<%BANNER%>

Characterization of Two Begomoviruses Isolated from Sida santaremensis Monteiro and Sida acuta Burm. f


PAGE 1

CHARACTERIZATION OF TWO BEGOMOVIRUSES ISOLATED FROM Sida santaremensis Monteiro AND Sida acuta Burm. f By HAMED ADNAN AL-AQEEL A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2003

PAGE 2

Copyright 2003 by Hamed Adnan Al-Aqeel

PAGE 3

This dedicated to my family my father Dr. Adnan, my mother Fareda and my wife Hanin.

PAGE 4

TABLE OF CONTENTS page LIST OF TABLES.............................................................................................................vi LIST OF FIGURES..........................................................................................................vii ABSTRACT.......................................................................................................................ix CHAPTER 1 HISTORY AND LITERATURE REVIEW.................................................................1 Geminivirus History.....................................................................................................1 Taxonomy and Nucleotide Functions...........................................................................3 Begomoviruses.............................................................................................................5 The Genus Sida.............................................................................................................6 Viruses Infecting Sida spp............................................................................................7 Begomoviruses Infecting Sida spp. in Florida............................................................10 2 CHARACTERIZATION OF A NEW BEGOMOVIRUS ISOLATED FROM Sida santaremensis Monteiro in Florida.............................................................................12 Materials and Methods...............................................................................................13 Virus Source........................................................................................................13 Begomovirus Detection.......................................................................................13 Cloning and Sequencing......................................................................................14 Molecular Characterization of the Virus.............................................................15 Biological characterization..................................................................................15 Biolistic inoculation.....................................................................................16 Whitefly inoculation.....................................................................................16 Detection of SiGMoV in Test Plants...................................................................17 Results.........................................................................................................................18 Phylogenetic Analysis.........................................................................................18 Nucleotide and Amino Acid Sequence Analysis.................................................19 Biological Characterization........................................................................................19 Discussion...................................................................................................................27 iv

PAGE 5

3 AN EPIDEMIC IN TOMATO CAUSED BY VARIANTS OF Sida golden mosaic virus............................................................................................................................29 Materials and Methods...............................................................................................29 Sample Source.....................................................................................................29 PCR Analysis and Restriction Analysis..............................................................29 Cloning................................................................................................................30 Gap and Blast Analysis.......................................................................................30 Phylogenetic Analysis.........................................................................................30 Results.........................................................................................................................31 Partial Sequence Analysis from Tomato and S. acuta........................................31 Phylogenetic Analysis.........................................................................................33 Discussion...................................................................................................................44 LIST OF REFERENCES...................................................................................................46 BIOGRAPHICAL SKETCH.............................................................................................51 v

PAGE 6

LIST OF TABLES Table page 2-1 Comparison of the nucleotide sequence identity of the DNA-A of Sida golden mottle virus...............................................................................................................21 2-2 Comparison of the nucleotide sequence identity of the DNA-B of Sida golden mottle virus...............................................................................................................21 2-3 Comparison of the open reading frame nucleotide and common region sequences identity of the DNA-A of Sida golden mottle virus.................................................22 2-4 Comparison of the open reading frame and common region nucleotide sequences identity of the DNA-B of Sida golden mottle virus.................................................22 2-5 Comparison of the open reading frame amino acid sequences similirity of the DNA-A of Sida golden mottle virus.........................................................................23 2-6 Comparison of the open reading frame amino acid sequences similirity of the DNA-B of Sida golden mottle virus.........................................................................23 2-7 Host range study of SiGMoV...................................................................................24 3-1 The nucleotides identity of partial sequences of SiGMV DNA-A...........................38 3-2 The nucleotides identity of partial sequences of SiGMV DNA-B...........................38 3-3 The Common region nucleotides identity of SiGMV DNA-A sequences isolated from tomato and S. acuta.........................................................................................39 3-4 The Common region nucleotides identity of SiGMV sequences isolated from tomato and S. acuta..................................................................................................39 3-6 The nucleotide identity of partial sequences DNA-B sequences isolated from tomato and S. acuta..................................................................................................41 vi

PAGE 7

LIST OF FIGURES Figure page 2-1 Sida santaremensis infected with Sida golden mottle virus showing typical........20 2-2 Phylogenic tree of complete nucleotide of a component of selected begomoviruses with SiGMoV................................................................................25 2-3 Phylogenic tree of complete nucleotide of B component of selected begomoviruses with SiGMoV................................................................................26 3-1 Partial sequence of DNA-A (S3-C7A) amplified from Sida acuta collected from Citra Field, Florida........................................................................................33 3-2 Partial sequence of DNA-A (T3-C8A) amplified from tomato plant collected from Citra Field, Florida........................................................................................34 3-3 Partial sequence of DNA-A (T5-C2A) amplified from tomato plant collected from Citra Field, Florida........................................................................................34 3-4 Partial sequence of DNA-A (T10-C8A) amplified from tomato plant collected from Citra Field, Florida........................................................................................35 3-5 Partial sequence of DNA-A (T10-C10A) amplified from tomato plant collected from Citra Field, Florida........................................................................................35 3-6 Partial sequence of DNA-A (T12-C6A) amplified from tomato plant collected from Citra Field, Florida........................................................................................36 3-7 Partial sequence of DNA-B (S3-C4B) amplified from Sida acuta collected from Citra Field, Florida.................................................................................................36 3-8 Partial sequence of DNA-B (T12-C3B) amplified from tomato plant collected from Citra Field, Florida........................................................................................37 3-9 Partial sequence of DNA-B (T12-C5B) amplified from tomato plant collected from Citra Field, Florida........................................................................................37 3-10 Partial sequence of DNA-B (T12-C7B) amplified from tomato plant collected from Citra Field, Florida........................................................................................37 vii

PAGE 8

3-11 Partial sequence of DNA-B (T12-C9B) amplified from tomato plant collected from Citra Field, Florida........................................................................................38 3-12 Phylogenic tree of partial nucleotide sequence of DNA-A of selected begomoviruses with the SiGMV and the SiGMV sequences isolated from tomato and S. acuta................................................................................................42 3-13 Phylogenic tree of partial nucleotide sequences of DNA-B of selected begomoviruses with the SiGMV and the SiGMV sequences isolated from tomato and S. acuta................................................................................................43 viii

PAGE 9

Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Master of Science Characterization of Two Begomoviruses Isolated from Sida santaremensis Monteiro and Sida acuta Burm. f. By Hamed Adnan Al-Aqeel December 2003 Chair: Jane E. Polston Major Department: Plant Pathology A new bipartite begomovirus was isolated and characterized from Sida santaremensis. The proposed name of this new begomovirus is Sida golden mottle virus (SiGMoV). The SiGMoV DNA-A is not similar to any characterized DNA-A begomovirus obtained by Blast analysis. However, the SiGMoV DNA-B shows some similarity with Tomato mottle virus and Abutilon mosaic virus. SiGMoV was able to infect Lycopersicon esculentum Mill. (FL Lanai), Phaseolus vulgaris L. (Topcrop), Gossypium hirsutum L. (elta Pine 70), Nicotiana benthamiana (Domin), and N. tabacum L (V20) based on biolistic inoculation. In fall of 2002, an epidemic was observed in a tomato field in Citra, FL. The plants in this field were 100% infected and showed symptoms of small upwardly-curled leaves with chlorotic margins, and stunting of the plants, that were nearly identical to those described for Tomato yellow leaf curl virus. The amplification of 1254-1295 nt fragment with degenerate primers PAR1c496 /PAL1v1978 and the amplification of 616-639 nt ix

PAGE 10

fragment with degenerate primers, PBL1240/PCRc154, suggests the presence of a bipartite begomovirus. Analysis of these partial sequences showed that the epidemic was caused by a strain of Sida golden mosaic virus. Gap and phylogenetic analyses showed the presence of two diverse DNA-B sequences. x

PAGE 11

CHAPTER 1 HISTORY AND LITERATURE REVIEW Geminivirus History Long before geminiviruses were identified to cause plant diseases, the symptoms caused by these viruses were noted. A poem written by the Empress Koken in Japan in 752 AD, which described the beauty of yellow veins of Eupatorium chinense L. leaves, may be the earliest record of a geminivirus [28]. For many years, plants with geminivirus-incited symptoms of yellow leaf veins and bright golden mosaics were selected and cultured long before the cause of these symptoms was known. There is a record in 1809 of the collection and movement (from the West Indies to Europe) of Abutilon sellovianum var. marmorata plants with mosaic symptoms now known to be caused by Abutilon mosaic virus [61]. Economic losses caused by geminiviruses were not described until the end of the 1800s, when several disease outbreaks that we now know to be caused by geminiviruses were reported from various locations around the globe. In 1894, cassava mosaic disease was reported in cassava in East Africa [63]. The cause of this disease is now known to be the geminivirus, African cassava mosaic virus (ACMV). Five years later, epidemics of beet curly top disease in sugar beet were reported from California [44, 61]. The cause of this disease was later identified as the geminivirus, Beet curly top virus (BCTV). A disease of maize known as streak disease was reported in South Africa in 1901 [22]. The cause of this disease is the geminivirus, Maize streak virus (MSV). 1

PAGE 12

2 The viral nature of geminiviruses was suggested in some of the earliest studies of viruses. In 1899, Beijerinck compared the mosaic symptoms of tobacco and mosaic symptoms of A. sariatum Dicks. ex Lindl. and concluded that they were related [14, 30]. Seven years later, Zimmermann suggested that the mosaic disease of cassava was caused by a virus [63]. By 1925, Story studied the symptoms and ability of leafhoppers to transmit streak disease of maize and concluded that streak disease of maize was caused by a virus which was transmitted by a leafhopper [62]. By 1931, Kirkpatrick reported the whitefly as a vector of leaf curl of cotton [39]. In approximately 1932, Ghesuiere suspected that whiteflies were the vector of the causal agent of cassava mosaic disease [63]. This suspicion was later confirmed by Storey in 1934 and Golding in 1936 [63]. The unique characteristics of geminiviruses were not clear until the 1970s, at which time geminate virus particles were observed by electron microscopy and the nature of the viral nucleic acid was determined. Bennett in 1971[48], observed small spherical bodies in filtered phloem sap of sugar beet infected with BCTV; his observation was confirmed by Mumford [48] in 1974. In 1972, Plasvic and Maramorisch observed isometric particles in thin sections of maize infected with MSV. This observation was confirmed in 1974 by Bock et al. [4]. Three years later in 1977, the nucleic acid of geminivirus was identified as a single-strand of DNA [27]. One year later, geminiviruses were recognized as a new virus group [44]. In 1978, plant viruses were classified into families. The Geminiviridae family consists of plant viruses with a single-stranded DNA (ssDNA) genome that is encapsidated into a unique geminate capsid structure [44]. Geminivirus genomes are either bipartite or monopartite. Bipartite genomes are divided into two components: A

PAGE 13

3 component (DNA-A) and B component (DNA-B). DNA-A contains the gene required for encapsidation of progeny and viral DNA replication. DNA-B contains the genes required for viral movement (for movement of viral DNA from host cytoplasm to host nucleus; and for cell-to-cell movement in infected host plants) [45, 49]. In monopartite geminiviruses, all of the genes are found in one component [45]. An intergenic region (IR) contains the common region (CR) found in all monopartite and bipartite geminiviruses. The IR is believed to play a role in the initiation of DNA replication. In bipartite genome geminivirus, the CR is highly conserved between DNA-A and DNA-B [38]. Although geminiviruses have a small genome (about 5000 nt for bipartite and about 2800 nt for monopartite viruses) and few genes, they have an efficient means of replication. The strategy of replication of the ssDNA genome begins by converting ssDNA into double-stranded DNA (dsDNA) starting at the stem loop. This dsDNA is used as a template to amplify viral dsDNA and to produce mature ssDNA in a process known as a rolling-circle replication mechanism [24]. Recently, Jeske reported recombination-dependent replication as another method of geminivirus replication [36]. Taxonomy and Nucleotide Functions Geminiviruses are currently divided into four genera (based on genome organization and structure, host range, and insect vector) [19]. The genera are Curtovirus, Topocuvirus, Mastrevirus, and Begomovirus. The Curtoviruses, type species BCTV, have a monopartite genome, are transmitted by leafhoppers, and infect dicot plants. Seven proteins are encoded by the Curtovirus genome. Three proteins are encoded on the viral-sense (v-sense) strand: the movement protein (MP) which is responsible for cell-to-cell movement; the capsid protein (CP)

PAGE 14

4 which is responsible for forming the viral capsid; and the V2 protein that converts double-stranded DNA to single-stranded DNA. Four proteins are encoded on the complementary sense (c-sense) strand: the Replication initiation protein (Rep) by which viral replication starts; the replication enhancer protein (REn); and C4 protein (which determines symptom expression). An extra open reading frame is also recognized (known as the C2) whose function is unknown [6, 24]. Topocuvirus, type species Tomato pseudo-curly top virus (TPCTV), has only one member virus that has a monopartite genome; is transmitted by the treehopper; and infects dicot plants. Six proteins are encoded by the TPCTV genome. On the v-sense strand, two proteins are encoded: the V2 and the CP. On the c-sense strand four proteins are encoded: Rep, C2, REn, and C4 [5, 6]. Mastrevirus, type species MSV is a genus that consists of viruses with a monopartite, genome that are transmitted by leafhoppers; and infect both monocots and dicots. The genome consists of two intergenic regions: one large (LIR) and one small (SIR) located on opposite sides on the viral genome. Two features are unique to this genus: the first is the presence of an ~80 nt-long DNA sequence annealed to a region within the SIR, which is present inside the viral particle. The second feature is the presence of a splicing event on the c-sense transcript. Four proteins are encoded by the genome; two on the c-sense strand (the MP and CP); and two on the v-sense strand (the Rep A protein and the Rep protein) [25, 38, 51]. Begomovirus, type species Bean golden mosaic virus (BGMV), is the largest genus in the family. The viruses in this genus are transmitted by the whitefly (Bemisia tabici) and they infect primarily dicot plants. Most begomovirus species consist of a bipartite

PAGE 15

5 genome and few are monopartite. DNA-A encodes five proteins which are the CP, on the v-sense strand, and the Rep, TrAP (a transcriptional activator), REn, and C4 on the c-sense strand. DNA-B encodes two proteins: the nuclear shuttle protein (NSP) and the MP on the c-sense and v-sense strands, respectively. [5, 18, 24, 61]. Recently small circular single stranded satellite DNAs (DNA ) have been found to be associated with some Old World monopartite begomoviruses. The DNA is about 1330 nucleotides and several have been isolated and sequenced [7, 16]. It is believed that the DNA play an important roll in the severity of the symptoms, begomovirus pathogenicity, and host range of the associated begomovirus [46]. Begomoviruses Begomoviruses can be one of the biggest threats to tomato production. In the early 1990s, 95% of tomato fields were destroyed in the Dominican Republic due to begomoviruses, primarily Tomato yellow leaf curl virus (TYLCV) [47]. In the 1991-1992 production season, the begomovirus Tomato mottle virus (ToMoV) cost the tomato growers in Florida about $140 million [47]. The whitefly Bemisia tabaci is the vector of begomoviruses. When adults feed on infected plants; virus is usually transferred with food material through the salivary canal to the mid-gut and from the mid-gut it passes into the hemolymph. The virus is then circulated with normal hemolymph. It then passes into the salivary glands. As the whitefly feeds in healthy plants, the virus is transmitted with the saliva to the plant via the salivary canal [13, 35]. The coat protein of begomoviruses has been shown to play an important role in the circulation of the virus in the vector [33].

PAGE 16

6 The Genus Sida Sida is the Greek word for a water plant, but the allusion to this genus is still unclear. According the USDA data base ( www.itis.usda.gov ), there are about 27 species of Sida worldwide. Sida is usually found in roadsides, gardens, waste places, barn yards, canal banks, and fallow and cultivated fields. The way to grow Sida is either by asexual propagation using cuttings of young green stems or by cultivation of seed under direct sun light and dry conditions. Seed of Sida spp. are covered with a thick layer of an unknown chemical that blocks water from penetrating, leaving the seed in a dormant state [55]. In 1975 Ghosal and his group were able to analyze S. cordifolia L. chemically. The chemical analyses showed S. cordifolia contains three types of chemicals: -phenethylamines (viz. -phenethylamines, ephedrine, and pseudoephedrine), carboxylated tryptamines (S-(+)-N-methyltryptophane methyl easter and hypaphorine), and quinazoline alkaloids (vasicinone, vasicinol, and vasicine). Moreover, different parts of the plant contain the same chemicals but in different concentrations. Ghosal reported the concentrations of those chemicals changed with plant age [23]. Genomic analysis of a selected Sida spp. done by Hazra showed that they have chromosome numbers that range from 2n=14 to 2n=32. In details, S. rhombifolia var. C, S. rhombifolia var. D, and S. rhombifolia var. E are 2n=14. S. acuta, S. rhombifolia var. A, and S. rhombifolia var. B are 2n=28. S. cordifolia, S. glutinosa Comm. ex Cav., and S. veronicaefolia Lam. are 2n=32 [29]. Sida plants are good source of fiber; and some Sida species are used in traditional medicine. S. rhomboidea L. and S. cordifolia are used for their anti-inflammatory activity [20, 64]. S. cordifolia contains a high amount of ephedrine and pseudoepherdrine

PAGE 17

7 components which have medical uses. In nature, Sida plants play an important roll in reducing erosion of nitrogen, organic carbon, calcium, potassium, and sodium from soil [40, 41]. Viruses Infecting Sida spp. Viruses that infect Sida spp were considered as a part of Infection Chlorosis of Malaveace virus group for many years. In the nineteenth century, the major tools used by botanists to classify and identify the causal agent of plant diseases were symptom expression, ability to see the pathogen with a microscope, and the method of transmission. Based on the presence of mosaic symptoms, inability to visualize any pathogen in infected cells [42], and transmission by grafting, a group of plant viruses was classified as one group, known as the Infectious Chlorosis of Malaveace. The written record begins with the movement of A. striatum with a mosaic symptoms to Europe from the Caribbean in 1868 [37]. One year later, Lemoine was able to transfer the Infectious Chlorosis of Malaveace to another species of Abutilon by grafting. In the same year, Masters reported the graft transmission of Infectious Chlorosis of Malaveace from A. pictum `Thompsonii` to other Malaveace species including S. napaea Cav. [30, 37]. In 1899, Beijerinck suggested the viral nature of Infectious Chlorosis of Malaveace after comparing symptom expression of A. striatum and tobacco infected with Tobacco mosaic virus (TMV) [30]. Between 1904 and 1908, Baur studied the transmission of Infectious Chlorosis of Malaveace from A. indicum L. by sap and seed. He reported the inability to transmit the symptoms by sap or seed. Interestingly, he concluded that the lack of seed or sap transmission was because the too low virus titer in the seed to produce a disease in new seedlings [37]. Today we know begomoviruses are not seed transmitted and hard to be sap transmitted. In 1926, Hein proved the Infectious Chlorosis of Malaveace cause the

PAGE 18

8 degradation of plastids and the disease move from cell-to-cell [31]. In 1927, Hertzsch was the first person to recognize variation within Infectious Chlorosis of Malaveace. He recognized the existence of two types of viruses within the Malvaceae. He call them Type A and Type B; each had a unique host range and produced different symptoms in the same hosts [37] By 1931, Cook reported from the West Indies that seeds of A. hirtum Lam. produced only healthy green seedlings, and concluded that the Infectious Chlorosis is not seed transmissible [37]. High temperature, hot water or sulphuric acid treatments, and physical disruption of seed coat are the major methods used to break the dormancy of the seed [17]. Although in 1899, Beijerinck suggested the viral nature of Infectious Chlorosis of Malaveace, the nature of this disease was not clear for many botanists. Several hypotheses were raised by scientists until the 1940s to explain Infectious Chlorosis of Malaveace. One was that the nature of Infectious Chlorosis of Malaveace was spontaneous and due to genetic crossing between white and green genes [60]. Another popular hypothesis referred to metabolic and enzymatic activity of plant cells as a reason for mosaic symptoms [59]. A third one suggested the presence of an ultramicroscopic pathogen [42] which ultimately replaced all other hypotheses by the 1940s. In 1943, Silberschmidt studied Infectious Chlorosis of Malaveace using three species of Sida showing mosaic symptoms (S. acuta, S. rhombifolia, and S. cordifolia). In his study he was able to observe the limitations of moving the symptoms from one species to another [58]. He explained these results by concluding that some species of Sida have immunity against the Infectious Chlorosis of other species. Today we know that different Sida species can be infected with different begomoviruses or different viruses. In 1945, just

PAGE 19

9 two years after Silberschmidts work, the whitefly was reported to be the vector of Infectious Chlorosis of Malaveace [11]. In 1946 Orlando and Silberschmidt published a paper proving the whitefly was the vector of Infectious Chlorosis of Malaveace using S. rhombifolia [50]. Those two papers are considered to be one of the earliest reports demonstrating the ability of the whitefly to vector a begomovirus in Western Hemisphere. The begomoviruses that infect Sida species were also considered to be strains of Abutilon mosaic virus for a time. This was because of the similar symptoms and the ability of some Sida begomoviruses to infect species of both Sida and Abutilon [11, 50]. In 1953, Costa and Bennett suggested again that the whitefly was the vector of a virus they called AbMV after studying whiteflies population on Sida sp [10]. In 1955, Costa published a study on AbMV that naturally infecting Sida (this at indication that Costa mixed between the begomoviruses infecting Sida with AbMV). He reported the ability to transmit a begomovirus infecting S. micrantha ST. Hill. and S. rhombifolia to other plants by means of whiteflies [11]. In 1960, Costa published study on the mechanical transmission of a begomovirus from Sida (which was referred to as AbMV) to selected plant hosts. He also reported on the difficulty in transmission of geminiviruses by mechanical means [12]. Species of Sida with mosaic symptoms have been reported from many locations in Latin America [3]. In Puerto Rico, S. carpinifolia L.f. with other species of Sida shows mosaic virus symptoms have been reported from different places in the island. These mosaic symptoms believed to be transmissible via whitefly [3]. In El Salvador, mosaic

PAGE 20

10 symptoms were observed in Sida spp and were shown to be transmissible to healthy Sida spp and cotton [3]. Viruses other than begomoviruses have been reported to infect species of Sida. S. alba in Zimbabwe was demonstrated to be a host of Turnip mosaic virus which belongs to the Potyviridae family [8]. In Nigeria S. acuta and S. rhombifolia were able to be inoculated with Okra mosaic virus which belongs to the Tymoviridae family [1]. Begomoviruses that infect species of Sida were not characterized until the 1990s, by which time sequencing was the primary method used to characterize and compare different begomovirus species. In 1997, Hofer et al. reported a new bipartite begomovirus which was isolated from S. rhombifolia in Costa Rica and know as Sida golden mosaic Costa Rica virus (SiGMCRV) (GenBank Accession No. X99550 and X99551) [33]. In the same year, Frischmuth et al. reported two bipartite begomoviruses with one extra DNA-B isolated from S. rhombifolia in Honduras. The first one is called Sida golden mosaic Honduras virus (SiGMHV) (GenBank Accession No. Y11097 and Y11098), the second is the Sida yellow vein virus (SiYVV) (Accession No. Y11099 and Y11100) [21], and the DNA-B has the Genbank Accession No. AJ250731 [34]. Recently, two DNA-A have been reported from Brazil from Sida spp. (Genbank Acc. No. AY090555 and AY090558) [19]. Begomoviruses Infecting Sida spp. in Florida Probably one of the earliest study on Sida begomoviruses in Florida was published in 1930 when Kunkel reported the ability of a mosaic disease to infect S. rhombifolia and other Sida spp. by budding or grafting but not by mechanical methods [43]. He also showed the this mosaic disease was not transmitted through seeds and pointed out that it resembled AbMV based on symptoms and method of transmission [43]. In 1953, Costa

PAGE 21

11 and Bennett reported that Sida spp. in Orlando, Florida, were probably infected with AbMV and hypothesis that this virus may transmissible by the whitefly (Bemisia tabaci) [10]. By 1990s, scientists in three labs at the University of Florida begin studying begomoviruses of Sida. In 1993, the laboratory of E. Hiebert in Gainesville was able to characterize a begomovirus that infects S. acuta known Sida golden mosaic virus (SiGMV) (GenBank Accession No. AF049336 and AF039841) [32]. In Homestead, partial sequences of two DNA-As from S. acuta were reported (GenBank Accession No. U77963, U77964) [19]. In Bradenton, begomovirus-like symptoms were observed in S. santaremensis.

PAGE 22

CHAPTER 2 CHARACTERIZATION OF A NEW BEGOMOVIRUS ISOLATED FROM Sida santaremensis Monteiro in Florida The genus Sida is a group of wild plants that is distributed throughout both the New and Old World [3, 9, 20, 41]. Several species of Sida have been reported as hosts of whiteflies, specifically Bemisia tabaci Genn. biotype B, as well as begomoviruses [10]. Begomoviruses, a genus of plant viruses that belong to the family Geminiviridae, are plant viruses with a single-stranded circular DNA genome. The whitefly, B. tabaci, is the only known insect vector of begomoviruses [35]. The relationship between Sida spp., begomoviruses, and whiteflies has been recognized since the 1950s [10-12]. Recently, several begomoviruses have been characterized from different species of Sida in the New World [21, 33]. In Costa Rica a bipartite begomovirus known as Sida golden mosaic Costa Rica virus (SiGMCRV) has been isolated and characterized from S. rhombifolia L. [33]. In Honduras two bipartite begomoviruses, known as Sida golden Honduras mosaic virus (SiGMHV) and Sida yellow vein virus (SiYVV), and an extra B component (DNA-B) have been isolated and characterized from S. rhombifolia [21]. In Brazil, two A components (DNA-A) have been sequenced and characterized from Sida spp. [19]. In Jamaica, a partial clone of a begomovirus was obtained from S. urens L. and partial sequences of other begomoviruses have been found in an unreported species of Sida. There are ten species of Sida found in Florida ( http://www.plantatlas.usf.edu ) and bright golden mosaic symptoms, typical of those caused by begomovirus, have been 12

PAGE 23

13 observed in several species. Several begomoviruses have been reported from S. acuta Burm. f. found in several counties. In S. acuta from Dade Co., two partial sequences of begomovirus DNA-A were obtained (Genbank Acc. No. U77963, U77964; data not published). Sida golden mosaic virus (SiGMV) was found in S. acuta in Alachua Co. (Genbank Acc. No. AF049336 and AF039841) (data not published). This study reports on the identification and characterization of a new begomovirus isolated from Sida santaremensis Monteiro in Manatee Co. FL. Materials and Methods Virus Source The virus was isolated from a plant of S. santaremensis showing bright golden mosaic symptoms (Fig. 2-2), which was originally collected from behind greenhouses located at the University of Florida, Gulf Coast Research and Education Center, Bradenton, FL. in January 1997. Plants were identified to species by curators at the Florida Museum of Natural History, University of Florida, Gainesville, FL. A culture of the virus was maintained in the greenhouse by periodically reproducing infected plants through cuttings made from young stems with symptomatic leaves. Begomovirus Detection DNA was extracted from leaves of S. santaremensis which displayed golden mosaic symptoms using a modification of a protocol reported by Doyle and Doyle [15]. The plant tissue was ground in CTAB buffer in the absence of liquid nitrogen, and DNA was precipitated in isopropanol for one hour at -20C. Degenerate primer pairs (PAR1c496/PAL1v1978, and PBL1240/PCRc154) were selected to detect begomovirus DNA [56]. PAR1c496/PAL1v1978 amplify an ~1100 bp from the begomovirus A component (DNA-A) of most bipartite begomoviruses and a ~1300 bp fragment from

PAGE 24

14 most monopartite begomoviruses. This fragment includes the 3 end of the putative Coat Protein gene (CP), the entire common region (CR), and a part of the putative Replication Association Protein gene (Rep) [56]. PBL1240/PCRc154 amplify an ~600 bp fragment from the B component (DNA-B) of most bipartite begomoviruses. This fragment includes the 3 end of the putative Nuclear Shuttle Protein gene (NSP) [65] and part of the CR sequence [56]. The PCR reaction contained 2.5 mM Mg, 50 pM of each primer, 12.5 pM of of dNTPS, 12.5 mM Spermidine, and 1U Taq polymerase. The PCR condition was started with a DNA denaturation step of 94C for 5 min. followed by 35 cycles of 60 sec. of denaturing, 60 sec. of annealing at 55C, and 60 sec. of extension at 72C. The reaction was terminated with a final extension at 72C for 5 min. The PCR reaction was carried out using gene amp PCR system 9700 or 2700 (Applied Biosystems, The Perkin Elmer Corp. Norwalk, CT). 2 Cloning and Sequencing The amplicons obtained with the above mentioned primers were cloned and sequenced. Sequences of the fragments were used to design primers using Wisconsin package (GCG) which would amplify the DNA from the remainder of the genome. After obtaining the complete sequences of DNA-A and DNA-B, a restriction map was constructed for both. In order to obtain an infectious clone, a single restriction site (ApaI) at the 5 end of the Rep gene was identified for DNA-A and a single restriction site (NcoI) in the Movement Protein gene (MP) was identified for DNA-B. The DNA extracted from leaves of S. santaremensis was, digested with the respective enzyme and a DNA fragment of 2600 bp was obtained. This DNA was gel purified using a gel purification kit (Qiagen Sciences, Germantown, MD) and cloned into plasmids. The

PAGE 25

15 linear full length DNA-A was cloned into pBluescript KS (-) [Stratagene, La Jolla, CA] and the DNA-B into pLitmus 28 (New England Biolabs, Beverly, MA). Molecular Characterization of the Virus After obtaining the complete sequences of DNA-A and DNA-B, open reading frames were determined using Vector NTI software (Infomax, Frederick, MD). Sequence comparisons were made by NCBI BLAST using the NCBI taxonomy database ( http://www.ncbi.nlm.nih.gov/ ). Based on this analysis the 13 begomoviruses with the highest nucleotide sequence identity to SiGMoV were selected for further comparisons. The nucleotide sequences of whole genomes as well as individual genes were compared. The same begomoviruses where used in the phylogenetic analysis at which the alignment of full length nucleotide sequences would begin at the ATAATT sequences of the stem loop [2]. The comparison were based on maximum parsimony using the PAUP*s heuristic method with the bisection-reconnecting branch swapping. The Bootstrap value was set to be based on 500 replicates. Display tree was with no rooting using the midpoint rooting option. Biological characterization A host range study was conducted using two methods of inoculation, biolistic inoculation with the infectious clones and whitefly inoculation. SiGMoV from S. santaremensis biolisticly which had been inoculated with the infectious clones and give a positive result for SiGMoV using PCR and dot spot hybridization. The host plants were grown from seed in a greenhouse. The host plants tested in this study were: common bean (P. vulgaris), cotton (G. hirsutum), N. benthamiana, tobacco (N. tabacum), pepper (Capsicum annuum L. Calwonder), S. santaremensis, and tomato (L. esculentum).

PAGE 26

16 Biolistic inoculation The infectious clones were grown overnight in 400 ml of 2XYT media with 1% Ampicillin and the plasmid DNA was extracted using QIAGEN Plasmid Maxi Kit (Qiagen Sciences, Germantown, MD). Approximately 5.8 g/l of the DNA-A plasmid and 2.4 g/l of DNA-B plasmid DNA were obtained. The viral insert of the DNA-A was released from the plasmid by an overnight digestion with ApaI which cut at the insertion site. NcoI was used in overnight reaction to release the DNA-B from the plasmid. The restriction reaction was stopped by precipitating the DNA using 0.1 vol. sodium acetate and 3 vol. isopropanol. The DNA was then dissolved in 50 l of water and the concentration of DNA was determined using a spectrophotometer. Both DNA-A and DNA-B were mixed together to make a total of 25.0 ng, which was bound to sterile 1.0 m in diameter spherical gold particles (Biorad, Hercules, CA). This mixture was then treated with 2.5 M calcium chloride and 0.1 M spermidine and allowed to sit for 15 minutes at room temperature. Then, it was washed with 70% isopropanol followed by 100% isopropanol. Finally the mixture was re suspended on 60l of 100% isopropanol. About 10 l of gold and DNA mixture were biolisticly inoculated into each host plant using a gene gun [57]. Whitefly inoculation A virus-free whitefly colony was established by allowing the virus-free whiteflies to feed on cotton. After 21 days, a new generation of adults was collected and used in transmission experiments. Virus-free adult whiteflies were given an acquisition access period of 3 days on SiGMoV-infected S. santaremensis. These S. santaremensis plants were three-week old plants propagated as cuttings from S. santaremensis plants that had been biolisticly

PAGE 27

17 inoculated with SiGMoV. The S. santaremensis plants used as acquisition hosts showed strong mosaic symptoms and were positive by PCR analysis for SiGMoV. The selected host plants were introduced to whiteflies that feed on S. santaremensis, and the S. santaremensis plants were shaken so that the whitefly adults could be removed. The S. santaremensis, was then isolated in a different cage. Whiteflies were given a 3 day inoculation access period which was terminated by the addition of a drench of imidacloprid, a systemic insecticide (Bayer Corp., Kansas City, Missouri). Inoculated plants were kept in an isolated cage in greenhouse. Detection of SiGMoV in Test Plants The presence of SiGMoV in test plants was determined by visual assessment of symptoms beginning two weeks after inoculation and continuing for two months in summer months. In winter months the symptoms were recorded every three weeks starting at three weeks after inoculation. Each time symptoms were recorded a leaf sample was collected from each plant and analyzed by PCR and by dot spot hybridization. Samples were tested for virus using dot spot hybridization. The full length DNA-B of the virus was used as a probe under conditions of high stringency [52]. The presence of SiGMoV was confirmed in plants testing positive by dot spot hybridization using PCR. Plant samples collected from N. benthamiana, N. tabacum, common bean, and tomato were extracted as described above. Plant samples of S. santaremensis, cotton and pepper were extracted using the protocol described by Porebski [54]. Degenerate primer pairs PAR1c496/PAL1v1978 for the DNA-A and PBL1240 and PCRc154 for DNA-B were used [56]. The homology analysis using Vector

PAGE 28

18 NTI software of those primers and SiGMoV shows that primers PAR1c496/PAL1v1978 have a homology of 91.2% and 88.8% at binding sites, and primers PBL1240/PCRc154 have the homology 87.5% and 69.7%. The positive results were further analyzed using a set of primers to specifically bind to SiGMoV. They were JAP85 3GCTCTCTCGCTCAAAAGTCTAG5 which binds in the CR of SiGMoV and the degenerate primer AC1048 [65] which binds in the 5 end of the CP and has a homology of 87.7% with SiGMoV. Results S. santaremensis (common name: moth fanpetals) is a species of Sida that was reported from Hillsborough and Pinellas counties in Florida ( http://www.plantatlas.usf.edu ). However, according to the USDA plant database S. santaremensis is not native to the U.S.A ( http://plants.usda.gov/topics.html ). This is the first report of this species of S. santaremensis in Manatee Co. Full length sequences of both DNA-A and DNA-B were obtained from symptomatic plants of S. santaremensis. The sequences were numbered beginning at the first nucleotide of the CR sequence shared by DNA-A and DNA-B. The DNA-A was found to have five open reading frame and the DNA-B was found to have two open reading frames which is an arrangement typical of many bipartite begomoviruses [19].The sequence identity of the CR (125 nt) between DNA-A and DNA-B was 95.2%. Phylogenetic Analysis The phylogenic analysis of SiGMoV DNA-A indicates that the DNA-A does not cluster with any characterized begomovirus (Fig. 2-2). However, the DNA-B clustered within the AbMV group (Fig. 2-3).

PAGE 29

19 Nucleotide and Amino Acid Sequence Analysis A comparison of SiGMoV DNA-A and DNA-B nucleotide sequences with ten other characterized begomoviruses confirmed the results obtained by the phylogenetic analysis (Tables 2-1 and 2-2). The comparison shows that DNA-A of SiGMoV nucleotide sequences identities ranged from 78.6 to 83.0% (Table 2-1.) Sida golden mosaic Honduras virus and Sida golden yellow vein virus had the greatest nucleotide sequences identity with SiGMoV. A comparison of the nucleotide sequence identities of DNA-B of SiGMoV showed a range of 66.5 to 78.3%, the most similar virus being AbMV (Table 2-2). A comparison of selected regions and open reading frames did not reveal any close relationships with other begomoviruses. The CR of DNA-A of SiGMV was somewhat similar to that of PYMV-VE (87.1%) but the CR of the DNA-B showed less identify with PYMV-VE (60.8%) than with PYMV (80.7%) (Tables 2-3 and 2-4). The comparison of open reading frames on the DNA-A with those of SiGMoV showed no significant identities (Table 2-3). Similar results were obtained using the amino acid sequence similarities of the open reading frames on DNA-A (Table 2-5). However, on DNA-B the nucleotide and amino acid sequence of the putative MP gene of SiGMoV was fairly homologous (>90%) to the MP of several characterized begomoviruses (Tables 2-4 and 2-6). Biological Characterization The biological characterization was carried out using two methods of transmission, biolistic inoculation and whitefly transmission, on selected host plants. The detection of SiGMoV was carried out using: symptom expression, PCR analysis, and dot spot hybridization. N. benthamiana, N. tabacum, S. santaremensis, bean, tomato and cotton

PAGE 30

20 were all susceptible to infection with SiGMoV by biolistic inoculation (Table 7). Viral DNA was detected by PCR and dot spot hybridization in these plants two weeks and four weeks after inoculation. However, symptoms were only observed in species, N. benthamiana, P. vulgaris, and S. santaremensis In N. benthaniana a mild mosaic was observed two weeks after inoculation. Four weeks after inoculation the symptoms observed in N. benthaniana were mosaic, leaf cupping, and shorting. In beans the symptoms appearred three weeks after inoculation and these were a mild mosaic and stunting of the plant. In whitefly transmission, only two plants were inoculated from SiGMoV-infected S. santaremensis plants. Two plants of N. tabacum were determined to be infected based on PCR and dot spot hyridization. No symptoms were produced in this plant. Figure 2-1: Sida santaremensis infected with Sida golden mottle virus showing typical mosaic symptoms. Figure 2-1. Sida santaremensis infected with Sida golden mottle virus showing typical

PAGE 31

21 Table 2-1. Comparison of the nucleotide sequence identity of the DNA-A of Sida golden mottle virus with the 13 most closely related begomoviruses identified by BLAST analysis Begomovirus ACC. NO. % Sequence Identity Sida golden mosaic virus AF049336 82.1 Sida golden mosaic Honduras virus Y11097 83.0 Chino del tomato virus-[IC] AF101476 82.1 Sida golden yellow vein virus Y11099 83.0 Potato yellow mosaic virus-Venezuela D00940 81.6 Chino del tomato virus[H6] AF226665 81.9 Tomato mottle Taino virus AF012300 79.7 Abutilon mosaic virus X15983 81.5 Abutilon mosaic virus-HW U51137 81.5 Bean dwarf mosaic virus M88179 81.5 Potato yellow mosaic Trinidad virus AF039031 78.6 Sida golden mosaic Costa Rica virus X99550 79.6 Tomato mottle virus-[Florida] L14460 79.6 ACC. No. : GenBank Accession number 1 Begomovirus sequences were selected from the first 13 sequences obtained by a Blast analysis. Table 2-2. Comparison of the nucleotide sequence identity of the DNA-B of Sida golden mottle virus with the 13 most closely related begomoviruses identified by BLAST analysis Begomovirus ACC. NO. % Sequence Identity Abutilon mosaic virus X15984 78.3 Tomato mottle virus-[Florida] L14461 77.7 Abutilon mosaic virus-HW U51138 77.0 Tomato mottle Taino virus AF012301 76.3 Sida golden mosaic virus AF049341 75.0 Sida yellow vein virus Y11100 73.4 Sida golden mosaic virus* (Honduras) AJ250731 72.7 Sida golden mosaic Honduras virus Y11098 72.6 Bean dwarf mosaic virus M88180 72.4 Sida golden mosaic Honduras virusyellow vein Y11101 72.1 Sida golden mosaic Costa Rica virus X99551 72.0 Chino del tomato virus-[IC] AF101478 70.2 Potato yellow mosaic virus-Venezuela D00941 67.8 Potato yellow mosaic Trinidad virus AF039032 66.5 Chino del tomato virus-[B52] AF226666 70.9 ACC. No. : GenBank Accession number

PAGE 32

22 Table 2-3. Comparison of the open reading frame nucleotide and common region sequences identity of the DNA-A of Sida golden mottle virus with the 13 most closely related begomoviruses identified by BLAST analysis % Sequence Identity Begomovirus CR CP Rep TrAP REn AC4 Potato yellow mosaic virus-Venezuela 87.1 82.1 83.4 78.3 80.3 67.4 Tomato mottle Taino virus 78.4 83.0 80.9 78.3 79.6 61.6 Sida golden mosaic Honduras virus 65.1 86.3 82.4 83.7 85.6 69.8 Sida golden mosaic Costa Rica virus 61.3 82.4 80.5 82.2 81.7 65.1 Sida yellow vein virus 61.6 87.5 81.7 83.0 83.3 76.7 Potato yellow mosaic Trinidad virus 61.3 82.8 78.4 79.1 81.1 64.0 Sida golden mosaic virus 60.0 87.7 81.3 81.4 82.6 67.4 Bean dwarf mosaic virus 56.5 85.3 80.4 82.0 81.1 66.3 Abutilon mosaic virus 55.7 85.5 81.3 78.9 81.1 67.4 Abutilon mosaic virus-HW 54.8 85.2 80.5 82.2 81.8 69.1 Chino del tomato virus-[H6] 54.8 86.7 80.9 83.0 83.3 64.0 Chino del tomato virus-[IC] 54.0 87.0 81.3 83.0 83.3 69.8 Tomato mottle virus-[Florida] 60.0 86.0 79.0 84.2 83.3 81.6 Table 2-4. Comparison of the open reading frame and common region nucleotide sequences identity of the DNA-B of Sida golden mottle virus with the 13 most closely related begomoviruses identified by BLAST analysis % Sequence Identity Begomovirus CR NSP MP Tomato mottle Taino virus 76.8 79.0 93.2 Sida golden mosaic virus*(Honduras) 62.4 76.3 93.5 Sida yellow vein virus 62.4 75.9 93.2 Sida golden mosaic Honduras virus 62.1 75.9 94.2 Sida golden mosaic Honduras virusyellow vein 62.1 75.9 93.5 Bean dwarf mosaic virus 58.9 77.4 92.9 Sida golden mosaic virus 58.4 82.1 94.2 Abutilon mosaic virus 57.6 75.1 93.2 Tomato mottle virus-[Florida] 57.6 80.1 93.9 Abutilon mosaic virus-HW 55.2 73.9 89.8 Chino del tomato virus-[IC] 52.8 75.5 90.5 Sida golden mosaic Costa Rica virus 52.4 74.7 91.8 Potato yellow mosaic Trinidad virus 60.8 79.5 69.1 Potato yellow mosaic virus 80.7 79.4 68.5 Chino del tomato virus-[B52] 53.6 82.9 74.8

PAGE 33

23 Table 2-5. Comparison of the open reading frame amino acid sequences similirity of the DNA-A of Sida golden mottle virus with the 13 most closely related begomoviruses identified by BLAST analysis Begomovirus CP Rep TrAP REn AC4 Abutilon mosaic virus 92.1 87.1 85.9 84.9 73.3 Abutilon mosaic virus-HW 90.4 83.9 89.9 86.4 70.9 Bean dwarf mosaic virus 93.6 86.7 85.9 87.1 72.1 Chino del tomato virus-[H6] 90.6 86.7 86.1 88.6 68.6 Potato yellow mosaic virusVenezuela 92.8 91.2 85.3 84.9 72.1 Potato yellow mosaic Trinidad virus 92.4 84.1 84.5 85.6 68.6 Sida golden mosaic virus (Honduras) 93.6 87.4 84.5 91.7 75.6 Sida golden mosaic Costa Rica virus 91.3 86.9 84.4 89.2 68.6 Sida golden mosaic virus 92.8 86.0 86.8 87.1 73.3 Sida golden mosaic Honduras virus 93.2 88.5 86.8 90.9 76.7 Sida yellow vein virus 93.6 85.4 86.8 89.4 81.4 Chino del tomato virus-[IC] 93.6 87.0 86.1 88.6 74.4 Tomato mottle Taino virus 91.6 86.2 83.7 86.4 95.1 Tomato mottle virus-Florida 92.3 85.8 85.7 86.4 65.9 Table 2-6. Comparison of the open reading frame amino acid sequences similirity of the DNA-B of Sida golden mottle virus with the 13 most closely related begomoviruses identified by BLAST analysis Begomovirus NSP MP Sida golden mosaic virus 87.2 96.3 Tomato mottle virus-Florida 85.2 96.3 Tomato mottle Taino virus 84.8 95.9 Bean dwarf mosaic virus 84.1 95.6 Sida golden mosaic virus* (Honduras) 81.7 95.2 Sida golden mosaic Honduras virus 81.7 95.9 Abutilon mosaic virus 81.3 95.9 Sida yellow vein virus 81.3 95.2 Sida golden mosaic Honduras virus-yellow vein 81.3 94.9 Chino del tomato virus-[IC] 80.9 93.9 Abutilon mosaic virus-HW 80.6 93.2 Sida golden mosaic Costa Rica virus 80.2 95.2 Potato yellow mosaic Trinidad virus 73.6 91.8 Potato yellow mosaic virusVenezuela 73.4 92.2 Chino del tomato virus-[B52] 94.2 81.0

PAGE 34

24 Table 2-7. Host range study of SiGMoV using selected plants at which number of positive SiGMoV to the total number of plant Plant Biolistic inoculation infectivity1 (infected/inoculated) Whitefly inoculation infectivity2 (infected/inoculated) Nicotiana benthamiana 8/24 0/6 N. tabacum L (V20) 9/15 2/6 Phaseolus vulgaris L. (Topcrop) 8/24 0/6 Gossypium hirsutum L. (Delta Pine 70) 20/25 0/6 Sida santaremensis Monteiro 11/12 0/0 Lycopersicon esculentum Mill. (FL Lanai) 9/25 0/6 1 25 plants were used in each biolistic inoculation and 5 were used as negative controls. 2 6 plants were used in each whiteflies transmission and 1 was used as a negative control.

PAGE 35

25 Figure 2-2. Phylogenic tree of complete nucleotide of a component of selected begomoviruses with SiGMoV. SiYVV: sida yellow vein virus, SiGMHV: Sida golden mosaic Honduras virus, SiGMCRV: Sida golden mosaic Costa Rica virus, BDMV: Bean dwarf mosaic virus, CdTV-[H6]: Chino del tomato virus-[H6], CdTV-[IC]: Chino del tomato virus-[IC], AbMV-HW: Abutilon mosaic virus-HW, AbMV: Abutilon mosaic virus, SiGMV: Sida golden mosaic virus, ToMoV-[FL]: Tomato mottle virus-Florida, SiGMoV: Sida golden mottle virus, PYMTV-TT: Potato yellow mosaic Trinidad virus, PYMV-VE: Potato yellow mosaic virusVenezuela, ToMoTV: Tomato mottle Taino virus.

PAGE 36

26 Figure 2-3. Phylogenic tree of complete nucleotide of B component of selected begomoviruses with SiGMoV. CdTV-[B52]: Chino del tomato virus-[B52], CdTV-[IC]: Chino del tomato virus-[IC], PYMTV-TT: Potato yellow mosaic Trinidad virus,, PYMV-VE: Potato yellow mosaic virusVenezuela, SiGMCRV: Sida golden mosaic Costa Rica virus, SiGMHV: Sida golden mosaic Honduras virus, SiGMHV*: B Strain of Sida golden mosaic Honduras virus, SiYVV: Sida yellow vein virus, SiGMHV-YV: Sida golden mosaic Honduras virus-yellow vein, BDMV: Bean dwarf mosaic virus, SiGMV: Sida golden mosaic virus, SiGMoV: Sida golden mottle virus, ToMoV-[FL]: Tomato mottle virus-Florida, ToMoTV: Tomato mottle Taino virus, AbMV-HW: Abutilon mosaic virus-HW, AbMV: Abutilon mosaic virus. Virus is in gene bank but there is no acronym for it.

PAGE 37

27 Discussion A new begomovirus, Sida golden mottle virus (SiGMoV) was isolated and characterized from S. santaremensis showing golden mosaic symptoms in the leaves. The nucleotide sequence identity of the CR of SiGMoV between DNA-A and DNA-B is 95.2%. The CR identity between DNA-A and DNA-B have been reported as low as 80.0% [26], also SiGMoV was able to infect and cause golden mosaic symptoms in S. santaremensis by biolistic inoculation. This suggests that the DNA-A and DNA-B are those of the same virus. Based on the results of phylogenetic analysis, nucleotide sequence and amino acid sequence comparisons, the SiGMoV DNA-A sequence was unique and was not clustered with any characterized begomovirus DNA-A sequence. Using the same analyses, the SiGMoV DNA-B sequence clustered with and shared a theoretical common ancestor with viruses in the AbMV group. The data obtained from host range study showed different results depending on method used. By biolistic inoculation, SiGMoV was able to infect L. esculentum, P. vulgaris, G. hirsutum, N. benthamiana, and N. tabacum. However, by whitefly inoculation using SiGMoV-infected S. santaremensis, SiGMoV was able to infect N. tabacum and at a lower rate of transmission than by biolistic inoculation. The method used to inoculate may influence the apparent host range. In biolistic inoculation a concentrated reproductive form of the geminivirus, double-stranded linear DNA, is bound to gold particles which are delivered directly into a variety of host plant cells using high velocity. The efficiency of biolistic inoculation is dependent upon the purity and the concentration of the DNA, and other parameters which are under the control of the researcher. However in whitefly transmission, a virion, containing a single-stranded

PAGE 38

28 circular DNA, is delivered into phloem parenchyma cells by the whitefly stylet. The efficiency of whitefly transmission is dependent upon the virus titer of the inoculum source plant, the distribution of virus within the source plant, and the feeding preference of the whiteflies, all of which are difficult to control by the researcher. These differences may explain the discrepancy between the results obtained using the two inoculation methods. These results indicate that SiGMoV can replicate in six plant species. However, it is not clear whether the whiteflies are able to transmit SiGMoV from S. santaremensis to these hosts. There is as yet no reported economic significance of SiGMoV. Even though SiGMoV is able to replicate in bean, tomato, cotton, and tobacco, no epidemics in these crops have been reported. This could be because whiteflies are not able to acquire and transmit SiGMoV from S. santaremensis to these crops. This could also be due to a limited geographic distribution of SiGMoV. The geographic distribution of SiGMoV has not been determined, but may be limited as S. santaremensis, the only known natural host of SiGMoV, has only been found in two counties in Florida. However, since SiGMoV was able to replicate in several hosts, there is a potential for SiGMoV to become a pathogen. The ability of whiteflies to acquire and transmit SiGMoV, a more extensive host range, and the geographic distribution of SiGMoV need to be established in order to better assess the potential of SiGMoV to cause crop losses.

PAGE 39

CHAPTER 3 AN EPIDEMIC IN TOMATO CAUSED BY VARIANTS OF Sida golden mosaic virus A tomato field near Citra, FL was 100% infected with a virus that produced symptoms identical to those caused by Tomato yellow leaf curl virus (TYLCV), a begomovirus found throughout Florida [53]. However, there was no identifiable source of TYLCV. This study was undertaken to identify the virus causing the symptoms in tomato and identify the source of the virus. Materials and Methods Sample Source Samples were collected from symptomatic plants of tomato and S. acuta growing in and around the tomato field. S. acuta was identified to species by curators at the Florida Museum of Natural History, University of Florida, Gainesville, FL. PCR Analysis and Restriction Analysis DNA was extracted from symptomatic plants of S. acuta [54]. The DNA was then used as a template for polymerase chain reaction (PCR). Degenerate primers, PAR1c496 /PAL1v1978, which amplify an ~1100 bp fragment of the DNA-A of most bipartite begomovirus and an ~1300 bp fragment from most monopartite begomovirus [56] were used to amplified the DNA-A. This fragment includes the 3 end of the putative Coat Protein gene (CP), the common region (CR), and part of the putative Replication Association Protein gene (Rep) [56]. Degenerate primers PBL1240/PCRc154 which amplifies an ~600 bp fragment of the begomovirus DNA-B which includes the 3 end of 29

PAGE 40

30 the putative Nuclear Shuttle Protein gene (NSP) and almost the entire CR [56, 65] were also used amplified the DNA-B. The amplicons obtained with the described primers were restricted using AluI, EcoRI, BglI, BglII, ApaI, and NcoI restriction enzymes and compared with a predicted restriction map of SiGMV generated by Vector NTI software (Infomax, Frederick, MD). Cloning One partial SiGMV variant was obtained from S. acuta. Six partial sequences of DNA-A and four partial sequences of DNA-B were obtained from tomato. The partial sequences were cloned using pGEM-T easy vector system (Promega, Madison, WI, USA 53711) and sequenced. Gap and Blast Analysis The partial begomovirus sequences obtained from S. acuta and tomato were compared using Gap method in Wisconsin package program (GCG). Sequence comparisons were made by NCBI BLAST using the NCBI taxonomy database ( http://www.ncbi.nlm.nih.gov/ ). The CR of the partial DNA-A and DNA-B sequences were determined and compared. In partial DNA-B the CR were missing at least two nucleotides. Phylogenetic Analysis The partial DNA-A and DNA-B sequences were used in phylogenetic analysis. The first 12-14 begomoviruses generated by Blast were also compared with these sequences and a phylogenic tree was constructed for DNA-A, DNA-B. [2]. The comparison were based on maximum parsimony using the PAUP*s heuristic method with the bisection-reconnecting branch swapping The Bootstrap value was set to be based on 500 replicates. Display tree was with no rooting using the midpoint rooting option.

PAGE 41

31 Results Even though the symptoms in tomato closely resembled those of TYLCV, the presence of 1254 bp to 1295 bp fragments amplified by the degenerate primers PAR1c496 /PAL1v1978 and 616 bp to 639 bp fragments amplified by the degenerate primers PBL1240/PCRc154 suggested the presence of a bipartite begomovirus. After obtaining the partial begomovirus sequences isolated from tomato and S. acuta, they were compared with each other, with SiGMV, and with known begomoviruses. The presence of S. acuta with SiGMV-like symptoms and high population of whitefly vector in and around the field suggested a possible role of SiGMV in the epidemic. A comparison of restriction enzyme patterns of DNA-A and DNA-B fragments amplified from S. acuta and tomato with the predicted restriction sites of SiGMV, indicated that the fragments amplified from S. acuta and tomato were very similar to those of SiGMV. There were 6 restriction enzyme sites predicted from SiGMV DNA-A and 5 to 7 of these sites were found in DNA-A fragments amplified from S. acuta and tomato. There were 4 restriction enzyme sites predicted from SiGMV DNA-B and 3 to 3 of these sites were found in DNA-B fragments amplified from S. acuta and tomato. Partial Sequence Analysis from Tomato and S. acuta The partial nucleotide sequences amplified from S. acuta are shown for DNA-A (Fig. 3-1) and DNA-B (Fig.3-7). The five DNA-A partial sequences amplified from tomato are presented in (Fig 3-2 3-6) and the four DNA-B partial sequences are presented in (Fig. 3-8 and 3-11). There were no significant differences among the five DNA-A sequences amplified from tomato that ranged from 97.9% to 98.7% (Table 3-1). There were no significant

PAGE 42

32 differences between the DNA-A sequences amplified from tomato and that amplified from S. acuta or SiGMV that ranged from 94.6% to 98.4% (Table 3-1). However, the nucleotide sequence identities among the four DNA-B sequences amplified from tomato and the one sequence from S. acuta were more variable than those of the DNA-A sequences, and ranged from 67.7% to 99.2% (Table 3-2). The analysis of the CR sequences of the partial sequences amplified from tomato and S. acuta showed some differences among the DNA-A sequences that ranged from 93.2% to 100% (Table 3-3) and among the DNA-B sequences that ranged from 94.5%-99.3% (Table 3-4). There were also no significant differences found between DNA-A and DNA-B CR sequences that ranged from 93.8% to 98.6% (Table 3-4). A comparison of the CR of the partial sequences (DNA-A and DNA-B) amplified from tomato and S. acuta and that of SiGMV DNA-A showed some differences that ranged from 91.7% to 95.9% (Table 3-4). The same was observed with SiGMV DNA-B CR that range from 94.5% to 96.6% (Table 3-4). The sequence analysis of DNA-A partial sequences amplified from tomato and S. acuta and characterized begomoviruses shows some similarity between partial sequences amplified from tomato and S. acuta and Tomato mottle virus[Florida] that ranged from 86.4%-87% (Table 3-5). The sequence analysis of DNA-B partial sequences amplified from tomato and S. acuta and characterized begomoviruses showed a variable similarity among partial sequences amplified from tomato and S. acuta with characterized begomovirus which can be divided into two groups. The first group shared some similarity with Tomato mottle virusFlorida with similarity of 76.1% (Table 3-6). The second group shared some

PAGE 43

33 similarity with Sida golden mosaic Costa Rica virus that ranged from 76.4%-77.9% (Table 3-6). Phylogenetic Analysis SiGMV strains DNA-A and SiGMV DNA-A cluster with Ablution mosaic virus group (Fig. 3-12). In the DNA-B Phylogenetic analysis, the SiGMV sequences are divided into two groups: the first group includes T12-C3B and T12-C9B that cluster with ToMoV-{FL] and Tomato mottle Taino virus group (Fig. 3-13). The other group includes T12-C5B and T12-C7B, SiGMV, and S3-C4B that clusters with SiGMVRV and BDMV group (Fig. 3-13). 1 TCTTGAATCA CCTTCTACTA TGAGACTTAA TGGTCTGTCT GGCCGCGCAG 51 CGGAACCTGT TCCAAAAAAT TTATCCGCCC ACTCTTGCAT CTCGTCGGGA 101 ACGTTAGTGA AAGAGGAGAG TTGAAATGGA GGAACCCACG GTTCCGGAAC 151 CTTAGCGAAT ATCCTCTCTA AGTTGGAGCG GATGTTATGA TTCTGCAAGA 201 CAAAATCCTT TGGCTGTTCT TCCCTTAAAA CCGCTAAGGC AGATTGAACA 251 GAATCTGCAT TTAACGCCTT GGGCATATGA ATCATTAGCA GTCTGCGGGC 301 CTCCTCTAGC TGATCTGCCG TCGATCTGGA ATTCTCCCCA TTCCAGTGTA 351 TCACCGTCCT TGTCGATGTA GGACTTGTCC GTCGGAGCTG GATTTAGCTC 401 CCTGNTATGT TTGGATGGAA ATGTGCTGAC CTGGTTGGGG AGACCAGATC 451 GAAGAATCTG TTATTCTTGC ACTGATATTT CCCTTCGAAC TGTATGAGCA 501 CATGGAGATG AGGCTCCCCA TTCTCGTGAA GCTCTCTGCA GATTTTGATG 551 AACTTCTTGT TCACTGGGGT ATTTAGGCTT TGTATTGGGA AAGTGCTTCT 601 TCTTTAGTCA GAGAGCACTG GGGATATGTG AGGAAATAGT TTTTGGACTG 651 AACTCGAAAT TTCTTTGGCG GGGGCATTTT TGTAATAAGA AGTGGGACTC 701 CAGTTGAGGT ACTCTAATTG AGCCCTCTCA AACTTGCTCA TTCAATTGGA 751 GTATTAGAGT CTCATATATA GTAGAACCCT CTATAGAACT CTCAATCTGG 801 TTCACACACG TGGCGGCCAT CCGGATATAG TATTACCGGA TGGCCGCGCG 851 CCCCCCCTGG TGCCGTACAC TCTCGCGCGA TCTTTAATTT CAATTAAAGA 901 TGGTCCCAGA CGCTCTCGTC CAATCAGGTC GCGTCTGACG AGTCTAGATA 951 TTTGCAACAA CTTGGGCCCT AAGTTGTTGG GTGTCTGCTA TAAATGAAAG 1001 AGACTTTGGC CCACTGCTTT TAACTCAAAA TGCCTAAGCG CGATTTGCCA 1051 TGGCGCTCTA TGGCGGGAAC CTCAAAGGTT AGCCGCAACG CTAACTATTC 1101 TCCTCGTGGA GGTAGTGGGC ACAAGAGTTA ACAAGGCCTC TGAATGGGTG 1151 AACAGG Figure 3-1. Partial sequence of DNA-A (S3-C7A) amplified from Sida acuta collected from Citra Field, Florida.

PAGE 44

34 1 GCCCACATTG TCTTTCCAGT GTCTTCCCCA TGTACAGAAA GCCATGCAGT 51 ATTATCTTCC CCGTTGCATC TGCAGGCCCA CATTGTCTTT CCTGTTCTTG 101 AATCACCTTC TACTATGAGA CTTAATGGTC TGTCTGGCCG CGCAGCGGAA 151 CCTGTTCCAA AAAATTCATC CGCCCACTCT TGCATCTCGN TCGGGAACGT 201 TAGTGAAAGA GGAGAGTTGA AATGGAGGAA CCCACGGNTT CCGGAACCTT 251 AGCGAATATC CTCTCTAAGT TGGAGCGGAT GTTATGATTC TGCAAGACAA 301 AATCCTTTGG CTGTTCTTCC CTTAAAACCG CTAAGGCAGA TTGAACAGAA 351 TCTGCATTTA ACGCCTTGGG CATATGAATC ATTAGCAGTC TGCGGGCCTC 401 CTCTCGCTGA TCTGCCGTCG ATCTGGAATT CTCCCCATTC CAGTGTATCA 451 CCGTCCTTGT TCGATGTAGG ACTTGACGTC GGAGCTGGAT TNTAGCTCCC 501 TGTTATGTTT GGATGGAAAT GTGCTGACCT GGTTGGGGAG ACCAGATCGA 551 AGAATCTGTT ATTCTTGCAC TGATATTTCC CTTCGAACTG TATGAGCACA 601 TGGAGATGAG GCTCCCCATT CTCGTGAAGC TCTCTGCAGA TTTTGATGAA 651 CTTCTTGTTC ACTGGGGTAT TAAGGCTTTG TAATNGGGAA AAGTGCTTCT 701 TCTTTAGTCA GAGAGCACTG GGGATATGTG AGGAAATAGT TTTTGGACTG 751 AACTCGAAAT TTCNTTTGCG GTGGCATTTT TGTAATAATG AGTGGGACTC 801 CAGTTGAGGT ACTCCAATTG AGCCCTCTCA AACTTGCTCA TTCAATTGGA 851 GTATTAGAGT CTCATATATA GTAGAACCCT CTATAGAACT CTCAATCTGG 901 TTCNCACACG TGGCGGCCAT CCGCTATAAT ATTACCGGAT GGCCGCGCGC 951 CCCCCCTGGT GCCGTACACT CTCGCGCGAT CTTTAATTTC AATTAAAGAT 1001 GGTCCCAGAC GCTCTCGTCC AATCAGGTCG CGTCTGACGA GTCTAGATAT 1051 TTGCAACAAC TTGGGCCCTA AGTTGTTGGG TGTCTGCTAT AAATGAAAGA 1101 TACTTTGGCC CACTGCTTTT AACTCACAAT GCCTAAGCGC GATTTGCCAT 1151 GGCGCTCTAT GGCGGGAACC TCAAAGGTTA GCCGCAACGC TAACTATTCT 1201 CCTCGTGGAG GTAGTGGGCC AAGAGTTAAC AAGGCCTCTG AATGGGTGAA 1251 CAGG Figure 3-2. Partial sequence of DNA-A (T3-C8A) amplified from tomato plant collected from Citra Field, Florida 1 TCTTGAATCA CCTTCTACTA TGAGACTTAA TGGTCTGTCT GGCCGCGCAG 51 CGGAACCTGT TCCAAAAAAT TCATCCGCCC ACTCTTGCAT CTCGTCGGGA 101 ACGTTAGTGA AAGAGGAGAG TTGAAATGGA GGAACCCACG GTTCCGGAAC 151 CTTAGCGAAT ATCCTCTCTA AGTTGGAGCG GATGTTATGA TTCTGCAAGA 201 CAAAATCCTT TGGCTGTTCT TCCCTTAAAA CCGCTAAGGC AGATTGAACA 251 GAATCTGCAT TTAACGCCTT GGCATATGAA TCATTAGCAG TCTGCGGGCC 301 TCCTCTCGCT GATCTGCCGT CGATCTGGAA TTCTCCCCAT TCCAGTGTAT 351 CACCGTCCTT GTCGATGTAG GACTTGACGT CGGAGCTGGA TTTAGCTCCC 401 TGTTATGTTT GGATGGTAAT GTGCTGACCT GGTTGGGGAG ACCAGATCGA 451 AGAATCTGTT ATTCTTGCAC TGATATTTCC CTTCGACTGT ATGAGCACAT 501 GGAGATGAGG CTCCCCATTC TCGTGAAGCT CTCTGCAGAT TTTGATGAAC 551 TTCTTGTTCA CTGGGGGTAT TTAGGCTTTG TAAATTGGGA AAGTGCTTCT 601 TCTTTAGTCA GAGAGCACTG GGGATATGTG AAGGAAATAG TTTTTGGACT 651 GAACTCCAAA ATTNCTTTGG CGGGGGCATT TTTGTAATAA TGAGTGGGAC 701 TCCAGTTGAG GTACTCCAAT TGAGCCCTCT CAAACTTGCT CATTCAATTG 751 GAGTATTAGA GTCTCATATA TAGTAGAACC CTCTATAGAA CTCTCAATCT 801 GGTTCACACA CGTGGCGGCC ATCCGCTATA ATATTACCGG ATGGCCGCGC 851 GCCCCCCCTG GTGCCGTACA CTCTCGCGCG ATCTTTAATT TCAATTAAAG 901 ATGGTCCCAG GCGCTCTCGT CCAATCAGGT CGCGTCTGAC GAGTCTAGAT 951 ATTTGCAACA ACTTAGGGCC CAAGTTGTTT GGTGTCTGCT ATAAATGAAA 1001 GAGACTTTGG CCCACTGCTT TTAACTCAAA ATGCCTAAGC GCGATTTGCC 1051 ATGGCGCTCT ATGGCGGGAA CCTCAAAGGT TAGCCGCAAC GCTAACTATT 1101 CTCCTCGTGG AGGTAGTGGG CACAAGAGTT AACAAGGCCT CTGAATGGGT 1151 GAACAGG Figure 3-3. Partial sequence of DNA-A (T5-C2A) amplified from tomato plant collected from Citra Field, Florida

PAGE 45

35 1 CTTGAATCAC CTTCTACTAT GAGACTTAAT GGTCTGTCTG GCCGCGCAGC 51 GGAACCTGTT CCAAAAAATT CATCCGCCCA CTCTTGCATC TCGTCGGGAA 101 CGTTTGTGAA AGAGGAGAGG TGAAATGGAG GAACCCACGG TTCCGGAACC 151 TTAGCGAATA TCCTCTCTAA GTTGGAGCGG ATGTTATGAT TCTGCAAGAC 201 ATAATCTTTT GGCTGTTCTT CCCTTAAAAC CGCTAAGGCA GATTGAACAG 251 AATCTGCATT TAACGCCTTG GCATATGAAT CATTAGCAGT CTGCGGGCCT 301 CCTCTAGCTG ATCTGCCGTC GATCTGGAAT TCTCCCCATT CCAGTGTATC 351 ACCGTCCTTG TCGATGTAAG ACTTGACGTC GGAGCTGGAT TTAGCTCCCT 401 GTATGTTTGG ATGGAAATGT GCTGACCTGG TTGGGGAGAC CAGATCGAAG 451 AATCTGTTAT TCTTGCACTG ATATTTCCCT TCGAACTGTA TGAGCACATG 501 GAGATGAGGC TCCCCATTCT CGTGAAGCTC TCTGCAGATT TTGATGAACT 551 TCTTGTTCAC TGGGGTATTT AGGCTCTGTA ATTGGGAAAG TGCTTCTTCT 601 TTAGTCAGAG AGCACTGAGG ATATGTTAGG AAATAGTTTT TGGACTGAAC 651 TCGAAGTTTC TTCGGCGGTG GCATTTTTGT AATAAGAAGT GGTACTCCAG 701 TTGAGGTACT CCAATTGATC CCTCTCAAAC TTGCTCATTC AATTGGAGTC 751 TAGAGTCTCA TATATAGTAG AACCCTCTAT AGAACTCTCA ATCTGGTTCA 801 CACACGTGGC GGCCATCCGC TATAATATTA CCGGATGGCC GCGCGCCCCC 851 CCTGGTGCCG TACACTCTCG CGCGATCTTT AATTTCAATT AAAGATGGTC 901 CCAGACGCTC TCGTCCAATC AGGTCGCGTC TGACGAGTCT AGATATTTGC 951 AACAACTTGG GCCCTAAGTT GTTGGGTGTC TGCTATAAAT GAAAGAGACT 1001 TTGGCCCACT GCTTTTAACT CAAAATGCCT AAGCGCGATT TGCCATGGCG 1051 CTCTATGGCG GGAACCTCAA AGGTTAGCCG CAACGCTAAC TATTCTCCTC 1101 GTGGAGGTAG TGGGCCAAGA GTTAACAAGG CCTCTGAATG GGTGAACAGG 1151 CCCATGTACA GAAAGCCCTG CAGTATTAAT CACTAGTGAA TTCGC Figure 3-4. Partial sequence of DNA-A (T10-C8A) amplified from tomato plant collected from Citra Field, Florida 1 TCTTGAATCA CCTTCTACTA TGAGACTTAA TGGTCTGTCT GGCCGCGCAG 51 CGGAACCTGT TCCAAAAAAT TCATCCGCCC ACTCTTGCAT CTCGTCGGGA 101 ACGTTAGTGA AAGAGGAGAG GTGAAATGGA GGAACCCACG GTTCCGGAAC 151 CTTAGCGAAT ATCCTCTCTA AGTTGGAGCG GATGTTATGA TTCTGCAAGA 201 CAAAATCTTT TGGCTGTTCT TCCCTTAAAA CCGCTAAGGC AGATTGAACA 251 GAATCTGCAT TTAACGCCTT GGCATATGAA TCATTAGCAG TCTGCGGGCC 301 TCCTCCAGCT GATCTGCCGT CGATCTGGAA TTCTCCCCAT TCCAATGTAT 351 CACCGTCCTT GTCGATGTAG GACTTGACGT CGGAGCTGGA TTTAGCTCCC 401 TGTATGTTTG GATGGAAATG TGCTGACCTG GTTGGGGAGA CCAGATCGAA 451 GAATCTGTTA TTCTTGCACT GATATTTCCC TTCGAACTGT ATGAGCACAT 501 GGAGATGAGG CTCCCCATTC TCGTGAAGCT CTCTGCAGAT TTTGATGAAC 551 TTCTTGTTCA CTGGGGTATT TAGGCTTTGT AATTGGGAAA GTGCTTCTTC 601 TTTAGTCAGA GAGCACTGGG GATATGTGAG GAAATAGTTT TTGGACTGAA 651 CTCGAAATTT CTTTGGCGGT GGCATTTTTG TAATAATGAG TGGGACTCCA 701 GTTGAGGCAC TCCAATTGAG CCCTCTCAAA ACTTGCTCAT TCAATTGGAG 751 TCTGGAGTCC CATATATACT AGAACCCTCT ATAGAACTCT CAATCTGGTT 801 CGCACACGTG GCGGCCATCC GCTATAATAT TACCGGATGG CCGCGCGCCC 851 CCCCTGGTGC CGTACACTCT CGCGCGATCT TTAATTTCAA TTAAAGATGG 901 TCCCAGACGC TCTCGTCCAA TCAGGTCGCG TCTGACGAGT CTAGATATTT 951 GCAACAACTT GGGCCCTAAG TTGTTGGGTG TCTGCTATAA ATGAAAGAGA 1001 CTTTGGCCCA CTGCTTTTAA CTCAAAATGC CTAAGCGCGA TTTGCCATGG 1051 CGCTCTATGG CGGGAACCTC AAAGGTTAGC CGCAACGCTA ACTATTCTCC 1101 TCGTGGAGGT AGTGGGCCAA GAGTTATCAA GGCCTCTGAA TGGGTGAACA 1151 GG Figure 3-5. Partial sequence of DNA-A (T10-C10A) amplified from tomato plant collected from Citra Field, Florida

PAGE 46

36 1 TCTTGAATCA CCTTCTACTA TGAGACTTAA TGGTCTGTCT GGCCGCGCAG 51 CGGAACCTGT TCCAAAAAAT TCATCCGCCC ACTCTTGCAT CTCGTCGGGA 101 ACGTTAGTGA AAGAGGAGAG TTGAAATGGA GGAACCCACG GTTCCGGAAC 151 CTTAGCGAAT ATCCTCTCTA AGTTGGAGCG GATGTTATGA TTCTGCAAGA 201 CGAAATCCTT TGGCTGTTCT TCCCTTAAAA CCGCTAAGGC AGATTGAACA 251 GAATCTGCAT TTAACGCCTT GGCATATGAA TCATTAGCAG TCTGCGGGCC 301 TCCTCTCGCT GATCTGCCGT CGATCTGGAA TTCTCCCCAT TCCAGTGTAT 351 CACCGTCCTT GTCGATGTAG GACTTGACGT CGGAGCTGGA TTTAGCTCCC 401 TGTATGTTTG GATGGAAATG TGCTGACCTG GTTGGGGAGA CCAGATCGAA 451 GAATCTGTTA TTCTTGCACT GATATTTCCC TTCGAACTGT ATGAGTACAT 501 GGAGATGAGG CTCCCCATTC TCGTGAAGCT CTCTGCGGAT TTTGATGAAT 551 TTCTTGTTCA CTGGGGTATT TAGGCTTTGT AATTGGGAAA GTGCTTCTTC 601 TTTAGTCAGA GAGCACTGGG GATATGTGAG GAAATAGTTT TTGGACTGAA 651 CTCGAAATTT CTTAGGCGGT GGCATTTTTG TAATAAGAAG TGGTACTCCA 701 GTTGAGGTAC TCCAATTGAG CCCTCTCAAA CTTGCTCATT CAATTGGAGT 751 CTGGAGTCTC ATATATAGTA GAACCCTCTA TAGAACTCTC AATCTGGTTC 801 ACACACGTGG CGGCCATCCG CTATAATATT ACCGGATGGC CGCGCGCCCC 851 CCTTGGTGCC GTACACTCTC GCGCGATCTT TAATTTCAAT TAAAGATGGT 901 CCCAGACGCT CTCGTCCAAT CAGGTCGCGT CTGACGAGTC TAGATATTTG 951 CAACAACTTG GGCCCTAAGT TGTTGGGTGT CTGCTATAAA TGAAAGAGAG 1001 TTTGGCCCAC TGCTTTTAAC TCAAAATGCC TAAGCGCGAT TTGCCATGGC 1051 GCTCTATGGC GGGAACCTCA AAGGTTAGCC GCAACGCTAA CTATTCTCCT 1101 CGTGGAGGTA GTGGGCCAAG AGTAAACAAG GCCTCTGAAT GGGTGAACAG 1151 G Figure 3-6. Partial sequence of DNA-A (T12-C6A) amplified from tomato plant collected from Citra Field, Florida 1 GCTACGACTC AGTCTAGCTG TCAACTGCGA CGCCGTCGAC GGGAATTGCA 51 GAATTATCTC AGTTAGGTCA TGGGAAAGTT GATACTCGTC CCGGTGCGAC 101 TCTATGTAGT TGAAGGCACT CGGAGGATTT ACTAACTGAG ATTCCATTTG 151 AAGAAGAAAG GCCGCGCAGC GGAACCGATT GCTGAAGTTG AATCGGAAAA 201 AAGATGTCAG GAATTCTCGT GAAGAACAGT ATTTGAACCC TTGTTGAAGA 251 TGAACACTTT TTCTGGGAAA CCCAGAAAGT TGGTGAAGAA GTTGAGGAAC 301 ACTCGTCTAA CCTCTTATGA AAGTGGGTGG GTTGTTGAGA AAGAGGAGAA 351 ATCTGGTGAT GAAAGTTTAG GATGATAGTG AGTTAGATCT GGTAGTGTCT 401 ATAAATAGAC CCAGATTTTA TGTTGTTGGT AAAGAACGTC TATGAGAAGT 451 TTTTACTTCT GTTTAATGGC ATTTTTGTAA TAATGAGTGG GACTCCAGTT 501 GAGGTACTCC AATTGAGCCC TCTCAAACTT GCTCATTCAA TTGGAGTATT 551 AGAGTCTCAT ATATAGTAGA ACCCTCTATA GAACTCTCAA TCTGGTTCAC 601 ACACGTGGCG GCCATCCGA Figure 3-7. Partial sequence of DNA-B (S3-C4B) amplified from Sida acuta collected from Citra Field, Florida

PAGE 47

37 1 GCTACGACTG AGCCTCGCCG TCAACTGCGA CGCCGTGGAA GGAAATTGCA 51 GTATTATCTC AGTTAGGTCA TGTGAAAGCT GATATTCGTC CCGGTGAGAT 101 TCTATGTAAT TGAAAGCGTT CGGAGGATTA ACTAACTGAG AATCCATATG 151 AGGAAGAAAG GCCGCGCAGC GGAACCGATT GCTGAAGTTG AATCGGGAAG 201 AAGATGAACA ACTGATGAAC AGGACGAACA GTGTTCGATG GCTGAGTTTA 251 GATCTCGAAG AAGGTAAAGG CGTAACTTTG TTTCTGTGTT TGAGAGTGTC 301 GGATCTTTCT GACAGTTACT GTTTAGAAGA TTTAAGAACG AAAATTTGTT 351 TAACCCTTGA TGTTTATGAG AAAGAAAGGA GTGTTGATGA ATAATTTGGG 401 AGAATTCTGG AAATGAAGTA GTTTGTGTAT GAACCCAGAA CTTCTGGGTT 451 GACGGGTATT TAAAATGGGA AAGGGTTCAT CAACCGGTGG CATTCTTGTA 501 ATAATGAGTG GGACTCCAGT TGAGGTACTC CAATTGATCC CTCTCAAACT 551 TGCTCATTCA ATTGGAGTCT AGAGTCTCAT ATATAGTAGA ACCCTCTATA 601 GAACTCTCAA TCTGGTTCAC ACACGTGGCG GCCATCCGA Figure 3-8. Partial sequence of DNA-B (T12-C3B) amplified from tomato plant collected from Citra Field, Florida 1 GCTACGACTC AGCCTCGCCG TCAACTGCGA CGCCGTCGAC GGAAATTGCA 51 GAATTATCTC AGTTAGGTCA TGGGAAAGTT GATACTCGTC CCGGTGAGAC 101 TCTATGTAGT TGAAGGCGCT CGGAGGATTT ACTAACTGAG ATTCCATTTG 151 AAGAAGAAAG GCCGCGCAGC GGAACCGATT GCTGAAGTTG AATCGGGAAA 201 AGATGTCAAG AATTCTCGTG AAGAACAGTA TATGAACCCC CCTTGAAGAT 251 GAACACTTTT TCTGGGAAAC CCAGAAAGTT GGTGAAGAAG TTGAGGAACA 301 CTTGTCTAAC CTCTCTTGAA AGTGGGTGTG TTGTTGAGAA AGAGGAGAAA 351 TCTGGTGATG AAAATGAGGA TGATAGTGAG TTAGATCTGG TAGTGTCTAT 401 AAATAGACCC AGATATTATG TTGTTGGTAA AGAACGTCTA TGAGAAGTTT 451 TTACTTCTGT TCAATGGCAT TTTTGTAATA AGAAGTGGTA CTCCAGTTGA 501 GGTACTCCAA TTGAGCCCTC TCAAACTTGC TCATTCAATT GGAGTCTGGA 551 GTCTCATATA TAGTAGAACC CTCTATAGAA CCCTCAATCT GGTTCACACA 601 CGTGGCGGCC ATCCGA Figure 3-9. Partial sequence of DNA-B (T12-C5B) amplified from tomato plant collected from Citra Field, Florida 1 GCTACGACTG AGCCTCGCCG TCAACTGCGA CGCCGTCGAC GGAAATTGCA 51 GAATTATCTC AGTTAGGTCA TGGGAAAGTT GATACTCGTC CCGGTGAGAC 101 TCTATGTAGT TGAAGGCGCT CGGAGGATTT ACTAACTGAG ATTCCATTTG 151 AAGAAGAAAG GCCGCGCAGC GGAACCGATT GCTGAAGTTG AATCGGGAAA 201 AGATGTCAAG AATTCTCGTG AAGAACAGTA TATGAACCCC CCTTGAAGAT 251 GAACACTTTT TCTGGGAAAC CCAGAAAGTT GGTGAAGAAG TTGAGGAACA 301 CTTGTCTAAC CTCTCTTGAA AGTGGGTGTG TTGTTGAGAA AGAGGAGAAG 351 TCTGGTGATG AAAATGAGGA TGATAGTGAG TTAGATCTGG TAGTGTCTAT 401 AAATAGACCC AGATATTATG TTGTTGGTAA AGAACGTCTA TGAGAAGTTT 451 TTACTTCTGT TCAATGGCAT TTTTGTAATA AGAAGTGGTA CTCCAGTTGA 501 GGTACTCCAA TTGAGCCCTC TCAAACTTGC TCATTCAGTT GGAGTCTGGA 551 GTCTCATATA TAGTAGAACC CTCTATAGAA CTCTCAATCT GGTTCACACA 601 CGTGGCGGCC ATCCGT Figure 3-10. Partial sequence of DNA-B (T12-C7B) amplified from tomato plant collected from Citra Field, Florida

PAGE 48

38 1 GCTACGACTG AGCCTCGCCG TCAACTGCGA CGCCGTGGAA GGAAATTGCA 51 GTATTATCTC AGTTAGGTCA TGTGAAAGCT GATATTCGTC CCGGTGAGAT 101 TCTATGTAAT TGAAAGCGTT CGGAGGATTA ACTAACTGAG AATCCATATG 151 AGGAAGAAAG GCCGCGCAGC GGAACCGATT GCTGAAGTTG AATCGGGAAG 201 AAGATGAACA ACTGATGAAC AGGACGAACA GCGTTCGATG GCTGAGTTTA 251 GATCTCGAAG AAGGTAAAGG TATAACTTTG TTTCTGTGTT TGAGAGTGTC 301 GGATCTTTCT GACAGTTACT GTTTAGAAGA TTTAAGAACG AAAATTTGTT 351 CAACCCTTGA TGTTTATGAG AAAGAAAGGA GTGTTGATGA ATAATTTGGG 401 AGAATTCTGG AAATGAAGTA GTTTGTGTAT GAACCCAGAA CTTCTGGGTT 451 GACGGGTATT TAAAATGGGA AAGGGTTCAT CAACCGGTGG CATTCTTGTA 501 ATAATGAGTG GGACTCCAGT TGAGGTACTC CAATTGATCC CTCTCAAACT 551 TGCTCATTCA ATTGGAGTCT AGAGTCTCAT ATATAGTAGA ACCCTCTATA 601 GAACTCTCAA TCTGGTTCAC ACACGTGGCG GCCATCCGT Figure 3-11. Partial sequence of DNA-B (T12-C9B) amplified from tomato plant collected from Citra Field, Florida Table 3-1. The nucleotides identity of partial sequences of SiGMV DNA-A isolated from tomato and Sida collected from Citra Field T3-C8A T5-C2A T10-C8A T10-C10A T12-C6A S3-C7A SiGMV-A T3-C8A 100% 97.9% 98.3% 98.7% 98.5% 97.8% 96.0% T5-C2A 100% 97.9% 98.3% 98.2% 98.5% 95.9% T10-C8A 100% 98.3% 98.3% 98.4% 94.6% T10-C10A 100% 98.2% 98.4% 95.9% T12-C6A 100% 98.4% 95.9% S3C7A 100% 96.2% SiGMV-A 100% T3-C8A: SiGMV DNA-A sequence from tomato 3 clone 8, T5-C2A: SiGMV DNA-A sequence from tomato 5 clone 2, T10-C8A: SiGMV DNA-A sequence from tomato 10 clone 8, T10-C10A: SiGMV DNA-A sequence from tomato 10 clone 10, T12-C6A: SiGMV DNA-A sequence from tomato 12 clone 6, S3-C7A: SiGMV DNA-A sequence from Sida 3 clone 7, SiGMV-A: Sida golden mosaic virus DNA-A Table 3-2. The nucleotides identity of partial sequences of SiGMV DNA-B isolated from tomato and Sida collected from Citra Field: S3-C4B T12-C3B T12-C5B T12-C7B T12-C9B SiGMV-B S3-C4B 100 67.9% 95.8% 95.3% 67.7% 96.1% T12-C3B 100 68.9% 68.9% 99.2% 68.0% T12-C5B 100 99.2% 68.7% 95.3% T12-C7B 100 69.0% 95.3% T12-C9B 100.0% 68.0% SiGMV-B 100.0% S3-C4B: SiGMV DNA-B sequence isolated from sida 3 clone 4, T12-C3B: SiGMV DNA-B sequence isolated from tomato 12 clone 3, T12-C5B: SiGMV DNA-B sequence isolated from tomato 12 clone 4, T12-C7B: SiGMV seqence of DNA-B isolated from tomato 12 clone 7, T12-C9B: SiGMV DNA-B sequence isolated from tomato 12 clone 9, SiGMV-B: Sida golden mosaic virus DNA-B

PAGE 49

39 Table 3-3. The Common region nucleotides identity of SiGMV DNA-A sequences isolated from tomato and S. acuta T3-C8A T5-C2A T10-C8A T10-C10A T12-C6A S3-C7A T3-C8A 100% 95.9% 95.9% 96.6% 97.3% T5-C2A 95.9% 95.9% 96.6% 97.3% T10-C8A 94.5% 99.3% 95.9% T10-C10A 95.2% 93.2% T12-C6A 96.6% T3-C8: SiGMV DNA-A sequence from tomato 3 clone 8, T5-C2: SiGMV DNA-A sequence from tomato 5 clone 2, T10-C8: SiGMV DNA-A sequence from tomato 10 clone 8, T10-C10: SiGMV DNA-A sequence from tomato 10 clone 10, T12-C6: SiGMV DNA-A sequence from tomato 12 clone 6, S3-C7: SiGMV DNA-A sequence from Sida 3 clone 7, SiGMV-A: Sida golden mosaic virus DNA-A. SiGMV-B: Sida golden mosaic virus DNA-B Table 3-4. The Common region nucleotides identity of SiGMV sequences isolated from tomato and S. acuta: S3-4B* T12-3B* T12-5B* T12-7B* T12-9B* SiGMV-A SiGMV-B T3-C8A 98.6% 97.3% 94.5% 94.5% 96.6% 95.2% 96.6% T5-C2A 98.6% 97.3% 94.5% 94.5% 96.6% 95.2% 96.6% T10-C8A 95.9% 96.6% 97.3% 97.3% 96.6% 95.2% 95.2% T10-C10A 95.2% 94.5% 93.8% 93.8% 94.5% 91.7% 93.2% T12-C6A 95.9% 95.2% 98.6% 98.6% 95.2% 95.9% 95.9% S3-C7A 97.3% 95.2% 95.9% 95.9% 95.2% 95.2% 96.6% S3-4B* 98.0% 96.0% 95.0% 97.3% 93.9% 95.9% T12-3B* 95.2% 94.5% 99.3% 91.8% 95.2% T12-5B* 98.0% 94.5% 93.8% 94.5% T12-7B* 95.2% 93.8% 94.5% T12-9B* 91.8% 95.2% SiGMV-A 93.9% the CR miss at least two necleotides.T3-C8: SiGMV DNA-A sequence from tomato 3 clone 8, T5-C2: SiGMV DNA-A sequence from tomato 5 clone 2, T10-C8: SiGMV DNA-A sequence from tomato 10 clone 8, T10-C10: SiGMV DNA-A sequence from tomato 10 clone 10, T12-C6: SiGMV DNA-A sequence from tomato 12 clone 6, S3-C7: SiGMV DNA-A sequence from Sida 3 clone 7, S3-C4B: SiGMV DNA-B sequence isolated from sida 3 clone 4, T12-C3B: SiGMV DNA-B sequence isolated from tomato 12 clone 3, T12-C5B: SiGMV DNA-B sequence isolated from tomato 12 clone 4, T12-C7B: SiGMV seqence of DNA-B isolated from tomato 12 clone 7, T12-C9B: SiGMV DNA-B sequence isolated from tomato 12 clone 9, SiGMV-A: Sida golden mosaic virus DNA-A, and SiGMV-B: Sida golden mosaic virus DNA-B

PAGE 50

40 Table 3-5. The nucleotide identity of partial sequences DNA-A sequences isolated from tomato and S. acuta at Citra, FL with begomoviruses generated by Blast Begomovirus ACC. No. T3-C8A T5-C2A T10-C8A T10-C10A T12-C6A S3-C7A SiGMV-A ChTV-[IC] AF101476 82.8% 82.9% 83.1% 83.4% 83.2% 82.8% 82.2% AbMV X15983 83.9% 85.9% 84.6% 84.7% 84.2% 83.9% 84.5% ToMoV-[FL] L14460 86.6% 86.5% 86.5% 86.4% 86.7% 86.6% 87.6% ChTV [H8] AF226664 81.5% 81.8% 81.8% 82.1% 82.7% 81.5% 82.0% ChTV [H6] AF226665 81.6% 81.7% 82.0% 82.0% 82.6% 81.4% 81.9% AbMV -HW U51137 82.9% 82.4% 83.1% 83.0% 82.8% 82.7% 83.0% SiYVV Y11099 83.1% 82.8% 83.1% 83.1% 83.5 83.0% 83.2% ToMoTV AF012300 76.8% 76.7% 77.3% 77.3% 77.0% 76.5% 77.3% SiGMV-YV AJ577395 76.2% 76.3% 76.5% 76.7% 76.7% 76.0% 76.6% SiGMHV Y11097 79.8% 79.6% 79.3% 80.0% 79.9% 79.4% 79.3% SiGMCVR X99550 77.2% 76.9% 77.0% 79.0% 77.4% 76.8% 77.3% BDMV M88179 77.8% 77.6% 78.0% 81.0% 78.3% 77.6% 78.3% PYMTV-TT AF039031 78.3% 78.3% 77.8% 77.9% 78.1% 78.0% 78.1% ACC. NO. Accession number, T3-C8: SiGMV DNA-A sequence from tomato 3 clone 8, T5-C2: SiGMV DNA-A sequence from tomato 5 clone 2, T10-C8: SiGMV DNA-A sequence from tomato 10 clone 8, T10-C10: SiGMV DNA-A sequence from tomato 10 clone 10, T12-C6: SiGMV DNA-A sequence from tomato 12 clone 6, S3-C7: SiGMV DNA-A sequence from Sida 3 clone 7, SiGMV-A: Sida golden mosaic virus DNA-A, ChTV-[IC]: Chino del tomato virus-[IC], AbMV: Abutilon mosaic virus, ToMoV-[FL]: Tomato mottle virus-Florida, ChTV-[H6]: Chino del tomato virus-[H6], ChTV-[H8]: Chino del tomato virus-[H8], AbMV-HW: Abutilon mosaic virus-HW, SiYVV: Sida yellow vein virus, ToMoTV: Tomato mottle Taino virus, SiGMHV: Sida golden mosaic Honduras virus, SiGMCRV: Sida golden mosaic Costa Rica virus, BDMV: Bean dwarf mosaic virus, and PYMTV-TT: Potato yellow mosaic Trinidad virusTrinidad and Tobago

PAGE 51

41 Table 3-6. The nucleotide identity of partial sequences DNA-B sequences isolated from tomato and S. acuta at Citra, FL with begomoviruses generated by Blast Begomovirus ACC. No. T12-C3B T12-C5B T12-C7B T12-C9B S10-C4B SiGMV-B ChTV-[IC] AF101478 64.6% 68.9% 68.7% 64.3% 68.6% 67.8% AbMV X15984 76.2% 63.4% 63.4% 75.9% 62.4% 61.5% ToMoV-[FL] L14461 76.1% 66.6% 66.7% 76.1% 66.6% 66.9% SiGMHV-YV AJ250731 62.2% 66.2% 65.7% 62.6% 65.1% 62.5% SiGMV-YV Y11101 62.2% 66.1% 65.6% 62.7% 65.0% 62.3% AbMV-HW U51138 75.1% 61.6% 61.6% 75.0% 61.3% 60.3% SiYVV Y11100 62.1% 66.1% 65.7% 62.4% 65.0% 62.3% ToMoTV AF012301 68.6% 59.2% 59.3% 68.8% 59.4% 58.5% SiGMHV Y11098 62.8% 63.0% 62.7% 75.0% 65.6% 63.0% SiGMCRV X99551 60.2% 77.9% 77.9% 60.4% 76.4% 75.8% BDMV M88180 60.3% 75.1% 74.8% 60.3% 75.2% 74.3% PYMTV-TT AF039032 63.3% 64.9% 64.9% 64.4% 65.1% 63.7% S3-C4B: SiGMV DNA-B sequence isolated from sida 3 clone 4, T12-C3B: SiGMV DNA-B sequence isolated from tomato 12 clone 3, T12-C5B: SiGMV DNA-B sequence isolated from tomato 12 clone 4, T12-C7B: SiGMV seqence of DNA-B isolated from tomato 12 clone 7, T12-C9B: SiGMV DNA-B sequence isolated from tomato 12 clone 9, SiGMV-B: Sida golden mosaic virus DNA-B, ChTV-[IC]: Chino del tomato virus-[IC], AbMV: Abutilon mosaic virus, ToMoV-[FL]: Tomato mottle virus-Florida, SiGMHV-YV: Sida golden mosaic Honduras virusyellow vein, SiGMV-YV: Sida golden mosaicyellow vein SiYVV: Sida yellow vein virus, ToMoTV: Tomato mottle Taino virus, SiGMHV: Sida golden mosaic Honduras virus, SiGMCRV: Sida golden mosaic Costa Rica virus, BDMV: Bean dwarf mosaic virus, and PYMTV-TT: Potato yellow mosaic Trinidad virusTrinidad and Tobago

PAGE 52

42 Figure 3-12. Phylogenic tree of partial nucleotide sequence of DNA-A of selected begomoviruses with the SiGMV and the SiGMV sequences isolated from tomato and S. acuta. PYMTV-TT: Potato yellow mosaic Trinidad virusTrinidad and Tobago, SiGMHV: Sida golden mosaic Honduras virus, SiGMCRV: Sida golden mosaic Costa Rica virus, BDMV: Bean dwarf mosaic virus, SiYVV: sida yellow vein virus, ToMoTV: Tomato mottle Taino virus, SiYVHV: Sida yellow vein Honduras virus, ChTV-[IC]: Chino del tomato virus-[IC], ChTV-[H6]: Chino del tomato virus-[H6], ChTV-[H8]: Chino del tomato virus-[H8], AbMV-HW: Abutilon mosaic virus-HW, AbMV: Abutilon mosaic virus, ToMoV-[FL]: Tomato mottle virus-Florida, SiGMV: Sida golden mosaic virus, T3-C8: SiGMV DNA-A sequence from tomato 3 clone 8, T5-C2: SiGMV DNA-A sequence from tomato 5 clone 2, T10-C8: SiGMV DNA-A sequence from tomato 10 clone 8, T10-C10: SiGMV DNA-A sequence from tomato 10 clone 10, T12-C6: SiGMV DNA-A sequence from tomato 12 clone 6, S3-C7: SiGMV DNA-A sequence from Sida 3 clone 7

PAGE 53

43 Figure 3-13. Phylogenic tree of partial nucleotide sequences of DNA-B of selected begomoviruses with the SiGMV and the SiGMV sequences isolated from tomato and S. acuta. ChTV-[IC]: Chino del tomato virus-[IC], PYMTV-TT: Potato yellow mosaic Trinidad virusTrinidad and Tobago, S3-C4B: SiGMV DNA-B sequence isolated from sida 3 clone 4, T12-C3B: SiGMV DNA-B sequence isolated from tomato 12 clone 3, T12-C5B: SiGMV DNA-B sequence isolated from tomato 12 clone 4, T12-C7B: SiGMV seqence of DNA-B isolated from tomato 12 clone 7, T12-C9B: SiGMV DNA-B sequence isolated from tomato 12 clone 9, ToMoV-[FL]: Tomato mottle virus-Florida, ToMoTV: Tomato mottle Taino virus, AbMV: Abutilon mosaic virus, AbMV-HW: Abutilon mosaic virus-HW, SiGMHV: Sida golden mosaic Honduras virus, SiGMHV-YV: Sida golden mosaic Honduras virusyellow vein, SiGMHV*: Strain of Sida golden mosaic Honduras virus, SiYVHV: Sida yellow vein Honduras virus, SiGMCRV: Sida golden mosaic Costa Rica virus, BDMV: Bean dwarf mosaic virus, SiGMV-B: Sida golden mosaic virus DNA-B

PAGE 54

44 Discussion The Samples were collected from putatively SiGMV infected tomatoes and S. acuta from experimental field near Citra, FL., Begomovirus DNA was extracted, isolated and characterized. Partial DNA-A and DNA-B fragments were cloned, sequenced and subjected to Gap sequencing and phylogenetic analysis. The partial DNA-A sequences comparisons revealed no significant differences between samples acquired from tomato and Sida. Furthermore the partial DNA-A sequence analysis suggested theses variants were related to ToMoV-[FL]. However, the partial DNA-B sequences showed greater diversity and were divided into two groups, the first group was related to ToMoV-[FL] and the second was related to a group of viruses that included SiGMV. The high level of homology in the nucleotide sequence of the CR between DNA-A and DNA-B confirmed that these components do support each other. The diversity observed in the sequences of DNA-B may be due to recombination events. It is possible that this recombination took place at some time in the past or could be relatively current and ongoing series of events These results suggest that S. acuta was the inoculation source for the epidemic of SiGMV in tomato. This is the first report of S. acuta acting as a virus source for tomato and possible recombination host source for Begomoviruses. The suggested recombination of the DNA-B in S. acuta could have an impact on the host range and virulence of Begomoviruses capable of using S. acuta as a host. The possibility of Begomoviruses using S. acuta as a recombination host could have a dramatic impact on cultural practice and crop selection where S. acuta occurs, which may lead to elimanite the S. acuta or change the crops in the farming area specially in South

PAGE 55

45 East United State. However, the scientific aspect of naturally recombination occurrences in S. acuta may lead to more attention to S. acuta. A complete nucleotide sequence of the partial DNA-A and DNA-B sequences from infected plants of tomato and S. acuta would help to understand the relationship between SiGMV, these variants, and recombination. More study on S. acuta begomovirus and the S. acuta the weed host must be achieved to understand the recombination events that can be due to the lack of stringency of replication or because of begomovirus movement to S. acuta. In addition, biolistic inoculation of infectious clones of SiGMV and SiGMV variants to tomato is required to determine if the SiGMV sequence variants that caused the epidemic in tomato should be classified as a strain of SiGMV. Also, whitefly feeding preference and virus aquision from sida speacies must be study to determine the efficiency of whiteflies to acquire and transmission. Finally, the occurrence of recombination and the whitefly preference and feeding to and from Sida species will play an importance role in introducing new begomoviruses.

PAGE 56

LIST OF REFERENCES 1. Atiri G (1984) Okra mosaic virus in weeds (Sida spp.). Journal of Plant Protection in the Tropics. 1: 55-57 2. Baldauf SL (2003) Phylogeny for the faint of heart: a tutorial. Trends in Genetics 19: 345-351 3. Bird J (1975) Tropical Diseases of Legumes, 1 edn. Academic Press, New York 4. Bock KR, Guthrie EJ (1974) Purification of maize streak virus and its relationship to viruses associated with streak diseases of sugar cane and panicum maximum. Annals of Applied Biology 77: 289-296 5. Briddon R, Bebford I, Tsai JH, Markham P (1996) Analysis of the nucleotide sequence of the treehopper-transmitted Geminivirus, Tomato pseudo-curly top virus, suggests a recombinant origin. Virology 219: 387 6. Briddon R, Markham P (2001) Complementation of bipartite begomovirus movement functions by topocuviruses and curtoviruses. Archives of Virology 146: 1811 7. Briddon RW, Bull SE, Mansoor S, Amin I, Markham PG (2002) Universal primers for the PCR-mediated amplification of DNA beta: A molecule associated with some monopartite begomoviruses. Molecular Biotechnology 20: 315-318 8. Chivasa S, Ekpo EJA, Hicks RGT (2001) New hosts of Turnip mosaic virus in Zimbabwe. Plant Pathology 51: 389 9. Clark GH, Fletcher J (1909) Farm weeds of Canada, Second edn. Government printing Bureau, Ottawa 10. Costa AS, Bennett CW (1953) A probable vector of Abutilon mosaic virus on species of sida in Florida. The Plant Disease Reporter 37: 92-93 11. Costa AS (1955) Studies on Abutilon mosaic in Brazil. Phytopathologische Zeitschrift 24: 97-112 12. Costa AS, Carvalho AM (1960) Mechanical transmission and properties of the Abutilon mosaic virus. Phytopathologische Zeitschrift 37: 259-272 46

PAGE 57

47 13. Czosnek H, Ghanim M, Ghanim M (2002) The circulative pathway of begomoviruses in the whitefly vector Bemisia tabaci-insights from studies with Tomato yellow leaf curl virus. Annals of Applied Biology 140: 215-231 14. Davis EF (1929) Some chemical and physiological studies on the nature and transmission of 'infectious chlorosis' in variegated plants. Annals of the Missouri Botanical Garden 16: 145-211 15. Doyle JJ, Doyle JL (1990) Isolation of plant DNA from fresh tissue. Focus 12: 13-15 16. Dry IB, Krake LR, Rigden JE, Rezaian MA (1997) A novel subviral agent associated with a geminivirus: The first report of a DNA satellite. PNAS 94: 7088-7093 17. Egley GH (1976) Germination of developing prickly sida seeds. Weed Science 24: 239-243 18. Fauquet C, Maxwell D, Gronenborn B, Stanley J (2000) Revised proposal for naming geminiviruses. Archives of Virology 145: 1743-1761 19. Fauquet CM, Bisaro DM, Briddon RW, Brown JK, Harrison BD, Rybicki EP, Stenger DC, Stanley J (2003) Revision of taxonomic criteria for species demarcation in the family Geminiviridae, and an updated list of begomovirus species. Archives of Virology 148: 405-421 20. Franzotti EM, Santos CVF, Rodrigues HMSL, Mouro RHV, Andrade MR, Antoniolli AR (2000) Anti-inflammatory, analgesic activity and acute toxicity of Sida cordifolia L. (Malva-branca). Journal of Ethnopharmacology 72: 273-277 21. Frischmuth T, Engel M, Lauster S, Jeske H (1997) Nucleotide sequence evidence for the occurrence of three distinct whitefly-transmitted, sida-infecting bipartite geminiviruses in Central America. Journal of General Virology 78: 2675-2682 22. Fuller C (1899-1901) Mealie variegation, 1st report of the government entomologist. Natal: 17-19 23. Ghosal S, Chauhan RBPS, Mehta R (1975) Alkaloids of Sida cordifolia. Phytochemistry 14: 830-832 24. Gutierrez C (1999) Geminivirus DNA replication. Cellular and Molecular Life Sciences 56: 313-329 25. Gutierrez C (2002) Strategies for geminivirus DNA replication and cell cycle interference. Physiological and Molecular Plant Pathology 60: 219-230

PAGE 58

48 26. Harrison B, Robinson D (1999) Natural genomic and antigenic variation in whitefly-transmitted geminiviruses (Begomoviruses). Annual Review of Phytopathology 37: 369-398 27. Harrison BD, Barker H, Bock KR, Guthrie EJ, Meredith G (1977) Plant viruses with circular single-stranded DNA. Nature 270: 760-762 28. Harrison BD (1985) Advances in Geminivirus research. Annual Review of Phytopathology 23: 55-82 29. Hazra R, Sharma A (1971) Chromosome studies in different species and varieties of sida with special refence to accessory chromosomes. Cytologia 36: 285-297 30. Heald FD (1933) Manual of Plant Diseases, Second edn. Mcgraw-Hill book company, New York 31. Hein I (1926) Changes in plastids in variegated plants. Bulletin of the Torrey Botanical Club 53: 411-418 32. Hiebert E, Abouzid AM, Polston JE (1995) Whitefly-transmitted geminiviruses. In: Bemisia : 1995, taxonomy, biology, damage, control and management / p. 277-288 33. Hofer P, Engel M, Jeske H, Frischmuth T (1997) Nucleotide sequence of a new bipartite geminivirus isolated from the common weed Sida rhombifolia in Costa Rica. Journal of General Virology 78: 1785-1790 34. Hfer P, Engel M, Jeske H, Frischmuth T (1997) Host range limitation of a pseudorecombinant virus produced by two distinct bipartite geminiviruses. Molecular Plant-Microbe Interactions 10: 1019-1022 35. Hunter WB, Hiebert E, Webb SE, TSAI JH, Polston JE (1998) Location of geminiviruses in the whitefly Bemisia tabaci (Homoptera: Aleyrodidae). Plant Disease 82: 1147-1151 36. Jeske H, Ltgemeier M, Prei W (2001) DNA forms indicate rolling circle and recombination-dependent replication of Abutilon mosaic virus. The EMBO Journal 20: 6158-6167 37. Keur JY (1934) Studies of the occurrence and transmission of virus diseases in the genus Abutilon. Bulletin of the Torrey Botanical Club 61: 53-70 38. Khan J, Dijkstra J (2001) Plant viruses as molecular pathogens. Food Products Pr (December 2001)

PAGE 59

49 39. Kirkpatrick TW (1931) Further studies on leaf-curl of cotton in the Sudan. Bulletin Entomology 22: 323-363 40. Kumar R, Ambasht RS, Srivastava AK, Srivastava NK (1996) Role of some riparian wetland plants in reducing erosion of organic carbon and selected cations. Ecological Engineering 6: 227-239 41. Kumar R, Ambasht RS, Srivastava A, Srivastava NK, Sinha A (1997) Reduction of nitrogen losses through erosion by leonotis nepetaefolia and Sida acuta in simulated rain intensities. Ecological Engineering 8: 233-239 42. Kunkel LO (1925) Mosaic and related diseases. American Journal of Botany 12: 517-521 43. Kunkel LO (1930) Transmission of Sida mosaic by grafting. Phytopathology 20: 129-130 44. Kurstak E (1981) Handbook of Plant Virus Infections Comparative Diagnosis. Elsevier/North-Holland biomedical press 45. Lazarowitz SG (1992) Geminiviruses: genome structure and gene function. Critical Reviews in Plant Sciences 11: 327-349 46. Mansoor S, Briddon RW, Zafar Y, Stanley J (2003) Geminivirus disease complexes: an emerging threat. Trends in Plant Science 8: 128-134 47. Moffat AS (1999) Geminiviruses emerge as serious crop threat. Science 286: 1835 48. Mumford DL (1974) Purification of Curly top virus. Phytopathology 64: 136-137 49. Noueiry AAO, Lucas BWJ, Gilbertson CRL (1994) Two proteins of a plant DNA virus coordinate nuclear and plasmodesmal transport. Cell 76: 925-932 50. Orlando A, Silberschmidt K (1946) Estudios sobre a disseminacao natural do virus da "Clorose Infecciosa" das malvaceas (Abutilon Virus 1. Baur) E A sua relacao com o inseto-vector "Bemisia tabaci (Genn)". Arquivos Do Instituto Biologico 17: 1-36 51. Palmer KE, Rybicki, E.P. (1998) The molecular biology of mastreviruses. Advances in Virus Research 50: 183-234 52. Polston JE, McGovern RJ (1999) Introduction of Tomato yellow leaf curl virus in Florida and implications for the spread of this and other geminiviruses of tomato. Plant Disease 83: 984-988

PAGE 60

50 53. Polston JE, Hiebert, E., McGovern, R.J., Stansly, P.A., Schuster, D,J, (1993) Host range of Tomato mottle virus, a new geminivirus infecting tomato in Florida. Plant Disease 77: 1181-1184 54. Porebski S, Bailey LG (1997) Modification of a CTAB DNA extraction protocol for plants. Plant Molecular Biology Reporter 15: 8-15 55. Robinson EL (1975) Dormancy of Sida spinosa seeds. Plant Physiology 56: 85 56. Rojas MR, Gilbertson RL, Russell DR, Maxwell DP (1993) Use of degenerate primers in the polymerase chain reaction to detect whitefly-transmitted germiniviruses. Plant Disease 77: 340-347 57. Sawant SV, Singh PK, Tuli R (2000) Pretreatment of microprojectiles to improve the delivery of DNA in plant transformation. BioTechniques 29: 246-248 58. Silberschmidt K (1943) Estudos sobre a transmissao experimental da "Clorose infecciosa" das malvaceas. Arquivos Do Instituto Biologico 14: 105-156 59. Smith FF (1926) Some cytological and physiological studies of mosaic diseases and leaf variegations. Annals of the Missouri Botanical Garden 13: 425-484 60. Spillman WJ (1909) A case of non-mendelian heredity. American Naturalist 43: 437-448 61. Stanley J, Boulton MI, WDavies J (2001) Geminiviridae Encyclopedia of Life Sciences (www.els.org). 62. Storey HH (1925) The transmission of streak disease of maize by the leafhopper Balclutha mbila naude. Annals of Applied Biology 12: 422-439 63. Storey HH, Nichols RFW (1938) Studies of the mosaic diseases of cassava. The Annals of Applied Biology 25: 790-806 64. Venkatesh S, Reddya YSR, Suresha B, Reddyb BM, Ramesh M (1999) Antinociceptive and anti-inflammatory activity of Sida rhomboidea leaves. Journal of Ethnopharmacology 67: 229-232 65. Wyatt SD, Brown JK (1996) Detection of subgroup iii geminivirus isolates in leaf extracts by degenerate primers and polymerase chain reaction. Phytopathology 86: 1288-1292

PAGE 61

BIOGRAPHICAL SKETCH Hamed Sayed Adnan Al-Aqeel was born on August 25, 1975, in Kuwait City, State of Kuwait. He received his Bachelors degree in Microbiology in 1998. In 1999 he received a scholarship from Kuwait University to continue his graduate studies toward Master and Doctor of Philosophy degrees in plant viruses. In the same year he married Hanin Altarkeet. In summer 2000 he joined the University of Florida as a graduate student and since then he has been working under the supervision and guidance of Dr Jane Polston and her lab group and under the support of the committe members, family, and friends. On February 17, 2001 he becomes a father to Ali Hamed Sayed Adnan Al-Aqeel. Upon completion of his M.S degree, Hamed is looking forward to completing to his PhD degree under the same supervisor at the same lab. 51


Permanent Link: http://ufdc.ufl.edu/UFE0002838/00001

Material Information

Title: Characterization of Two Begomoviruses Isolated from Sida santaremensis Monteiro and Sida acuta Burm. f
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0002838:00001

Permanent Link: http://ufdc.ufl.edu/UFE0002838/00001

Material Information

Title: Characterization of Two Begomoviruses Isolated from Sida santaremensis Monteiro and Sida acuta Burm. f
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0002838:00001


This item has the following downloads:


Full Text












CHARACTERIZATION OF TWO BEGOMOVIRUSES ISOLATED FROM Sida
santaremensis Monteiro AND Sida acuta Burm. f


















By

HAMED ADNAN AL-AQEEL


A THESIS PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE

UNIVERSITY OF FLORIDA


2003

































Copyright 2003

by

Hamed Adnan Al-Aqeel
































This dedicated to my family my father Dr. Adnan, my mother Fareda and my wife Hanin.
















TABLE OF CONTENTS



L IS T O F T A B L E S ................................................................................. .................... v i

LIST OF FIGURES .. ................... ............ ........ .............. vii

ABSTRACT .................................................... ................. ix

CHAPTER

1 HISTORY AND LITERATURE REVIEW .................................................

G em in iv iru s H isto ry ................. ....................................................... ..................... 1
Taxonom y and N ucleotide Functions...................................................... ...............3...
B egom viruses ..........................................................................................5..........
The G enus Sida ............................................................................... . .................6
V iruses Infecting Sida spp ..................................................... ..... ......... ...............7...
Begomoviruses Infecting Sida spp. in Florida....................................... ............... 10

2 CHARACTERIZATION OF A NEW BEGOMOVIRUS ISOLATED FROM Sida
santarem ensis M onteiro in Florida.................. .................................................. 12

M materials and M ethods .. ..................................................................... ............... 13
V iru s S o u rce ........................................................................................................ 13
B egom ovirus D election ........................................ ....................... ............... 13
C loning and Sequencing ................................................................. .............. 14
M olecular Characterization of the V irus ........................................ ................ 15
B biological characterization ............................................................. ............... 15
B iolistic inoculation ...................................... .. ........ .. .... ...... .. .......... .. 16
W hitefly inoculation ................................................................ ............... 16
D election of SiGM oV in Test Plants.............................................. ............... 17
R esults....................................................................................................... . 18
Phylogenetic A analysis ......................................................... .. .. .. ... .. ........ .... 18
Nucleotide and Amino Acid Sequence Analysis............................................19
B biological Characterization ................. ........................................................... 19
D isc u ssio n ................................................................................................................ .. 2 7









3 AN EPIDEMIC IN TOMATO CAUSED BY VARIANTS OF Sida golden mosaic
v ir u s ............................................................................................................................ 2 9

M materials and M ethods .. ..................................................................... ................ 29
Sample Source ................................... ...................... .. ... ............... 29
PCR Analysis and Restriction Analysis ......................................................... 29
C lo n in g ............................................................................................................ . 3 0
G ap and B last A naly sis ........................................ ....................... ................ 30
P hylogenetic A naly sis ......................................... ........................ .................. 30
R e su lts............... ................. ....... ................................................................ ........ .. 3 1
Partial Sequence Analysis from Tomato and S. acuta ..................................31
Phylogenetic Analysis ............................. ............................................ 33
D isc u ssio n ................................................................................................................ .. 4 4

L IST O F R E FE R E N C E S ... ........................................................................ ................ 46

BIOGRAPHICAL SKETCH ..................................................................................... 51





































v















LIST OF TABLES


Table page

2-1 Comparison of the nucleotide sequence identity of the DNA-A of Sida golden
m o title v iru s .............................................................................................................. 2 1

2-2 Comparison of the nucleotide sequence identity of the DNA-B of Sida golden
m o title v iru s .............................................................................................................. 2 1

2-3 Comparison of the open reading frame nucleotide and common region sequences
identity of the DNA-A of Sida golden mottle virus ...........................................22

2-4 Comparison of the open reading frame and common region nucleotide sequences
identity of the DNA-B of Sida golden mottle virus ...........................................22

2-5 Comparison of the open reading frame amino acid sequences similirity of the
DN A -A of Sida golden m ottle virus.................................................... ................ 23

2-6 Comparison of the open reading frame amino acid sequences similirity of the
D N A -B of Sida golden m ottle virus.................................................... ................ 23

2-7 H ost range study of SiG M oV ...................................................................................24

3-1 The nucleotides identity of partial sequences of SiGMV DNA-A........................38

3-2 The nucleotides identity of partial sequences of SiGMV DNA-B ...........................38

3-3 The Common region nucleotides identity of SiGMV DNA-A sequences isolated
from tom ato and S. acuta ......................................... ........................ ................ 39

3-4 The Common region nucleotides identity of SiGMV sequences isolated from
tom ato and S. acuta .............. .................. ................................................ 39

3-6 The nucleotide identity of partial sequences DNA-B sequences isolated from
tom ato and S. acuta .............. .................. ................................................ 4 1















LIST OF FIGURES


Figure page

2-1 Sida santaremensis infected with Sida golden mottle virus showing typical ........20

2-2 Phylogenic tree of complete nucleotide of a component of selected
begom viruses w ith SiG M oV ........................................................... ................ 25

2-3 Phylogenic tree of complete nucleotide of B component of selected
begom viruses w ith SiG M oV ........................................................... ................ 26

3-1 Partial sequence of DNA-A (S3-C7A) amplified from Sida acuta collected
from C itra F ield, F lorida ....................................... ........................ ................ 33

3-2 Partial sequence of DNA-A (T3-C8A) amplified from tomato plant collected
from C itra F ield, F lorida ........................................ ........................ ................ 34

3-3 Partial sequence of DNA-A (T5-C2A) amplified from tomato plant collected
from C itra F ield, F lorida ........................................ ........................ ................ 34

3-4 Partial sequence of DNA-A (T10-C8A) amplified from tomato plant collected
from C itra F ield, F lorida ........................................ ........................ ................ 35

3-5 Partial sequence of DNA-A (T10-C10A) amplified from tomato plant collected
from C itra F ield, F lorida ........................................ ........................ ................ 35

3-6 Partial sequence of DNA-A (T12-C6A) amplified from tomato plant collected
from C itra F ield, F lorida ........................................ ........................ ................ 36

3-7 Partial sequence of DNA-B (S3-C4B) amplified from Sida acuta collected from
C itra F ield, F lorida ... ................................................................... . .......... 36

3-8 Partial sequence of DNA-B (T12-C3B) amplified from tomato plant collected
from C itra F ield, F lorida ........................................ ........................ ................ 37

3-9 Partial sequence of DNA-B (T12-C5B) amplified from tomato plant collected
from C itra F ield, F lorida ........................................ ........................ ................ 37

3-10 Partial sequence of DNA-B (T12-C7B) amplified from tomato plant collected
from C itra F ield, F lorida ........................................ ........................ ................ 37









3-11 Partial sequence of DNA-B (T12-C9B) amplified from tomato plant collected
from C itra F ield, F lorida ........................................ ........................ ................ 38

3-12 Phylogenic tree of partial nucleotide sequence of DNA-A of selected
begomoviruses with the SiGMV and the SiGMV sequences isolated from
to m ato an d S a cu ta ................................................................................................ 4 2

3-13 Phylogenic tree of partial nucleotide sequences of DNA-B of selected
begomoviruses with the SiGMV and the SiGMV sequences isolated from
tom ato and S. acuta ........................................................................... .............. 43















Abstract of Thesis Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Master of Science

Characterization of Two Begomoviruses Isolated from Sida santaremensis Monteiro and
Sida acuta Burm. f.

By

Hamed Adnan Al-Aqeel

December 2003

Chair: Jane E. Polston
Major Department: Plant Pathology

A new bipartite begomovirus was isolated and characterized from Sida

santaremensis. The proposed name of this new begomovirus is Sida golden mottle virus

(SiGMoV). The SiGMoV DNA-A is not similar to any characterized DNA-A

begomovirus obtained by Blast analysis. However, the SiGMoV DNA-B shows some

similarity with Tomato mottle virus and Abutilon mosaic virus. SiGMoV was able to

infect Lycopersicon esculentum Mill. (FL Lanai), Phaseolus vulgaris L. (Topcrop),

Gossypium hirsutum L. (elta Pine 70), Nicotiana benthamiana (Domin), and N.

tabacum L. (V20) based on biolistic inoculation.

In fall of 2002, an epidemic was observed in a tomato field in Citra, FL. The plants

in this field were 100% infected and showed symptoms of small upwardly-curled leaves

with chlorotic margins, and stunting of the plants, that were nearly identical to those

described for Tomato yellow leaf curl virus. The amplification of 1254-1295 nt fragment

with degenerate primers PARlc496 /PALlv1978 and the amplification of 616-639 nt









fragment with degenerate primers, PBL1240/PCRc 154, suggests the presence of a

bipartite begomovirus. Analysis of these partial sequences showed that the epidemic was

caused by a strain of Sida golden mosaic virus. Gap and phylogenetic analyses showed

the presence of two diverse DNA-B sequences.














CHAPTER 1
HISTORY AND LITERATURE REVIEW

Geminivirus History

Long before geminiviruses were identified to cause plant diseases, the symptoms

caused by these viruses were noted. A poem written by the Empress Koken in Japan in

752 AD, which described the beauty of yellow veins of Eupatorium chinense L. leaves,

may be the earliest record of a geminivirus [28]. For many years, plants with

geminivirus-incited symptoms of yellow leaf veins and bright golden mosaics were

selected and cultured long before the cause of these symptoms was known. There is a

record in 1809 of the collection and movement (from the West Indies to Europe) of

Abutilon sellovianum var. marmorata plants with mosaic symptoms now known to be

caused by Abutilon mosaic virus [61].

Economic losses caused by geminiviruses were not described until the end of the

1800s, when several disease outbreaks that we now know to be caused by geminiviruses

were reported from various locations around the globe. In 1894, cassava mosaic disease

was reported in cassava in East Africa [63]. The cause of this disease is now known to be

the geminivirus, African cassava mosaic virus (ACMV). Five years later, epidemics of

beet curly top disease in sugar beet were reported from California [44, 61]. The cause of

this disease was later identified as the geminivirus, Beet curly top virus (BCTV). A

disease of maize known as streak disease was reported in South Africa in 1901 [22]. The

cause of this disease is the geminivirus, Maize streak virus (MSV).









The viral nature of geminiviruses was suggested in some of the earliest studies of

viruses. In 1899, Beijerinck compared the mosaic symptoms of tobacco and mosaic

symptoms of A. sariatum Dicks. ex Lindl. and concluded that they were related [14, 30].

Seven years later, Zimmermann suggested that the mosaic disease of cassava was caused

by a virus [63]. By 1925, Story studied the symptoms and ability of leafhoppers to

transmit streak disease of maize and concluded that streak disease of maize was caused

by a virus which was transmitted by a leafhopper [62]. By 1931, Kirkpatrick reported the

whitefly as a vector of leaf curl of cotton [39]. In approximately 1932, Ghesuiere

suspected that whiteflies were the vector of the causal agent of cassava mosaic disease

[63]. This suspicion was later confirmed by Storey in 1934 and Golding in 1936 [63].

The unique characteristics of geminiviruses were not clear until the 1970s, at which

time geminate virus particles were observed by electron microscopy and the nature of the

viral nucleic acid was determined. Bennett in 1971[48], observed small spherical bodies

in filtered phloem sap of sugar beet infected with BCTV; his observation was confirmed

by Mumford [48] in 1974. In 1972, Plasvic and Maramorisch observed isometric particles

in thin sections of maize infected with MSV. This observation was confirmed in 1974 by

Bock et al. [4]. Three years later in 1977, the nucleic acid of geminivirus was identified

as a single-strand of DNA [27]. One year later, geminiviruses were recognized as a new

virus group [44].

In 1978, plant viruses were classified into families. The Geminiviridae family

consists of plant viruses with a single-stranded DNA (ssDNA) genome that is

encapsidated into a unique geminate capsid structure [44]. Geminivirus genomes are

either bipartite or monopartite. Bipartite genomes are divided into two components: A









component (DNA-A) and B component (DNA-B). DNA-A contains the gene required for

encapsidation of progeny and viral DNA replication. DNA-B contains the genes required

for viral movement (for movement of viral DNA from host cytoplasm to host nucleus;

and for cell-to-cell movement in infected host plants) [45, 49]. In monopartite

geminiviruses, all of the genes are found in one component [45]. An intergenic region

(IR) contains the common region (CR) found in all monopartite and bipartite

geminiviruses. The IR is believed to play a role in the initiation of DNA replication. In

bipartite genome geminivirus, the CR is highly conserved between DNA-A and DNA-B

[38].

Although geminiviruses have a small genome (about 5000 nt for bipartite and about

2800 nt for monopartite viruses) and few genes, they have an efficient means of

replication. The strategy of replication of the ssDNA genome begins by converting

ssDNA into double-stranded DNA (dsDNA) starting at the stem loop. This dsDNA is

used as a template to amplify viral dsDNA and to produce mature ssDNA in a process

known as a rolling-circle replication mechanism [24]. Recently, Jeske reported

recombination-dependent replication as another method of geminivirus replication [36].

Taxonomy and Nucleotide Functions

Geminiviruses are currently divided into four genera (based on genome

organization and structure, host range, and insect vector) [19]. The genera are Curtovirus,

Topocuvirus, Mastrevirus, and Begomovirus.

The Curtoviruses, type species BCTV, have a monopartite genome, are transmitted

by leafhoppers, and infect dicot plants. Seven proteins are encoded by the Curtovirus

genome. Three proteins are encoded on the viral-sense (v-sense) strand: the movement

protein (MP) which is responsible for cell-to-cell movement; the capsid protein (CP)









which is responsible for forming the viral capsid; and the V2 protein that converts

double-stranded DNA to single-stranded DNA. Four proteins are encoded on the

complementary sense (c-sense) strand: the Replication initiation protein (Rep) by which

viral replication starts; the replication enhancer protein (REn); and C4 protein (which

determines symptom expression). An extra open reading frame is also recognized (known

as the C2) whose function is unknown [6, 24].

Topocuvirus, type species Tomato pseudo-curly top virus (TPCTV), has only one

member virus that has a monopartite genome; is transmitted by the treehopper; and

infects dicot plants. Six proteins are encoded by the TPCTV genome. On the v-sense

strand, two proteins are encoded: the V2 and the CP. On the c-sense strand four proteins

are encoded: Rep, C2, REn, and C4 [5, 6].

Mastrevirus, type species MSV is a genus that consists of viruses with a

monopartite, genome that are transmitted by leafhoppers; and infect both monocots and

dicots. The genome consists of two intergenic regions: one large (LIR) and one small

(SIR) located on opposite sides on the viral genome. Two features are unique to this

genus: the first is the presence of an -80 nt-long DNA sequence annealed to a region

within the SIR, which is present inside the viral particle. The second feature is the

presence of a splicing event on the c-sense transcript. Four proteins are encoded by the

genome; two on the c-sense strand (the MP and CP); and two on the v-sense strand (the

Rep A protein and the Rep protein) [25, 38, 51].

Begomovirus, type species Bean golden mosaic virus (BGMV), is the largest genus

in the family. The viruses in this genus are transmitted by the whitefly (Bemisia tabici)

and they infect primarily dicot plants. Most begomovirus species consist of a bipartite









genome and few are monopartite. DNA-A encodes five proteins which are the CP, on the

v-sense strand, and the Rep, TrAP (a transcriptional activator), REn, and C4 on the c-

sense strand. DNA-B encodes two proteins: the nuclear shuttle protein (NSP) and the MP

on the c-sense and v-sense strands, respectively. [5, 18, 24, 61].

Recently small circular single stranded satellite DNAs (DNA 13) have been found to

be associated with some Old World monopartite begomoviruses. The DNA 13 is about

1330 nucleotides and several have been isolated and sequenced [7, 16]. It is believed that

the DNA 13 play an important roll in the severity of the symptoms, begomovirus

pathogenicity, and host range of the associated begomovirus [46].

Begomoviruses

Begomoviruses can be one of the biggest threats to tomato production. In the early

1990s, 95% of tomato fields were destroyed in the Dominican Republic due to

begomoviruses, primarily Tomato yellow leaf curl virus (TYLCV) [47]. In the 1991-1992

production season, the begomovirus Tomato mottle virus (ToMoV) cost the tomato

growers in Florida about $140 million [47].

The whitefly Bemisia tabaci is the vector of begomoviruses. When adults feed on

infected plants; virus is usually transferred with food material through the salivary canal

to the mid-gut and from the mid-gut it passes into the hemolymph. The virus is then

circulated with normal hemolymph. It then passes into the salivary glands. As the

whitefly feeds in healthy plants, the virus is transmitted with the saliva to the plant via the

salivary canal [13, 35]. The coat protein of begomoviruses has been shown to play an

important role in the circulation of the virus in the vector [33].









The Genus Sida

Sida is the Greek word for a water plant, but the allusion to this genus is still

unclear. According the USDA data base (www.itis.usda.gov), there are about 27 species

of Sida worldwide. Sida is usually found in roadsides, gardens, waste places, barn yards,

canal banks, and fallow and cultivated fields. The way to grow Sida is either by asexual

propagation using cuttings of young green stems or by cultivation of seed under direct

sun light and dry conditions. Seed of Sida spp. are covered with a thick layer of an

unknown chemical that blocks water from penetrating, leaving the seed in a dormant state

[55].

In 1975 Ghosal and his group were able to analyze S. cordifolia L. chemically. The

chemical analyses showed S. cordifolia contains three types of chemicals: 3-

phenethylamines (viz. 3-phenethylamines, ephedrine, and pseudoephedrine),

carboxylated tryptamines (S-(+)-N-methyltryptophane methyl easter and hypaphorine),

and quinazoline alkaloids (vasicinone, vasicinol, and vasicine). Moreover, different parts

of the plant contain the same chemicals but in different concentrations. Ghosal reported

the concentrations of those chemicals changed with plant age [23].

Genomic analysis of a selected Sida spp. done by Hazra showed that they have

chromosome numbers that range from 2n=14 to 2n=32. In details, S. rhombifolia var. C,

S. rhombifolia var. D, and S. rhombifolia var. E are 2n= 14. S. acuta, S. rhombifolia var.

A, and S. rhombifolia var. B are 2n=28. S. cordifolia, S. glutinosa Comm. ex Cav., and

S. veronicaefolia Lam. are 2n=32 [29].

Sida plants are good source of fiber; and some Sida species are used in traditional

medicine. S. rhomboidea L. and S. cordifolia are used for their anti-inflammatory activity

[20, 64]. S. cordifolia contains a high amount of ephedrine and pseudoepherdrine









components which have medical uses. In nature, Sida plants play an important roll in

reducing erosion of nitrogen, organic carbon, calcium, potassium, and sodium from soil

[40, 41].

Viruses Infecting Sida spp.

Viruses that infect Sida spp were considered as a part of Infection Chlorosis of

Malaveace virus group for many years. In the nineteenth century, the major tools used by

botanists to classify and identify the causal agent of plant diseases were symptom

expression, ability to see the pathogen with a microscope, and the method of

transmission. Based on the presence of mosaic symptoms, inability to visualize any

pathogen in infected cells [42], and transmission by grafting, a group of plant viruses was

classified as one group, known as the Infectious Chlorosis of Malaveace. The written

record begins with the movement of A. striatum with a mosaic symptoms to Europe from

the Caribbean in 1868 [37]. One year later, Lemoine was able to transfer the Infectious

Chlorosis of Malaveace to another species of Abutilon by grafting. In the same year,

Masters reported the graft transmission of Infectious Chlorosis of Malaveace from A.

pictum 'Thompsonii' to other Malaveace species including S. napaea Cav. [30, 37]. In

1899, Beijerinck suggested the viral nature of Infectious Chlorosis of Malaveace after

comparing symptom expression of A. striatum and tobacco infected with Tobacco mosaic

virus (TMV) [30]. Between 1904 and 1908, Baur studied the transmission of Infectious

Chlorosis of Malaveace from A. indicum L. by sap and seed. He reported the inability to

transmit the symptoms by sap or seed. Interestingly, he concluded that the lack of seed or

sap transmission was because the too low virus titer in the seed to produce a disease in

new seedlings [37]. Today we know begomoviruses are not seed transmitted and hard to

be sap transmitted. In 1926, Hein proved the Infectious Chlorosis of Malaveace cause the









degradation of plastids and the disease move from cell-to-cell [31]. In 1927, Hertzsch

was the first person to recognize variation within Infectious Chlorosis of Malaveace. He

recognized the existence of two types of viruses within the Malvaceae. He call them Type

A and Type B; each had a unique host range and produced different symptoms in the

same hosts [37] By 1931, Cook reported from the West Indies that seeds of A. hirtum

Lam. produced only healthy green seedlings, and concluded that the Infectious Chlorosis

is not seed transmissible [37].

High temperature, hot water or sulphuric acid treatments, and physical disruption of

seed coat are the major methods used to break the dormancy of the seed [17].

Although in 1899, Beijerinck suggested the viral nature of Infectious Chlorosis of

Malaveace, the nature of this disease was not clear for many botanists. Several

hypotheses were raised by scientists until the 1940s to explain Infectious Chlorosis of

Malaveace. One was that the nature of Infectious Chlorosis of Malaveace was

spontaneous and due to genetic crossing between white and green genes [60]. Another

popular hypothesis referred to metabolic and enzymatic activity of plant cells as a reason

for mosaic symptoms [59]. A third one suggested the presence of an ultramicroscopic

pathogen [42] which ultimately replaced all other hypotheses by the 1940s. In 1943,

Silberschmidt studied Infectious Chlorosis of Malaveace using three species of Sida

showing mosaic symptoms (S. acuta, S. rhombifolia, and S. cordifolia). In his study he

was able to observe the limitations of moving the symptoms from one species to another

[58]. He explained these results by concluding that some species of Sida have immunity

against the Infectious Chlorosis of other species. Today we know that different Sida

species can be infected with different begomoviruses or different viruses. In 1945, just









two years after Silberschmidt's work, the whitefly was reported to be the vector of

Infectious Chlorosis of Malaveace [11]. In 1946 Orlando and Silberschmidt published a

paper proving the whitefly was the vector of Infectious Chlorosis of Malaveace using S.

rhombifolia [50]. Those two papers are considered to be one of the earliest reports

demonstrating the ability of the whitefly to vector a begomovirus in Western

Hemisphere.

The begomoviruses that infect Sida species were also considered to be strains of

Abutilon mosaic virus for a time. This was because of the similar symptoms and the

ability of some Sida begomoviruses to infect species of both Sida and Abutilon [11, 50].

In 1953, Costa and Bennett suggested again that the whitefly was the vector of a virus

they called AbMV after studying whiteflies population on Sida sp [10]. In 1955, Costa

published a study on AbMV that naturally infecting Sida (this at indication that Costa

mixed between the begomoviruses infecting Sida with AbMV). He reported the ability to

transmit a begomovirus infecting S. micrantha ST. Hill. and S. rhombifolia to other plants

by means of whiteflies [11]. In 1960, Costa published study on the mechanical

transmission of a begomovirus from Sida (which was referred to as AbMV) to selected

plant hosts. He also reported on the difficulty in transmission of geminiviruses by

mechanical means [12].

Species of Sida with mosaic symptoms have been reported from many locations in

Latin America [3]. In Puerto Rico, S. carpinifolia L.f. with other species of Sida shows

mosaic virus symptoms have been reported from different places in the island. These

mosaic symptoms believed to be transmissible via whitefly [3]. In El Salvador, mosaic









symptoms were observed in Sida spp and were shown to be transmissible to healthy Sida

spp and cotton [3].

Viruses other than begomoviruses have been reported to infect species of Sida. S.

alba in Zimbabwe was demonstrated to be a host of Turnip mosaic virus which belongs

to the Potyviridae family [8]. In Nigeria S. acuta and S. rhombifolia were able to be

inoculated with Okra mosaic virus which belongs to the Tymoviridae family [1].

Begomoviruses that infect species of Sida were not characterized until the 1990s,

by which time sequencing was the primary method used to characterize and compare

different begomovirus species. In 1997, Hofer et al. reported a new bipartite begomovirus

which was isolated from S. rhombifolia in Costa Rica and know as Sida golden mosaic

Costa Rica virus (SiGMCRV) (GenBank Accession No. X99550 and X99551) [33]. In

the same year, Frischmuth et al. reported two bipartite begomoviruses with one extra

DNA-B isolated from S. rhombifolia in Honduras. The first one is called Sida golden

mosaic Honduras virus (SiGMHV) (GenBank Accession No. Y1 1097 and Y1 1098), the

second is the Sida yellow vein virus (SiYVV) (Accession No. Y1 1099 and Y1 1100) [21],

and the DNA-B has the Genbank Accession No. AJ250731 [34]. Recently, two DNA-A

have been reported from Brazil from Sida spp. (Genbank Acc. No. AY090555 and

AY090558) [19].

Begomoviruses Infecting Sida spp. in Florida

Probably one of the earliest study on Sida begomoviruses in Florida was published

in 1930 when Kunkel reported the ability of a mosaic disease to infect S. rhombifolia and

other Sida spp. by budding or grafting but not by mechanical methods [43]. He also

showed the this mosaic disease was not transmitted through seeds and pointed out that it

resembled AbMV based on symptoms and method of transmission [43]. In 1953, Costa









and Bennett reported that Sida spp. in Orlando, Florida, were probably infected with

AbMV and hypothesis that this virus may transmissible by the whitefly (Bemisia tabaci)

[10]. By 1990s, scientists in three labs at the University of Florida begin studying

begomoviruses of Sida. In 1993, the laboratory of E. Hiebert in Gainesville was able to

characterize a begomovirus that infects S. acuta known Sida golden mosaic virus

(SiGMV) (GenBank Accession No. AF049336 and AF039841) [32]. In Homestead,

partial sequences of two DNA-As from S. acuta were reported (GenBank Accession No.

U77963, U77964) [19]. In Bradenton, begomovirus-like symptoms were observed in S.

santaremensis.














CHAPTER 2
CHARACTERIZATION OF A NEW BEGOMOVIRUS ISOLATED FROM Sida
santaremensis Monteiro in Florida

The genus Sida is a group of wild plants that is distributed throughout both the New

and Old World [3, 9, 20, 41]. Several species of Sida have been reported as hosts of

whiteflies, specifically Bemisia tabaci Genn. biotype B, as well as begomoviruses [10].

Begomoviruses, a genus of plant viruses that belong to the family Geminiviridae, are

plant viruses with a single-stranded circular DNA genome. The whitefly, B. tabaci, is the

only known insect vector of begomoviruses [35]. The relationship between Sida spp.,

begomoviruses, and whiteflies has been recognized since the 1950s [10-12].

Recently, several begomoviruses have been characterized from different species of

Sida in the New World [21, 33]. In Costa Rica a bipartite begomovirus known as Sida

golden mosaic Costa Rica virus (SiGMCRV) has been isolated and characterized from S.

rhombifolia L. [33]. In Honduras two bipartite begomoviruses, known as Sida golden

Honduras mosaic virus (SiGMHV) and Sida yellow vein virus (SiYVV), and an extra B

component (DNA-B) have been isolated and characterized from S. rhombifolia [21]. In

Brazil, two A components (DNA-A) have been sequenced and characterized from Sida

spp. [19]. In Jamaica, a partial clone of a begomovirus was obtained from S. urens L. and

partial sequences of other begomoviruses have been found in an unreported species of

Sida.

There are ten species of Sida found in Florida (http://www.plantatlas.usf.edu) and

bright golden mosaic symptoms, typical of those caused by begomovirus, have been









observed in several species. Several begomoviruses have been reported from S. acuta

Burm. f. found in several counties. In S. acuta from Dade Co., two partial sequences of

begomovirus DNA-A were obtained (Genbank Acc. No. U77963, U77964; data not

published). Sida golden mosaic virus (SiGMV) was found in S. acuta in Alachua Co.

(Genbank Acc. No. AF049336 and AF039841) (data not published).

This study reports on the identification and characterization of a new begomovirus

isolated from Sida santaremensis Monteiro in Manatee Co. FL.

Materials and Methods

Virus Source

The virus was isolated from a plant of S. santaremensis showing bright golden

mosaic symptoms (Fig. 2-2), which was originally collected from behind greenhouses

located at the University of Florida, Gulf Coast Research and Education Center,

Bradenton, FL. in January 1997. Plants were identified to species by curators at the

Florida Museum of Natural History, University of Florida, Gainesville, FL. A culture of

the virus was maintained in the greenhouse by periodically reproducing infected plants

through cuttings made from young stems with symptomatic leaves.

Begomovirus Detection

DNA was extracted from leaves of S. santaremensis which displayed golden

mosaic symptoms using a modification of a protocol reported by Doyle and Doyle [15].

The plant tissue was ground in CTAB buffer in the absence of liquid nitrogen, and DNA

was precipitated in isopropanol for one hour at -200C. Degenerate primer pairs

(PAR1c496/PALlv1978, and PBL1240/PCRcl54) were selected to detect begomovirus

DNA [56]. PARlc496/PALlv1978 amplify an ~1100 bp from the begomovirus A

component (DNA-A) of most bipartite begomoviruses and a -1300 bp fragment from









most monopartite begomoviruses. This fragment includes the 3' end of the putative Coat

Protein gene (CP), the entire common region (CR), and a part of the putative Replication

Association Protein gene (Rep) [56]. PBL1240/PCRcl54 amplify an -600 bp fragment

from the B component (DNA-B) of most bipartite begomoviruses. This fragment includes

the 3' end of the putative Nuclear .h/m/le Protein gene (NSP) [65] and part of the CR

sequence [56]. The PCR reaction contained 2.5 mM Mg2+ 50 pM of each primer, 12.5

pM of of dNTPS, 12.5 mM Spermidine, and 1U Taq polymerase. The PCR condition was

started with a DNA denaturation step of 940C for 5 min. followed by 35 cycles of 60 sec.

of denaturing, 60 sec. of annealing at 550C, and 60 sec. of extension at 720C. The

reaction was terminated with a final extension at 720C for 5 min. The PCR reaction was

carried out using gene amp PCR system 9700 or 2700 (Applied Biosystems, The Perkin

Elmer Corp. Norwalk, CT).

Cloning and Sequencing

The amplicons obtained with the above mentioned primers were cloned and

sequenced. Sequences of the fragments were used to design primers using Wisconsin

package (GCG) which would amplify the DNA from the remainder of the genome. After

obtaining the complete sequences of DNA-A and DNA-B, a restriction map was

constructed for both. In order to obtain an infectious clone, a single restriction site (Apal)

at the 5' end of the Rep gene was identified for DNA-A and a single restriction site

(Ncol) in the Movement Protein gene (MP) was identified for DNA-B. The DNA

extracted from leaves of S. santaremensis was, digested with the respective enzyme and a

DNA fragment of z2600 bp was obtained. This DNA was gel purified using a gel

purification kit (Qiagen Sciences, Germantown, MD) and cloned into plasmids. The









linear full length DNA-A was cloned into pBluescript KS (-) [Stratagene, La Jolla, CA]

and the DNA-B into pLitmus 28 (New England Biolabs, Beverly, MA).

Molecular Characterization of the Virus

After obtaining the complete sequences of DNA-A and DNA-B, open reading

frames were determined using Vector NTI software (Infomax, Frederick, MD). Sequence

comparisons were made by NCBI BLAST using the NCBI taxonomy database

(http://www.ncbi.nlm.nih.gov/). Based on this analysis the 13 begomoviruses with the

highest nucleotide sequence identity to SiGMoV were selected for further comparisons.

The nucleotide sequences of whole genomes as well as individual genes were compared.

The same begomoviruses where used in the phylogenetic analysis at which the

alignment of full length nucleotide sequences would begin at the ATAATT sequences of

the stem loop [2]. The comparison were based on maximum parsimony using the

PAUP*s heuristic method with the bisection-reconnecting branch swapping. The

Bootstrap value was set to be based on 500 replicates. Display tree was with no rooting

using the midpoint rooting option.

Biological characterization

A host range study was conducted using two methods of inoculation, biolistic

inoculation with the infectious clones and whitefly inoculation. SiGMoV from S.

santaremensis biolisticly which had been inoculated with the infectious clones and give a

positive result for SiGMoV using PCR and dot spot hybridization. The host plants were

grown from seed in a greenhouse. The host plants tested in this study were: common bean

(P. vulgaris), cotton (G. hirsutum), N. benthamiana, tobacco (N. tabacum), pepper

(Capsicum annuum L. 'Calwonder'), S. santaremensis, and tomato (L. esculentum).









Biolistic inoculation

The infectious clones were grown overnight in 400 ml of 2XYT media with 1%

Ampicillin and the plasmid DNA was extracted using QIAGEN Plasmid Maxi Kit

(Qiagen Sciences, Germantown, MD). Approximately 5.8 itg/ipl of the DNA-A plasmid

and 2.4 itg/ipl of DNA-B plasmid DNA were obtained. The viral insert of the DNA-A

was released from the plasmid by an overnight digestion with Apal which cut at the

insertion site. Ncol was used in overnight reaction to release the DNA-B from the

plasmid. The restriction reaction was stopped by precipitating the DNA using 0.1 vol.

sodium acetate and 3 vol. isopropanol. The DNA was then dissolved in 50 ipl of water

and the concentration of DNA was determined using a spectrophotometer. Both DNA-A

and DNA-B were mixed together to make a total of 25.0 ng, which was bound to sterile

1.0 tm in diameter spherical gold particles (Biorad, Hercules, CA). This mixture was

then treated with 2.5 M calcium chloride and 0.1 M spermidine and allowed to sit for 15

minutes at room temperature. Then, it was washed with 70% isopropanol followed by

100% isopropanol. Finally the mixture was re suspended on 60 pl of 100% isopropanol.

About 10 ipl of gold and DNA mixture were biolisticly inoculated into each host plant

using a gene gun [57].

Whitefly inoculation

A virus-free whitefly colony was established by allowing the virus-free whiteflies

to feed on cotton. After 21 days, a new generation of adults was collected and used in

transmission experiments.

Virus-free adult whiteflies were given an acquisition access period of 3 days on

SiGMoV-infected S. santaremensis. These S. santaremensis plants were three-week old

plants propagated as cuttings from S. santaremensis plants that had been biolisticly









inoculated with SiGMoV. The S. santaremensis plants used as acquisition hosts showed

strong mosaic symptoms and were positive by PCR analysis for SiGMoV. The selected

host plants were introduced to whiteflies that feed on S. santaremensis, and the S.

santaremensis plants were shaken so that the whitefly adults could be removed. The S.

santaremensis, was then isolated in a different cage. Whiteflies were given a 3 day

inoculation access period which was terminated by the addition of a drench of

imidacloprid, a systemic insecticide (Bayer Corp., Kansas City, Missouri). Inoculated

plants were kept in an isolated cage in greenhouse.

Detection of SiGMoV in Test Plants

The presence of SiGMoV in test plants was determined by visual assessment of

symptoms beginning two weeks after inoculation and continuing for two months in

summer months. In winter months the symptoms were recorded every three weeks

starting at three weeks after inoculation. Each time symptoms were recorded a leaf

sample was collected from each plant and analyzed by PCR and by dot spot

hybridization.

Samples were tested for virus using dot spot hybridization. The full length DNA-B

of the virus was used as a probe under conditions of high stringency [52].

The presence of SiGMoV was confirmed in plants testing positive by dot spot

hybridization using PCR. Plant samples collected from N. benthamiana, N. tabacum,

common bean, and tomato were extracted as described above. Plant samples of S.

santaremensis, cotton and pepper were extracted using the protocol described by

Porebski [54]. Degenerate primer pairs PARlc496/PALlv1978 for the DNA-A and

PBL1240 and PCRcl54 for DNA-B were used [56]. The homology analysis using Vector









NTI software of those primers and SiGMoV shows that primers PAR1c496/PALlv1978

have a homology of 91.2% and 88.8% at binding sites, and primers PBL1240/PCRc154

have the homology 87.5% and 69.7%. The positive results were further analyzed using a

set of primers to specifically bind to SiGMoV. They were JAP85

3'GCTCTCTCGCTCAAAAGTCTAG5' which binds in the CR of SiGMoV and the

degenerate primer AC1048 [65] which binds in the 5' end of the CP and has a homology

of 87.7% with SiGMoV.

Results

S. santaremensis (common name: moth fanpetals) is a species of Sida that was

reported from Hillsborough and Pinellas counties in Florida

(http://www.plantatlas.usf.edu). However, according to the USDA plant database S.

santaremensis is not native to the U.S.A (http://plants.usda.gov/topics.html). This is the

first report of this species of S. santaremensis in Manatee Co.

Full length sequences of both DNA-A and DNA-B were obtained from

symptomatic plants of S. santaremensis. The sequences were numbered beginning at the

first nucleotide of the CR sequence shared by DNA-A and DNA-B. The DNA-A was

found to have five open reading frame and the DNA-B was found to have two open

reading frames which is an arrangement typical of many bipartite begomoviruses

[19].The sequence identity of the CR (125 nt) between DNA-A and DNA-B was 95.2%.

Phylogenetic Analysis

The phylogenic analysis of SiGMoV DNA-A indicates that the DNA-A does not

cluster with any characterized begomovirus (Fig. 2-2). However, the DNA-B clustered

within the AbMV group (Fig. 2-3).









Nucleotide and Amino Acid Sequence Analysis

A comparison of SiGMoV DNA-A and DNA-B nucleotide sequences with ten

other characterized begomoviruses confirmed the results obtained by the phylogenetic

analysis (Tables 2-1 and 2-2). The comparison shows that DNA-A of SiGMoV

nucleotide sequences identities ranged from 78.6 to 83.0% (Table 2-1.) Sida golden

mosaic Honduras virus and Sida golden yellow vein virus had the greatest nucleotide

sequences identity with SiGMoV. A comparison of the nucleotide sequence identities of

DNA-B of SiGMoV showed a range of 66.5 to 78.3%, the most similar virus being

AbMV (Table 2-2).

A comparison of selected regions and open reading frames did not reveal any close

relationships with other begomoviruses. The CR of DNA-A of SiGMV was somewhat

similar to that of PYMV-VE (87.1%) but the CR of the DNA-B showed less identify with

PYMV-VE (60.8%) than with PYMV (80.7%) (Tables 2-3 and 2-4). The comparison of

open reading frames on the DNA-A with those of SiGMoV showed no significant

identities (Table 2-3). Similar results were obtained using the amino acid sequence

similarities of the open reading frames on DNA-A (Table 2-5). However, on DNA-B the

nucleotide and amino acid sequence of the putative MP gene of SiGMoV was fairly

homologous (>90%) to the MP of several characterized begomoviruses (Tables 2-4 and

2-6).

Biological Characterization

The biological characterization was carried out using two methods of transmission,

biolistic inoculation and whitefly transmission, on selected host plants. The detection of

SiGMoV was carried out using: symptom expression, PCR analysis, and dot spot

hybridization. N. benthamiana, N. tabacum, S. santaremensis, bean, tomato and cotton









were all susceptible to infection with SiGMoV by biolistic inoculation (Table 7). Viral

DNA was detected by PCR and dot spot hybridization in these plants two weeks and four

weeks after inoculation. However, symptoms were only observed in species, N.

benthamiana, P. vulgaris, and S. santaremensis In N. benthaniana a mild mosaic was

observed two weeks after inoculation. Four weeks after inoculation the symptoms

observed in N. benthaniana were mosaic, leaf cupping, and shorting. In beans the

symptoms appeared three weeks after inoculation and these were a mild mosaic and

stunting of the plant. In whitefly transmission, only two plants were inoculated from

SiGMoV-infected S. santaremensis plants. Two plants of N. tabacum were determined to

be infected based on PCR and dot spot hyridization. No symptoms were produced in this

plant. Figure 2-1: Sida santaremensis infected with Sida golden mottle virus showing

typical mosaic symptoms.


Figure 2-1. Sida santaremensis infected with Sida golden mottle virus showing typical









Table 2-1. Comparison of the nucleotide sequence identity of the DNA-A of Sida golden
mottle virus with the 13 most closely related begomoviruses identified by
BLAST analysis


Begomovirus


Sida golden mosaic virus
Sida golden mosaic Honduras virus
Chino del tomato virus-[IC]
Sida golden yellow vein virus
Potato yellow mosaic virus-Venezuela
Chino del tomato virus- [H6]
Tomato mottle Taino virus
Abutilon mosaic virus
Abutilon mosaic virus-HW
Bean dwarf mosaic virus
Potato yellow mosaic Trinidad virus
Sida golden mosaic Costa Rica virus
Tomato mottle virus-[Florida]
ACC. No. : GenBank Accession number
1 Begomovirus sequences were selected from the first
analysis.


ACC. NO.


AF049336
Y11097
AF101476
Y11099
D00940
AF226665
AF012300
X15983
U51137
M88179
AF039031
X99550
L14460


% Sequence
Identity
82.1
83.0
82.1
83.0
81.6
81.9
79.7
81.5
81.5
81.5
78.6
79.6
79.6


13 sequences obtained by a Blast


Table 2-2. Comparison of the nucleotide sequence identity of the DNA-B of Sida golden
mottle virus with the 13 most closely related begomoviruses identified by
BLAST analysis
Begomovirus ACC. NO. % Sequence


Abutilon mosaic virus
Tomato mottle virus-[Florida]
Abutilon mosaic virus-HW
Tomato mottle Taino virus
Sida golden mosaic virus
Sida yellow vein virus
Sida golden mosaic vil u '" (Honduras)
Sida golden mosaic Honduras virus
Bean dwarf mosaic virus
Sida golden mosaic Honduras virus- yellow vein
Sida golden mosaic Costa Rica virus
Chino del tomato virus-[IC]
Potato yellow mosaic virus-Venezuela
Potato yellow mosaic Trinidad virus
Chino del tomato virus-[B52/
ACC. No. : GenBank Accession number


X15984
L14461
U51138
AF012301
AF049341
Y11100
AJ250731
Y11098
M88180
Y11101
X99551
AF101478
D00941
AF039032
AF226666


Identity
78.3
77.7
77.0
76.3
75.0
73.4
72.7
72.6
72.4
72.1
72.0
70.2
67.8
66.5
70.9









Table 2-3. Comparison of the open reading frame nucleotide and common region
sequences identity of the DNA-A of Sida golden mottle virus with the 13 most
closely related begomoviruses identified by BLAST analysis


Begomovirus % Sequence Identity
CR CP Rep TrA REn AC4
P
Potato yellow mosaic virus- 87.1 82.1 83.4 78.3 80.3 67.4
Venezuela
Tomato mottle Taino virus 78.4 83.0 80.9 78.3 79.6 61.6
Sida golden mosaic Honduras virus 65.1 86.3 82.4 83.7 85.6 69.8
Sida golden mosaic Costa Rica virus 61.3 82.4 80.5 82.2 81.7 65.1
Sida yellow vein virus 61.6 87.5 81.7 83.0 83.3 76.7
Potato yellow mosaic Trinidad virus 61.3 82.8 78.4 79.1 81.1 64.0
Sida golden mosaic virus 60.0 87.7 81.3 81.4 82.6 67.4
Bean dwarf mosaic virus 56.5 85.3 80.4 82.0 81.1 66.3
Abutilon mosaic virus 55.7 85.5 81.3 78.9 81.1 67.4
Abutilon mosaic virus-HW 54.8 85.2 80.5 82.2 81.8 69.1
Chino del tomato virus-[H6] 54.8 86.7 80.9 83.0 83.3 64.0
Chino del tomato virus-[IC] 54.0 87.0 81.3 83.0 83.3 69.8
Tomato mottle virus-[Florida] 60.0 86.0 79.0 84.2 83.3 81.6


Table 2-4. Comparison of the open reading frame and common region nucleotide
sequences identity of the DNA-B of Sida golden mottle virus with the 13
closely related begomoviruses identified by BLAST analysis
Begomovirus % Sequence Identity
CR NSP MP
Tomato mottle Taino virus 76.8 79.0 93.2
Sida golden mosaic vil -it u(Honduras) 62.4 76.3 93.5
Sida yellow vein virus 62.4 75.9 93.2
Sida golden mosaic Honduras virus 62.1 75.9 94.2
Sida golden mosaic Honduras virus- yellow vein 62.1 75.9 93.5
Bean dwarf mosaic virus 58.9 77.4 92.9
Sida golden mosaic virus 58.4 82.1 94.2
Abutilon mosaic virus 57.6 75.1 93.2
Tomato mottle virus-[Florida] 57.6 80.1 93.9
Abutilon mosaic virus-HW 55.2 73.9 89.8
Chino del tomato virus-[IC] 52.8 75.5 90.5
Sida golden mosaic Costa Rica virus 52.4 74.7 91.8
Potato yellow mosaic Trinidad virus 60.8 79.5 69.1
Potato yellow mosaic virus 80.7 79.4 68.5
Chino del tomato virus-[B52] 53.6 82.9 74.8


most









Table 2-5. Comparison of the open reading frame amino acid sequences similirity of the


DNA-A of Sida golden mottle virus with the 13
begomoviruses identified by BLAST analysis
Begomovirus CP Rep
Abutilon mosaic virus 92.1 87.1
Abutilon mosaic virus-HW 90.4 83.9
Bean dwarf mosaic virus 93.6 86.7
Chino del tomato virus-[H6] 90.6 86.7
Potato yellow mosaic virus- Venezuela 92.8 91.2
Potato yellow mosaic Trinidad virus 92.4 84.1
Sida golden mosaic virus (Honduras) 93.6 87.4
Sida golden mosaic Costa Rica virus 91.3 86.9
Sida golden mosaic virus 92.8 86.0
Sida golden mosaic Honduras virus 93.2 88.5
Sida yellow vein virus 93.6 85.4
Chino del tomato virus-[IC] 93.6 87.0
Tomato mottle Taino virus 91.6 86.2
Tomato mottle virus-Florida 92.3 85.8


most closely related


TrAP
85.9
89.9
85.9
86.1
85.3
84.5
84.5
84.4
86.8
86.8
86.8
86.1
83.7
85.7


REn
84.9
86.4
87.1
88.6
84.9
85.6
91.7
89.2
87.1
90.9
89.4
88.6
86.4
86.4


Table 2-6. Comparison of the open reading frame amino acid sequences similirity of the
DNA-B of Sida golden mottle virus with the 13 most closely related
begomoviruses identified by BLAST analysis
Begomovirus NSP MP
Sida golden mosaic virus 87.2 96.3
Tomato mottle virus-Florida 85.2 96.3
Tomato mottle Taino virus 84.8 95.9
Bean dwarf mosaic virus 84.1 95.6
Sida golden mosaic vi it '"' (Honduras) 81.7 95.2
Sida golden mosaic Honduras virus 81.7 95.9
Abutilon mosaic virus 81.3 95.9
Sida yellow vein virus 81.3 95.2
Sida golden mosaic Honduras virus-yellow vein 81.3 94.9
Chino del tomato virus-[IC] 80.9 93.9
Abutilon mosaic virus-HW 80.6 93.2
Sida golden mosaic Costa Rica virus 80.2 95.2
Potato yellow mosaic Trinidad virus 73.6 91.8
Potato yellow mosaic virus- Venezuela 73.4 92.2
Chino del tomato virus-[B52] 94.2 81.0


AC4
73.3
70.9
72.1
68.6
72.1
68.6
75.6
68.6
73.3
76.7
81.4
74.4
95.1
65.9






24


Table 2-7. Host range study of SiGMoV using selected plants at which number of
positive SiGMoV to the total number of plant
Plant Biolistic inoculation Whitefly inoculation
infectivity infectivity 2
(infected/inoculated) (infected/inoculated)
Nicotiana benthamiana 8/24 0/6
N. tabacum L. (V20) 9/15 2/6
Phaseolus vulgaris L. (Topcrop) 8/24 0/6
Gossypium hirsutum L. (Delta Pine 70) 20/25 0/6
Sida santaremensis Monteiro 11/12 0/0
Lycopersicon esculentum Mill. (FL 9/25 0/6
Lanai)
1 25 plants were used in each biolistic inoculation and 5 were used as negative controls.
2 6 plants were used in each whiteflies transmission and 1 was used as a negative control.
















PYMTV-TT

- PYMV-VE


69 -- SiG(\l RV
69
204 BDMV



100.00
Substitutions per 100 residues


Figure 2-2. Phylogenic tree of complete nucleotide of a component of selected
begomoviruses with SiGMoV. SiYVV: sida yellow vein virus, SiGMHV:
Sida golden mosaic Honduras virus, SiGMCRV: Sida golden mosaic Costa
Rica virus, BDMV: Bean dwarf mosaic virus, CdTV-[H6]: Chino del tomato
virus-[H6], CdTV-[IC]: Chino del tomato virus-[IC], AbMV-HW: Abutilon
mosaic virus-HW, AbMV: Abutilon mosaic virus, SiGMV: Sida golden
mosaic virus, ToMoV-[FL]: Tomato mottle virus-Florida, SiGMoV: Sida
golden mottle virus, PYMTV-TT: Potato yellow mosaic Trinidad virus,
PYMV-VE: Potato yellow mosaic virus- Venezuela, ToMoTV: Tomato mottle
Taino virus.














SiGMHV*
142
3SiYVV
149 3
6SiGMHV-YV
156 127 SiGMHV

386 SiGMCRV

386 SiGMoV

161 1 338 ToMoV-[FL]
-- 160
339 ToMoTV
128
143
5 310 AbMV-HW
750 310
134 AbMV

448
BDMV

345 _SiGMV

p301 r4 CdTV-[IC]

b o CdTV-[B521
172
S- C286- PYMTV-TT

T229 PYMV-VE


100.00
Substitutions per 100 residues



Figure 2-3. Phylogenic tree of complete nucleotide of B component of selected
begomoviruses with SiGMoV. CdTV-[B52]: Chino del tomato virus-[B52],
CdTV-[IC]: Chino del tomato virus-[IC], PYMTV-TT: Potato yellow mosaic
Trinidad virus,, PYMV-VE: Potato yellow mosaic virus- Venezuela,
SiGMCRV: Sida golden mosaic Costa Rica virus, SiGMHV: Sida golden
mosaic Honduras virus, SiGMHV*: B Strain of Sida golden mosaic Honduras
virus, SiYVV: Sida yellow vein virus, SiGMHV-YV: Sida golden mosaic
Honduras virus-yellow vein, BDMV: Bean dwarf mosaic virus, SiGMV: Sida
golden mosaic virus, SiGMoV: Sida golden mottle virus,, ToMoV-[FL]:
Tomato mottle virus-Florida, ToMoTV: Tomato mottle Taino virus, AbMV-
HW: Abutilon mosaic virus-HW, AbMV: Abutilon mosaic virus. Virus is in
gene bank but there is no acronym for it.









Discussion

A new begomovirus, Sida golden mottle virus (SiGMoV) was isolated and

characterized from S. santaremensis showing golden mosaic symptoms in the leaves. The

nucleotide sequence identity of the CR of SiGMoV between DNA-A and DNA-B is

95.2%. The CR identity between DNA-A and DNA-B have been reported as low as

80.0% [26], also SiGMoV was able to infect and cause golden mosaic symptoms in S.

santaremensis by biolistic inoculation. This suggests that the DNA-A and DNA-B are

those of the same virus.

Based on the results of phylogenetic analysis, nucleotide sequence and amino acid

sequence comparisons, the SiGMoV DNA-A sequence was unique and was not clustered

with any characterized begomovirus DNA-A sequence. Using the same analyses, the

SiGMoV DNA-B sequence clustered with and shared a theoretical common ancestor with

viruses in the AbMV group.

The data obtained from host range study showed different results depending on

method used. By biolistic inoculation, SiGMoV was able to infect L. esculentum, P.

vulgaris, G. hirsutum, N. benthamiana, and N. tabacum. However, by whitefly

inoculation using SiGMoV-infected S. santaremensis, SiGMoV was able to infect N.

tabacum and at a lower rate of transmission than by biolistic inoculation. The method

used to inoculate may influence the apparent host range. In biolistic inoculation a

concentrated reproductive form of the geminivirus, double-stranded linear DNA, is bound

to gold particles which are delivered directly into a variety of host plant cells using high

velocity. The efficiency of biolistic inoculation is dependent upon the purity and the

concentration of the DNA, and other parameters which are under the control of the

researcher. However in whitefly transmission, a virion, containing a single-stranded









circular DNA, is delivered into phloem parenchyma cells by the whitefly stylet. The

efficiency of whitefly transmission is dependent upon the virus titer of the inoculum

source plant, the distribution of virus within the source plant, and the feeding preference

of the whiteflies, all of which are difficult to control by the researcher. These differences

may explain the discrepancy between the results obtained using the two inoculation

methods. These results indicate that SiGMoV can replicate in six plant species.

However, it is not clear whether the whiteflies are able to transmit SiGMoV from S.

santaremensis to these hosts.

There is as yet no reported economic significance of SiGMoV. Even though

SiGMoV is able to replicate in bean, tomato, cotton, and tobacco, no epidemics in these

crops have been reported. This could be because whiteflies are not able to acquire and

transmit SiGMoV from S. santaremensis to these crops. This could also be due to a

limited geographic distribution of SiGMoV. The geographic distribution of SiGMoV has

not been determined, but may be limited as S. santaremensis, the only known natural host

of SiGMoV, has only been found in two counties in Florida. However, since SiGMoV

was able to replicate in several hosts, there is a potential for SiGMoV to become a

pathogen. The ability of whiteflies to acquire and transmit SiGMoV, a more extensive

host range, and the geographic distribution of SiGMoV need to be established in order to

better assess the potential of SiGMoV to cause crop losses.














CHAPTER 3
AN EPIDEMIC IN TOMATO CAUSED BY VARIANTS OF Sida golden mosaic virus

A tomato field near Citra, FL was 100% infected with a virus that produced

symptoms identical to those caused by Tomato yellow leaf curl virus (TYLCV), a

begomovirus found throughout Florida [53]. However, there was no identifiable source of

TYLCV. This study was undertaken to identify the virus causing the symptoms in tomato

and identify the source of the virus.

Materials and Methods

Sample Source

Samples were collected from symptomatic plants of tomato and S. acuta growing in

and around the tomato field. S. acuta was identified to species by curators at the Florida

Museum of Natural History, University of Florida, Gainesville, FL.

PCR Analysis and Restriction Analysis

DNA was extracted from symptomatic plants of S. acuta [54]. The DNA was then

used as a template for polymerase chain reaction (PCR). Degenerate primers, PARlc496

/PALlv1978, which amplify an ~1100 bp fragment of the DNA-A of most bipartite

begomovirus and an -1300 bp fragment from most monopartite begomovirus [56] were

used to amplified the DNA-A. This fragment includes the 3' end of the putative Coat

Protein gene (CP), the common region (CR), and part of the putative Replication

Association Protein gene (Rep) [56]. Degenerate primers PBL1240/PCRc154 which

amplifies an -600 bp fragment of the begomovirus DNA-B which includes the 3' end of









the putative Nuclear .S/ntle Protein gene (NSP) and almost the entire CR [56, 65] were

also used amplified the DNA-B.

The amplicons obtained with the described primers were restricted using Alul,

EcoRI, BglI, BglII, Apal, andNcol restriction enzymes and compared with a predicted

restriction map of SiGMV generated by Vector NTI software (Infomax, Frederick, MD).

Cloning

One partial SiGMV variant was obtained from S. acuta. Six partial sequences of

DNA-A and four partial sequences of DNA-B were obtained from tomato. The partial

sequences were cloned using pGEM-T easy vector system (Promega, Madison, WI,

USA 53711) and sequenced.

Gap and Blast Analysis

The partial begomovirus sequences obtained from S. acuta and tomato were

compared using Gap method in Wisconsin package program (GCG). Sequence

comparisons were made by NCBI BLAST using the NCBI taxonomy database (

http://www.ncbi.nlm.nih.gov/). The CR of the partial DNA-A and DNA-B sequences

were determined and compared. In partial DNA-B the CR were missing at least two

nucleotides.

Phylogenetic Analysis

The partial DNA-A and DNA-B sequences were used in phylogenetic analysis. The

first 12-14 begomoviruses generated by Blast were also compared with these sequences

and a phylogenic tree was constructed for DNA-A, DNA-B. [2]. The comparison were

based on maximum parsimony using the PAUP*s heuristic method with the bisection-

reconnecting branch swapping The Bootstrap value was set to be based on 500 replicates.

Display tree was with no rooting using the midpoint rooting option.









Results

Even though the symptoms in tomato closely resembled those of TYLCV, the

presence of 1254 bp to 1295 bp fragments amplified by the degenerate primers

PAR1c496 /PALlv1978 and 616 bp to 639 bp fragments amplified by the degenerate

primers PBL1240/PCRc154 suggested the presence of a bipartite begomovirus. After

obtaining the partial begomovirus sequences isolated from tomato and S. acuta, they were

compared with each other, with SiGMV, and with known begomoviruses.

The presence of S. acuta with SiGMV-like symptoms and high population of

whitefly vector in and around the field suggested a possible role of SiGMV in the

epidemic. A comparison of restriction enzyme patterns of DNA-A and DNA-B fragments

amplified from S. acuta and tomato with the predicted restriction sites of SiGMV,

indicated that the fragments amplified from S. acuta and tomato were very similar to

those of SiGMV. There were 6 restriction enzyme sites predicted from SiGMV DNA-A

and 5 to 7 of these sites were found in DNA-A fragments amplified from S. acuta and

tomato. There were 4 restriction enzyme sites predicted from SiGMV DNA-B and 3 to 3

of these sites were found in DNA-B fragments amplified from S. acuta and tomato.

Partial Sequence Analysis from Tomato and S. acuta

The partial nucleotide sequences amplified from S. acuta are shown for DNA-A

(Fig. 3-1) and DNA-B (Fig.3-7). The five DNA-A partial sequences amplified from

tomato are presented in (Fig 3-2 3-6) and the four DNA-B partial sequences are

presented in (Fig. 3-8 and 3-11).

There were no significant differences among the five DNA-A sequences amplified

from tomato that ranged from 97.9% to 98.7% (Table 3-1). There were no significant









differences between the DNA-A sequences amplified from tomato and that amplified

from S. acuta or SiGMV that ranged from 94.6% to 98.4% (Table 3-1).

However, the nucleotide sequence identities among the four DNA-B sequences

amplified from tomato and the one sequence from S. acuta were more variable than those

of the DNA-A sequences, and ranged from 67.7% to 99.2% (Table 3-2).

The analysis of the CR sequences of the partial sequences amplified from tomato

and S. acuta showed some differences among the DNA-A sequences that ranged from

93.2% to 100% (Table 3-3) and among the DNA-B sequences that ranged from 94.5%-

99.3% (Table 3-4). There were also no significant differences found between DNA-A and

DNA-B CR sequences that ranged from 93.8% to 98.6% (Table 3-4). A comparison of

the CR of the partial sequences (DNA-A and DNA-B) amplified from tomato and S.

acuta and that of SiGMV DNA-A showed some differences that ranged from 91.7% to

95.9% (Table 3-4). The same was observed with SiGMV DNA-B CR that range from

94.5% to 96.6% (Table 3-4).

The sequence analysis of DNA-A partial sequences amplified from tomato and S.

acuta and characterized begomoviruses shows some similarity between partial sequences

amplified from tomato and S. acuta and Tomato mottle virus-[Florida] that ranged from

86.4%-87% (Table 3-5).

The sequence analysis of DNA-B partial sequences amplified from tomato and S.

acuta and characterized begomoviruses showed a variable similarity among partial

sequences amplified from tomato and S. acuta with characterized begomovirus which can

be divided into two groups. The first group shared some similarity with Tomato mottle

virus- Florida with similarity of 76.1% (Table 3-6). The second group shared some












similarity with Sida golden mosaic Costa Rica virus that ranged from 76.4%-77.9%


(Table 3-6).


Phylogenetic Analysis


SiGMV strains DNA-A and SiGMV DNA-A cluster with Ablution mosaic virus


group (Fig. 3-12).


In the DNA-B Phylogenetic analysis, the SiGMV sequences are divided into two


groups: the first group includes T12-C3B and T12-C9B that cluster with ToMoV-{FL]


and Tomato mottle Taino virus group (Fig. 3-13).


The other group includes T12-C5B and T12-C7B, SiGMV, and S3-C4B that


clusters with SiGMVRV and BDMV group (Fig. 3-13).


TCTTGAATCA
CGGAACCTGT
ACGTTAGTGA
CTTAGCGAAT
CAAAATCCTT
GAATCTGCAT
CTCCTCTAGC
TCACCGTCCT
CCTGNTATGT
GAAGAATCTG
CATGGAGATG
AACTTCTTGT
TCTTTAGTCA
AACTCGAAAT
CAGTTGAGGT
GTATTAGAGT
TTCACACACG
CCCCCCCTGG
TGGTCCCAGA
TTTGCAACAA
AGACTTTGGC
TGGCGCTCTA
TCCTCGTGGA
AACAGG


CCTTCTACTA
TCCAAAAAAT
AAGAGGAGAG
ATCCTCTCTA
TGGCTGTTCT
TTAACGCCTT
TGATCTGCCG
TGTCGATGTA
TTGGATGGAA
TTATTCTTGC
AGGCTCCCCA
TCACTGGGGT
GAGAGCACTG
TTCTTTGGCG
ACTCTAATTG
CTCATATATA
TGGCGGCCAT
TGCCGTACAC
CGCTCTCGTC
CTTGGGCCCT
CCACTGCTTT
TGGCGGGAAC
GGTAGTGGGC


TGAGACTTAA
TTATCCGCCC
TTGAAATGGA
AGTTGGAGCG
TCCCTTAAAA
GGGCATATGA
TCGATCTGGA
GGACTTGTCC
ATGTGCTGAC
ACTGATATTT
TTCTCGTGAA
ATTTAGGCTT
GGGATATGTG
GGGGCATTTT
AGCCCTCTCA
GTAGAACCCT
CCGGATATAG
TCTCGCGCGA
CAATCAGGTC
AAGTTGTTGG
TAACTCAAAA
CTCAAAGGTT
ACAAGAGTTA


TGGTCTGTCT
ACTCTTGCAT
GGAACCCACG
GATGTTATGA
CCGCTAAGGC
ATCATTAGCA
ATTCTCCCCA
GTCGGAGCTG
CTGGTTGGGG
CCCTTCGAAC
GCTCTCTGCA
TGTATTGGGA
AGGAAATAGT
TGTAATAAGA
AACTTGCTCA
CTATAGAACT
TATTACCGGA
TCTTTAATTT
GCGTCTGACG
GTGTCTGCTA
TGCCTAAGCG
AGCCGCAACG
ACAAGGCCTC


GGCCGCGCAG
CTCGTCGGGA
GTTCCGGAAC
TTCTGCAAGA
AGATTGAACA
GTCTGCGGGC
TTCCAGTGTA
GATTTAGCTC
AGACCAGATC
TGTATGAGCA
GATTTTGATG
AAGTGCTTCT
TTTTGGACTG
AGTGGGACTC
TTCAATTGGA
CTCAATCTGG
TGGCCGCGCG
CAATTAAAGA
AGTCTAGATA
TAAATGAAAG
CGATTTGCCA
CTAACTATTC
TGAATGGGTG


Figure 3-1. Partial sequence of DNA-A (S3-C7A) amplified from Sida acuta collected
from Citra Field, Florida.


1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101
1151












1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101
1151
1201
1251


GCCCACATTG
ATTATCTTCC
AATCACCTTC
CCTGTTCCAA
TAGTGAAAGA
AGCGAATATC
AATCCTTTGG
TCTGCATTTA
CTCTCGCTGA
CCGTCCTTGT
TGTTATGTTT
AGAATCTGTT
TGGAGATGAG
CTTCTTGTTC
TCTTTAGTCA
AACTCGAAAT
CAGTTGAGGT
GTATTAGAGT
TTCNCACACG
CCCCCCTGGT
GGTCCCAGAC
TTGCAACAAC
TACTTTGGCC
GGCGCTCTAT
CCTCGTGGAG
CAGG


TCTTTCCAGT
CCGTTGCATC
TACTATGAGA
AAAATTCATC
GGAGAGTTGA
CTCTCTAAGT
CTGTTCTTCC
ACGCCTTGGG
TCTGCCGTCG
TCGATGTAGG
GGATGGAAAT
ATTCTTGCAC
GCTCCCCATT
ACTGGGGTAT
GAGAGCACTG
TTCNTTTGCG
ACTCCAATTG
CTCATATATA
TGGCGGCCAT
GCCGTACACT
GCTCTCGTCC
TTGGGCCCTA
CACTGCTTTT
GGCGGGAACC
GTAGTGGGCC


GTCTTCCCCA
TGCAGGCCCA
CTTAATGGTC
CGCCCACTCT
AATGGAGGAA
TGGAGCGGAT
CTTAAAACCG
CATATGAATC
ATCTGGAATT
ACTTGACGTC
GTGCTGACCT
TGATATTTCC
CTCGTGAAGC
TAAGGCTTTG
GGGATATGTG
GTGGCATTTT
AGCCCTCTCA
GTAGAACCCT
CCGCTATAAT
CTCGCGCGAT
AATCAGGTCG
AGTTGTTGGG
AACTCACAAT
TCAAAGGTTA
AAGAGTTAAC


TGTACAGAAA
CATTGTCTTT
TGTCTGGCCG
TGCATCTCGN
CCCACGGNTT
GTTATGATTC
CTAAGGCAGA
ATTAGCAGTC
CTCCCCATTC
GGAGCTGGAT
GGTTGGGGAG
CTTCGAACTG
TCTCTGCAGA
TAATNGGGAA
AGGAAATAGT
TGTAATAATG
AACTTGCTCA
CTATAGAACT
ATTACCGGAT
CTTTAATTTC
CGTCTGACGA
TGTCTGCTAT
GCCTAAGCGC
GCCGCAACGC
AAGGCCTCTG


Figure 3-2. Partial sequence of DNA-A (T3-C8A) amplified from tomato plant collected
from Citra Field, Florida


TCTTGAATCA
CGGAACCTGT
ACGTTAGTGA
CTTAGCGAAT
CAAAATCCTT
GAATCTGCAT
TCCTCTCGCT
CACCGTCCTT
TGTTATGTTT
AGAATCTGTT
GGAGATGAGG
TTCTTGTTCA
TCTTTAGTCA
GAACTCCAAA
TCCAGTTGAG
GAGTATTAGA
GGTTCACACA
GCCCCCCCTG
ATGGTCCCAG
ATTTGCAACA
GAGACTTTGG
ATGGCGCTCT
CTCCTCGTGG
GAACAGG


CCTTCTACTA
TCCAAAAAAT
AAGAGGAGAG
ATCCTCTCTA
TGGCTGTTCT
TTAACGCCTT
GATCTGCCGT
GTCGATGTAG
GGATGGTAAT
ATTCTTGCAC
CTCCCCATTC
CTGGGGGTAT
GAGAGCACTG
ATTNCTTTGG
GTACTCCAAT
GTCTCATATA
CGTGGCGGCC
GTGCCGTACA
GCGCTCTCGT
ACTTAGGGCC
CCCACTGCTT
ATGGCGGGAA
AGGTAGTGGG


TGAGACTTAA
TCATCCGCCC
TTGAAATGGA
AGTTGGAGCG
TCCCTTAAAA
GGCATATGAA
CGATCTGGAA
GACTTGACGT
GTGCTGACCT
TGATATTTCC
TCGTGAAGCT
TTAGGCTTTG
GGGATATGTG
CGGGGGCATT
TGAGCCCTCT
TAGTAGAACC
ATCCGCTATA
CTCTCGCGCG
CCAATCAGGT
CAAGTTGTTT
TTAACTCAAA
CCTCAAAGGT
CACAAGAGTT


TGGTCTGTCT
ACTCTTGCAT
GGAACCCACG
GATGTTATGA
CCGCTAAGGC
TCATTAGCAG
TTCTCCCCAT
CGGAGCTGGA
GGTTGGGGAG
CTTCGACTGT
CTCTGCAGAT
TAAATTGGGA
AAGGAAATAG
TTTGTAATAA
CAAACTTGCT
CTCTATAGAA
ATATTACCGG
ATCTTTAATT
CGCGTCTGAC
GGTGTCTGCT
ATGCCTAAGC
TAGCCGCAAC
AACAAGGCCT


GGCCGCGCAG
CTCGTCGGGA
GTTCCGGAAC
TTCTGCAAGA
AGATTGAACA
TCTGCGGGCC
TCCAGTGTAT
TTTAGCTCCC
ACCAGATCGA
ATGAGCACAT
TTTGATGAAC
AAGTGCTTCT
TTTTTGGACT
TGAGTGGGAC
CATTCAATTG
CTCTCAATCT
ATGGCCGCGC
TCAATTAAAG
GAGTCTAGAT
ATAAATGAAA
GCGATTTGCC
GCTAACTATT
CTGAATGGGT


Figure 3-3. Partial sequence of DNA-A (T5-C2A) amplified from tomato plant collected
from Citra Field, Florida


GCCATGCAGT
CCTGTTCTTG
CGCAGCGGAA
TCGGGAACGT
CCGGAACCTT
TGCAAGACAA
TTGAACAGAA
TGCGGGCCTC
CAGTGTATCA
TNTAGCTCCC
ACCAGATCGA
TATGAGCACA
TTTTGATGAA
AAGTGCTTCT
TTTTGGACTG
AGTGGGACTC
TTCAATTGGA
CTCAATCTGG
GGCCGCGCGC
AATTAAAGAT
GTCTAGATAT
AAATGAAAGA
GATTTGCCAT
TAACTATTCT
AATGGGTGAA


1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101
1151












1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101
1151


CTTGAATCAC
GGAACCTGTT
CGTTTGTGAA
TTAGCGAATA
ATAATCTTTT
AATCTGCATT
CCTCTAGCTG
ACCGTCCTTG
GTATGTTTGG
AATCTGTTAT
GAGATGAGGC
TCTTGTTCAC
TTAGTCAGAG
TCGAAGTTTC
TTGAGGTACT
TAGAGTCTCA
CACACGTGGC
CCTGGTGCCG
CCAGACGCTC
AACAACTTGG
TTGGCCCACT
CTCTATGGCG
GTGGAGGTAG
CCCATGTACA


CTTCTACTAT
CCAAAAAATT
AGAGGAGAGG
TCCTCTCTAA
GGCTGTTCTT
TAACGCCTTG
ATCTGCCGTC
TCGATGTAAG
ATGGAAATGT
TCTTGCACTG
TCCCCATTCT
TGGGGTATTT
AGCACTGAGG
TTCGGCGGTG
CCAATTGATC
TATATAGTAG
GGCCATCCGC
TACACTCTCG
TCGTCCAATC
GCCCTAAGTT
GCTTTTAACT
GGAACCTCAA
TGGGCCAAGA
GAAAGCCCTG


GAGACTTAAT
CATCCGCCCA
TGAAATGGAG
GTTGGAGCGG
CCCTTAAAAC
GCATATGAAT
GATCTGGAAT
ACTTGACGTC
GCTGACCTGG
ATATTTCCCT
CGTGAAGCTC
AGGCTCTGTA
ATATGTTAGG
GCATTTTTGT
CCTCTCAAAC
AACCCTCTAT
TATAATATTA
CGCGATCTTT
AGGTCGCGTC
GTTGGGTGTC
CAAAATGCCT
AGGTTAGCCG
GTTAACAAGG
CAGTATTAAT


GGTCTGTCTG
CTCTTGCATC
GAACCCACGG
ATGTTATGAT
CGCTAAGGCA
CATTAGCAGT
TCTCCCCATT
GGAGCTGGAT
TTGGGGAGAC
TCGAACTGTA
TCTGCAGATT
ATTGGGAAAG
AAATAGTTTT
AATAAGAAGT
TTGCTCATTC
AGAACTCTCA
CCGGATGGCC
AATTTCAATT
TGACGAGTCT
TGCTATAAAT
AAGCGCGATT
CAACGCTAAC
CCTCTGAATG
CACTAGTGAA


Figure 3-4. Partial sequence of DNA-A (T10-C8A) amplified from tomato plant collected
from Citra Field, Florida


TCTTGAATCA CCTTCTACTA TGAGACTTAA TGGTCTGTCT GGCCGCGCAG
CGGAACCTGT TCCAAAAAAT TCATCCGCCC ACTCTTGCAT CTCGTCGGGA


ACGTTAGTGA
CTTAGCGAAT
CAAAATCTTT
GAATCTGCAT
TCCTCCAGCT
CACCGTCCTT
TGTATGTTTG
GAATCTGTTA
GGAGATGAGG
TTCTTGTTCA
TTTAGTCAGA
CTCGAAATTT
GTTGAGGCAC
TCTGGAGTCC
CGCACACGTG
CCCCTGGTGC
TCCCAGACGC
GCAACAACTT
CTTTGGCCCA
CGCTCTATGG


AAGAGGAGAG
ATCCTCTCTA
TGGCTGTTCT
TTAACGCCTT
GATCTGCCGT
GTCGATGTAG
GATGGAAATG
TTCTTGCACT
CTCCCCATTC
CTGGGGTATT
GAGCACTGGG
CTTTGGCGGT
TCCAATTGAG
CATATATACT
GCGGCCATCC
CGTACACTCT
TCTCGTCCAA
GGGCCCTAAG
CTGCTTTTAA
CGGGAACCTC


GTGAAATGGA
AGTTGGAGCG
TCCCTTAAAA
GGCATATGAA
CGATCTGGAA
GACTTGACGT
TGCTGACCTG
GATATTTCCC
TCGTGAAGCT
TAGGCTTTGT
GATATGTGAG
GGCATTTTTG
CCCTCTCAAA
AGAACCCTCT
GCTATAATAT
CGCGCGATCT
TCAGGTCGCG
TTGTTGGGTG
CTCAAAATGC
AAAGGTTAGC


GGAACCCACG
GATGTTATGA
CCGCTAAGGC
TCATTAGCAG
TTCTCCCCAT
CGGAGCTGGA
GTTGGGGAGA
TTCGAACTGT
CTCTGCAGAT
AATTGGGAAA
GAAATAGTTT
TAATAATGAG
ACTTGCTCAT
ATAGAACTCT
TACCGGATGG
TTAATTTCAA
TCTGACGAGT
TCTGCTATAA
CTAAGCGCGA
CGCAACGCTA


GTTCCGGAAC
TTCTGCAAGA
AGATTGAACA
TCTGCGGGCC
TCCAATGTAT
TTTAGCTCCC
CCAGATCGAA
ATGAGCACAT
TTTGATGAAC
GTGCTTCTTC
TTGGACTGAA
TGGGACTCCA
TCAATTGGAG
CAATCTGGTT
CCGCGCGCCC
TTAAAGATGG
CTAGATATTT
ATGAAAGAGA
TTTGCCATGG
ACTATTCTCC


1101 TCGTGGAGGT AGTGGGCCAA GAGTTATCAA GGCCTCTGAA TGGGTGAACA
1151 GG
Figure 3-5. Partial sequence of DNA-A (T10-C10A) amplified from tomato plant
collected from Citra Field, Florida


GCCGCGCAGC
TCGTCGGGAA
TTCCGGAACC
TCTGCAAGAC
GATTGAACAG
CTGCGGGCCT
CCAGTGTATC
TTAGCTCCCT
CAGATCGAAG
TGAGCACATG
TTGATGAACT
TGCTTCTTCT
TGGACTGAAC
GGTACTCCAG
AATTGGAGTC
ATCTGGTTCA
GCGCGCCCCC
AAAGATGGTC
AGATATTTGC
GAAAGAGACT
TGCCATGGCG
TATTCTCCTC
GGTGAACAGG
TTCGC


1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051












1
51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951
1001
1051
1101


TCTTGAATCA
CGGAACCTGT
ACGTTAGTGA
CTTAGCGAAT
CGAAATCCTT
GAATCTGCAT
TCCTCTCGCT
CACCGTCCTT
TGTATGTTTG
GAATCTGTTA
GGAGATGAGG
TTCTTGTTCA
TTTAGTCAGA
CTCGAAATTT
GTTGAGGTAC
CTGGAGTCTC
ACACACGTGG
CCTTGGTGCC
CCCAGACGCT
CAACAACTTG
TTTGGCCCAC
GCTCTATGGC
CGTGGAGGTA


CCTTCTACTA
TCCAAAAAAT
AAGAGGAGAG
ATCCTCTCTA
TGGCTGTTCT
TTAACGCCTT
GATCTGCCGT
GTCGATGTAG
GATGGAAATG
TTCTTGCACT
CTCCCCATTC
CTGGGGTATT
GAGCACTGGG
CTTAGGCGGT
TCCAATTGAG
ATATATAGTA
CGGCCATCCG
GTACACTCTC
CTCGTCCAAT
GGCCCTAAGT
TGCTTTTAAC
GGGAACCTCA
GTGGGCCAAG


TGAGACTTAA
TCATCCGCCC
TTGAAATGGA
AGTTGGAGCG
TCCCTTAAAA
GGCATATGAA
CGATCTGGAA
GACTTGACGT
TGCTGACCTG
GATATTTCCC
TCGTGAAGCT
TAGGCTTTGT
GATATGTGAG
GGCATTTTTG
CCCTCTCAAA
GAACCCTCTA
CTATAATATT
GCGCGATCTT
CAGGTCGCGT
TGTTGGGTGT
TCAAAATGCC
AAGGTTAGCC
AGTAAACAAG


TGGTCTGTCT
ACTCTTGCAT
GGAACCCACG
GATGTTATGA
CCGCTAAGGC
TCATTAGCAG
TTCTCCCCAT
CGGAGCTGGA
GTTGGGGAGA
TTCGAACTGT
CTCTGCGGAT
AATTGGGAAA
GAAATAGTTT
TAATAAGAAG
CTTGCTCATT
TAGAACTCT C
ACCGGATGGC
TAATTTCAAT
CTGACGAGTC
CTGCTATAAA
TAAGCGCGAT
GCAACGCTAA
GCCTCTGAAT


1151 G
Figure 3-6. Partial sequence of DNA-A (T12-C6A) amplified from tomato plant collected
from Citra Field, Florida


GCTACGACTC AGTCTAGCTG TCAACTGCGA CGCCGTCGAC GGGAATTGCA
GAATTATCTC AGTTAGGTCA TGGGAAAGTT GATACTCGTC CCGGTGCGAC


TCTATGTAGT
AAGAAGAAAG
AAGATGTCAG
TGAACACTTT
ACTCGTCTAA
ATCTGGTGAT
ATAAATAGAC
TTTTACTTCT
GAGGTACTCC
AGAGTCTCAT


TGAAGGCACT
GCCGCGCAGC
GAATTCTCGT
TTCTGGGAAA
CCTCTTATGA
GAAAGTTTAG
CCAGATTTTA
GTTTAATGGC
AATTGAGCCC
ATATAGTAGA


CGGAGGATTT
GGAACCGATT
GAAGAACAGT
CCCAGAAAGT
AAGTGGGTGG
GATGATAGTG
TGTTGTTGGT
ATTTTTGTAA
TCTCAAACTT
ACCCTCTATA


ACTAACTGAG
GCTGAAGTTG
ATTTGAACCC
TGGTGAAGAA
GTTGTTGAGA
AGTTAGATCT
AAAGAACGTC
TAATGAGTGG
GCTCATTCAA
GAACTCTCAA


ATTCCATTTG
AATCGGAAAA
TTGTTGAAGA
GTTGAGGAAC
AAGAGGAGAA
GGTAGTGTCT
TATGAGAAGT
GACTCCAGTT
TTGGAGTATT
TCTGGTTCAC


601 ACACGTGGCG GCCATCCGA
Figure 3-7. Partial sequence of DNA-B (S3-C4B) amplified from Sida acuta collected
from Citra Field, Florida


GGCCGCGCAG
CTCGTCGGGA
GTTCCGGAAC
TTCTGCAAGA
AGATTGAACA
TCTGCGGGCC
TCCAGTGTAT
TTTAGCTCCC
CCAGATCGAA
ATGAGTACAT
TTTGATGAAT
GTGCTTCTTC
TTGGACTGAA
TGGTACTCCA
CAATTGGAGT
AATCTGGTTC
CGCGCGCCCC
TAAAGATGGT
TAGATATTTG
TGAAAGAGAG
TTGCCATGGC
CTATTCTCCT
GGGTGAACAG


1
51
101
151
201
251
301
351
401
451
501
551












GCTACGACTG
GTATTATCTC
TCTATGTAAT
AGGAAGAAAG
AAGATGAACA
GATCTCGAAG
GGATCTTTCT
TAACCCTTGA
AGAATTCTGG
GACGGGTATT
ATAATGAGTG
TGCTCATTCA
GAACTCTCAA


AGCCTCGCCG
AGTTAGGTCA
TGAAAGCGTT
GCCGCGCAGC
ACTGATGAAC
AAGGTAAAGG
GACAGTTACT
TGTTTATGAG
AAATGAAGTA
TAAAATGGGA
GGACTCCAGT
ATTGGAGTCT
TCTGGTTCAC


TCAACTGCGA
TGTGAAAGCT
CGGAGGATTA
GGAACCGATT
AGGACGAACA
CGTAACTTTG
GTTTAGAAGA
AAAGAAAGGA
GTTTGTGTAT
AAGGGTTCAT
TGAGGTACTC
AGAGTCTCAT
ACACGTGGCG


CGCCGTGGAA
GATATTCGTC
ACTAACTGAG
GCTGAAGTTG
GTGTTCGATG
TTTCTGTGTT
TTTAAGAACG
GTGTTGATGA
GAACCCAGAA
CAACCGGTGG
CAATTGATCC
ATATAGTAGA
GCCATCCGA


GGAAATTGCA
CCGGTGAGAT
AATCCATATG
AATCGGGAAG
GCTGAGTTTA
TGAGAGTGTC
AAAATTTGTT
ATAATTTGGG
CTTCTGGGTT
CATTCTTGTA
CTCTCAAACT
ACCCTCTATA


Figure 3-8. Partial sequence of DNA-B (T12-C3B) amplified from tomato plant collected
from Citra Field, Florida


GCTACGACTC
GAATTATCTC
TCTATGTAGT
AAGAAGAAAG
AGATGTCAAG
GAACACTTTT
CTTGTCTAAC
TCTGGTGATG
AAATAGACCC
TTACTTCTGT
GGTACTCCAA
GTCTCATATA
CGTGGCGGCC


AGCCTCGCCG
AGTTAGGTCA
TGAAGGCGCT
GCCGCGCAGC
AATTCTCGTG
TCTGGGAAAC
CTCTCTTGAA
AAAATGAGGA
AGATATTATG
TCAATGGCAT
TTGAGCCCTC
TAGTAGAACC
ATCCGA


TCAACTGCGA
TGGGAAAGTT
CGGAGGATTT
GGAACCGATT
AAGAACAGTA
CCAGAAAGTT
AGTGGGTGTG
TGATAGTGAG
TTGTTGGTAA
TTTTGTAATA
TCAAACTTGC
CTCTATAGAA


CGCCGTCGAC
GATACTCGTC
ACTAACTGAG
GCTGAAGTTG
TATGAACCCC
GGTGAAGAAG
TTGTTGAGAA
TTAGATCTGG
AGAACGTCTA
AGAAGTGGTA
TCATTCAATT
CCCTCAATCT


GGAAATTGCA
CCGGTGAGAC
ATTCCATTTG
AATCGGGAAA
CCTTGAAGAT
TTGAGGAACA
AGAGGAGAAA
TAGTGTCTAT
TGAGAAGTTT
CTCCAGTTGA
GGAGTCTGGA
GGTTCACACA


Figure 3-9. Partial sequence of DNA-B (T12-C5B) amplified from tomato plant collected
from Citra Field, Florida


GCTACGACTG
GAATTATCTC
TCTATGTAGT
AAGAAGAAAG
AGATGTCAAG
GAACACTTTT
CTTGTCTAAC
TCTGGTGATG
AAATAGACCC
TTACTTCTGT
GGTACTCCAA
GTCTCATATA
CGTGGCGGCC


AGCCTCGCCG
AGTTAGGTCA
TGAAGGCGCT
GCCGCGCAGC
AATTCTCGTG
TCTGGGAAAC
CTCTCTTGAA
AAAATGAGGA
AGATATTATG
TCAATGGCAT
TTGAGCCCTC
TAGTAGAACC
ATCCGT


TCAACTGCGA
TGGGAAAGTT
CGGAGGATTT
GGAACCGATT
AAGAACAGTA
CCAGAAAGTT
AGTGGGTGTG
TGATAGTGAG
TTGTTGGTAA
TTTTGTAATA
TCAAACTTGC
CTCTATAGAA


CGCCGTCGAC
GATACTCGTC
ACTAACTGAG
GCTGAAGTTG
TATGAACCCC
GGTGAAGAAG
TTGTTGAGAA
TTAGATCTGG
AGAACGTCTA
AGAAGTGGTA
TCATTCAGTT
CTCTCAATCT


GGAAATTGCA
CCGGTGAGAC
ATTCCATTTG
AATCGGGAAA
CCTTGAAGAT
TTGAGGAACA
AGAGGAGAAG
TAGTGTCTAT
TGAGAAGTTT
CTCCAGTTGA
GGAGTCTGGA
GGTTCACACA


Figure 3-10. Partial sequence of DNA-B (T12-C7B) amplified from tomato plant
collected from Citra Field, Florida


1
51
101
151
201
251
301
351
401
451
501
551
601


1
51
101
151
201
251
301
351
401
451
501
551
601


1
51
101
151
201
251
301
351
401
451
501
551
601










GCTACGACTG
GTATTATCTC
TCTATGTAAT
AGGAAGAAAG
AAGATGAACA
GATCTCGAAG
GGATCTTTCT
CAACCCTTGA
AGAATTCTGG
GACGGGTATT
ATAATGAGTG
TGCTCATTCA
GAACTCTCAA


AGCCTCGCCG
AGTTAGGTCA
TGAAAGCGTT
GCCGCGCAGC
ACTGATGAAC
AAGGTAAAGG
GACAGTTACT
TGTTTATGAG
AAATGAAGTA
TAAAATGGGA
GGACTCCAGT
ATTGGAGTCT
TCTGGTTCAC


TCAACTGCGA
TGTGAAAGCT
CGGAGGATTA
GGAACCGATT
AGGACGAACA
TATAACTTTG
GTTTAGAAGA
AAAGAAAGGA
GTTTGTGTAT
AAGGGTTCAT
TGAGGTACTC
AGAGTCTCAT
ACACGTGGCG


CGCCGTGGAA
GATATTCGTC
ACTAACTGAG
GCTGAAGTTG
GCGTTCGATG
TTTCTGTGTT
TTTAAGAACG
GTGTTGATGA
GAACCCAGAA
CAACCGGTGG
CAATTGATCC
ATATAGTAGA
GCCATCCGT


GGAAATTGCA
CCGGTGAGAT
AATCCATATG
AATCGGGAAG
GCTGAGTTTA
TGAGAGTGTC
AAAATTTGTT
ATAATTTGGG
CTTCTGGGTT
CATTCTTGTA
CTCTCAAACT
ACCCTCTATA


Figure 3-11. Partial sequence of DNA-B (T12-C9B) amplified from tomato plant
collected from Citra Field, Florida

Table 3-1. The nucleotides identity of partial sequences of SiGMV DNA-A isolated from


tomato and Sida collected from
T3- T5- T10-
C8A C2A C8A


Citra Field
T10-
C10A


T12-
C6A


S3-
C7A


T3-C8A 100% 97.9% 98.3% 98.7% 98.5% 97.8% 96.0%
T5-C2A 100% 97.9% 98.3% 98.2% 98.5% 95.9%
T10-C8A 100% 98.3% 98.3% 98.4% 94.6%
T10- 100% 98.2% 98.4% 95.9%


C10A
T12-C6A 100% 98.4% 95.9%
S3- C7A 100% 96.2%
SiGMV-A 100%
T3-C8A: SiGMV DNA-A sequence from tomato 3 clone 8, T5-C2A: SiGMV DNA-A
sequence from tomato 5 clone 2, T10-C8A: SiGMV DNA-A sequence from tomato 10
clone 8, T10-C10A: SiGMV DNA-A sequence from tomato 10 clone 10, T12-C6A:
SiGMV DNA-A sequence from tomato 12 clone 6, S3-C7A: SiGMV DNA-A sequence
from Sida 3 clone 7, SiGMV-A: Sida golden mosaic virus DNA-A


Table 3-2. The nucleotides identity of partial sequences of SiGMV DNA-B isolated from
tomato and Sida collected from Citra Field: -
S3-C4B T12-C3B T12-C5B T12-C7B T12-C9B SiGMV-B


S3-C4B 100 67.9% 95.8% 95.3% 67.7% 96.1%
T12-C3B 100 68.9% 68.9% 99.2% 68.0%
T12-C5B 100 99.2% 68.7% 95.3%
T12-C7B 100 69.0% 95.3%
T12-C9B 100.0% 68.0%
SiGMV-B 100.0%
S3-C4B: SiGMV DNA-B sequence isolated from sida 3 clone 4, T12-C3B: SiGMV
DNA-B sequence isolated from tomato 12 clone 3, T12-C5B: SiGMV DNA-B sequence
isolated from tomato 12 clone 4, T12-C7B: SiGMV sequence of DNA-B isolated from
tomato 12 clone 7, T12-C9B: SiGMV DNA-B sequence isolated from tomato 12 clone 9,
SiGMV-B: Sida golden mosaic virus DNA-B


1
51
101
151
201
251
301
351
401
451
501
551
601


SiGMV-
A









Table 3-3. The Common region nucleotides identity of SiGMV DNA-A sequences
isolated from tomato and S. acuta
T3-C8A T5-C2A T10-C8A T10-C10A T12-C6A S3-C7A
T3-C8A 100% 95.9% 95.9% 96.6% 97.3%
T5-C2A 95.9% 95.9% 96.6% 97.3%
T10-C8A 94.5% 99.3% 95.9%
T10-C10A 95.2% 93.2%
T12-C6A 96.6%
T3-C8: SiGMV DNA-A sequence from tomato 3 clone 8, T5-C2: SiGMV DNA-A
sequence from tomato 5 clone 2, T10-C8: SiGMV DNA-A sequence from tomato 10
clone 8, T10-C10: SiGMV DNA-A sequence from tomato 10 clone 10, T12-C6: SiGMV
DNA-A sequence from tomato 12 clone 6, S3-C7: SiGMV DNA-A sequence from Sida 3
clone 7, SiGMV-A: Sida golden mosaic virus DNA-A. SiGMV-B: Sida golden mosaic
virus DNA-B


Table 3-4. The Common region nucleotides identity of SiGMV sequences isolated from
tomato and S. acuta: -
S3-4B* T12-3B* T12-5B* T12-7B* T12-9B* SiGMV- SiGMV
A -B
T3-C8A 98.6% 97.3% 94.5% 94.5% 96.6% 95.2% 96.6%
T5-C2A 98.6% 97.3% 94.5% 94.5% 96.6% 95.2% 96.6%
T10-C8A 95.9% 96.6% 97.3% 97.3% 96.6% 95.2% 95.2%
T10-C10A 95.2% 94.5% 93.8% 93.8% 94.5% 91.7% 93.2%
T12-C6A 95.9% 95.2% 98.6% 98.6% 95.2% 95.9% 95.9%
S3-C7A 97.3% 95.2% 95.9% 95.9% 95.2% 95.2% 96.6%
S3-4B* 98.0% 96.0% 95.0% 97.3% 93.9% 95.9%
T12-3B* 95.2% 94.5% 99.3% 91.8% 95.2%
T12-5B* 98.0% 94.5% 93.8% 94.5%
T12-7B* 95.2% 93.8% 94.5%
T12-9B* 91.8% 95.2%
SiGMV-A 93.9%
* the CR miss at least two necleotides.T3-C8: SiGMV DNA-A sequence from tomato 3
clone 8, T5-C2: SiGMV DNA-A sequence from tomato 5 clone 2, T10-C8: SiGMV
DNA-A sequence from tomato 10 clone 8, T10-C10: SiGMV DNA-A sequence from
tomato 10 clone 10, T12-C6: SiGMV DNA-A sequence from tomato 12 clone 6, S3-C7:
SiGMV DNA-A sequence from Sida 3 clone 7, S3-C4B: SiGMV DNA-B sequence
isolated from sida 3 clone 4, T12-C3B: SiGMV DNA-B sequence isolated from tomato
12 clone 3, T12-C5B: SiGMV DNA-B sequence isolated from tomato 12 clone 4, T12-
C7B: SiGMV sequence of DNA-B isolated from tomato 12 clone 7, T12-C9B: SiGMV
DNA-B sequence isolated from tomato 12 clone 9, SiGMV-A: Sida golden mosaic virus
DNA-A, and SiGMV-B: Sida golden mosaic virus DNA-B









Table 3-5. The nucleotide identity of partial sequences DNA-A sequences isolated from
tomato and S. acuta at Citra, FL with begomoviruses generated by Blast


Begomovirus

ChTV-[IC]
AbMV
ToMoV-[FL]
ChTV [H8]
ChTV [H6]
AbMV -HW
SiYVV
ToMoTV
SiGMV-YV
SiGMHV
SiGMCVR
BDMV
PYMTV-TT


ACC. No.

AF101476
X15983
L14460
AF226664
AF226665
U51137
Y11099
AF012300
AJ577395
Y11097
X99550
M88179
AF039031


T3-
C8A
82.8%
83.9%
86.6%
81.5%
81.6%
82.9%
83.1%
76.8%
76.2%
79.8%
77.2%
77.8%
78.3%


T5-
C2A
82.9%
85.9%
86.5%
81.8%
81.7%
82.4%
82.8%
76.7%
76.3%
79.6%
76.9%
77.6%
78.3%


T10-
C8A
83.1%
84.6%
86.5%
81.8%
82.0%
83.1%
83.1%
77.3%
76.5%
79.3%
77.0%
78.0%
77.8%


T10-
C10A
83.4%
84.7%
86.4%
82.1%
82.0%
83.0%
83.1%
77.3%
76.7%
80.0%
79.0%
81.0%
77.9%


T12-
C6A
83.2%
84.2%
86.7%
82.7%
82.6%
82.8%
83.5
77.0%
76.7%
79.9%
77.4%
78.3%
78.1%


S3-
C7A
82.8%
83.9%
86.6%
81.5%
81.4%
82.7%
83.0%
76.5%
76.0%
79.4%
76.8%
77.6%
78.0%


ACC. NO. Accession number, T3-C8: SiGMV DNA-A sequence from tomato 3 clone 8,
T5-C2: SiGMV DNA-A sequence from tomato 5 clone 2, T10-C8: SiGMV DNA-A
sequence from tomato 10 clone 8, T10-C10: SiGMV DNA-A sequence from tomato 10
clone 10, T12-C6: SiGMV DNA-A sequence from tomato 12 clone 6, S3-C7: SiGMV
DNA-A sequence from Sida 3 clone 7, SiGMV-A: Sida golden mosaic virus DNA-A,
ChTV-[IC]: Chino del tomato virus-[IC], AbMV: Abutilon mosaic virus, ToMoV-[FL]:
Tomato mottle virus-Florida, ChTV-[H6]: Chino del tomato virus-[H6], ChTV-[H8]:
Chino del tomato virus-[H8], AbMV-HW: Abutilon mosaic virus-HW, SiYVV: Sida
yellow vein virus, ToMoTV: Tomato mottle Taino virus, SiGMHV: Sida golden mosaic
Honduras virus, SiGMCRV: Sida golden mosaic Costa Rica virus, BDMV: Bean dwarf
mosaic virus, and PYMTV-TT: Potato yellow mosaic Trinidad virus- Trinidad and
Tobago


SiGMV-
A
82.2%
84.5%
87.6%
82.0%
81.9%
83.0%
83.2%
77.3%
76.6%
79.3%
77.3%
78.3%
78.1%









Table 3-6. The nucleotide identity of partial sequences DNA-B sequences isolated from
tomato and S. acuta at Citra, FL with begomoviruses generated by Blast


Begomovirus

ChTV-[IC]
AbMV
ToMoV-[FL]
SiGMHV-
YV
SiGMV-YV
AbMV-HW
SiYVV
ToMoTV
SiGMHV
SiGMCRV
BDMV
PYMTV-TT


ACC. No. T12-
C3B
AF101478 64.6%
X15984 76.2%
L14461 76.1%
AJ250731 62.2%


Y11101
U51138
Y11100
AF012301
Y11098
X99551
M88180
AF039032


62.2%
75.1%
62.1%
68.6%
62.8%
60.2%
60.3%
63.3%


S3-C4B: SiGMV DNA-B sequence isolated from sida 3 clone 4,


DNA-B sequence isolated from tomato 12 clone 3, T12-C5B: SiGMV DNA-B
sequence isolated from tomato 12 clone 4, T12-C7B: SiGMV sequence of DNA-B
isolated from tomato 12 clone 7, T12-C9B: SiGMV DNA-B sequence isolated from
tomato 12 clone 9, SiGMV-B: Sida golden mosaic virus DNA-B, ChTV-[IC]: Chino del
tomato virus-[IC], AbMV: Abutilon mosaic virus, ToMoV-[FL]: Tomato mottle virus-
Florida, SiGMHV-YV: Sida golden mosaic Honduras virus-yellow vein, SiGMV-YV:
Sida golden mosaic-yellow vein, SiYVV: Sida yellow vein virus, ToMoTV: Tomato
mottle Taino virus, SiGMHV: Sida golden mosaic Honduras virus, SiGMCRV: Sida
golden mosaic Costa Rica virus, BDMV: Bean dwarf mosaic virus, and PYMTV-TT:
Potato yellow mosaic Trinidad virus- Trinidad and Tobago


T12-
C5B
68.9%
63.4%
66.6%
66.2%

66.1%
61.6%
66.1%
59.2%
63.0%
77.9%
75.1%
64.9%


T12-
C7B
68.7%
63.4%
66.7%
65.7%

65.6%
61.6%
65.7%
59.3%
62.7%
77.9%
74.8%
64.9%


T12-
C9B
64.3%
75.9%
76.1%
62.6%

62.7%
75.0%
62.4%
68.8%
75.0%
60.4%
60.3%
64.4%


S10-
C4B
68.6%
62.4%
66.6%
65.1%

65.0%
61.3%
65.0%
59.4%
65.6%
76.4%
75.2%
65.1%
T12-C3B:


SiGMV-
B
67.8%
61.5%
66.9%
62.5%

62.3%
60.3%
62.3%
58.5%
63.0%
75.8%
74.3%
63.7%
SiGMV













PYMTV-I"


SG R: d ;Sai CI(RV





usXhnTV
H Sid SiYVHV


'i ChTV-1H6I

SChT\-IHSI]
Cid AbMV-HW
.MV

S u Toi oV-IFL I

S : gs, SiGMrq o
















sequencemfromatomato 12dclone6a.P S3-C7 SiGMV DNA-A Trinca vros-
Figure 3-12. Phylogenic tree of partial nucleotide sequence of DNA-A of selected
begomoviruses with the SiGMV and the SiGMV sequences isolated from
tomato and S. acuta. PYMTV-TT: Potato yellow mosaic Trinidad virus-
Trinidad and Tobago, SiGMHV: Sida golden mosaic Honduras virus,
SiGMCRV: Sida golden mosaic Costa Rica virus, BDMV: Bean dwarf
mosaic virus, SiYVV: sida yellow vein virus, ToMoTV: Tomato mottle Taino
virus, SiYVHV: Sida yellow vein Honduras virus, ChTV-[IC]: Chino del
tomato virus-[IC], ChTV-[H6]: Chino del tomato virus-[H6], ChTV-[H8]:
Chino del tomato virus-[H8], AbMV-HW: Abutilon mosaic virus-HW,
AbMV: Abutilon mosaic virus, ToMoV-[FL]: Tomato mottle virus-Florida,
SiGMV: Sida golden mosaic virus, T3-C8: SiGMV DNA-A sequence from
tomato 3 clone 8, T5-C2: SiGMV DNA-A sequence from tomato 5 clone 2,
T10-C8: SiGMV DNA-A sequence from tomato 10 clone 8, T10-C10:
SiGMV DNA-A sequence from tomato 10 clone 10, T12-C6: SiGMV DNA-A
sequence from tomato 12 clone 6, S3-C7: SiGMV DNA-A sequence from
Sida 3 clone 7












- (Arhvx *jF
PI-NITX\Trr


Figure 3-13. Phylogenic tree of partial nucleotide sequences of DNA-B of selected
begomoviruses with the SiGMV and the SiGMV sequences isolated from
tomato and S. acuta. ChTV-[IC]: Chino del tomato virus-[IC], PYMTV-TT:
Potato yellow mosaic Trinidad virus- Trinidad and Tobago, S3-C4B: SiGMV
DNA-B sequence isolated from sida 3 clone 4, T12-C3B: SiGMV DNA-B
sequence isolated from tomato 12 clone 3, T12-C5B: SiGMV DNA-B
sequence isolated from tomato 12 clone 4, T12-C7B: SiGMV sequence of
DNA-B isolated from tomato 12 clone 7, T12-C9B: SiGMV DNA-B
sequence isolated from tomato 12 clone 9, ToMoV-[FL]: Tomato mottle virus-
Florida, ToMoTV: Tomato mottle Taino virus, AbMV: Abutilon mosaic virus,
AbMV-HW: Abutilon mosaic virus-HW, SiGMHV: Sida golden mosaic
Honduras virus, SiGMHV-YV: Sida golden mosaic Honduras virus- yellow
vein, SiGMHV*: Strain of Sida golden mosaic Honduras virus, SiYVHV:
Sida yellow vein Honduras virus, SiGMCRV: Sida golden mosaic Costa Rica
virus, BDMV: Bean dwarf mosaic virus, SiGMV-B: Sida golden mosaic virus
DNA-B









Discussion

The Samples were collected from putatively SiGMV infected tomatoes and S.

acuta from experimental field near Citra, FL., Begomovirus DNA was extracted, isolated

and characterized. Partial DNA-A and DNA-B fragments were cloned, sequenced and

subjected to Gap sequencing and phylogenetic analysis. The partial DNA-A sequences

comparisons revealed no significant differences between samples acquired from tomato

and Sida. Furthermore the partial DNA-A sequence analysis suggested theses variants

were related to ToMoV-[FL].

However, the partial DNA-B sequences showed greater diversity and were divided

into two groups, the first group was related to ToMoV-[FL] and the second was related

to a group of viruses that included SiGMV.

The high level of homology in the nucleotide sequence of the CR between DNA-A

and DNA-B confirmed that these components do support each other. The diversity

observed in the sequences of DNA-B may be due to recombination events. It is possible

that this recombination took place at some time in the past or could be relatively current

and ongoing series of events These results suggest that S. acuta was the inoculation

source for the epidemic of SiGMV in tomato. This is the first report of S. acuta acting as

a virus source for tomato and possible recombination host source for Begomoviruses.

The suggested recombination of the DNA-B in S. acuta could have an impact on

the host range and virulence of Begomoviruses capable of using S. acuta as a host. The

possibility of Begomoviruses using S. acuta as a recombination host could have a

dramatic impact on cultural practice and crop selection where S. acuta occurs, which may

lead to elimanite the S. acuta or change the crops in the farming area specially in South









East United State. However, the scientific aspect of naturally recombination occurrences

in S. acuta may lead to more attention to S. acuta.

A complete nucleotide sequence of the partial DNA-A and DNA-B sequences from

infected plants of tomato and S. acuta would help to understand the relationship between

SiGMV, these variants, and recombination. More study on S. acuta begomovirus and the

S. acuta the weed host must be achieved to understand the recombination events that can

be due to the lack of stringency of replication or because of begomovirus movement to S.

acuta. In addition, biolistic inoculation of infectious clones of SiGMV and SiGMV

variants to tomato is required to determine if the SiGMV sequence variants that caused

the epidemic in tomato should be classified as a strain of SiGMV. Also, whitefly feeding

preference and virus aquision from sida species must be study to determine the

efficiency of whiteflies to acquire and transmission.

Finally, the occurrence of recombination and the whitefly preference and feeding to

and from Sida species will play an importance role in introducing new begomoviruses.















LIST OF REFERENCES


1. Atiri G (1984) Okra mosaic virus in weeds (Sida spp.). Journal of Plant Protection
in the Tropics. 1: 55-57

2. Baldauf SL (2003) Phylogeny for the faint of heart: a tutorial. Trends in Genetics
19: 345-351

3. Bird J (1975) Tropical Diseases of Legumes, 1 edn. Academic Press, New York

4. Bock KR, Guthrie EJ (1974) Purification of maize streak virus and its relationship
to viruses associated with streak diseases of sugar cane and panicum maximum.
Annals of Applied Biology 77: 289-296

5. Briddon R, Bebford I, Tsai JH, Markham P (1996) Analysis of the nucleotide
sequence of the treehopper-transmitted Geminivirus, Tomato pseudo-curly top
virus, suggests a recombinant origin. Virology 219: 387-394

6. Briddon R, Markham P (2001) Complementation of bipartite begomovirus
movement functions by topocuviruses and curtoviruses. Archives of Virology
146: 1811-1819

7. Briddon RW, Bull SE, Mansoor S, Amin I, Markham PG (2002) Universal
primers for the PCR-mediated amplification of DNA beta: A molecule associated
with some monopartite begomoviruses. Molecular Biotechnology 20: 315-318

8. Chivasa S, Ekpo EJA, Hicks RGT (2001) New hosts of Turnip mosaic virus in
Zimbabwe. Plant Pathology 51: 389

9. Clark GH, Fletcher J (1909) Farm weeds of Canada, Second edn. Government
printing Bureau, Ottawa

10. Costa AS, Bennett CW (1953) A probable vector of Abutilon mosaic virus on
species of sida in Florida. The Plant Disease Reporter 37: 92-93

11. Costa AS (1955) Studies on Abutilon mosaic in Brazil. Phytopathologische
Zeitschrift 24: 97-112

12. Costa AS, Carvalho AM (1960) Mechanical transmission and properties of the
Abutilon mosaic virus. Phytopathologische Zeitschrift 37: 259-272









13. Czosnek H, Ghanim M, Ghanim M (2002) The circulative pathway of
begomoviruses in the whitefly vector Bemisia tabaci-insights from studies with
Tomato yellow leaf curl virus. Annals of Applied Biology 140: 215-231

14. Davis EF (1929) Some chemical and physiological studies on the nature and
transmission of'infectious chlorosis' in variegated plants. Annals of the Missouri
Botanical Garden 16: 145-211

15. Doyle JJ, Doyle JL (1990) Isolation of plant DNA from fresh tissue. Focus 12:
13-15

16. Dry IB, Krake LR, Rigden JE, Rezaian MA (1997) A novel subviral agent
associated with a geminivirus: The first report of a DNA satellite. PNAS 94:
7088-7093

17. Egley GH (1976) Germination of developing prickly sida seeds. Weed Science
24: 239-243

18. Fauquet C, Maxwell D, Gronenborn B, Stanley J (2000) Revised proposal for
naming geminiviruses. Archives of Virology 145: 1743-1761

19. Fauquet CM, Bisaro DM, Briddon RW, Brown JK, Harrison BD, Rybicki EP,
Stenger DC, Stanley J (2003) Revision of taxonomic criteria for species
demarcation in the family Geminiviridae, and an updated list of begomovirus
species. Archives of Virology 148: 405-421

20. Franzotti EM, Santos CVF, Rodrigues HMSL, Mouro RHV, Andrade MR,
Antoniolli AR (2000) Anti-inflammatory, analgesic activity and acute toxicity of
Sida cordifolia L. (Malva-branca). Journal of Ethnopharmacology 72: 273-277

21. Frischmuth T, Engel M, Lauster S, Jeske H (1997) Nucleotide sequence evidence
for the occurrence of three distinct whitefly-transmitted, sida-infecting bipartite
geminiviruses in Central America. Journal of General Virology 78: 2675-2682

22. Fuller C (1899-1901) Mealie variegation, 1st report of the government
entomologist. Natal: 17-19

23. Ghosal S, Chauhan RBPS, Mehta R (1975) Alkaloids of Sida cordifolia.
Phytochemistry 14: 830-832

24. Gutierrez C (1999) Geminivirus DNA replication. Cellular and Molecular Life
Sciences 56: 313-329

25. Gutierrez C (2002) Strategies for geminivirus DNA replication and cell cycle
interference. Physiological and Molecular Plant Pathology 60: 219-230









26. Harrison B, Robinson D (1999) Natural genomic and antigenic variation in
whitefly-transmitted geminiviruses (Begomoviruses). Annual Review of
Phytopathology 37: 369-398

27. Harrison BD, Barker H, Bock KR, Guthrie EJ, Meredith G (1977) Plant viruses
with circular single-stranded DNA. Nature 270: 760-762

28. Harrison BD (1985) Advances in Geminivirus research. Annual Review of
Phytopathology 23: 55-82

29. Hazra R, Sharma A (1971) Chromosome studies in different species and varieties
of sida with special refence to accessory chromosomes. Cytologia 36: 285-297

30. Heald FD (1933) Manual of Plant Diseases, Second edn. Mcgraw-Hill book
company, New York

31. Hein I (1926) Changes in plastids in variegated plants. Bulletin of the Torrey
Botanical Club 53: 411-418

32. Hiebert E, Abouzid AM, Polston JE (1995) Whitefly-transmitted geminiviruses.
In: Bemisia : 1995, taxonomy, biology, damage, control and management / p.
277-288

33. Hofer P, Engel M, Jeske H, Frischmuth T (1997) Nucleotide sequence of a new
bipartite geminivirus isolated from the common weed Sida rhombifolia in Costa
Rica. Journal of General Virology 78: 1785-1790

34. Hfer P, Engel M, Jeske H, Frischmuth T (1997) Host range limitation of a
pseudorecombinant virus produced by two distinct bipartite geminiviruses.
Molecular Plant-Microbe Interactions 10: 1019-1022

35. Hunter WB, Hiebert E, Webb SE, TSAI JH, Polston JE (1998) Location of
geminiviruses in the whitefly Bemisia tabaci (Homoptera: Aleyrodidae). Plant
Disease 82: 1147-1151

36. Jeske H, Lttgemeier M, Preid W (2001) DNA forms indicate rolling circle and
recombination-dependent replication of Abutilon mosaic virus. The EMBO
Journal 20: 6158-6167

37. Keur JY (1934) Studies of the occurrence and transmission of virus diseases in
the genus Abutilon. Bulletin of the Torrey Botanical Club 61: 53-70

38. Khan J, Dijkstra J (2001) Plant viruses as molecular pathogens. Food Products Pr
(December 2001)









39. Kirkpatrick TW (1931) Further studies on leaf-curl of cotton in the Sudan.
Bulletin Entomology 22: 323-363

40. Kumar R, Ambasht RS, Srivastava AK, Srivastava NK (1996) Role of some
riparian wetland plants in reducing erosion of organic carbon and selected cations.
Ecological Engineering 6: 227-239

41. Kumar R, Ambasht RS, Srivastava A, Srivastava NK, Sinha A (1997) Reduction
of nitrogen losses through erosion by leonotis nepetaefolia and Sida acuta in
simulated rain intensities. Ecological Engineering 8: 233-239

42. Kunkel LO (1925) Mosaic and related diseases. American Journal of Botany 12:
517-521

43. Kunkel LO (1930) Transmission of Sida mosaic by grafting. Phytopathology 20:
129-130

44. Kurstak E (1981) Handbook of Plant Virus Infections Comparative Diagnosis.
Elsevier/North-Holland biomedical press

45. Lazarowitz SG (1992) Geminiviruses: genome structure and gene function.
Critical Reviews in Plant Sciences 11: 327-349

46. Mansoor S, Briddon RW, Zafar Y, Stanley J (2003) Geminivirus disease
complexes: an emerging threat. Trends in Plant Science 8: 128-134

47. Moffat AS (1999) Geminiviruses emerge as serious crop threat. Science 286:
1835

48. Mumford DL (1974) Purification of Curly top virus. Phytopathology 64: 136-137

49. Noueiry AAO, Lucas BWJ, Gilbertson CRL (1994) Two proteins of a plant DNA
virus coordinate nuclear and plasmodesmal transport. Cell 76: 925-932

50. Orlando A, Silberschmidt K (1946) Estudios sobre a disseminacao natural do
virus da "Clorose Infecciosa" das malvaceas (Abutilon Virus 1. Baur) E A sua
relacao com o inseto-vector "Bemisia tabaci (Genn)". Arquivos Do Instituto
Biologico 17: 1-36

51. Palmer KE, Rybicki, E.P. (1998) The molecular biology of mastreviruses.
Advances in Virus Research 50: 183-234

52. Polston JE, McGovern RJ (1999) Introduction of Tomato yellow leaf curl virus in
Florida and implications for the spread of this and other geminiviruses of tomato.
Plant Disease 83: 984-988









53. Polston JE, Hiebert, E., McGovern, R.J., Stansly, P.A., Schuster, D,J, (1993) Host
range of Tomato mottle virus, a new geminivirus infecting tomato in Florida.
Plant Disease 77: 1181-1184

54. Porebski S, Bailey LG (1997) Modification of a CTAB DNA extraction protocol
for plants. Plant Molecular Biology Reporter 15: 8-15

55. Robinson EL (1975) Dormancy of Sida spinosa seeds. Plant Physiology 56: 85

56. Rojas MR, Gilbertson RL, Russell DR, Maxwell DP (1993) Use of degenerate
primers in the polymerase chain reaction to detect whitefly-transmitted
germiniviruses. Plant Disease 77: 340-347

57. Sawant SV, Singh PK, Tuli R (2000) Pretreatment of microprojectiles to improve
the delivery of DNA in plant transformation. BioTechniques 29: 246-248

58. Silberschmidt K (1943) Estudos sobre a transmissao experimental da "Clorose
infecciosa" das malvaceas. Arquivos Do Instituto Biologico 14: 105-156

59. Smith FF (1926) Some cytological and physiological studies of mosaic diseases
and leaf variegations. Annals of the Missouri Botanical Garden 13: 425-484

60. Spillman WJ (1909) A case of non-mendelian heredity. American Naturalist 43:
437-448

61. Stanley J, Boulton MI, WDavies J (2001) Geminiviridae Encyclopedia of Life
Sciences (www.els.org).

62. Storey HH (1925) The transmission of streak disease of maize by the leafhopper
Balclutha mbila naude. Annals of Applied Biology 12: 422-439

63. Storey HH, Nichols RFW (1938) Studies of the mosaic diseases of cassava. The
Annals of Applied Biology 25: 790-806

64. Venkatesh S, Reddya YSR, Suresha B, Reddyb BM, Ramesh M (1999)
Antinociceptive and anti-inflammatory activity of Sida rhomboidea leaves.
Journal of Ethnopharmacology 67: 229-232

65. Wyatt SD, Brown JK (1996) Detection of subgroup iii geminivirus isolates in leaf
extracts by degenerate primers and polymerase chain reaction. Phytopathology
86: 1288-1292















BIOGRAPHICAL SKETCH

Hamed Sayed Adnan Al-Aqeel was born on August 25, 1975, in Kuwait City, State

of Kuwait. He received his Bachelor's degree in Microbiology in 1998. In 1999 he

received a scholarship from Kuwait University to continue his graduate studies toward

Master and Doctor of Philosophy degrees in plant viruses. In the same year he married

Hanin Altarkeet. In summer 2000 he joined the University of Florida as a graduate

student and since then he has been working under the supervision and guidance of Dr

Jane Polston and her lab group and under the support of the committee members, family,

and friends. On February 17, 2001 he becomes a father to Ali Hamed Sayed Adnan Al-

Aqeel. Upon completion of his M.S degree, Hamed is looking forward to completing to

his PhD degree under the same supervisor at the same lab.