<%BANNER%>

Effects of oral carbamazepine administration on biotin metabolism in rats

University of Florida Institutional Repository
xml version 1.0 encoding UTF-8
REPORT xmlns http:www.fcla.edudlsmddaitss xmlns:xsi http:www.w3.org2001XMLSchema-instance xsi:schemaLocation http:www.fcla.edudlsmddaitssdaitssReport.xsd
INGEST IEID E20110109_AAAAYC INGEST_TIME 2011-01-09T21:17:17Z PACKAGE UFE0001103_00001
AGREEMENT_INFO ACCOUNT UF PROJECT UFDC
FILES
FILE SIZE 63512 DFID F20110109_AACKMO ORIGIN DEPOSITOR PATH rathman_s_Page_119.pro GLOBAL false PRESERVATION BIT MESSAGE_DIGEST ALGORITHM MD5
b504a7299547e0a52d6e077905607508
SHA-1
b7d216b835f6749ccf2a9b91f253dd7ebcc3f5f2
3171 F20110109_AACKLZ rathman_s_Page_101.pro
6706fa8c82f3be7eb489c6c6f0158bdd
3ccfe8dcf31c3d394db213258a2f622fd27802e8
1589 F20110109_AACKNC rathman_s_Page_012.txt
dfb6dccf055314b0e0bff3bb07441a89
1bdd641279db3f94e72099a0ee5af7131ea3b640
63866 F20110109_AACKMP rathman_s_Page_120.pro
a07d4d432e94b74cba84d10c9d35ff1b
21d2598b9057a76d473371ab38fb9fbbeb54f149
1693 F20110109_AACKND rathman_s_Page_013.txt
0c9d8e82fbe466798bce61358bf4ea2e
48603b22e950a4cbbae11e159a3007dacd65a629
63939 F20110109_AACKMQ rathman_s_Page_121.pro
0eb37c1cec57e60f8f06960afc7c39a9
04809e2f6cdedda6f28e51f0d4c4b234d975c88f
1886 F20110109_AACKNE rathman_s_Page_015.txt
046a6fee97781aa124e410db024aa3df
2fbf0993c718352e8470f89e89a3126ede5d160f
5030 F20110109_AACKMR rathman_s_Page_123.pro
4afd55f769aa4795eae80d9fd822bf27
b1dc09106d3f61ddfda7e8aa85ad45c48471488a
1778 F20110109_AACKNF rathman_s_Page_016.txt
e5ba07624c45e852c417f07836ca2ce9
03adc58654ab150f9f7294376d7db10e8bc5d7aa
17672 F20110109_AACKMS rathman_s_Page_124.pro
e2b92772fc15851553ae7fd8d1fc0fb2
d6b45b8e07301205945c1775f29497f4b1d44987
1842 F20110109_AACKNG rathman_s_Page_017.txt
eb63fa35b89006b5d096cb55cc51a486
cdb23853ceabf885920f93065721976bb947d659
2025 F20110109_AACKNH rathman_s_Page_019.txt
62fe0391b30baf6f9479806939c81a56
33337afe4a903bda3d2e0b70a206a7e2f315d8ce
452 F20110109_AACKMT rathman_s_Page_001.txt
b1600b09cebaf4358a492f7a1a6ded18
50a11c470847249160691c295f2ce24bbcd9f3a9
1974 F20110109_AACKNI rathman_s_Page_020.txt
2a19526f51cb0a6db82ee90e39664426
95c7c1854a154fd62b6bbffe4a3c24208cbc96c7
1596 F20110109_AACKMU rathman_s_Page_003.txt
279aaafc6645c0e438a504e12acf6527
de83d34831d2d6e2ecbda2bf6b04b49fa0aa6351
2121 F20110109_AACKNJ rathman_s_Page_022.txt
f8a410b438a4224442db79e74dca7649
ed0a5700155f7336c9b7133d4438d4aa347277f0
4161 F20110109_AACKMV rathman_s_Page_005.txt
aa35d17891d429dd97378afc19af0ca9
b6659731357fdcd49224b833676b413f2ae85c37
2000 F20110109_AACKNK rathman_s_Page_023.txt
5103391542acdb19e00ad6e008bdbad7
ed3461aefa65f94e4227bb124ddf580d8b17cb23
4001 F20110109_AACKMW rathman_s_Page_006.txt
646ed6e5a08d4de3cad567fb6d45969c
0bf30fd6be21ff6f94360530c5e80ea96796d2c4
2005 F20110109_AACKNL rathman_s_Page_024.txt
191643c7b9767e92b564b388ce5c62a6
6710aa9f2e7662e6f1a5c69c9cf7601b0997ca72
1677 F20110109_AACKOA rathman_s_Page_043.txt
29297f7bd22783ff1d895315bc7f1341
56d68541fe9e4defef4656b788f184118d8da481
2061 F20110109_AACKNM rathman_s_Page_025.txt
8608d33e5df8290b21651a2e06d18fa8
d1cd669c40820060b32429d5806ac8d91c5940f4
1055 F20110109_AACKMX rathman_s_Page_007.txt
7468f936486141b9595f5accbc0b11b9
10169bea1e9cfebf66f1a92fb515093c1f29dfa0
2116 F20110109_AACKOB rathman_s_Page_044.txt
5362579fff29eb57965c8618f40a0b48
dce9fd99344501bb196e26c32ff50ec5d9f296bf
2078 F20110109_AACKNN rathman_s_Page_026.txt
12370e86c0b0d76d486111ba552fa0d7
ce69aad1fa988cf63ef414c596b1b29f0149b8ff
994 F20110109_AACKMY rathman_s_Page_008.txt
9485cf075d2f9aee8605f85c08e39a9d
62a98100def94c843995df3933a52781f966aabd
1579 F20110109_AACKOC rathman_s_Page_046.txt
70f280019cfee41b9da17a067f593ae8
93420bf01166f0eb85b5edac49c7ce86cbf5f790
2093 F20110109_AACKNO rathman_s_Page_027.txt
7f6f681aa5cc19429819540315497be8
6473f7ed5d9156bd03a8955f45aace956994b085
843 F20110109_AACKMZ rathman_s_Page_009.txt
5cb49a77630bb56fada75d992a08a14c
be9803efa3969674c32312eab956ecb33f9710e9
1965 F20110109_AACKOD rathman_s_Page_047.txt
d1099df1808b57d951e6d190b8f1febb
5ef1f1178cb4304e2c3e07fe966127063a145a73
1780 F20110109_AACKNP rathman_s_Page_028.txt
9fdeb23ad4ad606573aef6ae3813b485
d8ce6591409271be0cdde016c91d5007acdefe2e
1963 F20110109_AACKOE rathman_s_Page_048.txt
2206d3445b9356e5b01c46c7a225c6e3
e8c7e6a89223338979199e47d1fb0d1797768269
2097 F20110109_AACKNQ rathman_s_Page_029.txt
89da6d0a34e936e2776412769e29c509
efac8611181bf82ce88563c165b8429d0920b853
1936 F20110109_AACKOF rathman_s_Page_049.txt
928c607cd696dac3d7974aa0fd375d15
ce9746388bef8aa965308562405a84d50cc34bc1
1873 F20110109_AACKNR rathman_s_Page_030.txt
9ae5b9dfdb3ff399f91d9450d3ad9860
69eef35d09e5aa506c92dbf7825a3db1db22788f
F20110109_AACKOG rathman_s_Page_050.txt
518af5527edd27560ca1c6c9e12164a7
06a54d778d5af28460fdfdda048ee25717b0e7d5
1515 F20110109_AACKNS rathman_s_Page_031.txt
0f29ade3a8532df29c368ef6ba3165cb
2bb25a8ef3e7a8a85d7cd7cc06bb19cc4d027ac1
1575 F20110109_AACKOH rathman_s_Page_051.txt
1367cb4cac5ad5131e9a22bedcec9c46
2a04a2995c7edad6c1f7ff0bc091e5ecafbeaa29
321 F20110109_AACKNT rathman_s_Page_033.txt
0f0cbf77bfcf5d8fb994173290cea8fe
281c2af0a929301326be71f0eaef55d4008ba00f
1719 F20110109_AACKOI rathman_s_Page_052.txt
59c7bd902804216d730c34e39eab4a60
deaaff717df67dd005b0e6677428cb960ef829e5
1958 F20110109_AACKOJ rathman_s_Page_053.txt
d54ad22003fba28f7fe34e931b6241b6
3932b1af26ba9f6d3991ef56bdb98d9a86e5234f
1723 F20110109_AACKNU rathman_s_Page_034.txt
efdea7a83d548fce28706966c5f20626
e8554fe682aa0fa29b1a33a26a583bae19f9214c
1816 F20110109_AACKOK rathman_s_Page_054.txt
b0fd56f579cea60bdacbf549e646da1d
3df26754ccbc484c1634cbfe5c3a5d8df270d7b4
1953 F20110109_AACKNV rathman_s_Page_037.txt
64dc1be2db0a9b8639fc1f7fca7c8c60
e91fb980afa35a3998f9e155662a1bbe4aa29ffb
1705 F20110109_AACKOL rathman_s_Page_055.txt
b0cdc3fa1605c3f5357553b02e674d1c
6af381637bc379dbbd1c70f2183b91e017c46b84
1957 F20110109_AACKNW rathman_s_Page_038.txt
1ed6080e73d96f745afd04cd4aabf282
e5f1bfd206dfa3c36e83f9f3717b4c0fee328adc
2136 F20110109_AACKOM rathman_s_Page_056.txt
1dbe0014a83c2336998a70613ecc94b0
a3a1a4d7fb618c96d31b3416c69ac5787933f4d1
1904 F20110109_AACKNX rathman_s_Page_039.txt
541d2324e083699eaaea2e923af4c481
14f2c7bc748a4bd8dc13a9b523dbe9b3fe2fbe63
1496 F20110109_AACKPA rathman_s_Page_083.txt
d3fd8fb2392499d202db08733c72e28b
b6e6a852f57cb6135dc4767186ca9243f0675a2e
1382 F20110109_AACKON rathman_s_Page_058.txt
398546386b0adf9420bd2b4d052e6820
d7dc1b80e1206aa82dc556bd810327ac9eb68843
1945 F20110109_AACKNY rathman_s_Page_040.txt
0ce69a66055632656af41e87ef88f45f
db9b8d5be46062673bb484a1fe9e5dd635fbff9d
1791 F20110109_AACKPB rathman_s_Page_084.txt
e2cf3846ce0fca99e1300a2a84fc5697
a0b787359165cc0beb331ecb300cfd00dc9c91b7
2051 F20110109_AACKOO rathman_s_Page_062.txt
7ad38fd7d9314f95261a00c016b4f184
3216903f9a6a8512aed4781c226ca0cfdd03a27a
1860 F20110109_AACKNZ rathman_s_Page_041.txt
9ef0e12677797b6bbc63e0d483b79a2e
ac7ae33c776de4f2dfce0ac9e2dc5eb575bd899b
F20110109_AACKPC rathman_s_Page_085.txt
95a142f1e90018a03f5ca9f811403d91
de4987af206e8c6547e43266a4d6364cb6b0fe8a
1620 F20110109_AACKOP rathman_s_Page_068.txt
b04e6f2799f66598eb8f6479aae67068
efcf3bc1a9d9c684728b4156b013d3ba0de6bad6
1937 F20110109_AACKPD rathman_s_Page_086.txt
0bceb96167d2adde7fc4e27fdace1a1d
da7fc0a013f540e025e5bd5c9f70976707a95a1f
1942 F20110109_AACKOQ rathman_s_Page_069.txt
31c9d5f160423ee3f5754df4c9db3d45
283f52bf2aca5c8093312402afd99ede5b4feebe
1879 F20110109_AACKPE rathman_s_Page_088.txt
7288ed99bb936f35030663753f327c17
b60cc8d4d6c1ec7e723c51f70067b39c583e57de
1808 F20110109_AACKOR rathman_s_Page_070.txt
8f6b2f4094db1ee5fb69dbd7a91230e0
9c90ccd3bfa0d57d5d62957d172341c675b0d714
335 F20110109_AACKPF rathman_s_Page_089.txt
878ead4da22b67f70567277f944bd3e3
e4fcbb699a13f9bd34afa1ab325ea06a4b0b8128
F20110109_AACKOS rathman_s_Page_071.txt
74b33e65e24116e1388f1395bedf75ba
f2b9b9539c4b9a05b3bc45f6cb3ef47ae6b6d97a
859 F20110109_AACKPG rathman_s_Page_090.txt
2a64639ec31a4b65c13e932d00b525f5
70e71aded19ee2e32efd9b87d38216d03b61de3a
1717 F20110109_AACKOT rathman_s_Page_072.txt
e63457bae178422d0ddcc00ef6bcce46
eba03165ebd3d819471577f81e41ace6cc744109
1849 F20110109_AACKPH rathman_s_Page_091.txt
c553bd092b40dd0aaa5e358ed94283f6
e31d77194b08796518e3fbdb0e4ebc16490f8c89
1970 F20110109_AACKOU rathman_s_Page_073.txt
ba22153583fcd65fd5afdceffefb455a
7b090f7af2ca98de3ced590bebc6554f0772bd7b
1264 F20110109_AACKPI rathman_s_Page_094.txt
8c1e7ff0bc2988c48516690df2d52c56
81d2bf9f11f5d78ff12d43931da5c76e33a19809
1857 F20110109_AACKPJ rathman_s_Page_095.txt
e3da99d289e2758000cf3c5aabb60a81
898a3a770120e4c27bdb71935ac111e8e2767eff
1868 F20110109_AACKOV rathman_s_Page_075.txt
3a2cbf5aa5c70de340f5b5a19a9932b4
6d3a6cbc8eb2dcb6e319e9cc62798c3ed10c6452
1895 F20110109_AACKPK rathman_s_Page_096.txt
00fd2753d8bbea469b8991954c6a604f
b309556b50724fd83b99c26339ef0ff880be7595
1975 F20110109_AACKOW rathman_s_Page_076.txt
987c6f3a2976a5ea8e314b3170bcc236
c530f24410fab8856b18c7c661263a68d072d652
1910 F20110109_AACKPL rathman_s_Page_097.txt
887b35466c1588dd7d3115b7cfa6eae2
3affbd55b91ccba9648ea2f0b081a778aecf3dc4
1890 F20110109_AACKOX rathman_s_Page_078.txt
fb5c07e2417ad4e87aec8a4a6a2f1f1a
7d2f9d43fffb79b48c8be50fe9887594edb06e8f
2475 F20110109_AACKQA rathman_s_Page_116.txt
c02afadccea3feea7d6397ef16650d7b
8f306336d8ab851ecdbe5c8bad8ae8ff9468d5d6
2024 F20110109_AACKPM rathman_s_Page_098.txt
3e4e30c00127911040028a85a4bb9adf
5b625c8b7446c020251077433b08f19707f25fb7
1915 F20110109_AACKOY rathman_s_Page_080.txt
d19a283fe3a33dc5344dc424d3954fe1
e906df45d7b3c9e07d90e360e3303f3a4b5ce070
2357 F20110109_AACKQB rathman_s_Page_117.txt
aa625df90a62433cf82590366e4b27df
71dbba33ddf0ef15f4a36059835b60bdadf1edf2
1880 F20110109_AACKPN rathman_s_Page_099.txt
5712e07f458e636b8bc3921a8c77e340
1685aa3545b0478ebcfb78a114bfe4dc11cba29f
2027 F20110109_AACKOZ rathman_s_Page_081.txt
1f394d28188382637665977105347344
c20325d69b6909e615e720faa911ae29afb52a91
2667 F20110109_AACKQC rathman_s_Page_118.txt
94dc41867795e8207513cadae06d28f1
264085118c3eaa7b17334c7b4daeb5f51eef8c5c
1481 F20110109_AACKPO rathman_s_Page_102.txt
82368c2d442e82e607d6afce1d124aeb
7ffd9ea96ae9f7230d78931930c07617647a72db
2587 F20110109_AACKQD rathman_s_Page_121.txt
1452d21047841a16b203158f83737e9e
1bc1e55c752fc7f7f41161eb7187db558efb3228
1508 F20110109_AACKPP rathman_s_Page_103.txt
8d714e07ac1148435aa5840fcdff2d6a
b1205223637b1d2c19fd0f6e1fc97d11088b2a24
2326 F20110109_AACKQE rathman_s_Page_122.txt
45649114e41417c21a46c17f54b41ef6
bdaf1d0af8ca4839615695c20161ae3eddde4050
F20110109_AACKPQ rathman_s_Page_104.txt
35e097a2d6b15d84eb7f895a660627cf
2de3ee4ac5ccb02f2e85f0e47bf3a9ab97391546
246 F20110109_AACKQF rathman_s_Page_123.txt
319d148f392cc39a4dc989804c271353
18e34f72e5a98ffd5115c110f7a4ba94d6228f10
1317 F20110109_AACKPR rathman_s_Page_105.txt
2b3e120d9df5530c4c337d60be7ca28c
1a11913b0777154322d7576112b4fe6891ed0af1
751 F20110109_AACKQG rathman_s_Page_124.txt
09dbc6a23ffb51afed9f02b3840b0f37
9f34f92506999ce10763c7ccfb2ac5e25bf2311c
1984 F20110109_AACKPS rathman_s_Page_106.txt
a2bb70d9857149c462eb5e0ca476a4ed
0e4aab1ac801aa2f4fc794624d1de3ead9fcb059
1253681 F20110109_AACKQH rathman_s.pdf
731b5ff17e12135bc9535fb3bc330158
3a90a8f313014c9d6ec7a5d54e430e5efc084995
1444 F20110109_AACKPT rathman_s_Page_107.txt
8f2f552b311b2003adc53ca690b4fd73
6c9ef68880c1f09f5af8529497c9b6e380649221
24399 F20110109_AACKQI rathman_s_Page_025thm.jpg
035b402a5e0e58ad717835906ab20bc4
ea906af6f5bb48f2aa53dbf8aeb8db9b75b9c248
1649 F20110109_AACKPU rathman_s_Page_108.txt
ede1852dff80df1203f63ceae807b2f2
8ca3b885fae668cdbb98a137bf05469e4c1f98ef
56527 F20110109_AACKQJ rathman_s_Page_102.QC.jpg
ca5ce1193643a38259feb8f2e6c36186
e11020cbd3ad93de37691823fc8f366d3d303e37
166 F20110109_AACKPV rathman_s_Page_109.txt
ea9363aeaace520258a931ea73bbe912
88e22a8ec2d5403543a3b27c3e5c323fb0301738
69570 F20110109_AACKQK rathman_s_Page_044.QC.jpg
35acd0ddfb1ea8dbe07fa3e895178413
4636593a9b3b93a7466753cb0dad9242aaf1c6f0
21580 F20110109_AACKQL rathman_s_Page_072thm.jpg
57f0285dce5c7c0da1c203393f1f247a
2dfc63bec36eab4d8b6c373a73729ffd7b268cf4
2472 F20110109_AACKPW rathman_s_Page_112.txt
a4d56ea928b2598fa847f4b383b73203
1ba942889f8f9eaac0d2238088130805f4001739
28826 F20110109_AACKRA rathman_s_Page_044thm.jpg
cd5a3d3349c7bed28cb29a919cdc8fc1
5508bc3b8a3756c2b7dc1e27ecafb119d36f797c
93470 F20110109_AACKQM rathman_s_Page_076.QC.jpg
bb7cb42724b20150fa63293f8a3251f3
2f6c3bb6664cf968dd78ea0011e73fe2f1db2848
2427 F20110109_AACKPX rathman_s_Page_113.txt
709d99d964bcdf1aa5c622ee1c6c34b1
7e62f6a969f659e4830f8abfeaefd2a79262d7bd
23584 F20110109_AACKRB rathman_s_Page_080thm.jpg
e32eb87bd363f0b030f2c6ec630a4a17
1c5dc69b90813817698e7dbe6e0497f21e0fbb4b
83894 F20110109_AACKQN rathman_s_Page_121.QC.jpg
290c1f28da581cbd61f741ff1de250db
82b1d3045085a331f281f99f8211cf4609a65920
2433 F20110109_AACKPY rathman_s_Page_114.txt
aefdfcef6ccda2de2ce14cb732a42131
d6632d755c09a1cc9b8a67b7e58cd818f6614f0c
75825 F20110109_AACKRC rathman_s_Page_080.QC.jpg
eaafb53d11431b12974db0bced2859df
0bb105f8b61cc5e6dd4222391048fd50ecd9b644
68159 F20110109_AACKQO rathman_s_Page_052.QC.jpg
ff5054e97319dc1f62a36b7ce41a73b4
908813393835eb2c20c58de90f85abac70ede87a
2239 F20110109_AACKPZ rathman_s_Page_115.txt
435947b574375115bcb7626628a7bb82
401d5850bfce0ba89eaf3039d9b32c1ecfdd3bae
23738 F20110109_AACKRD rathman_s_Page_057thm.jpg
e0131ff4cbb9ad53c7c61cc2c22f1741
6c4b81deb9d1efcd9ea8347c6896cbeb1aef5f69
23977 F20110109_AACKQP rathman_s_Page_093thm.jpg
1ec963a609a8f92ec4df83bd6c92da81
ded85334910b607628ed9c8fc4c912db21862a12
24654 F20110109_AACKRE rathman_s_Page_120thm.jpg
fecdf412868d3db5bc09fa842dd486d4
f12e25c92c410c8e38808b772aa38bfceb18f802
33221 F20110109_AACKQQ rathman_s_Page_008.QC.jpg
1a68c120f0ea68901f4235164c491e4c
19afededd9d04443cdebab01ea17c11e84d9cd12
49519 F20110109_AACKRF rathman_s_Page_004thm.jpg
459746ea220598d1da075dcd197dd9e7
eb45c73a36a1fce82edb5333dd80910d3e789fe0
44474 F20110109_AACKQR rathman_s_Page_105thm.jpg
22379d09efdba7a3e38fab1df91cf979
aa25d373eab367b8dd44e7db80754b2323073a01
58259 F20110109_AACKRG rathman_s_Page_007.QC.jpg
9549d615e883be8dbc5c9f20d71fb399
19732a8edeb11785c0d12747a5b6161f462a42a3
28671 F20110109_AACKQS rathman_s_Page_059thm.jpg
d30dd164ca1e3ea265620eb2af2f80e4
40276059d4e612969a78d6fa3fa8835ae8840906
16641 F20110109_AACKRH rathman_s_Page_094thm.jpg
97ba6190dcfe6512db1432d2efeeff9b
714f52d2e870e3883d5ae246002a2652ebc18c4c
83082 F20110109_AACKQT rathman_s_Page_122.QC.jpg
8e3a39665e5b967cc059a29916017aae
4353e7cfd0dec08bfe0f31a2f1fadc79aa3fdcc9
41530 F20110109_AACKRI rathman_s_Page_107thm.jpg
3a5ea3f22165027a7600d2cb469bf6ea
d28aefabe046525ab17f7b4281912bb080fde99a
58135 F20110109_AACKQU rathman_s_Page_011.QC.jpg
95e534c35858ade2367b5de0292aef36
9b161fb846bae5bf9560eb88b16b4c3b8431df35
85539 F20110109_AACKRJ rathman_s_Page_105.QC.jpg
bfbaf63a2d5c07a841aefcff99fe7411
9fd26e7b432cc2f1d51df2516f2678a3404cfe75
18809 F20110109_AACKQV rathman_s_Page_016thm.jpg
2755e17d1f25f23cbaa4dc0b242ec4a4
ddc0a58135d5d529fbf97b36162725a43bc5c211
45694 F20110109_AACKRK rathman_s_Page_061thm.jpg
05abd629b947c81140b73a09fbcaf54f
a7059d82bf597d2181b065ab857cf3d2e98af02d
63127 F20110109_AACKQW rathman_s_Page_047.QC.jpg
df9ede8adc1e64db701df8ab50621c10
6fa417a93f68ec0928a0434db7a0ac897f198c84
64741 F20110109_AACKRL rathman_s_Page_110.QC.jpg
c331ce22ef454c3e0892709d3dea95d7
837e15d16e0d4c99ebe72027fe58b6c465cd3d5c
24660 F20110109_AACKRM rathman_s_Page_056thm.jpg
97e40a819bcc7701b2b33e898e280a6b
728ccea53062682bca7b399c412f0f8adc634044
73417 F20110109_AACKQX rathman_s_Page_028.QC.jpg
403562ad8d11b8e9051fd945cbe2268f
3ff33f117ae9cb339e7ab973b64ec475409dfa6f
118642 F20110109_AACKSA rathman_s_Page_006.QC.jpg
38ede5271886bc0fc2d028fbc5498e43
ed349c228556e1f5e2c6c8a054abe1cad254b1b0
42673 F20110109_AACKRN rathman_s_Page_092thm.jpg
d7110482c2f93856a5c3537d194fa614
47434fdd635b033782c47bcf8e9b8a260927f690
68142 F20110109_AACKQY rathman_s_Page_084.QC.jpg
808ed5265c6ee7ce0ab9204ec347e16d
e5ee2c728e5f680d27ff9a8cf749ab8c23fa1c42
95616 F20110109_AACKSB rathman_s_Page_097.QC.jpg
9420e1e3f11714b32f5fb4bde914f6b0
49090c9956a56eacac13a373e4ea1f7715728e78
29724 F20110109_AACKRO rathman_s_Page_099thm.jpg
6ed49a22d3f1e74f99a90ebdb4b84aec
879824ffba462fc60eede01a94b3d6fcd1aedd05
80502 F20110109_AACKQZ rathman_s_Page_100.QC.jpg
4b25511f5149eb4ff9177e0fb88a2810
d95864aea4ec6d6816e299bd637ed3b5cd707228
26352 F20110109_AACKSC rathman_s_Page_079thm.jpg
767bd800e7d780d5692025b5b0696a0b
79fd0be4b7d46bacb3e918a5bcbfb9c3e9593285
79618 F20110109_AACKRP rathman_s_Page_056.QC.jpg
ab800fc616e69c45462686d48ba7155d
b28523599631ec8cfd6bde03a9b04554a980e26d
80643 F20110109_AACKSD rathman_s_Page_067.QC.jpg
7e9edf48d9d98f70dda415d8e0a4ff00
193dfe46a8ead35e2975afb262b6dc9874d62aed
55319 F20110109_AACKRQ rathman_s_Page_016.QC.jpg
ce0775248309f53daf17dc5a3a7479bd
7b4e49e42c9a50145a7c2a7b45aa5d494ce41bec
78867 F20110109_AACKSE rathman_s_Page_098.QC.jpg
5042ab6f40fe0c94928abbbafbf8d660
7d633ca948abdd05414b5f76bd473c549c484332
25008 F20110109_AACKRR rathman_s_Page_121thm.jpg
af0e32408723df30045d5533a7639a25
7b566b45719c09e83f7374bf25d56a473e58df28
45924 F20110109_AACKSF rathman_s_Page_077thm.jpg
02b00103a0112eb018b9dffc57787e0a
60a146f5cbf019401927a19739d24307f8cf3d41
71306 F20110109_AACKRS rathman_s_Page_057.QC.jpg
2c389a012393ad3a3eb8ea46c834172d
1f77221b80bd2c21f4e0a216f8703432e57b998d
63347 F20110109_AACKSG rathman_s_Page_103.QC.jpg
a887eb3328f14d18c9836660d0cc589d
3fd2f5bbb60bc02f1914b8b7f12b7046027e0047
19605 F20110109_AACKRT rathman_s_Page_013thm.jpg
23c2e0a37de1a180fc2b2ceec42381b0
c8be5969720a2f71623c17bfe250d1aa6f28533f
25263 F20110109_AACKSH rathman_s_Page_081thm.jpg
32b0069a4a386d3041ea3450e706f6aa
85ad05ffb96eed14ad6b555062fc2f2ac0b50e4a
3346 F20110109_AACKRU rathman_s_Page_002thm.jpg
dfd0d3506c6a6d85470dd321ffd05cc0
2f2f14d9350a24704ab9e636afacb9fefc24adff
81491 F20110109_AACKSI rathman_s_Page_025.QC.jpg
43b45e46b457da01fe25e818b12a9a27
0d94928505e11dacbe1021c3a760aa2e50ffe060
75213 F20110109_AACKSJ rathman_s_Page_099.QC.jpg
44c7905face972e079273de44b48648a
ec2b4e9180c0f3445ce46f4a61a660bc76b0aec8
31842 F20110109_AACKRV rathman_s_Page_124.QC.jpg
253d90f005a46d4bd6ca448ab2617fae
cdf2901ac1bbe6be958d7edf8855b4a1fe49bd8a
77387 F20110109_AACKSK rathman_s_Page_092.QC.jpg
38f3c56d8e56939e858959c36e333a12
d8614df101309407f7ecdf3c226bfb6dae46c441
73907 F20110109_AACKRW rathman_s_Page_017.QC.jpg
93bacc79e4fffa7a446709bbc039362e
79fb26f6873134dfbf415b3760e9c7325302367a
25304 F20110109_AACKSL rathman_s_Page_122thm.jpg
821d454c52d81e3cb9896fe1c4b989d2
d770afc4f90659fb619ac18ca7f7dc2689a77621
25264 F20110109_AACKRX rathman_s_Page_026thm.jpg
46b3ef2aa5fa5f8626024bb88c64e210
d30aea7085ca8c06b3b12a681b19192d7ecdbcfd
13262 F20110109_AACKTA rathman_s_Page_009thm.jpg
f6b9516614255769e1648eee989b1f46
aa6faf3c5c6bee88f188f76f9517c695f24d6b90
24452 F20110109_AACKSM rathman_s_Page_114thm.jpg
3d7e4bb15716ffc9e270a2a55c9e13da
8f53e16ba2b709ad99722cc714329142a6bf74e0
85041 F20110109_AACKTB rathman_s_Page_111.QC.jpg
ee81c1accea6731f885237bc23c2baf8
7c9d2bdf4981795c4afb3369f16573b7de651704
22881 F20110109_AACKSN rathman_s_Page_035thm.jpg
bb32e29f68146fe57f152ae54280f71b
93b9eed7dca660a300246d82691a6ff03cec1bfc
24802 F20110109_AACKRY rathman_s_Page_019thm.jpg
932e4551a80ca70f78fec7c4f474e519
22e5d089acf8004664d3e3cf2674f1296f3947fa
11104 F20110109_AACKTC rathman_s_Page_010.QC.jpg
dfda0ffdb05d285de8cd4d89fa171ac2
2b9e2cfec92855264c454c9ce52ab4cf89d5667e
103033 F20110109_AACKSO rathman_s_Page_048.QC.jpg
0f8e968a9e0e3a8061acd1d5fad6aea0
55f98de9b7b5fbd4aaabfa3810142712dd791c2f
80980 F20110109_AACKRZ rathman_s_Page_019.QC.jpg
b8605013994fa86d15c26899c2093549
10eaacc1f9879ad3695d5469cc2936f8f144fe60
12867 F20110109_AACKTD rathman_s_Page_033.QC.jpg
80803b3644acd64961110add2d40fb73
e36ffebb1bc82f51b05f856931f3875a6b5ca840
20666 F20110109_AACKSP rathman_s_Page_003thm.jpg
050e86b3f09cfb4a38847c6ab955c123
200f3ed87a1f6e01eadf532a56b459378b0673e7
69818 F20110109_AACKTE rathman_s_Page_087.QC.jpg
a32d9c6814a59e1d7d451cc20fd42f4e
9d4f4e68ebbcb4762a34846b1b2aa4dfd02c7d54
44376 F20110109_AACKSQ rathman_s_Page_108thm.jpg
94fef436cd04c6fbbe6cef2c6d61903c
cf0ac74c07adf59fa869388cc71054cecb53e44f
22541 F20110109_AACKTF rathman_s_Page_084thm.jpg
58aa0d702b8cde07a7787028a5cc2bda
f6d99a7ffcb514fa5d1732acd8fec59c14c9b44e
25575 F20110109_AACKSR rathman_s_Page_027thm.jpg
2bb7bc9ca98a344e56be3fe17ff3ca05
9c6699fef7b860fa9a18f11f0120c421f800c039
81230 F20110109_AACKTG rathman_s_Page_063.QC.jpg
66ba8ed3376588af37da9509d5a88e84
6ff08db6420a7242419b7a96f0be6dcd5feeae15
23623 F20110109_AACKSS rathman_s_Page_050thm.jpg
891d7718f3a8e2dc18b3a807a291a545
1f8d6649275d1267ec5c1bfb179f5bd3f91489d2
37957 F20110109_AACKTH rathman_s_Page_009.QC.jpg
67a43277a5291204f6f6fa4ef44628d0
e4bef580c7257f476cd9e13e47a3c95c9921f6e1
73475 F20110109_AACKST rathman_s_Page_059.QC.jpg
fff6396a27f0aa28394f92afbb3e7477
d6bae10e8e816e433c0dd695cd654191400e3a22
26528 F20110109_AACKTI rathman_s_Page_047thm.jpg
14f9d8004b019be34641b41c8aa06add
3eb7169dc4795d1f6f3d5e9078d68972e04ea5af
76547 F20110109_AACKSU rathman_s_Page_015.QC.jpg
0199440caa59f3d9ef7e1957a5c433a5
ce1ecc711ee790bc5540d546eec92111db553f7b
24170 F20110109_AACKTJ rathman_s_Page_119thm.jpg
41983b78595b985de4d8ca72c6ded6f0
cc851caecb1a4fea26f7e36e46f5168784c59bf9
24172 F20110109_AACKSV rathman_s_Page_039thm.jpg
8093e1c7d2b72a63dbf004317e6b32bb
d294d8b3f57bb8704a4fe470a6f1fffb91860363
8423998 F20110109_AACJQI rathman_s_Page_079.tif
9ac1179d45500d47d630ad3912ae95ef
e6f9c2a52b7eace6b0f00fd33221ba51dbe84c0f
68833 F20110109_AACKTK rathman_s_Page_091.QC.jpg
928f3148f69ef46b0f257cedf7d135f2
16e7ed755bc3068c7ead55cb4066d3f4e96eef26
85863 F20110109_AACKSW rathman_s_Page_118.QC.jpg
bfad39cca35a63fa86149ba7394d21b0
226dd4bacd276430a217681f5225de6f9916805c
25179 F20110109_AACJQJ rathman_s_Page_118thm.jpg
c0e9e0b0e87c0eda028e1013acbaf328
e523380dfa60252292801602b761c774dde0a6d4
70005 F20110109_AACKTL rathman_s_Page_035.QC.jpg
76490d1d50d04ec19929c701da7b9cc8
35a408af245aa7d32aa3796f787ef84202c44473
24637 F20110109_AACKSX rathman_s_Page_030thm.jpg
5f3e0489d03fcb5270bc2cbffbaaef80
d1ebe8965f4272d76dc530fc29b4cb35586aaa7c
28545 F20110109_AACJQK rathman_s_Page_010.jpg
93ea567776ebaa99e835b2cf8a2bdfe1
675fdd65feba639470f78e5c8a5868ca1f0f1cfb
5152 F20110109_AACKTM rathman_s_Page_033thm.jpg
ab2f7a78bbf21fa77165f1c73ed1d507
1e962ca0928ec06af33a1abd54a2728f55f6cc06
23875 F20110109_AACKSY rathman_s_Page_055thm.jpg
ed6aea0eea50d1ad87bb15622227f944
c7d247d2bd71be4808f39aad7ba8933abe64b474
80298 F20110109_AACKUA rathman_s_Page_039.QC.jpg
e07fefc8476ffde5bab4ac33a35b24c7
1133c0b56ce592be73f830033f1ad78addf03fad
25470 F20110109_AACJQL rathman_s_Page_022thm.jpg
6e49631bb69de67b5c7448576ba1bd64
e507db694320323c5416a84a9c4eae68004cdee6
22033 F20110109_AACKTN rathman_s_Page_095thm.jpg
5ce771799e80348045665523e8cab437
2c0ca510964a837d42a022d0efa3d42dacbe880e
19225 F20110109_AACKUB rathman_s_Page_102thm.jpg
61cfc4f08cb5f125b91900d88ec6db1e
695c4007ee144b27c3577a422b318f60b68ca70b
10152 F20110109_AACJQM rathman_s_Page_101.jp2
ade0e4079c888de1f16853d5bd56838e
883d3d16243d530d4ecfab981db372704ad8d1bc
21700 F20110109_AACKTO rathman_s_Page_045thm.jpg
30d04709216b329f87116999a661c396
94aaec0b3a79894eb4dce42900468aba8834fbb3
68417 F20110109_AACKSZ rathman_s_Page_072.QC.jpg
a760fdbae64d45a096b33ac72e19a8be
4d0a1cf7185f32632220ab4c59267b31763eac30
2007 F20110109_AACJRA rathman_s_Page_110.txt
267c5ec71d63c66b0afd37dc1a253c51
ccca4ce5df5c69a5688e9b984975ed1c1f5be570
129017 F20110109_AACKUC rathman_s_Page_005.QC.jpg
7c3e1deb498fcea3a44aeb6f387e6516
73af7e64ed13eab37b774dfb360cbe6cadd583e2
2117 F20110109_AACJQN rathman_s_Page_018.txt
ea9cb8048d0a14f6bb4b1a8b5073929b
39a4d13392f59c67d57e94e7eaef426c6148e1e3
54760 F20110109_AACKTP rathman_s_Page_005thm.jpg
61609c356ed7c25cbb1b702e07356197
ac08d2596c61d2ef7df5b54ca683a4c07403eea7
1908 F20110109_AACJRB rathman_s_Page_059.txt
8c36de2994bfd403acf6638b2c48d7be
5120f60c319350185aced9fb5757b70bd3193b9b
45550 F20110109_AACKUD rathman_s_Page_073thm.jpg
d4ad8f29c16e8f540a1e34c49e942e68
dc2f03eff2d1a3a2e9f7465e3e4db5247fbbfacf
25683 F20110109_AACJQO rathman_s_Page_064thm.jpg
5c76f5f461b1eb9d78ba734774f3e32a
e2d255f26eb6dae68fa59aa348f77eb9b398340a
23350 F20110109_AACKTQ rathman_s_Page_028thm.jpg
45b26b7045e6032b496ef36d837bd97f
28e0e76b396d07a2e394bcde26b83305f6716e26
25208 F20110109_AACJRC rathman_s_Page_053thm.jpg
58facf63a73173f1a82eaa6a5c6a1157
a8807f5c82a944b4781d5ca4d525b75634ca3363
74714 F20110109_AACKUE rathman_s_Page_107.QC.jpg
b96cc3426a2a227b5b7ef5e57dd32e10
6f80b568f8861a496d0dc22096fd85c828cbb70c
78363 F20110109_AACJQP rathman_s_Page_037.QC.jpg
c2d1cdb427ae1fd002e9b2cb2df38a7f
004cf8d5a26c50893405008da65a042dced5cb38
64652 F20110109_AACKTR rathman_s_Page_079.QC.jpg
10b66861ec94a3d51c397b32604651c4
177d551ed851c39381ee971d283bcab38090fac2
25617 F20110109_AACJRD rathman_s_Page_007.pro
1a231a7eac9f5b7af866129f960ff4f1
b5cc7ce9b9b50f0d776ce154931c0fbb33129582
81274 F20110109_AACKUF rathman_s_Page_024.QC.jpg
2469fd4105469bd67caa81cae80fdf4f
27b7e9e7ab80d90e895b683200212fc50bec09e9
63315 F20110109_AACJQQ rathman_s_Page_051.QC.jpg
5fdf37c32e95f9f24b79f71e04f8f02b
b47a1e9b79e4e996bcbc20856cb7da03854429a1
84717 F20110109_AACKTS rathman_s_Page_119.QC.jpg
568a03e0e607789d36a65f72952baba6
7f272adc2d6f86940f91cdcb291c8f1bcb36d133
116871 F20110109_AACJRE rathman_s_Page_029.jp2
75e716f86a7c683c36ca902129605333
0bb5a9210da6e79d4fbbf9534e653c58c2a1d775
88643 F20110109_AACKUG rathman_s_Page_074.QC.jpg
d468004e945725f3b8b8ec2da885652e
5e62c27e70e19b86bea93f28be6f2a9304866ded
1659 F20110109_AACJQR rathman_s_Page_092.txt
75deabb89d2f38be9d166651c4d969c0
080eaf6f580a05f7abef9b0e1004649bc840e804
20553 F20110109_AACKTT rathman_s_Page_066thm.jpg
e77a5151e53bdfe5250d06f7c4fd08eb
6d3431ff2f9f0c7dd74d93118b6a85e2dc20590b
22637 F20110109_AACJRF rathman_s_Page_017thm.jpg
3ccbde05557410a0f29a9d97e20a9809
522a654163455ae550af335ddc945cb9a615ae05
23165 F20110109_AACKUH rathman_s_Page_091thm.jpg
68eb6664e089d6e141d1c8a058bdfe62
40ab7fe8fc5e7bbc48c663d912ba1c287b1bfaa0
1053954 F20110109_AACJQS rathman_s_Page_014.tif
046875de9a1e444fa87477a387fd4db8
e2c8cc334c4004c14be0c1b96d8e9b374bbdc06b
19013 F20110109_AACKTU rathman_s_Page_043thm.jpg
7660cf849566918719cc28757537d9a1
3edba38b564fc5c3fdb47cc6fbc2d9aea1a2f15e
40662 F20110109_AACJRG rathman_s_Page_077.pro
7143702ccb659a6b4bbdad488e72c831
19b4f80ef72f880711ab5e449c9905a6df65b804
80446 F20110109_AACKUI rathman_s_Page_036.QC.jpg
c7233dd6c77a78ee2e03aeb2ab144424
1be2a2b3c422f37ca8f6140f8d16f50635a4f2f5
189449 F20110109_AACJQT rathman_s_Page_087.jpg
efa1c75f7c9ebe7730cb1adfb6a59913
0c4eb76598a9baaf8099183714be58d51806304e
74834 F20110109_AACKTV rathman_s_Page_085.QC.jpg
809747c6e2bf5f1bff24d5f48b7cd1c0
e743a7c4b9fb8124e53dfb710b79201671da49cd
224972 F20110109_AACJRH rathman_s_Page_027.jpg
f9dded08de3920034100e52768a2d23a
51be5ceb83e21d20964d610d50247b6bae622516
84380 F20110109_AACKUJ rathman_s_Page_120.QC.jpg
b258f15caffd77d6a8663e11b60bac16
8f0a5df7879daedfd4b9ad17608813de1d8e473e
46025 F20110109_AACJQU rathman_s_Page_074thm.jpg
66fa9e63c0a41a0051f34b9d1a8b4f62
733bb9aea9344b550aa6dfafd497ed527539b741
57669 F20110109_AACKTW rathman_s_Page_043.QC.jpg
c7a178b0d9e275ad70a7a70560365e63
9a9ee5fb604de8afe68300c063ffa77076f6daa7
83393 F20110109_AACJRI rathman_s_Page_018.QC.jpg
fd743aa044f7a439da782d061d2907d0
5b22e137c7b5f5b4452bb97d64eb8315e2fa59d3
25425 F20110109_AACKUK rathman_s_Page_100thm.jpg
3e153cfc7a239cb2243100d08b17edb7
4e4ba7648ef6b379f3ddc1c3a0c4bc3cbf796267
32895 F20110109_AACJQV rathman_s_Page_016.pro
afaecebce5f16d72f9ca836afee5b04e
236b7d4a2af85dce685c5252c4a70b6bac9aaa55
63437 F20110109_AACKTX rathman_s_Page_042.QC.jpg
ca96aae4bf1ef1b80212d318ffdde8fb
7904ce78ee4270f096680941c4be9b8610ac3249
1989 F20110109_AACJRJ rathman_s_Page_063.txt
b1573c1c3a70d49dbb3506d86109333f
065c768156c447b68bf889727eeb8403cc5fc037
83100 F20110109_AACKUL rathman_s_Page_088.QC.jpg
90cc3f205422afa4ecc0e10fc7c6c526
d85be20bd58eee7dfffc89d218571ac3b44f7de4
24387 F20110109_AACKVA rathman_s_Page_071thm.jpg
9dcea4ee0f14c0c5e33601cbf4b8abd9
ca25104290702a0df3cf8f71ab7e047b2674e64b
5262 F20110109_AACJQW rathman_s_Page_010.pro
171c889402132f976b0a09fe61fc87d7
9ffef8243471a12dc258012c31ba56b9b623fe85
81595 F20110109_AACKTY rathman_s_Page_040.QC.jpg
7aaf1eb886a05f1a85f6b638c26c6bdd
2a79f7ec49c493e6e7c9648963b78529b26b9d54
111930 F20110109_AACJRK rathman_s_Page_081.jp2
8611f3db893132e94bfa941d35804218
230b51d8579ec763c159d25d579972299b4e5db8
19843 F20110109_AACKUM rathman_s_Page_001.QC.jpg
f27a8493e4137f2be659355ddf978089
3e583ec633012c99e5ee62ac2e83256d94ca98ff
47623 F20110109_AACKVB rathman_s_Page_058.QC.jpg
b0960b33ac229dd30610cce933a9f7b8
634e7b8909ed687a50baf584252d16853fbb01d7
1917 F20110109_AACJQX rathman_s_Page_093.txt
ac7719811f394bc428fc8842cf5753df
30460c090cdfe3874028dd171714879012f998c6
25818 F20110109_AACKTZ rathman_s_Page_069thm.jpg
ee605fd81b879af684b1d83dea14490f
bc001222979a651c7928ecaf756681bfb30e8bfb
23508 F20110109_AACJRL rathman_s_Page_085thm.jpg
c40fee4e04548cf2a603ac1e2bfd2a65
69fc6968e02f1b68947eb61c2824a4e4e9fd0233
23571 F20110109_AACKUN rathman_s_Page_115thm.jpg
fcbb343ac9b521cce22214d95b817771
326e4e670642d8a5b5324bbd597d8448275f1846
26031 F20110109_AACKVC rathman_s_Page_063thm.jpg
6edf5dbc994fd9a9a1cf728ab42d54ce
426251211ab1f753d5478ceac3770da12942ddae
23799 F20110109_AACKUO rathman_s_Page_117thm.jpg
2dbd835bddba5c8ca090156202a2b9ce
d0b561f60c7c63eca8a233ec799efedd972c8135
1927 F20110109_AACJSA rathman_s_Page_077.txt
403c6b04fe646a2359a83d17c30671d9
a02c13aa6316e33913d0ade8479642accde21c16
74338 F20110109_AACJRM rathman_s_Page_070.QC.jpg
14886f4f023e7ba3927ae7031b3deda1
eeab01ef07de603bc61213def00f34c0502ec068
52574 F20110109_AACKVD rathman_s_Page_094.QC.jpg
8a7189aba5df469f0279a8525946d965
fa6a504e8b7e3d83483ba5c2c8886eb436e661ac
58395 F20110109_AACKUP rathman_s_Page_031.QC.jpg
4eaf4c83e013a2df17c222f6b99f0fc8
34cbd7c0f72d1fffeffd73cc76d924b24fb8bde5
3887 F20110109_AACJQY rathman_s_Page_109thm.jpg
6d37237bcc5b9eb2e12985907f53f495
59287811420ef7d2324995050cdddd52a38f764d
152404 F20110109_AACJSB rathman_s_Page_068.jpg
03aa632afb7fb31679f7f0a230c190ff
034773cb3c1ea034ae32e8b49a1ae6f4a17d552e
226056 F20110109_AACJRN rathman_s_Page_022.jpg
11cbe632397e1d0a67d3d937f19809c6
428eb39ee3342a40dc5c220806e9c330f0be2bd6
80933 F20110109_AACKVE rathman_s_Page_064.QC.jpg
4cffc6fa3cdb4c7fe82a0d278b8f8b5d
fe057d21fce77844a246a62cbaa88d1a200193da
83952 F20110109_AACKUQ rathman_s_Page_029.QC.jpg
232bb79d3ca1fc07f54aaf7f8127aeee
de39e46b640205926333d69a0c09c3dbe33c89b2
78922 F20110109_AACJQZ rathman_s_Page_069.QC.jpg
df6967e23c9afd8996d6957f8f505908
707083061ff88b9c1d58474c4fe07f9d1a826f4c
25271604 F20110109_AACJSC rathman_s_Page_061.tif
e62cb9e5df7b124fde01020b56103ace
e380639321f10eaf532d6c509120c5928f51e00d
1243 F20110109_AACJRO rathman_s_Page_045.txt
4b4ba568abddff4cb27ac8112c070933
13f6eb2258715e4de8b3f87b6994ab7b1d29690d
44347 F20110109_AACKVF rathman_s_Page_046thm.jpg
0ca2662d548815950a16a7f819e3b9eb
a93b506478237d691a59a7213e27f971c4dcf75b
26006 F20110109_AACKUR rathman_s_Page_112thm.jpg
499d7a6114a251c5e82cf32553cf1d2a
85035ca337f835ee25987435a03d61964217068f
64809 F20110109_AACJSD rathman_s_Page_013.QC.jpg
b4c964c7e69be105200768e6da374a66
45157613a1050de982a1895583d7822a7096369b
53947 F20110109_AACJRP rathman_s_Page_018.pro
fb6621d0bae14518fded5d423aa15b64
e08324c9dbc1139fecb998c62eff3648ff690816
24398 F20110109_AACKVG rathman_s_Page_036thm.jpg
f0e91e1139c0d8fbd1112e0a2253494a
a72618dd7382c33f1dc6839baaa63537d13a1a78
76540 F20110109_AACKUS rathman_s_Page_096.QC.jpg
f7c720a855f3a1bc1e708b399e5b89d9
d75d5385b08242ac0a5b881c698f785ab50cf5cb
F20110109_AACJSE rathman_s_Page_022.tif
8caa51d788d4a179f0b103a8cc3f7c9b
6acffd8b0c5e1c81c5533f384c18b108a0a88276
38394 F20110109_AACJRQ rathman_s_Page_011.pro
07d633f0a6815642a23898fe0d1d7805
3e9677a77237aa4daeb8ef8fa218e818d48a0f8d
25161 F20110109_AACKVH rathman_s_Page_040thm.jpg
b6141f0e4e0d69c615f875899fb5c48f
7668cc09d2dd844977d4fdb417183159d54ba646
96637 F20110109_AACKUT rathman_s_Page_106.QC.jpg
df2749372fdd6f393cc396766a9a8534
476c74a02358107e0f820a60e15b7c41b0d3880e
53337 F20110109_AACJSF rathman_s_Page_001.jpg
4b7d3f194d02eb94c5b08b5caf117c58
a086021b6498e6468612a106784a709d76a33ff0
83087 F20110109_AACJRR rathman_s_Page_082.QC.jpg
c7aa17f2abac89dfd24161a36ccd315b
1c4585e9c570dd18e8a3cffaed46c21c5454d6ce
88869 F20110109_AACKVI rathman_s_Page_077.QC.jpg
14c321c59f834559e6b13872c7428ed6
9c1ab9173736067e72637f19c5de32802949be2c
20502 F20110109_AACKUU rathman_s_Page_110thm.jpg
61cfa51d9c3d91002819fcd2adc22bf5
b2749c68168ba3992b7034049a11bf2be04f5c1c
77887 F20110109_AACJSG rathman_s_Page_068.jp2
faac8827dc11d10cd553a039503b9309
dbfb0f11f78483bc461f09787ad36e85bf5222d7
83684 F20110109_AACJRS rathman_s_Page_124.jpg
817f4c64f9c09fdf68f594a55d4604f8
589ee87c16e97e5260c43a40826552c168b74427
55763 F20110109_AACKVJ rathman_s_Page_068.QC.jpg
c636f3f0a515d4600c9f33688b887f3a
4268e95f77e9a1518233ec8f9f30fb4146848d47
25281 F20110109_AACKUV rathman_s_Page_023thm.jpg
5e42143a0aabfd1882b4117fc52a84cf
e5e4817200dd402d6c88d8465f67aa5f63205dbb
31610 F20110109_AACJSH rathman_s_Page_094.pro
65a6f9b4c1b6bd57cf28b47578cc72f3
3a3ccf477844563713c2fa3eee3be1846e0f24df
109077 F20110109_AACJRT rathman_s_Page_023.jp2
e954184a45913ac2ee1e475e942196be
5250ce999f4807b872f154dd1602fb2947040de1
11079 F20110109_AACKVK rathman_s_Page_123.QC.jpg
5423bba425a5b3d55540142b4b9abdfa
3fc6fcd14a06b2967fe49a18d2fd55172fb3ed58
50217 F20110109_AACKUW rathman_s_Page_048thm.jpg
d4786d1b3e5b07a9e6926ed94721b145
f375752c6a77181c1a6f62b108661fe01a258d58
56608 F20110109_AACJSI rathman_s_Page_014.QC.jpg
bb07a93baf5a5f337d000d952887266d
6fca14e93f7fed07ec354dc642486cd8fb1819c5
66426 F20110109_AACJRU rathman_s_Page_065.jp2
bfebdfe067f3b87e1ac63929c29703b3
94fe1b4d16e5f0b6b51327d65a444d48e278ba88
84490 F20110109_AACKVL rathman_s_Page_021.QC.jpg
db38fc486ddea7e022228df6464ad88f
be764903a48bcec73b68feb022c7dbd574e7e74d
83118 F20110109_AACKUX rathman_s_Page_053.QC.jpg
4b367d795f5c8caaf8f7139bc8a7d2ac
3df037800478744d84baba90dd7b930814f2b2d2
92760 F20110109_AACJSJ rathman_s_Page_072.jp2
8a079b1f5b4b21b3966a7d937546b379
32a63a6e86669ab6cab702275a6ca81077ac2bcf
92774 F20110109_AACJRV rathman_s_Page_034.jp2
7fd971b83d63da67f9073010235368f2
e08cae4d1aac465eb6f0bde0be214542a61507cc
19734 F20110109_AACKWA rathman_s_Page_051thm.jpg
6e41a9b76582b868853680081a97aa3b
2912f440173c3848d15109a09a3b72296b05343f
18924 F20110109_AACKVM rathman_s_Page_011thm.jpg
e3b90058a27bafa077344bfb8e43b6bf
d4ddfc11ab4d48e04b0c02a1ffad0fbd0e9e8061
71924 F20110109_AACKUY rathman_s_Page_095.QC.jpg
89f0957f3c4a913d65d31969464ab473
8ced1892b28569e6957ba85a70a2c7ac7f9ce3b2
F20110109_AACJSK rathman_s_Page_091.tif
f6620dc999bf90d20ac85bba6442d6ab
4fd5b8477e0084a9f20a61f41a6989ee4cc68e0d
1204 F20110109_AACJRW rathman_s_Page_065.txt
7c924e2140ee09f6ff649a16443f6379
05511579548d9ff833f3b58f1828657f897bdcef
60752 F20110109_AACKWB rathman_s_Page_083.QC.jpg
fa7670a1ed17aad868f575619810695d
74cbc23300f9e9af64d80d17b8a4499caa82cc80
75973 F20110109_AACKVN rathman_s_Page_049.QC.jpg
2fee25a27bbf1b2b77826adc79a3f866
97c784b4ed224d3d8b112b7b0e2e07cd27b4851c
7019 F20110109_AACKUZ rathman_s_Page_001thm.jpg
42b2361694e0665e795eff1a8f4a4d19
7c937c4ef11bb0d6a7ed5ad68dbf8bb4211e4c0e
F20110109_AACJSL rathman_s_Page_078.tif
96da62bef5ab138ec593b3dcd9589f25
74673004f5843f071f1cc254c29cfb611c9b3783
1642 F20110109_AACJRX rathman_s_Page_066.txt
35d3bf6e83b9a63391367c90bd4b2b27
c5ebb0f7d405253954d277738fde752d49360b32
11978 F20110109_AACKWC rathman_s_Page_008thm.jpg
9745d40d802204add27158a03bcb6c4f
f7fe1b883651fbb574d906c252fd1be848f91c08
8221 F20110109_AACKVO rathman_s_Page_109.QC.jpg
7a39ff248a621f3a828000bdd238c7df
979e372d5c6c57338d1556427e201ddb2c2f4400
50808 F20110109_AACJTA rathman_s_Page_036.pro
7b0d16cde63e0a60842490655b32dc69
de64e6f4bbfc02bcb9e44a5a644807268f7ba2a3
2588 F20110109_AACJSM rathman_s_Page_120.txt
87967098e6222036182e45a07ee138fc
21ccc10582a7945f0865b3dc3ff0d63c186aedd8
1736 F20110109_AACJRY rathman_s_Page_035.txt
c35613b80a8fb108288ba71a36f64040
e022ade599333d56618317410d048e086e845825
69960 F20110109_AACKWD rathman_s_Page_054.QC.jpg
4069d88402004b2b07bc9cdc46fcc1e5
5f5af2a303be495211332a6e45b875bedc4c839f
45558 F20110109_AACKVP rathman_s_Page_075thm.jpg
9317983d8556513ee41cddbb22ec33c1
c60a04b29de9eed10c19c04850344a688a3467d5
51327 F20110109_AACJTB rathman_s_Page_100.pro
e96259b2f5c2098f3edd048f2e760cfc
7efa68e6f8cc8d5b7ae863097598a65031024a0b
2422 F20110109_AACJSN rathman_s_Page_014.txt
3c0940f36119064d05591dad08f18da0
2cf440abe08742679901c359f3492116a3484618
25324 F20110109_AACKWE rathman_s_Page_037thm.jpg
c1411c158d5f4721f46d80c4081ca2a5
802f98f00a1d9ae1c8abf6ac52f0fddc1df1d5f1
46508 F20110109_AACKVQ rathman_s_Page_106thm.jpg
e853ddfa83eab5f7e6468d00ad907339
7c216be3d29ed08047e43ad271a9443e3e8e3346
195162 F20110109_AACJTC rathman_s_Page_057.jpg
48a6e9f180867687556776cb8f279394
9df397c8ff1dc5085522095ed37c6abb18e211a1
21724 F20110109_AACJSO rathman_s_Page_034thm.jpg
80d93d0f4630db539a476882d5ae9c40
99368abf72161a96aab13e5ac7c66c5fb6175964
23552 F20110109_AACJRZ rathman_s_Page_015thm.jpg
ab996ec4f24da984228b925dfd0eba29
5adc70c3c4f28db501ade3b225b84cf22965fcdc
24062 F20110109_AACKWF rathman_s_Page_054thm.jpg
0cad8dd148a637db571d3dbc087614fb
745b7ab2f3a2440f3c345c635b20107d8a0aacd1
80987 F20110109_AACKVR rathman_s_Page_081.QC.jpg
1b4009eb21dce945def7296a472b006a
929441f4dabc1d94bd0f38f4147ff801b18167bc
F20110109_AACJTD rathman_s_Page_016.tif
bdcc9b34f293dd1d604af70a051b8984
dabb7d3234df8590c63a2dab3581ac785f3883db
53439 F20110109_AACJSP rathman_s_Page_029.pro
03e8da7dd05bd69b34dde74d75a04a78
4076dacc0bfe5bd2e0112cac2119fad206609864
25043 F20110109_AACKWG rathman_s_Page_104thm.jpg
3669f3ee8cf1a47c86a0c3de35021677
b8224a17f74d21b571502c04c7430e6be60ca5b5
51317 F20110109_AACKVS rathman_s_Page_006thm.jpg
cc7e942b839d27645507c1370295c9ac
f9f8ab3c33ee94e006c93365823d3c646939df47
170966 F20110109_AACJTE rathman_s_Page_012.jpg
149e0f2c48113b00a805c3e9af93425b
0e2626241c53d9862f491cb4a95223127a3351df
1051947 F20110109_AACJSQ rathman_s_Page_048.jp2
5eb0e0868ff3fdc4070b12bffc4036be
32a6d551f484edbb96b0f2d6c69034692cef8438
18952 F20110109_AACKWH rathman_s_Page_031thm.jpg
22181e1efdaa19763ad8c53369f2646e
3d1443dd5daf1fcc12fb18943f654ef3ce7abf66
24777 F20110109_AACKVT rathman_s_Page_086thm.jpg
94eca7c7acf4783427d7bb2ef61b5abf
cedcc46e3f3081c35cdea5630b70f4a2e11724b7
9060 F20110109_AACJTF rathman_s_Page_101.QC.jpg
f152e32742e6863f293d3bfa65712248
1d7cd7efe84cfdaaa4475d8c7f282f4269144511
23487 F20110109_AACJSR rathman_s_Page_032thm.jpg
1c3e56de816fa7748bf3e5d3506a9481
08b73ca532629e3f9dc7c65611e91419e37b0fb9
43022 F20110109_AACKWI rathman_s_Page_090.QC.jpg
5feed07664ef633741de6e184b703a2b
09607dadb15cc352c9ff3713dc1d89f53ca1b3e5
83267 F20110109_AACKVU rathman_s_Page_026.QC.jpg
1bb7fb6165b176dc225f3ed41d35f377
91b0c39e55b89330759f342e33b6c6f4058ba033
169 F20110109_AACJTG rathman_s_Page_101.txt
9effe86067f28fbcbf83bb68e8fa2bf5
0790f0ff62e91983d6cc8e81471a28df007acaa5
23932 F20110109_AACJSS rathman_s_Page_096thm.jpg
12eb58aaea75fef2eb773b4cb580aecb
5d3779e9843ed97d3798c39685310ca2d4d0e6d6
35931 F20110109_AACKWJ rathman_s_Page_007thm.jpg
a56255724f002f8e0554c4be2d4e530e
35f73d879302c5cb40b333d4e16c04721ab95b98
72928 F20110109_AACKVV rathman_s_Page_055.QC.jpg
4cab112b9f9c2ebf299a4dd769b144f3
fe64aa093b483c293551f17b2e69ecc05d8b71fb
2034 F20110109_AACJST rathman_s_Page_082.txt
bdd3a8f291d4d27a9ed92c71ef6c6337
ae4a8d4b5a4d841bc447b83c2458ef376c3ff84d
26079 F20110109_AACJTH rathman_s_Page_018thm.jpg
252cdc9a5956824c2af90a1aeb890c5b
42ba7c1475f604d0d65e8a4d4633fcc6423bb0a3
187029 F20110109_AACKWK UFE0001103_00001.xml FULL
96b3ee88e6f9c27e638c04d39e7a0e33
1fcbd7a413229d5155fc36ca451545b11a79e79c
81751 F20110109_AACKVW rathman_s_Page_022.QC.jpg
6981adb320011545e7516d3a2435f735
03bd5ef1423843af82d0477406ffe8503a96153e
13077 F20110109_AACJSU rathman_s_Page_089.QC.jpg
789ccc4ebace166bcedf725699a773eb
e76a1c395d6e002a492030e958a361d151ece846
264215 F20110109_AACJTI rathman_s_Page_116.jpg
7d6e1239e40ecc3f421da56de3d0c9c6
57e2cfd8b4d2a3c0ee94f4b55295968cc56b716b
6166 F20110109_AACKWL rathman_s_Page_002.QC.jpg
516738023ce61687cc949cae0e7f55e6
b73ab5fb558d320597197a29d663c327ff808ddf
47366 F20110109_AACKVX rathman_s_Page_097thm.jpg
7a5dd1abaa738c01ac2756a72738a5ab
f2e6c0896c6f44de371e9292bb8a55197e5a490c
220241 F20110109_AACJSV rathman_s_Page_026.jpg
6f368bdbf0b8b14d9cef6e5bb02e5afe
c159adfce30fdfe934e59ceadacfa6d9eed87735
76339 F20110109_AACJTJ rathman_s_Page_050.QC.jpg
e72204d69a3f45916c25e3af418b8c79
51f1c58e4c7cfea5e0c0cb7904670735d1513399
21542 F20110109_AACKXA rathman_s_Page_052thm.jpg
39a11e48b5e68b162f79851cebf397e5
e739ffc218d78f47134a5be0d663c2f895d5d97e
64299 F20110109_AACKWM rathman_s_Page_012.QC.jpg
85ada9b2a7346e7dc38818d034b78491
2fc0927232c438f5910cda39071d163fc823a640
86154 F20110109_AACKVY rathman_s_Page_112.QC.jpg
06373b264d3e433d2e71459f10107280
2156715cc53ef2213009c363f4162c121f8c6503
16081 F20110109_AACJSW rathman_s_Page_065thm.jpg
40adcd6509ac636321b4004a9939167b
5e4e4c57cc4955677e4ad647f0e218e6cc927c38
221491 F20110109_AACJTK rathman_s_Page_104.jpg
bb42bc942bd1d4f849fd92ad055db0a7
b47e66e129f71e47e3188dafd94db23f8e7067a4
17190 F20110109_AACKXB rathman_s_Page_058thm.jpg
9d3c128f446339dcffbb3af79db28382
3550d3199e074d4afbb61846b3913be0bbd7c1c9
23949 F20110109_AACKWN rathman_s_Page_020thm.jpg
befa95741057a77881dda69ef791e968
960c8923d237c715be305bfa4925d5459d3dd5b4
101735 F20110109_AACKVZ rathman_s_Page_060.QC.jpg
092937219c720be1996f9264fc1d1b9a
0c2b557b78f02c38f16b14989e27b0b645d2c938
1792 F20110109_AACJSX rathman_s_Page_061.txt
8fc08d9460056f0abb2d3faa3482a270
e207770121cf97447d79afcd39dfd461da7ea34e
2119 F20110109_AACJTL rathman_s_Page_032.txt
33a64b7fbc702f6661e23430a99c7967
f43ea07fd0bc12920697a8c546d6ecb085ba838e
86142 F20110109_AACKXC rathman_s_Page_061.QC.jpg
97e1b8a9fc444f345879c339fd4334ec
c6ace01012eaa7f248bf162982bafb5a34064762
78949 F20110109_AACKWO rathman_s_Page_023.QC.jpg
ad9bdfd74cb1b629cb9bb0e66e34024d
d835d0230b5a344e185f806867a0d136b6e7c610
43208 F20110109_AACJSY rathman_s_Page_014.pro
c6e6917bd67f8694321891bed3803a15
46358b311c7de11073831f11064bcd17281021a2
48117 F20110109_AACJUA rathman_s_Page_060thm.jpg
e5a63a86a4cf1bc8a8297ad1da7c31a6
5f67f9cc9ebf616cb2c818297b83eac3274e9980
F20110109_AACJTM rathman_s_Page_119.tif
579b3f5c0e68ea77bcb2d9cf275926d5
6a3d43f1324092d9a7ffc63a3bfeeac63ffbb780
25794 F20110109_AACKXD rathman_s_Page_062thm.jpg
e1ae4a7abd84924968d4f1638cb52173
fde7d891af58275a23fac0dad288f9c0be942c9a
84452 F20110109_AACKWP rathman_s_Page_027.QC.jpg
cd3ec66c1d7a5be9e8ffac055c406ff3
4f314f73c0309fe9d32daf4084a97172b3a01c0d
100729 F20110109_AACJSZ rathman_s_Page_070.jp2
c1f5be951dd77d8706ecda86f66b8fff
b15611ecc57da6c4f8a08aa71580fb4e882ee652
48616 F20110109_AACJUB rathman_s_Page_065.QC.jpg
e0f5f2fc983ac0735976c3a4ef88155e
836e1b3bf470e7c964741114674999a3a67a7596
80239 F20110109_AACJTN rathman_s_Page_117.QC.jpg
bbee9fb04ff9996f0e443b8aab18a8b2
b080a255f459f2b68a1944895fd5a355f38e80fb
25314 F20110109_AACKXE rathman_s_Page_067thm.jpg
bd054e2e3313147396579b2bf44cdbbd
b15e1315b114b847de7925807751297ece14cb20
73690 F20110109_AACKWQ rathman_s_Page_030.QC.jpg
713c9c4e6dcac39583ac2c728b470309
36ddeb545d74dad37798f153ec055aac84d99092
24353 F20110109_AACJUC rathman_s_Page_111thm.jpg
db631c155746ceb07ccd69014a52d1fd
eaf52cb30982de0c58603826a429251f92328db1
2042 F20110109_AACJTO rathman_s_Page_064.txt
9a5190e85a58d16f9d652d6e1d2271e3
c92d79177f29b1eb3c487bef2059c393e7230c91
24165 F20110109_AACKXF rathman_s_Page_070thm.jpg
e7be88c2bf7146c236d17ff84761762c
0a9cd2477c1e98f03fe7f743c52725eb49881fa7
77474 F20110109_AACKWR rathman_s_Page_032.QC.jpg
c88c5e9def93e57a25567632f95e10ce
71ddb9b2e065a2767bcc970479df80148a94529f
F20110109_AACJUD rathman_s_Page_041.tif
5a1ec749c2a09da23b61c1770796e8a1
2ca6133cdc041a25b6e442a9bbfa6497d4863eaa
111149 F20110109_AACJTP rathman_s_Page_024.jp2
d4d15da63aafb9a58928b88539ad82ba
5c0f6407e351b6491eb799d98c54e0e12eb8ca08
74813 F20110109_AACKXG rathman_s_Page_071.QC.jpg
c514dbfe960ff25c5c3289a0d8c412d2
534155d1f21dd5e1a0112d1c1d2f7afe3d21ccb1
68006 F20110109_AACKWS rathman_s_Page_034.QC.jpg
c447a73b75c80716cdc049c1110a1f13
4cc854a121a843ddc6f3c40fa922a11e32fe9cdb
F20110109_AACJUE rathman_s_Page_084.tif
bcbcf3c48fc06d908276164eb1256f63
eaf9a0136bd7058ee37a8b6b1e9db258ac75db21
21148 F20110109_AACJTQ rathman_s_Page_012thm.jpg
c8bef71b0163fb2ea052ba9bddfe79c6
5a0909f6e1d84626076672208e5833a0a4e93602
85531 F20110109_AACKXH rathman_s_Page_073.QC.jpg
4adc0dd631c98aaa41c4b2c5edbe35c9
1f81e87e7048910ff1a779c8b41494458c842c94
81202 F20110109_AACKWT rathman_s_Page_038.QC.jpg
0108ee9bc6f9da2fc37f66edcef4a335
55369ba0583681757df3007da3c6393e9becfb14
191367 F20110109_AACKAA rathman_s_Page_095.jpg
7ba3f6b987ca125c11a144b16ad1317d
fe37f4f4ec1d6a4877525d2d8a96cb63a4aacc7d
2634 F20110109_AACJUF rathman_s_Page_111.txt
f7ecf4704015c1f5ca3f510fea2c5d12
c7f694e9245401e17362abc47a9d0adfb1d14806
F20110109_AACJTR rathman_s_Page_069.tif
022c5bef96f8f9fde40863986c9430e6
da91653bc11a5daa06c068f2a73043085bb9a6b1
85621 F20110109_AACKXI rathman_s_Page_075.QC.jpg
e249cb5be7f19c9d7dfd322d543e8e12
08c48a7d5e2ecdeca713bb8fb0fe5d6d4e4450f7
26467 F20110109_AACKWU rathman_s_Page_038thm.jpg
d779b4f6809050bd3cb08edd4153d465
01aac67c1df329e5813c63bafe217d17e0da8988
202217 F20110109_AACKAB rathman_s_Page_096.jpg
d80b03c1ae6d9b9b4145f26c77a99e8a
e7a531fb985aa7980a25f2e944eeb828cefd07d8
14512 F20110109_AACJUG rathman_s_Page_090thm.jpg
bca0a4c723f305490812e6907eb8d918
31dbd9347652522cf1fa36f8ae8e94d28844080a
2020 F20110109_AACJTS rathman_s_Page_100.txt
e1c9f9958e15719ec62e0f58bdcfbc7e
fe5c3c9430b2474248ade30402a41a7836838370
47858 F20110109_AACKXJ rathman_s_Page_076thm.jpg
0ac58a118f40578e9735ecab75e024a6
e01a02238c2a62e2da7b3af44149c565d7077cda
24695 F20110109_AACKWV rathman_s_Page_041thm.jpg
3d1ea5ee7b294d5e9ef83034d409a9d8
af365e46db0d78fd862ad4ec45dff6adaac0d88a
221922 F20110109_AACKAC rathman_s_Page_097.jpg
68ebd34e16e85ec8ea56c94443afb339
d3881b1f72fa7f3b9da0940d9691ee9a2db39142
F20110109_AACJUH rathman_s_Page_110.tif
b779a0889cabbeb098667c767343a83c
e876d34a69c3d968f480a9270650038110eb7a97
131297 F20110109_AACJTT rathman_s_Page_111.jp2
ccf1338d76a55fc90ba0d716ca71477a
abb8aa6bea0834829a408eb5ad40da061bf7175b
84562 F20110109_AACKXK rathman_s_Page_078.QC.jpg
1248370b7c95a135186f56a70f68dde4
0de48b78a0ebafb52d2af0da2adfa42f85d7028d
18665 F20110109_AACKWW rathman_s_Page_042thm.jpg
77936980139c336604d0a4f22dd62c12
859e4d1c0329dd75bfa96ee6523ce0c114dffcf9
210823 F20110109_AACKAD rathman_s_Page_098.jpg
82db1507ac46ab351210f3c16ff1a53a
cfc6238edc813c36b9b0a96cf437a960121cf962
18440 F20110109_AACJUI rathman_s_Page_083thm.jpg
96f810cf8852975b1c0afadfe44c3248
4f8c9d49e9db35d83d920b3758f3483b11e5850b
36777 F20110109_AACJTU rathman_s_Page_042.pro
8e0ceffa52302559beed122c61dbb92d
cfbd9583ae412f57f2013530654f83ce08145ace
26144 F20110109_AACKXL rathman_s_Page_082thm.jpg
bfdf456d2e7d7840a6abd46e2ce3a571
e1907ea20f85ff7ff2cdd8e2f4de3f7519199ead
46400 F20110109_AACKWX rathman_s_Page_045.QC.jpg
f20e51761e30dde57dfbed8334e7d3d0
934bf3d6fab073574d53b382b77efe2faa122956
215968 F20110109_AACKAE rathman_s_Page_100.jpg
f1b4259b54bc0ea1f521d96ca12ed044
c339b5307bc5bb87d857b9e9731bbb5707fb2f8e
1514 F20110109_AACJUJ rathman_s_Page_042.txt
47458b5ea651c6f4a929377587e9982f
fb8b7dbfeb6e6ceaa0ad3547e3e827f72900a5a4
F20110109_AACJTV rathman_s_Page_008.tif
2f58374f213a457cc56f81fb11f7783d
df41585c5ebc2c59598153c5b49b986b08df7f1b
22573 F20110109_AACKXM rathman_s_Page_087thm.jpg
bfa0166c981e562a5aa11c12b29ac6ff
5a7065af8b9f33edf4786dd215a920ffba0ae159
82934 F20110109_AACKWY rathman_s_Page_046.QC.jpg
b70522ca196805871092b024ba861d34
d2a22c44870bc6eefb6b5d409b99a2d1e9894427
25433 F20110109_AACJUK rathman_s_Page_098thm.jpg
b3694140ddb257c5e0777d835b1f5a2a
b6e6a47c4ec00fdfc300c280e85a1a6443c3772f
213635 F20110109_AACJTW rathman_s_Page_063.jpg
f89fc107afe870b1e85e02db4f0c5e62
15abe16f817477b902a11798bd7f6cf9416e3ffa
21384 F20110109_AACKAF rathman_s_Page_101.jpg
295ee6fedc50ed02a9f7aa27fc442d4f
8748f73bbc6fab887baa5aef621de8af86705ae0
43642 F20110109_AACKXN rathman_s_Page_088thm.jpg
1003274b026f06821a4c6421b5e5d048
9d798a3c0a726f595818d4106c8cfaa0e29ce703
24313 F20110109_AACKWZ rathman_s_Page_049thm.jpg
8eea53b2ceaa86c803cad50fcc879ce8
bcd2b6153597dce8234a4da5ba5f1447e829cc21
21010 F20110109_AACJUL rathman_s_Page_045.pro
5c991229b94533ad114b444f20e3d38b
4650ebe30d9ac3090cd120d0f08a2754681928a9
F20110109_AACJTX rathman_s_Page_021.txt
f5c3075a598e6699a0399d71879dfc74
9cda8b20d7e4454086c2d1417ed299ae955e86be
157064 F20110109_AACKAG rathman_s_Page_102.jpg
e7d94ff93f49cf28d0db6a28ae87c9b6
ebcfb1c18cbc8fb46f911cd1e3b42d6c8fe16e10
81541 F20110109_AACKXO rathman_s_Page_104.QC.jpg
9c708937f52ee9e66e108345071a9f33
2e837d5a774a0666135316ee4f0889a950e89b70
16885 F20110109_AACJVA rathman_s_Page_090.pro
0502c6a589a2af30738e1e2d28b1b9de
6f141c32f4b23cdf4c7747683f15b8b6bb7b666a
77911 F20110109_AACJUM rathman_s_Page_102.jp2
1c14a76c1020fa760a225fe562d33f88
de5d3163c4abc2016e49bbaa6349788bffb1606a
194903 F20110109_AACJTY rathman_s_Page_110.jpg
c7c4f1add96c71ccc5e21bfbbfedeebe
d01b378dab473831e1199bedec1b47c76d4ced80
85265 F20110109_AACKXP rathman_s_Page_108.QC.jpg
a473a3508dfa36be0c0cf9c2e38bb815
9d611ec84cf08668d9d158a8b7d09bdfaefc0b71
108692 F20110109_AACJVB rathman_s_Page_004.QC.jpg
969a278b02c1a49f05fc017e0afc92ca
6377ad99f1ad9ca0c5945a7155d098a153ba8842
F20110109_AACJUN rathman_s_Page_057.txt
0bc9dd27a83fc90867e99bb9f6f8c891
c6c75d5afe619f14e8d94dbb0e1fcf08fbeb8254
257631 F20110109_AACJTZ rathman_s_Page_114.jpg
166cb34bc8ab2187dad6b730a016b3fd
0fe1a303fb5e69159cdb05eb0038a8cb2e33c781
167146 F20110109_AACKAH rathman_s_Page_103.jpg
3f67340158b287cd9a52e9df93fc40b1
a82791fd313c51d5c5ee73b7d09bf1c94cfaffe5
83037 F20110109_AACKXQ rathman_s_Page_113.QC.jpg
2c44ffad381a147ebb7b18d40ed7df44
4523fd6f00ca24cd642d7232d21737a2e1008f82
18951 F20110109_AACJVC rathman_s_Page_014thm.jpg
8572318781b7953d18796ef888fb5ef0
5c663324fde9f62387131579bb75ecf439da1b2f
43571 F20110109_AACJUO rathman_s_Page_091.pro
d650b35af86f6fecadf810d0758645b5
57624c46e56dfb6373bfd14867e2818c328d420e
202670 F20110109_AACKAI rathman_s_Page_105.jpg
84f834dae44d5c7fddf7b4d7728472ae
4902915e5576be67b057a433ef9135b6d609e622
24582 F20110109_AACKXR rathman_s_Page_113thm.jpg
cab7a59d1d16202bd3d045b152efc4d3
cad4741bd9708840e5c7696628183a2c60407bb6
1911 F20110109_AACJVD rathman_s_Page_074.txt
3752e0f9d50f89a4c0d82788124ea3c7
463862041bdfdd9161fe3e1186f3e5711f44d314
68335 F20110109_AACJUP rathman_s_Page_058.jp2
682b85bf32e132d1b158a56265f87b06
8f4e4e748c1575a5755a6ff7962f46bf05caaec1
217048 F20110109_AACKAJ rathman_s_Page_106.jpg
619e472e2f3657f9c81edf67d782b420
1c8b168ad39300ca69b5122badca58058528910d
86304 F20110109_AACKXS rathman_s_Page_114.QC.jpg
91182f3f950cc80b7050d34b7307eefd
6baa3f49bc2dc7bcb9f5d181177026f52e08e53d
4033 F20110109_AACJVE rathman_s_Page_101thm.jpg
f890fa715690e860972ac869c1ebdb4a
d1f07a669de6e92f2ddea595a383f06e2b57e665
26394 F20110109_AACJUQ rathman_s_Page_029thm.jpg
b06843fe16b13b310a7466a4692ff7e3
74ebb3db60f29b7409d41b108cbfef1662b8c75d
159405 F20110109_AACKAK rathman_s_Page_107.jpg
817d49b0258f421a7678b28085b8fb95
a5ade4ff5124037854b2f41148ab776d823fe0db
78239 F20110109_AACKXT rathman_s_Page_115.QC.jpg
9138fc82ecbdf62824ad295a77756d4b
405ae045c590943fe445fa65d89a908bf0a7cb13
193082 F20110109_AACJVF rathman_s_Page_028.jpg
192c19c131d3131978e361a8ba821177
d4e6b0cb2e28e32591c904c5632c66c5f4e61756
133 F20110109_AACJUR rathman_s_Page_002.txt
7117a1f8c1fbb77fca1665e69cb54159
a7aca949870b07a22303c65f07a368333c48b99e
1051957 F20110109_AACKBA rathman_s_Page_004.jp2
71f72ec982fad6a23222885a70239ced
6b808430053d60521d11fff3d53ec4689deba352
193453 F20110109_AACKAL rathman_s_Page_108.jpg
5ba44031a4fc599367a7040f0d950950
7caeaeb68b9a961a29ac4913c4783e70c576b680
83607 F20110109_AACKXU rathman_s_Page_116.QC.jpg
de47e7cbc0ab2f6e83d17e441381cf83
95300c4ecb6b75a85cce0d0a83524b5c69e735ea
79454 F20110109_AACJVG rathman_s_Page_014.jp2
76a6dc787deb2e19b4491d767b9f2c55
e4e04a43ba380ceddd6119ee3d04da2388c597a2
54071 F20110109_AACJUS rathman_s_Page_021.pro
a45469b755e9d6bd742b31f66d5b0235
f819f280efba5f7bbccf0fdc1e11c829f0e6763e
1051962 F20110109_AACKBB rathman_s_Page_005.jp2
17db822a28f9083cafc5b913814b1dac
e5997ed8f33b06632b15c97779047309d7e9bb5b
19941 F20110109_AACKAM rathman_s_Page_109.jpg
012750920047f07eef5349fb7d08eb66
d98994b2915dd1b2543bbb409ca5f655d78081c8
24106 F20110109_AACKXV rathman_s_Page_116thm.jpg
dabbe4ddf847b4aec99ebd16e559df7c
9a635ca3cf830e5a81c971f60160126a9cf58ad0
99819 F20110109_AACJVH rathman_s_Page_005.pro
d95be95956e799cbbe299d0a39c89849
cbf7f47775669b91478c36891f9c976d7d98a99e
40886 F20110109_AACJUT rathman_s_Page_052.pro
283edd3f37e9dd25b9d9cfb1a15969b7
ebf25411d40221f2184b7191555065ac1ea8af48
799420 F20110109_AACKBC rathman_s_Page_007.jp2
f0f4c3eb5dbda28165622d2c33c7fb0b
d019c790e9cf8053dfaf8076a3dadcc652b1e8c3
277540 F20110109_AACKAN rathman_s_Page_111.jpg
aea760f6dcf50c9ca27cd6a35fbcbe64
57e3fe07eb6ff2fd1ea8461d996f1a75d1836515
10426 F20110109_AACKXW rathman_s_Page_124thm.jpg
afda7d4a7d3fe1546aee67c029c066bc
4bbe9e0dc01249eed30924b5227624270bcff70d
F20110109_AACJVI rathman_s_Page_047.tif
6cd60bba6328c5da18671eb2f56f0eeb
49fa1ec637a6377a56aa85c2e47a5e929ee4e10d
1570 F20110109_AACJUU rathman_s_Page_079.txt
9a95b881a77c308e475e0de1ae50cc81
6f3b4c36f2bca019e5013d8ec5603b0a2ad785fb
41240 F20110109_AACKBD rathman_s_Page_008.jp2
3434c647d086e1fa3e9eefb8aa73ef9c
e8fb7ff19f02627687d8693c2adf4bdc8d0cc096
266738 F20110109_AACKAO rathman_s_Page_112.jpg
fc67cfb826e9a41218f4be8d69e2b85b
09fbba091a3dc28d30b599ec9a4b45a191bbd043
187698 F20110109_AACJVJ rathman_s_Page_099.jpg
3e63af58560a067fd21ce981356922e1
26033f3805de94209651f945c9398892ca584bc8
1782 F20110109_AACJUV rathman_s_Page_087.txt
d2a05a60c58393bf6e60c361f10761bd
e22bac7b9e64e6c71cc8f0ae6ad482e079b98597
48614 F20110109_AACKBE rathman_s_Page_009.jp2
728d29d789b9aac20e7eb65674de6d84
f9d66c8c7142d5c27e46d4859f838fdb6fe14e0a
262940 F20110109_AACKAP rathman_s_Page_113.jpg
d688be3e4b07a71947bc19786f573e3b
2e4cbf92c371f0f6b93a36a0293e6c979f60039d
2574 F20110109_AACJVK rathman_s_Page_119.txt
8e8e690b59bd2539b39a4f78ca269198
2a6efcf9704e89e1d388602a36644ad13559f9e3
25550 F20110109_AACJUW rathman_s_Page_021thm.jpg
c9f4d219715a3f7d4d8c2e9dfac0e7cc
a325a5d3fa5478d47a9e34f8bc3f2fe3dabea58d
13080 F20110109_AACKBF rathman_s_Page_010.jp2
6affdf72edef0fc54e1defe07db61871
71cd5317f4f433281492e440cf6e89754e9f9149
249848 F20110109_AACKAQ rathman_s_Page_115.jpg
3c21cf24436c320d2d5eac5253e31285
cec90a38b8763b9fb741337f5714ae1da0f49d0b
3412 F20110109_AACJVL rathman_s_Page_004.txt
07ffe703038b76cb00ea7635571bdcca
65839344369e3b28d4123a30f7d955bc6d239971
47067 F20110109_AACJUX rathman_s_Page_041.pro
c4274f16138cf7992f8f812a850337c6
4435f146a691833e28d9385228e2d17cb5ef33ad
85418 F20110109_AACKBG rathman_s_Page_011.jp2
afbbe2c91bb682c93784f4a4e43df6fc
3c070513d0156213d19555d07b6983e2cc826b99
261914 F20110109_AACKAR rathman_s_Page_117.jpg
cca613fd9f505aae01878f7e0aa232bc
e6fc0d6c9a16e048c7ec661c6d2b6c18a7760e6c
33381 F20110109_AACJVM rathman_s_Page_046.pro
e927e65f43b788d0cff31d78a8c3afd7
35c52b706d07f6667acbf33a334b2c18f2f7ac6c
F20110109_AACJUY rathman_s_Page_123.tif
6534758d809105cf5f336473c16325cb
9131501b009d66c3e8e160bed73c05b23f1ecb21
90571 F20110109_AACKBH rathman_s_Page_012.jp2
9d675fb299a448a6a456ec1e3dcfa416
9a8e56cc0c1bff063e4deaf3c829269acd1200cd
64097 F20110109_AACJWA rathman_s_Page_003.QC.jpg
43ea62e0bdda18d5b46d592701ab55b5
6dd7fdf709a0d987223d3369c40ed0379f19f6a3
274521 F20110109_AACKAS rathman_s_Page_118.jpg
2024a0e2a94503e19ed4d1299623dda3
0bfd0b45d42c7544902711b19db0dea3c0748b18
52052 F20110109_AACJVN rathman_s_Page_064.pro
d63a3d41d3deb9d478940f6c9114d8cb
1c6ddb346f66f8777ff2a766339fda4b4af3f6dc
F20110109_AACJUZ rathman_s_Page_027.tif
bbfd814b3b1217f01e956f3e1c80a78c
f783bb199f491f800623e1a95c1e1de36419715f
60179 F20110109_AACJWB rathman_s_Page_114.pro
4b54ddd9b060c52366bf7253e9e8034e
e47a974a88f61dafc3d35574cea092095058515b
271368 F20110109_AACKAT rathman_s_Page_119.jpg
be857fe191b7c3d3ca9b8f37fdbd4221
d3df1037aac4a42c5fa22c5e6bd3fd770b17219a
48689 F20110109_AACJVO rathman_s_Page_093.pro
6bfc4d0bcdb2dc9fd129c4a98e80a3a7
50632b75d758a0b0381fd91430147adf1c2e7a87
87944 F20110109_AACKBI rathman_s_Page_013.jp2
da4da95ce22ba2c4c6d6028b5503d587
89feb00177e56c6772338c610f9150652636fc99
43836 F20110109_AACJWC rathman_s_Page_078thm.jpg
02b57fbc4c43992b43c45a417b68a9ca
03cc6d76fe66aecd2a8b32f287763d2a1f4a5fa5
264052 F20110109_AACKAU rathman_s_Page_121.jpg
2dd5cc6137c9e51c914a7b4834b109ec
be5fb87e125102265bb31fc1b76234e0bad335de
76149 F20110109_AACJVP rathman_s_Page_093.QC.jpg
8c17a11172fc904214f290478df6a961
1d37592c4139608d5c36fee79fcbbad9a4e8ce2d
104961 F20110109_AACKBJ rathman_s_Page_015.jp2
29c2d8c3544f7648fe4ab9e3df613fb2
db1cc1f4ec0c8f1d3349ed9dd8bc1ad4e2db7937
35622 F20110109_AACJWD rathman_s_Page_103.pro
13d26ea4ed470ac79091492e8b3a37f9
d2ee1e6302cec02eeeb77e958a60c58b008ae5ed
256967 F20110109_AACKAV rathman_s_Page_122.jpg
a05c936ca022e2aa9d48eeafeb7f3723
f068998be3f9b319078cfe386daa588d6a4dea2f
20297 F20110109_AACJVQ rathman_s_Page_068thm.jpg
a693e82a1370165dbe345e2641f48c0c
21f7fa13f0053a5bda9d93207cf71dbb4ef20a08
75816 F20110109_AACKBK rathman_s_Page_016.jp2
afbc740ea4912c894d0a17bf5f33315f
05eef92cbc30d3386b951937d952669d05b45037
F20110109_AACJWE rathman_s_Page_067.txt
b5de308bca7f5d62bc8628e3f6311351
b951229324ee11b90284e66f3f562a838deace15
30873 F20110109_AACKAW rathman_s_Page_123.jpg
69446000649633f8883d40f4883e4f44
c6fed4c1c37c574eed2a089ee17d14d6eb6b1745
57534 F20110109_AACJVR rathman_s_Page_122.pro
c473e3380523925b1dedf0545ed585cc
99f9782cef512a628e2cf64352dbf45f37e18c8a
111606 F20110109_AACKCA rathman_s_Page_036.jp2
e671c463babc502ab81b737c07024a93
613ed42d0ce2b3d479887fc66e832e7f0c1a8220
100567 F20110109_AACKBL rathman_s_Page_017.jp2
a094e70a6da5a6ee7a3c7d9dda65f13e
9ed0c27915a8d1684a37526af2c7433337b686e9
2108 F20110109_AACJWF rathman_s_Page_060.txt
c76e8da1e269ff47edbcdf8e3770ebd6
b4040b71648fe41113a1dcd86ac6502aa66f6daa
23568 F20110109_AACKAX rathman_s_Page_001.jp2
620bd5b662d8b20d1b3b41660a220d11
ccd68f7abb29ccdd17186c41fb6b68c0c3cfd1b9
79968 F20110109_AACJVS rathman_s_Page_041.QC.jpg
b4b3ee82813cc03d2f4172152a987553
ed6b61cd1831142dbcd73fbfad021ad84737b476
108363 F20110109_AACKCB rathman_s_Page_037.jp2
327700a4f65ccecdc3ac1569d3cade4e
aeca682016d1d05479548d1a91420a7f7a9c15c7
113923 F20110109_AACKBM rathman_s_Page_018.jp2
e72816d2a89a4c5e516f3c11ad7a2534
eafc897f2fe1e402620736c5e708c76efd1c67d4
80260 F20110109_AACJWG rathman_s_Page_086.QC.jpg
39cf9875e115de901d0264efca2cec09
dfd99e0947a72fd90cbae37c46895b430c12cf58
7481 F20110109_AACKAY rathman_s_Page_002.jp2
9cd3859e27cf590d3b35a7ee66e17f47
3b7fa904f12fd61b8dacc1dc9e6a5ccddc9dbaf3
F20110109_AACJVT rathman_s_Page_089thm.jpg
1b97470aa943f356962f190751b207c0
b5f855ad9647ec66718031dc9731ccdee2a40d78
110418 F20110109_AACKCC rathman_s_Page_038.jp2
0316428ee0108f55191e5b18bea6eb59
91405858998a3c1564ff26d00e3ce100cd609df7
108762 F20110109_AACKBN rathman_s_Page_019.jp2
1ae63121225099a44dbeaa8200031129
1f48f79ceb508c82ea4fe2383ef6e16ed3539736
F20110109_AACJWH rathman_s_Page_120.tif
42542fc392662b84f3a5007af7053441
5697544d56bd84b3fe74324871ed8437d6706ba8
87419 F20110109_AACKAZ rathman_s_Page_003.jp2
eb0f8cc9cb0eab164fa77fd094b6ab55
c98e44eee74366a6efa9198480956a4161014122
26224 F20110109_AACJVU rathman_s_Page_103thm.jpg
2a50172046ff9bba27bbfe1a47f6b3a7
7d856b4f2167fb91defbdcd46b689c3c1d64a6c5
106837 F20110109_AACKCD rathman_s_Page_039.jp2
ad1079f64ac742655f742d4416b2f4e0
48c05e66c939e081d3245c4ec60a73c4d1504b0e
105814 F20110109_AACKBO rathman_s_Page_020.jp2
28d5c209bcf5cd9bd07b3d42fcf6a2ae
cb79e3b6896a29009fbd449eacbf97e99b2a451d
F20110109_AACJWI rathman_s_Page_092.tif
bc7b33acfc91486439af94cb1346e17b
5ce857a44efbcaee589ac8203c08fbd8554a069b
4627 F20110109_AACJVV rathman_s_Page_010thm.jpg
5e9b016a7ef2cfa969bf19ac9ff5c5ee
5f1d502c010ca33e0e3e1b0eac25dc0a4f74fc03
109512 F20110109_AACKCE rathman_s_Page_040.jp2
db0044dbf6f1f0465ef790ff8d7a19e4
7070091f285075cb7abf4e34556d2afccea8aa28
112961 F20110109_AACKBP rathman_s_Page_021.jp2
f82175740ca440c67c70c5b52befc6e0
7961e7ae3a249165cdfb34e272f2db0cf16316aa
55054 F20110109_AACJWJ rathman_s_Page_115.pro
ba5ca8abc7d3214982d87193a20340fe
b68e5a601feeaa077dfb04ce32dab18836ae1b60
25775 F20110109_AACJVW rathman_s_Page_024thm.jpg
327d5d4eace032921a8cbd479934a4b4
614fb61afdaf4bd4dc6fb066c1babfb78eba9532
105505 F20110109_AACKCF rathman_s_Page_041.jp2
3565aa49a8b07aaadaf3868ac7287c73
0c0464eabb9d441363ebf006b88e5aa93ea963ee
116132 F20110109_AACKBQ rathman_s_Page_022.jp2
1d38ca3951f1205bdfda22d5023f2adb
da813579a57078994065e9127140df89a5b436cc
269923 F20110109_AACJWK rathman_s_Page_120.jpg
5fd122a09dcc4f27c23f7f15eded5062
42e8161db945cb64236f38bd62cc20ceeae7ad7e
F20110109_AACJVX rathman_s_Page_083.tif
79bd43fb32dc89bdcebe347bf17469fd
832170f397a2430911f0e3f93f81db6fca82041f
82414 F20110109_AACKCG rathman_s_Page_042.jp2
ef264dbd5383dcacda1ee2a054e0e806
2c9a5adc07f87d4c3c8e2c6b094824d5c548bc03
110982 F20110109_AACKBR rathman_s_Page_025.jp2
f955b39fd05c323b999d9448d142f896
158c340f24dcc367e62ce7f0058078a8fd2ad114
81339 F20110109_AACJWL rathman_s_Page_062.QC.jpg
39262b1e0bfd8c2a78218f91dbe92e40
db64a7dc01bd2e8990698354482a576ff9bf219d
79275 F20110109_AACJVY rathman_s_Page_020.QC.jpg
f18cce584ebfb6618edc708829582d7e
9b433f476261b3a8f893e9367003a54857cf3870
81711 F20110109_AACKCH rathman_s_Page_043.jp2
872ac83454591582640681386fd42c63
35906853ea6540d1273608be1e9f8485c9992f21
127156 F20110109_AACJXA rathman_s_Page_007.jpg
a0fa6404b6fc843d14c63a92a6407558
f3f165ba71765ba7a4c63dca58a48363d84fdf2e
113940 F20110109_AACKBS rathman_s_Page_026.jp2
e95e962b7ebc4b8fb6cdeeef4848db0d
7d34fe9181f1b7590355271f86bac7f8094c325e
F20110109_AACJWM rathman_s_Page_024.tif
ee28cb530f73f19c26076a2ca2320e71
96ccda653484573cfc198d42342f9773b6204f00
F20110109_AACJVZ rathman_s_Page_006.tif
e6e3060599c00033eeb68f3d23142199
ac2c7b586b543e27badfbefc96b60c57d382834a
904482 F20110109_AACKCI rathman_s_Page_044.jp2
9303f5b9681f25e6706db5f1158f11a9
b72651d0ad4fd086b4efdd5528f7296bd5c9a134
83768 F20110109_AACJXB rathman_s_Page_008.jpg
e1c9551959e989bd94bba81ebd5db36d
55097806bfb016826e8f612821aa6b7f15035d0d
115258 F20110109_AACKBT rathman_s_Page_027.jp2
7a8e5ad71eba858090ace7051a79f69b
76fa16938d36a30eb3c3152c3e227075c653b116
51680 F20110109_AACJWN rathman_s_Page_082.pro
36bc0383f5711264a9a108f0122547db
967bf9fcda439e0e9c95ced1fea06f46e862c9dc
97718 F20110109_AACJXC rathman_s_Page_009.jpg
08f851975fe7a04ee0e0cc566946081c
54dcd7b55aab3aa2f1c08811959300fa1671c9f0
100331 F20110109_AACKBU rathman_s_Page_028.jp2
3c271f0a1ff291e22c848ddd6303f083
ad139af1175c02df5b444500a7c26ca05f630217
4025 F20110109_AACJWO rathman_s_Page_123thm.jpg
c9ab31b35ec1c4a336c1cf35c48f11e9
13d81d326790508b1a650bbb6ad9bbfbe3289b8a
522412 F20110109_AACKCJ rathman_s_Page_045.jp2
e26dfa8ec093685c886e431b5cd63903
352fa94b193f5a885cfda1bddc4054a55e7f5dbb
169514 F20110109_AACJXD rathman_s_Page_011.jpg
201ac1955cb25a6634d77e085031be2e
6848447d053b50e3b5a35a939f277eca1f4fc01e
103383 F20110109_AACKBV rathman_s_Page_030.jp2
f7aa30482202a3e746c8d9ae62e5d5ac
1556995490a8eb8d129e5319d18fd8afc24d0383
2002 F20110109_AACJWP rathman_s_Page_036.txt
e6f7e55f669a914f42fa2b8efc6876e1
3d8ad02aea073ac5d715ed8e60612f8d6ed60155
799410 F20110109_AACKCK rathman_s_Page_046.jp2
39d41d485f2c4aa6c605c0aaa207f590
abd1d29c4ad8c5728622bd5aa880c922209497ef
171942 F20110109_AACJXE rathman_s_Page_013.jpg
72b9c9d3344311c7eada3e8393ae1789
f69f1e0d65b93ad4bab4bf7bb2053923919fea03
82691 F20110109_AACKBW rathman_s_Page_031.jp2
0f4025aab38f146d4782401d6df0ac07
24d65e6db100257c53fd931b9155706cdd676d11
63614 F20110109_AACJWQ rathman_s_Page_066.QC.jpg
c1744ff9048b185a1fbcf8703eca11e5
90ab738c9a7449cdf7ee2b3025670cc80c41e1b8
821530 F20110109_AACKCL rathman_s_Page_047.jp2
a73fa4622857ab70b1415675460a30ae
9b156b4130099c1be36ce43d8c31181d18341c42
151430 F20110109_AACJXF rathman_s_Page_014.jpg
1229b41b02e8ec5eccf76aed825b51bf
91a8b1ac67ebdf52d41a613431058896905f0bff
112831 F20110109_AACKBX rathman_s_Page_032.jp2
2a69ec9d359cfe4ff8e87644e6398542
97a744774e3d85762eab670171b1e96e41a079ab
1051963 F20110109_AACJWR rathman_s_Page_006.jp2
0938dc54ca580da2af726abccf56caa0
608ac939498d6ebb8bd34939cc8bfe9b13900546
112400 F20110109_AACKDA rathman_s_Page_064.jp2
137ffeadc31cb2239df50cae0f5d5023
d961f4152611383e0a367ece49beed752d2d5480
106538 F20110109_AACKCM rathman_s_Page_049.jp2
e9d55f1de573e7ac97dac30e9d844684
4462a3fdb5a97b716b5e756316e7a564448d4014
205951 F20110109_AACJXG rathman_s_Page_015.jpg
c709640393676d76b06ded37ed23de74
d9a99058be35722d7c1ac505655086dff5f2731d
18352 F20110109_AACKBY rathman_s_Page_033.jp2
9744f7ee18297cf1ca25728e70b44800
e1c245e6041c5b96cf415dae91050cc87bc31008
144173 F20110109_AACJWS UFE0001103_00001.mets
8cb03724bca2708ced757018631bbc0e
3decf5812a0626116b64bb8dd0e2c609df50b468
88365 F20110109_AACKDB rathman_s_Page_066.jp2
ea5674a9e646bcf438f3b1686eb3a2f6
38fd1aa751ebf5bbb1ade9603ec8e18710b877e0
104293 F20110109_AACKCN rathman_s_Page_050.jp2
a71255383bf26bbc27b205487ac2b514
d20de257b7f84842d9fe30df465f3d93609b209d
149058 F20110109_AACJXH rathman_s_Page_016.jpg
791c8006d2f5ef775ab9a845b5e82cd5
871a50f09f6740cd5d9e676081d6a0348b985829
97263 F20110109_AACKBZ rathman_s_Page_035.jp2
f4613fe86c68bece84f79cdb4138dd6e
27b4d02c3284fa5375aa7c669df44a507644b63f
109498 F20110109_AACKDC rathman_s_Page_067.jp2
d9eee11da8531bd9d8a4c4c05372f08b
62458e3efebc9dd8c29add062f3ac2d373de1c30
87632 F20110109_AACKCO rathman_s_Page_051.jp2
eca9b8d3270ffbfea8733cf23a19b6e4
9a3d1ef5b94f52f693b8cf56bf759e4c406129d5
197714 F20110109_AACJXI rathman_s_Page_017.jpg
a27e5ebd6666ef72c09bcca7f127255a
d5ec2c641893ddbc9b9d691dec9bc4f7f51f6343
108611 F20110109_AACKDD rathman_s_Page_069.jp2
f486eee5eb00b069cbdbe41445248be0
76b56526dd0eaafb60a7d648826197a7995d6532
94033 F20110109_AACKCP rathman_s_Page_052.jp2
7f9b166fb59aa0f4384630dec81d2dd3
afd519c047eebdf21eec28587839293021d7afda
223168 F20110109_AACJXJ rathman_s_Page_018.jpg
c971a36dbfb1ae3845f9eda3a86dc9fd
58b2cdc9d07c92c69aa4f948a390d0466cd37cf4
18589 F20110109_AACJWV rathman_s_Page_002.jpg
6a5ac0d9521ee90c7430f61584c9eb09
10bbadc832a191724e67a1c5f8585d88937d3b92
104650 F20110109_AACKDE rathman_s_Page_071.jp2
a3fdf1f1728ecff8e070dd489598403b
9e94a7ec235563159c6f71b5e93fec6ad925ecd4
110781 F20110109_AACKCQ rathman_s_Page_053.jp2
c5d92492ae43bd091e4b1a70193827ca
39c1f50203899ceb3d92c44970f1703157140d4e
212914 F20110109_AACJXK rathman_s_Page_019.jpg
050e6a9fe626169c2e5173cba2550daf
b32e635bb206fc2f71659038610c6126cdb0c761
168994 F20110109_AACJWW rathman_s_Page_003.jpg
c03ea010c96eaad4cf0bced4e3b78543
f5b3100fd5be1f78d0efc06ad17290aafac25b0b
819625 F20110109_AACKDF rathman_s_Page_073.jp2
85a0ee1e60a215bc40fc335dae316cf2
7d981d2fba430527a45c3303ff5ba1114b4f814a
101373 F20110109_AACKCR rathman_s_Page_054.jp2
eba634a2f08ce700130afc8a81a6827e
05fa30cdf6c851831d3193c0879ae20acc18d081
210958 F20110109_AACJXL rathman_s_Page_020.jpg
b3b8f4bdd0530cc3486ce11da8943382
80aa063f419c4e0646a40934a0a7691fabe50d65
303597 F20110109_AACJWX rathman_s_Page_004.jpg
636ef482676cba7aae50fe6034bbb3d0
86189105fab1792865d9dc01ca83f0ef4f6c29ac
878495 F20110109_AACKDG rathman_s_Page_074.jp2
6f9d3cc66376234e90de8069cfdc14ce
7c1b954f084c9f90cfd3a91f3a561ed155897433
209886 F20110109_AACJYA rathman_s_Page_039.jpg
75ba5e99bda9de8c14a6971759a1ef0a
db3d4bf24b4576c0f3cc6604e3d9aa1f30e29318
97367 F20110109_AACKCS rathman_s_Page_055.jp2
56cfa0c4ddf64dda68551b4394362e12
3965cbee78d88ebdb30a3107ac6bcf7161102d74
219873 F20110109_AACJXM rathman_s_Page_021.jpg
8afa4a68870966717a50c1ccd8f01da5
de170618f8a071924c7ab0888ec0ce2721a0bf69
387659 F20110109_AACJWY rathman_s_Page_005.jpg
2fb37e9eda494411b2e2d24959fe2359
3b73fbc44878a117cf7385af330e5f020d367297
817734 F20110109_AACKDH rathman_s_Page_075.jp2
86ca7adb22f9a6d88e50da295bfc04aa
0597e1b9d28d5ea70f5b5c3cd1123a395a745935
218971 F20110109_AACJYB rathman_s_Page_040.jpg
7376062c8f90fa94f0f456f520aa4a21
380683f2c45905d8561c9c8c465278ebba92a077
113969 F20110109_AACKCT rathman_s_Page_056.jp2
a0593f1d8b9c1dc454b46d1227ae961c
ebad7bd4858d40b9612784fb8ae7e2df5d6b9ff8
213171 F20110109_AACJXN rathman_s_Page_023.jpg
b8dc19d6bcd5a4c277d56c5f82d80f69
f7808dd1b3242414c9fb6247098c5974c44ebf22
336903 F20110109_AACJWZ rathman_s_Page_006.jpg
84ee2dbffb10e09dbaf9f18d1dfd34c2
716de1eb64902882c7f6dd9e16f8f8dc6a4eb6cb
973289 F20110109_AACKDI rathman_s_Page_076.jp2
cb6d387c9082cb96fcf44f0c729163e3
64127787e34bb785ffdcdaef62d53b3689a9fc06
206552 F20110109_AACJYC rathman_s_Page_041.jpg
04b1defdff6d3e93adc6e43380b769f9
f594239ce0afad2ed0c4715d10de16fac987b8c4
98702 F20110109_AACKCU rathman_s_Page_057.jp2
ceade61592560abac37f8d98fa520184
c3a5ae55d89ffa8744e5387a7ad21b5efccaa575
220045 F20110109_AACJXO rathman_s_Page_024.jpg
3b765981c722f11c857c49cce1089675
a618c3310f8626a6a74b291d2466aeae76416b27
903341 F20110109_AACKDJ rathman_s_Page_077.jp2
007937daa6032fe862b43bc045fff807
adec666e40bc529bebf81055e567810e96d6e6b0
158335 F20110109_AACJYD rathman_s_Page_042.jpg
f594d17a95fad193726e540f3376bee9
182e2e3046bdac1d430b2fdb5bbe036a2fdbdded
961354 F20110109_AACKCV rathman_s_Page_059.jp2
57692dec933cda32385e5970359295a6
f92d8ab784349bc1ad18b92d9214e7679b7d99cc
215739 F20110109_AACJXP rathman_s_Page_025.jpg
931e48f51ceda01f71790a3c9163f19a
42ad79566118f1b5ae8364990b378c4ab51b4299
1051977 F20110109_AACKCW rathman_s_Page_060.jp2
7b3bc058bbe3c0f81fe0b16800445998
41362d44bd2d9fd25bfce4b3b42c5578d3796888
229634 F20110109_AACJXQ rathman_s_Page_029.jpg
aea5c8d9a3be19614c2acdfb6ea0c186
619e1d0be910eb1f7b14275566a384b2173dcf04
906322 F20110109_AACKDK rathman_s_Page_078.jp2
3f9096ecc4902124166d0c47aeaf04e6
5e2ba056f719fd8a00f1dd75ed81980153ea6b3d
163894 F20110109_AACJYE rathman_s_Page_043.jpg
8a65bdeede3b23eb222648dd2b8e992a
a9f3bb787461897aa1db169c821031a14f7c289b
866831 F20110109_AACKCX rathman_s_Page_061.jp2
466cc5378d4ae18e5f7883783a3ef622
be8ed64b5c63124126f1c63ae17ea22612baf09b
200384 F20110109_AACJXR rathman_s_Page_030.jpg
59e6a2f932ffa20c2f318a94df08ab39
5dcbb6adf4467ae9d166e21cc5bbc0d4333cf693
98667 F20110109_AACKEA rathman_s_Page_095.jp2
41dbd613183faa81d7388d29be2e0ee4
ed0ebd2b6797b45e6dead3bd75221f4ba331a898
825047 F20110109_AACKDL rathman_s_Page_079.jp2
ff189eec9a5e37b4a8874283f1247f70
0a7bd6b25638689f3b512baf91464bb878a73488
183375 F20110109_AACJYF rathman_s_Page_044.jpg
cd5204e5a5c38cf9032a73725677c2ca
673e85b561e1e08114e8bcd308554c32907a5187
113223 F20110109_AACKCY rathman_s_Page_062.jp2
9ee5cbfdc5090a4eb1e9ab618b2c5006
849514da3fadaf136d524c52e6165bcb3432cf02
160772 F20110109_AACJXS rathman_s_Page_031.jpg
b0c781b3af0978fc57a11fefaa27e831
1c44cd8bfb1da3b98bdbe138f9c9e089462cf986
105500 F20110109_AACKEB rathman_s_Page_096.jp2
d34ad64103d1aa61f12ddb3a22e6e5ba
fd9c45629696c69e09375c40bc65059028dbd02f
103594 F20110109_AACKDM rathman_s_Page_080.jp2
61974e57a1e97bf2c97e8bf8636dbf0a
7ee720bbfbbce3fc50f717d485cdbcb970adeb75
111794 F20110109_AACJYG rathman_s_Page_045.jpg
7155dc51fa7b7a18ca73a853c3ab55c9
129abbd64b3f3a46ee0df34d32d3ea699cd4a753
111049 F20110109_AACKCZ rathman_s_Page_063.jp2
eb1cf2fa18dcb022a1f106cc747e0bc3
b5caaa9d586444aa6a7967b5083efcc7cf7cdc7f
224550 F20110109_AACJXT rathman_s_Page_032.jpg
80befe73547e5b2e109cf0ff376b071f
29ea2a71587a35c8fafb0d6fbffafe3811efed55
1044533 F20110109_AACKEC rathman_s_Page_097.jp2
93a69ad5b26a33feb790af2724d45062
91dc2c868d266b3067972f46c9fce946bdf95ebb
112466 F20110109_AACKDN rathman_s_Page_082.jp2
621aa5f1db67d767d344e99919890995
8d68e4def3c29f4296440e4b7589738816bac029
184096 F20110109_AACJYH rathman_s_Page_046.jpg
762c6c92007dc2c7ebfc98fddc53fb73
b9c35d5d5f804adcfdc043aa39e3bdc5aaf45542
35495 F20110109_AACJXU rathman_s_Page_033.jpg
e0ca9a2f7c0e9a98d658577c28732233
73280075428b5ec85014d64205e7986fd032541c
111071 F20110109_AACKED rathman_s_Page_098.jp2
adfbef3101e96a0d632f0a45b50da655
f5b8c9aeb38eb78d816ba4caec94ac7abeb935c1
83626 F20110109_AACKDO rathman_s_Page_083.jp2
231c6be8200cd1d90cc42bac4a97e519
1f41f820d121b40e5c4a148a15cbee4f5d49ab0d
174378 F20110109_AACJYI rathman_s_Page_047.jpg
5e61803e9db20c84c694a44d606d01de
3fc016d9412b02d2685027d37ca5ca86ce6a006c
190156 F20110109_AACJXV rathman_s_Page_034.jpg
cf6e2dc012b3d5211d5d8cf4d173c7c1
832bab66e6cc7ca5a0c907e0a75325439ac22991
959427 F20110109_AACKEE rathman_s_Page_099.jp2
c2a1e9dbb98a2851215df5bcb92e4b76
7bfdcdcf85602a6748b24c0f9cb40c7668c2a2ec
96558 F20110109_AACKDP rathman_s_Page_084.jp2
d993bc80312a2f955c1b7b7ea0f3f948
075a3e39cff74516f5656b0c20df0e91d79e4fe0
232148 F20110109_AACJYJ rathman_s_Page_048.jpg
33513ebf20451272a7c92adf19babd08
c3b0bfc34ca2a63266c4f69b7a8a76d0ead30b31
187969 F20110109_AACJXW rathman_s_Page_035.jpg
4cb33e4d73e2bcea41da234230b17810
e33efc5e8f4bea94abfab22728ce9320d3b1a00c
111411 F20110109_AACKEF rathman_s_Page_100.jp2
340a15ad54c0799816ba531aeb6487f6
8aafc5c8a68b3ef77a1f3c0b12c853142155e762
99632 F20110109_AACKDQ rathman_s_Page_085.jp2
b5c713def30da0545f303c553d1b9cb7
17509392d12419cc71109f76a6a19a44add9ea18
206710 F20110109_AACJYK rathman_s_Page_049.jpg
a2bcadf601bf63144deae89f80820a1a
2e1fdf72a317de0e51ac17d3a12a04a1cc9484c0
218114 F20110109_AACJXX rathman_s_Page_036.jpg
8889ef2b278910179b66a4be808226a3
3c51b2452581d638407cfd9d94e404c66fe1525f
806372 F20110109_AACKEG rathman_s_Page_103.jp2
e654fc278f4c129177faeec3b462b130
d140d63d15ced2090e5a70e3ef77410f95754bc9
212029 F20110109_AACJZA rathman_s_Page_067.jpg
92d9eb846f16a579bcae917ef3bf60da
cda6a7bc099836046811cc5dda782f9c1c5c0061
106739 F20110109_AACKDR rathman_s_Page_086.jp2
44a4424d6a58d6ea74066d97e107b559
042c347e8dcbfee9225dac37329768b90367130b
204418 F20110109_AACJYL rathman_s_Page_050.jpg
eab0fb4b0602ec1028cd88e1cd3abd38
ee2db5e8852aa0fafdaa763b4f0cd20f73412dae
210508 F20110109_AACJXY rathman_s_Page_037.jpg
cdc4ea3acd6679cc90f0eef660fb567e
d4394f950f50fcbe967ab3c75424369f5015e0dd
110534 F20110109_AACKEH rathman_s_Page_104.jp2
82362604a0aaa1cca2ee3e4f44a11c5b
cdb2ae460d5acc28c18d15e4071358883e123954
97444 F20110109_AACKDS rathman_s_Page_087.jp2
72d35b32bdaedbd76b25559cd7e3ed74
cc45fa3aab5206f068fb86364c8f3bdf6f91f1af
169004 F20110109_AACJYM rathman_s_Page_051.jpg
f19a11d37ec26dfef6cdbc8ce72035a0
222b1f1ccdd0100a44354d0c68c5f605cc7b1623
216639 F20110109_AACJXZ rathman_s_Page_038.jpg
4b9df69a2fd35877644255d5eac919ba
40409930e7de28930331b5ee03e762a763cbb433
960672 F20110109_AACKEI rathman_s_Page_105.jp2
dbe1d003ea294429fa1bcc6f700a043e
8338d5ea459265a351c8ef07c99db14b3ba11511
214784 F20110109_AACJZB rathman_s_Page_069.jpg
c531ceeafe4b545b12e36d72e707a7bb
4debd81fa3e607c0cf8464cb6e568272f080dad7
970137 F20110109_AACKDT rathman_s_Page_088.jp2
bea1551ab94b11344de8759e2cb2d84f
bd3533d6fee2737f01bc7ee069afa07277d978ba
191063 F20110109_AACJYN rathman_s_Page_052.jpg
9cc2764da2769aced477064fe79f7a5a
039f7d2daed80d2e419a688d8455e82773492bb8
1026943 F20110109_AACKEJ rathman_s_Page_106.jp2
81981d153818bfa3a4597d17ac980119
934755c5ba2b44e752e54170f8c351f6e70c247c
202095 F20110109_AACJZC rathman_s_Page_070.jpg
b30dcc2c21ec528638ce4d024906be34
3398f40936ec8f2ada61a84c1f92a34924f797c6
19192 F20110109_AACKDU rathman_s_Page_089.jp2
bae16a0f2970a092f2abbe9710216e86
4700b1da894572595dfe2ce1581e76dee59b374d
212989 F20110109_AACJYO rathman_s_Page_053.jpg
33670e1ceae4dac884add19c393d5b92
9c3cc92988bd455651208b8555cff5ca8a86de8f
669147 F20110109_AACKEK rathman_s_Page_107.jp2
439a1141ade531d68888a79ac9d19dc7
f4e0654e4554b8da1d827660d46d31cf8d08f3ac
205561 F20110109_AACJZD rathman_s_Page_071.jpg
a00240bb6390acbb7e99ed8c0c4956ff
58684240e3b3a480c8d80b37dabd8b7704460561
55197 F20110109_AACKDV rathman_s_Page_090.jp2
5b7223de3660a2db52cf37ae41f98008
bcf36ee29ae6dae244d9b37fdbcab72228bdbcba
196843 F20110109_AACJYP rathman_s_Page_054.jpg
eae6e5f70f1681c1368606b824e84ff2
28e715a1bf63aee525e485b7f676625b33354bc9
180388 F20110109_AACJZE rathman_s_Page_072.jpg
d78d1863a9b60e1097cbbcd4aebb62af
6e16338297ced9053c8bd6b91c6bb23d91fce26c
95725 F20110109_AACKDW rathman_s_Page_091.jp2
5a97f02d16d9ea64d1faf45d88a2fb81
f4cffbd80a586ad1ef8a19b66276d8376741c0ef
194390 F20110109_AACJYQ rathman_s_Page_055.jpg
5b66be2fb02e37ff95a58606cf0cfc27
c61422f59d667451c334d1c8a18ee40f3fb60b87
42213 F20110109_AACKFA rathman_s_Page_124.jp2
5a95f462a71244e038b40672ca881dd8
f57573de5107efedd7cfdf73e6161df215dd5c99
874669 F20110109_AACKEL rathman_s_Page_108.jp2
11c8031f637b06cd7c9ae7755a4a38df
42b9f00416c4c7855e4f7001afc9d480d07e0458
183203 F20110109_AACJZF rathman_s_Page_073.jpg
9a57726d5bfb659bab1466dbdf9e984b
ecc826bb136dff3f2e6d5aa55b29b142a0c45eab
733218 F20110109_AACKDX rathman_s_Page_092.jp2
cd76d64d7919e3b0c7dea5493c0e2389
a72731d90c7d3cbc741cb76fe3b28016098d85f0
225068 F20110109_AACJYR rathman_s_Page_056.jpg
9b9638db563df2c39a767f517f01b0e0
18c44a37cdcc8c41a016f55fb3a02689648e3cd5
F20110109_AACKFB rathman_s_Page_001.tif
d0a672b848e049c382b72a2170750c0b
89034669bb8853d9b605bcd0756ec5c2ede01de9
9668 F20110109_AACKEM rathman_s_Page_109.jp2
2b9ca886b6e64dbf54d82a6149748820
44fa70710efe17b02e6209ea8e8042cda7bebe6e
195017 F20110109_AACJZG rathman_s_Page_074.jpg
4386fd38fa3c23b4498880b9b4f89034
dc64291664c73452b7a039e944b319de61a1bf1a
104914 F20110109_AACKDY rathman_s_Page_093.jp2
374ea3b4f8ee622a48f871a0b5c3da80
b65e160f0a04d7658b32779829a4abaebba9c6e6
135989 F20110109_AACJYS rathman_s_Page_058.jpg
762f3339cf048e272d6b46fa4ee57023
22a6a393887a74ae181312b14db8970bfc91e9cb
101404 F20110109_AACKEN rathman_s_Page_110.jp2
a610819e93bacf504b42832ed87c4364
ed24b4b8535832f29f5cc30d24cfc7042ee5e1a9
182383 F20110109_AACJZH rathman_s_Page_075.jpg
2f0a4c82fdce3d6f9e7d1cd26c7cb51c
d2bf3110e0629e1e64ab8f2fcd9ca85fc634ca3a
71365 F20110109_AACKDZ rathman_s_Page_094.jp2
2759415256087924a46ee0feab7f6508
0a50ed9bd0d0bcf3379df0f0a2ce07821d85ade4
196267 F20110109_AACJYT rathman_s_Page_059.jpg
139cac4fb2ce9fb4e92211ca8504fa0a
c6e25777cc4d773dfa825e8f3b435946784688d4
F20110109_AACKFC rathman_s_Page_002.tif
e0a08c996243d1272bfa21c2421b157d
0f4c83d91f5aa8f23ff142f9cb6fae018f010fb6
127996 F20110109_AACKEO rathman_s_Page_112.jp2
c18c51285b2f7849b3e29792bcff9d81
625a826c4ca8bc342cf02d5b15da408490403650
219226 F20110109_AACJZI rathman_s_Page_076.jpg
921550c723fbdbc7ecf9df4d41d7c84c
8d6279f4a96cc6ecf529f982b75f321d06f166fb
228387 F20110109_AACJYU rathman_s_Page_060.jpg
0aa2ba6c4cf7f5815e437bf3b6f30d3b
67d177d4cffbd126ab97695927097d8b3af160d6
F20110109_AACKFD rathman_s_Page_003.tif
92ce0a374f1c991d54acfc4a088b1bfd
3bcfb28e02e993f087ebb7e4d8deb0d2e29c6b61
122509 F20110109_AACKEP rathman_s_Page_113.jp2
6370c6e4ab35275e8a4211a54c94e25f
4ae7c6ffd1148d3f8d747ce0a11ce787299102e3
201572 F20110109_AACJZJ rathman_s_Page_077.jpg
174a908505dd4b405323293f915761ec
54bf6531099eff9ec90a3147be3ecf93b108b00e
188322 F20110109_AACJYV rathman_s_Page_061.jpg
a2f1a2e1c23755c0e66e4bd1f508165e
2603d053a2e291d624d0dd5cf2bad95374a7681e
F20110109_AACKFE rathman_s_Page_004.tif
d272a08bd1865ca77270e60a387a43a9
6884315960621780ec724af4e1c9ee6946d39f1b
125691 F20110109_AACKEQ rathman_s_Page_114.jp2
5cf16e8abf58f411b826a21e6907020f
59a21578374d98028b29a09b35dc48ec46e7ba47
210417 F20110109_AACJZK rathman_s_Page_078.jpg
fd2709481d5c42bff6d50072fe7dd58e
8dfa616a9190f32593258441be36eb277fa20772
218484 F20110109_AACJYW rathman_s_Page_062.jpg
28b3c5e2978e55fb3710236966139282
ac8caf9bc827c20395d5f3866cea52038701d59d
F20110109_AACKFF rathman_s_Page_005.tif
136945e569f9a1fcbd2f2e5d1799ee43
0f32bdc0e9c67265c8a112b21b919a2111772463
114915 F20110109_AACKER rathman_s_Page_115.jp2
700c2ad447d703a867d7c06d776c6cc7
aa52252b92ca6d32267b969e445e26c1702bbcf2
169462 F20110109_AACJZL rathman_s_Page_079.jpg
2667cb3a9f6cd60f96830105449239c9
3f6af02b309257b626d846ec2ff3ce0097ae1573
218913 F20110109_AACJYX rathman_s_Page_064.jpg
6eb8b323e0ba27936b51d6cd22a3bc83
cec63b92862813dd67cfb93404f8be82286dd299
F20110109_AACKFG rathman_s_Page_007.tif
69ed852f699a600c6b17a6ab3bbe1611
ab9cda04b8f0daebfc4760965cbdb21db0650cde
123376 F20110109_AACKES rathman_s_Page_116.jp2
88c7331007e29fc2fb611708b322e6e3
c9c12aa4211e9eec0d88ee642273be5f4ab80162
198903 F20110109_AACJZM rathman_s_Page_080.jpg
7e3e844d0a7bdcc93cdd8586f4fb8368
9a5f824f8d0b48427546b24c52d57412b45131be
129901 F20110109_AACJYY rathman_s_Page_065.jpg
9411e3719409415f62a0e09d125be749
f5496af66fe8063549e7b5aec374110f5fdc4084
F20110109_AACKFH rathman_s_Page_009.tif
a5d62edaf8517b77740610ea0a58f601
5e6190514f243bcb425dcab35237992308e160c7
119642 F20110109_AACKET rathman_s_Page_117.jp2
bd3d6d4994413f5176cf6c8395313e48
616ece587be443f30925e1015e69997128718512
216731 F20110109_AACJZN rathman_s_Page_081.jpg
7ef64cea48d4921ee8ced96a9aefc5cb
9e485676d960f5aeecb37a3b1385ac1586baa926
174728 F20110109_AACJYZ rathman_s_Page_066.jpg
20d5ad638e0e1cee6386bd8fe77eed2a
2c51c8585deced570c31cb5dd163699e380952e7
F20110109_AACKFI rathman_s_Page_010.tif
17a4db65f07e0b5d2ffb71d81bb321c0
c7cd989b35002765d85fb4990890d187c1a8ba84
132315 F20110109_AACKEU rathman_s_Page_118.jp2
45d25103fc7bbd3a1ca698c47342fce1
0ac09495e285c66b513e8c975d0c0471dab51546
219132 F20110109_AACJZO rathman_s_Page_082.jpg
1dd26746b30070b4b24d13995bbaf272
673d71f450b01d277f345b57e59a201502edd913
F20110109_AACKFJ rathman_s_Page_011.tif
77b43431376aa691a5caf11df0ffc983
926c2bd6580daede50766873112a2d15313df261
132715 F20110109_AACKEV rathman_s_Page_119.jp2
f28d6906730ef25e3feae0c869aea52e
619a584a443eaac3d4585653f6cb6b25f1c0d5ca
159700 F20110109_AACJZP rathman_s_Page_083.jpg
bf0f7315a1f9eb74ad88fbac1c6801c9
779c4dd3ecd1659b9fbeb56210e39f7c7f47a3ee
F20110109_AACKFK rathman_s_Page_012.tif
cef5c3bb9f4cc1c3fec09da1e0280b90
79fac828752c8f3f8f4e7360167eb38330e9e880
130031 F20110109_AACKEW rathman_s_Page_120.jp2
897b24b5320e6dc3ed0ade6d1011531a
d1a9231e5c224251dc7dc4f173e85e1b8658d61c
188183 F20110109_AACJZQ rathman_s_Page_084.jpg
b3bf23f471bb95efd239e77f4a56af4e
b9fe62de55ec42763800ac3eae194d662acf2ec1
F20110109_AACKFL rathman_s_Page_013.tif
af2d57bb9bde79a0fd35e5d36da2b502
6cb385e24d5df5a316d60e68858bf8da1ed57ac1
131361 F20110109_AACKEX rathman_s_Page_121.jp2
3b7cfec78116d70c8bbc9eb46f10bf90
cf5baab161a2b6d40cc57c5495fffb242090c30a
194550 F20110109_AACJZR rathman_s_Page_085.jpg
3305424b43699181d679ffb78c18f942
852230d02272387bd37759c4471cc13626809f37
F20110109_AACKGA rathman_s_Page_033.tif
ca4726a8618acf1cf8e7ae1a5cf047d2
94b87e5a970790dc6859eae6e21eac2b1928e917
120420 F20110109_AACKEY rathman_s_Page_122.jp2
89d100bf9f8e4f3d899a2b5f5a74f032
98a19b21488b68e75611db8cd3097461481842b1
212966 F20110109_AACJZS rathman_s_Page_086.jpg
8811465b85b38ffdbc2a1ee70cb693fb
5cb0bc3f163e4a3551e7da4926d99b4277968b5e
F20110109_AACKGB rathman_s_Page_034.tif
6d6aeaefe2f4debab98c4565a5cbefe8
db05079c6b52f0fad27a836a04de1f19d514620b
F20110109_AACKFM rathman_s_Page_015.tif
cccc0df803260e472783eaf94333988c
2dc54a76201319e7d0ff7271e38fb809c07e32ba
13522 F20110109_AACKEZ rathman_s_Page_123.jp2
9c1f1da8a458096e94d9f35183b086af
0d7858b476a18bcf29749f9b0b9bf6d4e5426282
204098 F20110109_AACJZT rathman_s_Page_088.jpg
c7f8cc2a4f02d1c57b14b9904b0c3de1
ed4b6840ff6a760a8cf23b31d6be41d1715d0721
F20110109_AACKGC rathman_s_Page_035.tif
76e25540b22466df549727a0c8f46fc8
3a3523c705f03555fe236d5b7b0700ce7a6a2968
F20110109_AACKFN rathman_s_Page_017.tif
ef81e90976106f501c0fe6ea8cbad298
0b1e7355df408acd50ad8deb53ec2bb00e5ff462
40138 F20110109_AACJZU rathman_s_Page_089.jpg
71242823e1f610bd63c9e92c42fbb1d5
63edbefc4d245050dfb95bf74a3aad6dba25a409
F20110109_AACKGD rathman_s_Page_036.tif
680296f9387fd7c69ab5016d47297a74
368c68b4a0030158442548cacf441c127a3c2c4a
F20110109_AACKFO rathman_s_Page_018.tif
962fbf9158b8d487df436552c07dd3d3
cb19cd8ce63c794df5ba1c06111c2f81b4ae0550
117819 F20110109_AACJZV rathman_s_Page_090.jpg
99d458754285e3e1615e982eba51d40b
0017322bd7cc2bb0072fbd16556c3ccb714060b4
F20110109_AACKGE rathman_s_Page_037.tif
adc0e2cf17c9da0e8d5bb25f13c26aa2
c21624342aedb8681040eb7ff8763c5ed1ba1884
F20110109_AACKFP rathman_s_Page_019.tif
71e06af34e0ce928c581b976f4546ab5
e56b34e3d7677419f07d772e16361cfd7f8385c2
195882 F20110109_AACJZW rathman_s_Page_091.jpg
2e352fd4ab9d5e8c547caf263e8f228e
a5f12c87d0105ea0457a810c354cef61d029be21
F20110109_AACKGF rathman_s_Page_038.tif
84b8b367e234914f8473e9d6303bb411
ff15ca369ad317d391cb36c976c784aad51cf150
F20110109_AACKFQ rathman_s_Page_020.tif
da801140a27c07d83d13b30d85b81820
0412da3fa422a4d11989df1904d986ac935a50ce
170384 F20110109_AACJZX rathman_s_Page_092.jpg
b608bd955c65cdf9497a747ad9222613
862a2dff8de769267820a2ea1e6bc7fa24558e87
F20110109_AACKGG rathman_s_Page_039.tif
f8f494eeaa2a95e029770176db6430fe
430151a511c34e40912609960532f675011e2748
F20110109_AACKFR rathman_s_Page_021.tif
6301fb68cde3fe94f7d412a4f0b4cd59
6176c3f7651ab5e185b47da8694dfa2c27935bec
206537 F20110109_AACJZY rathman_s_Page_093.jpg
94d3796e394fdf9af6303491a615f610
261efc17f162b05e0e568fc4fa0d4042897e6983
F20110109_AACKGH rathman_s_Page_040.tif
4435ad3090be46e531cbac23ba6c23b0
c29c3efa8840a52506335f1ddf6b4c1af197f686
F20110109_AACKFS rathman_s_Page_023.tif
8d7d15542e559651d87271bff58240c0
1a89a8e72f40fac70e3d39f694c97ca8641d4a63
137643 F20110109_AACJZZ rathman_s_Page_094.jpg
286cd97b8fee5499a0483fb87f17568e
7e7261de846fd3fe492a34ba0d52edf2d0841b46
F20110109_AACKGI rathman_s_Page_042.tif
669d64511777175fdd9bd3689e9f3cc5
c0e1df3f13fe7be1a09933c2f534dded118f6c29
F20110109_AACKFT rathman_s_Page_025.tif
aca628dd589614b7f78bce08f830fc91
86bb75069c3faa255fd1a4e25add794313c0f4dc
F20110109_AACKGJ rathman_s_Page_043.tif
53be609feb6d8efe5a5a3fa47f9a88c4
d9a1be83a493c2dcb8e6e8624a1e834cae4a2dcf
F20110109_AACKFU rathman_s_Page_026.tif
df9bfb72614e854bbec2d429076b82ee
b9670ea3f5f409dfd2b24854d470b0a6eccc344b
F20110109_AACKGK rathman_s_Page_044.tif
3037d50a5aa62f87284cb21f148224f5
bebfc7eea78a6a68c0a13b86409eb2f449ec8762
F20110109_AACKFV rathman_s_Page_028.tif
a9c28c3aa7f81eae7e8255975d78d9d0
5706af71b26cd0cc59a1c30fffae08b49dfda4f0
F20110109_AACKGL rathman_s_Page_045.tif
5cdb799ce1e8fb44388b4d1387a8f633
4eafbfbe81fd84e192c16641097fa3c91ea34f64
F20110109_AACKFW rathman_s_Page_029.tif
d5b91ae8263d2673ff5272718f572a57
7be464efe965c561c167b9209840b095332cc38e
F20110109_AACKHA rathman_s_Page_062.tif
970b1d2b8b7e8c7fdab76bde19bc3b01
490cdb9d29db3277867fffbe772da7db076178b8
F20110109_AACKGM rathman_s_Page_046.tif
4204023bb5a2062cf4ae90e882c07538
3f74b36c977a2136be46bdc3c1cddcc2d6eacc1e
F20110109_AACKFX rathman_s_Page_030.tif
2e75e5112e8f46cee1a17541bc57ede5
153545602bae0c29fe2b46d86417f500fc89a46d
F20110109_AACKHB rathman_s_Page_063.tif
249251567ca1bc27797e9debd4cb1b61
733b9a34d0aacd987ae44ca4f491c2c80f290d84
F20110109_AACKFY rathman_s_Page_031.tif
91bc2d878019d37e8dc01279a5df003b
2e323e87f0d15c9881a990a2c701ea694bc6a0ba
F20110109_AACKHC rathman_s_Page_064.tif
dc86e83d6ca0ebbe08472484603c1035
32cc4659a419cf8ef8938f3f844d980ebff2f38b
F20110109_AACKGN rathman_s_Page_048.tif
b5d94768779348852ea5f7eb776e74a9
6f4ec273cc1e37ddafd03d61b0183a56c44da2d0
F20110109_AACKFZ rathman_s_Page_032.tif
69d75abd738199af7361bdbb16a52cbf
2add496156d84e8055a2616fe6f1f36fc8aaefd3
F20110109_AACKHD rathman_s_Page_065.tif
84c7e0ecf7ccb983a68d8b369e56ad15
af87337376f47a230a082c859dc43ebff9566bca
F20110109_AACKGO rathman_s_Page_049.tif
423890c611f5db9e7ab4115bae4d839c
7e8592a2dca68c237658fa5620f626774b713d40
F20110109_AACKHE rathman_s_Page_066.tif
885aff4b362898a7cb4b3848dddbdbd4
d27289f4708ecd84cc83c91e6c590dc5dc86f8ae
F20110109_AACKGP rathman_s_Page_050.tif
d06770c9bbc8e9dc4b5da290ad88db03
b75e6129948350d76ad23e05eb786349eb32d6c3
F20110109_AACKHF rathman_s_Page_067.tif
4020df26cb4eccc6e9191ff0e02edaaf
c4d3048e082719dda8a406c589137ea87baaea66
F20110109_AACKGQ rathman_s_Page_051.tif
0d018e2b43c4cdd6ec281a9e0edab672
7bf9ba5d5ea976f2fdbc9aec7fc18dd45e565510
F20110109_AACKHG rathman_s_Page_068.tif
460b552de6e22a9bff90f8bb931f0308
7182bfae0e89448e743a414bafa1e886ade6c311
F20110109_AACKGR rathman_s_Page_052.tif
ae516466201841f5b1f80060566df0e1
58293674ac06dbcaafa74c60f04f4a18a3524eea
F20110109_AACKHH rathman_s_Page_070.tif
2852801564cbd66661efe718fe823c7d
68a0a4c62603822db082606a1cbd5ebf4194cadc
F20110109_AACKGS rathman_s_Page_053.tif
7c3ab6322f2c4ca15f03707f6a193922
c52cdaee580490813b193179989acec347a4c22c
F20110109_AACKHI rathman_s_Page_071.tif
0708de6a83521e897b9c4fcef394f67a
32e7e621ddc53fd1a7dd90da6817cb77c8ccb662
F20110109_AACKGT rathman_s_Page_054.tif
539f9f47fd88e8f5d6da202471f46a2b
8588b9dce7c038a50b005f5eebc638ad54f6f6a1
F20110109_AACKHJ rathman_s_Page_072.tif
777e98bf3caf257dbda28ca6c731b520
66d11545aabaf106d6c2794e28668bf2644ed321
F20110109_AACKGU rathman_s_Page_055.tif
cdc9b8eac7406e32c2b82bed10ad4ab9
72d0a720323d61a7775ecb3a2a6a61c9e503d915
F20110109_AACKHK rathman_s_Page_073.tif
fc0f59a6851f0302b15ef98a3dc34851
16962a3b101e3a13ce06fb61f46448efce116017
F20110109_AACKGV rathman_s_Page_056.tif
7a8c538a2718a9d328fec37af9b1b026
a250ed2402c0e140e319ab78a014a49a00f505b1
F20110109_AACKHL rathman_s_Page_074.tif
a4afa0030b70bd8ad764eb76c54bb83a
4cb21c722cb13e6d6f605512981a624599a89f3b
F20110109_AACKGW rathman_s_Page_057.tif
b89423b4cbde2512feaba4fa03754934
cb9fe10a7bbdd461453111914e16067ce77d75ca
F20110109_AACKHM rathman_s_Page_075.tif
6cf37e9220d58f1f17f38bc72a3cb9ef
cac614b2ecca8206c6da7276b4237305e9acc8bd
F20110109_AACKGX rathman_s_Page_058.tif
e4376466e94177bdf0d8107672c4d474
2705107aa2172ed7ec140150f940c787b5a9fc18
F20110109_AACKIA rathman_s_Page_095.tif
97d880ae13f45172be47b863704379e9
21c320e6a6deb4f2ad1b07d4d957e8cc8521e521
F20110109_AACKHN rathman_s_Page_076.tif
ea220e6ce6b22768652db7b5013d4476
abae265e94feda93a527ff5b4535e3a2d6ecbb0c
F20110109_AACKGY rathman_s_Page_059.tif
3a2918893dbe4d284a73ab36d396e5a5
e2207a1ab564e1c156854365ee5acd55b6b4c22e
F20110109_AACKIB rathman_s_Page_096.tif
c4e786fb18d1e3da0547149fa656c16c
56ce675a93fa910ef5f59430c5a74a7259ab8e40
F20110109_AACKGZ rathman_s_Page_060.tif
9bc4b723be8cc5db9d346df3ca18e8c7
3b2fbc62bed7a38d1410ed6b4f198c71c3f5f706
F20110109_AACKIC rathman_s_Page_097.tif
19145b23c60d6af614374c5bfc54db5a
ac90d2daf48ef7d61ccac1b7eca854b1868e820a
F20110109_AACKHO rathman_s_Page_077.tif
814fa986d016d76ac6466df7cf7b6fb1
fffc91850d8963e71de372b77434086921703f40
F20110109_AACKID rathman_s_Page_098.tif
66c908182355d61e30e1e2ddd60575ed
a2619bbdca1f0cb5f5239b5e35ea0463a36beca1
F20110109_AACKHP rathman_s_Page_080.tif
46a02e1c35f8e4ac873e722aa2b8d46a
7bfa9e35f6c415b63b1fca9308707d5f8d6d5125
F20110109_AACKIE rathman_s_Page_099.tif
f709f13d7c075d6d1c5507a6c7924798
abc115e794a853dbbed1792acd06efc6239cab2c
F20110109_AACKHQ rathman_s_Page_081.tif
b75408f56607c9364917ed3b24b31281
2adb511b0bcd76c4b826fae5332abe81ea7a955a
F20110109_AACKIF rathman_s_Page_100.tif
b7406083760bbf3837e1c33c49a7375f
178336451c1463784bd53470bc10e9c8e3c8b0ac
F20110109_AACKHR rathman_s_Page_082.tif
ddced82a1fb749afd2b2d36e99317245
145cd4a9223cfc660065844240c244f3f41e978d
F20110109_AACKIG rathman_s_Page_101.tif
603179d642e4bbd9d62871a526715fb1
750b6e68ee0826fde4122969e0ee0d7845086b28
F20110109_AACKHS rathman_s_Page_085.tif
adb37ba92c727190ac358aee9adfe61a
40845587c369bca89316270fa08937d9f95191b9
F20110109_AACKIH rathman_s_Page_102.tif
09266c856c9c45db6f1ce6d2b0c5c6fc
03448e15eba31ba16e4b907c0b2ce2843d0c45d4
F20110109_AACKHT rathman_s_Page_086.tif
d1b6b55267f6207ae68956277751eb5c
27b988d03df4d7ff5f225b9f969882136773b966
F20110109_AACKII rathman_s_Page_103.tif
fe74bd435971262f088a80bdcd0c9ce0
65d05181992de8badf71b7a1616f7f7102332806
F20110109_AACKHU rathman_s_Page_087.tif
a5bd2ddd95c7844651530df2d29a75a4
9c2ef3501788c6eed7c433df987485c4af0f9a99
F20110109_AACKIJ rathman_s_Page_104.tif
a047059283c1012339956e4e51cd99bd
1cdbcc6859594fd9c39c5c2dad4473cf36d8a68e
F20110109_AACKHV rathman_s_Page_088.tif
f144b6068e8c132e23af0783eb108507
e80d469180dd7657d92e0f8de31c004f8b96b03e
F20110109_AACKIK rathman_s_Page_105.tif
2a8ed821a49d48fcf1d264be7f1e202e
25ef7c81f9c274b3c9a24ced9393869ee6071e09
F20110109_AACKHW rathman_s_Page_089.tif
a3acdb85a45895d67d137487b4cbc781
c616b652b139f27310cd22443480df43c750e1b3
F20110109_AACKIL rathman_s_Page_106.tif
70b70af1e27b0bbf1c35f65e78d1fadb
2f47bfa326a8eb2eaee1c9772ce9bffae7df81eb
F20110109_AACKHX rathman_s_Page_090.tif
ffad3ec28b665af994fe3026f9b46511
5081f030d2d6f53198688c32f43d98e6638b1770
7915 F20110109_AACKJA rathman_s_Page_001.pro
a565dcde8d16d9e7ab06684e61b3ae23
e9bf93066cd9288048230ca781ebabd66c777eae
F20110109_AACKIM rathman_s_Page_107.tif
656ac9667992fc99979de1ecc3968a09
0361a6bbd95a3e07629ed6ae658066a0fa763fb2
F20110109_AACKHY rathman_s_Page_093.tif
92dc19ea4238bc6beba0a6a0a4298a9e
2489c590eada9bac6b143726251812b6fc811e10
2056 F20110109_AACKJB rathman_s_Page_002.pro
0f45deba8b10c0c56a13c87f1eb6562f
ef2bdf5bc7b13e048efbb6ce0c8f875d9c14cc92
F20110109_AACKIN rathman_s_Page_108.tif
e0c05ef045e65ef0cec97e572c0f5469
c1c3fc79b9668751ec3236f2013e99630d589f82
F20110109_AACKHZ rathman_s_Page_094.tif
cb9a7ed7028dee9d8e50c878f1c913e6
b15120d2f400e18dc60d73a7e01d7b088aa8d168
39355 F20110109_AACKJC rathman_s_Page_003.pro
d6544ff76290f8663534284101baeb24
f28945ec30de85b82ffa688a3da436cd3ec637c6
F20110109_AACKIO rathman_s_Page_109.tif
2eb7799dc2664fb4a31d6cdc5ea23980
8d8d46340b14febd8b526da2673cd03be24a7b06
80002 F20110109_AACKJD rathman_s_Page_004.pro
3187e5c539d5045689c00759be10047f
8730d639d13f7e4cb4f572888a29a534ae48dd39
98452 F20110109_AACKJE rathman_s_Page_006.pro
b7f220b3243d52107c6957ce06db2877
dfd4526ed6a8cd4255a5882df6b4c2338cde5cd6
F20110109_AACKIP rathman_s_Page_111.tif
c870033799b016d0fce0d4c7920a0223
15e8148b7bc4f179de81be0e2b1a5116b17dba0f
20198 F20110109_AACKJF rathman_s_Page_008.pro
1d621a175a39f67303b974f2dabead63
441f368a6c71e5a52a1db7ff4aea6a92b19826fc
F20110109_AACKIQ rathman_s_Page_112.tif
ffb0371a5c1efde552a5ce32f8867c08
c186962b0e09bbfc61f9de44934fd5c3a705dbbd
19254 F20110109_AACKJG rathman_s_Page_009.pro
52faf8c4fa80e9618e22f09c8a92253d
a7f31bc07bb38cc744dcc3dd20f991e26e452bc1
F20110109_AACKIR rathman_s_Page_113.tif
232f14c0e7b252493e145c65005a8e8a
03eb43970ec4014786bfb879f354ca7a6295319a
39871 F20110109_AACKJH rathman_s_Page_012.pro
82cdb80f0d17fcd4f713bbe43a75a437
6cdc79573fa3e0bd98e36de31d560f560422132c
F20110109_AACKIS rathman_s_Page_114.tif
98677df2b0287959be5bdf94df7a7028
87f9f815abbdd7cd83b645f1f54b2fd8c07a8059
39993 F20110109_AACKJI rathman_s_Page_013.pro
b8d76d03e8b8181090d8f075948bb7ab
80432cadf566d97cee81d53a73ab1deff01f8c89
F20110109_AACKIT rathman_s_Page_115.tif
775104d542c4f79cc5870ab14fb48370
f040adc4bc07aaffd94ebe76fbcc3cd2e7190988
47923 F20110109_AACKJJ rathman_s_Page_015.pro
dec8af12c7c7a88c310eedc8e7deaec8
099ff647d57244e575ba1b1ce8dfca8f229ed68e
F20110109_AACKIU rathman_s_Page_116.tif
5465de4514aa62dbfdcc87dd1a21a137
111a092a75ac814c0eccb88f165272bdb63dca9b
46613 F20110109_AACKJK rathman_s_Page_017.pro
c4b8edeab87d100ed1db1b7aeda67440
1bf5db719d1ea44ff7992f9ef03a7dac1df27a07
F20110109_AACKIV rathman_s_Page_117.tif
1db6beb63483a416ae7149866a167f42
10414f378e357ab01af03fe85e3b8d03aaed582b
51452 F20110109_AACKJL rathman_s_Page_019.pro
a16b476a2b21eb35033563219954f156
ccc5a9b135aba6680c3378785c5e9c3b60399a65
F20110109_AACKIW rathman_s_Page_118.tif
f922f464276f10000c4826aedb35c304
3412ab8afbab2986875ae909488700b4a955877f
50128 F20110109_AACKJM rathman_s_Page_020.pro
4d82a5b1ec569c81aa7db91e1cb147dc
627c5a33b3eca146fedba10f0118f815ed297371
F20110109_AACKIX rathman_s_Page_121.tif
754e90070e02d760bafa188bffbfe47f
ce65753044a3fe1465838a236b5de99be264bccf
49766 F20110109_AACKKA rathman_s_Page_037.pro
a4de634ef2dcdcc0df262467d3bd50d3
23fdf8595da600d75170d391ba403da737777bfa
54026 F20110109_AACKJN rathman_s_Page_022.pro
93eace89f200f5b337b5642d543eed1e
97dde57b18eb654f56bfe565f11561bca32238d6
F20110109_AACKIY rathman_s_Page_122.tif
586ab74106a127dc281e4963a83cdb4e
3a9886ca2d037b5b753c72bedc8989af782b4e50
49869 F20110109_AACKKB rathman_s_Page_038.pro
c22d8b375f5216a41aaf20d2f0406ef2
4b3765c9e10dd36679d788f10d87e14e27018cde
50828 F20110109_AACKJO rathman_s_Page_023.pro
27ed139818c9be15ed2850f9ab4e40da
3147ac7eb1cecc948d101b2bf0e9329e7e392ea0
F20110109_AACKIZ rathman_s_Page_124.tif
42874b8e02a674a4042cd73e85157edd
5e11a16a12d15c0a575810ad95de0a3570ca14e2
48192 F20110109_AACKKC rathman_s_Page_039.pro
ad6220ae05d771081c0a94fbc1c0e4f2
3f9af838a6dd64b4e560e727e8dc614fef766a59
50982 F20110109_AACKJP rathman_s_Page_024.pro
1234ee507653230f6e917218a00eb039
a5eaa5f752cb576baef660480acb432e5b74c6f1
49440 F20110109_AACKKD rathman_s_Page_040.pro
d853dac034e83102ae84723bab3e1634
464314367405ed0da8e3ebccd475be19dd969ba3
32654 F20110109_AACKKE rathman_s_Page_043.pro
8bc977e85f559d1ecfb9fe0c476f6c9a
7ea7d4c80a18508d44db0a4ea716b3a77c4493e4
51504 F20110109_AACKJQ rathman_s_Page_025.pro
3d1537c67e89d25c40c728e933ecb568
aaaf0680b07008513f6bf6986353ac4376c0290e
44086 F20110109_AACKKF rathman_s_Page_044.pro
a125e77105bfd3ba782a0297c9dfc099
f25637d94a9d63aa5d07725db3c6af8cd756a615
52674 F20110109_AACKJR rathman_s_Page_026.pro
83d19d009b0a5d2c14c56b5e8d841f7f
93e32b25c02e96f7648ef6dcd814a9494712cd5d
36290 F20110109_AACKKG rathman_s_Page_047.pro
55419c3d87980a58528aaa155ead4530
e1ed88a112db20d502df73332adf36ccf9f2dffc
53421 F20110109_AACKJS rathman_s_Page_027.pro
13dbb21d4a9f85e4da1c9293e1d93c80
9267ec69370cc9ba0193de34b948e5a4d47577e1
48961 F20110109_AACKKH rathman_s_Page_048.pro
e8b40efd428a8b59cb6f275dfb216e8a
72ffcab0d652cdd4fb220f748b678892f3f62b45
43639 F20110109_AACKJT rathman_s_Page_028.pro
181ca5ddbae3fde3bb0cb55366d25e2f
eb80d0889fa765a6ba8719a5e49770cc5589824d
49157 F20110109_AACKKI rathman_s_Page_049.pro
668a38646a186c9d4c8615ce68f13519
cb66c82ecf38f9c538ff8b5d77dde1263ff2c2de
47398 F20110109_AACKJU rathman_s_Page_030.pro
658009d8566827b2613d4c9b76c5888f
8a32114f7add97826534a928a4f7dc45f9e8e147
47804 F20110109_AACKKJ rathman_s_Page_050.pro
0d1d883b74fc49ac5fb4cb200b722585
7d824f973e3a9e31ed4691447a4cd3a999b605ac
36996 F20110109_AACKJV rathman_s_Page_031.pro
d636cca1902c057592f314c2cf09b0ff
0187da58521a0e57f182c90ab924b9db20e4e277
39570 F20110109_AACKKK rathman_s_Page_051.pro
27a508a03b849d797c73f8a98c05ba4a
f67bf54492e13e58fa858c3b84cf90de02581cf9
54061 F20110109_AACKJW rathman_s_Page_032.pro
095303c0b000a1c8152322db8d9bd5d1
6ae1a11470884ec4cd8de8643fad8342dda9b330
F20110109_AACKKL rathman_s_Page_053.pro
e407c70012038b7011fda8d4928f3275
a7ddf744c7effa209373e273958819c5b4c74c87
6916 F20110109_AACKJX rathman_s_Page_033.pro
d0b1851b6ebeba3e15f722562d1d04b3
e840658cb14f6bd416aa85508ffc764c5796f0d6
49358 F20110109_AACKLA rathman_s_Page_069.pro
c331cf7ea40d3b80d759de3ce573cec5
5aea58d7e36a3489db6b7afeefba978f4a3dbb32
45877 F20110109_AACKKM rathman_s_Page_054.pro
1acb76e23793676a397842f27e8dc77d
dd889e2f442be1b212a093ac9fd29fef33f12d78
41994 F20110109_AACKJY rathman_s_Page_034.pro
6fa156f924075f466d5991868e6ed6b6
23634fb98f2a198fe3495481122a621efc2f79d9
45513 F20110109_AACKLB rathman_s_Page_070.pro
97066e1eaa4173e06b89b465d7fb1a28
375ee2c233fb86c6c2b03a90aceae53fbb277938
42905 F20110109_AACKKN rathman_s_Page_055.pro
1851351c942f3a9457ae82c3d8879749
6d499c16f0ae83bc35909d90d53c55b8a9e8d0d8
42995 F20110109_AACKJZ rathman_s_Page_035.pro
afc636f1561d297127f380866706cfb2
b2b4bcda9e677d108bd2f38d844c3faca4f9b594
46726 F20110109_AACKLC rathman_s_Page_071.pro
9c72940d3a54d5a99e800a8a1dc763d2
4a437aae540e1f965eb8834b12afa9c0332aef80
52062 F20110109_AACKKO rathman_s_Page_056.pro
66f88be82f17d13f7e7d02e7d2e1dfb3
2fb158e4120482d971bb5d9134782e8a344d0841
41917 F20110109_AACKLD rathman_s_Page_072.pro
3f6b7578d176135b40eddfe6b01bcc94
558e230254708d37eb505b9b5425e78693c0ccd3
44810 F20110109_AACKKP rathman_s_Page_057.pro
eeda5e2ee9993ed83e62213d3252b708
41085c3ab62cccc55baab8e863ec2bf2974e30b7
39027 F20110109_AACKLE rathman_s_Page_073.pro
e8029d48a58d472f371f7c59a215bb43
37929325bd75843ce664f525148f099dca473d55
26756 F20110109_AACKKQ rathman_s_Page_058.pro
ee03d8f5d09a7862a54469844bdfd6ce
29b1a16e12c39553a7e37a9939d41aee4d6fe789
39907 F20110109_AACKLF rathman_s_Page_074.pro
205b0023887fa40c6f484e964e21100e
b4130f09162592ba77bae2941cbede70d63ce4a3
38279 F20110109_AACKLG rathman_s_Page_075.pro
edd5e68d7c37c653b751bce7056b1276
a03baab30b5f661fcd4e5c5aaf76773fe6bd5d6b
44216 F20110109_AACKKR rathman_s_Page_059.pro
e166927cd444cc10413bd755b206f691
160958dd14b413b5af928303ef7aadb1fb8cbcee
42501 F20110109_AACKLH rathman_s_Page_076.pro
b480581804a50acd84bed6eb62d13c80
c955b8db09918a553956ec771cdf84dd9aed1a34
49343 F20110109_AACKKS rathman_s_Page_060.pro
7dd5fc2fab2ad06baec1b32601f2f109
a8f555467d12f394c2ef29d80474951f111314d1
38910 F20110109_AACKLI rathman_s_Page_078.pro
c74918b5cbe81f18c89a7439db69518f
ab27f0b0730cb7f179a40aad68055656999adfe7
37122 F20110109_AACKKT rathman_s_Page_061.pro
920bab3b452ebc4d2fcef80047f6423d
6b5d8d29209ff94871fabf3a2723b321a6aea9e1
35036 F20110109_AACKLJ rathman_s_Page_079.pro
6490ca4a746060259542a0a8362516c6
eae0751607a3daf8aefa45618c3aae88b4b91443
52318 F20110109_AACKKU rathman_s_Page_062.pro
90db944e1b8f4e0fbfdaad1da25ff5ea
a0bde266559ed5b7037f26d5ab378fff45509663
47629 F20110109_AACKLK rathman_s_Page_080.pro
6a949195ba4bd007ee9c262164b44d73
e18f358aab560ef5bf51a1a2d4e9282cdc16be6d
50715 F20110109_AACKKV rathman_s_Page_063.pro
69f4e038e798d23eebe08a3cd06c9f3b
4a698225ee1bc8061f9755dc1583e56e5f150380
51511 F20110109_AACKLL rathman_s_Page_081.pro
1e88761829b0a5b5c46c86d0396de33f
dcb93de2d796e92d02230ffdd96393d61a2f6f4a
30176 F20110109_AACKKW rathman_s_Page_065.pro
e35055ade7dfd51de9906d44fd053590
ee542eb53740e5d08711086901318fbd0a662f37
34150 F20110109_AACKMA rathman_s_Page_102.pro
516b7f5a1931bea426e69c4fa94dae11
0acdb6d411882f2536956ec8e1a3f412751828fa
37516 F20110109_AACKLM rathman_s_Page_083.pro
246399bd536ef48ce0aae7870fa87348
b4490554a85d51e617ed2224d322565b8b684bf0
39225 F20110109_AACKKX rathman_s_Page_066.pro
040bc858e8a224491ef566f3ff0a62a4
02d9cdb716823c70d22f933b5270243b63ce325d
50439 F20110109_AACKMB rathman_s_Page_104.pro
45c0e0ff8e05b632112ac41454bb2007
2991bb002ee08e4d08739ac420568da0deb785ad
43350 F20110109_AACKLN rathman_s_Page_084.pro
a08eb5f0b91ed8b0905a020a7a7afa8e
3bd58fdf2e28637fd23bea47a8dc043d79f3d22b
48554 F20110109_AACKKY rathman_s_Page_067.pro
d600de73eb25ead8393e0fbc0ca86247
8e4c2cca3d99e8d100bafc9d70ff4c0f920293e2
31168 F20110109_AACKMC rathman_s_Page_105.pro
19e7f257eeac969c71734837eb09167f
1bd9d7658fbbaf489ea306878e7fa4cdf1778210
44221 F20110109_AACKLO rathman_s_Page_085.pro
88bc6895de590cccf5352e4642a9e89a
2e828def9d85760ba014e673698d251ec6323aa1
34701 F20110109_AACKKZ rathman_s_Page_068.pro
003faa3ddb94a576c242ae1a171750f0
cfe2f1000a67c5920f01cab56d4ba487cb5f6e62
43889 F20110109_AACKMD rathman_s_Page_106.pro
33ef18e0dd7762f872932d849339cce5
03b3bb5e467f5bac1724fcfe09dded07b043cc23
49392 F20110109_AACKLP rathman_s_Page_086.pro
0d954093c3296a49a16a867c113c384b
83eaec3fd1fe7c5d871dd7e4ef6806b6cab20fe7
27581 F20110109_AACKME rathman_s_Page_107.pro
842f392be792cbef93f6b9ee35344cc7
a70780226e58624ce0be7207b154b7e92e8e5d2e
43590 F20110109_AACKLQ rathman_s_Page_087.pro
d0ff7ce2ccdb33cab22a5b089127fad8
64f8c182dee0ce590a37804dbd6063cba5fcea55
36683 F20110109_AACKMF rathman_s_Page_108.pro
6b0dadf174f2ee42d950c197780e72ba
fe478a5875b67722d8b5d63d2056c3b329fe95a5
39221 F20110109_AACKLR rathman_s_Page_088.pro
e01ccc3498e9318c6b8ee05d876852eb
73b08f0e8544f4da069eba34655b6ccbc7aad3be
3041 F20110109_AACKMG rathman_s_Page_109.pro
d5fcb9a78b42cd8a10f83a35dc4085cc
4ec738ca167a35fe0762d93ee04a8c212c986ba8
49162 F20110109_AACKMH rathman_s_Page_110.pro
94e2f239cabd77b9871be347e23d9ee3
1e50bfa0311a2fb2a89372da3557052e30d9eb68
7257 F20110109_AACKLS rathman_s_Page_089.pro
b2c7af66763b9c707ca27d1586d69f99
982303330911b6f20232db47dff3e1783d05789c
65022 F20110109_AACKMI rathman_s_Page_111.pro
c55bb3f579be16bcbc45d73838cd3e6a
fa7167889dbd7da69612f2ecd1f1a97750608204
32896 F20110109_AACKLT rathman_s_Page_092.pro
c6d007e93d70783639275eefc7cb7d1e
fdac7f3aa63c3ba0dcf0b9bfca6024997a5ab59d
61232 F20110109_AACKMJ rathman_s_Page_112.pro
240692427b9573f91712fc2a5ba90ab8
f8b5ff1509de65e39b46b4cfba91fce01652b330
45221 F20110109_AACKLU rathman_s_Page_095.pro
a7a69de4908a307bbc61b49383793270
fcd6bb96e9a69d9109db0e002a8d73d2eacf5e11
59813 F20110109_AACKMK rathman_s_Page_113.pro
05117e25f8e90d6d53816f91f36b9add
3e741a9dea30264aca34bf6c77d5cc3267d4c8db
48078 F20110109_AACKLV rathman_s_Page_096.pro
d5d9eedee6b99212f65dd96e3f12edae
303062cb6c44d5c243c6a9edefb0a2ea80f7359f
60845 F20110109_AACKML rathman_s_Page_116.pro
c78c44dacca0e491a4b8e66cf913104e
6a1182cc36b8a76617a0c0ed95e1cfb05dd0ae3d
44635 F20110109_AACKLW rathman_s_Page_097.pro
15dc99e67e5e4c79914ba9a361bc9237
83c66bc52c15fc9e9ee12009ca82a1962d8f097d
58188 F20110109_AACKMM rathman_s_Page_117.pro
081a4faf072061e249f598c220b19a31
7a6ba6b7d5586b147bec778a7f78bf49a685c50f
51563 F20110109_AACKLX rathman_s_Page_098.pro
b636e647bca0fd14d5d42a0f61bef077
9cdd1522539bdce19f5b740ef9d8f9744271900b
264 F20110109_AACKNA rathman_s_Page_010.txt
9b80e08c2642b7a07873c0666839f9a2
9118196423a324414c0d8a4d4a3e90b508f21a68
65949 F20110109_AACKMN rathman_s_Page_118.pro
2f092d56536cad32eda663d830ec2062
b4291aedefc19283aacf8ac416ab0ce2404fa803
42906 F20110109_AACKLY rathman_s_Page_099.pro
2c1155545fb3fa95f3344d98fb7829c6
ec18c24ff52f5f320eeb264dbf601b7cd1e9793f
1715 F20110109_AACKNB rathman_s_Page_011.txt
f83803cb68c4c01e6be97a69f3ec5df6
1002e0fba351e0e8f6e190ec89c46817b30ba6fc



PAGE 1

EFFECTS OF ORAL CARBAMAZEPINE ADMINISTRATION ON BIOTIN METABOLISM IN RATS By SARA C. RATHMAN A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2003

PAGE 2

This dissertation is dedicated to my parents, John and Susan Rathman

PAGE 3

ACKNOWLEDGMENTS My sincere appreciation goes to my major advisors, Drs. Robert J. McMahon and Jesse F. Gregory III, for their tremendous guidance, patience, counsel, and for their support and confidence in me as a graduate student. I would particularly like to thank Dr. Robert J. Cousins, who has been a valuable scientific resource for the past four years and who was instrumental in bringing me to the University of Florida for my graduate education. I would also like to thank my other committee members, Drs. Lynn B. Bailey, Stephan Eisenschenk, and Lee McDowell, for their suggestions and overwhelming support of my project. This project would not have been possible to complete without the help from my colleagues and friends in the McMahon, Gregory, and Cousins labs, especially Brandon Lewis, Carolina Lima, Troy Pitts, Amy Mackey, Steve Davis, and Ray Blanchard. I shall always be grateful to these individuals for their assistance with my project and for enriching my graduate student experience. My profound gratitude goes to my parents, John and Susan Rathman, for their endless support and countless sacrifices for allowing me to have the best education possible throughout my entire academic career. Special thanks go to Heather DeJesus for her encouragement, unending support, and for being a wonderful friend. Finally, my love and appreciation go to my fianc, Daniel Zwart, for his continuous support and devotion he has so graciously given to me over the years. iii

PAGE 4

TABLE OF CONTENTS page ACKNOWLEDGMENTS.................................................................................................iii LIST OF ABBREVIATIONS..........................................................................................viii ABSTRACT.......................................................................................................................xi CHAPTER 1 LITERATURE REVIEW.............................................................................................1 Biotin............................................................................................................................1 Chemistry and Function of Biotin.........................................................................1 Food Sources, Bioavailability, and Requirement of Biotin...................................4 Indices of Biotin Status.........................................................................................6 Absorption and Transport......................................................................................7 Biotin Transport in the Central Nervous System..................................................8 Biotin Excretion.....................................................................................................9 Biotin Deficiency: Symptoms and Metabolic Bases..........................................10 Preferential Maintenance of Biotin in the Brain During Biotin Deficiency........12 Epilepsy......................................................................................................................13 Effects of Anti-Epileptic Drugs on Biotin Status................................................14 Mechanism of Altered Biotin Status During AED Therapy...............................15 Carbamazepine....................................................................................................16 Effects of Anti-Epileptic Drugs on Other Vitamins............................................17 Overall Rationale........................................................................................................19 Hypothesis #1: Chronic oral CBZ administration in rats decreases biotin status......................................................................................................20 Hypothesis #2: Chronic oral CBZ administration in rats reduces biotin-dependent enzyme expression and activity......................................................20 Hypothesis #3: Chronic oral CBZ administration in rats and subsequent reduction of biotin-dependent enzyme activity generates potentially neurotoxic intermediates..................................................................................20 Hypothesis #4: Supplementation with a pharmacological dose of biotin restores biotin status and function in rats receiving chronic oral CBZ administration..................................................................................................20 Hypothesis #5: While investigating hypothesis #4, we found that biotin supplementation increased pyruvate carboxylase activity without altering the biotinylated form of the enzyme; consequently, it was hypothesized that iv

PAGE 5

pyruvate carboxylase can be activated by other compounds including NADH..............................................................................................................20 2 THE ABUNDANCE AND FUNCTION OF BIOTIN DEPENDENT ENZYMES ARE REDUCED IN A RATS CHRONICALLY ADMINISTERED CARBAMAZEPINE..................................................................................................22 Materials and Methods...............................................................................................23 Materials..............................................................................................................23 Animals and Dietary Treatments.........................................................................24 Sample Preparation..............................................................................................24 Competitive Binding Assay of Biotin.................................................................25 Measurement of CBZ and CBZ-e........................................................................26 Synthesis of Avidin-AlexaFluor 430...................................................................27 Detection and Quantification of Biotinylated Proteins.......................................27 Lactate and Ammonia Measurements.................................................................29 Measurement of Pyruvate Carboxylase Activity.................................................29 Statistical Analysis..............................................................................................30 Results.........................................................................................................................30 Dietary Carbamazepine Administration in a Rodent Model of Biotin Nutriture...........................................................................................................30 Effect of Carbamazepine on Organic Acids and Ammonia................................32 Effect of Carbamazepine Administration on Urine, Serum, Liver, and Brain Biotin and Biotin Metabolites..........................................................................32 Effect of Carbamazepine Administration on the Abundance of BiotinDependent Enzymes in Liver and Brain..........................................................34 Effect of Carbamazepine Administration on the Activity of Hepatic Pyruvate Carboxylase......................................................................................................35 Discussion...................................................................................................................36 3 DIETARY CARBAMAZEPINE ADMINISTRATION DECREASES LIVER PYRUVATE CARBOXYLASE ACTIVITY AND BIOTINYLATION BY DECREASING PROTEIN AND mRNA EXPRESSION IN RATS.........................40 Materials and Methods...............................................................................................40 Materials..............................................................................................................40 Animals and Dietary Treatments.........................................................................41 Sample Preparation..............................................................................................41 Pyruvate Carboxylase Activity Assay.................................................................42 Detection of Biotinylated Biotin-Dependent Carboxylases................................42 In Vitro Biotinylation..........................................................................................42 Measurement of Biotin, Biotin Sulfoxide, Bisnorbiotin, and Biocytin...............43 Measurement of Carbamazepine.........................................................................43 RNA Isolation and Northern Blotting.................................................................43 Real-Time Reverse Transcriptase PCR Conditions............................................44 Real-Time Reverse Transcriptase PCR Conditions............................................44 Statistical Analysis..............................................................................................45 v

PAGE 6

Results.........................................................................................................................45 Effect of CBZ on Metabolites.............................................................................45 Effect of CBZ Administration on PC Biotinylation, Activity, and Protein and mRNA Expression....................................................................................46 Discussion...................................................................................................................49 4 PHARMACOLOGICAL BIOTIN SUPPLEMENTATION MAINTAINS BIOTIN STATUS AND FUNCTION IN RATS ADMINISTERED DIETARY CARBAMAZEPINE..................................................................................................54 Materials and Methods...............................................................................................55 Materials..............................................................................................................55 Animals and Dietary Treatments.........................................................................55 Sample Preparation..............................................................................................56 Pyruvate Carboxylase and Acetyl CoA Carboxylase Activity Assays...............57 Detection of Biotinylated Biotin-Dependent Carboxylases................................58 Measurement of Metabolites...............................................................................58 Statistical Analysis..............................................................................................59 Results.........................................................................................................................60 Concentration of CBZ in the Diet, Serum, Liver and Brain................................60 Effect of CBZ on Metabolites.............................................................................60 Effect of NADH on Hepatic PC Activity............................................................65 Discussion...................................................................................................................68 5 CHARACTERIZATION OF PYRUVATE CARBOXYLASE ACTIVATION BY NADH..................................................................................................................72 Experimental Procedures............................................................................................73 Materials..............................................................................................................73 Purification of Pyruvate Carboxylase..................................................................74 Pyruvate Carboxylase Activity Assay.................................................................75 Results.........................................................................................................................75 Pyruvate Carboxylase Purification......................................................................75 Kinetic Constants.................................................................................................77 Discussion...................................................................................................................79 6 DISCUSSION.............................................................................................................83 APPENDIX A GENERAL METHODS.............................................................................................90 Protein Concentration Measurement..........................................................................90 Preparation of HPLC Standards..................................................................................90 Synthesis of L and D-Biotin Sulfoxides..............................................................90 Synthesis of Bisnorbiotin....................................................................................91 HPLC Conditions for Biotin Measurements...............................................................92 vi

PAGE 7

Method Validation for the Measurement of Carbamazepine in Serum Using HPLC...............................................................................................................92 Separation of Propionyl CoA Carboxylase and Methylcrotonyl CoA Carboxylase............................................................................................................94 Linearity of Avidin-AlexaFluor 430 Detection Using STORM Fluorescent Scanner...................................................................................................................94 Biotinylated Protein Competition with Biotin Using Avidin-AlexaFluor 430 Detection..........................................................................................................95 Diet Preparation..........................................................................................................96 LIST OF REFERENCES...................................................................................................98 BIOGRAPHICAL SKETCH...........................................................................................112 vii

PAGE 8

LIST OF ABBREVIATIONS ACC1 Acetyl CoA carboxylase 1 ACC2 Acetyl CoA carboxylase 2 AI Adequate intake AIN American Institute of Nutrition ANOVA Analysis of variance AED Anti-epileptic drug AP Alkaline phosphatase APS Ammonium persulfate ATP Adenosine triphosphate BSA Bovine serum albumin BBSA Biotinylated bovine serum albumin BNB Bisnorbiotin BSO Biotin sulfoxide CBZ Carbamazepine CBZ-e Carbamazepine 10, 11-epoxide CNS Central nervous system DMSO Dimethyl sulfoxide ECL-Plus Enhanced chemiluminescence plus ECF Enhanced chemifluorescence EDTA Ethylenediaminetetraacetic acid viii

PAGE 9

EEG Electroencephalogram HCS Holocarboxylase synthase HEM HEPES, EDTA, Mannitol HEPES 4-(2-hydroxyethyl)-1-piperarzineethanesulfonic acid 3-HIA 3-hydroxyisovaleric acid HPLC High-performance liquid chromatography HRP Horseradish peroxidase i.p. Intraperitoneal Kda Kilodalton kg Kilogram MCC Methylcrotonyl CoA carboxylase mg Milligram MSUD Maple syrup urine disease NFDM Nonfat dry milk NHS-biotin N-hydroxysuccinimide ester OAA Oxaloacetate PBS Phosphate buffered saline PC Pyruvate carboxylase PCC Proptionyl CoA carboxylase SDS Sodium dodecyl sulfate SDS-PAGE SDS-polyacrylamide gel electrophoresis SMVT-1 Sodium-dependent multivitamin transporter TBS-T Tris buffered saline, tween-20 ix

PAGE 10

TCA Tricarboxylic acid cycle TEMED N,N,N,N-Tetramethylethylenediamine TFA Trifluoroacetic acid g Microgram YPD Yeast extract, peptone, dextrose x

PAGE 11

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy EFFECTS OF ORAL CARBAMAZEPINE ADMINISTRATION ON BIOTIN METABOLISM IN RATS By Sara C. Rathman August 2003 Chair: Jesse F. Gregory III Major Department: Food Science and Human Nutrition Clinical studies indicate that anti-epileptic drug therapy with carbamazepine often is associated with a 50% decrease in plasma biotin. It is estimated that over 80% of epileptics taking anti-epileptic drugs such as carbamazepine exhibit some degree of biotin deficiency. Decreased biotin status among epileptics is accompanied by metabolic alterations including lactic acidemia that imply loss of function of biotin-dependent enzymes as observed in other examples of biotin deficiency. Although the biotin deficiency that accompanies carbamazepine therapy has been clinically characterized, it is poorly understood at the biochemical level in tissues, particularly in the brain. It was hypothesized that carbamazepine decreases brain biotin status and function of biotin-dependent enzymes, which could result in lactate accumulation. It was also hypothesized that pharmacological doses of biotin would maintain biotin status and function during carbamazepine administration and, therefore, reduce lactate accumulation. These hypotheses were tested using a rat model of oral xi

PAGE 12

carbamazepine administration consuming a physiologically relevant level of biotin, while examining free and protein bound pools of biotin in the brain, liver, serum, and urine. Serum and liver free biotin decreased after long-term carbamazepine administration (>48 d), and pharmacological biotin supplementation completely prevented these decreases. Carbamazepine decreased specific enzymatic activity and biotinylated forms of pyruvate and acetyl CoA carboxylases in both liver and brain. Decreased biotinylated pyruvate carboxylase was due to decreased protein and mRNA expressions in carbamazepine-treated rats. Biotin supplementation prevented the decrease in biotinylation of hepatic and brain acetyl CoA carboxylase and specific activity of both acetyl CoA and pyruvate carboxylases. Brain and serum lactate concentrations were elevated after 68 d of carbamazepine administration, and were reduced to concentrations similar to control animals with biotin supplementation. Conversion of lactate to pyruvate, with concurrent generation of NADH, during biotin supplementation may explain how increases in pyruvate carboxylase activity could occur without changes in biotinylated pyruvate carboxylase since NADH is an activator of pyruvate carboxylase activity in vitro. These results support the use of biotin supplementation as a concurrent strategy during carbamazepine administration to maintain biotin status, function of biotin-dependent enzymes, and decrease carbamazepine-induced lactate accumulation. xii

PAGE 13

CHAPTER 1 LITERATURE REVIEW Biotin Chemistry and Function of Biotin Biotin is a water-soluble, B-vitamin that exists freely or bound to proteins in one form, as d-(+)-biotin (1). Its structure consists of an ureido group bound to a tetrahydrothiophene ring with a five-carbon valeric acid side chain. The two rings in the molecule have a boat configuration with respect to each other (1). The free carboxyl group of the valeric acid side chain is required for binding to the -amino group on a specific lysine residue of biotin-dependent carboxylases, and the ureido group has an important role in binding with avidin, a glycoprotein found in egg-whites. Biotin is a required cofactor for pyruvate carboxylase (PC), acetyl CoA carboxylase isoforms 1 and 2 (ACC1/2), propionyl CoA carboxylase (PCC), and -methylcrotonyl CoA carboxylase (MCC). The active form of these enzymes requires biotin covalently bound, which occurs through a reaction catalyzed by holocarboxylase synthase (HCS). Biotin is covalently attached to the apocarboxylases and participates in two sequential reactions catalyzed by this enzyme. First, biotin is adenylated in a reaction that is thermodynamically favorable because of the concurrent hydrolysis of pyrophosphate. Then, the holocarboxylase is formed via an amide linkage of the carboxyl group of biotin to the -amino group of a specific lysine residue in a highly conserved motif (AMKM) located 35 amino acids from the C-terminus of biotin-dependent enzymes (2). 1

PAGE 14

2 Biotin is hydrolyzed from the holocarboxylase to form biocytin, or biotinyl lysine. Biotinidase cleaves the lysine from biocytin to form free biotin (3). NHNHSOOHO NHNHSONHONH2OHO N H N H S O O BCCP N H N H S O A MP O NHN H S O OHOO NHN H S O O H O Proteolysis BiotinidaseHolocarboxylase Synthase HolocarboxylaseSynthaseSulfurOxidationSide ChainOxidationBisnorbiotin Biotin SulfoxideBiotinBiocytinBiotinyl-AMP Holocarboxylase Figure 1-1. Metabolism of biotin. L and d-biotin sulfoxides (BSO) and bisnorbiotin (BNB) are the major inactive metabolites of biotin (4) (Fig. 1-1). BNB is formed in microbes by -oxidation of the valeric acid side chain of biotin; however, the exact mechanism in mammals is still not known (5). While BSO accounts for approximately 3% of avidin binding species in human serum, BNB accounts for approximately 38%, and biotin accounts for half of the total avidin binding species in the serum (6). In the urine, biotin, BSO, and BNB account for more than 80% of total avidin binding species (7). The five biotin-dependent enzymes are involved in carbohydrate, fatty acid, and amino acid metabolism (Fig. 1-2). PC is located in the mitochondria and catalyzes the conversion of pyruvate to oxaloacetate (OAA), an intermediate of the tricarboxylic acid

PAGE 15

3 (TCA) cycle and a precursor for gluconeogenesis. PCC, also located in the mitochondrial matrix, is involved in amino acid catabolism (8). Specifically, it catalyzes the carboxylation of propionyl CoA to D-methylmalonyl CoA. Propionyl CoA is a product formed from the catabolism of isoleucine, valine, methionine, and it is a product of odd-chain fatty acid oxidation. It is also formed during the synthesis of bile acids. The product of the reaction, D-methylmalonyl CoA, can then racemize to L-methylmalonyl CoA and then isomerize to succinyl CoA, which is also an intermediate of the TCA cycle. Propionyl CoA can be shunted to another pathway where 3-hydroxypropionate and methylcitrate are formed in the case of a biotin deficiency or PCC deficiency. Increased concentrations of these organic acids were found in the urine of patients with biotin deficiency (9,10). PCC consists of an and subunit, with the chain containing the site for biotin binding (11). Methylcrotonyl CoA carboxylase is also a mitochondrial enzyme and is essential for the catabolism of leucine. It is responsible for catalyzing the conversion of 3-methylcrotonyl CoA to 3-methylglutaconyl CoA. In the case of biotin deficiency, 3-methylcrotonyl CoA is instead converted to 3-hydroxyisovaleric acid (3-HIA), which is also a validated early indicator of decreased biotin status (12). Both isoforms of ACC (ACC1 and ACC2) catalyze the carboxylation of acetyl CoA to form malonyl CoA, a substrate for fatty acid synthesis. The two isoforms are homologous, except for an additional 180 amino acids at the N terminus that target the protein to the outer mitochondrial membrane. ACC1 is highly expressed in the liver and adipose in the cytosol, whereas ACC2 is predominantly expressed in cardiac and skeletal muscle tissue (13).

PAGE 16

4 acetoacetyl CoA lipogenesis valine isoleucine methionine pyruvate acetyl CoA citrate succinyl CoA oxaloacetate gluconeogenesis propionyl CoA malonyl CoA leucine PC ACC M C C PCC odd chain fatty acid oxidation bile acid formatio n Figure 1-2. Diagram of pathways with biotin-dependent enzymes. PC, pyruvate carboxylase; ACC, acetyl CoA carboxylase isoforms 1 and 2; b-MCC, b-methylcrotonyl CoA carboxylase; PCC, propionyl CoA carboxylase. Each of the carboxylases has two catalytic sites that are involved in the carboxylation of the substrate. The first site, the biotin carboxylase site, is where the carboxylation of biotin occurs using bicarbonate as the carboxyl donor. Carboxylated biotin is physically moved to the second site, the carboxyl transferase site, by rotating one of the 10 single bonds of the valeryl-lysyl side chain. This catalytic site transfers the carboxyl group from biotin to the substrate (3). Food Sources, Bioavailability, and Requirement of Biotin Biotin is widely distributed among foods. Foods sources with the highest concentrations of biotin include royal jelly (400 g/100 g), brewers yeast (80 g/100 g),

PAGE 17

5 egg yolk (20 g/100 g), calf kidney (100 g/100 g), soybeans (60 g/100 g), cauliflower (17 g/100 g), and peanuts (34 g/100 g) (3,14). Most biotin in meats and cereals is protein bound and the bioavailability is highly variable, depending on the food source (15). Biotin from wheat is poorly available but it is nearly 100% available in corn (16). Protein bound biotin is only absorbed after non-enzymatic proteolysis and cleavage of lysine by biotinidase; therefore, factors that affect protein digestion also affect biotin uptake. The dietary reference intake for biotin has been determined based on adequate intake (AI) data only (17). To date, there is no recommended dietary allowance reported for biotin. This is based on lack of data and a general consensus that colonic bacteria synthesize biotin that contributes to the daily supply (17). Microbial synthesis of biotin takes place in the lower part of the intestine where there is limited nutrient absorption, so it is controversial as to the amount of available biotin that colonic bacteria contribute that is available for host metabolism. One study done in minipigs concluded that only approximately 1.7% of the biotin requirement is satisfied by bacterial synthesis (18). When considering that frank nutritional biotin deficiencies are rare, the AI was considered to be adequate until further research proves otherwise. Epileptic patients taking certain anticonvulsants (19,20) and pregnant women (21) have been reported to have marginal biotin deficiencies but the effects of such a status are still not fully understood. The AI for adults is extrapolated from the AI for healthy infants consuming breast milk and has been determined to be 30 g/day for men and women >19 years. (17).

PAGE 18

6 There is no upper limit (UL) reported for biotin based on lack of symptoms of biotin toxicity when administered at high doses. Patients receive up to 200 mg biotin orally for treatment of inborn errors of metabolism without any toxicity symptoms (1). Indices of Biotin Status There is no one set indicator of biotin status. In older literature, plasma or serum biotin alone was used to indicate biotin status. In an effort to determine if there is a more sensitive indicator of biotin status, biotin intake was decreased in 10 healthy subjects who also consumed enough avidin to bind seven times the amount of biotin found in the diet (12). Avidin is a glycoprotein found in egg-whites that can bind biotin very tightly (K d = 10 -15 M) and, thus, render it unavailable. Urinary excretion of biotin and its metabolites decreased significantly after 3 d (7 d for BSO) and urinary excretion of 3-HIA increased significantly after 3 d; however, these decreases were not out of the normal range until days 7 and 17, respectively. Serum biotin, on the other hand, did not decrease significantly throughout the study. This study showed that serum biotin concentration alone should not be used as an indicator of biotin status (12). The method for measuring biotin also must be considered when reviewing literature stating biotin status. Microbiological methods are not highly accurate, since other nutrients such as fatty acids in the sample preparation may promote certain microorganisms growth and interfere with assay results (22). These assays underestimate total avidin-binding species because they do not detect biotin metabolites. Avidin-binding assays without HPLC separation also underestimate total avidin-binding species because they do not account for the slightly lower affinities of the metabolites for avidin. Avidin-binding assays not complemented with HPLC separation overestimate biotin concentration, since biotin only accounts for half of the total avidin-binding species in serum and urine (6,7). The most

PAGE 19

7 accurate and accepted measurement of biotin and biotin metabolites includes a combined HPLC/competitive assay with standard curves for all species measured. Absorption and Transport Biotin in the form of free biocytin is the predominant form of biotin found in foods (15). Biotinidase activity is necessary for breaking down biocytin to yield biotin and lysine and is found in pancreatic juice and intestinal mucosal secretions (15). Absorption of biotin is highest in the jejunum, followed by the ileum with 50% of the absorptive capacity of the jejunum, and the lowest is in the colon with 12% of the absorptive capacity of the jejunum (23). Biotin uptake occurs by both simple diffusion and carrier-mediated transport. Studies show that there is saturable uptake of biotin on the brush border of the jejunum at low biotin concentrations and a linear uptake at higher concentrations (23). The saturable process in these studies is inhibited by structural analogs of biotin and is sodium and energy dependent. Similar to other vitamins during deficiency states, transport of biotin across jejunal and ileal brush border membranes was higher in biotin-depleted rats (24). The observed increase in transport during biotin depletion was due to an increase in the number of transporters since there was an increase in V max with little change in apparent K m This same study showed that upon supplementation with biotin, there was a decrease in V max compared to controls. These studies suggest that biotin transport is regulated by the concentration of biotin in the diet or body stores. Similar to the intestinal brush border transporter for biotin, the basolateral transporter in the intestine is saturable as a function of concentration, and it is inhibited by structural analogs of biotin. Unlike the transporter on the brush border membrane, the transporter on the basolateral membrane is sodium independent (25). Recently, a

PAGE 20

8 sodium-dependent multivitamin transporter (SMVT) has also been identified (26) and determined to be an electrogenic process, where there is a 2:1 coupling ratio of Na + :substrate (27). This transporter transports both biotin and pantothenate. The K m for biotin is 8.1 1.6 mmol/L, which highly exceeds the concentration of biotin normally found in the serum (~0.5 nmol/L). Another biotin transporter has recently been found in human peripheral blood mononuclear cells that has a K m of 2.6 0.4 nmol/L, which is much closer to the physiological concentration of biotin in the blood (28). Biotin exists in the blood both freely and covalently bound to protein. Mock and Malik (29) estimate that 12% of biotin in human serum is covalently bound to protein, 7% is reversibly bound, and 81% is free biotin. Biotinidase can act as a specific human serum biotin binding protein (30) that is possibly the major carrier of biotin in plasma. This group also confirmed that human serum albumin and and -globulins can bind biotin nonspecifically. Biotin Transport in the Central Nervous System To protect the brain from fluctuations in blood composition, two barriers are present. There is a blood-cerebral spinal fluid (CSF) barrier that is formed by tight junctions between the choroid plexus epithelial cells, the arachnoid membrane cells, and the circumventricular organs (31). The second is the blood-brain barrier also formed of tight junctions between the cells of the cerebral capillary endothelium. Only water and some salts are permitted to freely pass through these barriers. There is no tight barrier between the CSF and the extracellular space of the brain. Certain observations show that brain biotin stores are preferentially maintained during biotin deficiency (32,33), which suggests a role of transport in the regulation of biotin concentration in the CSF and brain.

PAGE 21

9 Other water-soluble vitamins including ascorbic acid, folate, and thiamin do not enter the brain through the blood-brain barrier (34), but through the choroid plexus (35), which is the interface of the blood-CSF barrier. Unlike these other water-soluble vitamins, there is no evidence in rat brain for a concentrating mechanism in the choroid plexus involved in transporting biotin between the blood and CSF (36). Spector and Mock (37) demonstrate that there is very little passive transport of biotin across the blood-brain barrier. There is evidence for sodium-dependent, carrier-mediated transport across the blood-brain barrier that is inhibited by pantothenic acid and nonanoic acid, but not biocytin or biotin methyl ester. Desthiobiotin and diaminobiotin have altered ureido ring structures and were also shown to inhibit transport of biotin (38). This is evidence that a free carboxyl end is required for transport across the blood-brain barrier by this specific biotin transporter that has a K m well above the physiological range of normal serum biotin (38). In other studies with cultured primary cell bovine brain microvessel endothelial cells from the blood-brain barrier, biocytin but not pantothenic acid or nonanoic acid was shown to compete with the saturable biotin uptake (39), which suggests there is probably another transporter in which the free carboxyl group of biotin is not required for binding. Biotin Excretion Biotin is excreted in both the urine and feces, but the majority is excreted in the urine. In tracer studies where carbonyl14 C biotin was given intravenously to rats, 60% of the label appeared in the urine 24 h after infusion while only 2% was detected in the feces (40). This could either mean that biliary excretion is quantitatively low or it could be evidence for enterohepatic circulation where biotin excreted into the bile was then reabsorbed or metabolized by microbial organisms in the colon; however, it has been shown that there is very little biliary biotin excretion (40).

PAGE 22

10 Biotin Deficiency: Symptoms and Metabolic Bases There is evidence that women become marginally biotin deficient during pregnancy (21). Biotin deficiencies have also been reported in individuals with inborn errors of metabolism, including multiple carboxylase deficiencies. There are two types of multiple carboxylase deficiencies: an early onset type with HCS deficiency, or a late onset type characterized by a biotinidase deficiency. A HCS deficiency results in the inability to biotinylate apocarboxylases, which yields inactivity of the five biotin-dependent carboxylases. Biotinidase deficiency is associated with low biotin status since biotin remains in an unavailable biotinyl-lysine form. In a biotinidase deficiency, seizures unresponsive to anti-epileptic drug (AED) therapy are reported in 50-75% of affected children, along with symptoms of developmental delay, dermatitis, ataxia, hearing loss, optic atrophy, and sensorineural hearing loss (41). In one study of 78 symptomatic children with a biotinidase deficiency, 55% had generalized tonic-clonic, generalized clonic partial seizures, infantile spasms, or myoclonic seizures (42). Biotin supplementation (5-10 mg/d) was effective in stopping the seizures within 24 h in 75% of the children. A small number of patients developed irreversible neurological damage and did not respond to biotin therapy. In other studies of biotinidase deficiencies, reversal of brain atrophy with biotin treatment was reported (43). At the cellular level, the effects of a biotin deficiency result in death of neurons in contact with astroglial cells (44). This same study showed that a biotin deficiency in rats resulted in a latent condition of altered neuronal excitability. Biotin deficient rats experienced a greater duration and more severe seizures after kindling stimulations compared to controls. Loss of function of biotin-dependent carboxylases accompanies a biotin deficiency and also results in adverse neurological effects. ACC is the rate limiting enzyme for de

PAGE 23

11 novo long-chain fatty acid synthesis from glucose or ketone body precursors in the brain (45). Fatty acids in the brain serve as either structural components of cells or as components of the complex lipids of myelin, which include galactosphingolipids and phospholipids. As expected, the highest specific enzymatic activities of ACC in the brain occur during peak myelination (14-29 days postnatal) periods and in the oligodendrocytes, which are the myelinating cells of the central nervous system (46). Biotin depletion in the brain during myelination periods could be expected to have detrimental effects on myelination due to decreased ACC activity. PC is also a biotin-dependent enzyme crucial for neurological health. There are two types of PC deficiencies characterized differently depending on clinical symptoms. In the neonatal type, there is severe lactic acidemia and death within 1-2 months after birth. In the less serious, juvenile type, there are reported episodes of lactic acidemia along with seizures, developmental delay, and failure to thrive (47). During biotin-responsive multiple carboxylase, biotinidase, and PC deficiencies, lactate and pyruvate build up in the body (33,48). Lactate accumulation in the brain is of particular concern because lactate does not easily cross the blood-brain barrier (49,50) and can have adverse effects in other tissues (51-53). MCC is involved with the catabolism of leucine, which also has an important role in maintaining neurological health. Branched-chain amino acids rapidly cross the blood-brain barrier, and the influx of leucine into the brain exceeds that of any other amino acid (54). Leucine plays a significant role in buffering brain glutamate concentration. It is rapidly converted to glutamate and -ketoisocaproate (-KIA) in the astrocytes. -KIA is then shunted to the extracellular space, where neurons take up -KIA and consume

PAGE 24

12 glutamate for the production of leucine to make a complete cycle (55). MCC catalyzes the conversion of -methylcrotonyl CoA, a catabolite of -KIA, to -methylglutaconyl CoA. Intraperitoneal (i.p.) administration of -KIA and leucine in rats leads to increased absence seizure activity speculated to be a result of altered glutamate concentration (55). Leucine is an allosteric activator of glutamate dehydrogenase, which catalyzes the reversible oxidation of glutamate and subsequently produces ammonia (56), a well documented neurotoxin (57). Hyperammonemia alters the balance between inhibitory and excitatory neurotransmission (57). MCC deficiency in humans results in convulsions or infantile spasm seizure activity that may be the result of a buildup of organic acids or ammonia (41). Other organic acids, such as propionic acidemia present in a PCC deficiency, also induce seizure activity. Newborns with propionic acidemia have seizures as the primary symptom (47). Maple Syrup Urine Disease (MSUD) is characterized by a defect in the branched-chain -ketoacid dehydrogenase complex that results in an accumulation of branched-chain amino acids and their ketoacids. This can be related to a biotin-deficient state because in both cases there is decreased catabolism of branched-chain amino acids. In MSUD, clinical symptoms include diffuse myelin loss in the brain, degeneration of the white matter in the brain and, if left untreated, myoclonic jerks and partial seizures (58). Preferential Maintenance of Biotin in the Brain During Biotin Deficiency There is less turnover of free biotin from biotinylated carboxylases in the brain compared to other tissues (36). Biotinidase activity is also normally low in human brain (59). In biotin-depleted rats, brain PC activity decreased to 53% of the control values, whereas hepatic activity decreased to 3% of controls (33). In another study, activities of

PAGE 25

13 PC and PCC in rat brain, liver, kidney, and brain were compared during biotin deficiency (60). In this experiment, both PC and PCC activities dropped to only 65% and 60% of the control values after 40 days while hepatic and kidney carboxylase activities dropped to less than 5% and 25% of the control values. These studies were also in agreement with observations of Bhagavan and Coursin in which rats were depleted of biotin for 8 weeks, and liver biotin decreased 90% while brain biotin only decreased 50% (32). In another study, ACC activity and protein expression were decreased in liver and adipose during fasting conditions in rats, while there were no changes observed in brain tissue (45). All of these studies report that the brain is one of the last tissues in the body to be depleted of its biotin stores and that there may be unique regulation of biotin status in the brain. This suggests the importance of biotin for normal brain function. Epilepsy Epilepsy is a condition characterized by recurrent seizures that affects 0.5-1% of the population, with the highest incidence among neonates and elderly (61). It is defined as a condition in which a person is prone to epileptic seizures. There are many different types of seizures but generally they are defined as abnormal or excessive discharges of a set of neurons (61). Seizures are commonly classified according to the International Classification of Epileptic Seizures founded in 1981 by the International League Against Epilepsy into groups that include two criteria: the clinical symptoms and the electroencephalogram (EEG) pattern (62). Seizures are also classified according to their origin in the brain. Generalized seizures arise from the cortex in both hemispheres of the brain while partial seizures arise from a small locus in one hemisphere of the brain. Partial seizures can spread to become a generalized seizure and are then secondarily generalized.

PAGE 26

14 Seizures can arise from a number of events including alterations in blood-brain barrier permeability or altered neuronal excitability (61). Acute cerebral insults including stroke, trauma, and infection are also seizure provoking. Other conditions that are associated with seizures include metabolic disorders or inborn errors of metabolism (63). In 70% of cases, however, the cause of seizures is unknown (64). Medical management of epilepsy is primarily performed through pharmacotherapy, although other treatment options include surgery, vagus nerve stimulation, and a ketogenic diet (64,65). In the United States, approximately 1.6 million people have inadequate relief of seizures or experience seizures unresponsive to anti-epileptic drug (AED) therapy (65). The goal of AED therapy is to stop seizures without incurring side effects that would reduce quality of life among patients. AED therapy is accompanied by adverse side effects in over 50% of patients (64). One side effect that will be discussed further is the alteration of nutrient status, particularly with respect to the vitamin biotin. As previously stated, clinical investigations have documented decreased biotin status in epileptics undergoing long-term AED therapy (19,20). Effects of Anti-Epileptic Drugs on Biotin Status In a study of 404 epileptics treated with primidone, phenytoin, carbamazepine (CBZ), or phenobarbital, but not sodium valproate, plasma biotin concentration was significantly lower than controls not taking AEDs (0.9 0.29 and 1.63 0.49 nmol/L, respectively, p< 0.0005) (19). Patients with partial epilepsy who received higher daily intakes of AEDs had lower plasma biotin concentration than epileptics with generalized seizures prescribed lower AED doses. AEDs that induce a reduction of plasma biotin include primidone, CBZ, phenytoin, and phenobarbital. Patients receiving sodium valproate had a significantly higher plasma biotin concentration than those on primidone,

PAGE 27

15 CBZ, phenytoin, or phenobarbital, but still lower than controls not taking AEDs. In this same study, three patients were followed before and after AED therapy with primidone or phenytoin. In all three patients, plasma biotin increased during the first week of therapy and then decreased below the initial plasma biotin concentration in the following weeks (19). In another study, Krause and colleagues examined 264 epileptics undergoing long-term AED therapy with phenytoin, primidone, CBZ, or sodium valproate (20). Plasma biotin concentration was significantly lower in AED-treated patients compared to controls (227 80 ng/L vs. 448 201 ng/L for the epileptics and controls, respectively). Patients taking valproate also had significantly lower plasma biotin than controls but significantly higher plasma biotin than those taking primidone, phenytoin, or CBZ. Urine and plasma lactate concentration was elevated in AED-treated epileptics (19); however, no information is known about lactate concentration at the tissue level. While elevated organic acids are suggestive of decreased biotin-dependent enzyme function, this phenomenon has not been investigated during AED therapy. Mechanism of Altered Biotin Status During AED Therapy Although decreased biotin status after AED therapy is not completely understood, several potential mechanisms include competition for uptake in the intestine and increased biotin metabolism. CBZ and primidone, but not valproate, competitively inhibit biotin transport across the intestinal brush border membrane in cell culture studies (66). The affected sodium-dependent transporter is also inhibited by biocytin, which suggests that there is no free carboxyl group required for transporter binding. Biotin transporters in the brush border of human kidney cortex and blood brain barrier apparently require a free carboxyl group because they are not inhibited by biocytin nor are they inhibited by primidone or CBZ (38,67). A number of AEDs, including CBZ and

PAGE 28

16 primidone, have an ureido group that is structurally similar to biotin (seen in bold in Fig. 1-3), which suggests this could be the functional group competed against for the intestinal transporter binding site. Valproate does not have an ureido group and, therefore, it is reasonable that it does not compete for biotin uptake. Another potential mechanism includes induction of sulfur oxidation and -oxidation processes that catabolize biotin. CBZ and/or phenytoin treatment in children (68) and adults (69) yielded increased excretion of the inactive biotin catabolites, BNB and BSO. In contrast, valproate is a known inhibitor of mitochondrial -oxidation (70); therefore, it would be expected that if BNB is a metabolite of biotin formed from -oxidation in the mitochondria, then more biotin and less BNB would be present. This phenomenon has not been investigated, but these mechanisms may explain why plasma biotin concentrations are not as depressed in epileptics undergoing valproate therapy. N O H 2 N S N HH N O OHONHHNOOHNONHOOCOOHcarbamazepine biotin primidone phenobarbital valproate Figure 1-3. Structures of biotin and anti-epileptic drugs with common ureido groups. Carbamazepine CBZ, originally synthesized for treatment of trigeminal neuralgia, is now one of the AEDs of choice for secondarily generalized tonic-clonic seizures (71). Its mechanism of action is not completely understood, but there is evidence that it may enhance sodium channel inactivation (71,72). This stabilizes neuronal membranes preand postsynaptically by reducing high-frequency repetitive firing of action potentials or by

PAGE 29

17 slowing synaptic transmission (71). Another proposed mechanism involves the blockage of N-methyl-D-aspartate (NMDA) receptor mediated events (73). NMDA is a glutamate receptor with involvement in seizure generation. CBZ is also known to be involved in the induction of hepatic enzymes such as multiple cytochrome P450 subfamilies (74). Approximately 70-80% of orally administered CBZ is absorbed (75) with no differences observed when the drug is taken with or without food. The body rapidly metabolizes CBZ and, therefore, less than 1% is excreted as CBZ in urine (76). CBZ is capable of inducing its own metabolism to CBZ 10,11-epoxide (CBZ-E), which also has anticonvulsant properties (71). As the duration of CBZ therapy increases, autoinduction becomes more efficient and consequently shortens the half-life of plasma CBZ (77). Effects of Anti-Epileptic Drugs on Other Vitamins Megaloblastic anemia observed in patients undergoing AED therapy prompted a further look at folate and B12 status of these patients. Reports of folate deficiency in non-anemic epileptics treated with AEDs followed (78). Intestinal absorption of supplemental folic acid during AED therapy was not affected; however, the absorption of food folates was inhibited (79). Within one week of treatment, primidone (100 mg/kg, twice daily) caused a decrease in pteroylpentaglutamates in the liver to less than half of that of the controls and total liver folate concentration decreased by 30% in rats (80). This same study found no effect on brain folate concentration. Disturbances of folate metabolism have also been observed after CBZ, phenytoin, phenobarbital, and valproate. The effects, however, were different depending on the type of AED. Red cell folate concentrations were significantly decreased in patients receiving phenytoin or CBZ but not with valproate (81). Folic acid supplementation in humans and rats restored plasma folate that was decreased by phenytoin treatment but the decreased brain folate was not

PAGE 30

18 restored (82). Results from this same study showed that phenytoin increased methylation capacity (S-adenylmethionine: S-adenylhomocysteine ratio) in brain but decreased the capacity in the liver. Supplementation with folic acid restored methylation capacity in the liver with no effect on the brain. There are potential confounding problems with the rat studies of oral AED administration described above in that none measured daily food intake compared to controls (80,82,83). It was noted in these studies that AED-treated rats gained significantly less weight when administered either phenytoin or CBZ but there was no record of food intake. This presents a major flaw in the design of the study because any decrease in folate concentration in the body could have been due to less food intake and, therefore, less folate intake. Vitamin B6 status was not altered significantly in the whole brain of rats that were genetically epilepsy prone (84); however, there were differences in individual regions of the brain. The concentration of pyridoxal phosphate was lower in the cerebral cortex in the seizure prone rat compared to controls but the opposite was true in the cerebellum. No changes were noted in the hippocampus or the basal ganglion. Vitamin status in 146 epileptics on chronic AED therapy was determined for a number of vitamins and there was a reported deficiency for vitamins B6 and B2 (85). There was no significant change for vitamins B1, B12, A, C, E, or beta-carotene. The most markedly reduced vitamins included folate, biotin, and vitamin D. In this study, 40% of epileptics were folate deficient, 35-43% had decreased plasma vitamin D concentration, and 80% had reduced plasma biotin concentration. In other studies, vitamin B12 concentration in the serum of

PAGE 31

19 AED-treated epileptics was lower than controls (86). Valproate-treated individuals had higher serum vitamin B12 than controls (87). A vitamin K deficiency is prevalent among neonates due to low placental transport and is especially prevalent in neonates exposed to AEDs in utero (88). It is hypothesized that CBZ, phenytoin, and phenobarbital induce microsomal mixed-function oxidase enzymes in fetal liver and these enzymes increase degradation of vitamin K. In one clinical study, antenatal vitamin K therapy (10 mg/d) administered during the last days of pregnancy of AED-treated mothers resulted in normal vitamin K status in neonates (89). Overall Rationale Although it is established that chronic treatment with AEDs including CBZ results in some degree of biotin deficiency in over 80% of patients, the impact on brain biotin and biotin-dependent enzymes involved in carbohydrate, lipid, and protein metabolism is unknown. This research project investigated the metabolic changes of biotin in the brain and the potential protective role of biotin supplementation during CBZ administration. This characterization has important clinical significance as biotin may have future use in medical management of epilepsy. The following hypotheses were tested using an in vivo rat model with a physiologically relevant level of dietary biotin using the experimental strategy outlined in the specific aims.

PAGE 32

20 Hypothesis #1: Chronic oral CBZ administration in rats decreases biotin status. Specific aims 1 To determine dose-dependent effects of chronic CBZ administration on biotin status in brain, serum, and liver. 2 To determine time-dependent effects of oral CBZ administration on biotin status in brain, serum, and liver. Hypothesis #2: Chronic oral CBZ administration in rats reduces biotin-dependent enzyme expression and activity. Specific aims 1 To measure both apo and holoenzyme forms of the biotin-dependent enzymes, acetyl CoA, pyruvate, propionyl CoA, and methylcrotonyl CoA carboxylases after oral CBZ administration in brain and liver. 2 To measure specific enzyme activities of acetyl CoA, pyruvate, propionyl CoA, and methylcrotonyl CoA carboxylases after oral CBZ administration in brain and liver. Hypothesis #3: Chronic oral CBZ administration in rats and subsequent reduction of biotin-dependent enzyme activity generates potentially neurotoxic intermediates. Specific aims 1 To determine biotin status dependence of lactate and ammonia in liver, serum, and brain after oral CBZ administration. Hypothesis #4: Supplementation with a pharmacological dose of biotin restores biotin status and function in rats receiving chronic oral CBZ administration. Specific aims 1 To determine effects of pharmacological biotin supplementation on serum, brain, and liver biotin after oral CBZ administration. 2 To determine effects of pharmacological biotin supplementation on activity and expression of biotin-dependent enzymes after oral CBZ administration. 3 To determine effects of pharmacological biotin supplementation on serum, brain, and liver lactate concentration following oral CBZ administration. Hypothesis #5: While investigating hypothesis #4, we found that biotin supplementation increased pyruvate carboxylase activity without altering the biotinylated form of the enzyme; consequently, it was hypothesized that pyruvate carboxylase can be activated by other compounds including NADH.

PAGE 33

21 Specific aims 1 To determine whether NADH is an activator of pyruvate carboxylase in vitro using both physiological and pharmacological concentrations of NADH. 2 To determine whether kinetic constants of pyruvate carboxylase are altered by NADH.

PAGE 34

CHAPTER 2 THE ABUNDANCE AND FUNCTION OF BIOTIN DEPENDENT ENZYMES ARE REDUCED IN A RATS CHRONICALLY ADMINISTERED CARBAMAZEPINE (As published in J. Nutr. 132: 3405-3410, 2002) Pharmacological intervention remains the most common therapeutic approach for the treatment of epilepsy. Several compounds exhibiting anti-epileptic properties have been developed over the last 50 years, each with a characteristic mode of action and efficacy. As with many other types of medications, these AEDs have the potential to induce nutrient-drug interactions that affect nutritional status. Among the nutrient-drug interactions known to occur with AEDs are reductions in folic acid, vitamin D, and vitamin B 12 (80,85,86,90). Although less well appreciated and understood, one of the most prominent nutrient-drug interactions that occur with AED therapy, in terms of both frequency and magnitude, is that with the water-soluble vitamin biotin. Along with decreased serum biotin concentrations (9,19,91), CBZ increased urinary excretion of the organic acids 3-hydroxyisovaleric acid (3-HIA) and lactic acid (associated with insufficient MCC activity PC activity, respectively). Although lending substantial weight to the evidence of an AED-biotin interaction, these studies were potentially limited by the technique used to measure biotin, which lacks chemical specificity (92). Additionally, serum biotin in humans may be limited as a useful indicator of biotin status (93). A later study, however, confirmed these earlier clinical observations by demonstrating an increase in the urinary 22

PAGE 35

23 excretion of 3-HIA, a marker of MCC activity and a validated index of biotin status, in AED treated individuals (94). Although increased excretion of organic acids has been demonstrated during AED therapy, its association with insufficient or reduced activity of biotin-dependent enzymes during AED therapy has not been investigated, particularly at the tissue level. In this report, we have established a non-toxic rat model of chronic CBZ administration and evaluated its effects on the abundance and activity of biotin-dependent enzymes in both the liver and brain. Materials and Methods Materials Male Sprague-Dawley rats were obtained from Harlan (Indianapolis, IN). Purified biotin-free rat diet based on a modified AIN 76A formulation described previously (95,96) was obtained from Research Diets (New Brunswick, NJ). CBZ, 5-ethyl-5-p-tolybarbituric acid, CBZ 10, 11-epoxide (CBZ-e), D-biotin, protease inhibitor cocktail and ortho-phenylenediamine dihydrochloride were purchased from Sigma-Aldrich (St. Louis, MO); avidin-horseradish peroxidase was purchased from Pierce Chemical Company (Birmingham, AL); 96-well microtiter plates (Nunc Maxisorb) and bovine serum albumin (BSA) were purchased from Fisher Scientific (Pittsburgh, PA). Enhanced chemiluminescence reagent (ECL-Plus) was purchased from Amersham Pharmacia (Picastaway, NJ). Biotinylated BSA was synthesized by mixing 50 mL of 10 g/L BSA in ice-cold 0.1 mol/L NaHCO 3 (pH 7.5) with 5 mL of a 12 g/L N-hydroxysuccinimide ester (NHS-biotin) in dimethyl sulfoxide overnight at 4C. The mixture was dialyzed for 48 h with gentle stirring at 4C.

PAGE 36

24 Animals and Dietary Treatments Male Sprague-Dawley rats (n=20), 50-74 g initial weight, were housed individually in hanging wire-bottom cages in an environmentally controlled room with constant temperature (22 o C) and a 12-h light:dark cycle. The animals were fed a modified AIN 76A diet containing 0.06 mg biotin/kg diet for 5 days prior to the study to standardize their biotin status as previously described (97). The composition of the diet was spray-dried egg white (20%), corn starch (15%), sucrose (50%), cellulose (5%), corn oil (5%), AIN 76A mineral and vitamin mix (with 0.06 mg/kg biotin), and choline bitartrate (0.2%). The spray-dried egg white was its sole protein source. The protein avidin, contained within the egg white, binds ~1.44 mg biotin/kg purified diet (98). The amount of dietary biotin reported in these experiments represents that in excess of the biotin binding capacity of avidin as determined by HPLC-avidin binding assay as previously described (97). On day 5, rats were randomly divided into 3 dietary treatment groups receiving either 0 g CBZ/kg diet (n=10), 1.5 g CBZ/kg diet (n=5), or 2.9 g CBZ/kg diet (n=5) and remained on these diets for the next 19 d. On days 12, 19, and 23, animals were placed in metabolic cages for 3 h to allow the discrete collection of urine. On day 24, animals were anesthetized with halothane vapor and killed by exsanguination. Brain, liver, and serum were collected and prepared as described below. All procedures were approved by the University of Florida Animal Care and Use Committee. Sample Preparation After anesthesia, whole blood was withdrawn, allowed to coagulate for 30 min, and centrifuged at 10,000 x g for 5 min to collect serum. Whole brain and liver (~500 mg) were removed and homogenized in 10 volumes of ice-cold homogenization buffer [300 mmol/L mannitol, 10 mmol/L HEPES (pH 7.2), 1 mmol/L EDTA and protease inhibitor

PAGE 37

25 cocktail]. A portion of the homogenate was set aside for protein biotinylation analysis and the remainder was centrifuged at 200,000 x g for 30 min at 4C to collect the soluble fraction. For the measurement of biotin and biotin metabolites, serum and tissue soluble fractions were ultrafiltered using a 5000 nominal molecular weight cutoff filter (Millipore, Bedford, MA). All samples were immediately frozen in a mixture of dry ice and isopropanol and stored at -80C until needed. Competitive Binding Assay of Biotin The measurement of biotin in urine, serum, and liver was performed with a coupled HPLC/competitive binding assay (99) with minor modifications. The reversed-phase column used was a Sphereclone 250 x 4.6 mm (Phenomenex, Torrance, CA), and the biotin-containing chromatography fractions were dried under a stream of nitrogen before the assay. A filtered solution (200 L, 0.45 micron filter, Fisher) of biotinylated bovine serum albumin (BBSA) (50 mmol/L bicarbonate, pH 9.0, 2.5 mg/mL BSA, 1:100 BBSA) was added to flat-bottom 96 well plates and incubated at 4C overnight. Biotin, BNB, and BSO standards were prepared from a 3000 pmol/L stock and 100 L of standard or sample was added to a U-bottom 96 well plate. Avidin solution (50 L, 100 mg/mL BSA, 0.1 mol/L HEPES, 1 mol/L NaCl, pH 7.0, 1:25,000 NeutrAvidin) was added to each well with either standard or sample and thoroughly mixed. The sample or standard and avidin were incubated for 1 h at room temperature. The coated flat-bottom plate was washed three times with an automatic washer using 0.5% Tween-20, and then 50 L of the contents from the U-bottom plate were transferred to the coated wells in the flat-bottom plate and allowed to incubate 1-4 h at room temperature. The plate was washed 3 times with 0.5% Tween-20, and 50 L of a chemiluminescent substrate was added for

PAGE 38

26 detection [0.08% ortho-phenylenediamine dihydrochloride (OPD), 0.1 mol/L citric acid, 0.2 mol/L sodium phosphate, pH 5.0, 0.04% (v/v) H 2 O 2 ]. Before the absorbance was recorded, the reaction was stopped by adding 100 L of 2 N H 2 SO 4 to each well. The plate was read after 45 min at 490 nm and subtracted from the reading at 650 nm. Measurement of CBZ and CBZ-e Urine, serum, and tissue CBZ and CBZ-e were measured using a method described previously (100) with minor modifications. Briefly, one gram of diet was mixed with 5 mL of acetone containing 10 mg of 5-ethyl-5-p-tolybarbituric acid/L and vortexed 10-15 min. This mixture was centrifuged at 13,000 x g for 10 min and the soluble fraction was recovered for analysis. Urine and serum were prepared by mixing an equal volume of acetone containing tolylbarbituric acid (10 mg/L) and centrifugation at 13,000 x g for 5 min. Tissues were prepared by homogenizing in 10 volumes ice-cold homogenization buffer (10 mmol/L HEPES, 300 mmol/L mannitol, 1 mmol/L EDTA and protease inhibitor cocktail, pH 7.2) using a Polytron homogenizer and centrifugation at 200,000 x g for 30 min at 4C. The soluble fraction was recovered and mixed with an equal volume of acetone containing 10 mg tolylbarbituric acid/L, and then the sample was centrifuged at 13,000 x g for 5 min at room temperature. The soluble fractions from these samples were then mixed with two volumes of dichloromethane, vortexed, and the aqueous phase was removed. The organic layer was dried at 65C and resuspended in methanol. All samples were filtered using a 0.5 m filter immediately before HPLC injection. A reversed phase column was used [Luna 5 m C18, 250 x 2 mm (Phenomenex, Torrance, CA)] with a mobile phase of 17% acetonitrile, 55% methanol, and 28% 0.4 mmol/L potassium phosphate (pH 6). Eluted compounds were detected by ultraviolet absorption

PAGE 39

27 at 195 nm. Known amounts of CBZ or CBZ-e were separated and a peak area ratio was determined to generate a standard curve. Synthesis of Avidin-AlexaFluor 430 NeutrAvidin, an isoelectrically neutral and deglycosylated form of avidin, was conjugated to the succinimidyl ester form of AlexaFluor 430. NeutrAvidin, 10 g/L in 50 mmol/L sodium bicarbonate, pH 8.3, was mixed on a vortexer for 1 h at room temperature. Unconjugated dye was removed by size exclusion chromatography over a DG-10 column (Bio-Rad, Hercules, CA) equilibrated in PBS (20 mmol/L sodium phosphate, pH 7.2, 150 mmol/L NaCl). Equal fractions (1 mL) were collected and the peaks with the highest absorbance at 280 nm combined. Sodium azide (0.2 g/L) was added for preservation, and the conjugate was stored at 4C protected from light. Detection and Quantification of Biotinylated Proteins Using the avidin-blotting technique, we specifically detected five distinct proteins in the liver and brain, corresponding to the five carboxylase enzymes ACC1, ACC2, PC, PCC, and MCC. The specificity of this detection was confirmed through competition with excess biotin. Two slightly different techniques were used in this analysis, i.e., direct fluorescent avidin blotting for PC, PCC, and MCC, and enzyme-linked horseradish peroxidase-avidin conjugate for detection of ACC isoforms 1 and 2. The enzyme-linked method was used for the latter due to the sensitivity limit of the direct fluorescent avidin blotting. The concentrations of protein in liver and brain samples were determined using a Markwell protein assay (101). Equal amounts of liver total membrane fractions (0.1 mg for the analysis of ACC1 and ACC2, 0.08 mg for all other carboxylases) were resolved by 5 % SDS-PAGE for ACC1 and ACC2 [0.375 M Tris-HCl, pH 8.8, 0.1% SDS (Fisher),

PAGE 40

28 5% acrylamide (1:29 bisacrylamide:acrylamide), 0.05% ammonium persulfate (Sigma, St. Louis), 30 l TEMED (Fisher)] and an 8% gel with separating gel buffer pH 8.0 for PC, PCC, and MCC [0.375 M Tris-HCl, pH 6.8, 0.23% SDS, 35% (v/v) glycerol, 0.035 mg/mL bromophenol blue, 1.43 mmol/L -mercaptoethanol (Sigma, St. Louis)], while diluting the sample in 20 uL sample dilution buffer. Proteins were run overnight with running buffer [0.025 M Tris base, 0.2 M glycine (Sigma, St. Louis), 0.1% SDS] at 47 volts. MCC and PCC are very close in molecular weight (79.8 kDa for MCC and 79.3 kDa for the chain of PCC) but can be separated using an 8% (w/v total acrylamide) SDS-PAGE gel with a separating gel buffer pH 8.0. The resolved gel was equilibrated in cold transfer buffer [0.03 mol/L Tris base, 0.2 mol/L glycine, 60% (v/v) methanol] for 10 min and was then electroblotted to PVDF (Immobilon-P, Millipore, Bedford, MA) for 2 h at 12 V. The blot was stained with amido black stain [50% (v/v) methanol, 10% (v/v) glacial acetic acid, napthol blue black] and destained [50% (v/v) methanol, 10% (v/v) glacial acetic acid], and then washed with 2 changes of methanol before allowing it to air dry. For the detection of ACC1 and ACC2, the blot was incubated in 0.5 % non-fat dry milk (NFDM) in Tris-buffered saline (20 mmol/L Tris, pH 7.4, 150 mmol/L NaCl) with 0.05% (v/v) tween-20 (TBS-T) and a 1:6000 dilution of Neutralite avidin-horseradish peroxidase conjugate for 40 min. The PVDF was washed 3 times in TBST without NFDM. A chemiluminescent substrate that exhibits fluorescent properties (ECL-Plus) was then applied to the blot and allowed to stand for 5 min. Placing the blot back into TBS-T stopped the reaction. For the detection of PC, PCC, and MCC, the blot was incubated in TBS-T/0.5% NFDM containing avidin-AlexaFluor 430 conjugate at a 1:750

PAGE 41

29 dilution for 45 min at room temperature on an orbital shaker. Biotinylated proteins on both blots were then detected and emitted fluorescence quantified on a Storm fluorescent optical scanner as described by the manufacturer (Amersham-Pharmacia). Resolving 80 g of tissue homogenate by 10% (w/v total acrylamide) SDS-PAGE has been determined to be within the linear range of the detection limits of avidin AlexaFluor-430 to detect PC, MCC, and PCC. The specificity of this detection was confirmed through competition with excess biotin. Lactate and Ammonia Measurements Ammonia and lactate were measured in serum and brain and liver homogenates using an ultraviolet endpoint method. 2-Oxoglutarate, ammonia, and NADPH were converted to glutamate and NADP + by glutamate dehydrogenase and the production of NADP + was measured (Sigma Diagnostic Kit, St. Louis, MO). Lactate concentration was measured in tissue homogenates or serum using an ultraviolet measurement of NADH production from lactic acid and conversion of NAD + to pyruvic acid and NADH by the enzymatic activity of lactate dehydrogenase (Sigma Diagnostics Kit, St. Louis, MO). Measurement of Pyruvate Carboxylase Activity PC activity was measured by a modification of the method previously described (102). The assay mixture contained in a final volume of 0.1 mL 100 mmol/L Tris-HCl (pH 8.0), 3.8 mmol/L MgCl 2 3.14 mmol/L ATP, 0.32 mmol/L acetyl CoA, 0.5% triton X-100, freshly prepared 7.5 mmol/L pyruvate, and 4 mmol/L [ 14 C]NaHCO 3 (specific activity 0.9 mCi/mmol). Blanks were prepared by omitting pyruvate from the reaction mixture. Equal aliquots of the crude homogenate (0.1 mg) were added and allowed to incubate at 37C for 15 min. PC activity was linear for at least the first 25 min. Adding

PAGE 42

30 0.05 ml 200 g/L trichloroacetic acid stopped the reaction and the precipitated protein was centrifuged at 5,000 x g for 5 min. The supernatant was transferred to a scintillation vial and 0.1 ml of 100 g/L TCA was added to wash the protein pellet. The pellet was centrifuged at 5,000 x g for 5 min and the supernatant added to the corresponding scintillation vial. The pooled supernatants were dried under a stream of nitrogen at 65C for 30 min and resuspended in 0.5 mL distilled water. Five milliliters scintillation cocktail were added to each vial and the samples were counted by liquid scintillation counting. Specific activities were expressed as pmol OAA formedmg protein -1 min -1 Statistical Analysis Results were expressed as means SD. The significance of differences (p<0.05) between the two drug levels was assessed by a Students t-test at each time point. Homogeneity of variance was routinely verified and no data transformation was necessary for these experiments. Results Dietary Carbamazepine Administration in a Rodent Model of Biotin Nutriture After mixing crystalline CBZ with the semipurified diet, analysis indicated concentrations of 1.5 and 2.9 g CBZ/kg diet. Over the 19 d course of treatment, rats consuming the CBZ-containing diets exhibited growth rates (Fig. 2-1a) and food intakes (Fig. 2-1b) not different from control animals consuming the purified diet alone.

PAGE 43

31 05101520 150 200 250 300 350Abody weight, g 0 5 10 15 20 25 10 20 30 CBZ diets startedBtime, dfood intake, g Figure 2-1. Effect of dietary carbamazepine (CBZ) on body weight (A) and food intake (B) in rats. Results are mean SD, n=10 (0 g CBZ/kg diet, solid black squares) and n=5 (1.5 and 2.9 g CBZ/kg diets, open squares and solid circles, respectively). After 1 wk of consuming the CBZ-containing diets, urinary CBZ excretion in rats fed the 2.9 g/kg diet was significantly higher than in those fed the 1.5 g/kg diet. Urinary CBZ excretion was not different between dietary groups for the remainder of the study. (Fig 2-2a). The urinary excretion of CBZ-e was significantly greater for rats fed the 2.9 g/kg diet than for those fed the 1.5 g/kg diet at all time points (Fig. 2-2b). At the end of the study, serum CBZ concentration was not different between the two drug treatment groups (3.9 0.72 mol/L and 4.9 0.1.6 mol/L for the 1.5 g CBZ/kg and 2.9 g CBZ/kg groups, respectively). Brain CBZ concentration was significantly different between the 1.5 and 2.9 g/kg groups (Fig. 2-2c). Hepatic CBZ concentration was similar to that in brain and was not different between the two dietary levels (Fig. 2-2d).

PAGE 44

32 0510152025 0.0 2.5 5.0 7.5*Aurine CBZ, mg/L 1.452.9 0.0 2.5 5.0 7.5*Cbrain CBZ,g/gtissue 0 5 10 15 20 25 0 100 200*** CBZ diets startedBtime, durine CBZ-E, mg/L 1.52.9 0.0 2.5 5.0 7.5Ddietary CBZ, g/kg dietliver CBZ,g/gtissue Figure 2-2. Effect of dietary carbamazepine (CBZ) on urinary CBZ (A) and CBZ 10,11-epoxide (CBZ-e) (B) excretions and brain (C) and liver (D) CBZ concentrations in rats. Results are means SD, n=10 (0 g CBZ/kg diet) and n=5 (1.5 and 2.9 g CBZ/kg diets). For A and B, means that differ (p<0.05) from the other dose at the same time point are indicated by an asterisk. For C and D, an asterisk above the bar indicates significant differences. Open symbols, 2.9 g CBZ/kg diet; closed symbols, 1.5 g CBZ/kg diet. Effect of Carbamazepine on Organic Acids and Ammonia In rats consuming the diet containing 2.9 g CBZ/kg, brain ammonia concentrations were significantly elevated compared with those consuming either no CBZ or 1.5 g/kg (p<0.05) (Fig. 2-3a). Brain lactate concentration was likewise elevated in rats consuming diet containing either 2.9 or 1.5 g CBZ/kg compared to control animals (p<0.05) (Fig. 2-3b). Consumption of diets containing CBZ did not affect hepatic lactate concentration (Fig. 2-3c). Effect of Carbamazepine Administration on Urine, Serum, Liver, and Brain Biotin and Biotin Metabolites Urinary biotin excretion was significantly reduced in rats consuming 1.5 g CBZ/kg diet but was elevated in those consuming 2.9 g CBZ/kg diet (p<0.05, Fig 2-4a).

PAGE 45

33 01.452.9 0 5 10*A brain ammonia,mol/g tissue 01.452.9 0 1 2**Bbrain lactate, mg/gtissue 01.52.9 0.0 2.5 5.0 7.5Cdietary CBZ, g/kg dietliver lactate, mg/gtissue Figure 2-3. Effect of dietary carbamazepine (CBZ) on brain lactate (A) and ammonia (B) and liver lactate (C) concentrations in rats. Results are means SD, n=10 (0 g CBZ/kg diet), n=5 (1.5 and 2.9 g CBZ/kg diets). Means without a common letter differ, p<0.05. Consumption of CBZ-containing diets had no effect on serum biotin concentration, But elevated the concentration of BSO and biocytin (p<0.05, Fig. 2-4b). The concentration of BNB and biocytin were reduced in the brain of rats consuming either 1.5 or 2.9 g CBZ/kg diet (p<0.05) (Fig. 2-4d). There was no effect of dietary CBZ on hepatic biotin, BSO, or biocytin at the two dietary CBZ concentrations tested (Fig. 2-4c).

PAGE 46

34 biotinBSOBNBbiocytin 0.0 2.5 5.0 7.5*C ng/g tissue biotinBSOBNBbiocytin 0 10 20***B pmol/L biotinBSOBNBbiocytin 0 1 2 3****Dng/g tissue biotinBSOBNBbiocytin 0 10 20 30 40 50******Apmol/molcreatinine Figure 2-4. Effect of dietary carbamazepine (CBZ) on urine (A), serum (B), liver (C), and brain (D) biotin, biotin sulfoxides (BSO), bisnorbiotin (BNB), and biocytin concentrations in rats. Results are means SD, n=10 (0 g CBZ/kg diet), n=5 (1.5 and 2.9 g CBZ/kg diets). Means without a common letter differ, p<0.05. Effect of Carbamazepine Administration on the Abundance of Biotin-Dependent Enzymes in Liver and Brain As assessed by avidin-blotting, the abundance of biotinylated PC was reduced approximately 25% (p<0.05) in the brain of rats consuming either 1.5 or 2.9 g CBZ/kg diet, whereas the abundance of biotinylated PCC, MCC, or ACC was not affected (Fig. 2-5). The relative abundance of hepatic biotinylated PC was significantly reduced by 25 and 39% in rats consuming the 1.5 and 2.9 g/kg diets, respectively. Hepatic ACC 1 and 2 were reduced in the rats consuming both dietary concentrations of CBZ compared to controls (41 and 25% for ACC1 and 40 and 38%, for ACC2, p<0.05, for the 1.5 g/kg and 2.9 g/kg diets, respectively) (Fig. 2-6).

PAGE 47

35 PCPCCMCCACC1 0 50 100 150 2000 g CBZ/kg diet 1.45 g CBZ/kg diet 2.9 g CBZ/kg diet relative abundanceabb Figure 2-5. Effect of dietary carbamazepine (CBZ) on the relative abundance of biotinylated biotin-dependent enzymes in rat brain. Results are means SD, n=10 (0 g CBZ/kg diet), n=5 (1.5 and 2.9 g CBZ/kg diets). Means without a common letter differ, p<0.05. Hepatic MCC and PCC abundances were reduced by 17 and 11% (p<0.05), respectively, in rats consuming 2.9 g CBZ/kg diet compared with controls (Fig. 2-6). PCPCCMCCACC1ACC2 0 50 100 150 2000 g CBZ/kg diet 1.5 g CBZ/kg diet 2.9 g CBZ/kg diet relative abundanceaa abaabbbababbc Figure 2-6. Effect of dietary carbamazepine (CBZ) on the relative abundance of biotinylated biotin-dependent enzymes in rat liver. Results are means SD, n=10 (0 g CBZ/kg diet), n=5 (1.5 and 2.9 g CBZ/kg diets). Means without a common letter differ, p<0.05. Effect of Carbamazepine Administration on the Activity of Hepatic Pyruvate Carboxylase To determine whether the observed reduction in carboxylase abundance was consistent with a reduction in enzymatic activity, the specific enzymatic activity of hepatic PC in rats consuming the 0 and 2.9 g CBZ/kg diets was measured. The activity

PAGE 48

36 of hepatic pyruvate carboxylase was reduced approximately 32% in rats consuming 2.9 g CBZ/kg diet compared to controls (3.7 0.23 versus 5.1 0.91 nmolmg 1min -1 p<0.05). Discussion This report describes experiments to determine the effects of CBZ administration on the metabolism and function of the water-soluble vitamin biotin in rats. Although reduction in circulating biotin is well established in the clinical setting, the effect of these reductions on tissue-associated biotin and function of biotin-dependent enzymes is very poorly understood. The dietary model used here was useful for analyzing such effects for several reasons. First, the oral administration of CBZ through the diet more closely models the normal administration route in humans, in contrast to other studies that used injected drug (103). This was an important consideration in light of the results by Said et al. (104), who demonstrated that one mechanism by which CBZ might reduce biotin status is competitive inhibition of intestinal biotin absorption. Second, we observed no reductions in food intake or growth rate, demonstrating the tolerability of the drug when mixed with the AIN76A diet. Furthermore, we observed the well established phenomenon of autoinduction of catabolism, evidenced by the substantial reduction in urine drug concentration after the first week of consumption. One potentially important consideration of these studies is that the dietary level of CBZ used achieved circulating drug concentrations was somewhat lower than we intended, resulting in a model that could be considered subclinical. This could partially explain the lack of toxicity in our study compared to symptoms of toxicity that have been observed in other studies using dietary CBZ (83). This also suggests, however, that the effects of dietary CBZ observed

PAGE 49

37 in this study should be viewed as conservative in relation to what could occur at higher dosages. In agreement with earlier studies, we have observed changes in the concentration of biotin metabolites consistent with altered biotin catabolism. Oral consumption of CBZ elevated both BSO and BNB, suggesting that the two major pathways of biotin catabolism (sulfur oxidation and -oxidation) were induced, which is in agreement with earlier reports (103). Elevation of circulating organic acids, such as lactic acid, is a common clinical finding in individuals treated with various AEDs (9,105). Although we observed no such elevation in serum lactate, brain lactate was significantly increased. Independence of these two compartments of the body is in agreement with earlier observations (50). One likely explanation for the increase of brain lactate is that CBZ reduced the abundance of biotinylated PC, which led to a reduced enzymatic capacity to maintain the TCA cycle intermediates. This could lead to an increase in pyruvate, which might increase the flux to lactate through lactate dehydrogenase. Loss of PC activity has been previously associated with elevation of lactate (106,107). The loss of PC activity can be explained at least in part by a reduction in the abundance of brain biotinylated PC. This provides strong evidence that either the abundance of the PC polypeptide or the biotinylation of the polypeptide is reduced in CBZ-treated rats. Lactate accumulation in the brain is of particular concern, because lactate exhibits low permeability across the blood-brain barrier and can be detrimental in other tissues (49,52). Additionally, lactic acidemia is associated with impaired neurological function. Elevated lactic acid concentration is observed in the brain of piglets with experimentally induced convulsions and in the

PAGE 50

38 extracellular fluid of the hippocampus of humans during spontaneous seizures (108,109). Lactate concentration was also higher in the cerebral spinal fluid of status epileptics than that of control individuals (110). Similarly, the elevation of 3-HIA that has been observed in CBZ therapy is explained by the reduction in the abundance of the biotinylated form of MCC, which is responsible for the catabolism of leucine. Reduction of MCC activity is associated with accumulation and excretion of the resulting 3-HIA (111-114). The dietary administration of CBZ also elevated brain ammonia, which was somewhat unexpected because of the labile nature of this metabolite. Two mechanisms can be proposed to account for this elevation. The first is that biotin deficiency has been shown to reduce the expression and activity of ornithine transcarbamoylase, a critical enzyme in the urea cycle (115). This inhibition of the urea cycle has been proposed to account for the hyperammonemia observed during biotin deficiency. However, because we observed no marked reduction in biotin status, this may be an unlikely mechanism. A second plausible explanation is the observation that leucine is an allosteric activator of glutamate dehydrogenase, the enzyme that catalyzes production of ammonia (116). It is reasonable to predict that leucine metabolism would be impaired in hepatocytes with decreased abundance of biotinylated MCC, although this has not been directly determined. Reductions in the abundance of biotinylated ACC isoforms and PCC have additional ramifications for metabolic alterations during CBZ therapy. Simultaneous reductions in ACC 1 and 2 would promote a shift in the hepatocytes from fatty acid synthesis to fatty acid oxidation. A reduction in the abundance of the cytosolic ACC1

PAGE 51

39 limits the ability to synthesize fatty acids de novo, and is associated with elevations in odd-chain fatty acids (117-121). A concurrent reduction in the abundance of outer mitochondrial membrane protein ACC2 would promote fatty acid oxidation by lowering the barrier to entry of fatty acids into the mitochondrial matrix (13,122,123). Although the reduction in enzyme abundance observed in these experiments is consistent with this interpretation, direct functional evidence is needed. Hepatocytes also contained less biotinylated PCC (Fig. 2-6) in rats consuming CBZ, limiting the enzymatic capacity to catabolize select amino acids, cholesterol, and odd-chain fatty acids. Again, although these results are strongly suggestive that these other metabolic pathways would be affected, positive functional data are required to substantiate these findings. Taken together, these data suggest that oral administration of CBZ reduces the abundance of the biotinylated, and therefore functional, form of biotin-dependent enzymes, even when the CBZ is administered with food. Furthermore, this effect is also evident in the rat brain, where the metabolic derangement results in accumulation of lactate and ammonia, both potentially neurotoxic intermediates. The reduction in abundance of the biotinylated carboxylases could arise from either reduction in the abundance of the polypeptide or reduced biotinylation of each carboxylase, and the mechanisms behind these observations await further investigation.

PAGE 52

CHAPTER 3 DIETARY CARBAMAZEPINE ADMINISTRATION DECREASES LIVER PYRUVATE CARBOXYLASE ACTIVITY AND BIOTINYLATION BY DECREASING PROTEIN AND mRNA EXPRESSION IN RATS (As published in J. Nutr. 133: 2119-2124, 2003) We demonstrated in Chapter 2 that dietary CBZ administration to rats yielded decreased abundance of both brain and hepatic biotinylated PC (124). We also observed increased brain lactate concentration, which could be due to decreased function of brain PC. The mechanism by which CBZ decreased abundance of the biotinylated and, therefore, active PC is unknown and was investigated in the current study. Decreased abundance of biotinylated PC could be due to either decreased expression of the total protein or decreased abundance of the holocarboxylase form of the enzyme. This study examined PC protein abundance and the proportions of apo-PC and biotinylated PC using an in vitro biotinylation technique as well as expression of PC mRNA following dietary CBZ administration to rats. Materials and Methods Materials Male Sprague-Dawley rats were obtained from Harlan (Indianapolis, IN). Purified biotin-free rodent diet based on a modified AIN 76A formulation described previously (125) was obtained from Research Diets (New Brunswick, NJ). Carbamazepine (CBZ), 5-ethyl-5-p-tolylbarbituric acid, carbamazepine 10,11-epoxide (CBZ-e), d-biotin, protease inhibitor cocktail, [ 14 C]NaHCO 3 and o-phenylenediamine dihydrochloride were purchased from Sigma (St. Louis, MO); avidin-horseradish peroxidase (Avidin-HRP) and 40

PAGE 53

41 avidin-alkaline phosphatase (Avidin-AP) was purchased from Pierce Chemical Company (Birmingham, AL); 96-well microtiter plates (Nunc Maxisorb), ScintiSafe liquid scintillation cocktail, and bovine serum albumin (BSA) were purchased from Fisher Scientific (Pittsburgh, PA). Enhanced chemifluorescence (ECF) reagent was purchased from Amersham-Pharmacia (Picastaway, NJ). Biotinylated BSA and avidin-AlexaFluor 430 conjugate were synthesized as previously described (97). Animals and Dietary Treatments Male Sprague-Dawley rats (n=11), 50-75 g initial weight, were housed individually in hanging wire-bottom cages in an environmentally controlled room with constant temperature (22C) and a 12 h light:dark cycle. The rats were acclimatized by feeding a powdered egg-white based modification of the AIN 76A diet containing 0.06 mg biotin/kg diet for 5 days to standardize their biotin status as described in Chapter 2 (97). After 5 days of acclimatization, the rats were randomly assigned to 2 groups: one group received 0 g CBZ/kg diet (n=5) and one group received 3.75 g CBZ/kg diet (n=6) fed for 28 days. Food intake and body weights were recorded daily for all rats. All procedures were approved by the University of Florida Animal Care and Use Committee. Sample Preparation On day 28, rats were anesthetized under halothane and killed via cardiac puncture and exsanguination. Whole blood was allowed to coagulate for 30 min, and then centrifuged at 13,000 x g for 5 min to separate serum. Whole brain was removed and minced before homogenizing in 10 volumes of ice-cold HEM homogenization buffer (30 mmol/L HEPES, pH 7.2, 1 mmol/L EDTA, 300 mmol/L mannitol, and protease inhibitor cocktail). The left lobe of the liver was divided into 10 sections and all samples were immediately frozen in liquid nitrogen and stored at C until further use for enzymatic

PAGE 54

42 activity assays or mRNA isolation. For liver protein extract preparation, a frozen liver portion was thawed and homogenized in 10 volumes of ice-cold HEM. A portion of each homogenate was saved for enzyme biotinylation assays and the remainder was centrifuged at 200,000 x g for 30 min at 4C to collect the soluble fraction for determination of biotin and biotin metabolites. All homogenized samples were immediately frozen in liquid nitrogen and stored at C until assayed. Pyruvate Carboxylase Activity Assay PC activity in brain and liver was determined as described by Suormala et al. (102) with the modifications presented in the Chapter 2 methods section (124). Specific enzymatic activities were expressed as nmol OAA formedmg protein -1 min -1 Detection of Biotinylated Biotin-Dependent Carboxylases The five biotin-dependent carboxylases, ACC1, ACC2, PC, PCC, and MCC were detected using the avidin-blotting technique described previously (97) with slight modifications as presented in the Chapter 2 methods section. In Vitro Biotinylation Total liver PC protein was determined as described by Rodriguez-Melendez et al. (126). Briefly, liver homogenate (approximately 500 g) protein was added to 450 L of a master mix providing a final concentration of 60 mmol/L Tris HCl, pH 7.5, 0.82 mmol/L biotin, 0.1 mmol/L EDTA, 0.6 g/L bovine serum albumin, 3 mmol/L reduced glutathione, 8 mmol/L MgCl 2 and 10 mmol/L adenosine triphosphate. The reaction mixture was incubated for 6 h at 37C. At 2 and 4 h of incubation, an additional 26.75 L of a solution containing 10 mmol/L adenosine triphosphate and 8 mmol/L MgCl 2 was added. Finally, the reaction was terminated by adding 500 L sample dilution buffer

PAGE 55

43 [0.375 mol/L Tris-HCl, pH 6.8, 2.3 g/L SDS, 350 mL/L glycerol, 0.035 mg/ml bromophenol blue, 1.43 mol/L -mercaptoethanol]. A portion of each protein sample (40 g) was loaded and resolved on a 10% SDS-PAGE gel, transferred to PVDF membrane, and detected by avidin-western blotting (125). Measurement of Biotin, Biotin Sulfoxide, Bisnorbiotin, and Biocytin The measurement of biotin and its metabolites in serum, liver, and brain was performed using a coupled HPLC/competitive binding assay (97,99). Measurement of Carbamazepine Serum, liver, brain, and dietary CBZ were measured using a method previously described (100) with slight modifications (124) presented in the Chapter 2 methods section. RNA Isolation and Northern Blotting Frozen liver was homogenized in Trizol reagent (Invitrogen Life Technologies, Carlsbad, CA) and RNA was isolated as directed by the manufacturer. RNA was quantified by absorbance at 260 nm and purity assessed by calculation of the ratio of the absorbance at 260 nm to absorbance at 280 nm. RNA integrity was analyzed by 1.2% agarose gel electrophoresis in 1 x TBE (89 mmol/L Tris base, 89 mmol/L boric acid, 2 mmol/L EDTA) with ethidium bromide staining (127). After electrophoresis, RNA was transferred to a nylon membrane (Millipore, Bedford, MD) using an overnight downward capillary transfer technique (127). The nucleic acids were cross-linked to the membrane using 160,000 joules short wave UV light and allowed to dry completely before probing. The random priming labeling kit (Gibco BRL) was used to label a rat PC cDNA probe with 32 P. The PC cDNA probe was

PAGE 56

44 hybridized to the homologous RNA and to normalize for lane-to-lane variation, a mouse beta-actin cDNA probe was used to detect beta-actin mRNA. Both PC and beta-actin were detected by phosphor imaging using a STORM840 fluorescent and phosphor imager (STORM, Sunnyvale, CA) following the manufacturers instructions. Densitometry of the resulting image was performed using ImageQuant software (Amersham Pharmacia Biotech, Picastaway, NJ). Real-Time Reverse Transcriptase PCR Conditions Using cDNA sequences for PC retrieved from GenBank, real-time PCR primers and TaqMan probe were designed using Primer Express software version 1.0 (PE Applied Biosystems, Foster City, CA). The primers and TaqMan probe for PC were synthesized by Keystone Labs (Biosource International, Camarillo, CA) with a FAM reporter dye and quencher BHQ1 (Table 3-1). The primers and TaqMan probe for 18S rRNA gene were purchased from PE Applied Biosystems and used as the endogenous control for RNA. Table 3-1. Primers and TaqMan probe for rat pyruvate carboxylase. Positions in the pyruvate carboxylase gene (GenBank accession no. NM 012744) are indicated. The TaqMan probe has the 5 and 3 ends labeled Sequence of PC primers and probePrimer/probeSequence (5' 3')Positions (bp)Forward primerCCTGCTCGTCAAAGTCATTGC1,306-1,326(Antisense) Reverse primerACACCTCGGACACGGAACTC1,379-1,398TaqMan probeFAM-CAAAGACCACCCTACAGCTGCCACCA-BHQ11,333-1,358 Real-Time Reverse Transcriptase PCR Conditions All assays were performed using one-step RT-PCR reagents and a GeneAmp 5700 Sequence Detection System (PE Applied Biosystems, Foster City, CA) in a 25 L reaction volume as employed by Moore et al. (128). RT-PCR conditions were as follows: 30 min at 48C, 10 min at 95C, 50 cycles of 15 s at 95C, and 1 min at 60C. Relative quantification was determined from a 3-4 log range standard curve generated from

PAGE 57

45 serially diluted RNA to final concentrations of 10, 1, 0.1, 0.01, and 0.001 ng/l. Quantification was performed by interpolation using a standard regression curve of C t values generated from RNA samples of these known concentrations. Total RNA (1 ng) isolated from individual rats was used for these experiments and all samples were run in duplicate. The reaction mixture contained 900 nmol/L each of the forward and reverse primers and 250 nmol/L of PC TaqMan probe, whereas the 18S rRNA TaqMan assay utilized 50 nmol/L forward and reverse primers and 50 nmol/L TaqMan probe. In order to ensure that the total RNA samples were not contaminated with DNA, RNA samples with no reverse transcriptase added were run. Statistical Analysis Results were expressed as means SD. The significance of differences (P<0.05) was tested by Students t-test. Homogeneity of variance was routinely verified and no data transformation was necessary for these experiments. Results Effect of CBZ on Metabolites Direct analysis of the diet by HPLC confirmed the intended concentration of 3.4 g CBZ/kg. There were no significant differences in food intake or body weight gain between treatment groups over the 28-d experiment (Fig. 3-1). At the end of the study, serum CBZ concentration of the drug-treated group was 11 7.1 mol/L, while liver and brain CBZ concentrations were 80 4.0 and 38 2.1 nmol/g tissue, respectively. After consuming the 3.4 g CBZ/kg diet for 28 d, the rats had a significantly higher concentration of lactic acid in the brain compared to control rats (10 2.8 versus 6.2 2.1 mol/g, p<0.05). Serum concentrations of lactic acid at 28 d were similar between

PAGE 58

46 0 100 200 300 4000 g CBZ/kg diet 3.4 g CBZ/kg diet body weight, g -3 0 3 6 9 12 15 18 21 24 27 0 10 20 30time, dfood intake, g Figure 3-1. Body weights (top) and food intakes (bottom). rats consuming the 3.4 g CBZ/kg diet (6.3 1.0 mmol/L) and those consuming the control diet (7.2 2.8 mmol/L). The administration of 3.4 g CBZ/kg diet for 28-d did not have a significant effect on serum, liver, or brain biotin, BSO, or BNB (Fig. 3-2). The distribution of biotin and metabolites in brain, liver, and serum was similar to results from our previous studies (124). Only brain biocytin was significantly elevated in rats consuming 3.4 g CBZ/kg diet compared to controls (3.6 1.0 and 1.2 0.26 pmol/g tissue, respectively, p<0.05). Effect of CBZ Administration on PC Biotinylation, Activity, and Protein and mRNA Expression The relative abundance of hepatic biotinylated PC was decreased 43% in the rats consuming 3.4 g CBZ/kg diet compared to controls (p<0.05) (Fig. 3-3a). Brain

PAGE 59

47 biotinylated PC was decreased 29% (p<0.05) in rats consuming the 3.4 g CBZ/kg diet compared to controls (Fig. 3-3a). There was no difference in the relative abundance of BiotinBNBBSOBiocytin 0 5 10 15 20 25Serumnmol/L BiotinBNBBSOBiocytin 0 10 20 30Brainpmol/g tissueab BiotinBNBBSOBiocytin0 g CBZ/kg diet 3.4 g CBZ/kg diet Liver Figure 3-2. Effect of dietary carbamazepine (CBZ) on serum, brain, and liver biotin and biotin metabolites in rats. Results are means SD for control (0 g CBZ/kg diet, n=5) and CBZ-supplemented (3.4 g CBZ/kg diet, n=6). Means without a common letter differ, p<0.01. biotinylated MCC, PCC, ACC1 or ACC2 in either brain or liver of rats consuming 3.4 g CBZ/kg diet compared to controls (data not shown). Hepatic PC specific enzymatic activity was decreased 30% in rats consuming the 3.4 g CBZ/kg diet compared to controls but brain PC activity was increased 175% in this group (p<0.05) compared to controls (Fig. 3-3b). LiverBrain 0 25000 50000 75000 100000Aabrelative abundance ofbiotinylated PC,arbitrary unitsab LiverBrain 0.00 0.05 0.100 g CBZ/kg diet 3.4 g CBZ/kg diet 2 4 6 8BababPC activity,nmolmg-1min-1 Figure 3-3. Effects of dietary carbamazepine (CBZ) on the relative abundance of biotinylated pyruvate carboxylase (PC) (A) and activity of PC (B) in rat liver and brain. Results are means SD for control (0 g CBZ/kg diet, n=5) and CBZ-supplemented (3.4 g CBZ/kg diet, n=6) rats. In (A), the relative abundance is the amount of fluorescence detected using a fluorescent-avidin blotting method. In (B), PC activity is expressed as nmol oxaloacetate formed per mg protein per min. Means without a common letter differ, p<0.05.

PAGE 60

48 As assessed by avidin blotting following in vitro biotinylation of all available apocarboxylase, hepatic PC protein expression was significantly decreased by approximately 43% in rats consuming the 3.4 g CBZ/kg diet compared to controls (Fig. 3-4a). 0 1 2 3 4 50 g CBZ/kg diet 0 g/kg (in vitro) 3.4 g CBZ/kg diet 3.4 g/kg (in vitro) aabbhepatic biotinylated PC,arbitrary units 0.00 0.25 0.50 0.75 1.000 g CBZ/kg diet 3.4 g CBZ/kg diet abPC/18S A B Figure 3-4. Effects of dietary carbamazepine (CBZ) on hepatic biotinylated pyruvate carboxylase (PC) before and after in vitro biotinylation (A) and hepatic PC mRNA determined by real-time PCR normalized to 18S mRNA (B). Results are means SD for control (0 g CBZ/kg diet, n=5) and CBZ-supplemented (3.4 g CBZ/kg diet, n=6) rats. Means without a common letter differ, P<0.01. At the RNA level, after normalizing the hepatic PC mRNA with beta-actin, PC mRNA tended to be lower in the drug treated group compared to controls, but the difference was not significant when analyzed by northern blot (Fig. 3-5). Real-time quantitative PCR was used to measure PC mRNA. The threshold cycle (C t ) was determined to be in the linear range of the curve by selecting an optimal R n (emission of the fluorescent reporter over the starting background) value in the exponential phase of the amplification plot for each dilution. The standard curves were generated by plotting the C t against the log of the mRNA concentration. A PC amplification plot for five dilutions of PC and 18S mRNA was used for the standard curves. The standard curve using the PC probe showed an R 2 of 0.999 and a slope of -3.42, compared to 18S values of 0.999 and .53 for R 2 and slope, respectively, indicating a high correlation between the linearity of both assays. Only concentrations of

PAGE 61

49 less than 1 pg/L mRNA deviated from the calculated standard curve, indicating that, at levels this low, quantification was not accurate. PC mRNA expression was significantly decreased 35% in rats consuming 3.4 g CBZ/kg diet (Fig. 3-4b). -CBZ+ CBZ 0.0 0.1 0.2 0.3 0.4 -CBZ +CBZPC-actin densitometry(PC/-actin), arbitraryunits Figure 3-5. Hepatic PC mRNA determined by northern blotting. Results are means SD for control (0 g CBZ/kg diet, n=5) and CBZ-supplemented (3.4 g CBZ/kg diet, n=6) rats. Discussion It was shown in Chapter 2 that oral CBZ administration to rats alters biotin metabolism but not free biotin status. While we observed no changes in serum biotin concentrations in the present study, we observed alterations in biotin-dependent enzyme activity, mRNA, and abundance of biotinylated carboxylases. These biochemical changes in biotin metabolism may occur prior to observed decreases in serum biotin since it is known that serum biotin is not an early or sensitive indicator of biotin status (129). Since both the previous study and current study were relatively short term (21-28 d) compared to the long-term therapy associated with decreased serum biotin in epileptics (19), our protocols may not have been long enough to encounter biotin deficiency induced by CBZ administration. It is also noteworthy in light of the data generated in

PAGE 62

50 this study that the dose of CBZ used may have been too low to elicit the full effects seen clinically. In our previous study, the dose of CBZ yielded a serum CBZ concentration of approximately 5 mol/L (124), which is less than the therapeutic range for both rats and humans of 17 51 mol/L (64,83). In the present experiment, we sought to increase the oral CBZ intake to result in a serum CBZ level more closely approximating the therapeutic range. Serum CBZ was approximately 12 mol/L, which is still slightly below the therapeutic range for the treatment of epilepsy; thus, these results still could be interpreted as conservative in relation to what could occur at higher CBZ doses. We previously found that oral CBZ administration to rats yields decreased hepatic abundance of biotinylated PC. Since the relative abundance of biotinylated PC depicts the holocarboxylase form of the enzyme and not the apocarboxylase, we wanted to determine whether the decrease was due to a reduction in the biotinylation (therefore the same concentration of total protein) or a decreased PC protein concentration. By biotinylating all of the available apocarboxylase form of the enzyme in vitro and then detecting by avidin-blotting (126), we determined that there was a change in total PC protein. The decrease in PC protein was confirmed by western blot using a polyclonal PC antibody (data not shown). To determine whether the decreased protein expression was due to protein degradation or altered mRNA expression, PC mRNA was quantified using both northern blotting and real-time PCR. After normalizing PC mRNA for beta-actin mRNA, there were no significant differences between the drug-treated group and controls as detected by northern blotting. Real-time PCR, however, showed that CBZ induced a statistically significant 35% decrease in hepatic PC mRNA in the drug-treated group after normalizing for 18 S rRNA. Two factors are likely involved that contribute

PAGE 63

51 to the different results between methods, including the possible expression differences in beta-actin mRNA and 18 S rRNA between drug and control groups as well as the increased sensitivity and precision of real-time PCR. It is possible that CBZ alters beta-actin mRNA as well as PC mRNA. It is also true that normalizing for 18 S rRNA should be more accurate since this accounts for most of the RNA measured by an absorbance reading at 260 nm, and from that number, equal amounts were loaded in each reaction. The greater reproducibility of real-time PCR gives credence that there is in fact a significant decrease in hepatic PC mRNA in the drug-treated group compared to controls. The 35% decrease in PC mRNA was accompanied by approximately the same magnitude of decreases found for hepatic PC protein, biotinylation, and activity, which suggests the decreased mRNA expression was responsible for decreased PC protein and activity. Furthermore, the decreased PC protein provides an explanation for the decreased detection of biotinylated PC and PC specific activity observed in earlier studies (124). While the present study only utilized one dose of CBZ, we predict that CBZ decreases PC protein and mRNA expression in a dose-dependent manner based on results from our previous study where we found that CBZ decreases biotinylated PC in a dose-dependent manner (124). The relative abundance of brain biotinylated PC was also reduced, but not to the extent that was seen in the liver (decreased 29% in brain compared to 43% in liver). This is consistent with a protective mechanism in the brain to preferentially maintain biotin status and biotin-dependent enzyme function compared to other tissues during periods of biotin deficiency (32,33,60). Biotinidase activity has also been found in previous studies to be lower in the brain compared to other tissues, which also suggests a slower turnover

PAGE 64

52 of biotinylated proteins in the brain (59). This is supportive of our different results between brain and liver biocytin concentration and biotinylated PC. The dietary administration of CBZ increased brain lactate but did not change serum lactate concentration. Elevated lactate in urine of patients undergoing long-term AED therapy is observed clinically and may be due to the same mechanism as the elevated brain lactate. Elevated lactate in the brain is associated with selective neuronal damage in cerebral ischemia and impaired neurological function (108-110,130) but more recently it has been argued that lactate may play an important role in nourishing oligodendrocytes and neurons (131-133). Whether elevated lactate concentration is detrimental to the brain is debatable, but it should be given some consideration since lactate does not easily cross the blood-brain barrier and it can act as a toxin in other tissues (49,52). One possible explanation of elevated lactate is a reduction in PC mRNA leading to decreased PC protein synthesis and decreased PC activity. PC catalyzes the carboxylation of pyruvate to form OAA and, as seen in PC deficiencies, decreased PC activity could lead to elevated lactate since pyruvate can build up and be shunted to alternate pathways, including lactate (107,134). Although we observed a decrease in hepatic mRNA, PC protein, and PC activity, there was a 175% increase in brain PC activity in the drug treated group compared to controls. This was not expected since there was a 30% decrease in the relative abundance of brain biotinylated PC, which is the active form of the enzyme. Although the mechanism underlying this discrepancy is not understood at this time, allosteric activators of PC may be responsible for the increased brain PC activity and warrants further study. Even though CBZ increased brain PC activity as measured in vitro and we would not expect lactate accumulation in compartments with

PAGE 65

53 increased PC activity, lactate could be formed in other tissues and transported into the brain across the blood-brain barrier by the monocarboxylate transporter MCT1 that is present on vascular endothelial cells (135). In contrast, lactate accumulation in the brain that is observed in these studies may not be related to PC function per se and this will be investigated in the studies to follow. Although it is established clinically that chronic treatment with AEDs including CBZ is associated with biotin deficiency, the impact on tissue biotin and biotin-dependent enzymes involved in carbohydrate, lipid, and protein metabolism is less understood. Metabolic changes of biotin in the brain are of particular importance since alterations of brain biotin status and subsequent loss of function of biotin dependent enzymes can contribute to impaired neurological health. The potential protective role of biotin supplementation during CBZ administration is the next important question that will be addressed. This characterization will have important clinical significance as biotin may have future use in the medical management of epilepsy.

PAGE 66

CHAPTER 4 PHARMACOLOGICAL BIOTIN SUPPLEMENTATION MAINTAINS BIOTIN STATUS AND FUNCTION IN RATS ADMINISTERED DIETARY CARBAMAZEPINE The previous animal studies presented in Chapters 2 and 3 indicated that 1.5 3.4 g CBZ/kg diet fed to rats for 21 or 28 d decreased specific enzymatic activity and abundance of hepatic biotinylated pyruvate carboxylase (PC) (124). An elevation of brain lactate also accompanied these changes (124), a product that has been shown to accumulate when PC activity is decreased (107,134,136,137). Decreased PC activity can lead to an accumulation of pyruvate, which might increase the flux to lactate through lactate dehydrogenase. If the elevated serum and urine lactate observed in epileptic patients treated with AEDs (19) and in the brain of rats treated with CBZ (124) is due to decreased PC activity, then increasing PC activity should decrease lactate concentration. In previous studies, biotin supplementation to biotin-deficient primary culture hepatocytes or biotin-deficient chicks increased PC specific enzymatic activity (138,139). This suggests that biotin supplementation could increase flux from lactate to pyruvate by increasing PC activity and, therefore, decrease brain lactate in CBZ-treated rats. In this investigation, we supplemented CBZ-treated rats with a pharmacological dose of biotin to determine whether biotin supplementation could reduce brain lactate by maintaining biotin status and activity of biotin-dependent enzymes. 54

PAGE 67

55 Materials and Methods Materials Male Sprague-Dawley rats were obtained from Harlan (Indianapolis, IN). Purified biotin-free rodent diet based on a modified AIN 76A formulation described previously was obtained from Research Diets (New Brunswick, NJ)(125). Carbamazepine (CBZ), 5-ethyl-5-p-tolylbarbituric acid, carbamazepine 10,11-epoxide (CBZ-e), d-biotin, protease inhibitor cocktail, [ 14 C]NaHCO 3 reduced -nicotinamide adenine dinucleotide (NADH), and o-phenylenediamine dihydrochloride were purchased from Sigma (St. Louis, MO); avidin-horseradish peroxidase (Avidin-HRP) and avidin-alkaline phosphatase (Avidin-AP) was purchased from Pierce Chemical Company (Birmingham, AL); 96-well microtiter plates (Nunc Maxisorb) and bovine serum albumin (BSA) were purchased from Fisher Scientific (Pittsburgh, PA). Enhanced chemifluorescence (ECF) reagent was purchased from Amersham-Pharmacia (Picastaway, NJ). Biotinylated BSA and avidin-AlexaFluor 430 conjugate were synthesized as previously described (97). Animals and Dietary Treatments Male Sprague-Dawley rats (n=55), 50-75 g initial weight, were housed individually in hanging wire-bottom cages in an environmentally controlled room with constant temperature (22C) and a 12 h light:dark cycle. The rats were acclimatized by feeding a powdered, egg-white based modification of the AIN 76A diet containing 0.06 mg free biotin/kg diet (97) described in Chapter 2 for 5 days to standardize their biotin status. After 5 days of acclimatization, 5 rats were killed and serum, liver, and brain were collected as described below. The remaining 50 rats were randomly assigned to 2 groups receiving either 0 g CBZ/kg diet (n=25) or 3.75 g CBZ/kg diet (n=25) for 21 days. Rats (n=5) from each treatment group were killed on day 26 of the study, and serum, liver, and

PAGE 68

56 brain were collected. Those from the remaining groups were then divided into two further treatment groups (n=10) receiving either 0.06 mg biotin/kg diet to represent a physiologic dose of biotin or a pharmacological dose of 6.0 mg biotin/kg diet. After 21 d (day 47 of the study) of biotin supplementation, 5 rats from each of the 4 groups were killed and serum, liver, and brain were collected. The remaining 5 rats from each group were killed 21 d later and serum, liver, and brain were also collected (Fig. 4-1). The entire study was 68 d. Food intake and body weights were recorded every other day. All procedures were approved by the University of Florida Animal Care and Use Committee. 50 rats Kill 5 rats 25 rats 25 rats 2 0 rats 20 rats Kill 10 rats 10 rats 10 rats 10 rats 10 rats 5 rats 5 rats 5 rats 5 rats Kill 20 rats Kill 20 rats 21 d 21 d 21 d 5 d 0.06mg biotin/kg diet 0.06 mg/kg CBZ 0.06 mg/kg + CBZ 0 .06 mg/kg CBZ 6 mg/kg +CBZ 0.06 mg/kg +CBZ 6 mg/kg +CBZ 55 rats Figure 4-1. Experimental protocol. Sample Preparation On days 5, 26, 47, and 68, rats were anesthetized with halothane and killed by cardiac puncture and exsanguination. Whole blood was allowed to coagulate for 30 min,

PAGE 69

57 and then centrifuged at 10,000 x g for 5 min to separate serum. Whole brain was removed and homogenized in 10 volumes of ice-cold HEM homogenization buffer (30 mmol/L HEPES, pH 7.2, 1 mmol/L EDTA, 300 mmol/L mannitol, and protease inhibitor cocktail). The left lobe of the liver was divided into 5 sections and all samples were immediately frozen in liquid nitrogen and stored at C until needed. For protein assays and metabolite analysis, a frozen liver portion was thawed and homogenized in 10 volumes of ice-cold HEM. A portion of each homogenate was saved for protein analysis and the remainder was centrifuged at 200,000 x g for 30 min at 4C to collect the soluble fraction for measurement of biotin, biotin metabolites, and CBZ. All samples were immediately frozen in liquid nitrogen and stored at C until assayed. Pyruvate Carboxylase and Acetyl CoA Carboxylase Activity Assays PC activity in brain and liver was determined using a method previously described (102) with slight modifications (124). For the experiment to determine whether NADH is an activator of PC activity, the reaction mixture was similar to the modified method (124), except 0 2.5 mmol/L NADH was added. Background activity was determined by omitting pyruvate from the reaction mixture. Specific enzymatic activity for PC was expressed as nmol OAA formedmg protein -1 min -1 ACC activity was determined using a method described by Thampy et al. (140) with minor modifications. Briefly, frozen liver was homogenized in 10 volumes of homogenization buffer (50 mmol/L potassium phosphate, pH 7.4, 10 mmol/L ethylenediaminetetraacetic acid, 2 mmol/L dithiothreitol, protease inhibitors) using a Polytron homogenizer. To measure activity, each tube contained 0.1 mg of either liver or brain homogenate, along with a mixture consisting of 50 mmol/L potassium phosphate,

PAGE 70

58 pH 7.4, 2.5 mmol/L MgCl 2 2 mmol/L dithiothreitol, 1.17 mmol/L acetyl CoA, 4 mmol/L ATP, 12.5 mmol/L [ 14 C] NaHCO 3 (specific activity 40.7 MBq/mmol), 0.75 mg/ml bovine serum albumin, and 10 mmol/L citrate in a final volume of 0.15 mL. After 15 min at 37C, the reaction was terminated by adding 0.05 mL 200 g/L trichloroacetic acid (TCA), and the precipitated protein was sedimented by centrifugation at 13,000 x g for 5 min. The supernatant was transferred to a scintillation vial and 0.1 mL of 100 g/L TCA was added to wash the protein pellet. After centrifugation (13,000 x g, 5 min), the supernatant was combined with the initial extract. Pooled supernatants were dried under a stream of nitrogen at 65C for 30 min and dissolved in 0.5 mL distilled water. Scintillation cocktail (5 mL) was added to each vial and the samples were counted by liquid scintillation counting. Specific enzymatic activity for ACC was expressed as pmol malonyl CoA formedmg protein -1 min -1 Detection of Biotinylated Biotin-Dependent Carboxylases The five biotin-dependent carboxylases, ACC1, ACC2, PC, PCC, and MCC were detected using the avidin-blotting technique described previously in Chapter 2 (97). Measurement of Metabolites The measurement of biotin and its metabolites in serum, liver, and brain was performed using a coupled HPLC/competitive binding assay (97,99). Serum, liver, brain, and dietary CBZ were measured using a method previously described (100) with slight modifications (124). NADH was measured using a method described by Uppal and Gupta (141). Briefly, 100 L brain homogenate (as prepared above) was added to tubes containing 2 mL alcoholic 0.5 mol/L KOH [prepared by dissolving KOH in a mixture of

PAGE 71

59 ethanol/doubly distilled water (1:1, v/v)] preheated in a heating block at 70C. The tubes were immediately capped, heated for 60 s, and then quickly cooled on ice for 10 min. Then the extract, which contained both mitochondrial and cytosolic NADH, was neutralized with triethanolamine-HCl phosphate (0.5 mol/L triethanolamine-HCl, 0.4 mol/L KH 2 PO 4 0.1 mol/L K 2 HPO 4 ) to pH 7.8 and kept at 37C for 20 min. After incubation, the extract was centrifuged at 30,000 x g for 10 min and the supernatant was collected. Spectrophotometric measurements at 340 nm were recorded upon mixing 2 mL extract with 5 L 1 mol/L pyruvate. Then 5 L 0.5 mg/mL lactate dehydrogenase (D-lactate dehydrogenase from Lactobacillus leichmannii, 270 units activity/mg, Sigma Chemical, St. Louis, MO, prepared by diluting stock with 2.1 mol/L ammonium sulfate) was added to the cuvette, mixed, and incubated for 3 min prior to reading the final absorbance at 340 nm. NADH concentration from brain samples was determined by extrapolation from a standard curve with known NADH concentrations. Serum and tissue lactate concentrations were measured using a kit based on spectrophotometric endpoint method of measuring NADH (Sigma Diagnostics, St. Louis, MO). Statistical Analysis Results are expressed as means SD. Differences in concentrations of biotin and biotin metabolites among treatments were tested using a Students t-test on day 26 (2 treatment groups), and a 2-way ANOVA for data from days 47 and 68 (with biotin intake and CBZ exposure as main factors). Data for biotinylated carboxylases and lactate from day 68 of the study were tested using a 2-way ANOVA. Comparisons of CBZ concentrations between control and biotin-supplemented groups were conducted using a

PAGE 72

60 Students t-test. In all statistical procedures, a difference was considered significant at p<0.05. Homogeneity of variance was routinely verified and no data transformation was necessary for these experiments. Results Concentration of CBZ in the Diet, Serum, Liver and Brain Analysis of the diet containing CBZ revealed 3.75 g CBZ/kg diet, which confirmed the accuracy of diet formulation. Brain, serum, and liver CBZ concentrations were determined on day 68 of the experiment (42 d after starting biotin supplementation in 2 groups). Biotin supplementation did not alter brain CBZ (46 2.4 and 44 5.3 nmol/g for rats consuming 0.06 or 6.0 mg biotin/kg diet, respectively), liver CBZ (53 0.7 and 54 0.7 nmol/g for rats consuming 0.06 or 6.0 mg biotin/kg diet, respectively), or serum CBZ (1.5 0.4 and 1.2 0.3 mol/L for rats consuming 0.06 or 6.0 mg biotin/kg diet, respectively). Effect of CBZ on Metabolites Brain, serum, and liver lactate concentrations were determined on day 68 of the study. CBZ administration was associated with greater lactate concentrations in both serum and brain in rats consuming 0.06 mg biotin/kg diet (p<0.05). Biotin supplementation (6.0 mg biotin/kg diet) in CBZ-treated rats effectively prevented the increase of lactate in serum and brain as seen in Fig. 4-2 (p<0.05). CBZ reduced serum biotin by 60% compared to controls (p<0.05) after day 47, but biotin supplementation maintained serum biotin concentration in these rats (Fig. 4-3a). Biotin-supplementation increased serum biotin concentration in both control and CBZ

PAGE 73

61 treated group, but serum biotin in the CBZ-treated group that was biotin-supplemented was only increased to 17% of the biotin supplemented control rats (61 20 versus -CBZ+CBZ 0 10 20 300.06 mg biotin/kg 6 mg biotin/kg baaaBrain lactate,mol/g -CBZ+CBZ 0.0 2.5 5.0 7.5Serum lactate, mmol/Laaba -CBZ+CBZ 0 5 10 15Liver lactate,mol/gABC Figure 4-2. Effect of dietary carbamazepine (CBZ) on (A) serum, (B) brain, and (C) liver lactate in rats after 68 d. Results are means SD for controls and CBZ-treated rats (n=5/group). Means without a common letter differ, p<0.05. 350 143 nmol/L, respectively, p<0.05). CBZ treatment did not alter brain biotin concentration (Fig. 4-3b). Biotin supplementation increased brain biotin concentration in both groups; however, the elevation was 12% less in the CBZ-treated group compared to the control group on day 68 (Fig. 4-3c). Hepatic biotin was reduced in CBZ-treated rats by approximately 50% compared to controls (p<0.05) (Fig. 4-3c), while biotin supplementation prevented the decrease of free hepatic biotin concentration in these rats. Effects of both CBZ and biotin intake were observed on concentrations of the biotin catabolites in serum and tissues. Biotin supplementation increased serum BSO concentration similarly in both controls and CBZ-treated groups, but CBZ alone had no

PAGE 74

62 5264768 1 10 100 10000.06 mg/kg -CBZ 6 mg/kg -CBZ 0.06 mg/kg + CBZ 6 mg/kg + CBZ abcdabcbTime, dSerum biotin, nmol/L 5264768 0 25 50 75abcbabcdTime, dLiver biotin, pmol/g 5264768 0 25 50 75aabbabcaTime, dBrain biotin, pmol/gABC Figure 4-3. Effect of dietary carbamazepine (CBZ) on biotin concentrations in (A) serum, (B) brain, and (C) liver in rats on day 68 of the study. Results are means SD, n=5. Means without a common letter at each time point differ, p<0.05. effect (Fig. 4-4a). CBZ increased hepatic BSO approximately 123% compared to controls on day 47 but there was no difference observed on day 68. Biotin supplementation also increased hepatic BSO in both groups (Fig. 4-4b). Brain BSO was reduced 40% in CBZ-treated rats on day 26 (p<0.05) but was not different from control values on days 47 and 68 (Fig. 4-4c). CBZ increased serum BNB 27% on day 26, 163% on day 47, and 410% on day 68 (Fig. 4-5a). Biotin supplementation also elevated serum BNB in both groups where, on day 68, CBZ-treated rats had serum BNB concentration equal to biotin supplemented control and CBZ-treated rats. Hepatic BNB was elevated 89% in CBZ-treated rats on day 68 and biotin supplementation similarly elevated hepatic BNB in control and CBZ-treated rats (Fig. 4-5b). CBZ administration significantly increased brain BNB by 75%

PAGE 75

63 and 45% on days 47 and 68, respectively, to approximately the same brain BNB concentration as both biotin-supplemented groups (Fig. 4-5c). 5.026.047.068.0 0 1 2 3abacababTime, dSerum BSO, nmol/L 5.026.047.068.0 0 10 20 300.06 mg/kg -CBZ 6 mg/kg -CBZ 0.06 mg/kg + CBZ 6 mg/kg + CBZ abcbabacTime, dLiver BSO, pmol/g 5.026.047.068.0 0 1 2 3ababaabTime, dBrain BSO, pmol/gABC Figure 4-4. Effect of dietary carbamazepine (CBZ) on biotin sulfoxide (BSO) concentration in (A) serum, (B) liver, and (C) brain in rats on day 68 of the study. Results are means SD, n=5. Means without a common letter at each time point differ, p<0.05. Biotin supplementation increased serum biocytin 146% in control rats but only 116% in CBZ-treated rats (Fig. 4-6a). CBZ had no effect on hepatic or brain biocytin (Fig. 4-6b, 4-6c). CBZ had no effect on the abundance of hepatic biotinylated MCC or PCC; however, the drug significantly decreased hepatic biotinylated ACC1, ACC2, and PC by approximately 33%, 60%, and 43%, respectively (Fig. 4-7). Biotin supplementation prevented the decrease of hepatic biotinylated ACC1 and ACC2 (Fig. 4-7). All biotin-dependent carboxylases in brain were significantly decreased by CBZ (31%, 42%, 43%,

PAGE 76

64 and 43% for PC, MCC, PCC, and ACC1, respectively, p<0.05) but only decreased biotinylated ACC1 was prevented by biotin supplementation (Fig. 4-7). 5.026.047.068.0 0 5 10 15abbcabbbabTime, dSerum BNB, nmol/L 5.026.047.068.0 0 10 20 30 400.06 mg/kg -CBZ 6 mg/kg -CBZ 0.06 mg/kg + CBZ 6 mg/kg + CBZ ababababcbTime, dLiver BNB, pmol/g 5.026.047.068.0 0 5 10 15abbbabccbTime, dBrain BNB, pmol/gABC Figure 4-5. Effect of dietary carbamazepine (CBZ) on bisnorbiotin (BNB) concentration in (A) serum, (B) liver, and (C) brain in rats on day 68 of the study. Results are means SD, n=5. Means without a common letter at each time point differ, p<0.05. CBZ significantly reduced hepatic ACC (both ACC isoforms) specific enzymatic activity 30% in rats consuming 0.06 mg biotin/kg diet but not in rats consuming 6.0 mg biotin/kg diet (p<0.05, Fig. 4-8a). Brain ACC specific enzymatic activity was significantly decreased 48% in CBZ-treated rats consuming 0.06 mg biotin/kg diet compared to controls (Fig. 4-8b, 73 15 versus 39 13 pmol malonyl CoA formedmg protein -1 min -1 respectively, p<0.05). The biotin supplemented group (6.0 mg biotin/kg diet) exhibited higher brain ACC activity in CBZ-treated rats compared to CBZ-treated rats consuming 0.06 mg biotin/kg diet (Fig. 4-8b, p<0.05). Hepatic specific enzymatic activity of PC was reduced by CBZ and but the decrease was prevented by biotin supplementation (Fig. 4-9a). The increase in PC activity due to biotin supplementation is

PAGE 77

65 5.026.047.068.0 0.00 0.25 0.50 0.75 1.00abacTime, dSerum biocytin, nmol/L 5.026.047.068.0 0.0 2.5 5.0 7.50.06 mg/kg -CBZ 6 mg/kg -CBZ 0.06 mg/kg + CBZ 6 mg/kg + CBZ Time, dLiver biocytin, pmol/g 5.026.047.068.0 0.0 2.5 5.0 7.5 10.0aacacTime, dBrain biocytin, pmol/gABC Figure 4-6. Effect of dietary carbamazepine (CBZ) on biocytin concentrations in (A) serum, (B) liver, and (C) brain in rats on day 68 of the study. Results are means SD, n=5. Means without a common letter at each time point differ, p<0.05. not limited to rats consuming CBZ, since it was also found that biotin supplementation increased PC activity in control rats consuming 0.06 mg biotin/kg diet (p<0.05). Relative to non-supplemented controls, biotin supplementation only increased PC activity in CBZ-treated rats by 16% compared to a 30% increase in activity of rats not consuming CBZ (Fig. 9, p<0.05). A similar relationship was observed for brain (Fig. 4-9b). The 48% decrease in brain PC activity induced by CBZ was prevented by biotin supplementation (Fig. 4-9b, p<0.05). Effect of NADH on Hepatic PC Activity In order to determine the mechanism by which PC activity increased in brain and liver following biotin supplementation in the CBZ-treated rats, it was hypothesized that there are activators of PC besides the Mg 2+ and acetyl CoA already accounted for in the activity assay. Elevated brain NADH would likely accompany decreased lactate. Since

PAGE 78

66 ACC1ACC2PCMCCPCCPCMCCPCCACC1 0 100 2000.06 mg/kg CBZ 6 mg/kg CBZ 0.06 mg/kg + CBZ 6 mg/kg + CBZ baaaaabcaabbaaaabbbbaabbaabcLiver Brainrelative abundance ofbiotinylatedcarboxylase, % ofcontrol Figure 4-7. Effect of dietary carbamazepine (CBZ) and biotin supplementation on the relative abundance of biotinylated biotin-dependent enzymes in rat liver and brain. Results (means SD, n=5) are expressed as a percentage of the control group (0.06 mg biotin/kg diet CBZ). Means for each carboxylase without a common letter differ, p<0.05. -CBZ+CBZ 0 50 100 150aaabHepatic ACC activity,pmolmg-1min-1 -CBZ+CBZ 0 25 50 75 100aaab0.06 mg/kg 6.0 mg/kg Brain ACC activity,pmolmg-1min-1AB Figure 4-8. Acetyl CoA carboxylase (ACC) specific enzymatic activity in (A) liver and (B) brain on day 68 of the study. Results (means SD, n=5) are expressed as pmol malonyl CoA formedmg 1min -1 Means for each activity without a common letter differ, p<0.05. -CBZ+CBZ 0.0 2.5 5.0 7.5abcaHepatic PC activity,nmol OAAmg-1min-1 -CBZ+CBZ 0.0 0.1 0.2 0.3 0.4 0.50.06 mg/kg 6.0 mg/kg aabaBrain PC activity,nmolmg-1min-1AB Figure 4-9. Pyruvate carboxylase (PC) specific enzymatic activity in (A) liver and (B) brain on day 68 of the study. Results (means SD, n=5) are expressed as nmol oxaloacetate formedmg protein -1 min -1 Means for each activity without a common letter differ, p<0.05.

PAGE 79

67 biotin supplementation prevents the increase in brain lactate and therefore maintains NADH concentration, the possibility of NADH being an activator of PC was studied. Using crude liver homogenates, we observed that NADH activates hepatic PC in both control and CBZ-treated rats. The addition of NADH to the reaction mixture brought hepatic PC concentration from CBZ-treated rats to equal hepatic PC activity from control rats having no added NADH (Fig. 4-10). 0 1 2 3 0 5 10 15Control CBZ NADH, mmol/LPyruvate carboxylaseactivity, nmol OAAformed/mg/min Figure 4-10. Activation of pyruvate carboxylase (PC) specific enzymatic activity by NADH in vitro using crude homogenate. PC specific enzymatic activity was determined in rat liver homogenate with 0-2.5 mmol/L NADH added to the reaction mixture for control and carbamazepine (CBZ)-treated rats. Control+ CBZ+ CBZ + Biotin 0.0 0.1 0.2abcBrain NADH,mol/gtissue Figure 4-11. Effects of carbamazepine (CBZ) and biotin supplementation on brain NADH concentrations of rats on day 68 of the study. Results (means SD, n=5) are expressed as mol NADH/g wet brain weight. Means for each bar without a common letter differ, p<0.05. NADH concentration was significantly lower in the brain of rats consuming 3.75 g CBZ/kg diet (Fig. 4-11). Biotin supplementation (6 mg/kg diet) partially prevented the

PAGE 80

68 decrease of brain NADH concentration in CBZ-treated rats to a range similar to that of controls. Discussion We investigated whether biotin supplementation could alleviate the antagonistic effects of CBZ on biotin status and function observed clinically. Clinical studies show that over 80% of epileptics undergoing long-term AED therapy exhibit some degree of biotin deficiency (90) but there are no animal studies that have been conducted regarding this phenomenon. Previous studies presented in Chapters 2 and 3 examined this effect, but showed no changes in serum, liver, or brain free biotin in rats after consuming CBZ for 21 or 28 d (124). In the present report, there was also no change in free biotin in these tissues after 26 d; however, CBZ significantly decreased serum and liver free biotin after day 47 and continued through day 68 d of the study. The observation that changes in biotin status were seen only after > 21 d of CBZ administration in this study supports the human clinical data where changes in biotin status were observed in epileptics undergoing long-term therapy (19). In the present study, biotin and CBZ were incorporated into the diet, and therefore, they were consumed simultaneously. This is a clinically relevant design since taking CBZ with meals is recommended to patients. Since biotin and CBZ were consumed together, this provided the greatest chance for the pharmacological dose of biotin to affect CBZ uptake in the intestine. In view of other studies finding that CBZ competitively inhibits biotin uptake in the intestine (66), there was a possibility that excess biotin may likewise inhibit CBZ uptake. Our results do not support this possibility since CBZ concentrations in serum, brain, and liver were unaltered by biotin supplementation.

PAGE 81

69 To determine whether elevated brain lactate during CBZ administration in rats (124) was due to decreased biotin status and PC activity, lactate was measured after biotin supplementation in rats administered 3.75 g CBZ/kg diet for 68 d. Serum and brain lactate were elevated approximately 15 and 100%, respectively, in rats consuming CBZ compared to controls, and supplementation with a pharmacological concentration of biotin (6 mg/kg diet) prevented this elevation. The elevation of brain lactate was ~10 fold higher than the increase found in our previous study where rats consumed 2.9 g CBZ/kg diet for 21 d. Not only did biotin supplementation in this present study prevent elevated brain and serum lactate in the drug-treated group, it did this without altering CBZ concentrations. This is striking evidence that decreased biotin status may, in fact, be related to elevated lactate in clinical (19) and animal studies (124) and that biotin supplementation can reduce lactate concentration. In CBZ-treated rats, the abundance of biotinylated ACC and PC were decreased in brain and liver. As expected, specific enzymatic activities of these carboxylases also were decreased in CBZ-treated rats since the biotinylated form is the active form of the enzyme. Biotin supplementation maintained the abundance of biotinylated ACC in these tissues; however, the abundance of biotinylated PC in brain and liver remained decreased. Biotin supplementation prevented the CBZ-induced decrease of both ACC and PC specific enzymatic activity. The likely mechanism for decreased ACC specific activity involves decreased biotin nutritional status, which led to under-biotinylation of all available ACC. Biotin supplementation increased the pool of free biotin available to biotinylate any remaining apo-ACC and, therefore, increased the amount of the active form of the enzyme. The mechanism is not as easily explained for the elevated brain and

PAGE 82

70 hepatic PC specific enzymatic activity following biotin supplementation since the abundance of biotinylated PC remained decreased. Whereas the precise mechanism of increased PC activity without changes in biotinylated PC is not known, changes in the concentration of an activator of PC could explain this phenomenon. Since biotin supplementation decreased lactate concentration in CBZ-treated rats to concentrations similar to control rats, it plausible that flux from lactate to pyruvate was increased or it was excreted from the body. Since lactate does not easily cross the blood-brain barrier, it is likely that lactate in the brain was at least partially shunted back to form pyruvate, a pathway that also involves the formation of NADH. In in vitro analysis, NADH maximally increased PC specific activities 350 and 170% in drug-treated and control groups, respectively, compared to PC activity when measured with no NADH in the reaction mixture (Fig. 4-9). We have purified rat liver PC and the kinetics of NADH activation are characterized in Chapter 5. Along with this activation data, the observation that CBZ decreased brain NADH and biotin supplementation prevented the decrease (Fig. 4-10) supports the hypothesis that higher NADH levels in CBZ-treated rats supplemented with biotin compared to CBZ-treated rats could account for the increased PC activity. The precise mechanism of action of anti-convulsant properties of CBZ is not completely known, but there is evidence showing it may enhance sodium channel inactivation (71). This stabilizes neuronal membranes preand postsynaptically by reducing high-frequency repetitive firing of action potentials or by slowing synaptic transmission (71). Another proposed mechanism is the blocking of N-methyl-D-aspartate (NMDA) receptor mediated events (73). NMDA is a glutamate receptor with involvement in seizure generation. It must be considered whether decreased biotin status

PAGE 83

71 contributes to the mechanism of action of the drug. Decreased function of biotin-dependent carboxylases, particularly PC, could result in higher cerebral concentrations of carbon dioxide, which has been shown to raise seizure threshold (142,143). Likewise, excessive carbon dioxide concentrations can induce seizures (144) and, therefore, could account for seizures unresponsive to CBZ. Decreased biotin status and PC activity in the brain could also lead to decreased concentration of OAA, which is an essential precursor for de novo synthesis of aspartate, an excitatory neurotransmitter. One study found a modest decrease in brain aspartate concentration following phenytoin treatment in rats (145). Further research is needed to determine precisely whether biotin deficiency during CBZ therapy is involved in the mechanism of action of the drug. If it is not involved in the mechanism of action, then it seems possible that maintaining biotin status during CBZ therapy could prevent some of the side effects that some 50% of patients on CBZ experience (71). The protective role of biotin supplementation during CBZ administration on biotin status and biotin-dependent enzyme function was demonstrated in this investigation. This characterization could serve as groundwork for future studies to determine whether biotin supplementation should be included as a concurrent strategy in the medical management of epilepsy.

PAGE 84

CHAPTER 5 CHARACTERIZATION OF PYRUVATE CARBOXYLASE ACTIVATION BY NADH Pyruvate carboxylase (PC) [EC 6.4.1.1] is a mitochondrial enzyme that catalyzes the formation of OAA from pyruvate and HCO 3 with concomitant ATP cleavage (146). The active site of PC consists of two separate subsites with biotin acting as a mobile 1-carbon carrier that is carboxylated at one subsite upon cleavage of ATP and then transfers the carboxyl group to the second subsite where pyruvate is carboxylated to form OAA (147,148). The synthesis of OAA provides a substrate for gluconeogenesis and it also replenishes tricarboxylic acid cycle intermediates used for amino acid and fatty acid synthesis. Both PC activity and the association state of the enzyme are regulated by several factors, including various activators and the dependence of association state on enzyme concentration. Studies have shown that upon decreasing PC enzyme concentration in vitro, there is dissociation of the catalytically active tetrameric enzyme into inactive dimers and, hence, loss of PC activity (149). It was also found that ATP, Mg 2+ and acetyl CoA can shift the equilibrium back to the tetrameric form to reactivate the enzyme (149). PC shows a dependence on acetyl CoA in certain species and also requires Mg 2+ for activity (150-153). PC mRNA expression is regulated by insulin, glucagon, and glucocorticoid concentrations during gluconeogenesis and lipogenesis (154-156). Siess et al. first suggested that mitochondrial NADH supply might be a factor in the regulation of PC activity (157). They found that NADH concentrations were elevated after PC 72

PAGE 85

73 activation by 3-hydroxybutyrate in in vitro studies (157), which suggests that the activation could be due to the increase in NADH concentration. Whether NADH exerts a direct regulatory effect on PC activity has not been previously investigated. We have demonstrated in Chapter 4 that NADH activates hepatic PC in a crude rat liver homogenate. The mechanism of activation is currently not known. In addition, it is not known whether other components of the homogenate contributed to the activation, including the possibility of oxidation of NADH to NAD + In this chapter, we present data showing that NADH is an activator of purified PC at high concentrations in vitro. We also report data regarding the influence of NADH on the kinetic constants for the different substrates from which we formulate a mechanistic hypothesis. Experimental Procedures Materials Male Sprague-Dawley rats were obtained from Harlan (Indianapolis, IN) and fed a standard rodent diet. D-biotin, protease inhibitor cocktail, [ 14 C]NaHCO 3 reduced -nicotinamide adenine dinucleotide (NADH), -nicotinamide adenine dinucleotide (NAD + ), -nicotinamide adenine dinucleotide phosphate (NADP + ), reduced -nicotinamide adenine dinucleotide phosphate (NADPH), and Sephacryl S200 were purchased from Sigma (St. Louis, MO); 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) and ethylenediaminetetraacetic acid (EDTA) were purchased from Fisher Scientific (Pittsburgh, PA); an ImmunoPure monomeric avidin column was purchased from Pierce (Rockford, IL). Avidin-AlexaFluor 430 conjugate was synthesized as previously described (97). Polyvinyldifluoride (Immobilon-P) was obtained from

PAGE 86

74 Millipore Corporation (Bedford, MA). All other chemicals used were analytical grade and of the highest purity available. Purification of Pyruvate Carboxylase PC was purified using a method adapted from Oei and Robinson (158). Rat liver obtained immediately after killing of the animals by exsanguination was minced into pieces and frozen in liquid nitrogen until use. Approximately 16 g was thawed and homogenized in 20 mL HEM buffer on ice (30 mmol/L HEPES, pH 7.2, 1 mmol/L EDTA, 300 mmol/L mannitol, and protease inhibitor cocktail) for 1 min using a Polytron homogenizer (Brinkman Instruments, Westbury, NY). The homogenate was centrifuged at 200,000 x g at 4C for 30 min, and the soluble fraction recovered was immediately applied to an ImmunoPure monomeric avidin column (Pierce, Rockford, IL) at 4C. Prior to application of the protein, the column was first washed with 6 mol/L guanidine-HCl, 0.2 mol/L KCl (pH 1.5) and then equilibrated with running buffer comprised of 0.1 mol/L Tris-HCl (pH 7.4), 1 mmol/L EDTA, 0.1 mmol/L dithiothreitol, 5% (v/v) glycerol (Buffer A). The column was washed with 2 mmol/L biotin in the running buffer to saturate biotin-binding sites and washed with 10 column volumes of 0.1 mol/L glycine-HCl (pH 2.8) to remove exchangeable biotin. After reequilibration with running buffer, the soluble protein fraction was applied to the column and non-biotinylated proteins were eluted with 10 volumes of Buffer A. After A 280 was < 0.05, biotinylated proteins were eluted with 2 mmol/L biotin in Buffer A. Fractions containing PC activity were pooled and directly applied to a Sephacryl S200 column equilibrated with Buffer A. PC activity was measured in collected fractions, and those containing the majority of the activity were pooled. PC activity was also assayed at each step during the purification procedure.

PAGE 87

75 Purity was determined by SDS-PAGE analysis using 8% w/v total acrylamide followed by an avidin-western blot (124). Rat liver PC was also purified using the above method for the experiment testing whether physiological NADH concentrations activate PC in vitro. Pyruvate Carboxylase Activity Assay PC activity was determined as described previously (124). Activity assays were conducted under conditions that allowed measurement of initial rate, and activity was a linear function of enzyme concentration. Protein concentration was determined by the method of Markwell et al. (101). All of the kinetic data presented in this paper were obtained using the purified PC. Various concentrations of NADH were added to the activity assay reaction mixture (0, 1.25, and 2.5, mmol/L) to evaluate the effects of NADH on PC activity with no preincubation. In order to determine whether other pyridine nucleotides affect PC activity, a similar experiment was performed with the addition of 5 mmol/L NAD + NADPH, or NADP + added to the reaction mixture. K m and V max values were calculated from saturation curves of velocity versus concentration of each substrate (pyruvate, ATP, or HCO 3 ) by nonlinear regression using GraphPad Prism Enzyme Kinetics Software (GraphPad Software, Inc. San Diego, CA). For these experiments, the non-variable substrates were saturating concentrations (3.14 mmol/L ATP, 4 mmol/L HCO 3 and 7.5 mmol/L pyruvate). Results Pyruvate Carboxylase Purification Avidin-affinity chromatography successfully isolated biotin-dependent enzymes, which were then applied to a size-exclusion column to purify PC. PC activity was eluted

PAGE 88

76 approximately with the void volume of the Sephacryl S200 column. Approximately 14% of initial PC activity was recovered after the last purification step, and this yielded a 270-fold purification (Table 5-1). Table 5-1. Purification table for rat liver pyruvate carboxylase (PC). Protein (mg)vol (ml)Activity (nmol/min)Specific activity (nmol/min/mg)Recovery of activity (%) Purification (-fold)Homogenate 190024170009.2100 1.0Cytosol 490771001542.0 1.6Post-Avidin column 6.08250042014.0 45Post-Sephacryl S200 1.042400250014.0 270 The amido stained gel and avidin-western blot (Fig. 5-1a & b) revealed that other biotin-dependent carboxylases were present in the avidin column eluant but they were not present in the Sephacryl S200 elution fraction containing PC activity. Figure 5-1. Amido-stained proteins following SDS-PAGE (8% w/v total acrylamide) (A) and avidin-western blot following PC purification (B). For both blots: lane 1, liver homogenate; lane 2, 200,000 x g supernatant; lane 3, post-avidin column; lane 4, post Sephacryl S200 column; lane 5 (A only), protein MW standards. Equal volumes of sample were applied to each lane. Pyruvate carboxylase, PC; methylcrotonyl CoA carboxylase, MCC; propionyl CoA carboxylase, PCC.

PAGE 89

77 Kinetic Constants Regardless of the concentration of NADH (0, 2.5 and 5 mmol/L) in the reaction mixture, PC obeyed Michaelis-Menten kinetics (Fig. 5-2). The Hill coefficient was determined to be 0.89 0.1, which suggests that NADH does not bind PC cooperatively.

PAGE 90

78 0 1 2 3 4 0 250 500 750 10000 NADH 1.25 mM NADH 2.5 mM NADH HCO3,mmol/LPC activity,nmolmg-1min-1 0 1 2 3 4 0 250 500 750 1000ATP, mmol/LPC activity,nmolmg-1min-1 0 2 4 6 8 0 500 1000 1500Pyruvate, mmol/LPC activity,nmolmg-1min-1ABC Figure 5-2. Effect of NADH concentration on the kinetics of pyruvate carboxylation by pyruvate carboxylase (PC) using variable HCO 3 with 3.14 mmol/L ATP and 7.5 mmol/L pyruvate(A), variable ATP with 4 mmol/L HCO 3 and 7.5 mmol/L pyruvate (B), and variable pyruvate with 3.14 mmol/L ATP and 4 mmol/L HCO 3 (C). Each data point represents means from two independent assays with duplicate samples for each assay.

PAGE 91

79 NADH altered Michaelis-Menten kinetic constants for the three substrates for the enzyme. Increasing concentrations of NADH increased V max of PC for pyruvate (Table 5-2). NADH increased V max 62 and 21% for PC with both ATP and HCO 3 respectively. The K m for these substrates was reduced 29 and 31 % for ATP and HCO 3 respectively, upon the addition of 2.5 mmol/L NADH to the reaction mixture. Table 5-2. Effects of increasing NADH concentrations on Michaelis-Menten kinetics for various substrates for pyruvate carboxylase (PC). 0 NADH 1.25 mM NADH 2.5 mM NADH HCO3 Km (mmol/L) 1.5 0.26 0.93 0.09 1.0 0.09 ATP Km (mmol/L) 0.77 0.20 0.55 0.12 0.55 0.15 Pyruvate Km ( mmol/L ) 0.40 0.07 0.50 0.05 0.50 0.08 Since the conditions of this activity assay do not constitute an oxidizing environment (124), it is not likely that NADH is being converted to NAD + in the reaction mixture. However, to determine unambiguously whether PC activation is specific for NADH, other pyridine nucleotides were also tested (NAD + NADP + and NADPH). These compounds did not activate PC, but instead decreased activity with increasing concentrations (Fig. 5-3). Unlike the effects observed with PC from crude liver homogenate seen in Chapter 4, physiological concentrations of NADH (0.05-0.30 mmol/L) did not activate purified PC (Fig. 5-4). Discussion There is reason to believe that physiological and pharmacological concentrations of NADH activate PC activity based on our preliminary studies using unpurified PC in Chapter 4. In order to determine explicitly whether NADH is an activator of PC specific

PAGE 92

80 enzymatic activity, PC from rat liver was purified. We found that pharmacological concentrations of NADH alter Michaelis-Menten kinetic constants for pyruvate, ATP, and HCO 3 which indicates that pharmacological concentrations of NADH are capable of regulating PC activity. Because NADP + NAD + and NADPH did not activate PC and actually suppressed PC activity, we conclude that NADH is a specific activator for PC. Figure 5-3. Purified rat liver pyruvate carboxylase (PC) specific enzymatic activity determined with and without 5 mmol/L NADH, NAD + NADP + or NADPH added to the reaction mixture. Each data point represents means from two independent assays with duplicate samples for each assay. 0.00 0.13 0.26 700 800 900 1000 1100 1200 1 2 3 4 5NADH, mmol/LPC activity,nmolmg-1min-1 Figure 5-4. Physiological and pharmacological NADH effects on specific enzymatic activity of purified pyruvate carboxylase (PC). Data from Chapter 4 indicate that physiological concentrations of NADH also activate PC, which suggests that cellular NADH concentration may regulate PC activity. We did

PAGE 93

81 not find this to be the case, however, with purified PC in vitro. At physiological concentrations of NADH (0.05-0.30), there was no change in PC specific enzymatic activity. The fact that PC from the crude homogenate and the purified PC do not behave similarly suggests that there is an unknown factor in the crude homogenate that is responsible for the activation. It is possible that the endogenous NADH in the crude homogenate may also have an effect on PC. The reaction catalyzed by PC is a sum of two partial reactions that occur at different sites on the enzyme (147,148). The valeric acid side chain of biotin is covalently bound to a specific lysine residue 35 amino acids from the C-terminus of the enzyme (159) and the long chain can act as a hinge to allow for the carboxylated biotin molecule to move from one reaction site to the next. In the first reaction site, biotin is carboxylated and ATP is concurrently hydrolyzed. Carboxylated biotin is then shifted to the second reaction site where the 1-carbon unit is transferred to pyruvate to form OAA. Since the decrease in K m was specific for ATP and HCO 3 but not pyruvate, we can speculate that NADH is acting at the site where biotin is carboxylated in the first partial reaction. While the 3-dimensional structure of PC has not been fully determined, there may be a region present that resembles a Rossmann fold that is a common binding site for enzymes requiring nucleotide binding for activity (160). The ATP/HCO 3 binding domain (site of first partial reaction) of yeast PC is between amino acids 157 and 468, while the pyruvate binding domain (site of second partial reaction) is between amino acids 559 and 913. A conserved motif among proteins with a Rossmann fold is KMSKS, and the closest match in the PC sequence is between amino acids 442-446 with KMSRA.

PAGE 94

82 This could possibly allow similar folding since the charges would be similar at physiological pH. Regulation of PC activity plays a crucial role in the control of gluconeogenesis. The design of metabolic reactions is such that anabolic and catabolic pathways are regulated in order to minimize futile cycling. Glycolysis and gluconeogenesis are examples of such metabolic pathways that are carefully regulated. It recently has been found that NAD + is an allosteric activator of pyruvate kinase in rat liver cells (161). Increased cytosolic NAD + concentration was associated with decreased gluconeogenesis and enhanced glycolysis (161). Our data, which indicate that NADH activates purified rat liver PC at high concentrations and at both high and low concentrations for PC from crude liver homogenate (Chapter 4), suggest that increased NADH may stimulate gluconeogenesis in vivo. In the present studies, we may not be accounting for an unknown factor or effect of NADH on PC from crude liver homogenate and we cannot rule out this same effect in vivo. Thus, these data provide evidence for another mechanism by which gluconeogenesis might be regulated in vivo but requires further investigation.

PAGE 95

CHAPTER 6 DISCUSSION This project describes the use of a rat model to address various aspects of altered biotin metabolism during oral CBZ administration. CBZ alters both biotin status and function after long-term therapy in rats. Most investigations of biotin metabolism during CBZ administration done previously were from clinical trials and have included plasma or urine biotin, BNB, and BSO measurements. Only one animal study examined the effects of three days of i.p. administration of CBZ on biotin, BNB, and BSO concentrations in the plasma (103). There were no differences found among these metabolites following CBZ administration, and it was suggested that a rat might not be a good model for human response of biotin after CBZ. There were several potential problems with this study, however, including the i.p. mode of administration. As stated earlier, one of the potential mechanisms of decreased biotin status is decreased biotin uptake across the intestinal brush border (66), and i.p. administration of CBZ would bypass this competitive uptake. Also, CBZ was only administered for three days in the study. Clinical data showing that AEDs decrease plasma biotin 45-50% are from patients undergoing long-term therapy for many years (19,20) and, therefore, three days may not have been long enough to elicit a response. Our rat model of oral CBZ administration is also clinically relevant in that the CBZ concentrations used in all of our studies were not toxic based on observations that all rats continued to gain weight for the entire duration of the studies. Other rat studies of oral CBZ administration report evidence that dosages were toxic based on decreased weight 83

PAGE 96

84 gain during the study and food intakes were not reported (83). The dietary model used in the experiments outlined for this project was useful because CBZ was administered orally, which closely models normal administration of the drug in humans, and biotin intake was physiologically relevant. Although serum CBZ concentrations in all three experiments were lower than the 4-12 mg/L therapeutic range for humans, we still observed alterations of biotin status and function. Therefore, our animal model could be considered as conservative compared to studies in humans with plasma CBZ between 4-12 mg/L. These studies demonstrated that biotin status and function of biotin-dependent enzymes at the tissue level are decreased during CBZ administration and that this decrease is prevented by biotin supplementation. Previously, changes in biotin status and function in tissues were poorly understood since most data of decreased plasma biotin status during AED therapy were from clinical trials. We, however, speculated that there would be a decrease in biotin-dependent enzyme function in tissues based on clinical observations that patients undergoing long-term AED therapy excreted high concentrations of organic acids including lactic acid, propionic acid, and 3-HIA. Although not definitive, these organic acids imply a loss of function of PC and ACC, PCC, and MCC, respectively. It is not well understood how pharmacological biotin supplementation prevented decreases in hepatic and brain PC specific enzymatic activity without altering the abundance of the biotinylated form of PC, which is the active form of the enzyme. One possibility is that there is an activator of PC not accounted for in the enzyme activity reaction mixture. Since biotin supplementation also prevented the decrease of ACC

PAGE 97

85 activity, the flux through this pathway could be increased along with an increased flux of lactate back to pyruvate (Fig. 6-1). This reaction, catalyzed by lactate dehydrogenase, is also accompanied by the formation of NADH (Fig. 6-1). We found that physiological concentrations of NADH activate PC from crude homogenate in vitro but not from purified PC. Since we also found that CBZ significantly reduced brain NADH concentration and that biotin supplementation partially prevented this metabolic effect, it is possible that the NADH generated after biotin supplementation and increased ACC activity was enough to increase PC activity in vivo without changing the abundance of the active form of the enzyme. 1 2 3 PC A CC + Figure 6-1. NADH as an activator of pyruvate carboxylase (PC). It is proposed that, upon biotin supplementation, ACC activity is increased and flux through the pathway catalyzed by this enzyme is increased (1). As a result of increased flux through this pathway, there is an increased flux of lactate to pyruvate and a resulting increase in concentration of NADH (2). NADH then activates PC without changing the abundance of biotinylated PC (3). The studies presented in this project show that oral CBZ administration to rats increases brain and serum lactate concentrations, and that biotin supplementation can completely prevent these increases. It is evident that biotin supplementation during CBZ therapy may be effective in preventing the lactic aciduria experienced by epileptics during long-term AED therapy (19,20). Before we can suggest that biotin

PAGE 98

86 supplementation should be considered for future medical management for the treatment of epilepsy to prevent this side effect, we must demonstrate that lactic acid buildup in the brain is actually an adverse effect. It is assumed that the elevated brain and serum lactate during CBZ administration to rats is an adverse side effect based on adverse effects of lactate accumulation in other tissues. Intravenous infusion with racemic D-, L-lactate into rats was accompanied by bradycardia when serum lactate was 1-2 mmol/L and fibrillation and ventricular standstill at 11 mmol/L (51). In other studies, patients with short bowel syndrome had elevated D-lactate (0.5 mmol/L) that was produced from colonic bacteria and was correlated with confusion, loss of memory, slurred speech, unsteady gait, and visual blurring (162). There is a possibility, however, that increased lactate could be involved with the mechanism of action of the drug. One of the most important questions that must be asked as a result of this research is whether decreased biotin status is a part of the mechanism of action of CBZ. If this were the case, then biotin supplementation during CBZ therapy would be expected to decrease the efficacy of the drug in the prevention of seizures. Biotin deficiency is accompanied by decreased PC activity, an enzyme that catalyzes the conversion of pyruvate to OAA. The overall effect of decreased PC activity is a relative diminution of the OAA pool and a consequent shift of the aspartate aminotransferase reaction away from aspartate, an excitatory neurotransmitter (Fig. 6-2). Increased glutamate concentrations would allow more substrate to be available for the glutamate decarboxylase reaction favoring -aminobutyric acid (GABA) production, which is an inhibitory neurotransmitter. Increased inhibitory neurotransmitter and decreased excitatory neurotransmitter concentrations that accompany a biotin deficiency could

PAGE 99

87 potentially decrease seizure activity and, therefore, could be a mechanism of action for CBZ. Ketogenic diets are used to manage epileptic seizures, and the mechanism of action may be similar to metabolic perturbations that are observed during a biotin deficiency (163). One proposed mechanism of action of the ketogenic diet is a decreased pool of OAA since -hydroxybutyrate utilizes available coenzyme A to produce acetyl CoA and, therefore, there is a decreased supply of TCA cycle intermediates. This is proposed to lead to decreased OAA, which would then yield increased inhibitory and decreased excitatory neurotransmitters. Glutamate Aspartate Glutamate Aspartate Oxaloacetate Pyruvate -ketoglutarate GABA Cytosol Mitochondrion P C Figure 6-2. Mitochondrial glutamate-aspartate translocator. PC, pyruvate carboxylase; GABA, -aminobutyric acid. If it were the case that decreased biotin status is part of the mechanism of action of CBZ, it would obviously not be recommended that epileptic patients receive concomitant biotin supplementation to increase status. Then, however, the consequences of long-term biotin deficiency must be addressed for patients who may require CBZ therapy for an entire lifetime. Seizure control among epileptic patients will be top priority for clinicians, but implications of biotin deficiency may need to be considered since it is apparent that CBZ therapy decreases biotin status and function of biotin-dependent enzymes. While studies have not been done directly addressing the effects of a long-term

PAGE 100

88 marginal biotin deficiency, it is likely that the metabolic pathways of carbohydrate, amino acid, and fatty acid metabolism that involve biotin-dependent enzymes would be altered. Since it has been shown in animal studies that biotin deficiency during pregnancy is teratogenic (164,165), this could also be a potential public health concern for women taking CBZ. CBZ administration during pregnancy increases chances for birth defects and developmental delay among the fetus (166-170). The future direction of this research may involve an investigation of the efficacy of CBZ in seizure control with concurrent biotin supplementation in an animal model of epilepsy. There are several animal models of epilepsy, including induction of seizures in an animal model with electrical stimulation, chemoconvulsants, and genetic models including a genetically epilepsy-prone rat strain. Only after it has been tested in an animal model and it has been found that CBZ is still effective in preventing seizures with concurrent biotin supplementation will this be likely to be tested in humans. The current project has demonstrated that biotin supplementation can completely prevent decreases in biotin status, biotin-dependent enzyme function, and increases in lactate concentration induced by long-term oral CBZ administration. The public health significance of the decreases in biotin status and function during CBZ therapy is important, particularly for epileptics, and may explain some of the adverse side effects experienced by nearly 50% of patients undergoing long-term AED therapy. Biotin supplementation during pregnancies of women taking CBZ should especially be considered to possibly reduce teratogenic risks commonly associated with CBZ therapy during pregnancy. This project has expanded the area of nutrient-drug interactions and the data presented here should provide a basis for the direction of future studies in this

PAGE 101

89 field to determine whether biotin supplementation should be included in the medical management of epilepsy.

PAGE 102

APPENDIX GENERAL METHODS Protein Concentration Measurement According to a method by Markwell et al. (101), the protein concentration in tissue samples was determined as follows. Samples or a standard curve using various concentrations of known amounts of BSA (0 100 mg/mL) diluted in dH 2 O were made in duplicate. An aliquot (1 mL) of solution C [100:1 solution A (2% Na 2 CO 3 0.4% NaOH, 0.16% Na + K + Tartrate, 1.0% SDS (w/v) to solution B (4% CuSO 4 )] was added to each sample or standard, vortexed, and incubated at room temperature for 10 min. Folin phenol (100 L, 1 mol/L) was then added, immediately vortexed, and incubated at room temperature for 45 min and the absorbance was read at 650 nm. A nonlinear regression (second order polynomial) was performed and unknown sample protein concentrations were extrapolated from this curve. Preparation of HPLC Standards Synthesis of L and D-Biotin Sulfoxides Acid peroxide (0.1 mol/L HCl, 1% v/v H 2 O 2 ) was mixed with an equal volume of either 100 mol/L [ 3 H] biotin (32 Ci/mmol) or unlabeled biotin and incubated for 24 h at room temperature. The reaction was stopped by adding 1.5 volumes of 0.1 mol/L NaOH and the samples were dried under N 2 at 37C. Finally, biotin sulfoxides (BSO) were resuspended in 10 mmol/L KP i pH 7.0. 90

PAGE 103

91 Synthesis of Bisnorbiotin Bisnorbiotin (BNB) was made using a previously described method with minor modifications (50). Rhodotorula rubra (ATCC) was grown in YPD broth (50 g/L, Becton Dickinson, Sparks, MD) and then washed 4 times in 0.9% saline (w/v) by centrifugation (10 min at 1,500 x g) to remove growth medium. The cells were resuspended in 10 mL of 0.25 mol/L phosphate buffered saline, pH 7.2. [ 14 C] biotin was diluted to 50 Ci/mL in 2 mL of 0.25 mol/L PBS. 1.75 mL (87.5 Ci) of the [ 14 C]biotin was added to 1 mL of cells. The yeast was cultured for 48 h with constant gentle shaking at 190-200 rpm at 25C. Then the cells were removed by centrifugation (20 min, 1,500 x g, 4C), and the supernatant that contained the [ 14 C]BNB was retained. The supernatant was centrifuged at 1,500 x g for 10 min at 4C to remove any remaining cells. BNB was separated from any remaining biotin by reversed phase HPLC described below. It was determined that the conversion of biotin to BNB was 92% efficient and the theoretical concentration of the newly synthesized BNB was adjusted accordingly (Fig. A-1). 48 h 246810121416182022242628303234363840 0 1000 2000 3000 4000cpm Figure A-1. Bisnorbiotin (BNB) synthesis. 48 h after incubation of Rhodotorula rubra with [ 14 C]biotin, 92% is converted to [ 14 C]BNB.

PAGE 104

92 HPLC Conditions for Biotin Measurements All samples were ultrafiltered using a 5000 molecular weight cutoff filter prior to injection to remove protein bound biotin. Therefore, this method is solely for the measurement of free biotin. Biotin and its metabolites were separated using a mobile phase gradient with two solutions. Solution 1 consisted of 0.05% (v/v) trifluroracetic acid (Sigma, St. Louis) adjusted to pH 2.5 with ammonium acetate, and Solution 2 was a 1:1 (v/v) dilution of Solution 1 mixed with HPLC grade acetonitrile (Fisher). At time zero, the gradient was 0% Solution 2, 100% Solution 1 and by 35 min, the gradient reached 60% Solution 1 and 40% Solution 2. Nonpolar molecules in the sample were then removed from the column after the analytical gradient by increasing Solution 2 to 100% for 5 min. The column was then re-equilibrated in 100% Solution 1 for the next 20 min for a total run time per sample of 60 min. Biotin eluted at fractions 35-36, BSO eluted at fractions 19-20, biocytin eluted at 30-33, and BNB eluted at fractions 22-23. Method Validation for the Measurement of Carbamazepine in Serum Using HPLC A Waters Model 501 HPLC (Millipore, Bedford, MA) with a Waters U6K injector (Millipore), a Waters 486 Model tunable absorbance detector (Millipore, Bedford, MA), and a 5 m, Luna C-18 reversed-phase (Phenomenex) 250 X 2 mm column was used to measure CBZ concentration in the serum (100). A 1 mg/mL stock standard of CBZ was made in HPLC-grade methanol. Various concentrations of CBZ working stock standards (2.5 20 mg/L) were prepared freshly in 10% distilled water and 90% phosphate buffer (0.4 mM potassium phosphate, adjusted to pH 6.0 with 0.9 mol/L phosphoric acid). The mobile phase consisted of 17:28:55 acetonitrile/methanol/phosphate buffer. 5-Ethyl-5-p-tolylbarbituric acid (tolylbarb) was used as an internal standard to compare the peak

PAGE 105

93 height ratio with that of CBZ. Samples were prepared by precipitating proteins with acetone containing 10 mg/L tolylbarb added to an equal volume of serum as described in Chapter 2. Sample or standard (5 L) was injected and eluted with mobile phase at ambient temperature and 0.2 mL/min, monitoring the effluent at 195 nm. Tolylbarb consistently eluted around 15.5 min and CBZ eluted at 19.5 min as seen in spiked serum samples in Fig. A-2. A. B.C. D. tolylbarb cbz Figure A-2. The 4 chromatograms represent spiked serum samples separated by HPLC with known amounts of carbamazepine (CBZ): 2.5mg/L (A), 5 mg/L (B), 10 mg/L (C), and 20 mg/L (D). 10 mg/L of the internal standard tolylbarb was used with each run. The peak areas were determined by Millennium 2010 Chromatography Manager software and the peak area ratio between CBZ and tolylbarb was determined for each standard and sample. The concentration of CBZ in the sample was then determined by extrapolation from the linear regression of the standard curve. In order to determine % recovery with spiked samples, various concentrations of CBZ were added to a serum

PAGE 106

94 sample and the peak area ratio was determined (Fig. A-3). The interassay error between days (same sample was measured 10 different days) was determined to be 1.66%. Spiked samples Mean Ratio SEM % recovery 2.5 mg/L 0.34 0.012 110 2.4 5 mg/L 0.69 0.014 98 1.4 10 mg/L 1.5 0.008 99 0.27 20 mg/L 3.0 0.013 95 0.58 0 5 1 0 1 5 2 0 2 5 0 1 2 3 4 c a r b a m a z e p in e m g / L Figure A-3. Standard curve for carbamazepine (CBZ) with table of values where serum was spiked with known concentrations of CBZ. Separation of Propionyl CoA Carboxylase and Methylcrotonyl CoA Carboxylase In order to determine the proper conditions to separate MCC and PCC, the following experiment was done (Fig. A-4). We found that loading 80 g of liver homogenate onto an 8% (w/v total acrylamide) SDS-PAGE gel with a separating gel buffer pH 8.0 maximally separated these two carboxylases that only differ in molecular weight by 0.5 kDa. p H 8.0 8.3 8.5 8.8 9.0 9.2 9.4 % gel: 6 7 8 9 A. B. -MCC -PCC Figure A-4. Separation of propionyl CoA carboxylase (PCC) and methylcrotonyl CoA carboxylase (MCC) using SDS-PAGE. In (A), separating gel buffers with different pH were used to optimally separate PCC and MCC (lower 2 bands in gels). In (B), a separating gel buffer with pH 8.0 was used with different % (w/v) total acrylamide. Linearity of Avidin-AlexaFluor 430 Detection Using STORM Fluorescent Scanner Loading 80 g liver homogenate using the conditions defined above to separate PCC and MCC has been determined to be within the linear range of the detection limits

PAGE 107

95 of avidin AlexaFluor-430 using a STORM fluorescent scanner (Fig. A-5). To determine the linear range of detection, a range of homogenate masses were loaded on a 10% (w/v total acrylamide) SDS-PAGE gel and detected with avidin AlexaFluor-430. The specificity of this detection was confirmed through competition with excess avidin. Liver homogenate (80 g) was resolved by SDS-PAGE and transferred to PVDF as described in Chapter 2. A v i d i n A l e x a F l u o r 0 50 100 150 200 0 2 5 0 0 0 5 0 0 0 0 7 5 0 0 0 P C P C C / M C C r 2 = 0 9 9 2 4 r 2 = 0 9 8 2 8 g homogenate loaded 100 50 25 12.5 6.3 3.1 1.6 0.8 0.4 Fluorescence, arbitrary units Figure A-5. Linearity of liver homogenates using avidin AlexaFluor-430 for detection. Biotinylated Protein Competition with Biotin Using Avidin-AlexaFluor 430 Detection In order to determine specificity of the detection of biotinylated proteins using avidin-AlexaFluor-430, an avidin-western blot was performed with excess biotin to compete for binding to the avidin. For the competition, 0.1 mol/L biotin was competed with 1:750 avidin AlexaFluor-430 (Fig. A-6).

PAGE 108

96 PC MCC PCC Figure A-6. Avidin competition. Biotin-dependent enzymes, pyruvate carboxylase (PC), methylcrotonyl CoA carboxylase (MCC), and propionyl CoA carboxylase (PCC) are competed in the blot on the left with excess biotin. Diet Preparation A diet commonly used for the analysis of dietary components formulated by the American Institute of Nutrition (AIN 76A) was used in the following experiments (Research Diets, Inc., New Brunswick, NJ). Although similar to diets used in other studies on biotin nutriture, this diet differs significantly from those used earlier in terms of carbohydrate source and amount, fatty acid composition, and some vitamins and minerals (95). The composition of the diet is spray dried egg white (20%), corn starch (15%), sucrose (50%), cellulose (5%), corn oil (5%), AIN 76A mineral and vitamin mix (with 0.06 mg/kg biotin), and choline bitartrate (0.2%). This diet has been modified to include spray-dried egg white as its sole protein source. The avidin protein of the egg white in the purified diet binds approximately 1.44 mg biotin/kg of purified diet, inhibiting biotin absorption (98). A 0.06 mg biotin/kg diet represents the biotin in excess of the binding capacity of the dietary egg white avidin. This daily dietary intake of biotin closely resembles the average daily biotin intake of a 70 kg person. CBZ was added to

PAGE 109

97 this diet in the appropriate amounts selected for the groups in the studies presented in Chapters 2-4.

PAGE 110

LIST OF REFERENCES 1. Mock, D. M. (1996) Biotin. In: Present Knowledge in Nutrition (Zeigler, E., Filer, L., ed.). pp. 220-235. ILSI Press, Washington, DC. 2. Chapman-Smith, A. & Cronan, J. E., Jr. (1999) The enzymatic biotinylation of proteins: a post-translational modification of exceptional specificity. Trends Biochem Sci 24: 359-363. 3. Combs, G. F. (1992) The Vitamins. Fundamental Aspects in Nutrition and Health. Academic Press, Inc., San Diego, CA. 4. Lee, H. M., McCall, N. E., Wright, L. D. & McCormick, D. B. (1973) Urinary excretion of biotin and metabolites in the rat. Proc Soc Exp Biol Med 142: 642-644. 5. Yang, H. C., Kusomoto, M., Iwahara, S., Tochikura, T., & Ogata, K. (1968) Degradation of d-biotin by microorganisms. Agric. Biol. Chem. 32: 399-400. 6. Mock, D. M., Lankford, G. L. & Mock, N. I. (1995) Biotin accounts for only half of the total avidin-binding substances in human serum. J Nutr 125: 941-946. 7. Mock, D. M., Lankford, G. L. & Cazin, J. (1993) Biotin and biotin analogs in human urine: biotin accounts for only half of the total. J Nutr 123: 1844-1851. 8. Gravel, R. A. & Robinson, B. H. (1985) Biotin-dependent carboxylase deficiencies (propionyl-CoA and pyruvate carboxylases). Ann N Y Acad Sci 447: 225-234. 9. Krause, K. H., Kochen, W., Berlit, P. & Bonjour, J. P. (1984) Excretion of organic acids associated with biotin deficiency in chronic anticonvulsant therapy. Int J Vitam Nutr Res 54: 217-222. 10. Mock, D. M., Mock, N. I. & Weintraub, S. (1988) Abnormal organic aciduria in biotin deficiency: the rat is similar to the human. J Lab Clin Med 112: 240-247. 11. Kalousek, F., Darigo, M. D. & Rosenberg, L. E. (1980) Isolation and characterization of propionyl-CoA carboxylase from normal human liver. Evidence for a protomeric tetramer of nonidentical subunits. J Biol Chem 255: 60-65. 98

PAGE 111

99 12. Mock, N. I., Malik, M. I., Stumbo, P. J., Bishop, W. P. & Mock, D. M. (1997) Increased urinary excretion of 3-hydroxyisovaleric acid and decreased urinary excretion of biotin are sensitive early indicators of decreased biotin status in experimental biotin deficiency. Am J Clin Nutr 65: 951-958. 13. Abu-Elheiga, L., Brinkley, W. R., Zhong, L., Chirala, S. S., Woldegiorgis, G. & Wakil, S. J. (2000) The subcellular localization of acetyl-CoA carboxylase 2. Proc Natl Acad Sci U S A 97: 1444-1449. 14. Praul, C. A., Brubaker, K. D., Leach, R. M. & Gay, C. V. (1998) Detection of endogenous biotin-containing proteins in bone and cartilage cells with streptavidin systems. Biochem Biophys Res Commun 247: 312-314. 15. van den Berg, H. (1997) Bioavailability of biotin. Eur J Clin Nutr 51: S60-S61. 16. Frigg, M. (1977) Comparative study on the effect of biotin contained in various cereals on chicken growth. Nutr Metab 21 Suppl 1: 236-237. 17. Food and Nutrition Board Institute of Medicine (2000) Dietary Reference Intakes for Thiamin, Riboflavin, Niacin, Vitamin B6, Folate, Vitamin B12, Pantothenic Acid, Biotin, and Choline. pp. 374-389. National Academy Press, Washington DC. 18. Scholtissek, J., Barth, C. A., Hagemeister, H. & Frigg, M. (1990) Biotin supply by large bowel bacteria in minipigs: evidence from intracaecal avidin. Br J Nutr 64: 715-720. 19. Krause, K. H., Bonjour, J. P., Berlit, P. & Kochen, W. (1985) Biotin status of epileptics. Ann N Y Acad Sci 447: 297-313. 20. Krause, K. H., Berlit, P. & Bonjour, J. P. (1982) Impaired biotin status in anticonvulsant therapy. Ann Neurol 12: 485-486. 21. Mock, D. M., Stadler, D. D., Stratton, S. L. & Mock, N. I. (1997) Biotin status assessed longitudinally in pregnant women. J Nutr 127: 710-716. 22. Livaniou, E., Costopoulou, D., Vassiliadou, I., Leondiadis, L., Nyalala, J. O., Ithakissios, D. S. & Evangelatos, G. P. (2000) Analytical techniques for determining biotin. J Chromatogr A 881: 331-343. 23. Said, H. M. & Redha, R. (1987) A carrier-mediated system for transport of biotin in rat intestine in vitro. Am J Physiol 252: G52-55. 24. Said, H. M., Mock, D. M. & Collins, J. C. (1989) Regulation of intestinal biotin transport in the rat: effect of biotin deficiency and supplementation. Am J Physiol 256: G306-311. 25. Said, H. M. (1991) Movement of biotin across the rat intestinal basolateral membrane. Studies with membrane vesicles. Biochem J 279: 671-674.

PAGE 112

100 26. Prasad, P. D., Wang, H., Huang, W., Fei, Y. J., Leibach, F. H., Devoe, L. D. & Ganapathy, V. (1999) Molecular and functional characterization of the intestinal Na+dependent multivitamin transporter. Arch Biochem Biophys 366: 95-106. 27. Prasad, P. D., Srinivas, S. R., Wang, H., Leibach, F. H., Devoe, L. D. & Ganapathy, V. (2000) Electrogenic nature of rat sodium-dependent multivitamin transport. Biochem Biophys Res Commun 270: 836-840. 28. Zempleni, J. & Mock, D. M. (1998) Uptake and metabolism of biotin by human peripheral blood mononuclear cells. Am J Physiol 275: C382-388. 29. Mock, D. M. & Malik, M. I. (1992) Distribution of biotin in human plasma: most of the biotin is not bound to protein. Am J Clin Nutr 56: 427-432. 30. Chauhan, J. & Dakshinamurti, K. (1988) Role of human serum biotinidase as biotin-binding protein. Biochem J 256: 265-270. 31. Partridge, W. M. (1998) Introduction to the blood brain barrier: Methodology, biology, and pathology. Cambridge University Press, New York, NY. 32. Bhagavan, H. N. & Coursin, D. B. (1970) Depletion of biotin from brain and liver in biotin deficiency. J Neurochem 17: 289-290. 33. Sander, J. E., Packman, S. & Townsend, J. J. (1982) Brain pyruvate carboxylase and the pathophysiology of biotin-dependent diseases. Neurology 32: 878-880. 34. Spector, R. & Eells, J. (1984) Deoxynucleoside and vitamin transport into the central nervous system. Fed Proc 43: 196-200. 35. Spector, R. (1982) Thiamin homeostasis in the central nervous system. Ann N Y Acad Sci 378: 344-354. 36. Spector, R. & Mock, D. M. (1988) Biotin transport and metabolism in the central nervous system. Neurochem Res 13: 213-219. 37. Spector, R. & Mock, D. (1987) Biotin transport through the blood-brain barrier. J Neurochem 48: 400-404. 38. Baur, B. & Baumgartner, E. R. (1993) Na(+)-dependent biotin transport into brush-border membrane vesicles from human kidney cortex. Pflugers Arch 422: 499-505. 39. Shi, F., Bailey, C., Malick, A. W. & Audus, K. L. (1993) Biotin uptake and transport across bovine brain microvessel endothelial cell monolayers. Pharm Res 10: 282-288. 40. Zempleni, J., Green, G. M., Spannagel, A. W. & Mock, D. M. (1997) Biliary excretion of biotin and biotin metabolites is quantitatively minor in rats and pigs. J Nutr 127: 1496-1500.

PAGE 113

101 41. Leary, L. D., Nordli, D.R., De Vino, D.C. (2001) Epilepsy in the Setting of Inherited Metabolic and Mitochondrial Disorders. In: The Treatment of Epilepsy. Principles and Practice, 3rd ed. (Wyllie, E., ed.), pp. 637-656. Lippincott Williams & Wilkins, Philadelphia, PA. 42. Salbert, B. A., Pellock, J. M. & Wolf, B. (1993) Characterization of seizures associated with biotinidase deficiency. Neurology 43: 1351-1355. 43. Bousounis, D. P., Camfield, P. R. & Wolf, B. (1993) Reversal of brain atrophy with biotin treatment in biotinidase deficiency. Neuropediatrics 24: 214-217. 44. Bregola, G., Muzzolini, A., Mazzari, S., Leon, A., Skaper, S. D., Beani, L., Bianchi, C. & Simonato, M. (1996) Biotin deficiency facilitates kindling hyperexcitability in rats. Neuroreport 7: 1745-1748. 45. Spencer, E. B., Bianchi, A., Widmer, J. & Witters, L. A. (1993) Brain acetyl-CoA carboxylase: isozymic identification and studies of its regulation during development and altered nutrition. Biochem Biophys Res Commun 192: 820-825. 46. Tansey, F. A. & Cammer, W. (1988) Acetyl-CoA carboxylase in rat brain. I. Activities in homogenates and isolated fractions. Brain Res 471: 123-130. 47. Stigsby, B., Yarworth, S.M., & Rahbeeni, Z. (1994) Neurophysiologic correlates of organic acidemias: a survey of 107 patients. Brain Dev 16 (suppl): 125-144. 48. Jaeken, J. & Casaer, P. (1988) "Cerebral" lactic acidosis and biotinidase deficiency. Eur J Pediatr 148: 175. 49. Oldendorf, W. H. (1971) Blood brain barrier permeability to lactate. Eur Neurol 6: 49-55. 50. Posner, J. B. P., F. (1967) Independence of blood and cerebral fluid lactate. Arch. Neurol. 16: 492-496. 51. Chan, L., Slater, J., Hasbargen, J., Herndon, D. N., Veech, R. L. & Wolf, S. (1994) Neurocardiac toxicity of racemic D,L-lactate fluids. Integr Physiol Behav Sci 29: 383-394. 52. Perret, C., Poli, S. & Enrico, J. F. (1970) Lactic acidosis and liver damage. Helv Med Acta 35: 377-405. 53. Stolberg, L., Rolfe, R., Gitlin, N., Merritt, J., Mann, L., Jr., Linder, J. & Finegold, S. (1982) d-Lactic acidosis due to abnormal gut flora: diagnosis and treatment of two cases. N Engl J Med 306: 1344-1348. 54. Yudkoff, M. (1997) Brain metabolism of branched-chain amino acids. Glia 21: 92-98.

PAGE 114

102 55. Dufour, F., Nalecz, K. A., Nalecz, M. J. & Nehlig, A. (2001) Modulation of absence seizures by branched-chain amino acids: correlation with brain amino acid concentrations. Neurosci Res 40: 255-263. 56. Erecinska, M. & Nelson, D. (1990) Activation of glutamate dehydrogenase by leucine and its nonmetabolizable analogue in rat brain synaptosomes. J Neurochem 54: 1335-1343. 57. Albrecht, J. (1998) Roles of neuroactive amino acids in ammonia neurotoxicity. J Neurosci Res 51: 133-138. 58. Tribble, D. & Shapira, R. (1983) Myelin proteins: degradation in rat brain initiated by metabolites causative of maple syrup urine disease. Biochem Biophys Res Commun 114: 440-446. 59. Suchy, S. F., McVoy, J. S. & Wolf, B. (1985) Neurologic symptoms of biotinidase deficiency: possible explanation. Neurology 35: 1510-1511. 60. Chiang, G. S. & Mistry, S. P. (1974) Activities of pyruvate carboxylase and propionyl CoA carboxylase in rat tissues during biotin deficiency and restoration of the activities after biotin administration. Proc Soc Exp Biol Med 146: 21-24. 61. Morrell, M. (2000) Handbook of Epilepsy. Blackwell Science Ltd., Malden, MA. 62. Parra, J., Augustijn, P. B., Geerts, Y. & van Emde Boas, W. (2001) Classification of epileptic seizures: a comparison of two systems. Epilepsia 42: 476-482. 63. Eisenschenk, S. G., R.L. (2001) The Treatment of Epilepsy, 3rd ed. (Wyllie, E., ed.). Lippincott Williams & Wilkins, Baltimore, MD. 64. Aiken, S. P. & Brown, W. M. (2000) Treatment of epilepsy: existing therapies and future developments. Front Biosci 5: E124-152. 65. Wheless, J. W. (2001) Vagus Nerve Stimulation. In: The Treatment of Epilepsy, 3rd ed. (Wyllie, E., ed.). Lippincott Williams & Wilkins, Baltimore, MD. 66. Said, H. M., Redha, R. & Nylander, W. (1989) Biotin transport in the human intestine: inhibition by anticonvulsant drugs. Am J Clin Nutr 49: 127-131. 67. Baur, B. & Baumgartner, E. R. (2000) Biotin and biocytin uptake into cultured primary calf brain microvessel endothelial cells of the blood-brain barrier. Brain Res 858: 348-355. 68. Mock, D. M., Mock, N. I., Nelson, R. P. & Lombard, K. A. (1998) Disturbances in biotin metabolism in children undergoing long-term anticonvulsant therapy. J Pediatr Gastroenterol Nutr 26: 245-250.

PAGE 115

103 69. Mock, D. M. & Dyken, M. E. (1997) Biotin catabolism is accelerated in adults receiving long-term therapy with anticonvulsants. Neurology 49: 1444-1447. 70. Ketter, T. A., Frye, M. A., Cora-Locatelli, G., Kimbrell, T. A. & Post, R. M. (1999) Metabolism and excretion of mood stabilizers and new anticonvulsants. Cell Mol Neurobiol 19: 511-532. 71. Sillanpaa, M. (1996) Carbamazepine. In: The Treatment of Epilepsy. Principles and Practice., 2nd ed. (Wyllie, E., ed.), pp. 808-823. Williams & Wilkins, Baltimore. 72. Shorvon, S. (2000) Handbook of Epilepsy Treatment. Blackwell Science, Inc., Malden, MA. 73. Lancaster, J. M. & Davies, J. A. (1992) Carbamazepine inhibits NMDA-induced depolarizations in cortical wedges prepared from DBA/2 mice. Experientia 48: 751-753. 74. Tateishi, T., Asoh, M., Nakura, H., Watanabe, M., Tanaka, M., Kumai, T. & Kobayashi, S. (1999) Carbamazepine induces multiple cytochrome P450 subfamilies in rats. Chem Biol Interact 117: 257-268. 75. Richter, K. & Terhaag, B. (1978) The relative bioavailability and pharmacokinetics of carbamazepine. Int J Clin Pharmacol Biopharm 16: 377-379. 76. Reith, D. M., Appleton, D. B., Hooper, W. & Eadie, M. J. (2000) The effect of body size on the metabolic clearance of carbamazepine. Biopharm Drug Dispos 21: 103-111. 77. Arroyo, S. S., J.W.A.S. (1999) Carbamzepine in comparative trials. Neurology 53: 1170-1174. 78. Neubauer, C. (1970) Mental deterioration in epilepsy due to folate deficiency. Br Med J 2: 759-761. 79. Reizenstein, P. & Lund, L. (1973) Effect of anticonvulsive drugs on folate absorption and the cerebrospinal folate pump. Scand J Haematol 11: 158-165. 80. Carl, G. F., Eto, I. & Krumdieck, C. L. (1987) Chronic treatment of rats with primidone causes depletion of pteroylpentaglutamates in liver. J Nutr 117: 970-975. 81. Goggin, T., Gough, H., Bissessar, A., Crowley, M., Baker, M. & Callaghan, N. (1987) A comparative study of the relative effects of anticonvulsant drugs and dietary folate on the red cell folate status of patients with epilepsy. Q J Med 65: 911-919.

PAGE 116

104 82. Carl, G. F., Smith, M. L., Furman, G. M., Eto, I., Schatz, R. A. & Krumdieck, C. L. (1991) Phenytoin treatment and folate supplementation affect folate concentrations and methylation capacity in rats. J Nutr 121: 1214-1221. 83. Carl, G. F. & Smith, M. L. (1989) Chronic carbamazepine treatment in the rat: efficacy, toxicity, and effect on plasma and tissue folate concentrations. Epilepsia 30: 217-224. 84. Ebadi, M., Jobe, P. C. & Laird, H. E., 2nd (1985) The status of vitamin B6 metabolism in brains of genetically epilepsyprone rats. Epilepsia 26: 353-359. 85. Krause, K. H., Berlit, P., Bonjour, J. P., Schmidt-Gayk, H., Schellenberg, B. & Gillen, J. (1982) Vitamin status in patients on chronic anticonvulsant therapy. Int J Vitam Nutr Res 52: 375-385. 86. Krause, K. H., Bonjour, J. P., Berlit, P., Kynast, G., Schmidt-Gayk, H. & Schellenberg, B. (1988) Effect of long-term treatment with antiepileptic drugs on the vitamin status. Drug Nutr Interact 5: 317-343. 87. Tamura, T., Aiso, K., Johnston, K. E., Black, L. & Faught, E. (2000) Homocysteine, folate, vitamin B-12 and vitamin B-6 in patients receiving antiepileptic drug monotherapy. Epilepsy Res 40: 7-15. 88. Cornelissen, M., Steegers-Theunissen, R., Kollee, L., Eskes, T., Vogels-Mentink, G., Motohara, K., De Abreu, R. & Monnens, L. (1993) Increased incidence of neonatal vitamin K deficiency resulting from maternal anticonvulsant therapy. Am J Obstet Gynecol 168: 923-928. 89. Cornelissen, M., Steegers-Theunissen, R., Kollee, L., Eskes, T., Motohara, K. & Monnens, L. (1993) Supplementation of vitamin K in pregnant women receiving anticonvulsant therapy prevents neonatal vitamin K deficiency. Am J Obstet Gynecol 168: 884-888. 90. Krause, K. H., Bonjour, J. P., Berlit, P., Kynast, G., Schmidt-Gayk, H. & Arab, L. (1986) B vitamins in epileptics. Bibl Nutr Dieta 38: 154-167. 91. Krause, K. H., Berlit, P. & Bonjour, J. P. (1982) Impaired biotin status in anticonvulsant therapy. Ann Neurol 12: 485-486. 92. Zempleni, J. & Mock, D. M. (1999) Advanced analysis of biotin metabolites in body fluids allows a more accurate measurement of biotin bioavailability and metabolism in humans. J Nutr 129: 494-497. 93. Mock, D. M. (1999) Biotin status: which are valid indicators and how Do We know? J Nutr 129: 498-503.

PAGE 117

105 94. Mock, D. M., Mock, N. I., Nelson, R. P. & Lombard, K. A. (1998) Disturbances in biotin metabolism in children undergoing long-term anticonvulsant therapy. J Pediatr Gastroenterol Nutr 26: 245-250. 95. American Institute of Nutrition (1977) Report of the American Institute of Nutrition ad hoc committee on standards for nutritional studies. J Nutr 107: 1340-1348. 96. National Research Council (1995) Nutrient Requirements of Laboratory Animals, 4th edition ed. National Institutes of Health, Bethesda, MD. 97. Lewis, B., Rathman, S. & McMahon, R. (2001) Dietary biotin intake modulates the pool of free and protein-bound biotin in rat liver. J Nutr 131: 2310-2315. 98. Klevay, L. M. (1976) The biotin requirement of rats fed 20% egg white. J Nutr 106: 1643-1646. 99. Mock, D. M. (1997) Determinations of biotin in biological fluids. Methods Enzymol 279: 265-275. 100. Szabo, G. K. & Browne, T. R. (1982) Improved isocratic liquid-chromatographic simultaneous measurement of phenytoin, phenobarbital, primidone, carbamazepine, ethosuximide, and Ndesmethylmethsuximide in serum. Clin Chem 28: 100-104. 101. Markwell, M. A., Haas, S. M., Bieber, L. L. & Tolbert, N. E. (1978) A modification of the Lowry procedure to simplify protein determination in membrane and lipoprotein samples. Anal Biochem 87: 206-210. 102. Suormala, T., Wick, H., Bonjour, J. P. & Baumgartner, E. R. (1985) Rapid differential diagnosis of carboxylase deficiencies and evaluation for biotin-responsiveness in a single blood sample. Clin Chim Acta 145: 151-162. 103. Wang, K. S., Mock, N. I. & Mock, D. M. (1997) Biotin biotransformation to bisnorbiotin is accelerated by several peroxisome proliferators and steroid hormones in rats. J Nutr 127: 2212-2216. 104. Said, H. M., Redha, R. & Nylander, W. (1989) Biotin transport in the human intestine: inhibition by anticonvulsant drugs. Am J Clin Nutr 49: 127-131. 105. Wolf, B. & Paulsen, E. P. (1981) Valproate in the treatment of seizures associated with propionic acidemia. Pediatrics 67: 162-163. 106. Van Coster, R. N., Fernhoff, P. M. & De Vivo, D. C. (1991) Pyruvate carboxylase deficiency: a benign variant with normal development. Pediatr Res 30: 1-4.

PAGE 118

106 107. Ahmad, A., Kahler, S. G., Kishnani, P. S., Artigas-Lopez, M., Pappu, A. S., Steiner, R., Millington, D. S. & Van Hove, J. L. (1999) Treatment of pyruvate carboxylase deficiency with high doses of citrate and aspartate. Am J Med Genet 87: 331-338. 108. During, M. J., Fried, I., Leone, P., Katz, A. & Spencer, D. D. (1994) Direct measurement of extracellular lactate in the human hippocampus during spontaneous seizures. J Neurochem 62: 2356-2361. 109. Thoresen, M., Hallstrom, A., Whitelaw, A., Puka-Sundvall, M., Loberg, E. M., Satas, S., Ungerstedt, U., Steen, P. A. & Hagberg, H. (1998) Lactate and pyruvate changes in the cerebral gray and white matter during posthypoxic seizures in newborn pigs. Pediatr Res 44: 746-754. 110. Calabrese, V. P., Gruemer, H. D., James, K., Hranowsky, N. & DeLorenzo, R. J. (1991) Cerebrospinal fluid lactate levels and prognosis in status epilepticus. Epilepsia 32: 816-821. 111. Lehnert, W., Niederhoff, H., Junker, A., Saule, H. & Frasch, W. (1979) A case of biotin-responsive 3-methylcrotonylglycinand 3hydroxyisovaleric aciduria. Eur J Pediatr 132: 107-114. 112. Mock, D. M., Mock, N. I. & Weintraub, S. (1988) Abnormal organic aciduria in biotin deficiency: the rat is similar to the human. J Lab Clin Med 112: 240-247. 113. Mock, N. I., Malik, M. I., Stumbo, P. J., Bishop, W. P. & Mock, D. M. (1997) Increased urinary excretion of 3-hydroxyisovaleric acid and decreased urinary excretion of biotin are sensitive early indicators of decreased biotin status in experimental biotin deficiency. Am J Clin Nutr 65: 951-958. 114. Mock, N. I. & Mock, D. M. (1992) Biotin deficiency in rats: disturbances of leucine metabolism are detectable early. J Nutr 122: 1493-1499. 115. Maeda, Y., Kawata, S., Inui, Y., Fukuda, K., Igura, T. & Matsuzawa, Y. (1996) Biotin deficiency decreases ornithine transcarbamylase activity and mRNA in rat liver. J Nutr 126: 61-66. 116. Sener, A. & Malaisse, W. J. (1980) L-leucine and a nonmetabolized analogue activate pancreatic islet glutamate dehydrogenase. Nature 288: 187-189. 117. Coker, M., de Klerk, J. B., Poll-The, B. T., Huijmans, J. G. & Duran, M. (1996) Plasma total odd-chain fatty acids in the monitoring of disorders of propionate, methylmalonate and biotin metabolism. J Inherit Metab Dis 19: 743-751. 118. Kramer, T. R., Briske-Anderson, M., Johnson, S. B. & Holman, R. T. (1984) Effects of biotin deficiency on polyunsaturated fatty acid metabolism in rats. J Nutr 114: 2047-2052.

PAGE 119

107 119. Liu, Y. Y., Shigematsu, Y., Bykov, I., Nakai, A., Kikawa, Y., Fukui, T. & Sudo, M. (1994) Abnormal fatty acid composition of lymphocytes of biotin-deficient rats. J Nutr Sci Vitaminol (Tokyo) 40: 283-288. 120. Mock, D. M., Johnson, S. B. & Holman, R. T. (1988) Effects of biotin deficiency on serum fatty acid composition: evidence for abnormalities in humans. J Nutr 118: 342-348. 121. Mock, D. M., Mock, N. I., Johnson, S. B. & Holman, R. T. (1988) Effects of biotin deficiency on plasma and tissue fatty acid composition: evidence for abnormalities in rats. Pediatr Res 24: 396-403. 122. Abu-Elheiga, L., Almarza-Ortega, D. B., Baldini, A. & Wakil, S. J. (1997) Human acetyl-CoA carboxylase 2. Molecular cloning, characterization, chromosomal mapping, and evidence for two isoforms. J Biol Chem 272: 10669-10677. 123. Abu-Elheiga, L., Jayakumar, A., Baldini, A., Chirala, S. S. & Wakil, S. J. (1995) Human acetyl-CoA carboxylase: characterization, molecular cloning, and evidence for two isoforms. Proc Natl Acad Sci U S A 92: 4011-4015. 124. Rathman, S. C., Eisenschenk, S. & McMahon, R. J. (2002) The abundance and function of biotin-dependent enzymes are reduced in rats chronically administered carbamazepine. J Nutr 132: 3405-3410. 125. Rathman, S. C., Lewis, B. & McMahon, R. J. (2002) Acute glucocorticoid treatment increases urinary biotin excretion and serum biotin. Am J Physiol Endocrinol Metab 282: E643-649. 126. Rodriguez-Melendez, R., Cano, S., Mendez, S. T. & Velazquez, A. (2001) Biotin regulates the genetic expression of holocarboxylase synthetase and mitochondrial carboxylases in rats. J Nutr 131: 1909-1913. 127. Kevil, C. G., Walsh, L., Laroux, F. S., Kalogeris, T., Grisham, M. B. & Alexander, J. S. (1997) An improved, rapid Northern protocol. Biochem Biophys Res Commun 238: 277-279. 128. Moore, J. B., Blanchard, R. K., McCormack, W. T. & Cousins, R. J. (2001) cDNA array analysis identifies thymic LCK as upregulated in moderate murine zinc deficiency before T-lymphocyte population changes. J Nutr 131: 3189-3196. 129. Mock, D. M. (1999) Biotin status: which are valid indicators and how do we know? J Nutr 129: 498S-503S. 130. Paljarvi, L. (1984) Brain lactic acidosis and ischemic cell damage: a topographic study with high-resolution light microscopy of early recovery in a rat model of severe incomplete ischemia. Acta Neuropathol (Berl) 64: 89-98.

PAGE 120

108 131. Schurr, A., Payne, R. S., Miller, J. J. & Rigor, B. M. (1997) Glia are the main source of lactate utilized by neurons for recovery of function posthypoxia. Brain Res 774: 221-224. 132. Schurr, A., Payne, R. S., Miller, J. J. & Rigor, B. M. (1997) Brain lactate is an obligatory aerobic energy substrate for functional recovery after hypoxia: further in vitro validation. J Neurochem 69: 423-426. 133. Schurr, A., Payne, R. S., Miller, J. J. & Rigor, B. M. (1997) Brain lactate, not glucose, fuels the recovery of synaptic function from hypoxia upon reoxygenation: an in vitro study. Brain Res 744: 105-111. 134. Merinero, B., Perez-Cerda, C. & Ugarte, M. (1992) Investigation of enzyme defects in children with lactic acidosis. J Inherit Metab Dis 15: 696-706. 135. Leino, R. L., Gerhart, D. Z. & Drewes, L. R. (1999) Monocarboxylate transporter (MCT1) abundance in brains of suckling and adult rats: a quantitative electron microscopic immunogold study. Brain Res Dev Brain Res 113: 47-54. 136. Brun, N., Robitaille, Y., Grignon, A., Robinson, B. H., Mitchell, G. A. & Lambert, M. (1999) Pyruvate carboxylase deficiency: prenatal onset of ischemia-like brain lesions in two sibs with the acute neonatal form. Am J Med Genet 84: 94-101. 137. Israels, S., Haworth, J. C., Dunn, H. G. & Applegarth, D. A. (1976) Lactic acidosis in childhood. Adv Pediatr 22: 267-303. 138. Rodriguez-Melendez, R., Perez-Andrade, M. E., Diaz, A., Deolarte, A., Camacho-Arroyo, I., Ciceron, I., Ibarra, I. & Velazquez, A. (1999) Differential effects of biotin deficiency and replenishment on rat liver pyruvate and propionyl-CoA carboxylases and on their mRNAs. Mol Genet Metab 66: 16-23. 139. Frigg, M. & Wick, H. (1977) Effect of graded biotin levels in the diet on liver pyruvate carboxylase of chicks fed ad libitum and after starvation. Int J Vitam Nutr Res 47: 57-61. 140. Thampy, G. K., Haas, M. J. & Mooradian, A. D. (2000) Troglitazone stimulates acetyl-CoA carboxylase activity through a post-translational mechanism. Life Sci 68: 699-708. 141. Uppal, A. & Gupta, P. K. (2003) Measurement of NADH concentration in normal and malignant human tissues from breast and oral cavity. Biotechnol Appl Biochem 37: 45-50. 142. Morimoto, T., Fukuda, M., Aibara, Y., Nagao, H. & Kida, K. (1996) The influence of blood gas changes on hyperthermia-induced seizures in developing rats. Brain Res Dev Brain Res 92: 77-80.

PAGE 121

109 143. De Jong, R. H., Wagman, I. H. & Prince, D. A. (1967) Effect of carbon dioxide on the cortical seizure threshold to lidocaine. Exp Neurol 17: 221-232. 144. Williams, K. P. & Singh, A. (2002) The correlation of seizures in newborn infants with significant acidosis at birth with umbilical artery cord gas values. Obstet Gynecol 100: 557-560. 145. Patsalos, P. N. & Lascelles, P. T. (1981) Changes in regional brain levels of amino acid putative neurotransmitters after prolonged treatment with the anticonvulsant drugs diphenylhydantoin, phenobarbitone, sodium valproate, ethosuximide, and sulthiame in the rat. J Neurochem 36: 688-695. 146. Utter, M. F. & Keech, D. B. (1963) Pyruvate carboxylase. Nature of the reaction. J Biol Chem 23X: 2603-2608. 147. Wallace, J. C., Phillips, N. B., Snoswell, M. A., Goodall, G. J., Attwood, P. V. & Keech, D. B. (1985) Pyruvate carboxylase: mechanisms of the partial reactions. Ann N Y Acad Sci 447: 169-188. 148. Keech, D. B. & Wallace, J. C. (1985) The reaction mechanism. In: Pyruvate Carboxylase. CRC Press, Boca Raton. 149. Attwood, P. V. & Geeves, M. A. (2002) Changes in catalytic activity and association state of pyruvate carboxylase which are dependent on enzyme concentration. Arch Biochem Biophys 401: 63-72. 150. Wallace, J. C. (1985). In: Pyruvate Carboxylase (Keech, D. B. & Wallace, J. C., eds.), pp. 5-64. CRC Press, Boca Raton. 151. Easterbrook-Smith, S. B., Campbell, A. J., Keech, D. B. & Wallace, J. C. (1979) The atypical velocity response by pyruvate carboxylase to increasing concentrations of acetyl-coenzyme A. Biochem J 179: 497-502. 152. Legge, G. B., Branson, J. P. & Attwood, P. V. (1996) Effects of acetyl CoA on the pre-steady-state kinetics of the biotin carboxylation reaction of pyruvate carboxylase. Biochemistry 35: 3849-3856. 153. Branson, J. P. & Attwood, P. V. (2000) Effects of Mg(2+) on the pre-steady-state kinetics of the biotin carboxylation reaction of pyruvate carboxylase. Biochemistry 39: 7480-7491. 154. Girard, J., Ferre, P., Pegorier, J. P. & Duee, P. H. (1992) Adaptations of glucose and fatty acid metabolism during perinatal period and suckling-weaning transition. Physiol Rev 72: 507-562. 155. Lynch, C. J., McCall, K. M., Billingsley, M. L., Bohlen, L. M., Hreniuk, S. P., Martin, L. F., Witters, L. A. & Vannucci, S. J. (1992) Pyruvate carboxylase in genetic obesity. Am J Physiol 262: E608-618.

PAGE 122

110 156. Jitrapakdee, S. & Wallace, J. C. (1999) Structure, function and regulation of pyruvate carboxylase. Biochem J 340 ( Pt 1): 1-16. 157. Siess, E. A., Banik, E. & Neugebauer, S. (1988) Control of pyruvate carboxylase activity by the pyridine-nucleotide redox state in mitochondria from rat liver. Eur J Biochem 173: 369-374. 158. Oei, J. & Robinson, B. H. (1985) Simultaneous preparation of the three biotin-containing mitochondrial carboxylases from rat liver. Biochim Biophys Acta 840: 1-5. 159. Lamhonwah, A. M., Quan, F. & Gravel, R. A. (1987) Sequence homology around the biotin-binding site of human propionyl-CoA carboxylase and pyruvate carboxylase. Arch Biochem Biophys 254: 631-636. 160. Rossmann, M. G., Moras, D. & Olsen, K. W. (1974) Chemical and biological evolution of nucleotide-binding protein. Nature 250: 194-199. 161. Devin, A., Nogueira, V., Leverve, X., Guerin, B. & Rigoulet, M. (2001) Allosteric activation of pyruvate kinase via NAD+ in rat liver cells. Eur J Biochem 268: 3943-3949. 162. Elomaa, E. & Aho, K. (1990) The colon, the rumen, and D-lactic acidosis. Lancet 336: 599-600. 163. Yudkoff, M., Daikhin, Y., Nissim, I. & Lazarow, A. (2001) Ketogenic diet, amino acid metabolism, and seizure control. J Neurosci Res 66: 931-940. 164. Watanabe, T., Dakshinamurti, K. & Persaud, T. V. (1995) Biotin influences palatal development of mouse embryos in organ culture. J Nutr 125: 2114-2121. 165. Watanabe, T. (1993) Dietary biotin deficiency affects reproductive function and prenatal development in hamsters. J Nutr 123: 2101-2108. 166. Vorhees, C. V., Acuff, K. D., Weisenburger, W. P. & Minck, D. R. (1990) Teratogenicity of carbamazepine in rats. Teratology 41: 311-317. 167. Rosser, E. M. & Wilson, L. C. (1999) Drugs for epilepsy have teratogenic risks. Bmj 318: 1289. 168. Jones, K. L., Lacro, R. V., Johnson, K. A. & Adams, J. (1989) Pattern of malformations in the children of women treated with carbamazepine during pregnancy. N Engl J Med 320: 1661-1666. 169. Gaily, E. & Granstrom, M. L. (1989) A transient retardation of early postnatal growth in drug-exposed children of epileptic mothers. Epilepsy Res 4: 147-155.

PAGE 123

111 170. Adams, J., Vorhees, C. V. & Middaugh, L. D. (1990) Developmental neurotoxicity of anticonvulsants: human and animal evidence on phenytoin. Neurotoxicol Teratol 12: 203-214.

PAGE 124

BIOGRAPHICAL SKETCH Sara C. Rathman is from Indianapolis, Indiana. She attended Brebeuf Jesuit Preparatory School for high school and graduated in 1995. She then attended the University of Notre Dame and received a Bachelor of Science degree in biological sciences in 1999. She received a University of Florida Alumni Fellowship and entered her Ph.D. program in the nutritional sciences in the fall of 1999 under the tutelage of Dr. Robert J. McMahon and completed her studies under Dr. Jesse F. Gregory III in 2003. After graduation, she will pursue a post-doctoral fellowship sponsored by the National Research Council at the Johnson Space Center in Houston, TX. 112


Permanent Link: http://ufdc.ufl.edu/UFE0001103/00001

Material Information

Title: Effects of oral carbamazepine administration on biotin metabolism in rats
Physical Description: Mixed Material
Creator: Rathman, Sara C. ( Author, Primary )
Publication Date: 2003
Copyright Date: 2003

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0001103:00001

Permanent Link: http://ufdc.ufl.edu/UFE0001103/00001

Material Information

Title: Effects of oral carbamazepine administration on biotin metabolism in rats
Physical Description: Mixed Material
Creator: Rathman, Sara C. ( Author, Primary )
Publication Date: 2003
Copyright Date: 2003

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0001103:00001


This item has the following downloads:


Full Text












EFFECTS OF ORAL CARBAMAZEPINE ADMINISTRATION ON BIOTIN
METABOLISM IN RATS















By

SARA C. RATHMAN


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2003

































This dissertation is dedicated to my parents, John and Susan Rathman















ACKNOWLEDGMENTS

My sincere appreciation goes to my major advisors, Drs. Robert J. McMahon and

Jesse F. Gregory III, for their tremendous guidance, patience, counsel, and for their

support and confidence in me as a graduate student. I would particularly like to thank Dr.

Robert J. Cousins, who has been a valuable scientific resource for the past four years and

who was instrumental in bringing me to the University of Florida for my graduate

education. I would also like to thank my other committee members, Drs. Lynn B. Bailey,

Stephan Eisenschenk, and Lee McDowell, for their suggestions and overwhelming

support of my project. This project would not have been possible to complete without the

help from my colleagues and friends in the McMahon, Gregory, and Cousins labs,

especially Brandon Lewis, Carolina Lima, Troy Pitts, Amy Mackey, Steve Davis, and

Ray Blanchard. I shall always be grateful to these individuals for their assistance with

my project and for enriching my graduate student experience. My profound gratitude

goes to my parents, John and Susan Rathman, for their endless support and countless

sacrifices for allowing me to have the best education possible throughout my entire

academic career. Special thanks go to Heather DeJesus for her encouragement, unending

support, and for being a wonderful friend. Finally, my love and appreciation go to my

fiance, Daniel Zwart, for his continuous support and devotion he has so graciously given

to me over the years.















TABLE OF CONTENTS
page

A C K N O W L E D G M E N T S ................................................................................................. iii

LIST OF ABBREVIATION S .......................................................... ........... ..... viii

ABSTRACT .............. .......................................... xi

CHAPTER

1 LITER A TU RE REV IEW .............................................. ......... .....................1

B io tin .................................................................................... 1
Chem istry and Function of Biotin ............................................ ........ ............... 1... 1
Food Sources, Bioavailability, and Requirement of Biotin................................4
Indices of B iotin Status ............................................................................. 6
A absorption and Transport............................................................................. 7
Biotin Transport in the Central Nervous System ..............................................8
Biotin Excretion................................9.......................9
Biotin Deficiency: Symptoms and Metabolic Bases........................................10
Preferential Maintenance of Biotin in the Brain During Biotin Deficiency........ 12
E p ile p sy ........................................ ... ...... ......................................... 1 3
Effects of Anti-Epileptic Drugs on Biotin Status...............................................14
Mechanism of Altered Biotin Status During AED Therapy .............................15
C arb am azep in e ............................................................................................. 16
Effects of Anti-Epileptic Drugs on Other Vitamins................. ............ .....17
O overall R ationale .................... ........... ....................................... .............. ..... 19
Hypothesis #1: Chronic oral CBZ administration in rats decreases
biotin status s ............... .................... ... ... ...... ...... ....... ................20
Hypothesis #2: Chronic oral CBZ administration in rats reduces biotin-
dependent enzyme expression and activity.................................................20
Hypothesis #3: Chronic oral CBZ administration in rats and subsequent
reduction of biotin-dependent enzyme activity generates potentially
neurotoxic interim ediates ........................................................... ............... 20
Hypothesis #4: Supplementation with a pharmacological dose of biotin
restores biotin status and function in rats receiving chronic oral CBZ
adm inistration. ............... ....................... .... ..... .. ...... ................... 20
Hypothesis #5: While investigating hypothesis #4, we found that biotin
supplementation increased pyruvate carboxylase activity without altering the
biotinylated form of the enzyme; consequently, it was hypothesized that









pyruvate carboxylase can be activated by other compounds including
N A D H ....................................................... ................ 2 0

2 THE ABUNDANCE AND FUNCTION OF BIOTIN DEPENDENT ENZYMES
ARE REDUCED IN A RATS CHRONICALLY ADMINISTERED
C A R B A M A Z E P IN E ....................................................................... .....................22

M materials and M methods ....................................................................... ..................23
M materials ........... ... ..........................................23
Animals and Dietary Treatments......... ................ ....................... 24
Sample Preparation...................... ........................ ... 24
Competitive Binding Assay of Biotin ........................ ....... ................ 25
M easurem ent of CBZ and CBZ-e................................... ........................ 26
Synthesis of Avidin-AlexaFluor 430.............................................................. 27
Detection and Quantification of Biotinylated Proteins ....................................27
Lactate and Ammonia M easurements ...................................... ............... 29
Measurement of Pyruvate Carboxylase Activity..............................................29
Statistical A analysis ...................................... .............................30
R results ............................. ...... ...... .. ....................... 30
Dietary Carbamazepine Administration in a Rodent Model of Biotin
N utriture ................... ................. ....... ... ....... ..... ............... 30
Effect of Carbamazepine on Organic Acids and Ammonia..............................32
Effect of Carbamazepine Administration on Urine, Serum, Liver, and Brain
B iotin and B iotin M etabolites..................................................... ................ 32
Effect of Carbamazepine Administration on the Abundance of Biotin-
Dependent Enzymes in Liver and Brain.............. .... .......................34
Effect of Carbamazepine Administration on the Activity of Hepatic Pyruvate
C arboxylase................................................... ........................... ....... 35
D iscu ssio n ...................................... ................................................. 3 6

3 DIETARY CARBAMAZEPINE ADMINISTRATION DECREASES LIVER
PYRUVATE CARBOXYLASE ACTIVITY AND BIOTINYLATION BY
DECREASING PROTEIN AND mRNA EXPRESSION IN RATS .......................40

M materials and M methods ....................................................................... ..................40
Materials ........................ .......................40
Animals and Dietary Treatments...... ..................... ...............41
Sam ple Preparation........................... .. .......... ........ .. ...... .. 41
Pyruvate Carboxylase Activity Assay ................................ ................42
Detection of Biotinylated Biotin-Dependent Carboxylases ................................42
In Vitro B iotinylation ......................................... .......... ...............................42
Measurement of Biotin, Biotin Sulfoxide, Bisnorbiotin, and Biocytin..............43
M easurem ent of Carbam azepine ........................................ ...... ............... 43
RNA Isolation and Northern Blotting ...................................... ............... 43
Real-Time Reverse Transcriptase PCR Conditions ........................................44
Real-Time Reverse Transcriptase PCR Conditions ........................................44
Statistical A analysis .......................... .......... ............... .... ....... 45


v









R esu lts ...................................................................................................4 5
Effect of CBZ on Metabolites ...................... ........... .......................45
Effect of CBZ Administration on PC Biotinylation, Activity, and Protein
and m RN A Expression ............................................................................. 46
D iscu ssio n ...................................... ................................................. 4 9

4 PHARMACOLOGICAL BIOTIN SUPPLEMENTATION MAINTAINS BIOTIN
STATUS AND FUNCTION IN RATS ADMINISTERED DIETARY
C A R B A M A Z E P IN E ....................................................................... .....................54

M materials and M methods ....................................................................... ..................55
M materials .............. ......... ............ .... ....... ..... .. ...... 55
Animals and Dietary Treatments...... ................. ...............55
S am ple P rep aration .............................................. ...... .. ... ...... ............. ...... 56
Pyruvate Carboxylase and Acetyl CoA Carboxylase Activity Assays ..............57
Detection of Biotinylated Biotin-Dependent Carboxylases ..............................58
M easurem ent of M etabolites ..................................................... ....... ........ 58
Statistical A analysis .......................... ............ ...........................59
R results ...... ......... .......... ..................... ...................................... 60
Concentration of CBZ in the Diet, Serum, Liver and Brain.............................60
Effect of CBZ on M etabolites ........................................... ....... ............... 60
Effect of NADH on Hepatic PC Activity .........................................................65
D iscu ssio n ...................................... ................................................. 6 8

5 CHARACTERIZATION OF PYRUVATE CARBOXYLASE ACTIVATION
B Y N A D H ................................................................72

E xperim mental Procedures ............................. ......... .. ....... .......... .....................73
Materials .................... ... ................. 73
Purification of Pyruvate Carboxylase................................ ....... ............... 74
Pyruvate Carboxylase Activity Assay .... .......... ........................................75
R e su lts .................. ...................................... ................. ................ 7 5
Pyruvate Carboxylase Purification ................ ............................................. 75
K inetic C onstants............ ........................................................ ..... .... ..... 77
D iscu ssio n ...................................... ................................................. 7 9

6 D ISCU SSIO N ...................................................................... .......... 83

APPENDIX

A G EN ER A L M E TH O D S ..................................................................... ..................90

Protein Concentration M easurem ent ........................................ ....... ............... 90
Preparation of H PLC Standards........................................... ........................... 90
Synthesis of L and D-Biotin Sulfoxides............... ............................................90
Synthesis of Bisnorbiotin ............................................................................... 91
HPLC Conditions for Biotin M easurements.................................... ............... 92









Method Validation for the Measurement of Carbamazepine in Serum Using
H P L C ........................................ .. .............. .. ............ ............... 9 2
Separation of Propionyl CoA Carboxylase and Methylcrotonyl CoA
C arboxylase ................... .................................................. ....................... 94
Linearity of Avidin-AlexaFluor 430 Detection Using STORM Fluorescent
S cann er............................................ ......... .... ........... ..... ................... 94
Biotinylated Protein Competition with Biotin Using Avidin-AlexaFluor 430
Detection ..... ........... .... ......... ..................95
Diet Preparation ................. ......... .................... 96

L IST O F R EFE R EN C E S ....................................................................................... 98

BIOGRAPHICAL SKETCH ............... ................. ............... 12















LIST OF ABBREVIATIONS

ACC1 Acetyl CoA carboxylase 1

ACC2 Acetyl CoA carboxylase 2

AI Adequate intake

AIN American Institute of Nutrition

ANOVA Analysis of variance

AED Anti-epileptic drug

AP Alkaline phosphatase

APS Ammonium persulfate

ATP Adenosine triphosphate

BSA Bovine serum albumin

BBSA Biotinylated bovine serum albumin

BNB Bisnorbiotin

BSO Biotin sulfoxide

CBZ Carbamazepine

CBZ-e Carbamazepine 10, 11-epoxide

CNS Central nervous system

DMSO Dimethyl sulfoxide

ECL-Plus Enhanced chemiluminescence plus

ECF Enhanced chemifluorescence

EDTA Ethylenediaminetetraacetic acid









EEG

HCS

HEM

HEPES

3-HIA

HPLC

HRP

i.p.

Kda

kg

MCC

mg

MSUD

NFDM

NHS-biotin

OAA

PBS

PC

PCC

SDS

SDS-PAGE

SMVT-1

TBS-T


Electroencephalogram

Holocarboxylase synthase

HEPES, EDTA, Mannitol

4-(2-hydroxyethyl)-1 -piperarzineethanesulfonic acid

3-hydroxyisovaleric acid

High-performance liquid chromatography

Horseradish peroxidase

Intraperitoneal

Kilodalton

Kilogram

Methylcrotonyl CoA carboxylase

Milligram

Maple syrup urine disease

Nonfat dry milk

N-hydroxysuccinimide ester

Oxaloacetate

Phosphate buffered saline

Pyruvate carboxylase

Proptionyl CoA carboxylase

Sodium dodecyl sulfate

SDS-polyacrylamide gel electrophoresis

Sodium-dependent multivitamin transporter

Tris buffered saline, tween-20









TCA Tricarboxylic acid cycle

TEMED N,N,N',N'-Tetramethylethylenediamine

TFA Trifluoroacetic acid

|tg Microgram

YPD Yeast extract, peptone, dextrose















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

EFFECTS OF ORAL CARBAMAZEPINE ADMINISTRATION ON BIOTIN
METABOLISM IN RATS

By

Sara C. Rathman

August 2003

Chair: Jesse F. Gregory III
Major Department: Food Science and Human Nutrition

Clinical studies indicate that anti-epileptic drug therapy with carbamazepine often

is associated with a 50% decrease in plasma biotin. It is estimated that over 80% of

epileptics taking anti-epileptic drugs such as carbamazepine exhibit some degree of biotin

deficiency. Decreased biotin status among epileptics is accompanied by metabolic

alterations including lactic acidemia that imply loss of function of biotin-dependent

enzymes as observed in other examples of biotin deficiency.

Although the biotin deficiency that accompanies carbamazepine therapy has been

clinically characterized, it is poorly understood at the biochemical level in tissues,

particularly in the brain. It was hypothesized that carbamazepine decreases brain biotin

status and function of biotin-dependent enzymes, which could result in lactate

accumulation. It was also hypothesized that pharmacological doses of biotin would

maintain biotin status and function during carbamazepine administration and, therefore,

reduce lactate accumulation. These hypotheses were tested using a rat model of oral









carbamazepine administration consuming a physiologically relevant level of biotin, while

examining free and protein bound pools of biotin in the brain, liver, serum, and urine.

Serum and liver free biotin decreased after long-term carbamazepine administration (>48

d), and pharmacological biotin supplementation completely prevented these decreases.

Carbamazepine decreased specific enzymatic activity and biotinylated forms of pyruvate

and acetyl CoA carboxylases in both liver and brain. Decreased biotinylated pyruvate

carboxylase was due to decreased protein and mRNA expressions in carbamazepine-

treated rats. Biotin supplementation prevented the decrease in biotinylation of hepatic

and brain acetyl CoA carboxylase and specific activity of both acetyl CoA and pyruvate

carboxylases.

Brain and serum lactate concentrations were elevated after 68 d of carbamazepine

administration, and were reduced to concentrations similar to control animals with biotin

supplementation. Conversion of lactate to pyruvate, with concurrent generation of

NADH, during biotin supplementation may explain how increases in pyruvate

carboxylase activity could occur without changes in biotinylated pyruvate carboxylase

since NADH is an activator of pyruvate carboxylase activity in vitro. These results

support the use of biotin supplementation as a concurrent strategy during carbamazepine

administration to maintain biotin status, function of biotin-dependent enzymes, and

decrease carbamazepine-induced lactate accumulation.














CHAPTER 1
LITERATURE REVIEW

Biotin

Chemistry and Function of Biotin

Biotin is a water-soluble, B-vitamin that exists freely or bound to proteins in one

form, as d-(+)-biotin (1). Its structure consists of an ureido group bound to a

tetrahydrothiophene ring with a five-carbon valeric acid side chain. The two rings in the

molecule have a boat configuration with respect to each other (1). The free carboxyl

group of the valeric acid side chain is required for binding to the e-amino group on a

specific lysine residue of biotin-dependent carboxylases, and the ureido group has an

important role in binding with avidin, a glycoprotein found in egg-whites.

Biotin is a required cofactor for pyruvate carboxylase (PC), acetyl CoA carboxylase

isoforms 1 and 2 (ACC1/2), propionyl CoA carboxylase (PCC), and P-methylcrotonyl

CoA carboxylase (MCC). The active form of these enzymes requires biotin covalently

bound, which occurs through a reaction catalyzed by holocarboxylase synthase (HCS).

Biotin is covalently attached to the apocarboxylases and participates in two sequential

reactions catalyzed by this enzyme. First, biotin is adenylated in a reaction that is

thermodynamically favorable because of the concurrent hydrolysis of pyrophosphate.

Then, the holocarboxylase is formed via an amide linkage of the carboxyl group of biotin

to the e-amino group of a specific lysine residue in a highly conserved motif (AMKM)

located 35 amino acids from the C-terminus of biotin-dependent enzymes (2).











Biotin is hydrolyzed from the holocarboxylase to form biocytin, or biotinyl lysine.


Biotinidase cleaves the lysine from biocytin to form free biotin (3).

0

HN NH
Biocytin

o Proteolysis s 0
|| /^ HN .,
HN NH HN
7i NH2
Holocarboxylase
0 o Biotinidase
BCCP HN NH
Side Chain B Bisnorbiotin
o Oxidation 0

Holocarboxylase HN NH OH
Synthase Biotin

s
OH
0 0

HN NH Holocarboxylase Sulfur HN NH
Biotinyl-AMP Synthase Oxidation Biotin Sulfoxide
0 s
S O OH
AMP OH

Figure 1-1. Metabolism of biotin.

L and d-biotin sulfoxides (BSO) and bisnorbiotin (BNB) are the major inactive


metabolites of biotin (4) (Fig. 1-1). BNB is formed in microbes by P-oxidation of the


valeric acid side chain of biotin; however, the exact mechanism in mammals is still not


known (5). While BSO accounts for approximately 3% of avidin binding species in


human serum, BNB accounts for approximately 38%, and biotin accounts for half of the


total avidin binding species in the serum (6). In the urine, biotin, BSO, and BNB account


for more than 80% of total avidin binding species (7).


The five biotin-dependent enzymes are involved in carbohydrate, fatty acid, and


amino acid metabolism (Fig. 1-2). PC is located in the mitochondria and catalyzes the


conversion of pyruvate to oxaloacetate (OAA), an intermediate of the tricarboxylic acid









(TCA) cycle and a precursor for gluconeogenesis. PCC, also located in the mitochondrial

matrix, is involved in amino acid catabolism (8). Specifically, it catalyzes the

carboxylation of propionyl CoA to D-methylmalonyl CoA. Propionyl CoA is a product

formed from the catabolism of isoleucine, valine, methionine, and it is a product of odd-

chain fatty acid oxidation. It is also formed during the synthesis of bile acids. The

product of the reaction, D-methylmalonyl CoA, can then racemize to L-methylmalonyl

CoA and then isomerize to succinyl CoA, which is also an intermediate of the TCA

cycle. Propionyl CoA can be shunted to another pathway where 3-hydroxypropionate

and methylcitrate are formed in the case of a biotin deficiency or PCC deficiency.

Increased concentrations of these organic acids were found in the urine of patients with

biotin deficiency (9,10). PCC consists of an a and 3 subunit, with the a chain containing

the site for biotin binding (11). Methylcrotonyl CoA carboxylase is also a mitochondrial

enzyme and is essential for the catabolism of leucine. It is responsible for catalyzing the

conversion of 3-methylcrotonyl CoA to 3-methylglutaconyl CoA. In the case of biotin

deficiency, 3-methylcrotonyl CoA is instead converted to 3-hydroxyisovaleric acid (3-

HIA), which is also a validated early indicator of decreased biotin status (12). Both

isoforms of ACC (ACC1 and ACC2) catalyze the carboxylation of acetyl CoA to form

malonyl CoA, a substrate for fatty acid synthesis. The two isoforms are homologous,

except for an additional 180 amino acids at the N terminus that target the protein to the

outer mitochondrial membrane. ACC 1 is highly expressed in the liver and adipose in the

cytosol, whereas ACC2 is predominantly expressed in cardiac and skeletal muscle tissue

(13).










pyruvate leucine
pyruvate
SP-MCC
PC
acetyl CoA -acetoacetyl CoA

gluconeogenesis CC

oxaloacetate malonyl CoA


citrate
lipogenesis
succinyl CoA
PCC
bile acid .. propionyl CoA
formation popionyl CoA

valine
isoleucine
isoleucine odd chain fatty acid oxidation
methionine


Figure 1-2. Diagram of pathways with biotin-dependent enzymes. PC, pyruvate
carboxylase; ACC, acetyl CoA carboxylase isoforms 1 and 2; b-MCC, b-
methylcrotonyl CoA carboxylase; PCC, propionyl CoA carboxylase.

Each of the carboxylases has two catalytic sites that are involved in the

carboxylation of the substrate. The first site, the biotin carboxylase site, is where the

carboxylation of biotin occurs using bicarbonate as the carboxyl donor. Carboxylated

biotin is physically moved to the second site, the carboxyl transferase site, by rotating one

of the 10 single bonds of the valeryl-lysyl side chain. This catalytic site transfers the

carboxyl group from biotin to the substrate (3).

Food Sources, Bioavailability, and Requirement of Biotin

Biotin is widely distributed among foods. Foods sources with the highest

concentrations of biotin include royal jelly (400 [tg/100 g), brewer's yeast (80 [tg/100 g),









egg yolk (20 [tg/100 g), calf kidney (100 [tg/100 g), soybeans (60 [tg/100 g), cauliflower

(17 [tg/100 g), and peanuts (34 gtg/100 g) (3,14). Most biotin in meats and cereals is

protein bound and the bioavailability is highly variable, depending on the food source

(15). Biotin from wheat is poorly available but it is nearly 100% available in corn (16).

Protein bound biotin is only absorbed after non-enzymatic proteolysis and cleavage of

lysine by biotinidase; therefore, factors that affect protein digestion also affect biotin

uptake.

The dietary reference intake for biotin has been determined based on adequate

intake (AI) data only (17). To date, there is no recommended dietary allowance reported

for biotin. This is based on lack of data and a general consensus that colonic bacteria

synthesize biotin that contributes to the daily supply (17). Microbial synthesis of biotin

takes place in the lower part of the intestine where there is limited nutrient absorption, so

it is controversial as to the amount of available biotin that colonic bacteria contribute that

is available for host metabolism. One study done in minipigs concluded that only

approximately 1.7% of the biotin requirement is satisfied by bacterial synthesis (18).

When considering that frank nutritional biotin deficiencies are rare, the AI was

considered to be adequate until further research proves otherwise. Epileptic patients

taking certain anticonvulsants (19,20) and pregnant women (21) have been reported to

have marginal biotin deficiencies but the effects of such a status are still not fully

understood. The AI for adults is extrapolated from the AI for healthy infants consuming

breast milk and has been determined to be 30 rig/day for men and women >19 years.

(17).









There is no upper limit (UL) reported for biotin based on lack of symptoms of

biotin toxicity when administered at high doses. Patients receive up to 200 mg biotin

orally for treatment of inborn errors of metabolism without any toxicity symptoms (1).

Indices of Biotin Status

There is no one set indicator of biotin status. In older literature, plasma or serum

biotin alone was used to indicate biotin status. In an effort to determine if there is a more

sensitive indicator of biotin status, biotin intake was decreased in 10 healthy subjects who

also consumed enough avidin to bind seven times the amount of biotin found in the diet

(12). Avidin is a glycoprotein found in egg-whites that can bind biotin very tightly (Kd =

10-15 M) and, thus, render it unavailable. Urinary excretion of biotin and its metabolites

decreased significantly after 3 d (7 d for BSO) and urinary excretion of 3-HIA increased

significantly after 3 d; however, these decreases were not out of the normal range until

days 7 and 17, respectively. Serum biotin, on the other hand, did not decrease

significantly throughout the study. This study showed that serum biotin concentration

alone should not be used as an indicator of biotin status (12). The method for measuring

biotin also must be considered when reviewing literature stating biotin status.

Microbiological methods are not highly accurate, since other nutrients such as fatty acids

in the sample preparation may promote certain microorganisms' growth and interfere

with assay results (22). These assays underestimate total avidin-binding species because

they do not detect biotin metabolites. Avidin-binding assays without HPLC separation

also underestimate total avidin-binding species because they do not account for the

slightly lower affinities of the metabolites for avidin. Avidin-binding assays not

complemented with HPLC separation overestimate biotin concentration, since biotin only

accounts for half of the total avidin-binding species in serum and urine (6,7). The most









accurate and accepted measurement of biotin and biotin metabolites includes a combined

HPLC/competitive assay with standard curves for all species measured.

Absorption and Transport

Biotin in the form of free biocytin is the predominant form of biotin found in foods

(15). Biotinidase activity is necessary for breaking down biocytin to yield biotin and

lysine and is found in pancreatic juice and intestinal mucosal secretions (15). Absorption

of biotin is highest in the jejunum, followed by the ileum with 50% of the absorptive

capacity of the jejunum, and the lowest is in the colon with 12% of the absorptive

capacity of the jejunum (23). Biotin uptake occurs by both simple diffusion and carrier-

mediated transport. Studies show that there is saturable uptake of biotin on the brush

border of the jejunum at low biotin concentrations and a linear uptake at higher

concentrations (23). The saturable process in these studies is inhibited by structural

analogs of biotin and is sodium and energy dependent. Similar to other vitamins during

deficiency states, transport of biotin across jejunal and ileal brush border membranes was

higher in biotin-depleted rats (24). The observed increase in transport during biotin

depletion was due to an increase in the number of transporters since there was an increase

in Vmax with little change in apparent Km. This same study showed that upon

supplementation with biotin, there was a decrease in Vmax compared to controls. These

studies suggest that biotin transport is regulated by the concentration of biotin in the diet

or body stores.

Similar to the intestinal brush border transporter for biotin, the basolateral

transporter in the intestine is saturable as a function of concentration, and it is inhibited

by structural analogs of biotin. Unlike the transporter on the brush border membrane, the

transporter on the basolateral membrane is sodium independent (25). Recently, a









sodium-dependent multivitamin transporter (SMVT) has also been identified (26) and

determined to be an electrogenic process, where there is a 2:1 coupling ratio of

Na+:substrate (27). This transporter transports both biotin and pantothenate. The Km for

biotin is 8.1 + 1.6 mmol/L, which highly exceeds the concentration of biotin normally

found in the serum (-0.5 nmol/L). Another biotin transporter has recently been found in

human peripheral blood mononuclear cells that has a Km of 2.6 0.4 nmol/L, which is

much closer to the physiological concentration of biotin in the blood (28).

Biotin exists in the blood both freely and covalently bound to protein. Mock and

Malik (29) estimate that 12% of biotin in human serum is covalently bound to protein,

7% is reversibly bound, and 81% is free biotin. Biotinidase can act as a specific human

serum biotin binding protein (30) that is possibly the major carrier of biotin in plasma.

This group also confirmed that human serum albumin and ao and P-globulins can bind

biotin nonspecifically.

Biotin Transport in the Central Nervous System

To protect the brain from fluctuations in blood composition, two barriers are

present. There is a blood-cerebral spinal fluid (CSF) barrier that is formed by tight

junctions between the choroid plexus epithelial cells, the arachnoid membrane cells, and

the circumventricular organs (31). The second is the blood-brain barrier also formed of

tight junctions between the cells of the cerebral capillary endothelium. Only water and

some salts are permitted to freely pass through these barriers. There is no tight barrier

between the CSF and the extracellular space of the brain. Certain observations show that

brain biotin stores are preferentially maintained during biotin deficiency (32,33), which

suggests a role of transport in the regulation of biotin concentration in the CSF and brain.









Other water-soluble vitamins including ascorbic acid, folate, and thiamin do not enter the

brain through the blood-brain barrier (34), but through the choroid plexus (35), which is

the interface of the blood-CSF barrier. Unlike these other water-soluble vitamins, there is

no evidence in rat brain for a concentrating mechanism in the choroid plexus involved in

transporting biotin between the blood and CSF (36). Spector and Mock (37) demonstrate

that there is very little passive transport of biotin across the blood-brain barrier. There is

evidence for sodium-dependent, carrier-mediated transport across the blood-brain barrier

that is inhibited by pantothenic acid and nonanoic acid, but not biocytin or biotin methyl

ester. Desthiobiotin and diaminobiotin have altered ureido ring structures and were also

shown to inhibit transport of biotin (38). This is evidence that a free carboxyl end is

required for transport across the blood-brain barrier by this specific biotin transporter that

has a Km well above the physiological range of normal serum biotin (38). In other studies

with cultured primary cell bovine brain microvessel endothelial cells from the blood-

brain barrier, biocytin but not pantothenic acid or nonanoic acid was shown to compete

with the saturable biotin uptake (39), which suggests there is probably another transporter

in which the free carboxyl group of biotin is not required for binding.

Biotin Excretion

Biotin is excreted in both the urine and feces, but the majority is excreted in the

urine. In tracer studies where carbonyl-14C biotin was given intravenously to rats, 60% of

the label appeared in the urine 24 h after infusion while only 2% was detected in the feces

(40). This could either mean that biliary excretion is quantitatively low or it could be

evidence for enterohepatic circulation where biotin excreted into the bile was then

reabsorbed or metabolized by microbial organisms in the colon; however, it has been

shown that there is very little biliary biotin excretion (40).









Biotin Deficiency: Symptoms and Metabolic Bases

There is evidence that women become marginally biotin deficient during pregnancy

(21). Biotin deficiencies have also been reported in individuals with inborn errors of

metabolism, including multiple carboxylase deficiencies. There are two types of multiple

carboxylase deficiencies: an early onset type with HCS deficiency, or a late onset type

characterized by a biotinidase deficiency. A HCS deficiency results in the inability to

biotinylate apocarboxylases, which yields inactivity of the five biotin-dependent

carboxylases. Biotinidase deficiency is associated with low biotin status since biotin

remains in an unavailable biotinyl-lysine form. In a biotinidase deficiency, seizures

unresponsive to anti-epileptic drug (AED) therapy are reported in 50-75% of affected

children, along with symptoms of developmental delay, dermatitis, ataxia, hearing loss,

optic atrophy, and sensorineural hearing loss (41). In one study of 78 symptomatic

children with a biotinidase deficiency, 55% had generalized tonic-clonic, generalized

clonic partial seizures, infantile spasms, or myoclonic seizures (42). Biotin

supplementation (5-10 mg/d) was effective in stopping the seizures within 24 h in 75% of

the children. A small number of patients developed irreversible neurological damage and

did not respond to biotin therapy. In other studies ofbiotinidase deficiencies, reversal of

brain atrophy with biotin treatment was reported (43). At the cellular level, the effects of

a biotin deficiency result in death of neurons in contact with astroglial cells (44). This

same study showed that a biotin deficiency in rats resulted in a latent condition of altered

neuronal excitability. Biotin deficient rats experienced a greater duration and more

severe seizures after kindling stimulations compared to controls.

Loss of function of biotin-dependent carboxylases accompanies a biotin deficiency

and also results in adverse neurological effects. ACC is the rate limiting enzyme for de









novo long-chain fatty acid synthesis from glucose or ketone body precursors in the brain

(45). Fatty acids in the brain serve as either structural components of cells or as

components of the complex lipids of myelin, which include galactosphingolipids and

phospholipids. As expected, the highest specific enzymatic activities of ACC in the brain

occur during peak myelination (14-29 days postnatal) periods and in the

oligodendrocytes, which are the myelinating cells of the central nervous system (46).

Biotin depletion in the brain during myelination periods could be expected to have

detrimental effects on myelination due to decreased ACC activity.

PC is also a biotin-dependent enzyme crucial for neurological health. There are

two types of PC deficiencies characterized differently depending on clinical symptoms.

In the neonatal type, there is severe lactic acidemia and death within 1-2 months after

birth. In the less serious, juvenile type, there are reported episodes of lactic acidemia

along with seizures, developmental delay, and failure to thrive (47). During biotin-

responsive multiple carboxylase, biotinidase, and PC deficiencies, lactate and pyruvate

build up in the body (33,48). Lactate accumulation in the brain is of particular concern

because lactate does not easily cross the blood-brain barrier (49,50) and can have adverse

effects in other tissues (51-53).

MCC is involved with the catabolism of leucine, which also has an important role

in maintaining neurological health. Branched-chain amino acids rapidly cross the blood-

brain barrier, and the influx of leucine into the brain exceeds that of any other amino acid

(54). Leucine plays a significant role in buffering brain glutamate concentration. It is

rapidly converted to glutamate and a-ketoisocaproate (c-KIA) in the astrocytes. a-KIA

is then shunted to the extracellular space, where neurons take up a-KIA and consume









glutamate for the production of leucine to make a complete cycle (55). MCC catalyzes

the conversion of P-methylcrotonyl CoA, a catabolite of a-KIA, to P-methylglutaconyl

CoA. Intraperitoneal (i.p.) administration of a-KIA and leucine in rats leads to increased

absence seizure activity speculated to be a result of altered glutamate concentration (55).

Leucine is an allosteric activator of glutamate dehydrogenase, which catalyzes the

reversible oxidation of glutamate and subsequently produces ammonia (56), a well

documented neurotoxin (57). Hyperammonemia alters the balance between inhibitory

and excitatory neurotransmission (57). MCC deficiency in humans results in convulsions

or infantile spasm seizure activity that may be the result of a buildup of organic acids or

ammonia (41).

Other organic acids, such as propionic acidemia present in a PCC deficiency, also

induce seizure activity. Newborns with propionic acidemia have seizures as the primary

symptom (47). Maple Syrup Urine Disease (MSUD) is characterized by a defect in the

branched-chain a-ketoacid dehydrogenase complex that results in an accumulation of

branched-chain amino acids and their ketoacids. This can be related to a biotin-deficient

state because in both cases there is decreased catabolism of branched-chain amino acids.

In MSUD, clinical symptoms include diffuse myelin loss in the brain, degeneration of the

white matter in the brain and, if left untreated, myoclonic jerks and partial seizures (58).

Preferential Maintenance of Biotin in the Brain During Biotin Deficiency

There is less turnover of free biotin from biotinylated carboxylases in the brain

compared to other tissues (36). Biotinidase activity is also normally low in human brain

(59). In biotin-depleted rats, brain PC activity decreased to 53% of the control values,

whereas hepatic activity decreased to 3% of controls (33). In another study, activities of









PC and PCC in rat brain, liver, kidney, and brain were compared during biotin deficiency

(60). In this experiment, both PC and PCC activities dropped to only 65% and 60% of

the control values after 40 days while hepatic and kidney carboxylase activities dropped

to less than 5% and 25% of the control values. These studies were also in agreement with

observations of Bhagavan and Coursin in which rats were depleted of biotin for 8 weeks,

and liver biotin decreased 90% while brain biotin only decreased 50% (32). In another

study, ACC activity and protein expression were decreased in liver and adipose during

fasting conditions in rats, while there were no changes observed in brain tissue (45). All

of these studies report that the brain is one of the last tissues in the body to be depleted of

its biotin stores and that there may be unique regulation of biotin status in the brain. This

suggests the importance of biotin for normal brain function.

Epilepsy

Epilepsy is a condition characterized by recurrent seizures that affects 0.5-1% of

the population, with the highest incidence among neonates and elderly (61). It is defined

as a condition in which a person is prone to epileptic seizures. There are many different

types of seizures but generally they are defined as abnormal or excessive discharges of a

set of neurons (61). Seizures are commonly classified according to the International

Classification of Epileptic Seizures founded in 1981 by the International League Against

Epilepsy into groups that include two criteria: the clinical symptoms and the

electroencephalogram (EEG) pattern (62). Seizures are also classified according to their

origin in the brain. Generalized seizures arise from the cortex in both hemispheres of the

brain while partial seizures arise from a small locus in one hemisphere of the brain.

Partial seizures can spread to become a generalized seizure and are then secondarily

generalized.









Seizures can arise from a number of events including alterations in blood-brain

barrier permeability or altered neuronal excitability (61). Acute cerebral insults including

stroke, trauma, and infection are also seizure provoking. Other conditions that are

associated with seizures include metabolic disorders or inborn errors of metabolism (63).

In 70% of cases, however, the cause of seizures is unknown (64). Medical management

of epilepsy is primarily performed through pharmacotherapy, although other treatment

options include surgery, vagus nerve stimulation, and a ketogenic diet (64,65). In the

United States, approximately 1.6 million people have inadequate relief of seizures or

experience seizures unresponsive to anti-epileptic drug (AED) therapy (65).

The goal of AED therapy is to stop seizures without incurring side effects that

would reduce quality of life among patients. AED therapy is accompanied by adverse

side effects in over 50% of patients (64). One side effect that will be discussed further is

the alteration of nutrient status, particularly with respect to the vitamin biotin. As

previously stated, clinical investigations have documented decreased biotin status in

epileptics undergoing long-term AED therapy (19,20).

Effects of Anti-Epileptic Drugs on Biotin Status

In a study of 404 epileptics treated with primidone, phenytoin, carbamazepine

(CBZ), or phenobarbital, but not sodium valproate, plasma biotin concentration was

significantly lower than controls not taking AEDs (0.9 0.29 and 1.63 0.49 nmol/L,

respectively, p< 0.0005) (19). Patients with partial epilepsy who received higher daily

intakes of AEDs had lower plasma biotin concentration than epileptics with generalized

seizures prescribed lower AED doses. AEDs that induce a reduction of plasma biotin

include primidone, CBZ, phenytoin, and phenobarbital. Patients receiving sodium

valproate had a significantly higher plasma biotin concentration than those on primidone,









CBZ, phenytoin, or phenobarbital, but still lower than controls not taking AEDs. In this

same study, three patients were followed before and after AED therapy with primidone or

phenytoin. In all three patients, plasma biotin increased during the first week of therapy

and then decreased below the initial plasma biotin concentration in the following weeks

(19). In another study, Krause and colleagues examined 264 epileptics undergoing long-

term AED therapy with phenytoin, primidone, CBZ, or sodium valproate (20). Plasma

biotin concentration was significantly lower in AED-treated patients compared to

controls (227 80 ng/L vs. 448 + 201 ng/L for the epileptics and controls, respectively).

Patients taking valproate also had significantly lower plasma biotin than controls but

significantly higher plasma biotin than those taking primidone, phenytoin, or CBZ. Urine

and plasma lactate concentration was elevated in AED-treated epileptics (19); however,

no information is known about lactate concentration at the tissue level. While elevated

organic acids are suggestive of decreased biotin-dependent enzyme function, this

phenomenon has not been investigated during AED therapy.

Mechanism of Altered Biotin Status During AED Therapy

Although decreased biotin status after AED therapy is not completely understood,

several potential mechanisms include competition for uptake in the intestine and

increased biotin metabolism. CBZ and primidone, but not valproate, competitively

inhibit biotin transport across the intestinal brush border membrane in cell culture studies

(66). The affected sodium-dependent transporter is also inhibited by biocytin, which

suggests that there is no free carboxyl group required for transporter binding. Biotin

transporters in the brush border of human kidney cortex and blood brain barrier

apparently require a free carboxyl group because they are not inhibited by biocytin nor

are they inhibited by primidone or CBZ (38,67). A number of AEDs, including CBZ and









primidone, have an ureido group that is structurally similar to biotin (seen in bold in Fig.

1-3), which suggests this could be the functional group competed against for the intestinal

transporter binding site. Valproate does not have an ureido group and, therefore, it is

reasonable that it does not compete for biotin uptake.

Another potential mechanism includes induction of sulfur oxidation and 3-

oxidation processes that catabolize biotin. CBZ and/or phenytoin treatment in children

(68) and adults (69) yielded increased excretion of the inactive biotin catabolites, BNB

and BSO. In contrast, valproate is a known inhibitor of mitochondrial P-oxidation (70);

therefore, it would be expected that if BNB is a metabolite of biotin formed from 3-

oxidation in the mitochondria, then more biotin and less BNB would be present. This

phenomenon has not been investigated, but these mechanisms may explain why plasma

biotin concentrations are not as depressed in epileptics undergoing valproate therapy.






HoN H H COOOH



carbamazepine biotin o primidone phenobarbital valproate

Figure 1-3. Structures of biotin and anti-epileptic drugs with common ureido groups.

Carbamazepine

CBZ, originally synthesized for treatment of trigeminal neuralgia, is now one of the

AEDs of choice for secondarily generalized tonic-clonic seizures (71). Its mechanism of

action is not completely understood, but there is evidence that it may enhance sodium

channel inactivation (71,72). This stabilizes neuronal membranes pre- and

postsynaptically by reducing high-frequency repetitive firing of action potentials or by









slowing synaptic transmission (71). Another proposed mechanism involves the blockage

of N-methyl-D-aspartate (NMDA) receptor mediated events (73). NMDA is a glutamate

receptor with involvement in seizure generation. CBZ is also known to be involved in

the induction of hepatic enzymes such as multiple cytochrome P450 subfamilies (74).

Approximately 70-80% of orally administered CBZ is absorbed (75) with no

differences observed when the drug is taken with or without food. The body rapidly

metabolizes CBZ and, therefore, less than 1% is excreted as CBZ in urine (76). CBZ is

capable of inducing its own metabolism to CBZ 10,11-epoxide (CBZ-E), which also has

anticonvulsant properties (71). As the duration of CBZ therapy increases, autoinduction

becomes more efficient and consequently shortens the half-life of plasma CBZ (77).

Effects of Anti-Epileptic Drugs on Other Vitamins

Megaloblastic anemia observed in patients undergoing AED therapy prompted a

further look at folate and B 12 status of these patients. Reports of folate deficiency in

non-anemic epileptics treated with AEDs followed (78). Intestinal absorption of

supplemental folic acid during AED therapy was not affected; however, the absorption of

food folates was inhibited (79). Within one week of treatment, primidone (100 mg/kg,

twice daily) caused a decrease in pteroylpentaglutamates in the liver to less than half of

that of the controls and total liver folate concentration decreased by 30% in rats (80).

This same study found no effect on brain folate concentration. Disturbances of folate

metabolism have also been observed after CBZ, phenytoin, phenobarbital, and valproate.

The effects, however, were different depending on the type of AED. Red cell folate

concentrations were significantly decreased in patients receiving phenytoin or CBZ but

not with valproate (81). Folic acid supplementation in humans and rats restored plasma

folate that was decreased by phenytoin treatment but the decreased brain folate was not









restored (82). Results from this same study showed that phenytoin increased methylation

capacity (S-adenylmethionine: S-adenylhomocysteine ratio) in brain but decreased the

capacity in the liver. Supplementation with folic acid restored methylation capacity in

the liver with no effect on the brain.

There are potential confounding problems with the rat studies of oral AED

administration described above in that none measured daily food intake compared to

controls (80,82,83). It was noted in these studies that AED-treated rats gained

significantly less weight when administered either phenytoin or CBZ but there was no

record of food intake. This presents a major flaw in the design of the study because any

decrease in folate concentration in the body could have been due to less food intake and,

therefore, less folate intake.

Vitamin B6 status was not altered significantly in the whole brain of rats that were

genetically epilepsy prone (84); however, there were differences in individual regions of

the brain. The concentration of pyridoxal phosphate was lower in the cerebral cortex in

the seizure prone rat compared to controls but the opposite was true in the cerebellum.

No changes were noted in the hippocampus or the basal ganglion. Vitamin status in 146

epileptics on chronic AED therapy was determined for a number of vitamins and there

was a reported deficiency for vitamins B6 and B2 (85). There was no significant change

for vitamins B1, B12, A, C, E, or beta-carotene. The most markedly reduced vitamins

included folate, biotin, and vitamin D. In this study, 40% of epileptics were folate

deficient, 35-43% had decreased plasma vitamin D concentration, and 80% had reduced

plasma biotin concentration. In other studies, vitamin B12 concentration in the serum of









AED-treated epileptics was lower than controls (86). Valproate-treated individuals had

higher serum vitamin B12 than controls (87).

A vitamin K deficiency is prevalent among neonates due to low placental transport

and is especially prevalent in neonates exposed to AEDs in utero (88). It is hypothesized

that CBZ, phenytoin, and phenobarbital induce microsomal mixed-function oxidase

enzymes in fetal liver and these enzymes increase degradation of vitamin K. In one

clinical study, antenatal vitamin K therapy (10 mg/d) administered during the last days of

pregnancy of AED-treated mothers resulted in normal vitamin K status in neonates (89).

Overall Rationale

Although it is established that chronic treatment with AEDs including CBZ results

in some degree of biotin deficiency in over 80% of patients, the impact on brain biotin

and biotin-dependent enzymes involved in carbohydrate, lipid, and protein metabolism is

unknown. This research project investigated the metabolic changes of biotin in the brain

and the potential protective role of biotin supplementation during CBZ administration.

This characterization has important clinical significance as biotin may have future use in

medical management of epilepsy. The following hypotheses were tested using an in vivo

rat model with a physiologically relevant level of dietary biotin using the experimental

strategy outlined in the specific aims.









Hypothesis #1: Chronic oral CBZ administration in rats decreases biotin status.

Specific aims

1 To determine dose-dependent effects of chronic CBZ administration on biotin
status in brain, serum, and liver.

2 To determine time-dependent effects of oral CBZ administration on biotin status
in brain, serum, and liver.

Hypothesis #2: Chronic oral CBZ administration in rats reduces biotin-dependent
enzyme expression and activity.

Specific aims

1 To measure both apo and holoenzyme forms of the biotin-dependent enzymes,
acetyl CoA, pyruvate, propionyl CoA, and methylcrotonyl CoA carboxylases after oral
CBZ administration in brain and liver.

2 To measure specific enzyme activities of acetyl CoA, pyruvate, propionyl CoA,
and methylcrotonyl CoA carboxylases after oral CBZ administration in brain and liver.

Hypothesis #3: Chronic oral CBZ administration in rats and subsequent reduction
of biotin-dependent enzyme activity generates potentially neurotoxic intermediates.

Specific aims

1 To determine biotin status dependence of lactate and ammonia in liver, serum,
and brain after oral CBZ administration.

Hypothesis #4: Supplementation with a pharmacological dose of biotin restores
biotin status and function in rats receiving chronic oral CBZ administration.

Specific aims

1 To determine effects of pharmacological biotin supplementation on serum, brain,
and liver biotin after oral CBZ administration.

2 To determine effects of pharmacological biotin supplementation on activity and
expression of biotin-dependent enzymes after oral CBZ administration.

3 To determine effects of pharmacological biotin supplementation on serum, brain,
and liver lactate concentration following oral CBZ administration.

Hypothesis #5: While investigating hypothesis #4, we found that biotin
supplementation increased pyruvate carboxylase activity without altering the
biotinylated form of the enzyme; consequently, it was hypothesized that pyruvate
carboxylase can be activated by other compounds including NADH.






21


Specific aims

1 To determine whether NADH is an activator of pyruvate carboxylase in vitro
using both physiological and pharmacological concentrations of NADH.

2 To determine whether kinetic constants of pyruvate carboxylase are altered by
NADH.














CHAPTER 2
THE ABUNDANCE AND FUNCTION OF BIOTIN DEPENDENT ENZYMES ARE
REDUCED IN A RATS CHRONICALLY ADMINISTERED CARBAMAZEPINE

(As published in J. Nutr. 132: 3405-3410, 2002)

Pharmacological intervention remains the most common therapeutic approach for

the treatment of epilepsy. Several compounds exhibiting anti-epileptic properties have

been developed over the last 50 years, each with a characteristic mode of action and

efficacy. As with many other types of medications, these AEDs have the potential to

induce nutrient-drug interactions that affect nutritional status. Among the nutrient-drug

interactions known to occur with AEDs are reductions in folic acid, vitamin D, and

vitamin B12 (80,85,86,90).

Although less well appreciated and understood, one of the most prominent nutrient-

drug interactions that occur with AED therapy, in terms of both frequency and

magnitude, is that with the water-soluble vitamin biotin. Along with decreased serum

biotin concentrations (9,19,91), CBZ increased urinary excretion of the organic acids 3-

hydroxyisovaleric acid (3-HIA) and lactic acid (associated with insufficient MCC activity

PC activity, respectively). Although lending substantial weight to the evidence of an

AED-biotin interaction, these studies were potentially limited by the technique used to

measure biotin, which lacks chemical specificity (92). Additionally, serum biotin in

humans may be limited as a useful indicator of biotin status (93). A later study, however,

confirmed these earlier clinical observations by demonstrating an increase in the urinary









excretion of 3-HIA, a marker of MCC activity and a validated index of biotin status, in

AED treated individuals (94).

Although increased excretion of organic acids has been demonstrated during AED

therapy, its association with insufficient or reduced activity of biotin-dependent enzymes

during AED therapy has not been investigated, particularly at the tissue level. In this

report, we have established a non-toxic rat model of chronic CBZ administration and

evaluated its effects on the abundance and activity of biotin-dependent enzymes in both

the liver and brain.

Materials and Methods

Materials

Male Sprague-Dawley rats were obtained from Harlan (Indianapolis, IN). Purified

biotin-free rat diet based on a modified AIN 76A formulation described previously

(95,96) was obtained from Research Diets (New Brunswick, NJ). CBZ, 5-ethyl-5-p-

tolybarbituric acid, CBZ 10, 11-epoxide (CBZ-e), D-biotin, protease inhibitor cocktail

and ortho-phenylenediamine dihydrochloride were purchased from Sigma-Aldrich (St.

Louis, MO); avidin-horseradish peroxidase was purchased from Pierce Chemical

Company (Birmingham, AL); 96-well microtiter plates (Nunc Maxisorb) and bovine

serum albumin (BSA) were purchased from Fisher Scientific (Pittsburgh, PA). Enhanced

chemiluminescence reagent (ECL-Plus) was purchased from Amersham Pharmacia

(Picastaway, NJ). Biotinylated BSA was synthesized by mixing 50 mL of 10 g/L BSA in

ice-cold 0.1 mol/L NaHCO3 (pH 7.5) with 5 mL of a 12 g/L N-hydroxysuccinimide ester

(NHS-biotin) in dimethyl sulfoxide overnight at 40C. The mixture was dialyzed for 48 h

with gentle stirring at 40C.









Animals and Dietary Treatments

Male Sprague-Dawley rats (n=20), 50-74 g initial weight, were housed individually

in hanging wire-bottom cages in an environmentally controlled room with constant

temperature (22C) and a 12-h light:dark cycle. The animals were fed a modified AIN

76A diet containing 0.06 mg biotin/kg diet for 5 days prior to the study to standardize

their biotin status as previously described (97). The composition of the diet was spray-

dried egg white (20%), corn starch (15%), sucrose (50%), cellulose (5%), corn oil (5%),

AIN 76A mineral and vitamin mix (with 0.06 mg/kg biotin), and choline bitartrate

(0.2%). The spray-dried egg white was its sole protein source. The protein avidin,

contained within the egg white, binds -1.44 mg biotin/kg purified diet (98). The amount

of dietary biotin reported in these experiments represents that in excess of the biotin

binding capacity of avidin as determined by HPLC-avidin binding assay as previously

described (97). On day 5, rats were randomly divided into 3 dietary treatment groups

receiving either 0 g CBZ/kg diet (n=10), 1.5 g CBZ/kg diet (n=5), or 2.9 g CBZ/kg diet

(n=5) and remained on these diets for the next 19 d. On days 12, 19, and 23, animals

were placed in metabolic cages for 3 h to allow the discrete collection of urine. On day

24, animals were anesthetized with halothane vapor and killed by exsanguination. Brain,

liver, and serum were collected and prepared as described below. All procedures were

approved by the University of Florida Animal Care and Use Committee.

Sample Preparation

After anesthesia, whole blood was withdrawn, allowed to coagulate for 30 min, and

centrifuged at 10,000 x g for 5 min to collect serum. Whole brain and liver (-500 mg)

were removed and homogenized in 10 volumes of ice-cold homogenization buffer [300

mmol/L mannitol, 10 mmol/L HEPES (pH 7.2), 1 mmol/L EDTA and protease inhibitor









cocktail]. A portion of the homogenate was set aside for protein biotinylation analysis

and the remainder was centrifuged at 200,000 x g for 30 min at 40C to collect the soluble

fraction. For the measurement of biotin and biotin metabolites, serum and tissue soluble

fractions were ultrafiltered using a 5000 nominal molecular weight cutoff filter

(Millipore, Bedford, MA). All samples were immediately frozen in a mixture of dry ice

and isopropanol and stored at -800C until needed.

Competitive Binding Assay of Biotin

The measurement of biotin in urine, serum, and liver was performed with a coupled

HPLC/competitive binding assay (99) with minor modifications. The reversed-phase

column used was a Sphereclone 250 x 4.6 mm (Phenomenex, Torrance, CA), and the

biotin-containing chromatography fractions were dried under a stream of nitrogen before

the assay. A filtered solution (200 [tL, 0.45 micron filter, Fisher) ofbiotinylated bovine

serum albumin (BBSA) (50 mmol/L bicarbonate, pH 9.0, 2.5 mg/mL BSA, 1:100 BBSA)

was added to flat-bottom 96 well plates and incubated at 40C overnight. Biotin, BNB,

and BSO standards were prepared from a 3000 pmol/L stock and 100 ptL of standard or

sample was added to a U-bottom 96 well plate. Avidin solution (50 [tL, 100 mg/mL

BSA, 0.1 mol/L HEPES, 1 mol/L NaC1, pH 7.0, 1:25,000 NeutrAvidin) was added to

each well with either standard or sample and thoroughly mixed. The sample or standard

and avidin were incubated for 1 h at room temperature. The coated flat-bottom plate was

washed three times with an automatic washer using 0.5% Tween-20, and then 50 p.L of

the contents from the U-bottom plate were transferred to the coated wells in the flat-

bottom plate and allowed to incubate 1-4 h at room temperature. The plate was washed 3

times with 0.5% Tween-20, and 50 ptL of a chemiluminescent substrate was added for









detection [0.08% ortho-phenylenediamine dihydrochloride (OPD), 0.1 mol/L citric acid,

0.2 mol/L sodium phosphate, pH 5.0, 0.04% (v/v) H202]. Before the absorbance was

recorded, the reaction was stopped by adding 100 pL of 2 N H2S04 to each well. The

plate was read after 45 min at 490 nm and subtracted from the reading at 650 nm.

Measurement of CBZ and CBZ-e

Urine, serum, and tissue CBZ and CBZ-e were measured using a method described

previously (100) with minor modifications. Briefly, one gram of diet was mixed with 5

mL of acetone containing 10 mg of 5-ethyl-5-p-tolybarbituric acid/L and vortexed 10-15

min. This mixture was centrifuged at 13,000 x g for 10 min and the soluble fraction was

recovered for analysis. Urine and serum were prepared by mixing an equal volume of

acetone containing tolylbarbituric acid (10 mg/L) and centrifugation at 13,000 x g for 5

min. Tissues were prepared by homogenizing in 10 volumes ice-cold homogenization

buffer (10 mmol/L HEPES, 300 mmol/L mannitol, 1 mmol/L EDTA and protease

inhibitor cocktail, pH 7.2) using a Polytron homogenizer and centrifugation at 200,000 x

g for 30 min at 40C. The soluble fraction was recovered and mixed with an equal volume

of acetone containing 10 mg tolylbarbituric acid/L, and then the sample was centrifuged

at 13,000 x g for 5 min at room temperature. The soluble fractions from these samples

were then mixed with two volumes of dichloromethane, vortexed, and the aqueous phase

was removed. The organic layer was dried at 650C and resuspended in methanol. All

samples were filtered using a 0.5 |tm filter immediately before HPLC injection. A

reversed phase column was used [Luna 5 ptm C18, 250 x 2 mm (Phenomenex, Torrance,

CA)] with a mobile phase of 17% acetonitrile, 55% methanol, and 28% 0.4 mmol/L

potassium phosphate (pH 6). Eluted compounds were detected by ultraviolet absorption









at 195 nm. Known amounts of CBZ or CBZ-e were separated and a peak area ratio was

determined to generate a standard curve.

Synthesis of Avidin-AlexaFluor 430

NeutrAvidin, an isoelectrically neutral and deglycosylated form of avidin, was

conjugated to the succinimidyl ester form of AlexaFluor 430. NeutrAvidin, 10 g/L in 50

mmol/L sodium bicarbonate, pH 8.3, was mixed on a vortexer for 1 h at room

temperature. Unconjugated dye was removed by size exclusion chromatography over a

DG-10 column (Bio-Rad, Hercules, CA) equilibrated in PBS (20 mmol/L sodium

phosphate, pH 7.2, 150 mmol/L NaC1). Equal fractions (1 mL) were collected and the

peaks with the highest absorbance at 280 nm combined. Sodium azide (0.2 g/L) was

added for preservation, and the conjugate was stored at 40C protected from light.

Detection and Quantification of Biotinylated Proteins

Using the avidin-blotting technique, we specifically detected five distinct proteins

in the liver and brain, corresponding to the five carboxylase enzymes ACC1, ACC2, PC,

PCC, and MCC. The specificity of this detection was confirmed through competition

with excess biotin. Two slightly different techniques were used in this analysis, i.e.,

direct fluorescent avidin blotting for PC, PCC, and MCC, and enzyme-linked horseradish

peroxidase-avidin conjugate for detection of ACC isoforms 1 and 2. The enzyme-linked

method was used for the latter due to the sensitivity limit of the direct fluorescent avidin

blotting.

The concentrations of protein in liver and brain samples were determined using a

Markwell protein assay (101). Equal amounts of liver total membrane fractions (0.1 mg

for the analysis of ACC1 and ACC2, 0.08 mg for all other carboxylases) were resolved

by 5 % SDS-PAGE for ACC1 and ACC2 [0.375 M Tris-HC1, pH 8.8, 0.1% SDS (Fisher),









5% acrylamide (1:29 bisacrylamide:acrylamide), 0.05% ammonium persulfate (Sigma,

St. Louis), 30 [tl TEMED (Fisher)] and an 8% gel with separating gel buffer pH 8.0 for

PC, PCC, and MCC [0.375 M Tris-HC1, pH 6.8, 0.23% SDS, 35% (v/v) glycerol, 0.035

mg/mL bromophenol blue, 1.43 mmol/L P-mercaptoethanol (Sigma, St. Louis)], while

diluting the sample in 20 uL sample dilution buffer. Proteins were run overnight with

running buffer [0.025 M Tris base, 0.2 M glycine (Sigma, St. Louis), 0.1% SDS] at 47

volts. MCC and PCC are very close in molecular weight (79.8 kDa for MCC and 79.3

kDa for the ac chain of PCC) but can be separated using an 8% (w/v total acrylamide)

SDS-PAGE gel with a separating gel buffer pH 8.0.

The resolved gel was equilibrated in cold transfer buffer [0.03 mol/L Tris base, 0.2

mol/L glycine, 60% (v/v) methanol] for 10 min and was then electroblotted to PVDF

(Immobilon-P, Millipore, Bedford, MA) for 2 h at 12 V. The blot was stained with

amido black stain [50% (v/v) methanol, 10% (v/v) glacial acetic acid, napthol blue black]

and destined [50% (v/v) methanol, 10% (v/v) glacial acetic acid], and then washed with

2 changes of methanol before allowing it to air dry.

For the detection of ACC 1 and ACC2, the blot was incubated in 0.5 % non-fat dry

milk (NFDM) in Tris-buffered saline (20 mmol/L Tris, pH 7.4, 150 mmol/L NaC1) with

0.05% (v/v) tween-20 (TBS-T) and a 1:6000 dilution ofNeutralite avidin-horseradish

peroxidase conjugate for 40 min. The PVDF was washed 3 times in TBST without

NFDM. A chemiluminescent substrate that exhibits fluorescent properties (ECL-Plus)

was then applied to the blot and allowed to stand for 5 min. Placing the blot back into

TBS-T stopped the reaction. For the detection of PC, PCC, and MCC, the blot was

incubated in TBS-T/0.5% NFDM containing avidin-AlexaFluor 430 conjugate at a 1:750









dilution for 45 min at room temperature on an orbital shaker. Biotinylated proteins on

both blots were then detected and emitted fluorescence quantified on a Storm fluorescent

optical scanner as described by the manufacturer (Amersham-Pharmacia).

Resolving 80 |tg of tissue homogenate by 10% (w/v total acrylamide) SDS-PAGE

has been determined to be within the linear range of the detection limits of avidin

AlexaFluor-430 to detect PC, MCC, and PCC. The specificity of this detection was

confirmed through competition with excess biotin.

Lactate and Ammonia Measurements

Ammonia and lactate were measured in serum and brain and liver homogenates

using an ultraviolet endpoint method. 2-Oxoglutarate, ammonia, and NADPH were

converted to glutamate and NADP+ by glutamate dehydrogenase and the production of

NADP+ was measured (Sigma Diagnostic Kit, St. Louis, MO). Lactate concentration was

measured in tissue homogenates or serum using an ultraviolet measurement of NADH

production from lactic acid and conversion of NAD+ to pyruvic acid and NADH by the

enzymatic activity of lactate dehydrogenase (Sigma Diagnostics Kit, St. Louis, MO).

Measurement of Pyruvate Carboxylase Activity

PC activity was measured by a modification of the method previously described

(102). The assay mixture contained in a final volume of 0.1 mL 100 mmol/L Tris-HCl

(pH 8.0), 3.8 mmol/L MgCl2, 3.14 mmol/L ATP, 0.32 mmol/L acetyl CoA, 0.5% triton

X-100, freshly prepared 7.5 mmol/L pyruvate, and 4 mmol/L [14C]NaHCO3 (specific

activity 0.9 mCi/mmol). Blanks were prepared by omitting pyruvate from the reaction

mixture. Equal aliquots of the crude homogenate (0.1 mg) were added and allowed to

incubate at 370C for 15 min. PC activity was linear for at least the first 25 min. Adding









0.05 ml 200 g/L trichloroacetic acid stopped the reaction and the precipitated protein was

centrifuged at 5,000 x g for 5 min. The supernatant was transferred to a scintillation vial

and 0.1 ml of 100 g/L TCA was added to wash the protein pellet. The pellet was

centrifuged at 5,000 x g for 5 min and the supernatant added to the corresponding

scintillation vial. The pooled supernatants were dried under a stream of nitrogen at 650C

for 30 min and resuspended in 0.5 mL distilled water. Five milliliters scintillation

cocktail were added to each vial and the samples were counted by liquid scintillation

counting. Specific activities were expressed as pmol OAA formed-mg protein- min-.

Statistical Analysis

Results were expressed as means + SD. The significance of differences (p<0.05)

between the two drug levels was assessed by a Student's t-test at each time point.

Homogeneity of variance was routinely verified and no data transformation was

necessary for these experiments.

Results

Dietary Carbamazepine Administration in a Rodent Model of Biotin Nutriture

After mixing crystalline CBZ with the semipurified diet, analysis indicated

concentrations of 1.5 and 2.9 g CBZ/kg diet. Over the 19 d course of treatment, rats

consuming the CBZ-containing diets exhibited growth rates (Fig. 2-la) and food intakes

(Fig. 2-1b) not different from control animals consuming the purified diet alone.










350- A
._ 300-
250-
o 200-

150-

30



20
0


10-
0 5 10 15 20 25
t time, d

CBZ diets started
Figure 2-1. Effect of dietary carbamazepine (CBZ) on body weight (A) and food intake
(B) in rats. Results are mean SD, n=10 (0 g CBZ/kg diet, solid black
squares) and n=5 (1.5 and 2.9 g CBZ/kg diets, open squares and solid circles,
respectively).

After 1 wk of consuming the CBZ-containing diets, urinary CBZ excretion in rats

fed the 2.9 g/kg diet was significantly higher than in those fed the 1.5 g/kg diet. Urinary

CBZ excretion was not different between dietary groups for the remainder of the study.

(Fig 2-2a). The urinary excretion of CBZ-e was significantly greater for rats fed the 2.9

g/kg diet than for those fed the 1.5 g/kg diet at all time points (Fig. 2-2b). At the end of

the study, serum CBZ concentration was not different between the two drug treatment

groups (3.9 0.72 tmol/L and 4.9 + 0.1.6 tmol/L for the 1.5 g CBZ/kg and 2.9 g

CBZ/kg groups, respectively). Brain CBZ concentration was significantly different

between the 1.5 and 2.9 g/kg groups (Fig. 2-2c). Hepatic CBZ concentration was similar

to that in brain and was not different between the two dietary levels (Fig. 2-2d).










75- A 7.5-


0 0- 0.0-




4 200- B 7.5- D
S50 5.0-




100-
I25- 2.5-

00- 0.0-








O 5 10 15 20 25 1.5 2.9
time, d dietary CBZ, g/kg diet
j200- 7.
B B D
LL V 5.0-












n=5 (1.5 and 2.9 g CBZ/kg diets). For A and B, means that differ (p<0.05)

from the other dose at the same time point are indicated by an asterisk. For C
and D, an asterisk above the bar indicates significant differences. Open
symbols, 2.9 g CBZ/kg diet; closed symbols, 1.5 g CBZ/kg diet.

Effect of Carbamazepine on Organic Acids and Ammonia


In rats consuming the diet containing 2.9 g CBZ/kg, brain ammonia concentrations
were significantly elevated compared with those consuming either no CBZ or 1.5 g/kg

(p<0.05) (Fig. 2-3a). Brain lactate concentration was likewise elevated in rats consuming

diet containing either 2.9 or 1.5 g CBZ/kg compared to control animals (p<0.05) (Fig. 2-

3b). Consumption of diets containing CBZ did not affect hepatic lactate concentration


(Fig. 2-3c).
Effect of Carbamazepine Administration on Urine, Serum, Liver, and Brain Biotin
and Biotin Metabolites

Urinary biotin excretion was significantly reduced in rats consuming 1.5 g CBZ/kg

diet but was elevated in those consuming 2.9 g CBZ/kg diet (p<0.05, Fig 2-4a).
(Fig. 2-3c).

Effect of Carbamazepine Administration on Urine, Serum, Liver, and Brain Biotin
and Biotin Metabolites

Urinary biotin excretion was significantly reduced in rats consuming 1.5 g CBZ/kg

diet but was elevated in those consuming 2.9 g CBZ/kg diet (pFo.05, Fig 2-4a).











10- A


E 2- B

E

2-

EB







0-

7.5-
S5--.0-





0.0-
0) 25 I



0 1.5 2.9
dietary CBZ, glkg diet
Figure 2-3. Effect of dietary carbamazepine (CBZ) on brain lactate (A) and ammonia (B)
and liver lactate (C) concentrations in rats. Results are means + SD, n=10 (0 g
CBZ/kg diet), n=5 (1.5 and 2.9 g CBZ/kg diets). Means without a common
letter differ, p<0.05.

Consumption of CBZ-containing diets had no effect on serum biotin concentration,

But elevated the concentration of BSO and biocytin (p<0.05, Fig. 2-4b). The

concentration of BNB and biocytin were reduced in the brain of rats consuming either 1.5

or 2.9 g CBZ/kg diet (p<0.05) (Fig. 2-4d). There was no effect of dietary CBZ on hepatic

biotin, BSO, or biocytin at the two dietary CBZ concentrations tested (Fig. 2-4c).











50- A 7.5- C
40-
E .= 5.0- T
t 30- A [i
E 20-







S o2-
"o I '25




D

S10





biotin BSO BNB biocytin biotin BSO BNB biocytin
Figure 2-4. Effect of dietary carbamazepine (CBZ) on urine (A), serum (B), liver (C),
and brain (D) biotin, biotin sulfoxides (BSO), bisnorbiotin (BNB), and
biocytin concentrations in rats. Results are means + SD, n=10 (0 g CBZ/kg
diet), n=5 (1.5 and 2.9 g CBZ/kg diets). Means without a common letter
differ, p<0.05.

Effect of Carbamazepine Administration on the Abundance of Biotin-Dependent
Enzymes in Liver and Brain

As assessed by avidin-blotting, the abundance of biotinylated PC was reduced

approximately 25% (p<0.05) in the brain of rats consuming either 1.5 or 2.9 g CBZ/kg

diet, whereas the abundance of biotinylated PCC, MCC, or ACC was not affected (Fig. 2-

5). The relative abundance of hepatic biotinylated PC was significantly reduced by 25

and 39% in rats consuming the 1.5 and 2.9 g/kg diets, respectively. Hepatic ACC 1 and

2 were reduced in the rats consuming both dietary concentrations of CBZ compared to

controls (41 and 25% for ACC1 and 40 and 38%, for ACC2, p<0.05, for the 1.5 g/kg and

2.9 g/kg diets, respectively) (Fig. 2-6).











) 200- 1 0 g CBZ/kg diet
U 11.45 g CBZ/kg diet
C m 2.9 g CBZ/kg diet
150-
a
100- I b

50-

0

PC PCC MCC ACC1

Figure 2-5. Effect of dietary carbamazepine (CBZ) on the relative abundance of
biotinylated biotin-dependent enzymes in rat brain. Results are means + SD,
n=10 (0 g CBZ/kg diet), n=5 (1.5 and 2.9 g CBZ/kg diets). Means without a
common letter differ, p<0.05.

Hepatic MCC and PCC abundances were reduced by 17 and 11% (p<0.05),

respectively, in rats consuming 2.9 g CBZ/kg diet compared with controls (Fig. 2-6).


G 200- 0 g CBZ/kg diet
U 1 1.5 g CBZ/kg diet
r- m 2.9 g CBZ/kg diet
*o 150-
a aa a a a
S100- b
C | b bb
S50-

0 --- -

PC PCC MCC ACC1 ACC2

Figure 2-6. Effect of dietary carbamazepine (CBZ) on the relative abundance of
biotinylated biotin-dependent enzymes in rat liver. Results are means + SD,
n=10 (0 g CBZ/kg diet), n=5 (1.5 and 2.9 g CBZ/kg diets). Means without a
common letter differ, p<0.05.

Effect of Carbamazepine Administration on the Activity of Hepatic Pyruvate
Carboxylase

To determine whether the observed reduction in carboxylase abundance was

consistent with a reduction in enzymatic activity, the specific enzymatic activity of

hepatic PC in rats consuming the 0 and 2.9 g CBZ/kg diets was measured. The activity









of hepatic pyruvate carboxylase was reduced approximately 32% in rats consuming 2.9 g

CBZ/kg diet compared to controls (3.7 0.23 versus 5.1 0.91 nmol-mg-1-min1,

p<0.05).

Discussion

This report describes experiments to determine the effects of CBZ administration

on the metabolism and function of the water-soluble vitamin biotin in rats. Although

reduction in circulating biotin is well established in the clinical setting, the effect of these

reductions on tissue-associated biotin and function of biotin-dependent enzymes is very

poorly understood. The dietary model used here was useful for analyzing such effects for

several reasons. First, the oral administration of CBZ through the diet more closely

models the normal administration route in humans, in contrast to other studies that used

injected drug (103). This was an important consideration in light of the results by Said et

al. (104), who demonstrated that one mechanism by which CBZ might reduce biotin

status is competitive inhibition of intestinal biotin absorption. Second, we observed no

reductions in food intake or growth rate, demonstrating the tolerability of the drug when

mixed with the AIN76A diet. Furthermore, we observed the well established

phenomenon of autoinduction of catabolism, evidenced by the substantial reduction in

urine drug concentration after the first week of consumption. One potentially important

consideration of these studies is that the dietary level of CBZ used achieved circulating

drug concentrations was somewhat lower than we intended, resulting in a model that

could be considered subclinical. This could partially explain the lack of toxicity in our

study compared to symptoms of toxicity that have been observed in other studies using

dietary CBZ (83). This also suggests, however, that the effects of dietary CBZ observed









in this study should be viewed as conservative in relation to what could occur at higher

dosages.

In agreement with earlier studies, we have observed changes in the concentration of

biotin metabolites consistent with altered biotin catabolism. Oral consumption of CBZ

elevated both BSO and BNB, suggesting that the two major pathways of biotin

catabolism (sulfur oxidation and 1-oxidation) were induced, which is in agreement with

earlier reports (103).

Elevation of circulating organic acids, such as lactic acid, is a common clinical

finding in individuals treated with various AEDs (9,105). Although we observed no such

elevation in serum lactate, brain lactate was significantly increased. Independence of

these two compartments of the body is in agreement with earlier observations (50). One

likely explanation for the increase of brain lactate is that CBZ reduced the abundance of

biotinylated PC, which led to a reduced enzymatic capacity to maintain the TCA cycle

intermediates. This could lead to an increase in pyruvate, which might increase the flux

to lactate through lactate dehydrogenase. Loss of PC activity has been previously

associated with elevation of lactate (106,107). The loss of PC activity can be explained

at least in part by a reduction in the abundance of brain biotinylated PC. This provides

strong evidence that either the abundance of the PC polypeptide or the biotinylation of

the polypeptide is reduced in CBZ-treated rats. Lactate accumulation in the brain is of

particular concern, because lactate exhibits low permeability across the blood-brain

barrier and can be detrimental in other tissues (49,52). Additionally, lactic acidemia is

associated with impaired neurological function. Elevated lactic acid concentration is

observed in the brain of piglets with experimentally induced convulsions and in the









extracellular fluid of the hippocampus of humans during spontaneous seizures (108,109).

Lactate concentration was also higher in the cerebral spinal fluid of status epileptics than

that of control individuals (110). Similarly, the elevation of 3-HIA that has been

observed in CBZ therapy is explained by the reduction in the abundance of the

biotinylated form of MCC, which is responsible for the catabolism of leucine. Reduction

of MCC activity is associated with accumulation and excretion of the resulting 3-HIA

(111-114).

The dietary administration of CBZ also elevated brain ammonia, which was

somewhat unexpected because of the labile nature of this metabolite. Two mechanisms

can be proposed to account for this elevation. The first is that biotin deficiency has been

shown to reduce the expression and activity of ornithine transcarbamoylase, a critical

enzyme in the urea cycle (115). This inhibition of the urea cycle has been proposed to

account for the hyperammonemia observed during biotin deficiency. However, because

we observed no marked reduction in biotin status, this may be an unlikely mechanism. A

second plausible explanation is the observation that leucine is an allosteric activator of

glutamate dehydrogenase, the enzyme that catalyzes production of ammonia (116). It is

reasonable to predict that leucine metabolism would be impaired in hepatocytes with

decreased abundance of biotinylated MCC, although this has not been directly

determined.

Reductions in the abundance of biotinylated ACC isoforms and PCC have

additional ramifications for metabolic alterations during CBZ therapy. Simultaneous

reductions in ACC 1 and 2 would promote a shift in the hepatocytes from fatty acid

synthesis to fatty acid oxidation. A reduction in the abundance of the cytosolic ACC1









limits the ability to synthesize fatty acids de novo, and is associated with elevations in

odd-chain fatty acids (117-121). A concurrent reduction in the abundance of outer

mitochondrial membrane protein ACC2 would promote fatty acid oxidation by lowering

the barrier to entry of fatty acids into the mitochondrial matrix (13,122,123). Although

the reduction in enzyme abundance observed in these experiments is consistent with this

interpretation, direct functional evidence is needed. Hepatocytes also contained less

biotinylated PCC (Fig. 2-6) in rats consuming CBZ, limiting the enzymatic capacity to

catabolize select amino acids, cholesterol, and odd-chain fatty acids. Again, although

these results are strongly suggestive that these other metabolic pathways would be

affected, positive functional data are required to substantiate these findings.

Taken together, these data suggest that oral administration of CBZ reduces the

abundance of the biotinylated, and therefore functional, form of biotin-dependent

enzymes, even when the CBZ is administered with food. Furthermore, this effect is also

evident in the rat brain, where the metabolic derangement results in accumulation of

lactate and ammonia, both potentially neurotoxic intermediates. The reduction in

abundance of the biotinylated carboxylases could arise from either reduction in the

abundance of the polypeptide or reduced biotinylation of each carboxylase, and the

mechanisms behind these observations await further investigation.














CHAPTER 3
DIETARY CARBAMAZEPINE ADMINISTRATION DECREASES LIVER
PYRUVATE CARBOXYLASE ACTIVITY AND BIOTINYLATION BY
DECREASING PROTEIN AND mRNA EXPRESSION IN RATS

(As published in J. Nutr. 133: 2119-2124, 2003)

We demonstrated in Chapter 2 that dietary CBZ administration to rats yielded

decreased abundance of both brain and hepatic biotinylated PC (124). We also observed

increased brain lactate concentration, which could be due to decreased function of brain

PC. The mechanism by which CBZ decreased abundance of the biotinylated and,

therefore, active PC is unknown and was investigated in the current study. Decreased

abundance of biotinylated PC could be due to either decreased expression of the total

protein or decreased abundance of the holocarboxylase form of the enzyme. This study

examined PC protein abundance and the proportions of apo-PC and biotinylated PC using

an in vitro biotinylation technique as well as expression of PC mRNA following dietary

CBZ administration to rats.

Materials and Methods

Materials

Male Sprague-Dawley rats were obtained from Harlan (Indianapolis, IN). Purified

biotin-free rodent diet based on a modified AIN 76A formulation described previously

(125) was obtained from Research Diets (New Brunswick, NJ). Carbamazepine (CBZ),

5-ethyl-5-p-tolylbarbituric acid, carbamazepine 10,11-epoxide (CBZ-e), d-biotin,

protease inhibitor cocktail, [14C]NaHCO3, and o-phenylenediamine dihydrochloride were

purchased from Sigma (St. Louis, MO); avidin-horseradish peroxidase (Avidin-HRP) and









avidin-alkaline phosphatase (Avidin-AP) was purchased from Pierce Chemical Company

(Birmingham, AL); 96-well microtiter plates (Nunc Maxisorb), ScintiSafe liquid

scintillation cocktail, and bovine serum albumin (BSA) were purchased from Fisher

Scientific (Pittsburgh, PA). Enhanced chemifluorescence (ECF) reagent was purchased

from Amersham-Pharmacia (Picastaway, NJ). Biotinylated BSA and avidin-AlexaFluor

430 conjugate were synthesized as previously described (97).

Animals and Dietary Treatments

Male Sprague-Dawley rats (n=l 1), 50-75 g initial weight, were housed individually

in hanging wire-bottom cages in an environmentally controlled room with constant

temperature (220C) and a 12 h light:dark cycle. The rats were acclimatized by feeding a

powdered egg-white based modification of the AIN 76A diet containing 0.06 mg

biotin/kg diet for 5 days to standardize their biotin status as described in Chapter 2 (97).

After 5 days of acclimatization, the rats were randomly assigned to 2 groups: one group

received 0 g CBZ/kg diet (n=5) and one group received 3.75 g CBZ/kg diet (n=6) fed for

28 days. Food intake and body weights were recorded daily for all rats. All procedures

were approved by the University of Florida Animal Care and Use Committee.

Sample Preparation

On day 28, rats were anesthetized under halothane and killed via cardiac puncture

and exsanguination. Whole blood was allowed to coagulate for 30 min, and then

centrifuged at 13,000 x g for 5 min to separate serum. Whole brain was removed and

minced before homogenizing in 10 volumes of ice-cold HEM homogenization buffer (30

mmol/L HEPES, pH 7.2, 1 mmol/L EDTA, 300 mmol/L mannitol, and protease inhibitor

cocktail). The left lobe of the liver was divided into 10 sections and all samples were

immediately frozen in liquid nitrogen and stored at -800C until further use for enzymatic









activity assays or mRNA isolation. For liver protein extract preparation, a frozen liver

portion was thawed and homogenized in 10 volumes of ice-cold HEM. A portion of each

homogenate was saved for enzyme biotinylation assays and the remainder was

centrifuged at 200,000 x g for 30 min at 40C to collect the soluble fraction for

determination of biotin and biotin metabolites. All homogenized samples were

immediately frozen in liquid nitrogen and stored at -800C until assayed.

Pyruvate Carboxylase Activity Assay

PC activity in brain and liver was determined as described by Suormala et al. (102)

with the modifications presented in the Chapter 2 methods section (124). Specific

enzymatic activities were expressed as nmol OAA formed-mg protein-l min-.

Detection of Biotinylated Biotin-Dependent Carboxylases

The five biotin-dependent carboxylases, ACC1, ACC2, PC, PCC, and MCC were

detected using the avidin-blotting technique described previously (97) with slight

modifications as presented in the Chapter 2 methods section.

In Vitro Biotinylation

Total liver PC protein was determined as described by Rodriguez-Melendez et al.

(126). Briefly, liver homogenate (approximately 500 [tg) protein was added to 450 |pL of

a master mix providing a final concentration of 60 mmol/L Tris HC1, pH 7.5, 0.82

mmol/L biotin, 0.1 mmol/L EDTA, 0.6 g/L bovine serum albumin, 3 mmol/L reduced

glutathione, 8 mmol/L MgCl2, and 10 mmol/L adenosine triphosphate. The reaction

mixture was incubated for 6 h at 370C. At 2 and 4 h of incubation, an additional 26.75

tL of a solution containing 10 mmol/L adenosine triphosphate and 8 mmol/L MgCl2 was

added. Finally, the reaction was terminated by adding 500 ptL sample dilution buffer









[0.375 mol/L Tris-HC1, pH 6.8, 2.3 g/L SDS, 350 mL/L glycerol, 0.035 mg/ml

bromophenol blue, 1.43 mol/L P-mercaptoethanol]. A portion of each protein sample (40

[tg) was loaded and resolved on a 10% SDS-PAGE gel, transferred to PVDF membrane,

and detected by avidin-western blotting (125).

Measurement of Biotin, Biotin Sulfoxide, Bisnorbiotin, and Biocytin

The measurement of biotin and its metabolites in serum, liver, and brain was

performed using a coupled HPLC/competitive binding assay (97,99).

Measurement of Carbamazepine

Serum, liver, brain, and dietary CBZ were measured using a method previously

described (100) with slight modifications (124) presented in the Chapter 2 methods

section.

RNA Isolation and Northern Blotting

Frozen liver was homogenized in Trizol reagent (Invitrogen Life Technologies,

Carlsbad, CA) and RNA was isolated as directed by the manufacturer. RNA was

quantified by absorbance at 260 nm and purity assessed by calculation of the ratio of the

absorbance at 260 nm to absorbance at 280 nm. RNA integrity was analyzed by 1.2%

agarose gel electrophoresis in 1 x TBE (89 mmol/L Tris base, 89 mmol/L boric acid, 2

mmol/L EDTA) with ethidium bromide staining (127).

After electrophoresis, RNA was transferred to a nylon membrane (Millipore,

Bedford, MD) using an overnight downward capillary transfer technique (127). The

nucleic acids were cross-linked to the membrane using 160,000 [tjoules short wave UV

light and allowed to dry completely before probing. The random priming labeling kit

(Gibco BRL) was used to label a rat PC cDNA probe with 32p. The PC cDNA probe was









hybridized to the homologous RNA and to normalize for lane-to-lane variation, a mouse

beta-actin cDNA probe was used to detect beta-actin mRNA. Both PC and beta-actin

were detected by phosphor imaging using a STORM840 fluorescent and phosphor imager

(STORM, Sunnyvale, CA) following the manufacturer's instructions. Densitometry of

the resulting image was performed using ImageQuant software (Amersham Pharmacia

Biotech, Picastaway, NJ).

Real-Time Reverse Transcriptase PCR Conditions

Using cDNA sequences for PC retrieved from GenBank, real-time PCR primers

and TaqMan probe were designed using Primer Express software version 1.0 (PE Applied

Biosystems, Foster City, CA). The primers and TaqMan probe for PC were synthesized

by Keystone Labs (Biosource International, Camarillo, CA) with a FAM reporter dye and

quencher BHQ1 (Table 3-1). The primers and TaqMan probe for 18S rRNA gene were

purchased from PE Applied Biosystems and used as the endogenous control for RNA.

Table 3-1. Primers and TaqMan probe for rat pyruvate carboxylase. Positions in the
pyruvate carboxylase gene (GenBank accession no. NM 012744) are
indicated. The TaqMan probe has the 5' and 3' ends labeled
Sequence of PC primers and probe
Primer/probe Sequence (5' -') Positions (bp)

Forward primer CCTGCTCGTCAAAGTCATTGC 1,306-1,326
(Antisense) Reverse primer ACACCTCGGACACGGAACTC 1,379-1,398
TaqMan probe FAM-CAAAGACCACCCTACAGCTGCCACCA-BHQ1 1,333-1,358


Real-Time Reverse Transcriptase PCR Conditions

All assays were performed using one-step RT-PCR reagents and a GeneAmp 5700

Sequence Detection System (PE Applied Biosystems, Foster City, CA) in a 25 ptL

reaction volume as employed by Moore et al. (128). RT-PCR conditions were as follows:

30 min at 480C, 10 min at 950C, 50 cycles of 15 s at 950C, and 1 min at 600C. Relative

quantification was determined from a 3-4 log range standard curve generated from









serially diluted RNA to final concentrations of 10, 1, 0.1, 0.01, and 0.001 ng/[tl.

Quantification was performed by interpolation using a standard regression curve of Ct

values generated from RNA samples of these known concentrations. Total RNA (1 ng)

isolated from individual rats was used for these experiments and all samples were run in

duplicate. The reaction mixture contained 900 nmol/L each of the forward and reverse

primers and 250 nmol/L of PC TaqMan probe, whereas the 18S rRNA TaqMan assay

utilized 50 nmol/L forward and reverse primers and 50 nmol/L TaqMan probe. In order

to ensure that the total RNA samples were not contaminated with DNA, RNA samples

with no reverse transcriptase added were run.

Statistical Analysis

Results were expressed as means SD. The significance of differences (P<0.05)

was tested by Student's t-test. Homogeneity of variance was routinely verified and no

data transformation was necessary for these experiments.

Results

Effect of CBZ on Metabolites

Direct analysis of the diet by HPLC confirmed the intended concentration of 3.4 g

CBZ/kg. There were no significant differences in food intake or body weight gain

between treatment groups over the 28-d experiment (Fig. 3-1). At the end of the study,

serum CBZ concentration of the drug-treated group was 11 7.1 [tmol/L, while liver and

brain CBZ concentrations were 80 4.0 and 38 + 2.1 nmol/g tissue, respectively.

After consuming the 3.4 g CBZ/kg diet for 28 d, the rats had a significantly higher

concentration of lactic acid in the brain compared to control rats (10 + 2.8 versus 6.2

2.1 [tmol/g, p<0.05). Serum concentrations of lactic acid at 28 d were similar between











400-
-*- 0 g CBZ/kg diet
30- -0-3.4 g CBZ/kg diet

S200-

0
100-

0-
30-


20-


0 10-


0

-3 0 3 6 9 12 15 18 21 24 27
time, d

Figure 3-1. Body weights (top) and food intakes (bottom).

rats consuming the 3.4 g CBZ/kg diet (6.3 + 1.0 mmol/L) and those consuming the

control diet (7.2 + 2.8 mmol/L).

The administration of 3.4 g CBZ/kg diet for 28-d did not have a significant effect

on serum, liver, or brain biotin, BSO, or BNB (Fig. 3-2). The distribution of biotin and

metabolites in brain, liver, and serum was similar to results from our previous studies

(124). Only brain biocytin was significantly elevated in rats consuming 3.4 g CBZ/kg

diet compared to controls (3.6 + 1.0 and 1.2 0.26 pmol/g tissue, respectively, p<0.05).

Effect of CBZ Administration on PC Biotinylation, Activity, and Protein and mRNA
Expression

The relative abundance of hepatic biotinylated PC was decreased 43% in the rats

consuming 3.4 g CBZ/kg diet compared to controls (p<0.05) (Fig. 3-3a). Brain







47


biotinylated PC was decreased 29% (p<0.05) in rats consuming the 3.4 g CBZ/kg diet

compared to controls (Fig. 3-3a). There was no difference in the relative abundance of


S0 g CBZ/kg diet
]3 4 g CBZ/kg diet


Biotin BNB BSO Blocytin Biotin BNB BSO Biocytin Biotin BNB


Serum


Brain


Liver


BSO Biocytin


Figure 3-2. Effect of dietary carbamazepine (CBZ) on serum, brain, and liver biotin and
biotin metabolites in rats. Results are means + SD for control (0 g CBZ/kg
diet, n=5) and CBZ-supplemented (3.4 g CBZ/kg diet, n=6). Means without a
common letter differ, p<0.01.

biotinylated MCC, PCC, ACC1 or ACC2 in either brain or liver of rats consuming 3.4 g

CBZ/kg diet compared to controls (data not shown). Hepatic PC specific enzymatic

activity was decreased 30% in rats consuming the 3.4 g CBZ/kg diet compared to

controls but brain PC activity was increased 175% in this group (p<0.05) compared to

controls (Fig. 3-3b).


S 6


E
-E 2
010-
005-


S 0 g CBZ/kg diet
= 3.4 g CBZ/kg diet




b
a


Liver


Figure 3-3. Effects of dietary carbamazepine (CBZ) on the relative abundance of
biotinylated pyruvate carboxylase (PC) (A) and activity of PC (B) in rat liver
and brain. Results are means SD for control (0 g CBZ/kg diet, n=5) and
CBZ-supplemented (3.4 g CBZ/kg diet, n=6) rats. In (A), the relative
abundance is the amount of fluorescence detected using a fluorescent-avidin
blotting method. In (B), PC activity is expressed as nmol oxaloacetate formed
per mg protein per min. Means without a common letter differ, p<0.05.


. 75000-

S. 5 50000-
m 25 0-
25000-


a

b
-j-










As assessed by avidin blotting following in vitro biotinylation of all available

apocarboxylase, hepatic PC protein expression was significantly decreased by

approximately 43% in rats consuming the 3.4 g CBZ/kg diet compared to controls (Fig.

3-4a).


A = 0 g CBZ/kg diet 1 00 B a
5- a = 0 g/kg (in vitro) | 0 g CBZ/kg diet
Ir M 3.4 g CBZ/kg diet l 3.4 g CBZ/kg diet
S 4- M 3.4 g/kg (in vitro) 0 75- b
3- b
n~ 2
U
C0.
1



Figure 3-4. Effects of dietary carbamazepine (CBZ) on hepatic biotinylated pyruvate
carboxylase (PC) before and after in vitro biotinylation (A) and hepatic PC
mRNA determined by real-time PCR normalized to 18S mRNA (B). Results
are means + SD for control (0 g CBZ/kg diet, n=5) and CBZ-supplemented
(3.4 g CBZ/kg diet, n=6) rats. Means without a common letter differ, P<0.01.

At the RNA level, after normalizing the hepatic PC mRNA with beta-actin, PC

mRNA tended to be lower in the drug treated group compared to controls, but the

difference was not significant when analyzed by northern blot (Fig. 3-5).

Real-time quantitative PCR was used to measure PC mRNA. The threshold cycle

(Ct) was determined to be in the linear range of the curve by selecting an optimal Rn

(emission of the fluorescent reporter over the starting background) value in the

exponential phase of the amplification plot for each dilution. The standard curves were

generated by plotting the Ct against the log of the mRNA concentration. A PC

amplification plot for five dilutions of PC and 18S mRNA was used for the standard

curves. The standard curve using the PC probe showed an R2 of 0.999 and a slope of

-3.42, compared to 18S values of 0.999 and -3.53 for R2 and slope, respectively,

indicating a high correlation between the linearity of both assays. Only concentrations of










less than 1 pg/[tL mRNA deviated from the calculated standard curve, indicating that, at

levels this low, quantification was not accurate. PC mRNA expression was significantly

decreased 35% in rats consuming 3.4 g CBZ/kg diet (Fig. 3-4b).


-CBZ +CBZ

..- .... F"wM -actin
0.4-
I-

bl 0.3-
E -.Z
= _E 0.2


0.1

0.0
-CBZ + CBZ

Figure 3-5. Hepatic PC mRNA determined by northern blotting. Results are means + SD
for control (0 g CBZ/kg diet, n=5) and CBZ-supplemented (3.4 g CBZ/kg
diet, n=6) rats.

Discussion

It was shown in Chapter 2 that oral CBZ administration to rats alters biotin

metabolism but not free biotin status. While we observed no changes in serum biotin

concentrations in the present study, we observed alterations in biotin-dependent enzyme

activity, mRNA, and abundance of biotinylated carboxylases. These biochemical

changes in biotin metabolism may occur prior to observed decreases in serum biotin since

it is known that serum biotin is not an early or sensitive indicator of biotin status (129).

Since both the previous study and current study were relatively short term (21-28 d)

compared to the long-term therapy associated with decreased serum biotin in epileptics

(19), our protocols may not have been long enough to encounter biotin deficiency

induced by CBZ administration. It is also noteworthy in light of the data generated in









this study that the dose of CBZ used may have been too low to elicit the full effects seen

clinically. In our previous study, the dose of CBZ yielded a serum CBZ concentration of

approximately 5 tlmol/L (124), which is less than the therapeutic range for both rats and

humans of 17 51 [tmol/L (64,83). In the present experiment, we sought to increase the

oral CBZ intake to result in a serum CBZ level more closely approximating the

therapeutic range. Serum CBZ was approximately 12 [tmol/L, which is still slightly

below the therapeutic range for the treatment of epilepsy; thus, these results still could be

interpreted as conservative in relation to what could occur at higher CBZ doses.

We previously found that oral CBZ administration to rats yields decreased hepatic

abundance of biotinylated PC. Since the relative abundance of biotinylated PC depicts

the holocarboxylase form of the enzyme and not the apocarboxylase, we wanted to

determine whether the decrease was due to a reduction in the biotinylation (therefore the

same concentration of total protein) or a decreased PC protein concentration. By

biotinylating all of the available apocarboxylase form of the enzyme in vitro and then

detecting by avidin-blotting (126), we determined that there was a change in total PC

protein. The decrease in PC protein was confirmed by western blot using a polyclonal

PC antibody (data not shown). To determine whether the decreased protein expression

was due to protein degradation or altered mRNA expression, PC mRNA was quantified

using both northern blotting and real-time PCR. After normalizing PC mRNA for beta-

actin mRNA, there were no significant differences between the drug-treated group and

controls as detected by northern blotting. Real-time PCR, however, showed that CBZ

induced a statistically significant 35% decrease in hepatic PC mRNA in the drug-treated

group after normalizing for 18 S rRNA. Two factors are likely involved that contribute









to the different results between methods, including the possible expression differences in

beta-actin mRNA and 18 S rRNA between drug and control groups as well as the

increased sensitivity and precision of real-time PCR. It is possible that CBZ alters beta-

actin mRNA as well as PC mRNA. It is also true that normalizing for 18 S rRNA should

be more accurate since this accounts for most of the RNA measured by an absorbance

reading at 260 nm, and from that number, equal amounts were loaded in each reaction.

The greater reproducibility of real-time PCR gives credence that there is in fact a

significant decrease in hepatic PC mRNA in the drug-treated group compared to controls.

The 35% decrease in PC mRNA was accompanied by approximately the same magnitude

of decreases found for hepatic PC protein, biotinylation, and activity, which suggests the

decreased mRNA expression was responsible for decreased PC protein and activity.

Furthermore, the decreased PC protein provides an explanation for the decreased

detection ofbiotinylated PC and PC specific activity observed in earlier studies (124).

While the present study only utilized one dose of CBZ, we predict that CBZ decreases PC

protein and mRNA expression in a dose-dependent manner based on results from our

previous study where we found that CBZ decreases biotinylated PC in a dose-dependent

manner (124).

The relative abundance of brain biotinylated PC was also reduced, but not to the

extent that was seen in the liver (decreased 29% in brain compared to 43% in liver). This

is consistent with a protective mechanism in the brain to preferentially maintain biotin

status and biotin-dependent enzyme function compared to other tissues during periods of

biotin deficiency (32,33,60). Biotinidase activity has also been found in previous studies

to be lower in the brain compared to other tissues, which also suggests a slower turnover









of biotinylated proteins in the brain (59). This is supportive of our different results

between brain and liver biocytin concentration and biotinylated PC.

The dietary administration of CBZ increased brain lactate but did not change serum

lactate concentration. Elevated lactate in urine of patients undergoing long-term AED

therapy is observed clinically and may be due to the same mechanism as the elevated

brain lactate. Elevated lactate in the brain is associated with selective neuronal damage

in cerebral ischemia and impaired neurological function (108-110,130) but more recently

it has been argued that lactate may play an important role in nourishing oligodendrocytes

and neurons (131-133). Whether elevated lactate concentration is detrimental to the brain

is debatable, but it should be given some consideration since lactate does not easily cross

the blood-brain barrier and it can act as a toxin in other tissues (49,52). One possible

explanation of elevated lactate is a reduction in PC mRNA leading to decreased PC

protein synthesis and decreased PC activity. PC catalyzes the carboxylation of pyruvate

to form OAA and, as seen in PC deficiencies, decreased PC activity could lead to

elevated lactate since pyruvate can build up and be shunted to alternate pathways,

including lactate (107,134). Although we observed a decrease in hepatic mRNA, PC

protein, and PC activity, there was a 175% increase in brain PC activity in the drug

treated group compared to controls. This was not expected since there was a 30%

decrease in the relative abundance of brain biotinylated PC, which is the active form of

the enzyme. Although the mechanism underlying this discrepancy is not understood at

this time, allosteric activators of PC may be responsible for the increased brain PC

activity and warrants further study. Even though CBZ increased brain PC activity as

measured in vitro and we would not expect lactate accumulation in compartments with









increased PC activity, lactate could be formed in other tissues and transported into the

brain across the blood-brain barrier by the monocarboxylate transporter MCT1 that is

present on vascular endothelial cells (135). In contrast, lactate accumulation in the brain

that is observed in these studies may not be related to PC function per se and this will be

investigated in the studies to follow.

Although it is established clinically that chronic treatment with AEDs including

CBZ is associated with biotin deficiency, the impact on tissue biotin and biotin-

dependent enzymes involved in carbohydrate, lipid, and protein metabolism is less

understood. Metabolic changes of biotin in the brain are of particular importance since

alterations of brain biotin status and subsequent loss of function of biotin dependent

enzymes can contribute to impaired neurological health. The potential protective role of

biotin supplementation during CBZ administration is the next important question that will

be addressed. This characterization will have important clinical significance as biotin

may have future use in the medical management of epilepsy.














CHAPTER 4
PHARMACOLOGICAL BIOTIN SUPPLEMENTATION MAINTAINS BIOTIN
STATUS AND FUNCTION IN RATS ADMINISTERED DIETARY
CARBAMAZEPINE

The previous animal studies presented in Chapters 2 and 3 indicated that 1.5 3.4 g

CBZ/kg diet fed to rats for 21 or 28 d decreased specific enzymatic activity and

abundance of hepatic biotinylated pyruvate carboxylase (PC) (124). An elevation of

brain lactate also accompanied these changes (124), a product that has been shown to

accumulate when PC activity is decreased (107,134,136,137). Decreased PC activity can

lead to an accumulation of pyruvate, which might increase the flux to lactate through

lactate dehydrogenase. If the elevated serum and urine lactate observed in epileptic

patients treated with AEDs (19) and in the brain of rats treated with CBZ (124) is due to

decreased PC activity, then increasing PC activity should decrease lactate concentration.

In previous studies, biotin supplementation to biotin-deficient primary culture

hepatocytes or biotin-deficient chicks increased PC specific enzymatic activity (138,139).

This suggests that biotin supplementation could increase flux from lactate to pyruvate by

increasing PC activity and, therefore, decrease brain lactate in CBZ-treated rats. In this

investigation, we supplemented CBZ-treated rats with a pharmacological dose of biotin to

determine whether biotin supplementation could reduce brain lactate by maintaining

biotin status and activity of biotin-dependent enzymes.









Materials and Methods

Materials

Male Sprague-Dawley rats were obtained from Harlan (Indianapolis, IN). Purified

biotin-free rodent diet based on a modified AIN 76A formulation described previously

was obtained from Research Diets (New Brunswick, NJ)(125). Carbamazepine (CBZ),

5-ethyl-5-p-tolylbarbituric acid, carbamazepine 10,11-epoxide (CBZ-e), d-biotin,

protease inhibitor cocktail, [14C]NaHCO3, reduced P-nicotinamide adenine dinucleotide

(NADH), and o-phenylenediamine dihydrochloride were purchased from Sigma (St.

Louis, MO); avidin-horseradish peroxidase (Avidin-HRP) and avidin-alkaline

phosphatase (Avidin-AP) was purchased from Pierce Chemical Company (Birmingham,

AL); 96-well microtiter plates (Nunc Maxisorb) and bovine serum albumin (BSA) were

purchased from Fisher Scientific (Pittsburgh, PA). Enhanced chemifluorescence (ECF)

reagent was purchased from Amersham-Pharmacia (Picastaway, NJ). Biotinylated BSA

and avidin-AlexaFluor 430 conjugate were synthesized as previously described (97).

Animals and Dietary Treatments

Male Sprague-Dawley rats (n=55), 50-75 g initial weight, were housed individually

in hanging wire-bottom cages in an environmentally controlled room with constant

temperature (220C) and a 12 h light:dark cycle. The rats were acclimatized by feeding a

powdered, egg-white based modification of the AIN 76A diet containing 0.06 mg free

biotin/kg diet (97) described in Chapter 2 for 5 days to standardize their biotin status.

After 5 days of acclimatization, 5 rats were killed and serum, liver, and brain were

collected as described below. The remaining 50 rats were randomly assigned to 2 groups

receiving either 0 g CBZ/kg diet (n=25) or 3.75 g CBZ/kg diet (n=25) for 21 days. Rats

(n=5) from each treatment group were killed on day 26 of the study, and serum, liver, and









brain were collected. Those from the remaining groups were then divided into two

further treatment groups (n=10) receiving either 0.06 mg biotin/kg diet to represent a

physiologic dose of biotin or a pharmacological dose of 6.0 mg biotin/kg diet. After 21 d

(day 47 of the study) of biotin supplementation, 5 rats from each of the 4 groups were

killed and serum, liver, and brain were collected. The remaining 5 rats from each group

were killed 21 d later and serum, liver, and brain were also collected (Fig. 4-1). The

entire study was 68 d. Food intake and body weights were recorded every other day. All

procedures were approved by the University of Florida Animal Care and Use Committee.

55 rats
0.06mg biotin/kg diet 5 d

50 rats U-- > Kill 5 rats

Ar


25 rats
0.06 mg/kg
-CBZ

20 rats
0.06mg/kg 6mg/kg
- CBZ l +CBZ
10 rats 10 rats




5 rats 5 rats


25 rats
0. 06 mg/kg 21d
+ CBZ 4

20rats II = Kill 10 rats
0.06 mg/kg /6mg/kg 21
+CBZ ( +CBZ 2

10 rats 10 rats > Kill 20 rats

21 d


5 rats


5 rats Kill 20 rats


Figure 4-1. Experimental protocol.

Sample Preparation

On days 5, 26, 47, and 68, rats were anesthetized with halothane and killed by

cardiac puncture and exsanguination. Whole blood was allowed to coagulate for 30 min,









and then centrifuged at 10,000 x g for 5 min to separate serum. Whole brain was

removed and homogenized in 10 volumes of ice-cold HEM homogenization buffer (30

mmol/L HEPES, pH 7.2, 1 mmol/L EDTA, 300 mmol/L mannitol, and protease inhibitor

cocktail). The left lobe of the liver was divided into 5 sections and all samples were

immediately frozen in liquid nitrogen and stored at -800C until needed. For protein

assays and metabolite analysis, a frozen liver portion was thawed and homogenized in 10

volumes of ice-cold HEM. A portion of each homogenate was saved for protein analysis

and the remainder was centrifuged at 200,000 x g for 30 min at 40C to collect the soluble

fraction for measurement ofbiotin, biotin metabolites, and CBZ. All samples were

immediately frozen in liquid nitrogen and stored at -800C until assayed.

Pyruvate Carboxylase and Acetyl CoA Carboxylase Activity Assays

PC activity in brain and liver was determined using a method previously described

(102) with slight modifications (124). For the experiment to determine whether NADH is

an activator of PC activity, the reaction mixture was similar to the modified method

(124), except 0 2.5 mmol/L NADH was added. Background activity was determined

by omitting pyruvate from the reaction mixture. Specific enzymatic activity for PC was

expressed as nmol OAA formed-mg protein- min-.

ACC activity was determined using a method described by Thampy et al. (140)

with minor modifications. Briefly, frozen liver was homogenized in 10 volumes of

homogenization buffer (50 mmol/L potassium phosphate, pH 7.4, 10 mmol/L

ethylenediaminetetraacetic acid, 2 mmol/L dithiothreitol, protease inhibitors) using a

Polytron homogenizer. To measure activity, each tube contained 0.1 mg of either liver or

brain homogenate, along with a mixture consisting of 50 mmol/L potassium phosphate,









pH 7.4, 2.5 mmol/L MgCl2, 2 mmol/L dithiothreitol, 1.17 mmol/L acetyl CoA, 4 mmol/L

ATP, 12.5 mmol/L [14C] NaHCO3 (specific activity 40.7 MBq/mmol), 0.75 mg/ml bovine

serum albumin, and 10 mmol/L citrate in a final volume of 0.15 mL. After 15 min at

37C, the reaction was terminated by adding 0.05 mL 200 g/L trichloroacetic acid (TCA),

and the precipitated protein was sedimented by centrifugation at 13,000 x g for 5 min.

The supernatant was transferred to a scintillation vial and 0.1 mL of 100 g/L TCA was

added to wash the protein pellet. After centrifugation (13,000 x g, 5 min), the

supernatant was combined with the initial extract. Pooled supernatants were dried under

a stream of nitrogen at 650C for 30 min and dissolved in 0.5 mL distilled water.

Scintillation cocktail (5 mL) was added to each vial and the samples were counted by

liquid scintillation counting. Specific enzymatic activity for ACC was expressed as pmol

malonyl CoA formed-mg protein-l min-.

Detection of Biotinylated Biotin-Dependent Carboxylases

The five biotin-dependent carboxylases, ACC1, ACC2, PC, PCC, and MCC were

detected using the avidin-blotting technique described previously in Chapter 2 (97).

Measurement of Metabolites

The measurement of biotin and its metabolites in serum, liver, and brain was

performed using a coupled HPLC/competitive binding assay (97,99). Serum, liver, brain,

and dietary CBZ were measured using a method previously described (100) with slight

modifications (124).

NADH was measured using a method described by Uppal and Gupta (141).

Briefly, 100 ptL brain homogenate (as prepared above) was added to tubes containing 2

mL alcoholic 0.5 mol/L KOH [prepared by dissolving KOH in a mixture of









ethanol/doubly distilled water (1:1, v/v)] preheated in a heating block at 700C. The tubes

were immediately capped, heated for 60 s, and then quickly cooled on ice for 10 min.

Then the extract, which contained both mitochondrial and cytosolic NADH, was

neutralized with triethanolamine-HCl phosphate (0.5 mol/L triethanolamine-HC1, 0.4

mol/L KH2PO4, 0.1 mol/L K2HPO4) to pH 7.8 and kept at 370C for 20 min. After

incubation, the extract was centrifuged at 30,000 x g for 10 min and the supernatant was

collected. Spectrophotometric measurements at 340 nm were recorded upon mixing 2

mL extract with 5 p.L 1 mol/L pyruvate. Then 5 ptL 0.5 mg/mL lactate dehydrogenase

(D-lactate dehydrogenase from Lactobacillus leichmannii, 270 units activity/mg, Sigma

Chemical, St. Louis, MO, prepared by diluting stock with 2.1 mol/L ammonium sulfate)

was added to the cuvette, mixed, and incubated for 3 min prior to reading the final

absorbance at 340 nm. NADH concentration from brain samples was determined by

extrapolation from a standard curve with known NADH concentrations.

Serum and tissue lactate concentrations were measured using a kit based on

spectrophotometric endpoint method of measuring NADH (Sigma Diagnostics, St. Louis,

MO).

Statistical Analysis

Results are expressed as means + SD. Differences in concentrations of biotin and

biotin metabolites among treatments were tested using a Student's t-test on day 26 (2

treatment groups), and a 2-way ANOVA for data from days 47 and 68 (with biotin intake

and CBZ exposure as main factors). Data for biotinylated carboxylases and lactate from

day 68 of the study were tested using a 2-way ANOVA. Comparisons of CBZ

concentrations between control and biotin-supplemented groups were conducted using a









Student's t-test. In all statistical procedures, a difference was considered significant at

p<0.05. Homogeneity of variance was routinely verified and no data transformation was

necessary for these experiments.

Results

Concentration of CBZ in the Diet, Serum, Liver and Brain

Analysis of the diet containing CBZ revealed 3.75 g CBZ/kg diet, which confirmed

the accuracy of diet formulation. Brain, serum, and liver CBZ concentrations were

determined on day 68 of the experiment (42 d after starting biotin supplementation in 2

groups). Biotin supplementation did not alter brain CBZ (46 2.4 and 44 5.3 nmol/g

for rats consuming 0.06 or 6.0 mg biotin/kg diet, respectively), liver CBZ (53 0.7 and

54 0.7 nmol/g for rats consuming 0.06 or 6.0 mg biotin/kg diet, respectively), or serum

CBZ (1.5 0.4 and 1.2 0.3 [tmol/L for rats consuming 0.06 or 6.0 mg biotin/kg diet,

respectively).

Effect of CBZ on Metabolites

Brain, serum, and liver lactate concentrations were determined on day 68 of the

study. CBZ administration was associated with greater lactate concentrations in both

serum and brain in rats consuming 0.06 mg biotin/kg diet (p<0.05). Biotin

supplementation (6.0 mg biotin/kg diet) in CBZ-treated rats effectively prevented the

increase of lactate in serum and brain as seen in Fig. 4-2 (p<0.05).

CBZ reduced serum biotin by 60% compared to controls (p<0.05) after day 47, but

biotin supplementation maintained serum biotin concentration in these rats (Fig. 4-3a).

Biotin-supplementation increased serum biotin concentration in both control and CBZ-







61


treated group, but serum biotin in the CBZ-treated group that was biotin-supplemented

was only increased to 17% of the biotin supplemented control rats (61 + 20 versus


b
a a 6 mg biotin/kg
1.5- Aa a 30 B 6mg biotm/kg
E a E b
E







5--
E 50- 20-

_~ a
; a a a
E 2-B 105- CBZi


-CBZ +CBZ -CBZ +CBZ
15-


L 10-


5


-CBZ +CBZ
Figure 4-2. Effect of dietary carbamazepine (CBZ) on (A) serum, (B) brain, and (C) liver
lactate in rats after 68 d. Results are means SD for controls and CBZ-
treated rats (n=5/group). Means without a common letter differ, p<0.05.

350 143 nmol/L, respectively, p<0.05). CBZ treatment did not alter brain biotin

concentration (Fig. 4-3b). Biotin supplementation increased brain biotin concentration in

both groups; however, the elevation was 12% less in the CBZ-treated group compared to

the control group on day 68 (Fig. 4-3c). Hepatic biotin was reduced in CBZ-treated rats

by approximately 50% compared to controls (p<0.05) (Fig. 4-3c), while biotin

supplementation prevented the decrease of free hepatic biotin concentration in these rats.

Effects of both CBZ and biotin intake were observed on concentrations of the biotin

catabolites in serum and tissues. Biotin supplementation increased serum BSO

concentration similarly in both controls and CBZ-treated groups, but CBZ alone had no










A B
1000- 0O 06 mg/kg -CBZ b 75 b
I 6 mg/kg -CBZ b
S0 06 mg/kg + CBZ
E ^ 0 6 mgkg + CBZ d
c 100- 5. 0-
a a c

E 10- 1 25- a
a a


5 26 47 68 5 26 47 68
Time, d Time, d

Sb
E d
.L 50-
Ci a
25-



5 26 47 68
Time, d
Figure 4-3. Effect of dietary carbamazepine (CBZ) on biotin concentrations in (A)
serum, (B) brain, and (C) liver in rats on day 68 of the study. Results are
means + SD, n=5. Means without a common letter at each time point differ,
p<0.05.

effect (Fig. 4-4a). CBZ increased hepatic BSO approximately 123% compared to

controls on day 47 but there was no difference observed on day 68. Biotin

supplementation also increased hepatic BSO in both groups (Fig. 4-4b). Brain BSO was

reduced 40% in CBZ-treated rats on day 26 (p<0.05) but was not different from control

values on days 47 and 68 (Fig. 4-4c).

CBZ increased serum BNB 27% on day 26, 163% on day 47, and 410% on day 68

(Fig. 4-5a). Biotin supplementation also elevated serum BNB in both groups where, on

day 68, CBZ-treated rats had serum BNB concentration equal to biotin supplemented

control and CBZ-treated rats. Hepatic BNB was elevated 89% in CBZ-treated rats on

day 68 and biotin supplementation similarly elevated hepatic BNB in control and CBZ-

treated rats (Fig. 4-5b). CBZ administration significantly increased brain BNB by 75%






63


and 45% on days 47 and 68, respectively, to approximately the same brain BNB

concentration as both biotin-supplemented groups (Fig. 4-5c).



A b B
3- 30-
006 mg/kg -CBZ
Sb 6 6 mg/kg -CBZ
Sb 0 0.06 mg/kg + CBZ
C2C
c 2- E 20- ZZ 6 mg/kg + CBZ
c d b b c
E a a
1 I10 cI a
a

5.0 26.0 47.0 68.0 5.0 26.0 47.0 68.0
Time, d Time, d


Sa


V..2 1 J i r ab


50 260 470 680
Time, d
Figure 4-4. Effect of dietary carbamazepine (CBZ) on biotin sulfoxide (BSO)
concentration in (A) serum, (B) liver, and (C) brain in rats on day 68 of the
study. Results are means + SD, n=5. Means without a common letter at each
time point differ, p<0.05.

Biotin supplementation increased serum biocytin 146% in control rats but only

116% in CBZ-treated rats (Fig. 4-6a). CBZ had no effect on hepatic or brain biocytin

(Fig. 4-6b, 4-6c).

CBZ had no effect on the abundance of hepatic biotinylated MCC or PCC;

however, the drug significantly decreased hepatic biotinylated ACC 1, ACC2, and PC by

approximately 33%, 60%, and 43%, respectively (Fig. 4-7). Biotin supplementation

prevented the decrease of hepatic biotinylated ACC1 and ACC2 (Fig. 4-7). All biotin-

dependent carboxylases in brain were significantly decreased by CBZ (31%, 42%, 43%,










and 43% for PC, MCC, PCC, and ACC1, respectively, p<0.05) but only decreased

biotinylated ACC 1 was prevented by biotin supplementation (Fig. 4-7).

15- A b 40 B
I0 0.06 mg/kg -CBZ
b b $ 6 mg/kg -CBZ
0b b b
E30- 0 0.06 mg/kg + CBZ b b
c 10- E iEzz 6 mg/kg + CBZ





5.0 26.0 47.0 68.0 5.0 26.0 47.0 68.0
Time, d Time, d
i15- C
CC
0 b

E 10- b bc






Time, d
Figure 4-5. Effect of dietary carbamazepine (CBZ) on bisnorbiotin (BNB) concentration
in (A) serum, (B) liver, and (C) brain in rats on day 68 of the study. Results
are means SD, n=5. Means without a common letter at each time point
differ, p<0.05.

CBZ significantly reduced hepatic ACC (both ACC isoforms) specific enzymatic

activity 30% in rats consuming 0.06 mg biotin/kg diet but not in rats consuming 6.0 mg

biotin/kg diet (p<0.05, Fig. 4-8a). Brain ACC specific enzymatic activity was

significantly decreased 48% in CBZ-treated rats consuming 0.06 mg biotin/kg diet

compared to controls (Fig. 4-8b, 73 15 versus 39 13 pmol malonyl CoA formed-mg

protein-'min', respectively, p<0.05). The biotin supplemented group (6.0 mg biotin/kg

diet) exhibited higher brain ACC activity in CBZ-treated rats compared to CBZ-treated

rats consuming 0.06 mg biotin/kg diet (Fig. 4-8b, p<0.05). Hepatic specific enzymatic

activity of PC was reduced by CBZ and but the decrease was prevented by biotin

supplementation (Fig. 4-9a). The increase in PC activity due to biotin supplementation is










A B m 0 06 mg/kg -CBZ
100- b 7.5- 6 mg/kg -CBZ
O 0 06 mg/kg + CBZ
E C E 6 mg/kg + CBZ
i c I
075-






50 26 0 47 0 68 0 5.0 26.0 47.0 68.0
Time, d Time, d
100 C


725-



25
o00000





50 260 470 680
Time, d

Figure 4-6. Effect of dietary carbamazepine (CBZ) on biocytin concentrations in (A)
serum, (B) liver, and (C) brain in rats on day 68 of the study. Results are
means + SD, n=5. Means without a common letter at each time point differ,
p<0.05.

not limited to rats consuming CBZ, since it was also found that biotin supplementation

increased PC activity in control rats consuming 0.06 mg biotin/kg diet (p<0.05). Relative

to non-supplemented controls, biotin supplementation only increased PC activity in CBZ-

treated rats by 16% compared to a 30% increase in activity of rats not consuming CBZ

(Fig. 9, p<0.05). A similar relationship was observed for brain (Fig. 4-9b). The 48%

decrease in brain PC activity induced by CBZ was prevented by biotin supplementation

(Fig. 4-9b, p<0.05).

Effect of NADH on Hepatic PC Activity

In order to determine the mechanism by which PC activity increased in brain and

liver following biotin supplementation in the CBZ-treated rats, it was hypothesized that

there are activators of PC besides the Mg2+ and acetyl CoA already accounted for in the

activity assay. Elevated brain NADH would likely accompany decreased lactate. Since











200-
.4-
0
8 0
0o a
U42z aa a aa
l r 100- I I

X I
0- bI bf HI
CU C 11MV] H
hrH


ACC1 ACC2


PC MCC PCC


Liver


S 0 06 mg/kg CBZ
S6 mg/kg CBZ
0 06 mg/kg + CBZ
S6 mg/kg + CBZ

a a a
a c
bb a a b
bb b b



PC MCC PCC ACC1
Brain


Figure 4-7. Effect of dietary carbamazepine (CBZ) and biotin supplementation on the
relative abundance of biotinylated biotin-dependent enzymes in rat liver and
brain. Results (means SD, n=5) are expressed as a percentage of the control
group (0.06 mg biotin/kg diet CBZ). Means for each carboxylase without a
common letter differ, p<0.05.


m E i


,i CI


>
fE
0V
0 '0


m


S 0 06 mg/kg
6 0 mgkg
a


-CBZ +CBZ -CBZ +CBZ
Figure 4-8. Acetyl CoA carboxylase (ACC) specific enzymatic activity in (A) liver and
(B) brain on day 68 of the study. Results (means + SD, n=5) are expressed as
pmol malonyl CoA formed-mg-l-min1. Means for each activity without a
common letter differ, p<0.05.


U
-o
(L
U 0
ii


= E


05-
'`7 04-
M 03-
r 02-
i E
-CO ni


0 06 mg/kg
6 0 mg/kg
a



Tl


a


-CBZ +CBZ -CBZ +CBZ
Figure 4-9. Pyruvate carboxylase (PC) specific enzymatic activity in (A) liver and (B)
brain on day 68 of the study. Results (means + SD, n=5) are expressed as
nmol oxaloacetate formed-mg protein-' min'. Means for each activity without
a common letter differ, p<0.05.







67


biotin supplementation prevents the increase in brain lactate and therefore maintains

NADH concentration, the possibility of NADH being an activator of PC was studied.

Using crude liver homogenates, we observed that NADH activates hepatic PC in both

control and CBZ-treated rats. The addition of NADH to the reaction mixture brought

hepatic PC concentration from CBZ-treated rats to equal hepatic PC activity from control

rats having no added NADH (Fig. 4-10).


-o 10-

BEE

5-


* Control
o CBZ


NADH, mmol/L
Figure 4-10. Activation of pyruvate carboxylase (PC) specific enzymatic activity by
NADH in vitro using crude homogenate. PC specific enzymatic activity was
determined in rat liver homogenate with 0-2.5 mmol/L NADH added to the
reaction mixture for control and carbamazepine (CBZ)-treated rats.


-0)


I-
=L


u.u
Control + CBZ + CBZ + Biotin
Figure 4-11. Effects of carbamazepine (CBZ) and biotin supplementation on brain
NADH concentrations of rats on day 68 of the study. Results (means + SD,
n=5) are expressed as [tmol NADH/g wet brain weight. Means for each bar
without a common letter differ, p<0.05.

NADH concentration was significantly lower in the brain of rats consuming 3.75 g

CBZ/kg diet (Fig. 4-11). Biotin supplementation (6 mg/kg diet) partially prevented the









decrease of brain NADH concentration in CBZ-treated rats to a range similar to that of

controls.

Discussion

We investigated whether biotin supplementation could alleviate the antagonistic

effects of CBZ on biotin status and function observed clinically. Clinical studies show

that over 80% of epileptics undergoing long-term AED therapy exhibit some degree of

biotin deficiency (90) but there are no animal studies that have been conducted regarding

this phenomenon. Previous studies presented in Chapters 2 and 3 examined this effect,

but showed no changes in serum, liver, or brain free biotin in rats after consuming CBZ

for 21 or 28 d (124). In the present report, there was also no change in free biotin in these

tissues after 26 d; however, CBZ significantly decreased serum and liver free biotin after

day 47 and continued through day 68 d of the study. The observation that changes in

biotin status were seen only after > 21 d of CBZ administration in this study supports the

human clinical data where changes in biotin status were observed in epileptics

undergoing long-term therapy (19).

In the present study, biotin and CBZ were incorporated into the diet, and therefore,

they were consumed simultaneously. This is a clinically relevant design since taking

CBZ with meals is recommended to patients. Since biotin and CBZ were consumed

together, this provided the greatest chance for the pharmacological dose of biotin to affect

CBZ uptake in the intestine. In view of other studies finding that CBZ competitively

inhibits biotin uptake in the intestine (66), there was a possibility that excess biotin may

likewise inhibit CBZ uptake. Our results do not support this possibility since CBZ

concentrations in serum, brain, and liver were unaltered by biotin supplementation.









To determine whether elevated brain lactate during CBZ administration in rats

(124) was due to decreased biotin status and PC activity, lactate was measured after

biotin supplementation in rats administered 3.75 g CBZ/kg diet for 68 d. Serum and

brain lactate were elevated approximately 15 and 100%, respectively, in rats consuming

CBZ compared to controls, and supplementation with a pharmacological concentration of

biotin (6 mg/kg diet) prevented this elevation. The elevation of brain lactate was -10

fold higher than the increase found in our previous study where rats consumed 2.9 g

CBZ/kg diet for 21 d. Not only did biotin supplementation in this present study prevent

elevated brain and serum lactate in the drug-treated group, it did this without altering

CBZ concentrations. This is striking evidence that decreased biotin status may, in fact,

be related to elevated lactate in clinical (19) and animal studies (124) and that biotin

supplementation can reduce lactate concentration.

In CBZ-treated rats, the abundance of biotinylated ACC and PC were decreased in

brain and liver. As expected, specific enzymatic activities of these carboxylases also

were decreased in CBZ-treated rats since the biotinylated form is the active form of the

enzyme. Biotin supplementation maintained the abundance of biotinylated ACC in these

tissues; however, the abundance of biotinylated PC in brain and liver remained decreased.

Biotin supplementation prevented the CBZ-induced decrease of both ACC and PC

specific enzymatic activity. The likely mechanism for decreased ACC specific activity

involves decreased biotin nutritional status, which led to under-biotinylation of all

available ACC. Biotin supplementation increased the pool of free biotin available to

biotinylate any remaining apo-ACC and, therefore, increased the amount of the active

form of the enzyme. The mechanism is not as easily explained for the elevated brain and









hepatic PC specific enzymatic activity following biotin supplementation since the

abundance of biotinylated PC remained decreased. Whereas the precise mechanism of

increased PC activity without changes in biotinylated PC is not known, changes in the

concentration of an activator of PC could explain this phenomenon.

Since biotin supplementation decreased lactate concentration in CBZ-treated rats to

concentrations similar to control rats, it plausible that flux from lactate to pyruvate was

increased or it was excreted from the body. Since lactate does not easily cross the blood-

brain barrier, it is likely that lactate in the brain was at least partially shunted back to

form pyruvate, a pathway that also involves the formation of NADH. In in vitro analysis,

NADH maximally increased PC specific activities 350 and 170% in drug-treated and

control groups, respectively, compared to PC activity when measured with no NADH in

the reaction mixture (Fig. 4-9). We have purified rat liver PC and the kinetics of NADH

activation are characterized in Chapter 5. Along with this activation data, the observation

that CBZ decreased brain NADH and biotin supplementation prevented the decrease (Fig.

4-10) supports the hypothesis that higher NADH levels in CBZ-treated rats supplemented

with biotin compared to CBZ-treated rats could account for the increased PC activity.

The precise mechanism of action of anti-convulsant properties of CBZ is not

completely known, but there is evidence showing it may enhance sodium channel

inactivation (71). This stabilizes neuronal membranes pre- and postsynaptically by

reducing high-frequency repetitive firing of action potentials or by slowing synaptic

transmission (71). Another proposed mechanism is the blocking of N-methyl-D-aspartate

(NMDA) receptor mediated events (73). NMDA is a glutamate receptor with

involvement in seizure generation. It must be considered whether decreased biotin status









contributes to the mechanism of action of the drug. Decreased function of biotin-

dependent carboxylases, particularly PC, could result in higher cerebral concentrations of

carbon dioxide, which has been shown to raise seizure threshold (142,143). Likewise,

excessive carbon dioxide concentrations can induce seizures (144) and, therefore, could

account for seizures unresponsive to CBZ. Decreased biotin status and PC activity in the

brain could also lead to decreased concentration of OAA, which is an essential precursor

for de novo synthesis of aspartate, an excitatory neurotransmitter. One study found a

modest decrease in brain aspartate concentration following phenytoin treatment in rats

(145). Further research is needed to determine precisely whether biotin deficiency during

CBZ therapy is involved in the mechanism of action of the drug. If it is not involved in

the mechanism of action, then it seems possible that maintaining biotin status during CBZ

therapy could prevent some of the side effects that some 50% of patients on CBZ

experience (71).

The protective role of biotin supplementation during CBZ administration on biotin

status and biotin-dependent enzyme function was demonstrated in this investigation.

This characterization could serve as groundwork for future studies to determine whether

biotin supplementation should be included as a concurrent strategy in the medical

management of epilepsy.














CHAPTER 5
CHARACTERIZATION OF PYRUVATE CARBOXYLASE ACTIVATION BY
NADH

Pyruvate carboxylase (PC) [EC 6.4.1.1] is a mitochondrial enzyme that catalyzes

the formation of OAA from pyruvate and HCO3-, with concomitant ATP cleavage (146).

The active site of PC consists of two separate subsites with biotin acting as a mobile 1-

carbon carrier that is carboxylated at one subsite upon cleavage of ATP and then transfers

the carboxyl group to the second subsite where pyruvate is carboxylated to form OAA

(147,148). The synthesis of OAA provides a substrate for gluconeogenesis and it also

replenishes tricarboxylic acid cycle intermediates used for amino acid and fatty acid

synthesis.

Both PC activity and the association state of the enzyme are regulated by several

factors, including various activators and the dependence of association state on enzyme

concentration. Studies have shown that upon decreasing PC enzyme concentration in

vitro, there is dissociation of the catalytically active tetrameric enzyme into inactive

dimers and, hence, loss of PC activity (149). It was also found that ATP, Mg2+, and

acetyl CoA can shift the equilibrium back to the tetrameric form to reactivate the enzyme

(149). PC shows a dependence on acetyl CoA in certain species and also requires Mg2+

for activity (150-153). PC mRNA expression is regulated by insulin, glucagon, and

glucocorticoid concentrations during gluconeogenesis and lipogenesis (154-156). Siess

et al. first suggested that mitochondrial NADH supply might be a factor in the regulation

of PC activity (157). They found that NADH concentrations were elevated after PC









activation by 3-hydroxybutyrate in in vitro studies (157), which suggests that the

activation could be due to the increase in NADH concentration. Whether NADH exerts a

direct regulatory effect on PC activity has not been previously investigated.

We have demonstrated in Chapter 4 that NADH activates hepatic PC in a crude rat

liver homogenate. The mechanism of activation is currently not known. In addition, it is

not known whether other components of the homogenate contributed to the activation,

including the possibility of oxidation of NADH to NAD+. In this chapter, we present

data showing that NADH is an activator of purified PC at high concentrations in vitro.

We also report data regarding the influence of NADH on the kinetic constants for the

different substrates from which we formulate a mechanistic hypothesis.

Experimental Procedures

Materials

Male Sprague-Dawley rats were obtained from Harlan (Indianapolis, IN) and fed a

standard rodent diet. D-biotin, protease inhibitor cocktail, [14C]NaHCO3, reduced 3-

nicotinamide adenine dinucleotide (NADH), P-nicotinamide adenine dinucleotide

(NAD ), P-nicotinamide adenine dinucleotide phosphate (NADP ), reduced 3-

nicotinamide adenine dinucleotide phosphate (NADPH), and Sephacryl S200 were

purchased from Sigma (St. Louis, MO); 4-(2-hydroxyethyl)-1-piperazineethanesulfonic

acid (HEPES) and ethylenediaminetetraacetic acid (EDTA) were purchased from Fisher

Scientific (Pittsburgh, PA); an ImmunoPure monomeric avidin column was purchased

from Pierce (Rockford, IL). Avidin-AlexaFluor 430 conjugate was synthesized as

previously described (97). Polyvinyldifluoride (Immobilon-P) was obtained from









Millipore Corporation (Bedford, MA). All other chemicals used were analytical grade

and of the highest purity available.

Purification of Pyruvate Carboxylase

PC was purified using a method adapted from Oei and Robinson (158). Rat liver

obtained immediately after killing of the animals by exsanguination was minced into

pieces and frozen in liquid nitrogen until use. Approximately 16 g was thawed and

homogenized in 20 mL HEM buffer on ice (30 mmol/L HEPES, pH 7.2, 1 mmol/L

EDTA, 300 mmol/L mannitol, and protease inhibitor cocktail) for 1 min using a Polytron

homogenizer (Brinkman Instruments, Westbury, NY). The homogenate was centrifuged

at 200,000 x g at 40C for 30 min, and the soluble fraction recovered was immediately

applied to an ImmunoPure monomeric avidin column (Pierce, Rockford, IL) at 40C.

Prior to application of the protein, the column was first washed with 6 mol/L guanidine-

HC1, 0.2 mol/L KC1 (pH 1.5) and then equilibrated with running buffer comprised of 0.1

mol/L Tris-HCl (pH 7.4), 1 mmol/L EDTA, 0.1 mmol/L dithiothreitol, 5% (v/v) glycerol

(Buffer A). The column was washed with 2 mmol/L biotin in the running buffer to

saturate biotin-binding sites and washed with 10 column volumes of 0.1 mol/L glycine-

HC1 (pH 2.8) to remove exchangeable biotin. After reequilibration with running buffer,

the soluble protein fraction was applied to the column and non-biotinylated proteins were

eluted with 10 volumes of Buffer A. After A280 was < 0.05, biotinylated proteins were

eluted with 2 mmol/L biotin in Buffer A. Fractions containing PC activity were pooled

and directly applied to a Sephacryl S200 column equilibrated with Buffer A. PC activity

was measured in collected fractions, and those containing the majority of the activity

were pooled. PC activity was also assayed at each step during the purification procedure.









Purity was determined by SDS-PAGE analysis using 8% w/v total acrylamide followed

by an avidin-western blot (124).

Rat liver PC was also purified using the above method for the experiment testing

whether physiological NADH concentrations activate PC in vitro.

Pyruvate Carboxylase Activity Assay

PC activity was determined as described previously (124). Activity assays were

conducted under conditions that allowed measurement of initial rate, and activity was a

linear function of enzyme concentration. Protein concentration was determined by the

method of Markwell et al. (101).

All of the kinetic data presented in this paper were obtained using the purified PC.

Various concentrations of NADH were added to the activity assay reaction mixture (0,

1.25, and 2.5, mmol/L) to evaluate the effects of NADH on PC activity with no

preincubation. In order to determine whether other pyridine nucleotides affect PC

activity, a similar experiment was performed with the addition of 5 mmol/L NAD+,

NADPH, or NADP+ added to the reaction mixture. Km and Vmax values were calculated

from saturation curves of velocity versus concentration of each substrate (pyruvate, ATP,

or HCO3-) by nonlinear regression using GraphPad Prism Enzyme Kinetics Software

(GraphPad Software, Inc. San Diego, CA). For these experiments, the non-variable

substrates were saturating concentrations (3.14 mmol/L ATP, 4 mmol/L HCO3-, and 7.5

mmol/L pyruvate).

Results

Pyruvate Carboxylase Purification

Avidin-affinity chromatography successfully isolated biotin-dependent enzymes,

which were then applied to a size-exclusion column to purify PC. PC activity was eluted






76


approximately with the void volume of the Sephacryl S200 column. Approximately 14%

of initial PC activity was recovered after the last purification step, and this yielded a 270-

fold purification (Table 5-1).

Table 5-1. Purification table for rat liver pyruvate carboxylase (PC).
Activity Specific activity Recovery of Purification
Protein (mg) vol (ml) (nmol/min) (nmol/min/mg) activity (%) (-fold)
Homogenate 1900 24 17000 9.2 100 1.0
Cytosol 490 7 7100 15 42.0 1.6
Post-Avidin column 6.0 8 2500 420 14.0 45
Post-Sephacryl S200 1.0 4 2400 2500 14.0 270
The amido stained gel and avidin-western blot (Fig. 5-la & b) revealed that other

biotin-dependent carboxylases were present in the avidin column eluant but they were not

present in the Sephacryl S200 elution fraction containing PC activity.

MW (kDa)


wc-


A t



E, "' "' I


I -116
MOM 97










-MCC
:**-pc


Figure 5-1. Amido-stained proteins following SDS-PAGE (8% w/v total acrylamide) (A)
and avidin-westem blot following PC purification (B). For both blots: lane 1,
liver homogenate; lane 2, 200,000 x g supernatant; lane 3, post-avidin column;
lane 4, post Sephacryl S200 column; lane 5 (A only), protein MW standards.
Equal volumes of sample were applied to each lane. Pyruvate carboxylase,
PC; methylcrotonyl CoA carboxylase, MCC; propionyl CoA carboxylase,
PCC.


: -~l C' T. OWN ~






77


Kinetic Constants

Regardless of the concentration of NADH (0, 2.5 and 5 mmol/L) in the reaction

mixture, PC obeyed Michaelis-Menten kinetics (Fig. 5-2). The Hill coefficient was

determined to be 0.89 + 0.1, which suggests that NADH does not bind PC cooperatively.















rr

cuE















OC.
cE




rr


c

E


0 1 2 3 4
HCO3, mmol/L


0 1 2 3 4


ATP, mmol/L


C,
cu E
- 'c


E
r -*


0 2 4 6 8
Pyruvate, mmol/L

Figure 5-2. Effect of NADH concentration on the kinetics of pyruvate carboxylation by
pyruvate carboxylase (PC) using variable HCO3- with 3.14 mmol/L ATP and
7.5 mmol/L pyruvate(A), variable ATP with 4 mmol/L HCO3- and 7.5 mmol/L
pyruvate (B), and variable pyruvate with 3.14 mmol/L ATP and 4 mmol/L
HCO3- (C). Each data point represents means from two independent assays
with duplicate samples for each assay.










NADH altered Michaelis-Menten kinetic constants for the three substrates for the

enzyme. Increasing concentrations of NADH increased Vmax of PC for pyruvate (Table

5-2). NADH increased Vmax 62 and 21% for PC with both ATP and HC03-, respectively.

The Km for these substrates was reduced 29 and 31 % for ATP and HC03-, respectively,

upon the addition of 2.5 mmol/L NADH to the reaction mixture.

Table 5-2. Effects of increasing NADH concentrations on Michaelis-Menten kinetics for
various substrates for pyruvate carboxylase (PC).
0 NADH 1.25 mM NADH 2.5 mM NADH
HC03-
Km (mmol/L) 1.5 0.26 0.93 0.09 1.0 + 0.09
ATP
Km (mmol/L) 0.77 0.20 0.55 0.12 0.55 + 0.15
Pyruvate
Km (mmol/L) 0.40 + 0.07 0.50 + 0.05 0.50 + 0.08

Since the conditions of this activity assay do not constitute an oxidizing

environment (124), it is not likely that NADH is being converted to NAD+ in the reaction

mixture. However, to determine unambiguously whether PC activation is specific for

NADH, other pyridine nucleotides were also tested (NAD+, NADP and NADPH).

These compounds did not activate PC, but instead decreased activity with increasing

concentrations (Fig. 5-3).

Unlike the effects observed with PC from crude liver homogenate seen in Chapter

4, physiological concentrations of NADH (0.05-0.30 mmol/L) did not activate purified

PC (Fig. 5-4).

Discussion

There is reason to believe that physiological and pharmacological concentrations of

NADH activate PC activity based on our preliminary studies using unpurified PC in

Chapter 4. In order to determine explicitly whether NADH is an activator of PC specific











enzymatic activity, PC from rat liver was purified. We found that pharmacological

concentrations of NADH alter Michaelis-Menten kinetic constants for pyruvate, ATP,

and HCO3-, which indicates that pharmacological concentrations of NADH are capable of

regulating PC activity. Because NADP NAD+, and NADPH did not activate PC and

actually suppressed PC activity, we conclude that NADH is a specific activator for PC.


1500-


-e
E 1000-
t E

SE 500-
aE 500-


* NADH
* NAD
o NADP
o NADPH


0 5 10 15 20 25
mmol/L

Figure 5-3. Purified rat liver pyruvate carboxylase (PC) specific enzymatic activity
determined with and without 5 mmol/L NADH, NAD NADP or NADPH
added to the reaction mixture. Each data point represents means from two
independent assays with duplicate samples for each assay.

1200-

S 1100-
C E

,r- 1000-

0 900-

800-

700 I
0.00 0.13 0.26 1 2 3 4 5

NADH, mmol/L

Figure 5-4. Physiological and pharmacological NADH effects on specific enzymatic
activity of purified pyruvate carboxylase (PC).

Data from Chapter 4 indicate that physiological concentrations of NADH also activate

PC, which suggests that cellular NADH concentration may regulate PC activity. We did









not find this to be the case, however, with purified PC in vitro. At physiological

concentrations of NADH (0.05-0.30), there was no change in PC specific enzymatic

activity. The fact that PC from the crude homogenate and the purified PC do not behave

similarly suggests that there is an unknown factor in the crude homogenate that is

responsible for the activation. It is possible that the endogenous NADH in the crude

homogenate may also have an effect on PC.

The reaction catalyzed by PC is a sum of two partial reactions that occur at

different sites on the enzyme (147,148). The valeric acid side chain of biotin is

covalently bound to a specific lysine residue 35 amino acids from the C-terminus of the

enzyme (159) and the long chain can act as a hinge to allow for the carboxylated biotin

molecule to move from one reaction site to the next. In the first reaction site, biotin is

carboxylated and ATP is concurrently hydrolyzed. Carboxylated biotin is then shifted to

the second reaction site where the 1-carbon unit is transferred to pyruvate to form OAA.

Since the decrease in Km was specific for ATP and HCO3- but not pyruvate, we can

speculate that NADH is acting at the site where biotin is carboxylated in the first partial

reaction. While the 3-dimensional structure of PC has not been fully determined, there

may be a region present that resembles a Rossmann fold that is a common binding site for

enzymes requiring nucleotide binding for activity (160). The ATP/HCO3- binding

domain (site of first partial reaction) of yeast PC is between amino acids 157 and 468,

while the pyruvate binding domain (site of second partial reaction) is between amino

acids 559 and 913. A conserved motif among proteins with a Rossmann fold is KMSKS,

and the closest match in the PC sequence is between amino acids 442-446 with KMSRA.









This could possibly allow similar folding since the charges would be similar at

physiological pH.

Regulation of PC activity plays a crucial role in the control of gluconeogenesis.

The design of metabolic reactions is such that anabolic and catabolic pathways are

regulated in order to minimize futile cycling. Glycolysis and gluconeogenesis are

examples of such metabolic pathways that are carefully regulated. It recently has been

found that NAD+ is an allosteric activator of pyruvate kinase in rat liver cells (161).

Increased cytosolic NAD+ concentration was associated with decreased gluconeogenesis

and enhanced glycolysis (161). Our data, which indicate that NADH activates purified

rat liver PC at high concentrations and at both high and low concentrations for PC from

crude liver homogenate (Chapter 4), suggest that increased NADH may stimulate

gluconeogenesis in vivo. In the present studies, we may not be accounting for an

unknown factor or effect of NADH on PC from crude liver homogenate and we cannot

rule out this same effect in vivo. Thus, these data provide evidence for another

mechanism by which gluconeogenesis might be regulated in vivo but requires further

investigation.














CHAPTER 6
DISCUSSION

This project describes the use of a rat model to address various aspects of altered

biotin metabolism during oral CBZ administration. CBZ alters both biotin status and

function after long-term therapy in rats. Most investigations of biotin metabolism during

CBZ administration done previously were from clinical trials and have included plasma

or urine biotin, BNB, and BSO measurements. Only one animal study examined the

effects of three days of i.p. administration of CBZ on biotin, BNB, and BSO

concentrations in the plasma (103). There were no differences found among these

metabolites following CBZ administration, and it was suggested that a rat might not be a

good model for human response of biotin after CBZ. There were several potential

problems with this study, however, including the i.p. mode of administration. As stated

earlier, one of the potential mechanisms of decreased biotin status is decreased biotin

uptake across the intestinal brush border (66), and i.p. administration of CBZ would

bypass this competitive uptake. Also, CBZ was only administered for three days in the

study. Clinical data showing that AEDs decrease plasma biotin 45-50% are from patients

undergoing long-term therapy for many years (19,20) and, therefore, three days may not

have been long enough to elicit a response.

Our rat model of oral CBZ administration is also clinically relevant in that the CBZ

concentrations used in all of our studies were not toxic based on observations that all rats

continued to gain weight for the entire duration of the studies. Other rat studies of oral

CBZ administration report evidence that dosages were toxic based on decreased weight









gain during the study and food intakes were not reported (83). The dietary model used in

the experiments outlined for this project was useful because CBZ was administered

orally, which closely models normal administration of the drug in humans, and biotin

intake was physiologically relevant. Although serum CBZ concentrations in all three

experiments were lower than the 4-12 mg/L therapeutic range for humans, we still

observed alterations of biotin status and function. Therefore, our animal model could be

considered as conservative compared to studies in humans with plasma CBZ between 4-

12 mg/L.

These studies demonstrated that biotin status and function of biotin-dependent

enzymes at the tissue level are decreased during CBZ administration and that this

decrease is prevented by biotin supplementation. Previously, changes in biotin status and

function in tissues were poorly understood since most data of decreased plasma biotin

status during AED therapy were from clinical trials. We, however, speculated that there

would be a decrease in biotin-dependent enzyme function in tissues based on clinical

observations that patients undergoing long-term AED therapy excreted high

concentrations of organic acids including lactic acid, propionic acid, and 3-HIA.

Although not definitive, these organic acids imply a loss of function of PC and ACC,

PCC, and MCC, respectively.

It is not well understood how pharmacological biotin supplementation prevented

decreases in hepatic and brain PC specific enzymatic activity without altering the

abundance of the biotinylated form of PC, which is the active form of the enzyme. One

possibility is that there is an activator of PC not accounted for in the enzyme activity

reaction mixture. Since biotin supplementation also prevented the decrease of ACC









activity, the flux through this pathway could be increased along with an increased flux of

lactate back to pyruvate (Fig. 6-1). This reaction, catalyzed by lactate dehydrogenase, is

also accompanied by the formation ofNADH (Fig. 6-1). We found that physiological

concentrations of NADH activate PC from crude homogenate in vitro but not from

purified PC. Since we also found that CBZ significantly reduced brain NADH

concentration and that biotin supplementation partially prevented this metabolic effect, it

is possible that the NADH generated after biotin supplementation and increased ACC

activity was enough to increase PC activity in vivo without changing the abundance of the

active form of the enzyme.









oxak acete ADP+i cetyl- CoA --- ricaboaylicacid cycle
ADP+P ? C



morwyl-CoA- faty oc~d elongation
Figure 6-1. NADH as an activator of pyruvate carboxylase (PC). It is proposed that,
upon biotin supplementation, ACC activity is increased and flux through the
pathway catalyzed by this enzyme is increased (1). As a result of increased
flux through this pathway, there is an increased flux of lactate to pyruvate and
a resulting increase in concentration of NADH (2). NADH then activates PC
without changing the abundance of biotinylated PC (3).

The studies presented in this project show that oral CBZ administration to rats

increases brain and serum lactate concentrations, and that biotin supplementation can

completely prevent these increases. It is evident that biotin supplementation during CBZ

therapy may be effective in preventing the lactic aciduria experienced by epileptics

during long-term AED therapy (19,20). Before we can suggest that biotin









supplementation should be considered for future medical management for the treatment

of epilepsy to prevent this side effect, we must demonstrate that lactic acid buildup in the

brain is actually an adverse effect. It is assumed that the elevated brain and serum lactate

during CBZ administration to rats is an adverse side effect based on adverse effects of

lactate accumulation in other tissues. Intravenous infusion with racemic D-, L-lactate

into rats was accompanied by bradycardia when serum lactate was 1-2 mmol/L and

fibrillation and ventricular standstill at 11 mmol/L (51). In other studies, patients with

short bowel syndrome had elevated D-lactate (0.5 mmol/L) that was produced from

colonic bacteria and was correlated with confusion, loss of memory, slurred speech,

unsteady gait, and visual blurring (162). There is a possibility, however, that increased

lactate could be involved with the mechanism of action of the drug.

One of the most important questions that must be asked as a result of this research

is whether decreased biotin status is a part of the mechanism of action of CBZ. If this

were the case, then biotin supplementation during CBZ therapy would be expected to

decrease the efficacy of the drug in the prevention of seizures. Biotin deficiency is

accompanied by decreased PC activity, an enzyme that catalyzes the conversion of

pyruvate to OAA. The overall effect of decreased PC activity is a relative diminution of

the OAA pool and a consequent shift of the aspartate aminotransferase reaction away

from aspartate, an excitatory neurotransmitter (Fig. 6-2). Increased glutamate

concentrations would allow more substrate to be available for the glutamate

decarboxylase reaction favoring y-aminobutyric acid (GABA) production, which is an

inhibitory neurotransmitter. Increased inhibitory neurotransmitter and decreased

excitatory neurotransmitter concentrations that accompany a biotin deficiency could









potentially decrease seizure activity and, therefore, could be a mechanism of action for

CBZ. Ketogenic diets are used to manage epileptic seizures, and the mechanism of

action may be similar to metabolic perturbations that are observed during a biotin

deficiency (163). One proposed mechanism of action of the ketogenic diet is a decreased

pool of OAA since P-hydroxybutyrate utilizes available coenzyme A to produce acetyl

CoA and, therefore, there is a decreased supply of TCA cycle intermediates. This is

proposed to lead to decreased OAA, which would then yield increased inhibitory and

decreased excitatory neurotransmitters.

Cytosol Mitochondrion

GABA

Glutamate Glutamate PC
V Oxaloacetate Pyruvate

a-ketoglutarate
Aspartate Aspartate



Figure 6-2. Mitochondrial glutamate-aspartate translocator. PC, pyruvate carboxylase;
GABA, y-aminobutyric acid.

If it were the case that decreased biotin status is part of the mechanism of action of

CBZ, it would obviously not be recommended that epileptic patients receive concomitant

biotin supplementation to increase status. Then, however, the consequences of long-term

biotin deficiency must be addressed for patients who may require CBZ therapy for an

entire lifetime. Seizure control among epileptic patients will be top priority for

clinicians, but implications of biotin deficiency may need to be considered since it is

apparent that CBZ therapy decreases biotin status and function of biotin-dependent

enzymes. While studies have not been done directly addressing the effects of a long-term









marginal biotin deficiency, it is likely that the metabolic pathways of carbohydrate,

amino acid, and fatty acid metabolism that involve biotin-dependent enzymes would be

altered. Since it has been shown in animal studies that biotin deficiency during

pregnancy is teratogenic (164,165), this could also be a potential public health concern

for women taking CBZ. CBZ administration during pregnancy increases chances for

birth defects and developmental delay among the fetus (166-170).

The future direction of this research may involve an investigation of the efficacy of

CBZ in seizure control with concurrent biotin supplementation in an animal model of

epilepsy. There are several animal models of epilepsy, including induction of seizures in

an animal model with electrical stimulation, chemoconvulsants, and genetic models

including a genetically epilepsy-prone rat strain. Only after it has been tested in an

animal model and it has been found that CBZ is still effective in preventing seizures with

concurrent biotin supplementation will this be likely to be tested in humans.

The current project has demonstrated that biotin supplementation can completely

prevent decreases in biotin status, biotin-dependent enzyme function, and increases in

lactate concentration induced by long-term oral CBZ administration. The public health

significance of the decreases in biotin status and function during CBZ therapy is

important, particularly for epileptics, and may explain some of the adverse side effects

experienced by nearly 50% of patients undergoing long-term AED therapy. Biotin

supplementation during pregnancies of women taking CBZ should especially be

considered to possibly reduce teratogenic risks commonly associated with CBZ therapy

during pregnancy. This project has expanded the area of nutrient-drug interactions and

the data presented here should provide a basis for the direction of future studies in this