<%BANNER%>

Biochemical characterization and action of connective tissue growth factor and its receptor in corneal scarring

University of Florida Institutional Repository

PAGE 1

BIOCHEMICAL CHARACTERIZATION AND ACTION OF CONNECTIVE TISSUE GROWTH FACTOR AND ITS RECEPTOR IN CORNEAL SCARRING by TIMOTHY DANIEL BLALOCK A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2003

PAGE 2

The work presented in this dissertation is dedicated to LeeAnn Blalock, for her love and encouragement in the pursuit of my higher education in biomedical science. I would also like to dedicate this dissertation to my parents, James and Ida Blalock, along with the rest of my family, for their support in this endeavor.

PAGE 3

iii ACKNOWLEDGMENTS I would like to express my deepest gratitude to my mentor and friend Dr. Gregory Schultz, for his encouragement, support, and understanding throughout the course of my work for this dissertation. His expertise and advice in this endeavor have been indispensable to my success. I would also like to sincerely thank the members of my doctoral thesis committee: Dr. Henry Baker, Dr. Nancy Denslow, Dr. Susan Frost, and Dr. Alfred Lewin. Their advice was crucial to my success in this research. I would also like to extend my thanks to Dr. Nasser Chegini, Dr. David Muir, Dr. Michael Goldstein, Dr. Gary Grotendorst, Dr. Matthew Duncan, Dr. Heather MacArthur, Dr. Rong Yuan, Dr. Santosh Gowda, Dr. Franck Ollivier, Cecilia Lopez, Helene Klapper, Kavita Gandhi, Alpesh Mehta, Brian Morrison, Kelly Brinsko, Samer Jaber, Julia Burrows, Siva Radhakrishnan and Juan Varela for all of the experimental advice, friendship, and support they have shown me throughout my time at the University of Florida. The help extended to me by these individuals as well as others too numerous to mention has been essential to my success. Finally, I would like to thank my wife, LeeAnn Talarico Blalock; my parents, James and Ida Blalock; as well as Jim, Connie, Jaime, Alicia, Bob, Lisa, and Chris Blalock for all of the support they have offered to me over the years.

PAGE 4

iv TABLE OF CONTENTS page ACKNOWLEDGMENTS.............................................................................................iii LIST OF TABLES........................................................................................................vii LIST OF FIGURES......................................................................................................viii KEY TO ABBREVIATIONS..........................................................................................x ABSTRACT..................................................................................................................xii CHAPTER 1 LITERATURE REVIEW...........................................................................................1 The Cornea................................................................................................................1 Normal Corneal Anatomy and Physiology...........................................................1 Corneal Scarring..................................................................................................3 Growth Factors in Corneal Wound Healing..........................................................4 Refractive Surgery...............................................................................................6 Antiscarring Treatments and Complications.........................................................8 Wound Repair and Regeneration................................................................................9 Wound Healing and Repair .................................................................................9 Molecular Biology of Wound Healing................................................................11 Wound Regeneration..........................................................................................12 Transforming Growth Factor Beta (TGF).............................................................13 Roles of TGF..................................................................................................14 TGFand Stromal Wound Healing...................................................................16 Connective Tissue Growth Factor (CTGF)...............................................................17 CCN Gene Family ..............................................................................................18 CTGF Protein Structure.....................................................................................19 CTGF and Fibrosis.............................................................................................21 CTGF as a Mediator of TGFAction.....................................................................23 CTGF Gene Regulation......................................................................................24 CTGF-Mediated TGFSignaling.....................................................................25 Study Design and Rationale.....................................................................................26

PAGE 5

v 2 GENERAL METHODS ............................................................................................30 Experimental Animals.............................................................................................30 Photorefractive Keratectomy....................................................................................30 Sample Collection....................................................................................................31 Tissue Sectioning and Processing.............................................................................31 Microscopy..............................................................................................................32 3 CONNECTIVE TISSUE GROWTH FACTOR EXPRESSION AND ACTION IN THE CORNEA..................................................................................................33 Introduction.............................................................................................................33 Materials and Methods.............................................................................................35 Cell Culture.......................................................................................................35 Induction of CTGF by TGFIsoforms in Human Corneal Fibroblasts..............35 CTGF Immunocytochemistry in Human Fibroblast Cultures..............................36 Photorefractive Keratectomy (PRK)...................................................................36 Protein and RNA Extraction...............................................................................37 CTGF Sandwich ELISA.....................................................................................38 CTGF TaqMan Assay........................................................................................39 Collagen Synthesis Assay..................................................................................40 Reverse Transcriptase Polymerase Chain Reaction (RT-PCR)............................41 CTGF Immunohistochemistry in Corneal Sections.............................................42 Results.....................................................................................................................43 Increased CTGF Expression by TGFIsoforms................................................43 CTGF-Mediated TGF-induced Collagen Synthesis.........................................44 Increased Immunostaining in Human Corneal Fibroblast Cultures .....................44 CTGF Expression in Rat Corneas after PRK......................................................45 CT GF Immunohistochemistry in Rat Corneas Following PRK...........................46 CT GF Expression in Corneal Epithelium ..........................................................46 Discussion ...............................................................................................................47 4 BIOCHEMICAL CHARACTERIZATION OF THE CONNECTIVE TISSUE GROWTH FACTOR RECEPTOR IN CORNEAL FIBROBLASTS..................58 Introduction.............................................................................................................58 Materials and Methods.............................................................................................60 Iodination of Recombinant Human CTGF..........................................................60 Cell Culture .......................................................................................................60 Cell Binding Experiments..................................................................................61 Cell Proliferation Assay ....................................................................................62 Cross-linking of 125I-CTGF to Human Corneal Fibroblast Receptors .................63 Time Course of Binding to Rat Corneas following PRK.....................................64 Immunoprecipitation of the Type II IGF Receptor ..............................................65 Immunoprecipitation of Binding Reactions .......................................................65 Immunoprecipitation of Cross-linked Human Corneal Fibroblast Receptors........66

PAGE 6

vi Results.....................................................................................................................66 Binding of CTGF to Receptors on Corneal Fibroblasts .......................................66 Binding of CTGF to Rat Corneas following PRK ..............................................67 Binding of CTGF to the Type II IGF Receptor...................................................68 Response to Exogenous TGFin Type II IGF Knockout Cells .........................69 Discussion ...............................................................................................................70 5 ABLATION OF CONNECTIVE TISSUE GROWTH FACTOR EXPRESSION AND ACTION USING HAMMERHEAD RIBOZYMES...........................................86 Introduction.............................................................................................................86 Materials and Methods.............................................................................................88 Ribozyme Design and Synthesis.........................................................................88 Ribozyme Time-course and Multi-turnover Kinetics..........................................89 Plasmid Construction.........................................................................................90 Cell Culture and Transfection ............................................................................91 Quantitative Reverse-transcription Polymerase Chain Reaction ..........................92 CTGF Enzyme-linked Immunosorbent Assay (ELISA)......................................93 Cell Proliferation Assay ....................................................................................94 Results.....................................................................................................................94 Kinetics of CTGF Hammerhead Ribozymes.......................................................94 Effect of Ribozymes on CTGF Expression in Cell Culture.................................95 Effect of Ribozymes on TGF-mediated Cell Proliferation...............................95 Discussion...............................................................................................................96 6 GENE EXPRESSION ANALYSIS OF CONNECTIVE TISSUE GROWTH FACTOR STIMULATED HUMAN CORNEAL FI BROBLAS TS.................. 107 Introduc tion ........................................................................................................... 107 Materials an d Method s........................................................................................... 109 Cell Culture and RNA Isolat ion ....................................................................... 109 cRNA Preparation and Arra y Hybridization .. ..... 110 Data An alysis .................................................................................................. 110 Result s................................................................................................................... 112 Unsupervised Analys is..................................................................................... 112 Supervised Analysis ........................................................................................ 114 Selected Gene s of Inte rest ................................................................................ 115 Discu ssion ............................................................................................................. 120 7 CONCLUSIONS....................................................................................................128 LIST OF RE FERENC ES............................................................................................. 136 BIOGRAPHICAL SKETCH ....................................................................................... 161

PAGE 7

vii LIST OF TABLES Table page 1-1 Growth factors involved in corneal wound healing...............................................5 1-2 Classification of member s of the CCN ge ne family ............................................19 5-1 Multi-turnover kinetics analysis.........................................................................90 6-1 Leave-one-out crossvalidation an alysis .......................................................... 113 6-2 Selected gene s of inte rest ................................................................................. 118

PAGE 8

viii LIST OF FIGURES Figure page 1-1 Domain structure of the CTGF protein...............................................................21 1-2 Proposed role of CTGF in corneal fibrosis.........................................................29 3-1 Expression of CT GF by human corneal fibroblasts.............................................52 3-2 Collagen synthesis in human corneal fibroblasts by CTGF and TG F...............53 3-3 Immunolocalization of CT GF in human corneal fibroblasts................................54 3-4 Expression of CTGF protein and mRNA in rat corneas after PRK......................55 3-5 Immunolocalization of CTGF in rat corneas after PRK ......................................56 3-6 Detection of CTGF mRNA in rat corneal epithelium using RT-PCR..................57 4-1 Iodination of recombinant human CTGF............................................................73 4-2 Time course of CTGF binding to human corneal fibroblasts...............................74 4-3 Specificity of CTGF binding to human corneal fibroblasts.................................75 4-4 Scatchard analysis of CTGF binding to human corneal fibroblasts.....................76 4-5 Cross-linking of CTGF to human corneal fibroblasts..........................................77 4-6 CTGF affinity chromatography and specific binding..........................................78 4-7 Specific binding of CTGF to rat corneas following PRK....................................79 4-8 Immunoprecipitation of CTGF bound to the Type II IGF Receptor ....................80 4-9 Immunoprecipitation of CTGF/Type II IGF receptor complexes ........................81 4-10 Specificity of CTGF binding to immunoprecipitated complexes.........................82 4-11 Immunoprecipitation of membrane proteins cross-linked with CTGF.................83 4-12 CTGF binding in Type II IGF receptor knockout cells ........................................84

PAGE 9

ix 4-13 Cell proliferation in Type II IGF receptor knockout cells ....................................85 5-1 Structure of syntheti c RNA oligonuc leotid es.................................................... 100 5-2 Structure of self-cle aving hairpin ribozy me...................................................... 101 5-3 Ribozyme cleavage time-course analys is.......................................................... 102 5-4 Multi-turnover kinetic anal ysis. ........................................................................ 103 5-5 Effect of CHR 745 on mRNA ex pressi on......................................................... 104 5-6 Effect of CHR 745 on protein ex pressi on......................................................... 105 5-7 Effect of CHR 745 on TGF-induced cell pr oliferat ion. .................................. 106 6-1 Hierarchical clus tering patt erns. ....................................................................... 124 6-2 K-means cluste ring anal ysis ............................................................................. 125 6-3 Functional groups of genes regulated by CTGF ................................................ 126 6-4 The proposed role of the effect of CTGF on corn eal fibrob lasts. ....................... 127

PAGE 10

x KEY TO ABBREVIATIONS bp base pair BSA bovine serum albumin CTGF connective tissue growth factor DEPC diethyl pyrocarbonate DMEM Dulbecco’s Modified Eagle medium ECM extracellular matrix EDTA ethylenediaminetetraacetic acid EGF epidermal growth factor FGF fibroblast growth factor HEPES N-2-Hydroxyethylpiperazine-N'-2-ethanesulfonic acid IGF insulin-like growth factor IGF-IIR type II insulin-like growth factor r eceptor kDa kilodalton LB Luria Bertani medium LRP low-density lipoprotein (LDL) receptor-related protein M6P mannose-6-phosphate MPR mannose-6-phosphate receptor PCR polymerase chain reaction PDGF platelet-derived growth factor

PAGE 11

xi PEG polyethylene glycol PMSF phenylmethylsulfonyl fluoride PRK photorefractive keratectomy RAP receptor-associated protein RT reverse transcription RT-PCR reverse transcription polymerase chain reaction PDGF platelet-derived growth factor SDS-PAGE sodium dodecyl sulfate-polyacrylamide gel electrophoresis TGFtransforming growth factor alpha TGFtransforming growth factor beta TGF-IIR type II transforming growth factor beta receptor VEGF vascular endothelial growth factor

PAGE 12

xii Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy BIOCHEMICAL CHARACTERIZATION AND ACTION OF CONNECTIVE TISSUE GROWTH FACTOR AND ITS RECEPTOR IN CORNEAL SCARRING by Timothy Daniel Blalock August 2003 Chair: Gregory S. Schultz Department: Biochemistry and Molecular Biology Connective tissue growth factor (CTGF) is a 38 kilodalton, cysteine-rich, secreted peptide with mitotic and chemotactic functions. CTGF expression is upregulated by transforming growth factor beta (TGF), leading to the synthesis of connective tissue and extracellular matrix components such as collagen, laminin, integrin, and fibronectin which are predominant components of scar tissue. CTGF mRNA and protein levels are elevated in human fibrotic disorders including renal fibrosis, scleroderma, and keloids. Experimental data suggest that CTGF mediates the effects of TGFon contributing to corneal scarring by binding to the type II insulin-like growth factor receptor. Gene expression profiling experiments, using GeneGhip technology, were performed showing the classes of genes in corneal fibroblasts that are induced upon CTGF stimulation. These results show that CTGF regulates key genes involved in corneal apoptosis, scarring, and angiogenesis. CTGF mRNA and protein expression was stimulated in corneal fibroblasts in response to TGFCTGF also mediated the effects

PAGE 13

xiii of TGFon cell-associated collagen formation. Photorefractive keratectomy (PRK) was performed on rats to show that CTGF mRNA and protein expression increased dramatically in the corneal fibroblasts and epithelial cells after surgery up to Day 21. To reduce corneal fibrosis, a gene-specific hammerhead ribozyme was developed to target and cleave CTGF mRNA to reduce its expression. Cells transfected with a plasmid encoding the CTGF ribozyme showed a marked decrease in CTGF mRNA and protein expression as well as TGF-induced cell proliferation. To characterize the receptor for CTGF, radioligand binding, cross-linking, in vitro binding, and immunoprecipitation experiments were performed. These results indicate that CTGF binds to the type II insulin-like growth factor (IGF) receptor in corneal fibroblasts. Binding to this receptor confers biological activity in these cells. Thus, these experiments show for the first time the induction of CTGF expression in corneal scarring, the application of gene therapy to reduce CTGF expression, and the identity of the CTGF receptor in corneal fibroblasts. Knowledge of the biochemistry and action of CTGF and its receptor w ill elucidate their roles in the process of wound healing and the development of anti-scarring agents.

PAGE 14

1 CHAPTER 1 LITERATURE REVIEW The Cornea The cornea is a transparent, avascular tissue that is exposed to the external environment. The principal physiologic requirement of the cornea is to maintain clarity for proper vision. The maintenance of corneal shape and clarity is critical to refraction since the cornea accounts for more than two-thirds of the total refractive power of the eye (Chaudhuri et al., 1983). A very slight change in the contour of the cornea may result in a serious change of refractive error. Additionally, small changes in surface smoothness or total thickness may result in visual distortion. Many structural components work together to maintain the optical function of the cornea. Most medical and surgical treatments of the cornea are performed to restore corneal transparency (Choi et al., 2002a). Normal Corneal Anatomy and Physiology The structure and physiology of the cornea is deceptively complex. The anterior corneal surface is covered by tear film, a physiologically dynamic structure; while the posterior surface is directly bathed by the aqueous humor (Doane et al., 1978). The cornea is a transparent tissue and is continuous with the opaque sclera and the semitransparent conjunctiva. The zone of transition between the cornea and sclera is the richly vascularized limbus, which contains a reservoir of pluripotent stem cells (Moore et al., 2002). Histological examination reveals a complex structure of six layers: epithelium, epithelial basement membrane, Bowman’s membrane, stroma, Descemet’s

PAGE 15

2 2 membrane, and the endothelium. The factor that determines the property of corneal transparency is the arrangement of collagen fibers in the stromal layer (Birk and Lande, 1981a). The mean diameter of each collagen fiber and the mean distance between these fibers are homogenous and measure less than half the wavelength of visible light. This anatomic relationship is thought to be responsible for the fact that the incident ray scattered by each collagen fiber is cancelled by interference of the other scattered ray, allowing light to pass through the cornea (Maurice D.M., 1984). When these distances vary because of fibrosis or edema, the cornea loses its transparency and there is random scattering of incident rays (Andreo and Farrell, 1982). The cell types of cells present in the cornea include epithelial cells, keratocytes (corneal fibroblasts) and endothelial cells. Even though the cornea is avascular, it contains almost all of the components of the blood, such as albumin and globulins; whereas the cellular elements are absent (Gullino, 1986). This is important for understanding the regulatory mechanisms for maintaining normal corneal integrity; and for appreciating the pathobiology of various diseases of the cornea. Over 90% of the cornea is composed of stroma. The epithelial and endothelial layers help to maintain the transparency of the cornea. However it is the anatomical and biochemical characteristics of the corneal stroma that are principally involved in its physical strength, constancy of shape, and transparency (Daxer et al., 1998). The corneal stroma consists of extracellular matrix components, corneal fibroblasts, and nerve fibers; with cellular components comprising only 2% of the total stromal volume (Otori, 1967). Collagen (mainly types I, III, and IV) occupies over 70% of the dry weight of the cornea (Komai and Ushiki, 1991). The procollagen chains and glycosaminoglycans (GAGs)

PAGE 16

3 3 are synthesized by keratocytes, the predominant cellular component of the corneal stroma (Kenney et al., 1986). These long, spindle-shaped keratocytes are found scattered between the lamellae in the corneal stroma. The chains are then assembled into a procollagen triple helix bundle and are assembled and processed ultimately into mature collagen fibers. Gap junctions are the only junctional complex allowing for communication and exchange between corneal fibroblasts (Nishida et al., 1988). It is through injury or surgery that the keratocytes lose their network connections and behave independently (Birk and Lande, 1981b). Corneal Scarring The healing of the corneal stromal wound is slower than in other connective tissues presumably because of the lack of blood vessels. When a corneal wound or incision occurs, fibroblasts around the wound edge die, creating a hypocellular zone (Wachtlin et al., 1999). Beyond this zone, the quiescent keratocytes become activated into fibroblasts and migrate to the site of injury (Snyder et al., 1998). Other cells, such as monocytes can migrate to the wound and transform into fibroblast-like cells (Sunderkotter et al., 1991). Formation of the stromal scar in humans is a dynamic process. Clinical changes have been noted up to 5 years after radial keratotomy (Eiferman, 1992). Dermatan sulfate and keratin sulfate proteoglycans from the adjacent matrix as well as newly synthesized proeoglycans accumulate with the scar (McDermott, 1993). Collagen types I, III, V, and VI are also quite predominant within the scar (Ljubimov et al., 1998). At 1 week after injury, single collagen bundles are seen along the surface of the fibroblasts; but by 3 weeks, a dense network of fibrils is present, in

PAGE 17

4 4 both parallel and random orientations (Melles et al., 1995). The strength of corneal scars and the surrounding tissue never reaches that of the uninjured cornea. Growth Factors in Corneal Wound Healing Histologic changes in wound healing (such as excessive accumulation of extracellular matrix proteins) have been known for many years; but the molecular factors that regulate these processes in vivo are newly recognized. A delicate balance exists between growth factors and the matrix in steps of corneal wound healing. Growth factors were initially discovered because of their ability to stimulate mitosis of quiescent cells in culture in a nutritionally complete medium that lacked serum (Tuft et al., 1989). Growth factors were then found to promote cellular proliferation in an autocrine or paracrine fashion (Steenfos, 1994a). Growth factors also possess chemoattractive and penetrating properties (Clark and Henson, 1996); and play a major role in the wound repair process. Growth factors attract inflammatory cells and fibroblasts into the wound, promote proliferation of fibroblasts and endothelial cells, and stimulate angiogenesis and wound epithelialization. They have a significant effect on the production and degeneration of extrcellular matrix. Growth factors are synthesized and secreted by many types of cells involved in wound healing (including platelets, inflammatory cells, fibroblasts, epithelial cells, and vascular endothelial cells). All peptide growth factors initiate their effects by binding to and activating specific, highaffinity receptor proteins located in the plasma membrane of target cells. Activation of the receptors eventually results in stimulating a number of processes, including those involved in wound healing. Growth factors are usually grouped into families based on structural and functional similarities. Some of the well-characterized growth factors are

PAGE 18

5 5 included in Table 1-1 and include epidermal growth factor (EGF), transforming growth factor(TGF), transforming growth factor(TGF) and platelet-derived growth factor (PDGF). Other growth factors that have been shown to be important in wound healing are the insulin-like growth factors (IGFs), fibroblast growth factor (FGF), tumor necrosis factor(TNF), the interleukins and growth hormone (Steenfos, 1994b;Greenhalgh, 1996;Mutsaers et al., 1997). Table 1-1: Growth factors involved in corneal wound healing Taking all of this information into consideration, a model of corneal wound healing can be formulated that integrates the contributions of growth factors secreted by lachrymal cells, inflammatory cells, epithelial cells and stromal cells (van Setten et al., 1994;Wilson et al., 1992a;Li and Tseng, 1995a;Schultz, 1995). When an actue injury occurs that extends through the epithelial layer into the corneal stroma, EGF and its Growth factor Abbreviation Description Epidermal growth factor EGF Synthesized by corneal epithelial cells, and lachrymal gland; mitogenic and chemotactic factor for all 3 corneal cell types Transforming growth factor alpha TGFStructurally similar to EGF; synthesized by corneal epithelial cells and lachrymal gland Transforming growth factor beta TGFThree isoforms exist; promotes formation of the ECM; TGF2 is present in aqueous humor; probably synthesized by the corneal epithelium Basic fibroblast growth factor bFGF Detected in the basement membrane; synthesized by corneal endothelium Acidic fibroblast growth factor aFGF Detected in the basal layer of corneal epithelial cells and in the basement membrane Keratinocyte growth factor KGF mRNA detected in corneal epithelial cells Hepatocyte growth factor HGF Produced in fibroblasts; mRNA detected in corneal epithelial cells

PAGE 19

6 6 closely related protein TGF(secreted from lachrymal cells into tear fluid) penetrate into the stromal matrix and recruit fibroblasts through chemotaxis to the site of injury through an exocrine mechanism (Grant et al., 1992). Normally, EGF and TGFin tears do not significantly penetrate through the intact keratinized layers of uninjuried epithelium. Inflammatory cells such as macrophages secrete multiple growth factors including TGF, TGF, and PDGF (Madtes et al., 1988). Factors secreted by corneal epithelial cells including TGF, TGF, EGF, PDGF, bFGF and interleukin(IL) act by paracrine pathway to stimulate migration and mitosis of stromal fibroblasts (Wilson et al., 1992b;Li and Tseng, 1995b;Wilson et al., 1994c;Murphy et al., 1991). Similarly, fibroblasts secrete keratinocyte growth factor (KGF) which acts on the epithelial cells, but not fibroblasts, to promote epithelial wound healing by a paracrine path (Sotozono et al., 1995). Refractive Surgery The practice of refractive surgery comprises many techniques designed to correct errors of refraction and improve uncorrected visual acuity. The field has experienced an explosion in popularity due to advances in laser technology and the refinement of procedures such as radial keratotomy, photorefractive keratectomy (PRK), and laser-assisted in situ keratomileusis (LASIK). Radial keratotomy is a type of refractive surgery performed on 1.5 million patients since its introduction in the United States in 1978 in which radial incisions are made with a diamond knife blade in the peripheral cornea, resulting in a structural weakening (Duffey and Leaming, 2002). This weakening causes peripheral steepening and central flattening, correcting myopia (Applegate and Howland, 1997). In addition, radial keratotomy is often performed with astigmatic

PAGE 20

7 7 keratotomy to correct astigmatism (Gimbel et al., 2000). In 1993, the excimer laser was introduced to corneal surgeons. The excimer laser emits high-energy ultraviolet light to ablate corneal tissue with submicron precision, without significant injury to non-ablated tissue (Stark et al., 1992). Photorefractive keratectomy (PRK) is a refractive procedure that uses the excimer laser to ablate the corneal epithelium followed by enough layers of corneal stroma to achieve correction of myopia. Over one million PRK procedures have been performed in the United States in the last 10 years (Choi et al., 2002b). Laserassisted in situ keratomileusis (LASIK) is similar to PRK in that a high-precision excimer laser is used to ablate layers of the corneal stroma. However, LASIK uses an instrument called a microkeratome to remove a flap of corneal epithelium that can be resected after ablation. This procedure has experienced an explosion in popularity in the last few years due as the procedure was refined and the number of qualified surgeons across the country grew (Wu, 2002). In addition patients with high degrees of myopia are better treated by LASIK than radial keratotomy or PRK, because LASIK reduces complications in healing changes. Although these procedures are relatively noninvasive, complications due to stromal scarring may occur, and these may impair refraction. In the case of radial keratotomy, normal side effects may occur such as pain, glare, short-term vision fluctuation, and anisometropia; but long-term effects due to scar tissue and haze in the stroma may occur (Duffey, 1995). With laser-assisted procedures such as PRK and LASIK, problems in refraction may arise due to corneal haze, a common condition of corneal opacification (Heitzmann et al., 1993). Conditions of corneal haze are associated

PAGE 21

8 8 with deposition of collagen, fibronectin, and laminin; and an absence of keratin sulfate from the extracellular matrix (Malley et al., 1990;Lee et al., 2001). Antiscarring Treatments and Complications Although corneal haze may occur with refractive procedures, the usual practice is to wait until the opacity fades spontaneously. However, the corneal haze may be dense with the presence of fibrosis, in which case topical corticosteroids may be administered (Bilgihan et al., 2000;Siganos et al., 1999). With severe cases, potent topical steroids such as dexamethasone or prednisolone sodium acetate may be used (Price, Jr. et al., 2001). If corneal haze is not alleviated, the surgeon may opt for retreatment with the excimer laser. In many cases, retreament of the cornea is safer than long-term use of topical steroids, because retreatment prevents the patient from developing complications from the use of steroids (Choi et al. 2002). Occasionally, other treatments may be used to reduce scar formation, such as 5-fluorouracil and mitomycin C. The 5-fluorouracil is a pyrimidine analog that inhibits fibroblast proliferation to help reduce scarring. However, it is associated with complications such as corneal erosion, corneal ulceration, wound and suture track leaks, or even disintegration of absorbable sutures during the early postoperative period (Lee, 1994). Long term complications include hemorrhage, endophthalmitis, maculopathy, malignant and pupillary block (Ticho and Ophir, 1993;Parrish and Minckler, 1996). Mitomycin C is an antineoplastic-antibiotic agent, that inhibits fibroblast proliferation and has been shown to decrease corneal haze after PRK (Porges et al., 2003). Mitomycin C shows side effects similar to those of 5fluorouracil. When administered intraand post-operatively, mitomycin C prevents postsurgical scarring. However, this is accomplished by causing widespread cell death and

PAGE 22

9 9 apoptosis; and mitomycin C may cause blindness (Khaw et al., 1993). Therefore, alternative safer agents are needed. Wound Repair and Regeneration Tissue regeneration can be impaired by alteration of its cellular architecture, which may occur through physical or genetic-induced tissue damage. Repair of these wounds does not occur simply by release of growth factors resulting in physiological responses such as cell migration and proliferation. Wound repair and regeneration occurs through an integrated series of events involving many mediators, formed blood elements, reorganization of the extracellular matrix, angiogenesis, and proliferation of both fibroblasts and epithelial cells (Singer and Clark, 1999). Tissue regeneration requires the regulation of various genes encoding regulatory and structural molecules participating in both growth and tissue reorganization (Clark and Henson, 1996). The events in wound repair follow a general temporal sequence: inflammation, tissue regeneration, and tissue remodeling (Gharaee-Kermani and Phan, 2001). These general categories usually overlap due to integration of events in each step. During normal wound repair, cells are recruited from connective tissue to the site of injury by directed migration, followed by cell proliferation, and finally deposition of extracellular matrix components (Gillitzer and Goebeler, 2001). These events occur sequentially until normal tissue architecture is restored. Wound Healing and Repair The wound healing response begins at the moment an injury occurs. These injuries usually produce damage to vessels, resulting in blood leakage. This leakage leads to vasoconstriction followed by formation of a clot (Mast BA and Schultz GS,

PAGE 23

10 10 1996;Bennett and Schultz, 1993;Rendell et al., 2002). These events occur early in the inflammatory phase and result in the termination of blood leakage. The clot comprises platelets, cross-linked fibrin molecules, fibronectin, and thrombospondin. The clot acts as a provisional matrix through which cells migrate during wound repair (Guo et al., 1997b). Activated platelets release alpha granules containing adhesion proteins such as fibrinogen, fibronectin, thrombospondin, and von Willebrand factor VIII (Guo et al., 1997a). Adhesion of platelets to these proteins is mediated through the IIb/ 3 integrin surface receptor (Ginsberg et al., 1992). In addition to these crucial events, platelets release leukocyte chemotactic factors such as platelet-derived growth factor (PDGF), insulin-like growth factor I (IGF-I), and transforming growth factors alpha and beta (TGFand TGF) (Weksler, 2000;Ross et al., 1990;Gutierrez et al., 1987;Sporn and Roberts, 1992). These chemotactic growth factors attract inflammatory cells, resulting in initiation of re-epithelialization, contraction of connective tissue and stimulation of angiogenesis (Clark and Henson, 1996; Mast and Schultz, 1996). The first leukocytes recruited to the site of the injury are neutrophils which attack bacteria that may have been introduced into the tissue at the time of injury (Simpson and Ross, 1972). Levels of neutrophils begin to decline and macrophages begin to take over as the dominant cell type in the wound. Macrophages degrade and remove tissue debris, in preparation for the reparative phases of wound healing (Leibovich and Ross, 1976). Activated platelets release several growth factors such as TGFwhich recruit neutrophils and monocytes from the bloodstream (Wiseman et al., 1988).

PAGE 24

11 11 Molecular Biology of Wound Healing Experiments using purified components of connective tissue showed chemotactic activity for neutrophils, monocytes, and fibroblasts in vitro Examples of these extracellular matrix (ECM) components include collagen, elastin, fibronectin, and laminin as well as their proteolytic cleavage products (Clark RAF and Henson PM, 1996). Many macrophage-derived growth factors and cytokines have been implicated in stimulating synthesis of ECM components in addition to secreting pleiotropic factors that impact cell proliferation and angiogenesis (Hunt et al., 1984). Primary factors of immune regulation are cytokines, such as tumor necrosis factor alpha (TNF) and interleukin-1beta (IL-1 ) which are released by both macrophages and neutrophils and have an impact on the inflammatory response (Cohen, 1976). Several pleiotropic factors have been shown to be crucial in wound-repair efficiency (such as TGF, PDGF, IGF-1, bFGF, and TGF. These growth factors have control over the complex processes in wound healing involving migration, mitosis, and differentiation of epithelial and stromal cells (Schultz et al., 1992). PDGF and vascular endothelial growth factor (VEGF) stimulate vascular endothelial cells to extend new capillaries into the wound site, establishing new blood supply (Mints et al., 2002). These new vessels provide nutrients, oxygen, and other factors necessary for fibroblasts to deposit additional pro-collagen, allowing the further and continued growth of blood vessels (Zhou et al., 2000). This process continues until a network of new vessels bridge the wound as well as continued connective tissue synthesis. Eventually, the fibroblasts synthesize enough ECM to form a scar, replacing the damaged tissue. Components of the ECM in the wound are either glycosaminoglycan polysaccharide chains, structural proteins (such as collagen and elastin) or adhesive

PAGE 25

12 12 proteins (fibronectin and laminin) (Hay, 1981). All of the events in the process of inflammation must be reversed for the tissue architecture to return to normal. For this to happen, the inflammatory mediators that were generated must be removed, followed by termination of granulocyte emigration from blood vessels, normal vascular permeability, and removal of inflammatory cytokines (Furie and McHugh, 1989). Infiltration of monocytes and neutrophils must decrease for this to occur. Finally, removal of extravasated fluid, protein, cellular debris, granulocytes, and macrophages occurs as the wound regeneration process continues (Daoud et al., 1985). Wound Regeneration The sequence of events in the progress of wound regeneration (Pollack 1984) is as follows: Activation of coagulation leading to termination of blood leakage and formation of the provisional matrix Release of soluble chemotactic factors formed from plasma proteins that attract inflammatory cells to the site of injury Influx of neutrophils and monocytes to engulf and neutralize bacteria in the wound site Debridement of damaged connective tissue matrix Initiation of neovascularization Stimulation of cell proliferation and connective tissue matrix remodeling While in many cases this series of events leads to restoration of normal tissue structure and function, problems often arise. For example, fibrotic disorders occur when scarring results in a loss of function in the particular organ. More specifically, scarring is a result

PAGE 26

13 13 of abundant cell synthesis by fibroblasts that proliferate and differentiate within the provisional matrix (Lindblad, 1998). Although fibrosis in the skin may sometimes be cosmetic, serious complications may arise when it occurs elsewhere; especially in vital organs, as mentioned earlier in the cornea. Transforming Growth Factor Beta (TGF) Transforming growth factor beta (TGF) has one of the widest ranges of activities in wound healing (of all of the growth factors involved in this process) because of the array of cell types that produce or respond to it and because of its spectrum of activity (Roberts and Sporn, 1990). Its role in the formation of scar tissue is due to its influence on chemotaxis of the mesenchymal cells into the wound, stimulation of growth, and increased synthesis and deposition of ECM components (Roberts and Sporn, 1990). Additionally, TGFregulates the expression of proteolytic enzymes such as matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs) (Roberts, 1995). TGFis secreted by almost every tissue. Almost all normal cells have functional membrane-bound receptors for this peptide family. The principal sources of TGFare macrophages and alpha granules from platelets. After it is released it is chemotactic for monocytes and fibroblasts and inhibitory to keratinocytes and endothelial cells (Ksander et al., 1990). TGFis strongly regulated at both the transcription and translation level in macrophages (Noble et al., 1993c). There is an association between macrophages, TGF, and collagen deposition in human fibrotic disorders. Evidence shows that in granulomas, one type of fibrosis, TGFwas localized at the interface between macrophages and the surrounding fibrotic capsule (Khalil et al., 1991). In addition, TGFwas found in abundance in the macrophages and epithelial cells in

PAGE 27

14 14 biopsies of patients with lung fibrosis compared to normal patients (Noble et al., 1993b). These results suggest that TGFis predominantly provided by macrophages during wound repair and fibrosis. Roles of TGFTGFis released from platelets as two distinct complexes. A larger, latent complex is released into the serum and comprises TGF, latency-associated protein (LAP) and the latent TGFbinding protein. A smaller complex is composed of TGFand the associated LAP and is relased from blood clots after dissociation (Roberts, 1995). Five isoforms of TGFexist known as TGF1, TGF2, TGF3, TGF4, and TGF5. TGF1 is the most abundant isoform found in all tissues, and in platelets it is the only one present (Weibrich et al., 2002). TGF2 is most abundant in body fluids including aqueous and vitreous humor; while TGF3 is usually the least abundant (Noble et al., 1993a). Application of exogenous TGF1, 2, and 3 resulted in increased scar formation in incisional wounds (Schmid et al., 1993). In these wounds, expression of TGFwas auto-induced by the presence of exogenous TGF. TGFhas a more profound effect on the ECM than any other growth factor. It has a tremendous effect on increasing the strength and maturation of wounds and the ECM in fibrotic disorders. The fibroblasts are targeted by TGFin skin wound healing, which are transcriptionally activated by TGF(Wikner et al., 1988). TGFhas been found to regulate matrix proteins by upregulating collagen, fibronectin, glycosaminoglycans, MMPs, and TIMPs while decreasing proteolytic activity and cell adhesion via integrin receptors (Roberts, 1995). Data suggests that a specific cell

PAGE 28

15 15 population in the early stages of wound healing is optimally targeted by TGFsince single applications of TGFapplied topically at the time of wounding are as effective as repeated doses on scar formation (Beck et al., 1990). TGFincreases collagen synthesis by upregulating procollagen I, II or VI, and parallels the increase in scar strength, even though collagen cross-linking is not a major determinant of TGF-dependent improvements in wound repair (Pierce et al., 1991). The increased expression of collagen genes seems to be partly mediated by increased transcription of collagen mRNAs through effects of TGFon nuclear factor 1 (NF1) and Sp1 binding sites on the collagen promoter (Inagaki et al., 1994b; Rossi et al., 1988). A defined interaction exists between the ECM and TGF. This interaction can be bidirectional in that a disruption in the basement membrane can contribute to prolonged and increased TGFexpression (Lankat-Buttgereit et al., 1991). In addition, TGFenhances the wound healing response in compromised conditions (like corticosteroid treatment, irradiation, treatment with anti-neoplastic agents, diabetes, and hypoxia) to levels comparable to those of normal tissue (Cromack et al., 1991). Also, fetal wounds contain very little TGFand heal without scarring, suggesting a critical role of TGFin fibrosis (Piscatelli et al., 1994). The accumulation of ECM in fibrosis may not only be due to a result of increased TGFexpression but also defects in the signaling pathways that usually suppress ECM formation (Streuli et al., 1993). In several animal models, it has been shown that post-surgical administration of TGFincreases the incidence of fibrosis, while neutralizing antibodies to TGFeffectively reduce the incidence of scarring (Cordeiro et al., 1999a). In rat incision wounds, injections of neutralizing antibodies to TGF1 and TGF2 at the time of

PAGE 29

16 16 wound formation reduced inflammation, angiogenesis, and matrix deposition (Shah et al., 1994b). These wounds healed without scarring or the histological appearance of scar tissue. Additionally, subcutaneous injections of TGFinto mice led to the formation of granulation tissue within two to three days, characterized by induction of neutrophils, macrophages, fibroblasts, and endothelial cells surrounded by newly formed collagen networks (Inagaki et al., 1994a). The effects of TGFwere reversible, suggesting that availability of TGFis important in determining the duration and course of fibrosis. These experimental data suggest that TGFis a key mediator of stromal scarring. TGFand Stromal Wound Healing In corneal cells, the TGFisoforms and TGFreceptors are expressed both in normal tissue and in the wound healing process after injury (Frank et al., 1996). To better understand stromal scarring, the effects of the TGFsystem must be examined fully. The TGFisoforms directly stimulate fibroblasts to synthesize ECM proteins including collagen and proteoglycans and suppress the synthesis of matrix metalloproteinases (MMPs) while simultaneously increasing synthesis of the tissue inhibitors of matrix metalloproteinases (TIMPs) (Border and Noble, 1994a;Roberts et al., 1986). In addition, the TGFisoforms upregulate their own synthesis by fibroblasts which leads to a prolonged TGFresponse utilizing an autocrine path. These combined actions are hypothesized to occur after excimer laser PRK and lead to the deposition of ECM in the cornea that is clinically visualized as subepithelial haze. The molecular mechanism and action of the TGFs were poorly understood until the recent elucidation of a TGFsignal transduction network. The three primary isoforms of TGF(TGF1, 2, and 3), whose biological properties in vitro are extremely

PAGE 30

17 17 similar, exert their effects through TGFtype I and type II receptors with serinethreonine kinase activity. The type II receptor appears to be required for the signaling by the type I receptor and thus, is the key receptor in the TGFresponse system (Wrana et al., 1994a). TGFbinds directly to the type II receptor which is a constitutively active kinase. The bound TGFis then recognized by type I receptor, which is recruited into the complex and becomes phosphorylated by the type II receptor. Phosphorylation allows the type I receptor to propagate the signal downstream substrate through the Smad family (Wrana et al., 1994b;Heldin et al., 1997a). The proteins of the Smad family were the first identified substrates of the type I TGFreceptor kinase and act as the intracellular signal transducer in the TGFresponse pathway. As shown in cell culture studies, Smad2 and/or Smad3 are phosphorylated by the type I receptor and form a complex with Smad4 followed by translocation of the complex from cytoplasm to nuclei (Heldin et al., 1997b;Nakao et al., 1997b). The translocated Smad complexes recruit transcription factors to form a complex and initiate transcription of genes. Some relevant genes such as collagen type I, fibronectin and type 1 plasminogen activator inhibitor (PAI-1) have been proven to be regulated by TGFat the transcriptional level by Smad signal transduction pathway (Nakao et al., 1997a). Connective Tissue Growth Factor (CTGF) Connective tissue growth factor (CTGF) is a secreted, cysteine-rich peptide of about 38 kilodaltons. It was discovered in 1991 in the conditioned medium of cultures of human umbilical vein endothelial cells (HUVEC). While a study was being performed on the role of platelet-derived growth factor (PDGF) in HUVEC cells, a new peptide that appeared to be responsible for the PDGF-related mitogen activity in the conditioned

PAGE 31

18 18 medium was identified and called CTGF (Bradham et al., 1991e). Amino acid analysis revealed that the peptide showed a 45% overall homology to the translational product of the v-src-induced CEF-10 mRNA from chicken embryo fibroblasts. CTGF is a heparinbinding protein and has been shown to be secreted by fibroblasts after activation with TGF. CTGF is aptly named, because it has been identified as a major chemotactic and mitogenic factor for cells of the connective tissue, and has PDGF-related biological and immunological properties. CCN Gene Family The CTGF gene is located on chromosome 6q23.1, proximal to the c-myb gene (Bradham et al., 1991d). It belongs to a family of peptides including serum-induced immediate early gene products such as cyr61, fisp12, a v-src-induced putative gene (CEF-10), and a putative avian transforming gene (nov) (Bradham et al., 1991c;O'Brien and Lau, 1992;Martinerie et al., 1992b). Sequence similarity also exists between CTGF and the twisted gastrulation ( tsg ) gene, one of seven known zygotic genes specifying the fate of dorsal cells in the embryos of Drosophila (Mason et al., 1994). This family of peptides (shown in Table 1-2) is characterized by conservation of thirty-eight cysteine residues between species, comprising just over 10% of the total amino acid content. This family also contains a sequence homology of 30-38% to the low-affinity IGF-binding proteins (IGFBPs), and has the conserved IGFBP motif (GCGCCXXC) in the amino terminus with up to seventeen of the cysteines conserved in the IGFBPs (Brigstock, 1999). It has been suggested that CTGF is another member of the low-affinity IGFBP group of genes. This family, along with the high-affinity IGFPB gene make up an

PAGE 32

19 19 IGFBP superfamily that regulates normal as well as neoplastic growth (Kim et al., 1997a). The mouse ortholog to CTGF is most likely fisp-12 since it has a 93-94% amino acid sequence homology to human CTGF. Similarly, the nov transcript is derived from a distinct gene known as nov in humans (Snaith et al., 1996), frog (Ying and King, 1996), mouse (Liu et al., 1999), and chicken (Martinerie et al., 1992a). Additionally, cyr61 (in humans, frog, and chicken) and cef10 (in mice) appear to be homologous indicating that at least three distinct genes encode these peptides (CTGF/fisp-12, cef10/cyr61, and nov). Currently, this family has been termed CCN (Bork, 1993d). This suggests that CTGF-related peptides function in a wide array of biological activities ranging from normal embryonic development to tissue regeneration, tumor formation and growth. Table 1-2: Classification of members of the CCN gene family Species CTGF Nov Cyr Homo sapiens (human) CTGF h-nov h-Cyr61 Xenopus laevis (frog) xCTGF x-nov — Gallus gallus (chicken) cCTGF nov Cyr61 Mus musculus (mouse) fisp-12 m-nov CEF10 Drosophila melanogaster (fruit fly) Tsg — — CTGF Protein Structure The CCN family of proteins reveal four distinct modules, each encoded by a separate exon and possess a signal peptide through normal secretory pathways (Bork, 1993c). Two cysteine-rich domains exist separated by a cysteine-free hinge region in the middle of the peptide (shown in Figure 1-1). An even number of cysteines are present in

PAGE 33

20 20 each module (22 in the N-terminus and 16 in the C-terminus), possibly contributing to independent disulfide bridges. Mild protease digestions show cleavage in the cysteinefree region yielding separate Nand C-terminal domains without denaturation or reduction of disulfides in the other modules. Overall, this suggests that the protein has two disulfide cross-linked domains separated by a cysteine-free hinge region. Furthermore, extensive proteolytic digestion fails to cleave the cross-linked domains into smaller fragments, suggesting the disulfide bonds are resistant to proteolysis. The amino-terminus of this protein contains two motifs which may be responsible for its binding to other growth factors (Bork, 1993b). Adjacent to the signal peptide is a sequence encoded in exon 2 which is nearly identical to the IGFBP motif, most likely responsible for its IGF binding property. The second domain is similar to von Willebrand factor type C which is present as a single copy in the CCN peptide family and as multiple copies in tsg all containing multiple cysteine residues (Bork, 1993a). This motif functions to interact with other growth factors to cause complex or dimer formation (Tanaka et al., 2001). The carboxy-terminus of the CCN family of peptides shares a disulfide linkage pattern with PDGF, TGF, and nerve growth factor (NGF), which are involved in heparin binding (Bork, 1993e). The first domain in the C-terminus is the thrombospondin type I repeat which is present in several extracellular matrix proteins. One function of this domain is binding interaction with glycoconjugates such as glycosaminoglycans (Incardona et al., 1996). This domain possesses a high-affinity for heparin, which has similarity to other growth factors such as bFGF and heparin-binding epidermal growth factor (EGF) (Grotendorst, 1997a). The discrete region of the domain

PAGE 34

21 21 growth facto r binding domain heparin-binding domain cysteine-free hinge H2N COOH responsible for heparin binding has not yet been identified. The final motif contains six cysteine residues also found in the growth factors PDGF, TGF, and NGF. The dimeric nature of TGFand PDGF exists due to disulfide bridges not found in CTGF (MurrayRust et al., 1993). The structural relationship of the heparin-binding domains to known growth factors suggest that CTGF could be involved in signaling and receptor binding. Figure 1-1. Domain structure of the CTGF protein. CTGF and Fibrosis The expression of CTGF is believed to be limited to cells derived from the mesenchyme including fibroblasts, vascular endothelial cells, smooth muscle cells, chondrocytes, and renal tubule cells (Dammeier et al., 1998a). Lymphocytes, leukocytes and cells derived from the epithelium of embryos are not known to express CTGF. It is also over-expressed in a variety of fibrotic disorders such as scleroderma (Kikuchi et al., 1995a), systemic sclerosis (Sato et al., 2000), atherosclerosis (Hishikawa et al., 1999b), internal organs in idiopathic pulmonary fibrosis (Igarashi et al., 1998b), liver fibrosis (Ksander et al., 1990), diabetic glomerulosclerosis (Ito et al., 1998a), and renal fibrosis (Goldschmeding et al., 2000). In addition it is over-expressed in tumors such as pancreatic carcinoma (Wenger et al., 1999b), malignant fibrous histocytoma (Igarashi et al., 1998a), and human breast cancer specimens (Hishikawa et al., 1999d). High expression of CTGF mRNA has been detected in myofibroblasts in the fibrotic tissues

PAGE 35

22 22 surrounding invasive tumors even though TGFwas not found (Hishikawa et al., 1999c). CTGF may also be important in the formation and stabilization of atherosclerotic plaques since it is expressed abundantly in human aortic smooth muscle cells and induces apoptosis through growth inhibition (Hishikawa et al., 1999a). Together, these results suggest that CTGF plays an important role in stimulating the proliferation of connective tissue and the extracellular matrix. A wide variety of important biological processes such as normal embryonic development and tissue regeneration seem to be regulated by CTGF-related gene products. Since recombinant CTGF has been produced, it is possible to investigate the biological activity of this growth factor on cells in culture and its possible functions in physiology in vivo Unstimulated mesangial cells in the kidney express and secrete minimal amounts of CTGF protein and minimal amounts of CTGF were secreted from the cells. However, when these cells were treated with sodium heparin, a four-fold increase in media-associated CTGF was observed, suggesting that the major amount of CTGF was matrix-bound. The addition of TGFmarkedly increased the amount of CTGF mRNA (Riser et al., 2000). In a separate study, CTGF has been shown to act as a mitogen in cultures of normal rat kidney fibroblasts, which is enhanced with the addition of either EGF or heparin. In the same study, CTGF also increased the mRNA transcripts for type I collagen, 5 integrin, and fibronectin (Frazier et al., 1996d). Thus, similarly to TGF, CTGF can induce connective tissue cell proliferation and ECM synthesis, differentiating it from EGF, FGF, and PDGF, which do not contribute significantly. These experiments show that CTGF was similar but not identical properties to TGF,

PAGE 36

23 23 suggesting that it may function as a downstream mediator of some of the actions of TGF. Limited information is available on the expression of CTGF in ocular tissues. One study showed the expression and localization of CTGF mRNA in human retrocorneal and subretinal fibrovascular membrane specimens using in situ hybridization (Wunderlich et al., 2000d;Meyer et al., 2002). Other studies show the expression of CTGF in human aqueous humor, human tear fluid, and pterygia samples, suggesting a possible involvement of CTGF in ocular pathology (van Setten et al., 2002b;van Setten et al., 2003;Van Setten et al., 2003). An additional study shows that the addition of TGFto cultures of rabbit corneal fibroblasts induces the expression of CTGF mRNA and protein although the properties of rabbit corneal fibroblasts in culture have proven to be quite different from human cultures (Folger et al., 2001a). Since the role of CTGF appears to be so crucial in the regulation of fibrosis in other tissues, its expression and role in the normal and fibrotic cornea needs to be assessed as a target for reducing fibrosis. CTGF as a Mediator of TGFAction The link between TGFand CTGF is clear in its role in the regulation of normal and fibrotic pathophysiology. The fact that TGFinduces expression of CTGF in almost every mesenchymal cell type suggests that expression of CTGF is necessary to mediate some of the actions of TGFon inducing extracellular matrix synthesis and regulating cell proliferation. TGFis known to affect many genes that are involved in wound healing, but it is the effect it has on expression of CTGF that may be one of the most important factors in understanding the regulation of stromal scarring

PAGE 37

24 24 CTGF Gene Regulation CTGF is known to be induced by TGFbut not by other related growth factors like EGF, PDGF, FGF, insulin or IGF (Grotendorst et al., 1996d). Most likely this is due to different signal transduction pathways induced upon activation by TGF, which activates a serine/threonine protein kinase receptor, as opposed to other growth factors like EGF, FGF, PDGF, insulin and IGF, which activate tyrosine kinase receptors (Ohtsuki and Massague, 1992;Ullrich and Schlessinger, 1990). The CTGF promoter has a TGF-inducible element, which is another mechanism for inducing the expression of CTGF mRNA by TGF. Examination of the CTGF promoter has revealed multiple consensus elements that are similar to other growth factor genes like the CArG box and AP-1/SP-1 sites. The sequences are present although they do not appear to be required for TGFinduction of the CTGF gene (Grotendorst et al., 1996c). Other regions of the human CTGF promoter include nucleotide sequences that are related to two other reported TGFcontrol elements, NF-1 and the TGFinhibitory element. Analysis of deletion mutants indicated that neither element was necessary for TGFinduction, and that an important TGFregulatory element was located between positions –162 and –128 of the CTGF promoter sequence (Grotendorst et al., 1996b). Extended expression of CTGF transcripts for 24-48 hours has been noted after only a brief one-hour exposure to TGF. In another experiment, brief treatment of human skin fibroblasts with TGFfor 1 hour gave nearly the same fold induction of CTGF gene transcription as either 4 or 24 hours of treatment (Grotendorst et al., 1996a). The induction of CTGF mRNA in fibroblasts in response to TGFis not blocked by protein synthesis inhibitors such as cycloheximide, even after a brief exposure in

PAGE 38

25 25 combination with TGF. These results confirmed that transcriptional regulation by TGFis a component of the mechanism for induction of CTGF expression. CTGF-Mediated TGFSignaling TGFis thought to influence CTGF by either direct or indirect pathways. With these hypotheses, TGFis believed to have an effect on cells via CTGF or synergistically with CTGF to induce a cellular response. TGFhas the ability to stimulate the growth of fibroblasts in soft agar, which is a property typical of transformed cells. On the other hand CTGF cannot induce anchorage independent growth of NRK fibroblasts. Also, neutralizing antibodies to CTGF specifically blocked TGF-induced anchorage-independent growth (AIG), while other growth factors including PDGF, FGF or EGF were not effective as mitogens on cells in culture. In addition, clones of normal rat kidney (NRK) fibroblasts that express an antisense-CTGF gene blocked the expression of endogenous CTGF but do not respond to TGFin the AIG assay. In an identical assay the addition of pure recombinant CTGF to the media restored the growth of cells (Kothapalli et al., 1997a). These studies show that TGFstimulation of NRK fibroblast AIG acts via the synergistic pathway probably by CTGF downstream stimulation. In the same study, the ability of CTGF to induce collagen synthesis (a component of the ECM) was examined. In vitro and in vivo studies were performed to determine whether CTGF was also essential for TGF-induced collagen synthesis (Duncan et al., 1999k). In vitro studies with NRK fibroblasts demonstrated that CTGF potently induced collagen synthesis and transfection. Additionally, an antisense to the CTGF gene blocked induction by TGF. Moreover, TGFinduced collagen synthesis in NRK fibroblasts

PAGE 39

26 26 and human foreskin fibroblasts was effectively blocked with specific anti-CTGF antibodies. A similar result was also observed by suppressing TGFinduced CTGF expression by elevating intracellular cAMP levels in the same report with either membrane-permeable 8-bromo-cAMP or an adenylate cyclase activator such as cholera toxin (Duncan et al., 1999). These data indicate that CTGF mediates TGFinduced fibroblast collagen synthesis and that in vivo blockade of CTGF synthesis. TGFalso induced granulation tissue formation via CTGF by inhibiting both collagen formation as well as fibroblast accumulation. Study Design and Rationale Although limited information is available on the role of CTGF in the cornea, most reports suggest that it might play a significant role in corneal fibrotic disorders (Wunderlich et al., 2000c;Folger et al., 2001b). Based on the reported effects of CTGF in other fibrotic conditions and initial experiments, it is the overall hypothesis that CTGF is a major regulator of corneal scar formation and mediates many of the fibrotic effects of TGFin corneal scarring. It is hypothesized that levels of CTGF mRNA and protein will increase in rat corneas during healing of excimer ablation wounds, and that all three TGFisoforms induce CTGF mRNA and protein in cultured human fibroblasts. It is also believed that CTGF will i nduce collagen synthesis, and most importantly, that inhibiting CTGF will block TGF-induced collagen synthesis in cultured human fibroblasts. Since limited information is available for the putative CTGF receptor (which will be addressed to greater detail in Chapter 4) characteristics of the receptors for CTGF on the surface of human corneal fibroblasts need to be obtained using a combination of

PAGE 40

27 27 biochemical techniques that include chemical cross-linking of 125I-CTGF to cultured fibroblasts, CTGF affinity column chromatography and immunoprecipitation. The proposed model of CTGF induction of corneal scarring is illustrated in Figure 1-2. Epidermal growth factor (EGF) and transforming growth factor alpha (TGF) are produced by the lachrymal gland and are present in tears. Activated macrophages and neutrophils from the inflammation response also release TGF. The binding of TGFactivates the synthesis and release of CTGF from the stromal fibroblasts within the cornea. These fibroblasts are also stimulated to produce even more TGF, which stimulates more cells to produce CTGF. When CTGF is released, it binds to receptors on the stromal fibroblasts or perhaps the epithelium and/or endothelium and signals the synthesis of collagen I, III, and IV, as well as fibronectin. CTGF also stimulates cell proliferation within the stroma so that the effect is amplified. Although sufficient information is available showing that CTGF is a mitogen for fibroblasts and a strong inducer of collagen synthesis, very little is known its regulation of other genes. The most effective method to understand the broad actions of CTGF on corneal gene expression and wound healing is to use microarray GeneChip technology to initially identify genes that are changing. This technology can be used to identify a number of genes that are up-regulated or down-regulated by CTGF. This information will be used to test previous hypotheses about corneal wound healing and to generate new hypotheses about how CTGF influences scar formation. A long-term goal of this research is to develop agents that reduce corneal scarring by selectively reducing the expression of fibrotic genes such as TGFand CTGF. In this work, antisense

PAGE 41

28 28 oligonucleotides and ribozymes to CTGF will be developed and optimized to evaluate the anti-scarring effects of these powerful agents on corneal wound healing animal models. The general goal of this dissertation is to understand the molecular regulation of stromal scarring and the role that CTGF plays in regulating corneal scarring and to develop new anti-scarring agents, targeting CTGF and related genes.

PAGE 42

29 29 Tears from lacrimal gland EGF, TGF Activated macrophages and neutrophils from the inflammation response TGFStromal fibroblasts CTGF CTGF CTGF TGFautoinduction Collagen I, III, IV, fibronectin scarring Cell proliferation STROMA ENDOTHELIUM EPITHELIUM Figure 1-2. The proposed role of connective tissue growth factor (CTGF) in corneal fibrosis.

PAGE 43

30 30 CHAPTER 2 GENERAL METHODS Experimental Animals Adult male Sprague-Dawley rats (200-250 g) were purchased from Harlan (Indianapolis, IN). All rats were housed in pairs in air-conditioned rooms (22-25 C) with 14 hours of lights per day. Constant food and water were available to all animals. Rats were euthanized at the end of the experiments with intraperitoneal injection of pentobarbital (Beuthanasia-D Special). Mice used for all experiments were housed four per cage in a similar environment. Mice were euthanized by cervical dislocation at the end of the experiments. All animal protocols were approved by the Institutional Animal Care and Use Committee (IACUC) at the University of Florida. Photorefractive Keratectomy Adult Sprague-Dawley male rats (200-250 g) with normal eyes were anesthetized with an intraperitoneal injection of sodium pentobarbital (30 mg/kg). Eyelashes and whiskers surrounding the eye were removed from the visual field. A drop of proparacaine-HCl (0.05%) was applied to the eye and the cornea was centered under the laser microscope. Bilateral excimer laser photorefractive keratectomy was performed (Chen et al., 2000h). Briefly, corneas were ablated in a 4.4-mm treatment zone with an excimer laser (Summit SVS Apex) in the phototherapeutic keratectomy mode. The corneal epithelium was ablated to a depth of 40 m, followed by ablation of the stroma to a depth of 20 m for a total ablation depth of 60 m. After excimer laser treatment,

PAGE 44

31 31 tobramycin (0.3%) ointment was applied to the corneal surface to prevent infection. No postoperative topical steroid was administered. Sample Collection On the appropriate day following excimer laser keratectomy, rats were euthanized as described earlier. The corneas were harvested with the aid of an operating microscope. Briefly, a 3-mm disposable biopsy punch was used to groove the cornea and enter the anterior chamber of the eye, followed by completion of tissue excision using Vannase scissors and Maumenee forceps. Corneal buttons were snap frozen in liquid nitrogen, placed in polypropylene 1.5-ml microcentrifuge tubes, and stored at -80 C until further analysis. Normal, unoperated rats were sacrificed at each of the time points to obtain control (Day 0) corneas. Tissue Sectioning and Processing After standard histological processing and embedding in paraffin blocks, 6 micrometer thick sections were cut with a microtome. Tissue sections were deparaffinized by two incubations in xylene for ten minutes, hydrated through absolute alcohol, 95% alcohol, 75% alcohol and 50% alcohol for ten minutes at each step followed by a 1 minute wash in distilled water. Endogenous peroxidase activity was quenched by incubation with 0.03% H2O2 for 60 minutes at room temperature. Tissue sections were gently rinsed in distilled water, washed for five minutes and wash buffer (5 mM Tris, 300 mM NaCl, 0.1% Tween 20, pH 7.4) containing 2% goat serum and 5% bovine serum albumin (BSA) was added and allowed to incubate for 60 minutes at room temperature.

PAGE 45

32 32 Immunohistochemical localization was then achieved through affinity-purified primary and secondary antibodies followed by the appropriate detection reagents. Microscopy Tissue sections mounted on glass slides were photographed using either bright field illumination or fluorescence microscopy with excitation/emission wavelengths for Texas Red staining, and Nomarski phase-contrast microscopy at 200x magnification. Photographs were taken at a constant exposure using a Peltier-cooled Olympus digital camera. Cell cultures fixed with paraformaldehyde or methanol on glass slides were photographed in a similar fashion, using an inverted-phase microscope using either bright field illumination or fluorescence microscopy with excitation/emission wavelengths for Texas Red staining.

PAGE 46

33 33 33 CHAPTER 3 CONNECTIVE TISSUE GROWTH FACTOR EXPRESSION AND ACTION IN THE CORNEA Introduction Connective tissue growth factor (CTGF) is a secreted, cysteine-rich monomer of about 38 kDa that was originally identified as a mitogen for fibroblast in conditioned media cultures from human umbilical vein endothelial cells (Bradham et al., 1991b;Ryseck et al., 1991;Frazier et al., 1996c). CTGF belongs to the CCN (CTGF, Cyr61/Cef10, Nov) family of secreted cysteine-rich proteins, which possess important growth regulatory functions and are involved in cell differentiation (Hashimoto et al., 1998a;Hurvitz et al., 1999;Albrecht et al., 2000). However, the most important biological action of CTGF may be in stimulating synthesis of extracellular matrix components. When added to cultured human skin fibroblasts, CTGF dramatically increased synthesis of collagen, integrin, and fibronectin, and subcutaneous injections of CTGF into mice produced granulation tissue and fibrosis in the skin (Frazier et al., 1996b). This finding led to investigations of the possible role of CTGF in fibrotic diseases. CTGF mRNA was significantly elevated in the left ventricles of rat hearts following myocardial infarction, which correlated well with concomitant increases in fibronectin, and type I and type III collagen mRNA levels and development of cardiac fibrosis in the animal hearts (Chen et al., 2000i). Significant upregulation of CTGF was detected in human heart samples derived from patients diagnosed with cardiac ischemia. Elevated CTGF protein and mRNA levels were found in sclerotic skin fibroblasts (Igarashi et al., 1995), specimens of

PAGE 47

34 34 34 inflammatory bowel disease (Dammeier et al., 1998b), in retrocorneal membranes (Wunderlich et al., 2000b), and overexpression of CTGF was linked to human renal fibrosis (Ito et al., 1998b). The transforming growth factor beta (TGF) system (Border and Noble, 1994b;Perkett, 1995;Perkett, 1995) has also been implicated in promoting scarring and fibrosis in numerous tissues including lung (Westergren-Thorsson et al., 1993), kidney (Border et al., 1992), liver (Castilla et al., 1991), and pancreas (Vogelmann et al., 2001). Furthermore, agents that reduced the activity of the TGFsystem by selectively targeting TGFor its receptors reduced scarring in several animal models of tissue fibrosis (Castilla et al., 1991;Border et al., 1990;Jester et al., 1997). Recently, two important links between CTGF and the TGFsystem were reported that added weight to the concept that CTGF plays important roles in scarring. First, TGF1 induced synthesis of CTGF in cultured normal rat kidney fibroblasts (Frazier et al., 1996a), and second, neutralizing antibodies to CTGF blocked collagen synthesis induced by TGFin rat and human fibroblasts (Duncan et al., 1999i). These results indicated that CTGF could be a downstream mediator of some of the scarring effects of TGF. The CTGF system has not been investigated in corneal wound healing. To help assess the hypothesis that CTGF regulates corneal scarring, the influence of TGFisoforms on expression of CTGF in human corneal fibroblasts was investigated as well as the role of CTGF in mediating the effects of TGFon CTGF levels and collagen synthesis by cultured human corneal fibroblasts. Finally, the levels of CTGF protein and mRNA in rat corneas after PRK were measured and CTGF protein was localized in healing rat corneas.

PAGE 48

35 35 35 Materials and Methods Cell Culture Cultures of human corneal fibroblasts were established by outgrowth from corneal explants as described previously (Woost et al., 1992). Briefly, epithelial and endothelial cells were removed from corneas that were unsuitable for corneal transplantation, the stroma was cut into cubes approximately 1 mm3, placed in culture medium consisting of equal parts Dulbecco’s Modified Eagle Medium (DMEM), Medium 199 (Gibco BRL), Ham’s F12 nutrient mixture (Gibco BRL) containing 1 mM NaHCO3, and buffered with 25 mM HEPES at pH 7.4. The medium was supplemented with 10% heat-inactivated normal calf serum and 1x antibiotic-antimycotic (Gibco BRL). Cell cultures used between passages 2 and 5 for all experiments. Induction of CTGF by TGFIsoforms in Human Corneal Fibroblast Cultures Cultures of corneal fibroblasts were washed and placed in serum-free medium for 24 hours then the medium was replaced by three different concentrations of TGF1, TGF2, and TGF3 isoforms (0.1, 1.0, and 10 ng/ml) (R&D Systems, Minneapolis, MN). After 48 hours of incubation, the conditioned medium was removed, centrifuged, the supernatant solution frozen at -80 C until the samples were assayed for CTGF using the ELISA described below. The cells in each well were also collected by scraping and frozen at -80 C and total RNA was isolated as described below for measurement of mRNA levels using TaqMan quantitative RT-PCR as described below. Each level of TGFwas assayed in three replicate wells, and results were analyzed using ANOVA/MANOVA and Tukey’s HSD post-hoc test.

PAGE 49

36 36 36 CTGF Immunocytochemistry in Human Fibroblast Cultures Human corneal fibroblasts were seeded into 48-well plates and grown to confluence in serum-supplemented medium. After incubation in serum-free medium containing insulin, transferrin, and selenious acid for 72 hours, fibroblasts were then cultured for an additional 48 hours with or without 5 ng/mL TGF. Cells expressing CTGF were then detected immunohistologically using a standard avidin-biotin amplification method. Briefly, cells were fixed in cold 4% paraformaldehyde, permeabilized with Triton-X-100, and blocked with 2% milk / 10% horse serum. Fibroblasts were then sequentially incubated with goat anti-human CTGF for 1 hour at room temperature, washed three times with Tris buffer saline (TBS, pH =7.4), incubated with biotinylated horse anti-goat IgG secondary antibody (Vector Labs, Burlingame, CA), washed, incubated with alkaline phosphatase conjugated streptavidin (Dako, Carpinteria, CA), washed, then incubated with Vector Red alkaline phosphatase visualization substrate. The goat anti-human CTGF antibody was raised against recombinant human CTGF protein and was purified with a CTGF-affinity column as described previously (Duncan et al., 1999h). The antibody predominately recognizes antigenic determinants on the N-terminal sequence of CTGF. Photorefractive Keratectomy Animal Procedures were performed in accordance with the ARVO statement for the Use of Animals in Ophthalmic and Vision Research and was approved by the University of Florida Animal Care and Use Committee. Twenty adult Sprague-Dawley male rats (250 g) with normal eyes were anesthetized with an intraperitoneal injection of sodium pentobarbital (30 mg/kg). Eyelashes and whiskers surrounding the eye were removed from the visual field. A drop of proparacaine-HCl (0.05%) was applied to the

PAGE 50

37 37 37 eye and the cornea was centered under the laser microscope. Bilateral excimer laser photorefractive keratectomy was performed.(Chen et al., 2000g) Briefly, corneas were ablated in a 4.4-mm treatment zone with an excimer laser (Summit SVS Apex) in the phototherapeutic keratectomy mode. The corneal epithelium was ablated to a depth of 40 m, followed by ablation of the stroma to a depth of 20 m for a total ablation depth of 60 m. After excimer laser treatment, tobramycin (0.3%) ointment was applied to the corneal surface to prevent infection. No postoperative topical steroid was administered. At 1, 3, 7, 11, 14, and 21 days after excimer laser ablation, rats were euthanized by peritoneal injection of pentobarbital. The corneas were excised using an operating microscope and snap-frozen in liquid nitrogen followed by storage at -80 C until analysis. Four rats were euthanized at each time point. Three rats from each time point were used for protein and RNA analysis. Corneas from the left eyes were used for protein analysis. Corneas from the right eyes were pooled and used to measure mRNA for CTGF. One rat from each time point was used for immunohistochemistry. Eight corneas from four rats that did not undergo excimer ablation were used as normal controls (Day 0). Protein and RNA extraction Whole corneas or epithelial scrapings were homogenized in 200 L PBS/0.1% Triton-X-100 using a frosted glass-on-glass tissue grinder (Duall 22). Tissue extracts were centrifuged at 4 C at 15,000 x g for 15 minutes to remove cellular debris and membranes. The supernatants were measured for CTGF protein levels using an enzymelinked immunosorbent assay (ELISA). Total RNA was extracted from pooled corneas by homogenization in TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA) using a frosted glass-on-glass tissue grinder. Total RNA was extracted from each sample using

PAGE 51

38 38 38 chloroform, RNA was precipitated with 70% isopropanol at -20 C and washed with 70% ethanol. RNA pellets were dissolved in diethylpyrocarbonate (DEPC)-treated water and stored at -80 C. RNA concentrations isolated from each group were measured using a spectrophotometer (GeneQuant, Amersham/Pharmacia Biotech). CTGF Sandwich ELISA CTGF was measured in the conditioned medium of cultured cells and in tissue extracts using a capture sandwich ELISA with biotinylated and non-biotinylated affinity purified goat polyclonal antibodies to human CTGF which was produced using a baculovirus expression system as described previously (Duncan et al., 1999g). Briefly, a flat-bottom ELISA plate (Costar 96-well) was coated with 50 L of goat anti-human CTGF antibody, which recognizes predominately epitopes in the N-terminal half of the CTGF molecule at a concentration of 10 g/mL in PBS/0.02% sodium azide for 1 hour at 37 C. Wells were washed four times and incubated with 300 L of blocking buffer (PBS/0.02% sodium azide/1% bovine serum albumin) for 1 hour at room temperature. This polyclonal antibody is appropriate for detection of rat CTGF because there is a 92% amino acid identity between the sequences of rat and human CTGF in the N-terminal half of the peptide (Moussad and Brigstock, 2000). The wells were washed four times and 50 L of recombinant human CTGF protein (from 0.1 ng/ml to 100 ng/ml) or sample was added and incubated at room temperature for 1 hour. After washing, 50 L of biotinylated goat anti-human CTGF (2 g/mL) was added and incubated at room temperature in the dark for 1 hour, then washed, and 50 L of alkaline phosphataseconjugated streptavidin (1.5 g/ml, Zymed, South San Francisco, CA) was added and incubated at room temperature for 1 hour. The wells were washed again and incubated

PAGE 52

39 39 39 with 100 L of alkaline phosphatase substrate solution (1 mg/mL p-nitrophenyl phosphate, Sigma Chemicals, St. Louis, MO) in sodium carbonate/bicarbonate buffer/0.02% sodium azide, pH = 9.6. Absorbance at 405 nm was measured using a microplate reader (Molecular Devices, Sunnyvale, CA). CTGF levels were normalized for total protein content of samples using bicinchoninic acid (BCA) protein assay reagent (Pierce Chemical, Rocckford, IL) and were expressed as ng/mg protein for three replicate samples for each condition. Sensitivity of the ELISA was 0.1 ng/ml with an intra-assay variability of 3%, which is similar to a previously published ELISA for CTGF (Tamatani et al., 1998). CTGF TaqMan Assay CTGF mRNA transcripts were detected using the TaqMan real-time quantitative RT-PCR procedure (Heid et al., 1996). The TaqMan technique for measuring mRNA levels is based on the 5’ exonuclease activity of Taq polymerase on DNA/DNA oligonucleotide complexes (Holland et al., 1991). In addition to gene specific PCR primers, TaqMan uses a reporter probe that is coupled to two fluorescent dye molecules at the 5’ and 3’ ends of the probe (Livak et al., 1995). A standard curve was generated using CTGF mRNA transcripts that were transcribed in vitro from a plasmid containing CTGF cDNA. Briefly, electrocompetent E. coli cells (Stratagene, La Jolla, CA) were transformed with a plasmid (pRc/CMV, Invitrogen, Carlsbad, CA) containing the full length cDNA for human CTGF, colonies were selected with ampicillin, and 1 g of isolated plasmid was transcribed using an in vitro transcription kit (Ambion, Houston, TX). CTGF mRNA was precipitated with ethanol and dissolved in DEPC-treated water. Reactions were assembled in a 96-well optical reaction plate. Each reaction contained 1x

PAGE 53

40 40 40 TaqMan One-step RT-PCR Master Mix, 900 nM forward primer (5’AGCCGCCTCTGCATGGT-3’), 900 nM reverse primer (5’CACTTCTTGCCCTTCTTAATGGTTCT-3’), 2 M fluorescent TaqMan probe (5’6FAM-TTCCAGGTCAGCTTCGCAAGGCCT-TAMRA-3’), and RNA sample (CTGF mRNA standard or 500 ng of sample RNA) to a final volume of 25 L per reaction. The plate was analyzed on the ABI Prism 5700 Sequence Detection System (Applied Biosystem, Foster City, CA), which simultaneously performs the RT-PCR and detects fluorescence signal. A standard curve was generated using the transcribed CTGF mRNA samples (2.3 x 10-2 to 2.3 x 10-6 pmol). The level of glyceraldehyde phosphate dehydrogenase (GAPDH) mRNA was also measured in each sample using the TaqMan GAPDH Control Kit (Applied Biosytems, Foster City CA), and the number of CTGF mRNA molecules in samples was expressed as pmol CTGF mRNA per pmol of GAPDH mRNA. Levels of mRNA were expressed as mean standard error of 3 replicate samples for each condition, and ANOVA and Tukey’s HSD post-hoc test were used to assess statistical significance between times and groups. Collagen synthesis assay Collagen synthesis by human corneal fibroblasts was measured using 3H-proline incorporation as described previously (Duncan et al., 1999f;Webster and Harvey, 1979). Briefly, cultures of human corneal fibroblasts were grown to confluence in serum supplemented medium, incubated in serum-free medium for 24 hours, then incubated 24 hours with eight different supplements: (1) serum-free medium; (2) 10% serum; (3) serum-free medium with 5 ng/mL TGF1; (4) 25 ng/mL CTGF; (5) 5 ng/mL TGF1 + 50 g/mL goat anti-CTGF; (6) 5 ng/mL TGF1 + 50 g/mL non-immune goat IgG; (7)

PAGE 54

41 41 41 5 ng/mL TGF1 + 10 M CTGF antisense oligonucleotide; (8) 5 ng/mL TGF1 + 10 M control scrambled oligonucleotide (Dou et al., 1997). All treatments contained 50 g/mL ascorbic acid and 1x insulin, transferrin, and selenious acid (ITS, Invitrogen Life Technologies, Carlsbad, CA) and 1 Ci tritiated proline (Amersham Biosciences, Piscataway, NJ). The CTGF antisense oligonucleotide was a 20-mer with the sequence GCCAGAAAGCTCAAACTTGA that contained phosphorothioate ester backbone modifications with 2-O-methoxyethylribose groups coupled at base positions 1 – 6 and 16 – 20, and 5-methylcytosine substituted for all cytosines (Dean and Griffey, 1997). The CTGF antisense oligonucleotide was identified by screening 81 separate 20-mer nucleotide sequences that span the mRNA sequence for reduction of CTGF mRNA in cultured mouse cells using RNase protection assay (data not shown). The scrambled 20mer oligonucleotide control was a random mixture of AGCT bases. Addition of oligonucleotides into the culture medium penetrated membranes, accessed cellular mRNA and reduce levels of target gene mRNA (Dou et al., 1997). Wells were incubated overnight with pepsin in 0.5 M acetic acid, carrier collagen was then added and the solution was centrifuged, the collagen was precipitated and washed with 0.1 M sodium chloride in 0.1 M acetic acid and the radioactivity was measured with beta scintillation counter (Duncan et al, 1999). Results were expressed as cpm/well standard error for six replicate wells. Reverse transcriptase polymerase chain reaction (RT-PCR) Total RNA was extracted from epithelial cells obtained from ex vivo corneal scrapings from 6 rat corneas using Trizol as described above, and RT-PCR was performed using the one-step RT-PCR kit (Invitrogen Life Technologies, Carlsbad, CA)

PAGE 55

42 42 42 to detect CTGF mRNA expression. Briefly, 10 M of CTGF-specific forward primer (5’-AGTGTGCACTGCCAAAGATG-3’) and reverse primer (5’TTAGGTGTCCGGATGCACT-3’) were added to 1 g of total RNA isolated from the pooled rat epithelial cells along reverse transcriptase, nucleotides and buffer and 35 cycles of amplification were completed using an annealing temperature of 58 C, an extension temperature of 72C, and a dissociation temperature of 94C. Controls included omitting the sample RNA, reverse transcriptase, or both reverse transcriptase and Taq polymerase. PCR products were visualized on a 1.5% agarose gel with ethidium bromide and isolated using a PCR purification kit (Qiagen, Valencia, CA). The predicted 503-bp product was cleaved using a unique restriction site ( PstI ) into 405 and 98 bp fragments and were visualized on a 1.5% agarose gel with ethidium bromide. CTGF Immunohistochemistry in Corneal Sections Excised corneas from each time point were incubated in 4% para-formaldehyde / PBS overnight at 4 C and transferred to 70% ethanol. Paraffin sections were prepared and 5-micron thick sections were mounted on Superfrost/Plus microscopic slides (Fisher Chemicals, Pittsburgh, PA). Slides were deparaffinized and rehydrated using xylene and a graded series of ethanol. Slides were blocked for 30 minutes at room temperature in TBS/10% rabbit serum, incubated with affinity purified goat anti-human CTGF (14 g/ml) in TBS/10% rabbit serum overnight at 4 C, washed and incubated with biotinylated rabbit anti-goat IgG in TBS/10% rabbit serum, washed then incubated with alkaline phosphatase conjugated streptavidin followed by Vector Red alkaline phosphatase visualization substrate (Vector Labs, Burlingame, CA). Sections were photographed using bright field illumination, fluorescence microscopy with

PAGE 56

43 43 43 excitation/emission wavelengths for Texas Red staining, and Nomarski phase-contrast microscopy at 200x magnification. Photographs were taken at a constant exposure (430 ms) using a Peltier-cooled Olympus digital camera. Results Increased CTGF Expression by TGFIsoforms All three TGFisoforms induced significantly higher levels of CTGF protein in conditioned medium and mRNA in cultures of human corneal fibroblasts (Figure 3-1). Furthermore, the levels of induction of CTGF mRNA and protein were dependent on the dose of the TGFisoforms. For example, the highest dose (10 ng/mL) of TGF1, TGF2, and TGF3 increased CTGF protein production 70-fold, 200-fold, and 160fold, respectively, compared to cells cultured in serum-free medium ( p 0.001). Also, increasing concentrations of each isoform significantly increased higher levels of CTGF ( p 0.05). The largest increase in CTGF protein was produced by TGF2, which was significantly higher than TGF1 (p < 0.05). All three TGFisoforms also significantly increased levels of CTGF mRNA when compared to control cells incubated with serum-free medium. CTGF mRNA transcripts were detected at 10to 45-fold increased levels upon stimulation by TGFisoforms ( p 0.001). The results of these experiments suggest that TGFisoforms regulate CTGF expression at both the levels of transcription and translation. No significant difference between CTGF mRNA induced by the highest concentration of the three isoforms is noted. These data suggest that CTGF is regulated by TGFisoforms at both the transcriptional and translational level.

PAGE 57

44 44 44 CTGF Mediated TGF-Induced Collagen Synthesis The addition of 5 ng/mL of either TGF1 or CTGF increased collagen synthesis approximately 4-fold, (Figure 3-2). However, the increase in collagen synthesis produced by TGF1 was blocked 80% by a neutralizing goat anti-CTGF antibody, and was blocked 92% by an antisense oligonucleotide directed to human CTGF ( p 0.001). The antibody was shown to be neutralizing using the appropriate controls as shown previously (Duncan et al., 1999e). Blockage of collagen synthesis did not occur with addition of an irrelevant goat IgG or by scrambled oligonucleotides ( p 0.001). These experiments demonstrate that CTGF induced by TGFmediates the increase in collagen synthesis when TGFis added to cultures of human corneal fibroblasts. Because the antisense oligonucleotide and neutralizing antibody to CTGF did not reduce collagen synthesis to levels below that for serum-free, CTGF does not appear to mediate the basal level of collagen synthesis of corneal fibroblasts grown on plastic. Furthermore, the effects of the neutralizing antibody and the antisense oligonucleotide are not due to nonspecific toxicity of the reagents. Increased CTGF Immunostaining in Human Corneal Fibroblast Cultures Intensity of immunostaining for CTGF was markedly increased in human corneal fibroblasts cultured for 48 hours with 5 ng/mL TGF1, especially in the perinuclear region when compared to non-stimulated cells (Figure 3-3). This localization is most likely due to increased levels of newly CTGF protein in the Golgi and secretory pathway. Furthermore, CTGF immunostaining is detected in essentially all the fibroblasts

PAGE 58

45 45 45 indicating that TGF-induced CTGF synthesis is not restricted to a subpopulation of corneal fibroblasts. CTGF Expression in Rat Corneas after PRK The experimental in vitro data described above established that TGFinduces CTGF synthesis, and that CTGF mediates the effects of TGFon collagen synthesis in cultures of human corneal fibroblasts. However, it is important to assess changes in levels of CTGF mRNA and protein change during healing of corneal wounds. As shown in Figure 3-4, levels of CTGF mRNA and protein significantly increased in rat corneas at several time points following PRK. Specifically, levels of CTGF mRNA increased in the corneas beginning at Day 3 following surgery after PRK when compared to non-operated control corneas. Furthermore, the mRNA levels progressively increased and remained statistically higher than normal corneas through Day 21, reaching approximately 1,000fold higher levels than non-injured corneas. Levels of CTGF protein tended to decrease during the first 3 days after PRK, perhaps reflecting fewer epithelial cells in the healing corneas. Beginning at Day 7 following surgery, levels of CTGF protein increased dramatically, which was slightly after mRNA levels begin to increase in the corneas, and continued to increase through Day 21 following surgery reaching approximately 10-fold higher levels than non-injured corneas. By Day 21, all corneas showed significant corneal haze, corresponding with elevated levels of CTGF. These data suggest that CTGF expression in rat corneas increases after PRK in a similar fashion as seen in the TGFstimulated corneal fibroblasts.

PAGE 59

46 46 46 CTGF Immunohistochemistry in Rat Corneas Following PRK CTGF was also immunolocalized in paraffin sections of rat corneas harvested at the same time points after surgery used for protein and RNA measurements. As shown in Figure 3-5, CTGF was detected in epithelial cells and stromal fibroblasts, with light staining in the stromal matrix of normal corneas before PRK ablation (Day 0). The fluorescence image (inset) emphasizes the intense staining of the epithelium. At Day 3 after injury, there was generally less intense staining in the epithelium and stroma. On Day 7, numerous fibroblast-like cells and inflammatory cells were present, which stained strongly for CTGF. On Days 11, 14, and 21, the epithelium continued to immunostain strongly for CTGF, corresponding to the increase in CTGF protein measured in corneal homogenates (Figure 3-4). On Day 21, intense immunostaining was present on the endothelium/Descemet’s membrane. Negative controls that omitted the primary antiCTGF antibody showed faint immunostaining when viewed in Nomarski-phase contrast, bright field, and fluorescence microscopy. CTGF Expression in Corneal Epithelium The immunostained corneas indicated high levels of CTGF protein were present in corneal epithelial cells and fibroblasts. To assess whether corneal epithelial cells synthesize CTGF mRNA and protein, CTGF ELISA and RT-PCR was performed on ex vivo corneal epithelium scrapings from normal rats, since corneal epithelial cell cultures were not available. CTGF ELISA detected substantial levels (1.5 ng/mg of total detergent-extracted protein) of CTGF protein in the corneal scrapings. In addition, RTPCR generated an intense amplicon band of the predicted size (503 bp) using primers specific for rat CTGF cDNA. Furthermore, endonuclease restriction digestion using PstI generated two fragments with the predicted sizes (405 bp and 98 bp), indicating that the

PAGE 60

47 47 47 amplicon contained the correct cDNA nucleotide sequence corresponding to rat CTGF mRNA (Figure 3-6). Discussion Multiple growth factors have been detected in the cornea, including epidermal growth factor (EGF), transforming growth factor alpha (TGF, basic fibroblast growth factor (bFGF), and interleukin-1 alpha (IL-1 ), platelet derived growth factor (PDGF), and TGF, where they appear to play different and important roles in corneal wound healing (Wilson et al., 1994a;Hoppenreijs et al., 1993;Hoppenreijs et al., 1992). For example, Chen et al.(Chen et al., 2000f) reported that levels of mRNAs for TGFisoforms rapidly increased and remained elevated 90 days in rat corneas after PRK, which correlated with increases in mRNAs for Type I and Type III collagen and fibronectin and the development of corneal haze after PRK in rats. They also reported the clinical status of the rat corneas. Epithelial healing was complete by Day 7, and corneal edema increased on Day 1.5 but returned to normal by Day 7. Corneal haze progressively increased from Day 7 through Day 91 following PRK, with all corneas showing significant corneal haze on Day 21 (average clinical grade 0.83 on a 0 to 4 scale). The clinical evaluations reported previously by Chen et al (Chen et al., 2000e). correlated well with the progressive increases in levels of CTGF mRNA and protein measured in the corneas. Inhibition of TGFby repeated topical applications of neutralizing antibody reduced corneal haze in rabbits following lamellar keratectomy (Jester et al., 1997). TGFalso is a key regulator of conjunctival scarring. For example,

PAGE 61

48 48 48 subconjunctival injections of TGFcaused a rapid-onset and exaggerated scarring response in a mouse model of conjunctival scarring (Cordeiro et al., 1999c). Reducing TGFactivity by repeated subconjunctival injections of a recombinant humanized mouse monoclonal antibody to TGF2 significantly reduced conjunctival scarring and improved glaucoma filtration surgery outcome in an aggressive rabbit model of filtration surgery scarring (Cordeiro et al., 1999b). These data led to a prospective, randomized, placebo-controlled, phase I/IIa clinical trial evaluating four subconjunctival injections of a neutralizing, humanized, mouse monoclonal antibody to TGF2 into the filtering bleb of trabeculectomy patients (Siriwardena et al., 2002a). Analysis of outcomes indicated the anti-TGF2 antibody produced greater declines in intraocular pressures at 3 and 6 months and fewer interventions than control injections without causing serious adverse events or complications (Siriwardena et al., 2002b). One important finding demonstrates the upregulation of CTGF by TGFin cultured rabbit corneal fibroblasts (Folger et al., 2001c). However, the interactions between the TGFand CTGF systems in human corneal fibroblasts, and the alterations of CTGF expression during corneal wound healing have not been investigated previously. As shown in Figure 3-1, all three isoforms of TGFsignificantly increased CTGF mRNA and protein levels compared to fibroblasts in serum free medium. Although there was no significant difference in the levels of CTGF mRNA induced by the highest concentration of the TGFisoforms, the highest concentrations TGF2 and TGF3 (10 ng/ml) induced significantly higher levels of CTGF protein than TGF1. This suggests that all three TGFisoforms regulate CTGF synthesis by transcription of mRNA, but regulation of CTGF synthesis by TGF1 may also involve some post-

PAGE 62

49 49 49 transcriptional regulation. Thus, during healing of wounds, corneal fibroblasts should respond to both TGF1 and TGF2 isoforms by increasing CTGF synthesis, even though TGF1 isoform predominates in human tears(Gupta et al., 1996) and TGF2 isoform predominates in aqueous humor (Jampel et al., 1990). Interestingly, corneal fibroblasts also increased CTGF synthesis in response to TGF3 isoform, which was reported to oppose the scarring effects of TGF1 and TGF2 isoforms in a rat skin incision model (Shah et al., 1994a). Another important interaction between the TGFand CTGF systems is shown in Figure 3-2. Specifically, addition of CTGF antisense oligonucleotide or CTGF neutralizing antibody blocked over 85% of the increased collagen synthesis induced by TGF1. This demonstrates that synthesis of CTGF is required for TGFto increase collagen synthesis. However, neither antisense oligonucleotide nor neutralizing antibody totally suppressed the effect of TGFnor was collagen synthesis reduced below basal levels for fibroblasts cultured in serum free medium. This may be due to suboptimal levels of the antisense oligonucleotide and antibody, the presence of other autocrine factors that stimulate collagen synthesis such as PDGF, or to a low constitutive level of collagen synthesis by fibroblasts grown on plastic, perhaps through activation of integrin receptors. Nevertheless, antisense oligos or ribozymes targeting CTGF might be effective therapies for selectively reducing corneal scarring. The in vitro experiments shown in Figures 3-1 and 3-2 strongly indicated that TGFand CTGF systems are linked and that CTGF is an important inducer of collagen synthesis. If the hypothesis that CTGF is a major promoter of corneal scarring in vivo is correct, levels of CTGF mRNA and protein should increase in corneas during wound

PAGE 63

50 50 50 healing and scar formation. As shown in Figure 3-4, analysis of rat corneas showed little change in levels at 1 day after PRK, followed by a sharp increase in mRNA at Day 3 with a continual and almost exponential increase in mRNA levels, reaching a 1,000-fold increase on Day 21. Protein levels slightly lagged mRNA levels, with a slight decrease on Day 3 followed by a nearly 10-old linear increase to Day 21. Since CTGF is a secreted protein, it is expected that the levels of CTGF measured in the detergent extracts of the corneal homogenates to represent only a small portion of the total CTGF protein that was synthesized by corneal cells. Immunostaining indicated the sources of CTGF protein appeared to be the fibroblasts, inflammatory cells and epithelial cells, which stained intensely. Previous reports suggested that synthesis of CTGF was limited to cells of mesenchymal origin (Grotendorst, 1997c). However, corneal epithelial cells are derived from surface ectoderm (Barishak, 1992). CTGF immunostaining in the epithelial cells could be due to synthesis of CTGF or to other sources of CTGF such as the tears. Unpublished findings showed that CTGF was detected in human tears at an average level of 6.2 ng/ml. RTPCR analysis performed on samples of total RNA isolated from corneal epithelial cells scraped from rat corneas generated a single amplicon with the predicted size, which was cleaved into the unique fragments predicted by endonuclease digestion, which strongly supports the concept that corneal epithelial cells synthesize CTGF (Figure 3-6). The intensity of CTGF immunostaining roughly followed the levels of CTGF protein measured by ELISA in rat corneas, with intense staining observed in the epithelium at Day 21 and strong staining in fibroblasts and endothelial cells/Descemet’s membrane. It was recently reported that CTGF protein was present in aqueous humor at an average

PAGE 64

51 51 51 concentration of 1.24 ng/ml (van Setten et al., 2002a). CTGF may be bound to extracellular matrix proteins and glycosoaminoglycans in basement membrane since CTGF possesses a heparin-binding domain (Grotendorst, 1997b). In summary, the interaction between TGFand CTGF systems in corneal fibroblast cultures, their regulation of collagen synthesis, and the expression and localization of CTGF in the cornea during wound healing after PRK was investigated. Collectively, the data strongly support the hypothesis that CTGF is induced by TGF, mediates the effects of TGFon collagen synthesis, increases dramatically during corneal wound healing and is likely to be a key regulator of corneal wound healing. These results suggest that CTGF may be a key target for therapies that reduce scarring by selectively reducing expression of CTGF.

PAGE 65

52 52 52 Figure 3-1. Expression of CTGF by human corneal fibroblasts. CTGF protein expression was detected by ELISA and mRNA was detected using TaqMan quantitative RT-PCR assay. Cells were cultured in a 96-well plate with each group performed in triplicate. The cells were grown to confluence and starved of serum for 24 hours followed by 48-hour treatments as shown on the graph. Results are shown as ng CTGF per total mg of protein in conditioned medium for normalization or in pmol of CTGF mRNA per nmol GAPDH mRNA. Results are expressed as the mean SE. TGF1 TGF2 TGF3

PAGE 66

53 53 53 Figure 3-2. Collagen synthesis stimulation in human corneal fibroblasts by CTGF and TGF. Collagen synthesis was examined by measuring 3H-proline incorporation. Cells were cultured in a 48-well plate with each group performed six times. The cells were grown to confluence for 5-7 days and starved of serum for 24 hours followed by 24-hour treatments as shown on the graph. Amount of 3H-collagen is expressed as cpm/well. Results are expressed as the mean SE.

PAGE 67

54 54 54 Figure 3-3. Immunolocalization of CTGF in human corneal fibroblasts. Human corneal fibroblasts were grown to confluence and then rested in serum-free medium for 72 hours before stimulation with 5 ng/mL TGF1 for 48 hours. The cells were fixed followed by localization of CTGF using immunocytochemistry. Original photographs were taken at 100x magnification with 400x magnifications in the insets.

PAGE 68

55 55 55 Figure 3-4. Expression of CTGF protein and mRNA in rat corneas after PRK. CTGF protein expression was detected by ELISA and mRNA was detected using TaqMan quantitative RT-PCR assay. Three corneas were analyzed for both protein and RNA at days 0, 1, 3, 7, 11, 14, 21 after PRK. Results are shown as ng CTGF per total mg of protein in the sample for normalization or as pmol of CTGF mRNA per nmol GAPDH mRNA. Results are expressed as the mean SE.

PAGE 69

56 56 56 Figure 3-5. Immunolocalization of CTGF in rat corneas after PRK. A-F) Rat corneas were excised at day 0, 3, 7, 11, 14, and 21 after PRK. The corneas were fixed, paraffin sections were prepared, and CTGF was localized using immunohistochemistry. CTGF was localized using Vector Red reagent (see Materials and Methods). Sections were photographed at 200x magnification using bright field microscopy. Images of the same field using fluorescence microscopy are shown in the insets. G-I) Control images in Nomarski, bright field, and fluorescence microscopy are shown which lack the primary antibody. A B C D E F G H I

PAGE 70

57 57 57 Figure 3-6. Detection of CTGF mRNA in rat corneal epithelium using RT-PCR. Corneal epithelium scrapings were isolated from rats and total RNA was isolated using TRIzol reagent. Reverse transcriptase polymerase chain reaction (RT-PCR) was performed using primers that amplify a 503 bp region of rat CTGF. The PCR product was cleaved with a unique restriction site ( PstI ) into 405 and 98 bp fragments and visualized on a 1.5% agarose gel with ethidium bromide. Lane 1 – 100 bp ladder, Lane 2 – 503 bp PCR product, Lane 3 – PstI digestion of PCR product.

PAGE 71

58 58 58 CHAPTER 4 BIOCHEMICAL CHARACTERIZATION OF THE CONNECTIVE TISSUE GROWTH FACTOR RECEPTOR IN CORNEAL FIBROBLASTS Introduction CTGF mediates the effects of transforming growth factor beta (TGF) on activity in fibroblast cell types in a cycloheximide-independent manner, indicating a direct signaling pathway (Pelton et al., 1990;Igarashi et al., 1993;Kikuchi et al., 1995b). CTGF alone does not induce anchorage-independent growth of fibroblasts, which distinguishes its actions distinctly from that of TGF(Kothapalli et al., 1997b). However, little information is known about the characteristics and identity of the CTGF receptor. CTGF was shown to cross-link to a cell-surface protein of about 250 kDa in a chondrosarcoma cell line (Nishida et al., 1998b). Other studies suggest that CTGF binds to the low-density lipoprotein receptor-related protein (LRP) / alpha-2-macroglobulin receptor in bone marrow-derived stromal cells (Segarini et al., 2001a). Insulin-like growth factors I and II (IGF-I and IGF-II) are peptides with diverse functions and effects on many tissues (Stewart et al., 1996b). IGF-I and IGF-II have a tremendous impact on many tissues since they exhibit mitogenic and anti-apoptotic properties on cells (Jones and Clemmons, 1995;Sara and Hall K, 1990;Stewart et al., 1996a). Both IGF-I and IGF-II bind to the insulin receptor, the type I IGF r eceptor and the type II IGF receptor with differing affinities (Andersen et al., 1990;Gustafson and Ritter, 1990;Schumacher et al., 1991). The overexpression and/or activation of type I

PAGE 72

59 59 IGF receptor has been shown to induce ligand-dependent neoplastic transformation (Kaleko et al., 1990). The type II IGF receptor is a single chain, membrane-spanning glycoprotein, which is identical to the cation-independent mannose-6-phosphate receptor (Kornfeld, 1992), however IGF-II and mannose-6-phosphate bind to distinct domains on the extracellular region of the receptor (Marron-Teraga et al., 1998). IGF -II is a bifunctional ligand that is able to stimulate both insulin and IGF-I receptor signaling, although with different potencies. In addition, the type II IGF receptor/cationindependent mannose-6-phosphate receptor regulates IGF -II clearance (Nakae et al., 2001). Elevated expression of CTGF has been shown in fibrotic and inflamed tissue, especially in the cornea after phototherapeutic keratectomy (PRK), where scarring is prevalent (Blalock et al., 2003;Sutton et al., 1995). Significant levels of other growth factors have been detected in the cornea (Wilson et al., 1994b) such as epidermal growth factor (EGF), TGF, TGF, basic fibroblast growth factor (bFGF), and interleukin-1 alpha (IL-1 ), suggesting a role for CTGF in the process of corneal fibrosis. CTGF is regulated by TGF, and increasing evidence shows that it is most likely an important component of corneal wound healing. Investigation of the role of the CTGF receptor in corneal wound healing can provide insight into treating corneal defects as well as applications to other tissues. Thus, it is crucial to investigate the biochemical properties of the CTGF receptor and binding to human corneal fibroblasts, a valid cell culture model for corneal wound healing. Evidence in this work suggests that CTGF is a ligand for the type II IGF receptor.

PAGE 73

60 60 Materials and Methods Iodination of Recombinant Human CTGF Recombinant human CTGF was labeled with iodine-125 using a modified Chloramine-T method (Iodobead method, Pierce). One Iodobead (Pierce) was added to 200 L of reaction buffer (10 mM phosphate buffer, 0.5 M NaCl, pH = 7.4) along with 1 mCi of Na125I with constant agitation for 5 minutes at room temperature. Five micrograms of recombinant CTGF were added and the reaction was carried out at room temperature for 10 minutes with constant stirring. The labeling reaction was applied to a PD-10 G-25 Sephadex column (Pharmacia) which was pre-equilibrated with reaction buffer containing 0.1% bovine serum albumin and 0.05% Tween-20 to reduce nonspecific binding to the column. Fractions were collected and aliquots were measured in a gamma counter. A representative iodination profile of recombinant human CTGF is shown in Figure 4-1. Two-microliter fractions were separated on a 15% SDS-PAGE gel followed by exposure of the gel to X-ray film overnight. Quality of labeled CTGF was also assessed by Western blot. Fractions with the highest specific activity were pooled for use in these experiments. Specific activity was approximately 33 Ci/ g. Cell Culture Cultures of human corneal fibroblasts were established by outgrowth from corneal explants as described previously (Woost et al., 1992). Briefly, epithelial and endothelial cells were removed from corneas that were unsuitable for corneal transplantation, the stroma was cut into cubes approximately 1 mm3, placed in culture medium (equal parts Dulbecco’s Modified Eagle Medium (DMEM), Medium 199 (Gibco BRL), Ham’s F12 nutrient mixture (Gibco BRL) containing 1 mM NaHCO3, and buffered with 25 mM

PAGE 74

61 61 HEPES at pH 7.4). The medium was supplemented with 10% heat-inactivated normal calf serum and 1x antibiotic-antimycotic (Gibco BRL). Cultures of type II IGF receptor knockout cells were established in a similar fashion by outgrowth from lung tissue from knockout mice. Lung fibroblasts from normal tissue in C57BL/6 mice were used as a control. Cell Binding Experiments Human corneal fibroblasts were grown to confluence in 48-well plates. Cells were washed and incubated with chilled binding buffer alone (serum-free culture medium plus 1 mg/mL bovine serum albumin) or binding buffer with unlabeled CTGF (2 g/mL) at 4C for 1 hour. 25,000 cpm of 125I-CTGF was added to the wells and allowed to bind at 4C or 37 C for the time points (0 min, 15 min, 30 min, 1, 2 and 4 hours). Cell layers were washed five times with chilled phosphate-buffered saline containing 1 mg/mL BSA and solubilized in 1 N NaOH. Radioactivity was measured by gamma scintillation counter. Specific binding of 125I-CTGF was measured by subtracting non-specific binding (wells with unlabeled CTGF present) from total binding (wells with unlabeled CTGF absent). Each time point was performed in triplicate. To measure the specificity of CTGF binding to cell surface receptors, human corneal fibroblasts were grown to confluence in a 48-well plate. Cells were washed as described above and incubated with 1 g/mL of the unlabeled competitor (CTGF, TGF1, TGF, PDGF, EGF, FGF, or insulin) for 1 hour at 4 C. 25,000 cpm of 125I-CTGF was added to each well and incubated for 1 hour at 37 C. Cells were washed five times as described above and solubilized in 1 N NaOH. Each experimental condition was performed six times.

PAGE 75

62 62 Scatchard analysis was performed (Scatchard, 1949) on human corneal fibroblasts cultures grown to confluence in a 48-well plate. Cells were washed and incubated with increasing concentrations of unlabeled CTGF (10-11 M to 10-6) for 1 hour at 4 C. 50,000 cpm of 125I-CTGF was added to each well and incubated at 37 C for 1 hour. Cells were washed five times and solubilized in 1 N NaOH. Each condition was performed six times. A saturation curve was constructed by plotting bound pM of 125I-CTGF versus free pM 125I-CTGF. Then, a Scatchard plot was constructed using the saturation curve data and the dissociation constants were calculated. Triton-X-100 soluble membrane extracts from human corneal fibroblasts were applied to a CTGF-coupled affinity column and eluted with 0.1 M glycine (pH = 2.5). Eluted fractions were bound with 125I-CTGF in the presence or absence of unlabeled CTGF and precipitated with gamma globulin as carrier and 15% polyethylene glycol. Pellets were washed with 20% ethanol and radioactivity measured by gamma scintillation counter. Specific binding was calculated by subtracting non-specific binding from total binding. Cell Proliferation Assay Control lung fibroblasts from normal mouse lung and type II IGF receptor knockout lung fibroblasts were seeded in a 48-well plate (5000 cells per well) and cultured for 48 hours in serum-supplemented medium. The cultures were held in serumfree medium for 48 hours followed by stimulation with 10% normal calf serum, 5 ng/mL recombinant human TGF1 (R&D Systems; Minneapolis, MN), 25 ng/mL CTGF, 25 ng/mL CTGF + 6.5 g/mL RAP, 6.5 g/mL RAP, 1 mg/mL IGF-I or IGF-II (R&D Systems; Minneapolis, MN), or 5 ng/mL TGFin the presence of 10 M CTGF

PAGE 76

63 63 antisense or scrambled control oligonucleotides following 48 hours of serum-starvation. Cell proliferation was measured using a non-radioactive MTS cell proliferation assay (Promega; Madison, WI). Absorbance readings corresponding to cell proliferation were expressed as mean standard error of six replicate samples for each condition, and ANOVA and Tukey’s HSD post-hoc test were used to assess statistical significance between times and groups. Cross-Linking of 125I-CTGF to Human Corneal Fibroblast Receptors Human corneal fibroblasts were grown to confluence in two T-75 flasks. The cells were stimulated for 24 hours with 5 ng/mL transforming growth factor beta-1 (TGF1). One flask was incubated with 2 g/mL CTGF for one hour at 4 C. Then 4,000,000 cpm of 125I-CTGF was added to each flask and incubated for 2 hours at 4 C. The cells were washed three times with chilled binding buffer (128 mM NaCl, 5 mM KCl, 5 mM MgSO4, 1.2 mM CaCl2, 50 mM HEPES, 0.1% bovine serum albumin, pH = 7.5). The cells were then incubated with 10 mg/mL disuccinimidyl suberate (DSS, dissolved in dimethyl sulfoxide) for 15 minutes at 4 C. The reaction was terminated with quenching buffer at 4 C (0.25 M sucrose, 10 mM Tris HCl, 1 mM EDTA, 0.3 mM PMSF, pH = 7.4). One milliliter of quenching buffer was added to each flask and the cells were detached using a cell scraper. The two cell suspensions were centrifuged at 14,000 x g for 2 minutes at 4 C to pellet the cells. The supernatants were removed and 100 L of solubilizing buffer was added to each pellet (125 mM NaCl, 10 mM Tris, 1 mM EDTA, 1% Triton-X-100, pH = 7.0, with protease inhibitor cocktail). The cell pellets were incubated overnight with the solubilizing buffer at 4 C with constant rocking. The samples were centrifuged at 14,000 x g for 15 minutes to remove insoluble cell debris.

PAGE 77

64 64 The protein-containing supernatants were added to an equal volume of electrophoresis buffer (100 mM Tris, pH = 6.8, 20% glycerol, 3% SDS, 0.05% bromophenol blue, 180 mM 2-mercaptoethanol). The samples were heat-denatured and run on a 3-8% TrisAcetate SDS-PAGE gel (Novex). The gel was fixed, dried, and exposed to X-ray film overnight at -80 C. The molecular weights of the bands were determined by comparing to Multi-Mark molecular weight protein standards (Novex). Time Course of Binding to Rat Corneas following PRK Photorefractive keratectomy (PRK) was performed on 28 male rats as described previously (Chen et al., 2000d). Adult Sprague-Dawley male rats (250 g) with normal eyes were anesthetized with inhaled isofluorane anesthetic. Eyelashes and whiskers surrounding the eye were removed from the visual field. A drop of proparacaine-HCl (0.05%) was applied to the eye and the cornea was centered under the laser microscope. Excimer laser photorefractive keratectomy was performed. Bilateral ablation of the corneas was performed in a 4.4-mm treatment zone with an excimer laser (Summit SVS Apex) in the phototherapeutic keratectomy mode. The corneal epithelium was ablated to a depth of 40 m, followed by ablation of the stroma to a depth of 20 m for a total ablation depth of 60 m. After excimer laser treatment, tobramycin (0.3%) ointment was applied to the corneal surface to prevent infection. No postoperative topical steroid was administered. Eight corneas from four rats were harvested on Days 0, 1, 3, 5, 7, 14, and 21 after surgery. Four corneas on each day were diced with scalpels and each was placed in 1 ml of binding buffer (phosphate-buffered saline containing 1 mg/ml BSA) with 2 g/ml unlabeled CTGF and four corneas were placed in binding buffer lacking CTGF. After incubation for 1 hour at 4 C, 50,000 cpm of 125I-CTGF were added to each cornea

PAGE 78

65 65 and incubated for 1 hour at 37 C. The corneas were then washed five times in binding buffer with BSA and radioactivity measured by gamma scintillation counter. Specific binding was calculated by subtracting non-specific binding from total binding. Values were normalized to the total mass of each cornea and expressed as cpm/10 mg tissue. Immunoprecipitation of Type II IGF Receptor To further confirm the identity of the CTGF receptor as the type II IGF receptor, affinity chromatography and immunoprecipitation was performed. Briefly, Recombinant human CTGF was covalently cross-linked to Ultra-link Support Medium (Pierce) and a column was prepared. Triton-X-100 solubilized membrane protein extracts were prepared from cultures of human corneal fibroblasts and applied to the resin. Bound protein was eluted from the resin by a drop in pH to 2.5. Fractions were tested for protein concentration. Fractions were also tested for binding of 125I-CTGF for 1 hour at 4 C, followed by precipitation with 15% polyethylene glycol (PEG) and -globulins as carrier proteins. Fractions from the CTGF affinity column exhibiting the highest binding activity to 125I-CTGF were pooled. A portion of the sample was bound to 125I-CTGF following binding by a goat antibody to the type II IGF receptor. The complex was run through a Protein G affinity column. The complex was eluted from the column with a shift in pH to 3.0 with 0.1 M glycine. The amount of binding was measured by counting the samples in the gamma counter. Two controls were used: 1) competition by unlabeled CTGF and 2) non-specific binding of 125I-CTGF alone to Protein G column. Immunoprecipitation of Binding Reactions To assess the interaction between CTGF and the type II IGF receptor, in vitro binding reactions were performed followed by immunoprecipitation of the complexes.

PAGE 79

66 66 1.5-mL microcentrifuge tubes were coated with buffer containing 0.1% BSA to reduce non-specific binding to the walls of the tubes. Reactions were assembled in the presence of 10 L of 1 mg/mL BSA and 75,000 cpm 125I-CTGF according to the scheme shown in Figure 4a overnight at 4 C. The reactions were precipitated by adding 150 mL of 10 mg/mL gamma-globulin and 150 mL of 20% polyethylene glycol (molecular weight = 8000). The samples were centrifuged at 14,000 x g for 15 minutes at 4 C. Pellets were washed with 20% ethanol and radioactivity was measured by gamma scintillation counter. Each reaction was repeated in triplicate. Specificity of the reaction was measured by adding various, related unlabeled competitors (CTGF, TGF1, TGF, PDGF, EGF, FGF, insulin, RAP, IGF-II, and mannose-6-phosphate) to the binding reactions and precipitated as described. Immunoprecipitation of Cross-linked Human Corneal Fibroblast Receptors Reactions were assembled in the presence of 10 L of 1 mg/mL BSA, 1000 cpm of 125I-CTGF cross-linked human corneal fibroblast extracts and either affinity purified goat anti-human CTGF or goat anti-human sMPR (soluble cation-independent mannose6-phosphate receptor) and incubated overnight at 4 C. The reactions were precipitated and measured as described above. Results Binding of CTGF to Receptors on Human Corneal Fibroblasts Recombinant CTGF binds to receptors on human corneal fibroblasts. Specific binding to the receptors reaches maximum at about two hours at 4 C and by one hour at 37 C (Figure 4-2). Specific binding is measured by calculating the difference between total binding of 125I-CTGF and binding in the presence of excess unlabeled ligand.

PAGE 80

67 67 Binding of CTGF to cell-surface receptors at 4 C is not inhibited by the addition of other closely related growth factors ( P < 0.01, Figure 4-3). Scatchard analysis of CTGF binding to human corneal fibroblasts at 4 C reveals two classes of cell-surface receptors (Figure 4-4). One high affinity, low abundance class is observed (Kd = 3.3 nM at 18,000 receptors per cell). A second lower affinity, high abundance class is also measured (Kd = 133.3 nM at 83,000 receptors per cell). 125I-CTGF cross-links to a protein of approximately 250 kDa on human corneal fibroblasts. The interaction is not observed in the presence of excess unlabeled ligand (Figure 4-5). To confirm this interaction further, corneal fibroblast cell membrane extracts were applied to a CTGF-coupled affinity column. Fractions that were eluted from the column exhibit a significantly higher amount of CTGF specific binding (approximately 330%) when compared to total cell membrane extract (Figure 4-6). Binding of CTGF to Rat Corneas Following PRK Levels of inflammatory cytokines and growth factors are known to increase in rat corneas following laser photorefractive keratectomy (PRK) and in cultures of corneal fibroblasts, which comprise the majority of the structure of the cornea. It has been shown that the expression of CTGF is induced by PRK in rat corneas and by TGFin cultured cells (Blalock et al., 2003). To assess the possibility of up-regulation or increased availability of the putative CTGF receptor, surgery was performed to induce the corneal scarring response and its relationship with measured specific CTGF binding. Specific binding was measured by calculating the difference between total binding of 125I-CTGF and binding in the presence of excess unlabeled ligand. Specific binding of CTGF

PAGE 81

68 68 increased significantly, peaking at 5 days after surgery ( P < 0.01, Figure 4-7). Data was analyzed using ANOVA/MANOVA and Tukey’s HSD post-hoc statistical tests. CTGF Binding to the Type II Insulin-like Growth Factor Receptor When iodinated CTGF was bound to the type II insulin-like growth factor receptor and immunoprecipitated using a protein G column, over 80% of the labeled CTGF eluted from the column (Figure 4-8). It was also shown that CTGF has a specific affinity for the type II IGF receptor and is blocked by unlabeled CTGF in these fractions. In vitro binding reactions were performed to measure the amount of binding of CTGF to the type II insulin-like growth factor (IGF) receptor / cation-independent mannose-6phosphate receptor. The interaction of 125I-CTGF with soluble mannose-6-phosphate receptor (sMPR) is inhibited in the presence of unlabeled CTGF (Figure 4-9, #1-2). An affinity-purified antibody to CTGF precipitates 125I-CTGF alone and is inhibited by the addition of unlabeled CTGF (#3 and #4). These binding complexes are also precipitated by affinity-purified antibody to human sMPR (#5 and #6) or to CTGF (#7 and #8). The amount of trace 125I-CTGF precipitated by PEG alone is much lower than the binding reactions ( P < 0.01, #9). Figure 4-10 shows that the inhibition of 125I-CTGF binding to sMPR by unlabeled CTGF is not seen upon addition of closely related growth factors and IGF family members. Insulin-like growth factor II (IGF-II) competes for binding somewhat ( P = 0.09) but not to the degree of CTGF competition ( P < 0.01). Human corneal fibroblast cell membrane extracts that are covalently cross-linked with 125I-CTGF are immunoprecipitated by affinity-purified antibodies to either sMPR or to CTGF. The

PAGE 82

69 69 amount of precipitated counts is significantly higher ( P < 0.01) when compared to control antibody or the addition of no antibody (Figure 4-11). Response to Exogenous TGFin Type II IGF Receptor Knockout Cells To confirm that CTGF binds to the type II IGF receptor in cell cultures, binding and cell proliferation experiments were performed in knockout cells lacking the receptor. Figure 4-12 shows that there is no significant binding to cells lacking the type II IGF receptor when compared to normal mouse lung fibroblasts (n = 6, P < 0.01). The same two cell cultures were used to measure cell proliferation in response to exogenously added growth factors and agents (Figure 4-13). Both cell types showed increased cell proliferation in response to serum but a reduced response was seen to both TGFand CTGF ( P < 0.01). This suggests that TGF-induced cell proliferation is hindered due to the absence of a cell-surface receptor for CTGF. The presence of RAP appeared to have no effect on cell proliferation, suggesting that the low-density lipoprotein receptor-related protein (LRP) is not responsible for CTGF-mediated TGFsignaling in this cell type. A marked difference between IGF-IIand IGF-I-induced cell proliferation is evident between the knockout and wild type cells ( P < 0.01), which is expected due to absence of the type II receptor. Finally, CTGF antisense oligonucleotides blocked TGF-induced cell proliferation in both cell types, suggesting that CTGF synthesis is required and acts as a mediator of TGF’s effects on the cells ( P = 0.17). This blockage is not seen in the presence of scrambled control oligonucleotides.

PAGE 83

70 70 Discussion The presence of CTGF-specific receptors was demonstrated on the surface of human corneal fibroblasts in this study. The addition of unlabeled CTGF inhibited the binding of 125I-CTGF whereas unlabeled TGF, TGF, PDGF-BB, bFGF, EGF, insulin, IGF-I, IGF-II, or mannose-6-phosphate did not (Figure 4-3). This suggests that CTGF binds to its receptor specifically on the cell surface of human corneal fibroblasts. Scatchard analysis reveals the presence of two classes of receptors on human corneal fibroblasts with Kd values of 1.3 nM and 133.3 nM and receptor numbers per cell of 18,000 and 83,000, respectively (Figure 4-4). Previous reports have shown that CTGF binds to PDGF receptors on fibroblasts (Bradham et al., 1991a), in which 125I-labeled CTGF was not used. However, two reports using labeled CTGF have been reported (Nishida et al., 1998a;Segarini et al., 2001b) in which CTGF bound to chondrosarcoma and bone marrow-derived stromal cell lines. In the chondrosarcoma cell line study a cross-linking experiment was performed revealing a major band at 280 kDa (Figure 4-5). The molecular weight of the ligand-receptor complex indicated that the molecular weight of CTGF receptors on human corneal fibroblasts is about 242 kDa. This molecular weight is similar to the study performed in a human chondrosarcoma cell line (Nishida et al., 1998c). The addition of unlabeled CTGF resulted in a disappearance of the crosslinked band at 280 kDa, suggesting that this band is a result of a direct interaction between CTGF and its receptor. Immunoprecipitation of CTGF affinity chromatography experiments reveal that a protein or proteins present in cell membrane extracts specifically bind to CTGF (Figure 4-6).

PAGE 84

71 71 CTGF binding also increased in rat corneas following photorefractive keratectomy (Figure 4-7). Expression of CTGF (Blalock et al., 2003), TGFI, II, and III, fibronectin, and collagen (Chen et al., 2000c) has been previously shown to increase in rat corneas following PRK. Expression of TGFreceptors type I and II increases in corneal epithelium following surgery (Zieske et al., 2000), but has not been studied extensively in corneal fibroblasts. The increase in CTGF binding to corneal tissue following surgery could be due to upregulation of the CTGF receptor or increased migration of the receptors via vesicles to the cell membrane surface. This suggests a crucial involvement of CTGF and its receptor during the course of corneal wound healing. Evidence from this report suggests that CTGF binds to the type II IGF receptor in human corneal fibroblasts. In vitro binding followed by immunoprecipitation using antibodies specific for CTGF or the soluble mannose-6-phosphate receptor show that CTGF specifically interacts with the sMPR (Figure 4-9) and that this interaction is not inhibited by the addition of other growth factors (Figure 4-10). In addition, the same antibodies precipitated the majority of 125I-CTGF cross-linked cell membrane extracts present in the in vitro binding reactions (Figure 4-11). These experiments prove that CTGF interacts specifically with the type II IGF receptor on the surface of human corneal fibroblasts. CTGF was previously shown to bind to the low-density lipoprotein-related receptor (LRP) / alpha-2 macroglobulin receptor in bone marrow-derived stromal cells (Segarini et al., 2001c). This interaction was inhibited by the addition of unlabeled CTGF, lactoferrin, ApoE, LPL, and methionine-activated alpha-2 macroglobulin, all ligands for this receptor (Gliemann, 1998). However, previous studies have shown that

PAGE 85

72 72 LRP is a multi-functional scavenger receptor (Herz and Strickland, 2001), so the interaction of CTGF may be rather non-specific and not confer any real biological activity. It is likely that the binding of CTGF, which is an IGF-binding protein related molecule (Kim et al., 1997b), to the type II IGF receptor on corneal fibroblasts confers biological responses and is responsible for signal transduction activity. The data presented in Figures 4-12 and 4-13 show additional evidence of the importance of CTGF binding to the type II IGF receptor. It is clear that the ability of CTGF to bind to this receptor is necessary for TGFto transmit a biological response such as cell proliferation to cells. Also, Figure 4-12 gives further evidence that CTGF binding to the LRP does not account for a significant amount of TGF-induced cell proliferation. Many growth factor membrane receptors are composed of several different subunits. For example, it has been previously shown that FGF and hepatocyte growth factor (HGF) bind to their signaling receptors which possess tyrosine kinase activities with high affinity (Schlessinger et al., 1995;Lyon et al., 1994). However, the same growth factors also bind with low affinity to cell surface proteoglycans that cannot transmit signals alone. These experiments demonstrate the presence of two classes of receptors on human corneal fibroblasts. The low affinity class of receptor may be a proteoglycan, or even LRP, while the high affinity class is most likely due to specific binding of CTGF to the type II IGF receptor. This study shows that binding of CTGF and its receptor have a clear role in corneal fibroblasts and their interaction is likely to be crucially involved in corneal wound healing.

PAGE 86

73 73 Figure 4-1. Iodination of recombinant human CTGF. Recombinant human CTGF was iodinated using a modified chloramine-T method (Iodobead, Pierce) and applied to a G-25 Sephadex column. 2 L of each fraction was counted in a scintillation counter. Labeled protein was contained in fractions 10, 11, 12 and pooled together for use in further experiments. Presence of intact CTGF was verified by Western blot (data not shown) 0 20000 40000 60000 80000 100000 1200001 3 5 7 9 1 1 1 3 1 5 1 7 1 9 2 1 2 3 2 5 2 7 2 9 3 1 3 3 3 5Fractioncpm / 2 uL

PAGE 87

74 74 Figure 4-2. Time course of CTGF binding to human corneal fibroblasts. Human corneal fibroblasts were bound with 125I-CTGF in the presence of absence of excess unlabeled CTGF at 4C for the time points shown (n = 3). Blue – total binding, pink – non-specific binding, red – specific binding.

PAGE 88

75 75 Figure 4-3. Specificity of CTGF binding to human corneal fibroblasts. Human corneal fibroblasts were incubated with 125I-CTGF in the presence of absence of excess unlabeled growth factors at 4C (n = 6)

PAGE 89

76 76 Figure 4-4. Scatchard analysis of CTGF binding to human corneal fibroblasts. Analysis of CTGF binding to human corneal fibroblasts at 4 C in the presence of increasing concentrations of excess, unlabeled CTGF (n = 6).

PAGE 90

77 77 Figure 4-5. Cross-linking of CTGF to human corneal fibroblasts 12 5I-CTGF was covalently cross-linked to human corneal fibroblasts at 4C in the presence or absence of excess, unlabeled CTGF. Cells were solubilized and Triton-X-100 soluble fractions were separated using SDS-polyacrylamide gel electrophoresis followed by autoradiography. M – molecular weight markers in kDa, T – total binding, N – non-specific binding.

PAGE 91

78 78 Figure 4-6. CTGF affinity chromatography and specific binding. Triton-X-100 soluble human corneal fibroblast extract was applied to a CTGF-coupled affinity column. CTGF bound material was eluted at fraction 28 by shifting the pH to 2.5. Eluted fractions were bound with 125I-CTGF in the presence or absence of CTGF and precipitated with 15% polyethylene glycol. The blue line represents total protein concentration and the pink line represents specific CTGF binding.

PAGE 92

79 79 Figure 4-7. Specific binding of CTGF to rat corneas following PRK. Phototherapeutic keratectomy (PRK) was performed on male Sprague-Dawley rats. Whole corneas were removed at the time points indicated and bound with 125I-CTGF in the presence or absence of unlabeled CTGF at 4C (n = 3).

PAGE 93

80 80 Figure 4-8. Immunoprecipitation of CTGF Bound to the Type II IGF Receptor. Iodinated CTGF was bound to soluble recombinant type II IGF receptor and bound to an affinity purified goat antibody to the type II IGF receptor. The complexes were applied to a Protein G column. Fractions bound to the column were eluted by a shift in pH to 3.0 with 0.1 M glycine 0 5000 10000 15000 20000 25000 30000 35000 40000 45000 500001 4 7 10 13 1 6 19 22 25 2 8 3 1 34 37 40 43 46FractioncpmSample loaded elution

PAGE 94

81 81 Figure 4-9. Immunoprecipitation of CTGF/Type II IGF receptor complexes. Reactions were assembled according to the scheme shown above. Reactions were precipitated in the presence of gamma globulin as a carrier protein and 15% polyethylene glycol (n = 3). Reactions were assembled in the presence of 10 L of 1 mg/mL BSA and 75,000 cpm 125I-CTGF according to the scheme shown above overnight at 4 C. The reactions were precipitated by adding 150 mL of 10 mg/mL gamma-globulin and 150 mL of 20% polyethylene glycol (molecular weight = 8000). The samples were centrifuged at 14,000 x g for 15 minutes at 4 C. Pellets were washed with 20% ethanol and radioactivity was measured by gamma scintillation counter. Total precipitated cpm are shown on the graph.

PAGE 95

82 82 Figure 4-10. Specificity of CTGF binding to immunoprecipitated complexes. Reactions were assembled in the presence of various unlabeled growth factors shown and precipitated as in Figure 4-7 (n = 3).

PAGE 96

83 83 Figure 4-11. Immunoprecipitation of membrane proteins cross-linked with CTGF. 125I-CTGF was covalently cross-linked to human corneal fibroblasts at 4C in the presence or absence of excess, unlabeled CTGF. Cells were solubilized and Triton-X-100 soluble fractions were immunoprecipitated with goat anti-sMPR, goat anti-CTGF, or irrelevant goat IgG (n = 3).

PAGE 97

84 84 Figure 4-12. CTGF binding in Type II IGF receptor knockout cells. Type II IGF receptor knockout cells and wild type mouse lung fibroblasts were incubated with 125I-CTGF in the presence of absence of excess unlabeled CTGF at 4C (n = 6).

PAGE 98

85 85 Figure 4-13. Cell proliferation in Type II IGF receptor knockout cells The effect of exogenous agents on cell proliferation in type II IGF receptor knockout cells and wild type mouse lung fibroblasts cultures was measured. Cell proliferation was measured using an MTT assay. Cells were held in serum-free medium (SFM) for 48 hours followed by addition of the stimulants for 24 hours before the assay was performed.

PAGE 99

86 CHAPTER 5 ABLATION OF CONNECTIVE TISSUE GROWTH FACTOR EXPRESSION AND ACTION USING HAMMERHEAD RIBOZYMES Introduction Ribozymes are catalytic RNA molecules first discovered twenty years ago that target and cleave specific sequences through base-pairing interactions (Kruger et al., 1982;Guerrier-Takada et al., 1983). After the ribozyme cleaves the bound target RNA, the products are released and recycled so th at the process can be repeated many times. Since ribozymes could be repeatedly targeted to cleave almost any target transcript in vitro its effectiveness as a therapeutic ag ent in vivo was investigated (Cech, 1988a;Usman and Blatt, 2000). Extensive study of trans -cleaving ribozymes, such as hairpin and hammerhead ribozymes, have shown their abilities in reducing the target RNA of interest (Symons, 1992). Extensive investigations have defined the nucleotide sequences in naturally occurring ribozymes that retain the core catalytic nuclease activity (Scott et al., 1996). This knowledge has enabled investigators to design synthetic ribozymes that act as gene specific endonucleases by combining the catalytic core nucleotide sequence with flanking nucleotide sequences that are complementary to a target genes mRNA sequence (Cech, 1988b;Sullivan, 1994). The consensus structure of the naturally occurring hammerhead ribozyme consists of three helical regions radiating from a central unpaired core, comprising the catalytic domain and the substrate portion. The hammerhead catalytic domain (so named because of its secondary RNA structure) has been mapped to a small core sequence of less than 40 nucleotides. Mutational

PAGE 100

87 87 analysis showed that base substitutions were responsible for reducing activity in the unpaired regions of the molecule, whereas mutations in the helical regions showed no effect as long as base pairing was maintained. Experimental data has shown that the nucleotide sequence represented by G-U-N, flanked by properly based paired segments, are the best candidates for cleavage (Haseloff and Gerlach, 1988). This suggests the possibilty of engineering a synthetic hammerhead ribozyme that selectively binds and cleaves a complementary mRNA molecule, then releases the fragments to repeat the process with the efficiency of a protein enzyme. Several studies have shown the effectiveness of hammerhead ribozymes in modifying gene expression in vitro and in vivo For example, a preformed hammerhead ribozyme directed against tumor necrosis factor alpha (TNF) mRNA significantly reduced the expression of both mRNA and protein in human promyelocyte leukemia cells (Sioud et al., 1992). Additionally, a hammerhead ribozyme delivered by an adenovirus vector system led to a significant reduction in human growth hormone mRNA in a transgenic mouse system (Lieber and Kay, 1996). Also, ribozymes targeting oncogenes caused tumor cells to lose their metastatic potential in nude mice (Abounader et al., 1999). Several clinical trials have focused on the possibility of developing ribozymebased therapies for reducing human immunodeficiency virus (HIV) infection using retroviral vectors (Bauer et al., 1997;Wong-Staal et al., 1998). A separate study showed that a synthetic hammerhead ribozyme selectively cuts the mRNA for a dominant negative form of rhodopsin that causes an inherited form of retinitis pigmentosa but does not destroy the mRNA for the normal allele of rhodopsin using adeno-associated virus (AAV) vectors (Drenser et al., 1998b). In these experiments, a point mutation in the mutant allele created a hammerhead ribozyme cleavage site. It was further shown that

PAGE 101

88 88 ribozyme rescue was maintained in rats up to eight months after treatment, and that ribozymes were effective even when injected later in the degeneration after significant photoreceptor cell loss (LaVail et al., 2000). These results show that ribozyme rescue appears to be a potentially effective, long-term therapy for autosomal dominant retinal degeneration and is highly effective even when the gene transfer is performed after significant photoreceptor cell loss. Since the upregulation of connective tissue growth factor (CTGF) seems to be correlated with increased incidence of fibrosis and collagen deposition in many tissues, especially the cornea, one avenue for antifibrotic therapy is to reduce expression of CTGF. The use of antisense oligonucleotides and neutralizing antibodies to CTGF has been investigated previously (Blalock et al., 2003;Duncan et al., 1999d). To assess the hypothesis that a reduction of CTGF expression can positively affect the rate of wound healing, the influence of gene-specific ribozymes on cleavage of synthetic targets in vitro was investigated, the effect of CTGF ribozymes on expression of CTGF mRNA and protein in cell culture was measured, and the effect of CTGF ribozymes on TGFmediated cell proliferation was surveyed. Materials and Methods Ribozyme Design and Synthesis Potential ribozyme target sites within the human CTGF cDNA sequence were initially selected based on identification of the single-stranded regions and elimination of sites based on secondary structure (Wilson et al., 1996) reduced the number to four putative targeting sites within the human CTGF mRNA. Among these four sites, two containing the highest A and U content were selected for subsequent analysis (CHR 745

PAGE 102

89 89 and CHR 859). Corresponding 33mer RNAs containing a hammerhead ribozyme and 12mer RNA targets were chemically synthesized as 2-ACE protected oligonucleotides (Dharmacon Research Inc.; Lafayette, CO). The sequences of the synthetic target oligonucleotides were CHR 745: 5CCUGGUCCAGAC-3 and CHR 859: 5CAUGGUCAGGCC-3 (Figure 5-1). The sequences of the synthetic ribozymes to target these two substrate RNAs were CHR 745: 5GUCUGCUGAUGAGUCCUUCGGGACGAAACCAGG-3 and CHR 859: 5GGCCUCUGAUGAGUCCUUCGGGACGAAACCAUG-3 (Figure 5-1). Ribozyme Time-course and Multi-turnover Kinetics Target oligonucleotides were de-protected according to the manufacturers directions and labeled with -[32P]-dATP using the following reaction: 2 l oligo-RNA (10pmol/ l), 1l RNasin (Promega; Madison, WI), 1l 0.1M DTT, 3 l ddH2O, 1l [ 32P]-dATP, 1l 10x PNK buffer, and 1l T4 polynucleotide kinase (Roche Molecular Biochemicals; Indianapolis, IN). The reaction was incubated at 37C for 30 minutes, and then diluted to 100 l with ddH2O, followed by extraction with phenol/chloroform/isoamyl alcohol (25:24:1). Free nucleotides were removed by passing the aqueous layer on a Sephadex G25 fine spin column. RNA was ethanol precipitated and resuspended in 100 l ddH2O to a final concentration of 0.2pmol/l. Ribozyme cleavage reactions were performed in the presence or absence of various concentrations of ribozyme and target RNA in a reaction mix (20 l) containing 40 mM Tris/HCl, pH=7.5 and 20 mM MgCl2. Samples were incubated at 37 C and the reaction was initiated by addition of ribozyme to target RNA. At the increasing times, the reactions were arrested with the addition of a 6 L of 90% formamide, 50 mM EDTA (pH=8.0), 0.05% xylene cyanol, and 0.05% bromophenol blue. Reaction products were separated on

PAGE 103

90 90 a 19% polyacrylamide gel containing 8 M urea, and were quantitated by radioanalytic scanning (PhosphorImager; Molecular Dynamics, Durham, NC). In the time course study, reaction mixtures included 10 pmol ribozyme and 100 pmol target RNA (containing 0.2 pmol -[32P]-target). Reactions were stopped at 0.5min, 1min, 2min, 3min, 4min, 5min, 10min, 30min, 1hr, 2hr, 3hr and 15hr. In the multiturnover study, reactions were stopped at 1min. Reactions included 0.015 pmol/ L of ribozyme and increasing concentrations of target RNA (0.15-15 pmol/ L) shown in Table 5-1. Plots of substrate concentration over velocity versus substrate concentration were used to determi ne v al ues for maxim um v elocity (Vm ax ), Michaeli s-Menten constant (Km), and reaction rate at saturating substrate concentration (Kcat). 1 2 3 4 5 6 7 8 9 10 11 12 Ribozyme 0 0.015 0.015 0.015 0.015 0.015 0.015 0.015 0.015 0.015 0.015 0.015 Target 0.15 0.15 0.3 0.6 0.9 1.2 1.5 3.0 6.0 9.0 12 15 Plasmid Construction Because of its better kinetic properties, CHR 745 was chosen as the candidate to test CTGF hammerhead ribozyme efficiency in cells. Single-stranded synthetic DNA oligonucleotides encoding ribozymes were chemically synthesized. The sequences were, CHR745 sense: 5-AGCTGGCCTCTG ATGAGTCCTTCGGGACGAAACCATGTGCA3, CHR 745 antisens e: 5-CATGGTTTCGT CCCGAAGGACTCATC AGAGGCC. A second pair of oligonucleotides was constructed, replacing underlined nucleotides (C G, G C) to create a control inactive ribozyme. The complementary oligonucleotides were

PAGE 104

91 91 annealed, producing NsiI and HindIII restriction sites (Promega; Madison, WI). The fragments were inserted into the pTR-UF-21HP vector, which had been linearized with HindIII and NsiI restriction enzymes. Synthesis of the ribozyme is driven by the chicken -actin promoter and CMV enhancer in this vector. The presence and correct orientation of the insert was verified by DNA sequencing. Since the pTR-UF21HP vector contains a hairpin ribozyme following the insert site, it can self-cleave the mRNA when transcribed in the cell, yielding a relatively short 3 arm of hammerhead ribozyme, improving cleavage efficiency (Figure 5-2). Cell Culture and Transfection Cultures of human newborn foreskin fibroblasts (ATCC; Manassas, VA) were cultured in equal parts Dulbeccos Modified Eagle Medium (DMEM), Medium 199 (Gibco BRL), Hams F12 nutrient mixture (Gibco BRL) containing 1 mM NaHCO3, and buffered with 25 mM HEPES at pH 7.4. The medium was supplemented with 10% heatinactivated normal calf serum and 1x antibiotic-antimycotic (Gibco BRL). Exponentially growing cells were transfected with vector (pTR-UF21), inactive ribozyme plasmid (pTR-UF21-In) or active CTGF ribozyme plasmid (pTR-UF21-CHR745) using Lipofecatime reagent (Invitrogen Life Technologies; Carlsbad, CA). Since pTR-UF-21 confers neomycin resistance, cells that were transfected stably were selected with Geneticin (G418 Sulfate, Invitrogen Life Technologies Carlsbad, CA). 48 hours after transfection, G418 was added to the culture medium at a concentration of 200 g/ml. After 7 days, selected cells were transferred to 48-well plates.

PAGE 105

92 Cells in 48-well pl ates were held in serum-free medium for 48 hours before RNA extraction (Qiagen; Valencia, CA). CTGF mRNA transcripts were detected using the TaqMan real-time quantitative RT-PCR procedure (Livek et al. 1995). A standard curve was generated using CTGF mRNA transcripts that were transcribed in vitro using T7 RNA polymerase from a plasmid containing CTGF cDNA. CTGF transcript was precipitated with ethanol and dissolved in DEPC-treated water. Reactions were assembled in a 96-well optical reaction plate. Each reaction contained 1x TaqMan Onestep RT-PCR Master Mix, 900 nM forward primer (5-AGCCGCCTCTGCATGGT-3), 900 nM reverse primer (5-CACTTCTTGCCCTTCTTAATGGTTCT-3), 2 M fluorescent TaqMan probe (5-6FAM-TTCCAGGTCAGCTTCGCAAGGCCT-TAMRA3), and RNA sample (CTGF mRNA standard or 500 ng of sample RNA) to a final volume of 25 L per reaction. The plate was analyzed on the ABI Prism 5700 Sequence Detection System (Applied Biosystem, Foster City, CA), which simultaneously performs the RT-PCR and detects fluorescence signal. A standard curve was generated using the transcribed CTGF mRNA samples (2.3 x 10-2 to 2.3 x 10-6 pmol). The level of glyceraldehyde phosphate dehydrogenase (GAPDH) mRNA was also measured in each sample using the TaqMan GAPDH Control Kit (Applied Biosytems, Foster City CA), and the number of CTGF mRNA molecules in samples was expressed as pmol CTGF mRNA per pmol of GAPDH mRNA. Levels of mRNA were expressed as mean standard error of six replicate samples for each condition, and ANOVA and Tukeys HSD post-hoc test were used to assess statistical significance between times and groups.

PAGE 106

93 CTGF was measured in conditioned medium and in cytoplasmic extracts of serum-starved, cultured cells using a capture sandwich ELISA with biotinylated and nonbiotinylated affinity purified goat polyclonal antibodies to human CTGF. Briefly, a flatbottom ELISA plate (Costar 96-well) was coated with 50 L of goat anti-human CTGF antibody at a concentration of 10 g/mL in PBS/0.02% sodium azide for 1 hour at 37 C. Wells were washed four times and incubated with 300 L of blocking buffer (PBS/0.02% sodium azide/1% bovine serum albumin) for 1 hour at room temperature. The wells were washed four times and 50 L of increasing concentrations of recombinant human CTGF protein or sample were added and incubated at room temperature for 1 hour. After washing, 50 L of biotinylated goat anti-human CTGF (2 g/mL) was added and incubated at room temperature in the dark for 1 hour, then washed, and 50 L of alkaline phosphatase-conjugated streptavidin (1.5 g/ml, Zymed, South San Francisco, CA) was added and incubated at room temperature for 1 hour. The wells were washed again and incubated with 100 L of alkaline phosphatase substrate solution (1 mg/mL p-nitrophenyl phosphate, Sigma Chemicals, St. Louis, MO) in sodium carbonate/bicarbonate buffer/0.02% sodium azide, pH = 9.6. Absorbance at 405 nm was measured using a microplate reader (Molecular Devices, Sunnyvale, CA). CTGF levels were normalized for total protein content of samples using bicinchoninic acid (BCA) protein assay reagent (Pierce Chemical, Rockford, IL) and were expressed as ng/mg protein for six replicate samples for each condition. Levels of protein were expressed as mean standard error of six replicate samples for each condition, and ANOVA and Tukeys HSD post-hoc test were used to assess statistical significance between times and groups.

PAGE 107

94 Control cells (non-transfected), and cells transfected with vector, inactive CTGF ribozyme plasmid, or active CTGF ribozyme plasmid were seeded in a 48-well plate (5000 cells per well) and cultured for 48 hours in serum-supplemented medium. The cultures were stimulated with 5 ng/mL recombinant human TGF1 (R&D Systems; Minneapolis, MN) following 48 hours of serum-starvation. Cell proliferation was measured using a non-radioactive MTS cell proliferation assay (Promega; Madison, WI). Absorbance reading corresponding to cell proliferation were expressed as mean standard error of six replicate samples for each condition, and ANOVA and Tukeys HSD post-hoc test were used to assess statistical significance between times and groups. Results Kinetics of CTGF Hammerhead Ribozymes Time course and multi-turnover studies were performed to test the kinetic properties of the ribozymes. Chemical synthesized RNA was labeled by -[32P]-ATP using polynucleotide kinase (PNK). Polynucleotide kinase catalyzes the transfer of the terminal phosphate of ATP to the 5'-hydroxyl terminus of riboand deoxyribonucleotides. Two products were produced following cleavage of the labeled synthetic products by the ribozyme: a 7-nucleotide 5 product and a 5-nucleotide 3 product. The intact oligo-RNA and 5 product, labeled by -[32P]-ATP, were detectable by radioanalytic scanning. In time course studies, CHR 859 was significantly more active than the CHR 745, cleaving 92% compared with 22% at 30 minutes and 94% compared with 46% at the end of incubation (Figure 5-3). Data shown are the result of two experiments. To estimate the catalytic efficiency of these ribozymes, steady-state cleavage velocities were measured

PAGE 108

95 95 with constant amounts (15 pM) of ribozyme and increasing concentrations (15015,000pM) of the substrate. The enzymatic reactions demonstrate Michaelis-Menten kinetics and were analyzed using Haynes-Wolff plots (Figure 5-4). CHR 859 showed a Km of 1.56 M and a Kcat of 2.97/min while CHR 745 had a Km of 7.80 M and a Kcat of 5.7/min. The turnover numbers (an estimate of the second order rate constant) of CHR 859 and CHR 745 were 1.9 x10-6M/min and 7.4 x10-5 M/min, respectively, thus CHR 859 is 2.6 times more efficient. Effect of Ribozymes on CTGF Expression in Cell Culture Because of its better kinetic parameters, CHR 859 was chosen to test the efficiency of cleavage of CTGF mRNA in cell culture. Expression of CTGF mRNA was measured by quantitative RT-PCR and CTGF protein was measured by enzyme-linked immunosorbent assay (ELISA). Results showed that CTGF mRNA expression in CHR 859-transfected cells was decreased by 55% (p < 0.01, n = 6) compared with control groups (Figure 5-5). CTGF protein expression was measured in conditioned medium and in cytoplasmic extracts. In cells transfected with the active CTGF ribozyme, CTGF protein was significantly reduced (by 72% in conditioned medium and 71% in the cytoplasm, p < 0.01, n = 6) compared with control groups (Figure 5-6). Effect of Ribozymes on TGF-mediated Cell Proliferation Since CTGF is a putative mediator of TGF-induced cell proliferation in cells in culture, the effect of ribozymes on hindering this process was performed. As seen in Figure 5-7, cells transfected with the active ribozyme to CTGF showed a marked decrease (90%, p < 0.01, n = 6) in cell proliferation when compared to control cell

PAGE 109

96 groups. This implies that the use of CTGF ribozymes have a physiological effect on cells as well as decreasing CTGF mRNA and protein expression. Discussion The roles of growth factors in wound healing such as epidermal growth factor (EGF), transforming growth factor alpha (TGF, basic fibroblast growth factor (bFGF), and interleukin-1 alpha (IL-1 ), platelet derived growth factor (PDGF), and TGF, are well-established. For example, levels of TGFmRNA increase in many fibrotic disorders such as lung fibrosis and liver cirrhosis (Nall et al., 1996;Kurt et al., 1992). These levels are correlated with increased expression of extracellular matrix genes, such as type I and type III collagen, integrins, and fibronectin (Chen et al., 2000b;Irving and Lala, 1995). Treatment of glioblastoma cell lines with antisense oligonucleotides to TGF1 decreased expression of collagen types I and IV, laminin, and fibronectin (Paulus et al., 1995). Furthermore, treatment of full-thickness incision wounds with neutralizing antibodies to TGFdecreased severity of fibrosis (Brahmatewari et al., 2000). Changes in CTGF expression during wound healing and the interactions between the TGFand CTGF system have been established in several systems. All three isoforms of TGFincrease CTGF mRNA and protein expression in human dermal and corneal fibroblasts (Tamatani et al., 1998;Blalock et al., 2003). CTGF also mediates the effects of TGFon collagen synthesis and cell proliferation in fibroblast cultures (Duncan et al., 1999c;Blalock et al., 2003;Hashimoto et al., 1998b;Shimo et al., 1999). Antisense oligonucleotides and neutralizing antibodies to CTGF decrease TGF-

PAGE 110

97 97 mediated collagen synthesis (Duncan et al., 1999b;Blalock et al., 2003). This suggests that CTGF may be an important target in reducing scarring, however antisense oligonucleotides and neutralizing antibodies may prove to be more effective if used in conjuction with ribozymes. Since ribozyme technology has been used successfully in reducing mRNAs in various experimental systems, it is likely to be effective in reducing the rate of fibrosis in vivo by blocking CTGF expression. The CTGF ribozymes used in these experiments show kinetics similar to other hammerhead ribozymes used in similar assays as seen in Figures 5-3 and 5-4 (Lewin et al., 1998;Drenser et al., 1998a). Some differences exist between the kinetics of CHR 745 and CHR 859, which may be due to some unexpected secondary structure which can inhibit the efficiency of the ribozyme to cleave the target RNA. There are limitations to data obtained from in vitro cleavage experiments because of the complex secondary structure of full length mRNA, which is why it will be necessary to test the effectiveness of ribozymes in cell culture before developing a suitable animal model. Expression of ribozymes in fibroblast cell cultures have been shown to effectively reduce the expression of mRNAs of interest (Propsting et al., 2000;Dawson and Marini, 2000). Similarly, ribozymes targeted to CTGF mRNA significantly reduced the expression of CTGF mRNA and protein in human dermal fibroblasts (Figures 5-5 and 56). TGF-induced cell proliferation was measured to prove that the ribozyme-mediated reduction in CTGF expression has a physiological effect on cells. As seen in Figure 5-7, reduction of CTGF expression was sufficient enough to significantly reduce the capacity of TGFto induce cell proliferation in the fibroblast cultures.

PAGE 111

98 98 These experiments prove that synthetic ribozymes cleave CTGF target mRNA in vitro and that dermal fibroblasts expressing an active CTGF ribozyme show decreased expression of CTGF mRNA and protein compared to control cells or cells expressing an inactive CTGF ribozyme. In addition, cells expressing an active CTGF ribozyme exhibit a reduced response to TGFon stimulating fibroblast proliferation in cultures. These results further prove that CTGF mediates some of the effects of TGFin wound healing and that CTGF may be a key target for therapies by selectively reducing expression. CTGF ribozyme used in conjunction with antisense oligonucleotides or neutralizing antibodies may have a maximal effect in reducing the expression of CTGF and potentially reducing scarring and fibrosis. Ribozymes were developed that effectively cleave target sequences of mRNAs for CTGF, and the significantly reduced the levels of CTGF mRNA and protein in cultured cells. The next phase of the development is to begin testing the ribozymes in vivo using rat and rabbit models of excimer-induced corneal haze. It may be necessary to suppress the actions of CTGF for weeks or months after corneal injury to reduce corneal scarring, in which case delivery of the ribozymes by an adenovirus or adeno-associated virus (AAV) vector may be very effective. One of the goals of this project is to develop agents that will reduce corneal scarring with minimal side effects. To test this possibility, initial experiments using ribozymes to target CTGF mRNA were performed. Development of ribozyme therapy is important because there are no agents to block corneal scarring other than steroids, which have not shown to be of much benefit after PRK. Some non-specific anti-cancer drugs have been used to treat corneal scarring such as 5-fluorouracil and mitomycin C but they cause serious side effects in some instances such as epithelial defects and endothelial cell

PAGE 112

99 99 damage. Because of these problems ribozyme-mediated gene therapy may be a good candidate for treatment. In these studies, a gene-specific hammerhead ribozyme targeting CTGF was developed and was shown to reduce the expression of CTGF in cell culture as well as reduce the biological effects of CTGF. Further animal studies will be performed in the future to confirm that the ribozyme has a similar effect in vivo in a wound healing model. It is likely that the use of ribozymes in conjunction with treatment with antisense oligonucleotides or neutralizing antibodies will reduce the fibrosis in the cornea after injury that leads to haze. These treatments have many advantages over current treatment options because they will selectively inhibit scarring without resulting in serious side effects. These modes of treatment can also be modified to act not only on corneal fibrosis, but also on fibrotic conditions throughout the body.

PAGE 113

100 100 Figure 5-1. Structure of synthetic RNA oligonucleotides. CTGF hammerhead ribozyme (CHR 745, left and CHR 859, right) 33mer RNAs were synthesized along with corresponding 12mer target RNA to the sequence of CTGF. The target RNA is shown on the top and the ribozyme RNA is directly below the complimentary base pairs

PAGE 114

101 101 Figure 5-2. Structure of self-cleaving hairpin ribozyme. The self-cleaving hairpin ribozyme follows the hammerhead ribozyme cloning site in pTR-UF-21. When transcribed the hairpin ribozyme cleaves the sequence following the right arm of hammerhead ribozyme.

PAGE 115

102 102 Figure 5-3. Ribozyme cleavage time-course analysis. Time course of CTGF target RNA cleavage by CHR 859 (left) and 745 (right). Cleavage reaction durations ranged from 0 minutes to 15 hours (15 hour data point not shown).

PAGE 116

103 103 Figure 5-4. Multi-turnover kinetic analysis. Haynes-Wolff plots are shown indicating Michaelis-Menton kinetics for CHR 859 (left) and 745 (right). The duration of the cleavage reactions was one minute.

PAGE 117

104 104 Figure 5-5. Effect of CHR 745 on mRNA expression. The effect of CHR 745 on CTGF mRNA expression in human dermal fibroblast cultures was examined. CTGF mRNA was measured using TaqMan quantitative RT-PCR and results were normalized to GAPDH mRNA. Cells were transfected with vector, inactive ribozyme plasmid, or active ribozyme plasmid and selected with G418. 0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6ControlpTR-UF21Inactive CTGF Ribozyme Active CTGF RibozymeCTGF mRNA / GAPDH

PAGE 118

105 105 0 20 40 60 80 100 120 controlpTR-UF-21inactive CTGF ribozyme active CTGF ribozymeCell Proliferation (%) SFM TGF-beta Figure 5-6. Effect of CHR 745 on protein expression. CTGF protein was measured in cytoplasmic extracts and conditioned medium samples of human dermal fibroblast cultures using a CTGF ‘sandwich’ ELISA and results were normalized for total protein concentration.

PAGE 119

106 106 0 0.5 1 1.5 2 2.5 3 3.5 4 4.5 5controlpTR-UF21Inactive CTGF Ribozyme CTGF RibozymeCTGF (ng/mL) Conditioned Medium Cytoplasm Figure 5-7. Effect of CHR 745 on TGF-induced cell proliferation. The effect of CHR 745 on TGF--induced cell proliferation in human dermal fibroblast cultures was examined. Cell proliferation was measured using an MTT assay. Cells were transfected with vector, inactive ribozyme plasmid, or active ribozyme plasmid and selected in G418. Cells were held in either serum-free medium (SFM) or medium containing 10 ng/mL TGF-1 24 hours before assaying. Data are normalized based on control cells in serum-free medium (0% proliferation) and control cells treated with TGF(100% proliferation).

PAGE 120

107 107 CHAPTER 6 GENE EXPRESSION ANALYSIS OF CONNECTIVE TISSUE GROWTH FACTOR STIMULATED HUMAN CORNEAL FIBROBLASTS Introduction The field of microarray technology utilizes the hybridization properties of nucleic acids to measure the expression of DNA or RNA on a very large scale. Genomics research has been revolutionized by advances in microarray procedures and data analysis because of the possibility of examining the expression of thousands of genes simultaneously. It is important to understand the roles that genes and their products play in the context of biological processes and functions. This can be accomplished by correlating sequences of genes to specific biological functions through the study of gene expression patterns. This advantage of simultaneously studying thousands of genes under different conditions of stimulation or disease states offers great potential to the study of human disease and prevention. Several methods are currently available for the largescale analysis of gene expression patterns such as gene membrane arrays and GeneChip microarrays. Gene chip microarrays have many advantages, especially the ability to measure the expression of thousands of genes in one sample with very rigorous analysis procedures. Affymetrix expression probe array chips utilize immobilized 25-base pair oligonucleotide probes. For each gene, 11-16 probes or tiles are present on the chip and the sequences are taken from different locations along the transcript. Perfect match and mismatch probes are present on the chip microarrays. The perfect match probes are

PAGE 121

108 108 designed to be complementary to a reference sequence and the mismatch probes are also designed to be complementary to the reference sequence except for a homomeric base mismatch at the central position. Mismatch probes serve as control for crosshybridization. The probes are organized into probe cells, which contain millions of probe molecules. A probe pair consists of two probe cells, a perfect match and its corresponding mismatch. A probe set consists of 11-16 probe pairs and provides the information necessary for the expression analysis of each gene. In the first step of the analysis, the scanned image is imported into the GeneChip software and a grid is automatically placed and aligned over the scanned image of the array. The average intensity of each probe cell is then calculated along with the background and noise values. The noise is a measure of the degree of pixel-to-pixel variation within the same probe cell. To obtain the net intensity, the software subtracts the background and noise from the average intensity of each probe cell. Next, the average difference for each probe set is calculated. Statistical algorithms are used to determine significance in detected probe sets. The average difference is an average of the differences in net intensity between every perfect match probe cell and its control mismatch probe cell within each probe set and is directly related to the level of expression of the transcript. The average difference value for each gene at each experimental time point undergoes variance normalization and the most variable genes and ESTs are clustered through hierarchical algorithms using Cluster and Treeview (Eisen et al. 1998). The clustering procedure groups together genes on the basis of their common expression patterns across the time points. Each cluster is then identified and an analysis is performed on any gene that encodes for proteins of interest.

PAGE 122

109 109 The classes of genes regulated by CTGF need to be examined to better understand how CTGF affects wound healing. Currently, only a few genes are known to be regulated by CTGF. For example, CTGF increased mRNA levels for type I collagen, type IV collagen, fibronectin, 5 integrin, laminin, and caspase 3 while decreasing mRNA levels for several anti-apoptosis genes including BCL-2, apoptosis inhibitors 1 and 2, and survivin (Hishikawa et al. 2001). Microarray technology is the best way to efficiently and accurately attempt to broadly define the action of CTGF on gene expression in human corneal fibroblasts. This approach allows for simultaneous measurement of thousands of known genes and expressed sequence tags (EST) in the same samples. These experiments will help assess our hypothesis that CTGF is integral in the regulation of corneal wound healing and will elucidate the classes of genes that are involved in this process. Materials and Methods Cell Culture and RNA Isolation Cultures of corneal fibroblasts were established by outgrowth from human corneal explants as described previously (Woost et al. 1992). Briefly, epithelial and endothelial cells were removed from corneas that were unsuitable for corneal transplantation, the stroma was cut into cubes approximately 1 mm3, placed in culture medium consisting of equal parts Dulbecco’s Modified Eagle Medium (DMEM), Medium 199 (Gibco BRL), Ham’s F12 nutrient mixture (Gibco BRL) containing 1 mM NaHCO3, and buffered with 25 mM HEPES at pH 7.4. The medium was supplemented with 10% heat-inactivated normal calf serum and 1x antibiotic-antimycotic (Gibco BRL). Cell cultures were used at passage 2 for all experiments. Cells were seeded in twelve 75-cm2 tissue culture flasks.

PAGE 123

110 110 Prior to treatment, cells were rinsed with serum-free medium and incubated with serumfree medium for an additional 48 hours. After exposure to 25 ng/mL recombinant human CTGF for 0, 0.5 or 24 hours, total RNA was isolated using RNeasy kits (Qiagen; Valencia, CA). Total RNA was isolated from four independent replicates of each time point of CTGF exposure and processed in parallel. cRNA Preparation and Array Hybridization Total RNA was converted into double-stranded cDNA using a custom doublestranded cDNA synthesis kit (SuperScript II; Invitrogen, Gaithersburg, MD). cDNA was extracted and in vitro transcription reactions were performed (BioArray HighYield RNA Transcript Labeling Kit; Enzo Biochemicals, Inc.; Farmingdale, NY) according to the manufacturer’s protocol. Following purification, the labeled cRNA was quantified by spectrophotometric analysis, and fragmented to 30 to 60 base fragments with Tris-acetate (pH 8.1; 40 mM), KOAc (100 mM), and MgOAc (30 mM) in a 40-L volume heated for 35 minutes at 94C. Protocols for instrumentation, cRNA sample preparation and labeling, hybridization to U95A v2 human microarrays, washing, staining, and scanning were followed as recommended in the Affymetrix Expression Analysis technical manual (Affymetrix, Santa Clara, CA). Data Analysis Microarray data analysis: Scanned images (*.dat files) were analyzed with Affymetrix Microarray Suite V 5. Raw Qs ranged from 1.6 to 2.9. Average Background ranged from 42 to 95. Chips were normalized using global normalization with an average target gene intensity of 500. Scaling factors ranged from 2.5 to 10.

PAGE 124

111 111Expression filter: Probe Sets that were flagged as absent on all arrays analyzed in this study by the Affymetrix Microarray Suite v 5 software using default settings were removed from the datasets subjected to k-means, hierarchical cluster analysis, and supervised learning analysis. After this expression filter was applied the dataset was reduced from 12,625 probe sets to 7,834 probe sets. Variation Filter: The gene expression observations (signal intensities) of the probe sets remaining after applying the expression filter obtained from the 12 U95Av2 GeneChips were subjected to a variation filter. The coefficient of variation was calculated for each probe set across the 12 chips and the probe sets were ranked by the coefficient of variation of the observed single intensities. Variance Normalization: After removing Affymetrix control probe sets, the tophalf of the dataset (observation of 3,894 probe sets) as determined by ranking of the coefficient of variation was normalized to a mean of 0 and a standard deviation of 1. Cluster Analyses: K-means and hierarchical cluster analyses were preformed using the variance normalized dataset and viewed with the algorithms in the software packages Cluster and TreeView (Eisen et al. 1998). Hierarchical clustering arranges genes into tree structures to view gene linkages while K-means clustering partitions genes into a pre-determined amount of clusters. “Spaghetti” graphs were generated using Genesis 1.13 developed by Sturn to examine the gene expression profiles in each group of the K-means clustering analysis (Wenger et al., 1999a). Supervised Learning, Discrimination Analysis, and Cross Validation: The hybridization signal intensities of the 7,834 probe sets that passed the expression filter were analyzed to identify probe sets, that displayed differential hybridization signal

PAGE 125

112 112 intensities, p < 0.001, between the three treatment classes, unstimulated (0 hr CTGF stimulation), 0.5 hr CTGF stimulation, and 24 hr CTGF stimulation using BRB Array Tools (Ye et al. 2003). The validity of probe sets identified at the p 0.001 significance level in predicting treatment class was established using “leave-one-out” cross validation where the data from one array was left out of the training set and probe sets with differential hybridization signal intensities (p 0.001) were identified from the remaining 8 arrays. The probe sets so identified were then used to predict the class label (unstimulated, 0.5 hr CTGF stimulation, or 24 hr CTGF stimulation) of the array that was left out of the training set. Three methods of class prediction were used: nearest neighbor, three nearest neighbor, and nearest centroid analysis. Results Unsupersived Analysis Four flasks of human corneal fibroblasts were evaluated in each of three groups: control (cells held in serum-free medium) and two experimental groups. The experimental groups were treated with recombinant human CTGF for either 30 minutes of 24 hours. The RNA was isolated from the fibroblast cultures and processed for microarray analysis in the manner described above. The resulting data set was filtered to remove data from probe sets that were not detected above background on any of the arrays. A variation filter was applied to remove signals from probe sets that did not vary much in the experiment. The signals of the remaining probe sets were then subjected to unsupervised hierarchical cluster analysis as shown in Figure 6-1. The primary node of separation was between control and 30 minute samples, indicating that cells treated with CTGF have significant expression changes compared to cells grown in serum-free

PAGE 126

113 113 medium with no treatment. The results also suggest that after 24 hours of CTGF stimulation, gene expression patterns had not returned to those seen in control (unstimulated cells). The image presented in Figure 6-1 shows the hierarchical cluster pattern of the top half of hybridization intensities ranked based on coefficient of variation (representing 3,894 probe sets) whose expression varied the most upon stimulation of the cells with CTGF. This figure shows the TreeView representation of the data set after clustering. The color scale shows whether the expression of the gene is higher (red) or lower (green) than its mean expression value across the time course of CTGF stimulation. Genes with similar expression patterns cluster together in this view. The dendrogram at the top of the figure shows the similarity of the expression patterns observed throughout the time course. The dendrogram shows that replicate arrays cluster together, and that there are Chip number Array ID 1 nearest neighbor correct? 3 nearest neighbors correct? Nearest centroid correct? 1 0 hr – r1 YES YES YES 2 0 hr – r2 YES YES YES 3 0 hr – r3 YES YES YES 4 0 hr – r4 YES YES YES 5 0.5 hr – r1 YES YES YES 6 0.5 hr – r2 YES YES YES 7 0.5 hr – r3 YES YES YES 8 0.5 hr – r4 YES YES YES 9 24 hr – r1 YES YES YES 10 24 hr – r2 YES YES YES 11 24 hr – r3 YES YES YES 12 24 hr – r4 YES YES YES Percent correctly classified 100 100 100 Table 6-1. Leave-one-out cross-validation anal y sis

PAGE 127

114 114 discrete groups of genes that are positively and/or negatively affected in response to CTGF at 0.5 and 24 hours when compared to non-treated cells. Supervised Analysis To identify genes whose expression levels varied between treatment classes, a supervised learning method was used to identify probe sets representing genes with significant differences in expression. The dataset was divided among three classes (0 hr, 0.5 hr and 24 hr exposure to CTGF) and significant differences in hybridization signal intensity at the p < 0.001 level of significance were identified using an F-test. In all 2,761 probe sets were identified as significant at p < 0.001. The ability of these probe sets to act as a classifier of time of exposure to CTGF was assesed using leave-one-out cross validation and permutation analysis. Results of this analysis show that the classifiers were able to correctly identify all the correct treatment group (Table 6-1). The changes in gene expression in the corneal fibroblasts throughout the time course of CTGF stimulation are most easily visualized using k-means clustering (Figure 6-2). Ten groups were chosen for the K-means clustering analysis to examine the expression profiles after CTGF stimulation. Clusters 1-5 represent classes of genes that were down-regulated in the corneal fibroblasts upon exposure to CTGF and clusters 6-10 represent classes of genes that were up-regulated. The pie charts in Figure 6-3 show the gene functional groups present in each of the clusters which comprise 5% or more of the total cluster. The ‘other’ category represents genes of unknown function, ESTs, unclassified genes, and functional groups comprising less than 5% of the cluster. Certain functional groups fall into logical clusters based on the limited number of genes that are known to be affected by CTGF. For example, about 8% of the genes in cluster 9 fall into

PAGE 128

115 115 the extracellular matrix proteins family. Several members of this group, such as collagen I, fibronectin, and laminin have been previously shown to be upregulated at 24 hours after stimulation by CTGF (Hishikawa et al. 2001). The functional group intracellular kinase network members (containing such genes as mitogen-activated protein kinases and other protein kinases) is present in clusters 2 through 5, all of which show a down-regulation by CTGF. Also of interest, a substantial number of ribosomal protein genes grouped into clusters that were up-regulated by CTGF at 0.5 and 24 hours (clusters 8 and 9). In contrast, some of the RNA processing, turnover, and transport genes grouped into clusters that were down-regulated at 0.5 and 24 hours, while others showed patterns similar to the ribosome protein genes. Other genes of interest had more complex patterns of regulation. Genes in clusters 5 and 6 (including groups such as oncogenes/tumor suppressors and cytoskeleton/motility proteins) were down regulated at 0.5 hours but were up-regulated at 24 hours, while genes in clusters 1 and 10 (including groups such as general trafficking genes and nucleotide metabolism genes) were the inverse pattern, and were up-regulated at 0.5 hours but down-regulated at 24 hours. Selected Genes of Interest Examination of the groups in Figure 6-2 shows the distinct gene expression responses to corneal fibroblasts when treated with CTGF. Ten groups were examined using k-means clustering of the 2,761 genes with an F-test p < 0.001 for variance normalized data presented in Figures 6-2 and 6-3 show the overall patterns of changes in gene expression at the two time points. In addition, 141 genes from the 2,761 genes were selected that fall into functional groups of particular interest to CTGF physiology. For example, previous reports have theorized that CTGF mediates TGF--induced apoptosis

PAGE 129

116 116 in aortic smooth muscle cells and hepatoma cells (Hishikawa et al. 1999a; Hishikawa et al. 2000; Coyle et al. 2002). Certain apoptosis-associated genes, such as the caspases, have been previously shown to be up-regulated by CTGF (Frazier et al. 1996). As shown in Table 6-2, caspases 4, 7, and 8 fall into clusters 8 and 10, which contain genes that were up-regulated at 0.5 hours by CTGF. In addition, the anti-apoptosis gene, BCL2, was rapidly down-regulated by CTGF (2.3-fold decrease at 0.5 hours, cluster 5), then returned to near 0 hour levels at 24 hours in accordance with previously published reports (Frazier et al. 1996; Hishikawa et al. 1999b). Thus, the array data support the hypothesis that CTGF has a transient influence on expression of apoptosis-related genes. Since CTGF is implicated in regulating scar formation, it is also of particular importance to note the influence of CTGF on expression of extracellular matrix genes. Collagens I, III, IV, fibronectin, laminin, and integrins are all important extracellular matrix genes and all are present in clusters that show increased expression after 24 hours of CTGF stimulation. Additionally, CTGF upregulated levels of mRNAs for chondroitin sulfate proteoglycan (versican) and heparan sulfate proteoglycan (perlecan), which play key roles in hydration of the corneal matrix and act as ligands for integrin receptors (Hirose et al. 2001; Saika et al. 2000), indicating that it may play a role in regulating adhesion between the cell and substratum (Yamagata et al, 1993; Malmstrom et al, 2002). CTGF is a member of the insulin-like growth factor binding protein (IGFBP) family and seems to have an effect on numerous members of this family (Bork 1993). This observation is important because alteration of IGFBP family member expression has been associated with various tumors (Astifoli et al. 2001; Vorwerk et al. 2002). CTGF also upregulates matrix metalloproteinase-1 (MMP-1, interstitial collagenase), suggesting a

PAGE 130

117 117 role in adhesive signaling (Chen et al, 2001). Another interesting trend to note is that expression of alpha smooth muscle actin increases 2.4-fold in response to CTGF. This may imply that CTGF plays a role in the transformation of corneal keratocytes to myofibroblasts and cellular contraction (Jester et al. 1999). These findings are consistent with unpublished data on the stimulation of human corneal fibroblast contraction of relaxed collagen gels by CTGF and different from the lack of an effect on rabbit corneal fibroblasts (Folger et al. 2001). CTGF has also been suggested to play a role in regulating angiogenesis. CTGF decreased thrombospondin type 1 mRNA (cluster 3) and increased expression of vascular endothelial growth factor (cluster 8). Thrombospondin-1 (TSP-1) is a bifunctional regulator of angiogenesis that depends on its concentration and the state of its proteolytic fragmentation. At low concentrations, the whole TSP-1 molecule and the aminoterminus stimulated angiogenesis in a rabbit cornea model, perhaps by up regulating expression of MMPs that are necessary for degrading basement membranes of capillaries and CTGF in the inactive CTGF/VEGF complex which releases active VEGF (Hashimoto et al, 2002; Ferrara 2002). This is consistent with report of CTGF stimulating migration of vascular endothelial cells and angiogenesis in the chick chorioallantoic membrane assay (Shimo et al. 1999). At higher concentrations, thrombospondin inhibits angiogensis, perhaps by binding and inactivating VEGF (Ferrara 2002).

PAGE 131

118 118 Table 6-2. Selected genes of interest. Genes of interest from the data in Figure 6-2 were chosen. Genes likely to be most affected by CTGF stimulation are involved in wound healing, cell signaling, and extracellular matrix production. Fold changes (FC) are shown along with the clusters identified in Figure 6-2.

PAGE 132

119 119 Table 6-2. Selected genes of interest continued

PAGE 133

120 120 Table 6-2. Selected genes of interest continued Discussion Gene expression in human corneal fibroblasts were examined at two time points during culturing with CTGF. The patterns of expression of genes in four of the ten clusters (1, 5, 6, and 10) showed striking changes in the levels at 0.5 hours compared to the levels at 0 and 24 hours. We interpret the changes observed at the 0.5 hour time point to represent the most immediate, direct effect of CTGF on the regulation of expression of each gene. The level of expression for each gene at 24 hours probably represents the integration of both the direct effects of CTGF combined with possible indirect effects of genes regulated by CTGF. Thus, measuring expression levels at only 24 hours would indicate the opposite trend measured at 0.5 hours for genes in clusters 1 and 6, and would have missed important information about the temporal response of genes to CTGF. This Table 6-2. Selected genes of interest continued

PAGE 134

121 121 would be important for some irreversible physiological processes such as apoptosis that are triggered by transient changes in gene expression. In these experiments, the predominate interest is in the roles that CTGF plays in corneal wound healing. There are several important events in this process that may utilize CTGF as a regulatory mediator. Apoptosis of fibroblasts occurs very rapidly after an injury to the corneal epithelium. Also, formation and remodeling of scar tissue occurs involving extracellular matrix turnover, changes in growth factor levels, corneal scar contraction, loss of corneal clarity, and scar turnover. A third important event that CTGF may regulate is corneal angiogenesis, which is a critical component of the wound healing process. A previous report showed that apoptosis occurs in quiescent keratocytes within the first 24 hours following corneal injury. This process may be a physiological response to reduce the development or establishment of viral infections after an injury to corneal epithelial cells (Wilson et al. 1997). This phenomenon is partially attributed to the Fas/Fas ligand system proven by the fact that Fas knockout mice show decreased incidence of keratocyte apoptosis in response to epithelial scrape injury (Wilson et al. 1997). CTGF may prove to be another rapid inducer of apoptosis because caspases 4, 7, and 8 are turned on and off rapidly whereas BCL2 is turned off and on rapidly. Later actions of CTGF may be to promote migration, cell proliferation, and extracellular matrix production. In previous reports, CTGF increased collagen synthesis in human corneal fibroblasts and cell proliferation in normal rat kidney cells (Duncan et al. 1999; Blalock et al. 2003). It is interesting to note that apoptosis was not observed in these experiments. This could be due to the fact that CTGF was present continuously over 24 hours, where

PAGE 135

122 122 the initial pulse of CTGF may be responsible for the upregulation of caspases and downregulation of BCL2 seen at 0.5 hours. Continuous CTGF exposure has been reported to stimulate mitosis in other systems such as in smooth muscle cells and cultured hepatocytes, which may account for the lack of apoptosis in this experiment (Fan et al. 2000; Paradis et al. 2002). CTGF has also been implicated in regulating production of the extracellular matrix. The general trend in this study was that CTGF upregulated ECM components, up-regulated proteases that degrade the ECM at 24 hours (MMP1, 9, 3), and regulated the inhibitors of MMPs (TIMPs). This suggests that CTGF plays an important role in regulating the turnover of the extracellular matrix during corneal wound healing. CTGF also regulated the expression of a number of growth factors associated with wound healing. CTGF downregulates macrophage colony stimulating factor and insulin-like growth factor 2 (IGF-2), two factors that are extremely important in regulating the metastatic state of cells (Pederson et al. 1999). Also, CTGF was not found to be autoregulatory as has been shown with TGF-(Kelley et al. 1993). At the same time, CTGF upregulated basic fibroblast growth factor (bFGF) and vascular endothelial growth factor (VEGF), which are heavily involved in the regulation of angiogenesis. Previous reports have shown that CTGF appears to have a direct effect on angiogenic actions in the chick chorioallantoic membrane assay (Eguchi et al. 2001). Here, we report the downregulation of thrombospondin-1, which is an inhibitor of angiogenesis (Lawler 2002). Taken together, these results suggest a role for CTGF in the regulation of angiogenesis.

PAGE 136

123 123 There are no other published reports of microarray analysis of gene expression in cells exposed to CTGF, especially corneal fibroblasts. However, there is a report of changes in gene expression of human corneal fibroblast cultures exposed to interleukin-1 alpha (IL-1) (Mahajan et al. 2002). This report showed changes in expression of approximately 165 genes after culturing cells for 24 hours in IL-1, using a low stringency probability cut off of p = 0.05. These experiments showed that CTGF expression was decreased 3.2-fold in response to IL-1, but CTGF did not significantly alter expression of IL-1 in this study. However, with 12,000 genes and ESTs on the chip microarray, it is possible that as many as 600 genes could randomly be misidentified as having changes in expression. Another report showed microarray analysis of stimulation of human corneal epithelial cells by TGF(Hayashida-Hibino et al. 2001). TGFdownregulated caspases in these experiments while upregulating genes such as 3 integrin and cyclin D1. In a closely related experiment, microarray analysis of rat corneas following photorefractive keratectomy was performed to better understand the cellular response to injury and the dynamic changes that occur in gene expression patterns as the wound heals.(Varela et al. 2002) The proposed role of CTGF in corneal fibroblasts is presented in Figure 6-4. These experiments suggest that CTGF is one such gene that is heavily involved in regulating the response to injury in the cornea.

PAGE 137

124 124 Figure 6-1. Hierarchical clustering patterns. The top half of hybridization intensities (3,894 probe sets) of genes responding to CTGF stimulation was clustered (using Cluster software) and organized with TreeView (shown here). The dendrogram at the top of the figure shows similarities between chips. The color scale at the bottom represents standard deviation from the mean. Genes which are green are down-regulated and genes which are red are up-regulated in human corneal fibroblasts upon exposure to CTGF. r= replicate number; r = Pearson’s correlation coefficient. S.D. From Mean <-2.0 -1.0 0 1.0 > 2.0 0 hr –r1 0 hr –r2 0 hr –r3 0 hr –r4 0.5 hr –r1 0.5 hr –r2 0.5 hr –r3 0.5 hr –r4 24 hr –r1 24 hr –r2 24 hr –r3 24 hr –r4

PAGE 138

125 125 Figure 6-2. K-means clustering analysis. K-means clustering analysis was performed on 2,761 genes (F test P < 0.001) to ten binds using Cluster software and organized with TreeView (a). The ten bins (b) illustrate the classes of genes that are differentially expressed in human corneal fibroblasts upon stimulation by CTGF. The ‘spaghetti’ graphs shown on the right illustrate the expression profiles of the individual genes contained within each of the same ten clusters present in the TreeView image on the left. p = number of probe sets in each bin. 1 2 3 4 5 6 7 8 9 10 6 1 2 7 3 4 8 9 5 10 S.D. From Mean <-2.0 -1.0 0 1.0 > 2.0 0 hr –r1 0 hr –r2 0 hr –r3 0 hr –r4 0.5 hr –r1 0.5 hr –r2 0.5 hr –r3 0.5 hr –r4 24 hr –r1 24 hr –r2 24 hr –r3 24 hr –r4Standard Deviation From the Mean 3 2 1 0 -1 -2 -3 3 2 1 0 -1 -2 -3 3 2 1 0 -1 -2 -3 3 2 1 0 -1 -2 -3 3 2 1 0 -1 -2 -3 3 2 1 0 -1 -2 -3 3 2 1 0 -1 -2 -3 3 2 1 0 -1 -2 -3 3 2 1 0 -1 -2 -3 3 2 1 0 -1 -2 -30 hr –r1 0 hr –r2 0 hr –r3 0 hr –r4 0.5 hr –r1 0.5 hr –r2 0.5 hr –r3 0.5 hr –r4 24 hr –r1 24 hr –r2 24 hr –r3 24 hr –r4 0 hr –r1 0 hr –r2 0 hr –r3 0 hr –r4 0.5 hr –r1 0.5 hr –r2 0.5 hr –r3 0.5 hr –r4 24 hr –r1 24 hr –r2 24 hr –r3 24 hr –r4 a b p=137 p=176 p=414 p=290 p=98 p=473 p=273 p=273 p=417 p=210

PAGE 139

126 126 Figure 6-3. Functional groups of genes regulated by CTGF. K-means clustering analysis was performed on 2,761 genes (F test P < 0.001). Ten clusters were chosen to illustrate the classes of genes that are differentially expressed in human corneal fibroblasts upon stimulation by CTGF. The functional groups of genes which comprised the greatest percentage of each cluster are shown in the pie charts. Expressed sequence tags, unknown proteins, and genes comprising less than 5% of the total number of genes are grouped together in the ‘other’ category. 1 2 3 4 5 6 9 8 7 10 Cytoskeleton/motility proteins Oncogenes and tumor suppressors Metabolism Other intracellular transducers/modulators Protein modification enzymes Intracellular kinase network members General trafficking G-proteins Extracellular matrix proteins RNA processing, turnover, transport Growth factors, cytokines, and chemokines Ribosomal proteins Transcription activators and repressors N ucleotide metabolis m Metabolism of cofactors and vitamins Other

PAGE 140

127 127 Figure 6-4. The proposed role of the effect of CTGF on corneal fibroblasts. TGFrelease CTGF injury SCAR FORMATIONcell proliferationECM proteinsheparan/chondroitinsulfate proteoglycansgrowth factors and receptors -smooth muscle actin, scar contraction APOPTOSIScaspasesBCL-2 ANGIOGENESISVEGF, PDGF-R thrombospondin-1

PAGE 141

128 128 CHAPTER 7 CONCLUSIONS One of the major complications of corneal trauma, infection and refractive surgery is the phenomenon of corneal scarring. A vast amount of research on the field of stromal wound healing and corneal haze formation exists yet there are still many events that are not well understood. The major objective of this research is to understand the regulatory events of stromal wound healing at the molecular level and to apply this knowledge towards the design of treatments that will selectively inhibit certain molecular pathways that may promote scarring. It is currently known that the transforming growth factor beta (TGFfamily plays a dominant role in the regulation of stromal scarring. More specifically, it is known to play a crucial role in the formation of corneal haze in rats following a refractive surgery model (Chen et al., 2000a). The results of these experiments specifically provided support for the hypothesis of the involvement of CTGF in the process because of its established regulation by TGF-. The hypothesis for these experiments is that CTGF is a major factor that induces scar formation by mediating many of the effects of TGFon extracellular matrix production and the development of corneal haze after injury. Prior to this research, very little was known about the involvement of CTGF in the cornea. Only two reports showed the detection of CTGF mRNA in retrocorneal membranes and the upregulation of CTGF by TGFin cultured rabbit corneal fibroblasts (Wunderlich et al., 2000a;Folger et al., 2001d). These preliminary findings support the hypothesis of the involvement of CTGF

PAGE 142

129 129 in corneal wound healing. The examination of human clinical specimens can provide some important information about the levels of CTGF at one particular stage of a disease process, but what would be of more value is a chronological analysis of CTGF in a controlled reproducible corneal wound model. Based on the information that is known about TGF-, it is likely that it will also upregulate expression of CTGF mRNA and protein in corneal fibroblasts as well as the CTGF receptor. The increased amounts of CTGF message would then likely regulate many genes that are involved in the formation of scar tissue. It is also likely that CTGF expression increases in healing corneal wounds. In addition, stimulation of corneal fibroblasts by CTGF is likely to stimulate classes of genes at many time points, especially groups that are known to be involved in wound healing and regulation of the extracellular matrix. Therefore, agents that reduce CTGF and/or the CTGF receptor would be good candidates for reducing corneal scarring whether using ribozymes or antisense oligonucleotides. One of the goals of these experiments was to prove the hypothesis that CTGF is a major inducer of corneal scarring and that it is a mediator of the effects of TGFon cellular responses in fibrosis. Perhaps the strongest evidence is given in Figure 3-2, showing that blocking CTGF with antisense oligonucleotides or a neutralizing antibody blocks the induction of collagen synthesis by TGF-. Increased expression of CTGF protein and mRNA were also found (Figure 3-4) which correlates with several experiments showing the same result in other fibrotic animal models. This is the first example of an analysis of CTGF expression in human corneal tissue as well as patterns of expression in a healing corneal wound. This experiment was important to answer the question of the time course of CTGF expression in the cornea. It was not known if

PAGE 143

130 130 corneal injury caused an early ‘spike’ of CTGF expression or whether there is a more prolonged and gradual elevation. Also, this information is necessary with regards to the development of anti-scarring treatments so that the optimal time of delivery can be determined. It was also important to identify which cells in the cornea synthesize CTGF during corneal wound healing, as well as which isoforms of TGFinduce this response. This is important so that the target cells can be identified for treatment with antisense oligonucleotides and ribozymes to achieve the maximal effect in the reduction of corneal scarring. Figure 3-1 showed that all three isoforms of TGFinduce CTGF mRNA and protein expression. Current data would suggest that CTGF is synthesized by corneal fibroblasts and acts through a paracrine mechanism to stimulate the surrounding fibroblasts. However, Figure 3-5 shows that CTGF immunostaining in rat corneas localizes to the corneal epithelium (which was confirmed by RT-PCR and ELISA) as well as to the fibroblasts in the corneal stroma. This may suggest a constant constitutive expression of CTGF in the epithelium, while expression in the corneal fibroblasts may increase in response to corneal injury. As with all growth factor systems, it is very important to characterize both the growth factor and its specific receptor because the response of cells is determined by the interaction between the ligand and its receptor. Furthermore, reducing the expression of the CTGF receptor in corneal fibroblasts may reduce the response of corneal cells to CTGF more effectively than attempting to reduce synthesis of CTGF, especially if it has multiple sources. For example, it is now known that CTGF is synthesized and secreted into tears by lacrimal gland cells (van Setten et al., 2002c). Also, if activated

PAGE 144

131 131 macrophages synthesize CTGF, the cells that enter the cornea several days after the initial injury might not be effected by topical eye drops of antisense oligonucleotides or ribozymes given when the injury is first created. Therefore, the optimal strategy to reduce CTGF signaling in corneal fibroblasts or epithelial cells may be to reduce synthesis or availability of the putative CTGF receptor. These experiments also showed specific binding of 125I-CTGF to cultured human corneal fibroblasts consisting of two classes of binding, a lower-abundance, high affinity binding component with a Kd of 5 nM and a higher-abundance lower affinity class of sites with a Kd of 166 nM. Chemical cross-linking of 125I-CTGF to a single high molecular weight protein of 250 kDa was also achieved whose binding is competed for by unlabeled CTGF. CTGF affinity column chromatography was also used to purify a protein fraction from Triton X-100 solubilized human corneal fibroblasts. When the fraction that purified with the CTGF-affinity column was incubated with a goat antibody to the type II-IGF receptor, 80% of the 125I-CTGF binding was immunoprecipitated. This indicates that the vast majority of the 125I-CTGF specific binding in human corneal fibroblasts is due to the type II IGF receptor protein. Also, fibroblasts lacking the type II IGR receptor do not show CTGF binding and do not respond to induction of cell proliferation by TGF-. This is similar to other unpublished findings showing that incubation of NRK fibroblasts with an antibody to the type II IGF receptor blocked approximately 60% of the TGF--induced increase in collagen synthesis. Additionally, the levels of 125I-CTGF binding at various time points in rat corneas following PRK were measured to calculate the number of available receptors following corneal injury. Figure 4-6 shows a coordinated increase in both CTGF binding and CTGF protein and mRNA

PAGE 145

132 132 (Figure 3-4) in corneas in the early period after corneal injury. In summary, these biochemical and cell culture data strongly indicate that the type II IGF receptor is the CTGF signaling receptor. The type II IGF receptor is a well-characterized integral membrane protein that is also known as the cation independent mannose 6-phosphate receptor. Two distinct, non-interacting binding sites have been identified, one for IGF-II and one for mannose 6-phosphate. In addition to binding IGF-II and proteins that contain mannose 6-phosphate groups in N-linked glycosylation side chains, the type II IGF receptor is also involved in activation of latent TGF-. The activation occurs through binding the mannose 6-phosphate groups on the latency-associated peptide of latent TGFand binding of cell membrane associated transglutaminase. These experiments have confirmed the hypothesis that the type II IGF receptor is the CTGF signaling receptor. Therefore, it is most likely that antisense oligonucleotides and ribozymes that target the type II IGF receptor w ill block the mitogenic effects of CTGF on fibroblasts in the cornea. Since the long-term goal of this project is to develop agents that will reduce corneal scarring with minimal side effects, initial experiments using ribozymes to target CTGF mRNA were performed. Development of ribozyme therapy is important because there are no agents to block corneal scarring other than steroids, which have not shown to be of much benefit after PRK. Some non-specific anti-cancer drugs have been used to treat corneal scarring such as 5-fluorouracil and mitomycin C but they cause serious side effects in some instances such as epithelial defects and endothelial cell damage. Because of these problems ribozyme-mediated gene therapy may be a good candidate for treatment. In these studies, a gene-specific hammerhead ribozyme targeting CTGF was

PAGE 146

133 133 developed and was shown to reduce the expression of CTGF in cell culture as well as reduce the biological effects of CTGF. Further animal studies will be performed in the future to confirm that the ribozyme has a similar effect in vivo in a wound healing model. It is likely that the use of ribozymes in conjunction with treatment with antisense oligonucleotides or neutralizing antibodies will reduce the fibrosis in the cornea after injury that leads to haze. These treatments have many advantages over current treatment options because they will selectively inhibit scarring without resulting in serious side effects. These modes of treatment can also be modified to act not only on corneal fibrosis, but also on fibrotic conditions throughout the body. Figure 3-2 established the hypothesis that CTGF is a potent inducer of type I collagen synthesis in cultures of human corneal fibroblasts. Also, it was shown that CTGF mediates TGFinduction of collagen and that all three isoforms of TGFinduce CTGF mRNA and protein as seen in normal rat kidney fibroblasts (Duncan et al., 1999a). These findings alone justify defining the role of CTGF in corneal wound healing. However, to understand how CTGF affects the process of corneal wound healing, it is necessary to examine the genes that are regulated by CTGF as broadly as possible. Presently, only a few genes are known that are regulated by CTGF as mentioned in Chapter 6. The most efficient and accurate approach to broadly define the action of CTGF on gene expression in the cornea is to utilize microarray technology with cultured human corneal fibroblasts. This allows for the simultaneous measurement of thousands of known genes and expressed sequence tags in one sample. Analysis of microarray data by variance normalization, hierarchical and K-means clustering reveals important relationships between groups of genes that will permit the testing of previous concepts

PAGE 147

134 134 and the generation of new hypotheses in corneal wound healing. Data obtained from these microarray experiments show that CTGF regulates many components of the extracellular matrix in corneal fibroblasts, such as collagen, integrin, fibronectin, and laminin. This suggests that CTGF is a potent inducer of scar formation in the cornea. Also, CTGF seems to regulate events in apoptosis and angiogenesis as discussed in Chapter 6. These experiments demonstrate that CTGF has an impact on the expression of groups of genes in the cornea and that expression of genes involved in corneal scar formation could be lowered by blocking CTGF, leading to a reduction in corneal scarring. In summary, the experiments represented here support the proposed hypothesis that CTGF is a key player in regulating corneal scarring. The data show that levels of CTGF mRNA and protein increase in rat corneas during healing of excimer ablation wounds, that all three TGFisoforms induce CTGF mRNA and protein in cultured human fibroblasts, that CTGF induces collagen synthesis, and most importantly that inhibiting CTGF blocks the TGF--induced collagen synthesis in cultured human fibroblasts. The CTGF binding protein in cultured human fibroblasts was also identified using a combination of biochemical techniques that include chemical cross-linking of 125I-CTGF to cultured fibroblasts, CTGF affinity column chromatography and immunoprecipitation. Results of these binding studies as well as experiments performed on knockout cell lines have led to the identification of the type II IGF receptor, also known as the cation-independent mannose 6-phosphate receptor, as a candidate CTGF receptor. Although CTGF is a mitogen for fibroblasts and a strong inducer of collagen synthesis, very little is known about the regulation of other genes by CTGF. The most

PAGE 148

135 135 effective method to understand the broad actions of CTGF on corneal gene expression and wound healing is to use microarray gene chip technology to initially identify genes that are changing. The microarray analysis of CTGF-regulated gene expression in cultured human corneal fibroblasts has identified a number of genes that are up-regulated by CTGF including multiple collagens, actin, and fibronectin. More importantly, the microarray data indicates that CTGF also down-regulates many gene classes, showing that it does not have purely stimulatory effects on corneal cells. The microarray data was used to test previous hypotheses about corneal wound healing and to generate new hypotheses about how CTGF influences scar formation. The results suggest that CTGF regulates key genes involved in corneal wound healing events such as scar formation, angiogenesis, and apoptosis. These experiments have made tremendous progress in developing and evaluating the role of CTGF and its receptor in the process of corneal scarring. Based on the reported effects of CTGF in other fibrotic conditions and in these experiments, evidence suggests that CTGF is a major regulator of corneal scar formation and mediates many of the fibrotic effects of TGFin corneal scarring.

PAGE 149

136 LIST OF REFERENCES 1. Abounader R, Ranganathan S, Lal B, Fielding K, Book A, Dietz H, Burger P, and Laterra J. 1999. Reversion of human glioblastoma malignancy by U1 small nuclear RNA/ribozyme targeting of scatter factor/hepatocyte growth factor and cmet expression. J. Natl. Cancer Inst. 91:1548-1556. 2. Albrecht C, von Der Kammer H, Mayhaus M, Klaudiny J, Schweizer M, and Nitsch RM. 2000. Muscarinic acetylcholine receptors induce the expression of the immediate early growth regulatory gene CYR61. J. Biol. Chem. 275:2892928936. 3. Andersen A, Kjeldsen T, Wiberg F, Christensen P, Rasmussen J, Norris K, and Moller K. 1990. Changing the insulin receptor to possess insulin-like growth factor I ligand specificity. Biochemistry. 29, 7363-7366. 4. Andreo RH, and Farrell RA. 1982. Corneal small-angle light-scattering theory: wavy fibril models. J. Opt. Soc. Am. 72:1479-1492. 5. Applegate RA and Howland HC. 1997. Refractive surgery, optical aberrations, and visual performance. J. Refract. Surg. 13:295-299. 6. Astifoli A, Giovanni C, Lanuzza L, Nicoletti G, Ricci C, Croci S, and Scopece L. 2001. Identification of new genes related to the myogenic differentiation arrest of human rhabdosarcoma cells. Gene. 274(1):139-49. 7. Barishak YR. 1992. Embryology of the eye and its adnexae. Dev. Ophthalmol. 24:1142. 8. Bauer G, Valdez P, Kearns K, Bahner I, Wen SF, Zaia JA, and Kohn DB. 1997. Inhibition of human immunodeficiency virus-1 (HIV-1) replication after transduction of granulocyte colony-stimulating factor-mobilized CD34+ cells from HIV-1-infected donors using retroviral vectors containing anti-HIV-1 genes. Blood. 89:2259-2267. 9. Beck LS, Chen TL, Hirabayashi SE, Deguzman L, Lee WP, McFatridge LL, Xu Y, Bates RL, and Ammann AJ. 1990. Accelerated healing of ulcer wounds in the rabbit ear by recombinant human transforming growth factor-beta 1. Growth Factors. 2:273-282.

PAGE 150

137 10. Bennett NT and Schultz GS. 1993. Growth factors and wound healing: biochemical properties of growth factors and their receptors. Am. J. Surg. 165:728-737. 11. Bilgihan K, Ozdek S, Ozogul C, Gurelik G, Bilgihan A, and Hasanreisoglu B. 2000. Topical vitamin E and hydrocortisone acetate treatment after photorefractive keratectomy. Eye. 14 (Pt 2):231-237. 12. Birk DE and Lande MA. 1981. Corneal and scleral collagen fiber formation in vitro. Biochim. Biophys. Acta. 670:362-369. 13. Blalock TD, Duncan MR, Varela JC, Goldstein MH, Grotendorst GR, and Schultz GS. 2003. Connective Tissue Growth Factor Expression and Action in Human Corneal Fibroblast Cultures and in Rat Corneas following Phototherapeutic Keratectomy. Invest. Ophtahlmol. Vis. Sci. 44(5):1879-1887. 14. Border WA and Noble NA. 1994. Transforming growth factor beta in tissue fibrosis. N. Engl. J. Med. 331:1286-1292. 15. Border WA, Noble NA, Yamamoto T, Harper JR, Yamaguchi Y, Pierschbacher MD, and Ruoslahti E. 1992. Natural inhibitor of transforming growth factor-beta protects against scarring in experimental kidney disease. Nature. 360:361-364. 16. Border WA, Okuda S, Languino LR, Sporn MB, and Ruoslahti E. 1990. Suppression of experimental glomerulonephritis by antiserum against transforming growth factor beta 1. Nature. 346:371-374. 17. Bork P. 1993. The modular architecture of a new family of growth regulators related to connective tissue growth factor. FEBS Lett. 327:125-130. 18. Bradham DM, Igarashi A, Potter RL, and Grotendorst GR. 1991. Connective tissue growth factor: a cysteine-rich mitogen secreted by human vascular endothelial cells is related to the SRC-induced immediate early gene product CEF-10. J. Cell Biol. 114:1285-1294. 19. Brahmatewari J, Serafini A, Serralta V, Mertz PM, and Eaglstein WH. 2000. The effects of topical transforming growth factor-beta2 and antitransforming growth factor-beta2,3 on scarring in pigs. J. Cutan. Med. Surg. 4:126-131. 20. Brigstock DR. 1999. The connective tissue growth factor/cysteine-rich 61/nephroblastoma overexpressed (CCN) family. Endocr. Rev. 20:189-206. 21. Castilla A, Prieto J, and Fausto N. 1991. Transforming growth factors beta 1 and alpha in chronic liver disease. Effects of interferon alpha therapy. N. Engl. J. Med. 324:933-940. 22. Cech TR. 1988. Ribozymes and their medical implications. JAMA. 260:3030-3034.

PAGE 151

138 23. Chaudhuri A, Hallett PE, and Parker JA. 1983. Aspheric curvatures, refractive indices and chromatic aberration for the rat eye. Vision Res. 23:1351-1363. 24. Chen CC, Chen N, and Lau LF. 2001. The angiogenic factors Cyr61 and connective tissue growth factor induce adhesive signalling in primary human skin fibroblasts. J. Biol. Chem. 276(13):10443-10452. 25. Chen C, Michelini-Norris B, Stevens S, Rowsey J, Ren X, Goldstein MH, and Schultz GS. 2000a. Measurement of mRNAs for TGFbeta and extracellular matrix proteins in corneas of rats after PRK. Invest. Ophthalmol. Vis. Sci. 41:4108-4116. 26. Chen MM, Lam A, Abraham JA, Schreiner GF, and Joly AH. 2000b. CTGF expression is induced by TGFbeta in cardiac fibroblasts and cardiac myocytes: a potential role in heart fibrosis. J. Mol. Cell Cardiol. 32:1805-1819. 27. Choi DM, Thompson RW Jr, and Price FW Jr. 2002. Incisional refractive surgery. Curr. Opin. Ophthalmol. 13:237-241. 28. Clark RAF and Henson PM. 1996. Wound repair: Overview and general considerations. In The molecular and cellular biology of wound repair. Plenum press, New York, NY. 3-50. 29. Cohen S. 1976. Cell mediated immunity and the inflammatory system. Hum. Pathol. 7:249-264. 30. Cordeiro MF, Gay JA, and Khaw PT. 1999a. Human anti-transforming growth factorbeta2 antibody: a new glaucoma anti-scarring agent. Invest. Ophthalmol. Vis. Sci. 40:2225-2234. 31. Cordeiro MF, Reichel MB, Gay JA, D'Esposita F, Alexander RA, and Khaw PT. 1999b. Transforming growth factor-beta1, -beta2, and -beta3 in vivo: effects on normal and mitomycin C-modulated conjunctival scarring. Invest. Ophthalmol. Vis. Sci. 40:1975-1982. 32. Coyle B, Freathy C, Gant TW, Roberts RA, and Cain K. 2003. Characterization of the transforming growth factor beta-1-induced apoptotic transcriptome in FaO hepatoma cells. J. Biol. Chem. 278(8):5920-8. 33. Cromack DT, Pierce GF, and Mustoe TA. 1991. TGF-beta and PDGF mediated tissue repair: identifying mechanisms of action using impaired and normal models of wound healing. Prog. Clin. Biol. Res. 365:359-373. 34. Dammeier J, Brauchle M, Falk W, Grotendorst GR, and Werner S. 1998. Connective tissue growth factor: a novel regulator of mucosal repair and fibrosis in inflammatory bowel disease? Int. J. Biochem. Cell Biol. 30:909-922.

PAGE 152

139 35. Daoud AS, Fritz KE, Jarmolych J, and Frank AS. 1985. Role of macrophages in regression of atherosclerosis. Ann. N. Y. Acad. Sci. 454:101-114. 36. Dawson PA and Marini JC. 2000. Hammerhead ribozymes selectively suppress mutant type I collagen mRNA in osteogenesis imperfecta fibroblasts. Nucleic Acids Res. 28:4013-4020. 37. Daxer A, Misof K, Grabner B, Ettl A, and Fratzl P. 1998. Collagen fibrils in the human corneal stroma: structure and aging. Invest. Ophthalmol. Vis. Sci. 39:644648. 38. Dean NM and Griffey RH. 1997. Identification and characterization of secondgeneration antisense oligonucleotides. Antisense Nucleic Acid Drug Dev. 7:229233. 39. Doane MG, Jensen AD, and Dohlman CH. 1978. Penetration routes of topically applied eye medications. Am. J. Ophthalmol. 85:383-386. 40. Dou Q, Williams RS, and Chegini N. 1997. Inhibition of transforming growth factorbeta 1 alters the growth, anchor-dependent cell aggregation and integrin mRNA expression in human promonocytes: implications for endometriosis and peritoneal adhesion formation. Mol. Hum. Reprod. 3:383-391. 41. Drenser KA, Timmers AM, Hauswirth WW, and Lewin AS. 1998. Ribozymetargeted destruction of RNA associated with autosomal-dominant retinitis pigmentosa. Invest. Ophthalmol. Vis. Sci. 39:681-689. 42. Duffey RJ. 1995. Post-operative complications of radial keratectomy. In Cornea. Krachmer JH, Mannis MJ, and Holland EJ, editors. Mosby, Chicago. 43. Duffey RJ and Leaming D. 2002. U.S. trends in refractive surgery: 2001 International Society of Refractive Surgery Survey. J. Refract. Surg. 18:185-188. 44. Duncan MR, Frazier KS, Abramson S, Williams S, Klapper H, Huang X, and Grotendorst GR. 1999. Connective tissue growth factor mediates transforming growth factor beta-induced collagen synthesis: down-regulation by cAMP. FASEB J. 13:1774-1786. 45. Eiferman RA. 1992. Corneal wound healing and its pharmacologica modification after radial keratotomy. In Refractive keratectomy for myopia and astigmatism. Waring GO, editor. Mosby, Chicago. 46. Eisen MB, Spellman PT, Brown PO, and Botstein D. 1998. Cluster analysis and display of genome-wide expression patterns. Proc Natl Acad Sci U S A. 95:14863-8.

PAGE 153

140 47. Eguchi T, Kubota S, Koudo S, Shimo T, Hittori T, Nikanishi T, and Kuboki T. 2001. Regulatory mechanism of human connective tissue growth factor gene expression in a human chondrocytic cell line, HCS-2/8. J. Biochem. (Tokyo) 130(1): 79-87. 48. Fan WH, Pech M, Karnovsky MJ. 2000. Connective tissue growth factor stimulates vascular smooth muscle cell growth and migration in vitro. Eur. J. Cell Biol. 79(12):915-923. 49. Ferrara N. 2002. Vascular endothelial growth vactor and the quest for tumor angiogenic factors. Nat. Rev. Cancer. 2(10):795-803. 50. Folger PA, Zekaria D, Grotendorst GR, and Masur SK. 2001. Transforming growth factor-beta-stimulated connective tissue growth factor expression during corneal myofibroblast differentiation. Invest. Ophthalmol. Vis. Sci. 42:2534-2541. 51. Frank S, Madlener M, and Werner S. 1996. Transforming growth factors beta1, beta2, and beta3 and their receptors are differentially regulated during normal and impaired wound healing. J. Biol. Chem. 271:10188-10193. 52. Frazier K, Williams S, Kothapalli D, Klapper H, and Grotendorst GR. 1996. Stimulation of fibroblast cell growth, matrix production, and granulation tissue formation by connective tissue growth factor. J. Invest. Dermatol. 107:404-411. 53. Furie MB and McHugh DD. 1989. Migration of neutrophils across endothelial monolayers is stimulated by treatment of the monolayers with interleukin-1 or tumor necrosis factor-alpha. J. Immunol. 143:3309-3317. 54. Gharaee-Kermani M and Phan SH. 2001. Role of cytokines and cytokine therapy in wound healing and fibrotic diseases. Curr. Pharm. Des. 7:1083-1103. 55. Gillitzer R and Goebeler M. 2001. Chemokines in cutaneous wound healing. J. Leukoc. Biol. 69:513-521. 56. Gimbel H, Sun R, and Kaye GB. 2000. Refractive error in cataract surgery after previous refractive surgery. J. Cataract Refract. Surg. 26:142-144. 57. Ginsberg MH, Du X, and Plow EF. 1992. Inside-out integrin signalling. Curr. Opin. Cell Biol. 4:766-771. 58. Gliemann J. 1998. Receptors of the low density lipoprotein (LDL) receptor family in man. Multiple functions of the large family members via interaction with complex ligands. Biol. Chem. 379, 951-64. 59. Goldschmeding R, Aten J, Ito Y, Blom I, Rabelink T, and Weening JJ. 2000. Connective tissue growth factor: just another factor in renal fibrosis? Nephrol. Dial. Transplant. 15:296-299.

PAGE 154

141 60. Golub TR, Slonim DK, Tamayo P, Huard C, Gaasenbeek M, and Mesirov JP. 1999. Molecular classification of cancer: class discovery and class prediction by gene expression monitoring. Science. 286(5439):531-537. 61. Grant MB, Khaw PT, Schultz GS, Adams JL, and Shimizu RW. 1992. Effects of epidermal growth factor, fibroblast growth factor, and transforming growth factor-beta on corneal cell chemotaxis. Invest. Ophthalmol. Vis. Sci. 33:32923301. 62. Greenhalgh DG. 1996. The role of growth factors in wound healing. J. Trauma 41:159-167. 63. Grotendorst GR. 1997. Connective tissue growth factor: a mediator of TGF-beta action on fibroblasts. Cytokine Growth Factor Rev. 8:171-179. 64. Grotendorst GR, Okochi H, and Hayashi N. 1996. A novel transforming growth factor beta response element controls the expression of the connective tissue growth factor gene. Cell Growth Differ. 7:469-480. 65. Guerrier-Takada C, Gardiner K, Marsh T, Pace N, and Altman S. 1983. The RNA moiety of ribonuclease P is the catalytic subunit of the enzyme. Cell. 35:849-857. 66. Gullino PM. 1986. Considerations on the mechanism of the angiogenic response. Anticancer Res. 6:153-158. 67. Guo N, Krutzsch HC, Inman JK, and Roberts DD. 1997. Thrombospondin 1 and type I repeat peptides of thrombospondin 1 specifically induce apoptosis of endothelial cells. Cancer Res. 57:1735-1742. 68. Gupta A, Monroy D, Ji Z, Yoshino K, Huang A, and Pflugfelder SC. 1996. Transforming growth factor beta-1 and beta-2 in human tear fluid. Curr. Eye Res. 15:605-614. 69. Gustafson T and Ritter WR. 1990. The cysteine rich-domains of the insulin and the insulin-like growth factor I receptors are primary determinants of hormone binding specificity. J. Biol. Chem. 265, 18663-18667. 70. Gutierrez GE, Mundy GR, Derynck R, Hewlett EL, and Katz MS. 1987. Inhibition of parathyroid hormone-responsive adenylate cyclase in clonal osteoblast-like cells by transforming growth factor alpha and epidermal growth factor. J. Biol. Chem. 262:15845-15850. 71. Haseloff J and Gerlach WL. 1988. Simple RNA enzymes with new and highly specific endoribonuclease activities. Nature. 334:585-591. 72. Hashimoto G, Inoki I, Fuiji Y, Aoki T, Ikeda E, and Okada Y. 2002. Matrix metalloproteinases cleave connective tissue growth factor and reactivate angiogenic activiy of VEGF 165. J. Biol. Chem. 277(39):36288-36296.

PAGE 155

142 73. Hashimoto Y, Shindo-Okada N, Tani M, Nagamachi Y, Takeuchi K, Shiroishi T, Toma H, and Yokota J. 1998. Expression of the Elm1 gene, a novel gene of the CCN (connective tissue growth factor, Cyr61/Cef10, and neuroblastoma overexpressed gene) family, suppresses In vivo tumor growth and metastasis of K-1735 murine melanoma cells. J. Exp. Med. 187:289-296. 74. Hay ED. 1981. Extracellular matrix. J. Cell Biol. 91:205s-223s. 75. Hayashida-Hibino S, Watanabe H, Nishiba K, Tsujikawa M, Tanaka T, and Hori Y 2001. The effect of transforming growth factor beta-1 on differential gene expression profiling in human corneal epithelium studied by cDNA expression array. Invest. Ophthalmol. Vis. Sci. 42(8):1691-1697. 76. Heid CA, Stevens J, Livak KJ, and Williams DM. 1996. Real time quantitative PCR. Genome Research. 10:986-984. 77. Heitzmann J, Binder PS, Kassar BS, and Nordan LT. 1993. The correction of high myopia using the excimer laser. Arch. Ophthalmol. 111:1627-1634. 78. Heldin CH, Miyazono K, and ten Dijke P. 1997. TGF-beta signalling from cell membrane to nucleus through SMAD proteins. Nature. 390:465-471. 79. Herz J and Strickland D. 2001. LRP: a multifunctional scavenger and signaling receptor. J. Clin. Invest. 108, 779-784. 80. Hirose J, Kawashima H, Yoshie O, Tashiro K, and Miyasaka M. 2001. Versican interacts with chemokines and modulates cellular responses. J. Biol. Chem. 276(7):5228-5234. 81. Hishikawa K, Nakaki T, and Fuiji T. 2000. Connective tissue growth factor induces apoptosis via caspase 3 in cultures human aortic smooth muscle cells. Eur. J. Pharmacol. 392(1):19-22. 82. Hishikawa K, Oemar BS, Tanner FC, Nakaki T, Fujii T, and Luscher TF. 1999a. Overexpression of connective tissue growth factor gene induces apoptosis in human aortic smooth muscle cells. Circulation. 100:2108-2112. 83. Hishikawa K, Oemar BS, Tanner FC, Nakaki T, Luscher TF, and Fujii T. 1999b. Connective tissue growth factor induces apoptosis in human breast cancer cell line MCF-7. J. Biol. Chem. 274:37461-37466. 84. Hishikawa K, Nakaki T, and Fuiji T. 1999c. Transforming growth factor beta-1 induces apoptosis via connective tissue growth factor in human aortic smooth muscle cells. Eur. J. Pharmacol. 385(2):287-90. 85. Hishikawa K, Oemar BS, and Nakaki T. 2001. Static pressure regulates connective tissue growth factor expression in human mesangial cells. J. Biol. Chem. 276(20):16797-803.

PAGE 156

143 86. Holland PM, Abramson RD, Watson R, and Gelfand DH. 1991. Detection of specific polymerase chain reaction product by utilizing the 5'----3' exonuclease activity of Thermus aquaticus DNA polymerase. Proc. Natl. Acad. Sci. USA. 88:7276-7280. 87. Hoppenreijs VPT, Pels E, Vrensen GFJM, Felten PC, and Treffers WF. 1993. Platelet-Derived Growth Factor: Receptor Expression in Corneas and Effects on Corneal Cells. Invest. Optholmol. Vis. Sci. 34:637-649. 88. Hoppenreijs VPT, Pels E, Vrensen GFJM, Oosting J, and Treffers FW. 1992. Effects of human epidermal growth factor on endothelial wound healing of human corneas. Invest. Ophthalmol. Vis. Sci. 33(6):1946-1957. 89. Hunt TK, Knighton DR, Thakral KK, Goodson WH III, and Andrews WS. 1984. Studies on inflammation and wound healing: angiogenesis and collagen synthesis stimulated in vivo by resident and activated wound macrophages. Surgery. 96:4854. 90. Hurvitz JR, Suwairi WM, VanHul W, El-Shanti H, Superti-Furga A et al. 1999. Mutations in the CCN gene family member WISP3 cause progressive pseudorheumatoid dysplasia. Nat. Genet. 23:94-98. 91. Igarashi A, Hayashi N, Nashiro K, and Takehara K. 1998. Differential expression of connective tissue growth factor gene in cutaneous fibrohistiocytic and vascular tumors. J. Cutan. Pathol. 25:143-148. 92. Igarashi A, Nashiro K, Kikuchi K, Sato S, Ihn H, Grotendorst GR, and Takehara K. 1995. Significant correlation between connective tissue growth factor gene expression and skin sclerosis in tissue sections from patients with systemic sclerosis. J. Invest Dermatol. 105:280-284. 93. Igarashi A, Okochi H, Bradham DM, and Grotendorst GR. 1993. Regulation of connective tissue growth factor gene expression in human skin fibroblasts and during wound repair. Mol. Biol. Cell. 4:637-645. 94. Inagaki Y, Truter S, and Ramirez F. 1994. Transforming growth factor-beta stimulates alpha 2(I) collagen gene expression through a cis-acting element that contains an Sp1-binding site. J. Biol. Chem. 269:14828-14834. 95. Incardona F, Lawler J, Cataldo D, Panet A, Legrand Y, Foidart JM, and Legrand C. 1996. Heparin-binding domain, type 1 and type 2 repeats of thrombospondin mediate its interaction with human breast cancer cells. J. Cell Biochem. 62:431442. 96. Irving JA and Lala PK. 1995. Functional role of cell surface integrins on human trophoblast cell migration: regulation by TGF-beta, IGF-II, and IGFBP-1. Exp. Cell Res. 217:419-427.

PAGE 157

144 97. Ito Y, Aten J, Bende RJ, Oemar BS, Rabelink TJ, Weening JJ, and Goldschmeding R. 1998. Expression of connective tissue growth factor in human renal fibrosis. Kidney Int. 53:853-861. 98. Jampel HD, Roche N, Stark WJ, and Roberts AB. 1990. Transforming growth factorbeta in human aqueous humor. Curr. Eye Res. 9:963-969. 99. Jester JV, Barry-Lane PA, Petroll WM, Olsen DR, and Cavanagh HD. 1997. Inhibition of corneal fibrosis by topical application of blocking antibodies to TGF beta in the rabbit. Cornea. 16:177-187. 100. Jester JV, Moller-Pedersen T, Huang J, Sax CM, Kays WT, and Cavanagh HD. 1999. The cellular basis of corneal transparency: evidence for 'corneal crystallins'. J. Cell Sci. 112(Pt 5):613-22. 101. Jones J and Clemmons D. 1995. Insulin-like growth factors and their binding proteins: biological actions. Endocr. Rev. 16:3-34. 102. Kaleko M, Rutter W, and Miller A. 1990. Overexpression of the human insulin-like growth factor I receptor promotes ligand dependent neoplastic transformation. Mol. Cell. Biol. 10:464-473. 103. Kelley J, Shull S, Walsh JJ, Cutroneo KR, and Absher M. 1993. Auto-induction of human transforming growth factor beta in human lung fibroblasts. Am. J. Respir. Cell Molec. Biol. 8(4):417-424. 104. Kenney MC, Shih LM, Labermeir U, and Satterfield D. 1986. Modulation of rabbit keratocyte production of collagen, sulfated glycosaminoglycans and fibronectin by retinol and retinoic acid. Biochim. Biophys. Acta. 889:156-162. 105. Khalil N, O'Connor RN, Unruh HW, Warren PW, Flanders KC, Kemp A, Bereznay OH, and Greenberg AH. 1991. Increased production and immunohistochemical localization of transforming growth factor-beta in idiopathic pulmonary fibrosis. Am. J. Respir. Cell Mol. Biol. 5:155-162. 106. Khaw PT, Doyle JW, Sherwood MB, Grierson I, Schultz GS, and McGorray S. 1993. Prolonged localized tissue effects from 5-minute exposures to fluorouracil and mitomycin C. Arch. Ophthalmol. 111:263-267. 107. Kikuchi K, Kadono T, Ihn H, Sato S, Igarashi A, Nakagawa H, Tamaki K, and Takehara K. 1995. Growth regulation in scleroderma fibroblasts: increased response to transforming growth factor-beta 1. J. Invest Dermatol. 105:128-132. 108. Kim HS, Nagalla SR, Oh Y, Wilson E, Roberts CT Jr, and Rosenfeld RG. 1997. Identification of a family of low-affinity insulin-like growth factor binding proteins (IGFBPs): characterization of connective tissue growth factor as a member of the IGFBP superfamily. Proc. Natl. Acad. Sci. USA. 94:12981-12986.

PAGE 158

145 109. Komai Y and Ushiki T. 1991. The three-dimensional organization of collagen fibrils in the human cornea and sclera. Invest. Ophthalmol. Vis. Sci. 32:2244-2258. 110. Kornfeld S. 1992. Structure and function of the mannose-6-phosphate/ insulinlike growth factor-II receptors. Annu. Rev. Biochem. 61:307-330. 111. Kothapalli D, Frazier KS, Welply A, Segarini PR, and Grotendorst GR. 1997. Transforming growth factor beta induces anchorage-independent growth of NRK fibroblasts via a connective tissue growth factor-dependent signaling pathway. Cell Growth Differ. 8:61-68. 112. Kruger K, Grabowski PJ, Zaug AJ, Sands J, Gottschling DE, and Cech TR. 1982. Self-splicing RNA: autoexcision and autocyclization of the ribosomal RNA intervening sequence of Tetrahymena. Cell. 31:147-157. 113. Ksander GA, Chu GH, McMullin H, Ogawa Y, Pratt BM, Rosenblatt JS, and McPherson JM. 1990. Transforming growth factors-beta 1 and beta 2 enhance connective tissue formation in animal models of dermal wound healing by secondary intent. Ann. N. Y. Acad. Sci. 593:135-147. 114. Kurt S, Theodore JCIV, Alfred WG, Carolyn LJ, and Gibbes RJ. 1992. Transforming growth factoracts as an autocrine growth factor in ovarian carcinoma cell lines. Cancer Res. 52:341-347. 115. Lankat-Buttgereit B, Kulozik MK, Hunzelmann N, and Krieg T. 1991. Cytokines alter mRNA steady state levels for basement membrane proteins in human skin fibroblasts. J. Dermatol. Sci. 2:300-307. 116. LaVail MM, Yasumura D, Matthes MT, Drenser KA, Flannery JG, Lewin AS, and Hauswirth WW. 2000. Ribozyme rescue of photoreceptor cells in P23H transgenic rats: long-term survival and late-stage therapy. Proc. Natl. Acad. Sci. USA. 97:11488-11493. 117. Lawler J. 2002. Thrombospondin-1 as an endogenous inhibotory of angiogenic and tumor growth. J. Cell Mol. Med. 6(1):1-12. 118. Lee DA. 1994. Antifibrosis agents and glaucoma surgery. Invest. Ophthalmol. Vis. Sci. 35:3789-3791. 119. Lee YC, Wang IJ, Hu FR, and Kao WW. 2001. Immunohistochemical study of subepithelial haze after phototherapeutic keratectomy. J. Refract. Surg. 17:334341. 120. Leibovich SJ and Ross R. 1976. A macrophage-dependent factor that stimulates the proliferation of fibroblasts in vitro. Am. J. Pathol. 84:501-514.

PAGE 159

146 121. Lewin AS, Drenser KA, Hauswirth WW, Nishikawa S, Yasumura D, Flannery JG, and LaVail MM. 1998. Ribozyme rescue of photoreceptor cells in a transgenic rat model of autosomal dominant retinitis pigmentosa. Nat. Med. 4:967-971. 122. Li DQ and Tseng SC. 1995. Three patterns of cytokine expression potentially involved in epithelial-fibroblast interactions of human ocular surface. J. Cell Physiol. 163:61-79. 123. Lieber A. and Kay MA. 1996. Adenovirus-mediated expression of ribozymes in mice. J. Virol. 70:3153-3158. 124. Lindblad WJ. 1998. Perspective article: collagen expression by novel cell populations in the dermal wound environment. Wound. Repair Regen. 6:186-193. 125. Liu C, Liu XJ, Crowe PD, Kelner GS, Fan J, Barry G, Manu F, Ling N, De Souza EB, and Maki RA. 1999. Nephroblastoma overexpressed gene (NOV) codes for a growth factor that induces protein tyrosine phosphorylation. Gene. 238:471-478. 126. Livak KJ, Flood SAJ, Marmaro J, Giusti W, and Deetz K. 1995. Oligonucleotides with fluorescent dyes at opposite ends provide a quenched probe system useful for detecting PCR product and nucleic acid hybridization. PCR Meth. Appl. 4:357362. 127. Ljubimov AV, Alba SA, Burgeson RE, Ninomiya Y, Sado Y, Sun TT, Nesburn AB, Kenney MC, and Maguen E. 1998. Extracellular matrix changes in human corneas after radial keratotomy. Exp. Eye Res. 67:265-272. 128. Lyon M, Deakin J, Mizuno K, Nakamura T, and Gallagher J. 1994. Interaction of hepatocyte growth factor with heparan sulfate. Elucidation of the major heparan sulfate structural determinants. J. Biol. Chem. 269, 11216-11213. 129. Madtes DK, Raines EW, Sakariassen KS, Assoian RK, Sporn MB, Bell GI, and Ross R. 1988. Induction of transforming growth factor-alpha in activated human alveolar macrophages. Cell. 53:285-293. 130. Mahajan VB, Wei C, and McDonnell PJ. 2002. Microarray analysis of corneal fibroblast gene expression after interleukin-1 treatment. Invest. Ophthalmol. Vis. Sci. 43(7):2143-2151. 131. Malley DS, Steinert RF, Puliafito CA, and Dobi ET. 1990. Immunofluorescence study of corneal wound healing after excimer laser anterior keratectomy in the monkey eye. Arch. Ophthalmol. 108:1316-1322. 132. Malmstrom J, Larsen K, Hansson L, Lofdahl CG, Norregard-Jensen O, MarkoVarga G, and Westergren-Thorsson G. 2002. Proteoclycan and proteome profiling of central human pulmonary fibrotic tissue utilizing miniature sample preparations. Proteomics. 2(4):394-404.

PAGE 160

147 133. Marron-Teraga P, Brzycki-Wessell M, and Dahms N. 1998. The two mannose 6phosphate binding sites of the insulin-like growth factor-II/mannose 6-phosphate receptor display different ligand binding properties. J. Biol. Chem. 273:2235822366. 134. Martinerie C, Viegas-Pequignot E, Guenard I, Dutr illaux B, Nguyen VC, Bernheim A, and Perbal B. 1992. Physical mapping of human loci homologous to the chicken nov proto-oncogene. Oncogene. 7:2529-2534. 135. Mason ED, Konrad KD, Webb CD, and Marsh JL. 1994. Dorsal midline fate in Drosophila embryos requires twisted gastrulation, a gene encoding a secreted protein related to human connective tissue growth factor. Genes Dev. 8:14891501. 136. Mast BA and Schultz GS. 1996. Interaction of cytokines, growth factors and proteases in acute and chronic wounds. Wounds. 4, 411-420. 137. Maurice DM. 1984. The cornea and sclera. In The eye. Davison H, editor. Academic Press, Orlando. 138. McDermott ML. 1993. Stromal wound healing. In Corneal surgery. Brightbill FS, editor. Mosby, Chicago. 139. Melles GR, SundarRaj N, Binder PS, van der Weiden MM, Wijdh RH, Beekhuis WH, and Anderson JA. 1995. Immunohistochemical analysis of unsutured and sutured corneal wound healing. Curr. Eye Res. 14:809-817. 140. Meyer P, Wunderlich K, Kain HL, Prunte C, and Flammer J. 2002. Human connective tissue growth factor mRNA expression of epiretinal and subretinal fibrovascular membranes: a report of three cases. Ophthalmologica. 216:284291. 141. Mints M, Blomgren B, Falconer C, and Palmblad J. 2002. Expression of the vascular endothelial growth factor (VEGF) family in human endometrial blood vessels. Scand. J. Clin. Lab Invest. 62:167-175. 142. Moore JE, McMullen CB, Mahon G, and Adamis AP. 2002. The corneal epithelial stem cell. DNA Cell Biol. 21:443-451. 143. Moussad EE and Brigstock DR. 2000. Connective tissue growth factor: What's in a name? Mol. Genet. Metab. 71:276-292. 144. Murphy G, Cockett MI, Ward RV, and Docherty AJ. 1991. Matrix metalloproteinase degradation of elastin, type IV collagen and proteoglycan. A quantitative comparison of the activities of 95 kDa and 72 kDa gelatinases, stromelysins-1 and -2 and punctuated metalloproteinase (PUMP). Biochem. J. 277(Pt 1):277-279.

PAGE 161

148 145. Murray-Rust J, McDonald NQ, Blundell TL, Hosang M, Oefner C, Winkler F, and Bradshaw RA. 1993. Topological similarities in TGF-beta 2, PDGF-BB and NGF define a superfamily of polypeptide growth factors. Structure. 1:153-159. 146. Mutsaers SE, Bishop JE, McGrouther G, and Laurent GJ. 1997. Mechanisms of tissue repair: from wound healing to fibrosis. Int. J. Biochem. Cell Biol. 29:5-17. 147. Nakae J, Kido Y, and Accili D. 2001. Distinct and overlapping functions of insulin and IGF-I receptors. Endocr. Rev. 22, 818-835. 148. Nakao A, Imamura T, Souchelnytskyi S, Kawabata M, Ishisaki A, Oeda E, Tamaki K, Hanai J, Heldin CH, Miyazono K, and ten Dijke P. 1997. TGF-beta receptormediated signalling through Smad2, Smad3 and Smad4. EMBO J. 16:5353-5362. 149. Nall AV, Brownlee RE, Colvin CP, Schultz G, Fein D, Cassisi NJ, Nguyen T, and Kalara A. 1996. Transforming growth factor 1 improves wound healing and random flap survival in normal and irradiated rats. Arch. Otolaryngol. Head Neck Surg. 122(2):171-177. 150. Nishida T, Nakanishi T, Shimo T, Asano M, Hattori T, Tamatani T, Tezuka K, and Takigawa M. 1998. Demonstration of receptors specific for connective tissue growth factor on a human chondrocytic cell line (HCS-2/8). Biochem. Biophys. Res. Commun. 247:905-909. 151. Nishida T, Yasumoto K, Otori T, and Desaki J. 1988. The network structure of corneal fibroblasts in the rat as revealed by scanning electron microscopy. Invest. Ophthalmol. Vis. Sci. 29:1887-1890. 152. Noble PW, Henson PM, Lucas C, Mora-Worms M, Carre PC, and Riches DW. 1993. Transforming growth factor-beta primes macrophages to express inflammatory gene products in response to particulate stimuli by an autocrine/paracrine mechanism. J. Immunol. 151:979-989. 153. O'Brien TP and Lau LF. 1992. Expression of the growth factor-inducible immediate early gene cyr61 correlates with chondrogenesis during mouse embryonic development. Cell Growth Differ. 3:645-654. 154. Ohtsuki M and Massague J. 1992. Evidence for the involvement of protein kinase activity in transforming growth factor-beta signal transduction. Mol. Cell Biol. 12:261-265. 155. Otori T. 1967. Electrolyte content of the rabbit corneal stroma. Exp. Eye Res. 6:356367. 156. Paradis V, Dargere D, Bonvoust F, Vidaud M, Segarini P, and Bedossa P. 2002. Effects and regulation of connective tissue growth factor on hepatic stellate cells. Lab. Invest. 82(6):767-774.

PAGE 162

149 157. Parrish R and Minckler D. 1996. "Late endophthalmitis"--filtering surgery time bomb? Ophthalmology. 103:1167-1168. 158. Paulus W, Baur I, Huettner C, Schmausser B, Roggendorf W, Schlingensiepen KH, and Brysch W. 1995. Effects of transforming growth factor-beta 1 on collagen synthesis, integrin expression, adhesion and invasion of glioma cells. J. Neuropathol. Exp. Neurol. 54:236-244. 159. Pederson L, Winding B, Foged NT, Spelsberg TC, and Ourster MJ. 1999. Identification of breast cancer cell line-derived paracrine factors that stimulate osteoclast activity. Cancer Res. 59(22):5849-5855. 160. Pelton RW, Hogan BL, Miller DA, and Moses HL. 1990. Differential expression of genes encoding TGFs beta 1, beta 2, and beta 3 during murine palate formation. Dev. Biol. 141:456-460. 161. Perkett EA. 1995. Role of growth factors in lung repair and diseases. Curr. Opin. Pediatr. 7:242-249. 162. Pierce GF, Brown D, and Mustoe TA. 1991. Quantitative analysis of inflammatory cell influx, procollagen type I synthesis, and collagen cross-linking in incisional wounds: influence of PDGF-BB and TGF-beta 1 therapy. J. Lab Clin. Med. 117:373-382. 163. Piscatelli SJ, Michaels BM, Gregory P, Jennings RW, Longaker MT, Harrison MR, and Siebert JW. 1994. Fetal fibroblast contraction of collagen matrices in vitro: the effects of epidermal growth factor and transforming growth factor-beta. Ann. Plast. Surg. 33:38-45. 164. Pollack SV. 1984. The wound healing process. Clin. Dermatol. 2:8-16. 165. Porges Y, Ben Haim O, Hirsh A, and Levinger S. 2003. Phototherapeutic keratectomy with mitomycin C for corneal haze following photorefractive keratectomy for myopia. J. Refract. Surg. 19:40-43. 166. Price FW Jr, Willes L, Price M, Lyng A, and Ries J. 2001. A prospective, randomized comparison of the use versus non-use of topical corticosteroids after laser in situ keratomileusis. Ophthalmology. 108:1236-1244. 167. Propsting MJ, Kubicka S, Genschel J, Manns MP, Lochs H, and Schmidt HH. 2000. Inhibition of transthyretin-met30 expression using Inosine(15.1)Hammerhead ribozymes in cell culture. Biochem. Biophys. Res. Commun. 279:970-973. 168. Ramaswamy, S., K.N.Ross, E.S.Lander, and T.R.Golub. 2003. A molecular signature of metastasis in primary solid tumors. Nat. Genet. 33(1):49-54.

PAGE 163

150 169. Ramaswamy S, Tamayo P, Rifkin R, Mukharjee S, Yeang CH, and Angelo M. 2001. Multiclass cancer diagnosis using tumor gene expression signatures. Proc. Nat. Acad. Sci. USA. 98(26):15149-15154. 170. Rendell MS, Johnson ML, Smith D, Finney D, Capp C, Lammers R, and Lancaster S. 2002. Skin blood flow response in the rat model of wound healing: expression of vasoactive factors. J. Surg. Res. 107:18-26. 171. Riser BL, Denichilo M, Cortes P, Baker C, Grondin JM, Yee J, and Narins RG. 2000. Regulation of connective tissue growth factor activity in cultured rat mesangial cells and its expression in experimental diabetic glomerulosclerosis. J. Am. Soc. Nephrol. 11:25-38. 172. Roberts AB. 1995. Tranforming growth factor-beta: activity and efficacy in animal models of wound healing. Wound. Repair Regen. 3, 408-418. 173. Roberts AB and Sporn MB. 1990. The transforming growth factors beta. In Handbook of experimental pharmacology. Peptide growth factors and their receptors. Roberts AB and Sporn MB, editors. Springer-Verlag, New York. 419472. 174. Roberts AB, Sporn MB, Assoian RK, Smith JM, Roche NS, Wakefield LM, Heine UI, Liotta LA, Falanga V, Kehrl JH, and 1986. Transforming growth factor type beta: rapid induction of fibrosis and angiogenesis in vivo and stimulation of collagen formation in vitro. Proc. Natl. Acad. Sci. USA. 83:4167-4171. 175. Ross R, Masuda J, Raines EW, Gown AM, Katsuda S, Sasahara M, Malden LT, Masuko H, and Sato H. 1990. Localization of PDGF-B protein in macrophages in all phases of atherogenesis. Science. 248:1009-1012. 176. Rossi P, Karsenty G, Roberts AB, Roche NS, Sporn MB, and de Crombrugghe B. 1988. A nuclear factor 1 binding site mediates the transcriptional activation of a type I collagen promoter by transforming growth factor-beta. Cell. 52:405-414. 177. Ryseck RP, Macdonald-Bravo H, Mattei MG, and Bravo R. 1991. Structure, mapping, and expression of fisp-12, a growth factorinducible gene encoding a secreted cysteine-rich protein. Cell Growth Differ. 2:225-233. 178. Saika S, Shiraishi A, Liu CY, Funderburgh JL, Kao CW, Converse RL, and Kao WW. 2000. Role of lumican in the corneal epithelium during wound healing. J. Biol. Chem. 275(4):2607-2612. 179. Sara V and Hall K. 1990. Insulin-like growth factors and their binding proteins. Physiol. Rev. 70:591-614.

PAGE 164

151 180. Sato S, Nagaoka T, Hasegawa M, Tama tani T, Nakanishi T, Takigawa M, and Takehara K. 2000. Serum levels of connective tissue growth factor are elevated in patients with systemic sclerosis: association with extent of skin sclerosis and severity of pulmonary fibrosis. J. Rheumatol. 27:149-154. 181. Scatchard G. 1949. The attraction of proteins for small molecules and ions. Ann. N. Y. Acad. Sci. 51, 660-673. 182. Schlessinger J, Lax I, and Lemmon M. 1995. Regulation of growth factor activation by proteoglycans: what is the role of the low affinity receptors? Cell. 83:357-360. 183. Schmid P, Kunz S, Cerletti N, McMaster G, and Cox D. 1993. Injury induced expression of TGF-beta 1 mRNA is enhanced by exogenously applied TGF-beta S. Biochem. Biophys. Res. Commun. 194:399-406. 184. Schultz GS, Chegini N, Grant MB, Khaw PT, and MacKay SA. 1992. Effects of growth factors on corneal wound healing. Acta Ophthalmol. Suppl. 60-66. 185. Schultz GS. 1995. Modulation of corneal wound healing. In Cornea. Krachmer JH, Mannis MJ, and Holland EJ, editors. Mosby, Chicago. 186. Schumacher R, Mosthaf L, Schlessinger J, Brandenburg D, and Ullrich A. 1991. Insulin and insulin-like growth factor 1 binding specificity is determined by distinct regions of their cognate receptors. J. Biol. Chem. 266:19288-19295. 187. Scott WG, Murray JB, Arnold JRP, Stoddard BL, and Klug A. 1996. Capturing the Structure of a Catalytic RNA Intermediate: The Hammerhead Ribozyme. Science. 274:2065-2069. 188. Segarini PR, Nesbitt JE, Li D, Hays LG, Yates JR III, and Carmichael DF. 2001. The low density lipoprotein receptor-related protein/alpha2-macroglobulin receptor is a receptor for connective tissue growth factor. J. Biol. Chem. 276:40659-40667. 189. Shah M, Foreman DM, and Ferguson MW. 1994. Neutralising antibody to TGF-beta 1,2 reduces cutaneous scarring in adult rodents. J. Cell Sci. 107(Pt 5):1137-1157. 190. Shimo T, Nakanishi T, Nishida T, Asano M, Kanyama M, Kuboki T, Tamatani T, Tezuka K, Takemura M, Matsumura T, and Takigawa M. 1999. Connective tissue growth factor induces the proliferation, migration, and tube formation of vascular endothelial cells in vitro, and angiogenesis in vivo. J. Biochem. (Tokyo) 126:137145. 191. Siganos DS, Katsanevaki VJ, and Pallikaris IG. 1999. Correlation of subepithelial haze and refractive regression 1 month after photorefractive keratectomy for myopia. J. Refract. Surg. 15:338-342.

PAGE 165

152 192. Simpson DM and Ross R. 1972. The neutrophilic leukocyte in wound repair a study with antineutrophil serum. J. Clin. Invest. 51:2009-2023. 193. Singer AJ and Clark RA. 1999. Cutaneous wound healing. N. Engl. J. Med. 341:738-746. 194. Sioud M, Natvig JB, and Forre O. 1992. Preformed ribozyme destroys tumour necrosis factor mRNA in human cells. J. Mol. Biol. 223:831-835. 195. Siriwardena D, Khaw PT, King AJ, Donaldson ML, Overton BM, Migdal C, and Cordeiro MF. 2002. Human antitransforming growth factor beta(2) monoclonal antibody--a new modulator of wound healing in trabeculectomy: a randomized placebo controlled clinical study. Ophthalmology. 109:427-431. 196. Snaith MR, Natarajan D, Taylor LB, Choi CP, Martinerie C, Perbal B, Schofield PN, and Boulter CA. 1996. Genomic structure and chromosomal mapping of the mouse nov gene. Genomics. 38:425-428. 197. Snyder MC, Bergmanson JP, and Doughty MJ. 1998. Keratocytes: no more the quiet cells. J. Am. Optom. Assoc. 69:180-187. 198. Sotozono C, Inatomi T, Nakamura M, and Kinoshita S. 1995. Keratinocyte growth factor accelerates corneal epithelial wound healing in vivo. Invest. Ophthalmol. Vis. Sci. 36:1524-1529. 199. Sporn MB and Roberts AB. 1992. Transforming growth factor-beta: recent progress and new challenges. J. Cell Biol. 119:1017-1021. 200. Stark WJ, Chamon W, Kamp MT, Enger CL, Rencs EV, and Gottsh JD. 1992. Clinical follow-up of 193-nm ArF excimer laser photokeratectomy. Ophthalmology. 99:805-812. 201. Steenfos HH. 1994. Growth factors and wound healing. Scand. J. Plast. Reconstr. Surg. Hand Surg. 28:95-105. 202. Stewart C, James P, Fant ME, and Rotwein P. 1996. Overexpression of insulin-like growth factor-II induces accelerated myoblast differentiation. J. Cell Physiol. 169, 23-32. 203. Streuli CH, Schmidhauser C, Kobrin M, Bissell MJ, and Derynck R. 1993. Extracellular matrix regulates expression of the TGF-beta 1 gene. J. Cell Biol. 120:253-260. 204. Su llivan SM. 1994. Dvevelopment of Ribozymes For Gene Therapy. J. Invest. Dermatol. 103:85S-89S. 205. Sunderkotter C, Beil W, Roth J, and Sorg C. 1991. Cellular events associated with inflammatory angiogenesis in the mouse cornea. Am. J. Pathol. 138:931-939.

PAGE 166

153 206. Sutton G, Kalski RS, Lawless MA, and Rogers C. 1995. Excimer retreatment for scarring and regression after photorefractive keratectomy for myopia. Br. J. Ophthalmol. 79:756-759. 207. Symons RH. 1992. Small catalytic RNAs. Annu. Rev. Biochem. 61:641-671. 208. Tamatani T, Kobayashi H, Tezuka K, Sakamoto S, Suzuki K, Nakanishi T, Takigawa M, and Miyano T. 1998. Establishment of the enzyme-linked immunosorbent assay for connective tissue growth factor (CTGF) and its detection in the sera of biliary atresia. Biochem. Biophys. Res. Commun. 251:748752. 209. Tanaka S, Sugimachi K, Saeki H, Kinoshita J, Ohga T, Shimada M, Maehara Y, and Sugimachi K. 2001. A novel variant of WISP1 lacking a Von Willebrand type C module overexpressed in scirrhous gastric carcinoma. Oncogene. 20:5525-5532. 210. Ticho U and Ophir A. 1993. Late complications after glaucoma filtering surgery with adjunctive 5-fluorouracil. Am. J. Ophthalmol. 115:506-510. 211. Tuft SJ, Zabel RW, and Marshall J. 1989. Corneal repair following keratectomy. A comparison between conventional surgery and laser photoablation. Invest. Ophthalmol. Vis. Sci. 30:1769-1777. 212. Ullrich A and Schlessinger J. 1990. Signal transduction by receptors with tyrosine kinase activity. Cell. 61:203-212. 213. Usman N and Blatt LM. 2000. Nuclease-resistant synthetic ribozymes: developing a new class of therapeutics. J. Clin. Invest. 106:1197-1202. 214. van Setten GB, Aspiotis M, Blalock TD, Grotendorst GR, and Schultz GS. 2003a. Connective tissue growth factor in pterygium: simultaneous presence with vascular endothelial growth factor possible contributing factor to conjunctival scarring. Graefes Arch. Clin. Exp. Ophthalmol. 241:135-139. 215. van Setten GB, Blalock TD, Grotendorst GR, and Schultz GS. 2003b. Detection of connective tissue growth factor (CTGF) in human tear fluid: preliminary results. Acta Ophthalmol. Scand. 81:51-53. 216. van Setten GB, Blalock TD, Grotendorst GR, and Schultz GS. 2002. Detection of connective tissue growth factor in human aqueous humor. Ophthalmic Res. 34:306-308. 217. van Setten GB, Schultz GS, and Macauley S. 1994. Growth factors in human tear fluid and in lacrimal glands. Adv. Exp. Med. Biol. 350:315-319.

PAGE 167

154 218. Varela JC, Goldstein MH, Baker HV, and Schultz GS. 2002. Microarray analysis of gene expression patterns during healing of rat corneas after excimer laser photorefractive keratectomy. Invest. Ophthalmol. Vis. Sci. 43(6):1772-1782. 219. Vogelmann R, Ruf D, Wagner M, Adler G, and Menke A. 2001. Effects of fibrogenic mediators on the development of pancreatic fibrosis in a TGF-beta1 transgenic mouse model. Am. J. Physiol Gastrointest. Liver Physiol 280:G164G172. 220. Vorwerk P, Wex H, Hohmann B, Mohnike K, Schmidt U, and Mittler U. 2002. Expression of components of the IGF signaling system in childhood acute lymphoblastic leukemia. Mol. Pathol. 55(1)40-5. 221. Wachtlin J, Langenbeck K, Schrunder S, Zhang EP, and Hoffmann F. 1999. Immunohistology of corneal wound healing after photorefractive keratectomy and laser in situ keratomileusis. J. Refract. Surg. 15:451-458. 222. Webster DF and Harvey W. 1979. A quantitative assay for collagen synthesis in microwell fibroblast cultures. Anal. Biochem. 96:220-224. 223. Weibrich G, Kleis WK, Hafner G, and Hitzler WE. 2002. Growth factor levels in platelet-rich plasma and correlations with donor age, sex, and platelet count. J. Craniomaxillofac. Surg. 30:97-102. 224. Weksler BB. 2000. Antiplatelet agents in stroke prevention. combination therapy: present and future. Cerebrovasc. Dis. 10(5):41-48. 225. Wenger C, Ellenrieder V, Alber B, Lacher U, Menke A, Hameister H, Wilda M, Iwamura T, Beger HG, Adler G, and Gress TM. 1999. Expression and differential regulation of connective tissue growth factor in pancreatic cancer cells. Oncogene. 18:1073-1080. 226. Westergren-Thorsson G, Hernnas J, Sarnstrand B, Oldberg A, Heinegard D, and Malmstrom A. 1993. Altered expression of small proteoglycans, collagen, and transforming growth factor-beta 1 in developing bleomycin-induced pulmonary fibrosis in rats. J. Clin. Invest. 92:632-637. 227. Wikner NE, Persichitte KA, Baskin JB, Nielsen LD, and Clark RA. 1988. Transforming growth factor-beta stimulates the expression of fibronectin by human keratinocytes. J. Invest Dermatol. 91:207-212. 228. Wilson SE, Pedroza L, Beuerman R, and Hill JM. 1997. Herpes simplex virus-type 1 infection of corneal epithelial cells induces apoptosis of the underlying keratocytes. Exp. Eye Res. 64(5):775-779. 229. Wilson SE, Li Q, Weng J, Barry-Lane PA, Jester JV, Liang Q, and Wardinger RJ. 1996a. The Fas-Fas ligand system and other moderators of apoptosis in the cornea. Invest. Ophthalmol. Vis. Sci. 37(8):1582-1592.

PAGE 168

155 230. Wilson, S.E., Y.G.He, J.Weng, Q.Li, A.W.McDowall, M.Vital, and E.L.Chwang. 1996b. Epithelial injury induces keratocyte apoptosis: hypothesized role for the interleukin-1 system in the modulation of corneal tissue organization and wound healing. Exp. Eye Res. 62:325-327. 231. Wilson SE, Lloyd SA, and He YG. 1992. EGF, basic FGF, and TGF beta-1 messenger RNA production in rabbit corneal epithelial cells. Invest. Ophthalmol. Vis. Sci. 33:1987-1995. 232. Wilson SE, Schultz GS, Chegini N, Weng J, and He YG. 1994. Epidermal growth factor, transforming growth factor alpha, transforming growth factor beta, acidic fibroblast growth factor, basic fibroblast growth factor, and interleukin-1 proteins in the cornea. Exp. Eye Res. 59:63-71. 233. Wiseman DM, Polverini PJ, Kamp DW, and S.J.Leibovich. 1988. Transforming growth factor-beta (TGF-beta) is chemotactic for human monocytes and induces their expression of angiogenic activity. Biochem. Biophys. Res. Commun. 157:793-800. 234. Wong-Staal F, Poeschla EM, and Looney DJ. 1998. A controlled, Phase 1 clinical trial to evaluate the safety and effects in HIV-1 infected humans of autologous lymphocytes transduced with a ribozyme that cleaves HIV-1 RNA. Hum. Gene Ther. 9:2407-2425. 235. Woost PG, Jumblatt MM, Eiferman RA, and Schultz GS. 1992. Growth factors and corneal endothelial cells: I. Stimulation of bovine corneal endothelial cell DNA synthesis by defined growth factors. Cornea. 11:1-10. 236. Wrana JL, Attisano L, Wieser R, Ventura F, and Massague J. 1994. Mechanism of activation of the TGF-beta receptor. Nature. 370:341-347. 237. Wu HK. 2002. Astigmatism and LASIK. Curr. Opin. Ophthalmol. 13:250-255. 238. Wunderlich K, Senn BC, Reiser P, Pech M, Flammer J, and Meyer P. 2000. Connective tissue growth factor in retrocorneal membranes and corneal scars. Ophthalmologica. 214:341-346. 239. Yamagata M, Saga S, Kato M, Bernfield M, and Kimata K. 1993. Selective distribution of proteoglycans and their ligands in pericellular matrix of cultured fibroblasts. J. Cell Sci. 106:55-65. 240. Ye QH, Qin LX, Forgues M, He P, Kim JW, Peng AC, Simon R, Li Y, Robles AI, Chen Y, Ma ZC, Wu ZQ, Ye SL, Liu YK, Tang ZY, Wang XW. 2003. Predicting hepatitis B virus-positive metastatic hepatocellular carcinomas using gene expression profiling and supervised machine learning. Nat Med. 9(4):41623.

PAGE 169

156 241. Ying Z and King ML. 1996. Isolation and characterization of xnov, a Xenopus laevis ortholog of the chicken nov gene. Gene. 171:243-248. 242. Zhou L, Dosanjh A, Chen H, and Karasek M. 2000. Divergent effects of extracellular oxygen on the growth, morphology, and function of human skin microvascular endothelial cells. J. Cell Physiol. 182:134-140. 243. Zieske JD, Takahashi H, Hutcheon AE, and Dalbone AC. 2000. Activation of epidermal growth factor receptor during corneal epithelial migration. Invest Ophthalmol. Vis. Sci. 41:1346-1355.

PAGE 170

157 BIOGRAPHICAL SKETCH Timothy Daniel Blalock, the third child of James and Ida Blalock, was born on July 7, 1977 in Tullahoma, Tennessee. He grew up in Manchester, Tennessee until his family moved to South Carolina in 1989. Timothy attended Charleston Southern University in Charleston, South Carolina on a Board of Trustees academic scholarship. He graduated magna cum laude in 1999 with majors in chemistry and biology. He also received the award for Most Outstanding Student in Biology upon graduation. He is a member of Beta Beta Beta biological honor society and Alpha Chi academic honor society. While attending college, Timothy gained scientific experience working as a laboratory assistant in student teaching labs and in summer internships in local biotechnology laboratories. In 1999, Timothy was accepted to the Interdisciplinary Program in Biomedical Sciences (IDP) at the University of Florida College of Medicine. He joined the Biochemistry and Molecular Biology Advanced Concentration under the leadership of Dr. Gregory Schultz. In 2003, he received the Boyce Award for Outstanding Graduate Research awarded by the Department of Biochemistry and Molecular Biology. In August 2003, Timothy will be conferred the degree of Doctor of Philosophy. Upon graduation, he will move with his wife, LeeAnn Blalock who is receiving a Ph.D. in microbiology from the University of Florida, to Boston, MA to pursue a post-doctoral position at Harvard Medical School. 157


Permanent Link: http://ufdc.ufl.edu/UFE0001161/00001

Material Information

Title: Biochemical characterization and action of connective tissue growth factor and its receptor in corneal scarring
Physical Description: Mixed Material
Creator: Blalock, Timothy Daniel ( Author, Primary )
Publication Date: 2003
Copyright Date: 2003

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0001161:00001

Permanent Link: http://ufdc.ufl.edu/UFE0001161/00001

Material Information

Title: Biochemical characterization and action of connective tissue growth factor and its receptor in corneal scarring
Physical Description: Mixed Material
Creator: Blalock, Timothy Daniel ( Author, Primary )
Publication Date: 2003
Copyright Date: 2003

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0001161:00001


This item has the following downloads:


Full Text










BIOCHEMICAL CHARACTERIZATION AND ACTION OF CONNECTIVE TISSUE
GROWTH FACTOR AND ITS RECEPTOR IN CORNEAL SCARRING
















by

TIMOTHY DANIEL BLALOCK


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2003
































The work presented in this dissertation is dedicated to LeeAnn Blalock, for her love and
encouragement in the pursuit of my higher education in biomedical science. I would also
like to dedicate this dissertation to my parents, James and Ida Blalock, along with the rest
of my family, for their support in this endeavor.















ACKNOWLEDGMENTS

I would like to express my deepest gratitude to my mentor and friend Dr. Gregory

Schultz, for his encouragement, support, and understanding throughout the course of my

work for this dissertation. His expertise and advice in this endeavor have been

indispensable to my success. I would also like to sincerely thank the members of my

doctoral thesis committee: Dr. Henry Baker, Dr. Nancy Denslow, Dr. Susan Frost, and

Dr. Alfred Lewin. Their advice was crucial to my success in this research.

I would also like to extend my thanks to Dr. Nasser Chegini, Dr. David Muir, Dr.

Michael Goldstein, Dr. Gary Grotendorst, Dr. Matthew Duncan, Dr. Heather MacArthur,

Dr. Rong Yuan, Dr. Santosh Gowda, Dr. Franck Ollivier, Cecilia Lopez, Helene Klapper,

Kavita Gandhi, Alpesh Mehta, Brian Morrison, Kelly Brinsko, Samer Jaber, Julia

Burrows, Siva Radhakrishnan and Juan Varela for all of the experimental advice,

friendship, and support they have shown me throughout my time at the University of

Florida. The help extended to me by these individuals as well as others too numerous to

mention has been essential to my success.

Finally, I would like to thank my wife, LeeAnn Talarico Blalock; my parents,

James and Ida Blalock; as well as Jim, Connie, Jaime, Alicia, Bob, Lisa, and Chris

Blalock for all of the support they have offered to me over the years.
















TABLE OF CONTENTS
page

A C K N O W L E D G M E N T S ............................................................................................. iii

L IST O F T A B L E S ...........................................................................vii

LIST OF FIGU RE S .......................................................................viii

K EY TO A B B R E V IA TIO N S .......................................................................... .............x

A B STR A CT .......... .......... ................................................... ......... ........ xii

CHAPTER

1 LITERATURE REVIEW .................................................. 1

T h e C o rn ea .......................................... ............. ........................................... 1
Normal Corneal Anatomy and Physiology ......................... ..... ..............1
Corneal Scarring .................. ................ ........................... ........... 3
Growth Factors in Corneal Wound Healing........................................................ 4
R efractive Surgery .............. ... ............... .................... .......... ......... 6
Antiscarring Treatments and Complications ................ .............. .................. 8
W ound R epair and R egeneration.......................................................................... 9
Wound Healing and Repair ................. ......... ................. 9
M olecular Biology of W ound Healing................................ ............. ........... 11
W ou nd R eg en eration ................................................................ .................... 12
Transforming Growth Factor Beta (TGF-) ........................................................... 13
R oles of T G F-P ................................................. ......................... ........ 14
TG F-P and Strom al W ound H ealing.............................................. .................... 16
Connective Tissue Growth Factor (CTGF)............... ..................................... 17
CCN Gene Family...... ......................................................... ............... 18
CTGF Protein Structure ................ ................ .................... 19
C T G F an d F ib ro sis....................................................................................... 2 1
CTGF as a M editor of TGF-P Action ............................................. .............. 23
CTG F G ene R egulation............................................. ............................. 24
CTGF-Mediated TGF- Signaling ....................................................... 25
Study D esign and R ationale ....................................................................... ....... 26









2 G E N E R A L M E T H O D S .................................................................... ...................30

E xperim ental A nim als .................................................................... ....................30
Photorefractive K eratectom y............................................................ .............. 30
Sam ple C collection ...............................................3 1
Tissue Sectioning and Processing..................................... ............................ ....... 31
M icroscopy ............................................................... ... ..... ........ 32

3 CONNECTIVE TISSUE GROWTH FACTOR EXPRESSION AND ACTION IN
THE CORNEA ................. ........ ........ ...........33

Introduction ................................. .............. ............................33
M materials and M ethods..................................................................... ................... 35
C ell C culture ........................................35
Induction of CTGF by TGF-P Isoforms in Human Corneal Fibroblasts .............35
CTGF Immunocytochemistry in Human Fibroblast Cultures............................ 36
Photorefractive Keratectomy (PRK)................................... ....... ............ 36
Protein and RN A Extraction............... .......... ................ .. ... ........... 37
C T G F Sandw ich E L ISA ....................................................................... .... .... 38
C TG F TaqM an A ssay ................................................ .............................. 39
C ollagen Synthesis A ssay .................. ............................................................. 40
Reverse Transcriptase Polymerase Chain Reaction (RT-PCR)............................41
CTGF Immunohistochemistry in Corneal Sections .............................................42
R e su lts ........................................................................... ............... 4 3
Increased CTGF Expression by TGF-P Isoforms..................... .............43
CTGF-Mediated TGF-P-induced Collagen Synthesis .................................44
Increased Immunostaining in Human Corneal Fibroblast Cultures ........ ....... 44
CTGF Expression in Rat Corneas after PRK .............................. .............. 45
CTGF Immunohistochemistry in Rat Corneas Following PRK........................46
CTGF Expression in Corneal Epithelium .......................... ...................46
D discussion .............................................. ................................ 47

4 BIOCHEMICAL CHARACTERIZATION OF THE CONNECTIVE TISSUE
GROWTH FACTOR RECEPTOR IN CORNEAL FIBROBLASTS .................. 58

In tro d u ctio n ................................................................................................ 5 8
M materials and M ethods ................. ....... ... ...... ... ......................................... 60
lodination of Recombinant Human CTGF...................................................... 60
C e ll C u ltu re .......................................................................................................6 0
Cell B finding Experim ents ................................................ .............. 61
Cell Proliferation Assay .............. .. ..... .......... .......................62
Cross-linking of 125I-CTGF to Human Corneal Fibroblast Receptors .................63
Time Course of Binding to Rat Corneas following PRK.............. ............. 64
Immunoprecipitation of the Type II IGF Receptor ................... ...............65
Immunoprecipitation of Binding Reactions ..................................... ................ 65
Immunoprecipitation of Cross-linked Human Corneal Fibroblast Receptors........66



v









R e su lts ..................... ....... ......... ..... ........ ........................................ 6 6
Binding of CTGF to Receptors on Corneal Fibroblasts............................ 66
Binding of CTGF to Rat Corneas following PRK ......... ........... ............. 67
Binding of CTGF to the Type II IGF Receptor ..............................................68
Response to Exogenous TGF-P in Type II IGF Knockout Cells .........................69
D discussion .................................... ................................... .......... 70

5 ABLATION OF CONNECTIVE TISSUE GROWTH FACTOR EXPRESSION AND
ACTION USING HAMMERHEAD RIBOZYMES....................................86

Introduction ............... ......... ......... .................. ...... ........ 86
M materials and M ethods............. ................................ ...................... .............. 88
Ribozym e D esign and Synthesis................ ..................... .............. ... 88
Ribozyme Time-course and Multi-turnover Kinetics ................. ...................89
Plasmid Construction .............. ...... ......... ................90
Cell Culture and Transfection ................................... ... ... .. .............. 91
Quantitative Reverse-transcription Polymerase Chain Reaction......................92
CTGF Enzyme-linked Immunosorbent Assay (ELISA).............. .................93
C ell P proliferation A ssay ............................................................ ................... 94
R e su lts ......................... ... ........................ ................ ............... 9 4
Kinetics of CTGF Hammerhead Ribozymes...............................................94
Effect of Ribozymes on CTGF Expression in Cell Culture............... ..............95
Effect of Ribozymes on TGF-P-mediated Cell Proliferation.............................95
D iscu ssion ......... ..... ............. ................................. ...........................96

6 GENE EXPRESSION ANALYSIS OF CONNECTIVE TISSUE GROWTH
FACTOR STIMULATED HUMAN CORNEAL FIBROBLASTS ................. 107

Introduction ............................................................... .. ..... ........ 107
Materials and Methods.... ...................................... 109
Cell Culture and RN A Isolation ................................... ............ ................. 109
cRNA Preparation and Array Hybridization ........... .......................... 110
Data Analysis ................................... ........................... .. ......... 110
R results .................. ................... ............................. ..... ...... ......... 112
U supervised A analysis .......................................................... .............. 112
Supervised A analysis .................................. ........................... 114
Selected G enes of Interest ........................................................... ......... .... 115
D discussion ............................................................... ... ..... ........ 120

7 CONCLUSIONS .................................... ........................... ............ 128

LIST OF REFEREN CE S.......................................................................... .............. 136

BIOGRAPH ICAL SKETCH ........................................................... .............. 161
















LIST OF TABLES

Table page

1-1 Growth factors involved in corneal wound healing.............................................5

1-2 Classification of members of the CCN gene family. .................... ................ 19

5-1 M ulti-turnover kinetics analysis. ...................................................................... 90

6-1 Leave-one-out cross-validation analysis. ................................ ................... 113

6-2 Selected genes of interest .................................................................... ....... 118
















LIST OF FIGURES


Figure page

1-1 Domain structure of the CTGF protein..... .......... .................................... 21

1-2 Proposed role of CTGF in corneal fibrosis ................................ .... ............... 29

3-1 Expression of CTGF by human corneal fibroblasts........................... ..........52

3-2 Collagen synthesis in human corneal fibroblasts by CTGF and TGF-P ...............53

3-3 Immunolocalization of CTGF in human corneal fibroblasts ...........................54

3-4 Expression of CTGF protein and mRNA in rat corneas after PRK...................55

3-5 Immunolocalization of CTGF in rat corneas after PRK ....................................56

3-6 Detection of CTGF mRNA in rat corneal epithelium using RT-PCR ................57

4-1 Iodination of recombinant human CTGF ...................................... ..............73

4-2 Time course of CTGF binding to human corneal fibroblasts.............................74

4-3 Specificity of CTGF binding to human corneal fibroblasts. ............. ..............75

4-4 Scatchard analysis of CTGF binding to human corneal fibroblasts ........ ........ 76

4-5 Cross-linking of CTGF to human corneal fibroblasts................. ................77

4-6 CTGF affinity chromatography and specific binding ..........................................78

4-7 Specific binding of CTGF to rat corneas following PRK ..............................79

4-8 Immunoprecipitation of CTGF bound to the Type II IGF Receptor ................ 80

4-9 Immunoprecipitation of CTGF/Type II IGF receptor complexes ...................... 81

4-10 Specificity of CTGF binding to immunoprecipitated complexes ........................ 82

4-11 Immunoprecipitation of membrane proteins cross-linked with CTGF ................. 83

4-12 CTGF binding in Type II IGF receptor knockout cells ...................................... 84









4-13 Cell proliferation in Type II IGF receptor knockout cells.................................85

5-1 Structure of synthetic RNA oligonucleotides................... ............................. 100

5-2 Structure of self-cleaving hairpin ribozym e ..................................................... 101

5-3 Ribozyme cleavage time-course analysis............................. 102

5-4 M ulti-turnover kinetic analysis ..................................................................... 103

5-5 Effect of CHR 745 on mRNA expression....................................................... 104

5-6 Effect of CHR 745 on protein expression .......... ...................................... 105

5-7 Effect of CHR 745 on TGF-P-induced cell proliferation................................. 106

6-1 Hierarchical clustering patterns. ............................................... ................ 124

6-2 K -m eans clustering analysis .................................. ............................. ........ 125

6-3 Functional groups of genes regulated by CTGF ............................................... 126

6-4 The proposed role of the effect of CTGF on corneal fibroblasts........................ 127
















KEY TO ABBREVIATIONS


bp base pair

BSA bovine serum albumin

CTGF connective tissue growth factor

DEPC diethyl pyrocarbonate

DMEM Dulbecco's Modified Eagle medium

ECM extracellular matrix

EDTA ethylenediaminetetraacetic acid

EGF epidermal growth factor

FGF fibroblast growth factor

HEPES N-2-Hydroxyethylpiperazine-N'-2-ethanesulfonic acid

IGF insulin-like growth factor

IGF-IIR type II insulin-like growth factor receptor

kDa kilodalton

LB Luria Bertani medium

LRP low-density lipoprotein (LDL) receptor-related protein

M6P mannose-6-phosphate

MPR mannose-6-phosphate receptor

PCR polymerase chain reaction

PDGF platelet-derived growth factor









PEG

PMSF

PRK

RAP

RT

RT-PCR

PDGF

SDS-PAGE

TGF-a

TGF-P

TGF-P-IIR

VEGF


polyethylene glycol

phenylmethylsulfonyl fluoride

photorefractive keratectomy

receptor-associated protein

reverse transcription

reverse transcription polymerase chain reaction

platelet-derived growth factor

sodium dodecyl sulfate-polyacrylamide gel electrophoresis

transforming growth factor alpha

transforming growth factor beta

type II transforming growth factor beta receptor

vascular endothelial growth factor















Abstract of Dissertation Presented to the Graduate School of the University of Florida in
Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy

BIOCHEMICAL CHARACTERIZATION AND ACTION OF CONNECTIVE TISSUE
GROWTH FACTOR AND ITS RECEPTOR IN CORNEAL SCARRING

by

Timothy Daniel Blalock

August 2003


Chair: Gregory S. Schultz
Department: Biochemistry and Molecular Biology

Connective tissue growth factor (CTGF) is a 38 kilodalton, cysteine-rich, secreted

peptide with mitotic and chemotactic functions. CTGF expression is upregulated by

transforming growth factor beta (TGF-P), leading to the synthesis of connective tissue

and extracellular matrix components such as collagen, laminin, integrin, and fibronectin

which are predominant components of scar tissue. CTGF mRNA and protein levels are

elevated in human fibrotic disorders including renal fibrosis, scleroderma, and keloids.

Experimental data suggest that CTGF mediates the effects of TGF-P on contributing to

corneal scarring by binding to the type II insulin-like growth factor receptor.

Gene expression profiling experiments, using GeneGhip technology, were

performed showing the classes of genes in corneal fibroblasts that are induced upon

CTGF stimulation. These results show that CTGF regulates key genes involved in

corneal apoptosis, scarring, and angiogenesis. CTGF mRNA and protein expression was

stimulated in corneal fibroblasts in response to TGF-3. CTGF also mediated the effects









of TGF-3 on cell-associated collagen formation. Photorefractive keratectomy (PRK) was

performed on rats to show that CTGF mRNA and protein expression increased

dramatically in the corneal fibroblasts and epithelial cells after surgery up to Day 21. To

reduce corneal fibrosis, a gene-specific hammerhead ribozyme was developed to target

and cleave CTGF mRNA to reduce its expression. Cells transfected with a plasmid

encoding the CTGF ribozyme showed a marked decrease in CTGF mRNA and protein

expression as well as TGF-P-induced cell proliferation. To characterize the receptor for

CTGF, radioligand binding, cross-linking, in vitro binding, and immunoprecipitation

experiments were performed. These results indicate that CTGF binds to the type II

insulin-like growth factor (IGF) receptor in corneal fibroblasts. Binding to this receptor

confers biological activity in these cells.

Thus, these experiments show for the first time the induction of CTGF expression

in corneal scarring, the application of gene therapy to reduce CTGF expression, and the

identity of the CTGF receptor in corneal fibroblasts. Knowledge of the biochemistry and

action of CTGF and its receptor will elucidate their roles in the process of wound healing

and the development of anti-scarring agents.














CHAPTER 1
LITERATURE REVIEW

The Cornea

The cornea is a transparent, avascular tissue that is exposed to the external

environment. The principal physiologic requirement of the cornea is to maintain clarity

for proper vision. The maintenance of corneal shape and clarity is critical to refraction

since the cornea accounts for more than two-thirds of the total refractive power of the eye

(Chaudhuri et al., 1983). A very slight change in the contour of the cornea may result in

a serious change of refractive error. Additionally, small changes in surface smoothness

or total thickness may result in visual distortion. Many structural components work

together to maintain the optical function of the cornea. Most medical and surgical

treatments of the cornea are performed to restore corneal transparency (Choi et al.,

2002a).

Normal Corneal Anatomy and Physiology

The structure and physiology of the cornea is deceptively complex. The anterior

corneal surface is covered by tear film, a physiologically dynamic structure; while the

posterior surface is directly bathed by the aqueous humor (Doane et al., 1978). The

cornea is a transparent tissue and is continuous with the opaque sclera and the

semitransparent conjunctiva. The zone of transition between the cornea and sclera is the

richly vascularized limbus, which contains a reservoir of pluripotent stem cells (Moore et

al., 2002). Histological examination reveals a complex structure of six layers:

epithelium, epithelial basement membrane, Bowman's membrane, stroma, Descemet's









membrane, and the endothelium. The factor that determines the property of corneal

transparency is the arrangement of collagen fibers in the stromal layer (Birk and Lande,

1981a). The mean diameter of each collagen fiber and the mean distance between these

fibers are homogenous and measure less than half the wavelength of visible light. This

anatomic relationship is thought to be responsible for the fact that the incident ray

scattered by each collagen fiber is cancelled by interference of the other scattered ray,

allowing light to pass through the cornea (Maurice D.M., 1984). When these distances

vary because of fibrosis or edema, the cornea loses its transparency and there is random

scattering of incident rays (Andreo and Farrell, 1982). The cell types of cells present in

the cornea include epithelial cells, keratocytes (corneal fibroblasts) and endothelial cells.

Even though the cornea is avascular, it contains almost all of the components of the

blood, such as albumin and globulins; whereas the cellular elements are absent (Gullino,

1986). This is important for understanding the regulatory mechanisms for maintaining

normal corneal integrity; and for appreciating the pathobiology of various diseases of the

cornea.

Over 90% of the cornea is composed of stroma. The epithelial and endothelial

layers help to maintain the transparency of the cornea. However it is the anatomical and

biochemical characteristics of the corneal stroma that are principally involved in its

physical strength, constancy of shape, and transparency (Daxer et al., 1998). The corneal

stroma consists of extracellular matrix components, corneal fibroblasts, and nerve fibers;

with cellular components comprising only 2% of the total stromal volume (Otori, 1967).

Collagen (mainly types I, III, and IV) occupies over 70% of the dry weight of the cornea

(Komai and Ushiki, 1991). The pro-ac collagen chains and glycosaminoglycans (GAGs)









are synthesized by keratocytes, the predominant cellular component of the corneal stroma

(Kenney et al., 1986). These long, spindle-shaped keratocytes are found scattered

between the lamellae in the corneal stroma. The chains are then assembled into a

procollagen triple helix bundle and are assembled and processed ultimately into mature

collagen fibers. Gap junctions are the only junctional complex allowing for

communication and exchange between corneal fibroblasts (Nishida et al., 1988). It is

through injury or surgery that the keratocytes lose their network connections and behave

independently (Birk and Lande, 1981b).

Corneal Scarring

The healing of the corneal stromal wound is slower than in other connective

tissues presumably because of the lack of blood vessels. When a corneal wound or

incision occurs, fibroblasts around the wound edge die, creating a hypocellular zone

(Wachtlin et al., 1999). Beyond this zone, the quiescent keratocytes become activated

into fibroblasts and migrate to the site of injury (Snyder et al., 1998). Other cells, such as

monocytes can migrate to the wound and transform into fibroblast-like cells

(Sunderkotter et al., 1991). Formation of the stromal scar in humans is a dynamic

process. Clinical changes have been noted up to 5 years after radial keratotomy

(Eiferman, 1992). Dermatan sulfate and keratin sulfate proteoglycans from the adjacent

matrix as well as newly synthesized proeoglycans accumulate with the scar (McDermott,

1993). Collagen types I, III, V, and VI are also quite predominant within the scar

(Ljubimov et al., 1998). At 1 week after injury, single collagen bundles are seen along

the surface of the fibroblasts; but by 3 weeks, a dense network of fibrils is present, in









both parallel and random orientations (Melles et al., 1995). The strength of corneal scars

and the surrounding tissue never reaches that of the uninjured cornea.

Growth Factors in Corneal Wound Healing

Histologic changes in wound healing (such as excessive accumulation of

extracellular matrix proteins) have been known for many years; but the molecular factors

that regulate these processes in vivo are newly recognized. A delicate balance exists

between growth factors and the matrix in steps of corneal wound healing.

Growth factors were initially discovered because of their ability to stimulate

mitosis of quiescent cells in culture in a nutritionally complete medium that lacked serum

(Tuft et al., 1989). Growth factors were then found to promote cellular proliferation in an

autocrine or paracrine fashion (Steenfos, 1994a). Growth factors also possess

chemoattractive and penetrating properties (Clark and Henson, 1996); and play a major

role in the wound repair process. Growth factors attract inflammatory cells and

fibroblasts into the wound, promote proliferation of fibroblasts and endothelial cells, and

stimulate angiogenesis and wound epithelialization. They have a significant effect on the

production and degeneration of extrcellular matrix. Growth factors are synthesized and

secreted by many types of cells involved in wound healing (including platelets,

inflammatory cells, fibroblasts, epithelial cells, and vascular endothelial cells). All

peptide growth factors initiate their effects by binding to and activating specific, high-

affinity receptor proteins located in the plasma membrane of target cells. Activation of

the receptors eventually results in stimulating a number of processes, including those

involved in wound healing. Growth factors are usually grouped into families based on

structural and functional similarities. Some of the well-characterized growth factors are









included in Table 1-1 and include epidermal growth factor (EGF), transforming growth

factor-a (TGF-c), transforming growth factor-P (TGF-3) and platelet-derived growth

factor (PDGF). Other growth factors that have been shown to be important in wound

healing are the insulin-like growth factors (IGFs), fibroblast growth factor (FGF), tumor

necrosis factor-a (TNF-c), the interleukins and growth hormone (Steenfos,

1994b;Greenhalgh, 1996;Mutsaers et al., 1997).

Table 1-1: Growth factors involved in corneal wound healing

Growth factor Abbreviation Description
Synthesized by corneal epithelial cells,
Epidermal growth factor EGF and lachrymal gland; mitogenic and
chemotactic factor for all 3 corneal cell
types
g g h f r T Structurally similar to EGF; synthesized
Transforming growth factor TGF-a
a by corneal epithelial cells and lachrymal
alpha gland
gland
Three isoforms exist; promotes formation
Transforming growth factor TGF-3 of the ECM; TGF-32 is present in aqueous
beta humor; probably synthesized by the
corneal epithelium
Basic fibroblast growth bFGF Detected in the basement membrane;
factor synthesized by corneal endothelium
.Acidic f t g h Detected in the basal layer of corneal
Acidic fibroblast growth .
factr aFGF epithelial cells and in the basement
factor
membrane
Keratinocyte growth factor KGF mRNA detected in corneal epithelial cells
Hepatocyte growth factor HGF Produced in fibroblasts; mRNA detected
in corneal epithelial cells


Taking all of this information into consideration, a model of corneal wound

healing can be formulated that integrates the contributions of growth factors secreted by

lachrymal cells, inflammatory cells, epithelial cells and stromal cells (van Setten et al.,

1994;Wilson et al., 1992a;Li and Tseng, 1995a;Schultz, 1995). When an actue injury

occurs that extends through the epithelial layer into the corneal stroma, EGF and its









closely related protein TGF-a (secreted from lachrymal cells into tear fluid) penetrate

into the stromal matrix and recruit fibroblasts through chemotaxis to the site of injury

through an exocrine mechanism (Grant et al., 1992). Normally, EGF and TGF-a in tears

do not significantly penetrate through the intact keratinized layers ofuninjuried

epithelium. Inflammatory cells such as macrophages secrete multiple growth factors

including TGF-c, TGF-P, and PDGF (Madtes et al., 1988). Factors secreted by corneal

epithelial cells including TGF-P, TGF-c, EGF, PDGF, bFGF and interleukin-a (IL-c) act

by paracrine pathway to stimulate migration and mitosis of stromal fibroblasts (Wilson et

al., 1992b;Li and Tseng, 1995b;Wilson et al., 1994c;Murphy et al., 1991). Similarly,

fibroblasts secrete keratinocyte growth factor (KGF) which acts on the epithelial cells,

but not fibroblasts, to promote epithelial wound healing by a paracrine path (Sotozono et

al., 1995).

Refractive Surgery

The practice of refractive surgery comprises many techniques designed to correct

errors of refraction and improve uncorrected visual acuity. The field has experienced an

explosion in popularity due to advances in laser technology and the refinement of

procedures such as radial keratotomy, photorefractive keratectomy (PRK), and

laser-assisted in situ keratomileusis (LASIK). Radial keratotomy is a type of refractive

surgery performed on 1.5 million patients since its introduction in the United States in

1978 in which radial incisions are made with a diamond knife blade in the peripheral

cornea, resulting in a structural weakening (Duffey and Leaming, 2002). This weakening

causes peripheral steepening and central flattening, correcting myopia (Applegate and

Howland, 1997). In addition, radial keratotomy is often performed with astigmatic









keratotomy to correct astigmatism (Gimbel et al., 2000). In 1993, the excimer laser was

introduced to corneal surgeons. The excimer laser emits high-energy ultraviolet light to

ablate corneal tissue with submicron precision, without significant injury to non-ablated

tissue (Stark et al., 1992). Photorefractive keratectomy (PRK) is a refractive procedure

that uses the excimer laser to ablate the corneal epithelium followed by enough layers of

corneal stroma to achieve correction of myopia. Over one million PRK procedures have

been performed in the United States in the last 10 years (Choi et al., 2002b). Laser-

assisted in situ keratomileusis (LASIK) is similar to PRK in that a high-precision excimer

laser is used to ablate layers of the corneal stroma. However, LASIK uses an instrument

called a microkeratome to remove a flap of corneal epithelium that can be rejected after

ablation. This procedure has experienced an explosion in popularity in the last few years

due as the procedure was refined and the number of qualified surgeons across the country

grew (Wu, 2002). In addition patients with high degrees of myopia are better treated by

LASIK than radial keratotomy or PRK, because LASIK reduces complications in healing

changes.

Although these procedures are relatively noninvasive, complications due to

stromal scarring may occur, and these may impair refraction. In the case of radial

keratotomy, normal side effects may occur such as pain, glare, short-term vision

fluctuation, and anisometropia; but long-term effects due to scar tissue and haze in the

stroma may occur (Duffey, 1995). With laser-assisted procedures such as PRK and

LASIK, problems in refraction may arise due to corneal haze, a common condition of

corneal opacification (Heitzmann et al., 1993). Conditions of corneal haze are associated









with deposition of collagen, fibronectin, and laminin; and an absence of keratin sulfate

from the extracellular matrix (Malley et al., 1990;Lee et al., 2001).

Antiscarring Treatments and Complications

Although corneal haze may occur with refractive procedures, the usual practice is

to wait until the opacity fades spontaneously. However, the corneal haze may be dense

with the presence of fibrosis, in which case topical corticosteroids may be administered

(Bilgihan et al., 2000;Siganos et al., 1999). With severe cases, potent topical steroids

such as dexamethasone or prednisolone sodium acetate may be used (Price, Jr. et al.,

2001). If corneal haze is not alleviated, the surgeon may opt for retreatment with the

excimer laser. In many cases, retreament of the cornea is safer than long-term use of

topical steroids, because retreatment prevents the patient from developing complications

from the use of steroids (Choi et al. 2002). Occasionally, other treatments may be used to

reduce scar formation, such as 5-fluorouracil and mitomycin C. The 5-fluorouracil is a

pyrimidine analog that inhibits fibroblast proliferation to help reduce scarring. However,

it is associated with complications such as corneal erosion, corneal ulceration, wound and

suture track leaks, or even disintegration of absorbable sutures during the early

postoperative period (Lee, 1994). Long term complications include hemorrhage,

endophthalmitis, maculopathy, malignant and pupillary block (Ticho and Ophir,

1993;Parrish and Minckler, 1996). Mitomycin C is an antineoplastic-antibiotic agent,

that inhibits fibroblast proliferation and has been shown to decrease corneal haze after

PRK (Porges et al., 2003). Mitomycin C shows side effects similar to those of 5-

fluorouracil. When administered intra- and post-operatively, mitomycin C prevents post-

surgical scarring. However, this is accomplished by causing widespread cell death and









apoptosis; and mitomycin C may cause blindness (Khaw et al., 1993). Therefore,

alternative safer agents are needed.

Wound Repair and Regeneration

Tissue regeneration can be impaired by alteration of its cellular architecture,

which may occur through physical or genetic-induced tissue damage. Repair of these

wounds does not occur simply by release of growth factors resulting in physiological

responses such as cell migration and proliferation. Wound repair and regeneration occurs

through an integrated series of events involving many mediators, formed blood elements,

reorganization of the extracellular matrix, angiogenesis, and proliferation of both

fibroblasts and epithelial cells (Singer and Clark, 1999). Tissue regeneration requires the

regulation of various genes encoding regulatory and structural molecules participating in

both growth and tissue reorganization (Clark and Henson, 1996). The events in wound

repair follow a general temporal sequence: inflammation, tissue regeneration, and tissue

remodeling (Gharaee-Kermani and Phan, 2001). These general categories usually

overlap due to integration of events in each step. During normal wound repair, cells are

recruited from connective tissue to the site of injury by directed migration, followed by

cell proliferation, and finally deposition of extracellular matrix components (Gillitzer and

Goebeler, 2001). These events occur sequentially until normal tissue architecture is

restored.

Wound Healing and Repair

The wound healing response begins at the moment an injury occurs. These

injuries usually produce damage to vessels, resulting in blood leakage. This leakage

leads to vasoconstriction followed by formation of a clot (Mast BA and Schultz GS,









1996;Bennett and Schultz, 1993;Rendell et al., 2002). These events occur early in the

inflammatory phase and result in the termination of blood leakage. The clot comprises

platelets, cross-linked fibrin molecules, fibronectin, and thrombospondin. The clot acts

as a provisional matrix through which cells migrate during wound repair (Guo et al.,

1997b). Activated platelets release alpha granules containing adhesion proteins such as

fibrinogen, fibronectin, thrombospondin, and von Willebrand factor VIII (Guo et al.,

1997a). Adhesion of platelets to these proteins is mediated through the aIIb/P33 integrin

surface receptor (Ginsberg et al., 1992). In addition to these crucial events, platelets

release leukocyte chemotactic factors such as platelet-derived growth factor (PDGF),

insulin-like growth factor I (IGF-I), and transforming growth factors alpha and beta

(TGF-a and TGF-P) (Weksler, 2000;Ross et al., 1990;Gutierrez et al., 1987;Sporn and

Roberts, 1992). These chemotactic growth factors attract inflammatory cells, resulting in

initiation of re-epithelialization, contraction of connective tissue and stimulation of

angiogenesis (Clark and Henson, 1996; Mast and Schultz, 1996). The first leukocytes

recruited to the site of the injury are neutrophils which attack bacteria that may have been

introduced into the tissue at the time of injury (Simpson and Ross, 1972). Levels of

neutrophils begin to decline and macrophages begin to take over as the dominant cell

type in the wound. Macrophages degrade and remove tissue debris, in preparation for the

reparative phases of wound healing (Leibovich and Ross, 1976). Activated platelets

release several growth factors such as TGF-P, which recruit neutrophils and monocytes

from the bloodstream (Wiseman et al., 1988).









Molecular Biology of Wound Healing

Experiments using purified components of connective tissue showed chemotactic

activity for neutrophils, monocytes, and fibroblasts in vitro. Examples of these

extracellular matrix (ECM) components include collagen, elastin, fibronectin, and

laminin as well as their proteolytic cleavage products (Clark RAF and Henson PM,

1996). Many macrophage-derived growth factors and cytokines have been implicated in

stimulating synthesis of ECM components in addition to secreting pleiotropic factors that

impact cell proliferation and angiogenesis (Hunt et al., 1984). Primary factors of immune

regulation are cytokines, such as tumor necrosis factor alpha (TNF-u) and interleukin-1-

beta (IL-13) which are released by both macrophages and neutrophils and have an impact

on the inflammatory response (Cohen, 1976). Several pleiotropic factors have been

shown to be crucial in wound-repair efficiency (such as TGF-3, PDGF, IGF-1, bFGF,

and TGF-a). These growth factors have control over the complex processes in wound

healing involving migration, mitosis, and differentiation of epithelial and stromal cells

(Schultz et al., 1992). PDGF and vascular endothelial growth factor (VEGF) stimulate

vascular endothelial cells to extend new capillaries into the wound site, establishing new

blood supply (Mints et al., 2002). These new vessels provide nutrients, oxygen, and

other factors necessary for fibroblasts to deposit additional pro-collagen, allowing the

further and continued growth of blood vessels (Zhou et al., 2000). This process continues

until a network of new vessels bridge the wound as well as continued connective tissue

synthesis. Eventually, the fibroblasts synthesize enough ECM to form a scar, replacing

the damaged tissue. Components of the ECM in the wound are either glycosaminoglycan

polysaccharide chains, structural proteins (such as collagen and elastin) or adhesive









proteins fibronectinn and laminin) (Hay, 1981). All of the events in the process of

inflammation must be reversed for the tissue architecture to return to normal. For this to

happen, the inflammatory mediators that were generated must be removed, followed by

termination of granulocyte emigration from blood vessels, normal vascular permeability,

and removal of inflammatory cytokines (Furie and McHugh, 1989). Infiltration of

monocytes and neutrophils must decrease for this to occur. Finally, removal of

extravasated fluid, protein, cellular debris, granulocytes, and macrophages occurs as the

wound regeneration process continues (Daoud et al., 1985).

Wound Regeneration

The sequence of events in the progress of wound regeneration (Pollack 1984) is as

follows:

* Activation of coagulation leading to termination of blood leakage and formation of

the provisional matrix

* Release of soluble chemotactic factors formed from plasma proteins that attract

inflammatory cells to the site of injury

* Influx of neutrophils and monocytes to engulf and neutralize bacteria in the wound

site

* Debridement of damaged connective tissue matrix

* Initiation of neovascularization

* Stimulation of cell proliferation and connective tissue matrix remodeling

While in many cases this series of events leads to restoration of normal tissue structure

and function, problems often arise. For example, fibrotic disorders occur when scarring

results in a loss of function in the particular organ. More specifically, scarring is a result









of abundant cell synthesis by fibroblasts that proliferate and differentiate within the

provisional matrix (Lindblad, 1998). Although fibrosis in the skin may sometimes be

cosmetic, serious complications may arise when it occurs elsewhere; especially in vital

organs, as mentioned earlier in the cornea.

Transforming Growth Factor Beta (TGF-P)

Transforming growth factor beta (TGF-0) has one of the widest ranges of

activities in wound healing (of all of the growth factors involved in this process) because

of the array of cell types that produce or respond to it and because of its spectrum of

activity (Roberts and Sporn, 1990). Its role in the formation of scar tissue is due to its

influence on chemotaxis of the mesenchymal cells into the wound, stimulation of growth,

and increased synthesis and deposition of ECM components (Roberts and Sporn, 1990).

Additionally, TGF-P regulates the expression of proteolytic enzymes such as matrix

metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs) (Roberts,

1995). TGF-P is secreted by almost every tissue. Almost all normal cells have

functional membrane-bound receptors for this peptide family. The principal sources of

TGF-P are macrophages and alpha granules from platelets. After it is released it is

chemotactic for monocytes and fibroblasts and inhibitory to keratinocytes and endothelial

cells (Ksander et al., 1990). TGF-P is strongly regulated at both the transcription and

translation level in macrophages (Noble et al., 1993c). There is an association between

macrophages, TGF-P, and collagen deposition in human fibrotic disorders. Evidence

shows that in granulomas, one type of fibrosis, TGF-P was localized at the interface

between macrophages and the surrounding fibrotic capsule (Khalil et al., 1991). In

addition, TGF-P was found in abundance in the macrophages and epithelial cells in









biopsies of patients with lung fibrosis compared to normal patients (Noble et al., 1993b).

These results suggest that TGF-P is predominantly provided by macrophages during

wound repair and fibrosis.


Roles of TGF-P

TGF-P is released from platelets as two distinct complexes. A larger, latent

complex is released into the serum and comprises TGF-P, latency-associated protein

(LAP) and the latent TGF-P binding protein. A smaller complex is composed of TGF-P

and the associated LAP and is released from blood clots after dissociation (Roberts, 1995).

Five isoforms of TGF-P exist known as TGF-P31, TGF-32, TGF-33, TGF-P4,

and TGF-P5. TGF-P31 is the most abundant isoform found in all tissues, and in platelets it

is the only one present (Weibrich et al., 2002). TGF-32 is most abundant in body fluids

including aqueous and vitreous humor; while TGF-33 is usually the least abundant

(Noble et al., 1993a). Application of exogenous TGF-p31, 2, and 3 resulted in increased

scar formation in incisional wounds (Schmid et al., 1993). In these wounds, expression

of TGF-P was auto-induced by the presence of exogenous TGF-P.

TGF-P has a more profound effect on the ECM than any other growth factor. It

has a tremendous effect on increasing the strength and maturation of wounds and the

ECM in fibrotic disorders. The fibroblasts are targeted by TGF-P in skin wound healing,

which are transcriptionally activated by TGF-P (Wikner et al., 1988). TGF-P has been

found to regulate matrix proteins by upregulating collagen, fibronectin,

glycosaminoglycans, MMPs, and TIMPs while decreasing proteolytic activity and cell

adhesion via integrin receptors (Roberts, 1995). Data suggests that a specific cell









population in the early stages of wound healing is optimally targeted by TGF-3 since

single applications of TGF-P applied topically at the time of wounding are as effective as

repeated doses on scar formation (Beck et al., 1990). TGF-3 increases collagen synthesis

by upregulating procollagen I, II or VI, and parallels the increase in scar strength, even

though collagen cross-linking is not a major determinant of TGF-P-dependent

improvements in wound repair (Pierce et al., 1991). The increased expression of collagen

genes seems to be partly mediated by increased transcription of collagen mRNAs through

effects of TGF-P on nuclear factor 1 (NF1) and Spl binding sites on the collagen

promoter (Inagaki et al., 1994b; Rossi et al., 1988).

A defined interaction exists between the ECM and TGF-3. This interaction can

be bidirectional in that a disruption in the basement membrane can contribute to

prolonged and increased TGF-P expression (Lankat-Buttgereit et al., 1991). In addition,

TGF-P enhances the wound healing response in compromised conditions (like

corticosteroid treatment, irradiation, treatment with anti-neoplastic agents, diabetes, and

hypoxia) to levels comparable to those of normal tissue (Cromack et al., 1991). Also,

fetal wounds contain very little TGF-3 and heal without scarring, suggesting a critical

role of TGF-P in fibrosis (Piscatelli et al., 1994). The accumulation of ECM in fibrosis

may not only be due to a result of increased TGF-P expression but also defects in the

signaling pathways that usually suppress ECM formation (Streuli et al., 1993).

In several animal models, it has been shown that post-surgical administration of

TGF-P increases the incidence of fibrosis, while neutralizing antibodies to TGF-3

effectively reduce the incidence of scarring (Cordeiro et al., 1999a). In rat incision

wounds, injections of neutralizing antibodies to TGF- 31 and TGF-32 at the time of









wound formation reduced inflammation, angiogenesis, and matrix deposition (Shah et al.,

1994b). These wounds healed without scarring or the histological appearance of scar

tissue. Additionally, subcutaneous injections of TGF-P into mice led to the formation of

granulation tissue within two to three days, characterized by induction of neutrophils,

macrophages, fibroblasts, and endothelial cells surrounded by newly formed collagen

networks (Inagaki et al., 1994a). The effects of TGF-P were reversible, suggesting that

availability of TGF-P is important in determining the duration and course of fibrosis.

These experimental data suggest that TGF-P is a key mediator of stromal scarring.

TGF-P and Stromal Wound Healing

In corneal cells, the TGF-P isoforms and TGF-P receptors are expressed both in

normal tissue and in the wound healing process after injury (Frank et al., 1996). To

better understand stromal scarring, the effects of the TGF-P system must be examined

fully. The TGF-P isoforms directly stimulate fibroblasts to synthesize ECM proteins

including collagen and proteoglycans and suppress the synthesis of matrix

metalloproteinases (MMPs) while simultaneously increasing synthesis of the tissue

inhibitors of matrix metalloproteinases (TIMPs) (Border and Noble, 1994a;Roberts et al.,

1986). In addition, the TGF-P isoforms upregulate their own synthesis by fibroblasts

which leads to a prolonged TGF-P response utilizing an autocrine path. These combined

actions are hypothesized to occur after excimer laser PRK and lead to the deposition of

ECM in the cornea that is clinically visualized as subepithelial haze.

The molecular mechanism and action of the TGF-Ps were poorly understood until

the recent elucidation of a TGF-P signal transduction network. The three primary

isoforms of TGF-P (TGF-P31, 2, and 3), whose biological properties in vitro are extremely









similar, exert their effects through TGF-3 type I and type II receptors with serine-

threonine kinase activity. The type II receptor appears to be required for the signaling by

the type I receptor and thus, is the key receptor in the TGF-3 response system (Wrana et

al., 1994a). TGF-3 binds directly to the type II receptor which is a constitutively active

kinase. The bound TGF-3 is then recognized by type I receptor, which is recruited into

the complex and becomes phosphorylated by the type II receptor. Phosphorylation allows

the type I receptor to propagate the signal downstream substrate through the Smad family

(Wrana et al., 1994b;Heldin et al., 1997a). The proteins of the Smad family were the first

identified substrates of the type I TGF-P receptor kinase and act as the intracellular signal

transducer in the TGF-3 response pathway. As shown in cell culture studies, Smad2

and/or Smad3 are phosphorylated by the type I receptor and form a complex with Smad4

followed by translocation of the complex from cytoplasm to nuclei (Heldin et al.,

1997b;Nakao et al., 1997b). The translocated Smad complexes recruit transcription

factors to form a complex and initiate transcription of genes. Some relevant genes such

as collagen type I, fibronectin and type 1 plasminogen activator inhibitor (PAI-1) have

been proven to be regulated by TGF-P at the transcriptional level by Smad signal

transduction pathway (Nakao et al., 1997a).


Connective Tissue Growth Factor (CTGF)

Connective tissue growth factor (CTGF) is a secreted, cysteine-rich peptide of

about 38 kilodaltons. It was discovered in 1991 in the conditioned medium of cultures of

human umbilical vein endothelial cells (HUVEC). While a study was being performed

on the role of platelet-derived growth factor (PDGF) in HUVEC cells, a new peptide that

appeared to be responsible for the PDGF-related mitogen activity in the conditioned









medium was identified and called CTGF (Bradham et al., 1991e). Amino acid analysis

revealed that the peptide showed a 45% overall homology to the translational product of

the v-src-induced CEF-10 mRNA from chicken embryo fibroblasts. CTGF is a heparin-

binding protein and has been shown to be secreted by fibroblasts after activation with

TGF-P. CTGF is aptly named, because it has been identified as a major chemotactic and

mitogenic factor for cells of the connective tissue, and has PDGF-related biological and

immunological properties.

CCN Gene Family

The CTGF gene is located on chromosome 6q23.1, proximal to the c-myb gene

(Bradham et al., 1991d). It belongs to a family of peptides including serum-induced

immediate early gene products such as cyr61, fisp 12, a v-src-induced putative gene

(CEF-10), and a putative avian transforming gene (nov) (Bradham et al., 1991c;O'Brien

and Lau, 1992;Martinerie et al., 1992b). Sequence similarity also exists between CTGF

and the twisted gastrulation (tsg) gene, one of seven known zygotic genes specifying the

fate of dorsal cells in the embryos of Drosophila (Mason et al., 1994). This family of

peptides (shown in Table 1-2) is characterized by conservation of thirty-eight cysteine

residues between species, comprising just over 10% of the total amino acid content. This

family also contains a sequence homology of 30-38% to the low-affinity IGF-binding

proteins (IGFBPs), and has the conserved IGFBP motif (GCGCCXXC) in the amino

terminus with up to seventeen of the cysteines conserved in the IGFBPs (Brigstock,

1999). It has been suggested that CTGF is another member of the low-affinity IGFBP

group of genes. This family, along with the high-affinity IGFPB gene make up an









IGFBP superfamily that regulates normal as well as neoplastic growth (Kim et al.,

1997a).

The mouse ortholog to CTGF is most likely fisp-12 since it has a 93-94% amino

acid sequence homology to human CTGF. Similarly, the nov transcript is derived from a

distinct gene known as nov in humans (Snaith et al., 1996), frog (Ying and King, 1996),

mouse (Liu et al., 1999), and chicken (Martinerie et al., 1992a). Additionally, cyr61 (in

humans, frog, and chicken) and ceflO (in mice) appear to be homologous indicating that

at least three distinct genes encode these peptides (CTGF/fisp-12, cefl0/cyr61, and nov).

Currently, this family has been termed CCN (Bork, 1993d). This suggests that

CTGF-related peptides function in a wide array of biological activities ranging from

normal embryonic development to tissue regeneration, tumor formation and growth.

Table 1-2: Classification of members of the CCN gene family

Species CTGF Nov Cyr

Homo sapiens (human) CTGF h-nov h-Cyr61

Xenopus laevis (frog) xCTGF x-nov

Gallus gallus (chicken) cCTGF nov Cyr61

Mus musculus (mouse) fisp-12 m-nov CEF10

Drosophila melanogaster (fruit fly) Tsg



CTGF Protein Structure

The CCN family of proteins reveal four distinct modules, each encoded by a

separate exon and possess a signal peptide through normal secretary pathways (Bork,

1993c). Two cysteine-rich domains exist separated by a cysteine-free hinge region in the

middle of the peptide (shown in Figure 1-1). An even number of cysteines are present in









each module (22 in the N-terminus and 16 in the C-terminus), possibly contributing to

independent disulfide bridges. Mild protease digestions show cleavage in the cysteine-

free region yielding separate N- and C-terminal domains without denaturation or

reduction of disulfides in the other modules. Overall, this suggests that the protein has

two disulfide cross-linked domains separated by a cysteine-free hinge region.

Furthermore, extensive proteolytic digestion fails to cleave the cross-linked domains into

smaller fragments, suggesting the disulfide bonds are resistant to proteolysis.

The amino-terminus of this protein contains two motifs which may be responsible

for its binding to other growth factors (Bork, 1993b). Adjacent to the signal peptide is a

sequence encoded in exon 2 which is nearly identical to the IGFBP motif, most likely

responsible for its IGF binding property. The second domain is similar to von

Willebrand factor type C which is present as a single copy in the CCN peptide family and

as multiple copies in tsg, all containing multiple cysteine residues (Bork, 1993a). This

motif functions to interact with other growth factors to cause complex or dimer formation

(Tanaka et al., 2001).

The carboxy-terminus of the CCN family of peptides shares a disulfide linkage

pattern with PDGF, TGF-P, and nerve growth factor (NGF), which are involved in

heparin binding (Bork, 1993e). The first domain in the C-terminus is the

thrombospondin type I repeat which is present in several extracellular matrix proteins.

One function of this domain is binding interaction with glycoconjugates such as

glycosaminoglycans (Incardona et al., 1996). This domain possesses a high-affinity for

heparin, which has similarity to other growth factors such as bFGF and heparin-binding

epidermal growth factor (EGF) (Grotendorst, 1997a). The discrete region of the domain









responsible for heparin binding has not yet been identified. The final motif contains six

cysteine residues also found in the growth factors PDGF, TGF-3, and NGF. The dimeric

nature of TGF-P and PDGF exists due to disulfide bridges not found in CTGF (Murray-

Rust et al., 1993). The structural relationship of the heparin-binding domains to known

growth factors suggest that CTGF could be involved in signaling and receptor binding.



H2N growth factor- heparin-binding COOH
H2N I --- COOH
binding domain domain


cysteine-free hinge

Figure 1-1. Domain structure of the CTGF protein.


CTGF and Fibrosis

The expression of CTGF is believed to be limited to cells derived from the

mesenchyme including fibroblasts, vascular endothelial cells, smooth muscle cells,

chondrocytes, and renal tubule cells (Dammeier et al., 1998a). Lymphocytes, leukocytes

and cells derived from the epithelium of embryos are not known to express CTGF. It is

also over-expressed in a variety of fibrotic disorders such as scleroderma (Kikuchi et al.,

1995a), systemic sclerosis (Sato et al., 2000), atherosclerosis (Hishikawa et al., 1999b),

internal organs in idiopathic pulmonary fibrosis (Igarashi et al., 1998b), liver fibrosis

(Ksander et al., 1990), diabetic glomerulosclerosis (Ito et al., 1998a), and renal fibrosis

(Goldschmeding et al., 2000). In addition it is over-expressed in tumors such as

pancreatic carcinoma (Wenger et al., 1999b), malignant fibrous histocytoma (Igarashi et

al., 1998a), and human breast cancer specimens (Hishikawa et al., 1999d). High

expression of CTGF mRNA has been detected in myofibroblasts in the fibrotic tissues









surrounding invasive tumors even though TGF-3 was not found (Hishikawa et al.,

1999c). CTGF may also be important in the formation and stabilization of atherosclerotic

plaques since it is expressed abundantly in human aortic smooth muscle cells and induces

apoptosis through growth inhibition (Hishikawa et al., 1999a). Together, these results

suggest that CTGF plays an important role in stimulating the proliferation of connective

tissue and the extracellular matrix.

A wide variety of important biological processes such as normal embryonic

development and tissue regeneration seem to be regulated by CTGF-related gene

products. Since recombinant CTGF has been produced, it is possible to investigate the

biological activity of this growth factor on cells in culture and its possible functions in

physiology in vivo. Unstimulated mesangial cells in the kidney express and secrete

minimal amounts of CTGF protein and minimal amounts of CTGF were secreted from

the cells. However, when these cells were treated with sodium heparin, a four-fold

increase in media-associated CTGF was observed, suggesting that the major amount of

CTGF was matrix-bound. The addition of TGF-P markedly increased the amount of

CTGF mRNA (Riser et al., 2000). In a separate study, CTGF has been shown to act as a

mitogen in cultures of normal rat kidney fibroblasts, which is enhanced with the addition

of either EGF or heparin. In the same study, CTGF also increased the mRNA transcripts

for type I collagen, a5 integrin, and fibronectin (Frazier et al., 1996d). Thus, similarly to

TGF-P, CTGF can induce connective tissue cell proliferation and ECM synthesis,

differentiating it from EGF, FGF, and PDGF, which do not contribute significantly.

These experiments show that CTGF was similar but not identical properties to TGF-3,









suggesting that it may function as a downstream mediator of some of the actions of

TGF-P.

Limited information is available on the expression of CTGF in ocular tissues.

One study showed the expression and localization of CTGF mRNA in human

retrocorneal and subretinal fibrovascular membrane specimens using in situ hybridization

(Wunderlich et al., 2000d;Meyer et al., 2002). Other studies show the expression of

CTGF in human aqueous humor, human tear fluid, and pterygia samples, suggesting a

possible involvement of CTGF in ocular pathology (van Setten et al., 2002b;van Setten et

al., 2003;Van Setten et al., 2003). An additional study shows that the addition of TGF-P

to cultures of rabbit corneal fibroblasts induces the expression of CTGF mRNA and

protein although the properties of rabbit corneal fibroblasts in culture have proven to be

quite different from human cultures (Folger et al., 2001a). Since the role of CTGF

appears to be so crucial in the regulation of fibrosis in other tissues, its expression and

role in the normal and fibrotic cornea needs to be assessed as a target for reducing

fibrosis.


CTGF as a Mediator of TGF-P Action

The link between TGF-P and CTGF is clear in its role in the regulation of normal

and fibrotic pathophysiology. The fact that TGF-P induces expression of CTGF in

almost every mesenchymal cell type suggests that expression of CTGF is necessary to

mediate some of the actions of TGF-P on inducing extracellular matrix synthesis and

regulating cell proliferation. TGF-P is known to affect many genes that are involved in

wound healing, but it is the effect it has on expression of CTGF that may be one of the

most important factors in understanding the regulation of stromal scarring









CTGF Gene Regulation

CTGF is known to be induced by TGF-3 but not by other related growth factors

like EGF, PDGF, FGF, insulin or IGF (Grotendorst et al., 1996d). Most likely this is due

to different signal transduction pathways induced upon activation by TGF-P, which

activates a serine/threonine protein kinase receptor, as opposed to other growth factors

like EGF, FGF, PDGF, insulin and IGF, which activate tyrosine kinase receptors

(Ohtsuki and Massague, 1992;Ullrich and Schlessinger, 1990). The CTGF promoter has

a TGF-P-inducible element, which is another mechanism for inducing the expression of

CTGF mRNA by TGF-P. Examination of the CTGF promoter has revealed multiple

consensus elements that are similar to other growth factor genes like the CArG box and

AP-1/SP-1 sites. The sequences are present although they do not appear to be required

for TGF-P induction of the CTGF gene (Grotendorst et al., 1996c). Other regions of the

human CTGF promoter include nucleotide sequences that are related to two other

reported TGF-P control elements, NF-1 and the TGF-P inhibitory element. Analysis of

deletion mutants indicated that neither element was necessary for TGF-3 induction, and

that an important TGF-3 regulatory element was located between positions -162 and

-128 of the CTGF promoter sequence (Grotendorst et al., 1996b).

Extended expression of CTGF transcripts for 24-48 hours has been noted after

only a brief one-hour exposure to TGF-P. In another experiment, brief treatment of

human skin fibroblasts with TGF-P for 1 hour gave nearly the same fold induction of

CTGF gene transcription as either 4 or 24 hours of treatment (Grotendorst et al., 1996a).

The induction of CTGF mRNA in fibroblasts in response to TGF-P is not blocked by

protein synthesis inhibitors such as cycloheximide, even after a brief exposure in









combination with TGF-P. These results confirmed that transcriptional regulation by TGF-

P is a component of the mechanism for induction of CTGF expression.

CTGF-Mediated TGF-P Signaling

TGF-P is thought to influence CTGF by either direct or indirect pathways. With

these hypotheses, TGF-P is believed to have an effect on cells via CTGF or

synergistically with CTGF to induce a cellular response. TGF-P has the ability to

stimulate the growth of fibroblasts in soft agar, which is a property typical of transformed

cells. On the other hand CTGF cannot induce anchorage independent growth of NRK

fibroblasts. Also, neutralizing antibodies to CTGF specifically blocked TGF-P-induced

anchorage-independent growth (AIG), while other growth factors including PDGF, FGF

or EGF were not effective as mitogens on cells in culture. In addition, clones of normal

rat kidney (NRK) fibroblasts that express an antisense-CTGF gene blocked the

expression of endogenous CTGF but do not respond to TGF-P in the AIG assay. In an

identical assay the addition of pure recombinant CTGF to the media restored the growth

of cells (Kothapalli et al., 1997a). These studies show that TGF-P stimulation of NRK

fibroblast AIG acts via the synergistic pathway probably by CTGF downstream

stimulation.

In the same study, the ability of CTGF to induce collagen synthesis (a component

of the ECM) was examined. In vitro and in vivo studies were performed to determine

whether CTGF was also essential for TGF-P-induced collagen synthesis (Duncan et al.,

1999k). In vitro studies with NRK fibroblasts demonstrated that CTGF potently induced

collagen synthesis and transfection. Additionally, an antisense to the CTGF gene blocked

induction by TGF-P. Moreover, TGF-P induced collagen synthesis in NRK fibroblasts









and human foreskin fibroblasts was effectively blocked with specific anti-CTGF

antibodies. A similar result was also observed by suppressing TGF-3- induced CTGF

expression by elevating intracellular cAMP levels in the same report with either

membrane-permeable 8-bromo-cAMP or an adenylate cyclase activator such as cholera

toxin (Duncan et al., 1999). These data indicate that CTGF mediates TGF-3 induced

fibroblast collagen synthesis and that in vivo blockade of CTGF synthesis. TGF-P also

induced granulation tissue formation via CTGF by inhibiting both collagen formation as

well as fibroblast accumulation.


Study Design and Rationale

Although limited information is available on the role of CTGF in the cornea, most

reports suggest that it might play a significant role in corneal fibrotic disorders

(Wunderlich et al., 2000c;Folger et al., 2001b). Based on the reported effects of CTGF in

other fibrotic conditions and initial experiments, it is the overall hypothesis that CTGF is

a major regulator of corneal scar formation and mediates many of the fibrotic effects of

TGF-P in corneal scarring. It is hypothesized that levels of CTGF mRNA and protein

will increase in rat corneas during healing of excimer ablation wounds, and that all three

TGF-P isoforms induce CTGF mRNA and protein in cultured human fibroblasts. It is

also believed that CTGF will induce collagen synthesis, and most importantly, that

inhibiting CTGF will block TGF-P-induced collagen synthesis in cultured human

fibroblasts. Since limited information is available for the putative CTGF receptor (which

will be addressed to greater detail in Chapter 4) characteristics of the receptors for CTGF

on the surface of human corneal fibroblasts need to be obtained using a combination of









biochemical techniques that include chemical cross-linking of 125I-CTGF to cultured

fibroblasts, CTGF affinity column chromatography and immunoprecipitation.

The proposed model of CTGF induction of corneal scarring is illustrated in Figure

1-2. Epidermal growth factor (EGF) and transforming growth factor alpha (TGF-ac) are

produced by the lachrymal gland and are present in tears. Activated macrophages and

neutrophils from the inflammation response also release TGF-P. The binding of TGF-P

activates the synthesis and release of CTGF from the stromal fibroblasts within the

cornea. These fibroblasts are also stimulated to produce even more TGF-P, which

stimulates more cells to produce CTGF. When CTGF is released, it binds to receptors on

the stromal fibroblasts or perhaps the epithelium and/or endothelium and signals the

synthesis of collagen I, III, and IV, as well as fibronectin. CTGF also stimulates cell

proliferation within the stroma so that the effect is amplified.

Although sufficient information is available showing that CTGF is a mitogen for

fibroblasts and a strong inducer of collagen synthesis, very little is known its regulation

of other genes. The most effective method to understand the broad actions of CTGF on

corneal gene expression and wound healing is to use microarray GeneChip technology to

initially identify genes that are changing. This technology can be used to identify a

number of genes that are up-regulated or down-regulated by CTGF. This information

will be used to test previous hypotheses about corneal wound healing and to generate new

hypotheses about how CTGF influences scar formation. A long-term goal of this

research is to develop agents that reduce corneal scarring by selectively reducing the

expression of fibrotic genes such as TGF-3 and CTGF. In this work, antisense






28


oligonucleotides and ribozymes to CTGF will be developed and optimized to evaluate the

anti-scarring effects of these powerful agents on corneal wound healing animal models.

The general goal of this dissertation is to understand the molecular regulation of

stromal scarring and the role that CTGF plays in regulating corneal scarring and to

develop new anti-scarring agents, targeting CTGF and related genes.












Activated macrophages andTears from
Tears from
neutrophils from the P O TGF-p3 lacrimal
inflammation response EGF, TGFa gland

-.,,,,4. .t'- _-' _. -C



-.. _. -. -- ." .. t
S tu g a -t







con-a- -- -- -- -. --" -a-.
.1" -1)()1111 1 II -. -i
"- "---" -- -"-- -

"-- -t .--
r -- -- .- --.. ..







Figure 1-2. The proposed role of connective tissue growth factor (CTGF) in
corneal fibrosis.















CHAPTER 2
GENERAL METHODS

Experimental Animals

Adult male Sprague-Dawley rats (200-250 g) were purchased from Harlan

(Indianapolis, IN). All rats were housed in pairs in air-conditioned rooms (22-25 C)

with 14 hours of lights per day. Constant food and water were available to all animals.

Rats were euthanized at the end of the experiments with intraperitoneal injection of

pentobarbital (Beuthanasia-D Special). Mice used for all experiments were housed four

per cage in a similar environment. Mice were euthanized by cervical dislocation at the

end of the experiments. All animal protocols were approved by the Institutional Animal

Care and Use Committee (IACUC) at the University of Florida.


Photorefractive Keratectomy

Adult Sprague-Dawley male rats (200-250 g) with normal eyes were anesthetized

with an intraperitoneal injection of sodium pentobarbital (30 mg/kg). Eyelashes and

whiskers surrounding the eye were removed from the visual field. A drop of

proparacaine-HCl (0.05%) was applied to the eye and the cornea was centered under the

laser microscope. Bilateral excimer laser photorefractive keratectomy was performed

(Chen et al., 2000h). Briefly, corneas were ablated in a 4.4-mm treatment zone with an

excimer laser (Summit SVS Apex) in the phototherapeutic keratectomy mode. The

corneal epithelium was ablated to a depth of 40 |tm, followed by ablation of the stroma to

a depth of 20 |tm for a total ablation depth of 60 rtm. After excimer laser treatment,









tobramycin (0.3%) ointment was applied to the corneal surface to prevent infection. No

postoperative topical steroid was administered.


Sample Collection

On the appropriate day following excimer laser keratectomy, rats were euthanized

as described earlier. The corneas were harvested with the aid of an operating microscope.

Briefly, a 3-mm disposable biopsy punch was used to groove the cornea and enter the

anterior chamber of the eye, followed by completion of tissue excision using Vannase

scissors and Maumenee forceps. Corneal buttons were snap frozen in liquid nitrogen,

placed in polypropylene 1.5-ml microcentrifuge tubes, and stored at -800 C until further

analysis. Normal, unoperated rats were sacrificed at each of the time points to obtain

control (Day 0) corneas.



Tissue Sectioning and Processing

After standard histological processing and embedding in paraffin blocks, 6

micrometer thick sections were cut with a microtome. Tissue sections were

deparaffinized by two incubations in xylene for ten minutes, hydrated through absolute

alcohol, 95% alcohol, 75% alcohol and 50% alcohol for ten minutes at each step followed

by a 1 minute wash in distilled water. Endogenous peroxidase activity was quenched by

incubation with 0.03% H202 for 60 minutes at room temperature. Tissue sections were

gently rinsed in distilled water, washed for five minutes and wash buffer (5 mM Tris, 300

mM NaC1, 0.1% Tween 20, pH 7.4) containing 2% goat serum and 5% bovine serum

albumin (BSA) was added and allowed to incubate for 60 minutes at room temperature.









Immunohistochemical localization was then achieved through affinity-purified primary

and secondary antibodies followed by the appropriate detection reagents.


Microscopy

Tissue sections mounted on glass slides were photographed using either bright

field illumination or fluorescence microscopy with excitation/emission wavelengths for

Texas Red staining, and Nomarski phase-contrast microscopy at 200x magnification.

Photographs were taken at a constant exposure using a Peltier-cooled Olympus digital

camera. Cell cultures fixed with paraformaldehyde or methanol on glass slides were

photographed in a similar fashion, using an inverted-phase microscope using either bright

field illumination or fluorescence microscopy with excitation/emission wavelengths for

Texas Red staining.














CHAPTER 3
CONNECTIVE TISSUE GROWTH FACTOR EXPRESSION AND ACTION IN THE
CORNEA

Introduction

Connective tissue growth factor (CTGF) is a secreted, cysteine-rich monomer of

about 38 kDa that was originally identified as a mitogen for fibroblast in conditioned

media cultures from human umbilical vein endothelial cells (Bradham et al.,

1991b;Ryseck et al., 1991;Frazier et al., 1996c). CTGF belongs to the CCN (CTGF,

Cyr61/CeflO, Nov) family of secreted cysteine-rich proteins, which possess important

growth regulatory functions and are involved in cell differentiation (Hashimoto et al.,

1998a;Hurvitz et al., 1999;Albrecht et al., 2000). However, the most important biological

action of CTGF may be in stimulating synthesis of extracellular matrix components.

When added to cultured human skin fibroblasts, CTGF dramatically increased synthesis

of collagen, integrin, and fibronectin, and subcutaneous injections of CTGF into mice

produced granulation tissue and fibrosis in the skin (Frazier et al., 1996b). This finding

led to investigations of the possible role of CTGF in fibrotic diseases. CTGF mRNA was

significantly elevated in the left ventricles of rat hearts following myocardial infarction,

which correlated well with concomitant increases in fibronectin, and type I and type III

collagen mRNA levels and development of cardiac fibrosis in the animal hearts (Chen et

al., 2000i). Significant upregulation of CTGF was detected in human heart samples

derived from patients diagnosed with cardiac ischemia. Elevated CTGF protein and

mRNA levels were found in sclerotic skin fibroblasts (Igarashi et al., 1995), specimens of









inflammatory bowel disease (Dammeier et al., 1998b), in retrocorneal membranes

(Wunderlich et al., 2000b), and overexpression of CTGF was linked to human renal

fibrosis (Ito et al., 1998b).

The transforming growth factor beta (TGF-3) system (Border and Noble,

1994b;Perkett, 1995;Perkett, 1995) has also been implicated in promoting scarring and

fibrosis in numerous tissues including lung (Westergren-Thorsson et al., 1993), kidney

(Border et al., 1992), liver (Castilla et al., 1991), and pancreas (Vogelmann et al., 2001).

Furthermore, agents that reduced the activity of the TGF-P system by selectively

targeting TGF-3 or its receptors reduced scarring in several animal models of tissue

fibrosis (Castilla et al., 1991;Border et al., 1990;Jester et al., 1997). Recently, two

important links between CTGF and the TGF-P system were reported that added weight to

the concept that CTGF plays important roles in scarring. First, TGF-P31 induced synthesis

of CTGF in cultured normal rat kidney fibroblasts (Frazier et al., 1996a), and second,

neutralizing antibodies to CTGF blocked collagen synthesis induced by TGF-P in rat and

human fibroblasts (Duncan et al., 1999i). These results indicated that CTGF could be a

downstream mediator of some of the scarring effects of TGF-P.

The CTGF system has not been investigated in corneal wound healing. To help

assess the hypothesis that CTGF regulates corneal scarring, the influence of TGF-P

isoforms on expression of CTGF in human corneal fibroblasts was investigated as well as

the role of CTGF in mediating the effects of TGF-P on CTGF levels and collagen

synthesis by cultured human corneal fibroblasts. Finally, the levels of CTGF protein and

mRNA in rat corneas after PRK were measured and CTGF protein was localized in

healing rat corneas.











Materials and Methods

Cell Culture

Cultures of human corneal fibroblasts were established by outgrowth from corneal

explants as described previously (Woost et al., 1992). Briefly, epithelial and endothelial

cells were removed from corneas that were unsuitable for corneal transplantation, the

stroma was cut into cubes approximately 1 mm3, placed in culture medium consisting of

equal parts Dulbecco's Modified Eagle Medium (DMEM), Medium 199 (Gibco BRL),

Ham's F12 nutrient mixture (Gibco BRL) containing 1 mM NaHCO3, and buffered with

25 mM HEPES at pH 7.4. The medium was supplemented with 10% heat-inactivated

normal calf serum and lx antibiotic-antimycotic (Gibco BRL). Cell cultures used

between passages 2 and 5 for all experiments.

Induction of CTGF by TGF-P Isoforms in Human Corneal Fibroblast Cultures

Cultures of corneal fibroblasts were washed and placed in serum-free medium for

24 hours then the medium was replaced by three different concentrations of TGF-P 1,

TGF-P2, and TGF-33 isoforms (0.1, 1.0, and 10 ng/ml) (R&D Systems, Minneapolis,

MN). After 48 hours of incubation, the conditioned medium was removed, centrifuged,

the supernatant solution frozen at -800C until the samples were assayed for CTGF using

the ELISA described below. The cells in each well were also collected by scraping and

frozen at -800C and total RNA was isolated as described below for measurement of

mRNA levels using TaqMan quantitative RT-PCR as described below. Each level of

TGF-P was assayed in three replicate wells, and results were analyzed using

ANOVA/MANOVA and Tukey's HSD post-hoc test.









CTGF Immunocytochemistry in Human Fibroblast Cultures

Human corneal fibroblasts were seeded into 48-well plates and grown to

confluence in serum-supplemented medium. After incubation in serum-free medium

containing insulin, transferring, and selenious acid for 72 hours, fibroblasts were then

cultured for an additional 48 hours with or without 5 ng/mL TGF-3. Cells expressing

CTGF were then detected immunohistologically using a standard avidin-biotin

amplification method. Briefly, cells were fixed in cold 4% paraformaldehyde,

permeabilized with Triton-X-100, and blocked with 2% milk / 10% horse serum.

Fibroblasts were then sequentially incubated with goat anti-human CTGF for 1 hour at

room temperature, washed three times with Tris buffer saline (TBS, pH =7.4), incubated

with biotinylated horse anti-goat IgG secondary antibody (Vector Labs, Burlingame,

CA), washed, incubated with alkaline phosphatase conjugated streptavidin (Dako,

Carpinteria, CA), washed, then incubated with Vector Red alkaline phosphatase

visualization substrate. The goat anti-human CTGF antibody was raised against

recombinant human CTGF protein and was purified with a CTGF-affinity column as

described previously (Duncan et al., 1999h). The antibody predominately recognizes

antigenic determinants on the N-terminal sequence of CTGF.

Photorefractive Keratectomy

Animal Procedures were performed in accordance with the ARVO statement for

the Use of Animals in Ophthalmic and Vision Research and was approved by the

University of Florida Animal Care and Use Committee. Twenty adult Sprague-Dawley

male rats (250 g) with normal eyes were anesthetized with an intraperitoneal injection of

sodium pentobarbital (30 mg/kg). Eyelashes and whiskers surrounding the eye were

removed from the visual field. A drop of proparacaine-HCl (0.05%) was applied to the









eye and the cornea was centered under the laser microscope. Bilateral excimer laser

photorefractive keratectomy was performed.(Chen et al., 2000g) Briefly, corneas were

ablated in a 4.4-mm treatment zone with an excimer laser (Summit SVS Apex) in the

phototherapeutic keratectomy mode. The corneal epithelium was ablated to a depth of 40

|tm, followed by ablation of the stroma to a depth of 20 |tm for a total ablation depth of

60 |tm. After excimer laser treatment, tobramycin (0.3%) ointment was applied to the

corneal surface to prevent infection. No postoperative topical steroid was administered.

At 1, 3, 7, 11, 14, and 21 days after excimer laser ablation, rats were euthanized by

peritoneal injection of pentobarbital. The corneas were excised using an operating

microscope and snap-frozen in liquid nitrogen followed by storage at -800 C until

analysis. Four rats were euthanized at each time point. Three rats from each time point

were used for protein and RNA analysis. Corneas from the left eyes were used for protein

analysis. Corneas from the right eyes were pooled and used to measure mRNA for CTGF.

One rat from each time point was used for immunohistochemistry. Eight corneas from

four rats that did not undergo excimer ablation were used as normal controls (Day 0).

Protein and RNA extraction

Whole corneas or epithelial scrapings were homogenized in 200 ptL PBS/0.1%

Triton-X-100 using a frosted glass-on-glass tissue grinder (Duall 22). Tissue extracts

were centrifuged at 40 C at 15,000 x g for 15 minutes to remove cellular debris and

membranes. The supernatants were measured for CTGF protein levels using an enzyme-

linked immunosorbent assay (ELISA). Total RNA was extracted from pooled corneas by

homogenization in TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA) using a

frosted glass-on-glass tissue grinder. Total RNA was extracted from each sample using









chloroform, RNA was precipitated with 70% isopropanol at -200 C and washed with 70%

ethanol. RNA pellets were dissolved in diethylpyrocarbonate (DEPC)-treated water and

stored at -800 C. RNA concentrations isolated from each group were measured using a

spectrophotometer (GeneQuant, Amersham/Pharmacia Biotech).

CTGF Sandwich ELISA

CTGF was measured in the conditioned medium of cultured cells and in tissue

extracts using a capture sandwich ELISA with biotinylated and non-biotinylated affinity

purified goat polyclonal antibodies to human CTGF which was produced using a

baculovirus expression system as described previously (Duncan et al., 1999g). Briefly, a

flat-bottom ELISA plate (Costar 96-well) was coated with 50 ptL of goat anti-human

CTGF antibody, which recognizes predominately epitopes in the N-terminal half of the

CTGF molecule at a concentration of 10 [tg/mL in PBS/0.02% sodium azide for 1 hour at

370 C. Wells were washed four times and incubated with 300 ptL of blocking buffer

(PBS/0.02% sodium azide/l% bovine serum albumin) for 1 hour at room temperature.

This polyclonal antibody is appropriate for detection of rat CTGF because there is a 92%

amino acid identity between the sequences of rat and human CTGF in the N-terminal half

of the peptide (Moussad and Brigstock, 2000). The wells were washed four times and 50

[tL of recombinant human CTGF protein (from 0.1 ng/ml to 100 ng/ml) or sample was

added and incubated at room temperature for 1 hour. After washing, 50 ptL of

biotinylated goat anti-human CTGF (2 [tg/mL) was added and incubated at room

temperature in the dark for 1 hour, then washed, and 50 ptL of alkaline phosphatase-

conjugated streptavidin (1.5 [tg/ml, Zymed, South San Francisco, CA) was added and

incubated at room temperature for 1 hour. The wells were washed again and incubated









with 100 ptL of alkaline phosphatase substrate solution (1 mg/mL p-nitrophenyl

phosphate, Sigma Chemicals, St. Louis, MO) in sodium carbonate/bicarbonate

buffer/0.02% sodium azide, pH = 9.6. Absorbance at 405 nm was measured using a

microplate reader (Molecular Devices, Sunnyvale, CA). CTGF levels were normalized

for total protein content of samples using bicinchoninic acid (BCA) protein assay reagent

(Pierce Chemical, Rocckford, IL) and were expressed as ng/mg protein for three replicate

samples for each condition. Sensitivity of the ELISA was 0.1 ng/ml with an intra-assay

variability of 3%, which is similar to a previously published ELISA for CTGF (Tamatani

et al., 1998).

CTGF TaqMan Assay

CTGF mRNA transcripts were detected using the TaqMan real-time quantitative

RT-PCR procedure (Heid et al., 1996). The TaqMan technique for measuring mRNA

levels is based on the 5' exonuclease activity of Taq polymerase on DNA/DNA

oligonucleotide complexes (Holland et al., 1991). In addition to gene specific PCR

primers, TaqMan uses a reporter probe that is coupled to two fluorescent dye molecules

at the 5' and 3' ends of the probe (Livak et al., 1995). A standard curve was generated

using CTGF mRNA transcripts that were transcribed in vitro from a plasmid containing

CTGF cDNA. Briefly, electrocompetent E. coli cells (Stratagene, La Jolla, CA) were

transformed with a plasmid (pRc/CMV, Invitrogen, Carlsbad, CA) containing the full

length cDNA for human CTGF, colonies were selected with ampicillin, and 1 |tg of

isolated plasmid was transcribed using an in vitro transcription kit (Ambion, Houston,

TX). CTGF mRNA was precipitated with ethanol and dissolved in DEPC-treated water.

Reactions were assembled in a 96-well optical reaction plate. Each reaction contained lx









TaqMan One-step RT-PCR Master Mix, 900 nM forward primer (5'-

AGCCGCCTCTGCATGGT-3'), 900 nM reverse primer (5'-

CACTTCTTGCCCTTCTTAATGGTTCT-3'), 2 [tM fluorescent TaqMan probe (5'-

6FAM-TTCCAGGTCAGCTTCGCAAGGCCT-TAMRA-3'), and RNA sample (CTGF

mRNA standard or 500 ng of sample RNA) to a final volume of 25 ptL per reaction. The

plate was analyzed on the ABI Prism 5700 Sequence Detection System (Applied

Biosystem, Foster City, CA), which simultaneously performs the RT-PCR and detects

fluorescence signal. A standard curve was generated using the transcribed CTGF mRNA

samples (2.3 x 10-2 to 2.3 x 10-6 pmol). The level of glyceraldehyde phosphate

dehydrogenase (GAPDH) mRNA was also measured in each sample using the TaqMan

GAPDH Control Kit (Applied Biosytems, Foster City CA), and the number of CTGF

mRNA molecules in samples was expressed as pmol CTGF mRNA per pmol of GAPDH

mRNA. Levels of mRNA were expressed as mean standard error of 3 replicate

samples for each condition, and ANOVA and Tukey's HSD post-hoc test were used to

assess statistical significance between times and groups.

Collagen synthesis assay

Collagen synthesis by human corneal fibroblasts was measured using 3H-proline

incorporation as described previously (Duncan et al., 1999f;Webster and Harvey, 1979).

Briefly, cultures of human corneal fibroblasts were grown to confluence in serum

supplemented medium, incubated in serum-free medium for 24 hours, then incubated 24

hours with eight different supplements: (1) serum-free medium; (2) 10% serum; (3)

serum-free medium with 5 ng/mL TGF-p31; (4) 25 ng/mL CTGF; (5) 5 ng/mL TGF-p31 +

50 [tg/mL goat anti-CTGF; (6) 5 ng/mL TGF-31 + 50 [tg/mL non-immune goat IgG; (7)









5 ng/mL TGF-p31 + 10 [tM CTGF antisense oligonucleotide; (8) 5 ng/mL TGF-p31 + 10

[LM control scrambled oligonucleotide (Dou et al., 1997). All treatments contained 50

[tg/mL ascorbic acid and lx insulin, transferring, and selenious acid (ITS, Invitrogen Life

Technologies, Carlsbad, CA) and 1 [tCi tritiated proline (Amersham Biosciences,

Piscataway, NJ). The CTGF antisense oligonucleotide was a 20-mer with the sequence

GCCAGAAAGCTCAAACTTGA that contained phosphorothioate ester backbone

modifications with 2-O-methoxyethylribose groups coupled at base positions 1 6 and

16 20, and 5-methylcytosine substituted for all cytosines (Dean and Griffey, 1997).

The CTGF antisense oligonucleotide was identified by screening 81 separate 20-mer

nucleotide sequences that span the mRNA sequence for reduction of CTGF mRNA in

cultured mouse cells using RNase protection assay (data not shown). The scrambled 20-

mer oligonucleotide control was a random mixture of AGCT bases. Addition of

oligonucleotides into the culture medium penetrated membranes, accessed cellular

mRNA and reduce levels of target gene mRNA (Dou et al., 1997). Wells were incubated

overnight with pepsin in 0.5 M acetic acid, carrier collagen was then added and the

solution was centrifuged, the collagen was precipitated and washed with 0.1 M sodium

chloride in 0.1 M acetic acid and the radioactivity was measured with beta scintillation

counter (Duncan et al, 1999). Results were expressed as cpm/well + standard error for

six replicate wells.

Reverse transcriptase polymerase chain reaction (RT-PCR)

Total RNA was extracted from epithelial cells obtained from ex vivo corneal

scrapings from 6 rat corneas using Trizol as described above, and RT-PCR was

performed using the one-step RT-PCR kit (Invitrogen Life Technologies, Carlsbad, CA)









to detect CTGF mRNA expression. Briefly, 10 [tM of CTGF-specific forward primer

(5'-AGTGTGCACTGCCAAAGATG-3') and reverse primer (5'-

TTAGGTGTCCGGATGCACT-3') were added to 1 [tg of total RNA isolated from the

pooled rat epithelial cells along reverse transcriptase, nucleotides and buffer and 35

cycles of amplification were completed using an annealing temperature of 580 C, an

extension temperature of 72C, and a dissociation temperature of 94C. Controls

included omitting the sample RNA, reverse transcriptase, or both reverse transcriptase

and Taq polymerase. PCR products were visualized on a 1.5% agarose gel with ethidium

bromide and isolated using a PCR purification kit (Qiagen, Valencia, CA). The predicted

503-bp product was cleaved using a unique restriction site (Pstl) into 405 and 98 bp

fragments and were visualized on a 1.5% agarose gel with ethidium bromide.

CTGF Immunohistochemistry in Corneal Sections

Excised corneas from each time point were incubated in 4% para-formaldehyde /

PBS overnight at 40 C and transferred to 70% ethanol. Paraffin sections were prepared

and 5-micron thick sections were mounted on Superfrost/Plus microscopic slides (Fisher

Chemicals, Pittsburgh, PA). Slides were deparaffinized and rehydrated using xylene and

a graded series of ethanol. Slides were blocked for 30 minutes at room temperature in

TBS/10% rabbit serum, incubated with affinity purified goat anti-human CTGF (14

[tg/ml) in TBS/10% rabbit serum overnight at 40C, washed and incubated with

biotinylated rabbit anti-goat IgG in TBS/10% rabbit serum, washed then incubated with

alkaline phosphatase conjugated streptavidin followed by Vector Red alkaline

phosphatase visualization substrate (Vector Labs, Burlingame, CA). Sections were

photographed using bright field illumination, fluorescence microscopy with









excitation/emission wavelengths for Texas Red staining, and Nomarski phase-contrast

microscopy at 200x magnification. Photographs were taken at a constant exposure (430

ms) using a Peltier-cooled Olympus digital camera.



Results

Increased CTGF Expression by TGF-0 Isoforms

All three TGF-P isoforms induced significantly higher levels of CTGF protein in

conditioned medium and mRNA in cultures of human corneal fibroblasts (Figure 3-1).

Furthermore, the levels of induction of CTGF mRNA and protein were dependent on the

dose of the TGF-P isoforms. For example, the highest dose (10 ng/mL) of TGF-P 1,

TGF-P2, and TGF-33 increased CTGF protein production 70-fold, 200-fold, and 160-

fold, respectively, compared to cells cultured in serum-free medium (p < 0.001). Also,

increasing concentrations of each isoform significantly increased higher levels of CTGF

(p < 0.05). The largest increase in CTGF protein was produced by TGF-P2, which was

significantly higher than TGF-P31 (p < 0.05).

All three TGF-P isoforms also significantly increased levels of CTGF mRNA

when compared to control cells incubated with serum-free medium. CTGF mRNA

transcripts were detected at 10- to 45-fold increased levels upon stimulation by TGF-P

isoforms (p < 0.001). The results of these experiments suggest that TGF-P isoforms

regulate CTGF expression at both the levels of transcription and translation. No

significant difference between CTGF mRNA induced by the highest concentration of the

three isoforms is noted. These data suggest that CTGF is regulated by TGF-P isoforms at

both the transcriptional and translational level.











CTGF Mediated TGF-0-Induced Collagen Synthesis

The addition of 5 ng/mL of either TGF-p 1 or CTGF increased collagen synthesis

approximately 4-fold, (Figure 3-2). However, the increase in collagen synthesis

produced by TGF-P31 was blocked 80% by a neutralizing goat anti-CTGF antibody, and

was blocked 92% by an antisense oligonucleotide directed to human CTGF (p < 0.001).

The antibody was shown to be neutralizing using the appropriate controls as shown

previously (Duncan et al., 1999e). Blockage of collagen synthesis did not occur with

addition of an irrelevant goat IgG or by scrambled oligonucleotides (p < 0.001). These

experiments demonstrate that CTGF induced by TGF-3 mediates the increase in collagen

synthesis when TGF-3 is added to cultures of human corneal fibroblasts. Because the

antisense oligonucleotide and neutralizing antibody to CTGF did not reduce collagen

synthesis to levels below that for serum-free, CTGF does not appear to mediate the basal

level of collagen synthesis of corneal fibroblasts grown on plastic. Furthermore, the

effects of the neutralizing antibody and the antisense oligonucleotide are not due to non-

specific toxicity of the reagents.

Increased CTGF Immunostaining in Human Corneal Fibroblast Cultures

Intensity of immunostaining for CTGF was markedly increased in human corneal

fibroblasts cultured for 48 hours with 5 ng/mL TGF-p 1, especially in the perinuclear

region when compared to non-stimulated cells (Figure 3-3). This localization is most

likely due to increased levels of newly CTGF protein in the Golgi and secretary pathway.

Furthermore, CTGF immunostaining is detected in essentially all the fibroblasts









indicating that TGF-P-induced CTGF synthesis is not restricted to a subpopulation of

corneal fibroblasts.

CTGF Expression in Rat Corneas after PRK

The experimental in vitro data described above established that TGF-3 induces

CTGF synthesis, and that CTGF mediates the effects of TGF-P on collagen synthesis in

cultures of human corneal fibroblasts. However, it is important to assess changes in

levels of CTGF mRNA and protein change during healing of corneal wounds. As shown

in Figure 3-4, levels of CTGF mRNA and protein significantly increased in rat corneas at

several time points following PRK. Specifically, levels of CTGF mRNA increased in the

corneas beginning at Day 3 following surgery after PRK when compared to non-operated

control corneas. Furthermore, the mRNA levels progressively increased and remained

statistically higher than normal corneas through Day 21, reaching approximately 1,000-

fold higher levels than non-injured corneas.

Levels of CTGF protein tended to decrease during the first 3 days after PRK,

perhaps reflecting fewer epithelial cells in the healing corneas. Beginning at Day 7

following surgery, levels of CTGF protein increased dramatically, which was slightly

after mRNA levels begin to increase in the corneas, and continued to increase through

Day 21 following surgery reaching approximately 10-fold higher levels than non-injured

corneas. By Day 21, all corneas showed significant corneal haze, corresponding with

elevated levels of CTGF. These data suggest that CTGF expression in rat corneas

increases after PRK in a similar fashion as seen in the TGF-3 stimulated corneal

fibroblasts.









CTGF Immunohistochemistry in Rat Corneas Following PRK

CTGF was also immunolocalized in paraffin sections of rat corneas harvested at

the same time points after surgery used for protein and RNA measurements. As shown in

Figure 3-5, CTGF was detected in epithelial cells and stromal fibroblasts, with light

staining in the stromal matrix of normal corneas before PRK ablation (Day 0). The

fluorescence image (inset) emphasizes the intense staining of the epithelium. At Day 3

after injury, there was generally less intense staining in the epithelium and stroma. On

Day 7, numerous fibroblast-like cells and inflammatory cells were present, which stained

strongly for CTGF. On Days 11, 14, and 21, the epithelium continued to immunostain

strongly for CTGF, corresponding to the increase in CTGF protein measured in corneal

homogenates (Figure 3-4). On Day 21, intense immunostaining was present on the

endothelium/Descemet's membrane. Negative controls that omitted the primary anti-

CTGF antibody showed faint immunostaining when viewed in Nomarski-phase contrast,

bright field, and fluorescence microscopy.

CTGF Expression in Corneal Epithelium

The immunostained corneas indicated high levels of CTGF protein were present

in corneal epithelial cells and fibroblasts. To assess whether corneal epithelial cells

synthesize CTGF mRNA and protein, CTGF ELISA and RT-PCR was performed on ex

vivo corneal epithelium scrapings from normal rats, since corneal epithelial cell cultures

were not available. CTGF ELISA detected substantial levels (1.5 ng/mg of total

detergent-extracted protein) of CTGF protein in the corneal scrapings. In addition, RT-

PCR generated an intense amplicon band of the predicted size (503 bp) using primers

specific for rat CTGF cDNA. Furthermore, endonuclease restriction digestion using PstI

generated two fragments with the predicted sizes (405 bp and 98 bp), indicating that the









amplicon contained the correct cDNA nucleotide sequence corresponding to rat CTGF

mRNA (Figure 3-6).



Discussion

Multiple growth factors have been detected in the cornea, including epidermal

growth factor (EGF), transforming growth factor alpha (TGF-c~, basic fibroblast growth

factor (bFGF), and interleukin-1 alpha (IL-lac), platelet derived growth factor (PDGF),

and TGF-P, where they appear to play different and important roles in corneal wound

healing (Wilson et al., 1994a;Hoppenreijs et al., 1993;Hoppenreijs et al., 1992). For

example, Chen et al.(Chen et al., 2000f) reported that levels of mRNAs for TGF-3

isoforms rapidly increased and remained elevated 90 days in rat corneas after PRK,

which correlated with increases in mRNAs for Type I and Type III collagen and

fibronectin and the development of corneal haze after PRK in rats. They also reported

the clinical status of the rat corneas. Epithelial healing was complete by Day 7, and

corneal edema increased on Day 1.5 but returned to normal by Day 7. Corneal haze

progressively increased from Day 7 through Day 91 following PRK, with all corneas

showing significant corneal haze on Day 21 (average clinical grade 0.83 on a 0 to 4

scale). The clinical evaluations reported previously by Chen et al (Chen et al., 2000e).

correlated well with the progressive increases in levels of CTGF mRNA and protein

measured in the corneas. Inhibition of TGF-P by repeated topical applications of

neutralizing antibody reduced corneal haze in rabbits following lamellar keratectomy

(Jester et al., 1997).

TGF-3 also is a key regulator of conjunctival scarring. For example,









subconjunctival injections of TGF-P caused a rapid-onset and exaggerated scarring

response in a mouse model of conjunctival scarring (Cordeiro et al., 1999c). Reducing

TGF-P activity by repeated subconjunctival injections of a recombinant humanized

mouse monoclonal antibody to TGF-P32 significantly reduced conjunctival scarring and

improved glaucoma filtration surgery outcome in an aggressive rabbit model of filtration

surgery scarring (Cordeiro et al., 1999b). These data led to a prospective, randomized,

placebo-controlled, phase I/IIa clinical trial evaluating four subconjunctival injections of

a neutralizing, humanized, mouse monoclonal antibody to TGF-32 into the filtering bleb

of trabeculectomy patients (Siriwardena et al., 2002a). Analysis of outcomes indicated

the anti-TGF-P2 antibody produced greater declines in intraocular pressures at 3 and 6

months and fewer interventions than control injections without causing serious adverse

events or complications (Siriwardena et al., 2002b).

One important finding demonstrates the upregulation of CTGF by TGF-3 in

cultured rabbit corneal fibroblasts (Folger et al., 2001c). However, the interactions

between the TGF-3 and CTGF systems in human corneal fibroblasts, and the alterations

of CTGF expression during corneal wound healing have not been investigated previously.

As shown in Figure 3-1, all three isoforms of TGF-P significantly increased CTGF

mRNA and protein levels compared to fibroblasts in serum free medium. Although there

was no significant difference in the levels of CTGF mRNA induced by the highest

concentration of the TGF-3 isoforms, the highest concentrations TGF-32 and TGF-33

(10 ng/ml) induced significantly higher levels of CTGF protein than TGF-pl. This

suggests that all three TGF-P isoforms regulate CTGF synthesis by transcription of

mRNA, but regulation of CTGF synthesis by TGF- 31 may also involve some post-









transcriptional regulation. Thus, during healing of wounds, corneal fibroblasts should

respond to both TGF-P31 and TGF-32 isoforms by increasing CTGF synthesis, even

though TGF-pl isoform predominates in human tears(Gupta et al., 1996) and TGF-32

isoform predominates in aqueous humor (Jampel et al., 1990). Interestingly, corneal

fibroblasts also increased CTGF synthesis in response to TGF-33 isoform, which was

reported to oppose the scarring effects of TGF-p31 and TGF-32 isoforms in a rat skin

incision model (Shah et al., 1994a).

Another important interaction between the TGF-P and CTGF systems is shown in

Figure 3-2. Specifically, addition of CTGF antisense oligonucleotide or CTGF

neutralizing antibody blocked over 85% of the increased collagen synthesis induced by

TGF-p1. This demonstrates that synthesis of CTGF is required for TGF-P to increase

collagen synthesis. However, neither antisense oligonucleotide nor neutralizing antibody

totally suppressed the effect of TGF-P nor was collagen synthesis reduced below basal

levels for fibroblasts cultured in serum free medium. This may be due to suboptimal

levels of the antisense oligonucleotide and antibody, the presence of other autocrine

factors that stimulate collagen synthesis such as PDGF, or to a low constitutive level of

collagen synthesis by fibroblasts grown on plastic, perhaps through activation of integrin

receptors. Nevertheless, antisense oligos or ribozymes targeting CTGF might be

effective therapies for selectively reducing corneal scarring.

The in vitro experiments shown in Figures 3-1 and 3-2 strongly indicated that

TGF-P and CTGF systems are linked and that CTGF is an important inducer of collagen

synthesis. If the hypothesis that CTGF is a major promoter of corneal scarring in vivo is

correct, levels of CTGF mRNA and protein should increase in corneas during wound









healing and scar formation. As shown in Figure 3-4, analysis of rat corneas showed little

change in levels at 1 day after PRK, followed by a sharp increase in mRNA at Day 3 with

a continual and almost exponential increase in mRNA levels, reaching a 1,000-fold

increase on Day 21. Protein levels slightly lagged mRNA levels, with a slight decrease

on Day 3 followed by a nearly 10-old linear increase to Day 21. Since CTGF is a

secreted protein, it is expected that the levels of CTGF measured in the detergent extracts

of the corneal homogenates to represent only a small portion of the total CTGF protein

that was synthesized by corneal cells.

Immunostaining indicated the sources of CTGF protein appeared to be the

fibroblasts, inflammatory cells and epithelial cells, which stained intensely. Previous

reports suggested that synthesis of CTGF was limited to cells of mesenchymal origin

(Grotendorst, 1997c). However, corneal epithelial cells are derived from surface

ectoderm (Barishak, 1992). CTGF immunostaining in the epithelial cells could be due to

synthesis of CTGF or to other sources of CTGF such as the tears. Unpublished findings

showed that CTGF was detected in human tears at an average level of 6.2 ng/ml. RT-

PCR analysis performed on samples of total RNA isolated from corneal epithelial cells

scraped from rat corneas generated a single amplicon with the predicted size, which was

cleaved into the unique fragments predicted by endonuclease digestion, which strongly

supports the concept that corneal epithelial cells synthesize CTGF (Figure 3-6). The

intensity of CTGF immunostaining roughly followed the levels of CTGF protein

measured by ELISA in rat corneas, with intense staining observed in the epithelium at

Day 21 and strong staining in fibroblasts and endothelial cells/Descemet's membrane. It

was recently reported that CTGF protein was present in aqueous humor at an average









concentration of 1.24 ng/ml (van Setten et al., 2002a). CTGF may be bound to

extracellular matrix proteins and glycosoaminoglycans in basement membrane since

CTGF possesses a heparin-binding domain (Grotendorst, 1997b).

In summary, the interaction between TGF-3 and CTGF systems in corneal

fibroblast cultures, their regulation of collagen synthesis, and the expression and

localization of CTGF in the cornea during wound healing after PRK was investigated.

Collectively, the data strongly support the hypothesis that CTGF is induced by TGF-3,

mediates the effects of TGF-P on collagen synthesis, increases dramatically during

corneal wound healing and is likely to be a key regulator of corneal wound healing.

These results suggest that CTGF may be a key target for therapies that reduce scarring by

selectively reducing expression of CTGF.







52


160
0

S140
E
c= Protein
" 120 H RNA
E

z 100




60


5 40

S20
C-
I--
U 0
no serum 0.1 1 10 0.1 1 10 0.1 1 10
serum
TGF-P1 TGF-P2 TGF-P3

Figure 3-1. Expression of CTGF by human corneal fibroblasts. CTGF protein
expression was detected by ELISA and mRNA was detected using TaqMan
quantitative RT-PCR assay. Cells were cultured in a 96-well plate with each
group performed in triplicate. The cells were grown to confluence and starved of
serum for 24 hours followed by 48-hour treatments as shown on the graph.
Results are shown as ng CTGF per total mg of protein in conditioned medium for
normalization or in pmol of CTGF mRNA per nmol GAPDH mRNA. Results are
expressed as the mean + SE.







53



5000

4500

4000

3500

3000

c 2500

2000
U

1500

1000

500

0
no serum serum CTGF TGF-beta TGF-beta+ TGF-beta+ TGF-beta+ TGF-beta+
goat anti- goat IgG CTGF scrambled
CTGF antisense


Figure 3-2. Collagen synthesis stimulation in human corneal fibroblasts by CTGF
and TGF-P. Collagen synthesis was examined by measuring 3H-proline
incorporation. Cells were cultured in a 48-well plate with each group performed
six times. The cells were grown to confluence for 5-7 days and starved of serum
for 24 hours followed by 24-hour treatments as shown on the graph. Amount of
3H-collagen is expressed as cpm/well. Results are expressed as the mean SE.














Basal


TGF-P
induced


1,


AW ,. 1
J, ^^ 5 4
r%- ~ ~ ~ ~ a "* *.,
I. V

h 4 41 .4L MW Zk
fro^ 1T4 \ .0


t A 12 bXA
; ;.<^ /-.^ ^
:is 'sl ) )i"A.. '~5 C 1-T
U? -,'t ^ StA si ircia a
"`t^ ^w\'" '
-^ dtl k1i. rr ce+cr,^rc


Figure 3-3. Immunolocalization ofCTGF in human corneal fibroblasts. Human
corneal fibroblasts were grown to confluence and then rested in serum-free medium
for 72 hours before stimulation with 5 ng/mL TGF-P 1 for 48 hours. The cells were
fixed followed by localization of CTGF using immunocytochemistry. Original
photographs were taken at 100x magnification with 400x magnifications in the
insets.










0.1 10

0.09 -

-I
O.OB -- 1 n



S-A- RNA -
S0.06- 0.1
CL 0

E 0.05 G)

u. 0.04 / 0.01

S0.03 Z

0.02 0.001 |

0.01

0 0.0001
0 5 10 15 20
Day Following Surgery


Figure 3-4. Expression of CTGF protein and mRNA in rat corneas after PRK.
CTGF protein expression was detected by ELISA and mRNA was detected
using TaqMan quantitative RT-PCR assay. Three corneas were analyzed for
both protein and RNA at days 0, 1, 3, 7, 11, 14, 21 after PRK. Results are
shown as ng CTGF per total mg of protein in the sample for normalization or as
pmol of CTGF mRNA per nmol GAPDH mRNA. Results are expressed as the
mean + SE.

















W Me


t--


W.


i.a, -"



Ll


- St.


*


e


r .


G H I


1~;.-

5 a -
.2-

42.,


Figure 3-5. Immunolocalization of CTGF in rat corneas after PRK. A-F) Rat
corneas were excised at day 0, 3, 7, 11, 14, and 21 after PRK. The corneas were
fixed, paraffin sections were prepared, and CTGF was localized using
immunohistochemistry. CTGF was localized using Vector Red reagent (see
Materials and Methods). Sections were photographed at 200x magnification using
bright field microscopy. Images of the same field using fluorescence microscopy
are shown in the insets. G-I) Control images in Nomarski, bright field, and
fluorescence microscopy are shown which lack the primary antibody.


-i


. --

r cC~


'"









1 2 3


503 bp
405 bp




98 bp


Figure 3-6. Detection of CTGF mRNA in rat corneal epithelium using RT-PCR.
Corneal epithelium scrapings were isolated from rats and total RNA was isolated
using TRIzol reagent. Reverse transcriptase polymerase chain reaction (RT-PCR)
was performed using primers that amplify a 503 bp region of rat CTGF. The PCR
product was cleaved with a unique restriction site (Pstl) into 405 and 98 bp
fragments and visualized on a 1.5% agarose gel with ethidium bromide. Lane 1 -
100 bp ladder, Lane 2 503 bp PCR product, Lane 3 -PstI digestion of PCR
product.
















CHAPTER 4
BIOCHEMICAL CHARACTERIZATION OF THE CONNECTIVE TISSUE GROWTH
FACTOR RECEPTOR IN CORNEAL FIBROBLASTS

Introduction

CTGF mediates the effects of transforming growth factor beta (TGF-P) on

activity in fibroblast cell types in a cycloheximide-independent manner, indicating a

direct signaling pathway (Pelton et al., 1990;Igarashi et al., 1993;Kikuchi et al., 1995b).

CTGF alone does not induce anchorage-independent growth of fibroblasts, which

distinguishes its actions distinctly from that of TGF-P (Kothapalli et al., 1997b).

However, little information is known about the characteristics and identity of the CTGF

receptor. CTGF was shown to cross-link to a cell-surface protein of about 250 kDa in a

chondrosarcoma cell line (Nishida et al., 1998b). Other studies suggest that CTGF binds

to the low-density lipoprotein receptor-related protein (LRP) / alpha-2-macroglobulin

receptor in bone marrow-derived stromal cells (Segarini et al., 2001a).

Insulin-like growth factors I and II (IGF-I and IGF-II) are peptides with diverse

functions and effects on many tissues (Stewart et al., 1996b). IGF-I and IGF-II have a

tremendous impact on many tissues since they exhibit mitogenic and anti-apoptotic

properties on cells (Jones and Clemmons, 1995;Sara and Hall K, 1990;Stewart et al.,

1996a). Both IGF-I and IGF-II bind to the insulin receptor, the type I IGF receptor and

the type II IGF receptor with differing affinities (Andersen et al., 1990;Gustafson and

Ritter, 1990;Schumacher et al., 1991). The overexpression and/or activation of type I









IGF receptor has been shown to induce ligand-dependent neoplastic transformation

(Kaleko et al., 1990). The type II IGF receptor is a single chain, membrane-spanning

glycoprotein, which is identical to the cation-independent mannose-6-phosphate receptor

(Kornfeld, 1992), however IGF-II and mannose-6-phosphate bind to distinct domains on

the extracellular region of the receptor (Marron-Teraga et al., 1998). IGF-II is a

bifunctional ligand that is able to stimulate both insulin and IGF-I receptor signaling,

although with different potencies. In addition, the type II IGF receptor/cation-

independent mannose-6-phosphate receptor regulates IGF-II clearance (Nakae et al.,

2001).

Elevated expression of CTGF has been shown in fibrotic and inflamed tissue,

especially in the cornea after phototherapeutic keratectomy (PRK), where scarring is

prevalent (Blalock et al., 2003;Sutton et al., 1995). Significant levels of other growth

factors have been detected in the cornea (Wilson et al., 1994b) such as epidermal growth

factor (EGF), TGF-3, TGF-u, basic fibroblast growth factor (bFGF), and interleukin-1

alpha (IL-la), suggesting a role for CTGF in the process of corneal fibrosis. CTGF is

regulated by TGF-P, and increasing evidence shows that it is most likely an important

component of corneal wound healing. Investigation of the role of the CTGF receptor in

corneal wound healing can provide insight into treating corneal defects as well as

applications to other tissues. Thus, it is crucial to investigate the biochemical properties

of the CTGF receptor and binding to human corneal fibroblasts, a valid cell culture model

for corneal wound healing. Evidence in this work suggests that CTGF is a ligand for the

type II IGF receptor.









Materials and Methods

lodination of Recombinant Human CTGF

Recombinant human CTGF was labeled with iodine-125 using a modified

Chloramine-T method (Iodobead method, Pierce). One lodobead (Pierce) was added to

200 ptL of reaction buffer (10 mM phosphate buffer, 0.5 M NaC1, pH = 7.4) along with 1

mCi of Nal25I with constant agitation for 5 minutes at room temperature. Five

micrograms of recombinant CTGF were added and the reaction was carried out at room

temperature for 10 minutes with constant stirring. The labeling reaction was applied to a

PD-10 G-25 Sephadex column (Pharmacia) which was pre-equilibrated with reaction

buffer containing 0.1% bovine serum albumin and 0.05% Tween-20 to reduce non-

specific binding to the column. Fractions were collected and aliquots were measured in a

gamma counter. A representative iodination profile of recombinant human CTGF is

shown in Figure 4-1. Two-microliter fractions were separated on a 15% SDS-PAGE gel

followed by exposure of the gel to X-ray film overnight. Quality of labeled CTGF was

also assessed by Western blot. Fractions with the highest specific activity were pooled

for use in these experiments. Specific activity was approximately 33 [tCi/[tg.

Cell Culture

Cultures of human corneal fibroblasts were established by outgrowth from corneal

explants as described previously (Woost et al., 1992). Briefly, epithelial and endothelial

cells were removed from corneas that were unsuitable for corneal transplantation, the

stroma was cut into cubes approximately 1 mm3, placed in culture medium (equal parts

Dulbecco's Modified Eagle Medium (DMEM), Medium 199 (Gibco BRL), Ham's F12

nutrient mixture (Gibco BRL) containing 1 mM NaHCO3, and buffered with 25 mM









HEPES at pH 7.4). The medium was supplemented with 10% heat-inactivated normal

calf serum and lx antibiotic-antimycotic (Gibco BRL). Cultures of type II IGF receptor

knockout cells were established in a similar fashion by outgrowth from lung tissue from

knockout mice. Lung fibroblasts from normal tissue in C57BL/6 mice were used as a

control.

Cell Binding Experiments

Human corneal fibroblasts were grown to confluence in 48-well plates. Cells

were washed and incubated with chilled binding buffer alone (serum-free culture medium

plus 1 mg/mL bovine serum albumin) or binding buffer with unlabeled CTGF (2 [tg/mL)

at 40C for 1 hour. 25,000 cpm of 125I-CTGF was added to the wells and allowed to bind

at 40C or 370C for the time points (0 min, 15 min, 30 min, 1, 2 and 4 hours). Cell layers

were washed five times with chilled phosphate-buffered saline containing 1 mg/mL BSA

and solubilized in 1 N NaOH. Radioactivity was measured by gamma scintillation

counter. Specific binding of 125I-CTGF was measured by subtracting non-specific

binding (wells with unlabeled CTGF present) from total binding (wells with unlabeled

CTGF absent). Each time point was performed in triplicate.

To measure the specificity of CTGF binding to cell surface receptors, human

corneal fibroblasts were grown to confluence in a 48-well plate. Cells were washed as

described above and incubated with 1 [tg/mL of the unlabeled competitor (CTGF, TGF-

31, TGF-ac, PDGF, EGF, FGF, or insulin) for 1 hour at 40 C. 25,000 cpm of 125I-CTGF

was added to each well and incubated for 1 hour at 370 C. Cells were washed five times

as described above and solubilized in 1 N NaOH. Each experimental condition was

performed six times.









Scatchard analysis was performed (Scatchard, 1949) on human corneal fibroblasts

cultures grown to confluence in a 48-well plate. Cells were washed and incubated with

increasing concentrations of unlabeled CTGF (10-1 M to 10-6) for 1 hour at 40 C. 50,000

cpm of 125I-CTGF was added to each well and incubated at 370 C for 1 hour. Cells were

washed five times and solubilized in 1 N NaOH. Each condition was performed six

times. A saturation curve was constructed by plotting bound pM of 125I-CTGF versus

free pM 125I-CTGF. Then, a Scatchard plot was constructed using the saturation curve

data and the dissociation constants were calculated.

Triton-X-100 soluble membrane extracts from human corneal fibroblasts were

applied to a CTGF-coupled affinity column and eluted with 0.1 M glycine (pH = 2.5).

Eluted fractions were bound with 125I-CTGF in the presence or absence of unlabeled

CTGF and precipitated with gamma globulin as carrier and 15% polyethylene glycol.

Pellets were washed with 20% ethanol and radioactivity measured by gamma scintillation

counter. Specific binding was calculated by subtracting non-specific binding from total

binding.

Cell Proliferation Assay

Control lung fibroblasts from normal mouse lung and type II IGF receptor

knockout lung fibroblasts were seeded in a 48-well plate (5000 cells per well) and

cultured for 48 hours in serum-supplemented medium. The cultures were held in serum-

free medium for 48 hours followed by stimulation with 10% normal calf serum, 5 ng/mL

recombinant human TGF-p31 (R&D Systems; Minneapolis, MN), 25 ng/mL CTGF, 25

ng/mL CTGF + 6.5 [tg/mL RAP, 6.5 [tg/mL RAP, 1 mg/mL IGF-I or IGF-II (R&D

Systems; Minneapolis, MN), or 5 ng/mL TGF-P in the presence of 10 [tM CTGF









antisense or scrambled control oligonucleotides following 48 hours of serum-starvation.

Cell proliferation was measured using a non-radioactive MTS cell proliferation assay

(Promega; Madison, WI). Absorbance readings corresponding to cell proliferation were

expressed as mean + standard error of six replicate samples for each condition, and

ANOVA and Tukey's HSD post-hoc test were used to assess statistical significance

between times and groups.

Cross-Linking of 125I-CTGF to Human Corneal Fibroblast Receptors

Human corneal fibroblasts were grown to confluence in two T-75 flasks. The

cells were stimulated for 24 hours with 5 ng/mL transforming growth factor beta-1 (TGF-

pl). One flask was incubated with 2 [tg/mL CTGF for one hour at 40C. Then 4,000,000

cpm of 125I-CTGF was added to each flask and incubated for 2 hours at 40C. The cells

were washed three times with chilled binding buffer (128 mM NaC1, 5 mM KC1, 5 mM

MgSO4, 1.2 mM CaC12, 50 mM HEPES, 0.1% bovine serum albumin, pH = 7.5). The

cells were then incubated with 10 mg/mL disuccinimidyl suberate (DSS, dissolved in

dimethyl sulfoxide) for 15 minutes at 40C. The reaction was terminated with quenching

buffer at 40C (0.25 M sucrose, 10 mM Tris HC1, 1 mM EDTA, 0.3 mM PMSF, pH =

7.4). One milliliter of quenching buffer was added to each flask and the cells were

detached using a cell scraper. The two cell suspensions were centrifuged at 14,000 x g

for 2 minutes at 40C to pellet the cells. The supernatants were removed and 100 ptL of

solubilizing buffer was added to each pellet (125 mM NaC1, 10 mM Tris, 1 mM EDTA,

1% Triton-X-100, pH = 7.0, with protease inhibitor cocktail). The cell pellets were

incubated overnight with the solubilizing buffer at 40C with constant rocking. The

samples were centrifuged at 14,000 x g for 15 minutes to remove insoluble cell debris.









The protein-containing supernatants were added to an equal volume of electrophoresis

buffer (100 mM Tris, pH = 6.8, 20% glycerol, 3% SDS, 0.05% bromophenol blue, 180

mM 2-mercaptoethanol). The samples were heat-denatured and run on a 3-8% Tris-

Acetate SDS-PAGE gel (Novex). The gel was fixed, dried, and exposed to X-ray film

overnight at -800C. The molecular weights of the bands were determined by comparing

to Multi-Mark molecular weight protein standards (Novex).

Time Course of Binding to Rat Corneas following PRK

Photorefractive keratectomy (PRK) was performed on 28 male rats as described

previously (Chen et al., 2000d). Adult Sprague-Dawley male rats (250 g) with normal

eyes were anesthetized with inhaled isofluorane anesthetic. Eyelashes and whiskers

surrounding the eye were removed from the visual field. A drop of proparacaine-HCl

(0.05%) was applied to the eye and the cornea was centered under the laser microscope.

Excimer laser photorefractive keratectomy was performed. Bilateral ablation of the

corneas was performed in a 4.4-mm treatment zone with an excimer laser (Summit SVS

Apex) in the phototherapeutic keratectomy mode. The corneal epithelium was ablated to

a depth of 40 |tm, followed by ablation of the stroma to a depth of 20 |tm for a total

ablation depth of 60 rtm. After excimer laser treatment, tobramycin (0.3%) ointment was

applied to the corneal surface to prevent infection. No postoperative topical steroid was

administered. Eight corneas from four rats were harvested on Days 0, 1, 3, 5, 7, 14, and

21 after surgery. Four corneas on each day were diced with scalpels and each was placed

in 1 ml of binding buffer (phosphate-buffered saline containing 1 mg/ml BSA) with 2

[tg/ml unlabeled CTGF and four corneas were placed in binding buffer lacking CTGF.

After incubation for 1 hour at 40 C, 50,000 cpm of 125I-CTGF were added to each cornea









and incubated for 1 hour at 370 C. The corneas were then washed five times in binding

buffer with BSA and radioactivity measured by gamma scintillation counter. Specific

binding was calculated by subtracting non-specific binding from total binding. Values

were normalized to the total mass of each cornea and expressed as cpm/10 mg tissue.

Immunoprecipitation of Type II IGF Receptor

To further confirm the identity of the CTGF receptor as the type II IGF receptor,

affinity chromatography and immunoprecipitation was performed. Briefly, Recombinant

human CTGF was covalently cross-linked to Ultra-link Support Medium (Pierce) and a

column was prepared. Triton-X-100 solubilized membrane protein extracts were

prepared from cultures of human corneal fibroblasts and applied to the resin. Bound

protein was eluted from the resin by a drop in pH to 2.5. Fractions were tested for protein

concentration. Fractions were also tested for binding of 125I-CTGF for 1 hour at 40 C,

followed by precipitation with 15% polyethylene glycol (PEG) and y-globulins as carrier

proteins. Fractions from the CTGF affinity column exhibiting the highest binding

activity to 125I-CTGF were pooled. A portion of the sample was bound to 125I-CTGF

following binding by a goat antibody to the type II IGF receptor. The complex was run

through a Protein G affinity column. The complex was eluted from the column with a

shift in pH to 3.0 with 0.1 M glycine. The amount of binding was measured by counting

the samples in the gamma counter. Two controls were used: 1) competition by unlabeled

CTGF and 2) non-specific binding of 25I-CTGF alone to Protein G column.

Immunoprecipitation of Binding Reactions

To assess the interaction between CTGF and the type II IGF receptor, in vitro

binding reactions were performed followed by immunoprecipitation of the complexes.









1.5-mL microcentrifuge tubes were coated with buffer containing 0.1% BSA to reduce

non-specific binding to the walls of the tubes. Reactions were assembled in the presence

of 10 pL of 1 mg/mL BSA and 75,000 cpm 125I-CTGF according to the scheme shown in

Figure 4a overnight at 40C. The reactions were precipitated by adding 150 mL of 10

mg/mL gamma-globulin and 150 mL of 20% polyethylene glycol (molecular weight =

8000). The samples were centrifuged at 14,000 x g for 15 minutes at 40C. Pellets were

washed with 20% ethanol and radioactivity was measured by gamma scintillation

counter. Each reaction was repeated in triplicate. Specificity of the reaction was

measured by adding various, related unlabeled competitors (CTGF, TGF-p 1, TGF-ca,

PDGF, EGF, FGF, insulin, RAP, IGF-II, and mannose-6-phosphate) to the binding

reactions and precipitated as described.

Immunoprecipitation of Cross-linked Human Corneal Fibroblast Receptors

Reactions were assembled in the presence of 10 ptL of 1 mg/mL BSA, 1000 cpm

of 125I-CTGF cross-linked human corneal fibroblast extracts and either affinity purified

goat anti-human CTGF or goat anti-human sMPR (soluble cation-independent mannose-

6-phosphate receptor) and incubated overnight at 40C. The reactions were precipitated

and measured as described above.


Results

Binding of CTGF to Receptors on Human Corneal Fibroblasts

Recombinant CTGF binds to receptors on human corneal fibroblasts. Specific

binding to the receptors reaches maximum at about two hours at 40 C and by one hour at

370 C (Figure 4-2). Specific binding is measured by calculating the difference between

total binding of 125I-CTGF and binding in the presence of excess unlabeled ligand.









Binding of CTGF to cell-surface receptors at 40 C is not inhibited by the addition of other

closely related growth factors (P < 0.01, Figure 4-3). Scatchard analysis of CTGF

binding to human corneal fibroblasts at 40 C reveals two classes of cell-surface receptors

(Figure 4-4). One high affinity, low abundance class is observed (Kd = 3.3 nM at 18,000

receptors per cell). A second lower affinity, high abundance class is also measured (Kd =

133.3 nM at 83,000 receptors per cell). 125I-CTGF cross-links to a protein of

approximately 250 kDa on human corneal fibroblasts. The interaction is not observed in

the presence of excess unlabeled ligand (Figure 4-5). To confirm this interaction further,

corneal fibroblast cell membrane extracts were applied to a CTGF-coupled affinity

column. Fractions that were eluted from the column exhibit a significantly higher

amount of CTGF specific binding (approximately 330%) when compared to total cell

membrane extract (Figure 4-6).

Binding of CTGF to Rat Corneas Following PRK

Levels of inflammatory cytokines and growth factors are known to increase in rat

corneas following laser photorefractive keratectomy (PRK) and in cultures of corneal

fibroblasts, which comprise the majority of the structure of the cornea. It has been shown

that the expression of CTGF is induced by PRK in rat corneas and by TGF-P in cultured

cells (Blalock et al., 2003). To assess the possibility of up-regulation or increased

availability of the putative CTGF receptor, surgery was performed to induce the corneal

scarring response and its relationship with measured specific CTGF binding. Specific

binding was measured by calculating the difference between total binding of 125I-CTGF

and binding in the presence of excess unlabeled ligand. Specific binding of CTGF









increased significantly, peaking at 5 days after surgery (P < 0.01, Figure 4-7). Data was

analyzed using ANOVA/MANOVA and Tukey's HSD post-hoc statistical tests.

CTGF Binding to the Type II Insulin-like Growth Factor Receptor

When iodinated CTGF was bound to the type II insulin-like growth factor

receptor and immunoprecipitated using a protein G column, over 80% of the labeled

CTGF eluted from the column (Figure 4-8). It was also shown that CTGF has a specific

affinity for the type II IGF receptor and is blocked by unlabeled CTGF in these fractions.

In vitro binding reactions were performed to measure the amount of binding of CTGF to

the type II insulin-like growth factor (IGF) receptor / cation-independent mannose-6-

phosphate receptor. The interaction of 125I-CTGF with soluble mannose-6-phosphate

receptor (sMPR) is inhibited in the presence of unlabeled CTGF (Figure 4-9, #1-2). An

affinity-purified antibody to CTGF precipitates 125I-CTGF alone and is inhibited by the

addition of unlabeled CTGF (#3 and #4). These binding complexes are also precipitated

by affinity-purified antibody to human sMPR (#5 and #6) or to CTGF (#7 and #8). The

amount of trace 125I-CTGF precipitated by PEG alone is much lower than the binding

reactions (P < 0.01, #9).

Figure 4-10 shows that the inhibition of 125I-CTGF binding to sMPR by unlabeled

CTGF is not seen upon addition of closely related growth factors and IGF family

members. Insulin-like growth factor II (IGF-II) competes for binding somewhat (P =

0.09) but not to the degree of CTGF competition (P < 0.01). Human corneal fibroblast

cell membrane extracts that are covalently cross-linked with 125I-CTGF are

immunoprecipitated by affinity-purified antibodies to either sMPR or to CTGF. The









amount of precipitated counts is significantly higher (P < 0.01) when compared to control

antibody or the addition of no antibody (Figure 4-11).



Response to Exogenous TGF-P in Type II IGF Receptor Knockout Cells

To confirm that CTGF binds to the type II IGF receptor in cell cultures, binding and

cell proliferation experiments were performed in knockout cells lacking the receptor.

Figure 4-12 shows that there is no significant binding to cells lacking the type II IGF

receptor when compared to normal mouse lung fibroblasts (n = 6, P < 0.01).

The same two cell cultures were used to measure cell proliferation in response to

exogenously added growth factors and agents (Figure 4-13). Both cell types showed

increased cell proliferation in response to serum but a reduced response was seen to both

TGF-P and CTGF (P < 0.01). This suggests that TGF-P-induced cell proliferation is

hindered due to the absence of a cell-surface receptor for CTGF. The presence of RAP

appeared to have no effect on cell proliferation, suggesting that the low-density

lipoprotein receptor-related protein (LRP) is not responsible for CTGF-mediated TGF-P

signaling in this cell type. A marked difference between IGF-II- and IGF-I-induced cell

proliferation is evident between the knockout and wild type cells (P < 0.01), which is

expected due to absence of the type II receptor. Finally, CTGF antisense

oligonucleotides blocked TGF-P-induced cell proliferation in both cell types, suggesting

that CTGF synthesis is required and acts as a mediator of TGF-P's effects on the cells (P

= 0.17). This blockage is not seen in the presence of scrambled control oligonucleotides.









Discussion

The presence of CTGF-specific receptors was demonstrated on the surface of

human corneal fibroblasts in this study. The addition of unlabeled CTGF inhibited the

binding of 125I-CTGF whereas unlabeled TGF-P, TGF-ac, PDGF-BB, bFGF, EGF,

insulin, IGF-I, IGF-II, or mannose-6-phosphate did not (Figure 4-3). This suggests that

CTGF binds to its receptor specifically on the cell surface of human corneal fibroblasts.

Scatchard analysis reveals the presence of two classes of receptors on human corneal

fibroblasts with Kd values of 1.3 nM and 133.3 nM and receptor numbers per cell of

18,000 and 83,000, respectively (Figure 4-4). Previous reports have shown that CTGF

binds to PDGF receptors on fibroblasts (Bradham et al., 1991a), in which 125I-labeled

CTGF was not used. However, two reports using labeled CTGF have been reported

(Nishida et al., 1998a;Segarini et al., 2001b) in which CTGF bound to chondrosarcoma

and bone marrow-derived stromal cell lines. In the chondrosarcoma cell line study a

cross-linking experiment was performed revealing a major band at 280 kDa (Figure 4-5).

The molecular weight of the ligand-receptor complex indicated that the molecular weight

of CTGF receptors on human corneal fibroblasts is about 242 kDa. This molecular

weight is similar to the study performed in a human chondrosarcoma cell line (Nishida et

al., 1998c). The addition of unlabeled CTGF resulted in a disappearance of the cross-

linked band at 280 kDa, suggesting that this band is a result of a direct interaction

between CTGF and its receptor. Immunoprecipitation of CTGF affinity chromatography

experiments reveal that a protein or proteins present in cell membrane extracts

specifically bind to CTGF (Figure 4-6).









CTGF binding also increased in rat corneas following photorefractive

keratectomy (Figure 4-7). Expression of CTGF (Blalock et al., 2003), TGF-P I, II, and

III, fibronectin, and collagen (Chen et al., 2000c) has been previously shown to increase

in rat corneas following PRK. Expression of TGF-P receptors type I and II increases in

corneal epithelium following surgery (Zieske et al., 2000), but has not been studied

extensively in corneal fibroblasts. The increase in CTGF binding to corneal tissue

following surgery could be due to upregulation of the CTGF receptor or increased

migration of the receptors via vesicles to the cell membrane surface. This suggests a

crucial involvement of CTGF and its receptor during the course of corneal wound

healing.

Evidence from this report suggests that CTGF binds to the type II IGF receptor in

human corneal fibroblasts. In vitro binding followed by immunoprecipitation using

antibodies specific for CTGF or the soluble mannose-6-phosphate receptor show that

CTGF specifically interacts with the sMPR (Figure 4-9) and that this interaction is not

inhibited by the addition of other growth factors (Figure 4-10). In addition, the same

antibodies precipitated the majority of 125I-CTGF cross-linked cell membrane extracts

present in the in vitro binding reactions (Figure 4-11). These experiments prove that

CTGF interacts specifically with the type II IGF receptor on the surface of human corneal

fibroblasts. CTGF was previously shown to bind to the low-density lipoprotein-related

receptor (LRP) / alpha-2 macroglobulin receptor in bone marrow-derived stromal cells

(Segarini et al., 2001c). This interaction was inhibited by the addition of unlabeled

CTGF, lactoferrin, ApoE, LPL, and methionine-activated alpha-2 macroglobulin, all

ligands for this receptor (Gliemann, 1998). However, previous studies have shown that









LRP is a multi-functional scavenger receptor (Herz and Strickland, 2001), so the

interaction of CTGF may be rather non-specific and not confer any real biological

activity. It is likely that the binding of CTGF, which is an IGF-binding protein related

molecule (Kim et al., 1997b), to the type II IGF receptor on corneal fibroblasts confers

biological responses and is responsible for signal transduction activity. The data

presented in Figures 4-12 and 4-13 show additional evidence of the importance of CTGF

binding to the type II IGF receptor. It is clear that the ability of CTGF to bind to this

receptor is necessary for TGF-3 to transmit a biological response such as cell

proliferation to cells. Also, Figure 4-12 gives further evidence that CTGF binding to the

LRP does not account for a significant amount of TGF-P-induced cell proliferation.

Many growth factor membrane receptors are composed of several different

subunits. For example, it has been previously shown that FGF and hepatocyte growth

factor (HGF) bind to their signaling receptors which possess tyrosine kinase activities

with high affinity (Schlessinger et al., 1995;Lyon et al., 1994). However, the same

growth factors also bind with low affinity to cell surface proteoglycans that cannot

transmit signals alone. These experiments demonstrate the presence of two classes of

receptors on human corneal fibroblasts. The low affinity class of receptor may be a

proteoglycan, or even LRP, while the high affinity class is most likely due to specific

binding of CTGF to the type II IGF receptor. This study shows that binding of CTGF

and its receptor have a clear role in corneal fibroblasts and their interaction is likely to be

crucially involved in corneal wound healing.







73



120000


100000


80000
--I

- 60000
E

40000


20000


0


Fraction

Figure 4-1. Iodination of recombinant human CTGF. Recombinant human
CTGF was iodinated using a modified chloramine-T method (Iodobead, Pierce)
and applied to a G-25 Sephadex column. 2 ptL of each fraction was counted in a
scintillation counter. Labeled protein was contained in fractions 10, 11, 12 and
pooled together for use in further experiments. Presence of intact CTGF was
verified by Western blot (data not shown)






74


5000


4000


3000


2000


1000


0
0 1 2 3 4

Time (hours)

Figure 4-2. Time course ofCTGF binding to human corneal fibroblasts. Human
corneal fibroblasts were bound with 125I-CTGF in the presence of absence of
excess unlabeled CTGF at 40C for the time points shown (n = 3). Blue total
binding, pink non-specific binding, red specific binding.










4500

4000

3500

3000

E 2500

0 2000

1500

1000

500

0




Figure 4-3. Specificity ofCTGF binding to human corneal fibroblasts. Human
corneal fibroblasts were incubated with 125I-CTGF in the presence of absence of
excess unlabeled growth factors at 40C (n = 6)










0.06


0.05


0,04


S0.03

0
E-

U-






0
0.02 -.


0.01



0 200 400 600 800 1000 1200 1400
Bound (pM)

Figure 4-4. Scatchard analysis of CTGF binding to human corneal fibroblasts.
Analysis of CTGF binding to human corneal fibroblasts at 40 C in the presence
of increasing concentrations of excess, unlabeled CTGF (n = 6).









M T N


4- 280 kDa


209 -N


111 -l



52 --


,aik


Figure 4-5. Cross-linking ofCTGF to human corneal fibroblasts. 125I-CTGF
was covalently cross-linked to human corneal fibroblasts at 40C in the presence
or absence of excess, unlabeled CTGF. Cells were solubilized and Triton-X-100
soluble fractions were separated using SDS-polyacrylamide gel electrophoresis
followed by autoradiography. M molecular weight markers in kDa, T total
binding, N non-specific binding.










600 .3b00

3000
S500 3000 C)
- T1
E 2500 C)
0)400
S2000
5 300 R
o0 1500-
' 200 -.
S100000

100 500

0 0

Fraction

Figure 4-6. CTGF affinity chromatography and specific binding. Triton-X-100
soluble human corneal fibroblast extract was applied to a CTGF-coupled affinity
column. CTGF bound material was eluted at fraction 28 by shifting the pH to
2.5. Eluted fractions were bound with 125I-CTGF in the presence or absence of
CTGF and precipitated with 15% polyethylene glycol. The blue line represents
total protein concentration and the pink line represents specific CTGF binding.









1400
0
= 1200
(A
.2 1000
E 800
E
0 600
E 400
o 200


DayO Day1 Day3 Day5 Day7 Day 14 Day 21
Day after Surgery

Figure 4-7. Specific binding of CTGF to rat corneas following PRK.
Phototherapeutic keratectomy (PRK) was performed on male Sprague-Dawley
rats. Whole corneas were removed at the time points indicated and bound with
125I-CTGF in the presence or absence of unlabeled CTGF at 40C (n = 3).











50000
45000
40000
35000
30000
E 25000
20000
15000 -Sam le
10000 loadd elution

5000
0


Fraction

Figure 4-8. Immunoprecipitation of CTGF Bound to the Type II IGF Receptor.
Iodinated CTGF was bound to soluble recombinant type II IGF receptor and
bound to an affinity purified goat antibody to the type II IGF receptor. The
complexes were applied to a Protein G column. Fractions bound to the column
were eluted by a shift in pH to 3.0 with 0.1 M glycine











1 2 3 4 5 6 7 8 9
51-C I'(;F + + + + + + + + +
CTGF + + + +
sMPR + + + + + +
Goat anti-sMl'R + +
Goat anti-CTGF + + + +


25000


20000


15000


10000


5000


1 2 3
1 2 3


Sample
Sample


6 7 8 9


Figure 4-9. Immunoprecipitation of CTGF/Type II IGF receptor complexes.
Reactions were assembled according to the scheme shown above. Reactions
were precipitated in the presence of gamma globulin as a carrier protein and 15%
polyethylene glycol (n = 3). Reactions were assembled in the presence of 10 pL
of 1 mg/mL BSA and 75,000 cpm 125I-CTGF according to the scheme shown
above overnight at 40C. The reactions were precipitated by adding 150 mL of 10
mg/mL gamma-globulin and 150 mL of 20% polyethylene glycol (molecular
weight = 8000). The samples were centrifuged at 14,000 x g for 15 minutes at
4C. Pellets were washed with 20% ethanol and radioactivity was measured by
gamma scintillation counter. Total precipitated cpm are shown on the graph.










25000


20000


15000


10000


5000


Trace None CTG
Trace None CTGF


TGF-bl TGF-a PDGF EGF FGF Insulin RAP


IGF-11


M-6-P


Competitor

Figure 4-10. Specificity of CTGF binding to immunoprecipitated complexes.
Reactions were assembled in the presence of various unlabeled growth factors
shown and precipitated as in Figure 4-7 (n = 3).









1000
900
800
700
600
500
'400

200
100

None sMPR CTGF Control Ab
Precipitating antibody

Figure 4-11. Immunoprecipitation of membrane proteins cross-linked with
CTGF. 125I-CTGF was covalently cross-linked to human corneal fibroblasts at
4C in the presence or absence of excess, unlabeled CTGF. Cells were
solubilized and Triton-X-100 soluble fractions were immunoprecipitated with
goat anti-sMPR, goat anti-CTGF, or irrelevant goat IgG (n = 3).

























SMPR KO Cells
m Normal Cells


OM


10-1' M


108 M


106 M


Unlabeled CTGF

Figure 4-12. CTGF binding in Type II IGF receptor knockout cells. Type II
IGF receptor knockout cells and wild type mouse lung fibroblasts were
incubated with 125I-CTGF in the presence of absence of excess unlabeled CTGF
at 40C (n = 6).












100000

90000

80000 MPR Knockout Cells
mWild-type Cells

70000

60000

50000

40000

30000

20000

10000



SFM 10% Serum TGF-beta CTGF CTGF + RAP IGF-II IGF-I TGF-beta + TGF-beta +
RAP CTGF scrambled
antisense oligo

Figure 4-13. Cell proliferation in Type II IGF receptor knockout cells. The
effect of exogenous agents on cell proliferation in type II IGF receptor knockout
cells and wild type mouse lung fibroblasts cultures was measured. Cell
proliferation was measured using an MTT assay. Cells were held in serum-free
medium (SFM) for 48 hours followed by addition of the stimulants for 24 hours
before the assay was performed.















CHAPTER 5
ABLATION OF CONNECTIVE TISSUE GROWTH FACTOR EXPRESSION AND
ACTION USING HAMMERHEAD RIBOZYMES

Introduction

Ribozymes are catalytic RNA molecules first discovered twenty years ago that

target and cleave specific sequences through base-pairing interactions (Kruger et al.,

1982;Guerrier-Takada et al., 1983). After the ribozyme cleaves the bound target RNA,

the products are released and recycled so that the process can be repeated many times.

Since ribozymes could be repeatedly targeted to cleave almost any target transcript in

vitro its effectiveness as a therapeutic agent in vivo was investigated (Cech,

1988a;Usman and Blatt, 2000). Extensive study of trans-cleaving ribozymes, such as

hairpin and hammerhead ribozymes, have shown their abilities in reducing the target

RNA of interest (Symons, 1992). Extensive investigations have defined the nucleotide

sequences in naturally occurring ribozymes that retain the core catalytic nuclease activity

(Scott et al., 1996). This knowledge has enabled investigators to design synthetic

ribozymes that act as "gene specific endonucleases" by combining the catalytic core

nucleotide sequence with flanking nucleotide sequences that are complementary to a

target gene's mRNA sequence (Cech, 1988b;Sullivan, 1994). The consensus structure of

the naturally occurring hammerhead ribozyme consists of three helical regions radiating

from a central unpaired core, comprising the catalytic domain and the substrate portion.

The 'hammerhead' catalytic domain (so named because of its secondary RNA structure)

has been mapped to a small core sequence of less than 40 nucleotides. Mutational









analysis showed that base substitutions were responsible for reducing activity in the

unpaired regions of the molecule, whereas mutations in the helical regions showed no

effect as long as base pairing was maintained. Experimental data has shown that the

nucleotide sequence represented by G-U-N, flanked by properly based paired segments,

are the best candidates for cleavage (Haseloff and Gerlach, 1988). This suggests the

possibility of engineering a synthetic hammerhead ribozyme that selectively binds and

cleaves a complementary mRNA molecule, then releases the fragments to repeat the

process with the efficiency of a protein enzyme. Several studies have shown the

effectiveness of hammerhead ribozymes in modifying gene expression in vitro and in

vivo. For example, a preformed hammerhead ribozyme directed against tumor necrosis

factor alpha (TNF-a) mRNA significantly reduced the expression of both mRNA and

protein in human promyelocyte leukemia cells (Sioud et al., 1992). Additionally, a

hammerhead ribozyme delivered by an adenovirus vector system led to a significant

reduction in human growth hormone mRNA in a transgenic mouse system (Lieber and

Kay, 1996). Also, ribozymes targeting oncogenes caused tumor cells to lose their

metastatic potential in nude mice (Abounader et al., 1999).

Several clinical trials have focused on the possibility of developing ribozyme-

based therapies for reducing human immunodeficiency virus (HIV) infection using

retroviral vectors (Bauer et al., 1997;Wong-Staal et al., 1998). A separate study showed

that a synthetic hammerhead ribozyme selectively cuts the mRNA for a dominant

negative form of rhodopsin that causes an inherited form of retinitis pigmentosa but does

not destroy the mRNA for the normal allele of rhodopsin using adeno-associated virus

(AAV) vectors (Drenser et al., 1998b). In these experiments, a point mutation in the

mutant allele created a hammerhead ribozyme cleavage site. It was further shown that