<%BANNER%>

Transgenic arabidopsis ADH/GFP reporter gene produced for studying space biology telemetrically

University of Florida Institutional Repository

PAGE 1

TRANSGENIC ARABIDOPSIS ADH/GFP REPORTER GENE PRODUCED FOR STUDYING SPACE BIOLOGY TELEMETRICALLY By MICHAEL S. MANAK A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS F OR THE DEGREE OF MASTER OF SCIENCE UNIVERSITY OF FLORIDA 2001

PAGE 2

Copyright 2001 by Michael Scott Manak

PAGE 3

This thesis is dedicated to all teachers of the past, present, and future who give a little piece of their heart to all whom they teach.

PAGE 4

iv ACKNOWLEDGMENTS I would like to take this opportunity to thank my fiance Jenn Conklin for her unending support and inspiration that is beyond words. I thank all my friends for believing in me. I am also thankful to all my family for their help and guid ance. I thank Dr. Steve Sargent for helping me get started in Horticultural research. I also thank Dr. Kenneth B. Wagener for the opportunity to work in a state of the art research laboratory where I gained invaluable experience. I thank my fellow graduate lab mates Dr. Carla Linebarger, Justin DeLille, and Matt Reyes for all their support both professionally and personally. I thank my senior lab mates Dr. Paul Shenke for teaching me an enormous amount about molecular biology, Beth Laughner for advising and taking care of the lab and all the lab members, Dr. Anna Lisa Paul for teaching me something new on a continuous basis, as well as for being on my committee. I also want to thank Dr. Bill Gurley for being on my committee and teaching me how to extract mea ning from experimental results. I thank all the PMCB professors for their hard work. Without their efforts and determination, the building where I conducted research would not exist. I thank Dr. Robert Ferl for giving me the opportunity to work in his lab. It was a privilege and a pleasure. Rob is an excellent mentor because he gives you the opportunity to grow and make as much out of your graduate experience as possible while guiding you with insightful wisdom.

PAGE 5

v TABLE OF CONTENTS Page ACKNOWLEDGMENTS ................................ ................................ ................................ .. iv ABSTRACT ................................ ................................ ................................ ....................... v ii CHAPTER 1 INTRODUCTORY REVIEW OF REPORTER GENES ................................ ................ 1 Introduction ................................ ................................ ................................ ..................... 1 Reporter Gene Review ................................ ................................ ................................ .... 3 Role of Agrobacterium ................................ ................................ ................................ 4 Neomycin Phosphotransferase, Chloramphenicol Acetyltransferase, and Octopine Synthase ................................ ................................ ................................ ...................... 5 b Galactosidase ................................ ................................ ................................ ........... 5 Luciferase ................................ ................................ ................................ .................... 6 b Glucuronidase ................................ ................................ ................................ .......... 6 Green Fluorescent Protein ................................ ................................ ........................... 7 Conclusion ................................ ................................ ................................ ...................... 8 2 STUDY OF ARABIDOPSIS PHYSIOLOGY USING AN ADH/GFP BIOSENSOR TO COLLECT DATA VIA TELEMETRIC SIMULATION ................................ ........ 10 Intro duction ................................ ................................ ................................ ................... 10 Results ................................ ................................ ................................ ........................... 12 Experimental Controls ................................ ................................ .............................. 12 Flooding ................................ ................................ ................................ .................... 13 Controlled Atmosphere ................................ ................................ ............................. 14 Abcissic Acid Treatment ................................ ................................ ........................... 15 Cold Treatment ................................ ................................ ................................ ......... 15 High Salt Treatment ................................ ................................ ................................ .. 16 Discussion ................................ ................................ ................................ ..................... 16 Materials and Methods ................................ ................................ ................................ .. 18 Constructs ................................ ................................ ................................ .................. 18 Arabidopsis Transformation and Isolation of Transgenic Lines ............................... 19 Microscopy ................................ ................................ ................................ ................ 20 Experimental Growth Conditions ................................ ................................ ............. 20

PAGE 6

vi 3 NETWORK OF BIOSENSORS FOR STUDYING ARABIDOPSIS PHYSIOLOGY IN E XRATERRESTRIAL ENVIRONMENTS ................................ ............................. 56 Introduction ................................ ................................ ................................ ................... 56 Results and Discussion ................................ ................................ ................................ 56 Ascorbate Peroxidase ................................ ................................ ................................ 56 Alter Response to Gravity ................................ ................................ ......................... 58 Chitinase B ................................ ................................ ................................ ................ 58 Dehydration Responsive Element 2A ................................ ................................ ....... 59 Response to Desiccation 29A ................................ ................................ ................... 60 Plastidal w 3 Fatty Acid Desaturase ................................ ................................ ......... 60 Plant Defensin 1.2 ................................ ................................ ................................ ..... 61 Glutathione S Transferase 6 ................................ ................................ ...................... 61 Small Auxin Up RNA AC1 ................................ ................................ ..................... 62 Glutathione Synthetase 2 ................................ ................................ .......................... 63 Heat Shock Protein 18.2 ................................ ................................ ........................... 63 Ni trate Reductase 1 ................................ ................................ ................................ ... 64 Touch 4 ................................ ................................ ................................ ..................... 65 Conclusion ................................ ................................ ................................ .................... 65 Materials and Meth ods ................................ ................................ ................................ .. 66 Cloning Strategy ................................ ................................ ................................ ....... 66 Additional Positive Controls ................................ ................................ ..................... 66 LIST OF REFERENCES ................................ ................................ ................................ ... 89 BIOGRAPHICAL SKETCH ................................ ................................ ............................. 97

PAGE 7

vii Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillme nt of the Requirements for the Degree of Master of Science TRANSGENIC ARABIDOPSIS ADH/GFP REPORTER GENE PRODUCED FOR STUDYING SPACE BIOLOGY TELEMETRICALLY By Michael Scott Manak December 2001 Chairman: Robert J. Ferl Major Department: Horticultural Scie nce Transgenic arabidopsis plants containing the alcohol dehydrogenase ( Adh ) gene promoter fused to the Green Fluorescent Protein (GFP) reporter gene were developed as biological sensors for monitoring physiological responses to unique environments. Plants were monitored in vivo during exposure to hypoxia, high salt, cold, and ABA (abcissic acid) in experiments designed to characterize the utility and responses of the Adh/GFP biosensors. Plants in the presence of environmental stimuli that induced the Adh p romoter responded by expressing GFP, which in turn generated a detectable fluorescent signal. The GFP signal degraded when the inducing stimulus was removed. Digital imaging of the Adh/GFP plants exposed to each of the exogenous stresses demonstrated that the stress induced gene expression could be followed in real time. The experimental results established the feasibility of using a digital monitoring system, such as the TAGES (Transgenic Arabidopsis Gene Expression System) camera developed by a

PAGE 8

viii NASA subco ntracted engineering firm (Bionetics) for collecting gene expression data in real time from a network of biosensor plants during space exploration experiments.

PAGE 9

1 CHAPTER 1 INTRODUCTORY REVIEW OF REPORTER GENES Introduction Studying the physiological responses of Arabidopsis ( Arabidopsis thaliana ) to extraterrestrial environments required the development of a system or biosensor that could produce data about multiple environmental stimuli and provide a means to collect data telemetrically. A reporter gene fused to a promoter provides data about plant physiological responses to multiple environmental stimuli. Green fluorescent protein (GFP) from the jellyfish Aequorea aequorea and dsred (Discosoma red) from Discosoma, an Indiopacific relative of sea anemones and cora ls (Matz et al ., 1999) are the only reporter genes currently available for studying promoters in vivo and under real time conditions. Both GFP and dsred produce signals that can be collected telemetrically. The dsred reporter gene is unsui table for studying plants, since chlorophyll autofluorescents in the red light spectrum and is difficult to distinguish from the reporter gene signal. GFP is the most suitable gene for studying promoter activity in arabidopsis during exposure to non earth environments. Wildtype GFP has been modified as a reporter gene in order to investigate low level promoter activity in plants. Wildtype GFP has a cryptic intron that must be masked in order to produce a functional protein in plants (Haselo ff and Amos, 1995) Modifications improving the overall signal of GFP include producing a synthetic version using codons for optimal eukayotic translation and mutating the chromophore by changing the sixty fifth amino acid from serine to threonine (S65T) (Heim and Tsien,

PAGE 10

2 1996) The combined modifications to wildtype GFP produce a protein (sGFP(S65T)) capable of generating a signal 100 fold stronger than wildtype GFP (Sheen et al ., 1995) Although sGFP(S65T) is an ideal rep orter gene for a real time biosensor, GFP is only one of several reporter genes that have been utilized to study plants. Reporter genes have been used to study plant physiology for the past two decades. During this time period, several genes have been used as reporter genes including, b galactosidase (Helmer et al ., 1984) chloramphenical acetyl transferase (Bevan et al ., 1992) neomycin phosphotransferase (Fraley et al ., 1983) nopaline synthase (Bevan et al ., 1983) octopine synthase (De Greve et al ., 1983) luciferase (Riggs and Chrispeels, 1987) and b glucuronidase (GUS) (Jefferson et al ., 1987) (Table 1 1) Although all of the reporter genes listed above have been used to study gene activity in plants, some are more useful than others. GUS is the most useful reporter gene used during the past two decades since the enzyme is easily assayed and histochemically stained. The Adh/GUS system of the experiment PGIM 01 on the space shuttle flight STS 93 was the first promoter reporter gene fusion used to study plant physiological response to non earth environments (Paul et al. 2001 ). The Adh/GUS system was useful for monitoring promoter activi ty during the shuttle flight yet, the plants had to be handled by a shuttle crewmember who histochemically stained the plants. Using an Adh/GFP system avoids the requirement for human manipulation and also provides the luxury of observing promoter activity in vivo over the lifetime of a single plant. The Adh/GFP biological system coupled with the TAGES camera system creates a powerful tool for producing plant physiological data that can be collected telemetrically.

PAGE 11

3 Table 1 1. Reporter Gene Comparison Report er gene Substrates Low limit sensitivity Peak excitation wavelength Peak emission wavelength NPT II ATP 0.1 ng of enzyme CAT acetyl Coenzyme A 3 mU LUC luciferin, ATP Mg 3*10 6 molecules 560 nm 615 nm b gal X gal, ONPG, Galacton Star (clontech) 1 0*4 molecules GUS X gluc, MUG 0.02 U GFP Molecular O 2 0.033 m g/ml 489 nm 511 nm dsRED (clontech) light NA 558 nm 583 nm Reporter genes and corresponding substrates along with low limit detection sensitivities. Reporter Gene Review Over the past twe nty years, reporter gene systems have developed into sophisticated tools for studying plant physiology. Modern reporter gene systems are based on a tripartite concept. The first part of the system was based on the discovery that the Ti plasmids in Agrobact erium ( Agrobacterium tumefaciens ) are the causative agents responsible for crown gall tumorigenisis (Bomhoff, 1976; Chilton et al ., 1977 ; Hernalsteens et al ., 1983) The second part of the system involves the use of an ant ibiotic resistant gene that acts as a dominant selectable marker (Bevan et al ., 1992 ; Herrera Estrella et al ., 1983) The third part of the system involves the use of a gene that produces a signal that can be used to study plant physiology. Genes that were already harbored on the Ti plasmids were the first coding sequences used as reporter genes (Herrera Estrella

PAGE 12

4 et al ., 1983 ; De Greve et al ., 1983) Early development of chimeric reporter g ene systems included the use of neomycin phosphotransferase (NPTII) and chloramphenicol acetyltransferase (CAT) (Herrera Estrella et al ., 1983 ; Herrera Estrella et al ., 1983) Although the use of NPTII and CAT were advance ments for that time, new reporter genes were needed in order to visually see where the genes were expressed. b galactosidase, luciferase, b glucuronidase, green fluorescent protein (GFP), and dsred all produce visual signals that can be photographed for fu ture reference (Helmer et al ., 1984 ; Ow et al ., 1986 ; Jefferson et al ., 1987 ; Prasher, 1995 ; Matz et al ., 1999) Using GFP as a reporter gene represents the crowning achie vement in the reporter gene development field. Role of Agrobacterium Discovering that grown gall tumors had the Agrobacterium Ti plasmid covalently integrated into the plant genome was the key to modern plant genetic engineering (Bomhoff, et al. 1976). A p ortion of the Ti plasmid known as transfer DNA (T DNA) was the part of the Ti plasmid that incorporates into the plant genome (Chilton et al ., 1977) Hernalsteens et al. (1983) proved that the Ti plasmid was useful as a vector for incorpor ating foreign DNA into a plant genome. The nopaline synthase gene (Nos) promoter found on T DNA was the first promoter used to drive the expression of foreign proteins in plant cells (Bevan et al ., 1983) Soon after the Nos promoter was se quenced it was used to drive the expression of octopine synthase (ocs) and chloramphenicol acetyltransferase (CAT) (Herrera Estrella et al ., 1983) Once the Nos promoter was proven useful as a promoter for chimaeric genes it was used to re gulate the expression of dominant selectable markers such as neomycin phosphotransferase (NPTII) and

PAGE 13

5 aminoglycoside phosphotransferase (APH(3)II) (Fraley et al ., 1983 ; Herrera Estrella et al ., 1983) Neomycin Phosphotrans ferase, Chloramphenicol Acetyltransferase, and Octopine Synthase NPTII has a convenient assay that has been developed to detect and quantify NPTII activity in crude cell extracts at levels as low as 0.1 ng of enzyme (Reiss et al ., 1984) O cs and CAT both are unique to plant genomes and have sensitive and simple assay systems for detecting enzyme activity (Herrera Estrella et al ., 1983) NPTII, CAT, and Ocs all have highly sensitive assay systems, yet the signals produced by these reporter genes cannot be captured photographically for future reference, nor are the signals detectable without the addition of foreign substrates. b b Galactosidase b galactosidase from E. coli was the first reporter gene used that produced a visible signal. b galactosidase had several advantages as a reporter gene. The products of b galactosidase enzymatic cleavage can be assayed using colorimetric or fluorogenic substrates (Helmer et al ., 1984) Genes of interest can be fused to the amino terminus of b galactosidase producing an enzymatically active hybrid. (Muller Hill and Kania, 1974) The hybrid protein can be used for subcellular localization studies, protein purification, and amino acid sequence studies. Althoug h using b galcatosidase as a reporter gene was an advanced contribution to studying plant physiology, the gene has some negative attributes. Higher plants possess endogenous galactosidases, with an average activity of 463 nanomoles ONPG/mg/hour in tobacco calli (Helmer et al ., 1984) The high level of background galactosidase activity interferes with data collection using b galactosidase

PAGE 14

6 activity as a signal for studying plant physiology. Low levels of b galactosidase cannot be distinguishe d from background levels, this limits the genes that can be studied using the b galactosidase reporter gene system. Foreign substrates, that can be toxic, must be added to plant tissue in order to collect data on b galactosidase activity. Using b galactosi dase as a reporter gene was state of the art for that time, yet other reporter genes needed to be produced in order to overcome the disadvantages of b galactosidase. Luciferase Luciferase (Luc) was the next step in reporter gene technology. Luciferase from the firefly Photinus pyralis produces a protein that is completely distinct from endogenous plants proteins; therefore, background expression level is not a problem. The Luc protein produces a light signal when exposed to the substrates ATP, O 2 and lucif erin. Light, the product of luciferase activity, can be assayed using a luminometer at levels 100 times more sensitive than a standard CAT assay (Ow et al ., 1986) In addition to the luminometer assay, lucifersae activity can be detected u sing X ray film exposure or video capture. Plant development studies can be performed with periodic treatment of luciferase since low levels of luciferin are non toxic. The luciferase reporter gene system was a vast improvement over the b galactosidase sys tem, yet luciferase still requires the addition of harsh substrates. b b Glucuronidase Another E.coli gene b glucuronidase (GUS) was used as a reporter gene. Higher plants lack endogenous GUS activity; therefore, no background activity interferes with report er gene assays. GUS activity can be easily quantified using the 4 methyl umbelliferyl glucuronide (MUG) fluorometric assay (Jefferson et al ., 1987) Jefferson et

PAGE 15

7 al. emphasized that the MUG assay used for quantifying GUS enzyme activity av oids the problems inherent in luciferase, CAT, and NPTII assays. N terminal fusions are also possible using the GUS reporter system (Jefferson et al ., 1987) The sensitivity of histochemical staining and the lack of background GUS activity allow the GUS reporter gene system to be excellent for studying regulatory regions of promoters. GUS was the first reporter gene that provided a simple means of studying regulatory regions of promoters such as arabidopsis ADH signal localization and signa l transduction (Chung, 1999). Beyond fusion genetics and promoter analysis, GUS can also be used to study membrane transport when the appropriate signal sequences are fused to the amino terminus of GUS. GUS was one of the most effective reporter gene syste ms ever developed, yet this system still requires the use of potentially toxic foreign substrates in order to detect GUS activity in plants. Green Fluorescent Protein Green fluorescent protein (GFP) detection requires no cofactors or substrates. Fluorescen t emission of GFP only requires excitation by light energy at a peak wavelength of either 395 or 475 nm (Cubitt et al ., 1995) GFP is relatively small in size (26.9kDa) and can tolerate both carboxyl and amino terminal fusions, which can b e used for protein localization studies and intercellular trafficking (Park and Raines, 1997 ; Presley et al ., 1997 ; Wang and Hazelrigg, 1994) GFP is a highly stable protein that can withstand many denatur ants, proteases, a broad pH, and temperature range. Other advantages of GFP include lack of interference with normal cellular activities and ease of assay using fluorescence microscope or other devices equipped with the proper excitation and emission filte rs (Prasher, 1995)

PAGE 16

8 Early reports indicate that improvements were needed in order to improve the quality of GFP as a reporter gene (Cubitt et al ., 1995 ; Haseloff and Amos, 1995 ; Prasher, 19 95) Mutations have been made that have improved fluorescent intensity (Crameri et al ., 1996 ; Heim et al ., 1995) thermostability (Siemering et al ., 1996) codon usage (Rouwendal et al ., 1 997 ; Yang et al ., 1996) chromophore formation (Crameri et al ., 1996) spectral qualities (Heim et al ., 1994 ; Heim and Tsien, 1996) and removal of high AT content or cryptic intron seque nces (Haseloff and Amos, 1995) GFP has been used to study many aspects of plant biology such as protein protein interactions and localization (Leffel et al ., 1997) nuclear and endoplasmic reticulum (ER) targeting (Grebenok et al ., 1997; Haseloff et al ., 1997) virus spread (Baulcombe et al ., 1995; Oparka et al ., 1997) as well as, visualization of mitochondria and plastids (Kohler et al ., 1997a, 1997b). The greatest problems found when using GFP as a reporter gene are poor expression and relative toxicity. Both of these problems were solved first by removing the cryptic intron (Haseloff and Amos, 1995) and mutating the chr omophore to increase excitation and emission values (Heim et al ., 1995) Secondly, by targeting GFP to the ER which solves the potential problem of toxicity upon localization to the nucleus (Haseloff et al ., 1997) GFP has emerged as the premier reporter gene for studying plant biology due to the improvements made to the reporter gene by using modern molecular biological techniques to tailor the gene. Conclusion The reporter gene field has developed many systems that have b een used to study plant physiology, only GFP can produce a signal without the need for exogenous

PAGE 17

9 substrates. Furthermore, GFP is a diverse reporter gene able to tolerate a multitude of manipulations without causing interference with normal plant physiology Although the reporter genes have changed, the basic principle of using T DNA as a vector and dominant selectable markers for screening purposes has remained unchanged for the past 20 years.

PAGE 18

10 CHAPTER 2 STUDY OF ARABIDOPSIS PHYSIOLOGY USING AN ADH/GFP BI OSENSOR TO COLLECT DATA VIA TELEMETRIC SIMULATION Introduction Developing an understanding of how terrestrial life would respond to features of the Martian environment in an on site experiment requires a system able to produce relevant physiological data t hat can be collected telemetrically. Plants are ideally suited as biological monitors of environments as they have sophisticated stress responses designed to deal with environmental fluctuations in situ. One class of environmental sensors is the promoter regulatory regions of key genes in the metabolic pathways that cope with environments. Electronic sensors can provide precise data describing the conditions surrounding the plant, but cannot provide details on the plant's physiological perception of those conditions. Environmentally responsive genes, however, provide the raw material for engineering biological sensors to evaluate metabolic responses to specific stresses. These biosensors can be tailored to meet specific needs in terms of both the stress response to be examined and the means by which the data will be collected by fusing the regulatory region of an environmentally sensitive gene to a reporter gene that can be monitored for expression. The design of the sensor region of a transgene determin es what type of stress will be detected. The promoter region of the arabidopsis alcohol dehydrogenase (Adh) gene was chosen as the sensor component of TAGES (Transgenic Arabidopsis Gene Expression System) plants used to monitor the effects of spaceflight o n STS 93 (Paul et

PAGE 19

11 al ., 2001) Adh is an example of a gene that is sensitive to diverse environmental stresses, including hypoxia, cold, high salt, dehydration, and the plant hormone abcissic acid (ABA). The Adh promoter has been well chara cterized (Chung and Parish, 1995; de Bruxelles et al ., 1996; Dolferus et al ., 1994; Nishiuchi et al ., 1999; Paul and Ferl, 1998) and sequence elements of the promoter have been associated with the perception of individual stresses (de Bruxelles et al ., 1996; Dolferus et al ., 1994; McKendree and Ferl, 1992; Lu, 1996 ). In addition, Adh is among the genes that have been implicated in spaceflight associated stress responses (Porterfield et al ., 1997) The des ign of the reporter component of the transgene dictates how gene expression data will be collected. The first generation TAGES biosensors used b glucuronidase (GUS), a widely used reporter gene (Jefferson, 1987; Jefferson et al ., 1987) Wh ile extremely useful in certain contexts, the GUS reporter is limited in that viewing expression of the reporter requires that the plant be killed in histochemical stain. Thus, gene expression cannot be followed over time in the same plant, nor can gene ex pression be monitored passively without direct human interaction. Obviating these limitations required a reporter gene that could be monitored in real time by non destructive means. The gene that encodes Green Fluorescent Protein (GFP) in the jellyfish Ae quorea aequorea is well suited for use as a passive reporter gene (Baulcombe et al ., 1995; Haseloff and Amos, 1995; Hu and Cheng, 1995; Prasher, 1995) The GFP signal can be easily visualized using the correct combination of excitation lig ht and viewing filters. Therefore, GFP expression can be monitored by non destructive means and can be used to study long term promoter activity in vivo, since harmful substrates are avoided. In

PAGE 20

12 addition, the GFP reporter gene signal can be detected by dig ital imaging equipment, which provides a way to observe activity via telemetry. Coupling an environmentally responsive gene promoter, a properly engineered GFP reporter (Haas et al ., 1996; Haseloff and Amos, 1995; Sheen et al ., 1995) and digital video collection creates a tool that can be used to monitor transgene expression over the lifetime of the plant. The first example of a transgenic biosensor for studying plant physiological response to non terrestrial environment was the arabidopsi s Adh/GUS TAGES system of the experiment PGIM 01 on STS 93 (Paul et al ., 2001) Since the reporter gene was GUS, monitoring the experiment in flight required crew time to harvest and stain plants. The experiments described here are design to model a telemetric experiment conducted at a place distant to the site of data processing. The GFP reporter gene replaces GUS. Arabidopsis plants containing an Adh/GFP transgene were exposed to various stresses and Adh/GFP transgene expression was monit ored by collecting digital images. This ground based study lays the foundation for using GFP to monitor stress response in real time via telemetry in future spaceflight and extraterrestrial lander experiments. Results Experimental Controls In addition to the experimental Adh/GFP biosensor line, the two control lines were examined for each experimental parameter. The positive control consisted of the CaMV 35S driving the sGFP(S65T) reporter (Figure 2 1 a c). The 35S promoter is active in many plant tissues and should provide a GFP signal in most cases, though its pattern of expression can be affected by some conditions (Lam et al ., 1989) The negative control consisted of the sGFP(S65T) reporter alone with no promoter, which should produce no

PAGE 21

13 GFP signal (Figure 2 2). For all tests, the control lines showed no changes in GFP expression during the course of the treatments. Flooding At 42 hours of flooding, the Adh/GFP expression was localized in the distal portion of the root, suggesting that Adh activity originally started in or near the root tip in response to flooding (Figure 2 3 e). As the duration of flooding increased, the Adh/GFP signal increased in intensity and extended up the root while maintaining intense expression in the root tip r egion (Figure 2 3 g). The intensity and distribution of Adh/GFP expression continued to increase until the experiment was halted at the 82 hour time point (Figure 2 3 i). Ten hours after the plants were removed from the flooded environment, Adh/GFP express ion was considerably diminished (Figure 2 3 k) and was barely detectable after the plants had been returned to a normally aerated environment for 30 hours (Figure 2 3 m). The continued increase of GFP at or near the root tip indicated that the Adh promoter was continuously activated due to the hypoxic conditions perceived by the plant. Ten day old Arabidopsis seedlings grown in 50 ml Fisherbrand conical tubes containing MS media were flooded with enough water to cover the roots. The plants were photographed macroscopically using a digital video camera. The first five days of flooding show the GFP signal traveling from the distal portion of the roots up toward the base of the stem in Arabidopsis plants containing the Adh biosensor (Figure 2 4 a e). The positi ve control remained relatively unchanged during the same five day flooding time period (Figure 2 5 a e). In addition, the positive control in the macroscopic pictures provides a more representative expression pattern (Figure 2 5) than the positive control photographs where only the root tips were photographed at a microscopic level. The

PAGE 22

14 negative controls produced no GFP signal upon flooding for five days (Figure 2 6). Through out the duration of the flooding experiment, there was a continual Adh biosensor p lants continued increase in the number of roots expressing GFP and in the amount of root area where the GFP signal was observable in Adh/GFP plants (Figure 2 4 f o). The positive and negative controls responded to the continued flooding in the same manner as the controls behaved in the first five days (Figures 2 5 & 2 6 f o respectively). After the flooding conditions were removed, the GFP signal in the Adh biosensor decreased overtime as an indication that the Adh promoter was no longer induced due to the hypoxic conditions produced by flooding (Figure 2 4 p t). The positive and negative controls continued to maintain the same levels of GFP expression during the recovery as the controls had during flooding conditions (Figures 2 4 & 2 5 p t). The macroscopic experiment compliments the microscopic experiment in that both experiments prove that the GFP signal and the biosensor transgene are excellent tools for capturing physiologically relevant data in regards to Arabidopsis perception of environmental stimulu s. Controlled Atmosphere The Adh/GFP plants displayed an intense induction of Adh/GFP expression after 24 hours of 3% O 2 (Figure 2 7 e). Adh/GFP expression was generally confined to the distal portion of the root in the early stages of induction, but exte nded throughout the root with increased intensity by 36 hours (Figure 2 7 g). At 48 hours of a 3% O 2 atmosphere, Adh/GFP was expressed in all visible root cells (Figure 2 7 i). The plants exposed to a 3% O 2 atmosphere for 48 hours were allowed to recover f rom hypoxia by returning the plants to normal atmosphere. After 12 hours of recovery, the Adh/GFP signal began to decrease (Figure 2 7 k). The Adh/GFP signal continued to decrease as the recovery time

PAGE 23

15 progressed, but evidence of low levels of GFP remained even after 48 hours of recovery (Figure 2 7 m). In contrast to 3% O 2 an atmosphere of 10% O 2 was insufficient hypoxic stress to induce Adh/GFP expression in the roots, even after 48 hours of exposure (Figure 2 8 e i). Adh/GFP expression was also absent d uring the recovery period (Figure 2 8 k m). Abcissic Acid Treatment The Adh/GFP signal was detectable throughout the roots after 12 hours of exposure to ABA (Figure 2 9 e), but began to decrease throughout the roots after 24 hours (Figure 2 9 g). Adh/GFP expression continued to decrease, suggesting that the available ABA concentration was reduced over time, possibly due to photo and metabolic degradation (Figure 2 9 i). Recovery was achieved by returning the plants to plain MS media plates. Adh/GFP signal continued to decrease with recovery time (Figure 2 9 k & m). The results show that the Adh/GFP signal was detectable when plants induced the Adh promoter as a result of exposure to ABA in the environment, and that the Adh/GFP signal was reduced once the p lants started to recover from ABA exposure. Cold Treatment After 24 hours of cold treatment, Adh/GFP expression was localized to the hypocotyl junction (Figure 2 10 e). The Adh/GFP signal was not detectable in the roots until the plants were exposed to 4 C for 48 hours (Figure 2 10 g). After 56 hours of exposure to 4 C, Adh/GFP expression extended down the primary root, demonstrating that the signal was moving from its origin at the hypocotyl junction to distal parts of the root (Figure 2 10 i). Twelve hour s of recovery at room temperature was sufficient to

PAGE 24

16 decrease the Adh/GFP signal, showing that the Adh promoter was inactivated upon removal of the stress conditions (Figure 2 10 k). High Salt Treatment The Adh/GFP signal was expressed in the upper portion of the primary root after 24 hours of high salt exposure (Figure2 11 e). The expression pattern resembled a checkerboard with some cells expressing GFP, while adjacent cells did not express GFP. The expression of Adh/GFP continued to extend further down t he root over time (Figure 2 11 g & i). Recovery from the high salt stress conditions entailed transferring the plants back to plain MS media. The Adh/GFP signal decreased throughout the roots upon removal of the high salt stress (Figure 2 11 k & m). The re sults of the high salt treatment revealed that the Adh/GFP signal was detectable when plants were exposed to 300 mM NaCl and the signal decreased as plants recovered from high salt stress conditions. Discussion These experiments using the Adh/GFP biosensor system demonstrate the feasibility of developing long range telemetry data on plant gene expression. Adh/GFP transgene expression levels were monitored passively and images were collected with a digital imaging system. While not part of the present study, radio transmission of digital signals is practical, and the distance between image data collection and image analysis is essentially irrelevant. In these experiments, Adh/GFP expression was monitored in response to several environmental stresses known to affect gene expression patterns. Both flooding and 3% O 2 presented clearly hypoxic conditions, and induced Adh/GFP expression in similar patterns over similar timeframes, with strong signals developing over 36 to 48 hours. An

PAGE 25

17 atmosphere of 10% O 2 did not c ause increased Adh/GFP expression in the roots, establishing that the threshold for Adh/GFP response to hypoxia in roots is between 3% O 2 and 10% O 2 Adh/GFP plants required 48 to 56 hours of exposure to 4 C to produce a detectable Adh/GFP signal in the ro ots, and the spatial localization of Adh/GFP signal was different than that detected by hypoxia. Specific localization of the Adh/GFP signal was most dramatically revealed by the high salt stress, which formed a checkerboard pattern of expression. The Adh/ GFP signal could reflect the changing state of an environmental stress over time. When the plants were transferred to the ABA containing medium, Adh/GFP signal was induced, but the signal steadily decreased as ABA was degraded in the media. Similarly, remo ving the plants from hypoxia, cold or salt stress resulted in the loss of Adh/GFP signal. The results collected from all of the experiments correlated with previously published Adh promoter/GUS reporter gene data (Chung e t al. 1999 ). Adh/GFP arabidopsis plants could, therefore, be used to collect physiological data on plant responses to diverse environments during space shuttle, space station, lunar, and Martian experiments by remote sensing. However, by using regulatory promoter sensors from other genes, biosensors can be developed to respond to any of a tremendous range of exogenous stresses that may exist during extraterrestrial exploration experiments. A promoter such as that of the ascorbate peroxidase gene (APX1) (Storozhenko et al ., 1998) could be used to assay superoxidizing agents in Martian soil. The altered response to gravity (ARG1) (Sedbrook et al ., 1999) promoter might be used to study physiological responses to reduced gravity. Responses to possible heavy met als in Martian soil could be studied using the promoter of glutathione synthetase (GSH2) (Wang and Oliver, 1996)

PAGE 26

18 Pathways involving hormonal fluctuations in response to extraterrestrial environments could be monitored with hormone respons ive promoters such as w 3 fatty acid desaturase (FAD7) (Nishiuchi et al ., 1999) small auxin up RNA (SAUR AC1) (Gil and Green, 1996; Gil et al ., 1994) or Chitinase B (CHIB) (Samac et al ., 1990) which res pond to jasmonic acid, auxin, and ethylene respectively. Basically any environmental condition that generates a molecular response could be developed into a biological sensor that would allow telemetric data collection about that response. The digital imag ing system used in the current demonstration was a microscope mounted digital camera. Digital imaging systems suitable for spaceflight or planetary lander missions would need to be small, lightweight, and energy efficient, while maintaining the need to col lect the GFP images at resolutions that meet experimental goals. However, even current commercially available video imaging equipment essentially meets these criteria, suggesting that image detection, transmission and analysis should not prove to be a limi ting factor. The results of these experiments demonstrate the utility of engineered plants as biosensors for studying plant physiology, and support the feasibility of using a remote digital data collection system for studying plant physiology in extraterre strial environments or in any application that requires remote sensing of gene activity. Materials and Methods Constructs The plant expression vector pBI 101 with the GUS reporter gene under Adh promoter regulation was previously reported by Chung and Ferl (1999) (Figure 2 12 a) In order to introduce the sGFP(S65T) reporter gene under Adh promoter regulation into

PAGE 27

19 Arabidopsis the plant expression vector was reconstructed to have the sGFP(S65T) reporter gene in place of the Gus reporter gene (Figure 2 12 b & c). The sGFP(S65T) was generated by Sheen et al. (Sheen et al ., 1995) A 5 BamHI site and a 3 SacI site were placed on the sGFP(S65T) gene through PCR techniques. The primers used for constructing the BamHI/ SacI cassette were 5TCGGAT CCGATGGTGAGCAAGGGCGAG3 and 5CCGAGCTCCCGCTTTACTTGTACAGCT3 respectively. The BamHI and SacI sites were chosen in order to insert the sGFP(S65T) between the same sites that the Gus reporter gene occupied. The final plasmid construct pBI 101 846 ADH sGFP(S 65T) was made by digesting the pBI 101 846 ADH Gus vector with BamHI and SacI, collecting the digested vector and ligating the vector with the sGFP(S65T) BamHI/ SacI cassette insert. A second plant expression vector, pBI 101, was constructed to have a s GFP(S65T) reporter gene with no promoter sequence. This vector was constructed in a similar manner to the pBI 101 846 ADH sGFP(S65T) vector with the exception that a 5 XbaI/ 3 SacI cassette was used to insert sGFP(S65T). The XbaI and SacI restriction si tes were placed on the sGFP(S65T) gene through PCR techniques. The primers used for constructing the XbaI and SacI cassette are 5GGTCTAGAATGGTGAGCAAGGGCGAG3 and 5CCGAGCTCCCGCTTTACTTGTACAGCT3 respectively. Arabidopsis Transformation and Isolation of Tr ansgenic Lines The pBI 101 846 Adh/sGFP(S65T) construct was introduced into Agrobacterium tumefaciens strain GV3101, which was then used for transforming arabidopsis (Bechtold and Pelletier, 1998) Seeds were screened on kanamycin (50 mg/m l) MS media (Murashige and Skoog, 1962) solidified with 0.2% phytagel (Sigma) to produce 15

PAGE 28

20 independent lines. Each line was carried through at least three generations to ensure homozygosity. One line was selected as the Adh/GFP line used for all of the experiments presented. Similar procedures were used to develop a CaMV 35S/sGFP(S65T) positive control line (Figure 2 1 a & b) (Lam et al ., 1989) and a promoterless/sGFP(S65T) negative control line (Figure 2 2 a & b). Micros copy A Zeiss Axioplan 2 Fluorescence Microscope was used to view arabidopsis roots at 50x magnification. The fluorescent images were captured using a FITC filter set with the following microscope/SPOT (Diagnostic Instruments, Inc.) camera settings: Atto A rc HBO 100W power setting at 50%, gain at 16, and the camera exposure time at 500 milliseconds. The bright field images were captured with the following microscope/SPOT camera settings: Atto Arc HBO 100W power setting at 50%, light intensity at 2, with gai n and exposure time determined automatically using the SPOT version 3.1 software. Experimental Growth Conditions In preparation for treatments, Adh/GFP seeds were chemically sterilized and planted in a row across MS media plates containing 2.5 ppm of the fungicide benomyl (Paul et al ., 2001) The plates were kept in a vertical position to ensure that the roots would grow across the surface of the media in an aerobic environment, and were maintained in a vertical position throughout the ex periments to prevent spurious Adh induction (Chung and Ferl, 1999) All of the roots observed for Adh/GFP expression during exposure to an exogenous stress were not expressing GFP prior to exposure to the exogenous stress.

PAGE 29

21 For flooding, v ertical plates were placed in plastic bags containing enough water to flood approximately 75% of each root. Images were collected every 10 hours for a total of 82 hours. After 82 hours, the plants were removed from the flood conditions and allowed to recov er. Images were collected every 10 hours for 30 hours of recovery. For growth in defined atmospheres, vertical plates were placed in separate sealed containers and maintained at either 97% N 2 and 3% O 2 or 90% N 2 and 10% O 2 Images were collected at 24, 36 and 48 hours of exposure. The plants were allowed to recover in ambient oxygen levels and images were collected every 12 hours for 48 hours To test the effects of ABA, seedlings were transplanted onto vertical plates containing 300 m M ABA. The plants gre w under continuous light on the ABA plates for 12 hours, and then images were collected every 12 hours for 48 hours. After 48 hours, the plants were transplanted onto vertical plates for recovery, and images were collected every 12 hours for 48 hours. For cold treatment vertical plates were placed at 4 C. The plants grew under continuous light at 4 C for 24 hours before the first images were collected. Then images were collected every 12 hours for 56 hours. After 56 hours, the plants were allowed to recover at 24 C, with images being collected every 12 hours for 48 hours. For high salt treatment seedlings were transplanted onto vertical plates containing 300 mM NaCl in the media. The plants grew under continuous light on the NaCl plates for 24 hours then ima ges were collected every 12 hours for 48 hours. After 48 hours, the plants were transplanted onto MS media plates for recovery, and images collected every 12 hours for 48 hours.

PAGE 30

22 Figure 2 1. Positive Control Vector Map and Sequence Data. a) Positive control vector map. The positive control biosensor vector map labeled sequenced area corresponds with the chromatogram data in figure 2 1 b. b) Chromatograms that correspond with the labeled portion of the vector construct map. c) Raw sequence directly from the chromatograph. The green letters represent GFP sequence and the black letters represent promoter seq uence.

PAGE 31

23 N C G T C C G C T C G A C C A G G A T G G G C A C C A C C C C G G T G A A C A G C T C C T C G C C C T T G C T C A C C A T T C T A G A G T C C C C C G T G T T C 1600 0 N C G T C C G C T C G A C C A G G A T G G G C A C C A C C C C G G T G A A C A G C T C C T C G C C C T T G C T C A C C A T T C T A G A G T C C C C C G T G T T C Fragment MANAK 121/P T C T C C A A A T G A A A T G A A C T T C C T T A T A T A G A G G A A G G G N C T T G C G A A G G A T A G T G G G A T T G T G C G T C A T C C C T T A C G T C 1600 0 T C T C C A A A T G A A A T G A A C T T C C T T A T A T A G A G G A A G G G N C T T G C G A A G G A T A G T G G G A T T G T G C G T C A T C C C T T A C G T C Fragment MANAK 121/P G T G G A G A T A T C A C A T C A A T C C A C T T G C T T T G A A G A C G T G G T T G G A A C G T C T T C T T T T T C C A C G A T G C T C C T C G T G G G 1600 0 G T G G A G A T A T C A C A T C A A T C C A C T T G C T T T G A A G A C G T G G T T G G A A C G T C T T C T T T T T C C A C G A T G C T C C T C G T G G G Fragment MANAK 121/P 121sGFP(S65T)5005 bp NPT II sGFP(S65T) sequenced area Pnos Tnos Tnos 35S promoter ClaI (3752) EcoRI (1004) HindIII (4165) XbaI (2) SacI (737) AvaI (1416) AvaI (4251) NcoI (2613) NcoI (4469) PstI (2234) PstI (4181) a b

PAGE 32

24 G T G G G G G T C C A T C T T T G G G A C C A C T G T C G G C A G A G G C A T C T T C A A C G A T G G C C T T T C C T T T A T C G C A A T G A T G G C A T T 1600 0 G T G G G G G T C C A T C T T T G G G A C C A C T G T C G G C A G A G G C A T C T T C A A C G A T G G C C T T T C C T T T A T C G C A A T G A T G G C A T T Fragment MANAK 121/P T T G T A G G A G C C A C C T T C C T T T T C C A C T A T C T T C A C A A T A A A G T G A C A G A T A G C T G G G C A A T G G A A T C C G A N G A G G T T 1600 0 T T G T A G G A G C C A C C T T C C T T T T C C A C T A T C T T C A C A A T A A A G T G A C A G A T A G C T G G G C A A T G G A A T C C G A N G A G G T T Fragment MANAK 121/P T T C C G G A T A T T A C C C T T T G T C T G A A A A G T C T C A A T T G C C C T T T G G T C T T C C T G A G A C T G T A T C T T T G A T A T T T T T N G G A G T 1600 0 T T C C G G A T A T T A C C C T T T G T C T G A A A A G T C T C A A T T G C C C T T T G G T C T T C C T G A G A C T G T A T C T T T G A T A T T T T T N G G A G T Fragment MANAK 121/P T A N A C A A G T G T G T C N T G C T C C A C C A T G T T N A C C N A A G A T T N T C T T C T T G T C N T T G A G T C C T A A G A G A C T C T G T A T T G A A 1600 0 T A N A C A A G T G T G T C N T G C T C C A C C A T G T T N A C C N A A G A T T N T C T T C T T G T C N T T G A G T C C T A A G A G A C T C T G T A T T G A A Fragment MANAK 121/P Figure 2 1 continued

PAGE 33

25 c NCGTCCGCTCGACCAGGATGGGCACCACCCCGGTGAACAGC TCCTCGCCCTTGCTCACCATTCTAG AGTCCCCCGTGTTCTCTC CAAATGAAATGAACTTCCTTATATAGAGGAAGGGNCTTGCG AAGGATAGTGGGATTGTGCGTCATCCCTTACGTCAGTGGAGA TATCACATCAATCCACTTGCTTTGAAGACGTGGTTGGAACGT CTTCTTTTT CCACGATGCTCCTCGTGGGTGGGGGTCCATCTTT GGGACCACTGTCGGCAGAGGCATCTTCAACGATGGCCTTTCC TTTATCGCAATGATGGCATTTGTAGGAGCCACCTTCCTTTTCC ACTATCTTCACAATAAAGTGACAGATAGCTGGGCAATGGAA TCCGANGAGGTTTCCGGATATTACCCTTTGTCTGAAAAGTCT CAATTGCCCTTTGGTCTTCCTGAGACTGTATCTTTGATATTTT TNGGAGTANAC AAGTGTGTCNTGCTCCACCATGTTNACCNAA GATTNTCTTCTTGTCNTTGAGTCCTAAGAGACTCTGTATTGAA CTGTTCGCCNANTCTTTTAC Figure 2 1 continued

PAGE 34

26 Figure 2 2. Negative Control Vector Map and Sequence Data. a) The negative control biosensor vector map label sequenced area corresponds with the chromatogram data in figure 2 2 b. b) Chromatograms that correspond with the labeled portion of the vector construct map. c) Raw sequence directly from the chromatograph. The green letters represent GFP sequence and the black letters represent pr omoter sequence.

PAGE 35

27 pBI101sGFP(S65T)seq4187 bp NPT II sequenced area Pnos Tnos Tnos GFP Ava I (1416) Cla I (3752) Eco RI (1004) Hin dIII (4165) Nco I (2613) Xba I (2) Sac I (737) Pst I (2234) Pst I (4181) T T C G T C G C C G T C C A G C T C G A C C A G G A T G G G C A C C A C C C C G G T G A A C A G C T C C T C G C C C T T G C T C A C C A T T C T A G A G T C G A C C 1475 0 T T C G T C G C C G T C C A G C T C G A C C A G G A T G G G C A C C A C C C C G G T G A A C A G C T C C T C G C C C T T G C T C A C C A T T C T A G A G T C G A C C Fragment MANAK 101/P C T G C A G G C A T G C A A G C T T G G C G T A A T C A T G G T C A T A G C T G T T T C C T G T G T G A A A T T G T T A T C C G C T C A C A A T T C C A C A C 1475 0 C T G C A G G C A T G C A A G C T T G G C G T A A T C A T G G T C A T A G C T G T T T C C T G T G T G A A A T T G T T A T C C G C T C A C A A T T C C A C A C Fragment MANAK 101/P A A C A T A C G A G C C G G A A G C A T A A A G T G T A A A G C C T G G G G T G C C T A A T G A G T G A G C T A A C T C A C A T T A A T T G C G T T G C G C 1475 0 A A C A T A C G A G C C G G A A G C A T A A A G T G T A A A G C C T G G G G T G C C T A A T G A G T G A G C T A A C T C A C A T T A A T T G C G T T G C G C Fragment MANAK 101/P a b

PAGE 36

28 C A C T G C C C G C T T T C C A G T C G G G A A A C C T G T C G T G C C A G C T G C A T T A A T G A A T C G G C C A A C G C G C G G G G A G A G G C G G T 1475 0 C A C T G C C C G C T T T C C A G T C G G G A A A C C T G T C G T G C C A G C T G C A T T A A T G A A T C G G C C A A C G C G C G G G G A G A G G C G G T Fragment MANAK 101/P T T G C G T A T T G G G C C A A A G A C A A A A G G G C G A C A T T C A A C C G A T T G A G G G A G G G A A G G T A A A T A T T G A C G G A A A T T A T T C 1475 0 T T G C G T A T T G G G C C A A A G A C A A A A G G G C G A C A T T C A A C C G A T T G A G G G A G G G A A G G T A A A T A T T G A C G G A A A T T A T T C Fragment MANAK 101/P C A T T A A A G G T G A A T T A T C A C C G T C A C C G A C T T G A G C C A T T T G G G A A T T A G A G C C A G C A A A A T C A C C A G T A G C A C C A T T 1475 0 C A T T A A A G G T G A A T T A T C A C C G T C A C C G A C T T G A G C C A T T T G G G A A T T A G A G C C A G C A A A A T C A C C A G T A G C A C C A T T Fragment MANAK 101/P C C A T T A G C A A G G C C G G A A A C G T C A C C A A T G A A A C C A T C G A T A G C A G C A C C G T A A T C A G T A G C G A C A G A A T C A A G T T T G 1475 0 C C A T T A G C A A G G C C G G A A A C G T C A C C A A T G A A A C C A T C G A T A G C A G C A C C G T A A T C A G T A G C G A C A G A A T C A A G T T T G Fragment MANAK 101/P G C C T T T A G C G T C A G A C T G T A G C G C G T T T T C A T C G G C A T T T T C G G T C A T A G C C C C C T T A T T A G C G T T T G C C A T C T T T T C A 1475 0 G C C T T T A G C G T C A G A C T G T A G C G C G T T T T C A T C G G C A T T T T C G G T C A T A G C C C C C T T A T T A G C G T T T G C C A T C T T T T C A Fragment MANAK 101/P C A T A A T C A A A A T C A C C G G A A C C A G A G C C A C C A C C G G A A C C C G C C T C C C T C A G A G C C C G C C A C C C T C A N A A C C G C C A C C C T C 1475 0 C A T A A T C A A A A T C A C C G G A A C C A G A G C C A C C A C C G G A A C C C G C C T C C C T C A G A G C C C G C C A C C C T C A N A A C C G C C A C C C T C Fragment MANAK 101/P Figure 2 2 continued

PAGE 37

29 c TTCGTCGCCGTCCAGCTCGACCAGGATGGGCACCACCCCGGTGAACAGCTC CTCGCCCTTGCTCACCATTCTAG AGTCGACCTGCAGGCATGCAAGCTTGGC GTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATT CCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTA ATGA GTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAG TCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGG AGAGGCGGTTTGCGTATTGGGCCAAAGACAAAAGGGCGACATTCAACCGA TTGAGGGAGGGAAGGTAAATATTGACGGAAATTATTCATTAAAGGTGAATT ATCACCGTCACCGACTTGAGCCATTTGGGAATTAGAGCCAGCAAAATCACC AGTAG CACCATTACCATTAGCAAGGCCGGAAACGTCACCAATGAAACCATC GATAGCAGCACCGTAATCAGTAGCGACAGAATCAAGTTTGCCTTTAGCGTC AGACTGTAGCGCGTTTTCATCGGCATTTTCGGTCATAGCCCCCTTATTAGCG TTTGCCATCTTTTCATAATCAAAATCACCGGAACCAGAGCCACCACCGGAA CCCGCCTCCCTCAGAGCCCGCCACCCTCANAACCGCCACCCTCAGAGCCCC A

PAGE 38

30 Florescent Images Brightfield Images Figure 2 3. Microscopic Time Lapse Flood Root Photos. Florescent and corresponding bright field images of Arabidopsis during flood stress. Negative control containing the promoterless sGFP(S65T) r eporter gene (a & b). Positive control containing CaMV35S promoter/sGFP(S65T) transgene (c & d). Time lapse of GFP expression in Adh promoter/sGFP(S65T) fusion plants through 82 hours of flood stress (e j). Time lapse of GFP expression in Adh promoter/sGFP (S65T) fusion plants through 30 hours of recovery from flooding (k n). Negative control Positive control 42 hours flooding 62 hours flooding 82 hours flooding 10 hours recovery 30 hours recovery a c e g i m k b d f h j l n

PAGE 39

31 Figure 2 4. Macroscopic Time Lapse Photos of Arabidopsis Adh/GFP Flooded a o) shows A rabidopsis with the Adh promoter maintaining induction of GFP over a 23 day flooding period. The flooding period caused the GFP signal to increase, indicating that the Adh promoter remained active during the flood period. p t) shows Arabidopsis with the Ad h promoter becoming repressed and GFP signal reducing over a 12 day period. The recovery period allowed the GFP signal to decrease, indicating that the Adh promoter became inactive during the recovery period. u) Representative picture of the macroscopic ti me lapse photos under white light The plants were not photographed everyday since the camera used to capture the images was not available on a continual basis. The plants were observed on a daily base though and GFP signal was maintained consistently as in dicated by the images.

PAGE 40

32 L R a b c d e f

PAGE 41

33 Figure 2 4 continued L S R g h i j k l

PAGE 42

34 Figure 2 4 continued m n o p q r

PAGE 43

35 50 ml fisher brand conical tube Canopy, not flooded Roots flooded Phytagel, MS media slant s t u 2 4 continued

PAGE 44

36 Figure 2 5. Ma croscopic Time Lapse Photos of Arabidopsis CaMV 35S/GFP Flooded. a o) shows Arabidopsis maintaining induction of the CaMV 35S promoter causing constitutive expression of the GFP signal. p t) shows the continued maintenance of GFP signal indicating induct ion of the CaMV 35S promoter. Arabidopsis containing CaMV promoter/sGFP(S65T) biosensor maintains a similar level of GFP signal indicating that the CaMV 35S promoter is unaffected by the flooding or recovery. In addition, the CaMV 35S promoter/sGFP(S65T) b iosensor proves to be an effective positive control. u) Representative picture of the macroscopic time lapse photos under white light

PAGE 45

37 L R S L R a b c d e f

PAGE 46

38 Figure 2 5 continued g l k j i h

PAGE 47

39 Figure 2 5 continued m r q p o n

PAGE 48

40 50 ml fisher brand conical tube Canopy, not flooded Roots flooded Phytagel, MS media slant u s t 2 5 continued

PAGE 49

41 Figure 2 6. Macrosco pic Time Lapse Photos of Arabidopsis Promoterless/GFP Flooded. a o) show Arabidopsis transformed with a pBI101sGFP(S65T) vector flooded in a comparable manner to the Adh and CaMV 35S plants. No GFP signal is produced, since no promoter is fused with the GF P gene. p t) shows Arabidopsis negative control biosensors after recovery. The promoterless sGFP(S65T) biosensors are effective negative controls since no GFP signal is produced during experimentation. Furthermore, the negative control biosensor is an effe ctive tool for comparing growth pattern/rate against the experimental system(s) to insure that the GFP has no measurable negative impact on the plants under the experimental growth conditions. u) Representative picture of the macroscopic time lapse photos under white light

PAGE 50

42 L R Florescent Images a c d b e f

PAGE 51

43 Figure 2 6 continued L S R i j g h k l

PAGE 52

44 Figure 2 6 continued r q p o m n

PAGE 53

45 50 ml fisher brand conical tube Canopy, not flooded Roots flooded Phytagel, MS medi a slant s t t Figure 2 6 continued

PAGE 54

46 Fluorescent Images Brightfield Images Figure 2 7. Microscopic Time Lapse 3% O 2 Root Photos. Microscopic time lapse 3% O 2 root photos. Fluorescent and corr esponding bright field images of Arabidopsis during 3% O 2 stress. Negative control containing the promoterless sGFP(S65T) reporter gene (a & b). Positive control containing CaMV35S promoter/sGFP(S65T) transgene (c & d). Time lapse of GFP expression in Adh promoter/sGFP(S65T) fusion plants through 48 hours of 3% O 2 stress (e j). Time lapse of GFP expression in Adh promoter/sGFP(S65T) fusion plants through 24 hours of recovery from 3% O 2 stress (k n). Negative control Positive control 24 hours 3% O 2 36 hours 3% O 2 48 hours 3% O 2 12 hours recovery 24 hours recovery a c e g i k m b d f h j l n

PAGE 55

47 Fluorescent Images Brightfield Images Figure 2 8. Microscopic Time Lapse 10% O 2 Root Photos. Fluorescent and corresponding bright field images of Arabidopsis during 10% O 2 stress. Negative control containing the promoterless sGFP(S65T) reporter gene (a & b). Positiv e control containing CaMV35S promoter/sGFP(S65T) transgene (c & d). Time lapse of GFP expression in Adh promoter/sGFP(S65T) fusion plants through 48 hours of 10% O 2 stress (e j). Time lapse of GFP expression in Adh promoter/sGFP(S65T) fusion plants through 24 hours of recovery from 10% O 2 stress (k n). Negative control Positive control 24 hours 10% O 2 36 hours 10% O 2 48 hours 10% O 2 12 hours recovery 24 hours recovery b d f h j l n

PAGE 56

48 Fluorescent Images Brightfield Images Figure 2 9. Microscopic Time Lapse 300 m M ABA Root Photos. Fluorescent and corresponding bright field images of Arabi dopsis during ABA stress. Negative control containing the promoterless sGFP(S65T) reporter gene (a &b). Positive control containing CaMV35S promoter/sGFP(S65T) transgene (c & d). Time lapse of GFP expression in Adh promoter/sGFP(S65T) fusion plants through 48 hours of ABA stress (e j). Time lapse of GFP expression in Adh promoter/sGFP(S65T) fusion plants through 24 hours of recovery from ABA stress (k n). Negative control Positive control 24 hours ABA 36 hours ABA 48 hours ABA 12 hours recovery 24 hours recovery b d f h j l n a c e g i k m

PAGE 57

49 Fluorescent Images Brightfield Images Figure 2 1 0. Microscopic Time Lapse 4 C Root Photos. Florescent and corresponding bright field images of Arabidopsis during cold stress. Negative control containing the promoterless sGFP(S65T) reporter gene (a & b). Positive control containing CaMV35S promoter/sGFP( S65T) transgene (c & d). Time lapse of GFP expression in Adh promoter/sGFP(S65T) fusion plants through 56 hours of cold stress (e j). Time lapse of GFP expression in Adh promoter/sGFP(S65T) fusion plants through 24 hours of recovery from cold stress (k n). Negative control Positive control 24 hours cold 48 hours cold 56 hours cold 12 hours recovery 24 hours recovery b d f h j l n a c e g i k m

PAGE 58

50 Fluorescent Images Brightfield Images Figure 2 11. Microscopic Time Lapse 300 mM NaCl Root Photos. Florescent and corresponding bright field images of Arabidopsis during high salt stress. Negative cont rol containing the promoterless sGFP(S65T) reporter gene (a & b). Positive control containing CaMV35S promoter/sGFP(S65T) transgene (c & d). Time lapse of GFP expression in Adh promoter/sGFP(S65T) fusion plants through 48 hours of high salt stress (e j). T ime lapse of GFP expression in Adh promoter/sGFP(S65T) fusion plants through 24 hours of recovery from high salt stress (k n). Negative control Positive control 24 hours high salt 36 hours high salt 48 hours high salt 12 hours recovery 24 hours recovery a c e g i m k b d f h j l n

PAGE 59

51 Figure 2 12. Adh/GUS and Adh/GFP Vector Maps and Adh/GFP Sequence Data. a) The original pBI101 construct contained a 846 Adh promoter/GUS reporter gene fusion. The original construct was modif ied by replacing the GUS reporter gene with the GFP reporter gene. b) The vector map represents sequence information for the DNA that is found inside the T DNA borders of the pBI101 vector. The vector map represents sequence information for the DNA that is found inside the T DNA borders of the pBI101 vector. c) Chromatograms that correspond with the labeled portion of the vector construct map. d) Raw sequence directly from the chromatograph. The green letters represent GFP sequence and the black letters rep resent promoter sequence.

PAGE 60

52 pBI101 -846 adh 6173 bp NPT II GUS Pnos At -846 Adh Tnos Tnos Bam HI (855) Cla I (5761) Eco RI (3013) Hin dIII (1) Nco I (4622) Pst I (4243) Sma I (862) Xma I (860) Apa LI (1812) Apa LI (2136) Ava I (860) Ava I (2726) Ava I (3425) pBI101-846 Adh sGFP(S65T) 5018 bp NPT II sGFP(S65T) sequenced area Pnos At -846 Adh Tnos Tnos Ava I (1417) Bam HI (2) Cla I (3753) Eco RI (1005) Hin dIII (4166) Nco I (2614) Pst I (2235) Sac I (738) a b

PAGE 61

53 T T A C G T C G C C G T C C A G C T C G A C C A G G A T G G G C A C C A C C C C G G T G A A C A G C T C C T C G C C C T T G C T C A C C A T C G G A T C C T T T G T 1600 0 T T A C G T C G C C G T C C A G C T C G A C C A G G A T G G G C A C C A C C C C G G T G A A C A G C T C C T C G C C C T T G C T C A C C A T C G G A T C C T T T G T Fragment MANAK ADH/P T A G T T T T G T G T G A T T G T G A T G T A A G A A A A G A G A A A C A G A G A A G G G G A T T T A T A T A G C A G C T G G T A A T T G G A A G A A G T A 1600 0 T A G T T T T G T G T G A T T G T G A T G T A A G A A A A G A G A A A C A G A G A A G G G G A T T T A T A T A G C A G C T G G T A A T T G G A A G A A G T A Fragment MANAK ADH/P A T A T T T A C A A A A A C T C A C C A C T A G A A A T T A A T T A G T A C T G T T T A T T G A A A T C T T T T G T A A T T A T C C A G T C G A C A T C T G 1600 0 A T A T T T A C A A A A A C T C A C C A C T A G A A A T T A A T T A G T A C T G T T T A T T G A A A T C T T T T G T A A T T A T C C A G T C G A C A T C T G Fragment MANAK ADH/P T A G A A T A C T A G G G G C G T A T T T G G T T T T G C C T T G T T C T C T C G A A C G C T C T T T C C A C T T G G C G T T G C T A G T A T T C G T C C A 1600 0 T A G A A T A C T A G G G G C G T A T T T G G T T T T G C C T T G T T C T C T C G A A C G C T C T T T C C A C T T G G C G T T G C T A G T A T T C G T C C A Fragment MANAK ADH/P Figure 2 12 continued c

PAGE 62

54 C A C G T G G C A T T T C T C G T T G A T C T T T T T A A T T A C A A A T T G T A G T A A T T A T T A A T A G T T T T T T T A A A A T G T G G T C T T A G 1600 0 C A C G T G G C A T T T C T C G T T G A T C T T T T T A A T T A C A A A T T G T A G T A A T T A T T A A T A G T T T T T T T A A A A T G T G G T C T T A G Fragment MANAK ADH/P G T T A A T T A G T C T T G A T G G T C A C G C C G T G G T G T T G C T A A A A G C A G T A A T C G G T G T A C C C A T C G A A T G C T T T T G G T T T C G 1600 0 G T T A A T T A G T C T T G A T G G T C A C G C C G T G G T G T T G C T A A A A G C A G T A A T C G G T G T A C C C A T C G A A T G C T T T T G G T T T C G Fragment MANAK ADH/P G G G C G G N T T C A T C T T A A A T A G C T C T T T A A T A A G T A T T A T T C T T G G N C A T C A A G T T G G A A T T N T T T T T T T C T A C T T T T G T 1600 0 G G G C G G N T T C A T C T T A A A T A G C T C T T T A A T A A G T A T T A T T C T T G G N C A T C A A G T T G G A A T T N T T T T T T T C T A C T T T T G T Fragment MANAK ADH/P G T G A G A A T T T T A A A G G T A T G A A A G A T C A C T A A T T G G C T C T T A A T T G T A T T C T T G G C C G G C N C T T T C A A G T C T T A A C N A T 1600 0 G T G A G A A T T T T A A A G G T A T G A A A G A T C A C T A A T T G G C T C T T A A T T G T A T T C T T G G C C G G C N C T T T C A A G T C T T A A C N A T Fragment MANAK ADH/P N A T C C A T T A T G A G N G G C A T T A A N N A T A C T T T T T N C T G G T T T A A A C C C G C C T A N T T N A G G G A T N G G N G A C A T T T C C C C C A A A 1600 0 N A T C C A T T A T G A G N G G C A T T A A N N A T A C T T T T T N C T G G T T T A A A C C C G C C T A N T T N A G G G A T N G G N G A C A T T T C C C C C A A A Fragment MANAK ADH/P Figure 2 12 continued

PAGE 63

55 d TTACGTCGCCGTCCAGCTCGACCAGGATGGGCACCACCCCGGTGAACAGCTCCT CGCCCTTGCTCACCATCGGATC CTTTGTTAGTTTTGTGTGATTGTGATGTAAGAA AAGAGAAACAGAGAAGGGGATTTATATAGCAGCTGGTAATTGGAAGAAGTAGA TATTTACAAA AACTCACCACTAGAAATTAATTAGTACTGTTTATTGAAATCTTTT GTAATTATCCAGTCGACATCTGTAGAATACTAGGGGCGTATTTGGTTTTGCCTTG TTCTCTCGAACGCTCTTTCCACTTGGCGTTGCTAGTATTCGTCCACGTGGCATTT CTCGTTGATCTTTTTAATTACAAATTGTAGTAATTATTAATAGTTTTTTTAAAATG TGGTCTTAGTTAATTAGTCTTGATGGTCACGCCGTGGTGTTGCTA AAAGCAGTA ATCGGTGTACCCATCGAATGCTTTTGGTTTCGGGCGGNTTCATCTTAAATAGCTC TTTAATAAGTATTATTCTTGGNCATCAAGTTGGAATTNTTTTTTTCTACTTTTGTG AGAATTTTAAAGGTATGAAAGATCACTAATTGGCTCTTAATTGTATTCTTGGCCG GCNCTTTCAAGTCTTAACNATCCATTATGAGNGGCATTAANNATACTTTTTNCTG GTTTAAACCCGCCTANTTNAGGGATN GGNGACATTTCCCCCAAAANACANTGGA CCCNNNTATAATTATCANGATTTTTGNTNATTATTTTNCTCCNNATGCCCAAA Figure 2 12 Continued

PAGE 64

56 CHAPTER 3 NETWORK OF BIOSENSORS FOR STUDYING ARABIDOPSIS PHYSIOLOGY IN EXRATERRESTRIAL ENVIRONMENTS I ntroduction Individual Arabidopsis lines were transformed with biosensing transgenes in order to monitor plant physiological responses to extraterrestrial environments via telemetry. A biosensor is defined as a transgene consisting of a promoter that respo nds to an environmental condition fused to the sGFP(S65T) reporter gene. Each line of transgenic Arabidopsis was developed to monitor a specific environmental condition with some overlapping among the promoters response capabilities. A range of previously characterized promoters that respond to various physiological conditions were fused to sGFP(S65T) producing a network of biosensors. A total of 14 Arabidopsis promoters chosen to monitor 16 different environmental conditions or metabolic activities will p rovide valuable information about plant physiological responses during exposure to extraterrestrial environments (Table 3 1 & 3 2). Results and Discussion Ascorbate Peroxidase Martian soil is considered to have high levels of oxidizing agents based on stu dies performed by the Viking landers (Oyama and Berdahl, 1979) Arabidopsis was transformed with a 265 APX1 promoter/sGFP(S65T) biosensor transgene as a potential tool for studying Arabidopsis physiology in response to growth in Martian s oil. Ascorbate peroxidases (APX) are genes involved in the removal of hydrogen peroxide

PAGE 65

57 from within the cytosol and chloroplasts (ASADA). Both in vivo footprinting and GUS fusion studies were used to prove that the 300 base pair promoter region contained cis elements that respond to oxidative stress, ethylene, and heat shock (Storozhenko et al ., 1998) Table 3 1. Promoters and Corresponding Environmental Stimuli Stimulus A D H A P X 1 A R G 1 C H I B D R E B 2 A F A D 7 G S H 2 G S T 6 H S P 1 8 2 N R 1 P D F 1 2 R D 2 9 A S A U R A C 1 T C H 4 ABA AUXIN BRASSINO STEROID COLD CIRCADIAN RHYTHM CYTOKININ DARKNESS DROUGHT ETHYLENE GRAVITY HEAT HYDROGEN PEROXIDE JASMONIC ACID LOW OXYGEN HEAVY METALS NITRATE PATHOGEN SALICYLIC ACID SALT TOUCH UV LIGHT WOUND Genes vs. stimuli that cause induction ( ) or reduction ( ) of mRNA.

PAGE 66

58 Table 3 2. Organs where promoters regulate Expression Genes Reporter Gene Stems Leaves Roots Flowers Trichomes Siliques ADH GUS X X X X X APX1 GUS X X X ARG1 mRNA X X X X X X CHIB GUS X X X DREB2A GUS X X X X X FAD7 GUS X X X GSH2 mRNA X X GST6 LUC X X X HSP18.2 GUS X X X NR1 GUS & CAT X PDC X X X X X PDF1.2 GUS X X X X X X RD29A GUS X X X X X SAUR AC1 GUS X X X X TCH4 GUS X X X X X X Organs in which reporter gene or indogenous mRNAs are up regulated by corresponding gene promoters. Alter Response to Gravity Gravity levels on the Space shuttle, International Space Station, Moon and Mars are reduced compared to gravity levels on Earth. ARG1 is a DnaJ like protein that is involved in Arabidopsis gravitropism (Sedbrook et al ., 1999) The ARG1 promoter has not been analyzed through reporter gene experiments. In ord er to monitor Arabidopsis gravitropic response to altered gravity an 1150 upstream base pair sequence of the ARG1 gene was fused to sGFP(S65T). Chitinase B Increased levels of ethylene have been reported on both the Space Shuttle and the Space Station MIR Ethylene is a plant hormone involved with both normal and stress related physiological responses (Cowles et al ., 1994) Chitinase is a plant enzyme

PAGE 67

59 produced during exposure to ethylene as well as pathogen attack (Stintzi et al ., 1993) Arabidopsis contains two chitinase genes one that has an acidic isoelectric point and one that has a basic isoeletric point (Samac et al ., 1990) The basic Arabidopsis chitinase (ChiB) responds to ethylene treatment whereas the acidic chitinase (ChiA) does not (Samac et al ., 1990) ChiB mRNA levels increase sharply over controls upon exposure to ethylene in roots and leaves (Samac et al ., 1990) The response to ethylene also appears to be mo re dramatic in older plants versus younger plants (Samac et al ., 1990) The 998 5 sequence upstream from the start site of the ChiB gene was fused to sGFP(S65T) (Figure 3 1 a c) in order to monitor Arabidopsis that may potentially be exp osed to ethylene on board the International Space Station or Space Shuttle. Dehydration Responsive Element 2A Martian soil not only appears to contain high levels of peroxides, but also appears to contain high levels of salts (Clark, 1979) The dehydration responsive element (DREB2A) gene is expressed under conditions of dehydration and high salinity (Nakashima et al ., 2000) Arabidopsis was transformed with a 1814 base pair fragment of the DREB2A promoter fused to the GUS reporter gene for analyzing cis elements that are involved with dehydration and high salinity response (Nakashima et al ., 2000) The putative promoter contains regulatory elements that caused GUS expression upon exposing the transgenic Ar abidopsis to dehydration and high salt conditions (Nakashima et al ., 2000) In order to assay Arabidopsis physiology in response to Martian soil salinity, Arabidopsis was transformed with a 1998 base pair fragment directly upstream from t he (DREB2A) transcription start site.

PAGE 68

60 Response to Desiccation 29A Another Arabidopsis gene that responds to high salt stress is the response to desiccation gene (rd29A) (Yamaguchi Shinozaki and Shinozaki, 1993) A 961 rd29A promoter/GUS re porter gene study demonstrated that the rd29A promoter contains regulatory sequences that are activated upon exposing Arabidopsis to cold, drought, high salt, and abscisic acid (Yamaguchi Shinozaki and Shinozaki, 1993) Since the temperatu res on Mars range from 188 K to 240 K (Margulis et al ., 1979) Arabidopsis containing rd29A biosensor could be used to monitor physiological responses to cold exposure, if systems failed on a growth chamber during a Martian exploration mis sion. In addition, Arabidopsis transformed with the rd29A biosensor could be used in concert with Arabidopsis transformed with DREB2A to monitor physiological responses during growth in highly saline Martian soil (Clark, 1979) Plastidal w w 3 Fatty Acid Desaturase The chance that plants could become wounded during growth on the Space Shuttle, International Space Station, or on Mars is relatively low due to the design of the growth facilities. However, plants experiencing space sickness may inadvertently activate the pathways that are responsive to wounding. Pathways responsive to wounding are often connected with the plant hormone jasmonic acid (Reymond and Farmer, 1998) Jasmonic acid acts as a signal transduction molecule in the activation of wound inducible genes (Reymond and Farmer, 1998) The Arabidopsis plastidial w 3 fatty acid desaturase (FAD7) enzyme responds early in the wound defensive pathway (Nishiuchi et al ., 1999) The FAD7 pr omoter was studied extensively through various deletion constructs fused to the GUS reporter gene (Nishiuchi et al ., 1999) The 825 base pair fragment of the FAD7 promoter consists of regulatory sequences that respond to both wounding and jasmonic

PAGE 69

61 acid in stems, leaves, and roots (Nishiuchi et al ., 1999) Thus, in extraterrestrial environment, transgenic Arabidopsis containing the FAD7 promoter fused to sGFP(S65T) (Figure 3 2 a c) would make an excellent candidate for anal yzing actual wounding or possible inappropriate induction of the jasmonic acid responsive pathway. Plant Defensin 1.2 Fungal contamination is a common problem when growing plants on nutrient agar during space shuttle flights (Paul et al ., 2 001) An Arabidopsis gene known as plant defensin 1.2 (PDF1.2) contains 5 regulatory sequences that respond both locally and systemically to fungal pathogen attack (Manners et al ., 1998) The 1254 PDF1.2 promoter was linked to GUS in or der to identify signals that could induce expression of the chimeric gene (Manners et al ., 1998) The 1254 PDF1.2 promoter/GUS fusion gene was up regulated upon exposure to exogenous jasmonic acid, methyl jasmonate, and the oxidation comp ound paraquat (Manners et al ., 1998) Conversely, the 1254 PDF1.2 promoter/ GUS fusion gene was unaffected by either exogenous treatments with salicylic acid or general wounding (Manners et al ., 1998) Arabidopsis transfo rmed with the 1254 PDF1.2 biosensor can be used to study physiological responses to pathogen correlated jasmonic acid signal transduction in comparison with wound induced jasmonic acid signal transduction of the FAD7 biosensor during exposure to micrograv ity. Similarly, Arabidopsis transformed with the 1254 PDF1.2 biosensor can be used to study systemic signal transduction during exposure to microgravity. Glutathione S Transferase 6 The National Academies committee for space biological research recomme nded that NASA research should be performed on cell elongation mechanisms in response to gravitropic signals. Auxin or indoleacetic acid (IAA) is a plant hormone that is directly

PAGE 70

62 involved in signaling cellular elongation (Rayle et al ., 1970 ) The Arabidopsis glutathione s transferase ( 495 GST6) promoter contains cis elements that respond to auxin, salicylic acid, and hydrogen peroxide (Chen and Singh, 1999) The GST6 promoter has been studied through deletion analysis via luciferase reporter gene fusions (Chen and Singh, 1999) The 495 GST6 promoter was fused to the sGFP(S65T) reporter gene in order to study Arabidopsis physiology in response to auxin signaling in connection with gravitropic signaling. The GST6 promoter has the added benefit of interacting with salicylic acid. A biosensor produced with the GST6 promoter could be used to study Arabidopsis physiology stimulated by UV irradiation, since salicylic acid content increases in many plants upon expo sure to UV irradiation. Collecting data on Arabidopsis physiology in response to UV irradiation will be important for Martian exploration, if plants are exposed to solar UV irradiation, that is nearly unfiltered by the thin Martian atmosphere (Zill et al ., 1979) Another cis element in the 495 GST6 promoter is activated by hydrogen peroxide. Therefore, a GST6/sGFP(S65T) biosensor could be used to study Arabidopsis physiology upon exposure to reduced gravity, UV irradiation, and elevated o xidizing elements. Small Auxin Up RNA AC1 In order to further study auxin response in Arabidopsis a small auxin up RNA gene (SAUR AC1) that contains 5 regulatory sequences responsive to exogenous auxin applications (Gil and Green, 1997) was fused to sGFP(S65T) to create a biosensor. A SAUR AC1/GUS transgene was previously used to identify specific Arabidopsis organs that increase GUS activity upon exposure to auxin (Gil and Green, 1997) GUS activity was elevated in Arabi dopsis roots, stems, leaves, and flowers when treated with auxin (Gil and Green, 1997) The SAUR AC1 biosensor can be used comparatively with the

PAGE 71

63 GST6 biosensor when observing Arabidopsis responding to auxin flux during growth in a microgr avity environment. Glutathione Synthetase 2 Both the Viking and Pathfinder missions to Mars provided evidence that Martian soil has a higher percentage of heavy metal content compared to the percentage of heavy metal content on earths continental crust (Rieder et al ., 1997) Although heavy metals are needed in trace levels for plant survival, overexposure to heavy metals can cause deleterious effects such as chlorosis, necrosis, stunting, leaf discoloration, and root growth inhibition (Williams et al ., 2000) An Arabidopsis glutathione synthetase gene (GSH2) was cloned into a gsh mutant yeast rescuing the yeast phenotype and restoring cadmium resistance (Wang and Oliver, 1996) Although GSH2 promoter repor ter gene fusions have not been performed, the GSH2 promoter should respond to heavy metal exposure since the GSH2 gene is essential for removing excess or unnecessary heavy metals from plants (Wang and Oliver, 1996) A GSH2 promoter/sGFP(S 65T) reporter gene fusion will make an excellent biosensor for monitoring physiological responses when Arabidopsis is grown in Martian soil. Heat Shock Protein 18.2 The growth chambers that will house Arabidopsis plants during experimental missions are des igned to maintain an average temperature of 24 C. Heat shock should not be a measured physiological response if the chambers are working correctly. If the chamber failed or if heat shock in an extraterrestrial environment were monitored a necessary biosens or would be required in order to collect data. The 18.2 KDa heat shock protein (HSP18.2) from Arabidopsis is induced by heat shock at the transcript level (Takahashi and Komeda, 1989) The 913 HSP18.2 promoter contains multiple copies of

PAGE 72

64 HSE like sequences, which cause chimeric HSP18.2 promoter/GUS genes to induce 10 fold higher than control plants after two hours of exposure to 40 C (Takahashi and Komeda, 1989) The 678 HSP18.2 promoter is specifically induced upon heat shock making a 678 HSP18.2 promoter/sGFP(S65T) (Figure 3 3 a c) reporter gene fusion an ideal biosensor for collecting data on Arabidopsis physiology in response to heat shock experiments. Nitrate Reductase 1 Highly sophisticated nutrient delivery systems have been developed by NASA space biologists and engineers in order to insure that plants receive all necessary nutrients during space flight growth experiments (Dreschel et al ., 1994) Nitrate is an essential nutrient for plant survival. Nitrate reductase (NR1) is a key enzyme involved with nitrogen assimilation and is induced directly by the uptake of nitrate (Lin et al ., 1994) The 1443 NR1 promoter region was fused to the chloramphenicol acetyltransferase (CAT) report er gene, during deletion analysis studies of the NR1 promoter, which proved that the NR1 promoter was directly induced by nitrate exposure (Lin et al ., 1994) Transgenic Arabidopsis that contain a biosensor consisting of the 1443 NR1 prom oter/sGFP(S65T) reporter gene fusion could test the efficiency of nutrient delivery systems developed for space flight. In addition to nitrate, the NR1 gene is partially controlled at the transcript level when stimulated by cytokinin (Lu et al ., 1990) sucrose (Cheng et al ., 1992) and photosynthetically active radiation (Cheng et al ., 1992) Arabidopsis containing the NR biosensor could be used to establish a baseline diurnal pattern for a living organism on Mars, since NR mRNA expression is in tune with the circadian rhythm (Lin et al ., 1994)

PAGE 73

65 Touch 4 Performing experiments on board space faring instruments presents unique opportunities to study Arabidopsis cell wall physiology. Cell wall xyloglucan are modified by an Arabidopsis xyloglucan endotransglycosylase (XETs) gene family (Campbell and Braam, 1999) Touch 4 (TCH4) is a XET gene that responses to touch, darkness, temperature shock, auxin, and brassinosteroids (Campbell and Braam, 1999) Previous studies showed that a 958 5 sequence of the TCH4 gene could drive GUS expression in leaves, roots, trichomes, flowers, and siliques (Campbell and Braam, 1999) Arabidopsis exposed to microg ravity may respond in the same manner as Arabidopsis plants exposed to physical touch on earth. Such a hypothesis could be tested using, Arabidopsis plants transformed with a biosensor such as the 959 TCH4/sGFP(S65T) transgene. Conclusion Collecting data on Arabidopsis physiology in response to potential stresses incurred during growth in environments such as the Space Shuttle, the International Space Station, Mars greenhouses, and other extraterrestrial systems requires a noninvasive system that produces telemetrically attainable results. Transgenic Arabidopsis encoding chimeric promoter/sGFP(S65T) reporter gene fusions provide a means for collecting telemetrically attainable results. The following promoters were subcloned, upon PCR amplification from Arab idopsis genomic DNA, into secondary vectors (APX1, ARG1, GST6, SAUR AC1, DREB2A, PDF1.2, and TCH4). These promoters are available for cloning into primary binary vectors, and then subsequent cloning into Arabidopsis. The Arabidopsis biosensor lines (ADH, F AD7 HSP18.2, CHIB,

PAGE 74

66 NR1, RD29A, GSH2/sGFP(S65T)) produced here cover a variety of physiologies that should provide evidence about plant physiological responses to changes during growth in extraterrestrial environments versus similarly controlled earth based environments. Materials and Methods Cloning Strategy Each promoter was amplified from Arabidopsis strain WS genomic DNA using specific primers that contained restriction sites at the ends of the sequences. Upon amplification the PCR fragments (Figure 3 4) were subcloned into either puc18 or PCR BLUNT (Invitrogen). Then the promoter vectors were transformed into E. coli strain DH10B (Life Technologies). The promoter vectors were harvested from the bacteria using standard alkaline lyses techniques. The promo ter vectors were digested to release the promoters, which were purified and collected from 1% agraose gels using the Stratagene strataprep DNA gel purification kit. The promoters were cloned into either pBI101 vectors or pCAMBIA 1300 vectors plant binary v ectors. The promoter binary vectors were transformed into E. coli strain DH10B. The promoter binary vectors were harvested from the bacteria using standard alkaline lyses techniques. The purified vectors were introduced into Agrobacterium tumefaciens strai n GV3101, which was then used for transforming Arabidopsis via vacuum infiltration (Bechtold and Pelletier, 1998) Additional Positive Controls In addition to the pBI121sGFP(S65T) positive control construct another positive control pCAMBIA 1300 CAMV35S/sGFP(S65T)/NosT was developed to represent the pCAMBIA constructs (Figure 3 5 a c). The original positive control used in the time lapse studies was not always consistent in expression level or pattern. Even after four

PAGE 75

67 generations (F5) of sel ection the positive control remained inconsistent. The original construct was reintroduce into the Arabidopsis genome. This reintroduction produced a positive control that had a consistent GFP expression pattern after three generations of selection (Figure 3 6).

PAGE 76

68 Figure 3 1. Genomic ChiB Gene Map, ChiB/GFP Vector Map, and Sequence Data. a) Map representing the promoter sequence of the ChiB gene. The symbols labeled as primers indicat e where the primers were designed to anneal to genomic DNA during the PCR reaction. b) Vector map of the ChiB/sGFP(S65T) biosensor represents the vector and cloned transgene. The portion labeled as sequenced area corresponds to the chromatogram in figure 3 1 c. c) Chromatograms that correspond with the labeled portion of the vector construct map. d) Genomic ChiB gene map, ChiB/GFP vector map, and sequence data. Raw sequence directly from the chromatograph. The green letters represent GFP sequence and the bl ack letters represent promoter sequence.

PAGE 77

69 AC069474 chib gene 3020 bp CDS(T2E22.18) 19 3' primer 5' primer Repeat Region 18 Repeat Region 19 Ava I (1013) Bam HI (1990) Cla I (998) Eco RI (724) Pst I (1564) Apa LI (978) Apa LI (1626) Nco I (418) Nco I (3012) pCAMBIA1300sGFP(S65T)ChiB 10915 bp sGFP(S65T) sequenced area ChiB promoter Tnos hptII (hygromycin resistance) gene 35S promoter right border left border Hin dIII (9905) Nco I (9916) Sma I (2047) Xma I (2045) Xba I (10911) Sac I (731) Cla I (6487) Cla I (10496) Eco RI (998) Eco RI (10222) a b

PAGE 78

70 G C C G T C C A G C T C G A C C A G G A T G G G C A C C A C C C C G G T G A A C A G C T C C T C G C C C T T G C T C A C C A T T C T A G A G A A A G A T A T A T A T 1506 0 G C C G T C C A G C T C G A C C A G G A T G G G C A C C A C C C C G G T G A A C A G C T C C T C G C C C T T G C T C A C C A T T C T A G A G A A A G A T A T A T A T Fragment MANAK CHI/P T A T A G A T C C A A T T A A T G A T T G T T T T A T C A C A T C A A A T T C T A T C G T T T T C C A T A G T T T A T T G T T T G T T A T G T C T A T G G A G 1506 0 T A T A G A T C C A A T T A A T G A T T G T T T T A T C A C A T C A A A T T C T A T C G T T T T C C A T A G T T T A T T G T T T G T T A T G T C T A T G G A G Fragment MANAK CHI/P A G T G T G G C T A T G G G G A A C A A A C A G T A T T T G G T A G G T T T G T T T T T G A T T A T A T T T A T T T T C C T T C C T T C A T T G T T G C T A 1506 0 A G T G T G G C T A T G G G G A A C A A A C A G T A T T T G G T A G G T T T G T T T T T G A T T A T A T T T A T T T T C C T T C C T T C A T T G T T G C T A Fragment MANAK CHI/P T A G G T T A G A T A T T G A T T T G T T T T T T T G G G G G A T T A T C A T G T T A A T T C C A A G T A A T G A G A A C T T T C T A T G T A T G A A A C 1506 0 T A G G T T A G A T A T T G A T T T G T T T T T T T G G G G G A T T A T C A T G T T A A T T C C A A G T A A T G A G A A C T T T C T A T G T A T G A A A C Fragment MANAK CHI/P A C T G T G C T A A A T A T T G G T A G A A G A A T A C A A A T T T T A G A A G A C C A A A G G C A T A A C A T A T T A C A C T C T T T T T G A G T T T T T 1506 0 A C T G T G C T A A A T A T T G G T A G A A G A A T A C A A A T T T T A G A A G A C C A A A G G C A T A A C A T A T T A C A C T C T T T T T G A G T T T T T Fragment MANAK CHI/P Figure 3 1 continued c

PAGE 79

71 T T T G T T C T A A A G T T A C T A T C G A C G T A G A T A G T G G G A C A C A A A G G T C G T A A A A T T T T G G G T G G T C T G A A A A C A C G T T T A C 1506 0 T T T G T T C T A A A G T T A C T A T C G A C G T A G A T A G T G G G A C A C A A A G G T C G T A A A A T T T T G G G T G G T C T G A A A A C A C G T T T A C Fragment MANAK CHI/P T A C T C G A G T T G C G G A C T A A T C G A T G A T C T G A G C T A G T G T G C A C T A A T T A A T C A A A C A C A C A C A T A T T C G G A T A T T C C C 1506 0 T A C T C G A G T T G C G G A C T A A T C G A T G A T C T G A G C T A G T G T G C A C T A A T T A A T C A A A C A C A C A C A T A T T C G G A T A T T C C C Fragment MANAK CHI/P C C C T A T G A T G T A T A C A C A A T A C T T G A C T A T A T C T A A A A C A A G A T C A C A A G A G T T G C A T G A A T A G T C A A G A A A A T G T A T A 1506 0 C C C T A T G A T G T A T A C A C A A T A C T T G A C T A T A T C T A A A A C A A G A T C A C A A G A G T T G C A T G A A T A G T C A A G A A A A T G T A T A Fragment MANAK CHI/P T A A C G T G G A G A A A A T A A A A A T A G A C C G T G T C T A A A T A T T T A A C T A T G A T C A A T G T T G A C A A A A A C A A A A T T T A A C T T T A 1506 0 T A A C G T G G A G A A A A T A A A A A T A G A C C G T G T C T A A A T A T T T A A C T A T G A T C A A T G T T G A C A A A A A C A A A A T T T A A C T T T A Fragment MANAK CHI/P A A T T A T G A A T A T G A N G C G G C G G G T T C G T G A T C N A C T T T T T C A A A A A A C A A T T G A G A C A T T T 1506 0 A A T T A T G A A T A T G A N G C G G C G G G T T C G T G A T C N A C T T T T T C A A A A A A C A A T T G A G A C A T T T A N A A T T C A T T T A T A A Fragment MANAK CHI/P Figure 3 1 continued

PAGE 80

72 d GCCGTCCAGCTCGACCAGGATGGGCACCACCCCGGTGAACAGCTCCTCGCC CTTGCTCACCAT TCTAGAGAAAGATATATATAGATCCAATTAATGATTGTTT TATCACATCAAATTCTATCGTTTTCCATAGTTTATTGTTTGTTATGTCTAT GG AGTGTGGCTATGGGGAACAAACAGTATTTGGTAGGTTTGTTTTTGATTATAT TTATTTTCCTTCCTTCATTGTTGCTAGGTTAGATATTGATTTGTTTTTTTGGGG GATTATCATGTTAATTCCAAGTAATGAGAACTTTCTATGTATGAAACTGTGC TAAATATTGGTAGAAGAATACAAATTTTAGAAGACCAAAGGCATAACATAT TACACTCTTTTTGAGTTTTTTGTTCTAAAGTTACTATCGACGTAG ATAGTGGG ACACAAAGGTCGTAAAATTTTGGGTGGTCTGAAAACACGTTTACTCGAGTT GCGGACTAATCGATGATCTGAGCTAGTGTGCACTAATTAATCAAACACACA CATATTCGGATATTCCCTATGATGTATACACAATACTTGACTATATCTAAAA CAAGATCACAAGAGTTGCATGAATAGTCAAGAAAATGTATAACGTGGAGA AAATAAAAATAGACCGTGTCTAAATATTTAACTATGATCAATGT TGACAAA AACAAAATTTAACTTTAATTATGAATATGANGCGGCGGGTTCGTGATCNAC TTTTTCAAAAAACAATTGAGACATTT Fig ure 3 1 continued

PAGE 81

73 Figure 3 2. Genomic FAD7 Gene Map, FAD7/GFP Vector Map, and Sequence Data. a) Map representing the promoter sequence of the FAD7 gene. The symbols labeled as primers indicate where the primers were designed to anneal to genomic DNA during the PCR reaction. b) Vector map of the FAD7/sGFP(S65T) biosensor represents the DNA that is found inside the T DNA borders of the pBI121 vector. The portion labeled sequenced area corresponds to the chromatograms in figure 3 2 c. c) Chromatograms that correspond with the labeled portion of the vector construct map d) Genomic FAD7 gene map, FAD7/GFP vector map, and sequence data. Raw sequence directly from the chromatograph. The sequence only re presents the promoter.

PAGE 82

74 a ATHFAD7COL 1084 bp CDS(FAD7) 1 3' primer 5' primer TATA Signal 1 Nco I (29) 121FAD7sGFP(S65T) 5253 bp NPT II sGFP(S65T) sequenced area Pnos -1084 FAD7 Tnos Tnos Ava I (1416) Cla I (3752) Eco RI (1004) Hin dIII (4165) Pst I (2234) Nco I (2613) Nco I (4198) b

PAGE 83

75 N G A A G C G A C C C N A A C C T T T T T N A G G A T G G G C A C C N G N C C G G N G A A C A G N T C C T C G C C C T T G C T C A C C A T T N T A N A C A T T 1600 0 N G A A G C G A C C C N A A C C T T T T T N A G G A T G G G C A C C N G N C C G G N G A A C A G N T C C T C G C C C T T G C T C A C C A T T N T A N A C A T T Fragment MANAK FAD/P T T T T C T T G A G C T C T C T C C C C A G A G T G A A A A G T C T C N C T T T C C N T T N T T T G G N G A G T T T C T G C N A T G A A T G A G T G G N G G 1600 0 T T T T C T T G A G C T C T C T C C C C A G A G T G A A A A G T C T C N C T T T C C N T T N T T T G G N G A G T T T C T G C N A T G A A T G A G T G G N G G Fragment MANAK FAD/P G T A A T A G A N A A A G A G A T A A N G T G T G N G A G A G A A A C T T G T G T T N T C T A C T T T G C T T A T C G T C T C T C A A T N T C T A T C T C T 1600 0 G T A A T A G A N A A A G A G A T A A N G T G T G N G A G A G A A A C T T G T G T T N T C T A C T T T G C T T A T C G T C T C T C A A T N T C T A T C T C T Fragment MANAK FAD/P T G T C T C T G G N T C G C A C G C T T A T G N C T T A T A T A A N T T A G C T A C A A C T T G A A A G G A G A A G G A A A T T T A T T A G C G A T G G C 1600 0 T G T C T C T G G N T C G C A C G C T T A T G N C T T A T A T A A N T T A G C T A C A A C T T G A A A G G A G A A G G A A A T T T A T T A G C G A T G G C Fragment MANAK FAD/P Figure 3 2 continued c C G T G A T G T G A G A T T T T T N T T T G T G A C G G T C A A T T T A N A C A C A A A G N T G N G G T T N C A A C A T G G G T N C N G A T T G A T C T C G T T 1600 0 C G T G A T G T G A G A T T T T T N T T T G T G A C G G T C A A T T T A N A C A C A A A G N T G N G G T T N C A A C A T G G G T N C N G A T T G A T C T C G T T Fragment MANAK FAD/P

PAGE 84

76 d NGAAGCGACCCNAACCTTTTTNAGGATGGGCACCNGNCCGGNGAACA GNTCCTCGCCCTTGCTCACCATTNTANACATTATTTTCTTGAGCTCTCTC CCCAGAGTGAAAAGTCTCNCTTTCCNTTNTTTGGNGAGTTTCTGCNATG AATGAGTGGNGGTAATAGANAAAGAGATAANGTGTGNGAGAGAAACT TGTG TTNTCTACTTTGCTTATCGTCTCTCAATNTCTATCTCTGTCTCTGG NTCGCACGCTTATGNCTTATATAANTTAGCTACAACTTGAAAGGAGAA GGAAATTTATTAGCGATGGCGTGATGTGAGATTTTTNTTTGTGACGGTC AATTTANACACAAAGNTGNGGTTNCAACATGGGTNCNGATTGATCTCG TTTTAATTCTTGTTTTGGC Figure 3 2 continued

PAGE 85

77 Figure 3 3. Genomic HSP18.2 Gene Map, HSP18. 2/GFP Vector Map, and Sequence Data. a) Map representing the promoter sequence of the HSP18.2 gene. The symbols labeled as primers indicate where the primers were designed to anneal to genomic DNA during the PCR reaction. b) Vector map of the HSP18.2/sGFP( S65T) biosensor represents the vector and cloned transgene. The portion labeled as sequenced area corresponds to the chromatogram in figure 3 3 c. c) Chromatograms that correspond with the labeled portion of the vector construct map. d) Raw sequence direct ly from the chromatograph. The green letters represent GFP sequence and the black letters represent promoter sequence.

PAGE 86

78 b ATHSP182 1398 bp CDS 1 Misc Feature 1 Misc Feature 2 Misc Feature 3 Misc Feature 4 Misc Feature 5 Misc Feature 6 Misc Feature 8 3' primer 5' primer Promoter E 1 Bam HI (751) Cla I (1143) Hin dIII (1206) Pst I (942) Pst I (1359) pCAMBIA1300sGFP(S65T)HSP18.210597 bp sGFP(S65T) sequenced area HSP18.2 promoter Tnos hptII (hygromycin resistance) gene 35S promoter right border left border ClaI (6491) EcoRI (1002) HindIII (9909) SacI (735) SmaI (2051) XbaI (10593) XmaI (2049) a

PAGE 87

79 C C G T C C A G C T C G A C C A G G A T G G G C A C C A C C C C G G T G A A C A G C T C C T C G C C C T T G C T C A C C A T T C T A G A G C T G A T T T G A T C T G A 1600 0 C C G T C C A G C T C G A C C A G G A T G G G C A C C A C C C C G G T G A A C A G C T C C T C G C C C T T G C T C A C C A T T C T A G A G C T G A T T T G A T C T G A Fragment MANAK HSP/P T T A G C A A A G G A C A T A T T T A T A G G G A A G T T A G A G G A T G A A G A G A G A A T G T T C T T C G A G T T T C T T G A A T A G A A T A G A A A A T 1600 0 T T A G C A A A G G A C A T A T T T A T A G G G A A G T T A G A G G A T G A A G A G A G A A T G T T C T T C G A G T T T C T T G A A T A G A A T A G A A A A T Fragment MANAK HSP/P G C T C C T T T T T C T A A A A C C T T C G C G T G G A G T C T T T A G A A C A C A T A C A C A A T G A T C A C T G T G G T G A A A T G A C C A G A T T T 1600 0 G C T C C T T T T T C T A A A A C C T T C G C G T G G A G T C T T T A G A A C A C A T A C A C A A T G A T C A C T G T G G T G A A A T G A C C A G A T T T Fragment MANAK HSP/P T T T C T T G G C A T T T C A G G A A G T T T C G T T T G T T G A A A C A A G A C C G A A A T G C A A T C C T T G G T T A C A A T T A A A A C T A C G T G C 1600 0 T T T C T T G G C A T T T C A G G A A G T T T C G T T T G T T G A A A C A A G A C C G A A A T G C A A T C C T T G G T T A C A A T T A A A A C T A C G T G C Fragment MANAK HSP/P G T G C C G T T T T G C T T T G T T G T T G T A T T A T C A T C T T C G A G A A A C G G G C T A A G T G A A G C G G A T C T T C T T T G C A A A A G C C C A 1600 0 G T G C C G T T T T G C T T T G T T G T T G T A T T A T C A T C T T C G A G A A A C G G G C T A A G T G A A G C G G A T C T T C T T T G C A A A A G C C C A Fragment MANAK HSP/P C A T T T C T T A A T A G G T C G G A A A T G G A A T T T A A G A A A A T C T A A C T C A G A G A A A A G A G G A C A A A A T C A A G A T T T A A G A T T A T 1600 0 C A T T T C T T A A T A G G T C G G A A A T G G A A T T T A A G A A A A T C T A A C T C A G A G A A A A G A G G A C A A A A T C A A G A T T T A A G A T T A T Fragment MANAK HSP/P Figure 3 3 continued c

PAGE 88

80 T T A G C T T T T C G C C A A A G G A A A A C T A T A G T A A G T T C T C G C A A T A A C A G T A G G C A C T A A A T T T C C G A G A A T G T C A A C A A T 1600 0 T T A G C T T T T C G C C A A A G G A A A A C T A T A G T A A G T T C T C G C A A T A A C A G T A G G C A C T A A A T T T C C G A G A A T G T C A A C A A T Fragment MANAK HSP/P A A T C T A T T A A T G G A T T T T T T T G T C T C C A T A T A T A C A A G A A C T G A A C C A C G T T T T T G G T G A C A A A C A T A G A C A A C A T A T T 1600 0 A A T C T A T T A A T G G A T T T T T T T G T C T C C A T A T A T A C A A G A A C T G A A C C A C G T T T T T G G T G A C A A A C A T A G A C A A C A T A T T Fragment MANAK HSP/P T T T A C T A A A C A A G T N A A C T A A A A A A A A A A A A A A T C T A A A T G A T T C G A T T C A A G T A T C A G T T A C T G N G A T C A A A A T C T 1600 0 T T T A C T A A A C A A G T N A A C T A A A A A A A A A A A A A A T C T A A A T G A T T C G A T T C A A G T A T C A G T T A C T G N G A T C A A A A T C T Fragment MANAK HSP/P T C A A C T T A T T T A T T G C C T G N T C A T G G T C A T G C T T N G A A C C C A G A A A G A A A A T G A C C A T T A A G C C T T G 1600 0 T C A A C T T A T T T A T T G C C T G N T C A T G G T C A T G C T T N G A A C C C A G A A A G A A A A T G A C C A T T A A G C C T T G G C A C T T G G C C C G T Fragment MANAK HSP/P Figure 3 3 continued

PAGE 89

81 d CCGTCCAGCTCGACCAGGATGGGCACCACCCCGGTGAACAGCTCCTCG CCCTTGCTCACCATTCTA GAGCTGATTTGATCTGAT TAGCAAAGGACA TATTTATAGGGAAGTTAGAGGATGAAGAGAGAATGTTCTTCGAGTTTC TTGAATAGAATAGAAAATGCTCCTTTTTCTAAAACCTTCGCGTGGAGT CTTTAGAACACATACACAATGATCACTGTGGTGAAATGACCAGATTTT TCTTGGCATTTCAGGAAGTTTCGTTTGTTGAAACAAGACCGAAATGCA ATCCTTGGTTACAATTAAAACTACGTGCCGTTTTGCTTTGTTGTTGTAT TAT CATCTTCGAGAAACGGGCTAAGTGAAGCGGATCTTCTTTGCAAAA GCCCATTTCTTAATAGGTCGGAAATGGAATTTAAGAAAATCTAACTCA GAGAAAAGAGGACAAAATCAAGATTTAAGATTATTAGCTTTTCGCCAA AGGAAAACTATAGTAAGTTCTCGCAATAACAGTAGGCACTAAATTTCC GAGAATGTCAACAATCTATTAATGGATTTTTTTGTCTCCATATATACAA GAACTGAACCACGTTTTT GGTGACAAACATAGACAACATATTTACTAA ACAAGTNAACTAAAAAAAAAAAAAATCTAAATGATTCGATTCAAGTA TCAGTTACTGNGATCAAAATCTCAACTTATTTATTGCCTGNTCATGGTC ATGCTTNGAACCCAGAAAGAAAATGACCATTAAGCCTTG Figure 3 3 continued

PAGE 90

82 Figure 3 4. One Per cent Agarose Gel Showing Promoters Amplified from Genomic DNA by PCR. Lane 1 ARG promoter Lane 2 SAUR AC1 promoter Lane 3 NR1 promoter Lane 4 RD29A promoter Lane 5 ChiB promoter Lane 6 FAD7 promoter Lane 7 GSH2 promoter Lane 8 PDF1.2 promoter 1 2 3 4 5 Kb ladder 6 7 8 Kb ladder

PAGE 91

83 Figure 3 5. pCAMBIA Positive Control Vector Map and Sequence Data. a) Vector map of the CaMV 35S/sGFP(S65T) positive control biosensor (pCAMBIA vectors) represents the vector and cloned transgene. The portion labeled as sequenced area corresponds to the chromatogram i n figure 3 5 b. The pCAMBIA 1300 vector was engineered to contain the CaMV 35S promoter sGFP(S65T) reporter gene NosT terminator sequence from the pBI121sGFP(S65T) vector in figure 2 1 a. b) Chromatograms that correspond with the labeled portion of the vec tor construct map. c) Raw sequence directly from the chromatograph. The green letters represent GFP sequence and the black letters represent promoter sequence.

PAGE 92

84 pCAMBIA1300CaMV35SsGFP(S65T) 10751 bp sGFP(S65T) sequenced area Tnos hptII (hygromycin resistance) gene 35S promoter 35S promoter right border left border Cla I (5490) Eco RI (1) Hin dIII (8908) Nco I (9212) Pst I (8924) Sma I (1050) Xma I (1048) Xba I (9750) Sac I (10485) T T C G G T C G C C G T C C A G C T C G A C C A G G A T G G G C A C C A C C C C G G T G A A C A G C T C C T C G C C C T T G C T C A C C A T T C T A G A G T C C C C C 1600 0 T T C G G T C G C C G T C C A G C T C G A C C A G G A T G G G C A C C A C C C C G G T G A A C A G C T C C T C G C C C T T G C T C A C C A T T C T A G A G T C C C C C Fragment MANAK 3GN/P C G T G T T C T C T C C A A A T G A A A T G A A C T T C C T T A T A T A G A G G A A G G G T C T T G C G A A G G A T A G T G G G A T T G T G C G T C A T C C C 1600 0 C G T G T T C T C T C C A A A T G A A A T G A A C T T C C T T A T A T A G A G G A A G G G T C T T G C G A A G G A T A G T G G G A T T G T G C G T C A T C C C Fragment MANAK 3GN/P a b

PAGE 93

85 C C C T T A C G T C A G T G G A G A T A T C A C A T C A A T C C A C T T G C T T T G A A G A C G T G G T T G G A A C G T C T T C T T T T T C C A C G A T G 1600 0 C C C T T A C G T C A G T G G A G A T A T C A C A T C A A T C C A C T T G C T T T G A A G A C G T G G T T G G A A C G T C T T C T T T T T C C A C G A T G Fragment MANAK 3GN/P T G C T C C T C G T G G G T G G G G G T C C A T C T T T G G G A C C A C T G T C G G C A G A G G C A T C T T C A A C G A T G G C C T T T C C T T T A T C G 1600 0 T G C T C C T C G T G G G T G G G G G T C C A T C T T T G G G A C C A C T G T C G G C A G A G G C A T C T T C A A C G A T G G C C T T T C C T T T A T C G Fragment MANAK 3GN/P G C A A T G A T G G C A T T T G T A G G A G C C A C C T T C C T T T T C C A C T A T C T T C A C A A T A A A G T G A C A G A T A G C T G G G C A A T G G A 1600 0 G C A A T G A T G G C A T T T G T A G G A G C C A C C T T C C T T T T C C A C T A T C T T C A C A A T A A A G T G A C A G A T A G C T G G G C A A T G G A Fragment MANAK 3GN/P A A T C C G A G G A G G T T T C C G G A T A T T A C C C T T T G T T G A A A A G T C T C A A T T G C C C T T T G G T C T T C T G A G A C T G T A T C T T T G 1600 0 A A T C C G A G G A G G T T T C C G G A T A T T A C C C T T T G T T G A A A A G T C T C A A T T G C C C T T T G G T C T T C T G A G A C T G T A T C T T T G Fragment MANAK 3GN/P Figure 3 5 continued

PAGE 94

86 G A T A T T T T T G G A G T A G A C A A G T G T G T C G T G C T C C A C C A T G T T G A C G A A G A T T T T C T T C T T G T C A T T G A G T C G T A A G A G 1600 0 G A T A T T T T T G G A G T A G A C A A G T G T G T C G T G C T C C A C C A T G T T G A C G A A G A T T T T C T T C T T G T C A T T G A G T C G T A A G A G Fragment MANAK 3GN/P G A C T C T G T A T G A A C T G T T C G C C A G T C T T T A C G G C G A G T T C T T G T T A G G T C C T C T A T T T G A A T C T T T G A C T C C A T G G C C T 1600 0 G A C T C T G T A T G A A C T G T T C G C C A G T C T T T A C G G C G A G T T C T T G T T A G G T C C T C T A T T T G A A T C T T T G A C T C C A T G G C C T Fragment MANAK 3GN/P Figure 3 5 continued T T T G A T T C A A G T G G G A A C T A C C T T T T T T A G A G A C T C C A A T C T C T A T T A C T T G C C C T T G G T T T G G G A A N C A A G C C T T G A A T C G 1600 0 T T T G A T T C A A G T G G G A A C T A C C T T T T T T A G A G A C T C C A A T C T C T A T T A C T T G C C C T T G G T T T G G G A A N C A A G C C T T G A A T C G Fragment MANAK 3GN/P T C G T C C A T T A C T G G A A N A G T A C T T C T G A T 1600 0 T C G T C C A T T A C T G G A A N A G T A C T T C T G A T C T T T G A N A A A N A A A T C T T T C T C T G N G C T C C T T G G A N G C A A N N A A G N C C T G G A A N C Fragment MANAK 3GN/P

PAGE 95

87 c TTCGGTCGCCGTCCAGCTCGACCAGGATGGGCACCACCCCGGT GAACA GCTCCTCGCCCTTGCTCACCATTCTAG AGTCCCCCGTGTTCTCTCCAAA TGAAATGAACTTCCTTATATAGAGGAAGGGTCTTGCGAAGGATAGTGG GATTGTGCGTCATCCCTTACGTCAGTGGAGATATCACATCAATCCACTT GCTTTGAAGACGTGGTTGGAACGTCTTCTTTTTCCACGATGCTCCTCGT GGGTGGGGGTCCATCTTTGGGACCACTGTCGGCAGAGGCATCTTCAAC GATGGCCT TTCCTTTATCGCAATGATGGCATTTGTAGGAGCCACCTTCC TTTTCCACTATCTTCACAATAAAGTGACAGATAGCTGGGCAATGGAAT CCGAGGAGGTTTCCGGATATTACCCTTTGTTGAAAAGTCTCAATTGCC CTTTGGTCTTCTGAGACTGTATCTTTGATATTTTTGGAGTAGACAAGTG TGTCGTGCTCCACCATGTTGACGAAGATTTTCTTCTTGTCATTGAGTCG TAAGAGACTCTGTATGAACTG TTCGCCAGTCTTTACGGCGAGTTCTTGT TAGGTCCTCTATTTGAATCTTTGACTCCATGGCCTTTGATTCAAGTGGG AACTACCTTTTTTAGAGACTCCAATCTCTATTACTTGCCCTTGGTTTGG GAANCAAGCCTTGAATCGTCCATTACTGGAANAGTACTTCTGAT

PAGE 96

88 Figure 3 6. Original Positive Control Plant vs. Ultrabright Positive Control Plant s. a) Original positive control containing the CaMV35S/sGFP(S65T) transgene. Although, the Arabidopsis lines were screened over four generations, a consistent positive control was not produced. b) "Ultrabright" positive control containing the CaMV35S(S65T) transgene. The need for a consistent positive control prompted the retransformation and rescreening of Arabidopsis lines to produce the current version shown above. a b

PAGE 97

89 LIST OF REFERENCES Baulcombe DC, Chapman S, Santa Cruz S (1995) Jel lyfish green fluorescent protein as a reporter for virus infections. Plant J 7: 1045 1053 Bechtold N, Pelletier G (1998) In planta Agrobacterium mediated transformation of adult Arabidopsis thaliana plants by vacuum infiltration. Methods Mol Biol 82: 259 266 Bevan M, Barnes WM, Chilton MD (1983) Structure and transcription of the nopaline synthase gene region of T DNA. Nucleic Acids Res 11: 369 385. Bevan MW, Flavell RB, Chilton MD (1992) A chimaeric antibiotic resistance gene as a selectable marker for plant cell transformation. 1983. Biotechnology 24: 367 370 Bomhoff G, Klapwijk PM, Kester HC, Schilperoort RA, Hernalsteens JP, Schell J (1976) Octopine and nopaline synthesis and breakdown genetically controlled by a plasmid of Agrobacterium tumefaciens. Mol Gen Genet 145: 177 181. Campbell P, Braam J (1999) In vitro activities of four xyloglucan endotransglycosylases from Arabidopsis. Plant J 18: 371 382 Chen W, Singh KB (1999) The auxin, hydrogen peroxide and salicylic acid induced expression of the A rabidopsis GST6 promoter is mediated in part by an ocs element. Plant J 19: 667 677 Cheng CL, Acedo GN, Cristinsin M, Conkling MA (1992) Sucrose mimics the light induction of Arabidopsis nitrate reductase gene transcription. Proc Natl Acad Sci U S A 89: 1 861 1864. Chilton MD, Drummond MH, Merio DJ, Sciaky D, Montoya AL, Gordon MP, Nester EW (1977) Stable incorporation of plasmid DNA into higher plant cells: the molecular basis of crown gall tumorigenesis. Cell 11: 263 271. Chung HJ, Ferl RJ (1999) Arabid opsis alcohol dehydrogenase expression in both shoots and roots is conditioned by root growth environment. Plant Physiol 121: 429 436

PAGE 98

90 Chung SK, Parish RW (1995) Studies on the promoter of the Arabidopsis thaliana cdc2a gene. FEBS Lett 362: 215 219 Clark BC (1979) Chemical and physical microenvironments at the Viking landing sites. J Mol Evol 14: 13 31. Cowles J, LeMay R, Jahns G (1994) Seedling growth and development on space shuttle. Adv Space Res 14: 3 12. Crameri A, Whitehorn EA, Tate E, Stemmer WP ( 1996) Improved green fluorescent protein by molecular evolution using DNA shuffling. Nat Biotechnol 14: 315 319. Cubitt AB, Heim R, Adams SR, Boyd AE, Gross LA, Tsien RY (1995) Understanding, improving and using green fluorescent proteins. Trends Biochem Sci 20: 448 455. de Bruxelles GL, Peacock WJ, Dennis ES, Dolferus R (1996) Abscisic acid induces the alcohol dehydrogenase gene in Arabidopsis. Plant Physiol 111: 381 391 De Greve H, Dhaese P, Seurinck J, Lemmers M, Van Montagu M, Schell J (1983) Nucleot ide Sequence and Transcript Map of the Agrobacreium tumifaciens Ti Plasmid Encoded Octopine Synthase Gene. Journal of Molecular and Applied Genetics 1: 499 511 Dolferus R, Jacobs M, Peacock WJ, Dennis ES (1994) Differential interactions of promoter elemen ts in stress responses of the Arabidopsis Adh gene. Plant Physiol 105: 1075 1087 Dreschel TW, Brown CS, Piastuch WC, Hinkle CR, Knott WM (1994) Porous Tube Plant Nutrient Delivery System development: a device for nutrient delivery in microgravity. Adv Spa ce Res 14: 47 51. Fraley RT, Rogers SG, Horsch RB, Sanders PR, Flick JS, Adams SP, Bittner ML, Brand LA, Fink CL, Fry JS, Galluppi GR, Goldberg SB, Hoffmann NL, Woo SC (1983) Expression of bacterial genes in plant cells. Proc Natl Acad Sci U S A 80: 4803 4807.

PAGE 99

91 Gil P, Green PJ (1996) Multiple regions of the Arabidopsis SAUR AC1 gene control transcript abundance: the 3' untranslated region functions as an mRNA instability determinant. Embo J 15: 1678 1686 Gil P, Green PJ (1997) Regulatory activity exerted by the SAUR AC1 promoter region in transgenic plants. Plant Mol Biol 34: 803 808 Gil P, Liu Y, Orbovic V, Verkamp E, Poff KL, Green PJ (1994) Characterization of the auxin inducible SAUR AC1 gene for use as a molecular genetic tool in Arabidopsis. Plant P hysiol 104: 777 784 Grebenok RJ, Pierson E, Lambert GM, Gong FC, Afonso CL, Haldeman Cahill R, Carrington JC, Galbraith DW (1997) Green fluorescent protein fusions for efficient characterization of nuclear targeting. Plant J 11: 573 586. Haas J, Park EC, Seed B (1996) Codon usage limitation in the expression of HIV 1 envelope glycoprotein. Curr Biol 6: 315 324 Haseloff J, Amos B (1995) GFP in plants [published erratum appears in Trends Genet 1995 Sep;11(9):374]. Trends Genet 11: 328 329 Haseloff J, Siem ering KR, Prasher DC, Hodge S (1997) Removal of a cryptic intron and subcellular localization of green fluorescent protein are required to mark transgenic Arabidopsis plants brightly. Proc Natl Acad Sci U S A 94: 2122 2127. Heim R, Cubitt AB, Tsien RY (19 95) Improved green fluorescence. Nature 373: 663 664. Heim R, Prasher DC, Tsien RY (1994) Wavelength mutations and posttranslational autoxidation of green fluorescent protein. Proc Natl Acad Sci U S A 91: 12501 12504. Heim R, Tsien RY (1996) Engineering green fluorescent protein for improved brightness, longer wavelengths and fluorescence resonance energy transfer. Curr Biol 6: 178 182. Helmer G, Casadaban M, Bevan M, Kayes L, Chilton MD (1984) A New Chimeric Gene as a Marker for Plant Transformation: Th e Expression of Escherichia coli B Galactosidase in Sunflower and Tobacco Cells. Biotechnology 16 : 520 527

PAGE 100

92 Hernalsteens JP, Van Vliet F, De Beuckeleer M, Depicker A, Engler G, Lemmers M, Holsters M, Van Montagu M, Schell J (1992) The Agrobacterium tumefac iens Ti plasmid as a host vector system for introducing foreign DNA in plant cells. 1980. Biotechnology 24: 374 376 Herrera Estrella L, De Block M, Messens E, Hernalsteens J P, Van Montagu M, Schell J (1983) Chimeric genes as dominant selectable markers i n plant cells. EMBO 2: 987 995 Herrera Estrella L, Depicker A, Van Montagu M, Schell J (1992) Expression of chimaeric genes transferred into plant cells using a Ti plasmid derived vector. 1983. Biotechnology 24: 377 381 Hu W, Cheng CL (1995) Expression o f Aequorea green fluorescent protein in plant cells. FEBS Lett 369: 331 334 Jefferson RA (1987) Assaying chimeric genes in plants: the GUS gene fusion system. Plant Mol. Biol. Rep. 5: 387 405 Jefferson RA, Kavanagh TA, Bevan MW (1987) GUS fusions: beta g lucuronidase as a sensitive and versatile gene fusion marker in higher plants. Embo J 6: 3901 3907 Kohler RH, Cao J, Zipfel WR, Webb WW, Hanson MR (1997) Exchange of protein molecules through connections between higher plant plastids. Science 276: 2039 20 42. Lam E, Benfey PN, Gilmartin PM, Fang RX, Chua NH (1989) Site specific mutations alter in vitro factor binding and change promoter expression pattern in transgenic plants. Proc Natl Acad Sci U S A 86: 7890 7894 Leffel SM, Mabon SA, Stewart Jr. CN. (19 97) Applications of green fluorescent protein in plants. Biotechniques 23: 912 918. Lin Y, Hwang CF, Brown JB, Cheng CL (1994) 5' proximal regions of Arabidopsis nitrate reductase genes direct nitrate induced transcription in transgenic tobacco. Plant Phy siol 106: 477 484.

PAGE 101

93 Lu JL, Ertl JR, Chen CM (1990) Cytokinin enhancement of the light induction of nitrate reductase transcript levels in etiolated barley leaves. Plant Mol Biol 14: 585 594. Manners JM, Penninckx IA, Vermaere K, Kazan K, Brown RL, Morgan A, Maclean DJ, Curtis MD, Cammue BP, Broekaert WF (1998) The promoter of the plant defensin gene PDF1.2 from Arabidopsis is systemically activated by fungal pathogens and responds to methyl jasmonate but not to salicylic acid. Plant Mol Biol 38: 1071 1080 Margulis L, Mazur P, Barghoorn ES, Halvorson HO, Jukes TH, Kaplan IR (1979) The Viking Mission: implications for life on Mars. J Mol Evol 14: 223 232. Matz MV, Fradkov AF, Labas YA, Savitsky AP, Zaraisky AG, Markelov ML, Lukyanov SA (1999) Fluorescent pr oteins from nonbioluminescent Anthozoa species. Nat Biotechnol 17: 969 973. McKendree WL, Jr., Ferl RJ (1992) Functional elements of the Arabidopsis Adh promoter include the G box. Plant Mol Biol 19: 859 862 Muller Hill B, Kania J (1974) Lac repressor ca n be fused to beta galactosidase. Nature 249: 561 563. Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue culture. Physiol. Plant. 15: 473 479 Nakashima K, Shinwari ZK, Sakuma Y, Seki M, Miura S, Shinozaki K, Yamaguchi Shinozaki K (2000) Organization and expression of two Arabidopsis DREB2 genes encoding DRE binding proteins involved in dehydration and high salinity responsive gene expression. Plant Mol Biol 42: 657 665. Nishiuchi T, Kodama H, Yanagisawa S, I ba K (1999) Wound induced expression of the FAD7 gene is mediated by different regulatory domains of its promoter in leaves/stems and roots. Plant Physiol 121: 1239 1246 Oparka K, Roberts A, Santa Cruz S, Boevink P, Prior D, Smallcombe A (1997) Using GFP to study virus invasion and spread in plant tissues. Nature 388: 401 402

PAGE 102

94 Ow DW, Wood KV, DeLuca M, De Wet JR, Helinski DR, Howell SH. (1986) Transient and Stable expression of the Firefly Luciferase Gene in Plant Cells and Transgenic Plants. Science 234: 856 859 Oyama VI, Berdahl BJ (1979) A model of Martian surface chemistry. J Mol Evol 14: 199 210. Park SH, Raines RT (1997) Green fluorescent protein as a signal for protein protein interactions. Protein Sci 6: 2344 2349. Paul AL, Ferl RJ (1998) Permeab ilized Arabidopsis protoplasts provide new insight into the chromatin structure of plant alcohol dehydrogenase genes. Dev Genet 22: 7 16 Paul A L, Daugherty CJ, Bihn EA, Chapman D, Norwood K, Ferl RJ (2001) Transgene Expression Patterns Indicate that Spac eflight Affects Stress Signal Percerption and Transduction in Arabidopsis. Plant Physiol 126: 613 621 Paul A L, Semer C, Kucharek T, Ferl RJ (2001) The fungicidal and phytotoxic properties of benomyl and PPM in supplemented agar media supporting transgeni c arabidopsis plants for a Space Shuttle flight experiment. Appl Microbiol Biotechnol 55: 480 485 Porterfield DM, Matthews SW, Daugherty CJ, Musgrave ME (1997) Spaceflight exposure effects on transcription, activity, and localization of alcohol dehydrogen ase in the roots of Arabidopsis thaliana. Plant Physiol 113: 685 693 Prasher DC (1995) Using GFP to see the light. Trends Genet 11: 320 323 Presley JF, Cole NB, Schroer TA, Hirschberg K, Zaal KJ, Lippincott Schwartz J (1997) ER to Golgi transport visuali zed in living cells. Nature 389: 81 85. Rayle DL, Evans ML, Hertel R (1970) Action of auxin on cell elongation. Proc Natl Acad Sci U S A 65: 184 191. Reiss B, Sprengel R, Will H, Schaller H (1984) A new sensitive method for qualitative and quantitative a ssay of neomycin phosphotransferase in crude cell extracts. Gene 30: 211 217.

PAGE 103

95 Reymond P, Farmer EE (1998) Jasmonate and salicylate as global signals for defense gene expression. Curr Opin Plant Biol 1: 404 411. Rieder R, Economou T, Wanke H, Turkevich A, Crisp J, Bruckner J, Dreibus G, McSween Jr HY. (1997) The chemical composition of Martian soil and rocks returned by the mobile alpha proton X ray spectrometer: preliminary results from the X ray mode. Science 278: 1771 1774. Riggs CD, Chrispeels MJ (198 7) Luciferase reporter gene cassettes for plant gene expression studies. Nucleic Acids Res 15: 8115. Rouwendal GJ, Mendes O, Wolbert EJ, Douwe de Boer A (1997) Enhanced expression in tobacco of the gene encoding green fluorescent protein by modification o f its codon usage. Plant Mol Biol 33: 989 999. Samac DA, Hironaka CM, Yallaly PE, Shah DM (1990) Isolation and Characterization of the Genes Encoding Basic and Acidic Chitinase in Arabidopsis thaliana. Plant Physiol 93: 907 914 Sedbrook JC, Chen R, Masso n PH (1999) ARG1 (altered response to gravity) encodes a DnaJ like protein that potentially interacts with the cytoskeleton. Proc Natl Acad Sci U S A 96: 1140 1145 Sheen J, Hwang S, Niwa Y, Kobayashi H, Galbraith DW (1995) Green fluorescent protein as a n ew vital marker in plant cells. Plant J 8: 777 784 Siemering KR, Golbik R, Sever R, Haseloff J (1996) Mutations that suppress the thermosensitivity of green fluorescent protein. Curr Biol 6: 1653 1663. Stintzi A, Heitz T, Prasad V, Wiedemann Merdinoglu S Kauffmann S, Geoffroy P, Legrand M, Fritig B (1993) Plant 'pathogenesis related' proteins and their role in defense against pathogens. Biochimie 75: 687 706 Storozhenko S, De Pauw P, Van Montagu M, Inze D, Kushnir S (1998) The heat shock element is a fu nctional component of the Arabidopsis APX1 gene promoter. Plant Physiol 118: 1005 1014 Takahashi T, Komeda Y (1989) Characterization of two genes encoding small heat shock proteins in Arabidopsis thaliana. Mol Gen Genet 219: 365 372

PAGE 104

96 Wang CL, Oliver DJ (1 996) Cloning of the cDNA and genomic clones for glutathione synthetase from Arabidopsis thaliana and complementation of a gsh2 mutant in fission yeast. Plant Mol Biol 31: 1093 1104 Wang S, Hazelrigg T (1994) Implications for bcd mRNA localization from spa tial distribution of exu protein in Drosophila oogenesis. Nature 369: 400 403. Williams LE, Pittman JK, Hall JL (2000) Emerging mechanisms for heavy metal transport in plants. Biochim Biophys Acta 1465: 104 126 Yamaguchi Shinozaki K, Shinozaki K (1993) C haracterization of the expression of a desiccation responsive rd29 gene of Arabidopsis thaliana and analysis of its promoter in transgenic plants. Mol Gen Genet 236: 331 340 Yang TT, Cheng L, Kain SR (1996) Optimized codon usage and chromophore mutations provide enhanced sensitivity with the green fluorescent protein. Nucleic Acids Res 24: 4592 4593. Zill LP, Mack R, DeVincenzi DL (1979) Mars ultraviolet simulation facility. J Mol Evol 14: 79 89.

PAGE 105

97 BIOGRAPHICAL SKETCH Michael S. Manak has a BS degree in Microbiology and Cell Science from the University of Florida. He is currently pursuing a degree in Plant Molecular and Cellular Biology at the University of Florida. His current research has focused on developing transgenic arabidopsis lines for studying plant physiology in responses to exposure to extraterrestrial environments.


Permanent Link: http://ufdc.ufl.edu/UFE0000332/00001

Material Information

Title: Transgenic arabidopsis ADH/GFP reporter gene produced for studying space biology telemetrically
Physical Description: Mixed Material
Language: English
Creator: Manak, Michael S. ( Dissertant )
Ferl, Robert ( Thesis advisor )
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Copyright Date: 2008

Subjects

Subjects / Keywords: Horticultural Science thesis, M.S
Dissertations, Academic -- UF -- Horticulture

Notes

Abstract: Transgenic arabidopsis plants containing the alcohol dehydrogenase (Adh) gene promoter fused to the Green Fluorescent Protein (GFP) reporter gene were developed as biological sensors for monitoring physiological responses to unique environments. Plants were monitored in vivo during exposure to hypoxia, high salt, cold, and ABA (abcissic acid) in experiments designed to characterize the utility and responses of the Adh/GFP biosensors. Plants in the presence of environmental stimuli that induced the Adh promoter responded by expressing GFP, which in turn generated a detectable fluorescent signal. The GFP signal degraded when the inducing stimulus was removed. Digital imaging of the Adh/GFP plants exposed to each of the exogenous stresses demonstrated that the stress-induced gene expression could be followed in real-time. The experimental results established the feasibility of using a digital monitoring system, such as the TAGES (Transgenic Arabidopsis Gene Expression System) camera developed by a NASA subcontracted engineering firm (Bionetics) for collecting gene expression data in real-time from a network of biosensor plants during space exploration experiments.
Subject: transgenic, arabidopsis, GFP, Mars, space biology, astrobiology
General Note: Title from title page of source document.
General Note: Document formatted into pages; contains viii, 97 p.; also contains graphics.
General Note: Includes vita.
Thesis: Thesis (M.S.)--University of Florida, 2001.
Bibliography: Includes bibliographical references.

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0000332:00001

Permanent Link: http://ufdc.ufl.edu/UFE0000332/00001

Material Information

Title: Transgenic arabidopsis ADH/GFP reporter gene produced for studying space biology telemetrically
Physical Description: Mixed Material
Language: English
Creator: Manak, Michael S. ( Dissertant )
Ferl, Robert ( Thesis advisor )
Publisher: University of Florida
Place of Publication: Gainesville, Fla.
Copyright Date: 2008

Subjects

Subjects / Keywords: Horticultural Science thesis, M.S
Dissertations, Academic -- UF -- Horticulture

Notes

Abstract: Transgenic arabidopsis plants containing the alcohol dehydrogenase (Adh) gene promoter fused to the Green Fluorescent Protein (GFP) reporter gene were developed as biological sensors for monitoring physiological responses to unique environments. Plants were monitored in vivo during exposure to hypoxia, high salt, cold, and ABA (abcissic acid) in experiments designed to characterize the utility and responses of the Adh/GFP biosensors. Plants in the presence of environmental stimuli that induced the Adh promoter responded by expressing GFP, which in turn generated a detectable fluorescent signal. The GFP signal degraded when the inducing stimulus was removed. Digital imaging of the Adh/GFP plants exposed to each of the exogenous stresses demonstrated that the stress-induced gene expression could be followed in real-time. The experimental results established the feasibility of using a digital monitoring system, such as the TAGES (Transgenic Arabidopsis Gene Expression System) camera developed by a NASA subcontracted engineering firm (Bionetics) for collecting gene expression data in real-time from a network of biosensor plants during space exploration experiments.
Subject: transgenic, arabidopsis, GFP, Mars, space biology, astrobiology
General Note: Title from title page of source document.
General Note: Document formatted into pages; contains viii, 97 p.; also contains graphics.
General Note: Includes vita.
Thesis: Thesis (M.S.)--University of Florida, 2001.
Bibliography: Includes bibliographical references.

Record Information

Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
System ID: UFE0000332:00001

Full Text












TRANSGENIC ARABIDOPSIS ADH/GFP REPORTER GENE PRODUCED FOR
STUDYING SPACE BIOLOGY TELEMETRICALLY















By

MICHAEL S. MANAK


A THESIS PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE

UNIVERSITY OF FLORIDA


2001





























Copyright 2001

by

Michael Scott Manak


























This thesis is dedicated to all teachers of the past, present, and future who give a little
piece of their heart to all whom they teach.















ACKNOWLEDGMENTS

I would like to take this opportunity to thank my fiancee Jenn Conklin for her

unending support and inspiration that is beyond words. I thank all my friends for

believing in me. I am also thankful to all my family for their help and guidance.

I thank Dr. Steve Sargent for helping me get started in Horticultural research. I

also thank Dr. Kenneth B. Wagener for the opportunity to work in a state-of-the-art

research laboratory where I gained invaluable experience.

I thank my fellow graduate lab mates Dr. Carla Linebarger, Justin DeLille, and

Matt Reyes for all their support both professionally and personally. I thank my senior lab

mates Dr. Paul Shenke for teaching me an enormous amount about molecular biology,

Beth Laughner for advising and taking care of the lab and all the lab members, Dr. Anna-

Lisa Paul for teaching me something new on a continuous basis, as well as for being on

my committee.

I also want to thank Dr. Bill Gurley for being on my committee and teaching me

how to extract meaning from experimental results. I thank all the PMCB professors for

their hard work. Without their efforts and determination, the building where I conducted

research would not exist.

I thank Dr. Robert Ferl for giving me the opportunity to work in his lab. It was a

privilege and a pleasure. Rob is an excellent mentor because he gives you the opportunity

to grow and make as much out of your graduate experience as possible while guiding you

with insightful wisdom.
















TABLE OF CONTENTS

Page
A C K N O W L E D G M E N T S ....................................................................... .....................iv

A B S T R A C T ...................................... ................................................... v ii

CHAPTER

1 INTRODUCTORY REVIEW OF REPORTER GENES .............. ...............1

In tro d u ctio n ...................................... ...................................... ............... 1
R ep orter G en e R ev iew ............................................................ .................................. 3
R ole of A grobacterium .......................................................... ......... .. ................. 4
Neomycin Phosphotransferase, Chloramphenicol Acetyltransferase, and Octopine
S y n th a se ............................................................... .......... ...... 5
3-G alactosidase ................................. .............................................. 5
Luciferase ............. ......... ........ ....... .................. 6
3-Glucuronidase ............... ........... .... ................. 6
G reen F lu orescent P rotein .............................................. ....................................... 7
C o n clu sio n ................................ ................................................................... . 8

2 STUDY OF ARABIDOPSIS PHYSIOLOGY USING AN ADH/GFP BIOSENSOR
TO COLLECT DATA VIA TELEMETRIC SIMULATION .............. .....................10

Introduction ............... ........... .......................... ............................ 10
R results ............. ....................... .............. .............. 12
Experimental Controls ................ ...................................... ...... ............ .. 12
F lo o d in g .......................................................................... 1 3
C controlled A tm sphere ........... ........................................................ .............. 14
A bcissic A cid Treatm ent ........................................................................ 15
Cold Treatm ent ......................................... 15
H ig h S alt T reatm ent ................................................................................... .. 16
D iscu ssion .............................. ............... ..... 16
M materials and M ethods................... ....... ...... .............. ... ............... ....... .................. 18
C on structs ............... .......... ......... ..................... ................... 18
Arabidopsis Transformation and Isolation of Transgenic Lines........................... 19
M icro scopy ............................................................................................ 2 0
Experim ental Growth Conditions ........................................ .... .............. 20









3 NETWORK OF BIOSENSORS FOR STUDYING ARABIDOPSIS PHYSIOLOGY
IN EXRATERRESTRIAL ENVIRONMENTS ...........................................................56

In tro d u ctio n ......................................................... ............... 5 6
R results and D discussion ................................................ ....... .. .......... .. 56
A scorbate Peroxidase .............. ................................ .. ...... ... .......... 56
Alter Response to Gravity........................... ... ............... ................. .............. 58
Chitinase B.......................................... .............. 58
Dehydration-Responsive Element 2A.............................................. .............. 59
R response to D esiccation 29A ................................................................................... 60
Plastidal co-3 Fatty Acid Desaturase .............. ...... ......................... ........... 60
Plant Defensin 1.2 ....................... ...... ............. .......... ........... 61
Glutathione S-Transferase 6.......................................................... 61
Sm all-Auxin-Up-RN A-A C1 ....................... ............................... ............ .............. 62
G lutathion e Sy nth etase 2 .......................................................................................... 63
H eat-S h o ck P rotein 18 .2 ........................................................................................... 6 3
N itrate R eductase 1 .... .............................. ................................ .............. 64
T o u c h 4 ................................................................... 6 5
C o n clu sio n ....................................65.............................
M materials and M ethod s............................................... ............................................. 66
C losing Strategy .... .................. ................................... ............. 66
A additional Positive C controls ....................... ............................... ............ .............. 66

L IST O F R E FE R E N C E S ......................................................................... ....................89

B IO G R A PH IC A L SK E TCH ..................................................................... ..................97














Abstract of Thesis Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Master of Science

TRANSGENIC ARABIDOPSIS ADH/GFP REPORTER GENE PRODUCED FOR
STUDYING SPACE BIOLOGY TELEMETRICALLY


By

Michael Scott Manak

December 2001

Chairman: Robert J. Ferl
Major Department: Horticultural Science

Transgenic arabidopsis plants containing the alcohol dehydrogenase (Adh) gene

promoter fused to the Green Fluorescent Protein (GFP) reporter gene were developed as

biological sensors for monitoring physiological responses to unique environments. Plants

were monitored in vivo during exposure to hypoxia, high salt, cold, and ABA (abcissic

acid) in experiments designed to characterize the utility and responses of the Adh/GFP

biosensors. Plants in the presence of environmental stimuli that induced the Adh

promoter responded by expressing GFP, which in turn generated a detectable fluorescent

signal. The GFP signal degraded when the inducing stimulus was removed. Digital

imaging of the Adh/GFP plants exposed to each of the exogenous stresses demonstrated

that the stress-induced gene expression could be followed in real-time. The experimental

results established the feasibility of using a digital monitoring system, such as the

TAGES (Transgenic Arabidopsis Gene Expression System) camera developed by a









NASA subcontracted engineering firm (Bionetics) for collecting gene expression data in

real-time from a network of biosensor plants during space exploration experiments.














CHAPTER 1
INTRODUCTORY REVIEW OF REPORTER GENES

Introduction

Studying the physiological responses of Arabidopsis (Arabidopsis thaliana) to

extraterrestrial environments required the development of a system or biosensor that

could produce data about multiple environmental stimuli and provide a means to collect

data telemetrically. A reporter gene fused to a promoter provides data about plant

physiological responses to multiple environmental stimuli. Green fluorescent protein

(GFP) from the jellyfish Aequorea aequorea and dsred (Discosoma red) from Discosoma,

an Indiopacific relative of sea anemones and corals (Matz et al., 1999) are the only

reporter genes currently available for studying promoters in vivo and under real time

conditions. Both GFP and dsred produce signals that can be collected telemetrically. The

dsred reporter gene is unsuitable for studying plants, since chlorophyll autofluorescents in

the red light spectrum and is difficult to distinguish from the reporter gene signal. GFP is

the most suitable gene for studying promoter activity in arabidopsis during exposure to

non-earth environments.

Wildtype GFP has been modified as a reporter gene in order to investigate low-

level promoter activity in plants. Wildtype GFP has a cryptic intron that must be masked

in order to produce a functional protein in plants (Haseloff and Amos, 1995).

Modifications improving the overall signal of GFP include producing a synthetic version

using codons for optimal eukayotic translation and mutating the chromophore by

changing the sixty-fifth amino acid from serine to threonine (S65T) (Heim and Tsien,









1996). The combined modifications to wildtype GFP produce a protein (sGFP(S65T))

capable of generating a signal 100 fold stronger than wildtype GFP (Sheen et al., 1995).

Although sGFP(S65T) is an ideal reporter gene for a real-time biosensor, GFP is only one

of several reporter genes that have been utilized to study plants.

Reporter genes have been used to study plant physiology for the past two decades.

During this time period, several genes have been used as reporter genes including, 3-

galactosidase (Helmer et al., 1984), chloramphenical acetyl transferase (Bevan et al.,

1992), neomycin phosphotransferase (Fraley et al., 1983), nopaline synthase (Bevan et

al., 1983), octopine synthase (De Greve et al., 1983), luciferase (Riggs and Chrispeels,

1987), and P-glucuronidase (GUS) (Jefferson etal., 1987). (Table 1-1) Although all of

the reporter genes listed above have been used to study gene activity in plants, some are

more useful than others. GUS is the most useful reporter gene used during the past two

decades since the enzyme is easily assayed and histochemically stained. The Adh/GUS

system of the experiment PGIM-01 on the space shuttle flight STS-93 was the first

promoter reporter gene fusion used to study plant physiological response to non-earth

environments (Paul et al., 2001 ).

The Adh/GUS system was useful for monitoring promoter activity during the

shuttle flight yet, the plants had to be handled by a shuttle crewmember who

histochemically stained the plants. Using an Adh/GFP system avoids the requirement for

human manipulation and also provides the luxury of observing promoter activity in vivo

over the lifetime of a single plant. The Adh/GFP biological system coupled with the

TAGES camera system creates a powerful tool for producing plant physiological data

that can be collected telemetrically.










Table 1-1. Reporter Gene Comparison
Reporter Substrates Low limit Peak Peak
gene sensitivity excitation emission
wavelength wavelength
NPT II ATP 0.1 ng of
enzyme
CAT acetyl 3 mU
Coenzyme A
LUC luciferin, 3*106 560 nm 615 nm
ATP-Mg molecules
P-gal X-gal, 10*4
ONPG, molecules
Galacton-
Star
(clontech)
GUS X-gluc, 0.02 U
MUG
GFP Molecular 0.033tlg/ml 489 nm 511 nm
02
dsRED light NA 558 nm 583 nm
(clontech)
.- .. .1 ......... .-^1: --1--^. -^. .-- -1 -- :- 1^. ..--- 1 -u: : .I,*^ : .-* .^


RepouIer genes and currespoiiiiig suusLIaLes along wlut low lIIIlt udeectIOI senIIMLvitieS.


Reporter Gene Review

Over the past twenty years, reporter gene systems have developed into

sophisticated tools for studying plant physiology. Modem reporter gene systems are

based on a tripartite concept. The first part of the system was based on the discovery that

the Ti plasmids in Agrobacterium (Agrobacterium tumefaciens) are the causative agents

responsible for crown gall tumorigenisis (Bomhoff, 1976; Chilton et al., 1977;

Hemalsteens et al., 1983). The second part of the system involves the use of an antibiotic

resistant gene that acts as a dominant selectable marker (Bevan et al., 1992; Herrera-

Estrella et al., 1983). The third part of the system involves the use of a gene that produces

a signal that can be used to study plant physiology. Genes that were already harbored on

the Ti-plasmids were the first coding sequences used as reporter genes (Herrera-Estrella


T-- -









et al., 1983; De Greve et al., 1983). Early development of chimeric reporter gene systems

included the use of neomycin phosphotransferase (NPTII) and chloramphenicol

acetyltransferase (CAT) (Herrera-Estrella et al., 1983; Herrera-Estrella et al., 1983).

Although the use of NPTII and CAT were advancements for that time, new reporter

genes were needed in order to visually see where the genes were expressed. 3-

galactosidase, luciferase, 3 -glucuronidase, green fluorescent protein (GFP), and dsred all

produce visual signals that can be photographed for future reference (Helmer et al., 1984;

Ow et al., 1986; Jefferson et al., 1987; Prasher, 1995; Matz et al., 1999). Using GFP as a

reporter gene represents the crowning achievement in the reporter gene development

field.

Role of Agrobacterium

Discovering that grown gall tumors had the Agrobacterium Ti-plasmid covalently

integrated into the plant genome was the key to modern plant genetic engineering

(Bomhoff, et al. 1976). A portion of the Ti-plasmid known as transfer DNA (T-DNA)

was the part of the Ti-plasmid that incorporates into the plant genome (Chilton et al.,

1977). Hernalsteens et al. (1983) proved that the Ti-plasmid was useful as a vector for

incorporating foreign DNA into a plant genome. The nopaline synthase gene (Nos)

promoter found on T-DNA was the first promoter used to drive the expression of foreign

proteins in plant cells (Bevan et al., 1983). Soon after the Nos promoter was sequenced it

was used to drive the expression of octopine synthase (ocs) and chloramphenicol

acetyltransferase (CAT) (Herrera-Estrella et al., 1983). Once the Nos promoter was

proven useful as a promoter for chimaeric genes it was used to regulate the expression of

dominant selectable markers such as neomycin phosphotransferase (NPTII) and









aminoglycoside phosphotransferase (APH(3')II) (Fraley et al., 1983; Herrera-Estrella et

al., 1983).

Neomycin Phosphotrans ferase, Chloramphenicol Acetyltransferase, and Octopine
Synthase

NPTII has a convenient assay that has been developed to detect and quantify

NPTII activity in crude cell extracts at levels as low as 0.1 ng of enzyme (Reiss et al.,

1984). Ocs and CAT both are unique to plant genomes and have sensitive and simple

assay systems for detecting enzyme activity (Herrera-Estrella et al., 1983). NPTII, CAT,

and Ocs all have highly sensitive assay systems, yet the signals produced by these

reporter genes cannot be captured photographically for future reference, nor are the

signals detectable without the addition of foreign substrates.

P-Galactosidase

P-galactosidase from E. coli was the first reporter gene used that produced a

visible signal. P-galactosidase had several advantages as a reporter gene. The products of

P-galactosidase enzymatic cleavage can be assayed using colorimetric or fluorogenic

substrates (Helmer et al., 1984). Genes of interest can be fused to the amino-terminus of

P-galactosidase producing an enzymatically active hybrid. (Muller-Hill and Kania, 1974).

The hybrid protein can be used for subcellular localization studies, protein purification,

and amino acid sequence studies. Although using P-galcatosidase as a reporter gene was

an advanced contribution to studying plant physiology, the gene has some negative

attributes.

Higher plants possess endogenous galactosidases, with an average activity of 463

nanomoles ONPG/mg/hour in tobacco calli (Helmer et al., 1984). The high level of

background galactosidase activity interferes with data collection using 3-galactosidase









activity as a signal for studying plant physiology. Low levels of P-galactosidase cannot

be distinguished from background levels, this limits the genes that can be studied using

the P-galactosidase reporter gene system. Foreign substrates, that can be toxic, must be

added to plant tissue in order to collect data on P-galactosidase activity. Using P-

galactosidase as a reporter gene was state of the art for that time, yet other reporter genes

needed to be produced in order to overcome the disadvantages of P-galactosidase.

Luciferase

Luciferase (Luc) was the next step in reporter gene technology. Luciferase from

the firefly Photinuspyralis produces a protein that is completely distinct from

endogenous plants proteins; therefore, background expression level is not a problem. The

Luc protein produces a light signal when exposed to the substrates ATP, 02, and

luciferin. Light, the product of luciferase activity, can be assayed using a luminometer at

levels 100 times more sensitive than a standard CAT assay (Ow et al., 1986). In addition

to the luminometer assay, lucifersae activity can be detected using X-ray film exposure or

video capture. Plant development studies can be performed with periodic treatment of

luciferase since low levels of luciferin are non-toxic. The luciferase reporter gene system

was a vast improvement over the P-galactosidase system, yet luciferase still requires the

addition of harsh substrates.

P-Glucuronidase

Another E.coli gene P -glucuronidase (GUS) was used as a reporter gene. Higher

plants lack endogenous GUS activity; therefore, no background activity interferes with

reporter gene assays. GUS activity can be easily quantified using the 4-methyl

umbelliferyl glucuronide (MUG) fluorometric assay (Jefferson et al., 1987). Jefferson et









al. emphasized that the MUG assay used for quantifying GUS enzyme activity avoids the

problems inherent in luciferase, CAT, and NPTII assays. N-terminal fusions are also

possible using the GUS reporter system (Jefferson et al., 1987). The sensitivity of

histochemical staining and the lack of background GUS activity allow the GUS reporter

gene system to be excellent for studying regulatory regions of promoters. GUS was the

first reporter gene that provided a simple means of studying regulatory regions of

promoters such as arabidopsis ADH signal localization and signal transduction (Chung,

1999). Beyond fusion genetics and promoter analysis, GUS can also be used to study

membrane transport when the appropriate signal sequences are fused to the amino

terminus of GUS. GUS was one of the most effective reporter gene systems ever

developed, yet this system still requires the use of potentially toxic foreign substrates in

order to detect GUS activity in plants.

Green Fluorescent Protein

Green fluorescent protein (GFP) detection requires no cofactors or substrates.

Fluorescent emission of GFP only requires excitation by light energy at a peak

wavelength of either 395 or 475 nm (Cubitt et al., 1995). GFP is relatively small in size

(26.9kDa) and can tolerate both carboxyl and amino-terminal fusions, which can be used

for protein localization studies and intercellular trafficking (Park and Raines, 1997;

Presley et al., 1997; Wang and Hazelrigg, 1994). GFP is a highly stable protein that can

withstand many denaturants, proteases, a broad pH, and temperature range. Other

advantages of GFP include lack of interference with normal cellular activities and ease of

assay using fluorescence microscope or other devices equipped with the proper excitation

and emission filters (Prasher, 1995).









Early reports indicate that improvements were needed in order to improve the

quality of GFP as a reporter gene (Cubitt et al., 1995; Haseloff and Amos, 1995; Prasher,

1995). Mutations have been made that have improved fluorescent intensity (Crameri et

al., 1996; Heim et al., 1995), thermostability (Siemering et al., 1996), codon usage

(Rouwendal et al., 1997; Yang et al., 1996), chromophore formation (Crameri et al.,

1996), spectral qualities (Heim et al., 1994; Heim and Tsien, 1996), and removal of high

AT content or cryptic intron sequences (Haseloff and Amos, 1995).

GFP has been used to study many aspects of plant biology such as protein-protein

interactions and localization (Leffel et al., 1997), nuclear and endoplasmic reticulum

(ER) targeting (Grebenok et al., 1997; Haseloff et al., 1997), virus spread (Baulcombe et

al., 1995; Oparka et al., 1997), as well as, visualization of mitochondria and plastids

(Kohler et al., 1997a, 1997b). The greatest problems found when using GFP as a reporter

gene are poor expression and relative toxicity. Both of these problems were solved first

by removing the cryptic intron (Haseloff and Amos, 1995) and mutating the chromophore

to increase excitation and emission values (Heim et al., 1995). Secondly, by targeting

GFP to the ER which solves the potential problem of toxicity upon localization to the

nucleus (Haseloff et al., 1997).

GFP has emerged as the premier reporter gene for studying plant biology due to

the improvements made to the reporter gene by using modem molecular biological

techniques to tailor the gene.


Conclusion

The reporter gene field has developed many systems that have been used to study

plant physiology, only GFP can produce a signal without the need for exogenous






9


substrates. Furthermore, GFP is a diverse reporter gene able to tolerate a multitude of

manipulations without causing interference with normal plant physiology. Although the

reporter genes have changed, the basic principle of using T-DNA as a vector and

dominant selectable markers for screening purposes has remained unchanged for the past

20 years.














CHAPTER 2
STUDY OF ARABIDOPSIS PHYSIOLOGY USING AN ADH/GFP BIOSENSOR TO
COLLECT DATA VIA TELEMETRIC SIMULATION

Introduction

Developing an understanding of how terrestrial life would respond to features of

the Martian environment in an on-site experiment requires a system able to produce

relevant physiological data that can be collected telemetrically. Plants are ideally suited

as biological monitors of environments as they have sophisticated stress responses

designed to deal with environmental fluctuations in situ. One class of environmental

"sensors" is the promoter regulatory regions of key genes in the metabolic pathways that

cope with environments. Electronic sensors can provide precise data describing the

conditions surrounding the plant, but cannot provide details on the plant's physiological

perception of those conditions. Environmentally responsive genes, however, provide the

raw material for engineering biological sensors to evaluate metabolic responses to

specific stresses. These "biosensors" can be tailored to meet specific needs in terms of

both the stress response to be examined and the means by which the data will be collected

by fusing the regulatory region of an environmentally sensitive gene to a reporter gene

that can be monitored for expression.

The design of the sensor region of a transgene determines what type of stress will

be detected. The promoter region of the arabidopsis alcohol dehydrogenase (Adh) gene

was chosen as the sensor component of TAGES (Transgenic Arabidopsis Gene

Expression System) plants used to monitor the effects of spaceflight on STS-93 (Paul et









al., 2001). Adh is an example of a gene that is sensitive to diverse environmental stresses,

including hypoxia, cold, high salt, dehydration, and the plant hormone abcissic acid

(ABA). The Adh promoter has been well characterized (Chung and Parish, 1995; de

Bruxelles et al., 1996; Dolferus et al., 1994; Nishiuchi et al., 1999; Paul and Ferl, 1998),

and sequence elements of the promoter have been associated with the perception of

individual stresses (de Bruxelles et al., 1996; Dolferus et al., 1994; McKendree and Ferl,

1992; Lu, 1996 ). In addition, Adh is among the genes that have been implicated in

spaceflight associated stress responses (Porterfield et al., 1997).

The design of the reporter component of the transgene dictates how gene

expression data will be collected. The first generation TAGES biosensors used 3 -

glucuronidase (GUS), a widely used reporter gene (Jefferson, 1987; Jefferson et al.,

1987). While extremely useful in certain contexts, the GUS reporter is limited in that

viewing expression of the reporter requires that the plant be killed in histochemical stain.

Thus, gene expression cannot be followed over time in the same plant, nor can gene

expression be monitored passively without direct human interaction. Obviating these

limitations required a reporter gene that could be monitored in real-time by non-

destructive means.

The gene that encodes Green Fluorescent Protein (GFP) in the jellyfish Aequorea

aequorea is well suited for use as a passive reporter gene (Baulcombe et al., 1995;

Haseloff and Amos, 1995; Hu and Cheng, 1995; Prasher, 1995). The GFP signal can be

easily visualized using the correct combination of excitation light and viewing filters.

Therefore, GFP expression can be monitored by non-destructive means and can be used

to study long-term promoter activity in vivo, since harmful substrates are avoided. In









addition, the GFP reporter gene signal can be detected by digital imaging equipment,

which provides a way to observe activity via telemetry. Coupling an environmentally

responsive gene promoter, a properly engineered GFP reporter (Haas et al., 1996;

Haseloff and Amos, 1995; Sheen et al., 1995), and digital video collection creates a tool

that can be used to monitor transgene expression over the lifetime of the plant.

The first example of a transgenic biosensor for studying plant physiological

response to non-terrestrial environment was the arabidopsis Adh/GUS TAGES system of

the experiment PGIM-01 on STS-93 (Paul et al., 2001). Since the reporter gene was

GUS, monitoring the experiment in flight required crew time to harvest and stain plants.

The experiments described here are design to model a telemetric experiment conducted at

a place distant to the site of data processing. The GFP reporter gene replaces GUS.

Arabidopsis plants containing an Adh/GFP transgene were exposed to various stresses

and Adh/GFP transgene expression was monitored by collecting digital images. This

ground-based study lays the foundation for using GFP to monitor stress response in real-

time via telemetry in future spaceflight and extraterrestrial lander experiments.


Results

Experimental Controls

In addition to the experimental Adh/GFP biosensor line, the two control lines

were examined for each experimental parameter. The positive control consisted of the

CaMV 35S driving the sGFP(S65T) reporter (Figure 2-1 a-c). The 35S promoter is active

in many plant tissues and should provide a GFP signal in most cases, though its pattern of

expression can be affected by some conditions (Lam et al., 1989). The negative control

consisted of the sGFP(S65T) reporter alone with no promoter, which should produce no









GFP signal (Figure 2-2). For all tests, the control lines showed no changes in GFP

expression during the course of the treatments.

Flooding

At 42 hours of flooding, the Adh/GFP expression was localized in the distal

portion of the root, suggesting that Adh activity originally started in or near the root tip in

response to flooding (Figure 2-3 e). As the duration of flooding increased, the Adh/GFP

signal increased in intensity and extended up the root while maintaining intense

expression in the root-tip region (Figure 2-3 g). The intensity and distribution of

Adh/GFP expression continued to increase until the experiment was halted at the 82 hour

time point (Figure 2-3 i). Ten hours after the plants were removed from the flooded

environment, Adh/GFP expression was considerably diminished (Figure 2-3 k) and was

barely detectable after the plants had been returned to a normally aerated environment for

30 hours (Figure 2-3 m). The continued increase of GFP at or near the root tip indicated

that the Adh promoter was continuously activated due to the hypoxic conditions

perceived by the plant.

Ten-day old Arabidopsis seedlings grown in 50 ml Fisherbrand conical tubes

containing MS media were flooded with enough water to cover the roots. The plants were

photographed macroscopically using a digital video camera. The first five days of

flooding show the GFP signal traveling from the distal portion of the roots up toward the

base of the stem in Arabidopsis plants containing the Adh biosensor (Figure 2-4 a-e). The

positive control remained relatively unchanged during the same five day flooding time

period (Figure 2-5 a-e). In addition, the positive control in the macroscopic pictures

provides a more representative expression pattern (Figure 2-5) than the positive control

photographs where only the root tips were photographed at a microscopic level. The









negative controls produced no GFP signal upon flooding for five days (Figure 2-6).

Through out the duration of the flooding experiment, there was a continual Adh biosensor

plants continued increase in the number of roots expressing GFP and in the amount of

root area where the GFP signal was observable in Adh/GFP plants (Figure 2-4 f-o). The

positive and negative controls responded to the continued flooding in the same manner as

the controls behaved in the first five days (Figures 2-5 & 2-6 f-o respectively). After the

flooding conditions were removed, the GFP signal in the Adh biosensor decreased

overtime as an indication that the Adh promoter was no longer induced due to the

hypoxic conditions produced by flooding (Figure 2-4 p-t). The positive and negative

controls continued to maintain the same levels of GFP expression during the recovery as

the controls had during flooding conditions (Figures 2-4 & 2-5 p-t). The macroscopic

experiment compliments the microscopic experiment in that both experiments prove that

the GFP signal and the biosensor transgene are excellent tools for capturing

physiologically relevant data in regards to Arabidopsis' perception of environmental

stimulus.

Controlled Atmosphere

The Adh/GFP plants displayed an intense induction of Adh/GFP expression after

24 hours of 3% 02 (Figure 2-7 e). Adh/GFP expression was generally confined to the

distal portion of the root in the early stages of induction, but extended throughout the root

with increased intensity by 36 hours (Figure 2-7 g). At 48 hours of a 3% 02 atmosphere,

Adh/GFP was expressed in all visible root cells (Figure 2-7 i). The plants exposed to a

3% 02 atmosphere for 48 hours were allowed to recover from hypoxia by returning the

plants to normal atmosphere. After 12 hours of recovery, the Adh/GFP signal began to

decrease (Figure 2-7 k). The Adh/GFP signal continued to decrease as the recovery time









progressed, but evidence of low levels of GFP remained even after 48 hours of recovery

(Figure 2-7 m).

In contrast to 3% 02, an atmosphere of 10% 02 was insufficient hypoxic stress to

induce Adh/GFP expression in the roots, even after 48 hours of exposure (Figure 2-8 e-i).

Adh/GFP expression was also absent during the recovery period (Figure 2-8 k-m).

Abcissic Acid Treatment

The Adh/GFP signal was detectable throughout the roots after 12 hours of

exposure to ABA (Figure 2-9 e), but began to decrease throughout the roots after 24

hours (Figure 2-9 g). Adh/GFP expression continued to decrease, suggesting that the

available ABA concentration was reduced over time, possibly due to photo- and

metabolic-degradation (Figure 2-9 i). Recovery was achieved by returning the plants to

plain MS media plates. Adh/GFP signal continued to decrease with recovery time (Figure

2-9 k & m). The results show that the Adh/GFP signal was detectable when plants

induced the Adh promoter as a result of exposure to ABA in the environment, and that

the Adh/GFP signal was reduced once the plants started to recover from ABA exposure.

Cold Treatment

After 24 hours of cold treatment, Adh/GFP expression was localized to the

hypocotyl junction (Figure 2-10 e). The Adh/GFP signal was not detectable in the roots

until the plants were exposed to 40C for 48 hours (Figure 2-10 g). After 56 hours of

exposure to 40C, Adh/GFP expression extended down the primary root, demonstrating

that the signal was moving from its origin at the hypocotyl junction to distal parts of the

root (Figure 2-10 i). Twelve hours of recovery at room temperature was sufficient to









decrease the Adh/GFP signal, showing that the Adh promoter was inactivated upon

removal of the stress conditions (Figure 2-10 k).

High Salt Treatment

The Adh/GFP signal was expressed in the upper portion of the primary root after

24 hours of high salt exposure (Figure2-11 e). The expression pattern resembled a

checkerboard with some cells expressing GFP, while adjacent cells did not express GFP.

The expression of Adh/GFP continued to extend further down the root over time (Figure

2-11 g & i). Recovery from the high salt stress conditions entailed transferring the plants

back to plain MS media. The Adh/GFP signal decreased throughout the roots upon

removal of the high salt stress (Figure 2-11 k & m). The results of the high salt treatment

revealed that the Adh/GFP signal was detectable when plants were exposed to 300 mM

NaCl and the signal decreased as plants recovered from high salt stress conditions.


Discussion

These experiments using the Adh/GFP biosensor system demonstrate the

feasibility of developing long-range telemetry data on plant gene expression. Adh/GFP

transgene expression levels were monitored passively and images were collected with a

digital imaging system. While not part of the present study, radio transmission of digital

signals is practical, and the distance between image data collection and image analysis is

essentially irrelevant.

In these experiments, Adh/GFP expression was monitored in response to several

environmental stresses known to affect gene expression patterns. Both flooding and 3%

02 presented clearly hypoxic conditions, and induced Adh/GFP expression in similar

patterns over similar timeframes, with strong signals developing over 36 to 48 hours. An









atmosphere of 10% 02 did not cause increased Adh/GFP expression in the roots,

establishing that the threshold for Adh/GFP response to hypoxia in roots is between 3%

02 and 10% 02. Adh/GFP plants required 48 to 56 hours of exposure to 40C to produce a

detectable Adh/GFP signal in the roots, and the spatial localization of Adh/GFP signal

was different than that detected by hypoxia. Specific localization of the Adh/GFP signal

was most dramatically revealed by the high salt stress, which formed a checkerboard

pattern of expression. The Adh/GFP signal could reflect the changing state of an

environmental stress over time. When the plants were transferred to the ABA containing

medium, Adh/GFP signal was induced, but the signal steadily decreased as ABA was

degraded in the media. Similarly, removing the plants from hypoxia, cold or salt stress

resulted in the loss of Adh/GFP signal. The results collected from all of the experiments

correlated with previously published Adh promoter/GUS reporter gene data (Chung et

al., 1999 ).

Adh/GFP arabidopsis plants could, therefore, be used to collect physiological data

on plant responses to diverse environments during space shuttle, space station, lunar, and

Martian experiments by remote sensing. However, by using regulatory promoter sensors

from other genes, biosensors can be developed to respond to any of a tremendous range

of exogenous stresses that may exist during extraterrestrial exploration experiments. A

promoter such as that of the ascorbate peroxidase gene (APX1) (Storozhenko et al.,

1998) could be used to assay superoxidizing agents in Martian soil. The altered response

to gravity (ARG1) (Sedbrook et al., 1999) promoter might be used to study physiological

responses to reduced gravity. Responses to possible heavy metals in Martian soil could be

studied using the promoter of glutathione synthetase (GSH2) (Wang and Oliver, 1996).









Pathways involving hormonal fluctuations in response to extraterrestrial environments

could be monitored with hormone responsive promoters such as co-3 fatty acid desaturase

(FAD7) (Nishiuchi et al., 1999), small auxin up RNA (SAUR-AC1) (Gil and Green,

1996; Gil et al., 1994), or Chitinase B (CHIB) (Samac et al., 1990), which respond to

jasmonic acid, auxin, and ethylene respectively. Basically any environmental condition

that generates a molecular response could be developed into a biological sensor that

would allow telemetric data collection about that response.

The digital imaging system used in the current demonstration was a microscope-

mounted digital camera. Digital imaging systems suitable for spaceflight or planetary

lander missions would need to be small, lightweight, and energy efficient, while

maintaining the need to collect the GFP images at resolutions that meet experimental

goals. However, even current commercially available video imaging equipment

essentially meets these criteria, suggesting that image detection, transmission and

analysis should not prove to be a limiting factor.

The results of these experiments demonstrate the utility of engineered plants as

biosensors for studying plant physiology, and support the feasibility of using a remote

digital data collection system for studying plant physiology in extraterrestrial

environments or in any application that requires remote sensing of gene activity.


Materials and Methods

Constructs

The plant expression vector pBI 101 with the GUS reporter gene under Adh

promoter regulation was previously reported by Chung and Ferl (1999). (Figure 2-12 a)

In order to introduce the sGFP(S65T) reporter gene under Adh promoter regulation into









Arabidopsis the plant expression vector was reconstructed to have the sGFP(S65T)

reporter gene in place of the Gus reporter gene (Figure 2-12 b & c). The sGFP(S65T) was

generated by Sheen et al. (Sheen et al., 1995). A 5' BamHI site and a 3' SacI site were

placed on the sGFP(S65T) gene through PCR techniques. The primers used for

constructing the BamHI/ SacI cassette were

5'TCGGATCCGATGGTGAGCAAGGGCGAG3' and

5'CCGAGCTCCCGCTTTACTTGTACAGCT3' respectively. The BamHI and SacI sites

were chosen in order to insert the sGFP(S65T) between the same sites that the Gus

reporter gene occupied. The final plasmid construct pBI 101 -846 ADH sGFP(S65T) was

made by digesting the pBI 101 -846 ADH Gus vector with BamHI and SacI, collecting

the digested vector, and lighting the vector with the sGFP(S65T) BamHI/ SacI cassette

insert. A second plant expression vector, pBI 101, was constructed to have a sGFP(S65T)

reporter gene with no promoter sequence. This vector was constructed in a similar

manner to the pBI 101 -846 ADH sGFP(S65T) vector with the exception that a 5' Xbal/

3' SacI cassette was used to insert sGFP(S65T). The Xbal and SacI restriction sites were

placed on the sGFP(S65T) gene through PCR techniques. The primers used for

constructing the Xbal and SacI cassette are

5' GGTCTAGAATGGTGAGCAAGGGCGAG3' and

5'CCGAGCTCCCGCTTTACTTGTACAGCT3' respectively.

Arabidopsis Transformation and Isolation of Transgenic Lines

The pBIlol-846 Adh/sGFP(S65T) construct was introduced into Agrobacterium

tumefaciens strain GV3101, which was then used for transforming arabidopsis (Bechtold

and Pelletier, 1998). Seeds were screened on kanamycin (50 mg/ml) MS media

(Murashige and Skoog, 1962) solidified with 0.2% phytagel (Sigma) to produce 15









independent lines. Each line was carried through at least three generations to ensure

homozygosity. One line was selected as the Adh/GFP line used for all of the experiments

presented. Similar procedures were used to develop a CaMV 35S/sGFP(S65T) positive

control line (Figure 2-1 a & b) (Lam et al., 1989), and a promoterless/sGFP(S65T)

negative control line (Figure 2-2 a & b).

Microscopy

A Zeiss Axioplan 2 Fluorescence Microscope was used to view arabidopsis roots

at 50x magnification. The fluorescent images were captured using a FITC filter set with

the following microscope/SPOT (Diagnostic Instruments, Inc.) camera settings: Atto Arc

HBO 100W power setting at 50%, gain at 16, and the camera exposure time at 500

milliseconds. The bright field images were captured with the following

microscope/SPOT camera settings: Atto Arc HBO 100W power setting at 50%, light

intensity at 2, with gain and exposure time determined automatically using the SPOT

version 3.1 software.

Experimental Growth Conditions

In preparation for treatments, Adh/GFP seeds were chemically sterilized and

planted in a row across MS media plates containing 2.5 ppm of the fungicide benomyl

(Paul et al., 2001). The plates were kept in a vertical position to ensure that the roots

would grow across the surface of the media in an aerobic environment, and were

maintained in a vertical position throughout the experiments to prevent spurious Adh

induction (Chung and Ferl, 1999). All of the roots observed for Adh/GFP expression

during exposure to an exogenous stress were not expressing GFP prior to exposure to the

exogenous stress.









For flooding, vertical plates were placed in plastic bags containing enough water

to flood approximately 75% of each root. Images were collected every 10 hours for a

total of 82 hours. After 82 hours, the plants were removed from the flood conditions and

allowed to recover. Images were collected every 10 hours for 30 hours of recovery.

For growth in defined atmospheres, vertical plates were placed in separate sealed

containers and maintained at either 97% N2 and 3% 02 or 90% N2 and 10% 02. Images

were collected at 24, 36, and 48 hours of exposure. The plants were allowed to recover in

ambient oxygen levels and images were collected every 12 hours for 48 hours

To test the effects of ABA, seedlings were transplanted onto vertical plates

containing 300 [tM ABA. The plants grew under continuous light on the ABA plates for

12 hours, and then images were collected every 12 hours for 48 hours. After 48 hours, the

plants were transplanted onto vertical plates for recovery, and images were collected

every 12 hours for 48 hours.

For cold treatment vertical plates were placed at 40C. The plants grew under

continuous light at 40C for 24 hours before the first images were collected. Then images

were collected every 12 hours for 56 hours. After 56 hours, the plants were allowed to

recover at 240C, with images being collected every 12 hours for 48 hours.

For high salt treatment seedlings were transplanted onto vertical plates containing 300

mM NaCl in the media. The plants grew under continuous light on the NaCl plates for 24

hours then images were collected every 12 hours for 48 hours. After 48 hours, the plants

were transplanted onto MS media plates for recovery, and images collected every 12

hours for 48 hours.


























Figure 2-1. Positive Control Vector Map and Sequence Data. a) Positive
control vector map. The positive control biosensor vector map labeled
'sequenced area' corresponds with the chromatogram data in figure 2-1-b.
b) Chromatograms that correspond with the labeled portion of the vector
construct map. c) Raw sequence directly from the chromatograph. The
green letters represent GFP sequence and the black letters represent
promoter sequence.

















sequenced area

35S promoter

Ncol (4469)


XbaI (2)


sGFP(S65T)


9 ..SacI (737)

Tnos

EcoRI (1004)


Clal (3752)





Tr


121sGFP(S65T)

5005 bp


_~. Ava (1416)


0Pnos

Pt (2234)

Nco 1 (2613) NPT II


NCGTC C G CTCGAC CAGG AT GGG CA C CA C C CCGGT GAACAGC T C CT CG CCCT TGCT CAC CA TTCTAGAGT CCC CC GT GT TC


NCGTC C GC TCGAC CAGG AT GGG CAC CA C CCGGT GAACA G CT C CT CGC CCT TGCT CAC CAT T CTAGAGT C CC CC GT GT TC

TCTCCAAATGAAATGAAC TT CCTT ATATAGAGGAAGGGNC TT GCGAAGGATAGTGGGAT TGT GCGTCAT CCCTTACGTC


HindIlI (4165)


MANAF
MANAM



























MANAF









wI/P


GTGGAGATAT CACAT CAATCCACTTGCTTTGAAGACGTGGTTGGAACGTCTTCTTTTTCCACGATGCTCCTCGTGGG


nos











24









3T GGGGTCCATCTTTI OGGACCACTGTCGGCAGAGGCATCTTCAACGATGGC C TTTCCTTTAT C GCAATGATOGCATT





wP
MANA















T G GGGGT CCAT C TT GGGAC CAC TGTC GGCAGAGGCAT CT TCAA C GA T GGC C T T TCCT T TAT C GCAATGATGGCAT T

TTGTAGGAGCCACCTTCCTTTTCCACTATCTTCACAATAAAGTGACAGATAGC TGGCAATGGAATCCGANGAGGTT




MANA
wP














TTGTAGGAGCCACCTTCCTTTTCCACTATCTTCACAATAAAGTGACAGATAGC TGGGCAATGGAATCCGANGAGGTT



TTC CG G ATA T TAC CCT T T GTCTGA AAAGT C TCAAT TGC C CT T TGG T C TTCCT GAGAC TGTATC TTT GA TA T TTT TNGGA GT




MANAF
wUP













TTC CG G ATA TTAC CCT T T GTCTGA AAAGT C TCAAT TGC CC T T TGGT C TTCCT GAGAC TGTATC T TT GA TA T TTT TNGGA GT



AN A C AA GT G TGT C NT GC TC CAC CATGTT N ACCNAAG A T TNT C TTCTTTCNT TGAGTC CTAAGAGACT CT GTATTG A A




MAPN


PAN ACAA GTGTGTC TGC TC CAC CATGTT NACCN AAG AT TNT C TT CTTG TCI T TGAG TC CTAAGAGAC T CT GTATTG A A


Figure 2-1 continued













C

AGTCCCCCGTGTTCTCTC
CAAATGAAATGAACTTCCTTATATAGAGGAAGGGNCTTGCG
AAGGATAGTGGGATTGTGCGTCATCCCTTACGTCAGTGGAGA
TATCACATCAATCCACTTGCTTTGAAGACGTGGTTGGAACGT
CTTCTTTTTCCACGATGCTCCTCGTGGGTGGGGGTCCATCTTT
GGGACCACTGTCGGCAGAGGCATCTTCAACGATGGCCTTTCC
TTTATCGCAATGATGGCATTTGTAGGAGCCACCTTCCTTTTCC
ACTATCTTCACAATAAAGTGACAGATAGCTGGGCAATGGAA
TCCGANGAGGTTTCCGGATATTACCCTTTGTCTGAAAAGTCT
CAATTGCCCTTTGGTCTTCCTGAGACTGTATCTTTGATATTTT
TNGGAGTANACAAGTGTGTCNTGCTCCACCATGTTNACCNAA
GATTNTCTTCTTGTCNTTGAGTCCTAAGAGACTCTGTATTGAA
CTGTTCGCCNANTCTTTTAC
Figure 2-1 continued

























Figure 2-2. Negative Control Vector Map and Sequence Data. a) The
negative control biosensor vector map label 'sequenced area' corresponds
with the chromatogram data in figure 2-2-b. b) Chromatograms that
correspond with the labeled portion of the vector construct map. c) Raw
sequence directly from the chromatograph. The green letters represent GFP
sequence and the black letters represent promoter sequence.














PstI (4181)

HindIII (4165) XbaI (2)

sequenced area GFP

Clal (3752)



Sac I (737)

Tnos Tnos



S pBI101sGFP(S65T)seq
EcoRI (1004)
4187 bp


AvaI (1416)


NcoI (2613)


PstI (2234)


Pnos


ITGCAGGCATG CAAGC TTGGC GTAAT CATGGTCATAGC TGTCCTGTGTGAAA T TGTTAT C CGCTCACAAT T C CACAC


1MAINA
la/p












MAIAP
la/p


\ACATACGAGCCGGAAGCATAAAGTGTAAAGC CTGGGGTGCCTAATGAGTGAGCTAACTCACATTAAT TGCGT TGCGC














CACTGCCCGCTTTCCAGTCGGGAAACCTGTC GTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGT













CACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAA CGCGCGGGGAGAGGCGGT

TTGCGTATT GGGC CAAAGACAAAAGGGCGACATTCAACCGAT GAGGGAGGGAAGGTAAATAT T GACGGAAATTAT T













TTGCGTATT GGGC CAAAGACAAAAGGGCGACATTCAA C C GAT T GAGGGAGGGAAGGTAAATAT T GACGGAAATTAT T


CAT TAAAGGTGAAT TA TCACCGTCACCGACTT GAGCCAT T TGGGAAT TAGAGC AGCAAAATCA CAACAGCACAT T













CATTAAAGGTGAAT TA T CA C C GTCACCGAC TTGAGCCAT T TGGAATTAGAGAGCAAAACACAGTA GCA C CAT T

C CAT TAGCAAGG C C GGAAAC GT CAC CAAT GAA A C CA T C GATAGCAGCAC C GTAAT CAGTAG GACAGAAT CAA G TT G
If yf ^


rlyp















flyp















flyp















rypp


C CAT TAGCAAGG C CGGAAAC GT CAC CAAT GAAA CCAT CGATAGCAGAC C GTAAT CAGTAGC GACAGAAT CAAGT TT G

GC CET T TAG C GT CAG A C TGTA GC GC GT T TTCA T CG GC A TT T TCG GT CA TA GC C C C CT TA TTA GC GTT T GEC CA T CT T TTCP


MANA
la/p


GC CT T TAGC GT CAGA CTGTA GC GC GT TTTCA T CGGC A TT T TCGGTCA TAGC C C CCTTATTAGC GTT TGC CA T CT T T T C

A TAAT CAAAAT CAC CGGAAC CAGAGC CAC CACC GGAAC CCGCCTCCCT'CAGAGCCCGCCACCCTC ANAACC GCCACCCTC


1475 -aept
MANAF
l/p







3A TAAT CAAAAT CAC CGGAAC CAGAGC CAC CACC GGAAC CCGC C T CCCT CAGAGCCCGC CAC CC T C ANAACC GCCAC CCT C


Figure 2-2 continued















C

AGTCGACCTGCAGGCATGCAAGCTTGGC
GTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATT
CCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTA
ATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAG
TCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGG
AGAGGCGGTTTGCGTATTGGGCCAAAGACAAAAGGGCGACATTCAACCGA
TTGAGGGAGGGAAGGTAAATATTGACGGAAATTATTCATTAAAGGTGAATT
ATCACCGTCACCGACTTGAGCCATTTGGGAATTAGAGCCAGCAAAATCACC
AGTAGCACCATTACCATTAGCAAGGCCGGAAACGTCACCAATGAAACCATC
GATAGCAGCACCGTAATCAGTAGCGACAGAATCAAGTTTGCCTTTAGCGTC
AGACTGTAGCGCGTTTTCATCGGCATTTTCGGTCATAGCCCCCTTATTAGCG
TTTGCCATCTTTTCATAATCAAAATCACCGGAACCAGAGCCACCACCGGAA
CCCGCCTCCCTCAGAGCCCGCCACCCTCANAACCGCCACCCTCAGAGCCCC
A


Figure 2-2 Continued



















Brightfield Images


Negative
control


Positive
control


f h

42 hours 62 hours
flooding flooding


Figure 2-3. Microscopic Time Lapse Flood Root Photos. Florescent and corresponding
bright field images of Arabidopsis during flood stress. Negative control containing the
promoterless sGFP(S65T) reporter gene (a & b). Positive control containing CaMV35S
promoter/sGFP(S65T) transgene (c & d). Time lapse of GFP expression in Adh
promoter/sGFP(S65T) fusion plants through 82 hours of flood stress (e-j). Time lapse of
GFP expression in Adh promoter/sGFP(S65T) fusion plants through 30 hours of recovery
from flooding (k-n).


82 hours
flooding


10 hours
recovery


30 hours
recovery
























Figure 2-4. Macroscopic Time Lapse Photos of Arabidopsis Adh/GFP Flooded a-
o) shows Arabidopsis with the Adh promoter maintaining induction of GFP over a
23-day flooding period. The flooding period caused the GFP signal to increase,
indicating that the Adh promoter remained active during the flood period. p-t)
shows Arabidopsis with the Adh promoter becoming repressed and GFP signal
reducing over a 12-day period. The recovery period allowed the GFP signal to
decrease, indicating that the Adh promoter became inactive during the recovery
period. u) Representative picture of the macroscopic time lapse photos under white
light The plants were not photographed everyday since the camera used to capture
the images was not available on a continual basis. The plants were observed on a
daily base though and GFP signal was maintained consistently as indicated by the
images.






32






















































Figure 2-4 continued






















































Figure 2-4 continued





























50 ml fisher brand conical tube

Canopy, not flooded
Roots flooded

Phytagel, MS media slant


2-4 continued

























Figure 2-5. Macroscopic Time Lapse Photos of Arabidopsis CaMV 35S/GFP
Flooded. a-o) shows Arabidopsis maintaining induction of the CaMV 35S
promoter causing 'constitutive' expression of the GFP signal. p-t) shows the
continued maintenance of GFP signal indicating induction of the CaMV 35S
promoter. Arabidopsis containing CaMV promoter/sGFP(S65T) biosensor
maintains a similar level of GFP signal indicating that the CaMV 35S
promoter is unaffected by the flooding or recovery. In addition, the CaMV
35S promoter/sGFP(S65T) biosensor proves to be an effective positive
control. u) Representative picture of the macroscopic time lapse photos under
white light






37























































Figure 2-5 continued
























































Figure 2-5 continued






40






















50 ml fisher brand conical tube

Canopy, not flooded
Roots flooded

Phytagel, MS media slant


2-5 continued

























Figure 2-6. Macroscopic Time Lapse Photos of Arabidopsis Promoterless/GFP
Flooded. a-o) show Arabidopsis transformed with a pBI101sGFP(S65T) vector
flooded in a comparable manner to the Adh and CaMV 35S plants. No GFP
signal is produced, since no promoter is fused with the GFP gene. p-t) shows
Arabidopsis negative control biosensors after recovery. The promoterless
sGFP(S65T) biosensors are effective negative controls since no GFP signal is
produced during experimentation. Furthermore, the negative control biosensor is
an effective tool for comparing growth pattern/rate against the experimental
systems) to insure that the GFP has no measurable negative impact on the plants
under the experimental growth conditions. u) Representative picture of the
macroscopic time lapse photos under white light






42

























































Figure 2-6 continued

























































Figure 2-6 continued





























50 ml fisher brand conical tube

Canopy, not flooded
Roots flooded


Phytagel, MS media slant


Figure 2-6 continued


















Brightfield Images






b dfI 1

Negative Positive 24 hours 36 hours 48 hours 12 hours 24 hours
control control 3% 02 3% 02 3% 02 recovery recovery

Figure 2-7. Microscopic Time Lapse 3% 02 Root Photos. Microscopic time lapse 3% 02
root photos. Fluorescent and corresponding bright field images of Arabidopsis during 3%
02 stress. Negative control containing the promoterless sGFP(S65T) reporter gene (a &
b). Positive control containing CaMV35S promoter/sGFP(S65T) transgene (c & d). Time
lapse of GFP expression in Adh promoter/sGFP(S65T) fusion plants through 48 hours of
3% 02 stress (e-j). Time lapse of GFP expression in Adh promoter/sGFP(S65T) fusion
plants through 24 hours of recovery from 3% 02 stress (k-n).


















Brightfield Images






b f h i I

Negative Positive 24 hours 36 hours 48 hours 12 hours 24 hours
control control 10% 02 10% 02 10% 02 recovery recovery

Figure 2-8. Microscopic Time Lapse 10% 02 Root Photos. Fluorescent and
corresponding bright field images of Arabidopsis during 10% 02 stress. Negative control
containing the promoterless sGFP(S65T) reporter gene (a & b). Positive control
containing CaMV35S promoter/sGFP(S65T) transgene (c & d). Time lapse of GFP
expression in Adh promoter/sGFP(S65T) fusion plants through 48 hours of 10% 02 stress
(e-j). Time lapse of GFP expression in Adh promoter/sGFP(S65T) fusion plants through
24 hours of recovery from 10% 02 stress (k-n).


















Brightfield Images






b / h

Negative Positive 24 hours 36 hours 48 hours 12 hours 24 hours
control control ABA ABA ABA recovery recovery

Figure 2-9. Microscopic Time Lapse 300 [tM ABA Root Photos. Fluorescent and
corresponding bright field images of Arabidopsis during ABA stress. Negative control
containing the promoterless sGFP(S65T) reporter gene (a &b). Positive control
containing CaMV35S promoter/sGFP(S65T) transgene (c & d). Time lapse of GFP
expression in Adh promoter/sGFP(S65T) fusion plants through 48 hours of ABA stress
(e-j). Time lapse of GFP expression in Adh promoter/sGFP(S65T) fusion plants through
24 hours of recovery from ABA stress (k-n).



















Brightfield Images






b d

Negative Positive
control control


24 hours
cold


h

48 hours 56 hours 12 hours
cold cold recovery


Figure 2-10. Microscopic Time Lapse 40C Root Photos. Florescent and corresponding
bright field images of Arabidopsis during cold stress. Negative control containing the
promoterless sGFP(S65T) reporter gene (a & b). Positive control containing CaMV35S
promoter/sGFP(S65T) transgene (c & d). Time lapse of GFP expression in Adh
promoter/sGFP(S65T) fusion plants through 56 hours of cold stress (e-j). Time lapse of
GFP expression in Adh promoter/sGFP(S65T) fusion plants through 24 hours of recovery
from cold stress (k-n).


24 hours
recovery

















Negative Positive 24 hours
control control high salt


L
36 hours
high salt


IIv


48 hours
high salt


L I
12 hours
recovery


Y11


ALA
24 hours
recovery


Figure 2-11. Microscopic Time Lapse 300 mM NaCl Root Photos. Florescent and
corresponding bright field images of Arabidopsis during high salt stress. Negative control
containing the promoterless sGFP(S65T) reporter gene (a & b). Positive control
containing CaMV35S promoter/sGFP(S65T) transgene (c & d). Time lapse of GFP
expression in Adh promoter/sGFP(S65T) fusion plants through 48 hours of high salt
stress (e-j). Time lapse of GFP expression in Adh promoter/sGFP(S65T) fusion plants
through 24 hours of recovery from high salt stress (k-n).


I`i

























Figure 2-12. Adh/GUS and Adh/GFP Vector Maps and Adh/GFP Sequence
Data. a) The original pBI101 construct contained a -846 Adh promoter/GUS
reporter gene fusion. The original construct was modified by replacing the
GUS reporter gene with the GFP reporter gene. b) The vector map represents
sequence information for the DNA that is found inside the T-DNA borders of
the pBI101 vector. The vector map represents sequence information for the
DNA that is found inside the T-DNA borders of the pBI101 vector. c)
Chromatograms that correspond with the labeled portion of the vector
construct map. d) Raw sequence directly from the chromatograph. The green
letters represent GFP sequence and the black letters represent promoter
sequence.


















-846 Adh


Clal (5761)

Tnos


'V


(860)


Nco (4622)

NPT II


PstI (4243)


pBI101 -846 adh
6173 bp


Pnos

Ava I (3425)


GUS
ApaLI (1812)

ApaLI (2136)


Ava (2726)


EcoRI (3013)


SSacI (738)

Tnos
EcoRI (1005)


HindII


pB:
Clal (3753) p B




Tnos


[101-846 Adh sGFP(S65T)
5018bp


Pnos
PstI (2235)


__4va (1417)


Nco 1 (2614)


NPT II
















TTACGT CGC CGTC CAG CT CGAC CAGG ATG GG CAC CA C CC CGGT GAACAGCT CCT CGCCCTTGCT CAC CA TCGGAT CCTTTGT


TTACGT CGC CGTC CAGC T CGAC CAGG ATG GG CAC CA C CC CGGT GAACAGCT CCT CG CCCTTGC TCAC CA TCGGAT CCTTTGT

TAGT TTTGTGTGATTGT GATGTAAG AAAGAGAAACAGAGAAGGGGATTTATATAGCAGC TGGTAATTGGAAGAAGTA


ATATTTACAAAAACTCACCACTAGAAATTAATTAGTACTGTTTATTGAAATCTTTTGTAATTATC CAGT C GACATCTG


TAGAATACTAGGGGCGTATTTI GT TTTGCCTTGTTCTCTCGAACGCTCTTT CCACTTGGCGTTGCTAGTATT C GTCCI



MAINA
I faI/P


Figure 2-12 continued

















CACGTGGCAT TTCTCGTTGAT CTTTTTAATTACAAATTGTAGTAATTATTAATAGTTTTTTTAAAATGT GTCTTAG


GTTAATTAGT CTT GAT GGT CACGC CGTGGTGTTGC TAAAAGCAGTAAT CGGTGTAC CCAT CGAATGCTTTTGGTTT CG


GTTAATTAGT CTT GAT GGT CACGC CGTGGTGTTGC TAAAAGCAGTAAT CGGTGTAC CCAT CGAATGCTTTTGGTTT CG


G GC GGNTTCAT CT TAAATA GC TCTT TAATAAGTATTA TT CT TG GNCAT CA AGTTG GA A TTNTTT TTTTCTACT TTTGT




MANAF
AAH/P














'GGC GG NTTCAT CT TAAATA GC TCTT TAATAAGTA TTATTCT TGGN CAT CAAGTTGGA A TTNTTTTTTTCTACT TTTGT


GTGA GAATT TTAAAGG TA TGAAAGATCACTA ATTGGC TCTTAATT GTATTCTTGGCCGGCNCTTT CAA GT CT TAAC NAT




MANAF
F-a P


GTGA GAATT T TAA AGG TA TGAAAGAT CACTA AT T GGC TCTTAATT GTATT CTT GGC C GG CNCTTT CAA GT CT TAAC NAT


NAT CC AT TATGAGNGGCA TTAANNATACTTT TTNCTCG T T TAAA C CCG CCTANT NAGGGATNGGNGACATTT C CC CCAAP


00 TFat
MANAF
pmp















NAT CC AT TA TGA GNGG CA T TAAN NAT A C T TT TT NCTCGl TTTAAA CCCG C CTA rT NAGGG AT NGG NGACA TT C CC CCAAP


Figure 2-12 continued














d

CTTTGTTAGTTTTGTGTGATTGTGATGTAAGAA
AAGAGAAACAGAGAAGGGGATTTATATAGCAGCTGGTAATTGGAAGAAGTAGA
TATTTACAAAAACTCACCACTAGAAATTAATTAGTACTGTTTATTGAAATCTTTT
GTAATTATCCAGTCGACATCTGTAGAATACTAGGGGCGTATTTGGTTTTGCCTTG
TTCTCTCGAACGCTCTTTCCACTTGGCGTTGCTAGTATTCGTCCACGTGGCATTT
CTCGTTGATCTTTTTAATTACAAATTGTAGTAATTATTAATAGTTTTTTTAAAATG
TGGTCTTAGTTAATTAGTCTTGATGGTCACGCCGTGGTGTTGCTAAAAGCAGTA
ATCGGTGTACCCATCGAATGCTTTTGGTTTCGGGCGGNTTCATCTTAAATAGCTC
TTTAATAAGTATTATTCTTGGNCATCAAGTTGGAATTNTTTTTTTCTACTTTTGTG
AGAATTTTAAAGGTATGAAAGATCACTAATTGGCTCTTAATTGTATTCTTGGCCG
GCNCTTTCAAGTCTTAACNATCCATTATGAGNGGCATTAANNATACTTTTTNCTG
GTTTAAACCCGCCTANTTNAGGGATNGGNGACATTTCCCCCAAAANACANTGGA
CCCNNNTATAATTATCANGATTTTTGNTNATTATTTTNCTCCNNATGCCCAAA


Figure 2-12 Continued














CHAPTER 3
NETWORK OF BIOSENSORS FOR STUDYING ARABIDOPSIS PHYSIOLOGY IN
EXRATERRESTRIAL ENVIRONMENTS

Introduction

Individual Arabidopsis lines were transformed with biosensing transgenes in

order to monitor plant physiological responses to extraterrestrial environments via

telemetry. A biosensor is defined as a transgene consisting of a promoter that responds to

an environmental condition fused to the sGFP(S65T) reporter gene. Each line of

transgenic Arabidopsis was developed to monitor a specific environmental condition with

some overlapping among the promoter's response capabilities. A range of previously

characterized promoters that respond to various physiological conditions were fused to

sGFP(S65T) producing a network of biosensors. A total of 14 Arabidopsis promoters

chosen to monitor 16 different environmental conditions or metabolic activities will

provide valuable information about plant physiological responses during exposure to

extraterrestrial environments (Table 3-1 & 3-2).


Results and Discussion

Ascorbate Peroxidase

Martian soil is considered to have high levels of oxidizing agents based on studies

performed by the Viking landers (Oyama and Berdahl, 1979). Arabidopsis was

transformed with a -265 APX1 promoter/sGFP(S65T) biosensor transgene as a potential

tool for studying Arabidopsis physiology in response to growth in Martian soil.

Ascorbate peroxidases (APX) are genes involved in the removal of hydrogen peroxide










from within the cytosol and chloroplasts (ASADA). Both in vivo footprinting and GUS

fusion studies were used to prove that the -300 base pair promoter region contained cis-

elements that respond to oxidative stress, ethylene, and heat shock (Storozhenko et al.,

1998).

Table 3-1. Promoters and Corresponding Environmental Stimuli
Stimulus A A A C D F G G H N P R S T
D P R H R A S S S R D D A C
H X G I E D H T P 1 F 2 U H
1 1 B B 7 2 6 1 1 9 R 4
2 8 A -
A 2 A
2 C

ABA f f U f
AUXIN f f f
BRASSINO- f
STEROID
COLD T T T
CIRCADIAN f
RHYTHM
CYTOKININ f
DARKNESS f
DROUGHT f f f f
ETHYLENE ft ft
GRAVITY f
HEAT f f
HYDROGEN ft f
PEROXIDE
JASMONIC ft f
ACID
LOW f
OXYGEN
HEAVY f
METALS
NITRATE f
PATHOGEN ft t
SALICYLIC f
ACID
SALT f f U f
TOUCH f
UV
LIGHT
WOUND f
Genes vs. stimuli that cause induction (1) or reduction (-) of mRNA.









Table 3-2. Organs where promoters regulate Expression
Genes Reporter Stems Leaves Roots Flowers Trichomes Siliques
Gene
ADH GUS X X X X X
APX1 GUS X X X
ARG1 mRNA X X X X X X
CHIB GUS X X X
DREB2A GUS X X X X X
FAD7 GUS X X X
GSH2 mRNA X X
GST6 LUC X X X
HSP18.2 GUS X X X
NR1 GUS & X
CAT
PDC X X X X X
PDF1.2 GUS X X X X X X
RD29A GUS X X X X X
SAUR- GUS X X X X
AC1
TCH4 GUS X X X X X X
Organs in which reporter gene or indigenous mRNAs are up-regulated by corresponding
gene promoters.


Alter Response to Gravity

Gravity levels on the Space shuttle, International Space Station, Moon, and Mars

are reduced compared to gravity levels on Earth. ARG1 is a DnaJ-like protein that is

involved in Arabidopsis gravitropism (Sedbrook et al., 1999). The ARG1 promoter has

not been analyzed through reporter gene experiments. In order to monitor Arabidopsis

gravitropic response to altered gravity an -1150 upstream base pair sequence of the

ARG1 gene was fused to sGFP(S65T).

Chitinase B

Increased levels of ethylene have been reported on both the Space Shuttle and the

Space Station MIR Ethylene is a plant hormone involved with both normal and stress

related physiological responses (Cowles et al., 1994). Chitinase is a plant enzyme









produced during exposure to ethylene as well as pathogen attack (Stintzi et al., 1993).

Arabidopsis contains two chitinase genes one that has an acidic isoelectric point and one

that has a basic isoeletric point (Samac et al., 1990). The basic Arabidopsis chitinase

(ChiB) responds to ethylene treatment whereas the acidic chitinase (ChiA) does not

(Samac et al., 1990). ChiB mRNA levels increase sharply over controls upon exposure to

ethylene in roots and leaves (Samac et al., 1990). The response to ethylene also appears

to be more dramatic in older plants versus younger plants (Samac et al., 1990). The -998

5' sequence upstream from the start site of the ChiB gene was fused to sGFP(S65T)

(Figure 3-1 a-c) in order to monitor Arabidopsis that may potentially be exposed to

ethylene on board the International Space Station or Space Shuttle.

Dehydration-Responsive Element 2A

Martian soil not only appears to contain high levels of peroxides, but also appears

to contain high levels of salts (Clark, 1979). The dehydration-responsive element

(DREB2A) gene is expressed under conditions of dehydration and high salinity

(Nakashima et al., 2000). Arabidopsis was transformed with a -1814 base pair fragment

of the DREB2A promoter fused to the GUS reporter gene for analyzing cis-elements that

are involved with dehydration and high salinity response (Nakashima et al., 2000). The

putative promoter contains regulatory elements that caused GUS expression upon

exposing the transgenic Arabidopsis to dehydration and high salt conditions (Nakashima

et al., 2000). In order to assay Arabidopsis physiology in response to Martian soil

salinity, Arabidopsis was transformed with a -1998 base pair fragment directly upstream

from the (DREB2A) transcription start site.









Response to Desiccation 29A

Another Arabidopsis gene that responds to high salt stress is the response to

desiccation gene (rd29A) (Yamaguchi-Shinozaki and Shinozaki, 1993). A-961 rd29A

promoter/GUS reporter gene study demonstrated that the rd29A promoter contains

regulatory sequences that are activated upon exposing Arabidopsis to cold, drought, high

salt, and abscisic acid (Yamaguchi-Shinozaki and Shinozaki, 1993). Since the

temperatures on Mars range from 188 K to 240 K (Margulis et al., 1979), Arabidopsis

containing rd29A biosensor could be used to monitor physiological responses to cold

exposure, if systems failed on a growth chamber during a Martian exploration mission. In

addition, Arabidopsis transformed with the rd29A biosensor could be used in concert

with Arabidopsis transformed with DREB2A to monitor physiological responses during

growth in highly saline Martian soil (Clark, 1979).

Plastidal o-3 Fatty Acid Desaturase

The chance that plants could become wounded during growth on the Space

Shuttle, International Space Station, or on Mars is relatively low due to the design of the

growth facilities. However, plants experiencing "space sickness" may inadvertently

activate the pathways that are responsive to wounding. Pathways responsive to wounding

are often connected with the plant hormone jasmonic acid (Reymond and Farmer, 1998).

Jasmonic acid acts as a signal transduction molecule in the activation of wound-inducible

genes (Reymond and Farmer, 1998). The Arabidopsis plastidial co-3 fatty acid desaturase

(FAD7) enzyme responds early in the wound defensive pathway (Nishiuchi et al., 1999).

The FAD7 promoter was studied extensively through various deletion constructs fused to

the GUS reporter gene (Nishiuchi et al., 1999). The -825 base pair fragment of the FAD7

promoter consists of regulatory sequences that respond to both wounding and jasmonic









acid in stems, leaves, and roots (Nishiuchi et al., 1999). Thus, in extraterrestrial

environment, transgenic Arabidopsis containing the FAD7 promoter fused to

sGFP(S65T) (Figure 3-2 a-c) would make an excellent candidate for analyzing actual

wounding or possible inappropriate induction of the j asmonic acid responsive pathway.

Plant Defensin 1.2

Fungal contamination is a common problem when growing plants on nutrient agar

during space shuttle flights (Paul et al., 2001). An Arabidopsis gene known as plant

defensin 1.2 (PDF1.2) contains 5' regulatory sequences that respond both locally and

systemically to fungal pathogen attack (Manners et al., 1998). The -1254 PDF1.2

promoter was linked to GUS in order to identify signals that could induce expression of

the chimeric gene (Manners etal., 1998). The -1254 PDF1.2 promoter/GUS fusion gene

was up-regulated upon exposure to exogenous jasmonic acid, methyl jasmonate, and the

oxidation compound paraquat (Manners et al., 1998). Conversely, the -1254 PDF1.2

promoter/ GUS fusion gene was unaffected by either exogenous treatments with salicylic

acid or general wounding (Manners et al., 1998). Arabidopsis transformed with the -1254

PDF1.2 biosensor can be used to study physiological responses to pathogen correlated

jasmonic acid signal transduction in comparison with wound induced jasmonic acid

signal transduction of the FAD7 biosensor during exposure to microgravity. Similarly,

Arabidopsis transformed with the -1254 PDF1.2 biosensor can be used to study systemic

signal transduction during exposure to microgravity.

Glutathione S-Transferase 6

The National Academies' committee for space biological research recommended

that NASA research should be performed on cell elongation mechanisms in response to

gravitropic signals. Auxin or indoleacetic acid (IAA) is a plant hormone that is directly









involved in signaling cellular elongation (Rayle et al., 1970). The Arabidopsis

glutathione s-transferase (-495 GST6) promoter contains cis-elements that respond to

auxin, salicylic acid, and hydrogen peroxide (Chen and Singh, 1999). The GST6

promoter has been studied through deletion analysis via luciferase reporter gene fusions

(Chen and Singh, 1999). The -495 GST6 promoter was fused to the sGFP(S65T) reporter

gene in order to study Arabidopsis physiology in response to auxin signaling in

connection with gravitropic signaling. The GST6 promoter has the added benefit of

interacting with salicylic acid. A biosensor produced with the GST6 promoter could be

used to study Arabidopsis physiology stimulated by UV-irradiation, since salicylic acid

content increases in many plants upon exposure to UV-irradiation. Collecting data on

Arabidopsis physiology in response to UV-irradiation will be important for Martian

exploration, if plants are exposed to solar UV-irradiation, that is nearly unfiltered by the

thin Martian atmosphere (Zill et al., 1979). Another cis-element in the -495 GST6

promoter is activated by hydrogen peroxide. Therefore, a GST6/sGFP(S65T) biosensor

could be used to study Arabidopsis' physiology upon exposure to reduced gravity, UV-

irradiation, and elevated oxidizing elements.

Small-Auxin-Up-RNA-AC1

In order to further study auxin response in Arabidopsis a small-auxin-up-RNA

gene (SAUR-AC1) that contains 5' regulatory sequences responsive to exogenous auxin

applications (Gil and Green, 1997) was fused to sGFP(S65T) to create a biosensor. A

SAUR-AC1/GUS transgene was previously used to identify specific Arabidopsis organs

that increase GUS activity upon exposure to auxin (Gil and Green, 1997). GUS activity

was elevated in Arabidopsis roots, stems, leaves, and flowers when treated with auxin

(Gil and Green, 1997). The SAUR-AC1 biosensor can be used comparatively with the









GST6 biosensor when observing Arabidopsis responding to auxin flux during growth in a

microgravity environment.

Glutathione Synthetase 2

Both the Viking and Pathfinder missions to Mars provided evidence that Martian

soil has a higher percentage of heavy metal content compared to the percentage of heavy

metal content on earth's continental crust (Rieder et al., 1997). Although heavy metals

are needed in trace levels for plant survival, overexposure to heavy metals can cause

deleterious effects such as chlorosis, necrosis, stunting, leaf discoloration, and root

growth inhibition (Williams et al., 2000). An Arabidopsis glutathione synthetase gene

(GSH2) was cloned into a gsh mutant yeast rescuing the yeast phenotype and restoring

cadmium resistance (Wang and Oliver, 1996). Although GSH2 promoter reporter gene

fusions have not been performed, the GSH2 promoter should respond to heavy metal

exposure since the GSH2 gene is essential for removing excess or unnecessary heavy

metals from plants (Wang and Oliver, 1996). A GSH2 promoter/sGFP(S65T) reporter

gene fusion will make an excellent biosensor for monitoring physiological responses

when Arabidopsis is grown in Martian soil.

Heat-Shock Protein 18.2

The growth chambers that will house Arabidopsis plants during experimental

missions are designed to maintain an average temperature of 240C. Heat shock should not

be a measured physiological response if the chambers are working correctly. If the

chamber failed or if heat shock in an extraterrestrial environment were monitored a

necessary biosensor would be required in order to collect data. The 18.2 KDa heat-shock

protein (HSP18.2) from Arabidopsis is induced by heat shock at the transcript level

(Takahashi and Komeda, 1989). The -913 HSP18.2 promoter contains multiple copies of









HSE-like sequences, which cause chimeric HSP18.2 promoter/GUS genes to induce 10

fold higher than control plants after two hours of exposure to 400C (Takahashi and

Komeda, 1989). The -678 HSP18.2 promoter is specifically induced upon heat shock

making a -678 HSP18.2 promoter/sGFP(S65T) (Figure 3-3 a-c) reporter gene fusion an

ideal biosensor for collecting data on Arabidopsis physiology in response to heat shock

experiments.

Nitrate Reductase 1

Highly sophisticated nutrient delivery systems have been developed by NASA

space biologists and engineers in order to insure that plants receive all necessary nutrients

during space flight growth experiments (Dreschel et al., 1994). Nitrate is an essential

nutrient for plant survival. Nitrate reductase (NR1) is a key enzyme involved with

nitrogen assimilation and is induced directly by the uptake of nitrate (Lin et al., 1994).

The -1443 NR1 promoter region was fused to the chloramphenicol acetyltransferase

(CAT) reporter gene, during deletion analysis studies of the NR1 promoter, which proved

that the NR1 promoter was directly induced by nitrate exposure (Lin et al., 1994).

Transgenic Arabidopsis that contain a biosensor consisting of the -1443 NR1

promoter/sGFP(S65T) reporter gene fusion could test the efficiency of nutrient delivery

systems developed for space flight. In addition to nitrate, the NR1 gene is partially

controlled at the transcript level when stimulated by cytokinin (Lu et al., 1990), sucrose

(Cheng et al., 1992), and photosynthetically active radiation (Cheng et al., 1992).

Arabidopsis containing the NR biosensor could be used to establish a baseline diurnal

pattern for a living organism on Mars, since NR mRNA expression is in tune with the

circadian rhythm (Lin et al., 1994).









Touch 4

Performing experiments on board space faring instruments presents unique

opportunities to study Arabidopsis cell wall physiology. Cell wall xyloglucan are

modified by an Arabidopsis xyloglucan endotransglycosylase (XETs) gene family

(Campbell and Braam, 1999). Touch 4 (TCH4) is a XET gene that responses to touch,

darkness, temperature shock, auxin, and brassinosteroids (Campbell and Braam, 1999).

Previous studies showed that a -958 5' sequence of the TCH4 gene could drive GUS

expression in leaves, roots, trichomes, flowers, and siliques (Campbell and Braam, 1999).

Arabidopsis exposed to microgravity may respond in the same manner as Arabidopsis

plants exposed to physical touch on earth. Such a hypothesis could be tested using,

Arabidopsis plants transformed with a biosensor such as the -959 TCH4/sGFP(S65T)

transgene.


Conclusion

Collecting data on Arabidopsis physiology in response to potential stresses

incurred during growth in environments such as the Space Shuttle, the International

Space Station, Mars greenhouses, and other extraterrestrial systems requires a

noninvasive system that produces telemetrically attainable results. Transgenic

Arabidopsis encoding chimeric promoter/sGFP(S65T) reporter gene fusions provide a

means for collecting telemetrically attainable results. The following promoters were

subcloned, upon PCR amplification from Arabidopsis genomic DNA, into secondary

vectors (APX1, ARG1, GST6, SAUR-AC1, DREB2A, PDF1.2, and TCH4). These

promoters are available for cloning into primary binary vectors, and then subsequent

cloning into Arabidopsis. The Arabidopsis biosensor lines (ADH, FAD7 HSP18.2, CHIB,









NR1, RD29A, GSH2/sGFP(S65T)) produced here cover a variety of physiologies that

should provide evidence about plant physiological responses to changes during growth in

extraterrestrial environments versus similarly controlled earth based environments.


Materials and Methods

Cloning Strategy

Each promoter was amplified from Arabidopsis strain WS genomic DNA using

specific primers that contained restriction sites at the ends of the sequences. Upon

amplification the PCR fragments (Figure 3-4) were subcloned into either pucl8 or PCR

BLUNT (Invitrogen). Then the promoter-vectors were transformed into E. coli strain

DH10B (Life Technologies). The promoter-vectors were harvested from the bacteria

using standard alkaline lyses techniques. The promoter-vectors were digested to release

the promoters, which were purified and collected from 1% agraose gels using the

Stratagene strataprep DNA gel purification kit. The promoters were cloned into either

pBI101 vectors or pCAMBIA 1300 vectors plant binary vectors. The promoter-binary-

vectors were transformed into E. coli strain DH10B. The promoter-binary-vectors were

harvested from the bacteria using standard alkaline lyses techniques. The purified vectors

were introduced into Agrobacterium tumefaciens strain GV3101, which was then used for

transforming Arabidopsis via vacuum infiltration (Bechtold and Pelletier, 1998).

Additional Positive Controls

In addition to the pBI121sGFP(S65T) positive control construct another positive

control pCAMBIA 1300 CAMV35S/sGFP(S65T)/NosT was developed to represent the

pCAMBIA constructs (Figure 3-5 a-c). The original positive control used in the time-

lapse studies was not always consistent in expression level or pattern. Even after four






67


generations (F5) of selection the positive control remained inconsistent. The original

construct was reintroduce into the Arabidopsis genome. This reintroduction produced a

positive control that had a consistent GFP expression pattern after three generations of

selection (Figure 3-6).

























Figure 3-1. Genomic ChiB Gene Map, ChiB/GFP Vector Map, and Sequence
Data. a) Map representing the promoter sequence of the ChiB gene. The
symbols labeled as primers indicate where the primers were designed to anneal
to genomic DNA during the PCR reaction. b) Vector map of the
ChiB/sGFP(S65T) biosensor represents the vector and cloned transgene. The
portion labeled as sequenced area corresponds to the chromatogram in figure
3-1-c. c) Chromatograms that correspond with the labeled portion of the vector
construct map. d) Genomic ChiB gene map, ChiB/GFP vector map, and
sequence data. Raw sequence directly from the chromatograph. The green
letters represent GFP sequence and the black letters represent promoter
sequence.












Avd (1013)

ClaI (998

ApcLI (97

EccRI (724)

er

1I) |


primer
\


PstI (1564)

ApLI (16:


BanHI(1990)

Repeat Region 18 Repeat Region 19

S CDS(T2E22.18)19 Ncol (3012)


AC069474 chib gene
3020 bp


Xbal (
sequenced
Cil (10496)
ChiB promote


NcoI (9916)


35S promoter


pCAMBIA1300sGFP(S65T)Chil
10915 bp


left border


Clic (6487)


5' prim

Ned (4


resistance)


II L











70




GC CGT C CAGC TCGAC CAGGATG GGCAC CAC CCCGGTGAACAGC TCCT CGCCCTTGCTCAC CAT T CTAGAGAAAGATATATAT


ATAGATCCAATTAATGATTGTTTTATCACATCAAATTCTATCGTTTTCCATAGTTTATTGTTTGTTATGTCTATGGAG


AGT GTGGE TATGGGGAACAAACAGTATTT GGT A GGTTTGTTTTTGAT TATATTTATTTTC TTCTTCATTGTT GT A


UatP
1IANAF

















IMgat
CVAP





























CHVP


TAGGTTAGATATTGATTTGTTT TTTT GGGGATTATCATGTTAATTCCAAGTAAT GAGAACTTTCTATGTATGAAAC


ItPat
1IANAF
CH/P


\C T GTGC TAA ATATT GGTAGAAGAATA CAAAT TTTAGAAGACCAAAGGCATAACATAT TACAC TC TTTTT GAGT TTT


CUtP


\C T GTGC TAA ATATT GGTAGAAGAATA CAAAT TTTAGAAGACCAAAGGCATAACATAT TACAC TC TTTTT GAGT TTT


Figure 3-1 continued


15Y











71






TTT GTTCTAAAGTTAC TAT CGACGTAGATAGTGGGACACAAAGGTC GTAAAATTTT GGGTG GTC TGAAAACAC GTTTAC


TAC T CGAGTTGCG GAC TAAT CGATGATCTGAG CTAGTGTGCACTAATTA ATCAAACA CACACAT ATT CG GATATTC CC


ECCTATGATGTATACACAATACTTGACTATATCTAAAACAAGATCACAAGAGTTGCATGAATAGT CAAGAAAATGTATA


Ut/P


















CH/P
PF-at
MML41F
CH/p


TAAC GTGG AGA AAA TAA AA ATAG A CCGT GT CTAA ATA TTTAAC TAT GA T CAAT GTTGACAAAAAC AAAA TTTAAC TTTA


Iteat
MIANA
oH/P


AA TTATGAATATGANGCG GCGGGTTCGTGATCNA C TTTTT CAAAAAACAATTGAGACAT TT




MANAF
H/PA







AA TTATGAATATGA G C G G CG GGTTCGTGATCNAC TTTTT CAA A AAACAATTGAGACATTTA NAATT CATTTA TA A


Figure 3-1 continued


156












d

TCTAGAGAAAGATATATATAGATCCAATTAATGATTGTTT
TATCACATCAAATTCTATCGTTTTCCATAGTTTATTGTTTGTTATGTCTATGG
AGTGTGGCTATGGGGAACAAACAGTATTTGGTAGGTTTGTTTTTGATTATAT
TTATTTTCCTTCCTTCATTGTTGCTAGGTTAGATATTGATTTGTTTTTGGGG
GATTATCATGTTAATTCCAAGTAATGAGAACTTTCTATGTATGAAACTGTGC
TAAATATTGGTAGAAGAATACAAATTTTAGAAGACCAAAGGCATAACATAT
TACACTCTTTTTGAGTTTTTTGTTCTAAAGTTACTATCGACGTAGATAGTGGG
ACACAAAGGTCGTAAAATTTTGGGTGGTCTGAAACACGTTTACTCGAGTT
GCGGACTAATCGATGATCTGAGCTAGTGTGCACTAATTAATCAAACACACA
CATATTCGGATATTCCCTATGATGTATACACAATACTTGACTATATCTAAAA
CAAGATCACAAGAGTTGCATGAATAGTCAAGAAAATGTATAACGTGGAGA
AAATAAAAATAGACCGTGTCTAAATATTTAACTATGATCAATGTTGACAAA
AACAAAATTTAACTTTAATTATGAATATGANGCGGCGGGTTCGTGATCNAC
TTTTTCAAAAAACAATTGAGACATTT


Figure 3-1 continued





















Figure 3-2. Genomic FAD7 Gene Map, FAD7/GFP Vector Map, and
Sequence Data. a) Map representing the promoter sequence of the FAD7
gene. The symbols labeled as primers indicate where the primers were
designed to anneal to genomic DNA during the PCR reaction. b) Vector
map of the FAD7/sGFP(S65T) biosensor represents the DNA that is found
inside the T-DNA borders of the pBI121 vector. The portion labeled
sequenced area corresponds to the chromatograms in figure 3-2-c. c)
Chromatograms that correspond with the labeled portion of the vector
construct map d) Genomic FAD7 gene map, FAD7/GFP vector map, and
sequence data. Raw sequence directly from the chromatograph. The
sequence only represents the promoter.








74




Nco I (29) 3' primer

5' primer TATA Signal 1 CDS(FAD7) 1







ATHFAD7COL
1084 bp
a





sequenced area

sGFP(S65T)

-1084 FAD7



Tnos

Nco (4198) \EcoRI (1004)

Hm dIII (4165)
121FAD7sGFP(S65T)
5253 bp
Ava I(1416)

Clal (3752)


Tnos /6 Pnos


(2234)


Nco 1(2613)











75




NGAAGCGACCCNAAC CTT TTTNAGGATGGG CA C CNG NCCGGNGAACAG NT CCTCGCCCTTGCTCAC CAT TNTA NACATT











SG AA GCGA CCCN A AC CTT TTT NAG G ATGGG CA C CN G NC CGG NGAA CAG NT C CT CG C CCT T G C T CAC CAT T NTA NACATT





TTTTCTT GAG C TC TCT CCCCAGAGT GAAAAGT CT CN CITT CCNT TNTTT GGNGAGTTTC T G CNAT GA AT GAGT GGNG G


1630 Bmat
IMAPAF
0 1 "&kv d





TTTTCTT GAG C TCT CT CCCCAGAGT GAAAAGT CT CN CITT CCNT TNTTT GGN GAGTTTC T G CNATGA AT GAGT GNG G






UTAATAGANAAAGAGATAANGTGT GNGAGAGAAACTTGTGTTNTCTACTTTGC T TATC GTCTCTCAATNTCTATCTCT


1630 Thgat








UTAATAGA AAAGAGATAA NGTGTG NGAGAGAAAC T T GTGTTN T C TAC T T T GC T TAT C GT C T C TCAA TNTCTATCTCT





TGTCTCTGGNTCGCACGCTTATGNCTTATATAANTTAGCTACAACTTGAAAGGAGAAGGAAATTTATTAGCGATGGC


P1hat
MAHAF
16iJ B mP





TGTCTCTGGNTCGCACGCTTATGNCTTATATAANTTAGCTACAACTTGAAAGGAGAAGGAAATTTATTAGCGATGGC






GT GAT GT GAGATTTTTNTTTGT GACGGTCAAT TTANAC ACAAAGN T GNGGT T NCAACATGG GT NCNGAT TGAT CT CGTT


1690 I te
MAHAF






3GT GAT GT GAGATTTTNTTT GT GACGGTCA AT TTA NAC ACAAAG NT GNGGTTNCAACATGG GT NCNGAT TGATCT CGTT


Figure 3-2 continued














d
NGAAGCGACCCNAACCTTTTTNAGGATGGGCACCNGNCCGGNGAACA
GNTCCTCGCCCTTGCTCACCATTNTANACATTATTTTCTTGAGCTCTCTC
CCCAGAGTGAAAAGTCTCNCTTTCCNTTNTTTGGNGAGTTTCTGCNATG
AATGAGTGGNGGTAATAGANAAAGAGATAANGTGTGNGAGAGAAACT
TGTGTTNTCTACTTTGCTTATCGTCTCTCAATNTCTATCTCTGTCTCTGG
NTCGCACGCTTATGNCTTATATAANTTAGCTACAACTTGAAAGGAGAA
GGAAATTTATTAGCGATGGCGTGATGTGAGATTTTTNTTTGTGACGGTC
AATTTANACACAAAGNTGNGGTTNCAACATGGGTNCNGATTGATCTCG
TTTTAATTCTTGTTTTGGC


Figure 3-2 continued

























Figure 3-3. Genomic HSP18.2 Gene Map, HSP18.2/GFP Vector Map, and
Sequence Data. a) Map representing the promoter sequence of the HSP18.2
gene. The symbols labeled as primers indicate where the primers were
designed to anneal to genomic DNA during the PCR reaction. b) Vector map
of the HSP18.2/sGFP(S65T) biosensor represents the vector and cloned
transgene. The portion labeled as sequenced area corresponds to the
chromatogram in figure 3-3-c. c) Chromatograms that correspond with the
labeled portion of the vector construct map. d) Raw sequence directly from
the chromatograph. The green letters represent GFP sequence and the black
letters represent promoter sequence.











3' primer
Promoter E 1
Misc Feature 6
Misc Feature 5
Misc Feature 4

Misc Feature 3
Misc Feature 2

Misc Feature 1 BI










ATHSP182
1398 bp


Clal (1143)

Hm dIII (1206)

Misc Feature 8
PstI (1359)







I


Xba l(10593)


HSP18.2 promoter sGFP(S65T)
HindIII (9909) Sac I (735)
right border 7 Tnos
1 EcoRI (1002)
35S promoter
Xma I (2049)
Sma I(2051)
pCAMBIA1300sGFP(S65T)HSP18.
pCAM A1 s. hptll (hygromycin resistance)
10597 bp


left border


Clal (6491)


-y


5' primer


a











79




CCGT CCAG C T CGAC CAGGATGG GCAC CAC C CCGGTGAACAG C TC CT CGC C CTTGCTCAC CA TT CTAG AG CTGAT T TGAT CTGA














CCGT CCAG C T CGAC CAGGATGG GCAC CAC CCCGGTGAACAG CTC CT CGC CCTTGCTCAC CA TT CTAG AG CTGAT T TGAT CTGA

TAG CAAAGGACATATTTATAGGGAAGT TA GAGGAT GAAGAGAGAATGT TCTT CGAGTTTCTTGAATAGAATAGAAAAT














TAG CAAAGGACATAT T TATAGGGAAGT TA GAGGAT GAAGAGAGAATGT TCTT CGAGTTTCTTGAATAGAATAGAAAAT

GCTCCTTTTTCTAAAACCTTCGCGTGGAGTCTTTAGAACACATACACAATGATCACTGTGGTGAAATGACCAGATTT














GCTCCTTTTTCTAAAACCTTCGCGTGGAGTCTTTAGAACACATACACAATGATCACTGTGGTGAAATGACCAGATTT

TTCTTGGCAT TTCAGGAAGTTT C GTTT GT TGAAACAAGAC CGAAATGCAATC CTTGGT TA CAA T TAAAACTACGT GC














TTCTTGGCATTTCAGGAAGTTTCGTTTGTTGAAACAAGACCGAAATGCAATCCTTGGTTACAATTAAAACTACGTGC

T GCCGTTTTGC TTTGTTGTTGTATTAT CAT C TTCGAGAAACGGGC TAAGTGAAGCGGATCTT CTTTGCAAAAGCCCA














T GCCGTTTTGC TTTGTTGTTGTATTAT CAT C TTCGAGAAACGGGC TAAGTGAAGCGGATCTT CTTTGCAAAAGCCCA

ATTTCT TAATAG GT C GGAAATG GAATTTAAGAAAATCTAAC TCAGAGAAAAGAGGACAAAAT CAAGATTTA AGATTAT



BI~Pm


Figure 3-3 continued


r


I


I

D











80







T TAGC TTTTCGCCAAAGGAAAACTATAGTAAG TTCTCGCAATAAC AGTAGGCACTAAATTT CC GAGAATGTCAACAAT



MANAF









T TA GC TT TCGCCAAAGGAAAACTATAGTAAG TT CTCGCAATAAC AGTAGGCACTAAATTT CC GAGAATGTCAACAAT




AATC TATTA ATG GATTTTT TT GTCTC CATATATAC AAGAACTGAAC CACGTTTT TGGT GAC AAACA TAGA CAACA T A T T


MANAF


AATC TATTA ATG GATTTTT TT GTCTC CA TATATAC AAGAACTGAAC CACGTTTT TGGT GAC AAACA TAGA CAACA T A T T




PTTACTAAACAAG TNAACTAAAAAAAAAAAAAA TCTAAATG ATTC GA TTCAAGTATC AGTTAC T GNGATCAAA TC T



MANAF









PT TA CTAAACAAG T NAACTAAAAAAAAAAAAAA TCTAAATG ATTC GA TTCAAGTATC AGTTA C T GGATCAAA TC T






TCAAC T TATT TATT GC CT G NTCATGGT CAT G C TT NGAACCCAGAAAGAAAATGACCATTAAG CCTTG



AMANA









TCAAC T TATT TATT GC CT G -TCAT GGT CAT G C TT -GAACCCAGAAAGAA A A TGACCATTAAG CCT TG G C A C TTGG CCCGT


Figure 3-3 continued












d

GAGCTGATTTGATCTGATTAGCAAAGGACA
TATTTATAGGGAAGTTAGAGGATGAAGAGAGAATGTTCTTCGAGTTTC
TTGAATAGAATAGAAAATGCTCCTTTTTCTAAAACCTTCGCGTGGAGT
CTTTAGAACACATACACAATGATCACTGTGGTGAAATGACCAGATTTT
TCTTGGCATTTCAGGAAGTTTCGTTTGTTGAAACAAGACCGAAATGCA
ATCCTTGGTTACAATTAAAACTACGTGCCGTTTTGCTTTGTTGTTGTAT
TATCATCTTCGAGAAACGGGCTAAGTGAAGCGGATCTTCTTTGCAAAA
GCCCATTTCTTAATAGGTCGGAAATGGAATTTAAGAAAATCTAACTCA
GAGAAAAGAGGACAAAATCAAGATTTAAGATTATTAGCTTTTCGCCAA
AGGAAAACTATAGTAAGTTCTCGCAATAACAGTAGGCACTAAATTTCC
GAGAATGTCAACAATCTATTAATGGATTTTTTTGTCTCCATATATACAA
GAACTGAACCACGTTTTTGGTGACAAACATAGACAACATATTTACTAA
ACAAGTNAACTAAAAAAAAAAAAAATCTAAATGATTCGATTCAAGTA
TCAGTTACTGNGATCAAAATCTCAACTTATTTATTGCCTGNTCATGGTC
ATGCTTNGAACCCAGAAAGAAAATGACCATTAAGCCTTG


Figure 3-3 continued






































Figure 3-4. One Percent Agarose Gel Showing Promoters Amplified from Genomic
DNA by PCR.
Lane 1-ARG promoter
Lane 2-SAUR-AC1 promoter
Lane 3-NR1 promoter
Lane 4-RD29A promoter
Lane 5-ChiB promoter
Lane 6-FAD7 promoter
Lane 7-GSH2 promoter
Lane 8-PDF1.2 promoter

























Figure 3-5. pCAMBIA Positive Control Vector Map and Sequence Data. a)
Vector map of the CaMV 35S/sGFP(S65T) positive control biosensor
(pCAMBIA vectors) represents the vector and cloned transgene. The portion
labeled as sequenced area corresponds to the chromatogram in figure 3-5-b.
The pCAMBIA 1300 vector was engineered to contain the CaMV 35S
promoter sGFP(S65T) reporter gene NosT terminator sequence from the
pBI121sGFP(S65T) vector in figure 2-1-a. b) Chromatograms that
correspond with the labeled portion of the vector construct map. c) Raw
sequence directly from the chromatograph. The green letters represent GFP
sequence and the black letters represent promoter sequence.


















Saci(10485)


sequenced

35S promo


35S promoter

Xma (1048)

Sma I (1050)


right border---

left border
pCAMBIA1300CaMV35SsGFP(S65T)

10751 bp


a





Cla (5490)



TT CGGT CGC CGT C CAG CT CGACCAGGATGGGCACCAC CCCGGTGAACA GCT CCT CGCCCTTGCTCAC CAT T CTAGAGT CCCCC


Bgat


TTCGGT CGCCGTCCAGCT CGACCAGGATGGGCACCAC CCCGGTGAACA GCT CCT CGCCCTTGCT CAC CAT T CTAGAGT CCCCC


CGTGTTCTCTCCAAAATGAAGAAAAACTTCCTTATATAGAGGAAGGGTCTTGCGAAGGATAGTGGGATTGTGCGTCATCCC


CGTGTTCTCTCCAAATGAAGAAAACTTCCTTATATAGAGGAAGGGTCT T GCGAAGGATAGTGGATTGTGCGTCAT C CC


16fm











85







CCCTTACGTCAGTGGAGATATACCATCAAT CCACTTGCTTTGAAGAC GT G0TT GGAAC GT CTT TT TT CAC GAT


MIAAP
a3P


TGCTCC TCGT GGT OGGGGTCCATCTTT OGGACCACTGTCGGCAGAGGCATCTTCAACGATGGCCTTTCCTTTATCG


MAIAF
a3P


TGCTCCTCGTGGGTGGGGGTCCATCT TT GGAC CACTGTCGGCAGAGGCATCT TCAACGATGGC CTTTCCTTTATCG


G CA AT GA TGGCATTTGTAGGAGC CAC CT TCCTTTTCCAC TAT C TTCACAA TA A AGT GACA GATAGC T GGGCAAT GGA


MIAAP
3SP


AATC CGAGGAGGTTTC CGGATATTAC CCTTTGTTGAAAAGTCTCAATTCC C CTTTGT TTCTGAGACTOTATCT TTG


MAIAF
a3P


Figure 3-5 continued










86



GATA TTTTTGGAGTAGACAAGTGTGTC GTGCTC CAC CAT GT T GACGA AGATTTT CT T CTT GTC AT TGAGT CGTAAGAG


GACTC TG TAT GAACT G TTCGCC AGT CTT TACGGCGAGTTCTTGTTAGGT CC TC TATT TGAA T CT TTGAC T CCAT GGCC T


16A0 CC A ACCCCCCA







GACTC TGTAT GAACT G TTCGCC AGT CTT TACGGCGAGTTCTTGTTAGGT CC TC TATT TGAA T CT TTGAC T CCAT GGCC T


TT TG AT T CAAGTG GGAAAC CCTTTTTTAGAGACT CCAAT CTCTATTAC TTGCCCTTGGTTTGGGAANCAAGC CT TGAATCC


160C







TT TG A T T CAAGTG GGAACTA CCTTTTTTAGAGACT CCAAT CTCTATTAC TT GCCCTT G GTTT G G GAAN CAAGC CT TGAATCC


TCG TCC ATTACK TG GAANA GTAC T T CTG AT


16(


TCG TCCATTAC TG GAANA GTAC T T CTG ATCTTTGANAAANAA A T CT TT CT CT GNGCT CCT TGA NG CA AN NAAGN CC TGGA A N


Figure 3-5 continued













C

AGTCCCCCGTGTTCTCTCCAAA
TGAAATGAACTTCCTTATATAGAGGAAGGGTCTTGCGAAGGATAGTGG
GATTGTGCGTCATCCCTTACGTCAGTGGAGATATCACATCAATCCACTT
GCTTTGAAGACGTGGTTGGAACGTCTTCTTTTTCCACGATGCTCCTCGT
GGGTGGGGGTCCATCTTTGGGACCACTGTCGGCAGAGGCATCTTCAAC
GATGGCCTTTCCTTTATCGCAATGATGGCATTTGTAGGAGCCACCTTCC
TTTTCCACTATCTTCACAATAAAGTGACAGATAGCTGGGCAATGGAAT
CCGAGGAGGTTTCCGGATATTACCCTTTGTTGAAAAGTCTCAATTGCC
CTTTGGTCTTCTGAGACTGTATCTTTGATATTTTTGGAGTAGACAAGTG
TGTCGTGCTCCACCATGTTGACGAAGATTTTCTTCTTGTCATTGAGTCG
TAAGAGACTCTGTATGAACTGTTCGCCAGTCTTTACGGCGAGTTCTTGT
TAGGTCCTCTATTTGAATCTTTGACTCCATGGCCTTTGATTCAAGTGGG
AACTACCTTTTTTAGAGACTCCAATCTCTATTACTTGCCCTTGGTTTGG
GAANCAAGCCTTGAATCGTCCATTACTGGAANAGTACTTCTGAT


Figure 3-5 Continued












































Figure 3-6. Original Positive Control Plant vs. "Ultrabright" Positive Control
Plants. a) Original positive control containing the CaMV35S/sGFP(S65T)
transgene. Although, the Arabidopsis lines were screened over four generations, a
consistent positive control was not produced. b) "Ultrabright" positive control
containing the CaMV35S(S65T) transgene. The need for a consistent positive
control prompted the retransformation and rescreening of Arabidopsis lines to
produce the current version shown above.















LIST OF REFERENCES


Baulcombe DC, Chapman S, Santa Cruz S (1995) Jellyfish green fluorescent
protein as a reporter for virus infections. Plant J 7: 1045-1053

Bechtold N, Pelletier G (1998) In plant Agrobacterium-mediated transformation
of adult Arabidopsis thaliana plants by vacuum infiltration. Methods Mol Biol 82:
259-266

Bevan M, Barnes WM, Chilton MD (1983) Structure and transcription of the
nopaline synthase gene region of T-DNA. Nucleic Acids Res 11: 369-385.

Bevan MW, Flavell RB, Chilton MD (1992) A chimaeric antibiotic resistance
gene as a selectable marker for plant cell transformation. 1983. Biotechnology 24:
367-370

Bomhoff G, Klapwijk PM, Kester HC, Schilperoort RA, Hernalsteens JP,
Schell J (1976) Octopine and nopaline synthesis and breakdown genetically
controlled by a plasmid of Agrobacterium tumefaciens. Mol Gen Genet 145: 177-
181.

Campbell P, Braam J (1999) In vitro activities of four xyloglucan
endotransglycosylases from Arabidopsis. Plant J 18: 371-382

Chen W, Singh KB (1999) The auxin, hydrogen peroxide and salicylic acid
induced expression of the Arabidopsis GST6 promoter is mediated in part by an
ocs element. Plant J 19: 667-677

Cheng CL, Acedo GN, Cristinsin M, Conkling MA (1992) Sucrose mimics the
light induction of Arabidopsis nitrate reductase gene transcription. Proc Natl Acad
Sci U S A 89: 1861-1864.

Chilton MD, Drummond MH, Merio DJ, Sciaky D, Montoya AL, Gordon
MP, Nester EW (1977) Stable incorporation of plasmid DNA into higher plant
cells: the molecular basis of crown gall tumorigenesis. Cell 11: 263-271.

Chung HJ, Ferl RJ (1999) Arabidopsis alcohol dehydrogenase expression in
both shoots and roots is conditioned by root growth environment. Plant Physiol
121: 429-436















Chung SK, Parish RW (1995) Studies on the promoter of the Arabidopsis
thaliana cdc2a gene. FEBS Lett 362: 215-219

Clark BC (1979) Chemical and physical microenvironments at the Viking
landing sites. J Mol Evol 14: 13-31.

Cowles J, LeMay R, Jahns G (1994) Seedling growth and development on space
shuttle. Adv Space Res 14: 3-12.

Crameri A, Whitehorn EA, Tate E, Stemmer WP (1996) Improved green
fluorescent protein by molecular evolution using DNA shuffling. Nat Biotechnol
14: 315-319.

Cubitt AB, Heim R, Adams SR, Boyd AE, Gross LA, Tsien RY (1995)
Understanding, improving and using green fluorescent proteins. Trends Biochem
Sci 20: 448-455.

de Bruxelles GL, Peacock WJ, Dennis ES, Dolferus R (1996) Abscisic acid
induces the alcohol dehydrogenase gene in Arabidopsis. Plant Physiol 111: 381-
391

De Greve H, Dhaese P, Seurinck J, Lemmers M, Van Montagu M, Schell J
(1983) Nucleotide Sequence and Transcript Map of the Agrobacreium
tumifaciens Ti Plasmid-Encoded Octopine Synthase Gene. Journal of Molecular
and Applied Genetics 1: 499-511

Dolferus R, Jacobs M, Peacock WJ, Dennis ES (1994) Differential interactions
of promoter elements in stress responses of the Arabidopsis Adh gene. Plant
Physiol 105: 1075-1087

Dreschel TW, Brown CS, Piastuch WC, Hinkle CR, Knott WM (1994) Porous
Tube Plant Nutrient Delivery System development: a device for nutrient delivery
in microgravity. Adv Space Res 14: 47-51.

Fraley RT, Rogers SG, Horsch RB, Sanders PR, Flick JS, Adams SP, Bittner
ML, Brand LA, Fink CL, Fry JS, Galluppi GR, Goldberg SB, Hoffmann NL,
Woo SC (1983) Expression of bacterial genes in plant cells. Proc Natl Acad Sci U
S A 80: 4803-4807.















Gil P, Green PJ (1996) Multiple regions of the Arabidopsis SAUR-AC1 gene
control transcript abundance: the 3' untranslated region functions as an mRNA
instability determinant. Embo J 15: 1678-1686

Gil P, Green PJ (1997) Regulatory activity exerted by the SAUR-AC1 promoter
region in transgenic plants. Plant Mol Biol 34: 803-808

Gil P, Liu Y, Orbovic V, Verkamp E, Poff KL, Green PJ (1994)
Characterization of the auxin-inducible SAUR-AC1 gene for use as a molecular
genetic tool in Arabidopsis. Plant Physiol 104: 777-784

Grebenok RJ, Pierson E, Lambert GM, Gong FC, Afonso CL, Haldeman-
Cahill R, Carrington JC, Galbraith DW (1997) Green-fluorescent protein
fusions for efficient characterization of nuclear targeting. Plant J 11: 573-586.

Haas J, Park EC, Seed B (1996) Codon usage limitation in the expression of
HIV-1 envelope glycoprotein. Curr Biol 6: 315-324

Haseloff J, Amos B (1995) GFP in plants [published erratum appears in Trends
Genet 1995 Sep;11(9):374]. Trends Genet 11: 328-329

Haseloff J, Siemering KR, Prasher DC, Hodge S (1997) Removal of a cryptic
intron and subcellular localization of green fluorescent protein are required to
mark transgenic Arabidopsis plants brightly. Proc Natl Acad Sci U S A 94: 2122-
2127.

Heim R, Cubitt AB, Tsien RY (1995) Improved green fluorescence. Nature 373:
663-664.

Heim R, Prasher DC, Tsien RY (1994) Wavelength mutations and
posttranslational autoxidation of green fluorescent protein. Proc Natl Acad Sci U
SA 91: 12501-12504.

Heim R, Tsien RY (1996) Engineering green fluorescent protein for improved
brightness, longer wavelengths and fluorescence resonance energy transfer. Curr
Biol 6: 178-182.

Helmer G, Casadaban M, Bevan M, Kayes L, Chilton MD (1984) A New
Chimeric Gene as a Marker for Plant Transformation: The Expression of
Escherichia coli B-Galactosidase in Sunflower and Tobacco Cells. Biotechnology
16: 520-527
















Hernalsteens JP, Van Vliet F, De Beuckeleer M, Depicker A, Engler G,
Lemmers M, Holsters M, Van Montagu M, Schell J (1992) The Agrobacterium
tumefaciens Ti plasmid as a host vector system for introducing foreign DNA in
plant cells. 1980. Biotechnology 24: 374-376

Herrera-Estrella L, De Block M, Messens E, Hernalsteens J-P, Van Montagu
M, Schell J (1983) Chimeric genes as dominant selectable markers in plant cells.
EMBO 2: 987-995

Herrera-Estrella L, Depicker A, Van Montagu M, Schell J (1992) Expression
of chimaeric genes transferred into plant cells using a Ti-plasmid-derived vector.
1983. Biotechnology 24: 377-381

Hu W, Cheng CL (1995) Expression of Aequorea green fluorescent protein in
plant cells. FEBS Lett 369: 331-334

Jefferson RA (1987) Assaying chimeric genes in plants: the GUS gene fusion
system. Plant Mol. Biol. Rep. 5: 387-405

Jefferson RA, Kavanagh TA, Bevan MW (1987) GUS fusions: beta-
glucuronidase as a sensitive and versatile gene fusion marker in higher plants.
Embo J 6: 3901-3907

Kohler RH, Cao J, Zipfel WR, Webb WW, Hanson MR (1997) Exchange of
protein molecules through connections between higher plant plastids. Science
276: 2039-2042.

Lam E, Benfey PN, Gilmartin PM, Fang RX, Chua NH (1989) Site-specific
mutations alter in vitro factor binding and change promoter expression pattern in
transgenic plants. Proc Natl Acad Sci U S A 86: 7890-7894

Leffel SM, Mabon SA, Stewart Jr. CN. (1997) Applications of green
fluorescent protein in plants. Biotechniques 23: 912-918.

Lin Y, Hwang CF, Brown JB, Cheng CL (1994) 5' proximal regions of
Arabidopsis nitrate reductase genes direct nitrate-induced transcription in
transgenic tobacco. Plant Physiol 106: 477-484.