• TABLE OF CONTENTS
HIDE
 Front Cover
 Copyright
 Main
 Back Matter
 Back Cover






Group Title: journal of Caribbean ornithology
Title: The Journal of Caribbean ornithology
ALL VOLUMES CITATION PDF VIEWER THUMBNAILS PAGE IMAGE ZOOMABLE
Full Citation
STANDARD VIEW MARC VIEW
Permanent Link: http://ufdc.ufl.edu/UF00100142/00002
 Material Information
Title: The Journal of Caribbean ornithology
Physical Description: v. : ill. ; 28 cm.
Language: English
Creator: Society for the Conservation and Study of Caribbean Birds
Publisher: Society for the Conservation and Study of Caribbean Birds / Sociedad para la Conservatción Y Estudio de Las Aves Caribeñas/Société pour la Conservation et L'Etude de Caraïbe
Place of Publication: Ridgewood, NY
Publication Date: Special Issue, 2004
Frequency: three issues a year
three times a year
regular
 Subjects
Subject: Ornithology -- Periodicals -- Caribbean Area   ( lcsh )
Ornithology -- Periodicals -- West Indies   ( lcsh )
Birds -- Conservation -- Periodicals -- Caribbean Area   ( lcsh )
Birds -- Conservation -- Periodicals -- West Indies   ( lcsh )
Genre: periodical   ( marcgt )
 Notes
Language: In English, French and Spanish.
Dates or Sequential Designation: Vol. 16, no. 1 (Spring 2004)-
General Note: Title from cover.
 Record Information
Bibliographic ID: UF00100142
Volume ID: VID00002
Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
Resource Identifier: oclc - 52094634
lccn - 2003212636
issn - 1544-4953
 Related Items
Preceded by: Pitirre

Downloads

This item has the following downloads:

PDF ( 24 MBs ) ( PDF )


Table of Contents
    Front Cover
        Front Cover
    Copyright
        Copyright
    Main
        Page 1
        Page 2
        Page 3
        Page 4
        Page 5
        Page 6
        Page 7
        Page 8
        Page 9
        Page 10
        Page 11
        Page 12
        Page 13
        Page 14
        Page 15
        Page 16
        Page 17
        Page 18
        Page 19
        Page 20
        Page 21
        Page 22
        Page 23
        Page 24
        Page 25
        Page 26
        Page 27
        Page 28
        Page 29
        Page 30
        Page 31
        Page 32
        Page 33
        Page 34
        Page 35
        Page 36
        Page 37
        Page 38
        Page 39
        Page 40
        Page 41
        Page 42
        Page 43
        Page 44
        Page 45
        Page 46
        Page 47
        Page 48
        Page 49
        Page 50
        Page 51
        Page 52
        Page 53
        Page 54
        Page 55
        Page 56
        Page 57
        Page 58
        Page 59
        Page 60
        Page 61
        Page 62
        Page 63
        Page 64
        Page 65
        Page 66
        Page 67
        Page 68
        Page 69
        Page 70
        Page 71
        Page 72
        Page 73
        Page 74
        Page 75
        Page 76
        Page 77
        Page 78
        Page 79
        Page 80
        Page 81
        Page 82
        Page 83
        Page 84
        Page 85
        Page 86
        Page 87
        Page 88
        Page 89
        Page 90
        Page 91
        Page 92
        Page 93
        Page 94
        Page 95
        Page 96
        Page 97
        Page 98
        Page 99
        Page 100
        Page 101
        Page 102
        Page 103
        Page 104
        Page 105
        Page 106
        Page 107
        Page 108
        Page 109
        Page 110
        Page 111
        Page 112
        Page 113
        Page 114
        Page 115
        Page 116
        Page 117
        Page 118
        Page 119
        Page 120
        Page 121
        Page 122
        Page 123
        Page 124
        Page 125
        Page 126
        Page 127
        Page 128
        Page 129
        Page 130
        Page 131
        Page 132
        Page 133
        Page 134
        Page 135
        Page 136
        Page 137
        Page 138
        Page 139
        Page 140
        Page 141
        Page 142
        Page 143
        Page 144
        Page 145
        Page 146
        Page 147
        Page 148
        Page 149
        Page 150
        Page 151
        Page 152
        Page 153
        Page 154
        Page 155
        Page 156
        Page 157
        Page 158
        Page 159
        Page 160
    Back Matter
        Back Matter
    Back Cover
        Back Cover
Full Text










STHE JOURNAL OF


CARIBBEAN ORNITHOLOGY

SOCIETY FOR THE CONSERVATION AND STUDY OF CARIBBEAN BIRDS
SOCIEDAD PARA LA CONSERVACION Y ESTUDIO DE LAS AVES CARIBErAS
SOCIETE POUR LA CONSERVATION ET L'ETUDE DES OISEAUX DE LA CARAIBE

2004 Special Issue
(ISSN 1527-7151)

Formerly EL PITIRRE


A SPECIAL ISSUE HONORING THE MEMORY OF NEDRA KLEIN (1951-2001)


CONTENTS

IN M EMORIAM: NEDRA KATHRYN KLEIN, 1951-2001. Shannon J. Hackett ............................................................................................ 1
MOLECULAR PHYLOGENETIC RELATIONSHIPS AMONG THE WOOD WARBLERS (PARULIDAE) AND HISTORICAL BIOGEOGRAPHY IN
THE CARIBBEAN BASIN. Nedra K. Klein, Kevin J. Bums, Shannon J. Hackett, and Carole S. Griffiths ........................................ 3
GEOGRAPHIC VARIATION IN BODY MASS OF THE BANANAQUIT (COEREBA FLAVEOLA) IN THE TRINIDAD AND TOBAGO ARCHIPEL-
AGO. FloydE. Hayes, StewartA. White, RichardP. ffrench, and Stefan Bodnar ............................... ................ 18
INDEPENDENT GEOGRAPHIC ORIGINS OF THE GENUS AMAZONA IN THE WEST INDIES. Patricia Ottens-Wainright, Kenneth M.
Halanych, Jessica R. Eberhard, Rachel I Burke, James W. Wiley, Rosemarie S. Gnam, andXiomara GdlvezAquilera ................ 23



ISLAND TREASURES: AVIAN RESEARCH AND CONSERVATION IN THE CARIBBEAN
A SYMPOSIUM PRESENTED AT THE THIRD NORTH AMERICAN ORNITHOLOGICAL CONFERENCE
25 SEPTEMBER 2002

ISLAND TREASURES: AVIAN RESEARCH AND CONSERVATION IN THE CARIBBEAN-INTRODUCTION. Rosemarie Gnam ...................... 50
CURRENT STATUS OF CUBAN THREATENED BIRDS: CASE STUDIES OF CONSERVATION PROGRAMS. Martin Acosta, Lourdes
Mugica, Orlando Torres, Dennis Denis, Ariam Jiminez, and Antonio Rodriguez ................................................ ............... 52
AVIAN RESEARCH, MONITORING, AND CONSERVATION IN THE DOMINICAN REPUBLIC. Kate Wallace ................................................. 59
BmRDLIFE JAMAICA INFLUENCING CONSERVATION IN JAMAICA. Catherine Levy and Suzanne Davis ............................................ 62
ORNITHOLOGICAL RESEARCH AND CONSERVATION EFFORTS IN PUERTO RICO. Adrianne G. Tossas ............................................... 67
THE WEST INDIAN WHISTLING-DUCK AND WETLANDS CONSERVATION PROJECT: A MODEL FOR SPECIES AND WETLANDS
CONSERVATION AND EDUCATION. Lisa G. Sorenson, Patricia E. Bradley, and Ann Haynes Sutton .......................................... 72
A RESEARCH AND TRAINING PROGRAM FOR CONSERVATION OF WINTERING KIRTLAND'S WARBLER AND ASSOCIATED SPECIES
IN THE BAHAMAS: THE FIRST FIELD SEASON. Eric Carey, Joseph M. Wunderle, Jr., and David N. Ewert ...................................... 81
THE STATUS OF RESIDENT AND MIGRANT BIRD COMMUNITIES IN CUBAN ECOSYSTEMS. Hiram Gonzalez Alonso, Alejandro
Llanes Sosa, Barbara Sdnchez Oria, Daysi Rodriguez Batista, Eneider Perez Mena, Pedro Blanco Rodriguez, and Ramona
Oviedo Prieto ..... ......... .. ....... ...... .. .................................................... 86
STATUS AND CONSERVATION OF THE FAMILY PSITTACIDAE IN THE WEST INDIES. James W. Wiley, Rosemarie S. Gnam, Susan E.
Koenig, Alwin Dorelly, Xiomara Gdlvez, Patricia E. Bradley, Thomas White, Michael Zamore, Paul R, Reillo, and Donald
A n th o ny ...... .... ............ ........ .. ................. .................................................. .. ................... ................................... 9 4
THE ROLE OF THE NON-PROFESSIONAL IN CARIBBEAN ORNITHOLOGY. Carolyn Wardle, Kate Wallace, and Lynn Gape ................... 154
THE CHALLENGE FOR FUTURE RESEARCH AND CONSERVATION EFFORTS IN THE CARIBBEAN. HerbertA. Raffaele .......................... 158











THE JOURNAL OF CARIBBEAN ORNITHOLOGY


THE JOURNAL OF THE SOCIETY FOR THE CONSERVATION AND STUDY OF CARIBBEAN BIRDS
LA REVISTA DE LA SOCIEDAD PARA LA CONSERVACION Y ESTUDIO DE LAS AVES CARIBENAS
LE JOURNAL DE LA SOCIETE POUR LA CONSERVATION ET L'ETUDE DES OISEAUX DE LA CARAIBE




Editor for this Special Issue: James W. Wiley, Maryland Cooperative Fish and Wildlife Research Unit, 1120
Trigg Hall, University ofMaryland Eastern Shore, Princess Anne, Maryland 21853, USA; Telephone:
(410) 651-7654; Fax: (410) 651-7662; e-mail: jwwiley@mail.umes.edu


Journal Editor: Dr. Jerome A. Jackson, Whitaker Center for Science, Mathematics, and Technology Education,
Florida Gulf Coast University, 10501 FGCU Blvd. South, Ft. Myers, Florida 33965-6565, USA; Tele-
phone: 941-590-7193; Facsimile: 941-590-7200; E-mail: jjackson@fgcu.edu
Associate Editor: Adrianne G. Tossas, Department of Biology, University of Puerto Rico, Rio Piedras, PR
00931; e-mail: agtossas@hotmail.com
Associate Editor for French West Indies: Philippe Feldmann, CIRAD-Micap, TA 179/03, F-34398 Montpellier
cedex 5, France; e-mail: philippe.feldmann@cirad.fr
Associate Editor for Spanish-Language Materials: Jos6 Placer, Coereba Society (www.coereba.org); e-mail:
jplacer@coereba. org
News, comments, requests, and manuscripts should be mailed to the Editor or an Associate Editor for inclusion
in the newsletter.
Noticias, comentarios, peticiones y manuscritos deben ser enviadas al Editor o Editor Asociado para inclusi6n
en el boletin.




The Society for the Conservation and Study of Caribbean Birds (SCSCB) is a non-profit organization under
section 501(c)3 of the United States' Internal Revenue Code. All contributions are fully tax-deductible to the
extent allowed by U.S. law. We welcome private support from individuals, corporations, and foundations.
Outright gifts, and pledges, may be made by contacting the SCSCB Treasurer at ilothian@msn.com or by
writing to PO Box 863208, Ridgewood NY 11386, USA.









The Society for the Conservation and Study of Caribbean Birds thanks Winged Ambassadors and the Division of
International Conservation of the U. S. Fish and Wildlife Service for their support
We thank the Coereba Society (www.coereba.org) for their editorial and translation assistance.





























IN MEMORIAM

NEDRA KATHRYN KLEIN, 1951-2001

SHANNON J. HACKETT
Department ofZoology, Field Museum of Natural History,
1400 South Lake Shore Drive, Chicago, IL 60605, USA


NEDRA KATHRYN KLEIN, a member of the
American Ornithologists' Union since 1979 and
Elective Member since 1998, died 12 May 2001 in
Bames-Jewish Hospital in St. Louis, Missouri, of
complications following open-heart surgery. Nedra
was bor in Chicago, Illinois on 30 April 1951 and
grew up in the Chicago suburb of Wilmette. As a
teenager, she was diagnosed with Hodgkin's dis-
ease. The extensive radiation treatments she en-
dured cured her of that disease (she was among the
first cohort of survivors), but also set in motion the
long-term tissue and organ damage that contributed
to her death. By the early 1990s, Nedra's heart
problems were becoming debilitating. She had her
first open-heart surgery in the spring of 1995, and
the second in April 2001.
Nedra's interests in natural history began in child-
hood; she always loved warblers and their songs.
Nedra received a bachelor's degree in 1974 from
the University of Colorado in Boulder. She earned
her Master's degree in 1982 from the University of
Montana, studying vocalizations of American Red-
starts (Setophaga ruticilla) under the guidance of
Richard Hutto. After taking some time off from aca-
demics to be with her mother after her father died


(she worked in a bank for part of that time), Nedra
spent a year in Baton Rouge at the Louisiana State
University Museum of Natural Science, where she
honed her skills in museum science. She then went
to the University of Michigan to work on genetic
structure in Yellow Warblers (Dendroica petechia)
with Robert Payne, receiving her Ph.D. in 1993.
Nedra completed a post-doctoral research appoint-
ment at the University of Michigan working on the
co-speciation of nest parasitic indigo-birds (Vidua)
and their estrildid hosts. She then moved to the
American Museum of Natural History in New York
for post-doctoral work on the systematics, biogeog-
raphy, and conservation of Caribbean birds. Her
first open-heart surgery was performed during that
time. She recovered well from that surgery and was
able to conduct several more field seasons in the
Caribbean sponsored by both the American Mu-
seum and the Field Museum in Chicago, where she
was a research associate.
She held research and teaching appointments at
the University of Wisconsin, Madison and Lewis
and Clark University in Portland, Oregon, before
settling in 1998 as an assistant professor of biology
at Truman State University in Kirksville, Missouri.


The Journal of


Caribbean Ornithology

Society for the Conservation and Study of Caribbean Birds
Sociedadpara la Conservaci6n y Estudio de las Aves Caribehas
Society pour la Conservation et 'Etude des Oiseaux de la Caraibe

SPECIAL ISSUE HONORING NEDRA KLEIN









HACKETT-NEDRA KLEIN: IN MEMORIAM


Sierra de Bahoruco, Dominican Republic, June 1998.
Nedra Kleinand John Gerwin. Photograph by Kate Wal-
lace.

At Truman, she began a rewarding period of teach-
ing, fieldwork, and scientific research. An excellent
teacher, she imparted her passion for the natural
world to her students. When she died, Nedra was
working on the systematics and evolution of warblers
and the morphological, behavioral, genetic, and bio-
geographic evolution of Caribbean birds (Stripe-
headed Tanagers [Spindalis zena], among many oth-
ers).
Nedra will be remembered for her careful study of
morphological and molecular evolution of Yellow
Warblers and for her outspoken support of museum
collections and the need for documentation in the
form of voucher specimens. Encountering great resis-
tance to the idea of scientific collecting, she patiently
and persistently educated governmental and wildlife
officials on the value of documenting their biodiver-
sity through museum inventory work. Her specimens
are housed in many institutions in the United States,
Central and South America, the Caribbean, and Af-
rica. Her work in the Caribbean is her true legacy,
developed and continued through a network of col-
leagues and friends despite her physical limitations.
Nedra lived a life of the highest personal integrity.
She did not hesitate to halt or alter her academic ca-
reer for her family. Her mother lived with her during
her doctoral studies in Michigan until she died from
ovarian cancer. Despite many difficulties, Nedra
lived each day to the fullest. She triumphed over


Sierra de Neiba, Dominican Republic, 1998. Rob Wil-
liams (BirdLife), Nedra Klein, Doug Wechsler (VIREO),
and Dominican field assistant. Photograph by Kate Wal-
lace.

physical adversity to become a strong, independent,
loyal, and sometimes goofy woman. Her own fam-
ily was small, but she created families among her
friends wherever she lived. All now mourn her
death. I have lost a valued colleague and a dear
friend. The museum ornithological community has
lost a special champion.
Reprinted by permission from The Auk.


Sierra de Bahoruco, Villa Ida, Dominican Republic. Rob
Williams, ?, Nedra Klein, John Gerwin, Doug Wechsler,
and Rod Martins. Photograph by Kate Wallace.


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 2














MOLECULAR PHYLOGENETIC RELATIONSHIPS AMONG THE WOOD WARBLERS (PARULIDAE)
AND HISTORICAL BIOGEOGRAPHY IN THE CARIBBEAN BASIN

NEDRA K. KLEIN1, KEVIN J. BURNS2, SHANNON J. HACKETT3, AND CAROLE S. GRIFFITHS4

'Division ofScience, Truman State University, Kirksville, MO 63501, USA; 2Department ofBiology,
San Diego State University, San Diego, CA 92182-4614, USA; 3Department of Zoology, Field Mu-
seum of Natural History, Roosevelt Road at Lake Shore Drive, Chicago, IL 60605-2496, USA; and
4Biology Department, Long Island University, Brooklyn, NY and Department of Ornithology, Ameri-
can Museum of Natural History, Central Park West at 79th Street, New York, NY 10024, USA

Abstract.-Although diversification and adaptive radiation of birds on archipelagoes have served as exemplars of
the evolutionary process, prior attention has focused on the avifauna of the Hawaiian and Galapagos Islands, with
little attention paid to West Indian species. One group of birds that includes several Caribbean endemics is the fam-
ily of Wood Warblers (Passeriformes: Parulidae). This family contains some of the best-studied avian species in
North America, lacking only an historical context for comparing behavior and ecology of the species. A phylogeny
for this group would also provide an objective basis for inferring the evolutionary origins of some of the endemic
West Indian bird species. In this paper we present the results of a phylogenetic analysis of relationships among pa-
rulid genera and species using DNA sequences (1140 base pairs) from the mitochondrial cytochrome b gene. Results
of this study indicate that the family Parulidae is not monophyletic. Perhaps the most significant finding is that many
of the currently recognized genera are also not monophyletic. These include Dendroica, Seiurus, Vermivora, Wil-
sonia, and Parula. Also of significance is the evidence found that morphologically divergent species in this region
represent previously unrecognized adaptive radiations. Finally, we identify the first example of intra-island adaptive
radiation proposed for any of the West Indian avifauna. This involves a well-supported clade in Hispaniola, includ-
ing the Black-crowned Palm-Tanager (Phaenicophilus palmarum), the Green-tailed Warbler (Microligea palustris),
and the White-winged Warbler (Xenoligea montana). Evidence of intra-island adaptive radiation has important im-
plications for understanding historical biogeography of the Caribbean region.
Key words: biogeography, Caribbean Basin, Parulidae, phylogeny, wood warbler
Resumen.-RELACIONES MOLECULARES FILOGENETICAS ENTRE LAS REINITAS DE BOSQUE (PARULIDAE) Y BIO-
GEOGRAFiA HISTORICA EN LA CUENCA DEL CARIBE. Aunque la diversificaci6n y la radiaci6n adaptiva de las aves en
los archipielagos han servido como ejemplos del proceso evolutivo, previamente la atenci6n se ha centrado en la
avifauna de las islas Hawai y las Galapagos, con poca atenci6n prestada a las especies de las Indias Occidentales. Un
grupo de aves que incluye varios endemismos caribefios es la familia de las reinitas de bosque (Passeriformes: Paru-
lidae). Esta familia contiene algunas de las especies mejor estudiadas en America del Norte, careciendo solamente de
un contexto hist6rico para comparar el comportamiento y la ecologia de las especies. Una filogenia para este grupo
tambi6n proporcionaria una base objetiva para deducir los origenes evolutivos de algunas de las especies de aves
endemicas a las Indias Occidentales. En este trabajo presentamos los resultados de un analisis filogen6tico de las
relaciones entre g6neros y especies de parulidos usando secuencias de ADN (1140 bases pares) del gen del citocro-
mo b mitocondrial. Los resultados de este estudio indican que la familia Parulidae no es monofil6tica. Quizas el
hallazgo mas significativo es que muchos de los g6neros actualmente reconocidos tampoco son monofil6ticos. Estos
incluyen Dendroica, Seiurus, Vermivora, Wilsonia y Parula. Tambi6n de importancia es la evidencia que indica que
las especies morfol6gicamente divergentes en esta region representan radiaciones adaptivas previamente desconoci-
das. Finalmente, identificamos el primer ejemplo de radiaci6n adaptiva intra-isla jamas propuesto para cualquier
avifauna de las Indias Occidentales, un clado bien respaldado por datos en La Espafiola con la Tangara Palmera Co-
roninegra (Phaenicophilus palmarum), la Reinita Coliverde (Microligea palustris), y la Reinita Aliblanca (Xenoligea
montana). La evidencia de la radiaci6n adaptiva intra-isla tiene implicaciones importantes para entender la biogeo-
grafia hist6rica de la region del Caribe.
Palabras clave: biogeografia, cuenca del Caribe,filogenia, Parulidae, reinita de bosque
Resume.-PHYLOGENIE MOLECULAIRE CHEZ LES PARULINES (PARULIDAE) ET BIOGEOGRAPHIE HISTORIQUE DANS
LE BASSIN CARAIBE. Bien que la diversification et la radiation adaptative des oiseaux dans les archipels aient servi
d'exemple pour la comprehension des processus d'6volution, attention s'est jusqu'a present port6e sur l'avifaune
des iles Hawaii et des Galapagos, avec peu d'int6ret pour les especes des Antilles. La famille des parulines
(Passeriformes : Parulidae) est un groupe d'oiseaux qui comporte plusieurs especes endemiques caraibe. Elle com-
porte certaines des especes d'oiseaux les mieux connues d'Amerique du Nord, manquant juste de mise en perspec-
tive du contexte historique pour comparer leur comportement et leur 6cologie. Une phylog6nie de ce groupe donne-
rait une base objective pour traiter des origines 6volutives de certaines especes end6miques des Caraibes. Nous pre-


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 3









KLEIN ETAL.-MOLECULAR PHYLOGENETIC RELATIONSHIPS AMONG THE WOOD WARBLERS


sentons ici les resultats d'une analyse phylog6entique des relations entre les genres et les especes de parulines en
utilisant le s6quencage de 1'ADN (1140 paires de bases) du gene du cytochrome b. Les r6sultats indiquent que la
famille Parulidae n'est pas monophyl6tique. Le resultat peut-etre le plus significatif est que beaucoup des genres
actuellement reconnus ne le sont pas non plus. Ceux-ci comportent les genres Dendroica, Seiurus, Vermivora, Wilso-
nia et Parula. Un autre resultat d'importance est qu'il a ete trouv6 que des especes morphologiquement divergentes
de la region repr6sentent des radiations adaptatives auparavant non reconnues. Enfin, nous avons identified le premier
exemple de radiation adaptative intra ile propose pour une espece d'oiseaux. Il s'agit d'un clade bien caracteris6 a
Hispaniola qui comprend le Tangara a couronne noire (Phaenicophilus palmarum), la Paruline aux yeux rouges
(Microligea palustris) et la Paruline a ailes blanches (Xenoligea montana). La demonstration de radiation adaptative
intra insulaire a d'importantes repercussions pour comprendre l'histoire de la biogeographie de la region caraibe.
Mots-clds: biogdographie, bassin caraibe, Parulidae, phyloginie, parulines


THE AVIFAUNA of the West Indian archipelago
includes many single island endemics, Caribbean
endemics found on multiple islands, as well as spe-
cies with more widespread distributions that include
continental areas. Diversification and adaptive ra-
diation of birds on archipelagoes have served as ex-
emplars of the evolutionary process. However, prior
attention has mainly been focused on the avifauna
of the Hawaiian and Galapagos Islands. The in situ
evolution of some endemic Caribbean species (i.e.,
from other West Indian birds), as well as the possi-
bility that some mainland species may in fact be
derived from West Indian taxa, has seldom been
considered. This is in spite of well-documented Car-
ibbean radiations in Anolis lizards and some other
taxonomic groups (Hedges et al. 1994, Hedges
1996, Losos et al. 1998). The Caribbean avifauna
has been assumed to owe its origins to dispersal
from continental areas (Bond 1963, 1978; Pregill
and Olson 1981), or from vicariant events (Rosen
1976) with the closest relatives of individual en-
demic island taxa thought to be continental forms
(Bond 1963, 1978; Ricklefs and Cox 1972). Until
recently, the origin of West Indian birds was in-
ferred without objective analysis (Bond 1963,
1978), or was based on assumptions of evolutionary
processes (Ricklefs and Cox 1972). As modem sys-
tematic methodologies and molecular data have be-
come more commonly used, the origin and relation-
ships of Caribbean birds can now be more rigor-
ously assessed (Klein and Brown 1994, Seutin et al.
1994, Hunt et al. 2001, Lovette and Bermingham
2001).
One group of birds that includes several Carib-
bean endemics is the family of wood warblers
(Passeriformes: Parulidae). Wood warblers are
mainly insectivorous New World species that vary
markedly in plumage color pattern and vocaliza-
tions, but exhibit relatively little variation in bill
morphology. The family has a wide distribution,
with representatives from Alaska to southern South


America. It contains some of the best-studied avian
species in North America. Research on parulid for-
aging ecology, singing and courtship behavior, nest
success, and non-breeding season ecology has been
critical in the development of modem ideas in ecol-
ogy, evolution, behavior, and conservation
(MacArthur 1958, Ficken and Ficken 1962a, Burtt
1986, Morse 1989, Shutler and Weatherhead 1990,
Spector 1992, Martin and Badyaev 1996). What has
been lacking for the group is the historical context
provided by a hypothesis of phylogenetic relation-
ships. In addition, a phylogeny would provide an
objective basis for inferring the evolutionary origins
of some of the endemic West Indian bird species. It
would also allow reexamination and reinterpretation
of prior work on the evolution of plumage color pat-
terns (Burtt 1986), sexual selection (Shutler and
Weatherhead 1990), and singing and courtship be-
havior (Ficken and Ficken 1962a, Spector 1992).
Parulidae is part of an assemblage of New World
bird groups, the members of which all have only a
vestigial tenth primary (they are the so-called "nine-
primaried oscines"). Because of this feature, they
have all been assumed to be closely related (Raikow
1978). This group consists of members of the fami-
lies Vireonidae, Peucedramidae, Parulidae, Coere-
bidae, Thraupidae, Emberizidae, Cardinalidae, Ic-
teridae, and Fringillidae. Only recently has the Vir-
eonidae been demonstrated to not be closely related
to the others (Sibley and Ahlquist 1990, Cicero and
Johnson 2001). Whether the remaining families
comprise a monophyletic group remains to be deter-
mined. The relationships among nine-primaried os-
cine families, as well as their individual taxonomic
limits, have been investigated with both molecular
and morphological data (Raikow 1978, Bledsoe
1988, Sibley and Ahlquist 1990, Klicka et al. 2000,
Sato et al. 2001), but with little consensus among
studies. The sister taxon to the parulids is thus still
not conclusively identified, nor has monophyly of
the family been demonstrated.


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 4









KLEIN ETAL.-MOLECULAR PHYLOGENETIC RELATIONSHIPS AMONG THE WOOD WARBLERS


Many questions also remain regarding the rela-
tionships of different species and genera of parulids.
Although recent analyses of relationships within the
genera Dendroica (Lovette and Bermingham 1999)
and Parula (Lovette and Bermingham 2001) exist,
the only general systematic treatments of the Paruli-
dae have included relatively few of the 115 species
and 26 genera as the goals of these studies were of-
ten broader in scope than the phylogeny of Parulidae
(e.g., Raikow 1978, Avise et al. 1980, Bledsoe 1988,
Sibley and Ahlquist 1990).
In this paper we present the results of a phyloge-
netic analysis of relationships among parulid genera
and species using DNA sequences (1140 base pairs)
from the mitochondrial cytochrome b gene. Using
the phylogenies generated in this study, we address
1) monophyly of Parulidae as currently defined, 2)
the monophyly of selected parulid genera, 3) taxo-
nomic and phylogenetic implications, and 4) impli-
cation for the historical biogeography of the Carib-
bean.

METHODS
Taxon Sampling and Outgroups
For consistency, taxonomy and species names
used in this paper follow the American Ornitholo-
gists' Union (1998) Check-list. Nineteen of the 26
genera currently recognized as belonging to Paruli-
dae were sequenced. Because of the potential prob-
lems associated with representing a genus by only
one species, individuals from at least two species
were used for all non-monotypic genera. More than
one conspecific individual was also included for
several species in order to have better geographical
representation. In addition to these warblers, we also
included the Bananaquit (Coereba flaveola) and a
representative of the emberizid genus Conirostrum.
We included these taxa because they have been pre-
viously considered closely related to warblers. In
addition, we also included three genera of tanagers
(Chlorospingus, Spindalis, and Phaenicophilus)
based on plumage similarities among these species
and the Hispaniolan endemic warblers Microligea
and Xenoligea (McDonald 1988; R. W. Storer, pers
comm.). Trees were rooted using a representative of
the blackbird family Icteridae (Icterus dominicen-
sis). Most of these sequences are new to this study
(GenBank accession numbers AY216801-
AY216867), but a few have already been published
(Burs 1997: AF006218; Bums et al. 2002:
AF489881, AF489883, AF489891, AF489894).
Voucher specimens were prepared as museum
study skins, skeletons, or skin and skeleton combi-


nations and deposited in museum collections (Table
1). Due to legislation with no provision for scientific
collecting in the Cayman Islands, voucher specimens
do not exist for Dendroica vitellina. For all
vouchered specimens, either total DNA extracts or
purified mtDNA (Table 1) were prepared from heart,
liver, or pectoral muscle tissue preserved in liquid
nitrogen or in "Queen's" buffer (Seutin et al. 1991),
and stored at -80C. Total DNA was extracted from
cells remaining in the base of a remige removed
from a color-banded individual of D. vitellina and
subsequently stored in "Queen's" buffer. All total
DNA extractions were done with a 5% Chelex solu-
tion (Walsh et al. 1991). Mitochondrial DNA was
isolated and purified from tissues of many of the
specimens according to methods outlined in Klein
and Brown (1994). To lower the probability that nu-
clear copies were being analyzed, both strands were
sequenced, initial amplification was of large frag-
ments, overlapping internal fragments were se-
quenced, more than one individual was sequenced
for most genera, and purified mtDNA was the DNA
source for many taxa. The sequences derived from
total DNA did not differ in any significant way from
those derived from purified mtDNA. Large frag-
ments of cytochrome b were amplified on an air ther-
mal cycler using PCR with the following primers:
H15915 (Helm-Bychowski and Cracraft 1993),
L15308, H15710, and L14851 (Groth 1998). Typical
initial double-stranded amplification protocols (10 ul
volumes) were 37 cycles of 940C: 2 seconds, 480C: 0
seconds, and 700C: 25 seconds. Using internal prim-
ers, shorter fragments were then amplified from the
initial PCR product using H15915, L15656, H15710,
L15308, H15505, L16206, H15298, and L14851
(Groth 1998) at a higher annealing temperature
(55C). Double-stranded PCR products were then
cleaned and cycle sequenced (ABI PrismTM Dye Ter-
minator Cycle Sequencing Ready Reaction kit with
AmpliTaq DNA Polymerase, FS; Perkin Elmer) us-
ing this protocol: 960C: 1 minute; then 32 cycles of
960C: 10 seconds; 500C: 5 seconds; 600C: 3 minutes.
Samples were run on polyacrylamide gels on an ABI
PrismTM 377.
Phylogenetic analyses
Phylogenetic trees were generated using both par-
simony and Bayesian approaches. Parsimony analy-
ses were performed using PAUP* 4.0b8 (Swofford
2001) under two different weighting schemes. Trees
were initially generated by weighting all characters
equally. However, plots of total percent sequence
divergence versus divergence at first, second, and
third position sites indicate that third position sites


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 5










KLEIN ETAL.-MOLECULAR PHYLOGENETIC RELATIONSHIPS AMONG THE WOOD WARBLERS


Table 1. Species names, museum, and voucher numbers of individuals included in this study. AMNH =
American Museum of Natural History; ANSP = Academy of Natural Sciences Philadelphia; FLS =
Fundacion La Salle, Venezuela; FMNH = Field Musem of Natural History; MVZ = Museum of Verte-
brate Zoology, University of California at Berkeley; UNAM = Universidad Nacional Autonoma de
Mexico; MNCR = Museo Nacional, Costa Rica; UMMZ = University of Michigan Museum of Zool-
ogy.


Scientific name


Basileuterus rufifrons
Basileuterus tristriatus
Cardellina rubrifons
Chlorospingus pileatus
Coerebaflaveola
Conirostrum bicolor
Dendroica adelaidae
Dendroica angelae
Dendroica caerulescens
Dendroica castanea
Dendroica discolor 1
Dendroica discolor 2
Dendroica dominica
Dendroica magnolia
Dendroica palmarum
Dendroica pensylvanica
Dendroica petechia 1
Dendroica petechia 2
Dendroica pharetra
Dendroica pinus 1
Dendroica pinus 2
Dendroica pinus 3
Dendroica striata
Dendroica virens
Dendroica vitellina
Geothlypis speciosa
Geothlypis trichas
Helmitheros vermivorus
Icteria virens
Icterus dominicensis
Limnothlypis swainsonii
Microligea palustris 1
Microligea palustris 2
Mniotilta varia
Myioborus albifacies
Myioborus brunneiceps
Oporornis agilis
Oporornisformosus
Parula americana
Parula gutturalis 1
Parula gutturalis 2
Parula pitiayumi
Parula superciliosa 1
Parula superciliosa 2
Phaenicophilus palmarum
Protonotaria citrea
Seiurus aurocapillus
Seiurus motacilla
Setophaga ruticilla


Common name


Rufous-capped Warbler
Three-striped Warbler
Red-faced Warbler
Sooty-capped Bush-Tanager
Bananaquit
Bicolored Conebill
Adelaide's Warbler
Elfin-woods Warbler
Black-throated Blue Warbler
Bay-breasted Warbler
Prairie Warbler
Prairie Warbler
Yellow-throated Warbler
Magnolia Warbler
Palm Warbler
Chestnut-sided Warbler
Yellow Warbler
Yellow Warbler
Arrowhead Warbler
Pine Warbler
Pine Warbler
Pine Warbler
Blackpoll Warbler
Black-throated Green Warbler
Vitelline Warbler
Black-polled Yellowthroat
Common Yellowthroat
Worm-eating Warbler
Yellow-breasted Chat
Greater Antillean Oriole
Swainson's Warbler
Green-tailed Warbler
Green-tailed Warbler
Black-and-white Warbler
White-faced Whitestart
Brown-capped Whitestart
Connecticut Warbler
Kentucky Warbler
Northern Parula
Flame-throated Warbler
Flame-throated Warbler
Tropical Parula
Crescent-chested Warbler
Crescent-chested Warbler
Black-crowned Palm-Tanager
Prothonotary Warbler
Ovenbird
Louisiana Waterthrush
American Redstart


Museum and
voucher number


MNCR NKK244
UMMZ 227798
LSUMNS B-10178
LSUMNS B-19947
UMMZ 225179
UMMZ 227715
LSUMNS B11431
LSUMNS B11459
UMMZ 232197
NKK571
UMMZ 227213
AMNH NKK802
AMNH NKK869
UMMZ 227690
NKK321
UMMZ 231694
UMMZ NKK302
UMMZ NKK490
FMNH 331126
AMNH BD963
AMNH NKK905
AMNH JAG2164
UMMZ 227599
UMMZ NK541
AMNH NKK755
AMNH PEP1901
UMMZ 227795
UMMZ 231699
LSUMNS B3326
AMNH NKK1112
UMMZ 231701
AMNH
AMNH NKK1055
881215
AMNH ML471
AMNH PRS453
NKK570
NKK125
UMMZ 228374
LSUMNS B19935
LSUMNS B19898
LSUMNS B18571
LSUMNS BMM040
154
AMNH 831246
FLS NKK505
881216
LSUMNS B16861
UMMZ NKK293


Journal of Caribbean Ornithology -


Page 6


Special Issue Honoring Nedra Klein









KLEIN ETAL.-MOLECULAR PHYLOGENETIC RELATIONSHIPS AMONG THE WOOD WARBLERS


Table 1 (concluded).


Scientific name

Spindalis zena
Teretistris femandinae
Vermivora celata 1
Vermivora celata 2
Vermivora chrysoptera 1
Vermivora chrysoptera 2
Vermivora crissalis
Vermivora luciae 1
Vermivora luciae 2
Vermivora peregrina 1
Vermivora peregrina 2
Vermivora pinus 1
Vermivora pinus 2
Vermivora ruficapilla 1
Vermivora ruficapilla 2
Vermivora ruficapilla 3
Vermivora ruficapilla 4
Vermivora virginiae 1
Vermivora virginiae 2
Wilsonia canadensis
Wilsonia citrina
Wilsonia pusilla
Xenoligea montana


Common name

Western Spindalis
Yellow-headed Warbler
Orange-crowned Warbler
Orange-crowned Warbler
Golden-winged Warbler
Golden-winged Warbler
Colima Warbler
Lucy's Warbler
Lucy's Warbler
Tennessee Warbler
Tennessee Warbler
Blue-winged Warbler
Blue-winged Warbler
Nashville Warbler
Nashville Warbler
Nashville Warbler
Nashville Warbler
Virginia's Warbler
Virginia's Warbler
Canada Warbler
Hooded Warbler
Wilson's Warbler
White-winged Warbler


Museum and
voucher number

AMNH NKK862
ANSP 186515
LSUMNS B19168
LSUMNS B19692
ANSP 183700
ANSP 183677
LSUMNS 95L
LSUMNS B23331
LSUMNS B23332
FLS 89-1264
FMNH
ANSP 183679
ANSP 183682
89-303
B20694
MVZ 173509
MVZ 173510
CMM110
CMM098
UMMZ 231702
LSUMNS B856
LSUMNS B23419
AMNH NKK1041


may be saturated for transitions. Therefore, we also
performed an additional parsimony analysis in
which we downweighted third position transitions
by a factor of seven. This was accomplished by giv-
ing third position transitions a weight of one and all
other characters a weight of seven using the stepma-
trix option in PAUP. The ratio of 7:1 was obtained
empirically from examining multiple sequences for
each of two of the larger genera used in this study:
Vermivora and Dendroica. We chose to estimate the
transition/transversion ratio among close relatives
because close relatives will have fewer multiple
substitutions at a given site than more distant rela-
tives. Thus, the ratio of 7:1 is probably a more accu-
rate estimate of the actual transition bias than the
ratio observed among all species included in the
study (Edwards 1997). Both parsimony analyses
consisted of heuristic searches of 1000 random ad-
dition sequences each. To estimate support for dif-
ferent nodes, both parsimony analyses were boot-
strapped with 10 random addition replicates per
each of 1000 bootstrap replicates.
Phylogenetic relationships were also explored
using a Bayesian approach. For this analysis, we


first chose a best-fit model of evolution using
Modeltest, vers. 3.06 (Posada and Crandall 1998).
We then used the chosen model (GTR + I + gamma)
in conjunction with MrBayes 2.01 (Huelsenbeck
and Ronquist 2001) to perform Bayesian analyses
on the data set. Parameters of the GTR + I + gamma
model were treated as unknown variables with uni-
form prior values and estimated as part of the analy-
sis. The analysis was run for 1,000,000 generations
and sampled every 100 generations. Thus, the
analysis resulted in 10,000 samples. Four Markov
Chain Monte Carlo chains were run for each analy-
sis. Resulting log likelihood scores were plotted
against generation time to identify the point at
which log likelihood values reached a stable equi-
librium value. Sample points prior to this point of
stationarity were discarded as "burn-in" samples.
The remaining samples were used to produce a ma-
jority rule consensus tree with the percentage values
indicating the percentage of samples that identified
a particular clade (the clade's posterior probability).
These posterior probability values provide a meas-
ure of support for a particular clade.


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 7









KLEIN ETAL. MOLECULAR PHYLOGENETIC RELATIONSHIPS AMONG THE WOOD WARBLERS


RESULTS
Sequence variation
Typical of cytochrome b sequences, mean propor-
tions of the four nucleotides were unequal (A = 0.28,
G = 0.35, C = 0.13, T = 0.24; Chi-square test for
homogeneity of base frequencies across taxa ignor-
ing correlations due to phylogenetic structure P =
1.0). All differences between taxa were base substi-
tutions; no insertions or deletions were detected. Of
the 450 variable nucleotide sites, 381 were phyloge-
netically informative. As expected, transitions
greatly outnumbered transversions at all positions.
Pairwise percent divergence within species was
generally low (mean 0.86%), but differences be-
tween subspecies of Yellow Warbler (2.1%0) and of
Nashville Warbler (mean 2.0%) were on the order of
(or even greater than) divergences seen between
some well-recognized species (e.g., Parula ameri-
cana and P. pitiayumi: 1.2%, and Dendroica casta-
nea and D. striata: 1.8%). Divergence between pa-
rulid species ranged widely (1.0-12.4%, mean
8.1%). Some clades identified in the tree had much
lower interspecific divergences than did others, indi-
cating disparate timings of diversification of major
groups. For example, mean pairwise divergence
within the clade of mainly southwestern Vermivora
was 2.0%, whereas divergence levels among Den-
droica warblers was 6.3%. Sequence divergence
within the clade of the Phaenicophilus tanager and
its warbler-like sister species (see below) averaged
9.3%.
Phylogenetic relationships
The equally weighted analysis resulted in 178
most parsimonious trees, each with 2427 steps and a
consistency index (excluding uninformative charac-
ters) of 0.2529. A strict consensus of these 178 trees
(Fig. 1) is resolved at basal and more recent clades.
However, the trees disagree in the placement of in-
termediate clades. The 7:1 weighted analysis re-
sulted in four trees of 7433 steps and a consistency
index of 0.2774. These trees show considerably
more agreement among themselves than do the
equally weighted trees, resulting in a more resolved
strict consensus tree (Fig. 2). In the Bayesian analy-
ses, log likelihood values reached a stable equilib-
rium well before 200,000 generations. Thus, we
chose a burn-in value of 2000 samples and con-
structed a majority rule consensus tree using the re-
maining samples (Fig. 3). The trees resulting from
the two parsimony analyses and the Bayesian analy-


sis agree in many of the relationships among taxa;
however, they also show some differences. We used
an S-H test (Shimodaira and Hasegawa 1999, Gold-
man 2000) to compare the likelihood of each of the
183 trees that resulted from our different methods.
Using this method, not surprisingly, the Bayesian
tree was found to have the highest log-likelihood
score (-12239.41). Most of the equally weighted
trees (101 of the 178 trees) had significantly lower
likelihood scores than the Bayesian tree (P < 0.05).
However, none of the 7:1 trees were significantly
different from the Bayesian tree (P < 0.05). Given
the effects of saturation, the Bayesian tree and 7:1
trees are probably better representations of the
higher-level relationships among these species than
the equally weighted trees.
Parulidae, as currently defined (American Orni-
thologists' Union 1998), is not monophyletic in any
of the trees (Figs. 1-3). Specifically, three warbler
taxa were more closely related to tanagers included
in the data set than they were to other warblers. The
Hispaniolan endemics Microligea and Xenoligea
form a clade with the Hispaniolan tanager Phaenico-
philus palmarum. This clade was recovered in all
analyses and received moderate bootstrap support
(61% and 84%) and had a high posterior probability
(100%). The Cuban endemic, Teretistris fernandi-
nae, was placed as the sister taxon of tanager Spin-
dalis zena in the 7:1 weighted parsimony analysis
and the Bayesian analysis, but not in the equally
weighted parsimony tree. The relationship between
Teretistris and Spindalis had low support and could
be the result of long-branch attraction. The Yellow-
breasted Chat (Icteria virens) was the most basal
member of a clade consisting of all remaining war-
blers in the 7:1 tree and the Bayesian tree. In the
equally weighted tree, Yellow-breasted Chat to-
gether with Worm-eating Warbler (Helmitheros ver-
mivorus) formed the sister taxa to the remaining
warblers.
In addition to the non-monophyly of Parulidae,
many other clades recovered in this study also do
not agree with current taxonomy. For example, the
following genera were not monophyletic: Dendro-
ica, Seiurus, Vermivora, Wilsonia, and Parula.
However, large subsets of Dendroica and Vermivora
were found to be monophyletic. In addition, the gen-
era Basileuterus, Geothlypis, Oporornis, and My-
ioborus were monophyletic in all analyses in this
study. However, only a few species were sampled
from each of these genera.


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 8







KLEIN ETAL.-MOLECULAR PHYLOGENETIC RELATIONSHIPS AMONG THE WOOD WARBLERS


Icterus dominicensis
Chlorospingus pileatus
40 86 Conirostrum bicolor
71 8 Coereba flaveola
10o Phaenicophilus palmarum
96 Xenoligea montana
100 Microligea palustris 1
Microligea palustris 2
76 Teretistris fernandinae
Spindalis zena
48 Icteria virens
Seiurus aurocapillus
79 Helmitheros vermivorus
94 Geothlypis trichas
100 I Geothlypis speciosa
98 | 65 Opororis agilis
25 Opororis formosus
SSeiurus motacilla
68 Mniotilta varia
49 49 Basileuterus tristriatus
41 98 Basileuterus rufifrons
47 Wilsonia canadensis
100 Cardellina rubrifons
56 Wilsonia pusilla
100 Myioborus albifacies
SMyioborus brunneiceps
65 Protonotaria citrea
1 -Limnothlypis swainsonii
89 18100 Vermivora chrysoptera 1
100 Vermivora chrysoptera 2
S95 Vermivora pinus 1
42 Vermivora pinus 2
S100 Parula gutturalis 2
948 Parula gutturalis 1
100 Parula superciliosa 1
99 Parula superciliosa 2
-100 Vermivora peregrina 1
SVermivora peregrina 2
87 83 Vermivora celafa 1
SVermivora celata 2
23 100 100 Vermivora ruficapilla 1
99 Vermivora ruficapilla 2
Vermivora crissalis
55 100 Vermivora virginiae 1
9 -- Vermivora virginiae 2
100 Vermivora luciae 1
71 Vermivora luciae 2
100 Vermivora ruficapilla 3
Vermivora ruficapilla 4
Dendroica angelae
100 Dendroica pharetra
67 Setophaga ruticilla
99 Wilsonia citrina
100 Parula pitiayumi
59 Parula americana
Dendroica caerulescens
24 100 Dendroica pensylvanica
39 100 Dendroica petechia 1
'27 Dendroica petechia 2
34 Dendroica magnolia
100 Dendroica castanea
19 Dendroica striata
96 Dendroica virens
100 I Dendroica adelaidae
Soo Dendroica vitellina
11100 Dendroica discolor 1
Dendroica discolor 2
L36 Dendroica palmarum
Dendroica dominica
10 Dendroica pinus 2
78 Dendroica pinus 1
Dendroica pinus 3

Fig. 1. Strict consensus tree of the 178 most parsimonious trees resulting from the equally weighted analysis. Tree is
rooted with Icterus dominicensis. Numbers on tree indicate levels of bootstrap support for nodes retained by more than
50% of bootstrap replicates.


Special Issue Honoring Nedra Klein


Journal of Caribbean Ornithology


Page 9











KLEIN ETAL.-MOLECULAR PHYLOGENETIC RELATIONSHIPS AMONG THE WOOD WARBLERS


SIcterus dominicensiE
Chlorospingus pileat
82 Phaenicophilus palms
83 Xenoligea montana
100 Microligea paluttris
Microligea palu3triE
54 Conirostrum bicolor
I-- oereba flaveola
Teretistris fernandi
Spindalis zena
Icteria virens
Helmitheros vermivoi
53 Seiurus aurocapilluE
Basileuterus tristri
62 Basileuterus rufifrc
__ i Wilsonia canadensis
80 Cardellina rubrifonE
Wilsonia pusilla
100 M-Myioborus albifacieE
Myioborus brunneicer
Mniotilta varia
62 Protonotaria citrea
Limnothlypis swainsc
100 i Vermivora peregrlina
Vermivora pereg2ina
82 Parula supercilliosa
S92 -- Parula supercil2iosa
S87 Parula gutturialis
Parula guttuiTlis
S---Vermivora crissalis
100 Vermivora ruficapill
100 54 Vermivora ruficapill
100 Vermivora celita
56 Vermivora celata
100 Vermivora ruficalill
74 Vermivora ruficalill
96 Vermivora luclae
Vermivora luclae
90 Vermivora virginiae
Vermivora virgi2iae
100 Vermivora chrysoptlei
100 Vermivora chrysoptei
96 Vermivora pinius
Vermivora pirls
59 Geothlypis trichas
87 Geothlypis speciosa
54 Oporornis agilis
Oporornis formosus
Dendroica angelae
Dendroica pharetra
Seiurus motacilla
Setophaga ruticilla
-Dendroica caerulesce
Dendroica palmarum
Dendroica magnolia
Wilsonia citrina
100 Dendroica castanea
Dendroica striata
71 Dendroica pensylvani
99 Dendroica petechia
Dendroica petectia
84 Dendroica dominica
100 Dendroica pinils
68 Dendroica pirius
Dendroica pinus
100 Parula pitiayumi
Parula americana
71 Dendroica virens
83 Dendroica adelaidae
83 Dendroica vitellina
100 Dendroica discdlor
Dendroica discolor


Fig. 2. Strict consensus tree of the four most parsimonious trees resulting from the transversion-weighted analysis. Tree is
rooted with Icterus dominicensis. Numbers on tree indicate levels of bootstrap support for nodes retained by more than
50% of bootstrap replicates.


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 10









KLEIN ETAL.-MOLECULAR PHYLOGENETIC RELATIONSHIPS AMONG THE WOOD WARBLERS


Icterus dominicensis
7 81sChlorospingus pileatus
40_ 86 Conirostrum bicolor
71 6 Coereba flaveola
10o Phaenicophilus palmarum
96 Xenoligea montana
100 Microligea palustris 1
Microligea palustris 2
76 Teretistris fernandinae
Spindalis zena
48 t Icteria virens
Seiurus aurocapillus
79 Helmitheros vermivorus
94 Geothlypis trichas
100 --- Geothlypis speciosa
98 65 Oporornis agilis
-25 Oporornis formosus
Seiurus motacilla
68 Mniotilta varia
49 49 Basileuterus tristriatus
141 9 Basileuterus rufifrons
47 Wilsonia canadensis
100 Cardellina rubrifons
56 Wilsonia pusilla
100 Myioborus albifacies
Myioborus brunneiceps
65 Protonotaria citrea
18 Limnothlypis swainsonii
89 100 Vermivora chrysoptera 1
100 Vermivora chrysoptera 2
95 Vermivora pinus 1
42 Vermivora pinus 2
100 4 Parula gutturalis 2
48 Parula gutturalis 1
100 Parula superciliosa 1
99 Parula superciliosa 2
100 Vermivora peregrina 1
Vermivora peregrina 2
87 83 Vermivora celafa 1
SVermivora celata 2
23 100 100 Vermivora ruficapilla 1
9- 9 Vermivora ruficapilla 2
Vermivora crissalis
55 100 Vermivora virginiae 1
89 Vermivora virginiae 2
100 Vermivora luciae 1
71 Vermivora luciae 2
100 Vermivora ruficapilla 3
Vermivora ruficapilla 4
Dendroica angelae
100 Dendroica pharetra
67 Setophaga ruticilla
99 Wilsonia citrina
100 Parula pitiayumi
59 Parula americana
Dendroica caerulescens
24 100 Dendroica pensylvanica
39 100 Dendroica petechia 1
27 Dendroica petechia 2
34 1 Dendroica magnolia
100 Dendroica castanea
19 -Dendroica striata
96 Dendroica virens
100 l Dendroica adelaidae
100 Dendroica vitellina
11100 Dendroica discolor 1
Dendroica discolor 2
36 Dendroica palmarum
93 Dendroica dominica
100Dendroica pinus 2
78 Dendroica pinus 1
Dendroica pinus 3
Fig. 3. Majority rule consensus tree of the 8000 trees resulting from the Bayesian analysis. Numbers at nodes indicate the
posterior probability of a particular clade.


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 11








KLEIN ETAL.-MOLECULAR PHYLOGENETIC RELATIONSHIPS AMONG THE WOOD WARBLERS


DISCUSSION
Phylogenetic and taxonomic conclusions
Non-monophyly of Parulidae.-Even though not
all genera have been included, results of the cyto-
chrome b analysis clearly indicate that Parulidae, as
currently defined, is not monophyletic. It is highly
unlikely that this conclusion would change with ad-
dition of the remaining genera because there is such
strong support for the exclusion of Teretistris, Mi-
croligea, and Xenoligea from Parulidae. To make
Parulidae monophyletic requires 213 extra steps
(2.9% longer) in the transition-downweighted
analysis, and 55 extra steps (2.3% longer) in the
equally weighted analysis. In both cases the trees
constrained to make Parulidae monophyletic are
significantly different from the shortest trees (P <
0.005). If anything, some of the genera currently
classified as parulids but not included in this study
(e.g., Granatellus and Zeledonia) may also end up
falling outside of Parulidae. The conclusion of non-
monophyly could also be drawn from the analysis
of myological data (Raikow 1978), although that
study included very few parulids. In contrast, the
DNA-DNA hybridization studies (Bledsoe 1988,
Sibley and Ahlquist 1990) revealed parulid mono-
phyly, but also had limited taxon sampling and did
not include the tanager-like species (e.g., Mi-
croligea, Xenoligea).
Monophyly of genera.-Some of the phylogenetic
relationships suggested by this study are congruent
with those recovered by other data sets, and with
those portrayed by linear classifications (Lowery
and Monroe 1968, American Ornithologists' Union
1998), but there are some significant and intriguing
differences. Perhaps the most significant is the find-
ing that few of the genera as currently defined in the
American Ornithologists' Union Check-list of North
American birds (1998) are monophyletic. Although
some genera were monophyletic (e.g., Basileuterus,
Myioborus), none of the genera with reasonably ex-
tensive sampling was found to be monophyletic.
Below we discuss the limits of the genera of war-
blers as indicated by the trees found in this study.
Vermivora.-With the exception of the extinct V.
bachmani, all members of this genus were included
in the study. In all trees, Vermivora as currently de-
fined is polyphyletic and includes two well-
supported clades (Figs. 1-3). One of these clades
consists of two species known to hybridize, Blue-
winged (V. pinus) and Golden-winged (V. chrysop-
tera) warblers. The close relationship of these two
species is indicated by high bootstrap support and a


high posterior probability (all values 100%; Figs. 1-
3). The second clade consists of several mostly
southwestern taxa (V. ruficapilla, V. luciae, V. vir-
giniae, V. crissalis, and V. celata). This clade also
has 100% bootstrap support and 100% posterior
probability. In addition, these species show very
little genetic divergence from each other. Average
sequence divergence between species in this south-
western Vermivora clade is 2.0%. In the Bayesian
tree, the Tennessee Warbler (Vermivora peregrina)
is the sister taxon of the southwestern Vermivora,
but the parsimony trees are not resolved with re-
spect to the position of V. peregrina. In all of the
trees, the Blue-winged/Golden-winged clade is
more closely related to the other genera of warblers
than they are to the other Vermivora. However, two
species of Central American warblers (P. supercil-
iosa and P. gutturalis) appear to be closely related
to the southwestern Vermivora and the Tennessee
Warbler. These species form a clade in 72% of the
7:1 bootstraps and have a posterior probability of
99%. Although currently classified as Parula
(American Ornithologists' Union 1998), these two
species are sometimes placed in Vermivora (Lowery
and Monroe 1968).
Within Vermivora, Nashville Warbler (V. rufi-
capilla) is not monophyletic. The western samples
included in this study are more closely related to
Lucy's and Virginia's Warblers (V. luciae and V.
virginiae) than they are to the eastern samples of
Nashville Warbler. We can think of three possible
explanations for this. Our gene tree based on mito-
chondrial DNA may not actually reflect the relation-
ships among the species due to incomplete lineage
sorting (Pamilo and Nei 1988). Another possibility
is recent introgression between V. luciae, V. vir-
giniae, and western V. ruficapilla. Alternatively, our
phylogeny may reflect the true relationships among
these taxa. Vermivora luciae and V. virginiae may
have split recently from western populations of V.
ruficapilla. Subsequently, the western populations
may have retained similar plumage to eastern popu-
lations. Additional genetic markers and additional
samples need to be sequenced to evaluate the likeli-
hood of these different hypotheses. Nevertheless,
this example is a good illustration of the importance
of including multiple individuals of a particular
taxon in a systematic study.
Parula.-All four species of the genus Parula
were included in this study. As mentioned above,
two species of Parula (P. superciliosa and P. gut-
turalis) are more closely related to species within
the genus Vermivora than they are to other members


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 12









KLEIN ETAL.-MOLECULAR PHYLOGENETIC RELATIONSHIPS AMONG THE WOOD WARBLERS


of Parula. This is consistent with the alternative
classifications that place these two species in the
genus Vermivora. The other two species in this ge-
nus, Tropical and Northern Parulas (P. pitiayumi
and P. americana) form a strongly supported, mo-
nophyletic group (Figs. 1-3). These two species are
more closely related to members of the genus Den-
droica than they are to P. superciliosa and P. gut-
turalis.
Wilsonia.-All three species of Wilsonia were
included in this study, and these species do not form
a monophyletic group in any of the trees (Figs. 1-
3). The Hooded Warbler (W. citrina) is closely re-
lated to species within the genus Dendroica. Wil-
son's Warbler (W. pusilla) and Canada Warbler (W.
canadensis) form a monophyletic group with My-
ioborus and Cardellina. This clade is closely related
to Basileuterus. The close relationships between W.
pusilla and W. canadensis to Myioborus and
Basileuterus is supported by at least superficial
plumage similarities. Although W. citrina was the
only species of Wilsonia included in the allozyme
analysis of Avise et al. (1980), it was similarly
grouped with Dendroica species.
Setophaga.-This monotypic genus has tradition-
ally been maintained to highlight the morphological
distinctiveness of the American Redstart's broad,
flat bill and prominent, long rictal bristles. How-
ever, analyses of behavior and singing patterns
(Ficken and Ficken 1965, Parkes 1961, Spector
1992), and of plumage characters (Mayr and Short
1970) suggest that S. ruticilla is just a morphologi-
cally unusual Dendroica. Our trees (Figs. 1-3)
agree with this assessment and place Setophaga
near the base of the Dendroica clade. As suggested
by Ficken and Ficken (1965), the unique bill and
bristle features of Setophaga appear to be adapta-
tions to flycatching behavior and thus may actually
mask an underlying close evolutionary relationship
to the species with thinner bills and shorter rictal
bristles that are currently recognized as Dendroica.
Close relationships among birds of vastly different
bill types have been reported in other nine-
primaried oscines (Bums 1997, Burs et al. 2002).
Our placement of Setophaga is also supported by
the allozyme analysis of Avise et al. (1980). An ad-
ditional mtDNA sequence analysis that included
more Dendroica species but fewer parulid genera
(Lovette and Bermingham 1999) also supports the
position of S. ruticilla in a clade with Dendroica,
although its placement within Dendroica (whether
more basal or more internal) varied with the algo-
rithm used to generate trees.


Seiurus.-This genus currently consists of three
species, Ovenbird (S. auricapillus), Louisiana Wa-
terthrush (S. motacilla), and Northern Waterthrush
(S. noveboracensis), two of which are included in
this study. Seiurus auricapillus and S. motacilla are
not monophyletic in our mtDNA trees (Figs. 1-3).
As in the allozyme study of Avise et al. (1980), our
study placed S. auricapillus near the base of the
warbler clade. Our analyses disagreed on the place-
ment of S. motacilla. Although the 7:1 weighted
tree indicates that S. motacilla is closely related to
some Dendroica species, this relationship is not
strongly supported. Other trees place this species
near the genera Mniotilta, Basileuterus, Wilsonia,
Cardellina, and Myioborus. Data are needed from
the third species of Seiurus before strong conclu-
sions can be made about the placement of S. mo-
tacilla. Although strong support for its relationship
to other species was not identified, it was not
closely related to S. auricapillus in any of the trees
of this study. The characteristics previously cited as
supporting a monophyletic Seiurus (e.g., streaked
plumage on undersides, lack of rictal bristles; Ridg-
way 1902, Griscom and Sprunt 1957) could realisti-
cally be considered convergent adaptations to the
terrestrial lifestyle typical of the three species of
Seiurus.
Dendroica.-Fifteen of the 27 species in this ge-
nus were included in this study. Our trees indicated
that Dendroica, as currently defined, is para-
phyletic. Parula americana, P. pitiayumi, and Seto-
phaga ruticilla are all members of a clade that also
contained all of the Dendroica included in this
study. These species share plumage features (wing
bars and tail spots) with Dendroica. Additionally,
similarities in courtship and singing behavior have
also been cited as supporting evidence of the close
relationship among these species. Given the evi-
dence from morphology, behavior, and DNA se-
quences, we recommend that P. americana, P. pitia-
yumi, S. ruticilla, and all species currently in Den-
droica be placed in a single genus.
Icteria.-Because the Yellow-breasted Chat
(Icteria virens) has many aberrant features (Clark
1974, Ficken and Ficken 1962b), the taxonomic
placement (familial affinity) of this monotypic ge-
nus has been problematic since its initial descrip-
tion. However, Ridgway (1902) stated that its place-
ment in the same higher taxonomic grouping with
wood warblers was justified based on its similarities
to the parulid taxa Geothlypis poliocephala and
Granatellus spp. (for dissenting opinions see Eisen-
mann 1962, Ficken and Ficken 1962a, and Mayr


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 13









KLEIN ETAL.-MOLECULAR PHYLOGENETIC RELATIONSHIPS AMONG THE WOOD WARBLERS


and Short 1970). An analysis of appendicular myol-
ogy in the nine-primaried oscines (Raikow 1978)
revealed the presence in Icteria of musculature char-
acters shared with other parulids (along with Co-
ereba and Conirostrum). Although taxon sampling
was limited, DNA-DNA hybridization data revealed
a basal placement of Icteria in Parulidae (Sibley and
Ahlquist 1982, 1990), as did a phenetic analysis of
allozymes by Avise et al. (1980). All trees of this
study (Figs. 1-3) place it at the base of a parulid
clade. Bootstrap support and posterior probabilities
are high, but not overwhelmingly strong for this ar-
rangement.

Historical biogeography in the West Indies
The West Indies as an area of endemism and
source of currently more widespread groups of
birds.-Most discussions of the historical biogeog-
raphy of the Caribbean avifauna assume that birds
colonized the islands by over-water dispersal. How-
ever, Rosen (1976) proposed a vicariance explana-
tion for West Indian organisms. Neithe vicariance
nor dispersal hypothesis has to date been rigorously
tested for birds. Given the geological history of the
Greater Antilles and movement of the Caribbean
Plate, vicariance is a viable explanation for faunal
distributions on those islands. That the Lesser Antil-
les were colonized by over-water dispersal is not an
issue because these islands are volcanic in origin
and truly oceanic (never connected to the mainland).
Klein and Brown (1994) provided evidence that
some of the Lesser Antilles were colonized more
than once by one species, and that the archipelago
itself was colonized multiple times by this same spe-
cies. However, results from that study could not be
used to discriminate between vicariance and disper-
sal hypotheses for the Greater Antilles.
The purpose of the present study is not to dis-
criminate among these hypotheses. However, rela-
tionships depicted here can be added to the growing
evidence that the West Indies contain not merely a
"waif' fauna of species that managed to either arrive
by dispersal or be retained after vicariant events.
Instead, there is growing evidence that morphologi-
cally divergent species found in this region actually
represent previously unrecognized adaptive radia-
tions. For example, in the current study, we identi-
fied a monophyletic clade containing the "tanager"
Phaenicophilus and the "warblers" Microligea and
Xenoligea. In Burns (1997), a close relationship was
also identified among one of these species, Phaeni-
cophilus, and the "tanagers" Spindalis and Nesospin-
gus. This suggests that all of these taxa form an en-


demic Caribbean radiation of birds that can not be
classified with either the tanagers or the warblers.
All of these taxa need to be included in a single
analysis along with a variety of tanagers and war-
blers before definitive conclusions can be made.
Nevertheless, our data suggest that the West Indies
appear to have played a central role in the diversifi-
cation of this group of birds. A recent analysis of
phylogenetic relationships among Darwin's finches
and relatives (Burs et al. 2002) mirrors the results
presented here. Burns et al. (2002) show that the
Darwin's finches are derived from a clade of mostly
Caribbean birds. Previously, the species in this
group were not thought to be closely related and
traditionally classified as Emberizidae, Thraupidae,
and Coerebidae. Thus, the Darwin's finches may
have had their origin in the West Indies, with Carib-
bean endemics undergoing adaptive radiation and
speciation in parallel.
Although a West Indian origin probably does not
apply for the Parulidae as a family, some of the
clades within the higher taxonomic group probably
originated in the West Indies. In both this study and
that of Lovette and Bermingham (1999), the most
basal members of the clade of Dendroica warblers
(and genera not currently classified as Dendroica,
see above) are West Indian endemics (D. angelae,
D. pharetra, D. plumbea, and Catharopeza). Simi-
larly, relationships within the more recent clade of
D. discolor and D. vitellina illustrate that vitellina is
the older taxon. Although not all members of the
Black-throated Green Warbler complex were in-
cluded in this study, one of these (D. virens) and
another Caribbean endemic (D. adelaidae) were
basal to the vitellina-discolor clade. In Lovette and
Bermingham (1999), which included most of the D.
virens species group, adelaidae was the most basal
member of that group. However, their analysis did
not include D. vitellina.
Intra-island differentiation and adaptive radiation
on Hispaniola.-Although intra-island adaptive
radiations are well described for the avifaunas of the
Galapagos and Hawaiian islands, such radiations
have not been proposed for any of the West Indian
avifauna. Intra-island radiations have been well
documented in other groups (e.g., anoles -Losos et
al. 1998; ants Wilson 1985; Eleutherodactylus
frogs Hedges 1989), but discussions of the evo-
lutionary history of birds in this region have not in-
cluded the role of intra-island adaptive radiation. In
this study, we identify a monophyletic group of
birds, all of which are endemic to the island of His-
paniola. This well-supported clade includes Black-


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 14









KLEIN ETAL.-MOLECULAR PHYLOGENETIC RELATIONSHIPS AMONG THE WOOD WARBLERS


crowned Palm-Tanager (Phaenicophilus palmarum),
Green-tailed Warbler (Microligea palustris), and
White-winged Warbler (Xenoligea montana). Our
data are consistent with the shared plumage and mor-
phological characteristics of these species (McDonald
1988; R. Storer, pers. comm.).
This evidence of adaptive radiation within a Carib-
bean island has important implications for understand-
ing historical biogeography of the Caribbean region,
as well as for understanding the evolution of birds on
islands in general. In attempting to provide a general
explanation for biogeographic patterns in the West
Indies, Ricklefs and Cox (1972, 1978) argued for the
presence of a taxon cycle in which, after initial coloni-
zation, taxa are widespread and undifferentiated. As
time goes on, competition with other species results in
their becoming more and more specialized with subse-
quent range reductions. The ultimate stage is single-
island endemism. If such a taxon cycle exists, then
single-island endemics should each be on their own
evolutionary trajectory with respect to other such en-
demics in the West Indies; i.e., each represents a relic
of a formerly widespread species. This model ignores
the strong possibility of adaptive radiation and lack of
dispersal to other islands. The results presented here
suggest that the assumption of single-island endemics
having formerly been more widespread does not apply
to at least some of the Hispaniolan endemic birds.
Since these three species are each others' closest rela-
tives, it is highly unlikely they each were formerly
more widespread and ended up as relics on the same
island. A much simpler explanation is that they
evolved in situ and never dispersed to other islands.

ACKNOWLEDGMENTS
This manuscript was almost complete when Nedra
Klein passed away on 12 May 2001. Although we did
some additional analyses, revisions, and final correc-
tions, we have tried to maintain the text of this manu-
script as close as possible to her final draft. We know
that Nedra was grateful to governmental agencies and
her friends and colleagues in the Caribbean and South
American countries who facilitated this research. We
know that this list is not exhaustive, and we apologize
for those whose contributions we may have neglected
to mention. We thank the following for their help with
this project: G. Barrowclough, J. Bates, T. Baxter, F.
Burton, A. Capparella, E. Carey, E. Cuevas, P. Esca-
lante, C. Gauveca, J. Gerwin, F. Gill, C. Hernandez, J.
Hunt, Y. Klein, S. Latta, P. Lau, J. McLean, R. Ovidio
Sanchez, F. Sheldon, D. Siri, P. Sweet, K. Wallace, J.
Wunderle, Fundacion La Salle, the Academy of Natu-
ral Sciences of Philadelphia, the University of Michi-


gan Museum of Zoology, and the Louisiana State
University Museum of Natural Science. For finan-
cial support, we thank the Frank M. Chapman Fund
of the American Museum of Natural History, the
National Science Foundation, the Pritzker Labora-
tory for Molecular Systematics and Evolution oper-
ated with support from the Pritzker Foundation, and
the Ambrose Monell Molecular Laboratory and the
Lewis B. and Dorothy Cullman Program for Mo-
lecular Systematic Studies, a joint initiative of the
New York Botanical Garden and the American Mu-
seum of Natural History.

LITERATURE CITED
AMERICAN ORNITHOLOGISTS' UNION. 1998 Check-
list of North American Birds, 7th ed. Washington,
DC: American Ornithologists' Union.
AVISE, J. C., J. L. PATTON, AND C. F. AQUADRO.
1980. Evolutionary genetics of birds: comparative
molecular evolution in New World warblers and
rodents. J. Hered. 71:303-310.
BLEDSOE, A. H. 1988. Nuclear DNA evolution and
phylogeny of the New World nine-primaried os-
cines. Auk 105:504-515.
BOND, J. 1963. Derivation of the Antillean avi-
fauna. Proc. Acad. Nat. Sci., Phila. 115:79-98.
BOND, J. 1978. Derivations and continental affini-
ties of Antillean birds. Pp. 119-128 in Zo-
ogeography in the Caribbean (Gill, F. B., ed.).
Philadelphia, PA: Academy of Natural Sciences.
BURNS, K. J. 1997. Molecular systematics of tana-
gers (Thraupidae): evolution and biogeography of
a diverse radiation of Neotropical birds. Mol.
Phylogen. Evol. 8:334-348.
BURNS, K. J., S. J. HACKETT, AND N. K. KLEIN.
2002. Phylogenetic relationships and morphologi-
cal diversity in Darwin's finches and their rela-
tives. Evolution 56:1240-1252.
BURTT, E. H., JR. 1986. An analysis of physical,
physiological, and optical aspects of avian colora-
tion with emphasis on wood warblers. Ornithol.
Monogr. 38:1-126.
CICERO, C., AND N. K. JOHNSON. 2001. Higher-
level phylogeny of New World vireos (Aves: Vir-
eonidae) based on sequences of multiple mito-
chondrial DNA genes. Mol. Phylogen. Evol.
20:27-40.
CLARK, G. A., JR. 1974. Foot-scute differences
among certain North American oscines. Wilson
Bull. 86:104-109.
EDWARDS, S. V. 1997. Relevance of microevolu-


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 15









KLEIN ETAL.-MOLECULAR PHYLOGENETIC RELATIONSHIPS AMONG THE WOOD WARBLERS


tionary processes to higher-level molecular sys-
tematics Pp. 251-278 in Avian molecular evolu-
tion and systematics (Mindell, D. P., ed.), San
Diego, CA: Academic Press.
EISENMANN, E. 1962. On the genus
'Chamaethlypis' and its supposed relationship to
Icteria. Auk 79:265-267.
FICKEN, M. S., AND R. W. FICKEN. 1962a. The
comparative ethology of wood warblers: a re-
view. Living Bird 1:103-122.
FICKEN, M. S., AND R. W. FICKEN. 1962b. Some
aberrant characters of the Yellow-breasted Chat.
Auk 79:718-719.
FICKEN, M. S., AND R. W. FICKEN. 1965. Compara-
tive ethology of the Chestnut-sided Warbler, Yel-
low Warbler, and American Redstart. Wilson
Bull. 77:363-375.
GOLDMAN, N. 2000. Likelihood-based tests of to-
pologies in phylogenetics. Syst. Biol. 49:652-
670.
GRISCOM, L., AND A. SPRUNT, JR. 1957. The war-
blers of America. New York, NY: Devin-Adair
Co.
GROTH, J. G. 1998. Molecular phylogenetics of
finches and sparrows: consequences of character
state removal in cytochrome b sequences. Mol.
Phylogen. Evol. 10:377-390.
HEDGES, S. B. 1989. Evolution and biogeography of
West Indian frogs of the genus Eleutherodactylus:
slow-evolving loci and the major groups. Pp.
305-370 in Biogeography of the West Indies:
past, present and future (Woods, C. A., ed.).
Gainesville, FL: Sandhill Crane Press.
HEDGES, S. B. 1996. Historical biogeography of
West Indian vertebrates. Annu. Rev. Ecol. Sys-
tem. 27:163-196.
HEDGES, S. B., C. A. HASS, AND L. R. MAXSON.
1994. Caribbean biogeography: molecular evi-
dence for dispersal in West Indian terrestrial ver-
tebrates. Proc. Nat. Acad. Sci. USA. 89:1909-
1913.
HELM-BYCHOWSKI, K., AND J. C. CRACRAFT. 1993.
Recovering phylogenetic signal from DNA se-
quences: relationships within the corvine assem-
blage (Class:Aves) as inferred from complete se-
quences of the mitochondrial DNA cytochrome b
gene. Mol. Biol. Evol. 10:1196-1214.
HUELSENBECK, J. P., AND F. R. RONQUIST. 2001.
MRBAYES: Bayesian inference of phylogenetic
trees. Bioinformatics 17:754-755.


HUNT, J. H., E. BERMINGHAM, AND R. E. RICKLEFS.
2001. Molecular systematics and biogeography of
Antillean thrashers, tremblers, and mockingbirds
(Aves: Mimidae). Auk 118:35-55.
KLEIN, N. K., AND W. M. BROWN. 1994. Intraspeci-
fic molecular phylogeny in the Yellow Warbler
(Dendroica petechia), and implications for avian
biogeography in the West Indies. Evolution
48:1914-1932.
KLICKA, J., K. P. JOHNSON, AND S. M. LANYON.
2000. New World nine-primaried oscine relation-
ships: constructing a mitochondrial DNA frame-
work. Auk 117:321-336.
Losos, J. B., T. R. JACKMAN, A. LARSON, K. DE
QUEIROZ, AND L. RODRIGUEZ-SCHETTINO. 1998.
Contingency and determinism in replicated adap-
tive radiations of island lizards. Science
279:2115-2118.
LOVETTE, I. J., AND E. BERMINGHAM. 1999. Explo-
sive speciation in the New World Dendroica war-
blers. Proc. R. Soc. Lond., Ser. B 266:1629-1636.
LOVETTE, I. J., AND E. BERMINGHAM. 2001. Mito-
chondrial perspective on the phylogenetic rela-
tionships of the Parula wood-warblers. Auk
118:211-215.
LOWERY, G. H., AND B. L. MONROE. 1968. Family
Parulidae. Pp. 3-93 in Peter's Check-list of birds
of the world, Vol. 14 (Paynter, Jr., R. A., ed.).
Cambridge, MA: Museum of Comparative Zool-
ogy.
MACARTHUR, R. H. 1958. Population ecology of
some warblers of northeastern coniferous forests.
Ecology 39:599-619.
MARTIN, T. E., AND A. V. BADYAEV. 1996. Sexual
dichromatism in birds: importance of nest preda-
tion and nest location for females versus males.
Evolution 50:2454-2460.
MAYR, E., AND L. L. SHORT. 1970. Species taxa of
North American birds: a contribution to compara-
tive systematics. Cambridge, MA: Pub. Nuttall
Ornithol. Club, No. 9.
MCDONALD, M. A. 1988. The significance of het-
erochrony to the evolution of Hispaniolan palm-
tanagers, genus Phaenicophilus: behavioral, mor-
phological and genetic correlates. Ph.D. disserta-
tion, Univ. Florida, Gainesville.
MORSE, D. H. 1989. American warblers: an ecologi-
cal and behavioral perspective. Cambridge, MA:
Harvard Univ. Press.
PAMILO, P., AND M. NEI. 1988. Relationships be-


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 16









KLEIN ETAL.-MOLECULAR PHYLOGENETIC RELATIONSHIPS AMONG THE WOOD WARBLERS


tween gene trees and species trees. Mol. Biol.
Evol. 5:568-583.
PARKES, K. C. 1961. Taxonomic relationships
among the American redstarts. Wilson Bull.
73:374-379.
POSADA, D., AND K. A. CRANDALL. 1998.
MODELTEST: testing the model of DNA substi-
tution. Bioinformatics 14:817-818.
PREGILL, G. K., AND S. L. OLSON. 1981. Zo-
ogeography of West Indian vertebrates in relation
to Pleistocene climatic cycles. Ann. Rev. Ecol.
Syst. 12:75-98.
RAIKOW, R. J. 1978. Appendicular myology and
relationships of the New World nine-primaried
oscines (Aves: Passeriformes). Bull. Carnegie
Mus. 7:1-43.
RICKLEFS, R. K., AND G. W. Cox. 1972. Taxon cy-
cle in the West Indian avifauna. Am. Nat.
106:195-219.
RICKLEFS, R. K., AND G. W. Cox. 1978. Stage of
taxon cycle, habitat distribution, and population
density in the avifauna of the West Indies. Am.
Nat. 112:875-895.
RIDGWAY, R. J. 1902. The birds of North and Mid-
dle America, part 2. Washington, DC: Smith-
sonian Institution.
ROSEN, D. E. 1976. A vicariance model of Carib-
bean biogeography. Syst. Zool. 24:431-464.
SATO, A., H. TICHY, C. O'HUIGIN, P. R. GRANT, B.
R. GRANT, AND J. KLEIN. 2001. On the origin of
Darwin's finches. Mol. Biol. Evol. 18:299-311.
SEUTIN, G., N. K. KLEIN, R. E. RICKLEFS, AND E.
BERMINGHAM. 1994. Historical biogeography of
the Bananaquit (Coereba flaveola) in the Carib-


bean region: a mitochondrial DNA assessment.
Evolution 48:1041-1061.
SEUTIN, G., B. N. WHITE, AND P. T. BOAG. 1991.
Preservation of avian blood and tissue samples
for DNA analyses. Can. J. Zool. 69:82-90.
SHIMODAIRA, H., AND M. HASEGAWA. 1999. Multi-
ple comparisons of log-likelihoods with applica-
tions to phylogenetic inference. Mol. Biol. Evol.
16:1114-1116.
SHUTLER, D., AND P. J. WEATHERHEAD. 1990. Tar-
gets of sexual selection: song and plumage of
wood warblers. Evolution 44:1967-1977.
SIBLEY, C. G., AND J. E. AHLQUIST. 1982. The rela-
tionships of the Yellow-breasted Chat (Icteria
virens) and the alleged "slow-down" in the rate of
macromolecular evolution in birds. Postilla
187:1-19.
SIBLEY, C. G., AND J. E. AHLQUIST. 1990. Phylog-
eny and classification of birds. New Haven, CT:
Yale Univ. Press.
SPECTOR, D. A. 1992. Wood-warbler song systems.
A review of Paruline singing behaviors. Curr. Or-
nithol. 9:199-238
SWOFFORD, D. L. 2001. PAUP*. Phylogenetic
Analysis Using Parsimony (*and Other Methods).
Version 4.0b8. Sunderland, MA: Sinauer Associ-
ates.
WALSH, P. S., D. A. METZGER, AND R. HIGUCHI.
1991. Chelex 100 as a medium for simple extrac-
tion of DNA for PCR-based typing from forensic
material. Biotechniques 10:506-513.
WILSON, E. O. 1985. Invasion and extinction in the
West Indian ant fauna: evidence from the Do-
minican amber. Science 229:265-267.


Special Issue Honoring Nedra Klein


Journal of Caribbean Ornithology


Page 17











GEOGRAPHIC VARIATION IN BODY MASS OF THE BANANAQUIT (COEREBA FLA VEOLA)
IN THE TRINIDAD AND TOBAGO ARCHIPELAGO


FLOYD E. HAYES1, STEWART A. WHITE2, RICHARD P. FFRENCH3, AND STEFAN BODNAR4


1Department of Life Sciences, University of the West Indies, St. Augustine, Trinidad and Tobago; Current address: De-
partment ofBiology, Pacific Union College, Angwin, CA 94508, USA; 2Department ofEnvironmental and Evolutionary
Biology, Graham Kerr Building, University of Glasgow, Glasgow G12 8QQ, UK; 3Toftingal, Laurieston Road, Gatehouse
ofFleet, Dumfries and Galloway DG7 2BE, UK; and 4995 Chester Road, Birmingham B24 OHG, UK

Abstract.-An analysis of body mass data from 1571 individual Bananaquits (Coerebaflaveola) within the Trini-
dad and Tobago archipelago revealed significant differences among six geographic regions. Multiple comparison tests
indicated two geographic trends in body mass variation. First, body mass was higher in the mountains, where tempera-
ture is cooler and humidity higher, than in the lowlands of both Trinidad and Tobago. Second, there was a west-east
trend toward higher body mass from the Bocas Islands and Trinidad in the west to Tobago and Little Tobago in the
east. An inverse correlation between temperature and body mass was consistent with Bergmann's rule. The relationship
between body mass and humidity was less clear. An assessment of published data on the foraging ecology, interspecific
competition, genetic drift, and predation of Bananaquits in the archipelago failed to find any other satisfactory explana-
tion for geographic variation in body mass.
Key words: Bananaquit, body mass, Coereba flaveola, geographic variation, Trinidad and Tobago archipelago
Resumen.-VARIACION EN MASA CORPORAL DEL MIELERO FLAVO (COEREBA FLAVEOLA) EN EL ARCHIPIELAGO DE
TRINIDAD Y TOBAGO. Un analisis de datos de masa corporal de 1541 individuos del Mielero Flavo (Coerebaflaveola)
en el archipielago de Trinidad y Tobago demostr6 diferencias significativas entre seis regiones geograficas. Pruebas de
comparaciones multiples indicaron dos patrones geograficos en la variaci6n de masa corporal. Primero, la masa corpo-
ral fue mayor en las montafias, donde la temperatura es mas fria y la humedad es mas alta, que en las tierras bajas de
Trinidad y Tobago. Segundo, hubo un patron ascendente de masa corporal de oeste a este, de las islas Bocas y Trinidad
en el oeste hasta Tobago y Little Tobago en el este. Una correlaci6n inversa entre la temperatura y masa corporal con-
cord6 con la regla de Bergmann. La relaci6n entre masa corporal y humedad fue menos clara. Una evaluaci6n de datos
publicados sobre la ecologia de forrajeo, la competencia interespecifica, la deriva gen6tica y la depredaci6n sobre el
Mielero Flavo en el archipielago no encontr6 otra explicaci6n adecuada para la variaci6n geografica en masa corporal.
Palabras clave: archipidlago de Trinidad y Tobago, Coereba flaveola, masa corporal, Mielero Flavo, variaci6n
geografica
Rdsume.-VARIATION DE LA MASSE CORPORELLE DU SUCRIER A VENTRE JAUNE (COEREBA FLAVEOLA) DANS L'AR-
CHIPEL DE TRINITE ET TOBAGO. L'analyse de la masse corporelle de 1571 sucriers a ventre jaune provenant de l'archi-
pel de Trinit6 et Tobago a rev1ee des differences significatives parmi les 6 regions geographiques. Des tests de compa-
raison multiple ont montre deux tendances geographiques dans la variation de poids. Premierement, cette masse corpo-
relle est sup6rieure dans les montagnes ou la temperature est plus fraiche et l'humidit6 plus levee par rapport aux zo-
nes de basse altitude de Trinite et de Tobago. Deuxiemement, il existe un gradient croissant depuis les iles terme et
Trinit6e l'ouest vers Tobago et Little Tobago a l'est. La correlation inverse entre masse corporelle et temperature est
encore avec la loi de Bergmann. La relation entre masse corporelle et humidity est moins claire. Une etude des donn6es
publi6es sur l'ecologie de l'alimentation, la competition intersp6cifique, la drive g6entique et la predation des sucriers
n'a pas permis de trouver d'explication satisfaisante pour cette variation geographique de la masse corporelle.
Mots-clds: Sucrier b ventrejaune, masse corporelle, Coereba flaveola, variation gdographique, archipel de Trinite
et Tobago



THE IMPORTANCE OF documenting geographic correlation of intraspecific variation in body size in
variation in organisms has long been recognized by birds with climatic and topographical variables,
evolutionary biologists who seek to understand the coupled with a high degree of concordance among
underlying causes of such variation (e.g., Mayr species, suggests that such variation is the result of
1970, Gould and Johnston 1972). In birds, geo- natural selection for polygenic traits representing
graphic variation in body size is typically attributed adaptation to local conditions (e.g., James 1970,
to natural selection, environmental induction, or Zink and Remsen 1986). However, experimental
stochasticity (Zink and Remsen 1986). The strong transplants of Red-winged Blackbird (Agelaius


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 18









HAYES ETAL. -GEOGRAPHIC VARIATION IN BANANAQUITS (COEREBA FLAVEOLA) IN TRINIDAD AND TOBAGO


phoeniceus) eggs between distant regions demon-
strated that a significant proportion of regional differ-
ences in body size was attributable to non-genetic en-
vironmental induction (James 1983). Because a pleth-
ora of ecological variables (e.g., annual productivity,
degree of seasonality, habitat quality, food availabil-
ity, prey size, competition, and predation) potentially
affect body size and presumably covary with climate
and topography (e.g., James 1970, Cody 1974, Case
1978, Zink and Remsen 1986), seeking the causes of
geographic variation in body size is exceedingly diffi-
cult, requiring considerable study.
The Bananaquit (Coereba flaveola) is a widely dis-
tributed passerine exhibiting considerable geographic
variation in plumage within the Caribbean region (see
Seutin et al. 1994 and references therein) and else-
where in the Neotropics (e.g., Ridgely and Gwynne
1989, Ridgely and Tudor 1989, Howell and Webb
1996). Diamond (1973) demonstrated that body mass,
bill length, and wing length of the Bananaquit were
significantly correlated with elevation in Jamaica, and
that bill length and wing length (insufficient data for
body mass) were similarly correlated with elevation in
Central America and South America. In the Trinidad
and Tobago archipelago, which is inhabited by the
black-backed, yellow-bellied subspecies C. f luteola
of northern South America, Snow and Snow (1963)
and ffrench (1973, 1991) reported that the body mass
of populations inhabiting the relatively dry Bocas Is-
lands off northwestern Trinidad averaged lower than
the populations on Trinidad and Tobago. Feinsinger et
al. (1985) reported no significant differences in body
mass of Bananaquits between Trinidad and Tobago.
However, these studies did not compare body mass of
montane and lowland populations on Trinidad or To-
bago, or on Little Tobago at the eastern end of the ar-
chipelago. In this paper we provide a more thorough
comparison of geographic variation in body mass of
the Bananaquit throughout the Trinidad and Tobago
archipelago, and discuss the potential causes of such
variation.

METHODS
We obtained body mass data from 1571 Ba-
nanaquits during routine mist-netting operations con-
ducted intermittently by ourselves and others through-
out the Trinidad and Tobago archipelago from 1958 to
2002. Each captured individual was weighed with a
spring scale to the nearest 0.1 or 0.5 g. Because of the
difficulty of sexing and aging captured individuals,
the data for sex and age classes, as well as during all
seasons of the year, were combined for analysis. We


Table 1. Geographic variation in body mass (g) of the Ba-
nanaquit (Coereba flaveola) in six regions of the Trinidad and
Tobago archipelago.


Region

Bocas Islands
Trinidad, Northern Range
Trinidad, Lowlands
Tobago, Main Ridge
Tobago, Lowlands
Little Tobago


Mean SD Min Max n


did not attempt to analyze other body size meas-
urements because of variation by investigators in
the measurements obtained.
For the purposes of analysis, we combined data
within six regions. These include: (1) Bocas Is-
lands (elevation <100 m): Chacachacare and
Monos (D. Snow and B. Snow, 17 October 1958
to 13 April 1960, n = 55; ffrench, 19 February
1961 to 22 June 1975, n = 61; Bodnar, 30 Sep-
tember to 7 October 1999, n = 10); (2) Northern
Range of Trinidad (elevation 240-900 m): El Tu-
cuche, Paria Springs, Morne Bleu, Las Lapas, and
Arima Valley (ffrench, 23 April 1962 to 24 April
1982, n = 140; White, 11 July 1994 to 19 August
2001, n = 797; Hayes, C. Ramjohn, and Bodnar, 3
October 1999 to 10 March 2002, n = 30); (3)
Lowlands of Trinidad (elevation <100 m): Arena
Forest Reserve, Rio Claro, Victoria-Mayaro For-
est Reserve, and Guayaguayare (T. Lovejoy, 24
June to 24 July 1973, n = 63; White, 29 August
1994 to 8 August 2001, n = 191); (4) Main Ridge
of Tobago (elevation 300-550 m): Centre Hill,
Gilpin Trace, and Argyle River Trail (Hayes, 30
June 1996 to 8 August 2001, n = 77); (5) Low-
lands of Tobago (elevation <100 m): Grafton Es-
tate (ffrench, 18 May 1974 to 13 April 1975, n =
79); and (6) Little Tobago (elevation <100 m;
Bodnar, 12 October 1999 to 30 June 2000, n =
67).
Because the distributions tended to be bimodal
rather than normal, presumably due to sexual di-
morphism, the assumptions of parametric tests
were not met. We therefore used a non-parametric
Kruskal-Wallis test (H statistic) to test for differ-
ences among the six regions, and non-parametric
multiple comparison tests between pairs of re-
gions (Zar 1984). The statistical tests were com-
puted with Statistix 7.0 software (Anonymous
2000), with two-tailed probabilities and a = 0.05.


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 19









HAYES ETAL. -GEOGRAPHIC VARIATION IN BANANAQUITS (COEREBA FLAVEOLA) IN TRINIDAD AND TOBAGO

Table 2. Matrix of non-parametric multiple comparisons of body mass (g) of the Bananaquit
(Coerebaflaveola) among six regions of the Trinidad and Tobago archipelago. S = significant;
NS = non-significant.


Region


Trinidad, Northern Range
Trinidad, Lowlands
Tobago, Main Ridge
Tobago, Lowlands
Little Tobago


Trinidad


Tobago


Bocas
Islands N. Range Lowlands M. Ridge Lowlands


S
S S
S S
S
S NS


RESULTS
The body mass of Bananaquits varied signifi-
cantly among the six regions (H = 165.2, P <
0.0001; Table 1). Multiple comparison tests (Table
2) revealed that body mass was significantly lower
in the Bocas Islands and significantly higher in the
Main Ridge of Tobago than in any other region.
Body mass was significantly higher in the Northern
Range than in the Lowlands of Trinidad, and sig-
nificantly higher in the Main Ridge of Tobago than
in the Lowlands of Tobago. Body mass was signifi-
cantly higher in the Main Ridge of Tobago than in
the Northern Range of Trinidad, but was not signifi-
cantly higher for the Lowlands of Tobago than in
the Lowlands of Trinidad. Body mass in Little To-
bago was significantly lower than in the Main Ridge
of Tobago and significantly higher than in the Bo-
cas Islands.

DISCUSSION
A variety of univariate and multivariate metrics
have been used to assess body size in birds; of the
univariate metrics, body mass and tarsus length ap-
pear to be the most accurate (Rising and Somers
1989, Freeman and Jackson 1990). Although body
mass is more readily available and widely used than
tarsus length, individual variation in body mass may
be considerable due to variability in nutrition, time
of day, season, migration, age, sex, and reproduc-
tive status (Clark 1979). Thus, our data should be
viewed with caution. However, the large sample
sizes for most of our regions would tend to mini-
mize the effects of individual variation.
Our data revealed two clear trends. First, body
mass was higher in the mountains, where tempera-
ture is cooler and humidity is lower (Berridge
1983), than in the lowlands of both Trinidad and
Tobago. The same trend has been documented in
Jamaica, Central America, and South America


(Diamond 1973). Second, there was a west-east
trend toward higher body mass from the Bocas Is-
lands and Trinidad in the west to Tobago and Little
Tobago in the east. Temperatures in the more oce-
anic, windward islands of Tobago and Little Tobago
probably average cooler, with less seasonal varia-
tion, than at corresponding elevations in Trinidad
and the Bocas Islands (Berridge 1983). The rela-
tionship between body mass and temperature in this
study appears to be consistent with Bergmann's
"rule," which predicts that body size is inversely
correlated with temperature (James 1970, Zink and
Remsen 1986).
Bergmann's rule has also been modified to pre-
dict that body size is inversely correlated with hu-
midity (James 1970). However, our data contra-
dicted this prediction in that body mass was lowest
in the relatively dry Bocas Islands, situated in the
rain shadow of Trinidad (Berridge 1983, Hayes and
Samad 2002), and highest in the humid mountains
of Trinidad and Tobago. Because body mass was
significantly higher in Little Tobago, at the east end
of the archipelago, than in the similarly dry Bocas
Islands at the west end (Berridge 1983), humidity
alone cannot explain geographic variation in body
size. Bananaquit densities are sensitive to the sever-
ity of drought, which is greater in lowlands than in
mountains (Faaborg et al. 1984), and may affect
body mass as well. But this hypothesis is apparently
falsified by the significant differences in body mass
between the Bocas Islands and Little Tobago, which
are probably subject to similar periods of drought.
In a comparative study of nectar-feeding bird
guilds in Trinidad and Tobago, Feinsinger et al.
(1985) provided crucial data for several ecological
variables potentially affecting body size in Ba-
nanaquits, which forage chiefly on nectar (Snow
and Snow 1971). Seasonal variation in the nectar
supply was a hundredfold on both islands, with al-


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 20









HAYES ETAL. -GEOGRAPHIC VARIATION IN BANANAQUITS (COEREBA FLAVEOLA) IN TRINIDAD AND TOBAGO


temating periods of surplus and shortages in supply.
The guild-wide ratio of demand to supply for nectar
was no more variable on either island, and the me-
dian monthly ratio of demand to supply did not dif-
fer significantly between the two islands. Neither
the median monthly diet breadth of the guild nor the
diet breadth of Bananaquits differed significantly
between the two islands. Diamond (1973) suggested
that heat stress limiting foraging at midday may ex-
plain the lower body mass of Bananaquits at lower
elevations in Jamaica, Central America, and South
America, but no data are available on the foraging
rates of Bananaquits within the archipelago. These
results suggest that variation in seasonality, produc-
tivity, food availability, and diet may not provide an
adequate explanation for geographic variation in
body size of Bananaquits. Further studies, however,
are warranted.
Reduced interspecific competition in Tobago and
Little Tobago, which have fewer species of birds
than Trinidad (ffrench 1973, 1991), might explain
the trend for larger body mass on these islands, but
Feinsinger et al. (1985) found no significant differ-
ences in the intensity of exploitative competition
with other species on the two islands, and reported
that Bananaquits won a significantly higher propor-
tion of interspecific aggressive encounters in Trini-
dad than in Tobago. Furthermore, body mass was
significantly smaller in the Bocas Islands, which
have fewer species and presumably less interspeci-
fic competition than Tobago (Hayes and Samad
2002).
Feinsinger et al. (1985) suggested that the larger
body size of several hummingbird species in To-
bago might be explained by genetic drift
(stochasticity). Because the correlation of body
mass with elevation in Bananaquits occurs in other
parts of its range (Diamond 1973) and numerous
other species of birds average larger body size in
Tobago than in Trinidad, including a handful of en-
demic subspecies in Tobago recognized solely on
the basis of larger size (ffrench 1973, 1991), such
concordance is unlikely to be explained by stochas-
ticity alone. Feinsinger et al. (1985) also suggested
that larger body size in Tobago may be due to the
founder effect (a form of genetic drift), in which the
most likely colonists from Trinidad populations
might be those phenotypes having the longest wings
or largest fat reserves. However, Tobago was almost
certainly connected with Trinidad during the most
recent glacial periods (Comeau 1991), when consid-
erable gene flow must have taken place.
Predation may also account for geographic varia-
tion in body size, but no data are available on an-


nual survivorship or predation rates of Bananaquits
in the archipelago. However, all six regions are in-
habited by bird-eating snakes (Murphy 1997) and
raptors (ffrench 1991).
Finally, in a review of this paper, J. M. Wunderle
(pers. comm.) suggested that the impact of hurri-
canes presumably increases competition for nectar
and might put a premium on large body mass for
competitive interactions during post-hurricane food
shortages. In Jamaica, Bananaquits declined sharply
and apparently moved from montane to lowland
habitats following Hurricane Gilbert in 1988
(Wunderle et al. 1992). Although Tobago may ex-
perience a higher hurricane strike frequency than
Trinidad, both islands are south of the normal west-
ern Atlantic hurricane paths and are only rarely sub-
jected to hurricanes; the most recent strikes were in
Tobago in 1963 and Trinidad in 1933 (ffrench 1973,
1991, Berridge 1983).
In conclusion, temperature appears to be the only
factor correlated with geographic variation in the
body mass of Bananaquits in this study, but because
of the complexity of ecological interactions, seeking
a single explanation may be elusive. Furthermore, it
remains uncertain whether such variation is herita-
ble or induced by the environment. Egg transplanta-
tion experiments such as those conducted by James
(1983) would be useful to assess the roles of envi-
ronment and heritability in the ontogeny of body
mass in Bananaquits.

ACKNOWLEDGMENTS
We dedicate this paper to the memory of Nedra
Klein, who Hayes assisted with fieldwork in Grand
Abaco of the Bahamas, and in Trinidad and Tobago.
The Bananaquit was one of her favorite birds. We
thank J. M. Wunderle and W. J. Arendt for review-
ing the manuscript. Fieldwork by Hayes in Tobago
was funded by the American Bird Conservancy,
Amoco Trinidad Oil Company, Andrews Univer-
sity, Benton Basham, BirdLife International, British
Petroleum, Caribbean Union College, Center for the
Study of Tropical Birds, Fauna and Flora Interna-
tional, Field Museum of Natural History, Floyd
Murdoch Guardian Life of the Caribbean Limited,
Lincoln Park Zoo, Loma Linda University, Repub-
lic Bank Limited, Sigma Xi, Trinidad and Tobago
National Petroleum Marketing Company Limited,
and Trinmar Limited; further funding was acquired
by the sales of T-shirts with a painting generously
donated by John P. O'Neill. Fieldwork by Hayes
and Bodnar in Trinidad was funded by the Paria
Springs Eco Community and the University of the


Journal of Caribbean Omithology Special Issue Honoring Nedra Klein


Page 21









HAYES ETAL. -GEOGRAPHIC VARIATION IN BANANAQUITS (COEREBA FLAVEOLA) IN TRINIDAD AND TOBAGO


West Indies. Fieldwork by White in Trinidad was
funded by the Carnegie Trust and University of
Glasgow Court. Fieldwork by ffrench in the Bocas
Islands was supported by the Trinidad and Tobago
Field Naturalists' Club; fieldwork in Tobago was
funded by Erma J. Fisk. Fieldwork by Bodnar was
supported by Blue Waters Inn. Finally, we thank
Thomas Lovejoy and Carol Ramjohn for sharing
body mass data from Trinidad, and the more than
200 volunteers who assisted us with fieldwork.

LITERATURE CITED
ANONYMOUS. 2000. Statistix 7 user's manual. Tal-
lahassee, FL: Analytical Software.
BERRIDGE, C. E. 1983. Climate. Pp. 2-12 in The
natural resources of Trinidad and Tobago
(Cooper, St. G. C., and P. R. Bacon, eds.). Lon-
don: Edward Arnold.
CASE, T. J. 1978. A general explanation for insular
body size trends in terrestrial vertebrates. Ecology
59:1-18.
CLARK, G. A., JR. 1979. Body weights of birds: a
review. Condor 81:193-202.
CODY, M. L. 1974. Competition and the structure of
bird communities. Princeton, NJ: Princeton Uni-
versity Press.
COMEAU, P. 1991. Geological events influencing
natural vegetation in Trinidad. Living World, J.
Trinidad Tobago Field Nat. Club 1991-1992:29-
38.
FAABORG, J., W. J. ARENDT, AND M. S. KAISER.
1984. Rainfall correlates of bird population fluc-
tuations in a Puerto Rican dry forest. Wilson Bull.
96:575-593.
FFRENCH, R. 1973. A guide to the birds of Trinidad
and Tobago. Wynnewood, Pennsylvania, PA:
Livingston Publ. Co.
FFRENCH, R. 1991. A guide to the birds of Trinidad
and Tobago. Ithaca, NY: Cornell University
Press.
FEINSINGER, P., L. A. SWARM, AND J. A. WOLFE.
1985. Nectar-feeding birds on Trinidad and To-
bago: comparison of diverse and depauperate
guilds. Ecol. Monogr. 55:1-28.
FREEMAN, S., AND W. M. JACKSON. 1990. Univari-
ate metrics are not adequate to measure body size.
Auk 107:69-74.
GOULD, S. J., AND R. F. JOHNSTON. 1972. Geo-
graphic variation. Annu. Rev. Ecol. Syst. 3:457-
498.


HAYES, F. E., AND I. SAMAD. 2002. Avifauna of the
'dragon's teeth': the Bocas Islands, northern Gulf
of Paria, between Venezuela and Trinidad. Dept.
Life Sci., Univ. West Indies, St. Augustine, Occ.
Pap. 11:62-85.
HOWELL, S. N. G., AND S. WEBB. 1996. A guide to
birds of Mexico and northern Central America.
Oxford, UK: Oxford University Press.
JAMES, F. C. 1970. Geographic size variation in
birds and its relationship to climate. Ecology
51:365-390.
JAMES, F. C. 1983. Environmental component of
morphological variation in birds. Science
221:184-186.
MAYR, E. 1970. Populations, species and evolution.
Cambridge, MA: Harvard University Press.
MURPHY, J. C. 1997. Amphibians and reptiles of
Trinidad and Tobago. Malabar, FL: Krieger Publ.
Co.
RIDGELY, R. S., AND J. A. GWYNNE, JR. 1989. A
guide to the birds of Panama with Costa Rica,
Nicaragua, and Honduras, 2nd ed. Princeton, NJ:
Princeton University Press.
RIDGELY, R. S., AND G. TUDOR. 1989. The birds of
South America. Vol. 1. The oscine passerines.
Austin, TX: University of Texas Press.
RISING, J. D., AND K. M. SOMERS. 1989. The meas-
urement of overall body size in birds. Auk
106:666-674.
SEUTIN, G., N. K. KLEIN, R. E. RICKLEFS, AND E.
BERMINGHAM. 1994. Historical biogeography of
the Bananaquit (Coereba flaveola) in the Carib-
bean region: a mitochondrial DNA assessment.
Evolution 48:1041-1061.
SNOW, B. K., AND D. W. SNOW. 1971. The feeding
ecology of tanagers and honeycreepers in Trini-
dad. Auk 88:291-322.
SNOW, D. W., AND B. K. SNOW. 1963. Weights and
wing-lengths of some Trinidad birds. Zoologica
48:1-12.
WUNDERLE, J. M., JR., D. J. LODGE, AND R. B.
WAIDE. 1992. Short-term effects of Hurricane
Gilbert on terrestrial bird populations on Jamaica.
Auk 109:148-166.
ZAR, J. H. 1984. Biostatistical analysis. 2nd ed.
Englewood Cliffs, New Jersey: Prentice-Hall, Inc.
ZINK, R. M., AND J. V. REMSEN, JR. 1986. Evolu-
tionary processes and patterns of geographic
variation in birds. Curr. Omithol. 4:1-69.


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 22












INDEPENDENT GEOGRAPHIC ORIGINS OF THE GENUS AMAZONA
IN THE WEST INDIES


PATRICIA OTTENS-WAINRIGHT1 2, KENNETH M. HALANYCH3, JESSICA R. EBERHARD4, RACHEL I. BURKE2,
JAMES W. WILEY5, ROSEMARIE S. GNAM6, AND XIOMARA GALVEZ AQUILERA7

'Corresponding Author; 2Institute of Marine and Coastal Sciences, Rutgers University, 71 Dudley Road, New Bruns-
wick, NJ 08903, USA, e-mail: pwainrig@timcs.rutgers.edu; 3Life Sciences Department, Auburn University, Rouse
Building 101, Auburn, AL 36849, USA, e-mail: ken@aubum.edu; 4Department of Biological Sciences and Museum
of Natural Science, Louisiana State University, 202 Life Sciences, Baton Rouge, LA 70803, USA, e-mail: eber-
hard@lsu.edu; 5USGS, Maryland Cooperative Fish and Wildlife Research Unit, University of Maryland Eastern
Shore, 1120 Trigg Hall, Princess Anne, AMD 21853, USA, e-mail: jwwiley@mail.umes.edu; 6Center for Biodiversity
and Conservation, American Museum of Natural History, Central Park West at 79th Street, New York, NY 10024,
USA, e-mail: rgnam@magnus.amnh.org; and Empresa Nacional para la Protecci6n de la Flora y Fauna, La Ha-
bana, Cuba


"The distribution of birds is hard to understand but the present pattern is clear enough, al-
though complex. The processes that have produced the present pattern -the evolution and
dispersal of birds -are difficult to trace and understand." (Darlington 1957)

Abstract.-Nine species of the parrot genus Amazona are endemic to the Greater Antilles, Bahamas, and Cayman
Islands (A. leucocephala, A. agilis, A. collaria, A. ventralis, A. vittata) and Lesser Antilles (A. guildingii, A. imperi-
alis, A. arausiaca, A. versicolor). Populations of one species, A. leucocephala, colonized Cuba, Bahamas, and Cay-
man Islands resulting in five subspecies. Biogeographic relationships of these Antillean Amazona were examined by a
reconstruction of their evolutionary history: mitochondrial cytochrome b sequence data were analyzed with maximum
likelihood, parsimony, and distance methods. Phylogenetic analyses show a distinct divergence of the smaller and
mostly green Greater Antillean Amazona from the larger, more colorful Lesser Antillean species, and imply that they
colonized the West Indies independently. This phylogenetic reconstruction was used to trace potential dispersal routes
of ancestral Amazona into the West Indies. The species distribution found today in the Lesser Antilles may have been
the result of at least two colonization events from South America, one or more of which occurred early in the history
of this genus. Data from this study also suggest that there may have been two dispersal events to the Greater Antilles.
The Greater Antillean species appear closely related to the small A. albifrons of Central America. Evolutionary rela-
tionships within the A. leucocephala subspecies complex suggest that A. 1. bahamensis and A. 1. caymanensis were the
first populations of this species to become genetically isolated. Isolation of populations on Cuba (A. 1. palmarum and
A. 1. leucocephala) occurred later.
Key words: Amazona, biogeography, Caribbean, cytochrome b, parrots, phylogeny
Resumen.-Los ORIGENES GEOGRAFICOS INDEPENDIENTES DEL GENERO AMAZONA EN LAS ANTILLAS. Nueve espe-
cies de cotorras del g6nero Amazona son endemicas en las Antillas Mayores, Bahamas y las islas Caiman (A. leuco-
cephala, A. agilis, A. collaria, A. ventralis, A. vittata) y las Antillas Menores (A. guildingii, A. imperialis, A. arausia-
ca, A. versicolor). Poblaciones de una especie, A. leucocephala, colonizaron Cuba, Bahamas y las islas Caimann re-
sultando en cinco subespecies. Las relaciones biogeograficas de las especies de Amazona de las Antillas fueron exa-
minadas por medio de una reconstrucci6n de su historia evolutiva: secuencias de citocromo b mitocondrial fueron
analizadas utilizando m6todos de parsimonia, maxima verosimilitud y de distancia. Analisis filogen6ticos muestran
una marcada divergencia entre las especies de las Antillas Mayores, que tienen menor tamafio corporal y plumaje pre-
dominantemente verde, y las especies de las Antillas Menores, que tienen plumajes mas coloridos. Esta divergencia
implica que los dos grupos colonizaron los Antilles independientemente. Esta reconstrucci6n filogen6tica fue utiliza-
da para trazar rutas potenciales de dispersion de las Amazona ancestrales por las Antillas. La presente distribuci6n de
especies en las Antillas Menores podria ser resultado de por lo menos dos colonizaciones desde Sudamerica, y por lo
menos una de 6stas ocurri6 temprano en la historia del g6nero. Datos de este estudio tambi6n sugieren la posibilidad
de dos eventos de dispersion a las Antillas Mayores. Las especies de las Antillas Mayores estan estrechamente rela-
cionadas con A. albifrons, una especie relativamente pequefia de Centroamdrica. Relaciones evolutivas dentro del
complejo de A. leucocephala sugieren que A. 1. bahamensis y A. 1. caymanensis fueron las primeras poblaciones de
esta especie en aislarse gen6ticamente. El aislamiento de las poblaciones de Cuba (A. 1. palmarum y A. 1. leucocep-
hala) ocurri6 mas tarde.
Palabras clave: Amazona, biogeografia, Caribe, citocromo b, cotorras, filogenia


Special Issue Honoring Nedra Klein


Journal of Caribbean Ornithology


Page 23








OTTENS-WAINRIGHT ET AL. INDEPENDENT GEOGRAPHIC ORIGINS OF AMAZONA IN THE WEST INDIES


Rsum.-- ORIGINES GEOGRAPHIQUES INDEPENDANTES CHEZ LE GENRE AMAZONA DANS LES ANTILLES. Neuf
especes de perroquets du genre Amazona sont endemiques des Grandes Antilles, des Bahamas et des iles Cayman
(A. leucocephala, A. agilis, A. collaria, A. ventralis, A. vittata) et des Petites Antilles (A. guildingii, A. imperialis,
A. arausiaca, A. versicolor). Des populations d'une espece, A. leucocephala, ont colonis6 Cuba, les Bahamas et
les iles Cayman, donnant naissance a cinq sous-especes. Les relations biogeographiques entre ces amazones antil-
laises ont 6ete tudi6es par la reconstruction de leur histoire 6volutive. Les donn6es de sequences du cytochrome b
mitochondrial ont 6ete tudi6es par les methodes du maximum de vraisemblance, de parcimonie et de distance. Les
analyses phylog6entiques montrent une divergence entre les amazones des Grandes Antilles, plus petites et a do-
minante verte, et les especes plus grandes et colorees des Petites Antilles, ce qui indiquent qu'elles ont colonis6 les
Antilles ind6pendamment. Cette reconstruction phylog6entique a 6te utilis6e pour tracer les routes potentielles de
dispersion des amazones ancestrales dans les Antilles. La distribution des especes observes aujourd'hui dans les
Antilles pourrait etre le resultat d'au moins deux 6evnements de colonisation depuis l'Amerique du Sud, 'un d'en-
tre eux, ou plusieurs, 6tant survenu tries precocement dans l'histoire du genre. Les donn6es de cette etude sugge-
rent qu'il pourrait y avoir eu aussi deux 6evnements de dispersion dans Les Grandes Antilles. Les especes des
Grandes Antilles apparaissent 6troitement relies au petit A. albifrons d'Amerique Centrale. Les relations 6voluti-
ves du complexe de sous-especes de A. leucocephala suggerent que A. 1. bahamensis et A. L caymanensis ont 6te
les premieres populations de cette espece a avoir ete g6entiquement isol6es. L'isolement des populations de Cuba
(A. L palmarum etA. L leucocephala) est survenue plus tard.
Mots-clks: Amazona, biogdographie, Caraibe, cytochrome b, perroquets, phyloginie



INTRODUCTION


THE WEST INDIES and its unique avian fauna fas-
cinated early zoogeographers (Du Tertre 1654,
1667; Denny 1847a,b; Ldotaud 1866; Sclater 1891;
Arldt 1936; Berlioz 1959a,b; as summarized in
Wiley 2000). A distinctive feature of the West In-
dian avifauna is the widespread distribution of the
parrot genus Amazona; it is better represented than
any other parrot genus. Although the source of
Amazona in the West Indies is believed to be from
the mainland the details of their colonization pat-
terns are unclear.
We will first introduce the study area and sum-
marize its geologic history. We then outline hy-
potheses regarding the colonization of the West
Indies by birds and other fauna, and their evidence
and limitations relevant to this project. Next, we
discuss the history of the genus Amazona. Finally,
we present new molecular data that we use in this
study to fill gaps in the knowledge of the phy-
logeography of West Indian Amazona. These data
are corroborated with previous studies on compara-
tive plumage characteristics.

Study Area
Here, we adopt the description of the West Indies
(Fig. 1) as those islands that are in the Greater and
Lesser Antillean faunal regions (see review in Mor-
gan 2001). The Lesser Antillean faunal region in-
cludes the northern-most island of Anguilla to the
southern-most island of Grenada. The Greater An-
tillean faunal region includes the four major islands
of Cuba, Hispaniola (Haiti and Dominican Repub-


lic), Jamaica, and Puerto Rico and their satellite
islands (e.g., Isla de Pinos and Culebra); the Cay-
man Islands; the Bahamas (all islands of the Baha-
mas archipelago and the Turks and Caicos Islands);
and the Virgin Islands. The Anegada Passage is a
100-km water barrier between the Greater Antilles
(Puerto Rican Bank) and the Lesser Antilles (St.
Martin Bank). In this discussion, we exclude those
islands off the northern coast of South America
(Trinidad, Tobago, Isla de Margarita, Aruba, Bon-
aire, and Curacao).

Vertebrate Colonization of the West Indies
Many authors have explored the modes and
sources of vertebrate colonizations of the West In-
dies (e.g., Darlington 1957; Bond 1963, 1979; Lack
1976; Ricklefs and Cox 1978; Terborgh et al. 1978;
Pregill 1981; Morgan and Woods 1986; Kluge
1988; Hedges et al. 1992; Hedges 1996; Iturralde-
Vinent and MacPhee 1999). The two principal
theories that have been used to explain the origins
of island species are overwater dispersal and vicari-
ance (fragmentation of habitats). Island vicariance
can occur by geologic factors (plate tectonics) or
sea level changes that can result in the isolation of
ancestral biota (Morgan 1994). We will briefly pre-
sent arguments for and against vicariance and over-
water dispersal as potential colonization modes of
the West Indies.
Interest in a vicariant faunal history of the West
Indies resulted from emerging evidence of eastward
tectonic movement of the Caribbean plate during


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 24









OTTENS-WAINRIGHT ETAL. INDEPENDENT GEOGRAPHIC ORIGINS OF AMAZONA IN THE WEST INDIES


Atlantic Ocean


Sl 1 Grand Bahama
aN ";N -Abaco Bahamas
providence A. I. bahamensis
I mG o .
Somils ....-Sn Sl.dor
Long,
289 kilometers Cooked



Virgin Islands Anegada Pa.ssge
A. uulcep hala C/Aulebr
S. eucocephaa J / Angulla
A. I. paymauenms
\ A.' hrn **, 1Ba buda
Il "A. ventralis Montserrat I: ouade pe
A. collaria Hispaniola A vtttata M rn. G-alant i Dominica
SNicaraguan aglis Puerto 0- A. ,usiac
Rise Jamaca Rico Martnique A. mperilis
Fg 1 DSt. Lucia
hisoi ad h i St. Vincentd Atgua
Caribbean Sea Aruba Curaao
vtAs(Cle ) A. I ael ,A ( al A gmiatdingiin /
Isla de f #Grenada
T og"na lre Magar Toago











leucocephala bahamensis (Grand Turk, Fortune, Long, Acklins, New Providence, and Crooked islands, Bahamas), and A.
leucocephala hesterma (Little Cayman, Cayman Islands). There is evidence ofAmazona (undescribed species) on Mont
A Not included in this studyD


Fig. 1. Distribution of Amazona in islands where they reside. Extinct species jad previous distributions known from pre-

vittata gracilipes (Culebra), A. violacea (Guadeloupe), A. cf violacea (MaRie-Galante), A. martinicana (Martinique), A.



serrat, Grand Turk, and Grenada. These extinct and undescribed species of Amazona are not shown, however, the names
of these islands are shown in this figure.


the late Cretaceous to early Tertiary (e.g., Malfait
and Dinkelmann 1972; see Table 1 for an outline of
geologic time intervals discussed here and below),
carrying with it a proposed archipelago (Greater
Antilles) that initially lay between South and Cen-
tral America, and its ancestral mainland biota
(Croziat et al. 1974, Rosen 1976). However, there
is no evidence that these early emergent lands sur-
vived as permanent islands into the Late Eocene
(continent-island vicariance; Iturralde-Vinent and
Mac Phee 1999).
More recent tectonic models of the eastward
movement of the Caribbean plate (e.g., Pindell et
al. 1988) stimulated further interest in vertebrate
colonization of the West Indies. Two terrestrial
connections may have existed at alternate times


between Central America and the Greater Antilles
during the early Tertiary: 1) Cuba was connected
with the Yucatan Peninsula and 2) Jamaica and
Honduras were connected by the Nicaraguan Rise
(Donnelly 1988). Direct paleontologic evidence of
early Eocene terrestrial mammals in Jamaica (e.g.,
Hyrachyus; Domning et al. 1997) indicates that
emergent land between western Jamaica and the
eastern end of the Nicaraguan Rise may have pro-
vided a corridor for immigration of such terrestrial
biota (as reviewed in Portell et al. 2001). Both of
these connections were, however, submerged by
the middle Tertiary (30 million years before pre-
sent; mybp), creating overwater distances of ap-
proximately 350 km across the Nicaraguan Rise
and 150 km between Cuba and the Yucatan Penin-


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 25









OTTENS-WAINRIGHT ET AL. -INDEPENDENT GEOGRAPHIC ORIGINS OF AMAZONA IN THE WEST INDIES


Table 1. Geologic time scale is given in years before present (approximate dates after
Feduccia 1996). Divisions of the geologic time scale are shown here as Eras (Cenozoic and
late Mesozoic), Periods (Quaternary, Tertiary, and Late Cretaceous), and Epochs
(Paleocene through Holocene).


Era

Cenozoic






Mesozoic


Period

Quaternary

Tertiary




Late Cretaceous


sula (Fig. 1; Donnelly 1988). The mammalian fos-
sil record and recent geologic evidence are also
consistent with the opinion that there was a short-
lived corridor (Aves Ridge continuous or punc-
tuated by short water gaps) between the developing
Greater Antilles and northwestern South America
(Eocene-Oligocene interval of 35-33 mybp)(as re-
viewed in Iturralde-Vinent and MacPhee 1999).
Subsidence and subdivision of this corridor (island-
island vicariance; Iturralde-Vinent and MacPhee
1999) would have occurred, however, before the
more recent divergences of avian genera and spe-
cies in the Miocene, Pliocene, and early Pleistocene
(Wetmore 1951, Haffer 1985, Feduccia 1995). A
vicariant hypothesis of colonization would not ap-
ply to the Lesser Antilles because this volcanic ar-
chipelago developed essentially in their current po-
sition from the Miocene to Recent (Donnelly
1988).
Early viewpoints of avian colonization in the
West Indies suggested occurrences of dispersal
events from the mainland (Darlington 1957, Bond
1963, Lack 1976). Bond (1963, 1979) concluded
that bird species from South America colonized the
West Indies relatively recently, from the south
through the Lesser Antilles and Trinidad (by defini-
tion, not in Lesser Antilles) and from the west
through Jamaica. The source for most of the
Greater Antilles was Central America (Darlington
1957; Bond 1963, 1979). Comparisons of plumage
characteristics between the West Indian species of
the parrot genus Aratinga and those from South and
Central America indicated two distinct invasions
into the Greater Antilles (Marien and Koopman
1955), apparently from the Yucatan Peninsula and
the Honduran-Nicaraguan Bulge (Lantermann


Epoch

Holocene
Pleistocene
Pliocene
Miocene
Oligocene
Eocene
Paleocene


Approximate years
before present

Recent-10,000
10,000-2,000,000
2,000,000-5,000,000
5,000,000-23,000,000
23,000,000-34,000,000
34,000,000-55,000,000
55,000,000-65,000,000
65,000,000-100,000,000


1997). Hummingbird distribution patterns in the
West Indies suggest that colonization events were
from Central America into the Greater Antilles and
Bahamas and from South America into the Lesser
Antilles (Schuchmann 1980). Several species of
bats (e.g., Natalas spp.) and non-volant mammalian
species also show a similar biogeographic pattern
within the West Indies (Morgan and Woods 1986;
Morgan 2001; Morgan, pers. com.). A bio-
geographic break at the Anegada Passage (Fig. 1)
appears to exist for many, but not all (see Results
and Discussion: Biogeographic junction between
the Lesser and Greater Antilles), avian and bat spe-
cies at the northern end of the Lesser Antilles
(Antigua and Barbuda) and the eastern-most exten-
sion of the Greater Antillean faunal region (Puerto
Rico and Virgin Islands; Bond 1963, Ricklefs and
Cox 1972, Morgan 2001).
Phylogenetic data are useful for reconstructing
geographic and historic patterns of colonization.
Multiple colonizations from different geographic
sources will result in a phylogeographic pattern that
appears random (polyphyly). A stepping-stone
model of colonization, however, involves a single
mainland source of dispersal resulting in mono-
phyly of island taxa (as reviewed in Klein and
Brown 1994). Recent examinations of inferred phy-
logenetic relationships have found both polyphyly
and monophyly of several avian taxa within the
West Indies (Klein and Brown 1994, Seutin et al.
1994, Hunt et al. 2001).

Fossil and Zooarcheologic History of New World
Parrots
Olson (1989) hypothesized that parrots origi-
nated in the Southern Hemisphere and became es-


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 26









OTTENS-WAINRIGHT ETAL.


tablished in the Northern Hemisphere sometime in
the early Miocene. The earliest New World parrot
fossil, Conuropsis fratercula, was found in North
America (Nebraska) from the Miocene (late Hem-
ingfordian, 16.1 + 3.7 mybp) (Wetmore 1926; as
reviewed in Wetmore 1956, Olson 1985, Becker
1987). Only Pleistocene parrot fossils, including
Amazona amazonica (Brazil) and Amazona fari-
nosa (Peru), have been found in South America
(Brodkorb 1971, Campbell 1976, Cuello 1988).
Records from the West Indies include: 1) Pleisto-
cene fossils of the extinct macaw, Ara tricolor, in
Cuba (Wetmore 1928, 1956; Brodkorb 1971; Arre-
dondo 1984); 2) the extinctAra autocthones in pre-
historic kitchen middens on St. Croix, Virgin Is-
lands (Wetmore 1937, 1956); and 3) an undated-
parrot rostrum from Barbuda (Williams and Stead-
man 2001). Remains of Amazona leucocephala are
reported in several Pleistocene cave deposits on
New Providence, Bahamas (Brodkorb 1959, 1971;
Olson 1978; Olson and Hilgartner 1982) and Cay-
man Brac, Cayman Islands (Morgan 1994); a pre-
Columbian bone on Crooked Island, Bahamas
(Wetmore 1938, Olson and Hilgartner 1982); and a
Quaternary tibiotarsus from Cueva del Cam-
pamento, Cuba (Diaz Franco 1999).
Our ability to determine the origins of many is-
land vertebrate species and processes of their evo-
lution are confounded by pre-historic and historic
human activities: archeologic evidence suggests
movement of West Indian vertebrates among the
islands (Pregill et al. 1988). Parrots in particular
were transported between islands by pre-
Columbian Indian cultures (Olson 1982), and there
is evidence that some were consumed for food (Du
Tertre 1654, 1667; as reviewed in Clark 1905a;
Wetmore 1917). Localized and complete extinc-
tions of vertebrate species followed Amerindian
(4500 to 500 years before present; ybp) and post-
Columbian (500 ybp) colonizations (Olson 1978;
Olson and Hilgartner 1982; Steadman et al. 1984;
Morgan and Woods 1986; Pregill et al. 1988, 1994;
Morgan 1994; James 1995). Early writings (Clark
1905a,b), along with zooarcheologic (Williams and
Steadman 2001) and fossil evidence (see above),
suggest a formerly more expanded distribution of
parrot taxa in the West Indies, but they do not re-
veal their place of origin.
At least three parrot genera were found in the
West Indies: Ara (macaw), Amazona, and Aratinga
(parakeet) (Wiley 1991, Williams and Steadman
2001). Although controversial, there is evidence of
a fourth genus, Anodorhynchus (macaw), in the


INDEPENDENT GEOGRAPHIC ORIGINS OF AMAZONA IN THE WEST INDIES

Lesser Antilles (Snyder et al. 1987, Williams and
Steadman 2001). An estimated 50-60 endemic spe-
cies of parrots are thought to have occurred in the
region (Williams and Steadman 2001) before human
influence. At the time of Columbus's discovery of
the West Indies, nearly 28 species were found; only
12 of them (species of Amazona and Aratinga) re-
main today (Wiley 1991).

Current New World Parrots and Amazona
The family Psittacidae includes all the New World
species and comprises two distinct monophyletic
groups-species with short tails and those with long
tails-that emerged during the Eocene
(approximately 50 mybp)(Miyaki et al. 1998). Spe-
cies of Amazona have short tails and are from 23 to
45 cm in length. They have a naked, prominent cere
above a strong and heavy bill, a distinct notch in the
upper bill, short-broad rounded wings, and diverse
plumages (Snyder et al. 1987, Forshaw 1989, Collar
1997, Juniper and Parr 1998).
The genus Amazona includes approximately 30
recognized extant species (Forshaw 1989, Collar
1997, Juniper and Parr 1998). The greatest diversity
of Amazona occurs in South America, and it was
also highly successful in colonizing Central America
(Forshaw 1989). Amazona is one of two parrot gen-
era in the Neotropics where sympatric species co-
occur, and in many places three or four species over-
lap ranges (Collar 1997).

Amazona of the Greater and Lesser Antilles
The nine extant West Indian Amazona (Fig. 1)
include the smaller species in the Greater Antilles,
Cayman Islands, and Bahamas (A. agilis, A. collaria,
A. leucocephala, A. ventralis, A. vittata) and the lar-
ger species in the Lesser Antilles (A. arausiaca, A.
guildingii, A. imperialis, A. versicolor; Forshaw
1989, Wiley 1991, Raffaele et al. 1998). In the
Greater Antilles, Jamaica has two sympatric species
(A. agilis and A. collaria) and in the Lesser Antilles,
Dominica has two sympatric species (A. arausiaca
andA. imperialis; Lack 1976, Collar 1997).
Amazona leucocephala is represented by five sub-
species in Cuba, the Cayman Islands, and the Baha-
mas (Fig. 1; reviewed in Wiley 1991). Amazona leu-
cocephala leucocephala is found mainly in eastern
Cuba and A. 1. palmarum occurs in western Cuba
and off the southwestern coast, on Isla de Pinos (Isla
de la Juventud). Two subspecies occur in the Cay-
man Islands: Amazona 1. caymanensis on Grand
Cayman and A. 1. hesterna on Cayman Brac and pre-
viously on Little Cayman. Currently two populations


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 27









OTTENS-WAINRIGHT ETAL. -INDEPENDENT GEOGRAPHIC ORIGINS OF AAZONA IN THE WEST INDIES


autumnalis


A. aestiva


A. barbadensis

A. dufresnana


.rina A. auropalliata
Sfarinosa.


A. ochrocep al
hroc


S-A. xantholora

A. albifrons
A. tucumana


Fig. 2. Mainland distribution of Amazona included in this study. Ranges are estimated from Forshaw (1989). Amazona
tucumana and A. xantholora are mentioned in the text but are not included in this study.


of A. 1. bahamensis survive: one on Abaco
(Schroder 1988, Gnam 1991, Gnam and Burchsted
1991) and one on Great Inagua (Snyder et al. 1982,
Gnam 1990, Gnam et al. 1995).
Archeologic evidence and historic accounts sug-
gest a wide distribution of Amazona throughout the
Lesser Antilles (see review in Williams and Stead-
man 2001). For example, an undetermined large
species of Amazona occurred on Grenada (Du Ter-
tre 1667; as mentioned in Snyder et al. 1987 and
Butler 1992; reviewed in Williams and Steadman
2001). Amazona violacea from Guadeloupe (based
on writings of DuTertre 1654, 1667; Labat 1722,
1724, 1742; Brisson 1760; as compiled in Clark
1905a and Wiley 2000) and, perhaps, A. cf. violacea
from Marie-Galante (Williams and Steadman 2001)
appeared to share a striking purple plumage with A.
imperialis of Dominica (Clark 1905a). Apparently,


Amazona violacea was larger thanA. imperialis and
had a red eye ring (Clark 1905a), however, plumage
descriptions of these extinct species of Amazona do
not clearly determine if they are unique species or
the same species. Another extinct species from Mar-
tinique, A. martinicana (Clark 1905a), was large
and resembled A. versicolor (St. Lucia) and A. arau-
siaca (Dominica). The plumage of the head was
mostly slate-colored with a small amount of red
(based on account of Labat 1722; reviewed in For-
shaw 1989 and Williams and Steadman 2001).
Amazona martinicana may have been related to
these two species and its colonization was part of a
radiation among the more central islands of the
Lesser Antilles.
Plumage characteristics and morphometric meas-
urements suggest a close relationship of the Greater
Antillean species ofAmazona (Fig. 1) with the Cen-


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


viridigenalis

A. finschi


Page 28









OTTENS-WAINRIGHT ET AL. -INDEPENDENT GEOGRAPHIC ORIGINS OF AMAZONA IN THE WEST INDIES


tral American A. albifrons and A. xantholora (Fig.
2; Lack 1976, Snyder et al. 1987, Wiley 1991,
Lantermann 1997), which are thought to be sibling
species (Paynter 1955). Several authors (Bond
1963, Lack 1976, Snyder et al. 1987, Wiley 1991,
Lantermann 1997) favor two colonizations of the
Greater Antilles from Central America (e.g., Yuca-
tan Peninsula and Honduran-Nicaraguan Bulge).
Movement of parrots into the Lesser Antilles (Fig.
1) was probably from South America (Bond 1963,
Snyder et al. 1987, Lantermann 1997). The relation-
ship among the Lesser Antillean Amazona and
South American species appears complex based on
their plumage patterns (Snyder et al. 1987, Forshaw
1989, Collar 1997, Juniper and Parr 1998). Plumage
characteristics have proven useful in establishing
relationships; however, such analyses have been
difficult because the evolution of parrot plumage
patterns is not well understood (Snyder et al. 1987).
Comprehensive studies of species of Amazona are
few, making comparative analyses difficult (Snyder
et al. 1987, Lousada and Howell 1996; and see re-
views in Gnam 1991, Enkerlin-Hoeflich 1995,
Koenig 1999).

Molecular Data
Molecular data provide another means of estimat-
ing the relationships of organisms (Avise 2000) be-
cause nucleotide sequences carry information about
the taxa's historical past (Zuckerandl and Pauling
1965). Mitochondrial DNA sequences (e.g., cyto-
chrome b gene) provide a source of characters for
studying systematics (Wilson et al. 1985) and bio-
geography (as reviewed in Avise 2000).
We attempt to provide the best estimate of the
relatedness of the West Indian Amazona with sev-
eral mainland species by reconstructing a phylog-
eny using cytochrome b sequence data. We com-
bine this analysis with current distribution patterns
of Amazona to propose a hypothesis of their historic
movements into the West Indies. Finally, we evalu-
ate plumage characteristics from mainland and is-
land species to determine whether they support the
molecular phylogeny presented here.

MATERIALS AND METHODS
Samples and Permits
We provide a list of all individuals sampled for
this study in Table 2, which includes sample types,
source of samples, voucher identification (deposited
with George Amato, Wildlife Conservation Society
of New York), permit identification numbers, se-
quence length, and GenBank accession numbers.


Permits (Convention for International Trade of En-
dangered Species, CITES I & II) were obtained and
regulations were followed for the importation of
samples obtained from outside the United States
(Littell 1993). The U.S. Fish and Wildlife Service
was consulted for appropriate procedures regarding
the transfer of samples within the United States.
Samples were collected from wild and captive
birds. Ornithologists from established institutions
collected samples from wild birds (Table 2). We
collected feathers from A. leucocephala palmarum
in Cuba (Isla de Pinos) and A. 1. caymanensis in the
Cayman Islands (Grand Cayman). On Isla de Pinos,
juvenile parrots were removed from nests by Cuban
scientists from the Empresa Nacional para la Protec-
ci6n de la Flora y Fauna. Two to three contour pin-
feathers were extracted with sterile forceps from
each individual and placed in 80% ethanol. Previous
studies indicated that removal of a primary wing
pinfeather does not affect nestling survival (Stangel
and Lennartz 1988) but we chose to take smaller
contour feathers to decrease discomfort to the nes-
tling parrots. In the Cayman Islands, with assistance
from F. Burton and the National Trust of the Cay-
man Islands, we collected individual feathers (A.
leucocephala caymanensis) from road kills (wild
birds) and private aviary collections (captive birds).
Samples (captive birds) from zoological institu-
tions and private aviaries were predominately feath-
ers, although several blood samples, and one liver
and one skin sample (deceased birds) were used. No
birds were harmed or sacrificed for collection of
any samples.
Categorization of samples from captive birds in-
clude: 1) wild-caught birds that were transferred to
a zoological institution within the same country or
island, 2) wild-caught birds that were transferred
from their place of origin to a zoological institution
of a different country or island, and 3) pet or avicul-
tural birds (Table 2). Reputable scientists made
taxonomic identifications of the captive birds
(categories one and two), and supervised the collec-
tion of samples for this study.
In the Bahamas, the Bahamas National Trust
(supervised by M. Isaacs and E. Carey) transferred
A. 1. bahamensis captive birds (category 2) from
their island of origin. Wardens transported parrots
from Great Inagua to the Ardasta Zoo (New Provi-
dence) for a captive-breeding program. The single
captive bird from Abaco was removed from a nest
and transferred to Rand Nature Center on Grand
Bahama. The Great Inagua parrot is distinct from
the Abaco parrot: there are more white feathers on


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 29











OTTENS-WAINRIGHT ETAL. INDEPENDENT GEOGRAPHIC ORIGINS OFAMAZONA IN THE WEST INDIES


00 -







00


CDC~






00
00
0 s- c
I^
I.IQ^
Q "~ n





0c.5
C) 0
010 -


zj 0'z
.





0~ 0
-a- s cN
Ci) > N
:, ^ c
Q 3"T
*aioOs^

lltl
A ^a
^ ins?^


5i
o~









". d
0 -e ON







aro
a S'
a u<

u .s m

cc





mNj
g 1^
~O Clo




rX
cl C



') W "i
& 0<





US2
Xc,

' Cl
0u


-t n

,- 6

i'pb





ao,

-O 0L< _





'd4
03 0 cc
-= -^ C
E2
o S^ S
S. o o (^

lljlN
r5 N ^
G S'^
h 2
0 w^l
O <.
H^ cP .

a ^?

i^'gs
_^W 0
"a" ai N
M "-v


r~i
Vct

m
W
icic 1
icic i
ic c U


ND ND C, C, C, D 't, cfl ND cfl N
0>^ 0> 0> 0> 0> 0> 0> 0> 0> 0> 0>
0> 0> 0> 0> 0> 0> 0> 0> 0> 0> 0>


00 (N rm

Ii i 00
" ^3 "

a & ?
cc
Nl cc N





u u3'i
^ ^
~ 0

2 2

u $A


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


N\D

r



E
1" O






3o ^
5-'a =





Ni i


^3:


Y1


0
n


=te
Sa C

(/ C)
E-

o0
0 -^

= 0)
a 0

02 -a


0J
=a



0a
8^
t*
"i
CJ



0,
>


S<;
s
^=fi











* C=la
a











o H
*aMw



l^




ai^r
EQ^

I ^
p ia

l^d






<; a ff


0n t -

o mli
.i "



- c
IIc



ua
r^m





N N0
a-Q
-o i


~"l^
p **-
'^ l (


)-


0>



0 \
cc
?SS

-s a
xv
^

00c00
a,,
*^


A<
0U oo



a UN
^y


*b -a<
* ,g0


" ^
m F








00
r
^ "a



- C




a
0&
2=






a
0-



~o .C <
5 a
6 0 v-i
^ ^t^
Mg,t


5>


01
N

H

w

u


C-




0C


= '-6
0>





H 0
5 z


CN
00
cc
Cl
* -

H
5
(N


00
f-
i -






0 .^
-3 9


00
00
C-
00 i-


~


IE I
rt H
0


ND
ND
N ND
- N

I' N

2 I~


I I
c u
at ^


Y
c .i


=.
C-I
0 ,
e 0


icicicic
icicicic


ic ic
ic ic ic
ic ic ic


i i
i i
i i


Page 30










OTTENS-WAINRIGHT ETAL. INDEPENDENT GEOGRAPHIC ORIGINS OF AMAZONA IN THE WEST INDIES


01
8n t o 00 mnr~ 00
-0 rn- M D
Cl


Q5 6,
~r > (/a T3 ^ ^^ -^ ^ ^* T (N'^i r ^ ^ ^ ^ie^ ^ i
o '-o H'-4 -, Cf ^ 0Sa2 a ^S ^*;2 m

CD .3 -- on |00 SC &
^1 ^1 1" S~ 1 I ilgll


0< .zccn n 0
00 C m 00 U 0 0 0, 0 4
o '-fooo -z rn
N


UE U 0m, f : 6 0



Zi'C ^i ii ^ 13 .|0 <| 0 0 iici
0 0 M, U
I ~~ ~ ~ q ;il| 7j |
0 4 0 U i




0 Cl


qg~ r | |^ ? l Cl 0> Cl NDlQ lll -
N D N N N N bN







* H U ^' U l r h ^* ^ *< r r r * * r
O Cl
m^ mi <;^Su ^(iS c-S ^ ou QSRSu.^'. M S








a>
U eU
0- mr a 1mo ,c

0 > 00 U x 00 0 72 Cl c cc









*00 U 0






2< * o cc a> a a 2
0 0
.oC, C, Cd

















Z 0 000 0 0
+^ 0> 0 0 0> 0 0> 0> 0> 0>

> > 0> a> a> a> a> a0 a> a a> > a a >


*t; U U U U M UU
^~~~~~ a^ ^ S

















m m m c 0
-a1 01 01 01 01 0 1 0 01 01









000
i bb b" bd bd o" d "" mmc bU o




o~ .o N b



















-zz
0 cz z N







1z -z -z 1z1
ont- C~n"C"3-n~eZr
















Cl^ '-- r ~ ^ 0v- -~ vCl inn Cl Cl rl v-t -"I innD
0 o

0 *^ 000
^7- 7-aS^ S^ C ^ f
to to to to to to to to to to t
*22d Iroar ^ ^^i^3 2
|1 p& i3 Ilae i^ i^ i~ ~ iliI |





H c-n c- ~ uo~, ~ ~ aF
I: i l o l c~ II II |. I 11
"N a .l IB i ^^ l 2

*s ??* ~s p'5 P: 'du dd 5 d '5 wd e

8- S S
a *^|: i



rt ~ ~ r I-t+D\ 00 0 0 \^
^ ] ] _] _ ] i i ^- -]^] ] _] _


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 31









OTTENS-WAINRIGHT ETAL. INDEPENDENT GEOGRAPHIC ORIGINS OF AMAZONA IN THE WEST INDIES



0

-- 00 i |0









i ^s I2 i ^ I iii I .I
S Cl I C )
51 -tm t N 1
00




:4. ^ | 00




|l -- 0
2 M-Q ^- B^ 0U Q -























i^ ++| ,, "1 i I



= G S-^^ ^^ .= --n o =. z I :: .- =


-5 > g .o! .s I .== =- -3


"^sl^^gi "=^ - ^ &
J S .o fs< a l
~~j~ o ~ 0
S 0 00 00





^C $-& &,& ,&,i ls
0 0
CD CD







O- C 00 05 0

t ~ 00 t .


-to
Cl 00 0





S000 -^ -" ^ z z
0a f "t~ Z *^^ .


0 16



C,~~ C) 0, C ,C










s~~I + I
r-c
M ~~ ~ -c .






000

CU,-
a S i |a l -

0 0" 00 t- ^ <
Nl (t *- *i *^ ^
s *n * 0i S'a ^













Qg ^ 2 2 M 2 4 cul"
0to





(U ^ '*^ 'N' '3
7- 7- 7- 7 -io 2
to 2 -t to
C- *s *- * -S 00 S C)- S

*5 -" -^ *a *a o H


s g" -' o' 0-


s~~~~~3~ o 0' 1 ^ g g 1 lilli
ff ~ ~ ~ ~ 0 ^ 2 0> u?


Page 32


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein









OTTENS-WAINRIGHT ETAL. -INDEPENDENT GEOGRAPHIC ORIGINS OF AMAZONA IN THE WEST INDIES


Table 3. The name of the primer includes the designation for the light (L) chain and heavy (H) chain of
the cytochrome b gene. The approximate position relative to the 3' end of the chicken mitochondrial
DNA sequence is given herein as the primer name (Desjardins and Morais 1990). Various combinations
of these primers were used to amplify the cytochrome b fragments and determine their nucleotide se-
quence. Several primers were numbered in original publications according to their approximate position
in the human mitochondrial DNA sequence (second number; Anderson et al. 1991): L14990 = L14841,
L15311 = L15162, L15506 = L15362, L15656 = L15507, H15104 = H14955, H15298 = H15149,
H15710 = H15561, andH16062 = H15915.


Primer
name


Nucleotide sequence (5'to 3')


Source


Light Chain
L14990 CCATCCAACATCTCAGCATGATGAAA
L15311 CTACCATGAGGACAAATATC
L15506 CTCACCTTCCTACACGAAACAGG
L15656 AACCTACTAGGAGACCCAGA
L15562 GACAAAATCCCATTCCACCC
L15762 ATCCTACGCTCAATCCCCAACAAACTG
L15866 CCTTCCGCCCCCTCTCACAACTC
L15417 GGTGGCTTCTCAGTGGACAACCCAA
L15985 TAACCTACTTCACCATCCTACTA
L15039 ACTGACACAAATCCTAACAG
L15288 AGCAACTGCCTTCGTAGGATA
L15010 ACTTCGGATCTCTCCTAGG
L15219 CTTCATCTGCATCTACCT
Heavy Chain
H 15104 GAGTCAGCCATATTGGACGTCTCGGC
H15298 GCCCCTCAGAATGATATTTGTCCTCA
H15710 GTAGGCGAATAGGAAGTATC
H15917 ATGAAGGGATGTTCTACTGGTTG
H16062 GGAGTCTTCAGTCTCTGGTTTACAAGAC
H15622 GGTTGGGGGAGAATAGGGCTA
H15543 GGGTGGAATGGGATTTTGTC
H15735 CAGTTTGTTGGGGATTGAGCGTAGGAT
H15844 GAGTTGTGAGAGGGGGCGGAAGG
H15360 GGGTTAGTGTTGGGTTGTCCACTGA
H15968 TAGGAGTAGTAGGATGGTGAAGTA
H15219 TGTGTTTCAGGTTTCTTTGTAGA
H16054 TTTACAAGACCAATGTTTT
H16029 AAACTACTAGAGTTTAGTTT



the forehead and below the eye (Carraway and Car-
raway 1979; RSG, pers. observ.).
Samples from avicultural and pet birds (category
3) were verified by POW and JRE, either by direct
examination (A. leucocephala caymanensis, Pionus
menstruus, Deroptyus accipitrinus, Poicephalis
gulielmi) or photographs (A. farinosa, A. ochro-
cephala spp., A. [ochrocephala] auropalliata) of the
parrot plumages. Samples obtained from the Uni-
versity of Georgia were taken from clinic birds at
the School of Veterinary Medicine and Branson
Ritchie (a leading parrot veterinarian in the U.S.)
verified species identification.

Sample Preparation, Amplification of Cytochrome
b, and Determination ofNucleotide Sequences
Feather processing for each species and subspe-


Kocher et al. 1989, Helm-Bychowski and Cracraft 1993
Irwin et al. 1991, Helm-Bychowski and Cracraft 1993
Helm-Bychowski and Cracraft 1993
Helm-Bychowski and Cracraft 1993
This study
This study
This study
This study
This study
This study
This study
This study
This study

Helm-Bychowski and Cracraft 1993
Kocher et al. 1989, Helm-Bychowski and Cracraft 1993
Helm-Bychowski and Cracraft 1993
Edwards et al. 1991
Edwards and Wilson 1990, Edwards et al. 1991
This study
This study
This study
This study
This study
This study
This study
This study
This study



cies was done on separate days. Epithelial tissue
was aseptically removed from the distal end of
feathers (Leeton et al. 1993). Genomic DNA was
extracted from skin, blood, and liver cells following
the protocol of Arctander (1988). Cytochrome b
(cyt b) coding regions were amplified (Medlin et al.
1988) from extracted genomic DNA (50 ng) using
the oligonucleotide primers listed in Table 3. A
negative control was included for each set of reac-
tions. DNA sequence data were obtained by stan-
dard methods (Sanger et al. 1977) with the Taq-Dye
Deoxy PrismTM Terminator Cycle Sequencing kit
(FS-Mix) and an ABI 373 automated DNA Se-
quencer (Applied Biosystems, Perkin Elmer, Nor-
walk, CT) using lOng of amplified DNA and 0.01
WM cyt b primers (Table 3).
Chromatograms were initially aligned by eye in


Special Issue Honoring Nedra Klein


Journal of Caribbean Ornithology


Page 33









OTTENS-WAINRIGHT ET AL. -INDEPENDENT GEOGRAPHIC ORIGINS OF AMAZONA IN THE WEST INDIES


Table 4. Character status summary of the data sets for assessing phylogenetic relationships among Amazona spp.
OTU = operational taxonomic units.


Characters


Data set

Long
Short
Amino Acid


Number of
OTUs

47
72
47


Variable
Excluded Included Constant uninformative


Variable
informative

260
143
199


the sequence editor, SeqEdTTM (1.03s, Applied Bio-
systems). Ambiguities of homologous nucleotides
were resolved by comparing overlapping sequences
from heavy and light chains, and from different se-
quencing primer fragments. Final alignment of cyt b
sequences was done with the multiple-alignment
program Clustal W (Thompson et al. 1994) and
verified with the inferred amino acid sequence.
Feather quills, although a poor source for DNA,
are less problematic in amplification of
"numts" (transposition of mitochondrial DNA se-
quences into nuclear DNA sequences; Sorensen and
Quinn 1998). We followed precautions to eliminate
or identify mitochondrial DNA inclusions within
nuclear DNA (Sorensen and Quinn 1998): multiple
individuals for most species and subspecies were
used (Table 2); chromatograms were checked for
double peaks at nucleotide residues; sequences were
examined for insertions or deletions; translated se-
quences were checked for stop codons; and overlap-
ping sequences were examined for ambiguities. No
evidence of nuclear copies was detected.

Data Sets
Sequence data were obtained from replicate indi-
viduals for most species and subspecies to check for
intraspecific variation and to verify the authenticity
of sample identification. Two nucleotide data sets
were derived from the cyt b sequence data: the long
data set (1101 base pairs; bp) and the short data set
(596 bp). The long data set corresponds to the
chicken mitochondrial DNA at base pair numbers
14968 to 16068; the short data set corresponds to
numbers 14968 to 15563 (Desjardins and Morais
1990). The short data set was included in this study
to add extra individuals and several species for
which poorly preserved feather samples resulted in
the amplification of short nucleotide fragments. Be-
cause the shorter DNA sequences increased our
taxonomic representation (see Graybeal 1998, Hillis


1998), we chose to include them in our analyses.
An inferred amino acid data set (366 amino acid
residues), including the same species from the long
data set, was also generated. The long and amino
acid data sets include 47 operational taxonomic
units (OTUs) consisting of 17 species of Amazona,
four subspecies of A. leucocephala, two subspecies
of A. ochrocephala, and three outgroup species (see
below). Sequences were obtained from at least two
individuals for 11 of the 17 species of Amazona.
The short data set includes 72 OTUs with 20 species
of Amazona. The three new species added to this
data set are A. auropalliata, A. viridigenalis, and A.
amazonica. Two of the six species represented by
one individual from the long and amino acid data
sets are replicated in the short data set. In all of the
data sets, A. dufresniana, A. versicolor, A. finschi,
and A. farinosa are represented by single samples.
Amazona auropalliata and A. amazonica are repre-
sented by single samples in the short data set.

Analysis
To understand and examine reconstructed topolo-
gies under a variety of assumptions, we employed
neighbor-joining, parsimony, and maximum likeli-
hood analyses (as reviewed in Swofford et al.
1996). Analyses were done using the PAUP*
(version 4.0b4a) software package (Swofford 1998).
Unless otherwise stated, phylogenetic analyses used
the default settings for a given analysis. The tradi-
tional, or non-parametric, bootstrap method
(Felsenstein 1985, Hillis and Bull 1993) was used to
evaluate support for branching patterns in the recon-
structed phylogenetic trees. Parsimony and
neighbor-joining bootstrap scores were based on
1000 iterations, and 100 were employed to assess
maximum likelihood estimates. Three data sets were
examined: a long data set, a short data set, and an
amino acid data set (Table 4).


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 34









OTTENS-WAINRIGHT ETAL. INDEPENDENT GEOGRAPHIC ORIGINS OF AMAZONA IN THE WEST INDIES


Preliminary trees were reconstructed to determine
the most appropriate outgroups. Pionus menstruus,
Ara ararauna (GenBank #U70761), Aratinga aurea
(#U70762), Deroptyus accipitrinus, and Poicepha-
lus gulielmi were considered. Three outgroups were
selected for final analyses. Pionus menstruus was
the closest outgroup to Amazona. Previous molecu-
lar studies have indicated that Pionus is more
closely related to Amazona (Birt et al. 1992) than
Amazona is to either Ara or Aratinga (Miyaki et al.
1998). Pionus and Amazona share cytogenic simi-
larities (Valentine 1990), a loss of the uropygial
gland (Collar 1997), and similar orbital ring struc-
tures (Thompson 1899). Deroptyus accipitrinus
(South America; Williams 1998) and Poicephalus
gulielmi (Africa) were also used as more distant
outgroups relative to Pionus.
A LogDet/Paralinear model (Lake 1994, Lockhart
et al. 1994) was used in the neighbor-joining analy-
sis of the DNA sequence data. For the amino acid
data set, the neighbor-joining search used mean
character difference. Parsimony analyses assumed
equal character weighting. To determine the most
appropriate model of nucleotide evolution for the
maximum likelihood analyses, we examined (with
and without a gamma correction): the Jukes-Cantor
one-parameter correction, the Kimura two-
parameter correction, the Hasegawa-Kishino-Yano
correction, the Tamura-Nei, and the general time-
reversible models (assumptions are explained in
Swofford et al. 1996). These models of nucleotide
substitution were evaluated to determine the best fit
to the data using a likelihood ratios approach, simi-
lar to that of MODELTEST (Posada and Crandall
1998; although their specific script and program
were not employed). The general time-reversible
model (i.e., with rate matrix and gamma estimated)
was used in comparison of all the neighbor-joining
trees produced with different models. The likeli-
hood scores under this most general model of these
neighbor-joining topologies were evaluated using a
Kishino-Hasegawa two-tailed t-test (Kishino and
Hasegawa 1989). Three models (Kimura two-
parameter, Hasegawa-Kishino-Yano, Tamura-Nei)
without a gamma correction had significantly worse
scores than all other models tested. No significant
differences were found between likelihood scores
for the other seven models. The Hasegawa-Kishino-
Yano model with empirically derived settings for
nucleotide frequency, and estimations of the Ti/Tv
ratio (i.e., kappa) and the gamma shape parameter
was chosen for likelihood analyses because this
model allows considerable savings on computation
time without employing an overly simplistic model


(e.g., Jukes-Cantor). Databases and results can be
obtained from TREEBASE (http://www.treebase.
org/treebase).
To trace the evolution of a feather character, the
speculum, we mapped its presence or absence on
our molecular phylogeny with the computer pro-
gram MacClade (Version 3.04; Maddison and Mad-
dison 1992). The speculum is a patch of contrasting
color found at the base of three to five outer secon-
dary wing feathers (i.e., secondary wing patch;
Smith 1975, Forshaw 1989, Collar 1997). Feather
patterns of the Greater Antillean Amazona and their
close Central American relatives were examined in
a previous study using 369 museum skins (Snyder
et al. 1987). We traced several of these plumage
characters onto the branches of our inferred molecu-
lar phylogeny.

RESULTS AND DISCUSSION
This molecular genealogy provides a hypothesis
of the evolutionary relationships of West Indian
Amazona. We address two issues: 1) the phy-
logeographic structure of the genus Amazona in the
West Indies relative to the mainland, and 2) estima-
tion of colonizations of the West Indies by Ama-
zona.
We obtained cyt b sequences from 20 extant spe-
cies of Amazona. These included nine species and
four of the five A. leucocephala subspecies (A. 1.
hesterna was not sampled) from the West Indies
and 11 species from Central and South America
(Figs. 1 and 2). Neighbor-joining, parsimony, and
maximum likelihood analyses were used to compare
these DNA sequences. For illustrative purposes, we
chose the parsimony trees from the long and short
data sets (Figs. 3 and 4) to best represent the evolu-
tionary history of West Indian Amazona. Branching
patterns of tree topologies among all analyses were
consistent with these parsimony trees except where
discussed below.

Biogeography of Amazona
The emergence of the genus Amazona occurred
after the separation of the short-tailed from the
long-tailed New World parrots, which has been
placed in the Eocene (Miyaki et al. 1998). Because
of continued controversy over the reliability of a
molecular clock, we interpret divergences of Ama-
zona in geologic time as approximate estimates. Our
estimates of Amazona divergence from the short-
tailed Pionus are based on previous calibrations of
avian mitochondrial DNA evolution (2% per mil-
lion years; Shields and Wilson 1987, Tarr and


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 35











OTTENS-WAINRIGHT ETAL. -INDEPENDENT GEOGRAPHIC ORIGINS OFAMAZONA IN THE WEST INDIES


A. autumna//s

A. dufresniana
A. finschi


Group 2


A. barbadensis

A. arausiaca *

A. versico/or
A. ochroceplha/a spp.
A. ochroceplha/a oratix
A. ochrocepha/a tresmariae
A. ochrocepha/a spp.


A. aestiva


Group 1


A. far/nosa

A. imperia/is *

A. gui/ding'ii *


A. ventralis *


A. vittata *


A. /eucocepha/a pa/marum *



A. /eucocephala leucocep/haa /*

A. /eucocepOha/a bahamens/s Abaco *

A. /eIcocepha/a bahamens/s Inagua *


A. /Ieucocepha/a caymanens/s


A. co//aria *

A. ag//ls *
A. alb/frons
P/onus menstruus
lPoicepha/us gu/e/nmi
Deroptyus accipitrinus


Speculum absent

Speculum present


Fig 3. Parsimony analysis (PAUP*, version 4.0b4a; Swofford 1998) of the long data set as represented by the consensus
tree of 48 best trees. The bold lines indicate the presence of a feather character, the speculum, as traced with MacClade
(version 3.04; Maddison and Maddison 1992). Bootstrap evaluations were done with 1000 iterations and their values are
shown above the branches. Specific indices from these trees include a tree length of 832, a consistency index (CI) of
0.5493, a homoplasy index (HI) of 0.4507, CI excluding uninformative characters of 0.4628, HI excluding uninformative
characters of 0.5372, and a retention index of 0.8212. (* =Amazona of the West Indies).


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 36










OTTENS-WAINRIGHT ETAL. -INDEPENDENT GEOGRAPHIC ORIGINS OF AMAZONA IN THE WEST INDIES


62 1 A. araus/aca *
<50o A. vers/coor *
989
50- Group 1
A. auropa///ata
90 A. ochrocephala spp.
100 s I3 A. ochrocepha/a oreatx F#1&2
A. ochrocepha/a tresmar/ae
A. ochrocepha/a spp.
I A. barbadensis
<50 too A. viridigena//s
69 A. finschi
90 63 A. autumna//s
97 A. dufresniane Group 2
o96s I A. autumna//s
<50
A. amazon/ca
<50 A. imperia//s
<50 A. far/nosa
IG I A. gui/ding/i *


82 100 A. albifrons

A. v/entra//s *


A. vittata *



A. leucoepha/a pa/marum *

< 57 A. leucocephala leucocephala *

-A. leucocephala pa/marum *

A. feucocepIhala leucocophala *
67 67------_c

.s ---- A. leucocephala caymanens/s *
97


I A. leucocephala babamensis ABACO *

A. leucoceohala bahamensis INAGUA *
E98 A. co/ar/a *

1oo1 I A. agi/is *
<50|o- P/onus menstruas
s!- Poicepha/us guile/mi
Deroptyus accip/trinus



Fig. 4. Single most parsimonious tree obtained in a heuristic search (PAUP*, version 4.0b4a; Swofford 1998) using the
short data set. Bootstrap evaluations were done with 1000 iterations and their values are shown above the branches. Specific
indices from this tree include a tree length of 419, a consistency index (CI) of 0.5251, a homoplasy index (HI) of 0.4749, CI
excluding uninformative characters of 0.4707, HI excluding uninformative characters of 0.5293, and a retention index of
0.8820. Sequence data for two feather samples were obtained for A. ochrocephala oratix (i.e., F#1 is feather 1 and F#2 is
feather 2). (* = Amazona of the West Indies).


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 37









OTTENS-WAINRIGHT ET AL. -INDEPENDENT GEOGRAPHIC ORIGINS OF AMAZONA IN THE WEST INDIES


Fleischer 1993; see reviews in Mindell and Thacker
1996, Klicka and Zink 1997, Avise and Walker
1998). Our uncorrected nucleotide divergence val-
ues (p-distances) of approximately 0.10 put their
divergence to be around 5 mybp, perhaps placing
the origins of Amazona on the mainland during
times of intermittent changes in climate and sea
level in the Pliocene (4-2.5 mybp; dates reviewed in
Haq et al. 1987, Donnelly 1988, Webb and Bartlein
1992, Bermingham and Lessios 1993, Emslie and
Morgan 1994).

Biogeography of Amazona in the West Indies
The deepest nodes in our molecular phylogeny
show a distinct bifurcation within the genus Ama-
zona (Figs. 3 and 4). The West Indian Amazona fall
into two assemblages of species: the Greater Antil-
lean and main assemblages of Amazona. The
Greater Antillean assemblage includes the five spe-
cies found in the Greater Antilles, Bahamas, and
Cayman Islands: A. collaria and A. agilis (Jamaica);
A. leucocephala (Cuba, the Bahamas, and the Cay-
man Islands); A. vittata (Puerto Rico); and A. ven-
tralis (Hispaniola). At the base of this Greater Antil-
lean assemblage is the close relative, A. albifrons
from Central America. The main assemblage of
Amazona includes the four species of the Lesser
Antilles (i.e., two species of Dominica, A. arausiaca
and A. imperialis; A. versicolor of St. Lucia; and A.
guildingii of St. Vincent) and the remainder of the
South and Central American species included in our
study (see Fig. 2).
High bootstrap values (82-92%) consistently sup-
ported both the Greater Antillean and main assem-
blages of Amazona in the parsimony trees using the
long and amino acid data sets. These clades were
also supported by high bootstrap values of 86-97%
in the neighbor-joining LogDet paralinear analyses
for these data sets. As is typical for maximum likeli-
hood analysis (as reviewed in Hasegawa and Ki-
shino 1994), lower bootstrap values were found in
the long data set than in the same data set for the
neighbor-joining or parsimony analyses: <50% for
the main assemblage of Amazona and 74% for the
Greater Antillean assemblage. In the short data set
(neighbor-joining, parsimony, maximum likelihood
analyses), nodes at the base of the main and Greater
Antillean assemblages of Amazona show less than
50% bootstrap support. The DNA fragment size is
perhaps too short to resolve deep nodes for such a
large number of taxa.
Plumage and body sizes of West Indian species
within the Greater Antillean and main assemblages


of Amazona are distinctly different. Those species
belonging to the Greater Antillean assemblage are
generally smaller than those of the main assemblage
of Amazona. The plumages of the Greater Antillean
assemblage are mostly green with color variation in
the head, wings, tail, and lower ventral regions of
the body (Snyder et al. 1987, Wiley 1991). Most
species from South and Central America within the
main assemblage of Amazona share an overall
plumage that is primarily green, but patches of other
vivid colors are present on different parts of the
body (Forshaw 1989, Collar 1997). The four large-
bodied species found in the Lesser Antilles possess
dramatic and colorful plumages (Forshaw 1989,
Collar 1997). The larger size of these species may
reflect behavioral and physiological characters that
have been hypothesized to enhance survival on is-
lands (Gotelli and Graves 1990).
The mainland species included in the main assem-
blage of Amazona and those species in the Lesser
Antilles possess a speculum (Fig. 3; Smith 1975,
Forshaw 1989, Collar 1997). Mainland species have
specula with predominately red to yellow-orange
colors. The speculum of the Lesser Antilles species
A. versicolor is red, and A. arausiaca has a red to
yellow speculum. Amazona imperialis has a deep
maroon speculum, whereas A. guildingii has a
smaller speculum that is orange and yellow. The
species of Amazona in the Greater Antilles assem-
blage do not have a speculum. Thus the distribution
of this plumage character in Amazona corroborates
the basal bifurcation in our molecular hypothesis.

Colonization of the West Indies by Amazona
Our analysis suggests that Amazona colonized the
Greater and Lesser Antilles during the Pliocene.
This estimate is based upon nucleotide divergences
within the main and Greater Antillean assemblages
of Amazona. Divergences (p-distance) of 0.06 to
0.08 (3-4 mybp) were observed between the basal
species of the main assemblage of Amazona (A. im-
perialis, A. guildingii, and A. farinosa) and the more
derived species (A. autumnalis, A. dufresniana, A.
barbadensis, A. versicolor, A. auropalliata, A.
ochrocephala, and A. aestiva). Similar values for
divergences within the Greater Antillean assem-
blage (A. albifrons compared to A. ventralis, A. vit-
tata, and A. leucocephala) are estimated at approxi-
mately 0.06. Therefore, our data indicate that colo-
nization of the West Indies probably occurred by
overwater dispersals (as proposed by Bond 1963,
1979; Darlington 1957) and not by any Late Creta-
ceous to early Tertiary vicariant event in the Carib-


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 38









OTTENS-WAINRIGHT ETAL. -INDEPENDENT GEOGRAPHIC ORIGINS OF AMAZONA IN THE WEST INDIES


bean basin (Rosen 1976), or over proposed land cor-
ridors between either northwestern South America
and Greater Antilles (Iturralde-Vinent and MacPhee
1999) or the emergent Nicaraguan Rise and western
Jamaica (Donnelly 1988, and as reviewed in Portell
et al. 2001). Both of these corridors were sub-
merged by the Pliocene. As a result of early Tertiary
ocean volume changes, Jamaica was also intermit-
tently below sea level until the early Miocene
(Buskirk 1985). Colonization of West Indian Ama-
zona would have occurred after these events.

Colonization of the Greater Antilles by Amazona
Amazona albifrons from Central America at the
base of the Greater Antillean assemblage (Figs. 3
and 4) is supported by all analyses with the excep-
tion of the neighbor-joining LogDet paralinear
model for the short data set. In this case A. agilis,
one of two species found on Jamaica, is more basal
than A. albifrons. Bootstrap support is less than
50% for this branching pattern. Amazona collaria,
also found on Jamaica, appears as an independent
basal branch, well differentiated from A. agilis (p-
distance = 0.056). The placement of A. collaria is
strongly supported by high bootstrap values (greater
than 97%) in parsimony and distance analyses of all
data sets; maximum likelihood analyses show lower
bootstrap values (70% and above) for this node.
These analyses indicate that there may have been
two dispersal events by ancestral Amazona to Ja-
maica.
Recent studies also suggested substantial differ-
ences between these two sympatric species A. agilis
and A. collaria in their behavior and ecological
needs (Koenig 2001). Lack (1976) also wrote that
island-niches are usually occupied by different
founder species. He hypothesized that beak size dif-
ferences between A. agilis and A. collaria resulted
from segregation of feeding strategies of popula-
tions of A. albifrons, and that they originated from
two separate invasions into the Greater Antilles
through Jamaica (Amazona agilis) and Cuba (A. leu-
cocephala), the latter giving rise to A. collaria.
Similar movements into Jamaica and Cuba were
also proposed by Snyder et al. (1987; see full de-
scription below), Wiley (1991), and Lanterman
(1997).
Our molecular data generally agree with these
authors: Amazona albifrons from Central America
is basal to the Jamaican species A. agilis and A. col-
laria, and A. leucocephala and A. collaria are de-
rived from a common, most-recent ancestor. Differ-
ences in our data suggest, however, that movement


of this ancestral species was directly to Jamaica, and
not via Cuba.
Bond (1963) and Lantermann (1997) considered
A. collaria, A. leucocephala, and A. ventralis
(Hispaniola) as superspecies, and suggested that a
close relationship exists between A. agilis and A.
vittata (Puerto Rico). Snyder et al. (1987) agreed
with their assessments, and placed these species
into three groups (Fig. 5) as based on comparison of
plumage characteristics. The first group consists of
the two Central American sibling species, A. albi-
frons and A. xantholora (not included in this study),
which are similar with a white forehead, red pri-
mary coverts, and mostly green throat and belly.
Amazona xantholora has a dark ear patch, yellow
lores, and darker scalloping on contour feathers, all
of which are lacking in A. albifrons. The second
group includes Bond's superspecies (see above), all
of which share a white forehead, blue primary cov-
erts, a dark ear patch, differing amounts of pink or
maroon on the throat, and traces of a maroon belly-
patch. The third group, A. agilis and A. vittata,
share the characteristics of a red-forehead patch
(most significant characteristic), green throat with
varying amounts of maroon feathers, and a green
belly. Given these three groups, the following hy-
pothesis of colonization of the West Indies was pro-
posed by Snyder and coworkers (Snyder et al.
1987): members of the second group (A. leuco-
cephala, A. collaria, A. ventralis) are descendants
of the two Central American species, and their ini-
tial colonization occurred independently of A. agilis
of Jamaica; Amazona vittata was derived directly
fromA. agilis.
This proposed relationship of A. agilis and A. vit-
tata implies a direct colonization from Jamaica to
Puerto Rico (Snyder et al. 1987, Lantermann 1997).
Alternately, a stepping-stone model would suggest
that taxa with a red forehead-patch went extinct on
intermediate islands (Cuba and Hispaniola). The
red-forehead patch shared between A. vittata and A.
agilis may, however, be the result of convergent
evolution (Snyder et al. 1987).
There are differences between these species; most
individuals of A. agilis, but not A. vittata, have a
reduced dark ear-patch, darker color of the eye-ring
and bill, and variable presence of red primary cov-
erts. Even though the primary coverts on A. agilis
are mostly red, some specimens have varying
amounts of blue and the females have mostly green
primary coverts. Blue primary coverts are charac-
teristic of A. collaria, A. leucocephala, A. ventralis,
and A. vittata, and may be a derived plumage char-


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Page 39











OTTENS-WAINRIGHT ETAL. -INDEPENDENT GEOGRAPHIC ORIGINS OF MAZONA IN THE WEST INDIES


Lesser Antilles Assemblage


ventra/is


A. viffatf



A. /euco.


SGroup 2


Group 3


cepha/a pa/marum


SA. /eucocepha/a /eucocepha/a


IA. /eucocepha/a caymanens/s


A. /eucocepha/al
ABACO
A. /eucoceph/a/a
INAGUA

SA. coll//aria


I '7" A. ag//is
A. albifrons

DEP
- --------------------- A. xantho/ora
YL (not included in this study)
SC


bahamens/s

b a hamens/s


Group 2


I Group 3

Group 1


Red primary coverts
Blue primary coverts
White forehead
Red forehead
Dark ear patch
Maroon belly
Green belly
Green throat
Pink throat
Yellow lores
Scallops on contours


Fig. 5. Phylogenetic distribution of feather characters in West Indian and Central American Amazona. Greater Antillean
Amazona and the Central American, A. albifrons and A. xantholora are placed into three groups (Snyder et al. 1987) as de-
termined by similar feather characters. The feather characters are placed on branches of the Neighbor-joining LogDet para-
linear tree (long data set). Branch lengths are not proportional to distances.


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 40









OTTENS-WAINRIGHT ETAL. INDEPENDENT GEOGRAPHIC ORIGINS OF AMAZONA IN THE WEST INDIES


acteristic in the Greater Antillean Amazona. If this
hypothesis is correct, then the presence of red pri-
mary coverts on A. agilis might suggest that this
species evolved early in the history of Amazona and
that there is not a close relationship with A. vittata.
Red primary coverts are also found in several
mainland species: Amazona pretrei and A. tu-
cumana from South America, and the two sibling
species A. albifrons and A. xantholora from Central
America (see a complete description in Snyder et
al. 1987).
A close relationship of A. vittata to A. ventralis,
and not A. agilis, is more attractive geographically.
This relationship implies rapid evolution of plum-
age characters from A. ventralis to A. vittata, in-
cluding transformation of the white forehead-patch
into a red one; a loss of distinct dark ear-patches
and blue feathers on the lores, throat and cheeks;
and partial losses of the maroon belly-patch and
blue crown color. Several plumage similarities link
A. vittata to A. ventralis; e.g., some specimens of A.
vittata have scattered maroon belly-feathers and
they both share yellow bills, white eye-rings, and
blue primary coverts (see a complete description in
Snyder et al. 1987). Indeed, our data do not support
A. agilis and A. vittata as sister lineages. They sup-
port Lack's (1976) view that A. ventralis and A. vit-
tata are sister lineages that share a common ances-
try with A. leucocephala. A common most-recent
ancestor gave rise to two lineages that resulted inA.
collaria and the clade formed by A. leucocephala,
A. ventralis, and A. vittata. Amazona agilis is basal
to these Greater Antillean species.
Our molecular data show the four subspecies of
A. leucocephala as distinct lineages that reflect their
current geographic distributions. Amazona 1. ba-
hamensis and A. 1. caymanensis probably diverged
nearly simultaneously in geologic time. The branch-
ing order of these two subspecies varies among
analyses: e.g., the 48 best trees found in parsimony
analysis of the long data set (Fig. 3) showed 50% of
trees with A. 1. bahamensis as the most basal sub-
species and 50% with A. 1. caymanensis as most
basal. Cuba's A. 1. leucocephala and A. 1. palmarum
are weakly differentiated in the short data set (Fig.
4) and only segregate in the analysis of the long
data set (Fig. 3), which has more resolving power;
they appear to be the last populations to become
genetically independent.
Fluctuating sea levels throughout the last three
million years, from the late Pliocene throughout the
Pleistocene, affected mammalian distribution pat-


terns in Cuba, the Cayman Islands, and the Baha-
mas (Morgan 1989). Although estimates of diver-
gences in geologic times become even less reliable
at the subspecies and population levels, we roughly
estimate diversification (p-distance of 0.0058 to
0.0094) of A. leucocephala to be sometime in the
middle to late Pleistocene. A long interglacial pe-
riod occurred in the middle Pleistocene
(approximately 420,000 ybp), raising sea levels by
20 m; it dramatically affected low-island complexes
(Hearty et al. 1999). The last interglacial event
(about 120,000 ybp) increased sea levels 5-9 m
higher than present (Slikas et al. 2002). The Baha-
mas (Olson 1977) and most of the small islands be-
tween Cuba and Isla de Pinos (Buden and Olson
1989) were likely to have been submerged. Later,
though, low sea levels (nearly 120 m lower than
present) during the last Wisconian glaciation
(approximately 17,000 ybp) probably exposed most
of the once submerged lands (as reviewed in Mor-
gan 2001). Exposed land provided new habitat and
less formidable overwater barriers for vertebrates to
cross between Cuba and the Cayman Islands, and
between Cuba and the Bahamas (Steadman and
Morgan 1985). Land connections between Cuba
and Isla de Pinos persisted as recently as 8000 ybp
(Buden and Olson 1989). Initial movements and
subsequent isolation of populations of A. leuco-
cephala most likely occurred sometime during these
eustatic sea level changes.
Amazona 1. bahamensis was at one time widely
distributed in the Bahamas, as evidenced by his-
toric, fossil, and archeologic findings on Acklins,
Crooked, Fortune, Grand Turk, San Salvador, Long,
and New Providence islands (Wetmore 1938, Brod-
korb 1959, Olson and Hilgartner 1982; as reviewed
in Snyder et al. 1982, Gnam and Burchsted 1991,
Wiley 1991, Williams and Steadman 2001). Reduc-
tion in the range of this subspecies, as suggested for
other vertebrate species, was probably the result of
human disturbances (Olson and Hilgartner 1982,
Morgan 1994) and fragmentation of islands caused
recently by rising sea levels (Pregill and Olson
1981, Olson and Pregill 1982, Morgan 1994). The
remaining two populations of A. 1. bahamensis in
Abaco and Great Inagua appear genetically sepa-
rated in all our analyses except in the parsimony
analysis of the short data set (Fig. 4). The cyt b dif-
ferences (p-distance = 0.009) support behavioral,
ecological, and morphological distinctions of these
populations as noted by others (Snyder et al. 1982;
Gnam 1990, 1991; Gnam and Rockwell 1991;
Gnam et al. 1995).


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Page 41









OTTENS-WAINRIGHT ET AL. INDEPENDENT GEOGRAPHIC ORIGINS OF AMAZONA IN THE WEST INDIES


Colonization of the Lesser Antilles by Amazona
Our data support Bond's (1963) view that the
four large Amazona currently in the Lesser Antilles
reached the islands from South America. There ap-
pears to have been a minimum of two, and possibly
three, dispersals of Amazona into the Lesser Antil-
les, in agreement with a recent study by Klein and
Brown (1994), which found that multiple coloniza-
tions of some avian species occurred in these is-
lands.
The three species at the base of the main assem-
blage of Amazona (A. farinosa, A. imperialis, and
A. guildingii) are separated by nodes that are unsta-
ble in all analyses and not well supported by boot-
strap values. These three species are among the
largest of the genus. Amazona farinosa is widely
distributed in South and Central America and has a
rather dull, uniform green plumage as compared to
the multi-colored plumages of A. imperialis
(Dominica) and A. guildingii (St. Vincent). Ama-
zona imperialis has a striking purple-hued plumage
and is the largest species of the genus. Amazona
guildingii has two color morphs with a kaleido-
scope of colors ranging from brown and bronze to
orange, yellow, and green (Snyder et al. 1987).
Colonization of St. Vincent by an ancestor of A.
guildingii may have been a single dispersal event
from South America independent from that of the
ancestry of A. imperialis. Alternatively, there may
have been a single dispersal of a common ancestral
species of A. guildingii and A. imperialis from
South America with a subsequent linear radiation
through the Lesser Antilles.
Several mainland species and the two remaining
species from the Lesser Antilles are placed into two
groups that are separate from A. farinosa, A. imperi-
alis and A. guildingii. Groups 1 and 2 (Figs. 3 and
4) are supported by high bootstrap values in all
analyses (71-100%). Group 1 includes A. aestiva,
A. auropalliata (the short data set only), the A.
ochrocephala complex, A. barbadensis, and the two
Lesser Antillean species, A. arausiaca (Dominica)
and A. versicolor (St. Lucia). The majority of
analyses show A. arausiaca and A. versicolor as
sister lineages with >80% bootstrap support, and are
most closely related to either A. barbadensis (e.g.,
see Fig. 3) found on the northern coast of South
America and adjacent islands orA. aestiva (e.g., see
Fig. 4) from central South America. Alternately, A.
versicolor is paired with A. barbadensis in the
neighbor-joining Log/Det paralinear distance analy-
sis of the short and long data sets. The bootstrap
support for this arrangement is less than 50%. Even


though we do not have >50% bootstrap values, the
four remaining neighbor-joining distance trees
show A. arausiaca and A. versicolor as paired line-
ages. In sum, our data suggest a close sister group
relationship, as did Lack (1976), of A. arausiaca
and A. versicolor (p-distance = 0.02). Similar plum-
age colorations (e.g., blue forehead and facial
patches, red neck-patch, and green body plumage)
also suggest a close relationship (Snyder et al.
1987). Colonization of Dominica and St. Lucia by
ancestors of A. arausiaca and A. versicolor appears
as one dispersal event from South America to the
Lesser Antilles.
Group 2 includes the mainland species A. autum-
nalis, A. dufresniana, A. finschi, A. viridigenalis
(short data set only) and A. amazonica (short data
set only) and is supported with 90% bootstrap val-
ues in parsimony, 99% in neighbor-joining, and 69-
71% in maximum likelihood analyses of the long
and the short data sets. Based on plumage patterns,
A. dufresniana (northern South America) appears to
be closely related to the species of Amazona from
the Lesser Antilles (Snyder et al. 1987, Wege and
Collar 1991), but our analysis does not indicate that
it is ancestral to the Lesser Antillean species.
The second pair of sympatric species of Amazona
in the West Indies, A. arausiaca and A. imperialis,
is found on Dominica. Our molecular phylogeny
shows that these two species are not sister species
and evidently arose from two different dispersals to
Dominica at different times in the history of Ama-
zona. Even though these two species share highland
forest habitats, Lack (1976) hypothesized that they
occupy two different ecological niches. He believed
that broad niches are occupied first, followed by an
adaptation of an incoming species to a more spe-
cific unoccupied niche. In our analysis, A. imperi-
alis appears to have colonized Dominica before A.
arausiaca. Amazona imperialis does not appear to
occupy a broader niche, though, than A. arausiaca.
Amazona imperialis is more sedentary and is most
frequently found at higher elevations (600-1300
m). The more nomadic A. arausiaca occasionally
moves from the highland forests (300-600 m) into
open-cultivated areas where it forages on a slightly
broader selection of fruits and seeds (as reviewed in
Collar 1997).

Biogeographic Junction between the Lesser and
Greater Antilles
The late Pleistocene and Holocene fossil records
of several vertebrates (iguanas, some birds, and
some bats and rodents) provide evidence of extinct


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Page 42








OTTENS-WAINRIGHT ETAL.


species that showed no faunal disjunction between
the Greater and Lesser Antilles (Morgan and
Woods 1986, Pregill et al. 1994, Morgan 2001).
Genetic homogeneity of Bananaquit (Coereba
flaveola) populations from the U. S. Virgin Islands
to St. Lucia suggests a continuous gene flow
through the Antillean islands chain; i.e., the historic
lack of a biogeographic break for that species
(Seutin et al. 1994). Bond (1963) and Ricklefs and
Cox (1972), however, agreed that for many avian
groups, a break occurs at the Anegada Passage (Fig.
1). Our molecular data show a distinct genealogical
division between extant Amazona of the Greater
and Lesser Antilles. However, evidence of a small
Amazona, similar to A. vittata (Puerto Rico) and the
extinct A. v. gracilipes (Isla Culebra, east of Puerto
Rico) (Wetmore 1917), was found at archeologic
sites on Antigua, at the northern end of the Lesser
Antilles (Steadman et al. 1984; Pregill et al. 1988,
1994). An undated (pre-cultural) rostrum similar to
A. vittata was also found on Barbuda, and a small
species of Amazona was discovered on Monsterrat
(Williams and Steadman 2001). This archeologic
evidence suggests that some limited eastward dis-
persal of A. vittata-like parrots occurred into the
Lesser Antilles across the Anegada Passage. An
alternate explanation is that Amazona from Puerto
Rico may have been transported to these northern-
most Lesser Antilles by human cultures.

Summary
As Bond (1963, 1979) concluded for other avian
species, and Morgan (Morgan and Woods 1986,
Morgan 2001) for several mammalian species, our
molecular phylogeny suggests that movements of
ancestral Amazona were from the south to north
into the Lesser Antilles and from west to east into
the Greater Antilles. Dispersal of Amazona from
South America throughout the Lesser Antilles in-
volved a minimum of two independent events, per-
haps three. Amazona imperialis colonized the
Lesser Antilles early in the history of Amazona and
independently of its sympatric species, A. arau-
siaca. Amazona arausiaca and A. versicolor appear
as sister species and are the result of a later coloni-
zation of the Lesser Antilles. Colonization of St.
Vincent by ancestral A. guildingii was also early in
the history of Amazona and may have been an inde-
pendent dispersal from the mainland. Our molecular
phylogeny, however, does not clearly differentiate
the branching pattern among A. imperialis, A. guild-
ingii, and A. farinosa at the base of the main assem-
blage of Amazona. The first island colonized by
Amazona in the Greater Antilles appears to be Ja-
maica. Amazona agilis and A. collaria are clearly


-INDEPENDENT GEOGRAPHIC ORIGINS OF AMAZONA IN THE WEST INDIES

differentiated from each other and their colonization
of Jamaica may be the result of two separate disper-
sal events.
ACKNOWLEDGMENTS
We dedicate this work to the memory of Doris
Corwin Ottens and in appreciation of Robert W.
Ottens, both of whom contributed financial support
and showed keen interest in the islands and their
birds. We thank Frederick J. Grassle and the Insti-
tute of Marine and Coastal Sciences (IMCS; Rut-
gers University) for laboratory space, supplies, and
support. This paper is IMCS contribution #2003-20.
Many individuals provided samples and are listed
in Table 2. We sincerely thank each of them for
their valuable participation in this project. We also
sincerely thank those individuals who gave addi-
tional assistance in obtaining samples: Claudia
Macias Caballero (Instituto Tecnol6gico y de Estu-
dios Superiores de Monterrey; Col. Tecnol6gico
[ITESM], Mexico), Keith Hill (Cayman Islands),
Ernesto Garcia and Joseph Wunderle (International
Institute of Tropical Forestry, Palmer, PR), David
Kerk (Pt. Loma Nazarene College, San Diego, CA),
and Dian and Robert Rattner (Wildlife Preservation
Trust International). We are sincerely grateful for
the assistance of the many valuable assistants who
aided us in the field at Los Indios, Isla de Pinos,
Cuba: Fidel Quiala G6ngora, Abel Dominguez
P6rez, Ing. Efren Iznago Palacio, Ian Lothian, Yur-
dania Vielza Rivera, Jesfis Dario Suarez, Luis G.
Hernmndez Garcia, Jorge Hernmndez Blanco, Den-
nys Lezcano Noqueira, Jos6 Rivera R., Adolfo Pi-
fiero, Antonio Normando Garcia Rius, Roberto
Rodriguez Sober6n, Ing. Jos6 Borlot Boloy, Dama-
ris Valde Adela, Morizel Martinez, Miguel Hecha-
nassia P6rez, and Afriano Amodon Pifiero. We
thank Miguel Magraner Fernmndez for providing us
with transportation while in Habana, Cuba.
We thank D. Campbell, Maurice Isaacs, and Eric
Carey (Department of Agriculture, Conservation
Unit) and the Bahamas National Trust for process-
ing our application for permission to conduct re-
search on the Bahama Parrot in the Bahamas. We
thank the Department of the Environment, National
Trust for the Cayman Islands, and Penny and Mi-
guel Clifford of the Cayman Islands for their gener-
ous accommodations, assistance, and use of their
vehicle for collection of samples on Grand Cayman.
We appreciate all the efforts of US Fish and Wild-
life Service (USFWS) personnel at the International
Branch of Permits (Washington DC) for providing
CITES import permits for samples: Sue Lieberman,
Anna Barry, Karen Anderson, Caroline Anderson,
Maggie Tieger, Lynn Noonan, Mike Carpenter,


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Page 43









OTTENS-WAINRIGHT ET AL. -INDEPENDENT GEOGRAPHIC ORIGINS OF AMAZONA IN THE WEST INDIES


Mary Ellen Antower, Christina Moody, Phil Ale-
granti, and Arthur Coppola. We respectfully express
our sincere gratitude to each country and their per-
sonnel for granting us permission to export feather
samples and for processing CITES permits or cer-
tificates of export: Claudia Macias Caballero
(ITESM), Leonel Lozano, Carlos Tereso Sanchez
Reyes Retano, and Jose Luis Reyna Cortez
(Secretaria de Medio Ambiente y Recursos Natu-
rales, Instituto Nacional de Ecologia) (Mexico);
Arlington James and Adolphus Christian, Forestry
and Wildlife Division, Ministry of Agriculture
(Dominica); Donald Anthony, Ministry of Agricul-
ture and CITES Management Authority (St. Lucia);
Maurice Isaacs and Eric Carey, Ministry of Agricul-
ture (Bahamas); Yvette Strong, Natural Resources
Conservation Authority, and Catherine Levy, Gosse
Bird Club (Jamaica); Keamey Gomez, Office of the
Permanent Secretary, Ministry of Agriculture, Envi-
ronment, Communications and Works, Grand Cay-
man, and Fred Burton, National Trust for the Cay-
man Islands (Cayman Islands); and Empresa Na-
cional para Conservaci6n de la Flora y la Fauna and
Ministerio de la Agricultura, Ciudad de La Habana
(Repuiblica de Cuba). We also appreciate the help of
those who assisted in the recovery of samples held
in various locales: David Tollatt, US Department of
Agriculture (USDA), American Embassy, Nassau,
Bahamas; Elizabeth Klontz (USDA), Bethesda,
MD; and Obdulio Menghi, CITES Secretariat,
Genbve, Switzerland. We give special thanks to In-
spector Laurel Zitowsky (USFWS, Wildlife Inspec-
tor, Division of Law Enforcement, Elizabeth, NJ),
who patiently cleared all feather samples imported
into the United States. We thank those individuals
at Rutgers University who contributed to this pro-
ject: Karen Janes, Susan Keller, Linda Dimmick,
Aline Kelsey, Pamela Nelson, Judith Grassle, Greg
O'Mullen, Lee Kerkhof, Christopher Gregg, and
David Scala.
We sincerely thank Cristina Y. Miyaki, Gary S.
Morgan, and Storrs L. Olson for their comprehen-
sive review of this manuscript, and we thank Linda
0. Sauerteig and Sam C. Wainright for reviewing
early versions of the manuscript. We thank Robert
Sauerteig for his contribution to this project. We
give special thanks to all the parrots that contributed
their feathers.

LITERATURE CITED
ANDERSON, S., A. T. BANKIER, B. G. BARRELL, M.
H. L. DE BRUIJN, A. R. COULSON, J. DROUIN, I.
C. EPERON, D. P. NIERLICH, B. A. ROE, F.
SANGER, P. H. SCHREIER, A. J. H. SMITH, R.


STADEN, AND I. G. YOUNG. 1981. Sequence and
organization of the human mitochondrial genome.
Nature 290:457-465.
ARCTANDER, P. 1988. Comparative studies of avian
DNA by restriction fragment length polymor-
phism analysis: convenient procedures based on
blood samples from live birds. J. Ornithol.
129:205-215.
ARLDT, T. 1936. Esquisse de gdographie zo-
ologique des Antilles (1). Rev. Soc. Hist. Gdogr.
Haiti 8(25):28-40.
ARREDONDO, 0. 1984. Sinopsis de las aves halladas
en dep6sitos fosiliferos Pleisto-holoc6nicos de
Cuba. Rep. Invest. Inst. Zool., Acad. Cienc. Cuba
17:1-35.
AVISE, J. C. AND D. WALKER. 1998. Pleistocene
phylogeographic effects on avian populations and
the speciation process. Proc. R. Soc. Lond., Ser.
B. 265:457-463.
AVISE, J. C. 2000. Phylogeography: the history and
information of species. Cambridge, MA: Harvard
Univ. Press.
BECKER, J. J. 1987. Neogene avian localities of
North America. Pp. 34-35. Washington, DC:
Smithson. Inst. Press.
BERLIOZ, J. 1959a. Un exemple des particularit6s de
la faune antillaise: les colibris. C. R. Soc.
Biogdogr. 36(311):3-6.
BERLIOZ, J. 1959b. Le peuplement animal des An-
tilles: les oiseaux des Grandes Antilles. C. R.
Soc. Biogeogr. 36(319):115-121.
BERMINGHAM, E., AND H. A. LESSIOS. 1993. Rate
variation of protein and mitochondrial DNA evo-
lution as revealed by sea urchins separated by the
Isthmus of Panama. Proc. Natl. Acad. Sci. USA
90:2734-2738.
BIRT, T. P., V. L. FRIESEN, J. M. GREEN, W. A.
MONTEVECCHI, AND W. S. DAVIDSON. 1992.
Cytochrome b sequence variation among parrots.
Hereditas 117:67-72.
BOND, J. 1963. Derivation of the Antillean avi-
fauna. Proc. Acad. Nat. Sci. Phila. 115:79-98.
BOND, J. 1979. Derivations of Lesser Antillean
birds. Proc. Acad. Nat. Sci. Phila. 131:89-103.
BRISSON, M. J. 1760. Ornithologie ou m6thode con-
tenant la division des oiseaux en ordres, sections,
genres, especes & leurs vari6t6s. Paris: J.-B.
Bauche.
BRODKORB, P. 1959. Pleistocene birds from New
Providence Island, Bahamas. Bull. Fla. St. Mus.


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Page 44









OTTENS-WAINRIGHT ETAL. INDEPENDENT GEOGRAPHIC ORIGINS OF AMAZONA IN THE WEST INDIES


Biol. Sci. 4(11):349-371.
BRODKORB, P. 1971. Catalogue of fossil birds: Part
4 (Columbiformes through Piciformes). Bull. Fla.
St. Mus. Biol. Sci. 15(4):163-266.
BUDEN, D. W., AND S. L. OLSON. 1989. The avi-
fauna of the Cayerias of southern Cuba, with the
ornithological results of the Paul Bartsch Expedi-
tion of 1930. Smithson. Contrib. Zool. 477.
BUSKIRK, R. E. 1985. Zoogeographic patterns and
the tectonic history of Jamaica and the northern
Caribbean. J. Biogeog. 12:445-461.
BUTLER, P. J. 1992. Parrots, pressures, people, and
pride. Pp. 25-46 in New World parrots in crisis:
solutions from conservation biology (Beissinger,
S. R., and N. F. R. Snyder, eds.). Washington,
DC: Smithson. Inst. Press.
CARRAWAY, C., AND P. CARRWAY. 1979. The Ba-
hama Parrot: Amazona leucocephala bahamensis.
Avic. Mag. 85:18-23.
CAMPBELL, K. E., JR. 1976. The late Pleistocene
avifauna of La Carolina, southwestern Ecuador.
Pp. 155-168 in Collected papers in avian paleon-
tology honoring the 90th birthday of Alexander
Wetmore (Olson, S. L., ed.). Smithson. Contrib.
Paleobiol. 27.
CLARK, A. H. 1905a. The West Indian parrots. Auk
22:337-344.
CLARK, A. H. 1905b. The Greater Antillean ma-
caws. Auk 22:345-348.
COLLAR, N. J. 1997. Family Psittacidae. Pp. 280-
477 in Handbook of the birds of the world, Vol.
4. (del Hoya, J., A. Elliott, and J. Sargatal, eds.).
Barcelona, Spain: Lynx Ediciones.
CROZIAT, L., G. NELSON, AND D. E. ROSEN. 1974.
Centers of origin and related concepts. Syst. Zool.
23:265-287.
CUELLO, J. P. 1988. Lista de las aves f6siles de la
region neotropical y de las islas antillanas. Paula-
Coutiana 2:3-79.
DARLINGTON, P. J., JR. 1957. Zoogeography: the
geographical distribution of animals. New York:
John Wiley & Sons, Inc.
DENNY, W. 1847a. A few remarks on the geo-
graphical distribution of birds in the West Indies.
Proc. Zool. Soc. Lond. 15:36-41.
DENNY, W. 1847b. A few remarks on the geo-
graphical distribution of birds in the West Indies.
Ann. Mag. Nat. Hist. 19(29):464-469.
DESJARDINS, P., AND R. MORAIS. 1990. Sequence
and gene organization of the chicken mitochon-


drial genome. J. Mol. Biol. 212:599-634.
DIAZ FRANCO, S. 1999. Dos registros nuevos de
aves end6micas en dep6sitos fosiliferos de Cuba.
Pitirre 12:12-13.
DOMNING, D. P., R. J. EMRY, R. W. PORTELL, S. K.
DONOVAN, AND K. S. SCHINDLER. 1997. Oldest
West Indian land mammal: rhinocerotoid ungu-
late from the Eocene of Jamaica. J. Vert. Paleon-
tol. 17:638-641.
DONNELLY, T. W. 1988. Geologic constraints on
Caribbean biogeography. Pp. 15-37 in Zo-
ogeography of Caribbean insects (Liebherr, J. K.,
ed.). Ithaca, NY: Cornell Univ. Press.
Du TERTRE, LE R. P. J.-B. 1654. Histoire g6ndrale
des iles de S. Christophe, de la Guadeloupe, de la
Martinique, et autres dans l'Amdrique. Paris: J.
Langlois et E. Langlois.
Du TERTRE, LE R. P. J.-B. 1667. Histoire g6ndrale
des Antilles habitues par les Franqais. Paris: T.
lolly.
EDWARDS, S. V., AND A. C. WILSON. 1990. Phy-
logenetically informative length polymorphism
and sequence variability in mitochondrial DNA
of Australian songbirds (Pomatostomus). Genet-
ics 126:695-711.
EDWARDS, S. V., P. ARCTANDER, AND A. C. WIL-
SON. 1991. Mitochondrial resolution of a deep
branch in the genealogical tree for perching birds.
Proc. Zool. Soc. Lond., Ser. B 243:99-107.
EMSLIE, S. D., AND G. S. MORGAN. 1994. A catas-
trophic death assemblage and paleoclimatic im-
plications of Pliocene seabirds of Florida. Science
264:684-685.
ENKERLIN-HOEFLICH, E. C. 1995. Comparative
ecology and reproductive biology of three species
of Amazona parrots in northeastern Mexico. Ph.
D. diss., Texas A&M University.
FEDUCCIA, A. 1995. Explosive evolution in the Ter-
tiary birds and mammals. Science 267:637-638.
FEDUCCIA, A. 1996. The origin and evolution of
birds. New Haven, CT: Yale Univ. Press.
FELSENSTEIN, J. 1985. Confidence limits on phylog-
enies: an approach using the bootstrap. Evolution
39:783-791.
FORSHAW, J. M. 1989. Parrots of the world, 3rd ed.
Melbourne, Australia: Landsdowne Eds.
GNAM, R. S. 1990. Zur Biologie der Bahama -
Amazone Amazona leucocephala bahamensis auf
Great Inagua. Papageien 2:89-92.
GNAM, R. S. 1991. Breeding biology of the Bahama


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Page 45









OTTENS-WAINRIGHT ET AL. -INDEPENDENT GEOGRAPHIC ORIGINS OF AMAZONA IN THE WEST INDIES


Parrot (Amazona leucocephala bahamensis). Ph.
D. diss., City Univ. New York.
GNAM, R., AND A. BURCHSTED. 1991. Population
estimates for the Bahama Parrot on Abaco Island,
Bahamas. J. Field Ornithol. 62:139-146.
GNAM, R., AND R. F. ROCKWELL. 1991. Reproduc-
tive potential and output of the Bahama Parrot,
Amazona leucocephala bahamensis. Ibis
133:400-405.
GNAM, R. S., M. WILSON, AND I. LOTHIAN. 1995.
Breeding biology of the Bahama parrot on Great
Inagua. Pitirre 10(1):26.
GOTELLI, N. J., AND G. R. GRAVES. 1990. Body
size and the occurrence of avian species on land-
bridge islands. J. Biogeogr. 17:315-325.
GRAYBEAL, A. 1998. Is it better to add taxa or char-
acters to a difficult phylogenetic problem? Syst.
Biol. 1:9-17.
HAFFER, J. 1985. Avian zoogeography in the
neotropical lowlands, in Neotropical ornithology
(Buckley, P. A., M. S. Foster, E. S. Morton, R. S.
Ridgely, and F. G. Buckley, eds.). American Or-
nithologists' Union. Ornithol. Monogr. 36:113-
146.
HAQ, B. V., J. HARDENBOL, AND P. R. VAIL. 1987.
Chronology of fluctuating sea levels since the
Triassic. Science 235:1156-1167.
HASEGAWA, M., AND H. KISHINO. 1994. Accuracies
of the simple methods for estimating the boot-
strap probability of a maximum-likelihood tree.
Mol. Biol. Evol. 11:142-145.
HEARTY, P. J., P. KINDLER, H. CHENG, AND R. L.
EDWARDS. 1999. A +20 m middle Pleistocene
sea-level highstand (Bermuda and the Bahamas)
due to partial collapse of Antarctic ice. Geology
27:375-378.
HEDGES, S. B. 1996. Historical biogeography of
West Indian vertebrates. Annu. Rev. Ecol. Syst.
27:163-196.
HEDGES, S. B., C. A HASS, AND L. R. MAXSON.
1992. Caribbean biogeography: molecular evi-
dence for dispersal in West Indian terrestrial ver-
tebrates. Proc. Natl. Acad. Sci. USA 89:1909-
1913.
HELM-BYCHOWSKI, K., AND J. CRACRAFT. 1993.
Recovering phylogenetic signal from DNA se-
quences: relationships within the Corvine assem-
blage (Class Aves) as inferred from complete se-
quences of the mitochondrial DNA cytochrome-b
gene. Mol. Biol. Evol. 10:1196-1214.


HILLIS, D. M., AND J. J. BULL. 1993. An empirical
test of bootstrapping as a method for assessing
confidence in phylogenetic analysis. Syst. Biol.
42:182-192.
HILLIS, D. M. 1998. Taxonomic sampling, phyloge-
netic accuracy, and investigator bias. Syst. Biol.
47:3-8.
HUNT, J. S., E. BERMINGHAM, AND R. E. RICKLEFS.
2001. Molecular systematics and biogeography of
Antillean thrashers, tremblers, and mockingbirds
(Aves: Mimidae). Auk 118:35-55.
IRWIN, D. M., T. D. KOCHER, AND A. C. WILSON.
1991. Evolution of the cytochrome b gene in
mammals. J. Mol. Evol. 32:128-144.
ITURRALDE-VINENT, M. A., AND R. D. E.
MACPHEE. 1999. Paleogeography of the Carib-
bean region: implications for Cenozoic biogeog-
raphy. Bull. Am. Mus. Nat. Hist. 238:1-95.
JAMES, H. F. 1995. Prehistoric extinctions and eco-
logical changes on oceanic islands. Ecolog. Stud.
115: 87-102.
JUNIPER, T., AND M. PARR. 1998. Parrots: a guide
to parrots of the world. New Haven, CT: Yale
Univ. Press.
KISHINO, H., AND M. HAGESAWA. 1989. Evaluation
of the maximum likelihood estimate of the evolu-
tionary tree topologies from DNA sequence data,
and the branching order in Hominoidea. J. Mol.
Evol. 29:170-179.
KLEIN, N. K., AND W. M. BROWN. 1994. Intraspeci-
fic molecular phylogeny in the Yellow Warbler
(Dendroica petechia), and implications for avian
biogeography in the West Indies. Evolution
48:1914-1932.
KLICKA, J., AND R. M. ZINK. 1997. The importance
of recent Ice Ages in speciation: a failed para-
digm. Science 277:1666-1669.
KLUGE, A. G. 1988. Parsimony in vicariance bio-
geography: a quantitative method and a Greater
Antillean example. Syst. Zool. 37:315-328.
KOCHER, T. D., W. K. THOMAS, A. MEYER, S. V.
EDWARDS, S. PAABO, F. X. VILLABLANCA, AND
A. C. WILSON. 1989. Dynamics of mitochondrial
DNA evolution in animals: amplification and se-
quencing with conserved primers. Proc. Natl.
Acad. Sci. USA 86:6196-6200.
KOENIG, S. 1999. The reproductive biology of Ja-
maica's Black-billed Parrot (Amazona agilis) and
conservation implications. Ph.D. diss., Yale
Univ., New Haven, CT.


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Page 46









OTTENS-WAINRIGHT ETAL. INDEPENDENT GEOGRAPHIC ORIGINS OF AMAZONA IN THE WEST INDIES


KOENIG, S. 2001. The breeding biology of Black-
billed Parrot Amazona agilis and Yellow-billed
Parrot Amazona collaria in Cockpit Country, Ja-
maica. Bird Conserv. Intern. 11:205-225.
LABAT, J. B. 1722. Nouveau voyage aux isles de
l'Amdrique. Paris: La Haye, P. Husson.
LABAT, J. B. 1724. Nouveau voyage aux isles de
I'Amdrique. Vols. I & II. Paris: La Haye, P. Hus-
son, T. Johnson, P. Gosse, J. van Duren, R. Al-
berts, C. Le Vier.
LABAT, J. B. 1742. Nouveau voyage aux isles de
l'Amdrique. New ed. Paris: La Haye, P. Husson.
LACK, D. 1976. Island biology, illustrated by the
land birds of Jamaica. Berkeley: Univ. Calif.
Press.
LAKE, J. A. 1994. Reconstructing evolutionary trees
from DNA and protein sequences: paralinear dis-
tances. Proc. Natl. Acad. Sci. USA 9:1455-1459.
LANTERMANN, W. 1997. Verbreitung und evolution
der psittacidenfauna auf den ozeanischen inseln
der Karibischen See. Papageienkunde 1:263-278.
LEETON, P., L. CHRISTIDIS, AND M. WESTERMAN.
1993. Feathers from museum bird skins a
good source of DNA for phylogenetic studies.
Condor 95:465-466.
LEOTAUD, A. 1866. Oiseaux de l'ile de La Trinidad,
(Antilles). Port-d'Espagne: Chronicle Publ. Off.
LITTELL, R. 1993. Controlled wildlife: Federal per-
mit procedures, Vol. 1, 2nd ed. Washington DC:
Assoc. Syst. Collections.
LOCKHART, P. J., M. A. STEEL, M. D. HENDY, AND
D. PENNY. 1994. Recovering evolutionary trees
under a more realistic model of sequence evolu-
tion. Mol. Biol. Evol. 11:605-612.
LOUSADA, S. A., AND S. N. G. HOWELL. 1996. Dis-
tribution, variation, and conservation of Yellow-
headed Parrots in northern Central America.
Cotinga 5:46-53.
MADDISON, W. P., AND D. R. MADDISON. 1992.
MacClade: analysis of phylogeny and character
evolution. Version 3. Sunderland, MA: Sinauer.
MALFAIT, B., AND M. DINKELMANN. 1972. Circum-
Caribbean tectonics and igneous activity and the
evolution of the Caribbean plate. Geol. Soc. Am.
Bull. 83:251-272.
MARIEN, D., AND K. F. KOOPMAN. 1955. The rela-
tionships of West Indian species of Aratinga
(Aves, Psittacidae). Am. Mus. Nat. Hist. Novit.
1712:1-20.
MEDLIN, L., H. J. ELWOOD, S. STICKEL, AND M. L.


SOGIN. 1988. The characterization of enzymati-
cally amplified eukaryotic 16S-like rRNA coding
regions. Gene 71:491-499.
MINDELL, D. P., AND C. E. THACKER. 1996. Rates
of molecular evolution: phylogenetic issues and
applications. Annu. Rev. Ecol. Syst. 27:279-303.
MIYAKI, C. Y., S. R. MATIOLI, T. BURKE, AND A.
WAJNTAL. 1998. Parrot evolution and paleo-
geographical events: mitochondrial DNA evi-
dence. Mol. Biol. Evol. 15:544-551.
MORGAN, G. S. 1989. Fossil Chiroptera and Roden-
tia from the Bahamas, and the historical biogeog-
raphy of the Bahamian mammal fauna. Pp. 685-
740 in Biogeography of the West Indies: past,
present, and future (Woods, C. A., ed.). Gaines-
ville, FL: Sandhill Crane Press.
MORGAN, G. S. 1994. Late Quaternary fossil verte-
brates from the Cayman Islands. Pp. 465-508 in
The Cayman Islands: natural history and biogeog-
raphy (Brunt, M. A., and J. E. Davies, eds.).
Dordrecht, Netherlands: Kluwer Academic Pub-
lishers.
MORGAN, G. S. 2001. Patterns of extinction in West
Indian bats. Pp. 369-407 in Woods, C. A., and F.
E. Sergile, eds. Biogeography of the West Indies:
patterns and perspectives, 2nd ed. Boca Raton, FL:
CRC Press.
MORGAN, G. S., AND C. A. WOODS. 1986. Extinc-
tion and the zoogeography of West Indian land
mammals. Biol. J. Linn. Soc. 28:167-203.
OLSON, S. L. 1977. Pleistocene birds of Puerto
Rico. Natl. Geogr. Res. Rep. 18:563-566.
OLSON, S. L. 1978. A paleontological perspective
of West Indian birds and mammals. Pp. 99-117
in Zoogeography in the Caribbean (Gill, F. B.,
ed.). Spec. Publ. 13. Philadelphia, PA: Acad. Nat.
Sci.
OLSON, S. L. 1982. Biological archeology in the
West Indies. Fla. Anthropol. 35:162-168.
OLSON, S. L. 1985. The fossil record of birds. Pp.
79-239 in Avian biology, Vol. VIII (Farner, D.
S., J. R. King, and K. C. Parkes, eds.). Orlando,
FL: Academic Press, Inc.
OLSON, S. L. 1989. Aspects of global avifaunal dy-
namics during the Cenozoic. Pp. 2023-2029 in
Symposium 35: The early radiation of birds
(Kurochkin, E. N., and S. L. Olson, eds.). Acta
XIX Congressus Internationalis Ornithologici 2.
Ottawa, Canada.
OLSON, S. L., AND W. B. HILGARTNER. 1982. Fos-
sil and subfossil birds from the Bahamas. Pp. 22-


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Page 47









OTTENS-WAINRIGHT ET AL. -INDEPENDENT GEOGRAPHIC ORIGINS OF AMAZONA IN THE WEST INDIES


56 in Fossil Vertebrates from the Bahamas
(Olson, S. L., ed.). Smithson. Contrib. Paleobiol.
48.
OLSON, S. L., AND G. K. PREGILL. 1982. Introduc-
tion to the paleontology of Bahamian vertebrates.
Pp. 1-7 in Olson, S. L., ed. Fossil vertebrates
from the Bahamas: Smithson. Contrib. Paleobio.
48.
PAYNTER, R. A., JR. 1955. The omithogeography of
the Yucatan Peninsula. Bull. Peabody Mus. Nat.
Hist. 9:1-347.
PINDELL, J. L., S. C. CANDE, W. C. PITMAN, III, D.
B. ROWLEY, J. F. DEWEY, J. LABRECQUE, AND
W. HAXBY. 1988. A plate-kinematic framework
for models of Caribbean evolution. Tectonophys-
ics 155:121-138.
PORTELL, R. W., S. K. DONOVAN, AND D. P.
DOMNING. 2001. Early Tertiary vertebrate fossils
from Seven Rivers, Parish of St. James, Jamaica,
and their biogeographical implications. Pp. 191-
200 in Biogeography of the West Indies: patterns
and perspectives, 2nd ed. (Woods, C. A., and F. E.
Sergile, eds.). Boca Raton, FL: CRC Press.
POSADA, D., AND K. A. CRANDALL. 1998.
MODELTEST: testing the model of DNA substi-
tution. Bioinformatics 14:817-818.
PREGILL, G. K. 1981. An appraisal of the vicariance
hypothesis of Caribbean biogeography and its
application to West Indian terrestrial vertebrates.
Syst. Zool. 30:147-155.
PREGILL, G. K., AND S. L. OLSON. 1981. Zo-
ogeography of West Indian vertebrates in relation
to Pleistocene climatic cycles. Annu. Rev. Ecol.
Syst. 12:75-98.
PREGILL, G. K., D. W. STEADMAN, S. L. OLSON,
AND F. V. GRADY. 1988. Late Holocene fossil
vertebrates from Burma Quarry, Antigua, Lesser
Antilles. Smithson. Contrib. Zool. No. 463.
PREGILL, G. K., D. W. STEADMAN, AND D. R.
WATTERS. 1994. Late Quaternary vertebrate fau-
nas of the Lesser Antilles: historical components
of Caribbean biogeography. Bull. Carnegie Mus.
Nat. Hist. 30:1-51.
RAFFAELE, H., J. WILEY, 0. GARRIDO, A. KEITH,
AND J. RAFFAELE. 1998. A guide to the birds of
the West Indies. Princeton, NJ: Princeton Univ.
Press.
RICKLEFS, R. E., AND G. W. Cox. 1972. Taxon cy-
cles in the West Indian avifauna. Am. Nat. 106
(948):195-219.
RICKLEFS, R. E., AND G. W. Cox. 1978. Stage of


taxon cycle, habitat distribution, and population
density in the avifauna of the West Indies. Am.
Nat. 112(987):875-895.
ROSEN, D. E. 1976. A vicariance model of Carib-
bean biogeography. Syst. Zool. 24:431-464.
SANGER, F., S. NICKLEN, AND A. R. COULSON.
1977. DNA sequencing with chain-terminating
inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-
5467.
SCHUCHMANN, K.-L. 1980. Okologie und Evolu-
tion der Trochilidenfauna auf den ozeanischen
Inseln der Karibischen See. Bonn. Zool. Beitr.
31:289-309.
SCLATER, P. L. 1891. On recent advances in our
knowledge of the geographical distribution of
birds. Ibis 3(12):514-557.
SCHRODER, V. W. 1988. Zur Biologie und zum
status der Kubaamazone (Amazona leucocephala)
auf Great Abaco (Bahamas). Trochilus 9:3-34.
SEUTIN, G., N. KLEIN, R. E. RICKLEFS, AND E. BER-
MINGHAM. 1994. Historical biogeography of the
Bananaquit (Coereba flaveola) in the Caribbean
region: a mitochondrial DNA assessment. Evolu-
tion 48:1041-1061.
SHIELDS, G. F. AND A. C. WILSON. 1987. Calibra-
tion of mitochondrial DNA evolution in geese. J.
Mol. Evol. 24:212-217.
SLIKAS, B., S. L. OLSON, AND R. C. FLEISCHER.
2002. Rapid independent evolution of flightless-
ness in four species of Pacific island rails
(Rallidae), an anlysis based on mitochondrial se-
quence data. J. Avian Biol. 33:5-14.
SMITH, G.A. 1975. Systematics of parrots. Ibis
117:18-68.
SNYDER, N. F. R., W. B. KING, AND C. B. KEPLER.
1982. Biology and conservation of the Bahama
Parrot. Living Bird 19:91-114.
SNYDER, N. F. R., J. W. WILEY, AND C. B. KEPLER.
1987. The parrots of Luquillo: natural history and
conservation of the Puerto Rican Parrot. Los An-
geles, CA: West. Found. Vert. Zool.
SORENSON, M. D., AND T. W. QUINN. 1998. Numts:
a challenge for avian systematics and population
biology. Auk 115:214-221.
STANGEL, P. W., AND M. R. LENNARTZ. 1988. Sur-
vival of Red-cockaded Woodpecker nestlings un-
affected by sampling blood and feather pulp for
genetic studies. J. Field Ornithol. 59:389-394.
STEADMAN, D. W., AND G. S. MORGAN. 1985. A
new species of bullfinch (Aves: Emberizinae)


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Page 48









OTTENS-WAINRIGHT ETAL. INDEPENDENT GEOGRAPHIC ORIGINS OF AAAZONA IN THE WEST INDIES


from a late Quaternary cave deposit on Cayman
Brac, West Indies. Proc. Biol. Soc. Wash.
98:544-553.
STEADMAN, D. W., G. K. PREGILL, AND S. L. OL-
SON. 1984. Fossil vertebrates from Antigua,
Lesser Antilles: evidence for late Holocene hu-
man-caused extinctions in the West Indies. Proc.
Natl. Acad. Sci. USA 81:4448-4451.
SWOFFORD, D. L. 1998. PAUP*: Phylogenetic
analysis using parsimony (*and other methods),
Version 4. Sunderland, MA: Sinauer Associates.
SWOFFORD, D. L., G. J. OLSEN, P. J. WADDELL,
AND D. M. HILLIS. 1996. Phylogenetic inference.
Pp. 407-514 in Molecular systemtatics (Hilllis,
D. M., C. Mortiz, and B. K. Mable, eds.). Sunder-
land, MA: Sinauer Associates, Inc.
TARR, C. L. AND R. C. FLEISCHER. 1993. Mitochon-
drial-DNA variation and evolutionary relation-
ships in the Amakihi complex. Auk 110:825-831.
TERBORGH, J., J. FAABORG, AND H. J. BROCK-
MANN. 1978. Island colonization by Lesser Antil-
lean birds. Auk 95:59-72.
THOMPSON, D. W. 1899. On characteristic points in
the cranial osteology of the parrots. Proc. Zool.
Soc. Lond. 1899:9-46.
THOMPSON, J. D., D. G. HIGGINS, AND T. J. GIB-
SON. 1994. Clustal W: improving the sensitivity
of progressive multiple sequence alignment
through sequence weighting, position specific gap
penalties, and weight matrix choice. Nucleic Ac-
ids Res. 22:4673-4680.
VALENTINE, M. 1990. Chromosome analysis. Pp.
127-131 in Genus Amazona (Stoodley, J., and P.
Stoodley, eds.). Portsmouth, England: Bezels
Publ.
WEBB, T., III, AND P. J. BARTLEIN. 1992. Global
changes during the last 3 millions years: climatic
controls and biotic responses. Annu. Rev. Ecol.
Syst. 23:141-173.
WEGE, D. C., AND N. J. COLLAR. 1991. The Blue-
cheeked Amazon Amazona dufresniana: a re-
view. Bird Conserv. Intern. 1:317-328.
WETMORE, A. 1917. The birds of Culebra Island,
Porto Rico. Auk 34:51-62.
WETMORE, A. 1926. Descriptions of additional fos-


sil birds from the Miocene of Nebraska. Am.
Mus. Nat. His. Novit. 211:1-5.
WETMORE, A. 1928. Bones of birds from the Ciego
Montero deposit of Cuba. Am. Mus. Nat. His.
Novit. 301:1-5.
WETMORE, A. 1937. Ancient records of birds from
the island of St. Croix with observations on ex-
tinct and living of Puerto Rico. J. Agric. Univ.
Puerto Rico 21:5-16.
WETMORE, A. 1938. Bird remains from the West
Indies. Auk 55:51-55.
WETMORE, A. 1951. Recent additions to our knowl-
edge of prehistoric birds 1933-1949. Pp. 51-74
in Proc. Tenth Intern. Ornithol. Congr. (1950)
(Horstadins, S., ed.). Uppsala, Sweden.
WETMORE, A. 1956. A check-list of the fossil and
prehistoric birds of North America and the West
Indies. Smithson. Misc. Coll. 131(5):1-105.
WILEY, J. W. 1991. Status and conservation of par-
rots and parakeets in the Greater Antilles, Ba-
hama Islands, and Cayman Islands. Bird Conserv.
Intern. 1:187-214.
WILEY, J. W. 2000. A bibliography of ornithhology
in the West Indies. Proc. West. Found. Vert.
Zool. 7:1-817.
WILLIAMS, M. I. 1998. The systematic relationships
of the Hawk-headed Parrot, Deroptyus accipitri-
nus. in Abstracts of the 1998 North American
Ornithological Conference. St. Louis, MO.
WILLIAMS W., AND D. W. STEADMAN. 2001. The
historic and prehistoric distribution of parrots
(Psittacidae) in the West Indies. Pp. 175-189 in
Biogeography of the West Indies: patterns and
perspectives, 2nd ed. (Woods, C. A., and F. E.
Sergile, eds.). Boca Raton, FL: CRC Press.
WILSON, A. C., R. L. CANN, S. M. CARR, M.
GEORGE, U. B. GYLLENSTEN, K. M. HELM-
BYCHOWSKI, R. G. HIGUCHI, S. R. PALUMBI, E.
M. PRAGER, R. D. SAGE, AND M. STONEKING.
1985. Mitochondrial DNA and two perspectives
on evolutionary genetics. Biol. J. Linn. Soc.
26:375-400.
ZUCKERKANDL, E., AND L. PAULING. 1965. Mole-
cules as documents of evolutionary history. J.
Theor. Biol. 8:357-366.


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Page 49












3rd North American Ornithological Conference



24-28 September 2002 New Orleans, LA

ISLAND TREASURES: AVIAN RESEARCH AND CONSERVATION
IN THE CARIBBEAN
A SYMPOSIUM PRESENTED AT THE
THIRD NORTH AMERICAN ORNITHOLOGICAL CONFERENCE
25 SEPTEMBER 2002





ISLAND TREASURES: AVIAN RESEARCH AND CONSERVATION IN THE CARIBBEAN

INTRODUCTION -


ROSEMARIE S. GNAM
Center for Biodiversity and Conservation, American Museum of Natural
History, Central Park West @79 Street, New York 110024 USA


OVER THE PAST 10 YEARS, increased conservation
awareness has transpired in several Caribbean is-
lands. This heightened awareness has in turn, nur-
tured ornithological research and conservation ef-
forts throughout the region. These efforts, however,
are poorly known outside the region itself. This
symposium will synthesize current ornithological
research and conservation activities in the Carib-
bean region. Several case studies will be presented
in the Symposium. Similarities and differences in
conservation approaches will be highlighted. Each
presentation will address avian conservation threats,
research priorities, and solutions. The discussion of
these key case studies will illustrate the research
and conservation priorities for the region, and help
integrate these largely island efforts into those of
the larger North American ornithological commu-
nity.
Before proceeding to the selected case studies, I
would like to introduce the avifauna of the Carib-
bean region and discuss its conservation signifi-
cance.
Five hundred and sixty-four bird species occur in
the West Indies (Raffaele et al. 1998). This geo-
graphic area includes the Bahamas, Greater Antil-


les, Virgin Islands, Cayman Islands, Lesser Antilles,
Isla San Andr6s and Isla Providencia. The Carib-
bean region ranks sixth among the top 25 biodiver-
sity hotspots in the world (Conservation Interna-
tional 2002). The West Indies has a human popula-
tion of about 2.5 million. It covers a geographic area
of 280,000 km2 or a land area roughly equivalent in
size to the state of Arizona. Politically, the West
Indies is composed of 12 independent nations and
several British, Dutch, French, and United States
territories.
Much of the islands' avifauna is unique, with 148
endemic species recorded (21%) among its 564 spe-
cies (Raffaele et al. 1998). The third largest island
(in size) of the West Indies, Jamaica, exhibits the
highest level of endemism (28 species), followed by
Cuba (25 species), Hispaniola (23 species), and
Puerto Rico (14 species; David Wege, pers. comm.).
The Lesser Antillean islands have seven endemic
genera unique to the Caribbean. Lastly, the West
Indies are not only important for their high avian
endemism but they play a critical role as habitats for
the 120 species that migrate during fall and winter
from North America. For example, the avifauna of
Jamaica doubles to over 250+ bird species during
migration.


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Page 50









GNAM INTRODUCTION TO ISLAND TREASURES: AVIAN RESEARCH AND CONSERVATION IN THE CARIBBEAN


According to BirdLife International (David
Wege, pers. comm.) and the IUCN (2000) Red Data
List, the West Indies are home to 57 globally threat-
ened bird species and 11 of these species are ranked
as critically threatened. These critically threatened
species include Cuban Kite (Chondrohierax uncina-
tus wilsoni), Ivory-billed Woodpecker
(Campephilus principalis), Bachman's Warbler
(Vermivora bachmanii), Ridgway's Hawk (Buteo
ridgwayi), Jamaican Petrel (Pterodroma caribbaea),
Jamaican Poorwill (Siphonorhis americanus),
Puerto Rican Parrot (Amazona vittata), Puerto Rican
Nightjar (Caprimulgus rufus), Grenada Dove
(Leptotila wellsi), Semper's Warbler (Leucopeza
semperi), and Montserrat Oriole (Icterus oberi).
Collaborative efforts and partnerships will be
needed for conservation of these threatened species
because 25 of these 57 globally threatened species
occur in more than one country. One of the sympo-
sium papers will highlight regional research and
conservation efforts for the West Indian Whistling
Duck (Dendrocygna arborea). IUCN lists the status
of this species as vulnerable.
Major conservation threats to birds in the West
Indies include habitat loss and degradation; intro-
duced species, especially predators such as mon-
goose, cats, raccoons, and rats; unsustainable use
from hunting and pet trade; and chemical pollution.
Although these threats are common to birds glob-
ally, their effects are exacerbated on islands, where
species' ranges and habitats are limited in size and
distribution. Tourism and agriculture are the pri-
mary forces in island development and significantly
impact avian habitats. According to the World
Tourism Organization's (2002) statistics for the
year 2000, 17+ million travelers visited the Carib-
bean and tourism grew at an average annual rate of
3.5% from 1995 to 1999. The island with the high-
est number of endemic species, Jamaica, attracted
1.3 million visitors, whereas the next island with
high endemism, Cuba, had a annual tourism growth
rate of 20% with 1.7 million tourists visiting. Tour-
ism and agriculture to feed residents and tourists
place ever increasing demands on an island's natu-
ral resources, notably land and, as a result, Carib-
bean islands have lost much of their primary forest
and wetlands habitats to development and agricul-
ture. World Wildlife Fund estimates that Cuba has
15-20% of its land remaining in its natural state,
whereas the Dominican Republic has 10% remain-
ing.


The Society for the Conservation and Study of
Caribbean Birds (SCSCB) conducted a workshop at
its 1998 annual meeting in Guadeloupe to determine
conservation needs and priorities for the Caribbean
Region. SCSCB identified training and capacity
building as the greatest conservation need in the
region. SCSCB recognizes that research agendas
and conservation priorities for the West Indies need
to be locally driven and implemented, with conser-
vation solutions needing strong local participation
to succeed in the long-term. Other needs are respon-
sible tourism and sustainable development, research
and conservation partnerships, environmental edu-
cation and outreach, exchange of scientific data and
information, and heightened conservation awareness
of the public and decision makers. SCSCB has initi-
ated efforts to address these needs both locally ("on
island") and regionally ("all islands"). For example,
SCSCB's annual "Caribbean Endemic Bird Day"
heightens awareness for birds and their habitats
throughout the region while each island customizes
the event's activities for its island culture. Several
of the Symposium presentations will discuss these
needs and demonstrate practical solutions.
Lastly, as Organizer and Chair for this Island
Treasures symposium, I am pleased to introduce
these case studies. They clearly show the diversity
of current research and conservation projects in the
Caribbean region. Noteworthy is the strong partici-
pation of Caribbean Nationals in this historic sym-
posium.

LITERATURE CITED
CONSERVATION INTERNATIONAL. 2002. Biodiver-
sity hotspots. www.biodiversityhotspots.org,
Washington DC.
IUCN (WORLD CONSERVATION UNION) 2000.
IUCN Red Data List of threatened species
(Hilton-Taylor, C., compiler). Gland, Switzer-
land: IUCN-The World Conservation Union/
Species Survival Commission. Available in elec-
tronic form at www.redlist.org.
RAFFAELE, H., J. WILEY, 0. GARRIDO, A. KEITH,
AND J. RAFFAELE. 1998. A guide to the birds of
the West Indies. Princeton, NJ: Princeton Univ.
Press.
WORLD TOURISM ORGANIZATION. 2002. Website.
www.world-tourism.org.


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Page 51












CURRENT STATUS OF CUBAN THREATENED BIRDS:
CASE STUDIES OF CONSERVATION PROGRAMS


MARTIN ACOSTA, LOURDES MUGICA, ORLANDO TORRES,
DENNIS DENIS, ARIAM JIMENEZ, AND ANTONIO RODRIGUEZ
Facultad de Biologia, Universidad de La Habana, Calle 25 entre J e I, Vedado, Ciudad de La Habana, Cuba


Abstract.-Cuba is the largest island in the Caribbean, with many ecosystems supporting high biodiversity.
The island has three main mountain groups as well as the major natural wetlands of the Caribbean. It is home to
over 350 bird species. Twenty-three Cuban species are considered threatened, and nine of these are under study
by several institutions, including the Universidad de La Habana, the Instituto de Ecologia y Sistematica
(Institute of Ecology and Systematics), and the Empresa para la Conservaci6n de la Flora y la Fauna (Agency
for the Conservation of Flora and Fauna). Here, we describe some of the results of our studies of Cuba's threat-
ened birds, as well as discuss current conservation efforts. Study cases where research and management have
been successful in improving the current status of the birds are presented. Efforts to manage Cuban Parrots
(Amazona leucocephala) and Greater Flamingos (Phoenicopterus ruber) have been the most successful of the
conservation efforts.
Key words: Amazona leucocephala, Charadrius melodus, conservation, Cuba, Cuban Parrot, Dendrocygna
arborea, Greater Flamingo, Grus canadensis nesiotes, Phoenicopterus ruber, Piping Plover, research institu-
tions, Sandhill Crane, threatened birds, West Indian Whistling-Duck
Resumen.-ESTADO ACTUAL DEL CONOCIMIENTO DE LAS AVES AMENAZADAS DE CUBA: ESTUDIOS DE CASO
DE PROGRAMAS DE CONSERVACION. Cuba es la mayor isla del Caribe, con un gran numero de ecosistemas dife-
rentes que soportan una elevada biodiversidad. La isla posee tres cadenas montafiosas y los humedales mas im-
portantes del Caribe. Alberga una omitofauna de mas de 350 especies de aves. Veintitr6s especies de aves se
consideran amenazadas y, de ellas, nueve estan bajo estudio en diferentes instituciones que incluyen La Univer-
sidad de La Habana, el Instituto de Ecologia y Sistematica y la Empresa para la Conservaci6n de la Flora y la
Fauna. En el trabajo se describen algunos de los esfuerzos y resultados de nuestros estudios sobre las aves ame-
nazadas. Se presentan ademais algunos estudios de caso donde la investigaci6n y el manejo han tenido exitosos
resultados y han mejorado el status de las especies involucradas. Entre los casos de manejo mas exitosos se plan-
tean el de la Cotorra (Amazona leucocephala) y el del Flamenco (Phoenicopterus ruber).
Palabras claves: Amazona leucocephala, aves amenazadas, Charadrius melodus, conservacion, Cotorra,
Cuba, Dendrocygna arborea, Flamenco, Frailecillo Silbador, Grulla, Grus canadensis nesiotes, instituciones de
investigaci6n, Phoenicopterus ruber, Yaguasa
Resume.-STATUT ACTUEL DES OISEAUX MENACES DE CUBA: ETUDE DE CAS DE PROGRAMES DE CONSERVA-
TION. Cuba est File la plus grande des Caraibes avec de nombreux 6cosystemes a forte biodiversity. L'ile pos-
sede trois groupes de montagnes importants ainsi que les plus grandes zones humides de la Caraibe. C'est l'ha-
bitat de plus 350 especes. 23 especes cubaines sont consid6rees comme menaces et neuf d'entre elles font l'ob-
jet d'6tudes par plusieurs institutions, dont l'universite de La Havane, l'institut d'Ecologie et de Systematique
ainsi que l'Agence pour la Conservation de la Flore et de la Faune. Nous d6crivons ici certains des r6sultats de
nos 6tudes sur les oiseaux menaces de Cuba et nous discutons des efforts de conservation en cours. Des 6tudes
de cas sont present6es ou la recherche et la gestion ont ete efficaces en ameliorant le statut actuel des oiseaux.
Les efforts de gestion les plus couronn6s de success concement l'Amazone de Cuba (Amazona leucocephala) et
le Flamant rose (Phoenicopterus ruber).
Mots-clks: Amazona leucocephala, Charadrius melodus, conservation, Cuba, Amazone de Cuba, Dendrocy-
gna arborea, Flamant rose, Grus canadensis nesiotes, Phoenicopterus ruber, Pluvier siffleur, institutions de re-
cherche, Grue du Canada, oiseaux menaces, Dendrocygne des Antilles



CUBA, WITH AN AREA of 110,992 km2, a great country: Cuba is at the mouth of the Gulf of Mex-
diversity of ecosystems, and more than a thousand ico, close to Florida and Yucatan, making it a key
keys, constitutes the most important territory for locality for many species of migratory Neotropical
birds within the Caribbean. Some ecological fea- birds. The three main mountain groups are in the
tures are outstanding for bird distribution in this east, center, and west of Cuba, where semidecidous


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Page 52












and evergreen forests are conspicuous. In contrast to
the northern coast, the lower southern coast has ex-
tensive wetlands, notably the Zapata, Biramas, and
Lanier swamps, which are important not only for
Cuban biodiversity but for the entire Caribbean.
Only two seasons occur: the rainy season from May
to September, and the dry season from October to
April. Island ecosystems are extremely fragile and
the rate of extinction there is high. These character-
istics, among others, drive the process of variation
or endemism, restricted or broad distributions, and
development or extinction of species.
Additionally, for more than four centuries, defor-
estation and some agricultural practices have af-
fected the distribution and abundance of many spe-
cies of birds. By 1960, when forests covered only
14% of Cuba, the government began the difficult
task of increasing the amount of forest cover. In the
ensuing 40 years, forested land increased to 21% of
land cover. Many other measures were taken to pre-
serve and recover our natural heritage, most impor-
tantly the creation of the National System of Pro-


ACOSTA ETAL.-STATUS OF CUBAN THREATENED BIRDS

tected Areas (which includes many National Parks),
Fauna Refuges, and Biosphere Reserves, among
other categories of protected areas.
Currently, the Cuban avifauna is composed of
368 species. Among these, 132 are permanent resi-
dents, 24 are endemics, and 23 are endangered to
different degrees. Several scientists from diverse
Cuban scientific institutions are studying the ecol-
ogy of the most-endangered species. Here, we pre-
sent a general overview of threatened birds of Cuba
and the Cuban institutions that are focusing on the
research of these birds. Below, we summarize cur-
rent studies of endangered species being conducted
within our scientific institutions and give an over-
view of what we will present in this report.

Empresa para la Conservaci6n de la Flora y la
Fauna
An active Group for the Study of the Globally
Threatened Birds has been formed. Their on-going
work includes:
1. Basic ecological studies useful for future man-


Table 1. Current research and conservation efforts by the Empresa para la Conservaci6n de la Flora y la Fauna for seven
threatened species of Cuban birds.


Locality


Nature of the research


Ivory-billed Woodpecker
Campephilus principalis
Hook-billed Kite
Chondrohierax uncinatus
wilsonii
Greater Flamingo
Phoenicopterus ruber ruber
Sandhill Crane
Grus canadensis nesiotes





Cuban Parakeet
Aratinga euops


Cuban Parrot
Amazona leucocephala



Fernandina's Flicker
Colaptes fernandinae


Turquino National Park

Alejandro de Humboldt National Park


Rio Maximo Fauna Refuge

Los Indios Ecological Reserve


Mantua, Moron, north & south of Ciego de
Avila, Ci6naga de Zapata, & Ci6naga
de Guayaberas
Banao & Jumagua Ecological Reserves

La Bel6n Protected Area

Monte Cabaniguan Fauna Refuge
Los Indios Ecological Reserve

Hanabanilla Protected Natural Landscape
La Bel6n & Moron Protected Areas
Monte Cabaniguan Fauna Refuge


Species search

Species search


Breeding ecology, management

Population trends, monitoring, daily
activity, behavior, feeding
biology, reproduction
Population trends


Movement, abundance, nesting
(artificial nests)
Abundance, feeding ecology,
reproduction
Abundance, nest selection, growth
Population trends, monitoring,
reproduction, feeding ecology
Abundance, feeding ecology, nesting
Population trends
Abundance, reproduction


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Species


Page 53









ACOSTA ETAL.-STATUS OF CUBAN THREATENED BIRDS


N 25000.


20000,


15000,


10000.


5000,


9-


---*-- Cabeza de Vaca -*- Boca Honda
3- California -s- Calderas


Years
-i-Boca Grande --Rio Maximo
-IJ -Cayo Las Loras ---- Cayo Picua


Fig. 1. Number of active Greater Flamingo (Phoenicopterus ruber) nests at eight Cuban localities,
from 1989 to 1992.


agement of the Cuban Parrot (Amazona leuco-
cephala), Cuban Parakeet (Aratinga euops), and
Sandhill Crane (Grus canadensis nesiotes),
among others.
2. We will showcase two cases where management
has been successful; i.e., Cuban Parrot in Los In-
dios, Isla de Pinos (now Isla de la Juventud), and
Greater Flamingos (Phoenicopterus ruber) in the
Rio Maximo Fauna Refuge, Camagijey.

Universidad de La Habana (Faculty of Biology)
1. We are studying the ecology of the bird commu-
nity associated with wetlands, with a primary
focus on the West Indian Whistling-Duck
(Dendrocygna arborea). Here, we will present
some results in relation to distribution, ecologi-
cal aspects, and the environmental education
program that is part of the whistling-duck pro-
ject.
2. We will present a brief overview of the current
status of eight species of endemic and threatened
bird species in the Sierra de Escambray of cen-
tral Cuba.

Instituto de Ecologia y Sistemdtica (CITMA4)
We present a summary of the ongoing research on
Piping Plover (Charadrius melodus) ecology, distri-
bution, and status.


INSTITUTIONS AND PROGRAMS
Empresa para la Conservaci6n de la Flora y la
Fauna
This Institution of the Agriculture Ministry man-
ages much of Cuba's natural areas, many of them
belonging to the National System of Protected Ar-
eas, and develops various programs for biodiversity
protection. One of these efforts is the Conservation
Program for Threatened Species, which includes
research on some species considered globally
threatened (Gilvez and Berovides, pers. comm.).
When the Conservation Program began, the Em-
presa had little information that was useful for the
implementation of management plans for natural
resources. Since 1987, however, an uninterrupted
study of the Cuban Parrot has been conducted in
Los Indios Ecological Reserve in the Isla de Pinos.
This intensive study has yielded valuable informa-
tion on which an effective management plan has
been based, resulting in a substantial increase in
numbers within this parrot population (see case
study below).
Encouraged by the results of the parrot research
and management, since 1998 other investigations
have begun on the Sandhill Crane, Cuban Parakeet,
Hook-billed Kite (Chondrohierax uncinatus wil-
sonii), Ivory-billed Woodpecker (Campephilus prin-
cipalis), and Fernandina's Flicker (Colaptes fernan-


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Page 54












dinae) (Table 1). The Sandhill Crane study, in par-
ticular, has produced exciting results (see case study
below).
In general, the conservation strategy used by the
Empresa for threatened and endangered species is
based on the use of charismatic "flagship" species
to justify the maximum possible protection for their
ecosystems. Environmental education and local par-
ticipation are essential elements of these conserva-
tion plans. An additional factor in the conservation
strategy is whether several threatened species occur
in an area or if certain of them occur in substantial
numbers.
The work of the Empresa has focused on three
important flagship species: Greater Flamingo, Cu-
ban Parrot, and Sandhill Crane, each of which is the
subject of case studies presented below.
Greater Flamingo.-Flamingos are among the
most beautiful and appealing colonial waterbirds in
the Caribbean and, as such, they play an important
role as a flagship species for wetlands conservation.
In fact, this species is a good example of the efforts
that the Cuban government has made to preserve its
natural areas. Before 1978, habitat degradation and
hunting threatened flamingo populations. In that
year, the Empresa para la Conservaci6n de la Flora
y la Fauna initiated a protection plan for the fla-
mingo. Eleven years later the Empresa created a
National Project for the flamingo's conservation.
Currently, this species is not considered endangered
in Cuba and, in fact, its populations are increasing
substantially in some regions of our country, in
large part as a result of the protective measures that
were taken. In Cuba, the main breeding populations
are in eight localities, including Granma,
Camagiley, Ciego de Avila, and Villa Clara prov-
inces, all in central and eastern Cuba (Fig. 1).
In general, Cuban flamingo numbers are increas-
ing, with the largest breeding population in the Rio
Maximo Fauna Refuge in northern Camagiley prov-

Table 2. Cuban Parrot (Amazona leucocephala) use of
natural and provided palms at Los Indios Ecological Re-
serve, Isla de la Juventud, Cuba, 1992.


Palm source'

Natural palms
Provided palms


Chicks per active nest (%)2

1.8(73.1)
2.4 (80.1)


'Provided palms are fallen trunks that were set vertically into the
ground and provisioned, when needed, with created cavities.
Natural palms are growing trees.
2Nests with chicks.


ACOSTA ETAL.-STATUS OF CUBAN THREATENED BIRDS

ince. There, important management measures have
been undertaken for the flamingo; e.g., increasing
the supply of freshwater from the rio Maximo to
reduce salinity and manage water levels in the rainy
season as a means of reducing egg losses. In 2002,
90,000 flamingos bred in the area (Morales 1996).
In spite of these successes, it is necessary to
maintain the conservation effort for flamingo popu-
lations because they are quite susceptible to many
environmental pressures. Nesting in huge colonies
in specialized habitat leaves flamingos vulnerable to
human disturbances, including hunting and distur-
bance by aircraft and boats. Further, feral dogs and
cats are extremely effective predators of nesting fla-
mingos and cause catastrophic disturbances within
colonies. Because of these threats, a vigorous envi-
ronmental education campaign is being developed
for the children of the communities near the pro-
tected areas, in addition to direct flamingo and habi-
tat management measures.
Cuban Parrot.-Fragmentation and destruction
of habitats, isolation and fragility of island ecosys-
tems, as well as the illegal marketing of nestlings
led to the extinction of the Cuban Macaw (Ara tri-
color) about 1864. The same factors were responsi-
ble for the extirpation of the endemic Cuban Para-
keet and the decrease of the previously abundant
and well-distributed Cuban Parrot from western
Cuba. The parrot is now considered near threatened.
In the 1970s, a program of research, restoration,
and conservation for the Cuban Parrot was begun in
Los Indios Ecological Reserve, where the parrot's
numbers and distribution had been diminishing
alarmingly. At Los Indios, parrots commonly nest in
natural palm cavities excavated by West Indian
(Melanerpes superciliaris) and Cuban Green
(Xiphidiopicus percusus) woodpeckers. A trial pro-
gram of subsidizing parrots with additional nesting
cavities was undertaken in the Reserve, wherein
fallen palms were erected and, where needed, fitted
with suitably sized cavities. In 1992, 417 palms
(including provided and natural palms) were under
study, and had high occupancy by parrots (Table 2).
Investigators determined that the optimum density
of nesting cavities was 1.2 per hectare. The provi-
sioning of dead palms with cavities resulted in a
three-fold increase in Los Indios parrot population
from 1979 to 1994. Depending on food abundance
and availability, the present parrot population now
varies from 300 to 400 breeding pairs.
Many other activities have been developed as part
of Los Indios parrot management effort, including
environmental education programs and public in-


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Page 55









ACOSTA ETAL.-STATUS OF CUBAN THREATENED BIRDS

volvement in the conservation campaign for the par-
rot.
Cuban Sandhill Crane.-The Cuban form is an
endemic subspecies of the northern Sandhill Crane.
It is an endangered permanent resident in Cuba,
where it has a restricted distribution. Before the
1990s, only four cranes populations were known,
with a total estimated at no more than 200 individu-
als.
In 1994, the Empresa para la Conservaci6n de la
Flora y la Fauna began an intensive research project
and a conservation program for the protection of the
crane, supported by the International Crane Founda-
tion and Cuban Ministry of Agriculture. From 1994
to 2003, extensive surveys were conducted through-
out Cuba and Isla de Pinos with the goal of locating
populations of the species. Historical data suggested
23 sites of known populations, of which 12 were
corroborated, although one was already extirpated.
Of the 11 extant populations surveyed, two are per-
haps ephemeral, whereas the others are stable or
increasing in numbers of birds. The total population
of the Cuban subspecies is estimated at 550 indi-
viduals (Gflvez, pers. comm.).
Cuban Sandhill Cranes inhabit flooded savannas,
marshes, and grassy fields near pine forests. Two
main threats have been identified for the population:
loss of natural habitats and man-made changes in
the hydrology of the wetlands, primarily by altering
river drainages.
Most research on the reproductive ecology of the
crane was conducted at Los Indios Ecological Re-
serve, where reproductive parameters, habitat use,
and home range were determined. Using radio te-
lemetry, Gflvez (pers. comm.) found a highly vari-
able home range of from 1 to 16 km2. Further, she
found that 87.8% of nesting sites were inside the
protected area, but birds foraged equally within both
reserve and outside areas. She recommended a re-
design of the protected area to create a more effi-
cient reserve for protecting the crane.
Beginning in 1995, annual environmental events,
"Cuban Crane and Parrot Festivals," were prepared
in locations targeted for conservation education.
During these events, local people were involved in
such events as painting contests, simultaneous bird
surveys, workshops, and conferences, among many
others, resulting in high levels of interest in children
and adults.

Universidad de La Habana
Ecology of wetland birds.-The Bird Ecology


Group of the Universidad de La Habana is studying
the ecology of the bird community associated with
wetlands, with a primary focus on the West Indian
Whistling-Duck (WIWD), an endemic bird from the
Caribbean which is listed as Vulnerablein the IUCN
(2000) Red List of Threatened Species.
Preliminary data on WIWD ecology were gath-
ered through a survey of the public, mostly hunters
and forest guards (Mugica et al. 2002). The main
findings of the opinion poll were:
* Feeding: more than 11 items were reported in
the whistling-duck's diet. They included various
weed seeds, yucca, sweet potato, royal palm
(Roystonea regia) seeds, tomato, corn, and
beans. Rice was the main food resource, how-
ever, reported by more than 40% of the people
surveyed.
Nesting: Nests were observed throughout the
year, with an increase in May and June, the two
most important months for breeding. Almost
40% of the nests were reported as placed on the
ground.
Habitat use: Rice paddies were the most impor-
tant habitat (30%) for these birds, although
dams, mangroves, lakes, and swamps were vis-
ited frequently as well.
Distribution and flock size: The whistling-duck
is distributed widely throughout Cuba; i.e., it
was reported in all Cuban provinces except La
Habana City, but usually in small flocks.
Legal Protection: Even though the WIWD is le-
gally protected in Cuba, most people reported
that it is until under considerable hunting pres-
sure. Historically, the whistle-duck was consid-
ered an important game species by Cuban farm-
ers.
The survey revealed that the species is still impor-
tant in our aquatic ecosystems, but to effectively
protect it, a strong environmental education pro-
gram should be implemented. Consequently, an
education program was organized as part of the
West Indian Whistling-Duck Working Group of the
Society for the Conservation and study of Caribbean
Birds, and had been active since 1996. During this
time:
* A network of collaborators from different Cuban
provinces was organized and two workshops
were given in relation to the program.
The program has involved 34,557 people from
seven provinces.
Fifty undergraduate students from the Universi-
dad de La Habana have collaborated.
In 1999, a festival was celebrated at the Habana


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Page 56









ACOSTAETAL.-STATUS OF CUBAN THREATENED BIRDS


Table 3. Status of and threats to avian species of concern in the Sierra de Escambray, Cuba.


Species


Status


Threats


Gundlach's Hawk Accipiter gundlachi
Cuban Parakeet Aratinga euops
Blue-headed Quail-Dove Starnoenas cyanocephala
Fernandina's Flicker Colaptes fernandinae
Giant Kingbird Tyrannus cubensis
Bee Hummingbird Mellisuga helenae
Gray-headed Quail-Dove Geotrygon caniceps
Cuban Parrot Amazona leucocephala



Zoo, with several activities for children of La
Habana province.
A video was prepared for use in the program.
Research on the status of the WIWD in Cuba is
on-going, although progress has been slow because
of the difficulties in surveying the resting sites dur-
ing the day (sites are far from swamps and coastal
areas, and are difficult to access) and the feeding
sites (usually rice paddies when they are being
sowed) during the night.
Three methods have been used to monitor WIWD
populations: aerial surveys, boat surveys, and fixed
point counts along the feeding flyway. Fixed-point
counts have been the most effective, but use of the
method requires previous knowledge of the flyway,
which may be quite variable and dependent on food
availability. This method was used in Cidnaga de
Biramas, where a maximum of 300 individuals was
recorded in the paddies surrounding the wetland
during one night. At Rio Maximo Faunal Refuge,
northern Camagiley province, 160 individuals were
recorded feeding in nearby rice paddies, whereas in
Los Indios Ecological Reserve, a small population
of more than 50 individuals is resident.
Conservation of the West Indian Whistling-Duck
in Cuba requires that both research and the aware-
ness program continue, with the addition of more
areas and involvement of more people as the only
way to guarantee the survival of the species in the
long term.
Current status of Cuban endemic birds in the
Sierra del Escambray and their relationship with
the local human community.-The Sierra del Es-
cambray, in south-central Cuba, has a high diversity
of flora and fauna. The main sources of income for
the rural community in the region are coffee and
timber. A body of Forest Guards safeguards the
natural areas, of which only 1% is protected area.


Very rare
Scarce
Very rare
Scarce
Very rare
Very rare
Uncertain
Relatively abundant


Persecution & deforestation
Pet trade & deforestation
Deforestation
Deforestation
Deforestation
Deforestation
Deforestation
Pet trade & deforestation


The Universidad de La Habana has undertaken re-
search to determine the status of endemic birds and
the effects of human activities on their populations
in the region. This research is relevant because the
region is being developed economically, including
for tourism. Thus, public education and establishing
a policy of sustainable use of resources are essential
for the maintenance of the region's biodiversity.
Some of the endemic bird species, their status,
and main threats in the region are summarized in
Table 3. The research will provide, among other
results, information on:
* Abundance and distribution of the 17 endemic
species of the region.
Effects of humans on the endemic and threat-
ened species.
In 2001, Gundlach's Hawk (Accipiter gundlachi),
Giant Kingbird (Tyrannus cubensis), Blue-headed
Quail-Dove (Starnoenas cyanocephala), and Fer-
nandina's Flicker were confirmed as occurring in
the area under study, but the presence of the Gray-
headed Quail-Dove (Geotrygon caniceps) is uncer-
tain, and the Bee Hummingbird (Mellisuga helenae)
has not been confirmed there. Various actions de-
signed to increase the environmental awareness of
the community have been undertaken.

Instituto de Ecologia y Sistem6tica
This group is working principally with the Piping
Plover. The plover is a North American species that
has declined drastically since the 1950s and, for that
reason, has been considered Vulnerable (BirdLife
International 2000). Piping Plovers spend most of
their annual cycle associated with wintering areas
(Haigh and Oring 1985), but little was known of the
species' wintering distribution and ecology before
1990 (Nicholls and Baldassarre 1990).
Since 1991, Cuba has been involved in the Inter-


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Page 57









ACOSTA ETAL.-STATUS OF CUBAN THREATENED BIRDS

national Census of the Piping Plover, with the ob-
jectives of confirming the species' presence in the
national territories and providing useful data on its
current distribution and population trends. The re-
search has been developed in three stages: (1) com-
pilation and analysis of the historical records of the
species from 1800 to 1987, (2) evaluation and char-
acterization of the habitats where the species has
been seen, and 3) surveys for the presence of the
plover in the historical localities and potential
coastal habitats.
The research (1991-2001) has shown better re-
sults than were expected, based on historical re-
cords. Twenty-five records of Piping Plovers in 11
localities were reported, including seven new locali-
ties for the species. These surveys revealed a Cuban
wintering population of 60-80 individuals (Blanco
2001). North-central keys, such as Cayo Coco and
Cayo Pared6n Grande in Ciego de Avila province,
were the main wintering grounds for the Piping
Plover in Cuba, with approximately 68% of indi-
viduals observed there (Blanco 2001). Because of
the considerable amount of potential habitat along
the Cuban coasts, the investigators estimated that
the wintering population of Piping Plover may be
more than 100 individuals.
The Cuban winter resident population of Piping
Plover comprises 2.0-2.7% of the current world
population of the species (Wetlands International
2002). The tourism development plan for Cuba and
the rest of the Caribbean could threaten the impor-
tant remaining habitats of the plover. For this rea-
son, the Piping Plover population wintering in Cuba
requires special attention. Conservation efforts
should focus on monitoring population trends and
developing studies of specific sites available to this
species.
CONCLUSIONS
Our threatened bird species are an important con-
cern for Cuban research teams. It is of note that nine
of the 23 threatened bird species in Cuba (Birdlife


International 2000) are being studied, and that all
have populations within in the National System of
Protected Areas.

ACKNOWLEDGMENTS
We wish to thank Xiomara Gilvez, Jos6 Morales,
Pedro Blanco, and Vicente Berovides for sharing
their information and expertise in making this paper
possible.

LITERATURE CITED
BIRDLIFE INTERNATIONAL. 2000. Threatened birds
of the world. Barcelona and Cambridge, UK:
Lynx Edicions and BirdLife International.
BLANCO, P. 2001. Areas de importancia regional
para el Frailecillo Silbador (Charadrius melodus)
en Cuba. P6ster presentado en la XIII Reuni6n de
la Sociedad Caribefia de Ornitologia, Julio 2001.
Topes de Collantes, Cuba.
HAIG, S. M., AND L. W. ORING. 1985. The distribu-
tion and status of the Piping Plover throughout
the annual cycle. J. Field Ornithol. 56:334-345.
IUCN (WORLD CONSERVATION UNION). 2000.
2000 IUCN Red List of threatened species.
(Hilton-Taylor, C., compiler). Gland, Switzer-
land: IUCN-The World Conservation Union/
Species Survival Commission.
MORALES, J. 1996. El flamenco rosado caribefio.
Flora y Fauna 0:14-18.
MUGICA, L., D. DENIS, AND M. ACOSTA. 2002. Re-
sultados preliminares de la encuesta sobre la Ya-
guasa (Dendrocygna arborea) en varias regiones
de Cuba. Pitirre 15:55-60.
NICHOLLS, J. L., AND G. A. BALDASSARRE. 1990.
Habitat associations of Piping Plover wintering in
the United States. Wilson Bull. 102:581-590.
WETLANDS INTERNATIONAL. 2002. Waterbird popu-
lation estimate, 3rd ed. Wetlands International
Global Series No. 12, Wageningen, The Nether-
lands.


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Page 58












AVIAN RESEARCH, MONITORING, AND CONSERVATION IN THE DOMINICAN REPUBLIC

KATE WALLACE
Sociedad Ornitol6gica de la Hispaniola, Apdo. 3284, Santo Domingo, Dominican Republic


Abstract.-I report on some of the recent and current research efforts in the Dominican Republic, including
those of Joseph Wunderle on coffee plantations, Steven Latta on migratory birds, and Christopher Rimmer on
Bicknell's Thrush (Catharus bicknelli). These workers, their Dominican assistants, and members of the Sociedad
Omitol6gica Hispaniola have developed a bird monitoring project in several areas and another to find nests of
resident birds. Also, there is participation in a Peregrine Fund project to study the status of Ridgway's Hawk
(Buteo ridgwayi). Information from these studies is expected to influence decisions that affect conservation.
Key words: Buteo ridgwayi, Catharus bicknelli, Dominican Republic, Sierra de Bahoruco, Sociedad Orni-
tol6gica de la Hispaniola
Resumen.-INVESTIGACIONES, MONITOREO Y CONSERVACION DE LAS AVES EN LA REPUBLICA DOMINICANA. Se
describen estudios cientificos recientes y en curso en la Republica Dominicana, incluyendo los de Joseph Wunder-
le sobre cafetales, los de Steven Latta sobre aves migratorias, y los de Chris Rimmer sobre el Zorzal de Bicknell
(Catharus bicknelli). Ellos y sus asistentes dominicanos y los miembros de la Sociedad Omitol6gica Hispaniola
han desarrollado un proyecto de monitoreo de aves en varios puntos y otro de busqueda de nidos de aves residen-
tes. Tambi6n han participado en un proyecto del Peregrine Fund estudiando el estado del Gavilan o Busardo de
Ridgway (Buteo ridgwayi). Se espera que esta informaci6n influya en las decisiones que impactan la conserva-
cion.
Palabras clave: Buteo ridgwayi, Catharus bicknelli, Republica Dominicana, sierra de Bahoruco, Sociedad Or-
nitol6gica Hispaniola
Resumn.-RECHERCHE, SULVI ET CONSERVATION DE L'AVIFAUNE DE LA REPUBLIQUE DOMINICAINE. Je pr6sente
des efforts de recherche r6cents et en cours en Republique Dominicaine ainsi que les activities de conservation
lies des chercheurs et des membres de la Societe d'Omithologie d'Hispaniola.
Mots-clks: Buteo ridgwayi, Catharus bicknelli, Republique Dominicaine, Sierra de Bahoruco, SociOtO d'Orni-
thologie d 'Hispaniola


THE DOMINICAN REPUBLIC comprises the eastern
two-thirds of Hispaniola, the second largest of the
Greater Antilles. The diversity of habitat is extreme,
ranging from the highest mountain in the Caribbean,
Pico Duarte, at 3175 m (10,400 ft) to Lago Enri-
quillo, a salt lake at 44 m (143 ft) below sea level.
There are extensive dry thorn forests, cactus, a karst
region, broad leaf and pine forests, and moist forest
with tree ferns. Wetland habitats include several
lakes, many rivers, and the coastal mix of man-
grove, limestone cliffs, sandy and pebble beaches,
and areas that have been developed for the produc-
tion of salt.
Because of its position in the Caribbean, large
size, and the variety of habitats, the Dominican Re-
public is home to 300 species of birds, of which 150
are resident, including several introduced species.
Of special interest are the 27 endemics. The remain-
ing species are migratory shorebirds, ducks, rap-
tors, and passerines, as well as the occasional va-
grant.


RESEARCH
The Dominican Republic was the area for some
of the first studies of avian use of shade coffee plan-
tations. The work of Joseph M. Wunderle, Jr. and
his colleague Steven Latta in the central mountain
range provided some of the early scientific basis
needed to promote "bird friendly coffee." I am
happy to report that locally produced organic coffee
is being promoted in the super markets of Santo Do-
mingo, the nation's capitol.
Because no institutional ornithological commu-
nity exists in the Dominican Republic, the projects
of researchers, primarily from the United States,
provide an extremely important opportunity to train
Dominican field assistants. In all the projects men-
tioned below, these local people then become the
mainstays of the program, and each project contains
such training for new assistants, as an important
component.
Steven Latta completed his thesis work in the Si-


Special Issuing Honoring Nedra Klein


Journal of Caribbean Ornithology


Page 59









WALLACE AVIAN RESEARCH, MONITORING, AND CONSERVATION IN THE DOMINICAN REPUBLIC


erra de Bahoruco in southwestern Dominican Re-
public. His work established important factors in the
winter limitation of migratory birds.
Another project which has been centered in the
Bahorucos is the work of Christopher Rimmer of
the Vermont Institute of Natural Science. Since
1994, Rimmer has been directing field studies to
assess the distribution, habitat use, and conservation
status of Bicknell's Thrush (Catharus bicknelli) in
the Dominican Republic. This bird exemplifies the
special threats facing a species with a limited habi-
tat, both in its breeding and its wintering range, and
which place it high on the endangered species list.
Other current activities include the continued
work of James Wiley, visiting sites first studied 30
years ago for various species and also Alexander
Cruz who is working with Village Weavers
(Ploceus cucullatus) and Shiny cowbirds
(Molothrus bonariensis).
The Peregrine Fund has begun work to determine
the status of Ridgway's Hawk (Buteo ridgwayi).
Following Wiley's earlier reports, and with exten-
sive bush-whacking in Los Haitises, the team dis-
covered eight nesting pairs in 2002. This work will
be continuing, with Eladio Fernandez providing fol-
low-up and photographic records.
The Comell Laboratory of Biodiversity, which
opened last summer in the eastern Dominican Re-
public, will also be proving research opportunities.
The main focus of professors and students there is
chemical analysis of plants used by birds, as well as
by humans. David Rosane is focusing on the chem-
istry of the uropygial gland secretions of birds and
the effect on avian parasites and fungi.

MONITORING
Latta and Rimmer have been instrumental in es-
tablishing in the Dominican Republic one of the
only long-term constant-effort mist-netting projects
in the Caribbean to monitor migrants and resident
species. Using a phased approach, 12 long-term
sites have been established in three areas of the
country. Paid field workers and volunteers will as-
sist at each site. Data will be deposited at Fundaci6n
Moscoso Puello, with VINS proving oversight and
guidance of data management. Once again, it is im-
portant to mention that the training of local field
assistants makes it possible to place the main re-
sponsibility for this project in the hands of Domini-
cans.
In addition, the Latta-Rimmer team has launched


a study of demographics and breeding biology of
resident birds, a group that is seriously under-
studied. The three-year study involves eight sites in
the Sierra de Bahoruco, in which nests of all breed-
ing species will be closely monitored to determine
local reproductive success and estimate survival
rates.
Ducks Unlimited is sponsoring a waterfowl sur-
vey in the Dominican Republic, where population
information is sadly out of date. It is too early to
report long-term trends, although it is already possi-
ble to make comparisons of waterfowl populations
between a wet and dry year.
The shorebird site at Salinas near Bani has been
one of our favorite day trips. As a result we have
expanded the list of birds known to occur there. A
member of the staff in the Coastal Resources Office
of the Department of Natural Resources is preparing
a guide that will incorporate our information.
I attended the seabird workshop in Puerto Rico,
organized by the Society for the Conservation and
Study of Caribbean Birds, and hope to be able to
obtain support for surveys in future breeding sea-
sons at the main colonies in the northern and south-
western comers of the country.

CONSERVATION
In a world-wide assessment of bird protection
priorities, Hispaniola ranks high in biological im-
portance and its contribution to global biodiversity.
Recent estimates, however, place forest loss at
greater than 90% in the last 20 years. Heavy pres-
sure from logging, charcoal production, grazing,
and subsistence farming continues. Conservation is
not a well-accepted concept in the country, because
of the demands of poverty and a serious lack of edu-
cation.
Our group has worked in communities associated
with national parks in an effort to expand awareness
of the importance of birds. In April 1998, we organ-
ized a ground-breaking national workshop on avian
conservation in an effort to gather together the vari-
ous groups with interest or responsibility in this
area. The meeting was well attended and important-
contacts were made. Follow up, however, has not
been noticeable, in part because of the changing cast
of characters in government agencies.
We also hosted the annual meeting for the Society
for the Conservation and Study of Caribbean Birds
in 1999. This was another opportunity to demon-
strate to groups here that the Dominican Republic


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Page 60









WALLACE AVIAN RESEARCH, MONITORING, AND CONSERVATION IN THE DOMNICAN REPUBLIC


has a special place in the world of ornithology.
PUBLICATIONS
Publications are seriously lacking in the Domini-
can Republic. The excellent books of Annabelle
Dod are out of print.
At the moment, however, several publications are
in the works. We produced a book of photographs
of 60 common birds. This is designed as an intro-
duction for Dominicans and visitors.
The Latta-Rimmer team is working on a complete
field guide. With the encouragement of Herbert
Raffaele and his co-authors, and the use of the illus-
trations and whatever information is appropriate
from their guide, the book will include all the birds


of the island. New illustrations of all the endemics
are being prepared by Canadian artist Barry Mac-
Kay. There will be English and Spanish editions.
Another book, which will be a wonderful re-
source, is an annotated check-list, prepared by Allan
Keith and colleagues.
We have recently incorporated as the Sociedad
Ornitologica de la Hispaniola and have signed an
agreement with the Fundacion Moscoso Puello.
This organization will provide guidance and also
serve as the location of our database.
We hope this will enable us to take a more active
role in conservation.


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Page 61











BIRDLIFE JAMAICA INFLUENCING CONSERVATION IN JAMAICA


CATHERINE LEVY1 AND SUZANNE DAVIS2
12 Starlight Avenue, Kingston 6, Jamaica; and 2Natural History
Division, Institute of Jamaica, 10-16 East Street, Kingston, Jamaica


Abstract.-The origins of the BirdLife Jamaica can be traced to the early days of the Natural History Soci-
ety of Jamaica, then headquartered in the Natural History Division, Institute of Jamaica. Over the years, the
growing importance of and urgency for conservation pointed to the need for more active involvement at na-
tional and regional levels. At annual meetings of the Society of Caribbean Ornithology (now the Society for
the Conservation and Study of Caribbean Birds) in the 1980s and 1990s, exposure to North American biolo-
gists (many with experience in the Caribbean) and to funding institutions led to useful information and contacts
for young Jamaicans. In 1993, the Environmental Foundation of Jamaica helped to fund the organization's first
field project and has been a supporter ever since. With great encouragement and support from BirdLife Inter-
national (formerly ICBP), BirdLife Jamaica made strides in structure that led to its development as a national
organization with a clear mission and stated objectives. Through its publications, its involvement in developing
an interest in bird ecology in students at the University of the West Indies, its outreach activities for schools
and community groups, and its membership activities, BirdLife Jamaica has gained recognition as a national
society for Jamaican birds and their habitats. Here we report on the major contributions of BirdLife Jamaica in
promoting bird and habitat conservation, education, field research, and advocacy.
Key words: BirdLife Jamaica, Conservation, education, Jamaica
Resumen.-BIRDLIFE JAMAICA INFLUYENDO EN LA CONSERVACION EN JAMAICA. Los origenes de la
organizaci6n se remontan a los albores de la Sociedad de Historia Natural de Jamaica, para aquel entonces con
sede en la Division de Historia Natural, Instituto de Jamaica. A lo largo de los afios, la creciente importancia y
urgencia de la conservaci6n sefialaron la necesidad de una participaci6n mias activa a niveles nacionales y re-
gionales. En las reuniones anuales de la Sociedad de Omitologia Caribefia (ahora la Sociedad para la Conser-
vaci6n y el Estudio de las Aves Caribefias) en las d6cadas de 1980 y 1990, el contacto de j6venes jamaicanos
con biologos norteamericanos (muchos con experiencia en el Caribe) e instituciones de financiamiento produjo
informaci6n util y contactos. En 1993, la Fundaci6n Ambiental de Jamaica (Environmental Foundation of Ja-
maica) ayud6 a financiar el primer proyecto de la organizaci6n y desde entonces ha sido un colaborador. Con
gran estimulo y ayuda de BirdLife International (antes ICBP), BirdLife Jamaica mejor6 su estructura y esto
result en su desarrollo como organizaci6n nacional con una misi6n clara y objetivos declarados. Por sus pu-
blicaciones, sus esfuerzos para desarrollar el interns en ecologia aviar en los estudiantes de la Universidad de
las Indias Occidentales, sus actividades de sensibilizaci6n con escuelas y grupos comunitarios y sus activida-
des para socios, BirdLife Jamaica ha sido reconocida como la principal organizaci6n nacional trabajando con
las aves jamaicanas y sus habitats. Reportamos sobre las contribuciones principales de BirdLife Jamaica en las
areas de conservaci6n de aves y habitats, educaci6n, investigaciones de campo, y promoci6n y defensa public.
Palabras clave: BirdLife Jamaica, conservaci6n, educaci6n, Jamaica
Resume.- BIRDLIFE JAMAICA INFLUENCER LA CONSERVATION EN JAMAIQUE. L'origine de l'organisa-
tion peut etre remont6e aux premiers jours de la Societe d'Histoire Naturelle de Jamaique, alors localis6e dans
la Division d'Histoire Naturelle, Institut de Jamaique. Au cours des ans, l'importance croissante et l'urgence
des questions de protection ont montr6 le besoin d'implication plus active aux niveaux national et regional. Les
confrontations aux biologistes nord-americains (dont beaucoup avec une experience carib6enne) lors des mee-
tings annuels de la Societe Carib6enne d'Ornithologie (d6sormais Association pour l'Etude et la Protection des
Oiseaux de la Caraibe) et aux agences de financements dans les ann6es 1980 et 1990 ont permis d'obtenir des
informations utiles et de d6velopper des contacts pour les jeunes jamaicains. En 1993, la Fondation Jamaicaine
pour l'Environnement a aide a financer le premier projet de l'organisation et n'a pas arret6 depuis. Avec l'aide
d'un fort encouragement et soutien de BirdLife International (anciennement ICBP), BirdLife Jamaica a 6volu6
dans sa structure permettant son d6veloppement comme une organisation national avec une mission claire et
des objectifs d6finis. Par ses publications, son implication dans le d6veloppement d'une emulation dans l'eco-
logie des oiseaux chez les 6tudiants de l'University of the West Indies, ses activities continues vers les 6coles et
les communaut6s et ses activities associatives, BirdLife Jamaica a gagn6 une reconnaissance comme une socie-
te nationale pour les oiseaux de Jamaique et leurs habitats. Nous montrons ici les apports majeurs de BirdLife
Jamaica pour favoriser la protection des oiseaux et des habitats ainsi que l'education, la recherche applique et
leur publicite.
Mots-clks: BirdLife Jamaica, Protection, education, Jamaique


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Page 62









LEVY & DAVIS BIRDLIFE JAMAICA -INFLUENCING CONSERVATION IN JAMAICA


Table 1. Landmark publications concerning Jamaican birds, their habitats, and conservation, 1847-2000.


Category


Date


Author(s)


Ornithology and
natural history
Field guide
Natural history



Legislation
Natural history
Natural history
Journal

Natural history
Field guide


Guide


Bibliography


1847

1936
1947-1957
(suspended with
a brief run in the
1980s)
1945
1955
1956
1963 to present

1976
1990


1998

2000


P. H. Gosse, assisted by Richard Hill

J. Bond
Natural History Society of Jamaica



Government of Jamaica
Lady Taylor
M. Jeffrey-Smith
Gosse Bird Club
(later renamed BirdLife Jamaica)
D. Lack
A. Downer and R. Sutton

H. Raffaele, J. Wiley, 0. Garrido,
A. Keith, and J. Raffaele
J. Wiley


The birds of Jamaica

Birds of the West Indies (1st ed.)
Natural History Notes



Wild Life Protection Act
An introduction to the birds of Jamaica
Bird-watching in Jamaica
Broadsheet

Island biology
Photographic field guide to the birds of
Jamaica
A guide to the birds of the West Indies

A bibliography of ornithology in the
West Indies


JAMAICA'S BIRDS are of global significance with
30 endemic species, the highest number of endemic
bird species for any Caribbean island (Stattersfield
1998). Three of these endemic species are listed
among the critically endangered birds of the world
according to the IUCN Red List Criteria (BirdLife
International 2000). Furthermore, many Neotropical
migrants over-winter on the island or use it as a
stopover site, with five warblers whose entire popu-
lations either pass through or spend the winter in the
West Indies reported from Jamaica. Although the
island is generally mountainous, a diversity of habi-
tats exists for the roughly 250 species of native and
migrant birds. There are offshore cays, beaches,
mangrove wetlands and marshes, wet and dry for-
ests at various altitudes, agricultural lands, and ur-
ban areas.
The conservation needs of Jamaican birds began
receiving recognition in the 1930s (Bond 1936).
Although large-scale degradation of natural habitats
occurred since the arrival of Europeans, various fac-
tors have contributed to an alarming increase in loss
in the post-World War II period. These factors in-
clude population growth and urban drift, greater
access to machinery and expansion of housing, tour-


ism, and agriculture. Of particular interest is forest
destruction and degradation because forests support
many endemic Jamaican birds as well as several
Neotropical migrants (Davis 1998). The growing
importance and urgency of questions such as "What
bird species and habitats in Jamaica need conserva-
tion?" and "What kind of protection is required?"
inevitably increased the demand for reliable infor-
mation on Jamaican birds.
Several major publications and documents, dating
from as far back as the 1800s until the present time
(Table 1), serve as indicators of knowledge and
growing conservation awareness concerning Jamai-
can birds.
Philip Henry Gosse, a British naturalist, made an
outstanding contribution to Jamaican ornithology
with his book The birds of Jamaica. Publications
during the second half of the 1800s revealed exploi-
tation of wildlife for monetary and sporting value
(Davis 1996). Nearly a century later, James Bond
expressed concern that rare West Indian birds were
in danger of extinction (Bond 1985). This was of
particular relevance to Jamaica because by the early
1900s, two endemic species, Jamaican Petrel
(Pterodroma caribbaea) and Jamaican Pauraque


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Page 63









LEVY & DAVIS -BIRDLIFE JAMAICA -INFLUENCING CONSERVATION IN JAMAICA


Table 2. Summary of technical support provided by BirdLife Jamaica.


Technical support


Specific activity and output


Field training


Technical workshops


Educational workshops
and presentations


Production and distribu-
tion of educational
resource material





Documentation


Bird identification




Bird banding


National Workshop on the Cockpit
Country (1998)
National Workshop for the Important
Bird Areas (IBA) Program (2001)
Training of educators workshop
Bird identification and conservation
awareness presentations

Production of A teacher's guide to the
birds of Jamaica, the birds of Jamaica -
a celebration, as well as accompanying
posters
Distribution of Society of Caribbean
Ornithology's West Indian Whistling-
Duck Conservation Project material
Initiating a database of bird specimen
records
Contribution of information to reports,
meeting, workshops


South Trelawny Environmental
Agency (STEA), Blue & John Crow
Mountains National Park (BJCMNP), un-
der graduate and postgraduate students of
University of the West Indies (UWI)
Mason River Game Sanctuary, STEA,
BJCMNP, undergraduate and post-
graduate students of UWI
Environmental professionals and the
general public
Partners in the IBA Programme

Environmental educators island-wide
BJCMNP, several community-based
organizations, and schools island-
wide
Environmental educators and schools
island-wide, general public






Natural History Division of Institute
of Jamaica and BirdLife Jamaica
Parks in Peril Project Cockpit Coun-
try, National Environment and Plan
ning Agency


(Siphonorhis americanus), were presumed extinct.
Bond noted that parrots were at special risk and also
pointed out the lack of research on the life history of
endemic species.
The need for (1) greater appreciation of Jamaica's
unique wildlife, (2) protection of endangered spe-
cies, and (3) more research on the biology and ecol-
ogy of Jamaican birds began to be addressed by lo-
cals through the Natural History Society of Jamaica
(NHSJ) and published Notes. The NHSJ was estab-
lished in 1941 by staff of the Natural History Divi-
sion of the Institute of Jamaica as a non-government
group that provided a forum for dialogue on Jamai-
can wildlife and its natural history.
Undoubtedly, the passing of the Wildlife Protec-
tion Act in 1945 motivated further interest in con-
servation with respect to birds. All birds were de-
clared protected with the exception of


"domesticated" species. Unfortunately, some en-
demic species and subspecies (e.g., Jamaican Crow
Corvus jamaicensis, Ring-tailed Pigeon Columba
caribaea, and Olive-throated Parakeet Aratinga
nana nana), as well as other doves, hawks, and mi-
gratory ducks, were also excluded from protection.
Unprotected species were vulnerable to hunting and
collecting pressure, although bird shooting was
regulated through the designation of game birds and
the establishment of game sanctuaries. In 1960, the
Act was amended to address regulations for bird-
shooting seasons. Eventually, hunters' licenses and
reports on harvest became mandatory for bird-
shooting seasons. Since then, the Wildlife Protec-
tion Act of 1945 has been periodically revised and
all native Jamaican species are now legally pro-
tected. Unfortunately, a major deficiency of the Act
is that it does not address protection of habitat of
wildlife (Levy 1996).


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Beneficiary


Page 64









LEVY & DAVIS -BIRDLIFE JAMAICA -INFLUENCING CONSERVATION IN JAMAICA


Table 3. Number of field projects facilitated or adminis-
tered by BirdLife Jamaica, 1994-2002.


Source of funding

Local1 Local + overseas Overseas2


No. of projects


1Local= Environmental Foundation of Jamaica.
2Overseas includes National Fish & Wildlife Foundation and
American Bird Conservancy.


By the mid-1950s, public support was being
sought for the protection of Jamaica's birds through
May Jeffrey-Smith's Bird-watching in Jamaica and
articles in the daily newspaper by Lisa Salmon. Jef-
frey-Smith dedicated her book "... to the Jamaican
public in the hope that it will stimulate keener ap-
preciation .... and arouse desire to preserve birds,
..." (Jeffrey-Smith 1956). It was Jeffrey-Smith, an
active member of the NHSJ and an avid birdwatcher
who, together with Anna Black, conceived the idea
of the Gosse Bird Club (1996). They envisioned a
local organization dedicated to the knowledge and
conservation of Jamaican birds. Shortly after, the
Gosse Bird Club (GBC) began printing the Broad-
sheet, a biannual publication for the exchange of
information on Jamaican birds. Both the GBC and
the Broadsheet have survived 40 years with the or-
ganization being renamed "BirdLife Jamaica" in
1998.
The Broadsheet initially served as a medium for
reporting bird observations, educational articles,
club reports, and notices. It has grown, however, to
include research news, articles, and book reviews. It
has proven to be a valuable resource in the develop-
ment of three recent publications, namely Birds of
Jamaica a photographic field guide, A guide to
the birds of the West Indies, and A bibliography of
Ornithology of the West Indies. In fact, Jim Wiley
(2000), in his bibliography stated, "By far, the
greatest number of entries (4101; 44.6%) are from
the Gosse Bird Club Broadsheet ..." Furthermore,
submissions to the Broadsheet have formed the ba-
sis of a database on species occurrence and distribu-
tion in Jamaica.
Several Caribbean and mainland scientists
strongly advocated the (1) creation and management
of protected areas and national parks, (2) regulation
of poaching and trade in wildlife, (3) further regula-
tion of bird-shooting, and (4) greater promotion and
facilitation of field research (Davis 1998). David


Lack (1976) was one of the first to emphasize con-
servation of habitat, in particular Jamaican forests.
BirdLife Jamaica has been instrumental in the ad-
vancement of habitat protection, stronger regula-
tions, and increased research on Jamaican birds
through its education, advocacy, and field research
programs and activities. This paper will only allow
for highlights to be presented on the major contribu-
tions to bird conservation in Jamaica.
As a non-government organization relying pri-
marily on volunteer effort, BirdLife Jamaica does
not have the institutional capacity to manage habitat
or protected areas. Technical support, however, has
been provided to a national park, environmental
non-government organizations, and the University
of the West Indies in the form of (1) field training,
(2) educational and technical workshops, (3) pro-
duction and distribution of educational resource ma-
terial, and (4) documentation of scientific data and
information (Table 2).
Before the establishment of protected areas, some
sport shooting clubs were actively managing private
properties by maintaining woodlands or vegetation
that would attract birds (Levy 1996). While encour-
aging protection of habitat for birds, BirdLife Ja-
maica has lobbied consistently for adequate bird-
shooting policies and adherence to hunting regula-
tions through its representation on the Game Bird
Committee of the National Environment and Plan-
ning Agency (NEPA). Currently, collaborative ef-
fort is maintained among BirdLife Jamaica, NEPA,
and the University of the West Indies for research
projects on game birds (columbids) and migratory
duck surveys.
With regard to improved legislation to support
conservation in Jamaica, BirdLife Jamaica has par-
ticipated in reviews of the Wildlife Protection Act.
Suggestions made include:
* Establishing categories of species: "at risk,"
"vulnerable," and "endangered."
Review of the "all birds protected" policy for
alien species such as the Shiny Cowbird
(Molothrus bonariensis) and birds in captivity
(Levy 1996).
BirdLife Jamaica also helped prepare local legisla-
tion for, and serves on, the Convention on Interna-
tional Trade & Endangered Species Committee that
advises NEPA on issues and requests concerning
external and internal trade in endangered flora and
fauna.
Within the last 10 years, BirdLife Jamaica has
evolved as an organization with the capacity for


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Page 65









LEVY & DAVIS -BIRDLIFE JAMAICA -INFLUENCING CONSERVATION IN JAMAICA


supporting and implementing field research. In ad-
dition to providing technical assistance to under-
graduate and postgraduate students at the University
of the West Indies, BirdLife Jamaica has success-
fully attracted both local and overseas funding. Op-
portunities for overseas funding have been greatly
facilitated by making contacts with researchers and
funders at annual meetings of the Society for the
Conservation and Study of Caribbean Birds. To
date, BirdLife Jamaica has facilitated or adminis-
tered six projects related to birds and their habitats
(Table 3).
As a member of the BirdLife International Part-
nership, BirdLife Jamaica is currently conducting
the Important Bird Areas (IBA) Program in Ja-
maica. Through field research and national collabo-
ration, sites that meet international IBA criteria will
be identified. BirdLife Jamaica is seeking to
strengthen its influence on conservation in Jamaica
by advocating on-the-ground conservation for the
IBA sites by the relevant authorities. It is expected
that the promotion of community participation in
the development of bird management plans will fur-
ther national efforts at protecting habitats that are of
critical importance to birds and wildlife in general
(BirdLife Jamaica 2001).
Outlines of Bird Research Projects are docu-
mented in El Pitirre (Vol. 11:70 [1998]; Vol. 14:97
[2001]).

LITERATURE CITED
BIRDLIFE INTERNATIONAL. 2000. Threatened birds
of the world. Barcelona, Spain: Lynx Edicions.


BIRDLIFE JAMAICA. 2001. The Important Bird Ar-
eas Programme in Jamaica. BirdLife Jamaica.
Gosse Bird Club Broadsheet 77 & 78:9.
BOND, J. 1936. Birds of the West Indies, 1st ed.
London: Collins.
BOND, J. 1985. Birds of the West Indies, 5th ed.
London: Collins.
DAVIS, S. 1996. Food for thought or birdseed.
Gosse Bird Club Broadsheet 66:16.
DAVIS, S. 1998. Bird communities in the upper Rio
Grande Valley: effects of forest loss and degrada-
tion in a buffer zone of the Blue & John Crow
Mountains National Park. (M. Phil. thesis). Dept.
of Life Sciences, Faculty of Pure & Applied Sci-
ences, Univ. West Indies, Mona.
GOSSE BIRD CLUB. 1996. Citations 1996 May
Jeffrey-Smith, Anna Black. Gosse Bird Club
Broadsheet 66:2-3.
JEFFREY-SMITH, M. 1956. Bird-watching in Ja-
maica. Kingston, Jamaica: Pioneer Press.
LACK, D. 1976. Island biology illustrated by the
land birds of Jamaica. Studies in Ecology, Vol. 3.
Oxford, UK: Blackwell Sci. Publ.
LEVY, C. 1996. Patoos, potoos and others. Gosse
Bird Club Broadsheet 67:4.
STATTERSFIELD, A. J., M. J. CROSBY, AND D. C.
WEGE. 1998. Endemic bird areas of the world:
priorities for biodiversity conservation. Cam-
bridge, UK: BirdLife International.
WILEY, J. 2000. A bibliography of ornithology in
the West Indies. Proc. West. Found. Vert. Zool. 7.


Special Issuing Honoring Nedra Klein


Page 66


Journal of Caribbean Ornithology












ORNITHOLOGICAL RESEARCH AND CONSERVATION EFFORTS IN PUERTO RICO

ADRIANNE G. TOSSAS
Puerto Rican Ornithological Society, Alt. de Mayagiiez, 713 Yunque,
Mayagiiez, PR 00682-6234; e-mail: agtossas@caribe.net


Abstract.-Previous to the 1970s, ornithological work in the Puerto Rico was limited to observations and col-
lections done by visiting or resident ornithologists, naturalists, and hunters. However, a different approach began
in the 1970s when projects were designed for research and conservation purposes. In this overview, I focus on the
work currently conducted in Puerto Rico by government (i.e., State and United States) agencies, universities, and
non-governmental organizations (NGOs). Even though Puerto Rico's Department of Natural and Environmental
Resources plays the main role monitoring bird populations, it also works with universities and United States
agencies, such as Fish and Wildlife Service and Forest Service. Local and United States universities have gradu-
ate students developing thesis work in avian ecology throughout the island. Moreover, several long-term research
projects provide important data on the ecology of resident species and Neotropical migrants. A local NGO, the
Puerto Rican Ornithological Society, is active in inventorying shorebird populations and designating important
bird areas. Despite the knowledge about the Puerto Rican avifauna, however, little is known about the breeding
biology of many resident species, particularly endemics. The major threats to the local avifauna are fragmentation
and habitat loss because of the demands of a sprawling human population.
Key words: bird conservation, Puerto Rican Ornithological Society, Puerto Rico
Resumen.-INVESTIGACION ORNITOLOGICA Y ESFUERZOS DE CONSERVACION EN PUERTO RIco. Previo a la
decada de 1970, el trabajo omitol6gico en Puerto Rico se limit a observaciones y colecciones hechas por omito-
logos visitantes o residentes, naturalistas y cazadores. Sin embargo, un acercamiento diferente comenz6 en la de-
cada de 1970 cuando se disefiaron proyectos con prop6sitos de investigaci6n y conservaci6n. En este inventario
enfatizo el trabajo llevado a cabo actualmente en Puerto Rico por agencias de gobierno (del Estado Libre Asocia-
do de Puerto Rico y del gobierno federal de Estados Unidos), universidades y organizaciones no gubernamentales
(ONG). Aunque el Departamento de Recursos Naturales y Ambientales de Puerto Rico juega el rol principal en el
monitoreo de las poblaciones de aves, tambi6n trabaja con universidades de los Estados Unidos continentales y
agencias federales como el Servicio de Pesca y Vida Silvestre y el Servicio Forestal. Universidades locales y del
continente tienen estudiantes graduados desarrollando trabajos de tesis en ecologia de aves a trav6s de la isla.
Ademas, varios estudios de investigaci6n a largo plazo proveen datos importantes sobre la ecologia de especies
residentes y de migrantes neotropicales. Una ONG local, la Sociedad Omitol6gica Puertorriquefia, esta activa
inventariando las poblaciones de limicolas y designando areas importantes para las aves. Sin embargo, a pesar del
conocimiento de la avifauna puertorriquefia, se conoce poco sobre la biologia reproductiva de muchas especies
residentes, en particular las end6micas. Las mayores amenazas a la avifauna local son la fragmentaci6n y la p6rdi-
da de habitat debido a las demandas de una desparramada poblaci6n humana.
Palabras clave: conservaci6n de aves, Puerto Rico, Sociedad Ornitol6gica Puertorriquefia
Resume.-RECHERCHE EN ORNITHOLOGIE ET EFFORTS DE CONSERVATION A PORTO RICO. Porto Rico est
l'habitat de 354 especes d'oiseaux. Avant 1970, les 6tudes sur l'ile 6taient limitees aux observations et collectes
faites par des omithologues visiteurs ou residents, des naturalistes et des chasseurs. Cependant, une approche
nouvelle d6buta dans les annees 1970 quand des projets ont ete d6velopp6s dans un but de recherche et de conser-
vation. Dans cet apergu, je me contrerai sur le travail conduit actuellement par les agences gouvernementales
(c'est-a-dire au niveau de l'Etat et des Etats-Unis), les universities et les ONG. Meme si le d6partement des res-
sources naturelles et environnementales de Porto Rico joue le role principal de suivi des populations d'oiseaux, il
travaille aussi avec les universities et les agences d'Etat, comme le Fish and Widlife Service et le Forest Service.
Les universities locales et des Etats-Unis foment des 6tudiants pr6parant des theses sur l'ecologie des oiseaux a
travers 'ile. De plus, plusieurs 6tudes a long terme fournissent des donn6es importantes sur l'ecologie des espe-
ces residents et des migrants neotropicaux. Une ONG locale, La Societe d'Ornmithologie de Porto Rico, est active
dans les inventaires des populations d'oiseaux de bord de mer et dans l'identification des zones importantes pour
les oiseaux. Toutefois, malgre la connaissance de l'avifaune de Porto Rico, la biologie de la reproduction de nom-
breuses especes r6sidentes est peu connue, en particulier en ce qui concerne les endemiques. Les menaces les plus
importantes pesant sur l'avifaune locale sont la fragmentation et la disparition des habitats dues aux demandes
d'une population humaine croissante.
Mots-clks: Conservation des oiseaux, SociOte d'Ornithologie de Porto Rico, Porto Rico


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Page 67









TOSSAS ORNITHOLOGICAL RESEARCH AND CONSERVATION IN PUERTO RICO


INTRODUCTION
BEFORE THE 1970s, ornithological work in Puerto
Rico was limited to collections, observations, and
descriptions by visiting or resident ornithologists,
naturalists, and hunters (Wiley 1996). However, a
different approach began in the 1970s, when pro-
jects were designed for research and conservation
purposes. The extensive knowledge acquired since
then makes the Puerto Rican avifauna one of the
best studied in the Caribbean region. In this over-
view I focus on the work currently conducted in the
island by ornithologists in government (i.e., State
and United States) agencies, universities, and non-
governmental organizations (NGOs).

GOVERNMENT AGENCIES ENGAGED
IN ORNITHOLOGICAL RESEARCH
Puerto Rico's Department of Natural and Environ-
mental Resources
Puerto Rico's Department of Natural and Envi-
ronmental Resources (DNER) is the State agency
responsible for the conservation of the island's bio-
diversity. It is in charge of monitoring bird popula-
tions in nature reserves and throughout the island.
Among its projects are the following:
Puerto Rican Parrot project.-The Puerto Ri-
can Parrot (Amazona vittata) is one of the most en-
dangered species in the Caribbean, with only about
150 extant individuals. The US Fish and Wildlife
Service (USFWS), in collaboration with the DNER
and US Forest Service, started a captive breeding
project in the early 1970s in the Luquillo Mountains
to increase progeny for future release and as a ge-
netic reserve (Snyder et al. 1987). The DNER estab-
lished a second captive population in Rio Abajo
State Forest in the north-central region of the island.
Yellow-shouldered Blackbird recovery pro-
ject.-By the 1970-80s, Shiny Cowbirds (Molo-
thrus bonariensis) were reported to parasitize 95%
of the endemic Yellow-shouldered Blackbird
(Agelaius xanthomus) nests (Wiley 1985, Wiley et
al. 1991). A recovery project was begun to improve
the blackbird's reproductive success through man-
agement and thus avoid further population declines.
Artificial nest structures are monitored to protect
blackbirds from nest predators and nest parasites, as
well as controlling the Shiny Cowbird population in
the nesting area.
Gap Analysis.-DNER, along with personnel
from North Carolina State University, the Interna-
tional Institute of Tropical Forestry, USFWS, and


US Geological Survey, collaborate in an island-
wide inventory of the flora and fauna, including
birds. This project, named the Gap Analysis, will
produce a series of maps showing species distribu-
tion. One of the goals of this project is to predict the
presence of the species according to the characteris-
tics of the habitat occupied.
Columbid surveys.-The DNER surveys colum-
bid populations along 101 routes throughout the
island to study their status, distribution, and abun-
dance. Species included in the surveys are Scaly-
naped Pigeon (Columba squamosa), Zenaida Dove
(Zenaida aurita), White-winged Dove (Z. asiatica),
Mourning Dove (Z. macroura), White-crowned Pi-
geon (Columba leucocephala), Plain Pigeon (C.
inornata), Common Ground-Dove (Columbina
passerina), Ruddy Quail-Dove (Geotrygon mon-
tana), Key West Quail-Dove (G. chrysia), and Bri-
dled Quail-Dove (G. mystacea). Emphasis is on the
first four species because they are legally hunted,
and in the White-crowned Pigeon which has sharply
declined in the island (Wiley 1979, Bonilla 2001).
Waterfowl surveys.-Since 1990 DNER staff
annually conduct aerial counts of waterfowl in 14 of
the island's major ponds. The purpose of the counts
is to survey the populations of migratory duck spe-
cies that are hunted in the island (Departamento de
Recursos Naturales y Ambientales 2001).

US Fish and Wildlife Service
Biologists of the US Fish and Wildlife Service
survey seabird populations throughout the island
and surrounding islets and cays (J. Saliva, pers.
comm.). Species surveyed include the Masked
Booby (Sula dactylatra), Red-footed Booby (S.
sula), Magnificent Frigatebird (Fregata magnifi-
cens), Brown Pelican (Pelecanus occidentalis),
Red-billed Tropicbird (Phaethon aethereus), White-
tailed Tropicbird (P. lepturus), Roseate Tern
(Sterna dougallii), Sandwich Tern (S. sandvicensis),
Least Tern (S. antillarum), Sooty Tern (S. fuscata),
and Brown Noddy (Anous stolidus).
A mist-netting project was started in 2001 by Leo-
poldo Miranda and Stephen Earsom to create a data-
set on the diversity and abundance of native and
migratory landbirds in different habitats in Puerto
Rico. They work in six locations, including dry and
moist forest, and a shade coffee plantation. In addi-
tion, Jos6 Col6n surveys shorebird populations and
Rolando Figueroa studies the nesting success of the
Snowy Plover (Charadrius alexandrinus) at the
Cabo Rojo salt flats.


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 68









TOSSAS ORNITHOLOGICAL RESEARCH AND CONSERVATION IN PUERTO RICO


US Forest Service
Research conducted by scientists of the US Forest
Service have provided important knowledge on the
island's avifauna. For instance, Joseph M.
Wunderle's work has shown bird population fluc-
tuations following hurricanes (Wunderle 1995a) and
habitat use segregation by males and females of the
Black-throated Blue Warbler (Dendroica caerules-
cens) while wintering in the island (Wunderle
1995b). His current research interests include the
effects of hurricanes on fruit and seed production,
fruit phenology as related to food resource for birds
in the Luquillo Mountains, studies on the population
biology of the Puerto Rican Parrot, and microhabitat
selection by a nest predator, the Puerto Rican boa
(Epicrates inornatus; J. Wunderle, pers. comm.).
Wayne J. Arendt works on several long-term pro-
jects in Puerto Rico. He assesses bird populations in
the Luquillo Mountains and studies the biology of
the Pearly-eyed Thrasher (Margarops fuscatus).
Results of the thrasher project have provided an in-
sight to the role of dipteran ectoparasites on the
bird's reproductive success. Arendt also works with
colleague John Faaborg, of the University of Mis-
souri, Columbia, on a project monitoring avian
populations in Guinica State Forest (Faaborg et al.
2001; see United States Universities, below).

LOCAL UNIVERSITIES
University of Puerto Rico, Rio Piedras
Students from the University of Puerto Rico
(UPR), Rio Piedras campus, have worked or are
currently working in ornithological research under
the supervision of Robert B. Waide, Joseph
Wunderle, John Thomlinson, and James Wiley.
Theses include work with the Shiny Cowbird
(Nufiez Garcia 1988), the avian community in the
Luquillo Mountains (Pagan 1995), Puerto Rican
Parrot (Thompson Baranello 2000), Bananaquit
(Coereba flaveola; Hernmndez 2002), and Puerto
Rican Vireo (Vireo latimeri; Tossas 2002). At pre-
sent, students work with the consequences and
mechanisms responsible for the habitat segregation
between sexes of the Black-throated Blue Warbler
(E. Vasquez), feeding response of adult Pearly-eyed
Thrashers to nestlings infested with botflies (A.
Toledo), relationship between fruit abundance and
home range size in the Pearly-eyed Thrasher (W.
Beltrin), and bird distribution in fragments within a
urban landscape (M. Suarez).
Moreover, Waide has been directing a mist-
netting project in the Luquillo Mountains since
1989 (Waide 1991). His main interest is in assessing


hurricane effects on native bird populations.

University of Puerto Rico, Humacao
The Department of Biology of UPR, Humacao,
has consistently offered an ornithology course since
1980 taught by Rauil P6rez. P6rez's research interest
deals mainly with the life cycle of endemic birds
and the distribution of exotic species. He also works
on a comparison of the avian community along an
elevational gradient. Enrique Hernindez studies
plant-bird interactions, particularly the ecology of
hummingbirds. He also works on a list of plant spe-
cies that provide fruit or nectar to birds. This list
will be used to make recommendations on species
to be considered in habitat restoration plans.
Hernmndez coordinates the Breeding Bird Surveys
in Puerto Rico.

University of Puerto Rico, Cayey
Carlos Ricart works on a project, originated with
colleague Emilio Font, on the density and diversity
of bird species in dry forest fragments in southwest-
ern Puerto Rico. Along with his students, Ricart is
designing a project on the distribution and seed dis-
persal of mistletoes in Guinica State Forest.

University of Puerto Rico, Mayagilez
Carlos Delannoy has focused his research interest
on the biology and conservation of raptors. His
population surveys of the Puerto Rican Sharp-
shinned Hawk (Accipiter striatus venator) and
Puerto Rican Broad-winged Hawk (Buteo platyp-
terus brunnescens) have helped include these en-
demic subspecies in the list of endangered species.
Students under his supervision have completed
Master's theses dealing with raptors, as well as pas-
serine birds (Rodriguez-Santiago 1988, Rivera Iri-
zarry 1990, Bonilla Martinez 1992, Fernmndez 1993,
Tossas 1995, Jim6nez-Rodriguez 1996). Delannoy's
current students work on Shiny Cowbird effects on
the breeding success of the Yellow Warbler
(Dendroica petechia; M. Vicenty); the abundance,
distribution, and foraging ecology of the Puerto Ri-
can Tody (Todus mexicanus; E. Rodriguez); and the
ecology of the Elfin Woods Warbler (Dendroica
angelae; V. Anad6n). Moreover, Allen Lewis has
led graduate students to complete Masters theses on
subjects ranging from the feeding behavior of
frugivorous birds (Vazquez-Plass 1992) to the ecol-
ogy of the Yellow-shouldered Blackbird (Cruz-
Burgos 1999) and the migratory Semipalmated
Sandpiper (Calidris pusilla) and Western Sandpiper
(Calidris mauri; Rice 1995).


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 69









TOSSAS ORNITHOLOGICAL RESEARCH AND CONSERVATION IN PUERTO RICO


UNITED STATES UNIVERSITIES
University of Nevada
Aaron Shiels completed a Master's degree at the
University of Nevada, with a thesis on the role of
avian seed dispersers in the plant succession process
in landslides (J. Wunderle, pers. comm.).

University of Colorado, Boulder
Tomis Carlo, a Ph.D. student at the University of
Colorado, Boulder, studies how the distribution and
presence of different plant species affect seed dis-
persal patterns by birds.

North Carolina State University
Jaime Collazo directs several projects dealing
with the avian community in the karst region in
north-central Puerto Rico. His research interests in-
clude the abundance and distribution of birds in re-
lation to habitat features in the landscape, and the
demographic and foraging patterns of various spe-
cies. Collazo also works on an improved protocol to
census the wild population of the Puerto Rican Par-
rot, a genetic assessment of the species, the selec-
tion of potential release sites, and estimating the
densities of fruiting trees and the population sizes of
its predators (J. Collazo, pers. comm.).

Mississippi State University
Mississipi State University is actively involved in
ornithological research in Puerto Rico through the
work done by students of Francisco Vilella. The
students' research interests range from the assess-
ment of management practices on waterfowl popu-
lations to the ecology of raptors (F. Vilella, pers.
comm.). Jos6 Cruz constructed impoundments in
lagoons of the Humacao Wildlife Refuge to deter-
mine the diversity, abundance, and activity of wa-
terbirds. Marisel L6pez examined the use of these
lagoons by the West Indian Whistling-Duck
(Dendrocygna arborea), Ruddy Duck (Oxyura ja-
maicensis), and White-cheeked Pintail (Anas ba-
hamensis). Meanwhile, Derek Hengstenberg studies
the movements of the Puerto Rican Broad-winged
Hawk in the karst region to understand habitat use
and selection, and Wyatt Nimitz studies the abun-
dance and distribution of the Red-tailed Hawk
(Buteojamaicensis), a known predator of the Puerto
Rican Parrot, in the Luquillo Mountains.

University of Missouri, Columbia
John Faaborg, along with Wayne Arendt (US For-
est Service), has been monitoring bird populations


in a dry forest in southwestern Puerto Rico since
1972. This long-term effort has provided data on
declines of Neotropical migrants wintering in the
island, as well as the survival and longevity of resi-
dent species (Faaborg et al. 2001).

NON-GOVERNMENTAL ORGANIZATIONS
Puerto Rican Ornithological Society
Field trips and surveys conducted by members of
the Puerto Rican Ornithological Society (PROS)
have provided new records to the list of bird species
in the island. Important observations include rare
sightings such as the Piping Plover (Charadrius
melodus) in three locations since 2001, and evi-
dence of the first breeding attempt of a migratory
species, the Willet (Catoptrophorus semipalmatus),
in Puerto Rico in 2002. Further contributions of the
PROS include monthly shorebird surveys in 13 lo-
cations, and active participation in Christmas Bird
Counts and Breeding Bird Surveys. In 2002 the
PROS joined BirdLife's International's Important
Bird Areas Program. This project will allow a thor-
ough study of the diversity and distribution of bird
species in the island while developing a list of
highly prioritized sites for their conservation.

RESEARCH AND CONSERVATION NEEDS
Despite the numerous studies done with the
Puerto Rican avifauna, little is known about the
breeding biology of many resident species, particu-
larly endemics. The major threats to the local avi-
fauna are the introduction of exotic species, and
fragmentation and habitat loss resulting from the
demands of a sprawling human population. Re-
search needs should emphasize work on the demog-
raphy of endemic species and to determine whether
these parameters are affected by the numerous exot-
ics dwelling in the island. Projects focusing on the
effects of habitat fragmentation on the avifauna and
management plans to restore native forests and wet-
lands are also needed. Moreover, measures to main-
tain sustainable agricultural practices, such as shade
coffee plantations, should be promoted.

ACKNOWLEDGMENTS
Thanks to J. Collazo, F. Vilella, J. Saliva, T.
Carlo, E. Ventosa, L. Miranda, J. Chabert, and J.
Wunderle for providing information about their cur-
rent projects in Puerto Rico, and the Society for the
Conservation and Study of Caribbean Birds for sup-
porting my participation in the Third North Ameri-
can Ornithological Conference.


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 70








TOSSAS -ORNITHOLOGICAL RESEARCH AND CONSERVATION IN PUERTO RICO


LITERATURE CITED
BONILLA MARTINEZ, G. 1992. Biologia reproducti-
va del Mozambique de Puerto Rico. M.S. thesis,
Univ. Puerto Rico, Mayagtiez.
BONILLA, G. 2001. Status, distribuci6n, abundancia
relativa y anidaje de la Paloma Cabeciblanca en
Puerto Rico. Departmento de Recursos Naturales
y Ambientales, Boletin de Caceria 2001:16.
CRUZ-BURGOS, J. A. 1999. Movements, activity
patterns and habitat use of the endangered Yel-
low-shouldered Blackbird, Agelaius xanthomus
xanthomus (Sclater), in southwestern Puerto Rico.
M.S. thesis, Univ. Puerto Rico, Mayagtiez.
DEPARTAMENTO DE RECURSOS NATURALES Y AM-
BIENTALES. 2001. Informe del proyecto de moni-
toreo de las aves de caza. Proyecto W-15. Depart-
mento de Recursos Naturales y Ambientales, Bo-
letin de Caceria 2001:3-12.
FERNANDEZ, J. R. 1993. Observations of the fora-
ging behavior of avian frugivores in a Puerto Ri-
can lower montane wet forest. M.S. thesis, Univ.
Puerto Rico, Mayagiiez.
FAABORG, J., W. J. ARENDT, AND K. M. DUGGER.
2001. The Guinica, Puerto Rico, bird monitoring
project. Bird Populations 5:102-111.
HERNANDEZ, B. 2002. The relationship between
nest density and availability on damage intensity
on covered nests of Bananaquits (Coereba
flaveola). M.S. thesis, Univ. Puerto Rico, Rio Pie-
dras.
JIMENEZ-RODRIGUEZ, L. V. 1996. Expansi6n
geogrdfica del Gorri6n Ingl6s (Passer domesti-
cus) en el oeste de Puerto Rico. M.S. thesis, Univ.
Puerto Rico, Mayagtiez.
NUNEZ-GARCIA, F. 1988. Effects of trapping on the
Shiny Cowbird (Molothrus bonariensis), a brood
parasite, and its hosts in eastern Puerto Rico. M.S.
thesis, Univ. Puerto Rico, Rio Piedras.
PAGAN, M. 1995. Avian distribution and abundance
in relation to habitat variation along an eleva-
tional gradient in the Luquillo Mountains, Puerto
Rico. M.S. thesis, Univ. Puerto Rico, Rio Piedras.
RICE, S. 1995. Residency rates, annual return rates
and population estimates of Semipalmated and
Western Sandpipers at the Cabo Rojo Salt Flats,
Puerto Rico. M.S. thesis, Univ. Puerto Rico, Ma-
yagtiez.
RIVERA IRIZARRY, M. T. 1990. Impacto del parasi-
tismo por Philornis (Neomusca) angustifrons
(Loew) (Diptera: Muscidae) en el crecimiento,
desarrollo y supervivencia de los pichones de
Zorzal Pardo, Margarops fuscatus (Vieillot)


(Passeriformes: Mimidae) en Mayagtiez, Puerto
Rico. M.S. thesis, Univ. Puerto Rico, Mayagtiez.
RODRIGUEZ-SANTIAGO, J. F. 1988. Patrones de fru-
tificaci6n y diseminaci6n por aves en dos espe-
cies de arboles tropicales. M.S. thesis, Univ.
Puerto Rico, Mayagtiez.
SNYDER, N. F. R., J. W. WILEY, AND C. B. KEPLER.
1987. The parrots of Luquillo: natural history and
conservation of the Puerto Rican Parrot. Los An-
geles, CA: Western Foundation of Vertebrate
Zool.
THOMPSON BARANELLO, J. J. 2000. Resource and
population modeling of the Puerto Rican Parrot
(Amazona vittata). M.S. thesis, Univ. Puerto Ri-
co, Rio Piedras.
TOSSAS, A. G. 1995. Nesting site habitat description
and space requirements of the Puerto Rican
Broad-winged Hawk. M.S. thesis, Univ. Puerto
Rico, Mayagtiez.
TOSSAS, A. G. 2002. Demography of the Puerto Ri-
can Vireo in a montane forest, with metapopula-
tion implications. Ph.D. diss., Univ. Puerto Rico,
Rio Piedras.
VAZQUEZ-PLASS, E. 0. 1992. Ecologia alimentaria
de una asamblea de aves frugivoras en un bosque
subtropical hfumedo de Puerto Rico. M.S. thesis,
Univ. Puerto Rico, Mayagtiez.
WAIDE, R. B. 1991. The effect of Hurricane Hugo
on bird populations in the Luquillo Experimental
Forest, Puerto Rico. Biotropica 23:475-480.
WILEY, J. W. 1979. The White-crowned Pigeon in
Puerto Rico: status, distribution, and movements.
J. Wildl. Manage. 43:402-413.
WILEY, J. W. 1985. Shiny Cowbird parasitism in
two avian communities in Puerto Rico. Condor
87:165-176.
WILEY, J. W. 1996. 1996. Ornithology in Puerto
Rico and the Virgin Islands. Pp 149-179 in The
scientific survey of Puerto Rico and the Virgin
Islands: an eighty-year reassessment of the is-
land's natural history (Figueroa Col6n, J. C., Ed.).
Ann. NY Acad. Sci. 776.
WILEY, J. W., W. POST AND A. CRUZ. 1991. Con-
servation of the Yellow-shouldered Blackbird
Agelaius xanthomus, an endangered West Indian
species. Biol. Conserv. 55:119-138.
WUNDERLE, J. M., JR. 1995a. Responses of bird
populations in a Puerto Rican forest to Hurricane
Hugo: the first 18 months. Condor 97:879-896.
WUNDERLE, J. M., JR. 1995b. Population character-
istics of Black-throated Blue Warblers wintering
in three sites on Puerto Rico. Auk 112:931-946.


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 71













THE WEST INDIAN WHISTLING-DUCK AND WETLANDS CONSERVATION PROJECT:
A MODEL FOR SPECIES AND WETLANDS CONSERVATION AND EDUCATION

LISA G. SORENSON1, PATRICIA E. BRADLEY2, AND ANN HAYNES SUTTON3

'Department of Biology, 5 Cummington St., Boston University, Boston, MA 02215, USA; 2PO Box 907 GT,
Grand Cayman, Cayman Islands, BWI, and 3Marshall's Pen, PO Box 58, Mandeville, Jamaica

Abstract.-The West Indian Whistling-Duck Working Group of the Society for the Conservation and Study of
Caribbean Birds seeks to reverse the decline of the globally threatened whistling-duck and the continuing loss of
wetlands throughout the Caribbean. Using our new resource book, Wondrous West Indian wetlands: teachers' re-
source book, and other outreach materials, we hold Wetlands Education Workshops for teachers and natural re-
source personnel to provide them with training and educational tools to raise awareness of and appreciation for the
values of local wetlands. We also promote the development of Watchable Wildlife Ponds, accessible wetlands
which are managed for interpretation to schoolchildren, local residents, and eco-tourists. Responses on evaluations
and a "before and after" wetland quiz show that the workshops are highly effective in changing attitudes and per-
ceptions about wetlands and that participants leave the workshops with the knowledge, skills, and tools they need to
teach and inspire others. Other project outcomes include increased protection for WIWDs and their habitats, stable
and/or increasing populations on several islands, and greater community involvement in wetlands conservation.
Factors contributing to the project's success include strong leadership, thousands of hours of donated work by
many creative and committed individuals, successful fundraising, use of a flagship species, local empowerment,
political involvement, and the regional nature of the project. We thank the many individuals, agencies, and organi-
zations that have provided funding and donated their time and talents to the project.
Key words: Caribbean, Dendrocygna arborea, flagship species, public education and awareness, threatened spe-
cies, West Indian Whistling-Duck, West Indies, wetlands conservation, wetlands education
Resumen.-EL PROYECTO DE CONSERVACION DEL PATO SILBADOR CARIBENO Y LOS HUMEDALES: UN MODELO
PARA LA CONSERVACION Y LA EDUCACION DIRIGIDA A LAS ESPECIES Y LOS HUMEDALES. El grupo de trabajo del
Pato Silbador Caribefio, de la Sociedad para la Conservaci6n y el Estudio de las Aves Caribefias, intenta dar marcha
atras al declive de esta globalmente amenazada ave y la constante p6rdida de humedales a trav6s del Caribe. Usan-
do nuestro nuevo libro Maravillosos humedales de las Indias Occidentales: libro de recursos para maestros
(Wondrous West Indian wetlands: teachers' resource book) y otros recursos de sensibilizaci6n, efectuamos Talleres
de Educaci6n sobre los Humedales (Wetlands Education Workshops) para maestros y personal de recursos natura-
les que les proveen la capacitaci6n y las herramientas educativas necesarias para crear conciencia sobre los valores
de los humedales locales y fomentar su aprecio. Tambi6n promovemos el desarrollo de Charcas donde ver Vida
Silvestre (Watcheable Wildlife Ponds), humedales accesibles que se gestionan para la interpretaci6n dirigida a es-
colares, residentes locales y ecoturistas. Las respuestas obtenidas en evaluaciones y examenes sobre conocimiento
previo y actual indican que los talleres son altamente eficaces en cambiar actitudes y opiniones sobre los humedales
y que los participantes concluyen los talleres con el conocimiento, las habilidades y las herramientas que necesitan
para ensefiar e inspirar a otros. Otros resultados del proyecto incluyen mejoras en la protecci6n del Pato Silbador
Caribefio y su habitat, poblaciones estables o en aumento en varias islas, y mayor participaci6n de la comunidad en
la conservaci6n de los humedales. Los factores que contribuyen al 6xito del proyecto incluyen el liderazgo firme,
las miles de horas de trabajo donadas por muchos individuos creativos y dedicados, la captaci6n de fondos acerta-
da, el uso de una especie bandera, la autogesti6n local, la participaci6n politica, y la naturaleza regional del proyec-
to. Agradecemos los muchos individuos, agencias y organizaciones que han proporcionado financiamiento y/o han
donado su tiempo y talentos al proyecto.
Palabras clave: Caribe, conservaci6n de humedales, Dendrocygna arborea, educaci6n sobre humedales, educa-
ci6n y sensibilizaci6n public, especie bandera, especies amenazadas, Indias Occidentales, Pato Silbador
Caribefo
Resum.--LE DENDROCYGNE DES ANTILLES ET LE PROJET WETLANDS CONSERVATION: UN MODELE POUR LA
CONSERVATION DES ESPECES ET DES ZONES HUMIDES ET POUR EDUCATION. Le groupe de travail sur le Dendro-
cygne des Antilles de l'Association pour la protection et l'etude des oiseaux de la Carafbe cherche a renverser la
tendance au d6clin de cette espece globalement menace ainsi que la perte continue des zones humides a travers la
caraibe. En utilisant notre nouvel ouvrage West Indian wetlands: livre de reference pour les enseignants et d'autres
materials adapts, nous organisons des ateliers de travail d'6ducation sur les zones humides pour les enseignants et
le personnel travaillant sur les ressources naturelles afm de leur foumir les outils d'6ducation et de formation per-
mettant d'augmenter la prise de conscience et la comprehension de la valeur des zones humides locales. Nous sou-


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Page 72









SORENSON METAL. -WEST INDIAN WHISTLING-DUCK AND WETLANDS CONSERVATION PROJECT


tenons aussi le d6veloppement d'Etangs d'observation de la vie sauvage, zones humides accessibles g6rees pour l'ac-
cueil des 6coliers, residents locaux et 6cotouristes. Les reponses aux questionnaires d'6valuation et a un quiz sur les zo-
nes humides montrent que les ateliers sont tres efficace pour changer les perceptions et les attitudes sur
les zones humides et que les participants quittent les ateliers avec les connaissances, comp6tences et les outils utile pour
enseigner ou inspirer le public. Les autres produits du projet concement l'amelioration de la protection du Dendrocygne
des Antilles et des ses habitats, la stabilisation et/ou 1'augmentation des populations sur certaines iles et une plus forte
implication des communaut6s locales dans la conservation des zones humides. Les facteurs de success du projet impli-
quent un fort leadership, des milliers d'heures de travail benevole par de nombreux individus motives et imaginatifs,
l'utilisation r6ussie d'une espece locale embl6matique pour soulever des financements, l'emploi local, l'implication poli-
tique et la nature r6gionale du projet. Nous remercions les nombreuses personnes, agences et organisations qui ont finan-
ce et/ou donned du temps et du talent a ce projet.
Mots-clMs: Antilles, Caraibe, conservation des zones humides, Dendrocygna arborea, Dendrocygne des Antilles, Mdu-
cation et sensibilisation du public, education sur les zones humides, espece drapeau, espkces menacees


INTRODUCTION AND BACKGROUND
RESTRICTED TO THE northern West Indies, the
West Indian Whistling-Duck (WIWD) is among the
rarest ducks in the Americas. The species also has
proved to be an excellent flagship for wetlands con-
servation as the WIWD Working Group of the
Society for the Conservation and Study of Carib-
bean Birds (SCSCB) has demonstrated.
To reverse the decline of the globally threatened
WIWD (BirdLife International 2000) and the con-
tinuing loss of wetlands throughout the region, the
WIWD and Wetlands Conservation Project was
launched in 1997 by the WIWD Working Group of
the SCSCB. With initial funding from the US Fish
and Wildlife Service, Ducks Unlimited Canada, and
the American Bird Conservancy, this region-wide
public education and awareness program provides
local teachers and educators with training and edu-
cational tools and works to raise awareness of and
appreciation for the value of local wetlands. A prin-
ciple product of the project, Wondrous West Indian
wetlands: teachers' resource book (Sutton et al.
2001), is a 276-page teacher's manual containing
comprehensive background information and educa-
tional activities relating to the ecology and conser-
vation of Caribbean wetlands. The book is being
distributed in conjunction with Wetlands Education
Workshops throughout the region. Companion ma-
terials include a WIWD slide show, puppet show,
poster, coloring book, conservation buttons, post-
card, field trip notebook, and a duck identification
card for hunters. Sharing similar outreach and habi-
tat conservation goals, the WIWD Working Group
has now partnered with BirdLife International's
Caribbean-wide conservation program. Working
with BirdLife Partners and local environmental non-
government organizations (NGOs) throughout the
region, the WIWD Working Group continues to de-
velop its programs with funding and in-kind support


from several sponsors (see Acknowledgments).
To date, the project has hosted two-day work-
shops on the use of the new workbook in the Baha-
mas, Cuba, Trinidad and Tobago, Antigua and Bar-
buda, and, most recently, Jamaica. Day one of each
workshop is spent "in the classroom" learning about
wetland ecology, the ways in which wetlands safe-
guard human health and benefit society, the conse-
quences of wetland degradation and destruction, and
alternatives to unsustainable use. Concepts and
teaching-interpretation techniques are conveyed
through presentations and interactive demonstra-
tions, peer-teaching, games, and role-playing activi-
ties (Fig. 1). All of these activities are included in
the teacher's resource book, such that workshop
participants can incorporate the same activities and
approaches in their own classrooms, field trips, or
other public education events. Day two is a field trip
to a local wetland(s) to learn bird and mangrove
identification, and to sample the field activities from
the workbook (e.g., honing of observation skills,


Fig. 1. A musical presentation of "Away with
Waste" (Activity 4-M in Wondrous West Indian wet-
lands ) at the Wetlands Education Workshop in Nassau
(January 2003).


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 73









SORENSON METAL. -WEST INDIAN WHISTLING-DUCK AND WETLANDS CONSERVATION PROJECT


Fig. 2. Birding at sewage lagoons in Greater Port-
more during the wetlands field trip portion of the
Wetlands Education Workshop in Kingston, Ja-
maica (10-11 June 2003).

quadrat sampling, line transects, wetland assess-
ment; Fig. 2). With the Spanish version of the book
now available (July 2003) and a French translation
underway, additional workshops are planned for the
Dominican Republic, Puerto Rico, Cuba, Haiti,
Cayman Islands, Turks and Caicos Islands, US and
British Virgin Islands, and St. Vincent and the
Grenadines. Five "workshop kits" rolling suit-
cases containing all the supplies needed to carry out
the activities in the workbook have been com-
pleted, and four kits have been distributed and are in
use.
Another major activity of the project is the devel-
opment of Watchable Wildlife Ponds, accessible
wetland areas which are managed for interpretation
to schoolchildren, local residents, and eco-tourists.
Watchable Wildlife Ponds serve as centers for wet-
lands education and help to promote the conserva-
tion of wetlands. Large, beautiful, and easy to
watch, West Indian Whistling-Ducks can be prime
attractions at such areas. A demonstration project
has already proved successful in the Cayman Is-
lands. Watchable Wildlife Ponds are under develop-
ment in the Bahamas, Jamaica, Antigua, and the
Dominican Republic.
To identify important wetland habitats for protec-
tion and promote local conservation legislation, sur-
veys of WIWDs are being conducted on several is-
lands, a training workshop on survey and monitor-
ing techniques has been held, and a manual
(standard protocol) for WIWD population monitor-
ing is in preparation.
The project's mission, history, materials, activi-
ties, and workshops have been described in detail in
several previous publications (Sorenson 1997;


Sorenson and Bradley 1998, 2000, 2002; Sorenson
and Carey 1998; Sorenson and Hunter 2002). Here,
we report on project evaluation and outcomes, and
discuss the factors that we believe have contributed
to the project's success.

PROJECT EVALUATION
A total of 502 people has attended 14 two-day
wetlands workshops in six countries; 90 attended
workshops held in the Bahamas and the Dominican
Republic before the publication of Wondrous West
Indian wetlands, whereas 412 have attended 12
workshops held in four countries after the publica-
tion of the book.
We have assessed the quality and effectiveness of
our materials and workshops through evaluations
and a wetlands quiz. Workshop participants are
asked to fill out a detailed evaluation form for both
the classroom and field trip portions of the work-
shop. These evaluations provide us with information
on which aspects of the workshop were most valu-
able and enjoyable, which activities will work best
with students, topics on which participants would
like more information and training, whether the
book and field trip notebook were adequately cov-
ered and easy to use, how the workshops could be
improved, and a rating of the overall quality of the
workshop. This feedback has enabled us to continu-
ally revise and improve the classroom and field trip
agendas and materials.
An overall workshop rating of "excellent" by
most participants, as well as many positive com-
ments, suggests that the book and workshops have
been highly effective in changing attitudes and per-
ceptions about wetlands and increasing awareness
and appreciation of their importance and values.


Fig. 3. One of the rarest ducks in the Americas-West
Indian Whistling-Ducks at the Negril Royal Palm Reserve
in western Jamaica. The female on the left is laying eggs
(note the "pregnant" profile).


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Page 74









SORENSON ETAL. WEST INDIAN WHISTLING-DUCK AND WETLANDS CONSERVATION PROJECT


The workshops also provide participants with the
knowledge, skills, and tools that they need to teach
and inspire others, analyze environmental issues and
make better decisions about wetland use, and lead
and/or participate in grassroots efforts to conserve
local wetlands. Sample comments from our recent
series of workshops in Jamaica (June 2003) and the
Bahamas (January 2003) summarize the views of
many participants:
This wetland workshop was a very interesting experi-
ence for me. Prior to the workshop I viewed wetlands
as murky, stagnant, mosquito-infested areas to be
avoided. Now I am fully aware of their importance to
the environment.
As a facilitator, I shall return to my community a
more knowledgeable person, and better able to dis-
seminate information.
The activities were very interesting and helped tre-
mendously to highlight essential concepts. Activities
would be very suitable for class sessions, especially
pour-a-pond.
Very, very educational workshop and an effective way
to start protecting, managing, and sustaining our wet-
lands.
Workshop participants also complete a two-page
Wetland Quiz they actually complete it twice,
once during the arrival and registration period on
the first day of the workshop and again at the end of
the second day following the field trip. The "before"
quiz provides us with a measure of each partici-
pants' level of knowledge and attitudes and percep-
tions about wetlands before the workshop, enabling
us to adjust what we cover and emphasize over the
two days. The "after" quiz measures what and how
much the participants learned during the two days,
providing us with feedback on how successful we
were at conveying essential concepts and informa-
tion on wetlands. The participant's quiz is anony-
mous (participants put their name-tag number on the
quiz instead of their name) which helps to lessen
test anxiety. To date, all participants have been
good sports about being subjected to this "pop
quiz" (now they know how their students feel!).
An analysis of the quizzes from the Bahamas
workshops (January 2003) showed that participants
significantly increased their knowledge of wetlands
after attending the two-day workshop. Participants
scored an average of 49% correct answers on the
"before" quiz and 79% correct answers on the
"after" quiz (n = 34, t = 10.6, P < 0.0001).
Participants also gain increased confidence in
both communicating wetland concepts and leading
wetland field trips. Before the workshop, 76% said


they were "a bit uncomfortable" or "not comfortable
at all" in communicating wetland concepts, whereas
after the workshop, 3% were uncomfortable, and
97% were "very comfortable" or "fairly comfort-
able." Similarly, before the workshop, 69% said
they were "a bit uncomfortable" or "not comfortable
at all" in leading wetland field trips, whereas after
the workshop, 7% were uncomfortable, and 93%
were "very comfortable" or "fairly comfortable."

PROJECT OUTCOMES
Stable and Increasing WIWD Populations
West Indian Whistling-Ducks rely on freshwater,
brackish, and marine wetlands. Their numbers have
declined throughout the region because of destruc-
tion and degradation of these wetlands and over-
hunting. WIWDs are resilient, however, and have
proved capable of recovering if they and their habi-
tats are protected. Surveys have shown that popula-
tions in the Cayman Islands, Cuba, and Jamaica are
now stable or increasing. For example, WIWD
populations have recovered in the Negril Royal
Palm Reserve in western Jamaica; no ducks were
present during a survey in 1986, but following pro-
tection of the site in the 1990s and enforcement of
hunting laws, the population may now be as many
as 70 individuals (Sutton, unpub. data; Fig. 3).
Increased Species and Habitat Protection
Increased awareness of the duck's globally threat-
ened status resulted in its removal from Cuba's
game bird list in 1997. Surveys documenting the
presence of sizable WIWD populations in the Bi-
rama Swamp and the Rio Maximo Fauna Refuge in



,, ; -;^ " r . --- ,w w tS W


Fig. 4. From the land to the sea teachers try out the
line-transect plant sampling technique during the wet-
lands field trip in Antigua to Great Bird Island (November
2002).


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Page 75









SORENSON METAL. WEST INDIAN WHISTLING-DUCK AND WETLANDS CONSERVATION PROJECT


Cuba contributed to the declaration of these wet-
lands as Ramsar sites (L. Mugica, pers. comm.).
Similarly, surveys in Jamaica's Lower Black River
Morass showing the presence of WIWDs helped in
the decision to designate this wetland as the coun-
try's first Ramsar site.
The development and management of wetlands as
Watchable Wildlife Ponds provides protection of
key wetlands and WIWD populations and encour-
ages long-term sustainable use of wetlands. The
first Watchable Wildlife Pond in the Cayman Is-
lands (Malportas Pond) is a prime tourist attraction.
Several hundred WIWDs are often present with up
to 400 Blue-winged Teal (Anas discors) and 15
other species of waterbirds (ducks, rails, herons, and
waders). A project funded by a United Kingdom
Foreign and Commonwealth Office environmental
fund grant on Little Cayman has allowed the con-
struction of viewing platforms and interpretive signs
on 10 major WIWD pond habitats, which are now
used as educational and tourist resources. Ideal lo-
cations (i.e., accessible wetlands that contain a large
diversity of resident and migratory birds and that
are close to population centers) for the development
of Watchable Wildlife Ponds in the Bahamas, Do-
minican Republic, Jamaica, Haiti, and Antigua have
been identified and plans are underway to begin
work at several of these sites to enhance their value
for education and eco-tourism.
Multiplier Effect
Because children are the future decision-makers
and voting citizens, the project strives to increase
knowledge and awareness of wetland functions and
values especially in children, and instill in them a
sense of caring, pride, and confidence as stewards
of the environment, qualities that they will carry
into adulthood. Activities in the workbook are
geared towards children of all ages and are designed
to spark the imagination and inspire independent
learning. Our strategy of using intensive workshops
to train enthusiastic teachers and environmental
government and NGO personnel, who in turn, will
teach children and train others in the use of the ma-
terials, is the most effective means of reaching a
large number of persons with a conservation mes-
sage.
The Bahamas National Trust (BNT) has begun to
hold its own training workshops for teachers, using
the workshop kit provided by the project. BNT
staff, creators of our Wetlands are Wild puppet
show, have performed the puppet show for over
6000 schoolchildren on several different islands.
The Adventure Learning Centre in New Providence


is using the workbook as the basis of their summer
camp program. In the Cayman Islands, the govern-
ment has appointed M. Keeley as Wetlands Coordi-
nator. He delivers wetland lessons and field trips to
school classes (ages 8 to 11). Lourdes Mugica
Vald6z has organized a network of collaborators
and institutions in seven provinces to implement the
education and awareness program in Cuba; more
than 35,000 people, mainly children, have benefited
and learned from the materials and activities organ-
ized by the program.
The "multiplier effect" is also becoming evident
in Jamaica. Following their attendance at the June
2003 wetland workshops, several agencies and pro-
jects (e.g., Ridge to Reef Watershed Project's Sum-
mer Youth Conference, Institute of Jamaica's Natu-
ral History Division, National Environment and
Planning Agency, and Caribbean Coastal Area
Management Foundation) will use the workbook
and workshop kit for summer camp programs. We
are also working on incorporating the workbook
into school curricula throughout the region. Jamaica
Environmental Trust (JET) has indicated their inter-
est in using a wetlands conservation theme and
Wondrous West Indian wetlands in its 2003-2004
"Schools for the Environment Programme." JET
expects to reach 400 schools and the project will
train teachers in 12 workshops during the coming
school year (Fig. 4).
The distribution of our other project materials (e.
g., slide show, puppet show, duck identification
card for hunters) as well as equipment (e.g., binocu-
lars, slide projectors, video cameras) has further en-
hanced the multiplier effect and outreach efforts of
many local NGOs, agencies, schools, and individu-
als. Articles in local newspapers and other print me-
dia (e.g., Haynes-Sutton 1996, 1998), radio inter-
views, and the SCSCB's Caribbean Endemic Bird
Festival all help to publicize the WIWD's threat-
ened status, and the project's mission to raise
awareness and encourage sustainable wetland use.
The project website (www.whistlingduck.org) is
under development and will provide access to com-
prehensive and downloadable information and
teaching materials on Caribbean wetlands.
Greater Community Involvement in Wetlands Con-
servation
We are beginning to witness the unique ways that
the project can lead to local community empower-
ment and positive change. For example, following
the workshops and wetland field trips for teachers in
Antigua and Barbuda (November 2002), partici-
pants commented on how they have a new apprecia-


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Page 76









SORENSON ETAL. -WEST INDIAN WHISTLING-DUCK AND WETLANDS CONSERVATION PROJECT


tion for the importance of wetlands and that they
will no longer remain silent when a local wetland is
under threat of development (as was the case in the
recent past). Two teachers have initiated a WIWD
survey and monitoring project with their students,
and a local tourist resort operator, upon learning
about the project, jumped at the opportunity to work
with the WIWD Working Group to restore and en-
hance his wetland for birding and nature tourism (i.
e., create a Watchable Wildlife Pond). He has begun
work on this with the local NGO, the Environmental
Awareness Group. Citizens in the Bahamas, Do-
minican Republic, Jamaica, and Haiti will be in-
volved in the development of Watchable Wildlife
Ponds in their communities and will form Wetland
Site Support Groups, volunteers working together to
manage and promote the conservation of their site.
These groups will be networked through BirdLife's
Important Bird Area program.
Festivals involving all the people in a community
are very popular in small towns and rural areas of
the Cuban countryside. They bring the people of a
municipality together to eat, drink, view artwork
and exhibits, buy and sell local handmade crafts,
and socialize. Highly successful WIWD festivals
have already been held in one municipality partici-
pating in the education program. Following the wet-
lands education workshops in these areas, Celebrate
Wetlands! festivals are planned for the communities
in Los Palacios in Pinar del Rio province (near the
rice culture and coastal areas) and the coastal wet-
lands in the south of Sancti Spiritus province. Both
wetlands are important for endemic and migratory
birds and Lourdes Mugica and colleagues are cur-
rently conducting ecological research in these areas.
Both wetlands are also associated with huge rice
plantations; all the water from the culture (including
the chemicals used for the rice) flowing to the wet-
lands. The festivals will be a celebration of the
nearby wetlands upon which the communities de-
pend. They will include wetland tours and bird
walks, a photographic exhibition, talks, t-shirts and
posters about the value of wetlands and their biodi-
versity, and displays of artwork, poetry, stories, and
songs about wetlands by schoolchildren participat-
ing in the program.

FACTORS CONTRIBUTING TO THE
PROJECT'S SUCCESS
Strong Leadership.-Leaders who establish
clearly defined goals and have the ability to moti-
vate and inspire participation have been essential for
project success. The WIWD Working Group co-


chairs (Sorenson and Bradley) and Project Coordi-
nator (Sorenson) have provided strong leadership
and had excellent success at raising funds for the
project. They have also coordinated communica-
tions, liaised with contacts in each Caribbean coun-
try, recruited new participants, and organized pro-
ject activities and materials development, facilitated
workshops, encouraged the island committees, and
kept the network continuously active and motivated.
In-kind Contributions.-Thousands of hours of
work have been donated by Working Group leaders
and members throughout the region in committees,
agencies, and environmental NGOs. These individu-
als, from many nations, are all highly motivated,
talented, and creative people who donate their skills,
talents, time, and gifts to the project. Their knowl-
edge and expertise are reflected in the superb qual-
ity of our outreach materials and workshops.
Successful Fundraising.-Successful proposals
require good writing skills and the ability to present
the objectives and achievements of the group in the
best light, highlighting the project's regional scope
and cooperative nature. We are very grateful to the
agencies that have supported our mission and given
us the opportunity to achieve our project goals. We
have used the substantial amount of in-kind work as
matching funds in some proposals, thereby substan-
tially increasing the amount of funds awarded.
A Unique Caribbean-wide Project.-The project
uses a flagship species, an elegant duck, to which
people can relate, and which is clearly associated
with the ecosystem to be conserved; i.e., a joint spe-
cies-ecosystem approach. As the project has grown
and other countries which do not have the WIWD
have asked to be included, the WIWD Working
Group has shown flexibility in responding to local
needs by moving the focus from WIWD conserva-
tion to wetlands conservation, thus widening the
circle of membership and reaching more people.
Empowerment.-The island committees, where
active, are empowered to take possession of the pro-
ject and own it. They can then expand and modify it
to suit their own local needs and expectations (e.g.,
the Bahamas and Cuba). Wetland workshops con-
tinue to increase this ability by giving teachers ex-
cellent outreach materials and the skills to present
and use them.
Political Involvement.-The project has had most
success in countries where politicians have been
involved in the decision to accept the WIWD Work-
ing Group into the country. Whereas there is an ad-
vantage to politicians in a successful project in


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Page 77









SORENSON METAL. WEST INDIAN WHISTLING-DUCK AND WETLANDS CONSERVATION PROJECT


terms of votes, the Working Group has benefited by
having access to Education Department authorities,
thus ensuring that teachers are released to attend
workshops and publicity is nationwide. This is lead-
ing to the incorporation of the wetlands book into
curricula, our ultimate aim if wetlands education is
to continue in the long term.
Truly Regional.-With the translation of materi-
als into Spanish and French, especially the new lan-
guage editions of the workbook, the project will be
ready to deliver workshops throughout the Carib-
bean.

ACKNOWLEDGMENTS
This project has been carried out with financial
support from the US Fish and Wildlife Service Di-
vision of International Conservation, US Fish and
Wildlife Service Neotropical Migratory Bird Con-
servation Act Fund, American Bird Conservancy,
Ducks Unlimited Canada, Royal Society for the
Protection of Birds, and the Dutch Ministry of For-
eign Affairs (DGIS) under the Partners for Wise
Use of Wetlands Programme, managed by Wetlands
International.
We are especially grateful for the personal inter-
est and support from senior executives in the major
governmental and non-governmental organizations
who recognized the potential of this ambitious pro-
ject and provided initial and continued funding and
support, including Herb Raffaele, Frank Rivera, and
Gilberto Cintron, USFWS; Jim Stevenson, RSPB;
Stewart Morrison, Ducks Unlimited Canada; Mi-
chael Parr and Robert Chipley, American Bird Con-
servancy; Bob Laidler, Oak Hammock Marsh Inter-
pretive Centre; and David Wege, BirdLife Interna-
tional).
A broad partnership of cooperating agencies and
organizations has provided generous in-kind support
and other contributions to the project. This partner-
ship includes: Abaco Outback, Adventure Learning
Center (New Providence, Bahamas), American
Birding Association, Andros Conservancy and
Trust, Avian Eyes (St. Vincent and the Grenadines),
Bahamas National Trust, Bahamas Reef Environ-
ment Educational Foundation, Bird Ecology Group
of Universidad de La Habana, Birdlife Jamaica,
Birdlife International, Boston University, British
High Commission (Jamaica), British Virgin Islands
National Parks Trust, Caribbean Coastal Area Man-
agement Foundation, Department of Natural Re-
sources and Environmental Education Division in
Tobago, Ducks Unlimited Canada, Ducks Unlim-
ited, Inc., Environment Tobago, Environmental


Awareness Group of Antigua and Barbuda, Friends
of the Environment (Abaco), Grupo Jaragua, His-
paniola Ornithological Society, Institute of Ecology
and Systematics, Institute of Jamaica (Natural His-
tory Division), Jamaica Environmental Trust, Min-
istry of Environment (Trinidad), Montego Bay Ma-
rine Park, Negril Environment Protection Trust, Na-
tional Environment and Planning Agency, National
Trust of the Cayman Islands, National Trust of the
Turks and Caicos Islands, Oak Hammock Marsh
Interpretive Centre, Pointe-a-Pierre Wildfowl and
Wetlands Trust, Portland Environment Protection
Association, Puerto Rican Ornithological Society,
St. Ann Environment Protection Association, RARE
Centre for Tropical Conservation, Ridge to Reef
Watershed Project, Royal Society for the Protection
of Birds, The Nature Conservancy Jamaica, UNEP
Caribbean Environment Program, United Kingdom
Foreign and Commonwealth Office. If we have in-
advertently omitted you from this list, please let us
know, and accept our apologies!
We are grateful to the Executive of the SCSCB
for their unfailing support and encouragement over
the years. We especially thank the many people who
have so willingly donated their time and talents to
this project. It is your enthusiasm, creativity, com-
mitment, and hard work that have made this project
a success.

LITERATURE CITED
BIRDLIFE INTERNATIONAL. 2000. Threatened birds
of the world. Barcelona and Cambridge, UK:
Lynx Edicions and BirdLife International.
HAYNES-SUTTON, A. M. 1996. Out for a duck -
the need for conservation of ducks in Jamaica.
Jamaica J. 26:39-59.
HAYNES-SUTTON, A. 1998. A duck without a quack.
Skywritings 116:24-27
SORENSON, L. G. 1997. Update on the West Indian
Whistling-Duck and Wetlands Conservation Pro-
ject. Pitirre 10:108-109.
SORENSON, L. G., AND P. BRADLEY. 1998. Update
on the West Indian Whistling-Duck (WIWD) and
Wetlands Conservation Project Report from
the WIWD Working Group. Pitirre 11:126-131.
SORENSON, L. G., AND P. BRADLEY. 2000. Update
on the West Indian Whistling-Duck (WIWD) and
Wetlands Conservation Project Report from
the WIWD Working Group. Pitirre 13:57-63.
SORENSON, L. G., AND P. BRADLEY. 2002. News
from the West Indian Whistling-Duck (WIWD)
and Wetlands Conservation Project. Pitirre 15:


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Page 78









SORENSON ETAL. WEST INDIAN WHISTLING-DUCK AND WETLANDS CONSERVATION PROJECT


137-139
SORENSON, L. G., AND E. CAREY. 1998. The West
Indian Whistling-Duck and Wetlands Conserva-
tion Project Working Group report on training
workshop held in Nassau, Bahamas, 13-15 No-
vember 1997. Pitirre 11:19-22.
SORENSON, L. G., AND L. HUNTER. 2002. West In-
dian Whistling-Duck and Wetlands Conservation


Project. U.S. Fish & Wildlife Service Wildlife
Without Borders Spring 2002:8-9.
SUTTON, A. H., L. G. SORENSON, AND M. A.
KEELEY. 2001. Wondrous West Indian wetlands:
teachers' resource book. Boston, MA: West In-
dian Whistling-Duck Working Group of the Soci-
ety of Caribbean Ornithology.


A GALLERY OF IMAGES FROM RECENT WETLANDS EDUCATION WORKSHOPS


Participants at the wetlands field trip to the Flashes, Hel-
shire, workshop in Kingston, Jamaica (June 2003).


Demonstration of the "Salty Currents" activity in Won-
drous West Indian wetlands by participants at workshop
in Montego Bay, Jamaica (June 2003).


Organizers, facilitators, and participants at the workshop Playing a game (Migration headache) about the conse-
in Port Antonio, Jamaica (June 2003). L to R: Ingrid quences of wetland loss in Trinidad workshop at the
Parchment, Michele Kading, Winnifred Moore, Leo Pointe-a-Pierre Wildfowl Trust (May 2002).
Douglas, Lisa Sorenson, Harvey Webb, Maisilyn Camp-
bell.


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Page 79












A GALLERY OF IMAGES FROM RECENT WETLANDS EDUCATION WORKSHOPS


A "local resident" expresses her feelings (in Patois) about Fun with wetland charades workshop in Tobago (May
the proposed development of "her wetland" in a role- 2002).
playing activity, Difficult decisions, Activity 4-D in Won-
drous West Indian wetlands (Montego Bay, June 2003).


Unraveling the 'human food web" in Nassau. Workshop at Identifying wetland critters in the pour-a-pond demonstra-
Bahamas National Trust (January 2003). tion in Antigua (November 2002).


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Ik


Page 80













A RESEARCH AND TRAINING PROGRAM FOR CONSERVATION OF
WINTERING KIRTLAND'S WARBLER AND ASSOCIATED SPECIES IN THE BAHAMAS:
THE FIRST FIELD SEASON

ERIC CAREY1'4, JOSEPH M. WUNDERLE, JR.2, AND DAVID N. EWERT3
'Department ofAgriculture, Botanical Gardens, Chippingham Rd., Nassau, Bahamas, ecarey@bahamas.net.bs;
2International Institute of Tropical Forestry, USDA Forest Service, P. 0. Box 490, Palmer, PR 00721 USA,
Wunderle@coqui.net; 3AMichigan Field Office, The Nature Conservancy, 2840 E. Grand River Ave., Ste. 5, East
Lansing, MI 48823, USA, dewert@tnc.org; 4Bahamas National Trust, PO Box N4105, Nassau, Bahamas

Abstract.-As one of North America's most endangered bird species, the Kirtland's Warbler (KW, Dendroica
kirtlandii) has been the focus of an intensive recovery effort on its Michigan breeding grounds. In contrast to the
breeding grounds, little is known about the species on its wintering areas where it is confined to the Bahamas
Archipelago. Recent studies indicate that wintering ground events can affect migrant populations and the absence
of wintering ground information and conservation efforts could compromise KW breeding ground conservation
efforts. Thus there is a need for more information regarding the KW and its winter habitat, as well as a need to
build the capacity of island residents to undertake conservation management activities in the Bahamas. The re-
search and training project discussed in this paper addresses these needs by involving Bahamian students in field
research focusing on KW winter habitat and associated bird species. This project has the potential to increase our
knowledge of the winter habitat requirements of the KW and associated species while building the capacity of
Bahamians to undertake conservation management activities.
Key words: Bahamas, conservation training, Dendroica kirtlandii, Kirtland's Warbler, student research partici-
pation
Resumen. UN PROGRAMA DE INVESTIGACION Y CAPACITACION PARA LA CONSERVACION DE LA REINITA DE
KIRTLAND Y ESPECIES RELACIONADAS EN SU HABITAT DE INVERNADA: LA PRIMERA TEMPORADA. Siendo una de
las especies mas amenazadas de America del Norte, la Reinita de Kirtland (RK, Dendroica kirtlandii) ha sido
objeto de un esfuerzo de recuperaci6n intenso en su territorio de cria en Michigan. A diferencia de los territorios
de cria, poco se sabe acerca de la especie en los territorios de invemada, los cuales se restringen al archipielago
de las Bahamas. Estudios recientes demuestran que los sucesos en las areas de invemada pueden afectar las po-
blaciones de aves migratorias y que la falta de informaci6n sobre 6stos y de proyectos de conservaci6n en los
cuarteles invemales pueden comprometer los esfuerzos en las areas de cria. Por lo tanto, es necesario obtener
mis informaci6n sobre la RK en su habitat invemal ademas de capacitar a los residentes islefios para que lleven a
cabo gestiones de manejo en las Bahamas. El proyecto de investigaci6n y capacitaci6n discutido en este articulo
aborda estas preocupaciones incluyendo a estudiantes bahameses en la investigaci6n de campo centrada en el
habitat invemal de la RK y especies relacionadas. Este proyecto posee el potencial de aumentar nuestro conoci-
miento de los requisitos del habitat de invemada de la RK y especies asociadas al mismo tiempo que se incre-
menta la capacidad de los bahameses para realizar actividades de manejo y conservaci6n.
Palabras clave: Bahamas, capacitaci6n para la conservaci6n, Dendroica kirtlandii, participaci6n estudiantil
en investigaciones, Reinita de Kirtland
Resume.-UN PROGRAMME DE RECHERCHE ET DE FORMATION POUR LA CONSERVATION DE LA PARULINE DE
KIRTLAND ET D'AUTRES ESPECES ASSOCIEES HIVERNANTES AUX BAHAMAS : PREMIERE SAISON D'ETUDE DE TER-
RAIN. En tant qu'une des especes d'oiseaux les plus menaces d'Am6rique du Nord, la Paruline de Kirtland (PK,
Dendroica kirtlandii) a fait l'objet d'efforts intensifs de reconstitution des populations dans ses zones de repro-
duction du Michigan. A la differences de la situation dans ses zones de nidification, peu de choses sont connues
pour cette espece dans son aire d'hivemage confine a l'archipel des Bahamas. Des 6tudes r6centes indiquent
que des evenements survenant sur les terres d'hivemage peuvent affecter les populations migratrices et que l'ab-
sence d'information et d'efforts de conservation dans ces zones peut compromettre ceux d6velopp6s dans son
aire de nidification. Il y a donc n6cessit6 d'avoir plus de connaissances sur le PK et son habitat en hivemage ainsi
que de d6velopper la capacity des habitants des iles a mettre en oeuvre des activities de gestion pour la conserva-
tion dans les Bahamas. Le projet de recherche et de formation discut6 dans cette presentation examine ces be-
soins en impliquant des 6tudiants des Bahamas dans la recherche de terrain en se concentrant sur les habitats
d'hivemage de la PK et des especes associ6es. Ce projet devrait permettre d'ameliorer notre connaissance des
besoins du PK et des especes associ6es dans leurs habitats d'hivemage tout en formant des bahamiens a prendre
la responsabilit6 des activities de gestion et de conservation.
Mots-clks: Bahamas, formation a la conservation, Dendroica kirtlandii, Paruline de Kirtland, participation
des etudiants a la recherche


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Page 81









CAREY ETAL. -CONSERVATION OF KIRTLAND'S WARBLER AND OTHER SPECIES IN THE BAHAMAS


THE KIRTLAND'S WARBLER (Dendroica kirtlandii)
is one of North America's most endangered migra-
tory birds, notable for its limited geographic distri-
bution on both its breeding and wintering grounds.
Intensive recovery efforts have concentrated on the
control of brood parasitism by Brown-headed Cow-
birds (Molothrus ater) and management of fire-
dependent jack pine (Pinus banksiana) to ensure
that adequate habitat is available on the central
Michigan breeding grounds. The success of these
management efforts is evident in the Kirtland's
Warbler population increase from approximately
1000 birds in 1951 (Mayfield 1953) to approxi-
mately 2100 breeding warblers in 2002.
In contrast to the intensive management efforts for
the Kirkland's Warbler on the breeding grounds, no
management activities have been conducted on be-
half of the warbler in the Bahama Archipelago win-
tering grounds, partly because of the belief that win-
tering ground events and habitat were not limiting
to the Kirtland's Warbler population (e.g., Sykes
and Clench 1998). Recent studies, however, have
indicated that events on the tropical or subtropical
wintering grounds may have serious population
consequences for many migrants (Rappole et al.
1989, Robbins et al. 1989, Sherry and Holmes
1995, Marra et al. 1998, Sillett 2000), including the
Kirtland's Warbler (Haney et al. 1998). Given re-
cent studies indicating that wintering ground events
can affect migrant populations, the absence of win-
tering ground information and conservation efforts
could compromise Kirtland's Warbler breeding
ground management efforts. It is for this reason that
the Kirtland's Warbler recovery plan (US Fish and
Wildlife Service 1985) ranks studies of wintering
Kirtland's Warblers and its habitat as a high prior-
ity, and also recommends building the capacity of
island residents to undertake conservation manage-
ment activities in the Bahamas.
To initiate and maintain conservation management
of protected areas in the Bahamas requires appropri-
ately trained personnel. Unfortunately, the Baha-
mas, as well as many other island territories of the
Caribbean, lacks citizens who are trained in natural
resources management or other closely related
fields. This problem partly arises from lack of expo-
sure to field biology, as well as a lack of employ-
ment opportunities for island residents. Thus there
is a need to train Bahamian students in field biology
and natural resources management.
In addition to a need for training Bahamians, there
is a need for basic studies of Bahamian birds, par-
ticularly endemics or near-endemics, many of which


have been poorly studied. For example, few studies
have been conducted on the Bahamas Yellowthroat
(Geothlypis rostrata), Thick-billed Vireo (Vireo
crassirostris), Bahama Swallow (Tachycineta
cyaneoviridis), Western Stripe-headed Tanager
(Spindalis zena), Bahama Mockingbird (Mimus
gundlachii), and West Indian Woodpecker
(MIelanerpes superciliaris), as well as other resident
and migrant species found in the Bahamas. Basic
ecological studies of these species and their habitats
are fundamental for future conservation activities in
the Bahamas.
Given these needs for studies of the winter biology
and habitats of the Kirtland's Warbler and ecologi-
cal studies of other bird species in the Bahamas, as
well as a need for training Bahamians in the meth-
ods of field biology and natural resources manage-
ment, we have developed a project with the follow-
ing objectives:
1. Characterize winter habitat, potential resources,
and stresses for wintering Kirtland's Warblers
in the Bahamas.
2. Characterize population biology and ecology of
focal Nearctic/Neotropical migrants and en-
demic or near-endemic birds in habitats occu-
pied by Kirtland's Warblers.
3. Strengthen the capacity of Bahamians to moni-
tor, manage, and protect ecosystems to con-
serve threatened and endangered resident and
migrant species.
The First Field Season.-During 13 January to 7
April 2002, the project successfully completed an
exploratory field season, which was designed to sur-
vey habitats for Kirtland's Warblers and associated
focal species and to initiate preliminary field studies
to fine-tune the study design for the next three win-
ters. As planned, the project also involved two Ba-
hamian students, who were trained in basic field
methods as they assisted with survey activities. As
specified in the original proposal, the fieldwork and
training occurred on the island of Andros in a region
designated for national park status. Here, in the
course of our surveys, one and possibly two Kirt-
land's Warblers were observed. In addition to the
completion of activities specified in the original
proposal, we captured and color-band six Kirtland's
Warblers and made preliminary observations of
these Kirtland's Warblers and their habitat at a
high-density Kirtland's Warbler site discovered by
the Ornithology Group of the Bahamas National
Trust on Eleuthera. The findings from these ex-
ploratory activities will guide our studies for the


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Page 82









CAREY ETAL. -CONSERVATION OF KIRTLAND'S WARBLER AND OTHER SPECIES IN THE BAHAMAS


next three winters.

PROJECT ACTIVITIES DURING
THE FIRST FIELD SEASON
The project started with a series of short meetings
in Nassau with various government officials, staff
of the College of the Bahamas, the Bahamas Na-
tional Trust, and members of the Ornithology Group
of the Bahamas National Trust, as well as others
interested in the project. These meetings helped us
to introduce the project and its objectives to poten-
tial cooperators and other interested persons. We
initiated the project on Andros with an orientation
to Andros natural history by Michael Baltz (The
Nature Conservancy, Illinois) and an introduction to
plant identification and fire ecology by Chris Bergh
(TNC, Florida). Our project was based at the Baha-
mas Envrionmental Research Center in Staniard
Creek, operated jointly by the College of the Baha-
mas and George Mason University.
Two College of the Bahamas biology students
participated for the duration of the project: Ancil-
leno Davis, a recent graduate from Nassau, and Jaz-
mine Turner, a second-year student from Andros
Island. Finacial support was raised to enable the two
students to participate in Kirtland's Warbler recov-
ery activities in Michigan during summer 2003. The
research and student training activities based at the
Bahamas Envrionmental Research Center on An-
dros included the following:
1. Training in avian identification.-The Baha-
mian participants received field training in iden-
tification of both migrant and resident species on
Andros. This has involved intensive fieldwork
with experienced observers to help them learn to
identify the birds of Andros by sight and sound.
In addition, basic natural history and conserva-
tion status were discussed.
2. Avian census methods.-Students were intro-
duced to both transect and point count methods
for monitoring and surveying terrestrial birds.
a. Point counts. Students participated in 180
point count bird censuses run in a variety of
habitats, reflecting different fire histories.
This involved fixed-radius point counts in
which all birds detected in a 25-m radius
were recorded during a 5-min period of si-
lence followed by a 5-min period in which a
tape recording of mixed migrant chips was
played. Point counts were located at intervals
of 150 m or more, and 30 point counts were
run per habitat. A GPS unit was used to


quantify the position of each point count lo-
cation. Counts were run from sunrise until
10:00 h. The following six typical Bahamian
terrestrial habitats were surveyed:
Pine forest with low understory (<1.5 m)
primarily of poisonwood and palms.
Pine forest with 2-3 m broadleaf shrub
understory.
Pine forest with bracken fern understory
(1-1.5 m).
Shrubby abandoned agricultural field,
with mix of herbaceous plants and scat-
tered shrubs (1-2 m).
Tall Coppice-broadleaf dry forest with
closed canopy at 12-15 m.
Short Coppice-broadleaf shrubby habitat
with broken canopy at 3-4 m.
b. Tape playback transects. Between each point
count site, observers walked for 150 m or
more between points while playing tape re-
cordings of Kirtland's Warbler songs and call
notes. The tape recorder volume was set so
that vocalizations could be heard at least 25
m to either side of the tape recorder. Thus
transects were run between the 30 points con-
ducted in the six habitats.
3. Quantification of vegetation structure.-Vege-
tation structure relevant to avian habitat use was
quantified in the six habitats sampled with point
counts to provide a description of the habitats.
Within each habitat two point count sites were
randomly selected for sampling. Sampling oc-
curred within a circle of 0.02 ha and included
measures of ground and canopy cover, shrub
density, foliage height profiles, and basal area of
pine and broadleaf trees.
4. Mist-netting and banding.-Mist-netting and
banding of focal species (Bahamas Yellow-
throat, Thick-billed Vireo, Prairie Warbler Den-
droica discolor, Palm Warbler D. palmarum)
were conducted to provide information on avian
distribution, movements, and physical condition
in the different habitats. All focal species were
given unique combinations of color-bands to
allow identification of individuals on their win-
tering territories and to enable studies of winter
site fidelity. All migrant species were banded
with a US Fish and Wildlife band. Mist-netting
and banding were conducted in some of the
habitats in which point counts were run and in-
clude: pine forest with 2-3 m broadleaf shrub


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Page 83









CAREY ETAL. -CONSERVATION OF KIRTLAND'S WARBLER AND OTHER SPECIES IN THE BAHAMAS


understory; shrubby abandoned agricultural field
with a mix of herbaceous plants and scattered
shrubs (1-2 m tall); tall coppice with broadleaf
canopy at 12-15 m; and short coppice with bro-
ken broadleaf canopy at 3-4 m.
5. Data entry and analysis.-Field data were en-
tered on computer spreadsheets and elementary
descriptive statistics calculated to compare bird
populations among habitats as well as document-
ing differences in vegetation among the sites.
6. Summary reports.-Students each wrote two
summary reports based on their field experiences
and analysis of various aspects of the field data.
The reports required the students to carefully
examine the field data and identify patterns of
avian distribution and vegetation structure, as
well as provided an opportunity to summarize
their project experiences.

PRELIMINARY FINDINGS
Our point count and mist-netting results provided
valuable documentation of avian abundance and
distribution in some of the major habitats in the area
proposed as a national park on Andros. A total of 38
species was detected in 180 fixed-radius point
counts conducted in the six habitats on Andros Is-
land. Mist-net captures of birds in four habitats sup-
plemented the point counts. A total of 435 individ-
ual birds of 34 species was captured in the four
habitats.
One and possibly two Kirtland's Warblers were
detected on Andros Island. One Kirtland's Warbler
observation was made by Matthew Anderson and
Ancilleno Davis on 21 February 2002 in tall cop-
pice when a Kirtland's Warbler responded during
the warbler chip-note playback session of a point
count. A second Kirtland's Warbler observation was
made by Jasmine Turner on 21 February 2002 dur-
ing a tape playback transect in the pine forest with
shrubby understory, 1033 m from the site where
Anderson and Davis observed their Kirtland's War-
bler. Given previous findings which indicate that
wintering Kirtland's Warblers can have home
ranges of 8 ha, it is possible that the two sightings
were of the same unbanded individual.
Wunderle made two trips to Eleuthera to observe
and capture Kirtland's Warblers at the site where
Paul Dean and the Ornithology Group of the Baha-
mas National Trust discovered several Kirtland's
Warblers. Four individuals were captured with tape
recorded playback and uniquely color-banded and
released during the first visit (17-18 March 2002).


During the second visit (3-6 April 2002), the four
color-banded Kirtland's Warblers were resighted,
each within 20 m of its original capture site. In addi-
tion, two other individuals were captured at the site
and two unbanded Kirtland's Warblers were ob-
served, indicating that at least eight individuals
were present along 235 m of a rural road. Vegeta-
tion measurements were made at four of the six
Kirtland's Warbler capture sites. The warblers on
Eleuthera were all observed in a shrubby second-
growth site (vegetation 2-3 m tall) in which the
shrub, black torch (Erithalus fruticosa, Rubiaceae)
was common and provided fruits which were con-
sumed by the Kirtland's Warblers.

PLANS FOR THE NEXT FIELD SEASON
Given the unexpected finding of an extraordinary
concentration of Kirtland's Warblers on Eleuthera,
we plan to return to that island in October 2002 to
continue studies of the Kirtland's Warblers at that
site, pending permission by the landowner. Thus,
we plan to shift our field studies from Andros to
Eleuthera to enable us to study the wintering Kirt-
land's Warblers, their habitat, and associated bird
species. Using the methods specified in the original
proposal we will study warbler foraging behavior,
site fidelity, home range (territory) size, move-
ments, and interactions between the sexes. Capture
of wintering Kirtland's Warblers will enable us to
document body condition and allow us to color-
band birds for individual recognition in the field. In
addition, we will initiate habitat studies to quantify
food resources (fruit and insects) and document sea-
sonal changes in food supply. We will also initiate
radio telemetry studies on focal species (e.g., Ba-
hama Yellowthroat, Thick-billed Vireo) to develop
our telemetry skills and obtain experience that may
be applied to future telemetry studies of the winter-
ing Kirtland's Warblers. These studies will be de-
signed to document the behavior of Kirtland's War-
blers at this site and to characterize the habitat so as
to determine why this particular Eleuthera site is so
attractive to wintering Kirtland's Warblers. Once
we understand why Kirtland's Warblers are so
abundant at this site and the value of this habitat to
the warblers, we will focus on the ecological factors
that produce such habitats. We are excited with the
potential of these studies to enable us to identify the
characteristics of high quality Kirtland's Warbler
winter habitat and how such habitats can be pro-
duced and managed.
Student training will continue to be an integral
part of the research activities. We are working


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Page 84









CAREY ETAL. -CONSERVATION OF KIRTLAND'S WARBLER AND OTHER SPECIES IN THE BAHAMAS


closely with the College of the Bahamas to identify
potential student participants and to enable students
to obtain research credit through the college. A
close working relationship with the College of the
Bahamas will help to publicize field opportunities
for students.

LITERATURE CITED
HANEY, J. C., D. S. LEE, AND M. WALSH-
MCGEHEE. 1998. A quantitative analysis of winter
distribution and habitats of Kirtland's Warbler in
the Bahamas. Condor 100:201-217.
MARRA, P. P., K. A. HOBSON, AND R. T. HOLMES.
1998. Linking winter and summer events in a mi-
gratory bird by using stable-carbon isotopes. Sci-
ence 282:1884-1886.
MAYFIELD, H. F. 1953. A census of the Kirtland's
Warbler. Auk 70:17-20.
RAPPOLE, J. H., M. A. RAMOS, AND K. WINKER.


1989. Wintering Wood Thrush movements and
mortality in southern Veracruz. Auk 106:402-410.
ROBBINS, C. S., J. R. SAUER, R. GREENBERG, AND
S. DROEGE. 1989. Population declines in North
American birds that migrate to the Neotropics.
Proc. Natl. Acad. Sci. USA 86:7658-7662.
SHERRY, T. W., AND R. T. HOLMES. 1995. Summer
versus winter limitation of populations: what are
the issues and what is the evidence? Pp. 85-120 in
Ecology and management of Neotropical migra-
tory birds (Martin, T. F., and D. M. Finch, Eds.).
New York, NY: Oxford University Press.
UNITED STATES FISH AND WILDLIFE SERVICE.
1985. Kirtland's Warbler recovery plan. (first pre-
pared 1976, revised in 1985). Washington DC.
SILLETT, T. S., R. T. HOLMES, AND T. W. SHERRY.
2000. Impacts of global climate cycle on popula-
tion dynamics of a migratory songbird. Science
288:2040-2042.


Journal of Caribbean Ornithology Special Issuing Honoring Nedra Klein


Page 85












THE STATUS OF RESIDENT AND MIGRANT BIRD COMMUNITIES IN CUBAN ECOSYSTEMS


HIRAM GONZALEZ ALONSO, ALEJANDRO LLANES SOSA, BARBARA SANCHEZ ORIA, DAYSI RODRIGUEZ
BATISTA, ENEIDER PEREZ MENA, PEDRO BLANCO RODRIGUEZ, AND RAMONA OVIEDO PRIETO

Instituto de Ecologia y Sistematica, Ministerio de Ciencia, Tecnologia y Medio Ambiente de Cuba, La
Habana, Cuba, e-mail: zoologia.ies@ama.cu.



Abstract.-We worked in 34 areas in 10 localities in Cuba from 1988 to 1999 to evaluate terrestrial bird com-
munities. We used circular plots counts and capture by mist-nets in our efforts. In addition, we sampled vegeta-
tion plots to learn the structure and composition of plant communities within these localities. We estimated the
composition and abundance of terrestrial bird communities during fall migration and resident periods. The pa-
rameters that most influence bird populations are canopy cover, ground cover, and foliage density between 0 and
1 m. Migratory birds demonstrated a high fidelity to wintering area, especially Black-throated Blue Warbler
(Dendroica caerulescens). The results that we obtained in 12 localities of six regions of Cuba during fall migra-
tion suggest that many individuals and species of migrant birds use the regions of Guanahacabibes, Peninsula de
Hicacos, Cayo Santa Maria, Cayo Coco, and Gibara.
Key words: abundance, community, Cuba,fidelity, habitat, migrant and resident birds, mist-nets, vegetation
Resumen.-ESTADO DE LAS COMUNIDADES DE AVES RESIDENTES Y MIGRATORIAS EN ECOSISTEMAS CUBA-
NOS. Trabajamos en 34 areas de 10 localidades de Cuba entre 1988 y 1999 para evaluar las comunidades de aves
terrestres. Usamos el metodo de conteo de parcela circular y la captura con redes ornitol6gicas. Marcamos par-
celas de vegetaci6n donde medimos diferentes parametros de su estructura. Estimamos la composici6n y abun-
dancia de las comunidades de aves durante la residencia invernal y la migraci6n otofial. Los parametros de la
vegetaci6n que mas influyeron sobre las poblaciones de aves fueron la cobertura del dosel, cobertura del suelo y
el follaje de 0 a 1 m. Las aves migratorias mostraron una alta fidelidad a las areas de invernada y se destac6 la
Bijirita Azul de Garganta Negra o Reinita Azul Golinegra (Dendroica caerulescens). Los resultados obtenidos
en 12 localidades de seis regiones de Cuba durante la migraci6n otofial indican que una gran cantidad de espe-
cies e individuos usan las regiones de Guanahacabibes, peninsula de Hicacos, cayo Santa Maria, cayo Coco y
Gibara.
Palabras clave: abundancia, aves residentes y migratorias, comunidad, Cuba,fidelidad, habitat, redes ornito-
16gicas, vegetaci6n
Resumn.-STATUT DES COMMUNAUTES D'OISEAUX SEDENTAIRES ET MIGRATRICES DES ECOSYSTEMES DE
CUBA. Nous avons travaille dans 34 zones de 10 localit6s cubaines entre 1988 et 1999 pour 6tudier les commu-
nautes d'oiseaux terrestres. Nous avons utilis6 des comptages par point et la capture au filet pour nos 6tudes.
Nous avons 6galement 6chantillonnr la vegetation pour connaitre la structure et la composition des associations
vegetales dans ces localisations. La composition et l'abondance des communaut6s d'oiseaux terrestres ont ete
6valuees pendant les migrations d'automnes et pour les especes r6sidentes. Les facteurs qui influencent le plus
les populations d'oiseaux sont la couverture de la canop6e, la couverture du sol et la density du feuillage entre 0
et 1 metre. Les especes migratrices pr6sentent une forte fidelity aux lieux d'hivemage, particulierement la Paru-
line bleue (Dendroica caerulescens). Les r6sultats obtenus dans 12 localisations de 6 regions de Cuba en migra-
tion d'automne suggerent que beaucoup d'especes et d'individus d'oiseaux migrateurs utilisent les regions de
Guanahacabibes, Peninsula de Hicacos, Cayo Santa Maria, Cayo Coco et de Gibara.
Alots-clks: abondance, communautk, Cuba, fiddlit&, habitat, oiseaux migrateurs et residents, capture au filet,
vegetation



INTRODUCTION tats, although it is important to emphasize that many
SOME INVESTIGATIONS conducted in the United migrant birds use the secondary vegetation and agri-
States (Robbins et al. 1989), Puerto Rico (Faaborg culture ecosystems (Waide and Wunderle 1989,
and Arendt 1989, 1992), Jamaica (Diamond and Blake and Loiselle 1992, Petit et al. 1993).
Smith 1973), and Virgins Islands (Askins et al. With Cuba's location, extension in the Caribbean
1990) show that migrant birds populations have de- Sea, considerable number of migratory birds using
clined in the last decades, along with original habi- its ecosystems during migration, and the declines


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 86









GONZALEZ ALONSO ETAL. -STATUS OF RESIDENT AND MIGRANT BIRD COMMUNITIES IN CUBAN ECOSYSTEMS


their populations have suffered in recent years be-
cause of diverse problems, it is necessary to carry
out investigations to determine the status of these
populations and the factors which affect them, and
to implement management plans for rationally con-
serving and improving the habitats that migrants
use. For these reasons, we have systematically de-
veloped ecological studies within communities of
resident and migratory birds in several localities of
Cuba (Llanes et al. 1987; Garcia y Rodriguez 1988;
Gonzalez et al. 1990, 1992a,b,c, 1997, 2000;
Sanchez et al. 1992a,b, 1994, 1998; Rodriguez et al.
1994; Rodriguez y Sanchez 1995; Wallace et al.
1996).
Toward this goal, we have set the following ob-
jectives:
* To determine the influence of the different kinds
of forests and regions on distribution, composi-
tion, abundance, and status of migratory and
resident birds communities during migration and
residence periods.
To determine possible migration routes.
To make recommendations to area managers to
protect the birds and their habitat.

MATERIALS AND METHODS
Sampling areas and periods
For terrestrial birds, 13 potential regions of great
importance were chosen to study the resident and
migratory birds, taking into account the representa-
tives kinds of vegetation and protected areas.
Studies were conducted in semideciduous forest,
mangrove, swamp, rain forest, pine grove, coastal
xeromorphic forests, as well as dry xeromorph ser-
pentine shrub-woods of lowlands.
The studies were carried out in 34 sampling areas
of 10 localities of Cuba (Table 1), 31 of them in
winter residence and 14 in fall migration periods.

General methodology
For sampling terrestrial birds, we surveyed using
circular plots and capture with mist-nets (Hutto et
al. 1986, Ralph et al. 1993). The use of both meth-
ods complemented the advantages and disadvan-
tages of each.
Fifteen points with two mist-nets, each separated
by 100 m from the other, and eight circular plots
were alternatively selected, so that they were 200 m
from each other. Each point was uniquely numbered
and each bird was marked with Fish and Wildlife
Service bands.


Eight vegetation plots were sampled per habitat,
using the methods of James and Shugart (1970) and
Noon (1981). Habitat plots were in the same kind of
vegetation where the counts and captures of birds
were made.
We applied the Correspondence Canonical
Analysis to the richness and abundance parameters
of the bird communities and vegetation structural
variables.

RESULTS AND DISCUSSION
Winter residence
The winter residence period lasts from 16 No-
vember to 15 March of the following year and is
when migratory birds remain in Cuba and mix with
resident species to use their ecosystems during the
winter period of temperate zones.
During banding of birds, 104 species were cap-
tured 36 were winter residents (WR), 45 perma-
nent residents (PR), and 23 transients (T).
Within Guanahacabibes, the area El Veral is ex-
ceptional in its species richness and high capture
rates (Table 2). In this locality 38 new bird species
were recorded.
In Mil Cumbres, we obtained the highest values
of species, capture rates, and relative abundance in
El Cayo pine grove (Table 2). In this locality, as
well as La Guira, all the species of birds are new
because the region had not been studied previously.
Within La Guira, El Salvador semidiciduous forest
was remarkable in richness of species, although
higher values of abundance were recorded in Ca-
bafias pine grove.
In such important regions as Cidnaga de Zapata,
the most important areas relative to richness of resi-
dent and migratory bird species were Los Sibalos
and Caleta del Toro (Table 1), although in general
all the areas had a great diversity and abundance of
birds (Table 2).
We observed the highest richness and capture
rates at Cayo Coco, in Petrolera mixed mangrove
forest, Vereda Marquez low semideciduous forest,
and Playa Dorada coastal xeromorphic forest. This
locality was the only one where we were able to
conduct a study throughout a yearly cycle to deter-
mine the composition and abundance in all the
months of the year. In this way we confirmed that
the greater number of species were observed in Feb-
ruary and October, whereas the highest values of
abundance were registered in September, October,
and November. This is influenced by fall migration,
because a great number of migratory birds arrive in


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 87









GONZALEZ ALONSO ETAL. STATUS OF RESIDENT AND MIGRANT BIRD COMMUNITIES IN CUBAN ECOSYSTEMS


Table 1. Richness of total species (Rtot), winter residents (SWR), permanent residents
(SPR), and transients (ST) in 34 areas of 10 localities of Cuba during the periods of winter
residence and fall migration, 1989-1999.


Locality


Area1


Rtot SWR SPR ST


Guanahacabibes



Total
Guira


Total
Mil Cumbres


Total
Punta Hicacos
Ci6naga de Zapata








Total
Cayo Sta. Maria


Total
Cayo Coco





Total
Gibara
Mayari


Total
Piedra la Vela


Total


Cabo Corrientes 33
El Veral 41
Las Tumbas 44
El Faro 49
73
Salvador 17
S. Venado 19
Las Cabafas 24
33
Cayo 30
San Marcos 15
Sierra 22
33
Punta Frances 32
Sabalos 46
Camilo 26
Cenote 34
El Brinco 25
Lindero 17
Caleta Buena 22
Caleta del Toro 24
Santo Tomas 23
52
Caletas 37
Estrella 23
38
Sitio Viejo (BSDa) 32
Camino Potrero (BSDm) 40
Vereda Marquez (BSDb) 26
Las Coloradas (MXSc) 33
Playa Dorada (MXC) 47
La Petrolera (M) 48
64
Caletones 42
Caridad 28
Mensura 19
Guayabal 17
35
Pinar 16
Pluvisilva 22
Siempreverde 16
26


1BSDa= high semideciduous forest, BSDm = moderate elevation semideciduous forest,
BSDb = low semideciduous forest, MXSc = subcoastal xeric scrub, MXC = coastal xeric
scrub, M = mangrove forest.


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 88









GONZALEZ ALONSO ETAL. STATUS OF RESIDENT AND MIGRANT BIRD COMMUNITIES IN CUBAN ECOSYSTEMS


Table 2. Relative Abundance (RA) (birds/count), Capture Rate (CR) (birds/100 net-hours), and Number of species by area
and year for winter residents (WR) and permanent residents (PR) in the winter residence period in Cuba.


RA CR No. species


Areas'


El Veral
El Veral
El Veral
Cabo Corrientes
Cabo Corrientes
San Marcos
S. Cajalbana
El Cayo
Cabafias
El Salvador
S. del Venado
Sabalos
Sabalos
Sabalos
Cenote
Cenote
Cenote
Camilo
Camilo
Caleta Buena
Caleta Buena
Lindero
Brinco
Caleta Toro
Estrella
Caletas
Sitio Viejo
Potrero
Playa Dorada
Vereda Marquez
Playa Coloradas
La Petrolera
Caletones
Caletones
La Caridad
La Caridad
Mensura II
Mensura II
Guayabal
Guayabal
P.A.H. Pinar
P.A.H. Pinar
P.A.H. Pinar
P.A.H. Pluv.
P.A.H. Pluv.
P.A.H. Pluv.
P.A.H. BSV
P.A.H. BSV
P.A.H. BSV


Year WR

1990 2.50
1991 4.27
1994 1.06
1991 1.37
1994 0.75
1993 0.75
1993 1.06
1993 1.32
1994 0.80
1994 1.13
1994 1.43
1988 2.23
1989 2.98
1995 4.00
1991 1.00
1992 0.87
1995 2.43
1991 1.44
1992 0.50
1992 6.73
1995 2.55
1992 0.62
1992 2.25
1992 3.25
1995 0.86
1995 0.87
1994 1.95
1993 3.26
1993 1.40
1993 2.60
1994 2.36
1994 3.62
1998 1.06
1999 0.87
1997 0.69
1998 1.13
1997 2.06
1998 3.62
1997 2.56
1998 3.12
1997 0.63
1998 1.94
1999 2.88
1997 0.75
1998 1.13
1999 1.19
1997 1.38
1998 1.88
1999 3.44


PR Net-hours PR


11.87
13.46
6.69
18.63
9.37
7.07
10.51
14.58
16.82
10.03
10.03
10.50
13.53
5.94
18.87
6.07
5.32
11.62
3.81
11.14
6.76
3.50
7.00
8.00
5.35
2.75
7.55
7.74
5.20
8.50
7.84
4.74
8.44
3.38
6.37
10.56
6.31
7.88
10.31
12.37
2.19
1.44
3.06
2.43
3.63
5.44
3.56
5.63
7.81


270.0
220.0
570.0
108.0
420.0
643.5
657.0
642.0
722.5
720.0
737.5
1662.0
1896.0
450.0
720.0
629.5
450.0
360.0
697.5
652.5
450.0
615.0
690.0
667.5
420.0
420.0
720.0
672.0
735.0
735.0
720.0
714.0
540.0
648.0
720.0
540.0
720.0
720.0
720.0
720.0
450.0
676.0
339.0
450.0
694.0
489.0
450.0
640.0
459.0


22.44
36.82
4.39
32.41
19.28
5.13
20.70
32.40
15.64
7.22
7.32
8.36
6.80
10.89
8.75
7.31
12.44
11.11
12.62
9.65
8.44
10.89
11.01
10.64
14.28
9.05
15.83
5.96
29.26
31.16
17.08
30.42
15.00
7.25
14.72
22.22
2.08
2.78
6.25
3.06
2.89
5.03
7.37
19.56
3.75
3.68
5.11
5.00
6.10


14.74
20.45
5.26
12.96
4.05
1.40
6.09
9.19
3.18
2.78
2.03
14.56
11.49
18.20
8.75
3.81
12.44
3.05
3.87
9.81
8.00
2.44
6.81
3.89
8.82
12.86
15.56
6.40
9.80
16.46
7.36
22.07
5.37
5.09
1.94
1.11
1.53
2.22
1.94
3.06
4.44
1.92
6.19
8.00
10.09
10.02
8.00
4.22
3.70


total WR PR

37.18 18 31
57.22 19 31
9.65 13 21
45.37 11 26
23.33 6 24
6.53 11 29
26.79 10 27
41.59 14 36
18.82 13 30
10.00 16 31
9.35 13 27
22.92 19 38
18.29 20 30
29.09 14 30
17.50 11 28
11.12 14 22
24.88 11 23
14.17 9 26
16.49 10 22
19.46 12 20
16.44 10 22
13.33 11 24
17.82 17 24
14.53 15 33
23.10 12 17
21.91 14 16
31.39 13 17
12.36 12 12
39.06 14 19
47.62 14 18
24.44 16 17
52.49 19 25
20.37 8 23
12.35 8 17
16.67 5 16
23.33 8 19
3.61 7 12
5.00 10 15
8.19 6 20
6.11 6 21
9.56 4 14
6.95 9 13
13.57 5 14
27.78 6 18
15.42 8 18
13.70 6 18
13.11 6 17
9.22 6 23
9.80 10 23


'P.A.H. = Alejandro de Humbolt National Park, Pinar = Pine Forest, Pluv. = Rain Forest, BSV = Evergreen Forest.


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 89









GONZALEZ ALONSO ETAL. -STATUS OF RESIDENT AND MIGRANT BIRD COMMUNITIES IN CUBAN ECOSYSTEMS


BS-BC9


P26Plu27 BLP BSV28 NOM CUG MXC PAR


CUL
BSV25 BSDm


LOW


BSDa


OW -. 22


MOc BWH BSV22YSF
BSDb BMM BA ,


P24
Ch23.

UGR

YI
CU R ....


OP

t.UE t2
f2 i


YWA


AMR S t
MXGs t


BSD13 WEW f4 f SHT O
BSV14 LAS GLCBAW CGW MX CUV C
PAB EWEV EAW GRE Co R H
bg C1 GAGCMW RLT D6 LOK P-CU7
sww cd
-WCBSD12 BSD4 up P5cd
KEW BHQ HB YHW
ZEN SUT
BSD11 BSD3
BS-BM10 RBW

1 -0.5 BS-BV2 0 0.5


cs


Fig. 1. Canonical Correspondence Analysis among bird species (69) and structure variables of ve-
getation in 28 habitats. cd = canopy cover, cs = ground cover, fl-f4 = foliage density (different
heights), alt = vegetation height, da = density trees, tr = density branch, BS = Semideciduous Fo-
rest, BM = Mangrove Forest, P = Pine Forest, MXC = Xeromorphic Forest, BC = Swamp Forest.


Cuba in these months.
In the localities of Gibara and Nipe's high pla-
teau, we verified that the higher richness and abun-
dance of birds were found in the Caletones and
Guayabal evergreen forests. Sixteen new species
were detected in Gibara.
The highest diversity and abundance of resident
and migratory birds were found in the evergreen
forest of Alejandro de Humbolt National Park.

Relationship between bird-fauna and vegetation
By applying the Correspondence Canonical
Analysis to the richness and abundance parameters
of bird communities and vegetation structural vari-
ables in 28 habitats, an ordering diagram was at-
tained (Fig. 1). The structural variables with greatest
influence on the ordering of habitat and on bird
populations were canopy cover, ground cover, and
0-1 m foliage density.
Most semideciduous forests group in the first
quadrant, which is because of a higher resemblance
among them in relationship to the vegetation struc-
ture, canopy cover being the most influencing ele-
ment.
The Cayo Coco semideciduous forests are sepa-


rated from other habitat of this vegetative formation
in the third quadrant because the coastal influence
determines structural characteristics differing from
other Cuban forests.
The pine grove forests, the Caletones (BSV22)
and Alejandro de Humbolt National Park (BSV28)
evergreen forests, as well as Cayo Coco (MXC)
coastal xeromorphic forests are found in the second
and fourth quadrants. This ordering is set up in fa-
vor of a higher ground cover and foliage density in
the lower layers of vegetation. These characteristics
contribute to the occurrence of species in this habi-
tat, which forage in the low strata and prefer more
open habitat, with greater herbaceous cover.
The majority of resident species occur at the cen-
ter of the graph, indicating no habitat preference,
and demonstrating that they are more general than
migratory birds with regard to use of sampled habi-
tat.
In general, the majority of migrant birds prefer
the semideciduous forest during winter season, with
the exception of Seiurus noveboracensis and S. mo-
tacilla, which prefer wet forest. Geothlypis trichas
and Dendroica caerulescens are common in Pine
Forest (P26) and Pluvisilva Forest (Plu27); D. pal-
marumn is present in Pine Forest (P8 and P-CU7)


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


1I


0.5


KWOQ


0




-0.5




-1


Page 90









GONZALEZ ALONSO ETAL. -STATUS OF RESIDENT AND MIGRANT BIRD COMMUNITIES IN CUBAN ECOSYSTEMS


Table 3. Distance from site of original capture where migrant birds were recovered in
subsequent years in Cuba.


Species


Code


Dendroica carolinensis GRCA
Dendroica caerulescens BTBW
Dendroica magnolia MAWA
Dendroica palmarum WPWA
Mniotilta varia BAWW
Setophaga ruticilla AMRE
Limnothlypis swainsonii SWWA
Seiurus aurocapillus OVEN
Seiurus noveboracensis NOWA
Geothlypis trichas COYE
Hermitheros vermivorus WEWA
Dendroica discolor PRAW
Dendroica tigrina CMWA
Totals


Distance from original site of capture (m)
Total
0 100 200 300 > 300 no.


1 1
15 9 3 1 28
1 1
3 5 1 2 1 12
3 1 1 1 6
9 1 1 11
2 1 3
5 6 1 12
11 4 1 16
5 3 2 10
2 1 1 1 5
2 2 4
1 1 2
55 35 9 5 7 111


Table 4. Relative Abundance (RA) (birds/count), Capture Rate (CR) (Birds/100 net-hours), and Number of species by area
and year for Migratory species (M) and Permanent Residents (PR) during fall migration in Cuba.


No. species


Areas


El Veral
C. Corrientes
Las Tumbas
Las Tumbas
El Faro
El Cayo
S. Cajalbana
Peninsula de Hicacos
Peninsula de Hicacos
Caletas
Vereda Marquez
Playa Dorada
Petrolera
Vereda Marquez
Playa Dorada
Petrolera
Caletones
Caletones
Caletones
La Caridad
La Caridad
Mensura II
Mensura II


Year WR PR

1996 1.37 5.25
1996 1.87 2.62
1997 1.12 4.06
1998 2.37 5.00
1998 -
1994 2.38 10.15
1994 1.30 7.63
1989 7.81 3.51
1990 8.69 4.01
1994 5.17 3.58
1992 5.80 14.50
1992 1.10 7.40
1992 4.80 17.20
1993 1.99 4.17
1993 0 0.30
1993 0.33 2.51
1989 -
1990 -
1997 1.38 4.13
1996 3.93 9.86
1997 2.56 10.81
1996 2.19 4.31
1997 2.31 6.56


Net-hours PR


450.0
450.0
840.0
900.0
98.0
420.0
420.0
401.6
420.5
660.0
144.0
144.0
128.0
144.0
144.0
144.0
692.0
480.0
720.0
422.0
510.0
540.0
450.0


5.55
5.71
5.71
4.44
5.71
27.86
16.90
16.68
12.39
13.68
25.69
38.86
53.12
36.80
57.63
48.61
12.86
13.96
22.38
37.86
33.33
5.37
6.22


WR total WR

8.00 13.55 11
13.93 19.64 36
13.92 19.63 36
7.11 11.55 21
44.13 49.80 28
9.52 37.48 13
1.67 18.57 6
45.12 61.80 20
50.48 62.87 23
83.33 97.00 22
42.33 68.02 13
17.05 55.91 14
60.93 114.06 13
61.80 98.60 9
28.46 86.11 11
68.05 116.67 12
33.96 46.82 15
16.67 30.63 16
17.78 40.16 16
26.20 64.05 9
16.86 50.20 9
3.33 8.70 8
3.78 10.00 8


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 91









GONZALEZ ALONSO ETAL. -STATUS OF RESIDENT AND MIGRANT BIRD COMMUNITIES IN CUBAN ECOSYSTEMS


and D. striata occur in the evergreen forest of Cale-
tones (BSV22).
These results confirm that the influence of habitat
on the bird communities' composition and abun-
dance.
In relation to migrant birds banded in one year
and recovered in another year, we found that 49.6%
were recovered in the same net where they were
banded and 31.5% were recovered within 100 m of
where they were banded (Table 3). This demon-
strates that migratory birds manifest a high fidelity
to the wintering area, especially Black-throated
Blue Warbler (Dendroica caerulescens), Ovenbird
(Seiurus aurocapillus), Northern Waterthrush
(Seiurus noveboracensis), American Redstart
(Setophaga ruticilla), and Common Yellowthroat
(Geothlypis trichas).

Fall migration
The fall migration of birds is one of nature's most
impressive events and occurs in response to the
needs of bird populations with yearly climate
changes occurring in different regions of the world.
The position of the Cuban archipelago in the West
Indies makes it one of the most important regions
within the Neartic-Neotropical migration system.
The results obtained in our 12 sampling areas of
six Cuban localities demonstrated that a large num-
ber of migratory terrestrial Neartic-Neotropical spe-
cies passes through Guanahacabibes, Peninsula de
Hicacos, Cayo Santa Maria, Cayo Coco, and Gibara
or remain there (Table 4). Noteworthy among these
sites was Guanahacabibes, mainly Las Tumbas and
El Faro, where large numbers of transient birds
were detected. In addition, the capture rates for mi-
gratory birds are high, indicating that their abun-
dance during this period is very high. In this sense,
Cayo Santa Maria, Peninsula de Hicacos, and Cayo
Coco are notable.
We point out that most of these localities are be-
ing transformed through tourism development, so
economic and conservation interests should be de-
veloped to attain a sustainable development com-
patible with management for avian habitat.
Our results are being considered by responsible
institutions for the development of a plan for man-
agement and nature tourism.

CONCLUSIONS
1. The composition and abundance of terrestrial bird
communities in each area depend on the type of
vegetation, geographic locality, and season.


2. The variable structure of the vegetation that most
affect composition and abundance of bird popula-
tions are canopy cover, ground cover, and the ver-
tical density of foliage in lower stratus of the
vegetation.
3. The Cidnaga de Zapata, Guanahacabibes, Cayo
Coco, Pinares de Mayari, and Alejandro de Hum-
bolt National Park constitute Important Bird Ar-
eas because of the diversity and abundance of en-
dangered and endemic species.
4. The most important regions for migratory birds
during fall migration are Guanahacabibes, Penin-
sula de Hicacos, Cayo Santa Maria, Cayo Coco,
and Gibara.

LITERATURE CITED
ASKINS, R. A., J. F. LYNCH, AND R. GREENBERG.
1990. Populations declines in migratory birds in
eastern North America. Curr. Ornithol. 7:1-57.
BLAKE, J. G., AND B. A. LOISELLE. 1992. Habitat
use by Neotropical migrants at La Selva Biologi-
cal Station and Braulio Carrillo National Park,
Costa Rica. Pp. 257-272 in Ecology and conser-
vation of Neotropical migrant landbirds (Hagan,
J. M., III, and D. W. Johnston, Eds.). Washing-
ton DC: Smithson. Inst. Press.
DIAMOND, A. W., AND R. W. SMITH. 1973. Returns
and survival of banded warblers wintering in Ja-
maica. Bird-Banding 44:221-224.
FAABORG, J. R., AND W. J. ARENDT. 1989. Long-
term declines in winter residents warblers in a
Puerto Rican dry forest. Am. Birds 43:1126-
1230.
FAABORGH, J. R. AND W. J. ARENDT. 1992. Long
term declines in winter residents warblers in a
Puerto Rican dry forest: which species are in
trouble? Pp. 57-63 in Ecology and conservation
of Neotropical migrant landbirds (Hagan, J. M.,
III, and D. W. Johnston, Eds.). Washington DC:
Smithson. Inst. Press.
GARCIA, M. E., AND D. RODRIGUEZ. 1988. Amplia-
ci6n de fechas para aves migratorias en Cuba.
Garciana 12:3.
GONZALEZ, H., M. MACNICHOLS, P. HAMEL, M.
ACOSTA, E. GODINEZ, D. RODRIGUEZ, J. SIROIS,
AND D. MACRAE. 1990. Preliminary results of a
cooperative bird banding project in the Cidnaga
de Zapata, Cuba. Phase one, January 1988 Pro-
gress Notes No. 187.
GONZALEZ H., M. MACNICHOLL, P. HAMEL, M.
ACOSTA, E. GODINEZ, J. HERNANDEZ, D. RODRI-


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 92









GONZALEZ ALONSO ETAL. -STATUS OF RESIDENT AND MIGRANT BIRD COMMUNITIES IN CUBAN ECOSYSTEMS


GUEZ, J. JACKSON, C. MARCOS, R. D. MCRAE,
AND J. SIROIS. 1992a. A cooperative bird-
banding project in Peninsula de Zapata, Cuba,
1988-89. Pp. 131-142 in Ecology and conserva-
tion of Neotropical migrant landbirds (Hagan, J.
M., III, and D. W. Johnston, Eds.). Washington
DC: Smithson. Inst. Press.
GONZALEZ, H., E. GODINEZ, AND A. PEREZ. 1992b.
Dos nuevas especies de aves para la Peninsula de
Guanahacabibes, P. del Rio, Cuba. Comunica-
ciones Breves de Zoologia 1:24-25.
GONZALEZ, H., E. GODINEZ, P. BLANCO, AND A.
PEREZ. 1992c. Three new records of Neotropical
migrants birds at Guanahacabibes Peninsula, Cu-
ba. Ornitologia Caribefia 3:56-57
GONZALEZ, H., E. GODINEZ, P. BLANCO, AND A.
PEREZ. 1997. Caracteristicas ecol6gicas de las
comunidades de aves en diferentes habitat de la
Reserva de la Biosfera Peninsula de Guanahaca-
bibes, Pinar del Rio, Cuba. Avicennia 6/7:103-
110.
GONZALEZ, H., E. GODINEZ, AND P. BLANCO. 2000.
Caracteristicas ecol6gicas de la comunidad de
aves en la Peninsula de Hicacos, Matanzas, du-
rante la migraci6n otofial. Avicennia 12-13: 25-
34.
HUTTO, R., S. M. PLETSCHET, AND P. HENDRICKS.
1986. A fixed radius point count method for non-
breeding and breeding season use. Auk 103:593-
602.
JAMES, F. C., AND H. H. SHUGART. 1970. A quanti-
tative method of habitat description. Audubon
Field Notes 24: 727-736.
LLANES, A., A. KIRKCONNELL, R. POSADA, AND S.
CUBILLAS. 1987. Nuevos reportes de fechas de
aves migratorias para Cuba. Miscelinea Zool6gi-
ca No. 36.
NOON, B. R. 1981. Techniques for sampling avian
habitats. Pp. 42-52 in The use of multivariate
statistics in studies of wildlife habitat (Capen, D.
E., ed.). USDA Forest Service Technical Report
RM-87.
PETIT, D. R., J. LYNCH, R. HUTTO, J. BLAKE, AND
R. WAIDE. 1993. Management and conservation
of migratory landbirds overwintering in the Neo-


tropics. Pp. 70-92 in Status and management of
Neotropical migratory birds (Finch, D., and P.
W. Stangel, Eds.). USDA Forest Service. Gene-
ral Technical Report RM-229.
ROBBINS, C., J. R. SAUER, R. S. GREENBERG, AND
S. DROEGE. 1989. Population declines in North
American birds that migrate to the Neotropics.
Proc. Natl. Acad. Sci. USA 86:7658-7662.
RODRIGUEZ, D., AND B. SANCHEZ. 1995. Avifauna
del matorral xeromorfo en la region oriental de
Cuba durante la migraci6n otofial (octubre de
1989, 1990, 1991). Poeyana 447:1-12.
RODRIGUEZ, D., B. SANCHEZ, A. TORRES, AND A.
RAMS. 1994. Composici6n y abundancia de las
aves durante la migraci6n otofial en Gibara, Cu-
ba. Avicennia 1:101-109.
SANCHEZ, B., R. OVIEDO, N. NAVARRO, A. HER-
NANDEZ, C. PENA, E. REYES, AND R. SANCHEZ.
1998. Composici6n y abundancia de la avifauna
en tres formaciones vegetales en la meseta de
Nipe, Holguin, Cuba. Pitirre 11:107.
SANCHEZ, B., D. RODRIGUEZ, AND M. ACOSTA.
1992a. Nuevos reportes y recapturas de aves mi-
gratorias en la Cidnaga de Zapata, Cuba. Comu-
nicaciones Breves de Zoologia, IES:4-5
SANCHEZ, B., D. RODRIGUEZ, AND A. KIRKCON-
NELL. 1994. Avifauna de los cayos Pared6n
Grande y Coco durante la migraci6n otofial de
1990 y 1991. Avicennia 1:31-38.
SANCHEZ, B., D. RODRIGUEZ, A. TORRES, A.
RAMS, AND A. ORTEGA. 1992b. Nuevos reportes
de aves para el corredor migratorio de Gibara,
Provincia de Holguin, Cuba. Comunicaciones
Breves de Zoologia, IES:4-5
WAIDE, R., AND J. M. WUNDERLE, JR. 1989. The
response of migrant birds to changing habitats in
the Greater Antilles and the Bahamas. P. 7 in
Ecology and conservation of migrant landbirds
Symposium. Woods Hole, MA. (Abstract).
WALLACE, G. E., H. GONZALEZ, M. K.
McNICHOLL, D. RODRIGUEZ, R. OVIEDO, A.
LLANES, B. SANCHEZ, AND E. WALLACE. 1996.
Forest-dwelling Neotropical migrant and resident
birds wintering in three regions of Cuba. Condor
98:745-768.


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 93












STATUS AND CONSERVATION OF THE FAMILY PSITTACIDAE IN THE WEST INDIES


JAMES W. WILEY\ ROSEMARIE S. GNAM2, SUSAN E. KOENIG3, ALWIN DORNELLY4, XIOMARA GALVEZ5,
PATRICIA E. BRADLEY6, THOMAS WHITE 7, MICHAEL ZAMORE8, PAUL R. REILLO9, AND DONALD ANTHONY10

1U. S. Geological Survey, Maryland Cooperative Fish and Wildlife Research Unit, 1120 Trigg Hall, University
of Maryland Eastern Shore, Princess Anne, AID 21853, USA, jwwiley@mail.umes.edu; Center for Biodiversity
and Conservation, American Museum of Natural History, Central Park West at 79th Street, New York, NY 10024,
USA, rgnam@amnh.org; 3 Windsor Research Station, Sherwood Content PO, Trelawny, Jamaica, win-
dsor@tcwjamaica.com, 4Department of Natural Resources Conservation, University of Massachusetts, 160 Hold-
worth Way, Amherst, ME 01003, USA, ezrad2000@hotmail.com, 5Empresa Nacional para la Protecci6n de la
Flora y la Fauna, La Habana, Cuba, consaves@ceniai.infcu; 6P. 0. Box 2394 GT, Grand Cayman, Cayman
Islands, British West Indies, pebrad@tcandw.ky; U. S. Fish and Wildlife Service, Puerto Rican Parrot Recovery
Program, Box 1600, Rio Grande, Puerto Rico 00745, diputado99@hotmail.com, 8Maryland-National Capital
Park and Planning Commission, Montgomery County Department of Park and Planning, 8787 Georgia Avenue,
Silver Spring, MD 20910, USA, michael.zamore@/mncppc-mc.org; 9Rare Species Conservatory Foundation,
1222 "E" Rd., Loxahatchee, FL 33470, USA, paulreillo@rarespecies.org, and 10Forestry Department, Ministry
of Agriculture, Forestry and Fisheries, Gabriel Charles Forestry Complex, Union, Castries, St. Lucia, anthony-
donald @hotmail. com.


Abstract.-The status of native West Indian parrots (Amazona; n = 12) and parakeets (Aratinga; n = 3) is re-
viewed, as are the environmental problems that have affected the species and the current and planned conservation
efforts. All parakeet species are in decline and are of great concern. The four Lesser Antillean species of amazon
parrots have shown increasing populations since the 1970s, the result of aggressive habitat protection and vigorous
environmental education campaigns. Amazon parrot populations in the Bahamas (Abaco and Inagua), Cuba, Cay-
man Islands, and perhaps Jamaica are stable, but most continue to be at varying risk to declines resulting from
further habitat loss and other environmental problems. The Cuban Parrot (Amazona leucocephala) population in
the Isla de Pinos has shown substantial population growth, resulting from a vigorous management effort. The
Puerto Rican Parrot (A. vittata) continues as the species at greatest risk of extinction, with the wild population
fluctuating from 30 to 48 individuals since Hurricane Hugo (1989) caused severe damage to the species' habitat.
Recent successes in saving some parrot populations from probable extinction (e.g., Puerto Rican Parrot) or the
substantial recovery of some small, local populations (e.g., Red-necked Parrot) give conservationists guarded opti-
mism that these species will recover. Other populations, though showing stable population levels (e.g., Cayman
Brac Parrot), are at great risk to rapid extinction and pose substantial conservation challenges. We present points
to consider in developing conservation strategies for the region's parrots and parakeets. It is of particular concern
that recovery programs are initiated sufficiently early to avoid the desperate and expensive measures needed to
recover severely reduced populations. Conservation efforts must not fall into a state of complacency based on lim-
ited successes, which may prove to be short-lived. Also, successful parrot conservation programs may lead to new
problems that will challenge the ingenuity of the conservation community, including renewed conflicts between
newly expanding parrot populations and agriculture. Perhaps the most daunting of the new threats is disease, car-
ried to naive island populations by the largely uncontrolled proliferation of exotic parrots and other cage birds.
West Nile virus and equine encephalitis represents new, unmeasured, and currently uncontrollable threats across
the Caribbean.
Key words: Amazona, Aratinga, Caribbean, conservation, parakeet, parrot, status, West Indies

Resumen.-ESTADO Y CONSERVACION DE LA FAMILIA PSITTACIDAE EN LAS INDIAS OCCIDENTALES. Se analiza
el estado de las cotorras (Amazona; n = 12) y pericos (Aratinga; n = 3) nativos de las Indias Occidentales, al igual
que los problemas ambientales que han afectado a las especies y los esfuerzos actuales y previstos de conserva-
cidn. Todas las especies de pericos estan en declive y son de gran preocupaci6n. Las cuatro especies de amazona
en las Antillas Menores han aumentado sus poblaciones desde la d6cada de 1970 como resultado de la proteccion
en6rgica del habitat y vigorosas campafias de educaci6n ambiental. Las poblaciones de amazonas en las Bahamas
(Abaco e Inagua), Cuba, las islas Caiman, y quizas Jamaica, son estables, pero la mayoria siguen estando en peli-
gro de experimentar declives como resultado de la p6rdida adicional de habitat y otros problemas ambientales. La
poblaci6n de la Cotorra Cubana (Amazona leucocephala) en la isla de Pinos ha aumentado considerablemente
como resultado de esfuerzos de manejo agresivos. La Cotorra Puertorriquefia (A. vittata) sigue siendo la especie
en mayor riesgo de extinci6n, con la poblaci6n salvaje fluctuando entre 30 y 48 individuos desde que el huracan
Hugo (1989) causara severos dafios al habitat de la especie. Los 6xitos recientes en el rescate de algunas poblacio-


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 94









WILEY ETAL.-STATUS & CONSERVATION OF PSITTACIDS IN WEST INDIES


nes de cotorras de una probable extinci6n (e.g., Cotorra Puertorriquefia) o la recuperaci6n sustancial de algunas
poblaciones locales pequefias (e.g., Cotorra Cuellirroja) le ofrecen a los conservacionistas cierto optimismo que
estas especies se recuperaran. Otras poblaciones, aunque presentan niveles poblacionales estables (e.g., Cotorra de
Cayman Brac), se encuentran seriamente amenazadas de extinguirse rapidamente y suponen retos conservacionis-
tas considerables. Presentamos factores que se deben considerar al desarrollar estrategias de conservaci6n para las
cotorras y pericos de la region. Es particularmente importante que los programas de recuperaci6n se inicien lo
suficientemente temprano para evitar las medidas desesperadas y costosas que se necesitan para recuperar pobla-
ciones severamente diezmadas. Los esfuerzos conservacionistas no se pueden considerar como exitosos si se ba-
san en 6xitos limitados que pueden demostrar ser de breve duraci6n. Ademas, los programas exitosos de conserva-
ci6n con cotorras pueden resultar en nuevos problemas que desafiaran el ingenio de la comunidad conservacionis-
ta, incluyendo conflictos renovados entre poblaciones de cotorras en expansion y la agricultura. Quizas la mas
desalentadora de las nuevas amenazas sean las enfermedades, transportadas a poblaciones indefensas en las islas
gracias a la proliferaci6n, en gran parte sin control, de cotorras ex6ticas y otras aves de jaula. El virus del Nilo
Occidental y la encefalitis equina representan nuevas amenazas, aun sin estudiar y actualmente incontrolables, a
trav6s de todo el Caribe.
Palabras clave: Amazona, Aratinga, Caribe, conservaci6n, cotorra, estado, Indias Occidentales, perico

Resumn.-STATUT ET CONSERVATION DE LA FAMILLE DES PSITTACIDAE DANS LES ANTILLES. Le statut des per-
roquets des Antilles (Amazona, n = 12; Aratinga; n = 3) est analyst, parallelement aux difficulties environnementa-
les qui affectent l'espece, ainsi que les efforts de conservation actuels et planifi6s. Toutes les especes du genre
Aratinga sont en regression et posent de s6rieuses inqui6tudes. Les 4 especes d'amazones des Petites Antilles sont
en augmentation depuis les ann6es 1970, grace a des mesures drastiques de protection et d'efficaces actions d'6du-
cation a l'environnement. Les populations d'amazones des Bahamas (Abaco et Inagua), de Cuba, des iles Cayman
et peut-etre de Jamaique sont stables mais la plupart continuent a etre exposes a des risques variables de d6clin en
raison de la poursuite de la regression de leur habitat et d'autres problems environnementaux. La population d'A-
mazone de Cuba (Amazona leucocephala) de I'lle des Pins a progress de maniere significative a la suite d'un
effort considerable de gestion. L'Amazone de Porto Rico (A. vittata) est toujours l'espece la plus menace d'ex-
tinction avec une population sauvage fluctuant entre 30 et 48 individus depuis que l'ouragan Hugo (1989) a pro-
voqu6 des dommages s6veres a son habitat. Les success r6cents de sauvegarde de certaines populations de perro-
quets d'une extinction probable (par exemple l'Amazone de Porto Rico) ou la forte augmentation locale de certai-
nes petites populations (par exemple l'Amazone de Bouquet) permettent aux acteurs de la conservation d'avoir un
optimisme mesur6 sur leur avenir. D'autres populations, bien que pr6sentant des effectifs stables (comme la popu-
lation d'Amazone de Cuba a Cayman Brac), restent exposes a des risques elev6s de disparition rapide et suscitent
des questions complexes de conservation. Les points a consid6rer pour le d6veloppement de strategies de conser-
vation des Psittacid6s de la region sont pr6sent6s. Il est particulierement important que les programmes de conser-
vation soient initi6s suffisamment t6t pour 6viter de prendre des mesures d6sesperees et coiteuses n6cessaires a la
sauvegarde des populations tries r6duites. Les mesures de conservation doivent 6viter de tomber dans un 6tat d'au-
tosatisfaction base sur des success, limits, qui seraient de courte dur6e. Mais, les programmes de conservation de
perroquets qui r6ussissent peuvent aussi faire apparaitre de nouvelles difficulties qui mettront au d6fi la naivete des
protecteurs. Celles-ci comporteront la r6apparition de conflits entre les populations de perroquets en expansion et
l'agriculture. Une des nouvelles menaces parmi les plus insidieuses concerne les maladies, apport6es aux popula-
tions insulaires jusqu'alors non exposes par la proliferation largement non controlee de perroquets exotiques et
d'autres oiseaux de cage. Le virus du West Nile et l'enc6phalite equine sont de nouvelles menaces pour toute la
Caraibe non 6valu6es et aujourd'hui incontrolables.
Mots-clks: Amazona, Antilles, Aratinga, Caraibe, conservation, perroquet, statut


INTRODUCTION among islands. Indeed, many species (e.g., Ara au-
AT THE TIME of Columbus's arrival in the West thocthones, unidentified Ara from Puerto Rico) are
Indies, the psittacine fauna was rich, consisting of known from kitchen middens because, aside from
as many as 34 species (up to eight parakeets, 12 ma- serving as companions, they served as meals when
caws, and 14 amazon parrots; Williams and Stead- needed. These early man-aided translocations may
man 2001; Table 1; Figs. 1 and 2). Interpretations of have affected the present day distribution of psittac-
parrot biogeography are particularly difficult in the ids and, with the absence of a complete specimen
West Indies, because many of these birds were kept record, further complicate the already difficult puz-
as pets by Amerindians and were likely transported zle of species' original distributions based on the
as human populations expanded and journeyed sketchy descriptions of early European colonists.


Special Issue Honoring Nedra Klein


Journal of Caribbean Ornithology


Page 95










WILEY ETAL.-STATUS & CONSERVATION OF PSITTACIDS IN WEST INDIES


Table 1. Known psittacine fauna of the West Indies, with current status of species and populations. Status includes IUCN Red List
(Hilton-Taylor 2000) abbreviations and appendix designation in CITES. Only native species and species introduced more than 75 years
ago are included.


Island


Species'


Status


Bahama Islands

Turks & Caicos Islands
Cuba



Grand Cayman
Cayman Brac


Little Cayman
Jamaica








Hispaniola




Puerto Rico



Culebra Island
Virgin Islands

Antigua
Barbuda

Montserrat

Guadeloupe



Marie Galante

Dominica



St. Lucia
Martinique



St. Vincent
Grenada
Barbados


Amazona leucocephala bahamensis

Amazona undescribed sp.T
Ara tricolor
Amazona leucocephala leucocephala
Amazona leucocephala palmarum
Aratinga euops
Amazona leucocephala caymanensis
Amazona leucocephala hesterna


Amazona leucocephala hesterna
Ara erythrocephalat
Ara gosseit'
Ara erythruraT
Ara tricolor
Amazona collaria
Amazona agilis
Forpus passerinus
Aratinga nana
Ara unknown sp.T
Ara tricolor
Amazona ventralis

Aratinga chloroptera
Ara unknown sp.T

Amazona vittata vittata
Aratinga [chloroptera] maugeit
Amazona vittata gracilipest
Ara autochthonest
Aratinga pertinax
Amazona vittata
Amazona vittata
Aratinga undescribed sp.T
Ara undescribed sp.T
Amazona undescribed sp.T
Ara guadeloupensisT'
Anodorhynchus purpurascenst
Amazona violaceat
Aratinga labatit
Ara cf. guadeloupensisT'
Amazona cf. violaceat
Ara atwoodit
Amazona imperialis
Amazona arausiaca
Aratinga undescribed sp.T
Amazona versicolor
Ara martinicust

Amazona martinicanaT'
Aratinga undescribed sp.T
Amazona guildingii
Amazona undescribed sp.T
Aratinga undescribed sp.T


1t = extinct.
21UCN Red List (Hilton-Taylor 2000) status: CR = Critically Endangered,
Near Threatened.
3CITES Appendix.


LR/NT I ; common on Great Inagua, threatened on Abaco,
extirpated on other islands
Extinct; Grand Turk; prehistoric remains
Extinct; range included Isla de Pinos
LR/NT2, 3; declining
LR/NT2, 3; declining
VU2, II3; declining, extirpated from Isla de Pinos
LR/NT2, I3; ca. 2000 birds, stable
LR/NT2, I3; 300-430 birds; stable, but because of so few birds
and the tiny range of this population, considered in danger of
rapid extinction
Extirpated
Extinct
Extinct
Extinct; questionable
Extinct; presence in Jamaica questionable
VU2, II3; small population, declining
VU2, II3; small population, declining
Introduced, locally common
II3; declining, but still locally common
Extinct
Extinct; questionable
VU2, II3; widespread and locally common, but declining rap-
idly
VU2, II3; declining
Extinct; known from aboriginal middens; possibly A. autoch-
thones orA. tricolor
CR2, 3; tiny population; aggressive conservation program
Extinct
Extinct
Extinct; St. Croix
II3; common, believed introduced from Curacao
Extirpated; prehistoric remains
Extirpated
Extinct; prehistoric remains
Extinct; prehistoric remains
Extinct; prehistoric remains
Extinct
Extinct; validity of species in doubt
Extinct
Extinct
Extinct; prehistoric remains
Extinct; prehistoric remains
Extinct
VU2, 13; 150 individuals
VU2, 13; 800+ individuals
Extinct
VU2, I3; 800 individuals
Extinct; validity of species in doubt; also possibly another
undescribed Ara species
Extinct
Extinct
VU2, 13; 519 individuals
Extinct
Extinct


EN Endangered, VU Vulnerable, LR Lower Risk, NT -


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 96









WILEY ETAL.-STATUS & CONSERVATION OF PSITTACIDS IN WEST INDIES


Fig. 1. Early macaw, parrot, and parakeet distribution in the Greater Antilles at the time of Columbus's arrival
(1492). Numbers represent known forms from the islands, T = extinct.


Certain, however, is that in less than 500 years
the parrot diversity of the region has been vastly
reduced: all 12 macaw species have disappeared,
63% of the native parakeet species have become
extinct, and 36% of the amazon parrot species have
been lost (Table 1; Figs. 1 and 2). Thus, only 35%
(15) of the original psittacine species survive today.
The Greater Antilles (Cuba, Hispaniola, Jamaica,
Puerto Rico, Virgin Islands), Cayman Islands, and
Bahama Islands were home to at least 13 psittacine
species (four macaws, four parakeets, and five ama-
zon parrots; Table 1). Although the parrot fauna of
these northern islands fared better than the Lesser
Antillean parrots, 38% of the species are now ex-
tinct. The psittacine fauna of the Lesser Antilles suf-
fered greater losses, with an overall 78% extinction
rate (14 of 18 species), including macaws (5 of 5),
parakeets (5 of 5), and amazon parrots (4 of 8; 50%)
(Table 1). Whereas all parakeets and parrots in the
region exhibit varying risk of further decline
through accelerating habitat loss and other human-
related activities, the three surviving parakeet spe-
cies seem to be especially vulnerable, judging from
this group's history of extinction in the West Indies.
Native Aratinga parakeets survive only in Cuba
(Aratinga euops), Jamaica (A. nana), and His-
paniola (A. chloroptera).


Each of the inhabited islands has one native spe-
cies of Amazon parrot, except Jamaica, with Ama-
zona agilis and A. collaria, and Dominica, with A.
imperialis and A. arausiaca. Among the other is-
lands A. ventralis occurs in Hispaniola, A. vittata in
Puerto Rico, A. guildingii in St. Vincent, A. versi-
color in St. Lucia, and the A. leucocephala complex
in Cuba (nominate leucocephala), Bahama Islands
(race bahamensis), and the Cayman Islands (Grand
Cayman with caymanensis, Cayman Brac with
hesterna).
During the last quarter of the twentieth century,
several exotic psittacine species became established
in the region, particularly in Puerto Rico and the U.
S. Virgin Islands (Philibosian and Yntema 1977,
Raffaele 1983). Two species, however, were estab-
lished in the region considerably earlier. The
Brown-throated Parakeet (Aratinga pertinax) may
have been introduced to St. Thomas from Curaqao
over a century ago (Philibosian and Yntema 1977,
Forshaw 1978, Wiley 1993a). The Green-rumped
Parrotlet (Forpus passerinus) was introduced to Ja-
maica in 1918 (Bond 1956, Lack 1976), and has
since steadily increased its range and is now wide-
spread in wooded cultivation from sea level to
around 500 m elevation. The parrotlet is unusual
among introduced species in the West Indies in that


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 97









WILEY ETAL.-STATUS & CONSERVATION OF PSITTACIDS IN WEST INDIES


Fig. 2. Early macaw, parrot, and parakeet distribution in the Lesser An-
tilles at the time of Columbus's arrival (1492). Numbers represent
known forms from the islands, T = extinct, X = extirpated.


it occurs to some extent in natural forests.
This report updates the status and trends of psit-
tacines in the Caribbean islands as reported by But-
ler (1991, 1992a) and Wiley (1991), presenting
summaries of the efforts on behalf of the region's
parrots and reporting on new problems associated
with the positive reversal of fortunes, albeit tenuous
in some cases, of parrots in the West Indies. We
also summarize refinements in earlier population
estimates and distributions. First we present general
information on threats to the region's parrots, then
examine each extant, native taxon, island-by-island,
giving special attention to those islands that have
made substantial efforts in parrot conservation and
to species that have exhibited population changes.
We use the term parrot for members of the genus
Amazona, parakeet for Aratinga spp., and macaw
for the genera Ara and Anodorhynchus.
ORIGINAL ECOSYSTEMS
Habitat diversity before Columbus's arrival in the
West Indies ranged from simple to complex. Some
islands that are small and low, like the Bahamas and
Cayman Islands, have always had relatively little
vegetational diversity compared to the larger is-
lands. Hispaniola, with an area of 81,000 km2 and


two peaks higher than 3000 m, has multiple vegeta-
tional zones ranging from cactus scrub woodland in
the arid coastal regions to alpine cloud-forest with
extensive broadleaf forests. West Indian psittacids
originally occupied essentially all habitat types with
food-bearing plants, including arid cactus wood-
lands, wet and xeric broadleaf forests, palm savan-
nas, pine woodlands, coppice, and mangrove forest.
However, as land was cleared for cultivation, habi-
tats were either destroyed or greatly altered, with
moist forests of the coastal and lowland montane
zones disappearing first. Today, only remote forests
in the most rugged areas predominantly in island
interiors have escaped cutting, and only in these
areas have parrots survived in substantial numbers.
CAUSES OF DECLINES IN PARROT POPULATIONS
Environmental assaults, almost all of which are tied
to human activities, have driven parrot population
declines and extinctions across the West Indies. The
most widespread and important of the causes of de-
cline are summarized below.
Habitat loss. Undoubtedly, habitat degradation,
fragmentation, and loss resulting from agricultural
and timber activities and urban development have
been the most important factors in the decline of


Journal of Caribbean Ornithology Special Issue Honoring Nedra Klein


Page 98




University of Florida Home Page
© 2004 - 2010 University of Florida George A. Smathers Libraries.
All rights reserved.

Acceptable Use, Copyright, and Disclaimer Statement
Last updated October 10, 2010 - - mvs