148 USDA-
FP_00239 Ridge pineapple sweet orange

Sequence of BAC T12C22 from Arabidopsis
thaliana chromosome 1, complete

Poor matches

Poor matches

Poor matches

>gi|9087297|dbj AP000397.1|AP000396S2
Beta vulgaris mitochondrial genomic DNA,
complete sequence, section 2/2

>gi|9087297|dbj AP000397.1|AP000396S2
Beta vulgaris mitochondrial genomic DNA,
complete sequence, section 2/2

Poor matches

Poor matches

Poor matches

Poor matches

Poor matches

Poor matches

Poor matches







1E-08 Arabidopsis





e-125 Beta unknown

e-114 Beta mitochondrial











8e-44 Citrus

108 Poor matches

>gil286192471gb|CB293790.1|C B "',,"
UCRCS01_06cg09_gl Washington Navel
orange cold acclimated flavedo & albedo
cDNA library Citrus sinensis cDNA
109 clone...8e-44

110 Poor matches

111 Poor matches

112 Poor matches

113 Poor matches

114 Poor matches

1 dbj|C95562.1|C95562 C95562 Citrus
unshiu Miyagawa-wase maturatio... 331 2e-
115 88

2e-88 Citrus

Poor matches

Poor matches

Poor matches

Poor matches

Poor matches

Poor matches

Poor matches

Poor matches















Poor matches

Poor matches

Poor matches

Poor matches





135 Poor matches unknown

136 FAAC01-035B05.g le-30 Citrus

>gil 12249|emb|X03775.1|CHSOATP1
Spinach plastid genes atpl-H-F for ATP
137 synthase CF(O) subunits IV, 6E-86 Spinach ATP synthase

138 Poor matches unknown

139 Poor matches unknown

1 gblBQ623784.1|BQ623784 USDA-
FP 00875 Ridge pineapple sweet orang...
140 220 6e-55 6e-55 Citrus

Daucus carota strain Imperator STS3A
141 mitochondrial DNA segment 3E-74 Daucus mitochondrial

1 gb|BE460852.1 BE460852 EST412271
tomato breaker fruit, TIGR Lyco... 5e-68 Tomato

EBma08_SQ002_L04_R maternal, 28 DPA,
142 no t... 9e-11 unknown

143 Poor matches unknown

144 Poor matches unknown

145 Poor matches unknown

>gi|18857892|dbj|AB061306.1| Citrus
jambhiri mitochondrial ACRS gene for ACR
146 toxin-sensitivity 4E-48 Citrus ACR toxin-sen.

Contig4126 3e-16 Citrus
1 gb|BM358396.1|BM358396
GA Ea0008M10r Gossypium arboreum 7-10
dp... 351 2e-94 2e-94 Gossypium

147 Poor matches unknown

>gi|5688942|dbj|ABO17426.11 Oryza sativa
(japonica cultivar-group) mitochondrial gene
148 for ribosomal protein L5, complete cds 2E-59 Oryza mitochondrial

1 dbj AV420567.1|AV420567 AV420567
Lotus japonicus young plants (t... 315 7e-84 7e-84 Lotus

149 CXJE02-097F04.g 2e-54 Citrus

150 CXJM02-089E08.g 2e-19 Citrus

1 gb|BM371381.21BM371381
EBma08_SQ002_I05 R maternal, 28 DPA, no
151 t... 86 le-14 le-14

152 CXContig831 3e-92 Citrus

153 Poor matches unknown

154 Poor matches unknown

1 gb|BI180911.1|BI180911 TY3H09
hepatocellular carcinoma expressio... 90 le-
155 15 le-15

156 Poor matches unknown

1 gb|BI180911.1|BI180911 TY3H09
157 hepatocellular carcinoma expressio... 3e-14

1 gb|BM376133.1|BM376133
EBma01_SQ002_H07_R maternal, 4 DPA, no
158 tr... 4e-12

1 gb|BM371429.21BM371429
EBma08_SQ002_L04_R maternal, 28 DPA,
159 no t... 7e-08

160 Poor matches unknown

1 gb|T44610.1|T44610 7873 Lambda-PRL2
161 Arabidopsis thaliana cDNA cl... 359 le-96 le-96 unknown

1 gb|BM371429.21BM371429
EBma08_SQ002_L04_R maternal, 28 DPA,
162 no t... 84 9e-14 9e-14

1 gb|BM371429.21BM371429
EBma08_SQ002_L04_R maternal, 28 DPA,
163 no t... 72 2e-10 2e-10

>gi112830831 gblAF320906.1|AF320906
Citrus unshiu metallothionein-like protein
164 (MT45) gene, complete cds 3E-90 Citrus metallothionein

Contig2243 2e-92 Citrus

1 gb|BQ624047.1|BQ624047 USDA-
FP_01138 Ridge pineapple sweet orang... le-86 Citrus

1 gblBQ623549.1|BQ623549 USDA-
FP_00640 Ridge pineapple sweet orang... 80
165 3e-13 3e-13 Citrus unknown

1 gb|BQ624621.1|BQ624621 USDA-
166 FP_01712 Ridge pineapple sweet orange le-96 Citrus

167 Poor matches unknown

1 emb|AL729032.1|AL729032 AL729032
168 Danio rerio embryonic inner ear... 58 3e-06 3e-06

1 gb|BQ414420.1|BQ414420
GA Ed0086EO5r Gossypium arboreum 7-10
169 dp... 60 2e-07

170 Poor matches unknown


Agrios GN (1997) Introduction to plant pathology. In GN Agrios, ed, Plant Pathology,
Ed 4. Academic Press Inc, pp 3-41

Albrigo LG, Syvertsen JP, Young RH (1986) Stress symptoms of citrus trees in
successive stages of decline due to blight. J. Am. Soc.Hort. Sci. 111: 465-470

Albrigo LG, Timmer LW, Derrick KS, Tucker DPH, Graham JH (1993) Failure to
transmit citrus blight by limb grafts. In International Organization of Citrus
Virologists, Vol 12. University of California, New Delhi, pp 127-130

Albrigo LG, Young RH (1980) Phloem zinc accumulation in citrus trees with blight.
Hortscience 15: 394-394

Albrigo LG, Young RH (1981) Phloem zinc accumulation in citrus trees affected with
blight. Hortscience 16: 158-160

Allen M (2000) A seed is planted. In: The history of Florida citrus. In Florida Grower,
Vol mid-August edition, pp 10-13

Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ
(1997) Gapped BLAST and PSI-BLAST: a new generation of protein database
search programs. Nucleic Acids Res 25: 3389-3402

Banzatto DA, Kronka SN (1992) Experimentagdo Agricola. FUNEP-UNESP,

Berger R (1998) A causa e o control do declinio dos Citros. Laranja 19: 91-105

Brazma A, Hingamp P, Quackenbush J, Sherlock G, Spellman P, Stoeckert C, Aach
J, Ansorge W, Ball CA, Causton HC, Gaasterland T, Glenisson P, Holstege
FC, Kim IF, Markowitz V, Matese JC, Parkinson H, Robinson A, Sarkans
U, Schulze-Kremer S, Stewart J, Taylor R, Vilo J, Vingron M (2001)
Minimum information about a microarray experiment (MIAME)-toward
standards for microarray data. Nat Genet 29: 365-371

Bausher MG (1990) Electrophoretic and immunological evidence of unique proteins in
leaves of citrus trees: application to citrus blight detection. Electrophoresis 11:

Callies T (2000) Reclaiming Florida's water. In Florida Grower, Vol September edition,
pp 8-12

Ceccardi TL, Barthe GA, Derrick KS (1998) A novel protein associated with citrus
blight has sequence similarities to expansion. Plant Mol Biol 38: 775-783

Chuaqui RF, Bonner RF, Best CJ, Gillespie JW, Flaig MJ, Hewitt SM, Phillips JL,
Krizman DB, Tangrea MA, Ahram M, Linehan WM, Knezevic V, Emmert-
Buck MR (2002) Post-analysis follow-up and validation of microarray
experiments. Nat Genet 32 Suppl: 509-514

Cohen M (1968) Citrus blight and "blight-like" diseases. Citrus Industry 47: 12-26

Cohen M (1974) Diagnosis of young tree decline, blight and sand hill decline of citrus by
measurement of water uptake using gravity injection. Plant Disease Reporter
58: 801-805

Cohen M, Pelosi RR, Brlansky RH (1983) Nature and location of xylem blockage
structures in trees with citrus blight. Phytopathology 73: 1125-1130

Colebatch G, Kloska S, Trevaskis B, Freund S, Altmann T, Udvardi MK (2002)
Novel aspects of symbiotic nitrogen fixation uncovered by transcript profiling
with cDNA arrays. Mol Plant Microbe Interact 15: 411-420

Costa AS, Grant TJ, Moreira S (1954) Behavior of various citrus rootstock-scion
combinations following inoculation with mild and severe strains of tristeza
virus. In Florida State Horticultural Society, Vol 67, Miami Beach, pp 26-30

Deng Z, Huang S, Ling P, Yu C, Tao Q, Chen C, Wendell MK, Zhang HB, Gmitter
FG, Jr. (2001) Fine genetic mapping and BAC contig development for the
citrus tristeza virus resistance gene locus in Poncirus trifoliata (Raf.). Mol Genet
Genomics 265: 739-747

Derrick KS, Beretta MJ, Barthe GA, Kayim M (2003) Strains of citrus tristeza virus
predominately found in roots with implications for citrus blight and citrus
sudden death. Phytopathology 93: S20

Derrick KS, Beretta MJ, Barthe GA, Kayim M, Harakava R (2003) Identification of
strains of Citrus tristeza virus by subtraction hybridization. Plant Disease 87:

Derrick KS, Lee RF, Brlansky RH, Timmer LW, Hewitt BG, Barthe GA (1990)
Proteins associated with citrus blight. Plant Disease 74: 168-170

Derrick KS, Timmer LW (2000) Citrus blight and other diseases of recalcitrant
etiology. Annu Rev Phytopathol 38: 181-205

Diatchenko L, Lau YF, Campbell AP, Chenchik A, Moqadam F, Huang B,
Lukyanov S, Lukyanov K, Gurskaya N, Sverdlov ED, Siebert PD (1996)
Suppression subtractive hybridization: a method for generating differentially
regulated or tissue-specific cDNA probes and libraries. Proc Natl Acad Sci U S
A 93: 6025-6030

Donson J, Fang Y, Espiritu-Santo G, Xing W, Salazar A, Miyamoto S, Armendarez
V, Volkmuth W (2002) Comprehensive gene expression analysis by transcript
profiling. Plant Mol Biol 48: 75-97

Eisen MB, Spellman PT, Brown PO, Botstein D (1998) Cluster analysis and display of
genome-wide expression patterns. Proc Natl Acad Sci U S A 95: 14863-14868

Fanta N, Ortega X, Perez LM (2003) The development ofAlternaria alternate is
prevented by chitinases and beta-1,3-glucanases from citrus limon seedlings.
Biol Res 36: 411-420

Fawcett HS, Lee HA (1926) Citrus Diseases and their Control, 1st. Ed. McGraw-Hill,
New York. [etc.]

Fegeros K, Zervas G, Stamouli S, Apostolaki E (1995) Nutritive value of dried citrus
pulp and its effect on milk yield and milk composition of lactating ewes. J Dairy
Sci 78: 1116-1121

Gaasterland T, Bekiranov S (2000) Making the most of microarray data. Nat Genet 24:

Hopkins DL (1987) Xylem-limited bacteria cause blight symptoms in citrus.
Phytopathology 77: 641-641

Hopkins DL (1988) Production of diagnostic symptoms of blight in citrus inoculated
with Xylellafastidiosa. Plant Disease 72: 432-435

Lee RF, Marais LJ, Timmer LW, Graham JH (1984) Syringe injection of water into
the trunk a rapid diagnostic-test for citrus blight. Plant Disease 68: 511-513

Lewandowski M (2000) Formulating frozen concentrate. In: The history of Florida
Citrus. In Florida Grower, Vol mid-august edition, pp 44-48

Lindbeck AGC, Brlansky RH (1998) Xylem plugging in feeder roots from blight-
affected citrus trees. Phytopathology 88: S54

Lindbeck AGC, Brlansky RH (2000) Cytology of fibrous roots from citrus blight-
affected trees. Plant Disease 84: 164-167

Mackay IM, Arden KE, Nitsche A (2002) Real-time PCR in virology. Nucleic Acids
Res 30: 1292-1305

Marais LJ, Lee RF (1990) Experimental transmission of citrus blight in South Africa. In
International organization of citrus virologists. University of California, pp 261-

Mawassi M, Gafny R, Bar-Joseph M (1993) Nucleotide sequence of the coat protein
gene of citrus tristeza virus: comparison of biologically diverse isolates
collected in Israel. Virus Genes 7: 265-275

Moreira S (1980) Hist6ria da citricultura no Brasil. In 0 Rodriguez, Viegas, F, ed,
Citricultura Brasileir. Fund. Cargill, Campinas, pp 1-28

Nemec S (1994) Stress-related compounds in blight-diseased citrus xylem fluid
associated with Fusarium solani naphthazarin toxins. Phytopathology 84: 870

Nemec S, Bustillo B, Obannon JH, Patterson M (1982) Effects of fungicides and
nematicides on citrus blight in Florida. Phytopathology 72: 360-360

Oliveira AC, Vallim MA, Semighini CP, Araujo WL, Goldman GH, Machado MA
(2002) Quantification of Xylellafastidiosa from citrus trees by real-time
polymerase chain reaction assay. Phytopathology 92: 1048-1054

Paiva LV, DeSouza M, Lopes MA, Paiva E (1997) Identification and isolation of
proteins found only in plants with citrus decline. Pesq. Agr. Bras. 32: 559-564

Pompeu JR. J (2001) Rootstocks and scions in the citriculture of the Sdo Paulo state. In
World Congress of the International Society of Citrus Nurseryman, 6th., pp 75-

Rafter JJ (2002) Scientific basis of biomarkers and benefits of functional foods for
reduction of disease risk: cancer. The British Journal of Nutrition 88: s219-s224

Rhoads AS (1936) Blight: a non-parasitic disease of citrus trees. University of Florida
Agricultural Experiment Station, Gainesville, Fla.

Rizhsky L, Liang H, Mittler R (2002) The combined effect of drought stress and heat
shock on gene expression in tobacco. Plant Physiol 130: 1143-1151

Rossetti VV, Beretta MJG, Teixeira ARR (1991) Experimental transmission of
declinio by approach-root-grafting in Sdo Paulo State, Brazil. In International
organization of citrus virologists, Vol 11. University of California, Orlando, pp

Scheideler M, Schlaich NL, Fellenberg K, Beissbarth T, Hauser NC, Vingron M,
Slusarenko AJ, Hoheisel JD (2002) Monitoring the switch from housekeeping
to pathogen defense metabolism in Arabidopsis thaliana using cDNA arrays. J
Biol Chem 277: 10555-10561

Seki M, Narusaka M, Abe H, Kasuga M, Yamaguchi-Shinozaki K, Carninci P,
Hayashizaki Y, Shinozaki K (2001) Monitoring the expression pattern of 1300
Arabidopsis genes under drought and cold stresses by using a full-length cDNA
microarray. Plant Cell 13: 61-72

Seki M, Shinozaki K, Ishida J, Nakajima M, Enju A, Sakurai T, Satou M, Akiyama
K, lida K, Oono Y (2003) [Arabidopsis functional genomics using full-length
cDNAs]. Tanpakushitsu Kakusan Koso 48: 1890-1898

Stoeckert CJ, Jr., Causton HC, Ball CA (2002) Microarray databases: standards and
ontologies. Nat Genet 32 Suppl: 469-473

Swingle WT, Webber HJ (1896) The principal diseases of citrus fruits in Florida. In GP
Office, ed. USDA, p 50

Taylor KC, Albrigo LG, Chase CD (1996) Purification of a Zn-binding phloem protein
with sequence identity to chitin-binding proteins. Plant Physiol 110: 657-664

Taylor KC, Ellis DR (1995) A zinc-binding protein in citrus with homology to plant
chitinases. Hortscience 30: 900

Taylor KC, Ellis DR, Paiva LV (2002) Purification of a zinc binding protein from
xylem of Citrus jambhiri. Journal of the Am. Soc. Hort. Sci. 127: 718-723

Timmer LW, Graham JH (1992) Nontransmission of citrus blight by soil. Plant Disease
76: 323-323

Timmer LW, Lee RF, Brlansky RH, Graham JH, L.G. A, Derrick KS, Tucker DPH
(1992) The infectious nature of citrus blight. In Florida State Horticultural
Society Annual Meeting, Vol 105, Orlando, pp 21-26

Tucker DPH, Lee RF, Timmer LW, Albrigo LG, Brlansky RH (1984) Experimental
Transmission of Citrus Blight. Plant Disease 68: 979-980

van den Boom J, Wolter M, Kuick R, Misek DE, Youkilis AS, Wechsler DS,
Sommer C, Reifenberger G, Hanash SM (2003) Characterization of gene