• TABLE OF CONTENTS
HIDE
 Title Page
 Acknowledgement
 Table of Contents
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 Biographical sketch














Title: Sh2-UR1
CITATION PDF VIEWER THUMBNAILS PAGE IMAGE ZOOMABLE
Full Citation
STANDARD VIEW MARC VIEW
Permanent Link: http://ufdc.ufl.edu/UF00100720/00001
 Material Information
Title: Sh2-UR1 an allosteric mutant of ADPglucose pyrophosphorylase
Physical Description: Book
Language: English
Creator: Caren, Joel Rogers, 1973-
Publisher: State University System of Florida
Place of Publication: Florida
Florida
Publication Date: 2000
Copyright Date: 2000
 Subjects
Subject: Plant Molecular and Cellular Biology thesis, M.S   ( lcsh )
Dissertations, Academic -- Plant Molecular and Cellular Biology -- UF   ( lcsh )
Genre: government publication (state, provincial, terriorial, dependent)   ( marcgt )
bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )
 Notes
Summary: ABSTRACT: Our understanding of starch synthesis in plants has benefitted from a broadening base of species studied. Discoveries made in one species may often translate to others. Previous work with potato tuber ADPglucose pyrophosphorylase (AGP), the enzyme responsible for synthesizing the substrate for starch synthesis, showed that a mutation from glutamate to lysine at position 38 in the large subunit of the enzyme increased sensitivity to 3-phosphoglycerate activation and reduced inhibition by phosphate. Since the enzyme is highly conserved among species, this research tested the effect of this mutation in the maize endosperm AGP. Site-directed mutagenesis was used to change threonine to lysine at position 93 (comparable to the previously mentioned mutation in potato), and the resulting mutant enzyme was partially purified and molecularly and biochemically characterized. The mutation in maize did not affect the enzyme's affinity for substrates or phosphate, the inhibitor. Activation by 3-phosphoglycerate did increase by 27%. This amino acid position appears to be less important to allostery in maize endosperm AGP than it is to allostery in potato tuber AGP.
Summary: KEYWORDS: maize, corn, AGP, ADPglucose pyrophosphorylase, site-directed mutagenesis, genetics, starch, activation, 3PGA
Thesis: Thesis (M.S.)--University of Florida, 2000.
Bibliography: Includes bibliographical references (p. 48-52).
System Details: System requirements: World Wide Web browser and PDF reader.
System Details: Mode of access: World Wide Web.
Statement of Responsibility: by Joel Rogers Caren.
General Note: Title from first page of PDF file.
General Note: Document formatted into pages; contains vi, 53 p.; also contains graphics.
General Note: Vita.
 Record Information
Bibliographic ID: UF00100720
Volume ID: VID00001
Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
Resource Identifier: oclc - 45296670
alephbibnum - 002566151
notis - AMT2432

Downloads

This item has the following downloads:

Thesis ( PDF )


Table of Contents
    Title Page
        Page i
    Acknowledgement
        Page ii
    Table of Contents
        Page iii
        Page iv
    Abstract
        Page v
        Page vi
    Introduction
        Page 1
        Page 2
        Page 3
        Page 4
        Page 5
        Page 6
        Page 7
        Page 8
        Page 9
        Page 10
        Page 11
        Page 12
        Page 13
        Page 14
        Page 15
        Page 16
        Page 17
        Page 18
        Page 19
        Page 20
    Materials and methods
        Page 21
        Page 22
        Page 23
        Page 24
        Page 25
        Page 26
        Page 27
        Page 28
        Page 29
        Page 30
        Page 31
        Page 32
        Page 33
    Results
        Page 34
        Page 35
        Page 36
        Page 37
        Page 38
        Page 39
        Page 40
        Page 41
    Discussion
        Page 42
        Page 43
        Page 44
        Page 45
        Page 46
        Page 47
    References
        Page 48
        Page 49
        Page 50
        Page 51
        Page 52
    Biographical sketch
        Page 53
Full Text



















Sh2-URl: AN ALLOSTERIC MUTANT OF ADPGLUCOSE PYROPHOSPHORYLASE


By

JOEL ROGERS CAREN




A THESIS PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE

UNIVERSITY OF FLORIDA


2000















ACKNOWLEDGMENTS


I would like to express my most sincere thanks to Dr.

L. Curt Hannah, who has invested inordinate time and

resources in my research and education. His patience,

knowledge, and ingenuity have taught me what it truly means

to be a scientist.

My eternal gratitude goes to Janine Shaw, Joanna Cross,

Tom Greene, and all the members of our laboratory group for

their encouragement, guidance, and friendship.

I wish to thank my mother with all my heart, for

investing her life in me, that I might grow to be a man of

integrity.

I thank my Lord, Jesus Christ, who has given me the

strength to persevere, and who has blessed me with these

people in my life.
















TABLE OF CONTENTS


ACKNOWLEDGMENTS . . . . . .

ABSTRACT . . . . . . .


CHAPTERS


1 INTRODUCTION . . . . .

Starch Synthesis . . . .
Starch Biosynthesis Pathway
Other Effects . . . .
ADPglucose Pyrophosphorylase .
AGP Allosteric Properties . .
Allosteric Compensation for


S 1


Reduced Activity


Identification of Effector Binding Sites


Activation by 3PGA . . . . .
Inhibition by Inorganic Phosphate .
Expression and Structure of AGP . . .
Expression . . . . . . .
General Structure . . . . .
Subunit Interaction . . . . .
Up-Regl: An Allosteric Mutant of AGP . .
Up-Regl in S. tuberosum . . . .
Proposal . . . . . . .

2 MATERIALS AND METHODS . . . . .

Mutant Generation and Screening . . .
Site-directed Mutagenesis . . .
Glycogen Staining . . . . .
Sequencing to Verify Point Mutations
Purification of AGP . . . . . .
Culture and Induction of AGP . .
Extraction of Protein from Cells .
Separation by Hydrophobicity . .


. 6


. . . 12
. . . 12
. . . 13
. . . 13
. . . 14
.. .... 16
. . . 18
. . . 18
. . . 19

. . . 21


Bradford Assay to Measure Protein Concentration
Assays of Enzyme Activity . . . . . . .
Pyrophosphorolysis Assay . . . . . .
ADPglucose-Synthesis Assay . . . . .


iii


page

. ii

iii











Enzyme Kinetics . . . .
Dilution Series . . . .
ExT Assay . . . . .
Activation by 3PGA . . .
Inhibition by Pi . . .
Measurement of Km .....

3 RESULTS . . . . . .


Initial Screening and Purification . . . . 34
Glycogen Staining . . . . . . . 34
Purification . . . . . . . . 34
E x T Determination . . . . . . . 36
Kinetic Properties . . . . . . . . 37
Km Determination . . . . . . . 37
Activation by 3PGA . . . . . . . 40
Inhibition by P04 . . . . . . . 41

4 DISCUSSION . . . . . . . . . . 42

Summary . . . . . . . . . . 42
Comparison with E38K in S. tuberosum . . . . 44
Other Possible Amino Acid Substitutions . . . 44


REFERENCES


BIOGRAPHICAL SKETCH . . . . . . ..


. . . 53
















Abstract of Thesis Presented to the Graduate School
of the University of Florida in Partial Fulfillment of
the
Requirements for the Degree of Master of Science




Sh2-URI: AN ALLOSTERIC MUTANT OF ADPGLUCOSE
PYROPHOSPHORYLASE

By

Joel Rogers Caren

May 2000


Chair: L. Curtis Hannah
Major Department: Plant Molecular and Cellular Biology

Our understanding of starch synthesis in plants has

benefitted from a broadening base of species studied.

Discoveries made in one species may often translate to

others. Previous work with potato tuber ADPglucose

pyrophosphorylase (AGP), the enzyme responsible for

synthesizing the substrate for starch synthesis, showed

that a mutation from glutamate to lysine at position 38

in the large subunit of the enzyme increased sensitivity

to 3-phosphoglycerate activation and reduced inhibition

by phosphate.










Since the enzyme is highly conserved among species,

this research tested the effect of this mutation in the

maize endosperm AGP. Site-directed mutagenesis was used

to change threonine to lysine at position 93 (comparable

to the previously mentioned mutation in potato), and the

resulting mutant enzyme was partially purified and

molecularly and biochemically characterized. The

mutation in maize did not affect the enzyme's affinity

for substrates or phosphate, the inhibitor. Activation

by 3-phosphoglycerate did increase by 27%. This amino

acid position appears to be less important to allostery

in maize endosperm AGP than it is to allostery in potato

tuber AGP.
















CHAPTER 1
INTRODUCTION







Starch Synthesis



Starch is the primary energy storage product in higher

plants, as well as an important source of nutrition for

humans. As such, it is a clear target for genetic

engineering efforts to improve the world's food supply.

Starch makes up 70% of the dry weight in the maize seed, and

increased starch synthesis appears to provide a greater

carbon sink in the seed (Giroux et al. 1996).


Starch Biosynthesis Pathway

ADPglucose is the glucosyl donor in starch biosynthesis

(Recondo and Leloir 1961). In both prokaryotes and

photosynthetic eukaryotes, ADPglucose is formed through the

reaction:


ATP + alpha-glucose-1-P <==> ADPglucose + PPi (Espada 1962).


In higher plants, starch synthase then catalyzes the

1









2

addition of glucose from ADPglucose to growing amylose

chains thus:



ADPglucose + (glucosyl)n --> ADP + (glucosyl)n+i (Espada
1962).


Amylopectin precursor is likely formed in a similar reaction

by an unidentified enzyme. Starch branching enzyme then

catalyzes the formation of alpha-1-6 linkages in

phytoglycogen. Starch debranching enzyme removes about half

the branch-chains in phytoglycogen to form amylopectin

(reviewed in Hannah 1997).


Other Effects

Mutations that reduce starch synthesis have also been

found to affect zein synthesis (Barbosa and Glover 1978),

and in severe starch mutants, zein transcript levels

actually increase (Giroux et al. 1994) though zein protein

decreases (Tsai et al. 1978). Impairing synthesis of starch

also increases transcription of the starch synthetic genes,

depending on the mutation and each individual gene, as well

as the tissue's function as source or sink (Giroux et al.

1994, Muller-Rober et al. 1990). In addition, the changes

in sugar levels that can accompany starch reduction may

affect signal transduction (Giroux et al. 1994), thus









3

precipitating other changes in the cell and tissue as a

whole.






ADPglucose Pyrophosphorylase



ADPglucose pyrophosphorylase (ADP: alpha-D-glucose-1-

phosphate adenyltransferase) represents the first unique

step in starch synthesis and is important for the regulation

of starch biosynthesis in plants and glycogen synthesis in

bacteria (reviewed in Greene and Hannah 1998a). Loss of

ADPglucose pyrophosphorylase (AGP) activity gives a

shrunken, collapsed kernel phenotype in maize endosperm

(Mains 1949), indicating lost capacity for starch

production. AGP is an allosteric enzyme. Stark et al.

(1992) have suggested that this allosteric property makes

AGP rate-limiting in starch biosynthesis of higher plants,

since they found that starch production varied with the

allostery of GlgC-AGP transgenic potato tubers.

Early work with maize endosperm AGP mutants seemed to

indicate the presence of a single form of AGP in maize

endosperm, since AGP kinetics varied according to the mutant

(Hannah and Nelson 1975, 1976). More recent work conducted

by Giroux and Hannah (1994) using null Bt2 and Sh2 mutants









4

(having no detectable protein product) showed that 5 20%

of wild type activity remains in the absence of a functional

Bt2 and/or Sh2 gene. Giroux and Hannah (1994) concluded

that a second form of AGP, independent of Bt2 and Sh2, must

account for this residual activity. These researchers then

identified transcripts in the endosperm resembling those of

Agpl and Agp2, the large and small subunits of maize embryo

AGP (Giroux and Hannah 1994).

Other plant tissues have been found to express multiple

forms of AGP as well. For example, tomato fruit contains

three isoforms of the AGP large subunit and two of the small

subunit (Chen and Janes 1997). In Arabidopsis, the large

subunit is encoded by Adg2 (Lin et al. 1988, Wang et al.

1997), and the small subunit is encoded by Adgl (Wang, et

al. 1998). Adg2 mutants do not completely abolish activity,

but retain 5% wild-type AGP activity levels and 40% wild-

type starch levels (Lin et al. 1988), possibly due to the

presence of multiple forms of the enzyme within the cell as

in maize endosperm.









5

AGP Allosteric Properties




AGP is an allosteric enzyme. In higher plants, AGP is

activated by 3-phosphoglycerate (3PGA) and inhibited by

phosphate (Pi, or PO4) (Preiss et al. 1966a), whereas

bacterial AGP is activated by fructose-1,6-bisphosphate

(FBP) and inhibited by cAMP (Preiss et al. 1966b). Known

effector binding sites in bacteria are conserved in all

species of bacteria and higher plants (Smith-White and

Preiss 1992). Cereal endosperm AGP's are relatively

insensitive to activation; at the extreme, wheat endosperm

AGP is completely insensitive to 3PGA (reviewed in Preiss et

al. 1991b). Leaf AGP's are highly sensitive to affector

molecules. For example, spinach leaf AGP is activated 58

fold by 3PGA and inhibited 50% by 45 pM Pi (Copeland and

Preiss 1981). For many plant species and isozymes, the

ratio of 3PGA to Pi is postulated to be the critical

regulator of starch accumulation (Singh et al. 1984,

Kleczkowski 1999).


Allosteric Compensation for Reduced Activity

A study of dosage effects in sh2 mutants of triploid

maize endosperm suggested that AGP's allosteric properties

can compensate for a one-third reduction in activity









6

conditioned by a mutant male crossed onto a wild-type

female, since this combination caused no decrease in seed

weight. Yet a two-thirds reduction conditioned by a wild-

type male crossed onto a mutant female did decrease seed

weight (Hannah and Greene 1998).


Identification of Effector Binding Sites

As an allosteric enzyme, AGP has multiple effector

binding sites. Studies of amino acids important to enzyme

activity are facilitated by the use of pyridoxal-5-

phosphate, which covalently binds to lysines in the

activator binding site, blocking 3PGA from binding (Preiss

et al. 1987). The potato tuber large subunit has three

lysines with which pyridoxal-5-P reacts, and the small

subunit has one such lysine (Morell et al. 1988, Smith-White

and Preiss 1992). Spinach leaf AGP also has three lysines

that bind pyridoxal-5-P (Preiss et al. 1995), whereas maize

endosperm AGP has only one (Shaw and Hannah 1992). While

the number of identified lysines is correlated with 3PGA

activation, addition of lysines to maize endosperm AGP at

positions analogous to those in spinach AGP does not

increase sensitivity to 3PGA (Shaw, personal communication).

Random mutagenesis of the AGP subunits has also helped

identify AGP's effector binding sites. Greene et al.

(1996b) changed Asp413 to Ala in the potato large subunit












and the resultant mutant required six to ten fold more 3PGA

than did the wild-type for maximum activation. Changing

Lys417 and Lys455 of the large subunit also decreased 3PGA

affinity nine and three fold, respectively (Ballicora et al.

1998) (Table 1).


Table 1. AGP large subunit mutations. Amino acid and
position listed is maize endosperm AGP site relative to
actual mutation where appropriate.
Mutation Organism/tissue Effect


maize endosperm


potato tuber


maize endosperm


maize endosperm


maize endosperm



potato tuber





maize endosperm


maize endosperm


maize endosperm


3PGA activation increased 27%
(this thesis)

3PGA activation decreased 45
fold (Greene et al. 1996)

temperature stability increased
12% (Greene et al. 1998)

temperature stability increased
(Greene et al. 1998)

temperature stability decreased
in Sh2-HS33 background (Greene
et al. 1998)

no effect on activity; however,
mutation of comparable Lys in
small subunit (K222, Table I)
decreased affinity for GIP (Fu
et al. 1998)

temperature stability increased
51% (Greene et al. 1998)

temperature stability increased
(Greene et al. 1998)

temperature stability increased
(Greene et al. 1998)


T93K


P99L


R104T


A177P


R217P



K265A





H333Y


D400H


V454I














Table 1

Mutation

T460I



D468A


K469A


K469E



K506A




K506E


--Continued

Organism/tissue

maize endosperm



potato tuber


potato tuber


potato tuber



potato tuber




potato tuber


However, mutating Lys404 and Lys441 of the small

subunit decreased 3PGA affinity 3000 and 50 fold,

respectively, and both mutations decreased Pi affinity 400

fold (Ballicora et al. 1998). (Table II) In this case,

mutating the small subunit had greater significance for

effector binding than did mutating the large subunit

(Ballicora et al. 1998). These data agree with the

suggestion by Greene et al. (1996a) that the allosteric

domain is formed by interaction of both subunits.


Effect

temperature stability decreased
in Sh2-HS33 background (Greene
et al. 1998)

sensitivity to both 3PGA and Pi
decreased (Greene et al. 1996)

3PGA activation reduced 10-20
fold (Ballicora et al. 1998)

3PGA activation reduced 10-20
fold (Ballicora et al. 1998)


affinity for 3PGA did not
change; affinity for Pi
increased 4 fold (Ballicora et
al. 1998)

affinity for 3PGA decreased 3
fold; affinity for Pi increased
4 fold (Ballicora et al. 1998)












Table 2. AGP small subunit mutations. Amino acid and
position listed is maize endosperm AGP site relative to
actual mutation where appropriate. FBP, fructose-1,6-
bisphosphate.
Mutation Organism/tissue Effect


C36A



C36S




K64E


A69T




R92C



K222A


K222E


K222R


K296E


P324S



G359D


K428A


potato tuber



potato tuber




E. coli


E. coli




E. coli



potato tuber


potato tuber


potato tuber


E. coli


E. coli



E. coli


potato tuber


temperature stability
decreased 65% (Ballicora et
al. 1999)

temperature stability
decreased 65% (Ballicora et
al. 1999)


affinity for FBP decreased
(Gardiol and Preiss 1990)

affinity for FBP decreased 25
fold; affinity for AMP
decreased 7.7 fold (Meyer et
al. 1993)

affinity for FBP increased,
affinity for cAMP decreased
(Meyer et al. 1993)

affinity for GIP decreased 400
fold (Fu et al. 1998)

affinity for GIP decreased 550
fold (Fu et al. 1998)

affinity for GIP decreased 135
fold (Fu et al. 1998)

no effect on activity (Kumar
et al. 1989)

affinity for FBP increased,
affinity for cAMP decreased
(Meyer et al. 1998)

affinity for FBP increased
(Meyer et al. 1998)

affinity for 3PGA decreased
3090 fold; affinity for Pi
decreased 650 fold (Ballicora
et al. 1998)












Table 2

Mutation

K465A




K465E


K465Q



K506A


K506E


K506Q


K506R


--Continued

Organism/tissue

potato tuber




potato tuber


Anabaena



Anabaena


Anabaena


Anabaena


Anabaena


In addition, Joanna Cross (personal communication)

expressed an AGP hybrid of the maize endosperm large subunit

and potato tuber small subunit in glgC- E. coli lacking

endogenous glycogen production. The hybrid exhibited

reduced activation by 3PGA and intermediate inhibition by Pi

compared to parental AGP's (Table 3), indicating the

importance of both subunits for allosteric functions.


Effect

affinity for 3PGA decreased
154 fold; affinity for Pi
decreased 432 fold (Ballicora
et al. 1998)

affinity for 3PGA decreased
191 fold; affinity for Pi
decreased 216 fold (Ballicora
et al. 1998)


activator specificity changed:
AGP activated by FBP rather
than 3PGA (Charng et al. 1995)

affinity for 3PGA decreased 50
fold (Charng et al. 1994)

affinity for 3PGA decreased
140 fold (Charng et al. 1994)

affinity for 3PGA decreased
150 fold (Charng et al. 1994)

affinity for 3PGA decreased 25
fold; affinity for Pi
decreased 3 fold (Charng et
al. 1994)









11

Table 3. Comparison of maize endosperm, potato tuber, and
maize large subunit/potato small subunit hybrid AGP's. A0s
is concentration of 3PGA giving half-maximal activation in
the absence of Pi; 10o.s is concentration of Pi giving half-
maximal inhibition in the absence of 3PGA.
Fold
Source Activation A0 s (mM) Io s (mM)

Maize 2-6 2.0 3.0
endosperm

Hybrid 1.6 1.3 0.8

Potato tuber 43 0.045 4.0


Activation by 3PGA

The extent of activation by 3PGA varies among isoforms

of AGP. In barley endosperm, 3PGA activates the enzyme only

25 percent in the ADPglucose synthesis reaction, and 10 mM

3PGA actually inhibits activity 45 percent in the

pyrophosphorolysis reaction (Kleczkowski et al. 1993a). In

tomato fruit, AGP is half-activated by 0.2 mM 3PGA, and is

almost completely inactive in the absence of 3PGA (Chen and

Janes 1997). Potato tuber AGP is also highly activatable by

3PGA (Table 3) (Iglesias et al. 1993), as are the leaf AGP's

of H. carnosa and X. danguyi, which are activated 26 fold by

3PGA, and half-maximally activated by 0.11 0.25 mM 3PGA

(Singh et al. 1984). Reports of 3PGA activation of AGP in

the maize endosperm typically vary from 2 to 6 fold

(Dickinson and Preiss 1969). Maize endosperm AGP's Km for









12

glucose-1-phosphate (G1P) in the presence of 3PGA is

reportedly half that in the absence of 3PGA (Dickinson and

Preiss 1969, Hannah and Nelson 1975).

Interestingly, there may be no physiological relevance

of AGP activation by 3PGA outside the chloroplast (reviewed

in Hannah and Greene 1998). 3PGA is found in the

chloroplast starch synthesis pathway but is not used in

starch synthesis in amyloplasts. Therefore, Greene and

Hannah (1998a) have suggested that activation by 3PGA may be

'evolutionary baggage.'


Inhibition by Inorganic Phosphate

Phosphate is a strong inhibitor of AGP in higher plants

(Ghosh and Preiss 1966). In maize endosperm AGP, 10 mM Pi

causes 50% inhibition in the presence of 10 mM 3PGA

(Dickinson and Preiss 1969). In barley endosperm AGP, which

is relatively insensitive to effector molecules, 24 mM Pi

causes 60% inhibition (Kleczkowski et al. 1993a). In

contrast, potato tuber AGP is inhibited 50% by 0.33 mM Pi in

the presence of 3.0 mM 3PGA (Sowokinos and Preiss 1982).

However, Iglesias et al. (1993) have shown that low levels

of 3PGA actually increase inhibition of potato tuber AGP by

Pi (Io. = 83 uM in the presence of 10 uM 3PGA, lo.s = 4 mM in

the absence of 3PGA). Similarly, Singh et al. (1984) showed









13

that the presence of 3PGA increases AGP's sensitivity to Pi

inhibition (10.5 = 500 uM Pi in the absence of 3PGA or 40 uM

Pi in the presence of 0.15 mM 3PGA) in the leaves of H.

carnosa and X. danguyi.

Phosphate appears to increase activator binding site

interactions, making the 3PGA activation curve more

sigmoidal (Ghosh and Preiss 1966). However, inhibition

studies that identified Pi as the primary inhibitor have

relied upon in vitro assays, and Greene and Hannah (1998a)

have suggested that the true inhibitor in vivo may actually

be a phosphate (or structurally similar) side-group of

another molecule.






Expression and Structure of AGP




Expression

The embryo, leaf, and endosperm of maize have different

forms of AGP (Preiss et al. 1971, Hannah and Nelson 1975,

Hannah et al. 1976, Fuchs 1977). The maize embryo large

subunit is encoded by Agpl, and the small subunit encoded by

Agp2 (Giroux and Hannah 1994). The maize leaf AGP small









14

subunit is encoded by Agpszmlf (previously known as L2)

(Prioul et al. 1994).

Giroux and Hannah (1994) suggested that maize endosperm

AGP is not localized to plastids since the Bt2 cDNA does not

encode a transit peptide. Denyer et al. (1996) later showed

that at least 95% of maize endosperm AGP activity is

localized to the cytoplasm.


General Structure

AGP in bacteria is a homotetramer, having four

identical subunits encoded by the GlgC gene. Conversely,

AGP in higher plants is a heterotetramer, having two pairs

of unlike subunits (Hannah and Nelson 1976, Copeland and

Preiss 1981, Morell et al. 1987). In maize endosperm, AGP

has a molecular mass of 210kDa, with small and large

subunits of 51kDa and 54kDa, respectively (Giroux and Hannah

1994). Sh2 encodes the large subunit and Bt2 encodes the

small subunit (Hannah and Nelson 1976, Bae et al. 1990,

Bhave et al. 1990). These two genes likely arose from a

common progenitor, and have diverged until they are

complementary rather than duplicate genes (Bhave et al.

1990).

AGP small subunits. The AGP small subunit is highly

conserved in amino acid structure among maize endosperm,









15

spinach leaf, and potato tuber AGP's. Thorbjornsen et al.

(1996) have shown that the small subunits of barley leaf and

endosperm AGP are encoded by a single gene and differ only

in their first exon. Thorbjornsen et al. (1996)

hypothesized that alternative splicing would account for the

different first exons, or the gene could have separate

promoters for the two transcripts. In contrast, maize has

two separate genes for these transcripts, termed Bt2 for the

endosperm and Agpszmlf for the leaf. They differ primarily

in their first exon, and most likely are duplicate genes

(Janine Shaw, personal communication).

AGP large subunits. In contrast to the small subunit,

the sequence of the AGP large subunit varies greatly among

source tissues (Smith-White and Preiss 1992). Giroux et al.

(1996) showed that the large subunit C-terminus is important

for wild-type activity levels and allostery in particular in

a study of Ds insertion/excision in Sh2. The Rev6 mutant, a

Tyr-Ser insertion caused by imperfect Ds excision near the

SH2 C-terminus, conditions an 11-18% increase in seed weight

and insensitivity to Pi (30 mM Pi inhibits Rev6 AGP 7%

versus 70% in the wild-type) (Giroux et al. 1996).

Proteolysis. Plaxton and Preiss (1987) suggested that

BT2 undergoes post-translational modification by

proteolysis, and that this affected the allosteric









16

properties of AGP. However, Hannah et al. (1995) later

showed that proteolysis of both subunits of maize endosperm

AGP occurs over time with no effect on activity or 3PGA

activation. Similar results were obtained with the large

subunit of barley endosperm AGP, which underwent proteolysis

from 60 to 51 kD without affecting specific activity

(Kleczkowski et al. 1993a).


Subunit Interaction

The yeast two-hybrid system has been used to show that

SH2 and BT2 do not form homodimers but interact with each

other (Greene and Hannah 1998b). Stability of BT2 and SH2

is dependent upon subunit interaction (Greene and Hannah

1998b). Turnover of both subunits in the endosperm is more

rapid in the absence of the other protein (Giroux et al.

1994). This was also demonstrated in Arabidopsis by Wang et

al. (1998). Sequences involved in enzyme assembly have been

found throughout both subunits (Greene and Hannah 1998b).

Homotetramers in potato tuber. In contrast to maize

endosperm AGP, the potato tuber small subunit may form a

homotetramer with very low activity (70 fold lower than that

of the heterotetramer) (Iglesias et al. 1993). High

concentrations (4 mM) of 3PGA increase homotetramer activity









17

to one-third the level of the heterotetramer (Ballicora et

al. 1995).

Heat stability in maize endosperm AGP. Ninety-six

percent of AGP in maize endosperm is heat-labile (Hannah et

al. 1980), a trait which may have been selected for during

cereal evolution (Greene and Hannah 1998c) to funnel

resources to the embryo during periods of heat stress.

Studies of maize yield have shown that increasing

temperature from 22 C to 36 C during kernel development is

accompanied by a decrease in seed weight (Singletary et al.

1994). Greene and Hannah (1998c) isolated a mutation in

maize endosperm AGP, Sh2-hs33, which is more stable than the

wild-type at elevated temperatures and has higher activity

before heat-treatment. Increased heat-stability in this

mutant was conditioned by a single His to Tyr change at

amino acid position 333 in the large subunit (Table I), a

change found repeatedly in mutagenesis experiments for heat-

stability (Greene and Hannah 1998c).









18

Up-Regl: An Allosteric Mutant of AGP




Up-Regl in S. tuberosum


Greene et al. (1996a) used hydroxylamine to mutagenize

the large subunit of potato tuber AGP expressed in -glgC E.

coli lacking endogenous glycogen production and selected

mutants deficient in glycogen synthesis. Among these, they

discovered a point mutation (P52L) that decreased AGP's

affinity for 3PGA 45 fold (Greene et al. 1996a).

Greene et al. (1998) then used the hydroxylamine

procedure to isolate second-site revertants that restored

glycogen synthesis. Among several mutants, E38K conditioned

the greatest increase in glycogen synthesis. Greene et al.

(1998) placed this revertant (Up-regl, or UR1) into the wild

type potato large subunit, and expressed it with the potato

small subunit in glgC- E. coli lacking endogenous glycogen

production. UR1 in a wild type background stained

significantly darker than the wild-type when exposed to

iodine vapors (Greene et al. 1998). The mutant enzyme was

then partially purified by ammonium sulfate precipitation,

heat treatment, C3 chromatography, and DEAE anion-exchange

chromatography (Greene et al. 1998), and its kinetic

properties were assayed. UR1 had 80 fold higher affinity









19

for 3PGA than did the wild type enzyme and was 67 fold less

sensitive to Pi inhibition. The K for substrates was

unaffected (Greene et al. 1998). Also, an E38R mutant gave

different activation properties from both wild-type and UR1,

indicating that activation is dependent upon R-group charge

and size (Greene et al. 1998).



Proposal


Based on the results obtained in potato with UR1 and on

the high degree of conservation between AGP's of various

plant species including potato and maize, UR1 could have a

similar effect in maize endosperm AGP. Increasing AGP's

sensitivity to 3PGA and decreasing its affinity for Pi would

be significant for the ongoing efforts to improve the

quality and yield of starchy maize.

Accordingly, site-directed mutagenesis was used to

mutate the Sh2 cDNA at position 93, analogous to E38 in the

potato large subunit, from a Thr to a Lys (T93K). The

mutated plasmid (Sh2-UR1) was coexpressed with Bt2 in glgC-

E. coli lacking endogenous glycogen production and exposed

to iodine vapors to measure glycogen production

qualitatively. The mutant was then partially purified and









20

its kinetics were characterized, with particular attention

to changes in allostery.

Based on the results of these experiments, Sh2-UR1 in

maize endosperm AGP conditions a 27% increase in maximal

activation by 3PGA and no apparent change in A0s or Pi

inhibition.














CHAPTER 2
MATERIALS AND METHODS







Mutant Generation and Screening




Site-directed Mutagenesis

The Clontech Transformer site-directed mutagenesis kit

(catalog number K1600-1) was used to change threonine 93 in

the Sh2 cDNA to lysine in order to generate the Sh2-UR1

mutant. 2.0 ul Annealing buffer (0.2 M Tris-HCL [pH 7.5],

0.1 M MgCI2, 0.5 M NaCI), 2.0 ul Sh2 plasmid DNA (Monsanto

vector pMON17336 bearing the Sh2 cDNA [Giroux et al., 1996],

50 ng/ul), 2.0 ul selection primer (removes a unique SstI

site to allow for selection of the mutant plasmid by

restriction digestion to linearize parental DNA, sequence

pGGGTCTGTCATATAGTGAGCACGGTACCCGGGG, obtained from GibcoBRL,

50 ng/ul), 2.0 ul mutagenic primer (introduces the mutation

by a two-base pair change in the primer, sequence

pGGGCGGAGGCAAGGGATCTCAGCTCTTTCC, obtained from GibcoBRL, 50

ng/ul), and 12.0 ul dH20 were added to a 0.5 ml









22

microcentrifuge tube. The mixture was centrifuged briefly,

boiled 3 minutes, chilled on ice immediately for five

minutes, then centrifuged briefly again.

The mutant strand was then synthesized by adding 3.0 ul

10X synthesis buffer (A, T, C, and G nucleotide mixture in

10mM Tris-HCl, pH 8.0), 1.0 ul T4 DNA polymerase (2-4 U/pl),

1.0 pl T4 DNA ligase (4-6 U/pl), and 5.0 pl dH20O to the

above reaction. The reaction was mixed and centrifuged

briefly, then incubated two hours at 37 C. The mixture was

incubated five minutes at 70 C to stop the reaction, then

cooled to room temperature.

The newly-mutated plasmid was then digested with SstI

to linearize parental DNA by adding 3.0 ul SstI restriction

endonuclease (10U/ul, GibcoBRL catalog number 15222-011) to

the above reaction. The mixture was incubated at 37 C for

two hours. The mutant plasmid was separated from parental

DNA on a 0.8% agarose minigel. The bands representing non-

linearized plasmid DNA were eluted from the gel. To

ethanol-precipitate the plasmid DNA, 1/10 volume 3.0 M

sodium acetate was added to a microcentrifuge tube

containing the eluted plasmid DNA, and the mixture was

vortexed. Then two volumes 100% ice-cold ethanol was added,

and the mixture was vortexed again and frozen for 30 minutes

at -80 C. The plasmid was thawed for five minutes at 37 C,









23

centrifuged five minutes at 12,000 rpm in an Eppendorf

microcentrifuge (catalog number 05-400-10), and the

supernatant was discarded. Ethanol (400 ul 70%) was added

to the tube, mixed by inversion, and centrifuged five

minutes at 12,000 rpm in an Eppendorf 5415-C

microcentrifuge. The supernatant was discarded, and the DNA

pellet was resuspended in 5 ul TE buffer (10mM Tris-HCl, 1mM

EDTA, pH 8.0).

To amplify the Sh2-UR1 plasmid (Monsanto vector

pMON17336 bearing the Sh2 cDNA with the T93K mutation), mutS

E. coli (deficient in DNA repair to prevent reversion of the

mutant plasmid, provided in Transformer site-directed

mutagenesis kit) was transformed with the Sh2-UR1 plasmid by

adding 40 ul electrocompetent mutS E. coli cells (Clontech,

catalog number C-2020-1) and 5 ul (about 100 ng) Sh2-UR1

plasmid DNA to an electroporation cuvette. The mixture was

shaken to the bottom of the cuvette, inserted into a Bio-Rad

E. coli Pulser electroporator (catalog number 165-2101) and

electroporated at 2.5 V. The transformed cells were then

used to inoculate 800 ul liquid Luria broth medium (10 g

tryptone, 5 g yeast extract, 5 g NaCl per liter) in a 14 ml

Falcon tube (Fisher Scientific, catalog number 35-2059).

The cells were incubated one hour in a 37C shaker at 220

rpm. This culture was then used to inoculate 4 ml Luria









24

broth containing 100 ug/ml spectinomycin and cultured

overnight in a 37C shaker at 220 rpm.

The Sh2-UR1 plasmid was isolated from the mutS E. coli

using a 5Prime-3Prime PerfectPrep plasmid DNA miniprep kit

(catalog number 1-323085). The isolated plasmid DNA was

then digested with SstI again to linearize remaining

parental DNA. 5.0 ul Sh2-UR1 plasmid DNA (about 100 ng),

2.0 ul 10X restriction enzyme buffer #2 (GibcoBRL, catalog

number 16302-010), 2.0 ul SstI restriction endonuclease (10

U/ul), and 11.0 ul dH20O were added to a 0.5 ml

microcentrifuge tube. The reaction was incubated three

hours at 37 C, with 1.0 ul fresh SstI (10U/ul) added after

the second hour. The digested Sh2-UR1 plasmid DNA was then

ethanol-precipitated (as above) to stop the reaction and to

remove salts for electroporation.

AC70R1-504 E. coli cells (a mutant glgC strain lacking

endogenous ADPglucose pyrophosphorylase activity) expressing

the pMON17335 vector containing wild-type (WT) Bt2 were

transformed with the pMON17336 vector containing Sh2-URl.

Electrocompetent AC70R1-504 cells (40 ul, O.D.=0.6) and 5 ul

Sh2-UR1 plasmid (20 ng/ul) were added to an electroporation

cuvette, and the cuvette was subjected to 2.5 V current in a

Bio-Rad E. coli Pulser electroporator (Bio-Rad, catalog

number 165-2101). The transformed cells were then used to









25

inoculate 800 ul liquid Luria broth medium in a 14 ml Falcon

tube. The cells were incubated one hour in a 37 C shaker at

220 rpm. 100 ul of this culture was plated out on selective

solid Luria broth containing spectinomycin (100 ug/ml) and

kanamycin (75 ug/ml). The cells were cultured overnight at

37 C, and individual colonies were selected for analysis.


Glycogen Staining

Single isolated colonies of AC70R1-504 E. coli

expressing pMON17335 and pMON17336 plasmids containing Bt2

and Sh2-UR1 cDNA's, respectively, were plated out on solid

Luria broth containing glucose (0.1%), spectinomycin (100

ug/ml), and kanamycin (75 ug/ml), concurrently with cells

expressing wild-type maize endosperm AGP. The cells were

cultured overnight at 37 C, then stored at 4 C for one hour.

Speed and intensity of glycogen staining after exposure to

iodine vapors for 60 seconds were monitored and compared.


Sequencing to verify point mutations

The vector pMON17336 containing Sh2 cDNA that had

undergone site-specific mutagenesis to introduce the T93K

mutation was isolated from AC70R1-504 E. coli using the

5Prime-3Prime Perfectprep plasmid miniprep kit. The

isolated plasmid DNA was then sent to the University of

Florida/Interdisciplinary Center for Biotechnology Research









26

sequencing core at the University of Florida. Both strands

of the gene were sequenced to verify the presence of the

mutation.








Purification of AGP




Culture and Induction of AGP

Cells from a glycerol stock (stored at -80 C) of

AC70R1-504 E.coli expressing the pMON17335 plasmid

containing Bt2 and pMON17336 containing either WT Sh2 or

Sh2-UR1 were plated on solid Luria broth containing

spectinomycin (100 ug/ml) and kanamycin (75 ug/ml) and

cultured overnight at 37 C. A single colony was selected to

inoculate 20 ml liquid Luria broth containing spectinomycin

(100 ug/ml) and kanamycin (75 ug/ml), then the culture was

grown overnight in a 37 C shaker at 250 rpm. 10 ml of this

culture was used to inoculate 1000 ml liquid Luria broth

containing spectinomycin (100 ug/ml) and kanamycin (75

ug/ml). The one-liter culture was divided into two-500 ml

cultures in 2 1 flasks and grown in a 37 C shaker at 250 rpm

to an optical density of 0.5 0.6. Synthesis of AGP was









27

induced for eight hours by the addition of 0.2 mM isopropyl

beta-D-thiogalactoside (25.4 mg/500 ml) and 25 ug/ml

nalidixic acid (12.5 mg/500 ml) to the cell cultures, and

incubation at 24 C. The cells were then harvested by

centrifugation (five minutes at 2300 x g) in 500 ml

centrifugation tubes and stored at -80 C for protein

extraction.


Extraction of Protein from Cells

Frozen pellets of AC70R1-504 E.coli expressing the

pMON17335 plasmid containing Bt2 along with pMON17336

containing either WT Sh2 or Sh2-UR1 were resuspended in 5 ml

(total) of sucrose buffer (50 mM HEPES, 10 mM KPi, 5 mM

MgCI2, 5 mM EDTA, 20% sucrose, and 30% ammonium sulfate;

dithiothreitol (DTT, 1 mM), 50 ug/ml lysozyme, 1 ug/ml

pepstatin, 1 ug/ml leupeptin, 1 ug/ml phenylmethylsulfonyl

fluoride, 10 ug/ml chymostatin, 1 ug/ml antipain, and 1

ug/ml benzamidine were added just before use). The cell

suspension was combined in one 14 ml Falcon tube and then

centrifuged five minutes at 3600 x g to re-pellet the cells

for sonication. The re-pelleted cells were sonicated in

three ten-second bursts by a Branson Sonifier 450 at setting

3.5. Lysed cells were cooled on a slurry of ice for at

least one minute between bursts to prevent protein

denaturation. The lysed cells were centrifuged 10 minutes









28

at 22,000 x g and 0 C to clarify the crude extract, and the

supernatant was placed on ice. The cell pellet was

resuspended in 2 ml sucrose buffer, and the sonication-

centrifugation procedure was repeated as above. The

supernatants were then combined for purification.


Separation by Hydrophobicity

Crude extract was immediately purified by a Pharmacia

FPLC superose 10 mm x 10 cm hydrophobic column (catalog

number 17-0530-01) using a step gradient of 1.0 M, 0.6 M,

0.3 M, and 0.0 M ammonium sulfate created by changing the

ratio of buffer A (50 mM HEPES pH 7.5, 0.1 mM EDTA, 5 mM

MgC2, 20% sucrose, and 1.0 M ammonium sulfate) to buffer B

(50 mM HEPES pH 7.5, 0.1 mM EDTA, 5 mM MgC2, and 20%

sucrose). All solutions were filtered at 0.45 pm before use

with columns, and fresh DTT was added to 1 mM before use.

The pumps were primed with buffer A, and the column was

equilibrated with the same buffer. The sample (8 ml) was

filtered through a 0.45 um Acrodisc filter (Gelman Sciences,

catalog number 4184), then loaded onto the hydrophobic

column by use of a superloop. Fractions were collected in

50 ml Oakridge tubes (Fisher Scientific, catalog number 05-

529C) at 1.0 M (18 ml), 0.6 M (11 ml), 0.3 M (7 ml) and 0.0

M (3 ml) ammonium sulfate. A pyrophosphorylysis assay

(described in the next section) was immediately performed to









29

determine which fraction contained the greatest activity per

ml of AGP, and that fraction was concentrated to 2 ml in an

Amicon Centriplus concentrator (catalog number 4412). The

partially purified enzyme was quickly separated into 50 ul

aliquots and immediately frozen at -80 C. Bradford assays

(described below) were used to determine protein

concentrations at each step of extraction and purification.


Bradford Assay to Measure Protein Concentration

Enzyme samples were diluted 5, 10, or 20 fold with 0.15

M NaCl to a final volume of 20 ul, then added to a 0.5 ml

microcentrifuge tube. 20 ul samples of 25, 50, 75, or 100

ug/ml Bovine Serum Albumin (BSA) in 0.15 M NaCl, and a blank

with 20 ul 0.15 M NaCl were used as standards. 180 ul

Coomassie blue (5 mg Coomassie brilliant blue G-250 [Kodak,

catalog number 14360], 2.5 ml 95% ethanol, 5 ml 85%

phosphoric acid, bring to 50 ml with dH20) was then added to

each microcentrifuge tube. The mixture was vortexed and

stored two minutes at 24 C. The As.s of each sample was

measured using a Beckman DU-68 spectrophotometer.













Assays of Enzyme Activity



Pyrophosphorolysis Assay

The pyrophosphorolysis reaction mixture (0.08 M Glycyl-

glycyl, 5 mM DTT, 5 mM MgCl2, 10 mM NaF, 1 mM ADPglucose, 10

mM 3PGA, 0.4 mg/ml BSA, and 1.5 mM NaPPi) was added to a 1.5

ml Eppendorf microcentrifuge tube (Fisher Scientific,

catalog number 05-406-15). Then an amount of Na32PPi (4.4

Ci/mmol, 4.9 mCi/ml) needed to give 5 x 106 cpm per reaction

was added. The reaction mixture was then aliquotted

(approximately 85 ul) to individual 1.5 ml Eppendorf

microcentrifuge tubes, and dH2O was added to a final volume

of 245 ul (usually 150-160 ul per reaction). 5 ul enzyme

diluted five-fold with dH20 was added to each tube, and the

reaction was mixed by tapping gently with a finger. The

reaction mixtures were then incubated for 10 minutes at 37

C, after which 1 ml 5 % TCA, 10 mM NaPPi was added to stop

the reaction. 150 ul activated 15 % charcoal solution was

added to each reaction to bind the radioactive product. The

mixture was centrifuged five seconds at 14,000 rpm in an

Eppendorf microcentrifuge to pellet the charcoal, and the

supernatant was aspirated. The charcoal was resuspend in 1

ml 5 % TCA, 10 mM NaPPi and mixed by vortexing, then finger-

vortexing. This centrifugation / aspiration / resuspension











procedure was repeated twice. 1 ml of 1.0 M HC1 was added

to each tube, mixed, and boiled five minutes to release

radioactive ATP from the charcoal. The mixture was then

centrifuged 10 seconds to clarify the supernatant. 500 ul

samples of the supernatant were collected in vials of 5 ml

ScintiSafe Plus 50% scintillation fluid (Fisher Scientific,

catalog number SX25-5), and the radioactivity measured in a

Rackbeta 1214 liquid scintillation counter. Background cpm

was determined by assaying AGP without ADPglucose

(substrate); total counts were determined by assaying AGP

with no ADPglucose and no wash step.


ADPglucose-Synthesis Assay

The reaction mixture (80 mM HEPES buffer, 2 mM glucose-

1-phosphate [GIP], 4 mM MgCI2, 0.5 mg/ml BSA, 8.6 uM alpha-

[14C]-G1P [233.9 mCi/mmol, 0.02 mCi/ml], 1.5 mM ATP, 10 mM

3PGA) was divided into 85 ul aliquots in 0.5 ml

microcentrifuge tubes. 10 ul enzyme diluted five fold (80

fold for Km determination) was added to each tube.

Reactions were incubated at 37 C for 30 minutes, boiled for

two minutes, and cooled to room temperature. Then 0.6 U (5

ul) bacterial alkaline phosphatase (Worthington, catalog

number LS004081), diluted five fold with dH20O, was added to

each reaction tube, and the reactions were incubated at 37 C

for 1+ hours or overnight to dephosphorylate remaining GIP.








32

20 ul of each reaction was then spotted onto labeled squares

of DE81 filter paper (Fisher Scientific, catalog number 05-

7171B) and washed by placing the squares in a sieve and

dunking the sieve in dH20 16 times, then discarding the dH20

and adding fresh dH20. The wash procedure was repeated three

times. Water from the first wash was discarded in 14C

waste. The DE81 filters were removed from the sieve, dried

under a heat lamp for 20 minutes, then placed in

scintillation vials with 5 ml ScintiSafe Plus 50%

scintillation fluid. Radioactivity was measured in a

Rackbeta 1214 liquid scintillation counter.






Enzyme Kinetics



The ADPglucose-synthesis assay was used to measure the

kinetic properties of partial purified WT and Sh2-UR1 AGP.

Unless noted, Pi was not added to the reactions.


Dilution Series

To determine the linearity of activity, the enzyme was

diluted with dH20 zero, five, 10, 20, and 40 fold in series

and assayed. The five fold dilution was selected for

subsequent assays.











E x T Assay

A series of reactions of Sh2-UR1 were run at 15, 30,

and 60 minutes and zero, five, and 10 fold dilution of AGP

with dHO to determine the linearity of activity at each

incubation time/dilution combination. Five fold dilution

and 30 minutes incubation was selected for subsequent

assays.


Activation by 3PGA

AGP was assayed with varying amounts of 3PGA to

determine A.s5 and maximal activation by 3PGA.

Concentrations of 3PGA used were zero, 0.5, 1.0, 1.5, 2.0,

3.0, 4.0, 10.0, and 20.0mM.


Inhibition by Pi

Likewise, Pi concentrations of zero, 1.0, 2.0, 3.0,

4.0, 5.0, 10.0, and 20.0 mM were used to determine lo.s. 10

mM 3PGA was added to each reaction.


Measurement of Km

G1P concentrations of 8.6, 18.6, 28.6, 38.6, 48.6,

58.6, 108.6, 208.6, and 408.6 uM were used for Km

determinations. 10 mM 3PGA was added to each reaction.















CHAPTER 3
RESULTS







Initial Screening and Purification





Glycogen Staining

AC70R1-504 glgC- E. coli bacteria expressing the

pMON17336 vector containing Sh2-UR1 and the pMON17335 vector

containing Bt2 were cultured on solid Luria broth medium

containing 0.1% glucose, then stained with iodine vapors and

compared to AC70R1-504 glgC- E. coli expressing wild-type

maize endosperm AGP. Differences in staining intensity were

not detected. Subsequent sequencing verified the expected

nucleotide change (CT to AG at nucleotides 364-5 of Sh2

cDNA).


Purification

Specific activity for the wild-type was 2.8 U/mg, while

that for Sh2-UR1 was 1.1 U/mg, where U = 1 pmol ADPglucose

formed/min. The wild-type had 4.2 U total activity after









35

purification and Sh2-UR1 had 1.7 U. The wild-type enzyme

was purified 16.5 fold, while the Sh2-UR1 mutant was

purified 9.4 fold. Final recovery of AGP activity as

determined by pyrophosphorolysis assay was 200% for the

wild-type and 70.8% for Sh2-UR1. Bradford assays performed

on the partially purified enzyme indicated the protein

concentration of wild-type was 1.0 mg/ml (Table 4), and that

of Sh2-UR1 was 0.62 mg/ml (Table 5).




Table 4. Purification of wild-type AGP. U = pmol ATP
formed/min. Crude = crude extract; Filtered = filtered
extract; FPLC = 0.0 M ammonium sulfate fraction from
hydrophobic column; Concentrated = concentrated hydrophobic
fraction (partially purified enzyme).
Crude Filtered FPLC Concentrated

activity (U) 2.1 1.7 0.32 4.2

yield (%) 100 81 15.2 200

protein (mg) 12.2 7.8 1.5 1.5

specific 0.17 0.22 0.21 2.8
activity
(U/mg)

purification 1 1.3 1.2 16.5
fold












Table 5. Purification
definitions.


36

of Sh2-UR1 AGP. See Table 4 for


Crude Filtered FPLC Concentrated

activity (U) 2.4 1.2 0.11 1.7

yield (%) 100 50 4.6 70.8

protein (mg) 20.4 13.6 1.5 1.5

specific 0.12 0.09 0.07 1.13
activity
(U/mg)

purification 1.0 0.75 0.58 9.4
fold


E x T Determination

Sh2-UR1 was assayed at varying enzyme dilutions and

incubation times to select a dilution/incubation combination

in the linear range of increasing activity over time, at

adequate levels of activity for measurement. (Table 6) The

five fold dilution was selected at 30 minutes incubation

time.










37

Table 6. AGP activity as E x T determination. U = 1 nmol
ADPglucose formed. *Adjusted for fold dilution and
incubation time.
Dilution
(fold) Time (min) Activity (U) E x T (U)*

5 15 2.9 11.6

5 30 4.0 8.0

5 60 5.8 5.8

10 15 1.6 12.5

10 30 2.9 11.4

10 60 5.5 11.0

20 15 0.7 10.8

20 30 1.5 11.9

20 60 1.7 6.8





Kinetic Properties





Km Determination

Wild-type and Sh2-UR1 AGP's were assayed with a series

of substrate concentrations (Figure 1). Based on a Hanes-

Woolf plot (Figure 2), the Km for wild-type was 3.9x10-5 M

and that for Sh2-UR1 was 3.7xl0-5 M in the presence of 10 mM

3PGA. The previously published Km for maize is 5x10-5 M in

the presence of 10 mM 3PGA (Dickinson and Preiss 1969).

Hill plots of the two genotypes (Figure 3) showed little or











no cooperativity for either the wild-type (n=1.2) or Sh2-UR1

(n=1.0) .


6.0

rn


I


100 200 300 400
mM G1P


Figure 1. Glucose-1-P
(diamonds) and Sh2-UR1
3PGA.


saturation of wild-type AGP
(squares) in the presence of 10 mM


L -
OE .U

' 4.0

- 3.0-
D- -
2.0-

1.0 -











140.0

120.0 -

100.0 -

80.0 -

60.0 -

40.0 -

20.0 -

0.0


100 200 300


uM G1P


Figure 2. Hanes-Woolf
Sh2-UR1 (squares) AGP.
UR1 K, was 3.7xl0-5 M.
of 10 mM 3PGA.


plot of wild-type (diamonds) versus
Wild-type Km was 3.9xl0-sM and Sh2-
Assays were performed in the presence



1.00

x + 5.6014 0.80 -
.9239 / 0.60 -
/" 0.40
0.20 -
0.00
.5 -4.0 -3.5 -0.20-2.0


log [G1P]


Figure 3. Hill plot of wild-type (diamonds) and Sh2-UR1
(squares) AGP. Wild-type n = 1.2 and Sh2-UR1 n = 1.0. Vmax
and v measured in nmol ADPglucose formed per minute.


y = 0.2683x + 10.037


y = 0.1923x+ 7.640
R2 = 0.9946












Activation by 3PGA

Sh2-UR1 and wild-type AGP were assayed at different

concentrations of 3PGA in the absence of Pi. Maximal

activation of Sh2-UR1 was 3.3 fold, while that of wild-type


was 2.5 fold.






40-
>35-


U25
(D20-


321.0
uQ05
00
0




Figure 4. 3P
activated 2.5
3.3 fold. A0.
least two ass
repetitions.


A0.s5 was 0.5 mM 3PGA for both genotypes.


4

mM 3PGA


GA activation curve. Wild-type (diamonds) was
fold, while Sh2-UR1 (squares) was activated
s=0.5 mM for both. Data are averages of at
ays on separate days, each with two













Inhibition by P04

Wild-type and Sh2-UR1 were assayed at different Pi

concentrations. 10.s was approximately 10 mM P04 for both

wild-type and Sh2-UR1 in the presence of 10 mM 3PGA.




103.0

8300






60.0-
< 40.0-





0 5 10 15 2D




Figure 5. P04 inhibition curve. Wild-type (diamonds) and
Sh2-UR1 (squares) both were inhibited 50% by 10 mM PO4 in
the presence of 10 mM 3PGA. Data are averages of at least
two repetitions in a single assay.














CHAPTER 4
DISCUSSION







Summary



Starch as a storage product for plants and as a food

source for humans has become the focus of intensified

research. AGP, a regulatory enzyme of starch biosynthesis

in higher plants, is a prime target for engineering to

improve starch production and thus crop yield. Mutation of

the genes encoding this enzyme has provided insight into the

function of various regions the AGP proteins.

Greene et al. (1996a) implicated the AGP large

subunit's highly conserved PAV sequence (Figure 6) in 3PGA

binding by mutating the Pro52 to Leu in a study of glycogen-

deficient mutants of E. coli expressing potato tuber AGP.

This mutation decreased AGP's sensitivity to 3PGA 45 fold.

Greene et al. (1998) then used hydroxylamine to generate

second-site revertants that restored glycogen synthesis.

The E38K mutation gave the greatest increase in glycogen

synthesis.









43

Greene et al. (1998) used site-directed mutagenesis to

make the E38K change in wild type potato AGP large subunit,

increasing activation by 3PGA 80 fold and decreasing

inhibition by Pi seven fold compared to the wild type. The

change in AGP's sensitivity to effectors indicated that

Glu38 is important for binding effector molecules.

The highly conservative nature of AGP suggests that

this site could be important for the allostery of AGP in

other species. Thus, site-directed mutagenesis was used to

change Thr93 in the maize large subunit (analogous to

position 38 in the large subunit of potato) to a Lys, and

the T93K mutant was characterized.

The T93K mutation had no detectable effect on the Km

for GIP compared to wild-type AGP. No change was expected,

since the original E38K mutation in potato only affected the

binding of effector molecules (Greene et al. 1998).

However, inhibition by P04 was also unaffected by the

mutation in maize, in contrast to the decrease in

sensitivity to P04 conditioned by the E38K mutation in

potato. Sensitivity to 3PGA did increase in the maize

mutant, as in potato, by 27% compared to potato AGP's 8000%

increase.









44

Comparison with E38K in S. tuberosum




The contrasting results obtained from this mutation in

potato tuber AGP and maize endosperm AGP indicate that the

importance of this position to allostery likely varies among

AGP isozymes. These differences could be due to slight

variations in tertiary structure, e. g. the residue may be

more exposed to binding 3PGA molecules in potato tuber AGP

than in maize endosperm AGP.

This residue in the large subunit is in a region of

otherwise highly conserved amino acids but is itself not

conserved (Table 7), suggesting that this position is not

crucial for activity but does have the potential to enhance

activation. An Ala is conserved throughout higher plants at

this analogous position in the small subunit, indicating

some importance for activity in the small subunit.






Other Possible Amino Acid Substitutions



Greene et al. (1998) mutated Glu38 further to study

this amino acid position. Among these mutants, E38R












decreased activation at low concentrations of 3PGA, and E38A

almost eliminated the enzyme's sensitivity to 3PGA, but E38G


Table 7. Amino acid sequence of the region surrounding the
residue analogous to Glu38 in the potato tuber large
subunit. Bold = 95% conserved in plants. Position 38 and
PAV sequence are labeled at top of figure.


Species/tissue


Sequence


38 PAV


potato tuber


tomato
tomato
potato


stem
leaf
leaf


tomato root
barley endosperm
wheat endosperm
maize embryo
maize endosperm
sorghum seed
rice endosperm
barley leaf
beet leaf
oriental melon
watermelon
sweet potato
pea cotyledon
Arabidopsis leaf
E. coli


VAAVILGGGE
VAAVILGGGE
VVAIILGGGG
VASVILGGGV
VASVILGGGV
VAAVILGGGT
VAAVILGGGT
VAAVILGGGT
VSAIILGGGT
VSAIILGGGT
VSAVILGGGT
VVAVILGGGA
VAAIVLGGGA
VASIILGGGA
VASIILGGGA
VAAIILPGGA
VISIVLGGGP
VAAIILGGGD
SVALILAGGR


GTKLFPLTSR TATPAVPVGG
GTKLFPLTSR TATPAVPVGG
GTRLFPLTKR RAKPAVPIGG
GTRLFPLTSR RAKPAVPIGG
GTRLFPLTSR RAKPAVPIGG
GTQLFPLTST RATPAVPIGG
GTQLFPLTST RATPAVPIGG
GTQLFPLTST RATPAVPIGG
GSQLFPLTST RATPAVPVGG
GSQLFPLTST RATPAVPVGG
GVQLFPLTST RATPAVPVGG
GTRLFPLTKR RAKPAVPIGG
GTRLFPLTSR RAKPAVPIGG
GTHLFPLTKR SATPAVPAGG
GTHLFPLTRR SATPAVPVGG
GTHLFPLTNR AATPAVPLGG
GTHLYPLTKR AATPAVPVGG
GAKLFPLTKR AATPAVPVGG
GTRLKDLTNK RAKPAVHFGG


produced effects similar to those of E38K (the UR1

mutation). Based on these observations, the researchers

concluded that both charge and the size of the R-group at

this position are important to 3PGA binding. The loss of

activation caused by the change to Ala is further evidence

of variations in enzyme conformation. Ala is found at this

relative position in the large subunit of various AGP's,









46

some of which are highly activatable (Table 8). Thus, it

may also follow that a different amino acid at this position

in maize endosperm AGP would have a more positive effect on

3PGA binding than did lysine.



Table 8. Sensitivity to 3PGA of AGP from various species
and tissues, and large subunit residue analogous to position
38 in potato tuber AGP. **, no detectable activity in the
absence of 3PGA; n/a, no analogous amino acid.
Species/organ Amino acid Activation by 3PGA

Tomato fruit E **

Spinach leaf A 58x
chloroplast

Potato tuber E 43x

Hoya sp. A 27x

A. thaliana A 24x

Barley leaf A 13x

Maize endosperm T 4x

Barley endosperm T 1/4x

Wheat endosperm T none



Since size and charge of the residue in potato tuber

AGP both play a part in sensitivity to 3PGA, amino acids

with different characteristics should be placed in this site

in the maize endosperm enzyme to verify the site's

importance to 3PGA binding. Particularly, mutants should

alter the charge, polarity, and/or size of the residue. The

Thr normally located at this position in maize endosperm AGP









47

and in all cereal endosperm AGP's has a small, polar R-

group. Alternative mutations should include Glu, the

original residue in the potato large subunit, which has a

large acidic R-group. Ala, which has a small nonpolar R-

group, is commonly found in species outside the grass family

(Table 7), and would yield a change in R-group polarity from

Thr. Tyr is another possible substitution, bearing a large

polar R-group, and Trp would represent a mutant with a large

nonpolar R-group. One of these amino acids may prove to be

a superior candidate for improving 3PGA binding.

The mutation of Thr93 in maize endosperm AGP represents

translation of discoveries in one species to knowledge about

another by the use of site-directed mutagenesis. Thus, the

genetics of starch biosynthesis benefits from the broad base

of species studied, and as important amino acids are

identified in model species, those analogous positions can

be mutated and studied in other species. In an

agronomically important crop such as maize, this translation

of information leads to further improvement of starch

production for the world's food supply.














REFERENCES


Anderson, J. M., Hnilo, J., Larson, R., Okita, T. W.,
Morell, M. & Preiss, J. (1989). Journal of Biological
Chemistry 264(21), 12238-12242.

Bae, J. M. & Liu, J. R. (1997). Molecular and General
Genetics 254(2), 179-85.

Ballicora, M., Fu, Y., Nesbitt, N. M. & Preiss, J. (1998).
Plant Physiology 118(1), 265-74.

Ballicora, M., Laughlin, M., Fu, Y., Okita, T., Barry, G. &
Preiss, J. (1995). Plant Physiology 109(245-251).

Barbosa, H. M. & Glover, D. V. (1978). Brazilian Journal of
Genetics 1, 29-39.

Bhave, M. R., Lawrence, S., Barton, C. & Hannah, L. C.
(1990). Plant Cell 2(6), 581-8.

Chen, B. Y. & Janes, H. W. (1997). Plant Physiology 113(1),
235-41.

Copeland, L. & Preiss, J. (1981). Plant Physiology 68, 996-
1001.

Denyer, K., Dunlap, F., Thorbjornsen, T., Keeling, P. &
Smith, A. M. (1996). Plant Physiology 112(2), 779-85.

Dickinson, D. B. & Preiss, J. (1969). Archives of
Biochemistry and Biophysics 130(1), 119-28.

Espada, J. (1962). Journal of Biological Chemistry 237,
3577.

Fu, Y., Ballicora, M. A., Leykam, J. F. & Preiss, J. (1998).
Journal of Biological Chemistry 273(39), 25045-52.

48













Fuchs, R. L. (1977). Ph. D, Texas A & M University.

Ghosh, H. P. & Preiss, J. (1966). Journal of Biological
Chemistry 241(19), 4491-504.

Giroux, M. J., Boyer, C., Feix, G. & Hannah, L. C. (1994).
Plant Physiology 106, 713-722.

Giroux, M. J. & Hannah, L. C. (1994). Molecular and General
Genetics 243(4), 400-8.

Giroux, M. J., Shaw, J., Barry, G., Cobb, B. G., Greene, T.,
Okita, T. & Hannah, L. C. (1996). Proceedings of the
National Academy of Sciences USA 93(12), 5824-9.

Greene, T. W., Chantler, S. E., Kahn, M. L., Barry, G. F.,
Preiss, J. & Okita, T. W. (1996a). Proceedings of the
National Academy of Sciences USA 93, 1509-1513.

Greene, T. W. & Hannah, L. C. (1998a). Physiologia Plantarum
103, 574-580.

Greene, T. W. & Hannah, L. C. (1998b). Proceedings of the
National Academy of Sciences USA 95(22), 13342-7.

Greene, T. W. & Hannah, L. C. (1998c). Plant Cell 10(8),
1295-306.

Greene, T. W., Kavakli, I. H., Kahn, M. L. & Okita, T. W.
(1998). Proceedings of the National Academy of Sciences
USA 95, 10322-10327.

Greene, T. W., Woodbury, R. L. & Okita, T. W. (1996b). Plant
Physiology 112(3), 1315-20.

Hannah, L. C. (1997). In Cellular and Molecular Biology of
Plant Seed Development (B.A.Larkins & I.K.Vasil, eds.),
Vol. 4, pp. 375-405. Kluwer, Dordrecht, The
Netherlands.

Hannah, L. C., Baier, J., Caren, J. & Giroux, M. (1995). In
Sucrose Metabolism, Biochemistry, Physiology, and
Molecular Biology (Pontis, H. D., Salerno, G. L. &
Echeverria, E., eds.), pp. 72-79. American Society of
Plant Physiologists, Rockville, MD.










50

Hannah, L. C. & Greene, T. W. (1998). Journal of Plant
Physiology 152, 649-652.

Hannah, L. C. & Nelson, 0. E., Jr. (1976). Biochemical
Genetics 14(7-8), 547-60.

Hannah, L. C. & Oliver E. Nelson, J. (1975). Plant
Physiology 55, 297-302.

Hannah, L. C., Tuschall, D. M. & Mans, R. J. (1980).
Genetics 95, 961-970.

Haugen, T. H., Ishaque, A. & Preiss, J. (1976). Journal of
Biological Chemistry 251, 7880-7885.

Hylton, C. & Smith, A. M. (1992). Plant Physiology 99, 1626-
1634.

Keller, G. L., Nikolau, B. J., Ulrich, T. H. & Wurtele, E.
S. (1988). Plant Physiology 86, 451-456.

Kleczkowski, L. A. (1999). Federation of European
Biochemical Societies 448, 153-156.

Kleczkowski, L. A., Villand, P., Luthi, E., Olsen, 0. A. &
Preiss, J. (1993). Plant Physiology 101(1), 179-86.

Krishnan, H. B., Reeves, C. D. & Okita, T. W. (1986). Plant
Physiology 81, 642-645.

Li, L. & Preiss, J. (1992). Carbohydrate Research 227, 227-
239.

Lin, T. P., Caspar, T., Somerville, C. & Preiss, J. (1998).
Plant Physiology 88, 1175-81.

Mains, E. B. (1949). Journal of Heredity 40, 21.

Morell, M. K., Bloom, M., Knowles, V. & Preiss, J. (1987).
Plant Physiology 85, 182-187.

Muller-Rober, B. T., Kossmann, J., Hannah, L. C.,
Willmitzer, L. & Sonnewald, U. (1990). Molecular and
General Genetics 224(1), 136-46.












Preiss, J., Ball, K., Hutney, J., Smith-White, B., Li, L. &
Okita, T. W. (1991a) Pure and Applied Chemistry 63(4),
535-544.

Preiss, J., Ball, K., Smith-White, B., Iglesias, A.,
Kakefuda, G. & Li, L. (1991b).Biochemical Society
Transcripts 19(3), 539-47.

Preiss, J., Bloom, M., Morell, M., Knowles, V., Plaxton, W.,
Okita, T., Larsen, R., Harmon, A. & Putnam-Evans, C.
(1987). In Tailoring Genes for Crop Improvement. An
Agricultural Perspective (Bruening, G., Harada, J.,
Kosuge, T. & Hollaender, A., eds.), pp. 133-152. Plenum
Press, New York.

Preiss, J., Danner, S., Summers, P., Morell, M., Barton, C.,
Yang, L. & Nieder, M. (1990). Plant Physiology 92, 881-
885.

Preiss, J., Shen, J., Greenberg, E. & Gentner, N. (1966b).
Biochemistry 5, 1833-1845.

Preiss, J., Sheng, J., Fu, Y. & Ballicora, M. (1995). In
Photosynthesis: from light to biosphere (Mathis, P.,
ed.), Vol. 5, pp. 47-52. Kluwer, Dordrecht, The
Netherlands.

Prioul, J. L., Jeannette, E., Reyss, A., Gregory, N.,
Giroux, M., Hannah, L. C. & Causse, M. (1994).
Aug;105(4) :1465 and 1994 Sep;106(1) :405]. Plant
Physiology 104(1), 179-87.

Recondo, E. & Leloir, L. F. (1961). Biochemical and
Biophysical Research Community 6, 85.

Singh, B. K., Greenberg, E. & Preiss, J. (1984). Plant
Physiology 74, 711-716.

Singletary, G., Banisadr, R. & Keeling, P. (1994).
Australian Journal of Plant Physiology 21, 829-841.

Smith-White, B. J. & Preiss, J. (1992). Journal of Molecular
Evolution 34(5), 449-64.

Sowokinos, J. R. & Preiss, J. (1982). Plant Physiology 69,
1459-1466.












Stark, D. M., Timmerman, K. P., Barry, G. F., Preiss, J. &
Kishore, G. M. (1992). Science 258, 287-291.

Tsai, C. Y., Larkins, B. A. & Glover, D. V. (1978).
Biochemical Genetics 16, 883-896.

Tsai, C. Y. & Nelson, 0. E. (1966). Science 151(708), 341-3.

Tuschall, D. M. & Hannah, L. C. (1982). Genetics 100, 105-
111.

Wang, S. M., Chu, B., Lue, W. L., Yu, T. S., Eimert, K. &
Chen, J. (1997). Plant Journal 11(5), 1121-6.

Wang, S. M., Lue, W. L., Yu, T. S., Long, J. H., Wang, C.
N., Eimert, K. & Chen, J. (1998). Plant Journal 13(1),
63-70.
















BIOGRAPHICAL SKETCH


Joel Caren was born in Gainesville, Florida, on July 31,

1973, and has lived in the Gainesville area all his life.

He graduated from Bradford High School as Valedictorian in

1991; then he attended Santa Fe Community College from 1991

to 1993, where he graduated with honors.

Joel attended Stetson University in DeLand, Florida, for

one year, then returned to Gainesville to attend the

University of Florida, from which he received the degree of

Bachelor of Science with high honors in botany in 1996. He

was accepted into the graduate school of the University of

Florida in the plant molecular and cellular biology program

that same year. In the spring of 2000, he was conferred the

degree of Master of Science.




University of Florida Home Page
© 2004 - 2010 University of Florida George A. Smathers Libraries.
All rights reserved.

Acceptable Use, Copyright, and Disclaimer Statement
Last updated October 10, 2010 - - mvs