• TABLE OF CONTENTS
HIDE
 Title Page
 Acknowledgement
 Abstract
 Introduction
 Literature review
 Genomic localization of a single...
 avrXv4: A new avirulence gene responsible...
 Functional domains of avrXv3 and...
 Conclusions
 Appendix
 References
 Biographical sketch














Title: Genetic characterization of plant-pathogen interactions between Xanthomonas campestris pv. vesicatoria and tomato (Lycopersicon esculentum L.)
CITATION PDF VIEWER THUMBNAILS PAGE IMAGE ZOOMABLE
Full Citation
STANDARD VIEW MARC VIEW
Permanent Link: http://ufdc.ufl.edu/UF00100672/00001
 Material Information
Title: Genetic characterization of plant-pathogen interactions between Xanthomonas campestris pv. vesicatoria and tomato (Lycopersicon esculentum L.)
Physical Description: Book
Language: English
Creator: Astua-Monge, Gustavo, 1967-
Publisher: State University System of Florida
Place of Publication: <Florida>
<Florida>
Publication Date: 1999
Copyright Date: 1999
 Subjects
Subject: Plant Pathology thesis, Ph. D   ( lcsh )
Dissertations, Academic -- Plant Pathology -- UF   ( lcsh )
Genre: government publication (state, provincial, terriorial, dependent)   ( marcgt )
bibliography   ( marcgt )
theses   ( marcgt )
non-fiction   ( marcgt )
 Notes
Summary: ABSTRACT: Bacterial spot caused by Xanthomonas campestris pv. vesicatoria (Xcv) is one of the most important diseases of tomato (Lycopersicon esculentum). A new source of resistance to tomato race 3 of this pathogen was found in the wild species L. pennellii. Genetic segregation of the resistance was determined with an F2 progeny of 245 plants derived from a cross between the tomato line L. esculentum Hawaii 7998, susceptible to this race, and the resistant parent L. pennellii LA716. Monogenic segregation of this resistance was confirmed by a goodness of fit test (chi square subscript3:1= 2.287; P=0.13). A collection of 50 L. pennellii-chromosome segment introgression, that covered the whole genome, were screened by inoculation with Xcv tomato race 3 in order to identify the genomic localization of the R gene. The resistance gene (Xv4) was located on chromosome 3. Linkage analysis of the resistance with neighboring RFLP and CAPS markers indicated the following gene order: TG599- 9.3 cM- Xv4- 11.1 cM- TG134. The resistance gene Xv4 maps to an approximate 22 cM interval defined on the centromeric side by the RFLP markers TG599 at 9.3 cM and on the telomeric side by TG134 at 11.1 cM. The role and characterization of the corresponding avirulence gene, avrXv4, are also discussed. A different gene-for-gene system (avrXv3-Xv3) controlling the resistance to this pathogen in tomato was previously described.
Summary: ABSTRACT (cont.): In order to elucidate the possible role of avrXv3 in eliciting the hypersensitive reaction (HR) on Xv3 genotypes, a collection of mutated avrXv3 were generated by PCR-mediated deletion mutagenesis of putative domains inferred from the hydrophobicity analysis of the predicted protein, and the modification of the termini of the protein by the addition of 6 histidine residues. All constructs were screened for their ability to elicit HR using transconjugants of a virulent strain of Xcv and Agrobacterium-mediated transient expression. Since preliminary data suggested a possible involvement of AvrXv3 in transcription activation, the mutants and wild type proteins were assessed for their ability to activate transcription in yeast. The results suggest that AvrXv3 protein had transcription activation activity in yeast. Whether or not this activity is associated with the ability to elicit the HR in tomato was not determined conclusively. Modifications of the termini of this protein seemed to block secretion of the AvrXv3 protein into the host cell.
Summary: KEYWORDS: resistance, Xanthomonas, bacterial spot, avirulence
Thesis: Thesis (Ph. D.)--University of Florida, 1999.
Bibliography: Includes bibliographical references (p. 74-85).
System Details: System requirements: World Wide Web browser and PDF reader.
System Details: Mode of access: World Wide Web.
Statement of Responsibility: by Gustavo Astua-Monge.
General Note: Title from first page of PDF file.
General Note: Document formatted into pages; contains vii, 86 p.; also includes graphics.
General Note: Vita.
 Record Information
Bibliographic ID: UF00100672
Volume ID: VID00001
Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
Resource Identifier: oclc - 47680006
alephbibnum - 002456841
notis - AMG2172

Downloads

This item has the following downloads:

astua-monge_g ( PDF )


Table of Contents
    Title Page
        Page i
        Page ii
    Acknowledgement
        Page iii
        Page iv
        Page v
    Abstract
        Page vi
        Page vii
    Introduction
        Page 1
        Page 2
        Page 3
        Page 4
        Page 5
    Literature review
        Page 6
        Page 7
        Page 8
        Page 9
        Page 10
        Page 11
        Page 12
        Page 13
        Page 14
        Page 15
        Page 16
        Page 17
        Page 18
        Page 19
        Page 20
        Page 21
        Page 22
        Page 23
        Page 24
    Genomic localization of a single locus controlling resistance to Xanthomonas campestris pv. vesicatoria race T3 in tomato
        Page 25
        Page 26
        Page 27
        Page 28
        Page 29
        Page 30
        Page 31
        Page 32
        Page 33
        Page 34
        Page 35
        Page 36
        Page 37
        Page 38
        Page 39
    avrXv4: A new avirulence gene responsible for the hypersensitive reaction in the wild relative of tomato Lycopersicon pennellii
        Page 40
        Page 41
        Page 42
        Page 43
        Page 44
        Page 45
        Page 46
        Page 47
        Page 48
        Page 49
        Page 50
    Functional domains of avrXv3 and its role in eliciting the hypersensitive reaction in tomato (Lycopersicon esculentum L.)
        Page 51
        Page 52
        Page 53
        Page 54
        Page 55
        Page 56
        Page 57
        Page 58
        Page 59
        Page 60
        Page 61
        Page 62
        Page 63
        Page 64
        Page 65
        Page 66
        Page 67
        Page 68
    Conclusions
        Page 69
        Page 70
        Page 71
    Appendix
        Page 72
        Page 73
    References
        Page 74
        Page 75
        Page 76
        Page 77
        Page 78
        Page 79
        Page 80
        Page 81
        Page 82
        Page 83
        Page 84
        Page 85
    Biographical sketch
        Page 86
Full Text







GENETIC CHARACTERIZATION OF PLANT-PATHOGEN INTERACTIONS
BETWEEN Xanthomonas campestris pv. vesicatoria
AND TOMATO (Lycopersicon esculentum L.)


















By
GUSTAVO ASTUA-MONGE
















A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE
UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE
REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY

UNIVERSITY OF FLORIDA


1999


























To my wonderful wife Juliana
and my families in Costa Rica
and Brazil















ACKNOWLEDGMENTS

I would like to express my sincere gratitude and appreciation to Dr. Jeffrey B. Jones,

chairman of the supervisory committee, Dr. Robert E. Stall, former chairman of the

supervisory committee, and co-chair Dr. Michael J. Davis, for their constant support and

guidance during the course of this program. I would also like to extend my gratitude to

Dr. Harold C. Kistler, Dr. Ernest Hiebert, and Dr. Eduardo Vallejos, who served on the

supervisory committee, for their support and suggestions. Special thanks are given to

Gerald Minsavage for his invaluable technical assistance and friendship.

I wish to thank Dr. Michael J. Davis and the Tropical Research and Education Center

in Homestead which have granted the scholarship for part of this graduate program, and

the Universidad de Costa Rica which gave permission for this study leave.

Finally, I would like to thank my wonderful wife Juliana Freitas-Astua, my families in

Costa Rica and Brazil, and my friends at the Plant Pathology Department for their

understanding, friendship, and support during the last three years.















TABLE OF CONTENTS

page
A CK N O W LED G M EN TS....................................... ............................ iii

A B STR A C T ......................................................................... ...... vi

CHAPTERS

1 INTRODUCTION .................................................... 1

2 LITERATURE REVIEW .............................................. 6

Diversity Among Plant-Pathogen Interactions...................... 7
Avirulence in Plant Pathogenic Bacteria.......................... 9
D disease Resistance G enes ..................................... ...... 16
Molecular Markers for Genetic Mapping............................ 22

3 GENOMIC LOCALIZATION OF A SINGLE LOCUS
CONTROLLING RESISTANCE TO Xanthomonas campestris
pv. vesicatoria RACE T3 IN TOMATO........................... 25

M materials and M ethods ........................................ ....... 26
R results ................................................... . ...... ...... 3 1
D discussion ............................................................. 37

4 avrXv4: A NEW AVIRULENCE GENE RESPONSIBLE FOR
THE HYPERSENSITIVE REACTION IN THE WILD
RELATIVE OF TOMATO Lycopersicon pennellii.................. 40

M materials and M ethods ............................................... 40
R results ................................................... . ...... ..... 43
D discussion ....................................................... ....... 49

5 FUNCTIONAL DOMAINS OF avrXv3 AND ITS ROLE IN
ELICITING THE HYPERSENSITIVE REACTION IN
TOMATO (Lycopersicon esculentum L.).............. ........... 51

M materials and M ethods ......................................... ....... 52











R results ........................................................... ....... 61
D discussion ........................................... ........... ....... 64

6 CON CLU SION S ............................................... ....... 69

APPENDIX .................................................................................... 72

REFERENCES ................................................................................ 74

BIOGRAPHICAL SKETCH............. .............. ................ ....... ........ 86














Abstract of Dissertation Presented to the Graduate School of the University of Florida in
Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy


GENETIC CHARACTERIZATION OF PLANT-PATHOGEN INTERACTIONS
BETWEEN Xanthomonas campestris pv. vesicatoria AND TOMATO
(Lycoperscon esculentum L.)

by

Gustavo Astua-Monge


May 1999


Chairman: Jeffrey B. Jones
Cochairman: Michael J. Davis
Major Department: Plant Pathology

Bacterial spot caused by Xanthomonas campestris pv. vesicatoria (Xcv) is one of the

most important diseases of tomato (Lycopersicon esculentum). A new source of resistance

to tomato race 3 of this pathogen was found in the wild species L. pennellii. Genetic seg-

regation of the resistance was determined with an F2 progeny of 245 plants derived from a

cross between the tomato line L. esculentum Hawaii 7998, susceptible to this race, and the

resistant parent L. pennellii LA716. Monogenic segregation of this resistance was con-

firmed by a goodness of fit test (Z231= 2.287; P=0.13). A collection of 50 L. pennellii-

chromosome segment introgression, that covered the whole genome, were screened by

inoculation with Xcv tomato race 3 in order to identify the genomic localization of the R

gene. The resistance gene (Xv4) was located on chromosome 3. Linkage analysis of the

vi











resistance with neighboring RFLP and CAPS markers indicated the following gene order:

TG599- 9.3 cM- Xv4- 11.1 cM- TG134. The resistance gene Xv4 maps to an approximate

22 cM interval defined on the centromeric side by the RFLP markers TG599 at 9.3 cM

and on the telomeric side by TG134 at 11.1 cM. The role and characterization of the cor-

responding avirulence gene, avrXv4, are also discussed.

A different gene-for-gene system (avrXv3-Xv3) controlling the resistance to this

pathogen in tomato was previously described. In order to elucidate the possible role of

avrXv3 in eliciting the hypersensitive reaction (HR) on Xv3 genotypes, a collection of

mutated avrXv3 were generated by PCR-mediated deletion mutagenesis of putative do-

mains inferred from the hydrophobicity analysis of the predicted protein, and the modifi-

cation of the termini of the protein by the addition of 6 histidine residues. All constructs

were screened for their ability to elicit HR using transconjugants of a virulent strain of Xcv

and Agrobacterium-mediated transient expression. Since preliminary data suggested a

possible involvement of AvrXv3 in transcription activation, the mutants and wild type

proteins were assessed for their ability to activate transcription in yeast. The results sug-

gest that AvrXv3 protein had transcription activation activity in yeast. Whether or not this

activity is associated with the ability to elicit the HR in tomato was not determined conclu-

sively. Modifications of the termini of this protein seemed to block secretion of the

AvrXv3 protein into the host cell.















CHAPTER 1
INTRODUCTION


Vegetable production is one of the most important and profitable agricultural

activities in the state of Florida. Among those vegetables produced, tomato (Lycopersicon

esculentum L.) provides the highest revenue to the state. According to the Florida

Agricultural Statistics, the total value of tomato production during the 1994-95 season

was about $461,369 million with approximately 49,000 acres harvested.

Tomato is the target of many infectious diseases that cause severe yield losses.

Among them, bacterial spot of tomato, incited by Xanthomonas campestris pv.

vesicatoria (Xcv), is one of the most important diseases, especially when weather

conditions are suitable for its development (Pohronezny and Volin, 1983). This particular

disease also affects peppers (Capsicum spp.) and has been reported throughout the world

wherever tomatoes and peppers are grown (Stall, 1995a). Bacterial spot is primarily

characterized by the occurrence of greasy-appearing, water-soaked, circular lesions on

leaves, stems, and fruits. These lesions vary in size and shape, and normally develop into

necrotic spots. As a final consequence, leaf abscission in pepper plants or necrosis of

tomato leaflets may occur (Stall, 1995b).

Bacterial spot disease, which is very difficult to manage, causes reduced plant

growth, fruit yield, and quality (Sahin and Miller, 1996). Despite many efforts to control

this disease, not a single method has been completely effective. The efficacy of chemical









2

control with copper compounds and streptomycin has been marginal. The rise of resistant

strains of Xcv to both of these chemicals is also responsible for reduced control (Stall and

Thayer, 1962; Stall et al., 1986; Bender et al., 1990; Ritchie and Dittapongpitch, 1991;

Sahin and Miller, 1996). Thus, management of bacterial spot relies essentially on

exclusion of the disease by using pathogen-free seeds and seedlings, sanitation, and

resistant varieties (Sahin and Miller, 1996). The inability to control the disease with

cultural practices and/or antibacterial agents leaves resistance as one of the most

important alternatives for controlling this disease.

In the 1980's, a research team established a program to search for useful sources

of resistance in the hope of contributing in the fight against bacterial spot in Florida

(Scott and Jones, 1986). Early efforts to find high levels of resistance in tomato to Xcv

were unsuccessful. Instead, measurable levels of resistance or foliar tolerance were found

in almost all lines or PI accessions screened (Stall, 1995a). It was not until the discovery

of the tomato genotype Hawaii 7998 (H7998) that a high level of resistance to Florida

strains was identified (Jones and Scott, 1986). However, segregation analysis of F2

populations indicated that the inheritance of this resistance was somewhat complex, and

possibly determined by multiple genes (Jones and Scott, 1986; Wang et al., 1994). Yu et

al. (1995) identified three different genetic loci in H7998 that appeared to act

independently and to have an additive effect on this resistance.

With respect to the variability of the pathogen, three different groups have been

found among Xcv strains. The XcvT group includes strains that are pathogenic on

tomato, the XcvP group includes strains that are pathogenic on pepper, and the XcvTP









3

group includes strains that are pathogenic on both plant species (Minsavage et al., 1990).

Among XcvT strains, three races have been identified so far based on their reaction on

three tomato cultigens: H7998, H7981, and Bonny Best (Stall, 1995b; Jones et al.,

1998b). Thus, those strains that showed incompatibility only with H7998 were designated

as tomato race 1 (TI) (Wang et al., 1994). Strains that caused hypersensitive reaction

only on H7981 were designated as tomato race 3 (T3), while strains unable to elicit HR

on any of the three cultigens were designated as tomato race 2 (T2) (Wang et al., 1994;

Jones et al., 1995).

Stall et al. (1994) and Bouzar et al. (1994b) thoroughly characterized the three

races. As a result, TI strains were classified into X campestris pv. vesicatoria group A.

Strains in this group have a 32-35 kD protein band, and exhibit negative or weak

amylolytic and pectolytic activity (Bouzar et al., 1994a). On the other hand, T2 strains

are in X campestris pv. vesicatoria group B, have a 25-27 kD protein band, and exhibit

strong amylolytic and pectolytic activity (Bouzar et al., 1994a). A proposal has recently

been made to reclassify group A and B into different species, Xanthomonas axonopodis

pv. vesicatoria and Xanthomonas vesicatoria, respectively, on the basis of DNA-DNA

homology (Vauterin et al., 1995). Since this proposal has not been generally accepted by

the scientific community, the old nomenclature is used throughout this work.

In 1991, following an outbreak of bacterial spot in Florida, a new race capable of

overcoming the resistance in H7998 was found and characterized (Jones et al., 1995).

Despite its strong amylolytic and pectolytic activity characteristic of group B, T3 strains

are different from T2 strains in their ability to cause hypersensitive reaction in several









4

genotypes such as H7981 and two plant introductions of L. pimpinellifolium PI128216

and PI126932 (Jones et al., 1995; Scott et al., 1995; Jones et al., 1998b). In addition, T3

strains could be considered pathogenically and physiologically as group C differing from

group A and B strains. Although group C strains had unique DNA restriction profiles,

DNA:DNA hybridization data suggests that group C strains are related to group A strains,

and they might even be a subspecies of group A strains (Jones et al., 1998b). Perhaps the

most striking feature of this third race is its competitive nature in the presence of TI

strains. Jones et al. (1998a) found that T3 predominated over TI strains both in the field

and under controlled conditions. This enhanced fitness or aggressiveness shown by T3

strains might be associated with its antagonistic activity towards TI strains (Jones et al.,

1998a). Tudor-Nelson et al. (1995) determined that T3 strains produced more than one

bacteriocin-like substance active against TI strains in vitro.

The first report of a high level of resistance to Xcv race T3 came when Scott et al.

(1995) found resistance to T3 strains in L. pimpinellifolium PI 128216 and PI 126932,

and L. esculentum cultigen Hawaii 7981 (H7981). This resistance is inherited as a single

incompletely dominant gene (Xv3), and appears to be controlled by the same gene in all

three lines (Scott et al., 1995; Minsavage et al., 1996).

The primary objective of this work was to study and characterize certain aspects

involved in plant-pathogen interactions between Xcv race T3 and tomato that lead to the

elicitation of the hypersensitive reaction and consequently confer resistance to the host.

The scope of this work included examining different sources of resistance to Xcv in

tomato, attempting to identify the genomic locations) of the novel gene(s) responsible









5

for controlling resistance to Xcv race T3, and the analysis of the AvrXv3 protein in order

to identify domains involved in HR and pathogen recognition.















CHAPTER 2
LITERATURE REVIEW


Evolution has provided plant pathogens with a significant number of mechanisms to

enhance their pathogenic potential and to ensure their survival. Likewise, plants have

developed an equally diverse set of countermeasures to avoid their own demise.

Throughout time, this co-evolution between host and pathogen has given form to what is

defined today as plant-pathogen interactions.

Since the early stages of plant pathology, natural resistance to plant pathogens has

been considered a desirable trait for selection of crop plants. The first attempts to study

resistance in plants focused on finding new sources of resistance throughout the world.

Those findings were then used to establish breeding programs in order to introduce

resistance into commercial varieties. Recently, the focus of this type of research has been

partially shifted towards the exploration of the molecular basis of resistance, and

ultimately to the improvement of the ability to genetically engineer durable resistance

into commercial crops. Perhaps the first scientist to begin this exploration was H.H. Flor.

who, in the 1940's, proposed the gene-for-gene model to explain the inheritance of plant

disease resistance and pathogen virulence (Flor, 1971). Since then, a great deal of

knowledge on the mechanisms controlling plant disease resistance has been accumulated.

The purpose of this review is to summarize the most relevant information regarding plant

disease resistance and the role of bacterial plant pathogens in eliciting such responses.











Diversity Among Plant-Pathogen Interactions

In order to understand the underlying mechanisms involved in plant disease

resistance, it is important to understand the level of diversity that prevails in the world of

plant-pathogen interactions. Although plant pathogenic microbes are a relatively small

group of organisms in the context of nature's diversity, this singular group exhibits a

great deal of variation when it comes to the type of interaction that they have with their

hosts. For instance, some plant pathogenic microbes have evolved diverse mechanisms to

colonize and kill plant tissue in order to survive. These so-called necrotrophic organisms

normally do so by attacking with enzymes or toxins that weaken and kill host cells. In

contrast, other groups such as biotrophs and hemibiotrophs evolved different strategies to

keep their host cells alive while they grow and reproduce (Hammond-Kosack and Jones,

1997).

Host plants have also evolved a variety of responses to pathogen attack. Thus, plants

with constitutive resistance may have one or more preformed barriers that passively

prevent pathogens from causing disease (Osbourn, 1996). As opposed to these preformed

barriers, other plants need the presence of the pathogen in order to trigger the resistance

response. In most cases, this response seems to be displayed by particular genotypes of

the host towards particular races of the pathogen (host-specific resistance). Well-known

examples of these active mechanisms are the systemic acquired resistance (SAR) and the

hypersensitive response (HR) (Yang et al., 1997).

On the other hand, the concept of constitutive susceptibility has also been proposed

to explain the interaction between pathogens that produce host-specific toxins and their









8

hosts. In this particular case, susceptibility factors seem to be preformed (toxin receptors)

while resistance relies only on the absence of those factors (recessive trait) (Yoder,

1980).

Regarding the genetic basis of compatibility in plant-pathogen interactions, two well

understood scenarios could be expected. First of all, toxin-dependent compatibility

encompasses those interactions where pathogenicity is a dominant trait in the pathogen

(toxin production) while susceptibility is recessive in the host (detoxification factor

absent) (Hammond-Kosack and Jones, 1997). Host plants expressing toxin-insensitive

targets display a variation of this interaction. In this case, resistance is also a recessive

trait (Levings et al., 1995). Finally, the second type of compatibility system involves two

dominant traits. In the gene-for-gene system, an interaction occurs between a pathogen

expressing an avirulence gene product and a host expressing the appropriate resistance

gene product. As a result, this interaction will lead to cell death and a limited spreading of

the pathogen (Bent, 1996).

More recently, the exploration of the molecular basis of the resistance-avirulence

incompatibility system has led scientists to follow two basic research avenues. These are

the identification and cloning of avirulence (avr) and resistance (R) genes, and the

characterization of cellular responses after recognition of the pathogen. These two lines

of research have contributed significantly to the understanding of the possible

interactions involved between plant pathogens and their host, and have also helped

scientists to start putting together the pieces of this puzzle.











Avirulence in Plant Pathogenic Bacteria

When Flor proposed the gene-for-gene hypothesis, the existence of avr genes in

bacteria was only suggested by the specific interactions observed between pathogen

strains and their hosts. However, since the advent of molecular biology, more than 30 avr

genes from bacteria have been cloned and characterized (Leach and White, 1996). The

first of them was avrA, cloned from the race 6 of the soybean pathogen Pseudomonas

syringae pv. glycinea (Staskawicz et al., 1984).

Early observations on the specificity of the interaction between avr genes and host

resistance genes suggested the existence of at least two groups of avr genes (Leach and

White, 1996). The first group included those gene products involved only in race-specific

interactions. Thus, for instance, when avrA is transferred to other races of Pseudomonas

syringae pv. glycinea, it confers the ability to elicit HR on soybean cultivars with the

Rpg2 gene for resistance (Staskawicz et al., 1984). A second group of avr genes referred

to as heterologous genes exhibited a broader range of interactions. These genes are able

to confer the ability to elicit HR in a host-specific manner when transferred to other

pathovars that have a different host range. So far, about ten of these genes have been

identified and characterized (Leach and White, 1996).

The structural organization and location of avr genes are also variable. The vast

majority is monocistronic, that is, one single open reading frame (ORF) is responsible for

their activity. However, avirulence activity of other genes such as avrE and avrPphD has

been shown to require two ORF's (Wood et al., 1994; Lorang and Keen, 1995).









10

Avirulence genes can be either plasmid-borne or chromosomal (Minsavage et al.,

1990; Leach and White, 1996). Leach and White (1996) suggested that this variability

might indicate a possible association between the mobility of avr genes and the

introduction of genetic variation in the evolution of host-pathogen interactions. For

example, the sequence and location of avrB represents a very particular case since

sequence analysis suggested that this avr gene does not reflect the GC content of

individuals belonging to the P. syringae group. Therefore, it has been suggested that avrB

is probably derived from outside this group of bacteria (Tamaki et al., 1988). More

recently, Kim et al. (1998) reported that avrA, avrB, avrC, avrPphC, avrRpml, and

avrPpiA] are bordered by sequences similar to those of transposable elements of Gram-

negative bacteria, while avrPto was found to be associated with a DNA region

homologous to a bacteriophage sequence. They also suggested that the association of

avirulence genes with transposable elements and bacteriophage sequences, along with the

presence of several of these genes on plasmids, supports the idea of horizontal transfer

and frequent exchange of avirulence genes among bacterial pathogens (Kim et al., 1998).

Along the same line, avrD homologues have been found widely distributed among

Pseudomonads and the soft rot bacteria, Erwinia carotovora (Hanekamp et al., 1997).

Hanekamp et al. (1997) also found that DNA linked to avrD showed evidence of class II

transpositions and contained a novel IS3-related insertion sequence. Besides, short

sequences linked to avrD were similar to pathogenicity genes from a variety of unrelated

pathogens. These data led them to conclude that this avr gene must have a conserved









11

function beyond virulence, and that it may have been transferred horizontally among

species (Hanekamp et al., 1997).

Even though avr predicted products do not exhibit any similarity to known

functional domains, sequence similarities among avr genes and among heterologous

genes have been noted at both the protein and DNA level. Among them, avrB and avrC

are known to have 42% of amino acid sequence identity (Tamaki et al., 1991), while

avrBs] and avrA have been shown to share about 47% of their sequence at the carboxy-

terminal region (Ronald and Staskawicz, 1988). Perhaps the most striking case is that of

avrRxv which shows a remarkable similarity to yopJ gene from Yersinia

pseudotuberculosis (Leach and White, 1996).

Despite the few cases of similarity found among avr genes, one group seems to have

recently emerged. The avrBs3 family of avr genes represents a unique case within this

particular group. The type member of this family is the avrBs3 gene, first isolated from

Xanthomonas campestris pv. vesicatoria race PI (Bonas et al., 1989). Since then, many

other members of this gene family have been found to be limited to several pathovars of

the genus Xanthomonas. Among them, avrBs3-2 was cloned from X campestris pv.

vesicatoria (Bonas et al., 1993), pthA from X citri (Swamp et al., 1992), avrXalO from

X oryzae pv. oryzae (Hopkins et al., 1992), and avrB4, avrb7, avrBIn, avrB102, and

avrB6 from X campestris pv. malvacearum (De Feyter et al., 1993; Yang et al., 1994;

Yang et al., 1996). All members of this gene family exhibit 90 to 97% amino acid

sequence identity, and multiple copies of related homologues have also been found

within the same pathovars; however, not all copies appeared to have avirulence activity









12

(Leach and White, 1996). Another common feature is that all members have a common

central domain composed of a series of directly repeated sequences of about 102 bp (34

aa) (Bonas et al., 1989; Canteros et al., 1991; Hopkins et al., 1992; Swamp et al., 1992;

Bonas et al., 1993; De Feyter et al., 1993). The number of copies of these repeated

sequences generally varies among members of the family from 13.5 to 17.5, and is

thought to be involved in avr gene specificity (Bonas and Van den Ackerveken, 1997).

Despite the conserved nature of this domain, differences in sequence can occur within

this region, but they normally are concentrated within a variable two-codon region

(Leach and White, 1996).

The function of avr gene products has always been one of the most puzzling aspects

of this subject. With the exception of avrD, avrBs2, and avrXalO, no tangible evidence

exists to reveal the exact function of the remaining avr genes in the context of plant-

pathogen interactions. Yucel et al. (1994) determined that the avrD gene cloned from P.

syringae pv. tomato conferred avirulence to P. syringae pv. glycinea by enzymatically

directing the production of several secondary metabolic compounds. These compounds,

called syringolides, are responsible for eliciting a hypersensitive reaction (HR) in

soybean plants carrying the Rpg4 disease resistance gene. Similarly, Swords et al. (1996)

suggested that avrBs2 may have enzymatic function due to its similarity with

Agrobacterium tumefaciens agrocinopine synthase. Kearney and Staskawicz (1990)

indicated that avrBs2 had a dual role, delivering the avirulence signal and promoting

pathogen virulence. In contrast, the highly acidic carboxy-terminal domain of the protein









13

encoded by avrXalO has been found to have transcription activation activity (Zhu et al.,

1998).

Although conclusive data regarding the function of avr gene products is not

available, several characteristics of these proteins and the mechanism involved in

triggering HR could be used to formulate plausible hypothesis to explain the function of

avr-encoded proteins. First of all, the majority of Avr proteins are hydrophilic in nature

and lack signal peptide sequences that could indicate secretion. Secondly, none of the

proteins encoded by bacterial avr genes induced hypersensitive reaction (HR) when

injected in the intercellular space of leaves of plants with the complementary R genes

(Alfano and Collmer, 1996; Leach and White, 1996). Finally, the involvement of avr

products in activities other than avirulence, such as pathogen fitness, has also been

demonstrated by Ritter and Dangl (1995) and Swords et al. (1996), who showed that

mutations of avrRpml and avrBs2 affected fitness of P. syringae pv. maculicola and X

campestris pv. vesicatoria, respectively. As a result, the first possible scenario may

involve avr gene products limited to the bacterial cytoplasm as opposed to being

membrane-bound or secreted proteins. Consequently, these proteins may have an indirect

function in eliciting HR ruling out a possible recognition of Avr proteins in the plant

intercellular spaces (Leach and White, 1996; Bonas and Van den Ackerveken, 1997).

Secondly, a novel secretion system may enable the transport of these proteins without the

requirement of signal peptide sequences.

Although the exact function of avr gene products is unknown, the highly specific

avr-R gene interaction suggests some type of cellular recognition by resistant plants. This









14

receptor-ligand interaction model might explain how the defense-signaling pathway is

activated after recognition of the pathogen. An argument against this model suggested

that if the function of avr genes is only associated with recognition, the lack of selective

advantage of such model could be enough for bacterial evolution to eliminate such genes

(Bonas and Van den Ackerveken, 1997). However, recent reports have indicated that

Agrobacterium-mediated transient expression of several avr genes as well as their

permanent expression in transgenic plants were enough to cause the elicitation of HR in

resistant plants. These findings support the receptor-ligand model, and suggest that the

presence of the Avr proteins inside the host cells may be required for the elicitation of the

HR (Gopalan et al., 1996; Leister et al., 1996; Scofield et al., 1996; Tang et al., 1996;

Van den Ackerveken et al., 1996; Bonas and Van den Ackerveken, 1997; Parker and

Coleman, 1997; De Feyter et al., 1998). As a result of these observations, it is thought

that a conserved bacterial delivery system capable of introducing Avr proteins into plant

cells must exist among plant pathogenic bacteria.

Early studies on virulence mechanisms of important Gram-negative mammalian

pathogens confirmed the existence of a novel secretion system now known as type III

protein secretion pathway (Hueck, 1998). Proteins secreted using this mechanism lack

both the cleavable N-terminal signal peptide characteristic of sec-dependent secretion

pathways (type II and type IV), and the C-terminal signal peptide associated to proteins

secreted by the sec-independent type I pathway (Hueck, 1998). Instead, it is thought that

at least some type III-secreted proteins possess the secretion signal in the 5' region of the

mRNA, which encodes the secreted protein (Anderson and Schneewind, 1997).









15

Pathogens such as Yersinia spp., Salmonella typhimurium, Escherichia coli, .\/nge//t

flexneri, Pseudomonas aeruginosa, and Clamidia spp. exhibit a specialized cluster of

genes involved in assembling the type III secretion system (Hueck, 1998). Early work on

avirulence and pathogenicity of bacterial plant pathogens led scientists to the discovery of

a cluster of genes, known as hypersensitivity and pathogenicity genes (hrp), involved

somehow in regulating both susceptible and incompatible interactions (Bonas, 1994).

Sequence similarity of at least nine hrp genes with components of the type III secretion

pathway described in mammalian pathogens first indicated the possibility that hrp genes

could be involved in the secretion of a broad range of virulence factors, elicitors, and

perhaps even Avr proteins. These conserved hrp genes are now called hrc genes.

Furthermore, the lack of distinctive signal peptides in Avr proteins and their critical

dependence on hrp activity are important evidences to support such hypothesis

(Bogdanove et al., 1996; Baker et al., 1997; Bonas and Van den Ackerveken, 1997). The

secretion of only non-specific elicitors such as PopA from Ralstonia solanacearum (Arlat

et al., 1994), and harpins from Pseudomonas (He et al., 1993) and Erwinia (Wei et al.,

1992; Bauer et al., 1995) has been confirmed to be mediated by Hrp proteins. Likewise, a

type III secretion system associated with cultivar-specific nodulation has also been

reported in Rhizobium spp. (Hueck, 1998).

Regarding Avr proteins, Bonas and Van den Ackerveken (1997) suggested that cell-

to-cell contact between the bacterium and the host might be required to secrete these

proteins directly into the host cell. This hypothesis is based on the fact that upon cell

contact utilizing the type III secretion pathway, Yersinia is able to secrete several Yop









16

proteins into the host cell (Bonas and Van den Ackerveken, 1997). Evidence for hrp-

dependent secretion of Avr proteins has recently been presented for avrB and avrPto

(Hyun-Han et al., 1998). When the hrp cluster from the host-promiscuous E.

c/i hl)%,i/hemin was introduced into the non-plant pathogenic bacterium Escherichia coli, it

allowed E. coli to secret AvrB and AvrPto in culture, and induced hypersensitive reaction

in inoculated plants carrying the appropriate resistance gene (Hyun-Han et al., 1998).

Disease Resistance Genes

Vertical or monogenic resistance follows a gene-for-gene interaction as originally

demonstrated by Flor (1971). Incompatibility between the host and the pathogen is the

result of the interaction between a dominant resistance gene (R) in the plant and a

dominant avirulence gene in the pathogen. The activation of several signal transduction

pathways, and the initiation of the hypersensitive reaction characterize the initial

recognition event. The hypersensitive reaction occurs following a rapid oxidative burst

and localized cell death. Activation of the antioxidant defense mechanisms in the cells

surrounding the developing lesion characterizes this defense response (Lamb and Dixon,

1997). The neighboring cells surrounding the lesion could also synthesize anti-microbial

phytoalexins, several pathogenesis-related proteins (PR), and cell wall fortifications

(Dixon, 1986; Bowles, 1990; Dixon and Lamb, 1990).

The nature of the R-avr gene interactions has led scientists to predict several

properties that resistance gene products may exhibit. First, it is thought that R proteins

could be expressed in healthy unchallenged plants in preparation for the attack. Secondly,

they may be able to recognize avr-gene-dependent ligands. The third feature of R









17

proteins implies a rapid evolution of specificity to cope with the fast changing pathogens

(Hammond-Kosack and Jones, 1997).

So far, 14 genes involved in conferring resistance in different plant species have

been cloned and characterized. Five genes (i.e., N gene from tobacco, L6 and M genes

from flax, Cf-9 from tomato, and Hml from maize) were cloned using transposon

tagging, whereas 8 genes (i.e., RPS2 and RPM1 from Arabidopsis, Xa21 from rice, 12C,

Pto, Cf-4, Cf-5, and Cf-2 from tomato) were cloned by map-based or positional cloning

(Johal and Briggs, 1992; Martin et al., 1993; Bent et al., 1994; Jones et al., 1994; Dinesh-

Kumar et al., 1995; Lawrence et al., 1995; Song et al., 1995; Dixon et al., 1996;

Anderson et al., 1997; Ori et al., 1997; Thomas et al., 1997).

Plant disease resistance genes can be grouped into five distinct classes on the basis of

their predicted structural motifs and their possible location in the plant cell (Hammond-

Kosack and Jones, 1997). The first of these classes is involved with detoxification of

plant pathogenic toxins and includes a single gene isolated from maize that confers

resistance to Race 1 strains of Cochliobolus carbonum (Johal and Briggs, 1992). The

function of this particular gene, known as Hml, is independent from the presence or

absence of any pathogen avr gene product, and it encodes a NADPH-dependent

detoxifying enzyme known as HC-toxin reductase (Johal and Briggs, 1992; Bent, 1996).

The second class of R genes includes proteins associated with the cytoplasmic

membrane and may be involved in signal transduction. It has a unique member cloned

from tomato and designated Pto due to its specific interaction with avrPto from

Pseudomonas syringae pv. tomato (Martin et al., 1993). Sequence analysis of this gene









18

suggests that it encodes a serine/threonine kinase capable of autophosphorylation (Loh

and Martin, 1995). This motif may be involved in signal transduction; however, no other

motifs with recognition capabilities such as leucine rich repeats (LRR) or nucleotide

binding sites (NBS) were found in its sequence. Nevertheless, direct interaction between

Pto and AvrPto was later confirmed by using the yeast 2-hybrid system (Tang et al.,

1996; Hammond-Kosack and Jones, 1997). More recently, two more genes were found

forming a clustered family of genes along with Pto. First of all, the fen gene is known to

confer sensitivity to the insecticide fenthion and seems to encode another serine/threonine

kinase exhibiting 80% identity to the Pto protein (Martin et al., 1994). Despite this

similarity, Fen has been confirmed to be unable to interact with the avrPto-encoded

protein, and consequently incapable of eliciting the resistance response (Tang et al.,

1996; Hammond-Kosack and Jones, 1997). The second of these genes, Prf is located

about 24 kb from Pto and encodes a large protein with a leucine zipper (LZ), a NBS, and

LRR of the 23-amino acid type (Salmeron et al., 1994). Mutations in the Prf gene

rendered tomato plants susceptible to P. syringae pv. tomato carrying the avrPto and

insensitive to fenthion (Martin et al., 1994). Hammond-Kosack and Jones (1997)

hypothesized that due to the fact that both Pto and Prf are required for resistance, LRR-

containing proteins and kinases could be components of the same signaling pathway.

More recently, Oldroyd and Staskawicz (1998) demonstrated that overexpression of Prf

in tomato plants led to enhanced resistance to several normally virulent bacterial and viral

pathogens, and an increased sensitivity to fenthion. They also noted that the constitutive

levels of salicylic acid and pathogenesis-related proteins in these transgenic plants were









19

comparable to those in plants induced for systemic acquired resistance (SAR). Therefore,

overexpression of Prf could be used to activate SAR in a pathogen-independent manner

leading to enhance broad-spectrum resistance (Oldroyd and Staskawicz, 1998). Finally,

using Pto as a bait in an interaction hunt with the yeast 2-hybrid system, one more gene

encoding a serine/threonine protein kinase was found to be a substrate of phosphorylation

by Pto and autophosphorylation (Zhou et al., 1997). This gene, named Ptil, is thought to

be part of the kinase cascade specific for Pto-AvrPto signaling (Bent, 1996). Since then,

other Pto-interacting proteins known as Pti4, Pti5, and Pti6 have been identified (Bent,

1996). These proteins exhibit a remarkable similarity to ethylene-responsive element

binding proteins from tobacco, which function as transcription factors and bind PR-box

DNA sequences located within the promoter region of many pathogenesis-related (PR)

proteins. Experimental evidence supporting the binding to PR-boxes has been obtained

only for Pti5 and Pti6 (Bent, 1996).

The third class includes those R genes predicted to encode cytoplasmic proteins

(Hammond-Kosack and Jones, 1997). Seven resistance genes have been included in this

class so far. Among them, RPS2 and RPM1 were isolated from Arabidopsis thaliana and

confer resistance to different strains of P. syringae carrying avrRpt2, and avrB or

avrRpml, respectively (Bent et al., 1994; Mindrinos et al., 1994; Grant et al., 1995).

RPP5, cloned from Arabidopsis, belongs to this class and confers resistance to

Peronospora parasitica (Hammond-Kosack and Jones, 1997). In addition, several other

R genes (e.g., N gene in tobacco that confers resistance to tobacco mosaic virus, the M

and L6 genes from flax that confer resistance to the rust fungus Melampsora lini, and the









20

ISC family of genes involved in conferring resistance to Fusarium oxysporum f.sp.

lycopersici in tomato) have also been included in this class (Whitham et al., 1994;

Lawrence et al., 1995; Anderson et al., 1997; Ori et al., 1997). All members of this class

exhibit at least three conserved motifs relating to structural organization. Thus, a NBS

region is found at their amino termini, LRR at the carboxyl termini, and an internal

hydrophobic domain (Bent et al., 1994; Mindrinos et al., 1994; Grant et al., 1995;

Hammond-Kosack and Jones, 1997). In addition, two sub-groups can be made within this

class on the basis of the presence of a variable motif immediately upstream of the NBS

(Hammond-Kosack and Jones, 1997). The I2C family, RPS2, and RPM have a LZ

whereas M, L6, N, and RPP5 exhibit an amino terminal TIR (Toll/Interleukin-1

resistance) domain with homology to the cytoplasmic domain of Drosophila Toll protein

and the mammalian interleukin-1 receptor (IL-R) protein (Anderson et al., 1997;

Hammond-Kosack and Jones, 1997; Ori et al., 1997). In Arabidopsis, mutational analysis

has revealed the existence of at least two loci involved in regulating race-specific disease

resistance (Century et al., 1995; Glazebrook et al., 1996; Parker et al., 1996). Aarts et al.

(1998) have presented evidence for the existence of two distinct signaling pathways

based on the differential requirements for EDS1 (enhance disease susceptibility) and

NDR1 (nonrace-specific disease resistance) by several resistance genes. Thus, RPP2,

RRP4, RPP5, RPP21, and RPS4 conferring resistance to P. parasitica and Pseudomonas

spp. carrying the avrRps4 gene are only dependent on EDS1, while RPS2, RPM1, and

RPS5 rely uniquely on NDR1 (Aarts et al., 1998).









21

The fourth class of R genes encodes proteins associated with the cytoplasmic

membrane and comprises four resistance genes isolated from tomato that specify

resistance towards different isolates of Cladosporiumfulvum, causal agent of leaf mold of

tomato (Hammond-Kosack and Jones, 1997). These gene products, designated Cf-2, Cf-

4, Cf-5, and Cf-9, are characterized by the presence of an extra-cytoplasmic LRR, a

single membrane spanning region, and a short cytoplasmic carboxyl terminus (Jones et

al., 1994; Dixon et al., 1996; Hammond-Kosack and Jones, 1997; Thomas et al., 1997).

The proteins encoded by these genes seem to belong to the same family of proteins since

they all share a similar overall structure (Hammond-Kosack and Jones, 1997).

Finally, the last class includes a single member, Xa21, isolated from rice. The gene

confers resistance to over 30 strains of Xanthomonas oryzae pv. oryzae, causal agent of

the leaf blight disease of rice (Song et al., 1995). Sequence analysis of the predicted

protein indicated the presence of a putative signal peptide, an extracytoplasmic LRR with

several glycosylation sites, a single membrane spanning domain, and a cytoplasmic

serine/threonine kinase domain (Song et al., 1995).

The presence of common structural features among R genes with different specificity

suggests the existence of a conserved pathway used by plants to trigger defense responses

(Bent, 1996). Thus, while LRR, LZ, and TIR domains may be involved in protein-protein

interactions and/or pathogen recognition, serine/threonine kinase domains could be

directly involved in signal transduction (Bent, 1996; Hammond-Kosack and Jones, 1997).

For those R genes without kinase activity, the presence of NBS domains suggest that they









22

could activate other kinases or G-proteins, which in turn could initiate the downstream

signaling (Hammond-Kosack and Jones, 1997).

Molecular Markers for Genetic Mapping

The characterization of genes involved in conferring disease resistance in plants is

often accomplished by using molecular markers (Tanksley et al., 1995). Several different

techniques have been used to generate molecular markers in order to locate resistance

genes in plant genomes.

RFLP (restriction fragment length polymorphism) markers were perhaps one of the

first types of molecular markers developed for analysis of genomes from different

organisms. Their use is based on the principle that polymorphism in restriction fragment

lengths between two individuals could be detected on DNA blots using labeled probes

that hybridize to a single target sequence in the genome (Bolstein et al., 1980). Although

this technique has been used in a variety of situations, the major applications of RFLP's

have been for the selection of markers for mapping and the analysis of genetic diversity

in populations. RFLP markers are co-dominant, allowing the detection and

characterization of multiple alleles at a given RFLP locus among individuals in a

population. Several types of polymorphism can be detected, including single base

substitutions, insertions, and deletions (Rafalski et al., 1996). Later on, the advent of the

polymerase chain reaction (PCR) opened the possibility of merging this powerful

technique with traditional RFLP analysis. Thus, by sequencing the termini of RFLP

probes and designing specific primers for PCR, dominant or co-dominant markers known









23

as cleaved amplified polymorphic sequence (CAPS) markers could be obtained

(Konieczny and Ausubel, 1993).

The random amplified polymorphic DNA (RAPD) technique is based on the use of

single, short, synthetic oligonucleotide primers of arbitrary sequence for the amplification

of randomly distributed segments of genomic DNA (Welsh and McClelland, 1990;

Willians et al., 1990). The resulting polymorphic profiles are a consequence of mutations

or rearrangements at the oligonucleotide primer binding sites in the genome. The

presence or absence of one or more amplification products can distinguish differences

between individuals. This technique has been used extensively for fingerprinting and

DNA mapping (Rafalski et al., 1996). Sequence characterized amplified regions (SCAR)

are PCR-based markers obtained when single bands from RAPD profiles are cloned,

sequenced, and specific PCR primers are designed for their amplification (Paran and

Michelmore, 1993).

Simple sequence repeat regions (SSR) or microsatellite repeats are stretches of

tandemly repeated mono-, di-, tri-, tetra-, penta-, or hexanucleotide motifs. They are

widely used as molecular markers due to their length variation, their abundance, and their

random distribution throughout eukaryotic genomes. Polymorphism is obtained by

amplifications of individual SSR loci using specific primers for a unique flanking DNA

sequence. Since the number of tandem repeats varies from one SSR locus to another,

amplified SSR loci show high levels of polymorphism (Rafalski et al., 1996).

AFLP (amplified fragment length polymorphism) markers have been developed on

the basis of the selective amplification of restriction fragments from total digested









24

genomic DNA (Vos et al., 1995). The suitability of the AFLP technique to identify

markers relies on the fact that most AFLP fragments correspond to unique positions on

the genome, so they can be exploited as landmarks in genetic and physical maps. AFLP-

based methods have been used in constructing high density maps of genomes or genome

parts, detecting corresponding genomic clones in libraries, and fingerprinting of cloned

DNA segments like cosmids, P1 clones, bacterial artificial chromosomes (BAC), or yeast

artificial chromosomes (YAC) (Vos et al., 1995).

A different approach that has been recently used to generate DNA-based markers for

mapping purposes is called DAF or DNA amplification fingerprints (Prabhu and

Gresshoff, 1994; Jiang and Gresshoff, 1997). It was originally developed to create

fingerprints from PCR products and whole genomes, to establish genetic relationships

between plant taxa at the interspecific and intraspecific level, and to identify closely

related fungal isolates and plant species (Caetano-Anolles et al., 1991). This technique is

based on the use of short arbitrary oligonucleotide primers to generate amplification

products that are separated on polyacrylamide gels and then stained with silver (Caetano-

Anolles and Gresshoff, 1996).















CHAPTER 3
GENOMIC LOCALIZATION OF A SINGLE LOCUS CONTROLLING
RESISTANCE TO Xanthomonas campestris pv. vesicatoria RACE T3 IN TOMATO


Two sources of resistance to Xanthomonas campestris pv. vesicatoria (Xcv) have

been reported previously, one each to races TI and T3 (Jones and Scott, 1986; Scott et

al., 1995). More recently, analysis of a F2 progeny from the cross between the

Lycopersicon esculentun cultigen H7981 (Xv3), resistant to T3 strains, and the wild

relative L. pennellii indicated the presence of a novel resistance gene against T3 strains in

the latter genotype (Astua-Monge and Stall, unpublished data).

In tomato, DNA-based markers have been extensively used to characterize the

inheritance and genomic localization of several resistance genes (Martin et al., 1993;

Jones et al., 1994; Yu et al., 1995; Dixon et al., 1996; Anderson et al., 1997; Ori et al.,

1997; Thomas et al., 1997; Moreau et al., 1998). In addition, the existence of a saturated

linkage map of tomato (Tanksley et al., 1992) and the availability of introgression lines

between L. esculentum and L. pennellii (Eshed and Zamir, 1994) make it possible to

genetically characterize possible sources of resistance from wild relatives.

The main objective of this research was to characterize the novel source of resistance

to Xcv race T3 in tomato derived from its wild relative Lycopersicon pennellii. The

genomic localization of the gene responsible for conferring this resistance was also









26

attempted by using CAPS and RFLP markers to analyze a collection of introgression

lines between L. esculentum and L. pennellii.



Materials and Methods

Bacterial Strains and Growth Conditions

Bacterial strains used in this study are listed in the Appendix. Strains of Xcv were

grown overnight at 28 C on nutrient agar plates (Becton Dickinson, Cockesysville, MD)

or in nutrient broth for plant inoculations. Escherichia coli strains were grown overnight

at 37 C on Luria-Bertani (LB) medium (Maniatis et al., 1982). All bacterial strains were

stored at room temperature in sterile tap water or at -70 C in nutrient broth containing

30% glycerol.

Plant Material, Inoculum Production, and Plant Inoculations

FI and F2 populations, provided by Robert E. Stall, University of Florida, were

derived from an interspecific cross between Lycopersicon pennellii LA 716 and

Lycopersicon esculentum accession Hawaii 7998, a susceptible tomato cultigen. Roger

Chetelat (Curator, Tomato Genetics Resource Center) kindly provided the population of

50 introgression lines generated as described by Eshed and Zamir (1994).

Xanthomonas strains used for inoculations were grown in nutrient broth for 20 h at

28 C with shaking. Bacterial cells were pelleted by centrifugation at 1500 g for 15 min,

and resuspended in sterile tap water. The concentration was adjusted to an A600 = 0.3 with

a spectrophotometer (Spectronic 20, Baush & Lomb, Inc.). This reading represents

approximately 2-5 x 108 colony forming units (cfu)/ml. Leaves were infiltrated with the









27

bacterial suspension as described by Hibberd et al. (1987). When whole plants were

inoculated, the bacterial suspension was prepared as described above, but diluted to 106

cfu/ml in a solution containing 250 [tg/ml of Silwet L77 (Osi Specialties Inc., Danbury,

CT), an organosilicon surfactant. Inoculations were carried out by dipping the foliage for

15 s in the suspension. Each treatment was replicated three times and the experiment was

also repeated 3 times unless otherwise indicated.

Two hundred and forty-five F2 plants, their parental lines, and 50 introgression lines

were grown in the greenhouse for four to five weeks at temperatures ranging from 25 to

35 C. Inoculated plants were moved to a growth room kept at constant temperature of 22

C and 16 h light period. Assessments for hypersensitivity were carried out 24 and 36 h

after inoculations. Plants exhibiting confluent necrosis (HR) within this period of time

were scored as resistant to bacterial spot. When dip inoculation was carried out,

assessments were performed 4-5 days after inoculations. A visual scale, designed for

these experiments, was used with scores ranging from 0 (no symptoms) to 11 (100% leaf

area affected by bacterial spot). Plants with scores of five or below were considered

resistant.

DNA Extraction and Hybridization Analysis

Plant genomic DNA was isolated from leaf tissue of 104 F2 plants and progenitors as

described by Prince et al. (1997). For Southern hybridization, genomic DNA was

digested with EcoRV according to the conditions established by the manufacturer

(Promega, Madison, WI), and DNA fragments were resolved by agarose gel

electrophoresis (Sambrook et al., 1989) and transferred to a Nytran membrane









28

(Schleicher & Schuell, Keene, NH) as described by Southern (1975). The RFLP probes,

provided by Dr. Steve Tanksley of Cornell University, were labeled with digoxigenin-11

dUTP (Boehringer Mannheim, Indianapolis, IN) by PCR as described by Lanzillo (1990)

and probed against the DNA immobilized on the Nytran membrane. Hybridization

signals were developed with CSPD (disodium 3-(4-methoxyspiro)1,2-dioxetane-3,2'-(5'-

chloro) tricyclo [3, 3.1.137] decan-4-yl-phenyl phosphate) chemiluminescense substrate

according to the conditions established by the manufacturer (Boehringer Mannheim,

Indianapolis, IN).

Construction of Cleaved Amplified Polymorphic Sequence (CAPS) Markers and
Identification of Recombinants between the Resistance Gene and Selected Markers

The termini of the RFLP probes used in this study were sequenced at the DNA

Sequencing Core Laboratory of the University of Florida's Interdisciplinary Center of

Biotechnology Research (ICBR). Oligonucleotides specific for the amplification of each

RFLP probe were synthesized at the ICBR DNA Synthesis Laboratory, University of

Florida, Gainesville. In the case of the marker NBS3, two degenerate oligonucleotide

primers were used. These primers were designed based on the amino acid sequences of

two highly conserved motifs of the nucleotide binding site (NBS) in tobacco N and

Arabidopsis RPS2 genes (Yu et al., 1996). The profiles obtained from the amplification

of the parental lines and the introgression lines LA3488 and LA3523 were compared. All

primer pairs were used to screen a subset of 104 F2 plants and the parental lines. DNA for

PCR amplifications was extracted as described before for the hybridization assays.









29

Polymerase chain reaction was carried out using a DNA automated thermocycler

PTC-100 equipped with a hot bonnet (M. J. Research, Watertown, MA), and with Taq

DNA polymerase (Promega, Madison, WI). Unless otherwise indicated, each 25-[tl PCR

reaction contained lx amplification buffer (from the manufacturer), 100 ptM of each

dNTP, 17.5 ptM of each primer, 1.5 mM of MgCl2, 1.25 U of Taq DNA polymerase, and

100 ng of template DNA. Generally, the template DNA was initially denatured at 95 C

for 3 min followed by 30 PCR cycles. For most of the primer pairs, each cycle consisted

of 30 s of denaturation at 95 C, 30 s of annealing at 50 C, and 1 min. of extension at 72

C. For the final cycle, the extension step was extended to 5 min. Oligonucleotide

sequences used in this study are shown in Table 3-1.

Aliquots of 20 [tl of the PCR products were mixed with 1 [tl of tracking dye and

added to wells of a 1.5% agarose gel in TAE buffer (40 mM Tris-acetate, 1 mM EDTA,

pH 8.2) as described by Sambrook et al. (1989). Agarose electrophoresis was performed

at 5 V/cm for 1.5 h, then stained with 0.5 [tg/ml of ethidium bromide in water, visualized

on a UV transilluminator and photographed with Polaroid type 55 film (Polaroid Corp.,

Cambridge, MA).

Restriction Endonuclease Digestion of PCR Products

Amplified DNA fragments obtained with oligonucleotides designed from probes

TG284a and TG599 were digested with HindIII and HindIII/EcorRI, respectively,

according to the conditions established by the manufacturer (Promega, Madison, WI).

Restriction fragments were resolved by agarose gel electrophoresis in 4% agarose gels

























Table 3-1. Sequence of specific oligonucleotides used for PCR-amplification of
genomic DNA from L. esculentum, L. pennellii, introgression lines, and F2
population. Modifications to the general conditions described before are also
indicated.


TG50c 3 FP 5'TGGAACATGTGTCGACCTTT 3' 2.5 mM MgCl2
RP 5'TATGTCCACCTCCAAAACCT 3'
TG377 3 FP 5'TTGGCCCTTTCTTACTCTCT 3'
RP 5'CGGGTTGATTCTTAATGTACG 3'
TG284a 3 FP 5'TGACTCCGTTGAAACAATTTA 3'
RP 5'AACTGTGGGCTTGTCTTTTG 3'
TG457 3 FP 5'AGGCCAGGTGACTTTATTAGG 3' Annealing temp.
RP 5'TTTGTGTGTTGGTTTCCCCT 3' 53 OC

TG599 3 FP 5'TGTTGATCCTTGCTTGCTGT 3'
RP 5'TTGTATGGTGCAACTTCCC 3'
NBS3 3 FP 5'YCTAGTTGTRAYDATDAYYYTRC3' Annealing temp.
RP 5'GGAATGGGNGGNGTNGGNAARAC3' 55 OC and
Y= C/T; R= A/G; D= A/G/T 2.5 mM MgC12

1 FP= forward primer, RP= reverse primer









31

(3% NuSieve and 1% Seakem GTG [FMC BioProducts, Rockland, ME]) in TAE buffer

at 8 V/cm. The gel was stained with 0.5 [tg/ml ehidium bromide in water for 30 min,

destined in 1 mM MgSO4 for 30 min, visualized by UV transillumination and

photographed as described above.

Genetic Analysis

Linkage and segregation analyses were performed with the software package

MapMaker/Exp 3.0 (Lander et al., 1987; Lincoln et al., 1992). Statistical analysis was

conducted with the Statistical Analysis System (SAS Institute, SAS Circle, Box 8000,

Cary, NC).

Results

Analysis of the Segregating Population

The development of confluent necrosis in L. pennellii LA716 24 to 36 h after

inoculation with T3 strains of Xcv indicated the existence of HR-related resistance in this

wild species (Figure 3-1, A). To construct a population segregating for this novel

resistance gene, the cultigen Hawaii 7998 (susceptible to T3 strains) was crossed with L.

pennellii LA716. A subset of 16 Fi plants was screened for resistance by inoculations

with the T3 strains Xcv 91-118 and Xcv 97-2. By 24 to 36 h after inoculation, all the Fi

plants produced a hypersensitive reaction in the infiltrated areas (Figure 3-1, B). When

245 F2 plants were screened with the same two strains for resistance, 79% (194) of them

developed hypersensitive responses, whereas only 21% (51) remained asymptomatic 24-

36 hours after inoculation. Analysis of the segregation ratio indicated a good fit to the 3:1

Mendelian segregation ( 2=2.287; P=0.13).




































Figure 3-1. Confluent necrosis in tomato plants 24 to 36 hours after
inoculation with the Xcv T3 strain 91-118. (A) L. pennellii, (B) an
FI individual, and (C) the introgression line LA3488. Arrows point
at the characteristic necrosis.









33

In order to test whether this resistance was the same as that described for L.

pimpinellifolium PI 128216 and PI 126932, and L. esculentum cultigen Hawaii 7981,

resistant plants were inoculated with the marker-exchange mutant strain M24 of Xcv 91-

118 (T3) and the complemented mutant carrying the avrXv3 gene. The M24 mutant is

unable to cause HR on H7981 or L. pimpinellifolium PI 128216 and PI 126932

(Minsavage et al., unpublished data). When these strains were inoculated into parental

lines, F1 and F2 plants, and resistant introgression lines, both strains exhibited the same

ability to elicit the hypersensitive response described before (Table 3-2).


Table 3-2. Response of different genotypes of tomato to strains of Xanthomonas
campestris pv. vesicatoria1
Strain L. esculentum L. pennellii L. esculentum L. esculentum
H7998 LA716 216 Fla. 7060
XcvT3M24 (HR-) Sus HR Sus Sus
XcvT3M24+
avrXv3 (HR) Sus HR HR Sus
Xcv-T3wt Sus HR HR Sus
1 Sus, susceptible response; HR, resistant response


Analysis of Introgression Lines Indicates a Chromosome-3 Location

When a collection of 50 introgression lines was screened for resistance to T3 strains,

only two lines, LA3488 and LA3489, developed confluent necrosis characteristic of the

hypersensitive reaction which was previously observed in L. pennellii, Fi, and F2

populations (Figure 3-1, C). In order to confirm this phenotype under more natural

conditions using strain Xcv 97-2, dip inoculations of all introgression lines were carried

out. As expected, LA3488 and LA3489 exhibited the lowest levels of infection scoring 4









34

and 5, respectively (data not shown). Both LA3488 and LA3489 carry overlapping

fragments from chromosome 3 of L. pennellii (Eshed and Zamir, 1994).

Identification of Markers Linked to the Resistance Locus

Two loci (TG50c and TG134) located at each end of the chromosomal fragment

carried by the introgression line LA3488 were chosen for the initial linkage analysis via

RFLP. Genomic clones for four neighboring loci were converted into PCR-based markers

by first sequencing the termini of the clones, and then designing primers suitable for PCR

amplification. Of these, TG457 produced a L. esculentum amplicon that behaved as

dominant locus (Figure 3-2). Primers for TG377 yielded allelic amplicons that differed in

size, whereas those for TG284a and TG599 were digested with HindIII and

HindIII/EcoRI, respectively, in order to distinguish the two alleles (Figure 3-2).

Comparison of profiles obtained with NBS degenerated primers among parental and

introgression lines indicated the presence of a 565 bp fragment unique to L. pennellii and

LA3488, and absent in L. esculentum H7998 and LA3523 profiles (Figure 3-3). This

unique fragment was designated NBS3.

The observed segregation ratios for the markers were a good fit to the 3:1 ratio.

The results of the goodness of fit tests were as follows: TG599 (X2=3.63), TG377

(X2=1.14), TG134 (X2=1.20), TG457 (X2=0.08), and TG284a (X2=2.56). Unlike the other

markers, NBS3 (x2=4.9) slightly deviated from the 3:1 ratio, while marker TG50c

exhibited a segregation that strongly deviates from the Mendelian 3:1 ratio (72= 8.60).

Therefore, TG50c was not used for further analysis.






















1230 bp
1030 bp A

4 7 0 b e ...... ........ .. . . .........:. ....... ....... ... .. ..... ........ ........ .......... .....:::i# ::::: :::iiiii ~i ii iii iii iiii iiii:

470 bp B

3 07. b .... .. ......
...::::: ... ..........................~r " " ................... . ....




1040 bp: iiiii:iiiiiiiii :~~
........................................................... ~~~~ ................... ...... ........................ ..... ...........:. -:
8 3 0 b e, iiiii...............................................................................:
. . . . . . ..................... :: : : : : .:. . .: : ii i i i i i i: : . .: ii i ij .. ., ; : .. ., iii
...:::iiiii!i::iii:: .... .. .........:. ::::::::# : ::::: .f..








E



Figure 3-2. Examples of polymorphism obtained with PCR-based
markers (C, D) and RFLP markers (E) used to screen the F2 progeny. The
approximate size of each band is also indicated. (A) TG377, co-
dominant; (B) TG457, dominant; (C) TG599, digested with
Hindll/EcoRI, co-dominant; (D) TG284a, digested with HindIII, co-
dominant; and (E) TG134, co-dominant marker.





















F nr.R


NBS3 4-


55 hn


Figure 3-3. Amplification profiles obtained with degenerated
oligonucleotide primers designed based on the amino acid
sequences of two highly conserved motifs of the nucleotide binding
site (NBS) in tobacco N and Arabidopsis RPS2 genes (Yu et
al., 1996) (Table 1). (k) Lambda DNA digested with
EcoRI/HindIII,(A) L. pennellii, (B) L. esculentum H7998, (C)
introgression line LA 3488, (D) introgression line LA 3523, and (E)
resistant F2 individual.











Construction of a Genetic Map Around the Resistance Gene

Linkage analysis of RFLP, CAPS markers, and NBS3 indicates that the new resistance

gene designated Xv4 is linked to all markers tested (LOD 3.0, max. distance 50.0). The

data were analyzed with MapMaker (Lander et al., 1987) and are summarized in Figure

3-4. As expected, LA3488 and LA3489 share the same region of chromosome 3.

Chromosome location and gene order were similar to those reported by Tanksley et al.

(1992).

Discussion

This study indicates the existence of resistance to T3 strains in the wild tomato

relative L. pennellii. Segregation analysis of an F2 population obtained from the

interspecific cross between L. esculentum and L. pennellii indicates that a single

dominant gene controls this novel resistance. The observed segregation ratio is a good fit

to the 3:1 ratio expected for a character controlled by a single gene. The dominance of

this character seems to be complete since Fi plants showed HR responses similar in

intensity and speed of development as L. pennellii.

Introgression lines have been previously used to locate qualitative and quantitative

trait loci in interspecific crosses of L. esculentum and L. pennellii (Eshed and Zamir,

1995; Eshed et al., 1996; McNally and Mutschler, 1997; Moreau et al., 1998). In the

present study, screening of the 50 introgression lines suggested that the gene controlling

resistance to T3 strains is located in the lower arm of chromosome 3.















[


TG479
- TG40; CAB3
- TG135; CT31;TG1
TG585;TG517
STG130;
TG13B; 22

66;CT225B;CT110C
TG39;TG47
TG288;TG50C
TG102;CT90A;TM8
TG599
TG246;TG457;
TG42
1TG134
1TG284a
TG377;CD4A;
TG126
152
1CD71;T B
TG214;CD69;CT2
TG244;TG94


B




I


A


Figure 3-4. Comparative map locations of CAPS and RFLP
markers. (A) Marker order as determined by Tanksley et al.
(1992). Introgression fragments from the chromosome 3 of L.
pennellii in different lines were mapped by Eshed and Zamir
(1994) and are shown superimposed on the map. L3-3=
LA3488, IL3-4= LA3489. (B) Marker order around the
resistance gene Xv4 as determined by MapMaker. All markers
shown are CAPS except for the RFLP probe TG134. Distance
between markers/LOD score is also indicated.


]
NBS3

7.5 cM/ 10.76

TG599

9.3 cM/ 9.82

Xv4


11.1 cM/ 7.81


TG134

6.6 cM/10.88

TG284a

11.8 cM/ 16.16


TG377


IL 3-1


IL 3-21


I


IL 3-3


IL 3-4



IL3-5









39

Linkage analysis with RFLP probes and CAPS markers suggested that at least four

of those markers are linked to the resistance gene in chromosome 3. Analysis of the data

indicated that the Xv4 locus is located between TG599 and TG134 (Figure 3-4).

The mapping of Xv4 was carried out with the long-term goal of cloning this gene by

chromosome landing (Tanksley et al., 1995). The next step would be to generate a high-

density map around this gene with the assistance of a large number of markers and

recombination events. Through the use of bulked segregant analysis (Michelmore et al.,

1991) and AFLP (Vos et al., 1995) and/or DAF (Caetano-Anolles et al., 1991), markers

closely linked to Xv4 might be generated and used to identify individual BAC or YAC

clones carrying that region of the genome.

Two lines of evidence suggest that this resistance is different from that described

before in L. esculentum cultigen H7981 and two plant introductions of L.

pimpinellifolium, PI 128216 and PI 126932 (Scott et al., 1995; Minsavage et al., 1996).

First of all, knocking out the activity of avrXv3 in Xcv proved to be completely

independent from the ability of T3 strains to elicit HR on L. pennellii or its progeny

carrying the newly discovered resistance gene. Secondly, when plants bearing the Xv3

were challenged with Xcv strains carrying the putative avr gene, no HR was observed.

Therefore, we can conclude that this incompatible interaction involves two previously

undescribed genes. We propose avrXv4 and Xv4 as the symbols for these genes.















CHAPTER 4
avrXv4: A NEW AVIRULENCE GENE RESPONSIBLE FOR THE HYPERSEN-
SITIVE REACTION IN THE WILD RELATIVE OF TOMATO
Lycopersicon pennellii


Cloning and characterization of avirulence genes from different plant pathogenic

bacteria have yielded important evidence as to how hosts and pathogens carry out their

interactions (Leach and White, 1996). Several avr genes have been cloned and charac-

terized previously from different strains of Xanthomonas campestris pv. vesicatoria

(Xcv). Among them, avrBs], avrBs2, avrBs3, and avrBsP were cloned from Xcv strains

pathogenic to pepper, whereas avrRxv, avrBsT, and avrXv3 were cloned from Xcv strains

pathogenic to tomato (Ronald and Staskawicz, 1988; Bonas et al., 1989; Minsavage et

al., 1990; Whalen etal., 1993; Canteros etal., 1995; Minsavage etal., 1996).

Based on the assumption that a gene-for-gene interaction is involved, the main pur-

pose of this work was to clone and characterize the putative avirulence gene(s) from X

campestris pv. vesicatoria race T3 involved in specifying resistance in the wild tomato

relative L. pennellii which carries the resistance gene Xv4, characterized in Chapter 3.

Materials and Methods


Bacterial Strains, Plasmids, and Media

The bacterial strains and plasmids used in this study are listed in the Appendix.

Strains of Xcv and E. coli were grown as described in Chapter 3. Plasmids were intro-









41

duced into E. coli by transformation (Maniatis et al., 1982) and mobilized into Xcv

strains by conjugation using pRK2073 as the helper plasmid in triparental matings

(Figurski and Helinski, 1979; Ditta et al., 1980). Triparental matings were made at 28 C

on plates of NYG agar (Daniels et al., 1984). Antibiotics were added to the medium at

the following final concentrations: ampicillin, 100 [tg/ml; kanamycin, 25 or 50 [tg/ml;

rifamycin SV, 100 [tg/ml; spectinomycin, 50 [tg/ml; and tetracycline, 12.5 [tg/ml.

Plant Material and Plant Inoculations

FI seeds from the cross between L. esculentum and L. pennellii were planted in

Plugmix (W. R. Grace & Co., Cambridge, MA). After two weeks, the emerged seedlings

were transferred to Metromix 300 (W. R. Grace & Co.) in 10 cm plastic pots. Seedlings

were grown in the greenhouse at temperatures ranging from 25 to 35 C (night/day).

Tomato plants were grown for four to five weeks and then the main stem was removed

above the fully expanded sixth true leaves. Plants were inoculated approximately 7 days

after topping and transferred to a growth room kept at a constant temperature of 22 C

with a daily 16 h photoperiod.

Xcv strains for plant inoculations were grown as described in Chapter 3. For popula-

tion dynamics studies, bacterial suspensions were diluted to a concentration of 2-5 x 105

cfu/ml in sterile tap water. Infiltration of tomato leaves and electrolyte leakage measure-

ments were carried out as previously described by Hibberd et al. (1987). Unless other-

wise indicated, all experiments were arranged as a completely randomized design with

three replications. All experiments were repeated twice. For electrolyte leakage and

growth curve experiments, statistical analysis was conducted using the ANOVA proce-









42

dure of the Statistical Analysis System (SAS Institute, SAS Circle, Box 8000, Cary, NC)

using the area under the curve as the variable for analysis.

Molecular Genetics Techniques

Standard molecular techniques were used for the extraction of genomic and plasmid

DNA, restriction endonuclease digestions of DNA, and cloning procedures (Maniatis et

al., 1982; Ausubel et al., 1992). Enzymes for restriction digestion and ligation reactions

were purchased from Promega (Madison, WI) and used following the manufacturer's

protocol.

A total genomic DNA library of Xcv strain 91-118 (tomato race 3) was constructed

in the cosmid vector pLAFR3 as previously described (Minsavage et al., 1990). Individ-

ual clones were mobilized into Xcv strain ME-90rif by triparental mating (Daniels et al.,

1984) and transconjugants were inoculated by leaf infiltration into the Fi (L. esculentum x

L. pennellii) tomato plants to screen for elicitation of a hypersensitive response.

Transposon Mutagenesis

For transposon mutagenesis, the plasmid pLAFR3 carrying the target insert was

transformed into the polyA-dependent E. coli strain DH50c containing the transposon-

carrying plasmid pHoKmGus and the plasmid pSShe carrying the transposase gene

(Stachel et al., 1985). Transformants were selected on media containing chloramphenicol,

tetracycline, and kanamycin. After overnight growth, pLAFR3 carrying mutated inserts

was isolated and transformed into the polyA-independent E. coli strain C2110. Two hun-

dred individual transformants, selected on media containing nalidixic acid, kanamycin,

and tetracycline, were mobilized into the virulent Xcv strain ME-90rif by triparental mat-









43

ing, and screened for their inability to elicit HR in Fi plants obtained from the cross be-

tween L. esculentum and L. pennellii.

Results


Resistance of Lycopersicon pennellii to Xcv T3

Tomato race 3 strains of Xcv are able to elicit a hypersensitive response (HR) in

leaves of L. pennellii LA716 (Figure 4-1). Phenotypic responses of parental lines and Fi

populations are summarized in Table 4-1. Unlike H7998, LA716 and Fi plants inoculated

with Xcv T3 strains exhibited the characteristic confluent necrosis about 24-36 h after

infiltration at temperatures ranging between 22 to 25 C. On the other hand, LA716 and

F1 plants inoculated with Xcv ME-90 remained free of symptoms for up to 48-60 h after

infiltration. When the growth of Xcv strains in leaves of tomato was examined, the wild

type strain 91-118 of Xcv T3 showed an increase in population size of about 100-fold by

4 days after infiltration but afterwards the growth curve leveled off (Figure 4-2). In con-

trast, the population of the virulent strain of Xcv ME-90 kept increasing up to 10000-fold

by the sixth day after infiltration (Figure 4-2). Statistical analysis of the area under the

curve indicated that strains carrying the putative avr gene exhibited an overall growth

significantly different from that of those strains that did not carry it.

Regarding the speed and degree of cell damage caused by strains of Xcv (Figure 4-

3), no significant differences were observed between Xcv T3 and ME-90 12 h after infil-

tration. However, in the following 48 h, electrolyte leakage increased significantly in












































Figure 4-1. Confluent necrosis in a leaf of Lycopersicon
pennellii LA216, 24 to 36 hours after inoculated with the
Xcv T3 strain 91-118. Arrow points at the characteristic
necrosis.






























Table 4-1.


Response of different tomato genotypes to strains of Xanthomonas cam-
S 1


pestris pv. vesicatona
Xcv strain L. pennellii LA716 L. esculentum F1
Hawaii 7998 (L. pennellii LA716 x
L. esculentum
Hawaii 7998)
ME-90 Sus HR Sus2
Xcv T3 91-118 HR Sus HR
Xcv-60 3 HR Sus HR
Xcv-60::334 Sus Sus Sus


1 Sus, susceptible response; HR, resistant response.2 The HR response in F1 plants to ME-90 is de-
layed, so it was considered susceptible.3 Xcv60 = ME-90 carrying the cosmid clone pXcvT3-60.
4 cosmid clone pXcvT3-60 carrying a transposon insertion.



















10

8-
SME-90

S 6 Xcv-60:: 33
0 -_- Xcv-60
4) --l- Xcv-T3wt



0
0 2 4 6 8
Days after inoculation

Figure 4-2. Time course of growth ofXanthomonas campestris pv. vesicatoria tomato
races and transconjugants in Fi plants obtained from the cross L. pennellii LA716 X
L. esculentum H7998. (ME-90) wild type virulent strain; (Xcv-60::33) ME-90 carry-
ing the mutant cosmid clone pXcv-60::33; (Xcv-60) ME-90 carrying the intact cos-
mid clone pXcv-60; and (Xcv-T3wt) wild type strain 91-118 of Xcv race T3. Bars in-
dicate standard errors.
















400

00 --- ME-90

I 200 Xcv-60::33
o 10---Xcv-60
100 -Xcv-T3wt
0

-100
0 12 24 36 48 60 72
Time after Inoculation (hr)

Figure 4-3. Time course of electrolyte leakage from leaves of resistant Fi plants ob-
tained from the cross L. pennellii LA716 X L. esculentum H7998 infiltrated with
strains and transconjugants of Xanthomonas campestris pv. vesicatoria. (ME-90)
wild type virulent strain; (Xcv-60::33) ME-90 carrying the mutant cosmid clone
pXcv-60::33; (Xcv-60) ME-90 carrying the intact cosmid clone pXcv-60; and (Xcv-
T3wt) wild type strain 91-118 of Xcv race T3. Bars indicate standard errors.









48

tissue infiltrated with Xcv T3 while that caused by ME-90 remained almost unchanged.

During the final 12 h, cell damage caused by ME-90 started to increase while that caused

by the wild type Xcv T3 leveled off (Figure 4-3). Statistical analysis of the area under the

curve indicated that there were significant differences in the degree and speed of the

damage caused by strains carrying the putative avr as compare to those strains that did

not have the gene.

Cloning of the Avirulence Gene avrXv4

A total of 600 cosmid clones from a genomic DNA library of Xcv tomato race 3

strain 91-118 were mobilized into the Xcv strain ME-90 (virulent on L. pennellii) by

conjugation and the resulting transconjugants were inoculated onto leaves of resistant

tomato plants. One clone, pXcvT3-60, carried by the strain ME-90 induced resistance on

FI plants obtained from the cross between L. esculentum and L. pennellii (Table 4-1). The

cosmid clone pXcvT3-60 contained a 29 kb fragment of Xcv DNA, as determined by re-

striction endonuclease digestion (data not shown).

When leaves of LA716 and Fi plants were infiltrated with the Xcv strain ME-90 car-

rying pXcvT3-60, the population growth exhibited a similar trend to that described before

for the wild type Xcv T3 (Figure 4-2). Similarly, cell damage caused by the same

transconjugant was identical to that caused by the wild type T3 (Figure 4-3).

Tn3-gusA Mutagenesis

The cosmid clone pXcvT3-60 containing the avrXv4 was mutagenized by transposon

insertion using Tn3-gusA. Three out of 200 transconjugants carrying transposon deriva-









49

tives were unable to elicit HR when inoculated into Fi (L. esculentum x L. pennellii) to-

mato plants.

Growth curves of Xcv ME-90 carrying the mutant clone pXcvT3-60::33 indicated

that insertion mutations in avrXv4 prevent the negative effect on growth that the intact

form of the gene had on the virulent strain ME-90 (Figure 4-2). Similarly, the speed at

which cell damage occurred in resistant plants was drastically reduced when Xcv ME-90

carrying the mutant pXcv-60::33 was used for inoculations (Figure 4-3).



Discussion

A new gene-for-gene model has been found involving T3 strains of Xcv and the re-

sistant host L. pennellii. Mobilization of a genomic library into a virulent strain of Xcv

was carried out with the purpose of finding a clone carrying the putative avr gene. One

single cosmid clone was able to convert the virulent strain into a fully avirulent one. As

shown before for other avr genes (Minsavage et al., 1990; Whalen et al., 1993), the in-

corporation of heterologous avr genes into virulent strains of the pathogen modify their

host specificity. The resistant tomato plants used in the screening carried the resistance

gene Xv4 from L. pennellii, so the putative avr gene was designated avrXv4.

A series of experiments were performed in order to further substantiate that the iso-

lated clone carried avrXv4. The experiments included comparing the effect of the wild

type and mutated genes on the speed and degree of damage caused to the plant, and the

growth rate in plant of different transconjugants. In one experiment, the presence of an

active avirulence gene in the virulent strain resulted in a lower growth rate of the bacte-









50

rium in the resistant plant. This limited growth was most likely due the onset of the HR as

has also been reported for other Xcv strains carrying avr genes such as avrRxv (Whalen

et al., 1993). In contrast, when the mutated form of the avirulence gene was present in the

virulent strain, an HR was not observed and the growth rate of the transconjugant was not

reduced resembling that of the virulent strain.

Klement (1982) determined that electrolyte leakage is a measure of membrane dis-

ruption in a plant undergoing an HR. When electrolyte leakage was measured, the speed

and degree of damage caused by the transconjugants carrying the intact gene and the wild

type T3 strain were equally high because the incompatible interaction between avrXv4

and Xv4 rapidly lead to cell death. Also, the onset of the electrolyte leakage induced by

avirulent strains correlated with the onset of the visible HR (24-36 hours). This finding

agrees with observations made from other gene-for-gene interactions involving other

races of Xcv (Minsavage et al., 1990; Whalen et al., 1993). Conversely, the speed and

amount of damage caused by the wild type virulent strain and the transconjugant carrying

the mutated form were significantly lower which is characteristic of compatible interac-

tions. These results strongly indicate that avrXv4 was the only avr gene restricting growth

of the strain ME-90 and inducing the HR in resistant Fi plants.















CHAPTER 5
FUNCTIONAL DOMAINS OF avrXv3 AND THEIR ROLE IN ELICITING THE
HYPERSENSITIVE REACTION IN TOMATO (Lycopersicon esculentum L.)


A thorough understanding of plant-pathogen interactions is vital for the development

of new and environmentally friendly strategies to control plant diseases. In plant-

pathogen interactions that fit the gene-for-gene model, determining the role of avr gene

products is essential to understand how plants defend themselves from their attackers.

However, with very few exceptions, little is known about how avr genes function.

Bacterial spot caused by Xanthomonas campestris pv. vesicatoria (Xcv) is a serious

disease on tomato and pepper. Minsavage et al. (1996) reported cloning and characteri-

zation of an avirulence gene from the race T3 of Xcv that is responsible for the elicitation

of a hypersensitive reaction in one genotype of Lycopersicon esculentum and two plant

introductions of L. pimpinellifolium. The gene was designated as avrXv3 and encodes one

of the smallest peptides found among bacterial avr gene products (Minsavage et al.,

1996).

The main objective of this research was to study the functional domains of the

AvrXv3 protein and its possible involvement in eliciting the hypersensitive reaction in

tomato.











Materials and Methods

Bacterial Strains and Growth Conditions

Bacterial strains used in this study are listed in the Appendix. Strains of Xcv and E.

coi were grown as described in Chapter 3.

Plant Material, Inoculum Production, and Avirulence Activity Assays

Plants of the tomato near-isogenic lines 216 and Fla. 7060, resistant and susceptible

to Xcv tomato race 3, respectively, were grown for four to five weeks and then the main

stem was removed above the fully-expanded sixth true leaf. Plants were inoculated ap-

proximately seven days after topping and transferred to a growth room kept at a constant

temperature of 25 C with a 16 h photoperiod.

Inoculations with Xcv strains were carried out as described in Chapter 3. Unless oth-

erwise indicated, inoculation experiments were replicated three times.

Hydrophobicity Chart and Sequence Homology of AvrXv3

The analysis of the distribution of hydrophobic and hydrophilic residues throughout

the AvrXv3 protein was carried out as described by Shaw (1995). Regions showing clus-

tering of amino acids with similar hydrophobic properties were considered as targets for

mutation (Figure 5-1).

A search for homology of the nucleotide sequence of avrXv3 and the amino acid se-

quence of the predicted AvrXv3 were carried out on the World Wide Web using the Blast

2.0 algorithm (Altschul et al., 1997) and DARWIN (Data Analysis and Retrieval with

Indexed Nucleotide/peptide sequences).





















47 a.a.


49 a.a. 52 a.a.


I m AvrXv3
1.5

1 -0.5







S 51 101 , 151 201
0 -1

-1.5

-2
Amino acid
Figure 5-1. Distribution of hydrophobic residues in the predicted
protein of avrXv3. Argos hydrophobicity values were calculated
as described by Shaw (1995). Solid line depicts the average of the
hydrophobicity values for 20 amino acid residues. Dashed line
represents the average of 10 amino acid residues.











Mutagenesis of avrXv3

PCR-based deletion mutagenesis was performed on the clone pLAFR 119APst to cre-

ate in-frame deletions of about 50 amino acids in three different sites along the sequence

of this gene. This clone carries the entire open reading frame of avrXv3 and its original

promoter region. First, pLAFRl 19APst was digested with HindIII and EcoRI and the

fragment containing the promoter region and the ORF of avrXv3 was transferred to

pBluescript KS, resulting in pBS:T3APst. The targets for deletion were chosen by identi-

fying putative domains defined by the distribution of hydrophobicity residues in the pre-

dicted protein (Figure 5-1). A set of 8 oligonucleotide primers were synthesized at the

ICBR DNA Synthesis Laboratory, University of Florida, Gainesville, in order to make

the in-frame deletions of the three putative domains (Table 5-1). As shown in Figure 5-2,

separated PCR reactions were carried out using pBS:T3APst as template and the follow-

ing primer combinations: P1/P2, P3/P8, P1/P4, P5/P8, P1/P6, and P7/P8. In order to ease

the process of screening for the right construct, unique restriction sites for the endonucle-

ases XhoI, Aval, and KpnI were engineered as silent mutations in primers P3, P5, and P7,

respectively (Table 5-1). Polymerase chain reaction was carried out as described in

Chapter 3. The annealing temperature use for all primers was 60 C. Oligonucleotide se-

quences used in this study are shown in Table 5-1.

Subsequently, PCR products were diluted 100-fold and an aliquot of 2 [tl of each

product was combined as follows: P1/P2 + P3/P8, P1/P4 + P5/P8, and P1/P6 + P7/P8.

The mixtures were used as templates for a second PCR reaction using the primers P1/P8

and the same conditions described above. The resulting modified constructs were de-
























Table 5-1. Sequence of specific oligonucleotides used for PCR-based deletion muta-
genesis of avrXv3. Restriction sites added by each oligonucleotide are also indicated.

ID Oligonucleotide Sequence Restriction
Enzyme
Site added
P1 5' GCGCGCAATTAACCCTCACTAAAG3'
P2 5' GTAACGATTGATACTACTTGTCATGG3'
P3 5 'GACAAGTAGTATCAATCGTTCGCTCGAGTGGAGCAGGTCG3' Xhol
P4 5 'AACGCCCTTGATCGGCTTATTTCG3'
P5 5 'ATAAGCCGATCAAGGGCGTTGTTATGCCCGAGAATCGC3' AvaI
P6 5'TTTAGCGGCATACCCCTGCGAACG3'
P7 5 'CGCAGGGGTATGCCGCTAAAGAAAAGGGTACCGTAAGG3' KpnI
P8 5'CG CGCGTAATACGACTCACTATAG3'












T3APst
-------------------

P1 P3 P5 EcoRI

PCRI
i/ P2
Hind II P4 P6 P8


PI -- Xho
/


El


P3/P8


/ Aval
/ i


PCR II


Kpn

U^^


PI/P


mutA


mutB


mutC


P8

Figure 5-2. Diagram of the procedure followed for PCR-based deletion muatagenesis. For
PCR I, individual reactions were carried out using pBS:T3APst as template and the fol-
lowing primer combinations: P1/P2, P3/P8, P1/P4, P5/P8, P1/P6, and P7/P8. For PCRII,
products from PCRI were diluted 100-fold and an aliquot of 2 [tl of each product was
combined as follows: P1/P2 + P3/P8, P1/P4 + P5/P8, and P1/P6 + P7/P8. The mixtures
were used as templates for a second PCR reaction using the primers P1/P8. Unique re-
striction sites for the endonucleases XhoI, Aval, and KpnI were engineered as silent mu-
tations in primers P3, P5, and P7, respectively


PI/P 0









57

signaled as mutA, mutB, and mutC. These mutants were digested with HindIII and EcoRI

and cloned into pLAFR6.

In order to determine the effect of possible changes in the three-dimensional struc-

ture of the AvrXv3 on its activity, the termini of the predicted protein were also modified

by the addition of six histidine residues. First, the ORF of avrXv3 was isolated by PCR

using the primers RST88 (5'CCGCTCGAGCTACTTAACGAGATTTGTTAC3') and

RST89 (5'CCGCTCGAGATGACAAGTAGTATCAATC3') which add Xhol restriction

sites. The PCR product was cloned into pET15b, in frame with a histidine tag at the 5'

terminus of the ORF. The resulting construct was designated pET15b:HisT3. Secondly,

primers PI and RST88b (5'CCGCTCGAGCTTCTTAACGAGATTTGTTAC3'), which

eliminate the stop codon of the gene, were used to isolate the ORF of avrXv3 and its

original promoter from pBS:T3APst. The resulting fragment was digested with HindIII

and XhoI and cloned into pET22b, in frame with a histidine tag at the 3' end of the ORF.

This construct was designated pET22b:T3His. Polymerase chain reaction was carried out

as described in Chapter 3. For both primer pairs, each cycle consisted of 30 s of denatu-

ration at 95 C, 30 s of annealing at 56 C, and 1 min of extension at 72 C. For the final

cycle, the extension step was prolonged to 5 min.

All mutants were sequenced at the ICBR sequencing facility (University of Florida,

Gainesville, FL) using the Applied Biosystems model 373 system (Applied Biosystems,

Foster City, CA).











Avirulence Activity in Xcv Background

The constructs pLAFR6:mutA, pLAFR6:mutB, and pLAFR6:mutC were introduced

into Xcv strain ME-90 by triparental mating (Daniels et al., 1984) and inoculated into the

tomato near-isogenic lines 216 and Fla. 7060 as described above. Regarding T3His,

pET22b:T3His was digested with HindIII and PstI and cloned into pLAFR3. HisT3, on

the other hand, was cloned into a previously constructed plasmid, pLAFR3 :Pt3, under

control of the original promoter region of avrXv3. The resulting constructs,

pLAFR3:T3His and pLAFR3Pt3:HisT3, were introduced into Xcv strain ME-90 by tri-

parental mating (Daniels et al., 1984) and inoculated into the tomato near-isogenic lines

216 and Fla. 7060 as described above.

Agrobacterium-mediated transient expression

The binary vector pMD-1, kindly provided by Dr. B. Staskawicz, was used for all

Agrobacterium-mediated transient expression assays. The ORF's of avrXv3, mutA, mutB,

and mutC were isolated by PCR using the primers RST89b (5'CCGTCTAGAATGACA

AGTAGTATCAATC3') and RST88c (5'CCGGGATCCCTTCTTAACGAGATTTGTT

AC3'), which add the restriction sites XbaI upstream of the start codon, and BamHI

downstream of the stop codon, respectively. Following digestion with the appropriate en-

zyme combination, constructs were cloned into pMD-1. The ORF of avrXv3 was also

cloned into the binary vector p04541 that lacks the 35S promoter. HisT3 was isolated

from pET15b:HisT3 by PCR using the primers HIST3-F (5'CCGGAATTCAT

GGGCAGCAGCCATCAT3') and RST88c, which add EcoRI and BamHI sites, respec-

tively. T3His was isolated from pET22b:T3His by PCR using the primers RST89c









59

(5'CCGGAATTCATGACAAGTAGTATCAATC3') and T3HIS-R (5'GCTGGATCCA

GTTATTGCTCAGCGG3'), which add EcoRI and BamHI sites, respectively. Following

digestion with the appropriate enzyme combination, constructs were cloned into pMD-1.

All constructs were maintained in E. coli and transferred to A. tumefaciens by triparental

mating (Daniels et al., 1984).

The Agrobacterium tumefaciens strain C58C1 containing the Ti-plasmid pGV2260

(Deblaere et al., 1985) and individual transconjugants were grown overnight at 28 C in

YEB medium (Kapila et al., 1997) amended with 10 mM N-morpholino-ethanesulfonic

acid (MES) (Sigma) pH 5.6, 20 pM acetosyringone (Sigma), and the appropriate antibi-

otics. After overnight growth, the concentration was adjusted to an A600 = 0.5-0.6, bacte-

ria were pelleted, washed with MMA medium pH 5.6 (Murashige and Skoog's medium

(Gibco BRL) amended with 10 mM MES, sucrose 20 g/1l, and 200 pM acetosyringone,

and resuspended in the same medium to a final concentration of A600 = 0.05. Bacterial

suspensions were kept at 25 C for 1 h and then used for infiltration. Fully expanded

leaves of the tomato near-isogenic lines Fla. 7060 and 216 were infiltrated with the bacte-

rial suspension as described by Hibberd et al. (1987). After infiltration, plants were incu-

bated at 22 C and continuous light for 48 h or until symptoms developed. Unless other-

wise indicated, inoculations were replicated three times.

Transcription Activation Activity

The yeast strain EGY48 (Saccharomyces cerevisae) carrying the plasmid pMW106,

which contains the LacZ gene under control of LexA-regulated promoters, was used for

testing transcription activation activity. The vector pEG202 containing the LexA DNA









60

binding domain sequence under control of the constitutive yeast ADH1 promoter and a

polylinker region at the C terminus was used for generating fusions with the wild type

and modified AvrXv3 proteins. The ORF of all mutant genes was isolated by PCR using

the following primer combinations: mutB and mutC with RST89c/RST88, mutA with

RST89c/RST88c, HisT3 with HIST3-F/RST88c, and T3His with RST89c/T3HIS-R. The

plasmids pMW106 and pEG202 were maintained in yeast by selection for uracil and his-

tidine auxotrophy, respectively, and in E. coli by selection for resistance to ampicillin and

kanamycin, respectively. The plasmid pSH17-4 carrying the LexA fused to Gal4p activa-

tion domain was used as a positive control for transcription activation, and pRFHM1 car-

rying the non-activating fusion between LexA and the Drosophila protein Bicoid was

used as negative control for transcription activation.

Expression of the expected fusion proteins in yeast was determined by standard

Western blot analysis (Ausubel et al., 1992) using a polyclonal antibody raised against

the LexA DNA-binding domain (kindly provided by Dr. E. Golemis). The membranes

were reacted for 1 h at 25 C with primary Anti-LexA polyclonal antiserum followed by

1 h incubation with the anti-rabbit IgG-alkaline phosphatase conjugate (Sigma). Bound

antibody was detected using 4-nitroblue tetrazolium chloride and 5-bromo-4-chloro-3-

indolyl phosphate (NBT/BCIP) substrate tablets (Boehringer Mannheim Biochemicals).

Methods for yeast manipulations were as described by Golemis and Brent (1997). P3-

galactosidase activity assays were performed as described by Clontech Laboratories. Dr.

Roger Brent, Department of Molecular Biology, Massachusetts General Hospital, kindly

provided all plasmids and yeast strains used in this study. Unless otherwise indicated, all









61

experiments were arranged in a completely randomized design with three replications.

All experiments were repeated twice. Statistical analysis was conducted with the Statisti-

cal Analysis System (SAS Institute, SAS Circle, Box 8000, Cary, NC).

Results

Sequence Analysis of avrXv3

A sequence homology search of avrXv3 and its predicted protein was carried out

with the computer program Gapped BLAST 2.0. The output of the search did not yield

any significant homology to any known gene or protein. Subsequent analysis using the

database DARWIN yielded three proteins with homology scores greater than 84%. The

three best matches included the human transcription factor Sp4 (98%), the human DNA

repair protein RAD52 homolog (89%), and the SCD2 protein from Schizosaccharomyces

pombe (84%). The region of homology between Sp4, RAD52, and AvrXv3 is located

near the N-terminus of AvrXv3, while the homologous region with the SCD2 protein

seems to expand most of the middle portion of AvrXv3.

Analysis of the distribution of hydrophobic residues indicated clustering of amino

acids with similar hydrophobic properties (Figure 5-1). The regions expanding the three

most prominent peaks in the chart were chosen as targets for deletion.

Mutagenesis of avrXv3

PCR-based deletion mutagenesis yielded three different mutant proteins lacking 47

aa (MutA), 49 aa (MutB), and 52 aa (MutC) at the N-terminus, middle portion, and C-

terminus of the AvrXv3, respectively. Addition of histidine tags at the C- and N- termi-









62

nus of the AvrXv3 protein yielded two larger proteins of about 27-kD. The sequence of

all mutants was confirmed by sequence analysis.

Avirulence Activity of Xcv Carrying Modified avrXv3 Constructs

In order to test the avirulence activity of the mutated proteins, all constructs were

cloned into the wide-host range plasmid pLAFR6, and introduced into the virulent strain

of Xcv ME-90. Despite the fact that all modified genes were under control of their natural

promoter, none of the constructs was able to confer this strain the ability to elicit the hy-

persensitive reaction in the resistant tomato genotype 216 (data not shown).

Cell Death Induced by AvrXv3 When Expressed Inside the Plant Cell

The use ofAgrobacterium tumefaciens for the expression of avrXv3 inside plant cells

led to hypersensitive reaction in the resistant tomato cultigen 216 but not in the suscepti-

ble genotype Fla. 7060 48 h after inoculations. The confluent necrosis observed in the

resistant genotype as a result of transient expression resembles the HR reaction induced

by race T3 of Xcv expressing avrXv3. Furthermore, confluent necrosis in the resistant

cultigen 216 only occurred when the 35S promoter controlled the expression of avrXv3.

Agrobacterium tumefaciens carrying the empty binary vector pMD-1 did not induce the

development of any symptoms on either Fla. 7060 or 216 (Figure 5-3). When mutated

constructs of avrXv3 were introduced into the plant cells by Agrobacterium-mediated

transient expression, only HisT3 and T3His were able to elicit the development of con-

fluent necrosis (data not shown).





































Figure 5-3. Agrobacterium-mediated transient expression of avrXv3 constructs
in the two near-isogenic tomato lines 216 and Fla. 7060. (A) avrXv3 in pMD-1
under control of the 35S promoter, (B) avrXv3 in p04541 without the 35S
promoter, (C) A. tumefaciens strain C58C1 carrying pMD-1, and (D) X cam-
pestris pv. vesicatoria strain 91-118 (T3).











Transcription Activation Activity

Wild type and the mutated forms of avrXv3 were expressed in the yeast strain

EGY48 as fusion proteins with the LexA DNA binding domain. As shown in Figure 5-4,

all constructs expressed a protein of the expected size.

The transcription activation activity of each mutant and the wild type AvrXv3 were

determined by indirect measurement of the activity of P-galactosidase in the presence of

the substrate o-nitrophenyl P-D-galactopyranose (ONPG). As shown in Figure 5-5, the

wild type AvrXv3 exhibited significant transcription activation activity as compared to

the negative control the homeodomain of the Drosophila protein Bicoid, and the plasmid

pEG202 without insert.

Regarding the mutant proteins, deletion of the putative domains located at the N-

terminus and middle portion of the AvrXv3 protein did not alter its transcription activa-

tion activity. However, the deletion of 59 aa in MutC at the C-terminus of the protein

seemed to cause a total shut down of the transcription activation activity of AvrXv3. The

addition of histidine tags to either end of the protein did not significantly modify its ac-

tivity.

Discussion

The experiments conducted for this research confirmed the ability of the avrXv3-encoded

protein to elicit the HR only in the resistant host. Agrobacterium-mediated transient ex-

pression of avrXv3 indicated that the gene product must be present inside the host cell in

order to trigger the resistant response. These results agree with what has already shown

for several other avr proteins (Gopalan et al., 1996; Leister et al., 1996; Scofield et al.,






















8 7 6 5 4 3 2 1


106 kD
80 kD
49.5 kD

32.5 kD
27.5 kD

18.5 kD


Figure 5-4. Western blot showing the expression of mutated
and wild type AvrXv3 protein in the yeast strain EGY48.
All proteins were expressed as fusions with the DNA bind-
ing domain of the LexA protein. (1) LexA-MUTA, (2)
LexA-MUTB, (3) LexA-MUTC, (4) LexA-AvrXv3 wild
type, (5) LexA-HisT3, (6) LexA-T3His, (7) LexA-
Homeodomain of Bicoid, (8) LexA-Galp4 activation do-
main.













*---35-
!30

2 5 b
j20


15
110

0-

A B C T3 HT TH RF P
Figure 5-5. Transcription activation of different mutants and wild type AVRXv3
expressed as LexA fusion in the yeast strain EGY48. (A) MutA, (B) MutB, (C)
MutC, (T3) AvrXv3 wild type, (HT) HisT3, (TH) T3His, (RF) Homeodomain of
Bicoid, negative control, and (P) plasmid pEG202 without any insert.









67

1996; Tang et al., 1996; Van den Ackerveken et al., 1996; Bonas and Van den Acker-

veken, 1997; Parker and Coleman, 1997; de Feyter et al., 1998).

The results of the transcription activation experiments demonstrated that AvrXv3 has

transcription activation activity in yeast, and that this activities are similar to those pre-

sented by Zhu et al. (1998) for the AvrXalO protein from Xanthomonas oryzae pv.

oryzae. Further evidence to support the transcription activation activity of AvrXv3 was

found by sequence comparisons using DARWIN. Based on these results, AvrXv3 may

have similarity to the human transcription factor Sp4.

Many eukaryotic transcription activators have a modular structure with at least two

functional domains, one that directs binding to specific DNA sequences and one that ac-

tivates transcription (Hope and Struhl, 1986). These two domains seem to act independ-

ently from one another, and can be exchanged among transcription factors without loos-

ing activity (Brent and Ptashne, 1985). Experiments conducted to map the position of the

putative domains involved in transcription activation in yeast and the avirulence activity

in tomato indicated that while the C-terminus of AvrXv3 seem to encode an active tran-

scription activation domain, the entire protein is required for normal avirulence activity in

the resistant host. Even though these results may indicate a lack of correlation between

these two traits, the inability of MutA and MutB to cause HR in tomato may be explained

by the disruption of a potential DNA-binding or protein-binding domain. In yeast, this

effect was not detectable since the LexA DNA-binding domain complemented that muta-

tion.









68

Addition of histidine tags at both termini of the AvrXv3 protein did not alter its abil-

ity to elicit the HR in tomato by transient expression or activate transcription in yeast.

However, when both constructs were introduced into a virulent strain of Xcv, the result-

ing transconjugants were unable to elicit HR in the resistant host. These results may indi-

cate that modifications of the termini could be interfering with the secretion of AvrXv3

by either modifying an unknown signal for secretion recognized by the Hrp system, or by

altering the three-dimensional structure of the protein needed for transport.















CHAPTER 6
CONCLUSIONS


The analysis of an F2 population obtained from the cross between Lycopersicon

pennellii cultigen LA716 and Lycopersicon esculentum Hawaii 7998 confirmed that the

former genotype is a new source of resistance to T3 strains of Xanthomonas campestris

pv. vesicatoria (Xcv). Segregation ratios of this trait suggested that the resistance found in

L. pennellii is controlled by a single gene. Inoculation of F2 plants with a strain of Xcv T3

carrying an inactive form of avrXv3 indicated that this resistance gene is different from

that found in L. esculentum H7981 or L. pimpinellifolium PI 128216 and PI 126932. This

new resistance gene was designated Xv4.

Screening of introgression lines and linkage analysis with CAPS and RFLP markers

indicated that the resistance gene Xv4 maps to an approximately 21.9 cM interval defined

on the centromeric side by TG599 at 9.3 cM and, on the telomeric side by TG134 at 11.1

cM. High-density mapping should be carried out in this region of the genome in order to

obtain more closely linked markers useful for chromosome walking or chromosome

landing.

Screening of a genomic library obtained from the strain 91-118 of Xcv yielded a

single clone able to confer to a virulent strain of Xcv the ability to elicit a hypersensitive

reaction in plants carrying the Xv4 gene for resistance. Comparison of the growth rates in









70

plant, and the speed/degree of damage between wild type and transconjugants of Xcv

strains carrying the putative avr gene confirmed that a newly discovered avirulence gene

was responsible for eliciting HR in L. pennellii. Sequence analysis of this gene and

homology searches should be carried out in order to determine its possible role in eliciting

the HR and/or similarities to other known genes. The designation avrXv4 is proposed for

this gene. Since avrXv4-Xv4 is the second gene-for-gene system described for the race T3

and tomato, future breeding programs focused on transferring the two different resistant

genes into commercial cultigens of tomato will ensure a better chance of achieving durable

resistance in the field against the race T3 of Xcv.

In order to explore the role of avr genes in incompatible interactions, the avrXv3 gene

was used in a series of experiments designed to examine some of the features that could be

involved in eliciting the HR in tomato. First of all, Agrobacterium-mediated transient

expression confirmed the direct role of avrXv3 in eliciting the HR in tomato. Furthermore,

these results suggested that this avr gene product must be present inside the host cell in

order for the plant to trigger the defense response.

Mutational analysis of avrXv3 and transcription activation assays in yeast revealed

that this Avr protein possesses transcription activation activity, and that the putative

domain responsible for that activity might be located near the C-terminus of the protein. In

addition, the remaining deleted sites of the protein that were examined by deletion analysis

might be involved in binding DNA, or another protein that binds DNA, so that the

assembly of the transcription factor would be completed. Finally, the addition of histidine









71

residues to the termini of the protein seemed to disrupt the secretion of the AvrXv3

protein, perhaps by modifying the secretion signal or by changing the structural

conformation of the protein. Further studies should be carried out in order to determine if

the transcription activation domain found at the C-terminus of the AvrXv3 is active in

plants, and if there is any region of the protein involved in protein-DNA or protein-protein

interactions.
















APPENDIX
BACTERIAL STRAINS, YEAST STRAINS, AND PLASMIDS USED IN THIS
STUDY

Table A-1. Bacterial strains and plasmids used in this work
Designation Relevant characteristics and use Reference or
source


Escherichia coli
DH5ca


C2110


SupE44 lacU169 (f80 lacZMI5) hsdR 17
recAl endAl gyrA96 thi-1 relAl, Nxr


Nalr polA


Bethesda
Research
Laboratories
Stachel et al.,
1985


Xanthomonas campestris
pv. vesicatoria
ME-90

91-118
97-2
M24


Saccharomyces cerevisiae
EGY48

Agrobacterium tumefaciens
C58C1

Plasmids
pLAFR3
pLAFR6
pLAFR3T3p

pBluescript II KS +/-
pET15-b
pET22-b
Table A-1-- Continued


Pepper race 3, 87-3 carrying Tn5, Rifr
Kmr
Tomato race 3, Rif avrXv3+
Tomato race 3, Rif avrXv3+
Tomato race 3, Rif r Tetr Kmr, avrXv3,
Marker-exchange mutant


MATu, trpl, his3, ura3, 6ops-LEU2


carrying pGV2260, Rif r


Tcr r/x +RK2 replicon
Tcr r/x +RK2 replicon
Tcr r/x +RK2 replicon, carrying avrXv3
promoter region
Phagemid sequencing vector, Apr
His tag expression vector, Apr
His tag expression vector, Apr


This study
This study
G. Minsavage1


R. Brent2


B. Staskawicz3


B. Staskawicz
B. Staskawicz
This study

Stratagene
Novagene
Novagene











pHoKmGus
pSShe


pMD-1
pEG202
pMW106
pRFHM1
pSH17-4
pXcvT3-60
pXcvT3-60::33


Kmr, Apr, tnpA-, Tn3-gusA fusion
Cmr tnpA


Binary vector, 35S, Kmr
LexA-fusion, HIS3, 2[t, Apr
URA3, 2[t, 8ops-lacZ, Kmr
HIS3, Homeodomain of Bicoid, 2[t, Apr
HIS3, LexA-Gal4p, 2[t, Apr
Tcr cosmid clone, avrXv4+
avrXv4 Tn3-gusA derivative


B. Staskawicz


Stachel et al.,
1985
B. Staskawicz
R. Brent
R. Brent
R. Brent
R. Brent
This study
This study


1 Plant Pathology Department, University of Florida, Gainesville, Fl
2 Department of Molecular Biology, Massachusetts General Hospital, Boston, MA
3 Department of Plant Biology, University of California, Berkeley, CA















REFERENCES


Aarts, N.; Metz, M.; Holub, E.B.; Staskawicz, B.J.; Daniels, M.J.; Parker, J.E. 1998. Dif-
ferent requirements for EDS1 and NDR1 by disease resistance gene define at least two R-
mediated signaling pathways in Arabidopsis. Proc. Natl. Sci. USA 95:10306-10311.

Alfano, J.R.; Collmer, A. 1996. Bacterial pathogens in plants: Life up against the wall.
The Plant Cell 8:1683-1698.

Anderson, D.M.; Schneewind, 0. 1997. A mRNA signal for type III secretion of Yop
proteins by Yersinia enterocolitica. Science 278:1140-1143.

Anderson, P.A.; Lawrence, G.L.; Morrish, B.C.; Ayliffe, M.A.; Finnegan, E.J.; Ellis, J.G.
1997. Inactivation of the flax rust resistance gene M associated with loss of a repeated
unit within the leucine-rich repeat coding region. The Plant Cell 9: 641-651.

Arlat, M.; Van Gijsegem, F.; Huet, J.C.; Pernollet, J.C.; Boucher, C.A. 1994. PopAl, a
protein which induces hypersensitivity-like response on specific Petunia genotypes, is
secreted via Hrp pathway of Pseudomonas solanacearum. EMBO J. 13:543-553.

Ausubel, F. M.; Brent, R.; Kingston, R. E.; Moore, D. D.; Seidman, J. G.; Smith, J. A.;
Struhl, K. (ed.). 1992. Current protocols in molecular biology. John Wiley & Sons, Inc.,
New York.

Baker, B.; Zambryski, P.; Staskawicz, B.; Dinesh-Kumar, S.P. 1997. Signaling in plant-
microbe interactions. Science 276:726-733.

Bauer, D.W.; Wei, Z.M.; Beer, S.V.; Collmer, A. 1995. Erwinia c hi)iiihei'in harpinEch :
an elicitor of the hypersensitive response that contributes to soft-rot pathogenesis. Mol.
Plant-Microbe Interact. 8:484-491.

Bender, C.L.; Malvick, D.K.; Conway, K.E.; George, S.; Pratt, P. 1990. Characterization
of pXV10A, a copper resistance plasmid in Xanthomonas campestris pv. vesicatoria.
Appl. Environ. Microbiol. 56:170-175.

Bent, A. 1996. Function meets structure in the study of plant disease resistance genes.
The Plant Cell 8:1757-1771.











Bent, A.F.; Kunkel, B.N.; Dahlbeck, D.; Brown, K.L.; Schmidt, R.; Giraudat, J.; Leung,
J.; Staskawics, B.J. 1994. RPS2 of Arabidopsis thaliana: A leucine-rich repeat class of
plant disease resistance genes. Science 265:1856-1860.

Bogdanove, A.J.; Wei, Z.M.; Zhao, L.; Beer, S.V. 1996. Erwinia amylovora secretes
harpin via a type III pathway and contains a homolog of yopN of Yersinia spp. J. Bacte-
riol. 178:1720-1730.

Bonas, U. 1994. Hrp genes of phytopathogenic bacteria. Curr. Top. Microbiol. Immunol.
192:79-98.

Bonas, U.; Conrads-Strauch, J.; Balbo, I. 1993. Resistance in tomato to Xanthomonas
campestris pv. vesicatoria is determined by alleles of the pepper-specific avirulence gene
avrBs3. Mol. Gen. Genet. 238:261-269.

Bonas, U.; Stall, R.E.; Staskawicz, B.J. 1989. Genetic and structural characterization of
the avirulence gene avrBs3 from Xanthomonas campestris pv. vesicatoria. Mol. Gen.
Genet. 218:127-136.

Bonas, U.; Van den Ackerveken, G. 1997. Recognition of bacterial avirulence proteins
occurs inside the plant cell: a general phenomenon in resistance to bacterial diseases? The
Plant J. 12: 1-7.

Botstein, D.; White, R.; Skolnick, M.; Davis, R.W. 1980. Construction of a genetic link-
age map in man using restriction fragment length polymorphism. Am. J. Human Genet.
32:314-331.

Bouzar, H.; Jones, J.B.; Minsavage, G.V.; Stall, R.E.; Scott, J.W. 1994a. Proteins unique
to phenotypically distinct groups of Xanthomonas campestris pv. vesicatoria revealed by
silver staining. Phytopathology 84:39-44.

Bouzar, H.; Jones, J.B.; Stall, R.E.; Hodge, N.C.; Minsavage, G.V.; Benedict, A.A.; Al-
varez. A.M. 1994b. Physiological, chemical, serological, and pathogenic analysis of a
worldwide collection of Xanthomonas campestris pv. vesicatoria strains. Phytopathology
84:663-671.

Bowles, D.J. 1990. Defense-related proteins in higher plants. Annu. Rev. Biochem.
59:873-907.

Brent, R.; Ptashne, M. 1985. An eukaryotic transcriptional activator bearing the DNA
specificity of a prokaryotic repressor. Cell 43:729-736.

Caetano-Anolles, G.; Bassam, B.J.; Gresshoff, P.M. 1991. DNA amplification finger-
printing using short arbitrary oligonucleotide primers. Bio/Technology 9:553-557.











Caetano-Anolles, G.; Gresshoff, P.M. 1996. Generation of sequence signatures from
DNA amplification fingerprints with mini-harpin and microsatellite primers. BioTech-
niques 20:1044-1056.

Canteros, B.; Minsavage, G.V.; Bonas, U.; Pring, D.; Stall, R. E. 1991. A gene from
Xanthomonas campestris pv. vesicatoria that determines avirulence in tomato is related to
avrBs3. Mol. Plant-Microbe Interact. 4:628-632.

Canteros, B.; Minsavage, G.V.; Jones, J.B.; Stall, R. E. 1995. Diversity of plasmids in
Xanthomonas campestris pv. vesicatoria. Phytopathology 85:1482-1486.

Century, K.S.; Holub, E.B.; Staskawicz, B.J. 1995. NDR1, a locus of Arabidopsis tha-
liana that is required for disease resistance to both a bacterial and a fungal pathogen.
Proc. Natl. Sci. USA 92:6597-6601.

Daniels, M. J.; Barber, C. E.; Turner, P. C.; Sawczyc, M. K.; Byrde, R. J. W.; Fielding,
A. H. 1984. Cloning of genes involved in pathogenicity of Xanthomonas campestris pv.
campestris using the broad host range cosmid pLAFRI. EMBO J. 3:3323-3328.

De Feyter, R.; McFadden, H.; Dennis, L. 1998. Five avirulence genes from Xanthomonas
campestris pv. malvacearum cause genotype-specific cell death when expressed tran-
siently in cotton. Mol. Plant-Microbe Interact. 11:698-701.

De Feyter, R.; Yang, Y.; Gabriel, D.W. 1993. Gene-for-genes interactions between cotton
R genes and Xanthomonas campestris pv. malvacearum avr genes. Mol. Plant-Microbe
Interact. 6:225-237.

Deblaere, R.; Bytebier, B.; De Greve, H.; Deboeck, F.; Schell, J.; Van Montagu, M.;
Leemans, J. 1985. Efficient octopine Ti plasmid-derived vectors for Agrobacterium-
mediated gene transfer to plants. Nucleic Acids Res. 13:4777-4788.

Dinesh-Kumar, S.P.; Whitham, S.; Choi, D.; Hehl, R.; Corr, C.; Baker, B. 1995. Transpo-
son tagging of tobacco mosaic virus resistance gene N: Its possible role in the TMV-N-
mediated signal transduction pathway. Proc. Natl. Acad. Sci. USA 92:4175-4180.

Ditta, G.; Stanfield, S.; Corbin, D.; Helinski, D. 1980. Broad host range DNA cloning
system for gram-negative bacteria: construction of a gene bank of Rhizobium meliloti.
Proc. Natl. Acad. Sci. USA 77:7347-7351.

Dixon, M.S.; Jones, D.A.; Keddie, J.S.; Thomas, C.M.; Harrison, K.; Jones, J.D.G. 1996.
The tomato Cf-2 disease resistance locus comprises two functional genes encoding leu-
cine-rich repeat proteins. Cell 84:451-459.

Dixon, R.A. 1986. The phytoalexin response: elicitation, signalling, and the control of
host gene expression. Biological Reviews 61:239-291.











Dixon, R.A.; Lamb, C. 1990. Molecular communication in plant-microbial pathogen in-
teractions. Annu. Rev. Plant Physiol. Plant Mol. Biol. 41:339-367.

Eshed, Y.; Gera, G.; Zamir, D. 1996. A genome wide search for wild species alleles that
increase horticultural yield for processing tomatoes. Theor. Appl. Genet. 877-886.

Eshed, Y.; Zamir, D. 1994. A genomic library of Lycopersicon pennellii in L. esculen-
tum: a tool for fine mapping of genes. Euphytica 79:175-179.

Eshed, Y.; Zamir, D. 1995. An introgression line population of Lycopersicon pennellii in
the cultivated tomato enables the identification and fine mapping of yield associated
QTL. Genetics 141:1147-1162.

Figurski, D.; Helinski, D. R. 1979. Replication of an origin-containing derivative of
plasmid RK2 dependent on a plasmid function provided in trans. Proc. Natl. Acad. Sci.
USA 76:1648-1652.

Flor, H.H. 1971. Current status of the gene-for-gene concept. Annu. Rev. Phytopathol.
9:275-296.

Glazebrook, J.; Ausubel, F.M. 1996. Isolation of Arabidopsis mutants with enhanced dis-
ease susceptibility by direct screening. Genetics 143: 973-982.

Golemis, E.A.; Brent, R. 1997. Searching for interacting proteins with the two-hybrid
system III. In The Yeast Two-Hybrid System. Ed. by P.L. Bartel and S. Fields. Oxford
University Press, New York. p. 43-72.

Gopalan, S.; Bauer, D.W.; Alfano, J.A.; Loniello, A.O.; He, S.Y.; Collmer, A. 1996. Ex-
pression of the Pseudomonas syringae avirulence protein AvrB in plant cells alleviates its
dependence on the hypersensitive response and pathogenicity (Hrp) secretion system in
eliciting genotype-specific hypersensitive cell death. Plant Cell 8:1095-1105.

Grant, M.R.; Godiard, L.; Straube, E.; Ashfield, T.; Lewald, J.; Sattler, A.; Innes, R.W.;
Dangl, J.L. 1995. Structure of the Arabidopsis RPMI gene enabling dual specificity dis-
ease resistance. Science 269:843-846.

Hammond-Kosack, K.E.; Jones, J.D.G. 1997. Plant disease resistance genes. Annu. Rev.
Plant Physiol. Plant Mol. Biol. 48:575-607.

Hanekamp, T.; Kobayashi, D.; Hayes, S.; Stayton, M.M. 1997. Avirulence gene D of
Pseudomonas syringae pv. tomato may have undergone horizontal gene transfer. FEBS
Letters 415:40-44.











He, S.Y.; Huang, H.C.; Collmer, A. 1993. Pseudomonas syringae pv syringae harpinpss :a
protein that is secreted via the hrp pathway and elicits the hypersensitive response in
plants. Cell 73:1255-1266.

Hibberd, A.M.; Stall, R.E.; Basset, M.J. 1987. Different phenotypes are associated with
incompatible races and resistance genes in the bacterial spot disease of pepper. Plant Dis.
70:337-339.

Hope, I.A.; Struhl, K. 1986. Functional dissection of a eukaryotic transcriptional activator
protein, GCN4 of yeast. Cell 46:885-894.

Hopkins, C.M.; White, F.F.; Choi, S.H.; Guo, A.; Leach, J.E. 1992. A family of aviru-
lence genes from Xanthomonas oryzae pv. oryzae. Mol. Plant-Microbe Interact. 5:451-
459.

Hueck, C.J. 1998. Type III protein secretion systems in bacterial pathogens of animals
and plants. Microbiol. and Mol. Biol. Rev. 62:379-433.

Hyun Ham, J.; Bauer, D.W.; Fouts, D.E.; Collmer, A. 1998. A cloned Erwinia chrysan-
themi Hrp (type III protein secretion system) functions in Escherichia coli to deliver
Pseudomonas syringae Avr signals to plant cell and to secrete Avr proteins in culture.
Proc. Natl. Acad. Sci. USA 95:10206-10211.

Jiang, Q.; Gresshoff, P.M. 1997. Classical and Molecular Genetics of the model legume
Lotus japonicus. Mol. Plant-Microbe Interact. 10:59-68

Johal, G.S.; Briggs, S.R. 1992. Reductase activity encoded by the HM1 disease resistance
gene in maize. Science 258:985-987.

Jones, D.A.; Thomas, C.M.; Hammond-Kosack, K.E.; Balint-Kurti, P.J.; Jones, J.W.
1994. Isolation of the tomato Cf-9 gene for resistance to Cladosporium fulvum by trans-
poson tagging. Science 266:789-93.

Jones, J.B.; Bouzar, H.; Somodi, G.C.; Stall, R.E.; Pernezny, K.; El-Morsy, G.; Scott,
J.W. 1998a. Evidence for the preemptive nature of tomato race 3 of Xanthomonas cam-
pestris pv. vesicatoria in Florida. Phytopathology 88:33-38.

Jones, J.B.; Scott, J.W. 1986. Hypersensitive response in tomato to Xanthomonas cam-
pestris pv. vesicatoria. Plant Dis. 70:337-339.

Jones, J.B.; Stall, R.E.; Bouzar, H. 1998b. Diversity among Xanthomonas pathogenic on
pepper and tomato. Annu. Rev. Phytopathol. 36:41-58.

Jones, J.B.; Stall, R.E.; Scott, J.W.; Somodi, G.C.; Bouzar, H.; Hodge, N.C. 1995. A third
race of Xanthomonas campestris pv. vesicatoria. Plant Disease 79:395-398.











Kapila, J.; De Rycke, R.; Van Montagu, M.; Angenon, G. 1997. An Agrobacterium-
mediated transient gene expression system for intact leaves. Plant Science 122:101-108.

Kearney, B.; Staskawicz, B.J. 1990. Widespread distribution and fitness contribution of
Xanthomonas campestris avirulence gene avrBs2. Nature 346:541-543.

Kim, J.F.; Charkowski, A.O.; Alfano, J.R.; Collmer, A.; Beer, S.V. 1998. Sequences re-
lated to transposable elements and bacteriophages flank avirulence genes of Pseudomo-
nas syringae. Plant-Microbe Interact. 11:1247-1252.

Klement, Z. 1982. Hypersensitivity. In Phytopathogenic prokaryotes. Ed by M.S. Mount
and G.S. Lacy. Academic Press, New York. p. 150-175 (vol. 2).

Konieczny, A.; Ausubel, F.M. 1993. A procedure for mapping Arabidopsis mutations
using co-dominant ecotype-specific PCR-based markers. Plant J. 4:403-410.

Lamb, C.; Dixon, R.A. 1997. The oxidative burst in plant disease resistance. Annu. Rev.
Plant Physiol. Plant Mol. Biol. 48:251-275.

Lander, E.S.; Green, P.; Abrahamson, J.; Barlow, A.; Daly, M.J.; Lincoln, S.E.; New-
burg, L. 1987. MAPMAKER: An interactive computer package for constructing primary
genetic linkage maps of experimental and natural populations. Genomics 1:174-181.

Lanzillo, J.J. 1990. Preparation of Dioxigenin-labeled probes by the polymerase chain
reaction. Biotechniques 8: 621-622.

Lawrence, G.J.; Finnegan, E.J.; Ayliffe, M.A.; Ellis, J.G. 1995. The L6 gene for flax rust
resistance is related to the Arabidopsis bacterial resistance gene RPS2 and the tobacco
viral resistance gene N. The Plant Cell 7: 1195-206.

Leach, J.E.; White, F.F. 1996. Bacterial avirulence genes. Annu. Rev. Phytopathol. 34:
153-179.

Leister, R.T.; Ausubel, F.M.; Katagiri, F. 1996. Molecular recognition of pathogen attack
occurs inside the plant cells in plant disease resistance specified by the Arabidopsis gene
RPS2 and RPM1. Proc. Natl. Acad. Sci. USA 93:15497-15502.

Levings, C.S.; Rhoads, D.M.; Siedow, J.N. 1995. Molecular interactions of Bipolaris
maydis T-toxin and maize. Can. J. Bot. 73:S483-S489.

Lincoln, S.E.; Daly, M.; Lander, E.S. 1992. Constructing genetic maps with Map-
Maker/EXP 3.0. Whitehead Institute Technical Report. 3rd ed.











Loh, Y.T.; Martin, G.B. 1995. The Pto bacterial resistance gene and the Fen insecticide
sensitivity gene encode functional protein kinases with serine/threonine specificity. Plant
Physiol. 108:1735-1739.

Lorang, J.M.; Keen, N.T. 1995. Characterization of avrE from Pseudomonas syringae pv.
tomato: a hrp-linked avirulence locus consisting of at least two transcriptional units. Mol.
Plant-Microbe Interact. 8:49-57.

Maniatis, T.; Fritsch, E. F.; Sambrook, J. (eds.) 1982. Molecular cloning: a laboratory
manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

Martin, G.B.; Brommonschenkel, S.H.; Chunwongse, L.; Frary, A.; Ganal, M.W.;
Spivey, R.; Wu, T.; Earle, E.D.; Tanksley, S.D. 1993. Map-based cloning of a protein ki-
nase gene conferring disease resistance in tomato. Science 262:1432-1436.

Martin, G.B.; Frary, A.; Wu, T.; Brommonschenkel, S.; Chunwongse, J.; Earle, E.D.;
Tanksley, S.D. 1994. A member of the tomato Pto gene family confers sensitivity to
fenthion resulting in rapid cell death. The Plant Cell 6:1543-1552.

McNally K.L.; Mutschler, M.A. 1997. Use of introgression lines and zonal mapping to
identify RAPD markers linked to QTL. Molecular Breeding: New strategies in plant im-
provement 3: 203-212.

Michelmore, R.W.; Paran, I.; Kesseli, R.V. 1991. Identification of markers linked to dis-
ease resistance genes by bulked segregant analysis: a rapid method to detect markers in
specific genomic regions by using segregating populations. Proc. Natl. Acad. Sci. USA
88:9828-9832.

Mindrinos, M.; Katagiri, E.; Yu, G.L.; Ausubel, F.M. 1994. The A. thaliana disease re-
sistance gene RPS2 encodes a protein containing a nucleotide-binding site and leucine-
rich repeats. Cell 78: 1089-1099.

Minsavage, G.V.; Dahlbeck, D.; Whalen, M.C.; Kearney, B.; Bonas, U.; Staskawicz,
B.J.; Stall, R.E. 1990. Gene-for-gene relationships specifying disease resistance in Xan-
thomonas campestris pv. vesicatoria pepper interactions. Mol. Plant-Microbe Interact.
3:41-47.

Minsavage, G.V.; Jones, J.B.; Stall, R.E. 1996. Cloning and sequencing of an avirulence
gene (avrRxv3) isolated from Xanthomonas campestris pv. vesicatoria tomato race 3.
Phytopathology 86:S15 (Abstr.)

Moreau, P.; Thoquet, P.; Olivier, J.; Laterrot, H.; Grimsley, N. 1998. Genetic mapping of
Ph-2, a single locus controlling partial resistance to Phytophthora infestans in tomato.
Mol. Plant-Microbe Interact. 11:259-269.











Oldroyd, G.E.D.; Staskawicz, B.J. 1998. Genetically engineered broad-spectrum disease
resistance in tomato. Proc. Natl. Acad. Sci. USA 95:10300-10305.

Ori, N.; Eshed, Y.; Paran, I.; Presting, G.; Dvora, A.; Tanksley, S.; Zamir, D.; Fluhr, R.
1997. The I2C family from the wilt disease resistance locus 12 belongs to the nucleotide
binding, leucine-rich repeat superfamily of plant resistance genes. The Plant Cell 9:521-
532.

Osbourn, A.E. 1996. Preformed antimicrobial compounds and plant defense against fun-
gal attack. Plant Cell 8:1821-1831.

Paran, I.; Michelmore, R.W. 1993. Development of reliable PCR-based markers linked to
downy mildew resistance genes in lettuce. Theor. Appl. Genet. 85:985-993.

Parker, J.E.; Coleman, J.M. 1997. Molecular intimacy between proteins specifying plant-
pathogen recognition. TIBS 22:291-296.

Parker, J.E.; Holub, E.B.; Frost, L.N.; Falk, A.; Gunn, N.D.; Daniels, M.J. 1996. Charac-
terization of eds], a mutation in Arabidopsis suppressing resistance to Peronospora para-
sitica specified by several different RPP genes. The Plant Cell 8:2033-2046.

Pohronezny, K.; Volin, R.B. 1983. The effect of bacterial spot on yield and quality of
fresh market tomatoes. HortScience 18:69-70.

Prabhu, S.; Gresshoff, P.M. 1994. Inheritance of polymorphic markers generated by
DNA amplification fingerprinting and their use as genetic markers in soybean. Plant Mol.
Biol. 26:105-116.

Prince, J.P.; Zhang,Y.; Radwanski, E.R.; Kyle, M.M. 1997. A high-yielding and versatile
DNA extraction protocol for Capsicum. HortScience 32:937-939.

Rafalski, J.A.; Vogel, J.M.; Morgante, M.; Powell, W.; Andre, C.; Tingey, S.V. 1996.
Generating and using DNA markers in plants. In Nonmammallian Genomic Analysis: A
Practical Guide. Ed. by B. Birren and E. Lai. USA. Academic Press. p. 75-129.

Ritchie, D.F.; Dittapongpitch, V. 1991. Copper- and streptomycin-resistant strains and
host differentiated races of Xanthomonas campestris pv. vesicatoria in North Carolina.
Plant Dis. 75:733-736.

Ritter, C.; Dangl, J.L. 1995. The avrRpml gene of Pseudomonas syringae pv. maculicola
is required for virulence on Arabidopsis. Mol. Plant-Microbe Interact. 8:444-453.

Ronald, P.C.; Staskawicz, B.J. 1988. The avirulence gene avrBs] from Xanthomonas
campestris pv. vesicatoria encodes a 50-kD protein. Mol. Plant-Microbe Interact. 1:191-
198.











Sahin, F.; Miller, S.A. 1996. Characterization of Ohio strains of Xanthomonas campestris
pv. vesicatoria, causal agent of bacterial spot of pepper. Plant Dis. 80:773-778.

Salmeron, J.M.; Barker, S.J.; Carland, F.M.; Mehta, A.Y.; Staskawicz, B.J. 1994. Tomato
mutants altered in bacterial disease resistance provide evidence for a new locus control-
ling pathogen recognition. Plant Cell 6:511-520.

Sambrook, J.; Fritsch, E. F.; Maniatis, T. (eds.). 1989. Molecular Cloning: A Laboratory
Manual. Cold Spring Harbor, N.Y., Cold Spring Harbor Laboratory. 1546 pp.

Scofield, S.R.; Tobias, C.M.; Rathjen, J.P.; Chang, J.H.; Lavelle, D.T.; Michelmore,
R.W.; Staskawicz, B.J. 1996. Molecular basis of gene-for-gene specificity in bacterial
speck disease of tomato. Science 274:2063-2065.

Scott, J.C.; Jones, J.B.; Somodi, G.C.; Stall, R.E. 1995. Screening tomato accessions for
resistance to Xanthomonas campestris pv. vesicatoria. HortScience 30:570-581.

Scott, J.W.; Jones, J.B. 1986. Sources of resistance to bacterial spot (Xanthomonas cam-
pestris pv. vesicatoria (Doidge) Dye) in tomato. HortScience 21:304-306.

Scott, J.W.; Jones, J.B. 1989. Inheritance of resistance to foliar bacterial spot of tomato
incited by Xanthomonas campestris pv. vesicatoria. J. Am. Soc. Hort. Sci. 114:111-114.

Shaw, G. 1995. Protein sequence interpretation using a Spreadsheet program. BioTech-
niques 19:978-983.

Song, W.Y.; Wang, G.L.; Chen, L.L.; Kim, H.S.; Pi L.Y.; Holten, T.; Gardner, J.; Wang,
B.; Zhai, W.-X.; Fauquet, C.; Ronald, P. 1995. A receptor kinase-like protein encoded by
the rice disease resistance gene, Xa21. Science 270:1804-1806.

Southern, E. 1975. Detection of specific sequences among DNA fragments separated by
gel electrophoresis. J. Mol. Biol. 98:503-517.

Stachel, S. E.; An, G.; Flores, C.; Nester, E. W. 1985. A Tn3 lacZ transposon for the ran-
dom generation of P-galactosidase gene fusions: application to the analysis of gene ex-
pression in Agrobacterium. EMBO J. 4:891-898

Stall, R.E. 1995a. Xanthomonas campestris pv. vesicatoria : cause of bacterial spot on
tomato and pepper. In Xanthomonas. Ed. by J.G. Swings, E.L. Civerolo, Chapman and
Hall, London. p. 57-60.

Stall, R.E. 1995b. Xanthomonas campestris pv. vesicatoria. In Pathogenesis and host
specificity in plant diseases: Histopathological, biochemical, genetic and molecular bases.
Ed. by U.S. Singh, R.P. Singh, K. Kohmoto, Elsevier Science, New York. p. 167-181.











Stall, R.E.; Beaulieu, C.; Egel, D.; Hodge, N.C.; Leite, R.R.; Minsavage, G.V.; Bouzar,
H.; Jones, J.B.; Alvarez, A.M.; Benedict, A.A. 1994. Two genetically diverse groups of
strains are included in a pathovar of Xanthomonas campestris. Int. J. Syst. Bacteriol.
44:47-53.

Stall, R.E.; Loschke, D.C.; Jones, J.B. 1986. Linkage of copper resistance and avirulence
loci on a self-transmissible plasmid in Xanthomonas campestris pv. vesicatoria. Phyto-
pathology 76:240-243.

Stall, R.E.; Thayer, P.L. 1962. Streptomycin resistance of the bacterial spot pathogen and
control with streptomycin. Plant Dis. Rep. 46:389-392.

Staskawicz, B.; Dahlbeck, D.; Keen, N.T. 1984. Cloned avirulence gene of Pseudomonas
syringae pv. glycinea determines race-specific imcompatibility on Glycines max (L.)
Merr. Proc. Natl. Acad. Sci. USA 81:6024-6028.

Swarup, S.; Yang, Y.; Kingsley, M.T.; Gabriel, D.W. 1992. A Xanthomonas citri patho-
genicity gene, pthA, pleiotropically encodes gratuitous avirulence on nonhost. Mol. Plant-
Microbe Interact. 5:204-213.

Swords, K.M.M.; Dalhbeck, D.; Kearney, B.; Roy, M.; Staskawicz, B.J. 1996. Spontane-
ous and induced mutations in a single open reading frame alter both virulence and aviru-
lence in Xanthomonas campestris pv. vesicatoria avrBs2. J. Bacteriol. 178: 4661-4669.

Tamaki, S.; Dahlbeck, D.; Staskawicz, B.; Keen, N.T. 1988. Characterization and expres-
sion of two avirulence genes cloned from Pseudomonas syringae pv. glycinea. J. Bacte-
riol. 170:4846-4854.

Tamaki, S.J.; Kobayashi, D.Y.; Keen, N.T. 1991. Sequence domains required for the ac-
tivity of avirulence genes avrB and avrC from Pseudomonas syringae pv. glycinea. J.
Bacteriol. 173:301-307.

Tang, X.; Frederick, R.D.; Zhou, J.; Halterman, D.A.; Jia, Y.; Martin, G.B. 1996. Initia-
tion of plant disease resistance by physical interaction of AvrPto and Pto kinase. Science
274:2060-2063.

Tanksley, S.D.; Ganal, M.W.; Martin, G.B. 1995. Chromosome landing: a paradigm for
map-based gene cloning in plants with large genomes. TIG 11:63-68.

Tanksley, S.D.; Ganal, M.W.; Prince, J.P.; Devicente, M.C.; Bonierbale, M.W.; Broun,
P.; Fulton, T.M.; Giovannoni, J.J.; Grandillo, S.; Martin, G.B.; Messeguer, R.; Miller,
J.C.; Miller, L.; Paterson, A.H.; Pineda, 0.; Roder, M.S.; Wing, R. A.; Wu, W.; Young;
N.D. 1992. High density molecular linkage maps of the tomato and potato genomes. Ge-
netics 132:1141-1160.











Thomas, C.M.; Jones, D.A.; Parniske, M.; Harrison, K.; Balint-Kurti, P.J.; Hatzixanthis,
K.; Jones, J.D.G. 1997. Characterization of the tomato Cf-4 gene for resistance to Clado-
sporium fulvum identifies sequences that determine recognitional specificity in Cf-4 and
Cf-9. The Plant Cell 9: 2209-2224.

Tudor-Nelson, S.M.; Jones, J.B.; Minsavage, G.V.; Stall, R.E. 1995. Characterization and
antagonism of tomato race 3 strains of Xanthomonas campestris pv. vesicatoria to other
strains of the same bacterium. (Abstr) Phytopathology 85:1148.

Van den Ackerveken, G.; Morois, E.; Bonas, U. 1996. Recognition of the bacterial
avirulence protein AvrBs3 occurs inside the host plant cell. Cell 87:1307-1316.

Vauterin, L.; Hoste, B.; Kerters, K.; Swings, J. 1995. Reclassification of Xanthomonas.
Int. J. Syst. Bacteriol. 45:472-489.

Vos, R.H.; Bleeker, M.; Reijans, M.; van deLee, T.; Homes, M.; Frijters, A.; Pot, J.;
Peleman, J.; Kuiper, M.; Zabeau, M. 1995. AFLP: a new technique for DNA finger-
printing. Nucl. Acids Res. 23:4407-4414.

Wang, J-F.; Stall, R.E.; Vallejos, C.E. 1994. Genetic analysis of a complex hypersensi-
tivity-associated resistance to Xanthomonas campestris pv. vesicatoria in tomato. Phyto-
pathology 84:126-132.

Wei, Z.M.; Laby, R.J.; Zumoff, C.H.; Bauer, D.W.; He, S.Y.; Collmer, A.; Beer, S.V.
1992. Harpin, elicitor of the hypersensitive response produced by the plant pathogen Er-
winia amylovora. Science 257:85-88.

Welsh, J.; McClelland, M. 1990. Fingerprinting genomes using PCR with arbitrary prim-
ers. Nucl. Acids Res. 18:7213-7218.

Whalen, M.C.; Wang, J-F.; Carland, F.M.; Heiskell, M.E.; Dahlbeck, D.; Minsavage,
G.V.; Jones, J.B.; Scott, J.W.; Stall, R.E.; Staskawicz, B.J. 1993. Avirulence gene avrRxv
from Xanthomonas campestris pv. vesicatoria specifies resistance on tomato line Hawaii
7998. Mol. Plant-Microbe Interact. 6:616-627.

Whitham, S.; McCormick, S.; Baker, B. 1996. The N gene of tobacco confers resistance
to tobacco mosaic virus in transgenic tomato. Proc. Natl. Acad. Sci. USA 93:8776-8781.

Willians, J.G.K.; Kubelik, A.R.; Livak, K.J.; Rafalski, J.A.; Tingey, S.V. 1990. DNA
polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucl. Acids.
Res. 18:6531-6535.

Wood, J.R.; Vivian, R.; Jenner, C.; Mansfield, J.W.; Taylor, J.D. 1994. Detection of a
gene in pea controlling nonhost resistance to Pseudomonas syringae pv. phaseolicola.
Mol. Plant-Microbe Interact. 7:534-537.











Yang, Y.; de Feyter, R.; Gabriel, D.W. 1994. Host-specific symptoms and increase re-
lease of Xanthomonas citri and Xanthomonas campestris pv. malvacearum from leaves
are determined by a 102-bp tandem repeats of pthA and avrb6, respectively. Mol. Plant-
Microbe Interact. 7:345-355.

Yang, Y.; Shah, J.; Klessig, D.F. 1997. Signal perception and transduction in plant dis-
ease responses. Gene Dev. 11:1621-1639.

Yang, Y.; Yuan, Q.; Gabriel, D.W. 1996. Watersoaking functions of XcmH1005 are
redundantly encoded by members of the Xanthomonas avr/pth gene family. Mol. Plant-
Microbe Interact. 9:105-113.

Yoder, O.C. 1980. Toxins in pathogenesis. Ann. Rev. Phytopathol. 18:103-129.

Yu, H.Z.; Wang, J.F.; Stall, R.E.; Vallejos, C.E. 1995. Genomic localization of tomato
genes that control a hypersensitive reaction to Xanthomonas campestris pv. vesicatoria
(Doidge) Dye. Genetics 141:675-682.

Yu, Y-G.; Buss, G.R.; Saghai Maroof, M.A. 1996. Isolation of a superfamily of candidate
disease-resistance genes in soybean based on a conserved nucleotide-binding site. Proc.
Natl. Acad. Sci. USA 93: 11751-11756.

Yucel, I.; Midland, S.L.; Sims, J.J.; Keen, N.T. 1994. Class I and Class II avrD alleles
direct the production of different products in gram-negative bacteria. Mol. Plant-Microbe
Interact. 7:148-150.

Zhou, J.M.; Tang, X.Y.; Martin, G.B. 1997. The Pto kinase conferring resistance to to-
mato bacterial speck disease interacts with proteins that bind a cis-element of pathogene-
sis-related genes. EMBO J. 16:3207-3218.

Zhu, W.; Yang, B.; Chittoor, J.M.; Johnson, L.B.; White, F.F. 1998. AvrXal0 contains an
acidic transcriptional activation domain in the functionally conserved C terminus. Mol.
Plant-Microbe Interact. 11: 824-832.

Zidock, N.K.; Backman, P.A.; Shaw, J.J. 1992. Promotion of bacterial infection of leaves
by an organosilicone surfactant: implications for biological weed control. Biological
control 2:111-117.















BIOGRAPHICAL SKETCH

Gustavo Astua-Monge was born on July 8, 1967, to Miguel Astua and Maria de los

Angeles Monge in San Jose, Costa Rica. He received a degree of Bachiller en Ingenieria

Agronomica from the Universidad de Costa Rica in 1990 and graduated as Licenciado en

Ingenieria Agronomica in 1991 at the same institution. From 1991 to 1993, he worked as

a teaching assistant and junior research scientist at the Plant Pathology Laboratory of the

University of Costa Rica. In 1993, he obtained a fellowship from LASPAU/FULBRIGHT

and came to the United States to pursue a Master of Science degree in plant pathology at

the University of Florida, which was completed in 1995. Gustavo was granted an assis-

tantship to continue his graduate studies towards a Doctor of Philosophy degree in plant

pathology at the University of Florida. Upon completion of his Ph.D. degree, Gustavo will

be joining Dr. Eduardo Vallejos' program as a postdoctoral fellow.




University of Florida Home Page
© 2004 - 2010 University of Florida George A. Smathers Libraries.
All rights reserved.

Acceptable Use, Copyright, and Disclaimer Statement
Last updated October 10, 2010 - - mvs