<%BANNER%>

Moderate murine dietary zinc deficiency and zinc supplementation modulate specific thymic mRNA abundances in Vivo: resul...

University of Florida Institutional Repository

PAGE 1

MODERATE MURINE DIETARY ZINC DEFICIENCY AND ZINC SUPPLEMENTATION MODULATE SPECI FIC THYMIC mRNA ABUNDANCES IN VIVO: RESULTS FROM cDNA AR RAY ANALYSIS AND DIFFERENTIAL DISPLAY SCREENING By J. BERNADETTE MOORE A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORID A IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY UNIVERSITY OF FLORIDA 2002

PAGE 2

Copyright 2002 by J. Bernadette Moore

PAGE 3

This work is dedicated to the strong-wil led, hardworking Irish women who came before me. Not only did they provide me with a tremendous genetic heritage, but they also shaped my intellectual curios ity and determination, ultimately making this accomplishment possible. In honor of my grandmother Claire, and her daughter Moya, my mother.

PAGE 4

iv ACKNOWLEDGMENTS It is a foolish man, he who believes hi s accomplishments to be solely his. For myself, it is more than a pleasure to acknowledge and thank the mentors, colleagues and friends who have inspired, taught and encouraged me toward this achievement. First, I am deeply honor ed to have worked for and with Dr. Robert J. Cousins, who is awe-inspir ing in work ethic, and whose decades of dedication and vision preceded and permitted th is research. In addition, I thank the members of my committee: Drs. Je sse F. Gregory, Bobb i Langkamp-Henken, Rachel B. Shireman and Wayne T. McCo rmack for their si gnificant, generous time contributions and guidance through my graduate education. Within the laboratory, Dr. Raymond K. Blanchard was an endless source of technical information, intellectual enthus iasm and scientific motivation. It is a truism that your workmates become almo st an extended family. I thank all those who supported me with patience and kindne ss, and muscle in the cases of those who moved me more than once, through the past five years. Virginia Mauldin deserves particular mention for her tr emendous compassion and also for her significant editing, computer, and lab (animal) contributions! Drs. Heather B. Bradshaw and Cathy W. Levenson are credited as my initial sources of inspiration and enc ouragement. As accomplished members of the scientific community, they continue to be role models and dear friends. Of course, I would acknowledge and sincerely thank the friends who, in particular,

PAGE 5

v supported me emotionally an d intellectually through the past five years: Elsa Bigelow, Chantal Coulen, Mindy Edward s, Ashley Lentz, Robin (and Mike!) Marshall, Dave Nolan, Janna (and Joe! ) Underhill, Judy Wolfe and dear Rodger Young. Lastly, a special extension of gr atitude goes to the exclusive continuum in my life thus far, my friend of al most twenty years, Jennifer Ady Levine.

PAGE 6

vi TABLE OF CONTENTS page ACKNOWLEDGME NTS.......................................................................................iv LIST OF T ABLES............................................................................................... viii LIST OF FI GURES...............................................................................................ix ABBREVIATIONS.................................................................................................xi ABSTRACT .........................................................................................................xii CHAPTER 1 INTRODUCTION AN D LITERATURE REVIEW..............................................1 Introduc tion .....................................................................................................1 Hypotheses and Resear ch Object ives............................................................4 Literature Review............................................................................................5 2 MURINE ZINC DEFICIENCY USIN G AN OUTBRED STRAIN AND cDNA ARRAY ANALYSIS OF THYMIC GENE EXPR ESSION...............................28 Introducti on...................................................................................................28 Materials and Methods ..................................................................................29 Result s..........................................................................................................36 Discussio n.....................................................................................................42 3 DIFFERENTIAL mRNA DISPLAY OF ZINC-DEFICIEN T, ZINC-NORMAL AND ZINC-SUPPLEMENTED MURINE TH YMUS........................................50 Introducti on...................................................................................................50 Materials and Methods ..................................................................................51 Result s..........................................................................................................61 Discussio n.....................................................................................................72 4 SUMMARY, SPECULATIONS AND FUTURE DIRE CTIONS.......................83

PAGE 7

vii APPENDIX A DIFFERENTIAL DISPLAY TR ANSCRIPTS INCREASED IN ZINC-SUPPLEMENT ED MICE .....................................................................88 Differential Display Ba nds 3,3,1 and 3,3,2....................................................88 Differential Display Bands 3,3,1b, 3,3,2b and 3,3,3 ......................................91 B DIFFERENTIAL DISPLAY TR ANSCRIPTS INCREASED IN ZINC-DEFICIEN T MICE................................................................................93 Differential Display Ba nds 2,17,1 and 2,17,2................................................93 Differential Display Band 3,1, 1......................................................................95 Differential Display Band 7,11, 1....................................................................97 Differential Display Band 10,7, 2G...............................................................100 Differential Display Band 9,7, 1A..................................................................102 C DIFFERENTIAL DISPLAY TRANSCRIPTS DECREASED IN ZINC-DEFICIEN T MICE ..............................................................................105 Differential Display Ba nds 2,4,2 and 2,4,3..................................................105 Differential Display Band 2,14, 1..................................................................108 Differential Display Band 3,1, 4....................................................................110 Differential Display Band 3,2, 4....................................................................113 Differential Display Band 9,6, 1....................................................................116 Differential Display Band 10,7, 2D...............................................................119 D DIFFERENTIAL DISPLAY TRANSCRIPTS DECREASED IN ZINC-SUPPLEMENT ED MICE ...................................................................121 Differential Display Band 2,8, 1....................................................................121 Differential Display Band 3,8, 2C.................................................................123 Differential Display Band 3,7, 1....................................................................125 Differential Display Band 3,7, 2....................................................................128 Differential Display Band 7,6, 2G.................................................................130 Differential Display Band 7,13, 1..................................................................132 Differential Display Band 7,20, 1..................................................................135 LITERATURE CITED .......................................................................................138 BIOGRAPHICAL SKETCH ...............................................................................155

PAGE 8

viii LIST OF TABLES Table page 2-1 Primers used for semi-quantitative and quantitative real-time RT-PCR.....33 2-2 Zinc status indicators for zinc -deficient and zinc -normal mi ce...................37 3-1 Anchored primers used for different ial display RT and PCR reactions.......52 3-2 Arbitrary primers used for diff erential display P CR reacti ons.....................53 3-3 Primers and FRET pr obes for QPCR........................................................61 3-4 Animal status indicators fo r zinc-deficient, zinc-normal and zinc-supplement ed mice .............................................................................62 3-5 Differential display transcripts in creased in zinc-def icient mice..................65 3-6 Differential display transcripts dec reased in zinc-def icient mice.................66 3-7 Differential display transcripts decreased in zinc-supplemented mice........67

PAGE 9

ix LIST OF FIGURES Figure page 2-1 Food intake and body weights of zinc -deficient (Zn-), pair-fed (PF) and zinc-normal (ZnN) mi ce.......................................................................36 2-2 FACS analysis of Zn and ZnN thym ocytes................................................38 2-3 Densitometry output for Znarra y relative to ZnN array using AtlasImage software................................................................................39 2-4 Scatter plot of adjusted intensit ies for detected genes from ZnN array vs. Znarray...............................................................................................40 2-5 Semi-quantitative RT-PCR c onfirmation of zinc-modulated cDNAs identified by array anal ysis.............................................................41 2-6 Comparison of relative expression of four genes based on array and real-time quantitative RT-PCR (Q-PCR) data......................................42 2-7 Western analysis of thymic LCK protein levels...........................................43 3-1 Original re-amplification, subc loning and isolation procedures for putatively regul ated ESTs ...........................................................................56 3-2 Example of subclone heter ogeneity and Souther n analysis .......................57 3-3 Revised experimental approach to differential display. ...............................58 3-4 Differential display RT and P CR reaction reproduc ibility............................63 3-5 AP3 and ARP3 differentia l displays generated on two separate o ccasions .....................................................................................64 3-6 Relative densitometri c analyses of northern blots for select DD clones and MT......................................................................69 3-7 Comparison of DD and northern anal yses..................................................70 3-8 Q-PCR analyses of sele ct DD clones and MT............................................71

PAGE 10

x Figure page 4-1 Pictorial view of gene transcrip ts altered in murine thymus in response to three weeks of dietary zinc def iciency.....................................85 A-1 Autoradiograph of DD bands 3,3,1 and 3,3,2.............................................88 A-2 Autoradiograph of DD bands 3,3,1b, 3,3,2b and 3,3,3 ...............................91 B-1 Autoradiograph of DD bands 2,17,1 and 2,17,2.........................................93 B-2 Autoradiograph of DD band 3,1, 1...............................................................95 B-3 Autoradiograph of DD band 7,11, 1.............................................................97 B-4 Autoradiograph of DD band 10,7, 2G........................................................100 B-5 Autoradiograph of DD band 9,7, 1A...........................................................102 C-1 Autoradiograph of DD bands 2,4,2 and 2,4,3...........................................105 C-2 Autoradiograph of DD band 2,14, 1...........................................................108 C-3 Autoradiograph of DD band 3,1, 4.............................................................110 C-4 Autoradiograph of DD band 3,2, 4.............................................................113 C-5 Autoradiograph of DD band 9,6, 1.............................................................116 C-6 Autoradiograph of DD band 10,7, 2D........................................................119 D-1 Autoradiograph of DD band 2,8, 1.............................................................121 D-2 Autoradiograph of DD band 3,8, 2C..........................................................123 D-3 Autoradiograph of DD band 3,7, 1.............................................................125 D-4 Autoradiograph of DD band 3,7, 2.............................................................128 D-5 Autoradiograph of DD band 7,6, 2G..........................................................130 D-6 Autoradiograph of DD band 7,13, 1...........................................................132 D-7 Autoradiograph of DD band 7,20, 1...........................................................135

PAGE 11

xi ABBREVIATIONS ANOVA analysis of variance AP anchored primer ARP arbitrary primer CD cluster designation cDNA complementary DNA CyC Cy-Chrome dATP deoxyadenosine triphosphate DNA deoxyribonucleic acid dNTP deoxynucleot ide triphosphate EDTA ethylene diamine tetraacetate EtBr ethidium bromide FACS fluorescence-activated cell sorting FITC fluorescein isothiocyanate HEPES N-2-hydroxyethylpipera zine-N’-2-ethane-sulfonic acid IgG immunoglobulin G LCK lymphocyte-specific protein tyrosine kinase MOPS 3-(N-morpholino)pr opane-sulfonic acid mRNA messenger RNA MCL1 myeloid cell leukemia sequence 1 MLR mouse lamina receptor MRE metal response element MT metallothionein MTF-1 MRE binding transcription factor 1PE phycoerythrin PF pair-fed PCR polymerase chain reaction Poly A+ polyadenylated RNA selected Q-PCR quantitative, real-time RT-PCR RAD23 DNA damage repair and recombination protein 23 RNA ribonucleic acid RPSA 40S ribosomal protein SA RT-PCR reverse transcription polymerase chain reaction SDS-PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresis UV ultraviolet Znzinc-deficient ZnN zinc-normal Zn+ zinc-supplemented

PAGE 12

xii Abstract of Dissertation Pr esented to the Graduate School of the University of Florida in Partial Fulf illment of the Requirements for t he Degree of Doctor of Philosophy MODERATE MURINE DIETARY ZINC DEFICIENCY AND ZINC SUPPLEMENTATION MODULATE SPECI FIC THYMIC mRNA ABUNDANCES IN VIVO: RESULTS FROM cDNA AR RAY ANALYSIS AND DIFFERENTIAL DISPLAY SCREENING By J. Bernadette Moore December 2002 Chair: Robert J. Cousins Major Department: Food Science and Human Nutrition The detrimental sequelae of severe zinc deficiency on the thymus and T-lymphocyte compartment of the mammalian immune system have been established, but underlying mechanisms remain unknown. Hypothesizing that the alterations in T-lymphocyte number and function observed during a zinc deficiency may result from initial c hanges in gene expression, we compared thymic mRNA expression profiles of zinc -deficient (Zn-) zinc-normal (ZnN) and zinc-supplemented (Zn+) mice utilizing bot h cDNA arrays and mRNA differential display. Initial studies developed and characterized the animal model of moderate dietary zinc deficiency us ed in the following experiments. Array analysis of 1200 characterized cDNAs using poly A+ selected thymic RNA from either Znor ZnN mi ce detected expression for ~230 cDNAs.

PAGE 13

xiii From these, four putative zinc-regul ated mRNAs were identified, and their modulation was then confirmed independent ly using real-time quantitative RT-PCR (Q-PCR). Of particular interest wa s elevated expression of the gene for the lymphocyte-specific protein tyro sine kinase (LCK), which, through a zinc-mediated interaction in the cytoplas m, transduces signaling from the CD4 and CD8 receptors. Further western analysis showed that, indeed, the zinc-binding protein LCK was elevated in Znthymus. For differential mRNA displa y experiments a moderately zinc-supplemented dietary group was also included. Candidate zinc-modulated cDNAs, visualized through differential displays generated from a battery of primers, were isolated and sequenced. Zinc regulation was confirmed independently by northern bl ot or Q-PCR. Notably, multiple heat shock and chaperone protein messages were down-regulated in Znanimals, whereas mRNAs for the T-cell cytokine receptor and mouse lamina receptor were found increased in the Znmice. In addition, ribosomal RNA and ribosomal protein coding genes were found responsive to both zinc deficiency and zinc supplementation. Lastly, several novel cDNAs have been identified as zinc-modulated, demonstrating the utility of differential display for contributing sequence data to the existing databases. In conclusion, these data support the hy pothesis that alterations in thymic mRNA abundances precede the phenotypic e ffects associated with severe zinc restriction or supplementation.

PAGE 14

1 CHAPTER 1 INTRODUCTION AND LI TERATURE REVIEW Introduction Zinc is an essential micronutri ent required for human growth and development. Considered to have three dist inct biological roles: catalytic, structural, and regulatory (Cousins 1996), over 900 tran scription factors and 100 enzymes require zinc for f unction (Tupler et al. 2001, Vallee and Falchuk 1993). Not surprisingly, mammalian dietary zinc deficiency has numerous adverse consequences. Classic symptoms of severe human zinc deficiency include diarrhea and dermatitis, attributable to fa ilure of the innate barrier component of immunity: the epithelium. Moreov er, thymic atrophy, lymphopenia and decreased host resistance to infectious di sease, attributable to failure of cell-mediated immunity, contribute signifi cantly to the syndr ome of human zinc deficiency (Shankar and Prasad 1998). Early animal studies showed that after the thymic cortical involution and atrophy induced by zinc deficiency, T-lymphocyte mediated responses, in particular T helper activities, were se verely impaired (Fernandes et al. 1979, Fraker et al. 1977). Furthermore, these ac tivities were rescued specifically by restoration of adequate zinc status (Frake r et al. 1978). It is now thought that lymphopenia, due to loss of precursor cells in bone marrow and thymus, results in host inability to replenish peripheral lymp hocytes. This loss of immunity is then

PAGE 15

2 responsible for the increased susceptibi lity to infectious disease observed secondary to zinc deficiency (Fraker et al. 2000). While flow cytometric experiments in the bone marrow, and more re cently the thymus (Osati-Ashtiani et al. 1998, King et al. 2002), of zinc-defic ient mice suggests apoptosis may be responsible for the preferent ial loss of precursor B and T-cells in these organs, the molecular signals dictating these losses remain to be established. Zinc is an established mediator of gene expression through both defined direct and (as yet poorly understood) indirect mechanisms (Cousins 1998). Zinc directly mediates transcription through revers ible interactions with zinc-fingers of the trans-acting, metal response element (MRE) binding transcription factor (MTF-1), which binds cis-acting MREs in the promoter of me tallothionein genes in an inducible fashion (Dalton et al 1997, Radtke et al. 1993). Because metallothionein knockout mice live norma l life spans but MTF-1 knockout mice die in utero it is clear that other examples of zinc’s direct mediation of gene expression exist, but remain to be eluc idated (Blanchard and Cousins 2000). Given the ubiquity of zinc-finger pr oteins and specifically zinc-finger transcription factors, it seems impr obable that MTF-1 will remain the only example of a zinc-finger prot ein whose functionality is det ermined by zinc supply. The existence of a zinc-responsiv e suite of genes (regulon) in Sacchromyces cerevisiae (Lyons et al. 2000) suggests t here will be a similar regulon in mammals. Isolated examples of promoter and reporter constructs of mammalian genes that have MRE sequences and provid e zinc regulation in have appeared, including two acute phase proteins, and t he calreticulan gene (Lichtlen et al.

PAGE 16

3 2001, Nguyen et al. 1996, Yiangou et al. 1991). Moreover, extensive experiments characterizing a mammalian ex pression profile of zinc-deficient small intestine further supports the idea that zinc deficiency alters the expression of multiple mRNA species with functional physiological significance (Blanchard and Cousins 1996, 1997, Blanchard et al. 2 001). Additional research will further define the role of dietary zinc in modul ating gene expression and its influence on host health and susceptibility to disease. The last decade has heralded tremendous technological advances in gene sequence and expression analysis (structu ral and functional genomics). These advances have given rise to exponential increases in the amount of structural genomic information for a variet y of model organisms including Saccharomyces cerevisiae Drosophila melanagaster Caenorhabditis elgans and the draft sequences of the human genome (Lander et al. 2001, Venter et al. 2001). Likewise, functional genomics has expande d from the study of a single gene transcript via northern blotting or RT-PCR to monitoring entire cellular expression patterns or profiles by methods such as differential mRNA display, serial analysis of gene expression (SAGE) and DNA arra ys (Lander 1999, Martin and Pardee 2000). Currently, these various methodologies offer specific advantages and disadvantages. For instance, while DNA array technology permits high throughput expression profili ng of hundreds to thousands of genes in parallel, this ability is exquisitely dependent on current sequence information and, as such, arrays to date have been used mo st effectively for analysis of the

PAGE 17

4 Saccharomyces cerevisiae transcriptome (Lander 1999). Differential display, on the other hand, is sequence independent and permits contribution of sequence data to the various databases; however ex perimentally, this approach does not offer the throughput provided by DNA arrays. Regardless of the method used, t he exploration of cellular mRNA expression profiles has been noted to yiel d global genomic fingerprints that identify the biological st ate of that cell/tissue, whether in the midst of proliferation, activation or differentiation (Staudt and Brown 2000). These global fingerprints are naturally extended to describing the nutri tional state of a cell/tissue, or indeed an organism, and ultimately transcription pr ofiles will be clinically relevant nutrition assessment tools. Hypotheses and Research Objectives The purpose of these experiments is to test the hypothesis that the phenotypic/pathologic manifestations of thymic atrophy and lymphopenia observed secondary to severe mammalian zinc deficiency have their genesis in initial changes of thymic gene expression. This hypothesis predicts that causal alterations in thymic mRNA abundanc es will precede the gross phenotypic effects of zinc deficiency and reflect, dire ctly or indirectly, critical molecular requirements for maintenance of thymic zinc homeostasis. Research objectives included the following: Development and characterization of a murine model of moderate zinc deficiency. cDNA array analysis of zinc-deficient and zinc-normal murine thymic gene expression.

PAGE 18

5 Differential mRNA display of zinc-deficient, zinc-normal and zinc-supplemented murine thymus. Independent confirmation of sele cted zinc-modulated cDNAs by PCR-based methodologies. Literature Review Zinc Biochemistry Zinc is a divalent cation. A group IIB element, it is typologically a mineral and a metal. The tetrahedral coordinate atomic geometry of the zinc atom, in combination with its unique pauc ity of redox function, lends itself particularly well to formation of stable molecules with th iol ligands (Fleet 2000). An essential nutrient for all forms of life examined, ranging from microorganisms through plants and animals, zinc is required in milligram amounts by humans (8 mg/day for adult females and 11 mg/day for adult males) (Panel on Micronutrients et al. 2002). These requirements ar e derived from the multiple molecular functions of zinc. Zinc is essential for the tertiary structure/function of multiple metalloproteins, including dozens of c onserved metalloenzymes in all enzyme classes, carbonic anhydrase and alc ohol dehydrogenase to name two (Vallee and Falchuk 1993). In addition, zinc is r equired for the conformation of the aptly named zinc-finger peptide motifs found extremely enriched within eukaryote transcription factor families ( Lander et al. 2001, Venter et al. 2001). Over ten classes of zinc-finger domains have now been described, and it is clear that these protein domains both bind specific DNA cis elements and mediate protein-protein interacti ons with regulatory outcomes (Berg and Shi 1996). The

PAGE 19

6 sheer numbers of existing zinc metalloprotei ns implicates an involvement of zinc in essentially all cellular processes. In addition to the established myriad of proteins dependent on zinc for function, signaling roles for zinc ions ex ist. New appreciation is emerging for the essential role of zinc in bridging ex tracellular receptors with intracellular transducers (Huse et al. 1998, Lin et al 1998). Similarly, recently described in vitro evidence exists for a membrane zinc-sensing re ceptor that triggers Ca2+ release from a variety of mammalian ce ll types, including colonocytes, kidney cells and keratinocytes (Hershfinkel et al 2001). Verification of these data would demonstrate an additional, novel, signaling role for zinc. In the brain, zinc is found in vesicles in the boutons of a specific subset of glutaminergic neurons. Zinc ion binding sites are found on both the N -methyl-D-aspartatate (NDMA) and kainic ac id (KA) glutamate receptors, demonstrating zinc involvement in t he glutaminergic, excitatory synapse (Frederickson et al. 2000). Seemingly cont radictory, zinc release from synapses in response to brain injury (ischemia, seizures and traumatic brain injuries) induces neuronal death (Koh et al. 1996, C hoi and Koh 1998). Moreover, recent in vivo data suggest that normal synaptically re leased zinc contributes greatly to the aggregation of the amyloid peptide and the pathology of Alzheimer’s (Lee et al. 2002). As women have higher glutam inergic signaling relative to men and therefore greater neuronal exposure to synaptically released zinc, these data may explain the enrichment of Alzheime r's disease expression in women (Bush and Tanzi 2002).

PAGE 20

7 The dichotic cellular toxicity of zinc ions, yet absolute cellular requirement for zinc, is underscored by the existence of the rapidly exp anding family of described mammalian zinc transporters (Cos tello et al. 1999, Cragg et al. 2002, Gaither and Eide 2000, Huang and Gitschie r 1997, Huang et al. 2002, Kambe et al. 2002, Liuzzi et al. 2001, Palmiter and Findley 1995, Palmiter et al. 1996a, 1996b). The importance of zinc trafficking is further supported by experiments in Escherichia coli showing that the zinc-sensing transcription factors Zur and ZntR, which modulate transcription of the bacte rial zinc uptake and efflux proteins, respond to femtomolar amounts (orders of magnitude lower than one zinc atom/cell) of free zinc (Outten and O'Halloran 2001). These data suggest that there are no pools of free zinc in bacte ria and support earlier suppositions that the level of free zinc in mammalian cells is 1 nmol/L (Cousins 1996). The cysteine-rich metallothionein (MT) protein which binds up to seven atoms of zinc, is responsive to dietary zi nc at the transcriptional level, and may function to manage a labile intracellular s ource of zinc (reviewed by Davis and Cousins 2000). However, given that MT knockout mice live happily without overt phenotypic expression of this deficit (Mast ers et al. 1994), and MT transcription is regulated by a variety of hormones and cytokines (Samson and Gedamu 1998), the possibility of unidentified zinc c haperones similar to those identified for copper (Pena et al. 1999) can not be excluded. The multiple requirements for zinc in so many intracellular processes is perhaps best shown by the response to a mammalian zinc deficiency. Rather than initial mobilization and decline in zi nc tissue stores, with subsequent failure

PAGE 21

8 of dependent metabolic function, the response to the loss of zinc is an initial decrease in endogenous losses and subse quent decline in growth (King and Keen 1999). This conservation makes it difficult to diagnose a deficiency by tissue levels, while the multitude of biochem ical roles for zinc means that a mild zinc deficiency produces a variety of diverse symptoms (Panel on Micronutrients et al. 2002). However, the sequelae of diarrhea, dermatitis and lymphopenia that manifest in a severe zinc deficiency (A ggett 1989) highlight the necessity of zinc for cellular replication. As a consequenc e, rapidly dividing cells (enterocytes, epithelial cells and lymphocytes) are affect ed most severely. The topic of immune integrity loss subsequent to zinc deficien cy, and the subject of zinc’s involvement in gene expression both require further expans ion. However, an overview of the physiology of the normal thymus is rele vant before discussing the immune effects of zinc deficiency. The Thymus and T-lymphocyte Development The thymus is a multi-lobed primary immune organ located in the upper anterior mediastinum. Each lobe can be divided histologically and functionally into outer cortical and inner medullary regions. During embryonic development the cortical and medullary regions ar ise from the ectodermal and endodermal layers of the third pharyngeal pouch and t he third branchial cleft, respectively (reviewed by Suster and Rosai 1990). The th ymus is the site of thymopoiesis, a differentiation process that requires the epithelial ce ll network (the thymic architecture/stroma) to be intact and of normal cellularity (Janeway et al. 2002, reviewed by Marx and Muller-Hermelink 199 9, Petrie et al. 2000). Thymocyte

PAGE 22

9 precursors arise from hemat opoietic stem cells in t he bone marrow or the fetal liver and then, unlike B lym phocyte precursors that complete their development in the bone marrow, migrate to the th ymus for differentiation into naive T-lymphocytes. Developing early in gestation, the thymus displays tremendous plasticity throughout the lifecycle in response to a vari ety of stimuli. The thymus begins to atrophy after puberty with the rate of thymic T-cell production declining concomittantly. However, this does not mean a loss of the T-cell arm of immunity, since in addition to the peri pheral expansion of established T-cells, thymopoiesis does continue at a lower rate Indeed, recent r eports suggest that the human thymus (which involutes, but does not lose volume with age, as opposed to mouse thymus which atrophies) functions well past middle age (Haynes et al. 2000). Beyond age rela ted changes in thymic structure and function, the thymus is known to at rophy/involute in response to pregnancy (reviewed by Clarke and Kendall 1994, Tibbe tts et al. 1999); glucocorticoids (Ashwell et al. 2000); dioxins (Wahba et al. 1989); and nutrient deficiencies. In particular, severe zinc deficiency and prot ein-energy malnutrition have been noted to precipitate thymic involuti on (Torun and Chew 1999, Yoshida et al. 2002). The process of T-cell differentiation follo ws migration of the cells thru first the cortical, then medullary, regions of the thymus and can be tracked by cell surface markers representative of each dev elopmental stage. The thymic cortex is composed primarily of cortical epithel ial cells and T-cell precursors from the

PAGE 23

10 bone marrow. Whereas, the medullary regi on contains medullary epithelial cells, dendritic cells, and macrophages, in addition to further differentiated T-cells (Janeway et al. 2002). Remarkably, over 95 % of the T-cell precursors that arrive in the thymus are doomed to an apoptot ic death (reviewed by Kuo and Leiden 1999). This reflects the intensive, incompletely understood, positive and negative selection processes of thymocyte differentiation. These ensure that T-cells will both recognize self-majo r histocompatibilit y complex (MHC) molecules, the molecules that present antigenic peptides to the T-cell receptors (TCR) to elicit an immune response, and distinguish between self-peptides and foreign peptides bound within the MHC mo lecules (reviewed by Janeway et al. 2002). T-cell development can be grossly di vided into stages based on cell surface expression of some of the protei ns that form the TCR and co-receptor complexes, namely the CD3, CD4 and CD8 mo lecules. While CD3 is one of the polypeptide chains comprising the TCR, CD4 and CD8 molecules are TCR co-receptors that divide mature T-cells f unctionally into MHC class II recognizing (T helper cells), and MHC class I recognizi ng (cytotoxic T-cells) subsets. As such, developing T-cells are tracked loos ely from the triple /double-negative, CD3-CD4-CD8-, pre-T-cells, to the double-positive T-cells, CD3+CD4+CD8+, and shortly before egress, the nai ve, single-positive T-cells, CD3+CD4+, or CD3+CD8+ (Kuo and Leiden 1999). Ultimately, the development of T-cells is orchestrated temporally at the transcriptional level. Transcription is driven by extracellular signals that are

PAGE 24

11 conveyed by complex signal transducti on pathways now being elucidated. Currently, it appears that the initial li neage commitment of T-cells to either expression of the : TCR or : TCR is dictated by which receptor receives signals first, eit her the pre-TCR (pT : TCR) or the : TCR (Borowski et al. 2002, Janeway et al. 2002). Dependent on successful, in-frame re-arrangement of the , and gene loci mediated by the recombinase-activating genes-1 and -2 (RAG1, RAG2), this lineage co mmitment appears as a race toward cell-surface expression. After early development, : T-cells clearly dominate this race representing 95% of T-cells produced (Janeway et al 2002). Signaling through the pT : TCR is transduced by the lymphocytespecific protein tyrosine kinase LCK, and is essential for initiati on of the rear rangement of the gene locus and progression to the double-positive st age (Killeen et al. 1998). The protein kinases LCK and ZAP-70 are indispensab le for T-cell development. As are several transcription factors including, t he zinc-finger proteins: Ikaros, GATA-3 and LKLF; and the HMG (high mobility gro up) box transcription factor TCF1 (reviewed in Kuo and Leiden 1999). Fr om the double-posit ive stage T-cell precursors undergo the posit ive and negative selection processes. These are mediated by TCR/co-receptor:MHC interact ions, also require LCK function, and ultimately result in single-positive, naive T-lymphocytes which exit the thymus to the periphery (reviewed in Borowski et al. 2002, Janeway et al. 2002, Killeen et al. 1998).

PAGE 25

12 In summary, thymopoeisis is a highly regulated, temporal process that occurs in the thymus in a manner that is still being clarified at the molecular level. The complexity of T-cell develop ment stems from the somatic gene rearrangements required for production of a functional TCR, which then must be tested for self-restriction and auto-reactivi ty. Exquisitely sensitive to host stressors, the thymus involutes and T-cell development is halted in the face of severe malnourishment, such as zinc deficiency, resulting in compromised host-immunity. Zinc Deficiency and Immunity In mammals, adequate zinc status is required for the proper functioning of almost every component of the imm une system (reviewed by Shankar and Prasad 1998). Beyond the clinical symptom s: dermatitis, diarrhea, alopecia and failure to grow (Aggett 1989), decreased host resistance to infectious disease is a primary consequence of zinc deficiency. Primarily a concern in the third world, zinc supplementation of children markedly reduces incidence of diarrhea (Bhutta et al. 2000). In addition, zinc supplement ation of high-risk deficient groups has been shown to reduce the morbidity of resp iratory disease (Rosado et al. 1997, Lira et al. 1998), nematode infection (Boul ay et al. 1998), and sickle cell disease (Prasad et al. 1999). Shortly after the characterization of human zinc deficiency by Prasad and colleagues in Iran in the early 1960s (re viewed in Prasad 1991), came inquiry into the relationship between zinc def iciency and immune function. Initial experiments conducted by Fraker et al. (1977) investigated the effects of zinc

PAGE 26

13 deficiency on the immune syst ems of young-adult, female, inbred A/J mice. In the initial study 5to 6-week-old mi ce were maintained on deficient (0.5 g Zn/g), low (2.3 g Zn/g), or high (29.1 g Zn/g) zinc diets for 39 da ys. In this case, the "high" zinc concentration represents the recommended sufficient level for zinc in rodent chow rather than a supplemental le vel (American Institute of Nutrition 1977, American Institute of Nutrition 1980). At Day 27 half of the deficient group were injected with the number of thymo cytes equal to that found in an intact thymus (60 X 106), and on Days 28 and 35 all mice were immunized with sheep red blood cells (SRBC), a T-cell dependent ant igen. After the mice were killed on Day 39, splenic lymphocytes were isolat ed and used in the classic Jerne plaque assay to assess the secondary immune response. Zinc-deficient mice produced 10%, and the low zinc animals produced 25% of the number of anti-SRBC plasmacytes produced by the high zinc group. Interestingly, the zinc-deficient animals reconstituted with thymocytes produced 61% of control plasmacytes, suggesting that zinc deficiency primarily affected T-cell helper activity. Extending these results Fraker then showed that t he drastic involution of the thymus could be reversed, the th ymus repopulated, and antibody-mediated response restored after re-feeding zinc-suffi cient diets for 2 w eeks (Fraker et al. 1978). This restoration of immune response with zinc repletion also holds true for delayed-type hypersensitivity reactions, which are also drastically diminished during zinc deficiency (Fraker et al. 1982). On the other hand, even moderate zinc deficiency experienced during gesta tion produced impaired immune function for three generations of mice fed control diets with adequate zinc (Beach et al.

PAGE 27

14 1982). Thus illustrating the severity of a zinc deficiency experienced in utero In contrast, during lactation, while pups su ckling from dams on a marginal zinc diet have a much weaker humoral respons e to both T-independent and dependent antigens; exhibiting 25 to 45% of the re sponse seen in control pups, 2 weeks of zinc-sufficient feeding could reverse i mmune deficits observed (Fraker et al. 1984). Early in vitro experiments also provided evid ence that T-cell function is selectively impaired by zinc deficien cy (Zanzonico et al. 1981). Ethylene diaminetetraacetate (EDTA) used in the m edium to chelate zinc did not affect B-cell mitogenesis as stimulated by lipop olysaccharide (LPS). Whereas T-cell mitogenesis, in response to either phyt ohemagglutinin P (PHA) or concanavalin A (Con A), decreased over 50% relative to controls. The addition of zinc to the media reversed the effects of EDTA. S upporting these findings are studies by Fernandes and workers (1979) wh ich found that mice fed zinc deficient diets did not show any decreased antibody-dependent cytotoxicity, while exhibiting both depressed T-cell-mediated cytot oxic and natural killer activities. Again, these data suggested that zinc deficiency selectively affected particular cell populations. Since adrenal hypertrophy occurs conc omitant to thymic involution during zinc deficiency, DePasquale-Jardieu and Fraker (1979, 1980) explored the role of increased levels of corticosterone on T-cell function during dietary zinc deficiency. In the A/J mouse corticoster one levels increase rapidly after Day 12 of a zinc deficient diet regime. While T-cell helper function did decrease 4 days

PAGE 28

15 after the rise in corticosterone levels, over 50% of the decrease in function was seen before the rise (DePasquale-Ja rdieu and Fraker 1979, 1980). These results may suggest that increased glucoc orticoid levels contributed to the decrease in T-cell activity, however t hey do not prove a direct link. A subsequent study examined the effe cts of dietary zinc deficiency on adrenalectomized mice (DePasquale-Jard ieu and Fraker 1979). There was no difference between a direct immune re sponse (IgM) from either the adrenalectomized deficient mice, or the in tact deficient mice when the diet was fed for 3, 4 or 6 weeks. An indire ct immune response (IgG; requiring T-cell function) varied slightly between groups, with the adrenalectomized deficient mice having a much stronger immune res ponse at 4 weeks, when the rise in corticosterone levels were seen in the inta ct mice. However, at 6 weeks, while the adrenalectomized deficient mice st ill had a statistically stronger response than did the intact deficient mice, the immune response had dropped below 40% of controls. Curiously, the adrenalectomiz ed deficient mice retained their thymus weight (94% of controls), but their cortical:medullary ra tio dropped from 2:1 (controls) to a 1:1 ratio, matching that of the intact deficient mice and indicating loss of thymocyte precursors and cortical involution. The authors concluded that the decrease in immunity seen in zinc def iciency is not mediated by the adrenal axis. Altered T-cell sub-populations an d cytokine production has been observed during human zinc depletion (Beck et al 1997b). Mild zinc deficiency was induced by feeding subjects (n=5) 2 to 3.5 mg zinc/day for 20-24 weeks.

PAGE 29

16 Subjects were initially brought to basel ine by consuming 12 mg zinc/day for 4 weeks, then repleted by supplementation of 25-50 mg zinc/day for 8-12 weeks. During the entire study, all meals were consumed in a metabolic ward, with the only variable being zinc, and zinc defic iency was confirmed by significant decreases in plasma, lymphocyte, granulo cyte and platelet zinc concentrations. While no differences were seen in total ly mphocyte, T-cell, B-cell, or leukocyte counts; significant decreases in the ratio of helper to cytotoxic T-cells (CD4+/CD8+), and in t he number of cytotoxic lymphocyte precursors (CD8+CD73+) were observed at the end of the zinc restriction period. In addition, a reduction in the rati o of nave and memory T-cells (CD4+CD45RA+:CD4+CD45RO+) was almost significant (p=.077) Cell populations returned to baseline after zinc repletion. In addition, interferon(IFN ) and tumor necrosis factor(TNF ) production were significantly reduced, while the production of interleukins (IL) 4, 6, and 10 was not altered during zinc restriction. The reductions in IFN and TNF both Th1 cytokines, suggests an imbalance between the response of T-helper cell subsets 1 and 2. occurred in the zinc-restricted subjects. Inadequate zinc nutriture results in host immunodeficiency. While many aspects of the immune system suffer during zinc deficiency, cell-mediated immunity is particularly impaired. T he site of T-lympho cyte development, the thymus, undergoes cortical involution and atrophy, and alterations are seen in lymphocyte populations and activities. Unless zinc deficiency is experienced in utero these symptoms are reversible with rest oration of zinc in the diet. While

PAGE 30

17 much research has outlined the specif ic functional deficiencies found during mammalian zinc deficiency, underlying molecular mechanisms are yet to be defined. Numerous pathologies have thei r origin in altered gene expression, whether inappropriate over expression or underexpression of a gene. The identification of thymic genes modulated by zinc status should significantly further the understanding of this micronutrient ’s critical role in immunity. Zinc and Gene Expression The requirement of zinc for prot ein synthesis and enzyme activity has been recognized for decades, but only recently have the multiple roles zinc plays in the modulation of gene transcription been highlighted. As zinc is required for RNA polymerase enzyme activity (re viewed by Vallee and Falchuk 1993), decreased RNA synthesis duri ng zinc deficiency could c ontribute to the observed growth inhibition in such a deficiency. However, expression analyses for genes regulated by zinc supply in both yeast (L yons et al. 2000) and rats (Blanchard and Cousins 1996, Blanchard et al. 2001) show that most of expressed genes are unaffected by zinc. This argues agai nst a global effect on transcription activities of the RNA polymerases, and sugges ts specificity of the zinc-deficient effect on a subset of responsive genes. The metallothioniens, cysteine-rich meta l binding proteins, were the first demonstrated zinc inducible proteins (Richards and Cousins 1975a, 1975b). Decades later while the functionality of the MTs is still being debated (Fischer and Davie 1998, Palmiter 1998), the mole cular mechanism of their zinc regulation is beginning to be understood. MT genes are highly responsive to a

PAGE 31

18 variety of factors that in teract with the multiple response elements in their promoter regions (reviewed by Davis and Cousins 2000). Thes e factors include: glucocorticoids, cytokines, electrophiles (hence MT’s responsiveness to cellular redox status), and transition metals su ch as zinc, cadmium and copper. Metal regulation of MT is dependent on the multiple metal response elements (MRE) in the metallothionein promoter; and this r egulation is mediated by the MRE-binding transcription factor (MTF-1), cloned by library screening wit h an oligonucleotide probe representing a compilation of MR E sequences (Radtke et al. 1993). Remarkably, while MT knockout mice di splay very mild phenotypic effects, the MTF-1 knockout results in a le thal phenotype (Gunes et al. 1998). The MTF-1 is a six zinc-finger protei n whose MRE motif binding activity was shown in vitro to be directly modulated by zinc (Dalton et al. 1997). Additional investigations suggest the firs t zinc-finger of MTF-1, which differs significantly from the other fingers in am ino acid sequence, binds zinc with low affinity and in the absence of zinc prev ents the MRE-binding function of the second, third and fourth zinc fingers (Bi ttel et al. 2000). More recently however, evidence for regulation of the tran sactivating functi on of MTF-1 via phosphorylation and signal transduction has emerged (LaRochelle et al. 2001, Saydam et al. 2002). While not negating th e regulation of MTF-1 by cellular zinc, as zinc mediates the DNA binding capabi lity of MTF-1 under a ll circumstances, these data present a plausible explanati on for the enigmatic, highly inducible nature of MTs.

PAGE 32

19 Corresponding to the MT data, the M TF-1 regulates the zinc transporter ZnT1 (Langmade et al. 2000), supporting the in itial report that Zn T1 is regulated by dietary zinc in vivo (McMahon and Cousins 1998). In addition to MTF-1, other zinc-finger transcription factors have been shown to exchange zinc with the environment. These include: the estrogen receptor, a member of the nuclear receptor superfamily, (Cano-Gauci and Sa rkar 1996); tramtrack, a transcription factor that regulates differentiation in Drosophila (Roesijadi et al. 1998); and the yeast transcriptional activato r Gal4 (Maret et al. 1997). Given the sheer number of zinc-finger proteins, ov er 50% of transcription fact ors identified by the human genome sequencing projects ( Lander et al. 2001, Venter et al. 2001), and the versatility of this structural motif which mediates both protein/DNA and protein/protein interactions, it seems un likely that the afor ementioned examples will remain exclusive. Evidence from expression profiles of zi nc deficiency in both yeast and rats further shows zinc’s involvement in gene expression and specifically the modulation of transcription by alter ed zinc status. In the case of Sacchromyces cerevisiae expression profiling is gr eatly aided by the availability of complete genome microarrays; indeed, the pioneering of glass microarrays was from the field of yeast genetics (Schena et al. 1995, Shalon et al. 1996). Utilizing this technique, in combination with algori thmic genetic motif analysis, Lyons and colleagues (2000) identified 46 genes tar geted by the yeast zinc-responsive transcription factor Zap1p. This tran scriptional activator, and zinc-sensor, responds to zinc limitation by in teracting with the yeast consensus

PAGE 33

20 zinc-responsive element and up-regulating its targeted genes, which include the zinc transporters responsible for importi ng zinc. The battery of genes (regulon) identified as Zap1p targets in yeast, impl y that a similar su ite will exist in a mammalian system, whether regulated by MTF-1 or a, yet unidentified, zinc-responsive transcription factor. An MTF-1 target gene search has been executed using a similar combinatorial appr oach as the yeast research; however, experimental limitations (i.e. worki ng with 12 and 13-day-old mouse embryos) prevented the success observed in yeast (Lichtlen et al. 2001). Expression profiling of rat small in testine has provided substantial evidence that dietary zinc deficiency al ters mRNA abundances in a manner that predicts both protein abundances and t he physiology of the deficiency (Blanchard and Cousins 1996, 2000, Blanchard et al. 2001). For example this research identified, among many expr essed sequence tags, preprouroguanylin mRNA, precursor to the natriuretic ho rmone uroguanylin, as up-regulated in the deficient animals (Blanchar d and Cousins 1997). Subsequent immunohistochemical experiments hav e demonstrated elevated uroguanylin protein levels both in the villi of zincdeficient rat duodenum and jejunum (Cui et al. 2000), and in the proximal tubule s of the kidney (Cui et al. 2001) substantiating these findings as a potentia l molecular mechanism involved in the classic diarrhea symptoms associated with zinc deficiency. As diarrhea is a leading cause of death in third world countries, these data further validate intervention trials demonstrating a decr ease in diarrhea morbidity after zinc supplementation (Bhutta et al. 2000, Ros ado et al. 1997, Sazawal et al. 1995,

PAGE 34

21 1996). However, since expression profiles, by either differential mRNA display or DNA arrays, only provide an estimate of a steady state level, wh ether dietary zinc is influencing transcription through cis-acti ng factors in the nucleus, or affecting message abundance indirectly by altering me ssage stability or turnover rate, remains to be understood. Zinc modulation of gene expression can occur through a variety of direct and indirect mechanisms. The further identification and characterization of zinc-regulated genes will increase the understanding of zinc biology and may provide clinical and field-adequate, reliable, zinc status indicators, which have been elusive to date. Gene Expression Analysis During the last quarter of the twentieth century, biomedical research has undergone a molecular revolution. The te chniques of molecular biology have been applied within a vast arra y of disciplines, revising the mendelian view of disease etiology (single gene mutation equa ls disease) to a synergistic genomic perspective. Currently, it is widely rec ognized that most chronic diseases arise from multiple genetic and environmental factors. Moreover, the tremendous responsiveness of cellular transcription in response to environmental stimuli, such as nutrition, is now appreciated. The various worldwide sequencing initiatives contributed to this and, in ma king tremendous strides in the acquisition of structural genomic information, provided a springboard for functional genomics, the study of which genes are transcribed, when, in which cell type, and in response to what stimuli. In this context, the ability and techniques for

PAGE 35

22 monitoring gene expression hav e expanded from the exam ination of single gene transcripts to the monitoring of multip le transcripts simultaneously (Martin and Pardee 2000). Transcriptional profiles highlight differential gene expression between treatment groups that o ften dictates the alter nate phenotypes observed. Technical approaches to t he study of differential gene expression originated in nucleic acid hybridization (Southern 1975) and amplification (Mullis et al. 1986) methods. Current approaches, such as differential mRNA display and DNA arrays, still exploit these principles. While these global methodologies present varied advantages and disadvantages fo r data acquisition, undoubtedly they have contributed to the understanding of many biological processes. Developed by Liang and Pardee (1992, 1993), differential mRNA display permits the identification and isolation of differentially expressed genes with no previous genetic information available. Beginning with cellular total RNA from two or more conditions, the population of mRNAs is sub-fractionated, first by reverse transcription and then by polymeras e chain reaction (PCR), until a pool of cDNA transcripts (~50-250) can be size separated by polyacrylamide gel electrophoresis (PAGE). The incorporati on of radiolabeled nucleotides during PCR permits visualization by autoradiography Transcripts visually identified as selectively expressed are excised from the gel and re-amplified by PCR for cloning and sequencing. The elegance of differential mRNA display lies in the primers chosen for reverse transcription and subsequent P CR reactions. The enzymes, reverse

PAGE 36

23 transcriptase and DNA polymerase, both require short oligonucleotide primers annealed to a strand of RNA or DNA to begin their activity. Choosing an oligo-deoxythymidine (o ligo-dT) primer for reverse tr anscription selects for the 3’ polyadenylate (poly-A) tail found on eukar yotic mRNA, thereby reducing the total RNA population to ~5% polyadenylated mRNA Anchoring this primer 5’ to the poly-A tail, the 3’ untranslated region, by two bases M, N [where M may be adenine (A), guanidine (G), or cytosine (C ) and N may be A, G, C or thymidine (T)] divides the mRNA population by a factor of 12. Furthermore, this eliminates the possibility of amplifying transcripts that are merely poly-T cDNAs. The products of the reverse transcription reacti on, then, are a pool of complementary DNA transcripts (3’ expressed sequence tags ; ESTs) that are fu rther fractionated by the choice of arbitrary 5’ primers. Primer length is a compromise between desired frequency and desired specificit y of annealing and varies between 10 nucleotides. Statistically, 20 arbitrar y 10-mer primers in combination with 12 anchored primers will screen t he estimated pool of 15,000 active genes in any one-cell type with 90% confidence that eac h mRNA will be repr esented at least once on the displays (Bauer et al. 1993). Originally used for identifying and cloning oncogenes and tumor suppressor genes, whose aberrant expression often leads to uncontrolled cancerous growth (Liang et al. 1992), di fferential display has now been employed to find altered gene expression in a vari ety of pathologies, including those with nutritional relevance. The laboratory of King and co-workers successfully utilized this technique to identify glucose-i nduced genes in both aortic smooth muscle

PAGE 37

24 cells and retinal pericytes (Aiello et al. 1994, Nishio et al. 1994). As hyperglycemia is considered a significant risk factor for both the retinopathy and vascular complications associated with diabetes, the identification of genes regulated by glucose may lead to better un derstanding of the role of glucose in general, and explain why these cell types are particularly susceptible to damage during diabetes. Another unique and successful applicati on of differential display screening was in the identification of abnormally expressed genes in obese transgenic ( ob/ob ) mice (Maratos-Flier et al. 1997). Seeking to understand the entire range of leptin’s action in the hypothalamus, this group compared hypothalamic mRNA from ob/ob and normal mice. Ob/ob mice do not make leptin due to a spontaneous mutation in the gene and t hese animals express a primary phenotype of marked obesity. This appr oach found Melanin Concentrating Hormone (MCH), a previously identif ied but poorly understood hormone, elevated in the transgenic mice. Furt her research observed elevated MCH mRNA levels during fasting in both obese and normal animals. In addition, injections of MCH to the lateral ventri cles of rats prompts consumption of threefold more food than control rats, establishing a novel role for MCH in feeding behavior. In addition to the previously menti oned use of differential display for the identification of zinc-regulat ed genes in the intestine, this technique has been used to identify copper regulated genes in the liver (Wang et al. 1996). Using a rat model of copper deficiency, these researchers identified several cDNAs

PAGE 38

25 altered by inadequate copper status, incl uding the ferritin heavy subunit and fetuin, a tyrosine kinase inhi bitor which influences the insulin receptor’s tyrosine kinase activity. The regulat ion of fetuin mRNA abun dance may be part of the mechanism that causes glucose in tolerance and hyperinsulinemia in copper-deficient rats. These examples show the primary advantages of the differential display approach are that no prior knowledge of sequence data is required, and theoretically t here are not the limit s of detection that are associated with low abundance messages and double fluorescent labeling. More recently, differential expre ssion analyses have utilized DNA arrays, which permit comparison of the message levels for hundreds to tens of thousands of genes simultaneously. In tradi tional southern/northern blotting and hybridization approaches, a target nucle ic acid population is anchored to a membrane and probed with an excess of a si ngle radiolabeled cDNA or cRNA. DNA arrays on the other hand, reverse this process and the arrays of cDNAs or oligonucleotides are essentially tether ed probes, while a population of nucleic acids are the targets and are labeled and applied to the fixed probes (Rockett and Dix 1999). Clearly, throughput is a primary advantage to this approach, albeit inherently dependent on a priori sequence information. DNA arrays are currently available in membrane, glass or chip formats (Freeman et al. 2000). Chip s, or high-density oligonuc leotide arrays, are unique as the probes are synthesized in situ by photolithography on a silicon chip, and are less than 25 nucleotides long. In contrast, both membrane and glass array probes may be oligonucleotides or cDNAs that are robotically spotted on their

PAGE 39

26 respective matrices. These formats also differ in labeling and targeting approaches. While both the glass and ch ip formats use fluorescence labeled targets, with glass arrays the two treatm ent populations are labeled with either red or green flurochromes and compete fo r binding on the same array, whereas with high-density arrays treatment target populations are labeled and hybridized separately. Membrane arrays have a cu rrent advantage, as targets are labeled with radionucleotides or fluorescence and hybridized in the same manner as a northern or southern blot and therefore do not require tremendous start up costs related to instrumentation. Expression arrays have been criticized as an experimental approach that is not hypothesis driven (Modlin and Bloom 2001). However, this perhaps is precisely why they are an excellent ex perimental approach, as is differential display for the same reason: no inherent bi as skews the search for differentially expressed genes. Data generated are not “hypothesis-limited” and repeatedly array data have yielded bot h predicted and surprising results (Staudt and Brown 2000). For example, a temporal ex amination of gene ex pression from serum-starved human fibroblasts in respons e to serum was intended to profile a model of mitogenesis (Iyer et al. 1 999). However, the profiles generated exemplified a physiological respon se to a wound, reminding us that in vivo when a cell is exposed to plasma abruptly it is in the context of a wound. In this situation, induced genes included both those invo lved in mediating clot dissolution and remodeling, a recognized ro le of fibroblasts in wound healing; and a host of genes for factors involved in recruiting a full immune response.

PAGE 40

27 Later commentary regarding thes e data by the authors, wryl y pointed out that this experiment served as a remi nder of the artificial natur e of cultured cells, which routinely have serum added to the medium (Staudt and Brown 2000). The tools of molecular biology have now been applied to multiple disciplines. Since most physiological processes have their origins in the alteration of gene expression, the applicat ion of differential display and DNA arrays has been extremely successful in id entifying selectively expressed genes in a variety of contexts. It is now re cognized that numerous nutrients regulate gene expression with physiologic outcomes, including sterols, fatty acids, retinoids, vitamin D and the trace metals: zinc, copper and iron. Further use of molecular tools should expand our burgeoning understanding of how nutrients influence gene expression and what role this plays in pathogenesis and health promotion.

PAGE 41

28 CHAPTER 2 MURINE ZINC DEFICIENCY USING AN OUTBRED STRAIN AND cDNA ARRAY ANALYSIS OF THYMIC GENE EXPRESSION Introduction In deciding to explore differential gene expression in zinc-deficient thymus, the objective was to observe initial, potentially pathological changes in gene expression rather than consequential changes resulting from the diseased deficient state itself. Described here is a mouse m odel of moderate zinc deficiency developed for the following expe riments. The initial rationale for choosing a mouse model was the wealth of available immunological markers and existing murine sequence information. Ea rly studies revealed these animals do not, in three weeks, exhibit the al tered eating behavior and growth patterns associated with severe zinc deficienc ies, precluding the need for an additional pair-fed control group and permitting direct comparison between zinc-deficient and zinc-normal animals. While several bioc hemical indices of zinc status were significantly depressed, fluorescenceactivated cell sorting (FACS) analysis showed no changes in thymo cyte populations expressi ng the surface markers CD3, CD4 or CD8, thus establishing that t here was no loss of th ymocytes at this level of zinc deficiency. This report then describes an expres sion profile analysis of zinc-deficient murine thymus utilizing membrane arrays containing 1200 cDNAs, from genes with characterized roles in cellular physiology.

PAGE 42

29 The array screening identified seve ral potential zinc-modulated genes, four of whose modulation was subsequently confirmed using semi-quantitative RT-PCR and then quantified using real-t ime quantitative RT -PCR (Q-PCR). Of particular interest was the elevat ed expression of the gene for the lymphocyte-specific protein tyrosine ki nase (LCK). Further western analysis showed that, indeed, the zinc-binding prot ein LCK was elevated in Znthymus. These results demonstrate that three weeks of dietary zinc deficiency is sufficient to alter specific thymic mRNAs and protein abundances in vivo before alterations in developmental thymocyte populatio ns detectable by FACS analysis. Materials and Methods Zinc-Deficient Diet Studies Young adult (303 g, ~6 wk old) outbred CD-1 mice (Charles River, Wilmington, MA) were maintained indivi dually in hanging stainless steel cages on a 12-h light/dark cycle with free access to distilled, deionized water. Animals were initially fed an AIN-76a-based (Ameri can Institute of Nutrition 1977, 1980) pelleted diet containing 5 mg Zn/kg diet (Research Diets, New Brunswick, NJ) for 3-5 days of acclimation. Then mice we re randomly assigned to 1 of 3 dietary groups: zinc-deficient (Zn-, <1 mg Zn/kg diet); zinc-adequate fed ad libitum (ZnN, 30 mg Zn/kg diet); or zinc-adequate pair-f ed to the zinc-deficient group (PF, 30 mg Zn/kg diet). After a 3-week f eeding period, between 0900-1200, animals were anesthetized with methoxyflurane, killed by exsanguination via cardiac puncture, and blood collected for subsequent serum zinc measurement by flame atomic absorption spectrophotometry. All animal studies in this and subsequent

PAGE 43

30 chapters were approved by the University of Florida Institutional Animal Care and Use Committee. Metallothionein Protein Measurement and RNA Isolation Pancreas was homogenized in 4 volu mes of 10 mmol/L Tris containing a protease inhibitor cocktail (P2714; Sigm a Chemical Co., St. Louis, MO) with a Potter Elvehjem homogenizer. Pancreas metallothionein (MT) levels were measured by the cadmium/hemoglobin affinity assay (Eaton and Toal 1982) as described before (Davis et al. 1998) Whole thymus (~250 mg) was homogenized in 4 mL TRIpure reagent (B oehringer Mannheim, Indianapolis, IN) and total RNA isolated. RNA concentration was determined by spectrophotometry, and RNA integrity conf irmed by UV visualization of EtBr stained ribosomal bands after electrophor esis in a 1% Agarose/1X MOPS/2.2 mol/L formaldehyde gel (Blanchard and Cousins 1996) Fluorescent Activated Cell Sorting In separate experiments, single cell thymocyte suspensions (~1-2 X 106 cells/mL) from individual animals were triple stained with phycoerythrin (PE) conjugated anti-CD3, fluorescein isothio cyanate (FITC) conjugated anti-CD4, and Cy-Chrome (CyC) conjugated anti-CD8 m onoclonal antibodies (BD PharMingen, San Diego, CA). Background fluore scence was established using the appropriate fluorochrome conjugated IgG isotype standards (BD PharMingen). All analyses were performed on a FACS can (BD Immunocytometry Systems, San Diego, CA) instrument at the University of Florida ICBR Flow Cytometry Core.

PAGE 44

31 cDNA Array Analysis Equal amounts of total RNA from either Znor ZnN animals (n=7/treatment group) were pooled and DN ase (Boehringer Mannheim) treated in 40 mmol/L Tris-HCL (pH 7.5), 10 mmol/ L NaCl, 6 mmol/L MgCl for 30 min at 37 C. The reaction was terminated with 10 mmol/L EDTA and 100 mg/L glycogen, and RNA extracted with phenol:chloroform:isoam yl (25:24:1, pH 4.5) and precipitated with 2 mol/L NaOAc and 95 % ethanol. After resuspension, poly A+ RNA was isolated with Qiagen Oligotex spin columns (Valencia, CA). Recovered poly A+ RNA was ethanol precipitated, resuspended, quantified, and assessed for quality as above. Atlas Mouse 1.2 nylon membrane arra ys (Clontech, Palo Alto, CA) containing 1185 partial cDNAs, from genes with known functions in cellular physiology, spotted individually at 10 ng/ spot were used for these experiments. Complex probe syntheses and array hybrid izations were performed precisely according to the manufacturer’s protocol Briefly, for first strand cDNA probe synthesis, 1 g of poly A+ RNA, either Znor ZnN, was incubated with cDNA synthesis primer mix (1.6 L) and conv erted to cDNA using Moloney murine leukemia virus reverse transcripta se in a reaction with >2500 Ci/mmol [ -33P]dATP (>9.25 104 GBq; NEN, Boston, MA). Probes were purified by column chromatography, and radioactivi ty measured by liquid scintillation counting. Probe incorporati on levels were within 1-5 106 dpm for each cDNA population and, for three separ ate hybridizations, probe incorporation levels measured between 25-50 106 dpm. Arrays were prehybridized with

PAGE 45

32 ExpressHyb (Clontech) containing sheared salmon testes DNA (Sigma) before addition of denatured probe. Arrays were hybridized overnight (16-20 h) at 68 C, washed according to Clontech’s specifications, and exposed to a phosphorimaging screen. Phosphorimages were scanned on a Storm Imager (Molecular Dynamics, Piscataway, NJ) and densitomet ries analyzed with AtlasImage software (Clontech). Signal intensities between arrays were normalized by global summation. In this method, a normalizati on coefficient is calculated from the summation of adjusted intensities (intens ity minus background) for all genes on one array (in this case Zn-) divided by the summation of adjusted intensities for all genes on the second array (ZnN). This coefficient was then applied to adjusted intensities of t he individual genes on t he second array. After normalization, adjusted in tensities were exported into Excel (Microsoft, Redmond, WA) for further statistical analyses. Semiquantitative RT-PCR Pooled (n=5), DNase treated total RNA (1.1 g), isolated from mice distinct from those used for array hybr idizations, was incubated with 500 ng oligo (dT)12-18 primers (GibcoBRL, Gaithersburg, MD) for 10 min, followed by reverse transcription with SUPERSCRIPT II RNase HReverse Transcriptase (GibcoBRL). Primer sequences used for PCR amplification were obtained from Clontech, and oligonucleotides were syn thesized by Gemini Biotech (Alachua, FL). Primers used were (Table 21) for: glyceraldehyde-3-phosphatedehydrogenase (GAPDH); myeloid cell leukemia sequence-1 (MCL-1)

PAGE 46

33 Table 2-1: Primers used for semi-quant itative and quantitative real-time RT-PCR Gene Accession # Semiquantitativea GAPDH M32599 5'-TCGTGGATCTGACGTGCCGCCTG-3' 5'-CACCACCCTGTTGCTGTAGCCGTAT-3' MCL-1 U35623 5'-TCCTTTACTGTTGGCGTGTTATGCTC-3' 5'-GCAAGTGTTCCTATCCTCTGACAGG-3' LCK M12056 5'-ATTGCAGAGGGCATGGCGTTCATCG-3' 5'-GGTAAGGGATTCGACCGTGGGTGAC-3' RAD23B X92411 5'-CAAGTGCCCTTGTGACAGGTCAGTC-3' 5'-GTTGTTGTAGTTGCTGTCGTGGTTGC-3' MLR J02870 5'-ACTCCGATCGCTGGCCGCTTCAC-3' 5'-GCATGACCTCCCAGGGGTGCTC-3' Quantitativea MT1 V00835 5'-GCTGTGCCTGATGTGACGAA-3' 5'-AGGAAGACGCTGGGTTGGT-3' TaqMan probe 5'-6FAM-AGCGCTGCCACCACGTGTAAATAGT ATCG-TAMRA-3' MCL-1 U35623 5'-CCAACCCCCCCAAAACTT-3' 5'-TGACAGGAAAGCTGTGCTGACT-3' LCK M12056 5'-GCATGGCGTTCATCGAAGA-3' 5'-GCGTGTCAGACACCAGGATGT-3' RAD23B X92411 5'-CAGGTCAGTCTTATGAGAATATGGTAACTG-3' 5'-GGCTCTCAGGGCTGCAATT-3' MLR J02870 5'-TTCACACCTGGGACCTTCACT-3' 5'-TGGGATCGGTCACCACTAGAA-3' a Sense and antisense, respectively lymphocyte-specific protein tyrosi ne kinase (LCK); DNA damage repair and recombination protein 23B (RAD23B); and m ouse laminin receptor (MLR). Using Clontech’s recommended protocol, PCR was performed with Taq DNA polymerase (Boehringer Mannheim) with aliquot s removed at 22, 27, 32, and 37 cycles. PCR products were electrophores ed on a 1.5% agarose gel, which was then stained for 60 min with SYBR Green I (Molecular Probes, Eugene, OR) and scanned on the Storm Imager.

PAGE 47

34 Real-time Quantitative RT-PCR All primers and the TaqMan probe were designed us ing Primer Express software version 1.0 (PE Applied Biosystem s, Foster City, CA) and designed to overlap gene regions amplifi ed by Clontech’s primers. Primers were synthesized by Applied Biosystems and were (Table 1) for: mouse metallothionein-1 (MT1); MCL-1; LCK; RAD23B; and MLR. Primers and TaqMan probe for 18S rRNA gene were purchased from PE Biosystem s and used as the endogenous control for initial, total RNA abundance normalizations. All assays were performed using one-step RT-PCR reagents and a GeneAmp 5700 Sequence Detection System all from PE Applied Biosystems, and relative quantitation was computed from a 4-5-log range standard curve generated from 1:10, serial dilutions of tota l RNA. Samples were run in triplicate, and amplicon specificity for the SYBR assays confirmed by presence of a single peak in the first derivative of primer me lt curve analysis for each assay. Total RNA (~1-3 ng) isolated from individual, ei ther Znor ZnN, mice, again distinct from those used in array and semi-quant itative PCR experiments, was used for these confirmation exper iments. The MT1 TaqMan assay was performed using 900 nmol/L each of the forward and reve rse primers and 250 nmol /L of specific MT1 TaqMan probe. Whereas, the 18S rRNA TaqMan assay utilized 50 nmol/L forward and reverse primers and 200 nmol/L TaqMan probe, and all SYBR assays used 50 nmol/L forward and reverse primers.

PAGE 48

35 Western Analysis Whole thymus, isolated from either Zn or ZnN animals, was immediately homogenized in 20 mmol/L HEPES, pH 7.4; 500 mmol/L EDTA; 300 mmol/L mannitol; and 5% protease inhibitor co cktail (P2714; Sigma). Samples were centrifuged for 20 min at 100,000 g, and the membrane pellet was resuspended in the HEPES, pH 7.4, buffer. After a second brief (2 min) centrifugation at 250 g, supernatant was taken and the prot ein concentration was determined (Markwell et al. 1978). An equal amount of membrane fraction from each individual animal was pooled within tr eatment groups (n=7-10), resolved on a 10% SDS-PAGE gel, and then electroblott ed to Immobilon-P as previously described (McMahon and Cousins 1998). A monoclonal LCK antibody (Upstate Biotechnology, Lake Placid, NY) was the primary antibody (1 g/mL), and anti-mouse IgG horseradish peroxidase conjugate (Sigma) was the secondary antibody. Detection was by fl uorescence imaging using ECF (Amersham Pharmacia Biotech, Piscataway, NJ) and the Storm Imager. Statistical Analysis Food intake and body weight data were analyzed by repeated-measures ANOVA using mixed model me thodology (SAS Institute Inc. 1988). Comparisons between Znand ZnN treatment groups were by two-tailed Student t-test (Instat, Graphpad, San Diego, CA), with signifi cance established at p < 0.05.

PAGE 49

36 Results Dietary Protocol Initial diet studies included a zinc-adequate group pair-fed (PF) to zinc-deficient (Zn-) animals; however, 3 replicate diet studies (n=5/treatment group) showed that 3 weeks of dietary zinc restriction in these young adult outbred mice did not permute food intake (F ig. 2-1A) or body weight (Fig. 2-1B). Figure 2-1: Food intake and body weights of zinc-deficient (Zn-), pair-fed (PF) and zinc-normal (ZnN) mice. Animals were fed either <1 or 30 mg Zn/kg diet for 3 weeks. PF group received zinc-adequate diet. (A) Food Intake. (B) Body weights. Values are mean of n=15 in each group and represent 3 separate experiments. There were no significant differences seen between experiments or at any time point. Data were anal yzed by repeated meas ures ANOVA using mixed methodology. Consequently, the PF group was dropped from later experiments where comparison periods were of 3 weeks dur ation. Zinc homeostasis was assessed by 3 separate biochemical indices: seru m zinc, thymic MT1 mRNA, and pancreas MT protein levels, all of which were si gnificantly (P < 0.004) depressed in Znmice (Table 2-2) after 3 weeks on diet. 14710131619 0 1 2 3 4 5 6 Days ZnPF ZnN 171420 25 27 29 31 33 35 37 39 Days ZnPF ZnNAB 14710131619 0 1 2 3 4 5 6 Days ZnPF ZnN 171420 25 27 29 31 33 35 37 39 Days ZnPF ZnN 14710131619 0 1 2 3 4 5 6 Days ZnPF ZnN 171420 25 27 29 31 33 35 37 39 Days ZnPF ZnNAB

PAGE 50

37 Table 2-2: Zinc status indicators fo r zinc-deficient and zinc-normal mice Dietary Group Variable ZnZnN Serum zinc, mol/La 4.4 0.9b 12.8 1.5 Pancreas MT1 protein, g/g tissuea 5.4 1.9b 65.0 8.7 Thymus MT1 mRNA, relative unitsa 9.4 1.0c 15.4 1.4 Thymus weight, g/g bodyd 1.1 0.1 1.1 0.1 aValues are mean SEM, n = 5-10 b Significantly different fr om ZnN group (P < 0.0001) c Significantly different fr om ZnN group (P < 0.004) dValues are mean SEM, n = 23-24 (P < 0.945) Fluorescence Activated Cell Sorting An additional consideration for the di etary time frame was whether thymic atrophy had begun. Since our objective wa s to observe zinc-mediated changes in mRNA levels rather t han those resulting from alte rations in cell populations occurring during severe thymic involuti on, we used FACS analysis to examine the thymocyte populations expressing t he surface glycoproteins CD3, CD4, and CD8 (Fig. 2-2). FACS analysis establishe d that there was no cellular loss in the Znanimals nor were there any pertur bations in the primary developmental populations examined, which further subst antiated 3 weeks of zinc deficiency in these animals as modest in effect (Fig. 2-2). After 4 weeks of zinc deficiency there was a slight decrease in total number of CD3+ cells (data not shown); however, this was not significant. These data gave confidence that observed changes in mRNA abundance were due to zinc deficiency and not gross alterations in thymocyte populations.

PAGE 51

38 42 10 845 114 31 21 893 72 A B –Zn ZnN TotalCD3+CD3– 11 33 963 00 31 10 902 62 41 11 863 93 10 43 954 00 42 10 845 114 42 10 845 114 31 21 893 72 31 21 893 72 A B –Zn ZnN TotalCD3+CD3– 11 33 963 00 11 33 963 00 31 10 902 62 31 10 902 62 41 11 863 93 41 11 863 93 10 43 954 00 10 43 954 00 Figure 2-2: FACS analysis of Znand ZnN thymocytes. Isolated from Znor ZnN mice after 3 or 4 weeks of feeding, thymocytes were triple-stained with anti-CD3 PE, anti-CD4 FITC and anti-CD8 CyC. ( A ) Thymocytes were first gated (R1) on size and granularity (left panel). Quadrants were set on background fluorescence of isotype control mA bs (middle panel) and thymocytes were secondarily gated as CD3+ (R2) or CD3(R3) (right panel). ( B ) Representative CD4 vs. CD8 expression profiles for to tal (left panels), CD3+ (middle panels), and CD3(right panels) thymocytes from 3 week Zn(top row) and ZnN (bottom row) mice. Percentage of cells in each quadrant is the mean of 9-10 animals. No significant differences were seen in any s ubset after either 3 or 4 weeks (data not shown) of feeding.

PAGE 52

39 1 2 3 4 Figure 2-3: Densitometry output for Znarray relati ve to ZnN array using AtlasImage software. Each square is the location of 1 of 1185 cDNAs on the array. The 33P-labeled cDNAs used for hybridization were derived by reverse transcription of pooled (n=7) poly A+ RNA isolated from Znand ZnN mice. Gray represents cDNAs not det ected above background levels. Green represents equal expression between Znand ZnN (0.667 < ratio < 1.5, absolute difference < 2 background). Red indicates higher expression and blue indicates lower expression in Znmice. Individual squar es are divided in half, with top half exhibiting densitometric ra tio (Zn-/ZnN), and bottom half absolute difference (Znminus ZnN). Black indicates gene was not considered because of signal irregularities. Squares circled (fold c hange observed in Zn-/ZnN) are: 1. MCL-1 ( 0.6); 2. LCK ( 1.5); 3. MLR ( 2.3); 4. RAD23B ( 1.8). Analysis of cDNA Arrays Array hybridizations resulted in detection of ~230 cDNAs above background levels, very few of which demonstrated altered levels at this moderate level of zinc deficiency (Fig 2-3). Linear regression of normalized cDNA intensities from both groups (Fig. 2-4) established a trendline equation of y=1.087x+10 and a correlation coefficient of R2=0.988, further highlighting the similarity of expression levels bet ween Znand ZnN animals. This tight correlation also illustrates the lack of experimental noise in this animal model, which increased the probability that cDNAs deviating from the line of normality

PAGE 53

40 10 100 1000 10000 100000 101001000100001000001 2 3 4 Zn-Adjusted IntensitiesZnNAdjusted Intensitiesy = 1.087x + 10 R2= 0.988 10 100 1000 10000 100000 101001000100001000001 2 3 4 Zn-Adjusted IntensitiesZnNAdjusted Intensitiesy = 1.087x + 10 R2= 0.988 Figure 2-4: Scatter plot of adjusted int ensities for detected genes from ZnN array vs. Znarray. Middle line is identity (y=x); from which these data deviated minimally, as demonstrated by trendline equation y=1.087x+10 and correlation coefficient R2=0.988 derived by linear regression. Top and bottom lines represent y=1.5x and 0.667x respecti vely. Circled are genes confirmed as zinc-modulated: 1. MCL-1; 2. LCK; 3. MLR; 4. RAD23 were not spurious. Those cDNAs demonstr ating greater than a 1.5-fold change were considered as candidates for post hoc confirmation. Circled (Figs. 2-3 and 2-4) are those confirm ed as zinc-modulated: 1. MCL-1; 2. LCK; 3. MLR; 4. RAD23B. RT-PCR Confirmations of Differ ential Gene Expression. The initial confirmation of zinc-regula ted candidates identified by cDNA array analysis was by semi-quantitativ e RT-PCR using the same Clontech primers that were used to produce the cDNA fragment spotted on the array. However, RT-PCR was performed using p ooled total RNA derived from Znand ZnN mice from a separate diet study rather than the RNA used for the array experiments. This qualitative assessm ent confirmed the upregulation of LCK,

PAGE 54

41 MLR LCK RAD23 GAPDH ZnZnN 37 32 27 22 37 32 27 22 MLR LCK RAD23 GAPDH ZnZnN 37 32 27 22 37 32 27 22RAD23B, and MLR, compared to identical expression of GAPDH (Fig. 2-5). Subsequently we chose to design primer s for use in real-time quantitative RT-PCR (Q-PCR), which permits more accurate quantification from the exponential phase of PCR amplification and the use of individual rather than pooled samples, in order to accurately qua ntify these perturbatio ns in expression. The results from Q-PCR (Fig. 2-6), perfo rmed using RNA from individual animals (n=5-10) independent of those used in previous experiments, confirmed zinc-mediated modulation for all 4 genes, wit h the greatest intragroup variation, expected as a heterogeneous response to a pathology, seen in the zinc-deficient mice. Figure 2-5: Semi-quantitative RT-PCR confirmation of zinc-modulated cDNAs identified by array analysis. RT-PCR was performed on pooled (n=5) total RNA isolated from other Znor ZnN mice wit h aliquots removed after 22, 27, 32, 37 cycles for resolution on a 1.5% agaros e gel and subsequent visualization by SYBR Green I staining and fluorescence imaging. Arrows point to linear region of PCR amplification where differences in expression are visible.

PAGE 55

42 MCLLCKRADMLR ZnN (Array) Zn(Array) ZnN (Q-PCR) Zn(Q-PCR)Relative Abundance** *2.5 1.0 2.0 1.5 0.5 0 MCLLCKRADMLR ZnN (Array) Zn(Array) ZnN (Q-PCR) Zn(Q-PCR)Relative Abundance** *2.5 1.0 2.0 1.5 0.5 0 Figure 2-6: Comparison of relative expr ession of four genes based on array and real-time quantitative RT-PCR (Q-PCR) da ta. Q-PCR was performed on total RNA isolated from individual Znand ZnN mice. Relative quantities were calculated using 18S rRNA as an endogenous control. Q-PCR values are mean SEM of 5-10 animals normalized to mean of Zn N animals. *P = 0.02; **P = 0.07.Western Analysis of LCK Thymus Protein. The previous identification of the zinc-binding LCK protein as elevated in zinc-deficient peripheral lymphocytes ( Lepage et al. 1999) prompted our further investigation of thymic LC K protein abundance in mice from our dietary study. Western analysis of LCK protein after 3 weeks of deficiency demonstrated a 1.8-fold increase in LCK protein abundance in the Znmice (Fig. 2-7) relative to ZnN mice. Discussion This reports the first expression prof iling of zinc-deficient thymus. Given the hypothesis that the detrimental effe cts of severe zinc deficiency on the thymus and T-lymphocyte populations may have their genesis in primary

PAGE 56

43 Relative Protein Abundance0 0.5 1.0 2.0 2.5 1.5 Zn–ZnNLCK Zn–ZnN Relative Protein Abundance0 0.5 1.0 2.0 2.5 1.5 Zn–ZnNLCK Zn–ZnN Figure 2-7: Western analysis of thymic LC K protein levels. Equal amounts of thymus total membrane preparations from individual, either Znor ZnN, animals were pooled (n = 7-10) within trea tment groups and resolved on a 10% SDS-PAGE gel. LCK protein was detec ted with an anti-LCK monoclonal antibody and chemiluminescence. Relative abundance is the mean variance of five replicate lanes for each treatment. Insert shows repres entative lanes for both (Znand ZnN) membrane preparations after western analysis. Arrow points to a single 56 kDa band for LCK protein. alterations in thymic gene expression, th e dietary protocol was designed to be moderate with the goal of ident ifying initial, rather than consequential, changes in mRNA populations. These studies used outbred, young adult male mice that were fed either zinc-deficient or zinc-a dequate diet for three weeks. This time period was sufficient to depress multiple bioc hemical indices of zinc status in the zinc-deficient animals, namely serum zinc pancreas MT protein, and thymic MT1 mRNA levels. Notably, there were no al terations in feeding behavior or growth rate, which permitted the exclusion of the pa ir-fed group traditionally used in zinc feeding studies. The fact that MT1 mRNA levels were significantly depressed in the thymus of the zinc-def icient mice was evidence that this level of zinc

PAGE 57

44 deficiency was sufficient to repress the expression levels of a gene recognized as directly regulated by zinc supply. Th is increased the likelihood of detecting other mRNAs influenced by dietary zinc using this approach. Having established the dietary framewor k for the transcriptional analysis of zinc-deficient murine thymus, cDNA a rrays containing cDNAs from 1185 genes with identified roles in cellular physiol ogy were utilized. The moderate dietary treatment was underscored by the very cl ose correlation between the expression profiles of the Znand ZnN mice. Nonetheless, at this level of in vivo zinc deficiency, array screening identified seve ral potential zinc-regulated candidates. These were confirmed as zinc-regulated using two different RT-PCR techniques and independent animal populations. Identif ied by array screening and confirmed as zinc-responsive were (relative to Zn N): myeloid cell leuk emia sequence-1, found depressed (0.6); DNA damage r epair and recombination protein-23B, found elevated (1.8); the m ouse laminin receptor, also elevated (2.3); and lastly the lymphocyte-specific protein tyrosine kinase, also found elevated (1.5). Several factors prompted the examinati on of potential candidates with less than a twofold change. Firs tly, recognition that t he twofold designation is arbitrary, and often dictated by signal to noise ratio, which in this system was extremely high. Secondly, previous re search (Blanchard and Cousins 2000, Lee et al. 1999) has shown that nutriti onal effects on gene expression in vivo are smaller in nature than those associ ated with development or oncogenic transformation. This is further supported by the statistical sign ificance of the 40% reduction in thymic MT1 mRNA observed in th is study. Thirdly, this approach to

PAGE 58

45 array analysis was based also on previous research with differential display (Blanchard and Cousins 1996). Specifically, the display/array is considered as a primary screening tool, and only mRNA’s whose zinc modulation is confirmed independently are reported as differentially expressed. However, perhaps the most compelling reason to exami ne cDNAs showing less than a twofold difference was the array identification of a 1.5-fold increase in LCK mRNA in the zinc-deficient animals. This lymphocyt e-specific protein tyrosine kinase associates with the cytoplasmic tail of the CD4 receptor through thiol-mediated tetrahedral coordination of a Zn2+ ion (Huse et al. 1998). In addition, the LCK protein was previously identified by Lepage and coworkers (1999) as up-regulated in murine splenic lymphocytes during dietary zinc deficiency. These two aspects of LCK expression/function su ggested that the 1.5-fold increase observed in our system was worthy of further investigation. The array conformation data demonstrat e that smaller fold changes in mRNA populations can be reproducible, and support the hypothesis that not exploring a less than twofold difference in expression may preclude changes with functional significance from considerati on. Indeed, (Tusher et al. 2001), in developing a method for statistical analys is of microarray data, articulated inadequacies `with “fold change” analysis. These authors show that the low signal-to-noise ratio seen at low levels of expression, where most genes are expressed, means that twofold changes occur randomly for a large percent of genes and is associated with a false discovery rate of 81%. Furthermore, they propose for genes expressed at higher abun dance, stoichiometrically smaller

PAGE 59

46 changes in gene expression are likely to be significant but are rejected from consideration by a twofold cutoff. In the array experimen ts described here, genes detected were predominantly those ex hibiting medium to high expression levels and very low noise was encountered. While the functional significance associated with these observed, reproducible, changes in mRNA and protein abundances in zinc-deficient thymus will be further defined by additional re search, currently several intriguing observations can be made regarding identified roles for these genes and the potential for a zinc-mediated interaction. Clearly, as LCK is dependent 0n zinc for its cytosolic binding, and therefore dow nstream signal transduction, of both the CD4 and CD8 co-receptors (Huse et al. 1998) it emerges as a candidate likely to be influenced directly by zinc s upply. As a lymphocyte-specific protein tyrosine kinase, LCK plays an essential role in the T-cell receptor-linked signal transduction pathways associated with peripheral T-lymphocyte activation (Straus and Weiss 1992), and is expressed in the thymus at all stages of thymocyte development. Furthermore, fr om studies in LCK knockout mice, it appears critical for the selection and ma turation of developing thymocytes (Molina et al. 1992). Dietary zinc insufficiency has al ready been reported to increase expression of LCK in peripheral splenic T-lymphocytes (Lepage et al. 1999) and, in this report, evidence is provided fo r its modulation, bot h at the mRNA and protein levels, by dietary zinc supply in developing thymocytes. It is plausible that a disruption of the zinc-mediated interaction between LCK and the CD4/CD8

PAGE 60

47 co-receptors in the cytosol results in a feedback signal to upregulate LCK mRNA expression. Such a signal disruption prov ides a potential mechanism for the zinc deficiency-associated loss of developing th ymocytes, and is worthy of future study. Alternatively, the recent identificat ion of a Kruppel-type zinc-finger protein, mt, as the essential transcriptional activator required for thymus-specific expression of LCK (Yamada et al. 2001) pr ovides another potential mechanistic avenue to explain the observed zinc-medi ated increase in LCK mRNA levels reported here. Of particular relevanc e is that a reduction in thymic metallothionein expression is concomitant with other alterations observed. Metallothionein, acting as a zinc donor/acce ptor, could be a factor in decreasing the availability of zinc nece ssary for LCK/CD4, LCK/CD8 binding, as has been proposed (Lin et al. 1998), or for zinc nece ssary for structure/function of the mt transcription factor (a functi on envisioned from the experi ments of Roesijadi et al. 1998). For the remainder of the zinc-modulated tr anscripts identified in this study, a direct zinc interaction is not immediat ely apparent. MCL-1 is a member of the apoptosis-related BCL-2 family of protei ns originally isolated as an early induction gene from human myeloid cells (Kozopas et al. 1993). It forms heterodimers preferentially wi th pro-apoptotic BCL-2 family members (Leo et al. 1999) and induction of MCL-1 is associated wi th a rapid and transient increase in cell viability suggestive of a permi ssive environment for hematopoietic differentiation (Townsend et al. 1999). Re cently, two independent investigations have shown that alternative splicing of the mcl-1 human gene, skipping exon 2,

PAGE 61

48 results in a protein variant having pro-apopt otic function (Bae et al. 2000, Bingle et al. 2000). As both sets of our primer s were designed for an amplicon within the 3' untranslated region of the MCL-1 transcript, wh ich variant is affected cannot be predicted. However, the d epression of MCL-1 mRNA observed in these experiments supports a role for a poptosis in zinc deficiency-associated lymphopenia, paralleling data regarding t he halt of B-lymphocyte development through apoptotic mechanisms in the bone marrow of zinc-deficient mice (Osati-Ashtiani et al. 1998). While there is relatively little known about the mouse laminin receptor (MLR), it is relevant to note that increased protein ex pression of both MLR and MCL-1 have been defined as immunohistochem ical markers of tumor metastatic potential. Moreover, MLR is associated wi th preleukemic thymuses (Verlaet et al. 2001) and MCL-1 with thymic carcinom as (Chen et al. 1996, Dorfman et al. 1998). However, MLR, a 67 kDA protein expr essed on the cell surface, is formed through the dimerizing of its cytoplasmic precursor, a 37-40 kDa protein found tightly associated with the 40S ribosome: the LBP/p40 (laminin binding protein precursor p40) (Sato et al. 1999). Hi ghly conserved, the yeast homologues Rps0A and Rps0B are essential components of the 40S ribosomal subunit (Ford et al. 1999) implying a role fo r the LBP/p40 in translation. Similarly, RAD23B (also MHR23B for mouse homologu e to RAD23B), identified as a nucleotide ex cision repair gene product in Saccharomyces cerevisiae, has evolved additional functions in mammals (Hiyama et al. 1999). Expressed constitutively in all tissues, RA D23B interacts with the regulatory, S5a

PAGE 62

49 subunit, domain of the 26S proteasome th rough its N-terminal ubiquitin-like domain (Hiyama et al. 1999, van der Spek et al. 1996). In addition, very recent experiments have revealed a RAD23B interaction with ubiquitin, which is mediated by its duplicated, highly conser ved, C-terminal ubiquitin-associated domain (Bertolaet et al. 2001). This supp orts other experiments indicating that RAD23B inhibited multi-ubiqu itin formation and proteoly tic degradation (Ortolan et al. 2000). Although a direct zinc-medi ated interaction is not immediately apparent, in light of zinc’s structural role for so many proteins and previous data identifying the proteasomal ATPase as in creased in zinc-deficient small intestine (Blanchard and Cousins 2000), it is nonet heless interesting to identify the RAD23B transcript as up-regul ated in this context. In summary, this research ident ifies by cDNA array analysis and subsequent RT-PCR confirmations, 4 mRNA transcripts significantly modulated by a moderate level of in vivo zinc deficiency although there was no general reduction in RNA transcription levels. In particular, one of th ese, LCK, mediates signal transduction through the CD4 and CD8 receptors through a cytosolic, zinc-dependent interaction. These data show that both LCK mRNA and protein levels are elevated in zinc-deficient mu rine thymus before the onset of thymic involution as detectable by FACS analysis. The thymic genes, found dysregulated here, may be factors in init iation of the lymphopenia and thymic atrophy associated with severe zinc deficiency.

PAGE 63

50 CHAPTER 3 DIFFERENTIAL mRNA DISPLAY OF ZINCDEFICIENT, ZINCNORMAL AND ZINC-SUPPLEMENTED MURINE THYMUS Introduction These experiments, using differential mRNA display for identifying dietary zinc-mediated changes in thymic gene transcr iption, were initially begun before the array experiments, and then reinitia ted. Consequently, the experiments outlined exemplify the current rapid evol ution of molecular methodology. In planning these protocols before the firm establishment of our dietary zinc deficiency model, one of the primary appeals of different ial display (DD) was its accommodation of multiple treatment groups. Hence, earlier displays include a pair-fed (PF) group and later displays do not. This advantage of DD also permitted the inclusion of a zinc-supplemen ted group (Zn+; receiving ~six fold more zinc than ZnN animals), in additi on to the Znand ZnN groups described previously. The following results demonstr ate that, in mice, moderate changes in the dietary amounts of a si ngle trace element can reproducibly alter specific mRNA abundances in the thymus. Genes i dentified as sensitive to thymic zinc supply implicate functional consequences, wh ich are intriguing in light of zinc's molecular role in mediating prot ein structure, and hence function.

PAGE 64

51 Materials and Methods Feeding Studies Young adult (303 grams), male CD-1 mice (C harles River, Wilmington, MA) were housed individually in hanging stainless steel cages with a 12-hour light/dark cycle and free access to distilled, de-ionized water. Animals were initially acclimated to a purified AIN-76a-based (America n Institute of Nutrition 1977) pelleted diet containing 5 mg /kg diet (Research Diets, New Brunswick, NJ) for 3-5 days. Subsequently, animals we re randomly assigned to one of three dietary groups: zinc-deficient (Zn-, <1 mg /kg), zinc-normal (Z nN, 30 mg /kg), and zinc-supplemented (Zn+, 180 mg /kg) for a three week feeding period. After which, beginning at 0900, animals were anesthetized with halothane and killed by cardiac puncture and exsanguination. Blood was collected for measurement of serum zinc concentration by flame at omic absorption spectrophotometry, and whole thymus (~250 mg) was excised and homogenized in 4 mL TRIpure reagent (Boehringer Manheim, Indianapolis, IN). RNA Isolation and Differential Di splay RT and PCR Reactions Thymic total RNA was isolated accordi ng to the manufacturer's directions. RNA concentrations were determined spec trophotometrically and integrity was verified by agarose electrophoresis and Ethi dium Bromide (EtBr) staining. Equal amounts of RNA were pooled from mice (n =7) within treatment groups and the pooled samples were DNase treated using Ambion's DNA-free kit (Austin, TX). For these experiments, the HIEROGLYPH mRNA profile kits (Beckman Coulter, Fullerton, CA) were utilized for differential display RT and PCR

PAGE 65

52 reactions. In total, these included 12 anchored 3' primers (AP1-12), and 20 arbitrary 5' primers (ARP120), which together are predicted to comprehensively screen an entire mammalian mRNA pool (Bauer et al. 1993). Anchored primers (APs), or T7oligo(dT12)MN primers, were 31 nucl eotides (nts) long, anchored upstream by 2 nts, and incorporated a T7 RNA polymerase-derived site downstream for aid in future amplification and sequencing reactions (Table 3-1). Table 3-1: Anchored primers used for di fferential display RT and PCR reactions Primer Sequence AP1 5'-GTAATACGACTCACTATAGGGCTTTTTTTTTTTTGA-3' AP2 5'-GTAATACGACTCACTATAGGGCTTTTTTTTTTTTGC-3' AP3 5'-GTAATACGACTCACTATAGGGCTTTTTTTTTTTTGG-3' AP4 5'-GTAATACGACTCACTATAGGGCTTTTTTTTTTTTGT-3' AP5 5'-GTAATACGACTCACTATAGGGCTTTTTTTTTTTTCA-3' AP6 5'-GTAATACGACTCACTATAGGGCTTTTTTTTTTTTCC-3' AP7 5'-GTAATACGACTCACTATAGGGCTTTTTTTTTTTTCG-3' AP8 5'-GTAATACGACTCACTATAGGGCTTTTTTTTTTTTAA-3' AP9 5'-GTAATACGACTCACTATAGGGCTTTTTTTTTTTTAC-3' AP10 5'-GTAATACGACTCACTATAGGGCTTTTTTTTTTTTAG-3' AP11 5'-GTAATACGACTCACTATAGGGCTTTTTTTTTTTTAT-3' AP12 5'-GTAATACGACTCACTATAGGGCTTTTTTTTTTTTCT-3' The upstream arbitrary primer s (ARPs) were 26 nts long a nd incorporated a 16 nt M13-reverse priming site (Table 3-2). For reverse transcription, the pooled, DNase treated RNA (~0.1 g) from each treatment group was incubated with 2 mol/L of specific AP at 70oC for 5 min, and immediately placed on ice. A master mix was added with final concentrations of 2 Units/L SuperscriptII RNase Hreverse transcriptase (Invitrogen, Carlsbad, CA), 50 mmol/L Tris-HCl, 75 mmol/L KCl, 3 mmol/L MgCl2, 10 mmol/L dithiothreitol, and 25 mol/L each, dNTPs. Fi rst strand synthesis reactions proceeded in a thermocycler wi th a heated lid (MJ Research, Waltham,

PAGE 66

53 Table 3-2: Arbitrary primers used fo r differential display PCR reactions Primer Sequence ARP1 5'-AGCGGATAACAATTTC ACACAGGACGACTCCAAG-3' ARP2 5'-AGCGGATAACAATTTC ACACAGGAGCTAGCATGG-3' ARP3 5'-AGCGGATAACAATTTC ACACAGGAGACCATTGCA-3' ARP4 5'-AGCGGATAACAATTTC ACACAGGAGCTAGCAGAC-3' ARP5 5'-AGCGGATAACAATTTC ACACAGGAATGGTAGTCT-3' ARP6 5'-AGCGGATAACAATTTC ACACAGGATACAACGAGG-3' ARP7 5'-AGCGGATAACAATTTC ACACAGGATGGATTGGTC-3' ARP8 5'-AGCGGATAACAATTTC ACACAGGATGGTAAAGGG-3' ARP9 5'-AGCGGATAACAATTTC ACACAGGATAAGACTAGC-3' ARP10 5'-AGCGGATAACAATTTC ACACAGGAGATCTCAGAC-3' ARP11 5'-AGCGGATAACAATTTC ACACAGGAACGCTAGTGT-3' ARP12 5'-AGCGGATAACAATTTC ACACAGGAGGTACTAAGG-3' ARP13 5'-AGCGGATAACAATTTC ACACAGGAGTTGCACCAT-3' ARP14 5'-AGCGGATAACAATTTC ACACAGGATCCATGACTC-3' ARP15 5'-AGCGGATAACAATTTC ACACAGGACTTTCTACCC-3' ARP16 5'-AGCGGATAACAATTTC ACACAGGATCGGTCATAG-3' ARP17 5'-AGCGGATAACAATTTC ACACAGGACTGCTAGGTA-3' ARP18 5'-AGCGGATAACAATTTC ACACAGGATGATGCTACC-3' ARP19 5'-AGCGGATAACAATTTC ACACAGGATTTTGGCTCC-3' ARP20 5'-AGCGGATAACAATTTC ACACAGGATCGATACAGG-3' MA); reactions were initiated at 42oC for 5 min, went to 50oC for 50 min, 70oC for 15 min and then were held at 4oC. Subsequent PCR amplification reactions were done in triplicate for each treatment group and each anchored and arbitr ary primer pair combination. Using 2 L of the appropriate RT reac tion products (AP and zinc -treatment specific) for template and 0.05 Units/L Taq DNA polymerase (Roche Indianapolis, IN) with supplied buffer, PCR reactions ha d final concentrations of 0.2 mol/L for each AP and ARP primers, 20 mol/L each of the dNTPs and 0.125 Ci/L [33P]dATP. Cycling parameters were: 95oC for 2 min; 4 cycles of: 92oC for 15 sec, 50oC for 30 sec, and 72oC for 2 min; 25 cycles of: 92oC for 15 sec, 60oC for 30 sec, and 72oC for 2 min; 72oC for 7 min; then reactions were held at 4oC.

PAGE 67

54 Denaturing Polyacrylamide Gel Electrophoresis After addition of a denaturing loading dye (95% formamide) and a 2 min, 95oC heat step, PCR products were th en electrophoresed under two separate conditions using a Genomyx LR DNA sequencing in strument (Beckman Coulter, Fullerton, CA) under parameters opt imized for differential display. In order to resolve longer cDNAs, DD r eaction products were run for 16 hr at 1,500V/100W/50oC, through a 340 m thick, 4.5% acrylamide gel matrix containing urea as the denaturant (Be ckman Coulter, Fullerton CA). For resolution of shorter cDNAs, a 6% gel matrix was used, and products were electrophoresed at 2,700V/100W/50oC for 2 hr. Utilization of a 96-well sharks toothcomb typically permitt ed the loading of 6-7 AP and ARP pair combinations simultaneously. When runs were finish ed, the plates were separated. Separation was facilitated by pretreatment of the bottom plate with 4N NaOH and the top plate with a siliconizing glass sh ield (Beckman Coulter, Fullerton CA). With the gel attached to the bottom plate, 3 cycles of rinsing and drying were performed in order to remove the urea. After the fi nal drying step, the DD gel was exposed to single emulsion Kodak Biom ax film (Fisher, Houston, TX) for display visualization. Identification, Excision and Re-amp lification of Differential cDNAs Differential expression between treatme nt groups was evaluated visually on the autoradiograph. Criteria for defining a band zinc-modulated were pronounced differences between treatment groups, consistency among triplicate reactions and higher overall abundances. Excised bands were also ranked "#1"

PAGE 68

55 or "#2" for prioritizing the order of re-amp lification reactions. In this subjective assessment, "#1" bands were those show ing the largest magnitude of change and highest cDNA expression. Chosen ban ds were excised from the gel by aligning the autoradiograph with the gel, on top of a lightbox. The band's position on the gel (marked with pencil from alignment with autoradiograph) was circumscribed with a sterile scalpel. Less than 1 L of sterile H20 was used to rehydrate the circumscribed band, whic h was then excised and placed in 100 L of TE. Later studies added an additional 1X PCR buffer (10 mmol/L Tris-HCl, 1.5 mmol/L MgCl2, 50 mmol/L KCl) to the TE, in light of data from Frost and Guggenheim (1999) demonstrating a benefit in preventing depurination and therefore improving downstream re -amplification reactions. Re-amplification and preparation of cDNAs for sequencing procedures evolved over the course of these experimen ts. Initially, cDNAs were re-amplified, sub-cloned into a pPCR-Script Amp SK( +) plasmid vector, transformed into ultracompetent cells (Stragene, La Jolla, CA), grown on Luria Bertani broth plates, and plasmid DNA then isolated fo r sequencing (Figure 3-1). This sub-cloning was performed, in part, to generate a cDNA for labeling and hybridization in Southern and northern confirmation anal yses. In addition, the possibility of multiple, different cDNAs migrating to the same place on the differential display exists, and this can be ef fectively identified by sub-cloning and Southern analyses. Figure 3-2 illustrat es this phenomenon; a particular DD band, 10,7,2, was sub-cloned, and eight pl asmid subclones (labeled A-H) were isolated and restriction digested. S ubsequent Southern anal ysis using plasmid

PAGE 69

56 Zn ZnN Zn+ Excise band & elute 1. ReamplificationPCR 2. Selective precipiation 3. Polish Ligate into plasmid vecto r pCRScript ( Stratagene ) DD insert Transform into bacteria Isolate plasmids ( Qiagen plasmid prep) Radiolabel whole plasmid fo r Northern/Southern blot analysis 1. Choose clones (restreak) 2. Incubate 2X 4mlcultures overnight Freezer stock 1. Restriction digests 2. Gel electrophoresis Confirmation of DD regulation by Northern blot analysis If confirmed(!) Sequence Determination of clone heterogeneity by Southern blot analysis * Zn ZnN Zn+ Excise band & elute 1. ReamplificationPCR 2. Selective precipiation 3. Polish Ligate into plasmid vecto r pCRScript ( Stratagene ) DD insert Isolate plasmids ( Qiagen plasmid prep) Radiolabel whole plasmidfo r Northern/Southern blot analysis 1. Choose clones (restreak) 2. Incubate 2X 4mlcultures overnight 1. Restriction digests 2. Gel electrophoresis Confirmation of DD regulation by Northern blot analysis If confirmed(!) Sequence Determination of clone heterogeneity by Southern blot analysis * Figure 3-1 Original re-amplification, subcloning and isolation procedures for putatively regulated ESTs. Those DD band s exhibiting zinc-modulation were excised, elutriated and used as template for re-amplification PCR. After ligation to a plasmid vector, ultracompetent cells were transformed and bacteria grown on plates. Subclones were chosen for plas mid isolation and restriction digests. Clone heterogeneity was determined by So uthern blotting and zinc regulation confirmed by northern blot analysis prior to sequencing. clone 10,7,2A as the cDNA probe revealed that this cDNA only hybridized to plasmid clones 10,7,2C and 10,7,2A, demonstrat ing that the other clones

PAGE 70

57 A B C D E F G H pPCRScript 10,7,2 reamp products Hybridized with 10,7,2-A A B C D E F G H A B A B C D E F G H pPCRScript 10,7,2 reamp products Hybridized with 10,7,2-A A B C D E F G H A B(B, D-H) represent at a mi nimum, one other cDNA (Fig ure 3-2). These results also dictate that several northerns would be required to “fish” out the zinc-modulated cDNA illustrated in the original display. The use of Q-PCR for differential display confirmations however precludes the need for a cDNA probe. In this context, the throughput of di rectly sequencing PCR products became advantageous, as most DD bands do repres ent a single species. Direct sequencing of re-amplified cDNAs is facilitat ed by the use of universal, full-length M13 (-48) 24-mer and T7 promot er 22-mer primers for re-a mplification reactions. Use of these primers [M13: 5'-A GCGGATAACAATTTCACACAGGA-3' and T7: 5'-GCCCTATAGTGAGTCGTATTAC-3'] stream lines the re-amplification process as they also eliminate the need to use the specific AP and ARP combination that generated the differential cDNA initially. In re-initi ating the DD analyses with availability of Q-PCR inst rumentation, an alternate experimental protocol, outlined in Figure 3-3, was used. Figure 3-2. Example of subclone hetero geneity and Southern analysis. After cloning DD band 10,7,2 eight bacterial colonies were chosen for plasmid isolation. (A) Autoradiograph of EtBr stained restriction digests of colonies A-H (B) Southern blot of restriction digest hy bridized to radiolabeled cDNA 10,7,2-A demonstrating homology of colonies A and C.

PAGE 71

58 Pooled Thymus RNA ZnZnN Zn+ RT; AP3 PCR; AP3 + ARP1 PAGE Excise PCR Sequence BLAST 3,1,1 3,1,1 3,1,2 Alignment of 311 to ref|XM_144450.1| Mus musculus similar to dJ1189B24.4 (novel PUTATIVE protein similar to hypothetical proteins S. pombe C22F3.14C and C. elegans C16A3.8) (LOC243171), mRNA Length = 4383 Score = 321 bits (162), Expect = 2e-85 Identities = 172/176 (97%) Strand = Plus / Plus Query: 2 tctactaccaagtgggccttgtngtgggctgccttcatctataggaagtntgtgtaaatt 61 ||||| |||||||||||||||| |||||||||||||||||||||||||| |||||||||| Sbjct: 3597 tctacaaccaagtgggccttgtagtgggctgccttcatctataggaagtatgtgtaaatt 3656 Query: 62 agatgagagcagtgctgaggaggccgacaaatcacgagaaagatctcagtgtgctgtgaa 121 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Sbjct: 3657 agatgagagcagtgctgaggaggccgacaaatcacgagaaagagctcagtgtgctgtgaa 3716 Query: 122 agctgctaataaagcttccagtgtcacaccaaaagggaatttaagcaatggaaaca 177 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3717 agctgctaataaagcttccagtgtcacaccaaaagggaatttaagcaatggaaaca 37723,1,1 matches 3’ UTR of cDNA for uncharacterized, putative protein (Acc# XM_144450) Pooled Thymus RNA ZnZnN Zn+ RT; AP3 PCR; AP3 + ARP1 PAGE RT; AP3 PCR; AP3 + ARP1 PAGE Excise PCR Sequence BLAST 3,1,1 3,1,1 3,1,2 Alignment of 311 to ref|XM_144450.1| Mus musculus similar to dJ1189B24.4 (novel PUTATIVE protein similar to hypothetical proteins S. pombe C22F3.14C and C. elegans C16A3.8) (LOC243171), mRNA Length = 4383 Score = 321 bits (162), Expect = 2e-85 Identities = 172/176 (97%) Strand = Plus / Plus Query: 2 tctactaccaagtgggccttgtngtgggctgccttcatctataggaagtntgtgtaaatt 61 ||||| |||||||||||||||| |||||||||||||||||||||||||| |||||||||| Sbjct: 3597 tctacaaccaagtgggccttgtagtgggctgccttcatctataggaagtatgtgtaaatt 3656 Query: 62 agatgagagcagtgctgaggaggccgacaaatcacgagaaagatctcagtgtgctgtgaa 121 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Sbjct: 3657 agatgagagcagtgctgaggaggccgacaaatcacgagaaagagctcagtgtgctgtgaa 3716 Query: 122 agctgctaataaagcttccagtgtcacaccaaaagggaatttaagcaatggaaaca 177 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3717 agctgctaataaagcttccagtgtcacaccaaaagggaatttaagcaatggaaaca 37723,1,1 matches 3’ UTR of cDNA for uncharacterized, putative protein (Acc# XM_144450) Figure 3-3. Revised experimental approach to differential display. Re-amplification reactions were run with 2 L of gel band eluate (1/2X template in a 40 L), 2X PCR buffer (Roche, Indianapolis, IN), 20 M each dNTPs, 0.2 M each M13 and T7 primers and 0.05 U/L Taq Polymerase (Roche). Cycling parameters were 95oC for 2 min; 4 cycles of: 92oC for 15 sec, 50oC for 30 sec, 72oC for 2 min; 25 cycles of: 92oC for 15 sec, 60oC for 30 sec, 72oC for 2 min; 72 oC for 7 min; and then reactions were held at 4oC. The optimization genera lly required for amplif ication of any one DNA template by PCR was not practically possible for the number of DD bands excised in these experiments. Our strat egy then, involved an initial assessment of template capacity for re-amplific ation, and the number of PCR products

PAGE 72

59 produced by the re-amplification reaction Robust reactions that produced a single PCR product were pursued for sequencing. To assess quality of the reactions, 2 L of re-amplification products were electrophoresed in a 1.5% agarose, 1X TBE gel, stained with SYBR Green I (Molecular Probes, Eugene OR) and scanned on a Storm Imager (Molecular Dynami cs, Piscataway, NJ). For obtaining sufficiently concentrated PCR product for sequencing, reactions were then repeated under identic al conditions in nine 40 l reactions (using DNA in the original gel band eluate for temp late). Reaction products were purified together (over the same column) usin g QIAquick PCR purification columns (Qiagen, Valencia, CA), and eluted in 30 L 10 mmol/L Tris-Cl, pH 8.5. Then, 2 L of the purified cDNA was electrophores ed in a 1.5% agarose/1X TBE gel with mass and base pair markers. After staini ng with EtBr and photographing to establish purification and concentration, the DD cDNA was sent for sequencing at the University of Florida's ICBR Sequencing Core. Upon return of sequence information, the Genbank databases (Benson et al. 2002) were queried using the BLAST algo rithm of Altschul and others (1997), running from the web-based, SeqWeb (version 2.02) platform for the Wisconsin Package (Accelrys, San Diego, CA) software. Independent Confirmation by No rthern or Q-PCR Analyses For northern blotting, total RNA (~15-20 g), from either individual animals or equally pooled treatment groups, wa s electrophoresed for 1 hr in a 1% Agarose/1X MOPS/2.2 mol/L formaldehyde gel. After ~30 min of rinsing in H2O, RNA was capillary transferred to nylon membrane (NEN, Boston, MA) overnight

PAGE 73

60 using 10X SSPE (1.8 mol/ L NaCl / 0.1 mol/L NaH2PO4 / 0.01 mol/L EDTA) as transfer buffer. Transfer to membrane was confirmed by UV visualization of EtBr stained ribosomal bands, and then RNA was UV crosslinked to membrane (Hoefer Scientific Instruments, San Franc isco, CA). For nort hern hybridization, cDNAs (within pPCR-Script Amp SK(+) pl asmid vector) were radiolabeled with [-32P]dCTP (NEN, Boston, MA) usin g DNA labeling beads (Amersham Pharmacia Biotech, Piscataway, NJ). Membranes were pr e-hybridized for 2 hr at 55oC in 8 mL hybridization buffer [1% BSA / 0.5 M NaH2PO4, pH 7.2 / 1 mmol/L EDTA / 7% SDS], to which probes were added to a final concentration of 2 X 106 cpm/mL. After ~18 hr hybridization at 55oC, membranes were washed and exposed to x-ray film. Scanned images were analyzed densitometrically using Bioimage (Ann Arbor MI) Intelli gent Quantifier software. Real-time Q-PCR primers and fluore scent resonance energy transfer (FRET) probes for select DD cDNA conf irmations (Table 3-3) were designed using Primer Express software version 2. 0 (PE Applied Biosyst ems, Foster City, CA), and synthesized by BioSource Inter national (Camirillo, CA). Primers and the TaqMan probe for 18S rRNA, used fo r total RNA normalization, were purchased from PE Biosystems, as were all one-step RT-PCR reagents. Assays were performed on a GeneAmp 5700 Sequenc e Detection System (PE Applied Biosystems). Relative quant itation was determined from 4-5 log range standard curves and pooled samples (n=7/treatment group) were run in triplicate. The 18S TaqMan assay was performed using 50 nm ol/L each forward primer, reverse

PAGE 74

61 primer, and TaqMan probe; all other assa ys used 900 nmol/L each of the forward and reverse primers, and 250 nm ol/L of the FRET probe. Table 3-3: Primers and FRET probes for Q-PCR Gene Accession Primer/Probea TCCR NM_016671 5'-GGGAGCCCAGGGATAAAGG-3' 5'-TGAGCCCAGTCCACCACATAC-3' 5'-CAATGGTTTCCTGGTCCCTTGTTTCCA-3' Hsp40 NM_008298 5'-AATGGAGAAGCGTATGAGGATGA-3' 5'-ACTGGCCCATTAAGAGGTCTGA-3' 5'-CACCCCAGAGGTGGCGTTCA-3' Hsp60 X53584 5'-TTGCCCTTATCAATGAACTGTGA-3' 5'-TCAGTCATTTTCTCCAGGTGACTTC-3' 5'-CTCAAGGCAGGTTCCTCACCAATAACTTCAG-3' Hsc70 BC006722 5'-GCTGCCGGGCATTCG-3' 5'-CCTTAGACATGGTTGCTTGTGTGTAG-3' 5'-TGGTCTCGTCGTCAGCGCAGCT-3' H2-A BC0019721 5'-GGCCTTGTGGGCATCGT-3' 5'-TCTGGAGGTGCCACCTGATC-3' 5'-TGGGCACCATCTTCATCATTCAAGGC-3' aRespectively: forward, reverse, and TaqMan probe Results Feeding Studies For these experiments, an additional zinc-supplemented (Zn+) group was added. The mice in this group received ap proximately six times the quantity of zinc in the ZnN purified diet. Undersco ring the moderate natur e of the threeweek feeding protocol was the lack of significa nt differences in terminal body and thymus weights between treatment groups (T able 3-4). Serum zinc levels in Znanimals were significantly depressed to 30% of ZnN animals (P < 0.0001), but were unchanged in Zn+ mice. Similarly, Znanimals had depressed, 66% of normal thymic MT1 mRNA levels; how ever, Zn+ animals also showed no changes in MT1 mRNA relative to the ZnN animals.

PAGE 75

62 Table 3-4: Animal status indicators for zinc-deficie nt, zinc-normal and zinc-supplemented mice Dietary groupa,b Variable ZnZnN Zn+ Serum, mol/L 5.0 0.3c 16.1 0.4 15.1 0.7 Thymus MT1 mRNA, relative unitsd66.3 100 102.1 Terminal body weight, mg 33. 7 1.3 37.8 0.8 36.2 1.1 Thymus weight, g/kg body 1.01 0.5 1.04 0.1 1.02 0.1 aMice were fed either <1 (Zn-), 30 (ZnN ), or 180 (Zn+) mg Zn /kg diet for 3 wk bValues are mean SEM, n= 5-10 animals cDifferent from ZnN and Zn+ (P < 0.0001) dDerived from Q-PCR on pooled sample s; expressed relative to ZnN Reproducibility of DD RT and PCR Reactions Reaction products from AP3 and ARPs 2 and 3 were generated in two separate months and subjected to denatur ing PAGE. Profiles were markedly similar in banding patterns (Figure 3-4) demonstrating gross reproduction of DD RT and PCR reactions. Furthermore, when sequenced independently, five differential bands: 2 from the “October gel”, number's 3,3,1 and 3,3,2; and three from the “November gel”, hypothesized to be 3,3,1b, 3,3,2b, and a lower band dubbed 3,3,3; were all identified as the same cDNA. Found overexpressed in Zn+ animals relative to Znand ZnN counterparts by differential display (Figures 3-5, A-1 and A-2), this cDNA code d for mitochondrial NADH dehydrogenase subunit 2 (NADH:ubiquinone oxidoreductase; mt-Nd2). Differential Display Eight of 12 possible dT12MN anchored primers, in combination with 20 arbitrary primers, were used to generate di fferential mRNA displays of thymic

PAGE 76

63 Figure 3-4. Differential display RT and PCR reaction reproducibility. The same pooled thymic total RNA from Zn-, ZnN and Zn+ animals was reverse transcribed and amplified using AP3 and ARPs 2 and 3 (Beckman Coulter) and subjected to 4.5% denaturing PAGE for 16 hrs in tw o separate months: October (A) and November (B) of 2001. Pointing to sele ct, comparable transcripts are letters a and a' through l and l'. transcription in Zn-, ZnN and Zn+ mice. These 160 primer pair combinations produced an approximate 32,000 interpretable bands, which were resolved over ~50 long-run denaturing polya crylamide gels. Presuming an estimated 15,000

PAGE 77

64 ABZn-ZnNZn+ 3,3,1 3,3,2 3,3,1b 3,3,2b 3,3,3Zn-ZnNZn+ ABZn-ZnNZn+ Zn-ZnNZn+ 3,3,1 3,3,2 3,3,1b 3,3,2b 3,3,3Zn-ZnNZn+ Zn-ZnNZn+ transcribed genes in any one cell-type, and considering the statistical requirements to represent ea ch mRNA transcript by at least one cDNA on a gel from a single primer pair (Bauer et al. 1993) conservatively this should represent at least a 66% screen of the th ymic transcriptome under these dietary conditions. Of the ~32,000 bands surveyed, 153 bands appearing differentially regulated by zinc treatment were excised for further investigation. This group represented bands meeting our priority criter ia of "#1" or "#2". Of these 153 cDNAs, 73 (almost 50%) appeared up-regulat ed in Znanimals and another 40 (27%) were down-regulated by Zntrea tment, and the remaining 40 cDNAs were modulated by Zn+ (15 increased and 25 decreased in Zn+ animals). Those cDNAs, which had a #1 priority and that were successfully re-amplified, Figure 3-5. AP3 and ARP3 differentia l displays generated on two separate occasions. The same pooled thymic tota l RNA from Zn-, ZnN and Zn+ animals was, in October (A) and November (B), reverse transcribed with AP3 and then amplified using AP3 and ARP3 (Beckman Coulter). Reaction products were electrophoresed in 4.5% polyacrylamide for 16 hr. Numbered bands appearing up-regulated in Zn+ animals were excis ed and sequenced. All were homologues of slightly different lengths coding for mitochondrial NADH dehydrogenase subunit 2 (appendices B-4 and B-5). T he designation of the bands 3,3,1b and 3,3,2b was done before sequencing and the “b” reflects prediction of identity.

PAGE 78

65 sequenced and identified by BLAST, are list ed in Tables 3-5 (increased by Zntreatment), 3-6 (decreased by Zn-) and 3-7 (decreased in Zn+ mice), with corresponding data in appendices B, C and D respectively. Of the bands sequenced thus far, only one, the aforementioned mitochondrial NADH dehydrogenase subunit 2 (mt-Nd2), belongs in an “increased by Zn+” group. In addition to those identified by homology to existing entries in the sequence databases, four other band sequences were determined to be novel EST's, and an additional four produced multiple genomic hits after database querying, but no characterized genes. Two from this last group are presumed L1 repeat elements and will be addressed further in the discussion section. Table 3-5: Differential display transcrip ts increased in zinc-deficient mice Namea Band idb # of ntsc % Identity Accessiond T cell cytokine receptor** (TCCR) 2,17,1 373 99% NM_16671 T cell cytokine receptor** (TCCR) 2,17,2 359 99% NM_16671 Similar to dJ1189B24.4* 3,1,1 247 97% XM_144450 Apoptosis inhibitor 5* (Api5) 7,11,1 469 99% 96% XM_123850 NM_007466 Mitochondrial 12S rRNA** 10,7,2G 349 100% NC_001569 Similar to hypothetical protein FLJ20274*** 9,7,1A 559 99% NM_145585 aAsterisks indicate whether transcripts were *untested, **confirmed, or ***did not confirm DD prediction by alternate methodology bDesignation of clone: AP, ARP, band cut and (if letter) a subclone cSequence, identities and DD images are presented in appendix B dWhen possible RefSeq (non-redundant curated data, Pruitt and Maglott 2001) accessions are used; here NM_ designa tes curated mRNAs, XM_ designates model mRNAs corresponding to genomic contigs, NC_ designates chromosomes/complete genomes

PAGE 79

66 Table 3-6: Differential display transcrip ts decreased in zinc-deficient mice Namea Band idb # of ntsc % Identity Accessiond Heat shock cognate protein 70** (Hsc70) 2,4,2 718 100% BC006722 Heat shock cognate protein 70** (Hsc70) 2,4,3 756 99% BC006722 Hematopoietic stem cell (Lin-/c-Kit-/Sca-1-) cDNA* (dbEST)e 2,14,1 291 100% 100% 100% BM244188 BM244095 BM243664 Retrotransposon L1Md-A101 pORF2* and L1Md-A2 repetitive element ORF2* 3,1,4 500 98% 98% AY053456 M13002 DnaJ homolog, subfamily A-1** (heat shock protein 40) 3,2,4 477 99% NM_008298 Histocompatibility 2, class II antigen A, alpha** (H2-A) 9,6,1 729 97% BC019721 Heat shock protein 60 kDa** (Hsp60) 10,7,2D 392 99% XM_109908 aAsterisks indicate whether transcripts were *untested, **confirmed, or ***did not confirm DD prediction by alternate methodology bDesignation of clone: AP, ARP, band cut and (if letter) a subclone cSequence, identities and DD images are presented in appendix C dWhen possible RefSeq (non-redundant curated data, Pruitt and Maglott 2001) accessions are used; here NM_ designates curated mRNAs; all others are archival accessions, which can not be changed by 3rd party, but eventually will be curated eMatches from Genbank EST database (rather than non-redundant database) Confirmation of Select DD Clones Initial confirmations of DD data we re done using pooled RNA samples for northern blotting with the radiolabel ed DD clone/EST/cDNA of interest, then

PAGE 80

67 Table 3-7: Differential display transcrip ts decreased in zinc-supplemented mice Namea Band idb # of ntsc % Identity Accessiond Similar to matrin cyclophilin* (matrin-cyp) 2,8,1 96 90% XM_130275 Ribosomal protein L28*** (Rpl28) 3,8,2C 320 99% NM_009081 Hypothetical gene supported by accession BC010584* and M similar to putative protein kinase* 3,7,1 585 99% 99% XM_129835 XM_110350 Ribosomal protein L3* (Rpl3) 3,7,2 156 100% NM_013762 Axonemal dynein heavy chain 8 short form** (Dnahc8) 7,6,2G 316 99% AF356521 Cleavage & polyadenylation factor 5, 25kDa subunit* (Cpsf5) 7,13,1 770 99% NM_026623 H3 histone, family 3A* (H3f3a) 7,20,1 785 98% XM_147791 aAsterisks indicate whether transcripts were *untested, **confirmed, or did not confirm DD prediction by alternate methodology bDesignation of clone: AP, ARP, band cut and (if letter) a subclone cSequence, identities and DD images are presented in appendix D dWhen possible RefSeq (non-redundant curated data; Pruitt and Maglott 2001) accessions are used; here NM_ designa tes curated mRNAs, XM_ designates model mRNAs corresponding to genomic contigs, others are archival accessions that cannot be changed by 3rd party, but eventually will be curated sequencing the DD clones that confirmed zinc-regulation. Then northern blots with RNA from individual animals (n=5 -6/treatment group) were examined for expression variation among groups (Figure 3-6). In order to interpret results the technical limitations of northern hybridizat ion must be noted. Extensive sample manipulation, lengthy hybr idization times and the lim itations of detection sensitivity all work to provide data that are sometimes inconclusive, or at best,

PAGE 81

68 semi-quantitative. In exam ining the expression of three DD clones (3,8,2C; 9,7,1A; 10,7,2D) and MT in individual Zn-, ZnN and Zn+ animals by northern blotting (Figures 3-6 and 3-7) high variat ion associated with this technique is apparent. Conclusions were that 3,8,2C (R ibosomal protein L28, Rpl28; Figure D-2) and 9,7,1A (similar to hypothetical pr otein FLJ20274; Figure B-5) were not zinc-regulated. However, 10,7,2D (heat shock protein 60, Hsp60; Figure C-6) was found significantly decreased in zinc-deficient animals and with a magnitude of change comparable to MT. A closer inspection of the data is illu strative. The DD band 9,7,1 appeared markedly increased in Znanimals on the DD (Figures 3-4, B-5), but the pooled and individual northern blots to DD clone 9,7,1A did not mirror this; a further example of the clone heterogeneity illu strated in Figure 3-2. The autoradiographs of 9,7,1A expression are e xcellent examples of northern blots that required lengthy exposure times, due to lower message abundance, in contrast to 3,8,2C expre ssion, which was readily detected and easily analyzed (Figure 3-7). In the ca se of DD band 3,8,2, both t he pooled and individual northerns showed decreased 3,82C/Rpl 28 expression in Zn+ animals, in agreement with the DD (Figures 3-7, D-2). Statistically (P=0.11) 3,8,2C was not confirmed as zinc-regulated, however l ooking at the autoradiographs for the northern blots it is apparent t hat the 18S hybridization co ntributed to the deviation of the ZnN mean. The Hsp60 and MT leve ls in Znanimals were significantly different from ZnN and Zn+ animals (P < 0.05). Yet, due to a low number of animals per treatment and high deviati on this "statistical" significance was

PAGE 82

69 Figure 3-6. Relative densit ometric analyses of northern bl ots for select DD clones and MT. (A) 3,8,2C / Rpl2 8 (B) 9,7,1A (C) 10,7,2 D / Hsp60 and (D) MT. Northern blots with total thymic RNA from individual (n=5-6) Zn -, ZnN, Zn+ mice were hybridized with DD clones, then st ripped and rehybridized with a cDNA probe for 18S rRNA, the normalization c ontrol. Relative units are mean SD and are calibrated to ZnN = 1. For Hsp60 (C) and MT (D) Znanimals are different from ZnN and Zn+ (P < 0.05) using Kruskal-Wallis nonparametiric ANOVA with Dunn's multiple comparisons of median. only achieved using either data transforma tion or a Kruskal-Wallis test, which tests nonparametric medians. The vari ation, limits of message detection, particularly in the thymus, and the m ediocre throughput of northern blotting 0 0 .2 0 .4 0 .6 0 .8 1 1 .2 1 .4 1 .6 1 .8 0 0 .2 0 .4 0 .6 0 .8 1 1 .2 1 .4 1 .6 1 .8Zn-ZnNZn+ 3,8,2C / Rpl28 0 0 .2 0 .4 0 .6 0 .8 1 1 .2 1 .4 1 .6 1 .8Zn-ZnNZn+ 9,7,1AA D C B 0 0 .2 0 .4 0 .6 0 .8 1 1 .2 1 .4 1 .6 1 .8Zn-ZnNZn+ Zn-ZnNZn+ 10,7,2D / Hsp60 MT1.8 1.6 0.8 0.6 0.4 0.2 0 1.4 1.2 1.0 1.8 1.6 0.8 0.6 0.4 0.2 0 1.4 1.2 1.0 1.8 1.6 0.8 0.6 0.4 0.2 0 1.4 1.2 1.0 1.8 1.6 0.8 0.6 0.4 0.2 0 1.4 1.2 1.0Relative Densitometric Units (cDNA/18S rRNA)* 0 0 .2 0 .4 0 .6 0 .8 1 1 .2 1 .4 1 .6 1 .8 0 0 .2 0 .4 0 .6 0 .8 1 1 .2 1 .4 1 .6 1 .8Zn-ZnNZn+ 3,8,2C / Rpl28 0 0 .2 0 .4 0 .6 0 .8 1 1 .2 1 .4 1 .6 1 .8Zn-ZnNZn+ 9,7,1AA D C B 0 0 .2 0 .4 0 .6 0 .8 1 1 .2 1 .4 1 .6 1 .8Zn-ZnNZn+ Zn-ZnNZn+ 10,7,2D / Hsp60 MT1.8 1.6 0.8 0.6 0.4 0.2 0 1.4 1.2 1.0 1.8 1.6 0.8 0.6 0.4 0.2 0 1.4 1.2 1.0 1.8 1.6 0.8 0.6 0.4 0.2 0 1.4 1.2 1.0 1.8 1.6 0.8 0.6 0.4 0.2 0 1.4 1.2 1.0Relative Densitometric Units (cDNA/18S rRNA) 0 0 .2 0 .4 0 .6 0 .8 1 1 .2 1 .4 1 .6 1 .8 0 0 .2 0 .4 0 .6 0 .8 1 1 .2 1 .4 1 .6 1 .8Zn-ZnNZn+ Zn-ZnNZn+ 3,8,2C / Rpl28 0 0 .2 0 .4 0 .6 0 .8 1 1 .2 1 .4 1 .6 1 .8Zn-ZnNZn+ Zn-ZnNZn+ 9,7,1AA D C B 0 0 .2 0 .4 0 .6 0 .8 1 1 .2 1 .4 1 .6 1 .8Zn-ZnNZn+ Zn-ZnNZn+ Zn-ZnNZn+ 10,7,2D / Hsp60 MT1.8 1.6 0.8 0.6 0.4 0.2 0 1.4 1.2 1.0 1.8 1.6 0.8 0.6 0.4 0.2 0 1.4 1.2 1.0 1.8 1.6 0.8 0.6 0.4 0.2 0 1.4 1.2 1.0 1.8 1.6 0.8 0.6 0.4 0.2 0 1.4 1.2 1.0 1.8 1.6 0.8 0.6 0.4 0.2 0 1.4 1.2 1.0 1.8 1.6 0.8 0.6 0.4 0.2 0 1.4 1.2 1.0 1.8 1.6 0.8 0.6 0.4 0.2 0 1.4 1.2 1.0 1.8 1.6 0.8 0.6 0.4 0.2 0 1.4 1.2 1.0Relative Densitometric Units (cDNA/18S rRNA)* *

PAGE 83

70 Figure 3-7: Comparison of DD and no rthern analyses. Compared were DD bands 3,8,2 (A) and 9,7,1 (B). For each band, the DD is marked by arrow, below which are northern blots from pooled sample s (n=5-7/treatment group) hybridized to DD clones then 18S. Below the pooled northern blots are blots run with RNA from individual animals within each tr eatment group. Graphs in upper right corners are dens itometry (mean SD) of individual northern blots for clones normalized to 18S. Results are not statisti cally significant although 3,8,2C, found decreased in Zn+ animals by DD and bot h northern blots, had a P = 0.11. ZnPF ZnN Zn+ Zn-ZnNZn+ 3,8,2 3,8,2C 18S 3,8,2C 18S 0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 1.8Zn-ZnNZn+3,8,2C/18S1.8 1.0 0 9,7,1A 18S 9,7,1A 18S ZnPF ZnN Zn+ Zn-ZnNZn+ 9,7,1 0 0 .2 0 .4 0 .6 0 .8 1 1 .2 1 .4 1 .6 1 .8Zn-ZnNZn+9,7,1A/18S1.8 1.0 0A B ZnPF ZnN Zn+ Zn-ZnNZn+ 3,8,2 3,8,2C 18S 3,8,2C 18S 0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 1.8Zn-ZnNZn+3,8,2C/18S1.8 1.0 0 0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 1.8Zn-ZnNZn+ Zn-ZnNZn+3,8,2C/18S1.8 1.0 0 9,7,1A 18S 9,7,1A 18S ZnPF ZnN Zn+ Zn-ZnNZn+ 9,7,1 0 0 .2 0 .4 0 .6 0 .8 1 1 .2 1 .4 1 .6 1 .8Zn-ZnNZn+ Zn-ZnNZn+9,7,1A/18S1.8 1.0 0A B

PAGE 84

71 0 0.5 1 1.5 2 MTH40H60H70H2AaTCCR ZnZnN Zn+MT H40 H60 H70 H2A TCCR 2.0 1.5 1.0 0.5 0Relative Quantities 0 0.5 1 1.5 2 MTH40H60H70H2AaTCCR ZnZnN Zn+MT H40 H60 H70 H2A TCCR 2.0 1.5 1.0 0.5 0Relative Quantities Figure 3-8: Q-PCR analyses of sele ct DD clones and MT. Assays were performed on triplicate pooled total RNA samp les (n=7/group) from Zn-, ZnN and Zn+ mice. Relative quantity calculati ons used 18S rRNA as the endogenous normalization control. Va lues are mean of three pool ed assays calibrated to ZnN. (weeks) prompted a switch to Q-PCR (day s) for secondary expression analyses, with its availability. Five identified DD bands were chosen based on function for follow-up confirmation using Q-PCR (Figure 3-8): heat shock protein 40 (H40; Figure C-4); heat shock protein 60 (H60; Figure C-6) ; heat shock cognate 70 (H70; Figure C-1); histocompatibility 2, class II antigen A, alpha (H2A; Figure C-5), and the T-cell cytokine receptor (TCCR; Figure B-1) In all cases, the zinc-modulation observed on the differential displays was r eplicated. Interestingly, for all three heat shock proteins, depression of expre ssion was seen in both Znand Zn+ animals (Figure 3-5), alt hough the depression seen in Zn+ was not to the extent observed in the Znanimals.

PAGE 85

72 Discussion This research presents a snapshot of differential gene expression produced in the thymus in response to altera tions in dietary amou nts of the trace element zinc. Thymic gene expression in response to zinc-restriction (Zn-) was clearly of interest because of the well -described immunodeficiency that follows severe dietary zinc deficiency. The decision to examine the thymic gene expression response to a three week diet ary zinc-supplementation is perhaps less obvious. In part, this choice was dict ated by feasibility as differential display does accommodate multiple tr eatment groups. Additionally, as the perspective on nutritional requirements moves from goals of identifying the minimal levels of nutrients required to prevent deficiency sy ndromes, to goals of describing optimal nutrient requirements for chronic disease prevention, it has become important to have data on physiologic responses to a range of intake levels for dietary nutrients. This is underscore d by the tolerable upper level (UL) value for a safe intake now contained within the Institute of Medicine's dietary reference intakes (Panel on Micronutrients et al. 2002). Furt hermore, in the case of zinc, the widespread use of zinc lozenges and zinc-supplemented functional foods marketed for immune enhancing properties, wa rrants scientific scrutiny on the outcomes of zinc-supplementation. The objective was to identify gene tr anscripts modulated after three weeks of either dietary zinc restriction or suppl ementation. This three week time period arose from earlier studies, which estab lished that three weeks of feeding a zinc-deficient diet to six-week old, male CD1 mice produced a moderate level of

PAGE 86

73 deficiency, but one that w ould nonetheless produce alterations in thymic gene expression (Moore et al. 2001). It is relevant to note that the choice of a DD approach to identify zinc-modulated gene expression in murine th ymus was made temporally at the beginning of the genomic revolution. Arra y analysis had recently been described (Schena et al. 1995, Shalon et al. 1996); however, the sequencing races had yet to heat up and databases were more limited Remarkably, the advantages to differential display articulated in 1997 still exist. It is recognized that transcription analyses are slanted in favor of constitu tively expressed, stable, higher abundance messages (Gmuender 2002, Matz and Lukyanov 1998). While also true to some extent for DD, use of all 12 APs in combination with all 20 ARPs statistically confers greater probability that all mRNAs (expressed in that condition/time/cell type), should be represent ed at least once after amplification to a level of detection by PCR (Bauer et al. 1993). Additionally, DD does not require the a priori sequence information 0n which arrays are dependent. This means DD has the capacity to find novel EST data, both contributing to the sequence databases and holding the potential for gene discovery. Sequencing initiatives for the mouse and human genome are well along the way towards meeting initial objectives (Marshall 2001) and, in the process, are providing substantial info rmatic resources for array design. However, the availability of arrays for researchers working with organisms other than the top priority model systems is limited and so for them and others, DD

PAGE 87

74 remains a powerful tool for both sequence acquisition and assessing differential gene expression in a variety of fields (Liang 2002). Criticized as technically laborious and artifact prone, a decade of DD optimization and commercial ap plications has reduced these concerns (Buess et al. 1997, Matz and Lukyanov 1998, Sung and Denman 1997). For example, the use of APs and ARPs tagged with universal sequences streamlines re-amplification procedures, reducing the workload associated with subcloning for sequencing. The availability of opt imized RT and DD reaction parameters and PAGE conditions (Hieroglyph kits, Be ckman Coulter) are improvements that contributed to the choice of DD application for this study. This decision was validated with the demonstration of DD, RT and PCR reaction reproducibly, to the extent of producing an i dentifiable, regulated cDNA of a particular length at two different times (Figures 3-4, 3-5). The genes identified as zinc-modulated are a small subset of the total observed on, and excised from, the DDs orig inating from reverse transcribed and amplified Zn-, ZnN and Zn+ total thymic RNA. The 153 excised bands observed by DD as altered by animal dietary zinc st atus, represent a very small percentage of total surveyed transcripts (~32,000 inte rpretable bands) illustrating the modest nature of the dietary treatm ents utilized in these studies. The majori ty of bands excised (~75%) were influenced by zincdeficiency, 73 found up-regulated and 40 found down-regulated in the Znanimals relative to the ZnN animals. Among the 73 bands demonstrating increased message abundance in Znwere the five sequenced and identified in th is report (Table 3-5). Included were

PAGE 88

75 cDNAs for the T-cell cytokine receptor (TCCR), an apoptosis inhibitor (Api5), mitochondrial 12S rRNA and messages for “h ypothetical” proteins. The latter is a term the National Center fo r Biotechnology Information ( NCBI) uses to define a gene supported by genomic sequence dat a rather than experimental or functional data. The dataset of five genes with increased message abundance in the Znmice (Table 3-5) serves as a good example of how follow-up experimental decisions were made. Pr acticality dictated that functionally uncharacterized cDNAs, such as bands 3,1,1 and 7,11,1, the hypothetical proteins, were not pursued. The identific ation of mitochondrial 12S rRNA, while at first alarming, was explained both in the use of total RNA, rather than polyA+ RNA, for DD, RT and PCR reaction templates and the long tract of polyAs within the 12S rRNA gene upon which AP anneali ng for amplification occurred. Although this amplificati on was unintentional, noneth eless its zinc-modulation was confirmed independently. Further more, 12S rRNA was one of two mitochondrial transcripts identified as alter ed by zinc status in this study. The other transcript, mitochondrial NA DH dehydrogenase subunit 2 (mt-ND2) increased in Zn+ animals (Figure 3-5). As a side note, this increase in mt-ND2 is interesting in conjunction with recent data finding that neuronal death in response to excess zinc induced a loss of NAD+ and energy failure (Sheline et al. 2000). On the other hand, TCCR, when identifi ed as a putatively zinc-modulated transcript, immediately became a candi date for Q-PCR assay design and confirmation analyses. Independently cloned by separate industrial groups, both research groups demonstrated highest TC CR expression in the thymus and

PAGE 89

76 peripheral blood lymphocytes among tiss ues examined (Chen et al. 2000, Sprecher et al. 1998). There is relatively little known about th is “orphan” cytokine receptor belonging to the class I family of receptors. This family includes receptors for the interleukins and poeitic gr owth factors such as thrombopoietin, erythropoietin and leptin, and is defined by a common, conserved, extracellular cytokine binding domain (Sprecher et al 1998). Existing data from TCCR knockout mice imply this receptor is essential for development of Th1 immune responses in vivo (Chen et al. 2000, Yoshida et al. 2001). These data precipitated our interest, given resear ch suggesting an aberrant Th1/Th2 balance in zinc deficiency (Beck et al. 1997a, 1997b, Prasad 1991). Differentiation of naive CD4+ T-lymphocytes into armed effe ctor Th1 or Th2 cells occurs in the periphery, so the function of TCCR in t he thymus is currently unknown. LCK serves as an example of a T-lymphocyte sp ecific protein with functions, directing differentiation and activation, in both the thymus and periphery. The LCK protein was found up-regulated in both the peripher y and thymus by zinc deficiency in mice (Lepage et al. 1999, Moore et al. 2001). Future research should characterize the function of TCCR in the thymus and clarify the zinc interaction noted in this study. Lastly, within the “i ncreased in zinc deficiency” dataset, the Api5 up-regulation observed on the DD awaits confirmation. Its identification is interesting in light of previous data (F raker et al. 2000, Kolenko et al. 2001, Shankar and Prasad 1998), suggesting links between zinc and apoptosis, and zinc-deficiency and lymphopenia.

PAGE 90

77 Most striking among the thymic transcrip ts identified sensitive to dietary zinc status were three s eparate heat shock proteins, Hsp40, Hsp60 and Hsc70, all down-regulated in the Znanimals (T able 3-6). Using different AP and ARP combinations, Hsp60 was identified first and initially confir med by northern blotting (Figure 3-6), then Hsp40 and H sc70 were identified as also down-regulated in the Znanimals. Q-P CR assays were devised for all three heat shock proteins. Consequently, Hsp60 se rves, next to MT ou r sentinel gene, as a gene whose zinc-regulation has been re-t ested by multiple techniques in animals from multiple diet studies. Results confirmed the DD-observed decreases in Znanimals, and also rev ealed decreased, albeit less pronounced, message abundance in Zn+ animals that had not been observed on the semiquantitative DD (Figure 3-8). Heat shock proteins were initially nam ed for their cellular induction by high temperature and other stress-induced pr otein denaturing conditions. More recently, the homeostatic function of these cellular proteins is identified as the chaperoning of nascent polypeptides, through de novo folding, into accurate native conformations (reviewed by Fryd man 2001). It is now appreciated that initial biochemical kinetic studi es of protein folding done in vitro are not relevant in the macromolecular crowding of the eukar yote cell (Minton 2001). In this vein, protein assembly in vivo has more recently been described as co-translational folding, with molecular chaperones/heat s hock proteins functioning in 'assisted self-assembly' (Ellis and Hartl 1999). In other words, the protein contains all information within its primary sequence for assumption of its native tertiary

PAGE 91

78 structure, but it is the c haperones that protect nascent vectorial peptides, either coming off the ribosome or translocat ing across organellellar membranes, from forming improper intermediate structur es driven by hydrophobic or other interactions (Ellis and Hartl 1999, Frydman 2001). From a physiological perspective, it is particularly interesting to note which heat shock proteins were found down-r egulated in these experiments by both dietary zinc treatments (Hsc70, Hsp40 and Hsp60), especially in the context of the characterized functions for these diffe rent chaperone familie s. Briefly, the Hsc70 protein is a constitutively express ed, rather than a heat-inducible, member of the Hsp70 family, and is one of the mo st abundant soluble proteins in the mammalian cell (Petersen et al. 2001). A small (70 kDA) ATPase, Hsc70 binds hydrophobic segments on nascent polypept ide chains in an ATP-dependent fashion (Bukau and Horwich 1998). Studies done in Escherichia coli have shown that Hsp40 serves as a co-factor in the Hsc70-substrate interaction by increasing ATP hydrolysis from Hsc70 (Ellis and Hart l 1999). Hsp40 is a chaperone in its own right by virtue of its C-terminal subs trate-binding domain, which interestingly contains two essential, cysteine-rich zi nc-binding domains (Frydman 2001). Lastly, in contrast to the cellular Hsc70/Hsp40 systems, which co-translationally protect hydrophobic regi ons of nascent polypeptides in the cytoplasm, Hsp60, a member of the large (>800 kDa) barrel-shaped chaperonin family, functions within the mitochondrial matrix (reviewed in Hartl and Neupert 1990). Chaperonins are remarkable cell ular machines that orchestrate oligomeric assembly of proteins in an ATP-dependent manner. This appears to

PAGE 92

79 occur through chaperonin's conformation changes, which expose its alternate hydrophobic and hydrophilic interior surf aces as the protein substrate is encouraged to form its native structure (Bukau and Horwich 1998). In the mitochondria, Hsp60 functions to mediate tr anslocation, folding and assembly of the multiple (>700) polypeptides that ar e coded in the nuclear genome but that function in the mitochondria. These peptid es/proteins function, possibly as part of large multimeric complexes, in t he mitochondria, and as such must be imported and exported (Hartl and Neupert 1990). Other chaperonins, TCP-1 and CCT function in the cytosol, but within this research these, along with the members of the Hsp90 family who chaperone the steroid hormone receptors and protein kinases, have not been id entified as zinc-modulated. Also confirmed by Q-PCR as decreased in zinc-deficient mice (Table 3-6, Figures 3-5 and C-5), DD band 9,6,1 code s for a subunit of the mouse major histocompatibility complex (MHC) class II receptor, termed hi stocompatibility 2, class II antigen A, alpha (H2-A). The H2-A peptide is one of three (antigens A, E and M) possible subunits for the MHC class II molecules in mice, and is encoded within the H-2 gene structure located on chromosome 17. MHC molecules require both and and subunits for cell surface expression and in the thymus, interactions between MHC receptors and the TCR/co-receptors of developing thymocytes mediate posit ive and negative selection processes (Janeway et al. 2002). MHC class I mole cules present to CD8+ T-cells and MHC class II molecules present to the CD4+ T-ce lls. The development of MHC class II knockout mice, which produce no CD4+ T-ce lls showed in vivo that CD4+ T-cell

PAGE 93

80 development is dependent on thymic MHC cla ss II expression (Cosgrove et al. 1991, Grusby et al. 1991). The H2-A mRNA was found by DD and confirmed by Q-PCR as down-regulated in Znmice. Although premature it is tantalizing to speculate about a potential mechanism involving H2-A that might contribute to either, the lymphopenia of zinc deficien cy, or the pathogen-specific increased susceptibility to infectious disease seen secondary to a zinc deficiency. Beyond speculation, it can be noted from the data that, while al l heat shock proteins were found by Q-PCR depressed in bo th Znand Zn+ animals, H2-Awas depressed in Znbut elevated in Zn+ animals. Within the transcripts decreased in Zn mice (Table 3-6) were a couple that were not followed by post hoc confirmation testing, DD band 2,14,1, a functionally uncharacterized cDNA, and DD band 3,1,4, which generated multiple genomic hits. Among the listed homologi es to the 3,1,4 BLAST query were matches to a section of open reading fram e (ORF2) found within A-type, long interspersed nuclear elements (LINE-1 or L1). The L1 repeat elements are retrotransposable elements that lack t he long terminal repeat sequences characteristic of retroviruses and retr otransposons (Furano 2000). Ranging between 5000-7000 base pairs, L1 repeats move by reverse transcription. There is an estimated 100,000 L1 repeats and an enormous amount of L1 fragments littered throughout the mouse genome (Hardi es et al. 2000). Subtypes of L1 repeats are defined by unique 5' ends, the A, F and V types, which are believed to have amplified in separat e evolutionary waves. Of these, the F and V types are thought to be ancestral and extinct and the A subtype was thought to be the

PAGE 94

81 youngest until recent descriptions of a hy brid TF subtype which is currently actively expressing and retrotransposing (H ardies et al. 2000, Saxton and Martin 1998). The sequence data for DD band 3,1,4 (Fi gure C-3) shows the region of L1 ORF2 amplified by the AP and ARP primers, but unfortunately tells little else, as this region is highly homologous betw een L1 subtypes. For this reason, confirmation of zinc-modulation for 3,1,4 wa s not attempted. However, an earlier DD band 10,8,1A, which was found up-regulated in Zn+ by northern blot, when sequenced and BLAST queried, also retur ned multiple genomic hits among which were identities to L1 repeat elem ents (data not shown). Furthermore, Muga and Grider (1999) using DD report ed expression of a human LINE1 in acrodermatitis enteropathica [autosomal recessive, congenital zinc deficiency] fibroblasts. These data currently seem di sparate, 3,1,4/L1 decreased in Zn-, 10,8,1B/L1 increased in Zn+, and a human LINE1 increa sed in Zn-. However, future studies may reveal cause and effect. Other identified transcripts decreased in Zn+ mice (Table 3-7) together suggest alterations in mRNA processing. Included are: an mRNA cleavage and polyadenylation factor; a H3 histone; and matrin cyclophin, an RNA splicing factor and chaperone located in the nuclear matrix. Additiona lly, decreased in Zn+ were transcripts for tw o ribosomal proteins, Rpl28, which is relatively uncharacterized and Rpl3, which is essent ial for peptidlytransferase activity (Hampl et al. 1981, Noller 1993).

PAGE 95

82 In conclusion, these DD data and a ssociated confirmation analyses revealed multiple mRNA transcripts altered by dietary zinc status in adult murine thymus after only three weeks feeding. Although datasets are not complete, some generalities may be noted. Remarkabl y, no metalloenzymes or zinc-finger transcription factors were identified zi nc-modulated in this study. Genes identified appear to be "housekeeping" in nat ure, involved in mRNA processing and translation. Chaperones for RNA, nascent peptides and mitochondrial proteins were identified as cDNAs changed with dietary zinc status. As were cDNAs for an H3 histone, a polyadenylati on and cleavage factor, ribosomal RNA, ribosomal proteins and an apoptosis inhibito r. Specific immune function related genes showing zinc-sensitive expression were a subunit of the MHC class II molecule, H2-Aa, and the T-cell cytokine receptor. These genes with altered thymic expression after only three weeks of altered zinc status may hold potential as sensitive biomarkers of human zinc status.

PAGE 96

83 CHAPTER 4 SUMMARY, SPECULATIONS AND FUTURE DIRECTIONS The primary aims of this research we re to characterize a murine model of moderate zinc deficiency, and to identif y genes differentially expressed in the thymus of zinc-deficient (Z n-) mice relative to animals fed adequate zinc (ZnN). Secondary goals were to also screen fo r differentially expressed genes in animals fed a moderately zinc-supplem ented (Zn+) diet, and to confirm independently a select group of g enes demonstrating zinc-modulation. As this project evolved, opportunities arose to utilize several technical approaches. For expression pr ofiling, both cDNA array analysis and differential display (DD) were used. Secondary co nfirmations used northern hybridization and Q-PCR for mRNA measurements, and western analysis was utilized for measuring protein abundances. The duplicat ion of results within individual techniques, and comparisons of data deriv ed from multiple methodologies, showed good reproducibility in identifying zinc-induced molecular changes within the thymus. Three weeks feeding either zinc-deficient or zinc-supplemented diets to young adult male mice were sufficient to alter specific RNA abundances in the thymus. Decreased in the Zn+ animals were multiple genes that seemingly have roles related to mRNA processing and tr anslation. Gene transcripts decreased

PAGE 97

84 included two ribosomal proteins, Rpl28 and Rpl3, the later essential for peptidyl transferase function. Furthermore, cyclophilin, an RNA splicing factor and molecular chaperone located in the nuclear membrane, a H3 histone and a mRNA cleavage and polyadenylation factor were all decreased in the Zn+ animals. Mitochondrial NADH dehydrogenas e, part of the ubiquinone oxidase complex I within the respir atory chain, and a putative L1 repeat element were the only gene transcripts increased by zinc supplementation iden tified here. Of the 11 identified genes modulated in Znanimals, six had increased and five had decreased message abundances in the thymus. Observed together they represent an emerging molecular vi ew of the thymic response to zinc limitation (Figure 4-1). Three heat sho ck proteins required for nascent peptide chaperoning and organellar translocation were identified with decreased mRNA abundances. In addition, mRNA abundances for the MCL protein and the H2-A peptide chain of the MHC cla ss II receptor were decrea sed in the Znanimals. Identified as up-regulated in Znanimals were two cell surface receptors, the T-cell cytokine receptor and murine lami na receptor, an apoptosis inhibitory factor, a DNA repair protein and the crit ical lymphocyte signal transduction protein, LCK. Zinc deficiency is marked by lympho penia that results from reduced replenishment of peripheral T-lymphocytes with mature, naive T-cells exiting the thymus. The LCK up-regulation in Zn animals found through array analysis implied a potential mechanism for this lo ss of T-cells. This tyrosine kinase mediates signal transduction from the CD4 and CD8 co-receptors in a manner

PAGE 98

85 TCCR Hsp40 Hsc70 nucleusMCL Api5 RAD23B AAAAAAAA MLR mitochondria12S rRNA Hsp60 ribosomal machinery & nascent peptide chain H2-A Thymic Epithelial CellTCR Zn2+ CD4 LCK Thymocyte TCCR Hsp40 Hsc70 nucleusMCL Api5 RAD23B AAAAAAAA MLR mitochondria12S rRNA Hsp60 ribosomal machinery & nascent peptide chain H2-A Thymic Epithelial CellTCR Zn2+ CD4 LCK Thymocyte Figure 4-1: Pictorial view of gene tran scripts altered in murine thymus in response to three weeks of dietary zinc deficiency. Arrows after gene name designate direction of mRNA change in Znrelative to ZnN mice. Messages changed were: LCK, lymphocyte-specific tyrosine kinase; H2-A, histocompatibility class II, antigen A; TCCR, T-cell cytokine receptor; MLR, mouse lamina receptor; MCL, myeloid ce ll leukemia sequence; Api5, apoptosis and inhibitory factor 5; RAD23B, DNA r epair and recombinatio n protein; Hsp40, heat shock protein 40, Hsc 70, heat shock cognate 70; Hsp60, heat shock protein 60; and mitochondrial 12S rRNA. that is dependent on zinc (Huse et al. 1998, Lin et al. 1998). Decreased zinc availability for this interaction limits signaling from the CD4 or CD8 receptors, which our data suggests, might signal the nucleus to increase transcription of LCK in a compensatory manner. Positive and negative selection processes in the thymus are completely dependent on signaling through the CD4 and CD8 receptors. LCK knockout mice have illustrated that loss of LCK function results in

PAGE 99

86 almost no mature single-positive naive T-ce lls exiting the thym us to the periphery (Molina et al. 1992). The DD finding of decreased H2-A expression in Znanimals fits into a picture of a potential feedba ck loop. MHC class II molecules are expressed by thymic epithelial cells and present selfantigens to the TCR and CD4 co-receptor on developing thymocytes. This MHC:T CR interaction mediates positive and negative selection processes and lineage dec isions demonstrated by a lack of CD4+ T-cells in MHC class II deficient mice (Grusby et al. 1991, Cosgrove et al. 1991). It may be that thymic epithelial cells are most sensitive to zinc restriction, and the increase in LCK expression coul d stem from reduced extracellular signals from the H2-A molecules. Identifying H2-A decreased expression in the thymic stroma of Znanimals va lidated an early experimental protocol decision to use total RNA extracted from whole thymus rather than RNA from isolated thymocytes. The zinc-modulated genes identified here are a small subset of the total considered altered in these studies. Infe rences from the data must be made with the caveat that a complete dataset will paint a more detailed picture, and one that may support or contradict hypotheses der ived from these data. However the molecular details gained from this research thus far, not only fit well together but also reconcile with previous clinical and cellular data regarding biochemical aspects of zinc function. Options for future studies are numerous. Zinc research has pursued an optimal biomarker of zinc status for y ears (Wood 2000). Al though this study

PAGE 100

87 examined genes differentially expressed in the thymus, LCK stands as evidence that some of the identified zinc-sens itive transcripts may be modulated in peripheral T-lymphocytes. One possibility, inspired by experiments within the breast cancer field (Martin et al. 2001), wo uld be to create cDNA arrays from the zinc-sensitive genes identified by the primary DD screen and pursue highly zinc-responsive genes in peripheral bl ood lymphocytes with the arrays. As mentioned before, the priorities of nutrition research are changing and currently there is a greater apprecia tion of the importance of adequate micronutrient nutrition for prev enting initial DNA damage that in the long term contribute to cancer initiation (Ames 2001, Fenech 2002). This idea is supported by the finding reported here of RAD23B a DNA damage and repair protein, up-regulations after a thr ee week zinc deficiency. The importance of zinc status for adequate immune function is well-established (Fraker et al. 2000). Se vere zinc deficiency is a continuing problem in the third world (Bhutta et al. 2000), and marginal zinc status exists in high-risk populations in America (Briefel et al. 2000). The research reported here identifies multiple thymic mRNA transcr ipts altered after a moderate zinc deficiency in adult animals. In addi tion to adding to our knowledge and understanding of the molecular roles and functions of zinc in the thymus, it is hoped these experiments may contribute to t he establishment of practical highly sensitive biomarkers of zinc status in humans.

PAGE 101

88 3,3,1 3,3,2 Zn-ZnNZn+ 3,3,1 3,3,2 Zn-ZnNZn+ Zn-ZnNZn+ A PPENDIX A DIFFERENTIAL DISPLAY TRANSCRIPTS I NCREASED IN ZINC-SUPPLEMENTED MICE Differential Display Bands 3,3,1 and 3,3,2 Figure A-1. Autoradiograph of DD bands 3,3,1 and 3,3,2. These cDNAs/ESTs were generated with 3 AP3 and 5 ARP3. Identity of both bands: Mitochondrial NADHdh S2 (mt-Nd2), alternativ ely NADH ubiquinone oxidoreductase. Band 3,3,1 Single Read Sequence Data 1 TTGCaACATAG GACTTATGCT TCTTNCATGA CAAAAAATTG CTCCCCTATC 51 AATTTTAATT CAAATTTACC CGCTACTCAA CTCTACTATC ATTTTAATAC 101 TAGCAATTAC TTCTATTTTC ATAGGGGCAT GAGGAGGACT TAACCAAACA 151 CAAATACGAA AAATTATAGC CTATTCATCA ATTGCCCACA TAGGATGAAT 201 ATTAGCAATT CTTCCTTACA ACCCATCCCT CACTCTACTC AACCTCATAA 251 TCTATATTAT TCTTACAGCC CCTATATTCA TAGCACTTAT ACTAAATAAC 301 TCTATAACCA TCAACTCAAT CTCACTTCTA TGAAATAAAA CTCCAGCAAT 351 ACTAACTATA ATCTCACTGA TATTACTATC CCTAGGAGGC CTTCCACCAC 401 TAACAGGATT CTTACCAAAA TGAATTATCA TCACAGAACT TATAAAAAAC 451 AACTGTCTAA TTATAGCAAC ACTCATAGCA ATAATAGCTC TACTAAACCT 501 ATTCTTTTAT ACTCGCCTAA TTTATTCCAC TTCACTAACA ATATTTCCAA 551 CCAACAATAA CTCAAAAATA ATAACTCACC AAACAAAAAC TAAACCCAAC 601 CTAATATTTT CCACCCTAGC TATCATAAGC ACAATAACCC TACCCCTAGC 651 CCCCCAACTA ATTACCCAAA AAAAAAAb

PAGE 102

89 aARP3 annealing site bAP3 annealing site BLAST Alignment for 3,3,1 Alignment of 07oMOORE_331R-48.txt to ref|NC_001569.1| Mus musculus mitochondrion, complete genome Length = 16295 Score = 1296 bits (654), Expect = 0.0 Identities = 662/665 (99%) Strand = Plus / Plus Query: 2 tgcacataggacttatgcttcttncatgacaaaaaattgctcccctatcaattttaattc 61 |||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||| Sbjct: 4284 tgcacataggacttattcttcttacatgacaaaaaattgctcccctatcaattttaattc 4343 Query: 62 aaatttacccgctactcaactctactatcattttaatactagcaattacttctattttca 121 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4344 aaatttacccgctactcaactctactatcattttaatactagcaattacttctattttca 4403 Query: 122 taggggcatgaggaggacttaaccaaacacaaatacgaaaaattatagcctattcatcaa 181 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4404 taggggcatgaggaggacttaaccaaacacaaatacgaaaaattatagcctattcatcaa 4463 Query: 182 ttgcccacataggatgaatattagcaattcttccttacaacccatccctcactctactca 241 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4464 ttgcccacataggatgaatattagcaattcttccttacaacccatccctcactctactca 4523 Query: 242 acctcataatctatattattcttacagcccctatattcatagcacttatactaaataact 301 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4524 acctcataatctatattattcttacagcccctatattcatagcacttatactaaataact 4583 Query: 302 ctataaccatcaactcaatctcacttctatgaaataaaactccagcaatactaactataa 361 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4584 ctataaccatcaactcaatctcacttctatgaaataaaactccagcaatactaactataa 4643 Query: 362 tctcactgatattactatccctaggaggccttccaccactaacaggattcttaccaaaat 421 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4644 tctcactgatattactatccctaggaggccttccaccactaacaggattcttaccaaaat 4703 Query: 422 gaattatcatcacagaacttataaaaaacaactgtctaattatagcaacactcatagcaa 481 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4704 gaattatcatcacagaacttataaaaaacaactgtctaattatagcaacactcatagcaa 4763 Query: 482 taatagctctactaaacctattcttttatactcgcctaatttattccacttcactaacaa 541 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Sbjct: 4764 taatagctctactaaacctattcttttatattcgcctaatttattccacttcactaacaa 4823 Query: 542 tatttccaaccaacaataactcaaaaataataactcaccaaacaaaaactaaacccaacc 601 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4824 tatttccaaccaacaataactcaaaaataataactcaccaaacaaaaactaaacccaacc 4883

PAGE 103

90 Query: 602 taatattttccaccctagctatcataagcacaataaccctacccctagccccccaactaa 661 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4884 taatattttccaccctagctatcataagcacaataaccctacccctagccccccaactaa 4943 Query: 662 ttacc 666 ||||| Sbjct: 4944 ttacc 4948 Partial 3 mRNA Sequence for NC_001569c 4201 cataacatta atagccctat ccataaaact aggcctcgcc ccattccact tctgattacc 4261 agaagtaact caagggatcc cactgcadcat aggacttatt cttcttacat gacaaaaaat 4321 tgctccccta tcaattttaa ttcaaattta cccgctactc aactctacta tcattttaat 4381 actagcaatt acttctattt tcataggggc atgaggagga cttaaccaaa cacaaatacg 4441 aaaaattata gcctattcat caattgccca cataggatga atattagcaa ttcttcctta 4501 caacccatcc ctcactctac tcaacctcat aatctatatt attcttacag cccctatatt 4561 catagcactt atactaaata actctataac catcaactca atctcacttc tatgaaataa 4621 aactccagca atactaacta taatctcact gatattacta tccctaggag gccttccacc 4681 actaacagga ttcttaccaa aatgaattat catcacagaa cttataaaaa acaactgtct 4741 aattatagca acactcatag caataatagc tctactaaac ctattctttt atattcgcct 4801 aatttattcc acttcactaa caatatttcc aaccaacaat aactcaaaaa taataactca 4861 ccaaacaaaa actaaaccca acctaatatt ttccacccta gctatcataa gcacaataac 4921 cctaccccta gccccccaac taattacceta gaagtttagg atatactagt ccgcgagcct 4981 tcaaagccct aagaaaacac acaagtttaa cttctgataa ggactgtaag acttcatcct 5041 acatctattg aatgcaaatc aattgcttta attaagctaa gacctcaact agattggcag 5101 gaattaaacc tacgaaaatt tagttaacag ctaaataccc tattactggc ttcaatctac 5161 ttctaccgcc gaaaaaaaaa aatggcggta gaagtcttag tagagatttc tctacacctt c Mus musculus mitochondrion, complete genome 1..16295; NADHdh Subunit 2 3914..4951 dARP3 annealing site eAP3 annealing site

PAGE 104

91 3,3,1b 3,3,2b 3,3,3 Zn-ZnNZn+ 3,3,1b 3,3,2b 3,3,3 Zn-ZnNZn+ Zn-ZnNZn+ Differential Display Bands 3,3,1b, 3,3,2b, and 3,3,3 Figure A-2. Autoradiograph of DD bands 3,3,1b, 3,3,2b and 3,3,3. These cDNAs/ESTs were generated with 3 AP3 and 5 ARP3. Identity of all 3 bands: mitochondrial NADHdh S2 (mt-Nd2) alternatively NADH ubiquinone oxidoreductase. BLAST Alignment for 3,3,1b Alignment of 03oMOORE_331BR-48.txt to dbj|NC_001569.1| NC_001569 Mus musculus domesticus mitochondrial DNA, complete genome Length = 16300 Score = 1318 bits (665), Expect = 0.0 Identities = 665/665 (100%) Strand = Plus / Plus 3,3,1b start 3,3,3 start Query: 2 tgcacataggacttattcttcttacatgacaaaaaattgctcccctatcaattttaattc 61 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4284 tgcacataggacttattcttcttacatgacaaaaaattgctcccctatcaattttaattc 4343 Query: 62 aaatttacccgctactcaactctactatcattttaatactagcaattacttctattttca 121 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4344 aaatttacccgctactcaactctactatcattttaatactagcaattacttctattttca 4403 Query: 122 taggggcatgaggaggacttaaccaaacacaaatacgaaaaattatagcctattcatcaa 181 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4404 taggggcatgaggaggacttaaccaaacacaaatacgaaaaattatagcctattcatcaa 4463 Query: 182 ttgcccacataggatgaatattagcaattcttccttacaacccatccctcactctactca 241 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4464 ttgcccacataggatgaatattagcaattcttccttacaacccatccctcactctactca 4523 Query: 242 acctcataatctatattattcttacagcccctatattcatagcacttatactaaataact 301 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4524 acctcataatctatattattcttacagcccctatattcatagcacttatactaaataact 4583 Query: 302 ctataaccatcaactcaatctcacttctatgaaataaaactccagcaatactaactataa 361

PAGE 105

92 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4584 ctataaccatcaactcaatctcacttctatgaaataaaactccagcaatactaactataa 4643 Query: 362 tctcactgatattactatccctaggaggccttccaccactaacaggattcttaccaaaat 421 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4644 tctcactgatattactatccctaggaggccttccaccactaacaggattcttaccaaaat 4703 Query: 422 gaattatcatcacagaacttataaaaaacaactgtctaattatagcaacactcatagcaa 481 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4704 gaattatcatcacagaacttataaaaaacaactgtctaattatagcaacactcatagcaa 4763 Query: 482 taatagctctactaaacctattcttttatactcgcctaatttattccacttcactaacaa 541 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4764 taatagctctactaaacctattcttttatactcgcctaatttattccacttcactaacaa 4823 Query: 542 tatttccaaccaacaataactcaaaaataataactcaccaaacaaaaactaaacccaacc 601 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4824 tatttccaaccaacaataactcaaaaataataactcaccaaacaaaaactaaacccaacc 4883 Query: 602 taatattttccaccctagctatcataagcacaataaccctacccctagccccccaactaa 661 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4884 taatattttccaccctagctatcataagcacaataaccctacccctagccccccaactaa 4943 Query: 662 ttacc 666 ||||| Sbjct: 4944 ttacc 4948 Partial 3 mRNA Sequence for NC_001569a 4201 cataacatta atagccctat ccataaaact aggcctcgcc ccattccact tctgattacc 4261 agaagtaact caagggatcc cactgcabcat aggacttatt cttcttacat gacaaaaaat 4321 tgctccccta tcaattttaa ttcaaattta cccgctactc aactctacta tcattttaat 4381 actagcaatt acttctattt tcataggggc atgaggagga cttaaccaaa cacaaatacg 4441 aaaaattata gcctattcat caattgccca cataggatga atattagcaa ttcttcctta 4501 caacccatcc ctcactctac tcaacctcat aatctatatt attcttacag cccctatatt 4561 catagcactt atactaaata actctataac catcaactca atctcacttc tatgaaataa 4621 aactccagca atactaacta taatctcact gatattacta tccctaggag gccttccacc 4681 actaacagga ttcttaccaa aatgaattat catcacagaa cttataaaaa acaactgtct 4741 aattatagca acactcatag caataatagc tctactaaac ctattctttt atattcgcct 4801 aatttattcc acttcactaa caatatttcc aaccaacaat aactcaaaaa taataactca 4861 ccaaacaaaa actaaaccca acctaatatt ttccacccta gctatcataa gcacaataac 4921 cctaccccta gccccccaac taattacccta gaagtttagg atatactagt ccgcgagcct 4981 tcaaagccct aagaaaacac acaagtttaa cttctgataa ggactgtaag acttcatcct aMus musculus mitochondrion, complete genome 1..16295; NADH dh Subunit 2 3914..4951 bARP3 annealing site cAP3 annealing site

PAGE 106

93 2,17,1 2,17,2 Zn-ZnNZn+ 2,17,1 2,17,2 Zn-ZnNZn+ Zn-ZnNZn+ APPENDIX B DIFFERENTIAL DISPLAY TRANSCRIPTS INCREASED IN ZINC-DEFICIENT MICE Differential Display Bands 2,17,1 and 2,17,2 Figure B-1. Autoradiograph of DD bands 2,17,1 and 2,17,2. These cDNAs/ESTs were generated with 3 AP2 and 5 ARP17. Identity of both bands: T cell cytokine receptor (TCCR). Band 2,17,1 Single Read Sequence Data 1 AGGCTGGCCT CGAACTTGTG ATCCTCCCTG CTGCAGCATC CCCAGAGCTG 51 GGATTACAGG TGTGCGTCAC TTCATCGAGT CATAACTTTT GATTCTAGTA 101 AGAATAACTA CCAGGCAGGC TATGAGGTGG TGACTCGAAA GACACATTCA 151 AGGACCTAAA GTGGTTAAGA GCCTGTGTTT TCTTGCAGTA GACCAAAGTT 201 TGGTTCCCTG CCCTTGCAAA GGACACACGT TCAGTTTCCA GCACCCACAG 251 GGCAGCTCAG AATCACCTGT AACTCCAGGT CCAAGGAATC CAATGCCCTC 301 TTCTGGCTTC TGTGAGCCCC GCACACACAT GGTTACTTAT GCACCGAAAA 351 ACACACGCAA AAAAAAAAAAa GCC aAP2 annealing site

PAGE 107

94 BLAST Alignment for 2,17,1 Alignment of 54oMOORE_2171R-48.txt to ref|NM_016671.1| Mus musculus T cell cytokine receptor (Tccr), mRNA Length = 2586 Score = 696 bits (351), Expect = 0.0 Identities = 358/359 (99%), Gaps = 1/359 (0%) Strand = Plus / Plus Query: 1 aggctggcctcgaacttgtgatcctccctgctgcagcatccccagagctgggattacagg 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2204 aggctggcctcgaacttgtgatcctccctgctgcagcatccccagagctgggattacagg 2263 2,7,2 Query: 61 tgtgcgtcacttcatcgagtcataacttttgattctagtaagaataactaccaggcaggc 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2264 tgtgcgtcacttcatcgagtcataacttttgattctagtaagaataactaccaggcaggc 2323 Query: 121 tatga-ggtggtgactcgaaagacacattcaaggacctaaagtggttaagagcctgtgtt 179 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2324 tatgaaggtggtgactcgaaagacacattcaaggacctaaagtggttaagagcctgtgtt 2383 Query: 180 ttcttgcagtagaccaaagtttggttccctgcccttgcaaaggacacacgttcagtttcc 239 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2384 ttcttgcagtagaccaaagtttggttccctgcccttgcaaaggacacacgttcagtttcc 2443 Query: 240 agcacccacagggcagctcagaatcacctgtaactccaggtccaaggaatccaatgccct 299 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2444 agcacccacagggcagctcagaatcacctgtaactccaggtccaaggaatccaatgccct 2503 Query: 300 cttctggcttctgtgagccccgcacacacatggttacttatgcaccgaaaaacacacgc 358 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2504 cttctggcttctgtgagccccgcacacacatggttacttatgcaccgaaaaacacacgc 2562 Partial 3 mRNA Sequence for NM_16671b 2161 cgttgttatt tcctccttgt gtcacaggct tgctaggtacg ccaadggctgg cctcgaacett 2221 gtgatcctcc ctgctgcagc atccccagag ctgggattac aggtgtgcgt cacttcatcg 2281 agtcataact tttgattcta gtaagaataa ctaccaggca ggctatgaag gtggtgactc 2341 gaaagacaca ttcaaggacc taaagtggtt aagagcctgt gttttcttgc agtagaccaa 2401 agtttggttc cctgcccttg caaaggacac acgttcagtt tccagcaccc acagggcagc 2461 tcagaatcac ctgtaactcc aggtccaagg aatccaatgc cctcttctgg cttctgtgag 2521 ccccgcacac acatggttac ttatgcaccg aaaaacacac gcfataaaata aagataaata 2581 aataaa bCDS bp 10-1881 cARP17 annealing site d,eBeginning of identities with single read sequence data for bands 2,17,1 and 2,17,2 respectively fAP2 annealing site gUniversal polyadenylation sequence (AATAAA)

PAGE 108

95 3,1,1 Zn-ZnNZn+ 3,1,1 Zn-ZnNZn+ Differential Display Band 3,1,1 Figure B-2. Autoradiograph of DD band 3,1,1. These cDNAs/ESTs were generated with 3 AP3 and 5 ARP1. Identity of band 3,1,1: Similar to dJ1189B24.4. Band 3,1,1 Single Read Sequence Data 1 NTCTACTACC AAGaTGGGCCT TGTNGTGGGC TGCCTTCATC TATAGGAAGT 51 NTGTGTAAAT TAGATGAGAG CAGTGCTGAG GAGGCCGACA AATCACGAGA 101 AAGATCTCAG TGTGCTGTGA AAGCTGCTAA TAAAGCTTCC AGTGTCACAC 151 CAAAAGGGAA TTTAAGCAAT GGAAACAGTG GCTCTAACAG CAAAGCTGTT 201 AAGGAAAATG ACAAAGAAAA GGGCAAAGAG AAAGAGAAAG AAGAAAA aARP1 annealing site BLAST Alignment for 3,1,1 Alignment of 311 to ref|XM_144450.1| Mus musculus similar to dJ1189B24.4 (novel PUTATIVE protein similar to hypothetical proteins S. pombe C22F3.14C and C. elegans C16A3.8) (LOC243171), mRNA Length = 4383 Score = 321 bits (162), Expect = 2e-85 Identities = 172/176 (97%) Strand = Plus / Plus Query: 2 tctactaccaagtgggccttgtngtgggctgccttcatctataggaagtntgtgtaaatt 61 ||||| |||||||||||||||| |||||||||||||||||||||||||| |||||||||| Sbjct: 3597 tctacaaccaagtgggccttgtagtgggctgccttcatctataggaagtatgtgtaaatt 3656 Query: 62 agatgagagcagtgctgaggaggccgacaaatcacgagaaagatctcagtgtgctgtgaa 121 ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| Sbjct: 3657 agatgagagcagtgctgaggaggccgacaaatcacgagaaagagctcagtgtgctgtgaa 3716

PAGE 109

96 Query: 122 agctgctaataaagcttccagtgtcacaccaaaagggaatttaagcaatggaaaca 177 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3717 agctgctaataaagcttccagtgtcacaccaaaagggaatttaagcaatggaaaca 3772 Partial 3 mRNA Sequence for XM_144450 3541 atacctgaaa atgaatttca tcacaaagac cctcctccaa gbaaatactgc taccaatcta 3601 caaccaagtg ggccttgtag tgggctgcct tcatctatag gaagtatgtg taaattagat 3661 gagagcagtg ctgaggaggc cgacaaatca cgagaaagag ctcagtgtgc tgtgaaagct 3721 gctaataaag cttccagtgt cacaccaaaa gggaatttaa gcaatggaaa cacctgttact 3781 ccagaggcca gggtacttgg taaagacagt aaagaaaaac ccaaggaaga acaaccaaat 3841 aaagatgaaa aaataagaga agccaaagaa agaatgccta aatctgataa agacaaggaa 3901 aaattaaaga aggaagaaaa agctaaagat gagaaattca ggatcattgt tgccaatgta 3961 gaatcaaaat ccactcaaga aagggaaaaa gagaaagagc cctcaaaaga aagagattta 4021 gcaaaggaaa tgaagtcaaa agagaatgtt aaaggagggg aaaaagcacc agtttctggc 4081 tccttgaaat cacctatttc ccgaacagat atcacagaac ctgaaagaga aaaacgtcgc 4141 aaagttgatt cccatccttc tccatcacac tcttccacaa taaadggacag tcttgtcaaa bARP1 annealing site cEnd of sequence homology with DD clone 3,1,1 dUniversal polyadenylati on sequence (AATAAA)

PAGE 110

97 Zn+ ZnN Zn7,11,1 Zn+ Zn+ ZnN ZnN ZnZn7,11,1 Differential Display Band 7,11,1 Figure B-3. Autoradiograph of DD band 7,11,1. These cDNAs/ESTs were generated with 3 AP7 and 5 ARP11. Identity of band 7,11,1: Apotosis inhibitory protein 5. Band 7,11,1 Single Read Sequence Data 1 GTaGATGTAGG ATTTGGAGAC TTAATAACCA GGGCTACCCA GGAGTGTGAC 51 TTGGTGACAT AGTACCATAA AAGTTGCTCA CTCCGCTTGC TTTTGCCACT 101 TTCAAATTTT AACTTCTCAG GTTATTAATC AGATTATTGT GTAAGTTAGC 151 CAATAGTCTT TAGATTAAGG CAACAGACGG GAGGTTCGTG GAGTGTCTCA 201 TGTTGGGCAT TTTTAGTAGC CCAGACTCTG TTCTTCATTT GAATGTTTCA 251 CACATTTTTG TTCACAGTTA ATCTTCCAAG TTTACTATTC AAATCAGAAA 301 TTCAGATGAC ATTTCTAGTG GTTTGCTGTT TTGGTTTTTT ATGTTTTTTG 351 GTTTTTTTTG AGGTTTCATT TCTTACACAG GTGTCTTCAT CACCATCACT 401 TCTACACTGG GGGAAAAACA ATCTCCTTTG TGAGAATCAC TGCACGTATT 451 TATGGCGAAA AAAAAAAAAb aARP11 annealing site bAP7 annealing site

PAGE 111

98 BLAST Alignment fo r 7,11,1 to XM_123850 Alignment of 03oMOORE_7111R-48.txt to ref|XM_123850.1| Mus musculus apoptosis inhibitory protein 5 (Api5), mRNA Length = 3621 Score = 634 bits (320), Expect = e-179 Identities = 323/324 (99%) Strand = Plus / Plus Query: 4 atgtaggatttggagacttaataaccagggctacccaggagtgtgacttggtgacatagt 63 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2626 atgtaggatttggagacttaataaccagggctacccaggagtgtgacttggtgacatagt 2685 Query: 64 accataaaagttgctcactccgcttgcttttgccactttcaaattttaacttctcaggtt 123 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2686 accataaaagttgctcactccgcttgcttttgccactttcaaattttaacttctcaggtt 2745 Query: 124 attaatcagattattgtgtaagttagccaatagtctttagattaaggcaacagacgggag 183 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2746 attaatcagattattgtgtaagttagccaatagtctttagattaaggcaacagacgggag 2805 Query: 184 gttcgtggagtgtctcatgttgggcatttttagtagcccagactctgttcttcatttgaa 243 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2806 gttcgtggagtgtctcatgttgggcatttttagtagcccagactctgttcttcatttgaa 2865 Query: 244 tgtttcacacatttttgttcacagttaatcttccaagtttactattcaaatcagaaattc 303 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 2866 tgtttcacacatttttgttcacagttaatcttccaagtttactattcaagtcagaaattc 2925 Query: 304 agatgacatttctagtggtttgct 327 |||||||||||||||||||||||| Sbjct: 2926 agatgacatttctagtggtttgct 2949 Score = 186 bits (94), Expect = 1e-44 Identities = 97/98 (98%) Strand = Plus / Plus Query: 360 gaggtttcatttcttacacaggtgtcttcatcaccatcacttctacactgggggaaaaac 419 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2982 gaggtttcatttcttacacaggtgtcttcatcaccatcacttctacactgggggaaaaac 3041 Query: 420 aatctcctttgtgagaatcactgcacgtatttatggcg 457 ||||||||||||||||||||||||| |||||||||||| Sbjct: 3042 aatctcctttgtgagaatcactgcatgtatttatggcg 3079

PAGE 112

99 Partial 3 mRNA Sequence for XM_123850c 2581 ccagatctgg tgtacataca ggttcccaca ggatctgcta gtgtd daatgta ggatttggag 2641 acttaataac cagggctacc caggagtgtg acttggtgac atagtaccat aaaagttgct 2701 cactccgctt gcttttgcca ctttcaaatt ttaacttctc aggttattaa tcagattatt 2761 gtgtaagtta gccaatagtc tttagattaa ggcaacagac gggaggttcg tggagtgtct 2821 catgttgggc atttttagta gcccagactc tgttcttcat ttgaatgttt cacacatttt 2881 tgttcacagt taatcttcca agtttactat tcaagtcaga aattcagatg acatttctag 2941 tggtttgctg ttttggtttt ttatgttttt tggttttttt tegaggtttca tttcttacac 3001 aggtgtcttc atcaccatca cttctacact gggggaaaaa caatctcctt tgtgagaatc 3061 actgcatgta tttatggcgfa aaatatttct gaaagtctag agtgatacaa gtgagcacaa 3121 gaagttggtc agcttgccta tggagtgctg gcaataaagct ctgaacattc cacaagcctg 3181 agctgaacct aggctccctt ggaagctgaa cagacatagg aacatgggat tgccagctga cCDS 82..1596, gene 1..3621 dARP11 annealing site eLow sequence complexity, resulting in inaccurate sequence reads fAP7 annealing site gUniversal polyadenylation sequence (AATAAA)

PAGE 113

100 ZnPF Zn+ ZnN 10,7,2G ZnPF Zn+ ZnN ZnZnPF Zn+ Zn+ ZnN 10,7,2GDifferential Display Band 10,7,2G Figure B-4. Autoradiograph of DD band 10,7,2G. These cDNAs/ESTs were generated with 3 AP10 and 5 ARP7. Identity of band 10,7,2G: Mitochondrial 12S RNA. Band 10,7,2G Single Read Sequence Data 1 ACGCCAAGCG CGCAATTAAC CCTCACTAAA GGGAACAAAA GCTGGAGCTC 51 CACCGCGGTG GCGGCCGCTC TAGCCCGTAA TACGACTCAC TATAGGGCTT 101 TTTTTTTTTA GaGTTTATGGC TAAGCATAGT GGGGTATCTA ATCCCAGTTT 151 GGGTCTTAGC TGTCGTGTAT TATAAATGAC TAGAATTACT TTCGTTATTG 201 AGTTTAGGTC CTAACAATGA ATTTTCACAT ATAAGTTGGA TTTTAATTCT 251 ATTTATTTAT TTATAGTTGA CACGTTTTAC GCCGAAGATA ATTAGTTTGG 301 GTTAATCGTA TGACCGCGGT GGCTGGCACG AAATTTACCA ACCCTAAGAG 351 GTATAACTTA GTCAAACTTT CGTTTATTGC TTAATATTTA TCACTGCTGA 401 GTCCCGTGGG GGTGTGGCTA GGCAAGGTGT CTTAAGCTAT TTTAATGTGC 451 TTGATACCC aFull length AP10 primer, preceded by plasmid vector sequence

PAGE 114

101 BLAST Alignment for 10,7,2G Score = 669 bits (348), Expect = 0.0 Identities = 348/348 (100%) Strand = Plus / Minus Query=NC_001569, Subject 10,7,2G Query: 176 gggtatcaagcacattaaaatagcttaagacaccttgcctagccacacccccacgggact 235 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 348 gggtatcaagcacattaaaatagcttaagacaccttgcctagccacacccccacgggact 289 Query: 236 cagcagtgataaatattaagcaataaacgaaagtttgactaagttatacctcttagggtt 295 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 288 cagcagtgataaatattaagcaataaacgaaagtttgactaagttatacctcttagggtt 229 Query: 296 ggtaaatttcgtgccagccaccgcggtcatacgattaacccaaactaattatcttcggcg 355 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 228 ggtaaatttcgtgccagccaccgcggtcatacgattaacccaaactaattatcttcggcg 169 Query: 356 taaaacgtgtcaactataaataaataaatagaattaaaatccaacttatatgtgaaaatt 415 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 168 taaaacgtgtcaactataaataaataaatagaattaaaatccaacttatatgtgaaaatt 109 Query: 416 cattgttaggacctaaactcaataacgaaagtaattctagtcatttataatacacgacag 475 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 108 cattgttaggacctaaactcaataacgaaagtaattctagtcatttataatacacgacag 49 Query: 476 ctaagacccaaactgggattagataccccactatgcttagccataaac 523 |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 48 ctaagacccaaactgggattagataccccactatgcttagccataaac 1 Partial 3 mRNA Sequence for NC_001569b 61 cataaacaca aaggtttggt ccctggcctta taattaatta gaggtaaaat tacacatgca 121 aacctccata gaccggtgta aaatccctta aacatttact taaaatttaa ggagagdggta 181 tcaagcacat taaaatagct taagacacct tgcctagcca cacccccacg ggactcagca 241 gtgataaata ttaagcaata aacgaaagtt tgactaagtt atacctctta gggttggtaa 301 atttcgtgcc agccaccgcg gtcatacgat taacccaaac taattatctt cggcgtaaaa 361 cgtgtcaact ataaataaat aaatagaatt aaaatccaac ttatatgtga aaattcattg 421 ttaggaccta aactcaataa cgaaagtaat tctagtcatt tataatacac gacagctaag 481 acccaaactg ggattagata ccccactatg cttagccata aacctaaaeta attaaattta 541 acaaaactat ttgccagaga actactagcc atagcttaaa actcaaagga cttggcggta 601 ctttatatcc atctagagga gcctgttcta taatcgataa accccgctct acctcaccat bMus musculus mitochondrion, complete genome 1..16295; 12S rRNA 70..1024 cARP7 annealing site dStart site of identity to 10,7,2G ePossible AP10 annealing site

PAGE 115

102 ZnPF Zn+ ZnN 9,7,1A ZnPF Zn+ ZnN ZnZnPF Zn+ Zn+ ZnN 9,7,1A Differential Display Band 9,7,1A Figure B-5. Autoradiograph of DD band 9,7,1A. These cDNAs/ESTs were generated with 3 AP9 and 5 ARP7. Identity of band 9,7,1A: Similar to hypothetical protein FLJ20274. Band 9,7,1A Single Read Sequence Data 1 GTAATACaGACa TCACaTATAGG GCTTTbTTTTT TTACAGAACA AATTCATTTT 51 TATTTTTTAA AATATCAGGA ACTTTGAAAA CTTGAAAGTT CAGCTGTACC 101 AAGAACAAAA TGCAGTAAAA ATATCTGAGA ACTGTATTCA GCTTTGGAGA 151 AACGTGTCCT CCAGGCCCAG GCTTAACTCC TCTCTCTGCA GAGCAGGACA 201 GGCATGCTGA TCGTCAGCAC GGGGATTTGG TTTCTGCTTC TTTATTTTCT 251 GTCCTAACTG CTATAGTTTA AAACTAACTG CTAAGTTCCT ACCCTGGATC 301 ACCTGTACGC TAGCACACTG AAAAGGCAGT GAAGACAAAG TCCGCAAATC 351 TGAAGGCAGA GCAAAATCTG TGAGTGAATT TAGATCCCAA GAGCACACAG 401 CACTGTACAA CTGGCAAATA GCCAGTAGGG ACTCGTTCAA AACAAACAAA 451 TAAAAAGGCC GTTAAAAGCA AAGTATAGAC CAAAATCCCA AGTGCAGCAA 501 CTGCCCTGCT CCAGAACAAC CTGTCTGAGC CAAGAGTAAC TGGTCCTCAG 551 GCCCTCTGTcC CTACACTATT AAAAGAAAAG TCCCTCTATC TTGGACCAAT 601 CCAdTCCTGTG TGAAATTGTT ATCCGCT apossible AP9 annealing sites bBegin sequence identities with NM_1455585 cEnd sequence identities with NM_1455585 dARP7 annealing site BLAST Alignment for 9,7,1A Alignment of 971arnp.seq.txt to ref|NM_145585.1|

PAGE 116

103 Mus musculus similar to hypothetical protein FLJ20274 (LOC233802), mRNA Length = 2668 Score = 1053 bits (531), Expect = 0.0 Identities = 534/535 (99%) Strand = Plus / Minus Query: 25 aaaatatcaggaactttgaaaacttgaaagttcagctgtaccaagaacaaaatgcagtaa 84 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2627 aaaatatcaggaactttgaaaacttgaaagttcagctgtaccaagaacaaaatgcagtaa 2568 Query: 85 aaatatctgagaactgtattcagctttggagaaacgtgtcctccaggcccaggcttaact 144 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2567 aaatatctgagaactgtattcagctttggagaaacgtgtcctccaggcccaggcttaact 2508 Query: 145 cctctctctgcagagcaggacaggcatgctgatcgtcagcacggggatttggtttctgct 204 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2507 cctctctctgcagagcaggacaggcatgctgatcgtcagcacggggatttggtttctgct 2448 Query: 205 tctttattttctgtcctaactgctatagtttaaaactaactgctaagttcctaccctgga 264 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2447 tctttattttctgtcctaactgctatagtttaaaactaactgctaagttcctaccctgga 2388 Query: 265 tcacctgtacgctagcacactgaaaaggcagtgaagacaaagtccgcaaatctgaaggca 324 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2387 tcacctgtacgctagcacactgaaaaggcagtgaagacaaagtccgcaaatctgaaggca 2328 Query: 325 gagcaaaatctgtgagtgaatttagatcccaagagcacacagcactgtacaactggcaaa 384 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2327 gagcaaaatctgtgagtgaatttagatcccaagagcacacagcactgtacaactggcaaa 2268 Query: 385 tagccagtagggactcgttcaaaacaaacaaataaaaaggccgttaaaagcaaagtatag 444 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2267 tagccagtagggactcgttcaaaacaaacaaataaaaaggccgttaaaagcaaagtatag 2208 Query: 445 accaaaatcccaagtgcagcaactgccctgctccagaacaacctgtctgagccaagagta 504 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2207 atcaaaatcccaagtgcagcaactgccctgctccagaacaacctgtctgagccaagagta 2148 Query: 505 actggtcctcaggccctctgtcctacactattaaaagaaaagtccctctatcttg 559 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2147 actggtcctcaggccctctgtcctacactattaaaagaaaagtccctctatcttg 2093

PAGE 117

104 Partial 3 mRNA Sequence for NM_145585 1981 tgtttgacat gctacctcgg gtctgagatt gaaaccatct tgaaaggata ggccttaggg 2041 tceacttaggg gaacgggagg agaggatctt ggtgccttct tgtggcttgc tccfaagatag 2101 agggactttt cttttaatag tgtaggacag agggcctgag gaccagttac tcttggctca 2161 gacaggttgt tctggagcag ggcagttgct gcacttggga ttttgatcta tactttgctt 2221 ttaacggcct ttttatttgt ttgttttgaa cgagtcccta ctggctattt gccagttgta 2281 cagtgctgtg tgctcttggg atctaaattc actcacagat tttgctctgc cttcagattt 2341 gcggactttg tcttcactgc cttttcagtg tgctagcgta caggtgatcc agggtaggaa 2401 cttagcagtt agttttaaac tatagcagtt aggacagaaa ataaagaagc agaaaccaaa 2461 tccccgtgct gacgatcagc atgcctgtcc tgctctgcag agagaggagt taagcctggg 2521 cctggaggac acgtttctcc aaagctgaat acagttctca gatattttta ctgcattttg 2581 ttcttggtac agctgaactt tcaagttttc aaagttcctg atattttgaaa aaataaahaat 2641 gaatttgttc tgtaaaaaaa aaaaaaaai eARP7 annealing site fBegin sequence identity with 9,7,1A gEnd sequence identity with 9,7,1A hUniversal polyadenylati on sequence (AATAAA) iAP9 annealing site

PAGE 118

105 2,4,2 2,4,3Zn+ ZnN Zn2,4,2 2,4,3Zn+ Zn+ ZnN ZnN ZnZnA PPENDIX C DIFFERENTIAL DISPLAY TRANSCRIPT S DECREASED IN ZINC-DEFICIENT MICE Differential Display Bands 2,4,2 and 2,4,3 Figure C-1. Autoradiograph of DD bands 2,4,2 and 2,4,3. These cDNAs/ESTs were generated with 3 AP2 and 5 ARP4. Identity of both bands: Heat shock cognate protein 70 (Hsc70). Band 2,4,3 Single Read Sequence Data 1 AAAGTATTAC CTCCTACTGT GACNANNNCC CTGGTGTACT CATTCAGGTG 51 TATGAAGGTG AAAGGGCCAT GACCAAGGAC AACAACCTGC TTGGAAAGTT 101 CGAGCTCACA GGCATCCCTC CAGCACCCCG TGGGGTCCCT CATATTGAGG 151 TTACTTTTGA CATCGATGCC AATGGCATCC TCAATGTTTC TGCTGTAGAT 201 AAGAGCACAG GAAAGGAGAA CAAGATCACC ATCACCAATG ACAAGGGCCG 251 NTTGAGTAAG GAAGATATTG AGCGCATGGT CCAAGAAGCT GAGAAGTACA 301 AGGCTGAGGA TGAGAAGCAG AGAGATAAGG TTTCCTCCAA GAACTCACTG 351 GAGTCCTATG CCTTCAACAT GAAAGCGACT GTGGAAGATG AGAAACTTCA 401 AGGCAAGATC AATGATGAGG ACAAACAGAA GATTCTTGAC AAGTGCAATG 451 AAATCATCAG CTGGCTGGAT AAGAACCAGA CTGCAGAGAA GGAAGAATTT 501 GAGCATCAGC AGAAAGAACT GGAGAAAGTC TGCAACCCTA TCATTACCAA 551 GCTGTACCAG AGTGCAGGTG GCATGCCTGG GGGAATGCCT GGTGGCTTCC 601 CAGGTGGAGG AGCTCCCCCA TCTGGTGGTG CTTCTTCAGG CCCCACCATT 651 GAAGAGGTGG ATTAAGTCAG TCCAAGAAGA AGGTGTAGCT TTGTTCCACA

PAGE 119

106 701 GGGACCCAAA ACAAGTAACA TGGAATAATA AAACTATTTA AATTGGCAAA 751 AAAAAAa aAP2 annealing site BLAST Alignment for 2,4,3 Alignment of 243sequence.txt to GB_RO:BC006722 BC006722 Mus musculus, Heat shock cognate protein 70, clone MGC:11684 IMAGE:3711399, mRNA, complete cds. 7/2001 Length = 2146 Score = 1402 bits (707), Expect = 0.0 Identities = 715/718 (99%) Strand = Plus / Plus Query: 30 cctggtgtactcattcaggtgtatgaaggtgaaagggccatgaccaaggacaacaacctg 89 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1409 cctggtgtactcattcaggtgtatgaaggtgaaagggccatgaccaaggacaacaacctg 1468 2,4,2 Query: 90 cttggaaagttcgagctcacaggcatccctccagcaccccgtggggtccctcatattgag 149 ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Sbjct: 1469 cttggaaagttcgagctcacaggcatccctccagcaccccgtggggtccctcagattgag 1528 Query: 150 gttacttttgacatcgatgccaatggcatcctcaatgtttctgctgtagataagagcaca 209 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1529 gttacttttgacatcgatgccaatggcatcctcaatgtttctgctgtagataagagcaca 1588 Query: 210 ggaaaggagaacaagatcaccatcaccaatgacaagggccgnttgagtaaggaagatatt 269 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Sbjct: 1589 ggaaaggagaacaagatcaccatcaccaatgacaagggccgcttgagtaaggaagatatt 1648 Query: 270 gagcgcatggtccaagaagctgagaagtacaaggctgaggatgagaagcagagagataag 329 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1649 gagcgcatggtccaagaagctgagaagtacaaggctgaggatgagaagcagagagataag 1708 Query: 330 gtttcctccaagaactcactggagtcctatgccttcaacatgaaagcgactgtggaagat 389 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 1709 gtttcctccaagaactcactggagtcctatgccttcaacatgaaagcaactgtggaagat 1768 Query: 390 gagaaacttcaaggcaagatcaatgatgaggacaaacagaagattcttgacaagtgcaat 449 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1769 gagaaacttcaaggcaagatcaatgatgaggacaaacagaagattcttgacaagtgcaat 1828 Query: 450 gaaatcatcagctggctggataagaaccagactgcagagaaggaagaatttgagcatcag 509 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1829 gaaatcatcagctggctggataagaaccagactgcagagaaggaagaatttgagcatcag 1888 Query: 510 cagaaagaactggagaaagtctgcaaccctatcattaccaagctgtaccagagtgcaggt 569 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1889 cagaaagaactggagaaagtctgcaaccctatcattaccaagctgtaccagagtgcaggt 1948 Query: 570 ggcatgcctgggggaatgcctggtggcttcccaggtggaggagctcccccatctggtggt 629 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1949 ggcatgcctgggggaatgcctggtggcttcccaggtggaggagctcccccatctggtggt 2008

PAGE 120

107 Query: 630 gcttcttcaggccccaccattgaagaggtggattaagtcagtccaagaagaaggtgtagc 689 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2009 gcttcttcaggccccaccattgaagaggtggattaagtcagtccaagaagaaggtgtagc 2068 Query: 690 tttgttccacagggacccaaaacaagtaacatggaataataaaactatttaaattggc 747 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2069 tttgttccacagggacccaaaacaagtaacatggaataataaaactatttaaattggc 2126 Partial 3 mRNA Sequence for BC006722b 1321 tggcggagtc atgactgtcc tcatcaagcg caataccacc atccccacca agcagaccaca 1381 gactttcacc acctactctg acaaccagccd tggtgtacetc attcaggtgt atgaaggtga 1441 aagggccatg accaaggaca acaacctgct tggaaagttc gagctcacag gcatccctcc 1501 agcaccccgt ggggtccctc agattgaggt tacttttgac atcgatgcca atggcatcct 1561 caatgtttct gctgtagata agagcacagg aaaggagaac aagatcacca tcaccaatga 1621 caagggccgc ttgagtaagg aagatattga gcgcatggtc caagaagctg agaagtacaa 1681 ggctgaggat gagaagcaga gagataaggt ttcctccaag aactcactgg agtcctatgc 1741 cttcaacatg aaagcaactg tggaagatga gaaacttcaa ggcaagatca atgatgagga 1801 caaacagaag attcttgaca agtgcaatga aatcatcagc tggctggata agaaccagac 1861 tgcagagaag gaagaatttg agcatcagca gaaagaactg gagaaagtct gcaaccctat 1921 cattaccaag ctgtaccaga gtgcaggtgg catgcctggg ggaatgcctg gtggcttccc 1981 aggtggagga gctcccccat ctggtggtgc ttcttcaggc cccaccattg aagaggtgga 2041 ttaagtcagt ccaagaagaa ggtgtagctt tgttccacag ggacccaaaa caagtaacat 2101 ggaataataa afactatttaa attggcgacca aaaaaaaaaa aaaaaa bCDS 104..2044 cARP4 annealing site d,eBeginning of identities with single read sequenced data for bands 2,4,3 and 2,4,2 respectively fUniversal polyadenylation sequence (AATAAA) gAP2 annealing site

PAGE 121

108 Zn+ ZnN Zn2,14,1 Zn+ Zn+ ZnN ZnN ZnZn2,14,1Differential Display Band 2,14,1 Figure C-2. Autoradiograph of DD band 2,14,1. These cDNAs/ESTs were generated with 3 AP2 and 5 ARP14. Identity of band 2,14,1: Hematopoietic stem cell cDNA. Band 2,14,1 Single Read Sequence Data 1 CTCATATGAC TTACTCTAAG CACATTATCA TTTCAGAGAG GTTGAGAAAG 51 AGTTTGTTCC TTGGTCAGCT GGTCCCACTT GCAGCCACAC TGACACAGGG 101 CAGGGTACCT GCAGTGTGTT CACTTCAGGG TGGGAGGGAA CCATGCAAAG 151 AGCAGAGGCT AGGGTACTGG AGATGATGTT TAGATATTTG GAGATATATG 201 TTTAGCCATT TAAAGTTTTA GGTGAAATTT TGTTTCTGCC AGCAACTTTA 251 TAAACAAGTA CAACCTAAAG TTTATGTTGC AAAAAAAAAA Aa aAP2 annealing site

PAGE 122

109 BLAST Alignment for 2,14,1 (dbESTb) Alignment of 53oMOORE_2141R-48.txt to gb|BM244188.1|BM244188 K0707H07-3 NIA Mouse Hematopoietic Stem Cell (Lin-/c-Kit-/Sca-1-) cDNA Library (Long) Mus musculus cDNA clone K0707H07 3 Length = 639 Score = 555 bits (280), Expect = e-156 Identities = 280/280 (100%) Strand = Plus / Minus Query: 1 ctcatatgacttactctaagcacattatcatttcagagaggttgagaaagagtttgttcc 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 280 ctcatatgacttactctaagcacattatcatttcagagaggttgagaaagagtttgttcc 221 Query: 61 ttggtcagctggtcccacttgcagccacactgacacagggcagggtacctgcagtgtgtt 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 220 ttggtcagctggtcccacttgcagccacactgacacagggcagggtacctgcagtgtgtt 161 Query: 121 cacttcagggtgggagggaaccatgcaaagagcagaggctagggtactggagatgatgtt 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 160 cacttcagggtgggagggaaccatgcaaagagcagaggctagggtactggagatgatgtt 101 Query: 181 tagatatttggagatatatgtttagccatttaaagttttaggtgaaattttgtttctgcc 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 100 tagatatttggagatatatgtttagccatttaaagttttaggtgaaattttgtttctgcc 41 Query: 241 agcaactttataaacaagtacaacctaaagtttatgttgc 280 |||||||||||||||||||||||||||||||||||||||| Sbjct: 40 agcaactttataaacaagtacaacctaaagtttatgttgc 1 b1 of 3 equal probability matches in Genbank EST database as of July 2002

PAGE 123

110 3,1,4Zn+ ZnN Zn3,1,4Zn+ Zn+ ZnN ZnN ZnZnDifferential Display Band 3,1,4 Figure C-3. Autoradiograph of DD band 3,1,4. These cDNAs/ESTs were generated with 3 AP3 and 5 ARP1. Identity of band 3,1,4: L1Md-A101 pORF2 and L1Md-A2 pORF2, alternat ively a repetitive element. Band 3,1,4 Single Read Sequence Data 1 GAAGAAACGG GAGAGAGCAC ATACTAGCAG CTTGACAACA CATCTAAAAG 51 CNCTAGAAAA AAAGGAAGCA AATTCACCCA AGAGGAGTAG ACGGCAGGAA 101 ATAATCAAAC TCAGGGGTGA AATCAACCAA GTGGAAACAA GAAGAACTAT 151 TCAAAGAATT AACCAAACGA GGAGTTGGTT CTTTGAGAAA ATCAACAAGA 201 TAGATAAACC CTTAGCTAGA CTCACTAAAG GGCACAGGGA CAAAATCCTA 251 ATTAACAAAA TCAGAAATGA AAAGGGAGAC ATAACAACAG ATCCTGAAGA 301 AATCCAAAAC ACCATCAGAT CCTTCTACAA AAGGCTATAC TCAACAAAAC 351 TGGAAAACCT GGACGAAATG GACAAATTTC TGGACAGATA CCAGGTACCA 401 AAGTTGAATC AGGATCAAGT TGACCATCTA AACAGTCCCA TATCACCTAA 451 AGAAATAGAA GCAGTTATTA ATAGTCTCCC AGCCAAAAAA AAAAAaGCCCT aAP3 annealing site

PAGE 124

111 BLAST Alignment for 3,1,4 Alignment of 314 to gb|AY053456.1| Mus musculus domesticus retrotransposon L1Md-A101 pORF1 and pORF2 mRNA, complete cds Length = 7249 Score = 898 bits (453), Expect = 0.0 Identities = 472/481 (98%) Strand = Plus / Plus Query: 1 gaagaaacgggagagagcacatactagcagcttgacaacacatctaaaagcnctagnnnn 60 |||||||||||||| |||||||||||||||||||||||||||||||||||| |||| Sbjct: 3133 gaagaaacgggagacagcacatactagcagcttgacaacacatctaaaagccctagaaaa 3192 Query: 61 nnnggaagcaaattcacccaagaggagtagacggcaggaaataatcaaactcaggggtga 120 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3193 aaaggaagcaaattcacccaagaggagtagacggcaggaaataatcaaactcaggggtga 3252 Query: 121 aatcaaccaagtggaaacaagaagaactattcaaagaattaaccaaacgaggagttggtt 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3253 aatcaaccaagtggaaacaagaagaactattcaaagaattaaccaaacgaggagttggtt 3312 Query: 181 ctttgagaaaatcaacaagatagataaacccttagctagactcactaaagggcacaggga 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3313 ctttgagaaaatcaacaagatagataaacccttagctagactcactaaagggcacaggga 3372 Query: 241 caaaatcctaattaacaaaatcagaaatgaaaagggagacataacaacagatcctgaaga 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3373 caaaatcctaattaacaaaatcagaaatgaaaagggagacataacaacagatcctgaaga 3432 Query: 301 aatccaaaacaccatcagatccttctacaaaaggctatactcaacaaaactggaaaacct 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3433 aatccaaaacaccatcagatccttctacaaaaggctatactcaacaaaactggaaaacct 3492 Query: 361 ggacgaaatggacaaatttctggacagataccaggtaccaaagttgaatcaggatcaagt 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3493 ggacgaaatggacaaatttctggacagataccaggtaccaaagttgaatcaggatcaagt 3552 Query: 421 tgaccatctaaacagtcccatatcacctaaagaaatagaagcagttattaatagtctccc 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3553 tgaccatctaaacagtcccatatcacctaaagaaatagaagcagttattaatagtctccc 3612 Query: 481 a 481 | Sbjct: 3613 a 3613

PAGE 125

112 Partial 3 mRNA sequence for AY053456b 3061 aacgtaccca aacctatggg acacaatgaa agcatttcta agagggaaac tcatagcgct 3121 gagtgcctcc aagcaagaaac gggagacagc acatactagc agcttgacaa cacatctaaa 3181 agccctagaa aaaaaggaag caaattcacc caagaggagt agacggcagg aaataatcaa 3241 actcaggggt gaaatcaacc aagtggaaac aagaagaact attcaaagaa ttaaccaaac 3301 gaggagttgg ttctttgaga aaatcaacaa gatagataaa cccttagcta gactcactaa 3361 agggcacagg gacaaaatcc taattaacaa aatcagaaat gaaaagggag acataacaac 3421 agatcctgaa gaaatccaaa acaccatcag atccttctac aaaaggctat actcaacaaa 3481 actggaaaac ctggacgaaa tggacaaatt tctggacaga taccaggtac caaagttgaa 3541 tcaggatcaa gttgaccatc taaacagtcc catatcacct aaagaaatag aagcagttat 3601 taatagtctc ccaaccaaaa aaadgcccagg accagatggg tttagtgcag agttctatca 3661 gaccttcaaa gaagatctaa ttccaattct gcacaaacta tttcacaaaa tagaagtaga 3721 aggtactcta cccaactcat tttatgaagc cactattact ctgataccta aaccacagaa b1 of 2 equally probable matches to an L1 ORF2; however, due to high genomic hits difficult to assess biological significance here cARP1 annealing site dAP3 annealing site

PAGE 126

113 3,2,4Zn+ ZnN Zn3,2,4Zn+ Zn+ ZnN ZnN ZnZnDifferential Display Band 3,2,4 Figure C-4. Autoradiograph of DD band 3,2,4. These cDNAs/ESTs were generated with 3 AP3 and 5 ARP2. Identity of band 3, 2,4: Heat shock protein 40 (Hsp40), alternatively DnaJ homo log subfamily A me mber 1 (Dnaja1). Band 3,2,4 Single Read Sequence Data 1 CATGGaGGATA TAAAATGNGT GCTAAATGAA GGTATGCCAA TATACCGTCG 51 GCCATATGAA AAGGGACGTC TAATCATTGA GTTTAAGGTA AACTTTCCTG 101 AAAATGGCTT TCTCTCTCCT GATAAACTCT CTTTGCTGGA AAAACTCCTT 151 CCTGAAAGGA AGGAAGTAGA AGAGACTGAT GAAATGGATC AGGTAGAACT 201 GGTGGACTTT GATCCAAATC AGGAAAGACG GCGTCATTAT AATGGAGAAG 251 CGTATGAGGA TGATGAACAT CNCCCCAGAG GTGGCGNTCA GTGTCAGACC 301 TCTTAATGGG CCAGTCACTC TTTGACATTC TGTATGCAGT AGTGAATGTG 351 GGAAGGACTG TAATCATAAT AAGCTCACTA CTTGGCTATT GTTTTTGTTT 401 TAATATTCAA CTATAGTAGT GCTTTAAAAA AAGCTAAGTG AAGAATAAAC 451 ACNGGTATNA NAGCCCAAAA AAAAAAAb aARP2 annealing site bAP3 annealing site

PAGE 127

114 BLAST Alignment for 3,2,4 Alignment of 324 to ref|NM_008298.1| Mus musculus DnaJ (Hsp40) homolog, subfamily A, member 1 (Dnaja1), mRNA Length = 2242 Score = 811 bits (409), Expect = 0.0 Identities = 417/421 (99%) Strand = Plus / Plus Query: 1 catggggatataaaatgngtgctaaatgaaggtatgccaatataccgtcggccatatgaa 60 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Sbjct: 980 catggggatataaaatgtgtgctaaatgaaggtatgccaatataccgtcggccatatgaa 1039 Query: 61 aagggacgtctaatcattgagtttaaggtaaactttcctgaaaatggctttctctctcct 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1040 aagggacgtctaatcattgagtttaaggtaaactttcctgaaaatggctttctctctcct 1099 Query: 121 gataaactctctttgctggaaaaactccttcctgaaaggaaggaagtagaagagactgat 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1100 gataaactctctttgctggaaaaactccttcctgaaaggaaggaagtagaagagactgat 1159 Query: 181 gaaatggatcaggtagaactggtggactttgatccaaatcaggaaagacggcgtcattat 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1160 gaaatggatcaggtagaactggtggactttgatccaaatcaggaaagacggcgtcattat 1219 Query: 241 aatggagaagcgtatgaggatgatgaacatcnccccagaggtggcgntcagtgtcagacc 300 ||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| Sbjct: 1220 aatggagaagcgtatgaggatgatgaacatcaccccagaggtggcgttcagtgtcagacc 1279 Query: 301 tcttaatgggccagtcactctttgacattctgtatgcagtagtgaatgtgggaaggactg 360 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 1280 tcttaatgggccagtcactctttgacattctgtatgcagtagtgaatgngggaaggactg 1339 Query: 361 taatcataataagctcactacttggctattgtttttgttttaatattcaactatagtagt 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1340 taatcataataagctcactacttggctattgtttttgttttaatattcaactatagtagt 1399 Query: 421 g 421 | Sbjct: 1400 g 1400

PAGE 128

115 Partial 3 mRNA Sequence for NM_008298c 901 gtgcggcttc caaaagccaa tatctactct tgacaaccga accatagtca tcacctctca 961 tccaggtcag attgtcaagc atggdggatat aaaatgtgtg ctaaatgaag gtatgccaat 1021 ataccgtcgg ccatatgaaa agggacgtct aatcattgag tttaaggtaa actttcctga 1081 aaatggcttt ctctctcctg ataaactctc tttgctggaa aaactccttc ctgaaaggaa 1141 ggaagtagaa gagactgatg aaatggatca ggtagaactg gtggactttg atccaaatca 1201 ggaaagacgg cgtcattata atggagaagc gtatgaggat gatgaacatc accccagagg 1261 tggcgttcag tgtcagacct cttaatgggc cagtcactct ttgacattct gtatgcagta 1321 gtgaatgngg gaaggactgt aatcataata agctcactac ttggctattg tttttgtttt 1381 aatattcaac tatagtagtg ttttaaaaaa agttaaatga agaataaaeca caaatataaa 1441 agctctgact ttgccctgta tgtatgatga cttcagtgtt caagatgaaa atgaatactt cCDS 92..1285 dARP2 annealing site eUniversal polyadenylati on sequence (AATAAA)

PAGE 129

116 Zn+ ZnN Zn9,6,1 Zn+ Zn+ ZnN ZnN ZnZn9,6,1Differential Display Band 9,6,1 Figure C-5. Autoradiograph of DD band 9,6,1. These cDNAs/ESTs were generated with 3 AP9 and 5 ARP6. Identity of band 9, 6,1: Histocompatibility 2 class II antigen A, alpha (H2-A). Band 9,6,1 Single Read Sequence Data 1 CCTCAAGCGA CTGNGTTCCC CAAGTCCCCT GTGCTGCTGG GTCAGCCCAA 51 CACCCTTATC TGCTTTGTGG ACAACATCTT CCCACCTGTG ATCAACATCA 101 CATGGCTCAG AAATAGCAAG TCAGTCACAG ACGGCGTTTA TGAGACCAGC 151 TTCCTCGTCA ACCGTGACCA TTCCTTCCAC AAGCTGTCTT ATCTCACCTT 201 CATCCCTTCT GATGATGACA TTTATGACTG CAAGGTGGAG CACTGGGGCC 251 TGGAGGAGCC GGTTCTGAAA CACTGGGAAC CTGAGATTCC AGCCCCCATG 301 TCAGAGCTGA CAGAAACTGT GGTGTGTGCC CTGGGGTTGT CTGTGGGCCT 351 TGTGGGCATC GTGGTGGGCA CCATCTTCAT CATTCAAGGC CTGCGATCAG 401 GTGGCACCTC CAGACACCCA GGGCCTTTAT GAGTCACACC CTGGAAAGGA 451 AGGTGTGTGT CCCTCTTCAT GGAAGAAGTG GTGTGCTGGG TGACCTGGCA 501 CAGTGTGTTT TCTGGACCAA TTTATGGTGT TCTTTTTCTT CTTCAAGTGA 551 CCCCCAACTT GCTTTTCCCT TGGCCCTGAG GCTGTCCCTC TCACAGCTCA 601 CACACCCTTG GAATTCTTCC CTGATCTGAA TTTTGTTTTC TGGCATCTTC 651 CAAGTCACAT CTACTGCAGA CTCTCTCAGA GACCCTGATC CACAAAAACC 701 AATAAAATCT CTTCTTGTAA AAAAAAAAAa aAP9 annealing site

PAGE 130

117 BLAST Alignment for BC019721 Alignment of 13oMOORE_961R-48.txt to gb|BC019721.1|BC019721 Mus musculus, histocompatibility 2, class II antigen A, alpha, clone MGC:30249 IMAGE:3669693, mRNA, complete cds Length = 1084 Score = 1255 bits (633), Expect = 0.0 Identities = 696/716 (97%), Gaps = 1/716 (0%) Strand = Plus / Plus Query: 1 cctcaagcgactgngttccccaagtcccctgtgctgctgggtcagcccaacacccttatc 60 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 345 cctcaagcgactgtgttccccaagtcccctgtgctgctgggtcagcccaacaccctcatc 404 Query: 61 tgctttgtggacaacatcttcccacctgtgatcaacatcacatggctcagaaatagcaag 120 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct: 405 tgctttgtggacaacatcttccctcctgtgatcaacatcacatggctcagaaatagcaag 464 Query: 121 tcagtcacagacggcgtttatgagaccagcttcctcgtcaaccgtgaccattccttccac 180 |||||| ||||||| |||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 465 tcagtcgcagacggtgtttatgagaccagcttcttcgtcaaccgtgactattccttccac 524 Query: 181 aagctgtcttatctcaccttcatcccttctgatgatgacatttatgactgcaaggtggag 240 |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Sbjct: 525 aagctgtcttatctcaccttcatcccttctgacgatgacatttatgactgcaaggtggaa 584 Query: 241 cactggggcctggaggagccggttctgaaacactgggaacctgagattccagcccccatg 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 585 cactggggcctggaggagccggttctgaaacactgggaacctgagattccagcccccatg 644 Query: 301 tcagagctgacagaaactgtggtgtgtgccctggggttgtctgtgggccttgtgggcatc 360 |||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| Sbjct: 645 tcagagctgacagagactgtggtctgtgccctggggttgtctgtgggccttgtgggcatc 704 Query: 361 gtggtgggcaccatcttcatcattcaaggcctgcgatcaggtggcacctccagacaccca 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 705 gtggtgggcaccatcttcatcattcaaggcctgcgatcaggtggcacctccagacaccca 764 Query: 421 gggcctttatgagtcacaccctggaaaggaaggtgtgtgtccctcttcatggaagaagtg 480 ||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| Sbjct: 765 gggcctttatgagtcacaccctggaaaggaaggcgtgtgtccctcttcagggaagaagtg 824 Query: 481 gtgtgctgggtgacctggcacagtgtgttttctggaccaatttatggtgttctttttctt 540 |||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| Sbjct: 825 gtgtgctgggtgacctggcacagtgtgttttctggaccaattcatggtgttctttctctt 884 Query: 541 cttcaagtgacccccaacttgcttttcccttggccctgaggctgtccctctcacagctca 600 ||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||| Sbjct: 885 cttcaagtgacccccaacttgcttttctcttgaccctgaggctgtccctctcacagctca 944 Query: 601 cacacccttggaattcttccctgatctgaattttgttttctggcatcttccaagtcacat 660 |||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| Sbjct: 945 cacacccttggaattcttccctgatctgaattttgttttctgtcatcttccaagttacat 1004

PAGE 131

118 Query: 661 ctactgcagactctctcagagaccctgatccacaaaaaccaataaaatctcttctt 716 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct: 1005 ctactgcagactctctcagagaccctgatccac-aaaaccaataaaatctcttctt 1059 Partial 3 mRNA Sequence for BC019721b 301 tcttgactaa gaggtcaaat tccaccccag ctaccaatga ggcctcdctcaa gcgactgtgt 361 tccccaagtc ccctgtgctg ctgggtcagc ccaacaccct catctgcttt gtggacaaca 421 tcttccctcc tgtgatcaac atcacatggc tcagaaatag caagtcagtc gcagacggtg 481 tttatgagac cagcttcttc gtcaaccgtg actattcctt ccacaagctg tcttatctca 541 ccttcatccc ttctgacgat gacatttatg actgcaaggt ggaacactgg ggcctggagg 601 agccggttct gaaacactgg gaacctgaga ttccagcccc catgtcagag ctgacagaga 661 ctgtggtctg tgccctgggg ttgtctgtgg gccttgtggg catcgtggtg ggcaccatct 721 tcatcattca aggcctgcga tcaggtggca cctccagaca cccagggcct ttatgagtca 781 caccctggaa aggaaggcgt gtgtccctct tcagggaaga agtggtgtgc tgggtgacct 841 ggcacagtgt gttttctgga ccaattcatg gtgttctttc tcttcttcaa gtgaccccca 901 acttgctttt ctcttgaccc tgaggctgtc cctctcacag ctcacacacc cttggaattc 961 ttccctgatc tgaattttgt tttctgtcat cttccaagtt acatctactg cagactctct 1021 cagagaccct gatccacaaa accaataaaae tctcttcttfa tatgtgtgtgca aaaaaaaaaa 1081 aaaag bCDS 6..776 cARP6 annealing site dBeginning of identities with DD band 9,6,1 eUniversal polyadenylati on sequence (AATAAA) fEnd of identities with DD band 9,6,1 gPossible AP9 annealing sites

PAGE 132

119 ZnPF Zn+ ZnN 10,7,2 ZnPF Zn+ ZnN ZnZnPF Zn+ Zn+ ZnN 10,7,2Differential Display Band 10,7,2D Figure C-6. Autoradiograph of DD band 10,7,2. These cDNAs/ESTs were generated with 3 AP10 and 5 ARP7. Identity of band 10,7,2D: Heat shock protein 60kDa, alternatively chaperonin. Band 10,7,2 had several subclones; D, unlike G (Appendix B, Figure B-4) demonstr ated alternate modul ation from that visible on display. Band/subclone 10,7,2D Single Read Data 1 AGCGGATAAC AATTTCACAC AGGATGGATT GGTCaTCTGCG TGGTTTTTAT 51 TCATAAATTA TTTTACTAAA ATTTTTTCTA GGTTGTGAGA ACTGCCTTAC 101 TGGATGCTGC TGGGGTGGCC TCCTTGCTAA CTACAGCCGA AGCTGTAGTG 151 ACAGAAATTC CTAAAGAAGA GAAGGACCCT GGAATGGGTG CAATGGGTGG 201 CATGGGAGGG GGTATGGGAG GCGGCATGTT CTAACTCCTA GAGTAGTGCT 251 TTGCCCTTAT CAATGAACTG TGACAGGAAG CTCAAGGCAG GTTCCTCACC 301 AATAACTTCA GAGAAGTCAC CTGGAGAAAA TGACTGAAGA GAAGGCTGGC 351 TGACCACTGT AATCATCAGT TACTGGTTTC CTTTGACGAT ATATAATGGT 401 TTACTGCTGT CATTGTCCAT GCCTACAGAT AATTTATTTT GTATTTTTGA 451 ATAAAGACAT TTGTACATTC CTAAAAAAAA AAAbGCCCTAT AGTGAGTCGT 501 ATTAC aARP7 annealing site bAP10 annealing site

PAGE 133

120 BLAST alignment for 10,7,2D Score = 727 bits (378), Expect = 0.0 Identities = 388/393 (98%) Strand = Plus / Plus Query: 1610 aggttgtaagaactgccttactggatgctgctggagtggcctccttgctaactacagccg 1669 ||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 80 aggttgtgagaactgccttactggatgctgctggggtggcctccttgctaactacagccg 139 Query: 1670 aagctgtagtgacagaaattcctaaagaagagaaggaccctggaatgggtgcaatgggtg 1729 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 140 aagctgtagtgacagaaattcctaaagaagagaaggaccctggaatgggtgcaatgggtg 199 Query: 1730 gcatgggagggggtatgggaggcagcatgctctaactcctagagtagtgctttgccctta 1789 ||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| Sbjct: 200 gcatgggagggggtatgggaggcggcatgttctaactcctagagtagtgctttgccctta 259 Query: 1790 tcaatgaactgtgacaggaagctcaaggcaggttcctcaccaataacttcagagaagtca 1849 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 260 tcaatgaactgtgacaggaagctcaaggcaggttcctcaccaataacttcagagaagtca 319 Query: 1850 cctggagaaaatgactgaagagaaggctggctgaccactgtaatcatcagttactggttt 1909 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 320 cctggagaaaatgactgaagagaaggctggctgaccactgtaatcatcagttactggttt 379 Query: 1910 cctttgatgatatataatggtttactgctgtcattgtccatgcctacagataatttattt 1969 ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 380 cctttgacgatatataatggtttactgctgtcattgtccatgcctacagataatttattt 439 Query: 1970 tgtatttttgaataaagacatttgtacattcct 2002 ||||||||||||||||||||||||||||||||| Sbjct: 440 tgtatttttgaataaagacatttgtacattcct 472 Partial 3 mRNA sequence for XM_109908d 1561 cttggagatt ttgtgaacat ggtggaaaaa gggatcattg atccaacaaae ggttgtaaga 1621 actgccttac tggatgctgc tggagtggcc tccttgctaa ctacagccga agctgtagtg 1681 acagaaattc ctaaagaaga gaaggaccct ggaatgggtg caatgggtgg catgggaggg 1741 ggtatgggag gcagcatgct ctaactccta gagtagtgct ttgcccttat caatgaactg 1801 tgacaggaag ctcaaggcag gttcctcacc aataacttca gagaagtcac ctggagaaaa 1861 tgactgaaga gaaggctggc tgaccactgt aatcatcagt tactggtttc ctttgatgat 1921 atataatggt ttactgctgt cattgtccat gcctacagat aatttatttt gtatttttga 1981 ataaafgacat ttgtacattc ctggatgctgg gtgcaagagc catataccag tgtcctgctt 2041 tcaacttaaa tcactgaggc atctctactg ttctgttagc atcaggactg tagcactgtg dGene 1..2217, CDS 988..1764 eBegin sequence identity with 10,7,2D fUniversal polyadenylation sequence (AATAAA) gAP10 annealing site

PAGE 134

121 2,8,1Zn-ZnNZn+ 2,8,1Zn-ZnNZn+ Zn-ZnNZn+ A PPENDIX D DIFFERENTIAL DISPLAY TRANSCRIPTS DECREASED IN ZINC-SUPPLEMENTED MICE Differential Display Band 2,8,1 Figure D-1. Autoradiograph of DD band 2,8,1. These cDNAs/ESTs were generated with 3 AP2 and 5 ARP8. Identity of band 2, 8,1: Similar to matrin cyclophilin. DD band single read sequence data 1 TGGTAAAGGG AAAGATCAGG ATAGGAGTGG AGGCGANGAG AACTCCAAGC 51 AGGTAGAATC AAAAGGTNAT GAACATGATC ATAGCAAAAA AAAAAAa aAP2 annealing site BLAST alignment for 2,8,1 Alignment of 52oMOORE_281R-48.txt to ref|XM_130275.1| Mus musculus similar to matrin cyclophilin (matrin-cyp) (LOC228005), mRNA Length = 4809 Score = 103 bits (52), Expect = 3e-20 Identities = 74/82 (90%) Strand = Plus / Plus

PAGE 135

122 Query: 4 taaagggaaagatcaggataggagtggaggcgangagaactccaagcaggtagaatcaaa 63 |||||||||||||||||| |||||| || || | ||||||||||| |||||||||||||| Sbjct: 1671 taaagggaaagatcaggaaaggagtagaagcaaagagaactccaaacaggtagaatcaaa 1730 Query: 64 aggtnatgaacatgatcatagc 85 | || ||||||||||||||||| Sbjct: 1731 aagtaatgaacatgatcatagc 1752 Partial 3 mRNA Sequence for XM_130275b 1561 agtaaggagc gagactcgaa gcacagcaga cacgaagaca agagggtgag gtcaagaagt 1621 aaagaaaggg atcatgagac tactaaagaa aaagaaaaac cactggatcc taaagggcaaa 1681 gatcaggaaa ggagtagaag caaagagaac tccaaacagg tagaatcaaa aagtaatgaa 1741 catgatcata gcaaaadgtaa agaaaaggat agacgtgcac agtccaggag tagagaacgg 1801 gatctgacta aaagtaaaca cagttacaat cagtagaaca agggagcgga gcagaagtag 1861 ggacaggagc agaagagtgc ggtccagaag ccacgacaga gatcgcagca gaagcaagga bGene 1..4809; CDS 157..1836 cARP8 dAP2 annelaing site

PAGE 136

123 ZnPF Zn+ ZnN 3,8,2C ZnZnPF Zn+ Zn+ ZnN 3,8,2CDifferential Display Band 3,8,2C Figure D-2. Autoradiograph of DD band 3,8,2C. These cDNAs/ESTs were generated with 3 AP3 and 5 ARP8. Identity of band 3,8,2C: Ribosomal protein L28. Band 3,8,2C Single Read Sequence Data 1 CGGATAACAA TTTCACACAG GATGGTAAAG GGaGTCGTGGT AGTTATGAAA 51 CGCAGATCCG GTCAGCGAAA ACCTGCCACT TCTTATGTGA GGACCACCAT 101 CAACAAGAAT GCTCGGGCTA CCCTCAGCAG CATCAGACAC ATGATCCGAA 151 AGAACAAGTA CCGCCCTGAT CTGCGTATGG CGGCCATCCG CAGGGCCAGT 201 GCCATCCTTC GAAGCCAGAA GCCTGTGGTG GTGAAGAGGA AACGGACCCG 251 CCCCACCAAG AGCTCCTGAG CCCCACACGC CCGAAGCAAT AAAGAGTCCA 301 CTGACTTCCA TTAGGCCTCCb aARP8 annealing site bAP3 annealing site

PAGE 137

124 BLAST Alignment for 3,8,2C Score = 565 bits (294), Expect = e-158 Identities = 296/297 (99%) Strand = Plus / Plus Query: 236 gatggaaaaggggtcgtggtagttatgaaacgcagatccggtcagcgaaaacctgccact 295 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 21 gatggtaaaggggtcgtggtagttatgaaacgcagatccggtcagcgaaaacctgccact 80 Query: 296 tcttatgtgaggaccaccatcaacaagaatgctcgggctaccctcagcagcatcagacac 355 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 81 tcttatgtgaggaccaccatcaacaagaatgctcgggctaccctcagcagcatcagacac 140 Query: 356 atgatccgaaagaacaagtaccgccctgatctgcgtatggcggccatccgcagggccagt 415 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 141 atgatccgaaagaacaagtaccgccctgatctgcgtatggcggccatccgcagggccagt 200 Query: 416 gccatccttcgaagccagaagcctgtggtggtgaagaggaaacggacccgccccaccaag 475 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 201 gccatccttcgaagccagaagcctgtggtggtgaagaggaaacggacccgccccaccaag 260 Query: 476 agctcctgagccccacacgcccgaagcaataaagagtccactgacttccattaggcc 532 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 261 agctcctgagccccacacgcccgaagcaataaagagtccactgacttccattaggcc 317 Partial 3 mRNA Sequence for NM_009081c 181 cttccgctac aacgggctaa ttcaccgcaa gaccgtcgga gtggagccgg ccgccgatgg 241 aaaagggdgtc gtggtagtta tgaaacgcag atccggtcag cgaaaacctg ccacttctta 301 tgtgaggacc accatcaaca agaatgctcg ggctaccctc agcagcatca gacacatgat 361 ccgaaagaac aagtaccgcc ctgatctgcg tatggcggcc atccgcaggg ccagtgccat 421 ccttcgaagc cagaagcctg tggtggtgaa gaggaaacgg acccgcccca ccaagagctc 481 ctgagcccca cacgcccgaa gcaataaaga gtccactgac ttccattagg ccaaaaaaaa 541 aaaaaaaaaec tcgag cCDS 71..484 dARP8 annealing site eAP3 annealing site

PAGE 138

125 3,7,1 Zn-ZnNZn+ 3,7,1 Zn-ZnNZn+ Zn-ZnNZn+ Differential Display Band 3,7,1 Figure D-3. Autoradiograph of DD band 3,7,1. These cDNAs/ESTs were generated with 3 AP3 and 5 ARP7. Identity of band 3,7,1: Hypothetical gene supported by accessi on BC010584 (XM_129835) and similar to putative protein kinase (XM_110350). Band 3,7,1 Single Sequence Read Data 1 GGACACANNT CAGGCTTCNN CTATCAAGTC ACATGGTCCA TCCGAGAAAC 51 CCTCAGACAT GAAAGACACA CGTCAGACGA CGACGACATG GAGAGCAGGA 101 GCTCCAGGGT GACCCAACTT TGCACTTACT TTCAGCAGAA ATACAAGCAC 151 CTCTGCCGCC TGGAGCGGGC AGAGTCTCGA CAAAAGAAGT GCCGGCATAC 201 ATTTAGGAAG GCACTGCTGC AGGCTGCCAG TAAGGAACCC GAATGCACTG 251 GTCAGCTGAT ACAAGAACTA CGGAGAGCTG CGTGCAGCCG AGCCAGCCTT 301 CGCCAGACCA AGTTGAAGGA GGTGGAGCCA GCAGCATGTA GTGGAACAGT 351 GAAGGGCGAA CAGTGCACAA AGCAGGCCCT TCCCTTCACC AGACACTGTT 401 TCCAGCACAT CCTCCTGAAC CGCTCTCAGC AGCTCTTCTC CAGCTGCACT 451 GCCAAGTTTG CAGACGGACA GCAGTGCTCT GTGCCAGTGT TTGACATTAC 501 ACACCAGACG CCCCTGTGTG AAGAACATGC CAAAAAGATG GATAATTTCC 551 TGAGAGGAGA TAACTCCCGT AAAGTTCAGC ACCAG

PAGE 139

126 BLAST Alignment for 3,7,1 Alignment of 371 to ref|XM_129835.1| Mus musculus hypothetical gene supported by BC010584 (LOC227195), mRNA Length = 1947 Score = 1110 bits (560), Expect = 0.0 Identities = 563/564 (99%) Strand = Plus / Plus Query: 22 tatcaagtcacatggtccatccgagaaaccctcagacatgaaagacacacgtcagacgac 81 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1333 tatcaagtcgcatggtccatccgagaaaccctcagacatgaaagacacacgtcagacgac 1392 Query: 82 gacgacatggagagcaggagctccagggtgacccaactttgcacttactttcagcagaaa 141 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1393 gacgacatggagagcaggagctccagggtgacccaactttgcacttactttcagcagaaa 1452 Query: 142 tacaagcacctctgccgcctggagcgggcagagtctcgacaaaagaagtgccggcataca 201 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1453 tacaagcacctctgccgcctggagcgggcagagtctcgacaaaagaagtgccggcataca 1512 Query: 202 tttaggaaggcactgctgcaggctgccagtaaggaacccgaatgcactggtcagctgata 261 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1513 tttaggaaggcactgctgcaggctgccagtaaggaacccgaatgcactggtcagctgata 1572 Query: 262 caagaactacggagagctgcgtgcagccgagccagccttcgccagaccaagttgaaggag 321 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1573 caagaactacggagagctgcgtgcagccgagccagccttcgccagaccaagttgaaggag 1632 Query: 322 gtggagccagcagcatgtagtggaacagtgaagggcgaacagtgcacaaagcaggccctt 381 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1633 gtggagccagcagcatgtagtggaacagtgaagggcgaacagtgcacaaagcaggccctt 1692 Query: 382 cccttcaccagacactgtttccagcacatcctcctgaaccgctctcagcagctcttctcc 441 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1693 cccttcaccagacactgtttccagcacatcctcctgaaccgctctcagcagctcttctcc 1752 Query: 442 agctgcactgccaagtttgcagacggacagcagtgctctgtgccagtgtttgacattaca 501 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1753 agctgcactgccaagtttgcagacggacagcagtgctctgtgccagtgtttgacattaca 1812 Query: 502 caccagacgcccctgtgtgaagaacatgccaaaaagatggataatttcctgagaggagat 561 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1813 caccagacgcccctgtgtgaagaacatgccaaaaagatggataatttcctgagaggagat 1872 Query: 562 aactcccgtaaagttcagcaccag 585 |||||||||||||||||||||||| Sbjct: 1873 aactcccgtaaagttcagcaccag 1896

PAGE 140

127 Partial 3 mRNA Sequence for XM_129835a 1261 tttcctcatt taggattgga ttggtcbtgag gagagcggag aggagttgga ggacgcagat 1321 caggcttcgc catcatcaagt cgcatggtcc atccgagaaa ccctcagaca tgaaagacac 1381 acgtcagacg acgacgacat ggagagcagg agctccaggg tgacccaact ttgcacttac 1441 tttcagcaga aatacaagca cctctgccgc ctggagcggg cagagtctcg acaaaagaag 1501 tgccggcata catttaggaa ggcactgctg caggctgcca gtaaggaacc cgaatgcact 1561 ggtcagctga tacaagaact acggagagct gcgtgcagcc gagccagcct tcgccagacc 1621 aagttgaagg aggtggagcc agcagcatgt agtggaacag tgaagggcga acagtgcaca 1681 aagcaggccc ttcccttcac cagacactgt ttccagcaca tcctcctgaa ccgctctcag 1741 cagctcttct ccagctgcac tgccaagttt gcagacggac agcagtgctc tgtgccagtg 1801 tttgacatta cacaccagac gcccctgtgt gaagaacatg ccaaaaagat ggataatttc 1861 ctgagaggag ataactcccg taaagttcag caccagdcaac agaggaaacc taggaaaaaa 1921 aecgaagcccc ctgcacttac caaaaaa aGene 1..1947; CDS 329..616 bARP7 annealing site c,dBegin, end sites of identities eAP3 annealing site

PAGE 141

128 Zn-ZnNZn+ Zn-ZnNZn+ 3,7,2 Differential Display Band 3,7,2 Figure D-4. Autoradiograph of DD band 3,7,2. These cDNAs/ESTs were generated with 3 AP3 and 5 ARP7. Identity of band 3, 7,2: Ribosomal protein L3 (Rpl3). Band 3,7,2 Single Read Sequence Data 1 AAGGCTACCT CATCAAGGAT GGCAAACTGA TCAAGAACAA TGCATCTACT 51 GACTATGACT TGTCTGACAA GAGCATCAAC CCACTGGGTG GCTTTGTGCA 101 TTATGGTGAG GTGACCAATG ACTTCATCAT GCTCAAAGGC TGTGTGGTGG 151 GGACCAG BLAST Alignment for 3,7,2 Alignment of 372 to ref|NM_013762.1| Mus musculus ribosomal protein L3 (Rpl3), mRNA Length = 1276 Score = 309 bits (156), Expect = 4e-82 Identities = 156/156 (100%) Strand = Plus / Plus Query: 1 aaggctacctcatcaaggatggcaaactgatcaagaacaatgcatctactgactatgact 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 875 aaggctacctcatcaaggatggcaaactgatcaagaacaatgcatctactgactatgact 934 Query: 61 tgtctgacaagagcatcaacccactgggtggctttgtgcattatggtgaggtgaccaatg 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 935 tgtctgacaagagcatcaacccactgggtggctttgtgcattatggtgaggtgaccaatg 994 Query: 121 acttcatcatgctcaaaggctgtgtggtggggacca 156 ||||||||||||||||||||||||||||||||||||

PAGE 142

129 Sbjct: 995 acttcatcatgctcaaaggctgtgtggtggggacca 1030 Partial 3 mRNA Sequence for NM_013762a 841 acagagatta acaagaagat ttacaagatt ggtcbaaggct acctcatcaa ggatggcaaa 901 ctgatcaaga acaatgcatc tactgactat gacttgtctg acaagagcat caacccactg 961 ggtggctttg tgcattatgg tgaggtgacc aatgacttca tcatgctcaa aggctgtgtg 1021 gtggggacca agaagcgagt acttactctt cgtaagtcct tgctggttca gaccaaaccgt 1081 cgggccctgg agaagattga cctgaagttc attgacacca cctccaaactt tggccatggt 1141 cgcttccaga ccatggagga gaagaaagca tttatgggac cactcaagaa agatcgcatt 1201 gccaaggagg aaggagcttg attccaggac cactttgtgc agatggtggg gtctcaccaa 1261 taaadatattt ctactc aCDS 10..1221 bARP7 annealing site cPossible AP3 annealing sites dUniversal polyadenylation sequence (AATAAA) preceeded by nt s. CC, also possible AP3 annealing site

PAGE 143

130 ZnPF Zn+ ZnN 7,6,2G ZnPF Zn+ ZnN ZnZnPF Zn+ Zn+ ZnN 7,6,2GDifferential Display Band 7,6,2G Figure D-5. Autoradiograph of DD band 7,6,2G. These cDNAs/ESTs were generated with 3 AP7 and 5 ARP6. Identity of band 7, 6,2G: Axonemal dynein heavy chain 8 short form (Dnahc8). Band 7,6,2G Single Read Sequence Data 1 AGCTCCACCG CGGTGGCGGC CGCTCTAGCC CGTAATACGA CTCACTATAG 51 GGCTTTTTTT TTTTCGaAGGT CCAGAAACGC CTGCCAATCT TTGAGTGCCC 101 TGGGGAGTTT TCGACATCTG TTCTGGAATT CCTGCAGCTC TGCATTGATC 151 TTTTCGATGT CTACATCTCC CCAGAGGATC TCATAGTAGC CACTGATGCT 201 GCCCATGACA GTGTCGTACA AGCCATACAG CTTCAGAAGC AAGTTGAGCT 251 CTTTTCTGGT TTTGTGTAAA ACCTCGTAGT CAGTCACAGG TAATCCAAAA 301 AGTTGCTCCC CGGATGAATA TGTGACAAAT TTCCTCCATA AATCGTCGAA 351 ATTGGCCTGG AATATCTGCA GCCTGTTGCT AGCCTCGTTG TATCCTGTGT 401 GAAATbTGTTA TCCGCTGGGC GGATCCCCCG GGCTGCAGGA ATTCGATATC 451 AAGCTTATCG ATACCGTCGA CCTCGAGGGG GGGCCC aEntire AP7 preceded by vector sequence bEntire ARP6 followed by vector sequence

PAGE 144

131 BLAST Alignment for 7,6,2G Alignment of 762grnp.seq.txt to gb|AF356521.1|AF356521 Mus musculus axonemal dynein heavy chain 8 short form (Dnahc8) mRNA, complete cds, alternatively spliced Length = 13457 Score = 611 bits (308), Expect = e-172 Identities = 314/316 (99%) Strand = Plus / Minus Query: 1 aggtccagaaacgcctgccaatctttgagtgccctggggagttttcgacatctgttctgg 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4979 aggtccagaaacgcctgccaatctttgagtgccctggggagttttcgacatctgttctgg 4920 Query: 61 aattcctgcagctctgcattgatcttttcgatgtctacatctccccagaggatctcatag 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4919 aattcctgcagctctgcattgatcttttcgatgtctacatctccccagaggatctcatag 4860 Query: 121 tagccactgatgctgcccatgacagtgtcgtacaagccatacagcttcagaagcaagttg 180 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 4859 tagccactgatgctgcccatgacagtgtcgtacaagccatacagcttctgaagcaagttg 4800 Query: 181 agctcttttctggttttgtgtaaaacctcgtagtcagtcacaggtaatccaaaaagttgc 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4799 agctcttttctggttttgtgtaaaacctcgtagtcagtcacaggtaatccaaaaagttgc 4740 Query: 241 tccccggatgaatatgtgacaaatttcctccataaatcgtcgaaattggcctggaatatc 300 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 4739 tccccagatgaatatgtgacaaatttcctccataaatcgtcgaaattggcctggaatatc 4680 Query: 301 tgcagcctgttgctag 316 |||||||||||||||| Sbjct: 4679 tgcagcctgttgctag 4664 Partial 3 mRNA sequence for AF356521c 4501 cagagcaaag ctgtttccgt acaaggtgaa cttgtgcaag tgcagcccaa atttaaaagc 4561 aacctgctcg agtcggtgaa ggtcttctgt gaggacgtta taaactttac agaagcctat 4621 gagacggaag gacccatggt accaaatatt ccaccccaag aggdctagcaa caggctgcag 4681 atattccagg ccaatttcga cgatttatgg aggaaatttg tcacatattc atctggggag 4741 caactttttg gattacctgt gactgactac gaggttttac acaaaaccag aaaagagctc 4801 aacttgcttc agaagctgta tggcttgtac gacactgtca tgggcagcat cagtggctac 4861 tatgagatcc tctggggaga tgtagacatc gaaaagatca atgcagagct gcaggaattc 4921 cagaacagat gtcgaaaact ccccagggca ctcaaagatt ggcaggcgtt tctggacctc 4981 aaaaaaaegaa tcgacgactt tagtgagtcg tgtccgctgc tggagatgat gaccaataaa 5041 gcgatgaagc agaggcattg ggaccgcatc tcagagctca ccggcacccc gttcgatgtg cGene 1..13457; CDS 253..12861 dARP6 annealing site eAP7 annealing site

PAGE 145

132 Zn-ZnNZn+ 7,13,1 Zn-ZnNZn+ Zn-ZnNZn+ 7,13,1Differential Display Band 7,13,1 Figure D-6. Autoradiograph of DD band 7,13,1. These cDNAs/ESTs were generated with 3 AP7 and 5 ARP13. Identity of band 7,13,1: Cleavage and polyadenylation factor 5, 25kDa subunit (Cpsf5). Band 7,13,1 Single Read Sequence Data 1 CAGTTACCAA TTATACTTTT GGTACAAAGG AGCCCCTCTA TGAGAAGGAC 51 AGCTCTGTTG CAGCCAGATT TCAGCGCATG AGGGAGGAAT TTGATAAGAT 101 TGGGATGAGA AGGACTGTAG AAGGGGTTCT GATTGTTCAT GAACACCGCC 151 TGCCCCACGT GCTCCTGCTG CAGCTGGGGA CAACTTTCTT CAAATTACCT 201 GGTGGGGAAC TTAACCCAGG AGAAGATGAA GTTGAAGGAC TAAAACGCTT 251 AATGACAGAG ATACTTGGTC GTCAAGATGG AGTCCTGCAA GACTGGGTCA 301 TTGATGACTG CATTGGGAAC TGGTGGAGAC CAAATTTTGA ACCTCCTCAG 351 TATCCGTATA TTCCTGCACA TATAACAAAA CCCAAGGAAC ATAAGAAGTT 401 GTTTCTGGTT CAGCTTCAAG AGAAAGCCTT GTTTGCAGTC CCTAAAAATT 451 ACAAGCTGGT AGCTGCACCA TTGTTTGAGC TGTATGACAA TGCACCGGGG 501 TATGGACCCA TCATTTCTAG TCTTCCTCAG CTGCTGAGCA GGTTCAATTT 551 TATATACAAC TGAATTCCTG TATGCAGAAG TAAAAGAAGC CGTCTCTATG 601 AGCACAGCTT ACACGTGTAG AAGAGTAACT GTAGAACAAG TTTTGGTTTT 651 CTCTTGTTCC CTAAATTGCC ACCACCTTCC TGTTTGAAGA GTAAAATGAA 701 TATGACCGAC ATAGTGGTGG AAACATGTGG CAGTGTTCAT TAGCTTTTGG 751 TTCTACTCAT ACTTTTTTTT BLAST Alignment for 7,13,1 Alignment of 15oMOORE_7131R-48.txt to ref|NM_026623.1|

PAGE 146

133 Mus musculus cleavage and polyadenylation specific factor 5, 25 kD subunit (Cpsf5), mRNA Length = 1090 Score = 1497 bits (755), Expect = 0.0 Identities = 758/759 (99%) Strand = Plus / Plus Query: 4 ttaccaattatacttttggtacaaaggagcccctctatgagaaggacagctctgttgcag 63 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 255 ttaccaattatacttttggtacaaaggagcccctctatgagaaggacagctctgttgcag 314 Query: 64 ccagatttcagcgcatgagggaggaatttgataagattgggatgagaaggactgtagaag 123 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 315 ccagatttcagcgcatgagggaggaatttgataagattgggatgagaaggactgtagaag 374 Query: 124 gggttctgattgttcatgaacaccgcctgccccacgtgctcctgctgcagctggggacaa 183 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 375 gggttctgattgttcatgaacaccgcctgccccacgtgctcctgctgcagctggggacaa 434 Query: 184 ctttcttcaaattacctggtggggaacttaacccaggagaagatgaagttgaaggactaa 243 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 435 ctttcttcaaattacctggtggggaacttaacccaggagaagatgaagttgaaggactaa 494 Query: 244 aacgcttaatgacagagatacttggtcgtcaagatggagtcctgcaagactgggtcattg 303 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 495 aacgcttaatgacagagatacttggtcgtcaagatggagtcctgcaagactgggtcattg 554 Query: 304 atgactgcattgggaactggtggagaccaaattttgaacctcctcagtatccgtatattc 363 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 555 atgactgcattgggaactggtggagaccaaattttgaacctcctcagtatccgtatattc 614 Query: 364 ctgcacatataacaaaacccaaggaacataagaagttgtttctggttcagcttcaagaga 423 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 615 ctgcacatataacaaaacccaaggaacataagaagttgtttctggttcagcttcaagaga 674 Query: 424 aagccttgtttgcagtccctaaaaattacaagctggtagctgcaccattgtttgagctgt 483 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 675 aagccttgtttgcagtccctaaaaattacaagctggtagctgcaccattgtttgagctgt 734 Query: 484 atgacaatgcaccggggtatggacccatcatttctagtcttcctcagctgctgagcaggt 543 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 735 atgacaatgcaccggggtatggacccatcatttctagtcttcctcagctgctgagcaggt 794 Query: 544 tcaattttatatacaactgaattcctgtatgcagaagtaaaagaagccgtctctatgagc 603 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 795 tcaattttatatacaactgaattcctgtatgcagaagtaaaagaagccgtctctatgagc 854 Query: 604 acagcttacacgtgtagaagagtaactgtagaacaagttttggttttctcttgttcccta 663 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 855 acagcttacacgtgtagaagagtaactgtagaacaagttttggttttctcttgttcccta 914 Query: 664 aattgccaccaccttcctgtttgaagagtaaaatgaatatgaccgacatagtggtggaaa 723 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct: 915 aattgccaccaccttcctgtttgaagagtaaaatgaatatgaccgagatagtggtggaaa 974

PAGE 147

134 Query: 724 catgtggcagtgttcattagcttttggttctactcatac 762 ||||||||||||||||||||||||||||||||||||||| Sbjct: 975 catgtggcagtgttcattagcttttggttctactcatac 1013 Partial 3 mRNA Sequence for NM_026623a 181 caaccagttc ggcaacaagt acatccagca gaccaagccc ctcaccctgg agcgcaccatb 241 taatctgtac ccgctctacca attatacttt tggtacaaag gagcccctct atgagaagga 301 cagctctgtt gcagccagat ttcagcgcat gagggaggaa tttgataaga ttgggatgag 361 aaggactgta gaaggggttc tgattgttca tgaacaccgc ctgccccacg tgctcctgct 421 gcagctgggg acaactttct tcaaattacc tggtggggaa cttaacccag gagaagatga 481 agttgaagga ctaaaacgct taatgacaga gatacttggt cgtcaagatg gagtcctgca 541 agactgggtc attgatgact gcattgggaa ctggtggaga ccaaattttg aacctcctca 601 gtatccgtat attcctgcac atataacaaa acccaaggaa cataagaagt tgtttctggt 661 tcagcttcaa gagaaagcct tgtttgcagt ccctaaaaat tacaagctgg tagctgcacc 721 attgtttgag ctgtatgaca atgcaccggg gtatggaccc atcatttcta gtcttcctca 781 gctgctgagc aggttcaatt ttatatacaa ctgaattcct gtatgcagaa gtaaaagaag 841 ccgtctctat gagcacagct tacacgtgta gaagagtaac tgtagaacaa gttttggttt 901 tctcttgttc cctaaattgc caccaccttc ctgtttgaag agtaaaatga atatgaccga 961 gatagtggtg gaaacatgtg gcagtgttca ttagcttttg gttctactca tacttttttt 1021 tcgtacattaa agaaagtgaa tttcttattt gtattttttt taagtttctc attaaadctct 1081 gaaaaegtctt aGene 1..1090; CDS 131..814 bARP13 annealing site cStart and stop sites for sequence identity with 7,13,1 dUniversal polyadenylati on sequence (AATAAA) ePossible AP7 annealing site

PAGE 148

135 Zn-ZnNZn+ 7,20,1 Zn-ZnNZn+ Zn-ZnNZn+ 7,20,1Differential Display Band 7,20,1 Figure D-7. Autoradiograph of DD band 7,20,1. These cDNAs/ESTs were generated with 3 AP7 and 5 ARP20. Identity of band 7, 20,1: H3 histone, family 3A (H3f3a). Band 7,20,1 Single Read Sequence Data 1 GCCCTCCGTG AAATCAGACG CTATCAGAAG TCCACTGAAC TTCTGATCCG 51 CAAGCTCCCC TTTCAGCGTC TGGTGCGAGA AATTGCTCAG GACTTCAAAA 101 CAGATCTGCG CTTCCAGAGT GCAGCTATTG GTGCTTTGCA GGAGGCAAGT 151 GAGGCCTATC TGGTTGGCCT TTTTGAAGAT ACCAATCTGT GTGCTATCCA 201 TGCCAAACGT GTAACAATTA TGCCAAAAGA TATCCAGCTA GCACGCCGCA 251 TACGCGGAGA ACGTGCTTAA GAGTCCACTA TGAGGGGAAA CATTTCATTC 301 TCAAAAAAAT TTTTTTTCCT CTTCTTCCTG TTATCAGTAG TTCTGAATGT 351 TAGATATTTT TTCCATGGGG TCAAAGGTAC CTAAGTATAT GATTGCGAGT 401 GGAAACATAG GGGACAGAAT CAGGTATTGG CGTTTCTCCA CGTTCATTTG 451 TGTGTGAATT TTTAATATAA ATGCAAGATG GAAAGCATTA ATGCAAGCAA 501 AATGTTTCAG TGAACACATT TCAACAGTTC AACTTTATAA CAATTATAAA 551 TAAACCTGTT AAAATTTTCT GGACAATGCC AGCATTTGGA TTTTTTTAAA 601 ATAAGTAAAT TTCTTATTGA CGGCAACTAA ATGGTGTTTG TAGCATTTTT 651 ATCACACAGT AGATTCCATC CATTCACTAT ACTTTTCTAA CTGAGTTGTC 701 CTACATACAA GTACATGTTT TTAATGTTGT CAGTCTTCTG TGCTGTTCCT 751 GTAAGTTTGC TATTAAAATA CATTAAACGA AAAAAAAa aAP7 annealing site

PAGE 149

136 BLAST Alignment for 7,20,1 Alignment of 18oMOORE_7201R-48.txt to ref|XM_147791.1| Mus musculus H3 histone, family 3A (H3f3a), mRNA Length = 1026 Score = 1400 bits (706), Expect = 0.0 Identities = 754/775 (97%) Strand = Plus / Plus Query: 4 ctccgtgaaatcagacgctatcagaagtccactgaacttctgatccgcaagctccccttt 63 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 250 ctccgtgaaatcagacgctatcagaagtccactgaacttctgatccgcaagctccccttt 309 Query: 64 cagcgtctggtgcgagaaattgctcaggacttcaaaacagatctgcgcttccagagtgca 123 ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 310 cagggtctggtgcgagaaattgctcaggacttcaaaacagatctgcgcttccagagtgca 369 Query: 124 gctattggtgctttgcaggaggcaagtgaggcctatctggttggcctttttgaagatacc 183 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 370 gctattggtgctttgcaggaggcaagtgaggcctatctggttggcctttttgaagatacc 429 Query: 184 aatctgtgtgctatccatgccaaacgtgtaacaattatgccaaaagatatccagctagca 243 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 430 aatctgtgtgctatccatgccaaacgtgtaacaattatgccaaaagatatccagctagca 489 Query: 244 cgccgcatacgcggagaacgtgcttaagagtccactatgaggggaaacatttcattctca 303 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 490 cgccgcatatgcggagaacgtgcttaagagtccactatgaggggaaacatttcattctca 549 Query: 304 aaaaaannnnnnnncctcttcttcctgttatcagtagttctgaatgttagatattttttc 363 |||||| |||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 550 aaaaaattttttttcctcttcttcctgttatcagtagttctgaatgttagatattttttc 609 Query: 364 catggggtcaaaggtacctaagtatatgattgcgagtggaaacataggggacagaatcag 423 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 610 catggggtcaaaggtacctaagtatatgattgcgagtggaaacataggggacagaatcag 669 Query: 424 gtattggcgtttctccacgttcatttgtgtgtgaatttttaatataaatgcaagatggaa 483 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 670 gtattggcgtttctccacgttcatttgtgtgtgaatttttaatataaatgcaagatggaa 729 Query: 484 agcattaatgcaagcaaaatgtttcagtgaacacatttcaacagttcaactttataacaa 543 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 730 agcattaatgcaagcaaaatgtttcagtgaacacatttcaacagttcaactttataacaa 789 Query: 544 ttataaataaacctgttaaaattttctggacaatgccagcatttggannnnnnnaaaata 603 ||||||||||||||||||||||||||||||||||||||||||||||| |||||| Sbjct: 790 ttataaataaacctgttaaaattttctggacaatgccagcatttggatttttttaaaata 849 Query: 604 agtaaatttcttattgacggcaactaaatggtgtttgtagcatttttatcacacagtaga 663 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | Sbjct: 850 agtaaatttcttattgacagcaactaaatggtgtttgtagcatttttatcacacagtaaa 909

PAGE 150

137 Query: 664 ttccatccattcactatacttttctaactgagttgtcctacatacaagtacatgttttta 723 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 910 ttccatccattcactatacttttctaactgagttgtcctacatacaagtacatgtgctta 969 Query: 724 atgttgtcagtcttctgtgctgttcctgtaagtttgctattaaaatacattaaac 778 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 970 atgttgtcagtcttctgtgctgttcctgtaagtttgctattaaaatacattaaac 1024 Partial 3 mRNA Sequence for XM_147791b 121 agactgcccg caaatccacc ggtggtaaag cacccaggaa acaactggct acaaaagccg 181 ctcgcaagag tgtgccctct actggagggg tgaagaaacc tcatcgttta caggccctggt 241 actgtggcacd tccgtgaaat cagacgctat cagaagtcca ctgaacttct gatccgcaag 301 ctcccctttc agggtctggt gcgagaaatt gctcaggact tcaaaacaga tctgcgcttc 361 cagagtgcag ctattggtgc tttgcaggag gcaagtgagg cctatctggt tggccttttt 421 gaagatacca atctgtgtgc tatccatgcc aaacgtgtaa caattatgcc aaaagatatc 481 cagctagcac gccgcatatg cggagaacgt gcttaagagt ccactatgag gggaaacatt 541 tcattctcaa aaaaattttt tttcctcttc ttcctgttat cagtagttct gaatgttaga 601 tattttttcc atggggtcaa aggtacctaa gtatatgatt gcgagtggaa acatagggga 661 cagaatcagg tattggcgtt tctccacgtt catttgtgtg tgaattttta atataaatgc 721 aagatggaaa gcattaatgc aagcaaaatg tttcagtgaa cacatttcaa cagttcaacdt 781 ttataacaat tataaataaae cctgttaaaa ttttctggac aatgccagca tttggatttt 841 tttaaaataa gtaaatttct tattgacagc aactaaatgg tgtttgtagc atttttatca 901 cacagtaaat tccatccatt cactatactt ttctaactga gttgtcctac atacaagtac 961 atgtgcttaa tgttgtcagt cttctgtgct gttcctgtaa gtttgctatt aaaatacatt 1021 aaacta bGene 1..1026; CDS 593..703 cARP20 annealing site dStart and stop sites of 7,20,1 identities eUniversal polyadenylati on sequence (AATAAA)

PAGE 151

138 LITERATURE CITED Aggett, P.J. (1989) Severe zinc deficiency. In: Zinc in Human Biology (Mills, C.F., ed.), pp. 259-279. Springer-Verlag, New York. Aiello, L.P., Robinson, G.S., Lin, Y. W., Nishio, Y., and King, G.L. (1994) Identification of multiple genes in bovine retinal pericytes altered by exposure to elevated levels of glucos e by using mRNA differential display. Proc. Natl. Acad. Sc i. USA 91: 6231-6235. Altschul, S.F., Madden, T.L., Schaffer, A.A. Zhang, J., Zhang, Z ., Miller, W., and Lipman, D.J. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25: 3389-3402. American Institute of Nutrition (1977) Report of the Am erican Institute of Nutrition ad hoc committee on standards for nut ritional studies. J. Nutr. 107: 1340-1348. American Institute of Nutr ition (1980) Second report of the ad hoc committee for experimental animals. J. Nutr. 110: 1726-1729. Ames, B.N. (2001) DNA damage from micronut rient deficiencies is likely to be a major cause of cancer. Mutat. Res. 475: 7-20. Ashwell, J.D., Lu, F.W., and Vacchio, M. S. (2000) Glucocorticoids in T cell development and function. Annu. Rev. Immunol. 18: 309-345. Bae, J., Leo, C.P., Hsu, S.Y., and Hsueh, A.J. (2000) MCL-1S, a splicing variant of the antiapoptotic BCL-2 family member MCL-1, enc odes a proapoptotic protein possessing only the BH3 domain. J. Biol. Chem. 275: 25255-25261. Bauer, D., Muller, H., Reic h, J., Riedel, H., Ahrenk iel, V., Warthoe, P., and Strauss, M. (1993) Identification of differentially expressed mRNA species by an improved display technique (DDRT-PCR). Nucleic Acids Res. 21: 4272-4280. Beach, R.S., Gershwin, M.E., and Hurl ey, L.S. (1982) Gestational zinc deprivation in mice: persistence of immunodeficiency for three generations. Science 218: 469-471.

PAGE 152

139 Beck, F.W.J., Kaplan, J., Fine, N., Handschu, W., and Prasad, A.S. (1997a) Decreased expression of CD73 (ecto-5'nucleotidase) in the CD8+ subset is associated with zinc deficiency in human patients. J. Lab Clin. Med. 130: 147-156. Beck, F.W.J., Prasad, A.S., Kaplan, J., Fitzgerald, J. T., and Brewer, G.J. (1997b) Changes in cytokine production and T cell subpopulations in experimentally induced zinc-defic ient humans. Am. J. Physiol. 272: E1002-E1007. Benson, D.A., Karsch-Mizrachi, I., Li pman, D.J., Ostell, J., Rapp, B.A., and Wheeler, D.L. (2002) GenBank. Nu cleic Acids Res. 30: 17-20. Berg, J.M. and Shi, Y. (1996) The gal vanization of biology: a growing appreciation for the roles of zinc. Science 271: 1081-1085. Bertolaet, B.L., Clarke, D.J. Wolff, M., Watson, M.H., Henze, M., Divita, G., and Reed, S.I. (2001) UBA domains of DNA damage-inducible proteins interact with ubiquitin. Nat. Struct. Biol. 8: 417-422. Bhutta, Z.A., Bird, S.M., Black, R.E., Br own, K.H., Gardner, J.M., Hidayat, A., Khatun, F., Martorell, R., Ninh, N.X., Penny, M.E., Rosado, J.L., Roy, S.K., Ruel, M., Sazawal, S., and Shankar, A. (2000) Therapeutic effects of oral zinc in acute and persistent diarrhea in children in developing countries: pooled analysis of randomized controll ed trials. Am. J. Clin. Nutr. 72: 1516-1522. Bingle, C.D., Craig, R.W., Swales, B.M., Singleton, V., Zhou, P ., and Whyte, M.K. (2000) Exon skipping in Mcl-1 result s in a bcl-2 homology domain 3 only gene product that promotes cell deat h. J. Biol. Chem. 275: 22136-22146. Bittel, D.C., Smirnova, I.V ., and Andrews, G.K. ( 2000) Functional heterogeneity in the zinc fingers of metalloregulatory protein metal response element-binding transcription facto r-1. J. Biol. Chem. 275: 37194-37201. Blanchard, R.K. and Cousins, R.J. (1996) Di fferential display of intestinal mRNAs regulated by dietary zinc. Proc. Natl. Acad. Sci. USA 93: 6863-6868. Blanchard, R.K. and Cousins, R.J. ( 1997) Upregulation of rat intestinal uroguanylin mRNA by dietary zinc re striction. Am. J. Physiol. 272: G972-G978. Blanchard, R.K. and Cousins, R.J. ( 2000) Regulation of intestinal gene expression by dietary zinc: induc tion of uroguanylin mRNA by zinc deficiency. J. Nutr. 130: 1393S-1398S. Blanchard, R.K., Moore, J.B., Green, C. L., and Cousins, R.J. (2001) Modulation of intestinal gene expression by dietar y zinc status: effectiveness of cDNA

PAGE 153

140 arrays for expression profiling of a si ngle nutrient deficiency. Proc. Natl. Acad. Sci. USA 98: 13507-13513. Borowski, C., Martin, C., Gounari, F., Haughn, L., Aif antis, I., Grassi, F., and Boehmer, H. (2002) On the brink of becoming a T cell. Curr. Opin. Immunol. 14: 200-206. Boulay, M., Scott, M.E., Conly, S.L., Stevenson, M.M., and Koski, K.G. (1998) Dietary protein and zinc restri ctions independently modify a Heligmosomoides polygyrus (Nematoda) infection in mice. Parasitology 116: 449-462. Briefel, R.R., Bialostosky, K., Kennedy-S tephenson, J., McDowell, M.A., Ervin, R.B., and Wright, J.D. (2000) Zinc inta ke of the U.S. population: findings from the third National Health and Nutrition Examination Survey, 1988-1994. J. Nutr. 130: 1367S-1373S. Buess, M., Moroni, C., and Hirsch, H. H. (1997) Direct identification of differentially expressed genes by cycle sequencing and cycle labelling using the differential display PCR primers. Nucleic Acids Res. 25: 2233-2235. Bukau, B. and Horwich, A.L. (1998) The Hsp70 and Hsp60 chaperone machines. Cell 92: 351-366. Bush, A.I. and Tanzi, R.E. (2002) T he galvanization of beta-amyloid in Alzheimer's disease. Proc. Natl Acad. Sci. USA 99: 7317-7319. Cano-Gauci, D.F. and Sark ar, B. (1996) Reversible zinc exchange between metallothionein and the estrogen receptor zinc finger. FEBS Lett. 386: 1-4. Chen, F.F., Yan, J.J., Chang, K.C., Lai, W.W., Chen, R.M., and Jin, Y.T. (1996) Immunohistochemical localization of Mcl-1 and bcl-2 proteins in thymic epithelial tumours. Hi stopathology 29: 541-547. Chen, Q., Ghilardi, N., Wang, H., Baker, T., Xie, M.H., Gurney, A., Grewal, I.S., and de Sauvage, F.J. (2000) Developm ent of Th1-type immune responses requires the type I cytokine receptor TCCR. Nature 407: 916-920. Choi, D.W. and Koh, J.Y. ( 1998) Zinc and brain injury. Annu. Rev. Neurosci. 21: 347-375. Clarke, A.G. and Kendall, M.D. (1994) The thymus in pregnancy: the interplay of neural, endocrine and immune influenc es. Immunol. Today 15: 545-551. Cosgrove, D., Gray, D., Dierich, A., K aufman, J., Lemeur, M., Benoist, C., and Mathis, D. (1991) Mice lacking M HC class II molecules. Cell 66: 1051-1066.

PAGE 154

141 Costello, L.C., Liu, Y., Zou, J., and Fr anklin, R.B. (1999) Evidence for a zinc uptake transporter in human prostate c ancer cells which is regulated by prolactin and testosterone. J. Biol. Chem. 274: 17499-17504. Cousins, R.J. (1996) Zinc. In: Present Knowledge in Nutrition (Filer, L.J. & Ziegler, E.E., eds.), pp. 293-306. Washington DC. Cousins, R.J. (1998) A role of zinc in the regulatio n of gene expression. Proc. Nutr. Soc. 57: 307-311. Cragg, R.A., Christie, G.R., Phillips, S.R., Russi, R.M., Kury, S., Mathers, J.C., Taylor, P.M., and Ford, D. (2002) A novel zinc-regulated human zinc transporter, hZTL1, is localized to t he enterocyte apical membrane. J. Biol. Chem. 277: 22789-22797. Cui, L., Blanchard, R.K., and Cousins, R.J. (2001) Dietar y zinc deficiency increases uroguanylin accumulation in rat kidney. Kidney Int. 59: 1424-1431. Cui, L., Blanchard, R.K., Coy, L.M. and Cousins, R.J. (2000) Prouroguanylin overproduction and localization in the inte stine of zinc-deficient rats. J. Nutr. 130: 2726-2732. Dalton, T.P., Bittel, D., and Andrews, G.K. (1997) Reversible activation of mouse metal response element-binding tran scription factor 1 DNA binding involves zinc interaction with the zinc finger domain. Molec. Cell. Biol. 17: 2781-2789. Davis, S.R. and Cousins, R.J. (2000) Metallothionein expression in animals: a physiological perspective on f unction. J. Nutr. 130: 1085-1088. Davis, S.R., McMahon, R.J. and Cousins, R.J. (1998) Metallothionein knockout and transgenic mice exhibit altered inte stinal processing of zinc with uniform zinc-dependent zinc transpor ter-1 expression. J. Nutr. 128: 825-831. DePasquale-Jardieu, P. and Fr aker, P.J. (1979) The role of corticosterone in the loss in immune function in the zinc-def icient A/J mouse. J. Nutr. 109: 1847-1855. DePasquale-Jardieu, P. and Fraker, P.J. (1980) Further characterization of the role of corticosterone in the loss of hum oral immunity in zinc-deficient A/J mice as determined by adrenalecto my. J. Immunology 124: 2650-2655. Dorfman, D.M., Shahsafaei, A., and Mi yauchi, A. (1998) Immunohistochemical staining for bcl-2 and mcl-1 in in trathyroidal epithelial thymoma (ITET)/carcinoma showing thymus -like differentiation (CASTLE) and cervical thymic carcinoma. Mod. Pathol. 11: 989-994.

PAGE 155

142 Eaton, D.L. and Toal, B.F. (1982) Evaluati on of the Cd/hemoglobin affinity assay for the rapid determination of metalloth ionein in biological tissues. Toxicol. Appl. Pharmacol. 66: 134-142. Ellis, R.J. and Hartl, F.U. (1999) Principles of prot ein folding in the cellular environment. Curr. Opin. St ruct. Biol. 9: 102-110. Fenech, M. (2002) Micronutrients and genom ic stability: a new paradigm for recommended dietary allowances ( RDAs). Food Chem. Toxicol. 40: 1113-1117. Fernandes, G., Nair, M., Onoe, K., Tanaka, T., Floyd, R., and Good, R.A. (1979) Impairment of cell-mediated immunity f unctions by dietary zinc deficiency in mice. Proc. Natl. Acad. Sci. USA 76: 457-461. Fischer, E.H. and Davie, E.W. (1 998) Recent excitement regarding metallothionein. Proc. Natl. Acad. Sci. USA 95: 3333-3334. Fleet, J.C. (2000) Zinc, copper, a nd manganese. In: Biochemical and Physiological Aspects of Human Nu trition (Stipanuk, M.H., ed.), pp. 741-760. W.B. Saunders Company, Philadelphia, PA. Ford, C.L., Randal-Whitis, L. and Ellis, S.R. (1999) Yeast proteins related to the p40/laminin receptor precursor are required for 20S ribosomal RNA processing and the maturation of 40S ribosomal subunits. Cancer Res. 59: 704-710. Fraker, P.J., DePasquale-Jardieu, P. Zwickl, C.M., and Luecke, R.W. (1978) Regeneration of T-cell helper function in zinc-deficient adult mice. Proc. Natl. Acad. Sci. USA 75: 5660-5664. Fraker, P.J., Haas, S.M., and Luecke, R.W. (1977) Effect of zinc deficiency on the immune response of the young adult A/J mouse. J. Nutr. 107: 1889-1895. Fraker, P.J., Hildebrandt, K., and Luecke, R.W. (1984) Alteration of antibody-mediated responses of su ckling mice to T-cell-dependent and independent antigens by maternal marginal zinc deficiency: restoration of responsivity by nutritional repl etion. J. Nu tr. 114: 170-179. Fraker, P.J., King, L.E., Laakko, T., and Vollmer, T.L. (2000) The dynamic link between the integrity of the immune system and zinc status. J. Nutr. 130: 1399S-1406S. Fraker, P.J., Zwickl, C.M., and Luecke, R.W. (1982) Delayed type hypersensitivity in zinc deficient adul t mice: impairment and restoration of responsivity to dinitrofluor obenzene. J. Nutr. 112: 309-313.

PAGE 156

143 Frederickson, C.J., Suh, S.W., Silva, D ., Frederickson, C.J., and Thompson, R.B. (2000) Importance of zinc in the central nervous system: the zinc-containing neuron. J. Nutr. 130: 1471S-1483S. Freeman, W.M., Robertson, D.J., and Vrana, K.E. ( 2000) Fundamentals of DNA hybridization arrays for gene expre ssion analysis. Biotechniques 29: 1042-1055. Frost, M.R. and Guggenheim, J.A. (1999) Prevention of depurination during elution facilitates the reamplification of DNA from differential display gels. Nucleic Acids Res. 27: e6. Frydman, J. (2001) Folding of newly trans lated proteins in vivo: the role of molecular chaperones. Annu. Rev. Biochem. 70: 603-647. Furano, A.V. (2000) The biological pr operties and evolutionary dynamics of mammalian LINE-1 retrotransposons. Prog. Nucleic Acid Res. Mol. Biol. 64: 255-294. Gaither, L.A. and Eide, D.J. (2000) F unctional expression of the human hZIP2 zinc transporter. J. Biol. Chem. 275: 5560-5564. Gmuender, H. (2002) Perspectives and chal lenges for DNA microarrays in drug discovery and development. Biotechniques 32: 152-154, 156, 158. Grusby, M.J., Johnson, R.S., Papaioan nou, V.E., and Glimc her, L.H. (1991) Depletion of CD4+ T cells in majo r histocompatibility complex class II-deficient mice. Science 253: 1417-1420. Gunes, C., Heuchel, R., Geor giev, O., Muller, K.H., Lichtlen, P., Bluthmann, H., Marino, S., Aguzzi, A., and Schaffner, W. (1998) Embryonic lethality and liver degeneration in mice lacking the metal-responsive transcriptional activator MTF-1. EMBO J. 17: 2846-2854. Hampl, H., Schulze, H., and Nierhaus, K. H. (1981) Ribosomal components from Escherichia coli 50 S subunits involved in the reconstitution of peptidyltransferase activity. J. Biol. Chem. 256: 2284-2288. Hardies, S.C., Wang, L., Zhou, L., Z hao, Y., Casavant, N.C., and Huang, S. (2000) LINE-1 (L1) lineages in the m ouse. Mol. Biol. Evol. 17: 616-628. Hartl, F.U. and Neupert, W. (1990) Protein sorting to mitochondria: evolutionary conservations of folding and assembly. Science 247: 930-938. Haynes, B.F., Markert, M.L., Sempowski, G. D., Patel, D.D., and Hale, L.P. (2000) The role of the thymus in immune reconstitution in aging, bone marrow transplantation, and HIV-1 infection. Annu. Rev. Immunol. 18: 529-560.

PAGE 157

144 Hershfinkel, M., Moran, A., Grossman, N., and Sekler, I. (2001) A zinc-sensing receptor triggers the release of in tracellular Ca2+ and regulates ion transport. Proc. Natl. Acad. Sci. USA 98: 11749-11754. Hiyama, H., Yokoi, M., Ma sutani, C., Sugasawa, K., Maekawa, T., Tanaka, K., Hoeijmakers, J.H., and Hanaoka, F. ( 1999) Interaction of hHR23 with S5a. The ubiquitin-like domain of hHR23 mediates interaction with S5a subunit of 26 S proteasome. J. Biol. Chem. 274: 28019-28025. Huang, L. and Gitschier, J. (1997) A nov el gene involved in zinc transport is deficient in the lethal milk mouse. Nat. Genet. 17: 292-297. Huang, L., Kirschke, C.P., and Gi tschier, J. (2002) Functi onal characterization of a novel mammalian zinc transporter, ZnT6. J. Biol. Chem. 277: 26389-26395. Huse, M., Eck, M.J., and Ha rrison, S.C. (1998) A Zn2+ ion links the cytoplasmic tail of CD4 and the N-terminal regi on of Lck. J. Biol. Chem. 273: 18729-18733. Iyer, V.R., Eisen, M.B., Ross, D.T., Schuler G., Moore, T., Lee, J.C., Trent, J.M., Staudt, L.M., Hudson, J., Jr., Boguski M.S., Lashkari, D., Shalon, D., Botstein, D., and Brown, P.O. (1999) The transcriptional program in the response of human fibroblasts to serum. Science 283: 83-87. Janeway, C.A., Travers, P., Walport, M., and Schlomchik, M.J. (2002) The development and survival of lymphocytes. In: Immunobiology: The Immune System in Health and Dis ease pp. 221-293. Garland Publishing Inc., New York. Kambe, T., Narita, H., Yam aguchi-Iwai, Y., Hirose, J. Amano, T., Sugiura, N., Sasaki, R., Mori, K., Iwanaga, T., and Nagao, M. ( 2002) Cloning and characterization of a novel mammalian zi nc transporter, zinc transporter 5, abundantly expressed in pancreatic beta cells. J. Biol. Chem. 277: 19049-19055. Killeen, N., Irving, B.A., Pippig, S., and Zingler, K. (1998) Si gnaling checkpoints during the development of T lym phocytes. Curr. Opin. Immunol. 10: 360-367. King, J.C. and Keen, C.L. (1999) Zinc In: Modern Nutrition in Health and Disease (Shils, M.E., Olson, J.A., Shike, M., & Ross, A.C., eds.), pp. 223-240. Williams & Wilkin s, Baltimore, MD. King, L.E., Osati-Ashtiani, F., and Fraker, P.J. (2002) Apoptosis plays a distinct role in the loss of precursor lymphocyt es during zinc deficiency in mice. J. Nutr. 132: 974-979.

PAGE 158

145 Koh, J.Y., Suh, S.W., Gw ag, B.J., He, Y.Y., Hsu, C.Y., and Choi, D.W. (1996) The role of zinc in selective neuronal death after transient global cerebral ischemia. Science 272: 1013-1016. Kolenko, V.M., Uzzo, R.G. Dulin, N., Hauzman, E., Bukowski, R., and Finke, J.H. (2001) Mechanism of apoptosis induced by zinc deficiency in peripheral blood T lymphocyt es. Apoptosis 6: 419-429. Kozopas, K.M., Yang, T., Buchan, H.L., Zhou, P., and Craig, R.W. (1993) MCL1, a gene expressed in programmed my eloid cell differentiation, has sequence similarity to BCL2. Proc. Natl. Acad. Sci. USA 90: 3516-3520. Kuo, C.T. and Leiden, J.M. (1999) Tr anscriptional regulation of T lymphocyte development and function. Annu. Rev. Immunol. 17: 149-187. Lander, E.S. (1999) Array of hope. Nat. Genet. 21: 3-4. Lander, E.S., Linton, L.M., Bi rren, B., Nusbaum, C., Z ody, M.C., Baldwin, J., Devon, K., Dewar, K., Doyle, M., FitzHugh, W. Funke, R., Gage, D., Harris, K., Heaford, A., Howland, J ., Kann, L., Lehoczky, J., LeVine, R., McEwan, P., McKernan, K., Meldrim, J., Mesirov, J. P., Miranda, C., Morris, W., Naylor, J., Ra ymond, C., Rosetti, M., S antos, R., Sheridan, A., Sougnez, C., Stange-Thomann, N., St ojanovic, N., Subramanian, A., Wyman, D., Rogers, J., Sulston, J., Ainscough, R., Beck, S., Bentley, D., Burton, J., Clee, C., Carter, N., Coul son, A., Deadman, R., Deloukas, P., Dunham, A., Dunham, I., Durbin, R., Fr ench, L., Grafham, D., Gregory, S., Hubbard, T., Humphray, S., Hunt, A., Jones, M., Lloyd, C., McMurray, A., Matthews, L., Mercer, S., Milne, S., Mullikin, J.C ., Mungall, A., Plumb, R., Ross, M., Shownkeen, R., Sims, S., Wa terston, R.H., Wils on, R.K., Hillier, L.W., McPherson, J.D., Marra, M.A., Ma rdis, E.R., Fulton, L.A., Chinwalla, A.T., Pepin, K.H., Gish, W.R., Chi ssoe, S.L., Wendl, M.C., Delehaunty, K.D., Miner, T.L., Delehaunty, A., Kram er, J.B., Cook, L.L., Fulton, R.S., Johnson, D.L., Minx, P.J., Clifton, S.W., Hawkins, T., Branscomb, E., Predki, P., Richardson, P., Wenning, S., Slezak, T., Doggett, N., Cheng, J.F., Olsen, A., Lucas, S., Elkin, C ., Uberbacher, E., Frazier, M., Gibbs, R.A., Muzny, D.M., Scherer, S.E., B ouck, J.B., Sodergren, E.J., Worley, K.C., Rives, C.M., Gorrell, J.H., Met zker, M.L., Naylor, S.L., Kucherlapati, R.S., Nelson, D.L., Weinstock, G.M., Sa kaki, Y., Fujiyama, A., Hattori, M., Yada, T., Toyoda, A., Itoh, T., Ka wagoe, C., Watanabe, H., Totoki, Y., Taylor, T., Weissenbach, J., Heilig, R., Saurin, W., Artiguenave, F., Brottier, P., Bruls, T., Pe lletier, E., Robert, C., Wi ncker, P., Smith, D.R., Doucette-Stamm, L., Rubenf ield, M., Weinstock, K. Lee, H.M., Dubois, J., Rosenthal, A., Platzer, M., Nyakatur a, G., Taudien, S., Rump, A., Yang, H., Yu, J., Wang, J., H uang, G., Gu, J., Hood, L. Rowen, L., Madan, A., Qin, S., Davis, R.W., Feder spiel, N.A., Abola, A.P. Proctor, M.J., Myers, R.M., Schmutz, J., Dickson, M., Grimw ood, J., Cox, D.R., Olson, M.V., Kaul, R., Raymond, C., Shimizu, N., Kawasaki, K., Minos hima, S., Evans,

PAGE 159

146 G.A., Athanasiou, M., Schultz, R., Roe, B.A., Chen, F., Pan, H., Ramser, J., Lehrach, H., Reinhardt, R., McComb ie, W.R., de la, B.M., Dedhia, N., Blocker, H., Hornischer, K., Nordsiek G., Agarwala, R., Aravind, L., Bailey, J.A., Bateman, A., Batzoglou, S ., Birney, E., Bork, P., Brown, D.G., Burge, C.B., Cerutti, L ., Chen, H.C., Church, D., Clamp, M., Copley, R.R., Doerks, T., Eddy, S.R., Eichler, E.E ., Furey, T.S., Galagan, J., Gilbert, J.G., Harmon, C., Hayashizaki, Y., H aussler, D., Hermjakob, H., Hokamp, K., Jang, W., Johnson, L.S., Jones, T. A., Kasif, S., Kaspryzk, A., Kennedy, S., Kent, W.J., Kitts, P., Koonin, E.V., Korf, I., Kulp, D., Lancet, D., Lowe, T.M., McLysaght, A., Mikkelsen, T., Mor an, J.V., Mulder, N., Pollara, V.J., Ponting, C.P., Schuler, G., Schultz, J. Slater, G., Smit, A.F., Stupka, E., Szustakowski, J., Thierry-Mieg, D., Th ierry-Mieg, J., Wagner, L., Wallis, J., Wheeler, R., Williams, A., Wolf, Y.I., Wo lfe, K.H., Yang, S.P., Yeh, R.F., Collins, F., Guyer, M.S., Peterson, J., Felsenfeld, A., Wetterstrand, K.A., Patrinos, A., Morgan, M.J., Szustakowk i, J., de Jong, P., Catanese, J.J., Osoegawa, K., Shizuya, H., and Choi, S. (2001) Initial sequencing and analysis of the human genom e. Nature 409: 860-921. Langmade, S.J., Ravindra, R., Daniels, P.J., and Andrews, G.K. (2000) The transcription factor MTF-1 mediates metal regulation of the mouse ZnT1 gene. J. Biol. Chem. 275: 34803-34809. LaRochelle, O., Gagne, V., Charron, J., Soh, J.W., and Seguin, C. (2001) Phosphorylation is involved in th e activation of metal-regulatory transcription factor 1 in response to metal ions. J. Biol. Chem. 276: 41879-41888. Lee, C.K., Klopp, R.G., Weindruch, R., and Prolla, T.A. (1999) Gene expression profile of aging and its retardation by caloric restriction. Science 285: 1390-1393. Lee, J.Y., Cole, T.B., Pa lmiter, R.D., Suh, S.W. and Koh, J.Y. (2002) Contribution by synaptic zinc to th e gender-disparate plaque formation in human Swedish mutant APP transgenic mi ce. Proc. Natl. Acad. Sci. USA 99: 7705-7710. Leo, C.P., Hsu, S.Y., Chun, S.Y., Bae, H.W., and Hsueh, A.J. (1999) Characterization of the antiapoptotic Bcl-2 family member myeloid cell leukemia-1 (Mcl-1) and the stimulati on of its message by gonadotropins in the rat ovary. Endocrinology 140: 5469-5477. Lepage, L.M., Giesbrecht, J.A., and Tayl or, C.G. (1999) Expression of T lymphocyte p56(lck), a zinc-finger signal transduction protein, is elevated by dietary zinc deficiency and diet restriction in mice. J. Nutr. 129: 620-627. Liang, P. (2002) A decade of differential display. Biotechniques 33: 338-344, 346.

PAGE 160

147 Liang, P., Averboukh, L., Keyomarsi, K., Sager, R., and Pa rdee, A.B. (1992) Differential display and cloning of messenger RNAs from human breast cancer versus mamary epithelial cells. Cancer Res. 52: 6966-6968. Liang, P., Averboukh, L., and Pardee, A. B. (1993) Distribut ion and cloning of eukaryotic mRNAs by means of di fferential display: refinements and optimization. Nucleic Acids Res. 21: 3269-3275. Liang, P. and Pardee, A.B. (1992) Differ ential display of eukaryotic messenger RNA by means of the polymerase c hain reaction. Science 257: 967-970. Lichtlen, P., Wang, Y., Belser, T., G eorgiev, O., Certa, U., Sack, R., and Schaffner, W. (2001) Ta rget gene search for the metal-responsive transcription factor MTF-1. Nu cleic Acids Res. 29: 1514-1523. Lin, R.S., Rodriguez, C., Veillette, A., and Lodish, H.F. (1998) Zinc is essential for binding of p56(lck) to CD4 and CD8. J. Biol. Chem. 273: 32878-32882. Lira, P.I., Ashworth, A., and Morris, S.S. (1998) Effect of zinc supplementation on the morbidity, immune function, and gr owth of low-birth-weight, full-term infants in northeast Brazil. Am J. Clin. Nutr. 68: 418S-424S. Liuzzi, J.P., Blanchard, R.K., and Cousins, R.J. (2001) Differ ential regulation of zinc transporter 1, 2, and 4 mRNA expr ession by dietary zinc in rats. J. Nutr. 131: 46-52. Lyons, T.J., Gasch, A.P., Gaither, L.A., Bots tein, D., Brown, P.O., and Eide, D.J. (2000) Genome-wide characterizati on of the Zap1p zinc-responsive regulon in yeast. Proc. Natl. Acad. Sci. USA 97: 7957-7962. Maratos-Flier, E., Qu, D ., and Gammeltoft, S. (1997) Analysis of gene expression in hypothalamus in obese and normal mi ce using differential display. In: Methods in Molecular Biology, Vol. 85: Differential Display Methods and Protocols (Liang, P. & Pardee, A. B., eds.), pp. 297-304. Humana Press Inc., Totowa, NJ. Maret, W., Larsen, K.S., and Vallee, B.L. (1997) Coordi nation dynamics of biological zinc "clusters" in meta llothioneins and in the DNA-binding domain of the transcription factor Ga l4. Proc. Natl. Acad. Sci. USA 94: 2233-2237. Markwell, M.A., Haas, S.M., Bieber, L.L., and Tolbert, N.E. (1978) A modification of the Lowry procedure to simplify protein determination in membrane and lipoprotein samples. Anal. Biochem. 87: 206-210. Marshall, E. (2001) Genom e sequencing. Celera assembles mouse genome; public labs plan new stra tegy. Science 292: 822.

PAGE 161

148 Martin, K.J., Graner, E., Li, Y., Price, L. M., Kritzman, B.M., F ournier, M.V., Rhei, E., and Pardee, A.B. (2001) High -sensitivity array analysis of gene expression for the early detection of disseminated breast tumor cells in peripheral blood. Proc. Natl. Acad. Sci. USA 98: 2646-2651. Martin, K.J. and Pardee, A.B. (2000) Identifying ex pressed genes. Proc. Natl. Acad. Sci. USA 97: 3789-3791. Marx, A. and Muller-Hermelink, H.K. ( 1999) From basic immunobiology to the upcoming WHO-classification of tumo rs of the thymus. The Second Conference on Biological and Clinical Aspects of Thymic Epithelial Tumors and related recent develop ments. Pathol. Res. Pract. 195: 515-533. Masters, B.A., Kelly, E.J., Quaife, C.J., Brinster, R.L., and Pa lmiter, R.D. (1994) Targeted disruption of me tallothionein I and II genes increases sensitivity to cadmium. Proc. Natl. Acad. Sci. USA 91: 584-588. Matz, M.V. and Lukyanov, S.A. (1998) Different strategies of differential display: areas of application. Nucl eic Acids Res. 26: 5537-5543. McMahon, R.J. and Cousins, R.J. (1998) Regulation of the zinc transporter ZnT-1 by dietary zinc. Proc. Na tl. Acad. Sci. USA 95: 4841-4846. Minton, A.P. (2001) The influence of macromolecular crowding and macromolecular confinement on biochem ical reactions in physiological media. J. Biol. Chem. 276: 10577-10580. Modlin, R.L. and Bloom, B.R. (2001) Immunology. Chip shots--will functional genomics get functional? Science 294: 799-801. Molina, T.J., Kishihara, K., Siderovski, D.P., van Ewijk, W., Narendran, A., Timms, E., Wakeham, A., Pa ige, C.J., Hartmann, K. U., and Veillette, A. (1992) Profound block in thymocyte dev elopment in mice lacking p56lck. Nature 357: 161-164. Moore, J.B., Blanchard, R.K., McCormack, W.T., and Cousins, R.J. (2001) cDNA array analysis identifies thymic LC K as upregulated in moderate murine zinc deficiency before T-lymphocyte population c hanges. J. Nutr. 131: 3189-3196. Muga, S.J. and Grider, A. (1999) Partial characte rization of a human zinc-deficiency syndrome by differentia l display. Biol. Trace Elem. Res. 68: 1-12. Mullis, K., Faloona, F., Scharf, S., Saik i, R., Horn, G., and Erlich, H. (1986) Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harb. Symp. Quant. Biol. 51: 263-273.

PAGE 162

149 Nguyen, T.O., Capra, J. D., and Sontheimer, R.D. (1996) Calreticulin is transcriptionally upregulated by heat shock, calcium and heavy metals. Mol. Immunol. 33: 379-386. Nishio, Y., Aiello, L.P., and King, G.L. (1994) Glucose induced genes in bovine aortic smooth muscle cells identified by mRNA differential display. FASEB J. 8: 103-106. Noller, H.F. (1993) Peptidyl transferase : protein, ribonucleoprotein, or RNA? J. Bacteriol. 175: 5297-5300. Ortolan, T.G., Tongaonkar, P., Lamber tson, D., Chen, L., Schauber, C., and Madura, K. (2000) The DNA repair pr otein rad23 is a negative regulator of multi-ubiquitin chain assemb ly. Nat. Cell Biol. 2: 601-608. Osati-Ashtiani, F., King, L.E., and Fraker P.J. (1998) Variance in the resistance of murine early bone marrow B cells to a deficiency in zinc. Immunology 94: 94-100. Outten, C.E. and O'Halloran, T.V. (2001) Femtomolar sensitivity of metalloregulatory proteins control ling zinc homeostasis. Science 292: 2488-2492. Palmiter, R.D. (1998) The el usive function of metallothioneins. Proc. Natl. Acad. Sci. USA 95: 8428-8430. Palmiter, R.D., Cole, T.B., and Findley S.D. (1996a) ZnT-2, a mammalian protein that confers resistance to zinc by facilitating vesicular sequestration. EMBO J. 15: 1784-1791. Palmiter, R.D., Cole, T.B., Quaife, C. J., and Findley, S.D. (1996b) ZnT-3, a putative transporter of zinc into synapt ic vesicles. Proc. Natl. Acad. Sci. USA 93: 14934-14939. Palmiter, R.D. and Findley, S.D. (1995) Cl oning and functional characterization of a mammalian zinc transporter that confer s resistance to zinc. EMBO J. 14: 639-649. Panel on Micronutrients, Subcommittees on Upper Reference Levels of Nutrients and of Interpretation and Use of Dietary Reference Intakes, and the Standing Committee on the Scientific Evaluation of Dietary Reference Intakes, F.N.B. (2002) Zinc. In: Diet ary Reference Intakes for Vitamin A, Vitamin K, Arsenic, Boron, Chromi um, Copper, Iodine, Iron, Manganese, Molybdenum, Nickel, Sil icon, Vanadium, and Zinc (Food and Nutrition Board, ed.), pp. 351-398. Nationa l Academy Press, Washington DC. Pena, M.M., Lee, J., and Thiele, D.J. (1999) A delicate balance: homeostatic control of copper uptake and dist ribution. J. Nutr. 129: 1251-1260.

PAGE 163

150 Petersen, G., Hahn, C., and Gehring, U. (2001) Dissection of the ATP-binding domain of the chaperone hsc70 for intera ction with the cofactor Hap46. J. Biol. Chem. 276: 10178-10184. Petrie, H.T., Tourigny, M. Burtrum, D.B., and Liva k, F. (2000) Precursor thymocyte proliferatio n and differentiation are controlled by signals unrelated to the pre-TCR. J. Immunol. 165: 3094-3098. Prasad, A.S. (1991) Discovery of hum an zinc deficiency and studies in an experimental human model. Am. J. Clin. Nutr. 53: 403-412. Prasad, A.S., Beck, F.W., Kaplan, J., C handrasekar, P.H., Ortega, J., Fitzgerald, J.T., and Swerdlow, P. (1999) Effect of zinc supplementation on incidence of infections and hospital admissions in sickle cell disease (SCD). Am. J. Hematol. 61: 194-202. Radtke, F., Heuchel, R., Georgiev, O., Her gersberg, M., Gariglio, M., Dembic, Z., and Schaffner, W. (1993) Cloned transcr iption factor MTF-1 activates the mouse metallothionein 1 prom oter. EMBO J. 12: 1355-1362. Richards, M.P. and Cousins, R.J. ( 1975a) Influence of parenteral zinc and actinomycin D on tissue zinc uptake and the synthesis of a zinc-binding protein. Bioinorg. Chem. 4: 215-224. Richards, M.P. and Cousins, R.J. (1975b) Mammalian zinc homeostasis: requirement for RNA and metallothi onein synthesis. Biochem. Biophys. Res. Commun. 64: 1215-1223. Rockett, J.C. and Dix, D.J. (1999) Applic ation of DNA arrays to toxicology. Environ. Health Perspect. 107: 681-685. Roesijadi, G., Bogumil, R ., Vasak, M., and Kagi, J.H. (1998) Modulation of DNA binding of a tramtrack zinc finger peptide by the metallothionein-thionein conjugate pair. J. Biol. Chem. 273: 17425-17432. Rosado, J.L., Lopez, P., Munoz, E., Mart inez, H., and Allen, L.H. (1997) Zinc supplementation reduced morbidity, but neither zinc nor iron supplementation affected growth or body composition of Mexican preschoolers. Am. J. Clin. Nutr. 65: 13-19. Samson, S.L. and Gedamu, L. (1998) Molecular analyses of metallothionein gene regulation. Prog. Nucleic Acid Res. Mol. Biol. 59: 257-288. SAS Institute Inc. (1988) SAS/STAT User's Guide: Statistics (Release 6.03 ed.) SAS Instititute, Cary, NC.

PAGE 164

151 Sato, M., Saeki, Y., Tanak a, K., and Kaneda, Y. (1999) Ribosome-associated protein LBP/p40 binds to S21 protei n of 40S ribosome: analysis using a yeast two-hybrid system. Biochem. Biophys. Res. Co mmun. 256: 385-390. Saxton, J.A. and Martin, S. L. (1998) Recombination be tween subtypes creates a mosaic lineage of LINE-1 that is ex pressed and actively retrotransposing in the mouse genome. J. Mol. Biol. 280: 611-622. Saydam, N., Adams, T.K., Steiner, F., Schaffner, W., and Freedman, J.H. (2002) Regulation of metallothionein tran scription by the metal-responsive transcription factor MTF1. Identification of signal transduction cascades that control metal-inducible transcription. J. Biol. Chem. 277: 20438-20445. Sazawal, S., Black, R.E., Bhan, M.K., Bhandari, N., Sinha, A., and Jalla, S. (1995) Zinc supplementation in young children with acute diarrhea in India. N. Engl. J. Med. 333: 839-844. Sazawal, S., Black, R.E., Bhan, M.K. Jalla, S., Bhandari, N., Sinha, A., and Majumdar, S. (1996) Zinc supplem entation reduces the incidence of persistent diarrhea and dysentery am ong low socioeconomic children in India. J. Nutr. 126: 443-450. Schena, M., Shalon, D., Davis, R.W., and Brown, P.O. ( 1995) Quantitative monitoring of gene expression patterns with a complementary DNA microarray. Science 270: 467-470. Shalon, D., Smith, S.J., and Brown, P.O. (1996) A DNA microarray system for analyzing complex DNA samples using two-color fluorescent probe hybridization. Genom e Res. 6: 639-645. Shankar, A.H. and Prasad, A.S. (1998) Zi nc and immune function: the biological basis of altered resistance to infect ion. Am. J. Clin. Nutr. 68: 447S-463S. Sheline, C.T., Behrens, M.M., and Choi D.W. (2000) Zinc-induced cortical neuronal death: contribution of energy fa ilure attributable to loss of NAD(+) and inhibition of glycolysis. J. Neurosci. 20: 3139-3146. Southern, E.M. (1975) De tection of specific s equences among DNA fragments separated by gel electrophoresis J. Mol. Biol. 98: 503-517. Sprecher, C.A., Grant, F.J., Baumgartner J.W., Presnell, S.R., Schrader, S.K., Yamagiwa, T., Whitmore, T.E., O'Ha ra, P.J., and Fost er, D.F. (1998) Cloning and characterization of a novel class I cytokine receptor. Biochem. Biophys. Res. Commun. 246: 82-90. Staudt, L.M. and Brown, P.O. (2000) Genomic views of the immune system. Annu. Rev. Immunol. 18: 829-859.

PAGE 165

152 Straus, D.B. and Weiss, A. (1992) Genetic evidence fo r the involvement of the lck tyrosine kinase in signal trans duction through the T cell antigen receptor. Cell 70: 585-593. Sung, Y.J. and Denman, R. B. (1997) Use of two reverse transcriptases eliminates false-positive results in differential display. Biotechniques 23: 462-464, 466, 468. Suster, S. and Rosai, J. (1990) Histology of the normal thymus. Am. J. Surg. Pathol. 14: 284-303. Tibbetts, T.A., DeMayo, F., Rich, S., Conneely, O.M., an d O'Malley, B.W. (1999) Progesterone receptors in the thymus are required for thymic involution during pregnancy and for normal fertility. Proc. Natl. Acad. Sci. USA 96: 12021-12026. Torun, B. and Chew, F. (1999) Proteinenergy malnutrition. In: Modern Nutrition in Health and Disease (Shils, M.E., Ol son, J.A., Shike, M., & Ross, A.C., eds.), pp. 963-988. Williams & Wilkins, Baltimore, MD. Townsend, K.J., Zhou, P., Qian, L., Bieszcz ad, C.K., Lowrey, C.H., Yen, A., and Craig, R.W. (1999) Regulation of MCL1 through a serum response factor/Elk-1-mediated mechanism links expression of a viability-promoting member of the BCL2 family to the induction of hematopoietic cell differentiation. J. Bio l. Chem. 274: 1801-1813. Tupler, R., Perini, G., and Green, M. R. (2001) Expressing the human genome. Nature 409: 832-833. Tusher, V.G., Tibshirani, R., and Chu, G. (2001) Significance analysis of microarrays applied to the ionizing r adiation response. Proc. Natl. Acad. Sci. USA 98: 5116-5121. Vallee, B.L. and Falchuk, K. H. (1993) The biochemical basis of zinc physiology. Physiol Rev. 73: 79-118. van der Spek, P.J., Visser, C.E., H anaoka, F., Smit, B., Hagemeijer, A., Bootsma, D., and Hoeijmakers, J. H. (1996) Cloning, comparative mapping, and RNA expression of the mouse homologues of the Saccharomyces cerevisiae nucleotide excision repair gene RAD23. Genomics 31: 20-27. Venter, J.C., Adams, M.D., Myers, E.W., Li, P.W., Mu ral, R.J., Sutton, G.G., Smith, H.O., Yandell, M., Evans, C. A., Holt, R.A., Gocayne, J.D., Amanatides, P., Ballew, R.M., Huson, D.H., Wortman, J.R., Zhang, Q., Kodira, C.D., Zheng, X.H., Chen, L., Skupski, M., Subramanian, G., Thomas, P.D., Zhang, J., Gabor Mikl os, G.L., Nelson, C., Broder, S., Clark, A.G., Nadeau, J., McKusick, V. A., Zinder, N., Levine, A.J., Roberts,

PAGE 166

153 R.J., Simon, M., Slayman, C., Hunkapille r, M., Bolanos, R., Delcher, A., Dew, I., Fasulo, D., Flanigan, M., Fl orea, L., Halpern, A., Hannenhalli, S., Kravitz, S., Levy, S., Mobarry, C., Reinert, K., Remington, K., Abu-Threideh, J., Beasley, E., Bi ddick, K., Bonazzi, V., Brandon, R., Cargill, M., Chandramouliswaran, I., C harlab, R., Chaturvedi, K., Deng, Z., Di, F., V, Dunn, P., Eilbeck, K., Evangel ista, C., Gabrielian, A.E., Gan, W., Ge, W., Gong, F., Gu, Z., Guan, P., He iman, T.J., Higgins M.E., Ji, R.R., Ke, Z., Ketchum, K.A., Lai, Z., Lei, Y., Li, Z., Li, J., Liang Y., Lin, X., Lu, F., Merkulov, G.V., Milshina, N., Moor e, H.M., Naik, A.K., Narayan, V.A., Neelam, B., Nusskern, D., Rusch, D.B., Salzberg, S., Shao, W., Shue, B., Sun, J., Wang, Z., Wang, A., Wang, X., Wang, J. Wei, M., Wides, R., Xiao, C., Yan, C., Yao, A., Ye, J., Zhan, M., Zhang, W., Zhang, H., Zhao, Q., Zheng, L., Zhong, F., Zhong, W., Zhu, S., Zhao, S., Gilbert, D., Baumhueter, S., Spier, G., Carter, C ., Cravchik, A., Woodage, T., Ali, F., An, H., Awe, A., Baldwin, D., B aden, H., Barnstead, M., Barrow, I., Beeson, K., Busam, D., Carver, A., Center, A., Cheng, M.L., Curry, L., Danaher, S., Davenport, L., Desilets, R. Dietz, S., Dodson, K., Doup, L., Ferriera, S., Garg, N., Gluecksmann, A ., Hart, B., Haynes, J., Haynes, C., Heiner, C., Hladun, S., Hostin, D., Houck, J. Howland, T., Ibegwam, C., Johnson, J., Kalush, F., Kline, L., Kodur u, S., Love, A., M ann, F., May, D., McCawley, S., McIntosh, T., McMullen, I., Moy, M., Moy, L., Murphy, B., Nelson, K., Pfannkoch, C., Pratts, E., Puri, V., Qureshi, H., Reardon, M., Rodriguez, R., Rogers, Y.H., Romblad, D., Ruhfel, B., Sco tt, R., Sitter, C., Smallwood, M., Stewart, E., Strong, R. Suh, E., Thomas, R., Tint, N.N., Tse, S., Vech, C., Wang, G., Wetter, J., William s, S., Williams, M., Windsor, S., Winn-Deen, E., Wolfe, K., Zaveri, J., Za veri, K., Abril, J.F., Guigo, R., Campbell, M.J., Sjolander, K. V., Karlak, B., Kejariwal, A., Mi, H., Lazareva, B., Hatton, T., Narec hania, A., Diemer, K., Muruganujan, A., Guo, N., Sato, S., Bafna, V., Istrail, S., Lippert, R., Schwartz, R., Walenz, B., Yooseph, S., Allen, D., Basu, A., Ba xendale, J., Blick, L., Caminha, M., Carnes-Stine, J., Caulk, P., Chiang, Y.H., Coyne, M., Dahlke, C., Mays, A., Dombroski, M., Donnelly M., Ely, D., Esparham, S., Fosler, C., Gire, H., Glanowski, S., Glasse r, K., Glodek, A., Goro khov, M., Graham, K., Gropman, B., Harris, M., He il, J., Henderson, S., Hoover, J., Jennings, D., Jordan, C., Jordan, J., Ka sha, J., Kagan, L., Kraft, C., Levitsky, A., Lewis, M., Liu, X., Lopez, J., Ma, D., Majoro s, W., McDaniel, J., Murphy, S., Newman, M., Nguyen, T., Nguyen, N., and Nodell, M. (2001) The sequence of the human genome. Science 291: 1304-1351. Verlaet, M., Deregowski, V., Denis, G., Humblet, C., Stalmans M.T., Bours, V., Castronovo, V., Boniver, J., and Defresne, M.P. (2001) Genetic imbalances in preleukemic thymuses Biochem. Biophys. Res. Commun. 283: 12-18. Wahba, Z.Z., Murray, W.J., Hassan, M.Q., and Stohs, S.J. (1989) Comparative effects of pair-feeding and 2,3,7,8-tetrachlorodi benzo-p-dioxin (TCDD) on various biochemical parameters in female rats. Toxicology 59: 311-323.

PAGE 167

154 Wang, Y.R., Wu, J.Y.J., Reaves, S.K., and Lei, K.Y. (1996) Enhanced expression of hepatic genes in copper-deficient rats detected by the messenger RNA differential display method. J. Nutr. 126: 1772-1781. Wood, R.J. (2000) Assessment of marginal zinc status in humans. J. Nutr. 130: 1350S-1354S. Yamada, A., Takaki, S., Hayashi, F ., Georgopoulos, K., Pe rlmutter, R.M., and Takatsu, K. (2001) Identification and characterization of a transcriptional regulator for the lck proximal pr omoter. J. Biol. Chem. 276: 18082-18089. Yiangou, M., Ge, X., Carter K.C., and Papaconstantinou J. (1991) Induction of several acute-phase protein genes by heavy metals: a new class of metal-responsive genes. Biochemistry 30: 3798-3806. Yoshida, H., Hamano, S., Senaldi, G., Co vey, T., Faggioni, R ., Mu, S., Xia, M., Wakeham, A.C., Nishina, H., Potter, J. Saris, C.J., and Mak, T.W. (2001) WSX-1 is required for the initiation of Th1 responses and resistance to L. major infection. Immunity. 15: 569-578. Yoshida, S.H., Keen, C.L., and Gershwin, M.E. (2002) Nutrition and the immune system. In: Modern Nutrition in Health and Disease (Shils, M.E., Olson, J.A., Shike, M., & Ross, A.C., eds .), pp. 725-750. Williams and Wilkins, Baltimore, MD. Zanzonico, P., Fernandes, G., and Good, R. A. (1981) The differential sensitivity of T-cell and B-cell mitogenesis to in vitro zinc deficiency. Cell. Immunol. 60: 203-211.

PAGE 168

155 BIOGRAPHICAL SKETCH Jennifer Bernadette Moore was born in Ireland in 1970. In 1982, her family imigrated to America settling in Dunedin, Florida, and in 1988 Jennifer graduated from Dunedin High School. Jennifer then attended Florida State University and acquired her B.S. in Nutrition in 1993. Before returning to graduate school, Jennifer became a licens ed massage therapist focusing her independent practice on in creasing collegiate and Olym pic athletic performance through physiologically relevant ma ssage. In addition, Jennifer managed an independently owned sports retail store, which catered to the needs of the athletic community of all levels in Tallahassee, Florida. In 1996, Jennifer returned to Florida State University and discovered her interest in the molecular biology of nut rients working in the lab of Cathy W. Levenson. In 1997, Jennifer received a B.S. in Chemical Sciences from Florida State University, and began her doctoral studies at the University of Florida in the laboratory of Robert J. Cousins. During her graduate career, Jennifer wa s a collegial member of the Food Science and Human Nutrition department organizing a Nutritional Sciences summer journal club and the first intradepartmental res earch symposium. Elected the FSHN graduate student repr esentative, Jennifer cata lyzed the renovation and spatial reallocation of a 20-year-old graduat e library. In additi on, Jennifer tutored

PAGE 169

156 advanced undergraduate univers ity athletes in biochemistry, genetics and molecular biology for 2 years Jennifer is an active member of the American Society for Nutrional Sciences, elected the first student representative of the Nutrient-Gene Interactions Research Interest Steer ing Committee in 2000, and re-elected in 2001. Jennifer also belongs to the Americ an Association for the Advancement of Science and is an elected member of the scientific honor society Sigma Xi. After becoming an American citizen in August 2001, future plans for Jennifer include moving to Washington D.C. and exploring scientific policy as a potential career.


Permanent Link: http://ufdc.ufl.edu/UFE0000577/00001

Material Information

Title: Moderate murine dietary zinc deficiency and zinc supplementation modulate specific thymic mRNA abundances in Vivo: results from cDNA array analysis and differential display screening
Physical Description: Mixed Material
Creator: Moore, J. Bernadette ( Author, Primary )
Publication Date: 2002
Copyright Date: 2002

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0000577:00001

Permanent Link: http://ufdc.ufl.edu/UFE0000577/00001

Material Information

Title: Moderate murine dietary zinc deficiency and zinc supplementation modulate specific thymic mRNA abundances in Vivo: results from cDNA array analysis and differential display screening
Physical Description: Mixed Material
Creator: Moore, J. Bernadette ( Author, Primary )
Publication Date: 2002
Copyright Date: 2002

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0000577:00001


This item has the following downloads:


Full Text











MODERATE MURINE DIETARY ZINC DEFICIENCY AND ZINC
SUPPLEMENTATION MODULATE SPECIFIC THYMIC mRNA ABUNDANCES
IN VIVO: RESULTS FROM cDNA ARRAY ANALYSIS AND DIFFERENTIAL
DISPLAY SCREENING













By

J. BERNADETTE MOORE


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2002





























Copyright 2002

by

J. Bernadette Moore





























This work is dedicated to the strong-willed, hardworking Irish women who came
before me. Not only did they provide me with a tremendous genetic heritage, but
they also shaped my intellectual curiosity and determination, ultimately making
this accomplishment possible. In honor of my grandmother Claire, and her
daughter Moya, my mother.















ACKNOWLEDGMENTS

It is a foolish man, he who believes his accomplishments to be solely his.

For myself, it is more than a pleasure to acknowledge and thank the mentors,

colleagues and friends who have inspired, taught and encouraged me toward this

achievement. First, I am deeply honored to have worked for and with

Dr. Robert J. Cousins, who is awe-inspiring in work ethic, and whose decades of

dedication and vision preceded and permitted this research. In addition, I thank

the members of my committee: Drs. Jesse F. Gregory, Bobbi Langkamp-Henken,

Rachel B. Shireman and Wayne T. McCormack for their significant, generous

time contributions and guidance through my graduate education.

Within the laboratory, Dr. Raymond K. Blanchard was an endless source

of technical information, intellectual enthusiasm and scientific motivation. It is a

truism that your workmates become almost an extended family. I thank all those

who supported me with patience and kindness, and muscle in the cases of those

who moved me more than once, through the past five years. Virginia Mauldin

deserves particular mention for her tremendous compassion and also for her

significant editing, computer, and lab (animal) contributions!

Drs. Heather B. Bradshaw and Cathy W. Levenson are credited as my

initial sources of inspiration and encouragement. As accomplished members of

the scientific community, they continue to be role models and dear friends. Of

course, I would acknowledge and sincerely thank the friends who, in particular,

iv









supported me emotionally and intellectually through the past five years: Elsa

Bigelow, Chantal Coulen, Mindy Edwards, Ashley Lentz, Robin (and Mike!)

Marshall, Dave Nolan, Janna (and Joe!) Underhill, Judy Wolfe and dear Rodger

Young. Lastly, a special extension of gratitude goes to the exclusive continuum

in my life thus far, my friend of almost twenty years, Jennifer Ady Levine.















TABLE OF CONTENTS

page

ACKNOWLEDGMENTS ............... ........... ....... ............... iv

LIST O F TA BLES .......... ................... ........................................... viii

LIST OF FIGURES ................ ......... ......... ........ix

ABBREVIATIONS................................................ ......... xi

ABSTRACT ............... ......... ................. xii

CHAPTER

1 INTRODUCTION AND LITERATURE REVIEW ................................... 1

Introduction ............... ................ ................... 1
Hypotheses and Research Objectives .... ............................ .. ... ........... 4
Literature Review ............... .. ........ .................. 5

2 MURINE ZINC DEFICIENCY USING AN OUTBRED STRAIN AND cDNA
ARRAY ANALYSIS OF THYMIC GENE EXPRESSION .............................. 28

Introd uctio n ......... .. ............ .............. .... ................. ........... 2 8
Materials and Methods ..................................................................................... 29
R e s u lts .............. ..... ............ ............................... ........................................ 3 6
Discussion ............... ........ .................. 42

3 DIFFERENTIAL mRNA DISPLAY OF ZINC-DEFICIENT, ZINC-NORMAL
AND ZINC-SUPPLEMENTED MURINE THYMUS...................... ........ 50

Introduction ................. .............................. .......................... ........ 50
M materials and M ethods ................................... ..................... .... ..... 51
Results .................................................................. ... ....... ........ 61
D is c u s s io n ............................................................................. 7 2

4 SUMMARY, SPECULATIONS AND FUTURE DIRECTIONS ....................... 83



vi









APPENDIX

A DIFFERENTIAL DISPLAY TRANSCRIPTS INCREASED IN
ZINC-SUPPLEMENTED MICE ........... ............ ....................... 88

Differential Display Bands 3,3,1 and 3,3,2 .............................. ... ................ 88
Differential Display Bands 3,3,1b, 3,3,2b and 3,3,3 ................ ............... 91

B DIFFERENTIAL DISPLAY TRANSCRIPTS INCREASED IN
ZINC-DEFICIENT MICE ........................................ ............... 93

Differential Display Bands 2,17,1 and 2,17,2 ............. ............................... 93
Differential Display Band 3,1,1 .............................................. 95
Differential Display Band 7,11,1 ............................................ 97
Differential Display Band 10,7,2G .................................. ...................... 100
Differential Display Band 9,7,1A................ ............................ ............... 102

C DIFFERENTIAL DISPLAY TRANSCRIPTS DECREASED IN
ZINC-DEFIC IENT M ICE........................................................... ............... 105

Differential Display Bands 2,4,2 and 2,4,3 ..... ......... .... ................ 105
Differential Display Band 2,14,1 .......................................... 108
Differential Display Band 3,1,4 ................ ........................... ............. 110
Differential Display Band 3,2,4 ...... .................... ............... 113
Differential Display Band 9,6,1 ............... .... ....................................... 116
Differential Display Band 10,7,2D ................................... ....... .... ........ 119

D DIFFERENTIAL DISPLAY TRANSCRIPTS DECREASED IN
ZINC-SUPPLEMENTED M ICE ............... ............................................. 121

Differential Display Band 2,8,1 ............... .... ....................................... 121
Differential Display Band 3,8,2C ............................... ............ .......... 123
Differential Display Band 3,7,1 ...... ................... ............. 125
Differential Display Band 3,7,2 ...... ................. ............... 128
Differential Display Band 7,6,2G ............................... ............ .......... 130
Differential Display Band 7,13,1 ............................... .............. 132
Differential Display Band 7,20,1 ...... ............... ............... 135

LITERATURE CITED ........... ............... ............ ......... ............... 138

BIOGRAPHICAL SKETCH ........ .............................. ............... 155















LIST OF TABLES


Table page

2-1 Primers used for semi-quantitative and quantitative real-time RT-PCR..... 33

2-2 Zinc status indicators for zinc-deficient and zinc-normal mice ................ 37

3-1 Anchored primers used for differential display RT and PCR reactions....... 52

3-2 Arbitrary primers used for differential display PCR reactions .................... 53

3-3 Primers and FRET probes for Q-PCR ....... ................................ 61

3-4 Animal status indicators for zinc-deficient, zinc-normal and
zinc-supplemented mice........ ... ....... ................... ........ ....... 62

3-5 Differential display transcripts increased in zinc-deficient mice ................. 65

3-6 Differential display transcripts decreased in zinc-deficient mice................. 66

3-7 Differential display transcripts decreased in zinc-supplemented mice........ 67















LIST OF FIGURES


Figure page

2-1 Food intake and body weights of zinc-deficient (Zn-), pair-fed (PF)
and zinc-normal (ZnN) mice ............. ....... ................... ............... 36

2-2 FACS analysis of Zn- and ZnN thymocytes.................... ................. 38

2-3 Densitometry output for Zn- array relative to ZnN array using
A tlaslm ageTM softw are ........................................................... ............... 39

2-4 Scatter plot of adjusted intensities for detected genes from ZnN array
vs. Z n- array .................... .......... ........................... ........... . 40

2-5 Semi-quantitative RT-PCR confirmation of zinc-modulated
cDNAs identified by array analysis ....... ..... ........... ............... ....... 41

2-6 Comparison of relative expression of four genes based on array
and real-time quantitative RT-PCR (Q-PCR) data................. ......... 42

2-7 Western analysis of thymic LCK protein levels........................... ........ 43

3-1 Original re-amplification, subcloning and isolation procedures for
putative ly re g u late d E S T s .................................................... .... .. ............... 56

3-2 Example of subclone heterogeneity and Southern analysis .................. 57

3-3 Revised experimental approach to differential display.............................. 58

3-4 Differential display RT and PCR reaction reproducibility .......................... 63

3-5 AP3 and ARP3 differential displays generated on two
se pa rate occasion ns............................... .............................. 64

3-6 Relative densitometric analyses of northern blots
for select DD clones and MT ............... ....... .... ...................... 69

3-7 Com prison of DD and northern analyses................................................ 70

3-8 Q-PCR analyses of select DD clones and MT...................................... 71

ix









Figure page

4-1 Pictorial view of gene transcripts altered in murine thymus in
response to three weeks of dietary zinc deficiency.............................. 85

A-1 Autoradiograph of DD bands 3,3,1 and 3,3,2 ......................................... 88

A-2 Autoradiograph of DD bands 3,3,1b, 3,3,2b and 3,3,3 ............................ 91

B-1 Autoradiograph of DD bands 2,17,1 and 2,17,2 ................................. 93

B-2 Autoradiograph of DD band 3,1,1 ............................................ ... 95

B-3 Autoradiograph of DD band 7,11,1 ........... ............ .................... .. 97

B-4 Autoradiograph of DD band 10,7,2G ..................................................... 100

B-5 Autoradiograph of DD band 9,7,1A................................... 102

C-1 Autoradiograph of DD bands 2,4,2 and 2,4,3 .................................. 105

C-2 A utoradiograph of D D band 2,14,1 ........................................ ....... ........ 108

C-3 Autoradiograph of DD band 3,1,4.......... .................................... 110

C-4 Autoradiograph of DD band 3,2,4....................... ............................... 113

C-5 Autoradiograph of DD band 9,6,1 ......................................................... 116

C-6 Autoradiograph of DD band 10,7,2D ........................ ........... .... ........... 119

D-1 Autoradiograph of DD band 2,8,1 .............. .................................. 121

D-2 Autoradiograph of DD band 3,8,2C ...................................... ......... 123

D-3 Autoradiograph of DD band 3,7,1 .............. .................................. 125

D-4 Autoradiograph of DD band 3,7,2.......... ............................ ....... 128

D-5 Autoradiograph of DD band 7,6,2G ........... ........... ...................... 130

D-6 Autoradiograph of DD band 7,13,1 ........... ............ ....................... 132

D-7 A utoradiograph of D D band 7,20,1 ........................................ ....... ........ 135















ABBREVIATIONS


ANOVA
AP
ARP
CD
cDNA
CyC
dATP
DNA
dNTP
EDTA
EtBr
FACS
FITC
HEPES
IgG
LCK
MOPS
mRNA
MCL1
MLR
MRE
MT
MTF-1
PE
PF
PCR
Poly A'
Q-PCR
RAD23
RNA
RPSA
RT-PCR
SDS-PAGE
UV
Zn-
ZnN
Zn+


analysis of variance
anchored primer
arbitrary primer
cluster designation
complementary DNA
Cy-Chrome
deoxyadenosine triphosphate
deoxyribonucleic acid
deoxynucleotide triphosphate
ethylene diamine tetraacetate
ethidium bromide
fluorescence-activated cell sorting
fluorescein isothiocyanate
N-2-hydroxyethylpiperazine-N'-2-ethane-sulfonic acid
immunoglobulin G
lymphocyte-specific protein tyrosine kinase
3-(N-morpholino)propane-sulfonic acid
messenger RNA
myeloid cell leukemia sequence 1
mouse lamina receptor
metal response element
metallothionein
MRE binding transcription factor 1-
phycoerythrin
pair-fed
polymerase chain reaction
polyadenylated RNA selected
quantitative, real-time RT-PCR
DNA damage repair and recombination protein 23
ribonucleic acid
40S ribosomal protein SA
reverse transcription polymerase chain reaction
sodium dodecyl sulfate polyacrylamide gel electrophoresis
ultraviolet
zinc-deficient
zinc-normal
zinc-supplemented















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

MODERATE MURINE DIETARY ZINC DEFICIENCY AND ZINC
SUPPLEMENTATION MODULATE SPECIFIC THYMIC mRNA ABUNDANCES
IN VIVO: RESULTS FROM cDNA ARRAY ANALYSIS AND DIFFERENTIAL
DISPLAY SCREENING

By

J. Bernadette Moore

December 2002


Chair: Robert J. Cousins
Major Department: Food Science and Human Nutrition

The detrimental sequelae of severe zinc deficiency on the thymus and

T-lymphocyte compartment of the mammalian immune system have been

established, but underlying mechanisms remain unknown. Hypothesizing that

the alterations in T-lymphocyte number and function observed during a zinc

deficiency may result from initial changes in gene expression, we compared

thymic mRNA expression profiles of zinc-deficient (Zn-) zinc-normal (ZnN) and

zinc-supplemented (Zn+) mice utilizing both cDNA arrays and mRNA differential

display. Initial studies developed and characterized the animal model of

moderate dietary zinc deficiency used in the following experiments.

Array analysis of 1200 characterized cDNAs using poly A+ selected

thymic RNA from either Zn- or ZnN mice detected expression for ~230 cDNAs.









From these, four putative zinc-regulated mRNAs were identified, and their

modulation was then confirmed independently using real-time quantitative

RT-PCR (Q-PCR). Of particular interest was elevated expression of the gene for

the lymphocyte-specific protein tyrosine kinase (LCK), which, through a

zinc-mediated interaction in the cytoplasm, transduces signaling from the CD4

and CD8a receptors. Further western analysis showed that, indeed, the

zinc-binding protein LCK was elevated in Zn- thymus.

For differential mRNA display experiments a moderately

zinc-supplemented dietary group was also included. Candidate zinc-modulated

cDNAs, visualized through differential displays generated from a battery of

primers, were isolated and sequenced. Zinc regulation was confirmed

independently by northern blot or Q-PCR. Notably, multiple heat shock and

chaperone protein messages were down-regulated in Zn- animals, whereas

mRNAs for the T-cell cytokine receptor and mouse lamina receptor were found

increased in the Zn- mice. In addition, ribosomal RNA and ribosomal protein

coding genes were found responsive to both zinc deficiency and zinc

supplementation. Lastly, several novel cDNAs have been identified as

zinc-modulated, demonstrating the utility of differential display for contributing

sequence data to the existing databases.

In conclusion, these data support the hypothesis that alterations in thymic

mRNA abundances precede the phenotypic effects associated with severe zinc

restriction or supplementation.















CHAPTER 1
INTRODUCTION AND LITERATURE REVIEW

Introduction

Zinc is an essential micronutrient required for human growth and

development. Considered to have three distinct biological roles: catalytic,

structural, and regulatory (Cousins 1996), over 900 transcription factors and 100

enzymes require zinc for function (Tupler et al. 2001, Vallee and Falchuk 1993).

Not surprisingly, mammalian dietary zinc deficiency has numerous adverse

consequences. Classic symptoms of severe human zinc deficiency include

diarrhea and dermatitis, attributable to failure of the innate barrier component of

immunity: the epithelium. Moreover, thymic atrophy, lymphopenia and

decreased host resistance to infectious disease, attributable to failure of

cell-mediated immunity, contribute significantly to the syndrome of human zinc

deficiency (Shankar and Prasad 1998).

Early animal studies showed that after the thymic cortical involution and

atrophy induced by zinc deficiency, T-lymphocyte mediated responses, in

particular T helper activities, were severely impaired (Fernandes et al. 1979,

Fraker et al. 1977). Furthermore, these activities were rescued specifically by

restoration of adequate zinc status (Fraker et al. 1978). It is now thought that

lymphopenia, due to loss of precursor cells in bone marrow and thymus, results

in host inability to replenish peripheral lymphocytes. This loss of immunity is then









responsible for the increased susceptibility to infectious disease observed

secondary to zinc deficiency (Fraker et al. 2000). While flow cytometric

experiments in the bone marrow, and more recently the thymus (Osati-Ashtiani et

al. 1998, King et al. 2002), of zinc-deficient mice suggests apoptosis may be

responsible for the preferential loss of precursor B and T-cells in these organs,

the molecular signals dictating these losses remain to be established.

Zinc is an established mediator of gene expression through both defined

direct and (as yet poorly understood) indirect mechanisms (Cousins 1998). Zinc

directly mediates transcription through reversible interactions with zinc-fingers of

the trans-acting, metal response element (MRE) binding transcription factor

(MTF-1), which binds cis-acting MREs in the promoter of metallothionein genes

in an inducible fashion (Dalton et al. 1997, Radtke et al. 1993). Because

metallothionein knockout mice live normal life spans but MTF-1 knockout mice

die in utero, it is clear that other examples of zinc's direct mediation of gene

expression exist, but remain to be elucidated (Blanchard and Cousins 2000).

Given the ubiquity of zinc-finger proteins and specifically zinc-finger

transcription factors, it seems improbable that MTF-1 will remain the only

example of a zinc-finger protein whose functionality is determined by zinc supply.

The existence of a zinc-responsive suite of genes (regulon) in Sacchromyces

cerevisiae (Lyons et al. 2000) suggests there will be a similar regulon in

mammals. Isolated examples of promoter and reporter constructs of mammalian

genes that have MRE sequences and provide zinc regulation in have appeared,

including two acute phase proteins, and the calreticulan gene (Lichtlen et al.









2001, Nguyen et al. 1996, Yiangou et al. 1991). Moreover, extensive

experiments characterizing a mammalian expression profile of zinc-deficient

small intestine further supports the idea that zinc deficiency alters the expression

of multiple mRNA species with functional physiological significance (Blanchard

and Cousins 1996, 1997, Blanchard et al. 2001). Additional research will further

define the role of dietary zinc in modulating gene expression and its influence on

host health and susceptibility to disease.

The last decade has heralded tremendous technological advances in gene

sequence and expression analysis (structural and functional genomics). These

advances have given rise to exponential increases in the amount of structural

genomic information for a variety of model organisms including Saccharomyces

cerevisiae, Drosophila melanagaster, Caenorhabditis elgans, and the draft

sequences of the human genome (Lander et al. 2001, Venter et al. 2001).

Likewise, functional genomics has expanded from the study of a single gene

transcript via northern blotting or RT-PCR to monitoring entire cellular expression

patterns or profiles by methods such as differential mRNA display, serial analysis

of gene expression (SAGE) and DNA arrays (Lander 1999, Martin and Pardee

2000).

Currently, these various methodologies offer specific advantages and

disadvantages. For instance, while DNA array technology permits high

throughput expression profiling of hundreds to thousands of genes in parallel,

this ability is exquisitely dependent on current sequence information and, as

such, arrays to date have been used most effectively for analysis of the









Saccharomyces cerevisiae transcriptome (Lander 1999). Differential display, on

the other hand, is sequence independent and permits contribution of sequence

data to the various databases; however experimentally, this approach does not

offer the throughput provided by DNA arrays.

Regardless of the method used, the exploration of cellular mRNA

expression profiles has been noted to yield global genomic fingerprints that

identify the biological state of that cell/tissue, whether in the midst of proliferation,

activation or differentiation (Staudt and Brown 2000). These global fingerprints

are naturally extended to describing the nutritional state of a cell/tissue, or indeed

an organism, and ultimately transcription profiles will be clinically relevant

nutrition assessment tools.

Hypotheses and Research Objectives

The purpose of these experiments is to test the hypothesis that the

phenotypic/pathologic manifestations of thymic atrophy and lymphopenia

observed secondary to severe mammalian zinc deficiency have their genesis in

initial changes of thymic gene expression. This hypothesis predicts that causal

alterations in thymic mRNA abundances will precede the gross phenotypic

effects of zinc deficiency and reflect, directly or indirectly, critical molecular

requirements for maintenance of thymic zinc homeostasis.

Research objectives included the following:

Development and characterization of a murine model of moderate zinc
deficiency.

cDNA array analysis of zinc-deficient and zinc-normal murine thymic gene
expression.






5


Differential mRNA display of zinc-deficient, zinc-normal and
zinc-supplemented murine thymus.

Independent confirmation of selected zinc-modulated cDNAs by
PCR-based methodologies.

Literature Review

Zinc Biochemistry

Zinc is a divalent cation. A group IIB element, it is typologically a mineral

and a metal. The tetrahedral coordinate atomic geometry of the zinc atom, in

combination with its unique paucity of redox function, lends itself particularly well

to formation of stable molecules with thiol ligands (Fleet 2000). An essential

nutrient for all forms of life examined, ranging from microorganisms through

plants and animals, zinc is required in milligram amounts by humans (8 mg/day

for adult females and 11 mg/day for adult males) (Panel on Micronutrients et al.

2002). These requirements are derived from the multiple molecular functions of

zinc.

Zinc is essential for the tertiary structure/function of multiple

metalloproteins, including dozens of conserved metalloenzymes in all enzyme

classes, carbonic anhydrase and alcohol dehydrogenase to name two (Vallee

and Falchuk 1993). In addition, zinc is required for the conformation of the aptly

named zinc-finger peptide motifs found extremely enriched within eukaryote

transcription factor families (Lander et al. 2001, Venter et al. 2001). Over ten

classes of zinc-finger domains have now been described, and it is clear that

these protein domains both bind specific DNA cis elements and mediate

protein-protein interactions with regulatory outcomes (Berg and Shi 1996). The









sheer numbers of existing zinc metalloproteins implicates an involvement of zinc

in essentially all cellular processes.

In addition to the established myriad of proteins dependent on zinc for

function, signaling roles for zinc ions exist. New appreciation is emerging for the

essential role of zinc in bridging extracellular receptors with intracellular

transducers (Huse et al. 1998, Lin et al. 1998). Similarly, recently described in

vitro evidence exists for a membrane zinc-sensing receptor that triggers Ca2+

release from a variety of mammalian cell types, including colonocytes, kidney

cells and keratinocytes (Hershfinkel et al. 2001). Verification of these data would

demonstrate an additional, novel, signaling role for zinc.

In the brain, zinc is found in vesicles in the boutons of a specific subset of

glutaminergic neurons. Zinc ion binding sites are found on both the

N-methyl-D-aspartatate (NDMA) and kainic acid (KA) glutamate receptors,

demonstrating zinc involvement in the glutaminergic, excitatory synapse

(Frederickson et al. 2000). Seemingly contradictory, zinc release from synapses

in response to brain injury (ischemia, seizures and traumatic brain injuries)

induces neuronal death (Koh et al. 1996, Choi and Koh 1998). Moreover, recent

in vivo data suggest that normal synaptically released zinc contributes greatly to

the aggregation of the amyloid P peptide and the pathology of Alzheimer's (Lee

et al. 2002). As women have higher glutaminergic signaling relative to men and

therefore greater neuronal exposure to synaptically released zinc, these data

may explain the enrichment of Alzheimer's disease expression in women (Bush

and Tanzi 2002).









The dichotic cellular toxicity of zinc ions, yet absolute cellular requirement

for zinc, is underscored by the existence of the rapidly expanding family of

described mammalian zinc transporters (Costello et al. 1999, Cragg et al. 2002,

Gaither and Eide 2000, Huang and Gitschier 1997, Huang et al. 2002, Kambe et

al. 2002, Liuzzi et al. 2001, Palmiter and Findley 1995, Palmiter et al. 1996a,

1996b). The importance of zinc trafficking is further supported by experiments in

Escherichia coli showing that the zinc-sensing transcription factors Zur and ZntR,

which modulate transcription of the bacterial zinc uptake and efflux proteins,

respond to femtomolar amounts (orders of magnitude lower than one zinc

atom/cell) of free zinc (Outten and O'Halloran 2001). These data suggest that

there are no pools of free zinc in bacteria and support earlier suppositions that

the level of free zinc in mammalian cells is <1 nmol/L (Cousins 1996).

The cysteine-rich metallothionein (MT) protein which binds up to seven

atoms of zinc, is responsive to dietary zinc at the transcriptional level, and may

function to manage a labile intracellular source of zinc (reviewed by Davis and

Cousins 2000). However, given that MT knockout mice live happily without overt

phenotypic expression of this deficit (Masters et al. 1994), and MT transcription is

regulated by a variety of hormones and cytokines (Samson and Gedamu 1998),

the possibility of unidentified zinc chaperones similar to those identified for

copper (Pena et al. 1999) can not be excluded.

The multiple requirements for zinc in so many intracellular processes is

perhaps best shown by the response to a mammalian zinc deficiency. Rather

than initial mobilization and decline in zinc tissue stores, with subsequent failure









of dependent metabolic function, the response to the loss of zinc is an initial

decrease in endogenous losses and subsequent decline in growth (King and

Keen 1999). This conservation makes it difficult to diagnose a deficiency by

tissue levels, while the multitude of biochemical roles for zinc means that a mild

zinc deficiency produces a variety of diverse symptoms (Panel on Micronutrients

et al. 2002). However, the sequelae of diarrhea, dermatitis and lymphopenia that

manifest in a severe zinc deficiency (Aggett 1989) highlight the necessity of zinc

for cellular replication. As a consequence, rapidly dividing cells (enterocytes,

epithelial cells and lymphocytes) are affected most severely. The topic of immune

integrity loss subsequent to zinc deficiency, and the subject of zinc's involvement

in gene expression both require further expansion. However, an overview of the

physiology of the normal thymus is relevant before discussing the immune effects

of zinc deficiency.

The Thymus and T-lymphocyte Development

The thymus is a multi-lobed primary immune organ located in the upper

anterior mediastinum. Each lobe can be divided histologically and functionally

into outer cortical and inner medullary regions. During embryonic development

the cortical and medullary regions arise from the ectodermal and endodermal

layers of the third pharyngeal pouch and the third branchial cleft, respectively

(reviewed by Suster and Rosai 1990). The thymus is the site of thymopoiesis, a

differentiation process that requires the epithelial cell network (the thymic

architecture/stroma) to be intact and of normal cellularity (Janeway et al. 2002,

reviewed by Marx and Muller-Hermelink 1999, Petrie et al. 2000). Thymocyte









precursors arise from hematopoietic stem cells in the bone marrow or the fetal

liver and then, unlike B lymphocyte precursors that complete their development

in the bone marrow, migrate to the thymus for differentiation into naive

T-lymphocytes.

Developing early in gestation, the thymus displays tremendous plasticity

throughout the lifecycle in response to a variety of stimuli. The thymus begins to

atrophy after puberty with the rate of thymic T-cell production declining

concomittantly. However, this does not mean a loss of the T-cell arm of

immunity, since in addition to the peripheral expansion of established T-cells,

thymopoiesis does continue at a lower rate. Indeed, recent reports suggest that

the human thymus (which involutes, but does not lose volume with age, as

opposed to mouse thymus which atrophies) functions well past middle age

(Haynes et al. 2000). Beyond age related changes in thymic structure and

function, the thymus is known to atrophy/involute in response to pregnancy

(reviewed by Clarke and Kendall 1994, Tibbetts et al. 1999); glucocorticoids

(Ashwell et al. 2000); dioxins (Wahba et al. 1989); and nutrient deficiencies. In

particular, severe zinc deficiency and protein-energy malnutrition have been

noted to precipitate thymic involution (Torun and Chew 1999, Yoshida et al.

2002).

The process of T-cell differentiation follows migration of the cells thru first

the cortical, then medullary, regions of the thymus and can be tracked by cell

surface markers representative of each developmental stage. The thymic cortex

is composed primarily of cortical epithelial cells and T-cell precursors from the









bone marrow. Whereas, the medullary region contains medullary epithelial cells,

dendritic cells, and macrophages, in addition to further differentiated T-cells

(Janeway et al. 2002). Remarkably, over 95% of the T-cell precursors that arrive

in the thymus are doomed to an apoptotic death (reviewed by Kuo and Leiden

1999). This reflects the intensive, incompletely understood, positive and

negative selection processes of thymocyte differentiation. These ensure that

T-cells will both recognize self-major histocompatibility complex (MHC)

molecules, the molecules that present antigenic peptides to the T-cell receptors

(TCR) to elicit an immune response, and distinguish between self-peptides and

foreign peptides bound within the MHC molecules (reviewed by Janeway et al.

2002).

T-cell development can be grossly divided into stages based on cell

surface expression of some of the proteins that form the TCR and co-receptor

complexes, namely the CD3, CD4 and CD8 molecules. While CD3 is one of the

polypeptide chains comprising the TCR, CD4 and CD8 molecules are TCR

co-receptors that divide mature T-cells functionally into MHC class II recognizing

(T helper cells), and MHC class I recognizing (cytotoxic T-cells) subsets. As

such, developing T-cells are tracked loosely from the triple/double-negative,

CD3-CD4-CD8-, pre-T-cells, to the double-positive T-cells, CD3+CD4+CD8+, and

shortly before egress, the naive, single-positive T-cells, CD3+CD4+, or

CD3+CD8+ (Kuo and Leiden 1999).

Ultimately, the development of T-cells is orchestrated temporally at the

transcriptional level. Transcription is driven by extracellular signals that are









conveyed by complex signal transduction pathways now being elucidated.

Currently, it appears that the initial lineage commitment of T-cells to either

expression of the y:6 TCR or a:3 TCR is dictated by which receptor receives

signals first, either the pre-TCR (pTa:3 TCR) or the y:6 TCR (Borowski et al.

2002, Janeway et al. 2002). Dependent on successful, in-frame re-arrangement

of the p, y, and 6 gene loci mediated by the recombinase-activating genes-1 and

-2 (RAG1, RAG2), this lineage commitment appears as a race toward

cell-surface expression.

After early development, a:3 T-cells clearly dominate this race

representing 95% of T-cells produced (Janeway et al. 2002). Signaling through

the pTa:P TCR is transduced by the lymphocyte-specific protein tyrosine kinase

LCK, and is essential for initiation of the rearrangement of the a gene locus and

progression to the double-positive stage (Killeen et al. 1998). The protein

kinases LCK and ZAP-70 are indispensable for T-cell development. As are

several transcription factors including, the zinc-finger proteins: Ikaros, GATA-3

and LKLF; and the HMG (high mobility group) box transcription factor TCF1

(reviewed in Kuo and Leiden 1999). From the double-positive stage T-cell

precursors undergo the positive and negative selection processes. These are

mediated by TCR/co-receptor:MHC interactions, also require LCK function, and

ultimately result in single-positive, naive T-lymphocytes which exit the thymus to

the periphery (reviewed in Borowski et al. 2002, Janeway et al. 2002, Killeen et

al. 1998).









In summary, thymopoeisis is a highly regulated, temporal process that

occurs in the thymus in a manner that is still being clarified at the molecular level.

The complexity of T-cell development stems from the somatic gene

rearrangements required for production of a functional TCR, which then must be

tested for self-restriction and auto-reactivity. Exquisitely sensitive to host

stressors, the thymus involutes and T-cell development is halted in the face of

severe malnourishment, such as zinc deficiency, resulting in compromised

host-immunity.

Zinc Deficiency and Immunity

In mammals, adequate zinc status is required for the proper functioning of

almost every component of the immune system (reviewed by Shankar and

Prasad 1998). Beyond the clinical symptoms: dermatitis, diarrhea, alopecia and

failure to grow (Aggett 1989), decreased host resistance to infectious disease is

a primary consequence of zinc deficiency. Primarily a concern in the third world,

zinc supplementation of children markedly reduces incidence of diarrhea (Bhutta

et al. 2000). In addition, zinc supplementation of high-risk deficient groups has

been shown to reduce the morbidity of respiratory disease (Rosado et al. 1997,

Lira et al. 1998), nematode infection (Boulay et al. 1998), and sickle cell disease

(Prasad et al. 1999).

Shortly after the characterization of human zinc deficiency by Prasad and

colleagues in Iran in the early 1960s (reviewed in Prasad 1991), came inquiry

into the relationship between zinc deficiency and immune function. Initial

experiments conducted by Fraker et al. (1977) investigated the effects of zinc









deficiency on the immune systems of young-adult, female, inbred A/J mice. In

the initial study 5- to 6-week-old mice were maintained on deficient (0.5 |tg Zn/g),

low (2.3 |tg Zn/g), or high (29.1 |tg Zn/g) zinc diets for 39 days. In this case, the

"high" zinc concentration represents the recommended sufficient level for zinc in

rodent chow rather than a supplemental level (American Institute of Nutrition

1977, American Institute of Nutrition 1980). At Day 27 half of the deficient group

were injected with the number of thymocytes equal to that found in an intact

thymus (60 X 106), and on Days 28 and 35 all mice were immunized with sheep

red blood cells (SRBC), a T-cell dependent antigen. After the mice were killed on

Day 39, splenic lymphocytes were isolated and used in the classic Jerne plaque

assay to assess the secondary immune response. Zinc-deficient mice produced

10%, and the low zinc animals produced 25% of the number of anti-SRBC

plasmacytes produced by the high zinc group. Interestingly, the zinc-deficient

animals reconstituted with thymocytes produced 61% of control plasmacytes,

suggesting that zinc deficiency primarily affected T-cell helper activity.

Extending these results Fraker then showed that the drastic involution of

the thymus could be reversed, the thymus repopulated, and antibody-mediated

response restored after re-feeding zinc-sufficient diets for 2 weeks (Fraker et al.

1978). This restoration of immune response with zinc repletion also holds true for

delayed-type hypersensitivity reactions, which are also drastically diminished

during zinc deficiency (Fraker et al. 1982). On the other hand, even moderate

zinc deficiency experienced during gestation produced impaired immune function

for three generations of mice fed control diets with adequate zinc (Beach et al.









1982). Thus illustrating the severity of a zinc deficiency experienced in utero. In

contrast, during lactation, while pups suckling from dams on a marginal zinc diet

have a much weaker humoral response to both T-independent and dependent

antigens; exhibiting 25 to 45% of the response seen in control pups, 2 weeks of

zinc-sufficient feeding could reverse immune deficits observed (Fraker et al.

1984).

Early in vitro experiments also provided evidence that T-cell function is

selectively impaired by zinc deficiency (Zanzonico et al. 1981). Ethylene

diaminetetraacetate (EDTA) used in the medium to chelate zinc did not affect

B-cell mitogenesis as stimulated by lipopolysaccharide (LPS). Whereas T-cell

mitogenesis, in response to either phytohemagglutinin P (PHA) or concanavalin

A (Con A), decreased over 50% relative to controls. The addition of zinc to the

media reversed the effects of EDTA. Supporting these findings are studies by

Fernandes and workers (1979) which found that mice fed zinc deficient diets did

not show any decreased antibody-dependent cytotoxicity, while exhibiting both

depressed T-cell-mediated cytotoxic and natural killer activities. Again, these

data suggested that zinc deficiency selectively affected particular cell

populations.

Since adrenal hypertrophy occurs concomitant to thymic involution during

zinc deficiency, DePasquale-Jardieu and Fraker (1979, 1980) explored the role

of increased levels of corticosterone on T-cell function during dietary zinc

deficiency. In the A/J mouse corticosterone levels increase rapidly after Day 12

of a zinc deficient diet regime. While T-cell helper function did decrease 4 days









after the rise in corticosterone levels, over 50% of the decrease in function was

seen before the rise (DePasquale-Jardieu and Fraker 1979, 1980). These

results may suggest that increased glucocorticoid levels contributed to the

decrease in T-cell activity, however they do not prove a direct link.

A subsequent study examined the effects of dietary zinc deficiency on

adrenalectomized mice (DePasquale-Jardieu and Fraker 1979). There was no

difference between a direct immune response (IgM) from either the

adrenalectomized deficient mice, or the intact deficient mice when the diet was

fed for 3, 4 or 6 weeks. An indirect immune response (IgG; requiring T-cell

function) varied slightly between groups, with the adrenalectomized deficient

mice having a much stronger immune response at 4 weeks, when the rise in

corticosterone levels were seen in the intact mice. However, at 6 weeks, while

the adrenalectomized deficient mice still had a statistically stronger response

than did the intact deficient mice, the immune response had dropped below 40%

of controls. Curiously, the adrenalectomized deficient mice retained their thymus

weight (94% of controls), but their cortical:medullary ratio dropped from 2:1

(controls) to a 1:1 ratio, matching that of the intact deficient mice and indicating

loss of thymocyte precursors and cortical involution. The authors concluded that

the decrease in immunity seen in zinc deficiency is not mediated by the adrenal

axis.

Altered T-cell sub-populations and cytokine production has been observed

during human zinc depletion (Beck et al. 1997b). Mild zinc deficiency was

induced by feeding subjects (n=5) 2 to 3.5 mg zinc/day for 20-24 weeks.









Subjects were initially brought to baseline by consuming 12 mg zinc/day for 4

weeks, then repleted by supplementation of 25-50 mg zinc/day for 8-12 weeks.

During the entire study, all meals were consumed in a metabolic ward, with the

only variable being zinc, and zinc deficiency was confirmed by significant

decreases in plasma, lymphocyte, granulocyte and platelet zinc concentrations.

While no differences were seen in total lymphocyte, T-cell, B-cell, or leukocyte

counts; significant decreases in the ratio of helper to cytotoxic T-cells

(CD4+/CD8+), and in the number of cytotoxic lymphocyte precursors

(CD8+CD73+) were observed at the end of the zinc restriction period. In

addition, a reduction in the ratio of naive and memory T-cells

(CD4+CD45RA+:CD4+CD45RO+) was almost significant (p=.077). Cell

populations returned to baseline after zinc repletion. In addition, interferon-y

(IFNy) and tumor necrosis factor-a (TNFa) production were significantly reduced,

while the production of interleukins (IL) 4, 6, and 10 was not altered during zinc

restriction. The reductions in IFNy and TNFa, both Thl cytokines, suggests an

imbalance between the response of T-helper cell subsets 1 and 2. occurred in

the zinc-restricted subjects.

Inadequate zinc nutriture results in host immunodeficiency. While many

aspects of the immune system suffer during zinc deficiency, cell-mediated

immunity is particularly impaired. The site of T-lymphocyte development, the

thymus, undergoes cortical involution and atrophy, and alterations are seen in

lymphocyte populations and activities. Unless zinc deficiency is experienced in

utero, these symptoms are reversible with restoration of zinc in the diet. While









much research has outlined the specific functional deficiencies found during

mammalian zinc deficiency, underlying molecular mechanisms are yet to be

defined. Numerous pathologies have their origin in altered gene expression,

whether inappropriate overexpression or underexpression of a gene. The

identification of thymic genes modulated by zinc status should significantly further

the understanding of this micronutrient's critical role in immunity.

Zinc and Gene Expression

The requirement of zinc for protein synthesis and enzyme activity has

been recognized for decades, but only recently have the multiple roles zinc plays

in the modulation of gene transcription been highlighted. As zinc is required for

RNA polymerase enzyme activity (reviewed by Vallee and Falchuk 1993),

decreased RNA synthesis during zinc deficiency could contribute to the observed

growth inhibition in such a deficiency. However, expression analyses for genes

regulated by zinc supply in both yeast (Lyons et al. 2000) and rats (Blanchard

and Cousins 1996, Blanchard et al. 2001) show that most of expressed genes

are unaffected by zinc. This argues against a global effect on transcription

activities of the RNA polymerases, and suggests specificity of the zinc-deficient

effect on a subset of responsive genes.

The metallothioniens, cysteine-rich metal binding proteins, were the first

demonstrated zinc inducible proteins (Richards and Cousins 1975a, 1975b).

Decades later while the functionality of the MTs is still being debated (Fischer

and Davie 1998, Palmiter 1998), the molecular mechanism of their zinc

regulation is beginning to be understood. MT genes are highly responsive to a









variety of factors that interact with the multiple response elements in their

promoter regions (reviewed by Davis and Cousins 2000). These factors include:

glucocorticoids, cytokines, electrophiles (hence MT's responsiveness to cellular

redox status), and transition metals such as zinc, cadmium and copper. Metal

regulation of MT is dependent on the multiple metal response elements (MRE) in

the metallothionein promoter; and this regulation is mediated by the MRE-binding

transcription factor (MTF-1), cloned by library screening with an oligonucleotide

probe representing a compilation of MRE sequences (Radtke et al. 1993).

Remarkably, while MT knockout mice display very mild phenotypic effects, the

MTF-1 knockout results in a lethal phenotype (Gunes et al. 1998).

The MTF-1 is a six zinc-finger protein whose MRE motif binding activity

was shown in vitro to be directly modulated by zinc (Dalton et al. 1997).

Additional investigations suggest the first zinc-finger of MTF-1, which differs

significantly from the other fingers in amino acid sequence, binds zinc with low

affinity and in the absence of zinc prevents the MRE-binding function of the

second, third and fourth zinc fingers (Bittel et al. 2000). More recently however,

evidence for regulation of the transactivating function of MTF-1 via

phosphorylation and signal transduction has emerged (LaRochelle et al. 2001,

Saydam et al. 2002). While not negating the regulation of MTF-1 by cellular zinc,

as zinc mediates the DNA binding capability of MTF-1 under all circumstances,

these data present a plausible explanation for the enigmatic, highly inducible

nature of MTs.









Corresponding to the MT data, the MTF-1 regulates the zinc transporter

ZnT1 (Langmade et al. 2000), supporting the initial report that ZnT1 is regulated

by dietary zinc in vivo (McMahon and Cousins 1998). In addition to MTF-1, other

zinc-finger transcription factors have been shown to exchange zinc with the

environment. These include: the estrogen receptor, a member of the nuclear

receptor superfamily, (Cano-Gauci and Sarkar 1996); tramtrack, a transcription

factor that regulates differentiation in Drosophila (Roesijadi et al. 1998); and the

yeast transcriptional activator Gal4 (Maret et al. 1997). Given the sheer number

of zinc-finger proteins, over 50% of transcription factors identified by the human

genome sequencing projects (Lander et al. 2001, Venter et al. 2001), and the

versatility of this structural motif which mediates both protein/DNA and

protein/protein interactions, it seems unlikely that the aforementioned examples

will remain exclusive.

Evidence from expression profiles of zinc deficiency in both yeast and rats

further shows zinc's involvement in gene expression and specifically the

modulation of transcription by altered zinc status. In the case of Sacchromyces

cerevisiae, expression profiling is greatly aided by the availability of complete

genome microarrays; indeed, the pioneering of glass microarrays was from the

field of yeast genetics (Schena et al. 1995, Shalon et al. 1996). Utilizing this

technique, in combination with algorithmic genetic motif analysis, Lyons and

colleagues (2000) identified 46 genes targeted by the yeast zinc-responsive

transcription factor Zapl p. This transcriptional activator, and zinc-sensor,

responds to zinc limitation by interacting with the yeast consensus









zinc-responsive element and up-regulating its targeted genes, which include the

zinc transporters responsible for importing zinc. The battery of genes (regulon)

identified as Zapl p targets in yeast, imply that a similar suite will exist in a

mammalian system, whether regulated by MTF-1 or a, yet unidentified,

zinc-responsive transcription factor. An MTF-1 target gene search has been

executed using a similar combinatorial approach as the yeast research; however,

experimental limitations (i.e. working with 12 and 13-day-old mouse embryos)

prevented the success observed in yeast (Lichtlen et al. 2001).

Expression profiling of rat small intestine has provided substantial

evidence that dietary zinc deficiency alters mRNA abundances in a manner that

predicts both protein abundances and the physiology of the deficiency

(Blanchard and Cousins 1996, 2000, Blanchard et al. 2001). For example this

research identified, among many expressed sequence tags, preprouroguanylin

mRNA, precursor to the natriuretic hormone uroguanylin, as up-regulated in the

deficient animals (Blanchard and Cousins 1997). Subsequent

immunohistochemical experiments have demonstrated elevated uroguanylin

protein levels both in the villi of zinc-deficient rat duodenum and jejunum (Cui et

al. 2000), and in the proximal tubules of the kidney (Cui et al. 2001)

substantiating these findings as a potential molecular mechanism involved in the

classic diarrhea symptoms associated with zinc deficiency. As diarrhea is a

leading cause of death in third world countries, these data further validate

intervention trials demonstrating a decrease in diarrhea morbidity after zinc

supplementation (Bhutta et al. 2000, Rosado et al. 1997, Sazawal et al. 1995,









1996). However, since expression profiles, by either differential mRNA display or

DNA arrays, only provide an estimate of a steady state level, whether dietary zinc

is influencing transcription through cis-acting factors in the nucleus, or affecting

message abundance indirectly by altering message stability or turnover rate,

remains to be understood.

Zinc modulation of gene expression can occur through a variety of direct

and indirect mechanisms. The further identification and characterization of

zinc-regulated genes will increase the understanding of zinc biology and may

provide clinical and field-adequate, reliable, zinc status indicators, which have

been elusive to date.

Gene Expression Analysis

During the last quarter of the twentieth century, biomedical research has

undergone a molecular revolution. The techniques of molecular biology have

been applied within a vast array of disciplines, revising the mendelian view of

disease etiology (single gene mutation equals disease) to a synergistic genomic

perspective. Currently, it is widely recognized that most chronic diseases arise

from multiple genetic and environmental factors. Moreover, the tremendous

responsiveness of cellular transcription in response to environmental stimuli,

such as nutrition, is now appreciated. The various worldwide sequencing

initiatives contributed to this and, in making tremendous strides in the acquisition

of structural genomic information, provided a springboard for functional

genomics, the study of which genes are transcribed, when, in which cell type,

and in response to what stimuli. In this context, the ability and techniques for









monitoring gene expression have expanded from the examination of single gene

transcripts to the monitoring of multiple transcripts simultaneously (Martin and

Pardee 2000).

Transcriptional profiles highlight differential gene expression between

treatment groups that often dictates the alternate phenotypes observed.

Technical approaches to the study of differential gene expression originated in

nucleic acid hybridization (Southern 1975) and amplification (Mullis et al. 1986)

methods. Current approaches, such as differential mRNA display and DNA

arrays, still exploit these principles. While these global methodologies present

varied advantages and disadvantages for data acquisition, undoubtedly they

have contributed to the understanding of many biological processes.

Developed by Liang and Pardee (1992, 1993), differential mRNA display

permits the identification and isolation of differentially expressed genes with no

previous genetic information available. Beginning with cellular total RNA from

two or more conditions, the population of mRNAs is sub-fractionated, first by

reverse transcription and then by polymerase chain reaction (PCR), until a pool

of cDNA transcripts (~50-250) can be size separated by polyacrylamide gel

electrophoresis (PAGE). The incorporation of radiolabeled nucleotides during

PCR permits visualization by autoradiography. Transcripts visually identified as

selectively expressed are excised from the gel and re-amplified by PCR for

cloning and sequencing.

The elegance of differential mRNA display lies in the primers chosen for

reverse transcription and subsequent PCR reactions. The enzymes, reverse









transcriptase and DNA polymerase, both require short oligonucleotide primers

annealed to a strand of RNA or DNA to begin their activity. Choosing an

oligo-deoxythymidine (oligo-dT) primer for reverse transcription selects for the 3'

polyadenylate (poly-A) tail found on eukaryotic mRNA, thereby reducing the total

RNA population to ~5% polyadenylated mRNA. Anchoring this primer 5' to the

poly-A tail, the 3' untranslated region, by two bases M, N [where M may be

adenine (A), guanidine (G), or cytosine (C) and N may be A, G, C or thymidine

(T)] divides the mRNA population by a factor of 12. Furthermore, this eliminates

the possibility of amplifying transcripts that are merely poly-T cDNAs. The

products of the reverse transcription reaction, then, are a pool of complementary

DNA transcripts (3' expressed sequence tags; ESTs) that are further fractionated

by the choice of arbitrary 5' primers. Primer length is a compromise between

desired frequency and desired specificity of annealing and varies between 10

nucleotides. Statistically, 20 arbitrary 10-mer primers in combination with 12

anchored primers will screen the estimated pool of 15,000 active genes in any

one-cell type with 90% confidence that each mRNA will be represented at least

once on the displays (Bauer et al. 1993).

Originally used for identifying and cloning oncogenes and tumor

suppressor genes, whose aberrant expression often leads to uncontrolled

cancerous growth (Liang et al. 1992), differential display has now been employed

to find altered gene expression in a variety of pathologies, including those with

nutritional relevance. The laboratory of King and co-workers successfully utilized

this technique to identify glucose-induced genes in both aortic smooth muscle









cells and retinal pericytes (Aiello et al. 1994, Nishio et al. 1994). As

hyperglycemia is considered a significant risk factor for both the retinopathy and

vascular complications associated with diabetes, the identification of genes

regulated by glucose may lead to better understanding of the role of glucose in

general, and explain why these cell types are particularly susceptible to damage

during diabetes.

Another unique and successful application of differential display screening

was in the identification of abnormally expressed genes in obese transgenic

(ob/ob) mice (Maratos-Flier et al. 1997). Seeking to understand the entire range

of leptin's action in the hypothalamus, this group compared hypothalamic mRNA

from ob/ob and normal mice. Ob/ob mice do not make leptin due to a

spontaneous mutation in the gene and these animals express a primary

phenotype of marked obesity. This approach found Melanin Concentrating

Hormone (MCH), a previously identified but poorly understood hormone,

elevated in the transgenic mice. Further research observed elevated MCH

mRNA levels during fasting in both obese and normal animals. In addition,

injections of MCH to the lateral ventricles of rats prompts consumption of

threefold more food than control rats, establishing a novel role for MCH in

feeding behavior.

In addition to the previously mentioned use of differential display for the

identification of zinc-regulated genes in the intestine, this technique has been

used to identify copper regulated genes in the liver (Wang et al. 1996). Using a

rat model of copper deficiency, these researchers identified several cDNAs









altered by inadequate copper status, including the ferritin heavy subunit and

fetuin, a tyrosine kinase inhibitor which influences the insulin receptor's tyrosine

kinase activity. The regulation of fetuin mRNA abundance may be part of the

mechanism that causes glucose intolerance and hyperinsulinemia in

copper-deficient rats. These examples show the primary advantages of the

differential display approach are that no prior knowledge of sequence data is

required, and theoretically there are not the limits of detection that are associated

with low abundance messages and double fluorescent labeling.

More recently, differential expression analyses have utilized DNA arrays,

which permit comparison of the message levels for hundreds to tens of

thousands of genes simultaneously. In traditional southern/northern blotting and

hybridization approaches, a target nucleic acid population is anchored to a

membrane and probed with an excess of a single radiolabeled cDNA or cRNA.

DNA arrays on the other hand, reverse this process and the arrays of cDNAs or

oligonucleotides are essentially tethered probes, while a population of nucleic

acids are the targets and are labeled and applied to the fixed probes (Rockett

and Dix 1999). Clearly, throughput is a primary advantage to this approach,

albeit inherently dependent on a priori sequence information.

DNA arrays are currently available in membrane, glass or chip formats

(Freeman et al. 2000). Chips, or high-density oligonucleotide arrays, are unique

as the probes are synthesized in situ by photolithography on a silicon chip, and

are less than 25 nucleotides long. In contrast, both membrane and glass array

probes may be oligonucleotides or cDNAs that are robotically spotted on their









respective matrices. These formats also differ in labeling and targeting

approaches. While both the glass and chip formats use fluorescence labeled

targets, with glass arrays the two treatment populations are labeled with either

red or green flurochromes and compete for binding on the same array, whereas

with high-density arrays treatment target populations are labeled and hybridized

separately. Membrane arrays have a current advantage, as targets are labeled

with radionucleotides or fluorescence and hybridized in the same manner as a

northern or southern blot and therefore do not require tremendous start up costs

related to instrumentation.

Expression arrays have been criticized as an experimental approach that

is not hypothesis driven (Modlin and Bloom 2001). However, this perhaps is

precisely why they are an excellent experimental approach, as is differential

display for the same reason: no inherent bias skews the search for differentially

expressed genes. Data generated are not "hypothesis-limited" and repeatedly

array data have yielded both predicted and surprising results (Staudt and Brown

2000). For example, a temporal examination of gene expression from

serum-starved human fibroblasts in response to serum was intended to profile a

model of mitogenesis (lyer et al. 1999). However, the profiles generated

exemplified a physiological response to a wound, reminding us that in vivo when

a cell is exposed to plasma abruptly it is in the context of a wound. In this

situation, induced genes included both those involved in mediating clot

dissolution and remodeling, a recognized role of fibroblasts in wound healing;

and a host of genes for factors involved in recruiting a full immune response.









Later commentary regarding these data by the authors, wryly pointed out that this

experiment served as a reminder of the artificial nature of cultured cells, which

routinely have serum added to the medium (Staudt and Brown 2000).

The tools of molecular biology have now been applied to multiple

disciplines. Since most physiological processes have their origins in the

alteration of gene expression, the application of differential display and DNA

arrays has been extremely successful in identifying selectively expressed genes

in a variety of contexts. It is now recognized that numerous nutrients regulate

gene expression with physiologic outcomes, including sterols, fatty acids,

retinoids, vitamin D and the trace metals: zinc, copper and iron. Further use of

molecular tools should expand our burgeoning understanding of how nutrients

influence gene expression and what role this plays in pathogenesis and health

promotion.















CHAPTER 2
MURINE ZINC DEFICIENCY USING AN OUTBRED STRAIN AND cDNA
ARRAY ANALYSIS OF THYMIC GENE EXPRESSION

Introduction

In deciding to explore differential gene expression in zinc-deficient thymus,

the objective was to observe initial, potentially pathological changes in gene

expression rather than consequential changes resulting from the diseased

deficient state itself. Described here is a mouse model of moderate zinc

deficiency developed for the following experiments. The initial rationale for

choosing a mouse model was the wealth of available immunological markers and

existing murine sequence information. Early studies revealed these animals do

not, in three weeks, exhibit the altered eating behavior and growth patterns

associated with severe zinc deficiencies, precluding the need for an additional

pair-fed control group and permitting direct comparison between zinc-deficient

and zinc-normal animals. While several biochemical indices of zinc status were

significantly depressed, fluorescence-activated cell sorting (FACS) analysis

showed no changes in thymocyte populations expressing the surface markers

CD3, CD4 or CD8, thus establishing that there was no loss of thymocytes at this

level of zinc deficiency. This report then describes an expression profile analysis

of zinc-deficient murine thymus utilizing membrane arrays containing 1200

cDNAs, from genes with characterized roles in cellular physiology.









The array screening identified several potential zinc-modulated genes,

four of whose modulation was subsequently confirmed using semi-quantitative

RT-PCR and then quantified using real-time quantitative RT-PCR (Q-PCR). Of

particular interest was the elevated expression of the gene for the

lymphocyte-specific protein tyrosine kinase (LCK). Further western analysis

showed that, indeed, the zinc-binding protein LCK was elevated in Zn- thymus.

These results demonstrate that three weeks of dietary zinc deficiency is sufficient

to alter specific thymic mRNAs and protein abundances in vivo, before alterations

in developmental thymocyte populations detectable by FACS analysis.

Materials and Methods

Zinc-Deficient Diet Studies

Young adult (303 g, ~6 wk old), outbred CD-1 mice (Charles River,

Wilmington, MA) were maintained individually in hanging stainless steel cages on

a 12-h light/dark cycle with free access to distilled, deionized water. Animals

were initially fed an AIN-76a-based (American Institute of Nutrition 1977, 1980)

pelleted diet containing 5 mg Zn/kg diet (Research Diets, New Brunswick, NJ) for

3-5 days of acclimation. Then mice were randomly assigned to 1 of 3 dietary

groups: zinc-deficient (Zn-, <1 mg Zn/kg diet); zinc-adequate fed ad libitum (ZnN,

30 mg Zn/kg diet); or zinc-adequate pair-fed to the zinc-deficient group (PF, 30

mg Zn/kg diet). After a 3-week feeding period, between 0900-1200, animals

were anesthetized with methoxyflurane, killed by exsanguination via cardiac

puncture, and blood collected for subsequent serum zinc measurement by flame

atomic absorption spectrophotometry. All animal studies in this and subsequent









chapters were approved by the University of Florida Institutional Animal Care and

Use Committee.

Metallothionein Protein Measurement and RNA Isolation

Pancreas was homogenized in 4 volumes of 10 mmol/L Tris containing a

protease inhibitor cocktail (P2714; Sigma Chemical Co., St. Louis, MO) with a

Potter Elvehjem homogenizer. Pancreas metallothionein (MT) levels were

measured by the cadmium/hemoglobin affinity assay (Eaton and Toal 1982) as

described before (Davis et al. 1998). Whole thymus (~250 mg) was

homogenized in 4 mL TRIpure reagent (Boehringer Mannheim, Indianapolis, IN)

and total RNA isolated. RNA concentration was determined by

spectrophotometry, and RNA integrity confirmed by UV visualization of EtBr

stained ribosomal bands after electrophoresis in a 1% Agarose/1X MOPS/2.2

mol/L formaldehyde gel (Blanchard and Cousins 1996)

Fluorescent Activated Cell Sorting

In separate experiments, single cell thymocyte suspensions (~1-2 X 106

cells/mL) from individual animals were triple stained with phycoerythrin (PE)

conjugated anti-CD3, fluorescein isothiocyanate (FITC) conjugated anti-CD4, and

Cy-Chrome (CyC) conjugated anti-CD8 monoclonal antibodies (BD PharMingen,

San Diego, CA). Background fluorescence was established using the

appropriate fluorochrome conjugated IgG isotype standards (BD PharMingen).

All analyses were performed on a FACScan (BD Immunocytometry Systems,

San Diego, CA) instrument at the University of Florida ICBR Flow Cytometry

Core.









cDNA Array Analysis

Equal amounts of total RNA from either Zn- or ZnN animals

(n=7/treatment group) were pooled and DNase (Boehringer Mannheim) treated in

40 mmol/L Tris-HCL (pH 7.5), 10 mmol/L NaCI, 6 mmol/L MgCI for 30 min at

370C. The reaction was terminated with 10 mmol/L EDTA and 100 mg/L

glycogen, and RNA extracted with phenol:chloroform:isoamyl (25:24:1, pH 4.5)

and precipitated with 2 mol/L NaOAc and 95% ethanol. After resuspension, poly

A+ RNA was isolated with Qiagen Oligotex spin columns (Valencia, CA).

Recovered poly A+ RNA was ethanol precipitated, resuspended, quantified, and

assessed for quality as above.

AtlasTM Mouse 1.2 nylon membrane arrays (Clontech, Palo Alto, CA)

containing 1185 partial cDNAs, from genes with known functions in cellular

physiology, spotted individually at 10 ng/spot were used for these experiments.

Complex probe syntheses and array hybridizations were performed precisely

according to the manufacturer's protocol. Briefly, for first strand cDNA probe

synthesis, 1 pg of poly A+ RNA, either Zn- or ZnN, was incubated with cDNA

synthesis primer mix (1.6 pL) and converted to cDNA using Moloney murine

leukemia virus reverse transcriptase in a reaction with >2500 Ci/mmol

[a-33P]dATP (>9.25 x 104 GBq; NEN, Boston, MA). Probes were purified by

column chromatography, and radioactivity measured by liquid scintillation

counting. Probe incorporation levels were within 1-5 x 106 dpm for each cDNA

population and, for three separate hybridizations, probe incorporation levels

measured between 25-50 x 106 dpm. Arrays were prehybridized with









ExpressHybTM (Clontech) containing sheared salmon testes DNA (Sigma) before

addition of denatured probe. Arrays were hybridized overnight (16-20 h) at 680C,

washed according to Clontech's specifications, and exposed to a

phosphorimaging screen.

Phosphorimages were scanned on a Storm Imager (Molecular Dynamics,

Piscataway, NJ) and densitometries analyzed with AtlaslmageTM software

(Clontech). Signal intensities between arrays were normalized by global

summation. In this method, a normalization coefficient is calculated from the

summation of adjusted intensities (intensity minus background) for all genes on

one array (in this case Zn-) divided by the summation of adjusted intensities for

all genes on the second array (ZnN). This coefficient was then applied to

adjusted intensities of the individual genes on the second array. After

normalization, adjusted intensities were exported into Excel (Microsoft,

Redmond, WA) for further statistical analyses.

Semiquantitative RT-PCR

Pooled (n=5), DNase treated total RNA (1.1 pg), isolated from mice

distinct from those used for array hybridizations, was incubated with 500 ng oligo

(dT)12-18 primers (GibcoBRL, Gaithersburg, MD) for 10 min, followed by reverse

transcription with SUPERSCRIPTTM II RNase H- Reverse Transcriptase

(GibcoBRL). Primer sequences used for PCR amplification were obtained from

Clontech, and oligonucleotides were synthesized by Gemini Biotech (Alachua,

FL). Primers used were (Table 2-1) for: glyceraldehyde-3-phosphate-

dehydrogenase (GAPDH); myeloid cell leukemia sequence-1 (MCL-1)









Table 2-1: Primers used for semi-quantitative and quantitative real-time RT-PCR

Gene Accession # Semiquantitativea
GAPDH M32599 5'-TCGTGGATCTGACGTGCCGCCTG-3'
5'-CACCACCCTGTTGCTGTAGCCGTAT-3'
MCL-1 U35623 5'-TCCTTTACTGTTGGCGTGTTATGCTC-3'
5'-GCAAGTGTTCCTATCCTCTGACAGG-3'
LCK M 12056 5'-ATTGCAGAGGGCATGGCGTTCATCG-3'
5'-GGTAAGGGATTCGACCGTGGGTGAC-3'
RAD23B X92411 5'-CAAGTGCCCTTGTGACAGGTCAGTC-3'
5'-GTTGTTGTAGTTGCTGTCGTGGTTGC-3'
MLR J02870 5'-ACTCCGATCGCTGGCCGCTTCAC-3'
5'-GCATGACCTCCCAGGGGTGCTC-3'

Quantitativea
MT1 V00835 5'-GCTGTGCCTGATGTGACGAA-3'
5'-AGGAAGACGCTGGGTTGGT-3'
TaqMan probe
5'-6FAM-AGCGCTGCCACCACGTGTAAATAGT
ATCG-TAMRA-3'
MCL-1 U35623 5'-CCAACCCCCCCAAAACTT-3'
5'-TGACAGGAAAGCTGTGCTGACT-3'
LCK M 12056 5'-GCATGGCGTTCATCGAAGA-3'
5'-GCGTGTCAGACACCAGGATGT-3'
RAD23B X92411 5'-CAGGTCAGTCTTATGAGAATATGGTAACTG-3'
5'-GGCTCTCAGGGCTGCAATT-3'
MLR J02870 5'-TTCACACCTGGGACCTTCACT-3'
5'-TGGGATCGGTCACCACTAGAA-3'
a Sense and antisense, respectively

lymphocyte-specific protein tyrosine kinase (LCK); DNA damage repair and

recombination protein 23B (RAD23B); and mouse laminin receptor (MLR). Using

Clontech's recommended protocol, PCR was performed with Taq DNA

polymerase (Boehringer Mannheim) with aliquots removed at 22, 27, 32, and 37

cycles. PCR products were electrophoresed on a 1.5% agarose gel, which was

then stained for 60 min with SYBR Green I (Molecular Probes, Eugene, OR)


and scanned on the Storm Imager.









Real-time Quantitative RT-PCR

All primers and the TaqMan probe were designed using Primer Express

software version 1.0 (PE Applied Biosystems, Foster City, CA) and designed to

overlap gene regions amplified by Clontech's primers. Primers were synthesized

by Applied Biosystems and were (Table 1) for: mouse metallothionein-1 (MT1);

MCL-1; LCK; RAD23B; and MLR. Primers and TaqMan probe for 18S rRNA

gene were purchased from PE Biosystems and used as the endogenous control

for initial, total RNA abundance normalizations.

All assays were performed using one-step RT-PCR reagents and a

GeneAmp 5700 Sequence Detection System, all from PE Applied Biosystems,

and relative quantitation was computed from a 4-5-log range standard curve

generated from 1:10, serial dilutions of total RNA. Samples were run in triplicate,

and amplicon specificity for the SYBR assays confirmed by presence of a single

peak in the first derivative of primer melt curve analysis for each assay. Total

RNA (~1-3 ng) isolated from individual, either Zn- or ZnN, mice, again distinct

from those used in array and semi-quantitative PCR experiments, was used for

these confirmation experiments. The MT1 TaqMan assay was performed using

900 nmol/L each of the forward and reverse primers and 250 nmol/L of specific

MT1 TaqMan probe. Whereas, the 18S rRNA TaqMan assay utilized 50

nmol/L forward and reverse primers and 200 nmol/L TaqMan probe, and all

SYBR assays used 50 nmol/L forward and reverse primers.









Western Analysis

Whole thymus, isolated from either Zn- or ZnN animals, was immediately

homogenized in 20 mmol/L HEPES, pH 7.4; 500 mmol/L EDTA; 300 mmol/L

mannitol; and 5% protease inhibitor cocktail (P2714; Sigma). Samples were

centrifuged for 20 min at 100,000xg, and the membrane pellet was resuspended

in the HEPES, pH 7.4, buffer. After a second brief (2 min) centrifugation at

250xg, supernatant was taken and the protein concentration was determined

(Markwell et al. 1978). An equal amount of membrane fraction from each

individual animal was pooled within treatment groups (n=7-10), resolved on a

10% SDS-PAGE gel, and then electroblotted to Immobilon-P as previously

described (McMahon and Cousins 1998). A monoclonal LCK antibody (Upstate

Biotechnology, Lake Placid, NY) was the primary antibody (1 pg/mL), and

anti-mouse IgG horseradish peroxidase conjugate (Sigma) was the secondary

antibody. Detection was by fluorescence imaging using ECF (Amersham

Pharmacia Biotech, Piscataway, NJ) and the Storm Imager.

Statistical Analysis

Food intake and body weight data were analyzed by repeated-measures

ANOVA using mixed model methodology (SAS Institute Inc. 1988). Comparisons

between Zn- and ZnN treatment groups were by two-tailed Student t-test (Instat,

Graphpad, San Diego, CA), with significance established at p < 0.05.










Results

Dietary Protocol

Initial diet studies included a zinc-adequate group pair-fed (PF) to

zinc-deficient (Zn-) animals; however, 3 replicate diet studies (n=5/treatment

group) showed that 3 weeks of dietary zinc restriction in these young adult

outbred mice did not permute food intake (Fig. 2-1A) or body weight (Fig. 2-1B).


3

2 -A- Zn
-*- PF
1
1 A --- ZnN

0
1 4 7 10 13 16 19
Days


-*- PF
B -- ZnN

1 7 14 20
Days


Figure 2-1: Food intake and body weights of zinc-deficient (Zn-), pair-fed (PF)
and zinc-normal (ZnN) mice. Animals were fed either <1 or 30 mg Zn/kg diet for
3 weeks. PF group received zinc-adequate diet. (A) Food Intake. (B) Body
weights. Values are mean of n=15 in each group and represent 3 separate
experiments. There were no significant differences seen between experiments
or at any time point. Data were analyzed by repeated measures ANOVA using
mixed methodology.

Consequently, the PF group was dropped from later experiments where

comparison periods were of 3 weeks duration. Zinc homeostasis was assessed

by 3 separate biochemical indices: serum zinc, thymic MT1 mRNA, and pancreas

MT protein levels, all of which were significantly (P < 0.004) depressed in Zn-


mice (Table 2-2) after 3 weeks on diet.









Table 2-2: Zinc status indicators for zinc-deficient and zinc-normal mice
Dietary Group
Variable Zn- ZnN

Serum zinc, pmol/La 4.4 0.9b 12.8 1.5

Pancreas MT1 protein, pg/g tissue 5.4 1.9b 65.0 8.7

Thymus MT1 mRNA, relative units 9.4 1.00 15.4 1.4

Thymus weight, g/g body 1.1 0.1 1.1 0.1
aValues are mean SEM, n = 5-10
b Significantly different from ZnN group (P < 0.0001)
0 Significantly different from ZnN group (P < 0.004)
dValues are mean SEM, n = 23-24 (P < 0.945)

Fluorescence Activated Cell Sorting

An additional consideration for the dietary time frame was whether thymic

atrophy had begun. Since our objective was to observe zinc-mediated changes

in mRNA levels rather than those resulting from alterations in cell populations

occurring during severe thymic involution, we used FACS analysis to examine

the thymocyte populations expressing the surface glycoproteins CD3, CD4, and

CD8 (Fig. 2-2). FACS analysis established that there was no cellular loss in the

Zn- animals nor were there any perturbations in the primary developmental

populations examined, which further substantiated 3 weeks of zinc deficiency in

these animals as modest in effect (Fig. 2-2). After 4 weeks of zinc deficiency

there was a slight decrease in total number of CD3+ cells (data not shown);

however, this was not significant. These data gave confidence that observed

changes in mRNA abundance were due to zinc deficiency and not gross

alterations in thymocyte populations.











A o o.
A
,,1. k.i. "



cL -. .

0 50 100 150 200 250 10 101 3 4 1 0 13 io
Side Scatter c cYC cC cyc
B "o--- "----- ------
72 893 114 8445 00 96+3
21 31 10 42 33 1+1

-Zn f I0 : 4 .
.*.C:, o ,: .. .,- "


I,0 i '. 102 10 0 10" 1 4 100 2 3
cO8CYC Cos YC CD8CYC
*.- ---------- -----, ----------- ._______
62 902, 93 863 00 954
10 11 41 43 10
ZnN

10 0 I 1 14 4 1 3 4
101 1o:i 4 01 10 12 10 1; 10 '1 03 10 4
CODCYC C CYC

Total CD3+ CD3-

Figure 2-2: FACS analysis of Zn- and ZnN thymocytes. Isolated from Zn- or ZnN
mice after 3 or 4 weeks of feeding, thymocytes were triple-stained with anti-CD3
PE, anti-CD4 FITC and anti-CD8 CyC. (A) Thymocytes were first gated (R1) on
size and granularity (left panel). Quadrants were set on background
fluorescence of isotype control mAbs (middle panel) and thymocytes were
secondarily gated as CD3+ (R2) or CD3- (R3) (right panel). (B) Representative
CD4 vs. CD8 expression profiles for total (left panels), CD3+ (middle panels),
and CD3- (right panels) thymocytes from 3 week Zn- (top row) and ZnN (bottom
row) mice. Percentage of cells in each quadrant is the mean of 9-10 animals. No
significant differences were seen in any subset after either 3 or 4 weeks (data not
shown) of feeding.

























Figure 2-3: Densitometry output for Zn- array relative to ZnN array using
AtlaslmageTM software. Each square is the location of 1 of 1185 cDNAs on the
array. The 33P-labeled cDNAs used for hybridization were derived by reverse
transcription of pooled (n=7) poly A+ RNA isolated from Zn- and ZnN mice. Gray
represents cDNAs not detected above background levels. Green represents
equal expression between Zn- and ZnN (0.667 < ratio < 1.5, absolute difference
< 2x background). Red indicates higher expression and blue indicates lower
expression in Zn- mice. Individual squares are divided in half, with top half
exhibiting densitometric ratio (Zn-/ZnN), and bottom half absolute difference (Zn-
minus ZnN). Black indicates gene was not considered because of signal
irregularities. Squares circled (fold change observed in Zn-/ZnN) are: 1. MCL-1
(10.6); 2. LCK (11.5); 3. MLR (42.3); 4. RAD23B (11.8).

Analysis of cDNA Arrays

Array hybridizations resulted in detection of ~230 cDNAs above

background levels, very few of which demonstrated altered levels at this

moderate level of zinc deficiency (Fig. 2-3). Linear regression of normalized

cDNA intensities from both groups (Fig. 2-4) established a trendline equation of

y=1.087x+10 and a correlation coefficient of R2=0.988, further highlighting the

similarity of expression levels between Zn- and ZnN animals. This tight

correlation also illustrates the lack of experimental noise in this animal model,

which increased the probability that cDNAs deviating from the line of normality










100000

C _
10000
U)

S1000 3 2
) 1
4'

< 100
N y = 1.087x +10
R2 = 0.988
10 1
10 100 1000 10000 100000
ZnN Adjusted Intensities

Figure 2-4: Scatter plot of adjusted intensities for detected genes from ZnN array
vs. Zn- array. Middle line is identity (y=x); from which these data deviated
minimally, as demonstrated by trendline equation y=1.087x+10 and correlation
coefficient R2=0.988 derived by linear regression. Top and bottom lines
represent y=1.5x and 0.667x respectively. Circled are genes confirmed as
zinc-modulated: 1. MCL-1; 2. LCK; 3. MLR; 4. RAD23

were not spurious. Those cDNAs demonstrating greater than a 1.5-fold change

were considered as candidates for post hoc confirmation. Circled (Figs. 2-3 and

2-4) are those confirmed as zinc-modulated: 1.MCL-1; 2.TLCK; 3.TMLR;

4.TRAD23B.

RT-PCR Confirmations of Differential Gene Expression.

The initial confirmation of zinc-regulated candidates identified by cDNA

array analysis was by semi-quantitative RT-PCR using the same Clontech

primers that were used to produce the cDNA fragment spotted on the array.

However, RT-PCR was performed using pooled total RNA derived from Zn- and

ZnN mice from a separate diet study rather than the RNA used for the array

experiments. This qualitative assessment confirmed the upregulation of LCK,








RAD23B, and MLR, compared to identical expression of GAPDH (Fig. 2-5).

Subsequently we chose to design primers for use in real-time quantitative

RT-PCR (Q-PCR), which permits more accurate quantification from the

exponential phase of PCR amplification and the use of individual rather than

pooled samples, in order to accurately quantify these perturbations in expression.

The results from Q-PCR (Fig. 2-6), performed using RNA from individual animals

(n=5-10) independent of those used in previous experiments, confirmed

zinc-mediated modulation for all 4 genes, with the greatest intragroup variation,

expected as a heterogeneous response to a pathology, seen in the zinc-deficient

mice.

Zn- ZnN
22 27 32 37 22 27 32 37
GAPDH II S I*U*


LCK i


RAD23 *** mgm.


MLR s ,, s



Figure 2-5: Semi-quantitative RT-PCR confirmation of zinc-modulated cDNAs
identified by array analysis. RT-PCR was performed on pooled (n=5) total RNA
isolated from other Zn- or ZnN mice with aliquots removed after 22, 27, 32, 37
cycles for resolution on a 1.5% agarose gel and subsequent visualization by
SYBR Green I staining and fluorescence imaging. Arrows point to linear region
of PCR amplification where differences in expression are visible.









2.5
ZnN (Array)
Zn- (Array)
2.0 ZnN (Q-PCR)






0 -
e qe R n- (Q-PCR)

1 1.5 -


**P = 0.07.


d o.5

0 -

MCL LCK RAD MLR

Figure 2-6: Comparison of relative expression of four genes based on array and
real-time quantitative RT-PCR (Q-PCR) data. Q-PCR was performed on total
RNA isolated from individual Zn- and ZnN mice. Relative quantities were
calculated using 18S rRNA as an endogenous control. Q-PCR values are mean
+ SEM of 5-10 animals normalized to mean of ZnN animals. *P = 0.02;
**P = 0.07.

Western Analysis of LCK Thymus Protein.

The previous identification of the zinc-binding LCK protein as elevated in

zinc-deficient peripheral lymphocytes (Lepage et al. 1999) prompted our further

investigation of thymic LCK protein abundance in mice from our dietary study.

Western analysis of LCK protein after 3 weeks of deficiency demonstrated a

1.8-fold increase in LCK protein abundance in the Zn- mice (Fig. 2-7) relative to

ZnN mice.

Discussion

This reports the first expression profiling of zinc-deficient thymus. Given

the hypothesis that the detrimental effects of severe zinc deficiency on the

thymus and T-lymphocyte populations may have their genesis in primary









o 2.5


2.0
3 LCK -.

1.5 Zn-ZnN
C

0 1.o


0.5


Zn- Zn N

Figure 2-7: Western analysis of thymic LCK protein levels. Equal amounts of
thymus total membrane preparations from individual, either Zn- or ZnN, animals
were pooled (n = 7-10) within treatment groups and resolved on a 10%
SDS-PAGE gel. LCK protein was detected with an anti-LCK monoclonal
antibody and chemiluminescence. Relative abundance is the mean + variance of
five replicate lanes for each treatment. Insert shows representative lanes for
both (Zn- and ZnN) membrane preparations after western analysis. Arrow points
to a single 56 kDa band for LCK protein.

alterations in thymic gene expression, the dietary protocol was designed to be

moderate with the goal of identifying initial, rather than consequential, changes in

mRNA populations. These studies used outbred, young adult male mice that

were fed either zinc-deficient or zinc-adequate diet for three weeks. This time

period was sufficient to depress multiple biochemical indices of zinc status in the

zinc-deficient animals, namely serum zinc, pancreas MT protein, and thymic MT1

mRNA levels. Notably, there were no alterations in feeding behavior or growth

rate, which permitted the exclusion of the pair-fed group traditionally used in zinc

feeding studies. The fact that MT1 mRNA levels were significantly depressed in

the thymus of the zinc-deficient mice was evidence that this level of zinc









deficiency was sufficient to repress the expression levels of a gene recognized

as directly regulated by zinc supply. This increased the likelihood of detecting

other mRNAs influenced by dietary zinc using this approach.

Having established the dietary framework for the transcriptional analysis of

zinc-deficient murine thymus, cDNA arrays containing cDNAs from 1185 genes

with identified roles in cellular physiology were utilized. The moderate dietary

treatment was underscored by the very close correlation between the expression

profiles of the Zn- and ZnN mice. Nonetheless, at this level of in vivo zinc

deficiency, array screening identified several potential zinc-regulated candidates.

These were confirmed as zinc-regulated using two different RT-PCR techniques

and independent animal populations. Identified by array screening and confirmed

as zinc-responsive were (relative to ZnN): myeloid cell leukemia sequence-1,

found depressed (0.6); DNA damage repair and recombination protein-23B,

found elevated (1.8); the mouse laminin receptor, also elevated (2.3); and lastly

the lymphocyte-specific protein tyrosine kinase, also found elevated (1.5).

Several factors prompted the examination of potential candidates with less

than a twofold change. Firstly, recognition that the twofold designation is

arbitrary, and often dictated by signal to noise ratio, which in this system was

extremely high. Secondly, previous research (Blanchard and Cousins 2000, Lee

et al. 1999) has shown that nutritional effects on gene expression in vivo are

smaller in nature than those associated with development or oncogenic

transformation. This is further supported by the statistical significance of the 40%

reduction in thymic MT1 mRNA observed in this study. Thirdly, this approach to









array analysis was based also on previous research with differential display

(Blanchard and Cousins 1996). Specifically, the display/array is considered as a

primary screening tool, and only mRNA's whose zinc modulation is confirmed

independently are reported as differentially expressed. However, perhaps the

most compelling reason to examine cDNAs showing less than a twofold

difference was the array identification of a 1.5-fold increase in LCK mRNA in the

zinc-deficient animals. This lymphocyte-specific protein tyrosine kinase

associates with the cytoplasmic tail of the CD4 receptor through thiol-mediated

tetrahedral coordination of a Zn2+ ion (Huse et al. 1998). In addition, the LCK

protein was previously identified by Lepage and coworkers (1999) as

up-regulated in murine splenic lymphocytes during dietary zinc deficiency. These

two aspects of LCK expression/function suggested that the 1.5-fold increase

observed in our system was worthy of further investigation.

The array conformation data demonstrate that smaller fold changes in

mRNA populations can be reproducible, and support the hypothesis that not

exploring a less than twofold difference in expression may preclude changes with

functional significance from consideration. Indeed, (Tusher et al. 2001), in

developing a method for statistical analysis of microarray data, articulated

inadequacies 'with "fold change" analysis. These authors show that the low

signal-to-noise ratio seen at low levels of expression, where most genes are

expressed, means that twofold changes occur randomly for a large percent of

genes and is associated with a false discovery rate of 81%. Furthermore, they

propose for genes expressed at higher abundance, stoichiometrically smaller









changes in gene expression are likely to be significant but are rejected from

consideration by a twofold cutoff. In the array experiments described here,

genes detected were predominantly those exhibiting medium to high expression

levels and very low noise was encountered.

While the functional significance associated with these observed,

reproducible, changes in mRNA and protein abundances in zinc-deficient thymus

will be further defined by additional research, currently several intriguing

observations can be made regarding identified roles for these genes and the

potential for a zinc-mediated interaction. Clearly, as LCK is dependent On zinc

for its cytosolic binding, and therefore downstream signal transduction, of both

the CD4 and CD8a co-receptors (Huse et al. 1998), it emerges as a candidate

likely to be influenced directly by zinc supply. As a lymphocyte-specific protein

tyrosine kinase, LCK plays an essential role in the T-cell receptor-linked signal

transduction pathways associated with peripheral T-lymphocyte activation

(Straus and Weiss 1992), and is expressed in the thymus at all stages of

thymocyte development. Furthermore, from studies in LCK knockout mice, it

appears critical for the selection and maturation of developing thymocytes

(Molina et al. 1992).

Dietary zinc insufficiency has already been reported to increase

expression of LCK in peripheral splenic T-lymphocytes (Lepage et al. 1999) and,

in this report, evidence is provided for its modulation, both at the mRNA and

protein levels, by dietary zinc supply in developing thymocytes. It is plausible

that a disruption of the zinc-mediated interaction between LCK and the CD4/CD8









co-receptors in the cytosol results in a feedback signal to upregulate LCK mRNA

expression. Such a signal disruption provides a potential mechanism for the zinc

deficiency-associated loss of developing thymocytes, and is worthy of future

study. Alternatively, the recent identification of a Kruppel-type zinc-finger protein,

mt3, as the essential transcriptional activator required for thymus-specific

expression of LCK (Yamada et al. 2001) provides another potential mechanistic

avenue to explain the observed zinc-mediated increase in LCK mRNA levels

reported here. Of particular relevance is that a reduction in thymic

metallothionein expression is concomitant with other alterations observed.

Metallothionein, acting as a zinc donor/acceptor, could be a factor in decreasing

the availability of zinc necessary for LCK/CD4, LCK/CD8a binding, as has been

proposed (Lin et al. 1998), or for zinc necessary for structure/function of the mt1

transcription factor (a function envisioned from the experiments of Roesijadi et al.

1998).

For the remainder of the zinc-modulated transcripts identified in this study,

a direct zinc interaction is not immediately apparent. MCL-1 is a member of the

apoptosis-related BCL-2 family of proteins originally isolated as an early

induction gene from human myeloid cells (Kozopas et al. 1993). It forms

heterodimers preferentially with pro-apoptotic BCL-2 family members (Leo et al.

1999) and induction of MCL-1 is associated with a rapid and transient increase in

cell viability suggestive of a permissive environment for hematopoietic

differentiation (Townsend et al. 1999). Recently, two independent investigations

have shown that alternative splicing of the mcl-1 human gene, skipping exon 2,









results in a protein variant having pro-apoptotic function (Bae et al. 2000, Bingle

et al. 2000). As both sets of our primers were designed for an amplicon within

the 3' untranslated region of the MCL-1 transcript, which variant is affected

cannot be predicted. However, the depression of MCL-1 mRNA observed in

these experiments supports a role for apoptosis in zinc deficiency-associated

lymphopenia, paralleling data regarding the halt of B-lymphocyte development

through apoptotic mechanisms in the bone marrow of zinc-deficient mice

(Osati-Ashtiani et al. 1998).

While there is relatively little known about the mouse laminin receptor

(MLR), it is relevant to note that increased protein expression of both MLR and

MCL-1 have been defined as immunohistochemical markers of tumor metastatic

potential. Moreover, MLR is associated with preleukemic thymuses (Verlaet et

al. 2001) and MCL-1 with thymic carcinomas (Chen et al. 1996, Dorfman et al.

1998). However, MLR, a 67 kDA protein expressed on the cell surface, is formed

through the dimerizing of its cytoplasmic precursor, a 37-40 kDa protein found

tightly associated with the 40S ribosome: the LBP/p40 (laminin binding protein

precursor p40) (Sato et al. 1999). Highly conserved, the yeast homologues

Rps0A and Rps0B are essential components of the 40S ribosomal subunit (Ford

et al. 1999) implying a role for the LBP/p40 in translation.

Similarly, RAD23B (also MHR23B for mouse homologue to RAD23B),

identified as a nucleotide excision repair gene product in Saccharomyces

cerevisiae, has evolved additional functions in mammals (Hiyama et al. 1999).

Expressed constitutively in all tissues, RAD23B interacts with the regulatory, S5a









subunit, domain of the 26S proteasome through its N-terminal ubiquitin-like

domain (Hiyama et al. 1999, van der Spek et al. 1996). In addition, very recent

experiments have revealed a RAD23B interaction with ubiquitin, which is

mediated by its duplicated, highly conserved, C-terminal ubiquitin-associated

domain (Bertolaet et al. 2001). This supports other experiments indicating that

RAD23B inhibited multi-ubiquitin formation and proteolytic degradation (Ortolan

et al. 2000). Although a direct zinc-mediated interaction is not immediately

apparent, in light of zinc's structural role for so many proteins and previous data

identifying the proteasomal ATPase as increased in zinc-deficient small intestine

(Blanchard and Cousins 2000), it is nonetheless interesting to identify the

RAD23B transcript as up-regulated in this context.

In summary, this research identifies by cDNA array analysis and

subsequent RT-PCR confirmations, 4 mRNA transcripts significantly modulated

by a moderate level of in vivo zinc deficiency although there was no general

reduction in RNA transcription levels. In particular, one of these, LCK, mediates

signal transduction through the CD4 and CD8a receptors through a cytosolic,

zinc-dependent interaction. These data show that both LCK mRNA and protein

levels are elevated in zinc-deficient murine thymus before the onset of thymic

involution as detectable by FACS analysis. The thymic genes, found

dysregulated here, may be factors in initiation of the lymphopenia and thymic

atrophy associated with severe zinc deficiency.















CHAPTER 3
DIFFERENTIAL mRNA DISPLAY OF ZINC-DEFICIENT, ZINC-NORMAL AND
ZINC-SUPPLEMENTED MURINE THYMUS

Introduction

These experiments, using differential mRNA display for identifying dietary

zinc-mediated changes in thymic gene transcription, were initially begun before

the array experiments, and then reinitiated. Consequently, the experiments

outlined exemplify the current rapid evolution of molecular methodology. In

planning these protocols before the firm establishment of our dietary zinc

deficiency model, one of the primary appeals of differential display (DD) was its

accommodation of multiple treatment groups. Hence, earlier displays include a

pair-fed (PF) group and later displays do not. This advantage of DD also

permitted the inclusion of a zinc-supplemented group (Zn+; receiving ~six fold

more zinc than ZnN animals), in addition to the Zn- and ZnN groups described

previously. The following results demonstrate that, in mice, moderate changes in

the dietary amounts of a single trace element can reproducibly alter specific

mRNA abundances in the thymus. Genes identified as sensitive to thymic zinc

supply implicate functional consequences, which are intriguing in light of zinc's

molecular role in mediating protein structure, and hence function.









Materials and Methods

Feeding Studies

Young adult (303 grams), male CD-1 mice (Charles River, Wilmington,

MA) were housed individually in hanging stainless steel cages with a 12-hour

light/dark cycle and free access to distilled, de-ionized water. Animals were

initially acclimated to a purified AIN-76a-based (American Institute of Nutrition

1977) pelleted diet containing 5 mg /kg diet (Research Diets, New Brunswick,

NJ) for 3-5 days. Subsequently, animals were randomly assigned to one of three

dietary groups: zinc-deficient (Zn-, <1 mg /kg), zinc-normal (ZnN, 30 mg /kg), and

zinc-supplemented (Zn+, 180 mg /kg) for a three week feeding period. After

which, beginning at 0900, animals were anesthetized with halothane and killed

by cardiac puncture and exsanguination. Blood was collected for measurement

of serum zinc concentration by flame atomic absorption spectrophotometry, and

whole thymus (~250 mg) was excised and homogenized in 4 mL TRIpure

reagent (Boehringer Manheim, Indianapolis, IN).

RNA Isolation and Differential Display RT and PCR Reactions

Thymic total RNA was isolated according to the manufacturer's directions.

RNA concentrations were determined spectrophotometrically and integrity was

verified by agarose electrophoresis and Ethidium Bromide (EtBr) staining. Equal

amounts of RNA were pooled from mice (n=7) within treatment groups and the

pooled samples were DNase treated using Ambion's DNA-freeTM kit (Austin, TX).

For these experiments, the HIEROGLYPHTM mRNA profile kits (Beckman

Coulter, Fullerton, CA) were utilized for differential display RT and PCR









reactions. In total, these included 12 anchored 3' primers (AP1-12), and 20

arbitrary 5' primers (ARP1-20), which together are predicted to comprehensively

screen an entire mammalian mRNA pool (Bauer et al. 1993). Anchored primers

(APs), or T7oligo(dT12)MN primers, were 31 nucleotides (nts) long, anchored

upstream by 2 nts, and incorporated a T7 RNA polymerase-derived site

downstream for aid in future amplification and sequencing reactions (Table 3-1).

Table 3-1: Anchored primers used for differential display RT and PCR reactions

Primer Sequence
AP1 5'-GTAATACGACTCACTATAGGGCTTTTTTTTTTTTGA-3'
AP2 5'-GTAATACGACTCACTATAGGGCTTTTTTTTTTTTGC-3'
AP3 5'-GTAATACGACTCACTATAGGGCTTTTTTTTTTTTGG-3'
AP4 5'-GTAATACGACTCACTATAGGGCTTTTTTTTTTTTGT-3'
AP5 5'-GTAATACGACTCACTATAGGGCTTTTTTTTTTTTCA-3'
AP6 5'-GTAATACGACTCACTATAGGGCTTTTTTTTTTTTCC-3'
AP7 5'-GTAATACGACTCACTATAGGGCTTTTTTTTTTTTCG-3'
AP8 5'-GTAATACGACTCACTATAGGGCTTTTTTTTTTTTAA-3'
AP9 5'-GTAATACGACTCACTATAGGGCTTTTTTTTTTTTAC-3'
AP10 5'-GTAATACGACTCACTATAGGGCTTTTTTTTTTTTAG-3'
AP11 5'-GTAATACGACTCACTATAGGGCTTTTTTTTTTTTAT-3'
AP12 5'-GTAATACGACTCACTATAGGGCTTTTTTTTTTTTCT-3'


The upstream arbitrary primers (ARPs) were 26 nts long and incorporated a 16 nt

M13-reverse priming site (Table 3-2).

For reverse transcription, the pooled, DNase treated RNA (~0.1 [tg) from

each treatment group was incubated with 2 [tmol/L of specific AP at 700C for 5

min, and immediately placed on ice. A master mix was added with final

concentrations of 2 Units/pL SuperscriptTMII RNase H- reverse transcriptase

(Invitrogen, Carlsbad, CA), 50 mmol/L Tris-HCI, 75 mmol/L KCI, 3 mmol/L MgC12,

10 mmol/L dithiothreitol, and 25 [tmol/L each, dNTPs. First strand synthesis

reactions proceeded in a thermocycler with a heated lid (MJ Research, Waltham,









Table 3-2: Arbitrary primers used for differential display PCR reactions
Primer Sequence
ARP1 5'-AGCGGATAACAATTTCACACAGGACGACTCCAAG-3'
ARP2 5'-AGCGGATAACAATTTCACACAGGAGCTAGCATGG-3'
ARP3 5'-AGCGGATAACAATTTCACACAGGAGACCATTGCA-3'
ARP4 5'-AGCGGATAACAATTTCACACAGGAGCTAGCAGAC-3'
ARP5 5'-AGCGGATAACAATTTCACACAGGAATGGTAGTCT-3'
ARP6 5'-AG C G GATAACAATTTCACACAGGATACAACGAGG-3'
ARP7 5'-AGCGGATAACAATTTCACACAGGATGGATTGGTC-3'
ARP8 5'-AGCGGATAACAATTTCACACAGGATGGTAAAGGG-3'
ARP9 5'-AGCGGATAACAATTTCACACAGGATAAGACTAGC-3'
ARP10 5'-AGCGGATAACAATTTCACACAGGAGATCTCAGAC-3'
ARP11 5'-AGCGGATAACAATTTCACACAGGAACGCTAGTGT-3'
ARP12 5'-AG C G GATAACAATTTCACACAG GAG GTACTAAG G-3'
ARP13 5'-AGCGGATAACAATTTCACACAGGAGTTGCACCAT-3'
ARP14 5'-AGCGGATAACAATTTCACACAGGATCCATGACTC-3'
ARP15 5'-AGCGGATAACAATTTCACACAGGACTTTCTACCC-3'
ARP16 5'-AGCGGATAACAATTTCACACAGGATCGGTCATAG-3'
ARP17 5'-AGCGGATAACAATTTCACACAGGACTGCTAGGTA-3'
ARP18 5'-AGCGGATAACAATTTCACACAGGATGATGCTACC-3'
ARP19 5'-AGCGGATAACAATTTCACACAGGATTTTGGCTCC-3'
ARP20 5'-AGCGGATAACAATTTCACACAGGATCGATACAGG-3'


MA); reactions were initiated at 420C for 5 min, went to 500C for 50 min, 700C for

15 min and then were held at 40C.

Subsequent PCR amplification reactions were done in triplicate for each

treatment group and each anchored and arbitrary primer pair combination. Using

2 [L of the appropriate RT reaction products (AP and zinc-treatment specific) for

template and 0.05 Units/pL Taq DNA polymerase (Roche, Indianapolis, IN) with

supplied buffer, PCR reactions had final concentrations of 0.2 [tmol/L for each AP

and ARP primers, 20 itmol/L each of the dNTPs and 0.125 tiCi/iL [a -33P]dATP.

Cycling parameters were: 950C for 2 min; 4 cycles of: 920C for 15 sec, 500C for

30 sec, and 720C for 2 min; 25 cycles of: 920C for 15 sec, 600C for 30 sec, and


720C for 2 min; 720C for 7 min; then reactions were held at 40C.









Denaturing Polyacrylamide Gel Electrophoresis

After addition of a denaturing loading dye (95% formamide) and a 2 min,

950C heat step, PCR products were then electrophoresed under two separate

conditions using a Genomyx LRTM DNA sequencing instrument (Beckman

Coulter, Fullerton, CA) under parameters optimized for differential display. In

order to resolve longer cDNAs, DD reaction products were run for 16 hr at

1,500V/100W/500C, through a 340 |tm thick, 4.5% acrylamide gel matrix

containing urea as the denaturant (Beckman Coulter, Fullerton CA). For

resolution of shorter cDNAs, a 6% gel matrix was used, and products were

electrophoresed at 2,700V/100W/500C for 2/ hr. Utilization of a 96-well sharks

toothcomb typically permitted the loading of 6-7 AP and ARP pair combinations

simultaneously. When runs were finished, the plates were separated.

Separation was facilitated by pretreatment of the bottom plate with 4N NaOH and

the top plate with a siliconizing glass shield (Beckman Coulter, Fullerton CA).

With the gel attached to the bottom plate, 3 cycles of rinsing and drying were

performed in order to remove the urea. After the final drying step, the DD gel

was exposed to single emulsion Kodak Biomax film (Fisher, Houston, TX) for

display visualization.

Identification, Excision and Re-amplification of Differential cDNAs

Differential expression between treatment groups was evaluated visually

on the autoradiograph. Criteria for defining a band zinc-modulated were

pronounced differences between treatment groups, consistency among triplicate

reactions and higher overall abundances. Excised bands were also ranked "#1"









or "#2" for prioritizing the order of re-amplification reactions. In this subjective

assessment, "#1" bands were those showing the largest magnitude of change

and highest cDNA expression. Chosen bands were excised from the gel by

aligning the autoradiograph with the gel, on top of a lightbox. The band's position

on the gel (marked with pencil from alignment with autoradiograph) was

circumscribed with a sterile scalpel. Less than 1 [L of sterile H20 was used to

rehydrate the circumscribed band, which was then excised and placed in 100 [L

of TE. Later studies added an additional 1X PCR buffer (10 mmol/L Tris-HCI, 1.5

mmol/L MgCI2, 50 mmol/L KCI) to the TE, in light of data from Frost and

Guggenheim (1999) demonstrating a benefit in preventing depurination and

therefore improving downstream re-amplification reactions.

Re-amplification and preparation of cDNAs for sequencing procedures

evolved over the course of these experiments. Initially, cDNAs were re-amplified,

sub-cloned into a pPCR-Script Amp SK(+) plasmid vector, transformed into

ultracompetent cells (Stragene, La Jolla, CA), grown on Luria Bertani broth

plates, and plasmid DNA then isolated for sequencing (Figure 3-1). This

sub-cloning was performed, in part, to generate a cDNA for labeling and

hybridization in Southern and northern confirmation analyses. In addition, the

possibility of multiple, different cDNAs migrating to the same place on the

differential display exists, and this can be effectively identified by sub-cloning and

Southern analyses. Figure 3-2 illustrates this phenomenon; a particular DD

band, 10,7,2, was sub-cloned, and eight plasmid subclones (labeled A-H) were

isolated and restriction digested. Subsequent Southern analysis using plasmid











Zn- ZnN Zn+
-* 1. Reamplification PCR
2. Selective precipitation
S Excise band 3. Polish
& elute
SLigate into plasmid vector



DD insert

Transform into bacteria pCRScript (Stratagene)
*


1. Choose clones (restreak)
2. Incubate 2X 4ml cultures
overnight



S Freezer stock




Isolate plasmids *Radiolabel whole plasmid for
(Qiagen plasmid prep) Northern/Southern blot analysis)



Confirmation of DD regulation
Determination of clone by Northern blot analysis
1. Restriction digests heterogeneity
2. Gel electrophoresis by Southern blot analysis
If confirmed(!)



SSequence




Figure 3-1 Original re-amplification, subcloning and isolation procedures for
putatively regulated ESTs. Those DD bands exhibiting zinc-modulation were
excised, elutriated and used as template for re-amplification PCR. After ligation
to a plasmid vector, ultracompetent cells were transformed and bacteria grown
on plates. Subclones were chosen for plasmid isolation and restriction digests.
Clone heterogeneity was determined by Southern blotting and zinc regulation
confirmed by northern blot analysis prior to sequencing.

clone 10,7,2A as the cDNA probe revealed that this cDNA only hybridized to

plasmid clones 10,7,2C and 10,7,2A, demonstrating that the other clones









(B, D-H) represent at a minimum, one other cDNA (Figure 3-2). These results

also dictate that several northern would be required to "fish" out the

zinc-modulated cDNA illustrated in the original display. The use of Q-PCR for

differential display confirmations however, precludes the need for a cDNA probe.

In this context, the throughput of directly sequencing PCR products became

advantageous, as most DD bands do represent a single species. Direct

sequencing of re-amplified cDNAs is facilitated by the use of universal, full-length

M13 (-48) 24-mer and T7 promoter 22-mer primers for re-amplification reactions.

Use of these primers [M13: 5'-AGCGGATAACAATTTCACACAGGA-3' and T7:

5'-GCCCTATAGTGAGTCGTATTAC-3'] streamlines the re-amplification process

as they also eliminate the need to use the specific AP and ARP combination that

generated the differential cDNA initially. In re-initiating the DD analyses with

availability of Q-PCR instrumentation, an alternate experimental protocol,

outlined in Figure 3-3, was used.

A B
AB DEF H ABCDFGH

-PCR-
Script

Hybridized with
10,7,2-A
10,7,2 reamp .
products




Figure 3-2. Example of subclone heterogeneity and Southern analysis. After
cloning DD band 10,7,2 eight bacterial colonies were chosen for plasmid
isolation. (A) Autoradiograph of EtBr stained restriction digests of colonies A-H
(B) Southern blot of restriction digest hybridized to radiolabeled cDNA 10,7,2-A
demonstrating homology of colonies A and C.









Pooled Thymus RNA
Zn- ZnN Zn+
S RT; AP3
PCR; AP3 + ARP1
PAGE




3,1,3

Excise






3,1,1 matches 3' UTR of cDNA for uncharacterized,
putative protein (Acc# XM_144450)

Figure 3-3. Revised experimental approach to differential display.
Re-amplification reactions were run with 2 [iL of gel band eluate (1/2X

template in a 40 [iL), 2X PCR buffer (Roche, Indianapolis, IN), 20 pM each

dNTPs, 0.2 upM each M13 and T7 primers and 0.05 U/pL Taq Polymerase

(Roche). Cycling parameters were 950C for 2 min; 4 cycles of: 920C for 15 sec,

500C for 30 sec, 720C for 2 min; 25 cycles of: 920U for 15 sec, 600C for 30 sec,

720C for 2 min; 72 OC for 7 min; and then reactions were held at 40C.

The optimization generally required for amplification of any one DNA

template by PCR was not practically possible for the number of DD bands

excised in these experiments. Our strategy then, involved an initial assessment

of template capacity for re-amplification, and the number of PCR products









produced by the re-amplification reaction. Robust reactions that produced a

single PCR product were pursued for sequencing. To assess quality of the

reactions, 2 pL of re-amplification products were electrophoresed in a 1.5%

agarose, 1X TBE gel, stained with SYBR Green I (Molecular Probes, Eugene

OR) and scanned on a Storm Imager (Molecular Dynamics, Piscataway, NJ).

For obtaining sufficiently concentrated PCR product for sequencing, reactions

were then repeated under identical conditions in nine 40 pl reactions (using DNA

in the original gel band eluate for template). Reaction products were purified

together (over the same column) using QIAquick PCR purification columns

(Qiagen, Valencia, CA), and eluted in 30 [L 10 mmol/L Tris-CI, pH 8.5. Then, 2

|iL of the purified cDNA was electrophoresed in a 1.5% agarose/1X TBE gel with

mass and base pair markers. After staining with EtBr and photographing to

establish purification and concentration, the DD cDNA was sent for sequencing

at the University of Florida's ICBR Sequencing Core.

Upon return of sequence information, the Genbank databases (Benson et

al. 2002) were queried using the BLAST algorithm of Altschul and others (1997),

running from the web-based, SeqWeb (version 2.02) platform for the Wisconsin

Package (Accelrys, San Diego, CA) software.

Independent Confirmation by Northern or Q-PCR Analyses

For northern blotting, total RNA (~15-20 [Lg), from either individual animals

or equally pooled treatment groups, was electrophoresed for 11A hr in a 1%

Agarose/1X MOPS/2.2 mol/L formaldehyde gel. After -30 min of rinsing in H20,

RNA was capillary transferred to nylon membrane (NEN, Boston, MA) overnight









using 10X SSPE (1.8 mol/L NaCI / 0.1 mol/L NaH2PO4 / 0.01 mol/L EDTA) as

transfer buffer. Transfer to membrane was confirmed by UV visualization of EtBr

stained ribosomal bands, and then RNA was UV crosslinked to membrane

(Hoefer Scientific Instruments, San Francisco, CA). For northern hybridization,

cDNAs (within pPCR-Script Amp SK(+) plasmid vector) were radiolabeled with

[a-32P]dCTP (NEN, Boston, MA) using DNA labeling beads (Amersham

Pharmacia Biotech, Piscataway, NJ). Membranes were pre-hybridized for 2 hr at

550C in 8 mL hybridization buffer [1% BSA / 0.5 M NaH2PO4, pH 7.2 / 1 mmol/L

EDTA / 7% SDS], to which probes were added to a final concentration of 2 X 106

cpm/mL. After ~18 hr hybridization at 550C, membranes were washed and

exposed to x-ray film. Scanned images were analyzed densitometrically using

Bioimage (Ann Arbor MI) Intelligent Quantifier software.

Real-time Q-PCR primers and fluorescent resonance energy transfer

(FRET) probes for select DD cDNA confirmations (Table 3-3) were designed

using Primer Express software version 2.0 (PE Applied Biosystems, Foster City,

CA), and synthesized by BioSource International (Camirillo, CA). Primers and

the TaqMan probe for 18S rRNA, used for total RNA normalization, were

purchased from PE Biosystems, as were all one-step RT-PCR reagents. Assays

were performed on a GeneAmp 5700 Sequence Detection System (PE Applied

Biosystems). Relative quantitation was determined from 4-5 log range standard

curves and pooled samples (n=7/treatment group) were run in triplicate. The 18S

TaqMan assay was performed using 50 nmol/L each forward primer, reverse









primer, and TaqMan probe; all other assays used 900 nmol/L each of the forward

and reverse primers, and 250 nmol/L of the FRET probe.

Table 3-3: Primers and FRET probes for Q-PCR
Gene Accession Primer/Probea
5'-GGGAGCCCAGGGATAAAGG-3'
TCCR NM_016671 5'-TGAGCCCAGTCCACCACATAC-3'
5'-CAATGGTTTCCTGGTCCCTTGTTTCCA-3'
5'-AATGGAGAAGCGTATGAGGATGA-3'
Hsp40 NM_008298 5'-ACTGGCCCATTAAGAGGTCTGA-3'
5'-CACCCCAGAGGTGGCGTTCA-3'
5'-TTGCCCTTATCAATGAACTGTGA-3'
Hsp60 X53584 5'-TCAGTCATTTTCTCCAGGTGACTTC-3'
5'-CTCAAGGCAGGTTCCTCACCAATAACTTCAG-3'
5'-GCTGCCGGGCATTCG-3'
Hsc70 BC006722 5'-CCTTAGACATGGTTGCTTGTGTGTAG-3'
5'-TGGTCTCGTCGTCAGCGCAGCT-3'
5'-GGCCTTGTGGGCATCGT-3'
H2-Aa BC0019721 5'-TCTGGAGGTGCCACCTGATC-3'
5'-TGGGCACCATCTTCATCATTCAAGGC-3'
aRespectively: forward, reverse, and TaqMan probe


Results


Feeding Studies

For these experiments, an additional zinc-supplemented (Zn+) group was

added. The mice in this group received approximately six times the quantity of

zinc in the ZnN purified diet. Underscoring the moderate nature of the threeweek

feeding protocol was the lack of significant differences in terminal body and

thymus weights between treatment groups (Table 3-4). Serum zinc levels in Zn-

animals were significantly depressed to 30% of ZnN animals (P < 0.0001), but

were unchanged in Zn+ mice. Similarly, Zn- animals had depressed, 66% of

normal thymic MT1 mRNA levels; however, Zn+ animals also showed no

changes in MT1 mRNA relative to the ZnN animals.









Table 3-4: Animal status indicators for zinc-deficient, zinc-normal and
zinc-supplemented mice

Dietary groupab
Variable Zn- ZnN Zn+

Serum, [lmol/L 5.0 0.30 16.1 0.4 15.1 0.7

Thymus MT1 mRNA, relative united 66.3 100 102.1

Terminal body weight, mg 33.7 1.3 37.8 0.8 36.2 1.1

Thymus weight, g/kg body 1.01 0.5 1.04 0.1 1.02 0.1

aMice were fed either <1 (Zn-), 30 (ZnN), or 180 (Zn+) mg Zn/kg diet for 3 wk
bValues are mean SEM, n= 5-10 animals
cDifferent from ZnN and Zn+ (P < 0.0001)
dDerived from Q-PCR on pooled samples; expressed relative to ZnN

Reproducibility of DD RT and PCR Reactions

Reaction products from AP3 and ARPs 2 and 3 were generated in two

separate months and subjected to denaturing PAGE. Profiles were markedly

similar in banding patterns (Figure 3-4), demonstrating gross reproduction of DD

RT and PCR reactions. Furthermore, when sequenced independently, five

differential bands: 2 from the "October gel", number's 3,3,1 and 3,3,2; and three

from the "November gel", hypothesized to be 3,3,1b, 3,3,2b, and a lower band

dubbed 3,3,3; were all identified as the same cDNA. Found overexpressed in

Zn+ animals relative to Zn- and ZnN counterparts by differential display (Figures

3-5, A-1 and A-2), this cDNA coded for mitochondrial NADH dehydrogenase

subunit 2 (NADH:ubiquinone oxidoreductase; mt-Nd2).

Differential Display

Eight of 12 possible dT12MN anchored primers, in combination with 20

arbitrary primers, were used to generate differential mRNA displays of thymic









ZZn Z + Zn--nNZt
t 1'


Zn- ZnN Zn+ B

_ -------.g
Nip -


LI-t-


-- h c'l


,w 64 -w i
IE1'



. or-

HEMY
.:4

--n wm"'L k


.

* k


AP3 X ARP2 AP3 X ARP
November 2001


Figure 3-4. Differential display RT and PCR reaction reproducibility. The same
pooled thymic total RNA from Zn-, ZnN and Zn+ animals was reverse transcribed
and amplified using AP3 and ARPs 2 and 3 (Beckman Coulter) and subjected to
4.5% denaturing PAGE for 16 hrs in two separate months: October (A) and
November (B) of 2001. Pointing to select, comparable transcripts are letters a
and a' through I and I'.

transcription in Zn-, ZnN and Zn+ mice. These 160 primer pair combinations

produced an approximate 32,000 interpretable bands, which were resolved over

~50 long-run denaturing polyacrylamide gels. Presuming an estimated 15,000


AP3 X ARP2 AP3 X ARP3
October 2001


Zn- ZnN Zn+


L I


ru. ~r~L~ik








transcribed genes in any one cell-type, and considering the statistical

requirements to represent each mRNA transcript by at least one cDNA on a gel

from a single primer pair (Bauer et al. 1993), conservatively this should represent

at least a 66% screen of the thymic transcriptome under these dietary conditions.

Of the ~32,000 bands surveyed, 153 bands appearing differentially

regulated by zinc treatment were excised for further investigation. This group

represented bands meeting our priority criteria of "#1" or "#2". Of these 153

cDNAs, 73 (almost 50%) appeared up-regulated in Zn- animals and another 40

(27%) were down-regulated by Zn- treatment, and the remaining 40 cDNAs were

modulated by Zn+ (15 increased and 25 decreased in Zn+ animals). Those

cDNAs, which had a #1 priority and that were successfully re-amplified,


3,3,1
3,3,2


3,3,1b
3,3,2b
3,3,3


Figure 3-5. AP3 and ARP3 differential displays generated on two separate
occasions. The same pooled thymic total RNA from Zn-, ZnN and Zn+ animals
was, in October (A) and November (B), reverse transcribed with AP3 and then
amplified using AP3 and ARP3 (Beckman Coulter). Reaction products were
electrophoresed in 4.5% polyacrylamide for 16 hr. Numbered bands appearing
up-regulated in Zn+ animals were excised and sequenced. All were homologues
of slightly different lengths coding for mitochondrial NADH dehydrogenase
subunit 2 (appendices B-4 and B-5). The designation of the bands 3,3,1b and
3,3,2b was done before sequencing and the "b" reflects prediction of identity.









sequenced and identified by BLAST, are listed in Tables 3-5 (increased by Zn-

treatment), 3-6 (decreased by Zn-) and 3-7 (decreased in Zn+ mice), with

corresponding data in appendices B, C and D respectively. Of the bands

sequenced thus far, only one, the aforementioned mitochondrial NADH

dehydrogenase subunit 2 (mt-Nd2), belongs in an "increased by Zn+" group. In

addition to those identified by homology to existing entries in the sequence

databases, four other band sequences were determined to be novel EST's, and

an additional four produced multiple genomic hits after database querying, but no

characterized genes. Two from this last group are presumed L1 repeat elements

and will be addressed further in the discussion section.

Table 3-5: Differential display transcripts increased in zinc-deficient mice
Band # of %
Name idb ntsc Identity Accessiond

T cell cytokine receptor** (TCCR) 2,17,1 373 99% NM_16671

T cell cytokine receptor** (TCCR) 2,17,2 359 99% NM_16671

Similar to dJ1189B24.4* 3,1,1 247 97% XM_144450

Apoptosis inhibitor 5* (Api5) 7,11,1 469 99% XM_123850
96% NM 007466

Mitochondrial 12S rRNA** 10,7,2G 349 100% NC_001569

Similar to hypothetical protein 9,7,1A 559 99% NM_145585
FLJ20274***

aAsterisks indicate whether transcripts were *untested, **confirmed, or ***did not
confirm DD prediction by alternate methodology
bDesignation of clone: AP, ARP, band cut and (if letter) a subclone
CSequence, identities and DD images are presented in appendix B
dVWhen possible RefSeq (non-redundant curated data, Pruitt and Maglott 2001)
accessions are used; here NM_ designates curated mRNAs, XM_ designates
model mRNAs corresponding to genomic contigs, NC_ designates
chromosomes/complete genomes









Table 3-6: Differential display transcripts decreased in zinc-deficient mice
Band # of %
Name idb nts0 Identity Accessiond


Heat shock cognate protein 70**
(Hsc70)

Heat shock cognate protein 70**
(Hsc70)

Hematopoietic stem cell
(Lin-/c-Kit-/Sca-1-) cDNA*
(dbEST)e

Retrotransposon L1Md-A101
pORF2* and
L1Md-A2 repetitive element ORF2*

DnaJ homolog, subfamily A-1**
(heat shock protein 40)

Histocompatibility 2, class II
antigen A, alpha** (H2-Aa)

Heat shock protein 60 kDa**
(Hsp60)


2,4,2


2,4,3


718


756


2,14,1 291



3,1,4 500


3,2,4


9,6,1


477


729


10,7,2D 392


100% BC006722


99% BC006722


100%
100%
100%


BM244188
BM244095
BM243664


98% AY053456

98% M13002

99% NM_008298


97% BC019721


99% XM 109908


aAsterisks indicate whether transcripts were *untested, **confirmed, or ***did not
confirm DD prediction by alternate methodology
bDesignation of clone: AP, ARP, band cut and (if letter) a subclone
CSequence, identities and DD images are presented in appendix C
dVWhen possible RefSeq (non-redundant curated data, Pruitt and Maglott 2001)
accessions are used; here NM_ designates curated mRNAs; all others are
archival accessions, which can not be changed by 3rd party, but eventually will
be curated
eMatches from Genbank EST database (rather than non-redundant database)

Confirmation of Select DD Clones

Initial confirmations of DD data were done using pooled RNA samples for

northern blotting with the radiolabeled DD clone/EST/cDNA of interest, then









Table 3-7: Differential display transcripts decreased in zinc-supplemented mice


Name"


Similar to matrin cyclophilin*
(matrin-cyp)

Ribosomal protein L28*** (Rpl28)

Hypothetical gene supported by
accession BC010584* and
M similar to putative protein kinase*

Ribosomal protein L3* (Rpl3)

Axonemal dynein heavy chain 8
short form** (Dnahc8)

Cleavage & polyadenylation factor 5,
25kDa subunit* (Cpsf5)

H3 histone, family 3A* (H3f3a)


Band
idb

2,8,1


# of
nts0


Identity
Identity


Accessiond


96 90% XM 130275


3,8,2C 320 99% NM_009081


3,7,1


585 99% XM 129835


99% XM_110350


3,7,2


156 100% NM_013762


7,6,2G 316 99% AF356521


7,13,1


770 99% NM_026623


7,20,1 785 98% XM_147791


aAsterisks indicate whether transcripts were *untested, **confirmed, or did not
confirm DD prediction by alternate methodology
bDesignation of clone: AP, ARP, band cut and (if letter) a subclone
CSequence, identities and DD images are presented in appendix D
dVWhen possible RefSeq (non-redundant curated data; Pruitt and Maglott 2001)
accessions are used; here NM_ designates curated mRNAs, XM_ designates
model mRNAs corresponding to genomic contigs, others are archival
accessions that cannot be changed by 3rd party, but eventually will be
curated

sequencing the DD clones that confirmed zinc-regulation. Then northern blots

with RNA from individual animals (n=5-6/treatment group) were examined for

expression variation among groups (Figure 3-6). In order to interpret results the

technical limitations of northern hybridization must be noted. Extensive sample

manipulation, lengthy hybridization times and the limitations of detection

sensitivity all work to provide data that are sometimes inconclusive, or at best,









semi-quantitative. In examining the expression of three DD clones (3,8,2C;

9,7,1A; 10,7,2D) and MT in individual Zn-, ZnN and Zn+ animals by northern

blotting (Figures 3-6 and 3-7) high variation associated with this technique is

apparent. Conclusions were that 3,8,2C (Ribosomal protein L28, Rpl28; Figure

D-2) and 9,7,1A (similar to hypothetical protein FLJ20274; Figure B-5) were not

zinc-regulated. However, 10,7,2D (heat shock protein 60, Hsp60; Figure C-6)

was found significantly decreased in zinc-deficient animals and with a magnitude

of change comparable to MT.

A closer inspection of the data is illustrative. The DD band 9,7,1 appeared

markedly increased in Zn- animals on the DD (Figures 3-4, B-5), but the pooled

and individual northern blots to DD clone 9,7,1A did not mirror this; a further

example of the clone heterogeneity illustrated in Figure 3-2. The

autoradiographs of 9,7,1A expression are excellent examples of northern blots

that required lengthy exposure times, due to lower message abundance, in

contrast to 3,8,2C expression, which was readily detected and easily analyzed

(Figure 3-7). In the case of DD band 3,8,2, both the pooled and individual

northern showed decreased 3,82C/Rpl28 expression in Zn+ animals, in

agreement with the DD (Figures 3-7, D-2). Statistically (P=0.11) 3,8,2C was not

confirmed as zinc-regulated, however looking at the autoradiographs for the

northern blots it is apparent that the 18S hybridization contributed to the deviation

of the ZnN mean. The Hsp60 and MT levels in Zn- animals were significantly

different from ZnN and Zn+ animals (P < 0.05). Yet, due to a low number of

animals per treatment and high deviation this "statistical" significance was







69





A1.8 B1.8
1.6 3,8,2C / Rp128 1.6 9,7,1A
1.4 1.4
Z 1.2 1.2
S 1.0 1.0
CO 0.8 0.8
0.6 0.6
z
0.4 0.4
0.2 0.2
S 0 0
SZn- ZnN Zn+ Zn- ZnN Zn+
SC D
S 1.8 1.8
6 10,7,2D Hsp60 1.6 MT
1.4 1.4
d 1.2 1.2
> 1.0 1.0
S0.8 0.8
0.6 0.6
0.4 0.4
0.2 0.2
0 0
Zn- ZnN Zn+ Zn- ZnN Zn+



Figure 3-6. Relative densitometric analyses of northern blots for select DD clones
and MT. (A) 3,8,2C / Rpl28 (B) 9,7,1A (C) 10,7,2D / Hsp60 and (D) MT.
Northern blots with total thymic RNA from individual (n=5-6) Zn-, ZnN, Zn+ mice
were hybridized with DD clones, then stripped and rehybridized with a cDNA
probe for 18S rRNA, the normalization control. Relative units are mean + SD
and are calibrated to ZnN = 1. For Hsp60 (C) and MT (D) Zn- animals are
different from ZnN and Zn+ (P < 0.05) using Kruskal-Wallis nonparametiric
ANOVA with Dunn's multiple comparisons of median.

only achieved using either data transformation or a Kruskal-Wallis test, which

tests nonparametric medians. The variation, limits of message detection,

particularly in the thymus, and the mediocre throughput of northern blotting












Zn- PF ZnN Zn+
3,8,2

3,8,2C

18S


3,8,2C


18S


9,7,10

9,7,1A


18S


9,7,1A -


Zn- ZnN Zn+


Zn- ZnN Zn+


18S Q "


-~ -.m ~ .l -.


Figure 3-7: Comparison of DD and northern analyses. Compared were DD
bands 3,8,2 (A) and 9,7,1 (B). For each band, the DD is marked by arrow, below
which are northern blots from pooled samples (n=5-7/treatment group) hybridized
to DD clones then 18S. Below the pooled northern blots are blots run with RNA
from individual animals within each treatment group. Graphs in upper right
corners are densitometry (mean + SD) of individual northern blots for clones
normalized to 18S. Results are not statistically significant although 3,8,2C, found
decreased in Zn+ animals by DD and both northern blots, had a P = 0.11.


Zn- ZnN Zn+



SomemeW V


Zn- ZnN Zn+
--,- r 4IYIIyUi1


-


low--












1 Zn-
S*ZnN
S1.5
C O Zn+

a 1.0


0.5

01
MT H40 H60 H70 H2Aa TCCR

Figure 3-8: Q-PCR analyses of select DD clones and MT. Assays were
performed on triplicate pooled total RNA samples (n=7/group) from Zn-, ZnN and
Zn+ mice. Relative quantity calculations used 18S rRNA as the endogenous
normalization control. Values are mean of three pooled assays calibrated to
ZnN.

(weeks) prompted a switch to Q-PCR (days) for secondary expression analyses,

with its availability.

Five identified DD bands were chosen based on function for follow-up

confirmation using Q-PCR (Figure 3-8): heat shock protein 40 (H40; Figure C-4);

heat shock protein 60 (H60; Figure C-6); heat shock cognate 70 (H70; Figure

C-1); histocompatibility 2, class II antigen A, alpha (H2Aa; Figure C-5), and the

T-cell cytokine receptor (TCCR; Figure B-1). In all cases, the zinc-modulation

observed on the differential displays was replicated. Interestingly, for all three

heat shock proteins, depression of expression was seen in both Zn- and Zn+

animals (Figure 3-5), although the depression seen in Zn+ was not to the extent

observed in the Zn- animals.









Discussion

This research presents a snapshot of differential gene expression

produced in the thymus in response to alterations in dietary amounts of the trace

element zinc. Thymic gene expression in response to zinc-restriction (Zn-) was

clearly of interest because of the well-described immunodeficiency that follows

severe dietary zinc deficiency. The decision to examine the thymic gene

expression response to a three week dietary zinc-supplementation is perhaps

less obvious. In part, this choice was dictated by feasibility as differential display

does accommodate multiple treatment groups. Additionally, as the perspective

on nutritional requirements moves from goals of identifying the minimal levels of

nutrients required to prevent deficiency syndromes, to goals of describing optimal

nutrient requirements for chronic disease prevention, it has become important to

have data on physiologic responses to a range of intake levels for dietary

nutrients. This is underscored by the tolerable upper level (UL) value for a safe

intake now contained within the Institute of Medicine's dietary reference intakes

(Panel on Micronutrients et al. 2002). Furthermore, in the case of zinc, the

widespread use of zinc lozenges and zinc-supplemented functional foods

marketed for immune enhancing properties, warrants scientific scrutiny on the

outcomes of zinc-supplementation.

The objective was to identify gene transcripts modulated after three weeks

of either dietary zinc restriction or supplementation. This three week time period

arose from earlier studies, which established that three weeks of feeding a

zinc-deficient diet to six-week old, male CD1 mice produced a moderate level of









deficiency, but one that would nonetheless produce alterations in thymic gene

expression (Moore et al. 2001).

It is relevant to note that the choice of a DD approach to identify

zinc-modulated gene expression in murine thymus was made temporally at the

beginning of the genomic revolution. Array analysis had recently been described

(Schena et al. 1995, Shalon et al. 1996); however, the sequencing races had yet

to heat up and databases were more limited. Remarkably, the advantages to

differential display articulated in 1997 still exist. It is recognized that transcription

analyses are slanted in favor of constitutively expressed, stable, higher

abundance messages (Gmuender 2002, Matz and Lukyanov 1998). While also

true to some extent for DD, use of all 12 APs in combination with all 20 ARPs

statistically confers greater probability that all mRNAs (expressed in that

condition/time/cell type), should be represented at least once after amplification

to a level of detection by PCR (Bauer et al. 1993).

Additionally, DD does not require the a priori sequence information On

which arrays are dependent. This means DD has the capacity to find novel EST

data, both contributing to the sequence databases and holding the potential for

gene discovery. Sequencing initiatives for the mouse and human genome are

well along the way towards meeting initial objectives (Marshall 2001) and, in the

process, are providing substantial informatic resources for array design.

However, the availability of arrays for researchers working with organisms other

than the top priority model systems is limited and so for them and others, DD









remains a powerful tool for both sequence acquisition and assessing differential

gene expression in a variety of fields (Liang 2002).

Criticized as technically laborious and artifact prone, a decade of DD

optimization and commercial applications has reduced these concerns (Buess et

al. 1997, Matz and Lukyanov 1998, Sung and Denman 1997). For example, the

use of APs and ARPs tagged with universal sequences streamlines

re-amplification procedures, reducing the workload associated with subcloning

for sequencing. The availability of optimized RT and DD reaction parameters

and PAGE conditions (Hieroglyph kits, Beckman Coulter) are improvements that

contributed to the choice of DD application for this study. This decision was

validated with the demonstration of DD, RT and PCR reaction reproducibly, to

the extent of producing an identifiable, regulated cDNA of a particular length at

two different times (Figures 3-4, 3-5).

The genes identified as zinc-modulated are a small subset of the total

observed on, and excised from, the DDs originating from reverse transcribed and

amplified Zn-, ZnN and Zn+ total thymic RNA. The 153 excised bands observed

by DD as altered by animal dietary zinc status, represent a very small percentage

of total surveyed transcripts (~32,000 interpretable bands) illustrating the modest

nature of the dietary treatments utilized in these studies. The majority of bands

excised (~75%) were influenced by zinc-deficiency, 73 found up-regulated and

40 found down-regulated in the Zn- animals relative to the ZnN animals.

Among the 73 bands demonstrating increased message abundance in Zn-

were the five sequenced and identified in this report (Table 3-5). Included were









cDNAs for the T-cell cytokine receptor (TCCR), an apoptosis inhibitor (Api5),

mitochondrial 12S rRNA and messages for "hypothetical" proteins. The latter is a

term the National Center for Biotechnology Information (NCBI) uses to define a

gene supported by genomic sequence data rather than experimental or

functional data. The dataset of five genes with increased message abundance in

the Zn- mice (Table 3-5) serves as a good example of how follow-up

experimental decisions were made. Practicality dictated that functionally

uncharacterized cDNAs, such as bands 3,1,1 and 7,11,1, the hypothetical

proteins, were not pursued. The identification of mitochondrial 12S rRNA, while

at first alarming, was explained both in the use of total RNA, rather than polyA+

RNA, for DD, RT and PCR reaction templates and the long tract of polyAs within

the 12S rRNA gene upon which AP annealing for amplification occurred.

Although this amplification was unintentional, nonetheless its zinc-modulation

was confirmed independently. Furthermore, 12S rRNA was one of two

mitochondrial transcripts identified as altered by zinc status in this study. The

other transcript, mitochondrial NADH dehydrogenase subunit 2 (mt-ND2)

increased in Zn+ animals (Figure 3-5). As a side note, this increase in mt-ND2 is

interesting in conjunction with recent data finding that neuronal death in response

to excess zinc induced a loss of NAD and energy failure (Sheline et al. 2000).

On the other hand, TCCR, when identified as a putatively zinc-modulated

transcript, immediately became a candidate for Q-PCR assay design and

confirmation analyses. Independently cloned by separate industrial groups, both

research groups demonstrated highest TCCR expression in the thymus and









peripheral blood lymphocytes among tissues examined (Chen et al. 2000,

Sprecher et al. 1998). There is relatively little known about this "orphan" cytokine

receptor belonging to the class I family of receptors. This family includes

receptors for the interleukins and poeitic growth factors such as thrombopoietin,

erythropoietin and leptin, and is defined by a common, conserved, extracellular

cytokine binding domain (Sprecher et al. 1998). Existing data from TCCR

knockout mice imply this receptor is essential for development of Thl immune

responses in vivo (Chen et al. 2000, Yoshida et al. 2001). These data

precipitated our interest, given research suggesting an aberrant Thl/Th2 balance

in zinc deficiency (Beck et al. 1997a, 1997b, Prasad 1991). Differentiation of

naive CD4+ T-lymphocytes into armed effector Thl or Th2 cells occurs in the

periphery, so the function of TCCR in the thymus is currently unknown. LCK

serves as an example of a T-lymphocyte specific protein with functions, directing

differentiation and activation, in both the thymus and periphery. The LCK protein

was found up-regulated in both the periphery and thymus by zinc deficiency in

mice (Lepage et al. 1999, Moore et al. 2001). Future research should

characterize the function of TCCR in the thymus and clarify the zinc interaction

noted in this study. Lastly, within the "increased in zinc deficiency" dataset, the

Api5 up-regulation observed on the DD awaits confirmation. Its identification is

interesting in light of previous data (Fraker et al. 2000, Kolenko et al. 2001,

Shankar and Prasad 1998), suggesting links between zinc and apoptosis, and

zinc-deficiency and lymphopenia.









Most striking among the thymic transcripts identified sensitive to dietary

zinc status were three separate heat shock proteins, Hsp40, Hsp60 and Hsc70,

all down-regulated in the Zn- animals (Table 3-6). Using different AP and ARP

combinations, Hsp60 was identified first and initially confirmed by northern

blotting (Figure 3-6), then Hsp40 and Hsc70 were identified as also

down-regulated in the Zn- animals. Q-PCR assays were devised for all three

heat shock proteins. Consequently, Hsp60 serves, next to MT our sentinel gene,

as a gene whose zinc-regulation has been re-tested by multiple techniques in

animals from multiple diet studies. Results confirmed the DD-observed

decreases in Zn- animals, and also revealed decreased, albeit less pronounced,

message abundance in Zn+ animals that had not been observed on the

semiquantitative DD (Figure 3-8).

Heat shock proteins were initially named for their cellular induction by high

temperature and other stress-induced protein denaturing conditions. More

recently, the homeostatic function of these cellular proteins is identified as the

chaperoning of nascent polypeptides, through de novo folding, into accurate

native conformations (reviewed by Frydman 2001). It is now appreciated that

initial biochemical kinetic studies of protein folding done in vitro are not relevant

in the macromolecular crowding of the eukaryote cell (Minton 2001). In this vein,

protein assembly in vivo has more recently been described as co-translational

folding, with molecular chaperones/heat shock proteins functioning in 'assisted

self-assembly' (Ellis and Hartl 1999). In other words, the protein contains all

information within its primary sequence for assumption of its native tertiary









structure, but it is the chaperones that protect nascent vectorial peptides, either

coming off the ribosome or translocating across organellellar membranes, from

forming improper intermediate structures driven by hydrophobic or other

interactions (Ellis and Hartl 1999, Frydman 2001).

From a physiological perspective, it is particularly interesting to note which

heat shock proteins were found down-regulated in these experiments by both

dietary zinc treatments (Hsc70, Hsp40 and Hsp60), especially in the context of

the characterized functions for these different chaperone families. Briefly, the

Hsc70 protein is a constitutively expressed, rather than a heat-inducible, member

of the Hsp70 family, and is one of the most abundant soluble proteins in the

mammalian cell (Petersen et al. 2001). A small (70 kDA) ATPase, Hsc70 binds

hydrophobic segments on nascent polypeptide chains in an ATP-dependent

fashion (Bukau and Horwich 1998). Studies done in Escherichia coli have shown

that Hsp40 serves as a co-factor in the Hsc70-substrate interaction by increasing

ATP hydrolysis from Hsc70 (Ellis and Hartl 1999). Hsp40 is a chaperone in its

own right by virtue of its C-terminal substrate-binding domain, which interestingly

contains two essential, cysteine-rich zinc-binding domains (Frydman 2001).

Lastly, in contrast to the cellular Hsc70/Hsp40 systems, which

co-translationally protect hydrophobic regions of nascent polypeptides in the

cytoplasm, Hsp60, a member of the large (>800 kDa) barrel-shaped chaperonin

family, functions within the mitochondrial matrix (reviewed in Hartl and Neupert

1990). Chaperonins are remarkable cellular machines that orchestrate

oligomeric assembly of proteins in an ATP-dependent manner. This appears to









occur through chaperonin's conformation changes, which expose its alternate

hydrophobic and hydrophilic interior surfaces as the protein substrate is

encouraged to form its native structure (Bukau and Horwich 1998). In the

mitochondria, Hsp60 functions to mediate translocation, folding and assembly of

the multiple (>700) polypeptides that are coded in the nuclear genome but that

function in the mitochondria. These peptides/proteins function, possibly as part

of large multimeric complexes, in the mitochondria, and as such must be

imported and exported (Hartl and Neupert 1990). Other chaperonins, TCP-1 and

CCT function in the cytosol, but within this research these, along with the

members of the Hsp90 family who chaperone the steroid hormone receptors and

protein kinases, have not been identified as zinc-modulated.

Also confirmed by Q-PCR as decreased in zinc-deficient mice (Table 3-6,

Figures 3-5 and C-5), DD band 9,6,1 codes for a subunit of the mouse major

histocompatibility complex (MHC) class II receptor, termed histocompatibility 2,

class II antigen A, alpha (H2-Aa). The H2-Aa peptide is one of three (antigens

A, E and M) possible a subunits for the MHC class II molecules in mice, and is

encoded within the H-2 gene structure located on chromosome 17. MHC

molecules require both and a and P subunits for cell surface expression and in

the thymus, interactions between MHC receptors and the TCR/co-receptors of

developing thymocytes mediate positive and negative selection processes

(Janeway et al. 2002). MHC class I molecules present to CD8+ T-cells and MHC

class II molecules present to the CD4+ T-cells. The development of MHC class II

knockout mice, which produce no CD4+ T-cells showed in vivo that CD4+ T-cell









development is dependent on thymic MHC class II expression (Cosgrove et al.

1991, Grusby et al. 1991). The H2-Aa mRNA was found by DD and confirmed

by Q-PCR as down-regulated in Zn- mice. Although premature it is tantalizing to

speculate about a potential mechanism involving H2-Aa that might contribute to

either, the lymphopenia of zinc deficiency, or the pathogen-specific increased

susceptibility to infectious disease seen secondary to a zinc deficiency. Beyond

speculation, it can be noted from the data that, while all heat shock proteins were

found by Q-PCR depressed in both Zn- and Zn+ animals, H2-Aa was depressed

in Zn- but elevated in Zn+ animals.

Within the transcripts decreased in Zn- mice (Table 3-6) were a couple

that were not followed by post hoc confirmation testing, DD band 2,14,1, a

functionally uncharacterized cDNA, and DD band 3,1,4, which generated multiple

genomic hits. Among the listed homologies to the 3,1,4 BLAST query were

matches to a section of open reading frame (ORF2) found within A-type, long

interspersed nuclear elements (LINE-1 or L1). The L1 repeat elements are

retrotransposable elements that lack the long terminal repeat sequences

characteristic of retroviruses and retrotransposons (Furano 2000). Ranging

between 5000-7000 base pairs, L1 repeats move by reverse transcription. There

is an estimated 100,000 L1 repeats and an enormous amount of L1 fragments

littered throughout the mouse genome (Hardies et al. 2000). Subtypes of L1

repeats are defined by unique 5' ends, the A, F and V types, which are believed

to have amplified in separate evolutionary waves. Of these, the F and V types

are thought to be ancestral and extinct and the A subtype was thought to be the









youngest until recent descriptions of a hybrid TF subtype which is currently

actively expressing and retrotransposing (Hardies et al. 2000, Saxton and Martin

1998).

The sequence data for DD band 3,1,4 (Figure C-3) shows the region of L1

ORF2 amplified by the AP and ARP primers, but unfortunately tells little else, as

this region is highly homologous between L1 subtypes. For this reason,

confirmation of zinc-modulation for 3,1,4 was not attempted. However, an earlier

DD band 10,8,1A, which was found up-regulated in Zn+ by northern blot, when

sequenced and BLAST queried, also returned multiple genomic hits among

which were identities to L1 repeat elements (data not shown). Furthermore,

Muga and Grider (1999) using DD reported expression of a human LINE1 in

acrodermatitis enteropathica autosomall recessive, congenital zinc deficiency]

fibroblasts. These data currently seem disparate, 3,1,4/L1 decreased in Zn-,

10,8,1B/L1 increased in Zn+, and a human LINE1 increased in Zn-. However,

future studies may reveal cause and effect.

Other identified transcripts decreased in Zn+ mice (Table 3-7) together

suggest alterations in mRNA processing. Included are: an mRNA cleavage and

polyadenylation factor; a H3 histone; and matrin cyclophin, an RNA splicing

factor and chaperone located in the nuclear matrix. Additionally, decreased in

Zn+ were transcripts for two ribosomal proteins, Rpl28, which is relatively

uncharacterized and Rpl3, which is essential for peptidlytransferase activity

(Hampl et al. 1981, Noller 1993).









In conclusion, these DD data and associated confirmation analyses

revealed multiple mRNA transcripts altered by dietary zinc status in adult murine

thymus after only three weeks feeding. Although datasets are not complete,

some generalities may be noted. Remarkably, no metalloenzymes or zinc-finger

transcription factors were identified zinc-modulated in this study. Genes

identified appear to be "housekeeping" in nature, involved in mRNA processing

and translation. Chaperones for RNA, nascent peptides and mitochondrial

proteins were identified as cDNAs changed with dietary zinc status. As were

cDNAs for an H3 histone, a polyadenylation and cleavage factor, ribosomal RNA,

ribosomal proteins and an apoptosis inhibitor. Specific immune function related

genes showing zinc-sensitive expression were a subunit of the MHC class II

molecule, H2-Aa, and the T-cell cytokine receptor. These genes with altered

thymic expression after only three weeks of altered zinc status may hold potential

as sensitive biomarkers of human zinc status.















CHAPTER 4
SUMMARY, SPECULATIONS AND FUTURE DIRECTIONS

The primary aims of this research were to characterize a murine model of

moderate zinc deficiency, and to identify genes differentially expressed in the

thymus of zinc-deficient (Zn-) mice relative to animals fed adequate zinc (ZnN).

Secondary goals were to also screen for differentially expressed genes in

animals fed a moderately zinc-supplemented (Zn+) diet, and to confirm

independently a select group of genes demonstrating zinc-modulation.

As this project evolved, opportunities arose to utilize several technical

approaches. For expression profiling, both cDNA array analysis and differential

display (DD) were used. Secondary confirmations used northern hybridization

and Q-PCR for mRNA measurements, and western analysis was utilized for

measuring protein abundances. The duplication of results within individual

techniques, and comparisons of data derived from multiple methodologies,

showed good reproducibility in identifying zinc-induced molecular changes within

the thymus.

Three weeks feeding either zinc-deficient or zinc-supplemented diets to

young adult male mice were sufficient to alter specific RNA abundances in the

thymus. Decreased in the Zn+ animals were multiple genes that seemingly have

roles related to mRNA processing and translation. Gene transcripts decreased









included two ribosomal proteins, Rpl28 and Rpl3, the later essential for peptidyl

transferase function. Furthermore, cyclophilin, an RNA splicing factor and

molecular chaperone located in the nuclear membrane, a H3 histone and a

mRNA cleavage and polyadenylation factor were all decreased in the Zn+

animals. Mitochondrial NADH dehydrogenase, part of the ubiquinone oxidase

complex I within the respiratory chain, and a putative L1 repeat element were the

only gene transcripts increased by zinc supplementation identified here.

Of the 11 identified genes modulated in Zn- animals, six had increased

and five had decreased message abundances in the thymus. Observed together

they represent an emerging molecular view of the thymic response to zinc

limitation (Figure 4-1). Three heat shock proteins required for nascent peptide

chaperoning and organellar translocation were identified with decreased mRNA

abundances. In addition, mRNA abundances for the MCL protein and the H2-Aa

peptide chain of the MHC class II receptor were decreased in the Zn- animals.

Identified as up-regulated in Zn- animals were two cell surface receptors, the

T-cell cytokine receptor and murine lamina receptor, an apoptosis inhibitory

factor, a DNA repair protein and the critical lymphocyte signal transduction

protein, LCK.

Zinc deficiency is marked by lymphopenia that results from reduced

replenishment of peripheral T-lymphocytes with mature, naive T-cells exiting the

thymus. The LCK up-regulation in Zn- animals found through array analysis

implied a potential mechanism for this loss of T-cells. This tyrosine kinase

mediates signal transduction from the CD4 and CD8a co-receptors in a manner









Thymic Epithelial Cell


LCK 1


TCCR 1


MLR T


ribosomal machinery &
nascent peptide chain


S-. AAAAAAAA Api5 t
"" MCL
nucleus RAD23B t


Figure 4-1: Pictorial view of gene transcripts altered in murine thymus in
response to three weeks of dietary zinc deficiency. Arrows after gene name
designate direction of mRNA change in Zn- relative to ZnN mice. Messages
changed were: LCK, lymphocyte-specific tyrosine kinase; H2-Aa,
histocompatibility class II, antigen Aa; TCCR, T-cell cytokine receptor; MLR,
mouse lamina receptor; MCL, myeloid cell leukemia sequence; Api5, apoptosis
and inhibitory factor 5; RAD23B, DNA repair and recombination protein; Hsp40,
heat shock protein 40, Hsc 70, heat shock cognate 70; Hsp60, heat shock
protein 60; and mitochondrial 12S rRNA.

that is dependent on zinc (Huse et al. 1998, Lin et al. 1998). Decreased zinc

availability for this interaction limits signaling from the CD4 or CD8a receptors,

which our data suggests, might signal the nucleus to increase transcription of

LCK in a compensatory manner. Positive and negative selection processes in

the thymus are completely dependent on signaling through the CD4 and CD8

receptors. LCK knockout mice have illustrated that loss of LCK function results in









almost no mature single-positive naive T-cells exiting the thymus to the periphery

(Molina et al. 1992).

The DD finding of decreased H2-Aa expression in Zn- animals fits into a

picture of a potential feedback loop. MHC class II molecules are expressed by

thymic epithelial cells and present self-antigens to the TCR and CD4 co-receptor

on developing thymocytes. This MHC:TCR interaction mediates positive and

negative selection processes and lineage decisions demonstrated by a lack of

CD4+ T-cells in MHC class II deficient mice (Grusby et al. 1991, Cosgrove et al.

1991). It may be that thymic epithelial cells are most sensitive to zinc restriction,

and the increase in LCK expression could stem from reduced extracellular

signals from the H2-Aa molecules. Identifying H2-Aa decreased expression in

the thymic stroma of Zn- animals validated an early experimental protocol

decision to use total RNA extracted from whole thymus rather than RNA from

isolated thymocytes.

The zinc-modulated genes identified here are a small subset of the total

considered altered in these studies. Inferences from the data must be made with

the caveat that a complete dataset will paint a more detailed picture, and one that

may support or contradict hypotheses derived from these data. However the

molecular details gained from this research thus far, not only fit well together but

also reconcile with previous clinical and cellular data regarding biochemical

aspects of zinc function.

Options for future studies are numerous. Zinc research has pursued an

optimal biomarker of zinc status for years (Wood 2000). Although this study









examined genes differentially expressed in the thymus, LCK stands as evidence

that some of the identified zinc-sensitive transcripts may be modulated in

peripheral T-lymphocytes. One possibility, inspired by experiments within the

breast cancer field (Martin et al. 2001), would be to create cDNA arrays from the

zinc-sensitive genes identified by the primary DD screen and pursue highly

zinc-responsive genes in peripheral blood lymphocytes with the arrays.

As mentioned before, the priorities of nutrition research are changing and

currently there is a greater appreciation of the importance of adequate

micronutrient nutrition for preventing initial DNA damage that in the long term

contribute to cancer initiation (Ames 2001, Fenech 2002). This idea is supported

by the finding reported here of RAD23B, a DNA damage and repair protein,

up-regulations after a three week zinc deficiency.

The importance of zinc status for adequate immune function is

well-established (Fraker et al. 2000). Severe zinc deficiency is a continuing

problem in the third world (Bhutta et al. 2000), and marginal zinc status exists in

high-risk populations in America (Briefel et al. 2000). The research reported here

identifies multiple thymic mRNA transcripts altered after a moderate zinc

deficiency in adult animals. In addition to adding to our knowledge and

understanding of the molecular roles and functions of zinc in the thymus, it is

hoped these experiments may contribute to the establishment of practical highly

sensitive biomarkers of zinc status in humans.