• TABLE OF CONTENTS
HIDE
 Title Page
 Acknowledgement
 Table of Contents
 List of Figures
 List of Tables
 Abstract
 Literature review
 General methods
 Circulating growth hormone levels...
 Leptin treatment increases growth...
 Leptin resistance is associated...
 Leptin’s effects on food intake...
 General discussion
 References
 Biographical sketch














Title: Leptin resistance reduces growth hormone secretion and contributes to the pathogenesis of obesity /
CITATION PDF VIEWER THUMBNAILS PAGE IMAGE ZOOMABLE
Full Citation
STANDARD VIEW MARC VIEW
Permanent Link: http://ufdc.ufl.edu/UF00100677/00001
 Material Information
Title: Leptin resistance reduces growth hormone secretion and contributes to the pathogenesis of obesity /
Physical Description: xiii, 167 leaves : ill. ; 29 cm.
Language: English
Creator: Martin, Robin Leigh, 1968-
Publication Date: 2000
Copyright Date: 2000
 Subjects
Subject: Pharmacodynamics thesis, Ph. D   ( lcsh )
Dissertations, Academic -- Pharmacodynamics -- UF   ( lcsh )
Genre: bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )
 Notes
Summary: ABSTRACT: Leptin is secreted by adipocytes in amounts indicative of body fat content. Variations in leptin levels contribute to hypothalamic regulation of feeding and metabolism to maintain body weight homeostasis. Importantly, if there is increasing leptin with increasing body fat and the hypothalamus cannot detect or respond to it, such as is seen in leptin resistance, obesity may develop. Growth hormone (GH) is secreted by the anterior pituitary and directly influences body composition through lipolysis. GH also stimulates the secretion of insulin-like growth factor I (IGF-1), which mediates some of the actions of GH. The hypotheses of this dissertation are (1) under normal circumstances, leptin stimulates GH, and (2) in the leptin resistance situation described above, leptin fails to stimulate GH. In obesity, GH is severely attenuated, and leptin resistance may be the mechanism by which this occurs. To test the first hypothesis, rats were given diets with varying fat contents and GH was measured. The diet with the highest fat content did not cause obesity; there were elevated levels of leptin but not enough to produce resistance. These animals had an enhanced GH-IGF-1-axis. In a second study, leptin treatment resulted in elevated GH secretion from a GH-secreting cell line (GH1), further strengthening the hypothesis. To test the second hypothesis, rats were given normal rat chow and implanted with osmotic minipumps for the continuous infusion of two doses of leptin or vehicle. The leptin-treated animals developed resistance, as measured by loss of effect on food intake but not on various metabolic measures, including glucose, triglycerides, and insulin. IGF-1 was attenuated in the high-dose leptin group. Leptin receptors were reduced in this study. A final study utilized both the diets of varying fat content and the leptin-filled osmotic minipumps. Leptin was shown to lose its effectiveness in animals fed the high-fat diet and IGF-1 was attenuated. The rats were fed the diets for a longer period than in the first diet study, allowing time for the development of leptin resistance. IGF-1 was also attenuated in animals infused with leptin. The results of these two studies agree with the second hypothesis.
Summary: KEYWORDS: leptin, obesity, leptin resistance, growth hormone, IGF-1
Thesis: Thesis (Ph. D.)--University of Florida, 2000.
Bibliography: Includes bibliographical references (leaves 134-165).
Additional Physical Form: Also available on the World Wide Web; PDF reader required.
Statement of Responsibility: by Robin Leigh Martin.
General Note: Printout.
General Note: Vita.
 Record Information
Bibliographic ID: UF00100677
Volume ID: VID00001
Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
Resource Identifier: oclc - 51638780
alephbibnum - 002566160
notis - AMT2441

Downloads

This item has the following downloads:

master ( PDF )


Table of Contents
    Title Page
        Page i
        Page ii
    Acknowledgement
        Page iii
        Page iv
    Table of Contents
        Page v
        Page vi
        Page vii
        Page viii
    List of Figures
        Page ix
        Page x
    List of Tables
        Page xi
    Abstract
        Page xii
        Page xiii
    Literature review
        Page 1
        Page 2
        Page 3
        Page 4
        Page 5
        Page 6
        Page 7
        Page 8
        Page 9
        Page 10
        Page 11
        Page 12
        Page 13
        Page 14
        Page 15
        Page 16
        Page 17
        Page 18
        Page 19
        Page 20
        Page 21
        Page 22
        Page 23
        Page 24
        Page 25
        Page 26
        Page 27
        Page 28
        Page 29
        Page 30
        Page 31
        Page 32
        Page 33
        Page 34
        Page 35
        Page 36
        Page 37
        Page 38
        Page 39
        Page 40
        Page 41
        Page 42
    General methods
        Page 43
        Page 44
        Page 45
        Page 46
        Page 47
        Page 48
        Page 49
        Page 50
        Page 51
        Page 52
        Page 53
        Page 54
        Page 55
        Page 56
        Page 57
        Page 58
        Page 59
        Page 60
        Page 61
    Circulating growth hormone levels are elevated in rats fed a high-fat diet
        Page 62
        Page 63
        Page 64
        Page 65
        Page 66
        Page 67
        Page 68
        Page 69
        Page 70
        Page 71
        Page 72
        Page 73
        Page 74
        Page 75
        Page 76
    Leptin treatment increases growth hormone secretion in cultured GH1 cells
        Page 77
        Page 78
        Page 79
        Page 80
        Page 81
        Page 82
        Page 83
        Page 84
        Page 85
        Page 86
        Page 87
    Leptin resistance is associated with hypothalamic receptor mRNA and protein downregulation
        Page 88
        Page 89
        Page 90
        Page 91
        Page 92
        Page 93
        Page 94
        Page 95
        Page 96
        Page 97
        Page 98
        Page 99
        Page 100
        Page 101
        Page 102
        Page 103
        Page 104
        Page 105
        Page 106
    Leptin’s effects on food intake and body weight are differentially attenuated in rats fed a low-fat or high-fat diet
        Page 107
        Page 108
        Page 109
        Page 110
        Page 111
        Page 112
        Page 113
        Page 114
        Page 115
        Page 116
        Page 117
        Page 118
        Page 119
        Page 120
        Page 121
        Page 122
        Page 123
        Page 124
    General discussion
        Page 125
        Page 126
        Page 127
        Page 128
        Page 129
        Page 130
        Page 131
        Page 132
        Page 133
    References
        Page 134
        Page 135
        Page 136
        Page 137
        Page 138
        Page 139
        Page 140
        Page 141
        Page 142
        Page 143
        Page 144
        Page 145
        Page 146
        Page 147
        Page 148
        Page 149
        Page 150
        Page 151
        Page 152
        Page 153
        Page 154
        Page 155
        Page 156
        Page 157
        Page 158
        Page 159
        Page 160
        Page 161
        Page 162
        Page 163
        Page 164
        Page 165
    Biographical sketch
        Page 166
        Page 167
Full Text












LEPTIN RESISTANCE REDUCES GROWTH HORMONE SECRETION AND
CONTRIBUTES TO THE PATHOGENESIS OF OBESITY

















By

ROBIN LEIGH MARTIN


A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL
OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


2000





















For Jarod















ACKNOWLEDGEMENTS

There are many people to whom I wish to express gratitude for standing by me

during my efforts to get my Ph.D. First, my family: husband, George Martin; step-son,

Joshua Martin; mother, Nikki Picking; father, Tom Picking; brother and sister-in-law,

Reed and Kelly Picking, and grandparents, Don and Maxine Picking. They have all been

tremendously understanding and supportive, and I greatly appreciate it. I would also like

to acknowledge the support I have received from in-laws, aunts, uncles, cousins, nieces,

and friends, all of whom have taken the good with the bad.

I want to thank my mentor, Dr. William Millard, for his guidance and patience in

helping me reach my goal and for his faith in my "independence." Sometimes he had

more faith than I did. I would also like to thank the other members of my supervisory

committee, Dr. Ralph Dawson, Dr. Maureen Keller-Wood, Dr. James Simpkins, and Dr.

Pushpa Kalra, for their valuable advice and for allowing liberal laboratory access and use

of equipment. In addition, I thank Dr. Jeff Hughes, Dr. James Simpkins, and Dr.

Maureen Keller-Wood for finding extra work for me to do, such as performing surgeries

and running assays, when my finances were low. I am sure they benefitted from my help,

but not nearly as much as I benefitted from their money.

I wish to thank Evelyn Perez, Feng Li, DeeAnn Dugan, and Amanda Crews,

students who worked in my laboratory, for patiently allowing me to hone and sharpen my

training and supervisory skills. It was fun. Thanks also goes to Dr. Yun-Ju He and

Eileen Monck, who were quick to share their extensive technical expertise with me. I am









grateful to the office staff, Donna Walko, Milena Palenzuela, Gwen Daniels, and

especially Theresa Jones, for all of their help in areas about which I know little.

I also appreciate the friendships I made with other students with whom I went

through graduate school both in my department and from other departments: Dr. Darren

Roesch, Dr. Kelly Gridley, Dr. Ming Hu, Dr. Pini Orbach, Dr. Scott Purinton, Tony

Smith, and Amanda Crews. I want to give special mention to Dr. Pattie Green, who was

a great study partner and friend, especially during our first two years as graduate students.

In addition I want to thank Dr. Bruce Jung for all the challenging, and often therapeutic,

racquetball games. The most important person I must mention, however, is Dr. Baerbel

Eppler. I am thoroughly indebted to BB for her scientific help as well as for her

friendship.

I would like to thank my friends Tim and Anita Harvey, who very unselfishly

provided me with a place to live and who took care of me when I first arrived in

Gainesville. I am also grateful to have secured friendships with Dr. Joanna Peris, Dr.

LeighAnn Stubley, Dr. Baerbel Eppler, and Theresa Jones while living in Gainesville.

Finally, I especially thank all my family and friends in Clearwater, who are awaiting my

return.
















TABLE OF CONTENTS

Chapter Page


ACKNOWLEDGEMENTS iii

LIST OF FIGURES ix

LIST OF TABLES xi

1 LITERATURE REVIEW 1

O b e sity ........................................................................................................ . .............. 1
O b esity M o d els ................................................................................................... 3
T heories of F ood Intake .................................................................. ................... 6
L e p tin ......................................................................................................... . ........... 9
R o les o f L eptin .......................................................................................................... 12
R regulation of L eptin .... ...................................................................... ............. 15
Leptin and Hormonal Interactions ...................................................................... 16
L eptin R eceptors .............. ........... .............................................. ...... ....... .. 19
L e p tin S ig n a lin g ........................................................................................................ 2 3
L eptin R resistance .. .. .... ........ ........ ..................................................... ........ 25
H um an L eptin M stations ................................................ ....... ............ .............. 28
Leptin Treatment in Humans and Leptin Gene Therapy .................................... 29
Growth Hormone ........... ................... ......... .............. 30
Excess of Deficiency of Growth Hormone ......................................................... 35
Growth Hormone and Obesity ......................................................................... 36
L eptin and G row th H orm one ...................................... ....................... .............. 39
O b j e ctiv e s.............................................................................................................. . . 4 1


2 GENERAL METHODS 43

A n im a ls ..................................................................................................................... 4 3
D iets ................. ... .. ........................ ............................. . . .................................... 4 3
Feeding, Pair-feeding, and Body Weight Measurements ................................... 43
Leptin Challenge Test ..................................... .......................... .............. 44
A lzet O sm otic M inipum ps ........................................ ......................... .............. 45
R ight A trial C annulation .................................................................... .............. 45
A n e sth e sia ............................................................................................................. 4 5
P rep a ratio n ............................................................................................................ 4 5









S u rg e ry .................................................................................................................. 4 6
R recovery ......................................................................................... .............. 46
B lood sam pling cages ............................................................................................... 46
Blood Sampling and Tissue Collection............................................................... 47
B lood C collection from Cannulae ...................................................... .............. 47
B lood C collection from Tail V ein ...................................................... .............. 47
Blood Collection via Cardiac Puncture........................................................... 47
T runk B lood C collection ................................................................. .............. 48
C collection of H ypothalam us .................................... ...................... .............. 48
Pituitary and O rgan W eights.................................... ...................... .............. 48
C e ll C u ltu re ............................................................................................................... 4 8
G H 1 C ells ................................................................................. . ................ 48
Plating C ells .......................................................................................................... 49
Five-D ay Tim e-C ourse ...................................................................................... 49
M edia Experim ent .............................................................................................. 49
Collecting RNA from GH1 Cells ................... ...................................... 50
R adioim m unoassays ............................................................................................... 50
G H Io d in atio n ....................................................................................................... 5 0
G row th H orm one R IA ............................................................... .............. ...... 51
IG F Iodination ............................................ ............... ...... . .. .............. 5 1
IG F R IA .................................................................................................... 5 2
L eptin R IA .. . . . ........................................................ ........................ ..... 52
In su lin R IA ................................................................................................ 5 3
Glucose and Triglyceride Assays ..................................................................... 54
D N A A ssay ............................................................................................................... 5 4
RNA extraction, RT-PCR, Southern Blot........................................................... 55
Protein Extraction and Western Immunoblotting ............................................... 57
P rotein E x tractio n ...... .. ........................................ ........................ .............. 5 7
M icro B C A Protein A ssay .................. .............................................. .............. 58
Western Immunoblot Analysis for Leptin Receptor....................................... 59


3 CIRCULATING GROWTH HORMONE LEVELS ARE ELEVATED IN
RATS FED A HIGH-FAT DIET 62

In tro d u ctio n .............................................................................................................. 6 2
Methods ........................................................ .............. 63
Animals .............. . .. .. ........ ............ .... ................ 63
Cannulation Surgery, Blood Sampling, and Tissue Collection ......................... 64
R adioim m unoassays... .. ................................ ....................................... 65
R T-PC R for L eptin R eceptor ............................................................ .............. 65
S ta tistic s ................................................................................................................. .. 6 6
R e su lts ....................................................................................................... . ........... 6 6
B o dy W eig h t ......................................................................................................... 6 6
F o o d In tak e ........................................................................................................... 6 6
L e p tin ................................................................................................................ . .. 6 7
L eptin R eceptor m R N A ................................................................. .............. 67


vi









I G F ........................................................................................................................ 6 7
G row th H orm one Profi le ....................................... ........................ .............. 67
D discussion ................................................................................ .... ...................... 72

4 LEPTIN TREATMENT INCREASES GROWTH HORMONE SECRETION
IN CULTURED GH1 CELLS 77

In tro d u ctio n .............................................................................................................. 7 7
M eth o d s ...................................................................................................... ........... 7 9
G H 1 C e lls .............................................................................................................. 7 9
Plating Cells and Leptin Concentration.......................................................... 79
Five-D ay Tim e-C ourse .............................................................. .............. 79
M ed ia E x p erim ent ................................................................................................. 8 0
R T-PCR for L eptin R eceptor ............................................................ .............. 80
Western Immunoblot for Leptin Receptor ............... ................................... 80
G H R adioim m unoassay ................................................................. .............. 81
S statistic s ........................................................................................................... . . 8 1
R results .............................................. .......................................................... . . . 8 1
Ob-Rb mRNA and Protein Expression ................................................ 81
Five-D ay Tim e-C ourse .............................................................. .............. 82
M edia E x p erim ent ...... .. ........................................ ........................ .............. 82
D iscu ssio n ............................................................................................................. . .. 8 5


5 LEPTIN RESISTANCE IS ASSOCIATED WITH HYPOTHALAMIC
RECEPTOR mRNA AND PROTEIN DOWNREGULATION 88

In tro d u ctio n .............................................................................................................. 8 8
M eth o d s ...................................................................................................... ........... 8 9
A n im a ls ............................................................................................................ . . 8 9
G ro u p s ............................................................................................................... ... 9 0
Serum M easurem ents .......................................... ........................... ............. 90
L eptin Challenge Test Pilot Study .................................................... .............. 91
Leptin Challenge Test ..................................................................... 91
R T-PC R for L eptin R eceptor ............................................................ .............. 91
Western Immunoblot for Leptin Receptor ............... ................................... 92
S ta tistic s ................................................................................................................. .. 9 2
R e su lts ....................................................................................................... . ........... 9 3
L e p tin ................................................................................................................ . .. 9 3
B o dy W eig h t ......................................................................................................... 9 3
Food Intake ........................................................................................................... 93
Leptin Challenge Test Pilot Studies................................................................ 94
L eptin C challenge T est .................................................................... ............. .. 94
Leptin Receptor mRNA in Hypothalamus ...................................................... 94
Leptin Receptor Protein Expression in Hypothalamus ................................... 94
IG F -1 V alues ......................................................................................................... 95
Hormonal and Metabolic Measures ................................................................ 95


vii









D isc u ssio n ............................................................................................................... 1 0 0


6 LEPTIN'S EFFECTS ON FOOD INTAKE AND BODY WEIGHT ARE
DIFFERENTIALLY ATTENUATED IN RATS FED A LOW-FAT OR HIGH-
FAT DIET 107

In tro d u ctio n ............................................................................................................. 10 7
M e th o d s ............................................................................................................... ... 1 0 8
A nim als and D iets ................................................................ ... ....... ........ 108
Osmotic Pumps, Blood Sampling, and Body Temperature ............................ 109
Leptin and IGF-1 Radioimmunoassays....................................... 109
S statistic s ............................................................................................................ . . . 1 1 0
R esu lts ............... .. .......................... .................................................... . ........... 1 10
Effects of Diet on Food Intake ...... .......... .......... .................... 110
L eptin ............................................................................. ...................... .. . .......... 1 10
Effects of D iet and Leptin on Food Intake...................................... ................. 111
Effects of Diet and Leptin on Body Weight ................................................. 111
Effects of Diet and Leptin on IGF-1 Values.......... ................................ 112
Effects of Diet and Leptin on Organ Weights...... .................. ................. 112
Effects of Diet and Leptin on Body Temperature..................... ................. 112
D iscu ssio n .............................................................................................................. 1 1 9


7 GENERAL DISCUSSION 125

REFERENCES 134

BIOGRAPHICAL SKETCH 166















LIST OF FIGURES



Figure Page

Figure 2-1: MgCl2 (mM) and temperature (C) optimization.............................................56

Figure 2-2: C ycle optim ization ...................................................................... ................ 56

Figure 2-3: Southern blot of leptin receptor ...................................................... ................ 57

Figure 2-4: Representative RT-PCR from hypothalamus samples.....................................57

Figure 2-5: Trizol extraction ................................................. .............. ................ 58

Figure 2-6: C ell lysis buffer extraction.............................................................. ................ 58

Figure 2-7: Protein loading optim ization........................................................... ................ 61

Figure 2-8: Primary antibody concentration optimization..................................................61

Figure 3-1: B ody W eight ................ .. .................. .................. ....................... ............... 68

F igure 3-2 : F oo d Intake .......................................................................................................... 69

Figure 3-3: L eptin L levels ............. .. .................... .................. ...................... ..................69

F igure 3-4 : O b-R b m R N A ................................................... ............................................. 70

F figure 3-5 : IG F .................................................................................................... . ....... .. 70

Figure 3-6: G H Profile .............. ......................... .......................... ..................... .. .. .. ..... 71

Figure 4-1: Ob-Rb mRNA on GH1 Cells ......................................................................82

Figure 4-2: Five-D ay Tim e-C ourse........................................ ........................ ................ 83

Figure 4-3: Media Supplemented with 10% Horse Serum and 2.5% FBS .............................83

F figure 4-4 : Serum -F ree M edia ...............................................................................................84

Figure 4-5: Media Supplemented with 12.5% Charcoal Stripped FBS ................................84


ix









Figure 5-1: Leptin Levels Indicate Proper Pump Activity ................................................ 95

Figure 5-2: Body Weight is Dose-Dependently Decreased by Leptin Treatment................. 96

Figure 5-3: Food Intake is Initially Decreased by Leptin; Ultimately Resistance Develops... 96

Figure 5-4: Leptin Challenge Test Pilot Study.................................................... .............. 97

Figure 5-5: L eptin C challenge Test ................................................................... .............. 97

Figure 5-6: Leptin Receptor mRNA in Hypothalamus...................................................... 98

Figure 5-7: Leptin Receptor Protein Expression in Hypothalamus ............... .................... 98

Figure 5-8: IG F-1 V values .. .... ................. ................................................... .... ........ .. 99

Figure 6-1: Absolute Food Intake Reported in Various Diet Parameters..............................113

Figure 6-2: Leptin Levels Indicate Proper Pump Activity ....... .................. ...................114

Figure 6-3: The Effects of Leptin on Food Intake in Diets of Varying Calorie and Fat
C o n ten ts ............................................................................................................ . . 1 1 5

Figure 6-4: The Effects of Leptin on Food Intake Normalized to 100 grams Body
W eig h t .............................................................................................................. . . 1 1 6

Figure 6-5: The Effects of Leptin on Body Weight in Diets of Varying Calorie and Fat
C o n ten ts ............................................................................................................ . . 1 1 7

Figure 6-6: IG F -1 V alues .. .... ................. ....................................................... .. .. ..... 118















LIST OF TABLES


Table Page

Table 1-1: Obesity Models................ .......................... ......................... 5

Table 1-2: Orexigenic and Anorexigenic Neuropeptides Regulated by Leptin.................... 18

T able 1-3 : L eptin R eceptors................................................. ............................................ 23

Table 1-4: Mediators that Inhibit GH Secretion in Both Man and Rodents ............................ 32

Table 1-5: Mediators that Stimulate GH Secretion in Both Man and Rodents..................... 32

Table 3-1: Growth Hormone Profile of Diet-Treated and Control Rats............................ 71

Table 5-1: H orm onal and M etabolic M easures................................................... ............. 99

T able 6-1: O rgan W eights ...... ... ............ .............................................................. .... 118

Table 6-2: B ody Tem perature .................... ................................................................ 119

Table 7-1: Model of GH Regulation by Leptin............................................133















Abstract of Dissertation Presented to the Graduate School
of the University of Florida in Partial Fulfillment of the
Requirements for the Degree of Doctor of Philosophy



LEPTIN RESISTANCE REDUCES GROWTH
HORMONE SECRETION AND CONTRIBUTES TO
THE PATHOGENESIS OF OBESITY

By

Robin Leigh Martin

May 2000

Chairman: William J. Millard
Major Department: Pharmacodynamics



Leptin is secreted by adipocytes in amounts indicative of body fat content.

Variations in leptin levels contribute to hypothalamic regulation of feeding and

metabolism to maintain body weight homeostasis. Importantly, if there is increasing

leptin with increasing body fat and the hypothalamus cannot detect or respond to it, such

as is seen in leptin resistance, obesity may develop. Growth hormone (GH) is secreted by

the anterior pituitary and directly influences body composition through lipolysis. GH

also stimulates the secretion of insulin-like growth factor I (IGF-1), which mediates some

of the actions of GH.

The hypotheses of this dissertation are (1) under normal circumstances, leptin

stimulates GH, and (2) in the leptin resistance situation described above, leptin fails to









stimulate GH. In obesity, GH is severely attenuated, and leptin resistance may be the

mechanism by which this occurs.

To test the first hypothesis, rats were given diets with varying fat contents and GH

was measured. The diet with the highest fat content did not cause obesity; there were

elevated levels of leptin but not enough to produce resistance. These animals had an

enhanced GH-IGF-1-axis. In a second study, leptin treatment resulted in elevated GH

secretion from a GH-secreting cell line (GH1), further strengthening the hypothesis.

To test the second hypothesis, rats were given normal rat chow and implanted

with osmotic minipumps for the continuous infusion of two doses of leptin or vehicle.

The leptin-treated animals developed resistance, as measured by loss of effect on food

intake but not on various metabolic measures, including glucose, triglycerides, and

insulin. IGF-1 was attenuated in the high-dose leptin group. Leptin receptors were

reduced in this study. A final study utilized both the diets of varying fat content and the

leptin-filled osmotic minipumps. Leptin was shown to lose its effectiveness in animals

fed the high-fat diet and IGF- 1 was attenuated. The rats were fed the diets for a longer

period than in the first diet study, allowing time for the development of leptin resistance.

IGF-1 was also attenuated in animals infused with leptin. The results of these two studies

agree with the second hypothesis.














CHAPTER 1
LITERATURE REVIEW


Obesity

Obesity is one of the most common health problems in industrial societies

[Grundy and Barnett 1990]. Obesity is a health threat in part because it is associated with

many other diseases, including type II diabetes, gallstones, and certain cancers [Grundy

and Bamett 1990] and with excessive mortality [NIH 1985]. Data from National Health

and Nutrition Examination Surveys (NHANES) show a high correlation between obesity

and risk for coronary artery disease [NIH 1985]. It has also been shown that most obese

people experience hypertriglyceridemia and hypercholesterolemia [Grundy and Bamett

1990]. In addition, obesity is a very strong risk factor for hypertension. Obesity is

epidemic in the United States (US) [Wilding 1998] and its prevalence is increasing

[Grundy and Bamett 1990].

Currently, the criteria for inclusion into the overweight and obese categories are a

relationship of height and weight [Bray 1992b]. Body mass index (BMI) is body weight

in kilograms divided by height in meters squared. In adults aged 19-34 years, BMI of 19-

25 kg/m2 is considered normal, 25-30 kg/m2 is overweight, and >30 kg/m2 constitutes

obesity. In people 35 years and older, the scale for normal weight is BMI of 19-27

kg/m2, 27-30 kg/m2 is considered overweight, and >30 kg/m2 represents obese. In the US

population of adults aged 25 years or more, 42% of men and 28% of women are

overweight and 21% of men and 27% of women are obese [Must et al. 1999]. In 1991,









the prevalence of obesity was 12.0% [Mokdad et al. 1999] and increased to 17.9% in

1998. The incidence of obesity in every state, in both sexes, and in all age groups, races,

and educational levels was increased. Nearly 10% of total health care costs are related to

obesity [Wilding 1998].

We often blame excessive eating and insufficient exercise for obesity; however

there is still no concrete explanation for the fact that some people become obese, despite

attempts not to, and others, apparently without much effort, do not [Ravussin and

Danforth 1999]. Genetic contributions to the development and maintenance of obesity

cannot be eliminated. Studies in twins demonstrated an inherited tendency to gain weight

in response to overfeeding [Wilding 1998]. Additionally, it was recently shown that

there is unaccounted for physical activity in some people that prevents weight gain

[Levine et al. 1999]. This activity has been called NEAT, for nonexercise activity

thermogenesis, and is made up of "nonvolitional muscle activity" including maintenance

of posture, fidgeting, and muscle tone. In some people, NEAT is triggered by excess

food and prevents fat gain. This concept was proposed in the past [Widdowson et al.

1954] with the suggestion that fidgetiness was more important in prevention of weight

gain than seemed obvious. It was shown that increased fidgeting enhanced energy

expenditure [Rassuvin et al. 1986; Zurlo et al. 1992]. This may account for some of the

individual variations observed in food consumption, exercise, and body weight

fluctuations.

Although obesity is strongly believed to be a risk factor in many diseases, some

experts are not in agreement. One professor suggests that obesity is simply a

consequence of a lifestyle, such as physical inactivity, that is associated with elevated









risks for certain disease, and that obesity in itself is not a risk factor [McDonald 1996].

There are some supporters of this theory, however obesity is intertwined with lack of

physical activity and most researchers are in agreement that obesity poses health risks. It

has been suggested that, without a change in the progression of obesity in today's society,

there will be increasingly overwhelming health care costs and hazardous health

conditions related to this disease [Must et al. 1999]. Thus, research relating to obesity is

important on an individual as well as on a national level.


Obesity Models

There are many types of genetic mutations that result in pathophysiological

signaling and metabolic alterations and which cause obesity in rodents [Guerre-Millo

1997]. Two such models are the obese (ob ob) and diabetes (db db) mice, both of which

exhibit hyperphagia, profound early-onset obesity, hyperglycemia, hyperinsulinemia,

infertility [Coleman 1973], and defective thermoregulation [Coleman 1978] indicative of

a hypothalamic defect. The phenotypes of the ob ob and db db mice are identical and the

strains can only be distinguished by genetic mapping or through parabiosis studies

[Coleman 1973; Coleman 1978]. To study these strains of mice, parabiosis studies were

completed in the following pairs of mice: db db + ob ob, ob ob + normal, and db db +

normal. Parabiosis is the surgical joining of two mice in a manner in which they share

the same circulatory system. In the db db + ob ob parabiosis study, the ob ob partner

became hypoglycemic, lost weight, and starved to death [Coleman 1973]. A similar

phenomenon was seen in the normal partner in the parabiosis experiment joining db db +

normal mice [Coleman 1969]. The results of these experiments suggest that there are

satiety centers in the ob ob and normal mice that respond to a circulation factor that is









produced by db/db mice. The db/db mice do not respond to the circulating satiety factor,

suggesting that the target satiety center is defective [Coleman 1973]. When ob/ob mice

were joined with normal mice, there was no alteration in the feeding behavior of the

normal mice suggesting that the ob/ob mice do not make the circulating satiety factor in

sufficient quantities to affect behavior [Coleman 1973].

The ob/ob genetic defect in mice was first discovered in the laboratory of Snell in

1950 [Ingalls et al. 1950]. Ob/ob is the result of an autosomal recessive mutation

[Coleman 1978] of the obese gene located on chromosome 6, which is also the location

of the leptin gene [Zhang et al. 1994] (leptin will be discussed in detail later in the

chapter). There are two different ob/ob strains of mouse: one with an absence of ob

mRNA [Zhang et al. 1994], and the other with 20 times higher expression of a mutant

protein [Zhang et al. 1994; Frederich et al. 1995b]. That leptin mRNA is altered in this

mutant suggests that the ob gene can be regulated transcriptionally [Mason et al. 1998].

The phenotype of the mice used in this study includes obesity, hyperphagia, low oxygen

consumption and body temperature, and reduced physical activity.

The db/db genetic defect in mice was first discovered in the laboratory of

Coleman in 1966 [Coleman and Hummel 1966; Hummel et al. 1996]. Db/db is the result

of an autosomal recessive mutation [Coleman 1978] of the diabetes gene located on

chromosome 4, which is the location of the leptin receptor gene [Tartaglia et al. 1995].

The db phenotype results from a mutation of the intracellular portion of the leptin

receptor that normally initiates signal transduction [Flier and Elmquist 1997] and as such

affects only the long form of the receptor [Guerre-Millo 1997]. Leptin is able to bind









specifically and with high affinity to the choroid plexus in db/db mice [Devos et al.

1996], indicating that the short form of the leptin receptor is present.

Thefa/fa genetic defect in rats was first discovered in the laboratory of Zucker

and Zucker in 1961 as an autosomal recessive mutation mapped to chromosome 5 [Truett

et al. 1991]. Thefa mutation is in the same gene as the db mutation [Chua et al. 1996].

Thefa mutation is a missense mutation in the extracellular domain of the leptin receptor

[Chua et al. 1996; Flier and Elmquist 1997] that results in inadequate transport to the

plasma membrane [Flier and Elmquist 1997]. As in db/db mice, leptin is able to bind

specifically and with high affinity to the choroid plexus infa/fa rats [Devos et al. 1996].

The Koletsky strain of rat develops obesity, hyperinsulinemia, hypertension, and

proteinuria [Koletsky et al. 1973] due to a single recessive gene with a mutation in the

extracellular domain of the leptin receptor [Takaya et al. 1996]. The same gene as is

mutated in the Zuckerfa/fa rat is mutated in the Koletsky rat, however, the Koletsky

mutation results in a premature stop codon, making this strain of rat a leptin receptor null

model.


Table 1-1: Obesity Models
Model Chromosome Anomaly Reference
Absence of leptin
Ob/ob mouse 6 mRNA or expression of Ingalls et al. 1950
mutant protein
Mutation of intracellular Coleman and Hummel 1966
Db/db mouse 4 portion of leptin Hummel et al. 1966
receptor (long form)
Missense mutation of
Fa/fa rat 5 extracellular portion of Zucker and Zucker 1961
leptin receptor
Koletsky rat 5 Premature stop codon Koletsky et al. 1973
leptin receptor null









In addition to genetically occurring models of obesity, obesity models can be

created by chemical damage to the hypothalamus. For example, the monosodium

glutamate (MSG)-treated animal develops a syndrome in which obesity is its most

characteristic feature [Olney 1969]. MSG treatment results in lesions of the brain,

specific to those areas surrounding the third ventricle such as the arcuate nucleus of the

hypothalamus. Females are infertile and have atrophied ovaries, uteri, and endometria;

males can reproduce and have normal testes. MSG rodents gain weight, which is more

evident in females, without accompanying hyperphagia, in fact, they appear to be slightly

hypophagic [Olney 1969]. The obesity in this model results from metabolic disturbances,

which is partially demonstrated in their decrease in body length [Olney 1969]. This

decrease in length suggests that there is a defect in growth hormone production,

secretion, and/or activity. MSG-treated rats are also lethargic as adults. As a result of

damage to the arcuate nucleus, the MSG-treated rodent has elevated leptin mRNA and

protein expression compared to control [Frederich et al. 1995b].


Theories of Food Intake

Several theories have been proposed to describe the mechanism of initiation of

food consumption. Most of the theories revolve around the dual center hypothesis

proposed in 1951 by Anand and Brobeck. The dual center hypothesis suggested that the

lateral region of the hypothalamus, the "feeding center," played a role in the initiation of

feeding and the ventromedial region, the "satiety center," inhibited feeding. This

hypothesis was based on studies that showed that lesions to the ventromedial

hypothalamus (VMH) and surrounding areas resulted in hyperphagia and obesity

[Hetherington et al. 1940] and lesions to the lateral hypothalamus (LH) abolished food









intake [Anand and Brobeck 1951]. More recent studies have shown the dual center

hypothesis to be too simplistic to be entirely accurate. When lesions of the VMH were

restricted solely to that nucleus of the hypothalamus, hyperphagia and obesity did not

develop [Reynolds 1963]. In addition, it was shown that hyperphagia developed

following injury to other nuclei of the hypothalamus [Jansen and Hutchinson 1969],

including areas through which critical catecholamine tracts travel [Sclafani and Berner

1977]. Another study demonstrated that obesity could develop in the absence of

hyperphagia [Han 1968]. Although these studies argue against the basic dual center

hypothesis, they demonstrate the importance of the hypothalamus in food intake and the

development of obesity [Bray and York 1979].

The aminostatic theory of food intake was proposed by Rogers and Leung in

1973. The theory suggests that rats eat less when fed a diet devoid of certain amino

acids, a diet with an amino acid imbalance, or a diet high in protein. The authors

suggested that brain amino acid content closely resembled the amino acid content in the

blood, and that a receptor system, which recognizes blood amino acid concentration, is

located in the brain. Their results point to a central involvement in orexic behavior.

The glucostatic theory was proposed by Mayer in 1953. The hypothesis was that

there are glucose-sensitive receptors, glucoreceptors, in the lateral hypothalamus that

initiate feeding when blood glucose is low. Additionally, the hypothesis suggests that

there are glucoreceptors in the satiety center of the hypothalamus that terminate feeding

when activated by elevated blood glucose. It was discovered that the mere presence of

glucose was not sufficient to initiate feeding, but that glucose had to cross the membranes

of the glucose-sensitive cells or undergo oxidation. It was later shown that a wide range









of metabolites in the blood in addition to glucose are capable of initiating or terminating

feeding.

The thermostatic theory of food intake was developed by Brobeck in the late

1940s [Brobeck 1948]. The theory states that "animals eat to keep warm and stop eating

to prevent hyperthermia." When animals are in warmer temperatures, they will decrease

their intake of food to prevent the production of too much heat within the body.

Consequently, when animals are in cooler temperatures, food intake increases in an effort

to produce heat and prevent hypothermia. It was further hypothesized that the amount of

food ingested is dependent on how much heat the food produces and how much heat is

required to maintain body temperature. Kennedy argued against this theory [1953]

because he felt that the weight loss experienced by these animals was due to the elevated

temperatures to which the animals were exposed which may have resulted in dehydration.

Kennedy developed his own theory of food intake in 1950 referred to as the

lipostatic theory. This theory is similar to Mayer's theory and agrees with the role of the

hypothalamus, but utilizes a signal other than glucose. It was theorized that, since young

rats are so adept at maintaining constancy of fat stores, there must be some circulating

factor that, along with the hypothalamic mechanism, regulates feeding and energy

expenditure. The circulating factor was proposed to be some unknown factor of the

synthesis, transport, or metabolism of fat. In 1994, a circulating peptide hormone

synthesized in fat was discovered [Zhang et al. 1994] which fit the role of Kennedy's

lipostatic factor. This hormone is leptin.









Leptin

Leptin, coming from the Greek word leptos, meaning thin, is a hydrophobic, 167-

amino acid, 16-kilodalton protein hormone [Samson et al. 1996] transcribed by the ob

gene. Leptin is often referred to as the obese protein. The 4.5 kilobase mRNA from

which leptin is translated is 84% homologous between humans and mice and has 67%

conservation among a large variety of vertebrates, including human, gorilla, chimpanzee,

orangutan, rhesus monkey, dog, cow, pig, rat, and mouse [Zhang et al. 1997]. McGregor

et al. [1996] demonstrated that mouse leptin has no homology with other known proteins.

Leptin has features of a protein that is secreted [Zhang et al. 1994; Cohen et al.

1996b]. It contains a disulfide bond in the carboxy-terminus [Cohen et al. 1996b]; a

mutation of either of the conserved cysteine residues that form the disulfide bond results

in the loss of activity [Zhang et al. 1997]. The fragment of leptin that is the predicted

signal peptide is 1-21 and fragment 22-56 may be the portion of the protein that is

biologically active [Samson et al. 1996]. Additionally, domains between residues 106-

140 have been shown to induce satiety [Grasso et al. 1997].

Leptin is produced in and secreted mainly from mature white adipocytes. The

other types of fat cells (preadipocytes, young adipocytes, fibroblasts, endothelial cells,

Schwann cells, and vascular cells) do not express the ob gene [Frederich et al. 1995b;

Maffei et al. 1995a]. In culture, leptin mRNA is not expressed until mouse fibroblasts

are fully differentiated into adipocytes [Yoshida et al. 1996]. Furthermore, leptin is

produced in fat depots throughout the body, including epididymal, parametrial,

abdominal, perirenal, and inguinal [Maffei et al. 1995a; McGregor et al. 1996]. Leptin is

also expressed in brown adipose tissue [Maffei et al. 1995a], but to a much lesser extent

than in white adipose tissue. In addition to expression in adipose tissue, leptin protein or









its mRNA have been observed in placenta [Senaris et al. 1997], amniotic fluid

[Schubring et al. 1997], and cord blood [Matsuda et al. 1997; Schubring et al. 1997].

Recently, leptin mRNA has also been found in stomach [Bado et al. 1998], skeletal

muscle [Wang et al. 1998c], brain [Esler et al. 1998; Wiesner et al. 1999], and pituitary

[Jin et al. 1999; Morash et al. 1999; Jin et al. 2000].

Leptin is secreted in proportion to adipose mass [Maffei et al. 1995b; Considine et

al. 1996b] and consistent with fat cell size; therefore, heavier humans and animals

generally produce more leptin than lean members of the same species do. Leptin is not

stored in adipocytes [Rau et al. 1999].

Leptin is secreted in a pulsatile manner with short pulses lasting just over 30

minutes [Licinio et al. 1997]. It has been reported that leptin secretion demonstrates

circadian and ultradian rhythms similar to other endocrine hormones [Sinha et al. 1996a;

Sinha et al. 1996c]. Leptin's circadian rhythm exhibits increased pulse frequency at night

[Sinha et al. 1996a; Licinio et al. 1997] and decreased activity in the afternoon [Sinha et

al. 1996a] in both lean and obese humans. Perhaps the purpose of increased leptin at

night is to suppress appetite during sleep [Sinha et al. 1996a]. It is interesting to note that

this diurnal pattern of leptin secretion is the inverse of that of adrenocorticotropin

hormone (ACTH) and cortisol [Licino 1997], however, the apparent diurnal rhythm of

leptin seems to be more related to feeding than to time of day [Saladin et al. 1995].

Perhaps leptin helps regulate the diurnal pattern of glucocorticoids [Ahima et al. 1996].

It was suggested that, like other hormones, this pulsatile secretion of leptin might

be required for maximum effectiveness [Licino 1997]. Leptin-producing fat depots,

however, do not resemble other endocrine glands; they are of varying sizes and are









located throughout the body, and as such, would be difficult to coordinate into producing

a circadian secretion pattern [Sinha et al. 1996c]. It has been suggested that the apparent

pulsatility displayed by leptin actually comes from regulation of its clearance or

elimination [Licino 1997].

Upon secretion, leptin distributes throughout the extracellular space and

accumulates in cellular water [Cumin et al. 1996] or circulates in the blood either free or

completed with binding proteins [Houseknecht et al. 1996]. Several circulating leptin-

binding proteins and a soluble leptin receptor have been observed [Lee et al. 1996]. In

lean humans, the majority of circulating leptin is bound [Sinha et al. 1996b]. Perhaps the

purpose of leptin binding is to limit bioavailability and regulate its actions on feeding and

metabolism homeostasis [Sinha 1997]. Binding proteins also protect leptin from

premature degradation or elimination [Liu et al. 1997].

Leptin that is bound remains in circulation and has a half-life of 71 minutes [Hill

et al. 1998]. Free leptin is rapidly degraded by proteases and has a half-life of less than 4

minutes [Sharma et al. 1997]. In patients with chronic renal failure [lida et al. 1996] and

end-stage renal disease [Merobet et al. 1997] and in chronic hemodialysis patients

[Sharma et al. 1997] leptin levels are elevated, largely represented by the pool of free

leptin [Sharma et al. 1997]. In addition, the molecular weight (16-kDa) and half-life

(approximately 25 minutes) [Klein et al. 1996] of leptin are similar to other peptide

hormones that are degraded by the proximal tubules [Bennett and McMartin 1979],

indicating that the kidneys are capable of metabolizing leptin [Klein et al. 1996]. Leptin

receptors have been found in the kidneys [Tartaglia et al. 1995] and leptin has, in fact,

been shown to have a renal mechanism of elimination [Cumin et al. 1996; lida et al.









1996; Merabet et al. 1997; Sharma et al. 1997]. It was found that leptin is cleared in a

two-pool model [Hill et al. 1998] with approximately 75% of leptin being cleared within

the first few minutes of secretion [Cumin et al. 1996].

These results, taken together, strongly indicate that leptin is degraded and/or

filtered by the kidneys. It is important to note that when pharmacological doses of leptin

are administered, the pathways involved in elimination do not become saturated [Cumin

et al. 1996; Hill et al. 1998]. Therefore, neither leptin distribution nor half-life differs

between lean and fat rats [Vila et al. 1998]. Furthermore, it was shown that

malfunctioning clearance or turnover rates [Klein et al. 1996] cannot account for the

hyperleptinemic characteristic of obesity.


Roles of Leptin

Leptin has been implicated as the lipostatic signal that is sensed, directly or

indirectly, by the hypothalamus [Campfield et al. 1995; Maffei et al. 1995a; Stephens et

al. 1995; Ahima et al. 1996; Levin et al. 1996; Schwartz et al. 1996a; Vaisse et al. 1996;

Woods and Stock 1996; Dawson et al. 1997]. Leptin in transported across the blood-

brain barrier by a saturable process [Banks et al. 1996] making it possible that this be the

rate-limiting step in leptin bioactivity [Banks et al. 1996; Schwartz et al. 1996b; Golden

et al. 1997]. In the hypothalamus, leptin works specifically in nuclei responsible for

feeding homeostasis: arcuate, ventromedial, paraventricular, lateral, and ventral

premammillary [Mercer et al. 1996]. Leptin is also active in areas of the brain which

may be important in controlling metabolism, energy balance, and transport into the brain

[Steiner 1996] such as cerebellum, choroid plexus, leptomeninges, cortex, hippocampus,

and thalamus [Mercer et al. 1996; Steiner 1996].









Leptin acts to regulate body weight and the size of adipose depots by the

regulation of food intake and energy expenditure [Zhang et al. 1994; Campfield et al.

1995; Halaas et al. 1995; Pelleymounter et al. 1995; Halaas et al. 1997]. It has been

suggested that leptin is an afferent signal in a negative feedback loop between adipose

tissue and the appetite/satiety centers in the brain [Rohner-Jeanrenaud and Jeanrenaud

1996]. Exogenous leptin administration is effective at reducing food intake in animals of

normal body weight [Campfield et al. 1995; Halaas et al. 1995] as well as in animals with

obesity due to defective leptin production [Pelleymounter et al. 1995]. Daily

intraperitoneal leptin injections given to ob/ob mice result in a dose- and time-dependent

reduction in food intake and body weight [Pelleymounter et al. 1995]. The effects of

leptin on food intake are lost over time, but the effects of leptin on body weight are not.

Leptin treatment also restores the oxygen consumption, body temperature, and activity

levels in these leptin-deficient mice to levels seen in control wild type mice. When leptin

treatment is terminated, body weight levels return to those of control animals [Campfield

et al. 1995]. Leptin treatment is also effective when administered continuously via

osmotic pumps or when administered centrally [Campfield et al. 1995].

It has been shown that leptin-treated animals lose body weight even when pair-fed

the same amount, caloric content, and fat content of food as that consumed by control

animals. Factors other than those involved with feeding are implicated in the control of

body weight. The rate of metabolism, for example, makes a considerable difference in

body composition among individuals, and, as previously mentioned, leptin increases

metabolism [Zhang et al. 1994; Campfield et al. 1995; Halaas et al. 1995; Pelleymounter

et al. 1995; Halaas et al. 1997].









Brown adipose tissue (BAT) in small mammals is important in heat production

and metabolism. When BAT cells are stimulated, mitochondria express uncoupling

protein 1 (UCP1) [Cinti 1992]. The sympathetic nervous system activates existing as

well as stimulates synthesis of new UCP1 [Zhao et al. 1994]. Upon activation, UCP1

uncouples mitochondria, which results in elevated substrate oxidation [Klingenberg

1990] and thermogenesis. It has been shown that leptin increases energy expenditure and

oxygen consumption in rats [Scarpace et al. 1997]; the mechanism by which this occurs

is an increase in UCP1 mRNA [Scarpace et al. 1997] via sympathetic activation

[Scarpace and Matheny 1998]. In addition, leptin stimulates sympathetic outflow to BAT

[Collins et al. 1997].

It has been shown that uncoupling protein 2 (UCP2) can also uncouple

mitochondria, and acts in white adipose tissue (WAT) as well as in BAT [Fleury et al.

1997; Scarpace and Matheny 1998]. The mechanism by which leptin stimulates UCP2

does not require sympathetic activation, but rather utilizes some as yet unexplained

indirect mechanism [Commins et al. 1999]. Together, these results indicate that leptin

activates the sympathetic nervous system and stimulates the production of UCP both

directly and by hypothalamic mechanisms, resulting in increased thermogenesis.

By reducing feeding and increasing metabolism, leptin decreases fat content.

Leptin also reduces fat by other means. Central leptin treatment degrades adipocyte-

specific genomic DNA in a ladder pattern consistent with apoptosis [Qian et al. 1998].

There is also evidence of condensed chromatin and histological staining consistent with

apoptotic events. In addition, leptin inhibits acetyl-CoA carboxylase (ACC) activity [Bai









et al. 1996]. ACC is the enzyme that represents the rate-limiting step in fatty acid

synthesis. By inhibiting ACC activity, leptin inhibits lipogenesis.

Both synthesis and degradation of fat regulate energy stores. In addition to

inhibiting lipogenesis, leptin triggers lipolysis by enhancing mitochondrial fatty acid

oxidation. This oxidation results in attenuated intracellular fatty acid and triglyceride

concentrations [Bai et al. 1996; Qian et al. 1998]. Leptin administration causes weight

loss by reduction of fat mass [Halaas et al. 1995] whereas food deprivation alone causes

weight loss by reduction of both fat and lean mass.

It is clear that leptin is the protein that, consistent with the lipostatic theory of

food intake, acts as a homeostatic marker of adipose tissue that regulates the size of

adipose mass [Zhang et al. 1994; Frederich et al. 1995b]. Elevated leptin is considered to

be a marker of the obese state [Maffei et al. 1995b], but it is also important in the

prevention of starvation [Ahima et al. 1996; Spiegelman and Flier 1996; Flier and

Elmquist 1997]. Evolutionarily, the role of leptin in starvation may be more important

than its role in the prevention of obesity. Leptin is also involved in cardiovascular, renal,

and reproductive physiology, and may be part of the circuitry of reward pathways.


Regulation of Leptin

It has been observed that the downregulation of leptin mRNA expression is

dependent on physiologically active leptin receptors [Guerre-Millo 1997]. If the receptor

is mutated or otherwise inactive, the result will be overexpression of leptin. Leptin

mRNA levels may be regulated by tissue-specific transcription factors or by endocrine

and/or paracrine hormonal regulators [Mason et al. 1998]. Regulatory regions of the

leptin gene promoter include sites specific for transcription factors that control adipocyte









differentiation [Auwerx and Staels 1998]. CCAAT/enhancer-binding protein ca

(C/EPBuc) induces leptin gene expression and peroxisome proliferator-activated receptor-

y (PPARy) inhibits leptin gene expression [Hollenberg et al. 1997].

Leptin levels are acutely altered in response to feeding [Caro et al. 1996b].

Leptin levels are low in food-deprived normal [MacDougald et al. 1995; Hardie et al.

1996; Sinha et al. 1996b] and db/db mice [Frederich et al. 1995b] and rise upon

refeeding. Leptin levels can be restored, with leptin treatment, to levels found in fed

mice [Ahima et al. 1996]. Human subjects fasted for 24 hours may lose only 0.5% of

body fat but 50% of leptin concentration [Boden et al. 1996]. It is clear that leptin

expression is regulated in response to nutritional alterations that influence adipose mass

[Frederich et al. 1995b].


Leptin and Hormonal Interactions

Leptin is intricately intertwined with many central and peripheral hormones. In

the brain, leptin affects many neuropeptide systems responsible for the regulation of

feeding. Neuropeptide Y (NPY) [Kalra et al. 1989], P-endorphin [McKay et al. 1981],

agouti [Lu et al. 1994], agouti-related peptide (AgRP) [Ollmann et al. 1997; Shutter et al.

1997], melanin concentrating hormone (MCH) [Qu et al. 1996], galanin [Sahu 1998], and

orexins [Sakurai et al. 1998] stimulate feeding. In general, leptin inhibits peptides that

stimulate feeding. Leptin binds to its receptors in the arcuate nucleus and decreases NPY

mRNA [Stephens et al. 1995; Schwartz et al. 1996c] thereby attenuating the feeding

response normally elicited by NPY. Both agouti [Lu et al. 1994] and AgRP [Ollmann et

al. 1997; Shutter et al. 1997] increase feeding by antagonizing a peptide that inhibits

feeding, ca-melanocyte-stimulating hormone (uc-MSH). Agouti and AgRP are decreased









by leptin [Mizuno and Mobbs 1999; Wilson et al. 1999]. Galanin [Sahu 1998] and

orexins, which act in the lateral hypothalamus to stimulate food intake [Sakurai et al.

1998] are inhibited by leptin [Beck and Richy 1999].

All orexigenic peptides discussed so far are inhibited by leptin. In some cases,

however, leptin's role in the regulation of these peptides is not as clear. Leptin has been

shown to increase [Huang et al. 1990] as well as decrease [Sahu 1998] MCH. In

addition, leptin receptor mRNA is found on proopiomelanocortin (POMC) mRNA-

containing neurons in the arcuate nucleus [Cheung et al. 1997]. POMC neurons are the

precursors of both stimulatory (P-endorphin) and inhibitory (Uc-MSH) feeding peptides.

Leptin has been shown both to decrease POMC mRNA [Schwartz et al. 1997; Thornton

et al. 1997] and to increase POMC mRNA [Sahu 1998]. The differential effects of leptin

on POMC mRNA may be the result of differential processing of POMC to P-endorphin

and ca-MSH, respectively.

In addition to ca-MSH, corticotropin-releasing factor (CRF) [Britton et al. 1982],

cocaine and amphetamine-regulating transcript (CART) [Elias et al. 1998; Kristensen et

al. 1998], and neurotensin [Sahu 1998] inhibit feeding. Just as leptin tends to inhibit

peptides that stimulate feeding, leptin stimulates peptides that inhibit feeding. Leptin

increases CRF mRNA in the paraventricular nucleus of the hypothalamus, potentiating

the action of CRF on the inhibition of feeding [Schwartz et al. 1996c]. CART, which

also is inhibitory on food intake [Elias et al. 1998; Kristensen et al. 1998], is enhanced by

leptin [Elias et al. 1998; Kristensen et al. 1998]. Neurotensin is another hypothalamic

peptide that inhibits feeding behavior, and leptin increases its gene expression [Sahu

1998].











Table 1-2: Orexigenic and Anorexigenic Neuropeptides Regulated by Leptin
Orexigenic Anorexigenic
NPY P3-endorphin Orexins a-MSH
Agouti AgRP CRF
MCH Galanin Neurotensin



In addition to regulation of central peptides, leptin interacts with peripheral

peptides associated with food intake. Blood glucose levels increase directly following a

meal and level off between meals. According to the glucostatic theory of food intake

[Mayer 1953], glucoreceptors in the lateral hypothalamus initiate feeding when blood

glucose is low. Additionally there are glucoreceptors in the satiety center of the

hypothalamus that terminate feeding when activated by elevated blood glucose. During

food deprivation, glucose levels as well as leptin levels are low. Upon ingestion of a

meal, glucose is available to be taken up into cells, and leptin secretion is restored. It has

been shown that glucose administration enhances leptin mRNA in mice [Mizuno et al.

1996] and that small glucose infusions following food deprivation prevent the fall of

leptin levels in humans [Boden et al. 1996].

Insulin is secreted in response to elevations in blood glucose following a meal. In

addition to leptin, insulin would be a potential candidate for the lipostatic theory of food

intake [Kennedy 1950; Kennedy 1953] except for one crucial criterion: it is not produced

in adipocytes. It is generally well agreed-upon that insulin increases leptin mRNA

expression [Yoshida et al. 1996] and leptin production and secretion [Saladin et al. 1995;

Mizuno et al. 1996; Wabitisch et al. 1996; Ahren et al. 1997; Barr et al. 1997], but the

effects of leptin on insulin are less well defined. There is some controversy about









whether leptin increases [Barzilai et al. 1997; Sivitz et al. 1997; Tanizawa et al. 1997],

decreases [Cohen et al. 1996a ; Kieffer et al. 1996; Dawson et al. 1997; Poitout et al.

1998], or has no effect [Sinha et al. 1996b] on insulin production, secretion, and/or

action. Perhaps these differences in results lie in the fact that leptin and insulin are both

dynamically regulated by metabolic factors such as meal ingestion and fasting, and both

have an important resistance component, making these comparisons difficult to interpret.

Leptin also has multiple hormonal interactions that may or may not be related to

orexic behavior. Synthesis and secretion of leptin are increased by glucocorticoids [De

Vos et al. 1995; Murakami et al. 1995; Berneis et al. 1996; Slieker et al. 1996; Wabitsch

et al. 1996] and leptin has been proposed as an important feedback regulator of the

hypothalamic-pituitary-adrenal (HPA) axis [Heiman et al. 1997; Licinio et al. 1997;

Pralong et al. 1998]. There is also regulation of leptin by thyroid hormones [Escobar-

Morreale et al. 1997], growth hormone (GH) [Florkowski et al. 1996], and insulin-like

growth factor-1 (IGF-1) [Bianda et al. 1997]. In turn, leptin is required for maximal

blood GH levels [Carro et al. 1997]. In fasted mice, estrus is delayed, serum testosterone,

luteinizing hormone, and thyroxine levels are reduced, and corticosterone and ACTH are

elevated, all of which can be normalized or nearly normalized with leptin treatment

[Ahima et al. 1996].


Leptin Receptors

Tartaglia et al. [1995] first cloned a high-affinity, single membrane-spanning

receptor for leptin mapped to a gene on chromosome 4 with strong sequence homology

between mouse and human. The receptor was 894 amino acids in length and the

membrane-spanning domain consisted of 23 amino acids. The short intracellular domain









of 34 amino acids contained a sequence that allowed binding to Janus protein kinases

(JAKs). It was predicted that the receptor was a member of the class I cytokine receptor

superfamily and was most closely related to gpl30 signaling component of the

interleukin-6 (IL-6) receptor, the granulocyte colony-stimulating factor (G-CSF) receptor,

and the leukemia inhibitory factor (LIF) receptor [Tartaglia et al. 1995]. Representatives

of the class I cytokine family to which the leptin receptor has the highest homology have

longer intracellular domains, necessary for signaling, than initially reported by Tartaglia

et al. for the leptin receptor. It was later found that the leptin receptor gene creates a

splice variant with a longer intracellular domain [Lee et al. 1996] capable of signaling.

The gene that encodes the leptin receptor produces multiple splice variants in

varying levels in a tissue-specific manner [Lee et al. 1996]. Initially, four membrane-

bound single-gene splice variants of the receptor were found in the mouse: three (Ob-Ra,

Ob-Rc, and Ob-Rd) with short intracellular domains originally thought to be incapable of

signaling, and one (Ob-Rb) with a longer intracellular domain, through which leptin

exerts its biological effects [Lee et al. 1996]. There is also one soluble leptin receptor

(Ob-Re). More recently, a new form of the receptor, Ob-Rf, was discovered [Wang et al.

1996]. Ob-Rf has strong sequence homology to the previously cloned isoforms, but with

the short intracellular domain dissimilar to the other short forms.

Leptin receptors are located in many areas of the body including lung, kidney,

liver, ovary, testis, prostate, gastrointestinal tract [Cioffi et al. 1996; Lee et al. 1996],

pancreas [Tanizawa et al. 1997] and the central nervous system (CNS). In the CNS,

receptors are especially abundant in nuclei of the hypothalamus implicated in feeding

homeostasis: arcuate, ventromedial, paraventricular, and ventral premammillary [Mercer









et al. 1996]. Leptin receptors have also been observed in cerebellum, choroid plexus,

leptomeninges, cortex, hippocampus, thalamus [Mercer et al. 1996; Steiner 1996]. These

areas are not necessarily important in modulating feeding behavior, but may be important

in controlling metabolism, energy balance, and transport into the brain [Steiner 1996].

Leptin binds with high affinity to the choroid plexus and leptomeninges in rats

[Devos et al. 1996]. Ob-Ra is expressed in the choroid plexus (blood-cerebrospinal fluid

or blood-CSF barrier), leptomeninges, brain, hypothalamus, testes, adipose tissue [Lee et

al. 1996], liver, stomach, kidney, heart, lung [Wang et al. 1996] and in rat brain

microvessels that make up the blood-brain barrier [Bjorbaek et al. 1998]. Ob-Ra is

thought to help transport leptin across the blood-brain barrier via receptor-mediated

transcytosis at the microvessels. It was shown that Ob-Ra on human brain endothelium

bind leptin and internalizes it in a temp erature-dependent process [Golden et al. 1997].

Leptin may also cross the blood-CSF barrier at the choroid plexus, although this is not the

major means by which leptin gains access to the CSF [Bjorbaek et al. 1998]. It has also

been suggested that Ob-Ra on the leptomeninges degrades CSF leptin [Bjorbaek et al.

1998] and that Ob-Ra on the choroid plexus clears leptin from the CSF [Tartaglia et al.

1995]. Leptin can be internalized by a coated-pit mechanism by binding to Ob-Ra and

partitioned into a lysosomal compartment where it can then be degraded [Uotani et al.

1999]. In addition, Ob-Ra is the receptor in the kidney thought to play a role in clearance

of leptin from the circulation [Cumin et al. 1996], possibly by glomerular filtration.

Ob-Rb is highly expressed in the hypothalamus [Lee et al. 1996] and is the

isoform of the receptor through which leptin exerts a biological effect [Tartaglia et al.

1995]. The hypothalamus is the only tissue in which the long form of the leptin receptor









is more abundantly expressed than the short form [Tartaglia 1997]. Within the

hypothalamus, Ob-Rb is strongly immunoreactive in the arcuate, paraventricular,

surpraoptic [Matsuda et al. 1999], ventromedial, and dorsomedial nuclei [Mercer et al.

1996]. Ob-Rb is also found in brain, cerebellum, testes, adipose tissue [Lee et al. 1996],

and pituitary [Jin et al. 1999; Jin et al. 2000]. In pituitary, leptin receptor is found in 70%

of ACTH cells, 21% of GH cells, 33% of FSH cells, 29% of LH cells, 32% of TSH cells,

and 3% of prolactin cells [Jin et al. 1999].

Recently, a soluble isoform of the leptin receptor (Ob-Re) has been characterized

which has an affinity similar to that of the membrane-bound Ob-Rb [Liu et al. 1997]. It

has been proposed that the role of Ob-Re is to regulate leptin bioactivity by protection

from degradation, slow the clearance process, and inhibit binding to Ob-Rb [Liu et al.

1997]. This soluble receptor is potentially the same protein as a plasma binding molecule

[Liu et al. 1997] and has been shown to bind the majority of circulating leptin in mice

and humans [Houseknecht et al. 1996].

The other short forms of the leptin receptor are far less characterized. Ob-Rc and

Ob-Rd are expressed in heart, testes, adipose tissue, and spleen [Lee et al. 1996]. Ob-Rf

is localized in the brain, liver, stomach, kidney, lung, heart, thymus, spleen, and

hypothalamus [Wang et al. 1996]. More work needs to be done to elucidate the roles

these receptors play in leptin bioactivity.











Table 1-3: Leptin Receptors
Receptor Length Localization Roles
Ob-Ra Short Choroid plexus, leptomeninges, Transports leptin across
brain microvessels, brain, blood brain barrier,
hypothalamus, testes, adipose tissue, degrades and/or clears leptin
liver, stomach, kidney, heart, lung from cerebrospinal fluid,
clears leptin from
circulation
Ob-Rb Long Hypothalamus, brain, cerebellum, Biological effects
pituitary, testes, adipose tissue
Ob-Rc and Short Heart, testes, adipose tissue, spleen ?
Ob-Rd
Ob-Re Short Soluble circulates in blood Regulates leptin bioactivity
Ob-Rf Short Brain, hypothalamus, liver, stomach, ?
heart, kidney, lung, thymus, spleen


Leptin Signaling

Members of the class I cytokine receptor superfamily, to which the leptin receptor

belongs, individually demonstrate no signaling capacity, but rather require complexation

with protein kinases to initiate a signal transduction cascade [Tartaglia et al. 1995]. All

membrane-bound isoforms of the leptin receptor have a Box 1 domain [Murakami et al.

1991] and the long form also has a Box 2 domain [Lee et al. 1996; Bjorbaek et al. 1997].

Both Boxes 1 and 2 are required for JAK (Janus kinase or just another kinase) binding

and activation of signal transduction via the signal transducers and activators of

transcription (STAT) pathway [Murakami et al. 1991]. It was initially suggested that the

short forms of the leptin receptor were incapable of signal transduction [Tartaglia et al.

1995].

As stated previously, cytokine receptors cannot initiate a signal transduction

cascade independently [Tartaglia et al. 1995]. Many cytokine receptors are capable of









signaling following receptor homooligomerization, and it was predicted that Ob-Rb

followed the same pattern [White et al. 1997]. It was shown that the long form as well as

the short form of the leptin receptor homodimerizes spontaneously [White and Tartaglia

1999] and can form heterodimers upon ligand binding.

The JAK-STAT pathway is common in cytokine signaling [Darnell 1997;

Pellegrini and Dusanter-Fourt 1997]. JAKs are constitutively associated with the

cytoplasmic domain of cytokine receptors. When the appropriate ligand binds to its

receptor, the receptor dimerizes and JAKs are able to phosphorylate each other. Upon

this activation, JAKs phosphorylate the receptor and various intracellular transcription

factors. One such factor is STAT. Src homology 2 (SH2) domains, found on all STATs,

promote binding of STATs to phosphorylated receptors [Darnell et al. 1994; Ihle and

Kerr 1995; Schindler and Darnell 1995], which subsequently results in phosphorylation

of STATs by JAKs. Phosphorylated STATs dimerize, translocate to the nucleus, and

induce gene transcription to produce a biological effect. The long form of the leptin

receptor has 3-5 sites where tyrosine phosphorylation may occur [Bjorbaek et al. 1997].

JAKs phosphorylate these sites and allow the interaction of STATs with the receptor.

Leptin is also capable of signal transduction through pathways that involve the

mitogen activating protein (MAP) kinase and insulin receptor substrate I (IRS-1)

[Bjorbaek et al. 1997; Murakami et al. 1997; Yamashita et al. 1998]. JAK activation is

required to initiate the MAP kinase transduction cascade [Wang et al. 1995; Winston and

Hunter 1996]. JAK phosphorylates Shc, which then activates Ras, and the cascade is

initiated. Alternatively, JAK mediates IRS-1 phosphorylation [Argetsinger et al. 1995;

Johnston et al. 1995], thereby activating Ras. Recently, however, it was found that the









short form of the leptin receptor, using the Box 1 motif, was capable of signal

transduction through a pathway in which Box 2 was not involved [Bjorbaek et al. 1997;

Murakami et al. 1997; Yamashita et al. 1998]. The Box 1 pathway phosphorylates JAK2

and IRS-1 tyrosine residues and activates the MAP kinase cascade, but is incapable of

STAT activation. The long form of the leptin receptor was better able to activate the

STAT pathway than the short form, however, it was clear that the short form had

signaling capabilities [Bjorbaek et al. 1997].

JAK-STAT transcription activity is rapid and transient [Shuai et al. 1992],

indicating that the pathway is negatively regulated. Suppressors of cytokine signaling

(SOCS) are proteins that are encoded by genes that are activated by the STATs

[Yoshimura et al. 1995; Starr et al. 1997]. There are many members of the SOCS family,

including SOCS-1 through SOCS-7 and CIS (cytokine inducible SH2-containing protein)

[Hilton et al. 1998]. There is differential expression of SOCS in various tissues [Tollet-

Egnell et al. 1999] and each member acts in a different way to negatively feedback on

JAK or STAT to limit the intensity and/or duration of activation [Nicholson and Hilton

1998; Starr and Hilton 1998]. Leptin treatment has been shown to induce SOCS-3 and

CIS mRNA in many target tissues [Emilsson et al. 1999]. Excess leptin production, such

as that in obesity, may result in overproduction of cytokine suppression proteins, and as

such is a potential mechanism of leptin resistance [Emilsson et al. 1999].


Leptin Resistance

As a circulating factor informing the brain of the body's energy stores, leptin

plays a role in the maintenance of body weight homeostasis. Mice with mutations of the

ob gene have reduced levels of circulating leptin and exhibit hyperphagia and obesity.









When these animals are given exogenous leptin, their body weight is significantly

reduced. Mice with mutations of the db gene have elevated levels of circulating leptin

but, like the ob mutants, experience hyperphagia and obesity. Leptin treatment in the db

mutants is ineffective. Human obesity is not often the result of a mutation, as far as is

currently known, so comparisons with these animal models is not entirely accurate;

however most obese humans exhibit dramatically elevated levels of circulating leptin

[Zhang et al. 1994; Maffei et al. 1995b] and ob mRNA [Considine et al. 1996b]. In this

respect, humans more closely resemble the db/db mouse than the ob/ob mouse and, in

general, are insensitive to the effects of leptin [Frederich et al. 1995a; Maffei et al.

1995b; Halaas et al. 1997]. The problem in humans is not the production of leptin, but

the response to leptin.

When the brain is unable to respond to elevated leptin levels, it is referred to as

resistance [Flier and Elmquist 1997]. It has been suggested that this so-called leptin

resistance is a major cause of obesity [Frederich et al. 1995a; Frederich et al. 1995b;

Maffei et al. 1995b; Considine et al. 1996b]. There are many potential mechanisms of

leptin resistance. Transport of leptin across the blood-brain barrier is unidirectional from

blood to brain [Banks et al. 1996] and occurs by a saturable process [Caro et al. 1996a].

The saturable transport of leptin into the brain may be a critical component in resistance

[Tartaglia 1997]. In a recent study in mice, it was shown that central administration of

leptin to peripherally resistant animals resulted in significant reductions in food intake

and body weight [Van Heek et al. 1997], suggesting that leptin may lose its ability to

cross the blood-brain barrier in the resistant state. In addition, it was shown that the

cerebrospinal fluid (CSF)-to-serum leptin ratio is lower in obese humans compared to









lean [Caro et al. 1996a; Schwartz et al. 1996b]. Other investigators have also

demonstrated an inability of leptin to cross the blood-brain barrier in resistant animals

[Banks et al. 1996; Caro et al. 1996a; Schwartz et al. 1996b; Van Heek et al. 1997].

However, all aspects of leptin resistance cannot be explained by its inability to cross the

blood-brain barrier. The Koletsky rat, a leptin receptor null model, has leptin CSF levels

similar to controls [Wu-Peng et al. 1997], indicating that leptin can enter the brain

independently of leptin receptors and other transport mechanisms [Bjorbaek et al. 1998].

Another mechanism of leptin resistance may be explained by the inability of the

hypothalamus to detect leptin [Tartaglia 1997] due to defective hypothalamic leptin

receptors [Considine et al. 1996a ; Dawson et al. 1997]. Considine et al. report that the

full-length leptin receptor is expressed in the human hypothalamus [Considine et al.

1996a]; perhaps leptin receptors are functional but downregulated in response to

hyperleptinemia. The possibility that there is a blocked leptin receptor has also been

suggested [McGregor et al. 1996]. Alternatively, leptin resistance may occur

downstream of the receptor in the signal transduction pathway [Tartaglia 1997].

There are varying stages of leptin resistance among different strains of obese mice

[Halaas et al. 1997]. In a study comparing many strains of obese mice, leptin given

peripherally was effective in lean mice and in one strain of obese mice but at a much

higher dose. In addition, leptin given directly into the brain was effective in two of three

strains of obese mice tested but at dramatically different doses. The significance of this

study is that there are likely to be variations of leptin resistance in obese humans as well.









Human Leptin Mutations

Although the majority of humans experience obesity due to leptin resistance

[Frederich et al. 1995a; Frederich et al. 1995b; Maffei et al. 1995b; Considine et al.

1996b], there are some instances of mutations of the leptin or leptin receptor. Two

cousins in a Pakistani family, normal weight at birth, developed severe early-onset

obesity [Montague et al. 1997]. No one in the families of either of the children was

obese. It was found that the obesity is due to a deletion mutation of a single nucleotide of

the leptin region of the obese gene, which results in a premature stop codon. Both

children are homozygous for the mutation; their parents are heterozygous. This mutation

caused the creation of a form of leptin that cannot be secreted; serum leptin levels are

nearly undetectable. In addition, the low levels of serum leptin present lack the disulfide

bond that produces bioactivity [Rau et al. 1999]. The children are hyperphagic but

display no noticeable impairment of basal energy expenditure [Montague et al. 1997].

Mutations of the obese gene, as have been described here, are rare [Reed et al. 1996]. It

has been shown, however, that mutations on chromosome 6 in the region of the obese

gene predispose toward extreme obesity [Clement et al. 1996].

In a Turkish family, congenital leptin deficiency resulted in severely obese

individuals. This deficiency is the result of a missense mutation in the leptin gene

[Strobel et al. 1998], which results in impaired secretion of leptin. The family members

homozygous for the mutation are severely obese, hyperphagic, and have low sympathetic

tone. The mutations in both the Pakistani and Turkish families are identical to that in the

ob/ob mouse.

A Kabilian family with severely obese individuals are homozygous for a nonsense

mutation in the leptin receptor [Clement et al. 1998]; this mutation being homologous to









that in the db/db mouse andfa/fa rat. The mutation results in a protein that lacks the

transmembrane and intracellular domains of leptin receptor. These subjects develop

obesity within the first year of life, are hyperphagic, and have high circulating levels of

leptin. As in the Pakistani and Turkish families, the members of the Kabilian family who

are heterozygous for the mutation do not develop the phenotype.


Leptin Treatment in Humans and Leptin Gene Therapy

As would be predicted from studies in which leptin was administered to ob/ob

mice, leptin treatment has been shown to be effective in an individual with congenital

leptin deficiency. The nine-year old female cousin from the Pakistani family was treated

with recombinant leptin for 12 months [Farooqi et al. 1999]. The treatment resulted in

weight reduction due to loss of fat and negative energy balance due to reduced food

intake. After 2 months of therapy, leptin antibodies were detectable in the plasma; they

did not, however, appear to interfere with the response to the treatment.

Leptin treatment may also be effective in patients whose obesity is not the result

of genetics. In a clinical trial in which leptin was given to both obese and lean subjects

[Heymsfield et al. 1999], leptin was effective at producing weight loss in a dose-

dependent manner over a 4-week period. In addition, leptin was effective for 24 weeks in

obese subjects. Weight loss was primarily due to fat loss [Heymsfield et al. 1999], as

was seen in the Pakistani female [Farooqi et al. 1999]. The results of this study are

promising because they indicate that, in instances in which resistance is not the result of a

mutation, high doses of exogenously administered leptin may overcome leptin resistance

and help obese individuals lose weight [Heymsfield et al. 1999].









It has been shown that leptin gene therapy is effective in animals [Chen et al.

1996; Murphy et al. 1997; Shimabukuro et al. 1997]. In animals that were made

hyperleptinemic with an adeno-associated virus (AAV), triglyceride content in several

tissues which express leptin receptor was reduced [Shimabukuro et al. 1997]. Murphy et

al. [1997] created a recombinant AAV, which expresses leptin both in vivo and in vitro.

A single intramuscular injection of this rAAV to ob ob mice resulted in correction of

metabolic defects, obesity, diabetes, elevated food intake and body weight,

hyperinsulinemia, and insulin resistance for as long as six months [Murphy et al. 1997].

Chen et al. [1996] also induced chronic hyperleptinemia in normal adult male rats by the

aid of adenovirus-mediated gene delivery. In these animals, there was a reduction in food

intake, no increase in body weight, and disappearance of adipose tissue. These results,

taken together with results from leptin treatment in humans, suggest that leptin gene

therapy may be beneficial in the treatment of human obesity.


Growth Hormone

Growth hormone (GH) is a 21.5 kilodalton, 191 amino-acid polypeptide that is

secreted episodically from the somatotropic cells of the anterior pituitary gland [Martin et

al. 1978]. The secretion of GH is under direct hypothalamic control mediated by two

neuropeptides: growth hormone releasing hormone (GHRH) and somatotropin-release

inhibiting hormone (SRIH) [Martin and Millard 1986; Millard 1989]. GHRH,

synthesized and released from neurons located in the hypothalamic arcuate nucleus, is

responsible for the high amplitude GH secretary episodes in both man and rats. SRIH, on

the other hand, mediates the prolonged intervals whereby very low levels of GH secretion

occur. SRIH neurons are confined to the periventricular nucleus of the hypothalamus









[Kiyama and Emson 1990] in both man and rodents. GHRH and SRIH are secreted

consistently into hypophyseal portal blood, and each also display a periodic surge every

3-4 hours. Each neuropeptide is secreted 1800 out of phase with the other [Tannenbaum

and Ling 1984]. SRIH regulates GHRH secretion [Tannenbaum 1994] and the release of

GHRH and SRIH are, in turn, regulated by a host of other neuropeptides and putative

neurotransmitters, including neuropeptide Y (NPY). In addition, synthetic growth

hormone releasing peptides (GHRPs) have been shown to be more potent at stimulating

GH release than GHRH [Bowers et al. 1991; Bowers 1994]. GHRPs synergize with

GHRH to release GH, which suggests that GHRH and GHRPs act at different pituitary

somatotrope receptors and through different second messenger pathways. GHRPs also

regulate GH by antagonizing the actions of SRIH [Ghigo et al. 1997].

In addition to regulation by GHRH, SRIH, and GHRP, GH secretion is altered in

response to many other neuropeptides, neurotransmitters, hormones, and physiological

conditions (Tables 1-4 and 1-5). These influences may occur directly at the level of the

pituitary or by control of the hypothalamic regulators of GH. When considered to its full

extent, the regulation of GH secretion is very complex. To further complicate the matter,

the regulation of GH is not always similar among species or within various disease states.

For example, the regulation of GH by histamine [Netti et al. 1981; Knigge et al. 1990],

bombesin [Pontiroli and Scarpignato 1986; Scarpignato et al. 1986; Benitez et al. 1990],

neuromedin C [Houben and Denef 1991], excitatory amino acids [Mason et al. 1983],

starvation [Shibasaki et al. 1985], and exercise [Felsing et al. 1992; Butkus et al. 1995]

have been demonstrated only in rats or have differential effects in man and rodents. In

addition, regulation of GH by thyrotropin releasing hormone [Czernichow et al. 1976;









Mueller et al. 1977; Valentini et al. 1989; Giustina et al. 1995] and dopamine [Liuzzi et

al. 1974; Chihara et al. 1979; Peillon et al. 1979; Kitajima et al. 1986; Schober et al.

1989] is altered in different disease states.


Table 1-4: Mediators that Inhibit GH Secretion in Both Man and Rodents
Mediator Type Reference
SRIH Neurohormone Martin and Millard 1986;
Millard 1989
Arginine vasopressin Neurohormone Martin et al. 1978a

P32 adrenergic agonists Neurotransmitter Mauras et al. 1987

Nicotinic muscarinic Neurotransmitter Mendelson et al. 1981
agonists
Plasma fatty acid Physiological Imaki et al. 1985
concentration condition
Age Physiological Iranmanesh et al. 1994;
condition Veldhuis and Iranmanesh 1996
Obesity Physiological Iranmanesh et al. 1994;
condition Veldhuis and Iranmanesh 1996


Table 1-5: Mediators that Stimulate GH Secretion in Both Man and Rodents
Mediator Type Reference
GHRH Neurohormone Martin and Millard 1986;
Millard 1989
GHRP Synthetic Bowers et al. 1980;
oligonucleotides Bowers et al. 1984
Galanin Neuropeptide Murakami et al. 1989;
Giustina et al. 1992
Opiates Neuropeptides Delitala et al. 1983;
Murakami et al. 1985
uc2 adrenergic agonists Neurotransmitter Lancranj an and Marback 1977;
Miki et al. 1984
Cholinergic muscarinic Neurotransmitter Locatelli et al. 1986
agonists
Serotonin Neurotransmitter Imura et al. 1973;
Murakami et al. 1986
GABA Neurotransmitter Cavagnini et al. 1977;
Acs et al. 1987
Testosterone Hormone Veldhuis et al. 1995a;
Mauras et al. 1996









GH pulses can be detected in the blood every 3-5 hours in humans, baboons

[Steiner et al. 1978], monkeys [Quabbe et al. 1981], rabbits, dogs, and rats [Martin

1978]. There are binding proteins for GH found in the plasma. These proteins, GHBPs,

correspond to the extracellular domain of the GH receptor [Leung et al. 1987] and, as

such, bind GH with high affinity. The role of these circulating binding proteins is to

protect GH from premature degradation or clearance [Baumann et al. 1987] and thus

increase its half-life, which is 17-45 minutes [Martin et al. 1978].

GH secretion is associated with the onset of sleep and slow wave sleep [Goldstein

et al. 1983] and levels fluctuate throughout the life span. GH levels are very high in

neonates due to elevated daytime and nighttime bursts of GH [de Zegher et al. 1993].

Values fall shortly after birth and remain stable from day to day in prepubertal children

[Martha et al. 1996]. During puberty, pulsatile GH secretion is amplified as much as 3-

fold [Mauras et al. 1996]. Following puberty, young adults experience a fall in GH to

levels equal to or lower than those in the prepubertal stage [Martha et al. 1996]. These

levels slowly fall throughout adulthood and are greatly reduced in aged individuals

[Veldhuis and Iranmanesh 1996].

GH has many important roles in the body. It is mitogenic, increasing RNA and

DNA synthesis and inducing cell division [Merimee 1979]. It is anabolic, incorporating

amino acids into proteins, increasing muscle size and strength, and lengthening and

widening bones [Merimee 1979]. GH also regulates body composition through nitrogen

sparing and lipolysis [Ho et al. 1996] directly at the level of the adipocyte [Fagin et al.

1980; Vikman et al. 1991]. In obese animals, GH burst amplitudes are reduced [Veldhuis

et al. 1991] and the resulting (decreased) levels of GH may not be sufficient to affect









lipolysis. Ahmad et al. found that in genetically obese Zucker (fa/fa) rats, GH and

GHRH and their messages were decreased by the age of five weeks [Ahmad et al. 1993].

When the rats were given recombinant human GH (rhGH), a decrease in body weight

was observed.

There are various signaling pathways by which GH works, but the main pathways

are JAK-STAT [Argetsinger and Carter-Su 1996] and SOCS [Tollet-Egnell et al. 1999].

Once secreted into the plasma, GH stimulates the release of insulin-like growth factor I

(IGF-1). IGF-1 is released in a continuous manner and circulates in the plasma bound

predominantly to one of its binding proteins, IGF binding protein-3 (IGFBP3) [Lamson et

al. 1991]. Both IGF-1 and its binding protein have relatively long half-lives in this

complex [Mohan and Baylink 1996]. Since GH stimulates IGF-1 and because of its

continuous release and relatively long half-life, IGF-1 is considered a good indicator of

GH status over time [Blum et al. 1990]. IGF-1 does not appear to have circadian

rhythmicity, so time of sampling is not important [Sara and Hall 1990]. The main source

of circulating IGF-1 is the liver [Sara and Hall 1990]. Regulation of liver IGF-1 is

strongly regulated by GH, but fasting and refeeding also have IGF-1 regulatory roles

[Philipps et al. 1989]. IGF-1 is also produced in many other tissues of the body in which

it acts as a paracrine factor [Hall and Bozovic 1969]. GH is a primary regulator of IGF-1

in extrahepatic tissues such as heart, lung, and pancreas [Roberts et al. 1987]. Other IGF-

1 regulators in extrahepatic tissues include prolactin [Murphy et al. 1988] and various

growth factors and trophic hormones [Clemmons and Shaw 1983; Clemmons 1985; Sara

and Hall 1990]. IGF-1 is also produced locally in response to neural [Hansson et al.

1986], arterial [Hansson et al. 1987], and skeletal muscle injury [Jennische et al. 1987].









GH has both direct effects in the body and indirect effects mediated by IGF-1.

Some of the direct effects of GH include lipolysis [Fain et al. 1965] and gluconeogenesis

[Dawson and Hales 1969]. Some of the effects mediated by IGF-1 include many of the

growth-promoting effects in muscle, cartilage, and bone, such as DNA synthesis, cell

proliferation, and protein synthesis [Schoenle et al. 1982]. Green et al. [1985] proposed a

dual model of GH action which suggested that GH stimulates differentiation of precursor

cells and IGF-1 then stimulates growth.


Excess of Deficiency of Growth Hormone

Excess and deficient GH secretion result in pathological conditions that can be

corrected pharmacologically. For example, GH hypersecretion usually occurs as the

result of a pituitary adenoma [Hansen et al. 1994]. When this hypersecretion begins

before puberty, gigantism occurs. When the hypersecretion starts after puberty, the result

is acromegaly. In both conditions, individuals experience elevated IGF-1, insulin

resistance, and impaired glucose tolerance [Quabbe and Plockinger 1996]. There is also

increased fat mobilization [Weil 1965], amino acid retention, and stimulated protein

synthesis [Russell-Jones et al. 1993], which result in decreased fat mass and increased

lean mass [Salomon et al. 1993]. Muscle strength is not necessarily greater. Increased

total body water and extracellular fluid result in mild arterial hypertension [Quabbe and

Plockinger 1996]. Bone turnover is increased [Lieberman et al. 1992]. In gigantism,

bones are widened as well as lengthened. In acromegaly, the GH excess occurs after

puberty when the epiphyseal plates fuse and bones can no longer grow in length. A

thickening of bones occurs in acromegaly. In addition, there is excess growth of cartilage

and soft tissue cell mass [Quabbe and Plockinger 1996]. Hypersecretion of GH can be









treated long-term with an analogue of SRIH, octreotide [Sassolas 1992]. Octreotide

therapy reduces GH and IGF in many patients with acromegaly [Hansen et al. 1994] and

these reductions result in normalization of lean body mass, body fat, extracellular water

content [Bengtsson et al. 1989; Bengtsson et al. 1990], and joint pain [Sassolas 1992].

However, body cell mass remains high [Bengtsson et al. 1990] and there is an increased

incidence of gallstones [Sassolas 1992].

Individuals deficient in GH experience increased truncal fat mass and decreased

lean mass [DeBoer et al. 1992]. There are also symptoms of osteopenia [Holmes et al.

1994], adverse lipid profiles [Cuneo et al. 1993], glucose intolerance and resistance

[Beshyan et al. 1994; Johansson et al. 1995], and reduced exercise capacity [Nass et al.

1995]. Finally, there is a general reduction in the quality of life [Bjork et al. 1989;

McGauley 1989; Rosen et al. 1994]. Growth hormone replacement increases circulating

IGF-1 values. It normalizes lean and fat mass [Binnerts et al. 1992], redistributing

adipose tissue from abdominal to peripheral depots [Bengtsson et al. 1992]. Patients gain

muscle [Bengtsson et al. 1990] through increased protein synthesis. There are also

increases in bone turnover [Binnerts et al. 1992]. In addition, individuals undergoing GH

replacement therapy experience improved quality of life [McGauley et al. 1990] and

cognitive functioning [Almqvist et al. 1986]. Side effects can include transient water

retention [Binnerts et al. 1992] that can be eliminated by lowering the dose of GH.


Growth Hormone and Obesity

It is widely recognized that GH is attenuated in obesity. A number of negative

correlations have been demonstrated between measures of body mass and GH, including

BMI vs. GH release, amplitude, and half-life [Iranmanesh et al. 1991; Veldhuis et al.









1995b] and percent body fat vs. GH release and half-life [Veldhuis et al. 1995b]. The

somatotrope secretary capacity is reduced in obesity [Maccario et al. 1997]; obese

individuals experience reductions in frequency, amount, and duration of GH secretion

and shorter plasma GH half-life [Veldhuis et al. 1991]. The exact mechanisms) of the

reduction of GH in obesity is unknown [Scacchi et al. 1999], however, it is known that

there are multiple players involved.

There may be a hypothalamic contribution to attenuation of GH in obesity. It was

previously suggested that elevated SRIH contributed to attenuated GH in obesity

[Cordido et al. 1989; Tannenbaum et al. 1990]. However, another study showed a

decreased CSF level of SRIH in obese patients [Brunani et al. 1995]. It was also

previously hypothesized that reductions in GHRH caused the GH attenuation in obesity

[Tannenbaum et al. 1990; Ahmad et al. 1993]. This hypothesis was also challenged

when it was demonstrated that GHRH concentrations did not differ between obese and

nonobese subjects [Brunani et al. 1995]. However, when given exogenous GHRH,

overweight subjects exhibit a blunted rise in GH whether GHRH was given by

intravenous bolus [Williams et al. 1984], continuous intravenous infusion [Davies et al.

1985], or pulsatile intravenous administration [Kopelman and Noonan 1986]. In

addition, the response of GH to GHRPs was reduced in obese patients compared to lean

[Cordido et al. 1993]. Obviously, more work needs to be done to fully elucidate the role

of the hypothalamic regulatory peptides on GH in the obese state.

Another potential mechanism of attenuated GH in obese patients is decreased

half-life, which may be explained by the reduction of circulating GHBPs in obese

patients [Hochberg et al. 1992; Argente et al. 1997; Kratzsch et al. 1997]. There is a









positive correlation between both BMI [Hochberg et al. 1992] and percent body fat

[Kratzsch et al. 1997] and GHBPs in obesity. GHBPs act to protect GH from

degradation and thus extend its half-life, so it is logical that reductions in the amount of

circulating GHBPs result in shorter GH half-life. In addition, metabolic clearance rate of

GH is increased in obese individuals [Veldhuis and Iranmanesh 1996].

Obese individuals also demonstrate a reduced number of IGF-1 receptors and

reduced binding [Hochberg et al. 1992]. There is some controversy as to the effects of

obesity on IGF-1 levels. There have been studies demonstrating both reduced [Argente et

al. 1997] and elevated [Hochberg et al. 1992] plasma IGF-1 levels in obesity, but

reductions in receptor binding limit the activity of IGF- 1 either way.

There are many circulating factors that feedback on GH to reduce its secretion

and which may play a role on the effects of GH in obesity. For example, it is known that

circulating insulin feedsback negatively on GH secretion [Lanzi et al. 1997]. Since

obesity is associated with hyperinsulinemia [Polonsky et al. 1988], it is tempting to

speculate that this negative feedback may play a role in inhibiting GH. However, there

are diseases in which insulin is elevated and GH is normal [Maccario et al. 1996]. In

addition, reduction of hyperinsulinemia in obesity does not normalize GH [Chalew et al.

1992]. Non-esterified fatty acids (NEFA) are another example of circulating factors that

feedback to inhibit GH. Upon lipolysis, NEFA are released into circulation. This

increase in NEFA has been shown to negatively feedback at both the level of the pituitary

[Casanueva et al. 1987] and the level of the hypothalamus to reduce GH secretion.

Obese individuals exhibit elevated plasma NEFA [Opie and Walfish 1963; Golay et al.

1986], adding another potential mechanism for the attenuation of GH in obesity.









Promisingly, the attenuation of GH is obesity is lessened with the reduction in

body weight. Weight loss restores both spontaneous and GHRH-stimulated GH release

[Williams et al. 1984] and normalizes elevated GHBP levels [Rasmussen et al. 1996;

Argente et al. 1997]. In addition, GH treatment of obese subjects results in desirable

effects on body mass [Jorgensen et al. 1994; Richelsen et al. 1994].


Leptin and Growth Hormone

It has recently been shown that circulating leptin and GH levels are related.

Studies demonstrated a normalization of elevated leptin levels upon GH replacement in

GH-deficient adults [Florkowski et al. 1996, Fisker et al. 1997], most likely a

consequence of the decrease in body fat which occurred as a result of the lipolytic effects

of GH. In addition to regulation of leptin by GH, there is regulation of GH by leptin.

Leptin induces spontaneous and GHRH-induced GH secretion [Tannenbaum et al. 1998],

at least partially by inhibiting SRIH release. Carro et al. [1997] demonstrated that leptin

antiserum decreased GH amplitude and nadir in rats suggesting that normal levels of

leptin are required for normal GH secretion. They also showed that in fasted animals

with low leptin and low GH, administration of exogenous leptin normalized GH

secretion.

The effect of leptin on GH may occur at the hypothalamic level. Leptin receptors

colocalize with GHRH in neurons [Hakansson et al. 1998] and are also found in the

periventricular nucleus [Mercer et al. 1996] where SRIH neurons are located [Kiyama

and Emson 1990]. When administered to fasted rats, leptin prevented the inhibition of

GHRH mRNA that is normally seen in conjunction with fasting [Dieguez 1998; Carro et

al. 1999]. When incubated with rat hypothalamic neurons, leptin decreased basal SRIH









mRNA and secretion [Quintela et al. 1997]. The regulation of either, or both, of these

two hypothalamic GH regulatory factors by leptin may result in indirect regulation of GH

by leptin. A direct regulation of GH by leptin may also occur at the pituitary level. It has

recently been shown that leptin and leptin receptors are produced in the anterior pituitary

of humans [Jin et al. 1999] and rodents [Jin et al. 2000].

One potential mechanism by which leptin may regulate GH is via neuropeptide Y

(NPY). NPY is a 36-amino acid peptide isolated in 1982 by Tatemoto et al. that has

considerable evolutionary conservation [Tatemoto et al. 1982]. NPY is the neuropeptide

most abundantly found in the brain [Chronwall et al. 1985] with high densities in and

complex networks throughout the hypothalamic nuclei, including the arcuate,

paraventricular, and periventricular nuclei [Chronwall et al. 1985; DeQuait and Emson

1986]. NPY neurons often colocalize with hormones and norepinephrine. In the arcuate

nucleus, NPY neurons colocalize with GHRH and in many other brain areas, NPY and

SRIH neurons colocalize [Vincent et al. 1982; De Quiat and Emson 1986; Fuxe et al.

1989; Okada et al. 1993].

NPY plays roles in reproduction [Kalra et al. 1989], circadian rhythmicity, and

cardiovascular control [Tatemoto 1989], but perhaps the stimulation of feeding is the best

know function of NPY. When given centrally, NPY invokes a robust food intake in male

and female rats [Kalra et al. 1989] during normal nighttime feeding and during daylight

[Clark et al. 1985]. The response is observed within 15 minutes, and is dose-dependent.

NPY specifically increases the intake of carbohydrates and is thought to act

physiologically at times of energy depletion [Leibowitz 1989]. NPY levels are increased

in animals that do not have leptin [Wilding et al. 1993] or functional leptin receptors









[Stephens et al. 1995]. In a study in which NPY-knockout mice were used it was shown

that leptin remained effective on the suppression of feeding indicating that this action of

letpin is mediated by pathways independent of NPY [Erickson et al. 1996]. In this study

it was also suggested that NPY opposes the appetite-suppressing effects of leptin.

It is known that (1) fasted animals have low leptin [Mizuno et al. 1996], (2) low

leptin levels increase NPY [Schwartz et al. 1996a], and (3) high NPY inhibits GH [Okada

et al. 1993] by increasing SRIH and by decreasing GHRH [McCann et al. 1989; Rettori

et al. 1990]. In addition, NPY given centrally blunts leptin-induction of GH secretion

[Carro et al. 1998]. It was also shown that the blunted GH that is observed in the fasted

state occurs in conjunction with elevated NPY mRNA [Vuagnat et al. 1998]. When

leptin was administered in this study, the NPY mRNA was reduced concomitant with

normalized GH levels [Vuagnat et al. 1998]. It is therefore possible that, in addition to

the other regulation pathways, leptin regulation of GH is mediated through NPY [Carro et

al. 1997] or that leptin and NPY regulate GH secretion in parallel [Carro et al. 1998].


Objectives

The regulation of GH by leptin and the effects on body homeostasis are the main

topic of investigation for my dissertation. Most of the literature on GH and leptin

interactions reviewed here was published after I developed my hypotheses. I

hypothesized that (1) in the lean animal, circulating leptin stimulates the release of GH by

acting directly at the level of the anterior pituitary and/or indirectly at the level of the

hypothalamus, and (2) animals that are hyperleptinemic and therefore leptin resistant lose

this ability to regulate GH. My work has been summed up by Scacchi et al.:

Leptin, by favouring GH secretion, might reinforce its own biological effects,
chiefly directed (as far as we presently know) at regulating the body fat content.






42


On the other side, the coexistence of high leptin and low GH serum levels in
obesity fits in well with the concept of a leptin resistance in this condition. [1999,
p.263]














CHAPTER 2
GENERAL METHODS


Animals

Male Long-Evans rats (the strain from which thefa/fa rat was derived) were obtained

from Harlan-Sprague Dawley (Indianapolis, IN) and housed individually under standard

temperature and lighting conditions (12 hour light:dark cycle). Individual housing was

required for individual food intake measurements. Water was available ad libitum at all

times. All procedures using animals received prior approval by the Institution's Animal

Care and Use Committee (IACUC).


Diets

The two test diets were obtained from PJ Noyes Company, Inc. (Lancaster, NH). The

high-calorie, high-fat diet consisted of 20-23% fat and 3.7 kilocalories/gram (kcal/g).

The high-calorie, low-fat diet consisted of 2-3% fat and 3.7 kcal/g. Normal rat chow

#5001, obtained from Purina Mills, Inc. (Richmond, VA), consisted of 5% fat and 3.0

kcal/g. It should be noted that the low-fat diet had a calorie content equivalent to that of

the high-fat diet, both of which were higher in calories than the control diet.


Feeding, Pair-feeding, and Body Weight Measurements


Feeding

The animals were allowed an acclimation period of 5 days during which they became

familiar with the new diets and daily handling. After acclimation, each of the diets was

weighed (Mettler scale, PM200, Highstown, NJ) to the nearest 0.1 gram and administered
43









daily to each animal. Each subsequent day, the amount of diet remaining was recorded,

including food that was dropped into or through the bottom of the cages. Daily intake

was calculated by subtracting the amount of food remaining from the amount of food

initially administered. Average daily intake was calculated per group.


Pair-feeding

After the acclimation period, the high fat and control rats were fed ad libitum daily. The

low-fat rats were pair-fed the amount in grams ingested by the high-fat group the

previous day. In this manner, the diets of the animals consuming the treatment diets

differed only in the percentage of fat content, not in the number of calories.


Body weight

Body weights of the animals in all three groups were recorded daily to the nearest gram.

The animals were weighed individually in a top loading scale (Taconic Farms, YG-700,

Germantown, NY).


Leptin Challenge Test

The animals were food deprived for 24 hours prior to the test. The leptin challenge test

consisted of a 30 mg/kg subcutaneous bolus of murine leptin (Amgen, Inc., Thousand

Oaks, CA) given to half of the animals in each treatment group (leptin challenge). The

other half of the animals in each group received a bolus of PBS for control. Food (Purina

rat chow #5001, Purina Mills Inc., Richmond, VA) was returned to the animals one hour

post-injection, allowing the animals time to recover following the injection. Food intake

was then measured at 4 hours and again at 24 hours.









Alzet Osmotic Minipumps

Alzet osmotic minipumps were used for the continuous administration of murine leptin

(Amgen, Inc., Thousand Oaks, CA) or vehicle over a 2-week (Model 2ML2, Alza

Scientific Products, Palo Alto, CA) or 4-week (Model 2ML4) period. Pump contents

were delivered at a rate of 5 [tg/hour or 2.5 [tg/hour, respectively. Leptin or PBS

(vehicle) was loaded into each pump under sterile conditions. Pumps were implanted

subcutaneously under methoxyflurane anesthesia. Leptin was stable for the entire 4 week

treatment period. For doses of leptin used, please refer to Chapters 5 and 6.


Right Atrial Cannulation

Anesthesia

Sodium phenobarbital (65 mg/mL, 45-50 mg/kg, Veterinary Laboratories, Inc., Lenexa,

KS) was administered intraperitoneally at a dose of 45-50 mg/kg to produce analgesia,

anesthesia, and muscle relaxation. Atropine sulfate (0.1 mL of 1 mg/mL concentration,

American Reagent Laboratories, Inc., Shirley, NY) was given intramuscularly in order to

prevent the accumulation of fluid in the lungs. If the animals were incompletely

anesthetized, methoxyflurane (Pitman-Moore, Inc., Mundelein, IL) was intermittently

administered via a nose cone.

Preparation

All surgical equipment and cannula hardware were autoclaved or gas sterilized, as

appropriate. The cranial (from between the ears to between the eyes) and neck areas

(unilaterally from slightly caudal to the breastbone to the jaw) of the rats were shaved and

disinfected with betadine and alcohol and the eyes were protected with lubricant.









Surgery

In each rat, the right jugular vein was exposed and ligated to stop blood flow. A small

cut was made in the jugular vein and the cannula was inserted and threaded toward the

heart. Pulsation of the cannula indicated that it reached the heart. The cannula was then

pulled back gently just until the pulsation ceased. At this location, the cannula was

secured into position. The cannula was threaded subcutaneously and externalized at the

base of the skull where it was secured with dental acrylic. Also fixed into the dental

acrylic was a snap fastener to later attach to a snap when collecting blood. The cannula

was filled with heparin to prevent coagulation. The neck incisions of the animals were

closed with wound clips.

Recovery

Post-operatively, the animals were placed on heating pads in cages and were closely

monitored until recovery from anesthesia. The animals were returned to their home cages

until blood sampling. The wound clips were removed within 7-10 days of the surgery.


Blood sampling cages

The animals were each placed into the blood sampling cages two days prior to sampling

to allow for acclimation to new surroundings. The cages are large wooden boxes into

which wire mesh cages complete with bedding, food, and water were placed. Tubing was

inserted into the top of the wooden cage, though a protective wire mesh, and attached to

the cannula implanted into the rat, secured with the snap. Through this tubing, blood was

collected without disturbing the rat, thus reducing confounding by stress hormones. Each

cage has a light timer set to the same schedule as the standard housing facility and an

exhaust system for the continual circulation of fresh air. This cage design was approved

by the institution's IACUC for temporary housing of rodents.









Blood Sampling and Tissue Collection

Blood Collection from Cannulae

Blood sampling occurred every 15 minutes for 6 hours from rats in the specialized cages

described above. Before collection of each sample, 400 jtL (the calculated amount of

dead space, which includes heparinized saline used to keep the cannula patent) was

withdrawn and saved. A sample of 300 p.L was collected and dead space was returned

immediately following the collection of the first sample. The blood was immediately

centrifuged and the plasma was stored at -350C until use in hormone and other assays.

Red blood cells were resuspended in sterile heparinized saline and returned to the

appropriate animals following collection of the subsequent blood sample and prior to the

return of the dead space. This was done in order to prevent hypovolemia due to

excessive sampling. This method was used to collect all remaining samples.

Blood Collection from Tail Vein

A scalpel was used to remove the tip of the tail from each unanesthetized rat and 1 mL of

blood was collected into a tube. The tail abrasion required no treatment to stop the

bleeding after the collection of blood. The blood was centrifuged at 3200 rpm for 30

minutes (Beckman Centrifuge Model J-6B, Fullerton, CA) and serum was frozen at -35C

until use in hormone and other assays.

Blood Collection via Cardiac Puncture

Rats were anesthetized with methoxyflurane anesthesia and a 23-gauge needle was

inserted into the heart to collect 1 mL of blood. The blood was centrifuged at 3200 rpm

for 30 minutes (Beckman Centrifuge Model J-6B, Fullerton, CA) and serum was frozen

at -35C until use in hormone and other assays.









Trunk Blood Collection

The animals were sacrificed by decapitation and trunk blood was collected by holding the

decapitated rat over a funnel and allowing blood to drain into a large glass test tube.

Trunk blood was centrifuged at 3200 rpm for 30 minutes (Beckman Centrifuge Model J-

6B, Fullerton, CA) and serum was stored in the -35C freezer until use in hormone and

other assays.

Collection of Hypothalamus

The animals were sacrificed by decapitation and the brain was dissected from the skull

using sterile instruments and placed on ice. The hypothalamus was rapidly dissected

away from the rest of the brain using a sharp razor. The hypothalamus was then rinsed,

blotted dry, and weighed before being placed into a sterile tube and snap frozen in liquid

nitrogen. The samples were frozen at -90C until reverse transcription and polymerase

chain reaction (RT-PCR) and Western immunoblotting were initiated for leptin receptor.

Pituitary and Organ Weights

In the skull, the clear membrane over the sella turcica was broken with forceps. The

posterior and intermediate lobes of the pituitary were removed and discarded. The

anterior lobe of the pituitary was removed, rinsed, blotted dry, and weighed. From the

body, the liver, testes, kidneys, heart, and adrenals were removed, rinsed, blotted dry, and

weighed.


Cell Culture

GH1 Cells

GH1 cells (American Type Culture Collection, Rockville, MD) are rat pituitary tumor

cells that hypersecrete GH. Cells were grown to 70% confluency in F-12K media

(ATCC, Rockville, MD) supplemented with 1% non-essential amino acids, 1% L-









glutamine, 1% nystatin (Gibco BRL, Life Technologies, Grand Island, NY), and either

10% horse serum and 2.5% fetal bovine serum (FBS, Gibco BRL, Life Technologies,

Grand Island, NY) or 12.5% charcoal-stripped FBS (Hyclone, Logan, UT). Cells were

incubated at 37C with 5% CO2. Media was changed 2-3 times weekly. GH1 cells were

back-cultured weekly using standard trypsinization procedures to maintain the cell line.

GH1 cells were used in passages 42-44.

Plating Cells

In general, cells were plated at 200,000 cells/well in 24-well plates in a volume of 1

mL/well. Cells were allowed time to adhere, usually 2-3 days, before experimentation.

On the day of each experiment, medium was aspirated from each well and discarded.

Control or leptin-supplemented (murine leptin, Amgen, Inc., Thousand Oaks, CA)

medium was added to appropriate wells. Experiments were completed as described

below.

Five-Day Time-Course

Control or leptin-supplemented (100nM) media was added to appropriate wells on each

plate. Supernatant was collected each day for 5 days and frozen at -35C until GH RIA.

Cells were collected and analyzed for DNA content for normalization of GH values and

to control for potentially inconsistent plating densities.

Media Experiment

Cells were plated using media and supplements as described above, but with differences

in serum content. Serum-free media or media supplemented with either 10% horse serum

and 2.5% FBS or with 12.5% charcoal stripped FBS were utilized. The rationale for

these differences in serum supplementation are explored in Chapter 4.









Collecting RNA from GH1 Cells

RNA from GH1 cells was collected for RT-PCR amplification of leptin receptor mRNA.

Media was aspirated from the flask and discarded. Trizol (Gibco BRL, Life

Technologies, Grand Island, NY), a reagent designed for the isolation of total RNA from

tissues and cells, was added to the flask (1 mL/10 cm2) and the cells and Trizol were

triturated. Trizol and cells were collected and RNA was extracted as described below.

RT-PCR was performed as described below.


Radioimmunoassays

GH iodination

125I-Na (1 mCi, Amersham Life Science, Inc., Arlington Heights, IL) was added to a 10

[tL aliquot of 1 mg/mL rGH-I-6 (NIADDK, NIH National Pituitary Agency, Bethesda,

MD) using a lead shielded syringe. Chloramine T (25 ptL of 1.5 mg/mL, Sigma

Chemical Co., St. Louis, MO) was added to initiate the reaction and 50 ptL sodium

metabisulfite (2.4 mg/mL, Fisher Scientific, Pittsburg, PA) was added 55 seconds later to

terminate the reaction. Bovine serum albumin (100 [gL of 100 mg/mL RIA grade, Sigma

Chemical Co., St. Louis, MO) was added to coat the column. The entire solution was

placed on a Sephadex G-75 (Sigma Chemical Co., St. Louis, MO) or Bio-Gel P-60

(BioRad Laboratories, Richmond, CA) column for separation. Each sample was counted

on the Apex Automatic Gamma Counter (ICN Micromedic Systems Model 28023,

Huntsville, AL with RIA AID software, Robert Maciel Associates, Inc., Arlington, MA)

and the fraction with the highest level of radioactivity was saved and diluted for use in

GH radioimmunoassays (RIAs).









Growth Hormone RIA

GH was measured in duplicate (cell culture media) or triplicate (plasma) using materials

supplied by Dr. A. F. Parlow and the National Hormone and Pituitary Program

(NIADDK, Baltimore, MD). Values were expressed in ng/mL in terms of the NIADDK

reference preparation rat GH-RP-2. Plasma collected from hypophysectomized rats was

added to the standard curve in the rat plasma assays to correct for non-specific binding.

Hypophysectomized rats have had their anterior pituitaries removed. The plasma,

therefore, lacks GH but has the GH binding proteins. Monkey-anti-rat GH primary

antibody, diluted 1:70,000, and labeled GH, diluted to approximately 12,000 counts/100

[tL, were added to the assay and incubated at room temperature for 3 days. On day 4,

goat-anti-monkey secondary antibody, diluted 1:30, was added. Normal monkey serum

(1:200) was added with the secondary antibody to reduce non-specific binding. The

assay was incubated at room temperature for 1 day. On day 5, all tubes except total

counts were centrifuged for 30 minutes (3200 rpm, Beckman Centrifuge Model J-6B,

Fullerton, CA) at 40C. Supernatant was removed with a vacuum aspirator and pellets

were counted on the Apex Automatic Gamma Counter (ICN Micromedic Systems Model

28023, Huntsville, AL with RIA AID software, Robert Maciel Associates, Inc.,

Arlington, MA) for 1 minute. The GH RIA has an assay sensitivity of 1 ng/mL and a

range of detection from 1 ng/mL to 320 ng/mL.

IGF iodination

125I-Na (1 mCi, Amersham Life Science, Inc., Arlington Heights, IL) was added to a 10

[tL aliquot 0.25 mg/mL IGF-1 iodination preparation (BACHEM Bioscience, Inc., King

of Prussia, PA) using a lead shielded syringe. Chloramine T (10 [IL of 1.0 mg/mL,

Sigma Chemical Co., St. Louis, MO) was added to initiate the reaction. After 45









seconds, 200 p.L of 100 mg/mL bovine serum albumin (RIA grade, Sigma Chemical Co.,

St. Louis, MO) was added. The entire solution was placed on a Sephadex G-75 column

(Sigma Chemical Co., St. Louis, MO) for separation. Each sample was counted on the

Apex Automatic Gamma Counter (ICN Micromedic Systems Model 28023, Huntsville,

AL with RIA AID software, Robert Maciel Associates, Inc., Arlington, MA) and the

fraction with the highest level of radioactivity was diluted and saved for use in IGF RIAs.

IGF RIA

IGF-1 was extracted from serum by the acid/ethanol procedure. IGF-1 was then

measured by RIA; plasma samples were measured in duplicate for IGF. Values were

expressed in ng/mL in terms of the BACHEM IGF reference preparation (BACHEM

Bioscience, Inc, King of Prussia, PA). Rabbit-anti-rat IGF primary antibody, diluted

1:3,000, and labeled IGF, diluted to approximately 12,000 counts/100 [tL, were added to

the assay and incubated at 40C for 2 days. On day 3, goat-anti-rabbit secondary antibody,

diluted 1:20, was added. Normal rabbit serum (1:50) was added with the secondary

antibody to reduce non-specific binding. The assay was incubated at 40C for 1 day. On

day 4, all tubes except total counts were centrifuged for 30 minutes (3200 rpm, Beckman

Centrifuge Model J-6B, Fullerton, CA) at 40C. Supernatant was removed with a vacuum

aspirator and pellets were counted on the Apex Automatic Gamma Counter (ICN

Micromedic Systems Model 28023, Huntsville, AL with RIA AID software, Robert

Maciel Associates, Inc., Arlington, MA) for 1 minute. The IGF RIA has an assay

sensitivity of 0.1 ng/mL and a range of detection of 0.1 ng/mL to 20 ng/mL.

Leptin RIA

Leptin was analyzed with a rat leptin RIA kit (Linco Research, Inc., St. Charles, MO)

which measures both rat and mouse leptin with an assay sensitivity of 0.5 ng/mL and a









range of detection from 0.5 ng/mL to 50 ng/mL. Briefly, samples and standards were

aliquoted in duplicate and primary guinea pig antibody, raised against highly purified rat

leptin, was added. The antibody is 100% cross-reactive with rat and mouse leptin and

<2% reactive with human leptin. The tubes were incubated overnight at room

temperature. On day 2, 125I-leptin was added and the tubes were incubated overnight at

room temperature. On day 3, cold precipitating reagent was added and the tubes were

incubated at 40C for 20 minutes. All tubes except total counts were centrifuged for 40

minutes (3200 rpm, Beckman Centrifuge Model J-6B, Fullerton, CA) at 40C.

Supernatant was removed with a vacuum aspirator and pellets were counted on the Apex

Automatic Gamma Counter (ICN Micromedic Systems Model 28023, Huntsville, AL

with RIA AID software, Robert Maciel Associates, Inc., Arlington, MA) for 1 minute.

Insulin RIA

Insulin was measured with a rat insulin RIA kit (Linco Research, Inc., St. Charles, MO)

with an assay sensitivity of 0.1 ng/mL and a range of detection from 0.1 ng/mL to 10

ng/mL. Briefly, samples and standards were aliquoted in duplicate and primary guinea

pig antibody, raised highly purified rat insulin, and 1251-insulin were added. The tubes

were incubated overnight at 40C. On day 2, cold precipitating reagent was added and the

tubes were incubated at 40C for 20 minutes. All tubes except total counts were

centrifuged for 40 minutes (3200 rpm, Beckman Centrifuge Model J-6B, Fullerton, CA)

at 40C. Supernatant was removed with a vacuum aspirator and pellets were counted on

the Apex Automatic Gamma Counter (ICN Micromedic Systems Model 28023,

Huntsville, AL with RIA AID software, Robert Maciel Associates, Inc., Arlington, MA)

for 1 minute. The assay is 100% specific for rat, mouse, hamster, human, porcine, and

ovine insulin.









Glucose and Triglyceride Assays

Glucose was measured in serum or plasma using a YSI 1500 Sidekick Glucose Analyzer

(Yellow Springs Instrument Company, Inc., Yellow Springs, OH). This instrument

utilizes the glucose oxidase method and the results are linear from 0-800 mg/dL. A 180

mg/dL standard was used. Triglycerides were measured using a kit from Sigma (Sigma

Diagnostics, St. Louis, MO). Triglycerides are hydrolyzed and glycerol is measured with

a qualitative enzymatic method. A 250 mg.dL standard was used and the assay is linear

to a triglyceride level of 1000 mg/dL.


DNA Assay

DNA of GH1 cells was assayed to normalize GH values. After collection of cell culture

media from the 48-well plates (see Cell Culture section), high salt DNA assay buffer

(0.05M sodium phosphate, 2.0M NaCl, 2 mM EDTA, pH 7.4) was added to the cells in

each well and incubated overnight. The samples were collected and sonicated prior to

DNA measurement. The DNA standard curve was derived from calf thymus (Sigma

Chemical Co., St. Louis, MO) and Hoescht florescence emission dye (Molecular Probes,

Eugene, OR) was used. Hoescht dye binds to intact double stranded DNA. Standards

and samples were aliquoted into opaque (white or black) 96-well plates in triplicate.

Hoescht dye (1 [tg/mL) was added and the plate was read on a Molecular Devices Type

374 Fluorometer (Labsystems, Finland) using SOFTmax PRO Version 1.3.2 software for

Macintosh at excitation wavelength 320 nm and emission wavelength 520 nm.












RNA extraction, RT-PCR, Southern Blot


RNA Extraction

RNA was extracted from hypothalamus and GH1 cells using the phenol-chloroform

method with isopropyl alcohol precipitation. Hypothalami were homogenized and GH1

cells were collected in Trizol reagent (Gibco BRL, Life Technologies, Grand Island,

NY). At the end of the procedure, the pellet was dried and resuspended in RNAse-free

water. Absorbances were read on a spectrophotometer (Model DU-64, Beckman,

Fullerton, CA) to obtain an OD260:OD280 value. OD260:OD280 of 1.7 to 2.1 indicates a

clean RNA extraction.


RT-PCR for Leptin Receptor

RT-PCR for leptin receptor mRNA was optimized using the sense and antisense primers

designed by Zamorano et al. [1997]. The sense and antisense primers were 5'-

ATGACGCAGTGTACTGCTG and 5'-GTGGCGAGTCAAGTGAACCT, respectively

and amplified a 357-base pair fragment of the long form of the leptin receptor. The

primers were designed using a homologous region in mouse and human leptin receptor

cDNA to amplify the extracellular domain (bp 1274-1630) of the leptin receptor in the rat

(95% homologous with rat). Optimal conditions were identified as 1 mM MgCl2, 64C

annealing temperature (Figure 2-1), and 30 cycles (Figure 2-2) following an initial

denaturation phase and followed by a final elongation phase. No plot was made of

density vs. temperature, MgCl2, or cycle number. The determination of optimal

conditions was made by rough estimation. Negative controls, including a sample lacking










the reverse transcription enzyme and a sample lacking RNA, were included (data not

shown).


? '2 A L : '7


1 2 3 4 5


.7 400


Figure 2-1: MgCl2 (mM) and temperature
(C) optimization
Lane 1 is the 100 base pair (bp) DNA ladder;
lane 2 is 0.5 mM at 630C; lane 3 is 1.0 mM at
630C; lane 4 is 1.5 mM at 630C; lane 5 is 2.0
mM at 630C; lane 6 is 0.5 mM at 640C; and lane
7 is 1.0 mM at 640C. Based on the results of this
experiment, the conditions used for the
subsequent studies were 1 mM MgCl2 at 640C.


Figure 2-2: Cycle optimization
Lane 1 is the mass DNA ladder; lane 2 is
25 cycles; lane 3 is 30 cycles; lane 4 is 35
cycles; and lane 5 is 40 cycles. Based on
the results of this experiment, 30 cycles
were used in subsequent experiments.


Southern Blot and Normalization


The identity of RT-PCR product (Figure 2-3) was confirmed using the internal probe 5'-

TGCAGCTGAGGTATCACAGG in Southern blot analysis (ECL, Amersham Pharmacia

Biotech, Piscataway, NJ). The inconsistencies in lanes 2 and 3 of the southern blot are

due to relative differences of RNA added to the initial PCR. The amount of leptin

receptor mRNA was normalized with the housekeeping gene cyclophilin. Cyclophilin

did not appear to be affected by the treatment parameters. The cyclophilin sense and

antisense primers used were 5'-GGGAAGGTGAAAGAAGGCAT and 5'-

GAGAGCAGAGATTACAGGGT, respectively and amplified a 210-base pair fragment

[Zamorano et al. 1997]. Cyclophilin conditions were optimized and found to be the same

as were used for the leptin receptor but half the concentration of RNA was added to the









reaction to prevent saturation of cyclophilin. A representative photograph of RT-PCR is

shown in Figure 2-4.




1 2 3 4 5 1 2 3 4 5 6 7 8 9




0 400 357
210
Figure 2-3: Southern blot of leptin receptor Figure 2-4: Representative RT-PCR from
Lane 1 is hypothalamus; lanes 2 and 3 are hypothalamus samples
GH1 cells; and lanes 4 and 5 are RC cells. Lane 1 is the mass DNA ladder; lanes 2, 4, 6, and 8
GH1 and RC cells are rat pituitary tumor are leptin receptor mRNA; and lanes 3, 5, 7, and 9
cell lines that hypersecrete and are corresponding cyclophilin mRNA.
hyposecrete GH, respectively.



Protein Extraction and Western Immunoblotting

Protein Extraction

Trizol: Protein was extracted from the same samples from which RNA was extracted

using Trizol reagent (Gibco BRL, Life Technologies, Grand Island, NY). After addition

of phenol/chloroform to isolate RNA, RNA was in the aqueous phase, DNA was in the

interphase, and protein remained in the phenol/chloroform phase. From the

phenol/chloroform phase, protein was precipitated with isopropanol and washed in a

solution containing guanidine hydrochloride. The samples were centrifuged at 7,500 g at

4C (Beckman Centrifuge Model J2-21, Fullerton, CA) and the pellet was dried and

resuspended in 1% SDS. However, the Trizol reagent does not contain a detergent to

efficiently break cell membranes and release membrane-bound proteins, so additional

samples were extracted in cell lysis buffer (see below) and comparisons were made in

Figures 2-5 and 2-6.









Cell Lysis Buffer: Some hypothalami did not require RNA extraction prior to protein

extraction, and therefore were not extracted using the Trizol method. Instead,

hypothalami were homogenized in a phosphate buffer (g tissue x 10 mL buffer), pH 7.4,

containing 5 mM EDTA, 5 mM EGTA, 50 mM NaC1, 5 mM sodium pyrophosphate

decahydrate, 2% Triton X-100, 0.5% SDS (all from Fisher Scientific, Fair Lawn, NJ), 1

mM orthovanadate, 0.1 mM PMSF (both from Sigma Chemical Co., St. Louis, MO), 10

ug/mL leupeptin, 1.0 ug/mL pepstatin, 10 ug/mL aprotinin (all three from Calbiochem,

La Jolla, CA), and 50 mM NaF (Fisher Scientific, Fair Lawn, NJ) using a Brinkman

polytron homogenizer (Brinkman Instruments, Inc., Palo Alto, CA). After

homogenization, samples were kept on ice and vortexed periodically. After 1 hour,

samples were centrifuged (Micro Centrifuge Model 23 5C, Fisher Scientific, Fair Lawn,

NJ) for 30 minutes and supernatant was frozen at -200C until further use.

1 2 3 4 5 6 1 2 3 4 5 6 7 8 9

I26 [26 if "






Figure 2-5: Trizol extraction Figure 2-6: Cell lysis buffer extraction
Lane 1 is the molecular weight marker; lanes Lane 1 is the molecular weight marker; lanes 2-9
2-6 are hypothalamic samples extracted by the are hypothalamic samples extracted by the cell
trizol method. Leptin receptor (long form) lysis buffer protocol. Leptin receptor (long form)
should be near the 126 kDa marker, is near the 126 kDa marker.


Micro BCA Protein Assay

Micro BCA protein assay is used to measure protein when the samples are suspended in

reagents that interfere with the Coomassie blue of the Bradford protein assay, such as

SDS. A standard curve ranging from 0.063 mg/mL to 1.0 mg/mL was made by serial

dilution in 1% SDS starting with 2 mg/mL albumin standard (Peirce, Rockford, IL). A









reference standard (0.0 mg/mL) was also used. Each standard was pipetted into a

colorless 96-well plate in triplicate. Samples were added in duplicate. If dilutions were

required, 1% SDS was used as the diluent. A working reagent was prepared by mixing

reagents MA, MB, and MC (Micro BCA reagents, Pierce, Rockford, IL) at a ratio of

25:24:1. Working reagent was added to standards and samples in each well. The plate

incubated at 370C for 30 minutes. The plate was then read on the SLT 400 AC Plate

Reader (SLT Lab Instruments, Salzburg, Austria) using dual wavelength (575 nm and

690 nm) with 30 second shake and four parameter standard curve fit. The accompanying

software was DeltaSoft II for Macintosh (BioMetallics, Inc., Princeton, NJ).

Western Immunoblot Analysis for Leptin Receptor

Separation and transfer: The 10 p.L protein sample or molecular weight marker

(Kaleidoscope, BioRad Laboratories, Hercules, CA) was combined with 5 p.L loading

buffer (0.06 M Tris, 2% SDS, 10% glycerol, 0.025% bromphenol blue, and 5% 2-

mercaptoethanol), boiled, and loaded onto the pre-cast polyacrylamide-SDS Ready Gel

(BioRad Laboratories, Richmond, CA). For protein loading optimization, see Figure 2-7.

Different volumes of protein were evaluated, 2-9 [tL. The best results were seen at a

volume of 9 jgL, but the bands were still faint. In all subsequent Westerns, the maximum

amount of protein (10 [gL) was loaded. After the Western was completed, |tg protein

loaded was calculated. No negative controls were utilized. After loading onto the gel,

the samples were separated by running the gel in a gel electrophoresis apparatus (Mini-

PROTEAN II Cell, BioRad Laboratories, Hercules, CA) at 125 V for approximately 70

minutes. Samples were transferred to a nitrocellulose membrane (Trans-Blot Transfer

Medium, 0.45 um, 7 x 8.4 cm; BioRad Laboratories, Hercules, CA) at 100 V for 1 hour

using a BioRad Trans Blot Cell apparatus (Hercules, CA).









Immunoblotting and detection: The membrane was blocked for 2 hours in 5% nonfat

dry milk in Tris buffered saline with 0.05% Tween (T-TBS) and then incubated with

primary antibody overnight at 40C. The primary antibody used was rabbit-anti-rat leptin

receptor (long-form) produced to the 18 amino acids near the C-terminus of mouse Ob-

Rb (Alpha Diagnostic International, San Antonio, TX). The primary antibody was diluted

1:500 in blocking buffer. After 3 10-minute washes with T-TBS, the membrane was

incubated with the secondary antibody (anti-rabbit IgG-HRP, Santa Cruz Biotechnology,

Santa Cruz, CA) at a dilution of 1:1,000 for 1 hour. Following another washing step, the

blot was exposed to 5 mL of each solution (simultaneously) of SuperSignal

Chemiluminescent Substrate for Western blotting (Pierce, Rockford, IL) for 10 minutes.

The blot was then exposed to radiographic film (Hyperfilm ECL, Amersham Life

Science, Buckinghamshire, England) for 10 minutes. The film was developed in a

Konica Medical Film Processor (QX-70). Optimization for the antibody concentrations

is shown in Figure 2-8. The best combination of primary and secondary antibody shown

in the figure is with each at a dilution of 1:1000, but the resutling bands were faint. A

subsequent test used a more concentrated primary antibody (1:500) with the same

concentration of secondary antibody (1:1000), with better results (data not shown).

These were the conditions used for all subsequent Western analyses.

Analysis: A pooled reference sample was included in each gel to correct for inter-gel

variation. The optical density of the bands was measured using an imaging densitometer

(BioRad Model GS-670, Hercules, CA) and Molecular Analyst Software (version 1.2,

Hercules, CA). The results were normalized according to the amount of protein loaded

([tg) and expressed as a ratio of sample to inter-gel control.











1 2 34 56 78


41St

40 opm


OW PW mo
M ai mom
mo ed M



-P paw


Figure 2-7: Protein loading optimization
Lane 1 is the molecular weight marker;
lane 2 is 2 pL; lane 3 is 3 pL; lane 4 is 4
PL; lane 5 is 5 pL; lane 6 is 6 4L; lane 7
is 7 pL; lane 8 is 8 iL; and lane 9 is 9 pL
of a 2.74 jtg/pL sample. In subsequent
experiments, 10 PL of each protein
sample was used.


Figure 2-8: Primary antibody concentration
optimization
Lanes 1, 3, 5, and 7 are the molecular weight
markers; lane 2 is 1:1000; lane 4 is 1:1500;
lane 6 is 1:2000; and lane 8 is 1:2500. In
lanes 2, 4, 6, and 8, secondary antibody
concentration was 1:1000. In subsequent
experiments, 1:500 primary antibody and
1:1000 secondary antibody concentrations
were used.


Each leptin receptor protein measured with this Western protocol gave bands of multiple
molecular weights. No pre-immune or pre-absorption samples were run, so the
specificity of the bands is uncertain. The molecular weight of the largest band is what
was expected for the leptin receptor, so it can be assumed to be specific. The lower
molecular weight bands have been seen in studies using different antibodies [Boes et al.
1999], so these are possibly specific as well.


126 -




40


'Al

4 1 .
* a


1 2 3 4 5 6 7 8 9














CHAPTER 3
CIRCULATING GROWTH HORMONE LEVELS ARE ELEVATED IN RATS FED A
HIGH-FAT DIET


Introduction

It is well known that the secretion of growth hormone (GH) from the anterior

pituitary gland is episodic. In the past, the rat has been the most widely studied model for

investigation of basic mechanisms that underlie the expression of the GH secretary

pattern in man because of numerous similarities in the GH secretary axes between man

and rats. The regulation of GH secretion is under direct hypothalamic control and is

mediated by the release of a stimulatory neuropeptide, growth hormone releasing

hormone (GHRH) and an inhibitory neuropeptide, somatotropin release inhibiting

hormone (SRIH), also called somatostatin [Martin and Millard 1986; Millard 1989].

In addition to hypothalamic control, metabolic control of GH secretion also shares

similarities in these species. It is clear that circulating GH is dramatically attenuated in

both obese animals [Veldhuis et al. 1991] and obese humans [Williams et al. 1984] and

that this may be directly related to blood-borne factors and their influence on

hypothalamic neurons involved in GH regulation. There are other metabolic controllers

of GH, however, that have the opposite effects between man and rodent species, such as

exercise and fasting.

One possible example of a circulating GH-regulating factor is the obese gene

product, leptin. Leptin is a protein hormone secreted by adipocytes in proportion to body

fat that acts in the brain to help regulate body weight. When there is insufficient leptin or









impaired leptin recognition by the brain, obesity develops. Circulating leptin influences

and is influenced by metabolic states such as obesity, exercise, and fasting [Mizuno et al.

1996; Ahren et al. 1997]. It is therefore logical to assume that body weight and

consequently leptin may influence GH secretion. An additional argument for this is that

leptin receptors are highly abundant in the arcuate nucleus of the hypothalamus (ARC)

[Mercer et al. 1996], which is also the location of GHRH-producing neurons [Martin

1973].

Leptin, being secreted in proportion to body fat, is higher in the blood of animals

with greater fat deposition. Consequently, it tends to be elevated in the blood of animals

that ingest a diet high in fat [Campfield et al. 1995; Frederich et al. 1995; Masuzaki et al.

1995; Van Heek et al. 1997; Widdowson et al. 1997]. The typical human diet generally

consists of fat in excess of 20% [Wang et al. 1998a], which is much greater that the

laboratory rodent diet that is approximately 5% fat (Purina Mills rodent chow). We

proposed that by placing young rats on a high-fat diet we would elevate circulating leptin

to levels, which would subsequently cause an elevation of circulating GH, assuming that

the length of time the rats were on the diets and the levels to which leptin was raised were

not sufficient to cause obesity/resistance. The results of the present study confirm this

hypothesis.


Methods


Animals

Twenty-five male Long-Evans rats (300-325 g) were obtained from Harlan-Sprague

Dawley and housed individually under standard temperature and lighting conditions. The

animals were divided into three groups each receiving different diets: 9 rats received a









high-fat diet (23% fat, 3.7 kcal/g, PJ Noyes Company, Inc., Lancaster, NH), 8 received an

isocaloric, low-fat diet (2% fat, 3.7 kcal/g, PJ Noyes Company, Inc., Lancaster, NH)

which was high in carbohydrates, and 8 controls received normal rat chow (5% fat, 3.0

kcal/g, Purina Mills, Inc., Richmond, VA). The control and high-fat rats were fed ad

libitum. The low-fat rats were pair-fed the amount of food in grams consumed by the

high-fat rats the previous day. Water was available to all groups ad libitum. Body

weight and food intake were measured daily in diet-treated rats and weekly in controls for

the duration of the study.

Cannulation Surgery, Blood Sampling, and Tissue Collection

After four weeks on the various diets, the rats were implanted with right atrial cannulae

under pentobarbital anesthesia (45-50 mg/kg intraperitoneally). The cannulae were

externalized at the base of the skull and secured with dental acrylic. One week after

surgery, 300-400 p.L blood samples were collected at 15-minute intervals for a total of 6

hours, beginning between 8 and 9 AM for each rat. Immediately after each 15-minute

sample collection, the blood was centrifuged and the plasma was stored at -350C until

hormone assays. Red blood cells were resuspended in sterile heparinized saline and

returned to each respective animal following collection of the subsequent blood sample.

This was done in order to prevent hypovolemia due to excessive sampling. After the

completion of sampling, the animals were sacrificed and trunk blood was collected for

analysis of insulin-like growth factor-1 (IGF-1) and leptin. Hypothalami were removed

and frozen at -900C until reverse transcription and polymerase chain reaction (RT-PCR)

studies were initiated for leptin receptor.









Radioimmunoassays

Plasma samples were measured in triplicate for GH using materials supplied by Dr. A. F.

Parlow and the National Hormone and Pituitary Program (NIADDK, Baltimore, MD), as

described [Millard et al. 1981]. Values were expressed in ng/mL in terms of the

NIADDK reference preparation rat GH-RP-6. The GH RIA has an assay sensitivity of 1

ng/mL and a range of detection of 1 ng/mL to 320 ng/mL. Plasma samples were

measured in duplicate for IGF-1. IGF-1 was extracted from trunk blood by the

acid/ethanol procedure and measured by RIA as previously described [Grant et al. 1986].

The IGF RIA has an assay sensitivity of 0.1 ng/mL and a range of detection of 0.1 ng/mL

to 20 ng/mL. Leptin was measured with a RIA kit (Linco Research, Inc., St. Charles,

MO) which measures both rat and mouse leptin with an assay sensitivity of 0.5 ng/mL

and a range of detection from 0.5 ng/mL to 50 ng/mL.

RT-PCR for Leptin Receptor

RT-PCR for leptin receptor mRNA was optimized using the sense and antisense primers

from Zamorano et al. [1997]. The sense and antisense primers were 5'-

ATGACGCAGTGTACTGCTG and 5'-GTGGCGAGTCAAGTGAACCT, respectively

and amplified a 357-base pair fragment of the long form of the leptin receptor. Optimal

conditions were identified as 1 mM MgCl2, 640C annealing temperature, and 30 cycles

following an initial denaturation phase and followed by a final elongation phase. The

identity of RT-PCR product was confirmed using the internal probe 5'-

TGCAGCTGAGGTATCACAGG in Southern blot analysis (ECL, Amersham Pharmacia

Biotech, Piscataway, NJ). The amount of leptin receptor mRNA was normalized with the

housekeeping gene cyclophilin. The cyclophilin sense and antisense primers used were

5'-GGGAAGGTGAAAGAAGGCAT and 5'-GAGAGCAGAGATTACAGGGT,









respectively and amplified a 210-base pair fragment [Zamorano et al. 1997]. The same

conditions were used for cyclophilin as were used for the leptin receptor.


Statistics

Daily and weekly body weight and food intake measurements were compared by two-

way repeated measures ANOVA with Student-Newman-Keuls Multiple Comparisons.

Growth hormone profiles were evaluated by Cluster Analysis [Veldhuis and Johnson

1986], which analyzes area under the curve, peak height and width, and valley nadir and

width. Comparisons of IGF-1, leptin, and leptin receptor mRNA were by one-way

ANOVA followed by Tukey Comparisons. Values were significant using p<0.05 unless

otherwise indicated.


Results

Body Weight

Although rats fed the low-fat diet did not lose weight during the study, they did not gain

as much weight as rats fed either the high-fat or control diets (Figure 3-1). There were

significant differences in body weights between low- and high-fat rats beginning on day

10 and remaining for most of the duration of the study and between the low-fat and

control rats on days 10-14 and 18-29. Rats fed the high-fat diet gained significantly more

weight than controls beginning at day 18 and remaining for most of the duration of the

study.

Food Intake

Rats fed the high-fat diet consumed significantly less chow in grams of food than rats fed

the control diet beginning within the first 5 days of the study and remaining for the

duration (Figure 3-2). No comparisons for animals fed the low-fat diet are reported









versus either of the other two groups because these rats were pair-fed (in grams of food)

to the high-fat rats. When the data are shown as grams of fat consumed for each

respective diet (Figure 3-2), the high-fat rats consumed significantly more throughout the

study compared to both controls and low-fat rats. In addition, control rats consumed

significantly more fat than low-fat rats for the duration of the study. Control rats

consumed more kcal than rats fed the special diets.

Leptin

At the end of the study, leptin levels were significantly elevated in the rats fed the high-

fat diet compared to those fed either of the other two diets (Figure 3-3). Although it

appeared that rats fed normal chow had lower leptin values than low-fat rats, the results

were not significant.

Leptin Receptor mRNA

There were no significant differences in leptin receptor mRNA in hypothalamus in

response to any of the different diets (Figure 3-4).

IGF

At the end of the study, IGF-1 levels were significantly elevated in the rats fed the high-

fat diet compared to those fed either of the other two diets (Figure 3-5).

Growth Hormone Profile

Growth hormone pulses and troughs were analyzed using the Cluster Program [Veldhuis

and Johnson 1986] among the diet-treated and control groups (Table 3-1). It must be

pointed out, however, that each group only averaged two or three values due to sampling

difficulties. Analyses were completed and demonstrated that, overall, the high-fat rats

had the highest total and mean GH under-the-curve values while the low-fat rats had the

lowest (p<0.10). This was most likely due to peak height and valley width. High-fat rats






68


had significantly higher peaks while low-fat rats had significantly lower peaks overall

compared to control (p<0.05). Similarly, the valley nadirs were higher in high-fat rats

and lower in low-fat rats, but these results were not significant. Control rats were in the

middle of the range for both peak height and valley nadir. As expected, because of

elevated pulse amplitudes, the high-fat rats spent less time in the GH trough periods

(valley width, p=0.01) compared to the other groups. Peak width, measured in minutes,

was not significantly different among the groups. Representative profiles for the high-fat

(panel A), control (panel B), and low-fat rats (panel C) are given in Figure 3-6.


0 10 20 30


Figure 3-1: Body Weight
There were significant differences in body weights between low- and high-fat rats (n=9) beginning on day
10 and remaining for most of the duration of the study and between the low-fat (n=8) and control rats (n=8)
on days 10-14 and 18-29 (2-way repeated measures ANOVA, p<0.05). Rats fed the high-fat diet gained
significantly more weight than controls beginning at day 18 and remaining for most of the duration of the
study.













B




* * * * **



5 10 15 20 23 30 35 0
Day


310 C

o t0






0 5 10 IS 20 30 35 40
Day


-- High-Fat Diet
Low-Fat Diet
Normal Chow


Figure 3-2: Food Intake
When measured in grams (g food), it was shown that rats fed the high-fat diet (n=9) consumed significantly
less chow than rats fed the control diet (n=8) beginning within the first 5 days of the study and remaining
for the duration (2-way repeated measures ANOVA, p<0.05, panel A). No comparisons for animals fed the
low-fat diet (n=8) are reported versus either of the other two groups because these rats were pair-fed in
grams of food to the high-fat rats. When measured in grams of fat consumed (panel B), the high-fat rats
consumed significantly more than the control rats, which in turn consumed significantly more than the low-
fat rats (2-way repeated measures ANOVA, p<0.05). When measured in kcal (panel C), normal chow rats
ate more for most of the study, but the values were nearly normalized.






16-









4
-1
0 *







Normal Chow Low-Fat High-Fat
Diet
Figure 3-3: Leptin Levels
At the end of the study, leptin levels were significantly elevated (1-way ANOVA, p<0.05) in the rats fed
the high-fat diet (n=8) compared to those fed either of the other two diets (n=6 each).


SA
S * *








0 5 t0 IS 2w 25 30 35 40






























Control Low-Fat High-Fat

Diet


Figure 3-4: Ob-Rb mRNA
There were no significant differences (1-way ANOVA, p<0.05) leptin receptor mRNA in hypothalamus
due to any of the different diets (n=6 for each group). Leptin receptor was normalized using the
housekeeping gene cyclophilin.


1400

1200

1000

800

600

400


Normal Chow Low Fat High Fat


Diet
Figure 3-5: IGF
At the end of the study, IGF-1 levels were significantly elevated (1-way ANOVA, p<0.05) in the rats fed
the high-fat diet (n=8) compared to those fed either of the other two diets (n=6 each).







71


Table 3-1: Growth Hormone Profile of Diet-Treated and Control Rats

Overall

Group High-Fat Diet Low-Fat Diet Normal Chow p values

Total Area

Under Curve 22,249.60 4,494.65 + 12,439.97 p<0.10

(ng/mL) 3,359.90 1,099.25 4,412.45

Mean Area

Under Curve 60.65 12.62 34.74 + p<0.10

(ng/mL.min) 8.73 3.47 11.82

Peak Width 46.25 58.75 37.50

(minutes) 6.25 8.75 4.33 N/S

Peak Height 288.63 36.81 + 142.01

(ng/mL) 59.60 7.88 47.53 p<0.05

Valley Width 45.00 66.25 62.50

(minutes) 0.00 1.25 2.50 p=0.01

Valley Nadir 25.75 5.56 11.68

(ng/mL) 10.71 1.99 3.70 N/S

Values are given as mean SEM. High-fat and low-fat diet groups, n=2 each; controls,
n=3. Overall p values are given to indicate significance or trends. N/S means not
significant at p<0.10 level.


SA: High-Fat Diet B: Normal Chow C: Low-Fat Diet
300 300 300
0 0 00



0 60 120 180 240 300 360 0 60 120 180 240 300 360 0 60 120 10 240 300 360

Time (minutes)
Figure 3-6: GH Profile
Representative GH profiles of high-fat (panel A), control (panel B), and low-fat rats (panel C).









Discussion

In the mammalian endocrine system, a variety of hormones and their hormonal

and metabolic regulators are intricately intertwined, both centrally and in the periphery.

GH is one such hormone. GH stimulates IGF-1, and separately or in concert, GH and

IGF-1 regulate body composition. In man, GH secretion is enhanced in diabetes [Glass et

al. 1981] and virtually all forms of stress. Both exercise and fasting also increase GH

[Martin and Millard 1986; Borst et al. 1994] while its secretion is attenuated in obesity.

In rats, insulin and corticosterone have a negative effect on circulating GH levels

[Tannenbaum et al. 1981], as do exercise and fasting. Similar to man, GH secretion is

attenuated in obesity in rats [Martin et al. 1983]. The differential regulation of GH

between rodents and man is largely unexplained.

Leptin is a hormone that is regulated by IGF-1 [Bianda et al. 1997] and GH

[Florkowski et al. 1996]. Upon GH replacement in GH-deficient subjects, body fat

decreased resulting in a decrease of elevated leptin [Florkowski et al. 1996]. In another

study, leptin levels were found to be elevated in GH-deficient adults and were normalized

after 1 year of GH therapy [Fisker et al. 1997]. Although the authors claimed there was

no association between the two hormones and that the effects were most likely due to the

decrease in body fat which occurred as a result of the lipolytic effects of GH, there

certainly is evidence that there is at least an indirect relationship. In addition, leptin is

required for maximal blood GH levels [Carro et al. 1997]. Carro et al. [1997]

demonstrated that leptin antiserum decreased GH amplitude and nadir in rats, suggesting

that normal levels of leptin are required for normal GH secretion. They also showed that,

in fasted animals with low leptin and low GH, administration of exogenous leptin

normalized GH secretion.









GH has many important roles in the body, including lipolysis. Several

investigators have shown GH receptors on adipocytes [Fagin et al. 1980; Vikman et al.

1991]. In obese animals, GH burst amplitudes are attenuated [Veldhuis et al. 1991].

This reduction of GH in obesity prevents GH-induced lipolysis, perhaps further

contributing to obesity. This is another example of GH-leptin interaction.

In the current study, rats consuming the high-fat diet gained more weight than

controls. The weight gain of the high-fat rats occurred in spite of a food intake in grams

and kilocalories significantly lower than that of controls. These results seem

contradictory but are reasonable when the fat content of each diet is taken into effect.

The grams of fat consumed by the high-fat group exceeded that of the control group,

which in turn exceeded that of the low-fat group. Furthermore, rats that ate the low-fat

diet gained less weight than controls, explained by the differences in overall fat

consumption.

Corresponding to the body weight data, leptin levels were significantly elevated in

the high-fat rats versus the other two groups. This was expected and is probably due to

elevated fat mass in these rats. The levels to which leptin was elevated remained within

the a physiological range, indicating that the animals were not obese and probably were

not leptin resistance. In addition to elevated leptin, IGF-1 levels were significantly

elevated in the high-fat rats. It has been shown that, in rats, IGF- 1 is present in the blood

at relatively constant concentrations dependent on GH secretary status [Donaghue et al.

1990]. IGF-1, therefore, is a good measure of overall GH secretion. Although IGF-1 is

regulated by factors other than GH, it is often used clinically to detect GH secretary









problems. The elevation of IGF- 1 in response to the high-fat diet may therefore suggest

that GH was also elevated in this group.

A growth hormone profile consisting of samples collected at 15-minute intervals

for 6 hours was established for each of the three groups. Unfortunately, due to sampling

difficulties, the number of animals in each group is insufficient to draw conclusions with

any degree of confidence. However, the results in Table 3-1 strongly suggest that rats fed

the high-fat diet secreted more GH and rats fed the low fat diet secreted less GH when

compared to control rats. Low-fat rats were pair-fed and thus were probably still hungry

when their food supply ran out, however it is unknown how much more food the low-fat

rats would have consumed had they been fed ad libitum. Thus, the implied chronic stress

experienced by these rats potentially due to being in a state of hunger may confound GH

data.

The results of the IGF- 1 assays and GH profiles, taken together, suggest that

ingestion of the high-fat diet and the subsequently elevated plasma leptin levels resulted

in increased circulating GH values. Although correlation does not imply causation, it is

possible that the physiological elevations in leptin levels stimulated the release of GH,

either directly or indirectly. The literature suggests that leptin is required for normal GH

release [Carro et al. 1997].

A natural feedback loop involving leptin and GH seems evident. Consider this

greatly simplified physiological situation: when an animal begins to eat more and gain

weight, resulting in hypertrohy and/or hyperplasia of fat cells, more leptin is produced.

This elevation of leptin is sensed by the hypothalamus which decreases feeding and

stimulates metabolism and perhaps directly by the pituitary to enhance GH secretion. GH









then acts directly on adipocytes [Fagin et al. 1980; Vikman et al. 1991] to reduce their

size and number, and this with the decreased food intake result in less fat and decreased

or normalized leptin production. When this fall in leptin is sensed by the hypothalamus,

food intake is again increased and GH secretion is reduced in an effort to prevent

lipolysis until normal fat mass has been attained.

In the case presented in the current study, the animals are given a high-fat diet,

and, as expected, gain weight and have elevated circulating leptin. We consequently see

the predicted elevation in GH secretion, mainly observed via IGF-1. The remainder of

the feedback loop described above is not observed, however, in which elevated GH

stimulates lipolysis and decreases leptin secretion. This is probably due to the high fat

content of the high-fat diet, which prevents a loss of body weight and a fall in leptin

levels.

Pathophysiologically, when an animal develops leptin resistance, the ability of the

hypothalamus to detect circulating leptin is attenuated and GH secretion will be

attenuated, as is seen in obesity and which may further contribute to obesity. Assuming

this interpretation is correct, no resistance has yet developed in the current study. First,

the circulating leptin levels, although elevated in rats fed a high-fat diet, remained within

a physiological range. Second, we have seen that GH is still elevated in response to

leptin. Last, we observed no down-regulation of leptin receptor mRNA in the

hypothalamus. In the chapters of this dissertation that study leptin resistance, we the

opposite effects as are demonstrated here: in resistant rats, leptin levels are much higher,

GH is attenuated, and hypothalamic leptin receptor is downregulated.









In summary, there is a relationship between leptin and GH in the normal animal.

We placed young rats on a high-fat diet, which resulted in elevated circulating leptin

levels and subsequently elevated endogenous GH and IGF-1 secretion. There are several

mechanisms that may explain the occurrence of this phenomenon. Leptin receptors have

been found in the pituitary [Cai and Hyde 1998] and leptin may directly regulate GH

secretion. Leptin receptors have also been found in the hypothalamus [Mercer et al.

1996] and may regulate the neuropeptides that directly affect GH secretion, GHRH and

SRIH. It has also been shown that leptin inhibits neuropeptide Y (NPY) secretion in the

ARC [Stephens et al. 1995; Schwartz et al. 1996c]. NPY stimulates SRIH and inhibits

GHRH [McCann et al. 1989; Rettori et al. 1990] and therefore inhibits GH, so inhibition

of NPY by leptin would prevent the inhibition of GHRH, thereby causing a stimulation of

GH. The current study does not demonstrate which, if any or all, of these mechanisms

are in effect, but it does show that elevated leptin levels in vivo enhance circulating GH

levels, in support of the first hypothesis.














CHAPTER 4
LEPTIN TREATMENT INCREASES GROWTH HORMONE SECRETION IN
CULTURED GH1 CELLS


Introduction

Growth hormone (GH) is secreted in an episodic pattern from the somatotropic

cells of the anterior pituitary gland. Secretion is under direct hypothalamic control of two

neuropeptides: growth hormone releasing hormone (GHRH) and somatotrope release

inhibiting hormone (SRIH) [Martin and Millard 1986; Millard 1989]. GHRH stimulates

the high amplitude GH secretary episodes. SRIH, on the other hand, is responsible for

prolonged intervals during which little GH secretion occurs. SRIH also regulates GHRH

secretion [Tannenbaum 1994] and the release of both GHRH and SRIH are, in turn,

regulated by many other neuropeptides and neurotransmitters.

One of the many roles of GH is regulation of body composition. GH triggers

lipolysis [Ho et al. 1996] directly at the level of the adipocyte [Fagin et al. 1980; Vikman

et al. 1991]. In obese animals, GH burst amplitudes are reduced [Veldhuis et al. 1991]

but administration of recombinant human GH to rats results in a decrease in body weight.

The exact mechanism of the attenuation of GH in obesity has yet to be elucidated.

Leptin is a hormone produced mainly in adipocytes and which is secreted into the

bloodstream in proportion to the amount of fat present. Leptin crosses the blood-brain

barrier and informs the hypothalamus of the body's energy stores. The hypothalamus

then responds by regulating orexigenic behavior and metabolic rate to maintain body

weight homeostasis.









Both leptin and GH are related to body composition, and it has been shown that

circulating leptin and GH are intricately intertwined. A previous study in GH-deficient

adults demonstrated a normalization of elevated leptin levels upon GH replacement

[Florkowski et al. 1996, Fisker et al. 1997]. This decrease in leptin most likely occurred

as a consequence of a decrease in body fat due to GH treatment. Another study showed

that leptin treatment induced spontaneous and GHRH-induced GH secretion

[Tannenbaum et al. 1998]. Carro et al. [1997] demonstrated that leptin antiserum

decreased GH amplitude and nadir in rats suggesting that normal levels of leptin are

required for normal GH secretion.

The effects of leptin on GH secretion may occur at the hypothalamic level.

Leptin receptors colocalize with GHRH neurons [Hakansson et al. 1998] in the arcuate

nucleus and are found in the periventricular nucleus [Mercer et al. 1996] where SRIH is

made [Kiyama and Emson 1990]. The regulation of either or both of these two

hypothalamic GH regulatory factors by leptin may result in indirect control of GH by

leptin. In addition, a direct regulation of GH by leptin may occur at the level of the

pituitary. It has recently been shown that leptin and leptin receptors are produced in the

anterior pituitary [Jin et al. 1999; Jin et al. 2000].

In Chapter 3 we demonstrated that leptin induces GH secretion, but there was no

indication of the level of control (hypothalamic or pituitary). The hypothesis of Chapter

4 is that leptin increases GH secretion directly in anterior pituitary cells. To test this

hypothesis, a rat pituitary cell line was used.









Methods

GH1 Cells

GH1 cells (American Type Culture Collection, Rockville, MD) are rat pituitary tumor

cells that hypersecrete GH. Cells were grown to 70% confluency in F-12K medium

(ATCC, Rockville, MD) supplemented with 1% non-essential amino acids, 1% L-

glutamine, 1% nystatin (Gibco BRL, Life Technologies, Grand Island, NY), and either

10% horse serum and 2.5% fetal bovine serum (FBS) (Gibco BRL, Life Technologies,

Grand Island, NY) or 12.5% charcoal-stripped FBS (Hyclone, Logan, UT). The use of

different serum supplementation is described later in the chapter. Cells were incubated at

37C with 5% CO2. GH1 cells were used in passes 42-44.

Plating Cells and Leptin Concentration

In general, cells were plated at 200,000 cells/well in 24-well plates and were allowed

time to adhere, usually 2-3 days, before experimentation. On the day prior to each

experiment, medium was aspirated from each well and discarded. Control or leptin-

supplemented (murine leptin, Amgen, Inc., Thousand Oaks, CA) medium was added to

appropriate wells. Leptin was used at a concentration of 100 nM. This concentration of

leptin was chosen because 100 nM seems to be in the upper end of the range of

physiological leptin levels. Experiments were completed as described below.

Five-Day Time-Course

Control or leptin-supplemented medium was added to appropriate wells on each plate.

Supernatant was collected each day for 5 days and frozen at -35C until GH RIA. Cells

were collected and analyzed for DNA content for normalization of GH values.









Media Experiment

Cells were plated using media and supplements as described above, but with differences

in serum content. Serum-free media or media supplemented with either 10% horse serum

and 2.5% FBS or with 12.5% charcoal-stripped FBS were utilized, as will be described

later in the chapter. Supernatant was collected at 8 and 24 hours and frozen at -35C until

GH RIA. Cells were collected and analyzed for DNA content for normalization of GH

values.

RT-PCR for Leptin Receptor

RNA from GH1 cells was collected for RT-PCR amplification of leptin receptor mRNA

as described in Chapter 2. RT-PCR for leptin receptor mRNA was optimized using the

sense and antisense primers designed by Zamorano et al. [1997]. The sense and antisense

primers were 5'-ATGACGCAGTGTACTGCTG and 5'-

GTGGCGAGTCAAGTGAACCT, respectively and amplified a 357-base pair fragment

of the long form of the leptin receptor.

Western Immunoblot for Leptin Receptor

Leptin receptor protein expression was observed by Western blotting. Briefly, protein

was extracted from hypothalamus, run on a gel, and transferred to a nitrocellulose

membrane. The membrane was then incubated with primary antibody to the long form of

the leptin receptor at a dilution of 1:500 overnight at 40C and with secondary antibody for

1 hour at room temperature. Detection reagents were added to the membrane, and the

membrane was exposed to radiographic film. The film was developed in a Konica

Medical Film Processor (QX-70).









GH Radioimmunoassay

Cell culture media was measured in duplicate for GH using materials supplied by Dr. A.

F. Parlow and the National Hormone and Pituitary Program (NIADDK, Baltimore, MD).

Values were expressed in ng/mL in terms of the NIADDK reference preparation rat GH-

RP-2. The GH RIA has an assay sensitivity of 1 ng/mL and a range of detection of 1

ng/mL to 320 ng/mL. Leptin at concentrations between 1.6 nM and 160 [tM do not

crossreact with the GH assay.

Statistics

Student's t-test was used to compare GH values between time points and between

treatment groups.


Results

Ob-Rb mRNA and Protein Expression

The band seen at 357 bp represents mRNA for the long-form of the leptin receptor

(Figure 4-1); lanes 3 and 4 are GH1 cells. An additional band, slightly larger, is also

seen. This band is most likely a primer-dimer attached to the fragment of interest, which

can materialize when the MgCl2 concentration is too high. This extraneous band was

eliminated when the MgCl2 concentration was optimized. For the purposes of this study,

we wanted to know whether or not the leptin receptor was present. Therefore the exact

concentration of leptin receptor mRNA is not required and no normalization with the

housekeeping gene cyclophilin was performed. A Western was completed to determine

if the presence of leptin receptor mRNA correlated to leptin receptor protein. The band

size (in kDa) representing the long-form of the leptin receptor was not revealed in the









Western analysis, however, multiple other bands of smaller sizes, also specific to leptin

receptor, were present (data not shown).

Five-Day Time-Course

Over the 5-day time-course, GH1 cells continued to secrete GH (Figure 4-2) and the GH

appeared to be stable in the culture media. Leptin treatment had no effect on GH

secretion.

Media Experiment

In all three serum-supplemented media tested, GH1 cells secreted significantly more GH

by 24 hours than at 8 hours. In media with 10% horse serum and 2.5% FBS (Figure 4-3)

and in serum-free media (Figure 4-4), leptin had no effect at either time point. In media

supplemented with 12.5% charcoal-stripped FBS, leptin significantly increased GH

secretion at 8 hours and tended to increase GH at 24 hour (Figure 4-5).














... ,_ 357 bp


Figure 4-1: Ob-Rb mRNA on GH1 Cells
Lane 1 is the 100 base-pair DNA ladder. Lane 2 is Ob-Rb mRNA in hypothalamus. Lanes 3 and 4 are Ob-
Rb mRNA in GH1 cells.




























1 2 3 4 5


Day
Figure 4-2: Five-Day Time-Course
Over the 5-day time-course, GH1 cells continually secreted GH (cumulative results over time). Leptin
treatment had no effect on GH secretion (t-test, n=6 each). Cells were plated in media supplemented with
10% horse serum and 2.5% FBS.


8hrs 24hrs


Time
Figure 4-3: Media Supplemented with 10% Horse Serum and 2.5% FBS
Significantly more GH was secreted at 24 hours (n=6) than at 8 hours (t-test, p<0.05, n=6). Leptin had no
effect at either 8 (n=6) or 24 hours (n=6).


*-* Control
o-o Leptin






























8hrs 24hrs


Time


Figure 4-4: Serum-Free Media
Significantly more GH was secreted at 24 hours (n=
effect at either 8 (n=6) or 24 hours (n=6).


=6) than at 8 hours (t-test, p<0.05, n=6). Leptin had no


8hrs 24hrs


Time
Figure 4-5: Media Supplemented with 12.5% Charcoal Stripped FBS
Significantly more GH was secreted at 24 hours (n=6) than at 8 hours (t-test, = p<0.05, n=6). Leptin
treatment significantly increased GH secretion at 8 hours (t-test, ** = p<0.05) and the effects were nearly
significant (p=0.07) at 24 hours (n=6 each).









Discussion

Leptin has been shown to influence GH secretion indirectly through regulation of

hypothalamic neuropeptides [Mercer et al. 1996; Hakansson et al. 1998]. In addition, a

direct regulation of GH by leptin may occur at the pituitary level; it has recently been

shown that leptin and leptin receptors are produced in the anterior pituitary of humans

[Jin et al. 1999] and rodents [Jin et al. 2000]. The current study shows that long-form

leptin receptor mRNA is present in GH1 cells. When analyzed for protein expression, the

long form of the leptin receptor was not seen, but many other isoforms were. Until

recently, it was thought that only the long form of the leptin receptor was biologically

active; however, it is now known that the short forms can also transduce signals

[Bjorbaek et al. 1997; Murakami et al. 1997; Yamashita et al. 1998].

GH1 cells secrete continuously over time in the absence of a stimulus. In the

time-course presented here, GH levels increased consistently over 5 days indicating that

GH was stable in the media over time. Leptin treatment had no effect on GH secretion on

any of the 5 days. However, these cells were plated in media supplemented with 10%

horse serum and 2.5% FBS. After completing these studies, it was discovered that using

serum-supplemented media could interfere with the actions of leptin on these cells.

To further investigate the effects of serum on leptin treatment, a study was

undertaken in which media with different serum contents were utilized. As was seen in

the time-course, cells in medium supplemented with 10% horse serum and 2.5% FBS

continued to secrete GH over time, but leptin had no effect. There are several potential

explanations for this. There may be leptin-binding proteins in the serum that prevent

leptin from binding to its cells surface receptors. Conversely, there may be some factor









in the serum that antagonizes leptin actions. Additionally, the serum may contain

elements that degrade or alter leptin, making it biologically inactive.

To eliminate these potentially confounding effects of serum on leptin, serum-free

medium was utilized. Again, cells secreted significantly more GH by 24 hours than at 8

hours, but leptin had no effect at either time point. Leptin did, however, tend to decrease

GH at 24 hours. This seems contrary to the hypothesis that leptin stimulates GH

secretion, however, leptin and GH are substances that may stick to the plastic 24-well

plates. In media supplemented with serum, the serum will coat the plates and prevent

leptin and GH from sticking. The results of the current study indicated that, in serum-

free media, leptin tended to decrease GH secretion. However, it is probable that leptin

was bound to the plate and therefore could not produce an effect. In addition, GH may

have also adhered to the plate, possibly explaining why there appears to have been less

GH secreted in Figure 4-4 than in Figure 4-3.

In an attempt to eliminate the uncertainty of the effects of either serum-

supplemented or serum-free media on the actions of leptin on GH1 cells, charcoal-

stripped FBS was utilized. Charcoal stripping reduces the levels of many hormones,

growth factors, and steroids. In media supplemented with charcoal-stripped FBS, leptin

treatment significantly increased GH secretion at 8 hours, in support of the original

hypothesis. Leptin also tended to increase GH secretion at 24 hours, indicating that leptin

lost some of its effectiveness over time. With continuous leptin treatment, leptin

receptors on GH1 cells may be downregulated. In the future, an 8-hour time-course and a

leptin dose-response should be completed. In addition, leptin receptor mRNA

concentration could be measured in the normal and leptin-resistant states.









The GH data reported was normalized to DNA content. It was found that leptin

treatment of GH1 cells in charcoal-stripped media decreased DNA content at both 8 and

24 hours, indicating that cell proliferation was inhibited. These results agree with those

in which leptin treatment decreased proliferation in GH3 cells [Jin et al. 2000]. The GH3

cell line was initiated from the same primary culture from which the GH1 cells were

initiated, two passages later. When we analyzed raw GH data, leptin had no effect (data

not shown) but when we analyzed GH data normalized to DNA, leptin stimulated GH

secretion. Taken together, these results suggest that leptin inhibits cell proliferation but

stimulates GH secretion from the cells that are present. GH1 cells are tumor cells, so any

extrapolation to in vivo physiology is uncertain; however, perhaps these results indicate

that leptin stimulates GH while decreasing cell proliferation as a self-limiting process.

This should be studied in the future in primary pituitary cells.

In vivo, serum is not charcoal-stripped, nor is there a serum-free option, so it may

be argued that the methods utilized in this chapter are not indicative of what happens in

whole animal physiology. In animals, serum is present that contains leptin-binding

proteins. However, it is possible that these proteins have a lower affinity for leptin than

leptin receptors, so when bound leptin reaches the desired destination, the binding

proteins would release leptin making it available to act at its receptor.

In summary, the studies presented here indicate that GH1 cells express leptin

receptor mRNA and that leptin stimulates GH secretion from these cells. These results

support the first hypothesis of this dissertation.




University of Florida Home Page
© 2004 - 2010 University of Florida George A. Smathers Libraries.
All rights reserved.

Acceptable Use, Copyright, and Disclaimer Statement
Last updated October 10, 2010 - - mvs