<%BANNER%>

Evalulation of sustained release of antisense Oligonucleotide from Poly DL (Lactide-Co-Glycolide) microspheres targeting...

University of Florida Institutional Repository

PAGE 1

EVALULATION OF SUSTAINED RELEASE OF ANTISENSE OLIGONUCLEOTIDE FROM POLY DL (LACTIDE-CO-GLYCOLIDE) MICROSPHERES TARGETING FIBROTIC GROWTH FACTORS CTGF AND TGF1 By KAREEM SAKURA BURNEY A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2003

PAGE 2

Copyright 2003 By Kareem Sakura Burney ii

PAGE 3

ACKNOWLEDGMENTS I would like to thank all the staff of the Biomedical Engineering Department at the University of Florida for their financial support for my time in graduate school. I would also like to thank the Materials Science and Engineering Department and the Obstetrics and Gynecology Department for their financial support for this project I would like to express my gratitude to my committee members, Dr. Gregory Schultz, Dr. Gloria Chin, and my advisor, Dr. Christopher D. Batich, for their support and advice for this project. For their time and help I would like to thank all the people who helped me succeed at accomplishing this project. These people are Xeve Silver, John Azeke, Tara Washington, Patrick Leamy, and Timothy Blalock. I would also like to thank Dr. Gene Goldberg and Dr. Hollis Caffee for their time and input in this project. I would now like to thank all my friends who have given me the support I needed to accomplish this goal. These people are Dr. Irvin W. Osborne-Lee, Dr. Kamel Fotouh, Jeffery Taylor, Ryan McGinty and Dana Milborune. Without their support I would not have been able obtain my Master of Science degree. Finally I would like to extend ultimate gratitude to my parents, Ulysses and Bettye Burney, and my brothers, Kofi and Khary Burney. Without them, I would not have had the ability to be successful nor even be in the position I am in today. iii

PAGE 4

TABLE OF CONTENTS Page ACKNOWLEDGMENTS.................................................................................................iii LIST OF TABLES.............................................................................................................vi LIST OF FIGURES.........................................................................................................viii ABSTRACT.......................................................................................................................xi CHAPTERS 1 INTRODUCTION..........................................................................................................1 2 BACKGROUND............................................................................................................5 Introduction...................................................................................................................5 PDMS Breast Implants.................................................................................................6 Design of Breast Implants.....................................................................................6 Complications of Breast Implants.........................................................................7 Wound Healing and Growth Factors............................................................................9 Wound Healing Process........................................................................................9 Growth Factors CTGF and TGF-1....................................................................11 Poly (DL-Lactide-co-Glycolide)................................................................................14 Lactide and Glycolide in the Human Body.........................................................14 Polymer Applications of PLGA..........................................................................16 Hyaluronic Acid..........................................................................................................17 Hyaluronic Acid Usage by the Human Body......................................................17 Wound Healing Applications..............................................................................18 3 MATERIALS AND METHODS..................................................................................20 Materials.....................................................................................................................20 Microsphere Components....................................................................................20 Antisense Oligonucleotides to CTGF and TGF-1.............................................20 Silicone Breast Implants......................................................................................21 Methods......................................................................................................................21 Doping Process of Microspheres.....................................................................21 Microsphere Preparation.....................................................................................22 Fluorescent Spectroscopy and UV-VIS Spectroscopy Analysis for Microsphere Release Kinetics Study....................................................................................23 iv

PAGE 5

SEM Analysis for Particle Characterization........................................................24 Particle Sizing for Particle Characterization.......................................................24 Total Amount Incorporated into Microspheres...................................................24 Release Profiles for Microspheres.......................................................................25 Microsphere Preparation for an Animal Study....................................................27 Rat Study.............................................................................................................28 Homogenizing of Rat Tissue for use in the ELISA Assay..................................29 CTGF ELISA Used in Rat Study........................................................................29 TGF-1 ELISA used in Rat Study......................................................................31 4 RESULTS AND DISCUSSION...................................................................................33 Microsphere UV-VIS Spectrophotometer Analysis...................................................33 1X microsphere release kinetics..........................................................................33 Microsphere Release Data from Fluorescent Detector...............................................36 Microsphere Encapsulation Experiment..............................................................36 50X Release Profile Experiment.........................................................................38 Particle Characterization of PLGA Microspheres......................................................40 Particle Sizing of Microspheres...........................................................................40 SEM Characterization of microspheres...............................................................45 In vivo results.............................................................................................................50 Surgical procedure...............................................................................................50 ELISA CTGF Assay Results...............................................................................55 ELISA TGF-1 Assay Results............................................................................60 5 CONCLUSION AND FUTURE WORK.....................................................................64 Microsphere Development..........................................................................................64 Implantation................................................................................................................64 Future Work................................................................................................................65 Microspheres-Future Work.................................................................................66 Microspheres-Future Uses...................................................................................66 Rat Animal Experiment-Future Work.................................................................66 APPENDICES A STASTICTICAL ANALYSIS OF MICROSPHERE PARTICLE DISTRIBUTION.67 B ELISA NUMERICAL RESULTS...............................................................................71 C STATISTICAL ANALYSIS PROVIDED BY ANOVA FOR ELISA RESULTS.....73 REFERENCES..................................................................................................................89 BIOGRAPHICAL SKETCH.............................................................................................95 v

PAGE 6

LIST OF TABLES Table page 3-1: The 20 rats in this experiment divided into four groups...........................................28 4-1: Cumulative antisense CTGF released from 1X microspheres during experiment (in mg). For each trial 50mg of microspheres were used..............................................35 4-2: Amount of encapsulated antisense CTGF (in g of antisense/mg of microspheres) in microspheres. For each trial 20mg of microspheres from each loading factor was used...........................................................................................................................37 4-3: Encapsulation efficiency of microspheres.................................................................38 4-4: Cumulative antisense CTGF released from 50X microspheres during experiment (in mg). For each trial 50mg of microspheres were used..............................................39 A.1: Particle sizing statistical data for 100X microspheres..............................................67 A.2: Particle sizing statistical data for 50X microspheres................................................68 A.3: Particle sizing statistical data for 10X microspheres................................................69 A.4: Particle sizing statistical data for 1X microspheres..................................................70 B.1: CTGF level ELISA results from week 1 rat groups. ( ng of CTGF/ mg protein).....71 B.2: CTGF level ELISA results from week 2 rat groups. ( ng of CTGF/ mg protein).....71 B.3: TGF-B1 level ELISA results from week 1 rat groups. ( pg of TGF-B1/ mg protein)72 B.4: TGF-B1 level ELISA results from week 2 rat groups. ( pg of TGF-B1 /mg protein)72 C.3: Mean and Standard Deviation values from ELISA results of CTGF bottom of capsule week 1.........................................................................................................75 C.4: P values of ELISA results from CTGF bottom of capsule week 1...........................76 C.5: Mean and Standard Deviation values of ELISA results from CTGF skin week 277 C.6: P values of ELISA results from CTGF skin week 2.................................................78 vi

PAGE 7

C.7: Mean and Standard Deviations of ELISA results from CTGF Bottom of capsule week 2......................................................................................................................79 C.8: P values of ELISA results from CTGF Bottom of capsule week 2..........................80 C.9: Mean and Standard Deviation values of ELISA results from TGF-B1 skin week 181 C.10 : P values of ELISA results from TGF-B1 skin week 1...........................................82 C.11: Mean and Standard Deviation values of ELISA results from TGF-B1 Bottom of capsule week 1.........................................................................................................83 C.12: P values of ELISA results from TGF-B1 Bottom of capsule week 1.....................84 C.13: Mean and Standard Deviation values of ELISA results from TGF-B1 skin week 285 C.14: P values of ELISA results from TGF-B1 skin week 2............................................86 C.15: Mean and Standard Deviation values of ELISA results from TGF-B1 Bottom of capsule week 2.........................................................................................................87 C.16: P values of ELISA results from TGF-B1 Bottom of capsule week 2.....................88 vii

PAGE 8

LIST OF FIGURES Figure page 2-1: Anatomy of human breast (51)....................................................................................5 2-2: Contour design of breast implant (23).........................................................................6 2-3: Round design of breast implant (23)...........................................................................7 2-4: Glycolysis and Gluconeogenesis diagram (3,5)........................................................14 2-4: Lactic Acid molecule.................................................................................................15 2-5:Glycolic Acid molecule..............................................................................................15 2-6: Reaction of Lactide and Glycolide to form PLGA (38)............................................16 2-6:Hyaluronic Acid repeat unit (13)................................................................................18 3-1: Type of silicone breast implant used in this study. Made by Mentor Corporation...21 4-1: Absorption Spectrum of PBS solution......................................................................33 4-2: Absorption peak of PBS solution with fluorescein labeled antisense CTGF............34 4-3: Percent Release Profile of 1X microspheres.............................................................34 4-4: Amount encapsulated in PLGA microspheres as loading of antisense CTGF increases...................................................................................................................36 4-5: Percent Release profile of 50X microspheres...........................................................38 4-6: Comparison of total release vs. time of 50X and 1X microspheres..........................39 4-7: Particle Characterization of 100X microspheres.......................................................40 4-8: Particle Characterization of 50X microspheres.........................................................41 4-9: Particle Characterization of 10X microspheres.........................................................42 4-10: Particle Characterization of 1X microspheres.........................................................43 viii

PAGE 9

4-11: Size distribution of microspheres:A) Size comparison of all microsphere batches from 0-200 um B) Size comparison of all microspheres from 0-2000um...............44 4-12: SEM pictures of 100X Microspheres at 5KeV, working distance =14mm A) 25x. Size bar =1mm B) 200x. Size bar = 100m C) 1500x. Size bar = 10m................45 4-12: Continued................................................................................................................46 4-13: SEM pictures of 50X Microspheres at 5KeV, working distance 14mm A) 25x. Size bar =1mm B) 200x. Size bar = 100m C) 1500x. Size bar = 10m................47 4-14: SEM pictures of 10X Microspheres at 5KeV, working distance 14mm A) 25x. Size bar =1mm B) 200x. Size bar = 100m C) 1500x. Size bar = 10m................48 4-15: SEM pictures of 100X Microspheres at 5KeV, working distance 14mm A) 25x. Size bar =1mm B) 200x. Size bar = 100m C) 1500x. Size bar = 10m................49 4-16: Pictures from rat surgery: A) The syringes used to deliver microspheres and HA B) Template used to determine incision location in animal experiment (areas marked with sharpie marker).................................................................................................50 4-17: Surgical procedure from rat surgery: A) and B) Microspheres/HA injected C) Incisions closed with staples....................................................................................51 4-18: Implant placement after surgery: A) Normal position of implants after surgery, B) and C) After one implant migrated during experiment............................................52 4-19:Capsules formed after experiment: A), B) and C) Different capsules formed around implants after 1 and 2 weeks....................................................................................53 4-20: Capsule formed after surgery and surgical procedure: A) Capsule after 1 and 2 weeks B) Capsule after movement of implant occurred C) Picture of how the skin was taken for ELISA analysis..................................................................................54 4-21: Levels of CTGF in the skin around the implant from week 1(ng of CTGF/mg protein). (* = migration)..........................................................................................56 4-22: Levels of CTGF from the bottom of the implant capsule from week 1 (ng of CTGF/mg protein). (* = migration).........................................................................57 4-23: Levels of CTGF in the skin around the implant from week 2 (ng of CTGF/mg protein). (*= migration)............................................................................................58 4-24: Levels of CTGF from the bottom of the implant capsule from week2 (ng of CTGF/ mg protein). (* = migration).....................................................................................59 4-25: Levels of TGF-1 from the skin from week 1 (pg of TGF-1 / mg protein). (* = migration).................................................................................................................60 ix

PAGE 10

4-26: Levels of TGF-1 from the bottom of the implant capsule from week 1 (pg of TGF-1/ mg protein). (* = migration)....................................................................61 4-27: Levels of TGF-1 from the skin from week 2 (pg of TGF-1/mg protein). (* = migration).................................................................................................................62 4-28: Levels of TGF-1 from the bottom of the implant capsule from week 2 (pg of TGF-1/ mg protein). (* = migration).....................................................................63 x

PAGE 11

Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science EVALULATION OF SUSTAINED RELESE OF ANTISENSE OLIGONUCLEOTIDE FROM POLY DL (LACTIDE-CO-GLYCOLIDE) MICROSPHERES TARGETING FIBROTIC GROWTH FACTORS CTGF AND TGF-1 By Kareem S. Burney August 2003 Chair: Christopher D. Batich Major Department: Biomedical Engineering Antisense oligo ribonucleotides to CTGF (connective tissue growth factor) and TGF-1 (transforming growth factor beta1) were encapsulated in 50/50 Poly (DL-Lactide-Co-Glycolide) acid microspheres for controlled delivery. The microspheres were first placed in a Phosphate Buffered Solution (PBS, 7.4 pH) to show the release kinetics for 24 days. The release kinetics in PBS involved measuring antisense oligonucleotide to CTGF containing a fluorescence label with a UV spectrometer and fluorometer. The amount of antisense CTGF encapsulated was gradually increased to determine how much could be held by the microspheres. The morphology and topography of the microspheres were analyzed using scanning electron microscopy and laser particle diffraction. xi

PAGE 12

After the microspheres were made they were then suspended in hyaluronic acid solutions to help provide an even distribution of particles. They were then injected subcuteneously along the surface of a miniature silicone breast implant for a period of two weeks to determine whether they could lower the amount of CTGF and TGF-1 being produced by the fibroblasts. The measurement of CTGF and TGF-1 were done using an ELISA assay. Results showed that there was a decrease in the levels of CTGF (p=0.005) but not in the levels of TGF-1. xii

PAGE 13

CHAPTER 1 INTRODUCTION The specific aim of this research project is to develop a drug delivery material that will release drugs for a long period of time that could one day be used to treat the problem of capsular contraction. Capsular contraction is a reaction of the body to the presence of a breast implant (11,12,20,31). A fibrous capsule forms around a breast implant and eventually contracts, disfiguring the implant and causing pain and suffering to the patient (11,12,20). This research project is based on the hypothesis that a polymer can be used as a drug delivery material to change how the body heals itself, while being safe and effective. The first objective is to develop a drug delivery method to deliver drugs locally. The second objective is to develop an animal model to test this drug delivery method. The research involves determining what polymer to use and the best methods to test the drug, both in vitro and in vivo. The polymer must degrade in the human body without causing a strong immunological response, and be able to release the drug efficiently. The polymer that will be used in this experiment is Poly Lactic Glycolic Acid (PLGA). PLGA is used because it degrades safely in the body and the FDA has already approved it for human use in other applications. Capsular contraction is a frequently major problem after breast implant surgery. Breast implants are used for cosmetic enhancement or for reconstruction, such as after breast cancer surgery. Of these uses, 5-10% of patients undergoing augmentation surgery 1

PAGE 14

2 using saline implants and 25-30% of patients undergoing breast reconstruction surgery using saline implants will experience capsular contracture. When a breast implant is implanted the body, it will generate a foreign body response and form a fibrous capsule. Once the capsule is formed, it shields the implant from immunological attacks to some extent. In some cases the fibrous capsule will contract (some theorize that this is due to the body trying to extrude the implant), compressing the implant, from a flattened ellipsoid shaped object into a spherical object. This compression of an object in confined space causes pain and discomfort to the patient, and will ultimately lead to disfigurement of the breast (20,23,31,41,51). At this point the patient has a few options. These options are to undergo a secondary breast reconstructive surgery, apply massage techniques to break the capsule, or to completely remove the breast implant (43). If the patient chooses to keep the implant, the capsule often continues to develop. Thus, there is a need to develop an effective way to prevent the capsule from forming. Since capsular contracture can occur from 3 months to 2 years after surgery, there is a long time period when it will occur, making prevention of this problem difficult. This research is designed to eventually develop a drug delivery device that will release antisense oligonucleotides for a defined time period and will hopefully prevent contracture from happening. Several approaches have been applied to prevent capsular contraction: these are grouped into preoperative and postoperative. Since there is no conclusive reason as to why contracture occurs, these published approaches represent a range of ideas to prevent capsular contraction.

PAGE 15

3 Preoperative techniques include, sub muscular placement of the implant. Making the shell of the implant very smooth in order to reduce bacterial contamination and reduce the immunological response leading to capsular contraction. Designing a breast implant with an air pocket so when contracture occurs it will not be as harmful to the patient. Having the patient take antibiotics to prevent wound infections (4). Postoperative procedures are to prevent early hematoma, to use implant movement (massage) in hopes of breaking the capsule, and trying to prevent infection due to the breast implant (4). All of these techniques have been used to prevent or reduce the threat of capsular contracture, but it still occurs. One reason for this could be the presence of growth factors causing the tissue to contract around the breast implant (10). The growth factors implicated are connective tissue growth factor (CTGF) and transforming growth factor beta (TGF-). Since the growth factors are thought to be a major cause of capsule formation, antisense oligonucleotides targeting TGFor CTGF were administered in order to negate their effect in the area of the implant (17,19). The only major drawback to the use of antisense oligonucleotides is when they are injected in solution with saline they have a rapid diffusion which makes them ineffective after a very rapid period of time. What was once done to overcome this fact was to inject the wound site multiple times. This would keep the effect of the antisense oligonucleotides constant for a prolonged period of time. In order to make it more cost effective and convienent for the patient a drug delivery device was designed in the study that had a sustained release of antisense oligonucleotides over a prolonged period of time (17,19).

PAGE 16

4 The experimental design consisted of two phases. Phase one developed the polymer microspheres for drug delivery and measured the release rate of the antisense oligonucleotides [from the polymer microspheres]. Drug release was measured at 30min, 2h, 4h, 6h, 8h, 7 days and 24 days using UV and fluorescent spectroscopy. The second phase consisted of using an animal model to test this device. This assessed if the drug delivery device was effective in decreasing the amount of CTGF and TGF-1 present in tissue. Rats and rabbits are both similar to humans for the development of capsular contracture. The rat was used because it is much less expensive. It was expected that the drug delivery device will affect the surrounding tissue and decrease the levels of CTGF and TGF-1 in the implant capsule for a significant period of time.

PAGE 17

CHAPTER 2 BACKGROUND Introduction The female breast is composed of around fifteen to twenty irregular shaped lobules, containing alveolar glands and a lactiferous duct, which leads to the nipple (47). Connective and adipose tissues separate the lobules and provide support and attachment to the fascia of the underlying pectoralis muscles. Suspensory ligaments, and dense connective tissue strands extend inward from the dermis of the breast to the fascia; and also help to support the weight of the breast. Breast implants were developed to enhance or restore a womans breast volume and contour (23,51). Many patents with congenital hypomes (congenital deficiency of breast tissue) or post-natal breast atrophy (the sagging that develops after child birth and age) choose to undergo breast augmentation to enhance their silhouette. Breast implants are also used in women who have had mastectomies, as the result of breast cancer or for prophylaxis to restore breast contour (23,51). Figure 2-1: Anatomy of human breast (51) 5

PAGE 18

6 PDMS Breast Implants Design of Breast Implants Breast implants consist of a poly dimethyl siloxane (PDMS) elastomer shell filled with either saline or PDMS gel. Saline filled implants are the only one currently approved by the FDA for use in humans. Silicone implants are only available through study centers for patents who meet strict criteria. There two basic designs of saline implants and they differ by whether the implant has a valve that allows for the addition of saline after surgery (23). The saline-filled design(spectrum) has a self-sealing valve located on the front of the implant that is used for filling the device before implantation at the time of surgery. The Spectrum design has a valve on the front of the implant that allows volume adjustments to be made after the implant is surgically placed. Breast implants also differ in their shape, round vs. anatomical, and whether there are surface projections on the silicone shell as in textured vs. smooth implants (23). Once the style is selected the implants are placed beneath the glandular tissue and over the pectoralias muscles or beneath both the breast tissue and the muscles for a subglandular or subpectoral placement respectively. Although it is currently thought by the plastic surgery community that subpectoral placement results in fewer capsular contractures, there are no scientific studies that support this premise. The decrease in capsular contracture of subpectoral implants may result from difficulty in detection. Figure 2-2: Contour design of breast implant (23)

PAGE 19

7 Figure 2-3: Round design of breast implant (23) Complications of Breast Implants Implant rupture, infection, hematoma, and capsular contracture have been reported after breast implant surgery. Rupture can occur days, months, or years after surgery and is detected by a decrease in breast size (34). Implant failure has been associated with closed capsulatomy, trauma, and excessive compression during mammographic imaging and from underfilling of the implant resulting in folds thought to weaken the integrity of the silicone sheet (23,31,51). Infection after breast implant surgery is a complication that frequently requires the removal of the implant and an intervening period of several months in which the patient is infection free before the implant is replaced. Infections, hematomas (blood collection) and seromas (serum collects) frequently occur early after implant placement (11,31). Hematomas and seromas sometimes develop in the pocket adjacent to the implant and may be seeded by bacteria to produce infection or contribute to capsular contraction. Infection has also been thought to cause contracture formation. Patients with breast implants will normally develop a fibrous capsule around the implant. Some will develop significant capsular contracture resulting in the implant causing pain and distortion of the breast implant. With capsular contracture formation the usually soft hemisphere implant becomes round and hard. Breast implant capsular

PAGE 20

8 contracture is believed to be the bodys exuberant response to the implant as a foreign body. When a breast implant is placed inside the human body the body will begin to attack it. The immune response will send macrophages and foreign body giant cells to destroy the implant (44). When this fails the macrophages allow the fibroblast to begin to form a collagen layer around the implant, encapsulating it from the rest of the body. This is normally where the process is desired to stop, but for some breast implants ;the process goes one step further. It occurs in 5-10% or all augmentation surgeries and 25-30% of all reconstruction surgeries using breast implants. This next step involves the newly formed collagen capsule beginning to contract around the implant altering its size and shape and eventually becoming hard. Capsule formation occurs around all prosthetic silicone devices, but has few consequences around devices that are non flexible. The capsular contraction that occurs around breast implants produces the pain and distortion that can only be corrected with surgery designed to replace the implant and open the capsule (capsulotomy) or remove the capsule (capsulcetomy)(11,12). The additional surgery results in additional cost and increases morbidity such as infection, hematoma and seroma. This is a major problem for doctors because there seems to be no direct cause for its occurrence. However, since transforming growth factor beta1 (TGF-1) has been shown to have a significant role in the formation of scar tissue and wound healing in general, we were interested to determine its role in breast implant capsular contracture. In recent studies connective tissue growth factor (CTGF) has been demonstrated to be the downstream mediator of TGF-1(33,39) and so we are also interested in elucidating its role in breast implant capsular contraction.

PAGE 21

9 Wound Healing and Growth Factors Wound Healing Process A wound is a disruption of a structure and its function in the human body (16,29,55), and initiates the wound healing process. Wound healing is influenced by many factors, for example, the presence of growth factors in the blood, the age of the person (because as a person ages the ability to heal decreases drastically), and the nutrients present in the body, (for example vitamin C is necessary for collagen production and calcium is important for cell migration and adhesion (29)). Once a wound is created the body has three different methods for closing the wound. These closures are primary, secondary and delayed primary. Primary closure occurs when the wound edges are very close to each other, as in a clean scapel wound; it usually results in very little granulation tissue, minimal scarring and contracture. Secondary closure is when the wound is initially left open and has greater tissue damage, which prevents primary closure of the wound. There is more scarring, granulation tissue, and contraction. It also takes more time to heal. Delayed primary closure is when the closure is delayed for a few days to treat local infection but ,after that it resumes a secondary closure process. Normally the body repairs acutely injured tissue with scar tissue that is similar to structures and function to the original non-injured tissues. A closure wound develops when the repair process is interrupted, slowed down or stopped completely (29,55). The restoration process is composed of many events, which are regulated extensively by growth factors. Growth factors are proteins that basically tell cells what to do. The growth factors are either secreted elsewhere in the body and arrive at the wound area via blood or are secreted by cells in the area and act on nearby cells in a paracrine manner to

PAGE 22

10 attract them to the wound to help heal it. The cell can also secrete growth factors that act on itself in an autocrine manner (29,55). The sequence of events that occurs in the wound healing process begins with a vascular response, then progresses to blood coagulation, inflammation, formation of new tissues, epithelialization, and contraction. The inflammatory phase is the initial step in the wound healing process. It occurs when the body responds to any type of disruption to the skin (55). Within seconds, blood vessels begin to constrict to control the bleeding and platelets merge within minutes to begin clot formation and stop the bleeding. These platelets also release the growth factors necessary to attract other cells to the wound. Such growth factors are platelet derived growth factor (PDGF) (which attract inflammatory cells and fibroblasts to the wound and transforming growth factor beta (TGF-), which stimulate the fibroblasts to make collagen. Neutrophiles can now enter the wound and attract macrophages. The macrophages will then break down the necrotic debris and activate the fibroblast response. The inflammatory phase will last for around 24hours and lead to the proliferation phase. The proliferation phase begins on the surface of the wound. This is where epidermal cells burst into mitotic activity within 24 to 72 hours and move across the surface of the wound (29). While this is happening, the fibroblasts move into the deeper parts of the wound and synthesize small amounts of collagen, which will act as a scaffold for migration and further the fibroblasts movement. The fibroblasts come from local tissue surrounding the wound and unless the wound is clean of bacteria the migration in this phase will be inhibited (55). Eventually, granulation tissue consisting of abundant new blood vessels will also develop to help in nutritional support of the fibroblast cells.

PAGE 23

11 The proliferation phase lasts for several days to weeks and leads to the repair phaseof the wound healing process. The repair phase begins four to five days after the injury. Fibroblasts begin to produce large amounts of collagen and protoglycans (29). These collagen fibers are laid down randomly and are crosslinked into large, closely packed bundles. During the 2 to 3 week period of the fibroblastic repair phase, wound strength continues to increase and then wound healing enters the maturation phase. The maturation phase begins with the number of fibroblasts in the wound decreasing. As the level of fibroblasts decreases, the collagen fibers are remodeled into a more organized matrix. This organized matrix becomes the dominant feature of the wound (55). The tensile strength of the fibers begins to increase for up to one year after the injury and although the healed wound never regains the full strength of the original skin, it does regain 70% to 80% of its original strength (55). The key growth factors that are responsible the synthesis of the collagen in the wound are Connective Tissue Growth Factor (CTGF) and Transforming Growth Factor Beta (TGF-1). Growth Factors CTGF and TGF-1 These two growth factors were examined in this study because they have been found to play key roles in the development of collagen fibers, which are the main component of capsules. Although TGF-1 seems to have more control over the development of collagen, it also has a role in many other biological functions(48,49,52). If TGF-1 levels were to decrease too greatly, it could have traumatic effects on the entire biological system. That is why CTGF is being investigated. It seems to focus

PAGE 24

12 primarily on the formation of collagen; thus, if its levels were to decrease, then other biological systems would still be able to function properly (8,39). CTGF is a member of the gene family CCN (C TGF, C yr61 and N ov). Members of the CCN family have characteristics of proteins that contain an IGF (Insulin-like Growth Factor) binding domain, a von Willebrand factor type C repeat, a thrombospondin type 1 domain and a C-terminal domain that contains a cystine knot (10,33). This family of proteins is significant because all members promote angiogenesis, cell migration, and cell adhesion. The CTGF molecule itself contains around 343-349 residues with the first 22-27 residues comprising a signal peptide. Even though it is found in different species, CTGF seems to have the same type of structure, except for the fact that human CTGF has the presence of N-linked glycosylation consensus sequence at residues 28-30 and 225-227, which is absent from the CTGF molecules in other species. CTGF so far has been implicated in many different physiological processes. Some of these processes involve embryo development, fibrosis, tumor desmoplasia, wound healing, cell proliferation, DNA synthesis, extra cellular matrix (ECM) production, and angiogenesis (24,26,30,40). CTGF is related to capsule formation due to its influence on the fibroblasts during the wound healing process. In recent studies, CTGF was shown to stimulate the fibroblasts production of ECM components such as type I collagen. (24,26,30,40). This is important because, as the body forms a capsule, the fibroblasts will eventually produce collagen around the implant, seemingly under the control of CTGF It is also known that CTGF is a mediator of TGF-1. TGF-1 is a 25kDa homodimeric protein that comes from the TGF-(Transforming Growth Factor beta) superfamily. This family of growth factors is related in that they share a similar cysteine

PAGE 25

13 knot structure. The general function of TGF-1 in mammals is to modulate cell cycles, inflammatory responses, extracellular matrix production, and mesenchymal-epithelial interactions (24,26). Overall, there are five different isoforms of TGFbut in mammals there are three. These three are called TGF-1, TGF-2,and TGF-3. The difference between these isoforms is that TGF-1 is a more potent growth inhibitor of heamopoeitic stem cells and ECM production than TGF-2 and TGF-3. TGF-3 is more potent than TGF-1 and TGF-2 at DNA synthesis in primary human keratinocyte cell cultures (24,26,35). TGF-1 is of concern in this research because it has the ability to promote fibroblast proliferation and matrix synthesis. The relationship between these factors is still being investigated, but it has been shown that fibrosis occurs only in the presence of both CTGF and TGF-1. In mammals, CTGF is normally expressed at relatively low levels. Furthermore, TGF-1 is the primary inducer of CTGF in the fibroblast cells which is one of the main producers of collagen during capsule formation (39,46,49). This has lead to the hypothesis that decreasing the amount of TGF-1 in the system should also decrease the amount of CTGF. Additionally, ways are being develop to decrease only CTGF. A way to decrease the amount of growth factors expressed in a system is to use a polymer drug delivery device to deliver antisense oligonucleotides that target the specific growth factors. Antisense oligonucleotides to the growth factors TGF-1 and CTGF could lead to a decrease in collagen development. How they could be delivered to cells will be discussed in the next section.

PAGE 26

14 Poly (DL-Lactide-co-Glycolide) Lactide and Glycolide in the Human Body For this work, the antisense growth factors were incorporated within a polymer. This polymer should not cause an inflammatory response, be biodegradable, be easily produced, and be metabolized by the body after it has released the drug. One such polymer that can do all of this is Poly (DL-Lactide-co-Glycolide) Acid (PLGA). PLGA is composed of two independent repeat units lactide and glycolide. When PLGA is degraded, lactide and glycolide repeat units become lactic acid and glycolic acid. Both of these acids are part of the Alpha Hydroxy Acid (AHA) group, and both are in some way produced by normal metabolism the human body. For example, lactic Acid is a molecule that comes from the breakdown of glucose during metabolism. Figure 2-4: Glycolysis and Gluconeogenesis diagram (3,5)

PAGE 27

15 Figure 2-4: Lactic Acid molecule Lactic acid is used it as an energy source. When the body begins to use its muscles, glucose goes directly to the muscles and is converted to lactic acid. The lactic acid then goes to liver and is converted to glucose. As to why the body does this is unclear but it seems that lactic acid in comparison to glucose is smaller and better exchanged between tissues. It can rapidly move across cell membranes and it is made in great amounts by the muscles, especially during anaerobic metabolism. Glycolic Acid on the other hand serves a different purpose inside the human body. The body uses glycolic acid to moisturize the skin, stimulate skin turnover, exfoliate and stimulate the generation of new skin (22,27). It is able to do this because of its very small size. Figure 2-5:Glycolic Acid molecule

PAGE 28

16 Once inside the cell it will begin to cause the synthesis of new collagen and dermal glycosaminoglycans that will help to heal the skin. Unlike lactic acid, glycolic acid seems not to be involved in production of energy for the body and is only used by the skin. Polymer Applications of PLGA When lactide (the cyclic dimer of lactic acid) and glycolide (the cyclic dimer of glycolic acid) undergo a catalytic ring opening reaction they become the copolymer PLGA. Figure 2-6: Reaction of Lactide and Glycolide to form PLGA (38) This copolymer is sometimes preferred over the homopolymer made from either pure lactide or glycolide because it has more useful properties then either pure polymer. Poly Glycolic Acid has a high melting point and low solubility in organic solvents, but it does not become amorphous after implantation in a time frame that is necessary for many applications in drug delivery. In contrast, DL-Poly Lactic Acid quickly becomes amorphous after implantation. DLPoly Lactic Acid is the optically inactive (racemic) form of Poly Lactic acid and it has the characteristics of having low tensile strength, high elongation, and a very rapid degradation time because of the highly irregular length of the polymer chain. L-Poly Lactic Acid is the optically active form of Poly Lactic Acid, and it has the properties of being semicrystalline in nature due to the high regularity of its polymer chain (38,41). DL-Poly Lactic Acid is usually chosen because DL-Poly Lactic

PAGE 29

17 Acid allows a more homogenous dispersion of the drug throughout its polymer matrix (38,41). PLGA can be used in many different applications, such as a drug delivery device in the form of microspheres, nanospheres and films (18,32,38,41,44). It can be used in wound management devices such as absorbable sutures, surgical meshes, clips, staples, and bioadhesives. The application of PLGA in this project will be in its microsphere form. Microspheres will be used because they should not interfere with the original intent of the breast implant and should not create a large physical barrier during the wound healing process. PLGA has recently generated great interest because of its biocompatibility and its ability to biodegrade over a period of time. PLGA can also be formulated into many different devices and has already been approved by the FDA for drug delivery uses. This has caused it to become a widely investigated copolymer that will allow scientists and engineers to find more applications that will benefit society as time goes on. Hyaluronic Acid Hyaluronic Acid Usage by the Human Body Hyaluronic Acid (HA) is a type of polysaccharide that is created naturally in animals and bacteria (2,13,15,40). In fact, its structure is the same in all living organisms. In mammals, its presence in the extracellular matrix allows the ECM bind to water, which allows it to hydrate the skin (13,15). HA also serves a second purpose in that it is used to lubricate joints such as knees and elbows. The reason HA is being used in this research is because it provides a medium that is viscous, safe and should provides a more even distribution of the PLGA/Antisense growth factor microspheres.

PAGE 30

18 HA is a linear polysaccharide from the glycosaminoglycan family. It is composed of repeating disaccharide units of D-glucoronic acid and N-acetly-glucosamine. Since these units are not covalently bonded to proteins, the body does not generate an immunological response to it (15). Figure 2-6:Hyaluronic Acid repeat unit (13) Wound Healing Applications HA also has an additional function by playing an important role in the wound healing process, which is derived from its physicochemical and biological properties. It physicochemical properties are that is has large amounts of visoelasticity and its solutions are highly osmotic. HA is highly osmotic which allow it to control tissue hydration during the wound healing process. HA also has the ability to exclude proteins from its matrix by steric exclusion (15). Its biological properties are that it binds to cells through three receptors on the cell surface. The receptors are CD44, RHAMM, and ICAM-1. CD44 is a receptor that is used for keratinocyte proliferation in response to extracellular stimuli and maintenance of local HA homeostasis. RHAMM is receptor that is on migrating fibroblasts and metastic tumor cells. ICAM-1 is a receptor that is only present on the endothelial cells and macrophages. During the initial phases of the wound healing process ICAM-1 binds to Lymphocyte function associated-1, which is an important step

PAGE 31

19 in inflammatory phase (13,15). If a large amount of HA is present in the wound area instead, ICAM will also bind to the HA molecule. HA has been shown to accumulate in the early stages of the inflammatory phase. It promotes migration of cells during the inflammatory phase and protects against free radical and proteolytic damage (15). It also increases the levels of proinflammatory cytokines TNF-(tumor necrosis factor-alpha), IL-1(interleukin-one beta), IL-8 (interleukin-eight) and it facilitates the primary adhesion of cytokine activated lymphocytes to endothelium cells. In the granulation phase HA helps to facilitate cell detachment and mitosis and it increases cell migration. HA presence in the epithelization phase stimulates proliferation of basal keratirocytes, while during the remodeling phase HA reduces scarring. In the extracellular matrix HA, is regulated by many growth factors where it also provides a means for supporting cell migration and adhesion. The amount of HA around a wound depends on the age of person. In fetal wounds, HA appears and remains throughout the process, while in adult wounds HA appears early and it begins to drop off as the wound is healing (36,34,40,50,54). HA seems to be able to cause minimal fibrosis by inhibiting platelet function. It also inhibits aggregation, cytokine release and protein synthesis, thereby decreasing the amount of collagen produced by the dermal fibroblasts and decreasing fibrosis(37). HA is present in large amounts during fetal wound healing, where the wounds are scar-free, but decreases greatly in adult wound healing where the wounds are marked by scarring (40).

PAGE 32

CHAPTER 3 MATERIALS AND METHODS Materials Microsphere Components A random copolymer DL-PLGA (DLPoly lactide co glycolide acid) with a ratio of 50/50 lactide/glycolide (Inherent visc:0. 58dL/g in HFIP@30C) was purchased from Birmingham Polymers, Inc (Birmingham, AL). One batch of 30 grams was used to prepare the microspheres. This was used in conjunction with poly vinyl alcohol (87-89%hydrolyzed, Average Mw 13,000-23,000, lot# 21702MO) purchased from Aldrich Chemical Company (Milwaukee, WI). After the DL-PLGA microspheres were made, they were administered along the implant surface in a Hyaluronic Acid (HA) suspension. The Hyaluronic Acid (animal source: streptococcus zooepidemicus, lot# 120K15211) was purchased from Sigma Aldrich (St Louis, MO). Antisense Oligonucleotides to CTGF and TGF-1 The 21-mer antisense CTGF whose sequence (5 CCACAAGCTGTCCAGTCTAAF 3, Molecular weight: 6644.4Da Optical Density 59.1), that was used in the release kinetics experiment was purchased from Sigma Genosys (The Woodlands, TX). The antisense CTGF, antisense TGF-1 and scrambled antisense that were used in the rat experiment was provided by Isis Pharmaceuticals (Carlsbad, CA). 20

PAGE 33

21 Silicone Breast Implants The silicone breast implants that were used in the rat experiments were provided by Mentor Corporation (Irving, TX). The implant had a diameter of 1 inch and a height of .5 inch. It was filled with a silicone elastomer gel in a silicone shell. Figure 3-1: Type of silicone breast implant used in this study. Made by Mentor Corporation. Methods Doping Process of Microspheres Doping is a process of mixing fluorescein-labeled antisense oligonucleotides and unlabeled antisense oligonucleotides at a certain ratio and diluting it with phosphate buffer saline (PBS). The dilution values were used to create a standard curve so that the concentrations of the samples could be determined. The basic procedure for the doping process involved taking 39 mg of antisense TGF-, placing it in a small vial, adding 250 l of the antisense CTGF/PBS, and then using a final vortex mixing. The vortexed solution was used to make the concentrations 100X, 50X, and 10X. Adding 50 l of pure PBS to the vortexed solution made a 100X concentration. Taking 100 l from the 100X solution and adding 100 l of pure PBS

PAGE 34

22 made a 50X concentration. Adding 200 l of pure PBS to 50l of the 50X solution made a 10X concentration. Microsphere Preparation The microsphere preparation method that was chosen for this research was a water-oil-water (w-o-w) evaporation technique described by Hussain et al (28). This method was chosen because it has been used previously for encapsulating antisense oligonucleotide growth factors. Using the (w-o-w) evaporation technique the 1X solution was made with antisense CTGF (composed of 26g of fluorescence labeled antisense CTGF), which was added to 150 l of pure phosphate buffered saline (PBS). This solution was then combined with 500 mg of PLGA, which was dissolved in 5 ml of methylene chloride. The mixture was then vortexed for 5 minutes and added to 160 ml of 4% (w/v) poly vinyl alcohol (PVA). In order to allow the methylene chloride to evaporate, the PVA was stirred at 671 revolutions per minute (rpm) for 24 hours. While the PVA was being stirred it was open to the air. The microspheres were then pipetted into three 50 ml polypropylene centrifuge tubes, centrifuged for 10 minutes, washed 3 times in distilled water and then freeze-dried at -50C for 48 hours using a Labconco Freeze Dryer 4.5 (Labconco, Inc. Kansas City, MO). Then stored at 4C for later use. Using antisense oligonucleotide CTGF, (composed of 2mg of fluorescence labeled antisense CTGF) the 10X solution was made by combining 503mg of PLGA and 5ml of methylene chloride. The mixture was then vortexed for 5 minutes and added to 160 ml of 4% w/v PVA. To allow the methylene chloride to evaporate; the PVA was stirred at 680 rpm for 24 hours. The microspheres were then pipetted into three 50ml polypropylene centrifuge tubes, centrifuged for 10 minutes, washed 3 times in distilled

PAGE 35

23 water and then freeze-dried at -50C for 48 hours using a Labconco Freeze Dryer 4.5 (Labconco, Inc. Kansas City, MO). Then stored at 4C for later use. The 50X solution was created by combining 497mg of PLGA and 5 ml of methylene chloride. The mixture was then vortexed for 5 minutes and added to 160 ml of 4% w/v PVA In order to allow the methylene chloride to evaporate; the PVA was stirred at 681 rpm for 24 hours. The microspheres were then pipetted into three 50ml polypropylene centrifuge tubes, centrifuged for 10 minutes, washed 3 times in distilled water and then freeze-dried at -50C for 48 hours using a Labconco Freeze Dryer 4.5 (Labconco, Inc. Kansas City, MO). Then stored at 4C for later use. The 100X solution was created by combining 503 mg of PLGA and 5 ml of methylene chloride. The mixture was then vortexed for 5 minutes and added to 160 ml of 4% w/v PVA In order to allow the methylene chloride to evaporate; the PVA was stirred at 674 rpm for 24 hours. The microspheres were then pipetted into three 50 ml polypropylene centrifuge tubes, centrifuged for 10 minutes, washed 3 times in distilled water and then freeze-dried at -50C for 48 hours using a Labconco Freeze Dryer 4.5 (Labconco, Inc. Kansas City, MO). Then stored at 4C for later use Fluorescent Spectroscopy and UV-VIS Spectroscopy Analysis for Microsphere Release Kinetics Study The release of the antisense CTGF from PLGA microspheres was determined with the use of an ultraviolet-visible (UV-VIS) Spectrophotometer (UV-2401 PC, Shimadzu Scientific Instruments, Inc. Columbia, MD.) The UV-VIS spectrophotometer measurements gave initial data of the release kinetics but the overall loading of the microspheres was too low to cause a biological effect so the antisense CTGF was increase by a factor of 10 times (10X) conc: 13.33 mg/ml, 50 times (50X) conc:

PAGE 36

24 66.67mg/ml, and 100 times (100X) conc: 133 mg/ml the initial concentration (1X) conc:02 mg/ml. These increase concentrations of antisense were more than what was available, so an unlabeled antisense TGFwas used in conjunction with the fluorescein labeled to develop new sets of doped microspheres. Unlabeled TGFwas used because it has about the same molecular weight as the fluorescein labeled antisense CTGF and thus would not affect the release kinetics during experimentation. The release of antisense CTGF from the doped microspheres was measured with a Fluorescent Detector (Mithras LB940, USA). SEM Analysis for Particle Characterization A field emission gun scanning electron microscope (FEG-SEM JEOL JSM-6335F, Jeol, MA, USA) was used to take pictures of the microspheres and to determine whether the antisense growth factor had an effect on the physical appearance at the differing microsphere concentrations (1X, 10X, 50X, and 100X). Particle Sizing for Particle Characterization Laser light scattering (Coulter LS230, USA) was used to determine whether antisense growth factor loading had an effect on particle size. The differing microsphere concentrations (1X, 10X, 50X, and 100X) were freeze-dried, dispersed in distilled water and the size distribution was determined using laser light scattering. The laser light scatter was used twice for each of the differing microsphere concentrations in order to verify any changes in the particle sizes. Total Amount Incorporated into Microspheres Fluorescent spectroscopy was used to determine the total amount of antisense CTGF in a 20 mg sample obtained from each of the differing microsphere concentrations (1X, 10X, 50X, and 100X). The microsphere samples were dissolved into a solution

PAGE 37

25 composed of 2.5 ml of methylene chloride and 2ml of the PBS solution. Then the mixtures individually were stirred using a magnetic plate for 1 hour and centrifuged at 13400 rpm for 10 minutes. After centrifugation, the PBS supernatant was pipetted into a polypropylene centrifuge tube and the concentrations of antisense CTGF were determined using a fluorescent spectroscopy. Fluorescent spectroscopy was used three times for each of the differing microsphere samples in order to verify the concentrations of antisense CTGF in each sample. Release Profiles for Microspheres An UV Spectrophotometer set at 494 nm was used to determine the amount of antisense CTGF that was released from three 50 mg samples of the 1X microsphere concentration. The 1X microsphere samples were dispersed in 1 ml of PBS with 0.1% sodium azide and rotated in a hybridization incubator (Robbins Scientific Model 400, USA) at 37C. At various time intervals (30 minutes, 2 hour, 4 hours, 8 hours, 24 hours, 48 hours, 7 days, and 24 days) the samples were removed from the incubator and centrifuged at 13400 rpm for 8 minutes to separate the microspheres from the suspension. The supernatant was then withdrawn and replaced with equal amounts of PBS, which allowed for a new measurement of the antisense oligonucleotide CTGF concentration within the microspheres at the various time intervals. The UV Spectroscope was used the microsphere samples in order to obtain an average concentration of antisense oligonucleotide CTGF released from each sample. Fluorescent spectroscopy was used to determine the amount of antisense oligonucleotide CTGF that was released from 50 mg samples of the 50X microsphere concentration. The 50X microsphere samples were dispersed in 1 ml of PBS with 0.1% sodium azide and rotated at 20 rotations per minute in a hybridization incubator (Robbins

PAGE 38

26 Scientific Model 400, USA) at 37C. At various time intervals (30 minutes, 2 hour, 4 hours, 8 hours, 24 hours, 48 hours, 7 days, and 24 days) the samples were removed from the incubator and centrifuged at 13400 rpm for 8 minutes to collect the microspheres from the suspension. The supernatant was then withdrawn and replaced with equal amounts of PBS, which allowed for a new measurement of the antisense CTGF concentration within the microspheres at the various time intervals. Fluorescent spectroscopy was used three times for each of the differing microsphere samples in order to obtain an average concentration of antisense oligonucleotide CTGF released from each sample. The1X microsphere samples had its release kinetics determined because it was the original set of microspheres made. Once its release kinetics was determined, it was shown that the concentration level of antisense in the microspheres would not be enough to cause a biological effect in an animal model. It is unknown how much antisense is actually needed to cause a biological effect in an animal model. To ensure that a biological effect happens, it is necessary to have the highest concentration of antisense possible incorporated in the microspheres. This then lead to the experiment of increasing the amount of antisense used in the microspheres by 10X, 50X, and 100X. After the 10X, 50X and 100X microspheres were made; the concentration levels of the antisense were determined. These levels showed that the 50X microspheres had the greater probability of having the highest concentration of antisense incorporated in the microspheres. This caused the 50X microspheres to have its release kinetics determined. The 50X microsphere procedure was then used to make the microspheres for the animal study

PAGE 39

27 Microsphere Preparation for an Animal Study The rat experiment used three different types of antisense: 1) antisense CTGF 2) antisense TGF1 3) scrambled antisense. The antisense CTGF microspheres were made by combining 11 mg of antisense oligonucleotide CTGF to 150l of PBS. This mixture was then vortexed until the antisense CTGF was dissolved. Then the PBS/antisense CTGF solution was added to a solution of 508 mg of PLGA and 5ml of methylene chloride. The mixture was then vortexed for 5 minutes and added to 160 ml of 4% w/v PVA. In order to allow the methylene chloride to evaporate, the PVA was stirred at 691 rpm for 24 hours. The microspheres were then pipetted into three 50ml polypropylene centrifuge tubes, centrifuged for 10 minutes, washed 3 times in distilled water and then freeze-dried at -50C for 48 hours using a Labconco Freeze Dryer 4.5 (Labconco, Inc. Kansas City, MO). Then the microspheres were then stored at 4C for later use. The antisense TGF-1 microspheres were made by combining 11mg of antisense TGF-1 with 150l of PBS. This mixture was then vortexed until the antisense TGF-1 was dissolved. Then the PBS/antisense TGF-1 solution was added to a solution of 501 mg of PLGA and 5ml of methylene chloride. The mixture was then vortexed for 5 minutes and added to 160 ml of 4% w/v PVA. In order to allow the methylene chloride to evaporate, the PVA was stirred at 691 rpm for 24 hours. The microspheres were then pipetted into three 50 ml polypropylene centrifuge tubes, centrifuged for 10 minutes, washed 3 times in distilled water and then freeze-dried at -50C for 48 hours using a Labconco Freeze Dryer 4.5 (Labconco, Inc. Kansas City, MO). Then the microspheres were stored at 4C for later use.

PAGE 40

28 The scrambled antisense microspheres were made by combining 13 mg of antisense CTGF to 150 l of PBS. This mixture was then vortexed until the antisense CTGF was dissolved. Then the PBS/scrambled-antisense solution was added to a solution of 504 mg of PLGA and 5 ml of methylene chloride. The mixture was then vortexed for 5 minutes and added to 160 ml of 4% w/v PVA. In order to allow the methylene chloride to evaporate, the PVA was stirred at 691 rpm for 24 hours. The microspheres were then pipetted into three 50ml polypropylene centrifuge tubes, centrifuged for 10 minutes, washed 3 times in distilled water and then freeze-dried at -50C for 48 hours using a Labconco Freeze Dryer 4.5 (Labconco, Inc. Kansas City, MO). Then the microspheres were stored at 4C for later use. Rat Study Twenty female Sprague Dawley rats with an average weight of 250 grams were implanted with two silicone implants each. Each implant had a diameter of 1 inch and a height of 0.5 inches. Before each surgery, the implants were sterilized by steam autoclaving and the backs of the rats were shaved and sterilized using 70% ethanol and betadine. The rats were then randomly assigned to one of into five groups with four rats per group: 1) Control-no Microspheres 2) 0.5 ml of hyaluronic acid (HA), 3) antisense TGF-1/PLGA microspheres in 0.5ml of HA 4) antisense CTGF/PLGA microspheres in 0.5ml of HA 5) scrambled/PLGA microspheres in 0.5ml of HA. Table 3-1: The 20 rats in this experiment divided into four groups Substance used in rats Rat # HA 5, 6, 7,8 Antisense TGF-1/HA 9, 10, 11, 12 Antisense CTGF/HA 13, 14, 15, 16 Scrambled Antisense/HA 17, 18, 19, 20 Control 1, 2, 3, 4

PAGE 41

29 During surgery, a 3 inch incision was made near the scapula and ilium on the back of each rat. The implants were placed through the incisions under the dermis and above the pannaciulosus carnous muscle. To obtain an even distribution of microspheres around the implant, 400 mg of each microsphere group was added to 10 ml of 1% (w/v) HA solution. One week and two weeks after the surgeries were completed,2 rats from each experimental group were sacrificed. The implants were resected from each rat and the bottom half of the capsule was removed along with an 8 mm skin section of the top half of the capsule. Skin taken from the top part of the capsule was later cut in half. One half of the skin was placed in formalin and processed for paraffin sections for histology and the other half with the bottom part of the capsule was analyzed for levels of CTGF and TGF-1 using an ELISA assay. Homogenizing of Rat Tissue for use in the ELISA Assay The growth factors within the tissue samples had to be extracted to be able to utilize the ELISA assay. A solution of PBS with 1% Triton (100X) was used to extract the growth factors. The procedure began with a sample of the top or bottom part of the capsule in a ground glass on glass homogenizer. A 0.5 ml solution of PBS/ Triton buffer was used for the top part and a 1 ml solution of PBS/Triton buffer was used for the bottom part of the capsule. The tissue samples were ground in the homogenizer crucible for 8 minutes, centrifuged for 5 minutes at 10,000 x g, the supernatant solution placed in a vial, and stored at -80C for future use. CTGF ELISA Used in Rat Study The CTGF ELISA assay was performed with a 96 well plate with each well coated with 50 l of goat anti-human CTGF antibody diluted with 1X PBS and sodium azide

PAGE 42

30 from 12 mg/ml to a 10 g/ml concentration. The antibody was then removed out and the plate was washed four times using a wash buffer comprised of PBS, 0.01% (w/v) sodium azide, and 0.05% (w/v) Tween 20. After the plate was washed, each well was filled with 300 l of a blocking buffer solution consisting of 1% (w/v) bovine serum albumin, PBS, and sodium azide. The well then remained at room temperature for 1 hour and subsequently the serum solution was pipetted out and the plate was washed four times with the wash buffer solution. After the plate was washed, 50 l of the samples and standards were added to the plate. The standard CTGF concentrations added to the plate were 100 ng/ml, 50 ng/ml, 10 ng/ml, 5 ng/ml, 1 ng/ml and 0.1 ng/ml. Once the standards and samples were added to the plate, the plate was incubated at 37C for 1 hour. After 1 hour the contents in the plate were pipetted out and the wells were washed four times with the wash buffer solution. Once the plate was washed, a 50 l of biotinylated goat anti human CTGF antibody with a concentration of 2 g/ml was added to each well. The plate was then sealed and placed in a dark area for 1 hour. After 1 hour the wells were pipetted out and washed four times with the wash buffer solution. A 100 l of alkaline phosphate substrate (Sigma N2765: One 20mg p-nitophenyl phosphate tablet dissolved in 20 ml carbonate and bicarbonate buffer at pH 9.6) was added to each well and the plate was then incubated at 37C for 30 minutes. After 30 minutes, a plate reader (Thermo Max, USA) was used at 405 nm to determine the absorbance of each well. The absorbance measurements were later converted to concentration. Then the samples underwent analysis by a BCA protein assay in order to normalize the samples to ng/mg protein.

PAGE 43

31 TGF-1 ELISA used in Rat Study The TGF-1 ELISA Assay (purchased from Promega, Madison, WI) was performed with a 96 well plate. Each well was coated with 100l of a TGF-1 Goat m-antibody and a carbonate coating buffer solution, which remained at 4C overnight. The antibody solution was then pipetted out and each well was subsequently filled with 270l of a blocking buffer solution consisting of bovine serum albumin, PBS, and sodium azide. Then the plate was incubated at 37C for 35 minutes. After 35 minutes the blocking buffer solution was pipetted out and washed four times using a wash buffer comprised of PBS, sodium azide, and Tween 20. Before the samples were added to the washed plate, they were acid treated. The acid treatment process was necessary because TGF-1 is processed in vivo from a latent form to the bioactive form of the protein. Only the bioactive form is detected by the ELISA process. Thus, the acid treatment in vitro mimics the in vivo activation of the protein. (1). To acid treat the samples 20 l from each sample was diluted in 80l of PBS and 1% Triton with 2 l of 1N HCL to lower the pH. After diluting the samples, the samples remained at room temperature for 15 minutes. A 2 l solution of 1N NaOH was then added to each sample to obtain a pH of 7.6, will not destroy the antibodies. Once the samples were acid treated and the plate was washed, 100 l of the samples and standards were added to the plate. The standards concentrations added to the plate were 1000 pg/ml, 500 pg/ml, 250 pg/ml, 125 pg/ml, 62 pg/ml, 31 pg/ml, 15.6 pg/ml, and 0.0 pg/ml. The standards and samples were added to the plate, the plate was incubated at 37C for 90 minutes. After 90 minutes the contents in the plate were pipetted out and the wells were washed four times with the wash buffer solution. A 50 l

PAGE 44

32 of an anti-TGF p-antibody was then added to each well of the washed plate. The plate then remained at room temperature for 2 hours. After 2 hours the contents in the wells were pipetted out and washed four times with the wash buffer solution. A 100l of TGF HRP conjugate was then added to each well of the washed plate and the plate remained at room temperature for 2 hours. After 2 hours, the TGF HRP Conjugate was pipetted out from the wells and washed four times with the wash buffer solution. The final step required the addition of a 100 l of TMB One Solution to each well of the washed plate and the plate remained at room temperature for an additional 30 minutes. After 30 minutes, 100 l of 1N NaOH was added to each well to stop the chemical reaction. Once the chemical reaction was ceased in each well, a plate reader (UVT 06045,Thermo Max, USA) was used at 450 nm to determine the absorbance of each well. The absorbance measurements were later converted to concentration. Then the samples underwent analysis by a BCA protein assay in order to normalize the samples to pg/mg protein.

PAGE 45

CHAPTER 4 RESULTS AND DISCUSSION Microsphere UV-VIS Spectrophotometer Analysis 1X microsphere release kinetics To use a UV-VIS spectrum, an absorption peak had to be determined. Figure 4-1 and 4-2 shows the absorption peak for this study. Figure 4-1 shows a spectrum analysis of PBS without the antisense CTGF attached to a fluorescein molecule. Notice there is a single peak in the spectrum. Figure 4-2 shows the absorption spectrum of PBS with CTGF attached to a Fluorescein molecule. The spectrum follows figure 4-1 except for the absorption peak around 494nm. That absorption peak represents the fluorescein molecule. That wavelength was used to detect the antisense CTGF concentration in the 1X microspheres release profile. PBS Solution Spectrum-10123456190217244271298325352379406433460487514541568595622649676Wavelength (nm)Absorption Figure 4-1: Absorption Spectrum of PBS solution 33

PAGE 46

34 Anti Sense Oligonucleotide in PBS Solution Spectrum-10123456190216242268294320346372398424450476502528554580606632658684Wavelength (nm)Absorption Figure 4-2: Absorption peak of PBS solution with fluorescein labeled antisense CTGF Figure 4-3 shows the percent release of the antisense from the microspheres vs. time. Average values were used and error bars were not added to the graph in order to simplify and emphasize the overall release profile of the microspheres. The release profile of antisense from the microspheres began with a burst effect that lasted for 4 hrs and then a lag phase, in which there was very little release of the antisense until the 7th day. After the 7th day, the microspheres had a secondary release phase when more antisense CTGF was released. The experiment lasted until the 24th day where 89% of all the antisense CTGF encapsulated in the microspheres had been released. 020406080100010203Time (Days)Percent Released of antisens 0 e CTGF from microspheres(%) Figure 4-3: Percent Release Profile of 1X microspheres

PAGE 47

35 A possible explanation as to why there was a burst effect is that the majority of the antisense CTGF was on the surface of the microspheres (53,56). When the microspheres were put in solution all the antisense on the surface was immediately released. This could have happened because in this procedure a small amount of antisense CTGF and a large amount of PVA was being used. The PVA surfactant may have prevented the antisense from penetrating deeply within the polymer matrix and may have forced a majority of the antisense to deposit on the surface (7,14,17,18). Another possible explanation is that there are pores on the microspheres surface. Having pores probably allowed more solution to penetrate the polymer matrix than was anticipated (53). Table 4-1 shows the amount of antisense released at each time point and the average value and the standard deviation. In table 4-1, the amount between the 8hr and 48hr are shown to be constant. An explanation is that since a very low amount of antisense CTGF was used, the UV-VIS detection reached a limit where it could not detect the amount of antisense CTGF in the PBS solution. Table 4-1: Cumulative antisense CTGF released from 1X microspheres during experiment (in mg). For each trial 50mg of microspheres were used. Time Trial1 Trial2 Trial3 Average 0 0 0 0 0 30 min 0.009 0.006 0.007 0.007+ 0015 2 hr 0.011 0.009 0.010 0.010+ 0009 4 hr 0.011 0.011 0.011 0.011+ 0002 6 hr 0.012 0.011 0.012 0.012+ 0005 8 hr 0.012 0.012 0.012 0.012 24 hr 0.012 0.012 0.012 0.012 48 hr 0.012 0.012 0.012 0.012 7 days 0.0126 0.013 0.013 0.013+ 0002 24 days 0.0132 0.013 0.014 0.013+ 0005

PAGE 48

36 Microsphere Release Data from Fluorescent Detector Microsphere Encapsulation Experiment Two different experiments were performed using fluorescent spectroscopy: finding the total amount of antisense CTGF encapsulated in each set of microspheres and the release kinetics of the 50X microspheres. Figure 4-4 shows the amount of antisense oligonucleotides was encapsulated in the microspheres as the loading increased. Average values were used and error bars were not added in order to show the general profile of microspheres. 0.32.77.98.3012345678910020406080100120Concentration of antisenseAmount of AntiSense i n Microspheres (g of antisense/ mg of microspheres) Figure 4-4: Amount encapsulated in PLGA microspheres as loading of antisense CTGF increases Although the average values do indicate the 50X microspheres encapsulate more antisense than the 100X microsphere, the standard deviation indicates that the differences

PAGE 49

37 are not significant. Table 4-2 shows that in trial 1 the 100X microspheres had the most encapsulated, in trial 2 they were both the same and in trial 3 the 50X had the most encapsulated. Table 4-2: Amount of encapsulated antisense CTGF (in g of antisense/mg of microspheres) in microspheres. For each trial 20mg of microspheres from each loading factor was used. Concentration Trial 1 Trial 2 Trial 3 Average 100X 8.3 8.1 7.4 7.9 + 4 50X 8.1 8.1 8.8 8.3 + 5 10X 3.0 2.5 2.7 2.7 + 2 1X 0.3 0.2 0.3 0.3 + 04 A theory as how this could happen is the amount of PVA used. PVA is used because during the (w/o/w) method it acts as a surfactant to prevent the microspheres from aggregating as they are being stirred. The surfactant also serves as something to prevent proteins from penetrating the surface of the polymer as the microspheres are being stirred in the PVA. Since 4% PVA was used, it probably prevented a significant amount of antisense present in the solution from entering the polymer. This data was also able to provide the percent encapsulation efficiency of the microspheres. This data is shown in table 4-3. The results were expected; as more antisense was added to the microspheres a lower percentage was encapsulated. While the 1X microspheres had 89% encapsulation efficiency they did not have a higher absolute loading than the 100X microspheres, which had 23% encapsulation efficiency. The data shows that the 50X microspheres provided the greatest chance of having the most antisense encapsulated. Therefore the 50X microspheres were selected to be used in the animal model and to have release kinetics measured in vivo.

PAGE 50

38 Table 4-3: Encapsulation efficiency of microspheres Concentration Theoretical Amount Loaded (g) Actual Amount Loaded (g) Encapsulation Efficiency (in %) 100X 34.6 7.9 23% 50X 16.8 8.3 50% 10X 4.3 2.7 63% 1X 0.3 0.27 89% 50X Release Profile Experiment Figure 4-5 shows the percent release of the 50X microspheres. The profile began with a burst effect that lasted for about 8hrs and a moderate lag phase between the 24 and 48hr point. After the 48 hr point, it underwent a secondary release that continued until the 24th day where 72% of all the antisense encapsulated was released. The amount released is shown in table 4-4. 010203040506070800510152025Time (Days)Percent released of antisense CTGF from microspheres(%) Figure 4-5: Percent Release profile of 50X microspheres

PAGE 51

39 Table 4-4: Cumulative antisense CTGF released from 50X microspheres during experiment (in mg). For each trial 50mg of microspheres were used. Time Trial 1 Trial 2 Trial 3 Average 0 0 0 0 0 32 min 0.03 0.03 0.02 0.03 + 01 2 hrs 0.05 0.08 0.05 0.06 + 02 4 hrs 0.09 0.11 0.08 0.09 + 02 6 hrs 0.11 0.12 0.11 0.11 + 01 8 hrs 0.15 0.17 0.15 0.15 + 01 24 hrs 0.18 0.21 0.18 0.19 + 02 48 hrs 0.19 0.23 0.20 0.21 + 02 7 days 0.21 0.26 0.22 0.23 + 02 24 days 0.28 0.32 0.28 0.29 + 02 Figure 4-6 shows the effects of increased antisense loading on release kinetics. It directly compares the amount of microspheres released from the 50X and 1X microspheres. It uses the average values to illustrate how the release kinetics was changed as the loading was increased. The 1X curve basically reaches a value and levels off while the 50X continues to increase. 00.050.10.150.20.250.30.350510152025Time (Days)Amount released of antisense CTGFfrom microspheres (g) 50X 1X Figure 4-6: Comparison of total release vs. time of 50X and 1X microspheres

PAGE 52

40 Particle Characterization of PLGA Microspheres Particle Sizing of Microspheres Figures 4-7 through 4-10 show the size distribution of all the microsphere batches. Overall, the microspheres all had similar particle size distribution that ranged peaked from, 60 m and 100 m. The only set of microspheres that did not fall within this range is the 10X microspheres. -2024681012140.370.590.951.522.423.866.169.8215.6524.9539.7863.41101.1161.2Particle Diameter (um)Diff. Volume(%) Figure 4-7: Particle Characterization of 100X microspheres

PAGE 53

41 0246810120.040.1220.3751.1493.51910.7833.01101.1309.6948.3Particle Diameter (um)Diff. Volume % Figure 4-8: Particle Characterization of 50X microspheres

PAGE 54

42 01234560.040.0840.1780.3750.7911.6683.5197.42115.6533.0169.61146.8309.66531377Particle Diameter (um)Diff. Volume(%) Figure 4-9: Particle Characterization of 10X microspheres

PAGE 55

43 -20246810120.040.120.381.153.5210.833101310Particle Diameter (um)Diff. Volume(%) Figure 4-10: Particle Characterization of 1X microspheres

PAGE 56

44 A)-202468101214050100150200250Particle Diameter (um)Diff. Volume(%) 100X 50X 10X 1X B)-20246810121405001000150020002500Particle Diameter (um)Diff. Volume(%) 100X 50X 10X 1X Figure 4-11: Size distribution of microspheres:A) Size comparison of all microsphere batches from 0-200 um B) Size comparison of all microspheres from 0-2000um

PAGE 57

45 SEM Characterization of microspheres Figures 4-12 through 4-15 shows the SEM pictures of the different microsphere batches. The micrographs show that regardless of the amount of antisense CTGF present the morphology and topography remained the same. An interesting feature of the microspheres is that the surfaces of the microspheres show pores. This characteristic is present on all the microspheres, and may lead to an enhanced burst effect because it allows the solution to enter the polymer matrix faster than it would normally be able to (54). Figure 4-12: SEM pictures of 100X Microspheres at 5KeV, working distance =14mm A) 25x. Size bar =1mm B) 200x. Size bar = 100m C) 1500x. Size bar = 10m

PAGE 58

46 Figure 4-12: Continued

PAGE 59

47 Figure 4-13: SEM pictures of 50X Microspheres at 5KeV, working distance 14mm A) 25x. Size bar =1mm B) 200x. Size bar = 100m C) 1500x. Size bar = 10m

PAGE 60

48 Figure 4-14: SEM pictures of 10X Microspheres at 5KeV, working distance 14mm A) 25x. Size bar =1mm B) 200x. Size bar = 100m C) 1500x. Size bar = 10m

PAGE 61

49 Figure 4-15: SEM pictures of 100X Microspheres at 5KeV, working distance 14mm A) 25x. Size bar =1mm B) 200x. Size bar = 100m C) 1500x. Size bar = 10m

PAGE 62

50 In vivo results Surgical procedure Figures 4-16 through 4-19 show some of the methods used and results from the rat surgery. Figure 4-16 show how the microspheres were injected into the rats and the template used to determine where the implants were going to be placed. Figure 4-17 show the procedure of injecting the HA and microspheres. Figure 4-18 shows some of the capsules that developed after the surgery. Figure 4-19 also show some of the capsules that developed and how the skin was taken for analysis. The capsules appeared to be very thin regardless of the test materials added around them. ELISA was to determine what type of effect the test materials had on the growth factors CTGF and TGF-1. Figure 4-16: Pictures from rat surgery A) The syringes used to deliver microspheres and HA B) Template used to determine incision location in animal experiment (areas marked with sharpie marker)

PAGE 63

51 Figure 4-17: Surgical procedure from rat surgery: A) and B) Microspheres/HA injected C) Incisions closed with staples

PAGE 64

52 Figure 4-18: Implant placement after surgery: A) Normal position of implants after surgery, B) and C) After one implant migrated during experiment.

PAGE 65

53 Figure 4-19:Capsules formed after experiment: A), B) and C) Different capsules formed around implants after 1 and 2 weeks

PAGE 66

54 Figure 4-20: Capsule formed after surgery and surgical procedure: A) Capsule after 1 and 2 weeks B) Capsule after movement of implant occurred C) Picture of how the skin was taken for ELISA analysis.

PAGE 67

55 ELISA CTGF Assay Results The results from the CTGF ELISA are shown in figures 4-20 through 4-23. They mark the release of the growth factor CTGF from the skin and the bottom of the capsule for of period of 1 and 2 weeks. The results from the first week were that the control had the largest amount of CTGF present and the antisense CTGF had lowest values of CTGF. A surprise from the first week was the HA alone and the scrambled antisense oligonucleotide also were also able to decrease the amount of CTGF present in the system. This was an unexpected result because at the time of experimental set-up it was known that HA would have an influence on fibrosis but it was not known how it would affect CTGF and TGF-1(13,24,30,40). Since the HA was able to have in effect, it probably had an effect on the levels of CTGF in the other test materials used. The scrambled antisense result was more interesting because, it is only supposed to be a random antisense oligonucleotide sequence. Not only did the scrambled cause a decrease in CTGF it was also able to cause implant migration like in figure 4-18 C. There are several reasons why this might be happening. For example, one reason could be the presence of lactic acid and glycolic acid that was being released from the microspheres (12,27). However, studies have shown that lactic and glycolic acid increases the presence of collagen rather than reduces it (6,9,15,22,31). There are also no reports of PLGA materials causing movement in other implants. Unfortunately, in some cases scrambled antisense does have an influence on the surrounding tissue and this fact invites future analysis. There are several types of scrambled oligonucleotides available, and some have been known to retain some activity (25).

PAGE 68

56 After week two, the results remained the similar as the previous week. Only in this case the HA and the antisense CTGF had the lowest levels of CTGF. The ANOVA results are shown in Appendix C. The ANOVA results of CTGF levels during week1 had p= 0.003 for the skin and p=0.0343 for the bottom of the capsule. During week2: p=0.039 for the skin and p=0.0038 for the bottom of the capsule. CTGF(ng/mg protein) Figure 4-21: Levels of CTGF in the skin around the implant from week 1(ng of CTGF/mg protein). (* = migration)

PAGE 69

57 CTGF(ng/mg protein) Figure 4-22: Levels of CTGF from the bottom of the implant capsule from week 1 (ng of CTGF/mg protein). (* = migration)

PAGE 70

58 CTGF(ng/mg protein) Figure 4-23: Levels of CTGF in the skin around the implant from week 2 (ng of CTGF/mg protein). (*= migration)

PAGE 71

59 CTGF(ng/mg protein) CTGF(ng/mg protein) Figure 4-24: Levels of CTGF from the bottom of the implant capsule from week2 (ng of CTGF/ mg protein). (* = migration)

PAGE 72

60 ELISA TGF-1 Assay Results The TGF-1 levels from the rat experiment are shown in figures 4-24 through 4-27. All the test groups were statistically the same in both weeks 1 and 2 when the TGF-1 concentrations from the test groups were analyzed using ANOVA. An explanation for this could be because TGF-1 unlike CTGF is used in a variety of functions that do not necessary relate to the development of fibrosis, for example, it is used during the process of inflammation and DNA synthesis (37,48,49,52). Since a large foreign object is present, the body will induce inflammation, DNA synthesis, and fibrosis. This requires great amounts of TGF-1 and these amounts probably were so great that the microspheres were unable to cause a biological effect. TGF1 (pg /m g p rotein ) Figure 4-25: Levels of TGF-1 from the skin from week 1 (pg of TGF-1 / mg protein). (* = migration)

PAGE 73

61 TGF1 (pg /m g p rotein ) Figure 4-26: Levels of TGF-1 from the bottom of the implant capsule from week 1 (pg of TGF-1/ mg protein). (* = migration)

PAGE 74

62 TGF1 (pg /m g p rotein ) Figure 4-27: Levels of TGF-1 from the skin from week 2 (pg of TGF-1/mg protein). (* = migration)

PAGE 75

63 TGF1 (pg /m g p rotein ) Figure 4-28: Levels of TGF-1 from the bottom of the implant capsule from week 2 (pg of TGF-1/ mg protein). (* = migration)

PAGE 76

CHAPTER 5 CONCLUSION AND FUTURE WORK Microsphere Development Microspheres of DL-PLGA (DL-poly lactide glycolide acid) containing antisense oligonucleotides were made using the water-oil-water (w/o/w) evaporation method. The overall loading of the microspheres was too low to cause a biological effect initially so the antisense CTGF was increase by a factor of 10 times (10X), 50 times (50X), and 100 times (100X) the initial concentration (1X). As the amount of antisense CTGF increased, the amount released from the microspheres increased as expected. The 50X microspheres had the greater probability of having the highest concentration of antisense incorporated in the microspheres. The 50X microsphere procedure was then used to make the microspheres for the animal study. Particle Characterization and release kinetics were determined using UV and Fluorescent Spectroscopy, SEM Microscopy, and Light Laser Diffraction Particle Sizing. It was shown that antisense CTGF loading does not affect the particle size, which peaked between 60-130m nor the physical appearance of the microspheres. The microspheres in general had holes along generally smooth surfaces. Implantation Twenty female Sprague Dawley rats with a weight of 250grams were implanted with two silicone implants. The rats were then divided into five groups: 1) Control-no Microspheres 2) hyaluronic acid (HA), 3) antisense TGF-1/PLGA microspheres in HA 4) antisense CTGF/PLGA microspheres in HA 5) scrambled antisense 64

PAGE 77

65 oligonucleotide/PLGA microspheres in HA. One week and two weeks after the surgeries were completed, respectively, 10 rats were sacrificed. The implants were resected from each rat and the bottom half of the capsule was removed along with a 8mm skin section of the top half of the capsule. The sections were then homogenized and analyzed for levels of CTGF and TGF-1 using the ELISA Assay. The CTGF ELISA Assay results when analyzed using ANOVA showed that CTGF levels were decreased for the first week when the capsule was exposed to HA, antisense TGF-1, antisense CTGF, and the scrambled antisense. For the second week the CTGF ELISA Assay result when analyzed using ANOVA showed that the levels of CTGF began to normalize and there was no significant difference between the test groups. The TGF-1 ELISA Assay results, when analyzed using ANOVA, showed for both weeks 1 and 2 that there was no difference between the test groups. The results from the TGF-1 ELISA Assay could have been influenced on the amount of TGF-1 present in around the capsule. Since TGF-1 is used in a variety of functions other than fibrosis and capsule formation, its levels were probably so high that the amount of antisense TGF-1 present was not enough to change its levels. We conclude that controlled release of antisense CTGF can reduce CTGF expression and hence will reduce scarring. Future Work The microspheres and rat experiments used in this project are just a first step in the development of a drug delivery method that may eventually be used to reduce capsular contraction or other applications in the human body.

PAGE 78

66 Microspheres-Future Work Extensive research into increasing the incorporation and release of the antisense oligonucleotides. Extensive testing of other type of microspheres to determine if PLGA is the best substance to use in microsphere development Microspheres-Future Uses Eventually use microspheres to decrease the probability of capsular contracture. Develop microspheres incorporating antisense oligonucleotides for other problems where less fibrosis is desired Rat Animal Experiment-Future Work Increase time of experiment to determine whether the current microsphere method can decrease CTGF and TGF-1 for longer periods of time. Eventually move up to an rabbit animal model and test microspheres since rabbits are more similar to humans for capsular development. More extensive research into the uses and effect of Hyaluronic Acid on CTGF, TGF-1, and the wound healing process in general. Improve standardization of microsphere injection along the implant shell.

PAGE 79

APPENDIX A STASTICTICAL ANALYSIS OF MICROSPHERE PARTICLE DISTRIBUTION Table A.1: Particle sizing statistical data for 100X microspheres COULTER LS 100X File name: 11. $07 Group ID: 100X Instrument: LS 230, Small Model Volume Volume 100 Mean: 51.06 Median: 56.76 D(3,2): 7.535 Mean/Median Ratio: 0.9 Mode: 80.07 S.D.: 28.15 Variance: 792.4 C.V.: 55.12 Skewness: -0.405 Kurtosis: -1.045 d10: 4.89 d50: 56.76 d90: 83.81 Specific Surf. Area: 7963 % < Size 10 4.89 25 28.3 50 56.76 75 75.01 90 83.81 Size % < 1 5.47 10 13.3 100 99.7 1000 100 67

PAGE 80

68 Table A.2: Particle sizing statistical data for 50X microspheres COULTER LS 50X File name: 50X.$01 Group ID: 50X Instrument: LS 230, Small Volume Module Run number: 1 Run length: 91 Optical model: Fraunhofer.rfd PIDS included Obscuration: 8 PIDS Obscur: 47 Obscuration: OK Serial Number: 186 From 0.04 To 2000 Volume 100 Mean: 74.11 Median: 72.61 D(3,2): 2.026 Mode: 87.9 S.D.: 59.72 C.V.: 80.58 Skewness: 2.237 Kurtosis: 8.32 d10: 0.88 d50: 72.61 d90: 114.7 Specific Surf. Area: 29613 % < Size 10 0.88 25 40.66 50 72.61 75 94.4 90 114.7

PAGE 81

69 Table A.3: Particle sizing statistical data for 10X microspheres COULTER LS 10X File name: 10X.$05 Group ID: 10X Instrument: LS 230, Small Volume Module Run number: 5 Run length: 91 Optical model: Fraunhofer.rfd PIDS included Obscuration: 7 PIDS Obscur: 65 Obscuration: Low Serial Number: 186 From 0.04 To 2000 Volume 100 Mean: 460.2 Median: 335.2 D(3,2): 16.27 Mode: 105.9 S.D.: 424.8 C.V.: 92.32 Skewness: 1.097 Kurtosis: 0.59 d10: 76.15 d50: 335.2 d90: 1072 Specific Surf. Area: 3688 % < Size 10 76.15 25 109 50 335.2 75 720.1 90 1072

PAGE 82

70 Table A.4: Particle sizing statistical data for 1X microspheres COULTER LS 1X File name: 1X.$07 Group ID: 1X Instrument: LS 230, Small Volume Module Run number: 7 Run length: 90 Optical model: Fraunhofer.rfd PIDS included Obscuration: 8 PIDS Obscur: 46 Obscuration: OK Serial Number: 186 From 0.04 To 2000 Volume 100 Mean: 79.9 Median: 77.08 D(3,2): 2.731 Mode: 87.9 S.D.: 52.84 C.V.: 66.13 Skewness: 2.142 Kurtosis: 9.406 d10: 19.94 d50: 77.08 d90: 120.8 Specific Surf. Area: 21973 % < Size 10 19.94 25 53.6 50 77.08 75 98.17 90 120.8

PAGE 83

APPENDIX B ELISA NUMERICAL RESULTS Table B.1: CTGF level ELISA results from week 1 rat groups. ( ng of CTGF/ mg protein) Week 1(skin) Silicone Implants 40.84 40.03 36.35 33.42 HA 17.89 26.93 29.95 20.70 Antisense TGF-Beta in HA 24.75 30.22 24.09 32.80 Antisense CTGF in HA (implant movement took place) 30.84 15.99 26.63 21.34 Scrambled 13.39 25.74 19.25 25.76 Week 1(bottom of capsule) Silicone Implants 28.24 25.72 42.16 19.14 HA 6.73 6.68 13.74 10.09 Antisense TGF-Beta in HA 10.52 4.34 10.30 9.64 Antisense CTGF in HA (implant movement took place) 9.39 9.42 9.29 15.95 Scrambled 6.46 12.08 4.66 40.59 Table B.2: CTGF level ELISA results from week 2 rat groups. ( ng of CTGF/ mg protein) Week 2(skin) Silicone Implants 59.04 37.92 35.28 29.01 HA 29.05 20.50 29.96 17.89 Antisense TGF-Beta in HA 32.07 22.76 21.36 29.89 Antisense CTGF in HA 30.59 23.75 26.49 21.86 Scrambled *(implant movement took place) 20.48 30.87 24.08 19.38 Week 2(bottom of capsule) Silicone Implants 32.52 66.71 23.02 27.29 HA 9.29 4.99 14.48 7.52 Antisense TGF-Beta in HA 10.10 6.54 13.66 14.43 Antisense CTGF in HA 8.41 6.79 14.03 Sample lost Scrambled *(implant movement took place) 9.59 5.51 8.25 12.08 71

PAGE 84

72 Table B.3: TGF-B1 level ELISA results from week 1 rat groups. ( pg of TGF-B1/ mg protein) Week 1(skin) Silicone Implants 518 376 639 332 HA 217 222 338 461 Antisense TGF-Beta in HA 496 435 418 519 Antisense CTGF in HA (implant movement took place) 422 428 517 286 Scrambled 193 764 265 897 Week#1(bottom of capsule) Silicone Implants 227 163 866 246 HA 73 296 143 124 Antisense TGF-Beta in HA 159 228 496 527 Antisense CTGF in HA (implant movement took place) 439 732 151 774 Scrambled 183 241 386 845 Table B.4: TGF-B1 level ELISA results from week 2 rat groups. ( pg of TGF-B1 /mg protein) Week 2(skin) Silicone Implants 1086 400 401 634 HA 582 158 484 333 Antisense TGF-Beta in HA 456 461 277 292 Antisense CTGF in HA 279 472 535 420 Scrambled *(implant movement took place) 541 503 459 374 Week 2(bottom of capsule) Silicone Implants 304 812 274 1700 HA 165 244 225 167 Antisense TGF-Beta in HA 339 149 125 337 Antisense CTGF in HA 134 460 410 Sample lost Scrambled *(implant movement took place) 143 266 120 242

PAGE 85

APPENDIX C STATISTICAL ANALYSIS PROVIDED BY ANOVA FOR ELISA RESULTS A.S. =Antisense PLGA microspheres in Hyaluronic Acid(HA) Table C.1 Mean and Standard Deviation Data from ELISA Results of CTGF skin week1 CTGF-Skin Week1 --------------------------------------------------------------------------Independent Group Analysis CTGF Skin Analysis-Week1 --------------------------------------------------------------------------Grouping variable is GROUP Analysis variable is OBS Group Means and Standard Deviations A.S. CTGF: mean = 23.7 s.d. = 6.4441 n = 4 A.S. TGF-B1: mean = 27.965 s.d. = 4.2353 n = 4 Control: mean = 37.66 s.d. = 3.4362 n = 4 HA: mean = 23.8675 s.d. = 5.5419 n = 4 Scrambled: mean = 21.035 s.d. = 5.9468 n = 4 Analysis of Variance Table Source S.S. DF MS F Appx P --------------------------------------------------------------------------Total 1094.97 19 Treatment 682.92 4 170.73 6.22 0.0037 Error 31.73 15 2.12 Error term used for comparisons = 27.47 with 15 d.f. 73

PAGE 86

74 Table C.2: P values of ELISA results from CTGF skin week 1 Newman-Keuls Multiple Comp. Difference P Q (.05) -----------------------------------------------------------------------Mean(Control)-Mean(A.S. CTGF) = 13.96 4 5.327 4.076 Mean(Control)-Mean(Scrambled) = 16.625 4 6.344 4.367 Mean(Control)-Mean(A.S. TGF-B1) = 9.695 2 3.7 3.014 Mean(Control)-Mean(HA) = 13.7925 3 5.263 3.674 Mean(HA)-Mean(A.S. CTGF) = 0.1675 (Do not test) Mean(HA)-Mean(Scrambled) = 2.8325 (Do not test) Mean(HA)-Mean(A.S. TGF-B1) = 4.0975 (Do not test) Mean(A.S. TGF-B1)-Mean(A.S. CTGF) = 4.265 (Do not test) Mean(A.S. TGF-B1)-Mean(Scrambled) = 6.93 4 2.644 4.076 Mean(Scrambled)-Mean(A.S. CTGF) = 2.665 (Do not test) Homogeneous Populations, groups ranked Gp 1 refers to GROUP=A.S. CTGF Gp 2 refers to GROUP=A.S. TGF-B1 Gp 3 refers to GROUP=Control Gp 4 refers to GROUP=HA Gp 5 refers to GROUP=Scrambled Gp Gp Gp Gp Gp 5 1 4 2 3 ----------This is a graphical representation of the Newman-Keuls multiple comparisons test. At the 0.05 significance level, the means of any two groups underscored by the same line are not significantly different.

PAGE 87

75 Table C.3: Mean and Standard Deviation values from ELISA results of CTGF bottom of capsule week 1 CTGF-Bottom of capsule Week1 --------------------------------------------------------------------------Independent Group Analysis CTGF Bottom of capsule-Week1 --------------------------------------------------------------------------Grouping variable is GROUP Analysis variable is OBS Group Means and Standard Deviations A.S. CTGF: mean = 11.0125 s.d. = 3.2921 n = 4 A.S. TGF-B1: mean = 8.7 s.d. = 2.9306 n = 4 HA: mean = 9.31 s.d. = 9.6886 n = 4 Scrambled: mean = 15.9475 s.d. = 16.7295 n = 4 Control: mean = 28.815 s.d. = 16.7295 n = 4 Analysis of Variance Table Source S.S. DF MS F Appx P --------------------------------------------------------------------------Total 2331.01 19 Treatment 1117.69 4 279.42 3.45 0.0343 Error 1213.32 15 80.89 Error term used for comparisons = 80.89 with 15 d.f.

PAGE 88

76 Table C.4: P values of ELISA results from CTGF bottom of capsule week 1 Newman-Keuls Multiple Comp. Difference P Q (.05) -----------------------------------------------------------------------Mean(Control)-Mean(Scrambled) = 12.8675 2 2.861 3.014 Mean(Control)-Mean(A.S. TGF-B1) = 20.115 5 4.473 4.367 Mean(Control)-Mean(A.S. CTGF) = 17.8025 3 3.959 3.674 Mean(Control)-Mean(HA) = 19.505 4 4.337 4.076 Mean(HA)-Mean(Scrambled) = 6.6375 (Do not test) Mean(HA)-Mean(A.S. TGF-B1) = 0.61 (Do not test) Mean(HA)-Mean(A.S. CTGF) = 1.7025 (Do not test) Mean(A.S. CTGF)-Mean(Scrambled) = 4.935 (Do not test) Mean(A.S. CTGF)-Mean(A.S. TGF-B1) = 2.3125 (Do not test) Mean(A.S. TGF-B1)-Mean(Scrambled) = 7.2475 4 1.612 4.076 Homogeneous Populations, groups ranked Gp 1 refers to GROUP=A.S. CTGF Gp 2 refers to GROUP=A.S. TGF-B1 Gp 3 refers to GROUP=Control Gp 4 refers to GROUP=HA Gp 5 refers to GROUP=Scrambled Gp Gp Gp Gp Gp 4 2 1 5 3 ----------This is a graphical representation of the Newman-Keuls multiple comparisons test. At the 0.05 significance level, the means of any two groups underscored by the same line are not significantly different.

PAGE 89

77 Table C.5: Mean and Standard Deviation values of ELISA results from CTGF skin week 2 CTGFSkin Week2 --------------------------------------------------------------------------Independent Group Analysis CTGF Skin-Week 2 --------------------------------------------------------------------------Grouping variable is GROUP Analysis variable is OBS Group Means and Standard Deviations A.S. CTGF: mean = 25.6725 s.d. = 3.7895 n = 4 A.S. TGF-B1: mean = 26.52 s.d. = 5.2575 n = 4 HA: mean = 24.35 s.d. = 6.0585 n = 4 Scrambled: mean = 23.7025 s.d. = 5.1828 n = 4 Control: mean = 40.3125 s.d. = 13.0322 n = 4 Analysis of Variance Table Source S.S. DF MS F Appx P --------------------------------------------------------------------------Total 1589.96 19 Treatment 763.74 4 190.93 3.47 0.0339 Error 526.22 15 55.08 Error term used for comparisons = 55.08 with 15 d.f.

PAGE 90

78 Table C.6: P values of ELISA results from CTGF skin week 2 Newman-Keuls Multiple Comp. Difference P Q (.05) -----------------------------------------------------------------------Mean(Control)-Mean(Scrambled) = 16.61 5 4.476 4.367 Mean(Control)-Mean(A.S. TGF-B1) = 13.7925 2 3.717 3.014 Mean(Control)-Mean(A.S. CTGF) = 14.64 3 3.945 3.674 Mean(Control)-Mean(HA) = 15.9625 4 4.302 4.076 Mean(HA)-Mean(Scrambled) = 0.6475 (Do not test) Mean(HA)-Mean(A.S. TGF-B1) = 2.17 (Do not test) Mean(HA)-Mean(A.S. CTGF) = 1.3225 (Do not test) Mean(A.S. CTGF)-Mean(Scrambled) = 1.97 (Do not test) Mean(A.S. CTGF)-Mean(A.S. TGF-B1) = 0.8475 (Do not test) Mean(A.S. TGF-B1)-Mean(Scrambled) = 2.8175 4 .759 4.076 Homogeneous Populations, groups ranked Gp 1 refers to GROUP=A.S. CTGF Gp 2 refers to GROUP=A.S. TGF-B1 Gp 3 refers to GROUP=Control Gp 4 refers to GROUP=HA Gp 5 refers to GROUP=Scrambled Gp Gp Gp Gp Gp 5 4 1 2 3 ----------This is a graphical representation of the Newman-Keuls multiple comparisons test. At the 0.05 significance level, the means of any two groups underscored by the same line are not significantly different.

PAGE 91

79 Table C.7: Mean and Standard Deviations of ELISA results from CTGF Bottom of capsule week 2 CTGFBottom of Capsule Week 2 --------------------------------------------------------------------------Independent Group Analysis CTGF Bottom of CapsuleWeek2 --------------------------------------------------------------------------Grouping variable is GROUP Analysis variable is OBS Group Means and Standard Deviations A.S. CTGF: mean = 9.7433 s.d. = 3.7997 n = 3 A.S. TGF-B1: mean = 11.1825 s.d. = 3.6244 n = 4 HA: mean = 9.07 s.d. = 4.0152 n = 4 Scrambled: mean = 8.8575 s.d. = 2.7384 n = 4 Control: mean = 37.385 s.d. = 19.9323 n = 4 Analysis of Variance Table Source S.S. DF MS F Appx P --------------------------------------------------------------------------Total 3762.67 18 Treatment 2431.64 4 607.91 6.39 0.0038 Error 1331.03 14 95.07. Error term used for comparisons = 95.07. with 14 d.f.

PAGE 92

80 Table C.8: P values of ELISA results from CTGF Bottom of capsule week 2 Newman-Keuls Multiple Comp. Difference P Q (.05) -----------------------------------------------------------------------Mean(Control)-Mean(Scrambled) = 28.5275 5 5.851 4.407 Mean(Control)-Mean(HA) = 28.315 4 5.808 4.111 Mean(Control)-Mean(A.S. CTGF) = 27.6417 3 5.249 3.702 Mean(Control)-Mean(A.S. TGF-B1) = 26.2025 2 5.375 3.033 Mean(A.S. TGF-B1)-Mean(Scrambled) = 2.325 4 .477 4.111 Mean(A.S. TGF-B1)-Mean(HA) = 2.1125 (Do not test) Mean(A.S. TGF-B1)-Mean(A.S. CTGF) = 1.4392 (Do not test) Mean(A.S. CTGF)-Mean(Scrambled) = 0.8858 (Do not test) Mean(A.S. CTGF)-Mean(HA) = 0.6733 (Do not test) Mean(HA)-Mean(Scrambled) = 0.2125 (Do not test) Homogeneous Populations, groups ranked Gp 1 refers to GROUP=A.S. CTGF Gp 2 refers to GROUP=A.S. TGF-B1 Gp 3 refers to GROUP=Control Gp 4 refers to GROUP=HA Gp 5 refers to GROUP=Scrambled Gp Gp Gp Gp Gp 5 4 1 2 3 ----------This is a graphical representation of the Newman-Keuls multiple comparisons test. At the 0.05 significance level, the means of any two groups underscored by the same line are not significantly different.

PAGE 93

81 Table C.9: Mean and Standard Deviation values of ELISA results from TGF-B1 skin week 1 TGFB1-Skin Week 1 --------------------------------------------------------------------------Independent Group Analysis TGFB1 Skin -Week 1 --------------------------------------------------------------------------Grouping variable is GROUP Analysis variable is OBS Group Means and Standard Deviations A.S. CTGF mean = 413.25 s.d. = 95.3078 n = 4 A.S. TGF-B1: mean = 467.0 s.d. = 48.201 n = 4 Control: mean = 466.25 s.d. = 139.8675 n = 4 HA: mean = 309.5 s.d. = 115.4369 n = 4 Scrambled: mean = 529.75 s.d. = 352.7222 n = 4 Analysis of Variance Table Source S.S. DF MS F Appx P --------------------------------------------------------------------------Total 614838.6 19 Treatment 108713.3 4 27178.32 .81 0.5406 Error 506125.3 15 33741.68 Error term used for comparisons = 33,741.68 with 15 d.f.

PAGE 94

82 Table C.10 : P values of ELISA results from TGF-B1 skin week 1 Newman-Keuls Multiple Comp. Difference P Q (.05) -----------------------------------------------------------------------Mean(Scrambled)-Mean(HA) = 220.25 5 2.398 4.367 Mean(Scrambled)-Mean(A.S. CTGF) = 116.5 (Do not test) Mean(Scrambled)-Mean(Control) = 63.5 (Do not test) Mean(Scrambled)-Mean(A.S. TGF-B1) = 62.75 (Do not test) Mean(A.S. TGF-B1)-Mean(HA) = 157.5 (Do not test) Mean(A.S. TGF-B1)-Mean(A.S. CTGF) = 53.75 (Do not test) Mean(A.S. TGF-B1)-Mean(Control) = 0.75 (Do not test) Mean(Control)-Mean(HA) = 156.75 (Do not test) Mean(Control)-Mean(A.S. CTGF) = 53.0 (Do not test) Mean(A.S. CTGF)-Mean(HA) = 103.75 (Do not test) Homogeneous Populations, groups ranked Gp 1 refers to GROUP=A.S. CTGF Gp 2 refers to GROUP=A.S. TGF-B1 Gp 3 refers to GROUP=Control Gp 4 refers to GROUP=HA Gp 5 refers to GROUP=Scrambled Gp Gp Gp Gp Gp 3 1 2 5 4 ----------This is a graphical representation of the Newman-Keuls multiple comparisons test. At the 0.05 significance level, the means of any two groups underscored by the same line are not significantly different.

PAGE 95

83 Table C.11: Mean and Standard Deviation values of ELISA results from TGF-B1 Bottom of capsule week 1 TGF-B1 Bottom of Capsule Week 1 --------------------------------------------------------------------------Independent Group Analysis TGF-B1 Bottom of CapsuleWeek 1 --------------------------------------------------------------------------Grouping variable is GROUP Analysis variable is OBS Group Means and Standard Deviations A.S. CTGF: mean = 524.0 s.d. = 289.8954 n = 4 A.S. TGF-B1: mean = 352.5 s.d. = 186.1764 n = 4 Control: mean = 375.5 s.d. = 328.922 n = 4 HA: mean = 159.0 s.d. = 95.9965 n = 4 Scrambled: mean = 413.75 s.d. = 299.9082 n = 4 Analysis of Variance Table Source S.S. DF MS F Appx P --------------------------------------------------------------------------Total 1259593. 19 Treatment 281440.2 4 70360.05 1.08 0.4016 Error 978152.8 15 65210.18 Error term used for comparisons = 65,210.18 with 15 d.f.

PAGE 96

84 Table C.12: P values of ELISA results from TGF-B1 Bottom of capsule week 1 Newman-Keuls Multiple Comp. Difference P Q (.05) -----------------------------------------------------------------------Mean(A.S. CTGF)-Mean(HA) = 365.0 5 2.859 4.367 Mean(A.S. CTGF)-Mean(A.S. TGF-B1) = 171.5 (Do not test) Mean(A.S. CTGF)-Mean(Control) = 148.5 (Do not test) Mean(A.S. CTGF)-Mean(Scrambled) = 110.25 (Do not test) Mean(Scrambled)-Mean(HA) = 254.75 (Do not test) Mean(Scrambled)-Mean(A.S. TGF-B1) = 61.25 (Do not test) Mean(Scrambled)-Mean(Control) = 38.25 (Do not test) Mean(Control)-Mean(HA) = 216.5 (Do not test) Mean(Control)-Mean(A.S. TGF-B1) = 23.0 (Do not test) Mean(A.S. TGF-B1)-Mean(HA) = 193.5 (Do not test) Homogeneous Populations, groups ranked Gp 1 refers to GROUP=A.S. CTGF Gp 2 refers to GROUP=A.S. TGF-B1 Gp 3 refers to GROUP=Control Gp 4 refers to GROUP=HA Gp 5 refers to GROUP=Scrambled Gp Gp Gp Gp Gp 3 4 2 5 1 ----------This is a graphical representation of the Newman-Keuls multiple comparisons test. At the 0.05 significance level, the means of any two groups underscored by the same line are not significantly different.

PAGE 97

85 Table C.13: Mean and Standard Deviation values of ELISA results from TGF-B1 skin week 2 TGFB1Skin Week 2 --------------------------------------------------------------------------Independent Group Analysis TGFB1 Skin -Week 2 --------------------------------------------------------------------------Grouping variable is GROUP Analysis variable is OBS Group Means and Standard Deviations A.S. CTGF: mean = 426.5 s.d. = 108.9969 n = 4 A.S. TGF-B1: mean = 371.5 s.d. = 100.6661 n = 4 Control: mean = 630.25 s.d. = 323.1577 n = 4 HA: mean = 389.25 s.d. = 185.0862 n = 4 Scrambled: mean = 469.25 s.d. = 71.7977 n = 4 Analysis of Variance Table Source S.S. DF MS F Appx P --------------------------------------------------------------------------Total 669552.6 19 Treatment 171982.3 4 42995.57 1.3 0.3158 Error 497570.3 15 33171.35 Error term used for comparisons = 33,171.35 with 15 d.f.

PAGE 98

86 Table C.14: P values of ELISA results from TGF-B1 skin week 2 Newman-Keuls Multiple Comp. Difference P Q (.05) -----------------------------------------------------------------------Mean(Control)-Mean(A.S. TGF-B1) = 258.75 5 2.841 4.367 Mean(Control)-Mean(HA) = 241.0 (Do not test) Mean(Control)-Mean(A.S. CTGF) = 203.75 (Do not test) Mean(Control)-Mean(Scrambled*) = 161.0 (Do not test) Mean(Scrambled*)-Mean(A.S. TGF-B1) = 97.75 (Do not test) Mean(Scrambled*)-Mean(HA) = 80.0 (Do not test) Mean(Scrambled*)-Mean(A.S. CTGF) = 42.75 (Do not test) Mean(A.S. CTGF)-Mean(A.S. TGF-B1) = 55.0 (Do not test) Mean(A.S. CTGF)-Mean(HA) = 37.25 (Do not test) Mean(HA)-Mean(A.S. TGF-B1) = 17.75 (Do not test) Homogeneous Populations, groups ranked Gp 1 refers to GROUP=A.S. CTGF Gp 2 refers to GROUP=A.S. TGF-B1 Gp 3 refers to GROUP=Control Gp 4 refers to GROUP=HA Gp 5 refers to GROUP=Scrambled Gp Gp Gp Gp Gp 2 4 1 3 5 ----------This is a graphical representation of the Newman-Keuls multiple comparisons test. At the 0.05 significance level, the means of any two groups underscored by the same line are not significantly different.

PAGE 99

87 Table C.15: Mean and Standard Deviation values of ELISA results from TGF-B1 Bottom of capsule week 2 TGFB1Bottom of Capsule Week 2 --------------------------------------------------------------------------Independent Group Analysis TGFB1 Bottom of Capsule -Week 2 --------------------------------------------------------------------------Grouping variable is GROUP Analysis variable is OBS Group Means and Standard Deviations A.S. CTGF: mean = 334.6667 s.d. = 175.5714 n = 3 A.S. TGF-B1: mean = 237.5 s.d. = 116.4632 n = 4 Control: mean = 772.45 s.d. = 665.8324 n = 4 HA: mean = 200.25 s.d. = 40.3103 n = 4 Scrambled: mean = 192.75 s.d. = 72.0156 n = 4 Analysis of Variance Table Source S.S. DF MS F Appx P --------------------------------------------------------------------------Treatment 953735.27 4 238433.8 2.3 0.1103 Error 1452774. 14 103769.6 Error term used for comparisons = 103,769.5 with 14 d.f. Total 2406509. 18

PAGE 100

88 Table C.16: P values of ELISA results from TGF-B1 Bottom of capsule week 2 Newman-Keuls Multiple Comp. Difference P Q (.05) -----------------------------------------------------------------------Mean(Control)-Mean(Scrambled) = 579.7 5 3.599 4.407 Mean(Control)-Mean(HA) = 572.2 (Do not test) Mean(Control)-Mean(A.S. TGF-B1) = 534.95 (Do not test) Mean(Control)-Mean(A.S. CTGF) = 437.7834 (Do not test) Mean(A.S. CTGF)-Mean(Scrambled) = 141.9167 (Do not test) Mean(A.S. CTGF)-Mean(HA) = 134.4167 (Do not test) Mean(A.S. CTGF)-Mean(A.S. TGF-B1) = 97.1667 (Do not test) Mean(A.S. TGF-B1)-Mean(Scrambled) = 44.75 (Do not test) Mean(A.S. TGF-B1)-Mean(HA) = 37.25 (Do not test) Mean(HA)-Mean(Scrambled) = 7.5 (Do not test) Homogeneous Populations, groups ranked Gp 1 refers to GROUP=A.S. CTGF Gp 2 refers to GROUP=A.S. TGF-B1 Gp 3 refers to GROUP=Control Gp 4 refers to GROUP=HA Gp 5 refers to GROUP=Scrambled Gp Gp Gp Gp Gp 4 5 2 1 3 ----------This is a graphical representation of the Newman-Keuls multiple comparisons test. At the 0.05 significance level, the means of any two groups underscored by the same line are not significantly different.

PAGE 101

REFERENCES 1. Acid Treatment of NGF Samples.Applications of Neuroscience.3:28,1996 2. Adolph, R. Vincent., Bleacher C. John, M.D. Dillon, W. Peter, M.D. and Krummer, M. Thomas., M.D. Hyaluronate Uptake and CD-44 Activity in Fetal and Adult Fibroblasts. Journal of Surgical Research. 54:328, 1993 3. Glycolysis & Gluconeogenesis Introducing Metabolism Module 12 June 2003 < http://www.unisanet.unisa.edu.au/08366/htp2carb.htm> 4. Becker, Hilton, M.D., and Springer, Rachelle. A.R.N.P., M.S., C.S., C.P.S.N. Prevention of Capsular Contracture. Plastic and Reconstruction Surgery. May: 1769, 1999 5. Berg, M. Jeremy., Tymoczko, L. John., Stryer, Lubert. Biochemistry 5th Edition. New York: W.H. Freeman and Company, 2002 6. Bernstein, F. Eric.M.D., Lee, Jason, M.D., Brown, B. Douglas, MS., Yu, Ruey, PhD, OMD., and Van Scott, Eugene, M.D.Glycolic Acid Treatment Increase Type I Collagen mRNA and Hyaluronic Acid Content of Human Skin. Dermatol Surgery.27: 429, 2001 7. Blanco, Dolores., Alonso J. Maria. Protein Encapsulation and Release from Poly(lactide-co-glycolide)Microspheres: Effect of the Protein and Polymer Properties and of the Co-Encapsulation of Surfactants. European Journal of Pharmaceutics and Biopharmaceutics.45: 285, 1998 8. Bradham, M. Douglass., Igarashi, Atsuyuki., Potter, L. Robert., and Grotendorst, R. Gary. Connective Tissue Growth Factor: a Cysteine-Rich Mitogen Secreted by Human Vascular Endothelial Cells is Related to the SRC-Induced Immediate Early Gene Production CEF-10. The Journal of Cell Biology.116: 1285, 1991 9. Breborowicz, A., Martis, L., and Oreopoulos, DG. In vitro Influence of Lactate on Function of Peritoneal Fibroblasts. Adv Perit Dial.10: 225, 1994 10. Brigstock, R. David. The Connective Tissue Growth Factor/Cysteine-Rich61/Nephroblastoma Overexpressed(CCN) Family.The FASEB Journal.13:189, 1999 89

PAGE 102

90 11. Caffee, Hollis, H. M.D. The Effects of Hematoma on Implant Capsules. Annals of Plastic Surgery.16: 102, 1986 12. Caffee, Hollis, H. M.D. The Influence of Silicone Bleed on Capsule Contracture. Annals of Plastic Surgery.17: 284, 1986 13. Chen, John,Y.W. PhD., and Abatangelo, Giovanni. M.D. PhD. Functions of Hyaluronan in Wound Repair.Wound Rep Reg.7: 79, 1999 14. Coombes, A.G.A., Yeh, Ming-Kung., Lavelle, E.C., and Davis, S.S. : The Control of Protein Release from Poly(DL-lactide co-glycolide)Microparticles by Variation of the External Aqueous Phase Surfactant in the Water in Oil in Water method. Journal of Controlled Release. 58: 311, 1998 15. Croce, M.A. Dyne, K., Boraldi, F. Quaglion, D., Cetta, G., Tiozzo, R. and Ronchetti, Pasquali, I. Hyaluronan affects Protein and Collagen by in vitro Human Skin Fibroblasts. Tissue & Cell.33: 326, 2001 16. Cukjati, D., Rebersek, S., Karba, R., and Miklavcic, D. Modeling of Chronic Wound Healing Dynamics. Medical & Biological Engineering & Computing.38: 339, 2000 17. De Rosa, Giuseppe., Bochot, Amelie., Quaglia, Fabiana., Besnard, Madeleine., and Fattal, Elias. A New Delivery System for Antisense Therapy:PLGA Microspheres Encapsulation Oligonucleotide/Polyethyleneimine Solid Complexes.International Journal of Pharmaceutics.254: 89, 2003 18. Dunne, M., Corrigan, O.I., and Ramtoola, Z. Influence of Particle Size and Dissolution Conditions on the Degradation Properties of Poly Lactide-co-Glycolide Particles. Biomaterials. 21: 1559, 2000 19. Duggan, BJ., Cotter, FE., Kelly, JD., Hamilton, PW., Mc Callion, K., Harkin, D., Gardiner, T., Anderson, N., Keane, PF., Johnston, SR., and Williamson, KE. Antisense Bcl-2 Oligonucleotide Uptake in Human Transitional Cell Carcinoma. Eur Urol. 40(6): 685, 2001 20. Eltze, E., Bettendorf, O., Rody, A., Jackisch, C., Herchenroder, F., Bocker, W., and Pfleiderer, B. Influence of Local Complications on Capsule Formation Around Model Implant in a Rat Model. J Biomed Mater Res.64A: 12, 2003 21. Faisant, N., Sipmann, J., and Benoit, P.J. PLGA-based Microparticles: Elucidation of Mechanisms and a New, Simple Mathematical Model Quantifying Drug Release.European Journal of Pharmaceutical Sciences.15: 355, 2002

PAGE 103

91 22. FDA Background: Cosmetics and Alpha Hydroxy Acids Alpha Hydroxy Acids in Cosmetics 14 May 2003. 23. Saline Filled Breast Implant Surgery: Making in Informed Decision Breast Implants 14 June 2003 24. Fraizer, Ken., Williams, Shawn., Kothapalli, Devashish., Klapper, Helene., and Grotendorst, R. Gary. Stimulation of Fibroblast Cell Growth, Matrix Production, and Granulation Tissue Formation by Connective Tissue Growth Factor. J Invest Dermatol.107: 404, 1996 25. Grinnell, Frederick. Fibroblasts, Myofibroblasts and Wound Contraction. The Journal of Cell Biology. 124: 401, 1994 26. Grotendorst Gary. Connective Tissue Growth Factor: a Mediator of TGFAction on Fibroblasts. Cytokine & Growth Factor Reviews. 8: 171, 1997 27. Hood, L.H.., Kraeling, K.E.M.., Robh, G.M., and Bronauch, L.R. The effects of an Alpha Hydroxy Acid (Glycolic Acid) on Hairless Guinea Pig Skin Permeability. Food and Chemical Toxicology.37: 1105, 1999 28. Hussain, Majad., Beale, Gary, Hughes., Marcus, and Akhtar, Saghir. Co-delivery of an Antisense Oligonucleotide and 5-Fluorouracil using Sustained Release Poly (Lactide-co-Glycolide) Microsphere Formulations for Potential Combination Therapy in Cancer. International Journal of Pharmaceutics. 234: 129, 2002 29. Phases of Wound Healing The Phases of Wound Healing .2003 Idexx Laboratories.23 Mar 2003 30. Igarashi, Atsuyuki., Nashiro, Kiyoko., Kukuchi, Kanako., Sato, Shinichi., Ihn, Hironobu., Fujimoto, Manabu., Grotendorst R. Gary., and Takehara, Kazuhiko. Connective Tissue Growth Factor Gene Expression in Tissue Sections from Localized Scleroderma Keloid, and Other Fibrotic Skin Disorders. The Journal of Investigative Dermatology. 106: 729, 1996 31. Iwuagwu, F.C. and Frame, J.S. Silicone Breast Implants: Complications. British Journal of Plastic Surgery. February: 632, 1997 32. Jain, A. Rajeev. The Manufacturing Techniques of Various Drug Loaded Biodegradable Poly(lactide-co-glycolide)(PLGA)Devices.Biomaterials.21: 247, 2000

PAGE 104

92 33. Leask, Andrew., Holmes, Alan., Black, M Carol., and Abraham, J. David. Connective Tissue Growth Factor Regulation. The Journal of Biological Chemistry. 276: 13008, 2003 34. Lee, Eun-Jong., Park Chul-Jong., Lee Hoon Kwang., Oh, Ho,Sang., and Suh, Hwal. Laminin Modified Infection-Preventing Collagen Membrane Containing Silver Sulfadiazine-Hyaluronan Microparticles.26: 521, 2002 35. Lu, Lichun., Stamatas, N. Georgios., and Mikos, G. Antonios. Controlled Release of Transforming Growth Factor 1 from Biodegradable Polymer Microspheres. Journal of Biomedical Material Research.50: 440, 2000 36. Maniwa, Sokichi., Ochi, Mitsuo., Motomura, Tetsuhisa., Nishikori, Tetsuya., Chen, Jun., and Naora, Hiroyuki. Effects of Hyaluronic Acid and Basic Fibroblast Growth Factor on Motility of Chondrocytes and Synovial Cells in Culture.Acta Orthop Scand.72: 299, 2001 37. Meyer, M.J., Ludger., Russell, B. Shirley., Russel, D. James., Trupin, S. Joel., Egbert, M. Barbara., Shunster, Svetlana., and Stern, Robert., Reduced Hyluronan in Keloid Tissue and Cultured Keloid Fibroblasts. The Journal of Investigative Dermatology. 114: 953, 2000 38. Middleton, C. John., and Tipton, J. Arthur.Synthetic Biodegradable Polymers Medical Devices(MPB archive, Mar 98). Synthetic Biodegradable Polymers Medical Devices 13 May 2003 39. Moussad, Essam and Brigstock, David., Connective Tissue Growth Factor: Whats in a Name? Molecular Genetics and Metabolism.71: 276, 2000 40. Pedagogos, Eugenia., Hewitson, D. Timothy., Nicholls, M. Kathleen., and Becker, J. Gavin. Hyaluronan and Rat Renal Fibroblasts: In vitro Studies. Nephron.88: 347, 2001 41. Ratner, D. Buddy., Hoffman, S. Allan., Schoen J. Frederick., and Lemons, E. Jack. Biomaterial Science: An Introduction to Materials in Medicine. San Diego: Academic Press,1996 42. Rosa, De Giuseppe., Quaglia, Fabiana., Rotonda, La Immacolata, Maira. Appel, Martine. Alphadary Hugette. and Fattal, Elias. Poly( lactide-co-glycolide) Microspheres for the Controlled Release of Oligonucleotide/Polyethylenimine Complexes. Journal of Pharmaceutical Sciences.91: 790, 2002 43. Rotatori, D.,M.D., Hathaway, Carol., M.D., Steinbach, Barbara., M.D. and Caffee H., M.D. Noninvasive Assessment of Implant Capsules. Plastic and Reconstructive Surgery.87: 703, 1991

PAGE 105

93 44. Schiller, Carsten., and Epple, Matthias.,: Carbonated Calcium Phosphates are Suitable pH-Stabilizing Fillers for Biodegradable Polyesters.Biomaterials. 24: 2037, 2003 45. Shah, Mamta., Foremam, David ., and Ferguson, Mark. Neutralisation of TGF-1 and TGF-2 or Exogenous Addition of TGF-3 to Cutaneous Rat Wounds reduces Scarring. Journal of Cell Science. 108: 985, 1995 46. Shah, Mamta., Foreman, M. David., and Feguson, W.J. Mark. Control of Scarring in Adult Wounds by Neutralizing Antibody to Transforming Growth Factor Lancet. 339: 213, 1992 47. Shier David, Butler Jackie, Lewis Ricki. Human Anatomy&Physiology. Boston: WCB/McGraw-Hill, 1999 48. TGF-beta 1 TGF-beta 1 5 May 2003 49. Tateshita, Tohru., Oho, Ichiro., and Kaneko, Fumin. Effects of Collagen Matrix containing Transforming Growth Factor(TGF)-1 on Wound Contraction. Journal of Dermatological Science.24: 104, 2001 50. Ueki, Norbru., Taguchi, Tomohiro., Takahashi, Masayuki., Masakazu, Adachi., Ohkawa, Toshihisa., Amuro, Yoshiki., Hada, Toshikazu., and Higashino, Kazuya. Inhibition of Hyluronan Synthesis by Vesnarinone in Cultured Human Myofibroblasts. Biochimica et Biophysica Acta. 1495: 160, 2000 51. Silicone Gel Implants Home Page Silicone Gel Breast Implants 14 June 2003 52. Vaughan, B. Melville., Howard, W. Eric., and Tomasek, J. James. Transforming Growth Factor-1 Promotes the Morphological and Functional Differentiation of the Myofibroblast.Experimental Cell Research.257: 180, 2000 53. Wang, Juan., Wang, M. Barbara., and Schewendeman, P. Steven. Characterization of the Initial Burst Release of a Model Peptide from Poly(D,L-Lactide-co-glycolide)Microspheres. Journal of Controlled Release.82: 289,2002 54. Wells, F. Alvin, PhD., Stephanie, Daniels, BSN., Gunasekaran, Sivaselvi, M.D., and Wells, E. Karen, M.D. Local Increase in Hyaluronic Acid and Interleukin-2 in the Capsules Surrounding Silicone Breast Implants.Annals of Plastic Surgery.33: 1, 1994

PAGE 106

94 55. Wound Healing at its best Basics of Wound Healing and Treatment. Woundhealer .23 Mar 2003 56. Zhu, Gaozhong., Mallery, R. Susan., and Schwendeman, P. Steven. Stabilization of Protein Encapsulated in Injectable Poly(lactide-co-glycolide). Nature Biotechnology.18: 52, 2000

PAGE 107

BIOGRAPHICAL SKETCH Kareem Sakura Burney was born in Detroit, Michigan on August 14, 1979. He attended Cass Technical High School and received his diploma in June 1997. In June of 1997, Kareem enrolled at Prairie View A&M University in Prairie View, Texas where he began studying chemical engineering. After four long and interesting years Kareem received his bachelors degree in May 2001. Upon finishing an internship in chemical engineering at the Dow Chemical Company in Plaquemine, Louisiana, Kareem began his graduate studies at the University of Florida in September 2001. His research focused on using antisense oligonucleotides in Poly (DL-Lactide-CO-Glycolide) Acid microspheres to decreases the levels of CTGF and TGF-1 around breast implants After graduation Kareem will continue for a PhD in biomedical engineering. 95


Permanent Link: http://ufdc.ufl.edu/UFE0001194/00001

Material Information

Title: Evalulation of sustained release of antisense Oligonucleotide from Poly DL (Lactide-Co-Glycolide) microspheres targeting fibrotic growth factors CTGF and TGF-Beta1
Physical Description: Mixed Material
Creator: Burney, Kareem Sakura ( Author, Primary )
Publication Date: 2003
Copyright Date: 2003

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0001194:00001

Permanent Link: http://ufdc.ufl.edu/UFE0001194/00001

Material Information

Title: Evalulation of sustained release of antisense Oligonucleotide from Poly DL (Lactide-Co-Glycolide) microspheres targeting fibrotic growth factors CTGF and TGF-Beta1
Physical Description: Mixed Material
Creator: Burney, Kareem Sakura ( Author, Primary )
Publication Date: 2003
Copyright Date: 2003

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0001194:00001


This item has the following downloads:


Full Text












EVALUATION OF SUSTAINED RELEASE OF ANTISENSE OLIGONUCLEOTIDE
FROM POLY DL (LACTIDE-CO-GLYCOLIDE) MICROSPHERES TARGETING
FIBROTIC GROWTH FACTORS CTGF AND TGF-pl

















By

KAREEM SAKURA BURNEY


A THESIS PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE

UNIVERSITY OF FLORIDA


2003




































Copyright 2003

By

Kareem Sakura Bumey















ACKNOWLEDGMENTS

I would like to thank all the staff of the Biomedical Engineering Department at the

University of Florida for their financial support for my time in graduate school. I would

also like to thank the Materials Science and Engineering Department and the Obstetrics

and Gynecology Department for their financial support for this project

I would like to express my gratitude to my committee members, Dr. Gregory

Schultz, Dr. Gloria Chin, and my advisor, Dr. Christopher D. Batich, for their support

and advice for this project.

For their time and help I would like to thank all the people who helped me succeed

at accomplishing this project. These people are Xeve Silver, John Azeke, Tara

Washington, Patrick Leamy, and Timothy Blalock. I would also like to thank Dr. Gene

Goldberg and Dr. Hollis Caffee for their time and input in this project.

I would now like to thank all my friends who have given me the support I needed to

accomplish this goal. These people are Dr. Irvin W. Osborne-Lee, Dr. Kamel Fotouh,

Jeffery Taylor, Ryan McGinty and Dana Milborune. Without their support I would not

have been able obtain my Master of Science degree.

Finally I would like to extend ultimate gratitude to my parents, Ulysses and Bettye

Burney, and my brothers, Kofi and Khary Burney. Without them, I would not have had

the ability to be successful nor even be in the position I am in today.
















TABLE OF CONTENTS
Page

A C K N O W L E D G M E N T S ......... ...................................................................................... iii

LIST OF TABLES ........ .................................... ................... ............ .. vi

LIST OF FIGU RE S ........................................ ............. .............. .. viii

ABSTRACT .............. .......................................... xi

CHAPTERS

1 IN TR O D U C TIO N ........................................................... .......... .......... .... ....

2 B A C K G R O U N D .................... ...................................... ........ ........ .......... .. ....

In tro d u ctio n .................................................................................. 5
PD M S B rest Im plants ................... .... ........ ..................... ... ...... ...............
Design of Breast Im plants .................... ..................................6
Complications of Breast Implants .............. ................... .................7
W ound H dealing and Growth Factors ........................................ ........................ 9
W ound H dealing Process ............................................... ............................. 9
Growth Factors CTGF and TGF-l ...................................... ................11
Poly (DL-Lactide-co-Glycolide) ........................................................... ............... 14
Lactide and Glycolide in the Human Body ............................... ................14
Polym er A applications of PLG A .................................. ..................................... 16
Hyaluronic Acid ................... .......... .. .. ..... ...... ........... 17
Hyaluronic Acid Usage by the Human Body ..................................................17
W ound H dealing A applications ........................................ ......................... 18

3 M ATERIALS AND M ETHOD S............................................ .......................... 20

M materials ........................................................... ................ 2 0
M icrosphere Components...................... ....................................20
Antisense Oligonucleotides to CTGF and TGF-1 ..........................................20
Silicone B reast Im plants......... ............... ................................... ............... 2 1
M methods ............................................ .... 2 1
"Doping" Process of Microspheres ........................................... .............21
Microsphere Preparation ........................... ......................22
Fluorescent Spectroscopy and UV-VIS Spectroscopy Analysis for Microsphere
R release K inetics Study ............................................................................. 23









SEM Analysis for Particle Characterization......................................24
Particle Sizing for Particle Characterization ....................................... .......... 24
Total Amount Incorporated into Microspheres ....................................... 24
Release Profiles for Microspheres...................................................... 25
Microsphere Preparation for an Animal Study....................... ..................27
R at Study ............................................................. .. ... .. ........ 28
Homogenizing of Rat Tissue for use in the ELISA Assay ..............................29
CTGF ELISA U sed in Rat Study ............................................. ............... 29
TGF-pl ELISA used in Rat Study ........................................... ............... 31

4 RESULTS AND DISCUSSION .......................... .............................. ............... 33

Microsphere UV-VIS Spectrophotometer Analysis ................................................33
1X m icrosphere release kinetics....................................................................... 33
Microsphere Release Data from Fluorescent Detector.............................................36
Microsphere Encapsulation Experiment ............................. .... ............36
50X Release Profile Experim ent ........................................ ...... ............... 38
Particle Characterization of PLGA Microspheres ..................................................40
Particle Sizing of M icrospheres..................... ..... ........................... 40
SEM Characterization of microspheres..................................... 45
In v iv o resu lts ....................................................... 50
Surgical procedure........... ... ........................................................ .... .... .... ... 50
ELISA CTGF A ssay Results ......................................................................... 55
ELISA TGF-pl A ssay R results ........................................ ........................ 60

5 CONCLUSION AND FUTURE WORK .......................................... ............... 64

M icrosphere D evelopm ent........................................... ... ................. .. ............. 64
Implantation ...................................................64
F u tu re W ork ...............................................................6 5
M icrospheres-Future W ork ........................................ ........................... 66
M icrospheres-Future U ses.......................... .............................. ... ............ 66
Rat Animal Experiment-Future Work.......... ................ .................. 66

APPENDICES

A STASTICTICAL ANALYSIS OF MICROSPHERE PARTICLE DISTRIBUTION.67

B ELISA N UM ER ICAL RE SU LTS .................................................... .....................71

C STATISTICAL ANALYSIS PROVIDED BY ANOVA FOR ELISA RESULTS .....73

R E F E R E N C E S ........................................ ........................................................... .. 8 9

B IO G R A PH IC A L SK E TCH ..................................................................... ..................95





v
















LIST OF TABLES


Table pge

3-1: The 20 rats in this experiment divided into four groups .......................................28

4-1: Cumulative antisense CTGF released from IX microspheres during experiment (in
mg). For each trial 50mg of microspheres were used. ............................................35

4-2: Amount of encapsulated antisense CTGF (in |tg of antisense/mg of microspheres) in
microspheres. For each trial 20mg of microspheres from each loading factor was
u se d ............................................................................. 3 7

4-3: Encapsulation efficiency of m icrospheres.............................................................. 38

4-4: Cumulative antisense CTGF released from 50X microspheres during experiment (in
mg). For each trial 50mg of microspheres were used. ............................................39

A.1: Particle sizing statistical data for 100X microspheres............................................67

A.2: Particle sizing statistical data for 50X microspheres..............................................68

A.3: Particle sizing statistical data for 10X microspheres ..............................................69

A.4: Particle sizing statistical data for 1X microspheres ...............................................70

B.1: CTGF level ELISA results from week 1 rat groups. ( ng of CTGF/ mg protein).....71

B.2: CTGF level ELISA results from week 2 rat groups. ( ng of CTGF/ mg protein).....71

B.3: TGF-B1 level ELISA results from week 1 rat groups. ( pg of TGF-B / mg protein)72

B.4: TGF-B1 level ELISA results from week 2 rat groups. ( pg of TGF-B1 /mg protein)72

C.3: Mean and Standard Deviation values from ELISA results of CTGF bottom of
cap su le w eek 1 ..................................................................... 7 5

C.4: P values of ELISA results from CTGF bottom of capsule week 1 ........................76

C.5: Mean and Standard Deviation values of ELISA results from CTGF skin week 2 77

C.6: P values of ELISA results from CTGF skin week 2..........................................78









C.7: Mean and Standard Deviations of ELISA results from CTGF Bottom of capsule
w eek 2 .............................................................................. 7 9

C.8: P values of ELISA results from CTGF Bottom of capsule week 2 .......................80

C.9: Mean and Standard Deviation values of ELISA results from TGF-B1 skin week 1 81

C.10 : P values of ELISA results from TGF-B1 skin week 1 ........................................82

C. 11: Mean and Standard Deviation values of ELISA results from TGF-B 1 Bottom of
cap su le w eek 1 ..................................................... ................ 8 3

C.12: P values of ELISA results from TGF-B1 Bottom of capsule week 1 ....................84

C.13: Mean and Standard Deviation values of ELISA results from TGF-B1 skin week 285

C.14: P values of ELISA results from TGF-B1 skin week 2 ................. .................86

C. 15: Mean and Standard Deviation values of ELISA results from TGF-B1 Bottom of
cap su le w eek 2 ..................................................... ................ 8 7

C.16: P values of ELISA results from TGF-B1 Bottom of capsule week 2 ...................88
















LIST OF FIGURES


Figure page

2-1: A natom y of hum an breast (51)........................................ ............... ...............5.

2-2: Contour design of breast implant (23).......................... ....................... ......... 6

2-3: Round design of breast implant (23) ....................................... ......... ...............7.

2-4: Glycolysis and Gluconeogenesis diagram (3,5).......................................................14

2-4 : L actic A cid m olecule........... ............................................................. .... .... ... .. 15

2-5:G lycolic A cid m molecule .............................................................................. .... ........15

2-6: Reaction of Lactide and Glycolide to form PLGA (38)................. ............. .....16

2-6:Hyaluronic Acid repeat unit (13)................................. ....... .................... 18

3-1: Type of silicone breast implant used in this study. Made by Mentor Corporation. ..21

4-1: Absorption Spectrum of PBS solution ........................................... ............... 33

4-2: Absorption peak of PBS solution with fluorescein labeled antisense CTGF............34

4-3: Percent Release Profile of IX microspheres.................................. .................34

4-4: Amount encapsulated in PLGA microspheres as loading of antisense CTGF
in c re a se s .......................................................................... 3 6

4-5: Percent Release profile of 50X microspheres ................................. ............... 38

4-6: Comparison of total release vs. time of 50X and IX microspheres..........................39

4-7: Particle Characterization of 100X microspheres.....................................................40

4-8: Particle Characterization of 50X microspheres ....................................................41

4-9: Particle Characterization of 10X microspheres................................................. 42

4-10: Particle Characterization of IX microspheres ....................................................43









4-11: Size distribution of microspheres:A) Size comparison of all microsphere batches
from 0-200 um B) Size comparison of all microspheres from 0-2000um ...............44

4-12: SEM pictures of 100X Microspheres at 5KeV, working distance =14mm A) 25x.
Size bar =lmm B) 200x. Size bar = 100tm C) 1500x. Size bar = 10[tm ...............45

4-12 : C ontinu ed ........................................................................... 46

4-13: SEM pictures of 50X Microspheres at 5KeV, working distance 14mm A) 25x.
Size bar =lmm B) 200x. Size bar = 100tim C) 1500x. Size bar = 10im ...............47

4-14: SEM pictures of 10X Microspheres at 5KeV, working distance 14mm A) 25x.
Size bar =lmm B) 200x. Size bar = 100tim C) 1500x. Size bar = 10itm ................48

4-15: SEM pictures of 100X Microspheres at 5KeV, working distance 14mm A) 25x.
Size bar =lmm B) 200x. Size bar = 100tm C) 1500x. Size bar = 10[tm ...............49

4-16: Pictures from rat surgery: A) The syringes used to deliver microspheres and HA B)
Template used to determine incision location in animal experiment (areas marked
w ith sharpie m arker).......... ..... ......................................................... .... ... ... .. 50

4-17: Surgical procedure from rat surgery: A) and B) Microspheres/HA injected C)
Incisions closed w ith staples ............................................................................. 51

4-18: Implant placement after surgery: A) Normal position of implants after surgery, B)
and C) After one implant migrated during experiment.........................................52

4-19:Capsules formed after experiment: A), B) and C) Different capsules formed around
im plants after 1 and 2 w eeks .............................................................................. .... 53

4-20: Capsule formed after surgery and surgical procedure: A) Capsule after 1 and 2
weeks B) Capsule after movement of implant occurred C) Picture of how the skin
w as taken for ELISA analysis. ..... ...................................................................... 54

4-21: Levels of CTGF in the skin around the implant from week l(ng of CTGF/mg
protein). (* = m igration)......... ......................................... ...... ...... ............. 56

4-22: Levels of CTGF from the bottom of the implant capsule from week 1 (ng of
CTGF/m g protein). (* = m igration) .............................................. ............... 57

4-23: Levels of CTGF in the skin around the implant from week 2 (ng of CTGF/mg
protein). (*= m migration) ...... .. .................................... .............. .... 58

4-24: Levels of CTGF from the bottom of the implant capsule from week (ng of CTGF/
m g protein). (* = m igration).......................................................... ............... 59

4-25: Levels of TGF- 31 from the skin from week 1 (pg of TGF- 31 / mg protein). (* =
m ig ratio n ) ........... ............................................................................ 6 0









4-26: Levels of TGF-P31 from the bottom of the implant capsule from week 1 (pg of
TGF-31/ mg protein). (* = migration) ........................................ ............... 61

4-27: Levels of TGF-pl from the skin from week 2 (pg of TGF-pl/mg protein). (* =
m migration) ................................................ ............ .... ........ ........... 62

4-28: Levels of TGF-pl from the bottom of the implant capsule from week 2 (pg of
TGF-P1 / mg protein). (* = m igration) ........................................ ............... 63





















Abstract of Thesis Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Master of Science
EVALUATION OF SUSTAINED RELEASE OF ANTISENSE OLIGONUCLEOTIDE
FROM POLY DL (LACTIDE-CO-GLYCOLIDE) MICROSPHERES TARGETING
FIBROTIC GROWTH FACTORS CTGF AND TGF-pl


By

Kareem S. Burney

August 2003

Chair: Christopher D. Batich
Major Department: Biomedical Engineering

Antisense oligo ribonucleotides to CTGF (connective tissue growth factor) and

TGF-p31 (transforming growth factor betal) were encapsulated in 50/50 Poly (DL-

Lactide-Co-Glycolide) acid microspheres for controlled delivery. The microspheres were

first placed in a Phosphate Buffered Solution (PBS, 7.4 pH) to show the release kinetics

for 24 days. The release kinetics in PBS involved measuring antisense oligonucleotide to

CTGF containing a fluorescence label with a UV spectrometer and fluorometer. The

amount of antisense CTGF encapsulated was gradually increased to determine how much

could be held by the microspheres. The morphology and topography of the microspheres

were analyzed using scanning electron microscopy and laser particle diffraction.









After the microspheres were made they were then suspended in hyaluronic acid

solutions to help provide an even distribution of particles. They were then injected

subcuteneously along the surface of a miniature silicone breast implant for a period of

two weeks to determine whether they could lower the amount of CTGF and TGF-pl

being produced by the fibroblasts. The measurement of CTGF and TGF-p 1 were done

using an ELISA assay. Results showed that there was a decrease in the levels of CTGF

(p=0.005) but not in the levels of TGF-p1.














CHAPTER 1
INTRODUCTION



The specific aim of this research project is to develop a drug delivery material that

will release drugs for a long period of time that could one day be used to treat the

problem of capsular contraction. Capsular contraction is a reaction of the body to the

presence of a breast implant (11,12,20,31). A fibrous capsule forms around a breast

implant and eventually contracts, disfiguring the implant and causing pain and suffering

to the patient (11,12,20). This research project is based on the hypothesis that a polymer

can be used as a drug delivery material to change how the body heals itself, while being

safe and effective. The first objective is to develop a drug delivery method to deliver

drugs locally. The second objective is to develop an animal model to test this drug

delivery method.

The research involves determining what polymer to use and the best methods to

test the drug, both in vitro and in vivo. The polymer must degrade in the human body

without causing a strong immunological response, and be able to release the drug

efficiently. The polymer that will be used in this experiment is Poly Lactic Glycolic Acid

(PLGA). PLGA is used because it degrades safely in the body and the FDA has already

approved it for human use in other applications.

Capsular contraction is a frequently major problem after breast implant surgery.

Breast implants are used for cosmetic enhancement or for reconstruction, such as after

breast cancer surgery. Of these uses, 5-10% of patients undergoing augmentation surgery









using saline implants and 25-30% of patients undergoing breast reconstruction surgery

using saline implants will experience capsular contracture. When a breast implant is

implanted the body, it will generate a foreign body response and form a fibrous capsule.

Once the capsule is formed, it shields the implant from immunological attacks to some

extent. In some cases the fibrous capsule will contract (some theorize that this is due to

the body trying to extrude the implant), compressing the implant, from a flattened

ellipsoid shaped object into a spherical object. This compression of an object in confined

space causes pain and discomfort to the patient, and will ultimately lead to disfigurement

of the breast (20,23,31,41,51).

At this point the patient has a few options. These options are to undergo a

secondary breast reconstructive surgery, apply massage techniques to break the capsule,

or to completely remove the breast implant (43). If the patient chooses to keep the

implant, the capsule often continues to develop. Thus, there is a need to develop an

effective way to prevent the capsule from forming. Since capsular contracture can occur

from 3 months to 2 years after surgery, there is a long time period when it will occur,

making prevention of this problem difficult. This research is designed to eventually

develop a drug delivery device that will release antisense oligonucleotides for a defined

time period and will hopefully prevent contracture from happening.

Several approaches have been applied to prevent capsular contraction: these are

grouped into preoperative and postoperative. Since there is no conclusive reason as to

why contracture occurs, these published approaches represent a range of ideas to prevent

capsular contraction.









Preoperative techniques include, sub muscular placement of the implant. Making

the shell of the implant very smooth in order to reduce bacterial contamination and

reduce the immunological response leading to capsular contraction. Designing a breast

implant with an "air pocket" so when contracture occurs it will not be as harmful to the

patient. Having the patient take antibiotics to prevent wound infections (4). Postoperative

procedures are to prevent early hematoma, to use implant movement (massage) in hopes

of breaking the capsule, and trying to prevent infection due to the breast implant (4).

All of these techniques have been used to prevent or reduce the threat of capsular

contracture, but it still occurs. One reason for this could be the presence of growth factors

causing the tissue to contract around the breast implant (10). The growth factors

implicated are connective tissue growth factor (CTGF) and transforming growth factor

beta (TGF-P). Since the growth factors are thought to be a major cause of capsule

formation, antisense oligonucleotides targeting TGF-3 or CTGF were administered in

order to negate their effect in the area of the implant (17,19).

The only major drawback to the use of antisense oligonucleotides is when they are

injected in solution with saline they have a rapid diffusion which makes them ineffective

after a very rapid period of time. What was once done to overcome this fact was to inject

the wound site multiple times. This would keep the effect of the antisense

oligonucleotides constant for a prolonged period of time. In order to make it more cost

effective and convienent for the patient a drug delivery device was designed in the study

that had a sustained release of antisense oligonucleotides over a prolonged period of time

(17,19).









The experimental design consisted of two phases. Phase one developed the

polymer microspheres for drug delivery and measured the release rate of the antisense

oligonucleotides [from the polymer microspheres]. Drug release was measured at 30min,

2h, 4h, 6h, 8h, 7 days and 24 days using UV and fluorescent spectroscopy. The second

phase consisted of using an animal model to test this device. This assessed if the drug

delivery device was effective in decreasing the amount of CTGF and TGF-pl present in

tissue.

Rats and rabbits are both similar to humans for the development of capsular

contracture. The rat was used because it is much less expensive. It was expected that the

drug delivery device will affect the surrounding tissue and decrease the levels of CTGF

and TGF-pl in the implant capsule for a significant period of time.














CHAPTER 2
BACKGROUND

Introduction

The female breast is composed of around fifteen to twenty irregular shaped lobules,

containing alveolar glands and a lactiferous duct, which leads to the nipple (47).

Connective and adipose tissues separate the lobules and provide support and attachment

to the fascia of the underlying pectoralis muscles. Suspensory ligaments, and dense

connective tissue strands extend inward from the dermis of the breast to the fascia; and

also help to support the weight of the breast.

Breast implants were developed to enhance or restore a woman's breast volume and

contour (23,51). Many patents with congenital hypomes (congenital deficiency of breast

tissue) or post-natal breast atrophy (the sagging that develops after child birth and age)

choose to undergo breast augmentation to enhance their silhouette. Breast implants are

also used in women who have had mastectomies, as the result of breast cancer or for

prophylaxis to restore breast contour (23,51).













Figure 2-1: Anatomy of human breast (51)










PDMS Breast Implants

Design of Breast Implants

Breast implants consist of a poly dimethyl siloxane (PDMS) elastomer shell filled

with either saline or PDMS gel. Saline filled implants are the only one currently approved

by the FDA for use in humans. Silicone implants are only available through study

centers for patents who meet strict criteria. There two basic designs of saline implants

and they differ by whether the implant has a valve that allows for the addition of saline

after surgery (23). The saline-filled design(spectrumTM) has a self-sealing valve located on

the front of the implant that is used for filling the device before implantation at the time

of surgery. The SpectrumTM design has a valve on the front of the implant that allows

volume adjustments to be made after the implant is surgically placed.

Breast implants also differ in their shape, round vs. anatomical, and whether there

are surface projections on the silicone shell as in textured vs. smooth implants (23). Once

the style is selected the implants are placed beneath the glandular tissue and over the

pectoralias muscles or beneath both the breast tissue and the muscles for a subglandular

or subpectoral placement respectively. Although it is currently thought by the plastic

surgery community that subpectoral placement results in fewer capsular contractures,

there are no scientific studies that support this premise. The decrease in capsular

contracture of subpectoral implants may result from difficulty in detection.




b i


Figure 2-2: Contour design of breast implant (23)




















Figure 2-3: Round design of breast implant (23)

Complications of Breast Implants

Implant rupture, infection, hematoma, and capsular contracture have been reported

after breast implant surgery. Rupture can occur days, months, or years after surgery and

is detected by a decrease in breast size (34). Implant failure has been associated with

closed capsulatomy, trauma, and excessive compression during mammographic imaging

and from underfilling of the implant resulting in folds thought to weaken the integrity of

the silicone sheet (23,31,51).

Infection after breast implant surgery is a complication that frequently requires the

removal of the implant and an intervening period of several months in which the patient

is infection free before the implant is replaced. Infections, hematomas (blood collection)

and seromas (serum collects) frequently occur early after implant placement (11,31).

Hematomas and seromas sometimes develop in the pocket adjacent to the implant and

may be seeded by bacteria to produce infection or contribute to capsular contraction.

Infection has also been thought to cause contracture formation.

Patients with breast implants will normally develop a fibrous capsule around the

implant. Some will develop significant capsular contracture resulting in the implant

causing pain and distortion of the breast implant. With capsular contracture formation the

usually soft hemisphere implant becomes round and hard. Breast implant capsular









contracture is believed to be the body's exuberant response to the implant as a foreign

body. When a breast implant is placed inside the human body the body will begin to

attack it. The immune response will send macrophages and foreign body giant cells to

destroy the implant (44). When this fails the macrophages allow the fibroblast to begin to

form a collagen layer around the implant, encapsulating it from the rest of the body. This

is normally where the process is desired to stop, but for some breast implants ;the process

goes one step further. It occurs in 5-10% or all augmentation surgeries and 25-30% of all

reconstruction surgeries using breast implants. This next step involves the newly formed

collagen capsule beginning to contract around the implant altering its size and shape and

eventually becoming hard.

Capsule formation occurs around all prosthetic silicone devices, but has few

consequences around devices that are non flexible. The capsular contraction that occurs

around breast implants produces the pain and distortion that can only be corrected with

surgery designed to replace the implant and open the capsule (capsulotomy) or remove

the capsule (capsulcetomy)(1 1,12). The additional surgery results in additional cost and

increases morbidity such as infection, hematoma and seroma. This is a major problem

for doctors because there seems to be no direct cause for its occurrence. However, since

transforming growth factor betal (TGF-1) has been shown to have a significant role in

the formation of scar tissue and wound healing in general, we were interested to

determine its role in breast implant capsular contracture. In recent studies connective

tissue growth factor (CTGF) has been demonstrated to be the downstream mediator of

TGF-pl(33,39) and so we are also interested in elucidating its role in breast implant

capsular contraction.









Wound Healing and Growth Factors

Wound Healing Process

A wound is a disruption of a structure and its function in the human body

(16,29,55), and initiates the wound healing process. Wound healing is influenced by

many factors, for example, the presence of growth factors in the blood, the age of the

person (because as a person ages the ability to heal decreases drastically), and the

nutrients present in the body, (for example vitamin C is necessary for collagen production

and calcium is important for cell migration and adhesion (29)).

Once a wound is created the body has three different methods for closing the

wound. These closures are primary, secondary and delayed primary. Primary closure

occurs when the wound edges are very close to each other, as in a clean scapel wound; it

usually results in very little granulation tissue, minimal scarring and contracture.

Secondary closure is when the wound is initially left open and has greater tissue damage,

which prevents primary closure of the wound. There is more scarring, granulation tissue,

and contraction. It also takes more time to heal. Delayed primary closure is when the

closure is delayed for a few days to treat local infection but ,after that it resumes a

secondary closure process.

Normally the body repairs acutely injured tissue with scar tissue that is similar to

structures and function to the original non-injured tissues. A closure wound develops

when the repair process is interrupted, slowed down or stopped completely (29,55). The

restoration process is composed of many events, which are regulated extensively by

growth factors. Growth factors are proteins that basically tell cells what to do. The

growth factors are either secreted elsewhere in the body and arrive at the wound area via

blood or are secreted by cells in the area and act on nearby cells in a paracrine manner to









attract them to the wound to help heal it. The cell can also secrete growth factors that act

on itself in an autocrine manner (29,55). The sequence of events that occurs in the

wound healing process begins with a vascular response, then progresses to blood

coagulation, inflammation, formation of new tissues, epithelialization, and contraction.

The inflammatory phase is the initial step in the wound healing process. It occurs

when the body responds to any type of disruption to the skin (55). Within seconds, blood

vessels begin to constrict to control the bleeding and platelets merge within minutes to

begin clot formation and stop the bleeding. These platelets also release the growth

factors necessary to attract other cells to the wound. Such growth factors are platelet

derived growth factor (PDGF) (which attract inflammatory cells and fibroblasts to the

wound and transforming growth factor beta (TGF-3), which stimulate the fibroblasts to

make collagen. Neutrophiles can now enter the wound and attract macrophages. The

macrophages will then break down the necrotic debris and activate the fibroblast

response. The inflammatory phase will last for around 24hours and lead to the

proliferation phase.

The proliferation phase begins on the surface of the wound. This is where

epidermal cells burst into mitotic activity within 24 to 72 hours and move across the

surface of the wound (29). While this is happening, the fibroblasts move into the deeper

parts of the wound and synthesize small amounts of collagen, which will act as a scaffold

for migration and further the fibroblasts movement. The fibroblasts come from local

tissue surrounding the wound and unless the wound is clean of bacteria the migration in

this phase will be inhibited (55). Eventually, granulation tissue consisting of abundant

new blood vessels will also develop to help in nutritional support of the fibroblast cells.









The proliferation phase lasts for several days to weeks and leads to the repair phaseof the

wound healing process.

The repair phase begins four to five days after the injury. Fibroblasts begin to

produce large amounts of collagen and protoglycans (29). These collagen fibers are laid

down randomly and are crosslinked into large, closely packed bundles. During the 2 to 3

week period of the fibroblastic repair phase, wound strength continues to increase and

then wound healing enters the maturation phase.

The maturation phase begins with the number of fibroblasts in the wound

decreasing. As the level of fibroblasts decreases, the collagen fibers are remodeled into a

more organized matrix. This organized matrix becomes the dominant feature of the

wound (55). The tensile strength of the fibers begins to increase for up to one year after

the injury and although the healed wound never regains the full strength of the original

skin, it does regain 70% to 80% of its original strength (55). The key growth factors that

are responsible the synthesis of the collagen in the wound are Connective Tissue Growth

Factor (CTGF) and Transforming Growth Factor Beta (TGF-pl).

Growth Factors CTGF and TGF-P1

These two growth factors were examined in this study because they have been

found to play key roles in the development of collagen fibers, which are the main

component of capsules. Although TGF-P31 seems to have more control over the

development of collagen, it also has a role in many other biological functions(48,49,52).

If TGF-pl levels were to decrease too greatly, it could have traumatic effects on the

entire biological system. That is why CTGF is being investigated. It seems to focus









primarily on the formation of collagen; thus, if its levels were to decrease, then other

biological systems would still be able to function properly (8,39).

CTGF is a member of the gene family CCN (CTGF, Cyr61 and Nov). Members of

the CCN family have characteristics of proteins that contain an IGF (Insulin-like Growth

Factor) binding domain, a von Willebrand factor type C repeat, a thrombospondin type 1

domain and a C-terminal domain that contains a cystine knot (10,33). This family of

proteins is significant because all members promote angiogenesis, cell migration, and cell

adhesion. The CTGF molecule itself contains around 343-349 residues with the first 22-

27 residues comprising a signal peptide. Even though it is found in different species,

CTGF seems to have the same type of structure, except for the fact that human CTGF has

the presence of N-linked glycosylation consensus sequence at residues 28-30 and 225-

227, which is absent from the CTGF molecules in other species.

CTGF so far has been implicated in many different physiological processes. Some

of these processes involve embryo development, fibrosis, tumor desmoplasia, wound

healing, cell proliferation, DNA synthesis, extra cellular matrix (ECM) production, and

angiogenesis (24,26,30,40). CTGF is related to capsule formation due to its influence on

the fibroblasts during the wound healing process. In recent studies, CTGF was shown to

stimulate the fibroblasts production of ECM components such as type I collagen.

(24,26,30,40). This is important because, as the body forms a capsule, the fibroblasts will

eventually produce collagen around the implant, seemingly under the control of CTGF .

It is also known that CTGF is a mediator of TGF-p31. TGF-pl is a 25kDa

homodimeric protein that comes from the TGF-P3(Transforming Growth Factor beta)

superfamily. This family of growth factors is related in that they share a similar cysteine-









knot structure. The general function of TGF-31 in mammals is to modulate cell cycles,

inflammatory responses, extracellular matrix production, and mesenchymal-epithelial

interactions (24,26). Overall, there are five different isoforms of TGF-3 but in mammals

there are three. These three are called TGF-P31, TGF-32,and TGF-33. The difference

between these isoforms is that TGF-pl is a more potent growth inhibitor of heamopoeitic

stem cells and ECM production than TGF-32 and TGF-33. TGF-33 is more potent than

TGF-p 1 and TGF-32 at DNA synthesis in primary human keratinocyte cell cultures

(24,26,35). TGF-pl is of concern in this research because it has the ability to promote

fibroblast proliferation and matrix synthesis.

The relationship between these factors is still being investigated, but it has been

shown that fibrosis occurs only in the presence of both CTGF and TGF-pl. In mammals,

CTGF is normally expressed at relatively low levels. Furthermore, TGF-p31 is the primary

inducer of CTGF in the fibroblast cells which is one of the main producers of collagen

during capsule formation (39,46,49). This has lead to the hypothesis that decreasing the

amount of TGF-p31 in the system should also decrease the amount of CTGF.

Additionally, ways are being develop to decrease only CTGF. A way to decrease the

amount of growth factors expressed in a system is to use a polymer drug delivery device

to deliver antisense oligonucleotides that target the specific growth factors. Antisense

oligonucleotides to the growth factors TGF-p 1 and CTGF could lead to a decrease in

collagen development. How they could be delivered to cells will be discussed in the next

section.









Poly (DL-Lactide-co-Glycolide)

Lactide and Glycolide in the Human Body


For this work, the antisense growth factors were incorporated within a polymer.

This polymer should not cause an inflammatory response, be biodegradable, be easily

produced, and be metabolized by the body after it has released the drug. One such

polymer that can do all of this is Poly (DL-Lactide-co-Glycolide) Acid (PLGA). PLGA is

composed of two independent repeat units lactide and glycolide. When PLGA is

degraded, lactide and glycolide repeat units become lactic acid and glycolic acid. Both of

these acids are part of the Alpha Hydroxy Acid (AHA) group, and both are in some way

produced by normal metabolism the human body. For example, lactic Acid is a molecule

that comes from the breakdown of glucose during metabolism.


GLYCOLYSIS & GLUCONEOGENESIS


Figure 2-4: Glycolysis and Gluconeogenesis diagram (3,5)














OH


O

0





Figure 2-4: Lactic Acid molecule

Lactic acid is used it as an energy source. When the body begins to use its muscles,

glucose goes directly to the muscles and is converted to lactic acid. The lactic acid then

goes to liver and is converted to glucose. As to why the body does this is unclear but it

seems that lactic acid in comparison to glucose is smaller and better exchanged between

tissues. It can rapidly move across cell membranes and it is made in great amounts by the

muscles, especially during anaerobic metabolism.

Glycolic Acid on the other hand serves a different purpose inside the human body.

The body uses glycolic acid to moisturize the skin, stimulate skin turnover, exfoliate and

stimulate the generation of new skin (22,27). It is able to do this because of its very small

size.






0


H ,I K OH


Figure 2-5:Glycolic Acid molecule









Once inside the cell it will begin to cause the synthesis of new collagen and dermal

glycosaminoglycans that will help to heal the skin. Unlike lactic acid, glycolic acid seems

not to be involved in production of energy for the body and is only used by the skin.

Polymer Applications of PLGA

When lactide (the cyclic dimer of lactic acid) and glycolide (the cyclic dimer of

glycolic acid) undergo a catalytic ring opening reaction they become the copolymer

PLGA.

0o


Ladcide GCHlide l id .-cgloli d

Figure 2-6: Reaction of Lactide and Glycolide to form PLGA (38)



This copolymer is sometimes preferred over the homopolymer made from either

pure lactide or glycolide because it has more useful properties then either pure polymer.

Poly Glycolic Acid has a high melting point and low solubility in organic solvents, but it

does not become amorphous after implantation in a time frame that is necessary for many

applications in drug delivery. In contrast, DL-Poly Lactic Acid quickly becomes

amorphous after implantation. DL- Poly Lactic Acid is the optically inactive racemicc)

form of Poly Lactic acid and it has the characteristics of having low tensile strength, high

elongation, and a very rapid degradation time because of the highly irregular length of the

polymer chain. L-Poly Lactic Acid is the optically active form of Poly Lactic Acid, and it

has the properties of being semicrystalline in nature due to the high regularity of its

polymer chain (38,41). DL-Poly Lactic Acid is usually chosen because DL-Poly Lactic









Acid allows a more homogenous dispersion of the drug throughout its polymer matrix

(38,41).

PLGA can be used in many different applications, such as a drug delivery device in

the form of microspheres, nanospheres and films (18,32,38,41,44). It can be used in

wound management devices such as absorbable sutures, surgical meshes, clips, staples,

and bioadhesives. The application of PLGA in this project will be in its microsphere

form. Microspheres will be used because they should not interfere with the original intent

of the breast implant and should not create a large physical barrier during the wound

healing process.

PLGA has recently generated great interest because of its biocompatibility and its

ability to biodegrade over a period of time. PLGA can also be formulated into many

different devices and has already been approved by the FDA for drug delivery uses. This

has caused it to become a widely investigated copolymer that will allow scientists and

engineers to find more applications that will benefit society as time goes on.

Hyaluronic Acid

Hyaluronic Acid Usage by the Human Body

Hyaluronic Acid (HA) is a type of polysaccharide that is created naturally in

animals and bacteria (2,13,15,40). In fact, its structure is the same in all living organisms.

In mammals, its presence in the extracellular matrix allows the ECM bind to water, which

allows it to hydrate the skin (13,15). HA also serves a second purpose in that it is used to

lubricate joints such as knees and elbows. The reason HA is being used in this research is

because it provides a medium that is viscous, safe and should provides a more even

distribution of the PLGA/Antisense growth factor microspheres.










HA is a linear polysaccharide from the glycosaminoglycan family. It is composed

of repeating disaccharide units of D-glucoronic acid and N-acetly-glucosamine. Since

these units are not covalently bonded to proteins, the body does not generate an

immunological response to it (15).


Figure 2-6:Hyaluronic Acid repeat unit (13)

Wound Healing Applications

HA also has an additional function by playing an important role in the wound

healing process, which is derived from its physicochemical and biological properties. It

physicochemical properties are that is has large amounts of visoelasticity and its solutions

are highly osmotic. HA is highly osmotic which allow it to control tissue hydration

during the wound healing process. HA also has the ability to exclude proteins from its

matrix by steric exclusion (15). Its biological properties are that it binds to cells through

three receptors on the cell surface. The receptors are CD44, RHAMM, and ICAM-1.

CD44 is a receptor that is used for keratinocyte proliferation in response to extracellular

stimuli and maintenance of local HA homeostasis. RHAMM is receptor that is on

migrating fibroblasts and metastic tumor cells. ICAM-1 is a receptor that is only present

on the endothelial cells and macrophages. During the initial phases of the wound healing

process ICAM-1 binds to Lymphocyte function associated-1, which is an important step


COG-Na+ C"p
0 MO-: 0

HO 0 a
0" NM
C=O
CHa
Na glucuronate N-acetylGlucosamlne









in inflammatory phase (13,15). If a large amount of HA is present in the wound area

instead, ICAM will also bind to the HA molecule.

HA has been shown to accumulate in the early stages of the inflammatory phase. It

promotes migration of cells during the inflammatory phase and protects against free

radical and proteolytic damage (15). It also increases the levels of proinflammatory

cytokines TNF-a(tumor necrosis factor-alpha), IL-13 (interleukin-one beta), IL-8

(interleukin-eight) and it facilitates the primary adhesion of cytokine activated

lymphocytes to endothelium cells. In the granulation phase HA helps to facilitate cell

detachment and mitosis and it increases cell migration. HA presence in the epithelization

phase stimulates proliferation of basal keratirocytes, while during the remodeling phase

HA reduces scarring. In the extracellular matrix HA, is regulated by many growth factors

where it also provides a means for supporting cell migration and adhesion.

The amount of HA around a wound depends on the age of person. In fetal wounds,

HA appears and remains throughout the process, while in adult wounds HA appears early

and it begins to drop off as the wound is healing (36,34,40,50,54). HA seems to be able

to cause minimal fibrosis by inhibiting platelet function. It also inhibits aggregation,

cytokine release and protein synthesis, thereby decreasing the amount of collagen

produced by the dermal fibroblasts and decreasing fibrosis(37). HA is present in large

amounts during fetal wound healing, where the wounds are scar-free, but decreases

greatly in adult wound healing where the wounds are marked by scarring (40).














CHAPTER 3
MATERIALS AND METHODS

Materials

Microsphere Components

A random copolymer DL-PLGA (DL- Poly lactide co glycolide acid) with a ratio

of 50/50 lactide/glycolide (Inherent visc:0. 58dL/g in HFIP@300C) was purchased from

Birmingham Polymers, Inc (Birmingham, AL). One batch of 30 grams was used to

prepare the microspheres. This was used in conjunction with poly vinyl alcohol (87-

89%hydrolyzed, Average Mw 13,000-23,000, lot# 21702MO) purchased from Aldrich

Chemical Company (Milwaukee, WI). After the DL-PLGA microspheres were made,

they were administered along the implant surface in a Hyaluronic Acid (HA) suspension.

The Hyaluronic Acid (animal source: streptococcus zooepidemicus, lot# 120K15211)

was purchased from Sigma Aldrich (St Louis, MO).

Antisense Oligonucleotides to CTGF and TGF-l1

The 21-mer antisense CTGF whose sequence (5'

CCACAAGCTGTCCAGTCTAAF 3', Molecular weight: 6644.4Da Optical Density

59.1), that was used in the release kinetics experiment was purchased from Sigma

Genosys (The Woodlands, TX). The antisense CTGF, antisense TGF-pl and scrambled

antisense that were used in the rat experiment was provided by Isis Pharmaceuticals

(Carlsbad, CA).









Silicone Breast Implants

The silicone breast implants that were used in the rat experiments were provided by

Mentor Corporation (Irving, TX). The implant had a diameter of 1 inch and a height of .5

inch. It was filled with a silicone elastomer gel in a silicone shell.
















Figure 3-1: Type of silicone breast implant used in this study. Made by Mentor
Corporation.

Methods

"Doping" Process of Microspheres

Doping is a process of mixing fluorescein-labeled antisense oligonucleotides and

unlabeled antisense oligonucleotides at a certain ratio and diluting it with phosphate

buffer saline (PBS). The dilution values were used to create a standard curve so that the

concentrations of the samples could be determined.

The basic procedure for the doping process involved taking 39 mg of antisense

TGF-P, placing it in a small vial, adding 250 ptl of the antisense CTGF/PBS, and then

using a final vortex mixing. The vortexed solution was used to make the concentrations

100X, 50X, and 10X. Adding 50 ptl of pure PBS to the vortexed solution made a 100X

concentration. Taking 100 pl from the 100X solution and adding 100 ptl of pure PBS









made a 50X concentration. Adding 200 [tl of pure PBS to 50[tl of the 50X solution made

a 10X concentration.

Microsphere Preparation

The microsphere preparation method that was chosen for this research was a water-

oil-water (w-o-w) evaporation technique described by Hussain et al (28). This method

was chosen because it has been used previously for encapsulating antisense

oligonucleotide growth factors. Using the (w-o-w) evaporation technique the 1X solution

was made with antisense CTGF (composed of 26tlg of fluorescence labeled antisense

CTGF), which was added to 150 [tl of pure phosphate buffered saline (PBS). This

solution was then combined with 500 mg of PLGA, which was dissolved in 5 ml of

methylene chloride. The mixture was then vortexed for 5 minutes and added to 160 ml of

4% (w/v) poly vinyl alcohol (PVA). In order to allow the methylene chloride to

evaporate, the PVA was stirred at 671 revolutions per minute (rpm) for 24 hours. While

the PVA was being stirred it was open to the air. The microspheres were then pipetted

into three 50 ml polypropylene centrifuge tubes, centrifuged for 10 minutes, washed 3

times in distilled water and then freeze-dried at -500C for 48 hours using a Labconco

Freeze Dryer 4.5 (Labconco, Inc. Kansas City, MO). Then stored at 40C for later use.

Using antisense oligonucleotide CTGF, (composed of 2mg of fluorescence

labeled antisense CTGF) the 10X solution was made by combining 503mg of PLGA and

5ml of methylene chloride. The mixture was then vortexed for 5 minutes and added to

160 ml of 4% w/v PVA. To allow the methylene chloride to evaporate; the PVA was

stirred at 680 rpm for 24 hours. The microspheres were then pipetted into three 50ml

polypropylene centrifuge tubes, centrifuged for 10 minutes, washed 3 times in distilled









water and then freeze-dried at -500C for 48 hours using a Labconco Freeze Dryer 4.5

(Labconco, Inc. Kansas City, MO). Then stored at 40C for later use.

The 50X solution was created by combining 497mg of PLGA and 5 ml of

methylene chloride. The mixture was then vortexed for 5 minutes and added to 160 ml of

4% w/v PVA In order to allow the methylene chloride to evaporate; the PVA was stirred

at 681 rpm for 24 hours. The microspheres were then pipetted into three 50ml

polypropylene centrifuge tubes, centrifuged for 10 minutes, washed 3 times in distilled

water and then freeze-dried at -500C for 48 hours using a Labconco Freeze Dryer 4.5

(Labconco, Inc. Kansas City, MO). Then stored at 40C for later use.

The 100X solution was created by combining 503 mg of PLGA and 5 ml of

methylene chloride. The mixture was then vortexed for 5 minutes and added to 160 ml of

4% w/v PVA In order to allow the methylene chloride to evaporate; the PVA was stirred

at 674 rpm for 24 hours. The microspheres were then pipetted into three 50 ml

polypropylene centrifuge tubes, centrifuged for 10 minutes, washed 3 times in distilled

water and then freeze-dried at -500C for 48 hours using a Labconco Freeze Dryer 4.5

(Labconco, Inc. Kansas City, MO). Then stored at 40C for later use

Fluorescent Spectroscopy and UV-VIS Spectroscopy Analysis for Microsphere
Release Kinetics Study

The release of the antisense CTGF from PLGA microspheres was determined

with the use of an ultraviolet-visible (UV-VIS) Spectrophotometer (UV-2401 PC,

Shimadzu Scientific Instruments, Inc. Columbia, MD.) The UV-VIS spectrophotometer

measurements gave initial data of the release kinetics but the overall loading of the

microspheres was too low to cause a biological effect so the antisense CTGF was

increase by a factor of 10 times (10X) conc: 13.33 mg/ml, 50 times (50X) conc:









66.67mg/ml, and 100 times (100X) cone: 133 mg/ml the initial concentration (IX)

conc:02 mg/ml. These increase concentrations of antisense were more than what was

available, so an unlabeled antisense TGF-0 was used in conjunction with the fluorescein

labeled to develop new sets of doped microspheres. Unlabeled TGF- 0 was used because

it has about the same molecular weight as the fluorescein labeled antisense CTGF and

thus would not affect the release kinetics during experimentation. The release of

antisense CTGF from the "doped" microspheres was measured with a Fluorescent

Detector (Mithras LB940, USA).

SEM Analysis for Particle Characterization

A field emission gun scanning electron microscope (FEG-SEM JEOL JSM-6335F,

Jeol, MA, USA) was used to take pictures of the microspheres and to determine whether

the antisense growth factor had an effect on the physical appearance at the differing

microsphere concentrations (1X, 10X, 50X, and 100X).

Particle Sizing for Particle Characterization

Laser light scattering (Coulter LS230, USA) was used to determine whether

antisense growth factor loading had an effect on particle size. The differing microsphere

concentrations (1X, 10X, 50X, and 100X) were freeze-dried, dispersed in distilled water

and the size distribution was determined using laser light scattering. The laser light

scatter was used twice for each of the differing microsphere concentrations in order to

verify any changes in the particle sizes.

Total Amount Incorporated into Microspheres

Fluorescent spectroscopy was used to determine the total amount of antisense

CTGF in a 20 mg sample obtained from each of the differing microsphere concentrations

(1X, 10X, 50X, and 100X). The microsphere samples were dissolved into a solution









composed of 2.5 ml of methylene chloride and 2ml of the PBS solution. Then the

mixtures individually were stirred using a magnetic plate for 1 hour and centrifuged at

13400 rpm for 10 minutes. After centrifugation, the PBS supernatant was pipetted into a

polypropylene centrifuge tube and the concentrations of antisense CTGF were

determined using a fluorescent spectroscopy. Fluorescent spectroscopy was used three

times for each of the differing microsphere samples in order to verify the concentrations

of antisense CTGF in each sample.

Release Profiles for Microspheres

An UV Spectrophotometer set at 494 nm was used to determine the amount of

antisense CTGF that was released from three 50 mg samples of the 1X microsphere

concentration. The IX microsphere samples were dispersed in 1 ml of PBS with 0.1%

sodium azide and rotated in a hybridization incubator (Robbins Scientific Model 400,

USA) at 37C. At various time intervals (30 minutes, 2 hour, 4 hours, 8 hours, 24 hours,

48 hours, 7 days, and 24 days) the samples were removed from the incubator and

centrifuged at 13400 rpm for 8 minutes to separate the microspheres from the suspension.

The supernatant was then withdrawn and replaced with equal amounts of PBS, which

allowed for a new measurement of the antisense oligonucleotide CTGF concentration

within the microspheres at the various time intervals. The UV Spectroscope was used the

microsphere samples in order to obtain an average concentration of antisense

oligonucleotide CTGF released from each sample.

Fluorescent spectroscopy was used to determine the amount of antisense

oligonucleotide CTGF that was released from 50 mg samples of the 50X microsphere

concentration. The 50X microsphere samples were dispersed in 1 ml of PBS with 0.1%

sodium azide and rotated at 20 rotations per minute in a hybridization incubator (Robbins









Scientific Model 400, USA) at 370C. At various time intervals (30 minutes, 2 hour, 4

hours, 8 hours, 24 hours, 48 hours, 7 days, and 24 days) the samples were removed from

the incubator and centrifuged at 13400 rpm for 8 minutes to collect the microspheres

from the suspension. The supernatant was then withdrawn and replaced with equal

amounts of PBS, which allowed for a new measurement of the antisense CTGF

concentration within the microspheres at the various time intervals. Fluorescent

spectroscopy was used three times for each of the differing microsphere samples in order

to obtain an average concentration of antisense oligonucleotide CTGF released from each

sample.

ThelX microsphere samples had its release kinetics determined because it was the

original set of microspheres made. Once its release kinetics was determined, it was

shown that the concentration level of antisense in the microspheres would not be enough

to cause a biological effect in an animal model. It is unknown how much antisense is

actually needed to cause a biological effect in an animal model. To ensure that a

biological effect happens, it is necessary to have the highest concentration of antisense

possible incorporated in the microspheres. This then lead to the experiment of increasing

the amount of antisense used in the microspheres by 10X, 50X, and 100X. After the 10X,

50X and 100X microspheres were made; the concentration levels of the antisense were

determined. These levels showed that the 50X microspheres had the greater probability

of having the highest concentration of antisense incorporated in the microspheres. This

caused the 50X microspheres to have its release kinetics determined. The 50X

microsphere procedure was then used to make the microspheres for the animal study









Microsphere Preparation for an Animal Study

The rat experiment used three different types of antisense: 1) antisense CTGF 2)

antisense TGF- 1p 3) scrambled antisense. The antisense CTGF microspheres were made

by combining 11 mg of antisense oligonucleotide CTGF to 150[tl of PBS. This mixture

was then vortexed until the antisense CTGF was dissolved. Then the PBS/antisense

CTGF solution was added to a solution of 508 mg of PLGA and 5ml of methylene

chloride. The mixture was then vortexed for 5 minutes and added to 160 ml of 4% w/v

PVA. In order to allow the methylene chloride to evaporate, the PVA was stirred at 691

rpm for 24 hours. The microspheres were then pipetted into three 50ml polypropylene

centrifuge tubes, centrifuged for 10 minutes, washed 3 times in distilled water and then

freeze-dried at -500C for 48 hours using a Labconco Freeze Dryer 4.5 (Labconco, Inc.

Kansas City, MO). Then the microspheres were then stored at 40C for later use.

The antisense TGF-31 microspheres were made by combining 1 1mg of antisense

TGF-pl with 150[tl of PBS. This mixture was then vortexed until the antisense TGF-pl

was dissolved. Then the PBS/antisense TGF-1 solution was added to a solution of 501

mg of PLGA and 5ml of methylene chloride. The mixture was then vortexed for 5

minutes and added to 160 ml of 4% w/v PVA. In order to allow the methylene chloride

to evaporate, the PVA was stirred at 691 rpm for 24 hours. The microspheres were then

pipetted into three 50 ml polypropylene centrifuge tubes, centrifuged for 10 minutes,

washed 3 times in distilled water and then freeze-dried at -500C for 48 hours using a

Labconco Freeze Dryer 4.5 (Labconco, Inc. Kansas City, MO). Then the microspheres

were stored at 40C for later use.









The scrambled antisense microspheres were made by combining 13 mg of

antisense CTGF to 150 [tl ofPBS. This mixture was then vortexed until the antisense

CTGF was dissolved. Then the PBS/scrambled-antisense solution was added to a

solution of 504 mg of PLGA and 5 ml of methylene chloride. The mixture was then

vortexed for 5 minutes and added to 160 ml of 4% w/v PVA. In order to allow the

methylene chloride to evaporate, the PVA was stirred at 691 rpm for 24 hours. The

microspheres were then pipetted into three 50ml polypropylene centrifuge tubes,

centrifuged for 10 minutes, washed 3 times in distilled water and then freeze-dried at -

500C for 48 hours using a Labconco Freeze Dryer 4.5 (Labconco, Inc. Kansas City, MO).

Then the microspheres were stored at 40C for later use.

Rat Study

Twenty female Sprague Dawley rats with an average weight of 250 grams were

implanted with two silicone implants each. Each implant had a diameter of 1 inch and a

height of 0.5 inches. Before each surgery, the implants were sterilized by steam

autoclaving and the backs of the rats were shaved and sterilized using 70% ethanol and

betadine. The rats were then randomly assigned to one of into five groups with four rats

per group: 1) Control-no Microspheres 2) 0.5 ml of hyaluronic acid (HA), 3) antisense

TGF-p1/PLGA microspheres in 0.5ml of HA 4) antisense CTGF/PLGA microspheres in

0.5ml of HA 5) scrambled/PLGA microspheres in 0.5ml of HA.

Table 3-1: The 20 rats in this experiment divided into four groups
Substance used in rats Rat #
HA 5, 6, 7,8
Antisense TGF-l1/HA 9, 10, 11, 12
Antisense CTGF/HA 13, 14, 15, 16
Scrambled Antisense/HA 17, 18, 19, 20
Control 1, 2, 3, 4









During surgery, a 3 inch incision was made near the scapula and ilium on the back

of each rat. The implants were placed through the incisions under the dermis and above

the pannaciulosus carnous muscle. To obtain an even distribution of microspheres around

the implant, 400 mg of each microsphere group was added to 10 ml of 1% (w/v) HA

solution.

One week and two weeks after the surgeries were completed,2 rats from each

experimental group were sacrificed. The implants were rejected from each rat and the

bottom half of the capsule was removed along with an 8 mm skin section of the top half

of the capsule. Skin taken from the top part of the capsule was later cut in half. One half

of the skin was placed in formalin and processed for paraffin sections for histology and

the other half with the bottom part of the capsule was analyzed for levels of CTGF and

TGF-p31 using an ELISA assay.

Homogenizing of Rat Tissue for use in the ELISA Assay

The growth factors within the tissue samples had to be extracted to be able to

utilize the ELISA assay. A solution of PBS with 1% Triton (100X) was used to extract

the growth factors. The procedure began with a sample of the top or bottom part of the

capsule in a ground glass on glass homogenizer. A 0.5 ml solution of PBS/ Triton buffer

was used for the top part and a 1 ml solution of PBS/Triton buffer was used for the

bottom part of the capsule. The tissue samples were ground in the homogenizer crucible

for 8 minutes, centrifuged for 5 minutes at 10,000 x g, the supernatant solution placed in

a vial, and stored at -800C for future use.

CTGF ELISA Used in Rat Study

The CTGF ELISA assay was performed with a 96 well plate with each well coated

with 50 ptl of goat anti-human CTGF antibody diluted with IX PBS and sodium azide









from 12 mg/ml to a 10 tg/ml concentration. The antibody was then removed out and the

plate was washed four times using a wash buffer comprised of PBS, 0.01% (w/v) sodium

azide, and 0.05% (w/v) Tween 20. After the plate was washed, each well was filled with

300 tl of a blocking buffer solution consisting of 1% (w/v) bovine serum albumin, PBS,

and sodium azide. The well then remained at room temperature for 1 hour and

subsequently the serum solution was pipetted out and the plate was washed four times

with the wash buffer solution.

After the plate was washed, 50 .il of the samples and standards were added to the

plate. The standard CTGF concentrations added to the plate were 100 ng/ml, 50 ng/ml,

10 ng/ml, 5 ng/ml, 1 ng/ml and 0.1 ng/ml. Once the standards and samples were added to

the plate, the plate was incubated at 370C for 1 hour. After 1 hour the contents in the

plate were pipetted out and the wells were washed four times with the wash buffer

solution.

Once the plate was washed, a 50 pl of biotinylated goat anti human CTGF antibody

with a concentration of 2 tg/ml was added to each well. The plate was then sealed and

placed in a dark area for 1 hour. After 1 hour the wells were pipetted out and washed

four times with the wash buffer solution. A 100 .il of alkaline phosphate substrate

(Sigma N2765: One 20mg p-nitophenyl phosphate tablet dissolved in 20 ml carbonate

and bicarbonate buffer at pH 9.6) was added to each well and the plate was then

incubated at 370C for 30 minutes. After 30 minutes, a plate reader (Thermo Max, USA)

was used at 405 nm to determine the absorbance of each well. The absorbance

measurements were later converted to concentration. Then the samples underwent

analysis by a BCA protein assay in order to normalize the samples to ng/mg protein.









TGF-1 ELISA used in Rat Study

The TGF-1 ELISA Assay (purchased from Promega, Madison, WI) was

performed with a 96 well plate. Each well was coated with 100l of a TGF-1 Goat m-

antibody and a carbonate coating buffer solution, which remained at 40C overnight. The

antibody solution was then pipetted out and each well was subsequently filled with 270l

of a blocking buffer solution consisting of bovine serum albumin, PBS, and sodium

azide. Then the plate was incubated at 370C for 35 minutes. After 35 minutes the

blocking buffer solution was pipetted out and washed four times using a wash buffer

comprised of PBS, sodium azide, and Tween 20.

Before the samples were added to the washed plate, they were acid treated. The

acid treatment process was necessary because TGF-1 is processed in vivo from a latent

form to the bioactive form of the protein. Only the bioactive form is detected by the

ELISA process. Thus, the acid treatment in vitro mimics the in vivo activation of the

protein. (1). To acid treat the samples 20 [il from each sample was diluted in 80l of

PBS and 1% Triton with 2 [l of IN HCL to lower the pH. After diluting the samples, the

samples remained at room temperature for 15 minutes. A 2 [il solution of IN NaOH was

then added to each sample to obtain a pH of 7.6, will not destroy the antibodies.

Once the samples were acid treated and the plate was washed, 100 [il of the

samples and standards were added to the plate. The standards concentrations added to

the plate were 1000 pg/ml, 500 pg/ml, 250 pg/ml, 125 pg/ml, 62 pg/ml, 31 pg/ml, 15.6

pg/ml, and 0.0 pg/ml. The standards and samples were added to the plate, the plate was

incubated at 370C for 90 minutes. After 90 minutes the contents in the plate were

pipetted out and the wells were washed four times with the wash buffer solution. A 50 il









of an anti-TGFp p-antibody was then added to each well of the washed plate. The plate

then remained at room temperature for 2 hours. After 2 hours the contents in the wells

were pipetted out and washed four times with the wash buffer solution. A 100Cl of TGFP

HRP conjugate was then added to each well of the washed plate and the plate remained at

room temperature for 2 hours. After 2 hours, the TGFP HRP Conjugate was pipetted out

from the wells and washed four times with the wash buffer solution. The final step

required the addition of a 100 pl of TMB One Solution to each well of the washed plate

and the plate remained at room temperature for an additional 30 minutes. After 30

minutes, 100 .il of IN NaOH was added to each well to stop the chemical reaction. Once

the chemical reaction was ceased in each well, a plate reader (UVT 06045,Thermo Max,

USA) was used at 450 nm to determine the absorbance of each well. The absorbance

measurements were later converted to concentration. Then the samples underwent

analysis by a BCA protein assay in order to normalize the samples to pg/mg protein.
















CHAPTER 4
RESULTS AND DISCUSSION

Microsphere UV-VIS Spectrophotometer Analysis

1X microsphere release kinetics

To use a UV-VIS spectrum, an absorption peak had to be determined. Figure 4-1

and 4-2 shows the absorption peak for this study. Figure 4-1 shows a spectrum analysis of

PBS without the antisense CTGF attached to a fluorescein molecule. Notice there is a

single peak in the spectrum. Figure 4-2 shows the absorption spectrum of PBS with

CTGF attached to a Fluorescein molecule. The spectrum follows figure 4-1 except for the

absorption peak around 494nm. That absorption peak represents the fluorescein molecule.

That wavelength was used to detect the antisense CTGF concentration in the 1X

microspheres release profile.


PBS Solution Spectrum

6-
5

0
=3
2


0
M '1- I 0 LO IN G 0 0 M 0 -Wavele '- CO (n) 'N
Wavelength (nm)


Figure 4-1: Absorption Spectrum of PBS solution












Anti Sense Oligonucleotide in PBS Solution Spectrum

6

5

4

*.
<3
0


1

0
C ( cN cc -I 0 (0 cN 0 'IT 0 (0 CN 0c 'IT 0 (0 CN cc 'I
C 0 ( -) N T 1- 0r ) N 0 1- 0 CN ) c 0 o 0 U cc
-11 C Cl C C CO C CO %" U) Ul U)O U) (D (D (l ("

Wavelength (nm)



Figure 4-2: Absorption peak of PBS solution with fluorescein labeled antisense CTGF

Figure 4-3 shows the percent release of the antisense from the microspheres vs.


time. Average values were used and error bars were not added to the graph in order to


simplify and emphasize the overall release profile of the microspheres. The release


profile of antisense from the microspheres began with a burst effect that lasted for 4 hrs


and then a lag phase, in which there was very little release of the antisense until the 7th


day. After the 7th day, the microspheres had a secondary release phase when more


antisense CTGF was released. The experiment lasted until the 24th day where 89% of all


the antisense CTGF encapsulated in the microspheres had been released.



S100
80 -
S60
40
2 0

0 10 20 30
Time (Days)


Figure 4-3: Percent Release Profile of 1X microspheres












A possible explanation as to why there was a burst effect is that the majority of the

antisense CTGF was on the surface of the microspheres (53,56). When the microspheres

were put in solution all the antisense on the surface was immediately released. This could

have happened because in this procedure a small amount of antisense CTGF and a large

amount of PVA was being used. The PVA surfactant may have prevented the antisense

from penetrating deeply within the polymer matrix and may have forced a majority of the

antisense to deposit on the surface (7,14,17,18).

Another possible explanation is that there are pores on the microspheres surface.

Having pores probably allowed more solution to penetrate the polymer matrix than was

anticipated (53). Table 4-1 shows the amount of antisense released at each time point and

the average value and the standard deviation.

In table 4-1, the amount between the 8hr and 48hr are shown to be constant. An

explanation is that since a very low amount of antisense CTGF was used, the UV-VIS

detection reached a limit where it could not detect the amount of antisense CTGF in the

PBS solution.

Table 4-1: Cumulative antisense CTGF released from IX microspheres during
experiment (in mg). For each trial 50mg of microspheres were used.
Time Triall Trial2 Trial3 Average
0 0 0 0 0
30 min 0.009 0.006 0.007 0.007+. 0015
2 hr 0.011 0.009 0.010 0.010+. 0009
4 hr 0.011 0.011 0.011 0.011+. 0002
6 hr 0.012 0.011 0.012 0.012+. 0005
8 hr 0.012 0.012 0.012 0.012
24 hr 0.012 0.012 0.012 0.012
48 hr 0.012 0.012 0.012 0.012
7 days 0.0126 0.013 0.013 0.013+. 0002
24 days 0.0132 0.013 0.014 0.013+. 0005











Microsphere Release Data from Fluorescent Detector

Microsphere Encapsulation Experiment

Two different experiments were performed using fluorescent spectroscopy: finding

the total amount of antisense CTGF encapsulated in each set of microspheres and the

release kinetics of the 50X microspheres. Figure 4-4 shows the amount of antisense

oligonucleotides was encapsulated in the microspheres as the loading increased. Average

values were used and error bars were not added in order to show the general profile of

microspheres.


10
9
8
*t 0
5 S' 7




o2i 3
1^ 2
< 1
n


2.7

0.3


0 20 40 60 80 100 120
Concentration of antisense




Figure 4-4: Amount encapsulated in PLGA microspheres as loading of antisense CTGF
increases

Although the average values do indicate the 50X microspheres encapsulate more

antisense than the 100X microsphere, the standard deviation indicates that the differences









are not significant. Table 4-2 shows that in trial 1 the 100X microspheres had the most

encapsulated, in trial 2 they were both the same and in trial 3 the 50X had the most

encapsulated.

Table 4-2: Amount of encapsulated antisense CTGF (in |tg of antisense/mg of
microspheres) in microspheres. For each trial 20mg of microspheres from
each loading factor was used.
Concentration Trial 1 Trial 2 Trial 3 Average
100X 8.3 8.1 7.4 7.9 +. 4
50X 8.1 8.1 8.8 8.3 +. 5
10X 3.0 2.5 2.7 2.7 +. 2
1X 0.3 0.2 0.3 0.3 +. 04


A theory as how this could happen is the amount of PVA used. PVA is used

because during the (w/o/w) method it acts as a surfactant to prevent the microspheres

from aggregating as they are being stirred. The surfactant also serves as something to

prevent proteins from penetrating the surface of the polymer as the microspheres are

being stirred in the PVA. Since 4% PVA was used, it probably prevented a significant

amount of antisense present in the solution from entering the polymer.

This data was also able to provide the percent encapsulation efficiency of the

microspheres. This data is shown in table 4-3. The results were expected; as more

antisense was added to the microspheres a lower percentage was encapsulated. While the

1X microspheres had 89% encapsulation efficiency they did not have a higher absolute

loading than the 100X microspheres, which had 23% encapsulation efficiency. The data

shows that the 50X microspheres provided the greatest chance of having the most

antisense encapsulated. Therefore the 50X microspheres were selected to be used in the

animal model and to have release kinetics measured in vivo.









Table 4-3: Encapsulation efficiency of microspheres
Concentration Theoretical Amount Actual Amount
Loaded ([tg) Loaded ([tg)
100X 34.6 7.9
50X 16.8 8.3
10X 4.3 2.7
1X 0.3 0.27


Encapsulation
Efficiency (in %)
23%
50%
63%
89%


50X Release Profile Experiment

Figure 4-5 shows the percent release of the 50X microspheres. The profile began

with a burst effect that lasted for about 8hrs and a moderate lag phase between the 24 and

48hr point. After the 48 hr point, it underwent a secondary release that continued until the

24th day where 72% of all the antisense encapsulated was released. The amount released

is shown in table 4-4.


80
70




S640

^ 2 30
2 0 20
10
10
0


0 5 10 15 20
Time (Days)


Figure 4-5: Percent Release profile of 50X microspheres









Table 4-4: Cumulative antisense CTGF released from 50X microspheres during
experiment (in mg). For each trial 50mg of microspheres were used.
Time Trial 1 Trial 2 Trial 3 Average
0 0 0 0 0
32 min 0.03 0.03 0.02 0.03 +. 01
2 hrs 0.05 0.08 0.05 0.06 +. 02
4 hrs 0.09 0.11 0.08 0.09 +. 02
6hrs 0.11 0.12 0.11 0.11 +.01
8 hrs 0.15 0.17 0.15 0.15 +. 01
24 hrs 0.18 0.21 0.18 0.19 +.02
48 hrs 0.19 0.23 0.20 0.21 +. 02
7 days 0.21 0.26 0.22 0.23 +. 02
24 days 0.28 0.32 0.28 0.29 +. 02



Figure 4-6 shows the effects of increased antisense loading on release kinetics. It

directly compares the amount of microspheres released from the 50X and 1X

microspheres. It uses the average values to illustrate how the release kinetics was

changed as the loading was increased. The IX curve basically reaches a value and levels

off while the 50X continues to increase.


0.35

0.3

0.25

- 0.2

b 0.15

S 0.1

0.05

0


-.-50X


0 5 10 15 20 25


Time (Days)


Figure 4-6: Comparison of total release vs. time of 50X and IX microspheres









Particle Characterization of PLGA Microspheres

Particle Sizing of Microspheres

Figures 4-7 through 4-10 show the size distribution of all the microsphere batches.

Overall, the microspheres all had similar particle size distribution that ranged peaked

from, 60 |tm and 100 |tm. The only set of microspheres that did not fall within this range

is the 1OX microspheres.





14

12
"----f


IU

8
E
I 6

4

2

n


v Parti cle Diam r ()
Particle Diameter (urn)


Figure 4-7: Particle Characterization of 100X microspheres






41














12

10

(D 8
E
-6

S 4

2



Pril eNO) N C b rm

Particle Diameter (um)


Figure 4-8: Particle Characterization of 50X microspheres






42













6

5

4
E
z 3

2

1





Particle Diameter (um)


Figure 4-9: Particle Characterization of 10X microspheres






43











12

10

8

E 6

> 4




0 -O-- Y--30--
-2 oo- ame- co
Particle Diameter (um)


Figure 4-10: Particle Characterization of IX microspheres



























U -- --I I
-22
-2 0 50 100 150 200 21
Particle Diameter (um)


B)











0 500 1000 1500 2000 2500


Particle Diameter (um)


Figure 4-11: Size distribution of microspheres:A) Size comparison of all microsphere
batches from 0-200 um B) Size comparison of all microspheres from 0-
2000um


I


100X
50X
10X
1X



iO









--100X
-50X
10X
1X











SEM Characterization of microspheres

Figures 4-12 through 4-15 shows the SEM pictures of the different microsphere

batches. The micrographs show that regardless of the amount of antisense CTGF present

the morphology and topography remained the same. An interesting feature of the

microspheres is that the surfaces of the microspheres show pores. This characteristic is

present on all the microspheres, and may lead to an enhanced burst effect because it

allows the solution to enter the polymer matrix faster than it would normally be able to

(54).


Figure 4-12: SEM pictures of 100X Microspheres at 5KeV, working distance =14mm
A) 25x. Size bar =lmm B) 200x. Size bar = 100lm C) 1500x. Size bar =
10rtm








































Figure 4-12: Continued

































































Figure 4-13: SEM pictures of 50X Microspheres at 5KeV, working distance 14mm
A) 25x. Size bar =lmm B) 200x. Size bar = 100lm C) 1500x. Size bar
10pm


11 I ,Ohv 0"11 1-1.1























































Figure 4-14: SEM pictures of 10X Microspheres at 5KeV, working distance 14mm
A) 25x. Size bar =lmm B) 200x. Size bar = 100OOm C) 1500x. Size bar
10pm


































































Figure 4-15: SEM pictures of 100X Microspheres at 5KeV, working distance 14mm
A) 25x. Size bar =lmm B) 200x. Size bar = 100lm C) 1500x. Size bar =
10pm


i msrfc









MIR: XI 90 10p W1, ..1iOiO









In vivo results

Surgical procedure

Figures 4-16 through 4-19 show some of the methods used and results from the rat

surgery. Figure 4-16 show how the microspheres were injected into the rats and the

template used to determine where the implants were going to be placed. Figure 4-17

show the procedure of injecting the HA and microspheres. Figure 4-18 shows some of the

capsules that developed after the surgery. Figure 4-19 also show some of the capsules

that developed and how the skin was taken for analysis. The capsules appeared to be very

thin regardless of the test materials added around them. ELISA was to determine what

type of effect the test materials had on the growth factors CTGF and TGF-P31.


Figure 4-16: Pictures from rat surgery A) The syringes used to deliver microspheres and
HA B) Template used to determine incision location in animal experiment
(areas marked with sharpie marker)
























































Figure 4-17: Surgical procedure from rat surgery: A) and B) Microspheres/HA injected
C) Incisions closed with staples





52
































A /

Figure 4-18: Implant placement after surgery: A) Normal position of implants after
surgery, B) and C) After one implant migrated during experiment.
































7


Figure 4-19:Capsules formed after experiment: A), B) and C) Different capsules formed
around implants after 1 and 2 weeks















A


Figure 4-20: Capsule formed after surgery and surgical procedure: A) Capsule after 1 and
2 weeks B) Capsule after movement of implant occurred C) Picture of how
the skin was taken for ELISA analysis.









ELISA CTGF Assay Results

The results from the CTGF ELISA are shown in figures 4-20 through 4-23. They

mark the release of the growth factor CTGF from the skin and the bottom of the capsule

for of period of 1 and 2 weeks.

The results from the first week were that the control had the largest amount of

CTGF present and the antisense CTGF had lowest values of CTGF. A surprise from the

first week was the HA alone and the scrambled antisense oligonucleotide also were also

able to decrease the amount of CTGF present in the system.

This was an unexpected result because at the time of experimental set-up it was

known that HA would have an influence on fibrosis but it was not known how it would

affect CTGF and TGF-pl(13,24,30,40). Since the HA was able to have in effect, it

probably had an effect on the levels of CTGF in the other test materials used.

The scrambled antisense result was more interesting because, it is only supposed to

be a random antisense oligonucleotide sequence. Not only did the scrambled cause a

decrease in CTGF it was also able to cause implant migration like in figure 4-18 C. There

are several reasons why this might be happening. For example, one reason could be the

presence of lactic acid and glycolic acid that was being released from the microspheres

(12,27). However, studies have shown that lactic and glycolic acid increases the presence

of collagen rather than reduces it (6,9,15,22,31). There are also no reports of PLGA

materials causing movement in other implants. Unfortunately, in some cases scrambled

antisense does have an influence on the surrounding tissue and this fact invites future

analysis. There are several types of scrambled oligonucleotides available, and some have

been known to retain some activity (25).








After week two, the results remained the similar as the previous week. Only in this
case the HA and the antisense CTGF had the lowest levels of CTGF. The ANOVA

results are shown in Appendix C. The ANOVA results of CTGF levels during weekly had
p= 0.003 for the skin and p=0.0343 for the bottom of the capsule. During week: p=0.039

for the skin and p=0.0038 for the bottom of the capsule.



CTGF Levels in skin Week 1


27



19



11
A.S. CTGF


A.S. TGF-B1


Control
GROUP


Scrambled


Figure 4-21: Levels of CTGF in the skin around the implant from week l(ng of
CTGF/mg protein). (* = migration)


F




















CTGF Levels in bottom of capsule- Week 1


A.S. CTGF A.S. TGF-B1


Control
GROUP


Scrambled


Figure 4-22: Levels of CTGF from the bottom of the implant capsule from week 1 (ng of
CTGF/mg protein). (* = migration)
















CTGF Levels in skin Week 2


A.S. CTGF


A.S. TGF-B1


Control
GROUP


Figure 4-23: Levels of CTGF in the skin around the implant from week 2 (ng of
CTGF/mg protein). (*= migration)


Scrambledt


-1.


J- ..n_


















CTGF Levels in bottom of capsule Week 2


A.S. CTGF


A.S. TGF-B1


Control
GROUP


Scrambled'


Figure 4-24: Levels of CTGF from the bottom of the implant capsule from week (ng of
CTGF/ mg protein). (* = migration)


Cg




H-
8"
u
0
HF
Q


I




tIJ







60


ELISA TGF-1 Assay Results

The TGF-31 levels from the rat experiment are shown in figures 4-24 through 4-27.

All the test groups were statistically the same in both weeks 1 and 2 when the TGF-31

concentrations from the test groups were analyzed using ANOVA. An explanation for

this could be because TGF-1 unlike CTGF is used in a variety of functions that do not

necessary relate to the development of fibrosis, for example, it is used during the process

of inflammation and DNA synthesis (37,48,49,52). Since a large foreign object is present,

the body will induce inflammation, DNA synthesis, and fibrosis. This requires great

amounts of TGF-1 and these amounts probably were so great that the microspheres

were unable to cause a biological effect.


TGF-B1 Levels in skin Week 1


A.S. CTGF* A.S. TGF-B1 Control
GROUP


Scrambled


Figure 4-25: Levels of TGF- 31 from the skin from week 1 (pg of TGF- 31 / mg protein).
(* = migration)





61



TGF-B1 Levels in bottom of capsule Week 1


Control
GROUP


Scrambled


Figure 4-26: Levels of TGF-P31 from the bottom of the implant capsule from week 1 (pg
of TGF-P 3/ mg protein). (* = migration)


A.S. CTGF= A.S. TGF-B1


~I

















TGF-B1 Levels in skin Week 2


1140





880





620





360





100
A.


S. CTGF


A.S. TGF-B1


Control
GROUP


Scrambled'


Figure 4-27: Levels of TGF-31 from the skin from week 2 (pg of TGF-pl/mg protein).
(* = migration)


T r








63













TGF-B1 Levels in bottom of capsule Week 2


A.S. TGF-B1


Control
GROUP


Scrambled"


Figure 4-28: Levels of TGF-P31 from the bottom of the implant capsule from week 2 (pg
of TGF- 31/ mg protein). (* = migration)


1790





1350





910





A711


30
A.


S. CTGF














CHAPTER 5
CONCLUSION AND FUTURE WORK

Microsphere Development

Microspheres of DL-PLGA (DL-poly lactide glycolide acid) containing antisense

oligonucleotides were made using the water-oil-water (w/o/w) evaporation method. The

overall loading of the microspheres was too low to cause a biological effect initially so

the antisense CTGF was increase by a factor of 10 times (10X), 50 times (50X), and 100

times (100X) the initial concentration (1X). As the amount of antisense CTGF increased,

the amount released from the microspheres increased as expected. The 50X microspheres

had the greater probability of having the highest concentration of antisense incorporated

in the microspheres. The 50X microsphere procedure was then used to make the

microspheres for the animal study.

Particle Characterization and release kinetics were determined using UV and

Fluorescent Spectroscopy, SEM Microscopy, and Light Laser Diffraction Particle Sizing.

It was shown that antisense CTGF loading does not affect the particle size, which peaked

between 60-130[tm nor the physical appearance of the microspheres. The microspheres in

general had holes along generally smooth surfaces.

Implantation

Twenty female Sprague Dawley rats with a weight of 250grams were implanted

with two silicone implants. The rats were then divided into five groups: 1) Control-no

Microspheres 2) hyaluronic acid (HA), 3) antisense TGF- 1/PLGA microspheres in HA

4) antisense CTGF/PLGA microspheres in HA 5) scrambled antisense









oligonucleotide/PLGA microspheres in HA. One week and two weeks after the surgeries

were completed, respectively, 10 rats were sacrificed. The implants were rejected from

each rat and the bottom half of the capsule was removed along with a 8mm skin section

of the top half of the capsule. The sections were then homogenized and analyzed for

levels of CTGF and TGF-pl using the ELISA Assay. The CTGF ELISA Assay results

when analyzed using ANOVA showed that CTGF levels were decreased for the first

week when the capsule was exposed to HA, antisense TGF-pl, antisense CTGF, and the

scrambled antisense. For the second week the CTGF ELISA Assay result when analyzed

using ANOVA showed that the levels of CTGF began to normalize and there was no

significant difference between the test groups.

The TGF-pl ELISA Assay results, when analyzed using ANOVA, showed for both

weeks 1 and 2 that there was no difference between the test groups. The results from the

TGF-pl ELISA Assay could have been influenced on the amount of TGF-P31 present in

around the capsule. Since TGF- 31 is used in a variety of functions other than fibrosis and

capsule formation, its levels were probably so high that the amount of antisense TGF-pl

present was not enough to change its levels.

We conclude that controlled release of antisense CTGF can reduce CTGF

expression and hence will reduce scarring.

Future Work

The microspheres and rat experiments used in this project are just a first step in the

development of a drug delivery method that may eventually be used to reduce capsular

contraction or other applications in the human body.









Microspheres-Future Work

Extensive research into increasing the incorporation and release of the antisense

oligonucleotides. Extensive testing of other type of microspheres to determine if PLGA is

the best substance to use in microsphere development


Microspheres-Future Uses

Eventually use microspheres to decrease the probability of capsular contracture.

Develop microspheres incorporating antisense oligonucleotides for other problems where

less fibrosis is desired


Rat Animal Experiment-Future Work

Increase time of experiment to determine whether the current microsphere method

can decrease CTGF and TGF-P31 for longer periods of time. Eventually move up to an

rabbit animal model and test microspheres since rabbits are more similar to humans for

capsular development. More extensive research into the uses and effect of Hyaluronic

Acid on CTGF, TGF-pl, and the wound healing process in general. Improve

standardization of microsphere injection along the implant shell.















APPENDIX A
STASTICTICAL ANALYSIS OF MICROSPHERE PARTICLE DISTRIBUTION


Table A.1: Particle sizing statistical data for 100X microspheres


COULTER LS
File name:
Group ID:
Instrument:
Volume
Mean:
Median:
D(3,2):
Mean/Median Ratio:


100X
11.$07
100X
LS 230, Small Model


Mode:
S.D.:
Variance:
C.V.:
Skewness:
Kurtosis:
d10:
d50:
d90:
Specific Surf. Area:
%<


Size


4.89
28.3
56.76
75.01
83.81


Size


1
10
100
1000


Volume
100
51.06
56.76
7.535
0.9
80.07
28.15
792.4
55.12
-0.405
-1.045
4.89
56.76
83.81
7963


5.47
13.3
99.7
100













Table A.2: Particle sizing statistical data for 50X microspheres


COULTER LS
File name:
Group ID:
Instrument:
Run number:
Run length:
Optical model:
Obscuration:
PIDS Obscur:
Obscuration:
Serial Number:


50X
50X.$01
50X
LS 230, Small Volume Module
1
91
Fraunhofer.rfd PIDS included
8
47
OK


From
To
Volume
Mean:
Median:
D(3,2):
Mode:
S.D.:
C.V.:
Skewness:
Kurtosis:
d10:
d50:
d90:
Specific Surf. Area:


Size


0.04
2000
100
74.11
72.61
2.026
87.9
59.72
80.58
2.237
8.32
0.88
72.61
114.7
29613

0.88
40.66
72.61
94.4
114.7















Table A.3: Particle sizing statistical data for 10X microspheres
COULTER LS 10X
File name: 10X.$05
Group ID: 10X
Instrument: LS 230, Small Volume Module
Run number: 5
Run length: 91
Optical model: Fraunhofer.rfd PIDS included
Obscuration: 7
PIDS Obscur: 65
Obscuration: Low
Serial Number: 186

From 0.04
To 2000
Volume 100
Mean: 460.2
Median: 335.2
D(3,2): 16.27
Mode: 105.9
S.D.: 424.8
C.V.: 92.32
Skewness: 1.097
Kurtosis: 0.59
d10: 76.15
d50: 335.2
d90: 1072
Specific Surf. Area: 3688

% < Size
10 76.15
25 109
50 335.2
75 720.1
90 1072










Table A.4: Particle sizing statistical data for 1X microspheres
COULTER LS 1X
File name: 1X.$07
Group ID: 1X
Instrument: LS 230, Small Volume Module
Run number: 7


Run length:
Optical model:
Obscuration:
PIDS Obscur:
Obscuration:
Serial Number:

From
To
Volume
Mean:
Median:
D(3,2):
Mode:
S.D.:
C.V.:
Skewness:
Kurtosis:
d10:
d50:
d90:
Specific Surf. Area:


90
Fraunhofer.rfd PIDS included
8
46
OK


Size


0.04
2000
100
79.9
77.08
2.731
87.9
52.84
66.13
2.142
9.406
19.94
77.08
120.8
21973



19.94
53.6
77.08
98.17
120.8















APPENDIX B
ELISA NUMERICAL RESULTS


Table B.1: CTGF level ELISA results from week 1 rat groups.


Week 1 (skin)
Silicone Implants
HA
Antisense TGF-Beta in
HA
Antisense CTGF in HA *
(implant movement took
place)
Scrambled

Week 1 (bottom of capsule)
Silicone Implants
HA
Antisense TGF-Beta in
HA
Antisense CTGF in HA *
(implant movement took
place)
Scrambled


40.84
17.89

24.75


30.84
13.39



28.24
6.73

10.52


9.39
6.46


40.03
26.93

30.22


15.99
25.74



25.72
6.68

4.34


9.42
12.08


( na of CTGF/ me protein)


36.35
29.95

24.09


26.63
19.25



42.16
13.74

10.30


33.42
20.70

32.80


21.34
25.76



19.14
10.09

9.64


15.95
40.59


9.29
4.66


Table B.2: CTGF level ELISA results from week 2 rat groups. ( ng of CTGF/ mg protein)
Week 2(skin)
Silicone Implants 59.04 37.92 35.28 29.01
HA 29.05 20.50 29.96 17.89
Antisense TGF-Beta in
HA 32.07 22.76 21.36 29.89
Antisense CTGF in HA 30.59 23.75 26.49 21.86
Scrambled *(implant
movement took place) 20.48 30.87 24.08 19.38

Week 2(bottom of capsule)
Silicone Implants 32.52 66.71 23.02 27.29
HA 9.29 4.99 14.48 7.52
Antisense TGF-Beta in
HA 10.10 6.54 13.66 14.43
Antisense CTGF in HA 8.41 6.79 14.03 Sample lost
Scrambled *(implant
movement took place) 9.59 5.51 8.25 12.08


Y \ Y Y j



















Table B.3: TGF-B1 level ELISA results from week 1 rat groups. ( pg of TGF-B1/ mg
protein)
Week 1(skin)
Silicone Implants 518 376 639 332
HA 217 222 338 461
Antisense TGF-Beta in HA 496 435 418 519
Antisense CTGF in HA (implant movement took place) 422 428 517 286
Scrambled 193 764 265 897

Week#1 (bottom of capsule)
Silicone Implants 227 163 866 246
HA 73 296 143 124
Antisense TGF-Beta in HA 159 228 496 527
Antisense CTGF in HA (implant movement took place) 439 732 151 774
Scrambled 183 241 386 845




Table B.4: TGF-B1 level ELISA results from week 2 rat groups. ( pg of TGF-B1 /mg
protein)
Week 2(skin)
Silicone Implants 1086 400 401 634
HA 582 158 484 333
Antisense TGF-Beta in HA 456 461 277 292
Antisense CTGF in HA 279 472 535 420
Scrambled *(implant movement took place) 541 503 459 374

Week 2(bottom of capsule)
Silicone Implants 304 812 274 1700
HA 165 244 225 167
Antisense TGF-Beta in HA 339 149 125 337
Antisense CTGF in HA 134 460 410 Sample lost
Scrambled *(implant movement took place) 143 266 120 242
















APPENDIX C
STATISTICAL ANALYSIS PROVIDED BY ANOVA FOR ELISA RESULTS

A.S. =Antisense PLGA microspheres in Hyaluronic Acid(HA)

Table C.1 Mean and Standard Deviation Data from ELISA Results of CTGF skin weekly
CTGF-Skin Weekl


Independent Group Analysis


CTGF Skin Analysis-Week1


Grouping variable is GROUP
Analysis variable is OBS

Group Means and Standard Deviations


A.S. CTGF: mean = 23.7
A.S. TGF-B1: mean = 27.965
Control: mean = 37.66
HA: mean = 23.8675
Scrambled: mean = 21.035

Analysis of Variance Table


Source


Total
Treatment
Error


S.S. DF


1094.97
682.92
31.73


s.d. = 6.4441
s.d. = 4.2353
s.d. = 3.4362
s.d. = 5.5419
s.d. = 5.9468


n= 4
n= 4
n= 4
n= 4
n= 4


MS F Appx P


19
4 170.73 6.22
15 2.12


0.0037


Error term used for comparisons = 27.47 with 15 d.f.


















Table C.2: P values of ELISA results from CTGF skin week 1

Newman-Keuls Multiple Comp. Difference P Q (.05)

Mean(Control)-Mean(A.S. CTGF) =
13.96 4 5.327 4.076 *
Mean(Control)-Mean(Scrambled) =
16.625 4 6.344 4.367*
Mean(Control)-Mean(A.S. TGF-B1) =
9.695 2 3.7 3.014*
Mean(Control)-Mean(HA) =
13.7925 3 5.263 3.674*
Mean(HA)-Mean(A.S. CTGF) = 0.1675 (Do not test)
Mean(HA)-Mean(Scrambled) = 2.8325 (Do not test)
Mean(HA)-Mean(A.S. TGF-B1) =
4.0975 (Do not test)
Mean(A.S. TGF-B1)-Mean(A.S. CTGF) =
4.265 (Do not test)
Mean(A.S. TGF-B1)-Mean(Scrambled) =
6.93 4 2.644 4.076
Mean(Scrambled)-Mean(A.S. CTGF) =
2.665 (Do not test)

Homogeneous Populations, groups ranked

Gp 1 refers to GROUP=A.S. CTGF
Gp 2 refers to GROUP=A.S. TGF-B1
Gp 3 refers to GROUP=Control
Gp 4 refers to GROUP=HA
Gp 5 refers to GROUP=Scrambled

GpGpGpGpGp
5 1 4 2 3
51423




This is a graphical representation of the Newman-Keuls multiple comparisons
test. At the 0.05 significance level, the means of any two groups
underscored by the same line are not significantly different.




















Table C.3: Mean and Standard Deviation values from ELISA results of CTGF bottom of
capsule week 1
CTGF-Bottom of capsule Week1

Independent Group Analysis CTGF Bottom of capsule-Week1

Grouping variable is GROUP
Analysis variable is OBS

Group Means and Standard Deviations

A.S. CTGF: mean = 11.0125 s.d. = 3.2921 n = 4
A.S. TGF-B1: mean = 8.7 s.d. = 2.9306 n = 4
HA: mean = 9.31 s.d. = 9.6886 n = 4
Scrambled: mean = 15.9475 s.d. = 16.7295 n = 4
Control: mean = 28.815
s.d.= 16.7295 n= 4

Analysis of Variance Table

Source S.S. DF MS F Appx P

Total 2331.01 19
Treatment 1117.69 4 279.42 3.45 0.0343
Error 1213.32 15 80.89

Error term used for comparisons = 80.89 with 15 d.f.















Table C.4: P values of ELISA results from CTGF bottom of capsule week 1


Newman-Keuls Multiple Comp. Difference P Q (.05)

Mean(Control)-Mean(Scrambled) =
12.8675 2 2.861 3.014"
Mean(Control)-Mean(A.S. TGF-B1) =
20.115 5 4.473 4.367
Mean(Control)-Mean(A.S. CTGF) =
17.8025 3 3.959 3.674"
Mean(Control)-Mean(HA) =
19.505 4 4.337 4.076
Mean(HA)-Mean(Scrambled) = 6.6375 (Do not test)
Mean(HA)-Mean(A.S. TGF-B1) =
0.61 (Do not test)
Mean(HA)-Mean(A.S. CTGF) = 1.7025 (Do not test)
Mean(A.S. CTGF)-Mean(Scrambled) =
4.935 (Do not test)
Mean(A.S. CTGF)-Mean(A.S. TGF-B1) =
2.3125 (Do not test)
Mean(A.S. TGF-B1)-Mean(Scrambled) =
7.2475 4 1.612 4.076


*




*


Homogeneous Populations, groups ranked

Gp 1 refers to GROUP=A.S. CTGF
Gp 2 refers to GROUP=A.S. TGF-B1
Gp 3 refers to GROUP=Control
Gp 4 refers to GROUP=HA
Gp 5 refers to GROUP=Scrambled

GpGpGpGpGp
4 2 1 5 3




This is a graphical representation of the Newman-Keuls multiple comparisons
test. At the 0.05 significance level, the means of any two groups
underscored by the same line are not significantly different.





















Table C.5: Mean and Standard Deviation values of ELISA results from CTGF skin
week 2
CTGF- Skin Week2


Independent Group Analysis


CTGF Skin-Week 2


Grouping variable is GROUP
Analysis variable is OBS

Group Means and Standard Deviations


A.S. CTGF: mean = 25.6725
A.S. TGF-B1: mean = 26.52
HA: mean = 24.35
Scrambled: mean = 23.7025
Control: mean = 40.3125



Analysis of Variance Table


Source


Total
Treatment
Error


S.S. DF


1589.96
763.74
526.22


s.d. = 3.7895
s.d. = 5.2575
s.d. = 6.0585
s.d. =5.1828

s.d. = 13.0322


MS F Appx P


19
4 190.93 3.47
15 55.08


0.0339


Error term used for comparisons = 55.08 with 15 d.f.


n= 4
n= 4
1i= 4
1=4

n= 4


















Table C.6: P values of ELISA results from CTGF skin week 2

Newman-Keuls Multiple Comp. Difference P Q (.05)

Mean(Control)-Mean(Scrambled) =
16.61 5 4.476 4.367
Mean(Control)-Mean(A.S. TGF-B1) =
13.7925 2 3.717 3.014
Mean(Control)-Mean(A.S. CTGF) =
14.64 3 3.945 3.674
Mean(Control)-Mean(HA) =
15.9625 4 4.302 4.076
Mean(HA)-Mean(Scrambled) = 0.6475 (Do not test)
Mean(HA)-Mean(A.S. TGF-B1) =
2.17 (Do not test)
Mean(HA)-Mean(A.S. CTGF) = 1.3225 (Do not test)
Mean(A.S. CTGF)-Mean(Scrambled) =
1.97 (Do not test)
Mean(A.S. CTGF)-Mean(A.S. TGF-B1) =
0.8475 (Do not test)
Mean(A.S. TGF-B1)-Mean(Scrambled) =
2.8175 4 .759 4.076

Homogeneous Populations, groups ranked

Gp 1 refers to GROUP=A.S. CTGF
Gp 2 refers to GROUP=A.S. TGF-B1
Gp 3 refers to GROUP=Control
Gp 4 refers to GROUP=HA
Gp 5 refers to GROUP=Scrambled

GpGpGpGpGp
5 4 1 23


This is a graphical representation of the Newman-Keuls multiple comparisons
test. At the 0.05 significance level, the means of any two groups
underscored by the same line are not significantly different.
















Table C.7: Mean and Standard Deviations of ELISA results from CTGF Bottom of
capsule week 2
CTGF- Bottom of Capsule Week 2


Independent Group Analysis


CTGF Bottom of Capsule- Week2


Grouping variable is GROUP
Analysis variable is OBS

Group Means and Standard Deviations


A.S. CTGF: mean = 9.7433
A.S. TGF-B1: mean = 11.1825
HA: mean = 9.07
Scrambled: mean = 8.8575
Control: mean = 37.385

Analysis of Variance Table


Source


Total
Treatment
Error


S.S. DF


3762.67
2431.64
1331.03


s.d. = 3.7997
s.d. = 3.6244
s.d. = 4.0152
s.d. = 2.7384
s.d. = 19.9323


MS F Appx P


18
4 607.91
14 95.07.


6.39


Error term used for comparisons = 95.07. with 14 d.f.


n= 3
n= 4
n= 4
n= 4
n= 4


0.0038















Table C.8: P values of ELISA results from CTGF Bottom of capsule week 2

Newman-Keuls Multiple Comp. Difference P Q (.05)

Mean(Control)-Mean(Scrambled) =
28.5275 5 5.851 4.407 *
Mean(Control)-Mean(HA) = 28.315 4 5.808 4.111*
Mean(Control)-Mean(A.S. CTGF) =
27.6417 3 5.249 3.702*
Mean(Control)-Mean(A.S. TGF-B1) =
26.2025 2 5.375 3.033 *
Mean(A.S. TGF-B1)-Mean(Scrambled) =
2.325 4 .477 4.111
Mean(A.S. TGF-B1)-Mean(HA) =
2.1125 (Do not test)
Mean(A.S. TGF-B1)-Mean(A.S. CTGF) =
1.4392 (Do not test)
Mean(A.S. CTGF)-Mean(Scrambled) =
0.8858 (Do not test)
Mean(A.S. CTGF)-Mean(HA) = 0.6733 (Do not test)
Mean(HA)-Mean(Scrambled) = 0.2125 (Do not test)
Homogeneous Populations, groups ranked

Gp 1 refers to GROUP=A.S. CTGF
Gp 2 refers to GROUP=A.S. TGF-B1
Gp 3 refers to GROUP=Control
Gp 4 refers to GROUP=HA
Gp 5 refers to GROUP=Scrambled

GpGpGpGpGp
5 4 1 2 3



This is a graphical representation of the Newman-Keuls multiple comparisons
test. At the 0.05 significance level, the means of any two groups underscored
by the same line are not significantly different.
















Table C.9: Mean and Standard Deviation values of ELISA results from TGF-B1 skin
week 1
TGFB1-Skin Week 1


Independent Group Analysis


TGFB1 Skin -Week 1


Grouping variable is GROUP
Analysis variable is OBS

Group Means and Standard Deviations


A.S. CTGF mean = 413.25
A.S. TGF-B1: mean = 467.0
Control: mean = 466.25
HA: mean = 309.5
Scrambled: mean = 529.75

Analysis of Variance Table


Source


s.d. = 95.3078
s.d. = 48.201
s.d. = 139.8675
s.d. =115.4369
s.d. = 352.7222


S.S. DF MS F Appx P


Total 614838.6
Treatment 108713.3
Error 506125.3


27178.32
33741.68


Error term used for comparisons = 33,741.68 with 15 d.f.


n= 4
n= 4
n= 4
n= 4
n= 4


0.5406




















Table C.10 : P values of ELISA results from TGF-B1 skin week 1

Newman-Keuls Multiple Comp. Difference P Q (.05)

Mean(Scrambled)-Mean(HA) = 220.25 5 2.398 4.367
Mean(Scrambled)-Mean(A.S. CTGF) =
116.5 (Do not test)
Mean(Scrambled)-Mean(Control) =
63.5 (Do not test)
Mean(Scrambled)-Mean(A.S. TGF-B1) =
62.75 (Do not test)
Mean(A.S. TGF-B1)-Mean(HA) =
157.5 (Do not test)
Mean(A.S. TGF-B1)-Mean(A.S. CTGF) =
53.75 (Do not test)
Mean(A.S. TGF-B1)-Mean(Control) =
0.75 (Do not test)
Mean(Control)-Mean(HA) = 156.75 (Do not test)
Mean(Control)-Mean(A.S. CTGF) =
53.0 (Do not test)
Mean(A.S. CTGF)-Mean(HA) = 103.75 (Do not test)

Homogeneous Populations, groups ranked

Gp 1 refers to GROUP=A.S. CTGF
Gp 2 refers to GROUP=A.S. TGF-B1
Gp 3 refers to GROUP=Control
Gp 4 refers to GROUP=HA
Gp 5 refers to GROUP=Scrambled
GpGpGpGpGp
3 1 2 54


This is a graphical representation of the Newman-Keuls multiple comparisons
test. At the 0.05 significance level, the means of any two groups
underscored by the same line are not significantly different.





























Table C.11: Mean and Standard Deviation values of ELISA results from TGF-B 1 Bottom
of capsule week 1
TGF-B1 Bottom of Capsule Week 1


Independent Group Analysis


TGF-B1 Bottom of Capsule-
Week 1


Grouping variable is GROUP
Analysis variable is OBS


Group Means and Standard Deviations


A.S. CTGF: mean = 524.0
A.S. TGF-B1: mean = 352.5
Control: mean = 375.5
HA: mean = 159.0
Scrambled: mean = 413.75

Analysis of Variance Table


Source


s.d. = 289.8954
s.d. = 186.1764
s.d. = 328.922
s.d. = 95.9965
s.d. = 299.9082


S.S. DF MS F Appx P


Total 1259593.
Treatment 281440.2
Error 978152.8


70360.05
65210.18


Error term used for comparisons = 65,210.18 with 15 d.f.


n= 4
n= 4
n= 4
n= 4
n= 4


1.08


0.4016

























Table C.12: P values of ELISA results from TGF-B1 Bottom of capsule week 1

Newman-Keuls Multiple Comp. Difference P Q (.05)

Mean(A.S. CTGF)-Mean(HA) = 365.0 5 2.859 4.367
Mean(A.S. CTGF)-Mean(A.S. TGF-B1) =
171.5 (Do not test)
Mean(A.S. CTGF)-Mean(Control) =
148.5 (Do not test)
Mean(A.S. CTGF)-Mean(Scrambled) =
110.25 (Do not test)
Mean(Scrambled)-Mean(HA) = 254.75 (Do not test)
Mean(Scrambled)-Mean(A.S. TGF-B1) =
61.25 (Do not test)
Mean(Scrambled)-Mean(Control) =
38.25 (Do not test)
Mean(Control)-Mean(HA) = 216.5 (Do not test)
Mean(Control)-Mean(A.S. TGF-B1) =
23.0 (Do not test)
Mean(A.S. TGF-B1)-Mean(HA) =
193.5 (Do not test)

Homogeneous Populations, groups ranked

Gp 1 refers to GROUP=A.S. CTGF
Gp 2 refers to GROUP=A.S. TGF-B1
Gp 3 refers to GROUP=Control
Gp 4 refers to GROUP=HA
Gp 5 refers to GROUP=Scrambled
GpGpGpGpGp
3 4 2 5 1
34251


This is a graphical representation of the Newman-Keuls multiple comparisons
test. At the 0.05 significance level, the means of any two groups
underscored by the same line are not significantly different.
















Table C.13: Mean and Standard Deviation values of ELISA results from TGF-B1 skin
week 2
TGFB1- Skin Week 2


Independent Group Analysis


TGFB1 Skin -Week 2


Grouping variable is GROUP
Analysis variable is OBS


Group Means and Standard Deviations


A.S. CTGF: mean = 426.5
A.S. TGF-B1: mean = 371.5
Control: mean = 630.25
HA: mean = 389.25
Scrambled: mean = 469.25

Analysis of Variance Table


Source


s.d.= 108.9969
s.d.= 100.6661
s.d. = 323.1577
s.d.= 185.0862
s.d. = 71.7977


S.S. DF MS


n= 4
n= 4
n= 4
n= 4
n= 4


F Appx P


Total 669552.6
Treatment 171982.3
Error 497570.3


19
4 42995.57
15 33171.35


Error term used for comparisons = 33,171.35 with 15 d.f.


0.3158


















Table C.14: P values of ELISA results from TGF-B1 skin week 2

Newman-Keuls Multiple Comp. Difference P Q (.05)

Mean(Control)-Mean(A.S. TGF-B1) =
258.75 5 2.841 4.367
Mean(Control)-Mean(HA) = 241.0 (Do not test)
Mean(Control)-Mean(A.S. CTGF) =
203.75 (Do not test)
Mean(Control)-Mean(Scrambled*) =
161.0 (Do not test)
Mean(Scrambled*)-Mean(A.S. TGF-B1) =
97.75 (Do not test)
Mean(Scrambled*)-Mean(HA) = 80.0 (Do not test)
Mean(Scrambled*)-Mean(A.S. CTGF) =
42.75 (Do not test)
Mean(A.S. CTGF)-Mean(A.S. TGF-B1) =
55.0 (Do not test)
Mean(A.S. CTGF)-Mean(HA) = 37.25 (Do not test)
Mean(HA)-Mean(A.S. TGF-B1) =
17.75 (Do not test)

Homogeneous Populations, groups ranked

Gp 1 refers to GROUP=A.S. CTGF
Gp 2 refers to GROUP=A.S. TGF-B1
Gp 3 refers to GROUP=Control
Gp 4 refers to GROUP=HA
Gp 5 refers to GROUP=Scrambled
GpGpGpGpGp
2 4 1 3 5


This is a graphical representation of the Newman-Keuls multiple comparisons
test. At the 0.05 significance level, the means of any two groups
underscored by the same line are not significantly different.















Table C.15: Mean and Standard Deviation values of ELISA results from TGF-B1 Bottom
of capsule week 2
TGFB1- Bottom of Capsule Week 2


Independent Group Analysis


Grouping variable is GROUP
Analysis variable is OBS


Group Means and Standard Deviations
A.S. CTGF: mean = 334.6667 s.d. = 175.5714


A.S. TGF-B1: mean = 237.5
Control: mean = 772.45
HA: mean = 200.25
Scrambled: mean = 192.75

Analysis of Variance Table


s.d. = 116.4632
s.d. = 665.8324
s.d. = 40.3103
s.d. = 72.0156


TGFB1 Bottom of Capsule
-Week 2


n= 3


S.S. DF MS


F Appx P


2406509.
953735.27
1452774.


18
4 238433.8
14 103769.6


Error term used for comparisons = 103,769.5 with 14 d.f.


Source


Total
Treatment
Error


0.1103


















Table C.16: P values of ELISA results from TGF-B1 Bottom of capsule week 2

Newman-Keuls Multiple Comp. Difference P Q (.05)

Mean(Control)-Mean(Scrambled) =
579.7 5 3.599 4.407
Mean(Control)-Mean(HA) = 572.2 (Do not test)
Mean(Control)-Mean(A.S. TGF-B1) =
534.95 (Do not test)
Mean(Control)-Mean(A.S. CTGF) =
437.7834 (Do not test)
Mean(A.S. CTGF)-Mean(Scrambled) =
141.9167 (Do not test)
Mean(A.S. CTGF)-Mean(HA) = 134.4167 (Do not test)
Mean(A.S. CTGF)-Mean(A.S. TGF-B1) =
97.1667 (Do not test)
Mean(A.S. TGF-B1)-Mean(Scrambled) =
44.75 (Do not test)
Mean(A.S. TGF-B1)-Mean(HA) =
37.25 (Do not test)
Mean(HA)-Mean(Scrambled) = 7.5 (Do not test)

Homogeneous Populations, groups ranked

Gp 1 refers to GROUP=A.S. CTGF
Gp 2 refers to GROUP=A.S. TGF-B1
Gp 3 refers to GROUP=Control
Gp 4 refers to GROUP=HA
Gp 5 refers to GROUP=Scrambled
GpGpGpGpGp
4 5 2 1 3
45213


This is a graphical representation of the Newman-Keuls multiple comparisons
test. At the 0.05 significance level, the means of any two groups
underscored by the same line are not significantly different.