<%BANNER%>

Building an Episomal Model of Aging in Saccharomyces cerevesiae

xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20110113_AAAAAZ INGEST_TIME 2011-01-13T08:41:09Z PACKAGE UFE0004372_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 8483 DFID F20110113_AAAPGL ORIGIN DEPOSITOR PATH falcon_a_Page_033thm.jpg GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
f1d60e85d18bc57e4a53fb750ae89f97
SHA-1
8d158c88e1cfd7e836ce7608893bc430897e7455
32702 F20110113_AAAPFX falcon_a_Page_023.QC.jpg
6a6452e6695514111f8778d2204abb18
c74b571732908fb3c4a78b0bea96aca5e182ee92
34195 F20110113_AAAPGM falcon_a_Page_033.QC.jpg
233943eff0691a058d8b03f3146d49b5
ca17124481810d7e1d53816b1418f89895fa1946
8221 F20110113_AAAPFY falcon_a_Page_024thm.jpg
b1817082dd63c5d21718d4fca5536bea
d33e4dbd8e603df21546e652b888568cff5f021a
7985 F20110113_AAAPHA falcon_a_Page_042thm.jpg
cf49f2f7d8f58520b65ed600afd86039
de795c340457996907d5ea09c7f8a2d3efcbb492
8201 F20110113_AAAPGN falcon_a_Page_034thm.jpg
14283843ce40f66abca4bf169d9f402f
2f38f2d19823d9286876c43f4dc56d8c7370ec4e
7592 F20110113_AAAPFZ falcon_a_Page_025thm.jpg
ec5716e2dc4bfeb49a59a4c44cefd650
5b949640eda82599f0173fb75dfa446681d4c197
30677 F20110113_AAAPHB falcon_a_Page_042.QC.jpg
2dc72a8e84398271a22f0d88dfe53db3
3e6782af1542123269174d83b344031b21997072
7987 F20110113_AAAPGO falcon_a_Page_035thm.jpg
360a9e237e789cce07e3bc287a31f453
4e9636ab3d8c81b8ab01db3686f2450f05e0c591
33932 F20110113_AAAPHC falcon_a_Page_043.QC.jpg
e64d7d99d0761e8745d8c38e6248366e
dd0b5a23fc8fe249092f665bf3d58f0792b471a5
31952 F20110113_AAAPGP falcon_a_Page_035.QC.jpg
a31bca4db95d1f8e9bd3968a63525941
5ce1a096d74d59f3b596feee52cc917bd4934309
7547 F20110113_AAAPHD falcon_a_Page_044thm.jpg
5fbb10001e7ac7873aaddeff21f4b244
5c33a8d5e6bf297d6f00441de0ff8545ed8256e4
9714 F20110113_AAAPGQ falcon_a_Page_036thm.jpg
c22aba933f5c99478b2d12b1a211fe94
23ce133ac6686f4e86082f795904ccdd7483265c
8457 F20110113_AAAPHE falcon_a_Page_045thm.jpg
9ee89b07a7c5e6208389b34f422922bc
da8492468d6e7212ad78cf2ec5dc80b8216503c7
37956 F20110113_AAAPGR falcon_a_Page_036.QC.jpg
5d30a42a84bae9cb7a7079388f2ac4e9
75bd1b6aa462d1266cf3d14b694cfc86150a515e
34630 F20110113_AAAPHF falcon_a_Page_045.QC.jpg
58258a81663ddcb7eefd477ec6fccc88
dd34ebeee36b83222873916b8b33870a0b1c168d
10609 F20110113_AAAPHG falcon_a_Page_046.QC.jpg
d652a05987183b5860fa18bf38f434d6
b56575ed00953aa0bc0b8934166d679f50dbb50c
8128 F20110113_AAAPGS falcon_a_Page_037thm.jpg
e756eb133eef578007ae3ebe51bd5e2e
e112bfaa15b6ad8c8c9ef8fe1ba104fa2c562266
7620 F20110113_AAAPHH falcon_a_Page_047thm.jpg
826d86927d52561c4bce291335a20656
cf2d27e5e4cc8a5efc92da4b320417352937cae4
34702 F20110113_AAAPGT falcon_a_Page_037.QC.jpg
121a53db9b886c91e0a4c1a338e62b38
4743f7c739ff8118f85691e4e51cfea68bfc631a
30806 F20110113_AAAPHI falcon_a_Page_047.QC.jpg
59c5c3f256ac7da7aa884e95e3a77f82
fdc61fbe160436bf60282e857523889ad6b4dea3
8203 F20110113_AAAPGU falcon_a_Page_038thm.jpg
68831c577a427ab2e342fedc5d8753fa
70a691ab8d0f5a5b51c9c6864ec63c54774d2650
8538 F20110113_AAAPHJ falcon_a_Page_048thm.jpg
ee1095a73fb889b730ecce902c79d477
1e025c2e3e794478f28e429588441e06d7eed1ff
32946 F20110113_AAAPGV falcon_a_Page_038.QC.jpg
5dafbb6d58f5873b7c2183e9a06dfc7a
434a6406401a0a0463872fbb790a6c82575b1145
35504 F20110113_AAAPHK falcon_a_Page_048.QC.jpg
24203fbd955621a919230cb4147665a6
a0591a6c8c7ac04e7e63062bb44790c3efa0e490
8500 F20110113_AAAPGW falcon_a_Page_039thm.jpg
11db3d50e6e51e69c39170ac914fc4bf
3453adcb6d041913f2e3c70da98a582334ba16b5
33351 F20110113_AAAPIA falcon_a_Page_062.QC.jpg
78c5aeae5f9b3036d5e084715bdd22c3
4f24fb8a1fb98fc7f71c6fbc358b77f8e332bb04
7935 F20110113_AAAPHL falcon_a_Page_050thm.jpg
b97aeaef9ad46520697dee38467616b1
1ab937ecc0644501f7e35cf0329016cd756c29b1
34161 F20110113_AAAPGX falcon_a_Page_039.QC.jpg
0d23e675ff163b25c30576e56e5c70f7
5df52557b663168e82c752890b6e85e85119da57
6778 F20110113_AAAPHM falcon_a_Page_051thm.jpg
052a4112e59c0020f3c48971ce2744f2
405d9b2d01a8b9fc1da3f7d0a4b4ef5673046da6
9296 F20110113_AAAPGY falcon_a_Page_040thm.jpg
a82d5eea540f69c1edc258d9873a26ca
2893fe05c8d1a29c17029be66ada21a7af00ace1
6761 F20110113_AAAPIB falcon_a_Page_063thm.jpg
bf903fbe81be94628de385263f5f8511
df6de4be664194185daff960089b0b0f95655737
25866 F20110113_AAAPHN falcon_a_Page_051.QC.jpg
df6ffd510c5a7a4c36f9320328f25731
d3dbaa399103ae7063c402bb814d3fcdd0e75264
8185 F20110113_AAAPGZ falcon_a_Page_041thm.jpg
97d7fa2ddeeadc8df6d4762a09e8c48b
d13e88ca32b8d74fa8648e0072f53e46ec163287
6841 F20110113_AAAPIC falcon_a_Page_064thm.jpg
08fca44d189e49c19d0f5c6ccd005a39
017315307bc9f8ee71da3a4e2cd46331280415b7
5738 F20110113_AAAPHO falcon_a_Page_052thm.jpg
c15d73a9bd93c3463dec7523f64ad1d9
1d1b283332d25bc47e1fc0aee2bd88de86d55854
6868 F20110113_AAAPID falcon_a_Page_065thm.jpg
a45e477b4ea13ddf019fd45926b32017
a4b5bdb602f9b9701a42b385df5c8669a44fba16
22182 F20110113_AAAPHP falcon_a_Page_052.QC.jpg
f02cfc36ce05536cb89427970fec3987
6eb58995b382db8971718aa1c7b1bc8e2b39b473
22940 F20110113_AAAPIE falcon_a_Page_065.QC.jpg
44206b184173b3ed7a65c029d600ea58
4690911119c59f2e242d772ce5118c9f60966e6d
3831 F20110113_AAAPHQ falcon_a_Page_053thm.jpg
b28c675f872dd908caf6a1374607273a
0c85af16256f64faf6aa83e9905c33634138cea3
7022 F20110113_AAAPIF falcon_a_Page_067thm.jpg
acdf6de2732a735672149270add085fc
5f20a18edce42c1f017928df53315e7840be02f5
13803 F20110113_AAAPHR falcon_a_Page_053.QC.jpg
818d6ee8e75672901fc8eb3c953158e2
f4a814b2dbb30a7e643fc510ceb515f0606c97ab
7124 F20110113_AAAPIG falcon_a_Page_068thm.jpg
35b98f0134c119a9d7b3e8e9f6d5b001
b47c463ef0885a0a65e3aa988444d2e035202c21
7008 F20110113_AAAPHS falcon_a_Page_054thm.jpg
08b5ddc464ccddbe627fc7dce30e8e89
dd71d12effe43481e480bc5ada15274951f0186c
24215 F20110113_AAAPIH falcon_a_Page_068.QC.jpg
688cc77353676a85ddf5e0050c894833
8eaf3154124370b535da3da4e21cb8e85e30a852
26931 F20110113_AAAPHT falcon_a_Page_054.QC.jpg
5a8cd67aacb0ae70b8b237d8bf9cfaad
ae60ee9b593ec7d97e8942e48eb19cec21fbf2a9
2869 F20110113_AAAPII falcon_a_Page_069thm.jpg
dccbc438aad9bce833a29c9b3f249ad4
4244c6bccb2e39ca613c967bff7fc0c95cbf659c
4922 F20110113_AAAPHU falcon_a_Page_055thm.jpg
ec47e4b4a5ca5b428ac4374e056e0300
f26041b3fb0c08729ed997d925b1942240a3bd29
10672 F20110113_AAAPIJ falcon_a_Page_069.QC.jpg
b4d4391b403aae6eb02e37740a737770
b27112da4ba85ad5e8827700c0496f3b16487874
7042 F20110113_AAAPHV falcon_a_Page_056thm.jpg
20ea1f8cafcd95ea09678dd59a5b7838
d15f75d1e74d1cef9528e42d34409f9f6c0b5b46
30969 F20110113_AAAPIK falcon_a_Page_070.QC.jpg
d4f5969ad36e3e10ea168ce0cc857a34
92c7244dd2038ec98ecc6b695efe78ceeb182c4c
8702 F20110113_AAAPHW falcon_a_Page_057thm.jpg
23fe0af6397e0d7c4617cf091d750e0e
c48de3db10cce4a67e6cf99ffef930cdcdf8a3d5
5774 F20110113_AAAPIL falcon_a_Page_071thm.jpg
b630b03c6cfff2c4a086a0f3c9c5f161
8d4790a4858978d41b2b8e3387e0f18c42eda713
29430 F20110113_AAAPHX falcon_a_Page_059.QC.jpg
c4ad4516afa9b80a5ebd81960321fa13
8bc7cd3611a7ca546f4bd5e88ff99937e9250ff8
33918 F20110113_AAAPJA falcon_a_Page_082.QC.jpg
dd9d40f9d9cf0933aac31db6072ed5b3
7d7205ccc8f2aaa1605b4fd7c6c81a082a7b1b94
66070 F20110113_AAAOFK falcon_a_Page_010.jpg
9ec485b66078f04008d029d330811509
d10c4383add13b4461238c8386c4a91f969d1a44
7565 F20110113_AAAPIM falcon_a_Page_072thm.jpg
5f63c90e01117452b228b9238a6cd994
848b51cc5a05b4d37e0a97af53e0612d3feb57a1
6627 F20110113_AAAPHY falcon_a_Page_061thm.jpg
eb110a2ac72f876f6f305db9cb84167d
00bb929c0f514c48c20c296d3933b3f59d497f3f
8238 F20110113_AAAPJB falcon_a_Page_083thm.jpg
0f3595a17ebf89dc6c543cf348186914
3ed194a2d82af4682fa811352d594a6fa9f42737
91778 F20110113_AAAOFL falcon_a_Page_030.jp2
11f1b75eaafc3195c3421d150c2dd00e
eb0f90e2ac4d5a0815b90a4f3cc26148787800de
7968 F20110113_AAAPIN falcon_a_Page_073thm.jpg
e9a72a420f14167e6d3ac73718606984
e8d5a8ecab093e5924a67e4e814879222df02092
8410 F20110113_AAAPHZ falcon_a_Page_062thm.jpg
48de5d97bb0097e44b226500bf37f8f3
ed4a359ad8423952a08b8423aa68d4b4928eea1c
8991 F20110113_AAAOFM falcon_a_Page_096.pro
73cab161a86b9b83760cb9173b038479
04276974062b88514fe43f07a81fcba746da8c14
5112 F20110113_AAAPIO falcon_a_Page_074thm.jpg
f0af834dc3db40def7c16deb1cf3bf9c
f29906d2b208c954184208d6394255bdcf73e3b6
25271604 F20110113_AAAOGA falcon_a_Page_058.tif
5fba636f692ed27bbaa9b2cf654bcdb4
7fe7e8069d43aa12073f5d927cb47d8d434cb7e7
32347 F20110113_AAAPJC falcon_a_Page_083.QC.jpg
423055944bec5377bdd0af226274ab2b
5301c456ca9d246e6cf7e431cf334a635a575dd6
97099 F20110113_AAAOFN falcon_a_Page_023.jpg
51226fe4cb3b7d2e7d5d7acb31a0b4e3
588fde39ba3d7639ee980a83a6c702283214ee5f
6168 F20110113_AAAPIP falcon_a_Page_075.QC.jpg
54ebe5327656f474418898683c25f508
848aae754e145b6e3bdfda3341338e58c3f00b0a
427 F20110113_AAAOGB falcon_a_Page_097.txt
933448bd20d29d2f117e0a75e5e65a72
6f9fd652f696acef87ed81ca69f83404a65c2115
F20110113_AAAPJD falcon_a_Page_084thm.jpg
8bd65ba976bbe40b09d460de7c260ded
9a578596d269882271c38e59e85787fb43604a27
5984 F20110113_AAAOFO falcon_a_Page_002.jp2
984d4a4b2ff2a5c3b06ef566e9584fba
a8640f95ab55a53d0e4eb886b28e51c2d9f67e06
7640 F20110113_AAAPIQ falcon_a_Page_076thm.jpg
01c3f2b2f9c90d54fe0d956f805110fe
feeac888f1d4f788e1c2a51b6d0b6c27578bd01d
47286 F20110113_AAAOGC falcon_a_Page_073.pro
1c6e816ec00359c8fa28898c7b122195
a79f7317375987e409deaba83d0e5fab60d6b3fa
34806 F20110113_AAAPJE falcon_a_Page_085.QC.jpg
5a3fb7ddecb65286501da0a213b3a586
be11c7f9767fd29e08fa44b5c718ea9b5c7899fb
F20110113_AAAOFP falcon_a_Page_008.tif
4e49cec6091cc5ae4ff90a110c178946
6aac32ef349b91dcbba1dc0e57579ae19bab941c
30704 F20110113_AAAPIR falcon_a_Page_076.QC.jpg
c8a5bff54ec52ea465d1d33fcce3d510
34da44c0881c6e81bd0901446eec3a9911d50f5f
10017 F20110113_AAAOGD falcon_a_Page_117.QC.jpg
e7fc3fe5f34fc165bdce4841c17cb888
814236d67cf0f07941f107be280696f5d342c199
8569 F20110113_AAAPJF falcon_a_Page_086thm.jpg
d06c0b24c3540681694829c8f2cf6584
86a9bb3b8fa25b8a2b66c5f36b7b224020c97722
366 F20110113_AAAOFQ falcon_a_Page_102.txt
9580478804c0df7b5edd5b56c38122cf
1f65c55de7bdaa9d6c5567ecc07e166ae92623af
6346 F20110113_AAAPIS falcon_a_Page_077thm.jpg
76d89855f459361f7cda4caea89b5ae9
c1328f8d60c5bc74ae43f8285ed834bfa7387fee
F20110113_AAAOGE falcon_a_Page_068.tif
4feaddca7e087968ac95c7d9b21da6fb
a4ab1876bae4505d0f0ac76f9cc343e9096a8a10
34416 F20110113_AAAPJG falcon_a_Page_086.QC.jpg
1d595069b422af418704a94866647a37
21297577bbbbe4bd0b81ab35cea6defb75800145
25190 F20110113_AAAOFR falcon_a_Page_066.QC.jpg
cce532ec04207ea7ff2952d617a1c0d8
8f75aa54baaecc70f8b1d08dbda37b4dd0bf8bb0
6788 F20110113_AAAPIT falcon_a_Page_078thm.jpg
0bf40771087d7c7da41bc1ddc81d9c1c
c2e9bc89de6c7b4c5f603353786257bb94a10e9a
60957 F20110113_AAAOGF falcon_a_Page_088.jp2
73d7252b0ba55b7e4c7f44e0a6a93f15
98503d0ce7ad20e7262cd4c324164c927527d500
8511 F20110113_AAAPJH falcon_a_Page_087thm.jpg
b2ee223353a7fa57488c73c871cda056
315caad7fe43336b469d5c51f9d8d1be866bf572
5746 F20110113_AAAOFS falcon_a_Page_017thm.jpg
ecd617b90b24e56ce835dddf60068b9b
63cd4dc0ddc23cc8babdf28ab9680dd6f34cd719
23948 F20110113_AAAPIU falcon_a_Page_078.QC.jpg
c1740bb2d03f2075bd3c5299184fd3e8
eaa5e450795e6926357d7445cc68e72882101593
15612 F20110113_AAAOGG falcon_a_Page_106.QC.jpg
368c31a26a2c78adfd42051f09d67533
3052c7ce222cd39b600d21918f5f3e54e5dc01bb
34825 F20110113_AAAPJI falcon_a_Page_087.QC.jpg
021ccff338db30913b9bb7cc93d8bb23
e8673804b34618b3c6c23aa2b3d9017a0bbf5ab5
4425 F20110113_AAAOFT falcon_a_Page_004.QC.jpg
4bd12b31aca8ba1253621de67e7c45b7
95946a73c3d99dddd594e6e4333292edb08b4c48
19522 F20110113_AAAPIV falcon_a_Page_079.QC.jpg
8dab8fe771084020e06cfca22783584f
b1355092f6c8c97c70d5c6e7268fd4686852d380
50312 F20110113_AAAOGH falcon_a_Page_086.pro
20e530672f26a14f2a4dcf2ff66ad87c
ac98c28b706be14d685991fa16003104b10e8291
4741 F20110113_AAAPJJ falcon_a_Page_088thm.jpg
ecb122b787ab1564b802c6e2608c73f1
446052457c7eeb1490140a93eb3d307df4455f3d
101218 F20110113_AAAOFU falcon_a_Page_047.jp2
47766bad874e49cf421aa6377f038438
248c86462a488aa2178ec8f0e51afc190d3304f8
1061 F20110113_AAAPIW falcon_a_Page_080thm.jpg
d2c792c40e003865309b0243505c12a7
c4cd5d5dd640c5bb027e452ac0b8b1a1e95b8617
46483 F20110113_AAAOGI falcon_a_Page_076.pro
48fa058c00de2e2522852e9ff1aba757
eb1f93ed84b61e8abb50340f8fba9244e82ca594
18915 F20110113_AAAPJK falcon_a_Page_088.QC.jpg
0607484cdfffa554e0d6fd68d8e342af
492007f81ccc9f06ccfd0bbcd9b2d461193a4af9
8626 F20110113_AAAPKA falcon_a_Page_097thm.jpg
cbe05fb075da06c8ca198d45dff5827f
44360b3a9a0ed480f6b1159359a8070ddb4cbbf8
729892 F20110113_AAAOFV falcon_a_Page_077.jp2
44d97ec3ca29984748f0de532172728f
aee73261431d146c8b68f109c18f781768f13a3c
3766 F20110113_AAAPIX falcon_a_Page_080.QC.jpg
06d24eab2514d99ce1d9d638e0be3e9c
ee1fe42c6a0cc68bd1864dc01d595febea8a5ea9
8019 F20110113_AAAOGJ falcon_a_Page_102thm.jpg
d7649e3d3d5696fa5b85e3d08b9696ba
165986320f61f76e3a24fe58a5eb81c85da9bd0c
6878 F20110113_AAAPJL falcon_a_Page_089thm.jpg
72e6e1354cd12c6d42035c97267c5067
0088e78cdfd547dbcbb444cd35c64ee836215625
22225 F20110113_AAAPKB falcon_a_Page_097.QC.jpg
c5a84bb8623d1e0318fdf99ea9c2b2f8
50f88256583822914c205e5fe49b3399b6c06bab
9659 F20110113_AAAOFW falcon_a_Page_099thm.jpg
50f1d08181d95441c865021ff1aecacf
aa48fd130a3c51b11368865d00858ff0025c0d2e
7457 F20110113_AAAPIY falcon_a_Page_081thm.jpg
08f674a6fa80b1592b9c665f48766dad
863bd8376eb237c2820fde90ecddcb741963e6ba
46702 F20110113_AAAOGK falcon_a_Page_115.pro
6a702a845f73eb48864a1a0945e2a132
f7a2eba42c2d2519b2786c408f378d9656dbf3a2
27734 F20110113_AAAPJM falcon_a_Page_089.QC.jpg
47f822e5d6ac1ed588b2ce73e690a1ca
43cc09b4ecd7cbe5d2cf16ee06a723c648f8247b
8111 F20110113_AAAPKC falcon_a_Page_098thm.jpg
f5ec48e1e53af9d02e83d9784b0824c0
fbe40756c702eab0e71befb94cebae407a34de90
26984 F20110113_AAAOFX falcon_a_Page_111.QC.jpg
6c68a05dd6fcf8cc3e3ae0db038250be
4abaaec62d20ba8b2dc9b5173d95687f9a08e887
8331 F20110113_AAAPIZ falcon_a_Page_082thm.jpg
da3728a5d5a9e1d6bb8db1d87bfa6ced
d19fd28ce31bb8a55393b1fea05fa290178d88df
31453 F20110113_AAAOHA falcon_a_Page_028.QC.jpg
88cee1ecdc3b4c6b43fd523b1302b676
495d0b6c5fced1bbc04986d1e1949da30b26c8d1
12132 F20110113_AAAOGL falcon_a_Page_100.QC.jpg
ee89a388c9d2ff2da0a10f682bdd58fc
26748d597503c1aa152dcb7de39596558eb7531a
7402 F20110113_AAAPJN falcon_a_Page_090thm.jpg
80f0f856b8ea2c38414785a73b87eede
a11e2cdebad06282081ca88ecaf2c59004eae92c
1053954 F20110113_AAAOFY falcon_a_Page_045.tif
b7630c41e8a03bc2cd6c492530d53542
1ef51ddd484a1d49f2878d2ef4c6922810d4bff7
1012977 F20110113_AAAOGM falcon_a_Page_061.jp2
330b36acc48e94ba4f2a5d972f95c18f
0d6ad57046ab66e2ddcc3bf4d0b53858753d70d4
30891 F20110113_AAAPJO falcon_a_Page_090.QC.jpg
9be68592fbf1b109a68831ebc794721f
9001bec0aeda5151f24e76b2f5485c96fc1eb6e7
20928 F20110113_AAAPKD falcon_a_Page_098.QC.jpg
54664a443a587be5c133ca635ee94df7
bf7b325665995b8c111d6191dc716a1ed328d638
F20110113_AAAOFZ falcon_a_Page_106.tif
7eea5781bc52b6202a6ce1da8918b4cd
411e5abc066e201ef38d5756679830870241aab9
623893 F20110113_AAAOHB falcon_a_Page_065.jp2
a44f2570697676098316a26e44b75dab
1f254444bcd4944a769dfc576a16f6c7af7b9ad4
27311 F20110113_AAAOGN falcon_a_Page_072.QC.jpg
e42c51e318d44f449bdcfa3939d59e1e
db09d4afbe22cc0594b118837af8278844494519
8444 F20110113_AAAPJP falcon_a_Page_091thm.jpg
61221a08fcc209fddbb9bc0a31d5101a
272177784d20eedd1c155ebeab5101c06026e644
25329 F20110113_AAAPKE falcon_a_Page_099.QC.jpg
8f38f0964dcd69bdb89a854a9956925e
229ddc608a4b9cdd676b7f27dd1163f51ea3bfc0
33908 F20110113_AAAPJQ falcon_a_Page_091.QC.jpg
4e77c280494dcee316232718ab1e4a04
17ae8c6fb11383df9d5c8d96a700c1440114a0a7
5627 F20110113_AAAOHC falcon_a_Page_079thm.jpg
e3c8ebd7e462fd842dca709ab90ce409
a2e356f44760d716eea7bbe80b961191ecf5cec2
6838 F20110113_AAAOGO falcon_a_Page_011thm.jpg
2ce32ac0b65e2cdc3f2d9520befa4632
75e0e2fee3477a7288ddee54d6521c2546594402
17514 F20110113_AAAPKF falcon_a_Page_101.QC.jpg
5c14f364c4e75405dc5baf107b744e4f
ad610fc991a2fe58fea85f1b072bcd1f82bf7a27
8579 F20110113_AAAPJR falcon_a_Page_092thm.jpg
02edbc95aac634f705a49a794ff7f553
6a389e019f288c57dc29608a351cf46987803356
33357 F20110113_AAAOHD falcon_a_Page_024.QC.jpg
f8b50d41d94fc1f408871be0a2f0ada9
89a0ae01fc45dfc6ecd31091176acc724c738f36
90643 F20110113_AAAOGP falcon_a_Page_013.jpg
df4545173f04058506ef448e3b227ff0
1d6f8e27b709d433c52b3134921376f65b93cd29
9782 F20110113_AAAPKG falcon_a_Page_103thm.jpg
7015b5ab4daeb0b8564cbdd5c192b057
d9f8afd029fc54b7cdc323a1a8bd6fc07ea84606
36292 F20110113_AAAPJS falcon_a_Page_092.QC.jpg
7ce4050c86b08322531dbeb35f86cdf5
2c6a22afbc9bb4dbb5af2f638edb8d00e35c4694
F20110113_AAAOHE falcon_a_Page_101.tif
3cdc0ba2ec14ff7a0ced7fd7654b4005
ea4f3f460870330bf5a7dfc1194532199895e681
32100 F20110113_AAAOGQ falcon_a_Page_049.QC.jpg
5357abb5ccf50094755574229b097af4
fec1db35530738912e4260e8c7d329ed9e9bc435
25585 F20110113_AAAPKH falcon_a_Page_103.QC.jpg
8f41f66026c8e4507f6a2a07bb4b9693
626cfc15b87300b6c335cefb6e284e4f6e18d4e4
34227 F20110113_AAAPJT falcon_a_Page_093.QC.jpg
09cca36662d939c12a20a708727d4e2e
7d1acfeb175a6c1f3ff4c800c2192a7e9d4ae69f
20405 F20110113_AAAOHF falcon_a_Page_071.QC.jpg
ba1f71f3df7033c757365f0b5cbc4eec
639c7803a0fbdcc057f7aa3c4e345f04c33e1653
23310 F20110113_AAAOGR falcon_a_Page_064.QC.jpg
12aa6c04aa74929044b72d3d6d084960
c250fa5a87eb04e83e1c26ebe3ae4d45dbc05a98
5508 F20110113_AAAPKI falcon_a_Page_105thm.jpg
78cfc2357a048a069ed62843bb419083
46b2d27455a4bfcf3db416543d4a6f82a15f703c
8196 F20110113_AAAPJU falcon_a_Page_094thm.jpg
93c962d0ef31083dae23915170280953
94a6bba63218a27e198026892ade576468d85c5c
F20110113_AAAOHG falcon_a_Page_112.tif
db0aefadc623549f66919ba416ecd2cd
d408f25d9b38c1347c2d37e6718fb29db954fb79
18837 F20110113_AAAOGS falcon_a_Page_074.QC.jpg
d938d3f4c285eea9a4621d83af0bc927
015c8b2af542415fe6416db6bb60c3e6265a901a
18440 F20110113_AAAPKJ falcon_a_Page_105.QC.jpg
f8e8f3245ca112e2ce9236907b7d2848
54154d0d86c8266dce040ee635d1de9e0dcd3610
31705 F20110113_AAAPJV falcon_a_Page_094.QC.jpg
8a07fd2f08fc6341ad0a4e53a7b255ce
203b647b064027d99523261158215965ec77b304
F20110113_AAAOHH falcon_a_Page_116.tif
46ea5bfabb9cbc1f60f8cedbf109967d
41fac7b0e1da010b9e877a3b561a514a4df9f925
88229 F20110113_AAAOGT falcon_a_Page_030.jpg
96128015cd6d6ab54cecc79baed85329
3ad1939cf854da3519c36813bc731fafbc275817
4852 F20110113_AAAPKK falcon_a_Page_106thm.jpg
94a9833df8e782081fb1aa9dfab94d4e
e537886519e9b2e9dbede029d89333ae746bd830
990 F20110113_AAAPJW falcon_a_Page_095thm.jpg
6a440c39bff5a6052a1369c0ebb846ef
22245846de32e35271daf5934dba42d3a154fa1a
38950 F20110113_AAAOHI falcon_a_Page_027.pro
cdaf3d48ab89f8cc92e7f72bdd722d2d
3fd0b497523ff8563562c0f50d26119ee03f74c3
33907 F20110113_AAAOGU falcon_a_Page_058.QC.jpg
0c5f0a87de749f13b1ef070359d25dc6
05b206e7d4bdb651e9dcdd57683031c8a477337b
2709 F20110113_AAAPLA falcon_a_Page_117thm.jpg
4258689ecdfe783165383143841f0a05
05dead4af3e672f87e6aafe08f1539e653998cca
5190 F20110113_AAAPKL falcon_a_Page_107thm.jpg
9d9e25e8a3d5bd86fe693608e53c8f2b
5073438b344dd247a9a0b4677b892be2bafcb57b
3402 F20110113_AAAPJX falcon_a_Page_095.QC.jpg
dc10d3d030c32d20ac221a751aa227ee
2c4f437e8743a5bf2a6ee4f3c36bacf8326ed489
43530 F20110113_AAAOHJ falcon_a_Page_113.pro
1c01459d12132355d592466c1f0d571c
810f88aaff0aa6b62f174fca3ea82261a874bbdf
F20110113_AAAOGV falcon_a_Page_039.tif
143f076212f73ff3797114cf841d0fc0
601065e1631e350fb8ddc58cb6e384bff78b24d6
135546 F20110113_AAAPLB UFE0004372_00001.mets FULL
2e164b436f1f0739e0a176730caa4fc4
cba57c1370cc556167eed94ed3e857621199ba65
21202 F20110113_AAAPKM falcon_a_Page_107.QC.jpg
fa432e2df44ed2a125a5a5113b1e1bdd
dbc98f03f78cd527456027c7d43684a708aaae83
9619 F20110113_AAAPJY falcon_a_Page_096thm.jpg
3d897a5630d1d7a64158cd105652ff1f
e00648bafcf98301138630b64926837f71c24a98
1840 F20110113_AAAOHK falcon_a_Page_013.txt
5f73cdc91419c0ca4b7c00a5c564b098
e018df0e494d00d20681b214e2f80c643f48c1f3
8778 F20110113_AAAOGW falcon_a_Page_059thm.jpg
df539cc7ae657821f13d226b5465160b
6c93b808e21144ae939f7ce281e8af542faa2eb6
6065 F20110113_AAAPKN falcon_a_Page_108thm.jpg
e4e30930d643715dfd690a950e1de01c
499f869e2914591ea1977c0d934806eca90b834f
25115 F20110113_AAAPJZ falcon_a_Page_096.QC.jpg
743533e01580c25008612411fa519680
61792c2ed7b433cc53ae0696e8f025fc9ac1dde6
1633 F20110113_AAAOIA falcon_a_Page_089.txt
c329043677553cb671a2e4c5779d0df4
e207303262399972bc6f2badf513be26493b8548
37480 F20110113_AAAOHL falcon_a_Page_040.QC.jpg
7df30af200df6419f68aa9547553f83c
519c77354cbbc1b23fa538a6953e8fa2419e5195
F20110113_AAAOGX falcon_a_Page_105.tif
51cb1a23793aeb6f8e18adc9dd4d1e86
d78f31fa45f957d3f2e74a01f64ec5e125ba5874
20583 F20110113_AAAPKO falcon_a_Page_108.QC.jpg
13fe97abc810d01b75a21e7238e43c32
6b2a61ceb9069f6385a3375faa69d06f199fb850
27408 F20110113_AAAOIB falcon_a_Page_011.QC.jpg
b6d4e08bf738d4179488664fd6c9a166
ee554eb4ee752871c290400892bea76de01ee053
30268 F20110113_AAAOHM falcon_a_Page_044.QC.jpg
d016af75881402e692915512e52fa9ae
c8c4522378983ce334b3921f7d549bcf503cfdfe
38099 F20110113_AAAOGY falcon_a_Page_018.pro
a5c3928ddf1965bb57ebf1edab53a8b9
12404294c600a52af4e18234ce66dcebed0e361c
6872 F20110113_AAAPKP falcon_a_Page_109thm.jpg
a045fd51c25d0d1eebbbdc0f24d04e82
510a301cf0e39b39cc669c93662bd50ca8decb6f
5179 F20110113_AAAOHN falcon_a_Page_104thm.jpg
0414a9804aee720b6b63486587a5e82d
0bc376f1e376bab58add54281e0248f52d05c58a
F20110113_AAAOGZ falcon_a_Page_047.tif
2529394bd51206a4b3469590036692c6
eb2020e2be374ff915584afe5c9d8e6a72509d8e
2117 F20110113_AAAPKQ falcon_a_Page_110thm.jpg
84bbdbfb6dab1f528958065ebacc2286
ddf3233cd1ca61ef06a40b4900022a4eb8df35d7
96374 F20110113_AAAOIC falcon_a_Page_090.jpg
6f9c7282381c50c1ee6fc1d733d90a02
e4955c9e26086109f6b2a3bdd70a9fbcdb805cdf
F20110113_AAAOHO falcon_a_Page_083.tif
35b03f60b5f02d6af5bfd5f5b1269007
789a7c68af8adf9d0a49c92bdbc53607da0e1016
7666 F20110113_AAAPKR falcon_a_Page_110.QC.jpg
c48bbb4bcd765d920e204d40dc4f91f8
c511850c2b56f87f49364e6ae2399cc11b5b3b05
28738 F20110113_AAAOID falcon_a_Page_112.QC.jpg
38e8e5c503fe25eb0e5a4694bff9faa0
d8e1a05c35b19ada4da6d7b9d13b48f779455f92
F20110113_AAAOHP falcon_a_Page_021thm.jpg
9e579e791a5fb175c4ff6f925c3f314f
c5c702102cade67f8266f97fcb2716274d70eca0
7895 F20110113_AAAPKS falcon_a_Page_112thm.jpg
538d67f44f978ee894fc99a6699cac6d
9ff59838dcab1efbb1e3e6bf1943a38a897a8354
8006 F20110113_AAAOHQ falcon_a_Page_001.pro
4dbf12d066d5565077baac02b0cce89c
d7354d1d0e5ca57c9eb0519ea09a4e9f38dc2469
F20110113_AAAOIE falcon_a_Page_087.tif
7a48abac4f0751d73fb73d5fc59f6367
0a8209986bcd197acf9716d1d4052fd2230ef75c
7717 F20110113_AAAPKT falcon_a_Page_113thm.jpg
eb0c156a302a09cdbeb145e6c183ca0e
301bf28c736034f61d787402ea987e9a136eea11
31656 F20110113_AAAOHR falcon_a_Page_050.QC.jpg
ed3bbf480e4b22909648e92ddc1940a3
78f6cf402e2887d29ae8135c32330de6e9123ed6
106640 F20110113_AAAOIF falcon_a_Page_060.jp2
eb2b8824ce18449304ba33bb3daf3e66
1c8de0d86c7eadad14569698c53e7b9afc3638c7
29647 F20110113_AAAPKU falcon_a_Page_113.QC.jpg
caa9c69e9f3b366dbeb6bfd60e9e802c
665c2b730ae4a9a1a2d1ac7f6f97544797f053c7
11105 F20110113_AAAOHS falcon_a_Page_080.jp2
7214f40798bc0d6252be260cfff6f253
300c947e900fff71fba2180e30d7fb85bb5a24af
24666 F20110113_AAAOIG falcon_a_Page_051.pro
f21038c2b571fafef681ea4083e912bf
6e8a93c2c83f8417d4c7a788cfece1ec2909777e
31972 F20110113_AAAPKV falcon_a_Page_114.QC.jpg
7f9e61a32d85f006042d0360abc9d132
3c772d9b20bf05adbfa3649f8b115b5dc225fd50
107235 F20110113_AAAOHT falcon_a_Page_062.jpg
a692f5734307d99fbe62f48c1a97d3a2
eb4b78b6337cbc194060a4ce66687644ff8ab079
F20110113_AAAOIH falcon_a_Page_070.tif
bd438c85cb4b53d082a09889553ad3ac
cce8fa8b01a7ea5123abc80afc322cacbf25347a
8143 F20110113_AAAPKW falcon_a_Page_115thm.jpg
7e0efc3eb97d60971c49c1e50f7dfbf3
c021fff8a0ed704b567021b011a64c4e9af6f617
123084 F20110113_AAAOHU falcon_a_Page_049.jpg
f0a4203cb31e9448aa9329e72eb57d4a
201d2ef678dbb538b9d52ff870e803118c6f1613
533 F20110113_AAAOII falcon_a_Page_117.txt
bd5f35e433df3410826ba3bddd98ec6e
c7cc448c2e813a388f35c3bd3da378731e775e9a
31551 F20110113_AAAPKX falcon_a_Page_115.QC.jpg
3701d39036a99d7eb22828d538012c99
5d4aa2bde0f3dea1b07fc59233d4fdf2b0de2530
107051 F20110113_AAAOHV falcon_a_Page_032.jpg
53c40d6844904de9b3219848444464dc
99714abda06463d6b876bca7079bd253af9ef380
1255 F20110113_AAAOIJ falcon_a_Page_004thm.jpg
cfd029b2f2dbe85cb8fdb346f7a54365
59cf1b4ffbd314a82072d17455e551ef4cb3a473
5199 F20110113_AAAPKY falcon_a_Page_116thm.jpg
f6247077208be65afc0714d379b2de1a
6b40986169b32aeba7d754870279c0e2d84ddb8f
2419 F20110113_AAAOHW falcon_a_Page_003.QC.jpg
9395afcf99b9d021c0ca1176760cc90e
f34fbc9b231f78f82cfa3e0f8b35b1bd06cac3e7
8577 F20110113_AAAOIK falcon_a_Page_110.pro
c72485112fdbf628673718867c3e81a6
f5f809155de0f7159ea498ac5402f79694c8199a
20137 F20110113_AAAPKZ falcon_a_Page_116.QC.jpg
b8eb45679f09f7898ea8567ad598f4a1
2a7e8be3492fb56f167b7e177f705d9aabf3c082
26179 F20110113_AAAOHX falcon_a_Page_008.jpg
23009615bbb247b37c0286b2605d1bfc
724a19ac70dd1d3f05ff0c1979130a15d16a9e8d
24029 F20110113_AAAOJA falcon_a_Page_063.QC.jpg
efbd35f17a5ee5060b6dea0814d7137b
3ac91764ac74e83bd841cc813c2a2b06bc02f6c8
84176 F20110113_AAAOIL falcon_a_Page_061.jpg
5fcee0b730f76ed29bad8199187a1f9d
5f61d0c84dae461ba9c45960f63e531ec9c150e1
1386 F20110113_AAAOHY falcon_a_Page_062.txt
834c46946bb719864a50b1926a824f9e
20bda5ce56e6d536002fb5412c7d11c4f2a040a6
15623 F20110113_AAAOJB falcon_a_Page_020.jp2
4525e76e01ad72b45ce5793a8dc134cf
223eb8bd03a97da0fcbc0df0d6a80c88835479d8
8411 F20110113_AAAOIM falcon_a_Page_114thm.jpg
68fbab421ea46ba4b3e84bbbadbd41e7
f0c5b1457fe37b5db731bb647943f3ff02b7f4da
1051986 F20110113_AAAOHZ falcon_a_Page_104.jp2
0e07e43cae318f1f34e1a6a97615940a
7c0b769be511a40b6ad9158bb5d8a6ccaaa7dc76
7704 F20110113_AAAOJC falcon_a_Page_070thm.jpg
0b7b95607d82a85fb46d71f736ca57cb
673583b6424dd2f144d176d3a4ed8eebeda40080
31749 F20110113_AAAOIN falcon_a_Page_041.QC.jpg
adf022aee03d0319ef024cdd78770f11
a1e14e40ff79d0baa3f10d611937597ce821f5b3
6993 F20110113_AAAOIO falcon_a_Page_075.pro
7d46a146a13c6f7d3b0c7075a53b50c2
0b679064461bc20677b01aa4534adf6a36ded98a
F20110113_AAAOJD falcon_a_Page_098.tif
5c4069fefc73535d46471c104546a7e0
efe90909ef02a97162ef35a57dbe90abaec75ae8
F20110113_AAAOIP falcon_a_Page_099.tif
13955b8fcb17c997f5474d821a04419d
0b472ff84cfa032299e0297d85f7fc2afa58e307
3349 F20110113_AAAOJE falcon_a_Page_095.pro
1398e9e968011a154665086f6d03ad37
0c7127c720244695eae4cfbd3bd0c56681086cb8
80322 F20110113_AAAOIQ falcon_a_Page_015.jpg
95a5d78b198727362e91a02c51519a63
269bd75f39f2f7c268b2f8ed38cfb49cee05f839
47684 F20110113_AAAOJF falcon_a_Page_021.pro
52ca7705c42d818e97fd15436095efae
bf4c9e54e8d45fd78c01064dcc14fec5cd3d4837
15553 F20110113_AAAOIR falcon_a_Page_055.QC.jpg
d23b9450c39bc27017b6f6e4e26c6d3d
4ccfaae0875b86b37adecbcb8c3842c34f9b1b04
2633 F20110113_AAAOJG falcon_a_Page_046thm.jpg
79ff4ac63164f8396993c60f6d5b0174
d440c0e45a81a605b5318565c9d005b6ed50e655
44139 F20110113_AAAOIS falcon_a_Page_013.pro
6f7f983abd25da4d47c8aefb9c86cfd8
bd3549893ff60e47d0860970410100adc4fa23ec
1135 F20110113_AAAOJH falcon_a_Page_017.txt
096984c0a1392e302565229e6442fd26
23613366a00c5aa97de39bdb2e1a3197f13be332
77334 F20110113_AAAOIT falcon_a_Page_007.jpg
c5d3260c62b834ddf8d3f95b255532a5
bd276be71c5ff0a4985a4f4c8d37fd8b67558aa8
10384 F20110113_AAAOJI falcon_a_Page_103.pro
466d6d62df44141e47a4752d2ee4831d
f9b3a586460c668fc8c36d135e1ea95e553a533b
486 F20110113_AAAOIU falcon_a_Page_059.txt
94e0f2e86f061557d7a2d1d30decb775
77b4113f598e8270b1d8237cc1b11d466bf44135
7368 F20110113_AAAOJJ falcon_a_Page_105.pro
f8223369d8984515f2e1d850e86b396e
a5bcfc4fc0cdb89ac8f1d38d2a824f764a4f207d
103682 F20110113_AAAOIV falcon_a_Page_023.jp2
304327c366cc10e3fce936ffc59ba705
51bc4c63c1be9ef70fc2bae0f47d968fa44a0a69
8443 F20110113_AAAOJK falcon_a_Page_043thm.jpg
9900c500291de1056890ba3fc9fca430
35da712f0ac66d1e9b1deeba30b331cd93db7f39
211 F20110113_AAAOIW falcon_a_Page_003.txt
426a85e542ea55e92dd47e84b8b364fb
c845cc81297068b2e7299f0fb219df193a0817f0
868885 F20110113_AAAOKA falcon_a_Page_015.jp2
013e0d66fb43f2a32bc0488019fe54f2
da0e191ca80f768f99d7d43515024f3e1b6474e0
973108 F20110113_AAAOJL falcon_a_Page_018.jp2
c8806a6e8542207cc1185e8fb5d37f61
8c6f06d65b9d5f5ea0afc58da37b0b0964a155f4
7899 F20110113_AAAOIX falcon_a_Page_102.pro
15a9c4a13024860d54f62d746f13506d
ab0b635c95c7ebf0bda66f0cffabc2d232b1042f
100693 F20110113_AAAOKB falcon_a_Page_076.jp2
0a4c2c4e8e0ba13e458101a6c63fc2dd
7f867434ee641af88985603b92c373a7b40afc66
25328 F20110113_AAAOJM falcon_a_Page_056.QC.jpg
c473085dd00e33990edcbe44ebf9ae4d
de0c71023ec87f8ff40bc368e60084183f675180
99514 F20110113_AAAOIY falcon_a_Page_070.jp2
aa5a295b7ea5b831deae3bf2eee774d7
06ad5418c827955376d8daeb1598e6914c6d879f
16753 F20110113_AAAOKC falcon_a_Page_104.QC.jpg
ddfd4dc175c49b9dd5d523f42780d243
aa5415e89c6fc10594c919211b8f6bdde74fdb04
86744 F20110113_AAAOJN falcon_a_Page_011.jpg
79f8a2d6f3b73d5c15bf81ba0d6572c9
19b9f665a0186e00c1d938eb6134f50ba21174bf
43934 F20110113_AAAOIZ falcon_a_Page_101.jpg
6a8de4db79d524e6c3a45f78ffbadbe1
6cc4efecfc121bcffd62b751713340c6d0b8a2d1
73043 F20110113_AAAOKD falcon_a_Page_109.jpg
e44b393e8d3bc283264d927dde484a6e
bcc41895edd679224a8cbc91816d1e2660e46f62
F20110113_AAAOJO falcon_a_Page_048.tif
997ee1eef078383fe8f154ff3350649e
a92afcf699709efb7e4da1a9a440c2331a02aa03
49547 F20110113_AAAOJP falcon_a_Page_102.jpg
e2fa1a94be49fd70530c3343fbe2b613
30a8bfdae25a13d6ddf2f29b6b46e2e28d0514dc
40066 F20110113_AAAOKE falcon_a_Page_016.pro
5a3a9971f5de4eac69fc7f473050c98d
0e8ebf740a8bbab9ca01f23c3950bceddcab0523
1051952 F20110113_AAAOJQ falcon_a_Page_067.jp2
83a46709e597bb39f8d5730dc65bc37a
bb36bdc14b03cae71616d61a60fa2e19a24ab40c
105448 F20110113_AAAOKF falcon_a_Page_045.jpg
9c1edaf4e2d9ea54f54c2688809cf9c7
3ad6836378def5b580ee1467251459462ccc70c6
1276 F20110113_AAAOJR falcon_a_Page_015.txt
64a89e5cd0a0c58fb19222d3712aefe0
c5c022f863ec701b85eb82376f85f60b33e74927
8825 F20110113_AAAOKG falcon_a_Page_095.jpg
800ca04623ee6dbde755753f14967ede
b35c3f88169ad833c94914d7ccfdd2f9a0c40d43
72069 F20110113_AAAOJS falcon_a_Page_074.jpg
b5aefb2b7df4884a7934a12509a63ca7
ac9dac5ab54007dbd7b51a9e70d33147eedf363b
1844 F20110113_AAAOKH falcon_a_Page_035.txt
dd9eaa252264022a8b101b09c50f7879
141b388e4bdbf861af5a2ff69b2f78a81cf96324
47081 F20110113_AAAOJT falcon_a_Page_023.pro
6130f89a5518d4bd9a7d28cfd8d0a052
6e96bc107716c96219c9c828eaae785bd80f6620
105434 F20110113_AAAOKI falcon_a_Page_005.jpg
97edb92a78e8c74e5bff32dc3f7d38e9
f6b4ad2f2e0e9441f3650727d0b9047b34c88eb6
93832 F20110113_AAAOJU falcon_a_Page_025.jp2
64f98aef9852c1d1b1a394f72eb7d67e
56271884b422c12560dfea8884687e7c0d424756
19973 F20110113_AAAOKJ falcon_a_Page_067.pro
309274746cf5a8cb47b1735e86c9102d
b6c9deaca79e496a6ac6f4bcbb8a9e428eea42e7
109825 F20110113_AAAOJV falcon_a_Page_086.jp2
86fe1a64ea73b225a8a0a823b78411f0
0e99e86d23d82ed091aec252a77af6fa5a407421
28608 F20110113_AAAOKK falcon_a_Page_116.pro
84205b9f6cc949014d3405c73cf0ebb6
884f78f6de255c33ceac4c10d1400b90fcc4b613
50649 F20110113_AAAOJW falcon_a_Page_091.pro
6c4ab9ad6780a1d2f917109325b92ad9
2ec7b842fcc72dbef5b52697ff05f485b2c19c60
993454 F20110113_AAAOKL falcon_a_Page_072.jp2
704b1d7939ee67040e6a74929573247c
dd2b11b4ccd07ab4d5041a4e6f80b15da196ea7a
F20110113_AAAOJX falcon_a_Page_034.tif
70eae07ffe6bb233386423faeac003d9
a811f08296d7d28e3292da02d28ba9d74dc6fc04
103921 F20110113_AAAOLA falcon_a_Page_050.jp2
a5355e97a9294af09e4e97cff2cee096
5e01bbff27cd2f26f99aa82f806e2a3d55bafa59
7202 F20110113_AAAOKM falcon_a_Page_013thm.jpg
579565583f10ee3b0dde8bc36835b054
dd7ea7a89915b319769834432c81fddcaaa73210
27045 F20110113_AAAOJY falcon_a_Page_061.pro
ca3e7c790191b849292c57b2f404581a
b8cca8120d60772fdbef39145418d2c720d32bd9
95945 F20110113_AAAOLB falcon_a_Page_076.jpg
ff70e0ac81735fdec542bb4d42d0d6ee
74b908b96f97a3fb2cb7ae085bcc532fe8b51376
1205 F20110113_AAAOKN falcon_a_Page_056.txt
78094bb22747ae717dc3f666c22d978f
37151b2960ae2af0bd413ac8895cecd00852eb51
1999 F20110113_AAAOJZ falcon_a_Page_039.txt
b4738821d9791d3e21d078ca0428c6ec
8e2aee3fa7941f1246ec322f5d9fb6a9b22354a7
1620 F20110113_AAAOLC falcon_a_Page_030.txt
71733acfd0c017af137f2f745868d7a1
3539112c36981e36fdb02809a403124016c9b228
1046 F20110113_AAAOKO falcon_a_Page_079.txt
bb9626ac94925d84bd4c911b47d6205d
e25cef1e715bb60748d6c09a7a45a98f25fe9897
F20110113_AAAOLD falcon_a_Page_063.tif
335004a3262daebb99f3a9470b7719ad
3791e580d8148a6df98f83d55b6110b2f11af75b
26040 F20110113_AAAOKP falcon_a_Page_061.QC.jpg
d64c20af983f6086499b469a09db36bd
08ea17ee753aecb406aebfc9322479676afaa4df
F20110113_AAAOLE falcon_a_Page_065.tif
c5649f6475fdfefc510933dd020b03c3
64627b6154933fe4c3b25d528119109886de1a26
881186 F20110113_AAAOKQ falcon_a_Page_051.jp2
a9d04b807c1cc48816fe5204f82c3cd0
cda5ad8b611345a8624bffe7d0af96cc32e8db67
637 F20110113_AAAOKR falcon_a_Page_002thm.jpg
57b4526648ac0a5ef1bc99cc445d2bd9
61489be41b61dd16d575fe1d67387a57b52f9e28
8419 F20110113_AAAOLF falcon_a_Page_085thm.jpg
831721e44b2c501af0e5c00ed372b8ac
9433c2e873a991c2beea3c521b05421d04243bf7
112473 F20110113_AAAOKS falcon_a_Page_058.jpg
3276eb1ad3018e5c9e30592a59ee9755
ab517998d8903c622cd33c66c869672c6154250c
10019 F20110113_AAAOLG falcon_a_Page_080.jpg
c6b3689c08fc69b25bbca75a9eb55724
1089721edcc3971e9645f52445c3b6c90a453ec4
13502 F20110113_AAAOKT falcon_a_Page_046.pro
bbe2dfc2c34a1505f0f8452014ab93a9
1f9b04213145a56f9f78553cf9e2ae55122bf7ae
F20110113_AAAOLH falcon_a_Page_025.tif
6b5ffc162b16384ebb9d91abdbfcc147
c3bd0caa10af7d8fe07be73b3392abffee87eb7e
1051887 F20110113_AAAOKU falcon_a_Page_105.jp2
84e880f4dc3f59762a0c5d700e6a70f5
f3d2df6c317f6c7566b201e8b36c3aedb2480a05
45296 F20110113_AAAOLI falcon_a_Page_047.pro
3a340fa449213b2eeceef249942ab31e
5e0242a3bab3e37e13a2ea747926af92b5bfd52e
591754 F20110113_AAAOKV falcon_a_Page_071.jp2
6cd76f2c5945d49e8effff5d7b869327
b7ed2760f600ab59cd80ba1c587a62cdd6dad931
7804 F20110113_AAAOLJ falcon_a_Page_049thm.jpg
bab0b838cdbebefa47b995ab7230f794
cbe1d5ab714556982d26e94a58c5d6bda4a8a623
113735 F20110113_AAAOKW falcon_a_Page_027.jpg
257e0ef85256236185ceac918ec0c765
dbfb33539d8b02edd50077586bf3c39e369b49ae
26423 F20110113_AAAOLK falcon_a_Page_015.QC.jpg
c41972b3d9e4387477f4dbb4eb99308c
ba2cd0c577e37e6dd04e5b1543d29fc5b00cba6e
62630 F20110113_AAAOKX falcon_a_Page_116.jpg
44ad6ba196af3493580791ef20200cd6
44e1596be28f64239d104ba8aad2240eefe16c11
1321 F20110113_AAAOMA falcon_a_Page_104.txt
c7954fad89156e0bb8d13c4316af38ab
5fe18bb38819fe4118ca927cfc2efcf48052b381
31642 F20110113_AAAOLL falcon_a_Page_073.QC.jpg
d198901f89bafb5ab03c9c920611e675
ef1e736e7d9fa60d4eedac0e1b0e961b41cd0716
3395 F20110113_AAAOKY falcon_a_Page_006.txt
010745bf97918cdbabf72ebf14298bca
cc8acff2798c0592c82e53d812367c04010c7929
27327 F20110113_AAAOMB falcon_a_Page_067.QC.jpg
f246d41cdf9f6a51991ad188693258c5
5f36d15157d16ee457817eb0555fc03369f5298e
2116 F20110113_AAAOLM falcon_a_Page_057.txt
a0bd871efbaeb46cd06a148fba291c97
896e657b68dbb2ed022f7c63c37bf06f1e5df037
124839 F20110113_AAAOKZ falcon_a_Page_040.jpg
3206b17409e6ce73091d6d01ece336e1
9e46caf56915c5d56e788d76fd67381548dd16d5
27015 F20110113_AAAOMC falcon_a_Page_072.pro
6d8ab36123af95b78cf4ff20d389cc74
31a8fd287648f8a5ede8b449e1bbb06f212ca195
1977 F20110113_AAAOLN falcon_a_Page_009.txt
1b87d73ddcbd91b97c539cd9336d3d91
59409dd64822f952d7c473490b89a4ea44c805b2
64383 F20110113_AAAOMD falcon_a_Page_099.jpg
64329112faf6e38ae9ceabfeb42aee67
fd75818342959b09dc4b7aab17360762241ec33e
1938 F20110113_AAAOLO falcon_a_Page_034.txt
1daccdbbcca9dcf42369bad15bdb5cb6
2a5581f7ebc792c0c64b5370482b85d5e529e027
1785 F20110113_AAAOME falcon_a_Page_011.txt
4befff245e02207f3d1845bc1480a7d7
03794f0219f52a55cfc065d7cfaaa64c52778324
21805 F20110113_AAAOLP falcon_a_Page_071.pro
da5b38c67667bf0d7c28fb2271ca413e
8b46a9a99f76a6e76fa87a492413d17c32de6ac3
35862 F20110113_AAAOMF falcon_a_Page_006.QC.jpg
88c35f77eb98933e684958763b4d6d04
43e1cabb6bf57b752287fcb9ffd9fb63604aab63
30425 F20110113_AAAOLQ falcon_a_Page_018.QC.jpg
b033353870c3dc2abc31b56158fd7c06
25d591b60fa28180f455dad2b91db6caec02c2b4
F20110113_AAAOLR falcon_a_Page_100.tif
6e05122a35541759b86eefed154dd975
e3b3acacbcfce156f150c2fe44a64b68bbd527c6
103438 F20110113_AAAOMG falcon_a_Page_022.jpg
d5dbb9e1aa136edb86d859a5bf3957ca
45c53dde81055c2a2db0878fc1734cf1a2539207
45829 F20110113_AAAOLS falcon_a_Page_081.pro
109e3fad3f5b369cab98ac01bb77ed07
aa3a53128ade353fa3a4eb5ad541c5e896bdc7f1
100275 F20110113_AAAOMH falcon_a_Page_115.jp2
6b614657d4ea87276ef0955bd5155c83
b6efba50a5b8021d92ab51eaa6352a02dd5d6098
107813 F20110113_AAAOLT falcon_a_Page_026.jp2
de09a57ef9eeb471464652d38de4b652
cc78846b5b0980c00c296f552aed70747f3c1472
9094 F20110113_AAAOMI falcon_a_Page_058thm.jpg
fa53298d2cb560ccbd97eddbeb7f1616
81e7390151527dd6e5858c06a62a7601e57ba6df
759148 F20110113_AAAOLU falcon_a_Page_064.jp2
73480918fbc9531725f4bf87c1f555c4
ee5ff0d7f0fb8e26c3c824b263c4ad2a8dbd862f
96194 F20110113_AAAOMJ falcon_a_Page_115.jpg
7d733bd1a82a0b1d81b8e9046dd78da1
ee23db8370c32f856170884f451904832a099509
107360 F20110113_AAAOLV falcon_a_Page_029.jpg
eb3865d7328ea4bcde6b9ffb0f378153
af299316bf8c0c9578099c233d0861a5a2753aaa
F20110113_AAAOMK falcon_a_Page_032.tif
3456e87e4af034e0726888ca16b7a4be
e30df9416943dc2f7ee2beed90e522f8900a9afc
19579 F20110113_AAAOLW falcon_a_Page_102.QC.jpg
ab1926dd0711ae4fc231810a4ea0e7de
462cee5c8538a7e21c4ab340f8f086c0c002c05f
1538 F20110113_AAAONA falcon_a_Page_018.txt
49d9dddad21bc4daaaf2b4ff79777d04
f95d1d1af41f57d765c1b56b65277f3d43e96ffd
6696 F20110113_AAAOML falcon_a_Page_015thm.jpg
1f5056625b3c3f6e67710092f1899c80
2cef2d9269ef4399db33deb466933c7d0af59f26
33536 F20110113_AAAOLX falcon_a_Page_022.QC.jpg
e0bf752401003d02a718ab225b869b77
bdc9538ef0aeae60acd3b065718f171384a3ed54
7092 F20110113_AAAONB falcon_a_Page_111thm.jpg
a811e99b3e5655972f048ec6f629ccfd
3e14cf8775b9011f0d0b93440a5bf24130215793
30016 F20110113_AAAOMM falcon_a_Page_068.pro
ecccebdd5dc7e70b18ab9a2d98778597
b0d8623f2109af87e687517bb09b82631ee993d2
1051925 F20110113_AAAOLY falcon_a_Page_062.jp2
a4b70d8eb1c60303a6d5178a6823aaa9
153283d13440788304109cd76a8034eac8c5a4ab
F20110113_AAAOMN falcon_a_Page_051.tif
b65439c4884b4693ac8505606326fb3c
2be80b511db2ae7a61f3dc2eaf322abf0ad1252e
98787 F20110113_AAAOLZ falcon_a_Page_081.jp2
8376ffd64623468efc67ff6cbb1360b0
bc70a2337525a308034bdc82c21108d420076e6c
659 F20110113_AAAONC falcon_a_Page_105.txt
57d436ac10fd5a78190501247c28fcdc
b8a998c1faaf065dd4d6cc0703714e89e588ff51
51261 F20110113_AAAOMO falcon_a_Page_032.pro
a2733039ff6a37f2830bf586bb2744ac
a2fea37ee1bf1d5d8a29b1a593e8a01e0c638e9b
97369 F20110113_AAAOND falcon_a_Page_021.jpg
01d3ee1daf9d7fe4fd8e3a32c3fecfcf
4a6390da4c5bff94eeafdadde8e44975a52dd10a
2275 F20110113_AAAOMP falcon_a_Page_037.txt
cc24bebaa7b2141e18c9aed42e50ce87
883ef3e077fec8ced2ad34f6a525075c2554adef
8522 F20110113_AAAONE falcon_a_Page_093thm.jpg
9acbe660785dc3c1ec27c5b642fa1534
dc7b670f98236e61c08a6422bb142d1a85c8e745
F20110113_AAAOMQ falcon_a_Page_067.tif
1628d7d1cc50f6fb6c6fa191ba749b2c
d4158341626fd2c96fab44f1269670f10c0cb919
8473 F20110113_AAAONF falcon_a_Page_060thm.jpg
940e211852d6701b474f84291892c58c
58a67ad600ea9fe57099d0ce0d9172a43def6b3f
7833 F20110113_AAAOMR falcon_a_Page_023thm.jpg
e49ee3a62eb7fc5f03951251c0948018
02aa9aba82a06cbe9fd6a193bd35eb2ccee76214
30313 F20110113_AAAONG falcon_a_Page_081.QC.jpg
11b14d09ab5c83825aaf1c09520b3586
b19456d4ee0b17204dd27ad70004dc6b910ff0d3
2118 F20110113_AAAOMS falcon_a_Page_092.txt
809d3bf4c94f653e283bd864be2d1ec4
781a675408ebe018946ca53d57ac989802cb7b67
23239 F20110113_AAAOMT falcon_a_Page_077.QC.jpg
5aabb3823226d45c309f764d96dfca3e
7e248f7e1fb4a599a1003272c92eb66d043d57e9
35250 F20110113_AAAONH falcon_a_Page_032.QC.jpg
686590a1ac175b4ae61fea243882f772
043986bf9bb45f94184afa892a3d2a6d4087c9a2
7020 F20110113_AAAOMU falcon_a_Page_101thm.jpg
9a09ac696bd2714658b064007f8b13da
3a906000bf9f851be4015ad3435e7640d2996f4d
7817 F20110113_AAAONI falcon_a_Page_028thm.jpg
bb8eb4ff6c04a7266cf56ddb7fdddd42
415cd6d948e03dc4d7547a4685ea453f88d6b0ad
F20110113_AAAOMV falcon_a_Page_012.tif
eecfd9b9cea5aa1f78b083b983c475ba
42f5e60d8dd3e70e2e2a3571723b4d5ca8cb03f8
71476 F20110113_AAAONJ falcon_a_Page_066.jpg
e62eaf7f6833c29319b6cc31cf6b93bf
e416100f7e1733f448ba0f2986aeae9079debf80
1051922 F20110113_AAAOMW falcon_a_Page_040.jp2
29d022e31266df76dc1f0f3ebec47921
3ecc144ffbe1388104d2c9ff5de05de7025edd2f
F20110113_AAAONK falcon_a_Page_109.tif
656f9ba594ebec6d835ddc8139833e9c
dab14dc31dfdd7725705d2f6b2a19221f2d96fdd
36720 F20110113_AAAOMX falcon_a_Page_057.QC.jpg
d018ab20825d0708b991e7479314b943
be6c4e4374ae1862e5b3571ea0a254a15c6835ea
24316 F20110113_AAAOOA falcon_a_Page_109.QC.jpg
2d07b6bb1d3faeb6bca84e714e0b1b24
3a381106217f474e8e2e51f22c749ae24902ce57
12152 F20110113_AAAONL falcon_a_Page_117.pro
4d53ec937d21ece9a2dfbe019fd25d05
0b15142a99e7b8addcd117c72d72d2f0c0e4091e
1557 F20110113_AAAOMY falcon_a_Page_044.txt
48bdee58d3d16b3e53f734eebf558a30
a83bbae28e1d79e221ee0fdcf1b37e824321179f
37930 F20110113_AAAOOB falcon_a_Page_031.QC.jpg
caf44daaa8d7715e41b85e03192f96df
35b5e0e454144b392cf8a8c000da6717e11ee3fd
89756 F20110113_AAAONM falcon_a_Page_009.jpg
f8578a4d66b463d0dd0a452072805baa
f01f69e7a956fb870c91ecd89d7d99673bedec47
34071 F20110113_AAAOMZ falcon_a_Page_060.QC.jpg
77f28c6ed9c15758306bb88b845188cb
af5426c2b8e2a9485630cc63d32e6fe13ca69439
175663 F20110113_AAAOOC UFE0004372_00001.xml
8668155a10a4fecdf22a9d07332de55f
84875b35547599d26d43b084ca0ef78be13228d2
1927 F20110113_AAAONN falcon_a_Page_038.txt
f27045e62dfe4e2199d7caae4d53ad3e
d05fbdbcef161cd1ad811bdcf33e7a9e2b441fcf
1687 F20110113_AAAONO falcon_a_Page_075thm.jpg
18a673d9d76e50cccdccb6b193aedf7a
c58de02fa9ba3805753bb07f8cc372b22fd76785
36970 F20110113_AAAONP falcon_a_Page_044.pro
9aa73332ae9f23ae569192fb20f9a552
79be1c6b8e5732efc9ef49d0b36578a561d6062d
24089 F20110113_AAAOOF falcon_a_Page_001.jpg
4105b60bef771d9cbe66f7638dfdfaee
52228b9324e3d02657a25ce361634aaaa67e52b2
6884 F20110113_AAAONQ falcon_a_Page_066thm.jpg
1761d59e26f2dece4d714cb00fe366f0
a04adc8ac73c7c39149d0efd26d1660db060da3a
5003 F20110113_AAAOOG falcon_a_Page_002.jpg
573f26338046cd5495636f5397f1712c
a31391aba3b13c3c11e556f54c7929923585394f
32624 F20110113_AAAONR falcon_a_Page_034.QC.jpg
8a3932dc64dbb062b16603731ab7a684
a3e81ae5c38db1b527c75b4677a43ac4b46a588d
9636 F20110113_AAAOOH falcon_a_Page_003.jpg
e4af2be8453247c27e62bc531056aee3
02940ef46f6c0d491181482aa61523dc1ea3d76b
26543 F20110113_AAAONS falcon_a_Page_088.pro
839a831354e43153913660aaeed4ce57
bdda8ae7be1181bd30fca156e01fce48ff1837c6
33966 F20110113_AAAONT falcon_a_Page_084.QC.jpg
0d5a809db6985e37118024a1900a7596
56c630a5f08591017ed8606e186517088838124e
12634 F20110113_AAAOOI falcon_a_Page_004.jpg
688c308dd1c9d6c5c4f409747c1f5bb0
74e4067ed6184a025c1d2c617c80fda45c81b382
81901 F20110113_AAAONU falcon_a_Page_051.jpg
35387b99385f31c798b28dbf13839616
c3c95ae2b14ab0415db08a1428d060dfb7422ae8
152252 F20110113_AAAOOJ falcon_a_Page_006.jpg
391f4236ca99203f781c1e32a7820e9a
1cfed17426501e141baeced68a6aefbc42ac2a8e
F20110113_AAAONV falcon_a_Page_050.tif
229ca64fe112b92625d1707b07100b92
9ad18d48aff96ae014c2bf39c035053a3684dafa
58350 F20110113_AAAOOK falcon_a_Page_012.jpg
77427b949ff2e1ea714eeab37316fa58
b75ff55cc59dc9757c23d10a7d3a446db488d859
4637 F20110113_AAAONW falcon_a_Page_100thm.jpg
43dbfffcc54cf0ff84c470bea7a7a376
f9b84937d0da0c90459ac76052bab14f26d3e396
113615 F20110113_AAAOPA falcon_a_Page_037.jpg
18ab2043a50af758f599af98b03ccd10
b6d1235a155c798649f27c9a7d885738a70ef681
110022 F20110113_AAAOOL falcon_a_Page_014.jpg
55cfffb3d5b790b3cfd1615593129ce5
df0673cc4f72cf2327e816794801889b828e1729
F20110113_AAAONX falcon_a_Page_029.tif
42e419687ef377595b465547b18c41d4
390ca1eb957e5ba611ea95adbd759c1b61bc8444
102126 F20110113_AAAOPB falcon_a_Page_038.jpg
11ef13e2dbd48a548e3bab2c20f4a136
c764c07d7db0f012c7223b30be94c57bf03082b8
97012 F20110113_AAAOOM falcon_a_Page_016.jpg
61a31e6059fde3ebe17cf75321ec2c06
dce72532fd95c5841efcd699599701711919127d
542 F20110113_AAAONY falcon_a_Page_046.txt
857d721c887af1bf7007b75b78ec20c9
206b8ef21a8192873ff9df2ff77ca7de571363bc
105073 F20110113_AAAOPC falcon_a_Page_039.jpg
0b0b01ef3fa1b95adde30dad7c42ef3f
9e9838f2331803ec92c429119c3a7a6c0e7f837d
63422 F20110113_AAAOON falcon_a_Page_017.jpg
1bffb4becbee2e1058728c48f83dd4c2
acf9a130ce5424ed37bbcc29fdf8fc48b7374c33
1933 F20110113_AAAONZ falcon_a_Page_021.txt
9c71ad34ffe044ca988c2d27ce13461d
22ac64b067abf535d892f674d85b45d5503b44fc
100343 F20110113_AAAOPD falcon_a_Page_041.jpg
291efa7fe691c6bc83a680bf391257c5
665c52999e50f2f711baff3619b63d59d0693028
91863 F20110113_AAAOOO falcon_a_Page_018.jpg
e095537003f79dbc82c0ad12717bddce
a1b9bd4d21273415889f1ce5aa1e23f25f1f7970
102826 F20110113_AAAOPE falcon_a_Page_042.jpg
1dd264858c655e4a3e47dc6b9e085b89
ee2366b44d478c7986200d5797c191b215c20888
104177 F20110113_AAAOOP falcon_a_Page_019.jpg
4e38e9919eb9fe86df27b119bb415c92
e68c28084e3c02c4deb8c64b718d68a6769c9bd4
104687 F20110113_AAAOPF falcon_a_Page_043.jpg
cb835780d4978ebf7a5290d3e988c220
dc60c22ea803221e93cb594bd6001a78ed019d99
14450 F20110113_AAAOOQ falcon_a_Page_020.jpg
17c2eaca4d8a35442c2f7f368ca39645
524856c73f1ad47b12d0a0db13cbada53707a9be
97843 F20110113_AAAOPG falcon_a_Page_044.jpg
9335f7eb1adea0005ab70e56a4f8919d
2a429f6ee5e26a04e4b95bc1ca1a53fe3530e081
103777 F20110113_AAAOOR falcon_a_Page_024.jpg
50ce30fcd50b272001a88a808755af1a
ddcdbc9602aef9e7e00c1223d460f19ec3d35977
31008 F20110113_AAAOPH falcon_a_Page_046.jpg
643186c98de97c5dd4dcaf98a58ed477
932467dad20b6565877a600a392ab2d51e4cf66f
91042 F20110113_AAAOOS falcon_a_Page_025.jpg
5ee8086d7c52fa480ac5e636b22b3baa
53717156acf24163000ca3057dba7dced55eb171
95275 F20110113_AAAOPI falcon_a_Page_047.jpg
ef81aafe66f975c5ec3bbadc7f8e3ad6
af3b6ff13f35a99c689ff7c7469a5de2ad63a8ca
101661 F20110113_AAAOOT falcon_a_Page_026.jpg
43993760cb73aec64394916c57acd9c3
33c26a01a703940e0d3653c38a795974fe9be927
96749 F20110113_AAAOOU falcon_a_Page_028.jpg
165de44dd3f51afe339a323ced25c767
bac7118d787771581fcca7f3e529e6cb3d8a666c
107453 F20110113_AAAOPJ falcon_a_Page_048.jpg
b3f14fd8cd421ed68785b3ac09903086
626369611b29ef0c002ae1b98665d6ce9e0d5568
136413 F20110113_AAAOOV falcon_a_Page_031.jpg
628744a11a82d4a28d3588214e37c02d
05f1df7eade0b3dd8802e38a60a7fd4b60bfc45c
98701 F20110113_AAAOPK falcon_a_Page_050.jpg
e6cede3ac868a433a3b349cb77ea2148
0c05f9bef10432bec895c912095f8c750f54be4a
104769 F20110113_AAAOOW falcon_a_Page_033.jpg
74b637b9415b88e4773769f90071eb9c
9b8fecc0db0cbc37410cd3ef88cd2302c2e18722
79579 F20110113_AAAOPL falcon_a_Page_052.jpg
1c51e81ae2d39b4976b8255abdde4b3a
eb9c15bc47d9a525698edebee30f9d0616ba5fe6
110688 F20110113_AAAOOX falcon_a_Page_034.jpg
726a345c2ae407c08bcf595611bb29b2
ab47ab202a0619bc1146e335f4ac71518296b4ae
57298 F20110113_AAAOQA falcon_a_Page_071.jpg
712c1c77f92ae88dc3752e7c7e90f47e
f00b37d03d74e126273e1de77f45eed56b345bcd
42079 F20110113_AAAOPM falcon_a_Page_053.jpg
683144cac662129635a8e5e0ef7230fd
98e46d7188065ba6281aa8775cf388d1bcd5a3ab
99420 F20110113_AAAOOY falcon_a_Page_035.jpg
45f0e32bf82c3169c81e694db81e3676
22cfb378fd7e4532ac32c8a2fb073fbdda6456b9
83559 F20110113_AAAOQB falcon_a_Page_072.jpg
853c82d8cc395e766bdefeff38db1d92
7d342e6173f6abbfa1e01a4d7f62cdd97fbacc49
82147 F20110113_AAAOPN falcon_a_Page_054.jpg
b9ee3acfbf56c7565ccdf08c065d7c08
214aaa04ed1f1372e09141e42724fde6d5e73158
147827 F20110113_AAAOOZ falcon_a_Page_036.jpg
5c1a9978cc0fad3df9db0338bd50bdef
acd0ab0ce066f5e134154cd44fada39eba4b6b86
97493 F20110113_AAAOQC falcon_a_Page_073.jpg
c438a656693b1d3ef66743003d41197a
b0b467b3cdcab432dd6ca022ab6d810fbdb3cc4e
45406 F20110113_AAAOPO falcon_a_Page_055.jpg
435ca0e3ad7ed9ef57f7cb320a7f3951
cec40f6b1947ec092ca402657d0724c2137dd8c8
17260 F20110113_AAAOQD falcon_a_Page_075.jpg
4d310972f8ba141c87ed4c225671c416
16b9583d1a1ae4f3927329245bfd3b4b5f401694
76217 F20110113_AAAOPP falcon_a_Page_056.jpg
62d0028315c2fdc71dcba2603de9bee0
fbe3738623a189995495bd7d81e5c1d66e8d07c5
67308 F20110113_AAAOQE falcon_a_Page_077.jpg
96699d6ba54e83b2c1edcdf60b8e6d75
7736832f1bbf3d8959b98b80e7120fdb3b3d8769
110652 F20110113_AAAOPQ falcon_a_Page_057.jpg
27c483a1c20988242376b5c2a031cab5
0c825b17a722c0b9c734d9f6373ee0cfc0054f26
76174 F20110113_AAAOQF falcon_a_Page_078.jpg
8a9459d236c595177eaa281604b9302b
72a74c741f724c7a44724dbb2ec07f1900efd97e
110404 F20110113_AAAOPR falcon_a_Page_059.jpg
dcb5b5d60f33f2c5e5a49ed19789597b
95aecaebb490d0d13b373ddf34086498de7582e0
56710 F20110113_AAAOQG falcon_a_Page_079.jpg
362d88d31360c00ae31491191daabfd5
beadc2cfe44b520403c76bbb73a4d8a2d6f4b53f
101953 F20110113_AAAOPS falcon_a_Page_060.jpg
8fb86985e42c5abfcfe0137c1bdb0620
a4de0dc1824b668db9ebc2313749cc884093a11a
94278 F20110113_AAAOQH falcon_a_Page_081.jpg
37018b1e0ae14fd602b612845b9c27cf
0838ea61dbce6086cf1ec4ef31397f62bc172c17
72336 F20110113_AAAOPT falcon_a_Page_063.jpg
9dde38ac673642ce7b9b3d7c696b45e4
f91d71395b8188d49adea3671b80c09d4759101b
104096 F20110113_AAAOQI falcon_a_Page_082.jpg
36ecf4f19898575b2af1cdb5cf5c1f52
fefa84346de4aaab6c4d5c6018332261e1dbe96f
68411 F20110113_AAAOPU falcon_a_Page_064.jpg
3c82fa3f934401cfc1f99713858274a1
169da34284dee82425ecad9bad182772c844c495
100138 F20110113_AAAOQJ falcon_a_Page_083.jpg
8a4dfc4f9e133dcb063d30a41fd1e96f
f7bb387a94436fc7e4db3377af52e176e85ef479
66095 F20110113_AAAOPV falcon_a_Page_065.jpg
6d6fa63757a0229b665ba63727dafea6
6713e2f0b6bbeb5262add038babb668d1bf01f18
93857 F20110113_AAAOPW falcon_a_Page_067.jpg
856a126adb7b8c983af13defa6f3551b
7dbb5971b252c81cf25f65f33ef17b101d2d6205
103199 F20110113_AAAOQK falcon_a_Page_084.jpg
995e74898007850564aa8d1c56163a7a
717feab06580fbdb12852cc9368978f1807eae0d
71923 F20110113_AAAOPX falcon_a_Page_068.jpg
a7996e310b72438d437cb28d16edd039
7731cfe45967f8a304ac246beab0fc9c7655e246
66771 F20110113_AAAORA falcon_a_Page_105.jpg
4e9b475891b18cb1ea1f662be894ddef
c4a217c8c2052038a15c26b599e9b7c37ffe8c0f
105980 F20110113_AAAOQL falcon_a_Page_085.jpg
837f799fc05ca6eb4f9421bc14c64160
5b7766335fe7b876deb26199c14db24fda52663b
32386 F20110113_AAAOPY falcon_a_Page_069.jpg
f611003b2074ccb4725ec664be254b08
56f4f07aafe6faaac8803bc55de3c5e1c976777b
59587 F20110113_AAAORB falcon_a_Page_106.jpg
46fa4d4dd52e7c0a0f545533599aa8f3
fc98046bea403fbd601a13dda2b0a05867b36ce6
104900 F20110113_AAAOQM falcon_a_Page_086.jpg
f6b3e3762be9aca707b9682d7af89863
e4f16bc90311fc5aab49dfd8bf869fd7de11e756
95444 F20110113_AAAOPZ falcon_a_Page_070.jpg
81514cd5584b8f6cd6b42d9a5b783850
c2151f78dce2ffba3043299c20fb32956887b854
62148 F20110113_AAAORC falcon_a_Page_107.jpg
789868d21f2dfc5a74c3f394a1082da1
cb1a461e36796425a0c1747df7838b9c9034b8e9
103877 F20110113_AAAOQN falcon_a_Page_087.jpg
e5601f487c4c599af8d2800ee638b8c8
e0632596c10bdc41bb719868d4b78c5c39893cbe
66841 F20110113_AAAORD falcon_a_Page_108.jpg
644971ec0f4f90aeea53d3d68b39eb96
5e2d3f4c1f39595f7ac8bbfb95f617b311d95ee4
56536 F20110113_AAAOQO falcon_a_Page_088.jpg
d800e7645474f05ad86108f7bf0b761b
28411938a22773c373e827d40b14c9beedc0f7d0
22258 F20110113_AAAORE falcon_a_Page_110.jpg
95dbb592ea46a967c6e69b58fff4abfd
97631057bbb74112f7a8c9e692714f1133a8aec3
84206 F20110113_AAAOQP falcon_a_Page_089.jpg
dd4d0a4cdb7d0ad076fd272174626dc7
568118054ebe6c3070dfc51042452acc688c6e0c
82010 F20110113_AAAORF falcon_a_Page_111.jpg
fc65bf3cb80854e8106c29b500767432
9acd5c654846f15ab45c4a43a82780c8b548996b
103667 F20110113_AAAOQQ falcon_a_Page_091.jpg
a49511a8aabf40ddad97f4c88ea60ebe
bd3cfd808cdb6135d48ee8514d752f8df097c50d
89302 F20110113_AAAORG falcon_a_Page_112.jpg
4f379f41f95cfd80ff2724512ec7ae83
8121609e884335b7c327805330f30090a016612c
110924 F20110113_AAAOQR falcon_a_Page_092.jpg
49a6b7d464f0ad49e61cd96b8fb63763
8f680fca3da1b91b092c45f70f20f6095ac3064e
91487 F20110113_AAAORH falcon_a_Page_113.jpg
2df65b1b23fe48e5e8a793994fd4ae9e
73df11084e51c7990729d636643fedcc4a1867a2
101732 F20110113_AAAOQS falcon_a_Page_093.jpg
d3bb60da66aad4aad0a9a8142660dbcc
6c884ab61585302ee4d95c7a38b10a682cea92ae
101083 F20110113_AAAORI falcon_a_Page_114.jpg
720e176ac87931adffdb00df8ea2c14f
8dd0f5ff6c532dc94cc883546ac4bc1a14b54d60
95795 F20110113_AAAOQT falcon_a_Page_094.jpg
2654922e3ae22e9eeb416ce0c38ae25f
f048e0a97e3b6a2f7a28306e98db63975753982b
29733 F20110113_AAAORJ falcon_a_Page_117.jpg
a2a895951c603de3bf44d3e48303d161
15c9d3bef3673c503fdaf013b182161f7beb68d7
63000 F20110113_AAAOQU falcon_a_Page_096.jpg
8184d5c0e136e152751c6b72fb2c5745
1a2467827c10c69c422727c16d0c4253f9a108e9
23416 F20110113_AAAORK falcon_a_Page_001.jp2
d6f8cb2b31c8fdf36a842f12eb81265f
d3d9bfd606a045cd355ab7d6d81e7270c567df06
54810 F20110113_AAAOQV falcon_a_Page_097.jpg
60a0125861b42890fade5e9fc7fa68b0
80d6bfac0b58a0f9e2a99a9986fd39f80123fae0
51838 F20110113_AAAOQW falcon_a_Page_098.jpg
c660e91f0d369130811cb8dc03334fca
3eba0f7d0df7addff39e588319e231393b28ee09
10091 F20110113_AAAORL falcon_a_Page_003.jp2
0a7b75c63948db0a0e67559aabd2af17
df56f688d3e9f4d3d66f8064953e54246585722e
30639 F20110113_AAAOQX falcon_a_Page_100.jpg
dd70750995607850ac639ccb64ac8457
e246565e683268cd03bdc8a1c5e396542c9f3106
104035 F20110113_AAAOSA falcon_a_Page_021.jp2
ccc40aa1bb8f7cbfc0ce021f19194198
743ed768e1045fcadc5435023c372efc19600f8d
13173 F20110113_AAAORM falcon_a_Page_004.jp2
20afc9095c10f026dcfa09abe4ccc58e
b439fbcfcdf0d53183375391cf100e49e7398da0
64775 F20110113_AAAOQY falcon_a_Page_103.jpg
a18879f68d9e3207e71881b9f30b408a
90809561675348965c2a89ecc1a41ee2025d616d
109945 F20110113_AAAOSB falcon_a_Page_022.jp2
237bc85a51f93b24fb1adae8dd5cd840
b9d791777e417582f5d381aa017a1aac217a8192
1051967 F20110113_AAAORN falcon_a_Page_005.jp2
5bf7663add5967705efb58034f45d9da
a20e26373bfd32af5cd887494d74e1143cef8439
62721 F20110113_AAAOQZ falcon_a_Page_104.jpg
32969fd7cf1b68a0bc23a14b185cc0d1
1f43d151bae84fb61da15d3b6028117ffb50692e
108763 F20110113_AAAOSC falcon_a_Page_024.jp2
c0c6cb43394c04477f24da615cb42f13
327705b356a530bc07e5ec81141b275384a113e7
1051971 F20110113_AAAORO falcon_a_Page_006.jp2
f31ea6a866229155fa358a328da8a4b9
bcc750ad5e5130399e68ec260f3706872bafa32b
1051907 F20110113_AAAOSD falcon_a_Page_027.jp2
fd82e6a36cdc0d37efadebc3111e6d48
f530ec87fda3f559518e67bc1e0cea2751c098cb
1051948 F20110113_AAAORP falcon_a_Page_007.jp2
50c878f204535833a197ab3d09f06d72
b6e607c79018883670057bd7cec94edb7f5f6cb9
102047 F20110113_AAAOSE falcon_a_Page_028.jp2
5aa9c112c341a28b30cc3571d337e05c
fbf00fb6c17092c164b9c8c569a831e410c0d321
445550 F20110113_AAAORQ falcon_a_Page_008.jp2
bb40bf38a3a67ca6c35ba5b4aab9d27e
c25bf7113ff28e53f3121e3ae49661edd49e3ae5
112223 F20110113_AAAOSF falcon_a_Page_029.jp2
8e317d694d88b7c495105abe95da19e9
4e41082cd81f8c29d495acf2bc99e482c6f333ef
1051969 F20110113_AAAORR falcon_a_Page_009.jp2
fe9dfbd08adff318f673da9a81700a52
86d90e1ed14a9b852109b602f05960f3a68fa01c
1051961 F20110113_AAAOSG falcon_a_Page_031.jp2
698572a66c0fbacddf59a0a1a7ac5cfa
61dcbdd2391536289e7aa012a90338a3e4ac98b8
1051965 F20110113_AAAORS falcon_a_Page_010.jp2
18dab5205aad31049ea13df238db1616
0c5edc141a71bf54d11ab1854cf5becb16c65633
112153 F20110113_AAAOSH falcon_a_Page_032.jp2
873f08e2d6699a208f1f3fa7c6c960ca
af7303b7746284a3d2c9a0fb6351991706df2926
91091 F20110113_AAAORT falcon_a_Page_011.jp2
3e0e1cd5388e259a74d678d2000dea46
a157d94d547b9f388d1d0d4cf71c92da0c8501a2
110565 F20110113_AAAOSI falcon_a_Page_033.jp2
bc749bc3c4269c2b97ab8dedea4d1779
60a1012016de41205902f89733a93695988644ff
62746 F20110113_AAAORU falcon_a_Page_012.jp2
3477a1dab7034c181c43bb09f52ebb44
f7039bf3caad4abfb7ee8765c5d599fdebf45dfa
F20110113_AAAOSJ falcon_a_Page_034.jp2
5280e3e236bfcf77b7bea36de876a5de
9cacdef7ce0ef30600280fdc9f6ad3aa310cd6b2
96339 F20110113_AAAORV falcon_a_Page_013.jp2
b5927a32e9692d134edcda2030e6d754
0c49142e28ec31bfedfb640264daf4b58423620f
103014 F20110113_AAAOSK falcon_a_Page_035.jp2
e48a6279b43e2e65474be3e96e1c4c43
06f0cc00433c50374333764ecf2a972113a6740c
114666 F20110113_AAAORW falcon_a_Page_014.jp2
5c3d8a34db36d66289068c2030c683c0
283bbe0e8497ad8e31e45493a8e3184158f1283d
1051950 F20110113_AAAOSL falcon_a_Page_036.jp2
6fe103ff298fd5d145e34237f2bb2fec
07061ea4b80a5cf591d2e27e0bdf1b44a30f7f31
1039700 F20110113_AAAORX falcon_a_Page_016.jp2
e4dffa4811f8d6b0ddef2a1d616a1d55
7ad14d9988fcd481e4edcb05da5353837a87ab9a
458570 F20110113_AAAOTA falcon_a_Page_055.jp2
e2411222bb5773ed73a41075fdf6b16a
df892b941dd113791dd1f5aa8ffd4caf56896c6a
687567 F20110113_AAAORY falcon_a_Page_017.jp2
8816f260b8d3bf22c049007a3ec6df0b
1183d2ab3331d709d7badc0d2e81f88923a14a1c
845198 F20110113_AAAOTB falcon_a_Page_056.jp2
e3ef4d6fe3224f8ba3718cf5b3197914
84bc0f28d10a8a6350d0959cb85e500abcea96fb
118702 F20110113_AAAOSM falcon_a_Page_037.jp2
7e9eccfe50c3d8d1d4cc2e7f5c5906c3
27eebb8d1d81f0572920c1d1cff1851e4c4f33c5
110834 F20110113_AAAORZ falcon_a_Page_019.jp2
92d714d5bbecb170e3fdb94e5ad951a1
ced2145287b87c5f9ee8562690401a38225fa6ab
115311 F20110113_AAAOTC falcon_a_Page_057.jp2
3a4b2ea5307f9678ca083161ea738d86
6f93bea16733ea22ea242c1279a06d91a972c6d3
107501 F20110113_AAAOSN falcon_a_Page_038.jp2
79652d860dbaa13f15037b8d97df9bc1
ff82fbc0677aaaa76f18e09741b8c071cc1df6db
1051982 F20110113_AAAOTD falcon_a_Page_058.jp2
ce3d648e1e0bed9001b2b40768a72369
8ab18e3af97d26d5a263cc8617be3f6bbbe2ee59
110354 F20110113_AAAOSO falcon_a_Page_039.jp2
7faa9081ccb79598f48d1a548be6cdbf
41f30eff7e5cb54a6f3a210288ab105c693308c5
1051953 F20110113_AAAOTE falcon_a_Page_059.jp2
51fbcf48cf0d4e380bdc856d6dd3b949
ca245f0963779b425224c59b7590463a7ea0e3ff
105188 F20110113_AAAOSP falcon_a_Page_041.jp2
011fd6ea7781ca5701b8e4e9cf17482b
5e9d4da2acd5b9c244d95b4d1487f5468602543b
780868 F20110113_AAAOTF falcon_a_Page_063.jp2
b93b6cf7100ee97ad585b50c05be3bb2
80eaaba88fb1a6ecb3dd8f7f5b6cc73544b0904a
1051979 F20110113_AAAOSQ falcon_a_Page_042.jp2
c81b67fd4eaa578d358183c00b5aca60
d86215a0c0401bcbc52ac763a484785b2f584eae
662999 F20110113_AAAOTG falcon_a_Page_066.jp2
ea147d33864db8b45ee05f85dbd34c77
1533d8dc9b42939a9750315222b81f6a2cee99f8
108623 F20110113_AAAOSR falcon_a_Page_043.jp2
9f515ea40a89476479681515a7f40dc1
e38ad25884282fe4bcbcc9485415e44cc1212e1d
703769 F20110113_AAAOTH falcon_a_Page_068.jp2
0d95642c27471a97c69010c783e91b24
738adb51c7e0d42eaf1379fefa57f4fc54b40b36
1051985 F20110113_AAAOSS falcon_a_Page_044.jp2
718e7ee2330b8198cdc0e2aabb93a8fe
a6bc58be89580e2a98c80940e405a3272b3c7da4
34118 F20110113_AAAOTI falcon_a_Page_069.jp2
004e0c4ef91816abee3d221b19f68570
43211b730b7611bfb6068068de879ae53641e0d5
111357 F20110113_AAAOST falcon_a_Page_045.jp2
155624515a55fd3501301d8e891b9b4f
e50c52fee3dc23a2c5b282839abadbd95e20bf5b
103773 F20110113_AAAOTJ falcon_a_Page_073.jp2
a74af3e019fa2ba5c4de115f4224b2be
d44f326fa301c200ccf87d38013e000d4286ef25
33000 F20110113_AAAOSU falcon_a_Page_046.jp2
7c1cd02a5227096bd20d04f9eab12d6e
24e0a179be76d7da7f619a1566892556e0fdd1d3
1051663 F20110113_AAAOTK falcon_a_Page_074.jp2
603aca0bd025371ef8dc6136faa2fed5
2bb3b1b22c851857b4bf6a4eb5d5737d1f29798b
112662 F20110113_AAAOSV falcon_a_Page_048.jp2
f33ca1030093fb7dc51ad8163dcf1669
54864514dce54a7ef0bff9a83989dd4a7b8bd801
18922 F20110113_AAAOTL falcon_a_Page_075.jp2
3e6453993e749a9022c64c0b44003c5a
15f9e2cce092aa78c0814c4364b813f125661cc1
1051956 F20110113_AAAOSW falcon_a_Page_049.jp2
b2d14fdf4fa1169c2aacdd00fb8f2420
e9b7a3622af0a328dbb3af0fc2bebb33f85b2a5c
F20110113_AAAOUA falcon_a_Page_096.jp2
98a8761d1db0d9c5e12e80f8bea1cba9
2958d114081a8aeb10a8e3cda2e6b3fe76eda43a
909169 F20110113_AAAOTM falcon_a_Page_078.jp2
d077fc0782a07d7d9c728228eb1fe3c1
03cd287f25b2c9ca6e90692c4b0e5ae0a6f2b68f
959808 F20110113_AAAOSX falcon_a_Page_052.jp2
120bd86f98587ed28b53f665257a3478
1ef27418a66ad0f6c447ea2fc6a460ca81d0b476
1051968 F20110113_AAAOUB falcon_a_Page_097.jp2
2862cd9348014c94ac82b1be3da6dbb0
f9ceacfe30d3b911788ff1fdd94908f6309ad727
44489 F20110113_AAAOSY falcon_a_Page_053.jp2
24b6531a378e3f69c1ff934fad0b803c
94847afbc5a9634d4697663fcb9fb6d7c91cb580
1051978 F20110113_AAAOUC falcon_a_Page_098.jp2
2ec1b370fa10e4147a6c382616146a75
ccb2f4b59ebadc41f751c1d993294ad40ce756e9
61166 F20110113_AAAOTN falcon_a_Page_079.jp2
6bbdb8d0fc5b74a7936f9c70a42d1fa3
7e4405608b9ce641895fd1a29e6d8cde899d9122
85195 F20110113_AAAOSZ falcon_a_Page_054.jp2
e8f81c37007f1cfb683993ad134a346c
2bea1e59da70ca8a578a6d8988b6518772a4a086
1051980 F20110113_AAAOUD falcon_a_Page_099.jp2
7737ad207c7555f0ab49e7dfcccf0190
b44f22d343993cdab8fac1e06f3e12c6268685b9
109650 F20110113_AAAOTO falcon_a_Page_082.jp2
0e8ba267f6075187e7b53a378a117b52
9f473aadac5e0154900135508528df4b404e4036
612481 F20110113_AAAOUE falcon_a_Page_100.jp2
c43d2e77f7bd74d71d36ce45afd66f7c
0ceeb84d633f9612c05455eb9df5c1c259d9dc3e
103611 F20110113_AAAOTP falcon_a_Page_083.jp2
4dde9c0485f44880e76f8025d1bcde4d
35e0afdf8f07911c280009d4fb903ff622ff15a4
999603 F20110113_AAAOUF falcon_a_Page_101.jp2
caa742d3c6f3a87252d037a85ffc7a4f
905e957a6d97533031f337f47101571e1dcd5642
108643 F20110113_AAAOTQ falcon_a_Page_084.jp2
67cfe51176f0323f35823109627d65bb
511c60b797ae71e2262eb7740d2c3e80408e2b0e
1051944 F20110113_AAAOUG falcon_a_Page_102.jp2
5e138c609157e71903d5f020c34eb0ac
17029bbe8db282427c55b81a9ca687947ac4e235
110916 F20110113_AAAOTR falcon_a_Page_085.jp2
5660e5019afcbfa9589498a620d1c1ea
5042e7b7d0904b4af5584e85236b5c141ea849d0
26039 F20110113_AAAPAA falcon_a_Page_063.pro
2a03d5a89b79a3fd76cf3e265dbe8b9f
95ea98dbd80027d5cb089d82ae4425e72517624a
1051983 F20110113_AAAOUH falcon_a_Page_103.jp2
d128dbea3c09d7122d040c16bd8b63e1
ea99bf235447518f8234babd02cdd68037e2249c
108431 F20110113_AAAOTS falcon_a_Page_087.jp2
5de4a6d0f7075b38ac776124b6e601be
6e60d26ab1b18691ce8827ab3bb93de4bda95cbd
25082 F20110113_AAAPAB falcon_a_Page_064.pro
e33539e35d806a77fa3d9c9595530f85
636826d633a7ec1aef177f73e2d0bec9f7d012bc
F20110113_AAAOUI falcon_a_Page_106.jp2
f18271cff76c4757c8ec82bacd189fd5
ca4aae5439fc8623dac63f2e31dfdd121fedae40
88921 F20110113_AAAOTT falcon_a_Page_089.jp2
43867a53f220d88090925e5a6a08b58c
c3349c8f615e5475d8331b86b6d13ec74b56fe2f
24861 F20110113_AAAPAC falcon_a_Page_065.pro
0063f985f0ff9e6bf93867e388d137c5
ff8b9668ea00d598324b4bacd41efd6c240da1c5
64751 F20110113_AAAOUJ falcon_a_Page_107.jp2
baa5152e2b902ca2a391ea287c046953
3a5ab65a82e17cfef8b30942dca4c5c52860131e
100949 F20110113_AAAOTU falcon_a_Page_090.jp2
c317c803c71e6ce3f2c9f86d774c9b8c
257544d4d7b60424303ad0e4aafe8ef3418ef374
24015 F20110113_AAAPAD falcon_a_Page_066.pro
b1b3fec755fa6ccfe6acd4d761ef599c
7a44a3e120b74e4fd03c602795228127b6f3521f
72203 F20110113_AAAOUK falcon_a_Page_108.jp2
fde4565e0270c5e0df65b8c71a3717d3
edda696e25a05eadd9e4230a167f5815f63d41e2
109437 F20110113_AAAOTV falcon_a_Page_091.jp2
2938b4cca280f40e0969bcbb509c8d15
84e5caee253799796f625ed29d1a4a9165fa02a5
14294 F20110113_AAAPAE falcon_a_Page_069.pro
021701719fec586535dfccb4d7d61bdd
4c180cd6611d3177a5987a02803976df1747eea0
78878 F20110113_AAAOUL falcon_a_Page_109.jp2
19aefbcc27ec55fade0d56335d702c5d
ef4bf9d536b5ede8eade1f4ef573080bf21a9a66
118260 F20110113_AAAOTW falcon_a_Page_092.jp2
8a259a0ecaa284cd06a12794d6500117
c1c7f2f43e7c6e3104cec43ab40054d94046568c
45808 F20110113_AAAPAF falcon_a_Page_070.pro
430ffa3ad83e37ae4a4c3f332c3bbf6e
a64533404e39d58d48ae42a18552210dffff327c
25405 F20110113_AAAOUM falcon_a_Page_110.jp2
2faaae64bbce7092daef9f6d3c442f3c
4981ebaf172f70570643f4e9eaad3b8e50e72bc1
107477 F20110113_AAAOTX falcon_a_Page_093.jp2
55b27e5ce896a341e64e5a05a79faa8f
e633d3912b0b7782e2802598fd7fb64e62a3373e
19811 F20110113_AAAPAG falcon_a_Page_074.pro
22e21ec1fb5e13985aefbb2a862d7acb
b5ebd60624dc8254a3d00227cd8e9e90d2597432
F20110113_AAAOVA falcon_a_Page_009.tif
c267d244c35ceb8cc8ae8d49b9b40817
02a181a13bbe8fff4efbc0d76dfa161d1a338ba0
87066 F20110113_AAAOUN falcon_a_Page_111.jp2
f292267a67f35903a2a9e3e8b71acdc3
174ba417f24a667e5b0fdf482f7bea1ecc0860b4
101648 F20110113_AAAOTY falcon_a_Page_094.jp2
bf0b70ff8c0b1993c3e268168fa6d483
2c548bd029d1e13081fd2c18a03fcc2e5441d2c9
25792 F20110113_AAAPAH falcon_a_Page_077.pro
d0dc580fb27d327b6336bb6b4aca55af
ab46d18cd0ceaebe016fcf8197d9efd904a12ce9
F20110113_AAAOVB falcon_a_Page_010.tif
0d1d0b49b077325392bd36c5b30f3c1e
0c32b11a409ef46eb4ded082d7dfc86f9636d8ee
10162 F20110113_AAAOTZ falcon_a_Page_095.jp2
791b4534729df8b70ed0d96781a54f32
7747f7dfe33534fc2e4074ac6e6006a029e5a29c
25972 F20110113_AAAPAI falcon_a_Page_078.pro
7469ff1a3c6b5acac4cb9f1b97614298
5b833166fed96a105a0e230b33ce35a84277468c
F20110113_AAAOVC falcon_a_Page_011.tif
a7c802143f98b1aa7dade25dae29cf36
283bcc302f873745a478fb7a141571ec4a41c63f
92589 F20110113_AAAOUO falcon_a_Page_112.jp2
5642f48887bd013709c0eb367813743a
f1af388a129c76f7b8192f73de04ef7b5cc0583c
25112 F20110113_AAAPAJ falcon_a_Page_079.pro
15c8bea5491b43b7f249d9a04a7fb5b5
00242fa722d867d445e3be51fe943b8ec54fa058
F20110113_AAAOVD falcon_a_Page_013.tif
989d704e60cb03d3fb338f02d6cbc4ec
7ae754f9a42ab569de8d78e0d794e07e789191af
95050 F20110113_AAAOUP falcon_a_Page_113.jp2
d8c1089c9c2db9b98f733261c4489cf0
01115fb33302d29ec47926189670d7b96303db5f
3556 F20110113_AAAPAK falcon_a_Page_080.pro
4c8ac48cfeaa2422adabc3ff1ac84ac6
1f38d8fcc0851b6cf60d22e8e7f0253b8b30ad17
F20110113_AAAOVE falcon_a_Page_014.tif
b6363946a94ea52290f2a96bbb630d0e
22e237c688187f3bc00e0131a773ed6a37d19a3f
104489 F20110113_AAAOUQ falcon_a_Page_114.jp2
4dcfe60fa77943f922e3feb280233a69
fbd1ade85f35861d2e98542c86d0c581531962db
50706 F20110113_AAAPAL falcon_a_Page_082.pro
9c0a4ebfa5e7621ebf56005ee4712905
3da86f36e892ea0263e50131c143cd44fc89295b
F20110113_AAAOVF falcon_a_Page_015.tif
c1dea29f6f8edff8f2a4f8976a13f065
3446433f4e77a83b75526c1ea90eefb8d11683d1
64567 F20110113_AAAOUR falcon_a_Page_116.jp2
31f6ae082f0ac71daf6a435f6d325f51
03818ab2cc8d7e6e1e5195360787efb1f720355f
14939 F20110113_AAAPBA falcon_a_Page_104.pro
f97095c0840d0a0f96254f72687e28c7
cca5caf799fda6195d0aaf5687dcac58d1590781
46908 F20110113_AAAPAM falcon_a_Page_083.pro
c901d881fc5a962dd69fdacab7584105
7aa53b5ca3e74610cad0fed3a016251284dd126c
F20110113_AAAOVG falcon_a_Page_016.tif
64d7a04d325941e4919da091f062340d
8c5304d1eda841fa3e1cb2dccc1af3e6b663c693
29814 F20110113_AAAOUS falcon_a_Page_117.jp2
a4c56134717059916d8480fe66066af5
d6d6ae19cca4bf8dd34cdcdd6d16e67b0d59c930
12502 F20110113_AAAPBB falcon_a_Page_106.pro
1bf4ed7fe6e01dba42646a8dc079636a
5a4d597587183536b27845ae195a510d599c2d61
50459 F20110113_AAAPAN falcon_a_Page_084.pro
ef7591c2a92aadabe17ad0ab1a3c223b
92e18144a20b88884dac10a9bf1fbebedb4141fa
F20110113_AAAOVH falcon_a_Page_017.tif
d856c51631c967ecaa930d7f42d9aa49
f61475d840ec186cf8ed1110366b9da31c1f4805
F20110113_AAAOUT falcon_a_Page_001.tif
89d113216e33ebdc6d3d27095612e3e9
591adbae234db684a12e836bf7aa95ec144bf957
24728 F20110113_AAAPBC falcon_a_Page_107.pro
1bcc98d64779888a6a1c82e792b6214e
2c3e59275b91ceffa75e7f7aa4d102bee1fca25d
51809 F20110113_AAAPAO falcon_a_Page_085.pro
820f99ea61c19e02b52dec2320d0fcd2
dd046b290f1f1ab1f987fd07b4b32335655eb63d
F20110113_AAAOVI falcon_a_Page_018.tif
6ce5f235fec3be07ad51e8db4168fd31
6093741146492c79196047943b39878371b6f5be
F20110113_AAAOUU falcon_a_Page_002.tif
7c7e5b2fce30bbac5a1329569c113a9e
d4586f84e82f6bc19a581f18ffbc11666e06472e
29127 F20110113_AAAPBD falcon_a_Page_108.pro
41633dedede4f5b77fb47adeb6cb22c1
48d19683025a6a217580b8cefa778e5f83ae4090
50516 F20110113_AAAPAP falcon_a_Page_087.pro
530bca663013cd0fc529c6af0056b687
6f760fb4591aff8bced86930541b97fdc883d470
F20110113_AAAOVJ falcon_a_Page_019.tif
7e0720884152f211b8a6a1a5d4289b93
7771ac178b6ff8671256180eaf41cc72104fc29d
F20110113_AAAOUV falcon_a_Page_003.tif
08f7f4ef18731b61dab7ee47056c1ebf
df9285350c63143c84e199602628d0412ddb47cc
31459 F20110113_AAAPBE falcon_a_Page_109.pro
b5462255bc92269774406f65e5a44e6c
48ab4f57ea36f8eb38e9171a16c18e17e15d7a28
38844 F20110113_AAAPAQ falcon_a_Page_089.pro
d6f76f2d5833fd8c2db577ec647d82c4
69b5566d9c324ea94c1e8c3b5f07c8cd8435e08b
F20110113_AAAOVK falcon_a_Page_020.tif
0d1a8e56d84c2ff37882ab034b0ec03a
764252b9f9a04ad64cb941a3d4c8d589f78a8470
F20110113_AAAOUW falcon_a_Page_004.tif
ca09e1927bf9239f6c7876abc1ea25ba
cbffe77a3a31e1c712126aa87d6265f5ce181155
40486 F20110113_AAAPBF falcon_a_Page_111.pro
37cd587e2000d275f0700f07edab75a3
39849122a3d6d1e279341b5ef2a6f2be092d22d5
45023 F20110113_AAAPAR falcon_a_Page_090.pro
de1014d6c7d6092abbc82f146c415616
fbcd014c07bcfa571cc5e7bc03761c1aee23be6b
F20110113_AAAOVL falcon_a_Page_021.tif
562a97cd4947d5b561beae22e20530c5
5fb9137c2113e55ddfeebe98a3524274bd60cb08
42378 F20110113_AAAPBG falcon_a_Page_112.pro
ba4176757954c4086b2707523967132e
24c6fad2741af12c4d1875c6c7c8d1ed9eea487b
F20110113_AAAOWA falcon_a_Page_041.tif
3ca089518f72127c51cbd4981217914a
6184c07cb6ca94b8acaf81e5bcc64a174c2b7e22
53498 F20110113_AAAPAS falcon_a_Page_092.pro
369ccc5f2dd946d77e9aa6d3cd5efdb2
e8ae038602a0275faca0337035c8ba0fb60a8204
F20110113_AAAOVM falcon_a_Page_022.tif
c37095cfbeb2b4507a25740e684aa9e8
9d45a04c253105691eef0e409f379d5a26e99dbd
F20110113_AAAOUX falcon_a_Page_005.tif
35e7ba8490bfd40956884783b6a00fe4
7694e3029303052fa905fcba3b097d31e5a299c5
48915 F20110113_AAAPBH falcon_a_Page_114.pro
40b36261c94c01feb40e1599eb8cf34c
860fa0a03649f88ee5399444b9b5903f7286acf8
F20110113_AAAOWB falcon_a_Page_042.tif
1556d07a5d52eca5fb62635954c42e4c
6bbe8b40ff72be7f2873701b149b79c127886290
50230 F20110113_AAAPAT falcon_a_Page_093.pro
6c522b8242aee4a1fcef8fcb33da4c33
30127cf35824af60cad7a685a28a3e0a4c84ff1b
F20110113_AAAOVN falcon_a_Page_023.tif
38a56ee22f52693818cc65e69723f4cb
e74da25bcb527651716b5a4698b1a9511639bf8f
F20110113_AAAOUY falcon_a_Page_006.tif
bdfd4c88875d9f1c85435a9aac189cfd
fe4a8374dc3ee78ab2ed1a7bf6c59102149371b5
425 F20110113_AAAPBI falcon_a_Page_001.txt
0b6f7d21138f2a46ca9cd1eb8f5db5fa
e6889fd08dcd0a8dec2f6bd1d03f6645e48b84dc
F20110113_AAAOWC falcon_a_Page_043.tif
3adaea5c0db40606abd7c6b0ff1bcebd
fe719a8f1c274ef3d944911b57956b9816202244
47014 F20110113_AAAPAU falcon_a_Page_094.pro
747a0c6e3da3e0e16eb1cd278e1b1e8d
b16c6a10cfc56bcc06381317e8c03c054b177985
F20110113_AAAOVO falcon_a_Page_024.tif
6a76fb070e973d2e440ac4f7b0be93c1
003750bf8a3936f73e71e3850090967f65cee46f
F20110113_AAAOUZ falcon_a_Page_007.tif
0c207e2fa81ffd4becdc0e75ba10ce19
7f1d631c8d0d0eb93cee42ebe9fcc0f25d3b0e93
122 F20110113_AAAPBJ falcon_a_Page_002.txt
ea414d7f8656600f84164ed3fa125e0c
636fef39b164471a2270e9d20f9e69c85e348466
F20110113_AAAOWD falcon_a_Page_044.tif
1bfe92dca5ca8ef17494a93eddf4171f
131e64c6f9356c5a92dc6623f5881fb76a641489
9079 F20110113_AAAPAV falcon_a_Page_097.pro
7c3f9ed3d2cfacfb619af77e17a62adf
313b6923e0b4baa8a5acfe40a14e30f51684a673
219 F20110113_AAAPBK falcon_a_Page_004.txt
89b068767818d3d0c1e8cea06c39599d
cc4cff74fc391f9684fe1970125f510b150ae7c5
F20110113_AAAOWE falcon_a_Page_046.tif
c3bd0d121ea33a7a248862911a6e9502
74ed2d919fc742d4b3f6568feb27635b4adaa871
8284 F20110113_AAAPAW falcon_a_Page_098.pro
58ce7952be8fa2bf8a8c2a9531640156
ce51ca5c87adcc6b726f8d6e911af7b6cdb27da1
F20110113_AAAOVP falcon_a_Page_026.tif
c56a6e03586909282577347407770a8f
be654f0fee7141ed6fe9d1854268a4a69d1a1d73
2547 F20110113_AAAPBL falcon_a_Page_005.txt
b97aef7a1c05589457a11c9535a9b6e5
9cbfb1254b407801c11a6881f97180b09f6bff08
F20110113_AAAOWF falcon_a_Page_049.tif
cd3551afeddf7b20729157cf647438c5
b2fbe8d2fdda795560c02cae08e3f388ea8f2f23
9220 F20110113_AAAPAX falcon_a_Page_099.pro
8988c8b76411a327abd4232c05efbd4c
d18b8ea5eef77bbb398426379996b0a2118c2013
F20110113_AAAOVQ falcon_a_Page_027.tif
0370e03ec1f24421225a20fe4ac97505
74ea7b853c8eeb743c6a1a98ff0c9f5c45f28f96
1446 F20110113_AAAPBM falcon_a_Page_007.txt
11f8f020bc2d76d89722628bbc43e45d
a5f28e8487399a22320f4561ce154e026572bc7b
F20110113_AAAOWG falcon_a_Page_052.tif
82546d05cacd476aa9d9ed8fce3e8f3c
3e3b8419ebd41675fcd70873d9c414824f3f6de1
5962 F20110113_AAAPAY falcon_a_Page_100.pro
a8c4d7d138b2b7caa0fb4cd955255d49
169b754c4ebc50a970a42b4e431a49396b448d9d
F20110113_AAAOVR falcon_a_Page_028.tif
8dd62068dae06e55ca61b638c1f9ff70
4a3be7112d746f8a76daadfb44fc1367e44835fd
1795 F20110113_AAAPCA falcon_a_Page_028.txt
767a8057debb18caa6ab56e77db31bdb
7923be8be95286210c831f5a84fa6819bf3e2ed2
567 F20110113_AAAPBN falcon_a_Page_008.txt
6ea45f611e8f474bb75ef90cdf0e6d79
42df9835903a1d811f54d8c894c7c6c55675b358
F20110113_AAAOWH falcon_a_Page_053.tif
54268ffa54e312d0f3f5a49b7eab72b4
358c64726f36d3f409c8c79c3e91f845ed35e164
F20110113_AAAOVS falcon_a_Page_030.tif
56e97debecfd36da6fdc4e4625dc4567
d18f5719bf75349dc59529338f191f181c85ea86
2021 F20110113_AAAPCB falcon_a_Page_029.txt
5164dbee39df4498765d3451a14b4782
b62479015a74b2888aaaa3fcb4e7d192ae8a8c07
1304 F20110113_AAAPBO falcon_a_Page_010.txt
a43dc2df99396ffbffa2e342c8c50e68
82cd8ef5e2de60bae128e66298cd836ca3dff570
F20110113_AAAOWI falcon_a_Page_054.tif
6c74cc5b4242a4c57a48a795afedfb2d
5adb4a5b5cb19be3bb4effff69907919c5e78e24
6606 F20110113_AAAPAZ falcon_a_Page_101.pro
125c7eb0b686ca93b05a50e4b5d7436c
ccdb285549f9bcc195efa2fbd18d0a84442773de
F20110113_AAAOVT falcon_a_Page_031.tif
bbcaea3cb0107b9447a08d7feba0c4b4
6f0980fef791f45d1e9d984c977140d58fcbfa83
F20110113_AAAPCC falcon_a_Page_031.txt
d0e878c60e6759c8faa9279a5e73c006
57c5ec6ba9066a6b95a31d710ac6ce72a738881e
1111 F20110113_AAAPBP falcon_a_Page_012.txt
973c3e9f3742e6ab256217d6b26d6cf2
6a94414deb28a128963444041b7042f5969f1dc8
F20110113_AAAOWJ falcon_a_Page_055.tif
7d6056732d5a87647c7c8a6021c82ca3
39e4f7c3928191e409ab156e87f09c7f85708c88
F20110113_AAAOVU falcon_a_Page_033.tif
ff772668cc2fcef578f33b9a4955a22e
3e6be800e3c6f3865053b08daf126552147b11e0
2034 F20110113_AAAPCD falcon_a_Page_032.txt
132376b425e295a8a20925350d7206e9
f6bf5bb96cb4b0e0b726e035ee28b6ff802edc2e
2092 F20110113_AAAPBQ falcon_a_Page_014.txt
682bbb19dfdd432dab1f2143f81b9462
a1ee9b82f7c3661b8c2586d90417fb42d3c163c9
F20110113_AAAOWK falcon_a_Page_056.tif
c92464528e4072e4cbeea330eaaf5062
b4d5b82178f8516e91b39d408e7524912adf7281
F20110113_AAAOVV falcon_a_Page_035.tif
a3da866a663471cabfe9b63ef7bf2952
436dec8387f36d0243e9ae2477b6f68144b07c18
1942 F20110113_AAAPCE falcon_a_Page_033.txt
d0ed9d73a07c0b0b498525b5527a4a1b
055143c705bf08209d1cdb69b7365215908b4af5
1623 F20110113_AAAPBR falcon_a_Page_016.txt
6a8ccc00fd399bafd3448f48af8e4125
61f96ae0484246be05033d9db970cac5f0e19d9b
F20110113_AAAOWL falcon_a_Page_057.tif
b784da84b98f4dc91c3d54deb4a81619
3be40b304e964f84ddd524546fe36dc5616de84d
F20110113_AAAOVW falcon_a_Page_036.tif
47ee514ef19041856347321fc602d939
aa7dd61d9d22cd52b753bc4388aa7da1c2c87a42
930 F20110113_AAAPCF falcon_a_Page_036.txt
68e7b098f9615bcb14e916fc032ed14b
b822d9d5a291a039b44e37bec5666ce519a2a353
1980 F20110113_AAAPBS falcon_a_Page_019.txt
1a8e06d7d7e999e4aa84c1c551b0a2ad
ba8cce8e1302ecef3716a01610d0925cca1ffc74
F20110113_AAAOWM falcon_a_Page_059.tif
305bc37dd36173fcb2d9818dc53afd94
40df0dc0a4374d8c6fa9475bace33194f6d81aa2
F20110113_AAAOVX falcon_a_Page_037.tif
33388ea7a18cad3cb2be80d50c1d1af4
f33031a4fd2bfb8d2825609ca235607a5587b25c
1464 F20110113_AAAPCG falcon_a_Page_040.txt
f0dba1d1f29ff4dff851ab3b1700cc64
0741eb6590d3aef40ab8bc47d38b21b60e397728
F20110113_AAAOXA falcon_a_Page_078.tif
b41526c6f1620805802656f7c8cc41eb
43f391d5b78e3ea341c6dc54fa95c52fe8bfd6ca
223 F20110113_AAAPBT falcon_a_Page_020.txt
7089b10f9aa57ac597e24f9a5b8821d0
cbda9d1a4f7b0823d1d92433d241655218f08952
F20110113_AAAOWN falcon_a_Page_060.tif
abad428cdcda5528b4215ff0936ea22c
7898794b4dc816606715c770a639289a29a64401
F20110113_AAAOVY falcon_a_Page_038.tif
81ac2b33a5a9d2f98b696c3516d6b335
c71567021c62c9744f783f3f8e36a6e5a1c1dba2
1952 F20110113_AAAPCH falcon_a_Page_041.txt
967bad43fd07fc5ba42c9b1885635cd1
f856321f6136e59f2719f0606266b618a0e500e9
F20110113_AAAOXB falcon_a_Page_079.tif
d460f8e7ef6d65c16778337ea4eae54c
8835338f50d64d73ce576ce65df0cbb7659c072a
1955 F20110113_AAAPBU falcon_a_Page_022.txt
a2f2aa2a9e1991933e597026b2c33eb9
afd8bc094cb5b547edcfc3e08bf3a44515f85f3c
F20110113_AAAOWO falcon_a_Page_061.tif
def3a17c62d5cb786042ab7ffdd35ece
c9ab937c61b12320b70d1c7f4c7cd6e387528530
F20110113_AAAOVZ falcon_a_Page_040.tif
a51057a32bed2415c163304563ffe96a
30b1bcabd05df5dce440eaf3f07f54d624906fc3
1306 F20110113_AAAPCI falcon_a_Page_042.txt
b7db6e0541691ef1da56e393cb8763a0
0b9936d4a29ed57c8b09f7497948480f1aa78489
F20110113_AAAOXC falcon_a_Page_080.tif
ad9deb3ff820458a709394a59e0f9014
fb2dfaf9e745403ec9fc63d244ec12828de999fc
F20110113_AAAOWP falcon_a_Page_062.tif
6162a0d60586718801cfa28ab9a95adf
9efe107038d82b6cf61270369c8b54dd6360749a
1979 F20110113_AAAPCJ falcon_a_Page_043.txt
b963dc239f0ff2504d22e9b5f96de216
5d6851ed9dff1458df783136ab08e7a65ca12809
F20110113_AAAOXD falcon_a_Page_081.tif
d93af2a1152706d8ab3d58cdad12dfab
2a859f21cd038dbcda232a96c657d72638e1bbc5
1861 F20110113_AAAPBV falcon_a_Page_023.txt
d7bb2822f8d7160a87b4095a0499b6e9
908ba3568ba47f455abc440e814ebf0c0cbcc7e1
2048 F20110113_AAAPCK falcon_a_Page_045.txt
7c4f0c6933ed6ad6e191e1eaf61c8723
c50ada393fe961882264bda8a398af3e703b7c66
F20110113_AAAOXE falcon_a_Page_082.tif
031717e7950fd9d415448f4a0ef36914
e62a1ba630e4a9fbec72d3a2930e25896c2437a2
1986 F20110113_AAAPBW falcon_a_Page_024.txt
6e8e46f3c7f355fc9a0cde1797c9fd62
7fb5a8b6b95778a83468d9d2e6d5d0fbd78f275e
F20110113_AAAOWQ falcon_a_Page_064.tif
94faea34ac7a1374b08927bbfeba0d9f
d23affd6a0909026b976974f76f70cda8d2871ea
1869 F20110113_AAAPCL falcon_a_Page_047.txt
9def23f6493e6a3b3b866fe2c9b8f5c7
0b4383804389e6bfc423f9dfccfc01a5874a5f3e
F20110113_AAAOXF falcon_a_Page_084.tif
fa191b283fa80b5ee1205f87a56ac061
e7884774280276ebab73b7e9c022c98f1f2c3fde
1610 F20110113_AAAPBX falcon_a_Page_025.txt
93cea0332e524c3db20484025a989596
efbeaa89bbdead076865d15c6a9c4f654c9fbc61
F20110113_AAAOWR falcon_a_Page_066.tif
84698903c3486496c5bef043d4ff385b
d78c2cc2e6f34545f0058ea996bc96b75c98ff07
978 F20110113_AAAPDA falcon_a_Page_066.txt
0e3bcfa93a67332d6583424fd2b24d71
c3003b38addb2152d7306be01d311e97d471e0de
2047 F20110113_AAAPCM falcon_a_Page_048.txt
9801d8d285b558e34dc1c9519b4f3311
5f96ebc7006551cbd7ccbf26c4e5070fe7b96405
F20110113_AAAOXG falcon_a_Page_085.tif
387c64d97c8e5f8477d27bb323f81846
41e5e44d0d588506d9644143ddbf26617e6d671b
1940 F20110113_AAAPBY falcon_a_Page_026.txt
e0a24dafc42dec8e621abf6e68866af2
4d07b17adc561699d6d0aa6819a5a74165af88f6
F20110113_AAAOWS falcon_a_Page_069.tif
aa4cd0b1abdf65279da534bb0873fefa
ef6f9a97bfbe80baae4209920465544255da4a60
882 F20110113_AAAPDB falcon_a_Page_067.txt
c9b81d8e13f1a1705c7e8c464fd5ad05
c2d7d26f7de637f9af8ba251ffb33b822c11b1ac
1712 F20110113_AAAPCN falcon_a_Page_049.txt
ef5b8ac9a50d75e0b2f3be4e089291cf
61aea5ad559b6fd81f1434f0965c6f1ea8b66f76
F20110113_AAAOXH falcon_a_Page_086.tif
3e194d7f72b5682414743023fec27627
b4288c12caf15571d919ad0e1a886fd7c920b6d0
1637 F20110113_AAAPBZ falcon_a_Page_027.txt
6b7c07bc7317ae2078600750ab50f1ee
28a055f683e162b94b11b65f6fa76a5b81fc529c
F20110113_AAAOWT falcon_a_Page_071.tif
a3df6329857e2fc2dd5e9a1facb07dcd
256c068053f804e42075319a5f37eb869c5e8d30
1401 F20110113_AAAPDC falcon_a_Page_068.txt
10b6b1ffcf3b46096611f55ec258fc68
7316258970594b747a9a647ff7582a10387c5fc9
1892 F20110113_AAAPCO falcon_a_Page_050.txt
d61f149a8296d1be4a675f9d5671b1ff
4ab3507ee1a726836b7b8bec0a52f855d1e34034
F20110113_AAAOXI falcon_a_Page_088.tif
119076250c20e6ffd776cec5f88339da
d759287bd65cff462391b28deaf09f08bc686aad
F20110113_AAAOWU falcon_a_Page_072.tif
3cf89206a4d5728092d3468481c2fca3
4ff4d50571d56c794708a1d5166c9c0eaa6e624e
592 F20110113_AAAPDD falcon_a_Page_069.txt
69c02c1723aec8c69aafcc02e1d85b6c
12496982806d0fcfe1de94aaaaf3ba22340fffa3
1121 F20110113_AAAPCP falcon_a_Page_051.txt
a9de398f1ffd5a3f3373841b3b2f3ce2
5567095f8b7c78b3998798f9fbb1384ff2560623
F20110113_AAAOXJ falcon_a_Page_089.tif
b8abde0952dae5a91dbba95c8fb54097
9bd5c42a76b22f9997d9252e115b82f831e12f93
F20110113_AAAOWV falcon_a_Page_073.tif
337e287bf3b647b5cafba3cc5d90f7ec
06c8d79f541a17db02b395b05d99d1b0bb5cee63
1867 F20110113_AAAPDE falcon_a_Page_070.txt
d74438415ba796e07178cc07734f2bdc
e9eca9dc21336636999ecc1b9526bf361094a703
1437 F20110113_AAAPCQ falcon_a_Page_052.txt
f2fa3b47e02556127409a8ad50831ca8
2b8c573452c18e7dd913643e54011f115dff4f0c
F20110113_AAAOXK falcon_a_Page_090.tif
1c1bb442e6a93ae7dfc0a5c46c227990
dfe61065d61f8358663223817a1ebc987a1bc60c
F20110113_AAAOWW falcon_a_Page_074.tif
c5368ce7541f72275c8b5c0c07de714e
4dd618f0e802d9e7dd542354f349de385155122e
1074 F20110113_AAAPDF falcon_a_Page_071.txt
1c9a9d1b0ce436be83655c98afd37104
350e6a3026ec0fface4a2fc64892925b57ab2ea3
810 F20110113_AAAPCR falcon_a_Page_053.txt
5c16bf3055138ddc6ba019648a04ce69
44dd92417b671a8f98da05d44bf617a95fd87175
F20110113_AAAOXL falcon_a_Page_091.tif
e8f45fe7eea3b73ea0ab48f93ec3738d
bd4e9b1e878b94ef2c6d5f451df519c1347e1eda
F20110113_AAAOWX falcon_a_Page_075.tif
ea14d6b566156f043b79900bfbbc387b
9e645edce977e5691d6099a620b68c82ed4b7152
1105 F20110113_AAAPDG falcon_a_Page_072.txt
35a99f30a88c1b996bb3fed500b00ffd
5e804b03a74890565409cee7cf2ad42541e262e1
F20110113_AAAOYA falcon_a_Page_114.tif
a7558a65d14c9291036f3c6396517595
ab16393560fc661eeff3e64e10932eb1258cb81b
1592 F20110113_AAAPCS falcon_a_Page_054.txt
2cdfd49389026cb9a49e703ca80e62c5
7a5e68552f0ed78df0bb7894fc49ae9241a16fbf
F20110113_AAAOXM falcon_a_Page_092.tif
ba3c6ee8b3376659341328ee80108209
2cc870022ec2afb18d6728ea6afd6d19619395b5
F20110113_AAAOWY falcon_a_Page_076.tif
cb9aa723e048e2a27917708e67d3bea5
41c93df11adb6091cc52a965840483d824dae59e
1904 F20110113_AAAPDH falcon_a_Page_073.txt
086be37eed9b0322383b9304b4615865
21c608c36731c711aa822689bede772a4f24fa0c
F20110113_AAAOYB falcon_a_Page_115.tif
803db9d6416b637092e21ea1e8583f9f
6d611247e0803c6a21c286a967293831e5b3f80b
718 F20110113_AAAPCT falcon_a_Page_055.txt
a8b596a41de54ec0820dd45c3347217f
242a8be946331231afe9d46616baca193753cd1d
F20110113_AAAOXN falcon_a_Page_093.tif
4b0503b25c296e735d8d64f73c72b2d8
09e7999660bb928bf68159f755b9fb67e9a56347
F20110113_AAAOWZ falcon_a_Page_077.tif
30b8f7a078c68fc9331b554e465ff7c4
d325afe33865841cf3fdcf96e197812a4d8e5886
910 F20110113_AAAPDI falcon_a_Page_074.txt
dbdafad6178a8bbf76435b764806c58c
6cdb98a8037c2f5199bf632736ab9b74813615db
F20110113_AAAOYC falcon_a_Page_117.tif
2f36bd08f5c6b7ac0a9496e80c74f391
efd8b418e259830d89aa76a3989eac0fc28e1b52
1487 F20110113_AAAPCU falcon_a_Page_058.txt
e35ad07e12b818ce44a694a16e4be8de
17419c1efc66a900923d5fbc248b1be505dfa096
F20110113_AAAOXO falcon_a_Page_094.tif
cb3ec50de78c79ee11bcdf90e094b67c
39427daad50cce0cf8b34293c3301b1596dd907e
280 F20110113_AAAPDJ falcon_a_Page_075.txt
801879162220b6859f72a4a3baa3b7db
1a62b61145df8093a1c87b6e6fc2967754c66431
1328 F20110113_AAAOYD falcon_a_Page_002.pro
01e4f51baee25027851db8ac8a64c8ae
3bac3264e803eb5bd5712e8c89bf538253c78d0c
F20110113_AAAPCV falcon_a_Page_060.txt
16532642cbf5eb12ee9922cf1a54bf77
a4d10bfde4f6a213f2e426a79f4bbff6fe0173c1
F20110113_AAAOXP falcon_a_Page_095.tif
eef2b12784d80676be7155a8e822d212
94f7795a5a8876d20ddb41680d19c6916ac502b8
1901 F20110113_AAAPDK falcon_a_Page_076.txt
83e2ffcd254dc1b36b3ea89e823781e0
34c55b8615d324274e933790f49d756c2b956985
3289 F20110113_AAAOYE falcon_a_Page_003.pro
2e9878d13e3d99febdbd0d149a5a1a58
d051f62bd86fd5848cfa6d0540199a8ec8ac66a4
1154 F20110113_AAAPCW falcon_a_Page_061.txt
c25d8fad5823ec4f10ca4437532791bd
f95e7b4d5b1304f0a5d199c734a8375d83900d83
F20110113_AAAOXQ falcon_a_Page_096.tif
eda74fb2cb312a0d68b70e820a453c93
4172210b4e3ef2ec44d340bf0de59de9d0d19531
1054 F20110113_AAAPDL falcon_a_Page_077.txt
3fccffa5b7edf50430558c4b2691b433
7b1abca7389b954ddfee35d27b3cf2d1cf535476
4266 F20110113_AAAOYF falcon_a_Page_004.pro
b825211c306b1e338c2ad29eabf082d6
88dcc3129840ed53e48cafe78473a3c31f3eb95d
1153 F20110113_AAAPCX falcon_a_Page_063.txt
77bf2e0cb193ea45ab8dc87cc4ec918d
d5f3884f336c71e4241d0d80fdfffce0621b7022
1058 F20110113_AAAPDM falcon_a_Page_078.txt
4fa1dfd01324f43d6d41310ecc746d94
292d32503c693a124d61dff17395124701973dab
58635 F20110113_AAAOYG falcon_a_Page_005.pro
d75d58f1a8bfcd9c97a78b086e2cf54c
d423532d5f0e3c42b220fb714a6478c5094cb951
1067 F20110113_AAAPCY falcon_a_Page_064.txt
2c9fe1e5020004364c1f9fe4afd19e33
64ab9f2acc774f901af84d3dc9a4147ed203c2c1
F20110113_AAAOXR falcon_a_Page_097.tif
1f999f7d7f74752db3a4a3e50470e73c
43b144a04c42a700484859f0ef0848cf1d528c4d
178 F20110113_AAAPEA falcon_a_Page_095.txt
5c8534f943182fcf90727295eda277dc
f766e3135d0647d3657cb9c4d58eaea3b429ed3b
184 F20110113_AAAPDN falcon_a_Page_080.txt
eaf1767229d6f9a2d81bb8b0bc49b474
aa567ba0203b5dc0d599030f26968ad07086f4cd
82652 F20110113_AAAOYH falcon_a_Page_006.pro
ffcb64a93138700268222d281e749860
8b688ad7c63720e47d8e5fae0986cde1260a090c
1103 F20110113_AAAPCZ falcon_a_Page_065.txt
2719a5a27a8ca2cd1381698468549da3
1f56f9b3fce0b352e11e7d6b50590a450837a706
F20110113_AAAOXS falcon_a_Page_102.tif
3a08336222f926b6b6ace14fe6b5b649
b3edbd4e7821efd3dc0648ef50706606e839a3e9
421 F20110113_AAAPEB falcon_a_Page_096.txt
f19de0bffc7d41c3256e454dd5f1b0db
f686301bb447547401e639feb7301265a293441c
1876 F20110113_AAAPDO falcon_a_Page_081.txt
57adbbd574b6e80c22659e0b386b8f16
29124a44a65110b93cd6b575e95a09228e601c4c
35777 F20110113_AAAOYI falcon_a_Page_007.pro
dfd958cac26811a3a941ed0b23730b3a
b824c77fd428ee27bbda060e98ded95776b5d612
F20110113_AAAOXT falcon_a_Page_103.tif
f90005888abd65fbb927c8887bc05f8d
db1f0580901e26130c92a40992c7aadbfafa7854
394 F20110113_AAAPEC falcon_a_Page_098.txt
bd2098087f56093577cfc516d4cbaee1
3c1a9b57ec5c5bff6ed9e891e669d298cd63fea1
2010 F20110113_AAAPDP falcon_a_Page_082.txt
addd7b136f598be759bd9e1aefec0914
cbae90aaeeb0a99bc12865f662fba93d9ab5e14f
12498 F20110113_AAAOYJ falcon_a_Page_008.pro
d0a96b43c43ff7a1b7818718f3ffcfa5
6f2311940c6d055a18663df78e50fd9daad60800
F20110113_AAAOXU falcon_a_Page_104.tif
41492ffac695f32c6f494a7ebcd7e489
20dac834237a2a3309b774c1dcee9c24ad4c2aec
437 F20110113_AAAPED falcon_a_Page_099.txt
db22887fc9ca9f55fb5220104d20a165
5abe29f506300028e050553b81761d6b3ca1e3fc
1899 F20110113_AAAPDQ falcon_a_Page_083.txt
71ec17b112fb5b65067181ee70e33509
e17b1bb8a931a386fd72adcedcdc5b97aa6a781c
48017 F20110113_AAAOYK falcon_a_Page_009.pro
fd4f1f59d8958092782f8dd56a78e2db
25b4b89576aea080f303504ad9327248468e4dcd
F20110113_AAAOXV falcon_a_Page_107.tif
14699c511edddb5dd15b629dee359da0
ec1e188dac3ebff1f3b91a1a0149e91a7a0619cb
290 F20110113_AAAPEE falcon_a_Page_100.txt
75a0d0816087bbc5107c4a4c7a6fd32d
f01a9cb37c500f7c998d2bbd6c2a402f903c2631
2051 F20110113_AAAPDR falcon_a_Page_084.txt
f65fa1ecc85a05323f3bb8f74a3297a4
78c9c9c16a9f74e42470bce2c30b26f14d3d3533
31936 F20110113_AAAOYL falcon_a_Page_010.pro
cf9b50e0680235775a35e238e7ceb0a4
bfc91e8fd6be61b20a7ce9d71ebb7189c6ce8c0d
F20110113_AAAOXW falcon_a_Page_108.tif
7c465c676bdb26e390ae9957133238ab
45dcc8b1febf89613f1f14cd576e4fd5c3833129
303 F20110113_AAAPEF falcon_a_Page_101.txt
e91dc9da024366cb4b70c5dd327dfac3
f01aca3216ada52539432cbccf3f16a0174e685b
49819 F20110113_AAAOZA falcon_a_Page_031.pro
c1c5b20b997a9d836613f605f0dbd5cb
203da07c497792bc07e7148be9975ed30ed5aec6
2046 F20110113_AAAPDS falcon_a_Page_085.txt
df15aaa96eacd873aa486392b09d17ed
275a594dfe60a45320730f625038cd1497836a08
41174 F20110113_AAAOYM falcon_a_Page_011.pro
e6e013777a18e5bdcc8ed1ac9b791a34
b9bfd4d6557376aabd91c05c473a0faf96fda70c
F20110113_AAAOXX falcon_a_Page_110.tif
afd6602465dd6838f25f7d796bc8efc8
dea90eddf57865a1b653f51f84ade9e9e57afbd2
473 F20110113_AAAPEG falcon_a_Page_103.txt
833c12c28f95fdbe38432d9ab95504e4
8c5287ffc6fb82e9c74269071abfc1ca66b82074
49371 F20110113_AAAOZB falcon_a_Page_033.pro
f0d0843cd8b04f58e14705b3f38ac880
bbfc91468f492da29bcdbbf7a0c1beb1552f4899
2011 F20110113_AAAPDT falcon_a_Page_086.txt
9c643743a017026acdbd24ec4ed56491
0d9a796551ad2fa5341974f9ce4aadcaa235dd06
27545 F20110113_AAAOYN falcon_a_Page_012.pro
d0df247ca93d48cef2f515effc706df9
068a2e2208f82174b73540e6d924ce7be6b6748c
F20110113_AAAOXY falcon_a_Page_111.tif
a3cc0bd5d982494187ef44179f7ab8b8
4caebeeb2b98e4ba5af8b26d558217fcff8531cc
1094 F20110113_AAAPEH falcon_a_Page_106.txt
7bb2d5de013b9121fbad0cfd1cf55157
1b3c989aa82f1840c7dade63087dae679dd13605
45651 F20110113_AAAOZC falcon_a_Page_034.pro
9caaa891f62fdc20cf3fed669d10a47d
e371fbb326758bfe54f058b8ec6c6d05fff393ea
1996 F20110113_AAAPDU falcon_a_Page_087.txt
7c1c7f62b52d43392c1579d147c28103
0da15d804c8ea603f349da754202f46407c51eb9
52924 F20110113_AAAOYO falcon_a_Page_014.pro
007059fd45433806bc2e00ca03797bdf
8ab09d990f1c9e12c2b661ab28126e34980f804c
F20110113_AAAOXZ falcon_a_Page_113.tif
0e8a7c26d821f0cc1eb25030bdca52ea
917d72fe6ade52d49ef1da690664277a749a0105
1003 F20110113_AAAPEI falcon_a_Page_107.txt
a87ab31376bac68f97fadc0e4230f131
0ddee7a0750ef96b0f9a7150a8d252b39c2485ad
46739 F20110113_AAAOZD falcon_a_Page_035.pro
fb38515f80f2fd480388e665e0b8fb9c
045762290a50b36f2437b9ca7e02dfb44391f2b4
1086 F20110113_AAAPDV falcon_a_Page_088.txt
4594d0f0a8d09da2be7fcef6f60653e4
3bdb08971d7f73bad05a9ee254757180f7530d59
30416 F20110113_AAAOYP falcon_a_Page_015.pro
1130245317bfbfacd753ebd123483e9e
7db231ef4d29b364578b90a4618e47a05eb5595c
1543 F20110113_AAAPEJ falcon_a_Page_108.txt
60d3857648d752024634d5542bc855dc
29098a1d647ea27ec8b08a0fab6055a873577893
22816 F20110113_AAAOZE falcon_a_Page_036.pro
ada4d6272a1b5f02783535e98196e060
a08c83d99f29c864307140eb5bf4544139ffa8a3
1789 F20110113_AAAPDW falcon_a_Page_090.txt
fe10505d5a1b4bbd38451fe77ff15b74
e15ac2667e5919e84e28ac908bd41343778a9765
24830 F20110113_AAAOYQ falcon_a_Page_017.pro
6d80be167fbb7a124d81e330bacfad27
e4879d0abbc1b1320774f0f6d43e0b89c3a419c9
1331 F20110113_AAAPEK falcon_a_Page_109.txt
e7beaa2f92dfed15a61bafb278149afe
54992cf84be4ce70c07b6301fbdb0ea6e68a2e72
55614 F20110113_AAAOZF falcon_a_Page_037.pro
6ea92f0a8cfc336aac7b2002694c9ac8
7fc231e648b7f0054529715050f2e5685dc5a959
2050 F20110113_AAAPDX falcon_a_Page_091.txt
6756e736653e4c668bf6189b17be75ee
464425703db1dabd4f32ee90c09361e9bc0d18fe
50302 F20110113_AAAOYR falcon_a_Page_019.pro
964902169d4c8ba440ebfa0e24b0f99d
120db2082ae83948e88936a98f2cf523727710ab
360 F20110113_AAAPEL falcon_a_Page_110.txt
18db6521c526b9f43121c18d438796bf
380b394d361c747f927b93ea93964f50d61769c2
48639 F20110113_AAAOZG falcon_a_Page_038.pro
a6cbb98cf12a5df4c7ae7958f61493dd
f0841788959363cbc1414bf3e0748d633d16dfd8
F20110113_AAAPDY falcon_a_Page_093.txt
f298116ddaca96e2da2474a2160981be
c8931d7d0c22f1c84018c35393e1eb1ecd38facf
5192 F20110113_AAAPFA falcon_a_Page_007thm.jpg
58dbd489458b9233c0919583b37d8aad
2ba18fd95e8583cab4e512deb1914ff2e733bc70
1678 F20110113_AAAPEM falcon_a_Page_111.txt
3e3ec07c54059a7a55a8e5fba0e5d834
e6bf83399f423505dadedafc198b7a55f347527d
50835 F20110113_AAAOZH falcon_a_Page_039.pro
88a9da665025460ad994ea5e3d813b33
08f89a4e32ef795fe56d077b98b432a62a9eeb69
1915 F20110113_AAAPDZ falcon_a_Page_094.txt
15af3af932b82e7391352add53f19cbf
1a4c1002516a8ba0a69ba5af4eb70ec7a4d46482
5512 F20110113_AAAOYS falcon_a_Page_020.pro
c12f92af499ff9b769be9d34327fd168
4b5f7c3c20e849977494311b1db4a6a0b8d2cc1b
20842 F20110113_AAAPFB falcon_a_Page_007.QC.jpg
4dcbd5a14c8f6a875743ec56818427db
a3b16aa7eb038bed0ef47563eb04349eadbd9850
1719 F20110113_AAAPEN falcon_a_Page_112.txt
fb601093b23ba2c7f086f963937af821
8538bd48352bf69597b72bb0be6a9ef24691c10a
34956 F20110113_AAAOZI falcon_a_Page_040.pro
7f4f6927f62665be9d4c6b6126aed0fc
3067c331a2f87d9a6ca049800d7b9c2811b30229
49701 F20110113_AAAOYT falcon_a_Page_022.pro
20e93ce01173fb536612772125f46565
07ba7f9f5c1fe85644002e1bf6b1a742ef113288
2126 F20110113_AAAPFC falcon_a_Page_008thm.jpg
b207fd471df3b7d3a5a0fe1b6e0f8d5a
146776c33ed1ca34b994903d272644b429e9acbd
1747 F20110113_AAAPEO falcon_a_Page_113.txt
26a7fa757d6d697fd9ac569bf1c9b6fd
5894dd89a13703e06bf1875c64d80e7172354437
48562 F20110113_AAAOZJ falcon_a_Page_041.pro
81f5017bd4fee3a49584087b3a7b73af
3f4e0b465af68590ff19c9be1be953258931c330
50467 F20110113_AAAOYU falcon_a_Page_024.pro
a38db8806abb6445a6aee275f50b66fe
8cb7bd143199b0f651e82f88f4e75c32a2cec689
F20110113_AAAPFD falcon_a_Page_008.QC.jpg
1ae6e8412f573652dcef0df9adef338a
18689df3a40ff0e50a05a63f94888125b877dc01
1981 F20110113_AAAPEP falcon_a_Page_114.txt
a6f1abdbfaed357c6818ebb79df1cbee
760d6e2e942f0496033eb6873eaa2cb8f03a4216
32549 F20110113_AAAOZK falcon_a_Page_042.pro
1f29b03280d27f7b62ac9c73c0643e43
8c4c064acc47610b1c103849223c4e4b21e9397f
40182 F20110113_AAAOYV falcon_a_Page_025.pro
003878a2f0472650c95892183acf2dd7
9f7945b6c42d78cc71e5c6b5f022e023ebec9d00
6254 F20110113_AAAPFE falcon_a_Page_009thm.jpg
213428bb66f2821a488635a0e505c0f8
fd2f46057125f83e69c604959f4f86c7844ec468
1864 F20110113_AAAPEQ falcon_a_Page_115.txt
18f1b080f18e27e639e5760086ef898e
db22986900d2f71570e293b0ce7e1e30e007ecac
50376 F20110113_AAAOZL falcon_a_Page_043.pro
b406c34383b97696d5e843cb8e9db5f3
948223854f1a1d9ad8de31ebc2c20b7d35d5e5ad
49279 F20110113_AAAOYW falcon_a_Page_026.pro
6fb5bca70b91b9b54e42593ec05f3f63
07deb89a229cad0b9b26ea164c07c1a08436c843
25432 F20110113_AAAPFF falcon_a_Page_009.QC.jpg
75c16d64351b27ba54cf02e8f8f3c4b3
83fd636954feb8880e41b2a9a6524d4ea4f7ee3b
1185 F20110113_AAAPER falcon_a_Page_116.txt
ef1f804c064bd1710846f9a1d729f78d
3d365824eb5c752219364a14285dbd2b7b9e7005
51306 F20110113_AAAOZM falcon_a_Page_045.pro
06ba554f260f86483b6430ff85c5b128
0b575408881980d221de3bc107293c46a42438b0
45490 F20110113_AAAOYX falcon_a_Page_028.pro
8a8dae126e12d23d9be117c0cfb23dfd
3ef06dbe1512867960a2859c7dfa77921bf77e50
4634 F20110113_AAAPFG falcon_a_Page_010thm.jpg
bca1c19097ddaf37a64b2b05de676091
b432643ac8a5a13d408a79f136a25fd731103c96
2678758 F20110113_AAAPES falcon_a.pdf
be7c7591638e447c1600c4a80900073c
cf120dd0b33745af7e5fa3788c6e0f11a8bd71ca
51753 F20110113_AAAOZN falcon_a_Page_048.pro
caf1b867a50a6c9e9f54d754cc93a62e
92ad1fd47de1eb28e217e41b232aa5222eee4984
51130 F20110113_AAAOYY falcon_a_Page_029.pro
1b25afde0d751194601484899988dbc0
b858e863e22a14bcd49c409568a77a5378849003
18234 F20110113_AAAPFH falcon_a_Page_010.QC.jpg
ccc3265711293a2dca33a64c173a8363
d7e4e084df86b7b4079297b5c5b472596ec6a3d4
2119 F20110113_AAAPET falcon_a_Page_001thm.jpg
0d4e418499fddad2bfcfe288928e021e
4a421da523113d9e3d21994b652b002d1cfc431c
41326 F20110113_AAAOZO falcon_a_Page_049.pro
3d6662d6282330ed1f32a671468fefc4
0e6ca24723c473c4ae460df3717ce7448b5cc14c
40643 F20110113_AAAOYZ falcon_a_Page_030.pro
7eaf3e1af8ab009cb690a17831ec4e0a
5b63a67fb5bbd227146e86f9a36e5dff1094d818
5120 F20110113_AAAPFI falcon_a_Page_012thm.jpg
486afadfe7604bec31544d818b4595c5
945cf0f56133fd586962489cf4acb374eb69ae2d
7490 F20110113_AAAPEU falcon_a_Page_001.QC.jpg
b785d95ca4051310dbd9240c9e276480
c783275ff7f89e8aeb5f857177bd5039fab10605
47448 F20110113_AAAOZP falcon_a_Page_050.pro
b936567b73f456bf2b1b7c285d3bca20
7e03677e3acba01f7d439ffc32324805c8205802
18791 F20110113_AAAPFJ falcon_a_Page_012.QC.jpg
58010e1dfe5bd291a094da825fdc26e2
bf8c97cda410d86eb8e51717f1b3c9ee9273c115
1721 F20110113_AAAPEV falcon_a_Page_002.QC.jpg
deaf4e46dc9347b3e71bb8ccd7c27893
370de0970dd462dfd8d3f6813008e615b70b05a8
34291 F20110113_AAAOZQ falcon_a_Page_052.pro
69e071945b004e906a46c60fc358c57c
ab084c59105cae83b61bdf73dfa10a6837b702e1
29117 F20110113_AAAPFK falcon_a_Page_013.QC.jpg
b917c830cf07add524030c4327efc8af
ddfb9e6b8644b6f2abd19e487aaeb81fd26cc5e7
974 F20110113_AAAPEW falcon_a_Page_003thm.jpg
48c069793cd7906ad78240aa2ab75084
e162e64f902db590569707f08c588e8737f7248c
19166 F20110113_AAAOZR falcon_a_Page_053.pro
24a13244a358caa826895830c1d3c12e
a03f904d212d9b5555871be582ab092c7a57227b
8601 F20110113_AAAPFL falcon_a_Page_014thm.jpg
9c67e5034133ce771546cb8959571252
55875e62166a0dd7e2c007f33f7291fdd8794fa4
6082 F20110113_AAAPEX falcon_a_Page_005thm.jpg
c1101ce62886e922444a6980df9cd479
77f86a3761f87034d032002ee714bbf190f9f8a4
38224 F20110113_AAAOZS falcon_a_Page_054.pro
717a8d45a6cce32d737d5de4424034c5
351c8d7958bf8cd1d5fafc41105e71c1c50bb6e1
30005 F20110113_AAAPGA falcon_a_Page_025.QC.jpg
55af4d017f7870a4e2c58d96289dbabd
cadc5198cbace206070543efd753418a8104fe90
36186 F20110113_AAAPFM falcon_a_Page_014.QC.jpg
9bb3c360909eedaef6760969062772e4
001d2ec8554ff1f92fea3208a9d9d856eb140874
26053 F20110113_AAAPEY falcon_a_Page_005.QC.jpg
f15cde2e17e59f37a56aca45e6ce19a4
24e910cc847410b0130eb9bf44c2e0ba65ee3e3b
8219 F20110113_AAAPGB falcon_a_Page_026thm.jpg
ca6d0e8f684477907b507095f59ef8e1
f6ae610c52f37be18cd5b20d51cb9eb1bf4404aa
7850 F20110113_AAAPFN falcon_a_Page_016thm.jpg
da2b61f9d48ac0181431cff8c6dff7e4
9ee6851b13624acac5ff17df34067a35482c5b87
7984 F20110113_AAAPEZ falcon_a_Page_006thm.jpg
f9204ac94f412345bdacb48b39f79ae4
cd59c29a197312ff06d83cc097788a90caacc581
14563 F20110113_AAAOZT falcon_a_Page_055.pro
2d17704829f2cd2c92deea695a77814a
9c0482e7cc5e66c000975d9907ef86894d40f813
32708 F20110113_AAAPGC falcon_a_Page_026.QC.jpg
d8a733ba4462e39a96d119c00d4c48ab
8f643f9551975a0651c6310503ea4f37886258ba
31001 F20110113_AAAPFO falcon_a_Page_016.QC.jpg
efd625629cefc5c5f0925dc5bf63ba29
1d6ecf94c6e179d504504491e5621c0b05b5edcf
7903 F20110113_AAAPGD falcon_a_Page_027thm.jpg
1674d2e1020545209f41f5616a2ffc5d
361b0db8bd75f2395261de7aad3e9123cf32b7ba
20249 F20110113_AAAPFP falcon_a_Page_017.QC.jpg
38459112a965000b1625e44da6202b41
b6b74b74af43a402301911b48d7e0f09e8984c0f
28218 F20110113_AAAOZU falcon_a_Page_056.pro
b39295be140ad2babacebec0c2b06aaf
c0e6e6b1ff89496e52a798d919d28c1b97199e03
31133 F20110113_AAAPGE falcon_a_Page_027.QC.jpg
c4f2e0ee4c376b9f5ad5cb21b3e85dd8
ca77a72dfc8b1328e051b305f0d4cdffa640fc93
8280 F20110113_AAAPFQ falcon_a_Page_018thm.jpg
7cfa6faf605d2825786557d839c39e7f
d1ba4472b0ddedd7eb710651d0ecb80a9ad559be
53857 F20110113_AAAOZV falcon_a_Page_057.pro
ee4cda376ec2a89d81954f84c70024db
6c4f8e841df1545c80f91f71e3934e4a228d8bcf
8694 F20110113_AAAPGF falcon_a_Page_029thm.jpg
dd497eccc074b98823466aa81f5b5730
287463b2b3a9fbcca576911c57acaa267ee2cb67
8514 F20110113_AAAPFR falcon_a_Page_019thm.jpg
5456a5571c3233c458850c1a772af9c5
5fe373b57b3d2c6770a923c9096d1af8c1e00f08
35455 F20110113_AAAOZW falcon_a_Page_058.pro
4a002eb085da5c4e3d369cc0f9080030
af48a7761cb9bd0c379dab9e99735ae26890771a
35068 F20110113_AAAPGG falcon_a_Page_029.QC.jpg
832cdd2906b88b06b23c3e68b33fd4e3
6780bc5bc53d8b0c4f2674b78391205a6788e7ce
34794 F20110113_AAAPFS falcon_a_Page_019.QC.jpg
0db45dac5152632b79152fc37dcbcdf5
b662833a380523ddecef54e68b993fe43c2a9bfa
11668 F20110113_AAAOZX falcon_a_Page_059.pro
1facb98ca4bf81f4259e167b358c6a05
7ba75d8335c74bae0a1468311af01d107b1e1f6f
6904 F20110113_AAAPGH falcon_a_Page_030thm.jpg
13b869bcf2fb5098bea435bf87be2b2b
175994156a02bea28a428846e660c06d446e3c9f
1428 F20110113_AAAPFT falcon_a_Page_020thm.jpg
9eeeecb3ec5a56f75e63048a15b37ab8
323a12803da5245b54c021d9a880810f45eb358c
49307 F20110113_AAAOZY falcon_a_Page_060.pro
07563f2abde71948e179da8938d63207
4c4190dcf0d85e4ea5ab58c2a47009ece6a65871
28691 F20110113_AAAPGI falcon_a_Page_030.QC.jpg
d11203b7093a625f92a67e12dcbda920
cc47d5ddb78de065afccf61ee9f1af6250cf6aea
5296 F20110113_AAAPFU falcon_a_Page_020.QC.jpg
2fc84f35e4feb8f699e178d490aeca5d
c07dd5eec1433452d6658c07875b5dc3ede216e3
34222 F20110113_AAAOZZ falcon_a_Page_062.pro
5e8d01794b43f7db0c2b3166223de5fa
72e9394c068c55893952a1779e8976213daed734
9213 F20110113_AAAPGJ falcon_a_Page_031thm.jpg
4949d7ea6a5c3be576f317311317a0ca
619653caca1f9a94581fa43e0e8c14b8ee05229a
31358 F20110113_AAAPFV falcon_a_Page_021.QC.jpg
65ec3dfaebe65f868c1b89745cccbd6b
e8ea8fe364c07aba26f3874dfeff645065d31286
8576 F20110113_AAAPGK falcon_a_Page_032thm.jpg
d46156ceafec1cbeb235921298000518
e65ba05bb96191e28aa90e4d9869691cbbcd20b2
8479 F20110113_AAAPFW falcon_a_Page_022thm.jpg
b83aba37093c72e275cefd946f35e760
53e43fe97abba4afb4030445aeaaba8c4fec6ec1



PAGE 1

BUILDING AN EPISOMAL MODEL OF AGING IN Saccharomyces cerevisiae By ALARIC ANTONIO FALCN A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2004

PAGE 2

Copyright 2004 by Alaric Antonio Falcn

PAGE 3

This document is dedicated to Peri A. Tong, Manuel A. Falcn, and Beverly L. Metcalfe for their unwavering support.

PAGE 4

iv ACKNOWLEDGMENTS I thank my mentor, John P. Aris, and my committee (William A. Dunn, Thomas C. Rowe, and Brian Burke) for helping me become a scientist.

PAGE 5

v TABLE OF CONTENTS Page ACKNOWLEDGMENTS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . iv LIST OF TABLES . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . viii LIST OF FIGURES . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix ABSTRACT . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xi CHAPTER 1 BACKGROUND AND SIGNIFICANCE . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 Sir2p, rDNA, and Aging . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 Extrachromosomal rDNA Circles are Discovered . . . . . . . . . . . . . . . . . . . . . . . . . . 2 Components of the rDNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3 Fob1p and its Role in ERC Production . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4 ARS of the rDNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6 Asymmetric Inheritance of ERCs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7 Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7 2 DEFINING THE LINK BETWEEN EPISOMES AND AGING . . . . . . . . . . . . . . . . 9 Roles of Different Cis-Acting Plasmid Sequences in Reduction of Yeast Replicative Life Span . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13 Plasmid Inheritance Correlates with Reduction in Yeast Life Span . . . . . . . . . . . . 17 Plasmids Do Not Significantly Increase ERC Levels . . . . . . . . . . . . . . . . . . . . . . . 20 Plasmid Accumulation Correlates with Reduction in Life Span . . . . . . . . . . . . . . . 22 Terminal Cell Morphology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29 Do Functional rDNA Transcriptional Units Play a Role in Reduction in Life Span? 31 Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 33 3 TWO MICRON CIRCLE: A NATURALLY OCCURRING EPISOMES ROLE IN AGING . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 35 New Method for Removal of Two Micron Circle . . . . . . . . . . . . . . . . . . . . . . . . . 36 Two Micron Circle Does Not Reduce Life Span . . . . . . . . . . . . . . . . . . . . . . . . . . 38 Two Micron Circle Does Not Accumulate in Old Cells . . . . . . . . . . . . . . . . . . . . . 39 Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 41

PAGE 6

vi 4 A CELLS LIMITED RESOURCES AND PLASMID COMPETITION . . . . . . . . 42 Sml1p, Mec1p, RNR, and Rad53p Pathway . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 42 SML1 Deletions Do Not Increase Life Span. . . . . . . . . . . . . . . . . . . . . . . . . . 43 Old Cells Do Not have an Increased Sensitivity to Hydroxyurea . . . . . . . . . . . 45 Double Strand Breaks Do Not Increase in Old Cells . . . . . . . . . . . . . . . . . . . . 48 Phosphorylation of Rad53p Does Not Increase in Old Cells . . . . . . . . . . . . . . 49 ERC Competition with a CEN Plasmid Throughout Yeast Life Span . . . . . . . . . . . 50 Mitotic Stabilities in the Presence of ERCs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 52 Plasmid Accumulation in sir2 and fob1 Strains . . . . . . . . . . . . . . . . . . . . . . . . . 55 Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 56 5 CHROMATIN SILENCING AND EPISOME FORMATION . . . . . . . . . . . . . . . . 58 ACS2 and ACS1 is Required for Normal Life Span . . . . . . . . . . . . . . . . . . . . . . . . 59 ACS2 Increases ERC Production . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 61 Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 62 6 LOOKING AT POSSIBLE MECHANISM OF CELLULAR AGING . . . . . . . . . . 64 YCA1 and Apoptosis in Yeast . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 64 Shu Gene Family and Mutation Suppression in Aging . . . . . . . . . . . . . . . . . . . . . . 65 Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 67 7 DISCUSSION . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 69 Why Do ARS Plasmids Accumulate in Mother Cells? . . . . . . . . . . . . . . . . . . . . . . 70 Why Do Budding Yeast Exhibit a Mother Cell Plasmid Segregation Bias? . . . . . . 71 Why Do ARS1 Plasmids Bring About Cellular Senescence More Rapidly than Do E R C s? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 71 Do Cis -acting Sequences that Counteract Mother Cell Segregation Bias Suppress Reduction in Life Span by ARS1 Plasmids? . . . . . . . . . . . . . . . . . . . . . . . . . . . . 72 Do 2 Micron Circles Reduce Life Span? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 72 Why Do 2 Micron Origin Plasmids Reduce Life Span? . . . . . . . . . . . . . . . . . . . . . 72 Why Do 2 Micron Origin Plasmids Have an Intermediate Effect on Life Span? . . . 73 Why Does Transformation with pJPA114 Lead to 2 Micron Circle Loss? . . . . . . . 73 By What Mechanism(s) Do Plasmids, and by Implication E R C s, Reduce Life Span in Yeast? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 74 Why Are There Less Plasmid Accumulation in Strains that Produce More ERCs? . 75 Is There Episomal Aging in Metazoans? . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 76 8 MATERIALS AND METHODS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 77 Yeast Strains and Plasmids . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 77 Mitotic Stability . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79 Replicative Life Span Determinations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79 Southern Blot Analysis and Quantitation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 80

PAGE 7

vii Magnetic Cell Sorting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81 Budscar Histograms . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 82 rDNA Recombination Assay . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 82 APPENDIX A STRAIN: W303AR5+pJPA113 MEDIA: SD aHLW . . . . . . . . . . . . . . . . . . . . . . . 84 B STRAIN: W303AR5+pJPA116 MEDIA: SD aHLW . . . . . . . . . . . . . . . . . . . . . . . 85 C STRAIN: W303AR5+pJPA138 MEDIA: SD aHLW . . . . . . . . . . . . . . . . . . . . . . . 86 D STRAIN: yAF6 MEDIA: SD aHLW . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 87 E STRAIN: W303AR5+pJPA133 MEDIA: SD aHWu . . . . . . . . . . . . . . . . . . . . . . . 88 F STRAIN: W303AR5+pJPA136 MEDIA: SD aHWu . . . . . . . . . . . . . . . . . . . . . . . 89 G STRAIN: W303AR5+pJPA148 MEDIA: SD aHWu . . . . . . . . . . . . . . . . . . . . . . . 90 H STRAIN: yAF5 MEDIA: SD aHWu . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 91 I STRAIN: W303R5 +pAF32 MEDIA: YPD . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 92 J STRAIN: FOB1 +pAF32 MEDIA: YPD . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 93 K STRAIN: SIR2 +pAF32 MEDIA: YPD . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 94 L PLASMIDS USED . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 95 M STRAINS USED . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 96 LIST OF REFERENCES . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 99 BIOGRAPHICAL SKETCH . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 105

PAGE 8

viii LIST OF TABLES Table page 2-1. Plasmids used in this study. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13 2-2. Life span data summary. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16 6-1. P-values of the SHU deletion life spans. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 67 L-1. The plasmids used throughout this dissertation. . . . . . . . . . . . . . . . . . . . . . . . . . . . 95 M-1. The strains used throughout this dissertation. . . . . . . . . . . . . . . . . . . . . . . . . . . . . 96

PAGE 9

ix LIST OF FIGURES Figure page 1-1. The pseudoERC strategy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3 1-2. The rDNA repeat . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4 1-3. Fob1 mediated expansion of the rDNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5 1-4. ERC Formation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6 2-1. Life span analysis of plasmid-transformed yeast . . . . . . . . . . . . . . . . . . . . . . . . . 15 2-2. Plasmid inheritance studies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 19 2-3. Extrachromosomal rDNA circle ( E R C ) formation in yeast transformants . . . . . . 22 2-4. Plasmid DNA and extrachromosomal rDNA circle ( E R C ) levels in young and old cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 24 2-5. Plasmid DNA and extrachromosomal rDNA circle ( E R C ) levels in young and old cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28 2-6. Terminal morphology of senescent cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30 2-7. Life span analysis of yeast transformed with plasmids containing rDNA repeats. 32 3-1. Southern blot analysis of pJPA114 transformants . . . . . . . . . . . . . . . . . . . . . . . . 37 3-2. Life span analysis of cir + and cir 0 yeast . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 39 3-3. Two micron plasmid levels in young and old cells . . . . . . . . . . . . . . . . . . . . . . . . 40 4-1. Mec1p, Rad53p, Sml1p, and RNR pathway (94). . . . . . . . . . . . . . . . . . . . . . . . . 43 4-2. Life span of SML1 deletions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 44 4-3. Hydroxyurea sensitivity of young and old cells from 0 mM to 200 mM . . . . . . . 46 4-4. Hydroxyurea sensitivity of young and old cells from 0 mM to 50 mM. . . . . . . . . 47

PAGE 10

x 4-5. Southern of DSB in yAF6 (WT), W1488-4C (WT), sml1 mec1 sml1 and rad53 sml1 .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 49 4-6. Rad53p phosphorylation in young and old cells . . . . . . . . . . . . . . . . . . . . . . . . . . 50 4-7. Life span of W303R5 (WT), sir2 and fob1 during the CEN loss experiment. . 51 4-8. The age which WT, sir2 and fob1 lose plasmid . . . . . . . . . . . . . . . . . . . . . . . 52 4-9. Mitotic stabilities of pAF31 and pAF32 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 53 4-10. Mitotic stabilities of pJPA133 and pJPA136. . . . . . . . . . . . . . . . . . . . . . . . . . . . . 54 4-11. Southern of showing plasmid competition phenomenon.. . . . . . . . . . . . . . . . . . . 55 4-12. Quantitation of plasmid competition Southern . . . . . . . . . . . . . . . . . . . . . . . . . . . 56 5-1. The acetylation of histones and its affect on ERC production and life span. . . . . . 59 5-2. Life span of ACS deletions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 60 5-3. Sorts of young and old ACS deletion strains . . . . . . . . . . . . . . . . . . . . . . . . . . . . 62 6-1. Life span of yca1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65 6-2. SHU genes role in life span.. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 66

PAGE 11

xi Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy BUILDING AN EPISOMAL MODEL OF AGING IN Saccharomyces cerevisiae By Alaric Antonio Falcn May, 2004 Chair: John P. Aris Major Department: Anatomy and Cell Biology Aging in Saccharomyces cerevisiae is under the control of multiple pathways. The production and accumulation of extrachromosomal rDNA circles ( E R C s) is one pathway that has been proposed to bring about aging in yeast. To test this proposal, we developed a plasmid-based model system to study the role of DNA episomes in reduction of yeast life span. Recombinant plasmids containing different replication origins, cis -acting partitioning elements, and selectable marker genes were constructed and analyzed for their effects on yeast replicative life span. Plasmids containing the ARS1 replication origin reduce life span to the greatest extent of the plasmids analyzed. This reduction in life span is partially suppressed by a CEN4 centromeric element on ARS1 plasmids. Plasmids containing a replication origin from the endogenous yeast 2 micron circle also reduce life span, but to a lesser extent than ARS1 plasmids. Consistent with this, ARS1 and 2 micron origin plasmids accumulate in ~7-generation-old cells, but ARS1/CEN4 plasmids do not. Importantly, ARS1 plasmids accumulate to higher levels in old cells than 2 micron origin plasmids, suggesting a correlation between plasmid accumulation

PAGE 12

xii and life span reduction. Reduction in life span is not an indirect effect of increased E R C levels, nor the result of stochastic cessation of growth. The presence of a fully functional 9.1 kb rDNA repeat on plasmids is not required for, and does not augment, reduction in life span. These findings support the view that accumulation of DNA episomes, including E R C s, cause cell senescence in yeast. The endogenous 2 micron circle is a naturally occurring episomal DNA. Loss of the 2 micron circle can be facilitated with the transformation of an ARS containing plasmid. Since 2 micron circles are episomes, and episomes can cause aging, experiments were complete to show that it does not accumulate in old cells and does not cause aging. In strains that contain more ERCs, ARS plasmids do not accumulate as much. There is an episomal competition phenomenon. While it is not known what the episomes are competing for, it can be demonstrated that as the number of different episomes increase the rate of accumulation for each episome decreases.

PAGE 13

1 CHAPTER 1 BACKGROUND AND SIGNIFICANCE Saccharomyces cerevisiae is a single-ce lled, budding yeast. During mitosis, budding yeast divide asymmetrically. This is different from fission yeast where the two cells produced by mitosis are indistinguishable. With budding yeast, the new smaller cell (the daughter cell) emerges from the older, larger cell (the mother cell) (1-4). Because the mother cell can be distinguished from its daughters, a mother can be followed throughout all of its divisions. As mothers age, they become enlarged, their cell cycle slows, and they become sterile (2,5). Daughters can be physically separated from their mothers with a microdisection microscope. Physical separation is necessary, because it is difficult to follow a mother cell through all of its divisions if it is obscured by daughter cells and daughters of daughter cells. By removing the daughters from mothers, and simultaneously tallying the number of divisions a mother completes, the cells replicative life span can be determined. The replicative life span is defined as the number of divisions a mother cell completes (6). With the ability to conduct replicative life span experiments and the ease of genetic manipulation, Saccharomyces cerevisia e is an excellent model organism for aging studies. Sir2p, rDNA, and Aging Long and short lived aging mutants have been isolated in Saccharomyces cerevisiae (7-10). One of the first such mutants identified was SIR4-42 a long lived mutant that resulted in the localization of the SIR complex to the nucleolus (3,8). The silent information regulator (SIR) complex is involved in the silencing of chromatin at

PAGE 14

2 the telomeres, mating type loci, and rDNA (2,11,12). The rDNA serves as a nucleolar organizing region in eukaryotic cells, and is the site of transcription of pre-rRNA (11). In addition to the findings that implicated the rDNA in life span, the nucleolus was found to be enlarged and fragmented in old yeast cells (2,3). This was consistent with the notion that the rDNA played a role in life span determination. More recently, the silencing protein Sir2p was found to be a nucleolar protein specifically involved in silencing at the rDNA locus (3). Loss of function sir2 mutations reduce life span (3,12), whereas SIR2 overexpression extends life span (13). Sir2p is now known to function as a histone deactylase that plays a central role in modulating chromatin structure (13,14). It has been tied to the extension of life span in metazoan organisms (15) as well as being linked to the caloric restriction model of aging (16). Extrachromosomal rDNA Circles are Discovered Based on SIR4-42 and other findings, Sinclair and Guarente in 1997 showed that old mother cells accumulated extrachromosomal rDNA circles (ERCs). This was proven by the use of 2D chloroquine gels and by Southern blots for rDNA. 2D chloroquine gels are used to look for closed circular DNA molecules (17-19). Old cell undigested DNA on 2D chloroquine gels showed rDNA episomes. The old cells had rDNA episomes and young cells did not (20) To test the role of ERCs in yeast mother cell aging, replicative life spans were conducted on cells that had been given pseudoERCs. PseudoERCs are induced by using a plasmid with a partial rDNA repeat flanked by loxP sites and a plasmid with Cre recombinase under the control of the galactose promoter. On adding galactose, the galactose promoter allows the expression of Cre recombinase (21). Cre recombinase then recombines the sequence between the loxP sites out of the plasmid (22). This creates the pseudoERC, a partial rDNA repeat with a selectable marker and no

PAGE 15

3 extraneous segregation or replication mechanisms (Figure 1-1). These pseudoERCs cause an earlier onset of senescence (20). More specifically, the cell that had the induction of pseudoERCs had a lower replicative life span (20). This suggested that ERCs are a cause of aging, and are not produced as an effect of aging. This experiment is the central proof of the ERC mediated aging model. The finding that ERCs could cause aging was a completely novel aging mechanism. Figure 1-1. The pseudoERC strategy. Activation of the GAL1 promoter by galactose produces Cre recombinase. Cre mediates recombination at the loxP sites resulting in the excision of the ARS CEN and the creation of a pseudoERC (20). Components of the rDNA The ribosomal DNA (rDNA) is present on chromosome XII in a single linear array of between 100 and 200 head-to-tail repeats (2,3,11,23). Each 9.1 kb rDNA repeat is responsible for producing the 5S and 35S pre-rRNA (Figure 1-2) (7,24) These RNAs are later processed and packaged with proteins to form a ribosome (24,25). One half of rDNA repeats are usually silent and not actively transcribing the rRNA (11,26). This excess capacity is to ensure that the vital function of protein synthesis will not be hindered by the lack of rRNA.

PAGE 16

4 Figure 1-2. The rDNA repeat. 5S and 35S pre-rRNA are both transcribed in the rDNA. The 35S is later processed into 18S, 5.8S, and 25S rRNA. Within the NTSs are the RFB and ARS-rD (both have been shown to be essential for ERC formation and replication, respectively). Fob1p and its Role in ERC Production The protein Fob1p is required for the replication fork block (RFB) in the nontranscribed spacer 1 (NTS1) (23,27) It is implicated in the formation of ERCs (7). The RFB blocks one of the replication forks within the replication bubble (23). This makes replication unidirectional, in the direction of 35S pre-rRNA transcription (23) The RFB has been observed in yeast, frog, mouse, human, and plant (28-32). The ultimate function of the RFB site in yeast is to allow the cell to expand and contract the number of repeats in the rDNA array by homologous recombination (23) (Figure 1-3). Because recombination is initiated at a DNA double stranded break (DSB), a crossover may occur within a sister chromatid by the formation of a Holliday structure (23). Conversely, recombination can occur upstream, resulting in the loss of a repeat (23). An apparently unintended consequence of RFB function is the increased production of ERCs (Figure 1-4) (7) Holliday structures within the rDNA occur 3.6 times per cell cycle (33), indicating rampant recombination at the locus. In FOB1 deleted strains, there is reduced recombination at the rDNA locus, because there is no RFB at the RFB site (34). This

PAGE 17

5 reflects fob1 s reduced formation of ERCs and longer life span (7). This further implicates ERCs in the aging process. Figure 1-3. Fob1 mediated expansion of the rDNA. (A) Fob1p acts at each RFB site in rDNA. (B) Replication begins at ARS-rD and two replication forks travel in opposite directions. (C) The replication fork traveling in the opposite direction of 35S transcription is stopped at RFB site. The other replication fork continues. A double stranded break can occur at the RFB site. (D) A Holliday structure forms and homologous recombination with the sister chromatid can repair the break. (E) The closest replication bubble catches up to the recombination site creating two separate strands of DNA, one of which has an additional repeat.

PAGE 18

6 Figure 1-4. ERC Formation (A) An ERC can be formed by homologous recombination and the looping out a circular DNA. (B) They can also be formed by recombination of the free end of DNA, the product of Fob1p RFB (27). ARS of the rDNA Within every rDNA repeat, there is an autonomously replicating sequence (ARS) or origin of replication (35,36) ARSs are AT rich sequences of DNA, to which the origin recognition complex (ORC) binds (37,38). The ORC complex of proteins is essential for the initiation of DNA replication (37,38). The ARS-rDs (rDNAs ARS) biological function is as a site for the initiation of DNA replication within the rDNA repeat. It is necessary because the repeat locus consists of one to two hundred headtotail 9.1 kb repeats (approximately 1,500 kb in length) (39). Normally, ARSs are spaced approximately 40 kb apart throughout the yeast genome (37,39,40). By putting an ARS in every repeat, replication of the genome through this lengthy region can occur more efficiently than with an ARS at either end of the locus (39). The ARS will also allow episomal rDNA, such as ERCs, to replicate (20,35) The ARS-rD is considered a weak ARS. That is, any given ARS-rD fires less than once per cell cycle (35,36,39) Because ARS-rD occurs once in every repeat, every third ARS can fire and still replicate the locus effectively. The distance between firing ARSs is approximately 30 kb. The

PAGE 19

7 activity of the ARS-rD has been linked to transcriptionally active 35S genes (which were in turn linked to nonsilent euchromatic regions of the locus) (41,42). Asymmetric Inheritance of ERCs A phenomenon associated with ERCs is their asymmetric segregation. There is a natural tendency for the ERCs and ARS plasmids to stay within the mother cell during cell division (2,3,43) This was demonstrated by pedigree analysis, a technique that follows the segregation of a non-Mendelian trait through mitosis (20). Mother cells have a bias to retain the plasmids and not pass them on to their daughters (43) Although this phenomenon was discovered in 1983, little is known about the mechanism that retains the plasmids in the mother cells. With ERCs being excised from the genome, replicated by their endogenous ARS, and segregated preferentially to the mother; there is a massive accumulation of the episomes in older cells. This is the model of ERC mediated aging (20). Although the amount of ERCs in very old cells is not known, the number estimated to be in cells after 15 generations is 500 to 1000 ERCs (20). This accumulation is thought to be behind the mechanism of ERC mediated aging (20). Summary A major tenet of the ERC mediated model for replicative aging in Saccharomyces cerevisiae is that ERCs are nothing more than episomal DNA molecules with an ARS (20). Evidence for this comes from the observation that a yeast shuttle vector, containing only an ARS, reduced replicative life span (compared to a control plasmid containing an ARS and a centromeric (CEN) element) (20). CEN plasmids are maintained at low copy number and segregate with high fidelity to daughter cells just like chromosomes (44) ARS plasmids attain a high copy number and show a bias toward retention in mother cells during mitosis (similar to ERCs) (43) The fact that the ARS plasmid can shorten

PAGE 20

8 yeast mother cell life span suggests that the rDNA sequence per se does not contribute to ERC mediated aging, and that potentially any extrachromosomal DNA able to replicate may reduce life span (20).

PAGE 21

9 CHAPTER 2 DEFINING THE LINK BETWEEN EPISOMES AND AGING The yeast Saccharomyces cerevisiae has proved to be a valuable model organism for investigating mechanisms of cellular aging (45-47). Central to the biology of aging in S. cerevisiae is an asymmetric cell division process that gives rise to mother and daughter cells with different characteristics. Mother cells have a limited capacity to produce daughter cells, and the decline in this capacity with each generation is referred to as replicative aging. The limited replicative potential of yeast mother cells has been recognized since the 1950s (48). Pioneering studies in the Jazwinski and Guarente laboratories postulated the existence of a senescence factor/substance that accumulates in mother cells and is transmissible to daughters (49,50). Work in the Guarente lab identified a heritable "age" locus that regulates yeast life span (51). More recent studies have made clear that allelic variation at single genetic loci can markedly affect yeast life span, including extension of life span. This indicates that a process as complex as cellular aging is controlled by a hierarchical regulatory system. Like in other model organisms, such as D. melanogaster and C. elegans mutations that influence yeast life span have been found to exert their effects through different physiological and genetic pathways, including those that participate in caloric restriction, gene silencing, genomic stability, growth regulation, mitochondrial function, and stress response (45-47,52,53). Replicative aging is undoubtedly a complex process, even in a eukaryote as simple as S. cerevisiae Different hypotheses have been proposed to explain yeast replicative aging. One hypothesis proposed by Sinclair and Guarente (54) posits that

PAGE 22

10 replicative aging is caused by progressive accumulation of extrachromosomal rDNA circles ( E R C s) in yeast mother cells. According to this model, E R C s are produced stochastically by intrachromosomal homologous recombination at the rDNA locus and are inherited asymmetrically by mother cells, which leads to E R C accumulation and replicative senescence. The rDNA locus in S. cerevisiae consists of a tandem array of ~150, 9.1 kb direct repeats, each of which encodes the four rRNAs (18S, 5.8S, 25S, and 5S) in precursor form. Many aspects of the E R C model have been supported experimentally. Numerous studies support the view that E R C s are produced by homologous recombination, are self-replicating, are inherited asymmetrically, and accumulate in mother cells (45,54,55). More controversial is the role E R C s play in the aging process. Are E R C s mediators or markers of yeast aging? Certain findings link E R C production with regulation of life span and support a mediator role for E R C s. One of the first life span extending mutations characterized in yeast ( SIR4-42 ) was found to redirect silent information regulator (Sir) protein complexes to the rDNA locus and limit recombination (51,56). Expression of SIR2 which encodes a nucleolar NAD-dependent histone deacetylase, correlates with longevity. Sir2p binds to rDNA and suppresses rDNA recombination and E R C production (57-59). Deletion of SIR2 shortens life span, whereas overexpression of SIR2 extends life span (60). FOB1 encodes a nucleolar fork blocking protein that binds to the replication fork barrier (RFB) site in rDNA and in so doing halts DNA replication in the direction opposite of pre-35S rRNA transcription (6163). The RFB site and the overlapping HOT1 site promote rDNA recombination (63,64). Mutations in (or deletion of) FOB1 reduce rDNA recombination, lower E R C levels, and

PAGE 23

11 extend life span (65). Recombination of replication forks stalled at RFB sites is suppressed by Sir2p (66) which partly explains the role of Sir2-dependent silencing in extending life span. Also, introduction of a plasmid carrying a stretch of rDNA, as an artificial E R C was shown to reduce life span (54). On the other hand, E R C s have been interpreted as a marker of aging that are a consequence, not a cause, of aging. Mutations that impair DNA replication, recombination, or repair have been observed to reduce life span without concomitant accumulation of E R C s (67-69). However, reduction in life span may be the result of the combined effects of age-dependent and age-independent processes at work in certain mutants. The hrm1 mutants, which affect rDNA recombination, age prematurely due to a combination of the normal aging process and a G 2 -like cell cycle arrest (69) Similarly, sgs1 mutants exhibit a shortened life span because of the combined effects of the normal aging process and cell cycle arrest due to defective recombination (70). Some petite mutants have been shown to have elevated E R C levels (71), but extended life spans (72). However, to our knowledge, both elevated E R C levels and extended life span in petite mutants have not been demonstrated side-by-side in the same strain. A sir2 mutant with an extended life span was reported to have normal E R C levels (73). More generally, the effects of SIR2 on life span have been attributed to altered patterns of gene expression, including altered transcription of rDNA, which may lead to an imbalance in ribosome synthesis (74,75). Thus, although there is agreement that the rDNA locus plays a key role in the yeast aging process, the precise role of extrachromosomal DNAs remains controversial.

PAGE 24

12 To shed light on this controversy, we have developed a plasmid-based model system to investigate the role of episomal DNAs in reduction of yeast life span. Here we present the first comprehensive test of the E R C model of yeast aging proposed by Sinclair and Guarente (54) We constructed three types of recombinant plasmid for this purpose: ARS plasmids, ARS/CEN plasmids, and 2 origin plasmids. ARS plasmids are most like E R C s in that they are circular DNA molecules with a replication origin but lack a cis -acting partitioning sequence. Classic pedigree analysis studies by Murray and Szostak showed that ARS plasmids exhibit a strong bias to be retained in mother cells during mitosis (43). Thus, ARS plasmids are predicted to accumulate in mother cells like E R C s, but this has not yet been demonstrated. ARS/CEN plasmids contain a centromeric DNA region that acts in cis to attach plasmid DNA to the mitotic spindle and ensure efficient delivery to daughter cells during mitosis. ARS/CEN plasmids should not accumulate in mother cells. 2 origin plasmids typically contain a DNA replication origin, a cis -acting REP3/STB element, and one copy of an inverted repeat that regulates plasmid copy number (~20 to 40 copies/cell) (76). The REP3/STB element actively partitions plasmid DNA to daughter cells during mitosis in cir + yeast strains (i.e., in strains that contain the endogenous 2 circle DNA plasmid that encodes proteins that interact in trans with REP3/STB ) (76). 2 origin plasmids are not predicted to accumulate in mother cells, although the 2 plasmid partitioning machinery is not predicted to exhibit the fidelity of a centromere-based partitioning machinery. We also constructed a series of plasmids containing functional rDNA repeat units, and tested their effects on life span. This represents a significant improvement over a previously reported

PAGE 25

13 experiment (54) which employed a non-functional stretch of rDNA (i.e., rDNA incapable of being transcribed to yield full-length 35S pre-rRNA). Roles of Different Cis-Acting Plasmid Sequences in Reduction of Yeast Replicative Life Span To study the effects of plasmids on yeast replicative life span, we generated two series of plasmids based on commonly-used integrating vectorspRS306 and pRS305 (77). In each plasmid, we inserted ARS1 or ARS1 and CEN4 or the 2 circle origin (see Materials and Methods). ARS1 (autonomous replicating sequence 1) is a nuclear genomic DNA replication origin whose function and domain organization have been studied in detail (78). Centromeric DNA from chromosome IV ( CEN4 ) has been mapped and functionally dissected (79). The region of the 2 circle plasmid extending from Table 2-1. Plasmids used in this study. Plasmid Origin, Insert Marker Backbone pJPA105 2 rDNA repeat (XmaI endpoints) TRP1 pAF15 pJPA106 2 rDNA repeat (AhdI endpoints) TRP1 pAF15 pJPA107 2 rDNA repeat (PsiI endpoints) TRP1 pAF15 pJPA113 ARS1 URA3 pRS306 (77) pJPA114 rDNA ARS URA3 pRS306 pJPA116 ARS1 CEN4 URA3 pRS306 pJPA117 rDNA ARS, CEN4 URA3 pRS306 pJPA138 2 URA3 pRS306 pJPA133 ARS1 LEU2 pRS305 (77) pJPA136 ARS1 CEN4 LEU2 pRS305 pJPA148 2 LEU2 pRS305 REP3 through the adjacent 599 bp 2 repeat functions as a replication origin as well as a cis -acting plasmid partitioning element (76,80). The plasmids used in this study are summarized in Table 2-1.

PAGE 26

14 To evaluate effects on life span, plasmids were transformed into strain W303AR5 (54). For each plasmid, six independently-isolated transformants were analyzed in parallel, and each life span curve reflects their collective behavior. Selection for the plasmid was maintained during life span analysis. Virgin mother cells unable to give rise to 5 daughters were discarded to exclude contributions from mother cells without plasmid. To identify mother cells that stopped dividing due to plasmid loss, rather than senescence, cells that had not divided in 2 days were transferred to nonselective medium and monitored for cell division and colony formation. A low percentage (<10%) of mother cells were found to give rise to colonies, and were excluded from the life span data set. Life span plates were incubated during the daytime at 30C, but placed overnight (~12 hours) at 14C, which gave a slightly, but significantly (p<0.01) longer life span than observed on plates stored overnight at 4C (Figure 2-1A). Interestingly, transformants harboring pJPA113 ( ARS1 ) showed dramatic reductions in both average and maximum life span compared to the Ura + control strain yAF6 (Figure 2-1B). yAF6 differs from pJPA113 transformants only in terms of plasmid DNA topology (i.e., integrated in yAF6 and episomal in transformants). Transformants containing pJPA116 ( ARS1, CEN4 ) have a reduced average life span compared to yAF6, but exhibit a maximum life span similar to yAF6 (Figure 2-1B). Thus, addition of a CEN4 element to an ARS1 plasmid suppresses reduction in maximum life span, but does not completely compensate for, or protect against, effects on average life span. Plasmids containing the 2 circle origin of replication were also constructed and analyzed. Yeast cells harboring pJPA138 (2 ori) show a reduction in both average and maximum life

PAGE 27

15 span (Figure 2-1B). Generally speaking, the extent of reduction in average and maximum life span in pJPA138 (2 ori) transformants is intermediate between that Figure 2-1. Life span analysis of plasmid-transformed yeast. Number of daughter cells (generations) produced per mother cell are plotted as a function of mother cell viability. A) Life span curves of strain W303AR5 (54) grown on SD (synthetic dextrose) and S+D (dextrose added after autoclaving) media at 30C during the daytime and stored overnight (~12 hours) at 4C or 14C. The number (n) of mother cells analyzed per curve is as follows: SD 4C, n=60; SD 14C, n=59; S+D 14C, n=60. B) Life span curves of W303AR5 transformed with plasmids pJPA113 ( ARS1 ), pJPA116 ( ARS1, CEN4 ), or pJPA138 (2 ori), and control strain yAF6 ( URA3 ) (n=55, 47, 57, and 58, respectively). C) Life span curves of W303AR5 transformed with plasmids pJPA133 ( ARS1 ), pJPA136 ( ARS1, CEN4 ), pJPA148 (2 ori), and control strain yAF5 ( LEU2 ) (n=38, 33, 41, and 59, respectively). D) Life span curves of W303AR5 transformed with pJPA116 ( ARS1 CEN4 ) determined on SD and YPD (n=45 and 49, respectively). Life spans of control strains yAF6 and W303AR5 were determined on YPD (n=50 and 55, respectively). Plasmids are described in Table 2-1. observed in pJPA113 ( ARS1 ) and pJPA116 ( ARS1, CEN4 ) transformants (Figure 2-1B). The results from multiple life span experiments are summarized in Table 2-2.

PAGE 28

16 Table 2-2. Life span data summary. Plasmid/Strain Mean Life Span Maximum Life Span n* pJPA113 12.4 1.8 21.8 2.2 4 pJPA116 23 1.4 39 2.7 4 pJPA138 16.3 1.8 31.3 0.6 3 yAF6 33.2 3.0 42 1 3 The results reported above were obtained with plasmids carrying a URA3 selectable marker. To eliminate the possibility that effects of plasmids on life span were due to URA3 or medium lacking uracil, we constructed plasmids with a LEU2 selectable marker (Table 2-1), and conducted life span experiments on medium lacking leucine. The results obtained with the LEU2 plasmid series were very similar to results obtained with the URA3 plasmid series (Figure 2-1C). pJPA133 ( ARS1 ) caused dramatic reductions in average (9.9 generations) and maximum (17 generations) life spans compared to the Leu + control strain yAF5. yAF5 yielded an average (30.3 generations) and a maximum (44 generations) life span very similar to the average and maximum lifespan for yAF6 (Table 2-2). Transformants containing pJPA136 ( ARS1, CEN4 ) yielded a maximum life span of 38 generations, but an average life span of 24 generations, similar to what was observed for the URA3 plasmid pJPA116 ( ARS1, CEN4 ). Plasmid pJPA148 (2 ori) reduced the average (15.5 generations) and maximum (31 generations) life span to an extent intermediate between pJPA133 ( ARS1 ) and pJPA136 ( ARS1, CEN4 ) (Figure 2-1C), similar to what was observed with the URA3 plasmid pJPA138 (2 ori) (Figure 2-1B). The reduction in average life span by ARS1 CEN4 plasmids pJPA116 and pJPA136 was unexpected. A similar plasmid had previously been reported to have no effect on life span when grown on YPD medium (54) One possible explanation for this

PAGE 29

17 difference was that ARS1 CEN4 plasmids are occasionally lost from mother cells, causing them to cease division on selective medium prior to senescence, which would result in a reduction in average life span. To test this, ARS1 CEN4 plasmid transformants were analyzed on non-selective YPD medium as done previously (54). On YPD, transformants carrying pJPA116 ( ARS1 CEN4 ) were as long-lived as control strains yAF6 ( URA3 ) and W303AR5 (Figure 2-1D). pJPA116 transformants analyzed in parallel on selective SD medium showed a reduction in average life span (Figure 2-1D), as expected. These findings support the interpretation that ARS1 CEN4 plasmids, which are present at near-unit copy number in transformants (see below), are occasionally lost from mother cells, rendering them unable to divide at a point in their life span prior to normal senescence. We have also examined the effects of two well-known plasmids that carry the TRP1 selectable marker. pTV3 carries the 2 origin whereas pRS314 carries ARSH4 and CEN6 (77,80). Life spans of transformants containing each plasmid were analyzed on medium lacking tryptophan. pTV3 transformants had an average life span of 18.7 and a maximum life span of 32, both values of which are in good agreement with corresponding values for the 2 origin plasmids pJPA138 and pJPA148 (Figure 2-1 and Table 2-2). pRS314 had average and maximum life spans of 21 and 41, respectively, which are in good agreement with values obtained with the ARS1/CEN4 plasmids pJPA116 and pJPA136 (Figure 2-1 and Table 2-2). These data allow us to exclude a specific role for ARS1 and CEN4 in life span reductions presented above (Figure 2-1). Plasmid Inheritance Correlates with Reduction in Yeast Life Span The plasmids used in this study were constructed to explore relationships between plasmid inheritance and effects on life span. Mitotic stability and plasmid copy number

PAGE 30

18 are widely-used measures of plasmid DNA inheritance. Mitotic stability is defined as the proportion of a population of cells grown under selection that contains plasmid. We determined the mitotic stability and plasmid copy number of the plasmids used in life span experiments. Included in our studies were plasmids containing the rDNA ARS. rDNA repeats contain a single, relatively weak ARS (81) pJPA114 and pJPA117 contain the rDNA ARS at the same position as ARS1 in pJPA113 and pJPA116, respectively (see Table 2-1 and Materials and Methods). Plasmid pJPA113 ( ARS1 ) was found to have a mitotic stability of approximately 20% (Figure 2-2A), which is typical of yeast replicating plasmids containing ARS1 which exhibit a mother cell partitioning bias (43) pJPA116 ( ARS1, CEN4 ) exhibited a much higher mitotic stability, ~90%, which is consistent with the presence of CEN4 centromeric DNA, and agrees with the mitotic stability of pRS316 ( ARSH4, CEN6 ) (Figure 2-2A). pJPA138 (2 ori) showed a high degree of mitotic stability, ~90% (Figure 2-2A). The 2 origin plasmid pRS424 had a somewhat lower mitotic stability by comparison (Figure 2-2A). pJPA114 (rDNA ARS) has a very low mitotic stability, <1% (Figure 2-2A). The presence of CEN4 with the rDNA ARS in pJPA117 improves mitotic stability to ~35% (Figure 2-2A). These results with pJPA114 and pJPA117 are consistent with the low efficiency of the rDNA ARS (81) Not surprisingly, it was impractical for us to carry out life span analyses of transformants containing pJPA114.

PAGE 31

19 Figure 2-2. Plasmid inheritance studies. Plasmids are denoted by cis -acting element(s). See Table 1 for plasmid descriptions. pRS316 ( ARSH4, CEN6 (77)) and pRS424 (2 ori, TRP1 (82)) are included for comparison purposes. A) Mitotic stability determinations. Mitotic stability is defined as the percentage of colony forming units in a culture grown under selective conditions that contains plasmid-borne selectable marker. Side-by-side bars are determinations from separate experiments. Average and standard deviation values are plotted. B) Plasmid copy number in toto for cell population. Average and standard deviation values from Southern blots of genomic DNA digested with BamHI (filled bars) and PstI (open bars) are shown. C) Plasmid copy number on a per cell basis. Values were calculated by dividing copy number values from panel B by mitotic stability values from panel A (average of both experiments). The variances in copy number values were determined, assuming a log normal distribution of values. Variances for all values were near 1.0, with the exception of rDNA ARS plasmid copy number, which had a variance of 3.0, which is indicative of a higher level of error in this measurement. Plasmid copy number was determined using Southern blot analysis. Copy number was displayed either as the total number of plasmids compared to the total number of genomes (copy number in the population, Figure 2-2B) or the total number of plasmid compared to the fraction cells (genomes) that contain a copy of the plasmid (copy number per cell, Figure 2-2C) by using a plasmids mitotic stability. Copy number determinations using two different restriction enzymes gave comparable results (Figure 2-2B). pJPA113 ( ARS1 ) exhibited the highest plasmid copy number (Figure 2-2C). Plasmids pJPA116 ( ARS1, CEN4 ) and pJPA117 (rDNA ARS, CEN4 ) exhibited near-unit copy number

PAGE 32

20 values (Figure 2-2C), which is typical of centromeric plasmids (79) such as pRS316 ( ARSH4, CEN6 ) (77) pJPA138 (2 ori) exhibited a copy number of ~33 (Figure 2-2C), which is in the range of copy number values reported for other 2 origin plasmid vectors (80). The high copy number of pJPA113 is primarily due to the asymmetric inheritance of this plasmid and its accumulation in mother cells, rather than ARS strength per se We reach this conclusion because pJPA114, which contains a weak (rDNA ARS) replication origin, achieves a copy number almost as great as pJPA113, which contains a strong ( ARS1 ) replication origin (Figure 2-2C). Thus, pJPA113 demonstrates a correlation between extent of reduction of transformant life span (Figure 2-1B) and tendency to be inherited asymmetrically and attain a high copy in yeast cells (Figure 2-2C). Plasmids Do Not Significantly Increase ERC Levels The results presented above suggest that reduction in life span by the ARS1 plasmid pJPA113 is due to asymmetric inheritance and accumulation in mother cells. An alternative explanation is that pJPA113 increases E R C levels in transformed cells, and thereby reduces life span indirectly. To address this possibility, we measured recombination at the rDNA locus using an ADE2 marker loss assay and measured E R C levels in transformed cells by Southern blotting. To analyze the frequency of recombination at the rDNA locus, we took advantage of the fact that W303AR5 contains ADE2 integrated at the rDNA locus (54). Recombination between flanking rDNA repeats results in loss of ADE2 and a change in colony color. The frequency of half-red sectored colonies is a measure of rDNA recombination rate (events per cell division). Transformation of yeast with plasmid results in a small increase in rDNA recombination as measured by ADE2 marker loss. For W303AR5, we find that ADE2 marker loss occurs at a frequency of ~1.3 per

PAGE 33

21 thousand cell doublings (Figure 2--3A), which is in good agreement with frequencies reported by others (60,68,69) The rate of ADE2 marker loss from yAF6 ( URA3 ) occurs at ~2.7 per thousand (Figure 2-3A). Transformants containing the three plasmids used in this study, pJPA113 ( ARS1 ), pJPA116 ( ARS1, CEN4 ), and pJPA138 (2 ori), exhibited marker loss rates of 4.1, 4.5, and 4.1 per thousand cell doublings, respectively. The differences between transformants and yAF6 represent increases of less than 2-fold. Higher levels of ADE2 marker loss are typically observed in strains with reduced life spans. For example, short-lived sir2 mutants exhibit ADE2 marker loss rates >10-fold higher than isogenic SIR2 strains (60). To directly compare E R C levels, yeast transformants and control strains were analyzed by Southern blotting, and E R C monomer bands were quantitated (see Materials and Methods). E R C monomers consist of a single 9.1 kb rDNA repeat and were chosen for purposes of quantitation because they are well-resolved from chromosomal rDNA and other E R C bands on Southern blots. E R C monomer levels in transformants were not significantly different than E R C monomer levels in control strains. Control strains W303AR5 and yAF6 ( URA3 ) have approximately 0.0007 and 0.0015 E R C monomers per total chromosomal rDNA, respectively (Figure 2-3B). Transformants bearing pJPA113 ( ARS1 ), pJPA116 ( ARS1, CEN4 ), and pJPA138 (2 ori) have E R C monomers levels of 0.0014, 0.001, and 0.001, respectively (Figure 2-3B). These values are within the error of measurements and are not significantly different (Figure 2-3). For comparison, we examined yAF5 ( LEU2 ), which contains a copy of pRS305 integrated at the leu2-113 locus, and found that the E R C monomer level was 0.001, which is intermediate between W303AR5 and yAF6 (Figure 2-3B). Quantitation of slower

PAGE 34

22 migrating E R C multimer bands did not reveal significant differences in levels between transformant and control strains (data not shown). We conclude that plasmids do not have a significant effect on E R C levels. Figure 2-3. Extrachromosomal rDNA circle ( E R C ) formation in yeast transformants. Plasmids are denoted by cis -acting element(s). See Table 2-1 for plasmid descriptions. Control strains W303AR5 ( W303 ), yAF5 ( LEU2 ), and yAF6 ( URA3 ) did not contain plasmid. A) ADE2 marker loss assay. The number of half-red sectored colonies on minimal selective medium per total colony number defines the per (first) cell division rate of loss of the ADE2 marker from the rDNA repeat in W303AR5. Total number (n) of colonies scored is shown. B) E R C monomer levels. Southern blotting analyses of DNA from transformed and control strains grown on selective media were done to quantify chromosomal rDNA and E R C monomer band levels (see Materials and Methods). E R C monomer band intensity was divided by chromosomal rDNA band intensity to give a normalized E R C monomer/chromosomal rDNA ratio. Average and standard deviation values are plotted. Plasmid Accumulation Correlates with Reduction in Life Span If plasmids reduce life span in a manner analogous to E R C s, then plasmid DNAs should accumulate in old mother cells. To test this prediction, we used a biotinylation and magnetic sorting approach to isolate ~7-generation old yeast cells (see Materials and Methods). Plasmid DNA levels in young and old cells were measured by quantitative Southern blotting. The ages of old and young (unsorted) cells were determined by counting bud scars stained with Calcofluor (83) From single sort experiments, the average ages of

PAGE 35

23 yeast transformed with pJPA113, pJPA116, pJPA138, and yAF6 were 6.9, 7.0, 6.1, and 6.2 generations, respectively (Figure 2-4A). Young cells from the same cultures were an average of 1.5, 1.4, 1.1, and 1.1 generations old, respectively (Figure 2-4A). Inspection of the Southern blot clearly reveals increases in relative amounts of pJPA113 ( ARS1 ) and pJPA138 (2 ori) in old cells (Figure 2-4B). pJPA116 ( ARS1, CEN4 ) did not accumulate in old cells, and yields bands similar in their intensities to corresponding bands from yAF6 (Figure 2-4B). In a striking illustration of the accumulation of pJPA113 and pJPA138 in old cells, the linearized plasmid DNA bands can be observed by ethidium bromide staining (Figure 2-4D). E R C levels in young and old cells were also analyzed by Southern blotting. Hybridization to rDNA probe revealed E R C bands and a broad band corresponding to the rDNA locus on chromosome XII (Figure 2-4C). We note that all old cell preparations contained increased numbers of both monomeric and slower-migrating E R C species (Figure 2-4C). The E R C and rDNA repeat bands collapse to a single 9.1 kb band following digestion with KpnI, which cuts rDNA once (data not shown). Chromosomal and plasmid band intensities were quantitated using a PhosphorImager. Consistent with our determinations in Figure 2-2, pJPA113 ( ARS1 ) and pJPA138 (2 ori) are present at high copy number in young cells, but pJPA116 ( ARS1, CEN4 ) is not (Figure 2-4E). In ~7-generation old transformants, the plasmid copy numbers for pJPA113 and pJPA138 are dramatically increased, reaching values of 254 and 137, respectively (Figure 2-4F). This represents a difference in copy number between young and old cells of ~13-fold for pJPA113 and ~6-fold for pJPA138. By

PAGE 36

24 Figure 2-4. Plasmid DNA and extrachromosomal rDNA circle ( E R C ) levels in young and old cells. Panel A conveys the cis -acting elements present in each plasmid (see also Table 2-1). Plasmids are abbreviated by numbers in panels B-H. All plasmids carry URA3 Control strain yAF6 ( URA3 ) did not contain plasmid. Old cells were harvested using a biotinylation and magnetic sorting approach (see Materials and Methods). A) Age profile histograms of young and old cells. Number of cells is plotted as a function of number of bud scars (n>40 for each histogram). B) Southern blot of plasmid DNAs. PstI-digested genomic DNA yields a 3.67 kb URA3 band. Other bands are plasmid-derived. Genomic URA3 DNA in lane Old 113 migrated as two bands due to partial over-digestion of this sample. C) Southern blot of E R C s. D) Ethidium

PAGE 37

25 bromide stained agarose gel corresponding to the blot in panels B and C. DNA marker sizes (in kb) are shown. E and F. Plasmid levels in young and old cells (quantitation of data presented in panel B). G and H) E R C monomer levels in young and old cells (quantitation of data presented in panel C). For E-H, ratios of episome (plasmid or E R C monomer) band intensity divided by chromosomal rDNA band intensity (X1000) are plotted (on a semi log scale). See Fig. 2-1B for corresponding life span data. Comparable results were obtained from similar cell sorting and Southern blotting experiments and are discussed in the Results section. comparison, 7-generation old pJPA116 transformants show no significant increase in plasmid copy number (Figure 2-4F). In a separate experiment with pJPA113 and pJPA116 transformants, in which genomic DNA was digested with BamHI instead of PstI, quantitative analysis revealed that young cells contained 27 and 1.5 plasmids/cell, respectively, whereas old cells contained 283 and 1.2 plasmids/cell, respectively (data not shown). This corresponds to a ~10-fold increase in plasmid copy number for pJPA113 in ~7-generation old cells, and no significant increase in pJPA116 copy number, which agrees with findings presented in Figure 2-4E, F. E R C monomer levels were also quantitated in young and ~7-generation old transformants and yAF6. E R C monomer levels in young cells were equal or close to 0.001 (Figure 2-4G), which agrees with measurements presented above (Figure 2-3B). In old cells, however, E R C monomer levels were appreciably higher, and exhibited increases between ~20-fold to ~70-fold (Figure 2-4H). The levels of E R C s we observe in ~7-generation old cells appears comparable to E R C levels in sorted cells of similar age reported by others (e.g., (54,60)), although quantitative analysis of E R C levels in young and old yeast cells is not commonly reported in the literature. In the experiment shown in Figure 2-4, E R C monomer levels in yAF6 ( URA3 ) are higher than in transformants (Figure 2-4H). This raises the question: does the presence

PAGE 38

26 of plasmid reduce E R C levels? In a separate experiment, E R C monomer levels in young cells were equal or close to 0.001 ( E R C monomer/chromosomal rDNA) and E R C monomer levels in old transformants containing pJPA113, pJPA116, and pJPA138 and in old yAF6 cells were determined to be 0.083, 0.075, 0.045, and 0.081, respectively (data not shown). The similar E R C levels in yAF6 and transformants in this experiment suggest that plasmid vectors do not appreciably affect E R C monomer levels (Figure 2-5). Does the extent of E R C accumulation in old cells in Fig. 4 agree with predictions based on our estimates of rates of recombination within the rDNA locus (see above, Figure 2-3)? If we assume that extrachromosomal rDNA repeats are generated at a rate of 0.5 per cell per generation, and that E R C s are retained in mother cells, then 6-7 generations should yield an increase of between 32to 64-fold, which is similar to the observed range of increase from 20to 70-fold (Figure 2-4G, H). We have also quantitated the relative amount of all E R C s (i.e., monomers, multimers, and concatemers) found in old transformants containing pJPA113, pJPA116, and pJPA138 and in old yAF6 cells. We found levels, respectively, of 0.140, 0.136, 0.086, and 0.238 (extrachromosomal rDNA/chromosomal rDNA; data not shown). These values mirror levels of accumulation of E R C monomers presented in Figure 2-4H. Thus, E R C monomers comprise approximately 1/4 to 1/3 of all extrachromosomal rDNA repeats and are present at similar levels relative to all E R C s in old transformed and untransformed cells. To extend these studies, yeast sorting experiments were done with transformants containing the LEU2 plasmids pJPA133 ( ARS1 ), pJP136 ( ARS1, CEN4 ), and pJPA148 (2 ori), and with the LEU2 strain yAF5. The average ages of sorted yeast transformed

PAGE 39

27 with pJPA133, pJPA136, pJPA148, and yAF5 are 7.1, 7.0, 7.6, and 7.9 generations, respectively (Figure 2-5A). Young cells from the same cultures were an average of 1.7, 1.0, 1.6, and 1.6 generations, respectively (Figure 2-5A). pJPA133 and pJPA148 attain copy number levels of 119 and 39, respectively, in ~7-generation old cells (Figure 2-5C). This represents an increase in copy number between young and old cells of ~30and ~8fold for pJPA133 and pJPA148, respectively. pJPA136 did not show a significant increase in old cells (Figure 2-5C). In comparison to pJPA113 and pJPA138, pJPA133 and pJPA148 reached lower absolute levels of plasmid in ~7-generation old cells. However, pJPA133 and pJPA148 accumulated to similar extents in terms of foldincrease. To resolve if this difference in absolute levels of plasmids in old cells was due to experimental error, sorting experiments with transformants and the control strain were repeated, followed by Southern analyses. The repeat experiment gave results very similar to first experiment, both in terms of absolute level of plasmid in young and old cells as well as fold-increase in young and old cells (Figure 2-5B, C). This indicates that plasmids with identical ARS1 origins and CEN4 elements, but with different backbones and selectable markers, are maintained at different absolute copy number levels in young and old cells. Nevertheless, similar fold-differences in plasmid levels are observed between young and ~7-generation old cells. This indicates that ASR1 and CEN4 elements present on plasmids functionally determine patterns of plasmid inheritance and accumulation during yeast mother cell replication. Next, E R C monomer levels in transformants containing pJPA133, pJPA136, and pJPA148, and in strain yAF5 were quantitated. In young cells, E R C monomers were detected at relatively high levels (Figure 2-5C). However, E R C monomer levels in ~7

PAGE 40

28 generation old cells were similar to levels observed above for pJPA113, pJPA116, and pJPA138 transformants (compare Figures 2-4H and 2-5D). Thus, E R C s in the Leu + transformants showed accumulation over a range of ~3-fold to ~12 fold between young and old transformants. This range of fold-increase is approximately 7-fold lower than the ~20-fold to ~70-fold increase in E R C levels between young and old Ura + transformants. This suggests that the rate of E R C accumulation during the aging process is regulated so that old cells of similar ages contain similar levels of E R C s despite differences in initial levels of E R C s in young cells. Figure 2-5. Plasmid DNA and extrachromosomal rDNA circle ( E R C ) levels in young and old cells. Plasmids are abbreviated by numbers in panels B-E. Panel A conveys the cis -acting elements present in each plasmid (see also Table 2-1). All plasmids carry LEU2 Control strain yAF5 ( LEU2 ) did not contain plasmid. Data were collected as described in Fig. 4. A. Age profile histograms of young and old cells. B and C. Plasmid levels in young and old cells (semi log plot). Data from two Southern blotting experiments are shown (Exp 1 and Exp 2). D and E. E R C monomer levels in young and old cells (semi log plot). See Fig. 1C for corresponding life span data.

PAGE 41

29 An important trend emerges from our studies of plasmid accumulation in old cells. Plasmids that accumulate to the greatest degree in old cells (Figures 2-4 and 2-5) exert the most profound effect on life span (Figure 2-1). ARS1 plasmids attain the highest copy numbers in old cells and have the most pronounced effect on life span. ARS1/CEN4 plasmids maintain a copy number near unity in young and old cells and have a small effect on maximum lifespan and a moderate effect on average life span. Plasmids with 2 origins attain a copy number in old cells roughly half that of ARS1 plasmids and reduce life span roughly half as much as ARS1 plasmids. This suggests the existence of an inverse relationship between plasmid accumulation in old cells and reduction in yeast life span. Terminal Cell Morphology Currently, in the field of yeast aging, there are few approaches available to directly address the senescent phenotype in old non-dividing cells. To address this issue indirectly, we scrutinized the terminal morphology of cells at the end of their life span (Appendix A-H). The rationale for this approach is that cell morphology is a phenotypic indicator of cell cycle stage and can serve as a basis to compare senescent cells (70) If cell morphology in terminal transformed cells is very different from the morphology of terminal wild type cells, this would imply that different mechanisms may bring about the senescent phenotype in transformed and untransformed cells. To examine terminal yeast cells, images of terminal cells were collected from three different life span experiments. Three different cell morphologies were scored: unbudded cells, single-budded cells with small buds, and single-budding cells with large buds (70). Bud emergence in S. cerevisiae correlates with entrance into S phase, and

PAGE 42

30 small buds are indicative of early S phase, whereas large buds are indicative of late S/G 2 or mitotic arrest. Unbudded cells are in G 1 phase. Between 10-15% of the terminal cells, transformed or untransformed, had multiple buds (data not shown) and were omitted from this comparison. For pJPA113 ( ARS1 ) and pJPA116 ( ARS1, CEN4 ) transformants, and W303AR5, more than 50% of terminal cells were unbudded (Figure 2-6). Typically, Figure 2-6. Terminal morphology of senescent cells. Cells at the end of life span experiments were classified according to budding pattern as described (70). Small buds were defined as having a diameter less than 25% of the diameter of the mother cell. All other buds were classified as large. Average and standard deviation values from three independent experiments are shown (n >40 for each transformant or control strain in each experiment). between 50% and 60% of senescent yeast cells have been found to be unbudded (69,70). pJPA116 transformant cells consistently yielded the highest proportion (~65%) of unbudded cells (Fig. 6). yAF6 ( URA3 ) and pJPA138 (2 ori) transformants ceased dividing with a predominance, yet a lower percentage, of unbudded cells (Figure 2-6).

PAGE 43

31 Thus, the majority of pJPA113 transformants, like W303AR5 cells, senesced in G 1 as expected. In addition, similar proportions of small budded and large budded terminal cells in senescent pJPA113 transformants and W303AR5 cells (Figure 2-6) indicate that similar proportions of these cells arrested in similar phases (S or G 2 /M) of the cell cycle. Thus, this analysis supports the interpretation that pJPA113 ( ARS1 ) reduces life span by a normal aging process. Do Functional rDNA Transcriptional Units Play a Role in Reduction in Life Span? Although plasmids without rDNA sequences reduce yeast life span, it is important to consider a potential role for rDNA sequences in life span reduction. It is possible that E R C s reduce life span in a manner that is mechanistically more complex than the manner in which plasmid episomes reduce life span. There are significant differences in coding potential between plasmids and E R C s. The 9.1 kb rDNA repeat carries genes for rRNA precursors as well as the gene TAR1 which lies on the strand opposite the 25S rRNA and encodes a mitochondrial protein (84). One way to address this issue is to ask whether or not a plasmid vector carrying an rDNA repeat unit has a more pronounced effect on life span than plasmid vector alone. It is important to note this issue was not completely addressed in a previous study employing the rDNA-containing plasmid pDS163 (54) Plasmid pDS163 does not contain a functional 9.1 kb rDNA repeat unit. The rDNA on pDS163 consists of a 12.1 kb insert extending from an EcoRI site within the coding sequence of 5.8S rRNA to the 5-most EcoRI site in the 25S rRNA coding region (data not shown). The 12.1 kb fragment does not carry a full-length 35S prerRNA transcription unit and is capable of producing only a truncated 35S pre-rRNA transcript, which if processed would be incapable of yielding mature 25S rRNA.

PAGE 44

32 To determine if an episomal rDNA repeat influences life span, we constructed three plasmids containing 9.1 kb rDNA repeats and used them in life span experiments. The three plasmids, pJPA105, pJPA106, and pJPA107 contain 9.1 kb repeats with different endpoints in the plasmid pAF15, which contains a 2 origin (see Materials and Methods, and Table 2-1). Plasmid pJPA105 contains a repeat with XmaI end points, Figure 2-7. Life span analysis of yeast transformed with plasmids containing rDNA repeats. Number of daughter cells (generations) produced per mother cell are plotted as a function of mother cell viability. Life span analysis was done as described in Figure 2-1 using W303AR5 carrying plasmids pJPA105 (n=45), pJPA106 (n=43), or pJPA107 (n=46) and control plasmid pAF15 (n=46). Plasmids pJPA105, pJPA106, and pJPA107 contain full length (9.1 kb), rDNA repeats with different endpoints (see Table 2-1 and Materials and Methods). pJPA105 contains an rDNA insert with XmaI endpoints, which has been shown to be functional in vivo (85). which has been shown by Nomura and colleagues to functionally complement an rDNA deletion in vivo (85). pJPA106 and pJPA107 contain repeats with AhdI and PsiI endpoints, respectively, which should not interfere with rDNA gene expression (Figure 12). A 2 origin plasmid was used because plasmids constructed with rDNA inserts

PAGE 45

33 whose replication relied solely on the rDNA ARS were found to integrate into the chromosomal rDNA locus with high frequency (as determined by Southern blot analysis; data not shown). Life span determinations of W303AR5 transformants containing pAF15, pJPA105, pJPA106, and pJPA107 were done as described above (see Figure 21). pJPA105, pJPA106, pJPA107, and pAF15 transformants gave very similar life span curves, indicating that the presence of a functional rDNA repeat does not have a dramatic effect on life span (Figure 2-7). All four plasmids affect life span to an extent similar to the 2 origin plasmids pJPA138 and pJPA148 (Figure 2-1B, C), although the average life spans for pJPA105, pJPA106, pJPA107, and pAF15 (13.3, 11.8, 11.7, and 12.2 generations, respectively) are lower than the average life spans for pJPA138 and pJPA148 transformants (15.5 and 16.3 generations, respectively; Figure 2-1 and Table 22). Life span curves for pJPA106 and pJPA107 transformants did not show a statistically significant difference from pAF15 transformants based on the Wilcoxon signed pair rank test (p>0.05) Only transformants carrying pJPA105 and pAF15 exhibited a statistically significant difference (p<0.05), but this represents a small increase in life span of transformants carrying pJPA105. These findings support the conclusion that the presence of a full-length rDNA repeat per se does is not required for, and does not necessarily augment, reduction in yeast life span. Summary Our studies show that yeast plasmids accumulate in mother cells and reduce replicative life span. The effect of plasmids on life span appears to be a direct effect, and not an indirect effect on E R C levels in mother cells. A functional rDNA repeat unit is not required for reduction in life span, and the presence of a functional rDNA repeat does not augment reduction in life span by plasmids. Thus, plasmids containing ARS

PAGE 46

34 elements appear to mimic E R C -mediated reduction in life span. These findings provide strong evidence that replicative aging in S. cerevisiae is caused by accumulation of episomal DNA. The fact that functional rDNA sequences are not required for reduction in life span argues that expression of rDNA genes present on E R C s is not a causative process in yeast aging. This indicates that accumulation of episomal DNAs, such as ARS plasmids and E R C s, is one mechanism by which yeast life span is regulated.

PAGE 47

35 CHAPTER 3 TWO MICRON CIRCLE: A NATURALLY OCCURRING EPISOMES ROLE IN AGING One of the processes that has been proposed to regulate replicative life span in the budding yeast Saccharomyces cerevisiae is the accumulation of extrachromosomal rDNA circles (ERCs) by yeast mother cells (54) ERCs are generated by recombination within the rDNA repeat region on chromosome XII and are passed on to daughter cells infrequently due to an inheritance bias exhibited by replication origin-containing DNA episomes (43). We have shown that plasmids containing an autonomously replicating sequence (ARS; yeast DNA replication origin) reduce life span due to their accumulation during replicative aging (86). This suggests that DNA episomes in general regulate replicative aging, and reduce life span due to their accumulation in yeast mother cells. The majority of laboratory strains of S. cerevisiae contain an endogenous plasmid known as the two micron (2 ) circle, due to the length of its circular DNA determined by electron microscopy (76,87). Strains harboring this non-Mendelian genetic element are denoted cir + ; strains lacking it are referred to as cir 0 (88). Four genes and multiple cisacting sequences on the 2 micron plasmid have been mapped and functionally dissected (76,87). These are responsible for maintaining copy number at approximately 20-40 copies per cell by a recombination-based mechanism and ensuring high fidelity transmission of the 2 micron plasmid during cell division and mating (76,87,89). There are no significant growth phenotypes generally associated with the presence of the 2 micron plasmid in cir + strains, and conversely, negligible growth advantages conferred to

PAGE 48

36 cir 0 strains (76,87) This has led to the view that the 2 micron plasmid is a parasitic DNA that imposes only a minor selective disadvantage to host strains (76,87). However, previous studies have not examined the possibility of an effect of the 2 micron plasmid on replicative life span. A minor effect on replicative life span is not predicted to result in a discernable difference in vegetative growth rate, and may have been overlooked in the past. To address this issue we have taken advantage of a novel and simple method for curing a cir + yeast strain of 2 micron plasmids. Previously described methods (90,91) for curing strains of 2 micron plasmids are more time-consuming and are less convenient than the method described herein. New Method for Removal of Two Micron Circle During the course of plasmid copy number studies published elsewhere (86) we fortuitously observed that transformants containing recombinant yeast shuttle vectors with an rDNA ARS lost 2 micron plasmid DNA more frequently than was expected, based on the known inheritance behavior of 2 micron plasmids. In our initial Southern blotting studies, half of the transformants containing plasmid pJPA114 (4/8 transformants) or plasmid pJPA118 (2/4 transformants) lost 2 micron plasmid DNA (data not shown). Plasmids pJPA114 and pJPA118 are derived from pRS306 (77) and have been described previously (86). pJPA114 contains a 200 bp insert with the rDNA ARS; pJPA118 contains a complete 9.1 kb rDNA repeat with its ARS. The rDNA ARS has relatively weak replication origin activity due to the presence of a non-consensus ARS consensus sequence (ACS) (81). As a result, the majority of pJPA114 and pJPA118 transformants form colonies slowly on selective SD medium. In instances where fastgrowing pJPA118 colonies arose on transformation plates or streaks of individual transformants, Southern analysis revealed that pJPA118 had integrated into the rDNA

PAGE 49

37 Figure 3-1. Southern blot analysis of pJPA114 transformants. Panel A. DNAs from twelve transformants were digested with PstI, separated on a 1% agarose gel and stained with ethidium bromide. Size markers (M) are shown (in kb). Panel B. DNAs from the gel in panel A were transferred to a nylon membrane, hybridized to 32 P-labeled 2 micron plasmid DNA probe, and visualized with a PhosphorImager. The 6318 bp 2 micron plasmid contains one PstI site and yields a single 6.3 kb band (arrowhead). The faint bands above and below the 2 micron plasmid band likely correspond to hybridization to regions of homology in yeast chromosomes (e.g., a region of homology in Ch III yields a PstI fragment of 7747 bp, which corresponds to the size of the upper faint band). Longer exposures of the Southern blot revealed no detectable bands in lanes 8 and 9 (data not shown). locus (data not shown). Transformants containing pJPA118 were not studied further because of the relative frequency with which pJPA118 integrated into the rDNA repeat locus. Fast-growing pJPA114 transformants arose only very infrequently and were not analyzed for plasmid integration by Southern blotting. Transformants containing plasmid pJPA113 (86), which is derived from pRS306 but contains the ARS1 origin instead of the rDNA ARS, did not show loss of 2 micron plasmids in our Southern blotting studies (data not shown). ARS1 contains an ARS consensus sequence (ACS) that conforms to the

PAGE 50

38 consensus observed in most ARS elements and is considered a strong ARS, unlike the rDNA ARS. These preliminary results suggested that pJPA114 may be generally useful to cure cir + strains of 2 micron plasmid DNA. To further test the use of pJPA114 for this purpose, we transformed W303AR5 with pJPA114, streaked independently-isolated transformants to single colonies, obtained isolates lacking pJPA114, and analyzed twelve arbitrarily-chosen isolates by Southern blot analysis (see Materials and Methods). pJPA114 has two technical merits in this experiment. Because pJPA114 contains the rDNA ARS, it is readily lost from transformants grown in the presence of uracil. Loss of pJPA114 can be confirmed by growth on medium containing 5-fluoroorotic acid (5FOA). In this experiment, 2 of 12 yeast isolates lost 2 micron plasmid DNA (Figure 3-1). This confirms our initial findings that pJPA114 transformants lose 2 micron plasmids with a sufficiently high frequency to allow pJPA114 to be useful for curing a strain of the 2 micron plasmid. Two Micron Circle Does Not Reduce Life Span To determine if the presence of 2 micron plasmids influenced replicative life span, microdissection-based life span determinations were done as described (86,92). The two cir 0 strains, yAF7 and yAF8, obtained from the experiment presented in Figure 1 were compared to the parental strain W303AR5. No apparent difference in replicative life spans was observed (Figure 3-2). The average replicative life spans for yAF7, yAF8, and W303AR5 were 22.7 (.2), 21.9 (.3), and 23.5 (.9) generations, respectively. Wilcoxon two-sample paired signed rank tests revealed no statistically significant differences between the three life span curves (p<0.05). Thus, the presence of 2 micron

PAGE 51

39 plasmids in W303AR5 does reduce replicative life span compared to two independentlyisolated, otherwise isogenic strains lacking 2 micron plasmids. Figure 3-2. Life span analysis of cir + and cir 0 yeast. Number of daughter cells (generations) produced per mother cell are plotted as a function of mother cell viability. yAF7 and yAF8 are derivatives of W303AR5 (54) that lack the 2 micron plasmid, and correspond, respectively, to lanes 7 and 8 in Figure 3-1. The number of mother cells (n) analyzed for each curve equals 55, 56, and 55 for yAF7, yAF8, and W303AR5, respectively. The three curves are indistinguishable by Wilcoxon two-sample paired signed rank tests (p<0.05). Two Micron Circle Does Not Accumulate in Old Cells These findings indicate that 2 micron plasmids do not confer a disadvantage insofar as replicative life span is concerned. This suggests that 2 micron plasmids do not accumulate during the aging process. To test this prediction, ~6-generation old yeast cells were prepared by magnetic sorting (see Materials and Methods) and 2 micron plasmid DNA levels were analyzed by Southern blotting. No differences in 2 micron

PAGE 52

40 Figure 3-3. Two micron plasmid levels in young and old cells. Old cells were isolated by biotinylation and magnetic sorting (see Materials and Methods). Bud scars in young and old cells were stained with Calcofluor and counted to determine average age. DNAs from young and old cells were analyzed by Southern blotting as described for Figure 3-1. Size markers (M) are shown (in kb). To normalize levels of 2 micron plasmid DNA to genomic DNA levels, the blot was stripped and rehybridized to 32 P-labeled probe to URA3 2 micron plasmid and URA3 band intensities were quantitated, and no significant difference was found between the ratios of 2 micron plasmid DNA to URA3 DNA in young and old cells. plasmid DNA levels were observed between populations of cells with average ages of 1.1 and 6.2 generations (Figure 3-2). To normalize the amounts of 2 micron DNA present in young and old cell samples to the amounts of genomic DNA present, the relative amount of the URA3 gene was determined by Southern blotting (Figure 3-2). Quantitative analysis of the intensities of bands corresponding to 2 micron plasmid DNA and URA3 was done and revealed no significant difference between normalized 2 micron DNA

PAGE 53

41 levels in young and old cells (data not shown). Previous studies have shown substantial accumulation of ERCs (5to 50-fold) and non-centromeric recombinant plasmids (5to 25-fold) in 7-generation old yeast cells (86). Thus, 2 micron plasmids are unlike ERCs and non-centromeric yeast plasmid vectors, and do not accumulate in old cells. Summary In chapter 2, 2 micron origin plasmids were shown to accumulate. The same is not true for naturally occurring 2 micron circles. They do not accumulate; therefore, they do not reduce lifespan. While only confirming the model of plasmid aging, the loss of 2 micron circles in transformants of pJPA114 is very interesting. What is pJPA114 doing to cause 2 micron circle loss?

PAGE 54

42 CHAPTER 4 A CELLS LIMITED RESOURCES AND PLASMID COMPETITION The main hypothesis being developed to explain ERC mediated aging revolves around the idea that episomes cause a replication burden in cells. As cells age, they accumulate episomes (93). The episomes eventually reach a high copy number. It is so high, that it is about the same amount of DNA as the yeast genome (93). This means that an old cell is replicating two or more times the amount of DNA it normally replicates. This enormous amount of DNA could require all of a cells replication factors and DNA substrates to complete replication. If one of these factors or substrates is limiting, then the cell may encounter problems during replication. This could result in mutations, double strand breaks, etc. In order to further explore this idea, the following experiments were completed. Sml1p, Mec1p, RNR, and Rad53p Pathway Sml1p and Mec1p are involved in a well know DNA damage and repair pathway (94). Most importantly it senses replication fork slowing and stalls. The cascade starts by Mec1p sensing DNA damage or replication fork stalling. It then signals through Rad53p to Sml1p. Sm11p, an inhibitor, releases and thereby activates Ribonucleotide Reductase (RNR) (Figure 4-1). RNR makes dNTPs from NTPs by removing the 2 hydroxyl from ribose. This reaction results in an increase of cellular pools of dNTPs and the progression of stalled replication forks (94).

PAGE 55

43 Figure 4-1. Mec1p, Rad53p, Sml1p, and RNR pathway (94). This pathway ultimately leads to the production of dNTPs. SML1 Deletions Do Not Increase Life Span. To see whether an increase in the cellular dNTPs pools would counteract the affects of an episomes replication burden, a SML1 deletion was created with the insertion of HIS3 By removing the RNR complex inhibitor, Sml1p, dNTPs are continuously being

PAGE 56

44 produced no matter what the state of the cell. SML1 deletions are known to increase dNTPs levels in the cell by 2-3 fold. In addition to looking at the life span of SML1 and sml1 strains, transformants of sml1 were also test for an extended life span. The plasmid used was pJPA113. This is the ARS1 plasmid from Figure 2-1B and Table 2-1. Transformed cells may help to amplify the affect sml1 has on a replication burden, since they contain more episomes and have shorter life spans. 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 0 10 20 30 40 Generations Fraction of Cells Viable yAF10+ARS yAF10 sml1 +ARS sml1 Figure 4-2. Life span of SML1 deletions. yAF10 ( HIS3 ; control) had a mean life span of 25.5 and a n=55. sml1 had a mean life span of 25.9 and a n=57. yAF10 + ARS (control) had a mean life span of 12.9 and a n=42. sml1 + ARS had a mean life span of 11.8 and a n=54. The ARS plasmid used was pJPA113 (ARS1). The SMLl1 deletion had the same life span as the control (yAF10). They were statistically indistinguishable using the Wilcoxon two-sample paired signed rank test.

PAGE 57

45 yAF10 is the yAF5 strain with its his3 locus repaired to control for insertion of HIS3 into sml1 The transformed sml1 cells also had the same life span as the transformed control strain (Figure 4-2). Reproducing previous results, the pJPA113 (ARS1) transformants had a mean life span within the standard deviations of the life spans in Table 2-2. Since replication is a doubling process, it is conceivable that an increase in dNTPs of 2-3 fold is not enough to be seen on a life span. In other words, the life span assay may not be sensitive enough. In old cells, episomes account for a large proportion of the total DNA (could be more than half). Since they are retained due to mother cell bias, a division occurring at an old age would increase the total DNA content by nearly double. The only DNA being passed on to the daughter cell would be the chromosomes, not the massively accumulated and newly replicated episomes. The key to this idea is that episomes can reach a quantity larger than that of the genome. A sml1 may only have increased a cells life span by one doubling, not enough to be observed by life span. Old Cells Do Not have an Increased Sensitivity to Hydroxyurea Hydroxyurea (HU) is a chemical inhibitor of the RNR complex (94) It has been widely used when studying Mec1p and Sml1p. Sm11 has an increased resistance to HU. Strains that are sm11 mec1 or sm11 rad53 have an increased sensitivity to HU. Interestingly MEC1 and RAD53 cannot be deleted without a SML1 deletion suppressing their lethality (94). Sml1p has a critical role in HU sensitivity because it is the inhibitor of the RNR complex. Without SML1 it takes more HU to suppress the larger pool of active RNR in the cell. If MEC1 or RAD53 are deleted then Sml1p does not release the RNR complex and the cell cannot make dNTPs. This is why sml1 is required when deleting MEC1 and RAD53 Mec1 sml and rad53 sml1 strains are not less sensitive to HU because of Mec1p and Rad53p regulation of transcription factors

PAGE 58

46 for the RNR proteins through Dun1p (Figure4-1). Without the activation of Dun1p, RNR levels in the cell stay the same and cannot compensate for the inhibition by HU. Figure 4-3. Hydroxyurea sensitivity of young and old cells from 0 mM to 200 mM. Each plate has five rows of pin stamps. Each row is a serial dilution of a strain. The first row is a WT control yAF6. The second row is a WT control W15884C. The third row is sml1 The fourth row is mec1 sml1 The fifth row is rad53 sml1 A change in HU sensitivity by old cells would show that this DNA repair pathway plays a role in the aging process. Two WT, sml1 mec1 sml1 and rad53 sml1 strains were magnetically sorted to get young and old cells. Serial dilutions were pin stamped onto minimal medium plates containing various levels of hydroxyurea. The first pin stamping contained HU concentrations of 0, 50, 100, 200, 300, and 400 mM. As expected the mec1 sml1 and rad53 sml1 strains had an increased sensitivity to HU, while the WT and sml1 were more resistant. There were no noticeable differences in the sensitivity of HU between the young and old cells (Figure 4-3). The 300 and 400 mM HU concentrations are not shown because no strains were able to grow in those conditions.

PAGE 59

47 Figure 4-4. Hydroxyurea sensitivity of young and old cells from 0 mM to 50 mM. Each plate has five rows of pin stamps. Each row is a serial dilution of a strain. The first row is a WT control yAF6. The second row is a WT control W15884C. The third row is sml1 The fourth row is mec1 sml1 The fifth row is rad53 sml1

PAGE 60

48 To further investigate HU sensitivity in old and young cells, a narrower range of HU was examined for the second round of pin stamping. The concentrations of HU used in this experiment were 0, 10, 20, 30, 40, and 50 mM. Again no distinction could be drawn between the HU sensitivity of old cells to the HU sensitivity of young cells. A closer look at concentrations between 0 to 10 mM and 100 to 300 mM may show the differences we are looking for. The increase resistance to HU of sml1 was not shown; therefore, there needs to be a tighter range of concentrations between 100 and 300 mM. It is possible that old cells are more resistant to HU because they are up regulating RNR. Double Strand Breaks Do Not Increase in Old Cells Replication slow zones are regions of DNA within the chromosomes at which replication forks slow down. These zones were first discovered in MEC1 mutants, where the slow zones turned into double stranded breaks (DSB) (95). Since Mec1p is the sensor for stalled replication forks, MEC1 mutants cannot fix stalled forks. In MEC1 mutants, replication forks spend more time at the slow zones. This leads to more DSBs in these replication slow zones. In old cells, the diminishing amounts of dNTPs caused by the episomal replication burden could cause replication forks to stall more frequently and for longer periods of time. This would in turn lead to more DSB. To test whether magnetically sorted old cells have more DSB then young cells, pulse field gels were used to separate chromosomes. After the gel was completed, it was transferred to positively charged nylon and probed with the CHA1 probe. CHA1 is located on one end chromosome III (95). If a DSB occurred, then faint bands should appear below the chromosome III band. These bands are shortened versions of chromosome III. No discernable difference could

PAGE 61

49 be observed between young and old cells. There were no shorter bands on the blot; therefore, there were no DSBs. The original paper describing DSBs in mec1 mutants used a synchronized population of cells. DNA was extracted from cells in the process of S phase. By using cell synchronization, DSB formation in old cell might be able to be seen. Since there is no positive control ( mec1 synchronized) in Figure 4-5, it is hard to say that the absence of DSB detection conclusively shows that DSB do not form in old cells. Figure 4-5. Southern of DSB in yAF6 (WT), W1488-4C (WT), sml1 mec1 sml1 and rad53 sml1 Pulse field gel was run according to materials and methods. Southern was transferred to positively charged nylon under alkaline conditions. The blot was probed with the CHA1 probe described in materials and methods. Phosphorylation of Rad53p Does Not Increase in Old Cells The protein that senses DSB and stalled replication forks in the cell, Mec1p, phosphorylates Rad53p (96) If Rad53p phosphorylation level increases in old cells, then this pathway could be implemented in aging. After magnetically sorting old cells, protein lysates were extracted. Several controls were also completed in parallel. HU causes a

PAGE 62

50 signal cascade through this DNA repair pathway resulting in the phosphorylation of Rad53p and the release of the RNR complex by Sml1p. The phosphorylation can be seen by a shift upward of Rad53p band on a gel (96). A rad53 sml1 strain was added to show which band is the Rad53p (the one not present in this strain). A mecl sml1 strain was used to show a less phosphorylated Rad53p. The western blot shows that there was no increase in the phosphrylation levels of Rad53p between young, old, and older (double magnetic sort) cells. Even between cells that have have a variety of ERC levels ( fob1 WT, and sir2 ), there was no difference in the phosphorylation of Rad53p. Figure 4-6. Rad53p phosphorylation in young and old cells. The upper dispersed band in the W1488-4C (+HU) is the phosphoralated version of Rad53p. The lower tight band in -HU lane of W1488-4C is the unphosphorylted state of Rad53p. Since this is a polyclonal antibody, there is some nonspecific binding to bands still present in the rad53 sml1 (lower band in the blot). ERC Competition with a CEN Plasmid Throughout Yeast Life Span By transforming pAF32 into WT, sir2 and fob1 strains the effects of ERCs on a CEN plasmid ccan be seen. These strains have different levels of ERCs and in turn different life spans. Sir2 produces the most ERCs. WT produce slightly less. Fob1 produces very few. pAF32 is a stable plasmid that contains a CEN element. It represents licensing of a single origin during the accumulation of ERCs. If ERCs cause an episomal replication burden by abnormal licensing of ARSs throughout the genome, then pAF32 should fail to replicate more often in strains with more ERCs.

PAGE 63

51 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 0 10 20 30 40 50 Generations Fraction of Cells Viable W303R5 sir2 fob1 Figure 4-7. Life span of W303R5 (WT), sir2 and fob1 during the CEN loss experiment. W303R5 had a mean life span of 22.4 and an n = 29. Sir2 had a mean life span of 12.6 and an n = 28. Fob1 had a mean life span of 30.1 and an n = 30. We followed the inheritance pattern of pAF32 throughout the life span of the various transformants. Because pAF32 contains the ADE2 gene, its inheritance can be followed by colony color (Appendix I-K). After the pedigree analysis was completed, the life spans of the three strains (with a CEN plasmid) were consistent with the life spans that are already published in the literature (without a CEN plasmid) (Figure 4-7). After a close analysis of the pedigrees, they show that the sir2 stain lost the plasmid at earlier divisions than the both WT and fob1 strains. WT, which has intermediate number of

PAGE 64

52 ERC, had intermediate loss of pAF32. The fob1 strain had the fewest ERCs and the latest lost of the CEN plasmid (Figure 4-8). While there was a low n, this result suggests that ERCs inhibit CEN plasmid replication. It also says that episomes may cause aging in old cells by sequestering needed replication factors away from the genome. 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 0 10 20 30 Generation at which CEN Plasmid was lost Fraction of Cells W303R5 sir2 fob1 Figure 4-8. The age which WT, sir2 and fob1 lose plasmid. CEN plasmids were lost at a mean generation time of 11.4, 6.25, and 14.3 (respectively). The number of cells analyzed in each strain were n = 8, n = 4, and n = 7 (respectively). Mitotic Stabilities in the Presence of ERCs To further investigate ERCs role in the cell, mitotic stabilities were examined. A change in mitotic stability of ARS plasmids may be expected in strains with various

PAGE 65

53 levels of ERCs accumulation. Fob1 WT, and sir2 strains were tested with pAF31 (ARS), pAF32 (CEN), pJPA133 (ARS), and pJPA136 (CEN). The two sets of plasmids were used to control for the use of the ADE2 or LEU2 selectable markers. The sir2 strain had an increased mitotic stability of pAF31. Normally pAF31 has a mitotic 0 10 20 30 40 50 60 70 80 90 100 W303 pAF31 fob1 pAF31 sir2 pAF31 W303 pAF32 fob1 pAF32 sir2 pAF32 Strain/Plasmid Mitotic Stability n = 7 9 11 13 13 14 Figure 4-9. Mitotic stabilities of pAF31 and pAF32. The two plasmids were tested in strains with various amounts of ERCs. stability of 16% (W303). In the sir2 strain, pAF31 had a mitotic stability of 29%. The sir2 strain had a slight increase in the mitotic stability of pJPA133, but it was not significant. The mitotic stability went from 17% (W303) to 21% ( sir2 ), but these

PAGE 66

54 numbers fell within the standard deviation of each other. This could be explained by the smaller size of pJPA133 from that of pAF31. Very small plasmids are known to have different mitotic stability characteristics. The ARS plasmid, pAF31, may have reached a critical threshold in size for ERCs to play a role in mitotic stability. The fob1 strains inability to further reduce the mitotic stability of pAF31 shows that there may be a critical mass of episomes a cell can handle. If the increase in ERCs from fob1 to W303 was not enough to change mitotic stability, then the decrease in size from pAF31 to pJPA133 could be not enough to change mitotic stability. 0 10 20 30 40 50 60 70 80 90 100 W303 pJPA133 fob1 pJPA133 sir2 pJPA133 W303 pJPA136 fob1 pJPA136 sir2 pJPA136 Strain/Plasmid Mitotic Stability Figure 4-10. Mitotic stabilities of pJPA133 and pJPA136. The two plasmids were tested in strains with various amounts of ERCs.

PAGE 67

55 Plasmid Accumulation in sir2 and fob1 Strains Again fob1 sir2 and wt strains were transformed with pJPA133 and pJPA136. Magnetic sorts were completed to obtain young and old cells. The episomal replication burden model predicts that accumulating plasmid will compete. In this example, ERCs will compete with pJPA133 for the replication machinery. The accumulation of the ARS plasmid will decrease in the strains with increased ERC production. Figure 4-11. Southern of showing plasmid competition phenomenon. XhoI digested genomic DNA yields a 8.935 kb LEU2 band. Other bands are plasmid derived. Southerns were completed on the magnetic sorts to quantify the copy number of the plasmids in each strain. As predicted old sir2 cells which contains more ERCs, had fewer ARS plasmids (pJPA133) per cell (165 plasmids/cell). WT had an intermediate number (272 plasmids/cell), and fob1 with the fewest number of ERCs contains the most copies of the plasmid (293 plasmids/cell) in old cells. pJPA133 also had a different copy number in the young strains. The copy numbers were 6, 4.6, and 2.8 with respect to

PAGE 68

56 fob1 WT, and sir2 This again mimicked the results from the old cells, but to a lesser degree. Young and old cells of all of the strains contained relatively the same number of pJPA136 (CEN). This argues for a competition between ARS episomes for replication machinery in the cell. To further extrapolate this idea, episomes may also compete with the genome for the replication machinery and cause aging. Another explanation of this result may be that there is a critical mass of episomes allowed in the nucleus. After that mass is reached episomes begin to be pushed out. 0 50 100 150 200 250 300 350 sir2 pJPA133 wt pJPA133 fob1 pJPA133 sir2 pJPA136 wt pJPA136 fob1 pJPA136 Strains Plasmid Copy Number per Cell Young Old Figure 4-12. Quantitation of plasmid competition Southern. Quantitaion was completed on the blot in Figure 4-11 by a Phosphuor imager. Summary The mechanism by which episomes cause aging has been very illusive. In this chapter several experiments have been designed to tease out the mechanism. Although some experiments gave negative answers, they did give definitive answers. While the

PAGE 69

57 exact mechanism of episomal aging is still not well known, the experiments strongly suggest in what direction subsequent experiments should go. The major experiments in this chapter show a few things: CEN plasmids are lost at younger generation times in strains with more ERCs. The mitotic stability of ARS plasmids increases in strains with more ERCs. Old cells of strains with more ERCs accumulate fewer ARS plasmids. Together they say that as episomes accumulate there is an increasing strain on the cells replication machinery.

PAGE 70

58 CHAPTER 5 CHROMATIN SILENCING AND EPISOME FORMATION The major role of Sir2p in aging is its ability to deacetylate histones. By deacetylating histones in the rDNA, it is silencing the DNA. More specifically it is compacting the chromatin and making it less accessible. This results in fewer ERCs produced and in turn a longer life span. Strains that over express Sir2p have fewer ERCs and live longer. Conversely SIR2 deletions create more ERCs and have a shorter life span because it cannot deacetylate histones. If the histone acetylation status in the rDNA is central in ERC aging, then limiting a cells ability to acetylate histones could be as important as Sir2p ability to deacetylate histones. Histone acetyl transferases (HATs) are the enzymes that acetylate histones. In addition to the enzymes responsible for the acetylation and deacetylation of histones the pool of acetyl CoA may be important to aging. Acetyl CoA is the substrate for HATs in the acetylation of histones. A closer look at the production of acetyl CoA may lead to mutants that increase life span. These ideas are illustrated in Figure 5-1. Two enzymes are responsible for the production of acetyl CoA, Acs1p and Acs2p (Acetyl CoA Synthetase). Acs1p has a K m 30 times lower than Acs2p (97). This does not mean that it does most of the conversion of acetate to acetyl CoA. The two enzymes are regulated very differently. Acs1p is completely repressed by glucose (100 mg/L), up regulated in ethanol, and further increased in acetate medium. Where as Acs2p is maintained at a constant level in glucose and ethanol, but acts sporadically in acetate (97). An ACS2 deletion cannot grow on glucose as a carbon source. This is because of

PAGE 71

59 the repression of ACS1 by glucose. If ACS2 is deleted and ACS1 is repressed by glucose, then there is insufficient ACS activity in the cell, and the cell cannot survive. The cell needs acetyl CoA to survive. Figure 5-1. The acetylation of histones and its affect on ERC production and life span. ACS2 and ACS1 is Required for Normal Life Span Deletions of ACS1 and ACS2 were obtained from the Clusius lab. It was predicted that deletions of the ACS genes would lead to an extended life span. This is because acetyl CoA levels in the cell would drop. Histones would be acetylated less, and the production of ERCs would decrease causing a longer life span.

PAGE 72

60 Life spans were completed on both glucose and ethanol. Surprisingly T23D, the strain background, has a much longer life span than the W303R5 derivatives that have been used in previous studies throughout this dissertation and other strains in published papers. Never the less, there was a reduction in life span in acs1 from the controls. Interestingly acs2 had an even shorter life span than asc1 (Figure 5-2). These reductions in life span are opposite of what one might conclude, from the model described in Figure 5-1. 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 0 20 40 60 80 Generations Fraction of Cells Viable T23D E 621 E 625 E T23D D 621 D Figure 5-2. Life span of ACS deletions. T23D (control) on ethanol (E) had a mean life span of 55.2 and an n=59. 621 ( acs1 ) on ethanol (E) had a mean life span of 47.4 and an n=59. 625 ( acs2 ) on ethanol (E) had a mean life span of 16.6 and an n=51. T23D (control) on glucose (G) had a mean life span of 35.0 and an n=59. 621 ( acs1 ) on glucose (G) had a mean life span of 24.8 and an n=59.

PAGE 73

61 A closer look at metabolism shows that acetyl CoA is used for many processes in the cell besides acetylation of histones. Acetyl CoA is one of the entrance points into the Citric Acid Cycle. It is also used in lipid synthesis. ACS2 is known to be coregulated with structural genes of fatty acid biosynthesis because of an upstream ICRE (inositol/choline-response element). These and other pathways may be more important to a cells health than the predicted decrease in the production of ERCs by the ACS deletions. In addition to looking at the affects of Acs1p and Acs2p in a cell, we inadvertently observed a difference in life span between cells grown on glucose and cells grown on ethanol as a carbon source. When T23D was grown on ethanol it had a mean life span of 55.2 and a maximum life span of 77 Generations. This is longer than the longest life span we have seen published in the literature. To our knowledge the longest life span published is a mean life span of 36.1 and a maximum life span of 74 (98) ACS2 Increases ERC Production To further explore ACS1 and ACS2 s role in aging, ERC production and accumulation was measure in old and young cells of the ACS deletions. According to the model illustrated in Figure 5-1, ACS deletions should lead to a decrease in ERC production. Cells were grown in ethanol and then age fractionated by magnetic sorting. T23D (control) had very few to no ERCs in the old cells. This may be why it has a longer life span than W303R5. What is the genetic difference between T23D and W303R5. T23D is a diploid strain while W303R5 is a haploid. Previous experiments have shown that the ploidy of a strain is not important to life span (99). Another difference is that W303R5 is ade2 his3 leu2 trp1 and ura3 ; and T23D has no

PAGE 74

62 auxotrophic markers. Some of these genes can be compared by life spans that were completely separately, and they do not seem to influence life span. Interestingly, the ACS2 deletion produces more ERCs. While the ACS1 deletion does not produce ERCs. Acs2 s ERC production may attribute to its shortened life span. Figure 5-3. Sorts of young and old ACS deletion strains. The southern blot was probe for rDNA. Light banding in the old acs2 sample can be observed at a high molecular weight. These are ERCs. Summary ACS1 ACS2 ethanol as a carbon source, and fatty acid biosynthesis are all linked to aging. Further exploration is needed to fully understand how acetyl CoA is involved in

PAGE 75

63 aging. Another noteworthy result is that T23D lives longer than W303R5. It would be interesting to know what genetic differences contribute to its extended life span. Many experiments could easily be designed to determine the genes that help it live longer.

PAGE 76

64 CHAPTER 6 LOOKING AT POSSIBLE MECHANISM OF CELLULAR AGING YCA1 and Apoptosis in Yeast Apoptosis and aging are intimately linked. Since programmed cell death, apoptosis, contributes to the aging of metazoans, looking at a known yeast caspase, an apoptotic regulator, seemed reasonable. Yca1p is the only known caspase like protein in yeast (100) It has been shown to be required for hydrogen peroxide induced apoptosis. When YCA1 is deleted, it increases yeast chronological life span (100). To further investigate the role of Yca1p in the aging process we constructed a YCA1 deletion in our W303AR5 strain. It was created by using microhomology to YCA1 and inserting HIS3 inside of the gene (See Materials and Methods). After the insertion of HIS3 into YCA1 we confirmed by southern that the constructed W303AR5 yca1 :: HIS3 strain was correct. A control strain was also created by repairing the his3 locus of the W303AR5 strain. This was to insure that the HIS3 status of the cell would not contribute to a lifespan change. The two strains were compared through replicative life spans (Figure 6-1). There was no statistical difference between the yca1 deletion and the control strain. The interpretation is that while yca1 is necessary for a normal chronological life span, it is not required for replicative life span. This experiment illustrates the fundamental difference between a chronological and replicative life span. A chronological life span demonstrates a cells resilience and ability to replicate after being in a saturated culture full of cells and depleted of nutrients. In a replicative life span, cells are spaced out very far from each other, so it is unlikely that they will run out of nutrients. It is a measure of

PAGE 77

65 a cell replicative potential, not its resilience over time. It is a subtle difference, but important when trying to address different questions about cellular aging. 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 0 10 20 30 40 Generations Fraction of Cells Viable Control yca1 Figure 6-1. Life span of yca1 This life span was completed on rich media (YPD). The control strain had a mean life span of 22.1 (n=60). The yca1 deletion had a mean life span of 21.4 (n=57). Shu Gene Family and Mutation Suppression in Aging Using a CAN1 forward-mutation assay, the SHU (sensitivity to hydroxyurea) genes were discovered. These genes are required to prevent spontaneous mutations. In the assay, 4,847 yeast deletion mutants (from the yeast deletion project) were screened for the ability to spontaneously become canavanine resistant ( can1 ) (101) In collaboration with the laboratory of Rodeny Rothstein, four of the genes discovered in this screen ( SHU1 SHU2 SHU3 and CSM2 ) were looked at by replicative

PAGE 78

66 0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1 0 10 20 30 40 Generations Fraction of Cells Viable W303R5 shu1 shu2 shu3 csm2 4X Figure 6-2. SHU genes role in life span. The mean life span of W303R5 is 24.5 (n=60). The mean life span of shu1 is 25.3 (n=60). The mean life span of shu2 is 25.8 (n=58). The mean life span of shu3 is 23.2 (n=56). The mean life span of csm2 is 22.5 (n=59). The mean life span of the quadruple deletion ( shu1 shu2 shu3 and csm2 ) is 21.5 (n=59). life span. They are believed to be involved in DNA replication. These experiments were completed in the Rothstein lab. These genes ability to suppress mutations and their involvement in DNA replication make them a candidate for having an increased life span. The Rothstein lab had preliminary data that suggested this with one or more of the mutants. After the experiment was completed all strains had very similar life spans (Figure 6-2). A close look at the p-values obtained from the Wilcoxon two-sample paired

PAGE 79

67 signed rank test shows that there may be a small difference between the strains (Table 61). The experiment needs to be repeated (one of the few that has not been) before any major conclusions can be drawn. Table 6-1. P-values of the SHU deletion life spans. Comparison #1 Comparison #2 P-Value W303R5 shu1 0.032 W303R5 shu2 0.003 W303R5 shu3 1.22 x 10 -7 W303R5 csm2 9.07 x 10 -6 W303R5 Quadruple 4.50 x 10 -8 shu1 shu2 0.090 shu1 shu3 1.14 x 10 -4 shu1 csm2 2.12 x 10 -6 shu1 Quadruple 3.30 x 10 -8 shu2 shu3 1.47 x 10 -4 shu2 csm2 1.02 x 10 -5 shu2 Quadruple 4.23 x 10 -6 shu3 csm2 0.016 shu3 Quadruple 1.68 x10 -5 csm2 Quadruple 0.002 Summary This chapter focuses on ideas that were not specifically linked to our episomal aging model. Because these concepts could have played a role in the broader scope of aging, we explored them. It is now known that YCA1 does not affect replicative life span.

PAGE 80

68 We also know that more experiments need to be completed to show definitively the subtle difference between the SHU strains

PAGE 81

69 CHAPTER 7 DISCUSSION Budding yeast is an excellent system in which to study cell-autonomous mechanisms of aging. Mechanisms linked to genome stability, metabolic damage, and metabolic regulation have been found to regulate yeast replicative life span (4547,52,53,102). Sinclair and Guarente have proposed that a key regulator of life span is the cellular level of extrachromosomal rDNA circles ( E R C s) (54). To study this proposal, we have used plasmids to model E R C inheritance and accumulation, two processes that govern E R C levels in yeast cells. Our work shows that plasmid DNAs bring about significant reductions in yeast life span. We find that ARS1 and 2 origin plasmids specifically accumulate in old yeast cells, and that the level of accumulation of ARS1 and 2 origin plasmids in old cells correlates with the extent of reduction in life span. This is the first demonstration to our knowledge of an inverse relationship between DNA episome level in old cells and reduction in life span. We find that plasmids have a direct effect on life span and do not indirectly reduce life span by increasing recombination at the rDNA locus and increasing E R C levels in transformed cells. Analysis of the terminal morphology of senescent cells indicates that plasmids do not cause a stochastic arrest in the cell cycle, which is consistent with a normal aging process. Reduction in life span does not require that plasmids carry rDNA repeat sequences, and the presence of a full-length, functional 9.1 kb rDNA repeat on a plasmid does not augment reduction in life span. These findings confirm the work of Sinclair and Guarente (54), and provide significant new support for their E R C model by directly

PAGE 82

70 demonstrating a relationship between plasmid inheritance, plasmid accumulation, and reduction in life span. Our studies also highlight the value of plasmids as tools to investigate properties of E R C s that are relevant to the aging process in yeast. Why Do ARS Plasmids Accumulate in Mother Cells? It has long been appreciated that ARS plasmids are inherited asymmetrically and accumulate in mother cells (43). This accounts for the high copy number and low mitotic stability of ARS plasmids. However, accumulation of ARS plasmids in cells that are multiple generations old has not been directly demonstrated. Our studies are the first to directly demonstrate that ARS1 -containing plasmids accumulate to high levels in old yeast cells. Although ARS1 plasmid partitioning bias is well known, little is understood about its underlying mechanism. One possibility is that plasmid partitioning bias is due to the nature of cell and nuclear division in budding yeast. During closed mitosis in yeast, an intact nucleus elongates along the axis of the mitotic spindle and adopts an elongated dumb-bell shape due to constriction of the nucleus at the bud neck. Chromosomes pass though the constriction at the bud neck by virtue of their attachment to the mitotic spindle, which is able to exert force on chromosomes. In the absence of spindle attachment, passage of DNA molecules through the constriction at the bud neck may be limited. Consistent with this notion, the relatively small (1.45 kb) TRP RI plasmid has been shown to be inherited efficiently and to exhibit high mitotic stability (103). The small size of the TRP RI plasmid may allow it to readily distribute between mother and daughter cells through the bud neck constriction. Commonly used yeast recombinant DNA vectors are typically larger than the TRP RI plasmid and require cis acting sequences and trans -acting factors to be stably inherited.

PAGE 83

71 Why Do Budding Yeast Exhibit a Mother Cell Plasmid Segregation Bias? One possibility is that mother cell segregation bias is a mechanism to protect progeny cells from potential parasitic effects of episomal DNAs acquired from the environment. The 2 circle is a commensal episomal DNA that Futcher has depicted as a sexually transmitted selfish DNA (89) The 2 circle depends on its capacity to overcome mother cell segregation bias (see below) in order to survive in a host population in the absence of any selective value. Another possibility is that mother cell segregation bias is a mechanism to increase the longevity of progeny cells by limiting transmission of E R C s. Why Do ARS1 Plasmids Bring About Cellular Senescence More Rapidly than Do E R C s? One possibility is that virgin mothers contain more plasmids than E R C s at the start of life span experiments. Virgin mothers must contain at least one ARS plasmid, but probably contain on average ~0.5 E R C per cell. The difference in origin strength between ARS1 and the rDNA ARS may also be important. ARS1 is a relatively strong ARS, and capable of supporting rapid plasmid accumulation in mother cells. E R C s contain a comparatively weak ARS that is likely to support only relatively slow accumulation in mother cells. The rDNA ARS contains an ACS (ARS consensus sequence) that departs from the consensus at position 1 a change that has been shown to reduce ARS function, primarily by limiting DNA unwinding (81). This difference in strength could explain why ARS1 plasmids bring about senescence in mother cells more rapidly than do E R C s. ARS1 plasmids are replicated more efficiently than E R C s, which increases the rate of ARS1 plasmid accumulation in mother cells compared to E R C s

PAGE 84

72 Do Cis -acting Sequences that Counteract Mother Cell Segregation Bias Suppress Reduction in Life Span by ARS1 Plasmids? Yes, ARS1/CEN4 plasmids reduce life span to a lesser extent than ARS1 plasmids, which is consistent with results of Sinclair and Guarente (54). However, inclusion of CEN4 on ARS1 plasmids suppresses the reduction in maximum life span by ARS1 plasmids, but does not fully suppress the reduction in average life span. Our studies also directly show that ARS1/CEN4 plasmids do not accumulate in ~7 generation old mother cells. The reduction in life span is not specific for the combination of ARS1 and CEN4 The combination of ARSH4 and CEN6 (in pRS314, (77)) reduces average life span with a minimal effect on maximum life span. The fact that centromeric DNA elements suppress reduction in maximum life span supports the conclusion that ARS1 plasmids exert their effect by accumulation in mother cells, as discussed above. Do 2 Micron Circles Reduce Life Span? It is initially surprising that cir 0 cells did not have an increased life span compared to cir + cells, especially since 2 origin plasmids accumulated in old cells. Quickly we realized that the 2 circles and 2 origin plasmids were very different. 2 circles did not accumulate in old cells and 2 origin plasmids did. With this knowledge of 2 accumulation, it becomes obvious that 2 circles would not decrease life span. Why Do 2 Micron Origin Plasmids Reduce Life Span? Although both 2 origin plasmids and 2 circles contain the REP3/STB cis -acting stability element, 2 origin plasmids contain a single 599 bp segment, whereas 2 circles contain two 599 bp segments arranged as an inverted repeat (76,80). More efficient autoregulation of 2 circle copy number and inheritance is likely to prevent accumulation in old cells. It is important to note that 2 circles can be toxic to cells

PAGE 85

73 when present at high copy number. Constitutive expression of the 2 amplification machinery results in high copy number and has deleterious effects on cell growth (76). Similarly, mutations in NIB1/ULP1 result in unusually high levels of 2 circles, formation of large inviable or mitotically arrested cells, and clonal lethality (104). Studies by Dobson and coworkers indicate that an abnormal form of Rep2p, a 2 circleencoded plasmid partitioning protein, accumulates in ulp1 mutants, suggesting that ULP1 is involved in partitioning of 2 circles during mitosis (M. Dobson, personal communication). This suggests that high levels of 2 circles in nib1/ulp1 mutants may result from asymmetric inheritance. In this sense, phenotypes associated with nib1 / ulp1 defects may share mechanistic underpinnings with senescent phenotypes associated with asymmetric inheritance of plasmids and E R C s. Why Do 2 Micron Origin Plasmids Have an Intermediate Effect on Life Span? Although 2 origin plasmids accumulate in ~7 generation old mother cells, they attain levels approximately half that observed with ARS1 plasmids. As mentioned above, comparison of results with 2 origin and ARS1 plasmids supports an important semiquantitative inverse relationship: the extent of plasmid accumulation in old cells correlates with the extent of reduction in life span. Why Does Transformation with pJPA114 Lead to 2 Micron Circle Loss? Recent studies of 2 micron plasmid partitioning have made great strides in revealing roles for cis-acting elements and trans-acting factors in substantial cellular and molecular detail (105,106). These studies and earlier studies (76,87) suggest that inheritance of 2 micron plasmids has little mechanistic overlap with inheritance of replicating (ARS) plasmids such as pJPA114. Thus, it seems unlikely that pJPA114 competes with 2 micron circle for a limiting amount of (a) specific mitotic partitioning

PAGE 86

74 factor(s). Another possibility is that pJPA114 adversely affects 2 micron circle copy number, which in turn adversely affects transmission to daughter cells. We have observed that 2 micron circle DNA levels are reduced 30-40% in ~7-generation old cells containing yeast replicating plasmid pJPA113, but not in ~7-generation control cells lacking pJPA113. pJPA113 accumulates to high levels in ~7-generation old cells (86), and perhaps 2 micron circle DNA levels are reduced as a result of this accumulation. pJPA114 attains a high copy number in young cells (86), and is likely to accumulate in old cells, like pJPA113. Although these findings are not conclusive, they are consistent with competition between pJPA114 and 2 micron circles for DNA replication factors and/or precursors, which could lead to reduced 2 micron circle copy number and impaired transmission to daughter cells. By What Mechanism(s) Do Plasmids, and by Implication E R C s, Reduce Life Span in Yeast? It is clear that asymmetric inheritance of plasmid DNAs has the potential to burden mother cells with high DNA content. If we assume that a 5 kb plasmid is replicated once each S phase, and uniformly inherited by the mother cell during M phase, then 12 doublings will yield a plasmid DNA content in excess of the nuclear genomic DNA content (5 X 2 12 = 20.5 Mb plasmid DNA content > ~13 Mb nuclear genomic DNA content). Of course, this example is an oversimplification and omits factors such as origin firing frequency and segregation efficiency. However, we note that after 12 generations, 90% of pJPA113 (5.7 kb ARS1 plasmid) transformants were senescent and after 20 generations, 90% of pJPA133 (4.8 kb ARS1 plasmid) transformants were senescent. The fact that significant percentages of senescent mother cells arise between 10 and 20 generations is consistent with the accumulation of plasmid DNA content to a

PAGE 87

75 level that approaches or exceeds nuclear genomic DNA content. Similarly, Sinclair and Guarente have estimated that the E R C content of old cells exceeds the content of the linear genome (54). Why Are There Less Plasmid Accumulation in Strains that Produce More ERCs? This concept of plasmid competition brings us to believe that there is a replication burden in old cells. Two things could cause the loss of pAF32 (CEN), when it is in the presence of ERCs. A limiting replication factor or DNA substrate could be soaked up by the large quantity of ERCs and not allow the single copy pAF32 to replicate. In another scenario the ERCs could act almost like a physical barrier making it harder for the plasmid to leave the cell. Inheritance and replication are the two mechanisms that are central to the characteristics and behavior of plasmids. The mitotic stability in sir2 WT, and fob1 eliminates the concept of ERCs acting as a physical barrier for inhertance of pAF32. It also raises new questions when looking at the ARS plasmids (pAF31 and pJPA133). Returning to the two plasmid processes, ERCs could be increasing plasmid inheritance or replication. While it is unlikely that ERCs are causing an increase in replication, a look at inheritance allows us to start constructing some models. It is possible that there is a limited amount of space in the nucleus. The total number of episomes cannot be higher than some critical mass of DNA. This would cause the two accumulating episomes to be pushed out of cells and inherited better. Saturation of the plasmid bias machinery could be another mechanism that increases mitotic stability. Episome accumulation in old cells of strains that produce various levels of ERCs shows us that plasmid competition is very real. The reduced level of pJPA133 in sir2 is about half of the copy number than in W303R5. This is dramatic. The most important

PAGE 88

76 part of the plasmid competition phenomenon is whether, it is an output of how episomes causes aging. Mechanistically these two ideas could be very similar. If this is true, we will be able utilize the versatility of plasmids to discover how ERCs cause aging. Is There Episomal Aging in Metazoans? While ERCs have not been found in metazoans, it is hard to say that the absence of evidence for them proves there is no episomal aging is higher organisms. It is possible that another highly repetitive sequence can recombine to form episomes, but they have been very difficult to detect. Also, DNA viruses could be interpreted as episomes that reach high copy within a cell. An analogy can be draw between ERC replication stress and viral commandeering of a cells replication machinery. Both may lead to problems during DNA replication and hence genomic instability. Genomic instability could facilitate the mutations and recombination in various cancer causing genes and increase the incidence of cancer.

PAGE 89

77 CHAPTER 8 MATERIALS AND METHODS This chapter contains the methods and procedure used for experiments throughout this dissertation. Yeast Strains and Plasmids W303AR5 ( MAT a leu2-3,112 his3-11,15 ura3-1 ade2-1 trp1-1 can1-100 RAD5 ADE2::rDNA [cir + ], (54)) was obtained from D. A. Sinclair. yAF5 and yAF6 were constructed by integrating linearized pRS305 and pRS306 (77), respectively, into the leu2-3,112 or ura3-1 loci of W303AR5, respectively, and genotypes were confirmed by Southern blotting. Plasmids were transformed into W303AR5 using a standard lithium acetate method (107). All experiments were done with freshly-prepared, independentlyisolated, colony-purified transformants. Unless otherwise noted, yeast were grown on selective SD drop in medium (88). Descriptions of plasmids are provided in Table 1. A 200 bp fragment containing ARS1 was amplified by P C R with primers 5-GGAAGCTTCCAAATGATTTAGCATTATC-3 and 5-CCGAATTCTGTGGAGACAAATGGTG3 using template YRp17. A 200 bp fragment containing the rDNA ARS was amplified by P C R with primers 5-CCAAGCTTGTGGACAGAGGAAAAGG -3 and 5-GGGAATTCATAACAGGAAAGTAACATCC -3 using template pJPA102 (rDNA repeat with AhdI endpoints in pCR4, see below). A 753 bp fragment containing CEN4 was amplified by P C R with primers 5-GCGGATCCCCTAGGTTATCTATGCTG -3 and 5-GGGAATTCCTAGGTACCTAAATCCTC-3 using template YCp50. A 1346 bp region of 2 circle DNA, containing the REP3/STB cis

PAGE 90

78 acting stability element and a single 599 bp repeat region, was amplified by P C R with primers 5-CCGGATCCAACGAAGCATCTGTGCTTC -3 and 5-CCAAGCTTTATGATCCAATATCAAAGG -3 using pRS424 as template. rDNA repeats were amplified by P C R using as template size-selected (8-10 kb), genomic DNA that was digested with the appropriate enzyme (AhdI, PsiI, or XmaI). The following primer pairs were used: AhdI endpoints, 5-GGGATCCATGTCGGCGGCAGTATTG-3 and 5-CCTGCAGCTGTCCCACATACTAAATCTCTTC-3 ; PsiI endpoints, 5-GGGATCCTAATATACGATGAGGATGATAGTG3 and 5-CCTGCAGTAATAGATATATACAATACATGTTTTTACC-3 ; XmaI endpoints, 5-CCCGGGGCACCTGTCACTTTGG-3 and 5CCCGGGTAAACCCAGTTCCTCACTAT-3 P C R was performed for 20 cycles with 15-second denaturation and annealing times using PfuTurbo DNA polymerase (Stratagene). P C R products were purified (Qiagen), digested with restriction enzymes and ligated directly into recipient vectors, or cloned into pCR4TOPO (Invitrogen), excised, gel-purified, and ligated into recipient vectors (see Table 21). ARS elements were cloned between HindIII and EcoRI sites. CEN4 was cloned between EcoRI and BamHI sites. The 2 origin was cloned between HindIII and BamHI sites. rDNA inserts were cloned between PstI and BamHI sites in pAF15, which is derived from pRS424 and contains loxP sites that were inserted at EcoRI and SpeI sites using annealed primer pairs: 5-AATTATAACTTCGTATAATGTATGCTATACGAAGTTAT3 and 5-AATTATAACTTCGTATAGCATACATTATACGAAGTTAT -3 (EcoRI); 5-CTAGATAACTTCGTATAATGTATGCTATACGAAGTTAT -3 and 5-CTAGATAACTTCGTATAGCATACATTATACGAAGTTAT-3 (SpeI). All cloned inserts were sequenced in their entirety. Plasmids pJPA105, pJPA106, and pJPA107 (that contain

PAGE 91

79 rDNA inserts) were propagated in E. coli DH5a grown in LB media with 25 g/ml carbenicillin at 30C to avoid insert instability. Mitotic Stability For each plasmid, five transformants were grown in selective SD liquid medium for 2 days at 30C to saturation (OD 600 = 1.1-1.5; 0.5-1X10 7 cfu/ml; growth to late log gave results similar to stationary phase). Approximately 200-250 colony forming units (cfu) of each transformant were plated on non-selective SD medium, grown for 2-3 days at 30C, replica plated onto selective and non-selective agar media, and grown for 3-4 days at 30C. After these plates grow the total number of colonies that grew under no selection are counted from the first plate. The number of colonies that grew under selection are counted from the second plate. Dividing the number of colonies from the second plate by the number of colonies on the first plate gets the percent of cells in the population that had the plasmid. This is the mitotic stability. It is simply the number of colonies that contained the plasmid divided by the total number of colonies. Replicative Life Span Determinations Replicative life span determinations were done essentially as described (92) with a few modifications. Six transformants were streaked individually on one side of an SD agar plate, and 10 virgin mother cells from each (n=60) were positioned in an orthogonal grid pattern. Virgin mothers that failed to give rise to 5 daughters were not included in the data set. Due to the low mitotic stability of ARS-plasmids, it was necessary to start with approximately 250 virgin mother cells from ARS1 -plasmid transformants to obtain n=50-60 for life span determinations. A Zeiss Tetrad microscope equipped with 16X eyepieces was used for micromanipulations as described (88). SD agar plates were weighed at the beginning of each experiment and sterile water was pipetted into four

PAGE 92

80 small notches at the edge of each plate on a daily basis to compensate for evaporation and prevent increases in osmolality, which could potentially affect results (108). During life span experiments, plates were incubated at 30C during the daytime and stored overnight (~12 hours) at 14C. We found that extended periods ( # 24 hours) at 14C reduced life spans of transformants and control strains (data not shown). At the end of a life span experiment, mother cells not having divided for 2 days were transferred to non-selective SD or YPD medium, and cells that resumed mitosis were excluded from the data set. This allowed us to exclude data from mother cells that stopped dividing due to plasmid loss rather than due to cell senescence. Data were entered into an Excel spreadsheet template file (available on request) that automatically calculated relevant life span data values and performed Wilcoxon two-sample paired signed rank tests. Images of terminal cells were collected using a Spot-2 CCD camera (Diagnostic Imaging) affixed to a Zeiss Tetrad microscope and terminal cell morphology analysis was done as described (70) Southern Blot Analysis and Quantitation DNA was extracted from yeast cells using a glass beads/phenol method, digested with restriction enzymes according to the supplier (New England Biolabs), separated on 0.8% agarose gels (200 V/hours), and capillary transferred to positively-charged nylon membrane under alkaline conditions using standard methods (109). For each plasmid copy number and E R C monomer level determination, five plasmid transformants were analyzed in parallel. Digestion with BamHI or PstI yielded single plasmid-specific or genome-specific bands of different sizes that hybridized to 32 P-labeled probe generated by random-primed labeling (New England Biolabs). PstI and BamHI do not cleave rDNA. Genomic bands were used as internal standards for measurements of plasmid levels. Chromosomal rDNA bands were used as internal standards for measurements of

PAGE 93

81 E R C monomer levels. Blots were hybridized first to URA3 or LEU2 probe, followed by stripping and hybridization to rDNA probe. Data from the same blots were used to prepare Figures 2 and 3B. Southern data were acquired with a Typhoon PhosphorImager and analyzed using ImageQuant software (Molecular Dynamics). Pulse field gel electrophoresis was completed at 14C with a Bio-Rad CHEF-DR II. 1% agarose gels were run in 0.5X TBE for 30 hours. The voltage used was 200V with a switch time starting at 5 seconds and ending at 30 seconds. Magnetic Cell Sorting At any given time 1 in 512 cells is an eight generation old cell. This is due to the nature of a doubling population. 1/2 of the cells are new, zero generation daughters. 1/2 of the cell remaining (1/4) are 1 generation old cells. 1/2 of the cell remaining (1/8) are 2 generation old cells. This continues until the number becomes increasingly smaller. To extract the small number of old cells from a large population of cells, magnetic sorting is used. 1x10 8 cells are grown up and labeled with biotin. They are then grown over night in 1 liter of liquid medium. Since new cell wall synthesis occurs at the bud of the emerging cell, no biotin is transferred to the newly divided daughters. This results in a large population of cells that have their oldest cells labeled with biotin and the young cells are not. The cells are then spun down and concentrated into a smaller volume. Strep-avidin coated magnetic beads are mixed with the cells for 2 hours at 4C. All of the subsequent steps are done in the cold to ensure that the cell do not continue to grow. The strong interaction between biotin and avidin allows the magnetic beads to bind to the old cells. The old cells are then pulled out of solution with a strong magnet and the young cells are washed away. Eight washes are used to ensure that the population acquired at

PAGE 94

82 the end of the experiment is homogeneously old. The old cell final product is ready for further use in other experiments. Budscar Histograms After a sort for old cells, a bud scar histogram is conducted to determine the age distribution of the cells collected. When a cell divides a bud scar ring is formed at the point of budding and separation. The bud scar can be stained with a fluorescent dye calcofluor white MR2. A small fraction of old and young cells are stained with calcofluor and the number of bud scars on 50 cells are recorded. This creates a histogram of the number of cells vs. the number of budscars. rDNA Recombination Assay The rDNA recombination assay is designed to quantitate the level of recombination at the rDNA locus. W303AR5 has an ADE2 gene within the rDNA locus. In the absence of the ADE2 gene colonies become red in color, while wild type ADE2 are white. This color phenotype allows the scoring of ade2 colonies to be very easy. Saturated liquid cultures were prepared from five transformants. They were diluted and spread on 15 cm selective SD agar plates containing 5 g/ml adenine hemisulfate and 5 g/ml histidine to enhance red color production. They are allowed to grow at 30C for 2-3 days. The plates are then placed at 4C for 1-2 days for the color to develop. The number of half sector colonies, colonies that are half red half white, are scored in comparison to the number of all white colonies. All other partially sectored or red colonies are ignored. The reason only half sector colonies are scored is because half sectored colonies are colonies that have lost the ADE2 marker on the first division in the colony formation. A completely red colony may have become red at any time in growing in the liquid culture.

PAGE 95

83 By looking at the first division to forming a colony, all of the data can be normalized to a single mitotic event.

PAGE 96

84 APPENDIX A STRAIN: W303AR5+pJPA113 MEDIA: SD aHLW Terminal morphology of senescent cells with its life span directly below the image.

PAGE 97

85 APPENDIX B STRAIN: W303AR5+pJPA116 MEDIA: SD aHLW Terminal morphology of senescent cells with its life span directly below the image.

PAGE 98

86 APPENDIX C STRAIN: W303AR5+pJPA138 MEDIA: SD aHLW Terminal morphology of senescent cells with its life span directly below the image.

PAGE 99

87 APPENDIX D STRAIN: yAF6 MEDIA: SD aHLW Terminal morphology of senescent cells with its life span directly below the image.

PAGE 100

88 APPENDIX E STRAIN: W303AR5+pJPA133 MEDIA: SD aHWu Terminal morphology of senescent cells with its life span directly below the image.

PAGE 101

89 APPENDIX F STRAIN: W303AR5+pJPA136 MEDIA: SD aHWu Terminal morphology of senescent cells with its life span directly below the image.

PAGE 102

90 APPENDIX G STRAIN: W303AR5+pJPA148 MEDIA: SD aHWu Terminal morphology of senescent cells with its life span directly below the image.

PAGE 103

91 APPENDIX H STRAIN: yAF5 MEDIA: SD aHWu Terminal morphology of senescent cells with its life span directly below the image.

PAGE 104

92 APPENDIX I STRAIN: W303R5 +pAF32 MEDIA: YPD Every two rows is the pedigree for a single cell.

PAGE 105

93 APPENDIX J STRAIN: FOB1 +pAF32 MEDIA: YPD Every two rows is the pedigree for a single cell.

PAGE 106

94 APPENDIX K STRAIN: SIR2 +pAF32 MEDIA: YPD Every two rows is the pedigree for a single cell.

PAGE 107

95 A PPENDIX L PLASMIDS USED Table L-1. The plasmids used throughout this dissertation. Plasmid Origin, Insert Marker Backbone Size pJPA105 2 rDNA repeat (XmaI endpoints) TRP1 pAF15 14,829 pJPA106 2 rDNA repeat (AhdI endpoints) TRP1 pAF15 14,746 pJPA107 2 rDNA repeat (PsiI endpoints) TRP1 pAF15 14,747 pJPA113 ARS1 URA3 pRS306 (77) 4,575 pJPA114 rDNA ARS URA3 pRS306 4,575 pJPA116 ARS1 CEN4 URA3 pRS306 5,316 pJPA117 rDNA ARS, CEN4 URA3 pRS306 5,316 pJPA118 rDNA repeat (XmaI endpoints) URA3 pRS306 13,556 pJPA133 ARS1 LEU2 pRS305 (77) 5,698 pJPA136 ARS1 CEN4 LEU2 pRS305 6,468 pJPA138 2 URA3 pRS306 5,703 pJPA148 2 LEU2 pRS305 6,826 pAF15 2 LoxP TRP1 pRS424 (77) 5,692 pAF31 ARS1 URA3,ADE2 pJPA113 6,828 pAF32 ARS1 CEN4 URA3,ADE2 pJPA116 7,568 pRS305 Integrating Vector LEU2 N/A 5,504 pRS306 Integrating Vector URA3 N/A 4,381 pRS424 2 High Copy Vector TRP1 N/A 5,616

PAGE 108

96 APPENDIX M STRAINS USED Table M-1. The strains used throughout this dissertation. Strains Summary Genotype Parent Strain W303R5 WT MAT a leu2-3,112 his3-11,15 ura3-1 ade2-1 trp1-1 can1-100 RAD5 N/A W303AR5 ADE2::rDNA MAT a leu2-3,112 his3-11,15 ura3-1 ade2-1 trp1-1 can1-100 RAD5 ADE2::rDNA W303R5 yAF5 pRS305 integration MAT a leu2-3,112::pRS305(LEU2) his3-11,15 ura3-1 ade2-1 trp1-1 can1100 RAD5 ADE2::rDNA W303AR5 yAF6 pRS306 integration MAT a leu2-3,112 his3-11,15 ura31::pRS306(URA3) ade2-1 trp1-1 can1100 RAD5 ADE2::rDNA W303AR5 yAF7 cir 0 MAT a leu2-3,112 his3-11,15 ura3-1 ade2-1 trp1-1 can1-100 RAD5 ADE2::rDNA cir 0 W303AR5 yAF8 cir 0 MAT a leu2-3,112 his3-11,15 ura3-1 ade2-1 trp1-1 can1-100 RAD5 ADE2::rDNA cir 0 W303AR5 W1588-4C WT MAT a leu2-3,112 his3-11,15 ura3-1 ade2-1 trp1-1 can1-100 RAD5 W303R5 U952-3B sml1 MAT a sml1::HIS3 leu2-3,112 his311,15 ura3-1 ade2-1 trp1-1 can1-100 RAD5 W1588-4C U953-61A mec1 MAT a mec1::TRP1 sml1::HIS3 leu23,112 his3-11,15 ura3-1 ade2-1 trp1-1 can1-100 RAD5 W1588-4C

PAGE 109

97 can1-100 RAD5 U960-5C rad53 MAT a rad53::HIS3 sml1-1 leu2-3,112 his3-11,15 ura3-1 ade2-1 trp1-1 can1100 RAD5 W1588-4C yAF2 sml1 MAT a sml1::HIS3 leu2-3,112 his311,15 ura3-1 ade2-1 trp1-1 can1-100 RAD5 ADE2::rDNA W303AR5 HKY580-10D WT MAT (alpha) leu2-3, 112 his3-11, 15 ade2-1 ura3-1 trp1-1 can1-100 RAD5+ W303R5 RMY178-1A fob1 MAT a fob1::URA3 leu2-3, 112 his3-11, 15 ade2-1 ura3-1 trp1-1 can1-100 RAD5+ HKY580-10D RMY206-5B sir2 MAT (alpha) sir2::HIS3 hmr::TRP1 leu2-3, 112 his3-11, 15 ade2-1 ura3-1 trp1-1 can1-100 RAD5+ HKY580-10D T2-3D WT Diploid (WT at all markers) N/A GG621 acs1 acs1::APT1 T2-3D GG625 acs2 acs2::Tn5BLE T2-3D yAF10 WT HIS3 MAT a leu2-3,112::pRS305(LEU2 ) ura31 ade2-1 trp1-1 can1-100 RAD5 ADE2::rDNA yAF5 yAF1 yca1 MAT a yca1::HIS3 leu2-3,112 his311,15 ura3-1 ade2-1 trp1-1 can1-100 RAD5 ADE2::rDNA W303AR5 W2889-19B shu1 MAT a shu1::HIS3 leu2-3,112 his311,15 ura3-1 ade2-1 trp1-1 can1-100 RAD5 W1588-4C U1672 shu2 MAT (alpha) shu2::K. lactis URA3 leu23,112 his3-11,15 ura3-1 ade2-1 trp1-1 can1-100 RAD5 W1588-4C W4154-3D shu3 MAT a shu3::KANMX leu2-3,112 his311,15 ura3-1 ade2-1 trp1-1 can1-100 RAD5 W1588-4C

PAGE 110

98 11,15 ura3-1 ade2-1 trp1-1 can1-100 RAD5 W3824-21D csm2 MAT a csm2::KANMX leu2-3,112 his311,15 ura3-1 ade2-1 trp1-1 can1-100 RAD5 W1588-4C W4173-16B shu1, shu2, shu3. csm2 MAT a shu1::HIS3 shu2::K. lactis URA3 shu3::KANMX csm2::KANMX leu2-3,112 his3-11,15 ura3-1 ade2-1 trp1-1 can1-100 RAD5 W1588-4C

PAGE 111

99 LIST OF REFERENCES 1. Guthrie, C., and Fink, G. R. (eds) (1991) Guide to Yeast Genetics and Molecular Biology Vol. 194. Methods Enzymol. Edited by Abelson, J. N., and Simon, M. I., Academic Press, San Diego 2. Guarente, L., Ruvkun, G., and Amasino, R. (1998) Proc Natl Acad Sci U S A 95 11034-11036. 3. Johnson, F. B., Sinclair, D. A., and Guarente, L. (1999) Cell 96 291-302 4. Sherman, F. (1991) Methods Enzymol. 194 3-21 5. Smeal, T., Claus, J., Kennedy, B., Cole, F., and Guarente, L. (1996) Cell 84 633642. 6. Motrtimer, R. K., and Johnston, J. R. (1959) Nature 183 1751-1752 7. Defossez, P. A., Prusty, R., Kaeberlein, M., Lin, S. J., Ferrigno, P., Silver, P. A., Keil, R. L., and Guarente, L. (1999) Mol Cell 3 447-455. 8. Kennedy, B. K., Gotta, M., Sinclair, D. A., Mills, K., McNabb, D. S., Murthy, M., Pak, S. M., Laroche, T., Gasser, S. M., and Guarente, L. (1997) Cell 89 381-391. 9. Park, P. U., Defossez, P. A., and Guarente, L. (1999) Mol Cell Biol 19 38483856. 10. Sinclair, D. A., Mills, K., and Guarente, L. (1997) Science 277 1313-1316 11. Cockell, M. M., and Gasser, S. M. (1999) Curr Biol 12 R575-R576 12. Guarente, L. (1999) Nat Genet 23 281-285. 13. Kaeberlein, M., McVey, M., and Guarente, L. (1999) Genes Dev 13 2570-2580. 14. Fritze, C. E., Verschueren, K., Strich, R., and Easton Esposito, R. (1997) EMBO J 16 6495-6509. 15. Tissenbaum, H. A., and Guarente, L. (2001) Nature 410 227-230. 16. Lin, S. J., Defossez, P. A., and Guarente, L. (2000) Science 289 2126-2128.

PAGE 112

100 17. Shure, M., Pulleyblank, D. E., and Vinograd, J. (1977) Nucleic Acids Res 4 11831205 18. Pruss, G. J. (1985) J Mol Biol 185 51-63. 19. Brill, S. J., and Sternglanz, R. (1988) Cell 54 403-411. 20. Sinclair, D. A., and Guarente, L. (1997) Cell 91 1033-1042. 21. Lohr, D. (1997) J Biol Chem 272 26795-26798. 22. Van Duyne, G. D. (2001) Annu Rev Biophys Biomol Struct 30 87-104 23. Kobayashi, T., Heck, D. J., Nomura, M., and Horiuchi, T. (1998) Genes Dev 12 3821-3830. 24. Warner, J. R. (1989) Microbiol Rev 53 256-271. 25. Melese, T., and Xue, Z. (1995) Curr Opin Cell Biol 7 319-324. 26. Dammann, R., Lucchini, R., Koller, T., and Sogo, J. M. (1993) Nucleic Acids Res 21 2331-2338. 27. Rothstein, R., and Gangloff, S. (1999) Nat Genet 22 4-6. 28. Gerber, J. K., Gogel, E., Berger, C., Wallisch, M., Muller, F., Grummt, I., and Grummt, F. (1997) Cell 90 559-567. 29. Hernandez, P., Martin-Parras, L., Martinez-Robles, M. L., and Schvartzman, J. B. (1993) EMBO J 12 1475-1485. 30. Little, R. D., Platt, T. H., and Schildkraut, C. L. (1993) Mol Cell Biol 13 66006613. 31. Lopez-estrano, C., Schvartzman, J. B., Krimer, D. B., and Hernandez, P. (1998) J Mol Biol 277 249-256. 32. Wiesendanger, B., Lucchini, R., Koller, T., and Sogo, J. M. (1994) Nucleic Acids Res 22 5038-5046. 33. Zou, H., and Rothstein, R. (1997) Cell 90 87-96. 34. Kobayashi, T., and Horiuchi, T. (1996) Genes Cells 1 465-474. 35. Miller, C. A., Umek, R. M., and Kowalski, D. (1999) Nucleic Acids Res 27 39213930. 36. Miller, C. A., and Kowalski, D. (1993) Mol Cell Biol 13 5360-5369.

PAGE 113

101 37. Newlon, C. S. (1997) Cell 91 717-720. 38. Rao, H., and Stillman, B. (1995) Proc Natl Acad Sci U S A 92 2224-2228. 39. Reppe, S., Jemtland, R., and Oyen, T. B. (1999) Biochem Biophys Res Commun 266 190-195. 40. Clyne, R. K., and Kelly, T. J. (1997) Methods 13 221-233. 41. Linskens, M. H., and Huberman, J. A. (1988) Mol Cell Biol 8 4927-4935. 42. Brewer, B. J., and Fangman, W. L. (1988) Cell 55 637-643. 43. Murray, A. W., and Szostak, J. W. (1983) Cell 34 961-970. 44. Tschumper, G., and Carbon, J. (1983) Gene 23 221-232. 45. Sinclair, D. A. (2002) Mech. Ageing Dev 123 857-867 46. Tissenbaum, H. A., and Guarente, L. (2002) Dev Cell 2 9-19 47. Jazwinski, S. M. (2002) Annu Rev Microbiol 56 769-792 48. Mortimer, R. K., and Johnson, J. R. (1959) Nature 183 1751-1752 49. Egilmez, N. K., and Jazwinski, S. M. (1989) J Bacteriol 171 37-42 50. Kennedy, B. K., Austriaco, N. R., Jr., and Guarente, L. (1994) J Cell Biol 127 1985-1993 51. Kennedy, B. K., Austriaco, N. R., Jr., Zhang, J., and Guarente, L. (1995) Cell 80 485-496 52. Mandavilli, B. S., Santos, J. H., and Van Houten, B. (2002) Mutat. Res 509 127151 53. Costa, V., and Moradas-Ferreira, P. (2001) Mol Aspects Med 22 217-246 54. Sinclair, D. A., and Guarente, L. (1997) Cell 91 1033-1042 55. Sinclair, D., Mills, K., and Guarente, L. (1998) Annu Rev Microbiol 52 533-560 56. Kennedy, B. K., Gotta, M., Sinclair, D. A., Mills, K., McNabb, D. S., Murthy, M., Pak, S. M., Laroche, T., Gasser, S. M., and Guarente, L. (1997) Cell 89 381-391 57. Fritze, C. E., Verschueren, K., Strich, R., and Easton Esposito, R. (1997) EMBO J 16 6495-6509

PAGE 114

102 58. Gotta, M., Strahlbolsinger, S., Renauld, H., Laroche, T., Kennedy, B. K., Grunstein, M., and Gasser, S. M. (1997) EMBO J 16 3243-3255 59. Smith, J. S., Brachmann, C. B., Pillus, L., and Boeke, J. D. (1998) Genetics 149 1205-1219 60. Kaeberlein, M., McVey, M., and Guarente, L. (1999) Genes Dev 13 2570-2580 61. Brewer, B. J., Lockshon, D., and Fangman, W. L. (1992) Cell 71 267-276 62. Brewer, B. J., and Fangman, W. L. (1988) Cell 55 637-643 63. Kobayashi, T., and Horiuchi, T. (1996) Genes Cells 1 465-474 64. Ward, T. R., Hoang, M. L., Prusty, R., Lau, C. K., Keil, R. L., Fangman, W. L., and Brewer, B. J. (2000) Mol Cell Biol 20 4948-4957 65. Defossez, P. A., Prusty, R., Kaeberlein, M., Lin, S. J., Ferrigno, P., Silver, P. A., Keil, R. L., and Guarente, L. (1999) Mol Cell 3 447-455 66. Benguria, A., Hernandez, P., Krimer, D. B., and Schvartzman, J. B. (2003) Nucleic Acids Res 31 893-898 67. Park, P. U., Defossez, P. A., and Guarente, L. (1999) Mol Cell Biol 19 3848-3856 68. Mays Hoopes, L. L., Budd, M., Choe, W., Weitao, T., and Campbell, J. L. (2002) Mol Cell Biol 22 4136-4146 69. Merker, R. J., and Klein, H. L. (2002) Mol Cell Biol 22 421-429 70. McVey, M., Kaeberlein, M., Tissenbaum, H. A., and Guarente, L. (2001) Genetics 157 1531-1542 71. Conrad-Webb, H., and Butow, R. A. (1995) Mol Cell Biol 15 2420-2428 72. Kirchman, P. A., Kim, S., Lai, C. Y., and Jazwinski, S. M. (1999) Genetics 152 179-190 73. Kim, S., Benguria, A., Lai, C. Y., and Jazwinski, S. M. (1999) Mol Biol Cell 10 3125-3136 74. Jazwinski, S. M. (2000) Trends Genet 16 506-511 75. Jazwinski, S. M. (2000) Ann N Y Acad Sci 908 21-30 76. Broach, J. R., and Volkert, F. C. (1991) in The molecular and cellular biology of the yeast Saccharomyces (Pringle, J. R., ed) Vol. 1, pp. 297-331, 2 vols., Cold Spring Harbor Press

PAGE 115

103 77. Sikorski, R. S., and Hieter, P. (1989) Genetics 122 19-27 78. Bielinsky, A. K., and Gerbi, S. A. (2001) J Cell Sci 114 643-651 79. Carbon, J., and Clarke, L. (1990) New Biol 2 10-19. 80. Rose, A. B., and Broach, J. R. (1990) Methods Enzymol 185 234-279 81. Miller, C. A., Umek, R. M., and Kowalski, D. (1999) Nucleic Acids Res 27 39213930. 82. Christianson, T. W., Sikorski, R. S., Dante, M., Shero, J. H., and Hieter, P. (1992) Gene 110 119-122 83. Pringle, J. R. (1991) Methods Enzymol 194 732-735 84. Coelho, P. S., Bryan, A. C., Kumar, A., Shadel, G. S., and Snyder, M. (2002) Genes Dev 16 2755-2760 85. Oakes, M., Aris, J. P., Brockenbrough, J. S., Wai, H., Vu, L., and Nomura, M. (1998) J Cell Biol 143 23-34 86. Falcn, A. A., and Aris, J. P. (2003) J Biol Chem In Press 87. Futcher, A. B. (1988) Yeast 4 27-40 88. Sherman, F. (2002) Methods Enzymol 350 3-41 89. Futcher, B., Reid, E., and Hickey, D. A. (1988) Genetics 118 411-415 90. Rose, A. B., and Broach, J. R. (1990) Methods Enzymol 185 234-279 91. Tsalik, E. L., and Gartenberg, M. R. (1998) Yeast 14 847-852 92. Park, P. U., McVey, M., and Guarente, L. (2002) Methods Enzymol 351 468-477 93. Falcon, A. A., and Aris, J. P. (2003) J Biol Chem 278 41607-41617 94. Zhao, X., Muller, E. G., and Rothstein, R. (1998) Mol Cell 2 329-340 95. Cha, R. S., and Kleckner, N. (2002) Science 297 602-606 96. Tercero, J. A., Longhese, M. P., and Diffley, J. F. (2003) Mol Cell 11 1323-1336 97. van den Berg, M. A., de Jong-Gubbels, P., Kortland, C. J., van Dijken, J. P., Pronk, J. T., and Steensma, H. Y. (1996) J Biol Chem 271 28953-28959 98. Anderson, R. M., Bitterman, K. J., Wood, J. G., Medvedik, O., and Sinclair, D. A. (2003) Nature 423 181-185

PAGE 116

104 99. Kennedy, B. K., Austriaco, N. R., Jr., and Guarente, L. (1994) J Cell Biol 127 1985-1993 100. Madeo, F., Herker, E., Maldener, C., Wissing, S., Lachelt, S., Herlan, M., Fehr, M., Lauber, K., Sigrist, S. J., Wesselborg, S., and Frohlich, K. U. (2002) Mol Cell 9 911-917 101. Huang, M. E., Rio, A. G., Nicolas, A., and Kolodner, R. D. (2003) Proc Natl Acad Sci U S A 100 11529-11534 102. Aguilaniu, H., Gustafsson, L., Rigoulet, M., and Nystrom, T. (2003) Science 299 1751-1753 103. Zakian, V. A., and Scott, J. F. (1982) Mol Cell Biol 2 221-232. 104. Holm, C. (1982) Cell 29 585-594 105. Mehta, S., Yang, X. M., Chan, C. S., Dobson, M. J., Jayaram, M., and Velmurugan, S. (2002) J Cell Biol 158 625-637 106. Scott-Drew, S., Wong, C. M., and Murray, J. A. (2002) Cell Biol Int 26 393-405 107. Gietz, R. D., and Woods, R. A. (2002) Methods Enzymol 350 87-96 108. Kaeberlein, M., Andalis, A. A., Fink, G. R., and Guarente, L. (2002) Mol Cell Biol 22 8056-8066 109. Wu, P., Brockenbrough, J. S., Metcalfe, A. C., Chen, S., and Aris, J. P. (1998) J Biol Chem 273 16453-16463

PAGE 117

105 BIOGRAPHICAL SKETCH I was born in San Jose, CA on January 7, 1979. At the age of five I moved to Ormond Beach, FL. I went Seabreeze Senior High School (in Daytona Beach, FL) where I graduate as the valedictorian. In August 1997, I started at the University of Florida (UF). In August 1999, I received a Bachelor of Science in Biochemistry from UF. That same month I started the Interdisciplinary Program in Biomedical Sciences at UF, to work on my Ph.D.


Permanent Link: http://ufdc.ufl.edu/UFE0004372/00001

Material Information

Title: Building an Episomal Model of Aging in Saccharomyces cerevesiae
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0004372:00001

Permanent Link: http://ufdc.ufl.edu/UFE0004372/00001

Material Information

Title: Building an Episomal Model of Aging in Saccharomyces cerevesiae
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0004372:00001


This item has the following downloads:


Full Text











BUILDING AN EPISOMAL MODEL OF AGING IN Saccharomyces cerevisiae


By

ALARIC ANTONIO FALCON















A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA INT PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2004

































Copyright 2004

by

Alaric Antonio Falc6n



































This document is dedicated to Peri A. Tong, Manuel A. Falc6n, and Beverly L. Metcalfe
for their unwavering support.
















ACKNOWLEDGMENT S

I thank my mentor, John P. Aris, and my committee (William A. Dunn, Thomas C.

Rowe, and Brian Burke) for helping me become a scientist.




















TABLE OF CONTENTS
Page

ACKNOWLEDGMENT S ........._._._..... .___ ..............iv.....

LI ST OF T ABLE S .............. ..............viii....


LI ST OF FIGURE S ........._._._..... .___ .............._ ix...

AB S TRAC T .........._.._.._ ..............xi..._.... ....


CHAPTER

1 BACKGROUND AND SIGNIFICANCE ........._..._.._ ...._._ .........._..........


Sirdp, rDNA, and Aging .............. ......._ .. .............. 1..
Extrachromosomal rDNA Circles are Discovered ......._.__ ........__ .............2
Components of the rDNA .........._.._...... .............. 3...
Foblp and its Role in ERC Production .........._.__..... .__ .. ....._._.......
ARS of the rDNA .........._..... ........_ ..............6....
Asymmetric Inheritance of ERCs .........._.._........_....._ ............
Summary .........._.__..... .__ ..............7.....


2 DEFINING THE LINK BETWEEN EPIS OMES AND AGING .............. ... ............9


Roles of Different Cis-Acting Plasmid Sequences in Reduction of Yeast Replicative
Life Span ................. .... ......... ............ .... ... ........... .......1
Plasmid Inheritance Correlates with Reduction in Yeast Life Span ................... ...... 17
Plasmids Do Not Significantly Increase ERC Levels ................. ................. ....20
Plasmid Accumulation Correlates with Reduction in Life Span .............. .... .......... 22
Terminal Cell M orphology ........._...... ........ .._.._ ..... ...._.._....... ...........2
Do Functional rDNA Transcriptional Units Play a Role in Reduction in Life Span?31
Summary ............ _...... ._ .............. 3 3...


3 TWO MICRON CIRCLE: A NATURALLY OCCURRING EPISOME' S ROLE IN
AGING ................. ................. 3......... 5.....


New Method for Removal of Two Micron Circle ................. ................ ...._ 36
Two Micron Circle Does Not Reduce Life Span ................ ... .............. ........38
Two Micron Circle Does Not Accumulate in Old Cells ................. ................. ..39
Summary ................. ................. 41.............











4 A CELL'S LIMITED RESOURCES AND PLASMID COMPETITION .................42


Smllp, Meclp, RNR, and Rad53p Pathway ................ ..............42. ...........
SML 1 Deletions Do Not Increase Life Span. ........._._........___ .........._...43
Old Cells Do Not have an Increased Sensitivity to Hydroxyurea. ........._...........45
Double Strand Breaks Do Not Increase in Old Cells .........._.... ........__........48
Phosphorylation of Rad53p Does Not Increase in Old Cells. ............. ...... ........ 49
ERC Competition with a CEN Plasmid Throughout Yeast Life Span ................... ... 50
Mitotic Stabilities in the Presence of ERCs ......___ ..... ...__ ........_..... 52
Plasmid Accumulation in sir2A and foblA Strains ................ ................ ...._ 55
Summary ................. ................. 56.............

5 CHROMATIN SILENCING AND EPISOME FORMATION ................ .............. 58


ACS2 and ACS1 is Required for Normal Life Span ................ ................ ...._ 59
ACS2A Increases ERC Production ................ ..............61. ..............
Summary ................ ..............62. ...............

6 LOOKING AT POSSIBLE MECHANISM OF CELLULAR AGING ................... ..64

YCA1 and Apoptosis in Yeast .............. ... .......... ...............64....
Shu Gene Family and Mutation Suppression in Aging ................. ................. ...65
Summary ................. ................. 67.............

7 DI SCU SSION ................. ................. 69.............


Why Do ARS Plasmids Accumulate in Mother Cells? ........... .. .. .........___......70
Why Do Budding Yeast Exhibit a Mother Cell Plasmid Segregation Bias?............. 71
Why Do ARS1~ Plasmids Bring About Cellular Senescence More Rapidly than Do
ER C s? ............ .... ........._ ........_ .. .. .............7
Do Cis-acting Sequences that Counteract Mother Cell Segregation Bias Suppress
Reduction in Life Span by ARS1~ Plasmids?.............. ................72
Do 2 Micron Circles Reduce Life Span? ......____ .... .. .__ .......__........7
Why Do 2 Micron Origin Plasmids Reduce Life Span? .............. ..............___....72
Why Do 2 Micron Origin Plasmids Have an Intermediate Effect on Life Span?......73
Why Does Transformation with pJPAll4 Lead to 2 Micron Circle Loss?...._........73
By What Mechanism(s) Do Plasmids, and by Implication ERC s, Reduce Life Span
in Y east? ........._.._.. ... ... ..._._ ..... .. .._ ..... .. .. ........7
Why Are There Less Plasmid Accumulation in Strains that Produce More ERCs?.. 75
Is There Episomal Aging in Metazoans? ....__ ......_____ .... .....__........7

8 MATERIALS AND METHODS ............_...... .__ .....___..........7

Yeast Strains and Plasmids ............ .....__ ..............77..
M itotic Stability .............. .. ........... ..............79.......
Replicative Life Span Determinations.............. .............79
Southern Blot Analysis and Quantitation ....__ ......_____ ..... .....__.........8











Magnetic Cell Sorting.............. ................ 8 1
Budscar Histograms ........._._ ......._. .............. 82...
rDNA Recombination Assay .........._._ ...._.._ .. .............. 82...

APPENDIX


A STRAIN: W303AR5+pJPAl l3 MEDIA: SD aHLW .................... .............. 84

B STRAIN: W303AR5+pJPAll6 MEDIA: SD aHLW.........._.._.. ........_.._........ 85

C STRAIN: W303AR5+pJPAl38 MEDIA: SD aHLW .........._.._.. ........_.._........ 86

D STRAIN: yAF6 MEDIA: SD aHLW .............. .................... 87

E STRAIN: W303AR5+pJPAl33 MEDIA: SD aHWu.............. .... .............. 88

F STRAIN: W303AR5+pJPAl36 MEDIA: SD aHWu.............. .................. 89

G STRAIN: W303AR5+pJPAl48 MEDIA: SD aHWu.............. ..................90

H STRAIN: yAF5 MEDIA: SD aHWu.............. ..............91...

I STRAIN: W303R5+pAF32 MEDIA: YPD.............. ...................92

J STRAIN: FOB1A+pAF32 MEDIA: YPD ....__ ......_____ ..... ......._.......93

K STRAIN: SIR2A+pAF32 MEDIA: YPD ........................... .......94

L PLASMIDS USED ............ _...... ._ ..............95....

M STRAINS USED ............ _...... ._ ..............96....

LIST OF REFERENCES.............. ...............99

BIOGRAPHICAL SKETCH ............_...... .__ ............._ 105...


















LIST OF TABLES

Table pag

2-1. Plasmids used in this study. ................ ................. 13......... ..

2-2. Life span data summary.............. ................ 16

6-1. P-values of the SHU deletion life spans. .........._._...... .__ ....._._........6

L-1. The plasmids used throughout this dissertation.............. .............. 95

M-1. The strains used throughout this dissertation. ................ ......... ................ 96


















LIST OF FIGURES


Finure pag

1-1. The pseudoERC strategy ............ ...... ._ ..............3...

1-2. The rDNA repeat. .........._...._ ..............4........_ .....

1-3. Fob 1 mediated expansion of the rDNA. .........._...._ .........._....5_....._.._..

1-4. ERC Formation ............ ..... ._ ..............6....

2-1. Life span analysis of plasmid-transformed yeast. ................ ................ ...._ 15

2-2. Plasmid inheritance studies ........._..... .............. 19.__.. .....

2-3. Extrachromosomal rDNA circle (ERC) formation in yeast transformants ............22

2-4. Plasmid DNA and extrachromosomal rDNA circle (ERC) levels in young and old
cell s ....... ..... ................. 24..............

2-5. Plasmid DNA and extrachromosomal rDNA circle (ERC) levels in young and old
cell s ....... ..... ................. 28..............

2-6. Terminal morphology of senescent cells.............. ................. 30

2-7. Life span analysis of yeast transformed with plasmids containing rDNA repeats.. 32

3-1. Southern blot analysis of pJPAll14 transformants ................ ................. ...._37


3-2. Life span analysis of cir+ and cir0 yeast ................ ..............39. .......... .

3-3. Two micron plasmid levels in young and old cells. ................ ... .............. .....40

4-1. Meclp, Rad53p, Smllp, and RNR pathway (94)............_._. .......___ ........._43

4-2. Life span of SM~L1 deletions ................. ......... ........ ...........4

4-3. Hydroxyurea sensitivity of young and old cells from 0 mM to 200 mM ............... 46

4-4. Hydroxyurea sensitivity of young and old cells from 0 mM to 50 mM. ................ 47











4-5. Southern of DSB in yAF6 (WT), W1488-4C (WT), smllA, meclAsml~A, and
rad53 Asml lA.. ................ ................. 49.............

4-6. Rad53p phosphorylation in young and old cells.............. ................ 50

4-7. Life span of W303R5 (WT), sir2A, and foblA during the CEN loss experiment...5 1

4-8. The age which WT, sir2A, and foblA lose plasmid.............. ................ 52

4-9. Mitotic stabilities of pAF3 1 and pAF32 ................ ................. 53...........

4-10. Mitotic stabilities of pJPAl33 and pJPAl36. ................ ......... ................ 54

4-11. Southern of showing plasmid competition phenomenon.. ................ ................. 55

4-12. Quantitation of plasmid competition Southern ....._____ .......___ ............. 56

5-1. The acetylation of histones and its affect on ERC production and life span............ 59

5-2. Life span of ACS deletions. ........._._. ....___......_. ..........6

5-3. Sorts of young and old ACS deletion strains. ....._._._ ..... ..__. .................62

6-1. Life span of ycalA. ........._._ ......._. ..............65...

6-2. SHU genes role in life span. .........._.__.....__ ......_ .........6
















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

BUILDING AN EPISOMAL MODEL OF AGING IN Saccharomyces cerevisiae

By

Alaric Antonio Falcon

May, 2004

Chair: John P. Aris
Major Department: Anatomy and Cell Biology

Aging in Saccharomyces cerevisiae is under the control of multiple pathways. The

production and accumulation of extrachromosomal rDNA circles (ERC s) is one pathway

that has been proposed to bring about aging in yeast. To test this proposal, we developed

a plasmid-based model system to study the role of DNA episomes in reduction of yeast

life span. Recombinant plasmids containing different replication origins, cis-acting

partitioning elements, and selectable marker genes were constructed and analyzed for

their effects on yeast replicative life span. Plasmids containing the ARS1 replication

origin reduce life span to the greatest extent of the plasmids analyzed. This reduction in

life span is partially suppressed by a CEN4 centromeric element on ARS1~ plasmids.

Plasmids containing a replication origin from the endogenous yeast 2 micron circle also

reduce life span, but to a lesser extent than ARS1 plasmids. Consistent with this, ARS1

and 2 micron origin plasmids accumulate in ~7-generation-old cells, but ARS1/CEN4

plasmids do not. Importantly, ARS1~ plasmids accumulate to higher levels in old cells

than 2 micron origin plasmids, suggesting a correlation between plasmid accumulation










and life span reduction. Reduction in life span is not an indirect effect of increased ERC

levels, nor the result of stochastic cessation of growth. The presence of a fully functional

9.1 kb rDNA repeat on plasmids is not required for, and does not augment, reduction in

life span. These findings support the view that accumulation of DNA episomes,

including ERC s, cause cell senescence in yeast.

The endogenous 2 micron circle is a naturally occurring episomal DNA. Loss of

the 2 micron circle can be facilitated with the transformation of an ARS containing

plasmid. Since 2 micron circles are episomes, and episomes can cause aging,

experiments were complete to show that it does not accumulate in old cells and does not

cause agmng.

In strains that contain more ERCs, ARS plasmids do not accumulate as much.

There is an episomal competition phenomenon. While it is not known what the episomes

are competing for, it can be demonstrated that as the number of different episomes

increase the rate of accumulation for each episome decreases.















CHAPTER 1
BACKGROUND AND SIGNIFICANCE

Saccharomyces cerevisiae is a single-ce Iled, budding yeast. During mitosis,

budding yeast divide asymmetrically. This is different from fission yeast where the two

cells produced by mitosis are indistinguishable. With budding yeast, the new smaller cell

(the daughter cell) emerges from the older, larger cell (the mother cell) (1-4). Because

the mother cell can be distinguished from its daughters, a mother can be followed

throughout all of its divisions. As mothers age, they become enlarged, their cell cycle

slows, and they become sterile (2,5). Daughters can be physically separated from their

mothers with a microdisection microscope. Physical separation is necessary, because it is

difficult to follow a mother cell through all of its divisions if it is obscured by daughter

cells and daughters of daughter cells. By removing the daughters from mothers, and

simultaneously tallying the number of divisions a mother completes, the cell's replicative

life span can be determined. The replicative life span is defined as the number of

divisions a mother cell completes (6). With the ability to conduct replicative life span

experiments and the ease of genetic manipulation, Saccharomyces cerevisiae is an

excellent model organism for aging studies.

Sir2p, rDNA, and Aging

Long and short lived aging mutants have been isolated in Saccharomyces

cerevisiae (7-10). One of the first such mutants identified was SIR4-42, a long lived

mutant that resulted in the localization of the SIR complex to the nucleolus (3,8). The

silent information regulator (SIR) complex is involved in the silencing of chromatin at









the telomeres, mating type loci, and rDNA (2,11,12). The rDNA serves as a nucleolar

organizing region in eukaryotic cells, and is the site of transcription of pre-rRNA (11). In

addition to the findings that implicated the rDNA in life span, the nucleolus was found to

be enlarged and fragmented in old yeast cells (2,3). This was consistent with the notion

that the rDNA played a role in life span determination. More recently, the silencing

protein Sirdp was found to be a nucleolar protein specifically involved in silencing at the

rDNA locus (3). Loss of function sir2 mutations reduce life span (3,12), whereas SIR2

overexpression extends life span (13). Sirdp is now known to function as a histone

deactylase that plays a central role in modulating chromatin structure (13,14). It has been

tied to the extension of life span in metazoan organisms (15), as well as being linked to

the caloric restriction model of aging (16).

Extrachromosomal rDNA Circles are Discovered

Based on SIR4-42 and other findings, Sinclair and Guarente in 1997 showed that

old mother cells accumulated extrachromosomal rDNA circles (ERCs). This was proven

by the use of 2D chloroquine gels and by Southern blots for rDNA. 2D chloroquine gels

are used to look for closed circular DNA molecules (17-19). Old cell undigested DNA

on 2D chloroquine gels showed rDNA episomes. The old cells had rDNA episomes and

young cells did not (20). To test the role of ERCs in yeast mother cell aging, replicative

life spans were conducted on cells that had been given pseudoERCs. PseudoERCs are

induced by using a plasmid with a partial rDNA repeat flanked by loxP sites and a

plasmid with Cre recombinase under the control of the galactose promoter. On adding

galactose, the galactose promoter allows the expression of Cre recombinase (21). Cre

recombinase then recombines the sequence between the loxP sites out of the plasmid

(22). This creates the pseudoERC, a partial rDNA repeat with a selectable marker and no










extraneous segregation or replication mechanisms (Figure 1-1). These pseudoERCs

cause an earlier onset of senescence (20). More specifically, the cell that had the

induction of pseudoERCs had a lower replicative life span (20). This suggested that

ERCs are a cause of aging, and are not produced as an effect of aging. This experiment is

the central proof of the ERC mediated aging model. The finding that ERCs could cause

aging was a completely novel aging mechanism.













producesDE Crep- rcmiaeC reomediatesrecobnto atr th lxPsie
resultingin the exision ofthe ASCNadteceaino suoR



Compoentsof th rDN





The ribosomal DNA (rDNA) is present on chromosome XII in a single linear array

of between 100 and 200 head-to-tail repeats (2,3,11,23). Each 9. 1 kb rDNA repeat is

responsible for producing the 5S and 35S pre-rRNA (Figure 1-2) (7,24) These RNAs

are later processed and packaged with proteins to form a ribosome (24,25). One half of

rDNA repeats are usually silent and not actively transcribing the rRNA (11,26). This

excess capacity is to ensure that the vital function of protein synthesis will not be

hindered by the lack of rRNA.






















Figure 1-2.The rDNA repeat. 5S and 35S pre-rRNA are both transcribed in the rDNA.
The 35S is later processed into 18S, 5.8S, and 25S rRNA. Within the NTSs
are the RFB and ARS-rD (both have been shown to be essential for ERC
formation and replication, respectively).

Foblp and its Role in ERC Production

The protein Foblp is required for the replication fork block (RFB) in the

non-transcribed spacer 1 (NTS1) (23,27). It is implicated in the formation of ERCs (7).

The RFB blocks one of the replication forks within the replication bubble (23). This

makes replication unidirectional, in the direction of 35S pre-rRNA transcription (23).

The RFB has been observed in yeast, frog, mouse, human, and plant (28-32). The

ultimate function of the RFB site in yeast is to allow the cell to expand and contract the

number of repeats in the rDNA array by homologous recombination (23) (Figure 1-3).

Because recombination is initiated at a DNA double stranded break (DSB), a crossover

may occur within a sister chromatid by the formation of a Holliday structure (23).

Conversely, recombination can occur upstream, resulting in the loss of a repeat (23). An

apparently unintended consequence of RFB function is the increased production of ERCs

(Figure 1-4) (7). Holliday structures within the rDNA occur 3.6 times per cell cycle (33),

indicating rampant recombination at the locus. In FOB1 deleted strains, there is reduced

recombination at the rDNA locus, because there is no RFB at the RFB site (34). This





















































Figure 1-3.Fob1 mediated expansion of the rDNA. (A) FoblIp acts at each RFB site in
rDNA. (B) Replication begins at ARS-rD and two replication forks travel in
opposite directions. (C) The replication fork traveling in the opposite
direction of 35S transcription is stopped at RFB site. The other replication
fork continues. A double stranded break can occur at the RFB site. (D) A
Holliday structure forms and homologous recombination with the sister
chromatid can repair the break. (E) The closest replication bubble catches up
to the recombination site creating two separate strands of DNA, one of which
has an additional repeat.


~s-~ ~-r


I~


-I1~L


__ __ __ __ _~ _~ _


-~L ~68r


reflects foblA' s reduced formation of ERCs and longer life span (7). This further

implicates ERCs in the aging process.


----


-r-~--~


C ~._~-gL~e. rqs8, ~L ~dL~


~

J~k~


~91P


~'118
~~B








A B3








O, O

Figure 1-4.ERC Formation (A) An ERC can be formed by homologous recombination
and the looping out a circular DNA. (B) They can also be formed by
recombination of the free end of DNA, the product of FoblIp RFB (27).
ARS of the rDNA

Within every rDNA repeat, there is an autonomously replicating sequence (ARS)

or origin of replication (3 5,36). ARSs are AT rich sequences of DNA, to which the

origin recognition complex (ORC) binds (37,38). The ORC complex of proteins is

essential for the initiation of DNA replication (37,3 8). The ARS-rD's (rDNA' s ARS)

biological function is as a site for the initiation of DNA replication within the rDNA

repeat. It is necessary because the repeat locus consists of one to two hundred
head-to-tail 9.1 kb repeats (approximately 1,500 kb in length) (39). Normally, ARSs are

spaced approximately 40 kb apart throughout the yeast genome (37,39,40). By putting an
ARS in every repeat, replication of the genome through this lengthy region can occur

more efficiently than with an ARS at either end of the locus (39). The ARS will also

allow episomal rDNA, such as ERCs, to replicate (20,35). The ARS-rD is considered a

"weak" ARS. That is, any given ARS-rD fires less than once per cell cycle (35,36,39).

Because ARS-rD occurs once in every repeat, every third ARS can fire and still replicate

the locus effectively. The distance between firing ARSs is approximately 30 kb. The









activity of the ARS-rD has been linked to transcriptionally active 3 5S genes (which were

in turn linked to nonsilent euchromatic regions of the locus) (41,42).

Asymmetric Inheritance of ERCs

A phenomenon associated with ERCs is their asymmetric segregation. There is a

natural tendency for the ERCs and ARS plasmids to stay within the mother cell during

cell division (2,3,43). This was demonstrated by pedigree analysis, a technique that

follows the segregation of a non-Mendelian trait through mitosis (20). Mother cells have

a bias to retain the plasmids and not pass them on to their daughters (43). Although this

phenomenon was discovered in 1983, little is known about the mechanism that retains the

plasmids in the mother cells. With ERCs being excised from the genome, replicated by

their endogenous ARS, and segregated preferentially to the mother; there is a massive

accumulation of the episomes in older cells. This is the model of ERC mediated aging

(20). Although the amount of ERCs in very old cells is not known, the number estimated

to be in cells after 15 generations is 500 to 1000 ERCs (20). This accumulation is

thought to be behind the mechanism of ERC mediated aging (20).

Summary

A maj or tenet of the ERC mediated model for replicative aging in Saccharomyces

cerevisiae is that ERCs are nothing more than episomal DNA molecules with an ARS

(20). Evidence for this comes from the observation that a yeast shuttle vector, containing

only an ARS, reduced replicative life span (compared to a control plasmid containing an

ARS and a centromeric (CEN) element) (20). CEN plasmids are maintained at low copy

number and segregate with high fidelity to daughter cells just like chromosomes (44).

ARS plasmids attain a high copy number and show a bias toward retention in mother

cells during mitosis (similar to ERCs) (43). The fact that the ARS plasmid can shorten









yeast mother cell life span suggests that the rDNA sequence per se does not contribute to

ERC mediated aging, and that potentially any extrachromosomal DNA able to replicate

may reduce life span (20).















CHAPTER 2
DEFINING THE LINK BETWEEN EPISOMES AND AGING

The yeast Saccharomyces cerevisiae has proved to be a valuable model organism

for investigating mechanisms of cellular aging (45-47). Central to the biology of aging in

S. cerevisiae is an asymmetric cell division process that gives rise to mother and daughter

cells with different characteristics. Mother cells have a limited capacity to produce

daughter cells, and the decline in this capacity with each generation is referred to as

replicative aging. The limited replicative potential of yeast mother cells has been

recognized since the 1950s (48). Pioneering studies in the Jazwinski and Guarente

laboratories postulated the existence of a senescence factor/substance that accumulates in

mother cells and is transmissible to daughters (49,50). Work in the Guarente lab

identified a heritable "age" locus that regulates yeast life span (51). More recent studies

have made clear that allelic variation at single genetic loci can markedly affect yeast life

span, including extension of life span. This indicates that a process as complex as

cellular aging is controlled by a hierarchical regulatory system. Like in other model

organisms, such as D. melan2oga~ster and C. elegan2s, mutations that influence yeast life

span have been found to exert their effects through different physiological and genetic

pathways, including those that participate in caloric restriction, gene silencing, genomic

stability, growth regulation, mitochondrial function, and stress response (45-47,52,53).

Replicative aging is undoubtedly a complex process, even in a eukaryote as

simple as S. cerevisiae. Different hypotheses have been proposed to explain yeast

replicative aging. One hypothesis proposed by Sinclair and Guarente (54) posits that










replicative aging is caused by progressive accumulation of extrachromosomal rDNA

circles (ERC s) in yeast mother cells. According to this model, ERC s are produced

stochastically by intrachromosomal homologous recombination at the rDNA locus and

are inherited asymmetrically by mother cells, which leads to ERC accumulation and

replicative senescence. The rDNA locus in S. cerevisiae consists of a tandem array of

~150, 9.1 kb direct repeats, each of which encodes the four rRNAs (18S, 5.8S, 25S, and

5S) in precursor form. Many aspects of the ERC model have been supported

experimentally. Numerous studies support the view that ERC s are produced by

homologous recombination, are self-replicating, are inherited asymmetrically, and

accumulate in mother cells (45,54,55).

More controversial is the role ERC s play in the aging process. Are ERC s

"mediators" or "markers" of yeast aging? Certain findings link ERC production with

regulation of life span and support a "mediator" role for ERC s. One of the first life span

extending mutations characterized in yeast (SIR4-42) was found to redirect "silent

information regulator" (Sir) protein complexes to the rDNA locus and limit

recombination (5 1,56). Expression of SIR2, which encodes a nucleolar NAD-dependent

histone deacetylase, correlates with longevity. Sirdp binds to rDNA and suppresses

rDNA recombination and ERC production (57-59). Deletion of SIR2 shortens life span,

whereas overexpression of SIR2 extends life span (60). FOB1 encodes a nucleolar "fork

blocking" protein that binds to the replication fork barrier (RFB) site in rDNA and in so

doing halts DNA replication in the direction opposite of pre-3 5S rRNA transcription (61-

63). The RFB site and the overlapping HOT1 site promote rDNA recombination (63,64).

Mutations in (or deletion of) FOB1 reduce rDNA recombination, lower ERC levels, and









extend life span (65). Recombination of replication forks stalled at RFB sites is

suppressed by Sirdp (66), which partly explains the role of Sir2-dependent silencing in

extending life span. Also, introduction of a plasmid carrying a stretch of rDNA, as an

"artificial" ERC, was shown to reduce life span (54).

On the other hand, ERC s have been interpreted as a "marker" of aging that are a

consequence, not a cause, of aging. Mutations that impair DNA replication,

recombination, or repair have been observed to reduce life span without concomitant

accumulation of ERC s (67-69). However, reduction in life span may be the result of the

combined effects of age-dependent and age-independent processes at work in certain

mutants. The hrmlA mutants, which affect rDNA recombination, age prematurely due to

a combination of the normal aging process and a G2-like cell cycle arrest (69). Similarly,

sgs1 mutants exhibit a shortened life span because of the combined effects of the normal

aging process and cell cycle arrest due to defective recombination (70). Some petite

mutants have been shown to have elevated ERC levels (71), but extended life spans (72).

However, to our knowledge, both elevated ERC levels and extended life span in petite

mutants have not been demonstrated side-by-side in the same strain. A sir2 mutant with

an extended life span was reported to have normal ERC levels (73). More generally, the

effects of SIR2 on life span have been attributed to altered patterns of gene expression,

including altered transcription of rDNA, which may lead to an imbalance in ribosome

synthesis (74,75). Thus, although there is agreement that the rDNA locus plays a key

role in the yeast aging process, the precise role of extrachromosomal DNAs remains

controversial.









To shed light on this controversy, we have developed a plasmid-based model

system to investigate the role of episomal DNAs in reduction of yeast life span. Here we

present the first comprehensive test of the ERC model of yeast aging proposed by

Sinclair and Guarente (54). We constructed three types of recombinant plasmid for this

purpose: ARS plasmids, ARS/CEN plasmids, and 2 CI origin plasmids. ARS plasmids

are most like ERC s in that they are circular DNA molecules with a replication origin but

lack a cis-acting partitioning sequence. Classic pedigree analysis studies by Murray and

Szostak showed that ARS plasmids exhibit a strong bias to be retained in mother cells

during mitosis (43). Thus, ARS plasmids are predicted to accumulate in mother cells like

ERC s, but this has not yet been demonstrated. ARS/CEN plasmids contain a

centromeric DNA region that acts in cis to attach plasmid DNA to the mitotic spindle and

ensure efficient delivery to daughter cells during mitosis. ARS/CEN plasmids should not

accumulate in mother cells. 2 CI origin plasmids typically contain a DNA replication

origin, a cis-acting REP3 STB element, and one copy of an inverted repeat that regulates

plasmid copy number (~20 to 40 copies/cell) (76). The REP3 STB element actively

partitions plasmid DNA to daughter cells during mitosis in cil- yeast strains (i.e., in

strains that contain the endogenous 2 CI circle DNA plasmid that encodes proteins that

interact in transrt~t~rt~t~rt~t~rt~ with REP3 STB) (76). 2 CI origin plasmids are not predicted to

accumulate in mother cells, although the 2 CI plasmid partitioning machinery is not

predicted to exhibit the fidelity of a centromere-based partitioning machinery. We also

constructed a series of plasmids containing functional rDNA repeat units, and tested their

effects on life span. This represents a significant improvement over a previously reported









experiment (54), which employed a non-functional stretch of rDNA (i.e., rDNA

incapable of being transcribed to yield full-length 35S pre-rRNA).

Roles of Different Cis-Acting Plasmid Sequences in Reduction of Yeast Replicative
Life Span

To study the effects of plasmids on yeast replicative life span, we generated two

series of plasmids based on commonly-used integrating vectors-pRS306 and pRS305

(77). In each plasmid, we inserted ARS1, or ARS1~ and CEN4, or the 2 CI circle origin (see

Materials and Methods). ARS1~ (autonomous replicating sequence 1) is a nuclear

genomic DNA replication origin whose function and domain organization have been

studied in detail (78). Centromeric DNA from chromosome IV (CEN4) has been mapped

and functionally dissected (79). The region of the 2 CI circle plasmid extending from

Table 2-1. Plasmids used in this study.
Plasmid Origin, Insert Marker Backbone

pJPA105 2 CI, rDNA repeat (Xmal endpoints) 7RP1 pAFl15
pJPA106 2 CI, rDNA repeat (Ahdl endpoints) 7RP1 pAFl15
pJPA107 2 CI, rDNA repeat (Psil endpoints) 7RP1 pAFl15
pJPAll3 ARS1~ GRA3 pRS306 (77)
pJPAll4 rDNA ARS GRA3 pRS306
pJPAll6 ARS1~, CEN4 GRA3 pRS306
pJPAll7 rDNA ARS, CEN4 GRA3 pRS306
pJPAl38 2 CI GRA3 pRS306
pJPAl33 ARS1~ LEU2 pRS305 (77)
pJPAl36 ARS1~, CEN4 LEU2 pRS305
pJPAl48 2 CI LEU2 pRS305
REP3 through the adj acent 599 bp 2 CI repeat functions as a replication origin as well as a

cis-acting plasmid partitioning element (76,80). The plasmids used in this study are

summarized in Table 2-1.









To evaluate effects on life span, plasmids were transformed into strain W303AR5

(54). For each plasmid, six independently-isolated transformants were analyzed in

parallel, and each life span curve reflects their collective behavior. Selection for the

plasmid was maintained during life span analysis. Virgin mother cells unable to give rise

to 5 daughters were discarded to exclude contributions from mother cells without

plasmid. To identify mother cells that stopped dividing due to plasmid loss, rather than

senescence, cells that had not divided in 2 days were transferred to nonselective medium

and monitored for cell division and colony formation. A low percentage (<10%) of

mother cells were found to give rise to colonies, and were excluded from the life span

data set. Life span plates were incubated during the daytime at 300C, but placed

overnight (~12 hours) at 140C, which gave a slightly, but significantly (p<0.01) longer

life span than observed on plates stored overnight at 40C (Figure 2-1A).

Interestingly, transformants harboring pJPAll3 (ARS1) showed dramatic reductions in

both average and maximum life span compared to the Ura+ control strain yAF6 (Figure

2-1B). yAF6 differs from pJPAll13 transformants only in terms of plasmid DNA

topology (i.e., integrated in yAF6 and episomal in transformants). Transformants

containing pJPAll6 (ARS1~, CEN4) have a reduced average life span compared to yAF6,

but exhibit a maximum life span similar to yAF6 (Figure 2-1B). Thus, addition of a

CEN4 element to an ARS1~ plasmid suppresses reduction in maximum life span, but does

not completely compensate for, or protect against, effects on average life span. Plasmids

containing the 2 CI circle origin of replication were also constructed and analyzed. Yeast

cells harboring pJPAl38 (2 CI ori) show a reduction in both average and maximum life









span (Figure 2-1B). Generally speaking, the extent of reduction in average and

maximum life span in pJPAl38 (2 CI ori) transformants is intermediate between that


Figure 2-1.Life span analysis of plasmid-transformed yeast. Number of daughter cells
(generations) produced per mother cell are plotted as a function of mother cell
viability. A) Life span curves of strain W303AR5 (54) grown on SD
(synthetic dextrose) and S+D (dextrose added after autoclaving) media at
300C during the daytime and stored overnight (~12 hours) at 40C or 140C.
The number (n) of mother cells analyzed per curve is as follows: SD 40C,
n=60; SD 140C, n=59; S+D 140C, n=60. B) Life span curves of W303AR5
transformed with plasmids pJPAll3 (ARS1~), pJPAll6 (ARS1~, CEN4), or
pJPAl38 (2 CI ori), and control strain yAF6 (URA3) (n=55, 47, 57, and 58,
respectively). C) Life span curves of W303AR5 transformed with plasmids
pJPAl33 (ARS1), pJPAl36 (ARS1, CEN4), pJPAl48 (2 CI ori), and control
strain yAF5 (LEU2) (n=38, 33, 41, and 59, respectively). D) Life span curves
of W303AR5 transformed with pJPAll16 (ARS1~, CEN4) determined on SD
and YPD (n=45 and 49, respectively). Life spans of control strains yAF6 and
W303AR5 were determined on YPD (n=50 and 55, respectively). Plasmids
are described in Table 2-1.

observed in pJPAll3 (ARS1) and pJPAll6 (ARS1~, CEN4) transformants (Figure 2-1B).

The results from multiple life span experiments are summarized in Table 2-2.












Table 2-2. Life span data summary.
Plasmid/Strain Mean Life Span Maximum Life Span n*"

pJPAll3 12.4 & 1.8 21.8 & 2.2 4
pJPAll6 23 A 1.4 39 & 2.7 4
pJPAl38 16.3 A 1.8 31.3 & 0.6 3
yAF6 33.2 & 3.0 42 & 1 3
The results reported above were obtained with plasmids carrying a GRA3 selectable

marker. To eliminate the possibility that effects of plasmids on life span were due to

GRA3 or medium lacking uracil, we constructed plasmids with a LEU2 selectable marker

(Table 2-1), and conducted life span experiments on medium lacking leucine. The results

obtained with the LEU2 plasmid series were very similar to results obtained with the

GRA3 plasmid series (Figure 2-1C). pJPAl33 (ARS1~) caused dramatic reductions in

average (9.9 generations) and maximum (17 generations) life spans compared to the Leu+

control strain yAF5. yAF5 yielded an average (30.3 generations) and a maximum (44

generations) life span very similar to the average and maximum lifespan for yAF6 (Table

2-2). Transformants containing pJPAl36 (ARS1~, CEN4) yielded a maximum life span of

38 generations, but an average life span of 24 generations, similar to what was observed

for the GRA3 plasmid pJPAll6 (ARS1, CEN4). Plasmid pJPAl48 (2 CI ori) reduced the

average (15.5 generations) and maximum (31 generations) life span to an extent

intermediate between pJPAl33 (ARS1~) and pJPAl36 (ARS1, CEN4) (Figure 2-1C),

similar to what was observed with the GRA3 plasmid pJPAl38 (2 CI ori) (Figure 2-1B).

The reduction in average life span by ARS1, CEN4 plasmids pJPAll6 and

pJPAl36 was unexpected. A similar plasmid had previously been reported to have no

effect on life span when grown on YPD medium (54). One possible explanation for this









difference was that ARS1, CEN4 plasmids are occasionally lost from mother cells,

causing them to cease division on selective medium prior to senescence, which would

result in a reduction in average life span. To test this, ARS1, CEN4 plasmid

transformants were analyzed on non-selective YPD medium as done previously (54). On

YPD, transformants carrying pJPAll6 (ARS1~, CEN4) were as long-lived as control

strains yAF6 (URA3) and W303AR5 (Figure 2-1D). pJPAll6 transformants analyzed in

parallel on selective SD medium showed a reduction in average life span (Figure 2-1D),

as expected. These findings support the interpretation that ARS1~, CEN4 plasmids, which

are present at near-unit copy number in transformants (see below), are occasionally lost

from mother cells, rendering them unable to divide at a point in their life span prior to

normal senescence.

We have also examined the effects of two well-known plasmids that carry the

7RP1 selectable marker. pTV3 carries the 2 CI origin whereas pRS314 carries ARSH14

and CEN6 (77,80). Life spans of transformants containing each plasmid were analyzed

on medium lacking tryptophan. pTV3 transformants had an average life span of 18.7 and

a maximum life span of 32, both values of which are in good agreement with

corresponding values for the 2 CI origin plasmids pJPAl38 and pJPAl48 (Figure 2-1 and

Table 2-2). pRS3 14 had average and maximum life spans of 21 and 41, respectively,

which are in good agreement with values obtained with the ARS1~/CEN4 plasmids

pJPAll6 and pJPAl36 (Figure 2-1 and Table 2-2). These data allow us to exclude a

specific role for ARS1~ and CEN4 in life span reductions presented above (Figure 2-1).

Plasmid Inheritance Correlates with Reduction in Yeast Life Span

The plasmids used in this study were constructed to explore relationships between

plasmid inheritance and effects on life span. Mitotic stability and plasmid copy number









are widely-used measures of plasmid DNA inheritance. Mitotic stability is defined as the

proportion of a population of cells grown under selection that contains plasmid. We

determined the mitotic stability and plasmid copy number of the plasmids used in life

span experiments. Included in our studies were plasmids containing the rDNA ARS.

rDNA repeats contain a single, relatively weak ARS (81). pJPAll4 and pJPAll7

contain the rDNA ARS at the same position as ARS1 in pJPAll3 and pJPAll6,

respectively (see Table 2-1 and Materials and Methods).

Plasmid pJPAll3 (ARS1~) was found to have a mitotic stability of approximately

20% (Figure 2-2A), which is typical of yeast replicating plasmids containing ARS1,

which exhibit a mother cell partitioning bias (43). pJPAll6 (ARS1~, CEN4) exhibited a

much higher mitotic stability, ~90%, which is consistent with the presence of CEN4

centromeric DNA, and agrees with the mitotic stability of pRS316 (ARSH4, CEN6)

(Figure 2-2A). pJPAl38 (2 CI ori) showed a high degree of mitotic stability, ~90%

(Figure 2-2A). The 2 CI origin plasmid pRS424 had a somewhat lower mitotic stability

by comparison (Figure 2-2A). pJPAll4 (rDNA ARS) has a very low mitotic stability,

<1% (Figure 2-2A). The presence of CEN4 with the rDNA ARS in pJPAll17 improves

mitotic stability to ~3 5% (Figure 2-2A). These results with pJPAl l4 and pJPAl l7 are

consistent with the low efficiency of the rDNA ARS (81). Not surprisingly, it was

impractical for us to carry out life span analyses of transformants containing pJPAll14.
























Figure 2-2.Plasmid inheritance studies. Plasmids are denoted by cis-acting elementss.
See Table 1 for plasmid descriptions. pRS316 (ARSH4, CEN6, (77)) and
pRS424 (2 CI ori, 7RPl, (82)) are included for comparison purposes. A)
Mitotic stability determinations. Mitotic stability is defined as the percentage
of colony forming units in a culture grown under selective conditions that
contains plasmid-borne selectable marker. Side-by-side bars are
determinations from separate experiments. Average and standard deviation
values are plotted. B) Plasmid copy number in toto for cell population.
Average and standard deviation values from Southern blots of genomic DNA
digested with BamHI (filled bars) and PstI (open bars) are shown. C) Plasmid
copy number on a per cell basis. Values were calculated by dividing copy
number values from panel B by mitotic stability values from panel A (average
of both experiments). The variances in copy number values were determined,
assuming a log normal distribution of values. Variances for all values were
near 1.0, with the exception of rDNA ARS plasmid copy number, which had a
variance of 3.0, which is indicative of a higher level of error in this
measurement.

Plasmid copy number was determined using Southern blot analysis. Copy number

was displayed either as the total number of plasmids compared to the total number of

genomes (copy number in the population, Figure 2-2B) or the total number of plasmid

compared to the fraction cells (genomes) that contain a copy of the plasmid (copy number

per cell, Figure 2-2C) by using a plasmids mitotic stability. Copy number determinations

using two different restriction enzymes gave comparable results (Figure 2-2B). pJPAll3

(ARS1) exhibited the highest plasmid copy number (Figure 2-2C). Plasmids pJPAll6

(ARS1, CEN4) and pJPAll7 (rDNA ARS, CEN4) exhibited near-unit copy number









values (Figure 2-2C), which is typical of centromeric plasmids (79), such as pRS316

(ARSH4, CEN6) (77). pJPAl38 (2 CI ori) exhibited a copy number of ~33 (Figure 2-2C),

which is in the range of copy number values reported for other 2 CI origin plasmid vectors

(80). The high copy number of pJPAll13 is primarily due to the asymmetric inheritance

of this plasmid and its accumulation in mother cells, rather than ARS strength per se. We

reach this conclusion because pJPAll4, which contains a weak (rDNA ARS) replication

origin, achieves a copy number almost as great as pJPAll3, which contains a strong

(ARS1) replication origin (Figure 2-2C). Thus, pJPAll3 demonstrates a correlation

between extent of reduction of transformant life span (Figure 2-1B) and tendency to be

inherited asymmetrically and attain a high copy in yeast cells (Figure 2-2C).

Plasmids Do Not Significantly Increase ERC Levels

The results presented above suggest that reduction in life span by the ARS1~ plasmid

pJPAll3 is due to asymmetric inheritance and accumulation in mother cells. An

alternative explanation is that pJPAll3 increases ERC levels in transformed cells, and

thereby reduces life span indirectly. To address this possibility, we measured

recombination at the rDNA locus using an ADE2 marker loss assay and measured ERC

levels in transformed cells by Southern blotting.

To analyze the frequency of recombination at the rDNA locus, we took advantage

of the fact that W3 03AR5 contains ADE2 integrated at the rDNA locus (54).

Recombination between flanking rDNA repeats results in loss ofADE2 and a change in

colony color. The frequency of half-red sectored colonies is a measure of rDNA

recombination rate (events per cell division). Transformation of yeast with plasmid

results in a small increase in rDNA recombination as measured by ADE2 marker loss.

For W303AR5, we find that ADE2 marker loss occurs at a frequency of ~1.3 per









thousand cell doublings (Figure 2--3A), which is in good agreement with frequencies

reported by others (60,68,69). The rate ofADE2 marker loss from yAF6 (URA3) occurs

at ~2.7 per thousand (Figure 2-3A). Transformants containing the three plasmids used in

this study, pJPAll3 (ARS1), pJPAll6 (ARS1, CEN4), and pJPAl38 (2 CI ori), exhibited

marker loss rates of 4.1i, 4.5, and 4. 1 per thousand cell doublings, respectively. The

differences between transformants and yAF6 represent increases of less than 2-fold.

Higher levels ofADE2 marker loss are typically observed in strains with reduced life

spans. For example, short-lived sir2A mutants exhibit ADE2 marker loss rates >10-fold

higher than isogenic SIR2 strains (60).

To directly compare ERC levels, yeast transformants and control strains were

analyzed by Southern blotting, and ERC monomer bands were quantitated (see Materials

and Methods). ERC monomers consist of a single 9. 1 kb rDNA repeat and were chosen

for purposes of quantitation because they are well-resolved from chromosomal rDNA and

other ERC bands on Southern blots. ERC monomer levels in transformants were not

significantly different than ERC monomer levels in control strains. Control strains

W303AR5 and yAF6 (URA3) have approximately 0.0007 and 0.0015 ERC monomers

per total chromosomal rDNA, respectively (Figure 2-3B). Transformants bearing

pJPAll3 (ARS1), pJPAll6 (ARS1, CEN4), and pJPAl38 (2 CI ori) have ERC monomers

levels of 0.0014, 0.001, and 0.001, respectively (Figure 2-3B). These values are within

the error of measurements and are not significantly different (Figure 2-3). For

comparison, we examined yAF5 (LEU2), which contains a copy of pRS305 integrated at

the leu2-113 locus, and found that the ERC monomer level was 0.001, which is

intermediate between W303AR5 and yAF6 (Figure 2-3B). Quantitation of slower-









migrating ERC multimer bands did not reveal significant differences in levels between

transformant and control strains (data not shown). We conclude that plasmids do not

have a significant effect on ERC levels.














Figure 2-3. Extrachromosomal rDNA circle (ERC) formation in yeast transformants.
Plasmids are denoted by cis-acting elementss. See Table 2-1 for plasmid
descriptions. Control strains W303AR5 (W303), yAF5 (LEU2), and yAF6
(URA3) did not contain plasmid. A) ADE2 marker loss assay. The number of
half-red sectored colonies on minimal selective medium per total colony
number defines the per (first) cell division rate of loss of the ADE2 marker
from the rDNA repeat in W303AR5. Total number (n) of colonies scored is
shown. B) ERC monomer levels. Southern blotting analyses of DNA from
transformed and control strains grown on selective media were done to
quantify chromosomal rDNA and ERC monomer band levels (see Materials
and Methods). ERC monomer band intensity was divided by chromosomal
rDNA band intensity to give a normalized ERC monomer/chromosomal
rDNA ratio. Average and standard deviation values are plotted.

Plasmid Accumulation Correlates with Reduction in Life Span

If plasmids reduce life span in a manner analogous to ERC s, then plasmid DNAs

should accumulate in old mother cells. To test this prediction, we used a biotinylation

and magnetic sorting approach to isolate ~?-generation old yeast cells (see Materials and

Methods). Plasmid DNA levels in young and old cells were measured by quantitative

Southern blotting.

The ages of old and young (unsorted) cells were determined by counting bud

scars stained with Calcofluor (83). From single sort experiments, the average ages of









yeast transformed with pJPAll3, pJPAll6, pJPAl38, and yAF6 were 6.9, 7.0, 6. 1, and

6.2 generations, respectively (Figure 2-4A). Young cells from the same cultures were an

average of 1.5, 1.4, 1.1, and 1.1 generations old, respectively (Figure 2-4A). Inspection

of the Southern blot clearly reveals increases in relative amounts of pJPAll13 (ARS1) and

pJPAl38 (2 CI ori) in old cells (Figure 2-4B). pJPAll6 (ARS1~, CEN4) did not

accumulate in old cells, and yields bands similar in their intensities to corresponding

bands from yAF6 (Figure 2-4B). In a striking illustration of the accumulation of

pJPAll3 and pJPAl38 in old cells, the linearized plasmid DNA bands can be observed

by ethidium bromide staining (Figure 2-4D). ERC levels in young and old cells were

also analyzed by Southern blotting. Hybridization to rDNA probe revealed ERC bands

and a broad band corresponding to the rDNA locus on chromosome XII (Figure 2-4C).

We note that all old cell preparations contained increased numbers of both monomeric

and slower-migrating ERC species (Figure 2-4C). The ERC and rDNA repeat bands

collapse to a single 9.1 kb band following digestion with KpnI, which cuts rDNA once

(data not shown).

Chromosomal and plasmid band intensities were quantitated using a

PhosphorImager. Consistent with our determinations in Figure 2-2, pJPAll3 (ARS1) and

pJPAl38 (2 CI ori) are present at high copy number in young cells, but pJPAll6 (ARS1,

CEN4) is not (Figure 2-4E). In ~?-generation old transformants, the plasmid copy

numbers for pJPAll3 and pJPAl3 8 are dramatically increased, reaching values of 254

and 137, respectively (Figure 2-4F). This represents a difference in copy number

between young and old cells of ~13-fold for pJPAll3 and~-6-fold for pJPAl38. By





Figure 2-4.Plasmid DNA and extrachromosomal rDNA circle (ERC) levels in young and
old cells. Panel A conveys the cis-acting elements present in each plasmid
(see also Table 2-1). Plasmids are abbreviated by numbers in panels B-H. All
plasmids carry UR3. Control strain yAF6 (UR3) did not contain plasmid.
Old cells were harvested using a biotinylation and magnetic sorting approach
(see Materials and Methods). A) Age profile histograms of young and old
cells. Number of cells is plotted as a function of number of bud scars (n>40
for each histogram). B) Southern blot of plasmid DNAs. Pstl-digested
genomic DNA yields a 3.67 kb UR3 band. Other bands are plasmid-derived.
Genomic UR3 DNA in lane "Old 113" migrated as two bands due to partial
over-digestion of this sample. C) Southern blot of ERCs. D) Ethidium









bromide stained agarose gel corresponding to the blot in panels B and C.
DNA marker sizes (in kb) are shown. E and F. Plasmid levels in young and
old cells (quantitation of data presented in panel B). G and H) ERC
monomer levels in young and old cells (quantitation of data presented in panel
C). For E-H, ratios of episome plasmidd or ERC monomer) band intensity
divided by chromosomal rDNA band intensity (X1000) are plotted (on a semi
log scale). See Fig. 2-1B for corresponding life span data. Comparable
results were obtained from similar cell sorting and Southern blotting
experiments and are discussed in the Results section.

comparison, 7-generation old pJPAll6 transformants show no significant increase in

plasmid copy number (Figure 2-4F).

In a separate experiment with pJPAll3 and pJPAll6 transformants, in which

genomic DNA was digested with BamHI instead of Pstl, quantitative analysis revealed

that young cells contained 27 and 1.5 plasmids/cell, respectively, whereas old cells

contained 283 and 1.2 plasmids/cell, respectively (data not shown). This corresponds to a

~10-fold increase in plasmid copy number for pJPAll3 in~?7-generation old cells, and no

significant increase in pJPAll6 copy number, which agrees with findings presented in

Figure 2-4E, F.

ERC monomer levels were also quantitated in young and ~?-generation old

transformants and yAF6. ERC monomer levels in young cells were equal or close to

0.001 (Figure 2-4G), which agrees with measurements presented above (Figure 2-3B). In

old cells, however, ERC monomer levels were appreciably higher, and exhibited

increases between ~20-fold to~-70-fold (Figure 2-4H). The levels of ERC s we observe

in ~?-generation old cells appears comparable to ERC levels in sorted cells of similar

age reported by others (e.g., (54,60)), although quantitative analysis of ERC levels in

young and old yeast cells is not commonly reported in the literature.

In the experiment shown in Figure 2-4, ERC monomer levels in yAF6 (URA3) are

higher than in transformants (Figure 2-4H). This raises the question: does the presence










of plasmid reduce ERC levels? In a separate experiment, ERC monomer levels in

young cells were equal or close to 0.001 (ERC monomer/chromosomal rDNA) and ERC

monomer levels in old transformants containing pJPAll3, pJPAll6, and pJPAl38 and in

old yAF6 cells were determined to be 0.083, 0.075, 0.045, and 0.081, respectively (data

not shown). The similar ERC levels in yAF6 and transformants in this experiment

suggest that plasmid vectors do not appreciably affect ERC monomer levels (Figure 2-5).

Does the extent of ERC accumulation in old cells in Fig. 4 agree with predictions

based on our estimates of rates of recombination within the rDNA locus (see above,

Figure 2-3)? If we assume that extrachromosomal rDNA repeats are generated at a rate

of 0.5 per cell per generation, and that ERC s are retained in mother cells, then 6-7

generations should yield an increase of between 32- to 64-fold, which is similar to the

observed range of increase from 20- to 70-fold (Figure 2-4G, H).

We have also quantitated the relative amount of all ERC s (i.e., monomers,

multimers, and concatemers) found in old transformants containing pJPAll3, pJPAll6,

and pJPAl38 and in old yAF6 cells. We found levels, respectively, of 0. 140, 0. 136,

0.086, and 0.238 (extrachromosomal rDNA/chromosomal rDNA; data not shown). These

values mirror levels of accumulation of ERC monomers presented in Figure 2-4H. Thus,

ERC monomers comprise approximately 1/4 to 1/3 of all extrachromosomal rDNA

repeats and are present at similar levels relative to all ERC s in old transformed and

untransformed cells.

To extend these studies, yeast sorting experiments were done with transformants

containing the LEU2 plasmids pJPAl33 (ARS1~), pJPl36 (ARS1, CEN4), and pJPAl48 (2

CI ori), and with the LEU2 strain yAF5. The average ages of sorted yeast transformed









with pJPAl33, pJPAl36, pJPAl48, and yAF5 are 7.1, 7.0, 7.6, and 7.9 generations,

respectively (Figure 2-5A). Young cells from the same cultures were an average of 1.7,

1.0, 1.6, and 1.6 generations, respectively (Figure 2-5A). pJPAl33 and pJPAl48 attain

copy number levels of 119 and 39, respectively, in ~?-generation old cells (Figure 2-5C).

This represents an increase in copy number between young and old cells of ~30- and ~8-

fold for pJPAl33 and pJPAl48, respectively. pJPAl36 did not show a significant

increase in old cells (Figure 2-5C). In comparison to pJPAll3 and pJPAl38, pJPAl33

and pJPAl48 reached lower absolute levels of plasmid in ~?-generation old cells.

However, pJPAl33 and pJPAl48 accumulated to similar extents in terms of fold-

increase. To resolve if this difference in absolute levels of plasmids in old cells was due

to experimental error, sorting experiments with transformants and the control strain were

repeated, followed by Southern analyses. The repeat experiment gave results very similar

to first experiment, both in terms of absolute level of plasmid in young and old cells as

well as fold-increase in young and old cells (Figure 2-5B, C). This indicates that

plasmids with identical ARS1~ origins and CEN4 elements, but with different backbones

and selectable markers, are maintained at different absolute copy number levels in young

and old cells. Nevertheless, similar fold-differences in plasmid levels are observed

between young and ~?-generation old cells. This indicates that ASR1 and CEN4 elements

present on plasmids functionally determine patterns of plasmid inheritance and

accumulation during yeast mother cell replication.

Next, ERC monomer levels in transformants containing pJPAl33, pJPAl36, and

pJPAl48, and in strain yAF5 were quantitated. In young cells, ERC monomers were

detected at relatively high levels (Figure 2-5C). However, ERC monomer levels in ~7










generation old cells were similar to levels observed above for pJPAll3, pJPAll6, and

pJPAl38 transformants (compare Figures 2-4H and 2-5D). Thus, ERCs in the Leu+

transformants showed accumulation over a range of ~3-fold to ~12 fold between young

and old transformants. This range of fold-increase is approximately 7-fold lower than the

~20-fold to ~70-fold increase in ERC levels between young and old Ura+ transformants.

This suggests that the rate of ERC accumulation during the aging process is regulated so

that old cells of similar ages contain similar levels of ERC s despite differences in initial

levels of ERC s in young cells.























Figure 2-5.Plasmid DNA and extrachromosomal rDNA circle (ERC) levels in young and
old cells. Plasmids are abbreviated by numbers in panels B-E. Panel A
conveys the cis-acting elements present in each plasmid (see also Table 2-1).
All plasmids carry LEU2. Control strain yAF5 (LEU2) did not contain
plasmid. Data were collected as described in Fig. 4. A. Age profile
histograms of young and old cells. B and C. Plasmid levels in young and old
cells (semi log plot). Data from two Southern blotting experiments are shown
(Exp 1 and Exp 2). D and E. ERC monomer levels in young and old cells
(semi log plot). See Fig. IC for corresponding life span data.









An important trend emerges from our studies of plasmid accumulation in old cells.

Plasmids that accumulate to the greatest degree in old cells (Figures 2-4 and 2-5) exert

the most profound effect on life span (Figure 2-1). ARS1 plasmids attain the highest copy

numbers in old cells and have the most pronounced effect on life span. ARS1 /CEN4

plasmids maintain a copy number near unity in young and old cells and have a small

effect on maximum lifespan and a moderate effect on average life span. Plasmids with 2

CI origins attain a copy number in old cells roughly half that of ARS1 plasmids and reduce

life span roughly half as much as ARS1 plasmids. This suggests the existence of an

inverse relationship between plasmid accumulation in old cells and reduction in yeast life

span.

Terminal Cell Morphology

Currently, in the field of yeast aging, there are few approaches available to directly

address the senescent phenotype in old non-dividing cells. To address this issue

indirectly, we scrutinized the "terminal" morphology of cells at the end of their life span

(Appendix A-H). The rationale for this approach is that cell morphology is a phenotypic

indicator of cell cycle stage and can serve as a basis to compare senescent cells (70). If

cell morphology in terminal transformed cells is very different from the morphology of

terminal wild type cells, this would imply that different mechanisms may bring about the

senescent phenotype in transformed and untransformed cells.

To examine terminal yeast cells, images of terminal cells were collected from

three different life span experiments. Three different cell morphologies were scored:

unbudded cells, single-budded cells with small buds, and single-budding cells with large

buds (70). Bud emergence in S. cerevisiae correlates with entrance into S phase, and









small buds are indicative of early S phase, whereas large buds are indicative of late S/G2

or mitotic arrest. Unbudded cells are in G1 phase. Between 10-15% of the terminal cells,

transformed or untransformed, had multiple buds (data not shown) and were omitted

from this comparison. For pJPAll3 (ARS1) and pJPAll6 (ARS1~, CEN4) transformants,

and W303AR5, more than 50% of terminal cells were unbudded (Figure 2-6). Typically,


Figure 2-6. Terminal morphology of senescent cells. Cells at the end of life span
experiments were classified according to budding pattern as described (70).
Small buds were defined as having a diameter less than 25% of the diameter
of the mother cell. All other buds were classified as large. Average and
standard deviation values from three independent experiments are shown (n
>40 for each transformant or control strain in each experiment).

between 50% and 60% of senescent yeast cells have been found to be unbudded (69,70).

pJPAll6 transformant cells consistently yielded the highest proportion (~65%) of

unbudded cells (Fig. 6). yAF6 (URA3) and pJPAl38 (2 CI ori) transformants ceased

dividing with a predominance, yet a lower percentage, of unbudded cells (Figure 2-6).









Thus, the maj ority of pJPAll13 transformants, like W303AR5 cells, senesced in G1, as

expected. In addition, similar proportions of small budded and large budded terminal

cells in senescent pJPAll3 transformants and W303AR5 cells (Figure 2-6) indicate that

similar proportions of these cells arrested in similar phases (S or G2 M) of the cell cycle.

Thus, this analysis supports the interpretation that pJPAll3 (ARS1) reduces life span by a

normal aging process.

Do Functional rDNA Transcriptional Units Play a Role in Reduction in Life Span?

Although plasmids without rDNA sequences reduce yeast life span, it is important

to consider a potential role for rDNA sequences in life span reduction. It is possible that

ERC s reduce life span in a manner that is mechanistically more complex than the

manner in which plasmid episomes reduce life span. There are significant differences in

coding potential between plasmids and ERC s. The 9. 1 kb rDNA repeat carries genes for

rRNA precursors as well as the gene TAR1, which lies on the strand opposite the 25S

rRNA and encodes a mitochondrial protein (84). One way to address this issue is to ask

whether or not a plasmid vector carrying an rDNA repeat unit has a more pronounced

effect on life span than plasmid vector alone. It is important to note this issue was not

completely addressed in a previous study employing the rDNA-containing plasmid

pDS163 (54). Plasmid pDS163 does not contain a functional 9.1 kb rDNA repeat unit.

The rDNA on pDS163 consists of a 12. 1 kb insert extending from an EcoRI site within

the coding sequence of 5.8S rRNA to the 5'-most EcoRI site in the 25S rRNA coding

region (data not shown). The 12.1 kb fragment does not carry a full-length 35S pre-

rRNA transcription unit and is capable of producing only a truncated 35S pre-rRNA

transcript, which if processed would be incapable of yielding mature 25 S rRNA.









To determine if an episomal rDNA repeat influences life span, we constructed

three plasmids containing 9.1 kb rDNA repeats and used them in life span experiments.

The three plasmids, pJPA105, pJPA106, and pJPA107 contain 9.1 kb repeats with

different endpoints in the plasmid pAFl5, which contains a 2 CI origin (see Materials and

Methods, and Table 2-1). Plasmid pJPA105 contains a repeat with Xmal end points,























Figure 2-7.Life span analysis of yeast transformed with plasmids containing rDNA
repeats. Number of daughter cells (generations) produced per mother cell are
plotted as a function of mother cell viability. Life span analysis was done as
described in Figure 2-1 using W303AR5 carrying plasmids pJPA105 (n=45),
pJPA106 (n=43), or pJPA107 (n=46) and control plasmid pAFl15 (n=46).
Plasmids pJPA105, pJPA106, and pJPA107 contain full length (9.1 kb),
rDNA repeats with different endpoints (see Table 2-1 and Materials and
Methods). pJPA105 contains an rDNA insert with Xmal endpoints, which has
been shown to be functional in vivo (85).

which has been shown by Nomura and colleagues to functionally complement an rDNA

deletion in vivo (85). pJPA106 and pJPA107 contain repeats with Ahdl and Psil

endpoints, respectively, which should not interfere with rDNA gene expression (Figure 1-

2). A 2 CI origin plasmid was used because plasmids constructed with rDNA inserts









whose replication relied solely on the rDNA ARS were found to integrate into the

chromosomal rDNA locus with high frequency (as determined by Southern blot analysis;

data not shown). Life span determinations of W303AR5 transformants containing

pAFl15, pJPA105, pJPA106, and pJPA107 were done as described above (see Figure 2-

1). pJPA105, pJPA106, pJPA107, and pAFl5 transformants gave very similar life span

curves, indicating that the presence of a functional rDNA repeat does not have a dramatic

effect on life span (Figure 2-7). All four plasmids affect life span to an extent similar to

the 2 CI origin plasmids pJPAl38 and pJPAl48 (Figure 2-1B, C), although the average

life spans for pJPA105, pJPA106, pJPA107, and pAFl15 (13.3, 11.8, 11.7, and 12.2

generations, respectively) are lower than the average life spans for pJPAl38 and

pJPAl48 transformants (15.5 and 16.3 generations, respectively; Figure 2-1 and Table 2-

2). Life span curves for pJPA106 and pJPA107 transformants did not show a statistically

significant difference from pAFl5 transformants based on the Wilcoxon signed pair rank

test (p>0.05) Only transformants carrying pJPA105 and pAFl5 exhibited a statistically

significant difference (p<0.05), but this represents a small increase in life span of

transformants carrying pJPA105. These findings support the conclusion that the presence

of a full-length rDNA repeat per se does is not required for, and does not necessarily

augment, reduction in yeast life span.

Summary

Our studies show that yeast plasmids accumulate in mother cells and reduce

replicative life span. The effect of plasmids on life span appears to be a direct effect, and

not an indirect effect on ERC levels in mother cells. A functional rDNA repeat unit is

not required for reduction in life span, and the presence of a functional rDNA repeat does

not augment reduction in life span by plasmids. Thus, plasmids containing ARS










elements appear to "mimic" ERC-mediated reduction in life span. These findings

provide strong evidence that replicative aging in S. cerevisiae is caused by accumulation

of episomal DNA. The fact that functional rDNA sequences are not required for

reduction in life span argues that expression of rDNA genes present on ERC s is not a

causative process in yeast aging. This indicates that accumulation of episomal DNAs,

such as ARS plasmids and ERC s, is one mechanism by which yeast life span is

regulated.















CHAPTER 3
TWO MICRON CIRCLE: A NATURALLY OCCURRING EPISOME' S ROLE IN
AGING

One of the processes that has been proposed to regulate replicative life span in the

budding yeast Saccharomyces cerevisiae is the accumulation of extrachromosomal rDNA

circles (ERCs) by yeast mother cells (54). ERCs are generated by recombination within

the rDNA repeat region on chromosome XII and are passed on to daughter cells

infrequently due to an inheritance bias exhibited by replication origin-containing DNA

episomes (43). We have shown that plasmids containing an autonomously replicating

sequence (ARS; yeast DNA replication origin) reduce life span due to their accumulation

during replicative aging (86). This suggests that DNA episomes in general regulate

replicative aging, and reduce life span due to their accumulation in yeast mother cells.

The majority of laboratory strains of S. cerevisiae contain an endogenous plasmid

known as the two micron (2CI) circle, due to the length of its circular DNA determined by

electron microscopy (76,87). Strains harboring this non-Mendelian genetic element are

denoted cir ; strains lacking it are referred to as ciro (88). Four genes and multiple cis-

acting sequences on the 2 micron plasmid have been mapped and functionally dissected

(76,87). These are responsible for maintaining copy number at approximately 20-40

copies per cell by a recombination-based mechanism and ensuring high fidelity

transmission of the 2 micron plasmid during cell division and mating (76,87,89). There

are no significant growth phenotypes generally associated with the presence of the 2

micron plasmid in cir+ strains, and conversely, negligible growth advantages conferred to









ciro strains (76,87). This has led to the view that the 2 micron plasmid is a "parasitic"

DNA that imposes only a minor selective disadvantage to host strains (76,87). However,

previous studies have not examined the possibility of an effect of the 2 micron plasmid

on replicative life span. A minor effect on replicative life span is not predicted to result

in a discernable difference in vegetative growth rate, and may have been overlooked in

the past. To address this issue we have taken advantage of a novel and simple method for

curing a cir+ yeast strain of 2 micron plasmids. Previously described methods (90,91) for

curing strains of 2 micron plasmids are more time-consuming and are less convenient

than the method described herein.

New Method for Removal of Two Micron Circle

During the course of plasmid copy number studies published elsewhere (86), we

fortuitously observed that transformants containing recombinant yeast shuttle vectors

with an rDNA ARS lost 2 micron plasmid DNA more frequently than was expected,

based on the known inheritance behavior of 2 micron plasmids. In our initial Southern

blotting studies, half of the transformants containing plasmid pJPAll14 (4/8

transformants) or plasmid pJPAll8 (2/4 transformants) lost 2 micron plasmid DNA (data

not shown). Plasmids pJPAll4 and pJPAll8 are derived from pRS306 (77) and have

been described previously (86). pJPAll4 contains a 200 bp insert with the rDNA ARS;

pJPAll8 contains a complete 9. 1 kb rDNA repeat with its ARS. The rDNA ARS has

relatively weak replication origin activity due to the presence of a non-consensus ARS

consensus sequence (ACS) (81). As a result, the maj ority of pJPAll14 and pJPAll18

transformants form colonies slowly on selective SD medium. In instances where fast-

growing pJPAll8 colonies arose on transformation plates or streaks of individual

transformants, Southern analysis revealed that pJPAll8 had integrated into the rDNA









A B
M 1 2 3 4 5 6 7 8 9g d101112 1 2 3 4L 5 6 7 8 1011 12


Figure 3-1.Southern blot analysis of pJPAll14 transformants. Panel A. DNAs from
twelve transformants were digested with Pstl, separated on a 1% agarose gel
and stained with ethidium bromide. Size markers (M) are shown (in kb).
Panel B. DNAs from the gel in panel A were transferred to a nylon
membrane, hybridized to 32P-labeled 2 micron plasmid DNA probe, and
visualized with a PhosphorImager. The 6318 bp 2 micron plasmid contains
one PstI site and yields a single 6.3 kb band (arrowhead). The faint bands
above and below the 2 micron plasmid band likely correspond to
hybridization to regions of homology in yeast chromosomes (e.g., a region of
homology in Ch III yields a PstI fragment of 7747 bp, which corresponds to
the size of the upper faint band). Longer exposures of the Southern blot
revealed no detectable bands in lanes 8 and 9 (data not shown).

locus (data not shown). Transformants containing pJPAll8 were not studied further

because of the relative frequency with which pJPAll18 integrated into the rDNA repeat

locus. Fast-growing pJPAll4 transformants arose only very infrequently and were not

analyzed for plasmid integration by Southern blotting. Transformants containing plasmid

pJPAll3 (86), which is derived from pRS306 but contains the ARS1~ origin instead of the

rDNA ARS, did not show loss of 2 micron plasmids in our Southern blotting studies (data

not shown). ARS1~ contains an ARS consensus sequence (ACS) that conforms to the


lie~iC1)3dC~~









consensus observed in most ARS elements and is considered a strong ARS, unlike the

rDNA ARS.

These preliminary results suggested that pJPAll4 may be generally useful to cure

cir+ strains of 2 micron plasmid DNA. To further test the use of pJPAll14 for this

purp ose, we tran sform ed W30O3 AR5 with pJPAll 4, streaked i ndep endently -i sol ated

transformants to single colonies, obtained isolates lacking pJPAll4, and analyzed twelve

arbitrarily-chosen isolates by Southern blot analysis (see Materials and Methods).

pJPAll4 has two technical merits in this experiment. Because pJPAll4 contains the

rDNA ARS, it is readily lost from transformants grown in the presence of uracil. Loss of

pJPAll4 can be confirmed by growth on medium containing 5-fluoroorotic acid (5-

FOA). In this experiment, 2 of 12 yeast isolates lost 2 micron plasmid DNA (Figure 3-1).

This confirms our initial findings that pJPAll4 transformants lose 2 micron plasmids

with a sufficiently high frequency to allow pJPAll14 to be useful for curing a strain of the

2 micron plasmid.

Two Micron Circle Does Not Reduce Life Span

To determine if the presence of 2 micron plasmids influenced replicative life span,

microdissection-based life span determinations were done as described (86,92). The two

ciro strains, yAF7 and yAF8, obtained from the experiment presented in Figure I were

compared to the parental strain W303AR5. No apparent difference in replicative life

spans was observed (Figure 3-2). The average replicative life spans for yAF7, yAF8, and

W303AR5 were 22.7 (16.2), 21.9 (17.3), and 23.5 (15.9) generations, respectively.

Wilcoxon two-sample paired signed rank tests revealed no statistically significant

differences between the three life span curves (p<0.05). Thus, the presence of 2 micron










plasmids in W303AR5 does reduce replicative life span compared to two independently-

isolated, otherwise isogenic strains lacking 2 micron plasmids.


~-+- yA54FT -W-- yAF8 --&-- Wct303AR$













03 10 20 30 4

Generatoe


Figure 3-.iesa nlsso i n ir es.Nme fduhe el








Figre3-.Lfor ypAF7 alyAF8,fi and W303R, reaspetivly Thm e three curelsar



indistinguishable by Wilcoxon two-sample paired signed rank tests (p<0.05).

Two Micron Circle Does Not Accumulate in Old Cells

These findings indicate that 2 micron plasmids do not confer a disadvantage insofar

as replicative life span is concerned. This suggests that 2 micron plasmids do not

accumulate during the aging process. To test this prediction, ~6-generation old yeast

cells were prepared by magnetic sorting (see Materials and Methods) and 2 micron

plasmid DNA levels were analyzed by Southern blotting. No differences in 2 micron















~ Ib
IrZu ;B

~s~ B
~Wfig 5


Figure 3-3.Two micron plasmid levels in young and old cells. Old cells were isolated by
biotinylation and magnetic sorting (see Materials and Methods). Bud scars in
young and old cells were stained with Calcofluor and counted to determine
average age. DNAs from young and old cells were analyzed by Southern
blotting as described for Figure 3-1. Size markers (M) are shown (in kb). To
normalize levels of 2 micron plasmid DNA to genomic DNA levels, the blot
was stripped and rehybridized to 32P-labeled probe to URA3. 2 micron
plasmid and URA3 band intensities were quantitated, and no significant
difference was found between the ratios of 2 micron plasmid DNA to URA3
DNA in young and old cells.

plasmid DNA levels were observed between populations of cells with average ages of 1.1

and 6.2 generations (Figure 3-2). To normalize the amounts of 2 micron DNA present in

young and old cell samples to the amounts of genomic DNA present, the relative amount

of the URA3 gene was determined by Southern blotting (Figure 3-2). Quantitative

analysis of the intensities of bands corresponding to 2 micron plasmid DNA and URA3

was done and revealed no significant difference between normalized 2 micron DNA


~ud~ga P~~
l.f 6.2 M


2 C1~ rrrr ~arirr,










levels in young and old cells (data not shown). Previous studies have shown substantial

accumulation of ERCs (5- to 50-fold) and non-centromeric recombinant plasmids (5- to

25-fold) in 7-generation old yeast cells (86). Thus, 2 micron plasmids are unlike ERCs

and non-centromeric yeast plasmid vectors, and do not accumulate in old cells.

Summary

In chapter 2, 2 micron origin plasmids were shown to accumulate. The same is

not true for naturally occurring 2 micron circles. They do not accumulate; therefore, they

do not reduce lifespan. While only confirming the model of plasmid aging, the loss of 2

micron circles in transformants of pJPAll14 is very interesting. What is pJPAll14 doing

to cause 2 micron circle loss?















CHAPTER 4
A CELL'S LIMITED RESOURCES AND PLASMID COMPETITION

The main hypothesis being developed to explain ERC mediated aging revolves

around the idea that episomes cause a replication burden in cells. As cells age, they

accumulate episomes (93). The episomes eventually reach a high copy number. It is so

high, that it is about the same amount of DNA as the yeast genome (93). This means that

an old cell is replicating two or more times the amount of DNA it normally replicates.

This enormous amount of DNA could require all of a cell's replication factors and DNA

substrates to complete replication. If one of these factors or substrates is limiting, then

the cell may encounter problems during replication. This could result in mutations,

double strand breaks, etc. In order to further explore this idea, the following experiments

were completed.

Smllp, Meclp, RNR, and Rad53p Pathway

Smllp and Meclp are involved in a well know DNA damage and repair pathway

(94). Most importantly it senses replication fork slowing and stalls. The cascade starts

by Meclp sensing DNA damage or replication fork stalling. It then signals through

Rad53p to Smllp. Sm 11p, an inhibitor, releases and thereby activates Ribonucleotide

Reductase (RNR) (Figure 4-1). RNR makes dNTPs from NTPs by removing the 2'

hydroxyl from ribose. This reaction results in an increase of cellular pools of dNTPs and

the progression of stalled replication forks (94).









































Figure 4-1.Meclp, Rad53p, Smllp, and RNR pathway (94). This pathway ultimately
leads to the production of dNTPs.
SML1 Deletions Do Not Increase Life Span.
To see whether an increase in the cellular dNTPs pools would counteract the affects

of an episome's replication burden, a SM~L1 deletion was created with the insertion of

HIS3. By removing the RNR complex inhibitor, Smllp, dNTPs are continuously being


DCNA Jarrage,. rephla~tion blockE, & jstalled repli~tcano fbrks6










Trascrptina r





Rur p 1


RNR ~


gu


lation









produced no matter what the state of the cell. SM~L1 deletions are known to increase

dNTPs levels in the cell by 2-3 fold. In addition to looking at the life span ofSM~L1 and

sml1A strains, transformants of smllA were also test for an extended life span. The

plasmid used was pJPAll3. This is the ARS1 plasmid from Figure 2-1B and Table 2-1.

Transformed cells may help to amplify the affect sml1A has on a replication burden, since

they contain more episomes and have shorter life spans.


-*yAF10O+ARS
-=-smll n+ARS


yAF10
-*-sm/7AI


0 10 20 30 40
Generations


Figure 4-2.Life span ofSM~L1 deletions. yAF10 (HIS3; control) had a mean life span of
25.5 and a n=55. smllA had a mean life span of 25.9 and a n=57. yAF10 +
ARS (control) had a mean life span of 12.9 and a n=42. smllA + ARS had a
mean life span of 11.8 and a n=54. The ARS plasmid used was pJPAll3
(ARS 1).

The SM~Ll deletion had the same life span as the control (yAF 10). They were

statistically indistinguishable using the Wilcoxon two-sample paired signed rank test.









yAF 10 is the yAF5 strain with its his3 locus repaired to control for insertion of HIS3 into

snall. The transformed snlall cells also had the same life span as the transformed control

strain (Figure 4-2). Reproducing previous results, the pJPAll3 (ARS1) transformants

had a mean life span within the standard deviations of the life spans in Table 2-2.

Since replication is a doubling process, it is conceivable that an increase in dNTPs

of 2-3 fold is not enough to be seen on a life span. In other words, the life span assay

may not be sensitive enough. In old cells, episomes account for a large proportion of the

total DNA (could be more than half). Since they are retained due to mother cell bias, a

division occurring at an old age would increase the total DNA content by nearly double.

The only DNA being passed on to the daughter cell would be the chromosomes, not the

massively accumulated and newly replicated episomes. The key to this idea is that

episomes can reach a quantity larger than that of the genome. A snlall may only have

increased a cells life span by one doubling, not enough to be observed by life span.

Old Cells Do Not have an Increased Sensitivity to Hydroxyurea

Hydroxyurea (HU) is a chemical inhibitor of the RNR complex (94). It has been

widely used when studying Meclp and Smllp. Sn~all has an increased resistance to

HU. Strains that are snzllA neclA or sn~all rad53A have an increased sensitivity to

HU. Interestingly M~EC1 and RAD53 cannot be deleted without a SM~L1 deletion

suppressing their lethality (94). Smllp has a critical role in HU sensitivity because it is

the inhibitor of the RNR complex. Without SM~L1 it takes more HU to suppress the

larger pool of active RNR in the cell. IfM~EC1 or RAD53 are deleted then Smllp does

not release the RNR complex and the cell cannot make dNTPs. This is why sdl~A is

required when deleting M~EC1 and RAD53. M~eclA snal and rad53A sdl~A strains are

not less sensitive to HU because of Mec lp and Rad53p regulation of transcription factors










for the RNR proteins through Dunlp (Figure4-1). Without the activation of Dunlp, RNR

levels in the cell stay the same and cannot compensate for the inhibition by HU.

O mtM HUL 50 mMi HU 1008 mM HU 3200 mM~ HU




Young







Old





Figure 4-3.Hydroxyurea sensitivity of young and old cells from 0 mM to 200 mM. Each
plate has Hyve rows of pin stamps. Each row is a serial dilution of a strain.
The first row is a WT control yAF6. The second row is a WT control W1588-
4C. The third row is sdl~A. The fourth row is nzeclAsnlall. The fifth row is
rad53Asndl A.

A change in HU sensitivity by old cells would show that this DNA repair pathway

plays a role in the aging process. Two WT, sdl~A, nzeclA snlall, and rad53A sdl~A

strains were magnetically sorted to get young and old cells. Serial dilutions were pin

stamped onto minimal medium plates containing various levels of hydroxyurea. The first

pin stamping contained HU concentrations of 0, 50, 100, 200, 300, and 400 mM. As

expected the nzeclA snlall and rad53A sdl~A strains had an increased sensitivity to HU,

while the WT and snlall were more resistant. There were no noticeable differences in

the sensitivity of HU between the young and old cells (Figure 4-3). The 300 and 400 mM

HU concentrations are not shown because no strains were able to grow in those

conditions.









Om ML HU


10 mM HU


20 mMV HUI


Young


80Q mMr HU


4~0 mM HU


50 mM HU


Figure 4-4.Hydroxyurea sensitivity of young and old cells from 0 mM to 50 mM. Each
plate has Hyve rows of pin stamps. Each row is a serial dilution of a strain.
The first row is a WT control yAF6. The second row is a WT control W1588-
4C. The third row is sdl~A. The fourth row is nzeclAsnlall. The fifth row is
rad53Asndl A.










To further investigate HU sensitivity in old and young cells, a narrower range of

HU was examined for the second round of pin stamping. The concentrations of HU used

in this experiment were 0, 10, 20, 30, 40, and 50 mM. Again no distinction could be

drawn between the HU sensitivity of old cells to the HU sensitivity of young cells.

A closer look at concentrations between 0 to 10 mM and 100 to 300 mM may show

the differences we are looking for. The increase resistance to HU of smllA was not

shown; therefore, there needs to be a tighter range of concentrations between 100 and 300

mM. It is possible that old cells are more resistant to HU because they are up regulating

RNR.

Double Strand Breaks Do Not Increase in Old Cells

Replication slow zones are regions of DNA within the chromosomes at which

replication forks slow down. These zones were first discovered in M~EC1 mutants, where

the slow zones turned into double stranded breaks (DSB) (95). Since Meclp is the sensor

for stalled replication forks, M~EC1 mutants cannot fix stalled forks. In M~EC1 mutants,

replication forks spend more time at the slow zones. This leads to more DSBs in these

replication slow zones.

In old cells, the diminishing amounts of dNTPs caused by the episomal replication

burden could cause replication forks to stall more frequently and for longer periods of

time. This would in turn lead to more DSB. To test whether magnetically sorted old

cells have more DSB then young cells, pulse field gels were used to separate

chromosomes. After the gel was completed, it was transferred to positively charged

nylon and probed with the CHA1 probe. CHAl is located on one end chromosome III

(95). If a DSB occurred, then faint bands should appear below the chromosome III band.

These bands are shortened versions of chromosome III. No discernable difference could









be observed between young and old cells. There were no shorter bands on the blot;

therefore, there were no DSBs.

The original paper describing DSBs in nzecl mutants used a synchronized

population of cells. DNA was extracted from cells in the process of S phase. By using

cell synchronization, DSB formation in old cell might be able to be seen. Since there is

no positive control (nzeclA synchronized) in Figure 4-5, it is hard to say that the absence

of DSB detection conclusively shows that DSB do not form in old cells.










Figure~~,a 4-.oter fDBinyF W),W484C(TsdlnelsnlA n
ra53sdl. usefil gl a rn corin o atral admehos
Sothrnws raseredt psiiel cage nln ndralaln










Thgue pr5.othein tht ene DSB an sale repicaio forks in4 the) cella Mecaslpa,



phosphorylates o Rad53p (96). If t Rad53p pohryaion Olevel icess nodcelte



this pathway could be implemented in aging. After magnetically sorting old cells, protein

lysates were extracted. Several controls were also completed in parallel. HU causes a









signal cascade through this DNA repair pathway resulting in the phosphorylation of

Rad53p and the release of the RNR complex by Smllp. The phosphorylation can be seen

by a shift upward of Rad53p band on a gel (96). A rad53A smllA strain was added to

show which band is the Rad53p (the one not present in this strain). A meclA sml1A strain

was used to show a less phosphorylated Rad53p. The western blot shows that there was

no increase in the phosphrylation levels of Rad53p between young, old, and older (double

magnetic sort) cells. Even between cells that have have a variety of ERC levels (foblA,

WT, and sir2A), there was no difference in the phosphorylation of Rad53p.







Fiue -.Rd3ppophrlain ny un an ol el.Teupr ipre adi

Sinc thii a polyclona antbd, thr issm oseiicbnigt ad






CiuEN pl6.asmd53 ccanorlaio be seenan ld. Thesstanhvedfrntles ofpe ERsese band in tr
differetlie spans. 4 Sir2A prdcs the mhosthrlae ERs W rsoduc slghl less. Fh oblA

producs ver few pF3 is a stycoable pasmibd that cotins a ENelme oseicdnt. It repesnts


licens foring ofF3 ano single origin~ during the accumlatio ofEosf ERCs casea eioal





replication burden by abnormal licensing of ARSs throughout the genome, then pAF32

should fail to replicate more often in strains with more ERCs.













-* W303R5


11

0.9

0.8

0.7

0.6

0.5

0.4

0.3

0.2

0.1

0


-m sir2A


-A- fob lA


0 10 20 30 40 50

Generations



Figure 4-7.Life span of W303R5 (WT), sir2A, and foblA during the CEN loss
experiment. W303R5 had a mean life span of 22.4 and an n = 29. Sir2A had
a mean life span of 12.6 and an n = 28. FoblA had a mean life span of 30. 1
and an n = 30.

We followed the inheritance pattern of pAF32 throughout the life span of the

various transformants. Because pAF32 contains the ADE2 gene, its inheritance can be

followed by colony color (Appendix I-K). After the pedigree analysis was completed,

the life spans of the three strains (with a CEN plasmid) were consistent with the life spans

that are already published in the literature (without a CEN plasmid) (Figure 4-7). After a

close analysis of the pedigrees, they show that the sir2A stain lost the plasmid at earlier

divisions than the both WT and foblA strains. WT, which has intermediate number of










ERC, had intermediate loss of pAF32. The foblA strain had the fewest ERCs and the

latest lost of the CEN plasmid (Figure 4-8). While there was a low n, this result suggests

that ERCs inhibit CEN plasmid replication. It also says that episomes may cause aging in

old cells by sequestering needed replication factors away from the genome.


-* W303R5


-m sir2A


-A- fob lA


1

0.9

0.8

0.7

0.6

0.5

0.4

0.3

0.2

0.1

0


10 20

Generation at which CEN Plasmid was lost


Figure 4-8.The age which WT, sir2A, and foblA lose plasmid. CEN plasmids were lost
at a mean generation time of 11.4, 6.25, and 14.3 (respectively). The number
of cells analyzed in each strain were n = 8, n = 4, and n = 7 (respectively).

Mitotic Stabilities in the Presence of ERCs

To further investigate ERC's role in the cell, mitotic stabilities were examined. A

change in mitotic stability of ARS plasmids may be expected in strains with various













levels of ERCs accumulation. FoblA, WT, and sir2A strains were tested with pAF31


(ARS), pAF32 (CEN), pJPAl33 (ARS), and pJPAl36 (CEN). The two sets of plasmids


were used to control for the use of the ADE2 or LEU2 selectable markers. The sir2A


strain had an increased mitotic stability of pAF31i. Normally pAF3 1 has a mitotic





n= 7 9 11 13 13 14


100


90 -


80 -


70 -


60 -


50 -


40 -


30 -


20 -


10 -


0-


-


-


-


-


-


-


-


-


-


W303
pAF31


foblA
pAF31


sir2A W303
pAF31 pAF32

Strain/Plasmid


foblA sir2A
pAF32 pAF32


Figure 4-9.Mitotic stabilities of pAF3 1 and pAF32. The two plasmids were tested in
strains with various amounts of ERCs.


stability of 16% (W303). In the sir2A strain, pAF3 1 had a mitotic stability of 29%. The


sir2A strain had a slight increase in the mitotic stability of pJPAl33, but it was not


significant. The mitotic stability went from 17% (W303) to 21% (sir2A), but these









numbers fell within the standard deviation of each other. This could be explained by the

smaller size of pJPAl33 from that of pAF3 1. Very small plasmids are known to have

different mitotic stability characteristics. The ARS plasmid, pAF31, may have reached a

critical threshold in size for ERCs to play a role in mitotic stability. The foblA strain's

inability to further reduce the mitotic stability of pAF31 shows that there may be a

critical mass of episomes a cell can handle. If the increase in ERCs from fob lA to W303

was not enough to change mitotic stability, then the decrease in size from pAF31 to

pJPAl33 could be not enough to change mitotic stability.


W303 foblA sir2A W303 fob1 sir2
pJPA133 pJPA133 pJPA133 pJPA136 pJPA136 pJPA136

Strain/Plasmid


Figure 4-10. Mitotic stabilities of pJPAl33 and pJPAl36. The two plasmids were
tested in strains with various amounts of ERCs.









Plasmid Accumulation in sir2A and foblA Strains

Again foblA, sir2A, and wt strains were transformed with pJPAl33 and pJPAl36.

Magnetic sorts were completed to obtain young and old cells. The episomal replication

burden model predicts that accumulating plasmid will compete. In this example, ERCs

will compete with pJPAl33 for the replication machinery. The accumulation of the ARS

plasmid will decrease in the strains with increased ERC production.











Fiue-1.S uathern ofsoigpasi opttonpeoeo. ldgse

genmi DNA yild a .3 k E2 ad the ad r lsi
derived.C













mostcopes411 Softher plasmid (29 plasmids/cll) iinoldcls pJPe l33 alon Xhad different


coy umbern i eecmpee n the youngti strains Toqatfhe copy numberswr6,46an2. wit res ett


























































I I -


foblA, WT, and sir2A. This again mimicked the results from the old cells, but to a lesser


degree. Young and old cells of all of the strains contained relatively the same number of


pJPAl36 (CEN). This argues for a competition between ARS episomes for replication


machinery in the cell. To further extrapolate this idea, episomes may also compete with


the genome for the replication machinery and cause aging. Another explanation of this


result may be that there is a critical mass of episomes allowed in the nucleus. After that


mass is reached episomes begin to be pushed out.


350 ,


300



-250



-


1 00 -


HYoung
SOld


50t-


sir2 plPA133


wt plPA133 fob1 plPA133 sir2 plPA136
Strains


wt plPA136 fob1 plPA136


Figure 4-12. Quantitation of plasmid competition Southern. Quantitaion was
completed on the blot in Figure 4-11 by a Phosphuor imager.

Summary

The mechanism by which episomes cause aging has been very illusive. In this


chapter several experiments have been designed to tease out the mechanism. Although


some experiments gave negative answers, they did give definitive answers. While the









exact mechanism of episomal aging is still not well known, the experiments strongly

suggest in what direction subsequent experiments should go.

The maj or experiments in this chapter show a few things:

*CEN plasmids are lost at younger generation times in strains with more ERCs.

*The mitotic stability of ARS plasmids increases in strains with more ERCs.

*Old cells of strains with more ERCs accumulate fewer ARS plasmids.

Together they say that as episomes accumulate there is an increasing strain on the

cells replication machinery.















CHAPTER 5
CHROMATIN SILENCINTG AND EPISOME FORMATION

The maj or role of Sirdp in aging is its ability to deacetylate histones. By

deacetylating histones in the rDNA, it is silencing the DNA. More specifically it is

compacting the chromatin and making it less accessible. This results in fewer ERCs

produced and in turn a longer life span. Strains that over express Sirdp have fewer ERCs

and live longer. Conversely SIR2 deletions create more ERCs and have a shorter life

span because it cannot deacetylate histones.

If the histone acetylation status in the rDNA is central in ERC aging, then limiting

a cells ability to acetylate histones could be as important as Sirdp ability to deacetylate

histones. Histone acetyl transferases (HATs) are the enzymes that acetylate histones. In

addition to the enzymes responsible for the acetylation and deacetylation of histones the

pool of acetyl CoA may be important to aging. Acetyl CoA is the substrate for HATs in

the acetylation of histones. A closer look at the production of acetyl CoA may lead to

mutants that increase life span. These ideas are illustrated in Figure 5-1.

Two enzymes are responsible for the production of acetyl CoA, Acslp and Acs2p

(Acetyl CoA Synthetase). Acslp has a Km 30 times lower than Acs2p (97). This does

not mean that it does most of the conversion of acetate to acetyl CoA. The two enzymes

are regulated very differently. Acslp is completely repressed by glucose (100 mg/L), up

regulated in ethanol, and further increased in acetate medium. Where as Acs2p is

maintained at a constant level in glucose and ethanol, but acts sporadically in acetate

(97). An ACS2 deletion cannot grow on glucose as a carbon source. This is because of






























At:


__ __ _~_ _


the repression of ACS1 by glucose. If ACS2 is deleted and ACS1 is repressed by glucose,

then there is insufficient ACS activity in the cell, and the cell cannot survive. The cell

needs acetyl CoA to survive.


-0,

















FDNA Stab~ilit


Are~tata


Lonlgevity
Agl ng
Figure 5-1. The acetylation of histones and its affect on ERC production and life span.

ACS2 and ACS1 is Required for Normal Life Span

Deletions ofACS1 and ACS2 were obtained from the Clusius lab. It was predicted

that deletions of the ACS genes would lead to an extended life span. This is because

acetyl CoA levels in the cell would drop. Histones would be acetylated less, and the

production of ERCs would decrease causing a longer life span.


EtH

Acetakiehyde


Acetyl CoA Co


s~4bc~HiStone~





rD~NA Inssta l4ilty










Life spans were completed on both glucose and ethanol. Surprisingly T23D, the

strain background, has a much longer life span than the W303R5 derivatives that have

been used in previous studies throughout this dissertation and other strains in published

papers. Never the less, there was a reduction in life span in acslA from the controls.

Interestingly acs2A had an even shorter life span than a~sclA (Figure 5-2). These

reductions in life span are opposite of what one might conclude, from the model

described in Figure 5-1.


-H-23D E -*-21 E
-K-T23D D -%-621 D


625 E


20 40 60
Generations


Figure 5-2.Life span of ACS deletions. T23D (control) on ethanol (E) had a mean life
span of 55.2 and an n=59. 621 (acslA) on ethanol (E) had a mean life span of
47.4 and an n=59. 625 (acs2A) on ethanol (E) had a mean life span of 16.6
and an n=51. T23D (control) on glucose (G) had a mean life span of 35.0 and
an n=59. 621 (acslA) on glucose (G) had a mean life span of 24.8 and an
n=59.









A closer look at metabolism shows that acetyl CoA is used for many processes in

the cell besides acetylation of histones. Acetyl CoA is one of the entrance points into the

Citric Acid Cycle. It is also used in lipid synthesis. ACS2 is known to be coregulated

with structural genes of fatty acid biosynthesis because of an upstream ICRE

(inositol/choline-response element). These and other pathways may be more important to

a cell's health than the predicted decrease in the production of ERCs by the ACS

deletions.

In addition to looking at the affects of Acslp and Acs2p in a cell, we inadvertently

observed a difference in life span between cells grown on glucose and cells grown on

ethanol as a carbon source. When T23D was grown on ethanol it had a mean life span of

55.2 and a maximum life span of 77 Generations. This is longer than the longest life

span we have seen published in the literature. To our knowledge the longest life span

published is a mean life span of 36. 1 and a maximum life span of 74 (98).

ACS2A Increases ERC Production

To further explore ACS1 and ACS2's role in aging, ERC production and

accumulation was measure in old and young cells of the ACS deletions. According to the

model illustrated in Figure 5-1, ACS deletions should lead to a decrease in ERC

production. Cells were grown in ethanol and then age fractionated by magnetic sorting.

T23D (control) had very few to no ERCs in the old cells. This may be why it has a

longer life span than W303R5. What is the genetic difference between T23D and

W303R5. T23D is a diploid strain while W303R5 is a haploid. Previous experiments

have shown that the ploidy of a strain is not important to life span (99). Another

difference is that W303R5 is ade2, his3, leu2, trpl, and ura3; and T23D has no







62


auxotrophic markers. Some of these genes can be compared by life spans that were

completely separately, and they do not seem to influence life span.

Interestingly, the ACS2 deletion produces more ERCs. While the ACS1 deletion

does not produce ERCs. Acs2A's ERC production may attribute to its shortened life

span.


9:
..I
IaIr ~


x:: x : :


Figure 5-3.Sorts of young and old ACS deletion strains. The southern blot was probe for
rDNA. Light banding in the old acs2A sample can be observed at a high
molecular weight. These are ERCs.

Summary

ACS1, ACS2, ethanol as a carbon source, and fatty acid biosynthesis are all linked

to aging. Further exploration is needed to fully understand how acetyl CoA is involved in









aging. Another noteworthy result is that T23D lives longer than W303R5. It would be

interesting to know what genetic differences contribute to its extended life span. Many

experiments could easily be designed to determine the genes that help it live longer.















CHAPTER 6
LOOKING AT POSSIBLE MECHANISM OF CELLULAR AGING

YCA1 and Apoptosis in Yeast

Apoptosis and aging are intimately linked. Since programmed cell death,

apoptosis, contributes to the aging of metazoans, looking at a known yeast caspase, an

apoptotic regulator, seemed reasonable. Yealp is the only known caspase like protein in

yeast (100). It has been shown to be required for hydrogen peroxide induced apoptosis.

When YCA1 is deleted, it increases yeast chronological life span (100). To further

investigate the role of Yealp in the aging process we constructed a YCA1 deletion in our

W303AR5 strain. It was created by using microhomology to YCA1 and inserting HIS3

inside of the gene (See Materials and Methods). After the insertion of HIS3 into YCA1,

we confirmed by southern that the constructed W303AR5 ycal::HIS3 strain was correct.

A control strain was also created by repairing the his3 locus of the W303AR5 strain.

This was to insure that the HIS3 status of the cell would not contribute to a lifespan

change. The two strains were compared through replicative life spans (Figure 6-1).

There was no statistical difference between the ycal deletion and the control strain. The

interpretation is that while ycal is necessary for a normal chronological life span, it is not

required for replicative life span. This experiment illustrates the fundamental difference

between a chronological and replicative life span. A chronological life span

demonstrates a cells resilience and ability to replicate after being in a saturated culture

full of cells and depleted of nutrients. In a replicative life span, cells are spaced out very

far from each other, so it is unlikely that they will run out of nutrients. It is a measure of









a cell replicative potential, not its resilience over time. It is a subtle difference, but

important when trying to address different questions about cellular aging.


-m Control


ycalAn


10 20 30 40
Generations


Figure 6-1.Life span of ycalA. This life span was completed on rich media (YPD). The
control strain had a mean life span of 22. 1 (n=60). The ycal deletion had a
mean life span of 21.4 (n=57).

Shu Gene Family and Mutation Suppression in Aging

Using a CAN1 forward-mutation assay, the SHU (sensitivity to hydroxyurea) genes

were discovered. These genes are required to prevent spontaneous mutations. In the

assay, 4,847 yeast deletion mutants (from the yeast deletion proj ect) were screened for

the ability to spontaneously become canavanine resistant (canl) (101).

In collaboration with the laboratory of Rodeny Rothstein, four of the genes

discovered in this screen (SHU1, SHU2, SHU3, and CSM~2) were looked at by replicative











-= W303R5 -* shu? A
-n- shu3n -m- csm2d


shu2n
4Xn


10 20 30 40

Generations


Figure 6-2. SHU genes role in life span. The mean life span of W303R5 is 24.5 (n=60).
The mean life span of shulA is 25.3 (n=60). The mean life span of shu2A is
25.8 (n=58). The mean life span of shu3A is 23.2 (n=56). The mean life span
of csm2A is 22.5 (n=59). The mean life span of the quadruple deletion (shulA,
shu2A, shu3A, and csm2A) is 21.5 (n=59).

life span. They are believed to be involved in DNA replication. These experiments were

completed in the Rothstein lab. These gene's ability to suppress mutations and their

involvement in DNA replication make them a candidate for having an increased life span.

The Rothstein lab had preliminary data that suggested this with one or more of the

mutants. After the experiment was completed all strains had very similar life spans

(Figure 6-2). A close look at the p-values obtained from the Wilcoxon two-sample paired









signed rank test shows that there may be a small difference between the strains (Table 6-

1). The experiment needs to be repeated (one of the few that has not been) before any

maj or conclusions can be drawn.

Table 6-1. P-values of the SHU deletion life spans.
Comparison #1 Comparison #2 P-Value

W303R5 shulA 0.032

W303R5 shu2A 0.003

W303R5 shu3A 1.22 x 10-7

W303R5 csm2A 9.07 x 10-6

W303R5 Quadruple a 4.50 x 10-s

shulA shu2A 0.090

shulA shu3A 1.14 x10-4

shulA csm2A 2. 12 x10-6

shulA Quadruple a 3.30 x 10-s

shu2A shu3A 1.47 x 10-4

shu2A csm2A 1.02 x 10-5

shu2A Quadruple a 4.23 x 10-6

shu3A csm2A 0.016

shu3A Quadruple a 1.68 x10-5

csm2A Quadruple a 0.002

Summary

This chapter focuses on ideas that were not specifically linked to our episomal

aging model. Because these concepts could have played a role in the broader scope of

aging, we explored them. It is now known that YCA1 does not affect replicative life span.






68


We also know that more experiments need to be completed to show definitively the

subtle difference between the SHU strains















CHAPTER 7
DISCUSSION

Budding yeast is an excellent system in which to study cell-autonomous

mechanisms of aging. Mechanisms linked to genome stability, metabolic damage, and

metabolic regulation have been found to regulate yeast replicative life span (45-

47,52,53,102). Sinclair and Guarente have proposed that a key regulator of life span is

the cellular level of extrachromosomal rDNA circles (ERC s) (54). To study this

proposal, we have used plasmids to model ERC inheritance and accumulation, two

processes that govern ERC levels in yeast cells. Our work shows that plasmid DNAs

bring about significant reductions in yeast life span. We Eind that ARS1~ and 2 CI origin

plasmids specifically accumulate in old yeast cells, and that the level of accumulation of

ARS1~ and 2 CI origin plasmids in old cells correlates with the extent of reduction in life

span. This is the first demonstration to our knowledge of an inverse relationship between

DNA episome level in old cells and reduction in life span. We Eind that plasmids have a

direct effect on life span and do not indirectly reduce life span by increasing

recombination at the rDNA locus and increasing ERC levels in transformed cells.

Analysis of the "terminal" morphology of senescent cells indicates that plasmids do not

cause a stochastic arrest in the cell cycle, which is consistent with a normal aging

process. Reduction in life span does not require that plasmids carry rDNA repeat

sequences, and the presence of a full-length, functional 9.1 kb rDNA repeat on a plasmid

does not augment reduction in life span. These Eindings confirm the work of Sinclair and

Guarente (54), and provide significant new support for their ERC model by directly









demonstrating a relationship between plasmid inheritance, plasmid accumulation, and

reduction in life span. Our studies also highlight the value of plasmids as tools to

investigate properties of ERC s that are relevant to the aging process in yeast.

Why Do ARS Plasmids Accumulate in Mother Cells?

It has long been appreciated that ARS plasmids are inherited asymmetrically and

accumulate in mother cells (43). This accounts for the high copy number and low mitotic

stability of ARS plasmids. However, accumulation of ARS plasmids in cells that are

multiple generations old has not been directly demonstrated. Our studies are the first to

directly demonstrate that ARS1-containing plasmids accumulate to high levels in old

yeast cells. Although ARS1 plasmid partitioning bias is well known, little is understood

about its underlying mechanism. One possibility is that plasmid partitioning bias is due

to the nature of cell and nuclear division in budding yeast. During closed mitosis in

yeast, an intact nucleus elongates along the axis of the mitotic spindle and adopts an

elongated "dumb-bell" shape due to constriction of the nucleus at the bud neck.

Chromosomes pass though the constriction at the bud neck by virtue of their attachment

to the mitotic spindle, which is able to exert force on chromosomes. In the absence of

spindle attachment, passage of DNA molecules through the constriction at the bud neck

may be limited. Consistent with this notion, the relatively small (1.45 kb) TRP RI

plasmid has been shown to be inherited efficiently and to exhibit high mitotic stability

(103). The small size of the TRP RI plasmid may allow it to readily distribute between

mother and daughter cells through the bud neck constriction. Commonly used yeast

recombinant DNA vectors are typically larger than the TRP RI plasmid and require cis-

acting sequences and trans-acting factors to be stably inherited.










Why Do Budding Yeast Exhibit a Mother Cell Plasmid Segregation Bias?

One possibility is that mother cell segregation bias is a mechanism to protect

progeny cells from potential "parasitic" effects of episomal DNAs acquired from the

environment. The 2 CI circle is a commensall" episomal DNA that Futcher has depicted

as a sexually transmitted selfish DNA (89). The 2 CI circle depends on its capacity to

overcome mother cell segregation bias (see below) in order to survive in a host

population in the absence of any selective value. Another possibility is that mother cell

segregation bias is a mechanism to increase the longevity of progeny cells by limiting

transmission of ERC s.

Why Do ARS1 Plasmids Bring About Cellular Senescence More Rapidly than Do
ERCs?

One possibility is that virgin mothers contain more plasmids than ERC s at the start

of life span experiments. Virgin mothers must contain at least one ARS plasmid, but

probably contain on average ~0.5 ERC per cell. The difference in origin strength

between ARS1~ and the rDNA ARS may also be important. ARS1 is a relatively "strong"

ARS, and capable of supporting rapid plasmid accumulation in mother cells. ERC s

contain a comparatively "weak" ARS that is likely to support only relatively slow

accumulation in mother cells. The rDNA ARS contains an ACS (ARS consensus

sequence) that departs from the consensus at position 1 a change that has been shown

to reduce ARS function, primarily by limiting DNA unwinding (81). This difference in

strength could explain why ARS1 plasmids bring about senescence in mother cells more

rapidly than do ERC s. ARS1~ plasmids are replicated more efficiently than ERC s, which

increases the rate of ARS1 plasmid accumulation in mother cells compared to ERCs.









Do Cis-acting Sequences that Counteract Mother Cell Segregation Bias Suppress
Reduction in Life Span by ARS1 Plasmids?

Yes, ARS1 CEN4 plasmids reduce life span to a lesser extent than ARS1 plasmids,

which is consistent with results of Sinclair and Guarente (54). However, inclusion of

CEN4 on ARS1~ plasmids suppresses the reduction in maximum life span by ARS1~

plasmids, but does not fully suppress the reduction in average life span. Our studies also

directly show that ARS1 CEN4 plasmids do not accumulate in ~7 generation old mother

cells. The reduction in life span is not specific for the combination ofARS1 and CEN4.

The combination ofARSH4 and CEN6 (in pRS314, (77)) reduces average life span with a

minimal effect on maximum life span. The fact that centromeric DNA elements suppress

reduction in maximum life span supports the conclusion that ARS1~ plasmids exert their

effect by accumulation in mother cells, as discussed above.

Do 2 Micron Circles Reduce Life Span?

It is initially surprising that ciro cells did not have an increased life span compared

to cir~ cells, especially since 2Cl origin plasmids accumulated in old cells. Quickly we

realized that the 2Cl circles and 2Cl origin plasmids were very different. 2Cl circles did not

accumulate in old cells and 2Cl origin plasmids did. With this knowledge of 2C

accumulation, it becomes obvious that 2Cl circles would not decrease life span.

Why Do 2 Micron Origin Plasmids Reduce Life Span?

Although both 2 CI origin plasmids and 2 CI circles contain the REP3 STB cis-acting

stability element, 2 CI origin plasmids contain a single 599 bp segment, whereas 2 CI

circles contain two 599 bp segments arranged as an inverted repeat (76,80). More

efficient autoregulation of 2 CI circle copy number and inheritance is likely to prevent

accumulation in old cells. It is important to note that 2 CI circles can be toxic to cells









when present at high copy number. Constitutive expression of the 2 CI amplification

machinery results in high copy number and has deleterious effects on cell growth (76).

Similarly, mutations in NIB1 ULP result in unusually high levels of 2 CI circles,

formation of large inviable or mitotically arrested cells, and clonal lethality (104).

Studies by Dobson and coworkers indicate that an abnormal form of Rep2p, a 2 CI circle-

encoded plasmid partitioning protein, accumulates in ulpl mutants, suggesting that ULP1

is involved in partitioning of 2 CI circles during mitosis (M. Dobson, personal

communication). This suggests that high levels of 2 CI circles in nib1 ulpl mutants may

result from asymmetric inheritance. In this sense, phenotypes associated with nibl/ulpl

defects may share mechanistic underpinnings with senescent phenotypes associated with

asymmetric inheritance of plasmids and ERC s.

Why Do 2 Micron Origin Plasmids Have an Intermediate Effect on Life Span?

Although 2Cl origin plasmids accumulate in ~7 generation old mother cells, they

attain levels approximately half that observed with ARS1~ plasmids. As mentioned above,

comparison of results with 2Cl origin and ARS1~ plasmids supports an important semi-

quantitative inverse relationship: the extent of plasmid accumulation in old cells

correlates with the extent of reduction in life span.

Why Does Transformation with pJPA114 Lead to 2 Micron Circle Loss?

Recent studies of 2 micron plasmid partitioning have made great strides in

revealing roles for cis-acting elements and trans-acting factors in substantial cellular and

molecular detail (105,106). These studies and earlier studies (76,87) suggest that

inheritance of 2 micron plasmids has little mechanistic overlap with inheritance of

replicating (ARS) plasmids such as pJPAll4. Thus, it seems unlikely that pJPAll4

competes with 2 micron circle for a limiting amount of (a) specific mitotic partitioning









factorss. Another possibility is that pJPAll4 adversely affects 2 micron circle copy

number, which in turn adversely affects transmission to daughter cells. We have

observed that 2 micron circle DNA levels are reduced 30-40% in ~?-generation old cells

containing yeast replicating plasmid pJPAll3, but not in ~?-generation control cells

lacking pJPAll3. pJPAll3 accumulates to high levels in ~?-generation old cells (86),

and perhaps 2 micron circle DNA levels are reduced as a result of this accumulation.

pJPAll4 attains a high copy number in young cells (86), and is likely to accumulate in

old cells, like pJPAll3. Although these Eindings are not conclusive, they are consistent

with competition between pJPAll4 and 2 micron circles for DNA replication factors

and/or precursors, which could lead to reduced 2 micron circle copy number and

impaired transmission to daughter cells.

By What Mechanism(s) Do Plasmids, and by Implication ERCs, Reduce Life Span
in Yeast?

It is clear that asymmetric inheritance of plasmid DNAs has the potential to burden

mother cells with high DNA content. If we assume that a 5 kb plasmid is replicated once

each S phase, and uniformly inherited by the mother cell during M phase, then 12

doublings will yield a plasmid DNA content in excess of the nuclear genomic DNA

content (5 X 212 = 20.5 Mb plasmid DNA content > ~13 Mb nuclear genomic DNA

content). Of course, this example is an oversimplification and omits factors such as

origin firing frequency and segregation efficiency. However, we note that after 12

generations, 90% of pJPAll13 (5.7 kb ARS1 plasmid) transformants were senescent and

after 20 generations, 90% of pJPAl33 (4.8 kb ARS1~ plasmid) transformants were

senescent. The fact that significant percentages of senescent mother cells arise between

10 and 20 generations is consistent with the accumulation of plasmid DNA content to a









level that approaches or exceeds nuclear genomic DNA content. Similarly, Sinclair and

Guarente have estimated that the ERC content of old cells exceeds the content of the

linear genome (54).

Why Are There Less Plasmid Accumulation in Strains that Produce More ERCs?

This concept of plasmid competition brings us to believe that there is a replication

burden in old cells. Two things could cause the loss of pAF32 (CEN), when it is in the

presence of ERCs. A limiting replication factor or DNA substrate could be soaked up by

the large quantity of ERCs and not allow the single copy pAF32 to replicate. In another

scenario the ERCs could act almost like a physical barrier making it harder for the

plasmid to leave the cell. Inheritance and replication are the two mechanisms that are

central to the characteristics and behavior of plasmids.

The mitotic stability in sir2A, WT, and foblA eliminates the concept of ERCs

acting as a physical barrier for inheritance of pAF32. It also raises new questions when

looking at the ARS plasmids (pAF31 and pJPAl33). Returning to the two plasmid

processes, ERCs could be increasing plasmid inheritance or replication. While it is

unlikely that ERCs are causing an increase in replication, a look at inheritance allows us

to start constructing some models. It is possible that there is a limited amount of space in

the nucleus. The total number of episomes cannot be higher than some critical mass of

DNA. This would cause the two accumulating episomes to be pushed out of cells and

inherited better. Saturation of the plasmid bias machinery could be another mechanism

that increases mitotic stability.

Episome accumulation in old cells of strains that produce various levels of ERCs

shows us that plasmid competition is very real. The reduced level of pJPAl33 in sir2A is

about half of the copy number than in W303R5. This is dramatic. The most important










part of the plasmid competition phenomenon is whether, it is an output of how episomes

causes aging. Mechanistically these two ideas could be very similar. If this is true, we

will be able utilize the versatility of plasmids to discover how ERCs cause aging.

Is There Episomal Aging in Metazoans?

While ERCs have not been found in metazoans, it is hard to say that the absence of

evidence for them proves there is no episomal aging is higher organisms. It is possible

that another highly repetitive sequence can recombine to form episomes, but they have

been very difficult to detect. Also, DNA viruses could be interpreted as episomes that

reach high copy within a cell. An analogy can be draw between ERC replication stress

and viral commandeering of a cell's replication machinery. Both may lead to problems

during DNA replication and hence genomic instability. Genomic instability could

facilitate the mutations and recombination in various cancer causing genes and increase

the incidence of cancer.















CHAPTER 8
MATERIALS AND METHODS

This chapter contains the methods and procedure used for experiments throughout

this dissertation.

Yeast Strains and Plasmids

W3 03AR5 (M4rATa leu2-3,11~2 his3-11,1~5 ura3-1 ade2-1 trpl-1 canl-100 RAD5

ADE2::rDNA, [cil-+], (54)) was obtained from D. A. Sinclair. yAF5 and yAF6 were

constructed by integrating linearized pRS305 and pRS306 (77), respectively, into the

leu2-3,11~2 or ura3-1 loci of W303AR5, respectively, and genotypes were confirmed by

Southern blotting. Plasmids were transformed into W303AR5 using a standard lithium

acetate method (107). All experiments were done with freshly-prepared, independently-

isolated, colony-purified transformants. Unless otherwise noted, yeast were grown on

selective SD "drop in" medium (88).

Descriptions of plasmids are provided in Table 1. A 200 bp fragment containing

ARS1~ was amplified by PCR with primers 5 '-GGAAGCTTCCAAATGATTTAGCATTATC-3 and

5'-CCGAATTCTGTGGAGACAAATGGTG-3' using template YRpl7. A 200 bp fragment

containing the rDNA ARS was amplified by PCR with primers

5 '-CCAAGCTTGTGGACAGAGGAAAAGG-3 and 5 '-GGGAATTCATAACAGGAAAGTAACATCC-3 using

template pJPA102 (rDNA repeat with Ahdl endpoints in pCR4, see below). A 753 bp

fragment containing CEN4 was amplified by PCR with primers

5 '-GCGGATCCCCTAGGTTATCTATGCTG-3 and 5 '-GGGAATTCCTAGGTACCTAAATCCTC-3 using

template YCp50. A 1346 bp region of 2 CI circle DNA, containing the REP3 STB cis-










acting stability element and a single 599 bp repeat region, was amplified by PCR with

primers 5 '-CCGGATCCAACGAAGCATCTGTGCTTC-3 and

5 '-CCAAGCTTTATGATCCAATATCAAAGG-3 using pRS424 as template. rDNA repeats were

amplified by PCR using as template size-selected (8-10 kb), genomic DNA that was

digested with the appropriate enzyme (Ahdl, Psil, or Xmal). The following primer pairs

were used: Ahdl endpointS, 5'-GGGATCCATGTCGGCGGCAGTATTG-3 and

5'-CCTGCAGiCTGTCCCACATACTAAATCTC~TTC-3'; Psil endpoints,

5'-GGGATCCTAATATACGATGAGGATGATAGTG-3' and

5'-CCTGCAGTAATAGATATATACAATACATGTT~TTTACC-3'; Xmal endpoints,

5 '-CCCGGGGCACCTGTCACTTTGG-3 and 5 '-CCCGGGTAAACCCAGTTCCTCACTAT-3' PCR was

performed for 20 cycles with 15-second denaturation and annealing times using PfuTurbo

DNA polymerase (Stratagene). PCR products were purified (Qiagen), digested with

restriction enzymes and ligated directly into recipient vectors, or cloned into pCR4-

TOPO (Invitrogen), excised, gel-purified, and ligated into recipient vectors (see Table 2-

1). ARS elements were cloned between HindIII and EcoRI sites. CEN4 was cloned

between EcoRI and BamHI sites. The 2 CI origin was cloned between HindIII and

BamHI sites. rDNA inserts were cloned between PstI and BamHI sites in pAFl15, which

is derived from pRS424 and contains loxP sites that were inserted at EcoRI and Spel sites

using annealed primer pairs: 5 -AAT`TATAAC TTCGTA TAA TGTAT`GC TATACGAAGTTA T-3' and

5'-AATTATAACTTCGTATAGCATACATTATACGAAGTTAT3 (EcoRI);
5'-CTAGATAACT~TCGTATAATGTATGCTATACGAAGTTA-3 and


5'-CTAGATAACTTCGTATAGCATACATTATACGAAGTTAT3 (Spel). All cloned inserts were

sequenced in their entirety. Plasmids pJPA105, pJPA106, and pJPA107 (that contain









rDNA inserts) were propagated in E. coli DH~a grown in LB media with 25 Clg/ml

carbenicillin at 300C to avoid insert instability.

Mitotic Stability

For each plasmid, five transformants were grown in selective SD liquid medium for

2 days at 300C to saturation (OD600 = 1.1-1.5; 0.5-1X107 ofu/ml; growth to late log gave

results similar to stationary phase). Approximately 200-250 colony forming units (cfu)

of each transformant were plated on non-selective SD medium, grown for 2-3 days at

300C, replica plated onto selective and non-selective agar media, and grown for 3-4 days

at 300C. After these plates grow the total number of colonies that grew under no

selection are counted from the first plate. The number of colonies that grew under

selection are counted from the second plate. Dividing the number of colonies from the

second plate by the number of colonies on the first plate gets the percent of cells in the

population that had the plasmid. This is the mitotic stability. It is simply the number of

colonies that contained the plasmid divided by the total number of colonies.

Replicative Life Span Determinations

Replicative life span determinations were done essentially as described (92) with a

few modifications. Six transformants were streaked individually on one side of an SD

agar plate, and 10 virgin mother cells from each (n=60) were positioned in an orthogonal

grid pattern. Virgin mothers that failed to give rise to 5 daughters were not included in

the data set. Due to the low mitotic stability of ARS-plasmids, it was necessary to start

with approximately 250 virgin mother cells from ARS1~-plasmid transformants to obtain

n=50-60 for life span determinations. A Zeiss Tetrad microscope equipped with 16X

eyepieces was used for micromanipulations as described (88). SD agar plates were

weighed at the beginning of each experiment and sterile water was pipetted into four









small notches at the edge of each plate on a daily basis to compensate for evaporation and

prevent increases in osmolality, which could potentially affect results (108). During life

span experiments, plates were incubated at 300C during the daytime and stored overnight

(~12 hours) at 140C. We found that extended periods (>24 hours) at 140C reduced life

spans of transformants and control strains (data not shown). At the end of a life span

experiment, mother cells not having divided for 2 days were transferred to non-selective

SD or YPD medium, and cells that resumed mitosis were excluded from the data set.

This allowed us to exclude data from mother cells that stopped dividing due to plasmid

loss rather than due to cell senescence. Data were entered into an Excel spreadsheet

template file (available on request) that automatically calculated relevant life span data

values and performed Wilcoxon two-sample paired signed rank tests. Images of terminal

cells were collected using a Spot-2 CCD camera (Diagnostic Imaging) affixed to a Zeiss

Tetrad microscope and "terminal" cell morphology analysis was done as described (70).

Southern Blot Analysis and Quantitation

DNA was extracted from yeast cells using a glass beads/phenol method, digested

with restriction enzymes according to the supplier (New England Biolabs), separated on

0.8% agarose gels (200 V/hours), and capillary transferred to positively-charged nylon

membrane under alkaline conditions using standard methods (109). For each plasmid

copy number and ERC monomer level determination, five plasmid transformants were

analyzed in parallel. Digestion with BamHI or PstI yielded single plasmid-specific or

genome-specific bands of different sizes that hybridized tO 32P-labeled probe generated

by random-primed labeling (New England Biolabs). PstI and BamHI do not cleave

rDNA. Genomic bands were used as internal standards for measurements of plasmid

levels. Chromosomal rDNA bands were used as internal standards for measurements of









ERC monomer levels. Blots were hybridized first to GRA3 or LEU2 probe, followed by

stripping and hybridization to rDNA probe. Data from the same blots were used to

prepare Figures 2 and 3B. Southern data were acquired with a Typhoon PhosphorImager

and analyzed using ImageQuant software (Molecular Dynamics).

Pulse field gel electrophoresis was completed at 14oC with a Bio-Rad CHEF-DR II.

1% agarose gels were run in 0.5X TBE for 30 hours. The voltage used was 200V with a

switch time starting at 5 seconds and ending at 30 seconds.

Magnetic Cell Sorting

At any given time 1 in 512 cells is an eight generation old cell. This is due to the

nature of a doubling population. 1/2 of the cells are new, zero generation daughters. 1/2

of the cell remaining (1/4) are 1 generation old cells. 1/2 of the cell remaining (1/8) are 2

generation old cells. This continues until the number becomes increasingly smaller. To

extract the small number of old cells from a large population of cells, magnetic sorting is

used. 1x10" cells are grown up and labeled with biotin. They are then grown over night

in 1 liter of liquid medium. Since new cell wall synthesis occurs at the bud of the

emerging cell, no biotin is transferred to the newly divided daughters. This results in a

large population of cells that have their oldest cells labeled with biotin and the young

cells are not. The cells are then spun down and concentrated into a smaller volume.

Strep-avidin coated magnetic beads are mixed with the cells for 2 hours at 4oC. All of the

subsequent steps are done in the cold to ensure that the cell do not continue to grow. The

strong interaction between biotin and avidin allows the magnetic beads to bind to the old

cells. The old cells are then pulled out of solution with a strong magnet and the young

cells are washed away. Eight washes are used to ensure that the population acquired at









the end of the experiment is homogeneously old. The old cell final product is ready for

further use in other experiments.

Budscar Histograms

After a sort for old cells, a bud scar histogram is conducted to determine the age

distribution of the cells collected. When a cell divides a bud scar ring is formed at the

point of budding and separation. The bud scar can be stained with a fluorescent dye

calcofluor white MR2. A small fraction of old and young cells are stained with

calcofluor and the number of bud scars on 50 cells are recorded. This creates a histogram

of the number of cells vs. the number of budscars.

rDNA Recombination Assay

The rDNA recombination assay is designed to quantitate the level of recombination

at the rDNA locus. W303AR5 has an ADE2 gene within the rDNA locus. In the absence

of the ADE2 gene colonies become red in color, while wild type ADE2 are white. This

color phenotype allows the scoring of ade2 colonies to be very easy. Saturated liquid

cultures were prepared from five transformants. They were diluted and spread on 15 cm

selective SD agar plates containing 5 Clg/ml adenine hemisulfate and 5 Clg/ml histidine to

enhance red color production. They are allowed to grow at 30oC for 2-3 days. The

plates are then placed at 4oC for 1-2 days for the color to develop. The number of half

sector colonies, colonies that are half red half white, are scored in comparison to the

number of all white colonies. All other partially sectored or red colonies are ignored.

The reason only half sector colonies are scored is because half sectored colonies are

colonies that have lost the ADE2 marker on the first division in the colony formation. A

completely red colony may have become red at any time in growing in the liquid culture.






83


By looking at the first division to forming a colony, all of the data can be normalized to a

single mitotic event.















APPENDIX A
STRAIN: W303AR5+pJPAll3 MEDIA: SD aHLW

15 20 25 30 35 40 45 50 55 60


8 15 10 7 17 11 16 21 6 11


85 8 1120


20 7 6


18 10 17 14 6 15 21 16 20


8 12 16 15 9 18 10 22 24


?5 21


g ;16 8


18 21 13 19 93 8 10 24 10 6

Terminal morphology of senescent cells with its life span directly below the image.















APPENDIX B
STRAIN: W303AR5+pJPAll6 MEDIA: SD aHLW

15 20 26 30 35 40 45 50 55 60


6 21


12 28


31 24


30 21 27


7 20 33L 30


11 38


18 18


915 18 25


B 9s 5 32


22 32 25


10 34 29 29 28


32 12 29 27' 9


19 27 21 37 24


Terminal morphology of senescent cells with its life span directly below the image.















APPENDIX C
STRAIN: W303AR5+pJPAl38 MEDIA: SD aHLW

15 20 26 30 35 40 45 50 55 60


10 13 15 9


6 10 14 6


19 10


7 7 12 9 16


23 26


29 11 9


23 19


5 15 28


29 17 16; 5


31 11


12 12 24 15 23


Terminal morphology of senescent cells with its life span directly below the image.















APPENDIX D
STRAIN: yAF6 IVEDIA: SD aHLW

15 20 26 30 35 40 45 50 55 60


29


29 32 30 23 30 27 25 33 22


24 29 34 33 35 26 35 24 32 33


24 34 32 21 38 28


37 42 3r;


37 29 33 30 31 19


38 35 38 41


23 32 42


25 31 34 38 35 31 38 33 29

Terminal morphology of senescent cells with its life span directly below the image.















APPENDIX E
STRAIN: W303AR5+pJPAl33 MEDIA: SD aHWu

15 20 26 30 35 40 45 50 55 60


9 11 14 10


10i 7


12 12 5 17 10 5 10


Terminal morphology of senescent cells with its life span directly below the image.