Group Title: BMC Genomics
Title: ASAP : Amplification, sequencing and annotation of plastomes
CITATION PDF VIEWER THUMBNAILS PAGE IMAGE ZOOMABLE
Full Citation
STANDARD VIEW MARC VIEW
Permanent Link: http://ufdc.ufl.edu/UF00100026/00001
 Material Information
Title: ASAP : Amplification, sequencing and annotation of plastomes
Physical Description: Book
Language: English
Creator: Dhingra, Amit
Folta, Kevin
Publisher: BMC Genomics
Publication Date: 2005
 Notes
Abstract: BACKGROUND:Availability of DNA sequence information is vital for pursuing structural, functional and comparative genomics studies in plastids. Traditionally, the first step in mining the valuable information within a chloroplast genome requires sequencing a chloroplast plasmid library or BAC clones. These activities involve complicated preparatory procedures like chloroplast DNA isolation or identification of the appropriate BAC clones to be sequenced. Rolling circle amplification (RCA) is being used currently to amplify the chloroplast genome from purified chloroplast DNA and the resulting products are sheared and cloned prior to sequencing. Herein we present a universal high-throughput, rapid PCR-based technique to amplify, sequence and assemble plastid genome sequence from diverse species in a short time and at reasonable cost from total plant DNA, using the large inverted repeat region from strawberry and peach as proof of concept. The method exploits the highly conserved coding regions or intergenic regions of plastid genes. Using an informatics approach, chloroplast DNA sequence information from 5 available eudicot plastomes was aligned to identify the most conserved regions. Cognate primer pairs were then designed to generate ~1 – 1.2 kb overlapping amplicons from the inverted repeat region in 14 diverse genera.RESULTS:100% coverage of the inverted repeat region was obtained from Arabidopsis, tobacco, orange, strawberry, peach, lettuce, tomato and Amaranthus. Over 80% coverage was obtained from distant species, including Ginkgo, loblolly pine and Equisetum. Sequence from the inverted repeat region of strawberry and peach plastome was obtained, annotated and analyzed. Additionally, a polymorphic region identified from gel electrophoresis was sequenced from tomato and Amaranthus. Sequence analysis revealed large deletions in these species relative to tobacco plastome thus exhibiting the utility of this method for structural and comparative genomics studies.CONCLUSION:This simple, inexpensive method now allows immediate access to plastid sequence, increasing experimental throughput and serving generally as a universal platform for plastid genome characterization. The method applies well to whole genome studies and speeds assessment of variability across species, making it a useful tool in plastid structural genomics.
General Note: Periodical Abbreviation:BMC Genomics
General Note: Start page 176
General Note: M3: 10.1186/1471-2164-6-176
 Record Information
Bibliographic ID: UF00100026
Volume ID: VID00001
Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: Open Access: http://www.biomedcentral.com/info/about/openaccess/
Resource Identifier: issn - 1471-2164
http://www.biomedcentral.com/1471-2164/6/176

Downloads

This item has the following downloads:

PDF ( PDF )


Full Text



BMC Genomics


B
Biol-l Central


Methodology article

ASAP: Amplification, sequencing & annotation of plastomes
Amit Dhingra* and Kevin M Folta


Address: Horticultural Sciences Department, University of Florida, Gainesville, FL 32611, USA
Email: Amit Dhingra* adhingra@ifas.ufl.edu; Kevin M Folta kfolta@ifas.ufl.edu
* Corresponding author


Published: 07 December 2005
8MC Genomics 2005, 6:176 doi:10.1 186/1471-2164-6-176


Received: 02 August 2005
Accepted: 07 December 2005


This article is available from: http://www.biomedcentral.com/1471-2164/6/176
2005 Dhingra and Folta; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0),
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.



Abstract
Background: Availability of DNA sequence information is vital for pursuing structural, functional
and comparative genomics studies in plastids. Traditionally, the first step in mining the valuable
information within a chloroplast genome requires sequencing a chloroplast plasmid library or BAC
clones. These activities involve complicated preparatory procedures like chloroplast DNA isolation
or identification of the appropriate BAC clones to be sequenced. Rolling circle amplification (RCA)
is being used currently to amplify the chloroplast genome from purified chloroplast DNA and the
resulting products are sheared and cloned prior to sequencing. Herein we present a universal high-
throughput, rapid PCR-based technique to amplify, sequence and assemble plastid genome
sequence from diverse species in a short time and at reasonable cost from total plant DNA, using
the large inverted repeat region from strawberry and peach as proof of concept. The method
exploits the highly conserved coding regions or intergenic regions of plastid genes. Using an
informatics approach, chloroplast DNA sequence information from 5 available eudicot plastomes
was aligned to identify the most conserved regions. Cognate primer pairs were then designed to
generate ~1 1.2 kb overlapping amplicons from the inverted repeat region in 14 diverse genera.
Results: 100% coverage of the inverted repeat region was obtained from Arabidopsis, tobacco,
orange, strawberry, peach, lettuce, tomato and Amaranthus. Over 80% coverage was obtained from
distant species, including Ginkgo, loblolly pine and Equisetum. Sequence from the inverted repeat
region of strawberry and peach plastome was obtained, annotated and analyzed. Additionally, a
polymorphic region identified from gel electrophoresis was sequenced from tomato and
Amaranthus. Sequence analysis revealed large deletions in these species relative to tobacco
plastome thus exhibiting the utility of this method for structural and comparative genomics studies.
Conclusion: This simple, inexpensive method now allows immediate access to plastid sequence,
increasing experimental throughput and serving generally as a universal platform for plastid genome
characterization. The method applies well to whole genome studies and speeds assessment of
variability across species, making it a useful tool in plastid structural genomics.


Background
Chloroplast DNA (cpDNA) represents an extranuclear
capsule of genetic information, encoding essential struc-
tural and enzymatic proteins of the organelle. This satel-


lite genome contains a wealth of information that has
been shaped by speciation, rendering it a rich resource to
trace evolutionary relationships between photosynthetic
taxa [1]. Genetic manipulation of the chloroplast genome


Page 1 of 13
(page number not for citation purposes)







http://www. biomedcentral.com/1471-2164/6/176


can transform the chloroplast into a bioreactor, allowing
large-scale production of proteins vital to agriculture or
pharmacology [2,3]. Maternal inheritance of plastid
genome in most species ensures gene containment in
genetically modified plants making it an attractive alterna-
tive for the integration of foreign genes [4,5].

Genomic and phylogenetic studies and efficient genetic
modification begin with the base material of plastid DNA
sequence. Despite their relatively small size, few plastid
genomes have been fully sequenced, thus limiting com-
parative genomics studies across the species. Complete
sequence coverage has been resolved for only 13 species
representing model and crop plants, namely, Arabidopsis
thaliana [6], Atropa belladonna [7], Medicago truncatula
(GenBank: NC 003119), Oryza sativa [8], Spinacea olera-
cea [9], Nicotiana tabacum [10], Triticum aestivum [11],
Lotus corniculatus [12], Zea mays [13], Panax ginseng [14],
Cucumis sativus (GenBank: NC 007144), Glycine max [15]
and Saccharum officinarum [16]. Comparison of a small set
of representative coding or intergenic sequences derived
from a large number of species has been used to perform
phylogenetic studies [17], but there are many unresolved
phylogenetic questions [18]. Use of complete genome
data is another emerging approach in plant phylogenetics
[19]. There are at least three federally-sponsored, multi-
institution endeavors underway to sequence about 200
plastid genomes from plants [20-22].

There are a number of challenges to rapid access to chlo-
roplast DNA sequence from a given species. Typical
sequencing efforts begin with construction of chloroplast
plasmid or other genomic libraries. Construction of such
resources requires isolation of pure plastid DNA, which
may be troublesome in some species. Even shotgun
sequencing to appreciable coverage is considerably expen-
sive and time consuming. From the standpoint of method
and cost, the generation of plastid sequence data is con-
siderable and a potential hindrance to productive data
mining and engineering efforts. One recent report
describes a sophisticated methodology using FACS (fluo-
rescence-assisted cell sorting) and RCA (rolling circle
amplification) for sequencing a plastid genome [23]. The
degree of technological sophistication is inversely propor-
tional to its wider applicability due to the prohibitive
costs associated with it, slowing chloroplast genomics
studies. These large-scale studies are expensive and pro-
hibit testing of additional related species or ecotypes that
may be informative. Additionally, smaller research pro-
grams do not necessarily have access to these tools and
techniques. Most importantly some rare and/or difficult-
to-obtain taxa that are not amenable to large-scale chloro-
plast DNA extraction can not be analyzed by the existing
methodology. While downstream processing of sequence
information is highly streamlined due to the presence of


freely available tools on the World Wide Web, such as
DOGMA [24,25], the lack of cost-effective innovation in
rapid sequence acquisition has restricted plastid informat-
ics studies.

To address these issues, we exploited the fact that chloro-
plast genomes are extremely well conserved in size, gene
arrangement, and coding sequence, at least within major
subgroups of the plant kingdom [26,27]. We formulated
the hypothesis that conserved islands of cpDNA sequence
could serve as universal anchors to generate overlapping
PCR products comprised of conserved coding regions, and
adjacent polymorphic intergenic regions. The resulting
amplicons could then be sequenced, assembled, anno-
tated and analyzed. This approach exploits the high
degree of sequence conservation and general synteny
within discrete portions of chloroplast genome. In this
report this powerful technique has been applied to the
large inverted repeat (IR) region of strawberry (Fragaria x
ananassa) and peach (Prunus persica). The entire ~30 kb
region was amplified from total DNA, sequenced, anno-
tated and submitted to public databases in several days for
a fraction of the cost of traditional or other recently pub-
lished approaches [28]. To further validate this applica-
tion, corresponding regions were amplified from a series
of other eudicots and a monocot of agricultural impor-
tance as well as two gymnosperms (Pinus and the distant
vascular plant Gingko) and a pteridophyte (Equisetum).
This universal method represents a rapid, inexpensive
means to obtain complete coverage of many higher plant
plastid genome regions, and even substantial coverage
from distant genera. The sequence information generated
form this method can hasten phylogenetic and genomics
studies and also help in identification of regulatory ele-


Template Coverage
4- 4- 4-
IR 2R 3R 4R
Round 1F 4R S% 50%
1R 4R

Round 2 3R 75%

Template Coverage
I F

2R


Figure I
Schematic representation of the ASAP approach.
Three rounds of PCR allow for 100% coverage of a given
region. F and R suffix to the numbers represent forward and
reverse universal primers.



Page 2 of 13
(page number not for citation purposes)


BMC Genomics 2005, 6:176







http://www. biomedcentral.com/1471-2164/6/176


.- ~ ~ I-% %b r A


Figure 2
ASAP profile from Fragaria x ananassa. A. Round I touc
down extension PCR.



ments necessary for design of transformation vectors for
the manipulation of chloroplast genomes of new species.

Results
In order to expand ongoing Rosaceae genomics studies
[29], the original goal of this work was to use existing
informatics resources to devise a PCR-based strategy to
obtain plastid DNA sequence for cultivated strawberry
and peach. This information would assist in identifying
indel (insertion/deletion) polymorphisms or SNPs (sin-
gle nucleotide polymorphisms) that could serve as an
additional tool for phylogenetic analysis [30] and also
allow the design of vectors useful for strawberry plastid
engineering. A schematic explanation of the technique is
shown in Figure 1. If a given primer pair fails to generate
an amplicon in initial PCR trials, the forward primer can
then be paired with the reverse primer from the next
primer pair to obtain coverage of that region. Figure 2
demonstrates proof-of-concept, as universal primer set
derived from the IR of five sequenced eudicots is sufficient
to amplify the corresponding ~30 Kb region in commer-
cial strawberry. The 27 primer pairs generate amplicons
spanning this region. The corresponding PCR products
were sequenced, and the sequence was immediately
deposited to public databases. Here we proceeded from
computational analyses to finished strawberry and peach
IR sequence in one week for <$500.

Since the method proved useful in strawberry and peach,
its applicability across plant species was assessed. Total
genomic DNA was derived from 13 diverse plant species
and subjected to the ASAP protocol using the primers


down PCR. B. Round 2 touchdown PCR and C. Round 3 touch-




listed in Table 1 and the conditions stated in Table 2. The
ASAP primer set effectively generated expected amplicons
from all eudicot species tested. Expected results were
obtained in Nicotiana and Arabidopsis. Complete coverage
was obtained with the first round of PCR and the ampli-
con sizes were consistent with predictions (Table 1).
Comparison of agarose gel electrophoresis profiles from
the IR region revealed clearly discernible amplified frag-
ment length polymorphisms (AFLPs) in the regions
amplified with primer pairs 11, 17 and 27 (Figure 3). The
profiles for these two species are in complete agreement
with the calculated sizes.

The maize plastid genome lacks the ycf2 open reading
frame in the IR region, therefore primer pairs 3 to 9 failed
to produce any amplicons, as anticipated (Figure 4A).
Similarly, primer pairs 11, 26 and 27 did not produce any
amplicons. Using bl2Seq program the maize IR region
was compared with the associated primers and no signifi-
cant sequence similarity was found between them. Inter-
estingly, one primer each in primer pairs 1 and 10 had
very low sequence similarity and yet the amplicons were
obtained. Using three rounds of PCR (Table 2) 100% cov-
erage was obtained even in the monocot plastome (Figure
4C), indicating the applicability of eudicot-based primer
designs to this taxonomic group. Absence of amplicons
from primer pair 26 and 27 could be due to the fact that
the primers annealed in the spacer region which could be
unique to the eudicots. The results of the reactions are pre-
sented in both Table 3 and Figure 3. Table 3 presents the
conditions required to produce the amplified regions
from individual species, whether the products were


Page 3 of 13
(page number not for citation purposes)


BMC Genomics 2005, 6:176








http://www. biomedcentral.com/1471-2164/6/176


Table I: ASAP PCR primers. Primer sequences, annealing site and the relative position in tobacco (Nt), Arabidopsis (At) and maize
(Zm) are presented, along with the anticipated amplicon size. represent the primers with low sequence similarity in maize.


IRBIF
IRBIR
IRB2F
IRB2R
IRB3F
IRB3R
IRB4F
IRB4R
IRB5F
IRB5R
IRB6F
IRB6R
IRB7F
IRB7R
IRB8F
IRB8R
IRB9F
IRB9R
IRBIOF
IRBIOR
IRBI IF
IRBI IR
IRBI2F
IRBI2R
IRB13F
IRBI3R
IRBI4F
IRBI4R
IRBI5F
IRBI5R
IRBI6F
IRBI6R
IRBI7F
IRBI7R
IRB18F
IRBI8R
IRBI9F
IRBI9R
IRB20F
IRB20R
IRB21F
IRB21R
IRB22F
IRB22R
IRB23F
IRB23R
IRB24F
IRB24R
IRB25F
IRB25R
IRB26F
IRB26R
IRB27F
IRB27R


Sequence 5' to 3'


Upstream of jLB
Intron rpl2
Intron rpl2
rp123 3'end
rp123 3'end
YCF2/ORF2280 5'
YCF2/ORF2280
YCF2/ORF2280
YCF2/ORF2280
YCF2/ORF2280
YCF2/ORF2280
YCF2/ORF2280
YCF2/ORF2280
YCF2/ORF2280
YCF2/ORF2280
YCF2/ORF2280
YCF2/ORF2280
YCF2/ORF2280
YCF2/ORF2280
ORF 87/YCF 15
YCF2/ORF2280 3'
ORF 79
ORF 79
ndhB 3' exon
ndhB 3' exon
ndhB 5' exon
ndhB 5' exon
rps 7 5'end
rps 7 5'end
rps 12 exon 2
rps 12 exon 2
Spacer
Spacer
rrn 16 start
trnV 3' end
rrn 16 start
rrn 16
trnI Intron/OriA
trnI start
trnA start
trnl end
trnA end
trnA intron
23S
23S
23S
23S
4.5S
23S end
trnR end
Spacer
ORF350
Spacer
ORF 350


Position in Nt


ggatttttttttagtgaacgtgtcac
aagtatcgacgtaatttcatagagtc
catctggcttatgttcttcatgtagc
caactaggacagaaataaagcattgg
atacgtctgtaatgcattgtatgtcc
gaagatacaggagcgaaacaatcaac
aagaaaaaatctctatttgatagggc
tttcgttccgtttgaagaaaggaagg
ggattccattagtaatgaggattcgg
gaggctcgaaccatttcttctgactc
cttcgaatatggaattcaaagggatc
tgaatatgttagatacctgtgactcg
acaattcctcaatatcttgttcattc
tcttctagagaatctcctaattgttc
gaaaaggtcaaatctttgatgattc c
tttccggcatcatatccatagttagc
ctgaacaagttcctggataacaagcc
aaatctctgatcaaggatagaacaag
gatctagttcatggcctattagaagt
taacatattcttccatggagctaagg
cggatgaaatgaaaattggattcatg
aatcggacctgctttttacatatctc
ccaattgcttcgatttgaattatccg
tggaaatcctagctattcttagcatg
attccaataattacatatccgatttg
cttatcaatacacaaatgtataactc
tacgtcaggagtccattgatgagaag
aatatggctttcaaattaagttccga
gtgcaaaagctctatttgcctctgcc
tcactgcttatatacccggtattggc
tcctcgaacaatgtgatatctcacac
caacataggtcatcgaaaggatctcg
gtgtgagcttatccatgcggttatgc
gcttcatattcgcccggagttcgctc
aagtcatcagttcgagcctgattatc
tgagtttcattcttgcgaacgtactc
cgacactgacactgagagacgaaagc
atcgaaagttggatctacattggatc
gggctattagctcagtggtagagcgc
caagagcggagctctaccaactgagc
gaggtctctggttcaagtccaggatg
ataagcggactcgaaccgctgacatc
agattttgagaagagttgctctttgg
tagatgtccagtcaactgctgcgcct
gaaactaagtggaggtccgaaccgac
cgctaccttaggaccgttatagttac
ggtctccgcaaagtcgtaagaccatg
acatcactgcacttccacttgacacc
ctgctgaaagcatctaagtagtaagc
ggttgtgggcgaggagggattcgaac
aaatggctggggagaggaaaggttcc
attatcttcatgcataaggatactag
tggctctatttcattatattccatcc
agtggatccctcttgttcctgtttag


86657-
87436-
87397-
88420-
88310-
89285-
89181-
90212-
90096-
91233-
91131-
92148-
92049-
93115-
92995-
94011-
93853-
94997-
94849-
93849-
95669-
96739-
96626-
97662-
97567-
98585-
98494-
99640-
99551-
100754-
100699-
101642-
101554-
102645-
102504-
103596-
103452-
104770-
104551-
105403-
105229-
106145-
106003-
107168-
107053-
108253-
108131-
109278-
109089-
110027-
109905-
111062-
110844-
11 1855-


Primer Gene (Nicotiana)


86682
87461
87422
88445
88335
8931 1
89206
90187
90121
91258
91156
92173
92074
93140
93020
94036
93878
95022
94874
95874
95724
96763
96644
97687
97592
98610
98519
99665
99576
100781
100694
101667
101581
102670
102529
103621
103477
104795
104576
105428
105324
106170
106028
107193
107079
108278
108156
109303
1091 15
110052
109930
111087
110869
111880


Page 4 of 13
(page number not for citation purposes)


Size Position in At

804 84258-84283
85045-85070
1048 85006-85031
86030-86055
1001 85920-85945
86875-86900
1031 86770-86795
87782-87807
1162 87685-87710
88831-88856
1042 88729-88754
89785-89810
1091 89680-89705
90743-90768
1041 90623-90648
91633-91658
1169 91493-91518
92619-92644
1025 92471-92496
93475-93492
1094 93330-93355
94624-94649
1061 94483-94508
95559-95584
1043 95464-95489
96488-96513
1171 96397-96422
97578-97603
1230 97489-97514
98695-98720
968 98608-98633
99662-99687
1116 99576-99601
100896-100921
1117 100751-100776
101848-101873
1343 101704-101729
103020-103045
877 102801-102826
103674-103699
941 103571-103596
104508-104533
1190 104367-104392
105530-105555
1225 105416-105441
106615-106640
1172 106493-106518
107637-107662
963 107451-107476
108355-108380
1182 108231-108256
109438-109463
1036 109225-109250
110186-110211


Size Position in Zm

812 82644-82669*
83622-83647
1049 83583-83608
84601-84626
980 84491-84516
Deleted
1037 Deleted
Deleted
1171 Deleted
Deleted
1081 Deleted
Deleted
1088 Deleted
Deleted
1035 Deleted
Deleted
1 151 Deleted
Deleted
1021 86077-86102
87190-87215*
1319 No similarity
No similarity
1101 88794-88819
89848-89873
1049 89753-89778
90796-90821
1206 90705-90730
91872-91897
1231 91783-91808
93003-93028
1079 92916-92941
93750-93775
1345 93669-93694
95043-95068*
1122 94901-94926
95997-96022
1341 95853-95878
97175-97200
898 96953-96978
98047-98072
962 97943-97968
98886-98911
1188 98743-98768
99911-99936
1224 99797-99822
101063-101088
1169 100941-100966
102072-102097
929 101897-101922
102792-102817
1232 No similarity
No similarity
986 No similarity
No similarity


BMC Genomics 2005, 6:176








http://www. biomedcentral.com/1471-2164/6/176


ASAP PCR conditions
Temperature
(Centigrade)

94


94
55 0.5/cycle
72


94
50
72

72

2. Touchdown PCR


Duration
(Minutes)

4


0:40
0:40
0:40


0:40
0:40
0:40

7


94


94
52 0.5/cycle
72


94
47
72

72


94


94
52 0.5/cycle
72


94
47
72

72


4


0:40
0:40
1:00 + .05/cycle


0:40
0:40
1:30 + 0.05/cycle

10


Table 2: ASAP PCR conditions. The thermalcycler parameters
used to generate ASAP amplicons in successive rounds of PCR
are presented.


Page 5 of 13
(page number not for citation purposes)


I. Touchdown
PCR

Denaturation

10 Cycles
Denaturation
Annealing
Extension

25 Cycles
Denaturation
Annealing
Extension

Final extension


obtained from PCR round 1, round 2 or round 3. Figure 3
shows the complete array of amplified products corre-
sponding to the amplification conditions presented in
Table 2.

Fragaria and Prunus (Rosaceae)
Complete coverage of the plastid IR region from Fragaria
was obtained after proceeding through three rounds of
ASAP PCR (Table 2) with the 27 pairs of primers (Figure
2). These amplicons were generated using Pfu Turbo DNA
polymerase (Stratagene Inc., Carlsbad, CA) in order to
minimize potential errors generated during PCR reac-
tions. These amplicons were directly sequenced in a 96-
well format. The sequence was assembled and annotated
as described in Methods.

Interestingly, in Prunus complete coverage was obtained
with Round 2 PCR. Sequence comparison with Fragaria
revealed that Prunus and Fragaria share considerable
sequence similarity in the IR region as expected being
from the same phylogenetic group. This is another dem-
onstration of the utility of this technique where two mem-
bers of the same taxonomic group were sequenced and
compared in a very short time frame and in a cost-effective
manner.

Other eudicots and identification of a variable region
The ASAP protocol was attempted in other eudicot species
for which plastid genome sequence has not been reported.
In Citrus and Lycopersicon complete coverage was obtained
after Round 1 PCR and for the remaining species almost
99 100% coverage was obtained using Round 2 PCR
conditions. Electrophoresis profiles revealed highly dis-
cernible AFLPs amongst different plant species. The most
consistently variable region was represented by primer
pair 11. In tobacco this amplicon represents sequences for
orf87/ycfl5, orf92, orf115, trnL and orf79. Gel electro-
phoresis profiles of amplicons generated from this primer
pair revealed a great range of variability across all species
tested (Figure 5A). AFLPs were discernable by gel electro-
phoresis between two solanaceous species, Nicotiana and
Lycopersicon. Sequencing and alignment of this region
from two members of Solanaceae, tobacco and tomato
revealed a 95% 98% sequence similarity in the aligning
sequences. Tomato had two deletions in the region coding
for orf92 and ycfl5 in tobacco, which reconciles the
smaller amplicon size. On the other extreme is the repre-
sentative member of Caryophyllaceae, Amaranthus, where
sequencing and subsequent alignments with tobacco
revealed absence of ORFs between ycf2 and orf92 trnL-
CAA region (Figure 5B). Thus the ASAP method provides
the advantage of analyzing a large region from a number
of species and identifying a highly variable region at the
same time.


Denaturation

10 Cycles
Denaturation
Annealing
Extension

25 Cycles
Denaturation
Annealing
Extension

Final extension


3. Touchdown extension PCR


Denaturation

10 Cycles
Denaturation
Annealing
Extension

25 Cycles
Denaturation
Annealing
Extension

Final extension


BMC Genomics 2005, 6:176







http://www. biomedcentral.com/1471-2164/6/176


Nt

1.5
1.0

Cs





Pp





Le





Ah





Ch


1.,'


Ls

Figure 3
Composite ASAP PCR profiles from 8 plant species. At -Arabidopsis thaliana, Nt Nicotiana tabacum, Cs Citrus sinen-
sis, Pp Prunus persica, Le Lycopersicon esculentum, Ah Amaranthus hypochondriacus, Ch Coleus hybrida and Ls Lactuca
sativa. Horizontal lines across each species indicate I kb size. Vertical columns indicate the amplicons generated from a given
primer pair in the 8 plant species.




Page 6 of 13
(page number not for citation purposes)


BMC Genomics 2005, 6:176


ba 1 2 '1 & Ii R 7 R -q IR 11 12 -11 14 15 IR 17 12 Iq A 71 2-1 M M A 77








http://www. biomedcentral.com/1471-2164/6/176


Table 3: ASAP coverage. Percentage coverage of the IR B region using ASAP method in 10 different genera and unique features of 4
diverse genera used in the study.


Family


Percentage coverage of the IR region using ASAP
Round I (%) Round 2 (%)


Round 3 (%)


Final


Crucifereae
Solanaceae
Rutaceae
Solanaceae

Rosaceae
Amaranthaceae
Asteraceae
Rosaceae
Lamiaceae
Poaceae


Arabidopsis thaliana
Nicotiana tabacum
Citrus sinensis
Lycopersicon
esculentum
Prunus persica
Amaranthus
Lactuca sativa
Fragaria x ananassa
Coleus x hybrida
Zea mays

Unique sps
Pisum sativum
Ginkgo biloba

Pinus taeda
Equisetum hyemale


Distant species
To test the limits of this methodology, the same 27 pairs
of primers were used against total DNA from Pisum sati-
vum, Ginkgo biloba, Pinus taeda and Equisetum hyemale.
These species represent a unique member of Fabaceae
(Pisum largest deletion resulting in removal of the rRNA
cluster; has only one IR), an ancient and contemporary
gymnosperm, and a pteridophyte. The primer pairs
designed for eudicot plastid genomes were able to amplify
the regions corresponding to primer pairs 14 to 25 in
Pisum. In tobacco these primer pairs amplify the 98494 -
110052 nt region of the IR that includes the rrn operon.
The bl2Seq program was used to determine the sequence
similarity between the 27 primer pairs and the Pisum chlo-
roplast genome sequence (Kindly provided by John Gray,
John Innes Institute, UK). The observed amplicon pat-
terns are consistent with what is anticipated from the
sequence data. Primer pairs that failed to generate an
amplicon do not share a significant sequence similarity
with the Pisum plastid genome sequence (Figure 6). In the
two gymnosperms, similar amplicon patterns were gener-
ated from the rrn operon region. Again in the pterido-
phyte only the primer pairs corresponding to the rrn
operon produced an amplicon. The Equisetum chloroplast
genome does possess ycf2 gene but comparative sequence
analysis with higher plant ycf2 revealed no significant
sequence similarity. Interestingly the amino acid
sequence similarity was almost 94% (data not shown).


Discussion
Chloroplast sequencing efforts of model photosynthetic
organisms have provided a wealth of information detail-
ing structural features and plant phylogeny, as well as a
basis for manipulation of the plastid genome in the inter-
est of bioengineering. Current molecular phylogenetic
studies are carried out using large or complete plastid
genome sequences or small coding or intergenic
sequences and the Amplification, Sequencing, and Anno-
tation of Plastomes (ASAP) method caters to both
approaches. Rapid generation of plastid sequence infor-
mation is necessary as it can facilitate better design of plas-
tid transformation vectors [15]. One of the factors in
successful engineering of cotton and carrot plastomes was
the use of species-specific flanking sequences in the trans-
formation vectors [31,32].

The simple yet powerful ASAP technique described herein
expands the capacity for any laboratory to dissect the chlo-
roplast genome at the informatics level with a basic set of
available resources. The obvious limitation of ASAP
method is that some plastid genomes have undergone
extensive rearrangements [33]. Therefore, this method
complements other strategies [28] for obtaining plastid
genome sequences and provides a convenient platform
for plastomes that share a considerable level of synteny. A
long range PCR based approach was used earlier to
sequence the Amborella trichopoda plastid genome [34],


Page 7 of 13
(page number not for citation purposes)


Species


Fabaceae No Inverted Repeat
Ginkgoaceae Small inverted repeat
of 17 kb
Pinaceae Gymnosperm
Equisetaceae Pteridophyte


BMC Genomics 2005, 6:176







http://www. biomedcentral.com/1471-2164/6/176


requiring nebulization of large amplicons and cloning
prior to sequencing. In contrast, the ASAP method per-
forms the dual task of generating small amplicons for
direct sequencing and the electrophoresis profiles provide
structural genomics information. Direct sequencing of the
PCR products limits incorrect base calls resulting from
amplification or sequencing errors, as large pools of prod-
ucts are sequenced and even early PCR errors will not be
scored incorrectly. In a worst-case scenario a base call at a
given position will be unclear, requiring re-amplification
and re-sequencing of the amplicon. This approach allows
the implementation of non-proofreading, highly proces-
sive polymerases that limit costs yet generate substantial
quantities of template for downstream analyses.

ASAP also allows description and characterization of the
frequent islands of high sequence identity present within
the coding regions of sequenced genomes. Using local
identities found within the cpDNA sequences of five
sequenced eudicot plant species, primer pairs were
designed to produce overlapping amplicons that bracket
sequences of plastid genes and the rich sequence variabil-
ity resident to their adjacent intergenic regions. The ASAP
method was herein shown to generate representative
regions of 10 diverse plant species to almost 100% cover-
age. Even the rrn region was also amplified from four
divergent genomes studied, such as Pisum, Equisetum,
Pinus and Ginkgo, with expected efficiency. The success of
the method suggests it an excellent first step in the analysis
of any novel plastid genome. The ASAP method may be
the only practical approach for some rare and/or difficult-
to-obtain taxa that are not amenable to chloroplast DNA
extraction.

One caveat of this technique is that plastid sequences are
not confined to the chloroplast. Plastid DNA sequences
are represented in both mitochondrial and nuclear
genomes, and may serve as templates for the amplicons
generated with the 27 primer pairs. The high copy number
of plastomes in green leaf derived total DNA and long
primers (26 bp each) used in this approach should prefer-
entially amplify chloroplast sequences. Additionally,
nuclear integrated plastid sequences are continuously
shuffled and eliminated [35], making them less likely to
be incorrectly amplified via this approach. However, with
the design of specific primers this technique could be
extended to plastid genomes of distant phylogenetic
groups or mitochondrial genomes in species where high
level of synteny is present.

Conclusion
The ASAP method represents a rapid means to generate a
large amount of plastid genome information from simple
PCR steps to facilitate bioinformatic dissection and func-
tional genomic studies. The products generated spotlight


AFLPs that serve as low-resolution beacons to report
regions of high diversity, such as the hypervariable Region
11 (Figure 5). These regions may be particularly meaning-
ful for phylogenetic analyses. In this capacity the ASAP
methods may facilitate studies of hypervariable specific
regions of the plastid genome, helping to quickly identify
areas of likely importance, bypassing the necessity to
sequence an entire genome as a first step. The ASAP
method eliminates cloning steps, thus negating the need
to identify and trim plasmid sequences before assembly.
Another powerful facet of the technique is the potential to
generate plastid fragment fingerprint for any species.
AFLPs produced may be immediately comparable to those
produced by other genomes, revealing deviations in oth-
erwise conserved sequence, thus informing of structural-
genomic variation. Even the absence of products in
related species may be extremely informative.

To summarize, the ASAP method has the following
advantages: The method is ideal for laboratories or pro-
grams with limited resources interested in obtaining chlo-
roplast DNA sequence information for their particular
research interest. ASAP method may be the only practical
approach to obtain chloroplast DNA sequence from rare
or small plant samples. This method provides a finger-
print of a given chloroplast region, which can be readily
compared amongst different genera and give information
of structural variability even without the sequence infor-
mation. Another practical application of this approach is
the use of PCR amplicons generated by ASAP method for
construction of chloroplast genome microarrays from a
given plant species.

Specific to this report, the method was used to amplify
and sequence the large IR region from octoploid straw-
berry and peach. This -30 kbp region from strawberry was
amplified in 33 PCR reactions and then sequenced. The
PCR fragments were generated in three thermalcycler runs
over two days, and the entire process, from leaf to data on
the server, was performed in under a week for under $500.
With this minimal time and capital investment roughly
25% of the chloroplast genome has been deciphered;
bidirectionally and with complete coverage. The entire
process is now being scaled up to sequence an entire plas-
tid genome within the context of a 96-well plate. In this
system 1.2 to 1.5 kb amplicons may be produced and
sequenced from this standard format. The common for-
mat also lends itself to robotic manipulation, and it is
exciting to speculate that a single set of 96 primer pairs
may be matched to a high-throughput robotic amplifica-
tion and sequencing system to generate plastid DNA
sequence at the rate of a plastid genome per day. It is our
hope that this methodology will hasten study of chloro-
plast sequences, especially those from unusual organisms
or those not considered worthy of large investment.


Page 8 of 13
(page number not for citation purposes)


BMC Genomics 2005, 6:176







http://www. biomedcentral.com/1471-2164/6/176


A IW iM 1 2 3 4 5 6 7 8 1 10 11 12 13 14 15 16 17 11 19 2 21 22 23 24 25 26 27

B 1.
9.7
0.5
0.3






to


Ml


E % ^ A
U2% Z_ &I &I N^^ ^ ^ ^ ^ ^


Figure 4
Zea mays ASAP PCR profiles. A. Round I and 2 touchdown PCR. B. Round 3 touchdown extension PCR and C. Compos-
ite profile from A and B.


Methods
Primer design
The cpDNA sequences of five eudicot plant species
namely Nicotiana tabacum (NC 001879), Arabidopsis thal-
iana (NC 000932), Atropa belladonna (NC 004561),
Spinacea oleracea (NC 002202) and Panax ginseng
(NC 006290) were aligned using ClustalW [36]. Tobacco
chloroplast genome sequence was used as a reference and
its coding regions were delineated in the aligned
sequences. Highly conserved, putative primer sites were
derived by hand parsing the aligned sequences of the IR B
region. Primer candidates satisfied several criteria. A can-
didate primer must be resident to the coding region or
conserved intergenic region and primer pairs must be
spaced by ~1.0 to 1.2 kb. The primers must share 95%
sequence identity among the representative plastid
genomes. For universal, large-format application in
simultaneous PCR reactions the primers should maintain
approximately 50% GC content and a Tm of approxi-
mately 500C. Table 1 lists the primer sequences, anneal-
ing sites, respective position in tobacco, Arabidopsis and
maize plastid genomes and the expected amplicon sizes.


This set of primers, used to amplify the large IR region in
this manuscript, will be supplied by the authors upon
request.

DNA preparation and primary optimization
Total plant DNA was isolated from fresh leaf tissue using
the Qiagen DNeasy Kit (Qiagen Inc., Valencia, CA)
according to manufacturer's instructions, except that the
homogenized plant material was mixed in Buffer AP 1 for
10 min on a platform vortexer for 10 min and the sample
was centrifuged for 10 min at 1000 rpm to remove any
debris at this stage. The supernatant was then incubated at
65 0C for 10 min and from this point on the manufac-
turer's protocol was followed. DNA was isolated from two
plant species namely Arabidopsis thaliana (ecotype Col-0)
and tobacco (Nicotiana tabacum). These two species served
as a positive control and a basis for detection of computa-
tionally predicted AFLPs. Upon validation of the tech-
nique with known genomes, amplification was performed
on several crops of agricultural importance namely, straw-
berry (Fragaria x ananassa; cv. Strawberry Festival), Sweet
orange (Citrus sinensis), lettuce (Lactuca sativa), peach


Page 9 of 13
(page number not for citation purposes)


BMC Genomics 2005, 6:176


C (kh


IWO







http://www. biomedcentral.com/1471-2164/6/176


A (kb) M Fa Pp At


Cs Ch Nt Le Ls Ah M (kb)


YCF7


ORF79


trnL
YCF2 ORF87 ORF79

trnL
YCF2 ORF87 ORF92 ORF79

ORF115 trnL


I imerenth us


hypochondriacus


Lycopersicon escuientum



Nicotiana tabacum


Figure 5
A. PCR amplicons generated from primer pair I I in 9 plant species. Fa Fragaria x ananassa/Rosaceae, Pp Prunus
persica/Rosaceae, At Arabidopsis thaliana/Crucifereae, Cs Citrus sinensis/Rutaceae, Ch Coleus hybrida/Lamiaceae, Nt Nico-
tiana tabacum/Solanaceae, Le Lycopersicon esculentum/Solanaceae, Ls Lactuca sativa/Asteraceae, Ah Amaranthus hypochondri-
acus/Caryophyllaceae. B. Schematic representation of the polymorphism between the amplicons generated from primer pair
I I in tobacco, tomato and amaranthus.


(Prunus persica; cv. UF Sun), Tomato (Lycopersicon esculen-
tum), coleus (Coleus x hybrida), Amaranthus (Amaranthus
hypochondricus). Maize (Zea mays; W22) was tested as a
model monocot. Since it has been sequenced, amplifica-
tion discrepancies related to insertion/deletion and/or
rearrangement can be anticipated and circumvented. The
technique was also performed on diverse plant species to
test the range of the approach. These species included
Pisum sativum L. (Little Marvel), which does not have an
IR region and has only one copy of the rRNA genes, an
ancient gymnosperm (Ginkgo biloba), a contemporary
gymnosperm loblolly pine (Pinus taeda), along with
horsetail, (Equisetum hyemale), a pteridophyte which rep-
resents an ancient plastid genome that would test and


define the limit of the application of the eudicot species-
based primer designs reported here.

Before performing reactions with the 27 primer pairs that
define the large IR, it was important to establish the
amount of total DNA to use in each reaction. Variability
in amplification may be introduced from several sources,
namely the relative amount of chloroplast DNA to total
DNA ratio and the tendency for inhibitory compounds to
co-purify with DNA templates in total DNA isolation [37].
For instance, the relative cpDNA: total DNA ratio will be
significantly different between Arabidopsis haploidd
genome size ~140 Mbp) and Pinus haploidd genome size
~21658 Mbp), two organisms with massively different


Page 10 of 13
(page number not for citation purposes)


BMC Genomics 2005, 6:176







http://www. biomedcentral.com/1471-2164/6/176


4WM 1
2-3 -


2 A 5 8 7 I a 1in ii iI 13 14 15 im. 17 lit 1 2 91 2 71 2 v sl 2a 7


Ps




Gb



Pt



Eh


Figure 6
Composite ASAP PCR profiles from 4 unique plant species. Ps Pisum sativum, Gb Gingko biloba, Pt Pinus taeda, Eh
- Equisetum hyemale.


nuclear genome sizes. DNA preparation from some spe-
cies, such as strawberry, may introduce phenolics or
polysaccharides that could inhibit efficient amplification
during PCR.

To accommodate both of these variables an initial reac-
tion set is performed using the most conserved primers,
those representing the 16 S rrn locus (primer set 19; Table
1). These primers predictably generate a fragment in all
species tested, yet the yield varies considerably based on
the amount of template used in the reaction. For instance,
while coleus was best amplified with 1 ng per reaction,
Equisetum required 10 ng per reaction (data not shown).
The fidelity of the reaction is extremely dependent upon
total isolated DNA concentration and the inherent
cpDNA: nuclear DNA ratio in total DNA. A pilot experi-
ment testing for the production of PCR product over 4-5
orders of magnitude must be performed to optimize con-
ditions for subsequent reactions.

PCR conditions for plastome amplification
Touchdown PCR was utilized to generate PCR amplicons
[38]. The first set of reactions was performed using Round
I conditions, conditions conducive to amplification in the
species for which the primers were designed (Figure 1;
Table 2). This reaction would routinely produce ampli-
cons in 24 out of 27 reactions. Reactions that failed to pro-
duce a product were reconstituted from fresh reagents and


template, and PCR is performed using Reaction II condi-
tions (Table 2). Typically this amplification was sufficient
to obtain complete coverage of the large IR in 7 of the 10
species studied (Table 3). Amplicons generated from this
approach will be made feely available upon request.

If Round II conditions failed to produce a PCR product it
could be assumed that sequence differences in the primer
landing site are present or those sites are deleted or rear-
ranged. In this case PCR is performed using each frag-
ment-specific primer and primers from adjacent
fragments that successfully amplified in Round I and/or
Round II. The process is outlined in Figure 1.

Sequencing was performed directly from PCR products in
a 96-well format at the University of Florida ICBR Core
Facility using ET Terminator (Amersham Inc, Schaum-
burg, IL) as reported earlier [29]. A 5 tl aliquot of PCR
product from a 50 ptl reaction was analyzed by gel electro-
phoresis to verify purity and concentration. PCR products
were treated with ExoSAP to remove primers and nucle-
otides. Each amplicon was sequenced bidirectionally
using the primers used in initial amplification. Sequenc-
ing primers were added at 10 pmol/jtl in a 10 tl final reac-
tion volume. Sequences with Phred score of >20 were
used for assembly. Both strands were sequenced for each
fragment thus providing a 2X coverage and, 4X coverage
in the overlapping regions.


Page 11 of 13
(page number not for citation purposes)


BMC Genomics 2005, 6:176








http://www. biomedcentral.com/1471-2164/6/176


Assembly, annotation and dissemination of the sequences
from Fragaria and Prunus
Sequences generated from a primer pair were first aligned
using Blast 2 sequences (bl2seq) available at NCBI web-
site [39,40]. Individual amplicons derived from this proc-
ess were further assembled using CAP3 [41,42]. The
sequence was then annotated using DOGMA [24,25].
Chloroplast genome sequences from the IR B region of
Fragaria and Prunus were submitted to the GenBank under
accession numbers FACPINVREP (Fa) and PPCPINVREP
(PP).

List of abbreviations
ASAP: Amplification, sequencing, annotation of plas-
tomes; ORF: Open reading frame; AFLP: Amplified frag-
ment length polymorphism; SNP: Single nucleotide
polymorphism; PCR: Polymerase chain reaction; FACS:
Fluorescence-assisted cell sorting; RCA: Rolling circle
amplification; DOGMA: Dual organeller genome annota-
tor

Authors' contributions
AD conceived of the ASAP methodology, designed prim-
ers, prepared DNA, performed all PCR/sequencing reac-
tions, and assembled/reported all sequences. AD also
prepared all figures and tables for the manuscript. KMF
assisted in shaping the ASAP concept and prepared the
first draft of the manuscript. Both authors contributed to
the development of the final manuscript.

Acknowledgements
The authors would like to thank Professor Pam Soltis and Professor Doug
Soltis, University of Florida, for critical review of the work and for their
helpful comments and suggestions. The authors would also like to thank
Jeremy Ramdial and Gene Peir for their technical support, Dr. Angel
Alpuche-Solis, IPICYT, Mexico for Amaranthus and Lactuca sativa DNA; Pro-
fessor John Davis, University of Florida for Pinus taeda DNA; Professor
Harry Klee, University of Florida for tomato DNA; Professor Karen Koch,
University of Florida for maize DNA; Professor Ben Elmo Whitty, Univer-
sity of Florida for tobacco plants and Professor John Gray, John Innes Insti-
tute, UK for pea chloroplast genome sequence. The authors acknowledge
Denise Tombolato and Philip Stewart for critical reading and evaluation of
this manuscript. This work was performed with support from NSF grant
#0416877 (KMF) and funding from IFAS at the University of Florida.

References
I. Palmer JD: Chloroplast DNA and molecular phylogeny. Bioes-
says 1985, 2:263-267.
2. Maliga P: Plastid transformation in higher plants. Annu Rev Plant
Biol 2004, 55:289-313.
3. Grevich JJ, Daniell H: Chloroplast genetic engineering: Recent
advances and future perspectives. Critical Reviews in Plant Sciences
2005, 24:83-107.
4. Daniell H, Kumar S, Dufourmantel N: Breakthrough in chloro-
plast genetic engineering of agronomically important crops.
Trends Biotechnol 2005, 23:238-245.
5. Dhingra A, Daniell H: Chloroplast genetic engineering via org-
anogenesis or somatic embryogenesis. In Arabidopsis Protocols
Volume 323. Second edition. Edited by: Salinas J and Sanchez-Serrano
JJ. Totowa, New Jersey, Humana Press; 2005:525.


6. Sato S, Nakamura Y, Kaneko T, Asamizu E, Tabata S: Complete
structure of the chloroplast genome of Arabidopsis thaliana.
DNA Res 1999, 6:283-290.
7. Schmitz-Linneweber C, Regel R, Du TG, Hupfer H, Herrmann RG,
Maier RM: The plastid chromosome of Atropa belladonna and
its comparison with that of Nicotiana tabacum: the role of
RNA editing in generating divergence in the process of plant
speciation. Mol Biol Evol 2002, 19:1602-1612.
8. HiratsukaJ, Shimada H, Whittier R, Ishibashi T, Sakamoto M, Mori M,
Kondo C, Honji Y, Sun CR, Meng BY, et aL: The complete
sequence of the rice (Oryza sativa) chloroplast genome:
intermolecular recombination between distinct tRNA genes
accounts for a major plastid DNA inversion during the evo-
lution of the cereals. Mol Gen Genet 1989, 217:185-194.
9. Schmitz-Linneweber C, Maier RM, Alcaraz JP, Cottet A, Herrmann
RG, Mache R: The plastid chromosome of spinach (Spinacea
oleracea): complete nucleotide sequence and gene organiza-
tion. Plant Mol Biol 2001, 45:307-315.
10. Shinozaki K, Ohme M, Tanaka M, Wakasugi T, Hayashida N, Matsuba-
yashi T, Zaita N, Chunwongse J, Obokata J, Yamaguchi-Shinozaki K,
Ohto C, Torazawa K, Meng BY, Sugita M, Deno H, Kamogashira T,
Yamada K, Kusuda J, Takaiwa F, Kato A, Tohdoh N, Shimada H, Sug-
iura M: The complete nucleotide sequence of tobacco chloro-
plast genome:its gene organization and expression. EMBO j
1986, 5:2043-2049.
I I. Ogihara Y, Isono K, Kojima T, Endo A, Hanaoka M, Shiina T, Terachi
T, Utsugi S, Murata M, Mori N, Takumi S, Ikeo K, Gojobori T, Murai
R, Murai K, Matsuoka Y, Ohnishi Y, Tajiri H, Tsunewaki K: Struc-
tural features of a wheat plastome as revealed by complete
sequencing of chloroplast DNA. Mol Genet Genomics 2002,
266:740-746.
12. Kato T, Kaneko T, Sato S, Nakamura Y, Tabata S: Complete struc-
ture of the chloroplast genome of a legume, Lotus japonicus.
2000, 7:323-330.
13. Maier RM, Neckermann K, Igloi GL, Kossel H: Complete sequence
of the maize chloroplast genome: gene content, hotspots of
divergence and fine tuning of genetic information by tran-
script editing. j Mol Biol 1995, 251:614-628.
14. Kim KJ, Lee HL: Complete chloroplast genome sequences
from Korean ginseng (Panax schinseng Nees) and compara-
tive analysis of sequence evolution among 17 vascular plants.
DNA Res 2004, 11:247-261.
15. Saski C, Lee SB, Daniell H, Wood TC, Tomkins J, Kim HG,Jansen RK:
Complete chloroplast genome sequence of Glycine max and
comparative analyses with other legume genomes. 2005,
59:309-322.
16. Asano T, Tsudzuki T, Takahashi S, Shimada H, Kadowaki K: Com-
plete nucleotide sequence of the sugarcane (Saccharum
officinarum) chloroplast genome: a comparative analysis of
four monocot chloroplast genomes. DNA Res 2004, I 1:93-99.
17. Soltis DE, Albert VA, Savolainen V, Hilu K, Qiu YL, Chase MW, Farris
JS, Stefanovic S, Rice DW, Palmer JD, Soltis PS: Genome-scale
data, angiosperm relationships, and 'ending incongruence': a
cautionary tale in phylogenetics. Trends in Plant Science 2004,
9:477-483.
18. Wolf PG, Rowe CA, Sinclair RB, Hasebe M: Complete nucleotide
sequence of the chloroplast genome from a leptosporang-
iate fern, Adiantum capillus-veneris L. DNA Research 2003,
10:59-65.
19. Martin W, Deusch 0, Stawski N, Grunheit N, Goremykin V: Chlo-
roplast genome phylogenetics: why we need independent
approaches to plant molecular evolution. Trends Plant Sci 2005,
10:203-209.
20. Project DT:. [http://www.flmnh.ufl.edu/deeptime/].
21. Project CGS: [http://www.genome.clemson.edu/projects/Chloro
last ].
22. project C: [http://evogen.jgi.doe.gov/second levels/chloroplasts/
jansen project home/chlorosite.html].
23. Wolf PG, Karol KG, Mandoli DF, Kuehl J, Arumuganathan K, Ellis
MW, Mishler BD, Kelch DG, Olmstead RG, Boore JL: The first
complete chloroplast genome sequence of a lycophyte,
Huperzia lucidula (Lycopodiaceae). Gene 2005, 350:117-128.
24. Website D:. [http://bugmaster.jgi-psf.org/dogma/].
25. Wyman SK, Jansen RK, Boore JL: Automatic annotation of
organellar genomes with DOGMA. Bioinformatics 2004,
20:3252-3255.



Page 12 of 13
(page number not for citation purposes)


BMC Genomics 2005, 6:176








http://www. biomedcentral.com/1471-2164/6/176


26. Palmer JD: Comparative organization of chloroplast
genomes. Annu Rev Genet 1985, 19:325-354.
27. Odintsova MS, lurina NP: Plastidic genome of higher plants and
algae: structure and function. Mol Biol (Mosk) 2003, 37:768-783.
28. Jansen RK, Raubeson LA, Boore JL, dePamphilis CW, Chumley TW,
Haberle RC, Wyman SK, Alverson AJ, Peery R, Herman SJ: Methods
for obtaining and analyzing whole chloroplast genome
sequences. In Methods in Enzymology Volume 395 edition. Aca-
demic Press; 2005:348-384.
29. Folta KM, Staton M, Stewart PJ, Jung S, Bies DH, Jesudurai C, Main D:
Expressed sequence tags (ESTs) and simple sequence repeat
(SSR) markers from octoploid strawberry (Fragaria x anan-
assa). BMC Plant Biol 2005, 5:12.
30. Lin J, Davis TM: SI analysis of long PCR heteroduplexes: detec-
tion of chloroplast indel polymorphisms in Fragaria. Theoret-
ical and Applied Genetics 2000, 101:415-420.
31. Kumar S, Dhingra A, Daniell H: Plastid-expressed betaine aide-
hyde dehydrogenase gene in carrot cultured cells, roots, and
leaves confers enhanced salt tolerance. Plant Physiology 2004,
136:2843-2854.
32. Kumar S, Dhingra A, Daniell H: Stable transformation of the cot-
ton plastid genome and maternal inheritance of transgenes.
Plant Molecular Biology 2004, 56:203-216.
33. Cosner ME, Jansen RK, Palmer JD, Downie SR: The highly rear-
ranged chloroplast genome of Trachelium caeruleum (Cam-
panulaceae): multiple inversions, inverted repeat expansion
and contraction, transposition, insertions/deletions, and sev-
eral repeat families. Curr Genet 1997, 31:419-429.
34. Goremykin W, Hirsch-Ernst KI, Wolfl S, Hellwig FH: Analysis of
the Amborella trichopoda chloroplast genome sequence
suggests that Amborella is not a basal angiosperm. Mol Biol
Evol 2003, 20:1499-1505.
35. Matsuo M, Ito Y, Yamauchi R, Obokata J: The rice nuclear genome
continuously integrates, shuffles, and eliminates the chloro-
plast genome to cause chloroplast-nuclear DNA flux. Plant
Cell 2005, 17:665-675.
36. website CW:. [http://www.ebi.ac.uk/clustalw/].
37. Demeke T, Adams RP: The effects of plant polysaccharides and
buffer additives on PCR. Biotechniques 1992, 12:332-334.
38. Don RH, Cox PT, Wainwright BJ, Baker K, MattickJS: Touchdown
PCR to circumvent spurious priming during gene amplifica-
tion. Nucleic Acids Research 1991, I 9:4008-4008.
39. [http://www.ncbi.nlm.nih.gov/blast/bl2seq/wblast2.cgi]
40. Tatusova TA, Madden TL: BLAST 2 SEQUENCES, a new tool
for comparing protein and nucleotide sequences. Ferns Micro-
biology Letters 1999, 1 74:247-250.
41. Huang XQ, Madan A: CAP3: A DNA sequence assembly pro-
gram. Genome Research 1999, 9:868-877.
42. Huang XQ, Madan A:. [http://genome.cs.mtu.edu/cap/cap3.html].











Publish with BioMed Central and every
scientist can read your work free of charge
"BioMed Central will be the most significant development for
disseminating the results of biomedical research in our lifetime."
Sir Paul Nurse, Cancer Research UK
Your research papers will be:
available free of charge to the entire biomedical community
peer reviewed and published immediately upon acceptance
cited in PubMed and archived on PubMed Central
yours you keep the copyright

Submit your manuscript here: BioMedcentral
http://www.biomedcentral.com/info/publishingadv.asp


Page 13 of 13
(page number not for citation purposes)


BMC Genomics 2005, 6:176




University of Florida Home Page
© 2004 - 2010 University of Florida George A. Smathers Libraries.
All rights reserved.

Acceptable Use, Copyright, and Disclaimer Statement
Last updated October 10, 2010 - - mvs