<%BANNER%>

Enhanced Trehalose Production Improves Growth of Escherichia coli under Osmotic Stress


PAGE 1

ENHANCED TREHALOSE PRODUCTION IMPROVES GROWTH OF Escherichia coli UNDER OSMOTIC STRESS By JEREMY E. PURVIS A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2004

PAGE 2

Copyright 2004 by Jeremy E. Purvis

PAGE 3

ACKNOWLEDGMENTS Long after the details of this work have faded from my memory, I will still be obliged to commend the few outstanding individuals who toiled alongside me during these past two years. I am particularly thankful to my advisor, Lonnie Ingram, for his instruction and encouragements, which have extended well beyond the boundaries of our laboratory; to my committee members, James Preston and Keelnatham Shanmugam, for their open resource and discussion; to my parents, for rejoicing in my successes as avidly as during my childhood; and to Joy, my future wife, for giving me something far better than a masters degree to look forward to. iii

PAGE 4

TABLE OF CONTENTS page ACKNOWLEDGMENTS.................................................................................................iii LIST OF TABLES...............................................................................................................v LIST OF FIGURES...........................................................................................................vi ABSTRACT......................................................................................................................vii CHAPTER 1 INTRODUCTION........................................................................................................1 Osmoregulation in Escherichia coli.............................................................................1 Role of Trehalose in Stress Tolerance..........................................................................1 2 MATERIALS AND METHODS.................................................................................5 Bacteria, Plasmids, and Culture Conditions.................................................................5 Genetic Methods...........................................................................................................5 Measurement of Intracellular Trehalose.......................................................................8 Tolerance Assays..........................................................................................................8 3 RESULTS.....................................................................................................................9 Native Trehalose Production Provided a Small Benefit for Growth............................9 Construction of Strains for Increased Production of Trehalose..................................11 Comparison of Integrants...........................................................................................12 Optimization of Trehalose Expression for Salt and Sugar Stress...............................13 Elevated Trehalose Production Increased Cell Growth after 24 h in the Presence or Absence of Osmotic Stress Agent..........................................................................14 4 DISCUSSION.............................................................................................................18 LIST OF REFERENCES...................................................................................................22 BIOGRAPHICAL SKETCH.............................................................................................29 iv

PAGE 5

LIST OF TABLES Table page 2-1 Strain sources and characteristics...............................................................................6 2-2 Plasmid sources and characteristics...........................................................................7 3-1 Stress tolerance of W3110 strains............................................................................15 v

PAGE 6

LIST OF FIGURES Figure page 1-1 Trehalose metabolism in E. coli.................................................................................2 3-1 Growth of E. coli strains under stress......................................................................10 3-2 Plasmid constructions...............................................................................................11 3-3 Intracellular trehalose accumulated by JP10 harboring pLOI3607 and derivatives................................................................................................................12 3-4 Incremental growth of wild type and otsA + otsB + integrants under salt stress.........13 3-5 Optimization of otsBA expression during salt and sugar stresses............................14 3-6 Intracellular trehalose accumulated by unstressed W3110 strains...........................16 3-7 Growth of E. coli strains in the absence or presence of osmotic stress....................17 vi

PAGE 7

Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science ENHANCED TREHALOSE PRODUCTION IMPROVES GROWTH OF Escherichia coli UNDER OSMOTIC STRESS By Jeremy E. Purvis May 2004 Chair: Lonnie O. Ingram Major Department: Microbiology and Cell Science The disaccharide trehalose protects bacterial cells against multiple environmental stresses. Escherichia coli synthesizes trehalose in response to osmotic stress, heat shock, extreme cold, desiccation, and entry of cells into stationary phase. Previous studies have shown that mutants that cannot produce trehalose are sensitive to elevated osmolarity, oxidation, and heat. Here we examined the potential benefit of trehalose for growth in glucose-mineral salts medium containing a series of concentrations of salts and sugars. Strain W3110 (wild type) was compared to an isogenic strain in which all genes for trehalose synthesis and degradation were deleted, and to a derivative in which a single chromosomal copy of the otsA otsB operon was provided under LacI regulation. Modest differences in growth between wild type and mutant strains suggested a direct protective role for trehalose. These differences in growth were increased when trehalose production was elevated above that of wild-type cells. Our results demonstrate that production of high intracellular vii

PAGE 8

trehalose levels can be used to increase cell growth under salt and sugar stress. This finding should aid the development of efficient microbial bioconversion processes that demand high substrate concentrations and greater tolerance to products. viii

PAGE 9

CHAPTER 1 INTRODUCTION Osmoregulation in Escherichia coli Bacteria have a remarkable ability to sense and respond to environmental stress (Storz and Hengge-Aronis 2000). A part of this natural defense system involves the intracellular accumulation of protective compounds that shield macromolecules and membranes from damage (Csonka 1989; Kempf and Bremer 1998). For this purpose, Escherichia coli can use a variety of compounds including glutamate, proline, trehalose, betaine, and dimethylsulfoniopropionate (Gouesbet et al. 1994; Landfald and Strm 1986; Measures 1975; Perroud and Le Rudulier 1985; Underwood et al. 2004). Although glutamate and proline provide transient relief from osmotic stress (Dinnbier et al. 1988), allosteric control of proline synthesis and the negative charge of glutamate limit their effectiveness at high concentrations (Richey et al. 1987). In recent studies, adding betaine was shown to stimulate growth and ethanol production in recombinant E. coli (Underwood et al. 2004) and to increase thermal tolerance in Bacillus subtilis (Holtmann and Bremer 2004 ). However, neither betaine nor dimethylsulfoniopropionate can be synthesized de novo by E. coli. In the absence of these supplements, trehalose is produced as the primary protective osmolyte (Ishida et al. 1996). Role of Trehalose in Stress Tolerance Trehalose is a nonreducing disaccharide that has proven very useful for stabilizing proteins and enhancing cell survival during dessication (Sola-Penna et al. 1998). Genes encoding trehalose biosynthesis are widely distributed in nature (Elbein 1974; Elbein et 1

PAGE 10

2 al. 2003; Richards et al. 2002) and have been extensively studied in E. coli and Saccharomyces. Escherichia coli regulates trehalose production at the transcriptional level (otsAB operon) with induction in response to osmotic shock (Giver et al. 1988), extreme heat (de Virgilio et al. 1994), extreme cold (Kandror et al. 2002), dessication (Van Laere 1989), and entry into stationary phase (Hengge-Aronis et al. 1991). Two enzymes are unique to trehalose biosynthesis: trehalose-6-phosphate synthase (otsA) and trehalose-6-phosphate phosphatase (otsB) (Figure 1) (Kaasen et al. 1992). Previous studies showed that mutations in either otsA, otsB, galU (glucose-6-phosphate uridylyl transferase), or rpoS (Hengge-Aronis et al. 1991) ( 38 required for stationary phase induction) are sufficient to prevent trehalose synthesis (Elbein et al. 2003). PPi Glucose-6-PUDP-GlucoseTrehalose-6-PUDP otsAPTSGlucosePEPpyruvateGlucose-1-PpgmUTPPPioutinTrehalose MSC galUTrehalose2 Glucose 2 GlucoseH2OGlucose +Glucose-6-P otsB treC treF treA H2O PPi Glucose-6-PUDP-GlucoseTrehalose-6-PUDP otsAPTSGlucosePEPpyruvateGlucose-1-PpgmUTPPPioutinTrehalose MSC galUTrehalose2 Glucose 2 GlucoseH2OGlucose +Glucose-6-P otsB treC treF treA H2O A B C Figure 1-1. Trehalose metabolism in E. coli. Bold arrows denote synthetic route by trehalose-overproducing strain, JP20. Reactions that have been blocked by gene deletions are marked with filled triangles. A) Glucose enters the cell as glucose-6-phosphate via a PEP-dependent phosphotransferase enzyme complex. B) The OtsA synthase condenses trehalose-6-phosphate with UDP-glucose to form the precursor trehalose-6-phosphate, which is dephosphorylated by a specific OtsB phosphatase. C) Intracellular trehalose can be degraded by the cytosolic trehalase TreF or by hydrolysis of trehalose-6-phosphate by a specific hydrolase TreC.

PAGE 11

3 Inability to synthesize trehalose results in poor growth under salt stress (Giver et al. 1988) and decreased survival during storage at high or low temperatures (Kandror et al. 2002; Hengge-Aronis et al. 1993), at low pH (Hengge-Aronis et al. 1991), during desiccation (Welsh and Herbert 1999), and under oxidative stress (Banaroudj et al. 2001). Although these effects are not reversed by the external addition of trehalose because of periplasmic catabolic enzymes in E. coli (Boos et al. 1990), the addition of trehalose has been shown to restore salt growth in an otsA mutant of Thermus themophilus (Silva et al. 2003). A combination of otsA and otsB genes from E. coli has been used to genetically engineer increased stress tolerance in plants (Garg et al. 2002) and in mammalian cells (Guo et al. 2000; Tunnacliffe et al. 2001). Prior studies with trehalose have focused primarily on cell survival under stress conditions. Recent interest in the development of microbial biocatalysts for the production of high concentrations of commodity chemicals (Causey et al. 2003; Zhou et al. 2003) implies a potential need for increased tolerance to high concentrations of sugar feedstocks and mineral nutrients during growth; and a need to minimize the effect of high product concentration. Previous studies by Billi et al. (2000) used the Synechocystis sp. spsA gene to show that the intracellular production of sucrose, a nonreducing sugar dimer with some of the properties of trehalose (Crowe 2002), dramatically increased the desiccation resistance of E. coli. Their results indicate that suboptimal levels of trehalose are produced by native control systems. Our study examined the importance of trehalose for growth in glucose-mineral salts containing a series of concentrations of salts and sugars. Tolerance was evaluated by measuring final cell density after 24 h in the presence of osmotic stress. Strain W3110

PAGE 12

4 (wild type) was compared to an isogenic strain in which all genes for trehalose synthesis and degradation were deleted, and to a derivative in which a single chromosomal copy of the otsA otsB operon was provided under LacI regulation. These studies demonstrate that native levels of trehalose synthesized in the parent strain are of limited benefit for growth under osmotic stress, at high temperature, or at pH extremes. However, increasing trehalose production above that produced by the native regulatory system improved growth substantially under both salt and sugar stress.

PAGE 13

CHAPTER 2 MATERIALS AND METHODS Bacteria, Plasmids, and Culture Conditions Strains and plasmids used in our study are listed in Table 2-1. Strains DH5 and TOPO10F' were used as hosts for plasmid constructions. For constructions, cultures were grown at 37C in Luria-Burtani medium (LB) (Ausubel et al. 1987) or on LB solidified with 1.5% agar. Ampicillin (50 g/mL), kanamycin (50 g/mL), and tetracycline (12.5 g/mL) were added as appropriate for selection. For stress studies, cultures were maintained on M9 plates (Miller 1992) containing 2% glucose. Isopropyl--D-thiogalactopyranoside (IPTG) was used to induce expression of otsBA in JP20. Inducer was added at time of inoculation. Growth was monitored spectrophotometrically at 550 nm with a Spectronic 70 spectrophotometer (Bausch & Lomb, Inc., Rochester, NY). Genetic Methods Standard methods were used for plasmid construction and analyses (Ausubel, et al. 1987). Coding regions for treA, treC and treF were amplified using ORFmer primers (Sigma-Genosys, The Woodlands, TX) and cloned initially into pCR2.1-TOPO (Invitrogen). Chromosomal integration of mutated genes was facilitated by pKD46 containing an arabinose-inducible Red Recombinase (Datsenko and Wanner 2000). Mutants were screened for appropriate antibiotic resistance and verified by analysis of PCR products. Coding regions for otsBA genes were amplified by PCR using W3110 geneomic DNA as the template for the primer pair: N terminus 5

PAGE 14

6 Table 2-1. Strain sources and characteristics Strains Relevant Characteristics Reference DH5 lacZM15 recA Bethesda Research Laboratory W3110 wild type ATCC 27325 TOP10F' lacI q (episome) Invitrogen S17-1pir thi pro hsdR hsdM + recA RP4-2-Tc::Mu-Km::Tn7 pir Simon 1983 JP10 W3110, otsBA::FRT treA treC treF This study JP15 W3110, otsBA::FRT treA::FRT-tet-FRT treC::FRT treF::FRT This study JP20 W3110, otsBA::FRT treA::FRT treC::FRT treF::FRT ampH::lacI q -P tac -otsBA-FRT This study JP21 W3110, otsBA::FRT treA::FRT treC::FRT treF::FRT alsA::lacI q -P tac -otsBA-FRT This study JP22 W3110, otsBA::FRT treA::FRT treC::FRT treF::FRT lacI q -P tac -otsBA-FRT This study JP23 W3110, otsBA::FRT treA::FRT treC::FRT treF::FRT lacI q -P tac -otsBA-FRT This study JP24 W3110, otsBA::FRT treA::FRT treC::FRT treF::FRT lacI q -P tac -otsBA-FRT This study 5'AAGGAGGAGAACCGGGTGACA3' and C terminus 5'ACGCAGCGTGATGCATGAAG3'. A 6.1 kb fragment containing the inducible ots operon (P tac -otsBA-FRT-kan-FRT) was integrated into JP15 by conjugation with donor strain S17-1 containing the -dependent transposase vector, pLOI3650. Kanomycin-resistant exconjugates (sensitive to ampicillin) were selected. Integration was confirmed by PCR. The FRT (FLP recognition target)-flanked antibiotic resistance genes were deleted by FLP recombinase (Posfai et al. 1997; Martinez-Morales et al. 1999). Chromosomal DNA adjacent to the P tac -otsBA-FRT insertion was amplified using arbitrarily primed PCR (Gibson and Silhavy 1999; Caetano-Annoles 1993; Wang et al. 2004). Sequences of primers used in the first (ARB1 and OUT-OTS) and second rounds

PAGE 15

7 Table 2-2. Plasmid sources and characteristics Plasmid Relevant Characteristics Reference pCR2.1-TOPO bla kan, TOPO TM TA cloning vector Invitrogen pFT-A bla flp low-copy vector containing recombinase and temperature-conditional pSC101 replicon 28 pKD46 bla exo low-copy vector containing red recombinase and temperature-conditional pSC101 replicon 26 pFLAG-CTC bla P tac controlled expression vector Sigma pLOI2065 bla, SmaI fragment with FRT-flanked tet gene Underwood 2002 pLOI2511 bla, SmaI fragment with FRT-flanked kan gene Underwood 2002 pLOI3469 bla tnp pir-dependent Tn5 transposase vector This study pLOI3601 bla kan otsBA This study pLOI3604 bla otsBA This study pLOI3605 bla otsBA-FRT-kan-FRT This study pLOI3607 bla P tac otsBA-FRT-kan-FRT This study pLOI3617 pLOI3607, otsA (MluI, Klenow) This study pLOI3618 pLOI3607, otsB (BglII, Klenow) This study pLOI3619 pLOI3617, otsB (BglII, Klenow) This study pLOI3621 bla kan treA This study pLOI3625 bla kan treA::FRT-tet-FRT This study pLOI3631 bla kan treF This study pLOI3635 bla kan treF::FRT-tet-FRT This study pLOI3641 bla kan treC This study pLOI3645 bla kan treC::FRT-tet-FRT This study pLOI3650 bla tnp pir-dependent vector containing transposable Tn5 element [ P tac otsBA-FRT-kan-FRT ] This study (ARB2 and IN-OTS) of amplification are listed below. Resulting products were gel-purified and used as a template for DNA sequencing. ARB1 5'GGCCACGCGTCGACTAGTACNNNNNNNNNNGATAT3' OUT-OTS 5'TGGCAGATGCACGGTTACGA3' ARB2 5'GGCCACGCGTCGACTAGTAC3' IN-OTS 5'CTATGCGGCATCAGAGCAG3'

PAGE 16

8 Measurement of Intracellular Trehalose Sufficient culture volume was harvested (10000 g, 25C) to provide 2.0 mg dry cell weight (1 OD 550nm = 0.33 g liter -1 dry cell weight). Cells were permeabilized with 50% methanol and extracted for 30 min on ice. The mixture was vortexed briefly and centrifuged at 10,000 g for 1 min. The supernatant was assayed for trehalose by thin-layer chromatography as described previously (Zhou and Ingram 2001). After visualizing with N-(1-naphthyl)ethylenediamine reagent (Bounias 1980), relative amounts of trehalose were determined by densitometry using Quantity One Software (BioRad). For estimates of intracellular trehalose concentrations, an aqueous volume of 1 mL was assumed per gram of dry cells. Tolerance Assays Tolerance was evaluated by measuring growth (defined as final cell mass after 24 h of incubation) in M9 minimal medium containing 2% glucose (without antibiotics). Ignoring dissociation effects, basal medium contained 93 mM mineral salts and 111 mM glucose. For each stress condition, a range of concentrations (or temperatures, or initial pH) was selected that caused a gradual, near complete inhibition of growth (defined as less than 2 doublings). Cells from a fresh plate were resuspended in M9 medium containing 2% glucose and used as inocula (initial level of 0.030 OD 550nm ). Cultures were incubated in 13 100 mm capped tubes (37C water bath, 50 rpm reciprocating shaker, 24 h) and tested in triplicate. Results are presented as average values with standard errors (bars) from three or more separate experiments, or as an average of replicates from one or two experiments (without error bars). All compounds tested were purchased from either the Sigma Chemical Company (St. Louis, MO) or from Fisher Scientific.

PAGE 17

CHAPTER 3 RESULTS Native Trehalose Production Provided a Small Benefit for Growth A mutant of W3110 was constructed (strain JP10) in which both biosynthetic genes for trehalose were deleted (otsA, otsB) as well as genes encoding cytoplasmic (treC, treF) and periplasmic (treA) trehalase (Figure 1-1). Although native trehalose production has been shown to be highly beneficial for survival under many conditions (Kandror et al. 2002; Hengge-Aronis et al. 1993), loss of trehalose synthesis in JP10 resulted in only modest decreases in final cell density during osmotic stress from salts and sugars (glucose, mannose, xylose, and arabinose) (Figure 3-1). Differences were most evident at the higher levels in which growth was reduced by more than half, decreasing the minimum inhibitory level for (NaCl, KCl, and KH 2 PO 4 ) and increasing the concentrations of salts and hexose sugars (glucose and mannose) that permitted growth equivalent to half that of the unstressed parent (IL 50 ). Inactivation of trehalose biosynthesis had no effect on tolerance to osmotic stress from pentose sugars (arabinose and xylose) or on tolerance to pH and elevated temperature. For glucose, mannose, arabinose, and the salts (assuming 2 particles per KH 2 PO 4 at pH 7), growth inhibition was roughly the same at equivalent osmolalities. Xylose was two-fold more toxic than other osmolytes and caused an abrupt inhibition of growth at concentrations above 120 mM (Figure 3-1). Most added osmolytes caused a progressive, dose-dependent reduction in growth, which began even with small additions (Figure 3-1). Both pentose sugars and KH 2 PO 4 9

PAGE 18

10 0 100 200 300 400 500 0.0 0.5 1.0 1.5 [Xylose] (mM)A550 0 200 400 600 800 1000 0.0 0.5 1.0 1.5 [KCl] (mM)A550 37 38 39 40 41 42 43 44 45 46 0.0 0.5 1.0 1.5 Temperature (C)A550 5 6 7 8 9 0.0 0.5 1.0 1.5 pHA550 0 200 400 600 800 1000 0.0 0.5 1.0 1.5 [Mannose] (mM)A550 0 200 400 600 800 1000 0.0 0.5 1.0 1.5 [Glucose] (mM)A550 0 100 200 300 400 500 600 0.0 0.5 1.0 1.5 [Arabinose] (mM)A550 0 200 400 600 800 1000 0.0 0.5 1.0 1.5 [NaCl] (mM)A550 0 200 400 600 800 1000 0.0 0.5 1.0 1.5 2.0 [KH2PO4] (mM)A550CABDEFGH I Figure 3-1. Growth of E. coli strains under stress. Plotted concentrations represent the osmolar contribution of each compound in addition to basal medium osmolarity of 204 mM. The wild type strain W3110 (F) and trehalose-deficient mutant JP10 () were grown in a defined medium containing increasing concentrations of osmolytes. A) KCl. B) KH 2 PO 4 C) NaCl. D) Arabinose. E) Glucose. F) Mannose. G) Xylose. JP20 (described below) was grown under the same conditions with (O) and without (G) 0.1 mM IPTG. The same strains were compared for tolerance to physical stress. H) Heat. I) pH. Results are presented as average values with standard deviations (bars) from three or more separate experiments. were exceptions in which 100 mM additions resulted in an increase in final cell density. In contrast to glucose and mannose, small additions of xylose and arabinose increased the final cell density. The largest increase was caused by KH 2 PO 4 and appears to result from pH buffering. All cultures that reached final densities of over 1.0 A 550nm were approximately pH 4.6, below that permitting growth. The addition of MOPS buffer

PAGE 19

11 (100 mM) to M9-glucose medium resulted in a similar increase in growth (data not shown). Construction of Strains for Increased Production of Trehalose A medium-copy number expression vector containing an inducible otsBA operon (pLOI3607) was originally used to investigate trehalose overproduction (Figure 3-2). Derivatives of this plasmid were constructed in which frameshift mutations were inserted at unique sites in the coding regions of otsA, otsB, or both genes (Table 2-1). Trehalose production in JP10 cells was compared for strains harboring each plasmid. Although a small increase was observed for plasmids containing a defect in either gene (1 to 6%), expression of both genes increased intracellular trehalose levels by more than 100-fold based on densitometry (Figure 3-3). Using trehalose standards, the intracellular concentrations in JP10 harboring pLOI3607 (both genes functional) and pLOI3619 (both genes deleted) were estimated to be 180 mM and <1 mM, respectively. Plasmid pLOI3607 and derivatives were quite unstable in W3110 and JP10 during growth in M9-glucose medium. To eliminate this problem, a single copy of the EcoRIEcoRISmaIPsiIPacI (T4) EcoRI EcoRI pUC ori kan otsA otsB f1 ori blapLOI3605FRTFRT7020 bps EcoRI tac amp pBR322 ori f1 or1 lacIpFLAG-CTC5348 bps SmaI PsiI tac otsB otsA kan bla pBR322 ori f1 ori lacIpLOI3607FRTFRT8868 bps PacI oriR6K oriT bla Tn5 tnp IE OEpLOI34695291 bps otsB otsA kan OE oriR6K oriT bla Tn5 tnp IE lacI tacpLOI365011366 bpsFRTFRT Figure 3-2. Plasmid constructions.

PAGE 20

12 pLOI3607pLOI3617pLOI3618pLOI3619 0 20 40 60 80Trehalose (g / mg dry cell weight)pLOI3607pLOI3617pLOI3618pLOI3619 7413 A B <1 Figure 3-3. Intracellular trehalose accumulated by JP10 harboring pLOI3607 and derivatives. Cultures were grown to mid-log phase and induced with 0.1 mM IPTG for 2 h. A) Section from thin-layer plate used for densitometry calculation. B) Intracellular trehalose levels. LacI-regulated ots operon was transposed into the chromosome of JP10. Five resulting integrants were chosen at random for deletion of the kan gene used for selection of the transposition. Chromosomal insertion of the modified ots casette was determined using arbitrarily-primed PCR to map the site of integration in two strains: JP20 (ampH::lacI q -P tac -otsBA-FRT), JP21 (alsA::lacI q -P tac -otsBA-FRT). Comparison of Integrants All integrants were similar and exhibited 6-fold to 10-fold increase in cell growth after 24 h in M9-glucose containing NaCl (300, 400, and 500 mM) in comparison to the parent containing otsAB deletions (JP10) and the wild type, W3110 (Figure 3-4). Addition of inducer (0.1 mM IPTG) to the medium of these integrants resulted in further doubling of cell growth. One integrant, strain JP20, was selected for further study.

PAGE 21

13 JP20 JP21 JP22 JP23 JP24 wt-+-+-+-+-+ 0.0 0.5 1.0 1.5 A550 Figure 3-4. Incremental growth of wild type and otsA + otsB + integrants under salt stress. Tops of bars mark final cell density after 24 h of incubation with 300 (black bars), 400 (hatched bars), and 500 (open bars) mM NaCl. Basal medium osmolarity equaled 204 mM. Integrants were treated with (+) or without () 0.1 mM IPTG. Results are presented as average values with standard deviations (bars) from three or more separate experiments. Intracellular trehalose levels in JP20 with 0.1 mM IPTG (952 mM) and without IPTG (74 mM) were much higher than in W3110 (<1 mM) and JP10 (<1 mM). These results are consistent with incomplete repression of the ots casette in JP20 by the adjacent lacI. In this JP10 background devoid of periplasmic and cytoplasmic trehalase activity, even low levels of otsAB expression could lead to substantial intracellular accumulation of trehalose. Optimization of Trehalose Expression for Salt and Sugar Stress Concentrations of individual salts and sugars were selected near the minimal inhibitory level (IL min ) for the parental strain, JP10. With each stress agent, JP20 growth was evaluated with a series of IPTG concentrations to determine the optimal level for induction (Figure 3-5). Results for all sugars and salts tested were essentially the same with an optimum at 0.1 mM IPTG. At this concentration, cell growth after 24 h was

PAGE 22

14 2-fold to 4-fold that of the uninduced culture. With the exception of glucose, further increases in IPTG were detrimental for cell growth in the presence of other osmotic stress agents. Elevated Trehalose Production Increased Cell Growth After 24 h in the Presence or Absence of Osmotic Stress Agent The growth of JP20 was compared after 24 h to that of the trehalose-deficient strain (JP10) and wild type (W3110) under all stress conditions. Results are summarized in Table 3-1. Induced expression of otsBA was marked by both increased accumulation of trehalose (Figure 3-6) and improved stress tolerance (Table 3-2). Comparison of growth patterns for JP20 during exposure to KCl and NaCl stress revealed a 5-fold improvement in growth for trehalose-overproducing cells at salt concentrations near IL 50 (Figure 3-1). During KH 2 PO 4 stress, induced JP20 grew 6-fold better than the trehalose-free strain, reaching a maximum OD 550nm of 2.0 at 200 mM KH 2 PO 4 IL min increased similarly for all u ninduce d -3.0-2.5-2.0-1.5-1.0-0.50.0 0.4 0.6 0.8 1.0log [IPTG] (mM)A550 u ninduce d -3.0-2.5-2.0-1.5-1.0-0.50.0 0.6 0.8 1.0 1.2log [IPTG] (mM)A550 u ninduce d -3.0-2.5-2.0-1.5-1.0-0.50.0 0.4 0.6 0.8 1.0 1.2 log [IPTG] (mM)A550 u ninduce d -3.0-2.5-2.0-1.5-1.0-0.50.0 0.2 0.4 0.6 0.8 1.0 log [IPTG] (mM)A550 u ninduce d -3.0-2.5-2.0-1.5-1.0-0.50 0.4 0.6 0.8 1.0 1.2 log [IPTG] (mM)A550ABCDF u ninduce d -3.0-2.5-2.0-1.5-1.0-0.50.0 0.8 1.0 1.2 1.4log [IPTG] (mM)A550E Figure 3-5. Optimization of otsBA expression during salt and sugar stresses. JP20 was treated with varying doses of IPTG during growth in the presence of each osmolyte. A) KCl (400 mM). B) KH 2 PO 4 (400 mM). C) NaCl (400 mM). D) Glucose (600 mM). E) Mannose (400 mM). F) Xylose (140 mM). Basal medium osmolarity equaled 204 mM. Results are presented as average values with standard deviations (bars) from three or more separate experiments.

PAGE 23

Table 3-1. Stress tolerance of W3110 strains 15 Minimum Inhibitory Level (IL min ) 2 Salts (mM) Sugars (mM) Physical Stress Strain 1 KCl KH 2 PO 4 NaCl Arabinose Glucose Mannose Xylose T (C) pH JP10 399 376 388 386 452 427 157 44.8 5 W3110 469 496 463 386 488 469 164 44.8 5 JP20 () 572 483 519 391 650 590 159 44.8 5 JP20(+) 602 608 552 392 729 667 171 44.7 5 Median Inhibitory Level (IL 50 ) 3 Salts (mM) Sugars (mM) Physical Stress KCl KH 2 PO 4 NaCl Arabinose Glucose Mannose Xylose T (C) pH JP10 166 242 164 333 260 247 134 44.0 6.26 W3110 205 291 182 325 314 324 141 44.0 6.26 JP20 () 368 347 385 321 510 508 142 43.9 6.21 JP20(+) 496 456 458 354 632 573 153 43.6 6.11 Density Equivalentto Unstressed Control (IL wt ) 4 Salts (mM) Sugars (mM) Physical Stress KCl KH 2 PO 4 NaCl Arabinose Glucose Mannose Xylose T (C) pH JP10 0 155 0 154 0 0 120 37.0 7.02 W3110 0 162 0 168 0 0 123 37.0 7.01 JP20 () 227 271 268 221 203 156 123 39.2 6.98 JP20(+) 399 377 387 306 522 511 136 39.3 6.90 1 Strains were grown at 37C for 24 h in M9 media containing 2% glucose and indicated additives. Millimolar values represent the osmolar contribution of each compound to total media osmolarity. Ignoring dissociation effects, basal medium contained 93 mM mineral salts and 111 mM glucose. 2 ILmin equals the lowest osmolyte concentration, growth temperature, or initial pH necessary to restrict growth to less than two doublings (OD550nm < 0.012). 3 IL50 equals the lowest osmolyte concentration, growth temperature, or initial pH necessary to restrict growth to half the OD550nm of the wild type culture grown without additives. 4 ILwt equals the concentration at which growth is reduced to a density equivalent to the maximal growth of the wild type in medium containing no additives.

PAGE 24

16 salts (40 to 60%). JP20 also exhibited higher tolerance than either parent strain under sugar stress (Figure 3-1). With 600 mM glucose present in the media, induced JP20 achieved a 24-fold higher cell mass than JP10. Trehalose overproduction improved absolute glucose tolerance by 35% (IL min = 800 mM). Growth of JP20 in 500 mM mannose was improved 20-fold compared to JP10. Growth improved less dramatically for arabinose and xylose, with the largest increases in final density (2-fold) occurring near the IL 50 values for each pentose. Overproduction of trehalose was not beneficial to heator pH-stressed cell. Time-course growth of wild type and JP20 was measured in aerobic shake flasks in the absence and presence of osmotic stress (Figure 3-7). Although growth in basal media was similar for all strains, final cell densities for wild type and uninduced JP20 were 15% higher than for induced JP20. Growth rate was 2-fold higher for JP20 when grown in either 400 mM NaCl or 600 mM glucose. JP10W3110JP20(-)JP20(+) 0 100 200 300 400Trehalose (g / mg dry cell weight)JP10W3110JP20 (-)JP20 (+) <1<12836 A 1 B Figure 3-6. Intracellular trehalose accumulated by unstressed W3110 strains. Cells were grown for 24 h in M9 medium containing 2% glucose. JP20 was treated with (+) or without () 0.1 mM IPTG. A) Section from thin-layer plate used for densitometry calculation. B) Intracellular trehalose levels.

PAGE 25

17 0 4 8 12 16 20 24 0.03125 0.0625 0.125 0.25 0.5 1 2Time (H)A550 0 4 8 12 16 20 24 0.03125 0.0625 0.125 0.25 0.5 1 2Time (H)A550 0 4 8 12 16 20 24 0.03125 0.0625 0.125 0.25 0.5 1 2Time (h)A550ABC Figure 3-7. Growth of E. coli strains in the absence or presence of osmotic stress. A) W3110 and JP20 were grown for 24 h in basal media containing no additives. B) Growth in 400 mM NaCl. C) Growth in 600 mM glucose. Basal media (M9, 2% glucose) osmolarity equaled 204 mM. Symbols: F, W3110; G, JP20; O, JP20 + 100M IPTG.

PAGE 26

CHAPTER 4 DISCUSSION Czonka (1989) has estimated that E. coli maintains an intracellular trehalose level equivalent to 20% of the osmolar concentration of solutes in the growth medium. The results presented in this paper show that this native regulation of trehalose synthesis is not optimal at high osmotic strength. The consequence of high external osmolarity is the collapse of turgor pressure, which is generally thought to be necessary for growth by stretching the cell envelope during division (Koch 1991; Norris and Manners 1993). In minimal media, cells counteract this loss of turgor by adjusting the intracellular solute pool, increasing glutamate levels first followed by sustained synthesis of trehalose (Dinnbier et al. 1988). Weak turgor resulting from high external osmolarity may have contributed to the lower growth rates observed for wild type cells during salt or sugar challenge (Figure 3-7). This interpretation is consistent with the observation that cells that rapidly produced trehalose under osmotic stress exhibited higher growth rates and shorter fermentation times than the wild type, implying a more favorable balance of osmotic pressure. Conversely, excessive trehalose production was also detrimental to the growth of trehalose-overproducing cells, which actually benefited from mild salt concentrations (Figure 3-1). Over the range of concentrations tested for each condition, the largest growth advantage for JP20 always occurred near the concentration at which expression was optimized, suggesting that a single level of intracellular trehalose provides the optimal osmotic balance at a given medium osmolarity. 18

PAGE 27

19 These results demonstrate that unnaturally high trehalose production can substantially improve growth of E. coli under osmotic stress. Preliminary experiments revealed small differences in growth between wild type and mutant strains during osmotic stress, which suggested a direct protective role for trehalose; these differences in growth were increased when trehalose production was elevated to levels beyond the capability of wild type cells (Figure 3-1). Under elevated osmolarity, synthesis of trehalose benefited cells in a dose-dependent fashion (Figure 3-5), and analysis of cell extracts revealed that intracellular trehalose levels (Figure 3-6) corresponded well with osmotic tolerance. Even in the absence of inducer, JP20 was more tolerant to osmotic stress than the wild type. This result was corroborated by analysis of cell extracts from JP20, which were found to contain significant amounts of trehalose after 24 h growth. Accumulation by uninduced cells probably reflects a low level of unregulated gene expression, which has an amplified effect in JP20 since this strain lacks the ability to degrade trehalose once it has been synthesized. Hence, even low rates of production by these cells are likely to boost tolerance significantly. In contrast, wild type E. coli moderates intracellular trehalose levels with a cytoplasmic trehalase (Horlacher et al. 1996) and a trehalose-6-phosphate hydrolase (Rimmele and Boos 1994). Externally, a periplasmic trehalase (TreA) functions under high osmolarity to break down extracellular trehalose for subsequent transport and resynthesis (Boos et al. 1987). Under hypoosmotic conditions, E. coli can excrete trehalose via a family of stretch-activated channels that allow rapid efflux of osmoprotectants (Sleator and Hill 2001; Schleyer et al. 1993; Sukharev et al. 1997). Trehalose released through these channels is retained in treA strains (Styrvold and Strm 1991).

PAGE 28

20 All salts used in this study produced similar effects on growth, suggesting a common mechanism of toxicity and relief by trehalose. Differences in final cell mass were greatest for growth experiments involving moderately high salinity (approximately half of IL min ). Cultures exposed to mild KH 2 PO 4 concentrations (100-300 mM) reached higher cell masses than those observed for NaCl and KCl (and higher than unstressed cultures), presumably due to the buffering capacity of the phosphate anion. Cells responded similarly to sugars with the same molecular weight and showed greater tolerance to hexoses than pentoses. When compared on the basis of total media osmolarity, inhibitory levels for glucose and mannose were nearly identical (2% glucose provides an additional 111 mM to total osmolarity). Comparatively slow growth on xylose is characteristic of the wild type strain (results not shown), and may reflect catabolite repression systems. Trehalose occurs naturally in a variety of plants, yeast, fungi, bacteria, insects, and some invertebrates. The molecules unusual effectiveness under diverse conditions has been attributed to its unique physical properties. Trehalose is a nonreducing sugar; the [1-1] glucosyl bond formed by trehalose-6-phosphate synthase conceals the most reactive end of each glucose monomer (Gibson et al. 2002). The resulting chemical inertness allows cells to accumulate high concentrations of trehalose without disturbing biochemical processes. Additionally, trehalose has an unusually high glass transition temperature, which effectively slows kinetic processes in solutions by making macromolecular movement difficult (Crowe 2002). Under dehydrating conditions, the sugar protects cells by replacing water at the surface of macromolecules, holding proteins and membranes in their native conformations until water content is restored (Crowe et al.

PAGE 29

21 1984). Sola-Penna et al. (1998) illustrated this water-structuring behavior by relating the stabilizing effect of trehalose to its large hydrated volume. Their results showed that other sugars protect enzyme activity equally well only after the solution viscosity is increased to match that of trehalose. Endogenous synthesis of trehalose has potential to improve stress tolerance in genetically engineered organisms. There is considerable interest in the development of microbial biocatalysts for the production of chemicals that are medically or commercially valuable (Burton et al., 2002). High product yields require robust organisms capable of tolerating high levels of substrate and toxic byproducts. These attributes are scarcely present in wild-type organisms, whose native stress response systems are adapted to conditions routinely encountered in nature. The use of microbes for industrial purposes demands a new breed of organisms that must be engineered for optimal growth under specific physical and chemical parameters. Our work presents a simplified approach to this task in which we have amplified a stress response system that is already present in the target organism.

PAGE 30

LIST OF REFERENCES Alakomi, H.-L., E. Skytta, M. Saarela, T. Mattila-Sandholm, K. Latva-Kala, and I. M. Helander. 2000. Lactic acid permeabilizes gram-negative bacteria by disrupting the outer membrane. Appl. Environ. Microbiol. 66:2001-2005. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Deidman, J. A. Smith, and K. Struhl (ed.). 1987. Current protocols in molecular biology. John Wiley & Sons, Inc., New York, N.Y. Bachmann, B. 1972. Pedigrees of Some Mutant Strains of Escherichi coli K-12. Bacteriological Reviews. 36:525-557. Banaroudj, N., D. H. Lee, and A. L. Goldberg. 2001. Trehalose accumulation during cellular stress protects cells and cellular proteins from damage by oxygen radicals. J. Biol. Chem. 276:24261-24267. Billi, D., Wright, D. J., Helm, R. F., Prickett, T., Potts, M., and J. H. Crowe. 2000. Engineering Dessication Tolerance in Escherichia coli. Appl. Environ. Microbiol. 66:1680-1684. Blzquez, M. A., R. Lagunas, C. Gancedo, and J. M. Gancedo. 1993. Trehalose-6-phosphate, a new regulator of yeast glycolysis that inhibits hexokinases. FEBS 329:51-54. Bonini, M. B., Van Dijck, P., and J. M. Thevelein. 2003. Uncoupling of the glucose growth defect and the deregulation of glycolysis in Saccharomyces cerevisiae tps1 mutants expressing trehalose-6-phosphate-insensitive hexokinase from Schizosaccharomyces pombe. Biochim. Biophys. Acta. 1606:83-93. Boos, W., U. Ehmann, E. Bremer, A. Middendorf, and P. Postma. 1987. Trehalase of Escherichia coli: mapping and cloning of its structural gene and indentification of the enzyme as a periplasmic protein induced under high osmolarity conditions. J. Biol. Chem. 262:13212-13218. Boos, W., U. Ehmann, H. Forkyl, W. Klein, M. Rimemele, and P. Postma. 1990. Trehalose Transport and Metabolism in Echerichia coli. J. Bacteriol. 172:3450-3461. Bounias M. N-(1-naphthyl)ethylenediamine dihydrochloride as a new reagent for nanomole quantification of sugars on thin-layer plates by a mathematical calibration process. 1980. Anal. Biochem. 106:291-295. 22

PAGE 31

23 Burton, S. G., D. A. Cowen, and J. M. Woodley. The search for the ideal biocatalyst. 2002. Nature Biotechnol. 20:37-45. Caetano-Annoles, G. 1993. Amplifying DNA with arbitrary oligonucleotide primers. PCR Methods Appl. 3:85-92. Caliskan G., A. Kisliuk, A. M. Tsai, C. L. Soles, and A. P. Sokolov. 2003. Protein dynamics in viscous solvents. J. Chem. Phys. 118:4230-4236. Cnovas, D., S. A. Fletcher, M. Hayashi, and L. N. Csonka. 2001. Role of Trehalose in Growth at High Temperature of Salmonella enterica Serovar Typhimurium. J. Bacteriol. 183:3365-3371. Causey, T. B., S. Zhou, K. T. Shanmugam, and L. O. Ingram. 2003. Engineering the metabolism of Escherichia coli W3110 for the conversion of sugar to redox-neutral and oxidized products: Homoacetate production. Proc. Natl. Acad. Sci. USA. 100:825-832. Cheville, A. M., K. W. Arnold, C. Buchrieser, C. M. Cheng, and C. W. Kaspar. 1996. rpoS Regulation fo Acid, Heat, and Salt Tolerance in Escherichia coli I157:H7. J. Bacteriol. 62:1822-1824. Crowe, J. H., L. M. Crowe, and D. Chapman. 1984. Preservation of membranes in anhydrobiotic organisms: the role of trehalose. Science. 223:701-703. Crowe, J. H., F. A. Hoekstra, and L. M. Crowe 1992. Anhydrobiosis. Annu. Rev. Physiol. 54:579-99. Crowe, L. M. 2002. Lessons from nature: the role of sugars in anhydrobiosis. Comp. Biochem. and Physiol. 131:505-513. Csonka, L. N. 1989. Physiological and Genetic Responses of Bacteria to Osmotic Stress. Micriobiol. Rev. 53:121-147. Csonka, L. N. and W. Epstein. Osmoregulation, p. 1210-1223. In F. C. Neidhard. (ed.), Escherichia coli and Salmonella Typhimurium: Cellular and Molecular Biology. ASM Press, Washington, DC. Datsenko K. A. and B. L. Wanner. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA. 2000 12:6640-6645. de Castro, A. G., H. Bredholt, A. R. Strm, and A. Tunnacliffe. 2000. Anhydrobiotic Engineering of Gram-Negative Bacteria. Appl. Environ. Microbiol. 66:4142-4144. de Virgilio, C., T. Hottinger, J. Dominguez, T. Boller, and A. Wiemken. 1994. The role of trehalose synthesis for the acquisition of thermotolerance in yeast: I. Genetic evidence that trehalose is a thermoprotectant. Eur. J. Biochem. 219:179-186.

PAGE 32

24 Diamant S., N. Eliahu, D. Rosenthal, and P. Goloubinoff. Chemical chaperones regulate molecular chaperones in vitro and in cells under combined salt and heat stresses. J. Biol. Chem. 276:39586-39591. Dinnbier, U., E. Limpinsel, R. Schmid, and E. P. Bakker. 1988. Transient accumulation of potassium glutamate and its replacement by trehalose during adaptation of growing cells of Escherichia coli K-12 to elevated sodium chloride concentrations. Arch. Microbiol. 150:348-357. Dulaney, E. L., D. D. Dulaney, and E. L. Rickes. 1968. Factors in yeast extract which relieve growth inhibition of bacteria in defined medium of high osmolarity. Dev. Ind. Microbiol. 9:260-269. Elbein, A. D. 1974. The metabolism of ,-trehalose. Adv. Carbohyd. Chem. Biochem. 30:227-256. Elbein, A. D., Y. T. Pan, I. Pastuszak, and D. Carroll. 2003. New insights on trehalose: a multifunctional molecule. Glycobiology. 13:17R-27R. Garg, A. K., J. K. Kim, T. G. Owens, A. P. Ranwala, Y. D. Choi, L. V. Kochian, and R. J. Wu. 2002. Trehalose accumulation in rice plants confers high tolerance levels to different abiotic stresses. Proc. Natl. Acad. Sci. U S A. 99:15898-15903. Giver H. M., O. B. Styrvold, I. Kaasen, and A. R. Strm. 1988. Biochemical and genetic characterization of osmoregulatory trehalose synthesis in Escherichia coli. J Bacteriol. 170:2841-2849. Gibson, K. E., and T. J. Silhavy. 1999. The LysR homolog LrhA promotes RpoS degradation by modulating activity of the response regulator SprE. J. Bacteriol. 181:563-571. Gibson R. P., J. P. Turkenburg, S. J. Charnock, R. Lloyd, and G. J. Davies. 2002. Insights into Trehalose Synthesis Provided by the Structure of the Retaining Glucosyltransferase OtsA. Chem. Biol. 9:1337-1346. Goddijn O. and K. van Dun. 1999. Trehalose metabolism in plants. Trends Plant Sci. 4:315-319. Gouesbet, G., M. Jebbar, R. Talibart, T. Bernard, and C. Blanco. 1994. Pipecolic acid is an osmoprotectant for Escherichia coli taken up by the general osmoporters ProU and ProP. Microbiol. UK. 140:2415-2422. Guo, N., Puhlev, I. Brown, D. R., Manbridge, J., Levine, F. 2000. Trehalose expression confers dessication tolerane on human cells. Nature Biotechnol. 18:167-171.

PAGE 33

25 Hars, U., R. Horlacher, W. Boos, W. Welte, and K. Diederichs. 1998. Crystal structure of the effector-binding domain of the trehalose-repressor of Escherichia coli, a member of the LacI family, in its complexes with inducer trehalose-6-phosphate and noninducer trehalose. Protein Sci. 7:2511-2521. Hengge-Aronis, R., R. Lange, N. Henneberg, and D. Fischer. 1993. Osmotic regulation of the rpoS-dependent genes in Escherichia coli. J. Bacteriol. 175:259-265. Hengge-Aronis, R., K. Wolfgang, R. Lange, M. Rimmele, and W. Boos. 1991. Trehalose synthesis genes are controlled by the putative sigma factor encoded by rpoS and are involved in stationary-phase thermotolerance in Escherichia coli. J. Bacteriol. 173:7918-7924. Holtmann, G. and E. Bremer. 2004. Thermoprotection of Bacillus subtilis by exogenously provided glycine betaine and structurally related compatible solutes: involvement of Opu transporters. J. Bacteriol. 186:1683-1693. Horlacher, R., K. Uhland, W. Klein, M. Ehrmann, and W. Boos. 1996. Characterization of a cytoplasmic trehalase of Escherichia coli. J. Bacteriol. 178:6250-6257. Ishida, A., N. Otsuka, S. Nagata, K. Adachi, and H. Sano. 1996. The effect of salinity stress on the accumulation of compatible solutes related to the induction of salt-tolerance in Escherichia coli. J. Gen. Appl. Microbiol. 42:331-336. Kaasen, I., P. Falkenberg, O. B. Styrvold, and A. R. Strm. 1992. Molecular cloning and physical mapping of the otsBA genes, which encode the osmoregulatory trehalose pathway of Escherichia coli: evidence that transcription is activated by katF (AppR). J Bacteriol. 1992 174:889-898. Kaasen, I., J. McDougall, and A. R. Strm. 1994. Analysis of the otsBA operon for osmoregulatory trehalose synthesis in Escherichia coli and homology of the OtsA and OtsB proteins to the yeast trehalose-6-phosphate synthase/phosphatase complex. Gene 145:9-15. Kandror, O., A. DeLeon, and A. L. Goldberg. 2002. Trehalose synthesis is induced upon exposure of Escherichia coli to cold and is essential for viability at low temperatures. Proc. Natl. Acad. Sci. USA. 99:9727-9732. Karp, P. D., M. Riley, M. Saier, I. T. Paulsen, S. Paley, and A. Pellegrini-Toole. 2002. The Ecocyc Database. Nucleic Acids Res. 30:56. Kempf, B. and E. Bremer. 1998. Uptake and synthesis of compatible solutes as microbial stress responses to high-osmolality environments. Arch Microbiol. 170:319-330. Koch, A. 1991. Effective growth by the simplest means: the bacterial way. ASM News. 57:633-637.

PAGE 34

26 Landfald, D. and A. R. Strm. 1986. Choline-glycinebetaine pathway confers a high level of osmotic tolerance in Escherichia coli. J. Bacteriol. 165:849-855. Leslie, S. B., E. Israeli, B. Lighthart, J. H. Crowe, and L. M. Crowe. 1995. Trehalose and sucrose protect both membranes and proteins in intact bacteria during drying. Appl Environ Microbiol. 61:3592-3597. Loewen, P. C. and R. Hengge-Aronis. 1994. The regulation of the sigma factor s (KatF) in bacterial global regulation. Annu. Rev. Microbiol. 48:53-80. Mansure, J. J., A. D. Panek, L. M. Crowe, and J. H. Crowe. 1994. Trehalose inhibits ethanol effects on intact yeast cells and liposomes. Biochim. Biophys. Acta. 1191:309-16. Martinez-Morales, F., Borges, A. G., Martinez, A., Shanmugam, K. T., and L. O. Ingram. 1999. Chromosomal integration of heterologous DNA in Escherichia coli with precise removal of markers and replicons used during construction. J. Bacteriol. 181:7143-7148. Measures, J. C. 1975. Role of amino acids in osmoregulation of nonhalophilic bacteria. Nature 257:398-400. Miller, J. H. 1992. A short course in bacterial genetics: a laboratory manual and handbook for Escherichia coli and related bacteria. Cold Spring Harbor Press, Cold Spring Harbor, N.Y. Norris, V., and B. Manners. 1993. Deformations in the cytoplasmic membrane of Escherichia coli direct the synthesis of peptidoglycan: the herni model. Biophys. J. 64:1691-1700. Padilla, L. R. Krmer, G. Stephanopulos, and E. Agosin. 2004. Overproduction of trehalose: heterologous expression of Escherichia coli trehalose-6-phosphate synthase and trehalose-6-phosphate phosphatase in Corynebacterium glutamicum. Appl. Environ. Microbiol. 70:370-376. Perroud, B. and D. Le Rudulier. 1985. Glycine betaine transport in Escherichia coli: Osmotic Modulation. J. Bacteriol. 161:393-401. Poolman, B. and E. Glaasker. 1998. Regulation of compatible solute accumulation in bacteria. Mol. Microbiol. 29:397-407. Posfai, G., M. D. Koob, H. A. Kirkpatrick, and F. C. Blattner. 1997. Versatile insertion plasmids for targeted genome manipulations in bacteria: isolation, deletion, and rescue of the pathogenicity island LEE of the Escherichia coli O157:H7 genome. J. Bacteriol. 179:4426-4428.

PAGE 35

27 Richards A. B., S. Krakowka, L. B. Dexter, H. Schmid, A. P. M. Wolterbeek, D. H. Waalkens-Berendsen, A. Shigoyuki, and M. Kurimoto. 2002. Trehalose: a review of properties, history of use and human tolerance, and results of multiple safety studies. Food Chem. Toxicol. 40:871-898. Richey, B. D., S. Cayley, M. C. Mossing, C. Kolka, C. F. Anderson, T. C. Farrar, and M. T. Record, Jr. 1987. Variability in the intracellular ionic environment of Escherichia coli: differences between in vitro and in vivo effects of ion concentrations on protein-DNA interactions and gene expression. J. Biol. Chem. 262:7157-7164. Rimmele, M. and W. Boos. 1994. Trehalose-6-phosphate hydrolase of Escherichia coli. J. Bacteriol. 176:5654-5664. Rudolph, B. R., I. Chandrasekhar, B. P. Gaber, and M. Nagumo. 1990. Molecular modeling of saccharide-lipid interactions. Chem. Phys. Lipids. 53:243-261. Schleyer, M. R. Schmidt, and E. O. Bakker. 1993. Transient, specific and extemely rapid release of osmolytes from growing cells of Escherichia coli K-12 exposed to hypoosmotic shock. Arch. Microbiol. 160:424-431. Silva, Z., S. Alarico, A. Nobre, R. Horlacher, J. Marugg, W. Boos, A. I. Mingote, and M. S. da Costa. 2003. Osmotic adaptation of Thermus thermophilus RQ-1: lesson from a mutant deficient in synthesis of trehalose. J. Bacteriol. 185:5943-5952. Simon, R., J. Quandt, and W. Klipp. 1983. A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in Gram-negative bacteria. Bio/Technology 1:784-791. Singer, M. A. and S. Lindquist. 1998. Multiple effects of trehalose on protein folding in vitro and in vivo. Mol. Cell. 1:639-638. Sleator, R. D. and C. Hill. 2001. Bacterial osmoadaptation: the role of osmolytes in bacterial stress and virulence. FEMS Microbiol. Rev. 26:49-71. Sola-Penna, M. and J. R. Meyer-Fernandes. 1998. Stabilization against thermal inactivation promoted by sugars on enzyme structure and function: why is trehalose more effective than other sugars? Arch. Biochem. Biophys. 360:10-14. Storz, G., and R. Hengge-Aronis. 2000. Bacterial Stress Responses. ASM Press, Washington, DC. Strm, A. R. 1998. Osmoregulation in the model organism Escherichia coli: genes governing the sythesis of glycine betaine and trehalose and their use in metabolic engineering of stress tolerance. J. Biosci. 23:437-445. Strm, A. R. and I. Kaasen. 1993. Trehalose metabolism in Escherichia coli: stress protection and stress regulation of gene expression. Mol. Microbiol. 8:205-210.

PAGE 36

28 Styrvold, O. B. and A. R. Strm. 1991. Synthesis, accumulation, and excretion of trehalose in osmotically stressed Escherichia coli K-12 strains: influence of amber suppressors and function of the periplasmic trehalase. J. Bacteriol. 173:1187-1192. Sukharev, S.I., P. Blount, B. Martinac, and C. Kung. 1997. Mechanosensitive channels of Escherichia coli: the MscL gene, protein and activities. Annu. Rev. Physiol. 59:633-657. Tunnacliffe, A., A. G. de Castro, and M. Manzanera. 2001. Anhydrobiotic engineering of bacterial and mammalian cells: is intracellular trehalose sufficient? Cryobiology. 43:124-132. Van Laere, A. 1989. Trehalose, reserve and/or stress metabolite? FEMS Microbiol. Rev. 63:201-210. Underwood, S. A., M. L. Buszko, K. T. Shanmugam, and L.O. Ingram. 2004. Lack of protective osmolytes limits cell growth and volumetric productivity of ethanologenic Escherichia coli KO11 during xylose fermentation. Appl. Environ. Microbiol., in press.* Wang, X., J. F. Preston, and T. Romeo. 2004. The pgaABCD Locus of Escherichia coli Promotes the Synthesis of a Polysaccharide Adhesin Required for Biofilm Formation. J. Bateriol., in press.* Welsh, D. T. and R. A Herbert. 1999. Osmotically induced trehalose, but not glycine betaine accumulation promotes desiccation tolerance in Escherichia coli. FEM Microbiol. Lett. 174:57-63. Yilmaz, J. L. and L. Blow. 2002. Enhanced stress tolerance in Escherichia coli and Nicotiana tabacum expressing a betaine aldehyde dehydrogenase/choline dehydrogenase fusion protein. Biotechnol. Prog. 18:1176-1182. Zhou, S. D., T. B. Causey, A. Hasona, K. T. Shanmugam, and L. O. Ingram. 2003. Production of optically pure D-lactic acid in mineral salts medium by metabolically engineered Escherichia coli W3110. Appl. Environ. Microbiol. 69:399-407. Zhou, S. D. and L. O. Ingram. 2001. Simultaneous saccharification and fermentation of amorphous cellulose to ethanol by recombinant Klebsiella oxytoca SZ21 without supplemental cellulase. Biotechnol. Lett. 23:1455-1462.

PAGE 37

BIOGRAPHICAL SKETCH On August 15th, 1979, Jeremy Edward Purvis was born in Sarasota, Florida, to a red-haired mechanic and a coupon-clipping schoolteacher who delighted themselves through selfless outpour of time, strength, and hard-earned dollars on behalf of two lucky children. From kindergarten, Jeremy was formally educated by Floridas public school system, receiving a bachelors degree in microbiology from the University of Florida in May, 2002. He plans to devote his future research efforts to computational and experimental approaches to understanding biomolecular structure and function. 29


Permanent Link: http://ufdc.ufl.edu/UFE0004870/00001

Material Information

Title: Enhanced Trehalose Production Improves Growth of Escherichia coli under Osmotic Stress
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0004870:00001

Permanent Link: http://ufdc.ufl.edu/UFE0004870/00001

Material Information

Title: Enhanced Trehalose Production Improves Growth of Escherichia coli under Osmotic Stress
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0004870:00001


This item has the following downloads:


Full Text












ENHANCED TREHALOSE PRODUCTION
IMPROVES GROWTH OF Escherichia coli
UNDER OSMOTIC STRESS
















By

JEREMY E. PURVIS


A THESIS PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE

UNIVERSITY OF FLORIDA


2004
































Copyright 2004

by

Jeremy E. Purvis
















ACKNOWLEDGMENTS

Long after the details of this work have faded from my memory, I will still be

obliged to commend the few outstanding individuals who toiled alongside me during

these past two years. I am particularly thankful to my advisor, Lonnie Ingram, for his

instruction and encouragements, which have extended well beyond the boundaries of our

laboratory; to my committee members, James Preston and Keelnatham Shanmugam, for

their open resource and discussion; to my parents, for rej oicing in my successes as avidly

as during my childhood; and to Joy, my future wife, for giving me something far better

than a master' s degree to look forward to.



















TABLE OF CONTENTS


page


ACKNOWLEDGMENT S .........__.. ..... .__. .............._ iii..


LIST OF TABLES ........._.___..... .__. ...............v....


LIST OF FIGURES .............. ....................vi


AB STRAC T ................ .............. vii


CHAPTER


1 INTRODUCTION ................. ...............1.......... ......


Osmoregulation in Escherichia coli .............. ...............1.....
Role of Trehalose in Stress Tolerance ................. ...............1...............


2 MATERIALS AND METHODS .............. ...............5.....


Bacteria, Plasmids, and Culture Conditions .............. ...............5.....
Genetic M ethods s................. ............... ...............5.......
Measurement of Intracellular Trehalose .....___.....__.___ .......____ ...........8
Tolerance As say s ........._.. ..... ._ ...............8.....


3 RE SULT S .............. ...............9.....


Native Trehalose Production Provided a Small Benefit for Growth ........._.................9
Construction of Strains for Increased Production of Trehalose. .............. ...............11

Comparison of Integrants ............... .... ......_ .. ..... ..... .. ...............12
Optimization of Trehalose Expression for Salt and Sugar Stress............... ............... 13
Elevated Trehalose Production Increased Cell Growth after 24 h in the Presence or
Absence of Osmotic Stress Agent. ....__ ......_____ .......___ ...........1


4 DI SCUS SSION ............ ..... .._ ............... 18..


LIST OF REFERENCES ............_ ..... ..__ ...............22...


BIOGRAPHICAL SKETCH .............. ...............29....








1V



















LIST OF TABLES

Table pg

2-1 Strain sources and characteristics............... .............

2-2 Plasmid sources and characteristics .............. ...............7.....

3-1 Stress tolerance of W3 110 strains ................ .............15............ .


















LIST OF FIGURES


Figure pg

1-1 Trehalose metabolism in E. coli ................. ...............2...............

3-1 Growth of E coli strains under stress .............. ...............10....

3-2 Plasmid constructions ................. ...............11......___ ....

3-3 Intracellular trehalose accumulated by JP10 harboring pLOI3607 and
derivatives .............. ...............12....

3-4 Incremental growth of wild type and otsA' otsB' integrants under salt stress .........13

3-5 Optimization of otsBA expression during salt and sugar stresses ..........................14

3-6 Intracellular trehalose accumulated by unstressed W3110 strains ................... ........16

3-7 Growth of E. coli strains in the absence or presence of osmotic stress. ...................1 7















Abstract of Thesis Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Master of Science

ENHANCED TREHALOSE PRODUCTION
IMPROVES GROWTH OF Escherichia coli
UNDER OSMOTIC STRESS

By

Jeremy E. Purvis

May 2004

Chair: Lonnie O. Ingram
Major Department: Microbiology and Cell Science

The disaccharide trehalose protects bacterial cells against multiple environmental

stresses. Escherichia coli synthesizes trehalose in response to osmotic stress, heat shock,

extreme cold, desiccation, and entry of cells into stationary phase. Previous studies have

shown that mutants that cannot produce trehalose are sensitive to elevated osmolarity,

oxidation, and heat.

Here we examined the potential benefit of trehalose for growth in glucose-mineral

salts medium containing a series of concentrations of salts and sugars. Strain W31 10

(wild type) was compared to an isogenic strain in which all genes for trehalose synthesis

and degradation were deleted, and to a derivative in which a single chromosomal copy of

the otsA otsB operon was provided under LacI regulation. Modest differences in growth

between wild type and mutant strains suggested a direct protective role for trehalose.

These differences in growth were increased when trehalose production was elevated

above that of wild-type cells. Our results demonstrate that production of high intracellular









trehalose levels can be used to increase cell growth under salt and sugar stress. This

finding should aid the development of efficient microbial bioconversion processes that

demand high substrate concentrations and greater tolerance to products.















CHAPTER 1
INTTRODUCTION

Osmoregulation in Escherichia coli

Bacteria have a remarkable ability to sense and respond to environmental stress

(Storz and Hengge-Aronis 2000). A part of this natural defense system involves the

intracellular accumulation of protective compounds that shield macromolecules and

membranes from damage (Csonka 1989; Kempf and Bremer 1998). For this purpose,

Escherichia coli can use a variety of compounds including glutamate, proline, trehalose,

betaine, and dimethyl sulfoniopropionate (Gouesbet et al. 1994; Landfald and Strarm

1986; Measures 1975; Perroud and Le Rudulier 1985; Underwood et al. 2004). Although

glutamate and proline provide transient relief from osmotic stress (Dinnbier et al. 1988),

allosteric control of proline synthesis and the negative charge of glutamate limit their

effectiveness at high concentrations (Richey et al. 1987). In recent studies, adding

betaine was shown to stimulate growth and ethanol production in recombinant E. coli

(Underwood et al. 2004) and to increase thermal tolerance in Bacillus subtilis (Holtmann

and Bremer 2004 ). However, neither betaine nor dimethylsulfoniopropionate can be

synthesized de novo by E. coli. In the absence of these supplements, trehalose is

produced as the primary protective osmolyte (Ishida et al. 1996).

Role of Trehalose in Stress Tolerance

Trehalose is a nonreducing disaccharide that has proven very useful for stabilizing

proteins and enhancing cell survival during dessication (Sola-Penna et al. 1998). Genes

encoding trehalose biosynthesis are widely distributed in nature (Elbein 1974; Elbein et










al. 2003; Richards et al. 2002) and have been extensively studied in E. coli and

Saccharomyces. Escherichia coli regulates trehalose production at the transcriptional

level (otsAB operon) with induction in response to osmotic shock (Gi~ever et al. 1988),

extreme heat (de Virgilio et al. 1994), extreme cold (Kandror et al. 2002), dessication

(Van Laere 1989), and entry into stationary phase (Hengge-Aronis et al. 1991). Two

enzymes are unique to trehalose biosynthesis: trehalose-6-phosphate synthase (otsA) and

trehalose-6-phosphate phosphatase (otsB) (Figure 1) (Kaasen et al. 1992). Previous

studies showed that mutations in either otsA, otsB, galU (glucose-6-phosphate uridylyl

transferase), or rpoS (Hengge-Aronis et al. 1991) (038 required for stationary phase

induction) are sufficient to prevent trehalose synthesis (Elbein et al. 2003).


Glucose 2 Glucose Trehalose
A treA
A
out


PEP pyr uvate
A ots4 A ots3
Glurcose-6-P Trehalose-6-P )~ Trehalose
UDP-Glucose UDP H0PP H2



1p~ g l P UTP PP teG lucose + C I 'e

Glucose- 1-P Glucose- 6- P 2 Gluc ose


Figure 1-1. Trehalose metabolism in E. coli. Bold arrows denote synthetic route by
trehalose-overproducing strain, JP20. Reactions that have been blocked by
gene deletions are marked with filled triangles. A) Glucose enters the cell as
glucose-6-phosphate via a PEP-dependent phosphotransferase enzyme
complex. B) The OtsA synthase condenses trehalose-6-phosphate with
UDP-glucose to form the precursor trehalose-6-phosphate, which is
dephosphorylated by a specific OtsB phosphatase. C) Intracellular trehalose
can be degraded by the cytosolic trehalase TreF or by hydrolysis of
trehalose-6-phosphate by a specific hydrolase TreC.









Inability to synthesize trehalose results in poor growth under salt stress (Ginever

et al. 1988) and decreased survival during storage at high or low temperatures (Kandror

et al. 2002; Hengge-Aronis et al. 1993), at low pH (Hengge-Aronis et al. 1991), during

desiccation (Welsh and Herbert 1999), and under oxidative stress (Banaroudj et al. 2001).

Although these effects are not reversed by the external addition of trehalose because of

periplasmic catabolic enzymes in E. coli (Boos et al. 1990), the addition of trehalose has

been shown to restore salt growth in an otsA mutant of Thermus themophihts (Silva et al.

2003). A combination of otsA and otsB genes from E. coli has been used to genetically

engineer increased stress tolerance in plants (Garg et al. 2002) and in mammalian cells

(Guo et al. 2000; Tunnacliffe et al. 2001).

Prior studies with trehalose have focused primarily on cell survival under stress

conditions. Recent interest in the development of microbial biocatalysts for the

production of high concentrations of commodity chemicals (Causey et al. 2003; Zhou et

al. 2003) implies a potential need for increased tolerance to high concentrations of sugar

feedstocks and mineral nutrients during growth; and a need to minimize the effect of high

product concentration. Previous studies by Billi et al. (2000) used the Synechocystis sp.

spsA gene to show that the intracellular production of sucrose, a nonreducing sugar dimer

with some of the properties of trehalose (Crowe 2002), dramatically increased the

desiccation resistance of E. coli. Their results indicate that suboptimal levels of trehalose

are produced by native control systems.

Our study examined the importance of trehalose for growth in glucose-mineral salts

containing a series of concentrations of salts and sugars. Tolerance was evaluated by

measuring final cell density after 24 h in the presence of osmotic stress. Strain W31 10










(wild type) was compared to an isogenic strain in which all genes for trehalose synthesis

and degradation were deleted, and to a derivative in which a single chromosomal copy of

the otsA otsB operon was provided under LacI regulation. These studies demonstrate that

native levels of trehalose synthesized in the parent strain are of limited benefit for growth

under osmotic stress, at high temperature, or at pH extremes. However, increasing

trehalose production above that produced by the native regulatory system improved

growth substantially under both salt and sugar stress.















CHAPTER 2
MATERIALS AND METHODS

Bacteria, Plasmids, and Culture Conditions

Strains and plasmids used in our study are listed in Table 2-1. Strains DH~a and

TOPO 10F' were used as hosts for plasmid constructions. For constructions, cultures were

grown at 370C in Luria-Burtani medium (LB) (Ausubel et al. 1987) or on LB solidified

with 1.5% agar. Ampicillin (50 Cpg/mL), kanamycin (50 Cpg/mL), and tetracycline

(12.5 Cpg/mL) were added as appropriate for selection. For stress studies, cultures were

maintained on M9 plates (Miller 1992) containing 2% glucose.

Isopropyl-P-D-thiogalactopyranoside (IPTG) was used to induce expression of otsBA in

JP20. Inducer was added at time of inoculation. Growth was monitored

spectrophotometrically at 550 nm with a Spectronic 70 spectrophotometer

(Bausch & Lomb, Inc., Rochester, NY).

Genetic Methods

Standard methods were used for plasmid construction and analyses (Ausubel, et al.

1987). Coding regions for treA, treC and treF were amplified using ORFmer primers

(Sigma-Genosys, The Woodlands, TX) and cloned initially into pCR2. 1-TOPO

(Invitrogen). Chromosomal integration of mutated genes was facilitated by pKD46

containing an arabinose-inducible Red Recombinase (Datsenko and Wanner 2000).

Mutants were screened for appropriate antibiotic resistance and verified by analysis of

PCR products. Coding regions for otsBA genes were amplified by PCR using W3110

geneomic DNA as the template for the primer pair: N terminus










Table 2-1. Strain sources and characteristics
Strains Relevant Characteristics
DH~a lacZAM15 recA


Reference

Bethesda Research
Laboratory


W3110 wild type ATCC 27325
TOP 10F' lacP (episome) Invitrogen
S17-11pir thi pro hsdR hsdllf recA RP4-2-Tc::Mu-Km:: Tn7 Simon 1983
hpir
JP10 W3110, AotsBA::FRT AtreA AtreC AtreF This study
JPl5 W3110, AotsBA::FRT AtreA::FRT-tet-FRT This study
AtreC::FRT AtreF::FRT
JP20 W3110, AotsBA::F'RT AtreA::FRT AtreC::F'RT This study
AtreF: :FRT OampH:: 1acP4-Pta-otsBA-FRT
JP21 W31 10, AotsBA::FRT AtreA::FRT AtreC::FRT This study
AtreF: :FRT OalsA:: 1acP-Ptac-otsBA-FRT
JP22 W3110, AotsBA::FRT AtreA::FRT AtreC::FRT This study
AtreF: :FRT lacP-Ptac-otsBA-FRT
JP23 W3110, AotsBA::F'RT AtreA::FRT AtreC::F'RT This study
AtreF: :FRT lacP4-Ptac-otsBA-FRT
JP24 W3110, AotsBA::F'RT AtreA::FRT AtreC::F'RT This study
AtreF: :FRT lacP-Ptac-otsBA-FRT

5'AAGGAGGAGAACCGGGTGACA3 and C terminus

5'ACGCAGCGTGATGCATGAAG3 '. A 6. 1 kb fragment containing the inducible ots

operon (Ptac-otsBA-FRT-kank~-FRT) was integrated into JPl5 by conjugation with donor

strain S17-1h containing the xn-dependent transposase vector, pLOI3650. Kanomycin-

resistant exconjugates (sensitive to ampicillin) were selected. Integration was confirmed

by PCR. The FRT (FLP recognition target)-flanked antibiotic resistance genes were

deleted by FLP recombinase (Posfai et al. 1997; Martinez-Morales et al. 1999).

Chromosomal DNA adj acent to the Ptac-otsBA-FRT insertion was amplified using

arbitrarily primed PCR (Gibson and Silhavy 1999; Caetano-Annoles 1993; Wang et al.

2004). Sequences of primers used in the first (ARB 1 and OUT-OTS) and second rounds










Table 2-2. Plasmid sources and characteristics
Plasmid Relevant Characteristics Reference

pCR2.1-TOPO bla kan, TOPOTM TA cloning vector Invitrogen
pFT-A bla flp low-copy vector containing recombinase and 28
temperature-conditional pSC101 replicon
pKD46 bla y P exo low-copy vector containing red 26
recombinase and temperature-conditional pSC101
replicon
pFLAG-CTC bla Ptae controlled expression vector Sigma
pLOI2065 bla, Smal fragment with FRT-flanked tet gene Underwood 2002
pLOI2511 bla, Smal fragment with FRT-flanked kan gene Underwood 2002
pLOI3469 bla tnp, hpir-dependent Tn5 transposase vector This study
pLOI3601 bla kan otsBA This study
pLOI3604 bla otsBA This study
pLOI3605 bla otsBA-FRT-kan-FRT This study
pLOI3607 bla Ptac- otsBA-FRT-kan-FRT This study
pLOI3617 pLOI3607, AotsA (M~lul, Klenow) This study
pLOI3618 pLOI3607, AotsB (BglII, Klenow) This study
pLOI3619 pLOI3617, AotsB (BglII, Klenow) This study
pLOI3 62 1 bla kan treA This study
pLOI3625 bla kan treA ::FRT-tet-FRT This study
pLOI3631 bla kan treF This study
pLOI3635 bla kan treF::FRT-tet-FRT This study
pLOI3 64 1 bla kan treC This study
pLOI3645 bla kan treC::FRT-tet-FRT This study
pLOI3650 bla tnp Apir-dependent vector containing This study
transposable Tn5 element [ Ptac- otsBA-FRT-kan-
FRT ]

(ARB2 and IN-OTS) of amplification are listed below. Resulting products were

gel-purified and used as a template for DNA sequencing.

* ARB1 5'GGCCACGCGTCGACTAGTACNNNNNNNNNNGATAT3'
* OUT-OTS 5'TGGCAGATGCACGGTTACGA3'
* ARB2 5'GGCCACGCGTCGACTAGTAC3'
* IN-OTS 5 'C TATGC GGC ATC AGAGCAG3 '









Measurement of Intracellular Trehalose

Sufficient culture volume was harvested (10000 x g, 250C) to provide 2.0 mg dry

cell weight (1 OD5sonm = 0.33 g liter ~1dry cell weight). Cells were permeabilized with

50% methanol and extracted for 30 min on ice. The mixture was vortexed briefly and

centrifuged at 10,000 x g for 1 min. The supernatant was assayed for trehalose by

thin-layer chromatography as described previously (Zhou and Ingram 2001). After

visualizing with N-(1 -naphthyl)ethylenediamine reagent (Bounias 1980), relative

amounts of trehalose were determined by densitometry using Quantity One Software

(BioRad). For estimates of intracellular trehalose concentrations, an aqueous volume of

1 mL was assumed per gram of dry cells.

Tolerance Assays

Tolerance was evaluated by measuring growth (defined as final cell mass after 24 h

of incubation) in M9 minimal medium containing 2% glucose (without antibiotics).

Ignoring dissociation effects, basal medium contained 93 mM mineral salts and 111 mM

glucose. For each stress condition, a range of concentrations (or temperatures, or initial

pH) was selected that caused a gradual, near complete inhibition of growth (defined as

less than 2 doublings). Cells from a fresh plate were resuspended in M9 medium

containing 2% glucose and used as inocula (initial level of 0.030 OD5sonm). Cultures were

incubated in 13 x 100 mm capped tubes (370C water bath, 50 rpm reciprocating shaker,

24 h) and tested in triplicate. Results are presented as average values with standard errors

(bars) from three or more separate experiments, or as an average of replicates from one or

two experiments (without error bars). All compounds tested were purchased from either

the Sigma Chemical Company (St. Louis, MO) or from Fisher Scientific.















CHAPTER 3
RESULTS

Native Trehalose Production Provided a Small Benefit for Growth

A mutant of W3 110 was constructed (strain JP 10) in which both biosynthetic genes

for trehalose were deleted (otsA, otsB) as well as genes encoding cytoplasmic (treC, treF)

and periplasmic (treA) trehalase (Figure 1-1). Although native trehalose production has

been shown to be highly beneficial for survival under many conditions (Kandror et al.

2002; Hengge-Aronis et al. 1993), loss of trehalose synthesis in JP10 resulted in only

modest decreases in final cell density during osmotic stress from salts and sugars

(glucose, mannose, xylose, and arabinose) (Figure 3-1). Differences were most evident at

the higher levels in which growth was reduced by more than half, decreasing the

minimum inhibitory level for (NaC1, KC1, and KH2PO4) and increasing the

concentrations of salts and hexose sugars (glucose and mannose) that permitted growth

equivalent to half that of the unstressed parent (1L50).

Inactivation of trehalose biosynthesis had no effect on tolerance to osmotic stress

from pentose sugars (arabinose and xylose) or on tolerance to pH and elevated

temperature. For glucose, mannose, arabinose, and the salts (assuming 2 particles per

KH2PO4 at pH 7), growth inhibition was roughly the same at equivalent osmolalities.

Xylose was two-fold more toxic than other osmolytes and caused an abrupt inhibition of

growth at concentrations above 120 mM (Figure 3-1).

Most added osmolytes caused a progressive, dose-dependent reduction in growth,

which began even with small additions (Figure 3-1). Both pentose sugars and KH2PO4







10



SA B C






[KCl] (mM) [KH2PO~ (mM) [NaCl] (mM)

D EF






[Ikabmnose] (mM) [Glucose] (mM) [Ma nose] (mM)








[X/osee] (mM) Tempematume (oC) pH


Figure 3-1. Growth of E coli strains under stress. Plotted concentrations represent the
osmolar contribution of each compound in addition to basal medium
osmolarity of 204 mM. The wild type strain W3 110 (0) and trehalose-
deficient mutant JP10 (A) were grown in a defined medium containing
increasing concentrations of osmolytes. A) KC1. B) KH2PO4. C) NaC1.
D) Arabinose. E) Glucose. F) Mannose. G) Xylose. JP20 (described below)
was grown under the same conditions with () and without (0) 0.1 mM
IPTG. The same strains were compared for tolerance to physical stress.
H) Heat. I) pH. Results are presented as average values with standard
deviations (bars) from three or more separate experiments.

were exceptions in which 100 mM additions resulted in an increase in final cell density.

In contrast to glucose and mannose, small additions of xylose and arabinose increased the

final cell density. The largest increase was caused by KH2PO4 and appears to result from

pH buffering. All cultures that reached final densities of over 1.0 Assonm were

approximately pH 4.6, below that permitting growth. The addition of MOPS buffer










(100 mM) to M9-glucose medium resulted in a similar increase in growth (data not

shown).

Construction of Strains for Increased Production of Trehalose

A medium-copy number expression vector containing an inducible otsBA operon

(pLOI3607) was originally used to investigate trehalose overproduction (Figure 3-2).

Derivatives of this plasmid were constructed in which frameshift mutations were inserted

at unique sites in the coding regions of otsA, otsB, or both genes (Table 2-1).

Trehalose production in JP10 cells was compared for strains harboring each

plasmid. Although a small increase was observed for plasmids containing a defect in

either gene (1 to 6%), expression of both genes increased intracellular trehalose levels by

more than 100-fold based on densitometry (Figure 3-3). Using trehalose standards, the

intracellular concentrations in JP10 harboring pLOI3607 (both genes functional) and

pLOI3619 (both genes deleted) were estimated to be 180 mM and <1 mM, respectively.

Plasmid pLOI3607 and derivatives were quite unstable in W3110 and JP10 during

growth in M9-glucose medium. To eliminate this problem, a single copy of the






pFLAG-CTC pLOI3469
.5348 bps 5291 bps




EcoRI t Pacl (T4) / ta



kan bp Ecdl Psi lo 8868 bps mr Snal Tntp 11366 bps
EcoRI~ FRknma sI R


Figure 3-2. Plasmid constructions.














t B








pLOI3607 pLOI3617 pLOI3618 pLOI3619

Figure 3-3. Intracellular trehalose accumulated by JP10 harboring pLOI3607 and
derivatives. Cultures were grown to mid-log phase and induced with 0.1 mM
IPTG for 2 h. A) Section from thin-layer plate used for densitometry
calculation. B) Intracellular trehalose levels.

Lacl-regulated ots operon was transposed into the chromosome of JP 10. Five resulting

integrants were chosen at random for deletion of the kankkkkkk~~~~~~~kkkkkk gene used for selection of the

transposition. Chromosomal insertion of the modified ots casette was determined using

arbitrarily-primed PCR to map the site of integration in two strains:

JP20 (QampH: :1acl-Pta-otsBA-FR T), JP21 (QalsA: :1acl-Ptac-otsBA-FR T).

Comparison of Integrants

All integrants were similar and exhibited 6-fold to 10-fold increase in cell growth

after 24 h in M9-glucose containing NaCl (300, 400, and 500 mM) in comparison to the

parent containing otsAB deletions (JP10) and the wild type, W3110 (Figure 3-4).

Addition of inducer (0. 1 mM IPTG) to the medium of these integrants resulted in further

doubling of cell growth. One integrant, strain JP20, was selected for further study.














15










JP20 JP21 JP22 JP23 JP24

Figure 3-4. Incremental growth of wild type and otsA+ otsB+ integrants under salt stress.
Tops of bars mark final cell density after 24 h of incubation with 300 (black
bars), 400 (hatched bars), and 500 (open bars) mM NaC1. Basal medium
osmolarity equaled 204 mM. Integrants were treated with (+) or without (-)
0.1 mM IPTG. Results are presented as average values with standard
deviations (bars) from three or more separate experiments.

Intracellular trehalose levels in JP20 with 0.1 mM IPTG (952 mM) and without IPTG

(74 mM) were much higher than in W3110 (<1 mM) and JP10 (<1 mM). These results

are consistent with incomplete repression of the ots casette in JP20 by the adj acent lacl.

In this JP10 background devoid of periplasmic and cytoplasmic trehalase activity, even

low levels of otsAB expression could lead to substantial intracellular accumulation of

trehalose.

Optimization of Trehalose Expression for Salt and Sugar Stress

Concentrations of individual salts and sugars were selected near the minimal

inhibitory level (ILmin) for the parental strain, JP10. With each stress agent, JP20 growth

was evaluated with a series of IPTG concentrations to determine the optimal level for

induction (Figure 3-5). Results for all sugars and salts tested were essentially the same

with an optimum at 0.1 mM IPTG. At this concentration, cell growth after 24 h was










2-fold to 4-fold that of the uninduced culture. With the exception of glucose, further

increases in IPTG were detrimental for cell growth in the presence of other osmotic stress

agents.

Elevated Trehalose Production Increased Cell Growth After 24 h in the Presence or
Absence of Osmotic Stress Agent

The growth of JP20 was compared after 24 h to that of the trehalose-deficient strain

(JP 10) and wild type (W3110) under all stress conditions. Results are summarized in

Table 3-1. Induced expression of otsBA was marked by both increased accumulation of

trehalose (Figure 3-6) and improved stress tolerance (Table 3-2). Comparison of growth

patterns for JP20 during exposure to KCl and NaCl stress revealed a 5-fold improvement

in growth for trehalose-overproducing cells at salt concentrations near IL5o (Figure 3-1).

During KH2PO4 Stress, induced JP20 grew 6-fold better than the trehalose-free strain,

reaching a maximum ODssonm Of 2.0 at 200 mM KH2PO4. ILmin increased similarly for all


B YC







D E "






Iog [IPTU~~m log [IPTG] (mM) lg[PG(M

Figure 3-5. Optimization of otsBA expression during salt and sugar stresses. JP20 was
treated with varying doses of IPTG during growth in the presence of each
osmolyte. A) KCl (400 mM). B) KH2PO4 (400 mM). C) NaCl (400 mM).
D) Glucose (600 mM). E) Mannose (400 mM). F) Xylose (140 mM). Basal
medium osmolarity equaled 204 mM. Results are presented as average values
with standard deviations (bars) from three or more separate experiments.











Table 3-1. Stress tolerance of W3 110 strains
Minimum Inhibitory Level (ILmm,)


SStrains were grown at 370C for 24 h in M9 media containing 2% glucose and indicated additives. Millimolar values represent the osmolar contribution of each
compound to total media osmolarity. Ignoring dissociation effects, basal medium contained 93 mM mineral salts and 111 mM glucose.

2 ILmm, equals the lowest osmolyte concentration, growth temperature, or initial pH necessary to restrict growth to less than two doublings (OD55onm < 0.012).

SIL5o equals the lowest osmolyte concentration, growth temperature, or initial pH necessary to restrict growth to half the OD55onm of the wild type culture grown
without additives.

SIL,, equals the concentration at which growth is reduced to a density equivalent to the maximal growth of the wild type in medium containing no additives.


Strain


JP1()
W311()
JP2() ()
JP2() (+)


Salts (mM)
KH2PO4
376
496
483
6)8


Salts (mM)
KH2PO4
242
291
347
456


Salts (mM)
KH2PO4
155
162
271
377


Sugars (mM)
Glucose Mannose
452 427
488 469
65() 59()
729 667


Physical Stress
T (oC) pH
44.8 3


NaC1
388
463
519
552


Arabinose
386
386
391
392


Xylose
157
164
159
171


Median InhibitorY Level (IL5o) 3

Sugars (mM)
Arabinose Glucose Mannose
333 26() 247
325 314 324
321 51() 5)8
354 632 573

Density Equivalent to Unstressed Control (IL, 4)


Physical Stress
T (oC) pH
44 () 6 26


NaC1
164
182
385
458


Xylose
134
141
142
153


JP1()
W311()
JP2() ()
JP2() (+)


Sugars (mM)
Glucose Mannose
() ()
() ()
2()3 156
522 511


Physical Stress
T (oC) pH
37.() 7.()2
37.() 7.()1
39.2 6.98
39.3 6.9()


NaC1
()
()
268
387


Arabinose


Xylose
12()
123
123
136


JP1()
W311()
JP2() ()
JP2() (+)










salts (40 to 60%). JP20 also exhibited higher tolerance than either parent strain under

sugar stress (Figure 3-1). With 600 mM glucose present in the media, induced JP20

achieved a 24-fold higher cell mass than JP10. Trehalose overproduction improved

absolute glucose tolerance by 35% (ILmin = 800 mM). Growth of JP20 in 500 mM

mannose was improved 20-fold compared to JP10. Growth improved less dramatically

for arabinose and xylose, with the largest increases in final density (2-fold) occurring

near the IL5o values for each pentose. Overproduction of trehalose was not beneficial to

heat- or pH-stressed cell.

Time-course growth of wild type and JP20 was measured in aerobic shake flasks

in the absence and presence of osmotic stress (Figure 3-7). Although growth in basal

media was similar for all strains, final cell densities for wild type and uninduced JP20

were 15% higher than for induced JP20. Growth rate was 2-fold higher for JP20 when

grown in either 400 mM NaCl or 600 mM glucose.






361










JP10 W3110 JP20 (-) JP20 (+)


Figure 3-6. Intracellular trehalose accumulated by unstressed W3110 strains. Cells were
grown for 24 h in M9 medium containing 2% glucose. JP20 was treated with
(+) or without (-) 0.1 mM IPTG. A) Section from thin-layer plate used for
densitometry calculation. B) Intracellular trehalose levels.























05


0 2





0 0625


003125


S8 12

Time (h)


16 20


I
C
0-

[J
r P P
P


~p- p-
d P
I
V-
O-
0-
D-
4
~;B~J?


1


05


0 2


0 125





003125


S8 12

Time (H)


16 20 24


0125 8

0 0625j m f-

0 03125



Time (H)




Figure 3-7. Growth ofE. coli strains in the absence or presence of osmotic stress.

A) W3110 and JP20 were grown for 24 h in basal media containing no

additives. B) Growth in 400 mM NaC1. C) Growth in 600 mM glucose. Basal

media (M9, 2% glucose) osmolarity equaled 204 mM. Symbols: O, W3110;

O, JP20; JP20 + 100CLM IPTG.















CHAPTER 4
DISCUSSION

Czonka (1989) has estimated that E. coli maintains an intracellular trehalose level

equivalent to 20% of the osmolar concentration of solutes in the growth medium. The

results presented in this paper show that this native regulation of trehalose synthesis is not

optimal at high osmotic strength. The consequence of high external osmolarity is the

collapse of turgor pressure, which is generally thought to be necessary for growth by

stretching the cell envelope during division (Koch 1991; Norris and Manners 1993). In

minimal media, cells counteract this loss of turgor by adjusting the intracellular solute

pool, increasing glutamate levels first followed by sustained synthesis of trehalose

(Dinnbier et al. 1988). Weak turgor resulting from high external osmolarity may have

contributed to the lower growth rates observed for wild type cells during salt or sugar

challenge (Figure 3-7). This interpretation is consistent with the observation that cells

that rapidly produced trehalose under osmotic stress exhibited higher growth rates and

shorter fermentation times than the wild type, implying a more favorable balance of

osmotic pressure. Conversely, excessive trehalose production was also detrimental to the

growth of trehalose-overproducing cells, which actually benefited from mild salt

concentrations (Figure 3-1). Over the range of concentrations tested for each condition,

the largest growth advantage for JP20 always occurred near the concentration at which

expression was optimized, suggesting that a single level of intracellular trehalose

provides the optimal osmotic balance at a given medium osmolarity.









These results demonstrate that unnaturally high trehalose production can

substantially improve growth of E coli under osmotic stress. Preliminary experiments

revealed small differences in growth between wild type and mutant strains during

osmotic stress, which suggested a direct protective role for trehalose; these differences in

growth were increased when trehalose production was elevated to levels beyond the

capability of wild type cells (Figure 3-1). Under elevated osmolarity, synthesis of

trehalose benefited cells in a dose-dependent fashion (Figure 3-5), and analysis of cell

extracts revealed that intracellular trehalose levels (Figure 3-6) corresponded well with

osmotic tolerance. Even in the absence of inducer, JP20 was more tolerant to osmotic

stress than the wild type. This result was corroborated by analysis of cell extracts from

JP20, which were found to contain significant amounts of trehalose after 24 h growth.

Accumulation by uninduced cells probably reflects a low level of unregulated gene

expression, which has an amplified effect in JP20 since this strain lacks the ability to

degrade trehalose once it has been synthesized. Hence, even low rates of production by

these cells are likely to boost tolerance significantly. In contrast, wild type E. coli

moderates intracellular trehalose levels with a cytoplasmic trehalase (Horlacher et al.

1996) and a trehalose-6-phosphate hydrolase (Rimmele and Boos 1994). Externally, a

periplasmic trehalase (TreA) functions under high osmolarity to break down extracellular

trehalose for subsequent transport and resynthesis (Boos et al. 1987). Under hypoosmotic

conditions, E. coli can excrete trehalose via a family of stretch-activated channels that

allow rapid efflux of osmoprotectants (Sleator and Hill 2001; Schleyer et al. 1993;

Sukharev et al. 1997). Trehalose released through these channels is retained in treA

strains (Styrvold and Strarm 1991).









All salts used in this study produced similar effects on growth, suggesting a

common mechanism of toxicity and relief by trehalose. Differences in final cell mass

were greatest for growth experiments involving moderately high salinity (approximately

half of ILmin). Cultures exposed to mild KH2PO4 COncentrations (100-3 00 mM) reached

higher cell masses than those observed for NaCl and KC land higher than unstressed

cultures), presumably due to the buffering capacity of the phosphate anion. Cells

responded similarly to sugars with the same molecular weight and showed greater

tolerance to hexoses than pentoses. When compared on the basis of total media

osmolarity, inhibitory levels for glucose and mannose were nearly identical (2% glucose

provides an additional 111 mM to total osmolarity). Comparatively slow growth on

xylose is characteristic of the wild type strain (results not shown), and may reflect

catabolite repression systems.

Trehalose occurs naturally in a variety of plants, yeast, fungi, bacteria, insects, and

some invertebrates. The molecule's unusual effectiveness under diverse conditions has

been attributed to its unique physical properties. Trehalose is a nonreducing sugar; the

[1-1] glucosyl bond formed by trehalose-6-phosphate synthase conceals the most reactive

end of each glucose monomer (Gibson et al. 2002). The resulting chemical inertness

allows cells to accumulate high concentrations of trehalose without disturbing

biochemical processes. Additionally, trehalose has an unusually high glass transition

temperature, which effectively slows kinetic processes in solutions by making

macromolecular movement difficult (Crowe 2002). Under dehydrating conditions, the

sugar protects cells by replacing water at the surface of macromolecules, holding proteins

and membranes in their native conformations until water content is restored (Crowe et al.










1984). Sola-Penna et al. (1998) illustrated this water-structuring behavior by relating the

stabilizing effect of trehalose to its large hydrated volume. Their results showed that other

sugars protect enzyme activity equally well only after the solution viscosity is increased

to match that of trehalose.

Endogenous synthesis of trehalose has potential to improve stress tolerance in

genetically engineered organisms. There is considerable interest in the development of

microbial biocatalysts for the production of chemicals that are medically or commercially

valuable (Burton et al., 2002). High product yields require robust organisms capable of

tolerating high levels of substrate and toxic byproducts. These attributes are scarcely

present in wild-type organisms, whose native stress response systems are adapted to

conditions routinely encountered in nature. The use of microbes for industrial purposes

demands a new breed of organisms that must be engineered for optimal growth under

specific physical and chemical parameters. Our work presents a simplified approach to

this task in which we have amplified a stress response system that is already present in

the target organism.

















LIST OF REFERENCES


Alakomi, H.-L., E. Skytta, M. Saarela, T. Mattila-Sandholm, K. Latva-Kala, and I. M.
Helander. 2000. Lactic acid permeabilizes gram-negative bacteria by disrupting the
outer membrane. Appl. Environ. Microbiol. 66:2001-2005.

Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Deidman, J. A. Smith, and
K. Struhl (ed.). 1987. Current protocols in molecular biology. John Wiley & Sons,
Inc., New York, N.Y.

Bachmann, B. 1972. Pedigrees of Some Mutant Strains of Escherichi coli K-12.
Bacteriological Reviews. 36:525-557.

Banaroudj, N., D. H. Lee, and A. L. Goldberg. 2001. Trehalose accumulation during
cellular stress protects cells and cellular proteins from damage by oxygen radicals.
J. Biol. Chem. 276:24261-24267.

Billi, D., Wright, D. J., Helm, R. F., Prickett, T., Potts, M., and J. H. Crowe. 2000.
Engineering Dessication Tolerance in Escherichia coli. Appl. Environ. Microbiol.
66:1680-1684.

Blazquez, M. A., R. Lagunas, C. Gancedo, and J. M. Gancedo. 1993.
Trehalose-6-phosphate, a new regulator of yeast glycolysis that inhibits
hexokinases. FEBS 329:51-54.

Bonini, M. B., Van Dij ck, P., and J. M. Thevelein. 2003. Uncoupling of the glucose
growth defect and the deregulation of glycolysis in Saccharomyces cerevisiae tps1
mutants expressing trehalose-6-phosphate-insensitive hexokinase from
Schizosacch aromyces~~hh~~hh~~ pombe. Biochim. Biophys. Acta. 1606:83-93.

Boos, W., U. Ehmann, E. Bremer, A. Middendorf, and P. Postma. 1987. Trehalase of
Escherichia coli: mapping and cloning of its structural gene and identification of
the enzyme as a periplasmic protein induced under high osmolarity conditions. J.
Biol. Chem. 262:13212-13218.

Boos, W., U. Ehmann, H. Forkyl, W. Klein, M. Rimemele, and P. Postma. 1990.
Trehalose Transport and Metabolism in Echerichia coli. J. Bacteriol. 172:3450-
3461.

Bounias M. N-(1 -naphthyl)ethylenediamine dihydrochloride as a new reagent for
nanomole quantification of sugars on thin-layer plates by a mathematical
calibration process. 1980. Anal. Biochem. 106:291-295.










Burton, S. G., D. A. Cowen, and J. M. Woodley. The search for the ideal biocatalyst.
2002. Nature Biotechnol. 20:37-45.

Caetano-Annoles, G. 1993. Amplifying DNA with arbitrary oligonucleotide primers.
PCR Methods Appl. 3:85-92.

Caliskan G., A. Kisliuk, A. M. Tsai, C. L. Soles, and A. P. Sokolov. 2003. Protein
dynamics in viscous solvents. J. Chem. Phys. 118:4230-4236.

Canovas, D., S. A. Fletcher, M. Hayashi, and L. N. Csonka. 2001. Role of Trehalose in
Growth at High Temperature of Salmonella enterica Serovar Typhimurium. J.
Bacteriol. 183:3365-3371.

Causey, T. B., S. Zhou, K. T. Shanmugam, and L. O. Ingram. 2003. Engineering the
metabolism of Escherichia coli W3 110 for the conversion of sugar to redox-neutral
and oxidized products: Homoacetate production. Proc. Natl. Acad. Sci. USA.
100:825-832.

Cheville, A. M., K. W. Arnold, C. Buchrieser, C. M. Cheng, and C. W. Kaspar. 1996.
rpoS Regulation fo Acid, Heat, and Salt Tolerance in Escherichia coli Il57:H7. J.
Bacteriol. 62: 1822-1824.

Crowe, J. H., L. M. Crowe, and D. Chapman. 1984. Preservation of membranes in
anhydrobiotic organisms: the role of trehalose. Science. 223:701-703.

Crowe, J. H., F. A. Hoekstra, and L. M. Crowe 1992. Anhydrobiosis. Annu. Rev. Physiol.
54:579-99.

Crowe, L. M. 2002. Lessons from nature: the role of sugars in anhydrobiosis. Comp.
Biochem. and Physiol. 131:505-513.

Csonka, L. N. 1989. Physiological and Genetic Responses of Bacteria to Osmotic Stress.
Micriobiol. Rev. 53:121-147.

Csonka, L. N. and W. Epstein. Osmoregulation, p. 1210-1223. In F. C. Neidhard. (ed.),
Escherichia coli and Salmonella Typhimurium: Cellular and Molecular Biology.
ASM Press, Washington, DC.

Datsenko K. A. and B. L. Wanner. One-step inactivation of chromosomal genes in
Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA. 2000
12:6640-6645.

de Castro, A. G., H. Bredholt, A. R. Stream, and A. Tunnacliffe. 2000. Anhydrobiotic
Engineering of Gram-Negative Bacteria. Appl. Environ. Microbiol. 66:4142-4144.

de Virgilio, C., T. Hottinger, J. Dominguez, T. Boiler, and A. Wiemken. 1994. The role
of trehalose synthesis for the acquisition of thermotolerance in yeast: I. Genetic
evidence that trehalose is a thermoprotectant. Eur. J. Biochem. 219: 179-186.










Diamant S., N. Eliahu, D. Rosenthal, and P. Goloubinoff. Chemical chaperones regulate
molecular chaperones in vitro and in cells under combined salt and heat stresses. J.
Biol. Chem. 276:39586-39591.

Dinnbier, U., E. Limpinsel, R. Schmid, and E. P. Bakker. 1988. Transient accumulation
of potassium glutamate and its replacement by trehalose during adaptation of
growing cells of Escherichia coli K-12 to elevated sodium chloride concentrations.
Arch. Microbiol. 150:348-357.

Dulaney, E. L., D. D. Dulaney, and E. L. Rickes. 1968. Factors in yeast extract which
relieve growth inhibition of bacteria in defined medium of high osmolarity. Dev.
Ind. Microbiol. 9:260-269.

Elbein, A. D. 1974. The metabolism of a,a-trehalose. Adv. Carbohyd. Chem. Biochem.
30:227-256.

Elbein, A. D., Y. T. Pan, I. Pastuszak, and D. Carroll. 2003. New insights on trehalose: a
multifunctional molecule. Glycobiology. 13:17R-27R.

Garg, A. K., J. K. Kim, T. G. Owens, A. P. Ranwala, Y. D. Choi, L. V. Kochian, and R.
J. Wu. 2002. Trehalose accumulation in rice plants confers high tolerance levels to
different abiotic stresses. Proc. Natl. Acad. Sci. U S A. 99: 15898-15903.

Ginever H. M., O. B. Styrvold, I. Kaasen, and A. R. Stream. 1988. Biochemical and
genetic characterization of osmoregulatory trehalose synthesis in Escherichia coli.
J Bacteriol. 170:2841-2849.

Gibson, K. E., and T. J. Silhavy. 1999. The LysR homolog LrhA promotes RpoS
degradation by modulating activity of the response regulator SprE. J. Bacteriol.
181:563-571.

Gibson R. P., J. P. Turkenburg, S. J. Charnock, R. Lloyd, and G. J. Davies. 2002. Insights
into Trehalose Synthesis Provided by the Structure of the Retaining
Glucosyltransferase OtsA. Chem. Biol. 9:1337-1346.

Goddijn O. and K. van Dun. 1999. Trehalose metabolism in plants. Trends Plant Sci.
4:315-319.

Gouesbet, G., M. Jebbar, R. Talibart, T. Bernard, and C. Blanco. 1994. Pipecolic acid is
an osmoprotectant for Escherichia coli taken up by the general osmoporters ProU
and ProP. Microbiol. UK. 140:2415-2422.

Guo, N., Puhley, I. Brown, D. R., Manbridge, J., Levine, F. 2000. Trehalose expression
confers dessication tolerane on human cells. Nature Biotechnol. 18:167-171.










Hars, U., R. Horlacher, W. Boos, W. Welte, and K. Diederichs. 1998. Crystal structure of
the effector-binding domain of the trehalose-repressor of Escherichia coli, a
member of the LacI family, in its complexes with inducer trehalose-6-phosphate
and noninducer trehalose. Protein Sci. 7:2511-2521.

Hengge-Aronis, R., R. Lange, N. Henneberg, and D. Fischer. 1993. Osmotic regulation of
the rpoS-dependent genes in Escherichia coli. J. Bacteriol. 175:259-265.

Hengge-Aronis, R., K. Wolfgang, R. Lange, M. Rimmele, and W. Boos. 1991. Trehalose
synthesis genes are controlled by the putative sigma factor encoded by rpoS and are
involved in stationary-phase thermotolerance in Escherichia coli. J. Bacteriol.
173:7918-7924.

Holtmann, G. and E. Bremer. 2004. Thermoprotection of Bacillus subtilis by
exogenously provided glycine betaine and structurally related compatible solutes:
involvement of Opu transporters. J. Bacteriol. 186: 1683-1693.

Horlacher, R., K. Uhland, W. Klein, M. Ehrmann, and W. Boos. 1996. Characterization
of a cytoplasmic trehalase ofEscherichia coli. J. Bacteriol. 178:6250-6257.

Ishida, A., N. Otsuka, S. Nagata, K. Adachi, and H. Sano. 1996. The effect of salinity
stress on the accumulation of compatible solutes related to the induction of salt-
tolerance in Escherichia coli. J. Gen. Appl. Microbiol. 42:331-336.

Kaasen, I., P. Falkenberg, O. B. Styrvold, and A. R. Stream. 1992. Molecular cloning and
physical mapping of the otsBA genes, which encode the osmoregulatory trehalose
pathway of Escherichia coli: evidence that transcription is activated by katF
(AppR). J Bacteriol. 1992 174:889-898.

Kaasen, I., J. McDougall, and A. R. Stream. 1994. Analysis of the otsBA operon for
osmoregulatory trehalose synthesis in Escherichia coli and homology of the OtsA
and OtsB proteins to the yeast trehalose-6-phosphate synthase/phosphatase
complex. Gene 145:9-15.

Kandror, O., A. DeLeon, and A. L. Goldberg. 2002. Trehalose synthesis is induced upon
exposure ofEscherichia coli to cold and is essential for viability at low
temperatures. Proc. Natl. Acad. Sci. USA. 99:9727-9732.

Karp, P. D., M. Riley, M. Saier, I. T. Paulsen, S. Paley, and A. Pellegrini-Toole. 2002.
The Ecocyc Database. Nucleic Acids Res. 30:56.

Kempf, B. and E. Bremer. 1998. Uptake and synthesis of compatible solutes as microbial
stress responses to high-osmolality environments. Arch Microbiol. 170:319-330.

Koch, A. 1991. Effective growth by the simplest means: the bacterial way. ASM News.
57:633-637.










Landfald, D. and A. R. Stream. 1986. Choline-glycinebetaine pathway confers a high level
of osmotic tolerance in Escherichia coli. J. Bacteriol. 165:849-855.

Leslie, S. B., E. Israeli, B. Lighthart, J. H. Crowe, and L. M. Crowe. 1995. Trehalose and
sucrose protect both membranes and proteins in intact bacteria during drying. Appl
Environ Microbiol. 61:3592-3597.

Loewen, P. C. and R. Hengge-Aronis. 1994. The regulation of the sigma factor as (KatF)
in bacterial global regulation. Annu. Rev. Microbiol. 48:53-80.

Mansure, J. J., A. D. Panek, L. M. Crowe, and J. H. Crowe. 1994. Trehalose inhibits
ethanol effects on intact yeast cells and liposomes. Biochim. Biophys. Acta.
1191:309-16.

Martinez-Morales, F., Borges, A. G., Martinez, A., Shanmugam, K. T., and L. O. Ingram.
1999. Chromosomal integration of heterologous DNA in Escherichia coli with
precise removal of markers and replicons used during construction. J. Bacteriol.
181:7143-7148.

Measures, J. C. 1975. Role of amino acids in osmoregulation of nonhalophilic bacteria.
Nature 257:398-400.

Miller, J. H. 1992. A short course in bacterial genetics: a laboratory manual and
handbook for Escherichia coli and related bacteria. Cold Spring Harbor Press, Cold
Spring Harbor, N.Y.

Norris, V., and B. Manners. 1993. Deformations in the cytoplasmic membrane of
Escherichia coli direct the synthesis of peptidoglycan: the herni model. Biophys. J.
64:1691-1700.

Padilla, L. R. Kramer, G. Stephanopulos, and E. Agosin. 2004. Overproduction of
trehalose: heterologous expression of Escherichia coli trehalose-6-phosphate
synthase and trehalose-6-phosphate phosphatase in Corynebacterium glutamicum.tt~~~tt~~~ttt~~
Appl. Environ. Microbiol. 70:370-376.

Perroud, B. and D. Le Rudulier. 1985. Glycine betaine transport in Escherichia coli:
Osmotic Modulation. J. Bacteriol. 161:393-401.

Poolman, B. and E. Glaasker. 1998. Regulation of compatible solute accumulation in
bacteria. Mol. Microbiol. 29:397-407.

Posfai, G., M. D. Koob, H. A. Kirkpatrick, and F. C. Blattner. 1997. Versatile insertion
plasmids for targeted genome manipulations in bacteria: isolation, deletion, and
rescue of the pathogenicity island LEE of the Escherichia coli 0157:H7 genome. J.
Bacteriol. 179:4426-4428.










Richards A. B., S. Krakowka, L. B. Dexter, H. Schmid, A. P. M. Wolterbeek, D. H.
Waalkens-Berendsen, A. Shigoyuki, and M. Kurimoto. 2002. Trehalose: a review
of properties, history of use and human tolerance, and results of multiple safety
studies. Food Chem. Toxicol. 40:871-898.

Richey, B. D., S. Cayley, M. C. Mossing, C. Kolka, C. F. Anderson, T. C. Farrar, and M.
T. Record, Jr. 1987. Variability in the intracellular ionic environment of
Escherichia coli: differences between in vitro and in vivo effects of ion
concentrations on protein-DNA interactions and gene expression. J. Biol. Chem.
262:7157-7164.

Rimmele, M. and W. Boos. 1994. Trehalose-6-phosphate hydrolase of Escherichia coli.
J. Bacteriol. 176:5654-5664.

Rudolph, B. R., I. Chandrasekhar, B. P. Gaber, and M. Nagumo. 1990. Molecular
modeling of saccharide-lipid interactions. Chem. Phys. Lipids. 53:243-261.

Schleyer, M. R. Schmidt, and E. O. Bakker. 1993. Transient, specific and extremely rapid
release of osmolytes from growing cells of Escherichia coli K-12 exposed to
hypoosmotic shock. Arch. Microbiol. 160:424-431.

Silva, Z., S. Alarico, A. Nobre, R. Horlacher, J. Marugg, W. Boos, A. I. Mingote, and M.
S. da Costa. 2003. Osmotic adaptation of Thermus thermophihts RQ-1: lesson from
a mutant deficient in synthesis oftrehalose. J. Bacteriol. 185:5943-5952.

Simon, R., J. Quandt, and W. Klipp. 1983. A broad host range mobilization system for in
vivo genetic engineering: transposon mutagenesis in Gram-negative bacteria.
Bio/Technology 1:784-791.

Singer, M. A. and S. Lindquist. 1998. Multiple effects of trehalose on protein folding in
vitro and in vivo. Mol. Cell. 1:639-638.

Sleator, R. D. and C. Hill. 2001. Bacterial osmoadaptation: the role of osmolytes in
bacterial stress and virulence. FEMS Microbiol. Rev. 26:49-71.

Sola-Penna, M. and J. R. Meyer-Fernandes. 1998. Stabilization against thermal
inactivation promoted by sugars on enzyme structure and function: why is trehalose
more effective than other sugars? Arch. Biochem. Biophys. 360:10-14.

Storz, G., and R. Hengge-Aronis. 2000. Bacterial Stress Responses. ASM Press,
Washington, DC.

Stream, A. R. 1998. Osmoregulation in the model organism Escherichia coli: genes
governing the sythesis of glycine betaine and trehalose and their use in metabolic
engineering of stress tolerance. J. Biosci. 23:43 7-445.

Stream, A. R. and I. Kaasen. 1993. Trehalose metabolism in Escherichia coli: stress
protection and stress regulation of gene expression. Mol. Microbiol. 8:205-210.










Styrvold, O. B. and A. R. Stream. 1991. Synthesis, accumulation, and excretion of
trehalose in osmotically stressed Escherichia coli K-12 strains: influence of amber
suppressors and function of the periplasmic trehalase. J. Bacteriol. 173:1 187-1 192.

Sukharev, S.I., P. Blount, B. Martinac, and C. Kung. 1997. Mechanosensitive channels of
Escherichia coli: the MscL gene, protein and activities. Annu. Rev. Physiol.
59:633-657.

Tunnacliffe, A., A. G. de Castro, and M. Manzanera. 2001. Anhydrobiotic engineering of
bacterial and mammalian cells: is intracellular trehalose sufficient? Cryobiology.
43:124-132.

Van Laere, A. 1989. Trehalose, reserve and/or stress metabolite? FEMS Microbiol. Rev.
63:201-210.

Underwood, S. A., M. L. Buszko, K. T. Shanmugam, and L.O. Ingram. 2004. Lack of
protective osmolytes limits cell growth and volumetric productivity of
ethanologenic Escherichia coli KO11 during xylose fermentation. Appl. Environ.
Microbiol., in press.*

Wang, X., J. F. Preston, and T. Romeo. 2004. The pgaABCD Locus of Escherichia coli
Promotes the Synthesis of a Polysaccharide Adhesin Required for Biofilm
Formation. J. Bateriol., in press.*

Welsh, D. T. and R. A Herbert. 1999. Osmotically induced trehalose, but not glycine
betaine accumulation promotes desiccation tolerance in Escherichia coli. FEM
Microbiol. Lett. 174:57-63.

Yilmaz, J. L. and L. Btillow. 2002. Enhanced stress tolerance in Escherichia coli and
Nicotiana tabacum expressing a betaine aldehyde dehydrogenase/choline
dehydrogenase fusion protein. Biotechnol. Prog. 18:1176-1182.

Zhou, S. D., T. B. Causey, A. Hasona, K. T. Shanmugam, and L. O. Ingram. 2003.
Production of optically pure D-lactic acid in mineral salts medium by metabolically
engineered Escherichia coli W3110. Appl. Environ. Microbiol. 69:399-407.

Zhou, S. D. and L. O. Ingram. 2001. Simultaneous saccharification and fermentation of
amorphous cellulose to ethanol by recombinant Klebsiella oxytoca SZ21 without
supplemental cellulase. Biotechnol. Lett. 23:1455-1462.
















BIOGRAPHICAL SKETCH

On August 15th, 1979, Jeremy Edward Purvis was born in Sarasota, Florida, to a

red-haired mechanic and a coupon-clipping schoolteacher who delighted themselves

through selfless outpour of time, strength, and hard-earned dollars on behalf of two lucky

children. From kindergarten, Jeremy was formally educated by Florida' s public school

system, receiving a bachelor' s degree in microbiology from the University of Florida in

May, 2002. He plans to devote his future research efforts to computational and

experimental approaches to understanding biomolecular structure and function.