<%BANNER%>

Expression of Pyruvate Decarboxylase in a Gram Positive Host: Sarcina ventriculi Pyruvate Decarboxylase versus Other Kno...


PAGE 1

EXPRESSION OF PYRUVATE DECARBOXYLASE IN A GRAM POSITIVE HOST: Sarcina ventriculi PYRUVATE DECARBOXYLASE VERSUS OTHER KNOWN PYRUVATE DECARBOXYLASES By LEEANN TALARICO BLALOCK A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2003 i

PAGE 2

This dissertation is dedicated to my mother, Sandra Lee, without whom none of this would be possible. I would also like to dedicate it to my husband, Timothy Blalock, for his love and encouragement during the course of this work ii

PAGE 3

ACKNOWLEDGMENTS I would like to express my deepest gratitude to my mentor, Dr. Julie Maupin-Furlow, for her training and guidance throughout the course my work. Her experience and advice in this endeavor have been indispensable to my success. I would also like to sincerely thank the members of my doctoral thesis committee: Dr. Lonnie O. Ingram, Dr. K.T. Shanmugam, Dr. Jon Stewart, and Dr. Greg Luli. Their advice was crucial to the success of my research. I would also like to extend my appreciation to Dr. Kwang-Myung Cho, Dr. K.C. Raj, Dr. Heather Wilson, Dr. Adnan Hasona, Dr. Han Tao, Dr. Yilei Qian, Steve Kaczowka, Gosia Gil, Chris Reuter, Angelina Toral, Jason Cesario, Brea Duval, Uyen Le, Jennifer Timothe, and Angel Sampson for all of the experimental advice, friendship, and support that they have shown me during my time at the University of Florida. Finally, I would like to thank my mother, Sandra Lee; my husband, Dr. Timothy Blalock; my grandmother, Jane Lee; my godmother, Enid Causey; and my family: Michelle Murillo, Michael Murillo, Cherie and Sabas Murillo, Jeanne and Al Crews, Tina Johnson, Christina Johnson, and Carl Johnson for the invaluable support they have offered to me over the years. Lastly, I would like to thank Dr. Nathan Griggs, who piqued my interest in research and gave me the knowledge I needed to pursue my goals. iii

PAGE 4

TABLE OF CONTENTS page ACKNOWLEDGEMENTS................................................................................................iii LIST OF TABLES............................................................................................................ vii LIST OF FIGURES ......................................................................................................... viii KEY TO ABBREVIATIONS ..............................................................................................x ABSTRACT...................................................................................................................... xii CHAPTER 1 LITERATURE REVIEW .............................................................................................. 1 1 Industrial Importance of Pyruvate Decarboxylase......................................................... Pyruvate Decarboxylase Catalyzes the Production of Bioethanol...........................1 Pyruvate Decarboxylase Catalyzes the Production of PAC ....................................4 Production of PAC by Yeast....................................................................................5 Production of PAC in a Cell Free System ...............................................................7 Distribution of Pyruvate Decarboxylase........................................................................8 PDC in Fungi and Yeast ..........................................................................................8 PDC in Bacteria .....................................................................................................12 PDC in Plants.........................................................................................................14 Structure of Pyruvate Decarboxylase...........................................................................16 Subunits of PDC ....................................................................................................17 Cofactors of PDC...................................................................................................18 Kinetics of PDC.....................................................................................................19 Catalytic Residues of PDC.....................................................................................20 Alternative Substrates of PDC...............................................................................21 Study Rationale and Design.........................................................................................22 2 CLONING AND EXPRESSION OF pdc, AND CHARACTERIZATION OF PYRUVATE DECARBOXYLASE FROM Sarcina ventriculi. ........................... 23 23 Introduction.................................................................................................................. 24 Materials and Methods................................................................................................. Materials ................................................................................................................24 Bacterial Strains and Media...................................................................................25 DNA Isolation........................................................................................................25 iv

PAGE 5

Cloning of the S. ventriculi pdc Gene....................................................................25 Nucleotide and Protein Sequence Analyses...........................................................27 Production of S. ventriculi PDC in Recombinant E. coli.......................................28 Purification of the S. ventriculi PDC Protein.........................................................28 Activity Assays......................................................................................................29 Molecular Mass and Amino Acid Sequence Analyses..........................................30 31 Results and Discussion ................................................................................................ PDC Operon in S. ventriculi ..................................................................................31 PDC Protein Sequence in S. ventriculi .................................................................32 Production of S. ventriculi PDC Protein................................................................35 Properties of the S. ventriculi PDC Protein from Recombinant E. coli.................36 39 Conclusion ................................................................................................................... 3 OPTIMIZATION OF SvPDC EXPRESSION IN A GRAM POSITIVE HOST ......... 56 56 Introduction.................................................................................................................. 58 Materials and Methods................................................................................................. Materials ................................................................................................................58 Bacterial Strains and Media...................................................................................58 DNA Isolation........................................................................................................58 Cloning of the Sarcina ventriculi pdc Gene into Expression Vector pWH1520...58 Gram-positive Ethanol (PET) Operon ...................................................................59 Protoplast Formation and Transformation of B. megaterium................................59 Production of SvPDC in Recombinant Hosts.........................................................60 Purification of the S. ventriculi PDC Protein.........................................................60 Activity Assays and Protein Electrophoresis Techniques .....................................61 62 Results.......................................................................................................................... SvPDC Expression Vector for B. megaterium.......................................................62 Production and Purification of SvPDC from B. megaterium.................................62 Determination of Optimum Conditions for SvPDC Activity.................................63 Kinetics of SvPDC Produced in B. megaterium.....................................................63 Thermostability of SvPDC Produced in B. megaterium ........................................64 Generation of a Gram-positive Ethanol Production Operon..................................65 65 Discussion.................................................................................................................... 4 EXPRESSION OF PDCs IN A GRAM POSITIVE BACTERIAL HOST, B. megaterium ............................................................................................................ 77 77 Introduction.................................................................................................................. 78 Materials and Methods................................................................................................. Materials ................................................................................................................78 Bacterial Strains and Media...................................................................................79 Protoplast Formation and Transformation of B. megaterium................................79 DNA Isolation and Cloning ...................................................................................79 Production of PDC Proteins in Recombinant B. megaterium................................80 Activity Assays and Protein Electrophoresis Techniques .....................................81 RNA Isolation........................................................................................................81 v

PAGE 6

RNA Quantification...............................................................................................82 Pulse Chase............................................................................................................82 83 Results.......................................................................................................................... Discussion.................................................................................................................... 5 LIST OF REFERENCES................................................................................................. BIOGRAPHICAL SKETCH ........................................................................................... 122 Construction of Gram-positive PDC Expression Plasmids ...................................83 Expression of PDC In Recombinant B. megaterium .............................................84 Analysis of PDC Transcript Levels .......................................................................85 PDC Protein Stability in Recombinant B. megaterium..........................................86 87 GENERAL DISCUSSION AND CONCLUSIONS....................................................98 102 vi

PAGE 7

LIST OF TABLES Table page 2-1 Strains and plasmids used for production of PDC from S. ventriculi in E. coli .......41 2-2 Amino acid composition of PDC proteins................................................................43 2-3 Codon usage of S. ventriculi (Sv) and Z. mobilis (Zm) pdc genes ...........................44 3-1 Strains, plasmids, and primers used in Chapter 3.....................................................68 3-2 Purification of SvPDC from B. megaterium.............................................................69 4-1 Strains, plasmids and primers used in Chapter 4......................................................89 4-2 PDC activity of B. megaterium strains transformed with pdc expression plasmids ....................................................................................................................91 4-3 Codon usage of PDC genes and B. megaterium genome .........................................92 vii

PAGE 8

LIST OF FIGURES Figure page 2-1 A partial map of restriction endonuclease sites for a 7-kb BclI genomic DNA fragment from S. ventriculi.......................................................................................46 2-2 Nucleic acid and predicted amino acid sequence of the S. ventriculi pdc gene........47 2-3 Multiple amino acid sequence alignment of S. ventriculi PDC with other PDC protein sequences......................................................................................................49 2-4 Relationships between selected PDCs ......................................................................50 2-5 Relationships between pyruvate decarboxylase (PDC), indole pyruvate decarboxylase (IPD), -ketoisocaproate decarboxylase (KID), and homologues (ORF)........................................................................................................................52 2-6 S. ventriculi PDC protein synthesis in recombinant E. coli......................................54 2-7 Pyruvate dependant activity of the S. ventriculi PDC purified from recombinant E. coli.............................................................................................................................55 3-1 S. ventriculi PDC protein synthesized in recombinant E. coli and B. megaterium...70 3-2 pH profile for S. ventriculi PDC activity ..................................................................71 3-3 Effect of temperature on S. ventriculi PDC ..............................................................72 3-4 Effect of Pyruvate concentration on S. ventriculi PDC synthesized in recombinant E. coli, and B. megaterium........................................................................................73 3-5 Thermostability of recombinant S. ventriculi PDC...................................................74 3-6 Effect of pH on the thermostability of the S. ventriculi PDC produced in B. megaterium ...............................................................................................................75 3-7 Induction of S. ventriculi PDC and G. stearothermophilus ADH in B. megaterium...........................................................................................................76 viii

PAGE 9

4-1 Strategy used to construct plasmids for expression of S. ventriculi pdc in recombinant B. megaterium......................................................................................94 4-2 PDC proteins synthesized in recombinant B. megaterium........................................95 4-3 Levels of pdc-specific transcripts in recombinant B. megaterium............................96 4-4 PDC protein thermostability in recombinant B. megaterium....................................97 ix

PAGE 10

KEY TO ABBREVATIONS ADH alcohol dehydrogenase Ap Acetobacter pasteurianus bp base pairs DNA deoxyribonucleic acid Km Michaelis Constant for enzyme activity MES 2-[N-morpholino]ethanesulfonic acid NADH nicotinamide adenine dinucleotide ORF open reading frame PAC (R)-phenylacetylcarbinol (R-1-hydroxy-1-phenylpropane-2-one) PDC pyruvate decarboxylase PET portable ethanol operon PVDF polyvinylidene difluoride RNA ribonucleic acid Sc Saccharomyces cerevisiae SDS-PAGE sodium dodecyl sulfate-polyacrylamide gel electrophoresis Sv Sarcina ventriculi TPP thiamine pyrophosphate U Unit of enzyme activity defined as the amount of enzyme that generates 1 mol of product (acetaldehyde) per minute x

PAGE 11

Vmax maximal rate of enzyme activity Zm Zymomonas mobilis Zp Zymobacter palmae xi

PAGE 12

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy EXPRESSION OF PYRUVATE DECARBOXYLASE IN A GRAM POSITIVE HOST: Sarcina ventriculi PYRUVATE DECARBOXYLASE VERSUS OTHER KNOWN PYRUVATE DECARBOXYLASES by LeeAnn Talarico Blalock December 2003 Chair: Julie A. Maupin-Furlow Major Department: Microbiology and Cell Science The technology currently exists for bacteria to produce ethanol from inexpensive plant biomass. To enhance the commercial competitiveness of biocatalysts for the large-scale production of ethanol, a new host organism will need to be developed that can withstand many factors including low pH, high temperature, high ethanol concentrations, and various other harsh environmental conditions. Gram-positive bacteria naturally possess many of these qualities and would be ideal candidates for ethanol production; however, the use of the pdc and adh genes from the Gram-negative bacterium, Zymomonas mobilis, has met with only limited success. In order for this approach to be successful, a gene for pyruvate decarboxylase that is readily expressed in a Gram-positive host needs to be identified. The Sarcina ventriculi pdc gene (Svpdc) is the first to be cloned and characterized from a Gram-positive bacterium. Comparative amino acid sequence analysis confirmed xii

PAGE 13

that SvPDC is quite distant from Z. mobilis PDC (ZmPDC) and plant PDC enzymes. Elucidation of the sequence of the Svpdc sequence also led to the identification of a new subfamily of PDCs. The Svpdc gene was expressed at low levels in recombinant E. coli due to differences in the codon usage in the hosts and the Sarcina ventriculi pdc. Expression was improved by the addition of supplemental tRNA genes and facilitated the purification and biochemical characterization of the recombinant SvPDC enzyme. This dramatic difference in codon usage suggested that the Svpdc gene was an ideal candidate for engineering high-level PDC production in low G+C Gram-positive bacteria. To confirm this, expression of pdc genes from distantly related organisms (i.e. Z. mobilis, Acetobacter pasteurianus, and Saccharomyces cerevisiae) were compared to that of the Svpdc in recombinant Bacillus megaterium. SvPDC protein and activity levels were several-fold higher in recombinant B. megaterium compared to the other PDCs examined. Transcript levels using quantitative reverse transcriptase polymerase chain reaction and protein stability using pulse-chase indicated that SvPDC was expressed at higher levels than other PDCs tested due to its optimal codon usage. This is the first PDC expressed at high levels in Gram-positive hosts. xiii

PAGE 14

CHAPTER 1 LITERATURE REVIEW Industrial Importance of Pyruvate Decarboxylase Pyruvate Decarboxylase Catalyzes the Production of Bioethanol In 2001 the United States produced 1.77 billion gallons of fuel ethanol of which 90% was produced by fermentation of corn by yeast (1). The demand for fuel ethanol is expected to more than double in the next few years because it will replace the fuel oxygenate methyl tertiary butyl ether (MTBE), a known carcinogen which has been linked to ground water contamination and has proven difficult to remove from the environment (2). Fuel ethanol production in 2001 consumed over 5% of the corn crop, and it has been estimated that fuel ethanol production will reach more than 4 billion gallons per year by 2006 (1, 2). The use of corn as a feedstock for the production of ethanol has led to several problems. Because corn is also used for food, this feedstock has a higher price than alternative feedstocks that are considered waste products from various processes (3). The use of corn also leads to controversy over sacrificing a food product for fuel production (3). However, production of ethanol from non-food sources (bioethanol) can provide a useful alternative to the current method of disposing of lignocellulosic wastes such as rice straw and wood wastes that were historically burned but now must be disposed of in a more environmentally friendly and much more costly manner (3). Utilizing these waste products for bioethanol production not only provides 1

PAGE 15

2 an inexpensive feedstock but benefits the environment by disposing of this material in an environmentally friendly manner and producing a clean burning fuel source (3). Organisms traditionally used for ethanol fermentation do not have the ability to metabolize pentoses. Considerable research has been performed to identify naturally occurring organisms that can ferment pentoses (4). Because yeast have been the traditional organisms used for ethanol production and they produce high ethanol yields, research focused on identifying yeast that could metabolize pentose sugars (5). Several yeast strains have been identified that are capable of utilizing xylose for ethanol production: Pachysolen tannophilus (6-9), Pichia stipitis (10-14), and Candida shehatae (10, 11, 15). Unfortunately, these yeast produce only low levels of ethanol from xylose and exhibit a multitude of problems including low ethanol tolerance, utilization of the ethanol produced, inability to utilize and metabolize arabinose, and production of xylitol (6-15). Attempts have also been made to isolate yeast that ferment arabinose, but the yeast which have been isolated produce very low levels of ethanol (4.1 g/liter) (16). Attempts to improve yeast strains for ethanol production have also been pursued by engineering recombinant strains. S. cerevisiae has been the primary focus of this research because the corn ethanol industry is already familiar with this organism, it produces high levels of ethanol, and it has been shown to be resistant to high levels of ethanol (5). Attempts to engineer a xylose utilization pathway from bacteria into S. cerevisiae has been unsuccessful (17-21). A more promising strategy has been to engineer the xylose-utilization genes from other yeast into S. cerevisiae (22, 23). One of the most successful recombinant strains of S. cerevisiae to utilize xylose has been a strain engineered with a plasmid that contained three xylose-metabolizing genes: a xylose

PAGE 16

3 reductase gene and xylitol dehydrogenase gene from Pichia stipitis, and a xylulokinase gene from S. cerevisiae (23). This strain produced ethanol at 22 g/liter which was a vast improvement over strains expressing bacterial xylose utilization genes (23). While recombinant yeast have been engineered to utilize xylose, there have been no successful attempts to engineer arabinose utilization into these organisms. Many bacteria naturally possess the ability to ferment hexose and pentose sugars, but produce a variety of fermentation endproducts (4). In bacteria, pentose and hexose sugars are metabolized to pyruvate. Ingram et al. (24) have demonstrated that funneling this pyruvate to ethanol is possible by the use of the pyruvate decarboxylase and alcohol dehydrogenase II from Z. mobilis. The low Km of the Z. mobilis PDC (0.4 mM pyruvate) competes favorably with the other enzymes for pyruvate in the cell and causes large amounts of acetaldehyde to be made, which is then converted to ethanol by alcohol dehydrogenase (24). A portable ethanol production operon (PET) was generated that contained the Z. mobilis PDC transcriptionally coupled to the Z. mobilis alcohol dehydrogenase II (24). The PET operon was used to successfully engineer enteric bacteria for ethanol production including Klebsiella oxytoca (25), Erwinia chrysanthemi (26), Enterobacter cloacae (27), and many strains of E. coli (28, 29). The PET operon has also been successfully used to engineer a wide range of other organisms including tobacco (30, 31) and cyanobacteria (32). Attempts have also been made to engineer Gram-positive bacteria to produce ethanol using the PET operon, but this strategy has been unsuccessful due to poor expression of the Z. mobilis genes (33-35). The recent cloning and characterization of a PDC from the Gram-positive bacterium Sarcina ventriculi and its subsequent high level expression in the Gram-positive bacterium,

PAGE 17

4 Bacillus megaterium, will enable the development of new Gram-positive biocatalysts for the production of ethanol (this study). Pyruvate Decarboxylase Catalyzes the Production of PAC In 1921, while examining the biotransformation of benzaldehyde to benzyl alcohol by fermenting Brewers yeast (Saccharomyces uvarum), Neuberg and Hirsh discovered that after 3-5 days no sugar or benzaldehyde remained. Furthermore, the amount of benzyl alcohol produced was not proportional to the amount of substrate consumed (36). They later determined that the byproduct of this reaction was (R)-phenylacetylcarbinol (PAC) and named the enzyme that catalyzed its synthesis carboligase (37, 38). The process of PAC formation by Brewers yeast was patented in 1932, making it one of the first chiral intermediates to be produced on an industrial scale by biotransformation (39, 40). PAC is the first chiral intermediate in the production of L-ephedrine and pseudoephedrine, which are the major ingredients in several commonly used decongestants and antiasthmatics as well as having a possible use in control of obesity (41, 42). Several studies have confirmed that the enzyme catalyzing the production of PAC is pyruvate decarboxylase (EC 4.1.1.1) (43-46). Pyruvate decarboxylase (PDC) catalyzes two different reactions: non-oxidative decarboxylation of -ketoacids to the corresponding aldehyde (47-50) and the carboligase side reaction forming the hydroxyketones (51, 52). In the acycloin-type condensation reaction, an active aldehyde in the active site is condensed with a second aldehyde as a cosubstrate (40). The

PAGE 18

5 cosubstrate is acetaldehyde in vivo, but can be another aldehyde when supplied externally (40). In the production of PAC, benzaldehyde is the cosubstrate fed to yeast cells (40). Production of PAC by Yeast The industrial production of PAC has historically utilized yeast cells, primarily Saccharomyces sp. and Candida sp. Many efforts to improve yeast PAC production have focused on increasing yields of PAC through alteration of the fermentation conditions and medium (53-55). When S. carlsbergensis is grown on sucrose, acetaldehyde, and benzaldehyde the highest initial rate of biotransformation and the highest production of PAC were detected in the cells with the lowest PDC activity. This led to the suggestion that production of PAC is limited only by the intracellular pools of pyruvate and that biotransformation of PAC ceases due to low levels of pyruvate before benzaldehyde mediated inactivation of PDC occurs. Addition of pyruvate did not increase the rate of PDC synthesis but did increase the overall production of PAC (55). The current industrial process for the production of PAC uses a two-stage fed-batch process. In the first stage, the yeast are grown under partial fermentative conditions to induce the production of PDC and allow intracellular accumulation of pyruvate. In the second stage, the biotransformation takes place with feeding of noninhibiting levels of benzaldehyde. Using this strategy a PAC accumulation level of 22 g/L has been reached (56). This strategy, however, is hindered by side-reactions within the cells as well as the sensitivity of the cells to benzaldehyde and the fermentative products (57). Besides the PAC production, yeast cells also typically reduce up to 16% to 50% of the

PAGE 19

6 benzaldehyde to benzyl alcohol (36-38). The production of benzyl alcohol is primarily due to the action of alcohol dehydrogenases and other oxidoreductases in the cell (58-60). Other byproducts are also produced including acetoin, benzoic acid, benzoin, butan-2,3-dione (diketone), trans-cinnamaldehyde, 2-hydroxypropiophenone, and 1-phenyl-propan-2,3-dione (acetylbenzoyl) (61, 62). In addition to the formation of these side-products, PAC is also enzymatically reduced to (1R, 2S)-1-phenyl-1,2-propane-diol (54). At benzaldehyde concentrations above 16 mM the viability of the yeast cells is diminished, and PAC production is completely inhibited above 20 mM (63). If the level of benzaldehyde drops below 4mM, benzyl alcohol becomes the primary product (63). Comparison of intracellular and extracellular benzaldehyde levels shows that the membrane maintains a permeability barrier (9.4 mM), which results in lower levels of benzaldehyde in the cell and may protect intracellular proteins. At concentrations above 9.4 mM benzaldehyde, the barrier appears to falter and intracellular enzymes are inactivated (59). The yeast PDC, however, is resistant to denaturation by benzaldehyde at levels up to 66 mM benzaldehyde and is also fairly resistant to final PAC concentration (59). Thus it was concluded that the modification of cell permeability by benzaldehyde decreases PAC production by causing release of the cofactors necessary for the carboligation reaction (i.e. Mg2+ and TPP) and not by inactivation of PDC (59). Because of these limitations, it would be beneficial to genetically engineer an organism for PAC production that is more resistant to benzaldehyde and does not catalyze multiple side reactions. Alternatively, a cell free system may be a viable alternative to the use of whole cells for PAC production.

PAGE 20

7 Production of PAC in a Cell Free System Utilization of isolated PDC for the biotransformation of pyruvate to PAC has only recently been pursued as an alternative to the use of whole cells. A distinct advantage to using a cell free system as opposed to cells as a source of PDC is that the oxidoreductases responsible for the conversion of benzaldehyde to benzyl alcohol as well as the cytotoxicity of benzaldehyde can be avoided (58, 59, 63, 64). The first attempt to use partially purified PDC for the conversion of pyruvate to PAC compared the efficiencies of PDCs from Z. mobilis and S. carlsbergensis (65). This study proved that both PDCs can be used for production of PAC, however the Z. mobilis PDC has a much lower affinity for benzaldehyde (65). In another study, a high concentration of benzaldehyde was used with partially purified PDC from Candida utilis (66). At a benzaldehyde levels of 200 mM, a PAC level of 190mM (28.6 g/L) was obtained which was considerably higher than previously reported values. Shin and Rogers (67) later determined that the factor limiting conversion of pyruvate and benzaldehyde to PAC was the inactivation of PDC by benzaldehyde. This inactivation was determined to be first order with respect to benzaldehyde and exhibited a square root dependency on time. Stability of the PDC used for the production of PAC is an important factor in the success of the biotransformation. Previous studies have shown that S. cerevisiae PDC exhibits a high carboligase activity, but shows only low stability when isolated (65). The PDC from Z. mobilis has been shown to have low carboligase activity with respect to the yeast enzyme but high stability (65, 68). It was determined that mutating residues within the Z. mobilis PDC enhanced its carboligase activity (68-70). The Pohl lab (71, 72) used

PAGE 21

8 the Z. mobilis PDC mutants to produce PAC in an enzyme-membrane reactor. This continuous reaction system utilized acetaldehyde and benzaldehyde in an equimolar ratio. At a substrate concentration of 50 mM of both aldehydes, a PAC volume production of 81 g L-1d-1 was obtained with higher yields possible by use of a series of membrane reactors. Use of cell free systems for the production of PAC is relatively new, having only started in 1988 (65), as opposed to the biotransformation using whole cells which began in 1932 (40). At the moment, the most promising PDCs for production of PAC are variants of Z. mobilis PDC that enable benzaldehyde to access the active site (68-70). In cell free systems, the primary factor limiting production of PAC is the availability of PDC enzymes that can withstand the reaction conditions, mainly inactivation by aldehydes. Until recently, Z. mobilis PDC was the only known PDC from bacteria. This enzyme has been shown to be more stable when compared to the yeast PDCs and alteration of as little as one amino acid enhanced carboligase activity (70). Recently characterized PDCs from bacteria are likely to have beneficial qualities for the production of PAC. Distribution of Pyruvate Decarboxylase PDC has been identified in a wide variety of plants and fungi, but is rare in bacteria. The following section identifies the organisms known to encode PDC and describes the known function of the enzyme in that organism. PDC in Fungi and Yeast Several fungal PDCs have been identified. These PDCs from filamentous fungi appear to be active when the organism experiences anoxic conditions (73-75). It is

PAGE 22

9 through PDC that the cell has the ability to regenerate NAD+ through the production of acetaldehyde that is then converted to ethanol by alcohol dehydrogenase. In Neurospora crassa PDC forms large cytoplasmic filaments that can measure 8-10 nm in length (73). The appearance of these filaments in the cell has been shown to correspond to increased levels of pdc mRNA and increased PDC activity levels within the cell (73). Disassembly of the filaments enables recovery of active PDC indicating that the filaments are an active storage form of the enzyme (73). This PDC is particularly interesting in that the amino acid sequence is more closely related to bacterial PDCs than to yeast PDCs while the kinetics are more similar to other fungal PDCs (73). A gene encoding a putative pdc was isolated from a genomic DNA library of Aspergillus parasiticus (74). The A. parasiticus PDC deduced amino acid sequence was shown to have 37% similarity to the PDC1 from Saccharomyces cerevisiae, which was the highest to any PDC and showed that it is quite different from previously characterized PDCs (74). The organisms A. parasiticus, Aspergillus niger, and Aspergillus nidulans were tested for the production of ethanol in shake flask cultures. Ethanol was detected indicating a response to anoxic conditions even though they are obligate aerobes (74). Although this showed that A. nidulans produced ethanol under anoxic conditions (74), the reasearchers did not test for PDC activity in cell lysate. Lockington et al. (75) showed that mycelia subjected to anoxic stress had elevated levels of PDC activity. The gene for PDC was isolated and sequenced from A. nidulans (75) and the deduced amino acid sequence from this gene was shown to have highest similarity (37%) to the A. parasiticus PDC (75). This study showed that production of PDC in the cell is regulated at the level

PAGE 23

10 of mRNA and that production of PDC is therefore the major determinant of ethanol production under anoxic conditions in A. nidulans (75). Several PDCs from yeast have been identified and two are among the best studied of all PDCs (76). In yeast, PDC serves the same purpose as in most organisms, which is to replenish NAD+ supplies under anaerobic conditions. In most yeast, fermentation and respiration both contribute to glucose catabolism under aerobic conditions. In Saccharomyces cerevisiae respiratory and fermentative pathways are mutually exclusive and the pyruvate produced during glycolysis is funneled by PDC almost entirely to acetaldehyde and then to ethanol by ADH (77). The majority of yeast, however, rely on respiration under aerobic conditions to regenerate NAD+ (77). Saccharomyces uvarum PDC has been extensively studied over the past two decades due to its various uses in industry, including use in breweries. Wild-type S. uvarum PDC exists in a mixture of isoforms consisting of an homotetramer composed of one type of subunit with a molecular weight of 59 kDa (78, 79)and an tetramer with two types of subunits with different molecular weights (subunit is 61 kDa) (80). These subunits also differ in amino acid composition and sequence (81, 82). A high performance liquid chromatography separation procedure was used to obtain a single isoform (4) in a catalytically active state for crystallization (83). The first crystal structure of a PDC was obtained using crystallized form of this 4 PDC (84). Deletion mutants of the gene coding for the-subunit have been used to produce the 4 PDC protein for study (85). It was found that the 4 enzyme is considerably less stable in aqueous solution than wild-type PDC having a rate of inactivation which is 5 times higher than the wild-type enzyme; however the kinetic features of the two isoforms are

PAGE 24

11 the same (85). Some controversy currently exists over the substrate activation of 4 PDC. A significant body of work led to the conclusion that the Cys221 residue is required for substrate activation of S. uvarum 4 PDC by binding pyruvate leading to a conformational change in the enzyme (86-90). However, a crystal structure of S. uvarum PDC in the presence of the activator pyruvamide shows that this pyruvate analog does not interact with the Cys221 residue (91). Kinetic evidence in this study also suggests that Cys221 is not responsible for substrate activation (91). Further aspects of S. uvarum PDC activation will be discussed later in this chapter. Saccharomyces cerevisiae has been extensively studied due to its various uses in industry, including industrial ethanol production (2). Nucleotide sequences of six PDC genes have been determined (92-98). Three of these genes have been identified as structural genes: PDC1 (92, 99-101), PDC5 (94, 102), and PDC6 (95, 96). Wild-type S. cerevisiae PDC protein is composed of 85% from PDC1 translation while 15% is from PDC5 translation (102). If one of these two genes is deleted, translation of the other increases to compensate (102). A crystal structure of S. cerevisiae PDC1 in the inactive state was determined and was essentially the same as the S. uvarum PDC structure (103). For this reason, the S. cerevisiae PDC has been a central focus for understanding PDC structure-function because, unlike S. uvarum PDC, the nucleotide sequence has been determined (84, 91). The various site-directed mutagenesis studies performed on the S. cerevisiae PDC will be discussed later in this chapter. A gene for PDC from Kluveromyces lactis was cloned, and it was determined that it was induced by glucose at a transcriptional level (104). The PDC protein encoded by this gene was purified and characterized, and it was determined that it was similar to S.

PAGE 25

12 cerevisiae PDC with a few distinct differences (105). There is a very low binding affinity for pyruvate at the regulatory site (Ka = 207.00 mM); however, it is compensated by the fast isomerization (kiso = 3.03) and low Km value for pyruvate of 0.24 mM which is approximately 2-fold lower than that for S. cerevisiae PDC (Km of 0.47 mM for pyruvate) (105). While the PDC from S. cerevisiae has been studied extensively, the majority of other known yeast PDCs are not well characterized. PDC has been characterized from Hanseniaspora uvarum (106), Zygosaccharomyces bisporus (107), and genes for PDC have been sequenced from Klyveromyces marxianus (108) and Pichia stipitis (109). PDC in Bacteria Although study of PDC has been ongoing for many years, the main focus has been primarily on PDC from yeast. The discovery that ethanol formation in Zymomonas mobilis was catalyzed by PDC (110) and the later characterization of the protein (111-113) and gene (114-116) identified bacterial PDCs as a distinct group with unique properties that made them attractive for further research. The identification, cloning, and characterization of bacterial PDCs have been aggressively pursued in recent years and our knowledge of this previously unidentified group of PDCs is quickly expanding. The PDC from Z. mobilis was the first bacterial PDC to be identified (110), characterized (111-113), and cloned (114-116) and has since become one of the most intensively studied PDC proteins. Z. mobilis PDC was the first PDC discovered that was not substrate activated (111). This enzyme has the highest specific activity of all PDCs (180 units per mg protein) and an extremely low Km of 0.4 mM pyruvate (112). PDC from Z. mobilis is also the most stable PDC in the purified form of those tested (117).

PAGE 26

13 This protein is readily expressed at high levels in E. coli (113, 114). A high resolution crystal structure of Z. mobilis PDC was obtained, and it was shown that the tight packing of the subunits in the dimers of the tetramer prevents large conformational changes and locks the enzyme in an active state (117). This crystal structure also showed how a previously characterized mutant, Trp392Ala, improved synthesis of PAC by Z. mobilis PDC (70) by relieving the steric hindrance caused by bulky amino acid side chains in the active site cavity (117). Extensive site-directed mutagenesis studies have been performed on Z. mobilis PDC (70, 110, 118-126). These studies will be discussed later in this chapter. The Z. mobilis PDC enzyme has been successfully used to engineer a wide variety of organisms for ethanol production (4, 30-32, 34, 127-129) and has also been modified for the efficient production of PAC in recombinant hosts (68, 70-72, 123). Acetobacter pasteurianus utilizes PDC in a unique way (130). While all other known PDC proteins function only in anaerobic fermentation to ethanol, the A. pasteurianus PDC actually functions only in oxidative metabolism (130). In A. pasteurianus, this enzyme functions to cleave the central metabolite pyruvate into acetaldehyde and CO2, after which the acetaldehyde is oxidized to the final product, acetic acid (130). Upon comparison of the deduced amino acid sequence, it was shown that the A. pasteurianus PDC is most closely related to the Z. mobilis PDC (130). The most recently discovered bacterial PDC is from Zymobacter palmae (131). The Z. palmae PDC protein composed approximately 1/3 of the soluble protein when produced in recombinant E. coli (131). It was hypothesized that the high level of PDC protein produced is due to similar codon usage of this pdc gene and the E. coli genome (131). The Km for pyruvate (0.24 mM) of the Z. palmae PDC is the lowest of all bacterial

PAGE 27

14 PDCs and is equivalent to the lowest Km for pyruvate reported for all PDCs (0.24 mM pyruvate for the PDC from K. lactis) (105, 131). This enzyme also has the highest Vmax (130 units per mg protein) of recombinant bacterial PDC proteins purified using similar conditions (131). The high level of Z. palmae PDC produced in recombinant E. coli combined with the biochemical characteristics of this enzyme make it an exciting enzyme for the development of new biocatalysts for fuel ethanol production (131). In 1992, Lowe and Zeikus (132) purified a PDC from Sarcina ventriculi. This was only the second PDC from bacteria to be characterized and unlike Z. mobilis PDC it was substrate activated (132). The gene for this PDC was cloned and expressed recombinantly in E. coli (133). Production of this protein in recombinant E. coli was low, probably due to large differences in codon usage, therefore augmentation with accessory tRNAs was necessary (133). The deduced amino acid sequence of S. ventriculi PDC differs from the Z. mobilis PDC and the SvPDC appears to have diverged from a common ancestor that included most fungal PDCs and bacterial indole-3-pyruvate decarboxylases (133). The purified enzyme is biphasic with a Km of 2.8 mM and 10 mM for pyruvate for the high and low affinity sites, respectively (133). Expression of S. ventriculi PDC is higher in Bacillus megaterium when compared to S. cerevisiae PDC1, Z. mobilis PDC, and Acetobacter pasteurianus PDC, indicating that it will be a useful tool in the engineering of Gram-positive bacteria for ethanol production (this study). PDC in Plants In plants, PDC serves to convert pyruvate to acetaldehyde. The acetaldehyde is then converted to ethanol by alcohol dehydrogenase. In this manner these two enzymes catalyze a pathway in which NAD+ is regenerated under anaerobic conditions such as

PAGE 28

15 during seed germination and in plant roots when submerged (134). Despite the large number of PDCs from plants, relatively few have been characterized in detail. In 1976, Wignarajah and Greenway tested for the effect of anaerobiosis on the roots of Zea mays (135). In this study, they determined that flushing nitrogen gas through solutions for a period of 4 to 15 hrs increased activity levels of both alcohol dehydrogenase and PDC in the Z. mays roots. The PDC from Z. mays was later purified and characterized (136, 137). It had a Km of 0.5 mM for pyruvate and a Vmax of 96 units per mg protein. Z. mays PDC was shown to be substrate activated, and cooperative binding of pyruvate decreased as the pH decreased leading to the enzyme being less dependant on pyruvate for activation (136). The PDC from Pisum sativum is one of the most thoroughly characterized plant PDCs (76, 138-143). Based on Southern hybridization experiment, P. sativum has three genes for putative-PDCs, of which only one has been sequenced (143). The purified enzyme is composed of two different subunits (65 kDa and 68 kDa), but it is still unknown whether the two subunits are transcriptional products of the same or different genes (142). The P. sativum PDC is activated by its substrate (140) and is ten times more stable than the PDC from the yeast, S. carlsbergensis (142). The active enzyme is a mixture of tetramers, octomers, and higher oligomers (139, 142). Acetaldehyde is a predominant aldehyde in orange juice (144) and significantly influences flavor (145). PDC is the key enzyme for the formation of acetaldehyde in oranges (146). The PDC purified from orange fruit is mechanistically similar to yeast PDC, except that it has only one active site (147).

PAGE 29

16 Ipomoea batatas (sweet potato) produces PDC in its roots (148-150). This PDC is substrate activated, has a Km of 0.6 mM, and is inhibited by phosphate (149). Pyruvate decarboxylation is the rate-limiting step in alcoholic fermentations in sweet potato roots based on the finding that PDC activity is 21to 28-fold less than ADH activity under aerobic conditions, but 6to 8-fold less than ADH under anaerobic conditions (150). PDC has also been characterized from Triticum aestivum (wheat) (81, 82, 151-154), Oryza sativa (rice) (155-160), and Vicia faba (fava bean) (161). PDC has been shown to be produced in but not characterized from Capsicum annuum (bell pepper) fruit (162), Echinochloa crus-galli (barnyard grass) (163), Nicotiana tobacum (tobacco) (164), Vitis vinifera (grape) (165), Lycopersicon esculentum (tomato) (166), Lepidium latifolium (167), Populus deltoides (Eastern cottonwood) (168), Glycine max (soybean) (168), and Arabidopsis thaliana (169, 170) Structure of Pyruvate Decarboxylase The crystal structures of Z. mobilis (117), S. uvarum (84, 91) and S. cerevisiae (103) PDCs have been invaluable when studying PDC proteins for use and engineering for industrial application. By comparison of deduced amino acid sequences and biochemical characteristics it has been shown that the A. pasteurianus and Z. palmae PDCs are more closely related to Z. mobilis PDC (130, 131); whereas, the S. ventriculi PDC is more closely related to S. cerevisiae PDC1 (133). Because the majority of the bacterial PDC proteins were only recently discovered (130, 131, 133) there has not been sufficient time for detailed structural analysis of these enzymes. However, the crystal structure and mutagenesis analysis of the well characterized Z. mobilis, S. uvarum and S.

PAGE 30

17 cerevisiae PDC proteins can give important and useful information about the structure of the newly identified bacterial PDC proteins. Subunits of PDC The quaternary structure of most PDCs is a tetramer with an apparent molecular weight of 240 kDa (79, 105, 111, 130-133, 148, 151, 155, 171), with the exception of PDCs forming larger complexes: A. pateurianus (130), Z. mays (135), P. sativum (139, 142), T. aestivum (81), and N. crassa (73). The association of the subunits has been determined to be pH-dependant with optimal pH for catalytic activity and subunit association of between pH 5.0 and pH 6.7 (108, 113, 131, 132, 147, 155). Until recently it was believed that the tetramer was the only active conformation (172), but a recent study showed that both dimers and tetramers of ScPDC1 had comparable specific activity (173). This study, however, determined a difference in the dissociation constant for the regulatory substrate by one order of magnitude among the two forms indicating that binding of the substrate to the regulatory site is influenced by oligomerization (173). In contrast, the subunit interactions of the Z. mobilis PDC are different than those of S. cerevisiae PDC1 (117). Unlike the S. cerevisiae PDC1, Z. mobilis PDC is not controlled by allosteric regulation. The reason for this difference is elucidated in the crystal structures (117). Z. mobilis PDC dimers are packed tightly together and lock the enzyme in an activated form so that large conformational changes are not possible or necessary for enzyme activity as they are in S. cerevisiae PDC1 (91, 117). This tight packing of the dimers also explains the extreme stability of the Z. mobilis PDC in comparison to the S. cerevisiae PDC1 (174). This data is also in agreement with the differences in the thermostabilities of the bacterial PDCs. The Z. mobilis, A. pasteurianus, and Z. palmae

PAGE 31

18 PDCs have temperature optima of 60C, while S. ventriculi PDC has a temperature optimum of 32C and is completely inactive at 60C (131). Structural differences in the subunit interactions may be responsible for the instability of S. ventriculi PDC at high temperatures. Analysis of S. ventriculi PDC thermostability throughout a range of pH shows that the enzyme is more stable between pH 5.0 and pH 5.5 indicating that protonation of an amino acid side chain may stabilize the subunit interactions at high temperatures (this study). Cofactors of PDC Both Mg2+ and thiamin diphosphate (TPP) are required cofactors for the action of PDC (175, 176). It has been demonstrated that TPP dissociates from PDC under alkaline conditions, but it is difficult if not impossible to remove Mg2+ completely from the enzyme (137, 177-179). Mg2+ can be replaced by other divalent cations, such as Mn2+, Ni2+, Co2+, and Ca2+ (176). The substitution of Mg2+ with these other cations does not affect the Vmax of the enzyme, but it does affect the stability of the reconstructed holoenzyme (180, 181). A TPP derivative retaining the N-1-4amino system functions properly with full binding capacity therefore proving that this is the functional group necessary for activity of the PDC (182, 183). The Z. mobilis PDC retains its tetrameric state even after the TPP and Mg2+ cofactors are removed (178). This is also true of S. ventriculi PDC, Z. palmae PDC, and S. cerevisiae PDC1, but not of A. pasteurianus PDC (131). A. pasteurianus PDC forms both tetramers and octomers of similar specific activity and dissociates into dimers after cofactor extraction (131). Tetrameric configuration and activity are restored upon addition of the cofactors (131). The dissociation of the subunits is consistent with the behavior of other PDCs upon cofactor

PAGE 32

19 removal (76). Residues responsible for binding the cofactors, as determined through X-ray crystallography studies, are conserved throughout yeast and bacterial PDC proteins (91, 103, 131). Kinetics of PDC There are currently two distinct groups of PDC proteins based on kinetics. All known PDC proteins, except those from Gram-negative bacteria, are allosterically regulated (76). The substrate activation behavior of S. cerevisiae PDC has been studied in detail through site-directed mutagenesis and crystal structure analysis (47, 86-91, 103, 184-191). Initial studies of the S. uvarum PDC determined that a cysteine residue was most likely responsible for the substrate activation behavior. In these studies, irreversible activation of the enzyme, exhibited by disappearance of the lag phase in product formation, was achieved by utilization of thiol specific reagents (80, 192-194). Use of a PDC1-PDC6 fusion protein that contained Cys221 as its only cysteine residue suggested that the Cys221 residue was responsible for the substrate activation behavior of S. cerevisiae PDC (86). Site-directed mutagenesis of the Cys221 and/or Cys222 to serine showed that the enzyme could no longer be activated by the substrate (87). Steady state kinetics studies were also used to bolster the argument for Cys221 as the site of substrate activation (88, 89). Although crystal structures of S. uvarum and S. cerevisiae PDC were determined in the presence and absence of effectors (84, 103, 187, 195), these crystal structures were not of high enough quality to determine where the activator molecules bound the enzyme More recently, Lu et al. obtained a high resolution crystal structure of S. uvarum PDC in the presence of pyruvamide and determined that pyruvamide did not bind at or near Cys221 (91). This study also used kinetics to show that the Cys221Ser

PAGE 33

20 was in fact still substrate activated (91); however, this data was later refuted by Wei et al. (90) who used solvent kinetic isotope effect to reaffirm that their original assertion that Cys221Ser does shift the enzyme into an active conformation. Lu et al. (91) determined the residues that bind pyruvamide in the regulatory site of the crystal structure of PDC1 as Tyr157 and Arg 224. Sergeinko et al. (191), however, argues that pyruvamide should not be considered to form an active conformation of the enzyme and may actually represent an inhibitory mode of binding. It is interesting to note that plant PDCs and the S. ventriculi PDC are substrate activated, yet the Cys221 equivalent is not conserved in these proteins while equivalent residues for Tyr157 and Arg224 are conserved (121, 131, 133). The Gram-negative bacterial PDC proteins are the only known PDCs that exhibit Michaelis-Menten kinetics (111-113, 130, 131). These PDCs also have high affinity for the substrate pyruvate with a Km of 0.24 mM pyruvate for Z. palmae PDC, 0.39 mM pyruvate for A. pasteurianus PDC, and 0.43 mM pyruvate for Z. mobilis PDC (131). The Gram-negative bacterial PDCs also have the highest Vmax values of all PDCs (68, 131). The low Km and high Vmax of Z. mobilis PDC have already been exploited successfully to engineer biocatalysts for fuel ethanol production (4). Catalytic Residues of PDC All crystal structures of TPP dependent enzymes have a glutamate residue close to the N-1 of TPP that promotes the ionization of the C-2 proton of TPP (121). Candy et al. demonstrated that substitution of Glu50 with either aspartate or glutamine yields an enzyme with 3.0% and 0.5% remaining catalytic activity of the wild-type enzyme, respectively (119). Each of these mutants also displays a decreased affinity for both

PAGE 34

21 cofactors (119). The equivalent glutamate in yeast, Glu51, is also essential for catalytic activity (196). Only 0.04% catalytic activity of the wild-type enzyme remains upon substitution of Glu51 with glutamine and binding of TPP to the protein is slow (196). The Z. mobilis PDC crystal structure reveals that amino acid side chains Asp27, His113, His114, Thr388, and Glu473 are in the vicinity of the active site and are conserved among PDC proteins (117). This data corresponds well with the crystal structure data and site-directed mutagenesis studies of the S. cerevisiae, Z. mobilis, and S. uvarum PDCs (91, 120, 122, 195, 197). Alternative Substrates of PDC As discussed previously in this chapter, Neuberg and Hirsch (36, 38) first discovered that yeast could catalyze the formation of PAC when benzaldehyde was added to the medium. This reaction was later determined to be catalyzed by PDC (43-46). It has since been shown that the yeast PDCs are much more efficient at carboligase reactions than the PDC from Z. mobilis (65). The reason for this difference is believed to be the size of the active site cleft which is smaller in the Z. mobilis PDC than its yeast counterparts (117). Bruhn et al. found that the mutation of only one amino acid increased carboligase activity by Z. mobilis PDC by 4-fold when compared to wild-type (70). The crystal structure of Z. mobilis PDC showed other large side chains that were possible sites for mutagenesis to increase carboligase activity (117). Pohl et al. have since made these mutations and found a wide variety of carboligase activities catalyzed by these PDC variants, including one in which the stereochemistry has been changed to form (S)-phenylacetylcarbinol (123).

PAGE 35

22 PDC from Brewers yeast catalyzes the formation of acetoin through two separate mechanisms (198-200). Acetoin is produced by the aldol-type condensation reaction between two molecules of acetaldehyde or by the addition of acetaldehyde to an intermediate formed between pyruvate and thiamin pyrophosphate (198-200). Besides pyruvate, yeast PDCs have been shown to accept longer aliphatic -keto acids like -keto butanoic acid, -keto pentanoic acid, branched aliphatic -keto acids, as well as -keto-phenylpropanoic acid (benzoylformate) and various phenyl-substituted derivatives of the latter (69, 201, 202). Only C4 and C5-keto acids have been shown to be substrates for PDC from Z. mobilis (65). Study Rationale and Design Engineering Gram-positive bacteria for ethanol production has been difficult due to the absence of suitably expressed pdc genes. A PDC was previously purified and characterized from the Gram-positive bacterium S. ventriculi; however the gene was not cloned (132). It was expected that S. ventriculi PDC will be expressed at high levels in Gram-positive hosts due to its origination from a Gram-positive bacterium. To test this possibility the pdc gene from S. ventriculi was cloned, sequenced, and characterized. SvPDC was expressed in recombinant E. coli and the protein was biochemically characterized. SvPDC was expressed in a Gram-positive host, B. megaterium. SvPDC production in B. megaterium was analyzed and optimal conditions for SvPDC activity in B. megaterium were determined. Expression analysis and optimization of a variety of PDCs (i.e. Z. mobilis, A. pasteurianus, S. cerevisiae, and S. ventriculi) in B. megaterium were performed to determine the optimal PDC for ethanol production in Gram-positive bacterial hosts.

PAGE 36

23 CHAPTER 2 CLONING AND EXPRESSION OF pdc, AND CHARACTERIZATION OF PYRUVATE DECARBOXYLASE FROM Sarcina ventriculi Introduction PDC (EC 4.1.1.1) serves as the key enzyme in all homo-ethanol fermentations. This enzyme catalyzes the non-oxidative decarboxylation of pyruvate to acetaldehyde and carbon dioxide using Mg2+ and thiamine pyrophosphate (TPP) as cofactors. Acetaldehyde is subsequently reduced to ethanol by alcohol dehydrogenase (ADH, EC1.1.1.1) during the regeneration of NAD+. PDC is widespread among plants, absent in animals, and rare in prokaryotes. Prior to this study, the only bacterial pdc gene described was from the Gram-negative -proteobacterium Zymomonas mobilis (114-116, 203). Z. mobilis PDC was purified to homogeneity, crystallized, and extensively characterized (121). This enzyme has also been purified from an unusual Gram-positive organism, Sarcina ventriculi (132). S. ventriculi is an obligate anaerobe that grows from pH 2 to pH 10, fermenting hexose and pentose sugars to produce acetate, ethanol, formate, CO2 and H2 (204, 205). In this organism, the relative production of ethanol and acetate vary with environmental pH. Under acidic conditions where acetic acid is toxic to cells, ethanol is the primary product (205). At neutral pH and above, a near equimolar mixture of ethanol and acetate are produced with low levels of formate (206). These changes in fermentation profiles 23

PAGE 37

24 have been attributed to changes in the levels of two enzymes that metabolize pyruvate, PDC and pyruvate dehydrogenase (205, 206). The properties of the S. ventriculi PDC are very different from those of the Z. mobilis enzyme. Unlike the Michaelis-Menten kinetics of Z. mobilis PDC (111, 116), the S. ventriculi enzyme is activated by pyruvate (132), similar to PDC enzymes from yeast and higher plants. S. ventriculi PDC was reported to have an unusually high Km for pyruvate (13 mM) compared to Km values of 0.3 mM to 4.4 mM for other PDC enzymes (111, 116, 207). The phenylalanine content of purified S. ventriculi PDC was reported to be 4-fold to 5-fold higher than that of other PDC enzymes suggesting significant differences in primary structure (132). To further examine the unusual nature of the S. ventriculi PDC, this gene was cloned, sequenced, and expressed in recombinant E. coli. This approach provided the primary amino acid sequence and facilitated PDC purification for further kinetic and biophysical characterization. Materials and Methods Materials Biochemicals were purchased from Sigma Chemical Co. (St. Louis, Mo.). Other organic and inorganic analytical grade chemicals were from Fisher Scientific (Atlanta, Ga.). Restriction endonucleases and DNA-modifying enzymes were from New England BioLabs (Beverly, Mass.). Oligonucleotides were from Sigma-Genosys (The Woodlands, Tex.). Digoxigenin-11-dUTP (2-deoxyuridine-5-triphosphate coupled by an 11-atom spacer to digoxigenin), alkaline phosphatase conjugated antibody raised against digoxigenin, and nylon membranes for colony and plaque hybridizations were

PAGE 38

25 from Roche Molecular Biochemicals (Indianapolis, Ind.). Positively charged membranes for Southern hybridization were from Ambion (Austin, Tex.). Bacterial Strains and Media Table 2-1 lists the E. coli strains used in this study including strains TB-1 and DH5 that were used for routine recombinant DNA experiments. E. coli strain SE2309 was used to create a genomic DNA library in plasmid pBR322. E. coli strains ER1647, LE392, and BM25.8 were used in conjunction with BlueSTAR for a genomic DNA library. E. coli strains BL21(DE3), BL21-CodonPlus-RIL, and BL21-CodonPlus-RIL/pSJS1240 were used to examine the expression of the S. ventriculi pdc gene from plasmid pJAM419. E. coli strains were grown in Luria-Bertani (LB) medium and supplemented with antibiotics as appropriate (30 mg of chloramphenicol per liter, 100 mg of carbenicillin per liter, 100 mg of ampicillin per liter, and/or 50 mg of spectinomycin per liter). S. ventriculi strain Goodsir was cultivated as described previously (205). DNA Isolation Plasmid DNA was isolated and purified using a Quantum Prep Plasmid Miniprep Kit from BioRad (Hercules, Ca.). DNA fragments were eluted from 0.8% SeaKem GTG agarose (FMC Bioproducts, Rockland, Me.) using either Ultrafree-DA filters from Millipore (Bedford, Md.) or the QIAquick gel extraction kit from Qiagen (Valencia, Ca.). S. ventriculi genomic DNA was isolated and purified as described previously (208). Cloning of the S. ventriculi pdc Gene A degenerate oligonucleotide (5-AARGARGTNAAYGTNGARCAYATGTTYGGNGT-3) was synthesized based on the N-terminal amino acid sequence of PDC purified from S. ventriculi (132)(where, R is A or G; N is A, C, G, or T; Y is C or T). This oligonucleotide was labeled at the 3-end using terminal transferase with

PAGE 39

26 digoxigenin-11-dUTP and dATP as recommended by the supplier (Roche Molecular Biochemicals) and was used to screen genomic DNA from S. ventriculi. For Southern analysis, genomic DNA was digested with BglI, EcoRI, or HincII, separated by 0.8% agarose electrophoresis, and transferred to positively charged nylon membranes (209). Membranes were equilibrated at 58C for 2 h in 5SSC (1SSC is 0.15 M NaCl plus 0.015 M sodium citrate) containing 1% blocking reagent (Roche Molecular Biochemicals), 0.1% N-lauroylsarcosine, and 0.02% SDS. After the probe (0.2 pmol per ml) and Poly(A) (0.01mg per ml) were added, membranes were incubated at 58C for 18.5 h. Membranes were washed twice with 2 X SSC containing 0.1% SDS (5 min per wash) at 25C and twice with 0.5 X SSC containing 0.1% SDS (15 min per wash) at 58C. Signals were visualized using colorimetric detection according to supplier (Roche Molecular Biochemicals). For generation of a genomic library in plasmid pBR322, S. ventriculi chromosomal DNA was digested with HincII and fractionated by electrophoresis. The 2.5to 3.5-kb HincII DNA fragments were ligated into the EcoRV site of pBR322 and transformed into E. coli SE2309. Colonies were screened with the degenerate oligonucleotide by colorimetric detection. By this method, plasmid pJAM400 that carries a HincII fragment containing 1,350 bp of the pdc gene was isolated. The BlueSTAR Vector System (Novagen) was used to create an additional genomic library to facilitate isolation of the full-length pdc gene from S. ventriculi. Genomic DNA was digested with BclI, separated by electrophoresis in 0.8% agarose, and the 6.5to 8.5-kb fragments were ligated with the BlueSTAR BamHI arms. In vitro packaging and plating of phage was performed according to the supplier (Novagen). A

PAGE 40

27 DNA probe was generated using an 800-bp EcoRI fragment of the pdc gene from pJAM400 that was labeled with digoxigenin-11-dUTP using the random primed method as recommended by the supplier (Roche Molecular Biochemicals). Plaques were screened using colorimetric detection. Cre-loxP-mediated subcloning was used to circularize the DNA of the positive plaques by plating BlueSTAR phage with E. coli BM25.8 that expresses Cre recombinase (Novagen). The circularized plasmid pJAM410 was then purified and electroporated into E. coli DH5. For generation of a pdc expression vector, the promoterless pdc gene was subcloned into pET21d after amplification from pJAM413 (Table 2-1) by the polymerase chain reaction (PCR). Primers were designed for directional insertion using BspHI (oligo 1) and XhoI (oligo 2) restriction sites. The resulting fragment was ligated into compatible NcoI and XhoI sites of pET21d (Novagen) to produce pJAM419 (Figure 2-1). The fidelity of the pdc gene was confirmed by DNA sequencing. Nucleotide and Protein Sequence Analyses DNA fragments of plasmids pJAM400 and pJAM410 (Figure 2-1) were subcloned into plasmid vector pUC19 for determining the pdc sequence using the dideoxy termination method (210) and a LI-COR (Lincoln, Neb.) automated DNA sequencer (DNA Sequencing Facility, Department of Microbiology and Cell Science, University of Florida). The nucleotide sequence of the S. ventriculi pdc gene and surrounding DNA was deposited in the GenBank database (accession number AF354297). Genepro 5.0 (Riverside Scientific, Seattle, WA), ClustalW version 1.81 (211), Treeview version 1.5 (212), and MultiAln (213) were used for DNA and/or protein

PAGE 41

28 sequence alignments and comparisons. Deduced amino acid sequences were compared to protein sequences available in the GenBank, EMBL, and SwissProt databases at the National Center for Biotechnology Information (Bethesda, Md.) using the BLAST network server (214). The Dense Alignment Surface (DAS) method was used for the prediction of transmembrane -helices (215). Production of S. ventriculi PDC in Recombinant E. coli Plasmid pJAM419 was transformed into E. coli BL21-CodonPlus-RIL containing plasmid pSJS1240 (Table 2-1). Expression of the pdc gene in this plasmid is regulated by the bacteriophage T7 RNA polymerase-promoter system (Novagen). Freshly transformed cells were inoculated into LB medium containing ampicillin, spectinomycin, and chloramphenicol and grown at 37C (200 rpm) until cells reached an O.D.600nm of 0.6 to 0.8 (mid-log phase). Transcription/translation of pdc was initiated by the addition of 1 mM isopropyl--D-thiogalactopyranoside (IPTG). Cells were harvested after 2-3 h by centrifugation at 5000 g (10 min, 4C) and stored at C or in liquid nitrogen. Purification of the S. ventriculi PDC Protein All purification buffers contained 1 mM TPP and 1mM MgSO4 unless indicated otherwise. Recombinant E. coli cells (14.8 g wet wt) were thawed in 6 volumes (wt/vol) of 50 mM Na-PO4 buffer at pH 6.5 (Buffer A) and passed through a French pressure cell at 20,000 lb per in2. Cell debris was removed by centrifugation at 16,000 g (20 min, 4C). Supernatant was removed and filtered through a 45 m filter membrane. Filtrate (692 mg protein) was applied to a Q Sepharose Fast Flow 26/10 column (Pharmacia) that was equilibrated with Buffer A containing 300 mM NaCl. The SvPDC did not bind and eluted in the wash. The wash fractions containing PDC activity (326 mg protein) were

PAGE 42

29 precipitated with 80% (NH4)2SO4. Protein was dissolved in Buffer A, dialyzed against buffer A (4C, 16 h), and filtered (.45 m membrane). The filtrate (287 mg) was applied to a Q Sepharose column equilibrated with Buffer A and developed with a linear NaCl gradient (0 to 400 mM NaCl in 220 ml of Buffer A). PDC active fractions eluted at 230 to 300 mM NaCl and were pooled. The pooled sample (23 mg) was applied to a 5 ml Bio-scale hydroxyapatite type I column (BioRad) that was equilibrated with 5 mM Na-PO4 buffer at pH 6.5 (Buffer B). The column was washed with 15 ml Buffer B and developed with a linear Na-PO4 gradient (5 to 500 mM Na-PO4 at pH 6.5 in 75 ml). Protein fractions (11.4 mg) with PDC activity eluted at 200 to 300 mM Na-PO4 and were pooled. For further purification, portions of this material (0.25 to 0.5 mg protein per 0.25 to 0.5 ml) were applied to a Superdex 200 HR 10/30 column (Pharmacia) equilibrated in 50 mM Na-PO4 at pH 6.5 with 150 mM NaCl and 10% glycerol in the presence or absence of 1 mM MgSO4 and 1 mM TPP. Activity Assays PDC activity was assayed by monitoring the pyruvate-dependent reduction of NAD+ with bakers yeast alcohol dehydrogenase (ADH) (Sigma) as a coupling enzyme at pH 6.5 as previously described (115), with the following modifications. Buffered enzyme (100 l) was added to a final volume of 1 ml containing 0.15 mM NADH, 0.1 mM TPP, 0 to 25 mM pyruvate, and 10 U ADH in 50 mM potassium-MES (2-[N-morpholino]ethanesulfonic acid) buffer with 5 mM MgCl2 at pH 6.5. Since this assay does not distinguish PDC from NADH oxidizing enzymes such as lactate dehydrogenase, activity of cell lysate was estimated by correcting for control reactions performed in the absence of added ADH. One unit of enzyme activity is defined as amount of enzyme that

PAGE 43

30 oxidizes 1 mol of NADH per min. Thermostability was determined by incubating purified PDC in 50 mM Na-PO4 buffer at pH 6.5 with 1 mM TPP and 1 mM MgCl2 for 90 min and then assaying for activity with 10 mM pyruvate under standard conditions. Protein concentration was determined using Bradford protein reagent with bovine serum albumin as the standard (BioRad). Molecular Mass and Amino Acid Sequence Analyses Subunit molecular mass was estimated by reducing and denaturing sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) using 12% polyacrylamide gels which were stained with Coomassie blue R-250. The molecular weight standards for SDS-PAGE were: phosphorylase b (97.4 kDa), bovine serum albumin (66.2 kDa), ovalbumin (45 kDa), carbonic anhydrase (31 kDa), trypsin inhibitor (21.5 kDa), and lysozyme (14.4 kDa). For determination of native molecular mass, samples were applied to a Superdex 200 HR 10/30 column equilibrated with 50 mM Na-PO4 buffer at pH 6.5 with 150 mM NaCl, 10% glycerol, and no added cofactors. Molecular mass standards included: serum albumin (66-kDa), alcohol dehydrogenase (150 kDa), -amylase (200 kDa), apoferritin (443 kDa), and thyroglobulin (669 kDa). The N-terminal sequence was determined for PDC protein purified from recombinant E. coli. The protein was separated by SDS-PAGE and electroblotted onto a polyvinylidene difluoride (PVDF) membrane (Immobilon-P). The sequence was determined by automated Edman degradation at the protein chemistry core facility of the University of Florida Interdisciplinary Center for Biotechnology Research.

PAGE 44

31 Results and Discussion PDC Operon in S. ventriculi The N-terminal amino acid sequence of the PDC protein purified from S. ventriculi (132) was used to generate a degenerate oligonucleotide for hybridization to genomic DNA. This approach facilitated the isolation of a 7.0-kb BclI genomic DNA fragment from S. ventriculi. The fragment was further subcloned in order to sequence both strands of a 3,886 bp HincII-to-HincII region that hybridized to the oligonucleotide probe (Figure 2-1). Analysis of the DNA sequence revealed an open reading frame (ORF) of 1,656 bp encoding a protein with an N-terminus identical to that of the previously purified S. ventriculi PDC (Figure 2-2). The ORF is therefore designated pdc. A canonical Shine-Dalgrano sequence is present 7 bp upstream of the pdc translation start codon. In addition, a region 82 to 110 bp upstream of pdc has limited identity to the eubacterial and promoter consensus sequence. Downstream (43 bp) of the pdc translation stop codon is a region predicted to form a stem-loop structure followed by an AT-rich region, consistent with a -independent transcription terminator. Thus, the S. ventriculi pdc appears to be transcribed as a monocistronic operon like the Z. mobilis pdc gene (115). A partial ORF was identified 722 bp upstream of pdc which encodes a 177 amino acid protein fragment (ORF1*) (Figure 2-1). ORF1* has identity (28-29 %) to several hypothetical membrane proteins (GenBank accession numbers CAC11620, CAC24018, CAA22902) and is predicted to form several transmembrane spanning domains (data not shown).

PAGE 45

32 PDC Protein Sequence in S. ventriculi The S. ventriculi pdc gene apparently encodes a protein of 552 amino acids (including the N-terminal methionine) with a calculated pI of 5.16 and anhydrous molecular mass of 61,737 Da. Consistent with other Z. mobilis and fungal PDC proteins, the N-terminal extension of up to 47 amino acids that is common to plant PDC proteins is not conserved in the S. ventriculi PDC protein. Although the pI of the purified S. ventriculi PDC protein has not been experimentally determined, the calculated pI is consistent with the acidic pH optimum of 6.3 to 6.7 for stability and activity of this enzyme (132). The amino acid composition of the protein deduced from the S. ventriculi pdc gene is similar to that determined for the S. cerevisiae PDC1 and Z. mobilis pdc genes (Table 2-2). A notable exception is the alanine composition of Z. mobilis PDC, which is 1.8to 2.2-fold higher than the composition of S. cerevisiae PDC1 and S. ventriculi PDC. Although the phenylalanine composition of the deduced S. ventriculi PDC protein is consistent with the other PDC proteins, it is almost 3.6-fold less than the composition previously reported for the purified S. ventriculi enzyme (132). The reason for this discrepancy remains to be determined. The amino acid sequence of S. ventriculi PDC was aligned with the sequences of the yeast (Sc) PDC1 and Z. mobilis (Zm) PDC proteins, both of which have been analyzed by X-ray crystallography (76, 84, 103, 117) (Figure 2-3). The conserved motif of TPP-dependent enzymes identified by Hawkins et al. (216) and known to be involved in Mg2+-TPP cofactor binding is highly conserved in all three PDC proteins. Other amino acid residues located within a 0.4 nm distance of the Mg2+ and TPP binding site of the two crystallized PDC proteins are also conserved in the S. ventriculi PDC protein.

PAGE 46

33 These include residues with similarity to the aspartate (SceD444, ZmoD440) and asparagine residues (SceN471, ZmoN467) that are involved in binding Mg2+. The S. ventriculi PDC appears to be more similar to the yeast PDC than to that of Z. mobilis in binding the diphosphates of TPP where serine and threonine side chains (SceS446 and T390) as well as the main chain nitrogen of isoleucine (SceI476) are conserved. This contrasts with the Z. mobilis enzyme, which utilizes a main chain nitrogen of aspartate (ZmoD390) instead of the threonine hydroxyl group (SceT390) for binding the -phosphate. S. ventriculi PDC residues are also similar to the aspartate, glutamate, threonine, and histidine residues (SceD28, E477, T388, H114 and H115; ZmoD27, E473, T388, H113, and H114) which may potentially interact with intermediates during the decarboxylation reaction mediated by Z. mobilis and yeast PDCs. Furthermore, the isoleucine (Sc and Zm I415) side chain which appears to stabilize the V conformation of TPP through Van der Waals interactions as well as the glutamate (SceE51, ZmoE50) which may donate a proton to the N1 atom of TPP are conserved in the S. ventriculi PDC protein sequence. A notable exception in conservation is the yeast C221 residue (Figure 2-3), which is highly conserved among the majority of fungal PDC enzymes but is not conserved in either bacterial or plant PDC proteins. Based on site directed mutagenesis, chemical modification, and kinetic studies, this C221 residue has been proposed to be a primary binding site of the regulatory substrate molecule and the starting point of a signal transfer pathway to the active site TPP in the yeast enzyme (87, 89, 193). Consistent with these previous results the yeast C221 is positioned in a large cavity formed at the interface among all three PDC domains including the or PYR (residues 1 to 189), or R

PAGE 47

34 (residues 190 to 356), and or PP (residues 357 to 563) domains (84). However, recent high-resolution structural analysis of the brewers yeast PDC crystallized in the presence of pyruvamide, a pyruvate analogue, enabled localization of the activator binding site and revealed that cysteine does not play a direct role in this binding (91). Additionally, kinetic studies using stopped-flow techniques revealed that the C221A variant of yeast PDC was still substrate activated, and the lag phase of product formation did not disappear with progressive thiol oxidation (91). Instead, tyrosine (Y157) and arginine (R224) residues form hydrogen bonds with the amide group of pyruvamide. Both of these residues are conserved in the S. ventriculi PDC and not found in the Z. mobilis enzyme which displays Michaelis-Menten kinetics. These results suggest that residues of the S. ventriculi PDC protein may allosterically bind the substrate activator with a mechanism common to the majority of fungal PDC proteins. Interestingly, these two residues that bind pyruvamide in the yeast enzyme are not universally distributed among the substrate activated PDC enzymes, most notably the plant PDCs. Phylogenetic analysis was performed to compare the PDC proteins and other TPP-dependent enzymes including indole-3-pyruvate decarboxylase (IPD), the E1 component of pyruvate dehydrogenase (E1), acetolactate synthase (ALS), and transketolase (TK) (Figure 2-4). The comparison reveals that all of these proteins are related in primary sequence and that there is a significant clustering of the sequences into families based on specific enzyme function. Of these, the S. ventriculi PDC appears most closely related to eubacterial IPD proteins as well as the majority of fungal PDC proteins. In contrast, the Z. mobilis PDC protein is most closely related to plant PDCs in addition to a couple of out-grouping fungal PDCs. Thus, it appears that the IPD protein family

PAGE 48

35 has close evolutionary roots with the PDC family and specifically the S. ventriculi PDC protein. In addition, the distant relationship of the S. ventriculi and Z. mobilis PDC proteins is consistent with the biochemical differences between these two enzymes (111, 116, 132, 207). In contrast to Z. mobilis PDC which may have originated by the horizontal transfer of a plant pdc gene, S. ventriculi PDC appears to have diverged early during evolution and last shared a common ancestor with most eubacterial IPD and fungal PDC enzymes. The unique nature of the S. ventriculi PDC enabled us to search for previously unknown PDC-like proteins (Figure 2-5). A new subfamily of hypothetical PDC proteins from Gram-positive bacteria has now been identified for further study due to their similarity to the newly identified S. ventriculi PDC. This subfamily includes PDC proteins from Gram-positive organisms including two bacilli, Bacillus anthracis and Bacillus cereus. Production of S. ventriculi PDC Protein Unlike Z. mobilis pdc, the codon usage of the pdc of S. ventriculi dramatically differs from that of E. coli (Table 2-3). In particular, the pdc gene of S. ventriculi requires elevated use of tRNAAUA and tRNAAGA both of which are relatively rare in E. coli. This is in contrast to the Z. mobilis pdc gene, which does not use the AUA codon and has only minimal use of the AGA codon. This suggests that production of the S. ventriculi PDC protein in recombinant E. coli may be limited by mRNA translation. To further investigate this, the levels of the tRNA genes that are rare in E. coli were modified during pdc expression by including multiple copies of these genes on the

PAGE 49

36 chromosome (E. coli strain BL21-CodonPlus-RIL) and/or on a complementary plasmid (pSJS1240) (Table 2-1). These modified E. coli strains were transformed with plasmid pJAM419 which carries the S. ventriculi pdc gene positioned 8 bp downstream of an optimized Shine-Dalgrano consensus sequence and controlled at the transcriptional-level by T7 RNA polymerase promoter and terminator sequences from plasmid vector pET21d. Detectable levels of PDC activity (0.16 U per mg protein at 5 mM pyruvate) were observed after induction of pdc transcription in E. coli host strains with additional chromosomal and/or plasmid copies of the ileU/ileX, argU and leuW genes encoding the rare tRNAAUA, tRNAAGG/AGA, and tRNACUA. A 5to 10-fold increase in the level of a 58-kDa protein with a molecular mass comparable to the S. ventriculi PDC (Figure 2-6) was produced in these strains compared to a similar E. coli strain without added tRNA genes [BL21(DE3)] (data not shown). These results suggest that the S. ventriculi PDC protein is synthesized in recombinant E. coli and that the high percentage of AUA and AGA codons of the pdc gene probably limits translation. Interestingly, additional proteins of 43 and 27 kDa were also observed when the PDC protein was synthesized in E. coli compared to control strains (Figure 2-6). The origin of these proteins remains to be determined. They may be fragments of PDC generated by proteolysis or truncated PDC produced from errors in translation/transcription. Alternatively, increased production of PDC may increase the levels of acetaldehyde, which can be toxic to the cell, and may subsequently induce the levels of proteins in response to this stress. Properties of the S. ventriculi PDC Protein from Recombinant E. coli The S. ventriculi PDC protein was purified over 136-fold from a recombinant E. coli. The N-terminal amino acid sequence of this protein (MKITIAEYLLXR, where X is

PAGE 50

37 an unidentified amino acid) was identical to the sequence of PDC purified from S. ventriculi (132). Both PDC proteins have an N-terminal methionine residue, which suggests that this residue is not accessible for cleavage by either the S. ventriculi or E. coli aminopeptidases. The thermostability of the purified S. ventriculi PDC was examined in the presence of 1 mM cofactors TPP and Mg2+ at pH 6.5. Enzyme activity was stable up to 42C but was abolished after incubation for 60 to 90 min at temperatures of 50C and above. This is consistent with the significant loss of PDC activity observed when a thermal treatment step (60 C for 30 min) was included in the purification (data not shown). In contrast, methods used to purify Z. mobilis and other PDC proteins (76) typically incorporate thermal treatment to remove unwanted proteins. These results suggest that the recombinant S. ventriculi PDC protein is not as thermostable as other PDC proteins including that of Z. mobilis. PDC proteins have been shown to bind TPP and Mg2+ cofactors with high affinity at slightly acidic pH (76). Consistent with this, the recombinant S. ventriculi PDC retains full activity after incubation at 37C for 90 min in the presence of 25 mM EGTA or EDTA in pH 6.5 buffer without cofactors. This is similar to the PDC protein purified directly from S. ventriculi which is fully active after similar treatment with metal chelators. The recombinant S. ventriculi enzyme displays sigmoidal kinetics (Figure 2-7) suggesting substrate activation similar to the fungal and plant PDC proteins (76). This contrasts with the Z. mobilis PDC which is the only PDC protein known to display Michaelis-Menten kinetics. The recombinant S. ventriculi PDC has a Km of 2.8 mM for

PAGE 51

38 pyruvate and Vmax of 66 U per mg protein for acetaldehyde production (Figure 2-7). This Km value is almost 5-fold less than the Km (13 mM) observed for the PDC purified from S. ventriculi (132); however, it is within the range of Km values determined for many of the fungal and plant PDCs including those purified from S. cerevisiae (1 to 3 mM)(184, 217), Zygosaccharomyces bisporus (1.73 mM) (107), orange (0.8 to 3.2 mM) (147), and wheat germ (3 mM) (81). The Km value for the recombinant PDC protein is several-fold higher than those values reported for the PDCs of Z. mobilis (0.3 to 0.4 mM) (112, 113) and rice (0.25 mM)(155). The reason for the apparent discrepancy in affinity for pyruvate between the PDC purified from S. ventriculi and that from recombinant E. coli may in part be due to the type of buffer used in the enzyme assay (sodium hydrogen maleate vs. potassium-MES buffer pH 6.5, respectively). The Z. mobilis PDC, which was reported to have a Km of 4.4 mM for pyruvate was determined in Tris-maleate buffer at pH 6 (111) while the Km values of 0.3 to 0.4 mM were from assays using potassium-MES buffer at pH 6 (112) and sodium citrate buffer at pH 6.5, respectively (113). It is also possible that the different methods used for purification of the S. ventriculi PDC protein may have influenced its affinity. In our study, the cofactors TPP and Mg2+ were included in the buffers for all purification steps. This differs from the initial steps used for purification of PDC from S. ventriculi (132) which may have resulted in partial loss of cofactors and decreased affinity of the enzyme for its substrate, pyruvate. If so, it is more likely TPP than Mg2+ since metal chelators do not influence the activity of either the PDC purified from recombinant E. coli (described above) or the enzyme purified from S. ventriculi at pH 6.5 (132). An additional possibility is that synthesis of PDC in E. coli may have modified the

PAGE 52

39 affinity of the enzyme through misincorporation of amino acids due to a high percentage of rare codons in the gene. At pH 6.5, the recombinant PDC forms a 235-kDa homotetramer consisting of a 58-kDa protein, as determined by Superdex 200 gel filtration chromatography and SDS-12% PAGE electrophoresis (see methods). Exclusion of the cofactors from the buffer during gel filtration chromatography at pH 6.5 did not alter the tetramer configuration or enzyme activity, suggesting that the cofactors are tightly bound. The configuration of the PDC complex is consistent with that purified from S. ventriculi as well as the majority of those isolated from fungi, plants, and Z. mobilis. There are however, plant PDCs which have been reported to form larger complexes including the PDC from Neurospora crassa which forms aggregated filaments of 8-10 nm (73) as well as the PDC from Pisum sativum which forms up to 960 kDa complexes (142). Conclusion Based on this study, the S. ventriculi PDC protein appears to share similar primary sequence structure to TPP-dependent enzymes and is highly related to the fungal PDC and eubacterial IPD enzymes. The close relationship of the S. ventriculi and fungal PDC structures is consistent with the similar biochemical properties of these enzymes. Both types of enzymes display substrate cooperativity with similar affinities for pyruvate. The structure and biochemistry of the S. ventriculi PDC, however, dramatically contrast with the only other bacterial PDC (Z. mobilis) that has been characterized. The Z. mobilis PDC is closely related to plants in primary structure; however, it is the only PDC enzyme known to display Michaelis-Menten kinetics.

PAGE 53

40 This study also demonstrates the synthesis of active, soluble S. ventriculi PDC protein in recombinant E. coli. Only two other genes, the Z. mobilis pdc and S. cerevisiae PDC1 genes, have been reported to synthesize PDC protein in recombinant bacteria (114, 115, 218). Of these, at least 50% of the S. cerevisiae PDC1 forms insoluble inclusions in E. coli and thus has not been useful in engineering bacteria for high-level ethanol production (218). Due to codon bias, accessory tRNA is essential for efficient production of S. ventriculi PDC in recombinant E. coli. However, the low G+C codon usage of the S. ventriculi pdc gene should broaden the spectrum of bacteria that can be engineered as hosts for high-level production of PDC protein and the engineering of homo-ethanol pathways (4). The S. ventriculi PDC is unique among previously characterized bacterial PDCs. This has enabled the identification of a new subfamily of PDC-like proteins from Gram-positive bacteria that will broaden the host range of future endeavors utilizing Gram-positive bacterial hosts.

PAGE 54

41 Table 2-1. Strains and plasmids used for production of PDC from S. ventriculi in E. coli. Strain or plasmid Phenotype, genotype, description, PCR primers Source S. ventriculi Goodsir American Type Culture Collection 55887 American Type Culture Collection (Manassas, Va.) E. coli TB-1 Fara (lac-proAB) rpsL (Strr) [80laclacZ)M15] thi hsdR(rkmk+) New England BioLabs (Beverly, Mass.) E. coli DH5 FrecA1 endA1 hsdR17(rkmk+) supE44 thi-1 gyrA relA1 Life Technologies (Rockville, Md.) E. coli SE2309 Fe14-(McrA-) endA1 supE44 thi-1 relA1? rfbD1? spoT1?mcrC-mrr)114::IS10 pcnB80 zad2084::Tn10 provided by K. T. Shanmugam (Univ. of Fl.) E. coli ER1647 FfhuA2lacZ) r1 supE44 trp31 mcrA1272::Tn10(Tetr) his-1 rpsL104 (Strr)xyl-7 mtl-2 metB1 mcrC-mrr)102::Tn10(Tetr) recD1040 Novagen (Madison, Wi.) E. coli LE392 Fe14-(McrA-) hsdR514(rkmk+) supE44 supF58 lacY1 or (lacIZY)6 galK2 galT22 metB1 trpR55 Novagen BM25.8 supE thiD(lac-proAB) [F traD36 proA+B+ lacIqZM15] imm434(kanR) P1 (CmR) hsdR (rK12-mK12+) Novagen E. coli BL21-CodonPlus-RIL F ompT hsdS(rB mB) dcm+ Tetr gal (DE3) endA Hte [argU ileY leuW Camr] (an E.coli B strain) Stratagene (La Jolla, Ca.) E. coli BL21(DE3) FompT gal[dcm] [lon] hsdSB (rB-mB-; an E. coli B strain) with DE3, a prophage carrying the T7 RNA polymerase gene Novagen pBR322 Apr, Tcr; cloning vector New England Biolabs pUC19 Apr; cloning vector New England Biolabs pBlueSTAR-1 Apr; plasmid derived from BlueSTAR-1 Novagen pET21d Apr; expression vector Novagen pSJS1240 Spr; derivative of pACYC184 with E. coli ileX and argU (219) pJAM400 Apr; two 3-kb HincII fragments of S. ventriculi genomic DNA ligated into the EcoRV site of pBR322; carries only 1350 bp of pdc This study pJAM410 Apr; 7-kb fragment of S. ventriculi genomic DNA with the complete pdc gene in pBlueSTAR-1 This study

PAGE 55

42 Table 2-1. Continued. Strain or plasmid Phenotype, genotype, description, PCR primers Source pJAM411 Apr; 6-kb SwaI fragment from pJAM410 ligated into the HincII site of pUC19; carries 2103 bp of pBlueSTAR-1 vector and 4 kb of S. ventriculi genomic DNA with the complete pdc This study pJAM413 Apr; 3-kb SacII fragment of pJAM411 with the complete pdc gene in the HincII site of pUC19 This study pJAM419 Apr; 1.7-kb BspHI-to-XhoI fragment generated by PCR amplification using pJAM410 as a template, oligo1, 5-ggcctcatgaaaataacaattgcag-3, and oligo2, 5-gcgggctcgagattagtagttattttg-3(BspHI and XhoI sites indicated in bold); ligated with NcoI-to-XhoI fragment of pET21d; carries complete pdc with its start codon positioned 8 bp downstream the Shine-Dalgrano sequence of pET21d This study

PAGE 56

43 Table 2-2. Amino acid composition of PDC proteins. Composition expressed as % residues per mol enzyme predicted from the gene sequence (g) or chemically determined from the purified enzyme (e). Abbreviations: Sv, Sarcina ventriculi PDC; Sc, Saccharomyces cerevisiae PDC1; Zm, Zymomonas mobilis PDC; ND, not determined. References: Sv(e) (132), Sv(g) (this study), Sc(g) (99), Zm (g) (113). Amino Acid Composition (mol%) Sv(e) Sv(g) Sc(g) Zm(g) Asx 8.7 9.8 10.2 10.2 Glx 10.7 12.0 8.9 8.6 Ser 5.5 6.5 6.0 4.2 Gly 7.3 7.1 7.8 8.1 His 1.1 1.6 2.0 2.1 Arg 4.1 4.0 2.7 3.0 Thr 6.1 6.5 7.7 4.6 Ala 7.2 6.9 8.2 15.0 Pro 2.7 2.7 4.6 4.8 Tyr 3.2 4.0 3.1 3.9 Val 6.8 8.0 7.5 7.8 Met 2.1 2.7 2.4 1.9 Ile 6.1 7.1 6.6 4.9 Leu 7.8 8.2 9.7 8.8 Phe 16.2 4.7 4.2 3.2 Lys 4.4 6.9 6.2 6.3 Cys ND 0.9 1.1 1.2 Trp ND 0.5 1.3 1.2

PAGE 57

44 Table 2-3. Codon usage of S. ventriculi (Sv) and Z. mobilis (Zm) pdc genes. Amino Acid Codon Zm* Sv E. coli Ala GCA 28.1 32.5 20.1 GCC 35.1 0 25.5 GCG 12.3 1.8 33.6 GCU 73.8 34.4 15.3 Arg AGA 1.8 39.8 2.1 CGC 15.8 0 22.0 CGG 1.8 0 5.4 CGU 12.3 0 20.9 Asn AAC 47.5 19.9 21.7 AAU 10.5 27.1 17.7 Asp GAC 28.1 3.6 19.1 GAU 10.5 47.0 32.1 Cys UGC 28.1 1.8 6.5 UGU 10.5 7.2 5.2 Gln CAA 0 28.9 15.3 CAG 17.6 0 28.8 Glu GAA 61.5 85.0 39.4 GAG 3.5 5.4 17.8 Gly GGA 1.8 50.6 8.0 GGC 19.3 0 29.6 GGG 0 0 11.1 GGU 56.2 19.9 24.7 His CAC 8.8 3.6 9.7 CAU 14.1 12.7 12.9 Ile AUA 0 39.8 4.4 AUC 35.1 9.0 25.1 AUU 14.1 21.7 30.3 Leu CUA 0 7.2 3.9 CUC 19.3 0 11.1 CUG 33.4 0 52.6 CUU 12.3 14.5 11.0 UUA 1.8 59.7 13.9 UUG 5.4 0 13.7 Lys AAA 33.4 63.3 33.6 AAG 31.6 5.4 10.3 Met AUG 21.1 27.1 27.9 Phe UUC 31.6 18.1 16.6 UUU 0 28.9 22.3 Pro CCA 3.5 18.1 8.4 CCC 3.5 0 5.5 CCG 29.9 1.8 23.2 CCU 10.5 7.2 7.0

PAGE 58

45 Amino Acid Codon Zm* Sv E. coli Ser AGC 14.1 12.7 16.1 AGU 7.0 12.7 8.8 UCA 1.8 32.5 7.2 UCC 15.8 0 8.6 UCU 5.3 7.2 8.5 Thr ACA 0 34.4 7.1 ACC 28.1 0 23.4 ACG 10.5 0 14.4 ACU 8.8 30.7 9.0 Trp UGG 12.3 5.4 15.2 Tyr UAC 12.3 7.2 12.2 UAU 26.4 32.5 16.2 Val GUA 0 36.2 10.9 GUC 26.4 0 15.3 GUG 7.0 0 26.4 GUU 43.9 43.4 18.3 Table 2 3. Continued *Codon usage for amino acids represented as frequency per thousand bases. Stop codons are not indicated. CGA and AGG codons for Arg, UCG for Ser, and GGG for Gly were not used for either of the pdc genes. Abbreviations: Zm, Zymomonas mobilis; Sv, Sarcina ventriculi. Average usage in frequency per thousand bases for genes in E. coli K-12. Highlighted are codons for accessory tRNAs essential for high-level synthesis of S. ventriculi PDC in recombinant E. coli.

PAGE 59

46 Figure 2-1. A partial map of restriction endonuclease sites for a 7-kb BclI genomic DNA fragment from S. ventriculi. Plasmids used in this study include pJAM410 which carries the complete 7-kb BclI fragment as well as pJAM400, pJAM411, and pJAM413 which were used for DNA sequence analysis. Plasmid pJAM419 was used for expression of the S. ventriculi pdc gene in recombinant E. coli. The location of the pdc gene and ORF1* are shown directly below the physical map with large arrows indicating the direction of transcription. The dashed line below the physical map indicates the 3,886 bp HincII-to-HincII region sequenced. Abbreviations: pdc, pyruvate decarboxylase gene; ORF1*, partial open reading frame of 177 amino acids with no apparent start codon.

PAGE 60

47 -35 -10 AAATTTAAAAATAACA TCAGATAAATCGTTTATATTAAT TTTTACTAAAAGCTATTTAAA 60 ttgaca-------N17-------tataat SD GGTGTATTATATATACATAGTTTATCTTATAAATAAAAAATGAATTGGAGGAA ATACATA 120 ATGAAAATAACAATTGCAGAATACTTATTAAAAAGATTAAAAGAAGTAAATGTAGAGCAT 180 M K I T I A E Y L L K R L K E V N V E H 20 M K I I I A E Y L L K R L K E V N V E H ATGTTTGGAGTTCCTGGAGATTATAACTTAGGATTTTTAGATTATGTTGAAGATTCTAAA 240 M F G V P G D Y N L G F L D Y V E D S K 40 M F G V P G D Y N L G F L D Y V GATATTGAATGGGTTGGAAGCTGTAATGAACTTAATGCAGAATATGCAGCAGATGGATAT 300 D I E W V G S C N E L N A E Y A A D G Y 60 GCAAGACTTAGAGGATTTGGTGTAATACTTACAACTTATGGAGTTGGTTCACTTAGTGCA 360 A R L R G F G V I L T T Y G V G S L S A 80 ATAAATGCTACAACAGGTTCATTTGCAGAAAATGTTCCAGTATTACATATATCAGGTGTA 420 I N A T T G S F A E N V P V L H I S G V 100 CCATCAGCTTTAGTTCAACAAAACAGAAAGCTAGTTCACCATTCAACTGCTAGAGGAGAA 480 P S A L V Q Q N R K L V H H S T A R G E 120 TTCGACACTTTTGAAAGAATGTTTAGAGAAATAACAGAATTTCAATCAATCATAAGCGAA 540 F D T F E R M F R E I T E F Q S I I S E 140 TATAATGCAGCTGAAGAAATCGATAGAGTTATAGAATCAATATATAAATATCAATTACCA 600 Y N A A E E I D R V I E S I Y K Y Q L P 160 GGTTATATAGAATTACCAGTTGATATAGTTTCAAAAGAAATAGAAATCGACGAAATGAAA 660 G Y I E L P V D I V S K E I E I D E M K 180 CCGCTAAACTTAACTATGAGAAGCAACGAGAAAACTTTAGAGAAATTCGTAAATGATGTA 720 P L N L T M R S N E K T L E K F V N D V 200 AAAGAAATGGTTGCAAGCTCAAAAGGACAACATATTTTAGCTGATTATGAAGTATTAAGA 780 K E M V A S S K G Q H I L A D Y E V L R 220 GCTAAAGCTGAAAAAGAATTAGAAGGATTTATAAATGAAGCAAAAATCCCAGTAAACACT 840 A K A E K E L E G F I N E A K I P V N T 240 Figure 2-2. Nucleic acid and predicted amino acid sequence of the S. ventriculi pdc gene. DNA is shown in the 5to 3-direction. Predicted amino acid sequences are shown in single-letter code directly below the first base of each codon. The N-terminal sequence previously determined for the purified PDC protein is shown directly below the sequence predicted for PDC. A putative promoter is double underlined with the and eubacterial promoter consensus sequence indicated in lower-case letters below the DNA sequence. A presumed ribosome-binding site is underlined. The translation stop codon is indicated by an asterisk. A stem-loop structure which may facilitate -independent transcription termination is indicated by arrows below the DNA sequence.

PAGE 61

48 Figure 2-2. Continued. TTAAGTATAGGAAAGACAGCAGTATCAGAAAGCAATCCATACTTTGCTGGATTATTCTCA 900 L S I G K T A V S E S N P Y F A G L F S 260 GGAGAAACTAGTTCAGATTTAGTTAAAGAACTTTGCAAAGCTTCTGATATAGTTTTACTA 960 G E T S S D L V K E L C K A S D I V L L 280 TTTGGAGTTAAATTCATAGATACTACAACAGCTGGATTTAGATATATAAATAAAGATGTT 1020 F G V K F I D T T T A G F R Y I N K D V 300 AAAATGATAGAAATTGGTTTAACTGATTGTAGAATTGGAGAAACTATTTATACTGGACTT 1080 K M I E I G L T D C R I G E T I Y T G L 320 TACATTAAAGATGTTATAAAAGCTTTAACAGATGCTAAAATAAAATTCCATAACGATGTA 1140 Y I K D V I K A L T D A K I K F H N D V 340 AAAGTAGAAAGAGAAGCAGTAGAAAAATTTGTTCCAACAGATGCTAAATTAACTCAAGAT 1200 K V E R E A V E K F V P T D A K L T Q D 360 AGATATTTCAAACAAATGGAAGCGTTCTTAAAACCTAATGATGTATTAGTTGGTGAAACA 1260 R Y F K Q M E A F L K P N D V L V G E T 380 GGAACATCATATAGTGGAGCATGTAATATGAGATTCCCAGAAGGATCAAGCTTTGTAGGT 1320 G T S Y S G A C N M R F P E G S S F V G 400 CAAGGATCTTGGATGTCAATTGGATATGCTACTCCTGCAGTTTTAGGAACTCATTTAGCT 1380 Q G S W M S I G Y A T P A V L G T H L A 420 GATAAGAGCAGAAGAAACATTCTTTTAAGTGGTGATGGTTCATTCCAATTAACAGTTCAA 1440 D K S R R N I L L S G D G S F Q L T V Q 440 GAAGTTTCAACAATGATAAGACAAAAATTAAATACAGTATTATTTGTAGTTAACAATGAT 1500 E V S T M I R Q K L N T V L F V V N N D 460 GGATATACAATTGAAAGATTAATCCACGGACCTGAAAGAGAATATAACCATATTCAAATG 1560 G Y T I E R L I H G P E R E Y N H I Q M 480 TGGCAATATGCAGAACTTGTAAAAACATTAGCTACTGAAAGAGATATACAACCAACTTGT 1620 W Q Y A E L V K T L A T E R D I Q P T C 500 TTCAAAGTTACAACTGAAAAAGAATTAGCAGCTGCAATGGAAGAAATAAACAAAGGAACA 1680 F K V T T E K E L A A A M E E I N K G T 520 GAAGGTATTGCTTTTGTTGAAGTAGTAATGGATAAAATGGATGCTCCAAAATCATTAAGA 1740 E G I A F V E V V M D K M D A P K S L R 540 CAAGAAGCAAGTCTATTTAGTTCTCAAAATAACTACTAATATATATTATATATAAATAAA 1800 Q E A S L F S S Q N N Y 552 AATTAAAAAGATTGTAAATTAAATTTAAAGGTGACTTCTATTAATAGAGGTCATCTTTTT 1860 ATGCTTATAAGTTTAATTTTATAAAATACAATTAGTAATTAAACACTTTATAAGAAAAAA 1920

PAGE 62

49 Figure 2-3. Multiple amino acid sequence alignment of S. ventriculi PDC with other PDC protein sequences. Abbreviations with GenBank or SwissProt accession numbers: Sce, S. cerevisiae P06169; Sve, S. ventriculi; Zmo, Z. mobilis P06672. Identical amino acid residues are shaded in inverse print. Functionally conserved and semi-conserved amino acid residues are shaded in gray. Dashes indicate gaps introduced in protein sequence alignment. Indicated above the sequences are amino acid residues within a 0.4 nm distance of the Mg2+ and TPP binding site of yeast PDC1 (84)(), the Cys221 residue originally postulated to be required for pyruvate activation of yeast PDC1 (), and the Tyr157 and Arg224 residues which form hydrogen bonds with allosteric activators such as pyruvamide (). The underlined sequence is a conserved motif identified in TPP-dependent enzymes (216).

PAGE 63

50 Figure 2-4. Relationships between selected PDCs. The dendrogram shown above summarizes the relationships between selected PDCs and other thiamine pyrophosphate-dependent enzymes. Deduced protein sequences were aligned using ClustalX. Amino acid extensions at the Nor C-terminus as well as apparent insertion sequences were removed. Remaining regions containing approximately 520 to 540 amino acids were compared. Treeview was used to display these results as an unrooted dendrogram. Protein abbreviations: PDC, pyruvate decarboxylase; IPD, indole-3-pyruvate decarboxylase; ORF, open reading frame; ALS, acetolactate synthase; PDH E1 or E1, the E1 component of pyruvate dehydrogenase; TK, transketolase. Organism abbreviations and GenBank or SwissProt accession numbers: Abr, Azosprillum brasilense P51852, Aor, Aspergillus oryzae AAD16178; Apa, Aspergillus parasiticus P51844; Asy, Ascidia sydneiensis samea BAA74730; Ath, Arabidopsis thaliana BAB08775; Bfl, Brevibacterium flavum A56684; Bsu, Bacillus subtilis P45694; Cgl, Corynebacterium glutamicum P42463;

PAGE 64

51 Cpn, Chlamydophila pneumoniae H72020; Dra, Deinococcus radiodurans A75387 (ALS), A75541 (E1); Ecl, Enterobacter cloacae P23234; Eco, E. coli CAA24740; Ehe, Erwinia herbicola AAB06571; Eni, Aspergillus (Emericella) nidulans P87208; Fan, Fragaria x ananassa AAG13131; Ghi, Gossypium hirsutum S60056; Gth, Guillardia theta NP_050806; Huv, Hanseniaspora uvarum P34734; Kla, Kluyveromyces lactis Q12629 (PDC), Q12630 (TK); Kma, Kluyveromyces marxianus P33149; Mav, Mycobacterium avium Q59498; Mja, Methanococcus jannaschii Q57725; Mle, Mycobacterium leprae CAC31122 (ORF), 033112 (ALS), CAC30602 (E1); Mth, Methanobacterium thermoautotrophicum A69081 (ORF), C69059 (ALS); Mtu, Mycobacterium tuberculosis E70814 (IPD), 053250 (ALS); Ncr, N. crassa P33287; Nta, Nicotiana tabacum P51846 (PDC), P09342 (ALS); Osa, Oryza sativa P51847 (PDC1), P51848 (PDC2), P51849 (PDC3); Pae, Pseudomonas aeruginosa G83123; Pmu, Pasteurella multocida AAK03712; Pop, Prophyra purpurea NP_053940; Ppu, Pseudomonas putida AAG00523; Psa, P. sativum P51850; Pst, Pichia stipitis AAC03164 (PDC1), AAC03165 (PDC2); Rca, Rhodobacter capsulatus JC4637; Reu, Ralstonia eutropha Q59097; Sav, Streptomyces avermitilis AAA93098; Sce, S. cerevisiae P06169 (PDC1), P16467 (PDC5), P26263 (PDC6), Q07471 (ORF), NP_011105 (E1), NP_009780 (E1); Sco, Streptomyces coelicolor T35828; Skl, Saccharomyces kluyveri AAF78895; Spl, Spirulina platensis P27868; Spo, Schizosaccharomyces pombe Q09737 (PDC1), Q92345 (PDC2); Sve, S. ventriculi AF354297; Syn, Synechocystis sp. BAA17984; Vch, Vibrio cholerae A82375; Vvi, Vitis vinifera AAG22488; Zma, Zea mays P28516; Zbi, Zygosaccharomyces bisporus CAB65554; Zmo, Z. mobilis P06672. Scale bar represents 0.1 nucleotide substitutions per site.

PAGE 65

52 Newly discovered Gram-positive PDC-like proteins Figure 2-5. Relationships between pyruvate decarboxylase (PDC), indole pyruvate decarboxylase (IPD), -ketoisocaproate decarboxylase (KID), and homologues (ORF). Abbreviations: Abr, Azospirillum brasilense; Ali, Azospirillum lipoferum; Aor, Aspergillus oryzae; Apa, Aspergillus parasiticus; Ape, A. pasteurianus; Ath, Arabidopsis thaliana; Ban, Bacillus anthracis; Bce, Bacillus cereus; Bcp, Burkholderia cepacia; Bfu, Burkholderia fugorum; Cac, Clostridium acetobutylicum; Cgl, Candida glabrata; Ecl, Enterobacter cloacae; Eni, Emericella nidulans; Fan, Fragaria x ananassa; Huv, Hanseniaspora uvarum; Kla, Kluyveromyces

PAGE 66

53 lactis; Kma, Kluyveromyces marxianus; Kpn, Klebsiella pneumoniae; Lla, Lactococcus lactis; Mac, Methanosarcina acetovorans; Mba, Methanosarcina barkeri; Mbo, Mycobacterium bovis; Mle, Mycobacterium leprae; Mlo, Mesorhizobium loti; Mpe, Mycoplasma penetrans; Mtu, Mycobacterium tuberculosis; Ncr, Neurospora crassa; Npu, Nostoc punctiforme; Nta, Nicotiana tabacum; Osa, Oryza sativa; Pag, Pantoea agglomerans; Ppu, Pseudomonas putida; Psa, Pisum sativum; Pst, Pichia stipitis; Rpl, Rhodopseudomonas palustris; Rru, Rhodospirillum rubrum; Sau, Staphylococcus aureus; Sba, Saccharomyces bayanus; Sep, Staphylococcus epidermidis; Sty, Salmonella typhimurium; Styp, Salmonella typhi; Sce, S. cerevisiae; Skl, Saccharomyces kluyveri; Spo, Schizosaccharomyces pombe; Sve, S. ventriculi; Vvi, Vitis vinifera; Zma, Zea mays; Zbi, Zygosaccharomyces bisporus; Zmo, Z. mobilis; Zpa; Z. palmae; G+, Gram-positive; G-, Gram-negative; C, cyanobacteria; A, archaea; P, plants; F, fungi and yeast; Bar, 0.1 nucleotide substitutions per site; ORF, open reading frame with no enzyme information.

PAGE 67

54 Figure 2-6. S. ventriculi PDC protein synthesized in recombinant E. coli. Proteins were analyzed by reducing SDS-PAGE using 12% polyacrylamide gels and stained with Coomassie blue R-250. Lanes 1 and 4, Molecular mass standards (5 g). Lanes 2 and 3, Cell lysate (20 g) of IPTG-induced E. coli BL21-CodonPlus-RIL/pSJS1240 transformed with pET21d or pJAM419, respectively. Lane 5. S. ventriculi PDC protein (2 g) purified from recombinant E. coli.

PAGE 68

55 Figure 2-7. Pyruvate dependant activity of the S. ventriculi PDC purified from recombinant E. coli. The data represent mean results from triplicate determinations of PDC activity by the ADH coupled assay using 1 g of purified enzyme in 1 ml final assay volume as described in methods section. SvPDC assayed in K-MES () and Maleate buffer (O).

PAGE 69

56 CHAPTER 3 OPTIMIZATION OF Sarcina ventriculi PDC EXPRESSION IN A GRAM POSITIVE HOST Introduction Our previous work has shown that the PDC from the Gram-positive bacterium S. ventriculi (SvPDC) was poorly expressed in E. coli (133). Addition of accessory tRNAs was necessary for a ten-fold increase in protein production. The elevated levels of protein produced upon addition of accessory tRNAs facilitated the purification of the SvPDC. While the protein produced and purified from E. coli enabled the initial characterization of SvPDC, it was not the optimal host due to low levels of SvPDC produced. Therefore, it was necessary to determine if there was a host that had similar codon usage to that of SvPDC so that limited tRNAs would not hinder over expression of the protein. Because S. ventriculi is a low-G+C Gram-positive bacterium, it was reasoned that a low-G+C Gram-positive host would be most suitable for expression of this protein in large quantities. The Gram-positive bacterium Bacillus megaterium WH320 was examined as a potential host for engineering high-level synthesis of PDC. B. megaterium has several advantages over other bacilli including the availability of a shuttle plasmid (pWH1520) for xylose inducible expression of foreign genes cloned downstream of the xylA promoter. Another advantage is that the alkaline proteases, often responsible for the degradation of foreign proteins in recombinant bacilli, are not produced in B. megaterium 56

PAGE 70

57 (220, 221). In contrast to E. coli, the tRNAs for AUA and AGA are abundant in B. megaterium suggesting that factors limiting PDC production will be optimal in this host. In this study, SvPDC was over expressed in and purified from B. megaterium. The biochemical characteristics and optimum conditions for activity of the SvPDC enzyme purified from B. megaterium were determined. Due to the expression of SvPDC in B. megaterium, a plasmid was also constructed containing a Gram-positive ethanol production operon in which production of SvPDC and Geobacillus stearothermophilus alcohol dehydrogenase (ADH) (222) are transcriptionally coupled and expression of these proteins was demonstrated.

PAGE 71

58 Materials and Methods Materials Biochemicals were purchased from Sigma Chemical Company (St. Louis, MO). Other organic and inorganic analytical-grade chemicals were purchased from Fisher Scientific (Marietta, GA). Restriction enzymes were from New England Biolabs (Beverly, MA). Oligonucleotides were obtained from QIAgen Operon (Valencia, CA). Bacillus megaterium Protein Expression System was purchased from MoBiTec (Marco Islands, FL). Rnase-free water and solutions were obtained from Ambion (Austin, TX). Bacterial Strains and Media Strains and plasmids used in this study are listed in Table 3-1. E. coli DH5 was used for routine recombinant DNA experiments. B. megaterium WH320 was used for protein production. Growth and transformation of B. megaterium were performed according to the manufacturer (MoBiTec). All strains were grown in Luria-Bertani (LB) medium supplemented with antibiotics as appropriate (ampicillin 100 mg per liter, or tetracycline 12.5 mg per liter) at 37C and 200 rpm. DNA Isolation Plasmid DNA was isolated and purified from E. coli using the QIAprep Spin Miniprep Kit (QIAgen). DNA was eluted from 0.8% (w/v) SeaKem GTG agarose (BioWhittaker Molecular Applications) gels using the QIAquick gel elution kit (QIAgen). Cloning of the Sarcina ventriculi pdc Gene Into Expression Vector pWH1520 Plasmid pJAM420 was constructed using the following methods. The BspEI-to-XbaI fragment of plasmid pJAM419 was ligated with 7.7-kb SpeI-to-XmaI fragment of

PAGE 72

59 plasmid vector pWH1520. This resulted in generation of the B. megaterium expression plasmid pJAM420 that carried the S. ventriculi pdc gene, along with the Shine-Dalgrano site and T7 transcriptional terminator of the original pET21d vector. The pdc gene was positioned to interrupt the B. megaterium xylA gene (xylA) of plasmid pWH1520 and to generate a stop codon within xylA. The Shine-Dalgrano site of the inserted pdc gene was positioned directly downstream of the xylA stop codon to allow for translational coupling in which the ribosomes would presumably terminate at the stop codon for xylA and then reinitiate at the pdc start codon. Gram-positive Ethanol Operon (PET). To construct the Gram-positive PET operon, the HindIII-to-MfeI fragment of pLOI1742 containing the adh gene from G. stearothermophilus (222) was blunt-end ligated into the BlpI site of pJAM420 using Vent Polymerase (New England Biolabs). This resulted in the generation of plasmid pJAM423 which was designed to facilitate the translational coupling of the S. ventriculi pdc gene with the G. stearothermophilus adh gene. The xylA promoter is upstream of the Svpdc and the terminator now follows the adh gene. Protoplast Formation and Transformation of B. megaterium. A 1.0% (v/v) inoculum of B. megaterium WH320 cells was grown in LB to an OD600nm of 0.6 units (early-log phase). Protoplasts were formed according to Puyet et al. (223) with the following variations. Cells were treated with 10 g per ml lysozyme for 20 min at 37C. Protoplasts were stored at C. Transformation of the protoplasts was performed according to the B. megaterium protein expression kit manual (MoBiTec).

PAGE 73

60 Production of SvPDC In Recombinant Hosts. Production of SvPDC in E. coli was performed as previously described (133). SvPDC protein was synthesized in B. megaterium WH320 cells using pJAM420. A 1.0% (v/v) overnight inoculum of recombinant B. megaterium cells was grown in LB supplemented with tetracycline to an OD600nm of about 0.3 units (early-log phase). Transcription from the xylA promoter was induced with 0.5% (w/v) xylose for 3 h. Cells were harvested by centrifugation at 5000 g (10 min, 4C) and stored at -70C. Purification of the S. ventriculi PDC Protein. All purification buffers contained 1 mM TPP and 1mM MgSO4 unless indicated otherwise. Purification of SvPDC from E. coli was performed as previously described (133). Recombinant B. megaterium cells (15 g wet wt) were thawed in 6 volumes (w/v) of 50 mM Na-PO4 buffer at pH 6.5 (Buffer A) and passed through a French pressure cell at 20,000 lb per in2. Cell debris was removed by centrifugation at 16,000 g (20 min, 4C). Supernatant was filtered through a .45 m membrane. Filtrate (372.3 mg protein) was applied to a Q Sepharose Fast Flow 26/10 column (Pharmacia) that was equilibrated with Buffer A. A linear gradient was applied from 0 mM to 400 mM NaCl. Fractions containing PDC activity eluted at 250 to 300 mM NaCl were pooled. Pooled fractions were applied to a 5 ml Bio-scale hydroxyapatite type I column (BioRad) that was equilibrated with 5 mM Na-PO4 buffer at pH 6.5 (Buffer B). The column was washed with 15 ml Buffer B and developed with a linear Na-PO4 gradient (5 to 500 mM Na-PO4 at pH 6.5 in 75 ml). Protein fractions with PDC activity were eluted at 300 to 530 mM Na-PO4 and were pooled (1mg protein per ml). For further purification, portions of this material (0.25 to 0.5 ml) were applied to a Superdex 200 HR 10/30 column (Pharmacia)

PAGE 74

61 equilibrated in 50 mM Na-PO4 at pH 6.5 with 150 mM NaCl and 10% glycerol in the presence or absence of 1 mM MgSO4 and 1 mM TPP. Activity Assays and Protein Electrophoresis Techniques. PDC activity was assayed by monitoring the pyruvic acid-dependant reduction of NAD+ with alcohol dehydrogenase (ADH) as a coupling enzyme at pH 6.5, as previously described (224). Sample was added to a final volume of 1 ml containing 0.15 mM NADH, 0.1 mM TPP, 50.0 mM pyruvate, and 10 U ADH in 50 mM K-MES buffer at pH 6.5 with 5 mM MgCl2. The reduction of NAD+ was monitored in a 1 cm path length cuvette at 340 nm over a 5 min period using a BioRad SmartSpec 300 (BioRad). Protein concentration was determined using BioRad Protein assay dye with bovine serum albumin as the standard according to supplier (BioRad). The pH optimum of SvPDC was assayed in buffers suitable to maintain the desired pH. The temperature optimum of SvPDC was assayed using a Beckman DU640 (Beckman) spectrophotometer with a circulating water bath. Thermostability of SvPDC was assayed by incubating purified enzyme in lysis buffer at a concentration of 0.02 g of protein per l for 90 min. After incubation, samples were assayed at room temperature. Molecular masses were estimated by reducing and denaturing SDS-PAGE using 12% polyacrylamide gels. Proteins were stained using the Rapid Fairbanks method (225). The molecular mass standards were phosphorylase b (97.4 kDa), serum albumin (66.2 kDa), ovalbumin (45 kDa), carbonic anhydrase (31 kDa), trypsin inhibitor (21.5 kDa), and lysozyme (14.4 kDa).

PAGE 75

62 Results SvPDC Expression Vector for B. megaterium. Previous studies have shown that SvPDC is poorly expressed in E. coli (133). Because SvPDC is from a Gram-positive bacterium, we decided to use a Gram-positive bacterial expression system for high-level production of SvPDC. A fragment of plasmid pJAM419, used previously for expression of SvPDC in E. coli (133), was isolated that contained a Shine-Dalgrano sequence, the S. ventriculi pdc gene, and the T7 terminator. This fragment was cloned into pWH1520 in such a way that the xylose isomerase gene (xylA) of pWH1520 was truncated to form a stop codon after 30 codons. The Shine-Dalgrano sequence upstream of SvPDC was positioned so that a xylose-inducible transcriptional coupling occurred between xylA and Svpdc. The resulting plasmid, pJAM420, was used for expression of SvPDC in B. megaterium. Production and Purification of SvPDC from B. megaterium. Based on SDS-PAGE, expression of SvPDC is notably higher when expressed in B. megaterium compared to E. coli (Figure 3-1). The high levels of SvPDC protein produced in B. megaterium facilitated a 22-fold purification of the protein from this host, with 8.35 mg purified protein from 15 g of cells (wet wt.) (Table 3-2). This is in contrast to purification of SvPDC from E. coli, which began with 14.8 g of cells and only yielded 0.2 mg purified protein (unpublished data). Purified SvPDC from B. megaterium was determined to be a 235 kDa homotetramer of 58 kDa subunits as determined by Superdex 200 gel filtration chromatography and SDS-12% PAGE electrophoresis. These results correlate with previous studies (132, 133).

PAGE 76

63 Determination of Optimum Conditions for SvPDC Activity. It is important when assaying any enzyme to determine its optimum conditions. PDCs are routinely assayed at pH 6.5 (178, 218) and pH 6.0 (94, 112). While these pH values are acceptable for the Z. mobilis and S. cerevisiae PDC proteins, they may give misleading kinetic values for SvPDC. Our research found that the recombinant SvPDC from B. megaterium had a pH optimum in the range of pH 6.5 to pH 7.4 (Figure 3-2). This pH optimum is quite high when compared to the PDCs from Z. mobilis (pH 6.0), S. cerevisiae PDC1 (pH 5.4-5.8), A. pasteurianus (pH 5.0-5.5), and Z. palmae (pH 5.5-6.0) (113, 131, 226). The pH optimum of SvPDC purified from recombinant E. coli has previously been shown to be between pH 6.3 to 6.7 (131), which is higher than the other bacterial PDCs and also different to the pH optimum determined for the B. megaterium purified protein. The temperature optimum of the SvPDC from B. megaterium was determined to be 32C (Figure 3-3). This temperature differs greatly from the Z. mobilis, Z. palmae, and A. pasteurianus PDCs, which have temperature optima of 60C (131). There is, however, an approximately 2.5-fold increase in activity of the SvPDC at 32C compared to room temperature. This increase in activity is comparable to that observed when the Gram-negative bacterial PDCs were assayed at their optimal temperatures (131). Kinetics of SvPDC Produced in B. megaterium. The recombinant SvPDC from B. megaterium displayed sigmoidal kinetics (Figure 3-4). The recombinant SvPDC from B. megaterium had a Km of 3.9 mM for pyruvate and a Vmax of 98 U per mg of protein when assayed at pH 6.5 and room temperature. When assayed at optimal conditions, 32C and pH 6.72, there was an

PAGE 77

64 increase in both Km (6.3 mM for pyruvate) and Vmax (172 U per mg protein). These results suggest that a change in conformation mediated by an increase in pH and/or temperature reduces the affinity of the enzyme for pyruvate but increases the overall activity of the enzyme. Further study is necessary to determine the cause of this phenomenon. Thermostability of SvPDC Produced in B. megaterium. Previous studies showed that SvPDC is not as thermostable as the other bacterial PDC proteins (131, 133). In order to determine if production of the SvPDC protein in a sub optimal host was responsible for this, thermostability of SvPDC produced in E. coli was compared to that produced in B. megaterium (Figure 3-5). When assayed for thermostability, the SvPDC produced in B. megaterium retained 30% activity after incubation at 50C while the protein purified from E. coli only had 0.95% residual activity after incubation at 50C. These results indicate that SvPDC is more thermostable when produced in B. megaterium compared to E. coli. Misincorporation of amino acids due to use of rare codons and/or misfolding of the SvPDC protein may have occurred when the enzyme was produced in E. coli and may account for this reduction in thermostability. During the biochemical characterization of SvPDC, we discovered that pH had a drastic effect on the thermostability of this enzyme (Figure 3-6). While the optimal pH for activity of the SvPDC is pH 6.72, this is not optimal for its thermostability. At pH 6.5 the SvPDC enzyme has only 3% of original activity remaining after incubation at 60C while samples incubated at pH 5.0 to pH 5.5 have 94% to 97% activity remaining. It was

PAGE 78

65 also determined that SvPDC retained 100% activity when stored at pH 5.5 for two weeks compared to 62 % when stored at 4C at pH 6.5 (data not shown). Generation of a Gram-positive Ethanol Production Operon. B. megaterium WH320 is capable of growth when tested in xylose minimal medium. The strain is also able to grow at temperatures up to 42C and at a low pH of 5.0. This strain appears to be a suitable candidate to perform preliminary tests on ethanol production with a portable pyruvate to ethanol operon (PET) and may prove useful in large-scale ethanol production under acidic conditions. To construct a Gram-positive PET operon, the adh gene from G. stearothermophilus (222) was cloned behind the S. ventriculi pdc gene in the B. megaterium pWH1520 expression vector. This vector was chosen based on successful overproduction of S. ventriculi PDC (Figure 3-7). The resulting PET plasmid, pJAM423, was transformed into B. megaterium. After xylose induction, a considerable portion of the cell lysate of this strain was composed of the S. ventriculi PDC and G. stearothermophilus ADH proteins (Figure 3-7). The ethanol production of this construct was tested in the presence of 0.5% xylose. HPLC analysis showed that ethanol production was doubled from that of a strain with pWH1520 alone, but levels were still quite low (20mM)(data not shown). PDC has already been shown to be very active in cell lysate, but further analysis needs to be performed to determine if the ADH is active. Discussion The SvPDC protein is poorly expressed in recombinant E. coli (133). Therefore, we reasoned that a host more similar to S. ventriculi might express this PDC at higher levels. B. megaterium was chosen as a host because it has several benefits over other

PAGE 79

66 Gram-positive expression systems. These include a xylose inducible expression vector and absence of alkaline proteases that are often responsible for degradation of foreign proteins (220, 221). Augmentation of the host, B. megaterium, with accessory tRNAs was not necessary for high-level SvPDC production. This high yield of SvPDC protein facilitated the 22-fold purification. The SvPDC protein was more active when produced in B. megaterium compared to E. coli. We believe that the difference in activity is primarily due to differences in the rate of misincorporation of amino acids based on codon usage. The SvPDC protein produced in B. megaterium has a higher Vmax (98 U per mg protein) at RT than when produced by E. coli (66 U per mg protein). The SvPDC produced in B. megaterium is also more thermostable than the E. coli produced protein. Choosing the correct host appears to have affected the quality of SvPDC protein that was recovered. These results indicate that differences can occur in the biochemical properties of recombinant protein based on host. In this study, we discovered that the pH of the incubation buffer has an effect on the thermostability of SvPDC. Low pH stabilized SvPDC at higher temperatures. These results suggest that residues of SvPDC gain a charge between pH 5.0.5 that allows the tetramer conformation to remain stable at higher temperatures. This is an important discovery because it gives insight into residues that can be altered in future experiments in order to engineer SvPDC to be more thermostable at cytosolic pH. The current portable production of ethanol (PET) operon consists of the pdc and adh genes from Zymomonas mobilis, a Gram-negative organism (24, 25, 129, 227). Past research to engineer a Gram-positive host for ethanol production has focused on using

PAGE 80

67 this PET operon, but these attempts have met with limited success (33-35, 228) primarily due to poor expression of the PDC. We have shown that SvPDC is expressed at high levels in B. megaterium, a Gram-positive host. Our construction and expression of the Gram-positive ethanol production operon using the SvPDC and G. stearothermophilus ADH has demonstrated that recombinant PDC and ADH production no longer limit ethanol production in Gram-positive biocatalysts. Our research shows that selection of host for recombinant production of proteins can affect the quality and stability of the recombinant protein. We have also demonstrated that SvPDC has qualities that make it unique among bacterial PDCs, including its substrate activation and elevated pH optimum. SvPDC is the only bacterial PDC that is not thermostable, but our results indicate that alteration of charged residues may facilitate the engineering of thermostable SvPDC variants. Lastly, we have created a Gram-positive ethanol production operon that will be useful in engineering future Gram-positive hosts for ethanol production.

PAGE 81

68 Table 3-1. Strains, plasmids, and primers used in Chapter 3. Strain or Plasmid Phenotype or genotype, PCR primers Source E. coli DH5 FrecA1 endA1 hsdR17 (rkmk+) supE44 thi-1 gyrA relA1 GibcoBRL (Gathers-burg, Md.) E. coli BL21-CodonPlus-RIL F ompT hsdS(rB mB) dcm+ Tetr gal (DE3) endA Hte [argU ileY leuW Camr] (an E.coli B strain) Stratagene (La Jolla, CA.) B. megaterium WH320 lacxyl+ MoBiTec pSJS1240 Spr; derivative of pACYC184 with E. coli ileX and argU (219) pET21d Apr; expression vector for replication in E. coli Novagen pWH1520 Apr Tc r; shuttle expression vector for replication in E. coli and B. megaterium (220) pJAM419 Apr; pET21d derivative encoding SvPDC (133) pJAM420 Apr Tc r; 1.9-kb BspEI-to-XbaI fragment of pJAM419 ligated with the SpeI-to-XmaI fragment of pWH1520; used for synthesis of SvPDC in B. megaterium This study pLOI1742 Plasmid containing the G. stearothermophilus adh gene L. Yomano pJAM423 Apr Tc r; 1.8-kb HindIII-to-MfeI fragment of pLOI1742 blunt-end ligated into the BlpI site of pJAM420; xylose-inducible Gram-positive ethanol production operon This study

PAGE 82

69 Table 3-2. Purification of SvPDC from B. megaterium. Step Protein (mg) Sp. Act. (U per mg protein) Purification Fold Percent Yield Cell Lysate 372.3 3.85 1.00 100 Q-Sepharose 38.26 20.34 5.28 54 Hydroxyapatite 15.70 24.83 6.45 27 Superdex 200 8.35 84.18 21.87 49

PAGE 83

70 1 2 3 4 5 6 kDa 97.4 66.2 58 58 45 21.5 14.4 Figure 3-1. S. ventriculi PDC protein synthesized in recombinant E. coli and B. megaterium. Proteins were analyzed by reducing SDS-PAGE using 12% polyacrylamide gels and stained with Coomassie blue R-250. Lanes 1 and 4, Molecular mass standard (5 g). Lanes 2 and 3, Cell lysate (20 g) of E.coli BL21-CodonPlus-RIL transformed with pJAM419/pSJS1240 uninduced and IPTG induced, respectively. Lanes 5 and 6, Cell lysate (20 g) of B. megaterium WH320 transformed with pJAM420 xylose induced and uninduced, respectively.

PAGE 84

71 020406080100120468pHSp. Act. (U/mg) 10 Figure 3-2. pH profile for S. ventriculi PDC activity.

PAGE 85

72 0501001502000102030405Temperature CSp. Act. (U/mg) 0 Figure 3-3. Effect of temperature on S. ventriculi PDC activity.

PAGE 86

73 02040608010012014002468101214Pyruvate (mM)Sp.Act. (U/mg) Figure 3-4. Effect of pyruvate concentration on S. ventriculi PDC synthesized in recombinant E. coli (), and B. megaterium () at 25C and pH 6.5. S. ventriculi PDC at 32C and pH 6.72 from recombinant B. megaterium (). The data represent mean results from triplicate determinations of PDC activity.

PAGE 87

74 0%20%40%60%80%100%120%405060Temperature (C)Relative Activity (U/mg) Figure 33-5. Thermostability of recombinant S. ventriculi PDC produced in B. megaterium () and E. coli CodonPlus with plasmid pSJS1240 ().

PAGE 88

75 0%20%40%60%80%100%120%140%160%010203040506070Temperature (C )Relative Activity Figure 3-6. Effect of pH on the thermostability of the S. ventriculi PDC produced in B. megaterium. Thermostability was tested at a pH 5.0 (), pH 5.5 (), pH 6.5 (), and pH 7.5 ().

PAGE 89

76 1 2 3 4 kDa 97.4 66.2 S. ventriculi PDC 45 G. stearothermophilus ADH 31 21.5 14.4 Figure 3-7. Induction of S. ventriculi PDC and G. stearothermophilus ADH in B. megaterium. Proteins were seperated by reducing SDS-PAGE using 12% polyacrylamide gels and stained with Coomassie blue R-250. Lanes 1, Molecular mass standard (5 g). Lanes 2, Cell lysate (20 g) of B. megaterium transformed with pWH1520 induced with xylose. Lanes 3 and 4, Cell lysate (20 g) of B. megaterium WH320 transformed with pJAM423 uninduced and xylose induced, respectively.

PAGE 90

77 CHAPTER 4 EXPRESSION OF PDCs IN THE GRAM-POSITIVE BACTERIAL HOST, B. megaterium Introduction PDC (PDC, EC 4.1.1.1) is a central enzyme in ethanol fermentation and catalyzes the non-oxidative decarboxylation of pyruvate to acetaldehyde with release of carbon dioxide. The acetaldehyde generated from this reaction is then converted to ethanol by alcohol dehydrogenase (ADH, EC1.1.1.1). The recombinant production of these two enzymes (PDC and ADH) converts intracellular pools of pyruvate to ethanol. The current portable production of ethanol (PET) operon used to engineer this conversion consists of the pdc and adh genes from Zymomonas mobilis, a Gram-negative organism (24, 25, 129, 227). While this strategy has been highly successful in the modification of Gram-negative bacteria for ethanol production, improvements in host strains are necessary (4, 129). To enhance the commercial competitiveness of biocatalysts for the large-scale production of ethanol, the hosts must withstand low pH, high temperature, high salt, high sugar, high ethanol, and various other harsh conditions. Many of these qualities are not found in Gram-negative bacteria and must be introduced through metabolic engineering. In contrast, Gram-positive bacteria naturally possess many desirable traits for the industrial production of ethanol (228); however, modifying them for ethanol production has met with only limited success. Several attempts to engineer the PET operon into 77

PAGE 91

78 Gram-positive organisms have resulted in low levels of PDC activity and only small elevations in ethanol production (33-35, 228). Prior to this work, construction of PET operons for engineering high-level synthesis of ethanol in recombinant Gram-positive bacteria has been limited by the availability of bacterial pdc genes. Recently, however, the cloning and DNA sequence of a pdc gene from the Gram-positive bacterium, S. ventriculi (Sv), was described (133). Synthesis of the SvPDC protein in recombinant Escherichia coli was low but enhanced by augmentation with accessory tRNAs (133). Based on these results, it is hypothesized that reduced translation due to differences in codon usage can be a major factor in limiting PDC production in recombinant bacterial hosts. In this study, pdc genes from diverse organisms (i.e., S. ventriculi, Z. mobilis, Acetobacter pasteurianus and Saccharomyces cerevisiae) with differing GC content were expressed in recombinant Bacillus megaterium. Superior levels of active SvPDC were produced in this host. Assessment of the mRNA transcript levels and rates of protein degradation in these recombinant strains revealed that the differences in PDC were at the level of protein synthesis. This is the first report of high level PDC production in a recombinant Gram-positive host and reveals that SvPDC is an ideal candidate for the metabolic engineering of ethanol production in this desirable group of organisms. Materials and Methods Materials Biochemicals were purchased from Sigma (St. Louis, Mo.). Other organic and inorganic analytical-grade chemicals were from Fisher Scientific (Atlanta, Ga.). Restriction enzymes were from New England Biolabs (Beverly, Mass.).

PAGE 92

79 Oligonucleotides were from QIAgen Operon (Valencia, Ca.) and Integrated DNA Technologies (Coralville, Ind.). Bacillus megaterium Protein Expression System was from MoBiTec (Marco Islands, Fla.). Rnase-free water and solutions were from Ambion (Austin, Tx.). Bacterial Strains and Media Strains and plasmids used in this study are listed in Table 4-1. E. coli DH5 was used for routine recombinant DNA experiments. B. megaterium WH320 was used for PDC production, pulse-chase, and transcript analysis. Strains were grown in Luria-Bertani (LB) medium unless otherwise indicated. Medium was supplemented with 2% (wt/vol) glucose and antibiotics (ampicillin 100 mg per liter, kanamycin 30 mg per liter, or tetracycline 15 mg per liter) as needed. All strains were grown at 37C and 200 rpm. Isolated colonies of B. megaterium were grown overnight in liquid medium and used as a 1.0% (vol/vol) inoculum into fresh medium unless otherwise indicated. Protoplast Formation and Transformation of B. megaterium. B. megaterium WH320 was grown to an O.D.600nm of 0.6 units (early-log phase). Protoplasts were generated according to Puyet et al. (223) with the following modifications. Cells were treated with lysozyme (10 g per ml) for 20 min. Protoplasts were stored at C and transformed according to MoBiTec. DNA Isolation and Cloning Plasmid DNA was isolated and purified from E. coli using the QIAprep Spin Miniprep Kit (QIAgen). DNA was eluted from 0.8% (wt/vol) SeaKem GTG agarose (Cambrex Corp., East Rutherford, NJ) gels using the QIAquick gel elution kit (QIAgen). To generate the B. megaterium expression plasmids (pJAM420, pJAM430, pJAM432,

PAGE 93

80 and pJAM435), similar strategies were used (Figure 4-1) (Table 4-1). For example, plasmid pJAM420 was constructed as follows. A BspHI-to-XhoI DNA fragment with the complete S. ventriculi pdc gene was generated by PCR amplification and cloned into the NcoI and XhoI sites of plasmid pET21d (133). The 1.9-kb XbaI-to-BspEI DNA fragment of the resulting plasmid (pJAM419) was ligated into the SpeI and XmaI sites of plasmid pWH1520. This resulted in generation of a pWH1520-based expression plasmid (pJAM420) that carried the S. ventriculi pdc gene, along with the Shine-Dalgrano site and T7 transcriptional terminator of the original pET21d vector. The pdc gene was positioned to interrupt the B. megaterium xylA gene (xylA) of plasmid pWH1520 and to generate a stop codon within xylA. The Shine-Dalgrano site originally from pET21d of upstream of the inserted pdc gene was positioned directly downstream of the xylA stop codon to allow for translational coupling in which the ribosomes would terminate at the stop codon for xylA and then reinitiate at the pdc start codon. Production of PDC Proteins In Recombinant B. megaterium. PDC proteins were independently synthesized in B. megaterium WH320 cells using the expression plasmids described above. Cells were grown to an O.D.600 nm of 0.3 units (early-log phase). Transcription from the xylA promoter was induced by addition of xylose (0.5% [wt/vol]). Cells were harvested after 3 h by centrifugation (5,000 g, 10 min, 4C) and stored at -80C. Cell pellets (0.5 g) were thawed in 6 volumes (wt/vol) of 50 mM Na2HPO4 buffer at pH 6.5 containing 1 mM MgSO4 and 1 mM TPP. Cells were passed through a French pressure cell at 20,000 lb per in2. Debris was removed by centrifugation (16,000 g, 20 min, 4C). Cell lysate was immediately assayed for activity.

PAGE 94

81 Activity Assays and Protein Electrophoresis Techniques PDC activity was assayed by monitoring the pyruvic acid-dependant reduction of NAD+ with alcohol dehydrogenase (ADH) as a coupling enzyme at pH 6.5, as previously described (115). Cell lysate (10 l) was added to a final volume of 1 ml containing 0.15 mM NADH, 0.1 mM thiamine pyrophosphate, 50.0 mM pyruvate, and 10 U ADH in 50 mM K-MES buffer at pH 6.5 with 5 mM MgCl2. The reduction of NAD+ was monitored in a 1 cm path length cuvette at 340 nm over a 5 min period using a BioRad SmartSpec 300 (BioRad). Protein concentration was determined using BioRad Protein assay dye with bovine serum albumin as the standard according to supplier (BioRad). Protein molecular masses were analyzed by reducing and denaturing SDS-PAGE using 12% polyacrylamide gels that were stained by heating with Coomassie blue R-250 (225). Molecular mass standards were phosphorylase b (97.4 kDa), serum albumin (66.2 kDa), ovalbumin (45 kDa), carbonic anhydrase (31 kDa), trypsin inhibitor (21.5 kDa), and lysozyme (14.4 kDa). RNA Isolation Cultures were grown in triplicate to an O.D.600 nm of 0.3 units (early-log phase). Transcription of pdc was induced for 15 min with 0.5% (wt/vol) xylose. Total RNA was isolated using the RNeasy miniprep kit. Samples were treated with lysozyme and On-column DNase as recommended by supplier (QIAgen). The removal of DNA from RNA samples was confirmed by performing PCR using Jumpstart Taq Readymix in the absence of reverse transcriptase (Sigma). Quality and quantity of RNA were determined by 0.8% agarose gel electrophoresis and absorbance at 260 nm, respectively.

PAGE 95

82 RNA Quantifications The MAXIscript T7 In vitro transcription kit (Ambion) was used to generate transcript from the E. coli expression vectors (pJAM419, pJAM429, pJAM431, and pScPDC1). Nuc-Away spin columns (Ambion) were used to remove unincorporated nucleotides. RNA products expressed in vitro were used to generate standard curves of absolute copy number for each experiment. Transcript levels were analyzed using quantitative real time reverse transcriptase PCR with an Icycler (BioRad). Total RNA (100 pg) was used as a template with the primers listed in Table 4-1. RNA Quantification reactions were performed using the QuantiTect SYBR Green 1-step RT-PCR kit according to supplier (QIAgen). All data had PCR efficiency of 90 to 100% and were analyzed using the Icycler software version 3.0.6070 (BioRad) and Microsoft Excel. Pulse Chase Recombinant B. megaterium strains were grown in minimal medium (10 g sucrose, 2.5 g K2HPO4, 2.5 g KH2PO4, 1.0 g (NH4)2HPO4, 0.2 g MgSO4H2O, 10 mg FeSO4H2O, 7 mg MnSO4H2O in 985 ml dH2O at pH 7.0) supplemented with tetracycline (MM Tet) using a 1% (vol/vol) inoculum. Cells were grown to an O.D.600nm of 0.3 units (early-log phase) and recombinant gene transcription was induced for 15 min with 0.5% (wt/vol) xylose. Cells were harvested by centrifugation (5000 g, 10 min, 25C) and resuspended in 2 ml of MM Tet supplemented with 0.5% xylose and 50 Ci per ml L-[35S]-methionine (DuPont-NEN). Cells were incubated for 15 min (37C, 200 rpm) and harvested as above. Cell pellets were resuspended in MM Tet supplemented with 0.5% xylose and 5mM L-methionine with or without chloramphenicol (15 mg per L) and incubated (37C, 200 rpm). Aliquots (0.5 ml) were withdrawn after 5, 10, 15, 30, 60,

PAGE 96

83 90, 120, 150, and 180 min of incubation and immediately added to 50 l stop solution (75 mM NaCl, 25 mM EDTA, 20 mM Tris pH 7.5, and 1 mg chloramphenicol per ml). Cells were incubated on ice (5 min), harvested at 16,000 g (10 min, 25C), and stored at 80C. Cell pellets were subjected to 3 cycles of freeze-thaw (C and 0C) to weaken the cell membrane. Pellets were resuspended to an O.D.600nm of 0.0134 units per l Lysis solution (75 mM NaCl, 25 mM EDTA, 20 mM Tris pH 7.5, and 0.2 mg lysozyme per ml) and incubated (25C, 15 min). Samples (O.D.600nm of 0.02 units per lane) were boiled (20 min) in SDS-PAGE loading dye (BioRad) and separated by SDS-PAGE. Gels were dried and exposed to X-ray film. A VersaDoc Model 1000 with Quantity One Software (BioRad) was used for densitometric readings. Results Construction of Gram-positive PDC Expression Plasmids Previous work suggested that codon usage effects the synthesis of PDCs in Gram-negative bacteria (133). To determine if this was the factor responsible for limiting PDC expression in Gram-positive bacteria, four PDC genes with different G+C content and codon usage were chosen for expression analysis. These included the S. ventriculi pdc gene (Svpdc) that is poorly expressed in E. coli and is the only known PDC from a Gram-positive bacterium. In addition, the Saccharomyces cerevisiae PDC1 (ScPDC1) was chosen because the encoded protein is closely related to SvPDC (130, 133) and is currently used in corn-to-ethanol production (2). The Acetobacter pasteurianus (130) and Zymomonas mobilis (111-115) pdc genes (Appdc and Zmpdc) were also used. These

PAGE 97

84 latter two genes are from Gram-negative bacteria and have high levels of expression and activity in Gram-negative hosts (130, 131, 133). To construct the expression plasmids, the pdc genes were initially cloned into pET vectors (Figure 4-1)(Table 4-1). DNA fragments containing the pdc gene of interest and the Shine-Dalgrano and T7-terminator from the pET plasmid were cloned into the B. megaterium expression plasmid pWH1520. This generated a truncation of the xylA gene, which encodes xylose isomerase, and allowed for induction of pdc expression by xylose in B. megaterium. Expression of PDC In Recombinant B. megaterium After 3 h induction of recombinant pdc gene expression, the levels of PDC protein produced in the B. megaterium strains were estimated by SDS-PAGE (Figure 4-2). High-levels of SvPDC protein were evident and estimated to account for 5% of soluble protein based on Coomassie blue R-250 stained gels. In contrast, only low-level synthesis of ZmPDC, ApPDC, and ScPDC1 were apparent. To determine if the PDC proteins were produced in an active form, cell lysate of the recombinant B. megaterium strains was assayed for PDC activity (Table 4-2). The SvPDC had the highest specific activity in cell lysate, with 5.29 U per mg protein. Thus, approximately 5% of the total soluble protein was active SvPDC, consistent with the levels of SvPDC protein estimated by SDS-PAGE. In contrast, the specific activity of the ZmPDC and ScPDC was 5-fold and 10-fold lower than SvPDC, respectively. Previous studies have determined the specific activity of ZmPDC to be 6.2 to 8 U per mg protein (113, 131) when produced in recombinant E. coli, in contrast with 1.1 U per mg in this study. There was no detectable activity for the ApPDC protein.

PAGE 98

85 It was previously reported that purified SvPDC from recombinant E. coli and reported specific activities in cell lysate of 0.16 U per mg from BL21-CodonPlus-RIL augmented with accessory tRNAs for the AUA and AGA codons (133). No tRNA augmentation was necessary in recombinant B. megaterium and yet there was a 33-fold increase in the specific activity in cell lysate. These results demonstrate that SvPDC is not only produced in very high quantity, but is produced in an active form within the B. megaterium host cell. This is quite remarkable because it is the first report of high levels of PDC production in a recombinant Gram-positive bacterium. These results indicate that B. megaterium is a better host for production of the SvPDC while it is sub optimal for the production of the Gram-negative PDCs, ZmPDC and ApPDC, which were expressed more efficiently in E. coli. Analysis of PDC Transcript Levels The factors responsible for low-level production of PDC protein in recombinant Gram-positive bacteria are unknown (33-35, 228). In order to determine if transcription and/or mRNA degradation were limiting production of PDC in Gram-positive hosts, we analyzed pdc transcript levels for the various recombinant B. megaterium strains. Total RNA was isolated and quantitative reverse transcriptase PCR was performed to determine if transcript levels correlated with PDC production (Figure 4-3). The transcript levels were similar for all four pdc genes, ranging from 12 to 24% of total RNA, with the transcript for Zmpdc the lowest and Scpdc1 the highest. There was not an abundance of Svpdc transcript compared to the other pdc gene transcripts. Thus, the pdc-specific mRNA levels did not correlate with the levels of PDC protein in the recombinant B. megaterium strains. These results indicate that the level of transcript is not the factor

PAGE 99

86 influencing protein levels of PDC in the cell. This is not unexpected due to the use of the same inducible promoter, transcription terminator, and vector for the construction of all four pdc gene expression plasmids. PDC Protein Stability In Recombinant B. megaterium Gram-positive bacteria, particularly the bacilli, are well known for an abundance of proteases (229). This is often a problem when producing heterologous proteins in these hosts (229-231). To determine if protein degradation was responsible for limiting PDC production in B. megaterium, pulse-chase analysis was performed. The SvPDC and ZmPDC were chosen for analysis based on the availability of antibodies. After induction of pdc transcription (15 min), protein was labeled with L-[35S]-methionine (15 min) and chased with excess unlabeled L-methionine. This enabled the rate of protein degradation after induction of pdc gene transcription to be monitored over a period of several hours (Figure 4-4). During the initial half-hour, the rate of degradation of recombinant PDC protein ranged from 1.3 to 3% of labeled PDC protein per min. The degradation of SvPDC was at a higher rate than that of ZmPDC. After these elevated initial rates, however, degradation of both SvPDC and ZmPDC were similar at 0.48% and 0.44% labeled PDC protein per minute, respectively. In contrast, samples that had chloramphenicol, a protein synthesis inhibitor, present during the entire chase exhibited no degradation of the PDC proteins. It is, therefore, interesting to note that the protease or proteases responsible for the degradation of the PDC proteins are induced during the induction of the recombinant proteins.

PAGE 100

87 This data proves that degradation of recombinant PDC proteins occurs at very similar rates, yet the amounts of the SvPDC present after 3 h induction is dramatically different when visualized on SDS-PAGE gel (Figure 4-1). Protein degradation is, therefore, not a factor influencing the levels of active PDC protein in B. megaterium. Discussion For production of ethanol in Gram-positive bacteria to become a viable fuel alternative it will be necessary to find a PDC that can be expressed at high enough levels to rapidly funnel pyruvate to acetaldehyde. Until now, there has not been a PDC that has been expressed well in a recombinant Gram-positive bacterium (33-35, 228). In this study, B. megaterium expression vectors were designed in such a way to transcribe all four pdc genes at similar rates by using the same xylA promoter, Shine-Dalgrano sequence, and T7 terminator. Using this approach, the S. ventriculi PDC was expressed at high levels in the recombinant Gram-positive host. The SvPDC protein levels and activity were at least 5-fold higher than when the Z. mobilis, A. pasteurianus, or S. cerevisiae PDC proteins were expressed. To assess the biological reason for these differences, quantitative reverse transcriptase PCR and pulse-chase experiments were performed. Similar levels of pdc-specific transcript and similar rates of PDC protein degradation were determined. Thus, in the Gram-positive host examined in this study, protein synthesis limited the production of PDC proteins from yeast and Gram-negative bacterial genes. It was previously demonstrated that addition of accessory tRNAs is necessary for enhancement of protein levels of SvPDC in E. coli by ten-fold (133). This is not the case when ApPDC and ZmPDC are expressed in E. coli. Both PDCs are produced at very high

PAGE 101

88 levels in this Gram-negative host without the addition of accessory tRNA. In B. megaterium, however, SvPDC is expressed at very high levels, while expression of ApPDC and ZmPDC is poor. The results of the expression of the PDC proteins in E. coli and B. megaterium indicate that codon usage of the pdc genes is one of the primary factors influencing expression of these proteins in Gram-positive hosts (131, 133) (Table 4-3). The contrasting codon usage of the pdc genes used in this study becomes evident when analyzing the % G+C in the wobble position. B. megaterium has a wobble position % G+C of 30.8%. The S. ventriculi pdc gene has the lowest % G+C in the wobble position at 12.3%, the A. pasteurianus pdc gene has the highest at 74.2%, and the Z. mobilis and S. cerevisiae pdc genes have similar percentages at 54.6% and 51.5%, respectively. These values vary quite dramatically and correspond with the general trend of efficiency of expression in B. megaterium demonstrated by these results. Previous studies have shown that changing rare codons to codons optimal for the recombinant host can increase protein levels. For example, expression of cyt2Aa1 of Bacillus thuringiensis in Pichia pastoris was improved (232) and production of antigen 85A from Mycobacterium tuberculosis in E. coli was increased 54-fold (233). Thus, future research is aimed at engineering Gram-positive hosts for ethanol production using the only known PDC that is expressed well in a Gram-positive host, SvPDC. Alternatively, a pdc gene with optimized codon usage could be synthesized for high-level production of alternative PDCs.

PAGE 102

89 Table 4-1. Strains, plasmids, and primers used in Chapter 4. Strain, Plasmid or PCR primer Phenotype, genotype or prim er sequence Source Strain: E. coli DH5 FrecA1 endA1 hsdR17 (rk mk +) supE44 thi-1 gyrA relA1 GibcoBRL (Gathersburg, Md.) B. megaterium WH320 lacxyl+ MoBiTec Plasmid: pET21d Apr; E. coli expression vector Novagen pET24b Kanr; E. coli expression vector Novagen pWH1520 Apr Tc r; E. coli and B. megaterium shuttle vector for expression in B. megaterium (220) pJAM419 Apr; pET21d derivative encoding SvPDC (133) pJAM420 Apr Tc r; 1.9-kb Bsp EI-toXba I fragment of pJAM419 ligated with the Spe I-toXma I fragment of pWH1520; used for synthesis of SvPDC in B. megaterium This study pJAM429 Kanr; pET24b derivative encoding ApPDC; 1.9-kb PCR product ligated into Nde I and Xho I sites of pET24b; ApPDC For 5’GGCC CATATG TATCTTGCAGAACG-3’, ApPDC Rev 5’-ATTAT CTCGAG TCAGGCCAGAGTGG3’( Nde I and Xho I sites in bold) This study pJAM430 Apr Tc r; 1.9-kb Bsp EI-toXba I fragment of pJAM429 ligated into Spe I and Xma I sites of pWH1520; used for synthesis of ApPDC in B. megaterium This study pJAM431 Apr; pET21d derivative encoding ZmPDC; 2.1-kb PCR product ligated into Nco I and Xho I sites of pET21d; ZmPDC For 5’-GGCC TCATGA GTTATAGTGTCGG3’, and ZmPDC Rev 5’GATTT CTCGAG CTAGAGGAGCTTG-3’ ( Bsp HI and Xho I sites in bold) This study pJAM432 Apr Tc r; 2.1-kb Xba I-toNgo MIV fragment of pJAM429 ligated into Spe I and Xma I sites of pWH1520; used for synthesis of ZmPDC in B. megaterium This study

PAGE 103

90 Table 4-1. Continued. Strain, Plasmid or PCR primer Phenotype, genotype or prim er sequence Source pScPDC1 Apr; pET22b derivative encodi ng ScPDC1 with a 6xHIS tag (90) pJAM435 Apr Tc r; 1.9-kb Bsp EI-toXba I fragment of pScPDC1 ligated into Spe I and Xma I sites of pWH1520; used for synthesis of ScPDC1 in B. megaterium This study RT Primersa: Svpdc For 5-AATCGAAATGAAACCGCTAA-3 This study Svpdc Rev 5-TGAGCTTGCAACCATTTCTTTTA-3 This study Appdc For 5-CGCGCCCAACAGCAATGATCA-3 This study Appdc Rev 5-GGGCGGAGTGAGCGTCGGTAAT-3 This study Zmpdc For 5-TGGCGAACTGGCAGAAGCTATCA-3 This study Zmpdc Rev 5-CGCGCTTACCCCATTTGACCA-3 This study Scpdc1 For 5-CACGGTCCAAAGGCTCAATACAA-3 This study Scpdc1 Rev 5-CCGGTGGTAGCGAC TCTGTGG-3 This study aAbbreviations: RT, reverse transcript ase; For, forward primer; Rev, reverse primer; Sv, S. ventriculi ; Ap, A. pasteurianus ; Zm, Z. mobilis ; Sc S. cerevisiae

PAGE 104

91 Table 4-2. PDC activity of B. megaterium strains transformed with pdc expression plasmids. Expression Plasmid Recombinant Proteina Sp. Act. (U mg -1protein)b Std. Dev. Purified Sp. Act. (U mg -1protein) pWH1520 None 0.29 0.05 NA pJAM420 SvPDC 5.29 0.23 65c 103d pJAM430 ApPDC 0.14 0.06 120e 134.2f pJAM432 ZmPDC 1.11 0.03 51.9g pJAM435 ScPDC1 0.53 0.04 92h aAbbrevations: Sv, S. ventriculi; Ap, A. pasteurianus; Zm, Z. mobilis; Sc, S. cerevisiae. bPDC specific activity, determined for cell lysate using the ADH coupled assay. References: c, (133); d, (132); e, (113); f, (111); g, (50); h, (131).

PAGE 105

92 Table 4-3. Codon usage of PDC genes and B. megaterium genome. Frequency per Thousand Amino Acid Codon B. megaterium genome S. ventriculi pdc A. pasteurianus pdc Z. mobilis pdc S. cerevisiae pdc A GCT 28.1 34.4 9.1 73.8 75.8 GCC 7.5 0 74.3 33.4 14.1 GCA 29.2 32.6 18.1 31.6 0 GCG 11.5 1.8 30.8 10.5 1.8 C TGT 3.4 7.2 3.6 1.8 8.8 TGC 2.3 1.8 16.3 10.5 0 D GAT 36.5 47.1 16.3 19.3 15.9 GAC 15.4 3.6 32.6 22.8 33.5 E GAA 60.2 85.1 43.5 63.3 51.1 GAG 17.1 5.4 10.9 5.3 1.8 F TTT 29.1 29.0 5.4 5.3 0 TTC 10.6 18.1 19.9 26.4 40.6 G GGT 20.6 19.9 7.2 58.0 72.3 GGC 12.5 0 63.4 21.1 1.8 GGA 26.8 50.7 3.6 1.8 0 GGG 8.4 0 3.6 0 0 H CAT 13.7 12.7 14.5 8.8 0 CAC 6.3 3.6 10.9 12.3 21.1 I ATT 43.5 21.7 18.1 14.1 35.3 ATC 14.9 9.1 34.4 35.1 30.0 ATA 8.9 39.8 0 0 0 K AAA 56.2 63.4 12.7 35.1 3.5 AAG 17.7 5.4 23.6 28.1 58.2 L TTA 37.3 59.8 0 1.8 7.1 TTG 10.6 0 5.4 17.6 86.4 CTT 21.6 14.5 10.9 15.8 0 CTC 4.5 0 9.1 19.3 0 CTA 10.4 7.2 0 0 1.8 CTG 8.0 0 70.7 33.4 0 M ATG 25.7 27.2 27.2 21.1 22.9 N AAT 27.6 27.2 16.3 10.5 1.8 AAC 19.9 19.9 32.6 49.2 51.1 P CCU 13.9 7.2 5.4 10.5 0 CCC 2.2 0 21.7 3.5 0 CCA 12.0 18.1 1.8 3.5 45.9 CCG 6.7 1.8 14.5 29.9 0 Q CAA 28.0 29.0 3.6 1.8 38.8 CAG 11.7 0 29.0 15.8 0 R CGT 12.8 0 9.1 12.3 3.5 CGC 7.1 0 29.0 15.8 0 CGA 6.1 0 0 0 0 CGG 2.1 0 5.4 1.8 0 AGA 8.5 39.8 0 0 24.7

PAGE 106

93 Table 4-3. Continued. Frequency per Thousand Amino Acid Codon B. megaterium genome S. ventriculi pdc A. pasteurianus pdc Z. mobilis pdc S. cerevisiae pdc AGG 2.4 0 1.8 0 0 S TCT 16.7 7.2 1.8 5.3 35.3 TCC 4.4 0 19.9 14.1 19.4 TCA 15.7 32.6 7.2 1.8 0 TCG 5.0 0 7.2 0 0 AGT 9.9 12.7 0 5.3 0 AGC 11.2 12.7 19.9 15.8 1.8 T ACT 10.5 30.8 1.8 7.0 26.5 ACC 6.2 0 29.0 28.1 49.4 ACA 24.1 34.4 10.9 0 0 ACG 14.2 0 23.6 10.5 0 V GTT 25.0 43.5 12.7 38.7 31.7 GTC 8.2 0 23.6 33.4 40.6 GTA 27.3 36.2 7.2 0 0 GTG 12.5 0 25.4 5.3 0 W TGG 10.4 5.4 12.7 12.3 12.3 Y TAT 23.9 32.6 14.5 26.4 1.8 TAC 11.0 7.2 14.5 12.3 28.2 Stop TAA 2.4 1.8 0 0 3.5 TAG 0.4 0 0 1.8 0 TGA 0.5 0 1.8 0 0

PAGE 107

94 pET21d 5440 b ps 4000 3000 S. ventriculi pdc B. megaterium expression vector S. ventriculi pdc E. coli expression vector S. ventriculi pdc Ap Te t x ylR Pxyl p dc T7T 8000 6000 4000 2000 9584 bps pJAM420 Pxyl x ylR Ap X ma x ylA I Spe I 7000 6000 5000 4000 Te t 3000 1000 7929 bps pWH1520 f1 ori Ap ori lac I p T7 p dc T7T XbaI B sp EI 7000 6000 5000 2000 1000 7026 bps pJAM419 XhoI BspHI Ap ori lacI pT7 T7T f1 ori N coI X hoI 5000 4000 3000 2000 1000 Figure 4-1. Strategy used to construct plasmids for expression of S. ventriculi pdc in recombinant B. megaterium. A similar approach was used to generate plasmids for expression of Z. mobilis, A. pasteurianus, and S. cerevisiae pdc genes in B. megaterium. Abbreviations: Ap = Ampicillin Resistance, pT = T7 polymerase promoter, T7T = T7 polymerase promoter, lacI = lactose operon repressor, f1 = f1 origin of replication, ori = origin of replication, Te = tetracycline resistance, Pxyl = xylA promoter, and xylR = xylose repressor.

PAGE 108

95 1 2 3 4 5 6 kDa 97.4 66.2 45.0 31.0 21.5 Figure 4-2. PDC proteins synthesized in recombinant B. megaterium. After 3 h induction with 0.5% xylose, cell lysate (6 g) was separated by reducing SDS-PAGE and stained with Coomassie blue R-250. Lane 1) Molecular mass standards (5 g). Lanes 2-6 Cell lysate of B. megaterium WH320 transformed with plasmid vector pWH1520, pJAM420, pJAM430, pJAM432, and pJAM435, respectively. SvPDC (lane 3), ApPDC (lane 4), ZmPDC (lane 5), and ScPDC1 (lane 6) are indicated by arrowheads.

PAGE 109

96 0%10%20%30%40%50%60%70%80%90%100%ScSvApZm% Total RNA Figure 4-3. Levels of pdc-specific transcripts in recombinant B. megaterium. Transcript levels were measured in triplicate using real time quantitative reverse transcription. Abbreviations for genes expressed in recombinant B. megaterium are Sc (S. cerevisiae pdc1), Sv (S. ventriculi pdc), Ap (A. pasteurianus pdc), and Zm (Z. mobilis pdc).

PAGE 110

97 0%20%40%60%80%100%120%140%050100150200Time (min)% Labeled PDC Protein Figure 4-4. PDC protein stability in recombinant B. megaterium. Labeled PDC protein levels of B. megaterium strains grown without (ZmPDC, ; SvPDC, ) and with (ZmPDC, ; SvPDC, ) addition of chloramphenicol to the chase medium.

PAGE 111

98 CHAPTER 5 GENERAL DISCUSSION AND CONCLUSIONS The S. ventriculi pdc is the first pyruvate decarboxylase to be cloned from a Gram-positive bacterium. S. ventriculi PDC protein appears to share similar primary sequence structure to TPP-dependent enzymes and is highly related to the fungal PDC and eubacterial IPD enzymes. The close relationship of the S. ventriculi and fungal PDC structures is consistent with the similar biochemical properties of these enzymes. Both types of enzymes display substrate cooperativity with similar affinities for pyruvate. The structure and biochemistry of the S. ventriculi PDC, however, dramatically contrast with the only other bacterial PDC (Z. mobilis) that has been characterized. The Z. mobilis PDC is closely related to plants in primary structure; however, it is the only PDC enzyme known to display Michaelis-Menten kinetics. This study also demonstrates the synthesis of active, soluble S. ventriculi PDC protein in recombinant E. coli. Only two other genes, the Z. mobilis pdc and S. cerevisiae PDC1 genes, have been reported to synthesize PDC protein in recombinant bacteria (114, 115, 218). Of these, at least 50% of the S. cerevisiae PDC1 forms insoluble inclusions in E. coli and thus has not been useful in engineering bacteria for high-level ethanol production (218). Due to codon bias, accessory tRNA is essential for efficient production of S. ventriculi PDC in recombinant E. coli. However, the low G+C codon usage of the S. ventriculi pdc gene should broaden the spectrum of bacteria that can be engineered as hosts for high-level production of PDC protein and the engineering of homo-ethanol 98

PAGE 112

99 pathways (4). The S. ventriculi PDC is unique among previously characterized bacterial PDCs. This has enabled the identification of a new subfamily of PDC-like proteins from Gram-positive bacteria that will broaden the host range of future endeavors utilizing Gram-positive bacterial hosts. The SvPDC protein is poorly expressed in recombinant E. coli (133). Therefore, we reasoned that a host more similar to S. ventriculi might express this PDC at higher levels. B. megaterium was chosen as a host because it has several benefits over other Gram-positive expression systems. These include a xylose inducible expression vector and absence of alkaline proteases that are often responsible for degradation of foreign proteins (220, 221). Augmentation of the host, B. megaterium, with accessory tRNAs was not necessary for high-level SvPDC production. The SvPDC protein was more active when produced in B. megaterium compared to E. coli. The SvPDC protein produced in B. megaterium has a higher Vmax (98 U per mg protein) at RT than when produced by E. coli (66 U per mg protein). The SvPDC produced in B. megaterium is also more thermostable than the E. coli produced protein. Choosing the correct host appears to have affected the quality of SvPDC protein that was recovered. These results indicate that differences can occur in the biochemical properties of recombinant protein based on host. In this study, we discovered that the pH of the incubation buffer has an effect on the thermostability of SvPDC. Low pH stabilized SvPDC at higher temperatures. These results suggest that residues of SvPDC gain a charge between pH 5.0.5 that allows the tetramer conformation to remain stable at higher temperatures. This is an important

PAGE 113

100 discovery because it gives insight into residues that can be altered in future experiments in order to engineer SvPDC to be more thermostable at cytosolic pH. The portable production of ethanol (PET) operon used in E. coli consists of the pdc and adh genes from Zymomonas mobilis, a Gram-negative organism (24, 25, 129, 227). Past research to engineer a Gram-positive host for ethanol production has focused on using this PET operon, but these attempts have met with limited success (33-35, 228) primarily due to poor expression of the PDC. We have shown that SvPDC is expressed at high levels in B. megaterium, a Gram-positive host. Our construction and expression of the Gram-positive ethanol production operon using the SvPDC and G. stearothermophilus ADH has demonstrated that recombinant PDC and ADH production no longer limit ethanol production in Gram-positive biocatalysts. Our research shows that selection of host for recombinant production of proteins can affect the quality and stability of the recombinant protein. We have also demonstrated that SvPDC has qualities that make it unique among bacterial PDCs, including its substrate activation and elevated pH optimum. SvPDC is the only bacterial PDC that is not thermostable, but our results indicate that alteration of charged residues may facilitate the engineering of thermostable SvPDC variants. Lastly, we have created a Gram-positive ethanol production operon that will be useful in engineering future Gram-positive hosts for ethanol production. B. megaterium expression vectors were designed in such a way to transcribe all four pdc genes at similar rates by using the same xylA promoter, Shine-Dalgrano sequence, and T7 terminator. Using this approach, the S. ventriculi PDC was expressed at high levels in the recombinant Gram-positive host. The SvPDC protein levels and

PAGE 114

101 activity were at least 5-fold higher than when the Z. mobilis, A. pasteurianus, or S. cerevisiae PDC proteins were expressed. To assess the biological reason for these differences, quantitative reverse transcriptase PCR and pulse-chase experiments were performed. Similar levels of pdc-specific transcript and similar rates of PDC protein degradation were determined. Thus, in the Gram-positive host examined in this study, protein synthesis limited the production of PDC proteins from yeast and Gram-negative bacterial genes. It was previously demonstrated that addition of accessory tRNAs is necessary for enhancement of protein levels of SvPDC in E. coli by ten-fold (133). This is not the case when ApPDC and ZmPDC are expressed in E. coli. Both PDCs are produced at very high levels in this Gram-negative host without the addition of accessory tRNA. In B. megaterium, however, SvPDC is expressed at very high levels, while expression of ApPDC and ZmPDC is low. The results of the expression of the PDC proteins in E. coli and B. megaterium indicate that codon usage of the pdc genes is one of the primary factors influencing expression of these proteins in Gram-positive hosts (131, 133). Thus, this research has now identified a PDC that is expressed at high levels within a Gram-positive bacterial host. Codon usage has also been identified as a major factor to consider when attempting to produce recombinant PDC. Future efforts to engineer Gram-positive hosts for ethanol production now have a PDC available that has been proven to be expressed at high levels or alternatively to synthesize a pdc with codon usage that will lead to optimal expression in the host.

PAGE 115

102 LIST OF REFERENCES 1. MacDonald, T., G. Yowell, and M. McCormack 2001. US Ethanol Industry; Production Capacity OutlookCal ifornia Energy Commission. 2. Dien, B. S., R. J. Bothast, N. N. Nichols, and M. A. Cotta 2002. The US Corn Ethanol Industry: An Overview of Cu rrent Technology and Future Prospects. Int.Sugar J. 104 :204-213. 3. Wyman, C. E. 2001. Twenty Years of Trials, Tribulations, and Research Progress in Bioethanol Technology Selected Key Events Along the Way. Appl.Biochem.Biotechnol. 91-3 :5-21. 4. Ingram, L. O., H. C. Aldrich, A. C. Borges, T. B. Causey, A. Martinez, F. Morales, A. Saleh, S. A. Underwood, L. P. Yomano, S. W. York, J. Zaldivar, and S. Zhou 1999. Enteric Bacterial Catalysts for Fuel Ethanol Production. Biotechnol.Prog. 15 :855-866. 5. Bothast, R. J., N. N. Nichols, and B. S. Dien 1999. Fermentations With New Recombinant Organisms. Biotechnol.Prog. 15 :867-875. 6. Deverell, K. F. 1983. Ethanol-Production from Wood Hydrolysates Using Pachysolen tannophilus Biotechnol.Lett. 5 :475-480. 7. Neirinck, L., R. Maleszka, and H. Schneider 1982. Ethanol Production From Mixed Sugars by Pachysolen tannophilus. Biotechnol.Bioeng.Symp. 12 :161-169. 8. Neirinck, L., R. Maleszka, and H. Schneider 1982. Alcohol Production from Sugar Mixtures by Pachysolen tannophilus Biotechnol.Bioeng. 161-169. 9. Slininger, P. J., R. J. Bothast, J. E. Vancauwenberge, and C. P. Kurtzman 1982. Conversion of D-Xylose to Ethanol by the Yeast Pachysolen tannophilus Biotechnol.Bioeng. 24 :371-384. 10. Dupreez, J. C., M. Bosch, and B. A. Prior 1986. The Fermentation of Hexose and Pentose Sugars by Candida shehatae and Pichia stipitis Appl.Microbiol.Biotechnol. 23 :228-233. 11. Dupreez, J. C., M. Bosch, and B. A. Prior 1986. Xylose Fermentation by Candida shehatae and Pichia stipitis Effects of pH, Temperature and Substrate Concentration. Enzyme Microb.Technol. 8 :360-364. 102

PAGE 116

103 12. Delgenes, J. P., R. Moletta, and J. M. Navarro 1988. Continuous Production of Ethanol from A Glucose, Xylose and Ar abinose Mixture by A Flocculant Strain of Pichia stipitis Biotechnol.Lett. 10 :725-730. 13. Delgenes, J. P., R. Moletta, and J. M. Navarro 1988. The Ethanol Tolerance of Pichia stipitis Y-7124 Grown on A D-Xylose, D-Glucose and L-Arabinose Mixture. J.Ferment.Technol. 66 :417-422. 14. Delgenes, J. P., R. Moletta, and J. M. Navarro 1988. Fermentation of DXylose, D-Glucose and L-Arabinose Mixture by Pichia stipitis Y-7124 Sugar Tolerance. Appl.Mic robiol.Biotechnol. 29 :155-161. 15. Jeffries, T. W. and H. K. Sreenath 1988. Fermentation of Hemicellulosic Sugars and Sugar Mixtures by Candida shehatae Biotechnol.Bioeng. 31 :502-506. 16. Dien, B. S., C. P. Kurtzman, B. C. Saha, and R. J. Bothast 1996. Screening for L-arabinose Fermenting Yeas ts. Appl.Biochem.Biotechnol. 57-8 :233-242. 17. Sarthy, A. V., B. L. Mcconaughy, Z. Lobo, J. A. Sundstrom, C. E. Furlong, and B. D. Hall 1987. Expression of the Escherichia coli Xylose Isomerase Gene in Saccharomyces cerevisiae Appl.Environ.Microbiol. 53 :1996-2000. 18. Gong, C. S., L. F. Chen, M. C. Flickinger, L. C. Chiang, and G. T. Tsao 1981. Production of Ethanol from D-Xylose by Using D-Xylose Isomerase and Yeasts. Appl.Environ.Microbiol. 41 :430-436. 19. Amore, R., M. Wilhelm, and C. P. Hollenberg 1989. The Fermentation of Xylose An Analysis of the Expression of Bacillus and Actinoplanes Xylose Isomerase Genes in Yeast. Appl.Microbiol.Biotechnol. 30 :351-357. 20. Moes, C. J., I. S. Pretorius, and W. H. vanZyl 1996. Cloning and expression of the Clostridium thermosulfurogenes D-xylose isomerase gene (xylA) in Saccharomyces cerevisiae Biotechnol.Lett. 18 :269-274. 21. Walfridsson, M., X. M. Bao, M. Anderlund, G. Lilius, L. Bulow, and B. HahnHagerdal 1996. Ethanolic Fermentation of Xylose with Saccharomyces cerevisiae Harboring the Thermus thermophilus xylA gene, Which Expresses an Active Xylose (glucose) Isomer ase. Appl.Environ.Microbiol. 62 :4648-4651. 22. Otero, R. R. C., F. C. Wahlbom, W. H. van Zyl, and B. Hahn-Hagerdal 2002. A Physiological Comparison Between an Industrial, Recombinant, XyloseUtilizing Saccharomyces sp and Pichia stipitis Yeast 19 :284. 23. Ho, N. W. Y., Z. D. Chen, and A. P. Brainard 1998. Genetically Engineered Sacccharomyces Yeast Capable of Effective Cofermentation of Glucose and Xylose. Appl.Environ.Microbiol. 64 :1852-1859.

PAGE 117

104 24. Ingram, L. O., T. Conway, D. P. Clark, G. W. Sewell, and J. F. Preston 1987. Genetic Engineering of Ethanol Production in Escherichia coli Appl.Environ.Microbiol. 53 :2420-2425. 25. Ohta, K., D. S. Beall, J. P. Mejia, K. T. Shanmugam, and L. O. Ingram 1991. Metabolic Engineering of Klebsiella oxytoca M5A1 for Ethanol Production from Xylose and Glucose. Appl.Environ.Microbiol. 57 :2810-2815. 26. Beall, D. S. and L. O. Ingram 1993. Genetic-Engineering of Soft-Rot Bacteria for Ethanol-Production from Li gnocellulose. J.Ind.Microbiol. 11 :151-155. 27. Dell, DM, Grunden, A, Shanmugam, KT, and Ingram LO Genetic Engineering of Enterobacter cloacae AC1 for Ethanol Production. Abst.Am.Soc.Microbiol.Gen.Meeting O-40, 426. 1997. 28. Alterthum, F. and L. O. Ingram 1989. Efficient Ethanol Production from Glucose, Lactose, and Xylose by Recombinant Escherichia coli Appl.Environ.Microbiol. 55 :1943-1948. 29. Ohta, K., F. Alterthum, and L. O. Ingram 1990. Effects of Environmental Conditions on Xylose Fermentation by Recombinant Escherichia coli Appl.Environ.Microbiol. 56 :463-465. 30. Bucher, M., R. Braendle, and C. Kuhlemeier 1994. Ethanolic Fermentation in Transgenic Tobacco Expressing Zymomonas mobilis Pyruvate Decarboxylase. EMBO J. 13 :2755-2763. 31. Tadege, M., R. Brandle, and C. Kuhlemeier 1998. Anoxia Tolerance in Tobacco Roots: Effect of Overexpressi on of Pyruvate Decarboxylase. Plant J. 14 :327-335. 32. Deng, M. D. and J. R. Coleman 1999. Ethanol Synthesis by Genetic Engineering in Cyanobacter ia. Appl.Environ.Microbiol. 65 :523-528. 33. Barbosa, M. F. S. and L. O. Ingram 1994. Expression of the Zymomonas mobilis alcohol dehydrogenase II ( adhB ) and pyruvate decarboxylase ( pdc ) genes in Bacillus Curr.Microbiol. 28 :279-282. 34. Gold, R. S., M. M. Meagher, S. Tong, R. W. Hutkins, and T. Conway 1996. Cloning and expression of the Zymomonas mobilis "production of ethanol" genes in Lactobacillus casei Curr.Microbiol. 33 :256-260. 35. Nichols, N. N., B. S. Dien, and R. J. Bothast 2003. Engineering Lactic Acid Bacteria with Pyruvate Decarboxylase and Alcohol Dehydrogenase Genes for Ethanol Production from Zymomonas mobilis J.Ind.Microbiol.Biotechnol. 30 :315-321.

PAGE 118

105 36. Neuberg, C. and J. Hirsch 1921. Biochem Zeitschr 115 :282-310. as sited in reference number 69. 37. Neuberg, C. and H. Ohle 1922. Biochem Zeitschr 127 :327-339. as sited in reference number 69. 38. Neuberg, C. and L. Lieberman 1921. Biochem Zeitschr 121 :322-325. as sited in reference number 69. 39. Hildebrandt, G and Klavehn, W [U.S. Patent Num. 1,956,950]. 1934. as sited in reference number 69. 40. Hildebrandt, G and Klavehn, W [German Patent Num. 548 459]. 1932. as sited in reference number 69. 41. Astrup, A., L. Breum, S. Toubro, P. Hein, and F. Quaade 1992. The Effect and Safety of An Ephedrine Caffein e Compound Compared to Ephedrine, Caffeine and Placebo in Obese Subjects on An Energy Restricted Diet: A DoubleBlind Trial. Int.J.Obesity 16 :269-277. 42. Astrup, A., B. Buemann, N. J. Christ ensen, S. Toubro, G. Thorbek, O. J. Victor, and F. Quaade 1992. The Effect of Ephedrine Caffeine Mixture on Energy-Expenditure and Body-Compos ition in Obese Women. Metab.Clin.Exp. 41 :686-688. 43. Singer, T. and J. Pensky 1951. Acetoin Synthesis by Highly Purified AlphaCarboxylase. Arch.Biochem.Biophys. 31 :457-459. 44. Singer, T. P. and J. Pensky 1952. Isolation and Properties of the AlphaCarboxylase of Wheat Germ. J.Biol.Chem. 196 :375-388. 45. Dirscherl, W. 1931. Hoppe-Seyler's Z.Physiol.Chem. 201 :47-77. as sited in reference number 69. 46. Langenbeck, W., H. Wrede, and W. Schlockermann 1934. Hoppe-Seyler's Z.Physiol.Chem. 227 :263. as sited in reference number 69. 47. Hbner, G., S. Knig, A. Schellenberger, and M. H. Koch 1990. An X-ray Solution Scattering Study of the Cofact or and Activator Induced Structural Changes in Yeast Pyruvate Deca rboxylase (PDC). FEBS Lett. 266 :17-20. 48. Barman, T. 1969. Pyruvate Dehydrogenase, p. 701. In Enzyme Handbook. Springer-Verlag, New York. 49. Juni, E. 1961. Evidence for A 2-Site Mechan ism for Decarboxylation of AlphaKeto Acids by Alpha-Carboxylase. J.Biol.Chem. 236 :2302-&.

PAGE 119

106 50. Ullrich, J., J. H. Wittorf, and C. J. Gubler 1966. Molecular Weight and Coenzyme Content of Pyruvate De carboxylase from Brewer's Yeast. Biochim.Biophys.Acta 113 :595-604. 51. Crout, D. H. G., H. Dalton, D. W. Hutchinson, and M. Miyagoshi 1991. Studies on Pyruvate Decarboxylase Ac yloin Formation from Aliphatic, Aromatic and Heterocyclic Aldehyd es. J.Chem.Soc.-Perk.Trans. 1329-1334. 52. Kren, V., D. H. G. Crout, H. Dalton, D. W. Hutchinson, W. Konig, M. M. Turner, G. Dean, and N. Thomson 1993. Pyruvate Decarboxylase A New Enzyme for the Production of Ac yloins by Biotransformation. J.Chem.Soc.Chem.Commun. 341-343. 53. Zwickau: Isis-Chemie KG [German Patent Num. 1,543,691]. 1966. 54. Groger, D., SCHMAUDE.HP, and K. Mothes 1966. Untersuchungen Uber Die Gewinnung Von I-Phenylacetylcar binol. Z.Allg.Mikrobiol. 6 :275-297. 55. Vojtisek, V. and J. Netrval 1982. Effect of Pyruvate Decarboxylaxe Activity and of Pyruvate Concentration on the Production of 1-Hydroxy-1Phenylpropanone in Saccharomyces carlsbergensis Folia Microbiol. 27 :173-177. 56. Wang, B., H. Shin, and P. L. Rogers 1994. p. 249. In Better Living Through Innovative Biochemical Engineering. Continental Press, Singapore. 57. Csuk, R. and B. I. Glanzer 1991. Bakers-Yeast Mediated Transformations in Organic-Chemistry. Chem.Rev. 91 :49-97. 58. Nikolova, P. and O. P. Ward 1991. Production of L-Phenylacetyl Carbinol by Biotransformation Product and By-Produc t Formation and Activities of the Key Enzymes in Wild-Type and Adh Isoenzyme Mutants of Saccharomyces cerevisiae Biotechnol.Bioeng. 38 :493-498. 59. Long, A. and O. P. Ward 1989. Biotransformation of Benzaldehyde by Saccharomyces cerevisiae Characterization of the Fermentation and Toxicity Effects of Substrates an d Products. Biotechnol.Bioeng. 34 :933-941. 60. Smith, P. F. and D. Hendlin 1953. Mechanism of Phenylacetylcarbinol Synthesis by Yeast. J.Bacteriol. 65 :440-445. 61. Becvarova, H. and O. Hanc 1963. Production of Phenylacetylcarbinol by Various Yeast Species. Folia Microbiol. 8 :42-&. 62. Voets, J. P., E. J. Vandamme, and C. Vlerick 1973. Some Aspects of Phenylacetylcarbinol Biosynthesis by Saccharomyces cerevisiae Z.Allg.Mikrobiol. 13 :355-366.

PAGE 120

107 63. Agarwal, S. C., S. K. Basu, V. C. Vora, J. R. Mason, and S. J. Pirt 1987. Studies on the Production of L-Acetyl Phenyl Carbinol by Yeast Employing Benzaldehyde As Precursor. Biotechnol.Bioeng. 29 :783-785. 64. Long, A. and O. P. Ward 1989. Biotransformation of Aromatic-Aldehydes by Saccharomyces cerevisiae Investigation of Reactio n-Rates. J.Ind.Microbiol. 4 :49-53. 65. Bringer-Meyer, S. and H. Sahm 1988. Acetoin and Phenylacetylcarbinol Formation by the Pyruvate Decarboxylases of Zymomonas mobilis and Saccharomyces carlsbergensis. Biocatalysis 1 :321-331. 66. Shin, H. S. and P. L. Rogers 1995. Biotransformation of Benzeldehyde to LPhenylacetylcarbinol, an Intermedia te in L-Ephedrine Production, by Immobilized Candida utilis Appl.Microbiol.Biotechnol. 44 :7-14. 67. Shin, H. S. and P. L. Rogers 1996. Production of L-phenylacetylcarbinol (LPAC) from Benzaldehyde Using Part ially Purified Pyruvate Decarboxylase (PDC). Biotechnol.Bioeng. 49 :52-62. 68. Pohl, M. 1997. Protein Design on Pyruvate Decarboxylase (PDC) by SiteDirected Mutagenesis. App lication to Mechanistical Investigations, and Tailoring PDC for the Use in Organic Synt hesis. Adv.Biochem.Eng Biotechnol. 58 :15-43. 69. Iding, H., P. Siegert, K. Mesch, and M. Pohl 1998. Application of -keto Acid Decarboxylases in Biotransformations. Biochim.Biophys.Acta 1385 :307-322. 70. Bruhn, H., M. Pohl, J. Grotzinger, and M. R. Kula 1995. The Replacement of Trp392 by Alanine Influences the Decarboxylase/Carboligase Activity and Stability of Pyruvate Decarboxylase from Zymomonas mobilis Eur.J.Biochem. 234 :650-655. 71. Goetz, G., P. Iwan, B. Hauer, M. Breuer, and M. Pohl 2001. Continuous Production of (R)-Phenylacetylcarbinol in an Enzyme-Membrane Reactor Using a Potent Mutant of Pyruvate Decarboxylase from Zymomonas mobilis Biotechnol.Bioeng. 74 :317-325. 72. Iwan, P., G. Goetz, S. Schmitz, B. Hauer, M. Breuer, and M. Pohl 2001. Studies on the Continuous Production of (R)-(-)-Phenylacetylcarbinol in an Enzyme-Membrane Reactor. J.Mol.Catal., B Enzym. 11 :387-396. 73. Alvarez, M. E., A. L. Rosa, E. D. Temp orini, A. Wolstenholme, G. Panzetta, L. Patrito, and H. J. Maccioni 1993. The 59-kDa Polypept ide Constituent of 810-nm Cytoplasmic Filaments in Neurospora crassa is a Pyruvate Decarboxylase. Gene 130 :253-258.

PAGE 121

108 74. Sanchis, V., I. Vinas, I. N. Roberts, D. J. Jeenes, A. J. Watson, and D. B. Archer 1994. A Pyruvate Decarboxylase Gene from Aspergillus parasiticus FEMS Microbiol.Lett. 117 :207-210. 75. Lockington, R. A., G. N. Borlace, and J. M. Kelly 1997. Pyruvate Decarboxylase and Anaerobic Survival in Aspergillus nidulans Gene 191 :61-67. 76. Knig, S. 1998. Subunit Structure, Function a nd Organisation of Pyruvate Decarboxylases from Various Or ganisms. Biochim.Biophys.Acta 1385 :271-286. 77. Gancedo, C. and R. Serrano 1989. Energy Yielding Metabolism, p. 205. In A. Rose and J. Harrisin (eds.), The Yeas t vol. 3. Academic Press, New York. 78. Knig, S., D. Svergun, M. H. Koch, G. Hbner, and A. Schellenberger 1992. Synchrotron Radiation Solution X-ray S cattering Study of the pH Dependence of the Quaternary Structure of Yeast Py ruvate Decarboxylase. Biochemistry 31 :8726-8731. 79. Kuo, D. J., G. Dikdan, and F. Jordan 1986. Resolution of Brewers' Yeast Pyruvate Decarboxylase into Two Isozymes. J.Biol.Chem. 261 :3316-3319. 80. Sieber, M., S. Konig, G. Hubner, and A. Schellenberger 1983. A Rapid Procedure for the Preparation of Highl y Purified Pyruvate Decarboxylase from Brewer's Yeast. Biomed.Biochim.Acta 42 :343-349. 81. Zehender, H., D. Trescher, and J. Ullrich 1987. Improved Purification of Pyruvate Decarboxylase from Wheat Germ Its Partial Characterisation and Comparison with the Yeast Enzyme. Eur.J.Biochem. 167 :149-154. 82. Zehender, H. and J. Ullrich 1985. Amino Acid Composition of and -chains of Yeast and Wheat Germ Pyruvate Decarboxylase. FEBS Lett. 180 :51-54. 83. Farrenkopf, B. and F. Jordan 1992. Resolution of Brewers Yeast Pyruvate Decarboxylase into Multiple Isoforms With Similar Subunit Structure and Activity Using High-Performance Liquid Ch romatography. Protein Express.Purif. 3 :101-107. 84. Dyda, F., W. Furey, S. Swaminathan, M. Sax, B. Farrenkopf, and F. Jordan 1993. Catalytic Centers in the Thiamin Di phosphate Dependent Enzyme Pyruvate Decarboxylase at 2.4resolution. Biochemistry 32 :6165-6170. 85. Killenberg-Jabs, M., S. Knig, S. Hohmann, and G. Hbner 1996. Purification and Characterisation of th e Pyruvate Decarboxylase from a Haploid Strain of Saccharomyces cerevisiae Biol.Chem.Hoppe Seyler 377 :313-317.

PAGE 122

109 86. Zeng, X., B. Farrenkopf, S. Hohmann, F. Dyda, W. Furey, and F. Jordan 1993. Role of Cysteines in the Activati on and Inactivation of Brewers' Yeast pyruvate decarboxylase investigated with a PDC1-PDC6 fusion protein. Biochemistry 32 :2704-2709. 87. Baburina, I., Y. Gao, Z. Hu, F. Jordan, S. Hohmann, and W. Furey 1994. Substrate Activation of Brewers' Yeas t Pyruvate Decarboxylas e is Abolished by Mutation of Cysteine 221 to Serine. Biochemistry 33 :5630-5635. 88. Baburina, I., G. Dikdan, F. Guo, G. I. Tous, B. Root, and F. Jordan 1998. Reactivity at the Substrate Activation S ite of Yeast Pyruvate Decarboxylase: Inhibition by Distorti on of Domain Interactions. Biochemistry 37 :1245-1255. 89. Baburina, I., H. Li, B. Bennion, W. Furey, and F. Jordan 1998. Interdomain Information Transfer During Substr ate Activation of Yeast Pyruvate Decarboxylase: the Interaction Between Cysteine 221 and Histidine 92. Biochemistry 37 :1235-1244. 90. Wei, W., M. Liu, and F. Jordan 2002. Solvent Kinetic Isotope Effects Monitor Changes in Hydrogen Bonding at the Active Center of Yeast Pyruvate Decarboxylase Concomitant with Substrate Activation: The Substituent at Position 221 Can Control the Stat e of Activation. Biochemistry 41 :451-461. 91. Lu, G., D. Dobritzsch, S. Bauman n, G. Schneider, and S. Knig 2000. The Structural Basis of Substrate Activat ion in Yeast Pyruva te Decarboxylase. A Crystallographic and Kinetic Study. Eur.J.Biochem. 267 :861-868. 92. Schaaff, I., J. B. Green, D. Gozalbo, and S. Hohmann 1989. A Deletion of the PDC1 Gene for Pyruvate Decarboxylase of Y east Causes a Different Phenotype than Previously Isolated Point Mutations. Curr.Genet. 15 :75-81. 93. Schmitt, H. D. and F. K. Zimmermann 1982. Genetic-Analysis of the Pyruvate Decarboxylase Reaction in Yeast Glycolysis. J.Bacteriol. 151 :1146-1152. 94. Seeboth, P. G., K. Bohnsack, and C. P. Hollenberg 1990. pdc1o Mutants of Saccharomyces cerevisiae Give Evidence for an Additional Structural PDC Gene: Cloning of PDC5 a Gene Homologous to PDC1 J.Bacteriol. 172 :678-685. 95. Hohmann, S. 1991. PDC6 a Weakly Expressed Pyruvate Decarboxylase Gene from Yeast, is Activated When Fused Spontaneously Under the Control of the PDC1 Promoter. Curr.Genet. 20 :373-378. 96. Hohmann, S. 1991. Characterization of PDC6 a Third Structural Gene for Pyruvate Decarboxylase in Saccharomyces cerevisiae J.Bacteriol. 173 :79637969.

PAGE 123

110 97. Hohmann, S. 1993. Characterisation of PDC2 a Gene Necessary for High Level Expression of Pyruvate Decar boxylase Structural Genes in Saccharomyces cerevisiae Mol.Gen.Genet. 241 :657-666. 98. Wright, A. P., H. L. Png, and B. S. Hartley 1989. Identification, Cloning and Characterisation of a New Gene Requir ed for Full Pyruvate Decarboxylase Activity in Saccharomyces cerevisiae Curr.Genet. 15 :171-175. 99. Kellermann, E., P. G. Seeboth, and C. P. Hollenberg 1986. Analysis of the Primary Structure and Promoter Func tion of a Pyruvate Decarboxylase Gene ( PDC1 ) from Saccharomyces cerevisiae Nucleic Acids Res. 14 :8963-8977. 100. Butler, G. and D. J. McConnell 1988. Identification of an Upstream Activation Site in the Pyruvate Deca rboxylase Structural Gene ( PDC1 ) of Saccharomyces cerevisiae Curr.Genet. 14 :405-412. 101. Kellermann, E. and C. P. Hollenberg 1988. The Glucose-and EthanolDependent Regulation of PDC1 from Saccharomyces cerevisiae are Controlled by Two Distinct Promoter Regions. Curr.Genet. 14 :337-344. 102. Hohmann, S. and H. Cederberg 1990. Autoregulati on May Control the Expression of Yeast Pyruvate Decarboxylase Structural Genes PDC1 and PDC5 Eur.J.Biochem. 188 :615-621. 103. Arjunan, P., T. Umland, F. Dyda, S. Swaminathan, W. Furey, M. Sax, B. Farrenkopf, Y. Gao, D. Zhang, and F. Jordan 1996. Crystal Structure of the Thiamin Diphosphate-Dependent Enzyme Pyruvate Decarboxylase from the Yeast Saccharomyces cerevisiae at 2.3 resolution. J.Mol.Biol. 256 :590-600. 104. Bianchi, M. M., L. Tizzani, M. Destru elle, L. Frontali, and M. WesolowskiLouvel 1996. The 'Petite-Negative' Yeast Kluyveromyces lactis Has a Single Gene Expressing Pyruvate Decarb oxylase Activity. Mol.Microbiol. 19 :27-36. 105. Krieger, F., M. Spinka, R. Go lbik, G. Hubner, and S. Konig 2002. Pyruvate Decarboxylase from Kluyveromyces lactis An Enzyme With an Extraordinary Substrate Activation Behaviour. Eur.J.Biochem. 269 :3256-3263. 106. Holloway, P. and R. E. Subden 1994. The Nucleotide Sequence and Initial Characterization of Pyruvate Decarboxylase from the yeast Hanseniaspora uvarum Yeast 10 :1581-1589. 107. Neuser, F., H. Zorn, U. Richter, and R. G. Berger 2000. Purification, Characterisation and cDNA Sequencing of Pyruvate Decarboxylase from Zygosaccharomyces bisporus Biol.Chem. 381 :349-353. 108. Holloway, P. and R. E. Subden 1993. The Isolation and Nucleotide Sequence of the Pyruvate Decarboxylase Gene from Kluyveromyces marxianus Curr.Genet. 24 :274-277.

PAGE 124

111 109. Lu, P., B. P. Davis, and T. W. Jeffries 1998. Cloning and Characterization of Two Pyruvate Decarboxylase Genes from Pichia stipitis CBS 6054. Appl.Environ.Microbiol. 64 :94-97. 110. Dawes, E. A., D. W. Ribbons, and P. J. Large 1966. The Route of Ethanol Formation in Zymomonas mobilis Biochem.J. 98 :795-803. 111. Hoppner, T. C. and H. W. Doelle 1983. Purification and Ki netic Characteristics of Pyruvate Decarboxylase and Ethanol Dehydrogenase from Zymomonas mobilis in Relation to Ethanol Production. Eur.J.Appl.Micr obiol.Biotechnol. 17 :152-157. 112. Bringer-Meyer, S., K.-L. Schimz, and H. Sahm 1986. Pyruvate Decarboxylase from Zymomonas mobilis Isolation and Partial Char acterization. Arch.Microbiol. 146 :105-110. 113. Neale, A. D., R. K. Scopes, R. E. Wettenhall, and N. J. Hoogenraad 1987. Pyruvate Decarboxylase of Zymomonas mobilis : Isolation, Properties, and Genetic Expression in Escherichia coli J.Bacteriol. 169 :1024-1028. 114. Bra, B. and H. Sahm 1986. Cloning and Expression of the Structural Gene for Pyruvate Decarboxylase of Zymomonas mobilis in Escherichia coli Arch.Microbiol. 144 :296-301. 115. Conway, T., Y. A. Osman, J. I. Konnan, E. M. Hoffmann, and L. O. Ingram 1987. Promoter and Nucleotide Sequences of the Zymomonas mobilis Pyruvate Decarboxylase. J.Bacteriol. 169 :949-954. 116. Neale, A. D., R. K. Scopes, R. E. Wettenhall, and N. J. Hoogenraad 1987. Nucleotide Sequence of the Pyruvate Decarboxylase Gene from Zymomonas mobilis Nucleic Acids Res. 15 :1753-1761. 117. Dobritzsch, D., S. Knig, G. Schneider, and G. Lu 1998. High Resolution Crystal Structure of Pyr uvate Decarboxylase from Zymomonas mobilis Implications for Substrate Activation in Pyruvate Decarboxylases. J.Biol.Chem. 273 :20196-20204. 118. Diefenbach, R. J., J. M. Candy, J. S. Mattick, and R. G. Duggleby 1992. Effects of Substitution of Aspartate440 and Tryptophan-487 in the Thiamin Diphosphate Binding Region of Py ruvate Decarboxylase from Zymomonas mobilis FEBS Lett. 296 :95-98. 119. Candy, J. M., J. Koga, P. F. Nixon, and R. G. Duggleby 1996. The Role of Residues Glutamate-50 and Phenylalanine-496 in Zymomonas mobilis Pyruvate Decarboxylase. Biochem.J. 315 :745-751. 120. Schenk, G., F. J. Leeper, R. England, P. F. Nixon, and R. G. Duggleby 1997. The Role of His113 and His114 in Pyruvate Decarboxylase from Zymomonas mobilis Eur.J.Biochem. 248 :63-71.

PAGE 125

112 121. Candy, J. M. and R. G. Duggleby 1998. Structure and Prope rties of Pyruvate Decarboxylase and Site-Directed Mutagenesis of the Zymomonas mobilis Enzyme. Biochim.Biophys.Acta 1385 :323-338. 122. Chang, A. K., P. F. Nixon, and R. G. Duggleby 1999. Aspartate-27 and Glutamate-473 are Involved in Catalysis by Zymomonas mobilis Pyruvate Decarboxylase. Biochem.J. 339 :255-260. 123. Pohl, M., P. Siegert, K. Mesch H. Bruhn, and J. Grotzinger 1998. Active Site Mutants of Pyruvate Decarboxylase from Zymomonas mobilis --a Site-Directed Mutagenesis Study of L112, I472, I4 76, E473, and N482. Eur.J.Biochem. 257 :538-546. 124. Chang, A. K., P. F. Nixon, and R. G. Duggleby 2000. Effects of Deletions at the Carboxyl Terminus of Zymomonas mobilis Pyruvate Decarboxylase on the Kinetic Properties and Substr ate Specificity. Biochemistry 39 :9430-9437. 125. Wu, Y. G., A. K. Chang, P. F. Nixon, W. Li, and R. G. Duggleby 2000. Mutagenesis at Asp27 of Pyruvate Decarboxylase from Zymomonas mobilis Effect on its Ability to Form Acetoin and Acetolactate. Eur.J.Biochem. 267 :64936500. 126. Huang, C. Y., A. K. Chang, P. F. Nixon, and R. G. Duggleby 2001. SiteDirected Mutagenesis of the Ionizab le Groups in the Active Site of Zymomonas mobilis Pyruvate Decarboxylase: Effect on Activity and pH Dependence. Eur.J.Biochem. 268 :3558-3565. 127. Arfman, N., V. Worrell, and L. O. Ingram 1992. Use of the tac Promoter and lacIq for the Controlled Expression of Zymomonas mobilis Fermentative Genes in Escherichia coli and Zymomonas mobilis J.Bacteriol. 174 :7370-7378. 128. Wood, B. E. and L. O. Ingram 1992. Ethanol Producti on From Cellobiose, Amorphous Cellulose, and Crystalline Cellulose by Recombinant Klebsiella oxytoca Containing Chromosomally Integrated Zymomonas mobilis Genes for Ethanol Production and Plasmids Expressi ng Thermostable Cellulase Genes from Clostridium thermocellum Appl.Environ.Microbiol. 58 :2103-2110. 129. Ingram, L. O., P. F. Gomez, X. Lai, M. Moniruzzaman, B. E. Wood, L. P. Yomano, and S. W. York 1998. Metabolic Engineering of Bacteria for Ethanol Production. Biotechnol.Bioeng. 58 :204-214. 130. Raj, K. C., L. O. Ingram, and J. A. Maupin-Furlow 2001. Pyruvate Decarboxylase: a Key Enzyme for the Ox idative Metabolism of Lactic Acid by Acetobacter pasteurianus Arch.Microbiol. 176 :443-451.

PAGE 126

113 131. Raj, K. C., L. A. Talarico, L. O. Ingram, and J. A. Maupin-Furlow 2002. Cloning and Characterization of the Zymobacter palmae Pyruvate Decarboxylase Gene (pdc) and Comparison to Bacteria l Homologues. Appl.Environ.Microbiol. 68 :2869-2876. 132. Lowe, S. E. and J. G. Zeikus 1992. Purification and Characterization of Pyruvate Decarboxylase from Sarcina ventriculi J.Gen.Microbiol. 138 :803-807. 133. Talarico, L. A., L. O. Ingram, and J. A. Maupin-Furlow 2001. Production of the Gram-Positive Sarcina ventriculi Pyruvate Decarboxylase in Escherichia coli Microbiology 147 :2425-2435. 134. Davies, D. D., S. Grego, and P. Kenworthy 1974. The Control of the Production of Lactate and Ethanol by Higher Plants. Planta 118 :297-310. 135. Wignarajah, K. and H. Greenway 1976. Effect of Anaerobiosis on Activities of Alcohol Dehydrogenase and Pyruva te Decarboxylase in Roots of Zea mays New Phytol. 77 :575-584. 136. Lee, T. C. and P. J. Langston-Unkefer 1985. Pyruvate Decarboxylase from Zea mays L. I. Purification and Partial Ch aracterization from Mature Kernals and Anaerobically Treated Roots. Plant Physiol. 79 :242-247. 137. Langston-Unkefer, P. J. and T. C. Lee 1985. Pyruvate Decarboxylase from Zea mays L. 2. Examination of Hysteretic Kinetics. Plant Physiol. 79 :436-440. 138. Leblov, S. and J. Valik 1980. Partial Characteri zation of Pyruvate Decarboxylase Isolated from Germinating Pea Seeds. Aust.J.Plant Physiol. 7 :3539. 139. Knig, S., D. I. Svergun, V. V. Volkov, L. A. Feigin, and M. H. Koch 1998. Small-Angle X-ray Solution-Scatteri ng Studies on Ligand-Induced Subunit Interactions of the Thiamine Dipho sphate Dependent Enzyme Pyruvate Decarboxylase from Different Organisms. Biochemistry 37 :5329-5334. 140. Dietrich, A. and S. Knig 1997. Substrate Activation Behaviour of Pyruvate Decarboxylase from Pisum sativum cv. Miko. FEBS Lett. 400 :42-44. 141. Leblov, S. and J. Valik 1981. The Effect of Metals on Isolated Pea Pyruvate Decarboxylase. Biolgia Plantarum (Praha) 23 :81-85. 142. Mcke, U., S. Knig, and G. Hbner 1995. Purification and Characterisation of Pyruvate Decarboxylase from Pea Seeds ( Pisum sativum cv. Miko). Biol.Chem.Hoppe Seyler 376 :111-117.

PAGE 127

114 143. Mcke, U., T. Wohlfarth, U. Fiedler, H. Bumlein, K. P. Rcknagel, and S. Knig 1996. Pyruvate Decarboxylase from Pisum sativum Properties, Nucleotide and Amino Acid Sequences. Eur.J.Biochem. 237 :373-382. 144. Kirschner, J. and JM. Miller 1957. Volatile Wate r-Soluble and Oil Constituents of Valencia Orange Juice. J.Agric.Food Chem. 5 :283. 145. Ahmed, EM, Dennison, RA, and Shaw, PE Flavor Enhancing Potential of Selected Orange Oil and Essence Com ponents. 10-10-1973. Winter Haven, FL. USDA Citrus Chemistry a nd Technology Conference. 146. Roe, B. and J. H. Bruemmer 1974. Enzyme-Mediated Aldehyde Change in Orange Juice. J.Agri.Food Chem. 22 :285-288. 147. Raymond, W. R., J. B. Hostettl er, K. Assar, and C. Varsel 1979. Orange Pyruvate Decarboxylase: Isolation a nd Mechanistic Studies. J.Food Sci. 44 :777781. 148. Oba, K. and I. Uritani 1975. Purification and Charac terization of Pyruvate Decarboxylase from Sweet Potato Roots. J.Biochem (Tokyo) 77 :1205-1213. 149. ba, K. and I. Uritani 1982. Pyruvate Decarboxylase from Sweet Potato Roots. Methods Enzymol. 90 Pt E :528-532. 150. Huang, Y. H., D. H. Picha, and A. W. Kilili 2002. Atmospheric Oxygen Level Influences Alcohol Dehydrogenase and Py ruvate Decarboxylase Activities in Sweetpotato Roots. J.Plant Physiol. 159 :129-136. 151. Balla, H. and J. Ullrich 1980. Wheat Germ Pyruvate Decarboxylase Improved Purification and Properties in Compar ison With the Yeast Enzyme. Hoppe Seylers.Z.Physiol Chem. 361 :1265. 152. Kluger, R., G. Gish, and G. Kauffman 1984. Interaction of Thiamin Diphosphate and Thiamin Thiazolone Diphosphate with Wheat-Germ Pyruvate Decarboxylase. J.Biol.Chem. 259 :8960-8965. 153. Ullrich, J. 1982. Structure-Function Relationshi ps in Pyruvate Decarboxylase of Yeast and Wheat Germ. Ann.N.Y.Acad.Sci. 378 :287-305. 154. Davies, D. D. and H. Asker 1985. The Enzymatic D ecarboyxlation of Hydroxypyruvate Associated with Purified Pyruvate Decarb oxylase from Wheat Germ. Phytochemistry 24 :231-234. 155. Rivoal, J., B. Ricard, and A. Pradet 1990. Purification and Partial Characterization of Pyr uvate Decarboxylase from Oryza sativa L. Eur.J.Biochem. 194 :791-797.

PAGE 128

115 156. Hossain, M. A., J. D. McGee, A. Grover, E. S. Dennis, W. J. Peacock, T. K. Hodges, and E. Dennis 1994. Nucleotide Sequence of a Rice Genomic Pyruvate Decarboxylase Gene that Lacks Introns: a Pseudo-Gene? [published erratum appears in Plant Physiol 1995 J un;108(2):881]. Plant Physiol 106 :1697-1698. 157. Hossain, M. A., E. Huq, T. K. Hodges, and E. Hug 1994. Sequence of a cDNA from Oryza sativa (L.) Encoding the Pyruvate Decarboxylase 1 Gene. Plant Physiol 106 :799-800. 158. Huq, E., M. A. Hossain, and T. K. Hodges 1995. Cloning and Sequencing of a cDNA Encoding Pyruvate Decarboxylase 2 Gene (Accession no. U27350) from Rice. Plant Physiol. 109 :722. 159. Hossain, M. A., E. Huq, A. Grover, E. S. Dennis, W. J. Peacock, and T. K. Hodges 1996. Characterization of Pyruvate Decarboxylase Genes from Rice. Plant Mol.Biol. 31 :761-770. 160. Kato-Noguchi, H. 2003. Anoxia Tolerance in Rice Roots Acclimated by Several Different Periods of Hypoxia. J.Plant Physiol. 160 :565-568. 161. Leblov, S. and J. Martinec 1987. Isolation and Charact erization of Pyruvate Decarboxylase from Germinating Bean Seeds ( Vicia faba ). Biolgia (Bratislava) 42 :1181-1189. 162. Imahori, Y., M. Kota, Y. Ueda, M. Ishimaru, and K. Cachin 2002. Regulation of Ethanolic Fermentation in Bell Pe pper Fruit Under Low Oxygen Stress. Postharvest Biol.Technol. 25 :159-167. 163. Fukao, T., R. A. Kennedy, Y. Yamasue, and M. E. Rumpho 2003. Genetic and Biochemical Analysis of Anaerobically-Induced Enzymes During Seed Germination of Echinochloa crus-galli Varieties Tolerant and Intolerant of Anoxia. J.Exp.Bot. 54 :1421-1429. 164. Bucher, M., K. A. Brander, S. Sbicego, T. Mandel, and C. Kuhlemeier 1995. Aerobic Fermentation in Tobacco Pollen. Plant Mol.Biol. 28 :739-750. 165. Or, E., J. Baybik, A. Sadka, and A. Ogrodovitch 2000. Fermentative Metabolism in Grape Berries: Isolati on and Characterization of Pyruvate Decarboxylase cDNA and Analysis of its Expression Throughout Berry Development. Plant Sci. 156 :151-158. 166. Imahori, Y., K. Matushita, M. Kota, Y. Ueda, M. Ishimaru, and K. Chachin 2003. Regulation of Fermentative Metabolism in Tomato Fruit Under Low Oxygen Stress. J.Hort.Sci.Biotechnol. 78 :386-393. 167. Chen, H. J. and R. G. Qualls 2003. Anaerobic Metabolis m in the Roots of Seedlings of the Invasive Exotic Lepidium latifolium Environ.Exper.Bot. 50 :2940.

PAGE 129

116 168. Kimmerer, T. W. 1987. Alcohol Dehydrogenase and Pyruvate Decarboxylase Activity in Leaves and Root s of Eastern Cottonwood ( Populus deltoides Bartr.) and Soybean ( Glycine max L.). Plant Physiol. 84 :1210-1213. 169. Kursteiner, O., I. Dupuis, and C. Kuhlemeier 2003. The Pyruvate Decarboxylase1 Gene of Arabidopsis is Required During Anoxia But Not Other Environmental Stress es. Plant Physiol. 132 :968-978. 170. Ismond, K. P., R. Dolferus, M. De Pauw, E. S. Dennis, and A. G. Good 2003. Enhanced Low Oxygen Survival in Arabidopsis Through Increased Metabolic Flux in the Fermentative Pathway. Plant Physiol. 132 :1292-1302. 171. Gounaris, A. D., I. Turkenkopf S. Buckwald, and A. Young 1971. Pyruvate Decarboxylase. I. Protein Dissociation Into Subunits Under Conditions in Which Thiamine Pyrophosphate is Released. J.Biol.Chem. 246 :1302-1309. 172. Knig, S., D. Svergun, M. H. Koch, G. Hbner, and A. Schellenberger 1993. The Influence of the Effectors of Ye ast Pyruvate Decarboxylase (PDC) on the Conformation of the Dimers and Tetramer s and Their pH-Dependent Equilibrium. Eur.Biophys.J. 22 :185-194. 173. Killenberg-Jabs, M., A. Jabs, H. Lilie, R. Golbik, and G. Hubner 2001. Active Oligomeric States of Pyruvate Decarboxylase and Their Functional Characterization. Eur.J.Biochem. 268 :1698-1704. 174. Pohl, M., J. Grtzinger, A. Wollmer, and M. R. Kula 1994. Reversible Dissociation and Unfolding of Pyruvate Decarboxylase from Zymomonas mobilis Eur.J.Biochem. 224 :651-661. 175. Green, D. E., D. Herbert, and V. Subrahmanyan 1941. Carboxylase. J.Biol.Chem. 138 :327-339. 176. Schellenberger, A. 1967. Angew.Chem. 79 :1050-1061. 177. Morey, A. V. and E. Juni 1968. Studies on the Nature of the Binding of Thiamine Pyrophosphate to Enzymes. J.Biol.Chem. 243 :3009-3019. 178. Diefenbach, R. J. and R. G. Duggleby 1991. Pyruvate Decarboxylase from Zymomonas mobilis Structure and Re-Activation of Apoenzyme by the Cofactors Thiamin Diphosphate and Magnesium Ion. Biochem.J. 276 :439-445. 179. Vaccaro, J. A., E. J. Crane, III, T. K. Harris, and M. W. Washabaugh 1995. Mechanism of Reconstitution of Brewer s' Yeast Pyruvate Decarboxylase With Thiamin Diphosphate and Magnesium. Biochemistry 34 :12636-12644. 180. Schellenberger, A. and G. Hbner 1967. Mechanismus and Kinetik Der Rekombination und Daraus Abgeletete Bi ndungsverhaltnisse im Aktiven Zentrum Der Hefe-PyruvatdecArboxylase. Hoppe Seylers.Z.Physiol.Chem. 348 :491.

PAGE 130

117 181. Eppendorfer, S., S. Knig, R. Golbik, H. Neef, K. Lehle, R. Jaenicke, A. Schellenberger, and G. Hbner 1993. Effects of Metal Ions, Thiamine Diphosphate Analogues and Subunit Interact ions on the Reconstitution Behaviour of Pyruvate Decarboxylase from Brewer 's Yeast. Biol.Chem.Hoppe Seyler 374 :1129-1134. 182. Kuo, D. J. and F. Jordan 1983. Direct Spectroscopic Ob servation of a Brewer's Yeast Pyruvate Decarboxylase-Bound En amine Intermediate Produced From a Suicide Substrate. Evidence for Nonconcerted Decarboxylation. J.Biol.Chem. 258 :13415-13417. 183. Kuo, D. J. and F. Jordan 1983. Active site Directed I rreversible Inactivation of Brewers' Yeast Pyruvate Decarboxylase by the Conjugated Substrate Analogue (E)-4-(4chlorophenyl)-2-oxo-3-butenoi c Acid: Development of a Suicide Substrate. Biochemistry 22 :3735-3740. 184. Hbner, G., R. Weidhase, and A. Schellenberger 1978. The Mechanism of Substrate Activation of Pyruvate Decarboxylase: A First Approach. Eur.J.Biochem. 92 :175-181. 185. Gish, G., T. Smyth, and R. Kluger 1988. Thiamin Diphosphate Catalysis Mechanistic Divergence As A Probe of Substrate Activation of Pyruvate Decarboxylase. J.Amer.Chem.Soc. 110 :6230-6234. 186. Baburina, I., D. J. Moore, A. Volkov, A. Kahyaoglu, F. Jordan, and R. Mendelsohn 1996. Three of Four Cysteines, Including That Responsible For Substrate Activation, Are Ionized at pH 6.0 in Yeast Pyruvate Decarboxylase: Evidence From Fourier Transform Infrar ed and Isoelectric Focusing Studies. Biochemistry 35 :10249-10255. 187. Furey, W., P. Arjunan, L. Chen, F. Dy da, T. Umland, S. Swaminathan, M. Sax, F. Jordan, B. Farrenkopf, Y. Gao, and D. Zhang 1996. Multiple Modes of Tetramer Assembly and Insight Into Allosteric Activation Revealed by X-ray Crystal Structures of Pyr uvate Decarboxylase, p. 103-124. In H. Bisswanger and A. Schellenberger (eds.), Biochemistry and Physiology of Thiamine Diphosphate Enzymes. Proc. Int. Meet. 4th. A.u.C. Intemann Wissenschaftlicher-Verlag, Prien, Germany. 188. Li, H. and F. Jordan 1999. Effects of Substitution of Tryptophan 412 in the Substrate Activation Pathway of Yeast Pyruvate Decarboxylase. Biochemistry 38 :10004-10012. 189. Li, H., W. Furey, and F. Jordan 1999. Role of Glutamate 91 in Information Transfer During Substrate Activation of Yeast Pyruvate Decarboxylase. Biochemistry 38 :9992-10003.

PAGE 131

118 190. Wang, J., R. Golbik, B. Seliger, M. Spi nka, K. Tittmann, G. Hubner, and F. Jordan 2001. Consequences of a Modified Pu tative Substrate-Activation Site on Catalysis by Yeast Pyruvate Decarboxylase. Biochemistry 40 :1755-1763. 191. Sergienko, E. A. and F. Jordan 2002. New Model for Activation of Yeast Pyruvate Decarboxylase by Substrate Cons istent with the Alternating Sites Mechanism: Demonstration of the Ex istence of Two Active Forms of the Enzyme. Biochemistry 41 :3952-3967. 192. Shellenberger, A., G. Hubner, and M. Sieber 1988. p. 113-121. In A. Schellenberger and R. Schowen (eds.), Thiamine Pyrophosphate Biochemistry. CRC Press, Boca Raton, FL. 193. Hbner, G., S. Knig, and A. Schellenberger 1988. The Functional Role of Thiol Groups of Pyruvate Decarboxylase from Brewer's Yeast. Biomed.Biochim.Acta 47 :9-18. 194. Jordan, F., O. Akinoyosoye, G. Dikdan, Z. Kudzin, and D. Kuo 1988. p. 7992. In A. Schellenberger and R. Schowen (eds.), Thiamine Pyrophosphate Biochemistry. CRC Press, Boca Raton, FL. 195. Lu, G., D. Dobritzsch, S. Knig, and G. Schneider 1997. Novel Tetramer Assembly of Pyruvate Decarboxylase from Brewer's Yeast Observed in a New Crystal Form. FEBS Lett. 403 :249-253. 196. Killenberg-Jabs, M., S. Knig, I. Eberhardt, S. Hohmann, and G. Hbner 1997. Role of Glu51 for Cofactor Binding a nd Catalytic Activ ity in Pyruvate Decarboxylase from Yeast Studied by Site -Directed Mutagenesis. Biochemistry 36 :1900-1905. 197. Jordan, F., N. Nemeria, F. Guo, I. Baburina, Y. Gao, A. Kahyaoglu, H. Li, J. Wang, J. Yi, J. R. Guest, and W. Furey 1998. Regulation of Thiamin Diphosphate-Dependent 2-Oxo Acid D ecarboxylases by Substrate and Thiamin Diphosphate.Mg(II) Evidence for Tertia ry and Quaternary Interactions. Biochim.Biophys.Acta 1385 :287-306. 198. Chen, G. C. and F. Jordan 1984. Brewers-Yeast Pyruvate Decarboxylase Produces Acetoin from Acetaldehyde A N ovel Tool to Study the Mechanism of Steps Subsequent to Carbon-Dioxide Loss. Biochemistry 23 :3576-3582. 199. Stivers, J. T. and M. W. Washabaugh 1993. Catalysis of Acetoin Formation by Brewers Yeast Pyruvate Decarboxyl ase Isozymes. Biochemistry 32 :13472-13482. 200. Stivers, J. T. and M. W. Washabaugh 1993. Catalysis of Acetoin Formation by Brewer Yeast Pyruvate Decarboxylase: Steady-State Kinetics, Steady-State Primary Deuterium and Tritium Kinetic Isotope Effects, and Activation by Pyruvamide. FASEB J. 7 :A1198.

PAGE 132

119 201. Suomalainen, H. and T. Linnahalme 1966. Metabolites of AlphaKetomonocarboxylic Acids Formed by Dried Bakers and Brewers Yeast. Arch.Biochem.Biophys. 114 :502-511. 202. Lehmann, H., G. Fischer, G. Hbner, K. D. Kohnert, and A. Schellenberger 1973. The Influence of Steric and Elect ronic Parameters on the Substrate Behavior of -Oxo Acids to Yeast Pyruvate Decarboxylase. Eur.J.Biochem. 32 :83-87. 203. Reynen, M. and H. Sahm 1988. Comparison of the Structural Genes for Pyruvate Decarboxylase in Different Zymomonas mobilis Strains. J.Bacteriol. 170 :3310-3313. 204. Stephenson, M. P. and E. A. Dawes 1971. Pyruvic Acid and Formic Acid Metabolism in Sarcina ventriculi and the Role of Ferredoxin. J.Gen.Microbiol. 69 :331-343. 205. Goodwin, S. and J. G. Zeikus 1987. Physiological Adaptations of Anaerobic Bacteria to Low pH: Metabolic Control of Proton Motive Force in Sarcina ventriculi J.Bacteriol. 169 :2150-2157. 206. Lowe, S. E. and J. G. Zeikus 1991. Metabolic Regul ation of Carbon and Electron Flow as a Function of pH During Growth of Sarcina ventriculi Arch.Microbiol. 155 :325-329. 207. Ullrich, J. and I. Donner 1970. Kinetic Evidence for Two Active Sites in Cytoplasmic Yeast Pyruvate Decarboxyl ase. Hoppe Seylers.Z.Physiol Chem. 351 :1026-1029. 208. Harwood, C. R. and S. M. Cutting 1990. In Molecular Biological Methods for Bacillus Wiley, New York. 209. Southern, E. M. 1975. Detection of Specific Sequences Among DNA Fragments Separated by Gel Electrophoresis. J.Mol.Biol. 98 :503-517. 210. Sanger, F., S. Nicklen, and A. R. Coulson 1977. DNA Sequencing With ChainTerminating Inhibitors. Proc.Natl.Acad.Sci.U.S.A. 74 :5463-5467. 211. Thompson, J. D., D. G. Higgins, and T. J. Gibson 1994. CLUSTAL W: Improving the Sensitivity of Progressive Multiple Sequence Alignment Through Sequence Weighting, Position-Specific Gap Penalties and Weight Matrix Choice. Nucleic Acids Res. 22 :4673-4680. 212. Page, R. D. 1996. TreeView: An Application to Display Phylogenetic Trees on Personal Computers. Comput.Appl.Biosci. 12 :357-358. 213. Corpet, F. 1988. Multiple Sequence Alignment with Hierarchical Clustering. Nucleic Acids Res. 16 :10881-10890.

PAGE 133

120 214. Altschul, S. F., W. Gish, W. Mill er, E. W. Myers, and D. J. Lipman 1990. Basic Local Alignment Search T ool. Journal of Molecular Biology 215 :403-410. 215. Cserzo, M., E. Wallin, I. Simon, G. von Heijne, and A. Elofsson 1997. Prediction of Transmembran e Alpha-Helices in Prokar yotic Membrane Proteins: The Dense Alignment Surface Method. Protein Eng 10 :673-676. 216. Hawkins, C. F., A. Borges, and R. N. Perham 1989. A Common Structural Motif in Thiamin Pyrophosphate -Binding Enzymes. FEBS Lett. 255 :77-82. 217. Boiteux, A. and B. Hess 1970. Allosteric Properties of Yeast Pyruvate Decarboxylase. FEBS Lett. 9 :293-296. 218. Candy, J. M., R. G. Duggleby, and J. S. Mattick 1991. Expression of Active Yeast Pyruvate Decarboxylase in Escherichia coli J.Gen.Microbiol. 137 :28112815. 219. Kim, K. K., R. Kim, and S. H. Kim 1998. Crystal Structure of a Small HeatShock Protein. Nature 394 :595-599. 220. Rygus, T. and W. Hillen 1991. Inducible High-Level Expression of Heterologous Genes in Bacillus megaterium Using the Regulatory Elements of the Xylose-Utilization Operon. Appl.Microbiol.Biotechnol. 35 :594-599. 221. Meinhardt, F., U. Stahl, and W. Ebeling 1989. Highly Efficient Expression of Homologous and Heterologous Genes in Bacillus megaterium Appl.Microbiol.Biotechnol. 30 :343-350. 222. Sakoda, H. and T. Imanaka 1992. Cloning and Sequencing of the Gene Coding for Alcohol Dehydrogenase of Bacillus stearothermophilus and Rational Shift of the Optimum pH. J.Bacteriol. 174 :1397-1402. 223. Puyet, A., H. Sandoval, P. Lpez, A. Aguilar, J. F. Martin, and M. Espinosa 1987. A Simple Medium for Rapid Regeneration of Bacillus subtilis Protoplasts Transformed with Plasmid DNA. FEMS Microbiol.Lett. 40 :1-5. 224. Conway, T., Y. A. Osman, and L. O. Ingram 1987. Gene Expression in Zymomonas mobilis : Promoter Structure and Identif ication of Membrane Anchor Sequences Forming Functional lacZ' Fusion Proteins. J.Bacteriol. 169 :2327-2335. 225. Wong, C. 2000. Heating Greatly Speeds Coomassie Blue Staining and Destaining. Biotechniques 29 :544. 226. Jordan, F., D. J. Kuo, and E. U. Monse 1978. A pH-Rate Determination of the Activity-pH Profile of Enzymes. Applic ation to Yeast Pyruvate Decarboxylase Demonstrating the Existence of Mult iple Ionizable Groups. Anal.Biochem. 86 :298-302.

PAGE 134

121 227. Ohta, K., D. S. Beall, J. P. Mejia, K. T. Shanmugam, and L. O. Ingram 1991. Genetic Improvement of Escherichia coli for Ethanol Production: Chromosomal Integration of Zymomonas mobilis Genes Encoding Pyruvate Decarboxylase and Alcohol Dehydrogenase II. Appl.Environ.Microbiol. 57 :893-900. 228. Gold, R. S., M. M. Meager, R. Hutkins, and T. Conway 1992. Ethanol Tolerance and Carbohydrate-Metabolism in Lactobacilli J.Indust.Microbiol. 10 :45-54. 229. Wong, S. L. 1995. Advances in the Use of Bacillus subtilis for the Expression and Secretion of Heterologous Pr oteins. Curr.Opin.Biotechnol. 6 :517-522. 230. Miyagi, T., K. Kaneichi, R. I. Aminov, Y. Kobayashi, K. Sakka, S. Hoshino, and K. Ohmiya 1995. Enumeration of Transconj ugated Ruminococcus albus and Its Survival in the Goat Rumen Microcosm. Appl.Environ.Microbiol. 61 :20302032. 231. Wong, S. L., R. Q. Ye, and S. Nathoo 1994. Engineering and Production of Streptokinase in A Bacillus subtilis Expression-Secretion System. Appl.Environ.Microbiol. 60 :517-523. 232. Gurkan, C. and D. J. Ellar 2003. Expression of the Bacillus thuringiensis Cyt2Aa I toxin in Pichia pastoris Using a Synthetic Gene Construct. Biotechnol.Appl.Biochem. 38 :25-33. 233. Lakey, D. L., R. K. R. Voladri, K. M. Edwards, C. Hager, B. Samten, R. S. Wallis, P. F. Barnes, and D. S. Kernodle 2000. Enhanced Production of Recombinant Mycobacterium tuberculosis Antigens in Escherichia coli by Replacement of Low-Usage Codons. Infect.Immun. 68 :233-238.

PAGE 135

122 BIOGRAPHICAL SKETCH LeeAnn Talarico Blalock was born on April 12, 1977, in Charleston, South Carolina. She grew up in Hanahan, South Caro lina, with her mother, Sandra Lee. Upon graduation from Stratford High School in Goose Creek, South Carolina, she attended Charleston Southern University on a Board of Trustees Academic Scholarship. She graduated cum laude with a major in biology and a minor in chemistry. She is a member of Beta Beta Beta biological honor society and Alpha Chi academic honor society. While attending college, LeeAnn ga ined experience working in microbiology, chemistry, and biotechnology laboratories, as well as tutori ng college students in biology and chemistry. In August 1999, LeeAnn was accepted as a grad uate student in the Department of Microbiology and Cell Science at the University of Florida. She worked in the laboratory of Dr. Julie Maupin-Furlow on the expre ssion of pyruvate decarboxylase in Grampositive bacteria. In November 2002, she rece ived the Presidents Award for Graduate Student Oral Presentation at the Southeaste rn Branch of the American Society for Microbiology annual meeting. In Decembe r 2003, LeeAnn will be conferred the degree of Doctor of Philosophy. Upon graduation, LeeAnn will move with her husband, Timothy Blalock, to Boston, Massachusetts, wher e she will be a Postdoctoral Fellow with Dr. Dennis Kasper in the Department of Microbiology and Molecular Genetics at Harvard Medical School. 122


Permanent Link: http://ufdc.ufl.edu/UFE0002366/00001

Material Information

Title: Expression of Pyruvate Decarboxylase in a Gram Positive Host: Sarcina ventriculi Pyruvate Decarboxylase versus Other Known Pyruvate Decarboxylases
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0002366:00001

Permanent Link: http://ufdc.ufl.edu/UFE0002366/00001

Material Information

Title: Expression of Pyruvate Decarboxylase in a Gram Positive Host: Sarcina ventriculi Pyruvate Decarboxylase versus Other Known Pyruvate Decarboxylases
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0002366:00001


This item has the following downloads:


Full Text













EXPRESSION OF PYRUVATE DECARBOXYLASE IN A GRAM POSITIVE HOST:
Sarcina ventriculi PYRUVATE DECARBOXYLASE VERSUS OTHER KNOWN
PYRUVATE DECARBOXYLASES
















By

LEEANN TALARICO BLALOCK


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2003































This dissertation is dedicated to my mother, Sandra Lee, without whom none of this

would be possible. I would also like to dedicate it to my husband, Timothy Blalock, for

his love and encouragement during the course of this work

















ACKNOWLEDGMENTS

I would like to express my deepest gratitude to my mentor, Dr. Julie Maupin-

Furlow, for her training and guidance throughout the course my work. Her experience

and advice in this endeavor have been indispensable to my success. I would also like to

sincerely thank the members of my doctoral thesis committee: Dr. Lonnie O. Ingram, Dr.

K.T. Shanmugam, Dr. Jon Stewart, and Dr. Greg Luli. Their advice was crucial to the

success of my research.

I would also like to extend my appreciation to Dr. Kwang-Myung Cho, Dr. K.C.

Raj, Dr. Heather Wilson, Dr. Adnan Hasona, Dr. Han Tao, Dr. Yilei Qian, Steve

Kaczowka, Gosia Gil, Chris Reuter, Angelina Toral, Jason Cesario, Brea Duval, Uyen

Le, Jennifer Timothee, and Angel Sampson for all of the experimental advice, friendship,

and support that they have shown me during my time at the University of Florida.

Finally, I would like to thank my mother, Sandra Lee; my husband, Dr. Timothy

Blalock; my grandmother, Jane Lee; my godmother, Enid Causey; and my family:

Michelle Murillo, Michael Murillo, Cherie and Sabas Murillo, Jeanne and Al Crews, Tina

Johnson, Christina Johnson, and Carl Johnson for the invaluable support they have

offered to me over the years. Lastly, I would like to thank Dr. Nathan Griggs, who

piqued my interest in research and gave me the knowledge I needed to pursue my goals.
















TABLE OF CONTENTS
page

ACKNOW LEDGEM ENTS...................................................... ........................................iii

LIST OF TABLES ................................ ........... ......... ...... ............ .. vii

LIST OF FIGU RE S ........................................ ............ .............. .. viii

K EY TO A BBREV IA TION S .......... ......... ............... .......................... ............... x

ABSTRACT ........ .............. ............. .. ...... .......... .......... xii

CHAPTER

1 LITER A TU RE REV IEW ................................................... ............................... 1

Industrial Importance of Pyruvate Decarboxylase ................................................. 1
Pyruvate Decarboxylase Catalyzes the Production of Bioethanol...........................1
Pyruvate Decarboxylase Catalyzes the Production of PAC .............. ...............4
P reduction of P A C by Y east ...................................................................................5
Production of PA C in a Cell Free System ........................................ ....................7
Distribution of Pyruvate Decarboxylase............................................... .................. 8
PD C in Fungi and Y east ........................................ .......................................8
PD C in B bacteria ................................................................ ... ......... 12
P D C in P lants ............... .. ................... ............................ ................. 14
Structure of Pyruvate D ecarboxylase.................................... .................................... 16
Subunits of P D C ..................................................................... 17
C factors of P D C ......... ............................. ......................... ...... ... ... 18
Kinetics of PDC ........................................... ................. .... ........ 19
C atalytic R esidues of PD C ........... ............................ ............... ............... 20
A alternative Substrates of PD C ..................................................... ...... ......... 21
Study R ationale and D esign .............................................................. .....................22

2 CLONING AND EXPRESSION OFpdc, AND CHARACTERIZATION OF
PYRUVATE DECARBOXYLASE FROM Sarcina ventriculi. ...........................23

Introduction .............. .... ....... ................ .... ............ ............ 23
M materials and M ethods......................................................................... .................. 24
M a te ria ls ....................................................................................2 4
Bacterial Strains and Media ......... ............... ................... 25
D N A Isolation ............................................................................... ............... 2 5









Cloning of the S. ventriculi pdc Gene ............... ............................................ 25
Nucleotide and Protein Sequence Analyses................................ ............... 27
Production of S. ventriculi PDC in Recombinant E. coli...................................28
Purification of the S. ventriculi PDC Protein............... ............................28
Activity Assays ......................... ........... ... .. ... ...... ............ 29
Molecular Mass and Amino Acid Sequence Analyses .............................. 30
R results and D discussion ........................................................ .... .... ..... .... .. 1
PD C O peron in S. ventriculi .......... ................. ........................ ................. 31
PDC Protein Sequence in S. ventriculi ..................................... ............... 32
Production of S. ventriculi PDC Protein......... ................................. .......... ......35
Properties of the S. ventriculi PDC Protein from Recombinant E. coli ...............36
C o n c lu sio n .......................................................................... 3 9

3 OPTIMIZATION OF SvPDC EXPRESSION IN A GRAM POSITIVE HOST .........56

In tro d u ctio n ............. .. ............. ............................................................................ 5 6
M materials and M ethods........................................................................ ...................58
M materials .........................................58
Bacterial Strains and Media ......... ............... ................... 58
D N A Isolation ............... ............... ...... ... ..... ..... ... .. ..................58
Cloning of the Sarcina ventriculipdc Gene into Expression Vector pWH1520...58
Gram-positive Ethanol (PET) Operon ............................................ ............... 59
Protoplast Formation and Transformation ofB. megaterium .............................59
Production of SvPDC in Recombinant Hosts.......... ......... ......................60
Purification of the S. ventriculi PDC Protein............... ...........................60
Activity Assays and Protein Electrophoresis Techniques ...................................61
R results ................ .... .............. ....... ...... .................... ............... ....... 62
SvPDC Expression Vector for B. megaterium ...............................................62
Production and Purification of SvPDC from B. megaterium .............. ...............62
Determination of Optimum Conditions for SvPDC Activity..............................63
Kinetics of SvPDC Produced in B. megaterium.................................................63
Thermostability of SvPDC Produced in B. megaterium .............. ..................64
Generation of a Gram-positive Ethanol Production Operon..............................65
D iscu ssion ............... ..................................... ............................65

4 EXPRESSION OF PDCs IN A GRAM POSITIVE BACTERIAL HOST, B.
m eg a terium ................................................................7 7

Introdu action ............. ................. .................................................................... 77
M materials and M ethods......................................................................... .................. 78
M materials .........................................78
B bacterial Strains and M edia ................................. .. .................. ....... ..... 79
Protoplast Formation and Transformation ofB. megaterium.............................79
D N A Isolation and Cloning .............. ................. ................ ............... ....79
Production of PDC Proteins in Recombinant B. megaterium.............................80
Activity Assays and Protein Electrophoresis Techniques ...................................81
RNA Isolation................................ ............................. ......... 81


v











RN A Quantification ............................................... ........ .. ............ 82
P u lse C h ase ................................................................................. ............. 82
R e su lts ............................. ..................................... ...... ....................................... 8 3
Construction of Gram-positive PDC Expression Plasmids ............... ...............83
Expression of PDC In Recombinant B. megaterium .................. ... .............84
Analysis of PDC Transcript Levels ........................ ........... ............... 85
PDC Protein Stability in Recombinant B. megaterium ................. ........... .... 86
D iscu ssio n ......... ..................................... ............................8 7

5 GENERAL DISCUSSION AND CONCLUSIONS...............................................98

L IST O F R E F E R E N C E S ...................................................................... ..................... 102

BIOGRAPHICAL SKETCH ............................................................. ............... 122

















LIST OF TABLES


Table page

2-1 Strains and plasmids used for production of PDC from S. ventriculi in E. coli .......41

2-2 Amino acid composition of PDC proteins ............... ............... ......... .......... 43

2-3 Codon usage of S. ventriculi (Sv) and Z. mobilis (Zm)pdc genes .........................44

3-1 Strains, plasmids, and primers used in Chapter 3 ........................................... 68

3-2 Purification of SvPDC from B. megaterium ..... ...........................69

4-1 Strains, plasmids and primers used in Chapter 4 ............................................... 89

4-2 PDC activity ofB. megaterium strains transformed with pdc expression
p la sm id s ............................................................................. 9 1

4-3 Codon usage of PDC genes and B. megaterium genome ...................................92
















LIST OF FIGURES


Figure pge

2-1 A partial map of restriction endonuclease sites for a 7-kb BclI genomic DNA
fragm ent from S. ventriculi ......................................................... .............. 46

2-2 Nucleic acid and predicted amino acid sequence of the S. ventriculipdc gene........47

2-3 Multiple amino acid sequence alignment of S. ventriculi PDC with other PDC
protein sequences .............. ................. ......... .. ......... .. ...... 49

2-4 Relationships between selected PDCs ........................................... ............... 50

2-5 Relationships between pyruvate decarboxylase (PDC), indole pyruvate
decarboxylase (IPD), ca-ketoisocaproate decarboxylase (KID), and homologues
(O R F ) ...............................................................................5 2

2-6 S. ventriculi PDC protein synthesis in recombinant E. coli................................. 54

2-7 Pyruvate dependant activity of the S. ventriculi PDC purified from recombinant E.
c o li..................................................................................... . 5 5

3-1 S. ventriculi PDC protein synthesized in recombinant E. coli and B. megaterium...70

3-2 pH profile for S. ventriculi PDC activity ...................................... ............... 71

3-3 Effect of temperature on S. ventriculi PDC ................................................. 72

3-4 Effect of Pyruvate concentration on S. ventriculi PDC synthesized in recombinant
E. coli, and B. m egaterium ................ ......... .................................. ............... 73

3-5 Thermostability of recombinant S. ventriculi PDC .............................. ..................74

3-6 Effect of pH on the thermostability of the S. ventriculi PDC produced in B.
m eg a ter iu m ...............................................................................................................7 5

3-7 Induction of S. ventriculi PDC and G. ei 'i,,letiipi mqhili% ADH in
B m eg a terium ................. .... ..... ................. ............. ................. 76









4-1 Strategy used to construct plasmids for expression of S. ventriculipdc in
recombinant B. megaterium ................... ........ .................... 94

4-2 PDC proteins synthesized in recombinant B. megaterium.................... ........ 95

4-3 Levels ofpdc-specific transcripts in recombinant B. megaterium............................96

4-4 PDC protein thermostability in recombinant B. megaterium.............................. 97




















ADH

Ap

bp

DNA

Km

MES

NADH

ORF

PAC

PDC

PET

PVDF

RNA

Sc

SDS-PAGE

Sv

TPP

U


KEY TO ABBREVATIONS

alcohol dehydrogenase

Acetobacter pasteurianus

base pairs

deoxyribonucleic acid

Michaelis Constant for enzyme activity

2-[N-morpholino]ethanesulfonic acid

nicotinamide adenine dinucleotide

open reading frame

(R)-phenylacetylcarbinol (R- 1-hydroxy- 1-phenylpropane-2-one)

pyruvate decarboxylase

portable ethanol operon

polyvinylidene difluoride

ribonucleic acid

Saccharomyces cerevisiae

sodium dodecyl sulfate-polyacrylamide gel electrophoresis

Sarcina ventriculi

thiamine pyrophosphate

Unit of enzyme activity defined as the amount of enzyme that generates 1
[tmol of product acetaldehydee) per minute









Vmax maximal rate of enzyme activity

Zm Zymomonas mobilis

Zp Zymobacter palmae

















Abstract of Dissertation Presented to the Graduate School of the University of Florida in
Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

EXPRESSION OF PYRUVATE DECARBOXYLASE IN A GRAM POSITIVE HOST:
Sarcina ventriculi PYRUVATE DECARBOXYLASE VERSUS OTHER KNOWN
PYRUVATE DECARBOXYLASES
by


LeeAnn Talarico Blalock

December 2003


Chair: Julie A. Maupin-Furlow
Major Department: Microbiology and Cell Science

The technology currently exists for bacteria to produce ethanol from inexpensive

plant biomass. To enhance the commercial competitiveness of biocatalysts for the large-

scale production of ethanol, a new host organism will need to be developed that can

withstand many factors including low pH, high temperature, high ethanol concentrations,

and various other harsh environmental conditions. Gram-positive bacteria naturally

possess many of these qualities and would be ideal candidates for ethanol production;

however, the use of the pdc and adh genes from the Gram-negative bacterium,

Zymomonas mobilis, has met with only limited success. In order for this approach to be

successful, a gene for pyruvate decarboxylase that is readily expressed in a Gram-positive

host needs to be identified.

The Sarcina ventriculipdc gene (Svpdc) is the first to be cloned and characterized

from a Gram-positive bacterium. Comparative amino acid sequence analysis confirmed









that SvPDC is quite distant from Z mobilis PDC (ZmPDC) and plant PDC enzymes.

Elucidation of the sequence of the Svpdc sequence also led to the identification of a new

subfamily ofPDCs.

The Svpdc gene was expressed at low levels in recombinant E. coli due to

differences in the codon usage in the hosts and the Sarcina ventriculi pdc. Expression

was improved by the addition of supplemental tRNA genes and facilitated the

purification and biochemical characterization of the recombinant SvPDC enzyme. This

dramatic difference in codon usage suggested that the Svpdc gene was an ideal candidate

for engineering high-level PDC production in low G+C Gram-positive bacteria. To

confirm this, expression ofpdc genes from distantly related organisms (i.e. Z mobilis,

Acetobacter pasteurianus, and Saccharomyces cerevisiae) were compared to that of the

Svpdc in recombinant Bacillus megaterium. SvPDC protein and activity levels were

several-fold higher in recombinant B. megaterium compared to the other PDCs examined.

Transcript levels using quantitative reverse transcriptase polymerase chain reaction and

protein stability using pulse-chase indicated that SvPDC was expressed at higher levels

than other PDCs tested due to its optimal codon usage. This is the first PDC expressed at

high levels in Gram-positive hosts.














CHAPTER 1
LITERATURE REVIEW

Industrial Importance of Pyruvate Decarboxylase

Pyruvate Decarboxylase Catalyzes the Production of Bioethanol

In 2001 the United States produced 1.77 billion gallons of fuel ethanol of which

90% was produced by fermentation of corn by yeast (1). The demand for fuel ethanol is

expected to more than double in the next few years because it will replace the fuel

oxygenate methyl tertiary butyl ether (MTBE), a known carcinogen which has been

linked to ground water contamination and has proven difficult to remove from the

environment (2). Fuel ethanol production in 2001 consumed over 5% of the corn crop,

and it has been estimated that fuel ethanol production will reach more than 4 billion

gallons per year by 2006 (1, 2). The use of corn as a feedstock for the production of

ethanol has led to several problems. Because corn is also used for food, this feedstock

has a higher price than alternative feedstocks that are considered waste products from

various processes (3). The use of corn also leads to controversy over sacrificing a food

product for fuel production (3). However, production of ethanol from non-food sources

(bioethanol) can provide a useful alternative to the current method of disposing of

lignocellulosic wastes such as rice straw and wood wastes that were historically burned

but now must be disposed of in a more environmentally friendly and much more costly

manner (3). Utilizing these waste products for bioethanol production not only provides









an inexpensive feedstock but benefits the environment by disposing of this material in an

environmentally friendly manner and producing a clean burning fuel source (3).

Organisms traditionally used for ethanol fermentation do not have the ability to

metabolize pentoses. Considerable research has been performed to identify naturally

occurring organisms that can ferment pentoses (4). Because yeast have been the

traditional organisms used for ethanol production and they produce high ethanol yields,

research focused on identifying yeast that could metabolize pentose sugars (5). Several

yeast strains have been identified that are capable of utilizing xylose for ethanol

production: Pachysolen tannophilus (6-9), Pichia stipitis (10-14), and Candida shehatae

(10, 11, 15). Unfortunately, these yeast produce only low levels of ethanol from xylose

and exhibit a multitude of problems including low ethanol tolerance, utilization of the

ethanol produced, inability to utilize and metabolize arabinose, and production of xylitol

(6-15). Attempts have also been made to isolate yeast that ferment arabinose, but the

yeast which have been isolated produce very low levels of ethanol (4.1 g/liter) (16).

Attempts to improve yeast strains for ethanol production have also been pursued

by engineering recombinant strains. S. cerevisiae has been the primary focus of this

research because the corn ethanol industry is already familiar with this organism, it

produces high levels of ethanol, and it has been shown to be resistant to high levels of

ethanol (5). Attempts to engineer a xylose utilization pathway from bacteria into S.

cerevisiae has been unsuccessful (17-21). A more promising strategy has been to

engineer the xylose-utilization genes from other yeast into S. cerevisiae (22, 23). One of

the most successful recombinant strains of S. cerevisiae to utilize xylose has been a strain

engineered with a plasmid that contained three xylose-metabolizing genes: a xylose









reductase gene and xylitol dehydrogenase gene from Pichia stipitis, and a xylulokinase

gene from S. cerevisiae (23). This strain produced ethanol at 22 g/liter which was a vast

improvement over strains expressing bacterial xylose utilization genes (23). While

recombinant yeast have been engineered to utilize xylose, there have been no successful

attempts to engineer arabinose utilization into these organisms.

Many bacteria naturally possess the ability to ferment hexose and pentose sugars,

but produce a variety of fermentation endproducts (4). In bacteria, pentose and hexose

sugars are metabolized to pyruvate. Ingram et al. (24) have demonstrated that funneling

this pyruvate to ethanol is possible by the use of the pyruvate decarboxylase and alcohol

dehydrogenase II from Z. mobilis. The low Km of the Z mobilis PDC (0.4 mM pyruvate)

competes favorably with the other enzymes for pyruvate in the cell and causes large

amounts of acetaldehyde to be made, which is then converted to ethanol by alcohol

dehydrogenase (24). A portable ethanol production operon (PET) was generated that

contained the Z mobilis PDC transcriptionally coupled to the Z mobilis alcohol

dehydrogenase II (24). The PET operon was used to successfully engineer enteric

bacteria for ethanol production including Klebsiella oxytoca (25), Erwinia c hrl ntlwheii

(26), Enterobacter cloacae (27), and many strains of E. coli (28, 29). The PET operon

has also been successfully used to engineer a wide range of other organisms including

tobacco (30, 31) and cyanobacteria (32). Attempts have also been made to engineer

Gram-positive bacteria to produce ethanol using the PET operon, but this strategy has

been unsuccessful due to poor expression of the Z mobilis genes (33-35). The recent

cloning and characterization of a PDC from the Gram-positive bacterium Sarcina

ventriculi and its subsequent high level expression in the Gram-positive bacterium,









Bacillus megaterium, will enable the development of new Gram-positive biocatalysts for

the production of ethanol (this study).


Pyruvate Decarboxylase Catalyzes the Production of PAC

In 1921, while examining the biotransformation of benzaldehyde to benzyl

alcohol by fermenting Brewer's yeast (Saccharomyces uvarum), Neuberg and Hirsh

discovered that after 3-5 days no sugar or benzaldehyde remained. Furthermore, the

amount of benzyl alcohol produced was not proportional to the amount of substrate

consumed (36). They later determined that the byproduct of this reaction was (R)-

phenylacetylcarbinol (PAC) and named the enzyme that catalyzed its synthesis

"carboligase" (37, 38).

The process of PAC formation by Brewer's yeast was patented in 1932, making it

one of the first chiral intermediates to be produced on an industrial scale by

biotransformation (39, 40). PAC is the first chiral intermediate in the production ofL-

ephedrine and pseudoephedrine, which are the major ingredients in several commonly

used decongestants and antiasthmatics as well as having a possible use in control of

obesity (41, 42).

Several studies have confirmed that the enzyme catalyzing the production of PAC

is pyruvate decarboxylase (EC 4.1.1.1) (43-46). Pyruvate decarboxylase (PDC) catalyzes

two different reactions: non-oxidative decarboxylation of c-ketoacids to the

corresponding aldehyde (47-50) and the "carboligase" side reaction forming the

hydroxyketones (51, 52). In the acycloin-type condensation reaction, an active aldehyde

in the active site is condensed with a second aldehyde as a cosubstrate (40). The









cosubstrate is acetaldehyde in vivo, but can be another aldehyde when supplied externally

(40). In the production of PAC, benzaldehyde is the cosubstrate fed to yeast cells (40).

Production of PAC by Yeast

The industrial production of PAC has historically utilized yeast cells, primarily

Saccharomyces sp. and Candida sp. Many efforts to improve yeast PAC production have

focused on increasing yields of PAC through alteration of the fermentation conditions

and medium (53-55).

When S. carlsbergensis is grown on sucrose, acetaldehyde, and benzaldehyde the

highest initial rate of biotransformation and the highest production of PAC were detected

in the cells with the lowest PDC activity. This led to the suggestion that production of

PAC is limited only by the intracellular pools of pyruvate and that biotransformation of

PAC ceases due to low levels of pyruvate before benzaldehyde mediated inactivation of

PDC occurs. Addition of pyruvate did not increase the rate of PDC synthesis but did

increase the overall production of PAC (55).

The current industrial process for the production of PAC uses a two-stage fed-

batch process. In the first stage, the yeast are grown under partial fermentative conditions

to induce the production of PDC and allow intracellular accumulation of pyruvate. In the

second stage, the biotransformation takes place with feeding of noninhibiting levels of

benzaldehyde. Using this strategy a PAC accumulation level of 22 g/L has been reached

(56).

This strategy, however, is hindered by side-reactions within the cells as well as

the sensitivity of the cells to benzaldehyde and the fermentative products (57). Besides

the PAC production, yeast cells also typically reduce up to 16% to 50% of the









benzaldehyde to benzyl alcohol (36-38). The production of benzyl alcohol is primarily

due to the action of alcohol dehydrogenases and other oxidoreductases in the cell (58-60).

Other byproducts are also produced including acetoin, benzoic acid, benzoin, butan-2,3-

dione (diketone), trans-cinnamaldehyde, 2-hydroxypropiophenone, and 1-phenyl-propan-

2,3-dione (acetylbenzoyl) (61, 62). In addition to the formation of these side-products,

PAC is also enzymatically reduced to (1R, 2S)-l-phenyl-l,2-propane-diol (54).

At benzaldehyde concentrations above 16 mM the viability of the yeast cells is

diminished, and PAC production is completely inhibited above 20 mM (63). If the level

of benzaldehyde drops below 4mM, benzyl alcohol becomes the primary product (63).

Comparison of intracellular and extracellular benzaldehyde levels shows that the

membrane maintains a permeability barrier (9.4 mM), which results in lower levels of

benzaldehyde in the cell and may protect intracellular proteins. At concentrations above

9.4 mM benzaldehyde, the barrier appears to falter and intracellular enzymes are

inactivated (59). The yeast PDC, however, is resistant to denaturation by benzaldehyde

at levels up to 66 mM benzaldehyde and is also fairly resistant to final PAC concentration

(59). Thus it was concluded that the modification of cell permeability by benzaldehyde

decreases PAC production by causing release of the cofactors necessary for the

carboligation reaction (i.e. Mg2+ and TPP) and not by inactivation of PDC (59).

Because of these limitations, it would be beneficial to genetically engineer an

organism for PAC production that is more resistant to benzaldehyde and does not

catalyze multiple side reactions. Alternatively, a cell free system may be a viable

alternative to the use of whole cells for PAC production.









Production of PAC in a Cell Free System

Utilization of isolated PDC for the biotransformation of pyruvate to PAC has only

recently been pursued as an alternative to the use of whole cells. A distinct advantage to

using a cell free system as opposed to cells as a source of PDC is that the oxidoreductases

responsible for the conversion of benzaldehyde to benzyl alcohol as well as the

cytotoxicity ofbenzaldehyde can be avoided (58, 59, 63, 64).

The first attempt to use partially purified PDC for the conversion of pyruvate to

PAC compared the efficiencies of PDCs from Z. mobilis and S. carlsbergensis (65). This

study proved that both PDCs can be used for production of PAC, however the Z. mobilis

PDC has a much lower affinity for benzaldehyde (65).

In another study, a high concentration of benzaldehyde was used with partially

purified PDC from Candida utilis (66). At a benzaldehyde levels of 200 mM, a PAC

level of 190mM (28.6 g/L) was obtained which was considerably higher than previously

reported values. Shin and Rogers (67) later determined that the factor limiting

conversion of pyruvate and benzaldehyde to PAC was the inactivation of PDC by

benzaldehyde. This inactivation was determined to be first order with respect to

benzaldehyde and exhibited a square root dependency on time.

Stability of the PDC used for the production of PAC is an important factor in the

success of the biotransformation. Previous studies have shown that S. cerevisiae PDC

exhibits a high carboligase activity, but shows only low stability when isolated (65). The

PDC from Z. mobilis has been shown to have low carboligase activity with respect to the

yeast enzyme but high stability (65, 68). It was determined that mutating residues within

the Z. mobilis PDC enhanced its carboligase activity (68-70). The Pohl lab (71, 72) used









the Z mobilis PDC mutants to produce PAC in an enzyme-membrane reactor. This

continuous reaction system utilized acetaldehyde and benzaldehyde in an equimolar ratio.

At a substrate concentration of 50 mM of both aldehydes, a PAC volume production of

81 g L-ld'1 was obtained with higher yields possible by use of a series of membrane

reactors.

Use of cell free systems for the production of PAC is relatively new, having only

started in 1988 (65), as opposed to the biotransformation using whole cells which began

in 1932 (40). At the moment, the most promising PDCs for production of PAC are

variants ofZ. mobilis PDC that enable benzaldehyde to access the active site (68-70). In

cell free systems, the primary factor limiting production of PAC is the availability of

PDC enzymes that can withstand the reaction conditions, mainly inactivation by

aldehydes. Until recently, Z mobilis PDC was the only known PDC from bacteria. This

enzyme has been shown to be more stable when compared to the yeast PDCs and

alteration of as little as one amino acid enhanced carboligase activity (70). Recently

characterized PDCs from bacteria are likely to have beneficial qualities for the production

of PAC.


Distribution of Pyruvate Decarboxylase

PDC has been identified in a wide variety of plants and fungi, but is rare in

bacteria. The following section identifies the organisms known to encode PDC and

describes the known function of the enzyme in that organism.

PDC in Fungi and Yeast

Several fungal PDCs have been identified. These PDCs from filamentous fungi

appear to be active when the organism experiences anoxic conditions (73-75). It is









through PDC that the cell has the ability to regenerate NAD through the production of

acetaldehyde that is then converted to ethanol by alcohol dehydrogenase.

In Neurospora crassa PDC forms large cytoplasmic filaments that can measure 8-

10 nm in length (73). The appearance of these filaments in the cell has been shown to

correspond to increased levels ofpdc mRNA and increased PDC activity levels within the

cell (73). Disassembly of the filaments enables recovery of active PDC indicating that

the filaments are an active storage form of the enzyme (73). This PDC is particularly

interesting in that the amino acid sequence is more closely related to bacterial PDCs than

to yeast PDCs while the kinetics are more similar to other fungal PDCs (73).

A gene encoding a putative pdc was isolated from a genomic DNA library of

Aspergillusparasiticus (74). The A. parasiticus PDC deduced amino acid sequence was

shown to have 37% similarity to the PDC1 from Saccharomyces cerevisiae, which was

the highest to any PDC and showed that it is quite different from previously characterized

PDCs (74). The organisms A. parasiticus, Aspergillus niger, and Aspergillus nidulans

were tested for the production of ethanol in shake flask cultures. Ethanol was detected

indicating a response to anoxic conditions even though they are obligate aerobes (74).

Although this showed that A. nidulans produced ethanol under anoxic conditions (74), the

researchers did not test for PDC activity in cell lysate. Lockington et al. (75) showed

that mycelia subjected to anoxic stress had elevated levels of PDC activity. The gene for

PDC was isolated and sequenced from A. nidulans (75) and the deduced amino acid

sequence from this gene was shown to have highest similarity (37%) to the A. parasiticus

PDC (75). This study showed that production of PDC in the cell is regulated at the level









of mRNA and that production of PDC is therefore the major determinant of ethanol

production under anoxic conditions in A. nidulans (75).

Several PDCs from yeast have been identified and two are among the best studied

of all PDCs (76). In yeast, PDC serves the same purpose as in most organisms, which is

to replenish NAD+ supplies under anaerobic conditions. In most yeast, fermentation and

respiration both contribute to glucose catabolism under aerobic conditions. In

Saccharomyces cerevisiae respiratory and fermentative pathways are mutually exclusive

and the pyruvate produced during glycolysis is funneled by PDC almost entirely to

acetaldehyde and then to ethanol by ADH (77). The majority of yeast, however, rely on

respiration under aerobic conditions to regenerate NAD+ (77).

Saccharomyces uvarum PDC has been extensively studied over the past two

decades due to its various uses in industry, including use in breweries. Wild-type S.

uvarum PDC exists in a mixture of isoforms consisting of an a4 homotetramer composed

of one type of subunit with a molecular weight of 59 kDa (78, 79)and an Ua22 tetramer

with two types of subunits with different molecular weights (3 subunit is 61 kDa) (80).

These subunits also differ in amino acid composition and sequence (81, 82). A high

performance liquid chromatography separation procedure was used to obtain a single

isoform (U4) in a catalytically active state for crystallization (83). The first crystal

structure of a PDC was obtained using crystallized form of this U4 PDC (84). Deletion

mutants of the gene coding for thep-subunit have been used to produce the a4 PDC

protein for study (85). It was found that the a4 enzyme is considerably less stable in

aqueous solution than U232 wild-type PDC having a rate of inactivation which is 5 times

higher than the wild-type enzyme; however the kinetic features of the two isoforms are









the same (85). Some controversy currently exists over the substrate activation of a4

PDC. A significant body of work led to the conclusion that the Cys221 residue is

required for substrate activation of S. uvarum Ua4 PDC by binding pyruvate leading to a

conformational change in the enzyme (86-90). However, a crystal structure of S. uvarum

PDC in the presence of the activator pyruvamide shows that this pyruvate analog does not

interact with the Cys221 residue (91). Kinetic evidence in this study also suggests that

Cys221 is not responsible for substrate activation (91). Further aspects of S. uvarum

PDC activation will be discussed later in this chapter.

Saccharomyces cerevisiae has been extensively studied due to its various uses in

industry, including industrial ethanol production (2). Nucleotide sequences of six PDC

genes have been determined (92-98). Three of these genes have been identified as

structural genes: PDC1 (92, 99-101), PDC5 (94, 102), and PDC6 (95, 96). Wild-type S.

cerevisiae PDC protein is composed of 85% from PDC1 translation while 15% is from

PDC5 translation (102). If one of these two genes is deleted, translation of the other

increases to compensate (102). A crystal structure of S. cerevisiae PDC 1 in the inactive

state was determined and was essentially the same as the S. uvarum PDC structure (103).

For this reason, the S. cerevisiae PDC has been a central focus for understanding PDC

structure-function because, unlike S. uvarum PDC, the nucleotide sequence has been

determined (84, 91). The various site-directed mutagenesis studies performed on the S.

cerevisiae PDC will be discussed later in this chapter.

A gene for PDC from Kluveromyces lactis was cloned, and it was determined that

it was induced by glucose at a transcriptional level (104). The PDC protein encoded by

this gene was purified and characterized, and it was determined that it was similar to S.









cerevisiae PDC with a few distinct differences (105). There is a very low binding affinity

for pyruvate at the regulatory site (Ka = 207.00 mM); however, it is compensated by the

fast isomerization (kiso = 3.03) and low Km value for pyruvate of 0.24 mM which is

approximately 2-fold lower than that for S. cerevisiae PDC (Km of 0.47 mM for pyruvate)

(105).

While the PDC from S. cerevisiae has been studied extensively, the majority of

other known yeast PDCs are not well characterized. PDC has been characterized from

Hanseniaspora uvarum (106), Zygosaccharomyces bisporus (107), and genes for PDC

have been sequenced from Klyveromyces marxianus (108) and Pichia stipitis (109).

PDC in Bacteria

Although study of PDC has been ongoing for many years, the main focus has

been primarily on PDC from yeast. The discovery that ethanol formation in Zymomonas

mobilis was catalyzed by PDC (110) and the later characterization of the protein (111-

113) and gene (114-116) identified bacterial PDCs as a distinct group with unique

properties that made them attractive for further research. The identification, cloning, and

characterization of bacterial PDCs have been aggressively pursued in recent years and

our knowledge of this previously unidentified group of PDCs is quickly expanding.

The PDC from Z mobilis was the first bacterial PDC to be identified (110),

characterized (111-113), and cloned (114-116) and has since become one of the most

intensively studied PDC proteins. Z. mobilis PDC was the first PDC discovered that was

not substrate activated (111). This enzyme has the highest specific activity of all PDCs

(180 units per mg protein) and an extremely low Km of 0.4 mM pyruvate (112). PDC

from Z mobilis is also the most stable PDC in the purified form of those tested (117).









This protein is readily expressed at high levels in E. coli (113, 114). A high resolution

crystal structure of Z mobilis PDC was obtained, and it was shown that the tight packing

of the subunits in the dimers of the tetramer prevents large conformational changes and

locks the enzyme in an active state (117). This crystal structure also showed how a

previously characterized mutant, Trp392Ala, improved synthesis of PAC by Z mobilis

PDC (70) by relieving the steric hindrance caused by bulky amino acid side chains in the

active site cavity (117). Extensive site-directed mutagenesis studies have been performed

on Z mobilis PDC (70, 110, 118-126). These studies will be discussed later in this

chapter. The Z mobilis PDC enzyme has been successfully used to engineer a wide

variety of organisms for ethanol production (4, 30-32, 34, 127-129) and has also been

modified for the efficient production of PAC in recombinant hosts (68, 70-72, 123).

Acetobacterpasteurianus utilizes PDC in a unique way (130). While all other

known PDC proteins function only in anaerobic fermentation to ethanol, the A.

pasteurianus PDC actually functions only in oxidative metabolism (130). In A.

pasteurianus, this enzyme functions to cleave the central metabolite pyruvate into

acetaldehyde and C02, after which the acetaldehyde is oxidized to the final product,

acetic acid (130). Upon comparison of the deduced amino acid sequence, it was shown

that the A. pasteurianus PDC is most closely related to the Z mobilis PDC (130).

The most recently discovered bacterial PDC is from Zymobacter palmae (131).

The Z palmae PDC protein composed approximately 1/3 of the soluble protein when

produced in recombinant E. coli (131). It was hypothesized that the high level of PDC

protein produced is due to similar codon usage ofthispdc gene and the E. coli genome

(131). The Km for pyruvate (0.24 mM) of the Z palmae PDC is the lowest of all bacterial









PDCs and is equivalent to the lowest Km for pyruvate reported for all PDCs (0.24 mM

pyruvate for the PDC from K. lactis) (105, 131). This enzyme also has the highest Vmax

(130 units per mg protein) of recombinant bacterial PDC proteins purified using similar

conditions (131). The high level of Z. palmae PDC produced in recombinant E. coli

combined with the biochemical characteristics of this enzyme make it an exciting enzyme

for the development of new biocatalysts for fuel ethanol production (131).

In 1992, Lowe and Zeikus (132) purified a PDC from Sarcina ventriculi. This

was only the second PDC from bacteria to be characterized and unlike Z. mobilis PDC it

was substrate activated (132). The gene for this PDC was cloned and expressed

recombinantly in E. coli (133). Production of this protein in recombinant E. coli was

low, probably due to large differences in codon usage, therefore augmentation with

accessory tRNAs was necessary (133). The deduced amino acid sequence of S. ventriculi

PDC differs from the Z. mobilis PDC and the SvPDC appears to have diverged from a

common ancestor that included most fungal PDCs and bacterial indole-3-pyruvate

decarboxylases (133). The purified enzyme is biphasic with a Km of 2.8 mM and 10 mM

for pyruvate for the high and low affinity sites, respectively (133). Expression of S.

ventriculi PDC is higher in Bacillus megaterium when compared to S. cerevisiae PDC1,

Z. mobilis PDC, and Acetobacterpasteurianus PDC, indicating that it will be a useful

tool in the engineering of Gram-positive bacteria for ethanol production (this study).

PDC in Plants

In plants, PDC serves to convert pyruvate to acetaldehyde. The acetaldehyde is

then converted to ethanol by alcohol dehydrogenase. In this manner these two enzymes

catalyze a pathway in which NAD+ is regenerated under anaerobic conditions such as









during seed germination and in plant roots when submerged (134). Despite the large

number of PDCs from plants, relatively few have been characterized in detail.

In 1976, Wignarajah and Greenway tested for the effect of anaerobiosis on the

roots of Zea mays (135). In this study, they determined that flushing nitrogen gas

through solutions for a period of 4 to 15 hrs increased activity levels of both alcohol

dehydrogenase and PDC in the Z. mays roots. The PDC from Z. mays was later purified

and characterized (136, 137). It had a Km of 0.5 mM for pyruvate and a Vmax of 96 units

per mg protein. Z. mays PDC was shown to be substrate activated, and cooperative

binding of pyruvate decreased as the pH decreased leading to the enzyme being less

dependant on pyruvate for activation (136).

The PDC from Pisum sativum is one of the most thoroughly characterized plant

PDCs (76, 138-143). Based on Southern hybridization experiment, P. sativum has three

genes for putative-PDCs, of which only one has been sequenced (143). The purified

enzyme is composed of two different subunits (65 kDa and 68 kDa), but it is still

unknown whether the two subunits are transcriptional products of the same or different

genes (142). The P. sativum PDC is activated by its substrate (140) and is ten times more

stable than the PDC from the yeast, S. carlsbergensis (142). The active enzyme is a

mixture of tetramers, octomers, and higher oligomers (139, 142).

Acetaldehyde is a predominant aldehyde in orange juice (144) and significantly

influences flavor (145). PDC is the key enzyme for the formation of acetaldehyde in

oranges (146). The PDC purified from orange fruit is mechanistically similar to yeast

PDC, except that it has only one active site (147).









Ipomoea batatas (sweet potato) produces PDC in its roots (148-150). This PDC

is substrate activated, has a Km of 0.6 mM, and is inhibited by phosphate (149). Pyruvate

decarboxylation is the rate-limiting step in alcoholic fermentations in sweet potato roots

based on the finding that PDC activity is 21- to 28-fold less than ADH activity under

aerobic conditions, but 6- to 8-fold less than ADH under anaerobic conditions (150).

PDC has also been characterized from Triticum aestivum (wheat) (81, 82, 151-

154), Oryza sativa (rice) (155-160), and Viciafaba favaa bean) (161). PDC has been

shown to be produced in but not characterized from Capsicum annuum (bell pepper) fruit

(162), Echinochloa crus-galli (barnyard grass) (163), Nicotiana tobacum (tobacco) (164),

Vitis vinifera (grape) (165), Lycopersicon esculentum (tomato) (166), Lepidium latifolium

(167), Populus deltoides (Eastern cottonwood) (168), Glycine max (soybean) (168), and

Arabidopsis thaliana (169, 170)

Structure of Pyruvate Decarboxylase

The crystal structures ofZ. mobilis (117), S. uvarum (84, 91) and S. cerevisiae

(103) PDCs have been invaluable when studying PDC proteins for use and engineering

for industrial application. By comparison of deduced amino acid sequences and

biochemical characteristics it has been shown that the A. pasteurianus and Z palmae

PDCs are more closely related to Z mobilis PDC (130, 131); whereas, the S. ventriculi

PDC is more closely related to S. cerevisiae PDC1 (133). Because the majority of the

bacterial PDC proteins were only recently discovered (130, 131, 133) there has not been

sufficient time for detailed structural analysis of these enzymes. However, the crystal

structure and mutagenesis analysis of the well characterized Z mobilis, S. uvarum and S.









cerevisiae PDC proteins can give important and useful information about the structure of

the newly identified bacterial PDC proteins.

Subunits of PDC

The quaternary structure of most PDCs is a tetramer with an apparent molecular

weight of 240 kDa (79, 105, 111, 130-133, 148, 151, 155, 171), with the exception of

PDCs forming larger complexes: A. pateurianus (130), Z mays (135), P. sativum (139,

142), T. aestivum (81), and N. crassa (73). The association of the subunits has been

determined to be pH-dependant with optimal pH for catalytic activity and subunit

association of between pH 5.0 and pH 6.7 (108, 113, 131, 132, 147, 155). Until recently

it was believed that the tetramer was the only active conformation (172), but a recent

study showed that both dimers and tetramers of ScPDC 1 had comparable specific activity

(173). This study, however, determined a difference in the dissociation constant for the

regulatory substrate by one order of magnitude among the two forms indicating that

binding of the substrate to the regulatory site is influenced by oligomerization (173). In

contrast, the subunit interactions of the Z mobilis PDC are different than those of S.

cerevisiae PDC1 (117). Unlike the S. cerevisiae PDC1, Z mobilis PDC is not controlled

by allosteric regulation. The reason for this difference is elucidated in the crystal

structures (117). Z mobilis PDC dimers are packed tightly together and lock the enzyme

in an activated form so that large conformational changes are not possible or necessary

for enzyme activity as they are in S. cerevisiae PDC1 (91, 117). This tight packing of the

dimers also explains the extreme stability of the Z mobilis PDC in comparison to the S.

cerevisiae PDC1 (174). This data is also in agreement with the differences in the

thermostabilities of the bacterial PDCs. The Z mobilis, A. pasteurianus, and Z. palmae









PDCs have temperature optima of 600C, while S. ventriculi PDC has a temperature

optimum of 320C and is completely inactive at 600C (131). Structural differences in the

subunit interactions may be responsible for the instability of S. ventriculi PDC at high

temperatures. Analysis of S. ventriculi PDC thermostability throughout a range of pH

shows that the enzyme is more stable between pH 5.0 and pH 5.5 indicating that

protonation of an amino acid side chain may stabilize the subunit interactions at high

temperatures (this study).

Cofactors of PDC

Both Mg2+ and thiamin diphosphate (TPP) are required cofactors for the action of

PDC (175, 176). It has been demonstrated that TPP dissociates from PDC under alkaline

conditions, but it is difficult if not impossible to remove Mg2+ completely from the

enzyme (137, 177-179). Mg2+ can be replaced by other divalent cations, such as Mn2+

Ni2+, Co2+, and Ca2+ (176). The substitution of Mg2+ with these other cations does not

affect the Vmax of the enzyme, but it does affect the stability of the reconstructed

holoenzyme (180, 181). A TPP derivative retaining the N-1'-4'amino system functions

properly with full binding capacity therefore proving that this is the functional group

necessary for activity of the PDC (182, 183). The Z. mobilis PDC retains its tetrameric

state even after the TPP and Mg2+ cofactors are removed (178). This is also true of S.

ventriculi PDC, Z palmae PDC, and S. cerevisiae PDC 1, but not of A. pasteurianus PDC

(131). A. pasteurianus PDC forms both tetramers and octomers of similar specific

activity and dissociates into dimers after cofactor extraction (131). Tetrameric

configuration and activity are restored upon addition of the cofactors (131). The

dissociation of the subunits is consistent with the behavior of other PDCs upon cofactor









removal (76). Residues responsible for binding the cofactors, as determined through X-

ray crystallography studies, are conserved throughout yeast and bacterial PDC proteins

(91, 103, 131).

Kinetics of PDC

There are currently two distinct groups of PDC proteins based on kinetics. All

known PDC proteins, except those from Gram-negative bacteria, are allosterically

regulated (76). The substrate activation behavior of S. cerevisiae PDC has been studied

in detail through site-directed mutagenesis and crystal structure analysis (47, 86-91, 103,

184-191). Initial studies of the S. uvarum PDC determined that a cysteine residue was

most likely responsible for the substrate activation behavior. In these studies, irreversible

activation of the enzyme, exhibited by disappearance of the lag phase in product

formation, was achieved by utilization of thiol specific reagents (80, 192-194). Use of a

PDC 1-PDC6 fusion protein that contained Cys221 as its only cysteine residue suggested

that the Cys221 residue was responsible for the substrate activation behavior of S.

cerevisiae PDC (86). Site-directed mutagenesis of the Cys221 and/or Cys222 to serine

showed that the enzyme could no longer be activated by the substrate (87). Steady state

kinetics studies were also used to bolster the argument for Cys221 as the site of substrate

activation (88, 89). Although crystal structures of S. uvarum and S. cerevisiae PDC were

determined in the presence and absence of effectors (84, 103, 187, 195), these crystal

structures were not of high enough quality to determine where the activator molecules

bound the enzyme More recently, Lu et al. obtained a high resolution crystal structure

of S. uvarum PDC in the presence of pyruvamide and determined that pyruvamide did not

bind at or near Cys221 (91). This study also used kinetics to show that the Cys221Ser









was in fact still substrate activated (91); however, this data was later refuted by Wei et

al. (90) who used solvent kinetic isotope effect to reaffirm that their original assertion

that Cys221 Ser does shift the enzyme into an active conformation. Lu et al. (91)

determined the residues that bind pyruvamide in the regulatory site of the crystal

structure of PDC1 as Tyr157 and Arg 224. Sergeinko et al. (191), however, argues that

pyruvamide should not be considered to form an active conformation of the enzyme and

may actually represent an inhibitory mode of binding. It is interesting to note that plant

PDCs and the S. ventriculi PDC are substrate activated, yet the Cys221 equivalent is not

conserved in these proteins while equivalent residues for Tyrl57 and Arg224 are

conserved (121, 131, 133).

The Gram-negative bacterial PDC proteins are the only known PDCs that exhibit

Michaelis-Menten kinetics (111-113, 130, 131). These PDCs also have high affinity for

the substrate pyruvate with a Km of 0.24 mM pyruvate for Z palmae PDC, 0.39 mM

pyruvate for A. pasteurianus PDC, and 0.43 mM pyruvate for Z. mobilis PDC (131). The

Gram-negative bacterial PDCs also have the highest Vmax values of all PDCs (68, 131).

The low Km and high Vmax of Z. mobilis PDC have already been exploited successfully

to engineer biocatalysts for fuel ethanol production (4).

Catalytic Residues of PDC

All crystal structures of TPP dependent enzymes have a glutamate residue close to

the N-l' of TPP that promotes the ionization of the C-2 proton of TPP (121). Candy et

al. demonstrated that substitution of Glu50 with either aspartate or glutamine yields an

enzyme with 3.0% and 0.5% remaining catalytic activity of the wild-type enzyme,

respectively (119). Each of these mutants also displays a decreased affinity for both









cofactors (119). The equivalent glutamate in yeast, Glu51, is also essential for catalytic

activity (196). Only 0.04% catalytic activity of the wild-type enzyme remains upon

substitution of Glu51 with glutamine and binding of TPP to the protein is slow (196).

The Z. mobilis PDC crystal structure reveals that amino acid side chains Asp27, His 13,

Hisl 14, Thr388, and Glu473 are in the vicinity of the active site and are conserved

among PDC proteins (117). This data corresponds well with the crystal structure data

and site-directed mutagenesis studies of the S. cerevisiae, Z. mobilis, and S. uvarum

PDCs (91, 120, 122, 195, 197).

Alternative Substrates of PDC

As discussed previously in this chapter, Neuberg and Hirsch (36, 38) first

discovered that yeast could catalyze the formation of PAC when benzaldehyde was added

to the medium. This reaction was later determined to be catalyzed by PDC (43-46). It

has since been shown that the yeast PDCs are much more efficient at carboligase

reactions than the PDC from Z mobilis (65). The reason for this difference is believed to

be the size of the active site cleft which is smaller in the Z. mobilis PDC than its yeast

counterparts (117). Bruhn et al. found that the mutation of only one amino acid increased

carboligase activity by Z mobilis PDC by 4-fold when compared to wild-type (70). The

crystal structure of Z mobilis PDC showed other large side chains that were possible sites

for mutagenesis to increase carboligase activity (117). Pohl et al. have since made these

mutations and found a wide variety of carboligase activities catalyzed by these PDC

variants, including one in which the stereochemistry has been changed to form (S)-

phenylacetylcarbinol (123).









PDC from Brewer's yeast catalyzes the formation of acetoin through two separate

mechanisms (198-200). Acetoin is produced by the aldol-type condensation reaction

between two molecules of acetaldehyde or by the addition of acetaldehyde to an

intermediate formed between pyruvate and thiamin pyrophosphate (198-200).

Besides pyruvate, yeast PDCs have been shown to accept longer aliphatic a-keto acids

like a -keto butanoic acid, a -keto pentanoic acid, branched aliphatic a -keto acids, as

well as a -keto-phenylpropanoic acid (benzoylformate) and various phenyl-substituted

derivatives of the latter (69, 201, 202). Only C4 and C5-keto acids have been shown to

be substrates for PDC from Z mobilis (65).

Study Rationale and Design

Engineering Gram-positive bacteria for ethanol production has been difficult due

to the absence of suitably expressedpdc genes. A PDC was previously purified and

characterized from the Gram-positive bacterium S. ventriculi; however the gene was not

cloned (132). It was expected that S. ventriculi PDC will be expressed at high levels in

Gram-positive hosts due to its origination from a Gram-positive bacterium. To test this

possibility the pdc gene from S. ventriculi was cloned, sequenced, and characterized.

SvPDC was expressed in recombinant E. coli and the protein was biochemically

characterized. SvPDC was expressed in a Gram-positive host, B. megaterium. SvPDC

production in B. megaterium was analyzed and optimal conditions for SvPDC activity in

B. megaterium were determined. Expression analysis and optimization of a variety of

PDCs (i.e. Z mobilis, A. pasteurianus, S. cerevisiae, and S. ventriculi) in B. megaterium

were performed to determine the optimal PDC for ethanol production in Gram-positive

bacterial hosts.
















CHAPTER 2
CLONING AND EXPRESSION OF pdc, AND CHARACTERIZATION OF
PYRUVATE DECARBOXYLASE FROM Sarcina ventriculi

Introduction

PDC (EC 4.1.1.1) serves as the key enzyme in all homo-ethanol fermentations.

This enzyme catalyzes the non-oxidative decarboxylation of pyruvate to acetaldehyde

and carbon dioxide using Mg2+ and thiamine pyrophosphate (TPP) as cofactors.

Acetaldehyde is subsequently reduced to ethanol by alcohol dehydrogenase (ADH,

EC1.1.1.1) during the regeneration of NAD+. PDC is widespread among plants, absent in

animals, and rare in prokaryotes. Prior to this study, the only bacterial pdc gene described

was from the Gram-negative a-proteobacterium Zymomonas mobilis (114-116, 203). Z.

mobilis PDC was purified to homogeneity, crystallized, and extensively characterized

(121). This enzyme has also been purified from an unusual Gram-positive organism,

Sarcina ventriculi (132).

S. ventriculi is an obligate anaerobe that grows from pH 2 to pH 10, fermenting

hexose and pentose sugars to produce acetate, ethanol, format, CO2 and H2 (204, 205).

In this organism, the relative production of ethanol and acetate vary with environmental

pH. Under acidic conditions where acetic acid is toxic to cells, ethanol is the primary

product (205). At neutral pH and above, a near equimolar mixture of ethanol and acetate

are produced with low levels of format (206). These changes in fermentation profiles









have been attributed to changes in the levels of two enzymes that metabolize pyruvate,

PDC and pyruvate dehydrogenase (205, 206).

The properties of the S. ventriculi PDC are very different from those of the Z.

mobilis enzyme. Unlike the Michaelis-Menten kinetics of Z. mobilis PDC (111, 116), the

S. ventriculi enzyme is activated by pyruvate (132), similar to PDC enzymes from yeast

and higher plants. S. ventriculi PDC was reported to have an unusually high Km for

pyruvate (13 mM) compared to Km values of 0.3 mM to 4.4 mM for other PDC enzymes

(111, 116, 207). The phenylalanine content of purified S. ventriculi PDC was reported to

be 4-fold to 5-fold higher than that of other PDC enzymes suggesting significant

differences in primary structure (132).

To further examine the unusual nature of the S. ventriculi PDC, this gene was

cloned, sequenced, and expressed in recombinant E. coli. This approach provided the

primary amino acid sequence and facilitated PDC purification for further kinetic and

biophysical characterization.


Materials and Methods

Materials

Biochemicals were purchased from Sigma Chemical Co. (St. Louis, Mo.). Other

organic and inorganic analytical grade chemicals were from Fisher Scientific (Atlanta,

Ga.). Restriction endonucleases and DNA-modifying enzymes were from New England

BioLabs (Beverly, Mass.). Oligonucleotides were from Sigma-Genosys (The

Woodlands, Tex.). Digoxigenin-11-dUTP (2'-deoxyuridine-5'-triphosphate coupled by

an 11-atom spacer to digoxigenin), alkaline phosphatase conjugated antibody raised

against digoxigenin, and nylon membranes for colony and plaque hybridizations were









from Roche Molecular Biochemicals (Indianapolis, Ind.). Positively charged membranes

for Southern hybridization were from Ambion (Austin, Tex.).

Bacterial Strains and Media

Table 2-1 lists the E. coli strains used in this study including strains TB-1 and

DH5ca that were used for routine recombinant DNA experiments. E. coli strain SE2309

was used to create a genomic DNA library in plasmid pBR322. E. coli strains ER1647,

LE392, and BM25.8 were used in conjunction with MBlueSTAR for a genomic DNA

library. E. coli strains BL21(DE3), BL21-CodonPlus-RIL, and BL21-CodonPlus-

RIL/pSJS1240 were used to examine the expression of the S. ventriculi pdc gene from

plasmid pJAM419. E. coli strains were grown in Luria-Bertani (LB) medium and

supplemented with antibiotics as appropriate (30 mg of chloramphenicol per liter, 100 mg

of carbenicillin per liter, 100 mg of ampicillin per liter, and/or 50 mg of spectinomycin

per liter). S. ventriculi strain Goodsir was cultivated as described previously (205).

DNA Isolation

Plasmid DNA was isolated and purified using a Quantum Prep Plasmid Miniprep

Kit from BioRad (Hercules, Ca.). DNA fragments were eluted from 0.8% SeaKem GTG

agarose (FMC Bioproducts, Rockland, Me.) using either Ultrafree-DA filters from

Millipore (Bedford, Md.) or the QIAquick gel extraction kit from Qiagen (Valencia, Ca.).

S. ventriculi genomic DNA was isolated and purified as described previously (208).

Cloning of the S. ventriculipdc Gene

A degenerate oligonucleotide (5'-AARGARGTNAAYGTNGARCAYA-

TGTTYGGNGT-3') was synthesized based on the N-terminal amino acid sequence of

PDC purified from S. ventriculi (132)(where, R is A or G; N is A, C, G, or T; Y is C or

T). This oligonucleotide was labeled at the 3'-end using terminal transferase with









digoxigenin-11-dUTP and dATP as recommended by the supplier (Roche Molecular

Biochemicals) and was used to screen genomic DNA from S. ventriculi.

For Southern analysis, genomic DNA was digested with BglI, EcoRI, or HincII, separated

by 0.8% agarose electrophoresis, and transferred to positively charged nylon membranes

(209). Membranes were equilibrated at 580C for 2 h in 5x SSC (Ix SSC is 0.15 M NaCl

plus 0.015 M sodium citrate) containing 1% blocking reagent (Roche Molecular

Biochemicals), 0.1% N-lauroylsarcosine, and 0.02% SDS. After the probe (0.2 pmol per

ml) and Poly(A) (0.Olmg per ml) were added, membranes were incubated at 58C for

18.5 h. Membranes were washed twice with 2 X SSC containing 0.1% SDS (5 min per

wash) at 250C and twice with 0.5 X SSC containing 0.1% SDS (15 min per wash) at

580C. Signals were visualized using colorimetric detection according to supplier (Roche

Molecular Biochemicals).

For generation of a genomic library in plasmid pBR322, S. ventriculi

chromosomal DNA was digested with HincII and fractionated by electrophoresis. The

2.5- to 3.5-kb HincII DNA fragments were ligated into the EcoRV site of pBR322 and

transformed into E. coli SE2309. Colonies were screened with the degenerate

oligonucleotide by colorimetric detection. By this method, plasmid pJAM400 that carries

a HincII fragment containing 1,350 bp of thepdc gene was isolated.

The ,BlueSTAR Vector System (Novagen) was used to create an additional

genomic library to facilitate isolation of the full-lengthpdc gene from S. ventriculi.

Genomic DNA was digested with BclI, separated by electrophoresis in 0.8% agarose, and

the 6.5- to 8.5-kb fragments were ligated with the ,BlueSTAR BamHI arms. In vitro

packaging and plating of phage was performed according to the supplier (Novagen). A









DNA probe was generated using an 800-bp EcoRI fragment of the pdc gene from

pJAM400 that was labeled with digoxigenin-11-dUTP using the random primed method

as recommended by the supplier (Roche Molecular Biochemicals). Plaques were

screened using colorimetric detection. Cre-loxP-mediated subcloning was used to

circularize the DNA of the positive plaques by plating MBlueSTAR phage with E. coli

BM25.8 that expresses Cre recombinase (Novagen). The circularized plasmid pJAM410

was then purified and electroporated into E. coli DH5ca.

For generation of apdc expression vector, the promoterless pdc gene was

subcloned into pET21d after amplification from pJAM413 (Table 2-1) by the polymerase

chain reaction (PCR). Primers were designed for directional insertion using BspHI (oligo

1) and Xhol (oligo 2) restriction sites. The resulting fragment was ligated into compatible

Ncol and Xhol sites of pET21d (Novagen) to produce pJAM419 (Figure 2-1). The fidelity

of the pdc gene was confirmed by DNA sequencing.

Nucleotide and Protein Sequence Analyses

DNA fragments of plasmids pJAM400 and pJAM410 (Figure 2-1) were

subcloned into plasmid vector pUC19 for determining the pdc sequence using the

dideoxy termination method (210) and a LI-COR (Lincoln, Neb.) automated DNA

sequencer (DNA Sequencing Facility, Department of Microbiology and Cell Science,

University of Florida). The nucleotide sequence of the S. ventriculi pdc gene and

surrounding DNA was deposited in the GenBank database (accession number

AF354297).

Genepro 5.0 (Riverside Scientific, Seattle, WA), ClustalW version 1.81 (211),

Treeview version 1.5 (212), and MultiAln (213) were used for DNA and/or protein









sequence alignments and comparisons. Deduced amino acid sequences were compared to

protein sequences available in the GenBank, EMBL, and SwissProt databases at the

National Center for Biotechnology Information (Bethesda, Md.) using the BLAST

network server (214). The Dense Alignment Surface (DAS) method was used for the

prediction of transmembrane a-helices (215).

Production of S. ventriculi PDC in Recombinant E. coli

Plasmid pJAM419 was transformed into E. coli BL21-CodonPlus-RIL containing

plasmid pSJS1240 (Table 2-1). Expression ofthepdc gene in this plasmid is regulated

by the bacteriophage T7 RNA polymerase-promoter system (Novagen). Freshly

transformed cells were inoculated into LB medium containing ampicillin, spectinomycin,

and chloramphenicol and grown at 370C (200 rpm) until cells reached an O.D.600nm of 0.6

to 0.8 (mid-log phase). Transcription/translation ofpdc was initiated by the addition of 1

mM isopropyl-y-D-thiogalactopyranoside (IPTG). Cells were harvested after 2-3 h by

centrifugation at 5000 x g (10 min, 4C) and stored at -700C or in liquid nitrogen.

Purification of the S. ventriculi PDC Protein

All purification buffers contained 1 mM TPP and ImM MgSO4 unless indicated

otherwise. Recombinant E. coli cells (14.8 g wet wt) were thawed in 6 volumes (wt/vol)

of 50 mM Na-P04 buffer at pH 6.5 (Buffer A) and passed through a French pressure cell

at 20,000 lb per in2. Cell debris was removed by centrifugation at 16,000 x g (20 min,

4C). Supernatant was removed and filtered through a 45 |tm filter membrane. Filtrate

(692 mg protein) was applied to a Q Sepharose Fast Flow 26/10 column (Pharmacia) that

was equilibrated with Buffer A containing 300 mM NaC1. The SvPDC did not bind and

eluted in the wash. The wash fractions containing PDC activity (326 mg protein) were









precipitated with 80% (NH4)2SO4. Protein was dissolved in Buffer A, dialyzed against

buffer A (4C, 16 h), and filtered (.45 |tm membrane). The filtrate (287 mg) was applied

to a Q Sepharose column equilibrated with Buffer A and developed with a linear NaCl

gradient (0 to 400 mM NaCl in 220 ml of Buffer A). PDC active fractions eluted at 230

to 300 mM NaCl and were pooled. The pooled sample (23 mg) was applied to a 5 ml

Bio-scale hydroxyapatite type I column (BioRad) that was equilibrated with 5 mM Na-

PO4 buffer at pH 6.5 (Buffer B). The column was washed with 15 ml Buffer B and

developed with a linear Na-PO4 gradient (5 to 500 mM Na-PO4 at pH 6.5 in 75 ml).

Protein fractions (11.4 mg) with PDC activity eluted at 200 to 300 mM Na-PO4 and were

pooled. For further purification, portions of this material (0.25 to 0.5 mg protein per 0.25

to 0.5 ml) were applied to a Superdex 200 HR 10/30 column (Pharmacia) equilibrated in

50 mM Na-PO4 at pH 6.5 with 150 mM NaCl and 10% glycerol in the presence or

absence of 1 mM MgSO4 and 1 mM TPP.

Activity Assays

PDC activity was assayed by monitoring the pyruvate-dependent reduction of

NAD+ with baker's yeast alcohol dehydrogenase (ADH) (Sigma) as a coupling enzyme at

pH 6.5 as previously described (115), with the following modifications. Buffered

enzyme (100 tl) was added to a final volume of 1 ml containing 0.15 mM NADH, 0.1

mM TPP, 0 to 25 mM pyruvate, and 10 U ADH in 50 mM potassium-MES (2-[N-

morpholino]ethanesulfonic acid) buffer with 5 mM MgCl2 at pH 6.5. Since this assay

does not distinguish PDC from NADH oxidizing enzymes such as lactate dehydrogenase,

activity of cell lysate was estimated by correcting for control reactions performed in the

absence of added ADH. One unit of enzyme activity is defined as amount of enzyme that









oxidizes 1 [tmol of NADH per min. Thermostability was determined by incubating

purified PDC in 50 mM Na-P04 buffer at pH 6.5 with 1 mM TPP and 1 mM MgCl2 for

90 min and then assaying for activity with 10 mM pyruvate under standard conditions.

Protein concentration was determined using Bradford protein reagent with bovine serum

albumin as the standard (BioRad).

Molecular Mass and Amino Acid Sequence Analyses

Subunit molecular mass was estimated by reducing and denaturing sodium

dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) using 12%

polyacrylamide gels which were stained with Coomassie blue R-250. The molecular

weight standards for SDS-PAGE were: phosphorylase b (97.4 kDa), bovine serum

albumin (66.2 kDa), ovalbumin (45 kDa), carbonic anhydrase (31 kDa), trypsin inhibitor

(21.5 kDa), and lysozyme (14.4 kDa). For determination of native molecular mass,

samples were applied to a Superdex 200 HR 10/30 column equilibrated with 50 mM Na-

P04 buffer at pH 6.5 with 150 mM NaC1, 10% glycerol, and no added cofactors.

Molecular mass standards included: serum albumin (66-kDa), alcohol dehydrogenase

(150 kDa), a-amylase (200 kDa), apoferritin (443 kDa), and thyroglobulin (669 kDa).

The N-terminal sequence was determined for PDC protein purified from

recombinant E. coli. The protein was separated by SDS-PAGE and electroblotted onto a

polyvinylidene difluoride (PVDF) membrane (Immobilon-P). The sequence was

determined by automated Edman degradation at the protein chemistry core facility of the

University of Florida Interdisciplinary Center for Biotechnology Research.









Results and Discussion


PDC Operon in S. ventriculi

The N-terminal amino acid sequence of the PDC protein purified from S.

ventriculi (132) was used to generate a degenerate oligonucleotide for hybridization to

genomic DNA. This approach facilitated the isolation of a 7.0-kb BclI genomic DNA

fragment from S. ventriculi. The fragment was further subcloned in order to sequence

both strands of a 3,886 bp HincII-to-HincII region that hybridized to the oligonucleotide

probe (Figure 2-1). Analysis of the DNA sequence revealed an open reading frame

(ORF) of 1,656 bp encoding a protein with an N-terminus identical to that of the

previously purified S. ventriculi PDC (Figure 2-2). The ORF is therefore designated pdc.

A canonical Shine-Dalgrano sequence is present 7 bp upstream of the pdc translation start

codon. In addition, a region 82 to 110 bp upstream ofpdc has limited identity to the

eubacterial -35 and -10 promoter consensus sequence. Downstream (43 bp) of the pdc

translation stop codon is a region predicted to form a stem-loop structure followed by an

AT-rich region, consistent with a p-independent transcription terminator. Thus, the S.

ventriculipdc appears to be transcribed as a monocistronic operon like the Z mobilispdc

gene (115).

A partial ORF was identified 722 bp upstream ofpdc which encodes a 177 amino

acid protein fragment (ORF1*) (Figure 2-1). ORF1* has identity (28-29 %) to several

hypothetical membrane proteins (GenBank accession numbers CAC11620, CAC24018,

CAA22902) and is predicted to form several transmembrane spanning domains (data not

shown).









PDC Protein Sequence in S. ventriculi

The S. ventriculipdc gene apparently encodes a protein of 552 amino acids

(including the N-terminal methionine) with a calculated pi of 5.16 and anhydrous

molecular mass of 61,737 Da. Consistent with other Z mobilis and fungal PDC proteins,

the N-terminal extension of up to 47 amino acids that is common to plant PDC proteins is

not conserved in the S. ventriculi PDC protein. Although the pi of the purified S.

ventriculi PDC protein has not been experimentally determined, the calculated pi is

consistent with the acidic pH optimum of 6.3 to 6.7 for stability and activity of this

enzyme (132). The amino acid composition of the protein deduced from the S. ventriculi

pdc gene is similar to that determined for the S. cerevisiae PDC1 and Z mobilispdc

genes (Table 2-2). A notable exception is the alanine composition ofZ. mobilis PDC,

which is 1.8- to 2.2-fold higher than the composition of S. cerevisiae PDC1 and S.

ventriculi PDC. Although the phenylalanine composition of the deduced S. ventriculi

PDC protein is consistent with the other PDC proteins, it is almost 3.6-fold less than the

composition previously reported for the purified S. ventriculi enzyme (132). The reason

for this discrepancy remains to be determined.

The amino acid sequence of S. ventriculi PDC was aligned with the sequences of

the yeast (Sc) PDC1 and Z mobilis (Zm) PDC proteins, both of which have been

analyzed by X-ray crystallography (76, 84, 103, 117) (Figure 2-3). The conserved motif

of TPP-dependent enzymes identified by Hawkins et al. (216) and known to be involved

in Mg2+-TPP cofactor binding is highly conserved in all three PDC proteins. Other

amino acid residues located within a 0.4 nm distance of the Mg2+ and TPP binding site of

the two crystallized PDC proteins are also conserved in the S. ventriculi PDC protein.









These include residues with similarity to the aspartate (SceD444, ZmoD440) and

asparagine residues (SceN471, ZmoN467) that are involved in binding Mg2+. The S.

ventriculi PDC appears to be more similar to the yeast PDC than to that of Z mobilis in

binding the diphosphates of TPP where serine and threonine side chains (SceS446 and

T390) as well as the main chain nitrogen of isoleucine (SceI476) are conserved. This

contrasts with the Z mobilis enzyme, which utilizes a main chain nitrogen of aspartate

(ZmoD390) instead of the threonine hydroxyl group (SceT390) for binding the 3-

phosphate. S. ventriculi PDC residues are also similar to the aspartate, glutamate,

threonine, and histidine residues (SceD28, E477, T388, HI 14 and HI 15; ZmoD27, E473,

T388, H113, and H114) which may potentially interact with intermediates during the

decarboxylation reaction mediated by Z. mobilis and yeast PDCs. Furthermore, the

isoleucine (Sc and Zm 1415) side chain which appears to stabilize the V conformation of

TPP through Van der Waals interactions as well as the glutamate (SceE51, ZmoE50)

which may donate a proton to the Nl' atom of TPP are conserved in the S. ventriculi

PDC protein sequence.

A notable exception in conservation is the yeast C221 residue (Figure 2-3), which

is highly conserved among the majority of fungal PDC enzymes but is not conserved in

either bacterial or plant PDC proteins. Based on site directed mutagenesis, chemical

modification, and kinetic studies, this C221 residue has been proposed to be a primary

binding site of the regulatory substrate molecule and the starting point of a signal transfer

pathway to the active site TPP in the yeast enzyme (87, 89, 193). Consistent with these

previous results the yeast C221 is positioned in a large cavity formed at the interface

among all three PDC domains including the ac or PYR (residues 1 to 189), 3 or R









(residues 190 to 356), and y or PP (residues 357 to 563) domains (84). However, recent

high-resolution structural analysis of the brewer's yeast PDC crystallized in the presence

of pyruvamide, a pyruvate analogue, enabled localization of the activator binding site and

revealed that cysteine does not play a direct role in this binding (91). Additionally,

kinetic studies using stopped-flow techniques revealed that the C221A variant of yeast

PDC was still substrate activated, and the lag phase of product formation did not

disappear with progressive thiol oxidation (91). Instead, tyrosine (Y157) and arginine

(R224) residues form hydrogen bonds with the amide group of pyruvamide. Both of

these residues are conserved in the S. ventriculi PDC and not found in the Z. mobilis

enzyme which displays Michaelis-Menten kinetics. These results suggest that residues of

the S. ventriculi PDC protein may allosterically bind the substrate activator with a

mechanism common to the majority of fungal PDC proteins. Interestingly, these two

residues that bind pyruvamide in the yeast enzyme are not universally distributed among

the substrate activated PDC enzymes, most notably the plant PDCs.

Phylogenetic analysis was performed to compare the PDC proteins and other

TPP-dependent enzymes including indole-3-pyruvate decarboxylase (IPD), the El

component of pyruvate dehydrogenase (El), acetolactate synthase (ALS), and

transketolase (TK) (Figure 2-4). The comparison reveals that all of these proteins are

related in primary sequence and that there is a significant clustering of the sequences into

families based on specific enzyme function. Of these, the S. ventriculi PDC appears most

closely related to eubacterial IPD proteins as well as the majority of fungal PDC proteins.

In contrast, the Z. mobilis PDC protein is most closely related to plant PDCs in addition

to a couple of out-grouping fungal PDCs. Thus, it appears that the IPD protein family









has close evolutionary roots with the PDC family and specifically the S. ventriculi PDC

protein. In addition, the distant relationship of the S. ventriculi and Z mobilis PDC

proteins is consistent with the biochemical differences between these two enzymes (111,

116, 132, 207). In contrast to Z mobilis PDC which may have originated by the

horizontal transfer of a plantpdc gene, S. ventriculi PDC appears to have diverged early

during evolution and last shared a common ancestor with most eubacterial IPD and

fungal PDC enzymes.

The unique nature of the S. ventriculi PDC enabled us to search for previously

unknown PDC-like proteins (Figure 2-5). A new subfamily of hypothetical PDC proteins

from Gram-positive bacteria has now been identified for further study due to their

similarity to the newly identified S. ventriculi PDC. This subfamily includes PDC

proteins from Gram-positive organisms including two bacilli, Bacillus allu/liuc i% and

Bacillus cereus.

Production of S. ventriculi PDC Protein

Unlike Z mobilispdc, the codon usage ofthepdc of S. ventriculi dramatically

differs from that of E. coli (Table 2-3). In particular, the pdc gene of S. ventriculi

requires elevated use of tRNAAUA and tRNAAGA both of which are relatively rare in E.

coli. This is in contrast to the Z mobilispdc gene, which does not use the AUA codon

and has only minimal use of the AGA codon. This suggests that production of the S.

ventriculi PDC protein in recombinant E. coli may be limited by mRNA translation.

To further investigate this, the levels of the tRNA genes that are rare in E. coli

were modified during pdc expression by including multiple copies of these genes on the









chromosome (E. coli strain BL21-CodonPlus-RIL) and/or on a complementary plasmid

(pSJS1240) (Table 2-1). These modified E. coli strains were transformed with plasmid

pJAM419 which carries the S. ventriculi pdc gene positioned 8 bp downstream of an

optimized Shine-Dalgrano consensus sequence and controlled at the transcriptional-level

by T7 RNA polymerase promoter and terminator sequences from plasmid vector pET21d.

Detectable levels of PDC activity (0.16 U per mg protein at 5 mM pyruvate) were

observed after induction of pdc transcription in E. coli host strains with additional

chromosomal and/or plasmid copies of the ileU/ileX, argU and leuW genes encoding the

rare tRNAAUA, tRNAAGG/AGA, and tRNACUA. A 5- to 10-fold increase in the level of a 58-

kDa protein with a molecular mass comparable to the S. ventriculi PDC (Figure 2-6) was

produced in these strains compared to a similar E. coli strain without added tRNA genes

[BL21(DE3)] (data not shown). These results suggest that the S. ventriculi PDC protein

is synthesized in recombinant E. coli and that the high percentage of AUA and AGA

codons of the pdc gene probably limits translation.

Interestingly, additional proteins of 43 and 27 kDa were also observed when the

PDC protein was synthesized in E. coli compared to control strains (Figure 2-6). The

origin of these proteins remains to be determined. They may be fragments of PDC

generated by proteolysis or truncated PDC produced from errors in

translation/transcription. Alternatively, increased production of PDC may increase the

levels of acetaldehyde, which can be toxic to the cell, and may subsequently induce the

levels of proteins in response to this stress.

Properties of the S. ventriculi PDC Protein from Recombinant E. coli

The S. ventriculi PDC protein was purified over 136-fold from a recombinant E.

coli. The N-terminal amino acid sequence of this protein (MKITIAEYLLXR, where X is









an unidentified amino acid) was identical to the sequence of PDC purified from S.

ventriculi (132). Both PDC proteins have an N-terminal methionine residue, which

suggests that this residue is not accessible for cleavage by either the S. ventriculi or E.

coi aminopeptidases.

The thermostability of the purified S. ventriculi PDC was examined in the

presence of 1 mM cofactors TPP and Mg2+ at pH 6.5. Enzyme activity was stable up to

42'C but was abolished after incubation for 60 to 90 min at temperatures of 50C and

above. This is consistent with the significant loss of PDC activity observed when a

thermal treatment step (600 C for 30 min) was included in the purification (data not

shown). In contrast, methods used to purify Z. mobilis and other PDC proteins (76)

typically incorporate thermal treatment to remove unwanted proteins. These results

suggest that the recombinant S. ventriculi PDC protein is not as thermostable as other

PDC proteins including that of Z mobilis.

PDC proteins have been shown to bind TPP and Mg2+ cofactors with high affinity

at slightly acidic pH (76). Consistent with this, the recombinant S. ventriculi PDC retains

full activity after incubation at 37C for 90 min in the presence of 25 mM EGTA or

EDTA in pH 6.5 buffer without cofactors. This is similar to the PDC protein purified

directly from S. ventriculi which is fully active after similar treatment with metal

chelators.

The recombinant S. ventriculi enzyme displays sigmoidal kinetics (Figure 2-7)

suggesting substrate activation similar to the fungal and plant PDC proteins (76). This

contrasts with the Z. mobilis PDC which is the only PDC protein known to display

Michaelis-Menten kinetics. The recombinant S. ventriculi PDC has a Km of 2.8 mM for









pyruvate and Vmax of 66 U per mg protein for acetaldehyde production (Figure 2-7). This

Km value is almost 5-fold less than the Km (13 mM) observed for the PDC purified from

S. ventriculi (132); however, it is within the range of Km values determined for many of

the fungal and plant PDCs including those purified from S. cerevisiae (1 to 3 mM)(184,

217), Zygosaccharomyces bisporus (1.73 mM) (107), orange (0.8 to 3.2 mM) (147), and

wheat germ (3 mM) (81). The Km value for the recombinant PDC protein is several-fold

higher than those values reported for the PDCs ofZ. mobilis (0.3 to 0.4 mM) (112, 113)

and rice (0.25 mM)(155).

The reason for the apparent discrepancy in affinity for pyruvate between the PDC

purified from S. ventriculi and that from recombinant E. coli may in part be due to the

type of buffer used in the enzyme assay (sodium hydrogen maleate vs. potassium-MES

buffer pH 6.5, respectively). The Z. mobilis PDC, which was reported to have a Km of

4.4 mM for pyruvate was determined in Tris-maleate buffer at pH 6 (111) while the Km

values of 0.3 to 0.4 mM were from assays using potassium-MES buffer at pH 6 (112) and

sodium citrate buffer at pH 6.5, respectively (113). It is also possible that the different

methods used for purification of the S. ventriculi PDC protein may have influenced its

affinity. In our study, the cofactors TPP and Mg2+ were included in the buffers for all

purification steps. This differs from the initial steps used for purification of PDC from S.

ventriculi (132) which may have resulted in partial loss of cofactors and decreased

affinity of the enzyme for its substrate, pyruvate. If so, it is more likely TPP than Mg2

since metal chelators do not influence the activity of either the PDC purified from

recombinant E. coli (described above) or the enzyme purified from S. ventriculi at pH 6.5

(132). An additional possibility is that synthesis of PDC in E. coli may have modified the









affinity of the enzyme through misincorporation of amino acids due to a high percentage

of rare codons in the gene.

At pH 6.5, the recombinant PDC forms a 235-kDa homotetramer consisting of a

58-kDa protein, as determined by Superdex 200 gel filtration chromatography and SDS-

12% PAGE electrophoresis (see methods). Exclusion of the cofactors from the buffer

during gel filtration chromatography at pH 6.5 did not alter the tetramer configuration or

enzyme activity, suggesting that the cofactors are tightly bound. The configuration of the

PDC complex is consistent with that purified from S. ventriculi as well as the majority of

those isolated from fungi, plants, and Z mobilis. There are however, plant PDCs which

have been reported to form larger complexes including the PDC from Neurospora crassa

which forms aggregated filaments of 8-10 nm (73) as well as the PDC from Pisum

sativum which forms up to 960 kDa complexes (142).


Conclusion

Based on this study, the S. ventriculi PDC protein appears to share similar

primary sequence structure to TPP-dependent enzymes and is highly related to the fungal

PDC and eubacterial IPD enzymes. The close relationship of the S. ventriculi and fungal

PDC structures is consistent with the similar biochemical properties of these enzymes.

Both types of enzymes display substrate cooperativity with similar affinities for pyruvate.

The structure and biochemistry of the S. ventriculi PDC, however, dramatically contrast

with the only other bacterial PDC (Z mobilis) that has been characterized. The Z mobilis

PDC is closely related to plants in primary structure; however, it is the only PDC enzyme

known to display Michaelis-Menten kinetics.









This study also demonstrates the synthesis of active, soluble S. ventriculi PDC

protein in recombinant E. coli. Only two other genes, the Z. mobilispdc and S. cerevisiae

PDC1 genes, have been reported to synthesize PDC protein in recombinant bacteria (114,

115, 218). Of these, at least 50% of the S. cerevisiae PDC1 forms insoluble inclusions in

E. coli and thus has not been useful in engineering bacteria for high-level ethanol

production (218). Due to codon bias, accessory tRNA is essential for efficient production

of S. ventriculi PDC in recombinant E. coli. However, the low G+C codon usage of the

S. ventriculipdc gene should broaden the spectrum of bacteria that can be engineered as

hosts for high-level production of PDC protein and the engineering of homo-ethanol

pathways (4). The S. ventriculi PDC is unique among previously characterized bacterial

PDCs. This has enabled the identification of a new subfamily of PDC-like proteins from

Gram-positive bacteria that will broaden the host range of future endeavors utilizing

Gram-positive bacterial hosts.









Table 2-1. Strains and plasmids used for production of PDC from S. ventriculi in E. coli.


Strain or plasmid


Source


S. ventriculi
Goodsir


E. coli TB-1

E. coli DH5ac

E. coli SE2309


E. coli ER1647



E. coli LE392


BM25.8


E. coli BL21-
CodonPlus-RIL

E. coli
BL21(DE3)


pBR322
pUC19
pBlueSTAR-1

pET21d
pSJS1240

pJAM400



pJAM410


Phenotype, genotype, description, PCR
primers
American Type Culture Collection
55887
F- ara A(lac-proAB) rpsL (Strr)
[4801ac A(lacZ)M15] thi hsdR(rk- mk )
F- recA1 endA1 hsdR 7(rk mk+) supE44
thi-1 gyrA relA1
F- el4-(McrA-) endAl supE44 thi-1
relAl? rfbD]? spoTI? A(mcrC-
mrr)114::IS10 pcnB80 zad2084::TnO0
F JhuA2A(lacZ) rl supE44 trp31
mcrA1272::Tn10(Tetr) his-1 rpsL104
(Strr)xyl-7 mtl-2 metBI A(mcrC-
mrr)102::Tn0O(Tetr) recD1040
F- el4-(McrA-) hsdR514(rk mk+)
supE44 supF58 lacY1 or A(laclZY)6
galK2 galT22 metBI trpR55
supE thiD(lac-proAB) [F' traD36
proA+B+ laclZAM15] kimm434(kanR)
Pl (CmR) hsdR (rKl2-mKl2 )
F ompThsdS(rB mB ) dcm+ Tetr gal k
(DE3) endA Hte [argU ileY leuW
Camr] (an E. coli B strain)
F- ompTgal[dcm] [lon] hsdSB (rB mB-;
an E. coli B strain) with kDE3, a k
prophage carrying the T7 RNA
polymerase gene
Apr, Tcr; cloning vector
Apr; cloning vector
Apr; plasmid derived from
XBlueSTAR-1
Apr; expression vector
Spr; derivative of pACYC 184 with E.
coli ileX and argU
Apr; two 3-kb HinclI fragments of S.
ventriculi genomic DNA ligated into
the EcoRV site of pBR322; carries only
1350 bp ofpdc
Apr; 7-kb fragment of S. ventriculi
genomic DNA with the complete pdc
gene in pBlueSTAR-1


American Type Culture
Collection (Manassas, Va.)
New England BioLabs
(Beverly, Mass.)
Life Technologies
(Rockville, Md.)
provided by K. T.
Shanmugam (Univ. of Fl.)

Novagen (Madison, Wi.)



Novagen


Novagen


Stratagene (La Jolla, Ca.)


Novagen



New England Biolabs
New England Biolabs
Novagen

Novagen
(219)

This study



This study





Source


Table 2-1. Continued.
Strain or plasmid Phenotype, genotype, description, PCR
primers
pJAM411 Apr; 6-kb Swal fragment from
pJAM410 ligated into the HinclI site of
pUC19; carries 2103 bp of
pBlueSTAR-1 vector and 4 kb of S.
ventriculi genomic DNA with the
complete pdc
pJAM413 Apr; 3-kb Sacl fragment of pJAM411
with the complete pdc gene in the
HinclI site of pUC 19
pJAM419 Apr; 1.7-kb BspHI-to-Xhol fragment
generated by PCR amplification using
pJAM410 as a template, oligol, 5'-
ggcctcatgaaaataacaattgcag-3', and
oligo2, 5'-gcgggctcgagattagtagttattttg-
3'(BspHI and Xhol sites indicated in
bold); ligated with Ncol-to-Xhol
fragment of pET21d; carries complete
pdc with its start codon positioned 8 bp
downstream the Shine-Dalgrano
sequence of pET21d


This study





This study


This study










Table 2-2. Amino acid composition of PDC proteins. Composition expressed as %
residues per mol enzyme predicted from the gene sequence (g) or chemically determined
from the purified enzyme (e). Abbreviations: Sv, Sarcina ventriculi PDC; Sc,
Saccharomyces cerevisiae PDC1; Zm, Zymomonas mobilis PDC; ND, not determined.
References: Sv(e) (132), Sv(g) (this study), Sc(g) (99), Zm (g) (113).
Amino Composition (mol%)
Acid Sv(e) Sv(g) Sc(g) Zm(g)
Asx 8.7 9.8 10.2 10.2
Glx 10.7 12.0 8.9 8.6
Ser 5.5 6.5 6.0 4.2
Gly 7.3 7.1 7.8 8.1
His 1.1 1.6 2.0 2.1
Arg 4.1 4.0 2.7 3.0
Thr 6.1 6.5 7.7 4.6
Ala 7.2 6.9 8.2 15.0
Pro 2.7 2.7 4.6 4.8
Tyr 3.2 4.0 3.1 3.9
Val 6.8 8.0 7.5 7.8
Met 2.1 2.7 2.4 1.9
Ile 6.1 7.1 6.6 4.9
Leu 7.8 8.2 9.7 8.8
Phe 16.2 4.7 4.2 3.2
Lys 4.4 6.9 6.2 6.3
Cys ND 0.9 1.1 1.2
Trp ND 0.5 1.3 1.2









Table 2-3. Codon usage of S. ventriculi (Sv) and Z mobilis (Zm)pdc genes.

Amino E.
E
Acid Codon Zm* Sv coh

Ala GCA 28.1 32.5 20.1
GCC 35.1 0 25.5
GCG 12.3 1.8 33.6
GCU 73.8 34.4 15.3
Arg AGA 1.8 39.8 2.1
CGC 15.8 0 22.0
CGG 1.8 0 5.4
CGU 12.3 0 20.9
Asn AAC 47.5 19.9 21.7
AAU 10.5 27.1 17.7
Asp GAC 28.1 3.6 19.1
GAU 10.5 47.0 32.1
Cys UGC 28.1 1.8 6.5
UGU 10.5 7.2 5.2
Gln CAA 0 28.9 15.3
CAG 17.6 0 28.8
Glu GAA 61.5 85.0 39.4
GAG 3.5 5.4 17.8
Gly GGA 1.8 50.6 8.0
GGC 19.3 0 29.6
GGG 0 0 11.1
GGU 56.2 19.9 24.7
His CAC 8.8 3.6 9.7
CAU 14.1 12.7 12.9
Ile AUA 0 39.8 4.4
AUC 35.1 9.0 25.1
AUU 14.1 21.7 30.3
Leu CUA 0 7.2 3.9
CUC 19.3 0 11.1
CUG 33.4 0 52.6
CUU 12.3 14.5 11.0
UUA 1.8 59.7 13.9
UUG 5.4 0 13.7
Lys AAA 33.4 63.3 33.6
AAG 31.6 5.4 10.3
Met AUG 21.1 27.1 27.9
Phe UUC 31.6 18.1 16.6
UUU 0 28.9 22.3
Pro CCA 3.5 18.1 8.4
CCC 3.5 0 5.5
CCG 29.9 1.8 23.2
CCU 10.5 7.2 7.0










Amino
Acid E.
Codon Zm* Sv co.

Ser AGC 14.1 12.7 16.1
AGU 7.0 12.7 8.8
UCA 1.8 32.5 7.2
UCC 15.8 0 8.6
UCU 5.3 7.2 8.5
Thr ACA 0 34.4 7.1
ACC 28.1 0 23.4
ACG 10.5 0 14.4
ACU 8.8 30.7 9.0
Trp UGG 12.3 5.4 15.2
Tyr UAC 12.3 7.2 12.2
UAU 26.4 32.5 16.2
Val GUA 0 36.2 10.9
GUC 26.4 0 15.3
GUG 7.0 0 26.4
GUU 43.9 43.4 18.3


Codon usage for amino acids represented as frequency per thousand bases. Stop codons
are not indicated. CGA and AGG codons for Arg, UCG for Ser, and GGG for Gly were
not used for either ofthepdc genes. Abbreviations: Zm, Zymomonas mobilis; Sv,
Sarcina ventriculi.
tAverage usage in frequency per thousand bases for genes in E. coli K-12. Highlighted
are codons for accessory tRNAs essential for high-level synthesis of S.
ventriculi PDC in recombinant E. coli.


_ __


Table 2-3


Continued










HicI pJM0 in


I pJA41 B
iclI pJAM410 Bel


SwaI


EcoRI


pJAM411


pJAM413


oligol oligo2

BspHI pJAM419 Xhoi


Hinll
HindIII
EcoRI
SwalI


'ORFI*


EcoRI
CalHindIII
Hirdll
HindHI
S I HindII
II i i I J "nII


HinclI
I


Bcl I
i


pdc


A partial map of restriction endonuclease sites for a 7-kb BclI genomic DNA
fragment from S. ventriculi. Plasmids used in this study include pJAM410
which carries the complete 7-kb BclI fragment as well as pJAM400,
pJAM411, and pJAM413 which were used for DNA sequence analysis.
Plasmid pJAM419 was used for expression of the S. ventriculipdc gene in
recombinant E. coli. The location of the pdc gene and 'ORF1* are shown
directly below the physical map with large arrows indicating the direction of
transcription. The dashed line below the physical map indicates the 3,886 bp
HinclI-to-HinclI region sequenced. Abbreviations: pdc, pyruvate
decarboxylase gene; 'ORF1*, partial open reading frame of 177 amino acids
with no apparent start codon.


500-bp


Figure 2-1.


r I


i i i j i =


HincII


Hincll


pJAM400







47


-35 -10
AAATTTAAAAATAACATCAGATAAATCGTTTATATTAATTTTTACTAAAAGCTATTTAAA 60
ttgaca-------N17-------tataat
SD
GGTGTATTATATATACATAGTTTATCTTATAAATAAAAAATGAATTGGAG GAATACATA 120


AT GAAAATAACAATT GCAGAATACTTATTAAAAAGATTAAAAGAAGTAAAT GTAGAGCAT 180
M K I T I A E Y L L K R L K E V N V E H 20
M K I I I A E Y L L KR L K E V N V E H
ATGTTTGGAGTTCCTGGAGATTATAACTTAGGATTTTTAGATTATGTTGAAGATTCTAAA 240
M F G V P G D Y N L G F L D Y V E D S K 40
M F G V P G D Y N L G F L D Y V
GATATTGAATGGGTTGGAAGCTGTAATGAACTTAATGCAGAATATGCAGCAGATGGATAT 300
D I E W V G S C N E L N A E Y A A D G Y 60

GCAAGACTTAGAGGATTTGGTGTAATACTTACAACTTATGGAGTTGGTTCACTTAGTGCA 360
A R L R G F G V I L T T Y G V G S L S A 80

ATAAATGCTACAACAGGTTCATTTGCAGAAAATGTTCCAGTATTACATATATCAGGTGTA 420
I N A T T G S F A E N V P V L H I S G V 100

CCATCAGCTTTAGTTCAACAAAACAGAAAGCTAGTTCACCATTCAACTGCTAGAGGAGAA 480
P S A L V Q Q N R K L V H H S T A R G E 120

TTCGACACTTTTGAAAGAATGTTTAGAGAAATAACAGAATTTCAATCAATCATAAGCGAA 540
F D T F E R M F R E I T E F Q S I I S E 140

TATAATGCAGCTGAAGAAATCGATAGAGTTATAGAATCAATATATAAATATCAATTACCA 600
Y N A A E E I D R V I E S I Y K Y Q L P 160

GGTTATATAGAATTACCAGTTGATATAGTTTCAAAAGAAATAGAAAT C GACGAAATGAAA 660
G Y I E L P V D I V S K E I E I D E M K 180

CCGCTAAACTTAACTATGAGAAGCAACGAGAAAACTTTAGAGAAATTCGTAAATGATGTA 720
P L N L T M R S N E K T L E K F V N D V 200

AAAGAAATGGTTGCAAGCTCAAAAGGACAACATATTTTAGCTGATTATGAAGTATTAAGA 780
K E M V A S S K G Q H I L A D Y E V L R 220

GCTAAAGCTGAAAAAGAATTAGAAGGATTTATAAATGAAGCAAAAATCCCAGTAAACACT 840
A K A E K E L E G F I N E A K I P V N T 240

Figure 2-2. Nucleic acid and predicted amino acid sequence of the S. ventriculipdc gene.
DNA is shown in the 5'- to 3'-direction. Predicted amino acid sequences are
shown in single-letter code directly below the first base of each codon. The
N-terminal sequence previously determined for the purified PDC protein is
shown directly below the sequence predicted for PDC. A putative promoter is
double underlined with the -35 and -10 eubacterial promoter consensus
sequence indicated in lower-case letters below the DNA sequence. A
presumed ribosome-binding site is underlined. The translation stop codon is
indicated by an asterisk. A stem-loop structure which may facilitate p-
independent transcription termination is indicated by arrows below the DNA
sequence.







48



Figure 2-2. Continued.

TTAAGTATAGGAAAGACAGCAGTATCAGAAAGCAATCCATACTTTGCTGGATTATTCTCA 900
L S I G K T A V S E S N P Y F A G L F S 260

GGAGAAACTAGTTCAGATTTAGTTAAAGAACTTTGCAAAGCTTCTGATATAGTTTTACTA 960
G E T S S D L V K E L C K A S D I V L L 280

TTTGGAGTTAAATTCATAGATACTACAACAGCTGGATTTAGATATATAAATAAAGATGTT 1020
F G V K F I D T T T A G F R Y I N K D V 300

AAAATGATAGAAATTGGTTTAACTGATTGTAGAATTGGAGAAACTATTTATACTGGACTT 1080
K M I E I G L T D C R I G E T I Y T G L 320

TACATTAAAGATGTTATAAAAGCTTTAACAGATGCTAAAATAAAATTCCATAACGATGTA 1140
Y I K D V I K A L T D A K I K F H N D V 340

AAAGTAGAAAGAGAAGCAGTAGAAAAATTTGTTCCAACAGATGCTAAATTAACTCAAGAT 1200
K V E R E A V E K F V P T D A K L T Q D 360

AGATATTTCAAACAAATGGAAGCGTTCTTAAAACCTAATGATGTATTAGTTGGTGAAACA 1260
R Y F K Q M E A F L K P N D V L V G E T 380

GGAACATCATATAGTGGAGCATGTAATATGAGATTCCCAGAAGGATCAAGCTTTGTAGGT 1320
G T S Y S G A C N M R F P E G S S F V G 400

CAAGGATCTTGGATGTCAATTGGATATGCTACTCCTGCAGTTTTAGGAACTCATTTAGCT 1380
Q G S W M S I G Y A T P A V L G T H L A 420

GATAAGAGCAGAAGAAACATTCTTTTAAGTGGTGATGGTTCATTCCAATTAACAGTTCAA 1440
D K S R R N I L L S G D G S F Q L T V Q 440

GAAGTTTCAACAATGATAAGACAAAAATTAAATACAGTATTATTTGTAGTTAACAATGAT 1500
E V S T M I R Q K L N T V L F V V N N D 460

GGATATACAATTGAAAGATTAATCCACGGACCTGAAAGAGAATATAACCATATTCAAATG 1560
G Y T I E R L I H G P E R E Y N H I Q M 480

TGGCAATATGCAGAACTTGTAAAAACATTAGCTACTGAAAGAGATATACAACCAACTTGT 1620
W Q Y A E L V K T L A T E R D I Q P T C 500

TTCAAAGTTACAACTGAAAAAGAATTAGCAGCTGCAATGGAAGAAATAAACAAAGGAACA 1680
F K V T T E K E L A A A M E E I N K G T 520

GAAGGTATTGCTTTTGTTGAAGTAGTAATGGATAAAATGGATGCTCCAAAATCATTAAGA 1740
E G I A F V E V V M D K M D A P K S L R 540

CAAGAAGCAAGTCTATTTAGTTCTCAAATAACTACTAATATATATAATTAT AATA 1800
Q E A S L F S S Q N N Y 552

AATTAAAAAGATTGTAAATTAAATTTAAAGGTGACTTCTATTAATAGAGGTCATCTTTTT 1860


ATGCTTATAAGTTTAATTTTATAAAATACAATTAGTAATTAAACACTTTATAAGAAAAAA 1920
4-











ji YX 'FV .7"
RIT CSDartNGz1uLc


SvePDC 60
ScePDCl 61
ZmoPDC 60


SvePDC
ScePDCl
ZmoPDC


SvePDC 179
ScePDCl 181
ZmoPDC 180


SvePDC
ScePDCl
ZmoPDC

SvePDC
ScePDCl
ZmoPDC


SvePDC 351
ScePDCl 359
ZmoPDC 359


j~fV4sZTjgIC; SiE AGL SDl oKLO'S mffTOV
AKSTP U) *I


S-Ig5. TT
eT F 'm G 5iSwp @


Qf rnIED T fXK t----D Z IKVE J'.EAIMKY
HS ISDW_
PPLASPRt GI I!F .x e P
V V V
~S r.5o-7.
A, T !


U* A --A
0* .M I5


T V r


p ij IIm 1 LFV*NgnGYTTM Y,
--silf ^ ILMGDSFQ2E I:F'LgvN^B Y!jj E~gjjv


SvePDC 467
ScePDC1 479
ZmoPDC 475


rm u ,,ie ; T


NGCYD94W ;1


524 ,
534
533


* s. guT's'

* 4$:


-------
------


Multiple amino acid sequence alignment of S. ventriculi PDC with other
PDC protein sequences. Abbreviations with GenBank or SwissProt
accession numbers: Sce, S. cerevisiae P06169; Sve, S. ventriculi; Zmo, Z.
mobilis P06672. Identical amino acid residues are shaded in inverse print.
Functionally conserved and semi-conserved amino acid residues are shaded
in gray. Dashes indicate gaps introduced in protein sequence alignment.
Indicated above the sequences are amino acid residues within a 0.4 nm
distance of the Mg2+ and TPP binding site of yeast PDC1 (84)(V), the
Cys221 residue originally postulated to be required for pyruvate activation of
yeast PDC 1 (*), and the Tyr157 and Arg224 residues which form hydrogen
bonds with allosteric activators such as pyruvamide (m). The underlined
sequence is a conserved motif identified in TPP-dependent enzymes (216).


SvePDC
ScePDCI
ZmOPDC


E:I TWjCENGoD
n"A.r4 ,L7%1mD


TV V
i~r~l~r;C~~k r~rl~J~~;ib-IvtF


.

WiWE"!F


SvePDC
ScePDC1
ZmoPDC


SV VT


SvePDC
ScePDCi
ZmOPDC


Figure 2-3.


LYi'L'_t1Z,__;V 'h Hja& Ki*-J _i ;._n HB


I


VHH5jnRG
51
LLnHT IG


el
Q'7PEYIELP6D1VS1A I
%&:TE, o 21
WN:SE TDf(7.-I;T Y QRPVyT.T.1,^LV.LM
Z To 40 J A -4A rAMIDEVIK,
r A, ",FPVYLE] I'm


-- ---


M.TVaHL'r
BMHYQ 4











PDH El


TK / KUTK
S RcaTK

I CpTK


SvePDC'-i G*
PDC


IPD


Fungal
PDC


Relationships between selected PDCs. The dendrogram shown above
summarizes the relationships between selected PDCs and other thiamine
pyrophosphate-dependent enzymes. Deduced protein sequences were
aligned using ClustalX. Amino acid extensions at the N- or C-terminus as
well as apparent insertion sequences were removed. Remaining regions
containing approximately 520 to 540 amino acids were compared. Treeview
was used to display these results as an unrooted dendrogram. Protein
abbreviations: PDC, pyruvate decarboxylase; IPD, indole-3-pyruvate
decarboxylase; ORF, open reading frame; ALS, acetolactate synthase; PDH
El or El, the El component of pyruvate dehydrogenase; TK, transketolase.
Organism abbreviations and GenBank or SwissProt accession numbers: Abr,
Azosprillum brasilense P51852, Aor, Aspergillus oryzae AAD16178; Apa,
Aspergillus parasiticus P51844; Asy, Ascidia sydneiensis samea BAA74730;
Ath, Arabidopsis thaliana BAB08775; Bfl, Brevibacteriumflavum A56684;
Bsu, Bacillus subtilis P45694; Cgl, Corynebacterium glutamicum P42463;


Figure 2-4.


""'~""""'~'~~- -
~""'
-"-


AsyTK









Cpn, Chlamydophila pneumoniae H72020; Dra, Deinococcus radiodurans
A75387 (ALS), A75541 (El); Ecl, Enterobacter cloacae P23234; Eco, E.
coli CAA24740; Ehe, Erwinia herbicola AAB06571; Eni, Aspergillus
(Emericella) nidulans P87208; Fan, Fragaria x aananssa AAG3 131; Ghi,
Gossypium hirsutum S60056; Gth, Guillardia theta NP_050806; Huv,
Hanseniaspora uvarum P34734; Kla, Kluyveromyces lactis Q12629 (PDC),
Q12630 (TK); Kma, Kluyveromyces marxianus P33149; Mav,
Mycobacterium avium Q59498; Mja, Methanococcus jannaschii Q57725;
Mle, Mycobacterium leprae CAC31122 (ORF), 033112 (ALS), CAC30602
(El); Mth, Methanobacterium thermoautotrophicum A69081 (ORF), C69059
(ALS); Mtu, Mycobacterium tuberculosis E70814 (IPD), 053250 (ALS);
Ncr, N. crassa P33287; Nta, Nicotiana tabacum P51846 (PDC), P09342
(ALS); Osa, Oryza sativa P51847 (PDC1), P51848 (PDC2), P51849 (PDC3);
Pae, Pseudomonas aeruginosa G83123; Pmu, Pasteurella multocida
AAK03712; Pop, Prophyrapurpurea NP_053940; Ppu, Pseudomonas putida
AAG00523; Psa, P. sativum P51850; Pst, Pichia stipitis AAC03164 (PDC 1),
AAC03165 (PDC2); Rca, Rhodobacter capsulatus JC4637; Reu, Ralstonia
eutropha Q59097; Sav, Streptomyces avermitilis AAA93098; See, S.
cerevisiae P06169 (PDC1), P16467 (PDC5), P26263 (PDC6), Q07471
(ORF), NP_011105 (El a), NP_009780 (El3); Sco, Streptomyces coelicolor
T35828; Ski, Saccharomyces kluyveri AAF78895; Spl, Spirulinaplatensis
P27868; Spo, Schizosaccharomycespombe Q09737 (PDC1), Q92345
(PDC2); Sve, S. ventriculi AF354297; Syn, Synechocystis sp. BAA17984;
Vch, Vibrio cholerae A82375; Vvi, Vitis vinifera AAG22488; Zma, Zea
mays P28516; Zbi, Zygosaccharomyces bisporus CAB65554; Zmo, Z
mobilis P06672. Scale bar represents 0.1 nucleotide substitutions per site.












PagORF G-
KpnORF G-
SIpOPF G-
El OR F G-
PpuORF G-
EclIPD G-
MleORF G+
MboORF G+
MtuORF G+
BcpORF G-
BfuORF G-
MbaORFA
-- MacORF A
ApaORF F
SpoORF1 F
-- EniPDC F
SceKID1 F
__ i PsIORFI F
PstORF2 F
HuvPDC F
ZbiORF F
I- KmaORF F
KlaPDC F
SklORF F
q[- CRF F
ScePDC6 F
ScePDC6 F
1_ SbaPDC F
ScePDC1 F

_


RpIORF G-
SRruORF G-
j-AliORF G-
AbrlPD G-


PsaPDC P
OsaORF2 P
SOsaORF3 P
OsaORF1 P
m ZmaPDC P
SNtaPDC2 P
VviORF P
FanORF P
AthORF P
NcrPDC F
SpoORF2 F
ZmoPDC G-
ApePDC G-
ZpaPDC G-
NpuORF C
SMpeORF G+
SVePDC G+
LlaORF G+ Newly di
SSeaORFG+ Gram-po
CacORF G+ like prot
BceORF G+
BanORF G+


Figure 2-5.


Relationships between pyruvate decarboxylase (PDC), indole pyruvate
decarboxylase (IPD), oa-ketoisocaproate decarboxylase (KID), and
homologues (ORF). Abbreviations: Abr, Azospirillum brasilense; Ali,
Azospirillum lipoferum; Aor, Aspergillus oryzae; Apa, Aspergillus
parasiticus; Ape, A. pasteurianus; Ath, Arabidopsis thaliana; Ban,
Bacillus aii///l, i Bce, Bacillus cereus; Bcp, Burkholderia cepacia; Bfu,
Burkholderia fugorum; Cac, Clostridium acetobutylicum; Cgl, Candida
glabrata; Eel, Enterobacter cloacae; Eni, Emericella nidulans; Fan,
Fragaria x ananassa; Huv, Hanseniaspora uvarum; Kla, Kluyveromyces


MIoORF G-


covered
jsitive PDC-
eins









lactis; Kma, Kluyveromyces marxianus; Kpn, Klebsiella pneumoniae; Lla,
Lactococcus lactis; Mac, 'i/thm/iu t a acetovorans; Mba,
1A'//iu/i/,,, Cina barker; Mbo, Mycobacterium bovis; Mle,
Mycobacterium leprae; Mlo, Mesorhizobium loti; Mpe, Mycoplasma
penetrans; Mtu, Mycobacterium tuberculosis; Ncr, Neurospora crassa;
Npu, Nostoc punctiforme; Nta, Nicotiana tabacum; Osa, Oryza sativa;
Pag, Pantoea i ,,,hinciie,. Ppu, Pseudomonas putida; Psa, Pisum
sativum; Pst, Pichia stipitis; Rpl, Rhodopseudomonas palustris; Rru,
Rhodospirillum rubrum; Sau, Staphylococcus aureus; Sba, Saccharomyces
bayanus; Sep, Staphylococcus epidermidis; Sty, Salmonella typhimurium;
Styp, Salmonella typhi; See, S. cerevisiae; Ski, Saccharomyces kluyveri;
Spo, Schizosaccharomyces pombe; Sve, S. ventriculi; Vvi, Vitis vinifera;
Zma, Zea mays; Zbi, Zygosaccharomyces bisporus; Zmo, Z mobilis; Zpa;
Z. palmae; G+, Gram-positive; G-, Gram-negative; C, cyanobacteria; A,
archaea; P, plants; F, fungi and yeast; Bar, 0.1 nucleotide substitutions per
site; ORF, open reading frame with no enzyme information.










kDa


97-4- -
66-2 --


S;r
-I


31-



21-5-



14-4-


Figure 2-6.


n- WS -27


S. ventriculi PDC protein synthesized in recombinant E. coli. Proteins were
analyzed by reducing SDS-PAGE using 12% polyacrylamide gels and
stained with Coomassie blue R-250. Lanes 1 and 4, Molecular mass
standards (5 kg). Lanes 2 and 3, Cell lysate (20 kg) of IPTG-induced E. coli
BL21-CodonPlus-RIL/pSJS1240 transformed with pET21d or pJAM419,
respectively. Lane 5. S. ventriculi PDC protein (2 kg) purified from
recombinant E. coli.


45-


-58

-43


wrii 58











60- 0



S40

u.

20




5 10 15 20
Pyruvate (mM)

Figure 2-7. Pyruvate dependant activity of the S. ventriculi PDC purified from
recombinant E. coli. The data represent mean results from triplicate determinations of
PDC activity by the ADH coupled assay using 1 |tg of purified enzyme in 1 ml final
assay volume as described in methods section. SvPDC assayed in K-MES (*) and
Maleate buffer (0).















CHAPTER 3
OPTIMIZATION OF Sarcina ventriculi PDC EXPRESSION IN A GRAM POSITIVE
HOST

Introduction

Our previous work has shown that the PDC from the Gram-positive bacterium S.

ventriculi (SvPDC) was poorly expressed in E. coli (133). Addition of accessory tRNAs

was necessary for a ten-fold increase in protein production. The elevated levels of

protein produced upon addition of accessory tRNAs facilitated the purification of the

SvPDC. While the protein produced and purified from E. coli enabled the initial

characterization of SvPDC, it was not the optimal host due to low levels of SvPDC

produced.

Therefore, it was necessary to determine if there was a host that had similar codon

usage to that of SvPDC so that limited tRNAs would not hinder over expression of the

protein. Because S. ventriculi is a low-G+C Gram-positive bacterium, it was reasoned

that a low-G+C Gram-positive host would be most suitable for expression of this protein

in large quantities.

The Gram-positive bacterium Bacillus megaterium WH320 was examined as a

potential host for engineering high-level synthesis of PDC. B. megaterium has several

advantages over other bacilli including the availability of a shuttle plasmid (pWH1520)

for xylose inducible expression of foreign genes cloned downstream of the xylA

promoter. Another advantage is that the alkaline proteases, often responsible for the

degradation of foreign proteins in recombinant bacilli, are not produced in B. megaterium









(220, 221). In contrast to E. coli, the tRNAs for AUA and AGA are abundant in B.

megaterium suggesting that factors limiting PDC production will be optimal in this host.

In this study, SvPDC was over expressed in and purified from B. megaterium.

The biochemical characteristics and optimum conditions for activity of the SvPDC

enzyme purified from B. megaterium were determined. Due to the expression of SvPDC

in B. megaterium, a plasmid was also constructed containing a Gram-positive ethanol

production operon in which production of SvPDC and Geobacillus 'ieitlhei mIpilh

alcohol dehydrogenase (ADH) (222) are transcriptionally coupled and expression of these

proteins was demonstrated.









Materials and Methods


Materials

Biochemicals were purchased from Sigma Chemical Company (St. Louis, MO).

Other organic and inorganic analytical-grade chemicals were purchased from Fisher

Scientific (Marietta, GA). Restriction enzymes were from New England Biolabs

(Beverly, MA). Oligonucleotides were obtained from QIAgen Operon (Valencia, CA).

Bacillus megaterium Protein Expression System was purchased from MoBiTec (Marco

Islands, FL). Rnase-free water and solutions were obtained from Ambion (Austin, TX).

Bacterial Strains and Media

Strains and plasmids used in this study are listed in Table 3-1. E. coli DH5ca was

used for routine recombinant DNA experiments. B. megaterium WH320 was used for

protein production. Growth and transformation ofB. megaterium were performed

according to the manufacturer (MoBiTec). All strains were grown in Luria-Bertani (LB)

medium supplemented with antibiotics as appropriate (ampicillin 100 mg per liter, or

tetracycline 12.5 mg per liter) at 370C and 200 rpm.

DNA Isolation

Plasmid DNA was isolated and purified from E. coli using the QIAprep Spin

Miniprep Kit (QIAgen). DNA was eluted from 0.8% (w/v) SeaKem GTG agarose

(BioWhittaker Molecular Applications) gels using the QIAquick gel elution kit

(QIAgen).

Cloning of the Sarcina ventriculipdc Gene Into Expression Vector pWH1520

Plasmid pJAM420 was constructed using the following methods. The BspEI-to-

Xbal fragment of plasmid pJAM419 was ligated with 7.7-kb Spel-to-Xmal fragment of









plasmid vector pWH1520. This resulted in generation of the B. megaterium expression

plasmid pJAM420 that carried the S. ventriculipdc gene, along with the Shine-Dalgrano

site and T7 transcriptional terminator of the original pET21d vector. The pdc gene was

positioned to interrupt the B. megaterium xylA gene (xylA') of plasmid pWH1520 and to

generate a stop codon within xylA'. The Shine-Dalgrano site of the insertedpdc gene was

positioned directly downstream of the xylA' stop codon to allow for translational coupling

in which the ribosomes would presumably terminate at the stop codon for xylA' and then

reinitiate at the pdc start codon.

Gram-positive Ethanol Operon (PET).

To construct the Gram-positive PET operon, the HindIll-to-Mfel fragment of

pLOI1742 containing the adh gene from G. i miriit /ith mi,,lhih/u (222) was blunt-end

ligated into the BlpI site of pJAM420 using Vent Polymerase (New England Biolabs).

This resulted in the generation of plasmid pJAM423 which was designed to facilitate the

translational coupling of the S. ventriculipdc gene with the G. \ieri, theII iu qhihu adh

gene. The xylA promoter is upstream of the Svpdc and the terminator now follows the

adh gene.

Protoplast Formation and Transformation of B. megaterium.

A 1.0% (v/v) inoculum of B. megaterium WH320 cells was grown in LB to an

OD600nm of 0.6 units (early-log phase). Protoplasts were formed according to Puyet et al.

(223) with the following variations. Cells were treated with 10 |tg per ml lysozyme for

20 min at 370C. Protoplasts were stored at -700C. Transformation of the protoplasts was

performed according to the B. megaterium protein expression kit manual (MoBiTec).









Production of SvPDC In Recombinant Hosts.

Production of SvPDC in E. coli was performed as previously described (133).

SvPDC protein was synthesized in B. megaterium WH320 cells using pJAM420. A 1.0%

(v/v) overnight inoculum of recombinant B. megaterium cells was grown in LB

supplemented with tetracycline to an OD600nm of about 0.3 units (early-log phase).

Transcription from the xylA 'promoter was induced with 0.5% (w/v) xylose for 3 h. Cells

were harvested by centrifugation at 5000 x g (10 min, 40C) and stored at -700C.

Purification of the S. ventriculi PDC Protein.

All purification buffers contained 1 mM TPP and ImM MgSO4 unless indicated

otherwise. Purification of SvPDC from E. coli was performed as previously described

(133). Recombinant B. megaterium cells (15 g wet wt) were thawed in 6 volumes (w/v)

of 50 mM Na-P04 buffer at pH 6.5 (Buffer A) and passed through a French pressure cell

at 20,000 lb per in2. Cell debris was removed by centrifugation at 16,000 x g (20 min,

4C). Supernatant was filtered through a .45 |tm membrane. Filtrate (372.3 mg protein)

was applied to a Q Sepharose Fast Flow 26/10 column (Pharmacia) that was equilibrated

with Buffer A. A linear gradient was applied from 0 mM to 400 mM NaC1. Fractions

containing PDC activity eluted at 250 to 300 mM NaCl were pooled. Pooled fractions

were applied to a 5 ml Bio-scale hydroxyapatite type I column (BioRad) that was

equilibrated with 5 mM Na-P04 buffer at pH 6.5 (Buffer B). The column was washed

with 15 ml Buffer B and developed with a linear Na-P04 gradient (5 to 500 mM Na-P04

at pH 6.5 in 75 ml). Protein fractions with PDC activity were eluted at 300 to 530 mM

Na-P04 and were pooled (1mg protein per ml). For further purification, portions of this

material (0.25 to 0.5 ml) were applied to a Superdex 200 HR 10/30 column (Pharmacia)









equilibrated in 50 mM Na-P04 at pH 6.5 with 150 mM NaCl and 10% glycerol in the

presence or absence of 1 mM MgSO4 and 1 mM TPP.

Activity Assays and Protein Electrophoresis Techniques.

PDC activity was assayed by monitoring the pyruvic acid-dependant reduction of

NAD+ with alcohol dehydrogenase (ADH) as a coupling enzyme at pH 6.5, as previously

described (224). Sample was added to a final volume of 1 ml containing 0.15 mM

NADH, 0.1 mM TPP, 50.0 mM pyruvate, and 10 U ADH in 50 mM K-MES buffer at pH

6.5 with 5 mM MgC12. The reduction ofNAD+ was monitored in a 1 cm path length

cuvette at 340 nm over a 5 min period using a BioRad SmartSpec 300 (BioRad). Protein

concentration was determined using BioRad Protein assay dye with bovine serum

albumin as the standard according to supplier (BioRad).

The pH optimum of SvPDC was assayed in buffers suitable to maintain the

desired pH. The temperature optimum of SvPDC was assayed using a Beckman DU640

(Beckman) spectrophotometer with a circulating water bath.

Thermostability of SvPDC was assayed by incubating purified enzyme in lysis

buffer at a concentration of 0.02 |tg of protein per [tl for 90 min. After incubation,

samples were assayed at room temperature.

Molecular masses were estimated by reducing and denaturing SDS-PAGE using

12% polyacrylamide gels. Proteins were stained using the Rapid Fairbanks method

(225). The molecular mass standards were phosphorylase b (97.4 kDa), serum albumin

(66.2 kDa), ovalbumin (45 kDa), carbonic anhydrase (31 kDa), trypsin inhibitor (21.5

kDa), and lysozyme (14.4 kDa).









Results


SvPDC Expression Vector for B. megaterium.

Previous studies have shown that SvPDC is poorly expressed in E. coli (133).

Because SvPDC is from a Gram-positive bacterium, we decided to use a Gram-positive

bacterial expression system for high-level production of SvPDC. A fragment of plasmid

pJAM419, used previously for expression of SvPDC in E. coli (133), was isolated that

contained a Shine-Dalgrano sequence, the S. ventriculipdc gene, and the T7 terminator.

This fragment was cloned into pWH1520 in such a way that the xylose isomerase gene

(xylA) of pWH1520 was truncated to form a stop codon after 30 codons. The Shine-

Dalgrano sequence upstream of SvPDC was positioned so that a xylose-inducible

transcriptional coupling occurred between xylA' and Svpdc. The resulting plasmid,

pJAM420, was used for expression of SvPDC in B. megaterium.

Production and Purification of SvPDC from B. megaterium.

Based on SDS-PAGE, expression of SvPDC is notably higher when expressed in

B. megaterium compared to E. coli (Figure 3-1). The high levels of SvPDC protein

produced in B. megaterium facilitated a 22-fold purification of the protein from this host,

with 8.35 mg purified protein from 15 g of cells (wet wt.) (Table 3-2). This is in contrast

to purification of SvPDC from E. coli, which began with 14.8 g of cells and only yielded

0.2 mg purified protein (unpublished data).

Purified SvPDC from B. megaterium was determined to be a 235 kDa

homotetramer of 58 kDa subunits as determined by Superdex 200 gel filtration

chromatography and SDS-12% PAGE electrophoresis. These results correlate with

previous studies (132, 133).









Determination of Optimum Conditions for SvPDC Activity.

It is important when assaying any enzyme to determine its optimum conditions.

PDCs are routinely assayed at pH 6.5 (178, 218) and pH 6.0 (94, 112). While these pH

values are acceptable for the Z. mobilis and S. cerevisiae PDC proteins, they may give

misleading kinetic values for SvPDC. Our research found that the recombinant SvPDC

from B. megaterium had a pH optimum in the range of pH 6.5 to pH 7.4 (Figure 3-2).

This pH optimum is quite high when compared to the PDCs from Z. mobilis (pH 6.0), S.

cerevisiae PDC1 (pH 5.4-5.8), A. pasteurianus (pH 5.0-5.5), and Z palmae (pH 5.5-6.0)

(113, 131, 226). The pH optimum of SvPDC purified from recombinant E. coli has

previously been shown to be between pH 6.3 to 6.7 (131), which is higher than the other

bacterial PDCs and also different to the pH optimum determined for the B. megaterium

purified protein.

The temperature optimum of the SvPDC from B. megaterium was determined to

be 320C (Figure 3-3). This temperature differs greatly from the Z mobilis, Z palmae,

and A. pasteurianus PDCs, which have temperature optima of 600C (131). There is,

however, an approximately 2.5-fold increase in activity of the SvPDC at 320C compared

to room temperature. This increase in activity is comparable to that observed when the

Gram-negative bacterial PDCs were assayed at their optimal temperatures (131).

Kinetics of SvPDC Produced in B. megaterium

The recombinant SvPDC from B. megaterium displayed sigmoidal kinetics

(Figure 3-4). The recombinant SvPDC from B. megaterium had a Km of 3.9 mM for

pyruvate and a Vmax of 98 U per mg of protein when assayed at pH 6.5 and room

temperature. When assayed at optimal conditions, 320C and pH 6.72, there was an









increase in both Km (6.3 mM for pyruvate) and Vmax (172 U per mg protein). These

results suggest that a change in conformation mediated by an increase in pH and/or

temperature reduces the affinity of the enzyme for pyruvate but increases the overall

activity of the enzyme. Further study is necessary to determine the cause of this

phenomenon.

Thermostability of SvPDC Produced in B. megaterium.

Previous studies showed that SvPDC is not as thermostable as the other bacterial

PDC proteins (131, 133). In order to determine if production of the SvPDC protein in a

sub optimal host was responsible for this, thermostability of SvPDC produced in E. coli

was compared to that produced in B. megaterium (Figure 3-5). When assayed for

thermostability, the SvPDC produced in B. megaterium retained 30% activity after

incubation at 500C while the protein purified from E. coli only had 0.95% residual

activity after incubation at 500C. These results indicate that SvPDC is more thermostable

when produced in B. megaterium compared to E. coli. Misincorporation of amino acids

due to use of rare codons and/or misfolding of the SvPDC protein may have occurred

when the enzyme was produced in E. coli and may account for this reduction in

thermostability.

During the biochemical characterization of SvPDC, we discovered that pH had a

drastic effect on the thermostability of this enzyme (Figure 3-6). While the optimal pH

for activity of the SvPDC is pH 6.72, this is not optimal for its thermostability. At pH 6.5

the SvPDC enzyme has only 3% of original activity remaining after incubation at 600C

while samples incubated at pH 5.0 to pH 5.5 have 94% to 97% activity remaining. It was









also determined that SvPDC retained 100% activity when stored at pH 5.5 for two weeks

compared to 62 % when stored at 40C at pH 6.5 (data not shown).

Generation of a Gram-positive Ethanol Production Operon.

B. megaterium WH320 is capable of growth when tested in xylose minimal

medium. The strain is also able to grow at temperatures up to 420C and at a low pH of

5.0. This strain appears to be a suitable candidate to perform preliminary tests on ethanol

production with a portable pyruvate to ethanol operon (PET) and may prove useful in

large-scale ethanol production under acidic conditions. To construct a Gram-positive

PET operon, the adh gene from G. stearothermophilus (222) was cloned behind the S.

ventriculipdc gene in the B. megaterium pWH1520 expression vector. This vector was

chosen based on successful overproduction of S. ventriculi PDC (Figure 3-7). The

resulting PET plasmid, pJAM423, was transformed into B. megaterium. After xylose

induction, a considerable portion of the cell lysate of this strain was composed of the S.

ventriculi PDC and G. stearothermophilus ADH proteins (Figure 3-7). The ethanol

production of this construct was tested in the presence of 0.5% xylose. HPLC analysis

showed that ethanol production was doubled from that of a strain with pWH1520 alone,

but levels were still quite low (20mM)(data not shown). PDC has already been shown to

be very active in cell lysate, but further analysis needs to be performed to determine if the

ADH is active.


Discussion

The SvPDC protein is poorly expressed in recombinant E. coli (133). Therefore,

we reasoned that a host more similar to S. ventriculi might express this PDC at higher

levels. B. megaterium was chosen as a host because it has several benefits over other









Gram-positive expression systems. These include a xylose inducible expression vector

and absence of alkaline proteases that are often responsible for degradation of foreign

proteins (220, 221). Augmentation of the host, B. megaterium, with accessory tRNAs

was not necessary for high-level SvPDC production. This high yield of SvPDC protein

facilitated the 22-fold purification. The SvPDC protein was more active when produced

in B. megaterium compared to E. coli. We believe that the difference in activity is

primarily due to differences in the rate of misincorporation of amino acids based on

codon usage.

The SvPDC protein produced in B. megaterium has a higher Vmax (98 U per mg

protein) at RT than when produced by E. coli (66 U per mg protein). The SvPDC

produced in B. megaterium is also more thermostable than the E. coli produced protein.

Choosing the correct host appears to have affected the quality of SvPDC protein that was

recovered. These results indicate that differences can occur in the biochemical properties

of recombinant protein based on host.

In this study, we discovered that the pH of the incubation buffer has an effect on

the thermostability of SvPDC. Low pH stabilized SvPDC at higher temperatures. These

results suggest that residues of SvPDC gain a charge between pH 5.0-5.5 that allows the

tetramer conformation to remain stable at higher temperatures. This is an important

discovery because it gives insight into residues that can be altered in future experiments

in order to engineer SvPDC to be more thermostable at cytosolic pH.

The current portable production of ethanol (PET) operon consists of the pdc and

adh genes from Zymomonas mobilis, a Gram-negative organism (24, 25, 129, 227). Past

research to engineer a Gram-positive host for ethanol production has focused on using









this PET operon, but these attempts have met with limited success (33-35, 228) primarily

due to poor expression of the PDC. We have shown that SvPDC is expressed at high

levels in B. megaterium, a Gram-positive host. Our construction and expression of the

Gram-positive ethanol production operon using the SvPDC and G. \ici'l,,i'II inhilhu1

ADH has demonstrated that recombinant PDC and ADH production no longer limit

ethanol production in Gram-positive biocatalysts.

Our research shows that selection of host for recombinant production of proteins

can affect the quality and stability of the recombinant protein. We have also

demonstrated that SvPDC has qualities that make it unique among bacterial PDCs,

including its substrate activation and elevated pH optimum. SvPDC is the only bacterial

PDC that is not thermostable, but our results indicate that alteration of charged residues

may facilitate the engineering of thermostable SvPDC variants. Lastly, we have created a

Gram-positive ethanol production operon that will be useful in engineering future Gram-

positive hosts for ethanol production.









Table 3-1. Strains, plasmids, and primers used in Chapter 3.


Strain or Plasmid
E. coli DH5ca


E. coli BL21-
CodonPlus-RIL

B. megaterium
WH320
pSJS1240

pET21d
pWH1520

pJAM419
pJAM420



pLOI1742

pJAM423


Phenotype or genotype, PCR primers
F- recA1 endA1 hsdR1 7 (rk mk ) supE44 thi-1
gyrA relA1

F ompThsdS(rB mB) dcm+ Tetr gal X (DE3)
endA Hte [argUileY leuW Camr] (an E. coli B
strain)
lac- xyl+

Spr; derivative of pACYC 184 with E. coli ileX
and argU
Apr; expression vector for replication in E. coli
Apr Tc r; shuttle expression vector for
replication in E. coli and B. megaterium
Apr; pET21d derivative encoding SvPDC
Apr Tc ; 1.9-kb BspEI-to-Xbal fragment of
pJAM419 ligated with the Spel-to-Xmal
fragment of pWH1520; used for synthesis of
SvPDC in B. megaterium
Plasmid containing the G. \ieir iiihel hihii1
adh gene
Apr Tcr; 1.8-kb HindIl-to-Mfel fragment of
pLOI 1742 blunt-end ligated into the BlpI site of
pJAM420; xylose-inducible Gram-positive
ethanol production operon


Source
GibcoBRL
(Gathers-
burg, Md.)
Stratagene
(La Jolla,
CA.)
MoBiTec

(219)

Novagen
(220)

(133)
This study



L. Yomano

This study









Table 3-2. Purification of SvPDC from B. megaterium.
Sp. Act.
Step Protein (mg) Sp. Act.
(U per mg protein)
Cell Lysate 372.3 3.85
Q-Sepharose 38.26 20.34
Hydroxyapatite 15.70 24.83
Superdex 200 8.35 84.18


Percent
purification Fold el
Yield
1.00 100
5.28 54
6.45 27
21.87 49












kDa


1 2 3


97.4
66.2 __
45 '




21.56

14.4 |i


4 5 6



58 6 58
.--i- 'I


S. ventriculi PDC protein synthesized in recombinant E. coli and B.
megaterium. Proteins were analyzed by reducing SDS-PAGE using 12%
polyacrylamide gels and stained with Coomassie blue R-250. Lanes 1 and 4,
Molecular mass standard (5 [tg). Lanes 2 and 3, Cell lysate (20 [tg) of E.coli
BL21-CodonPlus-RIL transformed with pJAM419/pSJS1240 uninduced and
IPTG induced, respectively. Lanes 5 and 6, Cell lysate (20 [tg) of B.
megaterium WH320 transformed with pJAM420 xylose induced and
uninduced, respectively.


Figure 3-1.











120
100
80
60
40
20
0


4 6 8


Figure 3-2. pH profile for S. ventriculi PDC activity.








200

S150

S100 -

" 50

0 -
0 10 20 30 40 50
Temperature C

Figure 3-3. Effect of temperature on S. ventriculi PDC activity.











140
120
100
80 *
60 +
40 A
20 -
0 ^------


* 0


*


0 2 4 6 8 10 12 14

Pyruvate (mM)


Figure 3-4.


Effect of pyruvate concentration on S. ventriculi PDC synthesized in
recombinant E. coli (m), and B. megaterium (A) at 250C and pH 6.5. S.
ventriculi PDC at 320C and pH 6.72 from recombinant B. megaterium (*).
The data represent mean results from triplicate determinations of PDC
activity.









120%

A 100%

80%

60%

> 40%

20%

0%
40 50 60
Temperature (oC)
Figure 3-5. Thermostability of recombinant S. ventriculi PDC produced in B.
megaterium (*) and E. coli CodonPlus with plasmid pSJS1240 (m).










160%
140%
=120%
=100%
e 80%
S60%
40%
20%
0%


0 10 20 30 40 50 60 70


Temperature (oC)


Figure 3-6.


Effect of pH on the thermostability of the S. ventriculi PDC produced in B.
megaterium. Thermostability was tested at a pH 5.0 (o), pH 5.5 (+), pH 6.5
(.), and pH 7.5 (A).






76

2 3 4


97.4 P
66.2 1 -

45 ,

31 00


21.5
14.4


Induction of S. ventriculi PDC and G. stearothermophilus ADH in B.
megaterium. Proteins were separated by reducing SDS-PAGE using 12%
polyacrylamide gels and stained with Coomassie blue R-250. Lanes 1,
Molecular mass standard (5 atg). Lanes 2, Cell lysate (20 atg) of B.
megaterium transformed with pWH1520 induced with xylose. Lanes 3 and 4,
Cell lysate (20 atg) ofB. megaterium WH320 transformed with pJAM423
uninduced and xylose induced, respectively.


4 S. ventriculi PDC

4 G. stearothermophilus ADH


kDa
1


Figure 3-7.


,














CHAPTER 4
EXPRESSION OF PDCs IN THE GRAM-POSITIVE BACTERIAL HOST,
B. megaterium

Introduction

PDC (PDC, EC 4.1.1.1) is a central enzyme in ethanol fermentation and catalyzes

the non-oxidative decarboxylation of pyruvate to acetaldehyde with release of carbon

dioxide. The acetaldehyde generated from this reaction is then converted to ethanol by

alcohol dehydrogenase (ADH, EC 1.1.1.1). The recombinant production of these two

enzymes (PDC and ADH) converts intracellular pools of pyruvate to ethanol. The

current portable production of ethanol (PET) operon used to engineer this conversion

consists of the pdc and adh genes from Zymomonas mobilis, a Gram-negative organism

(24, 25, 129, 227). While this strategy has been highly successful in the modification of

Gram-negative bacteria for ethanol production, improvements in host strains are

necessary (4, 129).

To enhance the commercial competitiveness of biocatalysts for the large-scale

production of ethanol, the hosts must withstand low pH, high temperature, high salt, high

sugar, high ethanol, and various other harsh conditions. Many of these qualities are not

found in Gram-negative bacteria and must be introduced through metabolic engineering.

In contrast, Gram-positive bacteria naturally possess many desirable traits for the

industrial production of ethanol (228); however, modifying them for ethanol production

has met with only limited success. Several attempts to engineer the PET operon into









Gram-positive organisms have resulted in low levels of PDC activity and only small

elevations in ethanol production (33-35, 228).

Prior to this work, construction of PET operons for engineering high-level

synthesis of ethanol in recombinant Gram-positive bacteria has been limited by the

availability of bacterial pdc genes. Recently, however, the cloning and DNA sequence of

apdc gene from the Gram-positive bacterium, S. ventriculi (Sv), was described (133).

Synthesis of the SvPDC protein in recombinant Escherichia coli was low but enhanced

by augmentation with accessory tRNAs (133). Based on these results, it is hypothesized

that reduced translation due to differences in codon usage can be a major factor in

limiting PDC production in recombinant bacterial hosts.

In this study, pdc genes from diverse organisms (i.e., S. ventriculi, Z mobilis,

Acetobacter pasteurianus and Saccharomyces cerevisiae) with differing GC content were

expressed in recombinant Bacillus megaterium. Superior levels of active SvPDC were

produced in this host. Assessment of the mRNA transcript levels and rates of protein

degradation in these recombinant strains revealed that the differences in PDC were at the

level of protein synthesis. This is the first report of high level PDC production in a

recombinant Gram-positive host and reveals that SvPDC is an ideal candidate for the

metabolic engineering of ethanol production in this desirable group of organisms.


Materials and Methods

Materials

Biochemicals were purchased from Sigma (St. Louis, Mo.). Other organic and

inorganic analytical-grade chemicals were from Fisher Scientific (Atlanta, Ga.).

Restriction enzymes were from New England Biolabs (Beverly, Mass.).









Oligonucleotides were from QIAgen Operon (Valencia, Ca.) and Integrated DNA

Technologies (Coralville, Ind.). Bacillus megaterium Protein Expression System was

from MoBiTec (Marco Islands, Fla.). Rnase-free water and solutions were from Ambion

(Austin, Tx.).

Bacterial Strains and Media

Strains and plasmids used in this study are listed in Table 4-1. E. coli DH5ca was

used for routine recombinant DNA experiments. B. megaterium WH320 was used for

PDC production, pulse-chase, and transcript analysis. Strains were grown in Luria-

Bertani (LB) medium unless otherwise indicated. Medium was supplemented with 2%

(wt/vol) glucose and antibiotics (ampicillin 100 mg per liter, kanamycin 30 mg per liter,

or tetracycline 15 mg per liter) as needed. All strains were grown at 370C and 200 rpm.

Isolated colonies of B. megaterium were grown overnight in liquid medium and used as a

1.0% (vol/vol) inoculum into fresh medium unless otherwise indicated.

Protoplast Formation and Transformation of B. megaterium.

B. megaterium WH320 was grown to an O.D.600nm of 0.6 units (early-log phase).

Protoplasts were generated according to Puyet et al. (223) with the following

modifications. Cells were treated with lysozyme (10 |tg per ml) for 20 min. Protoplasts

were stored at -700C and transformed according to MoBiTec.

DNA Isolation and Cloning

Plasmid DNA was isolated and purified from E. coli using the QIAprep Spin

Miniprep Kit (QIAgen). DNA was eluted from 0.8% (wt/vol) SeaKem GTG agarose

(Cambrex Corp., East Rutherford, NJ) gels using the QIAquick gel elution kit (QIAgen).

To generate the B. megaterium expression plasmids (pJAM420, pJAM430, pJAM432,









and pJAM435), similar strategies were used (Figure 4-1) (Table 4-1). For example,

plasmid pJAM420 was constructed as follows. A BspHI-to-Xhol DNA fragment with the

complete S. ventriculipdc gene was generated by PCR amplification and cloned into the

Ncol and Xhol sites of plasmid pET21d (133). The 1.9-kb XbaI-to-BspEl DNA fragment

of the resulting plasmid (pJAM419) was ligated into the Spel and Xmal sites of plasmid

pWH1520. This resulted in generation of a pWH1520-based expression plasmid

(pJAM420) that carried the S. ventriculi pdc gene, along with the Shine-Dalgrano site and

T7 transcriptional terminator of the original pET21d vector. The pdc gene was

positioned to interrupt the B. megaterium xylA gene (xylA') of plasmid pWH1520 and to

generate a stop codon within xylA'. The Shine-Dalgrano site originally from pET21d of

upstream of the inserted pdc gene was positioned directly downstream of the xylA' stop

codon to allow for translational coupling in which the ribosomes would terminate at the

stop codon for xylA and then reinitiate at the pdc start codon.

Production of PDC Proteins In Recombinant B. megaterium.

PDC proteins were independently synthesized in B. megaterium WH320 cells

using the expression plasmids described above. Cells were grown to an O.D.600 nm of 0.3

units (early-log phase). Transcription from the xylA' promoter was induced by addition

of xylose (0.5% [wt/vol]). Cells were harvested after 3 h by centrifugation (5,000 x g, 10

min, 40C) and stored at -800C. Cell pellets (0.5 g) were thawed in 6 volumes (wt/vol) of

50 mM Na2HPO4 buffer at pH 6.5 containing 1 mM MgSO4 and 1 mM TPP. Cells were

passed through a French pressure cell at 20,000 lb per in2. Debris was removed by

centrifugation (16,000 x g, 20 min, 40C). Cell lysate was immediately assayed for

activity.











Activity Assays and Protein Electrophoresis Techniques

PDC activity was assayed by monitoring the pyruvic acid-dependant reduction of

NAD+ with alcohol dehydrogenase (ADH) as a coupling enzyme at pH 6.5, as previously

described (115). Cell lysate (10 [tl) was added to a final volume of 1 ml containing 0.15

mM NADH, 0.1 mM thiamine pyrophosphate, 50.0 mM pyruvate, and 10 U ADH in 50

mM K-MES buffer at pH 6.5 with 5 mM MgCl2. The reduction ofNAD+ was monitored

in a 1 cm path length cuvette at 340 nm over a 5 min period using a BioRad SmartSpec

300 (BioRad). Protein concentration was determined using BioRad Protein assay dye

with bovine serum albumin as the standard according to supplier (BioRad).

Protein molecular masses were analyzed by reducing and denaturing SDS-PAGE

using 12% polyacrylamide gels that were stained by heating with Coomassie blue R-250

(225). Molecular mass standards were phosphorylase b (97.4 kDa), serum albumin (66.2

kDa), ovalbumin (45 kDa), carbonic anhydrase (31 kDa), trypsin inhibitor (21.5 kDa),

and lysozyme (14.4 kDa).

RNA Isolation

Cultures were grown in triplicate to an O.D.600 nm of 0.3 units (early-log phase).

Transcription ofpdc was induced for 15 min with 0.5% (wt/vol) xylose. Total RNA was

isolated using the RNeasy miniprep kit. Samples were treated with lysozyme and On-

column DNase as recommended by supplier (QIAgen). The removal of DNA from RNA

samples was confirmed by performing PCR using Jumpstart Taq Readymix in the

absence of reverse transcriptase (Sigma). Quality and quantity of RNA were determined

by 0.8% agarose gel electrophoresis and absorbance at 260 nm, respectively.









RNA Quantifications

The MAXIscript T7 In vitro transcription kit (Ambion) was used to generate

transcript from the E. coli expression vectors (pJAM419, pJAM429, pJAM431, and

pScPDC1). Nuc-Away spin columns (Ambion) were used to remove unincorporated

nucleotides. RNA products expressed in vitro were used to generate standard curves of

absolute copy number for each experiment. Transcript levels were analyzed using

quantitative real time reverse transcriptase PCR with an Icycler (BioRad). Total RNA

(100 pg) was used as a template with the primers listed in Table 4-1. RNA

Quantification reactions were performed using the QuantiTect SYBR Green 1-step RT-

PCR kit according to supplier (QIAgen). All data had PCR efficiency of 90 to 100% and

were analyzed using the Icycler software version 3.0.6070 (BioRad) and Microsoft Excel.

Pulse Chase

Recombinant B. megaterium strains were grown in minimal medium (10 g

sucrose, 2.5 g K2HPO4, 2.5 g KH2PO4, 1.0 g (NH4)2HP04, 0.2 g MgSO4-7H20, 10 mg

FeSO4-7H20, 7 mg MnSO4-H20 in 985 ml dH20 at pH 7.0) supplemented with

tetracycline (MM Tet) using a 1% (vol/vol) inoculum. Cells were grown to an O.D.600nm

of 0.3 units (early-log phase) and recombinant gene transcription was induced for 15 min

with 0.5% (wt/vol) xylose. Cells were harvested by centrifugation (5000 x g, 10 min,

250C) and resuspended in 2 ml of MM Tet supplemented with 0.5% xylose and 50 [[Ci

per ml L-[35S]-methionine (DuPont-NEN). Cells were incubated for 15 min (370C, 200

rpm) and harvested as above. Cell pellets were resuspended in MM Tet supplemented

with 0.5% xylose and 5mM L-methionine with or without chloramphenicol (15 mg per L)

and incubated (370C, 200 rpm). Aliquots (0.5 ml) were withdrawn after 5, 10, 15, 30, 60,









90, 120, 150, and 180 min of incubation and immediately added to 50 [tl stop solution (75

mM NaC1, 25 mM EDTA, 20 mM Tris pH 7.5, and 1 mg chloramphenicol per ml). Cells

were incubated on ice (5 min), harvested at 16,000 x g (10 min, 25C), and stored at -

800C.

Cell pellets were subjected to 3 cycles of freeze-thaw (-800C and 0C) to weaken

the cell membrane. Pellets were resuspended to an O.D.600nm of 0.0134 units per dtl Lysis

solution (75 mM NaC1, 25 mM EDTA, 20 mM Tris pH 7.5, and 0.2 mg lysozyme per ml)

and incubated (25C, 15 min). Samples (O.D.600nm of 0.02 units per lane) were boiled (20

min) in SDS-PAGE loading dye (BioRad) and separated by SDS-PAGE. Gels were dried

and exposed to X-ray film. A VersaDoc Model 1000 with Quantity One Software

(BioRad) was used for densitometric readings.


Results

Construction of Gram-positive PDC Expression Plasmids

Previous work suggested that codon usage effects the synthesis of PDCs in Gram-

negative bacteria (133). To determine if this was the factor responsible for limiting PDC

expression in Gram-positive bacteria, four PDC genes with different G+C content and

codon usage were chosen for expression analysis. These included the S. ventriculipdc

gene (Svpdc) that is poorly expressed in E. coli and is the only known PDC from a Gram-

positive bacterium. In addition, the Saccharomyces cerevisiae PDC1 (ScPDC1) was

chosen because the encoded protein is closely related to SvPDC (130, 133) and is

currently used in corn-to-ethanol production (2). The Acetobacterpasteurianus (130)

and Zymomonas mobilis (111-115) pdc genes (Appdc and Zmpdc) were also used. These









latter two genes are from Gram-negative bacteria and have high levels of expression and

activity in Gram-negative hosts (130, 131, 133).

To construct the expression plasmids, thepdc genes were initially cloned into

pET vectors (Figure 4-1)(Table 4-1). DNA fragments containing thepdc gene of interest

and the Shine-Dalgrano and T7-terminator from the pET plasmid were cloned into the B.

megaterium expression plasmid pWH1520. This generated a truncation of the xylA gene,

which encodes xylose isomerase, and allowed for induction ofpdc expression by xylose

in B. megaterium.

Expression of PDC In Recombinant B. megaterium

After 3 h induction of recombinantpdc gene expression, the levels of PDC protein

produced in the B. megaterium strains were estimated by SDS-PAGE (Figure 4-2). High-

levels of SvPDC protein were evident and estimated to account for 5% of soluble protein

based on Coomassie blue R-250 stained gels. In contrast, only low-level synthesis of

ZmPDC, ApPDC, and ScPDC1 were apparent. To determine if the PDC proteins were

produced in an active form, cell lysate of the recombinant B. megaterium strains was

assayed for PDC activity (Table 4-2). The SvPDC had the highest specific activity in cell

lysate, with 5.29 U per mg protein. Thus, approximately 5% of the total soluble protein

was active SvPDC, consistent with the levels of SvPDC protein estimated by SDS-PAGE.

In contrast, the specific activity of the ZmPDC and ScPDC was 5-fold and 10-fold lower

than SvPDC, respectively. Previous studies have determined the specific activity of

ZmPDC to be 6.2 to 8 U per mg protein (113, 131) when produced in recombinant E.

coli, in contrast with 1.1 U per mg in this study. There was no detectable activity for the

ApPDC protein.









It was previously reported that purified SvPDC from recombinant E. coli and

reported specific activities in cell lysate of 0.16 U per mg from BL21-CodonPlus-RIL

augmented with accessory tRNAs for the AUA and AGA codons (133). No tRNA

augmentation was necessary in recombinant B. megaterium and yet there was a 33-fold

increase in the specific activity in cell lysate. These results demonstrate that SvPDC is

not only produced in very high quantity, but is produced in an active form within the B.

megaterium host cell. This is quite remarkable because it is the first report of high levels

of PDC production in a recombinant Gram-positive bacterium. These results indicate that

B. megaterium is a better host for production of the SvPDC while it is sub optimal for the

production of the Gram-negative PDCs, ZmPDC and ApPDC, which were expressed

more efficiently in E. coli.

Analysis of PDC Transcript Levels

The factors responsible for low-level production of PDC protein in recombinant

Gram-positive bacteria are unknown (33-35, 228). In order to determine if transcription

and/or mRNA degradation were limiting production of PDC in Gram-positive hosts, we

analyzedpdc transcript levels for the various recombinant B. megaterium strains. Total

RNA was isolated and quantitative reverse transcriptase PCR was performed to

determine if transcript levels correlated with PDC production (Figure 4-3). The transcript

levels were similar for all fourpdc genes, ranging from 12 to 24% of total RNA, with the

transcript for Zmpdc the lowest and Scpdcl the highest. There was not an abundance of

Svpdc transcript compared to the otherpdc gene transcripts. Thus, the pdc-specific

mRNA levels did not correlate with the levels of PDC protein in the recombinant B.

megaterium strains. These results indicate that the level of transcript is not the factor









influencing protein levels of PDC in the cell. This is not unexpected due to the use of the

same inducible promoter, transcription terminator, and vector for the construction of all

fourpdc gene expression plasmids.

PDC Protein Stability In Recombinant B. megaterium

Gram-positive bacteria, particularly the bacilli, are well known for an abundance

of proteases (229). This is often a problem when producing heterologous proteins in

these hosts (229-231). To determine if protein degradation was responsible for limiting

PDC production in B. megaterium, pulse-chase analysis was performed. The SvPDC and

ZmPDC were chosen for analysis based on the availability of antibodies. After induction

ofpdc transcription (15 min), protein was labeled with L-[35S]-methionine (15 min) and

chased with excess unlabeled L-methionine. This enabled the rate of protein degradation

after induction ofpdc gene transcription to be monitored over a period of several hours

(Figure 4-4).

During the initial half-hour, the rate of degradation of recombinant PDC protein

ranged from 1.3 to 3% of labeled PDC protein per min. The degradation of SvPDC was

at a higher rate than that of ZmPDC. After these elevated initial rates, however,

degradation of both SvPDC and ZmPDC were similar at 0.48% and 0.44% labeled PDC

protein per minute, respectively. In contrast, samples that had chloramphenicol, a protein

synthesis inhibitor, present during the entire chase exhibited no degradation of the PDC

proteins. It is, therefore, interesting to note that the protease or proteases responsible for

the degradation of the PDC proteins are induced during the induction of the recombinant

proteins.









This data proves that degradation of recombinant PDC proteins occurs at very

similar rates, yet the amounts of the SvPDC present after 3 h induction is dramatically

different when visualized on SDS-PAGE gel (Figure 4-1). Protein degradation is,

therefore, not a factor influencing the levels of active PDC protein in B. megaterium.


Discussion

For production of ethanol in Gram-positive bacteria to become a viable fuel

alternative it will be necessary to find a PDC that can be expressed at high enough levels

to rapidly funnel pyruvate to acetaldehyde. Until now, there has not been a PDC that has

been expressed well in a recombinant Gram-positive bacterium (33-35, 228).

In this study, B. megaterium expression vectors were designed in such a way to

transcribe all fourpdc genes at similar rates by using the same xylA promoter, Shine-

Dalgrano sequence, and T7 terminator. Using this approach, the S. ventriculi PDC was

expressed at high levels in the recombinant Gram-positive host. The SvPDC protein

levels and activity were at least 5-fold higher than when the Z. mobilis, A. pasteurianus,

or S. cerevisiae PDC proteins were expressed. To assess the biological reason for these

differences, quantitative reverse transcriptase PCR and pulse-chase experiments were

performed. Similar levels ofpdc-specific transcript and similar rates of PDC protein

degradation were determined. Thus, in the Gram-positive host examined in this study,

protein synthesis limited the production of PDC proteins from yeast and Gram-negative

bacterial genes.

It was previously demonstrated that addition of accessory tRNAs is necessary for

enhancement of protein levels of SvPDC in E. coli by ten-fold (133). This is not the case

when ApPDC and ZmPDC are expressed in E. coli. Both PDCs are produced at very high