Group Title: BMC Biology
Title: Inter-genomic displacement via lateral gene transfer of bacterial trp operons in an overall context of vertical genealogy
CITATION PDF VIEWER THUMBNAILS PAGE IMAGE ZOOMABLE
Full Citation
STANDARD VIEW MARC VIEW
Permanent Link: http://ufdc.ufl.edu/UF00100048/00001
 Material Information
Title: Inter-genomic displacement via lateral gene transfer of bacterial trp operons in an overall context of vertical genealogy
Physical Description: Book
Language: English
Creator: Xie, Gary
Bonner, Carol
Song, Jian
Keyhani, Nemat
Jensen, Roy
Publisher: BMC Biology
Publication Date: 2004
 Notes
Abstract: BACKGROUND:The growing conviction that lateral gene transfer plays a significant role in prokaryote genealogy opens up a need for comprehensive evaluations of gene-enzyme systems on a case-by-case basis. Genes of tryptophan biosynthesis are frequently organized as whole-pathway operons, an attribute that is expected to facilitate multi-gene transfer in a single step. We have asked whether events of lateral gene transfer are sufficient to have obscured our ability to track the vertical genealogy that underpins tryptophan biosynthesis.RESULTS:In 47 complete-genome Bacteria, the genes encoding the seven catalytic domains that participate in primary tryptophan biosynthesis were distinguished from any paralogs or xenologs engaged in other specialized functions. A reliable list of orthologs with carefully ascertained functional roles has thus been assembled and should be valuable as an annotation resource. The protein domains associated with primary tryptophan biosynthesis were then concatenated, yielding single amino-acid sequence strings that represent the entire tryptophan pathway. Lateral gene transfer of several whole-pathway trp operons was demonstrated by use of phylogenetic analysis. Lateral gene transfer of partial-pathway trp operons was also shown, with newly recruited genes functioning either in primary biosynthesis (rarely) or specialized metabolism (more frequently).CONCLUSIONS:(i) Concatenated tryptophan protein trees are congruent with 16S rRNA subtrees provided that the genomes represented are of sufficiently close phylogenetic spacing. There are currently seven tryptophan congruency groups in the Bacteria. Recognition of a succession of others can be expected in the near future, but ultimately these should coalesce to a single grouping that parallels the 16S rRNA tree (except for cases of lateral gene transfer). (ii) The vertical trace of evolution for tryptophan biosynthesis can be deduced. The daunting complexities engendered by paralogy, xenology, and idiosyncrasies of nomenclature at this point in time have necessitated an expert-assisted manual effort to achieve a correct analysis. Once recognized and sorted out, paralogy and xenology can be viewed as features that enrich evolutionary histories.
General Note: Start page 15
General Note: M3: 10.1186/1741-7007-2-15
 Record Information
Bibliographic ID: UF00100048
Volume ID: VID00001
Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: Open Access: http://www.biomedcentral.com/info/about/openaccess/
Resource Identifier: issn - 1741-7007
http://www.biomedcentral.com/1741-7007/2/15

Downloads

This item has the following downloads:

PDF ( PDF )


Full Text


B
BMC Biology Biole Central


Research article


Inter-genomic displacement via lateral gene transfer of bacterial trp
operons in an overall context of vertical genealogy
Gary Xie1, Carol A Bonner2, Jian Song', Nemat 0 Keyhani2 and
Roy A Jensen*1,2

Address: 'Los Alamos National Laboratory, Los Alamos, New Mexico, 87544, USA and 2Department of Microbiology & Cell Science, University of
Florida, PO Box 110700, Gainesville, Florida, 32611, USA
Email: Gary Xie xie@lanl.gov; Carol A Bonner cbonner@ufl.edu; Jian Song jian@lanl.gov; Nemat 0 Keyhani keyhani@ufl.edu;
Roy A Jensen* rjensen@ufl.edu
* Corresponding author



Published: 23 June 2004 Received: 27 January 2004
BMC Biology 2004, 2:15 doi:10.I 186/1741-7007-2-15 Accepted: 23 June 2004
This article is available from: http://www.biomedcentral.com/1741-7007/2/15
2004 Xie et al; licensee BioMed Central Ltd. This is an Open Access article: verbatim copying and redistribution of this article are permitted in all media
for any purpose, provided this notice is preserved along with the article's original URL.



Abstract
Background: The growing conviction that lateral gene transfer plays a significant role in
prokaryote genealogy opens up a need for comprehensive evaluations of gene-enzyme systems on
a case-by-case basis. Genes of tryptophan biosynthesis are frequently organized as whole-pathway
operons, an attribute that is expected to facilitate multi-gene transfer in a single step. We have
asked whether events of lateral gene transfer are sufficient to have obscured our ability to track
the vertical genealogy that underpins tryptophan biosynthesis.
Results: In 47 complete-genome Bacteria, the genes encoding the seven catalytic domains that
participate in primary tryptophan biosynthesis were distinguished from any paralogs or xenologs
engaged in other specialized functions. A reliable list of orthologs with carefully ascertained
functional roles has thus been assembled and should be valuable as an annotation resource. The
protein domains associated with primary tryptophan biosynthesis were then concatenated, yielding
single amino-acid sequence strings that represent the entire tryptophan pathway. Lateral gene
transfer of several whole-pathway trp operons was demonstrated by use of phylogenetic analysis.
Lateral gene transfer of partial-pathway trp operons was also shown, with newly recruited genes
functioning either in primary biosynthesis (rarely) or specialized metabolism (more frequently).
Conclusions: (i) Concatenated tryptophan protein trees are congruent with 16S rRNA subtrees
provided that the genomes represented are of sufficiently close phylogenetic spacing. There are
currently seven tryptophan congruency groups in the Bacteria. Recognition of a succession of
others can be expected in the near future, but ultimately these should coalesce to a single grouping
that parallels the I6S rRNA tree (except for cases of lateral gene transfer). (ii) The vertical trace
of evolution for tryptophan biosynthesis can be deduced. The daunting complexities engendered
by paralogy, xenology, and idiosyncrasies of nomenclature at this point in time have necessitated
an expert-assisted manual effort to achieve a correct analysis. Once recognized and sorted out,
paralogy and xenology can be viewed as features that enrich evolutionary histories.






Page 1 of 30
(page number not for citation purposes)


70p7en7A7c







http://www.biomedcentral.com/1741-7007/2/15


Background
The process of LGT
Lateral gene transfer (LGT) undoubtedly occurs with high
frequency [1]. But what is required for any given LGT
event to escape transience and actually survive as a non-
vertical contributor to the evolutionary history of a spe-
cies? (i) Initially the incoming gene(s) must be replicated
in the original recipient cell and its immediate progeny.
(ii) Selective advantages of the LGT-gene(s) must be suffi-
cient to foster eventual domination of the species popula-
tion. (iii) During this time a crucial factor influencing
survival will be whether the considerable demands
imposed by the recipient genome for amelioration of
alien genes can be met [2]. Obviously, there will be less
amelioration pressure if the donor and recipient genomes
are phylogenetically close and have similar guanine/cyto-
sine base ratios, dinucleotide frequencies, promoter
motifs, and so on. Even here a LGT insertion into a
genome might be contra-selected for other reasons, for
example, if the location of the insertion disrupts the sym-
metry and physical balance between the origin and termi-
nus points of replication [3]. There is a balance in that one
can expect alien sources of greatest novelty to be phyloge-
netically distant, yet genes from such remote sources will
usually confront the greatest amelioration pressures. The
most obvious candidates as successfully imported alien
genes will encode novel functions that confer clear selec-
tive value, such as resistance to threatening environmental
agents (e.g. antibiotics) or ability to utilize a new source
of carbon and energy.

Enhanced probability of LGT success can be expected if
only a single gene is needed for the novel function. This
does not necessarily rule out the acquisition of a new
function that is complex and multi-genic. Sometimes
where existing functions are complex and multi-step, a
single incoming gene can create a new metabolic linkage.
For example, an organism having a multi-step pathway for
tyrosine catabolism could acquire a previously unavaila-
ble ability to also catabolize phenylalanine through
import of a gene encoding phenylalanine hydroxylase
(which converts phenylalanine to tyrosine). In cases
where the total repertoire of multiple steps that define a
novel function are all absent in a given organism, acquisi-
tion of that function by LGT would be highly improbable
were it not for the existence of operon modules in
prokaryotes. Lawrence has proposed, in fact, that gene
organization as operons largely exists because of "selfish"
properties that operate at the hierarchical level of genes
[4,5]. Although genes of L-tryptophan (Trp) biosynthesis,
a classic operon system, are completely dispersed in some
prokaryote genomes (e.g. Aquifex, Chlorobium, Wolinella
and unicellular cyanobacteria such as Synechococcus, Syne-
chocystis, and Prochlorococcus), they usually exist either as


whole-pathway operons or as a combination of several
partial-pathway operons [6].

Approaches for the detection of LGT events are either phy-
logenetic or parametric. Parametric approaches include
the detection of nucleotide composition, dinucleotide fre-
quencies and codon-usage biases in gene segments that
are atypical of the recipient genome. Such parametric
analysis is well illustrated by a study of the Escherichia coli
genome [1]. However, such atypical parametric properties
will drift with time toward those of the recipient genome
(amelioration). Therefore, parametric analysis is limited
to detection of genes that were acquired recently. We have
found only a single example where trp genes exhibited
parametric features suggesting LGT. In this case a low-GC
gene block in Xylella fastidiosa contains seven genes, of
which two encode the subunits of anthranilate synthase
and one encodes a repressor, TrpR [7]. On the other hand,
phylogenetic analysis can detect ancient events of LGT,
and this approach has allowed the recognition of a
number of whole-pathway and partial-pathway trp oper-
ons that were acquired by LGT. Presumably, the initial
aberrant parametric properties associated with LGT have
been ameliorated. Phylogenetic analysis also is a much
more powerful indicator of the likely donor lineage fol-
lowing gene acquisition by LGT.

En bloc importation of primary pathways via LGT
Ubiquitous pathways of primary biosynthesis, having a
long history of genomic optimization and metabolic inte-
gration, are generally improbable candidates for replace-
ment by LGT [8]. Among the challenges confronting
successful LGT are that key regulatory genes may be spa-
tially separated from the structural genes, and promoters
and transcription signals vary between bacterial species, as
also is the case for elements required for translation.

Exceptions can be envisioned, among them: (i) A gene of
primary biosynthesis could, in fact, be synonymous with
a gene of antibiotic resistance. Thus, if one or more pri-
mary-pathway enzymes is the target of an antimicrobial
agent, then genes in nature that encode resistant versions
of that enzyme(s) could confer strong selective pressure
for replacement. The apparent displacement of an essen-
tial enzyme of isoprenoid biosynthesis (hydroxymethylgl-
utaryl coenzyme A reductase) in Archaea by a statin-
resistant enzyme of bacterial origin exemplifies this [9].
(ii) If primary pathway genes are lost by deletion, as often
occurs with pathogens or symbionts, re-acquisition of the
pathway might later become advantageous. In this case,
no native pathway having a sophisticated history of amel-
ioration is present to out-compete a pathway of alien ori-
gin. In a sense, the recipient has reverted to a pristine
evolutionary state that is probably subject to instability
and rapid change. (iii) An alien suite of enzymes might


Page 2 of 30
(page number not for citation purposes)


BMC Biology 2004, 2:15







http://www.biomedcentral.com/1741-7007/2/15


Table I: Key to nomenclature used

New gene name


Prior gene name


Protein domain encoded


trpAa trpE Anthranilate synthase: aminase subunit (a)
trpAb trpG Anthranilate synthase: amidotransferase subunit (P)
trpB trpD Anthranilate phosphoribosyl transferase
trpC trpF Phosphoribosyl-anthranilate isomerase
trpD trpC Indoleglycerol phosphate synthase
trpEa trpA Tryptophan synthase, a subunit
trpEb trpB Tryptophan synthase, p subunit

aThe nomenclature is at the level of catalytic domain in the order of reaction steps in the pathway. See [6] for a detailed rationale supporting the
new nomenclature. Overall reactions of tight complexes are assigned one capital letter, with a and p subunits assigned the corresponding
lowercase 'a' and 'b' respectively. The convention of a bullet denotes a fusion, for example, trpD*trpC.


provide extraordinary properties of catalysis and/or regu-
lation that are of sufficient selective value to offset a lack
of ameliorative history.

The pathway of tryptophan biosynthesis
Amino acid biosynthetic pathways, such as the Trp path-
way (see Table 1 for nomenclature used), are not novel in
the sense that they are ancient and widely distributed.
When the Trp pathway is absent in prokaryotes, it is a con-
sequence of gene loss (reductive evolution), usually, if not
always, in pathogens or symbionts whose hosts or symbi-
ont partners supply the Trp required. Table 2 provides a
current listing of microbial genomes that have lost some
or all of the trp genes. Such reductive changes can be quite
recent, as illustrated by existence of some trp-gene degra-
dation in Yersinia pestis KIM, but not in the other two com-
pletely sequenced Y. pestis genomes. Genomes having
incomplete trp pathways are presumably in an intermedi-
ate state of genome reduction. However, see Xie et al.
[10,11] for novel functional innovations of "incomplete"
Trp pathways in chlamydiae. For example, the addition of
two genes to the partial-pathway operon of Chlamydophila
psittaci has been asserted to have created a novel operon
responsible for a kynurenine-to-Trp pathway that is
important in overcoming a mechanism of host defense
during pathogenesis [1]. This hypothesis has recently
been confirmed experimentally [12]. Also, see Barona-
Gomez and Hodgson [13] for their resolution of the mys-
tery of why trpC is absent in the clade of actinomycete
organisms, that is, they identified priA as a replacement
for the otherwise universal trpC. A thorough overview of
the phenomenon of "missing genes in metabolic path-
ways" and how this can be approached via comparative
genomics has been provided by Osterman and Overbeek
[141.

Trp is biochemically the most expensive of the amino
acids synthesized by prokaryotes. Accordingly, it is not
surprising that Trp biosynthesis is usually regulated with


fine-tuned precision. Different organisms deploy com-
pletely different modes of regulation, for example, com-
pare those of E. coli and Bacillus subtilis [15,16].
Pseudomonas aeruginosa exhibits yet a third distinctive sys-
tem of regulation, part of which involves an activator gene
(trpI) [17]. The sophisticated, complex, and highly dis-
tinctive regulation in each of the latter three organisms
appears to be of recent origin based upon the relatively
narrow clades possessing these particular regulatory sys-
tems. This is a very important point in support of the
thesis [6] that modern, sophisticated genomes may be
much less prone to displacement by LGT of trp genes
than were ancient genomes. In this context, it will be
quite important to determine whether organisms that lack
known modes of regulation based upon current model
organisms really have relatively unsophisticated control
mechanisms, or whether unknown regulatory mecha-
nisms are in place. For example, it has been initially sur-
prising that trp genes of Streptomyces coelicolor are not
regulated by feedback repression. However, an excellent
and detailed study [18] has demonstrated the existence of
regulation that is both growth phase-dependent and
growth rate-dependent. This has been attributed to the
oligotrophic lifestyle of Streptomyces. It would be interest-
ing to know whether the clade defined by the Streptomyces
mode of regulation is also narrow (and therefore of recent
origin).

Identical enzyme steps operating in different pathways
We refer to trp genes that produce Trp in general support
of protein synthesis as genes of primary metabolism.
Those trp genes responsible for the production of interme-
diates (or Trp) for any other purpose (e.g. as precursors of
antibiotics or pigments) are referred to as genes of special-
ized (or secondary) metabolism. There is ample prece-
dent for maintenance in a given genome of co-existing
structural genes whose gene products catalyze the same
reaction, but which function in differing temporal or spa-
tial modes in different pathways. Such genes may be dif-


Page 3 of 30
(page number not for citation purposes)


BMC Biology 2004, 2:15








http://www.biomedcentral.com/1741-7007/2/15


Table 2: Complete genomes where Trp-pathway genes were lost via reductive evolution


Bacterial organisms

Bdellovibrio bacteriovorus
Borrelia burgdorfen
Chlamydia muridarum
Chlamydia trachomatis
Chlamydophila pneumoniae
Chlamydophila psittacia
Clostridium difficile
Clostridium perfringens
Clostridium tetani
Coxiella burnetti
Enterococcus faecalis
Fusobacterium nucleatum
Haemophilus ducreyi
Lactobacillus johnsonii
Mycoplasma genitalium
Mycoplasma mycoides
Mycoplasma pneumoniae
Phytoplasma asteris
Porphyromonas gingivalis
Rickettsia prowazekii
Streptococcus agalactiae
Streptococcus equi
Streptococcus pyogenes
Treponema denticola
Treponema pallidum
Tropheryma whipplei
Ureaplasma urealyticum
Wigglesworthia glossinidiab
Wolbachia sp.b
Yesinia pestis KIM


No pathway


Incomplete pathway


aBut see [10] for a description of how an incomplete Trp pathway has been joined with other genes to yield a mosaic operon with a novel function.
blnsect endosymbiont.


ferentially regulated by distinctive control mechanisms or
mechanisms that accomplish spatial separation. For
example, S. coelicolor possesses trp paralog genes of identi-
cal catalytic function that exist in separate operons dedi-
cated to primary biosynthesis, on the one hand, or to
calcium-dependent antibiotic (CDA) production, on the
other hand [6,19]. It is interesting that, in such cases, one
or more of the pathway genes sometimes exist as a single
copy and, therefore, must be shared between both
functions.

Phylogenetic trees for proteins require a continuum of
close relatives
This study is primarily a phylogenetic analysis and
depends upon protein trees. However, sequences of pro-
teins such as the Trp enzymes are not nearly as conserved
as 16S rRNA, and it is well known that they are of limited
value for making phylogenetic inferences over wide phyl-
ogenetic distances [20]. On the other hand, for a group of
very closely related organisms, the 16S rRNA sequences


can be so similar that there is a limited basis for discrimi-
nating order of branching. Here some protein trees may
yield more refined branching relationships over short
phylogenetic distances. Until recently, there have been
relatively few sequenced genomes available that would
provide a critical mass of closely related organisms as a
source of Trp-protein sequences. The sequencing of new
genomes is now beginning to provide phylogenetic
groups of ever more dense genome representation.
Health-related organisms heavily influence priorities, and
wide gaps in the currently available tree exist. Phyloge-
netic regions where genome representation is sparse will
undoubtedly persist for many years, and it would be help-
ful if new genomes for sequencing were selected specifi-
cally to fill phylogenetic gaps. One can anticipate that a
given protein tree will progressively increase its useful
phylogenetic span of discrimination as the gaps between
regions of sufficient genome representation are filled.





Page 4 of 30
(page number not for citation purposes)


BMC Biology 2004, 2:15







http://www.biomedcentral.com/1741-7007/2/15


Additional daunting problems (which are minimal for
16S rRNA trees) assail the phylogenetic validity of protein
trees. These are: (i) unrecognized paralogy and (ii) xenol-
ogy. Ancient paralogs that arose in a common cell will
usually have diverged greatly in the contemporary organ-
isms that house them. If one or the other paralog has been
lost in various lineages in an erratic fashion and the gene-
alogical history of these losses is not recognized, this situ-
ation has been termed "unrecognized paralogy".
Differential loss of ancient paralogs in different lineages
has the potential to place surviving homolog proteins of
distantly related organisms closer to one another than to
the surviving proteins of closely related organisms. In this
case, xenology can be erroneously inferred. Although LGT
has been increasingly recognized for genes in general,
genes encoding 16S rRNA are thought to be recalcitrant to
LGT (but see Gogarten et al. [21] and Doolittle [22].

Congruency and implied cases of LGT
Since particular lineages have optimized Trp biosynthesis
to overall demands of primary and secondary metabolism
that are both qualitatively and quantitatively individualis-
tic, it seems that abandonment of native trp genes in favor
of imported alien genes would not occur very often. If cor-
rect, then one would expect that the vertical trace of evo-
lutionary descent for trp genes engaged in primary Trp
biosynthesis would be demonstrable, as has indeed been
shown following a very comprehensive analysis [6]. In the
latter study, individual Trp-protein trees were found to be
generally congruent with 16S rRNA trees in subtree
regions that were supported by sufficiently dense phyloge-
netic representation.

Against this background of congruency (and, indeed, ena-
bled because of the overall congruency), several clear
examples were found of LGT of whole-pathway trp oper-
ons in which all of the native trp genes were displaced,
occasionally leaving a surviving remnant behind. In addi-
tion, examples were found of LGT of partial-pathway trp
operons that either displaced native genes of primary bio-
synthesis (one case) or became associated with a second-
ary function. In the literature relevant to LGT there is
frequently little evidence about likely donor genomes,
and even less indications of direction of transfer [23]. This
paper provides detailed information and analysis not
given in [6], and it provides an especially thorough docu-
mentation in that the occasional LGT transposition of the
entire suite of seven genes responsible for Trp biosynthe-
sis are evaluated. Importantly, we were able to identify
donor lineages, to identify a gene remnant of the pre-exist-
ing Trp system in three divergent descendants of one of
the recipient genomes, and to identify in one genome sev-
eral evolutionary steps of specific operon perturbation
that resumed in the vertical genealogy following LGT.


Results
Figure 1 presents a 16S rRNA tree of 47 finished-genome
organisms from the domain Bacteria. In preliminary work
with the individual protein trees corresponding to the
seven catalytic domains of Trp biosynthesis, we noticed
that at least seven subtree blocks on the Trp-protein trees
tended to be congruent with corresponding subtree blocks
differentiallyy highlighted in Figure 1) of the 16S rRNA
tree. The Gram-negative proteobacteria command special
attention in this paper simply for the fortuitous reason
that the greatest density of sequenced genomes is to be
found in proteobacteria. The divisions of the proteobacte-
ria are labelled in the lower-right portion of Figure 1. Geo-
bacter and Desulfovibrio (delta-proteobacteria) are very
divergent lineages and do not contribute to a common
tryptophan congruency group. The grey area (epsilon pro-
teobacteria) represents a subtree region that will probably
become a tryptophan congruency group when more dense
genome representation becomes available in this region.
Another subtree region (not shown on Figure 1) in this
category is that represented by the chlamydiae. This latter
subtree region is temporarily limited for Trp analysis
because it is currently represented by genomes having Trp
pathways that are incomplete or absent. Beta-proteobacte-
ria fall into a common tryptophan congruency group with
some gamma-proteobacteria ("upper" gamma-proteobac-
teria), whereas the remaining "lower" gamma-proteobac-
teria (enteric lineage) form a separate and distinct
tryptophan congruency group.

Seven tryptophan congruency groups (TCGs)
Individual Trp-protein domains vary in size and degree of
conservation and thus confer varied amounts of phyloge-
netic information. Figure 2 shows a protein tree in which
the seven protein domains responsible for the Trp path-
way of biosynthesis have been concatenated in the order
of the pathway steps (TrpAa/TrpAb/TrpB/TrpC/TrpD/
TrpEa/TrpEb) prior to use of the tree-building program.
The seven-domain Trp tree was constructed by using 47
organisms having a complete Trp pathway and by
application of an analysis aimed at exclusion of diver-
gent paralogs and xenologs that do not function in
primary Trp biosynthesis (excluded paralogs and
xenologs can be viewed in the succeeding figures). Each of
the seven protein sections of a given concatenate has an
impact on the overall tree that is roughly proportional to
the number of amino acids encoded. Each of the seven
nodes defining TCGs is supported by a bootstrap value of
100% (in contrast to the weakness of individual Trp-pro-
tein trees). Although the overall concatenated tree does
not parallel the overall 16S rRNA tree, seven subtree
regions of the concatenated tree do parallel 16S rRNA sub-
tree regions. These seven groupings are not necessarily
equivalent in phylogenetic span. TCG-6, for example, is a
small, closely related grouping compared with the much


Page 5 of 30
(page number not for citation purposes)


BMC Biology 2004, 2:15








BMC Biology 2004, 2:15


http://www.biomedcentral.com/1741-7007/2/15


Aquifex aeolicus (Aae)
I Thermotoga maritima (Tma)
4 Deinococcus radiodurans (Dra)
-- Dehalococcoides ethenogenes (Det)
Clostridium acetobutylicum (Cae)
Desulfitobacterium hafniense (Dha)

Listeria monocytogenes (Lmo)
-- Lactococcus lactis (Lla)
Streptococcus pneumoniae (Spn)
Bacillus anthracis (Ban)
Staphylococcus aureus (Sau)
Bacillus subtilis (Bsu)
Bacillus stearothermophilus (Bst)
Bacillus halodurans (Bha)
Thermomonospora fusca (Tfu)
Streptomyces coelicolor (Sco)
Corynebacterium diphtheriae (Cdi)
Corynebacterium glutamicum (Cgl)
Mycobacterium tuberculosis (Mtu)
Synechocystis species (Ssp)
Synechococcus species (Syn)
Prochlorococcus marinus (Pma)
Nostoc punctiforme (Npu)
Anabaena species (Asp)

Chlorobium tepidum (Cte)
Cytophaga hutchinsonii (Chu)
1 Geobacter sulfurreducens (Gsu) 1
JI p Desulfovibrio vulgaris (Dvu) J delta
Campylobacterjejuni (Cje)
-- -- Helicobacterpylori (Hpy) epsilon

Caulobacter crescentus (Cer) 1
Sphingomonas aromaticivorans (Sar) alpha
1--- Rhodobacter sphaeroides (Rsp)
-- Thiobacillus ferrooxidans (Tfe)
Xylella fastidiosa (Xfa) "upper" gamma
Nitrosomonas europaea (Neu)
Ralstonia metallidurans (Rme)
Burkholderiafungorum (Bfu) beta
Neisseria meningitidis (Nme)
S16S rRNA -- Xanthomonas campestris (Xca)
Methylococcus capsulatus (Mca)
Pseudomonas aeruginosa (Pae) "upper" gamma
Pseudomonas syringae (Psy)
Shewanella putrefaciens (Spu)
0.1 Vibrio cholerae (Vch) "lower" gamma
Haemophilus influenzae (Hin) j (enteric lineage)
Escherichia coli (Eco)








Figure I
Positioning of 47 complete-genome organisms on a 16S rRNA tree (phylogram view). Among these, seven 16S rRNA subtree
regions are color-coded to facilitate comparison with the TCG regions on the Trp-protein concatenate tree of Fig. 2. Dashed
lines in orange indicate organisms representing lineages where genomes of close relatives have not yet been sequenced. A grey
box indicates a region of minimal current genome representation that is expected to become a region of subtree congruency.
The subdivisions of the Proteobacteria are labelled at the lower right. Note that it is an idiosyncracy of tree presentation that
Tfe and Xfa appear to group more closely with beta-proteobacteria than with other gamma-proteobacteria. However, it is a
distance tree and close inspection of the distances reveal the identity of the gamma-proteobacteria as a single, cohesive group.
The horizontal bar corresponds to 0.1 substitutions per site on the distance tree.




Page 6 of 30
(page number not for citation purposes)







http://www.biomedcentral.com/1741-7007/2/15


Trp


TCG-1


TCG-2 TCG-3 TCG-5


Figure 2
Phylogenetic tree (radial view) constructed using the seven-domain (TrpAa/Ab/B/C/D/Ea/Eb) concatenated sequences of Trp
proteins that specifically participate in primary biosynthesis. The Trp-pathway concatenates are from the same 47 organisms
shown in Fig. I. Dashed, orange lines indicate the lineage positions of concatenated sequences from organisms that presently
lack any close relatives whose genomes have been sequenced. TCG clusters are color-coded as in Fig. I, where full bacterial
names matching the corresponding abbreviations can be found. The Cje lineage, marked in aqua, represents a probable TCG
grouping. Nodes marked with solid black circles are supported by bootstrap values of 100%. Concatenates of LGT origin
within TCG- I are outlined with a grey pattern.


looser TCG-7 assemblage. The emerging, fuller member-
ship of these seven TCGs is hinted at in Table 3, where
additional provisional TCG members that were not
included in Figure 2 are listed in regular non-bold type.
The latter were assigned (mostly with newly available
genomes after completion of our primary analysis) by
assessment of the best BLAST (Basic Local Alignment
Search Tool) hits obtained after entering each Trp domain
of the organisms listed as query sequences. Best-match
methods are useful for rapid screening, but are subject to


limitations [24]. Tentative TCG assignments were also
assisted by other features. For example, Brucella melitensis,
Agrobacterium tumefaciens, Bradyrhizobium japonicum,
Sinorhizobium meliloti and Rhodopseudomonas palustris all
possess in common the following split-pathway gene
organization: trpAatrpAb (fused genes), a trpB/trpD
operon, and a trpC/trpEb/trpEa operon [6].

The few exceptions that violate the otherwise good con-
gruency between TCGs and 16S rRNA subtree regions


Page 7 of 30
(page number not for citation purposes)


BMC Biology 2004, 2:15







http://www.biomedcentral.com/1741-7007/2/15


point strongly to instances of whole-pathway trp-operon
displacement. These include the incongruent presence of
Trp-protein concatenates from both Helicobacter pylori and
the coryneform bacteria in TCG-1. This indicates that
inter-genomic transfer of whole-pathway trp operons
occurred, with the donor identifiable as a member of
TCG- 1.

Orange-highlighted dashed lines in Figures 1 and 2 mark
lineages where closely related genomes have not yet been
sequenced, that is, where there is sparse genome represen-
tation. There is no congruency of the branching positions
of these ten orphan organisms when the 16S rRNA tree
(Figure 1) is compared with the Trp-protein concatenate
tree (Figure 2). It is generally believed that the position of
these lineages on the 16S rRNA tree is reliable because 16S
rRNA comparisons can discriminate very well over wide
phylogenetic distances. In contrast, support for the posi-
tion of branching obtained for these lineages with respect
to the concatenated Trp-protein tree is not significant, that
is, low bootstrap values. One can reasonably expect that,
as more genomes are sequenced, new TCGs will emerge
that include these current orphan organisms. For
example, our preliminary data indicate that the Trp pro-
teins of Bacteroides thetaiotaomicron will reside within a
new TCG group with Cytophaga hutchinsonii.

Individual Trp-protein trees
In the following section, individual protein trees are
shown for comparison with the much superior tree of Trp-
protein concatenates shown in Figure 2. Each individual
tree consists of 47 sequences that comprise segments of
each concatenate string used for the tree shown in Figure
2. Included among the concatenates are proteins of LGT
origin (from Helicobacter pylori, Corynebacterium glutami-
cum, and Corynebacterium diptheriae) that function for pri-
mary Trp biosynthesis. In addition to the foregoing
sequences, Figure 3, Figures 5,6,7, and Figures 9,10,11
also display paralogs and xenologs that were excluded
from the concatenate strings because they were not
deemed to function for primary biosynthesis. It can be
seen that TrpAb (Figure 5) and TrpC (Figure 7), being rel-
atively short and not highly conserved sequences, are the
least informative. TCG-2 and TCG-7 are frequently not
visualized as entirely cohesive groupings when the indi-
vidual trees are inspected. In each individual Trp-protein
tree, primary-pathway Trp domains are designated by the
organism acronym (e.g. Det), whereas unknown xenologs
or paralogs are designated with a following number (e.g.
Det_2). If functions are known or if names exist in the lit-
erature, for example, Sco_CDA or Pae_PhnA, respectively,
these designations are used. Remnant proteins are
denoted with an 'r', for example, Cgl_r (Figure 9).


Xie et al. [6] can be consulted for a detailed overview of the
Trp pathway reactions (summarized here in Table 1) and
for a perspective on the nomenclature issues. Table 4 is a
comprehensive listing [see Additional File 1] that contains
gi (gene identification) numbers (in bold) that corre-
spond to each of the seven domains asserted to function
in primary Trp biosynthesis. Paralog and xenolog gi num-
bers are presented in regular type. Each gi number is
hyperlinked to the corresponding record at NCBI
(National Center for Biotechnology Information).

TrpAa
TrpAa is the aminase subunit of anthranilate synthase.
Figure 3 shows an individual protein tree for the TrpAa
catalytic domain. Forty-seven of these are domain seg-
ments of the 47 concatenates making up the tree of Figure
2. An additional three sequences are putative specialized
paralogs or xenologs that have been excluded from Figure
2. These include an apparent TrpAa xenolog from X. fastid-
iosa (Xfa_2) [7]. The origin ofXfa_2 TrpAa is unknown. It
is part of an apparent six-gene operon that is divergently
oriented next to trpR [7]. It is perhaps suggestive of epsilon
proteobacteria origin that Xfa_2 TrpAa exhibits a 100%
bootstrap score with the TrpAa of Campylobacter, although
the branch distances are great. Except for Xfa TrpAb
(which also exhibits a suggestively close relationship with
Campylobacter TrpAb; see Figure 5), the Campylobacter
genome possesses neither the other four genes of the
Xylella operon, nor trpR.

PhnA from P. aeruginosa [25], together with PhnB (see Fig-
ure 5), encode a partial-pathway operon that originated
from the enteric lineage. A TrpAa paralog (Sco_CDA) in S.
coelicolor functions in the calcium-dependent antibiotic
(CDA) pathway [191.

Figure 3 does not show the position of the TrpAa domain
from Thermomonospora fusca, which possesses a
trpAaotrpAb gene fusion. Other actinomycetes lack this
fusion. The fusion is present in some widely separated
organisms (Figure 4) that also use it for primary Trp bio-
synthesis [7]. These include Legionella pneumophila (Lpn),
Azospirillum brasilense, and the closely related group of
organisms: Rhodopseudomonas palustris, Mesorhizobium loti
(Mlo), Sinorhizobium meliloti (Sme), and Brucella melitensis
(Bme). Although Nostoc punctiforme (Npu) and Anabaena
sp. (Asp and Asp_2) also have trpAaotrpAb fusions, these
are deemed not to be engaged in primary Trp biosynthesis
[7]. These TrpAa* domains all cluster closely together to
the exclusion of other TrpAa sequences. They do not fall
into any of the TCGs that would be expected according to
the phylogenetic position of the organism having the
fusion. Figure 4 shows a broader phylogenetic sampling
of TrpAa sequences than shown in Figure 3. Figure 4 illus-
trates the distinct cohesion of TrpAa* domains of


Page 8 of 30
(page number not for citation purposes)


BMC Biology 2004, 2:15








http://www.biomedcentral.com/1741-7007/2/15


I -L--Vch TCG-1
Eco
Spu



R_-- Ssp
---- Npu
----ym-Asp TCG-4
Syn
Pma
iCte



Gs Neu
SAaNme
/ I -----a



1r-- xfa.. CDA
-Xco TCG-5TCG-2



e Mtu

I- r-N-Sar
01 cNm r TCG-3
Rme
--- --- -- B fu
















Figure 3
Phylogenetic tree (phylogram view) of TrpAa sequences. Nodes occupied by a solid, black circle are supported by bootstrap
values of 100%. Other bootstrap values are given within unfilled circles. Xenologs are shown with grey candy-striped bars, and
paralogs are shown with lavender/white patterning. A specialized-pathway paralog from Streptomyces coelicolor (Sco_CDA) is
shown, as well as a probable specialized-pathway xenolog (Xfa 2) from Xylella [7]. Genes in C. diptheriae, C. glutamicum, and H.
pylori that belong to whole-pathway operons originating via LGT are shown within TCG- 1. TCG- I also includes PhnA, encoded
by a gene of a partial-pathway operon from P. aeruginosa. TCG-7 is fragmented, the Ban and Sau TrpAa sequences being too
divergent to fall within TCG-7.




Page 9 of 30
(page number not for citation purposes)


BMC Biology 2004, 2:15








BMC Biology 2004, 2:15


http://www.biomedcentral.com/1741-7007/2/15


TCG-4




TCG-3











S\Asp Asp_2

Aac Npu Lpn
Pmu7 Bme
VchE Mlo
1y \ 6 lf Sme
t //y Atu

Cdi Pae

Hpy




0.1



rrl).\aTrr)l)I_Fh.-

Sve
Pch Sco

Pau pfl Pae








Figure 4
Phylogenetic tree (radial view) showing that free-standing TrpAa domains, TrpAa components of TrpAa*TrpAb fusions, and
TrpAa components of TrpAa*TrpAb_phz fusions are all distinct from one another. The position of some TCG groups are
marked at the top. TrpA* fusion domains are color-coded to indicate their expected TCG placements if convergent evolution
were not a factor. The TCG-I grouping is distinctly divergent from all of the other free-standing TrpAa sequences.



Page 10 of 30
(page number not for citation purposes)








http://www.biomedcentral.com/1741-7007/2/15


Nme
Tfe
jPf-----Neu
-~~--Rme TCG-2

fl___ Pae Bfu
Psy
Det
-Xfa
^ -- Xea


Lmo
Sau
-i Spn Lla
--- SpaSaun


TCG-1


- .j Xta


Ssp
_.._-- Asp
. ----Npu
ISyn
Pma


Cte
-co CDA
--"Sco TCG-5
Mtu
Ccr
_Sar TCG-3
IRsp


- Bha TCG-6
-Bsu


Figure 5
Phylogenetic tree of TrpAb sequences. Xfa_2 is a probable specialized-pathway xenolog from Xylella. Sco_CDA is a specialized-
pathway paralog within TCG-5. TCG- I contains a xenolog (PhnB) from Pseudomonas aeruginosa that (together with PhnA) is
encoded by genes of a partial-pathway operon. Trp Ab genes from Helicobacter pylori, Corynebacterium diptheriae, and C glutami-
cum are xenolog members of whole-pathway operons. TCG-2 and TCG-7 are fragmented. (Consult Fig. 2 for intact TCGs.)
Asterisks (Tma, Cje, and Eco) indicate domains that exist as part of TrpAb*TrpB fusions.




Page 11 of 30
(page number not for citation purposes)


TrpAb


TCG-7


TCG-4


0.1


BMC Biology 2004, 2:15








http://www.biomedcentral.com/1741-7007/2/15


Cte
Tma*
SSP Chu
[-Ssp


j_ I TCG-4
__------Asp
Npu
ePma
Dvu
SCn fDA


Tfu
-Sco


Dha
Det
Gsu
Dra


I-Neu
---Nme
I__ Xca
X_ Xfa
Rme
Bfu

1-__L M Tfe
PPMca
,-- pPsy


BCac
IBst
~IBha


TCG-5


TrpB


TCG-2





U
TCG-6


TCG-3


S'


(Cer


XSp


LS" Lmo a TCG-7
'----I |- -- Lla C<-
_______------------Spn-----------a
San
- -Cje*
I-f V < ff f f V VG '------------- II,. t_2
Cgl

7 I py


TCG-1


-- Hin
-|___Vch
'-------------Eco*


0.1






Figure 6
Phylogenetic tree of TrpB sequences. Det_2 is diagrammed with both patterns, indicating it could be either an ancient paralog
or a xenolog. Sco_CDA is a specialized-pathway paralog (antibiotic). Asp, Asp_2, Npu, and Npu_2 are paralogs from a gene
duplication that preceded speciation of Npu and Asp. The Asp and Npu sequences were arbitrarily used for input into the con-
catenate tree of Fig. 2. TCG-7 is fragmented. TCG- I contains xenolog members of whole-pathway operons from H. pylori, C.
diptheriae, and C. glutamicum. Asterisks (Tma, Cje, and Eco) indicate domains existing as part of TrpAb*TrpB fusions.


Page 12 of 30
(page number not for citation purposes)


BMC Biology 2004, 2:15








BMC Biology 2004, 2:15 http://www.biomedcentral.com/1741-7007/2/15













L---------Lla
---- Spn TCG-7
I- Lmo
Hin
Spu
n i-- ---Cgl
Cdi
F _I Vch
L ------ .-- Eco TCG-1

Cje

-Sau
-Bsu
Bst TCG-6
BBha
______ i------------------Ssp
I--- Pma
I-* p Syn TCG-4
l. -......_Npu

--Ccr
"Rsp Sar TCG-3
I ------ Rsp


u- rDra

SDet



-AaNme






Pg13Pae















cum and C. diptheriae. TCG-7 is fragmented. All members of TCG-1 shown (except Cje, whose position is probably coinciden-
tal) possess *TrpC as a fusion domain with TrpD*.



Page 13 of 30
(page number not for citation purposes)








BMC Biology 2004, 2:15 http://www.biomedcentral.com/1741-7007/2/15












Dha
Bha
T-- Bstasu HCG-6


Dra
Sco
1'riA Tfu
'- Mtu HCG-5
I- F--_--C gl





Ssp
r_-- Npu
--'... '-Asp HCG-4


y. -------Rsp
ccr HCG-3



Neu

Bf"u HCG-2







(i sqnsi H HCG-7


















(pag number notforcittin-prpoes
I.,G HCG-7 -



I Hin
___--------Xfa
--- Xca 0.1
---Lla --










Figure 8
Phylogenetic tree of HisA sequences. Congruency groupings that match TCG clusters are labelled 'HCG' for histidine congru-
ency group. Helicobacter pylori and Streptococcus pneumoniae are not represented on the tree because they have lost the histi-
dine pathway. C jejuni HisA appears to be a xenologous member of TCG-1. Similar to the relatively loose TCG-2 and TCG-7
groupings, HCG-2 and HCG-8 are fragmented. Actinomycete bacteria possess a tightly clustered section of dual-pathway HisA
(PriA) sequences within HCG-5.



Page 14 of 30
(page number not for citation purposes)








BMC Biology 2004, 2:15


http://www.biomedcentral.com/1741-7007/2/15


1 _P aae TrpD

__-.r.,Sar
-ICcr TCG-3
-----------Rsp
I- s-pPma

Syn TCG-4
[-=___ "--Asp_2





"VVVV+,,,,lHpy
TrpD* I . . Spu

L' .. i di TCG-1
[ Vch
Eco
Hin
------- LChu
S I|Lla
...L-" Spn TCG-7
I----Ban
Sau
-Bha
0.1 uBst TCG-6
Bsu
Cac

L[ Aae

Det



N,. CDA
Sco TCG-5
0.1 ru
-- ____. Mtu
-Cd Cglr






Figure 9
Phylogenetic tree of TrpD sequences. N. punctiforme and Anabaena sp. each possess a set of three paralogs. The Asp_2 and
Npu_2 paralog sequences were used for input into the concatenates of Fig. 2. In addition to the xenolog TrpD* domain of Cgl
and Cdi that is present in TCG- I, Cgl and Cdi also possess 'remnant' TrpD proteins denoted Cgl_r and Cdi_r that cluster in
TCG-5.



Page 15 of 30
(page number not for citation purposes)








BMC Biology 2004, 2:15 http://www.biomedcentral.com/1741-7007/2/15















Cac


-Sco
-- Tfu TCG-5
Mtu
Gsu
Nme
Neu
--., Mca
Rme TCG-2

L-- Tfe
Xfa
Xca
I--Sar
-- Ccr
Rsp
SPae TCG-3
Psy
Syn
Asp 2
Npu_2
\. 1 TCG-4 TrpEa
i TrpEa
I .-.-I-








------- L ino
Bha
Bst TCG-6
Bsu



E oHpy
I-- [ --,--gHin TCG-1
-Eco
Spu
Vchh


I- -Det u Cje

"-,-- Ban Sau C e
-_. -, Lmo
0.1 'Lla S TCG-7
Spn









Figure 10
Phylogenetic tree of TrpEa sequences. TrpEa proteins from Pae and Psy fall into TCG-3 instead of into TCG-2. Paralogs Asp_ I,
Npu_l, Asp_2 and Npu_2 were generated by a gene duplication that preceded speciation of Asp and Npu. Asp_2 and Npu_2
were arbitrarily used for concatenate input (Fig. 2). TCG-7 is not very cohesive.




Page 16 of 30
(page number not for citation purposes)









http://www.biomedcentral.com/1741-7007/2/15


Bha
*.i Bst


-- -Ban
I.Lmo
I Lla
Spn

N--
-- Tfe


S---- Mca
Neu
Rn
Bfu
Gsu
I-Sa
Rsp
Cc
Pae
SP


TCG-6
Bsu
Sau


TCG 7 *
TCG TrpEb irp:h 1,


me

- Xfa
-Xca TCG-2


ie


r
i1
r TCG-3

sy


;sp
1

1 TCG-4
2
Syn
a
Dha
-Mtu
- Tfu TCG-5
- Sco

9Hpy
Cdi 2
;tCgl
)-/y CCdi 1
Spu
Vch TCG-1
Hin
Eco
Dvu
Rsp 2

Chu
Cje r.L
r ... II


S Dra 0.1







Figure I I
Phylogenetic tree of TrpEb sequences. Cdi_2 is encoded by a paralog copy of trpEb_l that has been inserted ahead of the Cdi
trp operon. TrpEb_2 is encoded by a highly divergent paralog subclass of trpEb that probably has a specialized function [28]. No
TrpEb_2 sequences were used to construct concatenates (Fig. 2). Rsp_2 is shown with two patterns, indicating uncertainty
about whether it is an ancient paralog or a xenolog.




Page 17 of 30
(page number not for citation purposes)


BMC Biology 2004, 2:15








http://www.biomedcentral.com/1741-7007/2/15


Table 3: Membership composition of Tryptophan Congruency GroL

TCG-I






















TCG-2d




























TCG-3











TCG-4


[Corynebacterium diptheriae]b
[Corynebacterium glutomicum]b
Escherichia coli
Haemophilus influenza
[Helicobacter pylori] b
Shewanella putrefaciens
Vibrio cholera
Actinobacillus actinomycetemcomitans
Buchnera aphidicolac
Blochmannia floridanusc
[Corynebacterium efficiens]b
Erwinia carotovora
Klebsiella pneumoniae
Pasteurella multocida
Photorhabdus luminescens
Salmonella enterica
Shigella flexneri
Vibrio parahaemolyticus
Vibrio vulnificus
Yersinia pestis
Burkholderia fungorum
Methylococcus capsulatus
Neisseria meningitidis
Nitrosomonas europaea
Pseudomonas aeruginosa*
Pseudomonas syringae*
Ralstonia metallidurans
Thiobacillus ferrooxidans
Xanthomonas campestris
Xylella fastidiosa
Acinetobacter sp.
Azotobacter vinelandii*
Bordetella bronchisepticum
Bordetella parapertussis
Bordetella pertussis
Burkholderia cepacia
Burkholderia multivorans
Chromobacterium violaceum
Microbulbifer degradans
Neisseria gonorrhoeae
Pseudomonas fluorescens*
Pseudomonas putida*
Psychrobacter sp.
Ralstonia solanacearum
Xanthomonas axonopodis
Caulobacter crescentus
Rhodobacter sphaeroides
Sphingomonas aromoticivorans
Agrobacterium tumefaciens
Bradyrhizobium japonicum
Brucella melitensis
Brucella suis
Rhizobium loti
Rhodopseudomonas palustris
Sinorhizobium meliloti
Anabaena (Nostoc) sp. PCC 7120
Nostoc punctiforme
Prochlorococcus marinus CCMP 1986 (MED4)
Synechococcus sp. WH8 102
Synechocystis sp. PCC 6803
Anabaena variabilis ATCC 29413
Crocosphaera watsonii WH 8501


Page 18 of 30
(page number not for citation purposes)


BMC Biology 2004, 2:15








http://www.biomedcentral.com/1741-7007/2/15


Table 3: Membership composition of Tryptophan Congruency Groupsa (Continued)


TCG-5e


Gloeobacter violaceus PCC 2471
Prochlorococcus marinus CCMP 1375 (SS 120)
Prochlorococcus marinus MIT9313
Synechococcus elongatus PCC 7942
Thermosynechococcus elongatus BP- I
Tricodesmium erythraeum
Streptomyces coelicolor
Mycobacterium tuberculosis
Thermomonospora fusca
Bifidobacterium longum
Mycobacterium avium
Mycobacterium bovis
Mycobacterium leprae
Mycobacterium smegmatis
Streptomyces avermitilis
Bacillus halodurans
Bacillus stearothermophilus
Bacillus subtilis
Oceanobacillus iheyensis
Bacillus anthracis
Lactococcus lactis
Listeria monocytogenes
Staphylococcus aureus
Streptococcus pneumoniae
Bacillus cereus
Listeria innocua
Staphylococcus epidermidis
Streptococcus gordonii
Streptococcus mutans


TCG-6



TCG-7


aEach tryptophan congruency group (TCG) defined by the concatenated tree for Trp proteins (Fig. 2) is congruent with the color-coded subtree
section within the 16S rRNA tree (Fig. I). Organisms that are included in the concatenated tree of Fig. 2 are indicated in boldface type, whereas
additional organisms not included in the concatenated tree but that were qualitatively determined to belong to a given TCG are indicated in regular
type. bTCG members originating by LGT are indicated within brackets and indented. Insect symbionts. dThe five organisms marked with asterisks
form a distinctive subclade that is, in fact, not a "pure" component of TCG-2 because of the LGT origins of trpEa and trpEb from TCG-3 (see text).
eAll members of TCG-5 lack trpC and presumably utilize a dual-pathway hisA (priA) for this function.


TrpAa*TrpAb fusions, as well as tight clustering of another
variant of TrpAa*TrpAb fusion denoted
TrpAa*TrpAb_phz. The latter group has a deleted region,
which probably contributes to the dead-end production
of 2-amino-2-deoxy-isochorismate (normally an enzyme-
bound intermediate in the anthranilate synthase reac-
tion). This compound is a precursor of phenazine pig-
ments [26], hence our acronym TrpAa*TrpAb_phz. Figure
4 shows in the unlabelled (i.e. no organism acronyms)
upper group a variety of TrpAa proteins from Bacteria,
Archaea, and one lower eukaryote. It is qualitatively appar-
ent that TrpAa* in a given fusion protein is distinctly sep-
arated from TrpAa proteins of relatively close relatives
lacking the fusion (as indicated by the color coding in Fig-
ure 4). For example, unfused TrpAa proteins from S. coeli-
color or Mycobacterium tuberculosis, very similar to one
another as cohesive members of TCG-5, are not even as
close to the TrpAa* domain from the fellow actinomycete,
Thermomonospora fusca, as they are to various archaeal
TrpAa proteins or to that from Saccharomyces cerevisiae.


The *TrpAb domain of TrpAa*TrpAb or
TrpAa*TrpAb_phzE fusion proteins showed similar tight
clustering when comprehensive TrpAb trees were
constructed (data not shown). We have suggested that a
number of TrpAa*TrpAb fusions have occurred as inde-
pendent fusion events, but that the sequences have then
converged due to rigid constraints imposed for proper
protein-protein interactions of these subunits [7].

TrpAb
TrpAb is the glutamine-binding subunit of anthranilate
synthase responsible for function of the TrpAa/TrpAb
complex as an amidotransferase. It is the smallest and
least conserved of the seven Trp domains. Sequence fea-
tures of TrpAb do not distinguish it from from PabAb, an
amidotransferase subunit of p-aminobenzoate (PABA)
synthase. Usually, however, the functional role of the two
members of this homolog group can be deduced by the
presence of at least one homolog in a trp operon or a pab
operon. In some cases, as with B. subtilis and other mem-


Page 19 of 30
(page number not for citation purposes)


BMC Biology 2004, 2:15







http://www.biomedcentral.com/1741-7007/2/15


bers of TCG-6, a single subunit participates in both
anthranilate and PABA synthesis. In this case it has dual-
pathway function and has the ability to complex with
TrpAa, on the one hand, or with PabAa, on the other
hand. Most of the TCGs seen in Figure 2 are recognizable
on the TrpAb tree in faint outline (supported with only
marginal bootstrap values), with TCG-2 and TCG-7 being
especially fragmented (Figure 5). The position of the
*TrpAb domain from T. fusca is not shown. (The discus-
sion given immediately above for TrpAa* from T. fusca
applies here.) Note that TrpAb from Thermotoga, Campylo-
bacter, and a small subclade of TCG-1 represented in Fig-
ure 5 by E. coli are fused with TrpB (TrpAb*TrpB). These
seem to have arisen as independent fusions, and there is
no indication here of convergent evolution (in contrast to
the TrpAa*TrpAb fusions discussed above).

PhnB from P. aeruginosa is encoded by a gene within an
operon that also contains phnA (Figure 3). The phnA and
phnB xenologs in P. aeruginosa are both divergent from the
P. aeruginosa trpAa and trpAb homologs that are engaged
in primary biosynthesis. The phnA/phnB operon origi-
nated by LGT from within TCG-1.

The gene encoding the TrpAb paralog (Sco_CDA) is a
member of a large operon (along with TrpAa, TrpB, and
TrpD paralogs) that is engaged in "calcium-dependent
antibiotic" biosynthesis [19] and presumably arose
intragenomically by gene duplication.

TrpB
TrpB catalyzes the anthranilate phosphoribosyl trans-
ferase step in which anthranilate and PRPP combine to
yield phosphoribosyl-anthranilate. In this paper the usage
of "TrpB" refers to TrpB_l, the major and ubiquitous sub-
type species. The distinctly divergent TrpB_2 subtype is
narrowly distributed (being cyanobacteria-specific) and
usually co-exists with TrpB_1 in cyanobacteria (Table 4
[see Additional File 1]). TrpB_2 might prove to be an
ancient paralog in cyanobacteria that has diverged to per-
form some other phosphoribosyl-transfer function. How-
ever, at present the closest homolog of TrpB_2 proteins
are the TrpB_1 enzymes that catalyse the second step of
Trp biosynthesis.

Figure 6 includes another S. coelicolor paralog dedicated to
antibiotic synthesis (Sco_CDA) that can be distinguished
from the primary-biosynthesis paralog. Dehalococcoides
.l.1.n10 ..,..s has two highly divergent paralogs, but Det_2
can be reasonably excluded from the primary-biosynthe-
sis pathway (and, therefore, from the Det concatenated
sequence of Figure 2) because it alone is not located
within the whole-pathway operon
trpAaAbBDC(aroA 1)EbEa [6]. Det_2 could be a very
ancient paralog, or it may have come from a LGT donor


that happens to be relatively distant from any of the
homologs included in Figure 6.

In the case of the unicellular cyanobacteria, a single set of
completely dispersed trp genes exists in every genome. The
Nostoc/Anabaena subclade is more complex, having addi-
tional operon-organized trp genes. Since these species also
possess the set of dispersed trp genes, it has been con-
cluded that the dispersed trp genes constitute a basic set of
conserved genes whose functional role is primary Trp bio-
synthesis in all cyanobacteria [7]. Accordingly, the trp
genes that are present in operon organization (including
trpB) have been excluded from the Trp concatenates
constructed for Anabaena sp. and Nostoc punctiforme (Fig-
ure 2).

As observed above (Figure 5) with the TrpAb* domain of
three phylogentically separated TrpAb*TrpB fusions, the
corresponding *TrpB domains (marked with asterisks in
Figure 6) also show no indication of evolutionary conver-
gence (suggesting that for this particular domain
combination, fusion does not impose a set of rigid con-
straints that must be met in each independent fusion).

TrpC
TrpC catalyzes the phosphoribosyl-anthranilate isomer-
ase step, which yields 1-(o-carboxyphenylamino)-l-deox-
yribulose 5-phosphate (CDRP). Figure 7 shows the TrpC-
protein tree on which the seven TCG groups are marked,
as well as TrpC from the ten lineages (orange highlight)
whose branching positions are not supported by signifi-
cant bootstrap values. The *TrpC domain of H. pylori is the
most divergent sequence within TCG-1. It clusters with
TrpC from Campylobacter jejuni with a bootstrap value of
81%. All members of TCG-1 in the TrpC tree are *TrpC
domains of TrpD*TrpC fusions, except for C. jejuni TrpC
(whose location in TCG-1 is probably artifactual).

TCG-5 organisms (actinomycete bacteria) lack a trpC gene
(except, of course, for the horizontally transferred genes of
coryneform bacteria). hisA (priA) from these organisms
presumably encodes a dual-pathway enzyme that per-
forms the isomerase function in both the histidine and
Trp biosynthetic pathways [13]. These dual-function priA
genes are listed in the hisA column of Table 4 [see Addi-
tional File 1]. Since *trpC in the coryneform bacteria is
coordinated with the other trp-operon genes that origi-
nated by LGT, their hisA (priA) gene can be considered a
remnant in the context of Trp biosynthesis. However, an
essential role in histidine biosynthesis has undoubtedly
selected for maintenance of hisA. It would be interesting
to know whether the trpC function of hisA in the coryne-
form species of bacteria has deteriorated or not.




Page 20 of 30
(page number not for citation purposes)


BMC Biology 2004, 2:15







http://www.biomedcentral.com/1741-7007/2/15


HisA
HisA catalyses an Amadori rearrangement that is analo-
gous to the TrpC rearrangement. This HisA isomerase
catalyses the rearrangement of N'- [(5'-phosphoribosyl)
foriminol-5-aminoimidazole-4-carboxamide ribonucle-
otide to N'- [(5'-phosphoribulosyl) forimino]-5-ami-
noimidazole-4-carboxamide ribonucleotide.

As noted above, the actinomycete group of HisA proteins
is dually competent for both the TrpC and HisA isomerase
functions, and they have been named PriA to distinguish
them from the pathway-specific TrpC and HisA proteins
[13]. However, the PriA proteins are clear homologs of
HisA proteins, whereas homology with TrpC is uncertain.
It is noteworthy that the HisA-protein tree shown in Fig-
ure 8 resembles the individual Trp-protein trees in terms
of the congruency groupings that can be recognized, and
these have been given parallel HCG (Histidine
Congruency Group) denotations. HisA clusters are recog-
nizable that parallel TCG-1, TCG-2, TCG-3, TCG-4, TCG-
5, and TCG-6. HCG-2 exhibits some fragmentation in that
it does not include the sequences from Xca and Xfa. Note
that all of the actinomycete HisA (PriA) proteins, includ-
ing those from C. diptheriae, C. glutamicum (and Coryne-
bacterium efficiens, not shown), form a cohesive cluster. H.
pylori has no histidine pathway. C. jejuni HisA falls within
HCG-1. Indeed, C. jejuni appears to have acquired the
entire histidine pathway from the enteric lineage (tenta-
tive observations based upon BLAST queries). Organisms
belonging to TCG-7 do not exhibit cohesive clustering of
HisA proteins on the HisA tree, but comparable fragmen-
tation of TCG-7 is not unusual for many of the individual
Trp-protein trees (i.e. especially with the least conserved
proteins).

TrpD
TrpD catalyzes the reaction of indoleglycerol phosphate
synthase, whereby CDRP is converted to indole 3-glycerol
phosphate with the release of carbon dioxide (CO2) and
water (H20). The TCG groupings seen in Figure 2 are well
articulated in the TrpD-protein tree of Figure 9. Within the
cyanobacterial TCG-4, both Anabaena sp. and N. puncti-
forme possess multiple paralogs that are speculated [7] to
have arisen by two gene duplications that occurred in a
common ancestor of Anabaena and Nostoc. The TrpD*
domains of H. pylori and the coryneform bacteria cluster
within TCG-1. S. coelicolor possesses a divergent paralog,
Sco_CDA, that is dedicated to antibiotic biosynthesis.

All of the actinomycete bacteria (bottom of Figure 9) pos-
sess monofunctional TrpD proteins that cluster within
TCG-5. The trpD genes from coryneform bacteria in TCG-
5 are remnants that have been functionally displaced by
the trpD* domain (located in TCG-1). The latter exists as
part of the trpD*trpC fusion within the trp operon


imported via LGT. The long branches of the TrpD
sequences (Cgl_r and Cdi_r) from the coryneform
bacteria (especially from C. glutamicum) suggest strongly
that these remnants may have lost catalytic function.

TrpEa
TrpEa is the alpha subunit of tryptophan synthase. It con-
verts indole 3-glycerol phosphate to indole with the
release of glyceraldehyde 3-P. It forms a tight complex
with TrpEb [271. The TCG clusters are well defined, as
shown in Figure 10. Within cyanobacterial TCG-4, trpEa
appears to have been duplicated in a common ancestor of
Anabaena and Nostoc, as discussed previously [7]. The
close relatives, P. aeruginosa and Pseudomonas syringae,
possess a single trpEa gene, which clearly falls into TCG-3,
rather than TCG-2. Thus, the native trpEa in these Pseu-
domonas species must have been displaced by a gene orig-
inating within the lineage of TCG-3 organisms.

TrpEb (TrpEb_ I)
TrpEb is the beta subunit of tryptophan synthase and con-
denses indole with L-serine to produce L-tryptophan.
Indole is not a free intermediate and passes through a tun-
nel that is created within the TrpEa/TrpEb complex [271.
A small number of Archaea and Bacteria possess a
homolog of TrpEb that falls into a distinct subcluster
termed TrpEb_2 [281. (In this manuscript the major
enzyme species, TrpEb_l1, may simply be referred to as
TrpEb in any context where there would be no confusion.)
It has been suggested that the TrpEb_2 species does not
form a complex with TrpEa and might have some other
stand-alone function, such as that of serine deaminase
[281. Figure 11 shows four bacterial genomes that possess
trpEb_2 in addition to trpEb_1, namely Thermotoga, Geo-
bacter, Aquifex, and Chlorobium. These organisms are
widely spaced on the 16S rRNA tree (Figure 1). Geobacter
has the partial-pathway operon trpAa/trpAb/trpB/trpEb_2/
trpC. trpEa and trpEb_l are located outside the operon and
are unlinked to one another. Even though TrpEb_2 is
located in the operon, it was excluded from the Gsu con-
catenate string (Figure 2) because trpEb_l encodes all of
the critical contact residues known to be important for
physical association with TrpEa [28].

The TrpEb_l1 sequences in Figure 11 form TCG clusters
that are relatively well defined, judging from the excellent
conformation with the tree of concatenated Trp sequences
(Figure 2). The paralogs present in Anabaena and Nostoc
within TCG-4 presumably originated following gene
duplication in a common ancestor of these genera [7]. The
sequences of TrpEb from Thermomonospora, Streptomyces,
and Mycobacteria cluster together as expected for actino-
mycetes (TCG-5). Exceptions are the TrpEb proteins of the
coryneform bacteria, which originated by LGT from a
source within TCG-1. Interestingly, after LGT, gene dupli-


Page 21 of 30
(page number not for citation purposes)


BMC Biology 2004, 2:15







http://www.biomedcentral.com/1741-7007/2/15


cation appears to have resulted in a second TrpEb species
(Cdi_2) in C. diptheriae. The branching position shown in
Figure 11 suggests that the duplication preceded specia-
tion. If so, C. glutamicum has since lost the paralog.
Alternatively, rapid divergence associated with probable
status of Cdi_2 as a pseudogene might account for the
position on the distance tree. It is interesting that it has
recently been asserted that duplication occurs more often
among laterally transferred genes than for native genes
[291.

Aromatic Congruency Groups implicate two deteriorated
TCGs
Chlamydophila/Chlarnydia
The chlamydiae have an intact common pathway of aro-
matic biosynthesis, but none have a complete trp path-
way. In one case, Chlamydophila pneumoniae, no trp genes
are present. At the other extreme, C. psittaci possesses all
trp genes except for trpAa and trpAb. Other species possess
an intermediate number of trp genes. Various rationales
have been advanced [ 10,111 in support of novel functions
for these incomplete pathways that have some interesting
implications for pathogenesis. Those few trp proteins
remaining in the chlamydiae are always very tightly clus-
tered with one another on individual protein trees. We
expect that when sufficient related genomes are
sequenced, Trp congruency will be established for the
chlamydiae. We mainly base this on the fact that trees cor-
responding to the seven enzymes of the common aro-
matic pathway yield a very cohesive Aromatic Congruency
Group (Xie and Jensen, in progress).

Epsilon proteobacteria
The epsilon proteobacteria, Helicobacter pylori and C.
jejuni, were among the early complete and published
genomes. Recently, the genomes of H. hepaticus and
Wolinella succinogenes have also become available. These
four organisms all possess common-aromatic pathway
enzymes whose sequences cluster tightly together (Xie
and Jensen, in progress). Since the H. pylori trp genes had
been replaced via LGT after divergence from their closest
neighbor (H. hepaticus), we expected that the Trp proteins
of the three remaining epsilon proteobacteria would
define a TCG grouping. However, Trp proteins from H.
hepaticus, W. succinogenes and C. jejuni are all divergent
from one another. They are also divergent from sequences
of other organisms. There is, so far, no indication of an
LGT history. C. jejuni has a trpAa/trpAb*trpB/trpC/trpEb/
trpEa operon (trpD is isolated in an unlinked position). H.
hepaticus has spaced the trp genes in three locations, where
trpAa/trpAb*trpB, trpD*trpC and trpEb/trpEa reside. It is
anomalous and quite possibly symptomatic of ongoing
reductive evolution that trpEa and trpEb are divergently
oriented. H. hepaticus not only has the trpAbotrpB fusion,
but also has a trpD*trpC fusion. The trpD*trpC fusion of H.


hepaticus appears to be of independent origin with respect
to all of the others in TCG-1, based upon phylogenetic
analysis and inter-domain linker analysis. In W.
succinogenes the trp genes are all dispersed and none of
them are fused. In the future, a core of epsilon proteobac-
teria may become available as a source of sequences to
build a Tryptophan Congruency Group. The organisms
currently available have experienced dynamic (and per-
haps disruptive) evolutionary events that currently pre-
vent definitive conclusions about the common ancestor.

For comparison, we took a preliminary look at the histi-
dine pathway in these four epsilon proteobacteria. H.
pylori has completely lost the histidine pathway, and C.
jejuni appears to have displaced its pathway with the his-
tidine operon from the enteric lineage. Genes of histidine
biosynthesis are completely dispersed in H. hepaticus and
W. succinogenes, and all yield mutually best BLAST hits.
Thus, H. hepaticus and W. succinogenes may be core
genomes that represent a congruency group with respect
to histidine biosynthesis.

Some underlying complexities of Trp-protein concatenates
Convergence of TrpAa*TrpAb fusions
Fusions of general aromatic biosynthetic pathway genes,
including those of the Trp pathway, have occurred fre-
quently. It is not uncommon for the same genes in differ-
ent organisms to have undergone fusion independently.
In cases where the catalytic domains function separately,
there may be great latitude for successful fusion orienta-
tions, for example, aroQ*pheA fusions [30]. In contrast,
TrpAb delivers ammonia to the active site of TrpAa in a
way that may impose particular demands upon the spatial
orientation of the protein-protein interaction operating
for the anthranilate synthase complex. Although we sug-
gest that TrpAa*TrpAb fusions have occurred independ-
ently at least five times in widely spaced lineages, they all
group tightly together in both TrpAa trees (Figure 4) and
TrpAb trees (not shown). We believe that this is due to
strong selective pressure for convergence. Thus, the
individual TrpAa and TrpAb trees place the T. fusca TrpAa
and TrpAb proteins in an anomalous group that includes
proteins from Legionella, Azospirillum, Brucella (and close
relatives) and the Nostoc/Anabaena group of cyanobacte-
ria. This phenomenon of convergence disrupts the con-
gruence of the individual TrpAa tree when these
organisms are included, but this is not enough to under-
mine the proper placement of the T. fusca Trp-protein con-
catenate within TCG-5.

The bifunctional priA gene of TCG-5 actinomycetes
The enzyme encoded by priA is competent for the isomer-
ase step in both the histidine and Trp pathways of actino-
mycete bacteria [13]. Thus, PriA sequences would be
concatenate components defining not only TCG-5, but


Page 22 of 30
(page number not for citation purposes)


BMC Biology 2004, 2:15







http://www.biomedcentral.com/1741-7007/2/15


also a Histidine Congruency Group (HCG-5) (Figure 8).
Presumably the acquisition of the trp operon in coryne-
form species leaves priA unnecessary for a role in Trp
biosynthesis. The dual substrate capabilities of PriA might
reflect an ancient state of broad-specificity competence,
with hisA and trpC being derived from specialized off-
spring of gene duplication [13]. On the other hand,
because PriA is clearly a homolog of HisA, but an uncer-
tain homolog of TrpC, it is possible that an ancestral trpC
was lost and subsequently replaced by a divergent dupli-
cate of hisA. The overall effect of PriA being uniquely
present in Trp-protein concatenates of actinomycete bac-
teria (i.e. being forced to align with TrpC in all other con-
catenates) is to compress slightly the actinomycete TCG
grouping.

The dual-pathway pabAb of TCG-6 bacilli
Very much like the above situation, TCG-6 Bacillus species
have lost trpAb from an otherwise complete trp operon.
pabAb, located in the pab operon, is competent to function
for both Trp and folate biosynthesis (see Xie et al. [6]).
Thus, within the narrow Bacillus clade that includes B.
subtilis, B. halodurans and B. stearothermophilus, PabAb
sequences help to define not only TCG-6, but also a pend-
ing Folate Congruency Group.

Discussion
Evolutionary scenario for LGT of whole-pathway Trp
operons
Figure 12 depicts the evolutionary events proposed to
account for the location in both H. pylori and coryneform
bacteria of all seven domains that are associated with pri-
mary Trp biosynthesis within TCG-1, which otherwise is
populated by members of the enteric lineage. Members of
TCG-1 all possess whole-pathway operons with a
trpD*trpC fusion. As an isolated observation, we cannot
absolutely rule out independent fusions of trpD with trpC
in Helicobacter and coryneform bacteria, followed by con-
vergent evolution with respect to the remaining trpD*trpC
fusions, to explain their joint locations in TCG-1 for TrpD
and TrpC trees. However, the identical overall gene order
of the 7-gene operon, the phylogenetic positioning of the
remaining five protein domains that are not fused, and
the existence of congruent trpD remnants in coryneform
bacteria are observations that support the conclusion of
LGT with conviction. Although the phylogenetic analysis
pinpoints the LGT donor of the whole-pathway trp
operon to a member within the enteric lineage, the subc-
lade that includes E. coli, Salmonella typhimurium, Klebsiella
pneumoniae, and Si ,.. i., flexneri can be excluded. This is
because the latter four organisms all possess a recent gene
fusion (trpAbotrpB) that is absent elsewhere in the enteric
lineage (absent also, of course, in H. pylori and coryne-
form bacteria).


Helicobacter
The ancestral trp genes of H. pylori were displaced by a
complete trp operon, but apparently without a leader
region. H. hepaticus is the closest published complete
genome to H. pylori. The LGT event can be pinpointed
after divergence of H. pylori and H. hepaticus since the trp
genes of H. hepaticus do not cluster within TCG-1. H.
hepaticus possesses a partial-pathway trpAa/trpAbotrpB
operon and orphan trpC and trpD genes. There are indica-
tions that the pathway is in a state of rapid deterioration,
as has been described for some pathogenic enteric bacte-
ria, for example, in Actinobacillus actinomycetemcomitans
[6]. Most notably, TrpEb and TrpEa, although still linked,
have been scrambled to a divergent orientation (thus, not
having the typical operon organization). In addition, H.
hepaticus TrpEa and TrpEb possess alterations in two and
four, respectively, of the residues diagrammed as invariant
residues by Xie et al. [28]. Thus, one or both may be inac-
tive pseudogenes. In view of this rapid deterioration, the
contemporary genome of C. jejuni might be more similar
to the displaced H. pylori Trp genes. The C. jejuni operon
gene order is trpAaAb*BCEbEa. In C. jejuni trpD is not
fused to trpC and, in fact, trpD has escaped the otherwise
intact trp operon. C. jejuni does not have a leader peptide
encoded by a gene upstream of its trp operon.

Corynebacterium
The ancestor of coryneform bacteria also imported a
whole-pathway trp operon, but in this case including a
coding region for a leader peptide. It is significant that
three species of coryneform bacteria possess an unlinked
second copy of trpD (denoted TrpD_r), which is a
remnant of the native displaced operon that still persists
in other actinomycete Bacteria. This conclusion is sup-
ported (Figure 9) by the clustering of the stand-alone
TrpD_r from both C. glutamicum and C. diptheriae with
TrpD proteins from other actinomycete bacteria (species
of Bifidobacteria, Mycobacteria, Thermomonospora and Strep-
tomyces) in TCG-5. The latter organisms possess trpD
within a partial-pathway trp operon having the order
trpAaDEbEa [6]. The elongated branches seen for TrpD_r
in Cgl and Cdi in Figure 9 are consistent with drift of the
remnant genes from their previous functional role, due to
the lack of selective pressure that followed functional
replacement by TrpD* of the LGT operon.

It is interesting that C. diptheriae exhibits evidence of
changes to its trp operon that are both relatively recent
and disruptive (Figure 12). A duplicate of trpEb has been
inserted at the beginning of the operon between trpL
(encoding the leader peptide) and trpAa. This TrpEb
protein may not be functional, considering that invariant
residue 162G (S. typhimurium numbering) has been
changed to 162E and invariant residue 167K has been



Page 23 of 30
(page number not for citation purposes)


BMC Biology 2004, 2:15








http://www.biomedcentral.com/1741-7007/2/15


Tfu TCG-5


Ssp
- Syn
- Pma TCG-4


I Chu


(Hpy)


Pseudomonas aeruginosa ...
Pseudomonas syringe
Shewanella putrefaciens
.... "I U Vibrio cholerae
I A IA Haemophilus influenza
\Eco TCG-1


Figure 12
Schematic portrayal of two whole-pathway trp operon transfers and two partial-pathway trp operon transfers. The partial tree
shown is taken from Fig. I, which identifies the organisms. In C diptheriae, the vertical evolutionary events of gene duplication
and insertion that occurred following LGT can be visualized by comparing the gene organization shown to the right (including
intergenic spacing) with the gene organization originally received from the enteric donor (bottom right). Gene insertions that
followed LGT are shown in white.




Page 24 of 30
(page number not for citation purposes)


BMC Biology 2004, 2:15







http://www.biomedcentral.com/1741-7007/2/15


changed to 167S, as pointed out earlier [28]. Residue
167K is crucial to the formation of an intersubunit salt
bridge with 56D of TrpEa [31].

Another post-LGT event in C. diptheriae has been the inser-
tion of two genes of D-pantothenate biosynthesis between
trpD*C and trpEb. In C. glutamicum the panB/panC operon
is remote from the trp operon and has been well character-
ized [32]. In C. diptheriae the insertion between trpD*C
and trpEb has been in a scrambled orientation such that
panC and panB are transcribed convergently, hence no
longer being an operon. The transcription of panB in the
opposite direction as the flanking genes of trp biosynthe-
sis should prevent the formation of a single transcript
from the trp genes. It would appear that the original xenol-
ogous trp operon of C. diptheriae has been split such that
trpAaAbBD*C and trpEbEa would be separately
transcribed. This may illustrate the phenomenon of reduc-
tive evolution for a pathogen in the process of discarding
un-needed genes.

All elements of operon regulation were not transferred
The trp operon of E. coli (and presumably other members
of the enteric clade) is subject to control at several levels
[15,16,27,33]. These include (i) allosteric control of
anthranilate synthase, whereby Trp acts as a potent feed-
back inhibitor; and (ii) an attenuator mechanism that is
mediated by a Trp-rich leader peptide (encoded by trpL),
and repression control mediated by trpR, which binds Trp
as a corepressor moiety. Because sensitivity to feedback
inhibition is built into the allosteric domain of TrpAa, and
because trpL is located immediately upstream of the E. coli
trp operon, it is not surprising that recipient organisms
such as the coryneform bacteria possess both of the latter
regulatory features. However, trpR is distant from the
operon and was not co-transferred with the operon.

Perhaps the contemporary trp operon acquired by LGT
offered selective advantages to the ancestor of coryneform
bacteria, but Trp regulation in coryneform bacteria would
appear to be relatively unsophisticated without trpR. In E.
coli the impact of attenuation is relatively weak compared
with the impact of repression [16,27]. Repression detects
free Trp whereas attenuation detects uncharged tRNATrp.
Since free Trp concentrations can be fairly low and still
maintain highly charged tRNATrp, trpR-mediated
repression acts over a large range of expression. Relief
from attenuation ensues after maximal derepression has
occurred. In E. coli, trpR also functions beyond the Trp
pathway in that it binds to an operator for an initial gene
of aromatic biosynthesis.

LGT of trpL in coryneform bacteria
The existence of a leader peptide associated with regula-
tion of the trp operon (and, indeed, the unexpectedly


close relationship with the E. coli trp operon) was reported
some time ago in C. glutamicum [34-36]. The leader-pep-
tide region (encoded by trpL) upstream of the trp operons
of C. glutamicum, C. efficiens, and C. diptheriae are shown
(Figure 13) in comparison with the corresponding region
of V. cholerae, a member of the enteric lineage that repre-
sents the LGT donor. In V. cholerae, C. glutamicum, and C.
efficiens, trpL is immediately upstream of trpAa, the initial
structural genes of the trp operon in these organisms. In C.
diptheriae a copy of trpEb has recently been inserted
between trpL and trpAa (Figure 12). The putative start
codons of trpL in Vibrio cholerae, C. glutamicum, and C. dip-
theriae are ATG, TTG, ATG, and GTG, respectively. These
yield leader peptides of 30 amino acids in length. The start
codon is uncertain, and Heery and Dunican [35] have sug-
gested a start codon (vertical black arrow) for C. glutami-
cum that would yield a 17-amino acid leader peptide.

In the case of H. pylori, the trp operon was either acquired
without trpL, or trpL was soon lost. Thus, the trp pathway
of H. pylori appears to lack regulation by both attenuation
and repression. Assuming that the displaced pathway of
H. pylori was similar to that of the contemporary C. jejuni
or other epsilon-proteobacteria, it would be interesting to
compare the relative efficiencies of the modern Trp path-
ways in these fairly close relatives.

LGT of partial-pathway Trp operons
P. aeruginosa possesses a partial-pathway operon consist-
ing of genes encoding the two subunits of tryptophan syn-
thase that are of xenologous origin. These trpEb/trpEa
genes are engaged in primary biosynthesis. The donor is
clearly a member of the TCG-3 clade. Thus, in the scenario
considered [6] for gene separation of the ancestral trpC/
trpEb/trpEa operon to yield a stand-alone trpC gene and a
trpEb/trpEa operon, the native trpEb/trpEa must have been
displaced by LGT, after the intragenomic translocation.
Because the regulatory gene, trpI, is adjacent in divergent
orientation to trpEb in the P. aeruginosa/P. syringae clade
(and three other close relatives; see asterisks in Table 3), it
will be interesting if any genomic members ofTCG-3 to be
sequenced in the future prove to have trpI adjacent to a
trpEb/trpEa operon. (However, TrpI is a member of the
ubiquitous and large family of LysR transcriptional activa-
tors, and could easily have emerged recently in the P. aer-
uginosa clade following gene duplication.)

P. aeruginosa also possesses a partial-pathway trp operon
encoding the two subunits of anthranilate synthase. Phyl-
ogenetic analysis indicates that these are trpAa trpAb
xenologs that originated from within the enteric lineage.
As with the whole-pathway operons just discussed, the E.
coli/S. typhimurium/K. pneumoniae/S. flexneri clade can be
excluded as the specific donor because this clade possesses
a trpAbotrpB fusion. This xenologous two-gene operon of


Page 25 of 30
(page number not for citation purposes)


BMC Biology 2004, 2:15









BMC Biology 2004, 2:15


http://www.biomedcentral.com/1741-7007/2/15


Corynebacterium glutamicum
tryptophan-specific permease-) |
gtgcgtagagctgcggaaactacgcaagaacccaaaaatgattaataattgagacaagcttcccactatgtgataaagtcccattttgtgaataactcttgtctc
V R R A A E T T Q E P K N D * M R Q A S H Y V I K S H F V N N S C L
agtcaaagcacccagtggtggtggcgcgctaactaa gcggc gaatttcactttgatgaattttttg gct c tt ctcgacgaag
S Q S T Q W W W R A N *
aa gcgggccttttgtggtttttagcccacaaccggcaagccctg gatcgaatgaagctcgcagcgagtaattattt gatgtt tcccagaaaggcttcagccccac
aatgatcctcggtaggtgccccatgagcacgaatccccatgtt
M S T N P H V
TrpAa 4
Corynebacterium efficiens
hypothetical protein |
tgatgaggatgactctgctacgggaacccatgccacacatcccttaatctatatcta ttgttct
M R M T L L R E P M P H I P *
gggcatgt a atgagacaaatttcccaccccgtgataaagttctgggttgtgaacaacttctgtcaatcccagggcacccagtggtggtggcgcgct
M R Q I S H P V I K F W V V N N F C Q S Q G T Q W W W R A
agataagc gggc ggaca t tttcacac attcaggctcgtgtacttcgttgagacagggctttt gttcacaggataa
R *
acctggat aa cccacaaccggcgcgccccgggatcgaacgaagctcaaagccccattaatgagttgttctta aacgt t cccagtgaaaggcccggttcccat
gtcagtgtgacacccgtcctgagtctcaggcaggtgagtgccccatgagcaccgccccc
M S T A P
TrpAa 4
Corynebacterium diptheriae
tryptophan-specific permease-)
acctctgattcttaaat atgtgccggcccgctgttgcgtgcgccactcaagatgcgtattgtcatgttccatgacgaacatgaatgcacataactggtggtgg
T S D S* M P A R C C V R H S R C V L S C S M T N M N A H N W W W
cgcgcttaa cgggcctttcacgcattcatttcaaggcgccgggccttttt t ccgtt
R A *
cggcccaccgctgaacacaacaaatattgtttttcagcgaaagaggtagaaacaccatgactgactccaccctccgtaagacgttaatc
M T D S T L R K T L I
TrpEb4
Vibrio cholera
<-PHP domain containing protein (TRPH)
tccagttaagagta
attttttatttgcctgatttttaggcttgacttttt at cgccgcactagttaactagtacgcaaat gcaagatctct gt tagggctcac
L D I R M
ctatgttacaagaatttaacccaaaccataaacccaatttcagtccagcggatgctgaactggcttggtggcgcacttggacaagttcttggtgggctcacgtg
M L Q E F N P N H K P N F S P A D A E L A W W R T W T S S W W A H V

tatttctaagtttag t cacat ccaactt tttttattggttttttccacctatcactgctgtttcgctactttctcaacgcgg
Y F *
tgatcagtgcacaatcgaatcatggtaaggaggtcttatgaataaggc
M N K A
TrpAa 4







Figure 13
Comparison of trpL leader regions in species of coryneform bacteria and in a representative enteric bacterium. In the coryne-
form bacteria, the start codon for trpL is uncertain, and second start sites at an internal position for C glutamicum and C effi-
ciens are indicated by black, vertical arrows.


P. aeruginosa (originally denoted phnA and phnB by Craw-
ford et al. [25,37]) has not displaced the corresponding trp
genes that are engaged in primary biosynthesis. Although
phnA and phnB were originally thought to function in
phenazine production, as the naming implies, phenazine
pigments are not derived from anthranilate [26]. Instead,
the xenolog pair appear to have an unknown specialized
function that is geared to stationary-phase physiology
[38]. The LGT acquisition of the phnA/phnB xenolog
operon by P. aeruginosa occurred after its divergence from
close relatives such as P. putida, P. fluorescens, P. syringae
and Azotobacter vinelandii because none of these relatives


have the xenologous phnA/phnB operon. Hence, this
acquisition appears to be quite recent.


Species of Xylella also possess a xenologous two-gene
trpAa/trpAb partial-pathway trp operon that appears to
have a specialized function that is distinct from homologs
engaged in primary Trp biosynthesis. Xie et al. [7] have
suggested that the gene denoted acl probably encodes an
aryl-CoA ligase. Since acl appears to exist within the Xylella
trpAa/trpAb operon, its gene product may have the specif-
icity of anthranilate-CoA ligase. Activated anthranilate
may then function as a key precursor for production of
antibiotic, siderophore, and so on. Note that, if this is cor-


Page 26 of 30
(page number not for citation purposes)







http://www.biomedcentral.com/1741-7007/2/15


rect, the primary trp-pathway genes trpB/trpC/trpD/trpEa/
trpEb are irrelevant to the specialized pathway. Thus, refer-
ence to the xenologous trpAa/trpAb pair as a "partial-path-
way operon" could be somewhat a misnomer, and
perhaps "hybrid operon" might prove to be more apt. The
origin of the Xylella trpAa/trpAb genes might have been
from a close relative of C. jejuni because the best matches
of both genes are with C. jejuni. It is also suggestive that
these genes have a low-GC ratio (about 38%), compared
with a genomic GC ratio of 30.2% for C. jejuni. C. jejuni
cannot have been the direct donor, however, because it
possesses a trpAb.trpB fusion.

Conclusions
The overall impact of LGT in Bacteria and Archaea is cur-
rently a highly contentious issue. Critical reviews written
from completely different viewpoints are recommended
for a sense of the status of the ongoing debate, as well as
for a substantial listing of key references [39,40]. Gogarten
et al. [21] have summarized a contemporary rationale to
describe the evolutionary process as a phylogenetic "syn-
thesis" that could integrate a traditional tree-like behavior
(vertical descent of genes) and web-like, reticulate behav-
ior (LGT). The latter paper follows up on a balanced and
highly insightful review produced by Doolittle in 1999
[22]. In an essay by Martin [41] about the extent to which
bacterial chromosomes might be mosaic, it was
emphasized that "careful gene-by-gene phylogenetic com-
parisons in addition to genome-by-genome compari-
sons.....are needed." We consider the Trp system to be a
particularly apt choice for gaining detailed insight into the
relative contributions of lateral and vertical events in the
evolutionary history of a major segment of primary
metabolism. On the one hand, genes of Trp biosynthesis
are expected to represent a level and type of fundamental
metabolism that is least prone to LGT if it is correct that a
"core" of genes exists that is relatively recalcitrant to LGT
[23,42]. On the other hand, the wide distribution of intact
whole-pathway trp operons should facilitate the probabil-
ity of LGT (at least the initial acquisition event). For the
Trp pathway, we conclude that events of LGT and paralogy
do not obliterate the vertical trace of evolutionary history.
This view is reinforced by the contention that whole-
genome trees (mean pairwise similarities between shared
genomic proteins) have largely converged on the rRNA-
sequence tree [43]. The latter work was preceded by the
gene-content "trees" introduced by Snel et al. [44]. Also,
see Eisen [45].

Gogarten et al. [21] have discussed the radical possibility
that rRNA genes are highly mosaic and are so useful for
prokaryotic taxonomy "precisely because they are mosaics
and reflect the mosaic character of the genome as a
whole". According to this view, a vertical trace of genea-
logical history will not be found, because it only exists in


short jumps. (If so, the two whole-pathway LGT events
described here reflect LGT events that stand out against
the overall mosaic trends.)

The above caveat aside, 16S rRNA trees do appear to pro-
vide a reasonable guide to the vertical trace of evolution-
ary descent [46]. If so, the mapping of the Trp-pathway
system upon the 16S rRNA tree exemplifies a case where
the evolutionary history can indeed be tracked as a vertical
genealogy that features some intriguing reticulate rela-
tionships. Proteins of the Trp pathway generally exhibit a
genealogy that is parallel with the 16S rRNA tree. In the
case of Helicobacter and Corynebacterium species, the
genomes are a mosaic with respect to Trp genes. This
means that the history of the trp genes in the latter
organisms, instead of being that shared with their closest
relatives, is the same as that of enteric bacteria (the donor
lineage) up to the time of LGT. Following this time a new
vertical genealogical progression has begun. Each organ-
ism (lineage) can be envisioned to possess an individual-
istic repertoire of chimeric features that have been
assimilated into a recognizable skeleton of vertical events.
It would seem that the evolutionary history of the primary
pathway of Trp biosynthesis parallels the organismal phy-
logeny in most organisms. This presently includes all of
the organisms in Figure 2 that belong to TCG groupings,
except for H. pylori and the coryneform bacteria. Mosai-
cism can occasionally exist at a level of individual trp
genes, as illustrated by P. aeruginosa and its closest rela-
tives. Here the history of trpAa/trpAb/trpB/trpC/trpD (pri-
mary biosynthesis) parallels the organismal phylogeny,
but trpEb/trpEa exhibit a reticulate genealogy.

It will be important to obtain other analyses of similar
detail for other pathways to assess to what extent the evo-
lutionary process that underpins Trp biosynthesis reflects
the general process in other pathways. We have already
seen in preliminary work that construction of similar con-
gruency groups pertinent to common aromatic-pathway
biosynthesis, folate biosynthesis, and histidine biosynthe-
sis has good potential to expand the analysis. It seems
probable that there are no prokaryote species whose
evolutionary history exclusively involved a vertical line of
descent for all of its genes. Lawrence [47] has written a
cogent essay in support of the view that the Linnean para-
digm of hierarchical descent fails to describe the evolution
of prokaryotes because LGT occurs "at all levels of taxo-
nomic inclusiveness". However, Woese et al. [48] argue
that the dynamic of LGT has become progressively
diminished through time as simple, primitive early cells
became complex and refined. This is in accord with our
thesis [6] that early and simple trp-gene assemblages may
have been unstable until their progression to complexities
of regulation and to establishment of individualistic met-
abolic ties that conferred increasing operon stability.


Page 27 of 30
(page number not for citation purposes)


BMC Biology 2004, 2:15







http://www.biomedcentral.com/1741-7007/2/15


Methods
Genomes
Refer to the Gold Genomes Online Database [49] for a list
of published complete genomes and links to the corre-
sponding references. Synonymous names include Rhizo-
bium meliloti = Sinorhizobium meliloti; Corynebacterium
glutamicum = Brevibacterium lactofermentum = Brevibacte-
rium flavum = Brevibacterium divaricatum; Rhizobium
meliloti = Sinorhizobium meliloti; Rhizobium loti = Mesorhizo-
bium loti; Thermomonospora fusca = Thermobifida fusca;
Chlamydophila psittaci = Chlamydophila caviae; Thiobacillus
ferrooxidans = Acidithiobacillus ferrooxidans; Shewanella
putrefaciens = Shewanella oneidensis; Sphingomonas aromati-
civorans = Novosphingobium aromativorans.

16S rRNA phylogenetic trees
16S rRNA subtrees were derived from the Ribosomal
Database site [50,51].

Protein phylogenetic trees
Unrooted phylogenetic trees were derived from ClustalW
alignment [52,53]. The neighbor-joining and Fitch [54]
programs were employed to obtain distance-based trees.
The distance matrix was obtained using Protdist with a
Dayhoff Pam matrix. The Seqboot and Consense pro-
grams were then used to assess the statistical strength of
the tree using bootstrap resampling. Neighbor-joining
and Fitch trees yielded similar clusters and arrangement of
taxa within them. Bootstrap values indicate the number of
times a node was supported in 100 resampling
replications.

Concatenated sequences of Trp-pathway proteins
Multiple sequence alignments were derived by input of
the indicated homolog amino acid sequences into the
ClustalW program (Version 1.4) [52,53]. Manual align-
ment adjustments were made as needed with the assist-
ance of the BioEdit multiple alignment tool of Hall [55].

After each of the individual Trp-protein domain align-
ments were generated, both N-terminal and C-terminal
unaligned regions were trimmed manually through visual
inspection. Then the seven protein domains responsible
for the Trp pathway of biosynthesis were concatenated in
the order: TrpAa/TrpAb/TrpB/TrpC/TrpD/TrpEa/TrpEb.
The resulting concatenated multiple alignment was used
as input for generation of a phylogenetic tree using the
program package PHYLIP [56].

Analysis of raw DNA sequence data
Raw DNA contig sequences available from NCBI [57] and
the TIGR Unfinished Microbial Genomes database [58]
were screened using the built-in BLAST service. The pro-
tein sequences from GenBank were used as query entries.
The BLAST 2.0 and the ORF Finder (Open Reading Frame


Finder) offered by NCBI [59] were used to locate open
reading frames and to confirm the similarity search result
of the raw sequence.

Analysis of fusion proteins
Fusion protein sequences from GenBank and NCBI
Microbial Genomes Blast Databases [57] were screened
using the BLAST [60] program. Multiple alignments were
obtained by input of single-domain and fusion-protein
sequences into the ClustalW [52,53] program (version
1.4).

Authors' contributions
The major roles of the authors were as follows. GX
obtained the sequences, did the alignments, and obtained
the phylogenetic trees. CB drew the figures. JS undertook
the systematic management and organization of sequence
data with the objective of achieving a dynamic and pro-
gressively updateable website. NK managed and
coordinated the general laboratory operations. The initial
guiding concepts and the initial draft came from RJ. All of
the authors participated in the data analyses and in the
formulation of conclusions. All of the authors read and
approved the final version of the manuscript.

Additional material


Additional File 1
Table 4, entitled "Keys to sequence identifiers", is provided as supplemen-
tary material in an html document. This table contains a full collection of
sequence data and annotations contained in this paper, and gi (gene iden-
tification) numbers are included and hyperlinked to facilitate access to the
corresponding GenBank records. For future reference to a progressively
updated table, refer to .nh i,. i. I... I l .. i.' t, ,t-i.'4.html.
Click here for file
[http://www.biomedcentral.com/content/supplementary/1741-
7007-2-15-S1.html]


Acknowledgements
This is Florida Agricultural Experiment Station Journal Series No. R-09802.
RJensen thanks the National Library of Medicine (Grant GI 3 LM008297)
for partial support. Some of the preliminary sequence data were obtained
from the Institute for Genomic Research [58], National Center for Bio-
technology Information [57], and Integrated Genomics, Inc. [61]. We thank
Charles Yanofsky and Ross Overbeek for their critiques of an early version
of this manuscript.

References
I. Lawrence JG, Ochman H: Molecular archaeology of the
Escherichia coli genome. Proc Nat! Acad Sci USA 1998,
95:9413-9417.
2. Lawrence JG, Ochman H: Amelioration of bacterial genomes:
rate of change and exchange. J Mol Evol 1997, 44:383-397.
3. Song J, Ware A, Liu S-L: Wavelet to predict bacterial ori and ter
a tendency towards a physical balance. 8MC Genomics 2003,
4:17.



Page 28 of 30
(page number not for citation purposes)


BMC Biology 2004, 2:15








http://www.biomedcentral.com/1741-7007/2/15


4. Lawrence J: Selfish operons: the evolutionary impact of gene
clustering in prokaryotes and eukaryotes. Curr Opin Genet Dev
1999, 9:642-648.
5. Lawrence JG: Selfish operons and speciation. Trends Microbiol
1997, 5:355-359.
6. Xie G, Keyhani NO, Bonner CA, Jensen RA: The ancient origin of
the tryptophan operon and tracking the subsequent dynam-
ics of evolutionary change. Microbiol Mol Biol Rev 2003,
67:303-342.
7. Xie G, Bonner CA, Brettin T, Gottardo R, Keyhani NO, Jensen RA:
Lateral gene transfer and ancient paralogy of operons con-
taining redundant copies of tryptophan-pathway genes in
Xylella species and in heterocystous cyanobacteria. Genome
Biol 2003, 4:R-14.
8. Lawrence JG: Gene transfer, speciation, and the evolution of
bacterial genomes. Curr Opin Microbiol 1999, 2:519-523.
9. Boucher Y, Huber H, L'Haridon S, Stetter KO, Doolittle WF: Bacte-
rial origin for the isoprenoid biosynthesis enzyme HMG-CoA
reductase of the archaeal orders Thermoplasmatales and
Archaeoglobales. Mol Biol Evol 2001, 18:1378-1388.
10. Xie G, Bonner CA, Jensen RA: Dynamic diversity of the tryp-
tophan pathway in chlamydiae: reductive evolution and a
novel operon for tryptophan recapture. Genome Biol 2002,
3:research0051.1-005 1.17.
I I. Fehlner-Gardniner C, Roshick C, Carlson JH, Hughes S, Belland RJ,
Caldwell HD, McClarty G: Molecular basis defining human
Chlamydia trachomatis tissue tropism: a possible role for
tryptophan synthase.J Biol Chem 2002, 277:26893-26903.
12. Wood H, Roshick C, McClarty G: Tryptophan recycling is
responsible for the interferon-gamma resistance of Chlamy-
dia psittaci GPIC in indoleamine dioxygenase-expressing
host cells. Mol Microbiol 2004, 52:903-916.
13. Barona-G6mez F, Hodgson DA: Occurrence of a putative
ancient-like isomerase involved in histidine and tryptophan
biosynthesis. EMBO Reports 2003, 4:296-300.
14. Osterman A, Overbeek R: Missing genes in metabolic pathways:
a comparative genomics approach. Curr Opin Chem Biol 2003,
7:238-251.
15. Yanofsky C: Advancing our knowledge in biochemistry, genet-
ics, and microbiology through studies on tryptophan
metabolism. Ann Rev Biochem 2001, 70:1-37.
16. Yanofsky C: Reflections: using studies on tryptophan metabo-
lism to answer basic biological questions. J Biol Chem 2003,
278:10859-10878.
17. Auerbach S, GaoJ, Gussin GN: Nucleotide sequences of the trpl,
trpB, and trpA genes of Pseudomonas syringae: positive con-
trol unique to fluorescent pseudomonads. Gene 1993,
123:25-32.
18. Hu DS-J, Hood DW, Heidstra R, Hodgson D: The expression of
the trpD, trpC and trpBA genes of Streptomyces coelicolor
A3(2) is regulated by growth rate and growth phase but not
by feedback repression. Mol Microbiol 1999, 32:869-880.
19. Ryding NJ, Anderson TB, Champness WC: Regulation of the
Streptomyces coelicolor calcium-dependent antibiotic by
absA, encoding a cluster-linked two-component system. J
Bacteriol 2002, I 84:794-805.
20. Brown JR, Doolittle WF: Archaea and the prokaryote-to-
eukaryote transition. Microbiol Mol Biol Rev 1997, 61:456-502.
21. Gogarten JP, Doolittle WF, Lawrence JG: Prokaryotic evolution in
light of gene transfer. Mol Biol Evol 2002, I 9:2226-2238.
22. Doolittle WF: Phylogenetic classification and the universal
tree. Science 1999, 284:2124-2128.
23. Eisen JA: Horizontal gene transfer among microbial genomes:
new insights from complete genome analysis. Curr Opin Genet
Dev 2000, 10:606-61 1.
24. Eisen JA: Phylogenomics: improving functional predictions for
uncharacterized genes by evolutionary analysis. Genome Res
1998, 8:163-167.
25. Crawford IP, Milkman R: Orthologous and paralogous diver-
gence, reticulate evolution, and lateral gene transfer in bac-
terial trp genes. In: Evolution at the Molecular Level Edited by:
Selander RK, Clark AG, Whittam TS. Sunderland, Mass.: Sinauer &
Assoc; 1990:77-95.
26. McDonald MD, Mavrodi DV, Thomashow LS, Floss HG: Phenazine
biosynthesis in Pseudomonas fluorescens : branchpoint from
the primary shikimate biosynthetic pathway and role of


phenazine-1,6-dicarboxylic acid. J Am Chem Soc 2001,
1 23:9459-9460.
27. Yanofsky C, Miles E, Bauerle R, Kirschner K: Trp Operon. Volume 4.
New York: John Wiley & Sons, Inc; 1999.
28. Xie G, Forst C, Bonner CA, Jensen RA: Significance of two dis-
tinct types of tryptophan synthase beta chain in Bacteria,
Archaea and higher plants. Genome Biology 2001,
3:research005.1-005.13.
29. Hooper SD, Berg OG: Duplication is more common among lat-
erally transferred genes than among indigenous genes.
Genome Biol 2003, 4:R48.
30. Calhoun DH, Bonner CA, Gu W, Xie G, Jensen RA: The emerging
periplasm-localized subclass of AroQ chorismate mutases,
exemplified by those from Salmonella typhimurium and Pseu-
domonas aeruginosa. Genome Biol 2001, 2:research0030. 1-0030.16.
31. Miles EW, Bauerle R, Ahmed SA: Tryptophan synthase from
Escherichia coli and Salmonella typhimurium. Methods Enzymol
1987, 142:398-414.
32. Sahm H, Eggeling L: D-Pantothenate synthesis in Corynebacte-
rium glutamicum and use of panBC and genes encoding L-
valine synthesis for D-pantothenate overproduction. AppI
Environ Microbiol 1999, 65:1973-1979.
33. Xiu ZI, Chang ZY, Zeng AP: Nonlinear dynamics of regulation of
bacterial trp operon: model analysis of integrated effects of
repression, feedback inhibition, and attenuation. Biotech 2002,
1 8:686-693.
34. Matsui K, Sano K, Ohtsubo E: Sequence analysis of the Brevibac-
terium lactofermentum trp operon. Mol Gen Genet 1987,
209:299-305.
35. Heery DM, Dunican LK: Cloning of the trp gene cluster from a
tryptophan-hyperproducing strain of Corynebacterium
glutamicum: identification of a mutation in the trp leader
sequence. AppI Envir Microbiol 1993, 59:791-799.
36. Su YC, Chen SL: Cloning of the tryptophan operon of Brevibac-
terium divaricatum and its expression in E. coli. Proc NatlAcad Sci
USA 1996, 20:87-91.
37. Essar DW, Eberly L, Hadero A, Crawford IP: Identification and
characterization of genes for a second anthranilate synthase
in Pseudomonas aeruginosa : interchangeability of the two
anthranilate synthases and evolutionary implications. ]
Bacteriol 1990, 172:884-900.
38. Mavrodi DV, Bonsall RF, Delaney SM, Soule MJ, Phillips G, Tho-
mashow LS: Functional analysis of genes for biosynthesis of
pyocyamin and phenazine-l-carboxamide from Pseu-
domonas aeruginosa PAO I. J Bacteriol 2001, 183:6454-6465.
39. Kurland CG, Canback B, Berg OG: Horizontal gene transfer: A
critical view. Proc NatlAcad Sci USA 2003, 100:9658-9662.
40. Lawrence JG, Henderickson H: Lateral gene transfer: when will
adolescence end? Mol Microbiol 2003, 50:739-749.
41. Martin W: Mosaic bacterial chromosomes: a challenge en
route to a tree of genomes. Bioessays 1999, 21:99-104.
42. Lerat E, Daubin V, Moran NA: From gene trees to organismal
phylogeny in prokaryotes: the case of the alpha-proteobacte-
ria. PLoS Biology 2003, I :El.
43. Clarke AR, Beiko RG, Ragan MA, Charlebois RL: Inferring genome
trees by using a filter to eliminate phylogenetically
discordant sequences and a distance matrix based on mean
normalized BLAST scores. j Bacteriol 2002, I 84:2072-2080.
44. Snel B, Bork P, Huynen MA: Genome phylogeny based on gene
content. Nat Genet 1999, 21:108- I 10.
45. Eisen JA: Assessing evolutionary relationships among
microbes from whole-genome analysis. Curr Opin Microbiol
2000, 3:475-480.
46. Woese CR: Interpreting the universal phylogenetic tree. Proc
Natl Acad Sci USA 2000, 97:8392-8396.
47. Lawrence J: Gene transfer in Bacteria : speciation without
species? Theoret Populat Biol 2002, 61:449-460.
48. Woese CR, Olsen GJ, Ibba M, Soil D: Aminoacyl-tRNA syn-
thetases, the genetic code, and the evolutionary process.
Microbiol Mol Biol Rev 2000, 64:202-236.
49. Gold Genomes OnLine Database [http://www.genomeson
lin e.org/]
50. Maidak BL, Cole JR, Lilburn TG, Parker CT Jr, Saxman PR, Farris RJ,
Garrity GM, Olsen GJ, Schmidt TM, Tiedje JM: The RDP-11 (Ribos-
omal Database Project). Nucl Acids Res 2001, 29:173-17.
51. Ribosomal Database Project II [http://rdp.cme.msu.edu/html]



Page 29 of 30
(page number not for citation purposes)


BMC Biology 2004, 2:15








http://www.biomedcentral.com/1741-7007/2/15


52. Thompson JD, Higgins DG, Gibson TJ: Clustal W: improving the
sensitivity of progressive multiple sequence alignment
through sequence weighting, position-specific gap penalties
and weight matrix choice. Nucl Acids Res 1994, 22:4673-4680.
53. ClustalW, version 1.4 [http://www.ebi.ac.uk/clustalw]
54. Fitch WM: Toward defining the course of evolution: minimum
change for a specific tree topology. Syst Zool 1971, 20:406-416.
55. Hall TA: Biological sequence alignment editor for Windows
95/98/NT, 4.8.6. 2000 [http://http//:www.mbio.ncsu.edu/BioEdit/
bioedit.html].
56. Felsenstein J: PHYLIP-Phylogeny Inference Package (version
3.2). Cladistics 1989, 5:164-166.
57. National Center for Biotechnology Information [http://
www.ncbi.nlm.nih.gov/Microb blast/unfinishedgemome.html.old/]
58. The Institute for Genomic Research [http://www.tigr.org/tdb/
ufmgl]
59. National Center for Biotechnology Information [http://
www.ncbi.nlm.nih.gov/]
60. BLAST [http://www.ncbi.nlm.nih.gov/blast/]
61. Integrated Genomics, Inc [http://wit.integratedgenomics.com/
ERGO]


Page 30 of 30
(page number not for citation purposes)


Publish with BioMed Central and every
scientist can read your work free of charge
"BioMed Central will be the most significant development for
disseminating the results of biomedical research in our lifetime."
Sir Paul Nurse, Cancer Research UK
Your research papers will be:
available free of charge to the entire biomedical community
peer reviewed and published immediately upon acceptance
cited in PubMed and archived on PubMed Central
yours you keep the copyright

Submit your manuscript here: BioMedcentral
http://www.biomedcentral.com/info/publishing adv.asp


BMC Biology 2004, 2:15




University of Florida Home Page
© 2004 - 2010 University of Florida George A. Smathers Libraries.
All rights reserved.

Acceptable Use, Copyright, and Disclaimer Statement
Last updated October 10, 2010 - - mvs