<%BANNER%>

The Ethylene Receptor Multigene Family: Insights on Expression, Localization and Function in Arabidopsis and Tomato

Permanent Link: http://ufdc.ufl.edu/UFE0004346/00001

Material Information

Title: The Ethylene Receptor Multigene Family: Insights on Expression, Localization and Function in Arabidopsis and Tomato
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0004346:00001

Permanent Link: http://ufdc.ufl.edu/UFE0004346/00001

Material Information

Title: The Ethylene Receptor Multigene Family: Insights on Expression, Localization and Function in Arabidopsis and Tomato
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0004346:00001


This item has the following downloads:


Full Text

PAGE 1

THE ETHYLENE RECEPTOR MULTIGENE FAMILY: INSIGHTS ON EXPRESSION, LO CALIZATION AND FUNCTION IN ARABIDOPSIS AND TOMATO By PATRICIA MOUSSATCHE A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2004

PAGE 2

Copyright 2004 by Patricia Moussatche

PAGE 3

This work is dedicated to the few who do not try to fit their data to existing models, but instead try to understand the meaning of their findings despite them.

PAGE 4

iv ACKNOWLEDGMENTS Most of all I would like to thank my fam ily for their love and support. I have gotten this far because of them. I would like to thank my advisor, Dr. Harry Klee, for all his support throughout this project. It was a learning experience for both of us. I would like to thank my committee members for all th eir help with this work, especially Dr. Alice Harmon for her expertise with kinases. I could not have accomplished it without her. Dr. Denise Tieman was also a great sour ce of expertise; a lot of what I know now is due to her. I also learned a lot from othe r members of the department and university. I would like to thank Dr. Carole Dabney-Smith for her help in troubleshooting the yeast protein extractions and the Cline lab for thei r patience while I used their cold room. I would like to thank Dr. Wen-Yuan Song a nd his lab for their help with the twodimensional thin layer electrophoresis apparatu s, Dr. Savita Shanker and the University of Florida DNA Sequencing Core Facility fo r all their work and Scott McClung and the University of Florida Protein Chemistry Core Facility for the sequencing of Hsp70. Special thanks should be given to the members of the Klee la b, current and former. It was great to work with all of them. This project was funded by USDA Grant # 9835304-6667 to HK and by the Dickman Family Endowment. This work was also funded in part by the Florida Agricultu ral Experimental Station.

PAGE 5

v TABLE OF CONTENTS page ACKNOWLEDGMENTS.................................................................................................iv LIST OF TABLES............................................................................................................vii LIST OF FIGURES.........................................................................................................viii ABSTRACT....................................................................................................................... ..x CHAPTER 1 INTRODUCTION........................................................................................................1 Ethylene in Plant Biology.............................................................................................3 Ethylene Biosynthesis in Plants....................................................................................6 Ethylene Signal Transduction.......................................................................................8 The Ethylene Recepto r Multigene Family..................................................................14 2 EXPERIMENTAL PROCEDURES...........................................................................19 Experimental Procedures for Tomato Receptor Studies (Chapter 3).........................19 Isolation of Genomic Sequences fo r the Tomato Ethylene Receptors................19 Cloning of the Tomato Ethylene Re ceptors for Localization Studies.................23 Protoplast Isolation and Transient Expression of EGFP Fusion Proteins...........26 Isolation of the NR Promoter Sequence...............................................................26 Cloning of the NR Promoter Sequence for Expression Studies..........................28 Tomato Transformation.......................................................................................28 GUS Activity Assay............................................................................................28 Experimental Procedures for Arabidops is Expression Studies (Chapter 4)...............29 RNA Isolation......................................................................................................29 Real Time RT-PCR (TaqMan)............................................................................30 Arabidopsis Infections with Xanthomonas campestris .......................................30 Experimental Procedures for Enzyme Assays (Chapter 5).........................................31 Construction of Yeast Expression Plasmids........................................................32 Recombinant Protein Ex pression in Yeast..........................................................33 In vitro Autophosphorylation Assays..................................................................34 Acid/Base Stability Assay...................................................................................35 Phosphoamino Acid Analysis..............................................................................35

PAGE 6

vi 3 STUDIES ON ETHYLENE RECEPTORS IN TOMATO........................................36 Comparative Studies on Gene Struct ure between Tomato and Arabidopsis..............37 Cellular Localization of EGFP fusions.......................................................................39 The Promoter Region of the NR Gene........................................................................41 NR Promoter Expression Patterns by GUS fusions....................................................44 4 STUDIES ON RECEPTOR EXPRE SSION LEVELS IN ARABIDOPSIS..............47 Receptor Expression in Arabidopsis...........................................................................49 Receptor Expression in Response to Ethylene...........................................................51 Receptor Expression in Response to Pathogen Attack...............................................53 Receptor Expression in Arabidops is Ethylene Signaling Mutants.............................57 5 KINASE ACTIVITY OF THE ARAB IDOPSIS ETHYLEN E RECEPTORS..........62 Expression of the Five Arabidopsis Ethylene Receptors in Yeast.............................63 Autophosphorylation Activity in vitro ........................................................................64 Nature of the Phosphorylated Amino Acid................................................................67 Insights on the Mechanism of Phosphorylation..........................................................70 6 CONCLUSIONS AND FUTURE DIRECTIONS.....................................................75 APPENDIX A TOMATO GENOMIC SEQUENCES.......................................................................88 LeETR2 .......................................................................................................................88 NEVERRIPE ...............................................................................................................92 LeETR4 .......................................................................................................................95 LeETR5 .......................................................................................................................97 LeETR6 .....................................................................................................................101 B NEVERRIPE PROMOTER SEQUENCE.................................................................103 C SEQUENCE ALIGNMENT OF TH E KINASE DOMAINS OF THE ARABIDOPSIS ETHYL ENE RECEPTORS...........................................................113 LIST OF REFERENCES.................................................................................................115 BIOGRAPHICAL SKETCH...........................................................................................125

PAGE 7

vii LIST OF TABLES Table page 2-1. Cloning primers for the tomato genomic sequences*...............................................20 2-2. Sequencing primers fo r tomato genom ic clones........................................................22 2-3. Primers used to isolate and clone the NR promoter*.................................................27 2-4. Primers and probes used for real-time RT-PCR assays*...........................................31 2-5. Primers used for kinase assay constructs*.................................................................32 3-1. Signal sequence pr ediction by TargetP.....................................................................40 3-2. List of cis -acting elements identified by PLACE Signal Scan Program...................43

PAGE 8

viii LIST OF FIGURES Figure page 1-1. Ethylene biosynthesi s pathway in plants.....................................................................7 1-2. Proposed ethylene signa l transducti on pathway........................................................10 1-3. Schematic of the ethylene r eceptor family in Arabidopsis........................................15 1-4. Phylogenetic relationship between the Arabidopsis ethylene receptors....................17 2-1. The pDESTOE-GFP vector is a plant transformation vector containing the EGFP sequence downstream of an engi neered recombination region................................23 2-2. The pDESTOE vector is a plant tran sformation vector with an engineered recombination region................................................................................................24 2-3. The pFMVnos vector contains the FM V-35S promoter and the nos terminator.......25 2-4. The pHK1001 vector is a standa rd plant transformation vector................................25 3-1. The tomato ethyl ene receptor family.........................................................................36 3-2. Sequence similarity tr ee of the Arabidopsis and to mato ethylene receptors.............37 3-3. Gene structure for the Arabidopsis ethylene receptors AtETR1 AtERS1 AtETR2 AtEIN4 and AtERS2 .................................................................................................38 3-4. Gene structure for the tomato ethylene receptors LeETR2 Nr LeETR4 LeETR5 and LeETR6 .....................................................................................................................39 3-5. Cellular loca lization of the tomato re ceptors fused to EGFP....................................41 3-6. NR genomic locus.....................................................................................................42 3-7. GUS activity in the NR:GUS transgenic lines...........................................................46 4-1. Receptor mRNA levels in rosette leaves of WS (white bars) and Columbia (black bars) ecotypes were determined by realtime RT-PCR using gene specific primers and TaqMan probes to ETR1 ETR2 ERS1 ERS2 and EIN4 ...............................50

PAGE 9

ix 4-2. Effect of exogenous ethylene treatment on the mRNA levels of ethylene receptors in Columbia..................................................................................................................52 4-3. Receptor expression during pathogen response.........................................................56 4-4. mRNA levels in the constitutive mutant ctr1-10 and the insensitive mutant etr1-1 .58 5-1: Ethylene receptor cons tructs expressed in yeast.......................................................64 5-2: In vitro autophosphorylation activity and cat ion dependence. Ethylene receptors were tested for autophosphorylation in vitro in the presence of Mg2+ and Mn2+ as described in Chapter 2..............................................................................................65 5-3: In vitro autophosphorylation activity and cat ion dependence. GST (28 kDa) and ERS1 without the GST tag (ERS1-GST(-); 55 kDa) were tested for autophosphorylation in vitro in the presence of Mg2+ and Mn2+ as described in Chapter 2..................................................................................................................66 5-4: Acid and base stability of phosphorylated amino acids............................................68 5-5: Phosphoamino acid analysis of autophosphorylated receptors.................................69 5-6: ERS1 autophosphorylati on in the presence of both Mg2+ and Mn2+.........................70 5-7: Ethylene receptor mu tants expressed in yeast...........................................................71 5-8: Effects of histidine mutations on in vitro autophosphorylation activity...................72 5-9. Effects of G1-box mutations on in vitro autophosphorylation activity of ETR1 and ERS1.........................................................................................................................73 6-1. Phylogenetic relationship between the kinase domains of Arabidopsis and tomato ethylene receptors, phytochromes (PHY) the mitochondrial proteins PDK and BCKDK, the cytokinin receptors CRE1 and CKI1, histidine kinase homologues in Arabidopsis (ATHK1, AHK2, AHK3), and canonical hi stidine kinases (bold) SLN1, CheA, EnvZ and Cph1..................................................................................83

PAGE 10

x Abstract of Dissertation Pres ented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy THE ETHYLENE RECEPTOR MULTIGENE FAMILY: INSIGHTS ON EXPRESSION, LOCA LIZATION AND FUNCTION IN ARABIDOPSIS AND TOMATO By Patricia Moussatche May 2004 Chair: Harry J. Klee Major Department: Plant Molecular and Cellular Biology Ethylene is a plant hormone that aff ects several aspects of growth and development. Ethylene receptors comprise a diverged multigene family, with six members in tomato and five in Arabidopsis. The expression pattern s of these receptors and their localization in the cel l were investigated in this work, as a means to understand ethylene signal transduction. I show here that the tomato receptors have the same gene structure as the Arabidopsis re ceptors, and they localize to the endoplasmic reticulum. I also investigated the expression patt ern of one of the tomato receptors, NEVERRIPE which is regulated throughout development. I s how here that ethylene itself can regulate its receptor levels, and my studies in Arabi dopsis take advantage of the large mutant collection available for this model species. The ethylene receptors show sequence si milarity to bacterial two-component histidine kinases. These receptors can be di vided into two subfamilies, 1 and 2. It has been previously shown that a subfamily 1 Arabidopsis ethylene receptor, ETR1,

PAGE 11

xi autophosphorylates in vitro on a conserved histidine re sidue. However, sequence comparisons between the five ethylene receptor family members suggest that subfamily 2 members do not have the motifs necessary for hi stidine kinase activity. Here I show that all five Arabidopsis ethylene re ceptor proteins autophosphorylate in vitro I analyzed the nature of the phosphorylated amino acids by ac id/base stability and two-dimensional thin layer electrophoresis, and demonstrated th at unlike ETR1 all other ethylene receptors autophosphorylate predominantly on serine residues. ERS1, the only other subfamily 1 receptor in Arabidopsis, is able to phosphorylate on both histidine and serine re sidues in the presence of Mn2+. However, this activity is lost when ERS1 is assayed in the presence of both Mg2+ and Mn2+, suggesting that histidine autophosphorylation may not occur in vivo Furthermore, mutation of the histidine residue conserved in two-com ponent systems does not abolish serine autophosphorylation, discarding the possibility of a histidine to serine phosphotransfer. My biochemical observations complement the recently published genetic data that histidine kinase activity is not necessary fo r ethylene receptor f unction in plants and suggests that ethylene signal transduc tion does not occur through a phosphorelay mechanism.

PAGE 12

1 CHAPTER 1 INTRODUCTION There are several well characterized hormone s in plants, generally referred to as phytohormones whose roles and modes of action are diverse. Phytohormones do not follow the “classical” definition of animal hormones of molecules synthesized at a specific site that are trans ported to their site of ac tion, where changes in their concentration lead to physiological respons es (reviewed in Davies, 1995). The most general definition for a phytohormone is a compound made by the plant that affects physiology at concentrations lower than t hose of nutrients and vitamins. When concentrations of these compounds are altere d, development is affected (reviewed in Gaspar et al., 2003). The plant responses to hormones are mostly through growth and development such as: tissue regeneration following herbivore feeding, redirection of growth following shading or changes in light sources, and desiccation of the seed following its maturation. Hormonal responses however, are rare ly due to a single phytohormone, as hormone networks are very prominent in plants. Most physiological responses are due to multiple signals, and the sa me signals can also lead to a variety of responses depending on how they are combin ed (reviewed in Ross and O'Neill, 2001; Weyers and Paterson, 2001). Phytohormones can be produced from a va riety of molecules including amino acids, nucleotides, terp enoids, fatty acids and caroteno ids. Most phytohormones do not have a specific site of synthe sis; they can be synthesized by different tissues and even by

PAGE 13

2 different cells of those tissues. Plant physiology is controlled by these chemical messages, which can be transported throughout the plant, but they can also act on the same tissue and even the same cell in whic h they are synthesized. Some phytohormones require transport to their site of action, where they mediate responses in a dose-dependent manner. The lack of a continuous circulati on system in plants seems to aid in the directional flow of these co mpounds (reviewed in Davies, 1995; Weyers and Paterson, 2001). Phytohormones are thought to signal th rough their interacti on with specific receptor molecules. These receptors can be at the cell surface or inside the cell; they activate signal transduction path ways that induce or inhibit gene expression and cellular functions, including changes in membrane potenti al. Most studies so far have focused on transcriptional regulation by hormones. Seve ral promoter regions have been identified that contain cis -acting elements that confer hormone responsiveness. These elements recruit specific transcription factors that a ssemble at the promoter, forming complexes that can induce or repress transcription (Gaspar et al., 2003). There are several aspects to a hormone re sponse, allowing for multiple points of regulation. For a given phytohormone, plants can regulate synthesis, transport, uptake and metabolism of the active molecule, as we ll as perception and cellular response. These steps can be developmentally regulat ed, which may involve regulation by other hormones. Hormone concentration is cont rolled by metabolism, at the levels of biosynthesis, degradation a nd/or inactivation. Phytohormo nes can be inactivated by conjugation to sugars or amino acids. Some of these conjugat ions can also be a form of storage as some conjugations are reversible (Kende and Zeevaart, 1997). Plants can

PAGE 14

3 regulate changes in hormone concentration, but the “sensitivity” of the tissue to the hormone also changes throughout development. A change in tissue sensitivity is defined as the capacity of a tissue to vary its abili ty to respond to a given concentration of a stimulus (i.e., hormone) throughout development. It is not clear wh at regulates changes in tissue sensitivity; it could be due to changes in receptor concentrations, changes in the affinity between the receptor and the hormone, changes in signal transduction components, or combinations thereof (reviewed in Weyers and Paterson, 2001; Gaspar et al., 2003). Ethylene (ethene; C2H4) is a simple gaseous molecule and one of the best understood plant hormones. It is responsible for coordinatin g several aspects of plant physiology and, even though it has been studied fo r over a century, there is still very little understanding as to how the pl ant interprets the ethylene signal. The purpose of this work was to increase our understanding of the mechanism of ethyl ene signaling through the analysis of the ethylene receptors. Ethylene in Plant Biology Depending on the species, cultivar, tissue, and stage of development, ethylene may signal a variety of biological responses. Some of the roles of ethylene are to coordinate leaf and flower senescence, defense responses fruit ripening, leaf and fruit abscission, and seed germination (reviewed in Abeles et al., 1992). Flower development is regulated by ethylene and pollination elicits a burst in ethylene producti on in the style and stigma of the flower that leads to petal senescence. This process is very dramatic in orchid flowers as they last over 80 days if unpollinat ed, but senesce 2 days after pollination or ethylene treatment (O'Neill et al., 1993; Zh ang and O'Neill, 1993). Changes in ethylene synthesis are observed through development but also in response to environmental

PAGE 15

4 changes. Biotic and abiotic stresses can lead to increases in ethyl ene concentration, and depending on the pathogen, ethylene can indu ce defense responses or suppress them. Suppression of plant defense responses is us ed to exacerbate disease symptoms and to kill the tissue in order to control pathogen spread (reviewed in Abeles et al., 1992; Bleecker and Kende, 2000). The agriculture industry has sought control of fruit ripe ning as a way of preventing fruit from spoiling before it reaches th e consumer, and ethylene biosynthesis and perception has been a target for breeding and genetic manipulations. The fruit ripening process is complex and includes loss of ch lorophyll, production of pigments, production of volatiles involved in flavor and aroma, softening of the flesh of the fruit, and abscission of the fruit. Some classes of fruits, called climacteric show a steep increase in ethylene production at the mature green stag e that is accompanied by rise in cellular respiration. Examples of climacteric fru it are apple, banana, cantaloupe and tomato (reviewed in Mattoo and Suttle, 1991). To mato fruit ripening involves changes in ethylene production and gene e xpression at the mature green stage, before the onset of ripening. Some genes change their expression pattern due to changes in ethylene levels while others are developmentally regulated (L incoln et al., 1987; Lincoln and Fischer, 1988). Ripening starts at one re gion and quickly spreads throughout the rest of the fruit. Ethylene diffuses freely from cell to cell because it is liposoluble. It also stimulates its own biosynthesis, which helps amplify the pr ocess in a positive feedback loop (reviewed in Bleecker and Kende, 2000). In most plants, sensitivity to ethylene ch anges with development. Ethylene applied to immature green fruit will not induce ripeni ng, but after ripening ha s initiated ethylene

PAGE 16

5 speeds the ripening process. However, the plant is able to perceive ethylene at an early stage and remembers the amount of ethylen e to which it has been exposed during development. Gassing an immature green frui t with ethylene will not induce ripening but the number of days until ripening starts is redu ced (reviewed in Abeles et al., 1992). It is not clear what determines the sensitivity of th e tissue to ethylene. One possibility is that the developmental regulation of ethylene r eceptor expression would determine levels of ethylene perception. It has been sugges ted that one of th e tomato receptors, NEVERRIPE (NR), might be ra te-limiting before fruit ripening, as its messenger RNA accumulates concomitant with the increases in ethylene production during ripening (Lashbrook et al., 1998). It has also been show n that changes in receptor concentration in tomato, by antisense or over-expression, clearly affect the plant's sensitivity to ethylene (Ciardi et al., 2000; Tieman et al., 2000). An auto-inhibitory effect of ethylene on its own synthesis is observed in immature tomato fruit, which is then converted to an inducible effect at the onset of ripening. Th is difference in effect might be related to differential expression and regulation of ethylene bios ynthetic enzymes by ethylene (Atta-Aly et al., 2000). However, sensitivity to ethylene has also been shown to be independent of ethylene production in orchid s. For example, inhibition of ethylene biosynthesis by aminooxy acetic acid has no effect on the plant's sensitivity to the hormone (Porat et al., 1994). Another process controlled by ethylene is st em and petiole growth. When plants are grown in the dark they normally express an etiolated phenotype, which consists of a pale color and a tall and slim elongation of the stem. In the presence of ethylene, plants show a phenotype termed the triple response rather than the etio lated phenotype. This

PAGE 17

6 response is characterized by inhibition of shoot elongation accompanied by radial stem expansion, apical hook tightening, and loss of gravitropism. Ethylene is induced upon germination and the triple response morphol ogy helps protect the seedling’s apex and young leaves during soil emergence. Paradoxica lly, ethylene inhibits stem elongation in terrestrial plants but promotes rapid growth of stems in semi-a quatic plants, such as rice. Ethylene accumulates in submerged tissues, as it cannot diffuse as well through water as in air, and the rapid stem elongation leads to foliage formation above water (reviewed in Mattoo and Suttle, 1991; Bleecker and Kende, 2000). The triple response is an et hylene phenotype that has been very useful for genetic studies and this seedling phenotype has been exploited in order to search for mutants that show deviant behavior in the presence or ab sence of ethylene (Guzma n and Ecker, 1990). These mutant screens yielded two classes of mu tants: those that were insensitive to the presence of ethylene and do not show the triple response, and those that show a constitutive triple response in the absence of ethylene (reviewed in Kieber and Ecker, 1993; Kende and Zeevaart, 1997). These muta nts have helped elucidate the ethylene signal transduction path way and suggest that there are tw o levels of regulation of the plant's response to ethylene: one at the le vel of biosynthesis and one at the level of perception. Ethylene Biosynthesis in Plants Ethylene is synthesized from carbons C-3 and C-4 of methionine via two intermediates: S-adenosyl-L-methionine (SAM) and 1-aminocyclopropane-1-carboxylic acid (ACC), as seen in Figure 1-1. ACC s ynthase (ACS) and ACC oxidase (ACO) are the major enzymes in ethylene biosynthesis, where ACS catalyzes the first committed step in ethylene synthesis and is the prim ary step regulating ethylene production. The

PAGE 18

7 conversion of SAM to ACC by ACS releases 5’-methylthioad enosine (MTA). MTA is recycled to methionine by the Yang cycle, at the expense of ATP. This permits a continuous production of ethylene without depleting the plant’s methionine pool (Bleecker and Kende, 2000; Wang et al., 2002). ACC can be converted to ethylene by ACO or it can be inactivated by conjugation to produce malonyl-ACC or glutamyl-ACC. This conjugate is a sink for ACC and redu ces ethylene production (Alonso and Ecker, 2001). ACC oxidation produces CO2 and cyanide as byproducts, the latter of which is converted to -cyanoalanine to prevent the accumula tion of toxic levels of cyanide (Wang et al., 2002). methionine S NH3O O1-aminocyclopropaneO HO H2Nethylene OH OH O N N N N NH2 S H3N O O + + + S-adenosyl-L-methionine(SAM) SAM 1-carboxylic acid (ACC) ACC synthase (ACS) 5’-methylthioadenosine (MTA) ATP PPi+ Pisynthetase ACC oxidase (ACO) Fe2+, CO2H2C = CH2 O2ascorbate dehydroascorbate CO2, HCN, H2O Figure 1-1. Ethylene biosynt hesis pathway in plants.

PAGE 19

8 Both ACS and ACO are encoded by multigen e families, with 12 and 2 members in Arabidopsis, respectively. Transcripts of is oforms of these enzymes are differentially regulated during stages of plant developmen t and in response to various environmental stimuli, including exposure to ethylene and other hormones (Kende and Zeevaart, 1997; Alonso and Ecker, 2001; Wang et al., 2002). Regulation of ACS occurs not only at a transcriptional but at a post-translational leve l. Mutations at the carboxyl-terminus of ACS leads to loss of protein turnover and increased ethylene synthesis (Vogel et al., 1998; Wang et al., 2002; Chae et al., 2003). It has also been suggested that the ETHYLENE OVERPRODU CING1 (ETO1) protein binds to the carboxyl-terminus of ACS and acts as an inhibitor of its activity by inducing protein tur nover (Cosgrove et al., 2000; Alonso and Ecker, 2001; Wang et al., 200 2). The binding of ETO1 to ACS might be regulated by phosphorylation of the carboxyl-terminus by a calcium-dependent protein kinase (Tatsuki and Mori, 2001). ACS is also subject to suicide inactivation, where the conversion of SAM to ACC leads to enzyme inactivation and degradation, which is also consistent with its high turnover rate (Sat oh and Esashi, 1986; Satoh et al., 1993). Ethylene Signal Transduction Several components of the ethylene si gnal transduction pa thway have been identified in the last two decad es. Five proteins have now b een identified in Arabidopsis as receptors for the plant hormone ethyl ene: ETHYLENE-RESISTANT1 (ETR1) (Chang et al., 1993), ETHYLENE RESPONSE SENS OR1 (ERS1) (Hua et al., 1995), ETR2 (Sakai et al., 1998), ETHYLENE INSENSITIVE4 (EIN4), and ERS2 (Hua et al., 1998). The ethylene signal is transmitted from these receptors to transcription factors, such as EIN3 (Chao et al., 1997) and other EIN3-LIKE proteins (EILs) (Sol ano et al., 1998), via a common pathway that includes CONS TITUTIVE-TRIPLE-RESPONSE1 (CTR1)

PAGE 20

9 (Kieber et al., 1993), a MAP kinase cascade (Ouaked et al., 2003) and EIN2 (Chen and Bleecker, 1995). A putative CTR1-independent signaling pathway has also been proposed (Hua and Meyerowitz, 1998), but no components have yet been identified. The most likely model for ethylene signa ling is based on genetic data (Hua and Meyerowitz, 1998) and indicates that the ethyle ne receptors are in an “ON” state in the absence of ethylene, actively repressing dow nstream members of the pathway. Binding of ethylene switches the receptors to their “O FF” state, which releas es repression of the ethylene signal transduction pathway (review ed in Bleecker and Kende, 2000). Several dominant insensitive alleles of the receptors have been identified that impair ethylene binding and prevent release of the repressed state of th e ethylene signal transduction pathway (Bleecker et al., 1988; Hua et al., 1995; Hua et al., 1998; Sakai et al., 1998). However, the mechanism of receptor functi on is not understood, because of a lack of biochemical data. Thus, “ON” and OFF” are used here in general terms. The proposed pathway for ethylene signal tran sduction is shown in Figure 1-2. ETR1 was the first of five ethylene recepto rs identified in Arab idopsis and remains the best characterized receptor. ETR1 was iden tified due to a mutation that leads to lack of a triple response in the presence of ethylene. The etr1-1 mutation confers a dominant ethylene insensitive phenotype and these plants have larger rose tte leaves than wild-type. There is no significant change in ethylene synthesis but these plants show a 20% reduction in their ability to bind ethylene, wh en compared to wild-type plants (Bleecker et al., 1988). The amino-terminal regi on of ETR1 shows no similarities to known proteins and contains the ethylene binding-si te (Schaller and Bleecker, 1995), while the

PAGE 21

10 carboxyl-terminal region shows sequence simila rity to bacterial two-component systems (Chang et al., 1993) Figure 1-2. Proposed ethylene signal transducti on pathway. A, receptors in “ON” state represses ethylene signal transduction. B, ethylene binding turns receptors “OFF”, which leads to the activat ion of transcription factors. In bacteria, two-component signal transduc tion systems are involved in a variety of responses, including osmotic regulation, ch emotaxis, host recognition by pathogens, responses to changes in phospha te and nitrogen levels, and stress responses (reviewed in Stock et al., 2000). Traditional two-compone nt signal transduction systems involve a sensor protein and a response re gulator protein. In most cases the sensor consists of a variable amino-terminal domain located in the periplasm, two trans-membrane regions, and a histidine kinase domain at the car boxyl-terminus. The histidine kinase domain CTR1 SIMKK SIMK/MMK3 EIN2 EIN3 ERF1 ETR1 CTR1 SIMKK SIMK/MMK3 ETR1 H2C=C2H A B

PAGE 22

11 autophosphorylates in response to a given stimulus. The response regulator comprises a receiver domain and an effector dom ain. Following phosphorylation, the response regulator catalyzes the transfer of the phos phoryl group from a hist idine residue in the sensor’s kinase domain to an aspartate residue in its own receiver domain. The phosphorylation of the response regulator usually leads to a gain of DNA binding activity of its effector domain. Two-component prot eins are also involved in more complex signaling pathways, termed phosphorelays In these pathways the receptors are often hybrid proteins, containing a receiver domain at the carboxyl-terminus of their kinase domain. After autophosphorylati on of the histidine residue in the kinase domain, the phosphoryl group is transferred intra-molecu larly to the receiver domain. This phosphoryl group is subsequently transferred to a histidine-containing phosphotransfer protein (HPt), and then to a response re gulator protein, completing a phosphorelay (reviewed in Stock et al., 2000). ETR1 was localized to the endoplasmic re ticulum (ER) (Chen et al., 2002) and receptor signaling seems to regulate the a MAP kinase cascade (Ouaked et al., 2003). Mitogen activated protein ki nases (MAPKs) are enzymes that are activated following phosphorylation by a kinase named MAPK-kinas e (MAPKK). If the latter is also activated by phosphorylation, the kinase that pho sphorylates it is ca lled MAPKK-kinase (MAPKKK). This succession of kinase activ ations is termed a MAP kinase cascade (reviewed in Alberts, 2002). CTR1 is a se rine/threonine protein kinase with sequence similarity to the RAF family of protein kinases (Kieber et al., 1993). CTR1 is a MAPKKK and its kinase activity is necessary for repression of ethylene signaling (Huang et al., 2003). Mutations in the CTR1 gene ar e recessive and induce th e triple response in

PAGE 23

12 the absence of ethylene. This suggests that CT R1 acts as a repressor of ethylene response and the loss of this repression leads to a constitutive ethy lene response (Kieber et al., 1993). Epistasis analysis sugge sts that CTR1 acts downstream of ETR1 (Roman et al., 1995) and it has been shown to interact with ETR1 in vitro and in vivo (Clark et al., 1998; Gao et al., 2003; Huang et al., 2003). Mo reover, CTR1 localization to the ER is dependent on its interaction with ETR1 (Gao et al., 2003). Biochemical data suggest that SIMKK is a MAPKK involved in ethylene signaling. SIMKK seems to phosphorylate two MAPKs, SIMK and MMK3, which also seem to be involved in ethylene signal transduction (Ouaked et al., 2003). MAP kinase cascades are eukaryotic si gnaling systems, while two-component regulators are prokaryotic systems. This integration of prokaryotic and eukaryotic mechanisms, however, is not unique to ethylen e signaling. A similar system occurs in the yeast S. cerevisiae for example, where there is onl y one histidine kinase sensor protein, the osmolarity receptor SLN1 (Ota and Varshavsky, 1993). SLN1 is a hybrid histidine kinase that transfers its phosphoryl group to a HPt, YPD1, which then transfers the phosphoryl group to the res ponse regulator SSK1 (Maeda et al., 1994; Maeda et al., 1995). High osmolarity induces the deact ivation of SNL1, wh ich leads to the dephosphorylation of SSK1. This activates a MAP kinase cascade, where SSK2 is a MAPKKK, PBS2 is a MAPKK, and HOG1 is a MAPK (Posas and Saito, 1998). Five HPt homologues have been iden tified in Arabidopsis (reviewed in Hutchison and Kieber, 2002) and some have been shown to interact with ETR1 in yeast two-hybrid assay (Urao et al., 2000). There are also 22 response regulators in Arabidopsis (reviewed in

PAGE 24

13 Hutchison and Kieber, 2002), some of which could be involved in ethylene signaling (D'Agostino et al., 2000). Little is known about how the MAP kinase cascade regulates nuclear events in ethylene signaling. Epistasis analysis ha s positioned EIN2 downstream of the CTR1 (Roman et al., 1995). The EIN2 sequence pred icts twelve trans-membrane helix domains at the amino-terminal domain. This re gion shows 21% identity to Nramp-related proteins, which are ubiquitous and seem to f unction as cation transporters (Alonso et al., 1999). The ein2 loss-of-function mutants are recessive and completely insensitive to ethylene (Roman et al., 1995). The function of EI N2 in ethylene response is not clear, as no transport activity has been show n for this protein. One possibi lity is that it could be a transporter for a second messenger. However, EIN2 could also be a transporter for an important cofactor of one of the signal transduction components and not necessarily be directly involved in the pathway. Su ch is the case for the RESPONSIVE TO ANTAGONIST1 (RAN1) protein, which is a Menkes/Wilson disease-related copper transporter. As the receptor s require copper as a cofactor, ran1 loss-of-function mutants prevent the receptors from assemb ling properly (Hirayama et al., 1999). Ethylene signal transducti on regulates nuclear transc ription factors, which coordinate ethylene response ge nes. EIN3 is a nuclear-lo calized protein with a novel DNA binding domain, containing coil and helical basic regions (Chao et al., 1997). EIN3 is a member of a multi-gene family of transcription factors, including EIL1 EIL2 and EIL3 (Solano et al., 1998). The ein3 loss-of-function mutants are recessive and insensitive to ethylene, but this inse nsitivity is not as severe as in the ein2 mutants, probably due to functional redund ancy between EIN3 and the EILs. It has also been

PAGE 25

14 shown that overexpression of EIN3 leads to a constitutive ethylene response, even in an ein2 background (Chao et al., 1997). These da ta, along with the observation that the ein2 ; ein3 double mutant does not show an additive phenotype (Roman et al., 1995), suggest that EIN3 acts downstream of EIN2 in the ethylene signal transduction pathway. EIN3 gene expression is not indu ced by ethylene (Chao et al., 1997), but the EIN3 protein only accumulates in the presence of the hormone (Yanagisawa et al., 2003). EIN3 is necessary and sufficient for the expressi on of the transcrip tion factor ETHYLENE RESPONSE FACTOR1 (ERF1) (Solano et al., 1998). ERF1 is a member of a large family of plant-specific transcription f actors with more than a hundred members in Arabidopsis. ERF1 is one of the transcrip tion factors responsible for the induction of ethylene response genes but is not accountable for th e entire ethylene response (Riechmann and Meyerowitz, 1998; Wang et al., 2002). The Ethylene Receptor Multigene Family The focus of this work is to characterize the ethylene receptors and their role in ethylene signal transduction. As shown in Fi gure 1-3, the ethylene receptors show four distinct domains: a membrane spanning doma in, which is the ethylene binding site (Schaller and Bleecker, 1995); a GAF domain (Aravind and Ponting, 1997); a kinase domain with sequence similarity to histid ine kinases (Parkinson and Kofoid, 1992); and a receiver domain as found in response regulator proteins (Stock et al., 2000). The receiver domain, however, is absent from two of the ethylene receptors, ERS1 and ERS2 (Hua et al., 1995; Hua et al., 1998). It has been shown that ETR1 is present as a dimer, held together by a disulfide linkage that is predicted to be extra-cytoplasmic (Scha ller et al., 1995). The ethylene binding site is located in the membrane-spa nning region of the amino-terminal domain

PAGE 26

15 and competition assays with 14C-labeled ethylene show that ethylene binding in yeast expressing ETR1 is saturable and reversible. Measurements of 14C released from the receptor suggest that the half-life of et hylene binding is 12.5 hours (Schaller and Bleecker, 1995). However, this might be an underestimate as protein turnover was not taken into account. Ethylene se ems to interact with the copper atom in the electron rich hydrophobic region within the membrane-spannin g domains of the dimer (Rodriguez et al., 1999). The coordination of a copper atom e xplains the observed reversible ethylene binding to the receptor. Cys65 and His69 are necessary for binding activity, as these residues coordinate the metal. In the etr1-1 mutant, the C65Y mutation prevents the receptor from coordinating the copper atom, av erting ethylene binding (Hall et al., 1999; Rodriguez et al., 1999). The mo st conserved domain in all et hylene receptors is the transmembrane (sensor) domain, including the ami no acids that are required for dimerization and ethylene binding. Figure 1-3. Schematic of the ethylene receptor family in Arabidopsis. The five conserved motifs necessary for histidine kinase activity (H-, N-, G1-, F-, and G2-boxes) are noted. AtETR1 AtERS1 AtETR2 AtERS2 AtEIN4 HD GAF TMD N G1 F G2KD RD H N G1 F G2H D D G2

PAGE 27

16 The GAF domain has been identified by sequence comparison, and it is defined by a predicted secondary conformation. Th is domain was first identified in cG MP-specific phosphodiesterases, a denylate cyclases from Anabaena and F hlA from E. coli and is present in eubacterial and e ukaryotic signaling molecules. The function of the GAF domain is not clear, but it seems to be a bindi ng site for ligands, such as nucleotides and small molecules (Aravind and Ponting, 1997). The GAF domain has also been identified as the chromophore-binding domain of plan t phytochromes, which also show sequence similarity to bacterial two-component systems (Sharrock and Quail, 1989). The carboxyl-terminal region of ETR1 shows the main features of two-component regulators. ETR1 contains the five conser ved motifs necessary for histidine kinase activity (H-, N-, G1-, F-, and G2-boxes), in the conserved order and with loosely conserved spacing (Figure 1-3) (Parkinson and Kofoid, 1992; Chang et al., 1993). Histidine autophosphorylation activity of ETR1 has been shown at the conserved histidine in the H-box (Gamble et al., 1998). The receiver domain of ETR1 has two of the three conserved aspartate residues, incl uding the one that is phosphorylated, and the conserved lysine. However, no phosphorelay has been observed. It has also been reported that loss of histidine autophosphoryl ation or removal of the kinase domain of ETR1 does not impair ethylene insens itivity conferred by the dominant etr1 mutant (Gamble et al., 2002). Neither do mutations that disrupt his tidine kinase activity of ETR1 prevent its complementation of etr1;ers1 ethylene hypersensitiv e double loss-of-function mutant (Wang et al., 2003). Hence, it has been suggested that recepto r kinase activity is not part of the mechanisms of ethylene signal transduction.

PAGE 28

17 The Arabidopsis genes fall into two subf amilies, with respect to their sequence similarity (Figure 1-4). These two groups do not correspond to the presence or absence of the response regulator but they do correlate with intron distribution within the genes. ETR1 and ERS1 are subfamily 1 receptors a nd have all the conserved motifs necessary for histidine kinase activity (F igure 1-3) (Parkinson and Ko foid, 1992; Chang et al., 1993; Hua et al., 1995). The subfamily 2 class includes ETR2, ERS2 and EIN4, which do not contain most of the motifs characteristic of hi stidine kinases (Hua et al., 1998; Sakai et al., 1998). EIN4 is the only one in this gr oup containing a histidine in the same position as the one that is phosphorylated in twocomponent and phosphorelay systems (Hua et al., 1998). Figure 1-4. Phylogenetic relationship between the Arabidopsis ethy lene receptors. Neighbor-joining tree was generated from full-length protein sequences using Clustal W ( http://clustalw.genome.ad.jp/ ). The subfamily 2 members feature a putative fourth trans-membrane region at the amino-terminus of 20-30 hydrophobic amino acids which could be a targeting sequence (Hua et al., 1998; Sakai et al., 1998). The et hylene receptors also show differential gene regulation: ETR2 ERS1 and ERS2 are induced by ethylene wh ile the others are not. In situ hybridization data suggest that these genes are expr essed in all organs, in ETR1 ERS1 EIN4 ETR2 ERS2 Subfamily 1 Subfamily 2

PAGE 29

18 overlapping, but not identical tissues (Hua et al., 1998). Despite the divergence in sequence, genetic data suggest that all fam ily members are active in ethylene signal transduction. Dominant ethylene insensitiv e mutations have been recovered for all ethylene receptors (Bleecker et al., 1988; Hua et al., 1995; Hu a et al., 1998; Sakai et al., 1998) and single loss of function mutants do not lead to a constitutive ethylene response phenotype (Hua and Meyerowitz, 1998; Hall et al., 1999). In tomato, six ethylene receptor family members have also been identified: LeETR1, LeETR2 (Lashbrook et al., 1998), NR (Wilkinson et al., 1995), LeETR4, LeETR5 (Tieman and Klee, 1999), and LeETR6 (Tieman and Klee, unpublished). Nr mutants show several ethylene insensitive phenot ypes, such as absence of seedling triple response in the presence of ethylene and de layed tomato fruit ripening, abscission and senescence (Yen et al., 1995). The negative regulation model is supported by receptor studies in tomato, where antisense lines for LeETR4 show a severe ethylene response phenotype. Interestingly, antisense lines for other ethylene receptors, such as NR do not seem to show ethylene response phenotypes, as LeETR4 seems to be upregulated in these lines, which compensates for the reduction in NR receptor levels (Tieman et al., 2000). Compensation for lack of LeETR4 does not occur, as a result of differential regulation of gene expression. However, the ethylene hypersensitive response phenotype can be eliminated in these LeETR4 antisense lines by the overexpression of NR These data support the hypothesis that the receptors perf orm redundant functions and also suggest that the response regulator is not necessary for the ethylene respons e signal transduction pathway, as it is absent from the NR protein.

PAGE 30

19 CHAPTER 2 EXPERIMENTAL PROCEDURES This chapter outlines the experimental procedures used to obtain the results presented in the next few chapters. The descri ptions of the methods used in this work are moderately detailed and they assume the reader has at least a basic knowledge of biochemistry and molecular biology. Previ ously published techniques that were followed as described in the original work (or kit manual) are only referenced, while all modifications and optimizations made to those are described in detail. Experimental Procedures for Tomato Receptor Studies (Chapter 3) The genomic sequence between the translational start and stop sites of the tomato ethylene receptors LeETR2 NEVER RIPE ( NR ), LeETR4 LeETR5 and LeETR6 was isolated from Lycopersicon esculentum and cloned into an expression vector for localization studies. These constructs permitted the expression of the tomato receptors in vivo with the enhanced green fluorescent pr otein (EGFP) attached to their carboxyltermini. Two kilobases of the promoter region of NR was also isolated from L. esculentum and cloned into an expression vector where it controlled the expression of glucuronidase (GUS). This construct was us ed to produce transgenic tomato plants for expression studies. Isolation of Genomic Sequences for the Tomato Ethylene Receptors Genomic DNA was isolated from tomato leaves ( Lycopersicon esculentum cv. M82 ) using the DNeasy Plant Mini Kit (Qiagen) according to manufacture’s guidelines.

PAGE 31

20 Genomic DNA was used to amplify the genomic loci of the tomato ethylene receptors, as described below. Primers used for cloning are described in Table 2-1 and sequencing primers are described in Ta ble 2-2. The PCR products we re then cloned into the pENTR/D-TOPO vector (Invitrogen), which c ontains the site-specific recombination sites att L1 and att L2. Forward primers were de signed incorporat ing the CACC nucleotide sequence (underlined) required for directional cloning into pENTR/D-TOPO. Table 2-1. Cloning primers for the tomato genomic sequences* Primer Name Primer Sequence LeETR2-fwd3 GTGATTCATTAAGGATTTGTTCATCATGGATTGTA LeETR2-rev3 TTGAGACAATTTTGGTTTACTGGGATTAAAGAACAGT LeETR2-entry5’ CACC ATGGATTGTAACTGCTTCGATCCACTGTTG LeETR2-rev2 AAGAACAGTTCCGTGCTCTAAAAGCCCGGATA NR-entry5’ CACC ATGGAATCCTGTGATTGCATTGAGGCTTTAC NR-rev2 CAGACTTCTTTGATAGCGTTGAGCATTCACAGAC LeETR4-entry5’ CACC ATGTTGAGGACGTTAGCATCAGCTTTGTTG LeETR4-rev2 CATCATTCTACTTCCCCGTAGCAGAACCCTTT LeETR5-fwd3 GGATTGAGATGTTGGCAATGTTAAGGTTGTTG LeETR5-rev3 CATTAGTACTAACATCTCACAAGCCATCACCACC LeETR5-entry5’ CACC CACCATGTTGGCAATGTTAAGGTTGTTGTTTCT LeETR5-rev2 CAAGCCATCACCACCGCCGC LeETR6-fwd3 GGTGTAAACAAGAGTAGTTCTATTGGATGCAATGATGAAG LeETR6-rev3 TATAGTCTATTGTAAACGTTACCGTCATGGCATTCCT LeETR6-entry5’ CACC ATGATGAAGAAAGTAGTATCATGGTTGTTGTT LeETR6-rev2 TGGCATTCCTCTGTTTGCATG EGFPSpe I-fwd ACTAGT ATGGTGAGCAAGGGCGAGGAG EGFPKpn I-rev CCATGG AATGAACATGTCGAGCAGGTACGGCTCT *Underlined nucleotides ar e explained in the text. LeETR2 LeETR2 was amplified by nested PCR with the following conditions: primers LeETR2-fwd3 and LeETR2-rev3 were used to amplify genomic DNA using the following cycle conditions: 5 min at 95C, 30 cycles of 95C for 1 min, 61C for 1 min, and 72C for 8 min, followed by 10 min at 72C. Genomic PCR products were used in a nested PCR reaction with primers LeETR2entry5’ and LeETR2-rev2 using the following cycle conditions: 5 min at 95C, 30 cycles of 95C for 1 min, 61C for 1 min, and 72C for 8 min, followed by 10 min at 72C. LeETR2 sequence was obtained by automated sequencing with the following primers: M13F (Invitrogen), M13R (Invitrogen), LeETR2-

PAGE 32

21 seqfwd-1, LeETR2-seqfwd-2, LeETR2-seqfwd -3, LeETR2-seqrev-1, LeETR2-seqrev-2, LeETR2-seqrev-3, LeETR2-seqrev-4, LeETR2seqrev-5, LeETR2-seqrev-6, 7-3-2 (rev), 7-3-4 (rev), 7-3-5 (fwd), 7-36 (fwd), and 7-3-8 (rev). NR NR was amplified by genomic PCR with primers NR-entry5’ and NR-rev2 using the following cycle conditions: 5 min at 95C, 30 cycles of 95C for 1 min, 63C for 1 min, and 72C for 7 min, followed by 10 min at 72C. NR sequence was obtained by automated sequencing with the following primers: M13F, M13R, NR-seqfwd-1, NRseqfwd-2, NR-seqfwd-3, NR-seqfwd-4, NR-seqfwd-5, NR-seqrev-1, NR-seqrev-2, NRseqrev-3, and NR-seqrev-4. LeETR4 LeETR4 was amplified by genomic PCR with primers LeETR4-entry5’ and LeETR4-rev2 using the following cycle cond itions: 4 min at 95C, 30 cycles of 95C for 1 min, 63.4C for 1 min, and 72C for 7 min, followed by 15 min at 72C. LeETR4 sequence was obtained by automated sequenc ing with the following primers: M13F, M13R, LeETR4-seqfwd-1, LeETR4-seqfwd-2, LeETR4-seqrev-1, T12-1-3 (fwd), T12-14 (fwd), T12-1-5 (rev), and T12-1-8 (rev). LeETR5 LeETR5 was amplified by nested PCR with the following conditions: primers LeETR5-fwd3 and LeETR5-rev3 were used to amplify genomic DNA using the following cycle conditions: 4 min at 95C, 30 cycles of 95C for 1 min, 62C for 1 min, and 72C for 7 min, followed by 15 min at 72 C. Diluted genomic PCR products were used in a nested PCR reaction with prim ers LeETR5-entry5’ and LeETR5-rev2 using the following cycle conditions: 2 min at 95C, 30 cycles of 95C for 30s, 60.3C for 30s, and 72C for 10 min, followed by 15 min at 72C. LeETR5 sequence was obtained by automated sequencing with primers M13F, M13R, LeETR5-seqfwd-1, LeETR5-seqfwd-

PAGE 33

22 2, LeETR5-seqfwd-3, LeETR5-seqfwd-4, LeETR5-seqfwd-5, LeETR5-seqrev-1, LeETR5-seqrev-2, LeETR5-seqrev-3, T9-2-2 (fwd), T9-2-6 (rev), and T9-2-9 (fwd). Table 2-2. Sequencing primers for tomato genomic clones. Primer Name Primer Sequence LeETR2-seqfwd-1 CTCCCTGTAATTAATCAAGT LeETR2-seqfwd-2 CTGGTCGCTTAAATGAGTCA LeETR2-seqfwd-3 TCATCTGCACCACGCTGA LeETR2-seqrev-1 CGTTACCATCCTGCTAAACC LeETR2-seqrev-2 GCTTCCATCCTCTAGCCTTG LeETR2-seqrev-3 GCCAAGTCCAGTGCCAGCAG LeETR2-seqrev-4 TGACGGCAACATCATAACAG LeETR2-seqrev-5 GTTAAGCTCCTTCAACTTTC LeETR2-seqrev-6 TAGATCCTACATCCAACGTC 7-3-2 (rev) CAAAGCATAGCTCTTCGG 7-3-4 (rev) CCCTAACAGCAACCACCTC 7-3-5 (fwd) ACTTCTATTTGCGTGTACAGG 7-3-6 (fwd) GAGCAGAATGTGGCTCTTGATC 7-3-8 (rev) CCGAAGACAAACTAAGCGTGAC NR-seqfwd-1 TCCTTTGGCAAGGATGAGGA NR-seqfwd-2 GCAGTTATTGCTCTGTGCTC NR-seqfwd-3 CCAAACTCTCTTAAACGTGGC NR-seqfwd-4 GAGATAAGAAGCACACTCGA NR-seqfwd-5 GCTCAGACTCTGGTGTCG NR-seqrev-1 AATTTGGTGAATACTAGTGG NR-seqrev-2 GAGCACAGAGCAATAACTGC NR-seqrev-3 GCCACGTTTAAGAGAGTTTGG NR-seqrev-4 CGCACCTAAACATCCTTACC LeETR4-seqrev-1 CGAAGCCATCCAAATCAGGC T12-1-3 (fwd) CAGGTTAAGGAGAGTGACGGAG T12-1-4 (fwd) GGCATTGGTGGAGCATGGAG T12-1-5 (rev) GCAACAAGGAGAGCAGACCC T12-1-8 (rev) CCCAGATGTCTCCTTGCATCAAC LeETR5-seqfwd-1 CTTTCCAATTGATATTGTCC LeETR5-seqfwd-2 CTTGAGTTTCAACATGTGCA LeETR5-seqfwd-3 GAGAAAGAAGGGAGGAAC LeETR5-seqfwd-4 CCATGAAGAGACTGACTACC LeETR5-seqfwd-5 TTGAGCTGTAGGAACCAGTC LeETR5-seqrev-1 TCTGAGAATGAGTGTCATCC LeETR5-seqrev-2 TGCACATGTTGAAACTCAAG LeETR5-seqrev-3 CTGTCCGCAGAAGCAGTA T9-2-2 (fwd) CACTTATTAAATGTCAGCATTGG T9-2-6 (rev) CTAACCTCAATTTCAAATTTTATGG T9-2-9 (fwd) GAGCTAGATCAAGAGGTTGGG LeETR6-seqfwd-1 TTAGGATGCTTACCAATGAG LeETR6-seqfwd-2 TTAGAGCAAGTCAAGCTAGGA LeETR6-5 (fwd) CCGAGATCGAACTCATCCAATG

PAGE 34

23 LeETR6 LeETR6 was amplified by nested PCR with the following conditions: primers LeETR6-fwd3 and LeETR6-rev3 were used to amplify genomic DNA using the following cycle conditions: 5 min at 95C, 30 cycles of 95C for 1 min, 63C for 1 min, and 72C for 3 min, followed by 10 min at 72 C. Diluted genomic PCR products were used in a nested PCR reaction with prim ers LeETR6-entry5’ and LeETR6-rev2 using the following cycle conditions: 1 min at 95C, 30 cycles of 95C for 30s, 57C for 30s, and 72C for 3 min, followed by 5 min at 72C. LeETR2 sequence was obtained by automated sequencing with the following primers: M13F, M13R, LeETR6-seqfwd-1, LeETR6-seqfwd-2, and LeETR6-5 (fwd). Cloning of the Tomato Ethylene Receptors for Localization Studies The genomic clones of the tomato ethylene receptors cloned into pENTR/D-TOPO were recombined into a destination vector (pDESTOE-GFP; Figure 2-1). pDESTOE-GFP(10554 bp) pFMV NOS 3' nptII specR EGFP recomb. region PstI (304) PstI (521) BamHI (1313) XhoI (1582) BglI (1938) BglI (3069) BglI (3303) BglI (5622) PstI (5749) BglI (6461) PstI (6688) EcoRI (7315) EcoRI (7718) XbaI (7785) NotI (7916) BamHI (7987) EcoRI (8237) XbaI (8683) BamHI (8689) PstI (9358) BamHI (9495) EcoRI (9507) SpeI (9532) KpnI (10258) BamHI (10264) NotI (10546) EcoRI (10554) Figure 2-1. The pDESTOE-GFP vector is a plant transformation ve ctor containing the EGFP sequence downstream of an engi neered recombination region.

PAGE 35

24 The pDESTOE-GFP vector contains the gene for enhanced green fluorescent protein (EGFP) and expresses a fusion protein with the EGFP at the carboxyl-termini of the receptors. This vector was created as follows: the EGFP gene was amplified from pGREEN0029 (John Innes Centre, United Kingdom) with primers EGFPSpe I-fwd and EGFPKpn I-rev (Table 2-1), with e ngineered restriction sites to facilitate subcloning (underlined). The PCR conditions used were: 30 cycles of 95C for 30s, 60C for 30s, and 72C for 1 min. The EGFP PCR produc t was cloned into pCR4-Blunt-TOPO (Invitrogen), and sequenced with M13F and M13R primers. The EGFP fragment was then cut with Spe I and Kpn I and ligated into the destin ation vector pDESTOE (Figure 22) cut with the same endonucleases. Figure 2-2. The pDESTOE vector is a plant transformation vector with an engineered recombination region. The pDESTOE vector was made by ligating the Gateway Cassette (Invitrogen) into pFMV-nos (Figure 2-3) betw een the FMV-35S promoter and the nos terminator. The Not pDESTOE(9846 bp) pFMV NOS 3' recomb. region nptII specR PstI (304) BglII (308) PstI (521) BamHI (1313) XhoI (1582) BglI (1938) BglI (3069) BglI (3303) NdeI (4437) BglI (5622) PstI (5749) BglI (6461) PstI (6688) HindIII (7185) EcoRI (7315) EcoRI (7718) XbaI (7785) NotI (7916) BamHI (7987) EcoRI (8237) XbaI (8683) BamHI (8689) PstI (9358) BamHI (9495) EcoRI (9507) SpeI (9532) BamHI (9538) KpnI (9550) BamHI (9556) NotI (9838) EcoRI (9846)

PAGE 36

25 INot I fragment was then cloned into a standard vector for Agrobacterium -mediated transformation (pHK1001; Figure 2-4). Figure 2-3. The pFMVnos vector contai ns the FMV-35S promoter and the nos terminator. Figure 2-4. The pHK1001 v ector is a standard plan t transformation vector. pHK1001(7229 bp) NPTII Left Border oriV ori-322 Spc/Str Right Border HindIII XbaI SacI SalI EcoRV BamHI NotI EcoRI pFMVnos(4046 bp) pFMV NOS 3' -lactamase ORF NotI (877) HindIII (889) SacI (895) EcoRI (1019) EcoRI (1422) XbaI (1488) EcoRI (1500) SacI (1506) KpnI (1512) BamHI (1518) NotI (1800)

PAGE 37

26 Protoplast Isolation and Transient Ex pression of EGFP Fusion Proteins This procedure was performed by Isabelle Mila in Dr. Mondher Bouzayen’s laboratory at UMR 990, INRA-ENSATGenomique et biotechnologie des fruits, France. Protoplasts used for transfec tion were obtained from 6to 8-day-old suspension–cultured tobacco BY-2 cells. For the cell wall digestion, ~2 g of cells were fi rst rinsed two times with a Tris-MES (25 mM) buffer containing 0.6 M mannitol, pH 5.5, and then incubated for 1.5 h at 37C in the same solution contai ning 1% Caylase, 0.2% pectolyase Y-23 and 1% BSA. Protoplasts were then filtere d through 30 m nylon cloth and washed three times with W5 solution (154 mM NaCl, 125 mM CaCl2, 5 mM KCl, 5 mM glucose and 0.1% MES, pH 5.6). Protoplasts were transf ected with the receptor:EGFP constructs by a modified polyethylene glycol method (Abel a nd Theologis, 1994). Typically, 0.2 ml of protoplast suspension (0.5 x 106/ml) was transfected with 50 g of sheared salmon sperm carrier DNA (Clontech) and 20 g of the a ppropriated plasmid DNA. Transfected protoplasts were incubated at 25C for 16 hours. Confocal fluorescent images were obtained on a confocal laser scanning micr oscope (Leica TCS SP2, Leica DM IRBE ; Leica Microsystems, Wetzlar, Germany). Th e samples were illumi nated with an argon ion laser (488 nm wavelength) for GFP. The emitted light was collected at 500-525 nm. Isolation of the NR Promoter Sequence Genomic DNA was isolated from tomato leaves ( L. esculentum cv. Floridade and cv. Pearson ) using the DNeasy Plant Mini Kit (Q iagen), according to manufature’s guidelines. Genomic DNA from Floridade and Pearson culti vars were used to make GenomeWalker libraries according to the Universal GenomeWalker kit user manual (Clonetech). In brief, genomic DNA was digested overnight w ith five blunt-cutting restriction endonucleases ( Dra I, EcoR V, Pvu II, Sca I and Stu I), purified by

PAGE 38

27 phenol/chloroform extraction and ethanol pr ecipitation, and ligated to GenomeWalker adaptors. GenomeWalker libraries were screened by PCR, according to manufacturer’s guidelines, using NR sequence-specific primers (Table 2-3) and adapter primers provided with the kit. The sequence-specific primers used for isolation of the NR promoter were: NR-1, NR-2 (nested), NR-3, NR-4 (neste d), NR-5, and NR-6 (nested). The PCR conditions were as follows: 7 cycles of 94 C for 20s and 70C for 3 min, 37 cycles of 94C for 20s and 65C for 3 min, followed by 7 min at 65C. Diluted PCR products were subjected to a nested PCR with NR sequence-specific primers and nested adapter primers provided with the kit. The nested P CR conditions were as fo llows: 5 cycles of 94C for 20s and 70C for 3 min, 20 cycles of 94C for 20s and 70C for 3 min, followed by 7 min at 67C. PCR products from nested PCR were cloned into the Srf I site of pPCR-Script Amp SK(+) plasmid (Stratagen e) and sent for automated sequencing. Obtained sequence was used to design new se quence-specific primers, which were then used to screen the existing GenomeWalker lib raries. This procedure was repeated three times in order to isolate 2.1 kb of promoter sequence for NR Table 2-3. Primers used to isolate and clone the NR promoter* Primer Name Primer Sequence NR-1 TGCTATTTCCTGCTGCGACACATACCTGTC NR-2 (nested) GACGACGGAGAATGCGATCTCAGTATCTAC NR-3 CATGATCACCGAGAATATTAGTAGCTCAG NR-4 (nested) AATTCCGAACATGTAGCGTTTTCATCC NR-5 CGGAATTTTAGTTGAAACTTACAGGGTTACC NR-6 (nested) GAACACAAACCTATGGACTCAGCAAAAGC NR-promt-5’-2 CTAAAAGGGGGATTAGTTCTTATTTTTAAT NR-promt-3’short CCATGG GATTTTCGTCGTGTTCTTCG *Underlined sequence is the engineered Nco I site.

PAGE 39

28 Cloning of the NR Promoter Sequence for Expression Studies The NR promoter sequence was amplified from Pearson genomic DNA with the primers NR-promt-5’-2 and NR-promt-3’short (Table 2-3), using the following cycle conditions: 35 cycles of 95C for 45s, 60C for 45s, and 72C for 4 min. NR promoter PCR product was cloned into the Srf I site of pPCR-Script Amp SK(+) plasmid (Stratagene) to produce plasmid pPM7. The NR promoter was cut from pPM7 with Not I and Nco I, and subcloned into pMON637 (Monsanto Co.), which contained the coding sequence for GUS, to produce plasmid pPM8. The NR promoter-GUS fusion segment was cut from pPM8 with Not I and cloned into a Not I site in the pHK1001 expression vector, which contained the NPTII gene for spectinomycin resistan ce, to produce plasmid pPM9. Plasmids were purified using either Plasmid Midi Prep kit (Stratagene) or Plasmid Maxi Prep kit (Qiagen). Tomato Transformation This procedure was performed by Dr. Mark G. Taylor in Dr. Harry J. Klee’s laboratory at the University of Florida. Transgenic NR-GUS tomato plants ( Lycopersicon esculentum cv. Micro-Tom ) were produced by Agrobacterium -mediated transformation (Mccormick et al., 1986) of pP M9, using spectinomycin resistance as a selectable marker. Introduc tion and inheritance of the tr ansgene were confirmed by PCR using primers specific for the selectable marker. GUS Activity Assay Histochemical staining for GUS activity wa s performed by treating dissected tissue in assay solution (0.1 M NaPO4 buffer (pH 7.0), 0.5 mM K3[Fe(CN)6], 0.5 mM K4[Fe(CN)6], 10 mM Na2EDTA, 0.1% (w/v) 5-bomo-4-chloro-3-indolyl-D-gluguronic acid (X-GLUC)(BioVectra), 0.1 % (v/v) TritonX-100) for 24h at 37C. Tissue was rinsed

PAGE 40

29 twice in 80% (v/v) ethanol and incubated at 4C in ethanol to remove chlorophyll pigment. Stained tissue was visualized th rough a Wild dissecting stereomicroscope. Images were captured with a Leica DC300 color CCD camera and imported into Adobe Photoshop using a Leica twain driver. Experimental Procedures for Arabidop sis Expression Studies (Chapter 4) Ethylene receptor messenger RNA (mRNA) levels were quantified by real-time quantitative reverse transcriptase polymerase chain reaction (RT-PCR), using total RNA isolated from different wild -type and muta nt lines of Arabidopsis thaliana Exogenous ethylene treatments were performed for 1h in sealed glass chambers containing 10 ppm C2H4. RNA Isolation Total RNA was extracted from 1 g of rosette tissue in extraction buffer (1% (w/v) triisopropylnaphthalene-sulf onic acid (TIPS), 6% (w/v) -amino salicylic acid, 100 mM Tris (pH 8.0), 50 mM EGTA, 0.1 M NaCl, 1% (w/v) SDS, 0.039% (v/v) mercaptoethanol) containing 50% (v/v) phe nol:chloroform:isoamyl alcohol (PCI) solution (25:24:1 (v/v/v)). The extraction mi xture was homogenized with a polytron and incubated 20 min at 50C. The phases we re separated by centrif ugation and an equal volume of PCI was added to the aqueous pha se. The RNA was ethanol precipitated overnight and purified by two consecutive LiCl (2 M) precipitations. Purified RNA was ethanol precipitated and pellets were re suspended in water treated with diethyl pyrocarbonate (DEPC). RNAs were then treated with DNaseI (Ambion), followed by removal of impurities with RNeasy RNA extraction kit (Qiagen) according to the manufacturer's instructions.

PAGE 41

30 Real Time RT-PCR (TaqMan) Ethylene receptor mRNA levels were qua ntified by Real-time quantitative RT-PCR using Taqman one-step RT-PCR reagents (Applied Biosystems) and an Applied Biosystems GeneAmp 5700 sequence-detection system. Each determination was performed using 250 ng of DNase I-treated total RNA, in a 25-l reaction volume. RTPCR conditions were: 48C for 30 min, 95C for 10 min followed by 40 cycles of 95C for 15s and 60C for 1 min. Absolute mRNA levels were quantified using custom-made standard curves. The sense strand transcripts used to generate the standard curves were synthesized using an in vitro transcription kit (Ambion), via the incorporation of [3H] UTP using T7 or T3 RNA polymerase. Lengths of transcribed sense probes were 1267 nt (ETR1), 1887 nt (ERS1), 1908 nt (ETR2), 1460 nt (ERS2) and 2416 nt (EIN4). Primers and probes were designed usi ng Primer Express software (Applied Biosystems) and were as follows: ETR1 fwd primer, ETR1 rev primer, ETR1 Taqman probe, ETR2 fwd primer, ETR2 rev primer, ETR2 Taqman probe, EIN4 fwd primer, EIN4 rev primer, EIN4 Taqman probe, ER S1 fwd primer, ERS1 rev primer, ERS1 Taqman probe, ERS2 fwd primer, ERS2 rev primer, and ERS2 Taqman probe. Primers and probes are described in Table 2-4. Arabidopsis Infections with Xanthomonas campestris This procedure was performed by Dr. Phill ip J. O’Donnell in Dr. Harry J. Klee’s laboratory at the University of Florida. As described previously (O'Donnell et al., 2003), Arabidopsis thaliana Columbia (Col-0), etr1-1 (Bleecker et al., 1988) and etr2-1 (Sakai et al., 1998) and the NahG line (Novartis) we re grown in soil under long night conditions (8h day; 16h night) for 6 weeks to encourage vegetative growth. Forty-eight hours prior to treatment, plants were transferred to a 16h day, 8h night regime, and 12h before

PAGE 42

31 infection were enclosed in a humidity dome to aid bacterial entry. Plants were inoculated with Xanthomonas campestris pv. campestris ( Xcc ) strain 33913 by first submerging the whole plant in a suspension of 5 x 106 CFU bacteria, containing 10 mM MgCl2 and 0.02% (v/v) Silwet L-77, for 30s. A vacuum wa s then applied to the soaked plants for 1 min to aid bacterial entry and the plants were returned to the humidity chamber overnight. Table 2-4. Primers and probes us ed for real-time RT-PCR assays* Primer Name Primer Sequence ETR1 fwd primer TGAGTTGATTTACTTTGTGAAGAAATCA ETR1 rev primer GTTGCTCCACAAAGAACGATAAAA ETR1 Taqman probe 6FAM-CTGAACAAGTACCCATCTATACGGAAACACGG-TAMRA ETR2 fwd primer TTAGCTATAACGGCGGTGGTT ETR2 rev primer GAATGTTCTCTGTACTCCAGAAACTGTT ETR2 Taqman probe 6FAM-CCTTCGTCTTCGCAGTTACATCGTGGA-TAMRA EIN4 fwd primer CTTTAGGTCTTGGATTGCTTCTGTT EIN4 rev primer GAAACCTTCGTCGTCACAATTACA EIN4 Taqman probe 6FAMTCACGTAATCGTTATCACCAGAAACCAGAGCA-TAMRA ERS1 fwd primer CAACCTTTATGGATGTTCTTCATGCA ERS1 rev primer CACAACCGCGCAAGAGACT ERS1 Taqman probe 6FAM-CCAAAGCCGTTGCCATTGTCATGA-TAMRA ERS2 fwd primer GCAGAAGACGACGGTAGCTTGT ERS2 rev primer CGATAAGAAAGTCGCCGACTTT ERS2 Taqman probe 6FAM-TCTTTAGCTACGAGACAATCCTCAACTCGCA-TAMRA *6FAM, 6-carboxyfluorescein; TAMRA, 6-carboxytetramethylrhodamine. Experimental Procedures for Enzyme Assays (Chapter 5) In order to produce recombin ant proteins suitable for in vitro enzyme assays, only the soluble domains of the Arabidopsis ethyle ne receptors were used. The constructs included the GAF domain, the kinase domain and the receiver domain, when the latter was present in the native protein, but lack ed the amino-terminal membrane-spanning domain. The soluble domains of all five Ar abidopsis ethylene receptors were expressed in the yeast S. pombe each with a GST tag attached to its amino-terminus. The purified recombinant proteins were then a ssayed for autophosphor ylation activity in vitro

PAGE 43

32 Construction of Yeast Expression Plasmids The soluble domains of the Arabidopsis et hylene receptors were amplified from cDNA clones with the following primers (engin eered restriction sites are underlined): ETR1-ESP-fwd and ETR1-ESP-rev; ETR 2-ESP-fwd and ETR2-ESP-rev; ETR2GAFfwd and ETR2GAF-rev; ESR1-ESP-fwd and ESR1-ESP-rev; ERS2-ESP-fwd and ERS2-ESP-rev; and EIN4-ESP-fwd and EIN4-E SP-rev. Primers are described in Table 2-5. ETR1, ERS1 and EIN4 PCR products were cut with BamH I and cloned into pESP1 (Stratagene), ETR2 and ETR2-GAF were cut with Xma I and cloned into pESP-1, and ERS2 was cut with Bgl II and cloned into the BamH I site of pESP-1. Table 2-5. Primers used fo r kinase assay constructs* Primer Name Primer Sequence ETR1-ESP-fwd AGCTCGGATCC GAAATGGGATTGATTCGAACTCA ETR1-ESP-rev ATCCAGGATCC TTACATGCCCTCGTACAGTACC ETR2-ESP-fwd GAGCTTCCCGGG GAAGTTGGTTTGATTTTGATTAA ETR2-ESP-rev AGCCATCCCGGG TTAGAGAAGTTGGTCAGCTTGCAAC ETR2GAF-fwd ATGGCGCCCGGG GACGCGTTGAGAGCGAGCCAAGC ETR2GAF-rev AGCCATCCCGGG TTAGAGAAGTTGGTCAGCTTGCAAC ESR1-ESP-fwd AGTTAGGATCC GAAATGGGTCTTATTTTAACACA ESR1-ESP-rev TCCATGGATCC TCACCAGTTCCACGGTCTGGTTTGT ERS2-ESP-fwd AGAGCTTAGATCT GAGGTTGGGATCATTATGAAGCA ERS2-ESP-rev CATGGATAGATCT TCAGTGGCTAGTAGACGGAGGAGTT EIN4-ESP-fwd AGCTTGGATCC GAGGTTGGATTGATGAAGAGGCA EIN4-ESP-rev AGGATGGATCC TCACTCGCTCGCGGTCTGCAAAGC ETR1-H-fwd GAACACCGATGGC TGCGATTATTGCACT ETR1-H-rev GCATTTCAGC GTTCATAACCGCTAG ETR2-H-fwd CCTATGGC TTCGATACTCGGTCTTT ETR2-H-rev ACGCCTCATCCCTTCGCTCATCGTT ERS1-H-fwd GGACACCGATGGC TGCCATCATCTCTCT ERS1-H-rev TCATCTCGGC GTTCATAACAGCTAG EIN4-H-fwd GGAGACCAATGGC CACAATTCTTGGTCT EIN4-H-rev TCATTCCAGC ACTCATCACTTTCTG ETR1-G1-fwd C AGCAGC AATAAATCCTCAAGAC ETR1-G1-rev CAGAGTCTTTTACCTTCACTATA ERS1-G1-fwd C GTGTGC AATTCACACACAAGAC ERS1-G1-rev CTGTGTCCTTCACCTGCACAC *Underlined nucleotides ar e explained in the text. For the H A and G A mutations, we used the ExSite Site Directed Mutagenesis kit (Stratagene) on a BamH IBamH I fragment containing receptor coding sequence, cut

PAGE 44

33 from the previously described plasmids, cl oned into pBSKS(+). The plasmids were methylated prior to mutagenesis. The primer s used for the mutagenesis were (nucleotide substitutions are underlined ): ETR1-H-fwd and ETR1-H-re v; ETR2-H-fwd and ETR2-Hrev; ERS1-H-fwd and ERS1-H-rev; EIN4-H -fwd and EIN4-H-rev; ETR1-G1-fwd and ETR1-G1-rev; and ERS1-G1-fwd and ERS1-G1-re v. Primers are described in Table 2-5. The reverse primers (rev) were phosphorylat ed and the cycle parameters for the mutagenesis followed the manufacturer’s gui delines. Mutagenesis was confirmed by sequencing and the mutated BamH IBamH I fragment was returned to the expression vector. Recombinant Protein Expression in Yeast The recombinant constructs were transformed into S. pombe SP-Q01 (Stratagene), according to the ESP Yeast Protein Expre ssion and Purification System protocol (Stratagene). Colonies that grew on agar plates of Edinburgh minimal media (EMM) supplemented with thiamine were selected fo r screening. Colonies were grown in EMM for 8h and lysed with the Yeast-Buster kit (Novagen), according to manufacturer’s protocol. Protein blots of total lysate w ith a goat anti-GST antibody (Amersham) were used to determine expression levels of positive clones. Expressing clones were grown in 50 ml yeast extract suppleme nted (YES) media for 18h (3.0 OD600 4.0) and used to inoculate 50 ml YES media to an OD600 of 0.4. After a 5 hour growth period (OD600 1.0) the cells were washed twice with 50 ml sterile water and resuspended in 500 ml EMM (OD600 0.1). The culture was incubated at 30oC for 18-22h (1.8 OD600 2.2). Proteins were extract ed by vortexing at 4oC with 1X PBST (140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4, 1% (v/v) Triton X-100) with glass beads (425-600 microns, Sigma) and protease inhibitors: 1 mM PMSF (Sigma), 1 g/ml aprotinin

PAGE 45

34 (Sigma), 1 g/ml chymostatin (Sigma), 10 l/ml protease inhibitor cocktail for fungal and yeast extracts (Sigma). Recombinant protei ns were purified from clarified lysate on a Glutathione Sepharose 4B (Amersham) colu mn, which was washed with 1X PBS (140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4). GST-tagged proteins were eluted with Elution Solution (10 mM re duced glutathione (Sigma), 50 mM Tris-HCl (pH 8.0), 20% (v/v) glycerol). For proteins purified without the GST tag, instead of Elution Solution, columns were eluted with Th rombin (Amersham) in 1X PBS. Eluted proteins were concentrated with Centripl us YM-50 (Amicon) and the buffer exchanged for Storage Solution (50 mM Tris-HCl (pH 8.0) 25% (v/v) glycerol). Purification of recombinant protein was confirmed by protei n blot, using goat anti-GST (Amersham) or mouse anti-Flag (Stratagene) antibodies. Prot eins were aliquoted a nd stored at -80oC. In vitro Autophosphorylation Assays Purified recombinant protei n (50 pmol) was assayed in 50 mM Tris pH 7.5, 10 mM MgCl2 (or MnCl2), 2 mM DTT, 10% (v/v) glycerol, 0.5 mM [ -32P] ATP (1 Ci/mmol 1500 cpm/pmol). The react ion buffer with both Mg2+ and Mn2+ contained 0.15 mM MnCl2 and 10 mM MgCl2. Mg2+ and Mn2+ concentrations in so lution were calculated by a BASIC version of the COMICS program by (P errin and Sayce, 1967) using the stability constants described in (O'Sullivan and Sm ithers, 1979). The reaction buffer for the autophosphorylation of CDPK contained 0.12 mM CaCl2 and 10 mM MgCl2. Reactions were incubated for 60 min at 25oC and stopped by adding 5X loading dye (250 mM TrisHCl (pH 6.8), 500 mM DTT, 10% (w/v) SDS, 0.5% (w/v) Bromophenol Blue, 50% (v/v) glycerol) and boiling 3 min. Reactions were run on 8% SDS-PAGE and blotted to PVDF membrane (Hybond-P, Amersham) using a 3-solution semi-dry protein blotting protocol for 30 min at 16 V, optimized to a lower pH to avoid loss of phosphoester linkages.

PAGE 46

35 Blotting setup in brief, from anode to cat hode: one sheet of Wattman paper wet with Anode 1 solution (300 mM Tris pH 9.5, 10% (v /v) methanol), 2 sheets of Wattman paper wet in Anode 2 solution (25 mM Tris pH 9.5, 10% (v/v) methanol), PVDF membrane, gel, 3 Wattman sheets wet in Cathode solution (25 mM Tris pH 8.5, 20% (v/v) methanol, 0.3% (w/v) glycine). Phosphate incorpor ation was visualized by autoradiography. Acid/Base Stability Assay Autophosphorylation reactions were performed as above, in triplicate for each treatment. After blotting, PVDF membranes were incubated for 16h at room temperature in 1 M HCl, 3 M NaOH, or 100 mM Tris-HCl (pH 7.0). Proteins bands were cut from membrane and counted in scintillation fluid. The average for the counts of the acid and base treatments was normalized with respect to the counts for the neutral treatment (TrisHCl). Phosphoamino Acid Analysis Autophosphorylation reactions were performed in 50 mM Tris pH 7.5, 10 mM MgCl2 (or MnCl2), 2 mM D TT, 10% (v/v) glycerol, 0.2 M [ -32P] ATP (5000 Ci/mmol). After blotting, pr otein bands were cut from PV DF membranes and hydrolyzed in 100 l 6 N HCl (Pierce) for 1h at 110oC. Membrane was removed and hydrolyzed amino acids were lyophilized and resuspended in pH 1.9 buffer (2.2% (v/v) formic acid, 7.8% (v/v) acetic acid) containing 100 g/ml each phosphoamino acid standard (Ser-P, Thr-P, Tyr-P (Sigma)). Bi-dimensional thin layer electrophoresis was performed as described in (Liu et al., 2002) and pl ates were visualized by autoradiography.

PAGE 47

36 CHAPTER 3 STUDIES ON ETHYLENE RECEPTORS IN TOMATO A family of six ethylene receptors ha ve been identified from tomato: LeETR1, LeETR2 (Lashbrook et al., 1998), NEVERRIPE (NR) (Wilkinson et al., 1995), LeETR4, LeETR5 (Tieman and Klee, 1999), and LeETR6 (Tieman and Klee, unpublished). As shown in Figure 3-1, most of these receptors show the four domains defined for the Arabidopsis ETR1 protein, in cluding a membrane spanning domain, a GAF domain, a kinase domain, and a receiver domain. Figure 3-1. The tomato ethylene receptor fa mily. The five conserved motifs necessary for histidine kinase activity (H-, N-, G1-, F-, and G2-box) are noted. LeETR1 N R LeETR5 LeETR6 LeETR4 HD GAF TMD N G1 F G2 KD RD H N G1 F G2 HD D LeETR2 H D N G1 F G2 D N N H N

PAGE 48

37 The most conserved domain is the tr ans-membrane (sensor) domain, which includes the regions required for dimeri zation and ethylene bi nding. The dominant insensitive Nr mutant has a point mutation in th e sensor domain identical to the etr2-1 mutation (Wilkinson et al., 1995; Sakai et al., 1998). The receiver domain is absent from NR, and LeETR5 does not contain the conserved histidine. Comparative Studies on Gene Structure between Tomato and Arabidopsis Similar to the Arabidopsis ethylene recepto rs, the tomato receptors can be divided into two subfamilies with respect to their sequence similarity. LeETR1, LeETR2 and NR are subfamily 1 receptors and have all the c onserved motifs necessary for histidine kinase activity. The subfamily 2 class includes LeETR4, LeETR5 and LeETR6, which do not contain most of these motifs. The tomato subfamily 2 members also feature the putative fourth trans-membrane region at the amino-te rminus (Figure 3-1). Figure 3-2 shows the phylogenetic relationship between the tomato and Arabidopsis ethylene receptors. Figure 3-2. Sequence similarity tree of the Arabidopsis and tomato ethylene receptors. Neighbor-joining tree was generated from full-length protein sequences using Clustal W ( http://clustalw.genome.ad.jp/ ). Subfamil y 1 Subfamil y 2 LeETR1 LeETR2 A t ETR1 LeNR A t ERS1 LeETR4 LeETR6 A t ETR2 LeETR5 A t EIN4 A t ERS2

PAGE 49

38 Subfamily 2 divergences seem to have occurred after speciation, as no tomato orthologues to AtETR2 and AtERS2 or Arabidopsis orthologues LeETR4 and LeETR6 have been identified (F igure 3-2). The Arabidopsis subf amily segregation correlates not only with the conservation of ki nase motifs, but also with the intron distribution of the genes in each family. As shown in Figure 3-3, ETR1 has five introns in its coding sequence, one of which is in the receiver domain (Chang et al., 1993). ERS1 has four introns in its sequence. When compared to ETR1 ERS1 has introns at equivalent positions but lacks the receiver domain and its intron (Hua et al., 1995). ETR2 ERS2 and EIN4 have a single intron each at the sa me position in their sequence (Hua and Meyerowitz, 1998; Hua et al., 1998; Sakai et al., 1998). The Arabidopsis introns vary between 50 and 150 nucleotides (nt). Figure 3-3. Gene structure for th e Arabidopsis ethylene receptors AtETR1 AtERS1 AtETR2 AtEIN4 and AtERS2 Exons are shown as boxes and introns are shown as lines. In order to determine the gene structur e of the tomato receptors, the genomic sequence between the tran slational start and stop sites of the tomato ethylene receptors LeETR2 Nr LeETR4 LeETR5 and LeETR6 were isolated from Lycopersicon esculentum as described in Chapter 2. The comple te sequences of th ese genes are shown in Appendix A, and a graphic representation of their structure is shown in Figure 3-4. The tomato introns varied in size betw een 104 and 2863 nt, but were at conserved A tETR1 A tERS1 A tETR2 A tEIN4 A tERS2 A tETR1 A tERS1 A tETR2 A tEIN4 A tERS2

PAGE 50

39 positions when compared to members of their respective subfamilies. The LeETR1 genomic sequence could not be cloned by the methods described in Chapter 2 because it had a 5000 nt intron approximately 80 nt after the ATG start codon and the PCR fragment was predicted to be ove r 10 kb (data not shown). The LeETR1 start codon is 50 nt upstream when compared to the other subf amily 1 receptors and it is likely that the intron located in the 5’ untranslated region (U TR) in the other subfamily 1 receptors is in the coding region of LeETR1 All Arabidopsis receptors have an intron in their 5’ UTR (not shown) and the NR has two introns in its leader sequence, of 65 and 2400 nt (Figure 3-6). Figure 3-4. Gene structure for the tomato ethylene receptors LeETR2 Nr LeETR4 LeETR5 and LeETR6 Exons are shown as boxes and introns are shown as lines. Cellular Localization of EGFP fusions The Arabidopsis ETR1 protein has been shown to localize to the endoplasmic reticulum (ER) by sucrose density-grad ient centrifugation and immunoelectron microscopy (Chen et al., 2002). ETR1 has al so been shown to be required for the recruiting of CTR1 to the ER membrane (Gao et al., 2003). In terms of ethylene signaling, this localization should not aff ect the recognition of the receptor by the hormone as ethylene is highly liposoluble. Ho wever, the subfamily 2 receptors have an LeETR2(5634 bp) LeETR5(5163 bp) LeETR6(2373 bp) LeETR4(2839 bp) NR(4265 bp) LeETR2(5634 bp) LeETR2(5634 bp)LeETR2(5634 bp) LeETR5(5163 bp) LeETR5(5163 bp)LeETR5(5163 bp) LeETR6(2373 bp) LeETR6(2373 bp)LeETR6(2373 bp) LeETR4(2839 bp) LeETR4(2839 bp)LeETR4(2839 bp) NR(4265 bp) NR(4265 bp)NR(4265 bp)

PAGE 51

40 additional trans-membrane region at the am ino-terminus, which could be a targeting sequence (Figure 3-1). TargetP ( http://www.cbs.dtu.dk/se rvices/TargetP-1.0/ ) was used to predict the subcellular local ization of the tomato receptors (Emanuelsson et al., 2000). As shown in Table 3-1, TargetP predicted th at the subfamily two receptors should be secreted, which suggests th at this group localizes to the plasma membrane. Table 3-1. Signal sequence prediction by TargetP. Name Location Reliability Class length of the presequence LeETR1 2 LeETR2 4 NR 3 LeETR4 Secreted 1 21 LeETR5 Secreted 1 23 LeETR6 Secreted 2 23 *Reliability Class measures the size of th e difference between the highest and the second highest output scores. There are five reli ability classes; (1) represents the highest difference and (5) the lowest. In order to address where the tomato r eceptors localize in the cell, the genomic sequences described above were cloned into an expression vector for localization studies. These constructs permitted the transient expr ession of the tomato receptors in tobacco protoplasts with the EGFP attached to their carboxyl-termini. The cDNAs were not used for expression because of their toxicity to b acteria, even when expressed at low levels. These constructs were sent to Dr. Mondhe r Bouzayen’s laboratory at UMR 990, INRAENSATGenomique et biotec hnologie des fruits, France, and the localization assays were done by Isabelle Milla. Our preliminar y results suggest that the tomato receptors are also expressed in the ER. Figure 3-5 s hows fluorescence images for a cell transfected with EGFP and a cell transfected with NR fused to EGFP. A Differential Interference Contrast (DIC) image was also acquired for each cell. Most of the protoplasts transfected with receptor fusions show fluorescence around the nucleus, which is consistant with ER

PAGE 52

41 localization (Figure 3-5 and da ta not shown). As the labe ling appears as dots (more or less expanded) around the nucleus, it seems unlik ely that the receptors localize to the nuclear envelope. However, a marker that is specifically targeted to the ER is still needed to confirm these results. Figure 3-5. Cellular localization of the toma to receptors fused to EGFP. Transfected tobacco protoplasts were observed on a confocal laser scanning microscope. The samples were illuminated at 488 nm and the emission light collected between 500 and 525 nm. A Differentia l Interference Contrast (DIC) image was also acquired for each cell. The Promoter Region of the NR Gene The NR promoter was isolated from L. esculentum using the Genome Walker kit (BD Biosciences), as described in Chapter 2. Two kilobasepairs upstream of the putative transcription initiation site were isolated a nd sequenced. The transc ription initiation site was determined by examining the longest cDNAs available for NR The region between the site of transcriptional initiation and the st art of the coding sequence was also isolated and sequenced in order to obtain the introns in this region. It has been previously 10 m 10 m 10 m 10 m 10 m 10 mNR GFP Flourescence DIC

PAGE 53

42 reported that the Arabidopsis receptors have a single intron in their 5’ UTR (Chang et al., 1993; Hua et al., 1995; Hua and Meyerowitz, 19 98; Sakai et al., 1998). The two introns identified in the NR leader sequence were 65 an d 2400 nt long. A graphical representation of the NR locus is shown in Figure 3-6. It is also interesting to note that the 5’ UTR of NR has several putative translational start sites, which create short open reading frames. These alternate initiation site s might be used to decrease translation of the protein and regulate receptor levels. Figure 3-6. NR genomic locus. The 4768 nt upstream of the start site of NR ’s coding region are shown in Appendix B. The initiation site of transcription for NR has been predicted from cDNA clones to be around nucleotide 2015 of this sequence. PLACE Signal Scan Program ( http://www.dna.affrc.go.jp/htdo cs/PLACE/signalscan.html ) was used to identify cis acting elements in the promoter and lead er sequences (Prestri dge, 1991; Higo et al., 1999). Some of the cis -acting elements identified by the program are shown in Table 3-2 (identified by site number) and their loca tion on the promoter sequence is shown in Appendix B. Promoter Exons Introns Coding region 5’untranslated region Promoter Exons Introns Coding region 5’untranslated region

PAGE 54

43 Table 3-2. List of cis -acting elements identified by PLACE Signal Scan Program. Site number Putative Regulation Factor s000024 auxin, SA, light s000030 heat shock s000124 light s000142 pathogen response s000148 seed s000153 cold stress, ABA s000167 dehydration, ABA s000174 dehydration, ABA s000175 dehydration, ABA s000176 dehydration, ABA s000177 dehydration, ABA s000180 dehydration, ABA s000181 dehydration, ABA s000185 sucrose s000198 SA, light s000199 light s000245 pollen s000250 low temperature s000252 circadian s000256 sugar repression s000259 sugar repression s000263 ABA s000264 seed s000270 auxin s000273 auxin, meristem, shoot, root, vascular tissue s000292 ABA s000298 GA s000310 early defense responses s000314 RAV1 binding site (VP1) s000370 auxin s000390 SA, disease resistance s000392 light s000401 ABA s000403 sugar repression s000407 cold stress, ABA s000408 dehydration, ABA s000409 dehydration, ABA s000413 dehydration, ABA s000414 etiolation s000415 etiolation s000421 seed s000422 fruit s000439 GA *SA, salicylic acid; ABA, abscisic acid; GA, gibberellin.

PAGE 55

44 The elements identified by PLACE Signal Scan seem consistent with published data for NR expression patterns and ethylene regula tion. It has been previously shown that bacterial pathogen infection l eads to increased expression of NR in tomato (Ciardi et al., 2000). Moreover, cross-talk between ethylene signaling and other phytohormones such as auxin and abscisic acid have been established at the p hysiological level but molecular data are still lacking (reviewed in (Davies, 1995; Ross and O'Neill, 2001). Two programs were used to pr edict the TATA box of the NR promoter site (see Appendix B). PROSCAN version 1.7 ( http://bimas.cit.nih.gov/molbio/proscan/ ) predicted a promoter region on the forwar d strand from nucleotide 456 to 706 and a TATA box was found at 670 (Prestridge, 1995). TSSP, a promoter prediction software for plant sequences (RegSite Plant DB, Softberry Inc., http://www.softberry.com ), predicted three promoters in the given se quence with TATA boxes at nucleotides 303, 1341 and 1769. The site of transcription initia tion for these promoters was predicted at nucleotide 326, 1375, and 1783, respec tively. All these promoter predictions are too far from the start of transcripti on to be valid, which could be due to the limitations of the available programs. However, as the putat ive site of transcription initiation was determined by cDNA clones, it is possible that the leader sequence is actually longer than previously thought. It is po ssible that secondary structur es in the messenger RNA have prevented longer cDNAs from being cloned. De termining the true site of transcription will facilitate the identification of the true pr omoter, and mutagenesis studies can be used to verify these predictions. NR Promoter Expression Patterns by GUS fusions The expression pattern of the NR gene has been studied using RNase protection assays (Lashbrook et al., 1998) This study showed that NR is regulated during tomato

PAGE 56

45 fruit development: it is expressed at low levels in green fruit, its expression increases at the onset of ripening and declines after ripening has initiated. NR has also been shown to be expressed at low levels in seedlings, l eaves, petals, ovaries, anthers, sepals, and abscission zones, while it shows a higher leve l in styles and petio les (Lashbrook et al., 1998). As shown in Figure 3-2, ERS1 seems to be the Arabidopsis orthologue of NR The expression of ERS1 is also ubiquitous, but higher in young, small cells and reduced when cells are more expanded. ERS1 is expressed in embryos, etiolated seedlings, leaves and stems; high expression is noticed in flor al primordia and very strong expression is seen in anthers (Hua et al., 1995). In this study we looked at Nr expression within tissues by attaching the GUS reporter gene to the Nr promoter. The promoter region described above was cloned into an Agrobacterium transformation vector and transformed into L esculentum cv. MicroTom as described in Chapter 2. Six independe nt transgenic lines were analyzed for GUS expression patterns by staining for GUS activity, as shown in Figure 3-7. GUS expression in these transgenic lines was seen in the anthers, style and stigma of the flower (A), vascular bundles of the stem (E) and ma ture seeds (I, J). GUS activity was low in immature fruit (F) and occurred predominantly in the calyx and co lumella. Expression increased during fruit maturation (G), was at it s highest in ripening fr uit (I) and decreased after the fruit was ripe (J). Ma ture seeds showed high levels of GUS expression, while immature seeds showed very little (K). GUS activity was also seen in flower buds, but this organ was also stained in wild-type plants No expression was seen in leaves unless they were stained for three days (data not shown), with the exception of line 42, which showed expression in the leaf veins (D). Th is unique pattern of line 42 could be due to a

PAGE 57

46 position effect, where the expres sion pattern is influenced by the factors surrounding the insertion site. However, GUS expression in the vascular bundles of the stem (E) was observed in multiple lines. The expression pattern observed in the NR:GUS transgenic lines correlate with the previous studies men tioned above (Hua et al., 1995; Lashbrook et al., 1998). These data suggest that GUS activity assays might be a useful technique to look at NR gene regulation and could be used to study NR expression patterns in response to different hormone treatments and biotic and abiotic stresses. Figure 3-7. GUS activity in the NR:GUS transgenic lines. A, NR:GUS flower; B, wildtype (WT) flower; C, NR:GUS young leaf; D, NR:GUS old leaf; E, NR:GUS stem (left) and WT stem (right); F, NR:GUS immature fruit; G, NR:GUS mature green fruit; H, WT mature green fruit; I, NR:GUS ripening fruit; J, NR:GUS ripe fruit; K, NR:GUS mature and immature seeds. A B C D E F G H I J K

PAGE 58

47 CHAPTER 4 STUDIES ON RECEPTOR EXPRESSION LEVELS IN ARABIDOPSIS One of the ways a plant can regulate hormone sensitivity is through the regulation of its receptors (reviewed in Weyers and Pate rson, 2001; Gaspar et al ., 2003). Plants can regulate the distribution pattern of ethylene receptors throughout the plant, as discussed in Chapter 3, and they can also regulate th e amount of receptors expressed at a given time. Moreover, it has been suggested that the induction of receptors by ethylene is an alternative mechanism to limit the hormone response (Hall et al., 2000). Ethylene dissociation from the receptor does not appear to be a key regulator of response timing, as the half-life of ethylene bindi ng is 12.5h (Schaller and Bleecker, 1995). Even though this measurement was taken from recombinant proteins expressed in yeast, it seems reasonable to predict that protein tur nover removes ethylene-bound receptors, and de novo synthesis is used to replenish the receptor pool. NR messenger RNA (mRNA) levels are regul ated during tomato fruit development; its mRNA is at low levels in green fruit and it increases at th e onset of ripening (Lashbrook et al., 1998). After ripe ning has initiated the levels of NR mRNA reduce somewhat, which correlates with the reduction of ethylene during ripening. NR mRNA levels are induced by ethylene and the mRNA levels during fruit ripening correlate with the level of ethylene produced by the fruit. LeETR4 mRNA levels are also induced during fruit ripening, as well as during flower developmen t (Tieman and Klee, 1999). Besides developmental regulation, ethylene r eceptor mRNA levels are also affected by

PAGE 59

48 biotic and abiotic stresses. It has been prev iously shown that pathogen infection leads to increased mRNA levels of two ethyl ene receptor genes in tomato, NR and LeETR4 (Ciardi et al., 2000). Furthermore, increases in LeETR4 mRNA levels following infection is important in limiting the spread of necrosis (Ciardi et al., 2001). Abiotic stress such as flooding has also been shown to induce a Rumex NR homologue, RpERS (Vriezen et al., 1997). A dramatic effect of tran scriptional regulation of et hylene receptors has been observed in transgenic tomato plants. Antisense lines for LeETR4 show a severe hypersensitivity to ethylene, while antisense lines for other ethylen e receptors, such as NR do not seem to show this phenotype (Tieman et al., 2000). The LeETR4 antisense lines show increased leaf epinasty and prematur e flower abscission; fr uit set in these lines requires treatment with ethylene inhibitors. Moreover, the lack of phenotype in the NR antisense lines is due to the higher levels of LeETR4 mRNA in these lines, which compensates for the reduction in NR mRNA levels. Compensation for lack of LeETR4 however, does not occur in the LeETR4 antisense lines. Thus, there is a differential regulation of gene expression of the tomato ethylene receptors. However, the ethylene hypersensitivity phenotype can be eliminated in LeETR4 antisense lines by the overexpression of NR Taken together these data support the hypothesis that the receptors perform redundant functions. Furt hermore, they suggest that subfamily 2 receptors, such as LeETR4, are as capable of repressing the ethylene signal transduction pathway as the subfamily 1 receptor NR. Th ese data also suggest that the receiver domain is not necessary for receptor signal transduction, as it is absent from the NR receptor (Tieman et al., 2000).

PAGE 60

49 The large collection of Arab idopsis ethylene signaling mu tants makes this species an excellent model for molecular biology studi es of this signaling pathway. The goal of this study was to look at transcriptional regulation of the ethylene receptors in Arabidopsis by taking advantage of the existi ng mutant collection. All previous studies that looked at ethylene receptor mRNA levels in Arabidopsis were done by RNA blots. Due to the low expression levels of these receptors, RNA blots are not sensitive enough for comparative studies. More reliable in formation has been obtained from tomato expression studies using RNas e protection assays and re al-time RT-PCR (Lashbrook et al., 1998; Tieman and Klee, 1999; Tieman et al., 2001). Hence, real-time RT-PCR was used in this study in order to determine receptor mRNA levels in Arabidopsis, as described in Chapter 2. Receptor mRNA levels were measured in two different Arabidopsis ecotypes and the ability of ethylene to induce mRNA levels was investigated. Receptor mRNA levels were al so determined for the ethylene insensitive mutant etr1-1 and the constitutive ethylene response mutant ctr1-10 The effect of pathogen infection on receptor mRNA levels was also investigated, in order to look at the regulation of receptor gene expression due to biotic stress. Receptor Expression in Arabidopsis Several different ecotypes have been used in Arabidopsis studies in the past. The two ecotypes used in this study, Columbia and Wassilewskija (WS) have the same general morphology when grown under similar growth conditions. In order to determine if the receptor levels were equivalent in these two different ecotypes, receptor mRNA levels were measured in both Columbia and WS. Figure 4-1A shows that the major difference in receptor mRNA levels was seen in ETR2 ETR2 mRNA is four-fold higher in Columbia than in WS. ETR1 mRNA levels are higher in WS, while Columbia has

PAGE 61

50 slightly higher levels of ERS1 The mRNA levels of ERS2 and EIN4 are the same in both ecotypes (Figure 4-1A). Figure 4-1. Receptor mRNA levels in rosette leaves of WS (white bars) and Columbia (black bars) ecotypes were determin ed by real-time RT-PCR using gene specific primers and TaqMan probes to ETR1 ETR2 ERS1 ERS2 and EIN4 A, mRNA levels for individual receptors; B, total mRNA levels. Values expressed as percenta ge of mRNA SE (n=4). Despite the differences observed in Figure 41A, there is not a significant change in the total mRNA levels of ethylene receptors between the backgrounds (Figure 4-1B). As no phenotypic or behavioral differences ha ve yet been observed between these two ecotypes, these data support the hypothesis of re ceptor redundancy. Moreover, Figure 41A suggests that higher levels of the subf amily 1 receptor ETR1 can compensate for reduced levels of the subfamily 2 receptor ETR2. Taken together, these data seem to support the hypothesis that the two subfamilies have redundant roles; the total level of receptors determining the plant phenotype. It is important to note that these data correspond to steady-state mRNA levels and not protein quantifica tions. Moreover, a single biological sampling, desp ite comprising a pool of plants grown at the same time, 0 0.005 0.01 0.015 0.02 total% mRN A 0 0.001 0.002 0.003 0.004 0.005 0.006 0.007 ETR1ETR2ERS1ERS2EIN4% mRN A A B

PAGE 62

51 was used for these assays. Natural variati on has not been taken into account and these results need to be verified with different pools of plants grown at the same time. Furthermore, it would be interesting to l ook at receptor mRNA levels in additional Arabidopsis ecotypes, in order to determine wh ich receptors are expressed in the different backgrounds and if the total leve l of receptors is conserved. Receptor Expression in Response to Ethylene The induction of receptor expression levels by ethylene may be a mechanism to control the hormone response and delimit its window of action. Several physiological processes lead to the induction of ethy lene, which is normally accompanied by an increase in mRNA levels of some receptors. NR LeETR4 and LeETR5 are ethylene inducible tomato receptors, as determined by exogenous hormone treatments (Ciardi et al., 2000). However, fruit ripe ning only shows an increase of NR and LeETR4 mRNA concomitant with the ethylene burst (Las hbrook et al., 1998; Tieman and Klee, 1999). Moreover, the plant’s resistance response to pa thogens leads to the increases in ethylene production and in NR and LeETR4 mRNA levels (Ciardi et al., 2000). Therefore, even though NR LeETR4 and LeETR5 are all ethylene inducible when the plant is treated with exogenous ethylene, other factors seem to be necessary for regulating receptor expression during physiological processes, as not all th ese receptors are indu ced in all instances. In Arabidopsis, RNA blot studies us ing leaf tissue have suggested that ETR2 ERS1 ERS2 showed a six-fold induc tion after 12 hours of exoge nous ethylene treatment, while ETR1 and EIN4 were not ethylene inducible (Hua et al., 1998). As described in Chapter 2, a one hour exogenous ethylene treatm ent was used in this study, in order to look at early responses to exogenous ethylene. Due to the low mRNA levels of the ethylene receptors and the lack of sensitiv ity of RNA blots, mRNA levels were

PAGE 63

52 determined for ERS1 ETR2 ERS2 and EIN4 by real-time RT-PCR. Unfortunately, ETR1 mRNAlevels are lacking for this e xperiment. As shown in Figure 4-2A, ERS1 and ERS2 are the only receptors th at seem to be ethylene inducible under our assay conditions, and a two-fold induction was obs erved after a one hour treatment with ethylene. Moreover, after one hour there is already a 40% increas e in the total mRNA levels in response to the et hylene treatment (Figure 4-2B), which could potentially be translated into an increase in receptor levels. Figure 4-2. Effect of exoge nous ethylene treatment on the mRNA levels of ethylene receptors in Columbia. A, mRNA levels for ERS1 ETR2 ERS2 and EIN4 after air (white bars) or ethylene (b lack bars) treatment; B, total mRNA levels for air (white bars) or ethyle ne (black bars) treatments. Values expressed as percentage of mRNA SE (n=4). Total mRNA levels do not include ETR1 These results suggest that ERS1 and ERS2 are rapidly induced in response to exogenous ethylene treatments, and could be i nvolved in limiting the ethylene response. However, as mentioned above, only experiment al error has been taken into account in these assays and biological replicates are n eeded to confirm these results. Moreover, it would be interesting to l ook at receptor mRNA levels at various time points during 0 0.005 0.01 0.015 0.02 0.025 total% mRN A 0 0.002 0.004 0.006 0.008 0.01 0.012 0.014 ERS1ETR2ERS2EIN4% mRN A A B

PAGE 64

53 treatments with exogenous ethylene, in order to determine the rate of ERS1 and ERS2 increase and when ETR2 expression is induced. Receptor Expression in Response to Pathogen Attack Pathogen attack induces a complex and highl y coordinated response from the plant. Immediate and long-term defenses are ac tivated by local and systemic signaling mechanisms. There are two types of res ponses to pathogen inf ection, resistance and susceptibility. In a resistant response, th e host actively inhibits pathogen growth and prevents the spread of disease. This res ponse is dependent upon a specific host resistance ( R ) gene and a corresponding pathogen avirulence ( avr ) gene. R gene-mediated resistance is associated with rapid and locali zed cell death at the site of infection, termed the hypersensitive response (HR) (reviewed in (Yang et al., 1997). In the absence of either the plant R or pathogen avr gene, a susceptible response occurs. In this case extens ive disease development occurs and the virulent pathogen grows to a much higher titer. In the in teraction between th e bacterial pathogen Xanthomonas campestris pv. campestris (Xcc) and Arabidopsis th e susceptible response is characterized by cell death at the infection site followe d by spreading chlorosis and secondary necrosis in the surr ounding uninfected tissu e. However, susceptible hosts also possess a defense response that limits, but does not stop, pathogen growth. This phenomenon has been termed basal resistan ce. Although delayed in comparison to a resistant response, the susceptible response also leads to changes in gene expression. In both resistant and susceptible responses the host plant plays an active role in limiting pathogen growth and controlling diseas e symptom development (reviewed in (Glazebrook, 2001).

PAGE 65

54 Despite the complexity of the host res ponse to pathogens, a limited number of signaling intermediates are employed by the host to facilitate defens e. In the case of resistance, three candidate defense hormones have been identified from diverse plant species infected with a vari ety of pathogens: salicylic aci d (SA), ethylene, and jasmonic acid (JA). However, the specific plant-pat hogen interaction determines which of these hormones are important (Yang et al., 1997) In tomato, both SA and ethylene are essential for development of diseas e symptoms in response to either Xanthomonas campestris pv. vesicatoria (Xcv) or Pseudomonas syringae pv. tomato (Pst) (O'Donnell et al., 2001). Removal of e ither of these hormones leads to tolerance, where pathogen growth is observed in the absence of diseas e symptoms. This indi cates that although SA and ethylene are essential for symptoms they are not essential for basal resistance. Hormone analyses of mutant and transgenic lin es indicated that ethy lene-deficient plants do not produce SA following infection. Thus, al terations in ethylene responses directly affect SA levels and it is SA action that is associated with cell death (O'Donnell et al., 2001). In the compatible interaction between tomato and these bacterial pathogens, basal resistance is SA independent whereas SA is essential for basal resistance in the interactions of Arabidopsis and a number of bacterial pathogens. An ethylene response is observed in Arabidops is infected with Xcc. In wild-type plants, there is an increase in ethylene s ynthesis at approximately 48 h after infection (O'Donnell et al., 2003). In the Arabidopsis -Xcc compatible interaction, preventing SA accumulation by expression of the nahG gene reduced subsequent ethylene production and altered the development of disease sy mptoms, with plants showing no visible chlorosis. However, ethylene insensitive lines, etr1-1 and etr2-1 accumulated SA and

PAGE 66

55 exhibited normal but precocious symptom de velopment. Therefore, Arabidopsis, like tomato, was found to exhibit co-operative et hylene and SA action for the production of disease symptoms. However, in Arabidopsis, SA was found to act upstream of ethylene (O'Donnell et al., 2003). It has been previously shown that pa thogen infection leads to increased mRNA levels of two ethylene receptor genes in tomato, NR and LeETR4 (Ciardi et al., 2001). This study also showed that the increased levels of LeETR4 following infection is important in limiting the spread of cell death during the incompatible Xcv interaction. In order to determine whether regulation of receptor genes occurs in response to pathogen attack in Arabidopsis, steady-state mRNA leve ls of each of the et hylene receptors were quantified in infected tissue by quantitative real-time RT-P CR. As shown in Figure 4-3, three of the five ethylene receptors ( ETR1 EIN4 and ERS2 ) exhibited no alteration in mRNA levels following Xcc infection. Infecti on does, however, lead to alteration in the steady-state levels of ETR2 and ERS1 mRNA in Columbia. ERS1 mRNA levels increased several-fold over time, but a greater effect of in fection was seen on ETR2 expression. Maximum levels were observed at 72 hpi concurrent with the peak in ethylene synthesis (O'Donnell et al., 2003). Measurement of receptor mRNA levels in the etr1-1 and etr2-1 mutants showed that ethylene act ion is required for the observed increase of ETR2 and ERS1 mRNA levels. This result is consistent with the observations described above that these two genes ar e ethylene-inducible (Figure 4-2A). The increased ETR2 and ERS1 mRNA levels following in fection may act to reduce ethylene sensitivity of the infected tissue. In tomato, Xcv infection leads to increased mRNA levels of NR and LeETR4 and increased receptor gene expression limits symptom

PAGE 67

56 development by limiting ethylene action (Ciardi et al., 2000). Induction of expression of ETR2 and ERS1 was also absent from the NahG line (Figure 4-3). This effect may be a consequence of reduced ethylene in this line (O'Donnell et al., 2003) Since ethylene receptors are negative regulators of ethylen e responses (Hua and Meyerowitz, 1998), the significant increase in receptor levels duri ng infection would reduce overall ethylene sensitivity of infected tissue. Figure 4-3. Receptor expression during pa thogen response (adapted from O’Donnell et al. 2003) % mRNA % mRNA % mRNA % mRNA % mRNA ETR1 ETR2 EIN4 ERS1 ERS2 Hours Post Inoculation

PAGE 68

57 Receptor Expression in Arabidop sis Ethylene Signaling Mutants Several mutants have been identified in the ethylene signal transduction pathway through triple response screens, including mutants insensitive to ethylene and mutants that signal in the absence of the hormone (Stepanova and Ecker, 2000). Here, mRNA levels were determined for ETR1 ERS1 ETR2 ERS2 and EIN4 in the ethylene insensitive mutant etr1-1 and the constitutive response mutant ctr1-10 The etr1-1 mutation leads to ethylene insensitivity b ecause this receptor can no longer bind the hormone (Hall et al., 1999). As ethylene binding releases the repressed state, the etr1-1 mutant is constantly repressing the ethylene response. The ctr1-10 mutant contains a loss-of-function allele of the CTR1 gene, which encodes a Raf ki nase-like protein (Kieber et al., 1993). CTR1 acts downstream of the ethylene receptors and is also a negative regulator of the ethylene response. Previous work using RNA blot analysis s howed that there are no differences in the transcription levels of ETR1 and etr1 1 (Chang et al., 1993; Zhao et al., 2002). Given the lack of sensitivity of RNA blots, real-time RT-PCR was used in this study, as described in Chapter 2. As shown in Figure 4-4A, etr1-1 mRNA level is 30% less than ETR1 levels in Columbia. However, as the previous expression etr1-1 expression data were measured in seedlings (Zhao et al., 2002), it is not unreasonable to suppose that the mRNA levels of etr1-1 might be decreasing through development, as the plant responds to the lack of an ethylene response. Moreover, the mRNA levels of ERS1 ETR2 and ERS2 are lower in the etr1-1 mutants when compared to wild-typ e Columbia (Figure 4-4B, C, D).

PAGE 69

58 Figure 4-4. mRNA levels in the constitutive mutant ctr1-10 and the insensitive mutant etr1-1 A, ETR1 ; B, ERS1 ; C, ETR2 ; D, ERS2 ; E, EIN4 ; F, total mRNA levels. Values expressed as percenta ge of messenger RNA SE (n=4). 0 0.005 0.01 0.015 0.02 0.025 0.03 Colctr1-10etr1-1% mRN A 0 0.001 0.002 0.003 0.004 0.005 0.006 0.007 Colctr1-10etr1-1% mRN A 0 0.001 0.002 0.003 0.004 0.005 0.006 Colctr1-10etr1-1% mRN A 0 0.001 0.002 0.003 0.004 0.005 Colctr1-10etr1-1% mRN A 0 0.002 0.004 0.006 0.008 0.01 0.012 0.014 0.016 Colctr1-10etr1-1% mRN A 0 0.001 0.002 0.003 0.004 0.005 Colctr1-10etr1-1% mRN A ctr1-10 ctr1-10 ctr1-10 ctr1-10 ctr1-10 ctr1-10 etr1-1 etr1-1 etr1-1 etr1-1 etr1-1 etr1-1 ETR1 ERS1 ETR2 ERS2 EIN4 Total A C D E B F

PAGE 70

59 The reduced level of total mRNA in the etr1-1 mutant (Figure 44F) suggests that this plant is regulating the expr ession of its ethylene recepto rs in order to better respond to ethylene. This hypothesis is supported by the decrease of ETR 1 protein in other insensitive lines, such as etr2-1 ein4-1 ein2 and ein3 (Zhao et al., 2002). Furthermore, regardless of the RNA levels of the etr1-1 mutant, a two-fold increase in protein level has been observed in etiolated seedlings (Zhao et al., 2002). This higher protein level could be due to reduced turn-over of the mutant protein, or other mechanisms of posttranslational regulation. Howeve r, these data suggest that th e reduction in total receptor level (Figure 4-4F) might be th e cause of ethylene insensitivity as th e amount of mutant receptors might be greater than the wild-type ones. This hypothesis of a dosage effect is supported by data that show partia l ethylene sensitivity in triploid etr1-1 lines (Hall et al., 1999). As shown in Figure 4-4 (B and D), the mRNA levels of ERS1 and ERS2 are higher in ctr1-10 than in wild-type Columbia. The changes observed in the receptors’ expression pattern in the ctr1-10 mutant seem to correlate with the pattern observed after ethylene treatment (Figure 4-1). The tota l mRNA levels of receptor expression are increased in the ctr1-10 mutant and as a response to exogenous ethylene treatment, suggesting that the ethylene effect observe d in Figure 4-1 might be due to CTR1 inactivation by ethylene. Mo reover, the mRNA levels of ETR1 and ETR2 were lower in the ctr1-10 mutant, as shown in Figure 4-4 (A and C). However, Zhao et al. (2002) reported a two-fold increase in ETR1 protein levels in the ctr1-2 mutant, which could suggest that a post-transcri ptional regulation mechanism might be regulating ETR1. Taken together, these data suggest that the constitutive activation of the ethylene signal

PAGE 71

60 transduction pathway seem to induce receptor expression in order to try to reduce the ethylene response. As the constitutive activ ation of the pathway is downstream of the receptor, these efforts are not effective and the signaling pathway remains activated. As noted above, biological replicates are needed to confirm these results. Furthermore, it will be interesting to look at loss-of-function mu tants of the ethylene receptors in order to see if their recepto r expression pattern shows similarity to ctr1-10 No loss-of-function mutants for the ethylene rece ptors were identified in any of the large scale screens for ethylene response mutants, supporting the hypothesis that the receptor family members have redundant functions. Receptor loss-of-function mutants were obtained by either screens for intragenic suppressors of et hylene insensitive mutants or screens of T-DNA knockout populations (Hua an d Meyerowitz, 1998; Zhao et al., 2002; Hall and Bleecker, 2003). The single loss-of-function mutants have ethy lene sensitivity kinetics similar to wild-type, but are shorter at any given poi nt of the dose-response curve (Hua and Meyerowitz, 1998). Several cr osses between these loss-of-function mutants have been made in order to create double, triple a nd quadruple loss-of-functi on mutants (Hua and Meyerowitz, 1998). Most double mu tants do not appear to have a more severe phenotype than the single mutants, except the etr1 ; ers1 double loss-of-functi on mutant (Hall and Bleecker, 2003). However, this could be due to the fact that ETR1 and ERS1 are the most highly expressed receptors in the WS background, which was used for the ers1 mutant (Figure 4-1A). The triple loss-of-functi on mutants show several ethylene-inducible phenotypes when grown in air. These phenot ypes are rescued by application of ethylene inhibitors, which suggests that the mutations only affect ethylene perception. These

PAGE 72

61 mutants are slightly larger and healthier than the quadruple mutant, which has a very severe ethylene-sensitive phe notype (Hua and Meyerowitz, 1998). Preliminary studies using these loss-of-function mutant combin ations have not shown any pattern of differential regulation of gene expression (dat a not shown). However, it was clear from the results obtained that biological replicates are essential for interpreting the data from these mutants.

PAGE 73

62 CHAPTER 5 KINASE ACTIVITY OF THE ARAB IDOPSIS ETHYLENE RECEPTORS Two-component and phosphorelay signaling systems exist in both prokaryotes and eukaryotes. In the yeast S. cerevisiae for example, there is on ly one histidine kinase sensor protein, the osmolarity receptor SLN1 (Ota and Varshavsky, 1993). SLN1 signals through a phosphorelay (Maeda et al., 1994; Maeda et al., 1995), which regulates the SSK2-PBS2-HOG1 MAP kinase cascade (Posas and Saito, 1998). In plants, there are several proteins that show sequence similarity to histidine kinases, including the phytochromes (Schneider-Poetsch et al., 1991) as well as hor mone receptors for ethylene (Chang et al., 1993; Hua et al., 1995; Hua et al ., 1998; Sakai et al., 1998) and cytokinins (Inoue et al., 2001). The cytokinin two-com ponent signal transduction pathway has been suggested to function through a phosphorel ay mechanism (Hwang and Sheen, 2001; Inoue et al., 2001). ETR1 is an active histidine kinase, as it autophosphorylat es a conserved histidine in vitro (Gamble et al., 1998). Li ke the yeast SLN1 signaling pathway, ethylene receptor signaling has been suggested to regulat e the CTR1-SIMKK-SIMK/MMK3 MAP kinase cascade (Ouaked et al., 2003). However, due to the sequence divergence shown in Appendix C, it is doubtful that the subfam ily 2 receptors can f unction as histidine kinases. Moreover, genetic data suggest th at histidine autophos phorylation of ETR1 is not necessary for receptor function in ethylene signal transduction (Chang and Meyerowitz, 1995; Gamble et al ., 2002; Wang et al., 2003). Howe ver, there is significant

PAGE 74

63 evidence in the literature suggesting that his tidine kinases can evolve into kinases that phosphorylate on serine residues. This phenomenon has been observed in the mitochondrial proteins branched chain -ketoacid dehydrogenase (BCKD) kinase (Popov et al., 1992; Davie et al., 1995) and pyruvate dehydrogenase kinase (PDK) (Popov et al., 1993; Thelen et al., 2000), plant phytochro mes (Yeh and Lagarias, 1998; Lapko et al., 1999), as well as a tobacco homologue of a subfamily 2 ethylene receptor (Xie et al., 2003). Hence, the goal of this study was to understand the kinase ac tivity of the ethylene receptor family in Arabidopsis in order to provide insights into the mechanism of ethylene signal transduction. Here, we show that all five Arabidop sis ethylene receptors autophosphorylate in vitro However, ETR1 is the only family memb er that autophosphorylates exclusively on histidine residues. All other receptors s how predominantly serine autophosphorylation under our assay conditions, and ERS1 autophosphor ylates on both histidine and serine in the presence of Mn2+. However, dual phosphorylation is not observed when ERS1 is assayed in the presence of Mg2+ and Mn2+, suggesting that ERS1 might not have this activity in vivo Moreover, mutation studies show that the histidine residue conserved in histidine kinases is not required for the serine autophosphorylation of the ethylene receptors. Hence, our results suggest that et hylene signal transduction in plants does not occur by a phosphorelay mechanism. Expression of the Five Arabidop sis Ethylene Receptors in Yeast In order to produce proteins suitable for in vitro enzyme assays, the soluble domains of the Arabidopsis ethylene receptors were cloned into pESP1 as described in Chapter 2. These constructs included th e GAF domain, the kinase domain and the receiver domain, when the la tter was present in the native protein, but lacked the amino-

PAGE 75

64 terminal membrane-spanning domain. The solubl e domains of all five ethylene receptors were expressed in S. pombe each with a GST tag attached to its amino-terminus (Figure 5-1). A 70 kDa protein copurified with most ethylene receptors and could not be removed even after extensive washes. Se quencing of the ETR2 70 kDa contaminating band determined that the co-purifying protei n was the heat shock protein Hsp70 (data not shown). The molecular chaperone Hsp70 is usually removed by addition of Mg2+ and ATP to the column washes (Sherman and Goldberg, 1991), but such a treatment was not possible in this case as it could interfere with the in vitro autophosphorylati on activity of the ethylene receptors. As Hsp70 has ATPase activity but has not been shown to have kinase activity, hence it was not rem oved from the reaction mixture. Figure 5-1: Ethylene re ceptor constructs expressed in yeast. Soluble domains of the Arabidopsis receptors were cloned into a yeast expression vector as described in Chapter 2 and expressed as GST fusions. The thrombin cleavage site (bold line) was used for GST removal from the fusion protein. ETR1, ERS1, ETR2, EIN4, and ERS2 included the GAF domain along with the kinase domain (KD) and receiver domain (RD), when present in th e native protein. A construct was also made for ETR2 that deleted the GAF domain (ETR2GAF). Autophosphorylation Activity in vitro Purified recombinant receptors we re tested for autophosphorylation in vitro as described in Chapter 2, and resu lts are shown in Figure 5-2. ETR1 GAF KD RD GST EIN4 GAF KD RD GST ETR2 GAF KD RD GST ETR2GAF KD RD GST ERS2 GAF KD GST ERS1 GAF KD GST ETR1 GAF KD RD GST GAF KD RD GST EIN4 GAF KD RD GST GAF KD RD GST ETR2 GAF KD RD GST GAF KD RD GST ETR2GAF KD RD GST KD RD GST ERS2 GAF KD GST GAF KD GST ERS1 GAF KD GST GAF KD GST

PAGE 76

65 Figure 5-2: In vitro autophosphorylation ac tivity and cation dependence. Ethylene receptors were tested for autophosphorylation in vitro in the presence of Mg2+ and Mn2+ as described in Chapter 2. Autoradiogram of the protein blot (top) and a stained gel of the proteins used (bottom) are shown for ETR1 (95 kDa), ERS1 (81 kDa), ERS2 (81 kDa), ETR2GAF (73 kDa), ETR2 (95 kDa), and EIN4 (96 kDa). As previously reported (Gambl e et al., 1998), ETR1 required Mn2+ for autophosphorylation and did not f unction in the presence of Mg2+. ERS1 and ERS2 autophosphorylated in the presence of Mg2+ or Mn2+, while ETR2 and EIN4 had a higher activity in the presence of Mg2+. The recombinant EIN4 protein was very unstable and could not be purified in large quantities. Several independent cl ones were tested for EIN4 with similar results in the autophos phorylation assay (data not shown). It is interesting to note that ERS2, ETR2 and EIN4 were able to phosphorylate Hsp70 in the presence of Mg2+. There are other kinases that have their activity differentially regulated by Mg2+ and Mn2+. An example is the p21-activated protein kinase -PAK, which has 100 kDa 75 kDaMn2+Mg2+Mn2+Mg2+Mn2+Mg2+ETR1 ETR2GAF ERS1 Mn2+Mg2+ERS2100 kDa 75 kDaMn2+Mg2+Mn2+Mg2+ETR2 EIN4 100 kDa 75 kDaMn2+Mg2+Mn2+Mg2+Mn2+Mg2+ETR1 ETR2GAF ERS1 Mn2+Mg2+ERS2100 kDa 75 kDaMn2+Mg2+Mn2+Mg2+ETR2 EIN4

PAGE 77

66 higher autophosphorylation activ ity in the presence of Mn2+ but only phosphorylates its substrate in the presence of Mg2+ (Tuazon et al., 1998). Moreover, Hsp70 phosphorylation by the ethylene receptors might not be altogether circumstantial as Hsp70 has been shown to interact with recept ors and kinases to act ivate stress responses in eukaryotes (reviewed in Nollen and Morimoto, 2002)). As shown in Figure 5-3, GST alone s howed no phosphorylation, indicating that phosphorylation is dependent on the ethylene receptors being present in the reaction mixture. Moreover, phosphorylation was also observed when ERS1 was purified without the GST tag (ERS1-GST(-)), indi cating that the site of phosphor ylation is internal to the receptor. The reduced autophosphorylation of the ERS1-GST(-) in the presence of Mn2+ might be due to the instability of the recombinant protein afte r the thrombin digestion. Figure 5-3: In vitro autophosphorylation activ ity and cation dependenc e. GST (28 kDa) and ERS1 without the GST tag (ERS1GST(-); 55 kDa) were tested for autophosphorylation in vitro in the presence of Mg2+ and Mn2+ as described in Chapter 2. Autoradiogram of the prot ein blot (left) and a stained gel of the proteins used (right) are shown. Mg2+Mn2+Mg2+Mn2+GST ERS1-GST(-) Mg2+Mn2+Mg2+Mn2+GST ERS1-GST(-) 37 kDa 25 kDa 75 kDa 50 kDa Mg2+Mn2+Mg2+Mn2+GST ERS1-GST(-) Mg2+Mn2+Mg2+Mn2+GST ERS1-GST(-) 37 kDa 25 kDa 75 kDa 50 kDa

PAGE 78

67 We also tested whether the GAF doma in is required for autophosphorylation by using an ETR2 construct l acking this domain (ETR2GAF; Figure 5-1). As shown in Figure 5-2, ETR2GAF showed the same autophosphoryla tion pattern as the full-length ETR2 construct. This result also suggests that the GAF domain is not the site of autophosphorylation. Hence, the phosphorylated residue must reside in the kinase domain as ERS1 and ERS2 do not contain rece iver domains (Hua et al., 1995; Hua et al., 1998). Nature of the Phosphorylated Amino Acid In order to determine the nature of the phosphorylated amino acid, autophosphorylated proteins were incubated in acid or base as described in Chapter 2. Phosphorylated histidine residues form phosphoa midate bonds that are sensitive to acid and resistant to base, while phosphorylations on serine, threonine, and tyrosine produce phosphoester bonds that are acid -resistant and base-labil e. Moreover, aspartate phosphorylation is labile in both acid and base. As has been previously reported (Gamble et al., 1998), autophosphorylation of ETR1 in the presence of Mn2+ resulted in a base stable phosphorylated residue under our assa y conditions, consistent with histidine autophosphorylation (Figure 5-4) Low levels of incorporation were quantified from ETR1 reactions containing Mg2+. The phosphorylated residue of CDPK shows acid stability, consistent with its serine and threonine autophos phorylation (Putnam-Evans et al., 1990). As shown in Figure 5-4, ERS1, ETR2, EIN4, and ERS2 showed acid stability in the presence of Mg2+, indicating a phosphoester bond fo rmation. In the presence of Mn2+, ERS1 showed partial resistan ce to both acid and base, sugge sting that this protein has dual activity and can produce phosphoamidate and phosphoester linkages in the presence

PAGE 79

68 of this metal. The subfamily 2 class of ethylene receptors only produced phosphoester linkages, independent of the metal present in the reaction mixture (Figure 5-4). Low levels of incorporation were quantif ied from ETR2 reactions containing Mn2+, but ETR2GAF in the same buffer showed enough incorpor ation for quantification (Figure 5-4). Figure 5-4: Acid and base stability of phosphorylated amino acids. Autophosphorylation reactions were performed as described in Chapter 2, in triplicate for each treatment, in a total of nine reactions for each protein. Reaction products were run on SDS-PAGE, and blotted to PVDF membranes. Membranes were incubated for 16h in neutral (white bars), acidic (gray bars) or basic (black bars) solutions before indivi dual protein bands were cut from membranes and counted in a scintillation counter. Graphs show the average of three values for each treatment ( SE), normalized to the counts for the neutral treatment. L. I., low inco rporation; N. D., not determined. Bi-dimensional thin layer electrophoresi s was used to determine whether the phosphoester bond was formed on serines, threonin es, tyrosines, or combinations thereof and results are shown in Figur e 5-5. ERS1 only autophosphoryl ated on serine residues in the presence of Mg2+. All receptors were tested in the presence of Mg2+ or Mn2+ and all 0 20 40 60 80 100 120 140 160CDPK ETR1 ERS1 ETR2 ETR2GAF ERS2 EIN4 CDPK ETR1 ERS1 ETR2 ETR2GAF ERS2 EIN4 % Neutral TreatmentMn2+Mg2+ L. I. N. D. L. I. 0 20 40 60 80 100 120 140 160CDPK ETR1 ERS1 ETR2 ETR2GAF ERS2 EIN4 CDPK ETR1 ERS1 ETR2 ETR2GAF ERS2 EIN4 % Neutral TreatmentMn2+Mg2+ L. I. N. D. L. I.

PAGE 80

69 autophosphorylated predominantly on serine residues (data not shown). ETR1 did not show any significant phosphoryla tion on serine, threonine or ty rosine in the presence of Mn2+ (Figure 5-5) and Hsp70 phosphorylation al so occurred predominantly on serine residues (data not shown). Faint traces of threonine phosphorylation were only observed for ERS2 in the presence of Mn2+ (Figure 5-5) and for Hsp70 phosphorylated by EIN4 and ERS2 in the presence of Mn2+ (data not shown). Figure 5-5: Phosphoamino acid analysis of autophosphorylated receptors. Autophosphorylation reactions were performed as described in Chapter 2, run on SDS-PAGE and blotted to PVDF membrane. Protein bands were cut from PVDF membranes, hydrolyzed in HCl and subjected to twodimensional thin-layer electrophoresis. The autoradiograms of the plates are shown for ETR1 (Mn2+), ERS1 (Mg2+) and ERS2 (Mn2+), and the positions of the standard phosphorylated serine, threonine, and tyrosine are marked. In order to address the bi ological relevance of the different autophosphorylated sites of ERS1 we tested for autophos phorylation in the presence of both Mg2+ and Mn2+. As the cellular concentration of free Mg2+ is 50 to 100-fold higher than Mn2+ (reviewed in Mukhopadhyay and Sharma, 1991), the aut ophosphorylation reac tion was performed taking this ratio into account. Under th e conditions used for the autophosphorylation reaction the calculated apparent concentrations of free Mg2+ and Mn2+ are 9.5 mM and 0.14 mM, respectively, as described in Chapte r 2. As shown in Figure 5-6, in the presence of both metals, ERS1 only showed serine phosphorylation, suggesting that the ERS2 ERS1 + +StandardsETR1 + + pS pT pY ERS2 ERS1 + + ERS2 ERS1 + +StandardsETR1 + + pS pT pYStandardsETR1 + + pS pT pY

PAGE 81

70 histidine phosphoryla tion of ERS1 probably does not occur in vivo unless a Mn2+ donor is present. 0 20 40 60 80 100 120 ERS1% Neutral Treatmen t Figure 5-6: ERS1 au tophosphorylation in the presence of both Mg2+ and Mn2+. ERS1 was tested for autophosphorylation in vitro in the presence of both Mg2+ and Mn2+ as described in Chapter 2. Reacti ons were performed in triplicate for each treatment. Reaction products were subjected to SDS-PAGE, and blotted to PVDF membranes. Membranes were incubated for 16h in neutral (white bar), acidic (gray bar) or basic (black bar) solutions before individual protein bands were cut from membranes and c ounted in a scintillation counter. Values shown SE. Insights on the Mechanism of Phosphorylation Since the ethylene receptors are ancestral hi stidine kinases, it is possible that the observed serine phosphorylation occurs thr ough an intramolecular transfer from a phosphorylated histidine, although this phenome non has not been previously observed. Three of the five receptors contain the conserve d histidine, while four of the five contain a histidine residue extremely close to the H-box (Appendix A). The neighboring histidine is not phosphorylated in ETR1 (Gamble et al., 1998). To examine whether the conserved and neighboring his tidine residues are required fo r the autophos phorylation of the ethylene receptors, we made constructs that changed these histidine residues to

PAGE 82

71 alanines, as shown in Figure 5-7. The ETR2GAF deletion construct was used for this study as it behaved like the full length ETR 2 protein. The ERS2 protein sequence shows no histidine residue in this region (see A ppendix A), so it was not used in this study. Figure 5-7: Ethylene receptor mutants expressed in yeast. ETR1, ERS1, ETR2-GAF and EIN4 were mutated as described in Ch apter 2 and expressed as GST fusions. Mutated proteins lack th e conserved and/or neigh boring histidine of the Hbox or the two glycines of the G1-box. As previously reported (Gamble et al ., 1998), ETR1-H did not autophosphorylate in the presence of Mg2+ or Mn2+ (Figure 5-8). Consistent w ith the dual activity of ERS1, a reduction of autophosphorylati on activity was observed for ER S1-H in the presence of Mn2+. The mutations in ERS1-H, ETR2GAF-H, and EIN4-H did not abolish autophosphorylation, as occurred with ETR1-H. Hence, it is improbable that serine phosphorylation of the ethylene receptors is due to an intramolecular phosphoryl transfer. These data indicate that th e histidine residue of the H-box is not essential for autophosphorylation on serine resi dues and that no phosphoryl transfer is occurring from histidine to serine in th e ethylene receptors. ETR1-H GAF H353A,H360A RD GST EIN4-H GAF H373A,H380A RD GST ETR2GAF-H H384A RD GST ERS1-H GAF H353A,H360A GST ETR1-G1 GAF G515A,G517A GST RD ERS1-G1 GAF G511A,G513A GST ETR1-H GAF H353A,H360A RD GST GAF H353A,H360A RD GST EIN4-H GAF H373A,H380A RD GST GAF H373A,H380A RD GST GAF H373A,H380A RD GST ETR2GAF-H H384A RD GST ERS1-H GAF H353A,H360A GST GAF H353A,H360A GST ETR1-G1 GAF G515A,G517A GST RD ERS1-G1 GAF G511A,G513A GST

PAGE 83

72 Figure 5-8: Effects of histidine mutations on in vitro autophosphorylatio n activity. The conserved histidine and/or the second ary histidine of ETR 1 (95 kDa), ERS1 (81 kDa), ETR2GAF (73 kDa), and EIN4 (96 kDa) were mutated as described in Chapter 2. The expresse d proteins were then assayed for in vitro autophosphorylation activity in the presence of Mg2+ or Mn2+. Both the autoradiogram of the protein blot (top) and a stained gel of the proteins used (bottom) are shown. The ATP binding domain of histidine kinase s follows the Bergerat fold, which is conserved in enzymes with different func tions such as the chaperone Hsp90, the DNA mismatch repair enzyme MutL and type II DNA topoisomerases (Dutta and Inouye, 2000; Koretke et al., 2000). The primary sequence similarity between these enzymes is less than 15%, but thei r secondary structure is conserve d (Dutta and Inouye, 2000). As the ethylene receptors seem to be ancestral histidine kinases, it is likely that the mechanism of ATP binding should be cons erved in these proteins, whether they phosphorylate on serines or histidines. In or der to test whether ATP binding occurs by the same mechanism, we mutated the G1-box of ERS1. The G1-box is a glycine-rich loop region that is involved in ATP binding (reviewed in (Stock et al., 2000). According 100 kDa 75 kDaMn2+Mg2+Mn2+Mg2+Mn2+Mg2+ETR1-H EIN4-H ERS1-H100 kDa 75 kDaMn2+Mg2+ETR2GAF-H 100 kDa 75 kDaMn2+Mg2+Mn2+Mg2+Mn2+Mg2+ETR1-H EIN4-H ERS1-H100 kDa 75 kDaMn2+Mg2+ETR2GAF-H

PAGE 84

73 to Gamble et al. (1998), the G1-box mutation co mpletely abolishes histidine phosphorylation in ETR1. As shown in A ppendix A, ETR1 and ERS1 are the only ethylene receptors with all the recognizable mo tifs that seem to be necessary for histidine kinase activity (Parkinson and Kofoid, 1992). The subfamily 2 class of receptors does not have the conserved residues of the G1box motif and was not used for this study. However, as shown in Figure 5-9, mutation of the G1-box did not abolish autophosphorylation activity of ERS1 or ETR1 under our assay conditions. Figure 5-9. Effects of G1-box mutations on in vitro autophosphorylati on activity of ETR1 and ERS1. The conserved glycines of ETR1 (95 kDa) and ERS1 (81 kDa) were mutated as described in Chapter 2. The ETR1 mutant protein (ETR1-G1) was assayed for in vitro autophosphorylation activity in the presence of Mn2+, along with wild-type ETR1. The ERS1 mutant (ERS1-G1) was assayed in the presence of Mg2+ or Mn2+, along with wild-type ERS1. Both the autoradiogram of the protein blot (top) and a stained gel of the proteins used (bottom) are shown. The ETR1-G1 and ERS1-G1 plasmids were sequenced from the yeast clones to make sure the G1 box was mutated. The data in Figure 5-9 contra dict the previously published results that the G1 box is essentia l for ETR1 kinase activ ity (Gamble et al., 1998) and put into question whether the m echanism of ATP binding is the same for Mn2+Mn2+Mg2+Mn2+ETR1 ERS1-G1 Mg2+Mn2+ERS1 ETR1-G1 Mn2+Mn2+Mg2+Mn2+ETR1 ERS1-G1 Mg2+Mn2+ERS1 ETR1-G1 100 kDa 75 kDa 100 kDa 75 kDa 100 kDa 75 kDa 100 kDa 75 kDa

PAGE 85

74 histidine kinases and ethylene receptors. It will be interesting to know if the ethylene receptors have a conserved Bergerat stru cture even though the amino acids of the designated boxes are not conser ved, but protein structure data are necessary to address these issues.

PAGE 86

75 CHAPTER 6 CONCLUSIONS AND FUTURE DIRECTIONS Ethylene is one of the most studied phytohormones and it has several roles in plant development. It is involved in leaf and flower senescence, defense responses, fruit ripening, leaf and fruit abscission, and seed germination (Abeles et al., 1992). Several components of the ethylene signal transduction pathway have been id entified in the last two decades. Five proteins (ETR1, ERS1, ETR2, ERS2, and EIN4) have been identified in Arabidopsis as receptors for ethylene (Cha ng et al., 1993; Hua et al., 1995; Hua et al., 1998; Sakai et al., 1998). These receptors s how four distinct do mains: a membrane spanning domain, which contains the ethylene binding site (Schaller and Bleecker, 1995); a GAF domain (Aravind and Ponting, 1997); a kinase domain with sequence similarity to histidine kinases (Parkinson and Kofoid, 1992); and a receiver domain as found in response regulator proteins (Stock et al., 2000) The receiver domai n, however, is absent from ERS1 and ERS2 (Hua et al., 1995; Hua et al., 1998). Six ethylene receptor family members have been identified in tomato : LeETR1, LeETR2 (Lashbrook et al., 1998), NR (Wilkinson et al., 1995), LeETR4, LeETR 5 (Tieman and Klee, 1999), and LeETR6 (Tieman and Klee, unpublished). These receptors show the four domains defined for the Arabidopsis ETR1 protein, as discussed in Chapter 3. The most conserved domain in all ethyl ene receptors is the trans-membrane (sensor) domain, including the amino acids that are required for dimerization and ethylene binding. The ethylene receptor fa mily can be further divided into two

PAGE 87

76 subfamilies. Subfamily 1 recep tors have all the conserved motifs necessary for histidine kinase activity, while the subfamily 2 member s do not. Some subfamily 2 members even lack the conserved histidine that is phosphorylated in two-component and phosphorelay systems. This subfamily segregation does not correspond to the presence or absence of the receiver domain, but does co rrelate with intron distribut ion within the genes, as shown in Chapter 3. The subfamily 2 memb ers also feature a putative fourth transmembrane region at the amino-terminus consisting of 20-30 hydrophobic amino acids, which could be targeting sequences as disc ussed in Chapter 3. The Arabidopsis ETR1 protein has been shown to localize to the ER (Chen et al., 2002), which allows for the recruiting of CTR1 to the ER membrane (Gao et al., 2003). In terms of ethylene signaling, this localization should not aff ect the recognition of the receptor by the hormone as ethylene is highly liposoluble. As shown in Chapter 3, the tomato ethylene receptors seem to localize to the ER irrespective of their subfamily. In Arabidopsis, in situ hybridization studies show that ETR1 is expressed ubiquitously, at low levels in seedlings a nd higher levels in stems and flowers. ETR1 is strongly expressed in anthers and carpels th roughout development (Hua et al., 1998). The expression of ERS1 is ubiquitous; it is expressed in embryos, etiolated seedlings, leaves and stems. High levels of ERS1 expression are noticed in floral primordia and very strong expression is seen in anthers (Hua et al., 1998). In situ hybridization studies showed that ETR2 is evenly, but weakly, expressed in al l tissues, with higher levels in the central inflorescence meristem and in young floral meristems. In flowers, ETR2 expression is higher in developing ovules and petals (Sakai et al., 1998). EIN4 is expressed in several tissues as shown by RT-PCR and RNA blots; in situ studies showed

PAGE 88

77 that the expression level is low and ubiquitous but stronger in stamens. The expression pattern of ERS2 is the same as for EIN4 both genes being expressed in etiolated seedlings, leaves, roots, stems, and inflores cences. High expression is seen in stamens and ovules. In later floral development ERS2 expression was localized to epidermal layers of the septum, where the other four ge nes were not expressed (Hua et al., 1998). Taken together these data suggest that ethy lene receptors are expressed in all tissues throughout development, even though not all re ceptors are present in all tissues at all times. The NR:GUS transgenic lines described in Chap ter 2 were used to look at the expression pattern of NR within tissues. In these transg enic lines GUS activity was seen in the anthers, style and stig ma of the flower, vascular bund les of the stem and mature seeds. GUS expression was low in immature fruit a nd predominantly located in the calyx and columella. Expression increased during fruit maturation and spread throughout the fruit. It was highest in ri pening fruit and decreased when the fruit was ripe. Mature seeds showed high levels of GUS expression, while immature seeds showed very little. The expression pattern observed in the NR:GUS transgenic lines correlates with the previous studies on NR expression (Hua et al., 1995; La shbrook et al., 1998) and the data presented in Chapter 3 suggest that GUS activ ity assays might be a useful technique to study NR expression patterns in respon se to different hormone tr eatments and stresses. Plants can regulate the distribution pattern of ethylene receptors in different tissues and they can also regulate the levels of recep tors expressed at a given time. A dramatic effect of transcriptional regulation of ethylene receptors has been observed in NR antisense plants, where LeETR4 expression is increased to compensate for the lack of NR

PAGE 89

78 (Tieman et al., 2000). As discussed in Chapter 4, one of the goals of this study was to look at transcriptional regulat ion of the ethylene receptors in Arabidopsis. The two ecotypes used in this study, Columbia a nd Wassilewskija have the same general morphology when grown under similar growth c onditions. However, some differences in receptor mRNA levels were observed in these ecotypes, primarily higher levels of ETR2 mRNA were found in Columbia. Despite th e differences observed when comparing the steady-state RNA levels of i ndividual genes, there was not a significant change in the total level of ethylene receptor s between the ecotypes. The data presented in Chapter 4 are consistent with the hypothesis that the two subfamilies have redundant roles and that the total level of receptors de termines the plant’s phenotype. As discussed in Chapter 4, ERS1 and ERS2 seem to be induced immediately after the exogenous ethylene treatment. After one hour there was already a 40% increase in the total mRNA level in response to the treatm ent. Moreover, it has been reported that ETR2 ERS1 ERS2 showed a six-fold induction af ter 12 hours of exogenous ethylene treatment, while ETR1 and EIN4 were not ethylene inducib le (Hua et al., 1998). No increase in ETR2 mRNA level was seen after one hour ethylene treatment, under our assay conditions. As discussed in Chapter 4, ETR2 is expressed duri ng pathogenesis in an ethylene-dependent manner. Hence it seems likely that this gene should be ethylene inducible. The lack of visible ETR2 expression after one hou r of exogenous ethylene treatment could be due to ETR2 being induced later than ERS1 and ERS2 or having a slower rate of induction that prevented its detection after only one hour. A more detailed study is needed to establish the expression pattern of these receptors after exogenous ethylene treatment. It would be interesti ng to look at receptor expression levels at

PAGE 90

79 various time points during treatmen ts, in order to determine the rate of receptor induction. This more thorough analysis would help determine if and when ETR2 expression is induced in response to ethylene treatment. The pathogen response data presented in Chapter 4 have recently been published (O'Donnell et al., 2003). Arabidopsis infection with the bacterial pathogen Xcc leads to increases in mRNA levels of ETR2 and ERS1 ERS1 mRNA levels increased several-fold over time, but a greater effect of infection was seen on ETR2 mRNA levels. Maximum levels were observed after 72 hours, which was concurrent with the peak in ethylene synthesis. Measurement of receptor mRNA le vels in the ethylene insensitive mutants etr1-1 and etr2-1 showed that ethylene perception is re quired for the observed increase of ETR2 and ERS1 mRNA levels. Moreover, this result is consistent with the observations described in Chapter 4 that these two genes are ethylene-inducible in wild-type plants. However, no ERS2 induction was observed after pat hogen infection, suggesting that the pathogen might be interfering wi th the ethylene response. One of the advantages of studying ethylene response in Arabidopsis is the large mutant collection available for this signa ling pathway. As discussed in Chapter 4, receptor mRNA levels were determined in etr1-1 and the constitutive ethylene response mutant ctr1-10 Receptor mRNA levels were reduced in the former and increased in the latter. The reduced level of total mRNA in the etr1-1 mutant suggests that this plant is decreasing the levels of its ethylene receptors to better respond to ethylene. The opposite is true for the ctr1-10 mutant, where mRNA levels increase in an apparent attempt to block the constitutive ethylene response. The changes observed in the receptors’ mRNA levels in the ctr1-10 mutant seem to correlate with the patterns observed after ethylene

PAGE 91

80 treatment. As the receptors are negative re gulators of the ethyle ne signal transduction pathway, it will be interesting to look at receptor expression in loss-of-function mutants of the ethylene receptors to see if thei r expression patterns show similarity to ctr1-10 Single loss-of-function mutants do not show a constitutive ethylene response phenotype (Hua and Meyerowitz, 1998), which could be due to compensation by other ethylene receptors to maintain a cons tant level of receptors. This phenomenon has been observed in tomato transgenic lines between LeETR4 and NR (Tieman et al., 2000) and could also occur in Arabidopsis. The results presented in Chapter 3 and 4 support the hypothesis that the receptors are redundant in function. However, the se quence divergence betw een these receptors calls into question whether they have the same biochemical function. The Arabidopsis ETR1 protein is an active histidine kinase, as it autophosphorylates a conserved histidine in vitro (Gamble et al., 1998). However, the su bfamily 2 receptors do not contain the conserved motifs that seem to be necessary for histidine kinase activity (Appendix C). Moreover, genetic data suggest that hi stidine autophosphoryla tion of ETR1 is not necessary for receptor function in ethylene signal transduction (Chang and Meyerowitz, 1995; Gamble et al., 2002; Wang et al., 2003) As shown in Chapter 5, all five Arabidopsis ethylene rece ptors autophosphorylate in vitro independent of the presence or absence of the histidine kinase conserved motifs. While these results corroborate the previously published histid ine autophosphoryla tion activity of ETR 1 (Gamble et al., 1998), the other four members of the ethyl ene receptor family autophosphorylate predominantly on serine residues. As recepto r kinase activity was maintained despite the

PAGE 92

81 sequence divergence, it seems reasonable to predict that autophosphor ylation should be important for receptor function. There are several examples of serine autophosphorylation by proteins with sequence similarity to histidine kinases, including the plant phytochromes (Yeh and Lagarias, 1998; Lapko et al., 1999) as well as the mitochondrial pr oteins BCKD kinase (Davie et al., 1995) and PDK (Thelen et al., 2000). Figure 6-1 shows a sequence similarity tree comparing ethylene receptors to known histidine kinases and to kinases that phosphorylate on serine resi dues despite their similarity to histidine kinases. The subfamily 1 of ethylene receptors are in a clade with cytoki nin receptors CRE1 and CKI1 (Hwang and Sheen, 2001; Inoue et al., 2001) and other histidine kinase homologues from Arabidopsis (Urao et al., 2001). The kinase domains of Arabidopsis and tomato ethylene receptors are closely related to the kinase dom ain of eukaryotic phytochromes, but not to the kinase related domain present in these prot eins. The latter seems to have arisen from a duplication of the kinase domain and does not have in vitro kinase activity. The kinase related domain of plant phytochromes is in a separate clade along with PDK, BCKD kinase and the E. coli histidine kinase CheA. The canonical histidine kinases SL N1, EnvZ and Cph1 (cyanobacterial phytochrome) are not in a clade with either of the groups of se rine-phosphorylating enzymes, and sequence similarity between these groups is less than 15%. The phylogenetic relationship between these canon ical and non-canonical histidine kinases suggests that the ability of histidine kinases to phosphoryl ate on serine residues evolved independently multiple times. Furthermore, the ethylene receptor family seems to be showing degrees in this evol ution from histidine to serine phosphorylation. ETR1 and

PAGE 93

82 ERS1 have all the histidine kinase motifs, but ETR1 autophosphorylates on histidines while ERS1 has histidine and serine phosphor ylation activity. At the other end of the spectrum there is ERS2, which has none of the histidine kinase motifs and phosphorylates on serines and threonines. Phytochromes, BCKD kinase and PDK have maintained the conserved amino acids of the ATP-binding domain (Popov et al., 1992 ; Popov et al., 1993; Yeh and Lagarias, 1998) while the ethylene receptor subfamily 2 members have not. Hence, it is probable that these specific amino acids are not required for serine autophosphorylation. Moreover, the phosphorylation mechanism used by BCKD kinase is different from the one used by canonical histidine kina ses. Instead of attacking the -phosphate of ATP with the side chain of the phosphate-accepting histidine in the H-box (Bilwes et al., 1999) it uses a glutamate in the N-box as a general base catalyst to activate the serine to be phosphorylated (Tuganova et al., 2001). Th e ethylene receptors possess conserved glutamates and aspartates in close proxim ity to the N-box (Appendix C) that could be used by the enzyme to catalyze the phosphate tr ansfer. Moreover, the results presented in Chapter 5 suggest that the c onserved histidine residue of the H-box is not required for serine autophosphorylation of the ethylene receptors, as its exchange to an alanine residue does not abolish aut ophosphorylation. However, a defi nite answer to whether the ATP binding domain is conserved in the subf amily 2 receptors will require resolving the structure of their kinase domains. Structure data will also help identify amino acids that might be involved in the phosphorylation mechanism.

PAGE 94

83 Figure 6-1. Phylogenetic relationship between the kinase domains of Arabidopsis and tomato ethylene receptors, phytochromes (PHY), the mitochondrial proteins PDK and BCKDK, the cytokinin receptors CRE1 and CKI1, histidine kinase homologues in Arabidopsis (AT HK1, AHK2, AHK3), and canonical histidine kinases (bold) SLN1, CheA, EnvZ and Cph1. Neighbor-joining tree was generated from full-length pr otein sequences using Clustal W ( http://clustalw.genome.ad.jp/ ). KRD, kinase related domain present in eukaryotic phytochromes. LeETR1 LeETR2 AtETR1 LeNR A t ERS1 LeETR4 LeETR6 A t ETR2 LeETR5 A t EIN4 A t ERS2 AtPHYB AtPHYD AtPHYE AtPHYA AtPHYC EcEnvZ C p C p h1 EcCheA RnBCKD K AtPD K RnPDK1 RnPDK4 ScSLN1 AtATHK1 AtCKI1 AtAHK2 AtAHK3 AtCRE1 AtPHYA-KRD AtPHYC-KRD AtPHYB-KRD AtPHYD-KRD AtPHYE-KRD

PAGE 95

84 The proposed mechanism for histidine kina se phosphorylation suggests that transphosphorylation occurs between su bunits of homodimers (reviewed in Stock et al., 2000). Hence, it can be inferred that canonical a nd non-canonical histidine kinases should be able to phosphorylate other proteins. This phenomenon has been observed for phytochromes (Ahmad et al., 1998; Fankhauser et al., 1999), BCKD ki nase (Popov et al., 1992; Davie et al., 1995), and PDK (Popov et al., 1993; Thelen et al., 2000), and could be true for the ethylene receptors. No CTR1 phosphorylation by ethylene receptors has been shown to date, even though these proteins interact in vitro and in vivo (Clark et al., 1998; Gao et al., 2003; Huang et al., 2003). It is possible that the et hylene receptors could phosphorylate another component of the signal transduction pathway that has not been identified. As mentioned in Chapter 5, the ethylene receptors show substrate phosphorylation activity in vitro as they are able to phosphorylate Hsp70. The biochemical data presented in Chap ter 5 show that the five Arabidopsis ethylene receptors s how kinase activity in vitro but do not phosphorylate on identical amino acids. These data, however, do not completely disagree with the proposed functional redundancy of the recep tors. Genetic and biochemi cal data suggest that all family members are active in ethylene signal transduction (Hua and Meyerowitz, 1998; Hall et al., 1999), but it is not clear whet her kinase activity is the primary means by which the receptors signal. It has been re ported that loss of his tidine autophosphorylation or removal of the kinase domain of ETR1 does not impair ethylene insensitivity conferred by the dom inant insensitive etr1 mutant (Gamble et al., 2002). Neither do mutations that disrupt histid ine kinase activity of ETR1 pr event its complementation of etr1;ers1 double loss-of-function mutants (Wang et al., 2003). Hence, it has been

PAGE 96

85 suggested that receptor kinase activity is not part of the mechanisms of ethylene signal transduction. This conclusion, however, is based solely on data for ETR1 and histidine kinase activity. Moreover, it relies on the assumption th at the receptor’s kinase is active in the absence of ethylene and responsible for the “ON” state. It has been demonstrated that CTR1 kinase activity is required for the repr ession of ethylene signaling (Huang et al., 2003), yet the in vivo kinase activity of the ethylene receptors has not been studied. Histidine kinase activity of ETR1 is not n ecessary for the repression of the ethylene signal transduction pathway (Gamble et al., 2002; Wang et al., 2003), but if autophosphorylation is involved in protein turnover, for ex ample, it would not be necessary for the maintenance of the represse d state. The receptors could be modulating CTR1 kinase activity directly by a change in their conformation in response to ethylene binding; autophosphorylation of the receptors could be responsible for CTR1 turnover after ethylene binding. It seems unlikely that phosphorylation is required for CTR1 inactivation, as ETR1 mutant s that abolish phosphorylati on do not lead to ethylene insensitivity (Gamble et al., 2002). This mode l is consistent with lack of receptors inducing ethylene response in the absence of ethylene (Hua and Meyerowitz, 1998) as it would prevent CTR1 from localizing to the ER membrane where si gnaling is occurring (Gao et al., 2003). It cannot be ruled out that the recepto rs might be sequestering a downstream component of the signaling pathway that is released upon ethylene binding and protein phosphorylation. In this scenar io, phosphorylation c ould lead to recept or turnover or a change in its conformation, either of which would lead to release of the sequestered

PAGE 97

86 component. In order to answer these questions it will be necessary to know if serine phosphorylation occurs in vivo and whether serine phosphor ylation is required to maintain the repressed state or to release this repression. The biochemical data presented in Chapter 5 provide support for the geneti c evidence that histid ine autophosphorylation is not necessary for maintaining the re pressed state (Chang and Meyerowitz, 1995; Gamble et al., 2002; Wang et al., 2003), and su ggest that receptor signaling in the “ON” state does not occur through a phosphorelay. However, as kinase activity has been retained despite the sequence divergence of the ethylene receptor family, it seems likely that this activity is important for receptor function. Regardless of the differences in enzymatic activity of the ethylene receptors, their functional redundancy still seems to be a valid hypothesis. Several observations contributed to this hypothesis, including the identification of dominant insensitive alleles for all the receptor family members (Bleecker et al., 1988; Hua et al., 1995; Hua et al., 1998; Sakai et al., 1998), the observation that the two subfamilies can compensate for each other in tomato (Tieman et al., 2000) and the inability to identify loss-of-function mutants in genetic screens. Moreover, si ngle loss-of-function mutations of these receptors do not lead to a constitutive ethylene response (Hua and Meyerowitz, 1998), which further supports the hypothesis that th e receptor family members might have redundant functions. Triple and quadrupl e loss-of-function mutants have more pronounced phenotypes that mimic a consti tutive ethylene response (Hua and Meyerowitz, 1998). The only da ta inconsistent with the redundancy hypothesis is the observation that the subfamily 2 recept ors are not able to complement the etr1;ers1 double loss-of-function mutant, which shows a severe constitutive ethylene phenotype

PAGE 98

87 (Hall and Bleecker, 2003). However, it has been suggested that the subfamily 2 receptors do not bind CTR1 as tightly as the subfam ily 1 receptors (Cancel and Larsen, 2002). This difference in affinity for CTR1 coul d account for the lack of complementation observed with the etr1;ers1 double mutant. Nevertheless, a more detailed biochemical study of the receptors and their effect on CTR1 function is needed in order to determine the mechanism of ethylene signal transduction.

PAGE 99

88 APPENDIX A TOMATO GENOMIC SEQUENCES LeETR2 1 ATGGATTGTA ACTGCTTCGA TCCACTGTTG CCTGCCGATG AGTTGTTAAT 51 GAAGTATCAG TACATTTCTG ATTTTTTCAT TGCAGTTGCT TATTTTTCCA 101 TCCCAATCGA ACTGGTATAC TTTGTCCAGA AATCAGCTGT TTTTCCGTAT 151 CGATGGGTGC TTGTGCAGTT TGGTGCTTTC ATAGTTCTTT GTGGAGCAAC 201 ACACCTTATC AATTTGTGGA CTTCTACTCC TCATACAAGG ACTGTGGCAA 251 TGGTGATGAC TACGGCGAAG TTCTCCACTG CTGCGGTATC ATGTGCAACT 301 GCTGTCATGC TTGTGCACAT TATTCCGGAT TTATTAAGTG TCAAAACTAG 351 GGAGCTATTC TTGAAAAACA AAGCGGCGGA ACTTGATCGT GAAATGGGTC 401 TTATTCGGAC ACAGGAGGAG ACGGGTAGAT ATGTTAGAAT GCTAACACAT 451 GAAATCAGAA GTACTCTGGA TAGACATACT ATTTTGAAGA CTACACTTGT 501 TGAACTTGGA AGAGCATTGC AACTGGAAGA GTGTGCTTTG TGGATGCCGA 551 CTCGAACTGG AGTGGAGCTT CAACTTTCTT ACACTTTACA TCATCAAAAT 601 CCAGTTGGAT TTACAGTACC TATACAACTC CCTGTAATTA ATCAAGTTTT 651 CAGTGCAAAT TGTGCTGTTA AAATTTCACC TAATTCTGCC GTTGCAAGGC 701 TTCGACCTAC CCGGAAGTAC ATTCCAGGTG AGGTGGTTGC TGTTAGGGTC 751 CCACTTTTGC ATCTCTCAAA TTTTCAGACT AATGATTGGC CCGAACTCTC 801 GCCGAAGAGC TATGCTTTGA TGGTTTTGAT GCTTCCTTCA AATAGTGCAA 851 GACAATGGCA TGTCCATGAA TTGGAGCTTG TTGATGTGGT AGCCGATCAG 901 GTTTGATTTT TTTTATATGT GATACAATAT CTGATAGCTT CACTTTATTA 951 CCACAATGAG ACAACTACAT TGATGCAGTT TCATCTGCAC TGATTACAAC 1001 AACACTAACA ATATACCCAG TGTGTTCCCA CAGAGTGCGG TTGGGGGAGG 1051 ATAGTGTACG ATCTTACCTC TACTTTATAG GTAGAAAGTC TGTTTCCGAT

PAGE 100

89 1101 AGACCCTCGG CTTAAGCAAA AACAGTCAAG AAAAAGAAAT AACGGAAGTG 1151 AAAGCATGAC AAAGATTTCT GAACAGTGAC TATAGCAAAA TAATTCAATA 1201 ATCAAAGTAC AAGAAACAAT AGATAGTAAT AGTAATTGAC GTACAAGAAA 1251 TTTCATCTGC ACCACGCTGA TTATCTTCAT ACATGTTATT CCTCTTGATT 1301 CACAAAGTTT GATAAATGCT TGGACTGAAT TTTCAATCTG AGGTGTATGA 1351 GGCTTTTAAG CAAAAAGCAC AAGTATAGTG TAGACAATAA TTAAGAAGTA 1401 AAAACACTCA AGAATAAAAA CTATTAACGG AAAAAGCAAT TATATGAGTA 1451 AGGAATTGGA AAAAATACAA TAAAAAGCAA TTGTATGAGT AAGGGATTGA 1501 AACAAATACA AACTAAGTGC ATATTTACCT CCATAAGGTA GTGGTACGGT 1551 TTGCATACAC TCTACCCTCC TTTGACCCCA CTTGGTGGGA TTTCACTGGG 1601 TATGTTGTTG TTGTAAGTGA AACATTTATT ATTTTGTGTC GCCTTCTTCT 1651 AGGAAGAGCT TATTGGTGAT GAAATTCACA CTGTAACTCC TTGTTGCATA 1701 TGCATTGTTT GATATATGCA AGTCAAAACA CTCAACTTGT TTTTCTTAAG 1751 CCGAGTGTCT ATCGGAAACA ACCTCTCTAT CCCACAAAGG TAGGGGAGGG 1801 GTAAGGTCTA CATACAATGT ACATCTCACC TTCCCAGACC CTACTTGTGG 1851 GACTATATCG GGTATGTTGT TGTTATAACA CTCAACTTAC TATTAACATT 1901 AGCTTTTAAA GATGGCAGTT GACTAAATCT GGCTTCCACG ACTGTTATGC 1951 TTTATGAGAC TTTGACGTTG GATGTAGGAT CTAAACAAAA TGGGACCTAC 2001 AATTTTGATT TGATTTCATA TACATACTGT AGACTAAAGA TCTATTATGA 2051 CTGTCCGAGT AGTATTTTCT GTACTCTTCA TATAAAGTGA AAAGAAGGGA 2101 AAAGTTAAGA ATGTCCATAA AAGAAAAGAC AGTATTGTAC TGTTGAGATT 2151 TCTTCAGAAG GAGTTGTTTT CTGAAGGAGC AGCCCTCCAC CCCTCAAATT 2201 TTCGCTGGCG CCCCACTTCT CCTAGTATTT GTGGAGTGAT TGCAGTTTCC 2251 TCATTGAAGT AGATAGATTC AAGCTTCTAG TAGACTATGA TTAATCAATC 2301 AACTGGGCTC AAACGGAAGC AGCTCATGCA TGTGGGACTT GAATGTGTGA 2351 CCTGATGGAG TGACTTTTTC CTATATCTGT TTTCAATGCA GGTAGCTGTT 2401 GCTCTCTCCC ATGCTGCCAT CTTGGAGGAA TCAATGAGGG CTCGAGATCT 2451 TCTTATTGAG CAGAATGTGG CTCTTGATCT GGCAAGAAGA GAAGCAGAAA 2501 CAGCTGTTCG TGCGCGTAAT GATTTCCTGG GTGTTATGAA TCATGAAATG

PAGE 101

90 2551 AGAACTCCCA TGCATGCGGT GGTTGCACTT TCATCTTTGC TGCAAGAAAG 2601 TGAACTGATA CCCGAGCAGC GTCTGATGGT GGAAACAATC CTAAAGAGCA 2651 GCAACCTTTT AGCAACTCTC ATTAATGATG TCTTGGATCT TTCAAGGCTA 2701 GAGGATGGAA GCCTTCAACT TGATGTTGGG ACTTTCAATC TTCATGCTCT 2751 CTTCAGAGAG GTAAGCCTAA TTTTCCCTTT TACTTGCAAA TTCTAGATTA 2801 TTTGAGTAAA AGAACAATTA AAATATGTTC TCATTACTTA TGACAATATT 2851 GGGTTTTTTT TTTATCATGT TGTGTTGGAA ACTAGGAGTG ACAAATGGGC 2901 GGGTCAGTTT GGATATGAGC GTTGGAAACA TGCTAAACAA AAATGGATAA 2951 AAATATATTC AACCTGCCCA TATTTTACGC GGATAAAAAA TGGGTTAACC 3001 GATGGATAAT ATGGATAATT TCAATATTAG CTTGGTGAGA ACACAAGCTA 3051 AAAGTCAAAA TGAGCTTAGA CTCCCAAAAG TAAGAACTCA TGAAATGTAA 3101 CCAGCAGAGA AATGGGTATT GCTAATATGG ATACTTTCCA TATGTGATCC 3151 ATTTTTAAAT GTTCAGTTAT CCAACTCATA TATAGTGGGT TGGATTGGAT 3201 GGTTACTTGA TTTTTTAAAA CCATTTTGCC AACCCTTCCT GAAACTATTC 3251 ACTGATTCAG GTTTCTGCTT ATTGCTTTAG GTCCTTAACT TAATCAAGCC 3301 TGTTGCAGCT GTAAAGAAGC TGTTTGTCAC GCTTAGTTTG TCTTCGGATT 3351 TTCCGGAAGT TGCTATTGGA GATGAAAAAC GGCTCATGCA AATTCTTTTA 3401 AATGTTGTTG GCAATGCTGT AAAATTCTCA GAAGAAGGCA GTGTGTCAGT 3451 TTCTGCAGTT AATGCAAAAT CAGAATCTCT AATAGATCCT AGAGCTCCAG 3501 AGTTTTTTCC TGTGCAGAGT GAGAATCACT TCTATTTGCG TGTACAGGTA 3551 TGTTTATAGG TTTATTTTCA TGCTTGATAT TTAGTGTTCC CAGTAAATGG 3601 TAGTTGCTCT GTAAATTCTT CTTGGGTAGT GATTGTTATT GTTTTTTATT 3651 TTTATTGCTA CTTTTTCTGT GTAATTTAGG TAAAAGATAC AGGATCAGGC 3701 ATTAATCCTC AGGATTTCCC CAAGTTGTTC TGTAAATTTG CGCAAAACCA 3751 GGAACCAGCA ACTAAAAATT CTGCTGGCAC TGGACTTGGC CTTGCAATTT 3801 GTAAGAGGTA TCTCACTTCA CTGGTTTTTG TATTGAATGC AGTTTTCGGT 3851 TTGCTATGAT AATTGAGGAC TGCAGATTGA GACATTGAGT TCTTTTTTTT 3901 TGGCTGATGC ACATTCCCTG GAAATTTAGT ACCATGGGAT GTTGAGACAC

PAGE 102

91 3951 TTACAACAGT GATCATTTTC TGACGTATTG TTCTCATGGC CTGGATCAGG 4001 TTTGTAAATC TTATGGAAGG ACACATTTGG ATTGAAAGTG AAGGTGTCGG 4051 GAAGGGTTCT ACTGCTATCT TTATTGTTAA ACTTGGCATT CCTGGTCGCT 4101 TAAATGAGTC AAAGCTTCCC TTTACGGCCG GATTGCCTGC AAATCACATG 4151 CAGATGACTT TTCAAGGACT AAAGGTCTTG GTTATGGATG ATAATGGGTG 4201 AGTGCTCATG CTACCTCGTT ATCTTTTGTC CAATCTTGTT CTGCTATGTG 4251 TTGATCTGTT TTACGTGAGA CTGGACATTT ACAAGTTGAA AAAAGTGGTA 4301 GTCATTGGAC ATCACTTTGG AACAAGGAGC CTGACCGTCT ATTACTGTCT 4351 ATGGAAGTTA AGAGTCCAAT AACTTTTATG TATAGTGGGA TGTTCTAGAC 4401 TTAGATATAG TAGGAGCATA AGATGATGTG CACCTGAAGG ATAGCGACTG 4451 CGGGTTTGCT TGTCATTAAA AACAAAGGTC CAAGATAGGG ACGGTAAAAA 4501 CAAGAGATTA TTTTTCCTAA AAAAGTTCAT TCAGCTATTT CCTGCAAAAA 4551 TCATTATCTT TTTGTTCTGG TTCCACTAAC TGCTAAAGTT TGGTCCTCAA 4601 TGTATGCCTT GTTAGCTTGT TAATCATTTC TTGGTTTGTA GTAATTAAAT 4651 GCATGAAGTT TCATATCGTG TTGGTAGCAA AACTTGATAA GAAGCTCATA 4701 GGTCTTATCA TGCTAAAAGG AAAGTTGAAG GAGCTTAACA AAAAGAGGAA 4751 AATGAATGTG GTCTTTATTG GGAAAAAAAA AAAGAGGAGG AGAAAGCAAA 4801 GTAGAAGGAA AGATTGGAGA ACCCGAACCT CTTAAGCTTT GGAGCCTATT 4851 TATACTTTGA GGAGTCATAT TTTTACCGAC CAGCACAATC GGAAAATGTG 4901 ATTTATTGTA CTTTTATGTG CTTCCAATTT TTCTTACTTT AAAGGGTTAA 4951 GAAATGAACA GAGTAAAAGG ATTCTTTTAC TTTGTCATTC TTTAAGTGAC 5001 GAAAGGATTA ATAAATATTA GTTATAGACA TCTATAGGAG CAAGTTCCAG 5051 AAAATTCCTT TTTATCAAAT AAAAAGGCTA TAGAGGATTC TCTTTTAGTT 5101 ATTTGATAAG TATCCATACC TTTTGCTTTT TTCTTTATTC TCATTCACTG 5151 TTGGTGGCTG TAGATTGATT TACCCGAATC TGTCCCAGTG ACAACTCTGT 5201 TTCTCAGGTT GTTGCAAATG TTGCATCTTT TGAAAATGAT ATATAAGATG 5251 AATAATGTAG TTGCAAATTT TGAAACCTTT TTATGTAGGT TTAGCAGGAT 5301 GGTAACGAAG AGTCTGCTAG TGCATCTAGG GTGCGATGTA ACAACCATTG 5351 GCTCCGGTGA TGAGTGCTTG AGAATCCTTA CTCGGGAACA CAAAGTACTA

PAGE 103

92 5401 ATCATGGACG CAAGTATAAC AGGTATGAAC TGTTATGATG TTGCCGTCAG 5451 TGTACATGAG AAATTTGGAA AACGTCTCGA GAGGCCACTT ATTGTGGCAC 5501 TAACTGGGAA CACTGACCAA GTGACAAAAG AAAACTGCTT GAGAGTTGGA 5551 ATGGATGGAG TTATTCTGAA ACCTGTTTCA ATTGATAAAA TGAGAAGTGT 5601 TTTATCCGGG CTTTTAGAGC ACGGAACTGT TCTTTAA NEVERRIPE 1 ATGGAATCCT GTGATTGCAT TGAGGCTTTA CTGCCAACTG GTGACCTGCT 51 GGTTAAATAC CAATACCTCT CAGATTTCTT CATTGCTGTA GCCTACTTTT 101 CCATTCCGTT GGAGCTTATT TATTTTGTCC ACAAATCTGC ATGCTTCCCA 151 TACAGATGGG TCCTCATGCA ATTTGGTGCT TTTATTGTGC TCTGTGGAGC 201 AACACACTTT ATTAGCTTGT GGACCTTCTT TATGCACTCT AAGACGGTCG 251 CTGTGGTTAT GACCATATCA AAAATGTTGA CAGCTGCCGT GTCCTGTATC 301 ACAGCTTTGA TGCTTGTTCA CATTATTCCT GATTTGCTAA GTGTTAAAAC 351 GCGAGAGTTG TTCTTGAAAA CTCGAGCTGA AGAGCTTGAC AAGGAAATGG 401 GCCTAATAAT AAGACAAGAA GAAACTGGCA GACATGTCAG GATGCTGACT 451 CATGAGATAA GAAGCACACT CGACAGACAC ACAATCTTGA AGACTACTCT 501 TGTGGAGCTA GGTAGGACCT TAGACCTGGC AGAATGTGCT TTGTGGATGC 551 CATGCCAAGG AGGCCTGACT TTGCAACTTT CCCATAATTT AAACAATCTA 601 ATACCTCTGG GATCTACTGT GCCAATTAAT CTTCCTATTA TCAATGAAAT 651 TTTTAGTAGC CCTGAAGCAA TACAAATTCC ACATACAAAT CCTTTGGCAA 701 GGATGAGGAA TACTGTTGGT AGATATATTC CACCAGAAGT AGTTGCTGTT 751 CGTGTACCGC TTTTACACCT CTCAAATTTT ACTAATGACT GGGCTGAACT 801 GTCTACTAGA AGTTATGCGG TTATGGTTCT GGTTCTCCCG ATGAATGGCT 851 TAAGAAAGTG GCGTGAACAT GAGTTAGAAC TTGTGCAAGT TGTCGCAGAT 901 CAGGTTTTAA TTGCTAACTT CCTTTATCTT ATTATTAACT GGTTAGAAGC 951 AGGTCAGTGA TGTGTGTAAA GTTCAGCATA GTCTAAAAAA GATGTATTTC 1001 ATGCATTAGT TTTTAGCAAA TGAAAGTTCT CATTCAATTT TCCCAAATCA 1051 AGACAAAAAG ACCGCATAAA ATGGGAAATG ATGAAGGTTT TGCACAAATA

PAGE 104

93 1101 CTTTATTTTA CCCCTTAAGT GTTGTACTTT ATTCACCGAG CATCTATTCC 1151 CATTTTTGAT ACACCTATCC ACACTATCTC TAATGTATTC ACTTGCTTAG 1201 GCTATATTAT CCTTGTCTTA ATGGGTGCGA TGAACTTATA ATGCTAGAAC 1251 AATGTCGGTA GCTACTACTT TCCAATGAGA GCACATGGAC TATGTCTTGC 1301 TTCTTGATTA GCTGCATAAT TTTCACCTTT CCAATTCTTT GTCCAGAATT 1351 TTTTTGGTAT GGTTATGTTC TATGTTGCTC AGACTCTGGT GTCGGTATCT 1401 GATATAGGTA CAGATCTAGA AGTCAGATCC TTCCATTATA TAAATTTTAG 1451 GATTCAGGGT TATTGATACG GGGTGCTATG ATATGGTCAA TAATTGTATA 1501 TCATGACATA TAAAGTATAA ATTTGATTAA TTAAAGTTAT TGAACTAGAA 1551 ATAACAAAAT TTAATTCTTT ATAAACACCT GATATATTCA TAAGATATCT 1601 CGTGTAATAG CGAAGCCTTT TCATACTTTA TATAACCATA TATATGACAT 1651 AAACCCAAAT ATCAAACCAA ATAGCCAATC AATCTGTACA CCTCGATCAT 1701 AGATGTAGTC AAAGCACCCA AAGTAAGTTT GCCAACTCCT ATGTCAATCC 1751 CACAACGTCA TGGGTGCGGT CGGGACTTTA AAGATTCTGA GCAACATAAA 1801 TATGTCAATA AATTCTAATG TTGGAAGCCT TATGACTTGA AACATATTGC 1851 TGAAGCATCC ATTAAATGAA TAGGTAATGC ATACAGAAGA CATGCATTCC 1901 ACCCTCCTAT TTATTGAAAA TTTACCAATA AGAAGTTTCT TCAGTAGAAC 1951 ACCCCCCACC CCCAAGTAAA TGTTTAAGGA GTGGATAATG TTGCCTGTAA 2001 ATAAATAATT AAAGATAGTC GCATAATATC AGAGTGATTA GAAGGAGAAA 2051 GAAGACAGAA CTAATAGATA AGTTATATGG GAGATGAGTT TTCGTTCTTT 2101 TACTTACCTC ATTTAATTTA CTTGGAACTG AAAGGAACAT TGGTGCACAG 2151 AATTGCAACT TAAGAATGAT TATTTCTCTT TGTAATCATC ATGGGCAATT 2201 TTGTCTACAG ATAAATGCAT TAATTGCAGT GCGGGTAAGG ATGTTTAGGT 2251 GCGTTAATAG CTGCTCTCTT TTGTCAATTG GATTCTACTC CATTCTTAAA 2301 TTTATGCTGG TTTTCTGTCC AATCTTTGCC CTTGCTTTCT ATTTTGCTCT 2351 CTGAAGTTAC TTTGTATTAG CAACCCTAAC AGAACAAGAC TGCTACGTGT 2401 TGTTTACTGG ATCCATGACA CAAATTAGAA CTTGTCCATA TCAGTTTTGA 2451 ATTAGAATTC TGTCATTTTA AGTACAATCA TGTAATAGTA ACAGAACAAG

PAGE 105

94 2501 GCTGCTACAT GTCATTATCT GAAGAACAGA AATTAGAACT TTTGCATTTG 2551 ATTTCTTATT AGCATTGTCA TTTAAGTAAG TGTAATTGCT TATCAGGTTG 2601 CTGTCGCTCT TTCACATGCT GCAATTTTAG AAGATTCCAT GCGAGCCCAT 2651 GATCAGCTCA TGGAACAGAA TATTGCTTTG GATGTAGCTC GACAAGAAGC 2701 AGAGATGGCC ATCCGTGCAC GTAACGACTT CCTTGCTGTG ATGAACCATG 2751 AAATGAGAAC GCCCATGCAT GCAGTTATTG CTCTGTGCTC TCTGCTTTTA 2801 GAAACAGACT TAACTCCAGA GCAGAGAGTT ATGATTGAGA CCATATTGAA 2851 GAGCAGCAAT CTTCTTGCAA CACTGATAAA TGATGTTCTA GATCTTTCTA 2901 GACTTGAAGA TGGTATTCTT GAACTAGAAA ACGGAACATT CAATCTTCAT 2951 GGCATCTTAA GAGAGGTATA TGACGACAAA CCTATGCTAT ATCTAGCATA 3001 CACTGGTAAT ATGTTGATTT TCTCTAGTAA ACAGGTAGCA TGAATTCATT 3051 CTTTACATTG ATTTGCAGGC CGTTAATTTG ATAAAGCCAA TTGCATCTTT 3101 GAAGAAATTA TCTATAACTC TTGCTTTGGC TCTGGATTTA CCTATTCTTG 3151 CTGTGGGTGA TGCAAAACGT CTTATCCAAA CTCTCTTAAA CGTGGCGGGA 3201 AATGCTGTGA AGTTCACTAA AGAAGGACAT ATTTCAATTG AGGCTTCAGT 3251 TGCCAAACCA GAGTATGCGA GAGATTGTCA TCCTCCTGAA ATGTTCCCTA 3301 TGCCAAGTGA TGGCCAGTTT TATTTGCGTG TCCAGGTTGA GCATTTCTAT 3351 CCTCTTATCA TGGCTTAGTG GTTGTACTGT GTTTCTTCAT GAAATGAGTT 3401 TGCATACAAA TGCATGCAGT TCTAAGAGCT GTTTGTTGGC TCGTTCAGGG 3451 AAAAAGTGTC ATTTGTTCCA AAGCCAGCAA AGAATCAGGA TACAAATTGA 3501 AACCCTCTTT GAATGCTAAA TCTTTCTATT AAATGTGAAC ATTTATGTTT 3551 TCCTCTTCCC TTCAGATTGT CCGTGTATTT CAGAACAGAA TCTCCTTTTG 3601 TTTTCAGTTA CTTTTATCGT TGTAGGAGGT TTACTTTGCA GTTCTGGATT 3651 GTTTATTTCG TCTCAAGTTG AATATCATTC AGAAAGGAGA TCCCAAACTT 3701 GAAAATTAAT CCTGTTCAGA TTATGTTCTT GCAGGTTAGA GATACTGGGT 3751 GTGGAATTAG CCCACAAGAT ATACCACTAG TATTCACCAA ATTTGCAGAG 3801 TCACGGCCTA CGTCAAATCG AAGTACTGGA GGGGAAGGTC TAGGGCTTGC 3851 CATTTGCAGA CGGTATGTTT CAAATTGTTA ATTCGAGATC ATCATTTTTT 3901 CCTAGTTGTC CATATTATAA AGGCTTCTAC AAGACATCCT CTGTTTACCT

PAGE 106

95 3951 TGCCTTACTC GTATGTTGCT TTGTACCTTG GTTATCATTA TTTGTACTCA 4001 TTTGACATTT GAGACGGATG GATGCAGATT TATTCAACTT ATGAAAGGTA 4051 ACATTTGGAT TGAGAGTGAG GGCCCTGGAA AGGGAACCAC TGTCACGTTT 4101 GTAGTGAAAC TCGGAATCTG TCACCATCCA AATGCATTAC CTCTGCTACC 4151 TATGCCTCCC AGAGGCAGAT TGAACAAAGG TAGCGATGAT CTCTTCAGGT 4201 ATAGACAGTT CCGTGGAGAT GATGGTGGGA TGTCTGTGAA TGCTCAACGC 4251 TATCAAAGAA GTCTGTAA LeETR4 1 ATGTTGAGGA CGTTAGCATC AGCTTTGTTG GTTTTGTCCT TCTTTGTTTC 51 CTTATCGGCT GCTGATAATG GTTTCCCGCG ATGTAACTGT GATGATGAGG 101 GATTTTGGAG CATTGAGAGT ATCTTAGAGT GCCAAAAGAT TAGTGATCTC 151 TTTATTGCGA TTGCGTATTT TTCCATCCCA ATTGAGCTCC TTTACTTTGT 201 CAGTTGTTCT AACTTTCCAT TCAAATGGGT GCTCTTCCAA TTTATTGCAT 251 TCATTGTTCT GTGTGGGATG ACTCATTTGC TCAATTTCTG GACTTACTAT 301 GGCCAACACC CGTTTCAGCT TATGCTTGCT TTAACCATTT TTAAAGTCCT 351 CACTGCACTG GTATCCTTCG CCACGGCTAT AACCCTTATT ACCCTCTTTC 401 CTATGCTGCT TAAAGTCAAG GTGAGGGAAT TTATGCTGAA AAAGAAGACT 451 TGGGATCTTG GTAGAGAAGT TGGATTAATA AAGATGCAAA AAGAAGCTGG 501 ATGGCATGTT CGGATGCTTA CACAGGAGAT TCGAAAGTCA CTTGACCGTC 551 ATACAATACT CTACACAACT CTGGTGGAGC TATCAAAGAC GCTGGATTTG 601 CATAACTGTG CTGTTTGGAA GCCCAATGAG AATAAAACTG AGATGAACCT 651 AATTCATGAG CTGAGAGACA GTAGCTTTAA TAGCGCGTAT AATTTACCTA 701 TCCCGAGAAG TGATCCAGAT GTTATACAGG TTAAGGAGAG TGACGGAGTA 751 AAGATACTTG ATGCCGACTC CCCACTTGCT GTTGCGAGTA GTGGAGGGAG 801 TAGGGAACCA GGAGCTGTGG CTGCAATTAG GATGCCGATG CTTAAAGTGT 851 CGAACTTCAA AGGTGGAACT CCTGAACTTG TCCCAGAATG TTATGCCATA 901 CTGGTTTTGG TTCTACCTAG TGAACAAGGT AGATCATGGT GCAGCCAGGA 951 AATTGAGATA GTCAGGGTTG TGGCTGATCA GGTTGCTGTG GCTCTGTCCC

PAGE 107

96 1001 ATGCTGCAAT TCTTGAAGAG TCTCAGCATA TGAGAGAAAC ATTGGAAGAG 1051 CAAAACCGAG CTCTGGAACA AGCAAAGCAG GATGCACTTA GGGCGAGTCA 1101 AGCAAGGAAT GCATTTCAGA TGGTTATGAG CCATGGTCTG AGAAGACCCA 1151 TGCACTCAAT ATTGGGTCTG CTCTCCTTGT TGCAAGATGA GAAATTGGGT 1201 AATGAGCAGC GGCTTCTTGT GGATTCAATG GTTAAAACCA GTAATGTCGT 1251 GTCAACCCTA ATAGATGATG TGATGGATAC TTCAACAAAG GACAACGGTA 1301 GATTCCCTTT GGAGATGAGA TATTTTCAGC TACATTCCAT GATAAAAGAA 1351 GCTGCTTGTC TTGCCAAGTG TTTGTGTGCT TATAGGGGTT ATAATATTTC 1401 CATTGAGGTT GACAAATCTT TGCCAAATCA TGTTCTCGGT GATGAAAGAA 1451 GAGTTTTTCA AGTTATTCTT CATATGGTTG GAAATCTTTT GAAGGACCCC 1501 AATGGAGGTC TTCTCACATT TAGGGTTCTC CCAGAAAGTG TAAGTAGGGA 1551 AGGCATTGGT GGAGCATGGA GAACAAGGAG GTCAAACTCA TCTCGTGATA 1601 ACGCCTATAT CAGGTTTGAA GTTGGAACAA GCAATAATCA TTCTCAGCCA 1651 GAGGGGACCA TGTTGCCACA TTACAGGCCA AAACGCTGCA GTAAGGAGAT 1701 GGATGAAGGC TTGAGTTTCA CTGTGTGCAG AAAGCTGGTT CAGGTATTCT 1751 ATTGCTAATA CCAGCATCTG AGTATGTATA TTCTGGAGTT TATAAACCAA 1801 AAAACTGTTT CATTTGGTTC TATTCCCTTC TTTCTGTGGT TTATAGTACA 1851 CTCAACTTTG ATAAAATCAT TCTGTTATAG GTTAAAAGAG AAAAAATGAT 1901 AGTATTACAA AAGAAAAATG ATATTTAAGC CTGACTAGTT TTTAAATTTC 1951 TACTGCAATT GGATGAGACC TTTTAAATTG TGATTTCTGG ATGGCGTTAA 2001 CTACTACAAT TTCCATGTCA AAGAAGATAA AGCAATTCAT GACCTTGATT 2051 GCCTGTCATG TAATTAAATA TGTCGTTTTC CCTGTGAATG AGAAATATGA 2101 TACTAAAGTT GCTTAAGCTG TTTGTTGCGG AACTTTTAAT CCCCATTTGT 2151 TTGGGAATGA AATCTGAAAC CACTCATACA AGTTGGTAGT ACCGTAGTAC 2201 TTGTTCTCTT TTTTCTCCCT TCGATTATAA TTTAAGTGCA TATAGTTGTG 2251 GTTTGGGGTA GGCACTAACA TCTTGCTGGT ATGCAAATAT GATGAACAGT 2301 TGATGCAAGG AGACATCTGG GTAATCCCAA ATCCAGAAGG TTTTGATCAA 2351 AGCATGGCTG TCGTTCTTGG GCTTCAACTG CGGCCATCAA TTGCCATAGG

PAGE 108

97 2401 CATTCCTGAA TATGGGGAAT CTTCTGATCA TTCGCATCCA CACTCACTCC 2451 TCCAAGGTGT TAAAGTTCTG TTAGCAGATT ATGATGACGT GAATAGAGCG 2501 GTAACAAGTA AGCTACTTGA AAAATTGGGA TGCAGTGTTT CTGCAGTTTC 2551 ATCTGGACGT GACTGTATTG GTGTTCTTAG CCCTGCTGTA TCCTCATTCC 2601 AAATCGTCCT TTTGGATCTT CACCTGCCTG ATTTGGATGG CTTCGAAGTA 2651 ACCATGAGAA TTCGGAAGTT TGGTAGCCAC AACTGGCCAT TGATAGTTGG 2701 TTTAACTGCG ACTGCTGATG AAAATGTTAC TGGAAGATGC CTGCAGATTG 2751 GAATGAATGG ACTTATTCGT AAACCAGTGC TATTGCCAGG TATCGCTGAT 2801 GAGCTTCAAA GGGTTCTGCT ACGGGGAAGT AGAATGATGT AA LeETR5 1 ATGTTGGCAA TGTTAAGGTT GTTGTTTCTG GTACTGTTGA TTTCTTTGGT 51 CATTATATCT GTTTCAGCTA ATGATGGTGA ATTCTTCAAT TGCTGTGATG 101 AAGATGGTTT TTGGAGTATA CATACTATTT TAGACTGCCA GAAAGTGAGT 151 GACTTCTTTA TTGCTGTTGC TTACTTTTCT ATCCCTCTTG AGTTGCTTTA 201 CTTCATTAGC CGCTCGAATC TTCCTTTCAA ATGGGTTCTA GTTCAGTTCA 251 TTGCTTTTAT AGTGCTTTGT GGATTGACAC ATTTGCTCAA TGGATGGACT 301 TACAATCCTC ATCCTTCTTT CCAATTGATA TTGTCCCTAA CCGTTGCGAA 351 AATCCTTACT GCCCTTGTAT CTTGTGCAAC TGCAATCACC CTTTTGACTC 401 TGATCCCTCT TCTCCTAAAG ATAAAGGTCA GAGAACTTTT TTTGGCACAG 451 AATGTTTTAG AGCTAGATCA AGAGGTTGGG ATGATGAAGA AACAAACAGA 501 AGCTAGCATG CATGTCCGTA TGTTGACACA CGAAATTAGG AAGTCACTTG 551 ATAAGCACAC AATATTATAC ACTACACTAG TTGAACTTTC GAAAACCTTA 601 AAGTTGCAGA ATTGTGCTGT TTGGATGCCA AATGAAAGTA GGTCACAGAT 651 GAACTTAACA CATGAATTAA GCCCCAGTTC TGCTGCAGAA AGTCATCGTT 701 CACTCTCAAT TAATGATCCA GATGTGTTGG AGATAACAAA GAATAAGGGA 751 GTAAGGATTC TGAGGCAAGA TTCAGTTCTT GCAGCTTCGA GCAGTGGAGG 801 ATCTGGTGAA CCATGTGCTG TTGCTGCTAT TCGGATGCCA CTGCTTCGTG 851 CTTCGGACTT CAAAGGTGGG ACTCCAGAGT TGGTTGACAC TCGTTATGCC

PAGE 109

98 901 ATTTTAGTTT TGGTTCTTTC AAGTGTTGAT GAGAGAGTCT GGAGCTATGA 951 TGAGATGGAG ATAGTGGAAG TAGTTGCTGA TCAGGTGGCT GTGGCTTTAT 1001 CCCATGCCAC TGTTCTTGAA GAGTCTCAGA CGATGAGGGA GAAACTAGAA 1051 ATGAGAAATC GTGTGCTTCA GCAGGCTCAA GAGAATGCTA TGAAGGCAAG 1101 CCAGGCAAGG ACTTCGTTTC AGAAGGTGAT GAACAATGGT ATGAGGCGGC 1151 CTATGCACTC AATCTTGGGT TTGCTCTCCA TATTTCAAGA TGAGAAAGCC 1201 AGTTCTGACC AGAGGATGAT TGTTGACACA ATGGTGAAAA CAAGCACTGT 1251 TCTCTCAACA CTAATAAATG ACGCAATGGA GATATCTGCA AAAGATGATG 1301 GAAGGTTTCC AGTAGAAATG AAGCCCTTTC AGTTGCATTT ACTGGTCAGG 1351 GAGGCTTCTT GTCTTGTTAA GTGTTTGTGT GTCTATAAGG GATTTGGGTT 1401 TTCTACAGAT GTTCCCACTT CTTTGCCTAA TCAGGTGATG GGCGATGAAA 1451 AGAGAACTTT TCAGGTTTTA TTACATATGG TAGGACACTT ATTAAATGTC 1501 AGCATTGGTA AGGGCTCTGT TATATTCAGA GTCGTTCTAG AGACTGGAGC 1551 TGAGACTGGG AATGACAAAG TTTGGGGAAC AAGAAGACCA AGCACGACAG 1601 ACGAATATGT GACCATAAAA TTTGAAATTG AGGTTAGCCT TGAAGGCTCT 1651 CAATCTGATA GCTCAATCTC GACTATTCAC TTTGGTGGAA GAAGGCATAA 1701 CAGCAAGGAA GTAACGGAGG GCTTGAGTTT CAACATGTGC AAAAAGCTTG 1751 TTCAGGTTGG TTAGAATACT TGATATTGTT TCCCGATTGT TCTTTTTGTT 1801 ATGTTGTCAT TCAGATTGGT TCATCTTGCT AACAAGTATC TGTATATGAT 1851 TAGAGCTCTT GATCATGAAT AAGAAGTAAT GTTCATGGGT TGTGTGATAT 1901 TCATATGTGT TGGCATGTAG GTCTCCCTGT TGGTATTGAC TATGTCTTTA 1951 CCTAGAGAAT TAGGGGTAAG TCTGAGCTGC ATACTATAAT TGTAGTGGTA 2001 GAGAAAAATA GCAAAGCGAG TTCATGGAAG TAGTCTGAAA TGGAGAGAGT 2051 ACACATCATA ATCTAATTTT AGATTGTTAA AATGTGACGA TTTGTAGAAG 2101 TGTACCAAAC ATTTAAACAT CCTAAGGTGG AAAATTCATA AACTTAAAAT 2151 GGTCAGAGGA GTTGCATGTT CTTGCACAAA AATTGTCCCT AGGTTTCTAA 2201 GAAATGCCAC ACAATTTCAA ATTATTTGAG TTGAATTTGA AGGATCTATC 2251 CTACTCCCTT AGGGTTCAGG TAACCGGTAG GATCACCTAT TAAGAGAAAG 2301 AAGGAGAGGA ACTTGAAAAG GGGGTGTTTG AATTGGCTTT TCTAAAAGTA

PAGE 110

99 2351 TCTTATAAGC TAAAAAGTAA AATCCATAAA TTGGGAATAC TGAATTTTCG 2401 GCTTTTAGCT TATTTTTGTA CTTTTTCAGC CTAAAAGAAA GTGCTTAAAG 2451 GCACTGAGTG TCTTTCCCAA ACACCTTCCA AAAATTAGAA AGAGCTTTAA 2501 AGCCAAAAAC TACTTAAAAT GAGCCAATCC AAACACCCAC TAATTGAAAA 2551 TGTAACCTCC CCTCTTTCTT ATTGACTACT GCTTAGCTGA ATGATCTCAG 2601 AGAATAAGAT GCAGCTTGAG GATTTCTTTC TTGTGCAGAA GATGGTTCTT 2651 TAATACCTCT TCATCTGTAA ATCTTTGGTA AAGAGCTTTG TAGGATGCAA 2701 TATGCCAGGA TGATTTTTGT CCGGTTTCCT CAAGTTTACC TATTAACTGC 2751 CAAATCTTCC ATATGTTCAT ATTATGCTGG CATCAACCTC TTCGTGTTTA 2801 TGTTCTAGTA GAACCAATTC GGAGGGAGAA AGTATATGCA ATTAGAACCC 2851 TCATGACTTG AGAAACTGAA GTTATATTTC TTTAGAACTC TATCTTACCT 2901 ATAAATAAAA TTGAAATAGG GAGAGACCTG AAACCCATGA AGAGACTGAC 2951 TACCAAAAAC ATAGCATGTA AGTCAGCCTT ATACTGACAA GAGTAGGACT 3001 GATTTTTTTA ATTCCTTTTG CTAACAGTGG TGTCCGAGCC ATCTTGGTGC 3051 GCACCCCGAG TCCTCAACTA ATTCATGTGA GACAGGCTAC CTTTCACCAA 3101 CATAGATACC GGGTAACCTT GTTCATAAAA ACTTGGACAG ATGGAATCAT 3151 GGAAAGAAAT CACCTAGGTT TTATTGCCTT CATTGGGCTT TGAACCCGAG 3201 ACCTCATGGT TCTCAACCCA CTTCATTAAC CACTAGGCCA TACATTTGGG 3251 TCCAAAATAT GTACATTTAA TGGGTAAGAT GTTAGTTAGC TTCACCTTAG 3301 TTCCTGATGT GAAACTACAC ACAAGCATCT TCATTCAAAT AATCATTAGA 3351 TAGATATGTA GCATTCACTT CTGCTTGCAC CAGATGTGTG TGCGAGAGGG 3401 TGGGAAAGGA AGGGCTTGGA ATTGGACATA GATGAGAGTA AAAGATGTGT 3451 TCACAAGGAT GCACAGATAA AGATGTTGGC TTCAGTTTAT TTGAGCTGTA 3501 GGAACCAGTC TTTGCTGGTT TGTGGTGTGA CCTCATAGGC TCGTAGCTCT 3551 TAAACTAAAT CCGAAGTGAG CAGGAGAAGT TCAGGATTTC TTCTTTTGAT 3601 ACAAGTTTCT TGGGATTTCT TCTTTTGTAA ATAATATTGG CAGAACTTAT 3651 AAGAAACTCC AATATACACA GAAAATGGTA GATAGACTGG AAACCGGTAC 3701 TTGTATGTAT ATGTTAAATC AGTTAAATAG GAAGGTTGAA GAAGAAAATT

PAGE 111

100 3751 TGCTGGTTGA GCTTCTGAGG CTCAATTTCT CGATATCTAG GTTTAATGTG 3801 AGAAAATAGT AGTTTCTGAC AATTAACTGG TGTATCATAT AAATATAAAG 3851 TAGCTTCTGA CAGTGAGCTG GTGCCTATGT ATCATGTGTT TCAGATATAT 3901 ACTTTCACTG TTTATGTATC ATATAACTTC CCATGCAAAT TGGTACTCCT 3951 TGGGCTTCTG CGGACAGCAT AGCTACATCT TCTCCTTAAT CTTCTTATTA 4001 TTAATATTGG AACTTTAGTG TTGGGATTGA AGTTGCATTT GCTTTCACTG 4051 AATGAACGTT CATAAGAAGT GTGTAATATA AAGGAAGTGT TTTCAGTATG 4101 ATTTCATGCA CTCTGTCTAG GCGAGACCTT GTAAACGAAT CTAATCAGTC 4151 AATTGTCAAG AAGATTTTTA TTCCCGTGTG ACTACAGATC ATGCGATTTT 4201 GTAATTACAA TATCCATCAT TTTCTCCTTT GGGAAGAGGT TTCATCCGTA 4251 GAATTGATTT CTTAATCTGT AAAGTTTTTA GGTGCTTCTT GTAATAACAA 4301 CAATGTACCC AGTGTGATCT CATAAGTGGG GTCTGGGGAG GGTGAGGTGT 4351 ACACATACCT TACCGTTACC TTTGTGGGGT AGAGAGGTTG TTTCCAACAG 4401 ACCCTCGGCT TAGGAAAAAC ATTTTTCAAA ACAACTTTAC GATAGTTGCT 4451 GCTTATGATA TTAATAAATA ATCCAAACAG GAAAACTATT TTGTTCTTGA 4501 GTTTCTTATA TCTGTTATTT GAAGTGATAA GTTGCTTGTG AAGGTGATGA 4551 AGCAACAGCC TGGCTACCAT ATTGCTTATT CTGACCTGTA TTTTTTTTTT 4601 TTTGCATAAA ATTTCAGATG ATGCAGGGAA ATATATGGAT GTCCTCGAAT 4651 GCCCAGGGTC ATGCGCAGGG GATGACACTC ATTCTCAGAT TTCAAAAGCA 4701 GTCATCTTTT AGGAAACGCA TGTTTGAATA CAGAAATCCT TTGGAGCAAC 4751 CGATTTCTAG CACAATGTTC AGAGGCCTTC ATGTACTCCT TACTGATGAC 4801 GATGATGTAA ATAGACTGGT AACTAGAAAG CTCCTCGAAA AACTAGGTTG 4851 CCAAGTAACT GCTGTTTCAA CCGGTTTTCA ATGCCTGAGT GCTCTGGGCC 4901 CTTCACTAAC AACCTTTCAA GTACTCATCT TGGATCTTCA AATGCCAGAA 4951 ATGGATGGAT ATGAAGTGGC ATTGAGGGTG CGTAAGTTCC GCAGCCGTAG 5001 TTGGCCGTTG ATCATAGCCC TGACTGCTAG TTCAGAGGAA CAGGTTTGGG 5051 AGAAATGCCT ACAAGTGGGA ATGAATGGTC TAATAAGGAA ACCTGTTCTT 5101 CTACAAGGCT TGGCTGATGA ACTTCAACGA CTCCTTCAAA GGGGCGGCGG 5151 TGGTGATGGC TTGTGA

PAGE 112

101 LeETR6 1 ATGATGAAGA AAGTAGTATC ATGGTTGTTG TTTTTATCGA TCGTTGCTTC 51 CTTATGGGTT GTTGATGGTT ATATTGAATG TCCTTGTGAT GATAGTGATG 101 CATTTTTTAG CATGGAAACA ATGTTATTTG TTCAAAAAGC CGGTGATCTC 151 GGTATAGCAG TGGCCTATTT TTCCATCCCA ATCGAGATCA TCTACTTCGT 201 TTCCTGTTCT AGTTTTCCGT TCAAATGGGT GCTCTTTCAA TTCGGAGCAT 251 TCATTGTACT TTGTGGTTTA ACACATTTTC TCACCTTCTT GACTCATTTT 301 GGCAAATACA CATTTCACCT TATTCTTGCC CTTATTGTTT GCAAACTACT 351 CACTGCATTA GTCTCGATGC TCACCGCTAT AACACTTATG AATCTCATCC 401 CTTTGCTGCT TAAAGCCAAG GCAAGGGAGT TTATGCTGAG ACGAAAGAAT 451 CGTGAGCTTG ATCGAGAAGT TGAAAAAATA AAACAACTAG AGGAACTTGG 501 ACTGCATGTT AGGATGCTTA CCAATGAGAT CCGCAAGTCA ATTGATCGTC 551 ATACAATACT CTACACAACT CTTGTTGGGC TGTCGAAGTT ATTGAGTTTG 601 CAGAATTGTG TTATATGGAT GCCTAATGAG AACAGAACCG AGATGAAACT 651 GACTCATGAT ACTACAAGGG AGAATGTTTC CAGTGTGTAT AATGTGCCTA 701 TCCCGATCAG TGATCGAGAA GTAAAAGAGA TCAAGGGGAG TGATGATGTA 751 AAGATACTTG GTGCAGACTC CCGACTTGCT GCTGCAAGCA GTAGAGGGAG 801 TTGTGAGCCA GAATCTGTGG CTGCTATTAG GATTCCAATG CTGACGGTCT 851 CGAATTTCAG AGGTGAAACT CGTGAGATTG TCTCGCAATG TTATGCTATC 901 CTTGTTTTGG TTCAACCTTG TGGACATGGT AGGTTTTGGC TTAACCAGGA 951 AGTTGAGATA GTCAGGGCTG CAGCCGATCA AGTTGCTGTG GCGTTGTCCC 1001 ATGCTGCAGT GGTTGAAGAA TCCGAGTATA TCAAAGACAG GTTGATGGAA 1051 CAGAATCAAG CACTGCAGAA AGCAAGAGAG GAAGCTCTTA GAGCAAGTCA 1101 AGCTAGGAGT TCATTTCAGA CGGTTATGAG CCATCGATTG AGAAGACCAA 1151 TGCACTCAAT TTTGGGTCTG CTCTCGATGT TGCAGGAACA GAAGTTACGA 1201 GATGAACAAC AGCTTCTTGT GCATTCTATA ATCAAATCCA GCAATGTTGT 1251 CTCCACCCTG ATGGATGATG TGATAGTTAC TTCAACCAAG GAGAACGTAA 1301 AATTCCCATT GGAAATGAAG CATTTTCAGC TGCATTCCTT GATACGAGAA

PAGE 113

102 1351 GCTGCTTGTA CCGCCAAATC TTTGTGTATG TATAAGGGTT ACAACATCAC 1401 CATTGAGGTC GAAAAATCAT TTCCTAATAA AGTCATGGGA GACGAAAGAA 1451 GATTTTTTCA AGTTTTGCTT CATATAATTG GAAATCTTTT GAATGGCATC 1501 CACGGAGGAC ATCTTACCTT CAAAGTTCTC TCAGCAAGTG AAAACGATGT 1551 TAGTTGGAAA ACACCGAGAT CAAACTCATC CAATGACATT GTCTATATCA 1601 AGTTCGAGAT TTGCACAAAA TTTAATCGAT CTCAGTCAGA GATCACCCCT 1651 GCTCCTCCAA CATACGACAC TGAGGAGATT GAGGAGAGTT TAAGCTTTGC 1701 TGTTTGCAGG AAGTTGGTTC ATGTAAGCTT TTTATTTTCG TGTTTTTTAG 1751 TACTTCTTGA ATTTTATATC CTTATCTTAG TTAGCTATAT CAATTTTATG 1801 TCCTTATCTG GTGTGTGAAA AATGTTGAAA CAGTTGATGC AAGGAGACAT 1851 CTTTATAATC CGAAATTTAG CAGATTTTGA TCAAGGCATG GCTGTGATTG 1901 TCGGATTCCA AAGGCAGCCG TTAATTCCCT TAGGCATGTC CGAATATGTG 1951 GAGTCTTCTA ATCCCACATA TCCACATCCT GTTTTACGTG GTGTGGAGGT 2001 TCTGTTAGCT GACTATGATG ATTCGAATAG AGCTGTAACA AAGAAGATGC 2051 TCGAGAAATT GGGATGCATC GTTACTTTAG TTTCATCTGG ATATGAATGC 2101 CTCGGTGCTG TTGGCCCCGT TGTGTCCTCG TTACAAATTA TACTTTTGGA 2151 TCTTCATCTG CCTGATTTAG ATGGCTTTGA AGTTACCATG AGACTTCGAA 2201 AGCATAGAAG ACAGACCTGG CCTTTGATCA TCGGTTTAGC TGCAATTACT 2251 GATGAAGATA TCAGAAAATG CCTCAAGATC GGAATGAATG GTATCATCTG 2301 TAAACCATTG CTCTTATCAG GACTCGCCGA TGAGCTTCAG AAGGTTCTGC 2351 TTCATGCAAA CAGAGGAATG CCATGA

PAGE 114

103 APPENDIX B NEVERRIPE PROMOTER SEQUENCE The 4768 nucleotides upstream of NR ’s ATG are shown below. The site of transcription for has been predicted from cDNA clones to be around nucleotide 2015. PLACE Signal Scan ( http://www.dna.affrc.go.jp/ht docs/PLACE/signalscan.html ) was used to identify cis -acting elements in the promoter and leader sequences (Prestridge, 1991; Higo et al., 1999). Elements mentioned in Table 3-1 are shown below, identified by site number ((+) = Current Strand; (-) = Opposite Strand). Two programs were used to predict the NR promoter site: 1. PROSCAN version 1.7 ( http://bimas.cit.nih.gov/molbio/proscan/ ) predicted a promoter region on the forward strand from nucleotide 456 to 706 (underlined region) and a TATA box was found at 670. Promoter Score was 66.75 (cutoff = 53.00) (Prestridge, 1995). 2. TSSP, a promoter prediction software fo r plant sequences (RegSite Plant DB, Softberry Inc., http://www.softberry.com ), predicted three promoters in the given sequence (bold regions) with TATA boxe s at nucleotides 303, 1341 and 1769. The site of transcription initi ation for these promoters was predicted at nucleotide 326, 1375, and 1783, respectively. 1 CTAAAAGGGGGATTAGTTCTTATTTTTAATTAAATTACTGTATCCAAAAG (-)S000259 (+)S000403 (-)S000180 51 TATAAGTAAATAGGTTTAATATCAAAGCAAATTTAATTAATCTTGTTAGG (-)S000439 101 GTACTATGTCATGTTCCGTCACTTCATGTTCAAATAACAAATAAAAAAGA (-)S000024 (+)S000439 (+)S000181 151 AGAATCTAGACTCGTGGGGAGGTTAGTGGAAGACACTAGAATTCTCTAAG (+)S000292

PAGE 115

104 201 TCTTTCCTCGGAAGACTCTAGAATATTTTAGATATTTCCTAGAAAAGTTT (-)S000392 (-)S000198 (+)S000245 251 TGGAAAATCCTAGAACGTGTAGAGAATTCTAGAGAGGCATCAAAGTGTAA (+)S000198 (+)S000198 (+)S000414 (+)S000415 (-)S000415 301 AT ATTTTAGGGACTTGTGTAGTAACT TTTATTTACACTTAGACTCCTAAA (-)S000292 (-)S000259 351 AGGTAATATAAACAGAGACACTCTCATTCTAAATCACCGAATAAAGTTGT (-)S000270 (-)S000273 401 AAGCAATATTTGAAGCTTAATACAAAACATTCTTTCAAACTTCCAAATCT (-)S000245 451 TTCTAAAAAGTCTAGATTCAAAGAACTTACTTAAGTTTAGCACAAAATAT 501 TAGTAAGACTCTTTGTGATACTTAAAGCCATCAAATTTAATTGAAGGACT 551 TGTCAATTAAACTTGACATCCCTAGGATTAAACAAAATCAATAATATAAT (-)S000390 (+)S000390 (-)S000030 601 TGGCTCATATGGTTGTTGAATTGGCATTATTGTTGAACCACAAATTAACA (+)S000370 (+)S000407 (-)S000370 (-)S000407 (-)S000314 (-)S000030 (-)S000314 (-)S000256 651 TGGATAATGATATTTTGAATTATATATGGATAAATATTCTATGACTAAGG (-)S000403 (+)S000180 (+)S000198 (+)S000199 (-)S000256 (-)S000403 (+)S000180 (+)S000198 (+)S000199 (+)S000392 (+)S000442 (+)S000198 (-)S000298 (+)S000198

PAGE 116

105 701 AAAAAA TGACAATTAAAATTAATTTGATTAGATGTTTATTTTTCTAGAAT (-)S000198 (-)S000245 751 TTTATGATAATATTTTGCGATTGTTATAATATTTATCTGATCTTTCGAAT (+)S000198 (+)S000199 (-)S000198 (-)S000199 801 ATTTTTACATAATGGTTAGTATGTATATTTTTAATCATATTTCTTTACCT (-)S000408 (-)S000175 (-)S000245 (-)S000198 851 TTCGAGTAAACACTATGTGATAAAAACTTTAAGAAATAAATATCAATTAT (+)S000198 (+)S000199 (+)S000273 (+)S000245 901 AAATTACGATTATATGTTATCGATCATGATATTCATGATTATTAGCTTTT (-)S000199 951 GCTGAGTCCATAGGTTTGTGTTCTATTTATCAATGTTTACATAAAAGATA (-)S000198 (-)S000199 (+)S000198 (+)S000199 1001 ATGTTTAATCCTTAATTCGTATATAATTCTACATTCATTTAATTTCAAAA 1051 TGGTAACCCTATAAGTTTCTACTAAAATTCCGATAAAAATAGTAAGTTTA (-)S000245 (+)S000198 (+)S000199 1101 ATCAATCAATTAATATTCCTTTTTCAAATTAAAACATTAATCAATAGAGT (+)S000259 (-)S000198 (-)S000421 1151 TGTAAGTAACCATACCTCTTAAAACTTTGGGCTTGGAATGAGAAAATGAG (+)S000408 (+)S000245 (+)S000198 1201 GTAAGCTTAGAAAATGTATTTGGTGTTTTAAAGTTGTAATTTTTCTAATC (+)S000245 (+)S000198 (-)S000273 (-)S000198 (-)S000245 1251 AATAAAATAGATATCAAAAGTCTTTAAATTAATTGGATGAAAATGCTACA (+)S000198

PAGE 117

106 1301 TGTTCGAAATTTAAAGAAAATCGTGAATATAATTAGATAA AATAATATTA (+)S000245 (+)S000198 (+)S000198 (+)S000199 1351 ATGATGAAATTGAAGACAATATAAT ACAATTGAAATCAATTCCATATAAA (-)S000252 (+)S000407 (-)S000407 1401 AAGATACTTATCAAACTAGTCTTTAAATTAATTGGATGAAAACGCTACAT (-)S000124 (-)S000199 1451 GTTCGGAATTTAAAGAAAATTGTGAATATAATTAGAGAAAACAATACTAA (+)S000245 (+)S000198 (+)S000245 (+)S000185 1501 TGATAAAACTGAAGACAATATAATACAGTTGAAATCAATTACATATAAGA (+)S000198 (+)S000199 (+)S000176 (+)S000407 (-)S000409 (-)S000407 (+)S000245 1551 AAACACTTACTAAACTTTTCATGTTTTTTCGTTGTTATTTCAAAAGACAA (-)S000198 (+)S000148 (+)S000263 1601 ACACCAAACTTAAAAGTAACAAGAAAAATGAGAGATGAATTTTAACTAGA (+)S000167 (+)S000439 (+)S000245 (+)S000198 1651 TTTAAGTTTTCATAAAAAAATAAAATACTACAATTGTATTTTATTAAATT (+)S000407 (-)S000407 1701 GTCTAAAATATTTTTATCGTGTTAAAAGAAAAAGTCATTTTACCTCAGAG (-)S000198 (-)S000199 (+)S000245 (+)S000198 (-)S000198

PAGE 118

107 1751 AATTTATTAATCCAATAA TATTAATTAACTGAG CTACTAATATTCTCGGT (+)S000030 (+)S000177 (+)S000409 (-)S000176 (+)S000392 (-)S000401 1801 GATCATAAATATGACCACCAACTAAAAAAAAATGTTAACACATGTATGAA (+)S000292 (+)S000174 (+)S000407 (-)S000144 (-)S000413 (-)S000407 1851 GCTCTTCACTGTAGCAGCGTGATTCCGGTGAGTAGTTTAAGGCTTTTTTT (+)S000298 (-)S000198 (-)S000198 1901 TTTCCTCTTAATTACTTCCCTCCACTTTTAGTTGGGGAGCTTTTCTCGAT (-)S000245 (+)S000198 (+)S000199 1951 AATCGCCAAATTTCCATAAATTCAAATCAGTATATCATCGAAGAACACGA (-)S000198 2001 CGAAAATCCGATGGCCACAAGCAAAACGACAGTTCAAATTCACGGAGATT (+)S000198 2051 GTGAAAATGATAAAGTGAAGTTACGTGGAGTAGTAGTTCAGTGAAGTAGT (+)S000198 (+)S000198 (+)S000199 (-)S000273 (+)S000414 (+)S000415 (-)S000415 2101 AGATACTGAGATCGCATTCTCCGTCGTCATTTTTCACATCGAAATAGTAA (-)S000198 2151 TCTCTTTCTCAGATTTGTACTTTTTTTTTGAGTTTCTCGTTGTTTTCTCC (-)S000245 (-)S000245 (-)S000245 2201 GCTTGAATTGATACTGATCTGATTTTCATGTTTTAGGTCGTGTAAAAAAA (-)S000198 2251 TGAAAAAATTGCTGCGAGACAGGTATGTGTCGCAGCAGGAAATAGCATCT (+)S000198 (-)S000270 (+)S000198

PAGE 119

108 2301 TAAAGGAAGGAAGGAAGGAAACTCGAAAGTTACTAAAAATTTTTGGTAAT (+)S000198 2351 TAGTTGCTATGCCTGAAGTATTTAAGTTTCGGTTTGGCTGTAGATTTTTG (-)S000250 2401 AAGTTGAAACGTAAAAATTTGAGTTTTTGGAGTTGTGATTTATGGAATTT (+)S000415 (-)S000415 (-)S000421 2451 GAAGTTGTGTTTAGGTATAGATTTTATTTGTAAAAAAATTGAAGTTTTGT 2501 GAGTATAAGTACCCCCAAAAATTGAAAATATTTGAAGATTAGATTTTCAA (+)S000198 (-)S000198 2551 AATTTGATCAAATACATATATGAAGATAGATTTTAAAAATCTGTGGCAAA 2601 ATGCTAGCTAAATTATCTGTTATTTATGTTTCTCTATGGTGTAACTTCTT (-)S000198 (-)S000199 (+)S000176 (-)S000245 (-)S000198 2651 TTTCTTCTTTTGTTAAATGGAATTTGATTTTGAACTGTAAATTGTAGCTT (-)S000245 (-)S000439 (-)S000181 2701 TATTTTCGATGTCCAAGGGTTTTTCAATTTGCAGATAATAGAAAGAGTGA (-)S000198 (-)S000198 (+)S000198 (+)S000199 (+)S000245 2751 ATTTGATTCTACCATGGTTTTGCTATTAGTGCATAAATTCCTTCCAAGTT (-)S000408 2801 GCTATTTTGATTGGGGAGAAGGATATGTGTGCTTATCTATTACTTAGAGG (-)S000030 (+)S000180 (-)S000124 (-)S000199 (+)S000198 2851 AAATGAAATTGAGTGTGAATTTGAATTGGCATGGATCCATAACCTTTTAG (-)S000030 (+)S000259 2901 ATGCATAATCTTGTAGCCTCATGGAGGTTGAAAACCCAGAGTTGCCATCT (-)S000421

PAGE 120

109 2951 AATAGATTAATCATCAGAAAACAAGCAGGTATACCTTTTGGTAAGTTCAG (+)S000245 (+)S000259 3001 GAGATAAAAAGGTATTTTCTTGCCTTGTTTTTCTTTTCGGCGTGGTAGTT (+)S000198 (+)S000199 (-)S000259 (-)S000198 (-)S000245 (-)S000198 (-)S000245 (-)S000250 3051 GAAATGTTTAACGATGGAAATGAATGTAAATTGTACCATAATTACGTAGG (+)S000198 (+)S000415 (-)S000415 3101 AGCATTCCCTCTGGAGAAATCCTATAATAGGGCAAACACCAAAAATAGCT (+)S000245 (+)S000148 (+)S000263 3151 TGGAGTTGGAGAAAAACCATGCTCTACTTGGTTTCTTGTTATTCATTCTT (-)S000421 (+)S000245 (+)S000198 (+)S000408 (-)S000408 (-)S000245 (-)S000439 3201 TCCGTATTACTATGAAAGCTTAGATATTGTAGACAGTGAATTCAAGTAAA 3251 CTATTCCTTCCGTCGGAAGATCAAGAAATTGCTACTCCCTCCGTTTCATT (-)S000153 (+)S000245 3301 ATACTTGGCACCTATTCTAGAAATGAATTTTTCTTTTTACTAGTCCATTT (+)S000392 (+)S000245 (-)S000198 (-)S000245 3351 TAGCAAACCAAGAGAATTTTATTGTTTTCTTTCTATACTACCCTTAGAAC (+)S000408 (-)S000245 (-)S000245 3401 TCTCTCTAGTCCATATTGAGTGAAATTTTAGGGGTAATTGTTCAAAGTTC (+)S000198 (+)S000314 3451 AACATAATTTTTTAAACTTCTTTCCATATTTGCACTTCTCTTTAATGAGG

PAGE 121

110 3501 TTCTTAGCTATACTTTATATTTTCTAGGATATAAATTGCACAACTTACAA (+)S000273 (-)S000198 (-)S000245 (+)S000180 3551 AGTTGTATTTACGATTTCACTTTGAATCATAAATATAACTTTGTAAGTAG 3601 TGCAATTTATCTCCTAGAAAATGTAAATATAGCTAAGAACCTCATTAAAG (-)S000198 (-)S000199 (+)S000245 (+)S000198 3651 GAAAGGACAAATATAGAAAAAAGTTTCAACAATTATCTTGAACTTTGTAT (+)S000245 (+)S000198 (+)S000314 (-)S000198 (-)S000199 3701 AGTTTCACTTATACTGAACTATGAAGAAAATCCCAAAAATTTCACTTAAT (+)S000245 (+)S000198 3751 ATGGACTAGAGAGAATACCACTTTAAATTTTTCATTTTTTCAATCTATAT (-)S000392 (+)S000273 (-)S000198 (-)S000198 3801 TTGAAATCGAAAAGTGAATTAAGAGAGCTAAGATTTCATGTATCTTGATG (-)S000314 3851 TTGAAGACACTGCTAAAATAGTTCACTACTTTGATGTTGAAGACTCTGTT (-)S000314 (+)S000176 (-)S000314 3901 GATGCTGTAGAAATTTTCTGGTTGAATTTTGAGGTTTATTATTGTGCTGA (+)S000245 (-)S000198 (-)S000245 3951 AATTTTCAATTTAAATGTTTGGCTCCAATTGTACAAACTTTTCATCATGA (-)S000198 (+)S000030 (+)S000407 (-)S000407 4001 AACTAATGTCAATCGCTTCAATACAAAACCAAAAGTTTGATGTCATGCAG (-)S000390 (+)S000408 (+)S000264

PAGE 122

111 4051 TGTAAAATTTTTACGTCGGGATTTCAAATTGCTTCCTTAACTTATACGAG (+)S000415 (-)S000415 (-)S000153 4101 TAATTATCATAATCAAATCACTAAACCTTTTAGGTAATGACTCTTTCTAC (-)S000198 (-)S000199 (+)S000259 (+)S000198 (-)S000245 4151 TTTTAAGAATAGTTTGGGAATAAGCAAAAGGGCAATAATGGAAAGTAGAC (-)S000392 (-)S000259 4201 TTTGAACTATGTTCTTGAATGTGTTTCCTAAGGAGTGTGCCAAATCCAAA 4251 AATTTCGCTCAATATGAATTAGAGGAAGCATTAAATAACCACAAATTGTA (+)S000408 4301 GTAGTAGTCAAATTTAAAGTTTCAACTGTCATCAATAAGTTTAGTTTTAA (-)S000310 (-)S000390 (+)S000409 (+)S000407 (-)S000176 (-)S000407 4351 ATACACCCCTGTAAAAGCTTTCTTAAGGGTTGTGCCTAATCAACATGGGT (-)S000245 (+)S000314 (-)S000142 (-)S000390 4401 CAAGTAAAATGAAACAAAGGAAATATTATTTTAGAATAACTGTGACAGCG (+)S000198 (-)S000392 (+)S000177 (+)S000409 (-)S000176 (-)S000422 4451 TAGGAAGCTTCTAATTTCTTTCCTTAAACTGCTAACTAGTGGTAATATTA (-)S000245 (+)S000198 4501 AAGACACAGATCAGTTTTTTTGGTTGCAATGATCAGGAACACTTGTATAA (+)S000292 (+)S000407 (-)S000407

PAGE 123

112 4551 ACGTAAAAGCAATAACTAACAAATGTATGTCCACTAACGTTTATTAATGT (+)S000415 (-)S000415 (+)S000439 (+)S000181 (+)S000407 (-)S000407 (+)S000415 (-)S000415 (+)S000270 4601 CTCTTCATTCATTATTTTTTCCCTCGAACTGCGATAAACAAATGTGTGCA (+)S000298 (-)S000198 (-)S000198 (+)S000198 (+)S000199 (+)S000407 (-)S000407 4651 CTGCACGACAAAGATGTCGTGGACAATGGTGTATGCACTTTTTATTGTCA 4701 GTTTTACTATTTATGAAGAACCATTCCTCATTCTGTCTTTTTCAGATTCT (-)S000198 4751 TTGGGACGAAACGAGATA

PAGE 124

113 APPENDIX C SEQUENCE ALIGNMENT OF THE KINAS E DOMAINS OF THE ARABIDOPSIS ETHYLENE RECEPTORS. All five Arabidopsis ethylene receptor seque nces were aligned using Pretty and the consensus sequence for 4 out of 5 sequences was determined. The conserved motifs for histidine kinases as described by Parkin son and Kofoid (1992) are noted, where: non polar (I,L,M,Q); polar (A,G,P,S,T); +, basic (H,K,R); -, acidic/amidic (D,E,N,Q). The amino acids chosen for mutagenesis are in bold. H box ERS1_kinase EAEMAVHARN DFLAVMNHEM RTPMHAIISL SSLLLETE.L SPEQRVMIET ETR1_kinase EAETAIRARN DFLAVMNHEM RTPMHAIIAL SSLLQETE.L TPEQRLMVET EIN4_kinase NAMMASQARN TCQKVMSHGM RRPMHTILGL LSMF.QSESM SLDQKIIVDA ETR2_kinase DALRASQARN AFQKTMSEGM RRPMHSILGL LSMI.QDEKL SDEQKMIVDT ERS2_kinase NALRANQAKA AFEQMMSDAM RCPVRSILGL LPLILQDGKL PENQTVIVDA Consensus -A--A--ARN -F---M---M R-PMH-I--L -S-----E-L ---Q---V-HE +-PL ERS1_kinase ILKSSNLVAT LISDVLDLSR LEDGSLL.LE NEPFSLQAIF EEVISLIKPI ETR1_kinase ILKSSNLLAT LMNDVLDLSR LEDGSLQ.LE LGTFNLHTLF REVLNLIKPI EIN4_kinase LMKTSTVLSA LINDVIDISP KDNGKS.ALE VKRFQLHSLI REAACVAKCL ETR2_kinase MVKTGNVMSN LVGDSMDV.. .PDGRF.GTE MKPFSLHRTI HEAACMARCL ERS2_kinase MRRTSELLVQ LVNNAGDIN. ..NGTIRAAE THYFSLHSVV KESACVARCL Consensus --K-S----L--D--D-----G-----E ---F-LH---E-------N box ERS1_kinase ASVKKLSTNL ILSADLPTYA IGDEKRLMQT ILNIMGNAVK FT.KEGYISI ETR1_kinase AVVKKLPITL NLAPDLPEFV VGDEKRLMQI ILNIVGNAVK FS.KQGSISV EIN4_kinase SVYKGYGFEM DVQTRLPNLV VGDEKRTFQL VMYMLGYILD ..MTDGGKTV ETR2_kinase CLCNGIRFLV DAEKSLPDNV VGDERRVFQV ILHMVGSLVK PRKRQEGSSL ERS2_kinase CMANGFGFSA EVYRALPDYV VGDDRKVFQA ILHMLGVLMN RKIK...GNV Consensus --------------LP--V VGDE-R--QIL---G------------.Q N .NA G1 box ERS1_kinase IASIMK.... ..PESLQELP SPEFFPVLSD SHFYLCVQVK DTGCGIHTQD ETR1_kinase TALVTK.... ..SDT....R AADFFVVPTG SHFYLRVKVK DSGAGINPQD EIN4_kinase TFRVICE.GT GTSQDKSKRE TGMWKSHMS. .DDSLGVKFE VEINEIQNPP ETR2_kinase MFKVLKE..R G.SLDRSDHR WAAWRSPASS ADGDVYIRFE MNVENDDSSS ERS2_kinase TFWVFPESGN SDVSERKDIQ EAVWRHCYSK EYMEVRFGFE VTAEGEESSS Consensus ---V----------------------S------------------. D-G G

PAGE 125

114 F box G2 box ERS1_kinase IPLLFTKFVQ PRTGTQRNHS GGGLG....L ALCKRFVGLM GGYMWI..ES ETR1_kinase IPKIFTKFAQ TQSLATRSSG GSGLG....L AISKRFVNLM EGNIWI..ES EIN4_kinase LDGSAMAMR. .HIPNRRYHS N.GIKEGLSL GMCRKLAQMM QGNIWISPKS ETR2_kinase QSFASVSSRD QEVGDVRFSG GYGLGQDLSF GVCKKVVQLI HGNISVVPGS ERS2_kinase SSSGSNLEEE EENP...... ........SL NACQNIVKYM QGNIRVVEDG Consensus ---------------R----G------L --C---V--M -GNI-----S F-PF G GLG L ERS1_kinase EGLEKGCTAS FIIRLGICNG PSSSSGSMAL HLAAKSQTRP WNW~ ETR1_kinase DGLGKGCTAI FDVKLGISER SNESKQSGIP KVPAIPRHSN FTG~ EIN4_kinase HGQTQSMQLV LRFQTRPSIR .RSILAGNAP ELQ.HPNSNS ILRG ETR2_kinase DGSPETMSLL LRFRRRPSIS VHGSSESPAP DHHAHPHSNS LLRG ERS2_kinase LGLVKSVSVV FRFQLRRSMM SRGGGYSGET FRTSTPPSTS H~~~ Consensus -G--------------S-------S-------P------

PAGE 126

115 LIST OF REFERENCES Abel, S., and Theologis, A. (1994). Transient transforma tion of Arabidopsis leaf protoplasts--a Versatile Experimental Sy stem to Study Gene-Expression. Plant J. 5, 421-427. Abeles, F.B., Morgan, P.W., and Saltveit, M.E. (1992). Ethylene in plant biology. (San Diego: Academic Press). Ahmad, M., Jarillo, J.A., Smirnova, O., and Cashmore, A.R. (1998). The CRY1 blue light photoreceptor of Arabidopsis intera cts with phytochrome A in vitro. Mol. Cell. 1, 939-948. Alberts, B. (2002). Molecular biology of the cel l. (New York: Garland Science). Alonso, J.M., and Ecker, J.R. (2001). The ethylene pathwa y: a paradigm for plant hormone signaling and interaction. Sci. STKE 2001, RE1. Alonso, J.M., Hirayama, T., Roman, G., Nourizadeh, S., and Ecker, J.R. (1999). EIN2, a bifunctional transdu cer of ethylene and stress responses in Arabidopsis. Science 284, 2148-2152. Aravind, L., and Ponting, C.P. (1997). The GAF domain: an evolutionary link between diverse phototransducing protei ns. Trends Biochem. Sci. 22, 458-459. Atta-Aly, M.A., Brecht, J.K., and Huber, D.J. (2000). Ethylene feedback mechanisms in tomato and strawberry fruit tissues in relation to fruit ripening and climacteric patterns. Postharvest Biol. Tech. 20, 151-162. Bilwes, A.M., Alex, L.A., Crane, B.R., and Simon, M.I. (1999). Structure of CheA, a signal-transducing histidine kinase. Cell 96, 131-141. Bleecker, A.B., Estelle, M.A., Somerville, C., and Kende, H. (1988). Insensitivity to ethylene conferred by a dominant mutati on in Arabidopsis thaliana. Science 241, 1086-1089. Bleecker, A.B., and Kende, H. (2000). Ethylene: a gaseous signal molecule in plants. Annu. Rev. Cell. Dev. Biol. 16, 1-18.

PAGE 127

116 Cancel, J.D., and Larsen, P.B. (2002). Loss-of-function mutations in the ethylene receptor ETR1 cause enhanced sensitivity and exaggerated response to ethylene in Arabidopsis. Plant Physiol. 129, 1557-1567. Chae, H.S., Faure, F., and Kieber, J.J. (2003). The eto1, eto2, and eto3 mutations and cytokinin treatment increase ethylene biosynthesis in Arabidopsis by increasing the stability of ACS protein. Plant Cell 15, 545-559. Chang, C., Kwok, S.F., Bleeck er, A.B., and Meyerowitz, E.M. (1993). Arabidopsis ethylene-response gene Etr1-similarity of product to 2-component regulators. Science 262, 539-544. Chang, C., and Meyerowitz, E.M. (1995). The ethylene hormone response in Arabidopsis--a eukaryotic 2-component si gnaling system. Proc. Natl. Acad. Sci. U. S. A. 92, 4129-4133. Chao, Q., Rothenberg, M., Solano, R., Roman, G., Terzaghi, W., and Ecker, J.R. (1997). Activation of the ethylene gas re sponse pathway in Arabidopsis by the nuclear protein ETHYLENE-INSENSIT IVE3 and related proteins. Cell 89, 11331144. Chen, Q.H.G., and Bleecker, A.B. (1995). Analysis of ethylene signal-transduction kinetics associated with seedling-growth response and chitinaseinduction in wildtype and mutant Arabidopsis. Plant Physiol. 108, 597-607. Chen, Y.F., Randlett, M.D., Fi ndell, J.L., and Schaller, G.E. (2002). Localization of the ethylene receptor ETR1 to the endoplasmic reticulum of Arabidopsis. J. Biol. Chem. 277, 19861-19866. Ciardi, J.A., Tieman, D.M., Jones, J.B., and Klee, H.J. (2001). Reduced expression of the tomato ethylene receptor gene LeETR 4 enhances the hypersensitive response to Xanthomonas campestris pv. vesicatori a. Mol. Plant Microbe Interact. 14, 487495. Ciardi, J.A., Tieman, D.M., Lund, S.T., Jones, J.B., Stall, R.E., and Klee, H.J. (2000). Response to Xanthomonas campestris pv. vesicatoria in tomato involves regulation of ethylene receptor ge ne expression. Plant Physiol. 123, 81-92. Clark, K.L., Larsen, P.B., Wang, X.X., and Chang, C. (1998). Association of the Arabidopsis CTR1 Raf-like kinase wi th the ETR1 and ERS ethylene receptors. Proc. Natl. Acad. Sci. U. S. A. 95, 9060-9060. Cosgrove, D.J., Gilroy, S., Kao, T.H., Ma, H., and Schultz, J.C. (2000). Plant Signaling 2000. Cross talk among geneticists, physiologists, and ecologists. Plant Physiol. 124, 499-506.

PAGE 128

117 D'Agostino, I.B., Deruere, J., and Kieber, J.J. (2000). Characterization of the response of the Arabidopsis response regulator gene family to cytokinin. Plant Physiol. 124, 1706-1717. Davie, J.R., Wynn, R.M., Meng, M., Huang, Y.S., Aalund, G., Chuang, D.T., and Lau, K.S. (1995). Expression and characteri zation of branched-chain alphaketoacid dehydrogenase kinase from the ra t. Is it a histidineprotein kinase? J. Biol. Chem. 270, 19861-19867. Davies, P.J. (1995). Plant hormones: physiology, bi ochemistry, and molecular biology. (Dordrecht ; London: Kluwer Academic). Dutta, R., and Inouye, M. (2000). GHKL, an emergent ATPase/kinase superfamily. Trends Biochem. Sci. 25, 24-28. Emanuelsson, O., Nielsen, H., Brunak, S., and von Heijne, G. (2000). Predicting subcellular localization of proteins based on thei r N-terminal amino acid sequence. J. Mol. Biol. 300, 1005-1016. Fankhauser, C., Yeh, K.C., Lagarias, J.C ., Zhang, H., Elich, T.D., and Chory, J. (1999). PKS1, a substrate phosphorylated by phytochrome that modulates light signaling in Arabidopsis. Science 284, 1539-1541. Gamble, R.L., Coonfield, M.L., and Schaller, G.E. (1998). Histidine kinase activity of the ETR1 ethylene receptor from Arabidopsis. Proc. Natl. Acad. Sci. U. S. A. 95, 7825-7829. Gamble, R.L., Qu, X., and Schaller, G.E. (2002). Mutational analysis of the ethylene receptor ETR1. Role of the histidine kinase domain in dominant ethylene insensitivity. Plant Physiol. 128, 1428-1438. Gao, Z., Chen, Y.F., Randlett, M.D., Zhao, X.C., Findell, J.L., Kieber, J.J., and Schaller, G.E. (2003). Localization of the Raf-like kinase CTR1 to the endoplasmic reticulum of Arabidopsis through participation in ethylene receptor signaling complexes. J. Biol. Chem. 278, 34725-34732. Gaspar, T., Kevers, C., Faivre-Rampant, O ., Crevecoeur, M., Penel, C., Greppin, H., and Dommes, J. (2003). Changing concepts in pl ant hormone action. In Vitro Cell. Dev. Biol. Plant 39, 85-106. Glazebrook, J. (2001). Genes controlling expre ssion of defense responses in Arabidopsis--2001 status. Curr. Opin. Plant Biol. 4, 301-308. Guzman, P., and Ecker, J.R. (1990). Exploiting the triple response of Arabidopsis to identify ethylene-related mutants. Plant Cell 2, 513-523.

PAGE 129

118 Hall, A.E., and Bleecker, A.B. (2003). Analysis of comb inatorial loss-of-function mutants in the Arabidopsis ethylene recep tors reveals that the ers1 etr1 double mutant has severe developmental defect s that are EIN2 dependent. Plant Cell 15, 2032-2041. Hall, A.E., Chen, Q.H.G., Findell, J.L ., Schaller, G.E., and Bleecker, A.B. (1999). The relationship between ethylene binding and dominant insensitivity conferred by mutant forms of the ETR1 ethylene receptor. Plant Physiol. 121, 291-299. Hall, A.E., Findell, J.L., Schaller, G. E., Sisler, E.C., and Bleecker, A.B. (2000). Ethylene perception by the ERS1 protei n in Arabidopsis. Plant Physiol. 123, 1449-1457. Higo, K., Ugawa, Y., Iwamoto, M., and Korenaga, T. (1999). Plant cis-acting regulatory DNA elements (PLACE) da tabase: 1999. Nucleic Acids Res. 27, 297300. Hirayama, T., Kieber, J.J., Hir ayama, N., Kogan, M., Guzman, P., Nourizadeh, S., Alonso, J.M., Dailey, W.P., Dancis, A., and Ecker, J.R. (1999). Responsive-toantagonist1, a Menkes/Wilson disease-related copper transporter, is required for ethylene signaling in Arabidopsis. Cell 97, 383-393. Hua, J., Chang, C., Sun, Q., and Meyerowitz, E.M. (1995). Ethylene insensitivity conferred by Arabidopsis Ers gene. Science 269, 1712-1714. Hua, J., and Meyerowitz, E.M. (1998). Ethylene responses are negatively regulated by a receptor gene family in Arabidopsis thaliana. Cell 94, 261-271. Hua, J., Sakai, H., Nourizadeh, S., Chen, Q.H.G., Bleecker, A.B., Ecker, J.R., and Meyerowitz, E.M. (1998). EIN4 and ERS2 are me mbers of the put ative ethylene receptor gene family in Arabidopsis. Plant Cell 10, 1321-1332. Huang, Y., Li, H., Hutchison, C.E., Laskey, J., and Kieber, J.J. (2003). .Biochemical and functional analysis of CTR1, a prot ein kinase that ne gatively regulates ethylene signaling in Arabidopsis. Plant J. 33, 221-233. Hutchison, C.E., and Kieber, J.J. (2002). Cytokinin signali ng in Arabidopsis. Plant Cell 14 Suppl, S47-59. Hwang, I., and Sheen, J. (2001). Two-component circuitr y in Arabidopsis cytokinin signal transduction. Nature 413, 383-389. Inoue, T., Higuchi, M., Hashimoto, Y., Se ki, M., Kobayashi, M., Kato, T., Tabata, S., Shinozaki, K., and Kakimoto, T. (2001). Identification of CRE1 as a cytokinin receptor from Arabidopsis. Nature 409, 1060-1063.

PAGE 130

119 Kende, H., and Zeevaart, J.A.D. (1997). The five ''classical'' plant hormones. Plant Cell 9, 1197-1210. Kieber, J.J., and Ecker, J.R. (1993). Ethylene gas--its not just for ripening any more. Trends Genet. 9, 356-362. Kieber, J.J., Rothenberg, M., Roman, G., Feldmann, K.A., and Ecker, J.R. (1993). Ctr1, a negative regulator of the ethy lene response pathway in Arabidopsis, encodes a member of the Raf fam ily of protein-kinases. Cell 72, 427-441. Koretke, K.K., Lupas, A.N., Warren, P. V., Rosenberg, M., and Brown, J.R. (2000). Evolution of two-component signal transduction. Mol. Biol. Evol. 17, 1956-1970. Lapko, V.N., Jiang, X.Y., Smith, D.L., and Song, P.S. (1999). Mass spectrometric characterization of oat phytochrome A: isoforms and posttranslational modifications. Protein Sci. 8, 1032-1044. Lashbrook, C.C., Tieman, D.M., and Klee, H.J. (1998). Differential regulation of the tomato ETR gene family throughout plant development. Plant J. 15, 243-252. Lincoln, J.E., Cordes, S., Read, E., and Fischer, R.L. (1987). Regulation of geneexpression by ethylene during Lycope rsicon esculentum (tomato) fruitdevelopment. Proc. Natl. Acad. Sci. U. S. A. 84, 2793-2797. Lincoln, J.E., and Fischer, R.L. (1988). Diverse mechanisms for the regulation of ethylene-inducible gene-expres sion. Molec. Gen. Genet. 212, 71-75. Liu, G.Z., Pi, L.Y., Walker, J.C., Ronald, P.C., and Song, W.Y. (2002). Biochemical characterization of the kinase domain of the rice disease resistance receptor-like kinase XA21. J. Biol. Chem. 277, 20264-20269. Maeda, T., Wurgler-Murphy, S.M., and Saito, H. (1994). A two-component system that regulates an osmosensing MAP kinase cascade in yeast. Nature 369, 242-245. Maeda, T., Takekawa, M., and Saito, H. (1995). Activation of yeast PBS2 MAPKK by MAPKKKs or by binding of an SH 3-containing osmosensor. Science 269, 554558. Mattoo, A., and Suttle, J.C. (1991). The plant hormone ethylene. (Boca Raton, FL: CRC Press). Mccormick, S., Niedermeyer, J., Fry, J., Barnason, A., Horsch, R., and Fraley, R. (1986). Leaf disk transformation of cultiv ated tomato (Lycopersicon esculentum) using Agrobacterium tumefaciens. Plant Cell Rep. 5, 81-84.

PAGE 131

120 Mukhopadhyay, M.J., and Sharma, A. (1991). Manganese in cell-metabolism of higher-plants. Bot. Rev. 57, 117-149. Nollen, E.A., and Morimoto, R.I. (2002). Chaperoning signaling pathways: molecular chaperones as stress-sensing 'heat shock' proteins. J. Cell Sci. 115, 2809-2816. O'Donnell, P.J., Jones, J.B., Antoine, F.R., Ciardi, J., and Klee, H.J. (2001). Ethylene-dependent salicylic acid regulates an expanded cell death response to a plant pathogen. Plant J. 25, 315-323. O'Donnell, P.J., Schmelz, E.A., Moussatche P., Lund, S.T., Jones, J.B., and Klee, H.J. (2003). Susceptible to intolerance --a range of hormonal actions in a susceptible Arabidopsis pa thogen response. Plant J. 33, 245-257. O'Neill, S.D., Nadeau, J.A., Zhang, X.S., Bui, A.Q., and Halevy, A.H. (1993). Interorgan regulation of ethylene bios ynthetic genes by pollination. Plant Cell 5, 419-432. O'Sullivan, W.J., and Smithers, G.W. (1979). Stability constants for biologically important metal-ligand comp lexes. Methods Enzymol. 63, 294-336. Ota, I.M., and Varshavsky, A. (1993). A yeast protein similar to bacterial twocomponent regulators. Science 262, 566-569. Ouaked, F., Rozhon, W., L ecourieux, D., and Hirt, H. (2003). A MAPK pathway mediates ethylene signaling in plants. EMBO J. 22, 1282-1288. Parkinson, J.S., and Kofoid, E.C. (1992). Communication m odules in bacterial signaling proteins. Annu. Rev. Genet. 26, 71-112. Perrin, D.D., and Sayce, I.G. (1967). Computer calculation of equilibrium concentrations in mixtures of metal ions and complexing species. Talanta 14, 833842. Popov, K.M., Kedishvili, N.Y., Zhao, Y., Shimomura, Y., Crabb, D.W., and Harris, R.A. (1993). Primary structure of pyruvate dehydrogenase kinase establishes a new family of eukaryotic prot ein kinases. J. Biol. Chem. 268, 26602-26606. Popov, K.M., Zhao, Y., Shimomura, Y ., Kuntz, M.J., and Harris, R.A. (1992). Branched-chain alpha-ketoacid dehydr ogenase kinase. Molecular cloning, expression, and sequence similarity with hi stidine protein kinases. J. Biol. Chem. 267, 13127-13130. Porat, R., Borochov, A., and Halevy, A.H. (1994). Pollination-induced senescence in Phalaenopsis petals--relationship of et hylene sensitivity to activity of GTPbinding proteins and protein-phos phorylation. Physiol. Plant. 90, 679-684.

PAGE 132

121 Posas, F., and Saito, H. (1998). Activation of the yeast SS K2 MAP kinase kinase kinase by the SSK1 two-component res ponse regulator. EMBO J. 17, 1385-1394. Prestridge, D.S. (1991). SIGNAL SCAN: a comput er program that scans DNA sequences for eukaryotic transcripti onal elements. Comput. Appl. Biosci. 7, 203206. Prestridge, D.S. (1995). Predicting Pol II promoter se quences using transcription factor binding sites. J. Mol. Biol. 249, 923-932. Putnam-Evans, C.L., Harmon, A.C., and Cormier, M.J. (1990). Purification and characterization of a novel calcium-depe ndent protein kinase from soybean. Biochemistry 29, 2488-2495. Riechmann, J.L., and Meyerowitz, E.M. (1998). The AP2/EREBP family of plant transcription factors. Biol. Chem. 379, 633-646. Rodriguez, F.I., Esch, J.J., Hall, A.E., Bi nder, B.M., Schaller, G.E., and Bleecker, A.B. (1999). A copper cofactor for the ethyl ene receptor ETR1 from Arabidopsis. Science 283, 996-998. Roman, G., Lubarsky, B., Kieber, J.J., Rothenberg, M., and Ecker, J.R. (1995). Genetic-analysis of ethylen e signal-transduction in Ar abidopsis thaliana--5 novel mutant loci integrated into a stress-response pathway. Genetics 139, 1393-1409. Ross, J., and O'Neill, D. (2001). New interactions betw een classical plant hormones. Trends Plant Sci. 6, 2-4. Sakai, H., Hua, J., Chen, Q.H.G., Chang, C.R., Medrano, L.J., Bleecker, A.B., and Meyerowitz, E.M. (1998). ETR2 is an ETR1-like gene involved in ethylene signaling in Arabidopsis. Proc. Natl. Acad. Sci. U. S. A. 95, 5812-5817. Satoh, S., and Esashi, Y. (1986). Inactivation of 1-ami nocyclopropane-1-carboxylic acid synthase of etiolated mung bean hypocotyl segments by its substrate, S-adenosylL-methionine. Plant Cell Physiol. 27, 285-291. Satoh, S., Mori, H., and Imaseki, H. (1993). Monomeric and dimeric forms and the mechanism-based inactivation of 1-am inocyclopropane-1-carboxylate synthase. Plant Cell Physiol. 34, 753-760. Schaller, G.E., and Bleecker, A.B. (1995). Ethylene-binding s ites generated in yeast expressing the Arabidopsis ETR1 gene. Science 270, 1809-1811. Schaller, G.E., Ladd, A.N., Lanahan, M.B., Spanbauer, J.M., and Bleecker, A.B. (1995). The ethylene response mediator ETR1 from Arabidopsis forms a disulfide-linked dimer. J. Biol. Chem. 270, 12526-12530.

PAGE 133

122 Schneider-Poetsch, H.A., Braun, B., Marx, S., and Schaumburg, A. (1991). Phytochromes and bacterial sensor pr oteins are related by structural and functional homologies. H ypothesis on phytochrome-medi ated signal-transduction. FEBS Lett. 281, 245-249. Sharrock, R.A., and Quail, P.H. (1989). Novel phytochrome se quences in Arabidopsis thaliana--structure, evolution, and diffe rential expression of a plant regulatory photoreceptor family. Genes Dev. 3, 1745-1757. Sherman, M.Y., and Goldberg, A.L. (1991). Formation in vitro of complexes between an abnormal fusion protein and the heat s hock proteins from Escherichia coli and yeast mitochondria. J. Bacteriol. 173, 7249-7256. Solano, R., Stepanova, A., Chao, Q., and Ecker, J.R. (1998). Nuclear events in ethylene signaling: a transcriptional cascade mediated by ETHYLENEINSENSITIVE3 and ETHYLENERESPONSE-FACTOR1. Genes Dev. 12, 3703-3714. Stepanova, A.N., and Ecker, J.R. (2000). Ethylene signalin g: from mutants to molecules. Curr. Opin. Plant. Biol. 3, 353-360. Stock, A.M., Robinson, V.L., and Goudreau, P.N. (2000). Two-component signal transduction. Annu. Rev. Biochem. 69, 183-215. Tatsuki, M., and Mori, H. (2001). Phosphorylation of to mato 1-aminocyclopropane-1carboxylic acid synthase, LE-ACS2, at th e C-terminal region. J. Biol. Chem. 276, 28051-28057. Thelen, J.J., Miernyk, J.A., and Randall, D.D. (2000). Pyruvate dehydrogenase kinase from Arabidopsis thaliana: a protein his tidine kinase that pho sphorylates serine residues. Biochem. J. 349, 195-201. Tieman, D.M., Ciardi, J.A., T aylor, M.G., and Klee, H.J. (2001). Members of the tomato LeEIL (EIN3-like) gene family are functionally redundant and regulate ethylene responses throughout pl ant development. Plant J. 26, 47-58. Tieman, D.M., and Klee, H.J. (1999). Differential expressi on of two novel members of the tomato ethylene-receptor family. Plant Physiol. 120, 165-172. Tieman, D.M., Taylor, M.G., Ciardi, J.A., and Klee, H.J. (2000). The tomato ethylene receptors NR and LeETR4 are negative regulators of ethylene response and exhibit functional compensation within a multigene family. Proc. Natl. Acad. Sci. U. S. A. 97, 5663-5668.

PAGE 134

123 Tuazon, P.T., Chinwah, M., and Traugh, J.A. (1998). Autophosphorylation and protein kinase activity of p21-activat ed protein kinase gamma-PAK are differentially affected by magnesium and manganese. Biochemistry 37, 1702417029. Tuganova, A., Yoder, M.D., and Popov, K.M. (2001). An essential role of Glu-243 and His-239 in the phosphotransfer reaction catalyzed by pyruvate dehydrogenase kinase. J. Biol. Chem. 276, 17994-17999. Urao, T., Miyata, S., Yamaguchi-Shinozaki, K., and Shinozaki, K. (2000). Possible His to Asp phosphorelay signaling in an Arabidopsis two-component system. FEBS Lett. 478, 227-232. Urao, T., Yamaguchi-Shinozaki, K., and Shinozaki, K. (2001). Plant histidine kinases: an emerging picture of two-component signal transduction in hormone and environmental responses. Sci. STKE 2001, RE18. Vogel, J.P., Woeste, K.E., Theologis, A., and Kieber, J.J. (1998). Recessive and dominant mutations in the ethylene bi osynthetic gene ACS5 of Arabidopsis confer cytokinin insensiti vity and ethylene overpr oduction, respectively. Proc. Natl. Acad. Sci. U. S. A. 95, 4766-4771. Vriezen, W.H., van Rijn, C.P., Voesenek, L.A., and Mariani, C. (1997). A homolog of the Arabidopsis thaliana ERS gene is actively regulated in Rumex palustris upon flooding. Plant J. 11, 1265-1271. Wang, K.L., Li, H., and Ecker, J.R. (2002). Ethylene bios ynthesis and signaling networks. Plant Cell 14 Suppl, S131-151. Wang, W., Hall, A.E., O'Malley, R., and Bleecker, A.B. (2003). Canonical histidine kinase activity of the transmitter doma in of the ETR1 ethylene receptor from Arabidopsis is not required for signal transm ission. Proc. Natl. Acad. Sci. U. S. A. 100, 352-357. Weyers, J.D.B., and Paterson, N.W. (2001). Plant hormones and the control of physiological processes. New Phytol. 152, 375-407. Wilkinson, J.Q., Lanahan, M.B., Yen, H.C., Giovannoni, J.J., and Klee, H.J. (1995). An ethylene-inducible component of si gnal transduction enc oded by never-ripe. Science 270, 1807-1809. Xie, C., Zhang, J.S., Zhou, H.L., Li, J., Zhang, Z.G., Wang, D.W., and Chen, S.Y. (2003). Serine/threonine kinase activity in the putative histidine kinase-like ethylene receptor NTHK1 from tobacco. Plant J. 33, 385-393.

PAGE 135

124 Yanagisawa, S., Yoo, S.D., and Sheen, J. (2003). Differential regulation of EIN3 stability by glucose and ethylene signalling in plants. Nature 425, 521-525. Yang, Y., Shah, J., and Klessig, D.F. (1997). Signal perception and transduction in plant defense responses. Genes. Dev. 11, 1621-1639. Yeh, K.C., and Lagarias, J.C. (1998). Eukaryotic phyto chromes: light-regulated serine/threonine protein kina ses with histidine kinase ancestry. Proc. Natl. Acad. Sci. U. S. A. 95, 13976-13981. Yen, H.C., Lee, S., Tanksley, S.D., Lanahan, M.B., Klee, H.J., and Giovannoni, J.J. (1995). The tomato Never-ripe locus regulat es ethylene-inducible gene expression and is linked to a homolog of the Arabidopsis ETR1 gene. Plant Physiol. 107, 1343-1353. Zhang, X.S., and O'Neill, S.D. (1993). Ovary and gametophyte development are coordinately regulated by auxin and ethylene following pollination. Plant Cell 5, 403-418. Zhao, X.C., Qu, X., Mathews, D.E., and Schaller, G.E. (2002). Effect of ethylene pathway mutations upon expression of the ethylene receptor ETR1 from Arabidopsis. Plant Physiol. 130, 1983-1991.

PAGE 136

125 BIOGRAPHICAL SKETCH Patricia Moussatche was born in Rio de Ja neiro, Brazil, in 1975. She demonstrated an interest in science at an early age and started her laborato ry training while still in high school. She started her undergra duate studies at the Federal Un iversity of Rio de Janeiro in 1994, majoring in biomedicine. In 1996 she moved to the United States as a Distinguished Science Scholar at Bard Colle ge, NY. While at Bard, Patricia did two summer internships at the U. of Florida, unde r the supervision of Dr. Harry Klee. After graduating with a B.A. in biology in 1998, and a brief internship at the Boyce Thompson Institute at Cornell University, she enrolled at the U. of Florida as a graduate student in the Plant Molecular and Cellular Biology Program The work detailed in this dissertation was conducted in the laboratory of Dr. Harry Klee.