Title: Angiotensin II modulation of neuronal calcium current
CITATION PDF VIEWER THUMBNAILS PAGE IMAGE ZOOMABLE
Full Citation
STANDARD VIEW MARC VIEW
Permanent Link: http://ufdc.ufl.edu/UF00100786/00001
 Material Information
Title: Angiotensin II modulation of neuronal calcium current
Physical Description: Book
Language: English
Creator: Evans, Jenafer, 1974-
Publisher: University of Florida
Place of Publication: Gainesville Fla
Gainesville, Fla
Publication Date: 2001
Copyright Date: 2001
 Subjects
Subject: calcium channels, Ca2+ channels, neuron, neuronal culture, angiotensin II
Physiology thesis, Ph. D   ( lcsh )
Dissertations, Academic -- Physiology -- UF   ( lcsh )
Genre: government publication (state, provincial, terriorial, dependent)   ( marcgt )
bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )
 Notes
Abstract: ABSTRACT: In neurons cultured from neonatal rat hypothalamus and brainstem, angiotensin II (Ang II) caused an increase in Ca2+ current. Molecular and pharmacological analyses revealed the presence of all high voltage activated Ca2+ current subtypes in the neurons: L, N, P/Q, and R. The Ca2+ current could be facilitated with a depolarizing voltage pulse, which is indicative of voltage-dependent Ca2+ current inhibition by Gbetagamma subunits. Recovery of inhibition following a depolarizing voltage pulse occurs with a time constant consistent with rates of Gbetagamma reassociation. Ang II partially prevented facilitation, consistent with relief of Gbetagamma inhibition. These data suggest that Ang II, via the Ang II type 1 receptor (AT1R), may increase Ca2+ current by relieving tonic G protein inhibition in a PKC dependent manner. Embryonic or neonatal rat neurons retain plasticity and are readily cultured, but neurons of the adult brain are thought to be non-replenishable, and therefore difficult to culture. Adult neural cell cultures were prepared from brainstem or hypothalamus. Very few adherent cells were apparent in cultures for up to one week, at which time the cell population expanded dramatically. The predominant cell type was immunopositive for alpha-internexin, a neurofilament expressed in developing neurons of the CNS. alpha-internexin positive cells co-immunostained for neuronal markers including MAP2, beta-tubulin III, and tetanus toxin, but were negative for glial markers and for the neurofilaments characteristic of mature neurons. alpha-internexin positive cells incorporated BrdU, suggesting that the neuron-like cells retain the ability to proliferate.
Abstract: Patch clamp analysis revealed voltage gated Na+ currents and small Ca2+ currents, but the cells were unable to fire action potentials, consistent with an immature phenotype. These results show that the cultures are immunologically and electrophysiologically more similar to neurons than glia. The immature neuronal phenotype makes these cells an attractive model system for several neurobiology applications.
Thesis: Thesis (Ph. D.)--University of Florida, 2001.
Bibliography: Includes bibliographical references (p. 92-99).
System Details: System requirements: World Wide Web browser and PDF reader.
System Details: Mode of access: World Wide Web.
Statement of Responsibility: by Jenafer Evans.
General Note: Title from first page of PDF file.
General Note: Document formatted into pages; contains x, 100 p.; also contains graphics.
General Note: Vita.
 Record Information
Bibliographic ID: UF00100786
Volume ID: VID00001
Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
Resource Identifier: oclc - 78536800
alephbibnum - 002729341
notis - ANK7105

Downloads

This item has the following downloads:

JEvans ( PDF )


Full Text











ANGIOTENSIN II MODULATION OF NEURONAL CALCIUM CURRENT


By

JENAFER EVANS
















A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2001


























I dedicate this dissertation to my family and especially my mother, Barba Lee Evans.
They have made countless sacrifices so that I could pursue my dreams.















ACKNOWLEDGMENTS

I would like to acknowledge my committee chair Dr. Craig H. Gelband. The

support, advice, and expertise he shared with me with regarding all aspects of a scientific

career will be invaluable in my future endeavors. I thank the members of my committee

for their dedication to my scientific training and for being friends as well as mentors. I

would like to thank Dr. Colin Sumners for his willingness to discuss my work and for his

efforts to shape my dissertation work into a significant scientific contribution. Dr.

Sumners opened his lab to me, and I feel as much a part of his lab as I feel a part of my

own. I am indebted to Dr. Gerry Shaw who was always willing to share ideas and

expertise. Dr. Mohan K. Raizada's enthusiasm and eagerness to try new techniques or

explore new ideas was both motivating and productive.

I would like to acknowledge Dr. Jeffrey K. Harrison who recruited me to the

University of Florida and who was always eager to share his laboratory resources and his

skills. I give many thanks go to members of the Sumners' lab, past and present, for their

friendship and support. I would like to thank the members of the Gelband lab, past and

present, for their technical support and friendship, particularly that of Miss Jannet

Kocerha and Miss Monica Gardon.

Finally, I thank Mike Norfleet for his confidence in my abilities and for his

incredible patience. I look forward to continuing my life's endeavors with him at my

side.
















TABLE OF CONTENTS

page

A C K N O W L E D G M E N T S ............................................... ............................. ...............iii

L IST O F TA B L E S .... ...... .................................................. .. .. .... .. ............ vi

LIST OF FIGURES .................................................... ............... ... ...... .. vii

A B ST R A C T .................................................................. ................................ ix

CHAPTERS

1 IN TR O D U C T IO N ....................... ........................... .. ........ ..............

Angiotensin II in Blood Pressure Control............................................ 1
Peripheral Actions of the Renin-Angiotensin System............................................... 1
A ngiotensin II in B rain N eurons ................. .... ...................... ....................... ... 2
Signal Transduction Mechanisms of Angiotensin II in Brain Neurons ........................ 3
Short-term Angiotensin II Effects ...................................................... ..... ....... .. 3
Long-term A ngiotensin II Effects ........................................ ........................... 7
C a2+ C channels ................ ................................................................... 8
S u b ty p e s ....................................................................... 8
R egu nation ............................. .............. ...... 14
Neurotransmitter Release ................................. ......... ......... 17
Role of Voltage Dependent Ca2+ Channels .................. ......... ... ....... ........ 17
Role of Angiotensin II in Neurotransmitter Release: Specific Aims ....................... 19

2 ANGIOTENSIN II MODULATION OF CA2+ CURRENT.......................................24

In tro d u ctio n ......................................................... ............... 2 4
M materials and M ethods....................................................... ..................................... 26
Preparation of Neuronal Cultures ........................................................... 26
W hole-cell Patch Clamp and Current Analysis .............................. .............. ... 27
Reverse-Transcriptase Polymerase Chain Reaction (RT-PCR)............................ 27
Protein Isolation............................ ........... .............. 28
Immunoblotting.................. ................................ 28
R e su lts ................................ ....................................................... 2 9
D iscu ssio n ............................................................................................. 3 3









3 DEVELOPMENT OF A NEW MODEL................................... ....................... 51

Intro du action ..................................................... 5 1
M materials and M ethods....................................................... ..................................... 52
Preparation of Neuronal Cultures .......................................................... 52
Norepinephrine Release and Uptake ..... ..................... ................. 53
A ngiotensin II B finding Studies....................................................... ... ................. 54
Protein Isolation............................ ........... .............. 55
Immunoblotting.......................... .. ................ ........ 55
Preparation of Adult Rat Brain-Derived Cultures................................. ........... 55
Passaging of Cultured Cells ........................ ................................ ......................... 56
Cryopreservation of Cultured Cells ........... .................. ...................... 57
Infection of C ultured C ells.............................................................. .................... 57
Im m u n ocy toch em istry .............................................................................................. 58
C current R recording and A nalysis..................................................... ... ................. 59
Proliferation Assay via BrdU Incorporation....................... ..... ............ 59
R e su lts ................................ ....................................................... 6 1
D iscu ssio n ............................................................................................. 6 8

L IST O F R E FE R E N C E S ......................................................................... ....................92

B IO G R A PH ICA L SK ETCH .................................................................. ............... 100































v















LIST OF TABLES



Table Page

1-1. Ca2+ channel subtypes, pharmacology, function, and molecular identities...................22

1-2. Biophysical properties of Ca2+ channel subtypes in expression systems. ...................23

2-1. Primers designed to amplify transcripts of specific Ca2+ channel a-subunits ..............37
















LIST OF FIGURES


Figure Page

1-1. Classic renin-angiotensin pathw ay. ........................................ .......................... 21

2-1. Putative regulation mechanism for non-L type Ca2+ channels. ....................................38

2-2. Ang II increases voltage-gated Ca2+ current via the AT1R ..........................................39

2-3. Changing the holding potential from -80 mV to -40 mV does not significantly alter
the current elicited by a voltage pulse to 0 mV. ................................................40

2-4. Most of the current in the neurons is non-L type, nifedipine insensitive current..........41

2-5. RT-PCR analysis of RNA isolated from co-cultured neurons reveals the presence of
transcripts encoding all Ca2+ current subtypes.........................................42

2-6. Western blot analysis of proteins extracted from neuronal co-cultures reveals the a-
subunits corresponding to each of the subtypes of HVA Ca2+ current. ...............43

2-7. Western blot analysis using an antibody to alic failed to recognize a protein band of
the correct molecular weight in the neuronal protein isolates. ..........................44

2-8. Pharmacological dissection of Ca2+ current in co-cultured neurons reveals the
presence of all HVA current subtypes.. ....................................... ...............45

2-9. Ca2+ current in neuronal co-cultures can be facilitated......................................46

2-10. Recovery from facilitation is consistent with recovery of G3y subunit association....47

2-11. Voltage-dependence of activation. ........................................ .......................... 48

2-12. Ang II and a depolarizing prepulse have differing effects on the current-voltage
relation n sh ip ...................................... .......................... ................ . 4 9

2-13. Ang II and PMA treatment prevent facilitation of Ca2+ current in neuronal co-
cu ltu re s ............. ... ... ......................................................5 0

3-1. Optimization of [3H]-NE uptake in neuronal co-cultures...............................74









3-2. Analysis of TH expression in Sprague Dawley and WKY derived neuronal cultures.. 75

3-3. Optimization of the number of washes prior to stimulation of NE release ..................76

3-4 Effect of Ang II, Cd2+, or nifedipine on [3H]-NE release and uptake ...........................77

3-5. Ca2+ dependence of [3H]-NE release and uptake. .............................. ...... ............ ...78

3-6. Population expansion of cells cultured from adult rat hypothalamus and brainstem
photographed in phase contrast microscopy. ...................................... ........... 79

3-7. Flow cytometric analysis of BrdU incorporation in adult rat brain-derived cultures....80

3-8. Presence of a-intemexin in the absence of neurofilament triplet protein expression
in patterning cells .................................. .................................... 81

3-9. BrdU incorporation by a-internexin positive cells............................................ 82

3-10. Markers indicative of an early neuronal phenotype are expressed in the a-
internexin positive patterning cells.. ........................................ ...............83

3-11. The a-internexin positive cells co-express several well-accepted neuronal
m a rk e rs ...................................... ............................... ................ . 8 4

3-12. a-internexin expression does not overlap with expression of glial markers. .............85

3-13. Patterning cells cultured from adult rat brain express Cd2+ sensitive Ca2+ current.. ...86

3-14. Patterning cells from adult rat brain express Na+ current.........................................87

3-15. Patterning cells survive passaging in tissue culture and retain a-internexin
ex pression ...................................................... ................ . 8 8

3-16. Patterning cells express GFP after infection with a lentivirus construct ..................89

3-17. Western blot analysis of TH expression in adult rat-derived cultures.......................90

3-18. Effect of T3 on astrocyte expression in adult rat brain derived cultures ..................91















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy

ANGIOTENSIN II MODULATION OF NEURONAL CALCIUM CURRENT

By

Jenafer Evans

May 2001

Chairman: Craig H. Gelband
Major Department: Physiology

In neurons cultured from neonatal rat hypothalamus and brainstem, angiotensin II

(Ang II) caused an increase in Ca2+ current. Molecular and pharmacological analyses

revealed the presence of all high voltage activated Ca2+ current subtypes in the neurons:

L, N, P/Q, and R. The Ca2+ current could be facilitated with a depolarizing voltage pulse,

which is indicative of voltage-dependent Ca2+ current inhibition by G3y subunits.

Recovery of inhibition following a depolarizing voltage pulse occurs with a time constant

consistent with rates of Gpy reassociation. Ang II partially prevented facilitation,

consistent with relief of G3y inhibition. These data suggest that Ang II, via the Ang II

type 1 receptor (AT R), may increase Ca2+ current by relieving tonic G protein inhibition

in a PKC dependent manner.

Embryonic or neonatal rat neurons retain plasticity and are readily cultured, but

neurons of the adult brain are thought to be non-replenishable, and therefore difficult to

culture. Adult neural cell cultures were prepared from brainstem or hypothalamus. Very









few adherent cells were apparent in cultures for up to one week, at which time the cell

population expanded dramatically. The predominant cell type was immunopositive for

a-internexin, a neurofilament expressed in developing neurons of the CNS. a-intemexin

positive cells co-immunostained for neuronal markers including MAP2, 3-tubulin III, and

tetanus toxin, but were negative for glial markers and for the neurofilaments

characteristic of mature neurons. a-internexin positive cells incorporated BrdU,

suggesting that the neuron-like cells retain the ability to proliferate. Patch clamp analysis

revealed voltage gated Na+ currents and small Ca2+ currents, but the cells were unable to

fire action potentials, consistent with an immature phenotype. These results show that the

cultures are immunologically and electrophysiologically more similar to neurons than

glia. The immature neuronal phenotype makes these cells an attractive model system for

several neurobiology applications.














CHAPTER 1
INTRODUCTION


Angiotensin II in Blood Pressure Control

Peripheral Actions of the Renin-Angiotensin System

Angiotensin II (Ang II) is the octapeptide product of a series of enzymatic

reactions starting with the cleavage of angiotensinogen by the enzyme renin to produce

angiotensin I (Figure 1-1). Angiotensin I is then cleaved by angiotensin converting

enzyme (ACE) to produce Ang II, the peptide with the broadest range of activities and

highest potency in the cardiovascular system.

Ang II affects cardiovascular function on both the long and short term. The acute,

rapid actions of Ang II are a concerted effort to maintain extracellular fluid volume.

These pressor actions include vasoconstriction, aldosterone secretion leading to salt

retention, water conservation through stimulation of thirst and release of antidiuretic

hormone, increased strength of myocardial contraction, and stimulation of the

sympathetic nervous system to potentiate the vasoconstrictor and ionotropic actions of

Ang II. Chronic elevation of Ang II is associated with vascular smooth muscle

hyperplasia, cardiac hypertrophy and fibrosis, endothelial dysfunction, altered arterial

contractile sensitivity, and renal insufficiency. Prolonged loss of extracellular fluid

volume is not likely to occur in humans, so the chronic Ang II effects are probably

pathophysiological rather than protective.









The circulating renin-angiotensin system (RAS) is a classical endocrine system.

Angiotensinogen, the only known precursor protein for the family of angi otensin

peptides, is produced primarily in the liver. Renin is synthesized and secreted by the

kidney. ACE is synthesized primarily in the lung. These proteins come into contact in

the circulation to produce circulating levels of Ang II.

In addition to the circulating RAS, several tissue RASs exist and contribute to

cardiovascular structure, function, and adaptation to stressors. These tissues can make all

of the components of the RAS, but may also pick up components from the circulation.

The tissues known to have specific systems are the kidney, vasculature, heart, and brain.

Ang II in Brain Neurons

All of the components of the RAS have been found in the brain. Some effects of

Ang II in the brain can be achieved with peripherally administered doses while some

occur only with direct injections to the brain. There appear to be significant differences

between the effects elicited from these two sources of the hormone, since systemic Ang II

can only contact sites that have no blood-brain barrier, such as the circumventricular

organs. The central and peripheral actions of Ang II are therefore entirely independent,

but are focused toward the ultimate goal of maintaining body fluid homeostasis.

High densities of Ang II receptors are located in the hypothalamus and brainstem

(Gehlert et al., 1986; Mendelsohn et al., 1984). Ang II receptor subtypes, the Ang II

Type 1 receptor (AT R) and the Ang II Type 2 receptor (AT2R), are found in these areas,

but are localized to different nuclei and tracts, overlapping only in the superior colliculus.

Radioligand binding, quantitative autoradiography, and in situ hybridization shows the

AT1R to be located in the suprachiasmatic nucleus, the median preoptic nucleus, the

nucleus tractus solitarius, the dorsal vagal nucleus, the paraventricular nucleus, the









median eminence, the organum vasculosum of the lamina terminalis, the lateral

parabrachial nucleus, the supraoptic nucleus, the subfomical organ, and the area

postrema, all nuclei in the hypothalamus or brainstem or structures known to be

circumventricular organs. The areas that contain the AT2R are the inferior olive, the

ventral septum, the lateral septum, the locus coeruleus, the mediodorsal thalamic nuclei,

the medial amygdala, and the medial geniculate nucleus. Activation of the AT1R in the

hypothalamic or brainstem nuclei ultimately leads to physiological changes such as

increased blood pressure, altered baroreflex modulation, increased water and sodium

intake, and increased vasopressin secretion (Hegarty et al., 1996; Phillips, 1987; Sumners

et al., 1994).


Signal Transduction Mechanisms of Ang II in Brain Neurons

Short-term Ang II Effects

Electrophysiological recordings from supraoptic neurons in hypothalamic

explants showed that Ang II, via the AT1R, increased the firing rate and increased

outward current. In the presence of tetrodotoxin, which blocks Na+ current and therefore

action potentials (APs) and subsequent neurotransmitter release, as well as in the absence

of Ca2+, Ang II was still able to effect a net depolarization of the neurons, suggesting that

Ang II acts directly in situ to modify resting membrane potential and neuronal

excitability (Yang et al., 1992).

Because the depolarization induced by Ang II is observed even in the absence of

inward currents Na+ and Ca2+, it is likely that the effect is due to an inhibition of outward

current, commonly carried through voltage gated K+ channels. Indeed, in neurons

cultured from neonatal rat hypothalamus and brainstem, Ang II decreased voltage-gated









K current in a losartan sensitive manner. Additionally, Ang II, via the AT1R, increased

voltage-gated Ca2+ current. These effects were inhibited by intracellular application of

antibodies to phospholipase C-gamma (PLCy), calphostin C and protein kinase C

inhibitor peptide (PKCIP), and were mimicked by superfusion of 4-ac-phorbol myristate

acid (PMA), a protein kinase C (PKC) stimulator. Ang II increased IP3 release as

measured by Dowex chromatography, and increased incorporation of labeled phosphate

from ATP into histones in a PKC activity assay (Sumners et al., 1996). These results,

taken together, suggest that Ang II stimulates a classic Gq coupled receptor pathway to

stimulate voltage dependent Ca2+ current and inhibit voltage dependent K+ current.

In the same model system of neurons cultured from neonatal rat hypothalamus

and brainstem, Ang II increased tetrodotoxin-sensitive AP-firing rate, concurring with the

studies in hypothalamic explants. In addition Ang II increased cadmium (Cd2+) sensitive

subthreshold oscillations in the cultured neurons that are likely to be carried through Ca2+

channels. In contrast to the explant studies wherein the absence of Ca2+ did not alter the

Ang II response, a Cd2+ block of the Ca2+ current decreased the firing rate in the presence

of Ang II. In agreement with the putative signal transduction mechanism, stimulation of

PKC with PMA as well as tetraethylammonium or 4-aminopyridine inhibition of voltage

gated K+ channels, mimicked the effect of Ang II on the firing rate. These results showed

that the substrates underlying the chronotropic effect of Ang II are voltage-gated Ca2+

and K+ channels. The current clamp studies in the cultured neurons also expand on the

findings in the explants regarding the depolarizing actions of Ang II and demonstrate that

the in vitro resting membrane potential is not altered, but the amplitude of the current









stimulus required to reach an AP was decreased, suggesting that the threshold in the

neurons was decreased on Ang II stimulation.

Using different methodology in the same model system, a peptide corresponding

to the 3rd intracellular loop of the AT1R was introduced into the neurons via the patch

pipette (Zhu et al., 1997). The peptide mimicked the effect of Ang II stimulation on K

and Ca2+ current, and these effects were inhibited by introduction of antibodies to Gaq/11.

In accord with the other signal transduction studies in this model, PKCIP and BAPTA (a

Ca2+ chelator) fully alleviated the inhibitory effect of the peptide on the voltage-

dependent K+ current. However, PKCIP and calphostin C, another inhibitor of PKC,

blocked the stimulatory effect on voltage-gated Ca2+ current. Calphostin C or anti-IP3

receptor antibodies alone were unable to block the entire effect of the AT 1R peptide on

K current, indicating the possibility of another contributing mechanism.

Likely to mediate the PKC-independent effect is calmodulin-dependent kinase

Type II (CaMKII) (Zhu et al., 1999). Pretreatment of the neurons with CaMKII

inhibitors including CaMKII 281-302 peptide, KN92, and KN93 attenuates the reduction

of voltage-gated K+ (Ky) current caused by Ang II. Western blot analysis of proteins

isolated from the neonatal cultured neurons revealed the presence of CaMKII a and 3

isoforms. The Ang II decrease in K+ current is mimicked by intracellular application of

active CaMKII.

Pharmacological dissection of the K+ current shows that the non-inactivating

current modulated by Ang II was sensitive to TEA, 4-AP, and low doses of quinine.

Despite the presence of the mRNA for Kv subunits 2.2 or 3. lb, only Kv2.2 was present at

the protein level. Coupling of Kv2.2 and Ang II did occur in oocytes injected with the









appropriate mRNAs, implicating this subtype ofK current as a substrate for the Ang II

actions (Gelband et al., 1999). Ang II was also shown to decrease the conductance and

open probability of A-type single channels in whole-cell, outside-out patch, and cell-

attached patch experiments on neuronal cultures (Wang et al., 1997). A-type channels

therefore underlie the Ang II modulation of the transient component of the whole cell K

current.

Activation of the AT2R had an apparently opposite effect on K+ current in the

neuronal cultures (Kang et al., 1993). Ang II, via the AT2R, stimulated TEA-sensitive Kv

current and A-current. Charybdotoxin and apamin, which block Ca2+ activated K

current subtypes did not block the AT2R-mediated effects of Ang II. No alteration of

voltage-gated Ca2+ current was observed with AT2R activation. Although some groups

have proposed antagonistic effects of the two Ang II receptor subtypes, recent studies

suggest that the AT2R pathway stimulates AP firing rate, similar to the situation with the

AT1R (Zhu et al., personal communication).

Interestingly, all of the Kv recordings in the AT 1R studies were conducted in the

presence of Cd2+ which blocks voltage-gated Ca2+ current, suggesting that the role of the

Ca2+ current is not solely to contribute to Ca2+-dependent components of the pathway

(such as PKC or CaMKII) resulting in the decrease in K+ current. Unlike the situation

with the K+ current, all of the acute Ang II effects on Ca2+ current seem to require PKC

activity. While K+ current largely determines the resting membrane potential and

ultimately the excitability of neurons, Ca2+ current generally acts to shape the AP and

subsequent signaling pathways. Therefore, Ang II may alter K+ current for acute

chronotropic results and Ca2+ current for other consequences.









Long-term Ang II Effects

In addition to the acute effects of AT 1R activation, neuromodulation by Ang II

can also involve transcriptional and translational events, and involve signal transduction

pathways distinct from those that cause the acute changes in membrane excitability. The

dissociation of the G-protein ac and 3y subunits may liberate the 3y subunits for

interaction with membrane-associated factors causing activation of the small G-protein,

Ras. Indeed, incubation of neuronal co-cultures with Ang II resulted in the activation of

Ras, which is known to require G3y, as judged by an increase in the ratio of GTP-bound

Ras to GDP-bound Ras. The ratio reached a maximum between 5 and 10 minutes after

Ang II treatment, and falls back to control levels in an hour. Ang II stimulated activity

and phosphorylation of Raf-1 on a similar time scale, consistent with the idea that

activated Ras in turn activates Raf-1. The MAP kinase (MAPK) activity is increased on

the same timescale, and likely underlies the stimulation of tyrosine hydroxylase (TH)

activity and TH mRNA that begins within about an hour of Ang II treatment, and peaks

at about 4 hours (Yang et al., 1996). In another study, activation of MAPK by Ang II

resulted in its translocation to the nucleus. This translocation has been shown to mediate

activation of serum-response element (SRE) binding activity, c-fos gene expression, and

AP1 binding activity (Lu et al., 1996). Initiation of these transcription factors by Ang II

may result in their binding to the API binding site on the promoter regions of TH and

norepinephrine transporter (NET) genes, explaining the increase in NET and TH mRNA

expression in co-cultured neurons after chronic (4-hour) treatment with Ang II (Lu et al.,

1996; Yu et al., 1996). These results, taken together, suggest a stimulation of the

Ras/Raf/MAPK pathway via the AT1R, resulting in an increase in production and activity









of the TH enzyme, which is the first enzyme in the production pathway for

catecholamines, and in the NET protein. The Ras/Raf/MAPK pathway, then, likely

mediates long-term effects of Ang II on NE modulation.


Ca2+ Channels

Subtypes

Ca2+ influx through voltage-gated Ca2+ channels plays a major role in many

cellular processes, including muscle contraction, neurotransmitter release, and signal

transduction. Distinctions between various types of voltage-gated Ca2+ channels have

historically been based on functional properties such as distribution, pharmacology,

single-channel conductance, and voltage-dependent kinetics. Early studies of cardiac and

skeletal muscle electrophysiology pointed to two groups of Ca2+ channels: high voltage

activated (HVA) and low voltage activated (LVA).

LVA Ca2+ channels support pacemaker activity in the heart and Ca2+ entry at

negative membrane potentials. They are termed T-type, because of their transient

kinetics during a voltage pulse caused by rapid activation and slow deactivation. They

are less Cd2+ sensitive than HVA channels, and more sensitive to nickel, amiloride, and

octanol (Tsien et al., 1991).

Functional studies defined the major pathway for voltage gated Ca2+ entry in

cardiac, smooth muscle, and skeletal muscle cells as through HVA L-type channels. The

L-type channels are sensitive to 1,4 dihydropyridines (DHP) such as nifedipine, are

sensitive to the Ca2+ channel antagonists verapamil and diltiazem, and are found in

virtually all excitable tissues and in many non-excitable cells (Tsien et al., 1991).









Molecular and pharmacological tools have revealed a number of DHP-insensitive

HVA Ca2+ channels expressed predominantly in the nervous system. The N-type Ca2+

channels are sensitive to o-conotoxins MVIIC and GVIA (McDonough et al., 1996).

They have a smaller single-channel conductance than the L-type channels and a greater

tendency to inactivate with depolarized holding potentials, though the rate of inactivation

varies from cell type to cell type. The o -conotoxin-sensitive channels are found in

neurons in various densities, but are absent in Purkinje cells of the cerebellum (Tsien et

al., 1991).

The prominent Ca2+ channel subtype in the Purkinje cells of the cerebellum is the

P/Q-type HVA channel. Qualitatively, these channels show slow inactivation during

depolarization, and are widely dispersed in many types of neurons. The P/Q-type

channels are sensitive to the funnel web toxin from Aglenopsis aperta, o0-agatoxin IVA

(Mintz et al., 1992).

The R-type channels are so named because they are resistant to the toxins and

antagonists used to block the other HVA channels.

Molecular biology has revealed structural diversity to parallel the functional and

pharmacological diversity of voltage-gated Ca2+ channels. Immunoprecipitation of the

DHP receptors from skeletal muscle showed that the channel exists as a multimeric

assembly of c 1, Oc2, P, y, and 6 subunits. The c 1 subunit is a single polypeptide chain

with four repeated units of homology. Each homologous unit contains six a-helical

membrane-spanning segments. The fourth segment in each repeat is considered the

voltage sensor of the channel and contains positively charged amino acid residues at

every third or fourth residue. The ca subunit appears to be necessary and sufficient to









confer the functional, biophysical, and pharmacological attributes to a particular channel

subtype (Table 1-1).

Cloning of the a1 subunits corresponding to the various Ca2+ channel subtypes

has allowed for analysis of their expression in various mammalian tissues (Table 1-2) as

well as an analysis of their relationship to each other molecularly. The P-type channels

were first identified in cerebellar Purkinje cells (Hillman et al., 1991), while Q-type

currents were first recorded from cerebellar granule cells. The alA subunit underlies both

of these types of Ca2+ current, and thus they are commonly lumped together as P/Q type

current (Stea et al., 1994). Compared to the a1 subunits that underlie L-type Ca2+ current,

the P/Q type protein contains a number of amino acid substitutions in the voltage sensor

that may explain its distinct gating properties (Starr et al., 1991). The rat alA clone

differs from the L-type channel in the II/III linker and in the carboxy terminal segment,

and is about 33% identical at the amino acid level (Starr et al., 1991). Northern blot

analysis of RNA from rat tissues revealed expression in brain, heart, and pituitary, but not

in spleen, kidney, or liver. Detailed Northern blot analysis of brain areas showed

expression of alA RNA in virtually every area of the brain: spinal cord, cerebellum,

pons/medulla, hypothalamus/thalamus, olfactory bulb, striatum, hippocampus and cortex

(Starr et al., 1991).

Antibodies to the protein product of the alB clone immunoprecipitated w-

conotoxin binding sites from rat brain, confirming that this subunit underlies N-type

current. Northern analysis of rat RNA exposed the transcript in all brain areas, and

exclusively in brain tissues (Dubel et al., 1992). Immunocytochemical analysis of the









expression pattern of alB at the single neuron level showed that N-type channels are

localized primarily in dendrites and their associated synapses (Westenbroek et al., 1992).

Three a subunits are associated with L-type current. The als subunit is the

equivalent of the skeletal muscle cell DHP-receptor. It was the first a subunit identified,

and it was discovered by immunoprecipitation of the DHP sites from skeletal muscle,

where it is exclusively located. The cardiac and smooth muscle isoform of the L-type

Ca2+ channel is alc. Two splice variants of a ic have been identified, and injection of

antisense to either variant is sufficient to block 90% of the Ca2+ currents caused by

injection of rat heart mRNA into oocytes. Both transcripts are expressed in all regions of

the CNS, but in varying proportions as determined by RT-PCR (Snutch et al., 1991).

Both are expressed in the tissues examined by Northern blot: heart, adrenal, pituitary,

and brain. The UlD subunit, which also produces an L-type current and was first

identified in neuroendocrine cells, is expressed in the nervous system, along with aic

(Tomlinson et al., 1993). The subunit diversity underlying L-type current suggests

functional diversity, which is further supported by distinct expression patterns.

Recently, it has come to light that a 1E is likely to be the molecular equivalent of

R-type Ca2+ current. The alE rat clone shows only about a 53-54% identity to the

subunits associated with N-type and P/Q-type Ca2+ current, and about 23% identity to a ic

or alD, the subunits that underlie the L-type Ca2+ current in non-skeletal muscle cells.

The polypeptide sequence of the II/III linker and the carboxyl terminal region shows little

conservation as compared to the other neuronal a subunits (Soong et al., 1993).

Although no specific antagonist has been identified for the R-type current, its high









sensitivity to both nickel and Cd2+ distinguish it from the HVA and LVA channels,

respectively.

The LVA Ca2+ current is carried via a subunits a1G, alH, and a11. Two alG

mRNA transcripts were detected by Northern analysis of rat mRNA, and the strongest

signals were detected in the brain, with less abundant expression in the heart. Transcripts

were detected in all brain areas tested including amygdala, thalamus, subthalamic nuclei,

substantial nigra, hippocampus, caudate nucleus, corpus callosum, and cerebellum (Perez-

Reyes et al., 1998). The T-type current responsible for pacemaker activity in the heart is

carried via alH subunits. Human tissue Northern blots revealed strong alH expression in

the kidney, relatively higher abundance in heart than in brain, and expression in the liver

(Cribbs et al., 1998). The anl protein is 59.3% identical to human alH and 56.9%

identical to rat alG, but it is only 13-19% identical to the HVA subunits. The distribution

of an in various rat tissues was determined by Northern blot to be predominantly in the

brain (Lee et al., 1999). In contrast to the fast activating currents generated by alG and

alH, the T-type current carried by anl is considered "slow".

Expression of the varied a subunits in oocytes or HEK cells permitted analysis of

the biophysical properties associated with single current types (Table 1-2) in isolation. In

general, expression of the alpha subunits associated with L-type current (ais, aic, and

aiD) in Xenopus oocytes yielded a current with a threshold of about -20 mV that peaks at

30 mV. The half-maximal activation occurred at about 6 mV, while the half-maximal

inactivation occurred at -37 mV. Single-channel analysis revealed a conductance of

about 20 pS. These recordings were done in solutions containing 40 mM Ba2+ in the

absence of exogenous channel subunits (Tomlinson et al., 1993).









Similarly, expression of UlB subunits in Xenopus oocytes and recording in 40 mM

Ba2+, revealed the biophysical properties of the non-regulated N-type Ca2+ current. This

current activated near -30 mV and the peak of the current-voltage relationship was at 30

mV. The half maximal activation was found to be near the origin at 1 mV and the half

maximal inactivation occurred at -34 mV (Stea et al., 1993). These parameters are very

similar to those found for the L-type currents. Small differences in the voltage-dependent

properties of the current carried via the (l1A subunit were revealed in similar Xenopus

oocyte experiments, also in 40 mM Ba2+. The threshold was found to be -20 mV and the

current peaked somewhere between 10 and 20 mV. Like the N-type current, the half-

maximal activation was just negative at -1 mV, and the half maximal inactivation was

slightly less depolarized than that of L or N type current at -29 mV (Stea et al., 1994).

Because of their similar biophysical properties, the current carried by alE was

thought to be an LVA current. Expression in Xenopus oocytes revealed a threshold of

-50 mV, significantly hyperpolarized with respect to the other HVA currents, and a peak

at -10 mV. The half maximal activation and inactivation, -25 and -65 mV, respectively,

are also significantly shifted for the R-type current as compared to those for the N, P/Q

and L type currents (Soong et al., 1993). However, molecular analysis showed that the

U1E subunit is evolutionarily more related to the HVA currents than the LVA currents that

are carried via aG1, alH and al (Cribbs et al., 1998; Lee et al., 1999; Perez-Reyes et al.,

1998). The LVA currents expressed in Xenopus oocytes or HEK-293 cells activate near

-50 to -60 mV and peak at -25 mV, a significantly more negative potential than that for

R-type current. The half maximal activation and inactivation are in the ranges of -68 to

-21 mV and -75 to -50 mV, respectively, also significantly shifted as compared to the R-









type current. The single channel conductance is small, ranging from 4 to 11 pS (Cribbs et

al., 1998; Lee et al., 1999; Perez-Reyes et al., 1998).

Regulation

As current molecular and imaging techniques give rise to a deep understanding of

Ca2+ channel subunits, their localization, and their function, a stronger knowledge base of

the regulation of Ca2+ channels is emerging. A wide variety of neurotransmitters,

peptides, and drugs can affect Ca2+ channel activity. Additionally, accessory subunit

expression can affect the voltage-dependent properties of Ca2+ current. Existing studies,

although limited, suggest that multiple pathways dynamically regulate Ca2+ channels, in a

subtype-specific manner (Tsien et al., 1988). Such shifting but orchestrated control

provides the opportunity for shaping a given current subtype for a highly specific

function or cell type.

As with other proteins including other ion channels, phosphorylation is an

important regulatory mechanism. Proteins immunoprecipitated with an antibody to co -

conotoxin binding sites (N-type channels) proved to be in vitro substrates for both PKC

and PKA phosphorylation as assayed by Western blot analysis and autoradiography

(Ahlijanian et al., 1991). Although the electrophysiological effects of PKA on N-type

current vary between cell types, in general, PKC phosphorylation results in a stimulation

of the current (Gross and MacDonald, 1989; Gross and Macdonald, 1988; Kaneko and

Nomura, 1987). Conversely, PKA activity results in stimulation of the cardiac L-type

current, while PKC effects on this current subtype are variable (Kamp and Hell, 2000).

Multiple G-protein coupled receptors in the heart signal through cAMP/PKA pathways to

stimulate or inhibit L-type current, depending on the coupling with either Gas or Gai.









Stimulation of Gaq coupled receptors and subsequent PKC activation in the heart,

however, shows varying effects on Ica. In vitro studies demonstrated that both alc and

P2a subunits are substrates for PKC, so it is possible that phosphorylation of different sites

can produce different effects (Kamp and Hell, 2000).

Different splice variants of alA are susceptible to differential phosphorylation.

Immunoprecipitation of a 1A subunits and subsequent in vitro phosphorylation showed

that the 220-kDa polypeptide was most susceptible to PKA phosphorylation, while the

190-kDa form was a substrate for PKC or PKG phosphorylation (Sakurai et al., 1995).

Protein-protein interactions, including the interactions of the a-subunit of a Ca2

channel with other subunits can also regulate the expression and voltage-dependence of

the current. Coexpression of alA with P3 b, P2a, 33, and 34 subunits resulted in an apparent

increase in the number of positive oocytes and also increased the average size of barium

current recorded from positive cells, but had no apparent effect on the rate of activation

of the current. The different 3 subunits did have pronounced effects on the inactivation,

depending on the particular 3 subunit expressed. All of the 3 subunits shifted the I/V

relations of the (alA subunit to more hyperpolarized potentials. The sensitivity of the a 1A

current to the various pharmacological agents, including co -agatoxin IVA was not

changed by expression of the 3 subunits (Stea et al., 1994).

Expression of alB subunits in HEK293 cells required expression of a P subunit,

but alE expression did not require any additional subunits for functional expression,

although expression of al1E with Gu2b and P1-3 cDNAs did increase current magnitudes.









Expression of the additional subunits also shifted the peak of the current-voltage

relationship from +10 to +5 mV (Williams et al., 1994).

Neurotransmitter modulation of neuronal Ca2+ current has been extensively

documented. The voltage-dependent Ca2+ current of many neurons is depressed by many

neurotransmitters including NE, possibly as a mechanism to inhibit presynaptic

neurotransmitter release. The initial model proposed suggested that a neuronal Ca2+

channel can exist in two modes that are in equilibrium with each other: a willing mode

and a reluctant mode. In the willing mode, which predominates in the absence of an

inhibitory neurotransmitter, channels can be opened by moderate depolarization, while in

the reluctant mode, strong depolarizing potentials are required to open the channels

(Bean, 1989). It has been shown that stimulation of some G-protein coupled receptors

liberates G3y that associates with the Ca2+ channel a-subunit, switching it to a reluctant

state, and thus inhibiting the current. Several groups established that G3y interacts with

the a-subunit of N, P/Q, and R type Ca2+ channels, which are the current types subject to

the membrane-delimited voltage-dependent inhibition. The L-type channels do not seem

to be substrates for this type of G-protein dependent inhibition. Relief of the G3y-

inhibition of Ca2+ current in voltage-clamp mode with a depolarizing prepulse has been

termed facilitation. Facilitation by inference is then a technique to measure the inhibition

of a channel by a neurotransmitter.

The PKC activator PMA was shown to disrupt the voltage-dependent inhibition of

Ca2+ current in freshly dissociated central and peripheral rat neurons by baclofen,

leutinizing hormone-releasing hormone, Oxo-M (a muscarinic receptor agonist), and an

adenosine receptor agonist (Swartz, 1993). Competition studies with peptides









corresponding to the I-II linker loop of the alA or a1B subunits suggested that the

crosstalk between the G3y modulation and the PKC modulation were at the level of the

channel itself (Zamponi et al., 1997). Further dissection of the linker narrowed the region

capable of competing for regulation of the channels and pointed to the QXXER domain

in the intracellular loop. Interestingly, this motif overlaps with the consensus sequence

for binding of Ca2+ channel 3 subunits, and therefore may be critical for interaction of

three different modulatory mechanisms (Herlitze et al., 1997).

Although the various mechanisms regulating Ca2+ channels have typically been

studied in isolation, in the physiological environment, the dynamic combination of

kinases, phosphatases, subunit proteins, etc., regulates the ultimate function of the

channel.


Neurotransmitter Release

Role of Voltage Dependent Ca2+ Channels

The Ca2+ entry via voltage-gated Ca2+ channels is essential for neurotransmitter

release. Stimulated release of neurotransmitters is principally resistant to

dihydropyridines, suggestive of a role for non-L type channels in exocytosis. The K

evoked [3H]-NE release from rat sympathetic neurons was markedly reduced by Cd2+ and

co -conotoxin GVIA but was largely resistant to nitrendipine, a dihydropyridine

antagonist. The Ca2+ imaging experiments using Fura-2 showed that nitrendipine

strongly reduced calcium influx, despite its lack of effect on neurotransmitter release

(Hirning et al., 1988). These results, taken together, suggest a dominant role for N-type

Ca2+ current in NE release from sympathetic neurons, despite a significant contribution of

L-type current to the total Ca2+ influx of the cell.









Different types of Ca2+ channels mediate central synaptic transmission. Inhibitory

postsynaptic currents in cerebellar and spinal neurons and excitatory postsynaptic

currents in hippocampal neurons are reduced by o -agatoxin IVA and to a lesser degree

by co -conotoxin GVIA. Again, nicardipine had no effect (Takahashi and Momiyama,

1993). Studies like these suggested a role for P/Q type Ca2+ current in neurotransmitter

release and also initiated the idea that multiple current subtypes could be involved with

exocytosis. Consistent with this idea, and further revising the function of Ca2+ current

subtypes in neurotransmitter release, [3H]-glutamate release from synaptosomes was

resistant to co -conotoxin GVIA, but was partially blocked by co -agatoxin IVA, suggesting

that P/Q type and a toxin-resistant (possibly R-type) Ca2+ current coexist to regulate

release of this excitatory neurotransmitter. In contrast, [3H]-dopamine release from

synaptosomes was blocked by co -conotoxin and co -agatoxin, suggesting that N-type and

P/Q type currents regulate release of this neurotransmitter (Turner et al., 1993).

Regulation of transmitter release in different types of cells by different current subtypes

which themselves have different biophysical properties and regulatory mechanisms adds

to the ways in which synaptic transmission can be modulated.

Immunoprecipitation with an antibody to N-type Ca2+ channels revealed a tight

interaction with syntaxin, a protein involved in synaptic vesicle docking at the plasma

membrane. The N-type Ca2+ channel/syntaxin complex also immunoprecipitated with

synaptotagmin, the calcium binding protein of synaptic vessels (Leveque et al., 1994). A

peptide corresponding to a sequence in the II-III loop of the UlB subunit, can block the

binding of syntaxin to alB (Sheng et al., 1994). This region is termed the "synprint" or

synaptic protein interaction site on the Ca2+ channel. The corresponding II-III segment of









the alA subunit did not bind syntaxin, suggesting that P/Q type Ca2+ current may not bind

to presynaptic transmitter release machinery. However, the II-III loop of the alA subunit

is subject to alternative splicing, and fusion proteins containing the synprint site from one

isoform interacted with both syntaxin and SNAP-25 (synaptosome-associated protein of

25 kDa), while fusion proteins from the other isoform bound SNAP-25 alone (Rettig et

al., 1996). The physical interaction of the Ca2+ channel with the exocytotic machinery

coupled with the localization of non-L type channels to the neuron terminals and

dendrites is consistent with the tight coupling between Ca2+ influx and transmitter

release.

Role of Ang II in Neurotransmitter Release: Specific Aims

Ang II has a centrally mediated pressor effect that correlates with levels of NE in

the brain (Camacho and Phillips, 1981; Chevillard et al., 1979; Sumners and Phillips,

1983). Studies of K+ evoked [3H]-NE release from rabbit hypothalamic slices revealed

that Ang II facilitated this release in a losartan-sensitive, Ca2+-dependent manner (Garcia-

Sevilla et al., 1979). Microdialysis showed that Ang II evokes NE release from the PVN

(Stadler et al., 1992).

Evidence for a direct interaction between Ang II and NE neuromodulation

includes elimination of Ang II-mediated responses by central injections of 6-

hydroxydopamine, a lesioning agent specific to catecholaminergic neurons (Bellin et al.,

1987; Cunningham and Johnson, 1991). Also, the AT1R has been co-localized to

catecholaminergic neurons (Gelband et al., 1997; Jenkins et al., 1995; Rowe et al., 1990),

providing anatomical evidence for the possibility of a direct interaction.









The neuromodulatory effects of Ang II are exacerbated in the spontaneously

hypertensive rat (SHR) model of hypertension. ATiR levels are increased in neurons

cultured from hypertensive rat brain (Raizada et al., 1984). Additionally, regulation of

the norepinephrine transport system and expression of the TH gene are increased in the

SHR as compared to normotensive animals (Lu et al., 1996; Yu et al., 1996).

Since voltage gated Ca2+ channels are required for neurotransmitter release, and

Ang II increases voltage gated Ca2+ current, the increase in NE release by Ang II may be

a result of the increase in Ca2+ current. Since NE neuromodulation in the SHR is altered,

this NE release pathway may be altered in hypertensive animals, leading to increases in

sympathetic outflow, ultimate modification of the baroreflex, and alterations in

vasopressin release, among other pathways leading to changes in blood pressure. The

specific aims of the study presented in the following chapters are:

1. Determine which subtypes of voltage gated Ca2+ current are expressed in neurons co-
cultured from neonatal rat hypothalamus and brainstem.
2. Determine which Ca2+ current subtypes are modulated by Ang II.
3. Determine the role of PKC at the level of the channel in the modulation of Ca2
current.
4. Develop a model of neurons from adult rat brainstem and hypothalamus to be used in

future electrophysiology, signal transduction, or biochemical studies.

Establishment of the pathway in neurons from normotensive animals will provide

the reference to compare to hypertensive animals, and will reveal potential central targets

for hypertension therapeutics. In addition, determination of the pathway of Ang II

modulation of Ca2+ current will provide information relevant to other peptide

neuromodulators.










Angiotensinogen

Renin .-. . .-...***> oen

Angiotensin I


A C E .........................


ACE Inhibitors


Angiotensin II

/Vv\


AT1 R Antagonists


Ang II Type 1 Receptor


Extracellular Fluid Volume


Figure 1-1. Classic renin-angiotensin pathway.














Ca2+ channel subtypes,


pharmacology, function, and molecular identities.


Subtype Antagonist Putative Function Molecular Equivalent

L Dihydropyridines Signaling alc, a1D, als, a1E

N co-Conotoxins GVIA, Neurotransmitter release UlB
MVIIC
p/Q co-Agatoxin IVA Neurotransmitter release a(lA

R? ?1E

T Mibefradil Pacemaker activity lG, (lH, (11


Table 1-1.















Table 1-2. Biophysical properties of Ca2+ channel subtypes in expression systems.


Current Type L N P/Q R T
Expression system Xenopus oocytes Xenopus oocytes Xenopus oocytes Xenopus oocytes Xenopus oocytes, HEK-293 cells
Charge Carrier 40 mM Ba2 40 mM Ba2 40 mM Ba2 4 mM Ba 10-40 mM Ba
Threshold (mV) -20 -30 -20 -50 -50 to -60
Peak of I/V (mV) 30 30 10-20 -10
V1/2 Activation (mV) 6 1 -1 -25 68 to -21
V1/2 Inactivation (mV) -37 -34 -29 -65 -75 to -50
Conductance (pS) 20 4 to 11
(Tomlinson et al., (Stea et al., (Soong et al., (Cribbs et al., 1998; Lee et al.,
Reference 1993) (Stea et al., 1993) 1994) 1993) 1999; Perez-Reyes et al., 1998)














CHAPTER 2
ANGIOTENSIN II MODULATION OF CA2+ CURRENT


Introduction

All of the components of the RAS can be found in the brain. In the brain, like in

the periphery, Ang II stimulates a number of mechanisms to net an increase in blood

pressure and extracellular fluid volume (Phillips, 1987). One such mechanism that has

been studied in detail at the neuronal level is NE neuromodulation. Ang II stimulates NE

release on the short term, and, on the longer term, stimulates uptake and transcriptional

and translational events leading to synthesis of proteins involved in norepinephrine

production and release (Gelband et al., 1998). These actions of Ang II can be reversed

with losartan, the ATIR antagonist. The ATIR is localized to nuclei in the hypothalamus

and brainstem, areas that have been long associated with cardiovascular control,

providing anatomical support for the direct role of the brain RAS in blood pressure

regulation (Phillips et al., 1993).

In a model system of neurons co-cultured from neonatal rat hypothalamus and

brainstem, Ang II has been shown to increase firing rate, decrease delayed rectifier K

current, and decrease an A-type K+ current, in a losartan-sensitive manner (Sumners et

al., 1996; Zhu et al., 1997). Detailed studies of the mechanisms involved in the ATIR-

mediated regulation of K+ current have revealed a role for PKC and CaMKII (Gelband et

al., 1999; Wang et al., 1997; Zhu et al., 1999). In contrast, Ang II, via the Gq-coupled

ATIR, causes an increase in voltage-gated Ca2+ current. This effect can be completely









inhibited with PKC-inhibitor peptide (PKCIP), and mimicked with superfusion of PMA

(Sumners et al., 1996).

There are 5 subtypes of voltage-gated Ca2+ current: T, L, N, P/Q, and R (Nooney

et al., 1997; Perez-Reyes and Schneider, 1995; Tsien et al., 1991). Since voltage-gated

Ca2+ influx is required for neurotransmitter release (Miller, 1987; Takahashi and

Momiyama, 1993; Turner et al., 1993), the Ang II stimulated increase in Ca2+ current

may underlie the Ang II stimulated increase in NE release. Several studies have

addressed the regulation of Ca2+ current subtypes implicated in neurotransmitter release

(N, P/Q, and R) (Barrett and Rittenhouse, 2000; Bean, 1989; Currie and Fox, 1997;

Herlitze et al., 1996; Mintz and Bean, 1993; Shapiro et al., 1996; Swartz, 1993; Zamponi

et al., 1997). PMA activation of PKC increases these current types by alleviating

voltage-dependent G3y inhibition (Barrett and Rittenhouse, 2000, see figure 2-1). Since

the Ang II effect is PKC-dependent, this mechanism may be involved. The study

presented in this chapter dissects the current subtypes from the total Ca2+ current in the

neuronal co-cultures and examines the role of the PKC/Gpy pathway in the stimulatory

effect. We find that Ang II stimulates at least one of the non-L, HVA current subtypes,

which have been implicated in neurotransmitter release in other neuron types, and that

Gpy tonically inhibits the Ca2+ current. Ang II can alleviate this inhibition,

demonstrating, for the first time, a signal transduction pathway stimulation of PKC

causing an increase in non-L type Ca2+ current. This pathway is therefore important in

the physiological regulation of neuronal Ca2+ influx.









Materials and Methods

Preparation of Neuronal Cultures


Rat pups less than one day post-natal were euthanized with pentobarbital. The

brains were removed and placed in a culture dish containing solution D (in mM: 140

NaC1, 5.4 KC1, 0.17 Na2HPO4, 0.2 KH2PO4, 5.5 glucose, 58 sucrose, 0.007 streptomycin,

and 1x105 U penicillin, and 250 mg/mL fungizone.The hypothalamus and brainstem were

dissected from the brains, the pia and meninges were removed, and the tissue was

transferred to another dish containing solution D. The tissue was minced, digested with

0.25% trypsin solution (1.0 mL per brain used) at 370C for 4 min and 45 sec with gentle

shaking. The DNase solution (2 mL) was added to the cells, and shaking continued for

an additional 5 min. DMEM/10% PDHS (10 mL) was added to stop the enzyme actions,

and the volume of the cell suspension was brought to 45 mL with DMEM/10% PDHS.

Cells were then pelleted at 600 x g for 4 min. The supernatant was aspirated and the

pellet was gently triturated 6 times with 10 mL DMEM/10% PDHS each time. The

supernatant from each trituration was filtered through sterile gauze into a sterile bottle.

Cells were counted using a hemacytometer and plated at a density of 3 million cells per

dish on 35 mm culture dishes that had been coated with poly-L-lysine for three hours

before plating and rinsed with Solution D. Cultures were maintained in a 10% CO2

incubator for 3 days at which time the medium was replaced with DMEM/10% PDHS

containing 1% cytosine arabinoside (ARC) for two days. The ARC was replaced with

fresh DMEM/10% PDHS, and cells were maintained in culture for an additional 5-13

days before use.









Whole-cell Patch Clamp and Current Analysis

Membrane currents were isolated using the whole-cell patch-clamp technique.

Patch electrodes had resistances of 2-5 MQ when filled with internal solution that

contained (in mM): 110-tetraethylammonium chloride (TEA-C1), 9 HEPES, 9 EGTA,

4.5 MgC12, 0.3 GTP, and 4 ATP, and 14 phosphocreatine (pH 7.4 with TEA-OH). The

standard external solution contained (in mM): 0.001 PD123, 319 (AT2R antagonist), 142

TEA-C1, 10 BaC12, 10 HEPES, and 0.003 tetrodotoxin (pH 7.3 with TEA-OH). All

experiments were performed at room temperature. For all experiments except current-

voltage relationships and where otherwise noted, currents were evoked by stepping from

a holding potential of -80 mV to a test potential of -10 mV for 80 ms. Composite data is

expressed as the mean + s.e.m. All chemicals were purchased from Sigma (St. Louis,

MO).

Reverse-Transcriptase Polymerase Chain Reaction (RT-PCR)

Specific oligonucleotides were synthesized against 3' portions of rat brain Ca2+

channel ca-subunit cDNAs (Table 2-1). BLAST analysis was used to ensure the

specificity of the primers, and initial products were sequenced to further guarantee

amplification of the desired transcript.

RT was performed using RNA isolated from 5 dishes of co-cultured neurons via

Trizol extraction and ethanol precipitation. 1 tg of DNase I-digested RNA was added to

the RT reaction using random hexamers. As a control for the PCR, a parallel reaction

was carried out in the absence of the RT enzyme. The reaction was carried out at 250C

for 10 min, 420C for 45 min, 99C for 5 min, and 50C for 5 min. The PCR step was

carried out in a reaction volume of 50 pL with 2 mM MgCl2 and 10 pmoles of each









primer specific to the desired product. The reaction was performed with an initial 2 min

denaturation followed by 35 cycles with the following profile: 95C for 1 min, 55C for

1 min, and 720C for 1 min. The final step was an extension at 720C for 10 min.

Reaction products (25 [IL) were electrophoresed through a 1.3% agarose gel in

TBE buffer (90 mM Tris base, 90 mM boric acid, and 2 mM EDTA), and visualized with

ethidium bromide.

Protein Isolation

Proteins from cultured neurons (10-18 days post-culture) were isolated for

immunoblotting by the following procedure: First the culture dishes were washed with 1

mL cold PBS containing 5 mg/mL leupeptin and 8 mg/mL calpain inhibitors. After this

wash was aspirated, the cells were solubilized for 20-40 min at 40C in 100 ptL of a sterile

solution of 1.2% digitonin, 300 mM KC1, 150 mM NaC1, 10 mM NaPO4 buffer, pH 7.4

containing the following protease inhibitor cocktail: pepstatin A (1 [tg/mL), leupeptin (1

[tg/mL), aprotinin (1 [tg/mL), AESFB (0.2 mM), benzamidine (0.1 mg/mL), and calpain

inhibitors (8 [tg/mL). Dishes were then scraped and the cells centrifuged at 10,000 rcf for

20 min at 40C. The protein concentration in the supernatant was determined via Biorad

assay using BSA for the standard curve.

Immunoblotting

Each sample (20 [tg) was prepared and denatured with Laemmli sample buffer in

a boiling water bath for 3 min. 16 ptL of each sample mixture per well was

electrophoresed in 4-15% gradient SDS-PAGE and transferred onto nitrocellulose

membrane. The membrane was blocked with 10% non-fat dried milk in PBST-BSA for 1

hour followed by incubation overnight at 40C with anti-clA, anti-calB, anti-aic, anti-alD,









or anti-OalE (Alomone Labs). Protein-bound antibody was detected by incubation of the

membrane with horseradish peroxidase-labeled secondary antibody for 1 hour and

enhanced by chemiluminescent assay reagents. The bands recognized by the primary

antibody were visualized by exposure to film.


Results

Using 10 mM Ba2+ as the charge carrier, a voltage pulse from -80 mV to +10 mV

for 80 ms was used to assay the inward current carried via voltage-gated Ca2+ currents.

100 nM Ang II caused a dramatic increase in the inward current as compared to the

control current, and 10 pM losartan reversed this effect (Figure 2-2, A). Composite data

from a number of experiments is shown in the form of a current-voltage (I/V)

relationship, where Ang II caused a significant increase in the peak current density, but

did not cause a shift of the peak. Losartan, again, reversed the effect and returned the

current to control levels (I/V, Figure 2-2, B).

Holding the cells at a membrane potential at -40 mV inactivates any LVA current

present in the cells, resulting in a decrease in the total current as compared to that with a

holding potential of -80 mV. Holding at -40 mV did not reduce the inward current,

demonstrating the lack of functional LVA, T-type, current in the co-cultured neurons

(Figure 2-3).

10 pM nifedipine was used to block the L-type calcium current. Some cells had a

significant amount of L-type current (Figure 2-4, left), while some had little or no

nifedipine-sensitive current (Figure 2-4, right). Composite data suggests that at least

60.8+6.3% (n=10) of the Ca2+ current in the neurons is non-L type, and the residual non-









L type current was completely blocked with 10 [LM Cd2+, confirming that it is carried via

voltage gated Ca2+ channels.

Using nifedipine to isolate the HVA Ca2+ current subtypes that have been

implicated in neurotransmitter release, 100 VM Ang II caused an increase in the non-L

type component of Ca2+ current in the neurons, in a losartan-reversible manner (data not

shown). This suggests that at least one non-L Ca2+ current subtype is potentiated by Ang

II.

Exploiting the unique a-subunits underlying the various Ca2+ current types (see

Table 1-1), RT-PCR analysis was used to determine which current subtypes' transcripts

were expressed in the neuronal co-cultures. Primers specific for alA, alB, U1E, aic, aGD,

and alG amplified products of the predicted sizes (Table 2-1 and Figure 2-5), suggesting

that the mRNAs for P/Q, N, R, L, and T type Ca2+ current were all actively transcribed in

the neurons. Western blot analysis revealed the protein a-subunits corresponding to P/Q,

N, L, and R type Ca2+ current (Figure 2-6). Antibodies to the a-subunits associated with

T-type current were unavailable, and no aic protein expression was detectable by

Western (Figure 2-7), though the antibody recognized two bands of appropriate

molecular weights in proteins isolated from heart. Prominent bands of lower molecular

weight were recognized with the aic antibody but correspond with non-specific binding

by the secondary antibody alone (data not shown).

Further pharmacological dissection of the non-L, nifedipine insensitive current

revealed the presence of all HVA current types (Figure 2-8). A significant portion of the

non-L type component could be blocked with 3 [tM co -agatoxin IVA, showing the

presence of functional P/Q type current. The remaining non-L, non-P/Q type current was









sensitive to 1 [ M co -conotoxin GVIA, revealing the presence of functional N-type

channels. The residual current was Cd2+ sensitive and was likely to be carried via R-type

Ca2+ channels.

To test the hypothesis that the PKC-mediated increase in non-L type HVA

currents occurs via relief of G3y inhibition, it was first necessary to establish tonic G3y

inhibition of the Ca2+ current in the cultured neurons. G3y inhibition is voltage-

dependent, and as such, can be relieved with strong depolarizations. Using a triple pulse

protocol (see Figure 2-9), a control test pulse was given (P1). The current in this test

pulse was then compared to the current in the second test pulse (P2) that immediately

followed a strong depolarizing pulse. If the current in the second test pulse was larger

than the current in the first test pulse, the current has been facilitated, and, by inference

was inhibited by G3y subunits. A representative trace (Figure 2-9) shows that the current

in the hypothalamus and brainstem neurons can be facilitated.

This data is expressed as the ratio of the current in the second test pulse to the

current in the first test pulse, the facilitation ratio. A facilitation ratio greater than one

suggests that the current was inhibited by G3y subunits and that the depolarizing prepulse

alleviated the inhibition. Both the total Ca2+ current as well as the non-L type component

have facilitation ratios greater than 1 (Figure 2-10), suggesting that the Ca2+ current in the

co-cultures is tonically inhibited by GPy subunits.

To rule out the possibility that the depolarizing pulse caused any artifactual

increases in the current, the time between the depolarizing prepulse and the second test

pulse was varied to assay the recovery from facilitation (Figure 2-11). The recovery from

facilitation or the recovery of inhibition occurred with a time constant of about 39+0.01









ms, consistent with values of G3y association with non-L type Ca2+ channels in published

reports (Currie and Fox, 1997).

If Ang II is acting by stimulating PKC to phosphorylate the channel and prevent

inhibition by G3y, Ang II should shift the voltage-dependence of activation of the Ca2+

current leftward, at least at less depolarized potentials. 100 nM Ang II did not

significantly shift the activation curve, while the prepulse did cause a significant leftward

shift (Figure 2-12). As determined by a fitting the data with a simple Boltzmann

function, the membrane potential necessary for half-maximal activation (V1/2) in the

presence of Ang II (-38.71.57 mV) was not significantly different from that of control (-

42.93.6 mV) or losartan (-39.01.6 mV) treated currents, but the prepulse caused a

significant change in the V1/2 activation (-51.61.3 mV).

In contrast to the large increase in the peak of the I/V curve in the presence of

Ang II (Figure 2-1), the depolarizing prepulse only doubled the current density at the

peak of the I/V (Figure 2-13). This suggests that Ang II may be affecting an increase by

yet another PKC-dependent pathway.

Consistent with this idea, superfusion of Ang II not only increased the current

elicited by a control test pulse, but it also alleviated a portion of the G3y inhibition of the

non-L type current as assayed by facilitation (Figure 2-14). The difference between the

control current and the current following a prepulse in the presence of Ang II is smaller

than that in the absence of Ang II demonstrating that Ang II decreased the facilitation

ratio. Less facilitation is consistent with a PKC phosphorylation of the G3y association

site on the channel, causing an apparent increase in Ca2+ current. Addition of PMA

completely prevents facilitation of the current, confirming that this pathway is present in









the co-cultures and that PKC phosphorylation is able to totally alleviate the GPy

inhibition.


Discussion

The results presented here shed light not only on the Ang II modulation of

neuronal Ca2+ current, but also on the physiological role of the dynamic regulation of

Ca2+ current by Gpy/PKC systems. Ang II increased non-L type Ca2+ current via the

AT1R, and Ang II stimulation of norepinephrine release is also AT1R-mediated. Since

non-L voltage gated Ca2+ current subtypes have been implicated in neurotransmitter

release in a variety of neuron types (Hirning et al., 1988; Takahashi and Momiyama,

1993; Turner et al., 1993), this modulation of Ca2+ current may be directly related to the

modulation of NE release.

RT-PCR analysis of RNA isolated from the neuronal cultures revealed transcripts

for the a-subunits representing all of the Ca2+ channel subtypes. This was in contrast to

the Western blot analysis, which failed to detect the aic protein, and to the biophysical

analysis that did not reveal any T-type Ca2+ current, despite the presence of the mRNA

for clG. There are two possible explanations for these discrepancies. The first is that the

neuronal cultures contain glia, although only 10% of the total cells are glial. Regardless,

the glia may be actively transcribing the mRNAs for these channels. RT-PCR analysis of

RNA isolated from glia remaining after high-KCl elimination of the neurons did reveal

the same expression pattern as with the RNA isolated from the total population of the

neuronal cultures (data not shown). The other possibility is that the channels transcribe

the mRNA for these channels, but they are post-transcriptionally regulated so they are not

translated to functional channels. In either case, it is difficult to determine which









subtypes of channels exist in a population of neurons using these analyses, but these

methods can be effective to rule out particular subtypes if they are not revealed

molecularly. Also, as is evident with the differing nifedipine sensitivity between cells,

the molecular analysis does not paint an accurate picture of the expression pattern in a

given neuron. We have made efforts to optimize single cell RT-PCR methods, but this

methodology is again only useful to confirm the electrophysiological analysis, not to

make statements about functional expression, since the cell may be transcribing mRNAs

for channels it does not express as functional currents. Fortunately, the selective

antagonists are effective in dissecting the current and uncovering functional channel

subtypes, here revealing the presence of all HVA current types: L, N, P/Q, and R.

Previous studies from our group have shown the Ang II effect on Ca2+ current can

be completely inhibited by PKCIP, but this was not the case for K+ current, which also

involves CaMKII activity (Zhu et al., 1999). Since PKC is required for the effect of Ang

II, but seems to alleviate G3y inhibition only partially, it is likely that another PKC

dependent mechanism is involved in the stimulation. The a-subunits of Ca2+ channels

contain a number of phosphorylation sites, and many are yet uncharacterized. In

addition, there are a number of accessory subunits that may be associated with the a-

subunits in the neurons which themselves could be substrates for PKC phosphorylation.

Finally, PKC could be phosphorylating and activating another kinase or accessory protein

fostering another pathway that then goes on to effect the Ca2+ channel's ability to pass

current. A similar mechanism could explain the unexpected lack of shift in the voltage-

dependence of activation in the presence of Ang II. Perhaps the other mechanism causes

a right shift that masks the shift caused by relieving G-protein inhibition. Additionally,









the activation curve was constructed with total Ca2+ currents, not just with non-L type

current isolated. Ang II may have an effect on the L-type current that is masking the

anticipated shift of the activation curve.

Now that the current subtypes expressed in the neurons have been deciphered, it

will be possible to isolate the L-type component and examine its modulation by Ang II,

but because the individual non-L type currents are relatively small (about 100-200 pA) it

is difficult to isolate them and determine their regulation individually. An expression

system such as stably transfected HEK cells carrying the AT1R and the calcium channel

of interest may be an appropriate alternative system to study the intricacies of the

signaling mechanism.

Regulation studies have shown PMA alleviating G3y inhibition, often with G3y

inhibition initiated by an inhibitory neurotransmitter cascade, such as in the case with NE

or somatostatin (Bean, 1989; Currie and Fox, 1997; Golard and Siegelbaum, 1993). This

is the first reported case, to our knowledge, using a ligand-receptor interaction to

stimulate PKC to alleviate G3y inhibition. The origin of the tonic G3y inhibition is

unknown, but is likely due to 3y subunits liberated from endogenous spontaneously

activated G-protein coupled receptors or due to an excess of GPy subunits in the cell.

The fact that activation of PKC via the AT1R is not sufficient to alleviate the tonic G3y

inhibition in the neurons raises interesting possibilities regarding subtype specificity both

on the part of the PKC isozyme as well as on the part of the 3y subunits. PMA, which

has been the PKC activator used in the Ca2+ channel regulation studies, activates all

isoforms of PKC, so it is possible that its effects are more potent. This idea also explains

the ability of PMA to alleviate facilitation to a greater degree than Ang II in the






36


experiments presented here. The Ang II inhibition of K+ current is mediated by PKCa,

so it is possible that this isoform of PKC mediates the Ca2+ current increase as well.

Further studies addressing the PKC isoform involved, as well as studies directly linking

this mechanism to neurotransmitter release will provide the groundwork to study the role

of the pathway in the development or maintenance of hypertension.













Table 2-1. Primers designed to amplify transcripts of specific Ca2+ channel ca-subunits.
Predicted
Target Sense primer (5'-3') Antisense primer (5'-3') product
size (bp)

alA CCCTCCTCAACTCCATGAAA AAAGTGTCGAAGTTGGTGGG 144

aXl ATGAGGCCAGAGCACCTCTA TGTGTTGCAAAGCTGAGTCC 266

aic ACGGCACCCTCTTACCTTTT TGCTGACATAGGACCTGCTG 141

alD ACTGGTCTATTCTGGGGCCT CTTGATCTTGAGAGCCGTCC 260

alE CAGCTCCCTGATGAGACACA GCAAGGAGTTGGAAGACTCTG 128

alG ACTGTGACCAGGAGTCCACC TTGCCTCTTTGTTGCTTTCT 144







Ca2+


+


Figure 2-1. Putative regulation mechanism for non-L type Ca2+ channels.













A B

-

-4- --

-8-

~L -12-

control --16
=-16-
Los (1 mM) o
--L control (n=5)
Ang 11 (100 nM) -20- Ang II (100 nM) (n=5)
< Losartan (1 iM) (n =3)
-24 i- ,
-80-60-40-20 0 20 40 60 80
100 ms Membrane Potential
(mV)



Figure 2-2. Ang II increases voltage-gated Ca2+ current via the AT 1R. A:
Representative traces elicited from with an 80 ms voltage pulse from -80 mV to -10 mV
in the presence or absence of Ang II or Ang II and losartan. B: Mean current-voltage
relationship from a number of cells in the presence or absence of Ang II or Ang II and
losartan.















hold @ -40 mV


K-llH#HI


Figure 2-3. Changing the holding potential from -80 mV to -40 mV does not
significantly alter the current elicited by a voltage pulse to 0 mV. Since T-type Ca2
current is the LVA current that inactivates at -40 mV, a lack of difference signifies a lack
of LVA current in the co-cultured neurons.


hold @ -80 mV


f






41











3 3
" ."2 2; |^-_(1||1 ... .. .. '' ^ ^y-^ ,- -




1 4
1. Control 1&2 <
2. Nifedipine (10 pM) o
3. Cd2+ (10 pM)
4. Washout
100 ms


Figure 2-4. Most of the current in the neurons is non-L type, nifedipine insensitive
current. The traces on the left are from a cell with significant L-type current, while the
traces on the right are from a cell with little or no nifedipine sensitivity.














1A 1B aiE a1C aiD 1G


Figure 2-5. RT-PCR analysis of RNA isolated from co-cultured neurons reveals the
presence of transcripts encoding all Ca2+ current subtypes.















aGB WID


Figure 2-6. Western blot analysis of proteins extracted from neuronal co-cultures reveals the ca-subunits corresponding to each of the
subtypes of HVA Ca2+ current. The markers denoting the molecular weight standards designate 205 kDa, 121 kDa, and 78 kDa, top to
bottom.


aIA


aIE






44








C::
(- 3
(U
a) a)






















Figure 2-7. Western blot analysis using an antibody to ailc failed to recognize a protein
band of the correct molecular weight in the neuronal protein isolates. Heart protein was
run as a positive control and two isoforms of aic were identified.
















-80 mV







0

50 ms


60

c 50(
U,
S40
i,/)
1,
ci 30

S20-
z
o 10


1. Total Ba 2+ current
2. + 10 PM nifedipine
3. + 3 |IM V-agatoxin IVA
4. + 1 |iM V-conotoxin GVIA
5. + 10 IM Cd2+


d, (P L
) Y0^
0& K,0 -


Figure 2-8. Pharmacological dissection of Ca2+ current in co-cultured neurons reveals the
presence of all HVA current subtypes. Composite data shows that the major components
of the non-L type current are sensitive to o -agatoxin and o -conotoxin (n=3).















+80 mV

P1 P2
-10 mV

-80 mV-


0
0,
c1o


Cu
L-


1.50-

1.25-

1.00-

0.75-

0.50-

0.25-


0
0
50 ms
50 ms


0.00 '
Total Non-L
(n = 8)



Figure 2-9. Ca2+ current in neuronal co-cultures can be facilitated. A: The depolarizing
prepulse (-80 mV) relieves the voltage dependent inhibition by G3y subunits, rendering
the current in the second test pulse (P2), larger than the current in the first test pulse (P1).
B: The facilitation ratio of both the total and the non-L Ca2+ currents are greater than
one, indicating the tonic inhibition by GBy subunits.













+80 mV


-10 mV


-80 mV

A1 1


K 111.1 1


MOMMON"M


0

0
C-,
U-,


S= 39+0.01 ms


9 I I I I I I I I I
0 20 40 60 80 100 120 140160


Time (ms)


(n=5)


Figure 2-10. Recovery from facilitation is consistent with recovery of GPy subunit
association. On the left is a representative experiment showing the decay of the
facilitation in the current elicited by the second test pulse (P2). Composite data from
several experiments is shown on the right. The facilitation is decaying with a time
constant of 39+0.01 ms.







48







1.1
1.0
0.9 --
S 0.8---- ""
-- II
S 0.7 -
S 0.6- 1 V1/2 Std. Err.
E 0.5- -- Control -42.87 3.622
oU Prepulse -51.64 1.322
S 0.4- Ang II -38.65 1.568
z 0.3- Control (n=11) Losartan -38.99 2.248
0.2-, Prepulse (+80 mV, n=6)
0.2- I, Ang II (100 nM, n=5) p<0.05
0.1 Losartan (1 jIM, n=3)

0.0 i i I i
-100-80 -60 -40 -20 0 20 40 60 80
Membrane Potential




Figure 2-11. Voltage-dependence of activation. Ang II did not significantly shift the
activation curve, but a depolarizing prepulse did cause a significant leftward shift.























A10 mV


E
0(



o
Z


50 ms \
25 ms


-- Control (n=6)
-+ Prepulse (n=6)


-100-80-60-40-20 0 20 40 60 80
Membrane Potential
(mV)


Figure 2-12. Ang II and a depolarizing prepulse have differing effects on the current-
voltage relationship. The prepulse increases the peak of the current-voltage relationship
less than Ang II does (Figure 2-1) and shifts it leftward as compared to that of the control.


+80mV


-80mV-




















+100 nM Ang II +500 nM PMA




0
l L control
10 ms -after +80 mV prepulse



Figure 2-13. Ang II and PMA treatment prevent facilitation of Ca2+ current in neuronal
co-cultures. Not only did Ang II increase the non-facilitated current as compared to
control, but the difference between the currents in the absence and presence of a prepulse
was much smaller after superfusion of Ang II. Superfusion of PMA completely
eliminated the increase in current caused by the prepulse as compared to the control
conditions.














CHAPTER 3
DEVELOPMENT OF A NEW MODEL


Introduction

Ca2+ entry via voltage-gated Ca2+ channels is essential for neurotransmitter

release, and Ang II has been shown to increase spontaneous and evoked NE release both

in vivo and in vitro (Bellin et al., 1987; Cunningham and Johnson, 1991; Garcia-Sevilla et

al., 1979; Stadler et al., 1992). The central Ang II-mediated pressor effect correlates with

levels of NE in the brain (Camacho and Phillips, 1981; Chevillard et al., 1979; Sumners

and Phillips, 1983). Establishment of the pathway connecting Ang II modulation of Ca2+

current to NE release in neurons from normotensive animals will provide the reference

for comparison to hypertensive animals, and will reveal potential central targets for

hypertension therapeutics. In addition, determination of the pathway of Ang II

modulation of NE release will provide information relevant to other peptide

neuromodulators.

Different types of Ca2+ current mediate synaptic transmission. In general, studies

suggest that L-type Ca2+ current plays little or no role in neurotransmitter release

(Hirning et al., 1988; Takahashi and Momiyama, 1993). Varying combinations of N,

P/Q, or R type Ca2+ current are necessary for neurotransmitter release, depending on both

the neuron type and the transmitter type (Takahashi and Momiyama, 1993; Turner et al.,

1993).









Since non-L type Ca2+ influx is required for neurotransmitter release, and Ang II

increases non-L type Ca2+ current (Chapter 2), the increase in NE release by Ang II may

be a result of the increase in Ca2+ current. Several mechanisms of NE neuromodulation

are altered in the SHR (Lu et al., 1996; Raizada et al., 1984; Yu et al., 1996), therefore

the NE release pathway may be altered in hypertensive animals, leading to increases in

sympathetic outflow, ultimate modification of the baroreflex, and alterations in

vasopressin release, among other pathways leading to changes in blood pressure. The

specific aim of the study presented in the following chapter was originally to examine the

role of the Ca2+ current subtypes in Ang II facilitation of both spontaneous and K+ evoked

release. Preliminary studies suggested that the model system and the assay used were not

sufficient to study this mechanism, and the effects of Ca2+ modulators on release

generally could not be dissected from their effects on uptake. Therefore, also presented

in this chapter is the characterization of a new model system of neuron-like cells cultured

from adult rat brain that is currently under development for future studies.


Materials and Methods

Preparation of Neuronal Cultures

Rat pups less than one day post-natal were euthanized with pentobarbital. The

brains were removed and placed in a culture dish containing solution D (in mM: 140

NaC1, 5.4 KC1, 0.17 Na2HPO4, 0.2 KH2PO4, 5.5 glucose, 58 sucrose, 0.007 streptomycin,

and 1x105 U penicillin, and 250 mg/mL fungizoneThe hypothalamus and brainstem were

dissected from the brains, the pia and meninges were removed, and the tissue was

transferred to another dish containing solution D. The tissue was minced, digested with

0.25% trypsin solution (1.0 mL per brain used) at 370C for 4 min and 45 seconds with









gentle shaking. DNase solution (2 mL) was added to the cells, and shaking continued for

an additional 5 min. DMEM/10% PDHS (10 mL) was added to stop the enzyme actions,

and the volume of the cell suspension was brought to 45 mL with DMEM/10% PDHS.

Cells were then pelleted at 600 x g for 4 min. The supernatant was aspirated and the

pellet was gently triturated 6 times with 10 mL DMEM/10% PDHS each time. The

supernatant from each trituration was filtered through sterile gauze into a sterile bottle.

Cells were counted using a hemacytometer and plated at a density of 3 million cells per

dish on 35 mm culture dishes that had been coated with poly-L-lysine for three hours

before plating and rinsed with Solution D. Cultures were maintained in a 10% CO2

incubator for 3 days at which time the medium was replaced with DMEM/10% PDHS

containing 1% cytosine arabinoside (ARC) for two days. The ARC was replaced with

fresh DMEM/10% PDHS, and cells were maintained in culture for an additional 5-13

days before use.

Norepinephrine Release and Uptake

Initial uptake experiments were performed in triplicate with 4-5 dishes per sample

per run in the absence and presence of 10 [LM maprotiline, as described previously

(Sumners et al., 1985). For uptake experiments that correspond directly to release

experiments, cells were dissolved with NaOH after the release experiment, and the lysate

was collected and diluted into 4 mL of Scintiverse I. Radioactivity was estimated using

an LKB 1215 LS counter. Data were expressed as the mean dpm per dish + s.e.m.

Statistical differences were tested using one-way analysis of variance followed by a

pairwise multiple comparison method.









For release experiments, DMEM was removed, and the dishes were washed 3

times with physiological Krebs-Hensleit (KH) buffer, pH 7.4, containing in mM: 140

NaC1, 3.9 KC1, 1.8 CaC12, and 1.2 MgC12, 1.5 KH2PO4, 5.5 glucose, 10 HEPES. The

neurons were incubated with 1 mL of KH buffer containing pargyline (100 ptM), ascorbic

acid (200 [M) and 0.1 [tM L-[3H-NE for 20 min at 370C. This mixture was aspirated

and the dishes were washed four times with modified PBS at 370C. Cells were then

incubated in 0.75 mL of KH or high K+ KH (containing, in mM: 74.4 NaC1, 69.5 KC1,

1.8 CaCl2, and 1.2 MgC12, 1.5 KH2PO4, 5.5 glucose, 10 HEPES) with or without the

appropriate Ca2+ modulator for 1 min at 370C. The PBS was removed and placed in a

scintillation vial containing 4 mL of Scintiverse I. Radioactivity was estimated using an

LKB 1215 LS counter. Data are expressed as mean dpm per dish + s.e.m. Statistical

differences were tested using one-way analysis of variance followed by a pairwise

multiple comparison method.

Ang II Binding Studies

Media was removed from culture plates and cells were washed twice with PBS.

Cultures were incubated for 1 hour at room temperature with reaction mix containing

-800,000 cpm 125I-Ang II in PBS with 0.004% heat-inactivated BSA. To assess non-

specific binding, 1 nM cold-Ang II was added to the reaction mix, and to assess specific

binding to the AT1R or AT2R, 1 nM losartan or PD 123,319 was added to the reaction

mix, respectively. The reaction mix was removed and culture plates washed twice with

ice-cold PBS containing 0.8% heat-inactivated BSA. 1 mL of 1N NaOH was added to

each dish to dissolve the cells. The dissolved cells were placed in a 12 X 75 mm glass

tube and radioactivity was measured on a gamma counter.











Protein Isolation

Culture dishes containing cells were rinsed with ice-cold PBS. 100 gL of

boilingl25 mM Tris-HCl lysis buffer containing 2% SDS, 5% glycerol, and 1% P-

mercaptoethanol was added to each 35 mm culture dish. 5 dishes were scraped into a

sterile tube using a rubber policeman. After boiling the dissolved cells in the

microcentrifuge tubes for 3 min, the samples were sonicated for 15 seconds and

centrifuged at 12,000 x g for 5 min. The supernatant was transferred to a fresh

microcentrifuge tube and stored at -800C until needed. Protein concentrations were

determined via Bio-Rad protein assay.

Immunoblotting

Each sample (20 [tg) was prepared and denatured with LaemmLi sample buffer in

a boiling water bath for 3 min. 16 mL of each sample mixture was electrophoresed per

well in 7.5% SDS-PAGE and transferred onto nitrocellulose membrane. The membrane

was blocked with 10% non-fat dried milk in PBST-BSA for 1 hour followed by

incubation overnight at 40C with anti-TH antibody (Sigma). Protein-bound antibody was

detected by incubation of the membrane with horesradish peroxidase-labeled secondary

antibody for 1 hour and enhanced by chemiluminescent assay reagents. The bands

recognized by the primary antibody were visualized by exposure to film.

Preparation of Adult Rat Brain-Derived Cultures

Cultured adult neurons were prepared as described by Brewer et al, with

exceptions noted (Brewer, 1997). Fifteen week or older Sprague-Dawley female rats or

Wistar Kyoto male rats were injected with 3 mL of euthanasia solution and decapitated.









The brain was rapidly dissected in a cell culture hood into 7 mL of cold Hibernate A

supplemented with 2% B27 defined media supplement and 0.5 mM glutamine (Hibernate

A/B27). The hypothalamus or brain stem was dissected and the meninges removed in 7

mL of cold Hibernate A/B27. Tissue was transferred to a culture dish containing 5.5 mL

of cold Hibernate A/B27 and chopped into small pieces using fine dissecting scissors.

Tissue pieces in Hibernate A medium were transferred to a centrifuge tube, digested with

papain (2 mg/mL in Hibernate A medium), and triturated with a fire-polished glass

Pasteur pipet. The suspended cells were added to the top of an Optiprep gradient made

with four 1 mL steps of 35, 25, 20 and 15%, and the cell suspension was centrifuged for

15 min at 800g. Debris was removed and fractions containing cells were diluted into

Hibernate A/B27 and centrifuged for 1 min at 200g. Cell pellets were resuspended in

Neurobasal A/B27. 2 mL of cell suspension was added to 35 mm Nunc tissue culture

dishes coated with poly-D-lysine. One hour after plating, the media was aspirated,

replaced with 1 mL of Hibernate A/B27 that was aspirated and replaced with Neurobasal

A/B27 containing 5 ng/mL FGF2. Every 3 days, half of the media was removed and

replaced with fresh Neurobasal A/B27 containing twice the original concentration of

FGF2. Neurobasal A, Hibernate A, B27, FGF2, and glutamine were obtained from Gibco

Life Technologies (Grand Island, NY). Poly-D-lysine was purchased from Sigma (St.

Louis, MO).

Passaging of Cultured Cells

Media was aspirated from dishes roughly 3 weeks after initial plating. Dishes

were treated with 0.5 mL warm trypsin solution (lg/400 mLs in Hibernate A at 370C) per

dish for 4 min while swirling the dish to loosen cells. Neurobasal A containing 10%









serum was added to the dish to quench the trypsin activity, and cells were removed from

the dish with a glass Pasteur pipette. Cells were spun at low speed (250 x g) for 4 min

and the supernatant was aspirated and discarded. The pellet was diluted into Neurobasal

A/B27/glutamine and related at half the initial density onto poly-D-lysine coated 35 mm

culture dishes. Cultures were permitted to recover for 2 weeks before fixing and staining.

Cryopreservation of Cultured Cells

Cells were trypsinized and pelleted cells as in the passaging procedure. The

pellet was resuspended in a minimal amount of Neurobasal A/B27/glutamine medium

containing 7.5% sterile DMSO. The cells were aliquotted into 1 mL cryotubes and

frozen slowly in a -700C freezer. 10 days post-freezing, aliquots were removed from

storage and thawed quickly in a 37C water bath. 1 mL of preserved cells was diluted in

45 mL of Neurobasal A/B27/glutamine and centrifuged at low speed for 5 min.

Supernatant was discarded and the pellet resuspended in fresh medium and plated on

poly-D-lysine coated 35 mm dishes.

Infection of Cultured Cells

The virus used was an HIV-1 derived, replication-incompetent, self-inactivating

vector produced by transient transfection of 293T cells. Virus was concentrated by

ultracentrifugation at 50,000 x g for 2.5 hours and resuspended in 1/500th of the original

volume in Hank's balanced salt solution. The pellet was resuspended by orbital shaking

at 200 rpm for 5 hours. The titer of the virus was 1 +/- 2 X 108 infectious units per

milliliter. Cells were infected in a minimal amount of media (- 1 mL) with 1 [tl (- 10

MOI) of concentrated HIV-1 vector pseudotyped with the VSV-G envelope and encoding

the gene for enhanced green fluorescent protein (EGFP, for methods review see









Huentelman, et al. Methods in Enzymology, in press) expressed from the human

elongation factor 1 alpha promoter. 24 hours later approximately half the media was

replaced. At this time EGFP expression was evident. Half the media was replaced every

three days for the following ten days. After ten days the cells were fixed in 4%

paraformaldehyde solution for 10 min, rinsed with PBS, and mounted in Fluoromount-G

(Gibco). GFP expression was documented via epifluorescent photography using

flourescein filters.

Immunocytochemi story

Cultures were washed briefly with Dulbecco's phosphate buffered saline (PBS)

and then fixed for 1 min with PBS containing 0.1% Tween 20 (PBS/Tween) and 10% of

a 37% w/w formaldehyde solution (Fisher). Dishes were then washed briefly with

PBS/Tween. For all antibody combinations, except those with anti-tetanus toxin or anti-

GalC, dishes were then fixed with -200C methanol for 1 min, followed by an additional

wash with PBS/Tween. 10% Goat serum in PBS/Tween was added to the dish for 30 min

at 370C to block non-specific binding, followed by a further wash with PBS/Tween.

Primary antibodies, diluted in a 1 mL total volume of PBS/Tween, were added to the dish

and incubated for 30 min to 1 hour at 370C. Following two 30-min washes with

PBS/Tween, the dishes were incubated with secondary antibodies, washed twice, 30 min

each time, with PBS/Tween, and mounted with anti-bleaching medium and a glass

coverslip. Primary antibodies were titrated for use to give robust staining and were as

described in Table 1. Secondary antibodies were extensively cross-adsorbed goat anti-

mouse and goat anti-rabbit IgGs coupled to either ALEXA 594 or ALEXA 488 and were

obtained from Molecular Probes (Eugene, OR 97402). These were used at 1:2000









dilutions corresponding to a final concentration of 1l[g/mL. All other chemicals were

purchased from Sigma (St. Louis, MO).

Current Recording and Analysis

Membrane currents were measured using the whole-cell patch-clamp technique

(Hamill et al, 1981). When filled with internal solution, electrode resistances measured

1-4 MQ. Voltage-clamp command potentials were applied to the cells and membrane

current recorded using an Axopatch 200A patch-clamp amplifier (Axon Instruments,

Burlingame, CA). Membrane current was digitized on-line (10.0 kHz) with an analog-to-

digital interface and filtered at 5.0 kHz. All experiments were performed at room

temperature. Pipette solution for Na+ currents contained (in mM) 140 CsC1, 2 MgC12, 10

HEPES, 10 EGTA, 20 TEA-C1, 0.2 GTP, and 1 ATP (pH 7.2 with CsOH). Bath solution

for Na+ recordings contained (in mM) 140 NaC1, 1 MgC12, 10 HEPES, and 10 EGTA (pH

7.4 with TEA-OH). Pipette solution for Ca2+ current recordings contained (in mM) 110

TEA-C1, 9 HEPES, 9 EGTA, 4.5 MgC12, 4 ATP, 0.3 GTP, and 14 phosphocreatine (pH

7.3 with TEA-OH). Bath solution for Ca2+ recordings contained (in mM), 142 TEA-C1,

10 HEPES, and 10 BaC12 (pH to 7.3 with TEA-OH). Cell capacitance measurements

ranged from 9 to 90 pF. Composite data are expressed as the mean + s.e.m. All

chemicals were purchased from Sigma (St. Louis, MO).

Proliferation Assay via BrdU Incorporation

Bromodeoxyuridine (BrdU) was added to the cell culture medium to a final

concentration of 30 [tg/mL. After 24 hours of incubation in the dark at 370C, cells were

collected from the culture plates by treatment with trypsin (0.25 g/L in Hibernate A) for 3

min. Four plates were used for each sample. The cells were centrifuged at 300 x g for 3









min. The cell pellet was resuspended in PBS and fixed in 10 mL of ice-cold methanol for

1 min. The cells were collected by centrifugation and resuspended in 25 mL of ice-cold

0.1% Triton X-100/0.1M HC1. Following 1 min incubation on ice, cells were again

centrifuged and collected. The pellet was resuspended in 1 mL of DNA denaturation

buffer (0.15 mM NaCl and 15 [tM trisodium citrate dihydrate) using a Pasteur pipette.

The cell suspension was heated for 5 min at 900C, and then placed on ice for 5 min prior

to the addition of 10 mL of antibody diluting buffer (100 mL PBS containing 100 ptL

Triton X-100, and 1 g BSA) and subsequent centrifugation. The resulting pellet was

incubated with 0.005 [tg/[tL of FITC-labeled anti-BrdU antibody (clone BMC9318,

Chemicon) in the dark for 30 min at room temperature prior to addition of 20 mL of

antibody diluting buffer and centrifugation until a pellet formed (about 5 min at 300 x g).

The supernatant was discarded and the pellet was resuspended in 2 mL of PBS containing

20 |tg of propidium iodide and 0.2 mg RNase A for 30 min in the dark. The samples

were then analyzed using a FACScan (BD Biosciences, San Jose, CA) flow cytometer.

The instrument illuminated the cells with a 15 mW argon-ion laser, emitting 488 nm.

Signals collected were forward light scatter, side light scatter, green fluorescence

emission (515-545 nm) and red fluorescence emission (>650 nm). Data was acquired for

30,000 cells per sample. The resulting computer files were transferred to a Macintosh

G3-350 computer running Cell Quest Software (BD Biosciences) or a PC running

WinMDI Version 2.8 (courtesy of J. Trotter, Scripps Institute, La Jolla, CA) for routine

plotting and percentage calculations. Cell cycle analysis was performed on the

Macintosh using ModFit LT, version 2.0 (Verity Software House, Topsham, ME).









For dual staining with a-internexin antibodies and BrdU antibodies, cells were

treated with BrdU as above for 36 hours, and fixed and stained as detailed in the dual

staining procedure, using the R35 antibody to a-intemexin and a FITC-tagged anti-BrdU

antibody.


Results

In preparation for studies of NE release from co-cultured neurons, it was

necessary to optimize conditions for uptake of [3H]-NE. A time course was run, allowing

cells to take labeled neurotransmitter up for up to 45 min. Maprotiline, a drug with

specifically blocks the neuronal NE transporter, was used to assay the proportion of

specific uptake. In averaged data from 3 sets of neurons cultured from Sprague-Dawley

neonatal rat pups, [3H]-NE uptake plateaued at 13,000 dpm/dish at about 20 min (Figure

3-1, A). More than half of this uptake was insensitive to 100 tiM maprotiline, suggesting

it was glial or non-specific. In contrast, uptake in neuronal cultures from 3 sets of WKY

rat pups, does not plateau during the time course of the experiment (Figure 3-1, B), and

was significantly greater than the uptake in the Sprague Dawley cultures. The

maprotiline-insensitive uptake was only a small portion of the uptake at 45 min, implying

about 35,000 dpm/dish of [3H]-NE uptake was by the neuronal uptake 1 mechanism (i.e.

via the NET), and was available for exocytotic release. The specific uptake in both

culture types was also assayed by omitting sodium. Since maprotiline-sensitive NE

uptake is sodium-dependent, it was anticipated that the same results would be obtained,

but omitting sodium apparently had a non-specific osmotic effect, and produced

unreliable results (data not shown).









Because both WKY and Sprague Dawley rats are normotensive and because the

cultures are prepared in the same way, it was unanticipated that there would be such a

significant difference between them in terms of maprotiline-sensitive uptake. The

difference cannot be attributed to glial uptake because both culture types have roughly

the same amount of non-specific uptake. One possibility is that the WKY cultures

contain more catecholaminergic neurons capable of transporting NE. To address this

possibility, Western blot analysis was performed using an antibody to the TH enzyme

necessary for production of all catecholamines. Surprisingly, each of two sets of

Sprague-Dawley derived cultures expressed significantly more TH protein than each of

three sets of WKY cultures (Figure 3-2). Assuming that the level of TH expression is

relative to the number of catecholaminergic neurons, it appears thatWKY cultures

actually have fewer such neurons than do the Sprague-Dawley cultures.

Because WKY cultures have significantly higher maprotiline-sensitive uptake

levels and therefore a larger releasable pool of NE, these cultures were used for the

release studies. After optimizing the number of washes necessary prior to collecting the

sample (Figure 3-3), agents altering voltage gated Ca2+ current were assayed for effects

on both spontaneous and high K+ evoked NE release. In all cases, high K+ appeared to

evoke significantly greater NE release as compared to that occurring spontaneously in the

control samples (Figure 3-4, A). Surprisingly, Ang II, which causes significant increases

in the Ca2+ currents in the cultured neurons (Chapter 2), had no significant effect on

either evoked or spontaneous release, as compared to control. Nifedipine, which blocks

L-type Ca2+ current also had no effect, nor did Cd2+. The Cd2+ is expected to block the

high K+ effect, since the high K+ increases voltage gated Ca2+ current by depolarizing the









neurons. As a control, uptake was measured, to ensure the agents were not acting by

affecting transport of NE into the cells. It appears that nifedipine had a significant effect

on uptake (Figure 3-4, B), but Cd2+ and Ang II did not.

Because the effects of agents which alter voltage-gated Ca2+ current were

expected to have a much larger effect on the Ca2+ dependent neurotransmitter release, the

Ca2+ dependence of release and uptake were assayed by omitting Ca2+ when collecting

the samples (0 Ca2+), omitting Ca2+ throughout the procedure (0 Ca2+ through), and

omitting and buffering Ca2+ throughout the procedure to eliminate any contaminating

Ca2+ in the solutions (5 mM EGTA and 10 mM EGTA). While all alterations in Ca2

eliminated the significant differences between spontaneous and high K+ stimulated

release, only 10 mM EGTA had a significant effect on release overall (Figure 3-5, A).

Eliminating and buffering Ca2+ did not significantly reduce the amount of high K+

stimulated release, suggesting that it was not Ca2+ dependent. Buffering Ca2+ did

significantly reduce uptake of [3H]-NE (Figure 3-5, B), which may have caused

artifactual effects on release.

Because the results from these studies are unexpected and the effects of agents on

uptake and release cannot be dissected in this system, the sensitivity of the assay is not

sufficient to examine the effects of antagonizing specific Ca2+ current subtypes. Efforts

were then focused on development of a new model system to use in future experiments.

A cell culture procedure optimized to isolate and culture neurons from adult rat

hippocampus, specifically the dentate gyms, was modified for brain areas of interest for

the Ang II modulation of NE studies. The target tissues were initially locus coeruleus

and dorsal vagal nucleus, since these areas are rich in Ang II receptors in the adult









animal. The dissections were difficult and yielded very few culture dishes, so cultures of

total hypothalamus or total brainstem were used for initial studies of the properties of the

neurons resulting from the procedure.

Immediately after the culture procedure only a few adherent cells derived from

the adult rat brainstem or hypothalamus were apparent, although there was non-adherent

material, which contained live cells as well as debris. However, after 7 days in culture

many adherent cells were visible in cultures derived from either brain area. Most of these

cells showed a generalized neural morphology with rounded cell bodies and short

processes (Figure 3-6). Cultures 10 days of age have significantly more adherent cells

with longer processes and neuronal and glial-like morphology. By two weeks after

plating a variety of different cell types were seen including interesting islands of smaller

cells with a stellate morphology that appear in clusters over about half of the culture dish.

Cells of this type continued to divide and formed continually expanding monolayers for

at least 35 days in culture (data not shown). Since these cells formed a regular,

reproducible patterned network we named them "patterning cells". Visual observation

made it clear that the patterning cells we noted in our cultures were dividing (Figure 3-6).

Further confirmation of this came from flow cytometry of BrdU incorporation and DNA

content demonstrated that at least 7% of the cells in 20-day-old brainstem-derived

cultures are incorporating BrdU during a 24-hour period (Figure 3-7).

To further characterize the phenotype of this population of proliferating cells, we

initially utilized antibodies to intermediate filament proteins and intermediate filament

associated proteins, convenient and widely used markers of CNS cell types.

Immunocytochemical analysis of the hypothalamus-derived cultures with such antibodies









revealed both neuronal and glial cell types. A few cells per dish were stained with

antibodies to the neurofilament subunits of mature neurons NF-L and NF-M (Figure 3-8

A and B, green channel). These presumably correspond to the mature neurons described

in cultures derived from the adult hippocampus by the same procedure [Brewer, 1993

#29], although we do not see many cells of this type. In initial experiments, we stained

these cultures with monoclonal NF-H neurofilament antibody NE14, as described for the

hippocampal cultures, and noted prominent nuclear staining in essentially all cells (Figure

3-8, C). This staining is probably artifactual, and was not replicated with other NF-H

antibodies.

Antibodies raised against a-intemexin, a neurofilament subunit expressed in

developing neurons of the CNS, revealed strong staining of the islands of patterning cells

(Figure 3-8, A-C, red channel). This finding was made with both monoclonal and

polyclonal antibodies to this protein and suggested that such antibodies and therefore

these neurofilament subunits were good markers for cells of this type in these cultures.

Staining cultures exposed to BrdU for 36 hours showed that the a-internexin positive

cells incorporate BrdU, and are thus proliferating (Figure 3-9). Further double labeling

showed that some a-intemexin positive cells in the hypothalamus derived cultures

expressed nestin, a marker for neuronal stem cells, and all expressed some level of

vimentin, an intermediate filament found in developing cells (Figure 3-10). However

both these proteins are found in both developing neurons and glia so are not useful for

cell type classification. The patterning cells were therefore stained for markers that are

specific for different types of neural cells. Interestingly, the a-internexin positive cells

showed clear staining for type III P-tubulin, tetanus toxin, MAP2 and tau, showing that









they express several typical neuronal markers (Figure 3-11). There was no overlap of a-

intemexin staining with glial fibrillary acidic protein (GFAP, Figure 3-12, A), the

astrocyte marker. Additionally, there was no overlap of a-intemexin expression in these

cells with the oligodendrocyte marker galactocerebroside (Gal-C, Figure 3-12, B). There

was also no overlap of a-intemexin with isolectin B4, a microglial marker. Similar

staining patterns were obtained with brainstem-derived cultures. The patterning cells

therefore have several immunocytochemical properties expected of neuronal cells.

The hallmark characteristic of cells committed to a neuronal fate versus other

cells of the mature CNS is the functional ability to fire action potentials and release

quanta of neurotransmitter. Action potential initiation and propagation requires Na+

channel expression while neurotransmitter release requires Ca2+ influx through voltage

gated Ca2+ channels. Patch clamp analysis of patterning cells reveals the presence of

Cd2+ sensitive Ca2+ current in the cells cultured from the brainstem with a peak current-

voltage relationship of -0.50.1 pA/pF at a membrane potential of -30 mV (n=5, Figure

3-13). Fast inward currents were recorded in solutions lacking Ca2+ and K+ ions. These

currents, likely to be carried via voltage gated Na+ channels, show a peak current voltage

relationship of -154.549.8 pA/pF at a membrane potential of -10 mV (n=5, Figure 3-14).

Similar results were obtained via voltage-clamp recordings from hypothalamic cultures.

Despite the presence of voltage-gated currents, neither spontaneous nor evoked APs were

detected in current clamp analyses, consistent with an immature neuronal phenotype.

Exploiting the proliferative nature of these cells, the cultures were passage and

split. Post-passage, the cells continued to express a-intemexin and maintained their

proliferative nature and stellate morphology (Figure 3-15). The cells also survived









cryopreservation for up to 15 days. Finally the cells were tested for infectability using a

lentiviral vector containing a GFP construct. Expression of GFP was evident in infected

stellate cells one-day post infection and was maintained for up to ten days post infection

(Figure 3-16).

To assess the potential of these cells to use as a model for Ang II studies on NE

release, binding studies using [125I]-Ang II were carried out in the absence and presence

of losartan, the ATiR antagonist, and/or PD123,319, the AT2R antagonist. Results from

binding studies on 3 different culture sets showed no specific binding of labeled Ang II,

suggesting a lack of expression of either receptor subtype. Additionally, Western blot

analysis of TH expression revealed no expression in cultures derived from the

hypothalamus, implying a lack of catecholaminergic neurons and the capacity to produce

catecholamines (Figure 3-17). Although these data preclude immediate use of the

cultures for NE release studies, they are consistent with the immature phenotype revealed

by the immunocytochemical and electrophysiological profile.

Stem cells by definition can be converted to other cell types. To assay the ability

of the patterning cells to be driven to differentiate to a non-neuronal phenotype, cultures

were incubated with the thyroid hormone triiodothyronine (T3, 3 ng/mL), which has been

shown to convert stem cells to oligodendrocytes and astrocytes [Johe, 1996 #19]. The

astrocyte cell number after T3 treatment was compared to the astrocyte cell number in

control cultures relative to the total cell number, and despite the presence of a trend in

both the hypothalamic and brainstem cultures toward a greater astrocyte number, the

differences were not significant (Figure 3-18).









Discussion

Efforts to optimize the procedure to study NE release produced several

unexpected results. First, cultures derived from WKY rat pups had significantly greater

[3H]-NE uptake via the specific neuronal uptake mechanism, as determined by

maprotiline sensitivity and as compared to Sprague-Dawley derived cultures. Since both

rat strains are normotensive, this result was surprising, and could not be explained by a

larger expression of TH in the WKY cultures. Since dopamine P-hydroxylase is the

enzyme responsible for NE production, this enzyme may have been a better marker to

assay for noradrenergic neurons, which may be elevated in the WKY with respect to the

Sprague-Dawley cultures. However, at the time of the experiment, a reliable antibody to

DBH was unavailable. Also, since TH is required for production of all catecholamines, it

may be a better indicator of cells that would be anticipated to take NE up, since there is a

possibility of some uptake into dopaminergic neurons.

None of the Ca2+ modulators significantly altered NE release, spontaneous or

evoked, with respect to control. Ang II has been shown to increase release in several

systems, in vivo and in vitro. Additionally, Ang II, in neurons, increases voltage gated

Ca2+ current, which has been shown to mediate neurotransmitter release. Surprisingly,

Ang II had no effect on spontaneous or evoked NE release from the neuronal cultures.

High K+ concentration is used to evoke release. The increased concentration of external

potassium is expected to depolarize the neurons beyond the threshold for Ca2+ channel

activation, therefore causing neurotransmitter release. Because Ca2+ current mediates this

effect, Cd2+, which blocks all Ca2 current subtypes, should prevent the evoked release.

However, 10 WM Cd2+ had no effect on the evoked release suggesting that the high K+









concentration caused an increase in NE release by a Ca2+ independent mechanism.

Nifedipine also had no significant effect on spontaneous or evoked release. This can be

explained by the fact that nifedipine sensitive L-type current is not generally associated

with neurotransmitter release. Distinct from the other Ca2+ modulators, nifedipine also

had a significant effect on the NE uptake.

The results from these preliminary studies suggest that the [3H]-NE release from

the neurons is not Ca2+ dependent. In the subsequent experiments, eliminating and

buffering Ca2+ eliminated the significant differences between the control and high K+

evoked release. While superficially this suggests that the high K+-evoked release does

require Ca2+, in reality, the spontaneous NE release is seemingly affected by the omission

of Ca2+, which is causing the loss of significant difference between the control and high

K+ samples. Additionally, EGTA has a significant effect on NE uptake, which may cause

artifactual results in the release experiments.

The results from the release and uptake studies suggest that the assay in this

model system is not sufficiently sensitive to detect changes in neurotransmitter release by

varying the sources of Ca2+ influx. In addition, the effects of Ca2+ on release cannot be

dissected from its effects on uptake in this assay. Carbon fiber amperommetry may be a

better assay system to measure the effects of Ang II on release of NE, since it allows

study of a single cell that can be voltage clamped to evoke release and monitor Ca2

current. Another way to make the assay more sensitive is to somehow enrich the cultures

for neurons containing the desired attributes. Since neurons do not survive automated

cell sorting, it may be necessary to use molecular techniques to optimize the system

artificially.









Cultures derived from adult rat hypothalamus and brainstem generated a class of

dividing cell that formed a distinctive two-dimensional network that were therefore

dubbed "patterning cells". a-internexin antibodies were excellent markers for this type

of cell. Since a-internexin positive cells incorporated BrdU, it was clear that they were

proliferative. Significantly, these a-internexin positive cells also stained with antibodies

to several other well-accepted neuronal markers, namely type III 3 tubulin, MAP2 and

tau. Incubation with tetanus toxin and subsequent antibody staining also revealed the

presence of tetanus toxin binding sites, another well accepted neuronal marker. In

contrast, these cells lacked GalC staining and GFAP staining, showing a lack of well

accepted oligodendrocyte and astrocyte markers. Because the patterning cells appeared

to divide, yet expressed neuronal markers, it seemed likely that they could be classified as

a neuronal progenitor or precursor cell. The presence ofvimentin and nestin is as

expected for early neuronal lineage cells, and both were found to be expressed in the a-

intemexin positive cells. The electrophysiological data presented here indicates the

expression of Na+ channels and voltage gated Ca2+ channels. Neurons generally acquire

the ability to generate APs relatively late in neurogenesis, so the inability to detect action

potentials in patterning cells is not inconsistent with the properties expected of early

differentiating neuronal cells [Liu, 1999 #47]. It seems the patterning cells belong to the

neuronal lineage but have the unusual property of retaining the ability to divide in tissue

culture.

The patterning cells are morphologically similar to a class of dividing cells found

in similar cultures derived from adult rat hippocampus that were described while the

present work was in progress, though it remains to be seen if the cells are identical









[Brewer, 1999 #23]. It will be interesting to see how far it is possible to expand these

cells in tissue culture and if these cells can be induced to differentiate into more mature

neuronal phenotypes by appropriate adhesion and growth factor treatments. Preliminary

studies with T3 caused a trend toward glial differentiation in the presence of this growth

factor, but due to the fact that the culture medium is optimized to promote survival of

neurons over glia, it will be necessary to put the cells into less-selective medium to

determine the ability for them to differentiate to cell types other than neuronal cells. It is

somewhat surprising that these cells are able to divide, as previous studies have suggested

that a-internexin is normally expressed post-mitotically [Kaplan, 1990 #34], as are tau,

MAP2, type III 3 tubulin and tetanus toxin binding sites. Even after 35 days in tissue

culture these a-intemexin positive cells do not express NF-L or NF-M, the neurofilament

subunits characteristic of more mature neurons, suggesting that these cells maintain

immature neuronal characteristics over several divisions. Possibly the FGF2 treatment or

other aspects of the culture conditions select for an immature neuron type, suppressing

terminal differentiation of the cells. Interestingly, and in contrast to previous stem and

progenitor cell findings, omission or withdrawal ofFGF2 results in cell death or lack of

population expansion [Kaplan, 1990 #34].

The a-internexin positive cells may resemble cells extracted from mature brain

tissues by several other groups [Reynolds, 1992 #50]. These cells generally develop

"neurospheres" in tissue culture under the influence of growth factors such as epidermal

growth factor and FGF2. The present procedure, while distinct in many ways from that

used to generate these progenitor cells, does use FGF2 and may also select for the

proliferation of cells of this type. The a-intemexin positive patterning cells may









therefore have the same origin as so-called neuronal progenitors currently being studied

by many other groups. In support of this conclusion, sometimes what appeared to be

spontaneous neurospheres were observed in these cultures, some cells in which stained

with a-intemexin antibodies.

The origin of the a-internexin positive cells described here is an interesting

subject for future study. Perhaps they derive from a mature neuron type that de-

differentiates in tissue culture, or they may derive from a population of stem or

progenitor cells such as those described by other research groups. It is now generally

accepted that there are two regions of relatively active neurogenesis in the adult

mammalian brain, namely the subgranular zone of the dentate gyms of the hippocampus

and the subventricular zone lining the ventricles [Gage, 1998 #44]. One group has

provided evidence that a subpopulation of ependymal cells in the adult brain can generate

colonies in tissue culture which contain both neurons and glia [Johansson, 1999 #52],

while another has shown that a distinct class of GFAP positive cells can generate both

neurons and glia [Doetsch, 1999 #41]. The starting material for hypothalamic cultures

includes the third ventricle, which is expected to include subventricular zone neuronal

progenitor cells. The brainstem cultures were derived from tissue that includes the

cerebral aqueduct also lined with ependymal cells and a small subventricular zone. These

a-intemexin positive cells could therefore be derived either from ependyma or

subventricular zone. However, although a detailed immunocytochemical analysis was

not performed on these cultures, patterning cells were also derived from locus coeruleus

or dorsal vagal nucleus, which were dissected carefully so as not to contain ventricle. In

any case it is apparent that a neuron-like dividing cell type can be harvested from adult









brain, identified with an ca-intemexin antibody, and made to divide and differentiate to an

early neuronal phenotype. The culture procedure used for these studies provides a cell

type useful for studies of neurogenesis relating to brain injury and repair. Because the

cultures proliferate and can be split and passage, it should also be possible to grow

clonogenic cultures. Finally, as demonstrated here, the ability to infect these cells and

cause them to express exogenous proteins can be exploited in further differentiation

studies and also to track the movement and differentiation of these cells in future

transplantation studies.

Despite the lack of Ang II receptors and TH expression, these cells may still

prove to be a good model for NE release studies. Exploiting the proliferative nature of

these cells, they can be infected and cloned and made to express the appropriate

components of a system, therefore becoming a "designer" expression system with a

neuronal background. In addition, it will be possible to determine if expression of Ang II

receptors is sufficient to convey a particular neurotransmitter phenotype or to cause

terminal differentiation of the cells.







74







A B

14000 50000 -

12000 /- [ H]-NE uptake
40000 _- [3H]-NE uptake
w/ 100 pM maprotiline
10000
80 r 30000 -
E 8000 ---- E

6000 / 20000

4000 / [H]-NE uptake 10000
--- [ H]-NE uptake
2000 w/100 pM maprotiline

0 I I I 0
0 5 10 15 20 25 30 35 0 10 20 30 40 50
Time (min) Time (min )





Figure 3-1. Optimization of [3H]-NE uptake in neuronal co-cultures. A. More than half
of the NE taken up by Sprague-Dawley derived neurons is not mediated by the
maprotiline-sensitive norepinephrine transport protein. B. The NE uptake in WKY-
derived neurons is not saturable during the course of the experiment, but a large portion
of the uptake is maprotiline-sensitive.

















I
C-;


Now P-
c~-,- ^~S


Y


0

is-
Q i 20-

X )
t5
U |
1-


r5-


*


4~\O


a/


p<0.05 as compared to Sprague-Dawley




Figure 3-2. Analysis of TH expression in Sprague Dawley and WKY derived neuronal
cultures. A. Western blot analysis with an antibody recognizing TH protein shows that
WKY cultures generally express less TH per 20 |tg of protein than those derived from
Sprague Dawley animals. B. Densitometry analysis of TH expression shows that the
expression in WKY derived cultures is significantly less than in Sprague Dawley
cultures. Data are expressed as the mean + s.e.m.



























cn

LU.
zE
Tv


30000



25000



20000



15000



10000



5000



0


~, o,
0,' 0,* o~
~C) ~ ccb (0 C


* p < 0.05


2 Washes


3 Washes


4 Washes


Figure 3-3. Optimization of the number of washes prior to stimulation of NE release.








77







A B


7000
17500
6000
15000 -
5000 15000


4000
4 I c 10000 -
-- 3000- I E
LE r 7500
2000 5000

1000 2500

0 0


100 nM 100 M 1HM 100 nM 100 M 10 M
Ang II Cd2+ nlfedipne Ang II Cd2 nlfedipmne
p< 0 05 p < 0 05




Figure 3-4 Effect of Ang II, Cd2+, or nifedipine on [3H]-NE release and uptake. A.
Neither Ang II, which increases voltage gated Ca2+ current, nor Cd2+ or nifedipine which
block all or L-type Ca2+ current, respectively, have significant effects on NE release. B.
Nifedipine does significantly alter NE uptake.








78







A B


12000 60000

10000 50000


8000 I 1 40000


S 6000- I 30000

T1 I E
4000 20000


2000- [_ _ _._ 10000


O 0
0 -- --- o --- -

OCa 0Ca2+ 5 mM 0 mM Ca 0a2+ mM mM
p 0 05 through EGTA EGTA p<005 through EGTA EGTA




Figure 3-5. Ca2+ dependence of [3H]-NE release and uptake. A. 0 Ca2+ during the
release and 10 mM EGTA appear to have significant effects on NE release. B. Buffering
Ca2+ with EGTA appears to affect uptake, suggesting the effects of 10 mM EGTA on
release may be a result of altered uptake.






79




7 days 10 days 14 days
u,
E


O
CL


E

I-




Figure 3-6. Population expansion of cells cultured from adult rat hypothalamus and
brainstem photographed in phase contrast microscopy. Cells cultured from adult rat
hypothalamus (top row) or brainstem (bottom row) develop a stellate morphology and
form extended monolayer networks as shown in the photomicrographs of live cells.
Magnification is 100X.





















# of
cells






100 10i 102 10i 10'
BrdU Incorporation
(arbitrary units)



Figure 3-7. Flow cytometric analysis of BrdU incorporation in adult rat brain-derived
cultures. A second peak is observed for brainstem-derived cultures which have been
incubated with BrdU for 24 hours (gray) when compared to the histogram obtained for
control cultures not treated with BrdU (black line). The second peak represents a
population of cells that incorporated BrdU into DNA and thus was proliferating. The
fraction of cells proliferating was taken as the number of cells in the region marked
"BrdU-positive cells" divided by the total number of cells. Data representative of 4
different culture dishes.





































Figure 3-8. Presence of a-internexin in the absence of neurofilament triplet protein
expression in patterning cells. A. Hypothalamic culture fixed after 23 days in vitro and
stained for neurofilament NF-L (DA2 monoclonal antibody, green channel). This
antibody stains large relatively rare cells with an obviously neuronal morphology. A
network of a-intemexin positive cells, as revealed with polyclonal antibody R35 (red
channel), do not stain for NF-L. B. Hypothalamic culture fixed after 23 days in culture
and stained with NF-M as revealed with monoclonal antibody 3H11 (green channel) is
also not expressed in a-internexin positive cells as revealed with R35 antibody (red
channel). C. Monoclonal antibody NE14 (green channel) stains nuclei found in all cell
types (hypothalamic culture 22 days in vitro). No filamentous staining ofNF-H is present
in a-internexin positive cells (red), though some staining was seen in the processes of
NF-L/NF-M positive cells such as those shown in figure 4a and 4b. Scale bars: 50 |tm.































Figure 3-9. BrdU incorporation by a-internexin positive cells. Monoclonal antibody to
BrdU (green channel) reveals BrdU incorporation in nuclei of a-intemexin positive
hypothalamic cells (R35 antibody, red channel). Scale bar: 50 |tm.













































Figure 3-10. Markers indicative of an early neuronal phenotype are expressed in the a-
internexin positive patterning cells. A. Some a-internexin positive cells (R35 antibody,
red channel) co-express nestin (Rat 301 antibody, green channel), a neuroepithelial stem
cell marker. Hypothalamic cultures after 21 days in culture. B. Vimentin (V9 antibody,
green), an intermediate filament found in many cell types, is co-expressed with a-
internexin (R36, red) in some cells. All a-intemexin positive cells revealed some
vimentin staining, but many vimentin positive cells, presumably glia, showed no a-
internexin staining. Scale bars: 25 |tm.




































Figure 3-11. The a-internexin positive cells co-express several well-accepted neuronal
markers. A. a-intemexin positive cells (R35 antibody, red) co-express MAP2 (AP20
monoclonal antibody, green) in dendrite like processes. Hypothalamic cells 18 days in
tissue culture. B. Tau expression (Tau monoclonal antibody, green) overlaps with a-
intemexin expression (R35 antibody, red). Some other stellate cells, apparently astrocytes
also show tau expression. Hypothalamic cultures 24 days in culture. C. Tetanus toxin
binding sites (revealed with Boerhinger-Mannheim kit, in green) are present on the
processes of the a-intemexin positive cells (R35 antibody, red). Hypothalamic cultures
29 days in tissue culture. D. P-tubulin III expression (Sigma antibody, green) overlaps
with a-internexin expression (R35, red) in a cell in a hypothalamic culture after 26 days
in culture almost completely. Scale bars: A and B, 50 [tm; C and D, 25 tm.













































Figure 3-12. a-intemexin expression does not overlap with expression of glial markers.
A. a-internexin (R35 antibody, red) expression of patterning cells does not overlap with
GFAP expression (GA5 antibody, green) demonstrating that the lack of the astrocytic
marker in these cells. B. Cells expressing Gal-C (Sigma antibody, red) are fewer in
number and distinct from a-internexin positive patterning cells (2E3 antibody, green)
showing the absence of the oligodendrocyte marker in these cells. Scale bars: 50 |tm.
































-0.8 1 ..Ii
-80-60-40-20 0 20 40 60 80100
Membrane Potential (mV)


z -10 -

E -15-

-20
C-

-25 -

-30 -

-35


Cd2+


0 2 4 6 8 10 12 14 16 18
Time (ms)


Figure 3-13. Patterning cells cultured from adult rat brain express Cd2+ sensitive Ca2
current. A. A representative family of Ca2+ currents elicited by step depolarizations from
a holding potential of -80 mV. B. Current voltage relationship with a peak of 0.5 pA/pF
at -20 mV (n=5). C. Ca2+ current elicited by a step depolarization to -20 mV was
blocked by superfusion of 10 pLM Cd2+


70 mV


0.4

u_ 0.2

1 0.0


S-0.2

E -0.4

C( -0.6


20 ms


Jl.11 I .1


I' '" II


0

50 ms






87






A
+30 mV
-120 mV -70 m


C0

20 ms


B


- bU
CI
50


'*U -50
a,
- -100

= -150

-200


-80 -60 -40 -20 0 20 40 60
Membrane Potential (mV)


Figure 3-14. Patterning cells from adult rat brain express Na current. A. A
representative family ofNa+ currents elicited by step depolarizations from a holding
potential of -120 mV. B. Stellate cells cultured from adult rat brain express Na+ current
with a peak of the current voltage relationship of 150 pA/pF at -15 mV (n=5). Cell
capacitance ranged from 9-90 pF.






































Figure 3-15. Patterning cells survive passaging in tissue culture and retain a-internexin
expression. The a-intemexin positive cells (green) continue to proliferate and maintain
their stellate morphology after being split. Scale bar: 50 |tm.






89




Bright field GFP





Control. .









Infected






Figure 3-16. Patterning cells express GFP after infection with a lentivirus construct.
Stellate cells express GFP (green) 24 hours post infection and continue to express up to
10 days post infection. Control, non-infected cells do not show GFP fluorescence. Scale
bars: top, 200 [tm; bottom, 50 [tm.















78 kDa --







India Ink


Figure 3-17. Western blot analysis of TH expression in adult rat-derived cultures.




University of Florida Home Page
© 2004 - 2010 University of Florida George A. Smathers Libraries.
All rights reserved.

Acceptable Use, Copyright, and Disclaimer Statement
Last updated October 10, 2010 - - mvs