<%BANNER%>

HIV-1 Based Viral Vector Development for Gene Transfer to the Cardiovascular System


PAGE 1

HIV-1 BASED VIRAL VECTOR DE VELOPMENT FOR GENE TRANSFER TO THE CARDIOVASCULAR SYSTEM By MATTHEW J. HUENTELMAN A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLOR IDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2003

PAGE 2

Copyright 2003 by Matthew J. Huentelman

PAGE 3

This work is dedicated to my family, my spouse, my fellow lab-mates, and my friends, without whom none of my goals could be achieved.

PAGE 4

ACKNOWLEDGMENTS I would like to express my gratitude to my mentor, Mohan Raizada, for almost five full years of unfaltering guidance and kick in the pants motivation. I feel very lucky to have spent my time at the University of Florida in his laboratory where day in and day out everyone pushed each other to not only succeed, but to excel. Additionally, I need to thank all the wonderful people with whom I was lucky to interact in Mohans lab, especially Beverly Metcalfe with whom I worked closely on the AT2R project. I would also like to thank the invaluable members of my dissertation committee, Harm Knot, Peter Sayeski, and especially Michael Katovich who was directly involved with many of the experiments detailed in this thesis. Next I would like to thank my parents, Connie and John, for providing me the greatest gift in the worlda top notch college education. I am a direct reflection of their flawless parenting skills. Also, I need to recognize my wife of eight months, Heather, for all the support and inspiration she provided to me during these last five years togetherI look forward to the remainder of our lives with each other. Last, but certainly not least, I need to thank my fellow student and friend, Jason Coleman, his mentor, Susan Semple-Rowland, Adrian Timmers, and all others who passed through the UF LenTi Roundtable (LTR) group. Without Jasons hard work and helpful suggestions this dissertation would have a lot fewer results to speak of. Sue and others in the LTR group provided me with unparalleled support and helped to advance the lenti system further than any of us could have imagined in such a short period of time. iv

PAGE 5

TABLE OF CONTENTS Page ACKNOWLEDGMENTS.................................................................................................iv LIST OF FIGURES.........................................................................................................viii ABSTRACT.........................................................................................................................x CHAPTER 1 INTRODUCTION: BACKGROUND AND SIGNIFICANCE...................................1 Cardiovascular Disease and Hypertension...................................................................1 Importance and Impact..........................................................................................1 The Renin-Angiotensin System.............................................................................2 Renin..............................................................................................................2 Angiotensinogen.............................................................................................4 Angiotensin converting enzyme.....................................................................5 Angiotensin II type 1 receptor........................................................................6 Angiotensin II type 2 receptor........................................................................8 Pro-/renin receptor........................................................................................10 Angiotensin(1-7)..........................................................................................10 Angiotensin converting enzyme 2................................................................11 Angiotensin III.............................................................................................12 Angiotensin IV.............................................................................................13 Gene Therapy and Cardiovascular Disease................................................................14 Why Gene Therapy?............................................................................................14 The Perfect Vector...............................................................................................14 Gene Transfer Vectors.........................................................................................15 Non-viral vectors..........................................................................................15 Naked nucleic acid.......................................................................................15 Complexed nucleic acid...............................................................................16 Viral vectors.................................................................................................17 Adenovirus based.........................................................................................17 Adeno-associated virus based......................................................................18 Human immunodeficiency virus based........................................................20 Vector choice................................................................................................21 State of the Field: Gene Therapy for Cardiovascular Disease............................22 Hypertension................................................................................................22 Vascular disease...........................................................................................24 v

PAGE 6

Cardiac disease.............................................................................................25 Lentiviral Vectors.......................................................................................................25 Development and Discovery...............................................................................25 Lentiviral Vector Design and Molecular Biology...............................................27 Gag-Pol.........................................................................................................27 Env...............................................................................................................28 Rev...............................................................................................................29 Tat 30 Vpr................................................................................................................30 Vpu...............................................................................................................30 Vif 31 Nef................................................................................................................31 State of the Field: Lentiviral-Based Vectors.......................................................31 Alternative lentiviruses................................................................................31 In vivo usage.................................................................................................32 Aims and Rationale.............................................................................................34 Aim 1: Create a more user friendly lentiviral vector system.......................35 Aim 2: Characterize the efficacy of the lentiviral vector system in non-dividing cells in vitro..............................................................................35 Aim 3: Deliver the lentiviral vector systemically into the cardiovascular system and characterize its efficacy........................................................35 Aim 4: Prevent the development of cardiovascular disease in the SHR using systemic delivery of the lentiviral vector................................................35 2 IMPROVING LENTIVIRAL VECTOR PRODUCTION RESULTS IN THE ABILITY TO CONSISTENTLY PRODUCE VECTOR ON A LARGE SCALE....36 Introduction.................................................................................................................36 Results.........................................................................................................................38 TYF Cloning Vector Improvements................................................................38 Vector Production Modifications........................................................................39 Concentration Protocol Modifications................................................................41 Lentivector Performance in the Brain In Vivo.....................................................41 Discussion...................................................................................................................42 3 SYSTEMICALLY ADMINISTERED LENTIVIRAL VECTOR TRANSDUCES SEVERAL TISSUES IN THE RAT RELEVANT TO THE CARDIOVASCULAR SYSTEM.....................................................................................................................45 Introduction.................................................................................................................45 Results.........................................................................................................................46 In Vitro Efficacy..................................................................................................46 In Vivo Efficacy...................................................................................................48 Dose-response..............................................................................................49 Transgene expression duration.....................................................................50 Biodistribution of vector..............................................................................50 Discussion...................................................................................................................51 vi

PAGE 7

4 ANGIOTENSIN II TYPE 2 RECEPTOR GENE TRANSFER ATTENUATES THE DEVELOPMENT OF CARDIAC HYPERTROPHY IN THE SPONTANEOUSLY HYPERTENSIVE RAT..............................................................................................56 Introduction.................................................................................................................56 Results.........................................................................................................................59 Lentiviral Vector Design and In Vitro Assay......................................................59 In Vivo Delivery of TYF.hEF1.AT2R.IRES.Neo................................................60 Discussion...................................................................................................................61 5 CONCLUSIONS AND DIRECTIONS......................................................................67 Lentivector Production and Performance...................................................................68 The AT2R and Other Targets of the RAS...................................................................69 APPENDIX METHODS..................................................................................................72 Chapter 2.....................................................................................................................72 Lentiviral Vector Constructs: pNHP, phEF1.VSV.G, and the pTYF family..72 DNA Preparation.................................................................................................74 Production of Lentivector: Transfection.............................................................74 Production of Lentivector: Concentration...........................................................75 Lentivector Titration: PLAP................................................................................77 Delivery of TYF.hEF1.EGFP Vector to Brain Nuclei........................................77 Cell Culture.........................................................................................................78 Solutions..............................................................................................................78 Chapter 3.....................................................................................................................79 TYF Constructs...................................................................................................79 Growth Arrest and Transduction.........................................................................79 Systemic Delivery of Lentivector to Neonatal Rat..............................................79 Cell Staining for lacZ..........................................................................................80 Tissue Histochemistry for PLAP.........................................................................80 Cell Culture.........................................................................................................81 Chapter 4.....................................................................................................................81 AT2R Lentivector Construction...........................................................................81 Lentivector Titration: G418 Resistance...............................................................81 125I-Angiotensin II Binding.................................................................................82 Cardiac Echocardiography..................................................................................83 Cell Culture.........................................................................................................83 Solutions..............................................................................................................83 Statistics...............................................................................................................83 LIST OF REFERENCES...................................................................................................84 BIOGRAPHICAL SKETCH.............................................................................................96 vii

PAGE 8

LIST OF FIGURES Figure page 1-1 Major components of the Renin-Angiotensin System...............................................3 1-2 Signal transduction pathways for the AT1R and AT2R..............................................7 1-3 Wild-type HIV-1 genome organization....................................................................27 2-1 Three plasmid system used to produce recombinant lentiviral vector.....................38 2-2 The pTYF family of modified cloning vectors........................................................39 2-3 Lentivector production is greatest within the first 48 hours following transfection...............................................................................................................40 2-4 A modified lentivector concentration protocol results in higher final titers............42 2-5 Lentiviral vector efficiently transduces neurons in the adult rat brain in vivo.........43 3-1 The pTYF lentiviral vector reporter gene constructs...............................................46 3-2 Lentiviral vector efficiently transduces quiescent cells relevant to the cardiovascular system in vitro..................................................................................47 3-3 Separate lentiviral vectors are able to transduce the same cell in succession..........48 3-4 Increasing the dose of lentiviral vector results in higher transduction efficiency....49 3-5 Lentiviral vector expresses transgene for at least 120 days in vivo.........................51 3-6 Systemically delivered lentiviral vector transduces multiple tissues relevant to the cardiovascular system..............................................................................................52 3-7 Lentivector effectively transduces cardiomyocytes in vivo.....................................54 3-8 Systemically administered lentiviral vector is capable of transducing germ cells...55 4-1 Lentiviral constructs encoding the AT2R.................................................................60 4-2 Binding characteristics of the AT2R expressed from the lentiviral vector in CHO cells...........................................................................................................................61 viii

PAGE 9

4-3 AT2R gene transfer results in decreased cardiac hypertrophy in the SHR...............62 4-4 AT2R gene transfer significantly decreases the increase in left ventricular wall thickness for up to 9 weeks......................................................................................63 4-5 AT2R gene transfer has no effect on systolic blood pressure in the SHR................65 ix

PAGE 10

Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy HIV-1 BASED VIRAL VECTOR DEVELOPMENT FOR GENE TRANSFER TO THE CARDIOVASCULAR SYSTEM By Matthew J. Huentelman December 2003 Chair: Mohan K. Raizada Major Department: Physiology and Functional Genomics Cardiovascular disease (CVD) is the nations number one killer. Several pharmacotherapies exist to combat CVD however its incidence and mortality rates continue to rise. Alternative treatment options must be explored in order to provide hope for the future treatment of this disease. Gene therapy has been suggested as one such alternative option. Gene therapy involves the transfer of therapeutic nucleic acid into diseased cell types. The vector for such gene transfer is of major consideration when approaching any disorder. Viral vectors based on HIV-1 are an up and coming class of gene transfer vehicles first utilized in 1996 and already finding their way into human clinical trials. However the HIV-1 vectors, or lentiviral vectors, are poorly characterized in almost every major organ of the CV system. Lentiviral vectors possess many of the characteristics required for effective gene therapy for CVD including the ability to accommodate large payloads of nucleic acid, transduce non-dividing cells, direct longx

PAGE 11

term transgene expression, and evoke a miniscule immune response. However, many challenges face lentiviral vectors including questions about their safety for use in humans and technical hurdles concerning their large-scale preparation. The primary goal of this study was to further develop the lentiviral vector system and characterize its efficacy in the CV system and its ability to prevent CVD. Novel methods were developed for the production and concentration of the vector allowing for reproducible large-scale production. Upon delivery to neonatal rats, the lentiviral vector transduced every major target organ of the rat cardiovascular system including the heart, liver, brain, kidney, and adrenal gland. The optimal vector dose was determined, and additional studies using an angiotensin II type 2 receptor transgene illustrated the ability of the vector to prevent the development of hypertrophy in a spontaneous model of hypertension in the rat. The methodology of lentiviral vector preparation was improved and its effectiveness in the CV system illustrated. Initial results using a therapeutic transgene show promise for the future study of cardiac hypertrophy. The findings here help to lay the foundation for future use of the lentiviral vector in the study and possible therapy of CVD. xi

PAGE 12

CHAPTER 1 INTRODUCTION: BACKGROUND AND SIGNIFICANCE Cardiovascular Disease and Hypertension Importance and Impact Cardiovascular disease (CVD) is the number one cause of mortality and morbidity in industrialized countries. An estimated 1 in 4 Americans suffer from some form of CVD and over 40% of all deaths in the United States are linked to CVD. Additionally, the economic impact on society is enormous. The National Center for Chronic Disease Prevention and Health Promotion reports that nearly $300 billion is spent each year both managing this disease through health care costs and through lost workplace productivity. With our increasingly aging population, these statistics can only be predicted to worsen. CVD in general encompasses many disorders including hypertension, heart disease, and atherosclerosis among others. In most cases, the treatment options for the CVD patient only serve to alleviate the symptoms not reverse or sometimes even halt the progress of the underlying disorder. As medicine advances into the next century there is great hope that new treatment options may emerge to remedy this. The contributions of the renin-angiotensin system (RAS) in both the normal physiology of blood pressure (BP) regulation and the pathophysiology of hypertension are under intense study. Hypertension alone affects over 50 million Americans reaching epidemic proportions in the adult population where 1 in 5 have been diagnosed with the disorder. The primary symptom of this disease is chronic elevated blood pressure, but 1

PAGE 13

2 patients often have an increased risk of stroke, heart disease, and renal damage. If left untreated, hypertension can adversely affect several major organs including the kidneys, heart, brain, vasculature, and eyes. Many antihypertensive pharmacotherapies exist; however, they primarily succeed in managing the symptoms of the disease. The Renin-Angiotensin System The Renin-Angiotensin System (RAS) is an endocrine system of major importance to the body with its key feature being the maintenance of body fluid homeostasis. The next section discusses the major players of the RAS individually. Figure 1-1 is a reference diagram of the RAS components discussed below. Renin The unusually specific aspartyl protease renin was first identified over 100 years ago by Tiegerstedt and Bergman in extracts from the kidneys of rabbits. In the circulation, renin is the rate limiting step of the RAS. The main source of the circulating enzyme is from the juxtaglomerular (JG) cells in the kidney (Gomez et al, 1990). The JG cells are modified smooth muscle cells containing the characteristic dense core secretory granules often found in other neuroendocrine cells (Hackenthal et al, 1990). However, in JG cells the secretory granules are atypical in appearance with a much greater similarity to the common lysosome. Therefore some researchers suggest that the JG cells do not contain the stereotypical granules found in many endocrine cells, but rather have adapted their lysosomes for the specialized role of processing and

PAGE 14

3 AOGEN Renin Ang I ACE Ang II AT1R AT2RPro-ReninPro-/Renin ReceptorCathepsin GToninChymaseCathepsin GToninChymaseToninCathepsin GAT3R (?)AT4RAT1-7R Ang III Ang IV Ang 1-7 Ang 1-9 Kinin N-term KininACEAminopeptidaseAAmino-peptidase NCarboxypeptidase P ACE2 RnBP + Vasoconstriction Na+/H2O Conservation Hypertrophy/HyperplasiaVasodilation Apoptosis DevelopmentVasodilation Na+/H2O ConservationH2O ConservationDilation Hypertrophy Memory ACE2t-PA Figure 1-1. Major components of the Renin-Angiotensin System. Highlighted in red are the more thoroughly understood proteins and peptides of the system. All enzymes are written nearest an arrowed line connecting the substrate and products of the reaction they catalyze. Other components (proteins, peptides, and receptors) are listed at the tail or head of an arrow. secreting renin (Bader and Ganten 2000). Renin is produced and secreted from these cells through the processing of its inactive precursor, prorenin, by the lysosomal protease cathepsin B. The JG cells are not the only source of renin in the organism. It has been shown that renin/prorenin is secreted from cells in the adrenal gland, heart, and brain and may therefore be assumed to participate in a local, tissue-based RAS (Dostal et al, 1992; Rong et al, 2001). Once in the circulation, renin may act on its circulating substrate, angiotensinogen.

PAGE 15

4 Angiotensinogen The 55-60 kDa globular protein angiotensinogen (AOGEN) is the single known precursor to angiotensin I synthesis. The bioavailability of AOGEN rate limits the activity of renin, and the primary source of circulating AOGEN is from the hepatocytes in the liver. In fact, within the AOGEN secreting hepatocytes a positive feedback loop has been established with the final bioactive product of the RAS, angiotensin II, acting at angiotensin II type 1 receptor sites on the cells to further upregulate AOGEN secretion (Brasier et al, 2000). Additionally, astrocytes, primarily located in the hypothalamus and brainstem nuclei, and adipocytes have been shown to secrete large amounts of AOGEN while AOGEN mRNA can be found in a wide variety of tissues and cell types in the body. This suggests that AOGEN synthesis can proceed in organ systems throughout the body as is the case with the renin enzyme and other components of the RAS. There is no direct experimental evidence to show any intracellular processing of AOGEN, in fact the three major sources of AOGEN (hepatocytes, astrocytes, and adipocytes) lack basic cellular machinery to concentrate secretory proteins. Instead these cell types can only constitutively export the AOGEN to the extracellular fluid. The result is a circulating concentration of AOGEN of approximately 1M, essentially equal to the calculated Km of the renin-AOGEN cleavage reaction. The action of renin on the N-terminus of AOGEN liberates the invariant decapeptide, angiotensin I (Ang I), in addition to its globular chaperone, des(Ang I)-AOGEN. To date no direct physiological effects have been shown for AOGEN or des(Ang I)-AOGEN alone and the general consensus is that AOGEN functions purely as

PAGE 16

5 an extracellular reservoir of Ang I. However, a recent publication suggests anti-angiogenic effects for both AOGEN and des(Ang I)-AOGEN (Corvol et al, 2003). Angiotensin converting enzyme The dipeptidyl carboxyl metallopeptidase, angiotensin converting enzyme (ACE), cleaves Ang I to form the vasoactive octapeptide angiotensin II (Ang II). ACE exists in both a soluble and endothelial cell bound form. The primary site of ACE action is found in the lungs, but ACE activity has been documented in several other organs including but not limited to the kidney, liver, heart, and blood vessels (Kohara et al, 1992; Balcells et al, 1997). Unlike renin, ACE is very non-selective in its mode of action. In fact, ACE has been documented to cleave substance P, luteinizing hormone releasing hormone, and the potent vasodilator bradykinin. It is also important to note that ACE action is not a rate controlling step in the RAS cascade. The pharmacologic inhibition of ACE (ACEi) represents one of the early and most successful antihypertensive targets of the RAS. The first orally active ACE inhibitor, captopril, was reported in Science in 1977 (Ondetti et al, 1977). Since then, ACEi has been used to successfully treat hypertension, myocardial ischemia, and cardiac hypertrophy (Latini et al, 2000; Cuspidi et al, 2002). As touched on above, ACEi blocks both the formation of Ang II and the breakdown of bradykinin. In this manner ACEi serves to quiet the vasoconstrictive qualities of the RAS while increasing the circulating concentrations of the vasodilator bradykinin. Along with touching off the pharmacologic crusade against hypertension, the study of ACE gene polymorphisms in the human population helped to initiate the modern day understandings of the genetic component of hypertension. The I/D ACE polymorphism was related to serum ACE concentrations. It was shown that those individuals

PAGE 17

6 homozygous for the D allele presented with higher levels of serum ACE than heterozygotes or homozygous I/I patients (Rigat et al, 1990). ACE action on Ang I drives the formation of the vasoactive octapeptide Ang II. The majority of Ang IIs well studied cardiovascular (CV) actions are mediated by the type 1 receptor (AT1R). The type 2 receptor (AT2R) had classically been thought to only play a role during the development of the CV system due to its transient increased expression during embryogenesis, however many studies have suggested an AT1R -antagonistic role for the AT2R. Angiotensin II type 1 receptor The distinct AT1R and AT2R binding sites were first experimentally revealed in 1987. Through treatment with the thiol-reducing agent DTT two distinctly sensitive classes of receptors for Ang II were identified. The molecular cloning of the AT1R in 1991 revealed it to be a part of the G-protein couple receptor (GPCR) super-family (Sasaki et al, 1991). Within two years the AT1R was cloned from several animals including humans, rats, and mice. Also during this time a second subtype of the receptor, the AT1BR, was isolated in rodents. The AT1BR was found to predominate in the adrenal cortex and pituitary gland while AT1AR was primarily expressed in vascular smooth muscle, liver, kidney, heart, and other organs (Kakar et al, 1992; Murphy et al, 1992). Both subtypes were found to bind Ang II with similar affinity and also couple to identical G-protein subtypes. By GPCR family definition the AT1R consists of seven transmembrane domains with its N-terminus located extracellularly and C-terminus intracellularly. Members of the GPCR family must also couple to cytosolic G-proteins, most commonly a complex of three G-proteins known as a heterotrimer. Three mechanisms exist for AT1R -mediated

PAGE 18

7 (Figure 1-2). Figure 1-2. Signal transduction pathways of the AT1R and AT2R. q11 or G1313 pathwnding kinase (MAPK), and a resultant release of intracellular calcium stores. signal transduction: G-protein mediated, G-protein independent, and internalization AT1RG Protein Gq11or G12/13: PLC activation, IP3/DAG generation, Ca2+release, PKC activation, MAPK activation Gi: AC inhibition, decreased cAMP levels Src: PLC activation, IP3/DAG generation, Ca2+release, PKC activation, MAPK activation Tyrosine Kinase JAK : STAT phosphorylation, transcriptional changes FAK : Paxillin phosphorylation, cytoskeletal re-arrangementInternalization PKC-dependent clathrin/caveolae processAT2RG Protein Gi: Protein phosphatase activation (PP2A, MKP-1, SHP-1), MAPK inhibition, decreased cell growth, apoptosis, increased cGMP levels AT1RG Protein Gq11or G12/13: PLC activation, IP3/DAG generation, Ca2+release, PKC activation, MAPK activation Gi: AC inhibition, decreased cAMP levelsG Protein Gq11or G12/13: PLC activation, IP3/DAG generation, Ca2+release, PKC activation, MAPK activation Gq11or G12/13: PLC activation, IP3/DAG generation, Ca2+release, PKC activation, MAPK activation Gi: AC inhibition, decreased cAMP levels Gi: AC inhibition, decreased cAMP levels Src: PLC activation, IP3/DAG generation, Ca2+release, PKC activation, MAPK activation Tyrosine Kinase JAK : STAT phosphorylation, transcriptional changes FAK : Paxillin phosphorylation, cytoskeletal re-arrangement Src: PLC activation, IP3/DAG generation, Ca2+release, PKC activation, MAPK activation Src: PLC activation, IP3/DAG generation, Ca2+release, PKC activation, MAPK activation Tyrosine Kinase JAK : STAT phosphorylation, transcriptional changes JAK : STAT phosphorylation, transcriptional changes FAK : Paxillin phosphorylation, cytoskeletal re-arrangement FAK : Paxillin phosphorylation, cytoskeletal re-arrangementInternalization PKC-dependent clathrin/caveolae processInternalization PKC-dependent clathrin/caveolae processAT2RG Protein Gi: Protein phosphatase activation (PP2A, MKP-1, SHP-1), MAPK inhibition, decreased cell growth, apoptosis, increased cGMP levels Gi: Protein phosphatase activation (PP2A, MKP-1, SHP-1), MAPK inhibition, decreased cell growth, apoptosis, increased cGMP levelsInternalization No definitive evidence supporting any form of internalizationInternalization No definitive evidence supporting any form of internalizationTyrosine Kinase No definitive evidence supporting any form of activationTyrosine Kinase No definitive evidence supporting any form of activation Ang II binding at the AT1R produces IP3 by activation of the G ays. Cytosolic loop number three has been shown to play the critical role in this action (Ohyama et al, 1992). Additionally the G subunits are known to activate phospholipase D. In fact, the AT1R is known to mediate several varied effects depeon both cell type and distinct Gsubunit coupling. In general, the intracellular hallmarks of Ang II binding at the AT1R and acting via G-protein mediated signal transduction are activation of phospholipase C (PLC), protein kinase C (PKC), mitogen activated protein

PAGE 19

8 GPCRs also have the ability to transactivate growth factor receptors and the janus kinase (JAK) signal transduction activators of transcription (STAT) pat hway (Wu and Cunn of ). Upon ligand binding the receptor is phosphorylated by a PKC d and therefore exist in the rm as the AT1R. The AT2R was cloned in 1993 and foundng sis toxin ick 2002). This is termed the tyrosine kinase activity of the AT1R. Through the activation of these membrane-bound and soluble tyrosine kinases, Ang II can exert effects on cellular proliferation and transcription (Marrero et al, 1997). The important site of action for these effects is a canonical YIPP motif located on the C-terminusthe molecule (Ali et al, 1997). The C-terminus plays a critical role in rapid desensitization and internalization of the AT1R (Hunyady et al, 2000 -dependent mechanism and internalized via clathrin and caveolae-mediated processes (Bkaily et al, 2003). It is possible that caveolae-internalized AT1Rs can still transduce their intracellular signals. In fact, internalization of receptor into specificsubcellular domains (nuclear and perinuclear) has been demonstrated in both neurons ansmooth muscle cells (Yang et al, 1997; Adams et al, 1999). Angiotensin II type 2 receptor Type 2 receptors also belong to the GPCR superfamily membrane in a nearly identical fo to only share an approximate 30% sequence homology with the AT1R (Kambayashi et al, 1993; Mukoyama et al, 1993). This is the lowest value known amoall GPCR family subtypes. Current evidence suggests coupling to both pertussensitive (Gi2 and Gi3) and Gs proteins. It was demonstrated that the AT2R can couple and functionally signal after association with the Gs alone (Feng et al, 2002). This suggests a novel mechanism for GPCR signaling because previously the paradigm of

PAGE 20

9 GPCR members required heterotrimeric (, and subunits) coupling prior to signatransduction. The AT2R is classically thought to play a role during development where it is expressed high l ly in the embryonic kidney and vasculature among other CV-relevant organer, 2R et ed. However it has been shown that the AT2R can signal through the activaes to ne activa this loop of the AT2R with the same loop s. In adults, the receptor is expressed in a limited number of tissues, but is up-regulated over 5-fold during times of tissue remodeling (Ohkubo et al, 1997). Howevongoing research from the past several years suggests an antagonistic role for the ATon the classical AT1R -mediated actions of Ang II. For example, the presence of AT2R inAng II pressor areas of the brain helps to decrease the resultant BP rise following an intracerebroventricular injection of Ang II (Li et al, 2003). Additionally, mice lacking the AT2R have higher blood pressure compared to their wild-type littermates (Siragy al, 1999). Many of the intracellular signaling pathways of the AT2R have yet to be fully characteriz tion of protein tyrosine (SHP-1) or protein serine/threonine (PP2A) phosphatasinactivate the extracellular signal regulated kinases (ERKs) (Bedecs et al, 1997). Recently it was shown that SHP-1 activation via the AT2R occurs via a novel GPCR mechanism (Feng et al, 2002). Upon AT2R stimulation, the Gs protein alo tes the SHP-1 protein. In fact, the G subunits were shown to be inhibitory toprocess presenting an alternate mechanism for GPCR signaling which challenges the obligatory heterotrimeric G-protein association. Several studies suggesting a constitutive activity of the AT2R have also been performed. One such study replaced the third cyto

PAGE 21

10 from t he AT1R. Transfection of this chimera resulted in increased expression of the c-gene and calcium release, two hallmarks of AT1R activation, in the absence of ligand (Wang et al, 1995). Secondly, modifications to any Ang II side chains was shown to have little effect on AT2R function suggesting that the receptor already exists in the membrane in an active state (Noda et al, 1996). The AT2R has also been shown to induce apoptosis. Sadashiva Karniks groupfrom the Cleveland Clinic has shown that mere o fos ver-expression of the receptor, again in the ab n 2002 (Nguyen et al, rch for such a receptor was based on the evidence that pro-renin is takens. peptide of the RAS that has been shown to hypertensive and hypertrophic actions of Ang II (Santos et al, 2000). Intrac sence of ligand, caused increased apoptosis in a vascular smooth muscle cell line(Miura and Karnik 2000). This process was shown to be mediated by increased caspase-3 and p38 MAPK activities. Additionally, the AT2R doesnt seem to undergo internalization desensitization (Figure 1-2) (Ouali et al, 1997). Pro-/renin receptor A functional receptor for the renin enzyme was described i 2002). The initial sea up from the circulation and concentrated in certain tissues. The receptor was shown at high levels in the heart and brain while at lower levels in the liver and kidney. In the kidney it was shown to co-localize with renin primarily in smooth muscle cellRenin bound to its receptor is fourfold more efficient at forming Ang I and it can also induce an intracellular signal via the MAPKs. Angiotensin(1-7) Angiotensin(1-7) is a biologically active counterbalance the erebroventricular (i.c.v.) infusion of Ang(1-7) into the lateral ventricle has no effect on mean arterial pressure or heart rate, but it greatly facilitates the baroreflex control of

PAGE 22

11 heart rate (Campagnole-Santos et al, 1992). This is in opposition to Ang II specific effects. In the kidney, Ang(1-7) can act at both proximal and distal sites in the nephron to cause natriuresis and diuresis (Benter et al, 1995). In the vasculature, Ang(1-7) is generally characterized as a vasodilator; however, some researchers have proposed vasoconstrictor and even dilator/constrictor properties to the peptide (Santos et al, 200Recently, research has emerged reporting the identification of a putative Ang(receptor molecule known as Mas (Santos et al. 2003). Previously an orphan GPCR, the 0). 1-7) autho angiotensin converting enzyme, ACE2, was identified in 2000 s an approximate 40% identify with ACE, but it differ re les in both cardiac and renal physi blood pressure, decreased cardiac contractility, increased cardiac expression of hy rs illustrate that in the kidneys of Mas knockout mice there is a significant decrease in Ang(1-7) binding when compared to non-transgenic animals. Additionally, the Mas knockout mice showed a decrease in their ability to concentrate urine and vasodilate in response to Ang(1-7). Angiotensin converting enzyme 2 The gene of a new (Donoghue et al, 2000). ACE2 share s greatly in substrate specificity. Whereas ACE action promotes Ang II formation,ACE2 activity catalyzes the formation of the vasodilator molecule, Ang(1-7). TherefoACE2 may act as a functional antagonist of Ang II action. ACE2 is expressed in endothelial cells located in the heart, kidney, and testis (Tipnis et al, 2000). For this reason ACE2 has proposed ro ology. ACE2 knockout mice (ACE2 -/-) have elevated plasma and tissue Ang II levels, normal basal poxia-inducible genes, normal kidney function, and unaltered female or male fertility (Crackower et al, 2002). This is in contrast to the ACE knockout mice which

PAGE 23

12 exhibit low basal blood pressure, normal heart function, reduced male fertility, and inability to produce concentrated urine (Bernstein 1998; Stec and Sigmund 2001). However, the ACE/ACE2 double knockout mice have reduced basal blood pressure andcompletely normal heart, kidney, and reproductive function (Crackower et al, 2002)From these findings it is possible to suggest that ACE2 expression is important to direct normal cardiac development. In the case of basal blood pressure regulation, it m the ay be tharait se models of hypertension in the rat (Oudit et al, 2003). Locat ly Angioment of Ang II) heptapeptide is a iological modulator of the RAS. To this date a specific Ang III receptor has yethe brain induces the release of arginine vasopressin (AVP) into the blood. Co-injection of the AT1R and AT2R antagonists completely block this effect (Hogarty et t in the absence of ACE2 another system compensates enough to keep blood pressure at a normal level. Additionally it was shown that the ACE2 gene maps to reported quantitative tloci identified in three diver ed on the X chromosome, ACE2 was genetically linked with hypertension in Sabrasalt-sensitive rats, stroke prone spontaneously hypertensive rats, and the spontaneoushypertensive rat (Hilbert et al, 1991; Kloting et al, 1998; Yagil et al, 1999). The future study of the CV-relevance of ACE2 will be aided by the recent creationof novel peptide-based inhibitors (Huang et al, 2003). tensin III The Angiotensin III (Ang III, 2-8 amino acid frag documented phys t to be identified; however, both the AT1R and AT2R can bind Ang III. There is some evidence that Ang III is the major effector peptide in the brain, not Ang II (Reaux et al, 2001). Injection of Ang III directly into the supraoptic (SON) or paraventricular (PVN) nucleus of

PAGE 24

13 al, 19 92). The conversion of Ang II to Ang III in the brain occurs quite rapidly and is mediated by aminopeptidase A (APA). If an APA inhibitor is co-injected with Ang II into the same brain nuclei the response to the Ang II is inhibited in a dose-dependent manner (Zini et al, 1998). This suggests that under these conditions Ang II conversionAng III is necessary to stimulate AVP release. Ang III in the brain also exerts control over systemic blood pressure. Again theis evidence supporting the theory that Ang II must be converted to Ang III to elicit a rise in blood pressure via the CNS. The authors show that in spontaneously hypertensive rats to re (SHRed on of aminopeptidase B on Ang III. In 1992, Ang IV was found to bind to a renal membranes denoted as the AT4R (Harding et al, 1992). In late 2001 rectly ) treated with an APA inhibitor the pressor response to i.c.v. delivered Ang II is blocked. Angiotensin IV Angiotensin IV (Ang IV, C-terminal 3-8 amino acid fragment of Ang II) is formby the acti specific site on ad the AT4R was identified as the insulin-regulated aminopeptidase (IRAP) enzyme (Albiston et al, 2001). IRAP is a transmembrane, zinc-dependent peptidase found in thebrain and periphery and Ang IV was shown to inhibit its activity. In the brain in particular IRAP localizes very closely with the glucose transporter 4 (GLUT4) moleculeThe majority of physiological effects for Ang IV have focused on its ability to potentiate memory. It is proposed that Ang IV-mediated inhibition of IRAP in the CNS indiincreases the half-life of neurotransmitters involved in memory and cognition, like substance P and somatostatin.

PAGE 25

14 Gene Therapy and Cardiovascular Disease Why Gene Therapy? As discussed ea treats only the er and usually does nothing to halt or reverse its progression. Othernd isease. It could be envisic r for a gene therapy vector to succeed it must have the following et both dividing and non-dividing cells; (ii) integrate into a known or sasion free rlier, typical pharmacotherapy for hypertension symptoms of the disord problems with current pharmacotherapies include the existence of side effects athe need for daily administration. These second two problems work together to cause patient drug regimen compliance to drop possibly as low as 60%. Clearly, more must be done to help alleviate these problems with antihypertensive therapy. We chose to investigate gene therapy as an option to help us both understand hypertension in general and hopefully advance the treatment of this d ioned that a gene therapy approach to hypertension would result in more speciflong-term treatment of the disorder. Additionally, in the ideal situation, therapeutic vector need only be delivered once thereby alleviating the problems associated with compliance. The Perfect Vector In orde characteristics: (i) targ fe location in the host genome; (iii) direct robust and stable gene expresfrom positional silencing; (iv) invoke no long-term immune response in the recipient animal; (v) be produced reproducibly and at high concentrations; (vi) deliver a large payload of therapeutic nucleic acid that could theoretically contain cell-type specific promoter or regulatory elements; and (vii) achieve all of these goals without compromising the safety profile of the vector.

PAGE 26

15 Gene Transfer Vectors A major step in every gene therapy exper iment comes at the very beginning where se the vehicle that will be used to transfer the therapeutic nucle virus life cycle to achieve gene transfer. apeutic nucleic acid may take many forms: circular plasmid DNA, linearay rily target either the skin, skeletal se organs are easily isolated and directly injected with DNA solutito skin age, n ieved the investigator must choo ic acid. Many times gene therapy experiments are hindered from the start simply bythe improper choice of gene transfer vector. Non-viral vectors Non-viral vectors simply avoid using the In this case, the ther ized plasmid DNA, and short DNA or RNA oligonucleotides. The therapeutic nucleic acid may then be delivered naked, that is simply purified and injected, or it mbe complexed with one of many available reagents. Naked nucleic acid Naked DNA injections for gene therapy prima muscle, or liver. The on and they possess above average abilities to uptake DNA from the blood and interstitial fluid. Recently electroporation was employed to deliver plasmid DNA and skeletal muscle with increased efficiency (Hartikka et al, 2001). Up to a 10-fold increase in expression was seen when employing such a technique. Efficient expression can be achieved in the liver by the simple delivery of DNA into the tail vein. On aver10-15% of hepatocytes are transduced when delivering 10g of plasmid DNA into the tail vein (Herweijer et al, 2001). However, the liver is not the only tissue that is transduced following such a procedure, low numbers of positive cells (100-fold less) cabe found in the heart, spleen, and kidneys. Better targeting of the liver can be achby direct delivery into the portal circulation (Eastman et al, 2002). Cardiac muscle can

PAGE 27

16 also be targeted by direct injection into the muscle wall or the coronary circulation. Expression from naked DNA injection is generally limited to 1-4 weeks in duration withthe highest levels of expression lost within the first seven days. Naked DNA for gene therapy is inexpensive to prepare, not constrained by gene size, and is very safe. However, its limited range of target tissue s and very short term expreeic acid is usually complexed with cationic lipids (lipoplexes) or cationic r to delivery. The overall goal of the process of complexation is to seic f other components into the cation, the or ssion pattern generally preclude its usage from all but very specific gene therapy protocols. Complexed nucleic acid Nucl polymers (polyplexes) prio pontaneously create small particles containing nucleic acid with an overall net positive charge. The positive charge helps to force an interaction with the surface of the cell where the small particles may then be endocytosed. Coating the therapeutic nuclacid with cationic molecules helps to increase their stability in vivo and improves their tissue tropism and efficiency compared to naked DNA. Complexed nucleic acid can effectively transduce every major organ in the body. Additionally, recent advances have shown the inclusion o ic complexes could further increase their efficacy. Polyethylene glycol has been included to increase stability and allow for lyophilization and long-term room temperature storage of therapeutic complexes (Anchordoquy et al, 2001). Such a development is key for the future clinical use of these complexes. Additionallyincorporation of basic peptides, called protein transduction domains, into the lipopolyplexes can markedly facilitate their efficacy (Nakanishi et al, 2003).

PAGE 28

17 Complexed nucleic acid incorporates all the advantages of naked nucleic acid plthe added benefits of increased tropism and stability. However, this techni us que is still limiteiral infection to transfer leic acid into the cell and therefore generally exhibit an increased effici to non-us-based (Ad) vectors are the second most commonly utilized vector in Ad vector usage in humans came under fire in 1999 when a patient died oa d vectors could only carry up to 8kb of DNA, but the newly developed helpeenerally d by relatively short transgene expression duration therefore it is an unlikely candidate for therapeutic use against a chronic disorder. Viral vectors Viral-based vectors exploit the natural process of v therapeutic nuc ency over non-viral methods. There are a myriad of viral vector systems in existence, but this section will focus on the most popular vectors for gene transferdividing cells. Adenovirus based Adenovir human clinical trials f vector-associated toxicity, but the vector was recently redeemed when its use in phase II trail resulted in very promising results on lower limb angiogenesis (Makinen et al, 2002). The Ad particle is non-enveloped and has a size of approximately 80nm. The earlygeneration A r-dependent Ad (HD-Ad) can carry 30kb. Ad particles bind a cell surface receptor molecule known as the coxsackievirus and Ad receptor (CAR) and are rapidly internalized. Once inside the cell the virus genome is transported into the nucleus where it exists in episomal form, un-integrated into the host genome. Ad vectors are geasy to purify and perform efficiently in vitro and in vivo provided that the target cell expresses the CAR molecule.

PAGE 29

18 Recently the area of the vector that confers the CAR binding specificity (the capsid) was modified to contai n an RGD peptide motif instead thereby targeting the vectoized 01). privile reased immunogenicity, and long-term transgene expression abiliti el with loped particle approximately 25nm in diameter with a single stranded genome (Hoggan 1970). The wild type virus integrates r to integrin molecules (Okada et al, 2002). Other peptides have also been utilto specifically target endothelial and smooth muscle cells (Nicklin et al, 2001). Alternatively, bi-specific antibodies, one end directed against the Ad vector and other to the target cell, were bound to the vector to achieve the same result (Levy et al, 20The severe immunogenicity of early generation Ad vectors has also been addressedEarly generation Ad vectors elicit inflammation and immune response even in immune eged organs (Mashhour et al, 1994). To address this, much of the Ad genome was deleted and vector production was achieved using helper virus. These HD-Ad vectors arthe future of the Ad system since they can carry a greater payload (30kb versus 8kb for early generation Ad vectors), have a reduced immune response, and exhibit much longer transgene expression. Non HD-Ad vectors only manage expression for approximately thirty days while HD-Ad vectors have been shown to express for greater than 9 months (Reddy et al, 2002). The current generation of HD-Ad vectors look very promising due to their large payload capacity, dec es. However, target cells are limited to those expressing the CAR unless modifications are made to the Ad vector capsid protein. Also, the HD-Ad are moredifficult to produce and every preparation of vector is contaminated at a low levhelper vector presenting a biosafety issue for the user. Adeno-associated virus based The adeno-associated virus (AAV) is a non-enve

PAGE 30

19 in a specific location on human c hromosome 19 and has yet been associated with any type o large expression cassette into two AAV vectoe can efractory to AAV transduction is the hematopoetic stem cell. of ion preciable levels. f disease. The modified vector genome results in a loss in this specificity with the majority of vector existing in an episomal form. However, up to 90% of the population is seropositive for AAV thereby causing problems for the future use of this vector in the human clinic. Five major serotypes of AAV have been identified in humans therefore each patient must be screened for neutralizing antibodies and treated with a different serotype vector for the greatest efficacy. The AAV genome is almost completely deleted, but the payload capacity of the virus remains quite low, between 4-5kb. Some investigators have worked their way around this potential problem by splitting a rs and then co-delivering them into target cells (Yan et al, 2002). This requires infection of a single target cell by each vector and the proper heterodimerization of thAAV genomes inside the cell. The primary receptor for AAV is the widely expressed heparin sulfate proteoglymolecule, and the vector has been used successfully in several species and cell types. The one major cell type that is r Targeting to specific cell types was achieved using the exact same techniques employed with the Ad virus: bi-specific antibody complexes and genetic manipulation the capsid protein (Bartlett et al, 1999). Although existing primarily as an episome the AAV directs long-term express(over one year) of transgene, but, depending on the viral dose, transgene expression could take up to one month before reaching ap

PAGE 31

20 AAV is well suited to in vivo gene transfer due to its safety, broad tropism, and long-term gene expression. However, the vector is limited by its very small payload, the presence of neutralizing antibodies in the human population, and its slow start to transgas NA genome of approximately e packaged in each virion bringing the total space lent to the genetic modification of the ies safetyll ene expression. Additionally, AAV is difficult to produce on a large scale and hsomewhat limited effectiveness in rapidly dividing cells. Human immunodeficiency virus based The human immunodeficiency type 1 viral (HIV-1) vector is an enveloped virus approximately 120nm in diameter. HIV-1 consists of an R 9kb. However, two copies of the genome ar for therapeutic RNA to 18kb (Kumar et al, 2001). While the wild type virus primarily transduces lymphocytes the HIV-1 vector has been adapted to accept a wide variety of envelope glycoproteins from different envelopedviruses. This process is called pseudotyping and is equiva Ad or AAV capsid proteins. For example, pseudotyping the vector with an Ebola virus envelope causes preferential transduction of airway epithelial cells. The most common pseudotype protein for the HIV-1 vector is the vesicular stomatitus virus glycoprotein (VSV-G). The VSV-G pseudotype helps to stabilize the vector particles andbroadens the tropism of the vector since the receptor for VSV-G is a phospholipid. As with AAV, the HIV-1 vector has been used successfully across many specand in almost every tissue in the body. The wild type HIV-1 genome consists of nine genes, but five of these are completely unnecessary for vector function. To increase all five of these genes are deleted from the vector and the other four genes are expressed in trans and then only during production of the vector. After entering the cethe vector genome is actively transported into the nucleus of both dividing and non

PAGE 32

21 dividing cells where it integrates permanently into the genome. The nuclear transportintegration process happens very quickly allowing transgene expression to proceed within12-24 hours following infection. This integration is random with some preference toareas in the genome with relaxed chromatin structure. The vectors stable integration in the genome results in long-term (greater than one year) transgene expression. The HIV-1 vector is very amenable to in vivo therapeutic gene transfer due to itslarge size, low immunogenicity, long-term expression, and ability to infect both dividing and non-dividing cell types. However, since this vector is based on a human p and athogen there o tor in e-fold. First, gene therapy for CVD will likely m expression of transgene thereby eliminating naked and complexed DNA he will always be concerns about its safety. Additionally, the vector is still difficult tproduce in large quantities and because it is an integrating vector there exists the possibility for insertional mutagenesis. Vector choice Based on the above descriptions we made the decision to use the HIV-1 vecour experiments. The reasons were thre require long-ter along with classical Ad vectors. The helper-dependent Ad vectors were not available at the start of these experiments, but they still would not have been chosen dueto their tropism and contaminating helper virus issues. Additionally, we wanted the option of using large transgene cassettes with multiple regulatory elements and thepossibility of using our therapeutic gene in situations where it must express immediately, like during restenosis or after myocardial infarction, was a possibility. Therefore, theonly logical choice was the HIV-1 vector. Much of my work was spent improving tlarge-scale production methods.

PAGE 33

22 State of the Field: Gene Therapy for Cardiovascular Disease Gene therapy for cardiovascu lar disorders is of major clinical interest due to the risingly a myriad of vecton y gene or the inhibition or knockdown of a vasoconstrictor molecule. Knoc s eotide antisense molecules to the beta 1 the impact of such diseases both economically and socially. Not surp r systems and therapeutic genes have been utilized depending on the specific disorder being tackled. Three major areas for CVD gene therapy are covered below. Hypertension Antihypertensive gene therapies have focused on primarily either the introductio of a vasodilator kdown is classically achieved through the use of antisense technology, but recent advances in double stranded RNA inhibition appear to be promising alternatives to thisapproach (Brantl 2002). These techniques allow specific targeting of a constrictor genemRNA through the introduction of complementary nucleic acid. The resulting double stranded RNA is a target for degradation by endogenous cellular machinery. Viral and non-viral methods have made use of such an approach. Antisense was used successfully against beta 1 adrenergic receptors, ACE, and theAT1R. Ian Phillips group delivered non-viral oligonucl receptor into the systemic circulation of spontaneously hypertensive rats (SHR). Asingle dose of the antisense oligo was able to decrease systolic blood pressure by 35 mmHg for 30 days (Zhang et al, 2000). Cardiac contractility was significantly reduced during this period, and the authors suggest this as the major mechanism of action for nucleic acid drug. However after 30 days the antisense effect began to reverse with the values for both parameters returning to baseline. While these findings are a significant step forward with regards to required daily administration of antihypertensive medication, there is still room for improvement.

PAGE 34

23 To address this, Mohan Raizadas group at the University of Florida deveretroviral vectors encoding both ACE and AT1R an loped tisense. Systemic administration of the Aense g in expressing either humay o play a significant role in pathole to the SHR by CE antisense vector into the neonatal SHR resulted in an approximate 15 mmHg drop in blood pressure in the animals when measured in adulthood (92 days of age) (Wang et al, 1999). This finding illustrates the much longer term nature of viral-mediated antisense transduction versus oligonucleotide transfection. The AT1R antisvector showed more impressive results with a drop in blood pressure of >35 mmHadult animals for a period of at least 90 days (Iyer et al, 1996). Additional effects were also shown including decreased cardiac hypertrophy, improved endothelial cell functionand decreased perivascular and cardiac fibrosis (Martens et al, 1998). The major sense approach to hypertension originates from the lab of Julie and Lee Chao at South Carolina. Using an adenoviral-based vector system n kallikrein or adrenomedullin, they were able to reduce blood pressure in a varietof models of hypertension. Kallikrein gene transfer into the quadriceps reduced blood pressure in the SHR for 5 weeks (Xiong et al, 1995). In an animal model of renal failure, kallikrein transduction again reduced blood pressure in Dahl salt-sensitive rats for four weeks while also significantly improving cardiac hypertrophy and fibrosis and renal function (Chao et al, 1998). Similar effects were also demonstrated in the Goldblatt model of hypertension (Yayama et al, 1998). The impact of reactive oxygen on blood pressure and especially nitric oxide bioavailability has only recently been shown t physiology. In fact, Donald Heistads group at the University of Iowa was abreduce mean arterial blood pressure and rescue impaired vasorelaxation in

PAGE 35

24 transferring the free radical scavenging enzyme, superoxide dismutase, via an adenoviralvector (Chu et al, 2003). The future of antioxidant gene therapy for hypertension looks very promising at this time. Even the formidable disease of pulmonary hypertension has been attacked with gene therapy. No effective p harmacotherapy exists for this disorder, but gene transfer of the poed ssels, and the myriad of cell types they are comprised of, represent major scular disease gene therapy. Anna Dominiczaks group at the Univeal, wn haps ctor ic e tassium channel Kv1.5 into the lung or prostacyclin synthase into the liver resultin lowered pulmonary pressures (Suhara et al, 2002; Pozeg et al, 2003). These findings should stimulate more interest in addressing the problem of pulmonary hypertension via gene therapy. Vascular disease Blood ve targets for cardiova rsity of Glasgow in the United Kingdom used an adenovirus encoding superoxide dismutase to improve endothelial dysfunction in the stroke prone SHR (Fennell et 2002). Other groups have explored ways to improve new blood vessel growth, or angiogenesis, in response to ischemia. Human tissue kallikrein gene delivery was shoto augment ischemia-induced angiogenesis in the SHR (Emanueli et al, 2001). Perthe most well known and by far the most clinically explored gene therapy for angiogenesis originates from the late Jeffery Isners group at Tufts University. Their work has focused on plasmid-based delivery of vascular endothelial growth fa(VEGF) to aid in collateral angiogenesis in peripheral arterial disease (PAD) and myocardial ischemia (MI). In fact this plasmid-based approach was used in the clinbeginning in 1994. The trial for PAD exceeded all expectations following the demonstration of the growth of countless numbers of new collateral blood vessels in th

PAGE 36

25 limbs of patients suffering from PAD (Baumgartner et al, 1998). The trial usinmyocardial muscle delivery of the VEGF encoding DNA produced impressive results also. In over 30 patients, who previously failed all conventional therapy, the VEGF encoding plasmid successfully decreased the number of angina attacks and nitroglyceritablet consumption by over 15-fold (Losordo et al, 1998). The success of VEGF therresulted in further successful angiogenic experiments with fibroblast and hepatocyte growth factors in animal models of disease. Cardiac disease Cardiomyocytes themselves are anothe g direct n apy r important target for anti-CVD gene ant therapy with an adenovirus encoding superoxide dismutase was show% In the nd Discovery The first non-replicating lentiviral vector was reported in 1990 and was designed to aid investigations into wild-type HIV-1 biology (Sakai et al, 1990). The first therapy. Antioxid n to protect rabbit myocytes in vivo against MI, reducing the infarct size by 50when given prior to the MI (Li et al, 2001). Victor Dzaus group from the Harvard Medical School pre-delivered another antioxidant gene, heme-oxygenase 1 (HO-1), to adult rats in an adeno-associated vector and prevented over 75% of the infarct zone following MI (Melo et al, 2002). Eduardo Marbans group at Johns Hopkins focuses onheart failure and arrythmia. Recently they showed the ability to create pacemaker activity in non-nodal cardiomyocytes through the use of an adenoviral vector encoding a dominant negative inward rectifier potassium channel (Kir2.1) (Miake et al, 2002).future it may be possible to use such manipulation in place of mechanical pacemaker implantation. Lentiviral Vectors Development a

PAGE 37

26 pseudotyped (viruses enveloped with a non-native pro tein) particles were reported later as successfully produced using the murine leukemia virus its per ay ). ntivector use and development really began in 1996 after Naldini et al pubain e ability to that year after infectious virus w 4070A amphotropic envelope glycoprotein (Trono and Baltimore 1990). The quantitative titers of these initial vectors were approximately 105 infectious unmilliliter (IU/mL). However, the gene transfer potential of these vectors went unnoticed until Buchshacker and Panganiban hypothesized in 1992 that such defective lentivectors mbe useful therapeutics for the treatment of AIDS (Buchschacher and Panganiban 1992The modern age of le lished their seminal paper in Science showing successful transduction of brtissue in vivo (1996) Their manuscript was key for several reasons: (i) the first deletionswere made in the virus to improve safety without sacrificing efficacy; (ii) the particles were pseudotyped with the vesicular stomatitus virus glycoprotein (VSV-G) resulting in titers of 5 X 105 before and 5 X 108 IU/mL after concentration; and (iii) most importantly, they were the first group to use the lentivector system in a non-dividing cell type (neurons). This set the stage for the future of the lentivector. The theme with eachnew generation of vector is ever increasing safety through further deletions, versatility through altered envelope pseudotyping, and efficacy through re-engineered production/concentration protocols. The lentivector is attractive to many investigators due to its inherent abilities to transduce both dividing and non-dividing cells, direct long term expression, and produce little to no immune response (Thomas et al, 2003). These traits coupled to th

PAGE 38

27 produce the vector in large quant ities and at high concentrations results in a vector system that is almost ideally suited for therapeutic gene transfer. Lentiviral Vector Design and Molecular Biology The HIV-1 virus is a so-called comp lex retrovirus belonging to the Lentivirinae family. This means it shares conserved stru ctural and enzymatic genes encoding the Gag, Pol, and Env proteins with other retroviruses while at the same time the virus encodes for an additional two regulatory genes (tat a nd rev) and four accessory genes (vif, vpu, vpr, and nef). It is these additional genes wh ich set apart the lentiviruses from the oncoviruses. The major genes of HIV-1 biology and their importance to lentiviral vector development are detailed below (Figure 1-3). Figure 1-3. Wild-type HI V-1 genome organization. Gag-Pol The Gag-Pol fusion protein (p160) is cr eated by a ribosomal frameshift during normal Gag translation. During virus maturation a virally en coded protease cleaves the Pol segment away from Gag and further digests Pol into 4 additional proteins: Protease (Pro), Reverse-Transcriptase (RT), RNase H, and Integrase (IN). Pro is an aspartyl protease dimer whose act ivity is required for the cleavage of the Gag and Gag-Pol polyprotein. The RT prot ein has both an RNA and DNA-dependent polymerase activity. Functional RT can be found in the capsid of budded virions and because of this viral DNA can be comp letely synthesized in 6 hours following

PAGE 39

28 transd uction. The RNase H protein is necessary during the action of RT. RNase H digests the original RNA template from the newly created first strand of DNA allowingsynthesis to begin on the complementary strand. Integrase mediates the insertion of thviral genome into the transduced cell. Gag-Pol expression is required during viproduction and packaging. Env This 160 kDa glycosylated protein (gp160) is further processed by the host cell into120 (gp120) and 41 kDa (gp41) proteins. The gp120 protein translocates to the cell surface and interacts with g e ral vector p41 to aid in its incorporation into budding virions. The dictates the tropism of the virus toward T-cells and primary macrophages by its ability pe envelope is based greatly improve transduced by the envelope proteins parent virus. For example, lentivector particles gp120 to bind the CD4 molecule on these cells surfaces. The gp41 protein has been shown to aid in viral fusion with the cell membrane (Huang et al, 2003). Env expression is completely dispensable with regards to vector production. Infact, one of the major benefits of the lentiviral vector is the fact that it is pseudotypeable. This means Env proteins from different viruses can efficiently be substituted for the native HIV-1 Env. The most commonly used pseudoty on the vesicular stomatitus virus glycoprotein (VSV-G) (Yee et al, 1994). The incorporation of the VSV-G into the coat of the vector has been shown tothe stability of the vector, and because the purported receptor molecule for VSV-G is aphospholipid, it broadens the tropism of the vector to include every cell type in the body (Guibinga et al, 2002). In fact these pseudotype Env proteins can do more than just alter stability of the particle; they can be used to specifically direct the vector to cell types normally

PAGE 40

29 pseudotyped with the rabies glycoprotein have been shown to undergo neuronal retrograde transport in th e same manner as the native rabies virus (Mazarakis et al, 2001). This firway ent essfully s the ar export signal (NES). The NES is then free to interact with nucleoporins, nuclear expord for stems has not eat is achieved by simply exchanging the outer envelope protein. Additionally, pseudotyping with the Zaire Ebola virus glycoprotein preferentially transduces aepithelial cells versus VSV-G pseudotyped vector, a potential advantage for the treatmof cystic fibrosis and other epithelial disorders. Lentiviral vectors have been succpseudotyped with several envelope glycoproteins including those mentioned above along with the murine leukemia virus (MuLV), lymphocytic choriomenigitus virus (LCMV),and Mokola virus envelope glycoproteins (Watson et al, 2002; Duisit et al, 2002). Rev Rev protein is expressed to circumvent the normal process of intronic splicing and is therefore crucial for virus production. Rev is known to bind a multi-stem loop structure on the viral RNA known as the Rev-response element (RRE) in a multimeric fashion (Lesnik et al, 2002). This binding in turn exposes a region in Rev known a nucle t receptors, and other components of the infected cells native export machinery to facilitate export of partially or un-spliced viral transcripts. Rev function is requirethe cytoplasmic translation of the splice site containing Gag-Pol mRNA. For these reasons the Rev protein, or some functional replacement of it, must be expressed during lentiviral vector production. Additionally, the RRE should be present on any transcript destined to be packaged into therapeutic virus. To further improve biosafety, some groups have exchanged the HIV-1 based Rev/RRE system for other similar spliceosome-evading strategies of other viruses. The use of such sy

PAGE 41

30 becom e widespread due to the approximately 10-fold lower vector titers obtained from these systems (Wagner et al, 2000). Tat The Tat protein is a transcriptional transactivator that acts at the 5 long terminarepeat (LTR) region. Tat forms a complex with other host proteins at a nascent viral RNA hairpin known as the trans-activating response element (TAR). Once bound, the Tat complexes direct hyper-phosphor l ylation of RNA Polymerase II and enhance criptional activity by 100 to 500-fold (Roebuck and Saifuddin 1999). s n he Vpr in the This 16 kDa polypeptide has been shown to both downregulate the CD4 molecule (the H to the lentiviral vector. trans In lentiviral vector design the Tat protein is dispensible. Chimeric 5 LTR regionable to direct robust tat-independent transcription have replaced the native 5 LTR promoter sequence (Mitta et al, 2002). However, the TAR motif is essential for initiatioof reverse transcription in the transduced cell and therefore should be present on ttherapeutic construct. The Vpr protein is carried into infected cells inside the virus and plays a role nuclear import of the viral genome (Krichevsky et al, 2003). Additionally, Vpr has been shown to cause G2 phase cell cycle arrest. It is unnecessary in the lentiviral vector. Vpu IV-1 receptor) and to enhance the release of infectious virions (Piguet et al, 1999). In the absence of Vpu the majority of newly formed virions merely accumulate at the cell surface and never successfully bud. It has been shown to be dispensible with regards

PAGE 42

31 Vif Vif is a 23 kDa polypeptide essential for replication of HIV-1 in certain cell types. In most cells some unidentified endogenous protein can complement Vif function (Lake et al, 2003). Vif is incorporated into virions. This peptide is also unnecessary for proper lentivector function. Nef Negative factor (Nef) is a 27 kDa myristolated protein whose primary action is to post-t proper lentivector performance. of the Field: Lentiviral-Based Vectors question, however, from their rall safety profile of the vector. To this end mathogen. solution to this problem was to make use of other Lentivirinae familved ranslationally decrease the expression of CD4 in infected cells (Fackler and Baur 2002). This action has been shown to actually increase virus production. Nef is packaged into virions and is the first viral protein to accumulate following HIV infection. Nef is not needed for State Since their first in vivo usage in 1996 the lentiviral vector development and utility has been improving and expanding by leaps and bounds. This next section details the current state of the art. Alternative lentiviruses The efficacy of lentivirus-based vectors is of no inception much emphasis was placed on the ove any molecular safety valves were ingressed into the vector system, but to some investigators these improvements simply did not change the fact that the entire system was based on a human p To these groups the y members not shown to cause human disease. Good transfer efficacy was achieusing equine infectious anemia virus (EIAV) and feline immunodeficiency virus (FIV)

PAGE 43

32 derived vectors (Olsen 2001; Curran and Nolan 2002). Both vector types performed similarly to HIV-1 based lentiviral vectors and were used to transduce equivalent targetcells. Even the less virulent HIV-2 strain was developed as a lentiviral gene transfer vecto or ors lead the field and will most probably be the first tlly rate that non-targeted delivery of lentivector into the systemic ditionally capable of transducing lung, adrenal gland, and even the testes (Cole a mber r (Gilbert and Wong-Staal 2001). However, the highest titers of these vector systems remain up to 100-fold lower than the HIV-1 lentivectors. Additionally, for the very reason that HIV-1 is a human pathogen the scientific and medical community have much more knowledge about itsbiology. There are simple and fast diagnostic tests for HIV infection and the clinic is arrayed with multiple antiretroviral pharmacotherapies specifically targeted at HIV. Fthese reasons the HIV-1 based lentivect ype of lentiviral vectors used in the human clinic. However, the further development of the alternative lentivirus systems should continue. As we learn more about these other lentiviruses they may soon approach the overall performance of the HIV-1 based systems. In vivo usage Since its first in vivo usage in 1996 the lentiviral vector has been utilized by numerous investigators to transduce a myriad of target cells. Organs successfutransduced with a targeted injection of lentiviral vector include the heart, brain, liver, eyeblood, pancreas, spleen, kidney, skeletal muscle, and skin among others. In the work detailed here I will illust circulation is ad man et al, 2003). These results indicate the potential for this vector system inwide range of organ systems. Additionally, the lentivector was used to correct a nuof defects in animal models of human genetic disorders including cancer, cystic fibrosis,

PAGE 44

33 parkinsons disease, sickle cell, huntingtons disease, thalassemia, retinitis pigmentosadiabetes, porphyria, ischemic myocardium, and hemophelia. Lentiviral vectors have alsbeen used to combat HIV infection and even to help slow the progression of aging. Recently, lentiviral vectors were used to efficiently create transgenic rats, a species traditionally refractory to the often used microinjection technique used to make transgenic mice (Hamra et al, 2002; Lois et al, 2002). Surprisingly, very few examples of cardiovascular disease models have been targeted with lentivirus-derived vectors. In fact, most of the cardiovascular system work with the lentivector was performed in the last two years. In 2002, it was reported thalentivirus expressing a fragment of matrix metalloproteinase 2 was capable of inhibiangiogenesis while earlier that year a group from New York illustrated that lentiinfused into the ureter efficiently transduced cells in the o t ting vector kidney, a traditionally difficult target. than ten years from the date the first generation of lentiviral vectors were used in vivo. to gene transfer (Gusella et al, 2002). In 2003 we published our findings on effective transfer into several organs of the cardiovascular system of neonatal animals while two other groups demonstrated tremendous (80-90%) in vivo transduction of cardiomyocytes in adult mice (Bonci et al, 2003; Fleury et al, 2003). While all of these findings contribute evidence that targeting of the CV system is possible with the lentivector no group has yet prevented or reversed any form of CVD with the lentivectorThe first proposal using an HIV-1 vector in a clinical trial was submitted for approval in 2001 (MacGregor 2001). The goal of this study was to use antisense technology to suppress the expression of the HIV env gene in T cells of seropositivepatients currently failing antiretroviral therapy. If approved, this trial would begin less

PAGE 45

34 Such a short time frame from discovery to clinic is a testament to the utility of thelentiviral vector system. Aimsand i) eady done, and (ii) The requirement for a daily drug regimen ffects results in low patient compliance leading to a general mis-manalready tablished. d a large nucleic acid payload capac d and Rationale As detailed in this first chapter, CVD is the number one killer of Americans management of the disease has enormous socioeconomic impacts on this country. Hypertension is the most common CVD with over 50 million Americans currently diagnosed. Modern antihypertensive pharmacotherapy is lacking in two main aspects: (It only treats the symptoms of the disease while not efficiently reversing the physiological damage alr and drug related side e gement of the disease. For these reasons, radical new methods for the management and possible cure of hypertension must be elucidated. Successful gene therapy for the prevention and reversal of hypertension has abeen demonstrated. However, in each case a certain aspect was lacking. The ultimate goal of antihypertensive therapy should be to reverse the disease once it is esFor this to be achieved the ideal gene transfer vector must be utilized. The ideal vectorwould efficiently target quiescent cells since this disease is generally found in the adult population. Additionally the vector must be easily produced and be as safe as possible for use in humans. Site specific genomic integration an ity are also important. The lentivirus-based vector system satisfies the majority of these requirements. The overall goal of the work described here was to develop a user-friendly lentivector system for systemic gene transfer to the cardiovascular system. Thiswould set the foundation for future work using the vector system in the general study anpossibly treatment of hypertension. The specific aims for this work are detailed below.

PAGE 46

35 Aim 1: Create a more user friendly lentiviral vector system. (a) Modify the core cloning constructs to include multiple unique site and varioubicistronic marker gene cassettes. (b) Develop a reproducible transfection protocol using decreased amounts of DNAwithout compromising vector titer. (c) Engineer simple concentration methods permitting the large scale production of high titer vector stocks. s m in non-dividing cells in vitro. (a) Transduce growth-arrested and primary cells relevant to the cardiovascular system. (b) Assess transgene expression and determine transduction efficiency. Aim 3: Deliver the lentiviral vector systemically into the cardiovascular system and charasduction efficiency. Aim 4: Prevent the development of cardiovascular disease in the SHR using systemnitor blood pressure along with other hypertensive pathophysiology following the sy Aim 2: Characterize the efficacy of the lentiviral vector syste cterize its efficacy. (a) Determine tran (b) Assay duration of transgene expression. ic delivery of the lentiviral vector. Mo stemic administration of the vector.

PAGE 47

CHA PTER 2 IMPROVING LENTIVIRAL VECTOR PRODUCTION RESULTS IN THE ABILITY TO CONSISTENTLY PRODUCE VECTOR ON A LARGE SCALE. Introduction As discussed previously, it is quite clear that lentiviral vectors are fast becoming the vector of choice for long-term gene transfer into dividing and non-dividing cells. This fact is due to the many benefits associated with the lentiviral vector systems including large payload capacity, low immunogenicity, and wide tropism. This increased interest has given rise to a need for efficient and reproducible methods to produce large quantities of vector. As more investigative genes are cloned into the lentivirus, there is an additional need for utilitarian cloning constructs thereby allowing ease in cloning and also the possibility for the bicistronic expression of marker genes for the identification of transduced cells. The traditional production of lentiviral vector involves the co-transfection of human cell lines with plasmid DNA encoding the viral components required for packaging. The transient transfection of these cell lines is usually achieved using the conventional calcium phosphate co-precipitation methodology. Disadvantages of this method include: (1) the large amount of plasmid DNA that is required for transfection; (2) the difficulties associated with scaling up the precipitation reaction; and (3) the high degree of variability observed in transfection efficiency and viral production. Recently, several groups have developed packaging cell lines that facilitate the production of lentiviral vectors by reducing the need for multi-plasmid transfections. Although the use 36

PAGE 48

37 of packaging cell lines has streamlined the packaging procedure, the resulting viral titers have not been significantly higher than those obtained using transient co-transfection methods. In addition, the advantages of these new cell lines are often offset by the need to dscale production of high-titer lentiviral vector it is critical that transfection of the virus-produn arget e ntration protocol. The result was the reproducible production of higheired e array ay e evelop new lines for each generation of improved lentiviral vector. To achieve largecing cell cultures be both efficient and reproducible; however, little effort has beeput forth to optimize this step in vector production. To target a disease like hypertension with gene therapy it may be critical to tmany different cells or cell types distributed throughout the body. To achieve this using a single dose of vector would require its systemic administration into the circulation. Reaching this goal with any gene therapy vector would require methods to easily producit on a large scale. Therefore to reach such a level with the lentivirus we developed methods utilizing a dendrimer-based transfection reagent, SuperFect (Qiagen), coupled with a novel conce r titer virus using one-third less the amount of plasmid DNA traditionally requwhen using calcium phosphate co-precipitation. Additionally, we designed a widof cloning constructs used to produce the lentivector. These were designed in such a wto simplify the cloning of new genes of interest into the vector system and also enable thbicistronic expression of a marker gene to simultaneously identify transduced cells. Finally, vectors produced using these new methods were assayed for in vivo efficacy in adult rat brain.

PAGE 49

38 Results TYF Cloning Vector Improvements The plasmid DNA constructs used to produce the lentiviral vector are denoted as pNHP, phEF1.VSV.G, and pTYF (Figure 2-1). The pNHP plasmid encodes all the viral Figure 2-1. Three plasmid system used to pr oduce recombinant lentiviral vector. From top to bottom, pNHP, phEF 1.VSV.G, and pTYF backbone. proteins necessary for the production of infectio us virus in trans. It is important to note the open reading frame deletions of all th e unnecessary accessory genes (vif, vpr, vpu, and nef) along with the native env gene. Expression of the pseudotype env gene is achieved by the co-transfection of the phEF1.V SV.G construct. This plasmid expresses the vesicular stomatitus virus glycoprotein (V SV-G) under the control of the constitutive human elongation factor 1 alpha promoter (hEF 1). The TYF family of vectors are the only component of the system containing an intact psi ( ) packaging signal and fully functional long terminal repeats (LTR). Th e therapeutic gene is cloned into this construct, therefore, modification were made to this plasmid in order to facilitate cloning and improve the overall utility of the vector system. The newly created family of

PAGE 50

39 constructs are illustrated in Figure 2-2. It is important th e note the large number of unique cloning sites and the fu rther inclusion of an intern al ribosome entry site (IRES) based bicistronic cassette. Th e IRES-containing vectors have been successfully used to create stable cell lines in vitro (IRES.NEO), assay live cell transduction in vitro (IRES.EGFP), and to localize transduction in vivo (IRES.PLAP). Figure 2-2. The pTYF family of modified cloning vectors. Only the unique cloning sites are indicated for each construct. From top to bottom, pTYF.Linker, pTYF.hEF1.Linker, pTYF.hEF1.IRES.EGFP, pTYF.hEF1.IRES.PLAP, pTYF.hEF1.IRES.NEO, and pTYF.hEF1.IRES.Hyg-EGFP Vector Production Modifications The goals of our first series of experiments were to determine the optimum ratio of total plasmid DNA to Superfect reagent that produced the highest titer virus and the optimum time for viral harvest. This ratio wa s determined to be 1:2 (ratios of 1:1, 1:1.5,

PAGE 51

40 1:2, 1:5, and 1:10 were tested; data not shown). The titers of virus-containing mediharvested directly from transfected 293T cultures were determined 30, 45, 60, and 7hours post-transfection to identify the timeframe during which virus production by thesecultures is at maximum levels (Figure 2-3). The average titer values were 8.0 x 106, 6.8 x106, 2.6 x 106 and 0.8 x106 transducing units (TU) per ml at 30, 45, 60 and 70 h pansfected 293T cultures were determined 30, 45, 60, and 7hours post-transfection to identify the timeframe during which virus production by thesecultures is at maximum levels (Figure 2-3). The average titer values were 8.0 x 106, 6.8 x106, 2.6 x 106 and 0.8 x106 transducing units (TU) per ml at 30, 45, 60 and 70 h p 2 2 a 0 ost-transfection, respectively. Therefore, we collected culture media 30 and 45 hours postFigure 2-3. Lentivector production is greatest within the first 48 hours following transfection. Packaging cells were transfected with the appropriate plasmids to produce TYF.hEF1.PLAP vector. Un-concentrated supernatants were collected at the indicated times and titered on TE671 cells (n=3). 0 ost-transfection, respectively. Therefore, we collected culture media 30 and 45 hours postFigure 2-3. Lentivector production is greatest within the first 48 hours following transfection. Packaging cells were transfected with the appropriate plasmids to produce TYF.hEF1.PLAP vector. Un-concentrated supernatants were collected at the indicated times and titered on TE671 cells (n=3). transfection for subsequent experiments. It should also be noted that 293T cells passaged between 2 and 60 times were used for transfections and that passage number did not significantly affect transfection efficiency or final vector titers. transfection for subsequent experiments. It should also be noted that 293T cells passaged between 2 and 60 times were used for transfections and that passage number did not significantly affect transfection efficiency or final vector titers. Virus titer (x 106 TU/ml) 46810 Virus titer (x 106 TU/ml) 46810 Harvest time (hours post-transfection) 0 30456070 Harvest time (hours post-transfection) 0 30456070

PAGE 52

41 Concentration Protocol Modificat ions st 40 44 x delivered into the paraventricular (PVN) and the caudal nucleus of the solitary tract (NTS) of the adult rat brain. Examination of transverse sections cut from the brains of animals either 7 days (PVN) or 30 days (NTS) after injection revealed that the vector transduced a high proportion of cells in both nuclei as evidenced by the presence GFP-positive cells (Figure 2-5). Many GFP-positive cells exhibited a neuronal phenotype (Figure 2-5, C) and in many cases fluorescent axons could be seen hundreds of microns away from the area of concentration of fluorescent cell bodies. Although not shown, robust expression was shown for up to 90 days, the duration of the experiment. The goal of our second series of experiments was to develop a concentration protocol that would minimize virus loss and yield the highest titer virus in the smallepossible volume. The concentration procedure and results are summarized in Figure 2-4. The average starting titer of the virus-containing media (Figure 2-4, Steps 1-3) was 1. 0.35 x 107 TU/ml. The next step in the concentration procedure (Figure 2-4, Step 4) yielded an average titer of 3.59 0.70x 108 TU/ml in a volume of ~3.0 ml, resulting in a 33-fold increase in titer and an average recovery of 84%. Further concentration of the virus stock by low-speed centrifugation (Figure 2-4, Steps 5c and 6) yielded 1.40 0.1010 TU/ml, a 958-fold increase over the average starting titer. The average overall percent recovery of the virus was 40%. Lentivector Performance in the Brain In Vivo Lentiviral vector carrying an hEF1-EGFP transgene was

PAGE 53

42 Figurrs. Multiple preparations of TYF.hEF1.PLAP lentiviral vector were concentrated Harvest virus at 30 h post-transfection (~20 x 7.0 ml)Concentrate by ultrafiltration (2 x Centricon-80 units)Harvest virus at 45 h post-transfection (~20 x 6.5 ml)Combine virus from step 2 and step 3aOverlay 30 ml virus onto 220 l iodixanol (x 4 tubes)Centrifuge at 50k x g for 2.5 hDay 1 Remove supernatant down to DMEM-iodixanol interfaceCombine virus from 4 tubes (Step 4a) and add to 3 ml tubeCentrifuge at 3k x g for 20 hRemove supernatant and add buffer to resuspend virus pellet to achieve an approximate 3000-fold volume change.Day 2 Day 3 1.2.3.a.b.4.5.6.a.b.a.b.c. Concentration e 2-4. A modified lentivector concentration protocol results in higher final titeas indicated and titered on TE671 cells. Discussion By optimizing both the DNA transfection and viral concentration steps for production of lentiviral vector, we have overcome many of the problems that we had previously encountered in our efforts to produce large volumes of high-titer lentiviral vector in a consistent manner. We found that SuperFect-mediated transfection of viral packaging cells consistently yielded large-scale vector stocks (~120 ml) with starting *Mean SEM derived from 13 separate large-scale virus preparations***Titer (TU/ml) Approx. volume Titer increase (fold) %Virus recovered StepStepStep 8 change (fold) 3b 1.40 0.35 x 107 n/a n/a n/a 5b 3.59 0.70 x 108 40 33 4 84 9 6 1.40 0.44 x 1010 3000 958 191 40 r Tite

PAGE 54

43 titers averaging >1.0 x 107 TU/ml, titers that were comparable to vector stocks prepusing other transfection reagents (Curran ared et al, 2002; Fleury et al, 2003; Gusella et al, nsfection protocol and significantly reducedation Figure 2-5. Lentiviral vector efficiently transduces neurons in the adult rat brain in vivo. Vector encoding EGFP (TYF.hEF1.EGFP, see Chapter 3) was prepared using the transfection and concentration schemes outlined above. The left-most panel illustrates green fluorescence in the paraventricular nucleus (PVN) 7 days after the delivery of 5 X 105 transducing units of vector (n=2). The PVN is highlighted in red in the inset drawing. The center panel illustrates similar results achieved in the nucleus of the solitary tract (NTS) 30 days after the bilateral delivery of 3 X 105 transducing units (n=2). Inset illustrates in red the location of the NTS. The right-most panel is a magnified, pseudocolored image of an EGFP-positive neuron from the NTS. Additionally, we illustrated some modifications introduced into the TYF vectors allowing an increased ease in cloning new genes of interest into the lentivector system. Bicistronic expression cassettes were also created to allow the simultaneous expression of marker protein or second therapeutic gene. 2002). Use of SuperFect greatly simplified the tra the amount of plasmid DNA required for the procedure. The viral concentrprotocol that we developed consistently increased the titers of the viruses by approximately 1000-fold (~1 x 1010 TU/ml). Lentiviral vectors produced using these novel methods were shown to be able to efficiently transduce non-dividing cells (neurons) in vivo. PVN 200m 150m NTS

PAGE 55

44 In summary, the transfection and concentration protocols outlined here allow efficient, reproducible production of high-titer lentiviral vectors that exhibit robust transduction properties in vivo. The transfection protocol itself is simple and can be easily implemented by investigators interested in producing lentiviral vector in their laboratories. Furthermore, the methods can be easily adapted to large-scale lentiviral production protocols that are currently being developed for use in large animal studies or for possible use in clinical studies.

PAGE 56

CHAPTER 3 SEVERAL TISSUES IN THE RAT RELEVANT TO THE CARDIOVASCULAR large quantities it is necessary to characterize the vector system in cardiovascular (CV) target predicted to efficiently transduce these types of cells it has not been demonstrated Throo translate diinto the trothe whole majority of target tissues. To answer the questions regarding the in vitro and in vivo efficacy of the vector we utilized a construct expressing marker genes (PLAP, EGFP, nlacZ, or DsRED). The goal of these experiments was to determine if and under what conditions the lentivector could SYSTEMICALLY ADMINISTERED LENTIVIRAL VECTOR TRANSDUCES SYSTEM. Introduction Having shown that it is possible to produce lentivector reproducibly and in cells in vitro and in vivo. Lentiviral vectors have documented success in very few CV relevant cell types in vitro. Successful transfer of marker genes was demonstrated in primary cultured neurons and cardiomyocytes. To investigate or treat a systemic disorder like hypertension it may be necessary to transduce these cell types in addition to endothelial, smooth muscle, liver, and kidney cells. Although vector pseudotyped with the VSV-G envelope would be empirically. ugh the simple transduction of such cell types in vitro it cannot be inferred trectly to the in vivo performance of the vector. Such in vivo investigations pism of the vector are necessary to perform. Additionally, when moving to animal it is important to determine what vector dose is necessary to transduce a 45

PAGE 57

46 successfully transduce cell types and tissues of the CV system. We were able to show that the lentivector very efficiently transduc es cells in vitro relevant to the CV system includas o ng the transfection and concentration protocols detailed in the previous chapter. The PLAP and EGFP TYF constructs used in these studies are illustrated in Figure 3-1. Two additional TYF constructs were also utilized, one expressing a nuclear localized form of bacterial beta-galactosidase (nlacZ) and a second one encoding a red-shifted commercially available fluorescent protein (DsRED, Clontech). Figure 3-1. The pTYF lentiviral vector reporter gene constructs. The top vector encodes the PLAP gene and is denoted as pTYF.hEF1.PLAP. The vector illustrated on the bottom expresses the EGFP gene and is denoted as pTYF.hEF1.EGFP. The goal of the in vitro experiments was to simply assay the efficacy of the lentivector in quiescent, CV-relevant cell types. The first cell type tested was a cell line ing endothelial, neuronal, vascular smooth muscle, and liver cells. In vivo it wshown that the highest dose of vector examined, 2.5 X 108 total particles, was able ttransduce a myriad of tissues including heart, liver, kidney, lung, adrenal glands, and testes when administered into the systemic circulation of a 5-day-old rat. Results In Vitro Efficacy All vectors were produced usi RRE Gag F hEF1LTRTATACMV PLAPbGHpALTR RRE Gag F hEF1LTRTATACMV PLAPbGHpALTR PLAPbGHpALTR RRE Gag F hEF1LTRTATACMV EGFPbGHpALTR EGFPbGHpALTR

PAGE 58

47 of rat aortic endothelial cells. The cells were growth-arrested at confluency and transduced with a TYF.hEF1.nlacZ vector Staining at 48 hours post-transduction revealed that at 1 multiplicity of infection (MOI) approximately 50% of the cells were transduced. Two cell lines of vascular sm ooth muscle (A.10 and A7r5) were treated in the same manner and 20% of the cells were able to be transduced. A hepatocyte cell line (HepG2) was also growth-arrested and inst ead incubated with a vector expressing enhanced GFP (TYF.hEF1.EGFP). When inf ected at 5 MOI 80% of the cells were positive for EGFP expression 48 hours following viral incubation. Figure 3-2. Lentiviral vector efficiently transduces quiescent cells relevant to the cardiovascular system in vitro A) Growth-arrested A-10 vascular smooth muscle cells transduced with lacZ en coding vector. B) Growth-arrested pulmonary artery endothelial cells trans duced with lacZ encoding vector and counterstained with nuclear fast red. C) Grow th-arrested HepG2 cells transduced with EGFP vector. D) Primary cultures of hypothalamus / brainstem neurons transduced with EGFP vector.

PAGE 59

48 Primary cultures of neurons from the hypothalamus and brainstem regions were also transduced with TYF.hEF1.EGFP viral vector. At 10 days post-infection ~20% of the neurons were positive for EGFP expression when transduced at 10 MOI. A second DsRED expressing vector was used in the neurons to illustrate the ability of the lentivirus to infect the same cell multiple times thus transferring genes encoding for EGFP and DsRED (Figure 3-3). In all instances control treated cells were incubated with an equivalent amount of viral re-suspension buffer and examined for background activity. Figure 3-3. Separate lentiviral vectors are able to transduce the same cell in succession. ary neuron cultures were transduced at 10 MOI with EGFP expressing vector and 5 MOI with DsRED vector. Ten days following vector exposure the in vivo variet what Prim ACB the cells were assayed by direct fluorescence. A) Neuron viewed using a filter specific for EGFP, B) A composite picture of the same neuron merging the green and red fluorescent images, and C) Neuron viewed using a filter for the DsRED fluorescence. Bar = 50m In Vivo Efficacy For the in vivo studies all vectors were prepared using the methods detailed in Chapter 2 and only the PLAP expressing construct (TYF.hEF1.PLAP) was utilized. The objective of this second set of experiments was to determine three key points regarding performance of the vector: (i) The dose of vector needed to transduce a wide y of CV tissues; (ii) The duration of transgene expression; and (iii) Elucidaterelevant tissues are targets of systemically delivered vector. In all cases the vector was

PAGE 60

49 delivered into the systemic circulation of neonatal rats through direct injection inleft ventricular space. Dose-response Equal volumes of three doses (2.5 X 108, 5 X 107, and 2.5 X 107 total infectious particles) were injected into 5-day-old rat pups in replicates of four along with virus re-suspension buffer (a-CSF) injected controls. Animal were sacrificed and assayed fPLAP expression in the heart, liver, and lung at 3 (n=1 per group), 30 (n=2), and 60 to the or (n=1) days post-delivery. At all time points and in every tissue the highest dose of lentivector igure 3-4. Increasing doses of lentiviral vector results in higher transduction efficiency aline, P ted gh a dissecting microscope. resulted in the greatest degree of PLAP histochemical staining (Figure 3-4). No obvious adverse affects on the general health of the animals was noted. Based on these findings all in vivo work from here onward was conducted using the maximum dose of 2.5 X 108 particles. F in vivo. Neonatal Sprague-Dawley rats were injected with control (A) s2.5 X 107 (B), 5 X 107 (C), or 2.5 X 108 (D) total infectious particles of PLAencoding lentiviral vector. The ventricles of the heart were grossly dissec30 days post-delivery of vector and stained for PLAP activity (n=2 per group for time point shown). Images were acquired at low magnification throu

PAGE 61

50 Transgene expression duration 8 Six neonatal rats were transduced with 2.5 X 10 particles of PLAP expressing lentivy ed Expression levels at three days post-delivery were lower than all other time points. CSF). At 30 and 120 days post-delivery, 2 animals from each group were sacrificed and injected anliver, lung,highest trae heart (~30%). Within the heart 90-e cells were identified morphologically as cardiomyocytes (Figure 3-7). In ector along with an equal number of control injected (a-CSF) animals. Animals were sacrificed at 3 (n=1 per group), 30 (n=3), and 120 (n=2) days following the deliverof the vector. Heart, lung, liver, and kidney samples were collected and assayed for PLAP expression using histochemical staining. At all time points and in all three tissues PLAP expression was detected in the vector injected animals and could not be identifiin their respective controls. The results for the kidney are illustrated (Figure 3-5). Among the other time points no significant difference in expression was noted. Biodistribution of vector The final set of experiments utilized a PLAP encoding vector. A total of 2.5 X 108 infectious particles were administered into the circulation of 5-day-old rat pups. A total of eight animals were injected, 4 experimental and 4 receiving a control injection (aseveral organs were removed to undergo PLAP staining. At both time points in the virus imals only PLAP staining was seen in every tissue collected including heart, brain, aorta, kidney, adrenal gland, and spleen (Figure 3-6). Liver was the nsduced tissue (~60%) followed by th 95% of the positiv the 30 day old animal occasional single positive cells were found in the testes,however, in the 120 day old animal it was evident that some of the transduced cells in the tubule of the testes were indeed germ cells (Figure 3-8). No background staining was seen in any tissue of the control treated rats.

PAGE 62

51 Figure 3-5. Lentiviral vector expresses transgene for at least 120 days in vivo. Neonatal rats were injected with 2.5 X 108 total infectious particles of PLAP encoding lentiviral vector. Kidneys were removed and stained for PLAP activity at either 3, 30, or 120 days following viral delivery. Panel A illustrates a control animal of the same age. Images were acquired at low magnification through a dissection microscope. Discussion Knowledge regarding the use of lentivirus-derived vectors in the cardiovascular system is largely lacking. We report here several studies highlighting the use of DC AB for gene transfer into cardiovascularly relevant cells in vitro and in vivo. lentivector

PAGE 63

52 Lentivecto r was able to efficiently (from 1-10 MOI) transduce non-dividing endothelial, ooth muscle, neuronal, and liver-derived cells in vitro (Figure 3-2). Gene vascular smexpression occurred rapidly (within 48 hours) and lasted for at least 10 days in the case of the primary neuron cultures. These in vitro studies re-iterated the utility of the lentivector system, but in some novel cell types not previously transduced with lentivector. 8 the Figure 3-6. Systemically delivered lentiviral vector transduces multiple tissues relevant to the cardiovascular system. A total of 2.5 X 10 infectious particles were delivered to neonatal rats and tissues were collected and stained for PLAP activity (n=4 for each treatment group). In each lettered panel tissue from control animals is shown on the left: A) Heart, B) Adrenal Gland, C) Lung,D) Liver, and E) Kidney. Pictures were acquired at low magnification through a dissection microscope. The second set of experiments focused on the in vivo efficacy of the vector systemWhen delivered into the circulation of 5-day-old rat pups it was shown that the higher ED CBA

PAGE 64

53 dose of virus given the greater the amount of transduction (Figure 3-4). This finding seems intuitive, but many times gene transfer efficiency is shown to reach a plateau at aparticularly well transduced at approximately 6 point where additional vector doesnt necessarily result in increased transduction. I think e heart upwards of 95% of the positive cells expressed cardiomyocyte morphology (Figure 3-7transduce aproblem. W in our case this plateau is much higher than under normal circumstances due to the fact that our vector is injected and then disseminated throughout the entire blood stream of the animal. We are delivering the maximum dose currently possible. In the future, if higher titers can be obtained, I believe that systemically administered virus will transduce at an even higher level. We also examined the length of transgene expression following the similar delivery of the highest dose of vector. In this study gene expression was found up to 120 days, the duration of the examination period (Figure 3-5). In another study not detailed here expression was documented at 200 days post-delivery. Such results are not surprising due to the well documented long-term nature of lentivirus-mediated transgene expression (Barker and Planelles 2003). It could be expected that virus administered to a five-day-old animal will continue to robustly express transgene for the life of that animal. Lastly, and most importantly, we examined the biodistribution of systemically administered lentivector. To our surprise, lentivector-mediated transgene expression was found in varying extents in every tissue examined (Figure 3-6). The heart and liver were 0 and 30% respectively. Additionally, in th ). These results illustrate the overwhelming potential of the lentivector to wide array of tissue and cell types in vivo. It also illustrates a potential hen vector is administered this way it may be important to limit transgene

PAGE 65

54 expression through the use of cell specific promoter elements. In this way it becomes non-consequential if a cardiomyocyte promoter is used in the vector, but its major target happens to be hepatocytes. Figure 3-7. Lentivector effectiv ely transduces cardiomyocytes in vivo PLAP encoding vector was delivered into neonatal rats and ten micrometer thin sections were stained for PLAP activity. A) and B) Left ventricle sections with DAPI costaining as a nuclear marker (Bar = 25 m). C) Left atria section (Bar = 100 m). Surprisingly, our studies also showed that the systemically delivered lentiviral vector transduced germ cells in the male rat (Figure 3-8). To our knowledge, this is the first example of viral vector-mediated ge rm cell transduction in which transgene expression was detected using histochemical methods rather than PCR-based detection methods. Expression of PLAP was seen with in the testicular t ubule spermatogonia and included PLAP-positive spermatocyte, spermatid, and mature spermatozoa. Our observation of transduced germ cells in male rats, while intriguing, must be interpreted with caution with regard to its po tential impact on the use of lentiviral vectors for gene therapy. We believe that the transduc tion we observed could be attributed to the poorly developed blood-testicular barrier that is present in 5-day-old rats. It is our hypothesis that injections of le ntivirus after this barrier has matured will not result in transduction of germ cells. It would be in teresting to determin e if our hypothesis is correct by conducting these expe riments in adult animals.

PAGE 66

55 The results detailed here shed some light onto the use of the lentivector in the cardiovascular system. Vector dose along with duration of expression and biodistribution were examined. These parameters set the st age for the future use of a cardiovascularly relevant therapeutic gene in the lentivector. Figure 3-8. Systemically administered lentivir al vector is capable of transducing germ cells Lentivector encoding PLAP was de livered into the circulation of neonatal rats. The testes we re removed at various times and stained in toto for PLAP expression. Frozen thin sections were then prepared and analyzed. Samples are as follows: A) Control inj ected animal at 30 days post-injection, B) Three examples of different cell types within the testes in a vector injected animal at 30 days post-injection, C) Germ cell transduction in a 120 day old animal. Note the purple staining matu re sperm cells in the lumen of the tubule.

PAGE 67

CHAPTER 4 HE DEVELOPMENT OF CARDIAC HYPERTROPHY IN THE SPONTANEOUSLY ological conditions. Under pathological concentrations of Ang II the cardiac AT1R s increase left ventricular hypertrophy, interstitial fibrosis, collagen deposition, and up-regulate extracellular matrix gene expression (Wagenaar et al, 2002). If AT1R sites are pharmacologically blocked during pathophysiological exposure of the heart to Ang II these effects of the AT1R are avoided. Interestingly if AT2R sites are investigatoregulated ito suppress the actions of the over-stimulated AT1Rs. er sodium secret ANGIOTENSIN II TYPE 2 RECEPTOR GENE TRANSFER ATTENUATES THYPERTENSIVE RAT. Introduction The role of Ang II actions at cardiac AT1Rs is well characterized during both physiological and pathophysi blocked the effects via the AT1R are enhanced. For this reason, among others, many rs propose that during Ang II mediated cardiac disease the AT2Rs are up-n an attempt However, the role of the AT2R in the heart is still poorly misunderstood if not controversial. As an example, one can simply investigate the currently available transgenic mouse models. One mouse line was engineered to be completely devoid of AT2R expression in every tissue of the body (AT2R -/-). The AT2R -/mice were shown to have increased sensitivity to Ang II infusion exhibiting higher blood pressures (BP) and low ion rates compared to wild-type littermates (Siragy et al, 1999). Lower levels of bradykinin and cGMP were also indicated. Abdominal aortic banding resulted in similar 56

PAGE 68

57 increases in BP between strains, but the AT2R -/animals exhibited increased coronary artery wall thickening and increased perivascular fibrosis (Akishita et al, 2000). However, in this study no effect on cardiac hypertrophy was noted between the two strains. Using the same strain, another group showed that chr onic Ang II infusion was unablssential for induction of hypertrophy while the other side suggests no role at all for the AT2R in hypertrophy. A second transgenic mouse exists over-expressing the AT2R only in cardiomyocytes (Masaki et al, 1998). Upon chronic Ang II infusion in these mice a number of effects were noted both systemically and on the heart including increased BP, increased bradykinin and nitric oxide levels, decreased MAPK activity, and no effect on apoptosis in relation to control animals. Additionally, Ang II caused increased cardiac hypertrophy and atrial natriuretic peptide expression, a well accepted marker gene for hypertrophy. In contrast to the findings in the AT2R -/mice, a decreased perivascular fibrosis was noted in the cardiomyocyte-specific AT2R over-expressing mice (Kurisu et al, 2003). The findings with these mice support the hypothesis that the AT2R is involved in stimulating hypertrophy. Transgenic mouse models are extremely useful, but they suffer from the major complication of possible developmental effects due to the deletion or over-expression of e gene of interest. In the case of the ATR, it has already been implicated in the e to induce cardiac hypertrophy only in the AT2R -/animals while normal littermates did indeed develop hypertrophy (Ichihara et al, 2001). Together, these studies suggest two very differing roles for the AT2R with regards to cardiac hypertrophy. On one side of the coin, the AT2R appears to be e th 2

PAGE 69

58 developme nt of the CV system due to its high levels of expression during fetal life and t decrease following parturition. It is possible that alterations in AT2R levels or patterns through transgenesis could result in the improper concomitanexpressiondevelopment of the CV system. This fact did not escape the authors of the transgenic dies because they reported no observed super-structural CV abnormalities between transgenic and control mice. However, it cannot be ruled out that certain unforeseen molecular problems exist in the transgenic animals. These molecular abnormalities could manifest themselves as the changes reported in the studies highlighted above. To avoid developmental affects associated with AT2R gene perturbation it is necessary to allow cardiovascular development to proceed as normal in the presence of unaltered levels of AT2R expression. To achieve this a conditional transgenic animal must be created that will delete or over-express the AT2R on demand and after fetal development, or the AT2R gene could be regulated up or down through the use of gene transfer in neonatal or adult animals. The goal of this study was to elucidate the role of the AT2R on cardiac hypertrophy in the SHR following normal fetal development of the CV system. Such an approach will help determine the true role of the AT2R in hypertrophy. Lentiviral vector expressing the AT2R gene was created and characterized in vitro. Delivery of this vector into the systemic circulation of 5-day-old SHR prevented the development of cardiac hypertrophy versus control injected animals. Blood pressures of treated and control animals remained elevated and equivalent. These findings support a role for the AT2R in the attenuation of cardiac hypertrophy irrespective of blood pressure changes. stu

PAGE 70

59 Results Lentiviral Vector Design and In Vitro Assay Bicistronic lentivector TYF constructs were created expressing both the rat AT2R anwere shown to express both the ata not shown). AT2R -specific binding was assayed in stablyinese hamster ovary (CHO) cells. Usingnd 2igure 4-2). Specific activity equal to 4.85 pmol/mg of protein indicated robust expre22d n 2xperiments illustr2th 22lls e binding and appears to couple to its respective intracellular signa d either PLAP, Neo, or EGFP (Figure 4-1) from the hEF1 promoter. All constructs individual genes in vitro (d transduced Ch the TYF.hEF1.AT2R.IRES.Neo virus, CHO cells were infected at 1MOI and selected with G418 (1,000ug/mL) for 14 days. After selection, binding was conducted using radiolabelled Ang II (Sar-Ile-125I-Ang II) and selective AT1R (1M Losartan) aATR (1M PD123,319) antagonists (Figure 4-2). Scatchard analysis revealed a Kd of 0.82 nM (F ssion of the ATR transgene (Figure 4-2). Although not shown here, microarray experiments conducted by Beverly Metcalfe in Mohan Raizadas laboratory indicate that over-expression of the ATR using the identical lentivector was able to induce elevateexpression of both caspase-3 and PP2A without ligand. These two proteins are knowdownstream targets of the ATR signal transduction cascade. Together these e ate that the TYF-hEF1.ATR.IRES.Neo lentivector can successfully transfer bothe ATR and Neo genes in vitro and the ATR protein produced in transduced ceexhibits specific cell surfac ling cascade.

PAGE 71

60 Figure 4-1. Lentiviral vector constructs encoding the AT2R. In Vivo Delivery of TYF.hEF1.AT2R.IRES.Neo Large-scale preparations of TYF.hEF1.AT2R.IRES.Neo lentivector were prepared and 1.5 X 108 total particles were delivered into the left ventricular space of 5-day-old male SHR (n=5). Control animals received an injection of virus resuspension buffer (aCSF, n=6). At 11 weeks of age control ec hocardiography was performed on each animal. The initial measurement of left ventricular (LV) wall thickness indica ted neither group of animals were hypertrophic (p=0.57, Figure 43). Additional echocardiograms were measured 5 weeks later (at 16 weeks of ag e) and revealed a LV wall thickness of 0.155cm +/0.003cm for treated and 0.178mm +/0.006cm for control animals (p<0.01, Figure 4-3). A third set of echos were meas ured at 20 weeks of age and indicated a LV wall thickness of 0.158cm +/0.003cm in th e treated animals and 0.186mm +/0.019cm in control animals (p=0.24, Figure 4-3). When the findings are compared using repeated measures the p value is just short of signi ficance (p=0.06, Figure 43). The individual, and overall, change in wall th ickness was also compared. From the echos measure at 11 weeks to those measured at 16 weeks of age the treated animals wall thickness increased by 0.15cm +/0.003cm and the control animals increased by over double that number at 0.38cm +/0.06cm (p<0.05, Figure 4-4). From 16 to 20 weeks the treated animals showed a 0.05cm +/0.05cm increase while th e control animals in creased by 0.43cm +/-

PAGE 72

61 0.17cm (p=0.05, Figure 4-4). When compared using repeated meas ures the p value obtained significance (p<0.01, Fi gure 4-4). After the echocardiograms were performed at 16 and 20 weeks the animals were allowe d to recover and indi rect systolic blood pressures were measured. At 16 weeks the viru s treated animals had a blood pressure of 186 +/7 mmHg while the control animals had a pressure of 184 +/5 mmHg (p=0.84, Figure 4-5). At 20 weeks the treated animal s had a pressure of 180 +/5 mmHg while the control animals had pressures of 188 +/7 mmHg (p=0.51, Figure 4-5). Figure 4-2. Binding char acteristics of the AT2R expressed from the le ntiviral vector in CHO cells. CHO cells were transduced at 1MOI with a lentiviral vector expressing the AT2R and NEO genes. After drug selection, whole cell binding was performed with 125I-Sar-Ile-AngII. Discussion The role of the cardiac AT2R under pathologic loads of Ang II is poorly understood. For example, through the use of transgenic animal s researchers have reported conflicting results with re gards to the importance of the AT2R in the development of cardiac hypertrophy a nd perivascular fibrosis. The AT2R plays a

PAGE 73

62 demonstrated role in development theref ore such t ransgenic models may be inherently n of this receptor during the devel Lentivector encoding ATR was transferred into neonatal SHR. At 11, 16, ventricular free wall thickness for control (blue) and vector treated (yellow) repeated measures p value is indicated on top of the figure. To avoid any unnecessary alterations in development we created a lentiviral vector expressing the AT2R and delivered it into the circulation of neonatal SH rats. Through the use of such an approach we were able to demonstrate a clear inhibitory effect of AT2R over-expression on cardiac hypertrophy. These results were demonstrated in the SHR, a hypertensive model known to express an overly active RAS, but were seen in the flawed through the simple up or down regulatio opmental period. Figure 4-3. AT2R gene transfer results in decreased cardiac hypertrophy in the SHR. 2and 20 weeks of age echocardiography was performed. Illustrated is the left animals. P values are indicated above each respective set of bars. The p = 0.06 p = 0.06 00.050.10.25LV Wll Thickness (cm) 0.150.2a 16 Weeks 16 Weeks 11 Weeks 11 Weeks p = 0.57 p < 0.01 20 Weeks 20 Weeks p = 0.24 p = 0.24n = 5n = 5n = 4n = 5 n = 4n = 4

PAGE 74

63 absence of any alteration in bl ood pressure. Therefore, the AT2R gene appears to be altering only the cardiac tissue-based RAS. This is not surprising based on the rather impressive cardiac transduction observed when de livering the lentivector as we did in this study into the left ventricu lar cavity (see Chapter 3). Figure 4-4. AT2R gene transfer significantly decreas es the increase in left ventricular wall thickness for up to 9 week s. Lentivector encoding AT2R was delivered into neonatal SHR. At 11, 16, and 20 weeks of age echocardiography was performed on the animals. The changes reflected here relate to the measured increase in left ventricular wall thic kness when compared to the previous echocardiogram. The results from the control animals are in blue while the vector treated animals are in yellow. P values are indicated for each set of experiments and a repeated measures p va lue is shown at the top of the figure.

PAGE 75

64 The basic finding revealed in this study, the AT2R is a negative regulator of cardiac hypertrophy in the SHR, is the first genetically-based demonstration of this in an animal with normal CV development. The term normal CV development is usebecause it is not entirely clear that the SHR model itself undergoes what could be considered normal fetal development. We know that the SHR is a polygenetic model ofhypertension therefore it is plausible that it may express certain genes that could make imore amenable to cardiac directed therapy with the AT2R gene. To investig d t ate this, future experiments should be conducted using a myriad of high Ang II models of expressiond they will not express transgene and the direct effect of the AT2R over-expression on the myocyte can be investigated. f cell animal. hypertension (i.e. chronic Ang II infusion, Ren2 transgenic rat, etc) The true cardiac specific effects of these findings could also be called into question. As shown in Chapter 3, lentivector encoding a hEF1.PLAP transgene delivered in exactly the same manner as in this experiment transduces many more tissues other than the heart. The similar blood pressures that were observed between treated and control animals suggests a truly cardiac specific effect for the AT2R transgene, but it does not rule out peripheral effects from any of the other transduced tissues and cell types. To alleviate this problem, future experiments should use a lentivector encoding cardiomyocyte-specific promoter elements (i.e. alpha myosin heavy chain) driving of the AT2R. In this manner, although other cell types will be transduce Another area that could be improved is the age of the animal at the time olentivector delivery. Although the cardiomyocyte is characteristically a quiescent type at all ages this vector system was really developed to be used in the adult

PAGE 76

65 Recently two independent research groups delive red lentivector into adult mice hearts in vivo and demonstrated efficien t gene transfer using approx imately the same number of infectious particles as our experiments in ne onatal rats (Fleury et al, 2003). I feel it would be of great in terest to deliver AT2R expressing vector to adul t rats just before or during the development of hypertrophy. This could more closely mimic the clinical situation where hypertensive patients already expressing LV hypertrophy may benefit from enhanced AT2R expression or stimulation. More knowledge may also be gained by delivering vector after hypertr ophy, but before complete failure of the heart. It is an important step to successfu lly block the development of hypertrophy, but actual reversal of the disease process shoul d remain the ultimate goal. Figure 4-5. AT2R gene transfer has no effect on syst olic blood pressure in the SHR. Lentivector encoding the AT2R was delivered into the systemic circulation of neonatal SHR. Indirect blood pressures were taken at the indicated times. Blue bars represent control treated an imals while the yellow bars reflect the vector injected rats. P values are indicated above each set.

PAGE 77

66 Our results illustrate another potential benefit of AT2R stimulation in patients taking AT1R blockers (ARBs). Patients on ARBs are known to have elevated circulatilevels of Ang II The endogenous AT2Rs on cardiomyocytes, while extremely low in expression level, are nonetheless viable targets for thi ng s Ang II. Certainly ARBs slow the progression of cardiac hypertrophy, but much of this effect is presumably through their potent BP lowering abilities. The findings in this study occur separately from any changes in blood pressure. It may be interesting to inhibit or partially inhibit the AT1Rs and see if the anti-hypertrophic effects of the AT2R gene transfer are augmented. In summary, our findings suggest a role for the AT2R in the prevention of cardiac hypertrophy in the SHR. These findings are novel in that they were investigated in the rat after normal CV development. Although a relatively small and preliminary study the findings set the stage for future use of both the AT2R gene and the lentivector in general in the heart.

PAGE 78

CHAPTER 5 ther its in vivo perform t of SH rats. ation ings in the SHR and other models of hypertension are neces CONCLUSIONS AND DIRECTIONS Chapter 2 and 3 illustrate the improvements made in the lentivector system and theresultant efficiency in CV-relevant tissues and cell types. When these studies were beganvery little was known about the in vivo performance of this vector system in tissues othan the brain. Even today, only two studies have been published detailing in vitroperformance of the vector in cardiomyocytes and only three studies of ance in the heart. Therefore, there is still much more to be learned about lentivector performance in the cardiovascular system. Our novel production and concentration schema represent a major advancement in the field. Our final titers are anywhere from 10-100 times greater than those currently reported in the literature usingstandard protocols. While a definite improvement, there is still more work to be done regarding the production and purity of the lentivector. Finally, Chapter 4 presents a preliminary study into the consequences of AT2R over-expression in the hearAs discussed, there is a lot of debate regarding the consequences of AT2R gene activin the cardiomyocyte. The work presented here seems to suggest that in the SHR the AT2R may play a role in dampening the hypertrophic response of the cardiac muscleFuture evaluation of these find sary. 67

PAGE 79

68 Lentivector Production and Performance Further improvements in the technology of lentivector production can help keep this virus at the forefront of gene therapy vectors. Our final titers of 1 X 1010 TU/ml high, but every small improvement in the production of this vector is a big help. One avenue that should still be investigated is the creation of inducible packagicell lines. Some systems have been created, however, they yield lower titers and requirthe laborious creation of new cell lines with every improvement in vector design (like the discovery of the cPPT/CTS DNA flap benefits). It is quite clear that the creation of arobust packaging cell line would greatly increase the user friendliness of the vector andtherefore increase its usage. The use of alternative enve are ng e lope proteins instead of the VSV-G will aid in the packaging cell line establishment. One group recently used the iral vector production should be heading. The oWith cleacould increase. This was demonstrated recently by a group who used anion exchange baculovirus GP64 protein in a packaging cell line with promising results (Kumar et al, 2003). Cell free lentiviral vector production may one day become a reality. Recently a Canadian group was able to produce infectious encephalomyocarditis virus using cellular extract in a test tube (Sirven et al, 2000). This would certainly be the safest way to engineer lentivector and should be quite easily scaled up. All necessary proteins could be produced and then mixed with human cell membranes and vector genome. Lentivector could then be directly purified thereby significantly decreasing production time. Such protocols are possibly many years away, but I think it represents a major direction where v verall purity of the lentiviral vector preparation should also be considered. ner vector preps it may be possible that the overall infectivity of the vector

PAGE 80

69 HPLC to purify lentivector and observed a 2-fold increase in transduction (Yamada e2003). Column purification of the lentivector should be explored further. Simple size exclusion or ligand columns may be alternative methods. Magnetic purification of the vector should also be explored. In 2001 a group from the United Kingdom prepared classical retroviral vector labeled with biotin and later purified this vector using streptavidin coupled magnetic beads (Hughes et al, 2001)overall purity of the vector preparation wasnt directly assayed, but the procedure improved their titers over 10-fold. Such a technique could easily be employed to t al, The lentive or this phage integrase. If incorporated into the lentivector system it may be possible to actually direct transgene integration into innocuous sites in the human genome and therefore relieve the fears of insertional mutagenesis. Such an advancement would represent the single most major accomplishment in the retroviral field in the past decade. The AT2R and Other Targets of the RAS The AT2R results, while interesting, are still preliminary due to the relatively small sample size. I think the next thing to be done with the AT2R expressing vector is to repeat the experiment in SH rats to increase sample size and also to use Sprague-Dawley (SD) rats in a separate experiment. The SD rats have the added advantage of being much cleaner with regards to their genetics. Hypertrophy would have to be induced in the SD animals with chronic Ang II infusion. ector production and the benefits may be increased infectivity and purity. Lastly, work in the field of directed integration has advanced greatly recently. Ongroup used a bacteriophage derived integrase to insert plasmid DNA into specific sites in the mouse genome (Olivares et al, 2001). In the human there are limited number of integration sites f

PAGE 81

70 Next, I would develop surgical methods to deliver the lentivector into the hearts of adult rats. As discussed earlier, one group has already achieved great success using the lentivector in the hearts of adult mice with transduction efficiencies approaching 80% (Bonci et al, 2003). Suchn adult animals as was intend222ins? ion of 2 to ke 22. oter n the myocytes are exposed to high levels of Ang II, as is the case during hypertrophy, they will automatically turn on the therapeutic transgene. methods will allow us to use the vector i ed at the inception of our experiments. This situation also more closely mimics what would take place in human therapy using the ATR. Additionally, we can begin to more fully dissect the ATRs role in hypertrophy by delivering the vector directly into the heart of animals at different stages of hypertrophic growth. Can the ATR reverse hypertrophy or can it only play a therapeutic role if present before the process begAfter these initial experiments, I think future experiments should utilize a cardiomyocyte specific promoter, like alpha myosin heavy chain, to direct expressthe ATR. In this manner it will become much clearer if the therapeutic effects are duethe genetic manipulation of the myocytes, as we propose, or through some other mechanism. Additionally, it would be advantageous to use an inducible promoter system, lithe commonly used tetracycline-based system, to turn on or off the ATR gene. If this were achieved we could then transduce the animals at a young age and then induce expression of the ATR at different stages of hypertrophy or heart failure as they agedThe ultimate inducible promoter would respond to the actual disease state we are tryingto prevent. Work is ongoing in our laboratory to synthesize an Ang II inducible promso that whe

PAGE 82

71 Finally, the disco very of new components in the RAS is very e xciting. The Mas recep tor, ACE2 enzyme, and renin receptor should be inserted into the lentivector as quickly as possible so that we may use this unique technology to help elucidate the role of these newly discovered proteins.

PAGE 83

APPENDIX The pNHP construct used to produce all vectors utilized in the studies described here is a modified version of the pHP plasmid (Chang, Urlacher et al. 1999). The pNHP has additional deletions of all remaining accessory proteins in addition to the deletions already highlighted in the original pHP plasmid. The pNHP plasmid was a kind gift of Lung-Ji Chang, University of Florida. The phEF1.VSV.G construct was fully detailed elsewhere (Iwakuma, Cui et al. 1999). This plasmid was another gift of Lung-Ji Chang. The transducing vector used in our experiments was derived from a previously described self-inactivating vector (Iwakuma, Cui et al. 1999). The pTY vector was modified by inserting a cPPT-DNA FLAP element upstream of the multiple cloning site, an element that has been shown to significantly improve the transduction efficiency of recombinant lentiviral vectors in vitro and in vivo (Zennou, Petit et al. 2000). The original pTY vector was detailed elsewhere and was a generous gift of Lung-Ji Chang (Iwakuma, Cui ere g ification was verified by DNA sequencing. METHODS Chapter 2 Lentiviral Vector Constructs: pNHP, phEF1.VSV.G, and the pTYF family t al. 1999). A 186-bp fragment containing the cPPT-DNA FLAP sequence was amplified from the pNHP vector using the polymerase chain reaction and the same coprimers that have been previously described (Sirven, Pflumio et al. 2000). Eag1 and Not1 restriction sites were added to the sense and antisense primers, respectively. The resulting fragment was cloned into the Not1 site of the pTY vector in the sense orientation creatinthe pTYF vector. The integrity of this mod 72

PAGE 84

73 The T YF family of vectors were produced on the backbone of this original pTYF construct (known as pTYF.Linker). The hEF1 alpha promoter was amplified from phEF1.VSV.G (Upper primer: 5GCGCGGCCGC TTTGGAGCTAAGCCAGCAAT, Lower primer: 5 GCGCTAGCA TCGAT TTCACGACACCTGAAATGG) and cloned into the 5 Not I and 3 Nhe I sitein the pTYF.Linker. This new construct was denoted as pTYF.hEF1.Linker. The pTYF.hEF1.PLAP construct was made through the removal of the PLAP gene from the pRISAP construct (gift from Susan Semple-Rowland, UF) using 5 Pme I and 3 Kpdigestions. This gene was directionally cloned into pTYF.hEF1.Linker at the 5 Sma I s n I and 3ed Kpn I sites. The pTYF.hEF1.EGFP vector was made by using PCR directagainst the EGFP gene (Upper: 5 GCGTTTAAAC GATCCACCGGTCGCCACCAT, Lower: 5GCGGTACC CGCTTTACTTGTACAGCTCGTC) in the pEGFP-N1 plasmid (Clontech). The amplified gene was cloned directionally into pTYF-hEF1.LinkerSma I and 3 K at 5 pn I. P, ower 5 GCGGTA CCGATATCCGCTCAGAAGAACTCGTCAA The bicistronic IRES constructs were created using a three fragment ligation approach. pTYF.hEF1.Linker was opened with 5 Nhe I and 3 Kpn I. The IRES, PLANeo, and EGFP genes were amplified using the primers below: IRES: Upper 5 GCGTCGACGTTTAAACATCGGAGCTTAAAAC, Lower 5GCACG CGTCCGCAATCCAA PLAP: Upper 5 GCACGCGTGTGGCGTCGACAATA, Lower 5 GCGGTACCGATA TCTGGCCGTCTCCAG Neo: Upper 5 GCACGCGTGCCACCATGATTGAACAAGA, L

PAGE 85

74 EGFP: Upper 5 GCACGCGTGATCCACCGGTCGCCACCAT, Lower 5 GCGTACCGATATCCGCTTTACTTGTACAGCTCGTC All the fragments were individually purified and ligated at 1:1:1 molar ratios to create pTYF.hEF1.IRES.PLAP, pTY G F.hEF1.IRES.Neo, and pTYF.hEF1.IRES.EGFP. pTYF.hEF1.IRES.HygEGFP was created by moving the HygEGFP gene from pHygEGFP (Clontech) with 5 Mlu I and 3 Sma I. This fragment was ligated directionally into pTYF.hEF1.IRES.Neo cut open with 5 Mlu I and 3 EcoRV. DNA Preparation Plasmid DNA was prepared in either one of two methods. One method involved the use of Mega Plasmid Prep kit from Qiagen while the second method involved a modified alkaline lysis protocol followed by CsCl-EtBr gradient banding of the DNA (from Maniatas et. al). Production of Lentivector: Transfection 293FT cells (Invitrogen Corporation, #R70007) were seeded in 75 cm2 (T-75) culture flasks at a density of 1 x 107 cells per flask and grown in Dulbeccos modified Eagle medium (DMEM; Gibco) containing 10% fetal bovine serum and antibiotics (130 U/ml penicillin and 130 g/ml streptomycin; growth medium). Prior to cell seeding the culture flasks were coated with poly-D-lysine in PBS for 1-2 hours at 37C. Culture flasks were then rinsed 1X with PBS and stored dry overnight at room temperature. The cultures were maintained at 37C in 5% CO2 throughout the virus production period. On the following day, or when the cultures reached 90-95% confluency, the transfection was performed. For one large-scale preparation of virus, 27 T-75 flasks of 293FT cells were transfected as follows: Transfection mixture for all 27 flasks was prepared by gently mixing 192 g pNHP, 95 g pTYF and 76 g pHEF.VSVG plasmid

PAGE 86

75 DNA and 8.0 ml DMEM in one 50 ml polystyrene tube. After mixing, 756 l of Superfect was added to the DNA solution. The contents of the tube were gently mixed and incubated at room temperature for 10 min. Next, these transfection completed into 140 ml of pre-warmed growth medium. The cultures that wer hours ago were then removed from medium containing the transfection complexes. The flasks were then incubated for 4-8 hours in a 37C/5% CO2 incubator. Following the incubation period, the medium containing the transfection mixture was replaced with 6.0 ml of fresh growth medium. The next day, the media containing the first batch of virus was harvested from each flask and 5.0 ml of fresh growth medium was added to the cells. This should result in two collections of vector, one at ~30 hours post-transfection and a second at ~45 hours. To prepare transfection mixture sufficient for one T-75 flask, the amounts of DNA, DMEM and Superfect were each divided by 27 to scale the reaction down. We have also found that viral vector can be produced in larger or smaller cell culture flasks or plates by simply scaling cell numbers and the amount of DNA, DMEM and Superfect linearly with respect to the cell growth area. Production of Lentivector: Concentration xes were dilu e seeded ~24 the incubator, their medium was aspirated, and then replaced with 5 mls of growth The two collections of vector are handled independently. Each collection of vector is performed in 50 ml polystyrene tubes on ice. Each tube is then centrifuged at 2000 x g for 10 minutes then filtered through a 0.45 micron low protein binding membrane (Nalgene, PES). Concentration steps are outlined in Figure 2-4.

PAGE 87

76 For ultrafiltration, the virus stock collected from 27 T-75 flasks at 30 h post-transfection (~120 ml) was divided int o two 60 ml aliquots and centrifuged through Centric -ot ace was carefully removed from each tube and discarded, leaving ~750 omer Konical Tubes; Beckm ining pellet spinal fluid by incubating the virus at 4C fnd on-80 ultrafiltration columns (Millipore) for 1 h in 4C at 2500 x g. The retentatewas retrieved by centrifuging the inverted column for 1 min in 4C at 990 x g and was stored at 4C until further processing. On the following day, the virus-containing retentate was added to the ~120 ml of virus-containing media collected at 45 h posttransfection. Four 30 ml conical-bottom tubes (polyallomer Konical tubes; Beckman), each containing a 220 l cushion of 60% iodixanol solution (used directly from the Optiprep stock solution obtained from Axis-Shield) were prepared. Iodixanol was used because of its demonstrated safety in human clinical trials. Media containing virus (30 ml) was gently pipetted into each tube, taking care nto disturb the iodixanol, and the samples were centrifuged at 50,000 x g for 2.5 h at 4C using a Beckman SW-28 swinging bucket rotor. The media just above the media/iodixanol interf l of the solution in each tube (220 l of iodixanol plus ~500 l of media). Theresidual media containing virus and the iodixanol were mixed gently. The resulting mixtures were pooled into one 3 ml conical-bottom tube (polyall an) and centrifuged at 6100 x g for 22-24 h at 4C using a Beckman SW-50.1swinging bucket rotor. The resulting supernatant was removed and discarded and the remawas resuspended in 30-50 l of artificial cerebro or 10-14 h. The final viral vector was gently mixed by pipetting, aliquoted astored at -80C until use.

PAGE 88

77 Lenti vector Titration: PLAP Infectious titers of the TYF.hEF1.PLAP virus were determined by incub overn with 3X with BS at 72C for 60 minutes. The plate was then allowed to cool to room ark 1 hour and then moved to 4C overnight. The following M EDTA and finally overlayed with 1 nal virus. nd ating 1.75 x 105 TE671 cells seeded in 12-well plates with limiting dilutions of theviral stock (1/10, 1/100 and 1/1000) in the presence of 8 g/ml polybrene. After an ight incubation period, the vector containing medium was removed and fresh medium was added directly to the cells. After 48 hours, cultures were rinsed 2XPBS, fixed in 4% paraformaldehyde for 15 minutes at room temperature, rinsed PBS, and heated in P temperature with the lid removed. BCIP pre-inhibition buffer is then added to the cells and incubated for 30 minutes at room temperature. The pre-inhibition buffer isremoved and replaced with BCIP reaction buffer. The cells are then incubated in the dat room temperature for morning, the cells are rinsed with PBS containing 50m ml of PBS + 50mM EDTA. Ten random areas from each well are scored for thetotal number of PLAP positive (purple) cells when viewed using the 10X objective. Fititer is determined using the following equation: (Number of PLAP positive cells / number of areas examined) 152 mL of virus added to the well The number of transducing units (TU; defined as an infectious particle) was expressed as TU/ml which is equivalent to the number of PLAP positive cells per ml of Delivery of TYF.hEF1.EGFP Vector to Brain Nuclei Male Wistar rats were anesthetized with a mixture of ketamine (60 mg/kg) amedetomidine (250 g/kg) and placed in a stereotaxic frame. Vector delivered to the

PAGE 89

78 brain was suspended in artificial cerebrospinal fluid. For the paraventricular nucle(PVN) injections 275 g rats were used and the head of the animal was flexed 5 mm belothe interaural line. The microinjection pipette wa us w s angled ten degrees relative to the midlineirus a lso elative to calamus scriptorius, 350-700 m from midlinecut on a cryostat and confocal microscopy (Leica e 904). d h m Axisto avoid the mid-sagittal sinus. A slow injection of 500 nl (5 X 105 TU) of vwas performed at the following coordinates: 1.8 mm lateral, 1.8 mm caudal to the bregmand 7.5 mm below the surface. The caudal nucleus of the solitary tract (NTS) was ainjected bilaterally with 3 injections per side for a total of 300 nl (3 X 105 TU). The site of injection was within 0 to -500 m r and 500-600 m below the dorsal surface of the medulla. The head of the animal was flexed 10 mm below the interaural line. The animals were sacrificed either 7 days (PVN, n = 2) or 30 days (NTS, n = 2) following the injections and fixed by intracardial perfusion with 4% paraformaldehyde in PBS. Brains were removed, cryoprotected in 30% sucrose, 60 m thick brain sections were SP) was used to visualize GFP fluorescence. Cell Culture Human embryonic kidney cells (293FT) were obtained from Invitrogen Corporation (#R70007). Human medulloblastoma cells (TE671) were obtained from thEuropean Collection of Cell Cultures (#89071 Solutions Artificial cerebrospinal fluid (virus resuspension buffer) was made as describeon http://www.alzet.com with the addition of 0.1% heat-inactivated (56C, 40 minutes) fetal bovine serum + 1X fungizone and 1X penicillin/streptomycin. D-MEM (higglucose) was purchased from Invitrogen. Iodixanol was used as provided fro

PAGE 90

79 Shield (Oslo, Norway). Polybrene (Hexadimethrin bromide) was prepared as a 100Xsolution (800g/ml) in Hanks balanced salt solution. BCIP pre-inihibiton buffer: 100mM Tris Base, 100mM sodium chloride, 50mM magnesium chloride, 0.5mM Levamisole, pH 9.5. BCIP reaction buffer: 100mM Tris Base, 100mM sodium chloride50mM magnesium chloride, 0.5mM Levamisole, 1mg/ml nitro blue tetrazolium, 0.1mg/ml 5-bromo-4-chloro-3-indolyl-phosphate (also known as X-Phos or BCIP), p9.5. Chapter 3 TYF Constructs Additional TYF constructs used included pTYF.hEF H 1.DsRED and pTYF.h were generous nd as ing ining media was removed and replaced with growth medium contained e animals are then placed on a heated surface and the heart visualized through the translucent chest wall. A standard insulin syringe needle was EF1.nlacZ. The DsRED construct was made by directly inserting the DsRED gene (Clontech) into pTYF.hEF1.Linker. The nlacZ construct was made by inserting thebacterial beta-galactosidase gene into pTYF.hEF1.Linker. Both constructsgifts from Susan Semple-Rowlands laboratory, UF. Growth Arrest and Transduction All cell types (A.10, A7r5, HepG2, and RPAEC) were grown to confluency athen growth-arrested with aphidicolin at a concentration of 15g/ml. At the same timegrowth-arrest, the cells were overlaid with virus and incubated overnight. The followmorning the vector conta ing aphidicolin. The cells were either imaged or stained the next day. Systemic Delivery of Lentivector to Neonatal Rat Five-day-old animals were removed from their mothers and lightly anesthetizwith methoxyfluorane. Th

PAGE 91

80 inserted into the apex of the hea rt and angled into the left ventricular cavity. A small volume of blooioning ion. thers. ed lly with 60mls of ice-cold PBS followehen harvested into 4% paraformalhours on ice. Whole organs were th ues were equilibrated in BCIP pre-inhibition buffer for one hour. The pre-uffer and the tissues were stained d was withdrawn into the syringe barrel to indicate the correct postof the needle and the 20-35l volume of vector or control was delivered in a slow bolus. The needle was quickly removed and the animal allowed to recover in a heated locatAnimals were then lightly coated with peanut oil and returned to their respective moIn all cases the investigator delivering the vector or control solution was blinded with respect to the composition of the sample being injected. Cell Staining for lacZ To assay for lacZ expression cells were first rinsed 2X with PBS then fixed in 4%paraformaldehyde for 10 minutes at room temperature. The fixed cells were then rins3X with PBS and overlaid with lacZ staining buffer: 35mM potassium ferrocyanide, 35mM potassium ferriccyanide, 2mM MgCl2, 0.02% Nonidet P-40, 0.01% sodiumdeoxycholate, 1mg/ml X-gal, pH 8.0. Cells were then incubated at 37C until color developed. Tissue Histochemistry for PLAP The entire animal was perfused intracardia d by 60mls of ice-cold 4% paraformaldehyde in PBS. Organs were t dehyde and post-fixed for two en rinsed at room temperature in PBS 4 times for 15 minutes each rinse. Thetissue was then heated in PBS at 72C for 2.5 hours. After cooling to room temperature,the tiss inhibition buffer was then replaced with BCIP reaction b for one hour at room temperature. After this time they were moved to 4C to develop a deep purple color overnight. In the morning the organs were rinsed 2X with

PAGE 92

81 PBS + 50mM EDTA and stored in the same solution prior to cryoprotection and sectioning or direct microscopic analysis. Cell Culture All cell lines were acquired from American Tissue Culture Collection (ATCC) as follows: A-10 (CRL-1476), A7r5 (CRL-1444), HepG2 (HB-8065). Cells were cultured according to instructions provided by the supplier. Chapter 4 AT2R Lentivector Construction AT2R coding region was generously provided by Jeffrey Harrison, UF. To create 22 all three pTYF.hEF1.ATR.IRES vectors the ATR gene was excised from pLNSV-AT2R with 5 Avr II and 3 Cla I and ligated into the pTYF.hEF1.IRES constructs cut open with 5 Nhe I and 3 Cla I. Lentivector Titration: G418 Resistance TE671 cells were split into 12-well plates at a density of 175,000 cells per well. After 24 hours they were transduced with 0.0001l of vector in the presence of 8g/ml polybe ter a 5 minute incubation at 37C to plete dissociation of the cells from the bottom of each well, 500l of growth mediu a 6-s rene in a total volume of 500l in duplicate. Cells were then returned to thincubator for 24 hours after which time each well was rinsed with 1ml of trypsin solution and then overlaid with 500l of trypsin solution. Af ensure com m (D-MEM + 10% FBS) was added to each well. The contents of each well werepipetted up and down to assure total de-aggregation of the typsinized cells. Twenty microliters (a 1:50 dilution) of each cell suspension was then transferred to a well inwell plate containing 2mls of growth medium in duplicate. This results in 4 total well

PAGE 93

82 used per 6-well plate: 2 wells containing duplicate dilutions of each originally transducwell of the 12-well plate. Control (non-transduced) cells were handled in the same manner. After another 24 hour period (now 48 hours from exposure to virus) the cwere incubated in growth medium containing 400g/ml G418. Every 24 hour period the G418 concentration was increased by 400g/ml until a final concentration of 1,20was achieved. The cells were then incubated in the presence of 1,200g/ml of G418 fortotal of ed ells 0g/ml a 10 more days. Fresh G418 media was added every other day to the cultures. Add the end of this period the cells were rinroom temperature PBS and then crystal violet in 10% ethanol in water for 20 minutes. After this incubn extra nfluency in 12-well plates taking at least three days to rea After old PBS to remove any unbound ligand. Cells were then lysed in 0.1N sodium hydroxide by incubating at room sed 2X with incubated in 0.1% ation, each well was rinsed 2X with 10% ethanol in water to remove astaining solution. The resulting purple staining, G418 resistant colonies were then counted and the titer of the virus calculated as infectious units (colony forming units) per ml of viral vector. 125I-Angiotensin II Binding Cells were grown to ~80% co ch this level following exposure to trypsin. Cells were removed from the incubatorand rinsed 2X with room temperature PBS. Binding reaction mixtures consisting of 1% BSA, varied amounts of 125I-Sar-Ile-AngII, and the presence or absence of specific inhibitors (losartan (1M), PD123,319 (1M), or cold AngII (100nM)) were then overlaid onto the cells. Binding was allowed to proceed at 37C for 30 minutes this time the cells were washed quickly 4X with ice-c

PAGE 94

83 temperature for 1 hour. This lysate was collected, each well was washed with distilledwater, and then counted for total specific 125I decay. Each sample was read in triplicate. Cardiac Echocardiography After mild sedation, echo readings were taken using an S12 probe and a clinical ultrasound machine at a depth of 2cm. The cardiac papillary muscles were used as a landmark for echocardiogram recording. Wall thickness was measured using an on-screen electronic micrometer. The investigator performing the echos was Dr. Leonard rom David Taylor. In all cases, both investigator and assistant were F. ncentrations. G418 (Invitrogen) was made up in D-MEM without fetal re use. Statisrmined Parilak with assistance f blinded as to the animals identification and treatment group. Cell Culture Chinese hamster ovary (CHO) cells were a generous gift from Peter Sayeski, USolutions Losartan, PD123,319, and Angiotensin II were made up in sterile PBS at theindicated co bovine serum and sterile filtered befo tics Repeated measures ANOVA and ANOVA were used. Outliers were deteusing Grubbs Outlier test at a confidence level of p<0.05. Statistical analyses were performed using StatView (Version 5.0, SAS Institute Inc.).

PAGE 95

internalization and mRNA decay in down-regulation of recombinant type 1 ooth muscle cells. Mol Pharmacol, 55(6), 1028-36. Akishita, M., Iwai, M., Wu, L., Zhang, ., Dzau, V. J., & Horiuchi, M. (2000). in II type 2 receptor on coronary arterial remodeling after aortic banding in mice. Circulation, 102(14), 1684-9. Albiston, A. L., McDowall, S. G., Matsacos, D., Sim, P., Clune, E., Mustafa, T., Lee, J., Evidence that the angiotensin IV (AT(4)) receptor is the enzyme insulinregulated P., Dirksen, L. B., Hayzer, D. J., Marrero, M. B., & Bernstein, K. dence on the motif YIPP for the physical association of Jak2 tail of the angiotensin II AT1 receptor. J Biol Anchells and genetically modified mice. J Mol Med, 78(3), 130-9. Balcells, E., Meng, Q. C., Johnson, W. H., Jr., Oparil, S., & Dell'Italia, L. J. (1997). methods and species considerations. Am J Physiol, 273(4 Pt 2), H1769-74. Barker E, Planelles V. (2003). Vectors derived from the human immunodeficiency virus, a LIST OF REFERENCES Adams, B., Obertone, T. S., Wang, X., & Murphy, T. J. (1999). Relationship between angiotensin II receptor (AT1) expression in sm L., Ouchi, Y Inhibitory effect of angiotens Mendelsohn, F. A., Simpson, R. J., Connolly, L. M., & Chai, S. Y. (2001). aminopeptidase. J Biol Chem, 276(52), 48623-6. Ali, M. S., Sayeski, P. E. (1997). Depen kinase with the intracellular carboxylChem, 272(37), 23382-8. ordoquy, T. J., Allison, S. D., Molina, M. C., Girouard, L. G., & Carson, T. K. (2001). Physical stabilization of DNA-based therapeutics. Drug Discov Today, 6(9), 463-470. Bader, M., & Ganten, D. (2000). Regulation of renin: new evidence from cultured cAngiotensin II formation from ACE and chymase in human and animal hearts: HIV-1. Front Biosci, 8, 491-510. Bartlett, J. S., Kleinschmidt, J., Boucher, R. C., & Samulski, R. J. (1999). Targeted adeno-associated virus vector transduction of nonpermissive cells mediated by bispecific F(ab'gamma)2 antibody. Nat Biotechnol, 17(2), 181-6. 84

PAGE 96

85 Baumgartner, I., Pieczek, A., Manor, O., Blair, R., Kearney, M., Walsh, K., & Isner, J. transfer promotes collateral vessel development in patients with critical limb C. (1997). Angiotensin II type 2 receptors mediate inhibition of mitogen-activated Biochem J, 325(Pt 2), 449-54. Benter, I. F., Ferrario, C. M., Morris, M., & Diz, D. I. (1995). Antihypertensive actions of angiotensin-(1-7) in spontaneously hypertensive rats. Am J Physiol, 269(1 Pt 2), its discovery. Nephrologie, 19(7), 391-5. Bkaily, G., Sleiman, S., Stephan, J., Asselin, C., Choufani, S., Kamal, M., Jacques, Dinternalization, translocation and de novo synthesis modulate cytosolic and nu274-87. Bonci, D., Cittadini, A., Latronico, M. V., Borello, U., Aycock, J. K., Drusco, A., Peschle, C., C M. (1998). Constitutive expression of phVEGF165 after intramuscular gene ischemia. Circulation, 97(12), 1114-23. Bedecs, K., Elbaz, N., Sutren, M., Masson, M., Susini, C., Strosberg, A. D., & Nahmias, protein kinase cascade and functional activation of SHP-1 tyrosine phosphatase. H313-9. Bernstein, K. E. (1998). Examining the renin-angiotensin system one hundred years after ., Gobeil, F., Jr., & D'Orleans-Juste, P. (2003). Angiotensin II AT1 receptor clear calcium in human vascular smooth muscle cells. Can J Physiol Pharmacol, 81(3), Innocenzi, A., Follenzi, A., Lavitrano, M., Monti, M. G., Ross, J., Jr., Naldini, L., ossu, G., & Condorelli, G. (2003). 'Advanced' generation lentiviruses as efficient vectors for cardiomyocyte gene transduction in vitro and in vivo. Gene BrantActa, 1575(1-3), 15-25. Brasier, A. R., Jamaluddin, M., Han, Y., Patterson, C., & Runge, M. S. (2000). the nuclear factor-kappaB (NF-kappaB) transcription factor. Mol Cell Biochem, irus A. in very attenuates hypertension, cardiac hypertrophy, and renal injury in Dahl salt-sensitive rats. Hum Gene Ther, 9(1), 21-31. Ther, 10(8), 630-6. l, S. (2002). Antisense-RNA regulation and RNA interference. Biochim Biophys Angiotensin II induces gene transcription through cell-type-dependent effects on 212(1-2), 155-69. Buchschacher, G. L., Jr., & Panganiban, A. T. (1992). Human immunodeficiency vvectors for inducible expression of foreign genes. J Virol, 66(5), 2731-9. Campagnole-Santos, M. J., Heringer, S. B., Batista, E. N., Khosla, M. C., & Santos, R.(1992). Differential baroreceptor reflex modulation by centrally infused angiotenspeptides. Am J Physiol, 263(1 Pt 2), R89-94. Chao, J., Zhang, J. J., Lin, K. F., & Chao, L. (1998). Human kallikrein gene deli

PAGE 97

86 Chu, Y., Iida, S., Lund, D. D., Weiss, R. M., DiBona, G. F., Watanabe, Y., Faraci, F. Mreduces arterial pressure in spontaneously hypertensive rats: role of heparin-binding ., & Heistad, D. D. (2003). Gene transfer of extracellular superoxide dismutase domain. Circ Res, 92(4), 461-8. Coleman, J. E., Huentelman, M. J., Kasparov, S., Metcalfe, B. L., Paton, J. F., Katovich, production and concentration of HIV-1-based lentiviral vectors for use in vivo. angiogenesis: a new function for angiotensinogen and des(angiotensin Oliveira-dos-Santos, A. J., da Costa, J., Zhang, L., Pei, Y., Scholey, J., Ferrario, C. ., & Penninger, J. M. (2002). Angiotensin-converting enzyme 2 is an essential regulator of heart Nature, 417(6891), 822-8. CurraImmunol, 261, 75-105. Cuspidi, C., Muiesan, M. L., Valagussa, L., Salvetti, M., Di Biagio, C., Agabiti-Rosei, E., enalapril on left ventricular hypertrophy in patients with essential hypertension: the y. J Hypertens, 20(11), 2293-300. Donoghue, M., Hsieh, F., Baronas, E., Godbout, K., Gosselin, M., Stagliano, N., van, M., Woolf, B., Robison, K., Jeyaseelan, R., Breitbart, R. E., & Acton, S. ). A novel angiotensin-converting enzyme-related carboxypeptidase (ACE2) ). Intracardiac detection of angiotensinogen and renin: a localized reninangiotensin C838-50. Duisit, G., Conrath, H., Saleun, S., Folliot, S., Provost, N., Cosset, F. L., Sandrin, V., Moullier, P., & Rolling, F. (2002). Five recombinant simian immunodeficiency virus pseudotypes lead to exclusive transduction of retinal pigmented epithelium in rat. Mol Ther, 6(4), 446-54. Eastman, S. J., Baskin, K. M., Hodges, B. L., Chu, Q., Gates, A., Dreusicke, R., Anderson, S., & Scheule, R. K. (2002). Development of catheter-based procedures for transducing the isolated rabbit liver with plasmid DNA. Hum Gene Ther, 13(17), 2065-77. M. J., Semple-Rowland, S. L., & Raizada, M. K. (2003). Efficient large-scale Physiol Genomics, 12(3), 221-8. Corvol, P., Lamande, N., Cruz, A., Celerier, J., & Gasc, J. M. (2003). Inhibition of I)angiotensinogen. Curr Hypertens Rep, 5(2), 149-54. Crackower, M. A., Sarao, R., Oudit, G. Y., Yagil, C., Kozieradzki, I., Scanga, S. E., M., Manoukian, A. S., Chappell, M. C., Backx, P. H., Yagil, Y function n, M. A., & Nolan, G. P. (2002). Nonprimate lentiviral vectors. Curr Top Microbiol Magnani, B., & Zanchetti, A. (2002). Comparative effects of candesartan and candesartan assessment in the treatment of cardiac hypertrophy (CATCH) stud Dono(2000 converts angiotensin I to angiotensin 1-9. Circ Res, 87(5), E1-9. Dostal, D. E., Rothblum, K. N., Chernin, M. I., Cooper, G. R., & Baker, K. M. (1992system in neonatal rat heart. Am J Physiol, 263(4 Pt 1),

PAGE 98

87 Emanueli, C., Salis, M. B., Stacca, T., Gaspa, L., Chao, J., Chao, L., Piana, A., & Madeddu, P. (2001). Rescue of impaired angiogenesis in spontaneously hypertensive rats by intramuscular human tissue kallikrein gene transfer. Hypertension, 38(1), 136-41. Fackler, O. T., & Baur, A. S. (2002). Live and let die: Nef functions beyond HIV replication. Immunity, 16( tial in ase improves endothelial dysfunction in a rat model of hypertension. Gene Ther, 9(2), 110-7. Fleurrger, periods of time in adult rat cardiomyocytes in vivo. Circulation, 107(18), 2375-82. Gilbeol Gomez, R. A., Chevalier, R. L., Carey, R. M., & Peach, M. J. (1990). Molecular biology Guibinga, G. H., Miyanohara, A., Esko, J. D., & Friedmann, T. (2002). Cell surface heparan sulfate is a receptor for attachment of envelope protein-free retrovirus-like n 2-retion. Physiol Rev, 70(4), 1067-116. R. E., f 31-6. 4), 493-7. Feng, Y. H., Sun, Y., & Douglas, J. G. (2002). Gbeta gamma -independent constitutiveassociation of Galpha s with SHP1 and angiotensin II receptor AT2 is essenAT2-mediated ITIMindependent activation of SHP-1. Proc Natl Acad Sci U S A, 99(19), 12049-54 Fennell, J. P., Brosnan, M. J., Frater, A. J., Hamilton, C. A., Alexander, M. Y., Nicklin, S. A., Heistad, D. D., Baker, A. H., & Dominiczak, A. F. (2002). Adenovirus-mediated overexpression of extracellular superoxide dismut y, S., Simeoni, E., Zuppinger, C., Deglon, N., von Segesser, L. K., KappenbeL., & Vassalli, G. (2003). Multiply attenuated, self-inactivating lentiviral vectors efficiently deliver and express genes for extended rt, J. R., & Wong-Staal, F. (2001). HIV-2 and SIV vector systems. Somat Cell MGenet, 26(1-6), 83-98. of the renal renin-angiotensin system. Kidney Int Suppl, 30, S18-23. particles and VSV-G pseudotyped MLVderived retrovirus vectors to target cells.Mol Ther, 5(5 Pt 1), 538-46. Gusella, G. L., Fedorova, E., Marras, D., Klotman, P. E., & Klotman, M. E. (2002). Ivivo gene transfer to kidney by lentiviral vector. Kidney Int Suppl, 61 Suppl 1, 36. Hackenthal, E., Paul, M., Ganten, D., & Taugner, R. (1990). Morphology, physiology, and molecular biology of renin sec Hamra, F. K., Gatlin, J., Chapman, K. M., Grellhesl, D. M., Garcia, J. V., Hammer, & Garbers, D. L. (2002). Production of transgenic rats by lentiviral transduction omale germline stem cells. Proc Natl Acad Sci U S A, 99(23), 149

PAGE 99

88 Harding, J. W., Cook, V. I., Miller-Wing, A. V., Hanesworth, J. M., Sardinia, M. F., HaK. L., Stobb, J. W., Swanson, G. N., Coleman, J. K., Wright, J. W., & et al. (1Identification of an AII(3-8) [AIV] binding site in guinea pig hippocampus. BRes, 583(1-2), 340-3. ll, 992). rain and effect of poloxamer 188. Mol Ther, 4(5), 407-15. Herwime course of gene expression after plasmid DNA gene transfer to the liver. J Gene Med, 3(3), 280-91. Hilbeerikawa, T., Soubrier, F., Dubay, C., Cartwright, P., De Gouyon, B., Julier, C., Takahasi, S., & et al. (1991). Hogasin, AT1 and AT2 receptors in the pressor, drinking and vasopressin responses to central angiotensin. Brain Res, 586(2), 289-94. HoggHuan Wu, Q. L., Conley, G., DeOliveira, D., Morganelli, L., Ducar, M., Wescott, C. R., & Ladner, R. C. (2003a). Novel peptide inhibitors of Huang, L., Zhang, L., & Chen, C. H. (2003b). Potential Drug Targets on the HIV-1 2. Hughcles provide a choice of three affinitybased capture and magnetic concentration strategies for retroviral vectors. Mol Ther, 3(4), 623-30. Hunynctions of AT(1) angiotensin receptor internalization. Regul Pept, 91(1-3), 29-44. Ichihatial for left ventricular hypertrophy and cardiac fibrosis in chronic angiotensin II-induced hypertension. Circulation, Hartikka, J., Sukhu, L., Buchner, C., Hazard, D., Bozoukova, V., Margalith, M., Nishioka, W. K., Wheeler, C. J., Manthorp, M., & Sawdey, M. (2001). Electroporation-facilitated delivery of plasmid DNA in skeletal muscle: plasmid dependence of muscle damage eijer, H., Zhang, G., Subbotin, V. M., Budker, V., Williams, P., & Wolff, J. A. (2001). T rt, P., Lindpaintner, K., Beckmann, J. S., S Chromosomal mapping of two genetic loci associated with blood-pressure regulation in hereditary hypertensive rats. Nature, 353(6344), 521-9. rty, D. C., Speakman, E. A., Puig, V., & Phillips, M. I. (1992). The role of angioten an, M. D. (1970). Adenovirus associated viruses. Prog Med Virol, 12, 211-39. g, L., Sexton, D. J., Skogerson, K., Devlin, M., Smith, R., Sanyal, I., Parry, T., Kent, R., Enright, J., angiotensin-converting enzyme 2. J Biol Chem, 278(18), 15532-40. Envelope Glycoproteins, gp120 and gp41. Curr Pharm Des, 9(18), 1453-6es, C., Galea-Lauri, J., Farzaneh, F., & Darling, D. (2001). Streptavidin paramagnetic parti ady, L., Catt, K. J., Clark, A. J., & Gaborik, Z. (2000). Mechanisms and fu ra, S., Senbonmatsu, T., Price, E., Jr., Ichiki, T., Gaffney, F. A., & Inagami, T. (2001). Angiotensin II type 2 receptor is essen 104(3), 346-51.

PAGE 100

89 Iyer, S. N., Lu, D., Katovich, M. J., & Raizada, M. K. (1996). Chronic control of high blood pressure in the spontaneously hypertensive rat by delivery of angiotensitype 1 receptor antisense. Proc Natl Acad Sci U S A, 93(18), 9960-5. n Kakar, S. S., Sellers, J. C., Devor, D. C., Musgrove, L. C., & Neill, J. D. (1992). Kambi, K., Tsuzuki, S., Inui, H., Hamakubo, T., & Inagami, T. (1993). Molecular cloning of a novel angiotensin II receptor isoform 543-Kloting, I., Voigt, B., & Kovacs, P. (1998). Metabolic features of newly established Koha system. ents selected by phage display against the nuclear localization signal of the HIV-1 Vpr protein inhibit nuclear import in permeabilized Kumaation of Kurisatsuura, H., Chayama, K., Teranishi, Y., Iba, O., Amano, K., & Matsubara, H. (2003). Cardiac Lake, J. A., Carr, J., Feng, F., Mundy, L., Burrell, C., & Li, P. (2003) The role of Vif Angiotensin II type-1 receptor subtype cDNAs: differential tissue expression and hormonal regulation. Biochem Biophys Res Commun, 183(3), 1090-6. ayashi, Y., Bardhan, S., Takahash involved in phosphotyrosine phosphatase inhibition. J Biol Chem, 268(33), 246. congenic diabetes-prone BB.SHR rat strains. Life Sci, 62(11), 973-9. ra, K., Brosnihan, K. B., Ferrario, C. M., & Milsted, A. (1992). Peripheral and central angiotensin II regulates expression of genes of the renin-angiotensinAm J Physiol, 262(5 Pt 1), E651-7. Krichevsky, A., Graessmann, A., Nissim, A., Piller, S. C., Zakai, N., & Loyter, A. (2003). Antibody fragm and intact cultured cells. Virology, 305(1), 77-92. r, M., Bradow, B. P., & Zimmerberg, J. (2003). Large-Scale Production of Pseudotyped Lentiviral Vectors Using Baculovirus GP64. Hum Gene Ther, 14(1), 67-77. Kumar, M., Keller, B., Makalou, N., & Sutton, R. E. (2001). Systematic determinthe packaging limit of lentiviral vectors. Hum Gene Ther, 12(15), 1893-905. u, S., Ozono, R., Oshima, T., Kambe, M., Ishida, T., Sugino, H., M angiotensin II type 2 receptor activates the kinin/NO system and inhibits fibrosis. Hypertension, 41(1), 99-107. during HIV-1 infection: interaction with novel host cellular factors. J Clin Virol,26(2), 143-152.

PAGE 101

90 Latini, R., Tognoni, G., Maggioni, A. P., Baigent, C., Braunwald, E., Chen, Z. M.,Collins, R., Flather, M., Franzosi, M. G., Kjekshus, J., Kober, L., Liu, L. R., Pfeffer, M., Pizzetti, F., Santoro, E., Sleight, P., Swedberg, K., TavazzWang, W., & Yusuf, S. (2000) S., Peto, i, L., Clinical effects of early angiotensin-converting enzyme inhibitor treatment for acute myocardial infarction are similar in the nsin-converting Enzyme Inhibitor Myocardial Infarction Collaborative Group. J Am Coll Cardiol, 35(7), 1801-1807. Lesni ing Li, Q., Bolli, R., Qiu, Y., Tang, X. L., Guo, Y., & French, B. A. (2001). Gene therapy Li, Z.oriuchi, M. (2003). Role of AT2 receptor in the brain in regulation of blood pressure and water intake. Am J Lois, C., Hong, E. J., Pease, S., Brown, E. J., & Baltimore, D. (2002). Germline M., l ischemia. Circulation, 98(25), 2800-4. sduced with VRX496 in HIV-positive subjects. Hum Gene Ther, 12(16), 2028-9. Maki Yla-Herttuala, S. (2002). Increased vascularity detected by digital subtraction presence and absence of aspirin: systematic overview of individual data from96,712 randomized patients. Angiote k, E. A., Sampath, R., & Ecker, D. J. (2002). Rev response elements (RRE) in lentiviruses: an RNAMotif algorithmbased strategy for RRE prediction. Med Res Rev, 22(6), 617-36. Levy, R. J., Song, C., Tallapragada, S., DeFelice, S., Hinson, J. T., Vyavahare, N., Connolly, J., Ryan, K., & Li, Q. (2001). Localized adenovirus gene delivery usantiviral IgG complexation. Gene Ther, 8(9), 659-67. with extracellular superoxide dismutase protects conscious rabbits against myocardial infarction. Circulation, 103(14), 1893-8. Iwai, M., Wu, L., Shiuchi, T., Jinno, T., Cui, T. X., & H Physiol Heart Circ Physiol, 284(1), H116-21. transmission and tissue-specific expression of transgenes delivered by lentiviral vectors. Science, 295(5556), 868-72. Losordo, D. W., Vale, P. R., Symes, J. F., Dunnington, C. H., Esakof, D. D., MayskyAshare, A. B., Lathi, K., & Isner, J. M. (1998). Gene therapy for myocardial angiogenesis: initial clinical results with direct myocardial injection of phVEGF165as sole therapy for myocardia MacGregor, R. R. (2001). Clinical protocol. A phase 1 open-label clinical trial of the safety and tolerability of single escalating doses of autologous CD4 T cells tran nen, K., Manninen, H., Hedman, M., Matsi, P., Mussalo, H., Alhava, E., & angiography after VEGF gene transfer to human lower limb artery: a randomized, placebocontrolled, double-blinded phase II study. Mol Ther, 6(1), 127-33.

PAGE 102

91 Marrero, M. B., Schieffer, B., Li, B., Sun, J., Harp, J. B., & Ling, B. N. (1997). Role of Janus kinase/signal transducer and activator of transcription and mitogen-activated protein kinase cascades in angiotensin IIand platelet-derived growth factor-induced vascular smoo th muscle cell proliferation. J Biol Chem, 272(39), 24684-90. Marte S. P., ense gene therapy. Proc Natl Acad Sci USA, 95(5), 2664-2669. S., ., ). Cardiac-specific overexpression of angiotensin II AT2 receptor causes attenuated response to AT1 receptor-mediated pressor and Mashus-. L., ycoprotein pseudotyping of lentiviral vectors enables retrograde axonal transport and access to . P., tection gene. Circulation, 105(5), 602-607. Miak transfer. Nature, 419(6903), 132-3. Mittan vectors for multigene interventions in mammalian cells and in vivo transduction. Miura, S., & Karnik, S. S. (2000). Ligand-independent signals from angiotensin II type 2 Mukoon cloning of type 2 angiotensin II receptor reveals a unique class of seven-transmembrane receptors. J Biol Chem, 268(33), 24539-42. ns, J. R., Reaves, P. Y., Lu, D., Katovich, M. J., Berecek, K. H., Bishop,Raizada, M. K., & Gelband, C. H. (1998) Prevention of renovascular and cardiac pathophysiological changes in hypertension by angiotensin II type 1 receptor antis Masaki, H., Kurihara, T., Yamaki, A., Inomata, N., Nozawa, Y., Mori, Y., MurasawaKizima, K., Maruyama, K., Horiuchi, M., Dzau, V. J., Takahashi, H., Iwasaka, TInada, M., & Matsubara, H. (1998 chronotropic effects. J Clin Invest, 101(3), 527-35. hour, B., Couton, D., Perricaudet, M., & Briand, P. (1994). In vivo adenovirmediated gene transfer into ocular tissues. Gene Ther, 1(2), 122-6. Mazarakis, N. D., Azzouz, M., Rohll, J. B., Ellard, F. M., Wilkes, F. J., Olsen, ACarter, E. E., Barber, R. D., Baban, D. F., Kingsman, S. M., Kingsman, A. J., O'Malley, K., & Mitrophanous, K. A. (2001). Rabies virus gl the nervous system after peripheral delivery. Hum Mol Genet, 10(19), 2109-21 Melo, L. G., Agrawal, R., Zhang, L., Rezvani, M., Mangi, A. A., Ehsan, A., Griese, DDell'Acqua, G., Mann, M. J., Oyama, J., Yet, S. F., Layne, M. D., Perrella, M. A., & Dzau, V. J. (2002). Gene therapy strategy for long-term myocardial prousing adenoassociated virus-mediated delivery of heme oxygenase e, J., Marban, E., & Nuss, H. B. (2002). Biological pacemaker created by gene B., Rimann, M., Ehrengruber, M. U., Ehrbar, M., Djonov, V., Kelm, J., & Fussenegger, M. (2002). Advanced modular self-inactivating lentiviral expressio Nucleic Acids Res, 30(21), e113. receptor induce apoptosis. Embo J, 19(15), 4026-35. yama, M., Nakajima, M., Horiuchi, M., Sasamura, H., Pratt, R. E., & Dzau, V. J. (1993). Expressi

PAGE 103

92 Murphy, T. J., Takeuchi, K., & Alexander, R. W. (1992). Molecular cloning of AT1 angiotensin receptors. Am J Hypertens, 5(12 Pt 2), 236S-242S. Nakanishi, M., Eguchi, A., Akuta, T., Nagoshi, E., Fujita, S., Okabe, J., Senda, T., & l gene Naldini, L., Blomer, U., Gallay, P., Ory, D., Mulligan, R., Gage, F. H., Verma, I. M., & ells Nguyen, G., Delarue, F., Burckle, C., Bouzhir, L., Giller, T., & Sraer, J. D. (2002). Pivotal role of the renin/prorenin receptor in angiotensin II production and cellular Nicklin, S. A., Reynolds, P. N., Brosnan, M. J., White, S. J., Curiel, D. T., Dominiczak, Noda, K., Feng, Y. H., Liu, X. P., Saad, Y., Husain, A., & Karnik, S. S. (1996). The Ohkusawa, S., Kijima, K., Maruyama, K., Masaki, H., Tsutumi, Y., Shibazaki, Y., Iwasaka, T., & Inada, M. (1997). ling tion, 96(11), 3954-62. mutagenesis. Biochem Biophys Res Commun, 189(2), 677-83. Okadtablished Murine Melanoma Using RGD (Arg-Gly-Asp) Fiber-mutant Adenovirus Vectors. Jpn J Cancer Res, 93(4), 436-44. Olivaon in human cells. Gene, 278(1-2), 167-76. Olsen, J. C. (2001). EIAV, CAEV and other lentivirus vector systems. Somat Cell Mol Genet, 26(1-6), 131-45. Ondetti, M. A., Rubin, B., & Cushman, D. W. (1977). Design of specific inhibitors of angiotensin-converting enzyme: new class of orally active antihypertensive agents. Science, 196(4288), 441-4. Hasegawa, M. (2003). Basic peptides as functional components of non-viratransfer vehicles. Curr Protein Pept Sci, 4(2), 141-50. Trono, D. (1996). In vivo gene delivery and stable transduction of nondividing cby a lentiviral vector. Science, 272(5259), 263-7. responses to renin. J Clin Invest, 109(11), 1417-27. A. F., & Baker, A. H. (2001). Analysis of cell-specific promoters for viral genetherapy targeted at the vascular endothelium. Hypertension, 38(1), 65-70. active state of the AT1 angiotensin receptor is generated by angiotensin II induction. Biochemistry, 35(51), 16435-42. bo, N., Matsubara, H., Nozawa, Y., Mori, Y., Mura Angiotensin type 2 receptors are reexpressed by cardiac fibroblasts from faimyopathic hamster hearts and inhibit cell growth and fibrillar collagen metabolism.Circula Ohyama, K., Yamano, Y., Chaki, S., Kondo, T., & Inagami, T. (1992). Domains for G-protein coupling in angiotensin II receptor type I: studies by site-directed a, Y., Okada, N., Nakagawa, S., Mizuguchi, H., Takahashi, K., Mizuno, N., Fujita, T., Yamamoto, A., Hayakawa, T., & Mayumi, T. (2002). Tumor Necrosis Factor alpha-Gene Therapy for an Es res, E. C., Hollis, R. P., & Calos, M. P. (2001). Phage R4 integrase mediates site-specific integrati

PAGE 104

93 Ouali, R., Berthelon, M. C., Begeot, M., & Saez, J. M. (1997). Angiotensin II recepsubtypes AT1 and AT2 are down-regulated by angiotensin II through AT1 receptoby different mechanisms. Endocrinology, 138(2), 725-33. G. Y., Crackower, M. A., Backx, P. H., & Penninger, J. M. (2003). The RoleACE2 in Cardiovascular Physiology. Trends Cardiovasc Med, 13(3), 93-101. t, V., Schwartz, O., Le Gall, S., & Trono, D. (1999). The downregulatio tor r Oudit of Piguen of CD4 and MHC-I by primate lentiviruses: a paradigm for the modulation of cell surface Pozeg, Z. I., Michelakis, E. D., McMurtry, M. S., Thebaud, B., Wu, X. C., Dyck, J. R., Hashimoto, K., Wang, S., Moudgil, R., Harry, G., Sultanian, R., Koshal, A., & nel n, 107(15), 2037-44. nol ed human factor VIII expression in hemophilia A mice following systemic delivery of a gutless adenoviral vector. Mol Rigatbien, F., Corvol, P., & Sou. (1990). An insertion/deletion polymorphism in the angiotensin I-converting enzyme gene Roeb Gene Expr, 8(2), 67-84. Rongon (1-2), 203-12. ., & an and Santos, R. A., Campagnole-Santos, M. J., & Andrade, S. P. (2000). Angiotensin-(1-7): an update. Regul Pept, 91(1-3), 45-62. receptors. Immunol Rev, 168, 51-63. Archer, S. L. (2003). In vivo gene transfer of the O2-sensitive potassium chanKv1.5 reduces pulmonary hypertension and restores hypoxic pulmonary vasoconstriction in chronically hypoxic rats. Circulatio Reaux, A., Fournie-Zaluski, M. C., & Llorens-Cortes, C. (2001). Angiotensin III: a central regulator of vasopressin release and blood pressure. Trends EndocriMetab, 12(4), 157-62. Reddy, P. S., Sakhuja, K., Ganesh, S., Yang, L., Kayda, D., Brann, T., Pattison, S., Golightly, D., Idamakanti, N., Pinkstaff, A., Kaloss, M., Barjot, C., Chamberlain, J. S., Kaleko, M., & Connelly, S. (2002). Sustain Ther, 5(1), 63-73. B., Hubert, C., Alhenc-Gelas, F., Cam accounting for half the variance of serum enzyme levels. J Clin Invest, 86(4), 1343-1346. uck, K. A., & Saifuddin, M. (1999). Regulation of HIV-1 transcription. P., Wilkinson-Berka, J. L., & Skinner, S. L. (2001). Control of renin secretifrom adrenal gland in transgenic Ren-2 and normal rats. Mol Cell Endocrinol, 173 Sakai, H., Shibata, R., Miura, T., Hayami, M., Ogawa, K., Kiyomasu, T., Ishimoto, AAdachi, A. (1990). Complementation of the rev gene mutation among humsimian lentiviruses. J Virol, 64(5), 2202-7.

PAGE 105

94 Sasaki, K., Yamano, Y., Bardhan, S., Iwai, N., Murray, J. J., Hasegawa, M., Matsuda, Y& Inagami, T. (1991). Cloning and expression of a complementary DNA encoding a bovine adrenal angiotensin II type-1 receptor. Nature, 351(6323), 230-3. ., Siragy, H. M., Inagami, T., Ichiki, T., & Carey, R. M. (1999). Sustained hypersensitivity to angiotensin II and its mechanism in mice lacking the subtype-2 (AT2) Sirvenodeficiency virus type-1 central DNA flap is a crucial determinant for lentiviral vector nuclear Stec, 16, 80-4. e, hase into the liver is effective for the treatment of pulmonary hypertension in rats. J Thorac Thom the use of Tipnis, S. R., Hooper, N. M., Hyde, R., Karran, E., Christie, G., & Turner, A. J. (2000). A Trono human cell factor is essential for HIV-1 Rev action. Embo J, 9(12), 4155-60. Wage Gilst WH. (2002). Angiotensin receptors in the cardiovascular system. Can J Cardiol, 18(12), 1331-9. Wagn d simian immunodeficiency virus: implications for the safety of lentiviral vectors. Hum Gene Ther, 11(17), 2403-13. Wangtion of a domain in the angiotensin II type 1 receptor determining Gq coupling by the use of receptor angiotensin receptor. Proc Natl Acad Sci U S A, 96(11), 6506-10. n, A., Pflumio, F., Zennou, V., Titeux, M., Vainchenker, W., Coulombel, L., Dubart-Kupperschmitt, A., & Charneau, P. (2000). The human immu import and gene transduction of human hematopoietic stem cells. Blood, 96(13), 4103-4110. D. E., & Sigmund, C. D. (2001). Physiological insights from genetic manipulation of the reninangiotensin system. News Physiol Sci, Suhara, H., Sawa, Y., Fukushima, N., Kagisaki, K., Yokoyama, C., Tanabe, T., OhtakS., & Matsuda, H. (2002). Gene transfer of human prostacyclin synt Cardiovasc Surg, 123(5), 855-61. as, C. E., Ehrhardt, A., & Kay, M. A. (2003). Progress and problems withviral vectors for gene therapy. Nat Rev Genet, 4(5), 346-58. human homolog of angiotensin-converting enzyme. Cloning and functional expression as a captopril-insensitive carboxypeptidase. J Biol Chem, 275(43), 33238-43. D., & Baltimore, D. (1990). A naar LJ, Voors AA, Buikema H, van er, R., Graf, M., Bieler, K., Wolf, H., Grunwald, T., Foley, P., & Uberla, K. (2000).Rev-independent expression of synthetic gag-pol genes of human immunodeficiency virus type 1 an C., Jayadev, S., & Escobedo, J. A. (1995). Identifica chimeras. J Biol Chem, 270(28), 16677-82.

PAGE 106

95 Wang, H., Katovich, M. J., Gelband, C. H., Reaves, P. Y., Phillips, M. I., & Raizada,K. (1999). Sustained inhibition of angiotensin I-converting enzy M. me (ACE) expression and long-term antihypertensive action by virally mediated delivery of Watso, & Wolfe, J. H. (2002). Targeted transduction patterns in the mouse brain by lentivirus vectors pseudotyped Wu, J., & Cunnick, J. M. (2002). Trans-regulation of epidermal growth factor receptor by Xiong, W., Chao, J., & Chao, L. (1995). Muscle delivery of human kallikrein gene Yagil9). Role of chromosome X in the Sabra rat model of salt-sensitive hypertension. Yamaalsh, C. E. (2003). Lentivirus vector purification using anion exchange HPLC leads to improved gene transfer. Yan, uronal Yee, J. K., Friedmann, T., & Burns, J. C. (1994). Generation of high-titer pseudotyped Zhang YC, Bui JD, Shen L, Phillips MI. (2000). Antisense inhibition of beta(1)-ressure in spontaneously hypertensive rats. Circulation, 101(6), 682-8. Zini, Inhibition of vasopressinergic neurons by central injection of a specific aminopeptidase A inhibitor. Neuroreport, 9(5), 825-8. ACE antisense cDNA. Circ Res, 85(7), 614-22. n, D. J., Kobinger, G. P., Passini, M. A., Wilson, J. M. with VSV, Ebola, Mokola, LCMV, or MuLV envelope proteins. Mol Ther, 5(5 Pt 1), 528-537. lysophosphatidic acid and G protein-coupled receptors. Biochim Biophys Acta1582(1-3), 100-6. reduces blood pressure in hypertensive rats. Hypertension, 25(4 Pt 2), 715-9. C., Sapojnikov, M., Kreutz, R., Zurcher, H., Ganten, D., & Yagil, Y. (199 Hypertension, 33(1 Pt 2), 261-5. da, K., McCarty, D. M., Madden, V. J., & W Biotechniques, 34(5), 1074-8, 1080. Z., Ritchie, T. C., Duan, D., & Engelhardt, J. F. (2002). Recombinant AAV-mediated gene delivery using dual vector heterodimerization. Methods Enzymol, 346, 334-57. Yang, H., Lu, D., Vinson, G. P., & Raizada, M. K. (1997). Involvement of MAP kinase in angiotensin II-induced phosphorylation and intracellular targeting of neAT1 receptors. J Neurosci, 17(5), 1660-9. Yayama, K., Wang, C., Chao, L., & Chao, J. (1998). Kallikrein gene delivery attenuates hypertension and cardiac hypertrophy and enhances renal function in Goldblatt hypertensive rats. Hypertension, 31(5), 1104-10. retroviral vectors with very broad host range. Methods Cell Biol, 43(Pt A), 99-112 adrenergic receptor mRNA in a single dose produces a profound and prolonged reduction in high blood p S., Demassey, Y., Fournie-Zaluski, M. C., Bischoff, L., Corvol, P., Llorens-Cortes, C., & Sanderson, P. (1998).

PAGE 107

BIOGRAPHICAL SKETCH Matthews interest in science began in an advanced chemistry class at Hamilton High Schooenroll town he began to question his future as a chemist and as a result approached a faculty member in the Dtrue interest lay in the biological applications of chemistry, his education path at Ohio UniveJohnssenior year a loving relationship was forged with a fellow Chemistry Department student, Heathgraduation Matthew spent three months working in the lab of Dr. Alexander Boldyrev, a progrs stimuent. Matthew John Huentelman was born on November 4th, 1975, in Hamilton, Ohio. l taught by Susan King. Motivated to pursue a degree in chemistry, Matthew ed at Ohio University in Athens, Ohio. In this beautiful southeastern Ohio epartment of Chemistry, Dr. Peter Johnson, for some direction. Discovering his rsity was altered. After four years, including two spent working in the lab with Dr. on, Matthew graduated with a BS degree in biochemistry. Additionally, during his er Myers, who would later become his wife in 2002. Following undergraduate close colleague of Dr. Johnson, in Moscow, Russia. Matthews graduate thesis work began in 1998 following his enrollment in the University of Floridas interdisciplinaryam in the biomedical sciences. Following the initial year of course work, he wa excited to enter the laboratory of Dr. Mohan Raizada to pursue his Ph.D. degree in a lating and progressive thinking lab environm 96


Permanent Link: http://ufdc.ufl.edu/UFE0000974/00001

Material Information

Title: HIV-1 Based Viral Vector Development for Gene Transfer to the Cardiovascular System
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0000974:00001

Permanent Link: http://ufdc.ufl.edu/UFE0000974/00001

Material Information

Title: HIV-1 Based Viral Vector Development for Gene Transfer to the Cardiovascular System
Physical Description: Mixed Material
Copyright Date: 2008

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0000974:00001


This item has the following downloads:


Full Text












HIV-1 BASED VIRAL VECTOR DEVELOPMENT FOR GENE TRANSFER
TO THE CARDIOVASCULAR SYSTEM

















By

MATTHEW J. HUENTELMAN


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2003

































Copyright 2003

by

Matthew J. Huentelman
































This work is dedicated to my family, my spouse, my fellow lab-mates, and my friends,
without whom none of my goals could be achieved.















ACKNOWLEDGMENTS

I would like to express my gratitude to my mentor, Mohan Raizada, for almost five

full years of unfaltering guidance and "kick in the pants" motivation. I feel very lucky to

have spent my time at the University of Florida in his laboratory where day in and day

out everyone pushed each other to not only succeed, but to excel. Additionally, I need to

thank all the wonderful people with whom I was lucky to interact in Mohan's lab,

especially Beverly Metcalfe with whom I worked closely on the AT2R project.

I would also like to thank the invaluable members of my dissertation committee,

Harm Knot, Peter Sayeski, and especially Michael Katovich who was directly involved

with many of the experiments detailed in this thesis.

Next I would like to thank my parents, Connie and John, for providing me the

greatest gift in the world-a top notch college education. I am a direct reflection of their

flawless parenting skills. Also, I need to recognize my wife of eight months, Heather, for

all the support and inspiration she provided to me during these last five years together-I

look forward to the remainder of our lives with each other.

Last, but certainly not least, I need to thank my fellow student and friend, Jason

Coleman, his mentor, Susan Semple-Rowland, Adrian Timmers, and all others who

passed through the UF LenTi Roundtable (LTR) group. Without Jason's hard work and

helpful suggestions this dissertation would have a lot fewer results to speak of. Sue and

others in the LTR group provided me with unparalleled support and helped to advance

the lenti system further than any of us could have imagined in such a short period of time.
















TABLE OF CONTENTS
Page

A C K N O W L E D G M E N T S ................................................................................................. iv

L IST O F FIG U R E S .............. ............................ ............. ........... ... ........ viii

A B ST R A C T ................. .......................................................................................... x

CHAPTER

1 INTRODUCTION: BACKGROUND AND SIGNIFICANCE .............. ...............1

Cardiovascular D disease and H hypertension ........................................ .....................1
Im portance and Im pact ........................................................... .................
The R enin-A ngiotensin System ................................... .............................. ...... 2
R e n in .............................................................................................................. 2
A ngiotensinogen ....................................... ....... .. .. .... .. ........ ..
Angiotensin converting enzym e ............... ............................................ 5
Angiotensin II type 1 receptor............................................... .................. 6
A ngiotensin II type 2 receptor.................................... ........................ 8
Pro-/renin receptor .......................................... ............ .. .... .. ............ 10
A ngiotensin(1-7) .............. ............. .. .............................. ............. 10
Angiotensin converting enzyme 2....................... ..........................11
A n g io ten sin III ....................................................................................... 12
A ngiotensin IV ...................................... ....... .... ............... ........ 13
Gene Therapy and Cardiovascular Disease ..............................................14
W hy G ene T herapy? ............................................................. ............. .....14
The Perfect V sector ................................................. ....... .. ............ 14
G ene Transfer V ectors ............................................................ ............... 15
N on -v iral v ectors ......................................................... .. ...... ...... ... ... 15
N aked nucleic acid ............................................................ ....... ........15
C om plexed nucleic acid ........................................ .......................... 16
V iral vectors ............................................................. .... ........ 17
A denovirus based .......... ....... ........................ ...... ................. 17
A deno-associated virus based ........................................... ............... 18
Human immunodeficiency virus based.................................................20
V sector choice.................. .................................................... 2 1
State of the Field: Gene Therapy for Cardiovascular Disease ............................22
H hypertension .......................... ............ ............... .... ....... 22
V ascu lar disease ................................................. .. .. ........ ...... ............24



v









C cardiac disease ................................. ......... .... .. .. .. ............ 25
L en tiv iral V e cto rs ................................................................................................. 2 5
Development and Discovery ................................................... 25
Lentiviral Vector Design and Molecular Biology ...................... ............... 27
Gag-Pol ..................................................................... .. ............ ...................27
E nv ........................................................................................ 28
R e v ............................................................................................................... 2 9
Tat30
V p r ......................................................... 3 0
Vpu ................................. .......................... .... .... ......... 30
Vif31
N e f ................................................................................................................ 3 1
State of the Field: Lentiviral-Based Vectors ......................................................31
A alternative lentiviruses ........................................ .......................... 31
In vivo usage ................................................................ ......... 32
Aim s and Rationale .............................. ... .... .. ... .............. 34
Aim 1: Create a more user friendly lentiviral vector system. ....................35
Aim 2: Characterize the efficacy of the lentiviral vector system in non-
dividing cells in vitro. .......... ..... .......... ............................ .. ............. 35
Aim 3: Deliver the lentiviral vector systemically into the cardiovascular
system and characterize its efficacy................... ... ..................... .... 35
Aim 4: Prevent the development of cardiovascular disease in the SHR using
systemic delivery of the lentiviral vector ................... ...... ............35

2 IMPROVING LENTIVIRAL VECTOR PRODUCTION RESULTS IN THE
ABILITY TO CONSISTENTLY PRODUCE VECTOR ON A LARGE SCALE....36

In tro d u ctio n ...................................... ................................................ 3 6
R e su lts ................ .............. ...... ........................... ................ 3 8
"TY F" Cloning V ector Im provem ents ........................................ .....................38
V ector Production M modifications ............................................. ............... 39
Concentration Protocol M modifications ..................................... ............... ..41
Lentivector Performance in the Brain In Vivo................. ............................41
D iscu ssio n ...................... .. .. ......... .. .. ................................................. 4 2

3 SYSTEMICALLY ADMINISTERED LENTIVIRAL VECTOR TRANSDUCES
SEVERAL TISSUES IN THE RAT RELEVANT TO THE CARDIOVASCULAR
S Y S T E M ...................................... .................................................. 4 5

In tro du ctio n ...................................... ................................................ 4 5
R e su lts ...........................................................................................4 6
In Vitro Efficacy ....................................................... ................. 46
In Vivo Efficacy ................................................................................... 48
D ose-response ............................................................... .... .. ..49
Transgene expression duration................................ ....................... 50
Biodistribution of vector .............. ... ................ .......... .....50
D iscu ssion ............... .................................... ............................5 1









4 ANGIOTENSIN II TYPE 2 RECEPTOR GENE TRANSFER ATTENUATES THE
DEVELOPMENT OF CARDIAC HYPERTROPHY IN THE SPONTANEOUSLY
H Y PE R TE N SIV E R A T ...................................................................... ..................56

Introduction..................................... .................................. ........... 56
R e su lts ................... ........................................................... ................5 9
Lentiviral Vector Design and In Vitro Assay ................................................ 59
In Vivo Delivery of TYF.hEF .AT2R.IRES.Neo .............................................60
D iscu ssio n ...................................... ................................................. 6 1

5 CONCLUSIONS AND DIRECTIONS ....................................... ...............67

Lentivector Production and Perform ance .......................... ..................... ..............68
The AT2R and Other Targets of the RAS....................................... .......... .............. 69

A PPEN D IX M E TH O D S ......................................................................... ...................72

Chapter 2...................... .. ....................... ....... ....... ....... .................72
Lentiviral Vector Constructs: pNHP, phEFl.VSV.G, and the pTYF "family" ..72
D N A P rep aration ............................ .. .... ........ ............................................74
Production of Lentivector: Transfection .................................. ............... 74
Production of Lentivector: Concentration.........................................................75
Lentivector Titration: PLA P ......................................... ........................ ......... 77
Delivery of TYF.hEF 1.EGFP Vector to Brain Nuclei .............. ... .............77
C e ll C u ltu re ..................................................................... 7 8
S o lu tio n s .....................................................................................7 8
C h a p te r 3 ............................................................................................................... 7 9
TYF Constructs ...........................................................79
G row th A rrest and Transduction........................................... .......................... 79
Systemic Delivery of Lentivector to Neonatal Rat ...........................................79
C ell Staining for lacZ ............................................. .................... ............. 80
Tissue Histochem istry for PLAP......................................................................80
C e ll C u ltu re ................................................................................................... 8 1
C h a p te r 4 ........................ ............................................................................. ... 8 1
A T2R Lentivector Construction....................................... ......... ............... 81
Lentivector Titration: G418 Resistance................................................81
125I-A ngiotensin II B finding ........................................ ........................... 82
Cardiac Echocardiography ............................................................................ 83
C e ll C u ltu re ................................................................................................... 8 3
Solutions .............................. ............... ................. 83
S statistics ...................... .. ............. ..................................................... 8 3
LIST OF REFERENCES ............... ......... .............. ......... .........84

B IO G R A PH IC A L SK E T C H ....................................................................................... 96
















LIST OF FIGURES

Figure page

1-1 Major components of the Renin-Angiotensin System. .........................................3

1-2 Signal transduction pathways for the AT1R and AT2R ........................................ 7

1-3 W ild-type HIV-1 genome organization................................ ........................ 27

2-1 Three plasmid system used to produce recombinant lentiviral vector ...................38

2-2 The pTYF family of modified cloning vectors. ...................................................39

2-3 Lentivector production is greatest within the first 48 hours following
transfection ...........................................................................40

2-4 A modified lentivector concentration protocol results in higher final titers ...........42

2-5 Lentiviral vector efficiently transduces neurons in the adult rat brain in vivo.........43

3-1 The pTYF lentiviral vector reporter gene constructs. ...................... ...............46

3-2 Lentiviral vector efficiently transduces quiescent cells relevant to the
cardiovascular system in vitro ............................ .............................. 47

3-3 Separate lentiviral vectors are able to transduce the same cell in succession. .........48

3-4 Increasing the dose of lentiviral vector results in higher transduction efficiency....49

3-5 Lentiviral vector expresses transgene for at least 120 days in vivo .......................51

3-6 Systemically delivered lentiviral vector transduces multiple tissues relevant to the
cardiovascular system ...................................... ................... ......... 52

3-7 Lentivector effectively transduces cardiomyocytes in vivo. ...................................54

3-8 Systemically administered lentiviral vector is capable of transducing germ cells...55

4-1 Lentiviral constructs encoding the AT2R. ...................................... ............... 60

4-2 Binding characteristics of the AT2R expressed from the lentiviral vector in CHO
c e lls ..............................................................................6 1









4-3 AT2R gene transfer results in decreased cardiac hypertrophy in the SHR............... 62

4-4 AT2R gene transfer significantly decreases the increase in left ventricular wall
thickness for up to 9 w eeks. ............................................ ............................. 63

4-5 AT2R gene transfer has no effect on systolic blood pressure in the SHR ...............65















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

HIV-1 BASED VIRAL VECTOR DEVELOPMENT FOR GENE TRANSFER
TO THE CARDIOVASCULAR SYSTEM

By

Matthew J. Huentelman

December 2003

Chair: Mohan K. Raizada
Major Department: Physiology and Functional Genomics

Cardiovascular disease (CVD) is the nation's number one killer. Several

pharmacotherapies exist to combat CVD however its incidence and mortality rates

continue to rise. Alternative treatment options must be explored in order to provide hope

for the future treatment of this disease. Gene therapy has been suggested as one such

alternative option.

Gene therapy involves the transfer of therapeutic nucleic acid into diseased cell

types. The vector for such gene transfer is of major consideration when approaching any

disorder. Viral vectors based on HIV-1 are an up and coming class of gene transfer

vehicles first utilized in 1996 and already finding their way into human clinical trials.

However the HIV-1 vectors, or lentiviral vectors, are poorly characterized in almost

every major organ of the CV system. Lentiviral vectors possess many of the

characteristics required for effective gene therapy for CVD including the ability to

accommodate large payloads of nucleic acid, transduce non-dividing cells, direct long-









term transgene expression, and evoke a miniscule immune response. However, many

challenges face lentiviral vectors including questions about their safety for use in humans

and technical hurdles concerning their large-scale preparation. The primary goal of this

study was to further develop the lentiviral vector system and characterize its efficacy in

the CV system and its ability to prevent CVD.

Novel methods were developed for the production and concentration of the vector

allowing for reproducible large-scale production. Upon delivery to neonatal rats, the

lentiviral vector transduced every major target organ of the rat cardiovascular system

including the heart, liver, brain, kidney, and adrenal gland. The optimal vector dose was

determined, and additional studies using an angiotensin II type 2 receptor transgene

illustrated the ability of the vector to prevent the development of hypertrophy in a

spontaneous model of hypertension in the rat.

The methodology of lentiviral vector preparation was improved and its

effectiveness in the CV system illustrated. Initial results using a therapeutic transgene

show promise for the future study of cardiac hypertrophy. The findings here help to lay

the foundation for future use of the lentiviral vector in the study and possible therapy of

CVD.















CHAPTER 1
INTRODUCTION: BACKGROUND AND SIGNIFICANCE

Cardiovascular Disease and Hypertension

Importance and Impact

Cardiovascular disease (CVD) is the number one cause of mortality and morbidity

in industrialized countries. An estimated 1 in 4 Americans suffer from some form of

CVD and over 40% of all deaths in the United States are linked to CVD. Additionally,

the economic impact on society is enormous. The National Center for Chronic Disease

Prevention and Health Promotion reports that nearly $300 billion is spent each year both

managing this disease through health care costs and through lost workplace productivity.

With our increasingly aging population, these statistics can only be predicted to worsen.

CVD in general encompasses many disorders including hypertension, heart disease,

and atherosclerosis among others. In most cases, the treatment options for the CVD

patient only serve to alleviate the symptoms not reverse or sometimes even halt the

progress of the underlying disorder. As medicine advances into the next century there is

great hope that new treatment options may emerge to remedy this.

The contributions of the renin-angiotensin system (RAS) in both the normal

physiology of blood pressure (BP) regulation and the pathophysiology of hypertension

are under intense study. Hypertension alone affects over 50 million Americans reaching

epidemic proportions in the adult population where 1 in 5 have been diagnosed with the

disorder. The primary symptom of this disease is chronic elevated blood pressure, but









patients often have an increased risk of stroke, heart disease, and renal damage. If left

untreated, hypertension can adversely affect several major organs including the kidneys,

heart, brain, vasculature, and eyes. Many antihypertensive pharmacotherapies exist;

however, they primarily succeed in managing the symptoms of the disease.

The Renin-Angiotensin System

The Renin-Angiotensin System (RAS) is an endocrine system of major importance

to the body with its key feature being the maintenance of body fluid homeostasis. The

next section discusses the major players of the RAS individually. Figure 1-1 is a

reference diagram of the RAS components discussed below.

Renin

The unusually specific aspartyl protease renin was first identified over 100 years

ago by Tiegerstedt and Bergman in extracts from the kidneys of rabbits. In the

circulation, renin is the rate limiting step of the RAS. The main source of the circulating

enzyme is from the juxtaglomerular (JG) cells in the kidney (Gomez et al, 1990). The JG

cells are modified smooth muscle cells containing the characteristic dense core secretary

granules often found in other neuroendocrine cells (Hackenthal et al, 1990). However, in

JG cells the secretaryy granules" are atypical in appearance with a much greater

similarity to the common lysosome. Therefore some researchers suggest that the JG cells

do not contain the stereotypical granules found in many endocrine cells, but rather have

adapted their lysosomes for the specialized role of processing and
































AT3R (?) AT4R ATI-7R
Vasoconstriction Vasodilation H20 Conservation Dilation Vasodilation
Na /HO Conservation Apoptosis Hypertrophy Na/HO Conservation
Hypertrophy/Hyperplasia Development Memory

Figure 1-1. Major components of the Renin-Angiotensin System. Highlighted in red are
the more thoroughly understood proteins and peptides of the system. All
enzymes are written nearest an arrowed line connecting the substrate and
products of the reaction they catalyze. Other components (proteins, peptides,
and receptors) are listed at the tail or head of an arrow.

secreting renin (Bader and Ganten 2000). Renin is produced and secreted from these

cells through the processing of its inactive precursor, prorenin, by the lysosomal protease

cathepsin B. The JG cells are not the only source of renin in the organism. It has been

shown that renin/prorenin is secreted from cells in the adrenal gland, heart, and brain and

may therefore be assumed to participate in a local, tissue-based RAS (Dostal et al, 1992;

Rong et al, 2001). Once in the circulation, renin may act on its circulating substrate,

angiotensinogen.









Angiotensinogen

The 55-60 kDa globular protein angiotensinogen (AOGEN) is the single known

precursor to angiotensin I synthesis. The bioavailability of AOGEN rate limits the

activity of renin, and the primary source of circulating AOGEN is from the hepatocytes

in the liver. In fact, within the AOGEN secreting hepatocytes a positive feedback loop

has been established with the final bioactive product of the RAS, angiotensin II, acting at

angiotensin II type 1 receptor sites on the cells to further upregulate AOGEN secretion

(Brasier et al, 2000). Additionally, astrocytes, primarily located in the hypothalamus and

brainstem nuclei, and adipocytes have been shown to secrete large amounts of AOGEN

while AOGEN mRNA can be found in a wide variety of tissues and cell types in the

body. This suggests that AOGEN synthesis can proceed in organ systems throughout the

body as is the case with the renin enzyme and other components of the RAS.

There is no direct experimental evidence to show any intracellular processing of

AOGEN, in fact the three major sources of AOGEN hepatocytess, astrocytes, and

adipocytes) lack basic cellular machinery to concentrate secretary proteins. Instead these

cell types can only constitutively export the AOGEN to the extracellular fluid. The result

is a circulating concentration of AOGEN of approximately 1 M, essentially equal to the

calculated Km of the renin-AOGEN cleavage reaction.

The action of renin on the N-terminus of AOGEN liberates the invariant

decapeptide, angiotensin I (Ang I), in addition to its globular chaperone, des(Ang I)-

AOGEN. To date no direct physiological effects have been shown for AOGEN or

des(Ang I)-AOGEN alone and the general consensus is that AOGEN functions purely as









an extracellular reservoir of Ang I. However, a recent publication suggests anti-

angiogenic effects for both AOGEN and des(Ang I)-AOGEN (Corvol et al, 2003).

Angiotensin converting enzyme

The dipeptidyl carboxyl metallopeptidase, angiotensin converting enzyme (ACE),

cleaves Ang I to form the vasoactive octapeptide angiotensin II (Ang II). ACE exists in

both a soluble and endothelial cell bound form. The primary site of ACE action is found

in the lungs, but ACE activity has been documented in several other organs including but

not limited to the kidney, liver, heart, and blood vessels (Kohara et al, 1992; Balcells et

al, 1997). Unlike renin, ACE is very non-selective in its mode of action. In fact, ACE

has been documented to cleave substance P, luteinizing hormone releasing hormone, and

the potent vasodilator bradykinin. It is also important to note that ACE action is not a

rate controlling step in the RAS cascade.

The pharmacologic inhibition of ACE (ACEi) represents one of the early and most

successful antihypertensive targets of the RAS. The first orally active ACE inhibitor,

captopril, was reported in Science in 1977 (Ondetti et al, 1977). Since then, ACEi has

been used to successfully treat hypertension, myocardial ischemia, and cardiac

hypertrophy (Latini et al, 2000; Cuspidi et al, 2002). As touched on above, ACEi blocks

both the formation of Ang II and the breakdown of bradykinin. In this manner ACEi

serves to quiet the vasoconstrictive qualities of the RAS while increasing the circulating

concentrations of the vasodilator bradykinin.

Along with touching off the pharmacologic crusade against hypertension, the study

of ACE gene polymorphisms in the human population helped to initiate the modem day

understandings of the genetic component of hypertension. The I/D ACE polymorphism

was related to serum ACE concentrations. It was shown that those individuals









homozygous for the D allele presented with higher levels of serum ACE than

heterozygotes or homozygous I/I patients (Rigat et al, 1990).

ACE action on Ang I drives the formation of the vasoactive octapeptide Ang II.

The majority of Ang II's well studied cardiovascular (CV) actions are mediated by the

type 1 receptor (ATiR). The type 2 receptor (AT2R) had classically been thought to only

play a role during the development of the CV system due to its transient increased

expression during embryogenesis, however many studies have suggested an AT1R -

antagonistic role for the AT2R.

Angiotensin II type 1 receptor

The distinct AT1R and AT2R binding sites were first experimentally revealed in

1987. Through treatment with the thiol-reducing agent DTT two distinctly sensitive

classes of receptors for Ang II were identified. The molecular cloning of the AT1R in

1991 revealed it to be a part of the G-protein couple receptor (GPCR) super-family

(Sasaki et al, 1991). Within two years the AT1R was cloned from several animals

including humans, rats, and mice. Also during this time a second subtype of the receptor,

the AT1BR, was isolated in rodents. The AT1BR was found to predominate in the adrenal

cortex and pituitary gland while AT1AR was primarily expressed in vascular smooth

muscle, liver, kidney, heart, and other organs (Kakar et al, 1992; Murphy et al, 1992).

Both subtypes were found to bind Ang II with similar affinity and also couple to identical

G-protein subtypes.

By GPCR family definition the AT1R consists of seven transmembrane domains

with its N-terminus located extracellularly and C-terminus intracellularly. Members of

the GPCR family must also couple to cytosolic G-proteins, most commonly a complex of

three G-proteins known as a heterotrimer. Three mechanisms exist for ATiR -mediated








signal transduction: G-protein mediated, G-protein independent, and internalization

(Figure 1-2).


AT R


AT2R


G Protein
: PLC activation,
IP3/DAG generation, Ca2+ release,
PKC activation, MAPK activation
: AC inhibition, decreased
cAMP levels
Tyrosine Kinase
M: STAT phosphorylation,
transcriptional changes
: PLC activation, IP3/DAG
generation, Ca2+ release, PKC
activation, MAPK activation
M: Paxillin phosphorylation,
cytoskeletal re-arrangement

Internalization
PKC-dependent clathrin/caveolae
process


G Protein
: Protein phosphatase activation
(PP2A, MKP-1, SHP-1), MAPK
inhibition, decreased cell growth,
apoptosis, increased cGMP levels
Tyrosine Kinase
No definitive evidence supporting any
form of activation
Internalization
No definitive evidence supporting any
form of internalization


Figure 1-2. Signal transduction pathways of the AT1R and AT2R.

Ang II binding at the AT1R produces IP3 by activation of the Gaqll or GUay3173

pathways. Cytosolic loop number three has been shown to play the critical role in this

action (Ohyama et al, 1992). Additionally the G3y subunits are known to activate

phospholipase D. In fact, the ATiR is known to mediate several varied effects depending

on both cell type and distinct Guc subunit coupling. In general, the intracellular hallmarks

of Ang II binding at the ATiR and acting via G-protein mediated signal transduction are

activation of phospholipase C (PLC), protein kinase C (PKC), mitogen activated protein

kinase (MAPK), and a resultant release of intracellular calcium stores.









GPCRs also have the ability to transactivate growth factor receptors and the j anus

kinase (JAK) signal transduction activators of transcription (STAT) pathway (Wu and

Cunnick 2002). This is termed the "tyrosine kinase" activity of the AT1R. Through the

activation of these membrane-bound and soluble tyrosine kinases, Ang II can exert

effects on cellular proliferation and transcription (Marrero et al, 1997). The important

site of action for these effects is a canonical "YIPP" motif located on the C-terminus of

the molecule (Ali et al, 1997).

The C-terminus plays a critical role in rapid desensitization and internalization of

the AT1R (Hunyady et al, 2000). Upon ligand binding the receptor is phosphorylated by

a PKC-dependent mechanism and internalized via clathrin and caveolae-mediated

processes (Bkaily et al, 2003). It is possible that caveolae-internalized AT1Rs can still

transduce their intracellular signals. In fact, internalization of receptor into specific

subcellular domains (nuclear and perinuclear) has been demonstrated in both neurons and

smooth muscle cells (Yang et al, 1997; Adams et al, 1999).

Angiotensin II type 2 receptor

Type 2 receptors also belong to the GPCR superfamily and therefore exist in the

membrane in a nearly identical form as the ATiR. The AT2R was cloned in 1993 and

found to only share an approximate 30% sequence homology with the ATIR

(Kambayashi et al, 1993; Mukoyama et al, 1993). This is the lowest value known among

all GPCR family subtypes. Current evidence suggests coupling to both pertussis toxin

sensitive (Gi 2 and Gia3) and Gas proteins. It was demonstrated that the AT2R can couple

and functionally signal after association with the Gas alone (Feng et al, 2002). This

suggests a novel mechanism for GPCR signaling because previously the paradigm of









GPCR members required heterotrimeric (c, 3, and y subunits) coupling prior to signal

transduction.

The AT2R is classically thought to play a role during development where it is

expressed highly in the embryonic kidney and vasculature among other CV-relevant

organs. In adults, the receptor is expressed in a limited number of tissues, but is up-

regulated over 5-fold during times of tissue remodeling (Ohkubo et al, 1997). However,

ongoing research from the past several years suggests an antagonistic role for the AT2R

on the classical AT1R -mediated actions of Ang II. For example, the presence of AT2R in

Ang II pressor areas of the brain helps to decrease the resultant BP rise following an

intracerebroventricular injection of Ang II (Li et al, 2003). Additionally, mice lacking

the AT2R have higher blood pressure compared to their wild-type littermates (Siragy et

al, 1999).

Many of the intracellular signaling pathways of the AT2R have yet to be fully

characterized. However it has been shown that the AT2R can signal through the

activation of protein tyrosine (SHP-1) or protein serine/threonine (PP2A) phosphatases to

inactivate the extracellular signal regulated kinases (ERKs) (Bedecs et al, 1997).

Recently it was shown that SHP-1 activation via the AT2R occurs via a novel

GPCR mechanism (Feng et al, 2002). Upon AT2R stimulation, the Gas protein alone

activates the SHP-1 protein. In fact, the G3y subunits were shown to be inhibitory to this

process presenting an alternate mechanism for GPCR signaling which challenges the

obligatory heterotrimeric G-protein association.

Several studies suggesting a "constitutive" activity of the AT2R have also been

performed. One such study replaced the third cytoloop of the AT2R with the same loop









from the AT1R. Transfection of this chimera resulted in increased expression of the c-fos

gene and calcium release, two hallmarks of AT1R activation, in the absence of ligand

(Wang et al, 1995). Secondly, modifications to any Ang II side chains was shown to

have little effect on AT2R function suggesting that the receptor already exists in the

membrane in an active state (Noda et al, 1996).

The AT2R has also been shown to induce apoptosis. Sadashiva Kamik's group

from the Cleveland Clinic has shown that mere over-expression of the receptor, again in

the absence of ligand, caused increased apoptosis in a vascular smooth muscle cell line

(Miura and Karnik 2000). This process was shown to be mediated by increased caspase-

3 and p38 MAPK activities. Additionally, the AT2R doesn't seem to undergo

internalization desensitization (Figure 1-2) (Ouali et al, 1997).

Pro-/renin receptor

A functional receptor for the renin enzyme was described in 2002 (Nguyen et al,

2002). The initial search for such a receptor was based on the evidence that pro-renin is

taken up from the circulation and concentrated in certain tissues. The receptor was

shown at high levels in the heart and brain while at lower levels in the liver and kidney.

In the kidney it was shown to co-localize with renin primarily in smooth muscle cells.

Renin bound to its receptor is fourfold more efficient at forming Ang I and it can also

induce an intracellular signal via the MAPKs.

Angiotensin(1-7)

Angiotensin(1-7) is a biologically active peptide of the RAS that has been shown to

counterbalance the hypertensive and hypertrophic actions of Ang II (Santos et al, 2000).

Intracerebroventricular (i.c.v.) infusion of Ang(1-7) into the lateral ventricle has no effect

on mean arterial pressure or heart rate, but it greatly facilitates the baroreflex control of









heart rate (Campagnole-Santos et al, 1992). This is in opposition to Ang II specific

effects. In the kidney, Ang(1-7) can act at both proximal and distal sites in the nephron

to cause natriuresis and diuresis (Benter et al, 1995). In the vasculature, Ang(1-7) is

generally characterized as a vasodilator; however, some researchers have proposed

vasoconstrictor and even dilator/constrictor properties to the peptide (Santos et al, 2000).

Recently, research has emerged reporting the identification of a putative Ang(1-7)

receptor molecule known as Mas (Santos et al. 2003). Previously an "orphan" GPCR, the

authors illustrate that in the kidneys of Mas knockout mice there is a significant decrease

in Ang(1-7) binding when compared to non-transgenic animals. Additionally, the Mas

knockout mice showed a decrease in their ability to concentrate urine and vasodilate in

response to Ang(1-7).

Angiotensin converting enzyme 2

The gene of a new angiotensin converting enzyme, ACE2, was identified in 2000

(Donoghue et al, 2000). ACE2 shares an approximate 40% identify with ACE, but it

differs greatly in substrate specificity. Whereas ACE action promotes Ang II formation,

ACE2 activity catalyzes the formation of the vasodilator molecule, Ang(1-7). Therefore

ACE2 may act as a functional antagonist of Ang II action.

ACE2 is expressed in endothelial cells located in the heart, kidney, and testis

(Tipnis et al, 2000). For this reason ACE2 has proposed roles in both cardiac and renal

physiology.

ACE2 knockout mice (ACE2 -/-) have elevated plasma and tissue Ang II levels,

normal basal blood pressure, decreased cardiac contractility, increased cardiac expression

of hypoxia-inducible genes, normal kidney function, and unaltered female or male

fertility (Crackower et al, 2002). This is in contrast to the ACE knockout mice which









exhibit low basal blood pressure, normal heart function, reduced male fertility, and the

inability to produce concentrated urine (Bernstein 1998; Stec and Sigmund 2001).

However, the ACE/ACE2 double knockout mice have reduced basal blood pressure and

completely normal heart, kidney, and reproductive function (Crackower et al, 2002).

From these findings it is possible to suggest that ACE2 expression is important to

direct normal cardiac development. In the case of basal blood pressure regulation, it may

be that in the absence of ACE2 another system compensates enough to keep blood

pressure at a normal level.

Additionally it was shown that the ACE2 gene maps to reported quantitative trait

loci identified in three diverse models of hypertension in the rat (Oudit et al, 2003).

Located on the X chromosome, ACE2 was genetically linked with hypertension in Sabra

salt-sensitive rats, stroke prone spontaneously hypertensive rats, and the spontaneously

hypertensive rat (Hilbert et al, 1991; Kloting et al, 1998; Yagil et al, 1999).

The future study of the CV-relevance of ACE2 will be aided by the recent creation

of novel peptide-based inhibitors (Huang et al, 2003).

Angiotensin III

The Angiotensin III (Ang III, 2-8 amino acid fragment of Ang II) heptapeptide is a

documented physiological modulator of the RAS. To this date a specific Ang III receptor

has yet to be identified; however, both the AT1R and AT2R can bind Ang III. There is

some evidence that Ang III is the major effector peptide in the brain, not Ang II (Reaux et

al, 2001).

Injection of Ang III directly into the supraoptic (SON) or paraventricular (PVN)

nucleus of the brain induces the release of arginine vasopressin (AVP) into the blood.

Co-injection of the AT1R and AT2R antagonists completely block this effect (Hogarty et









al, 1992). The conversion of Ang II to Ang III in the brain occurs quite rapidly and is

mediated by aminopeptidase A (APA). If an APA inhibitor is co-injected with Ang II

into the same brain nuclei the response to the Ang II is inhibited in a dose-dependent

manner (Zini et al, 1998). This suggests that under these conditions Ang II conversion to

Ang III is necessary to stimulate AVP release.

Ang III in the brain also exerts control over systemic blood pressure. Again there

is evidence supporting the theory that Ang II must be converted to Ang III to elicit a rise

in blood pressure via the CNS. The authors show that in spontaneously hypertensive rats

(SHR) treated with an APA inhibitor the pressor response to i.c.v. delivered Ang II is

blocked.

Angiotensin IV

Angiotensin IV (Ang IV, C-terminal 3-8 amino acid fragment of Ang II) is formed

by the action of aminopeptidase B on Ang III. In 1992, Ang IV was found to bind to a

specific site on adrenal membranes denoted as the AT4R (Harding et al, 1992). In late

2001 the AT4R was identified as the insulin-regulated aminopeptidase (IRAP) enzyme

(Albiston et al, 2001). IRAP is a transmembrane, zinc-dependent peptidase found in the

brain and periphery and Ang IV was shown to inhibit its activity. In the brain in

particular IRAP localizes very closely with the glucose transporter 4 (GLUT4) molecule.

The majority of physiological effects for Ang IV have focused on its ability to potentiate

memory. It is proposed that Ang IV-mediated inhibition of IRAP in the CNS indirectly

increases the half-life of neurotransmitters involved in memory and cognition, like

substance P and somatostatin.









Gene Therapy and Cardiovascular Disease

Why Gene Therapy?

As discussed earlier, typical pharmacotherapy for hypertension treats only the

symptoms of the disorder and usually does nothing to halt or reverse its progression.

Other problems with current pharmacotherapies include the existence of side effects and

the need for daily administration. These second two problems work together to cause

patient drug regimen compliance to drop possibly as low as 60%. Clearly, more must be

done to help alleviate these problems with antihypertensive therapy.

We chose to investigate gene therapy as an option to help us both understand

hypertension in general and hopefully advance the treatment of this disease. It could be

envisioned that a gene therapy approach to hypertension would result in more specific

long-term treatment of the disorder. Additionally, in the ideal situation, therapeutic

vector need only be delivered once thereby alleviating the problems associated with

compliance.

The Perfect Vector

In order for a gene therapy vector to succeed it must have the following

characteristics: (i) target both dividing and non-dividing cells; (ii) integrate into a known

or "safe" location in the host genome; (iii) direct robust and stable gene expression free

from positional silencing; (iv) invoke no long-term immune response in the recipient

animal; (v) be produced reproducibly and at high concentrations; (vi) deliver a large

payload of therapeutic nucleic acid that could theoretically contain cell-type specific

promoter or regulatory elements; and (vii) achieve all of these goals without

compromising the safety profile of the vector.









Gene Transfer Vectors

A major step in every gene therapy experiment comes at the very beginning where

the investigator must choose the vehicle that will be used to transfer the therapeutic

nucleic acid. Many times gene therapy experiments are hindered from the start simply by

the improper choice of gene transfer vector.

Non-viral vectors

Non-viral vectors simply avoid using the virus life cycle to achieve gene transfer.

In this case, the therapeutic nucleic acid may take many forms: circular plasmid DNA,

linearized plasmid DNA, and short DNA or RNA oligonucleotides. The therapeutic

nucleic acid may then be delivered "naked", that is simply purified and injected, or it may

be completed with one of many available reagents.

Naked nucleic acid

Naked DNA injections for gene therapy primarily target either the skin, skeletal

muscle, or liver. These organs are easily isolated and directly injected with DNA

solution and they possess above average abilities to uptake DNA from the blood and

interstitial fluid. Recently electroporation was employed to deliver plasmid DNA to skin

and skeletal muscle with increased efficiency (Hartikka et al, 2001). Up to a 10-fold

increase in expression was seen when employing such a technique. Efficient expression

can be achieved in the liver by the simple delivery of DNA into the tail vein. On average,

10-15% of hepatocytes are transduced when delivering 10[tg of plasmid DNA into the

tail vein (Herweijer et al, 2001). However, the liver is not the only tissue that is

transduced following such a procedure, low numbers of positive cells (100-fold less) can

be found in the heart, spleen, and kidneys. Better targeting of the liver can be achieved

by direct delivery into the portal circulation (Eastman et al, 2002). Cardiac muscle can









also be targeted by direct injection into the muscle wall or the coronary circulation.

Expression from naked DNA injection is generally limited to 1-4 weeks in duration with

the highest levels of expression lost within the first seven days.

Naked DNA for gene therapy is inexpensive to prepare, not constrained by gene

size, and is very safe. However, its limited range of target tissues and very short term

expression pattern generally preclude its usage from all but very specific gene therapy

protocols.

Complexed nucleic acid

Nucleic acid is usually completed with cationic lipids (lipoplexes) or cationic

polymers (polyplexes) prior to delivery. The overall goal of the process of complexation

is to spontaneously create small particles containing nucleic acid with an overall net

positive charge. The positive charge helps to force an interaction with the surface of the

cell where the small particles may then be endocytosed. Coating the therapeutic nucleic

acid with cationic molecules helps to increase their stability in vivo and improves their

tissue tropism and efficiency compared to naked DNA.

Complexed nucleic acid can effectively transduce every major organ in the body.

Additionally, recent advances have shown the inclusion of other components into the

cationic complexes could further increase their efficacy. Polyethylene glycol has been

included to increase stability and allow for lyophilization and long-term room

temperature storage of therapeutic complexes (Anchordoquy et al, 2001). Such a

development is key for the future clinical use of these complexes. Additionally, the

incorporation of basic peptides, called protein transduction domains, into the lipo- or

polyplexes can markedly facilitate their efficacy (Nakanishi et al, 2003).









Complexed nucleic acid incorporates all the advantages of naked nucleic acid plus

the added benefits of increased tropism and stability. However, this technique is still

limited by relatively short transgene expression duration therefore it is an unlikely

candidate for therapeutic use against a chronic disorder.

Viral vectors

Viral-based vectors exploit the natural process of viral infection to transfer

therapeutic nucleic acid into the cell and therefore generally exhibit an increased

efficiency over non-viral methods. There are a myriad of viral vector systems in

existence, but this section will focus on the most popular vectors for gene transfer to non-

dividing cells.

Adenovirus based

Adenovirus-based (Ad) vectors are the second most commonly utilized vector in

human clinical trials. Ad vector usage in humans came under fire in 1999 when a patient

died of vector-associated toxicity, but the vector was recently redeemed when its use in a

phase II trail resulted in very promising results on lower limb angiogenesis (Makinen et

al, 2002).

The Ad particle is non-enveloped and has a size of approximately 80nm. The early

generation Ad vectors could only carry up to 8kb of DNA, but the newly developed

helper-dependent Ad (HD-Ad) can carry 30kb. Ad particles bind a cell surface receptor

molecule known as the coxsackievirus and Ad receptor (CAR) and are rapidly

internalized. Once inside the cell the virus genome is transported into the nucleus where

it exists in episomal form, un-integrated into the host genome. Ad vectors are generally

easy to purify and perform efficiently in vitro and in vivo provided that the target cell

expresses the CAR molecule.









Recently the area of the vector that confers the CAR binding specificity (the

capsid) was modified to contain an RGD peptide motif instead thereby targeting the

vector to integrin molecules (Okada et al, 2002). Other peptides have also been utilized

to specifically target endothelial and smooth muscle cells (Nicklin et al, 2001).

Alternatively, bi-specific antibodies, one end directed against the Ad vector and other to

the target cell, were bound to the vector to achieve the same result (Levy et al, 2001).

The severe immunogenicity of early generation Ad vectors has also been addressed.

Early generation Ad vectors elicit inflammation and immune response even in immune

privileged organs (Mashhour et al, 1994). To address this, much of the Ad genome was

deleted and vector production was achieved using helper virus. These HD-Ad vectors are

the future of the Ad system since they can carry a greater payload (30kb versus 8kb for

early generation Ad vectors), have a reduced immune response, and exhibit much longer

transgene expression. Non HD-Ad vectors only manage expression for approximately

thirty days while HD-Ad vectors have been shown to express for greater than 9 months

(Reddy et al, 2002).

The current generation of HD-Ad vectors look very promising due to their large

payload capacity, decreased immunogenicity, and long-term transgene expression

abilities. However, target cells are limited to those expressing the CAR unless

modifications are made to the Ad vector capsid protein. Also, the HD-Ad are more

difficult to produce and every preparation of vector is contaminated at a low level with

helper vector presenting a biosafety issue for the user.

Adeno-associated virus based

The adeno-associated virus (AAV) is a non-enveloped particle approximately 25nm

in diameter with a single stranded genome (Hoggan 1970). The wild type virus integrates









in a specific location on human chromosome 19 and has yet been associated with any

type of disease. The modified vector genome results in a loss in this specificity with the

majority of vector existing in an episomal form. However, up to 90% of the population is

seropositive for AAV thereby causing problems for the future use of this vector in the

human clinic. Five major serotypes of AAV have been identified in humans therefore

each patient must be screened for neutralizing antibodies and treated with a different

serotype vector for the greatest efficacy.

The AAV genome is almost completely deleted, but the payload capacity of the

virus remains quite low, between 4-5kb. Some investigators have worked their way

around this potential problem by splitting a large expression cassette into two AAV

vectors and then co-delivering them into target cells (Yan et al, 2002). This requires

infection of a single target cell by each vector and the proper heterodimerization of the

AAV genomes inside the cell.

The primary receptor for AAV is the widely expressed heparin sulfate proteoglycan

molecule, and the vector has been used successfully in several species and cell types.

The one major cell type that is refractory to AAV transduction is the hematopoetic stem

cell. Targeting to specific cell types was achieved using the exact same techniques

employed with the Ad virus: bi-specific antibody complexes and genetic manipulation of

the capsid protein (Bartlett et al, 1999).

Although existing primarily as an episome the AAV directs long-term expression

(over one year) of transgene, but, depending on the viral dose, transgene expression could

take up to one month before reaching appreciable levels.









AAV is well suited to in vivo gene transfer due to its safety, broad tropism, and

long-term gene expression. However, the vector is limited by its very small payload, the

presence of neutralizing antibodies in the human population, and its slow start to

transgene expression. Additionally, AAV is difficult to produce on a large scale and has

somewhat limited effectiveness in rapidly dividing cells.

Human immunodeficiency virus based

The human immunodeficiency type 1 viral (HIV-1) vector is an enveloped virus

approximately 120nm in diameter. HIV-1 consists of an RNA genome of approximately

9kb. However, two copies of the genome are packaged in each virion bringing the total

space for therapeutic RNA to 18kb (Kumar et al, 2001).

While the wild type virus primarily transduces lymphocytes the HIV-1 vector has

been adapted to accept a wide variety of envelope glycoproteins from different enveloped

viruses. This process is called pseudotyping and is equivalent to the genetic modification

of the Ad or AAV capsid proteins. For example, pseudotyping the vector with an Ebola

virus envelope causes preferential transduction of airway epithelial cells. The most

common pseudotype protein for the HIV-1 vector is the vesicular stomatitus virus

glycoprotein (VSV-G). The VSV-G pseudotype helps to stabilize the vector particles and

broadens the tropism of the vector since the receptor for VSV-G is a phospholipid.

As with AAV, the HIV-1 vector has been used successfully across many species

and in almost every tissue in the body. The wild type HIV-1 genome consists of nine

genes, but five of these are completely unnecessary for vector function. To increase

safety all five of these genes are deleted from the vector and the other four genes are

expressed in trans and then only during production of the vector. After entering the cell

the vector genome is actively transported into the nucleus of both dividing and non-









dividing cells where it integrates permanently into the genome. The nuclear transport and

integration process happens very quickly allowing transgene expression to proceed within

12-24 hours following infection. This integration is random with some preference to

areas in the genome with relaxed chromatin structure. The vector's stable integration in

the genome results in long-term (greater than one year) transgene expression.

The HIV-1 vector is very amenable to in vivo therapeutic gene transfer due to its

large size, low immunogenicity, long-term expression, and ability to infect both dividing

and non-dividing cell types. However, since this vector is based on a human pathogen

there will always be concerns about its safety. Additionally, the vector is still difficult to

produce in large quantities and because it is an integrating vector there exists the

possibility for insertional mutagenesis.

Vector choice

Based on the above descriptions we made the decision to use the HIV-1 vector in

our experiments. The reasons were three-fold. First, gene therapy for CVD will likely

require long-term expression of transgene thereby eliminating naked and completed

DNA along with classical Ad vectors. The helper-dependent Ad vectors were not

available at the start of these experiments, but they still would not have been chosen due

to their tropism and contaminating helper virus issues. Additionally, we wanted the

option of using large transgene cassettes with multiple regulatory elements and the

possibility of using our therapeutic gene in situations where it must express immediately,

like during restenosis or after myocardial infarction, was a possibility. Therefore, the

only logical choice was the HIV-1 vector. Much of my work was spent improving the

large-scale production methods.









State of the Field: Gene Therapy for Cardiovascular Disease

Gene therapy for cardiovascular disorders is of major clinical interest due to the

impact of such diseases both economically and socially. Not surprisingly a myriad of

vector systems and therapeutic genes have been utilized depending on the specific

disorder being tackled. Three major areas for CVD gene therapy are covered below.

Hypertension

Antihypertensive gene therapies have focused on primarily either the introduction

of a vasodilatory gene or the inhibition or knockdown of a vasoconstrictor molecule.

Knockdown is classically achieved through the use of antisense technology, but recent

advances in double stranded RNA inhibition appear to be promising alternatives to this

approach (Brantl 2002). These techniques allow specific targeting of a constrictor gene's

mRNA through the introduction of complementary nucleic acid. The resulting double

stranded RNA is a target for degradation by endogenous cellular machinery. Viral and

non-viral methods have made use of such an approach.

Antisense was used successfully against beta 1 adrenergic receptors, ACE, and the

AT1R. Ian Phillips' group delivered non-viral oligonucleotide antisense molecules to the

beta 1 receptor into the systemic circulation of spontaneously hypertensive rats (SHR). A

single dose of the antisense oligo was able to decrease systolic blood pressure by 35

mmHg for 30 days (Zhang et al, 2000). Cardiac contractility was significantly reduced

during this period, and the authors suggest this as the major mechanism of action for the

nucleic acid drug. However after 30 days the antisense effect began to reverse with the

values for both parameters returning to baseline. While these findings are a significant

step forward with regards to required daily administration of antihypertensive

medication, there is still room for improvement.









To address this, Mohan Raizada's group at the University of Florida developed

retroviral vectors encoding both ACE and AT1R antisense. Systemic administration of

the ACE antisense vector into the neonatal SHR resulted in an approximate 15 mmHg

drop in blood pressure in the animals when measured in adulthood (92 days of age)

(Wang et al, 1999). This finding illustrates the much longer term nature of viral-

mediated antisense transduction versus oligonucleotide transfection. The AT1R antisense

vector showed more impressive results with a drop in blood pressure of >35 mmHg in

adult animals for a period of at least 90 days (Iyer et al, 1996). Additional effects were

also shown including decreased cardiac hypertrophy, improved endothelial cell function,

and decreased perivascular and cardiac fibrosis (Martens et al, 1998).

The major "sense" approach to hypertension originates from the lab of Julie and

Lee Chao at South Carolina. Using an adenoviral-based vector system expressing either

human kallikrein or adrenomedullin, they were able to reduce blood pressure in a variety

of models of hypertension. Kallikrein gene transfer into the quadriceps reduced blood

pressure in the SHR for 5 weeks (Xiong et al, 1995). In an animal model of renal failure,

kallikrein transduction again reduced blood pressure in Dahl salt-sensitive rats for four

weeks while also significantly improving cardiac hypertrophy and fibrosis and renal

function (Chao et al, 1998). Similar effects were also demonstrated in the Goldblatt

model of hypertension (Yayama et al, 1998).

The impact of reactive oxygen on blood pressure and especially nitric oxide

bioavailability has only recently been shown to play a significant role in

pathophysiology. In fact, Donald Heistad's group at the University of Iowa was able to

reduce mean arterial blood pressure and rescue impaired vasorelaxation in the SHR by









transferring the free radical scavenging enzyme, superoxide dismutase, via an adenoviral

vector (Chu et al, 2003). The future of antioxidant gene therapy for hypertension looks

very promising at this time.

Even the formidable disease of pulmonary hypertension has been attacked with

gene therapy. No effective pharmacotherapy exists for this disorder, but gene transfer of

the potassium channel Kv1.5 into the lung or prostacyclin synthase into the liver resulted

in lowered pulmonary pressures (Suhara et al, 2002; Pozeg et al, 2003). These findings

should stimulate more interest in addressing the problem of pulmonary hypertension via

gene therapy.

Vascular disease

Blood vessels, and the myriad of cell types they are comprised of, represent major

targets for cardiovascular disease gene therapy. Anna Dominiczak's group at the

University of Glasgow in the United Kingdom used an adenovirus encoding superoxide

dismutase to improve endothelial dysfunction in the stroke prone SHR (Fennell et al,

2002). Other groups have explored ways to improve new blood vessel growth, or

angiogenesis, in response to ischemia. Human tissue kallikrein gene delivery was shown

to augment ischemia-induced angiogenesis in the SHR (Emanueli et al, 2001). Perhaps

the most well known and by far the most clinically explored gene therapy for

angiogenesis originates from the late Jeffery Isner's group at Tufts University. Their

work has focused on plasmid-based delivery of vascular endothelial growth factor

(VEGF) to aid in collateral angiogenesis in peripheral arterial disease (PAD) and

myocardial ischemia (MI). In fact this plasmid-based approach was used in the clinic

beginning in 1994. The trial for PAD exceeded all expectations following the

demonstration of the growth of countless numbers of new collateral blood vessels in the









limbs of patients suffering from PAD (Baumgartner et al, 1998). The trial using direct

myocardial muscle delivery of the VEGF encoding DNA produced impressive results

also. In over 30 patients, who previously failed all conventional therapy, the VEGF

encoding plasmid successfully decreased the number of angina attacks and nitroglycerin

tablet consumption by over 15-fold (Losordo et al, 1998). The success of VEGF therapy

resulted in further successful angiogenic experiments with fibroblast and hepatocyte

growth factors in animal models of disease.

Cardiac disease

Cardiomyocytes themselves are another important target for anti-CVD gene

therapy. Antioxidant therapy with an adenovirus encoding superoxide dismutase was

shown to protect rabbit myocytes in vivo against MI, reducing the infarct size by 50%

when given prior to the MI (Li et al, 2001). Victor Dzau's group from the Harvard

Medical School pre-delivered another antioxidant gene, heme-oxygenase 1 (HO-1), to

adult rats in an adeno-associated vector and prevented over 75% of the infarct zone

following MI (Melo et al, 2002). Eduardo Marban's group at Johns Hopkins focuses on

heart failure and arrythmia. Recently they showed the ability to create pacemaker

activity in non-nodal cardiomyocytes through the use of an adenoviral vector encoding a

dominant negative inward rectifier potassium channel (Kir2.1) (Miake et al, 2002). In the

future it may be possible to use such manipulation in place of mechanical pacemaker

implantation.

Lentiviral Vectors

Development and Discovery

The first non-replicating lentiviral vector was reported in 1990 and was designed to

aid investigations into wild-type HIV-1 biology (Sakai et al, 1990). The first









"pseudotyped" (viruses enveloped with a non-native protein) particles were reported later

that year after infectious virus was successfully produced using the murine leukemia

virus 4070A amphotropic envelope glycoprotein (Trono and Baltimore 1990). The

quantitative titers of these initial vectors were approximately 105 infectious units per

milliliter (IU/mL).

However, the gene transfer potential of these vectors went unnoticed until

Buchshacker and Panganiban hypothesized in 1992 that such defective lentivectors may

be useful therapeutics for the treatment of AIDS (Buchschacher and Panganiban 1992).

The modern age of lentivector use and development really began in 1996 after Naldini et

al published their seminal paper in Science showing successful transduction of brain

tissue in vivo (1996) Their manuscript was key for several reasons: (i) the first deletions

were made in the virus to improve safety without sacrificing efficacy; (ii) the particles

were pseudotyped with the vesicular stomatitus virus glycoprotein (VSV-G) resulting in

titers of 5 X 105 before and 5 X 108 IU/mL after concentration; and (iii) most

importantly, they were the first group to use the lentivector system in a non-dividing cell

type (neurons). This set the stage for the future of the lentivector. The theme with each

new "generation" of vector is ever increasing safety through further deletions, versatility

through altered envelope pseudotyping, and efficacy through re-engineered

production/concentration protocols.

The lentivector is attractive to many investigators due to its inherent abilities to

transduce both dividing and non-dividing cells, direct long term expression, and produce

little to no immune response (Thomas et al, 2003). These traits coupled to the ability to









produce the vector in large quantities and at high concentrations results in a vector system

that is almost ideally suited for therapeutic gene transfer.

Lentiviral Vector Design and Molecular Biology

The HIV-1 virus is a so-called "complex" retrovirus belonging to the Lentivirinae

family. This means it shares conserved structural and enzymatic genes encoding the Gag,

Pol, and Env proteins with other retroviruses while at the same time the virus encodes for

an additional two regulatory genes (tat and rev) and four accessory genes (vif, vpu, vpr,

and nef). It is these additional genes which set apart the lentiviruses from the

oncoviruses. The major genes of HIV-1 biology and their importance to lentiviral vector

development are detailed below (Figure 1-3).


TAR U RRE LTR
Gag Vif Env I
R Pol R Tat
LTR Rev Nef



Figure 1-3. Wild-type HIV-1 genome organization.

Gag-Pol

The Gag-Pol fusion protein (p160) is created by a ribosomal frameshift during

normal Gag translation. During virus maturation a virally encoded protease cleaves the

Pol segment away from Gag and further digests Pol into 4 additional proteins: Protease

(Pro), Reverse-Transcriptase (RT), RNase H, and Integrase (IN).

Pro is an aspartyl protease dimer whose activity is required for the cleavage of the

Gag and Gag-Pol polyprotein. The RT protein has both an RNA and DNA-dependent

polymerase activity. Functional RT can be found in the capsid of budded virions and

because of this viral DNA can be completely synthesized in 6 hours following









transduction. The RNase H protein is necessary during the action ofRT. RNase H

digests the original RNA template from the newly created first strand of DNA allowing

synthesis to begin on the complementary strand. Integrase mediates the insertion of the

viral genome into the transduced cell. Gag-Pol expression is required during viral vector

production and packaging.

Env

This 160 kDa glycosylated protein (gpl60) is further processed by the host cell into

120 (gpl20) and 41 kDa (gp41) proteins. The gpl20 protein translocates to the cell

surface and interacts with gp41 to aid in its incorporation into budding virions. The

gpl20 dictates the tropism of the virus toward T-cells and primary macrophages by its

ability to bind the CD4 molecule on these cell's surfaces. The gp41 protein has been

shown to aid in viral fusion with the cell membrane (Huang et al, 2003).

Env expression is completely dispensable with regards to vector production. In

fact, one of the major benefits of the lentiviral vector is the fact that it is

"pseudotypeable". This means Env proteins from different viruses can efficiently be

substituted for the native HIV-1 Env. The most commonly used pseudotype envelope is

based on the vesicular stomatitus virus glycoprotein (VSV-G) (Yee et al, 1994). The

incorporation of the VSV-G into the coat of the vector has been shown to greatly improve

the stability of the vector, and because the purported receptor molecule for VSV-G is a

phospholipid, it broadens the tropism of the vector to include every cell type in the body

(Guibinga et al, 2002).

In fact these pseudotype Env proteins can do more than just alter stability of the

particle; they can be used to specifically direct the vector to cell types normally

transduced by the envelope protein's parent virus. For example, lentivector particles









pseudotyped with the rabies glycoprotein have been shown to undergo neuronal

retrograde transport in the same manner as the native rabies virus (Mazarakis et al, 2001).

This feat is achieved by simply exchanging the outer envelope protein. Additionally,

pseudotyping with the Zaire Ebola virus glycoprotein preferentially transduces airway

epithelial cells versus VSV-G pseudotyped vector, a potential advantage for the treatment

of cystic fibrosis and other epithelial disorders. Lentiviral vectors have been successfully

pseudotyped with several envelope glycoproteins including those mentioned above along

with the murine leukemia virus (MuLV), lymphocytic choriomenigitus virus (LCMV),

and Mokola virus envelope glycoproteins (Watson et al, 2002; Duisit et al, 2002).

Rev

Rev protein is expressed to circumvent the normal process of intronic splicing and

is therefore crucial for virus production. Rev is known to bind a multi-stem loop

structure on the viral RNA known as the Rev-response element (RRE) in a multimeric

fashion (Lesnik et al, 2002). This binding in turn exposes a region in Rev known as the

nuclear export signal (NES). The NES is then free to interact with nucleoporins, nuclear

export receptors, and other components of the infected cells native export machinery to

facilitate export of partially or un-spliced viral transcripts. Rev function is required for

the cytoplasmic translation of the splice site containing Gag-Pol mRNA.

For these reasons the Rev protein, or some functional replacement of it, must be

expressed during lentiviral vector production. Additionally, the RRE should be present

on any transcript destined to be packaged into therapeutic virus. To further improve

biosafety, some groups have exchanged the HIV-1 based Rev/RRE system for other

similar spliceosome-evading strategies of other viruses. The use of such systems has not









become widespread due to the approximately 10-fold lower vector titers obtained from

these systems (Wagner et al, 2000).

Tat

The Tat protein is a transcriptional transactivator that acts at the 5' long terminal

repeat (LTR) region. Tat forms a complex with other host proteins at a nascent viral

RNA hairpin known as the trans-activating response element (TAR). Once bound, the

Tat complexes direct hyper-phosphorylation of RNA Polymerase II and enhance

transcriptional activity by 100 to 500-fold (Roebuck and Saifuddin 1999).

In lentiviral vector design the Tat protein is dispensible. Chimeric 5' LTR regions

able to direct robust tat-independent transcription have replaced the native 5' LTR

promoter sequence (Mitta et al, 2002). However, the TAR motif is essential for initiation

of reverse transcription in the transduced cell and therefore should be present on the

therapeutic construct.

Vpr

The Vpr protein is carried into infected cells inside the virus and plays a role in the

nuclear import of the viral genome (Krichevsky et al, 2003). Additionally, Vpr has been

shown to cause G2 phase cell cycle arrest. It is unnecessary in the lentiviral vector.

Vpu

This 16 kDa polypeptide has been shown to both downregulate the CD4 molecule

(the HIV-1 receptor) and to enhance the release of infectious virions (Piguet et al, 1999).

In the absence of Vpu the majority of newly formed virions merely accumulate at the cell

surface and never successfully bud. It has been shown to be dispensible with regards to

the lentiviral vector.









Vif

Vif is a 23 kDa polypeptide essential for replication of HIV-1 in certain cell types.

In most cells some unidentified endogenous protein can complement Vif function (Lake

et al, 2003). Vif is incorporated into virions. This peptide is also unnecessary for proper

lentivector function.

Nef

Negative factor (Nef) is a 27 kDa myristolated protein whose primary action is to

post-translationally decrease the expression of CD4 in infected cells (Fackler and Baur

2002). This action has been shown to actually increase virus production. Nef is

packaged into virions and is the first viral protein to accumulate following HIV infection.

Nef is not needed for proper lentivector performance.

State of the Field: Lentiviral-Based Vectors

Since their first in vivo usage in 1996 the lentiviral vector development and utility

has been improving and expanding by leaps and bounds. This next section details the

current state of the art.

Alternative lentiviruses

The efficacy of lentivirus-based vectors is of no question, however, from their

inception much emphasis was placed on the overall safety profile of the vector. To this

end many molecular "safety valves" were ingressed into the vector system, but to some

investigators these improvements simply did not change the fact that the entire system

was based on a human pathogen.

To these groups the solution to this problem was to make use of other Lentivirinae

family members not shown to cause human disease. Good transfer efficacy was achieved

using equine infectious anemia virus (EIAV) and feline immunodeficiency virus (FIV)









derived vectors (Olsen 2001; Curran and Nolan 2002). Both vector types performed

similarly to HIV-1 based lentiviral vectors and were used to transduce equivalent target

cells. Even the less virulent HIV-2 strain was developed as a lentiviral gene transfer

vector (Gilbert and Wong-Staal 2001).

However, the highest titers of these vector systems remain up to 100-fold lower

than the HIV-1 lentivectors. Additionally, for the very reason that HIV-1 is a human

pathogen the scientific and medical community have much more knowledge about its

biology. There are simple and fast diagnostic tests for HIV infection and the clinic is

arrayed with multiple antiretroviral pharmacotherapies specifically targeted at HIV. For

these reasons the HIV-1 based lentivectors lead the field and will most probably be the

first type of lentiviral vectors used in the human clinic. However, the further

development of the "alternative" lentivirus systems should continue. As we learn more

about these other lentiviruses they may soon approach the overall performance of the

HIV-1 based systems.

In vivo usage

Since its first in vivo usage in 1996 the lentiviral vector has been utilized by

numerous investigators to transduce a myriad of target cells. Organs successfully

transduced with a targeted injection of lentiviral vector include the heart, brain, liver, eye,

blood, pancreas, spleen, kidney, skeletal muscle, and skin among others. In the work

detailed here I will illustrate that non-targeted delivery of lentivector into the systemic

circulation is additionally capable of transducing lung, adrenal gland, and even the testes

(Coleman et al, 2003). These results indicate the potential for this vector system in a

wide range of organ systems. Additionally, the lentivector was used to correct a number

of defects in animal models of human genetic disorders including cancer, cystic fibrosis,









parkinson's disease, sickle cell, huntington's disease, thalassemia, retinitis pigmentosa,

diabetes, porphyria, ischemic myocardium, and hemophelia. Lentiviral vectors have also

been used to combat HIV infection and even to help slow the progression of aging.

Recently, lentiviral vectors were used to efficiently create transgenic rats, a species

traditionally refractory to the often used microinjection technique used to make

transgenic mice (Hamra et al, 2002; Lois et al, 2002).

Surprisingly, very few examples of cardiovascular disease models have been

targeted with lentivirus-derived vectors. In fact, most of the cardiovascular system work

with the lentivector was performed in the last two years. In 2002, it was reported that

lentivirus expressing a fragment of matrix metalloproteinase 2 was capable of inhibiting

angiogenesis while earlier that year a group from New York illustrated that lentivector

infused into the ureter efficiently transduced cells in the kidney, a traditionally difficult

target to gene transfer (Gusella et al, 2002). In 2003 we published our findings on

effective transfer into several organs of the cardiovascular system of neonatal animals

while two other groups demonstrated tremendous (80-90%) in vivo transduction of

cardiomyocytes in adult mice (Bonci et al, 2003; Fleury et al, 2003). While all of these

findings contribute evidence that targeting of the CV system is possible with the

lentivector no group has yet prevented or reversed any form of CVD with the lentivector.

The first proposal using an HIV-1 vector in a clinical trial was submitted for

approval in 2001 (MacGregor 2001). The goal of this study was to use antisense

technology to suppress the expression of the HIV env gene in T cells of seropositive

patients currently failing antiretroviral therapy. If approved, this trial would begin less

than ten years from the date the first generation of lentiviral vectors were used in vivo.









Such a short time frame from discovery to clinic is a testament to the utility of the

lentiviral vector system.

Aims and Rationale

As detailed in this first chapter, CVD is the number one killer of Americans and

management of the disease has enormous socioeconomic impacts on this country.

Hypertension is the most common CVD with over 50 million Americans currently

diagnosed. Modern antihypertensive pharmacotherapy is lacking in two main aspects: (i)

It only treats the symptoms of the disease while not efficiently reversing the

physiological damage already done, and (ii) The requirement for a daily drug regimen

and drug related side effects results in low patient compliance leading to a general mis-

management of the disease. For these reasons, radical new methods for the management

and possible cure of hypertension must be elucidated.

Successful gene therapy for the prevention and reversal of hypertension has already

been demonstrated. However, in each case a certain aspect was lacking. The ultimate

goal of antihypertensive therapy should be to reverse the disease once it is established.

For this to be achieved the ideal gene transfer vector must be utilized. The ideal vector

would efficiently target quiescent cells since this disease is generally found in the adult

population. Additionally the vector must be easily produced and be as safe as possible

for use in humans. Site specific genomic integration and a large nucleic acid payload

capacity are also important. The lentivirus-based vector system satisfies the majority of

these requirements. The overall goal of the work described here was to develop a user-

friendly lentivector system for systemic gene transfer to the cardiovascular system. This

would set the foundation for future work using the vector system in the general study and

possibly treatment of hypertension. The specific aims for this work are detailed below.









Aim 1: Create a more user friendly lentiviral vector system.

(a) Modify the core cloning constructs to include multiple unique site and various

bicistronic marker gene cassettes.

(b) Develop a reproducible transfection protocol using decreased amounts of DNA

without compromising vector titer.

(c) Engineer simple concentration methods permitting the large scale production of

high titer vector stocks.

Aim 2: Characterize the efficacy of the lentiviral vector system in non-dividing cells
in vitro.

(a) Transduce growth-arrested and primary cells relevant to the cardiovascular

system.

(b) Assess transgene expression and determine transduction efficiency.

Aim 3: Deliver the lentiviral vector systemically into the cardiovascular system and
characterize its efficacy.

(a) Determine transduction efficiency.

(b) Assay duration of transgene expression.

Aim 4: Prevent the development of cardiovascular disease in the SHR using
systemic delivery of the lentiviral vector.

Monitor blood pressure along with other hypertensive pathophysiology following

the systemic administration of the vector.














CHAPTER 2
IMPROVING LENTIVIRAL VECTOR PRODUCTION RESULTS IN THE ABILITY
TO CONSISTENTLY PRODUCE VECTOR ON A LARGE SCALE.

Introduction

As discussed previously, it is quite clear that lentiviral vectors are fast becoming

the vector of choice for long-term gene transfer into dividing and non-dividing cells.

This fact is due to the many benefits associated with the lentiviral vector systems

including large payload capacity, low immunogenicity, and wide tropism. This increased

interest has given rise to a need for efficient and reproducible methods to produce large

quantities of vector. As more investigative genes are cloned into the lentivirus, there is

an additional need for utilitarian cloning constructs thereby allowing ease in cloning and

also the possibility for the bicistronic expression of marker genes for the identification of

transduced cells.

The traditional production of lentiviral vector involves the co-transfection of

human cell lines with plasmid DNA encoding the viral components required for

packaging. The transient transfection of these cell lines is usually achieved using the

conventional calcium phosphate co-precipitation methodology. Disadvantages of this

method include: (1) the large amount of plasmid DNA that is required for transfection;

(2) the difficulties associated with scaling up the precipitation reaction; and (3) the high

degree of variability observed in transfection efficiency and viral production. Recently,

several groups have developed packaging cell lines that facilitate the production of

lentiviral vectors by reducing the need for multi-plasmid transfections. Although the use









of packaging cell lines has streamlined the packaging procedure, the resulting viral titers

have not been significantly higher than those obtained using transient co-transfection

methods. In addition, the advantages of these new cell lines are often offset by the need to

develop new lines for each generation of improved lentiviral vector. To achieve large-

scale production of high-titer lentiviral vector it is critical that transfection of the virus-

producing cell cultures be both efficient and reproducible; however, little effort has been

put forth to optimize this step in vector production.

To target a disease like hypertension with gene therapy it may be critical to target

many different cells or cell types distributed throughout the body. To achieve this using a

single dose of vector would require its systemic administration into the circulation.

Reaching this goal with any gene therapy vector would require methods to easily produce

it on a large scale. Therefore to reach such a level with the lentivirus we developed

methods utilizing a dendrimer-based transfection reagent, SuperFect (Qiagen), coupled

with a novel concentration protocol. The result was the reproducible production of

higher titer virus using one-third less the amount of plasmid DNA traditionally required

when using calcium phosphate co-precipitation. Additionally, we designed a wide array

of cloning constructs used to produce the lentivector. These were designed in such a way

to simplify the cloning of new genes of interest into the vector system and also enable the

bicistronic expression of a marker gene to simultaneously identify transduced cells.

Finally, vectors produced using these new methods were assayed for in vivo efficacy in

adult rat brain.









Results

"TYF" Cloning Vector Improvements

The plasmid DNA constructs used to produce the lentiviral vector are denoted as

pNHP, phEFl.VSV.G, and pTYF (Figure 2-1). The pNHP plasmid encodes all the viral

SD RRE
Gag PTat
Pol kRev" SV40pA
TATA + TAR

hEF1
II VSV-G

4pAbGHpA

II TR Gag --------- MCS ---------
TATA ALTR



Figure 2-1. Three plasmid system used to produce recombinant lentiviral vector. From
top to bottom, pNHP, phEFl.VSV.G, and pTYF backbone.

proteins necessary for the production of infectious virus in trans. It is important to note

the open reading frame deletions of all the unnecessary accessory genes (vif, vpr, vpu,

and nef) along with the native env gene. Expression of the pseudotype env gene is

achieved by the co-transfection of the phEFl.VSV.G construct. This plasmid expresses

the vesicular stomatitus virus glycoprotein (VSV-G) under the control of the constitutive

human elongation factor 1 alpha promoter (hEF 1). The TYF family of vectors are the

only component of the system containing an intact psi (Y) packaging signal and fully

functional long terminal repeats (LTR). The therapeutic gene is cloned into this

construct, therefore, modification were made to this plasmid in order to facilitate cloning

and improve the overall utility of the vector system. The newly created family of









constructs are illustrated in Figure 2-2. It is important the note the large number of

unique cloning sites and the further inclusion of an internal ribosome entry site (IRES)

based bicistronic cassette. The IRES-containing vectors have been successfully used to

create stable cell lines in vitro (IRES.NEO), assay live cell transduction in vitro

(IRES.EGFP), and to localize transduction in vivo (IRES.PLAP).

ALTR bG
1:1 1 1 AGmi:::RF :F:::Not lI, Ne I, Sal I, Srm I, BamH I, Spe I Xba I, Kpn I :I
TATA 4 ALTR
NtI

:F :11 E he aI ll,SmalI, BarrH I, Spe l, Kpnl I

NHtI MulI EcoRV
I I I
F 1NheS I s Cla EGFP -:i

NI Mu I EcoR V



NatI Mul EcoRV
I I I
:F:I Nhe II, Smal, Clal NEO :IB

Mu I
:F 1I Nhe I, Sma Cla li Hyg-EGFP::


Figure 2-2. The pTYF family of modified cloning vectors. Only the unique cloning sites
are indicated for each construct. From top to bottom, pTYF.Linker,
pTYF.hEF .Linker, pTYF.hEF 1.IRES.EGFP, pTYF.hEF 1.IRES.PLAP,
pTYF.hEF 1 .IRES.NEO, and pTYF.hEF1 .IRES.Hyg-EGFP

Vector Production Modifications

The goals of our first series of experiments were to determine the optimum ratio of

total plasmid DNA to Superfect reagent that produced the highest titer virus and the

optimum time for viral harvest. This ratio was determined to be 1:2 (ratios of 1:1, 1:1.5,








1:2, 1:5, and 1:10 were tested; data not shown). The titers of virus-containing media

harvested directly from transfected 293T cultures were determined 30, 45, 60, and 70

hours post-transfection to identify the timeframe during which virus production by these

cultures is at maximum levels (Figure 2-3). The average titer values were 8.0 x 106, 6.8 x

106, 2.6 x 106 and 0.8 x106 transducing units (TU) per ml at 30, 45, 60 and 70 h post-

transfection, respectively. Therefore, we collected culture media 30 and 45 hours post-

transfection for subsequent experiments. It should also be noted that 293T cells passage

between 2 and 60 times were used for transfections and that passage number did not

significantly affect transfection efficiency or final vector titers.



10


E 8

H-
co 6



) 4
C,,



0

30 45 60 70
Harvest time (hours post-transfection)

Figure 2-3. Lentivector production is greatest within the first 48 hours following
transfection. Packaging cells were transfected with the appropriate plasmids
to produce TYF.hEF l.PLAP vector. Un-concentrated supernatants were
collected at the indicated times and titered on TE671 cells (n=3).









Concentration Protocol Modifications

The goal of our second series of experiments was to develop a concentration

protocol that would minimize virus loss and yield the highest titer virus in the smallest

possible volume. The concentration procedure and results are summarized in Figure 2-4.

The average starting titer of the virus-containing media (Figure 2-4, Steps 1-3) was 1.40

+ 0.35 x 107 TU/ml. The next step in the concentration procedure (Figure 2-4, Step 4)

yielded an average titer of 3.59 0.70x 108 TU/ml in a volume of -3.0 ml, resulting in a

33-fold increase in titer and an average recovery of 84%. Further concentration of the

virus stock by low-speed centrifugation (Figure 2-4, Steps 5c and 6) yielded 1.40 + 0.44 x

1010 TU/ml, a 958-fold increase over the average starting titer. The average overall

percent recovery of the virus was 40%.

Lentivector Performance in the Brain In Vivo

Lentiviral vector carrying an hEF -EGFP transgene was delivered into the

paraventricular (PVN) and the caudal nucleus of the solitary tract (NTS) of the adult rat

brain. Examination of transverse sections cut from the brains of animals either 7 days

(PVN) or 30 days (NTS) after injection revealed that the vector transduced a high

proportion of cells in both nuclei as evidenced by the presence GFP-positive cells (Figure

2-5). Many GFP-positive cells exhibited a neuronal phenotype (Figure 2-5, C) and in

many cases fluorescent axons could be seen hundreds of microns away from the area of

concentration of fluorescent cell bodies. Although not shown, robust expression was

shown for up to 90 days, the duration of the experiment.






42



1. Harvest virus at 30 h post-transfection (-20 x 7.0 ml)

Day 1 -
2. Concentrate by ultrafiltration (2 x Centricon-80 units)



3. a. Harvest virus at 45 h post-transfection (-20 x 6.5 ml)
O b. Combine virus from step 2 and step 3a


Q) 4. a. Overlay 30 ml virus onto 220 1l iodixanol (x 4 tubes)
SDay 2 b. Centrifuge at 50kx g for 2.5 h
o 0
5. a. Remove supernatant down to DMEM-iodixanol interface
b. Combine virus from 4 tubes (Step 4a) and add to 3 ml tube
c. Centrifuge at 3k x g for 20 h

I
Day 3 6. Remove supernatant and add buffer to resuspend virus pellet to
L1 achieve an approximate 3000-fold volume change.

Approx. volume *
Titer (TU/ml) change (folu Titerincrease (fold) %Virus recovered

) Step 3b 1.40 0.35 x 107 n/a n/a n/a
|- Step5b 3.59 0.70 x10 40 33 4 84 9
L Step 6 1.40 0.44 x 1010 3000 958 191 40 8
*Mean SEM derived from 13 separate large-scale virus preparations

Figure 2-4. A modified lentivector concentration protocol results in higher final titers.
Multiple preparations of TYF.hEF 1.PLAP lentiviral vector were concentrated
as indicated and titered on TE671 cells.

Discussion

By optimizing both the DNA transfection and viral concentration steps for

production of lentiviral vector, we have overcome many of the problems that we had

previously encountered in our efforts to produce large volumes of high-titer lentiviral

vector in a consistent manner. We found that SuperFect-mediated transfection of viral

packaging cells consistently yielded large-scale vector stocks (-120 ml) with starting









titers averaging >1.0 x 107 TU/ml, titers that were comparable to vector stocks prepared

using other transfection reagents (Curran et al, 2002; Fleury et al, 2003; Gusella et al,

2002). Use of SuperFect greatly simplified the transfection protocol and significantly

reduced the amount of plasmid DNA required for the procedure. The viral concentration

protocol that we developed consistently increased the titers of the viruses by

approximately 1000-fold (-1 x 1010 TU/ml). Lentiviral vectors produced using these

novel methods were shown to be able to efficiently transduce non-dividing cells

(neurons) in vivo.













Figure 2-5. Lentiviral vector efficiently transduces neurons in the adult rat brain in vivo.
Vector encoding EGFP (TYF.hEF 1.EGFP, see Chapter 3) was prepared using
the transfection and concentration schemes outlined above. The left-most
panel illustrates green fluorescence in the paraventricular nucleus (PVN) 7
days after the delivery of 5 X 105 transducing units of vector (n=2). The PVN
is highlighted in red in the inset drawing. The center panel illustrates similar
results achieved in the nucleus of the solitary tract (NTS) 30 days after the
bilateral delivery of 3 X 105 transducing units (n=2). Inset illustrates in red
the location of the NTS. The right-most panel is a magnified, pseudocolored
image of an EGFP-positive neuron from the NTS.

Additionally, we illustrated some modifications introduced into the TYF vectors

allowing an increased ease in cloning new genes of interest into the lentivector system.

Bicistronic expression cassettes were also created to allow the simultaneous expression of

marker protein or second therapeutic gene.






44


In summary, the transfection and concentration protocols outlined here allow

efficient, reproducible production of high-titer lentiviral vectors that exhibit robust

transduction properties in vivo. The transfection protocol itself is simple and can be easily

implemented by investigators interested in producing lentiviral vector in their

laboratories. Furthermore, the methods can be easily adapted to large-scale lentiviral

production protocols that are currently being developed for use in large animal studies or

for possible use in clinical studies.














CHAPTER 3
SYSTEMICALLY ADMINISTERED LENTIVIRAL VECTOR TRANSDUCES
SEVERAL TISSUES IN THE RAT RELEVANT TO THE CARDIOVASCULAR
SYSTEM.

Introduction

Having shown that it is possible to produce lentivector reproducibly and in large

quantities it is necessary to characterize the vector system in cardiovascular (CV) target

cells in vitro and in vivo.

Lentiviral vectors have documented success in very few CV relevant cell types in

vitro. Successful transfer of marker genes was demonstrated in primary cultured neurons

and cardiomyocytes. To investigate or treat a systemic disorder like hypertension it may

be necessary to transduce these cell types in addition to endothelial, smooth muscle, liver,

and kidney cells. Although vector pseudotyped with the VSV-G envelope would be

predicted to efficiently transduce these types of cells it has not been demonstrated

empirically.

Through the simple transduction of such cell types in vitro it cannot be inferred to

translate directly to the in vivo performance of the vector. Such in vivo investigations

into the tropism of the vector are necessary to perform. Additionally, when moving to

the whole animal it is important to determine what vector dose is necessary to transduce a

majority of target tissues.

To answer the questions regarding the in vitro and in vivo efficacy of the vector we

utilized a construct expressing marker genes (PLAP, EGFP, nlacZ, or DsRED). The goal

of these experiments was to determine if and under what conditions the lentivector could









successfully transduce cell types and tissues of the CV system. We were able to show

that the lentivector very efficiently transduces cells in vitro relevant to the CV system

including endothelial, neuronal, vascular smooth muscle, and liver cells. In vivo it was

shown that the highest dose of vector examined, 2.5 X 108 total particles, was able to

transduce a myriad of tissues including heart, liver, kidney, lung, adrenal glands, and

testes when administered into the systemic circulation of a 5-day-old rat.

Results

In Vitro Efficacy

All vectors were produced using the transfection and concentration protocols

detailed in the previous chapter. The PLAP and EGFP TYF constructs used in these

studies are illustrated in Figure 3-1. Two additional TYF constructs were also utilized,

one expressing a nuclear localized form of bacterial beta-galactosidase (nlacZ) and a

second one encoding a red-shifted commercially available fluorescent protein (DsRED,

Clontech).


ALTR
S b AGag RRE F II i
I ALTR
ALTR
SAGag RRE F || EGFP
TATA I A T
4 ALTR

Figure 3-1. The pTYF lentiviral vector reporter gene constructs. The top vector encodes
the PLAP gene and is denoted as pTYF.hEF .PLAP. The vector illustrated on
the bottom expresses the EGFP gene and is denoted as pTYF.hEF1.EGFP.

The goal of the in vitro experiments was to simply assay the efficacy of the

lentivector in quiescent, CV-relevant cell types. The first cell type tested was a cell line









of rat aortic endothelial cells. The cells were growth-arrested at confluency and

transduced with a TYF.hEFl.nlacZ vector. Staining at 48 hours post-transduction

revealed that at 1 multiplicity of infection (MOI) approximately 50% of the cells were

transduced. Two cell lines of vascular smooth muscle (A. 10 and A7r5) were treated in

the same manner and 20% of the cells were able to be transduced. A hepatocyte cell line

(HepG2) was also growth-arrested and instead incubated with a vector expressing

enhanced GFP (TYF.hEF .EGFP). When infected at 5 MOI 80% of the cells were

positive for EGFP expression 48 hours following viral incubation.





X b


















Figure 3-2. Lentiviral vector efficiently transduces quiescent cells relevant to the
cardiovascular system in vitro. A) Growth-arrested A-10 vascular smooth
muscle cells transduced with lacZ encoding vector. B) Growth-arrested
pulmonary artery endothelial cells transduced with lacZ encoding vector and
counterstained with nuclear fast red. C) Growth-arrested HepG2 cells
transduced with EGFP vector. D) Primary cultures of hypothalamus /
brainstem neurons transduced with EGFP vector.










Primary cultures of neurons from the hypothalamus and brainstem regions were

also transduced with TYF.hEF1.EGFP viral vector. At 10 days post-infection -20% of

the neurons were positive for EGFP expression when transduced at 10 MOI. A second

DsRED expressing vector was used in the neurons to illustrate the ability of the lentivirus

to infect the same cell multiple times thus transferring genes encoding for EGFP and

DsRED (Figure 3-3). In all instances control treated cells were incubated with an

equivalent amount of viral re-suspension buffer and examined for background activity.












Figure 3-3. Separate lentiviral vectors are able to transduce the same cell in succession.
Primary neuron cultures were transduced at 10 MOI with EGFP expressing
vector and 5 MOI with DsRED vector. Ten days following vector exposure
the cells were assayed by direct fluorescence. A) Neuron viewed using a filter
specific for EGFP, B) A composite picture of the same neuron merging the
green and red fluorescent images, and C) Neuron viewed using a filter for the
DsRED fluorescence. Bar = 50[tm

In Vivo Efficacy

For the in vivo studies all vectors were prepared using the methods detailed in

Chapter 2 and only the PLAP expressing construct (TYF.hEF .PLAP) was utilized. The

objective of this second set of experiments was to determine three key points regarding

the in vivo performance of the vector: (i) The dose of vector needed to transduce a wide

variety of CV tissues; (ii) The duration of transgene expression; and (iii) Elucidate what

relevant tissues are targets of systemically delivered vector. In all cases the vector was









delivered into the systemic circulation of neonatal rats through direct injection into the

left ventricular space.

Dose-response

Equal volumes of three doses (2.5 X 108, 5 X 107, and 2.5 X 107 total infectious

particles) were injected into 5-day-old rat pups in replicates of four along with virus re-

suspension buffer (a-CSF) injected controls. Animal were sacrificed and assayed for

PLAP expression in the heart, liver, and lung at 3 (n=l per group), 30 (n=2), and 60 (n=l)

days post-delivery. At all time points and in every tissue the highest dose of lentivector

resulted in the greatest degree of PLAP histochemical staining (Figure 3-4). No obvious

adverse affects on the general health of the animals was noted. Based on these findings

all in vivo work from here onward was conducted using the maximum dose of 2.5 X 108

particles.


Figure 3-4. Increasing doses of lentiviral vector results in higher transduction efficiency
in vivo. Neonatal Sprague-Dawley rats were injected with control (A) saline,
2.5 X 107 (B), 5 X 107 (C), or 2.5 X 108 (D) total infectious particles of PLAP
encoding lentiviral vector. The ventricles of the heart were grossly dissected
30 days post-delivery of vector and stained for PLAP activity (n=2 per group
for time point shown). Images were acquired at low magnification through a
dissecting microscope.









Transgene expression duration

Six neonatal rats were transduced with 2.5 X 108 particles of PLAP expressing

lentivector along with an equal number of control injected (a-CSF) animals. Animals

were sacrificed at 3 (n=l per group), 30 (n=3), and 120 (n=2) days following the delivery

of the vector. Heart, lung, liver, and kidney samples were collected and assayed for

PLAP expression using histochemical staining. At all time points and in all three tissues

PLAP expression was detected in the vector injected animals and could not be identified

in their respective controls. The results for the kidney are illustrated (Figure 3-5).

Expression levels at three days post-delivery were lower than all other time points.

Among the other time points no significant difference in expression was noted.

Biodistribution of vector

The final set of experiments utilized a PLAP encoding vector. A total of 2.5 X 108

infectious particles were administered into the circulation of 5-day-old rat pups. A total

of eight animals were injected, 4 experimental and 4 receiving a control injection (a-

CSF). At 30 and 120 days post-delivery, 2 animals from each group were sacrificed and

several organs were removed to undergo PLAP staining. At both time points in the virus

injected animals only PLAP staining was seen in every tissue collected including heart,

liver, lung, brain, aorta, kidney, adrenal gland, and spleen (Figure 3-6). Liver was the

highest transduced tissue (-60%) followed by the heart (-30%). Within the heart 90-

95% of the positive cells were identified morphologically as cardiomyocytes (Figure 3-

7). In the 30 day old animal occasional single positive cells were found in the testes,

however, in the 120 day old animal it was evident that some of the transduced cells in the

tubule of the testes were indeed germ cells (Figure 3-8). No background staining was

seen in any tissue of the control treated rats.











































Figure 3-5. Lentiviral vector expresses transgene for at least 120 days in vivo. Neonatal
rats were injected with 2.5 X 108 total infectious particles of PLAP encoding
lentiviral vector. Kidneys were removed and stained for PLAP activity at
either 3, 30, or 120 days following viral delivery. Panel A illustrates a control
animal of the same age. Images were acquired at low magnification through a
dissection microscope.

Discussion

Knowledge regarding the use of lentivirus-derived vectors in the cardiovascular

system is largely lacking. We report here several studies highlighting the use of

lentivector for gene transfer into cardiovascularly relevant cells in vitro and in vivo.









Lentivector was able to efficiently (from 1-10 MOI) transduce non-dividing endothelial,

vascular smooth muscle, neuronal, and liver-derived cells in vitro (Figure 3-2). Gene

expression occurred rapidly (within 48 hours) and lasted for at least 10 days in the case of

the primary neuron cultures. These in vitro studies re-iterated the utility of the lentivector

system, but in some novel cell types not previously transduced with lentivector.






B




















Figure 3-6. Systemically delivered lentiviral vector transduces multiple tissues relevant
to the cardiovascular system. A total of 2.5 X 108 infectious particles were
delivered to neonatal rats and tissues were collected and stained for PLAP
activity (n=4 for each treatment group). In each lettered panel tissue from
control animals is shown on the left: A) Heart, B) Adrenal Gland, C) Lung,
D) Liver, and E) Kidney. Pictures were acquired at low magnification
through a dissection microscope.

The second set of experiments focused on the in vivo efficacy of the vector system.

When delivered into the circulation of 5-day-old rat pups it was shown that the higher the









dose of virus given the greater the amount of transduction (Figure 3-4). This finding

seems intuitive, but many times gene transfer efficiency is shown to reach a plateau at a

point where additional vector doesn't necessarily result in increased transduction. I think

in our case this plateau is much higher than under "normal" circumstances due to the fact

that our vector is injected and then disseminated throughout the entire blood stream of the

animal. We are delivering the maximum dose currently possible. In the future, if higher

titers can be obtained, I believe that systemically administered virus will transduce at an

even higher level.

We also examined the length of transgene expression following the similar delivery

of the highest dose of vector. In this study gene expression was found up to 120 days, the

duration of the examination period (Figure 3-5). In another study not detailed here

expression was documented at 200 days post-delivery. Such results are not surprising

due to the well documented long-term nature of lentivirus-mediated transgene expression

(Barker and Planelles 2003). It could be expected that virus administered to a five-day-

old animal will continue to robustly express transgene for the life of that animal.

Lastly, and most importantly, we examined the biodistribution of systemically

administered lentivector. To our surprise, lentivector-mediated transgene expression was

found in varying extents in every tissue examined (Figure 3-6). The heart and liver were

particularly well transduced at approximately 60 and 30% respectively. Additionally, in

the heart upwards of 95% of the positive cells expressed cardiomyocyte morphology

(Figure 3-7). These results illustrate the overwhelming potential of the lentivector to

transduce a wide array of tissue and cell types in vivo. It also illustrates a potential

problem. When vector is administered this way it may be important to limit transgene









expression through the use of cell specific promoter elements. In this way it becomes

non-consequential if a cardiomyocyte promoter is used in the vector, but its major target

happens to be hepatocytes.












Figure 3-7. Lentivector effectively transduces cardiomyocytes in vivo. PLAP encoding
vector was delivered into neonatal rats and ten micrometer thin sections were
stained for PLAP activity. A) and B) Left ventricle sections with DAPI co-
staining as a nuclear marker (Bar = 25tm). C) Left atria section (Bar =
100tm).

Surprisingly, our studies also showed that the systemically delivered lentiviral

vector transduced germ cells in the male rat (Figure 3-8). To our knowledge, this is the

first example of viral vector-mediated germ cell transduction in which transgene

expression was detected using histochemical methods rather than PCR-based detection

methods. Expression of PLAP was seen within the testicular tubule spermatogonia and

included PLAP-positive spermatocyte, spermatid, and mature spermatozoa.

Our observation of transduced germ cells in male rats, while intriguing, must be

interpreted with caution with regard to its potential impact on the use of lentiviral vectors

for gene therapy. We believe that the transduction we observed could be attributed to the

poorly developed blood-testicular barrier that is present in 5-day-old rats. It is our

hypothesis that injections of lentivirus after this barrier has matured will not result in

transduction of germ cells. It would be interesting to determine if our hypothesis is

correct by conducting these experiments in adult animals.









The results detailed here shed some light onto the use of the lentivector in the

cardiovascular system. Vector dose along with duration of expression and biodistribution

were examined. These parameters set the stage for the future use of a cardiovascularly

relevant therapeutic gene in the lentivector.


I C- cl


Figure 3-8. Systemically administered lentiviral vector is capable of transducing germ
cells. Lentivector encoding PLAP was delivered into the circulation of
neonatal rats. The testes were removed at various times and stained in toto for
PLAP expression. Frozen thin sections were then prepared and analyzed.
Samples are as follows: A) Control injected animal at 30 days post-injection,
B) Three examples of different cell types within the testes in a vector injected
animal at 30 days post-injection, C) Germ cell transduction in a 120 day old
animal. Note the purple staining mature sperm cells in the lumen of the
tubule.














CHAPTER 4
ANGIOTENSIN II TYPE 2 RECEPTOR GENE TRANSFER ATTENUATES THE
DEVELOPMENT OF CARDIAC HYPERTROPHY IN THE SPONTANEOUSLY
HYPERTENSIVE RAT.

Introduction

The role of Ang II actions at cardiac AT1Rs is well characterized during both

physiological and pathophysiological conditions. Under pathological concentrations of

Ang II the cardiac AT1R s increase left ventricular hypertrophy, interstitial fibrosis,

collagen deposition, and up-regulate extracellular matrix gene expression (Wagenaar et

al, 2002).

If AT1R sites are pharmacologically blocked during pathophysiological exposure of

the heart to Ang II these effects of the ATiR are avoided. Interestingly if AT2R sites are

blocked the effects via the ATiR are enhanced. For this reason, among others, many

investigators propose that during Ang II mediated cardiac disease the AT2Rs are up-

regulated in an attempt to suppress the actions of the over-stimulated ATiRs.

However, the role of the AT2R in the heart is still poorly misunderstood if not

controversial. As an example, one can simply investigate the currently available

transgenic mouse models.

One mouse line was engineered to be completely devoid of AT2R expression in

every tissue of the body (AT2R -/-). The AT2R -/- mice were shown to have increased

sensitivity to Ang II infusion exhibiting higher blood pressures (BP) and lower sodium

secretion rates compared to wild-type littermates (Siragy et al, 1999). Lower levels of

bradykinin and cGMP were also indicated. Abdominal aortic banding resulted in similar









increases in BP between strains, but the AT2R -/- animals exhibited increased coronary

artery wall thickening and increased perivascular fibrosis (Akishita et al, 2000).

However, in this study no effect on cardiac hypertrophy was noted between the two

strains.

Using the same strain, another group showed that chronic Ang II infusion was

unable to induce cardiac hypertrophy only in the AT2R -/- animals while normal

littermates did indeed develop hypertrophy (Ichihara et al, 2001). Together, these studies

suggest two very differing roles for the AT2R with regards to cardiac hypertrophy. On

one side of the coin, the AT2R appears to be essential for induction of hypertrophy while

the other side suggests no role at all for the AT2R in hypertrophy.

A second transgenic mouse exists over-expressing the AT2R only in

cardiomyocytes (Masaki et al, 1998). Upon chronic Ang II infusion in these mice a

number of effects were noted both systemically and on the heart including increased BP,

increased bradykinin and nitric oxide levels, decreased MAPK activity, and no effect on

apoptosis in relation to control animals. Additionally, Ang II caused increased cardiac

hypertrophy and atrial natriuretic peptide expression, a well accepted marker gene for

hypertrophy. In contrast to the findings in the AT2R -/- mice, a decreased perivascular

fibrosis was noted in the cardiomyocyte-specific AT2R over-expressing mice (Kurisu et

al, 2003). The findings with these mice support the hypothesis that the AT2R is involved

in stimulating hypertrophy.

Transgenic mouse models are extremely useful, but they suffer from the major

complication of possible developmental effects due to the deletion or over-expression of

the gene of interest. In the case of the AT2R, it has already been implicated in the









development of the CV system due to its high levels of expression during fetal life and

concomitant decrease following parturition. It is possible that alterations in AT2R

expression levels or patterns through transgenesis could result in the improper

development of the CV system. This fact did not escape the authors of the transgenic

studies because they reported no observed super-structural CV abnormalities between

transgenic and control mice. However, it cannot be ruled out that certain unforeseen

molecular problems exist in the transgenic animals. These molecular abnormalities could

manifest themselves as the changes reported in the studies highlighted above. To avoid

developmental affects associated with AT2R gene perturbation it is necessary to allow

cardiovascular development to proceed as normal in the presence of unaltered levels of

AT2R expression. To achieve this a conditional transgenic animal must be created that

will delete or over-express the AT2R on demand and after fetal development, or the AT2R

gene could be regulated up or down through the use of gene transfer in neonatal or adult

animals.

The goal of this study was to elucidate the role of the AT2R on cardiac

hypertrophy in the SHR following normal fetal development of the CV system. Such an

approach will help determine the true role of the AT2R in hypertrophy.

Lentiviral vector expressing the AT2R gene was created and characterized in vitro.

Delivery of this vector into the systemic circulation of 5-day-old SHR prevented the

development of cardiac hypertrophy versus control injected animals. Blood pressures of

treated and control animals remained elevated and equivalent. These findings support a

role for the AT2R in the attenuation of cardiac hypertrophy irrespective of blood pressure

changes.









Results

Lentiviral Vector Design and In Vitro Assay

Bicistronic lentivector TYF constructs were created expressing both the rat AT2R

and either PLAP, Neo, or EGFP (Figure 4-1) from the hEF 1 promoter. All constructs

were shown to express both the individual genes in vitro (data not shown). AT2R -

specific binding was assayed in stably transduced Chinese hamster ovary (CHO) cells.

Using the TYF.hEF .AT2R.IRES.Neo virus, CHO cells were infected at 1MOI and

selected with G418 (1,000ug/mL) for 14 days. After selection, binding was conducted

using radiolabelled Ang II (Sar-Ile-125I-Ang II) and selective AT1R (1 tM Losartan) and

AT2R (1[tM PD123,319) antagonists (Figure 4-2). Scatchard analysis revealed a Kd of

0.82 nM (Figure 4-2). Specific activity equal to 4.85 pmol/mg of protein indicated robust

expression of the AT2R transgene (Figure 4-2). Although not shown here, microarray

experiments conducted by Beverly Metcalfe in Mohan Raizada's laboratory indicate that

over-expression of the AT2R using the identical lentivector was able to induce elevated

expression of both caspase-3 and PP2A without ligand. These two proteins are known

downstream targets of the AT2R signal transduction cascade. Together these experiments

illustrate that the TYF-hEF 1.AT2R.IRES.Neo lentivector can successfully transfer both

the AT2R and Neo genes in vitro and the AT2R protein produced in transduced cells

exhibits specific cell surface binding and appears to couple to its respective intracellular

signaling cascade.









ALTR

II FTA Ag RRE F IIM AT2R
l ALTR

AT2R NEO

AT2R EGFP

Figure 4-1. Lentiviral vector constructs encoding the AT2R.

In Vivo Delivery of TYF.hEF1.AT2R.IRES.Neo

Large-scale preparations of TYF.hEF 1.AT2R.IRES.Neo lentivector were prepared

and 1.5 X 108 total particles were delivered into the left ventricular space of 5-day-old

male SHR (n=5). Control animals received an injection of virus resuspension buffer (a-

CSF, n=6). At 11 weeks of age control echocardiography was performed on each animal.

The initial measurement of left ventricular (LV) wall thickness indicated neither group of

animals were hypertrophic (p=0.57, Figure 4-3). Additional echocardiograms were

measured 5 weeks later (at 16 weeks of age) and revealed a LV wall thickness of

0.155cm +/- 0.003cm for treated and 0.178mm +/- 0.006cm for control animals (p<0.01,

Figure 4-3). A third set of echos were measured at 20 weeks of age and indicated a LV

wall thickness of 0.158cm +/- 0.003cm in the treated animals and 0.186mm +/- 0.019cm

in control animals (p=0.24, Figure 4-3). When the findings are compared using repeated

measures the p value is just short of significance (p=0.06, Figure 4-3). The individual,

and overall, change in wall thickness was also compared. From the echos measure at 11

weeks to those measured at 16 weeks of age the treated animal's wall thickness increased

by 0.15cm +/- 0.003cm and the control animal's increased by over double that number at

0.38cm +/- 0.06cm (p<0.05, Figure 4-4). From 16 to 20 weeks the treated animals

showed a 0.05cm +/- 0.05cm increase while the control animals increased by 0.43cm +/-









0.17cm (p=0.05, Figure 4-4). When compared using repeated measures the p value

obtained significance (p<0.01, Figure 4-4). After the echocardiograms were performed

at 16 and 20 weeks the animals were allowed to recover and indirect systolic blood

pressures were measured. At 16 weeks the virus treated animals had a blood pressure of

186 +/- 7 mmHg while the control animals had a pressure of 184 +/- 5 mmHg (p=0.84,

Figure 4-5). At 20 weeks the treated animals had a pressure of 180 +/- 5 mmHg while

the control animals had pressures of 188 +/- 7 mmHg (p=0.51, Figure 4-5).



5 0.01, B = 4.85 pmol ng

4- 0.000-
S0.008
2-1
0.004



1 0.002
SKd = 0.82 nM
00
I 1 0
0 2000 4000 0 2 4 6
Fr ee 12 I- S ar- Ile-An gI I Boun d
(pmol/L) (pmol/mg)


Figure 4-2. Binding characteristics of the AT2R expressed from the lentiviral vector in
CHO cells. CHO cells were transduced at 1MOI with a lentiviral vector
expressing the AT2R and NEO genes. After drug selection, whole cell
binding was performed with 125I-Sar-Ile-AnglI.

Discussion

The role of the cardiac AT2R under pathologic loads of Ang II is poorly

understood. For example, through the use of transgenic animals researchers have

reported conflicting results with regards to the importance of the AT2R in the

development of cardiac hypertrophy and perivascular fibrosis. The AT2R plays a








demonstrated role in development therefore such transgenic models may be inherently

flawed through the simple up or down regulation of this receptor during the

developmental period.


0.25 p = 0.06

0 p=0.57 p<0.01 p=0.24
E 0.2 7


C 0.15 n 4
Sn=4 4

0.1


S0.05


0
-11 Weeks- -16 Weeks- -20 Weeks-

Figure 4-3. AT2R gene transfer results in decreased cardiac hypertrophy in the SHR.
Lentivector encoding AT2R was transferred into neonatal SHR. At 11, 16,
and 20 weeks of age echocardiography was performed. Illustrated is the left
ventricular free wall thickness for control (blue) and vector treated (yellow)
animals. P values are indicated above each respective set of bars. The
repeated measures p value is indicated on top of the figure.

To avoid any unnecessary alterations in development we created a lentiviral vector

expressing the AT2R and delivered it into the circulation of neonatal SH rats. Through

the use of such an approach we were able to demonstrate a clear inhibitory effect of

AT2R over-expression on cardiac hypertrophy. These results were demonstrated in the

SHR, a hypertensive model known to express an overly active RAS, but were seen in the








absence of any alteration in blood pressure. Therefore, the AT2R gene appears to be
altering only the cardiac tissue-based RAS. This is not surprising based on the rather
impressive cardiac transduction observed when delivering the lentivector as we did in this
study into the left ventricular cavity (see Chapter 3).


E 0.7
U

u 0.6









-j
"0.5
u


0.4


S 0.3


c 0.2
* 0
au
'0.1

00


-r


p Sp < 0.05-


.U I
~p = 0.05


-11 to 16 Weeks- -16 to 20 Weeks -


Figure 4-4. AT2R gene transfer significantly decreases the increase in left ventricular
wall thickness for up to 9 weeks. Lentivector encoding AT2R was delivered
into neonatal SHR. At 11, 16, and 20 weeks of age echocardiography was
performed on the animals. The changes reflected here relate to the measured
increase in left ventricular wall thickness when compared to the previous
echocardiogram. The results from the control animals are in blue while the
vector treated animals are in yellow. P values are indicated for each set of
experiments and a repeated measures p value is shown at the top of the figure.









The basic finding revealed in this study, the AT2R is a negative regulator of

cardiac hypertrophy in the SHR, is the first genetically-based demonstration of this in an

animal with "normal" CV development. The term "normal" CV development is used

because it is not entirely clear that the SHR model itself undergoes what could be

considered normal fetal development. We know that the SHR is a polygenetic model of

hypertension therefore it is plausible that it may express certain genes that could make it

more amenable to cardiac directed therapy with the AT2R gene. To investigate this,

future experiments should be conducted using a myriad of high Ang II models of

hypertension (i.e. chronic Ang II infusion, Ren2 transgenic rat, etc...)

The true cardiac specific effects of these findings could also be called into

question. As shown in Chapter 3, lentivector encoding a hEFl.PLAP transgene delivered

in exactly the same manner as in this experiment transduces many more tissues other than

the heart. The similar blood pressures that were observed between treated and control

animals suggests a truly cardiac specific effect for the AT2R transgene, but it does not

rule out peripheral effects from any of the other transduced tissues and cell types. To

alleviate this problem, future experiments should use a lentivector encoding

cardiomyocyte-specific promoter elements (i.e. alpha myosin heavy chain) driving

expression of the AT2R. In this manner, although other cell types will be transduced they

will not express transgene and the direct effect of the AT2R over-expression on the

myocyte can be investigated.

Another area that could be improved is the age of the animal at the time of

lentivector delivery. Although the cardiomyocyte is characteristically a quiescent cell

type at all ages this vector system was really developed to be used in the adult animal.









Recently two independent research groups delivered lentivector into adult mice hearts in

vivo and demonstrated efficient gene transfer using approximately the same number of

infectious particles as our experiments in neonatal rats (Fleury et al, 2003). I feel it

would be of great interest to deliver AT2R expressing vector to adult rats just before or

during the development of hypertrophy. This could more closely mimic the clinical

situation where hypertensive patients already expressing LV hypertrophy may benefit

from enhanced AT2R expression or stimulation. More knowledge may also be gained by

delivering vector after hypertrophy, but before complete failure of the heart. It is an

important step to successfully block the development of hypertrophy, but actual reversal

of the disease process should remain the ultimate goal.

250

p = 0.84 -i ,p= 0.51
B 200


150
i-

UL


0
FU 50


0 -16 Weeks- -20 Weeks-


Figure 4-5. AT2R gene transfer has no effect on systolic blood pressure in the SHR.
Lentivector encoding the AT2R was delivered into the systemic circulation of
neonatal SHR. Indirect blood pressures were taken at the indicated times.
Blue bars represent control treated animals while the yellow bars reflect the
vector injected rats. P values are indicated above each set.









Our results illustrate another potential benefit of AT2R stimulation in patients

taking AT1R blockers (ARBs). Patients on ARBs are known to have elevated circulating

levels of Ang II. The endogenous AT2Rs on cardiomyocytes, while extremely low in

expression level, are nonetheless viable targets for this Ang II. Certainly ARBs slow the

progression of cardiac hypertrophy, but much of this effect is presumably through their

potent BP lowering abilities. The findings in this study occur separately from any

changes in blood pressure. It may be interesting to inhibit or partially inhibit the AT1Rs

and see if the anti-hypertrophic effects of the AT2R gene transfer are augmented.

In summary, our findings suggest a role for the AT2R in the prevention of cardiac

hypertrophy in the SHR. These findings are novel in that they were investigated in the

rat after normal CV development. Although a relatively small and preliminary study the

findings set the stage for future use of both the AT2R gene and the lentivector in general

in the heart.














CHAPTER 5
CONCLUSIONS AND DIRECTIONS

Chapter 2 and 3 illustrate the improvements made in the lentivector system and the

resultant efficiency in CV-relevant tissues and cell types. When these studies were began

very little was known about the in vivo performance of this vector system in tissues other

than the brain. Even today, only two studies have been published detailing in vitro

performance of the vector in cardiomyocytes and only three studies of its in vivo

performance in the heart. Therefore, there is still much more to be learned about

lentivector performance in the cardiovascular system. Our novel production and

concentration schema represent a major advancement in the field. Our final titers are

anywhere from 10-100 times greater than those currently reported in the literature using

standard protocols. While a definite improvement, there is still more work to be done

regarding the production and purity of the lentivector. Finally, Chapter 4 presents a

preliminary study into the consequences of AT2R over-expression in the heart of SH rats.

As discussed, there is a lot of debate regarding the consequences of AT2R gene activation

in the cardiomyocyte. The work presented here seems to suggest that in the SHR the

AT2R may play a role in dampening the hypertrophic response of the cardiac muscle.

Future evaluation of these findings in the SHR and other models of hypertension are

necessary.









Lentivector Production and Performance

Further improvements in the technology of lentivector production can help keep

this virus at the forefront of gene therapy vectors. Our final titers of 1 X 1010 TU/ml are

high, but every small improvement in the production of this vector is a big help.

One avenue that should still be investigated is the creation of inducible packaging

cell lines. Some systems have been created, however, they yield lower titers and require

the laborious creation of new cell lines with every improvement in vector design (like the

discovery of the cPPT/CTS DNA flap benefits). It is quite clear that the creation of a

robust packaging cell line would greatly increase the "user friendliness" of the vector and

therefore increase its usage. The use of alternative envelope proteins instead of the

VSV-G will aid in the packaging cell line establishment. One group recently used the

baculovirus GP64 protein in a packaging cell line with promising results (Kumar et al,

2003).

Cell free lentiviral vector production may one day become a reality. Recently a

Canadian group was able to produce infectious encephalomyocarditis virus using cellular

extract in a test tube (Sirven et al, 2000). This would certainly be the safest way to

engineer lentivector and should be quite easily scaled up. All necessary proteins could be

produced and then mixed with human cell membranes and vector genome. Lentivector

could then be directly purified thereby significantly decreasing production time. Such

protocols are possibly many years away, but I think it represents a major direction where

viral vector production should be heading.

The overall purity of the lentiviral vector preparation should also be considered.

With "cleaner" vector preps it may be possible that the overall infectivity of the vector

could increase. This was demonstrated recently by a group who used anion exchange









HPLC to purify lentivector and observed a 2-fold increase in transduction (Yamada et al,

2003). Column purification of the lentivector should be explored further. Simple size

exclusion or ligand columns may be alternative methods.

Magnetic purification of the vector should also be explored. In 2001 a group from

the United Kingdom prepared classical retroviral vector labeled with biotin and later

purified this vector using streptavidin coupled magnetic beads (Hughes et al, 2001). The

overall purity of the vector preparation wasn't directly assayed, but the procedure

improved their titers over 10-fold. Such a technique could easily be employed to

lentivector production and the benefits may be increased infectivity and purity.

Lastly, work in the field of directed integration has advanced greatly recently. One

group used a bacteriophage derived integrase to insert plasmid DNA into specific sites in

the mouse genome (Olivares et al, 2001). In the human there are limited number of

integration sites for this phage integrase. If incorporated into the lentivector system it

may be possible to actually direct transgene integration into innocuous sites in the human

genome and therefore relieve the fears of insertional mutagenesis. Such an advancement

would represent the single most major accomplishment in the retroviral field in the past

decade.

The AT2R and Other Targets of the RAS

The AT2R results, while interesting, are still preliminary due to the relatively small

sample size. I think the next thing to be done with the AT2R expressing vector is to

repeat the experiment in SH rats to increase sample size and also to use Sprague-Dawley

(SD) rats in a separate experiment. The SD rats have the added advantage of being much

"cleaner" with regards to their genetics. Hypertrophy would have to be induced in the

SD animals with chronic Ang II infusion.









Next, I would develop surgical methods to deliver the lentivector into the hearts of

adult rats. As discussed earlier, one group has already achieved great success using the

lentivector in the hearts of adult mice with transduction efficiencies approaching 80%

(Bonci et al, 2003). Such methods will allow us to use the vector in adult animals as was

intended at the inception of our experiments. This situation also more closely mimics

what would take place in human therapy using the AT2R. Additionally, we can begin to

more fully dissect the AT2Rs role in hypertrophy by delivering the vector directly into the

heart of animals at different stages of hypertrophic growth. Can the AT2R reverse

hypertrophy or can it only play a therapeutic role if present before the process begins?

After these initial experiments, I think future experiments should utilize a

cardiomyocyte specific promoter, like alpha myosin heavy chain, to direct expression of

the AT2R. In this manner it will become much clearer if the therapeutic effects are due to

the genetic manipulation of the myocytes, as we propose, or through some other

mechanism.

Additionally, it would be advantageous to use an inducible promoter system, like

the commonly used tetracycline-based system, to turn on or off the AT2R gene. If this

were achieved we could then transduce the animals at a young age and then induce

expression of the AT2R at different stages of hypertrophy or heart failure as they aged.

The ultimate inducible promoter would respond to the actual disease state we are trying

to prevent. Work is ongoing in our laboratory to synthesize an Ang II inducible promoter

so that when the myocytes are exposed to high levels of Ang II, as is the case during

hypertrophy, they will automatically turn on the therapeutic transgene.






71


Finally, the discovery of new components in the RAS is very exciting. The Mas

receptor, ACE2 enzyme, and renin receptor should be inserted into the lentivector as

quickly as possible so that we may use this unique technology to help elucidate the role

of these newly discovered proteins.














APPENDIX
METHODS

Chapter 2

Lentiviral Vector Constructs: pNHP, phEFl.VSV.G, and the pTYF "family"

The pNHP construct used to produce all vectors utilized in the studies described

here is a modified version of the pHP plasmid (Chang, Urlacher et al. 1999). The pNHP

has additional deletions of all remaining accessory proteins in addition to the deletions

already highlighted in the original pHP plasmid. The pNHP plasmid was a kind gift of

Lung-Ji Chang, University of Florida. The phEF .VSV.G construct was fully detailed

elsewhere (Iwakuma, Cui et al. 1999). This plasmid was another gift of Lung-Ji Chang.

The transducing vector used in our experiments was derived from a previously

described self-inactivating vector (Iwakuma, Cui et al. 1999). The pTY vector was

modified by inserting a cPPT-DNA FLAP element upstream of the multiple cloning site,

an element that has been shown to significantly improve the transduction efficiency of

recombinant lentiviral vectors in vitro and in vivo (Zennou, Petit et al. 2000). The original

pTY vector was detailed elsewhere and was a generous gift of Lung-Ji Chang (Iwakuma,

Cui et al. 1999). A 186-bp fragment containing the cPPT-DNA FLAP sequence was

amplified from the pNHP vector using the polymerase chain reaction and the same core

primers that have been previously described (Sirven, Pflumio et al. 2000). Eag] and Not1

restriction sites were added to the sense and antisense primers, respectively. The resulting

fragment was cloned into the Not1 site of the pTY vector in the sense orientation creating

the pTYF vector. The integrity of this modification was verified by DNA sequencing.









The TYF "family" of vectors were produced on the backbone of this original pTYF

construct (known as pTYF.Linker).

The hEF alpha promoter was amplified from phEFl.VSV.G (Upper primer: 5'

GCGCGGCCGCTTTGGAGCTAAGCCAGCAAT, Lower primer: 5' GCGCTAGCA

TCGATTTCACGACACCTGAAATGG) and cloned into the 5' NotI and 3' Nhe I sites

in the pTYF.Linker. This new construct was denoted as pTYF.hEF .Linker. The

pTYF.hEF .PLAP construct was made through the removal of the PLAP gene from the

pRISAP construct (gift from Susan Semple-Rowland, UF) using 5' Pme I and 3' Kpn I

digestions. This gene was directionally cloned into pTYF.hEF .Linker at the 5' Sma I

and 3' Kpn I sites. The pTYF.hEF 1.EGFP vector was made by using PCR directed

against the EGFP gene (Upper: 5' GCGTTTAAACGATCCACCGGTCGCCACCAT,

Lower: 5'GCGGTACCCGCTTTACTTGTACAGCTCGTC) in the pEGFP-N1 plasmid

(Clontech). The amplified gene was cloned directionally into pTYF-hEF 1.Linker at 5'

Sma I and 3' Kpn I.

The bicistronic IRES constructs were created using a three fragment ligation

approach. pTYF.hEF1.Linker was opened with 5' Nhe I and 3' Kpn I. The IRES, PLAP,

Neo, and EGFP genes were amplified using the primers below:

IRES: Upper 5' GCGTCGACGTTTAAACATCGGAGCTTAAAAC, Lower

5'GCACG CGTCCGCAATCCAA

PLAP: Upper 5' GCACGCGTGTGGCGTCGACAATA, Lower 5'

GCGGTACCGATA TCTGGCCGTCTCCAG

Neo: Upper 5' GCACGCGTGCCACCATGATTGAACAAGA, Lower 5'

GCGGTA CCGATATCCGCTCAGAAGAACTCGTCAA









EGFP: Upper 5' GCACGCGTGATCCACCGGTCGCCACCAT, Lower 5' GCGG

TACCGATATCCGCTTTACTTGTACAGCTCGTC

All the fragments were individually purified and ligated at 1:1:1 molar ratios to

create pTYF.hEF1.IRES.PLAP, pTYF.hEF1.IRES.Neo, and pTYF.hEFl.IRES.EGFP.

pTYF.hEF1 .IRES.HygEGFP was created by moving the HygEGFP gene from

pHygEGFP (Clontech) with 5' Mlu I and 3' Sma I. This fragment was ligated

directionally into pTYF.hEF 1.IRES.Neo cut open with 5' Mlu I and 3' EcoRV.

DNA Preparation

Plasmid DNA was prepared in either one of two methods. One method involved

the use of Mega Plasmid Prep kit from Qiagen while the second method involved a

modified alkaline lysis protocol followed by CsCl-EtBr gradient banding of the DNA

(from Maniatas et. al).

Production of Lentivector: Transfection

293FT cells (Invitrogen Corporation, #R70007) were seeded in 75 cm2 (T-75)

culture flasks at a density of 1 x 107 cells per flask and grown in Dulbecco's modified

Eagle medium (DMEM; Gibco) containing 10% fetal bovine serum and antibiotics (130

U/ml penicillin and 130 [tg/ml streptomycin; growth medium). Prior to cell seeding the

culture flasks were coated with poly-D-lysine in PBS for 1-2 hours at 370C. Culture

flasks were then rinsed 1X with PBS and stored dry overnight at room temperature. The

cultures were maintained at 370C in 5% CO2 throughout the virus production period.

On the following day, or when the cultures reached 90-95% confluency, the

transfection was performed. For one large-scale preparation of virus, 27 T-75 flasks of

293FT cells were transfected as follows: Transfection mixture for all 27 flasks was

prepared by gently mixing 192 |tg pNHP, 95 |tg pTYF and 76 |tg pHEF.VSVG plasmid









DNA and 8.0 ml DMEM in one 50 ml polystyrene tube. After mixing, 756 kl of

Superfect was added to the DNA solution. The contents of the tube were gently mixed

and incubated at room temperature for 10 min.

Next, these transfection complexes were diluted into 140 ml of pre-warmed

growth medium. The cultures that were seeded -24 hours ago were then removed from

the incubator, their medium was aspirated, and then replaced with 5 mls of growth

medium containing the transfection complexes. The flasks were then incubated for 4-8

hours in a 370C/5% CO2 incubator.

Following the incubation period, the medium containing the transfection mixture

was replaced with 6.0 ml of fresh growth medium. The next day, the media containing

the first batch of virus was harvested from each flask and 5.0 ml of fresh growth medium

was added to the cells. This should result in two collections of vector, one at -30 hours

post-transfection and a second at -45 hours.

To prepare transfection mixture sufficient for one T-75 flask, the amounts of

DNA, DMEM and Superfect were each divided by 27 to scale the reaction down. We

have also found that viral vector can be produced in larger or smaller cell culture flasks or

plates by simply scaling cell numbers and the amount of DNA, DMEM and Superfect

linearly with respect to the cell growth area.

Production of Lentivector: Concentration

The two collections of vector are handled independently. Each collection of

vector is performed in 50 ml polystyrene tubes on ice. Each tube is then centrifuged at

2000 x g for 10 minutes then filtered through a 0.45 micron low protein binding

membrane (Nalgene, PES). Concentration steps are outlined in Figure 2-4.









For ultrafiltration, the virus stock collected from 27 T-75 flasks at 30 h post-

transfection (-120 ml) was divided into two 60 ml aliquots and centrifuged through

Centricon-80 ultrafiltration columns (Millipore) for 1 h in 40C at 2500 x g. The retentate

was retrieved by centrifuging the inverted column for 1 min in 40C at 990 x g and was

stored at 40C until further processing. On the following day, the virus-containing

retentate was added to the -120 ml of virus-containing media collected at 45 h post-

transfection. Four 30 ml conical-bottom tubes (polyallomer Konical tubes; Beckman),

each containing a 220 [tl cushion of 60% iodixanol solution (used directly from the

Optiprep stock solution obtained from Axis-Shield) were prepared. Iodixanol was used

because of its demonstrated safety in human clinical trials.

Media containing virus (30 ml) was gently pipetted into each tube, taking care not

to disturb the iodixanol, and the samples were centrifuged at 50,000 x g for 2.5 h at 4C

using a Beckman SW-28 swinging bucket rotor. The media just above the

media/iodixanol interface was carefully removed from each tube and discarded, leaving

-750 [tl of the solution in each tube (220 [tl of iodixanol plus -500 [tl of media). The

residual media containing virus and the iodixanol were mixed gently. The resulting

mixtures were pooled into one 3 ml conical-bottom tube (polyallomer Konical Tubes;

Beckman) and centrifuged at 6100 x g for 22-24 h at 40C using a Beckman SW-50.1

swinging bucket rotor.

The resulting supernatant was removed and discarded and the remaining pellet

was resuspended in 30-50 tl of artificial cerebrospinal fluid by incubating the virus at

4C for 10-14 h. The final viral vector was gently mixed by pipetting, aliquoted and

stored at -800C until use.









Lentivector Titration: PLAP

Infectious titers of the TYF.hEF 1.PLAP virus were determined by

incubating 1.75 x 105 TE671 cells seeded in 12-well plates with limiting dilutions of the

viral stock (1/10, 1/100 and 1/1000) in the presence of 8 tlg/ml polybrene. After an

overnight incubation period, the vector containing medium was removed and fresh

medium was added directly to the cells. After 48 hours, cultures were rinsed 2X with

PBS, fixed in 4% paraformaldehyde for 15 minutes at room temperature, rinsed 3X with

PBS, and heated in PBS at 720C for 60 minutes. The plate was then allowed to cool to

room temperature with the lid removed. BCIP pre-inhibition buffer is then added to the

cells and incubated for 30 minutes at room temperature. The pre-inhibition buffer is

removed and replaced with BCIP reaction buffer. The cells are then incubated in the dark

at room temperature for 1 hour and then moved to 40C overnight. The following

morning, the cells are rinsed with PBS containing 50mM EDTA and finally overlayed

with lml of PBS + 50mM EDTA. Ten random areas from each well are scored for the

total number of PLAP positive (purple) cells when viewed using the 10X objective. Final

titer is determined using the following equation:

(Number of PLAP positive cells / number of areas examined) 152

mL of virus added to the well

The number of transducing units (TU; defined as an infectious particle) was

expressed as TU/ml which is equivalent to the number of PLAP positive cells per ml of

virus.

Delivery of TYF.hEF1.EGFP Vector to Brain Nuclei

Male Wistar rats were anesthetized with a mixture of ketamine (60 mg/kg) and

medetomidine (250 [tg/kg) and placed in a stereotaxic frame. Vector delivered to the









brain was suspended in artificial cerebrospinal fluid. For the paraventricular nucleus

(PVN) injections 275 g rats were used and the head of the animal was flexed 5 mm below

the interaural line. The microinjection pipette was angled ten degrees relative to the

midline to avoid the mid-sagittal sinus. A slow injection of 500 nl (5 X 105 TU) of virus

was performed at the following coordinates: 1.8 mm lateral, 1.8 mm caudal to the bregma

and 7.5 mm below the surface. The caudal nucleus of the solitary tract (NTS) was also

injected bilaterally with 3 injections per side for a total of 300 nl (3 X 105 TU). The site

of injection was within 0 to -500 |tm relative to calamus scriptorius, 350-700 |tm from

midline and 500-600 |tm below the dorsal surface of the medulla. The head of the animal

was flexed 10 mm below the interaural line. The animals were sacrificed either 7 days

(PVN, n = 2) or 30 days (NTS, n = 2) following the injections and fixed by intracardial

perfusion with 4% paraformaldehyde in PBS. Brains were removed, cryoprotected in

30% sucrose, 60 |tm thick brain sections were cut on a cryostat and confocal microscopy

(Leica SP) was used to visualize GFP fluorescence.

Cell Culture

Human embryonic kidney cells (293FT) were obtained from Invitrogen

Corporation (#R70007). Human medulloblastoma cells (TE671) were obtained from the

European Collection of Cell Cultures (#89071904).

Solutions

Artificial cerebrospinal fluid (virus resuspension buffer) was made as described

on http://www.alzet.com with the addition of 0.1% heat-inactivated (560C, 40 minutes)

fetal bovine serum + 1X fungizone and 1X penicillin/streptomycin. D-1MEM (high

glucose) was purchased from Invitrogen. Iodixanol was used as provided from Axis-









Shield (Oslo, Norway). Polybrene (Hexadimethrin bromide) was prepared as a 100X

solution (800tlg/ml) in Hank's balanced salt solution. BCIP pre-inihibiton buffer:

100mM Tris Base, 100mM sodium chloride, 50mM magnesium chloride, 0.5mM

Levamisole, pH 9.5. BCIP reaction buffer: 100mM Tris Base, 100mM sodium chloride,

50mM magnesium chloride, 0.5mM Levamisole, Img/ml nitro blue tetrazolium,

0. lmg/ml 5-bromo-4-chloro-3-indolyl-phosphate (also known as X-Phos or BCIP), pH

9.5.

Chapter 3

TYF Constructs

Additional TYF constructs used included pTYF.hEF 1.DsRED and

pTYF.hEF .nlacZ. The DsRED construct was made by directly inserting the DsRED

gene (Clontech) into pTYF.hEF 1.Linker. The nlacZ construct was made by inserting the

bacterial beta-galactosidase gene into pTYF.hEF 1.Linker. Both constructs were generous

gifts from Susan Semple-Rowland's laboratory, UF.

Growth Arrest and Transduction

All cell types (A. 10, A7r5, HepG2, and RPAEC) were grown to confluency and

then growth-arrested with aphidicolin at a concentration of 15[tg/ml. At the same time as

growth-arrest, the cells were overlaid with virus and incubated overnight. The following

morning the vector containing media was removed and replaced with growth medium

containing aphidicolin. The cells were either imaged or stained the next day.

Systemic Delivery of Lentivector to Neonatal Rat

Five-day-old animals were removed from their mothers and lightly anesthetized

with methoxyfluorane. The animals are then placed on a heated surface and the heart

visualized through the translucent chest wall. A standard insulin syringe needle was









inserted into the apex of the heart and angled into the left ventricular cavity. A small

volume of blood was withdrawn into the syringe barrel to indicate the correct positioning

of the needle and the 20-35%tl volume of vector or control was delivered in a slow bolus.

The needle was quickly removed and the animal allowed to recover in a heated location.

Animals were then lightly coated with peanut oil and returned to their respective mothers.

In all cases the investigator delivering the vector or control solution was blinded with

respect to the composition of the sample being injected.

Cell Staining for lacZ

To assay for lacZ expression cells were first rinsed 2X with PBS then fixed in 4%

paraformaldehyde for 10 minutes at room temperature. The fixed cells were then rinsed

3X with PBS and overlaid with lacZ staining buffer: 35mM potassium ferrocyanide,

35mM potassium ferriccyanide, 2mM MgC12, 0.02% Nonidet P-40, 0.01% sodium

deoxycholate, Img/ml X-gal, pH 8.0. Cells were then incubated at 37C until color

developed.

Tissue Histochemistry for PLAP

The entire animal was perfused intracardially with 60mls of ice-cold PBS

followed by 60mls of ice-cold 4% paraformaldehyde in PBS. Organs were then

harvested into 4% paraformaldehyde and post-fixed for two hours on ice. Whole organs

were then rinsed at room temperature in PBS 4 times for 15 minutes each rinse. The

tissue was then heated in PBS at 720C for 2.5 hours. After cooling to room temperature,

the tissues were equilibrated in BCIP pre-inhibition buffer for one hour. The pre-

inhibition buffer was then replaced with BCIP reaction buffer and the tissues were

stained for one hour at room temperature. After this time they were moved to 40C to

develop a deep purple color overnight. In the morning the organs were rinsed 2X with









PBS + 50mM EDTA and stored in the same solution prior to cryoprotection and

sectioning or direct microscopic analysis.

Cell Culture

All cell lines were acquired from American Tissue Culture Collection (ATCC) as

follows: A-10 (CRL-1476), A7r5 (CRL-1444), HepG2 (HB-8065). Cells were cultured

according to instructions provided by the supplier.

Chapter 4

AT2R Lentivector Construction

AT2R coding region was generously provided by Jeffrey Harrison, UF. To create

all three pTYF.hEF 1.AT2R.IRES vectors the AT2R gene was excised from pLNSV-AT2R

with 5' Avr II and 3' Cla I and ligated into the pTYF.hEF 1.IRES constructs cut open with

5' Nhe I and 3' Cla I.

Lentivector Titration: G418 Resistance

TE671 cells were split into 12-well plates at a density of 175,000 cells per well.

After 24 hours they were transduced with 0.0001 tl of vector in the presence of 8[tg/ml

polybrene in a total volume of 500[tl in duplicate. Cells were then returned to the

incubator for 24 hours after which time each well was rinsed with lml of trypsin solution

and then overlaid with 500[tl of trypsin solution. After a 5 minute incubation at 370C to

ensure complete dissociation of the cells from the bottom of each well, 500[tl of growth

medium (D-MEM + 10% FBS) was added to each well. The contents of each well were

pipetted up and down to assure total de-aggregation of the typsinized cells. Twenty

microliters (a 1:50 dilution) of each cell suspension was then transferred to a well in a 6-

well plate containing 2mls of growth medium in duplicate. This results in 4 total wells









used per 6-well plate: 2 wells containing duplicate dilutions of each originally transduced

well of the 12-well plate. Control (non-transduced) cells were handled in the same

manner. After another 24 hour period (now 48 hours from exposure to virus) the cells

were incubated in growth medium containing 400[tg/ml G418. Every 24 hour period the

G418 concentration was increased by 400[tg/ml until a final concentration of 1,200|tg/ml

was achieved. The cells were then incubated in the presence of 1,200[tg/ml of G418 for a

total of 10 more days. Fresh G418 media was added every other day to the cultures. Add

the end of this period the cells were rinsed 2X with room temperature PBS and then

incubated in 0.1% crystal violet in 10% ethanol in water for 20 minutes. After this

incubation, each well was rinsed 2X with 10% ethanol in water to remove an extra

staining solution. The resulting purple staining, G418 resistant colonies were then

counted and the titer of the virus calculated as infectious units (colony forming units) per

ml of viral vector.

125I-Angiotensin II Binding

Cells were grown to -80% confluency in 12-well plates taking at least three days

to reach this level following exposure to trypsin. Cells were removed from the incubator

and rinsed 2X with room temperature PBS. Binding reaction mixtures consisting of 1%

BSA, varied amounts of 125I-Sar-Ile-AngII, and the presence or absence of specific

inhibitors (losartan (1 M), PD123,319 (1[ M), or cold AngII (100nM)) were then

overlaid onto the cells. Binding was allowed to proceed at 37C for 30 minutes. After

this time the cells were washed quickly 4X with ice-cold PBS to remove any unbound

ligand. Cells were then lysed in 0. IN sodium hydroxide by incubating at room









temperature for 1 hour. This lysate was collected, each well was washed with distilled

water, and then counted for total specific 125I decay. Each sample was read in triplicate.

Cardiac Echocardiography

After mild sedation, echo readings were taken using an S12 probe and a clinical

ultrasound machine at a depth of 2cm. The cardiac papillary muscles were used as a

landmark for echocardiogram recording. Wall thickness was measured using an on-

screen electronic micrometer. The investigator performing the echos was Dr. Leonard

Parilak with assistance from David Taylor. In all cases, both investigator and assistant

were blinded as to the animal's identification and treatment group.

Cell Culture

Chinese hamster ovary (CHO) cells were a generous gift from Peter Sayeski, UF.

Solutions

Losartan, PD123,319, and Angiotensin II were made up in sterile PBS at the

indicated concentrations. G418 (Invitrogen) was made up in D-MEM without fetal

bovine serum and sterile filtered before use.

Statistics

Repeated measures ANOVA and ANOVA were used. Outliers were determined

using Grubb's Outlier test at a confidence level of p<0.05. Statistical analyses were

performed using StatView (Version 5.0, SAS Institute Inc.).















LIST OF REFERENCES


Adams, B., Obertone, T. S., Wang, X., & Murphy, T. J. (1999). Relationship between
internalization and mRNA decay in down-regulation of recombinant type 1
angiotensin II receptor (AT1) expression in smooth muscle cells. Mol Pharmacol,
55(6), 1028-36.

Akishita, M., Iwai, M., Wu, L., Zhang, L., Ouchi, Y., Dzau, V. J., & Horiuchi, M. (2000).
Inhibitory effect of angiotensin II type 2 receptor on coronary arterial remodeling
after aortic banding in mice. Circulation, 102(14), 1684-9.

Albiston, A. L., McDowall, S. G., Matsacos, D., Sim, P., Clune, E., Mustafa, T., Lee, J.,
Mendelsohn, F. A., Simpson, R. J., Connolly, L. M., & Chai, S. Y. (2001).
Evidence that the angiotensin IV (AT(4)) receptor is the enzyme insulin- regulated
aminopeptidase. JBiol Chem, 276(52), 48623-6.

Ali, M. S., Sayeski, P. P., Dirksen, L. B., Hayzer, D. J., Marrero, M. B., & Bernstein, K.
E. (1997). Dependence on the motif YIPP for the physical association of Jak2
kinase with the intracellular carboxyl tail of the angiotensin II AT1 receptor. JBiol
Chem, 272(37), 23382-8.

Anchordoquy, T. J., Allison, S. D., Molina, M. C., Girouard, L. G., & Carson, T. K.
(2001). Physical stabilization of DNA-based therapeutics. DrugDiscov Today,
6(9), 463-470.

Bader, M., & Ganten, D. (2000). Regulation of renin: new evidence from cultured cells
and genetically modified mice. JMolMed, 78(3), 130-9.

Balcells, E., Meng, Q. C., Johnson, W. H., Jr., Oparil, S., & Dell'Italia, L. J. (1997).
Angiotensin II formation from ACE and chymase in human and animal hearts:
methods and species considerations. Am JPhysiol, 273(4 Pt 2), H1769-74.

Barker E, Planelles V. (2003). Vectors derived from the human immunodeficiency virus,
HIV-1. Front Biosci, 8, 491-510.

Bartlett, J. S., Kleinschmidt, J., Boucher, R. C., & Samulski, R. J. (1999). Targeted
adeno-associated virus vector transduction of nonpermissive cells mediated by a
bispecific F(ab'gamma)2 antibody. Nat Biotechnol, 17(2), 181-6.









Baumgartner, I., Pieczek, A., Manor, O., Blair, R., Kearney, M., Walsh, K., & Isner, J.
M. (1998). Constitutive expression of phVEGF165 after intramuscular gene
transfer promotes collateral vessel development in patients with critical limb
ischemia. Circulation, 97(12), 1114-23.

Bedecs, K., Elbaz, N., Sutren, M., Masson, M., Susini, C., Strosberg, A. D., & Nahmias,
C. (1997). Angiotensin II type 2 receptors mediate inhibition of mitogen-activated
protein kinase cascade and functional activation of SHP-1 tyrosine phosphatase.
Biochem J, 325(Pt 2), 449-54.

Benter, I. F., Ferrario, C. M., Morris, M., & Diz, D. I. (1995). Antihypertensive actions of
angiotensin-(1-7) in spontaneously hypertensive rats. Am JPhysiol, 269(1 Pt 2),
H313-9.

Bernstein, K. E. (1998). Examining the renin-angiotensin system one hundred years after
its discovery. Nephrologie, 19(7), 391-5.

Bkaily, G., Sleiman, S., Stephan, J., Asselin, C., Choufani, S., Kamal, M., Jacques, D.,
Gobeil, F., Jr., & D'Orleans-Juste, P. (2003). Angiotensin II AT1 receptor
internalization, translocation and de novo synthesis modulate cytosolic and nuclear
calcium in human vascular smooth muscle cells. Can JPhysiol Pharmacol, 81(3),
274-87.

Bonci, D., Cittadini, A., Latronico, M. V., Borello, U., Aycock, J. K., Drusco, A.,
Innocenzi, A., Follenzi, A., Lavitrano, M., Monti, M. G., Ross, J., Jr., Naldini, L.,
Peschle, C., Cossu, G., & Condorelli, G. (2003). 'Advanced' generation lentiviruses
as efficient vectors for cardiomyocyte gene transduction in vitro and in vivo. Gene
Ther, 10(8), 630-6.

Brantl, S. (2002). Antisense-RNA regulation and RNA interference. Biochim Biophys
Acta, 1575(1-3), 15-25.

Brasier, A. R., Jamaluddin, M., Han, Y., Patterson, C., & Runge, M. S. (2000).
Angiotensin II induces gene transcription through cell-type-dependent effects on
the nuclear factor-kappaB (NF-kappaB) transcription factor. Mol Cell Biochem,
212(1-2), 155-69.

Buchschacher, G. L., Jr., & Panganiban, A. T. (1992). Human immunodeficiency virus
vectors for inducible expression of foreign genes. J Virol, 66(5), 2731-9.

Campagnole-Santos, M. J., Heringer, S. B., Batista, E. N., Khosla, M. C., & Santos, R. A.
(1992). Differential baroreceptor reflex modulation by centrally infused angiotensin
peptides. Am JPhysiol, 263(1 Pt 2), R89-94.

Chao, J., Zhang, J. J., Lin, K. F., & Chao, L. (1998). Human kallikrein gene delivery
attenuates hypertension, cardiac hypertrophy, and renal injury in Dahl salt-sensitive
rats. Hum Gene Ther, 9(1), 21-31.









Chu, Y., lida, S., Lund, D. D., Weiss, R. M., DiBona, G. F., Watanabe, Y., Faraci, F. M.,
& Heistad, D. D. (2003). Gene transfer of extracellular superoxide dismutase
reduces arterial pressure in spontaneously hypertensive rats: role of heparin-binding
domain. Circ Res, 92(4), 461-8.

Coleman, J. E., Huentelman, M. J., Kasparov, S., Metcalfe, B. L., Paton, J. F., Katovich,
M. J., Semple-Rowland, S. L., & Raizada, M. K. (2003). Efficient large-scale
production and concentration of HIV-1-based lentiviral vectors for use in vivo.
Physiol Genomics, 12(3), 221-8.

Corvol, P., Lamande, N., Cruz, A., Celerier, J., & Gasc, J. M. (2003). Inhibition of
angiogenesis: a new function for angiotensinogen and des(angiotensin
I)angiotensinogen. Curr Hypertens Rep, 5(2), 149-54.

Crackower, M. A., Sarao, R., Oudit, G. Y., Yagil, C., Kozieradzki, I., Scanga, S. E.,
Oliveira-dos-Santos, A. J., da Costa, J., Zhang, L., Pei, Y., Scholey, J., Ferrario, C.
M., Manoukian, A. S., Chappell, M. C., Backx, P. H., Yagil, Y., & Penninger, J. M.
(2002). Angiotensin-converting enzyme 2 is an essential regulator of heart
function. Nature, 417(6891), 822-8.

Curran, M. A., & Nolan, G. P. (2002). Nonprimate lentiviral vectors. Curr Top Microbiol
Immunol, 261, 75-105.

Cuspidi, C., Muiesan, M. L., Valagussa, L., Salvetti, M., Di Biagio, C., Agabiti-Rosei, E.,
Magnani, B., & Zanchetti, A. (2002). Comparative effects of candesartan and
enalapril on left ventricular hypertrophy in patients with essential hypertension: the
candesartan assessment in the treatment of cardiac hypertrophy (CATCH) study. J
Hypertens, 20(11), 2293-300.

Donoghue, M., Hsieh, F., Baronas, E., Godbout, K., Gosselin, M., Stagliano, N.,
Donovan, M., Woolf, B., Robison, K., Jeyaseelan, R., Breitbart, R. E., & Acton, S.
(2000). A novel angiotensin-converting enzyme-related carboxypeptidase (ACE2)
converts angiotensin I to angiotensin 1-9. Circ Res, 87(5), E1-9.

Dostal, D. E., Rothblum, K. N., Chernin, M. I., Cooper, G. R., & Baker, K. M. (1992).
Intracardiac detection of angiotensinogen and renin: a localized renin- angiotensin
system in neonatal rat heart. Am JPhysiol, 263(4 Pt 1), C838-50.

Duisit, G., Conrath, H., Saleun, S., Folliot, S., Provost, N., Cosset, F. L., Sandrin, V.,
Moullier, P., & Rolling, F. (2002). Five recombinant simian immunodeficiency
virus pseudotypes lead to exclusive transduction of retinal pigmented epithelium in
rat. Mol Ther, 6(4), 446-54.

Eastman, S. J., Baskin, K. M., Hodges, B. L., Chu, Q., Gates, A., Dreusicke, R.,
Anderson, S., & Scheule, R. K. (2002). Development of catheter-based procedures
for transducing the isolated rabbit liver with plasmid DNA. Hum Gene Ther,
13(17), 2065-77.









Emanueli, C., Salis, M. B., Stacca, T., Gaspa, L., Chao, J., Chao, L., Piana, A., &
Madeddu, P. (2001). Rescue of impaired angiogenesis in spontaneously
hypertensive rats by intramuscular human tissue kallikrein gene transfer.
Hypertension, 38(1), 136-41.

Fackler, O. T., & Baur, A. S. (2002). Live and let die: Nef functions beyond HIV
replication. Immunity, 16(4), 493-7.

Feng, Y. H., Sun, Y., & Douglas, J. G. (2002). Gbeta gamma -independent constitutive
association of Galpha s with SHP- 1 and angiotensin II receptor AT2 is essential in
AT2-mediated ITIM- independent activation of SHP-1. Proc Natl Acad Sci US A,
99(19), 12049-54.

Fennell, J. P., Brosnan, M. J., Frater, A. J., Hamilton, C. A., Alexander, M. Y., Nicklin,
S. A., Heistad, D. D., Baker, A. H., & Dominiczak, A. F. (2002). Adenovirus-
mediated overexpression of extracellular superoxide dismutase improves
endothelial dysfunction in a rat model of hypertension. Gene Ther, 9(2), 110-7.

Fleury, S., Simeoni, E., Zuppinger, C., Deglon, N., von Segesser, L. K., Kappenberger,
L., & Vassalli, G. (2003). Multiply attenuated, self-inactivating lentiviral vectors
efficiently deliver and express genes for extended periods of time in adult rat
cardiomyocytes in vivo. Circulation, 107(18), 2375-82.

Gilbert, J. R., & Wong-Staal, F. (2001). HIV-2 and SIV vector systems. Somat CellMol
Genet, 26(1-6), 83-98.

Gomez, R. A., Chevalier, R. L., Carey, R. M., & Peach, M. J. (1990). Molecular biology
of the renal renin-angiotensin system. Kidney Int Suppl, 30, S 18-23.

Guibinga, G. H., Miyanohara, A., Esko, J. D., & Friedmann, T. (2002). Cell surface
heparan sulfate is a receptor for attachment of envelope protein-free retrovirus-like
particles and VSV-G pseudotyped MLV- derived retrovirus vectors to target cells.
Mol Ther, 5(5 Pt 1), 538-46.

Gusella, G. L., Fedorova, E., Marras, D., Klotman, P. E., & Klotman, M. E. (2002). In
vivo gene transfer to kidney by lentiviral vector. Kidney Int Suppl, 61 Suppl 1, 32-
6.

Hackenthal, E., Paul, M., Ganten, D., & Taugner, R. (1990). Morphology, physiology,
and molecular biology of renin secretion. Physiol Rev, 70(4), 1067-116.

Hamra, F. K., Gatlin, J., Chapman, K. M., Grellhesl, D. M., Garcia, J. V., Hammer, R. E.,
& Garbers, D. L. (2002). Production of transgenic rats by lentiviral transduction of
male germ- line stem cells. Proc NatlAcadSci USA, 99(23), 14931-6.









Harding, J. W., Cook, V. I., Miller-Wing, A. V., Hanesworth, J. M., Sardinia, M. F., Hall,
K. L., Stobb, J. W., Swanson, G. N., Coleman, J. K., Wright, J. W., & et al. (1992).
Identification of an AII(3-8) [AIV] binding site in guinea pig hippocampus. Brain
Res, 583(1-2), 340-3.

Hartikka, J., Sukhu, L., Buchner, C., Hazard, D., Bozoukova, V., Margalith, M.,
Nishioka, W. K., Wheeler, C. J., Manthorp, M., & Sawdey, M. (2001).
Electroporation-facilitated delivery of plasmid DNA in skeletal muscle: plasmid
dependence of muscle damage and effect of poloxamer 188. Mol Ther, 4(5), 407-
15.

Herweijer, H., Zhang, G., Subbotin, V. M., Budker, V., Williams, P., & Wolff, J. A.
(2001). Time course of gene expression after plasmid DNA gene transfer to the
liver. J Gene Med, 3(3), 280-91.

Hilbert, P., Lindpaintner, K., Beckmann, J. S., Serikawa, T., Soubrier, F., Dubay, C.,
Cartwright, P., De Gouyon, B., Julier, C., Takahasi, S., & et al. (1991).
Chromosomal mapping of two genetic loci associated with blood-pressure
regulation in hereditary hypertensive rats. Nature, 353(6344), 521-9.

Hogarty, D. C., Speakman, E. A., Puig, V., & Phillips, M. I. (1992). The role of
angiotensin, AT1 and AT2 receptors in the pressor, drinking and vasopressin
responses to central angiotensin. Brain Res, 586(2), 289-94.

Hoggan, M. D. (1970). Adenovirus associated viruses. ProgMed Virol, 12, 211-39.

Huang, L., Sexton, D. J., Skogerson, K., Devlin, M., Smith, R., Sanyal, I., Parry, T.,
Kent, R., Enright, J., Wu, Q. L., Conley, G., DeOliveira, D., Morganelli, L., Ducar,
M., Wescott, C. R., & Ladner, R. C. (2003a). Novel peptide inhibitors of
angiotensin-converting enzyme 2. JBiol Chem, 278(18), 15532-40.

Huang, L., Zhang, L., & Chen, C. H. (2003b). Potential Drug Targets on the HIV-1
Envelope Glycoproteins, gp 120 and gp41. Curr Pharm Des, 9(18), 1453-62.

Hughes, C., Galea-Lauri, J., Farzaneh, F., & Darling, D. (2001). Streptavidin
paramagnetic particles provide a choice of three affinity- based capture and
magnetic concentration strategies for retroviral vectors. Mol Ther, 3(4), 623-30.

Hunyady, L., Catt, K. J., Clark, A. J., & Gaborik, Z. (2000). Mechanisms and functions
of AT(l) angiotensin receptor internalization. Regul Pept, 91(1-3), 29-44.

Ichihara, S., Senbonmatsu, T., Price, E., Jr., Ichiki, T., Gaffney, F. A., & Inagami, T.
(2001). Angiotensin II type 2 receptor is essential for left ventricular hypertrophy
and cardiac fibrosis in chronic angiotensin II-induced hypertension. Circulation,
104(3), 346-51.









lyer, S. N., Lu, D., Katovich, M. J., & Raizada, M. K. (1996). Chronic control of high
blood pressure in the spontaneously hypertensive rat by delivery of angiotensin
type 1 receptor antisense. Proc Natl Acad Sci USA, 93(18), 9960-5.

Kakar, S. S., Sellers, J. C., Devor, D. C., Musgrove, L. C., & Neill, J. D. (1992).
Angiotensin II type-1 receptor subtype cDNAs: differential tissue expression and
hormonal regulation. Biochem Biophys Res Commun, 183(3), 1090-6.

Kambayashi, Y., Bardhan, S., Takahashi, K., Tsuzuki, S., Inui, H., Hamakubo, T., &
Inagami, T. (1993). Molecular cloning of a novel angiotensin II receptor isoform
involved in phosphotyrosine phosphatase inhibition. JBiol Chem, 268(33), 24543-
6.

Kloting, I., Voigt, B., & Kovacs, P. (1998). Metabolic features of newly established
congenic diabetes-prone BB.SHR rat strains. Life Sci, 62(11), 973-9.

Kohara, K., Brosnihan, K. B., Ferrario, C. M., & Milsted, A. (1992). Peripheral and
central angiotensin II regulates expression of genes of the renin-angiotensin system.
Am JPhysiol, 262(5 Pt 1), E651-7.

Krichevsky, A., Graessmann, A., Nissim, A., Piller, S. C., Zakai, N., & Loyter, A.
(2003). Antibody fragments selected by phage display against the nuclear
localization signal of the HIV-1 Vpr protein inhibit nuclear import in permeabilized
and intact cultured cells. Virology, 305(1), 77-92.

Kumar, M., Bradow, B. P., & Zimmerberg, J. (2003). Large-Scale Production of
Pseudotyped Lentiviral Vectors Using Baculovirus GP64. Hum Gene Ther, 14(1),
67-77.

Kumar, M., Keller, B., Makalou, N., & Sutton, R. E. (2001). Systematic determination of
the packaging limit of lentiviral vectors. Hum Gene Ther, 12(15), 1893-905.

Kurisu, S., Ozono, R., Oshima, T., Kambe, M., Ishida, T., Sugino, H., Matsuura, H.,
Chayama, K., Teranishi, Y., Iba, O., Amano, K., & Matsubara, H. (2003). Cardiac
angiotensin II type 2 receptor activates the kinin/NO system and inhibits fibrosis.
Hypertension, 41(1), 99-107.

Lake, J. A., Carr, J., Feng, F., Mundy, L., Burrell, C., & Li, P. (2003) The role of Vif
during HIV-1 infection: interaction with novel host cellular factors. J Clin Virol,
26(2), 143-152.