Group Title: BMC Biotechnology
Title: Transformation of Anaplasma phagocytophilum
CITATION PDF VIEWER THUMBNAILS PAGE IMAGE ZOOMABLE
Full Citation
STANDARD VIEW MARC VIEW
Permanent Link: http://ufdc.ufl.edu/UF00100002/00001
 Material Information
Title: Transformation of Anaplasma phagocytophilum
Physical Description: Book
Language: English
Creator: Felsheim, Roderick
Herron, Michael
Nelson, Curtis
Burkhardt, Nicole
Barbet, Anthony
Kurtti, Timothy
Munderloh, Ulrike
Publisher: BMC Biotechnology
Publication Date: 2006
 Notes
Abstract: BACKGROUND:Tick-borne pathogens cause emerging zoonoses, and include fastidious organisms such as Anaplasma phagocytophilum. Because of their obligate intracellular nature, methods for mutagenesis and transformation have not been available.RESULTS:To facilitate genetic manipulation, we transformed A. phagocytophilum (Ap) to express a green fluorescent protein (GFP) with the Himar1 transposase system and selection with the clinically irrelevant antibiotic spectinomycin.CONCLUSION:These transformed bacteria (GFP/Ap) grow at normal rates and are brightly fluorescent in human, monkey, and tick cell culture. Molecular characterization of the GFP/Ap genomic DNA confirmed transposition and the flanking genomic insertion locations were sequenced. Three mice inoculated with GFP/Ap by intraperitoneal injection became infected as demonstrated by the appearance of morulae in a peripheral blood neutrophil and re-isolation of the bacteria in culture.
General Note: Start page 42
General Note: M3: 10.1186/1472-6750-6-42
 Record Information
Bibliographic ID: UF00100002
Volume ID: VID00001
Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: Open Access: http://www.biomedcentral.com/info/about/openaccess/
Resource Identifier: issn - 1472-6750
http://www.biomedcentral.com/1472-6750/6/42

Downloads

This item has the following downloads:

PDF ( 3 MBs ) ( PDF )


Full Text



BMC Biotechnology


0
Bio.led Central


Methodology article
Transformation of Anaplasma phagocytophilum
Roderick F Felsheim*1, Michael J Herron', Curtis M Nelson1,
Nicole Y Burkhardt', Anthony F Barbet2, Timothy J Kurttil and
Ulrike G Munderloh1


Address: 'Department of Entomology, University of Minnesota, St. Paul, MN, 55108, USA and 2Department of Pathobiology, College of Veterinary
Medicine, University of Florida, Gainesville, FL, 32611, USA
Email: Roderick F Felsheim* -felsh001@umn.edu; Michael J Herron herro001@umn.edu; Curtis M Nelson nelso015@umn.edu;
Nicole Y Burkhardt burkh032@umn.edu; Anthony F Barbet BarbetA@mail.vetmed.ufl.edu; Timothy J Kurtti kurttool @umn.edu;
Ulrike G Munderloh munde001@umn.edu
* Corresponding author


Published: 31 October 2006
BMC Biotechnology 2006, 6:42 doi: 10.1186/1472-6750-6-42


Received: 08 August 2006
Accepted: 31 October 2006


This article is available from: http://www.biomedcentral.com/1472-6750/6/42
2006 Felsheim et al; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0),
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.



Abstract
Background: Tick-borne pathogens cause emerging zoonoses, and include fastidious organisms
such as Anaplasma phagocytophilum. Because of their obligate intracellular nature, methods for
mutagenesis and transformation have not been available.
Results: To facilitate genetic manipulation, we transformed A. phagocytophilum (Ap) to express a
green fluorescent protein (GFP) with the Himarl transposase system and selection with the
clinically irrelevant antibiotic spectinomycin.
Conclusion: These transformed bacteria (GFP/Ap) grow at normal rates and are brightly
fluorescent in human, monkey, and tick cell culture. Molecular characterization of the GFP/Ap
genomic DNA confirmed transposition and the flanking genomic insertion locations were
sequenced. Three mice inoculated with GFP/Ap by intraperitoneal injection became infected as
demonstrated by the appearance of morulae in a peripheral blood neutrophil and re-isolation of
the bacteria in culture.


Background
Anaplasma phagocytophilum (Ap, formerly the Human
Granulocytic Ehrlichiosis agent) is a common tick borne
obligate intracellular pathogen with an uncommon tro-
pism for host granulocytes. While much has been made of
the physiologic stability of the intracellular environment,
vector transmission requires extraordinary flexibility to
bind and infect the variety of cell types encountered in the
travels of the pathogen within and between vector and
host(s). Remarkably, Ap and the related rickettsial patho-
gens accomplish this feat with small genomes.


Tracking tissue distribution, cellular binding, entry, and
intracellular development of these organisms would be
greatly augmented by expression of fluorescent proteins,
but genetic transformation of obligate intracellular bacte-
ria has only been accomplished in a few cases [1-5].
Obstacles to transformation of obligate intracellular path-
ogens include: DNA delivery while retaining viability of
extracellular bacteria, efficient reintroduction of the trans-
formed bacterial population into host cells, selection
(given the limited number of antibiotics ethically applica-
ble to a pathogen), and the limited efficiency of homolo-
gous recombination and transposition systems. Recent


Page 1 of 9
(page number not for citation purposes)







http://www.biomedcentral.com/1472-6750/6/42


development of the mariner transposase Himarl, which
can function in many organisms [6-14] has effectively
diminished this last obstacle. The further development of
hyperactive Himarl mutants, as detailed by Lampe et.al.
[15], has made this transposition system capable of driv-
ing insertional mutagenesis systems [8,9,11-13,16-19 ].

Here we describe the first successful transformation of
Anaplasma phagocytophilum. We used Himarl transposi-
tion to produce Ap transformants that express green fluo-
rescent reporter protein GFPuv at levels useful for
imaging. These GFPuv expressing Ap (GFP/Ap) transform-
ants grow readily in a variety of cell types and in a manner
so far indistinguishable from the growth of the non-trans-
formed parental strain. Also like the parental strain, they
are infectious for laboratory mice.

Results
Southern Blot, confirmation PCR and rescue cloning
To detect the presence of the GFPuv Specr DNA in the
fluorescent bacteria, a set of PCR primers not used in the
plasmid construction (Forward UV-SS confirmation PCR,
Reverse UV-SS confirmation PCR) was used to amplify a


700 bp product which spans the junction between the two
coding sequences. Using total DNA isolated from GFP/Ap
infected HL-60 as the template, the primers readily
detected the presence of the inserted DNA in 25 cycles.
Samples without primers or without template gave no sig-
nal (data not shown).

Transposon insertion points map to the following posi-
tions on the Ap HZ genome[20]: 992097, 987221,
843456, 528403, 571958 (Figure 1A). Two examples were
found in which one end of the transposon maps to a dif-
ferent location than the other end; 586610 or 429803,
and 586608 or 426632 (Figure 1A). We attribute this to
possible recombination following transposition or differ-
ences between the HGE1 and HZ Ap strains. Another
insertion maps to a repeat region of a virB6 family mem-
ber gene and could either be inserted at 383427 or
383673. Limited sequence data prevents discrimination
between the two.

Southern analysis of restriction digested genomic GFP/Ap
DNA using a GFPuv probe detected 7-9 bands of varying
intensities in most of the digests (Figure 1B). The pattern


Bglll Band size A
983819 987221 988304h


992097 993987
990198
5.0 I 6


588372 586610 429803 427502
44 A .


843456A


843402
3.1

528403
527960 529 52
3.6 --o-- 6 I 46 2---


586809 586608 426632 427508
2.9 -----


571957


568707


575758


3839
o359 383427 or 383673 r
3834138


Insertion site


Intergenic


APH_0920


Intergenic


APH0798 & APH 07797


Intergenic


Intergenic


APH_0546


APH_0377


B


Xbal Xhol EcoRI Hindill Bglll


e-e~


U-


m


m


4a1M


'" 8.9

6.4
B5.6
4.4

3.6



mW


Figure I
Transposition insertion diagram and Southern blot. (A) This diagram represents eight Ap genomic locations and direction of
the transposon (arrow under the line) as determined by rescue cloning from GFP/Ap genomic DNA and sequence mapping
onto the Ap HZ genome. Four insertions were found in putative coding sequences and four were in intergenic sites. The band
sizes on the left of the diagram correspond to bands in the Bglll digest lane of the Southern blot. (B) Southern blot of restric-
tion digested GFP/Ap genomic DNA probed with a GFPuv coding sequence probe. The labels indicate restriction enzyme used
and the numbers on the right indicate the sizes of visible bands in the Bglll lane.




Page 2 of 9
(page number not for citation purposes)


BMC Biotechnology 2006, 6:42


4 8 695







http://www.biomedcentral.com/1472-6750/6/42


of bands in the BglII digest and their intensities is consist-
ent with the sizes and numbers of BglII fragments
obtained in the rescue cloning from genomic DNA iso-
lated from GFP/Ap. The bands detected from the BglII
digest are approximately 2.1, 2.9, 3.1, 3.6, 4.4, 5.6, 6.4,
8.9 and 12 kb in size. The numbers of rescue clones from
each size class are 2.1 kb 1 clone, 2.9 kb 6 clones, 3.1
kb 6 clones, 3.6 kb 1 clone, 4.4 kb 20 clones, 5.6 kb
- 5 clones, 6.4 kb 2 clones, 8.9 kb 1 clone. The South-
ern blot shows the 4.4 kb band to be the most intense, and
most rescue clones recovered were of this class. Insertion
events for each BglII fragment size class were sequenced
out from both ends of the transposon into flanking
genomic DNA, and into genomic DNA from the vector
used in the rescue cloning. All insertions had the expected
TA dinucleotides at the junctions of transposon repeats
and genomic DNA sequence. For sequence comparison,
we used the recently sequenced Ap HZ strain to map the
sequences obtained from the rescued clones onto the Ap
genome.

The transformation efficiency at this point is three to
thirty transformants per electroporation of bacteria iso-
lated from one T-75 flask of infected HL-60 cells.

In vitro growth and imaging
Approximately 105 of GFP/Ap infected HL-60 (Figure 2A)
were inoculated into mCherry/RF6A, mCherry/HMEC-1,
and DSred/ISE6 growing in 35 mm glass bottom culture
dishes (MatTek) and incubated as detailed above. After 48
hours, endothelial cells were rinsed to remove HL-60 cells
and imaged. Imaging revealed fully developed morulae
with a variety of fluorescence intensities and characteris-
tic, pleomorphic Ap morphology (Figure 2C and 2D). The
visualization of live endothelial and HL-60 cell cultures
revealed morulae with dramatically symmetrical arrange-
ments of bacteria. DsRed2/ISE6 cells imaged after 27 days
showed bacterial inclusions as characteristically indistinct
masses. (Figure 2B)

Infection of mice
Three mice one C3H SCID and two immunocompetent
(C57BL/6) challenged with GFP/Ap, became infected.
Following ip inoculation with GFP/Ap infected HL-60, a
characteristic Ap inclusion was seen in a neutrophil of the
C3H scid mouse, and GFP/Ap was cultured from the
peripheral blood of all three mice.

Discussion
Transformation of Ap represents an important step in the
development of methods for the genetic manipulation of
human and animal anaplasmosis agents. The inability to
employ many molecular techniques in the study of these
emerging infectious agents has hampered the normally
rapid progression of research. The availability of hyperac-


tive Himarl transposases and the methods described
herein should allow the routine transformation of Ap and
related organisms and accelerate work in this area.

Successful bacterial transformations require a mechanism
of genomic remodeling with a high enough efficiency to
be effective with a reasonable population of bacteria and
a means to select rare transformants. Transformation of a
pathogen should not involve the use of clinically relevant
antibiotics or constructs that are likely to allow horizontal
transfer of resistance to other organisms. Spectinomycin
resistance and the Himarl transposon system fulfill both
of these requirements. The major use of spectinomycin is
presently one of 21 antimicrobial drugs used for treat-
ment of gonococcal infections [21]. We could find no
reports of spectinomycin use in anaplasmosis. Ap con-
tains no known plasmids or mobile elements that might
enable resistance transfer. The "cut and paste" mechanism
of mariner type transposase plasmid systems such as
Himarl, in which the transposase sequence is not incor-
porated into the target genome, are not conducive to hor-
izontal transfer. The two-plasmid system employed in
these transformations may provide an additional element
of safety by reducing the likelihood of accidental genomic
transposase integration.

Our choice of a promoter to control expression of the
transposase and GFP was driven by the analysis of the tr
promoter using quantitative PCR [22]. The tr promoter is
one of the few characterized in Anaplasma and we have
demonstrated it to be expressed in bacteria grown in both
mammalian and tick cells. The upstream out-of-frame
start codon located between the start of transcription and
the start of translation was removed to increase expression
of GFP and spectinomycin resistance. Presumably it is
present in wild type Am to attenuate the level of tr protein
produced. The efficiency of Himarl transposition is a
function of transposon size, with a 38% decrease for every
1-kb increase in transposon size [23]. To keep the transpo-
son under 2 kb the GFPuv reporter and spectinomycin
resistance genes were driven by a single tr promoter via
translational coupling. Future studies should allow the
exploration of promoters that are regulated by environ-
mental changes.

Insertion site cloning and sequencing reveals that the
transposon was inserted in intergenic regions four times
and interrupted real or putative coding sequences four
times. The transposition event at position 992097 is
located 45 base pairs upstream of the stop codon of an
ankyrin repeat protein gene (APH_0928). As a result the
last 14 amino acids have been changed from wild type but
the protein is otherwise unaffected. The transposition
event at position 843456 lies inside two small overlap-
ping putative open reading frames (APH_0798 and


Page 3 of 9
(page number not for citation purposes)


BMC Biotechnology 2006, 6:42







http://www.biomedcentral.com/1472-6750/6/42


Figure 2
Images of GFP/Ap growing within various host cells. HL-60 (A) with partial bright field to illuminate the non fluorescent host
cell. Tick cell ISE6 (B) expressing DSred and containing indistinct bacteria in morulae. Monkey RF/6A (C) and human HMEC- I
(D) endothelial cells expressing mCherry and containing GFP/Ap morulae with distinct bacteria. Bars 5 rpm.


APH_0797). The transposition event at position 571957
disrupts a putative open reading frame (APH_0546).
Lastly, the transposition event at position 383427 or
383673 lies in (APH_0377) a VirB6 family member. All
four of these insertions into putative coding sequences
appear to be tolerated in Ap cultured in HL-60 cells.


Regarding the stability of transformants; The bacteria
remain fluorescent green and spectinomycin resistant
after more than 40 passages in HL-60 cells (with or with-
out spectinomycin selection). They are a population of
transformants at this point (i.e. not clonal) so we expect


Page 4 of 9
(page number not for citation purposes)


BMC Biotechnology 2006, 6:42







http://www.biomedcentral.com/1472-6750/6/42


the proportion of individual insertions relative to one
another may change over time.

The development of reporter genes such as green fluores-
cent protein has greatly accelerated the study of changing
biological systems, both in vitro and in vivo. Ap that consti-
tutively express GFPuv can be used for in vitro studies of Ap
binding, entry, morula development, and cell/cell transfer
using standard widefield epifluorescence and confocal
techniques for live cell observation and imaging. In previ-
ous work using histochemistry and immunostaining we
have demonstrated that the development of Ap in tick
cells differs strikingly from its growth in human cells [24].
In human cells, Ap forms morulae containing bacteria that
are individually visible. In tick cells the morulae often
become enlarged and ill defined [25]. Imaging of GFP/Ap
in ISE6 tick cells reveals the same characteristics (Figure
2B). GFP/Ap grown in HL60 and endothelial cells (Figure
2A,C,D) display the compact, well-defined morulae and
pleomorphism seen in non-transformed Ap [24].

To date, the visual study of Ap in vitro and in vivo has relied
upon static fixed samples stained by standard histological
techniques. Such studies of static specimens can never
give a complete picture of the dynamic processes of bacte-
rial growth and development within host cells or animals.
Indeed, many aspects of morula development and Ap/
host-cell interaction can only be studied by continuous
observation over time, made possible with fluorescent
reporter proteins. The combination of fluorescent Ap and
host cells, each expressing a contrasting fluorescent
reporter protein, will allow observation of the develop-
ment of live Ap into morulae, and the passage of Ap from
cell to cell in an adherent cellular system that is especially
amenable to microscopic imaging. Towards these ends,
the GFP expression obtained in these transformants is
bright, and is useful for live cell imaging. The number of
distinctly differentially bright Ap, when compared to the
number of insertions sequenced, suggests that the site of
transposon insertion influences expression, as has been
found in other systems.

A central goal in our efforts to establish a method for
transforming Ap has been to produce fluorescent bacteria.
Live, fluorescent bacteria can be readily imaged in cul-
tured host cells, and in vivo within the cells of the ticks and
mammals Ap naturally infects. It has been our experience
that when passed extensively in vitro (approximately > 15
passes) Ap loses its infectivity for animals (unpublished
data). Because our initial efforts at transforming Ap have
required a substantial amount of in vitro culture (e.g. to
generate sufficient quantities of bacteria for transforma-
tion experiments and to cultivate potential transform-
ants), we have been concerned that the transformants that
arise will be poorly infective for animals. This has not


been the case, however. In preliminary experiments we
have found that these transformed Ap behave like
untransformed parental bacteria; they invade and grow
within tick (ISE6) and primate (RF/6A, HMEC1, HL-60)
cells and infect mice.

Conclusion
In this study, we have described a simple method for
transformation and selection of Ap. The resulting trans-
formants grow normally in all in vitro systems in common
use for the culture of these organisms and have success-
fully infected laboratory mice; suggesting behavior similar
to the parental strain. The GFP transformants will prove
useful for observation of bacterial binding, entry, growth
and cellular exit. These transformation methods should
allow gene knock out by random mutagenesis, and the
method of spectinomycin selection may prove useful for
specific gene knockout by homologous recombination.

Methods
Cell and Bacterial culture
The human promyelocytic leukemia cell line HL-60
(American Type Culture Collection, Manasssas, VA, USA;
ATCC CCL-240) was used to propagate Ap strain HGE1
[26]. HL-60 cells, infected and uninfected, were main-
tained in RPMI1640 (Bio-Whittaker, Walkersville, MD,
USA) with 10% heat-inactivated fetal bovine serum (FBS,
Harlan, Indianapolis, IN, USA) and 25 mM HEPES in 5%
CO2 in humidified air at 37C.

Additional mammalian cells employed in this study were:
endothelial lines RF/6A (ATCC CRL-1780), from the ret-
ina choroid endothelium of a normal fetal rhesus monkey
(Macaca mulatta), and the human microvascular endothe-
lial cell line HMEC-1 [27]. All cells were maintained as
specified above for HL-60 cells. Adherent cells were
detached using trypsin (Gibco, Grand Island, NY, USA),
and diluted five-fold once a week.

The Tick cell line ISE6, isolated from embryos of the
black-legged tick, I. scapularis, was grown in L15B300 with
5% tryptose phosphate broth (Difco Laboratories,
Detroit, MI, USA), 5% heat-inactivated FBS (Harlan), and
0.1% bovine lipoprotein concentrate (MP Biomedical,
Irvine, CA, USA), pH 7.2. Medium for infected cultures
was additionally supplemented with 25 mM HEPES and
0.25% NaHCO3, and the pH adjusted to 7.5-7.7. ISE6
cultures were maintained at 34 C. Ap were subcultured by
transferring 1/50th of an infected culture to a new flask
containing sterile host cells. [25].

Host cell Transformation
RF/6A, HMEC-1 and ISE6 cell lines were transformed to
express mCherry [28] or DsRed2 (Clontech, Mountain
View, CA), under the control of the chicken beta-actin


Page 5 of 9
(page number not for citation purposes)


BMC Biotechnology 2006, 6:42








http://www.biomedcentral.com/1472-6750/6/42


promoter and flanked by the transposase recognition
sequences, using the Sleeping Beauty Transposon system
[29]. DNA was delivered into sub confluent monolayers
using Effectene (Qiagen, Valencia, CA) according to the
manufacturers instructions. After several days, selection
with G418 sulfate was begun and continued until cells not
expressing fluorescent protein were absent for two weeks.

The plasmid used to impart fluorescence to host cells was
constructed by moving the GFP expression cassette from
pVITRO4-NEO-GFP/LacZ (Invivogen, San Diego, CA) as a
Nhel NotI DNA fragment, into pT-HB (a gift from P. B.
Hackett) between the Sleeping Beauty IR/DR sequences.
The GFP expression cassette contains the CAG promoter
driving GFP followed by an FMDV IRES, the EM7 pro-
moter and the neomycin resistance gene. An E. coli origin
of replication is also on the DNA fragment. To obtain red
fluorescent host cells, the coding sequence for GFP was
replaced by those of mCherry or DsRed-2.

Plasmid construction
All enzymes were obtained from New England Biolabs
(Beverly, MA), Promega (Madison, WI), or Stratagene (La
Jolla, CA), unless stated otherwise. PCR was performed
using PfuUltra HS (Stratagene). Electrophoresis and blot
transfer buffers were prepared as described previously
[301, unless stated otherwise. All primers (Table 1) were
from MWG Biotech (High Point, NC) or Integrated DNA
Technologies (Coralville, IA). Standard molecular tech-
niques were used throughout [31].


Transposase expression plasmid
The vector used to express the Himarl transposase was
pET28 (Novagen, Madison, WI) due to the presence of the
laclq gene and lac operator sequence, to minimize expres-
sion of the transposase in E. coli. The T7 promoter of
pET28 was replaced with the tr promoter from Anaplasma
marginale (Am) [22] by PCR of the vector using the prim-
ers pET28 T7 replace PCR and pET28 lacO PCR, and PCR
of the promoter using the primers 5' Amtr pro Himarl
and 3' Amtr pro Himarl. Both PCR products were cut with
BglII and ligated, creating pET28AMTR. The Himarl trans-
posase coding sequence was moved into this vector as a
NcoI-HindIII fragment from pBADA7 [15] to create
pET28AMTR-A7-HIMAR (Figure 3B).

Transposon plasmid
The promoter chosen to drive expression of GFPuv was
the tr promoter from Am. This promoter was isolated from
Am genomic DNA as an EcoRI BamHI fragment using
PCR and primers 5' Am tr pro and 3' Am tr pro. Base
number 19 in the 3' Am tr promoter primer was substi-
tuted with a T to remove the upstream out of frame start
codon. The DNA fragment was cut with EcoRI and BamHI
and cloned into the same restriction sites of pMOD-2
(Epicentre, Madison WI). The BamHI site was removed
from the coding sequence of GFPuv in pGFPUV (Clon-
tech) using the QuickChange method (Stratagene). The
GFPuv coding sequence was isolated from the modified
pGFPUV using PCR and the primers 5' GFPuv PCR and 3'
GFPuv PCR phos. The spectinomycin resistance coding
sequence was isolated from a derivative of pMON9443
[32] using PCR and the primers 5' S-S PCR phos and 3' S-
S Xba PCR. The GFPuv PCR product was cut with BamHI,


Table I: Primer List


pET28 T7 replace PCR
pET28 lacO PCR
5' Amtr pro Himarl
3' Amtr pro Himarl
5' Am tr pro
3' Am tr pro
GFPuv SDM A
GFPuv SDM B
5' GFPuv PCR
3' GFPuv PCR phos
3' S-S Xba PCR
5' S-S PCR phos
Barn re SDM A
Barn re SDM B
Himarl right repeatA
Himarl right repeatB
Himar left repeatA
Himarl left repeatB
UV-SS up and out
UV-SS down and out
Forward UV-SS confirmation PCR
Reverse UV-SS confirmation PCR


CCTATAGTGAGTCGTATTAATTTCGCGGGATCG
phos-GGAATTGTGAGCGGATAACAATTCCCCTC
GTTGTTAGATCTGGCTCCTCCTAGAACGATCGC
phos-GATAACTTAGGATAAATCATACATAATGTTAATGCAACAG
GTTGTTGAATTCGGCTCCTCCTAGAACGATCGC
GTTGTTGGATCCTATCCCTTATGTTACTCAGATAACTTAGGATAAATCA
CCACAACATTGAAGATGGTTCCGTTCAACTAGCAGACC
GGTCTGCTAGTTGAACGGAACCATCTTCAATGTTGTGG
GTTGTTGGATCCATGAGTAAAGGAGAAGAACTTTTCACTG
phos-AATCCCTATTTGTAGAGCTCATCCATGCCATGTGTAATC
GTTGTTTCTAGATTATTTGCCGACTACCTTGGTGATCTCGCCTTTC
phos-AAATTATGAGGGAAGCGGTGATCGCCGAAGTATCGACTC
CTGAGTAACATAAGGGATATTATAATGAGTAAAGGAGAAGAAC
GTTCTTCTCCTTTACTCATTATAATATCCCTTATGTTACTCAG
TGTTGAAGCTTAGACCGGGGACTTATCAGCCAACCTGTTACTCGAGTTGT
ACAACTCGAGTAACAGGTTGGCTGATAAGTCCCCGGTCTAAGCTTCAACA
TGTTGAGATCTAACAGGTTGGCTGATAAGTCCCCGGTCTGAATTCTTGTT
AACAAGAATTCAGACCGGGGACTTATCAGCCAACCTGTTAGATCTCAACA
CATCACCTTCACCCTCTCCACTGAC
CAGCCCGTCATACTTGAAGCTAGGC
AAAGATGACGGGAACTACAAGACG
CACAACAATGGTGACTTCTACAGCG


Page 6 of 9
(page number not for citation purposes)


BMC Biotechnology 2006, 6:42







http://www.biomedcentral.com/1472-6750/6/42


A


B


repeat


Figure 3
Physical maps of the Himarl transposon and transposase plasmids. (A) pHIMARI-UV-SS carries the A. marginale promoter tr
driving expression of GFPuv and spectinomycin resistance between the left and right Himar transposon repeats. (B)
pET28AMTR-A7-HIMAR contains the A7 hyperactive mutant of the Himarl transposase also driven by the Am tr promoter.


the Spec PCR product was cut with Xbal and both were
ligated into the pMOD-2 with Am tr promoter vector cut
with BamHI and Xbal. To increase expression of GFPuv,
the BamHI site upstream of the ATG was replaced with AT
rich sequence by site directed mutagenesis, using the
QuickChange method (Stratagene) and primers Bam re
SDM A and Bam re SDM B. The expression cassette Am tr
GFPuv-Spec was moved from the pMOD based plasmid
into pLITMUS-HIMAR1-REPEATS, as detailed below,
using EcoRI and HindIII.

To generate pLITMUS-HIMAR1-REPEATS, the restriction
sites between and including EcoRI and KpnI were
removed from pLITMUS28 (New England Biolabs) by
restriction digestion and blunting with Pfu DNA polymer-
ase. The Himarl left and right repeat oligonucleotide sets
were annealed and cut with either BglII or Xhol. Himarl
repeat elements were ligated into the modified
pLITMUS28 using the BglII and Xhol sites. The DNA from
this ligation was cut with EcoRI and HindIII and the
expression cassette was moved from the pMOD based
plasmid described above into this pLITMUS-HIMAR1-
REPEATS plasmid as an EcoRI HindIII fragment, creat-
ing pHIMARI-UV-SS (Figure 3A).


Prior to electroporation into Ap, the plasmid DNAs were
grown in the dam/dcm mutant E. coli strain GM2163 (New
England Biolabs), isolated using endofree Maxi-prep kits
(Qiagen), and methylated with Ap protein extracts as in
[331.

Bacterial transformation and selection
Cell density of Ap infected HL-60 in upright flasks was
maintained between 1-5 x 105/ml by 20 to 60-fold dilu-
tion of fully (>90% of cells) infected cultures with unin-
fected cells. Culture infection was monitored by
microscopic examination of Giemsa stained slides (Cyt-
ospin, Shandon, Sewickley, PA) prepared from small sam-
ples of the cultures. When it was determined that greater
than 90% of cells were infected, host cell free Ap were pre-
pared by needle aspiration, 2.0 jim glass fiber filtration
(Whatman), and twice washed in 270 mM sucrose. The
pelleted bacteria were placed on ice and resuspended in a
small volume of 270 mM sucrose. One jig of pET28-
AMTR-A7-HIMAR and 1 jig of pHIMAR1-UV-SS
(described above) were added to the resuspended bacteria
and a 50-jil aliquot was pulsed once (4 to 5 ms, 1.2 kV,
400 Ohms, 25 iF) with a Gene Pulser II (Bio-Rad, Her-
cules, Calif.) in a 0.1-cm-gap electroporation cuvette. Elec-


Page 7 of 9
(page number not for citation purposes)


BMC Biotechnology 2006, 6:42







http://www.biomedcentral.com/1472-6750/6/42


troporated bacteria were immediately combined with 5
million HL-60 in 5 ml of medium and incubated over-
night at 37C. The next day spectinomycin (100 itg/ml)
selection began. When bacteria exhibiting spectinomycin
resistance were evident, cultures were monitored for green
fluorescence by observing wet mounts on an Olympus
BH2-RFCA microscope with epifluorescent illumination
and a fluorescein isothiocyanate filter set. Images were
collected with a CFW- 1310M CCD (Scion, Frederick, Mar-
yland) and ImageJ (Rasband, W.S., ImageJ, National Insti-
tutes of Health, Bethesda, Maryland, USA) with the
VisiCapture plugin from Scion. HL-60 contained green
fluorescent morulae with individual bacteria distinctly
visible (Figure 2A).

PCR and Southern blot detection of transposons in
Anaplasma genomic DNA
PCR was performed to confirm the GFPuv Specr expres-
sion cassette was within GFP/Ap DNA using AmpliTaq
Gold DNA polymerase (Roche, Indianapolis, IN), and
primers Forward UV-SS confirmation PCR and Reverse
UV-SS confirmation PCR. DNA was isolated from GFP/
Ap-infected HL-60 cultures using the AquaPure DNA iso-
lation kit (Bio-Rad). Cycling conditions were as follows:
94C for 5 min; 94C for 30 sec, 52C for 30 sec, and
74 C for 45 sec for 25 cycles, followed by a final extension
at 74 C for 5 min. Amplicons were electrophoresed on a
0.8% agarose gel and stained with ethidium bromide. For
Southern blots, 100 ng of GFP/Ap DNA was digested with
Xbal, Xhol, EcoRI, HindIII, BglII, or EcoRV, electro-
phoresed on a 1% agarose gel, and transferred overnight
onto Zeta Probe GT genomic membrane (Bio-Rad) in 0.4
M NaOH. The blots were rinsed in 3x SSC buffer, baked at
80 C for 30 min, prehybridized at 650 C for 2 hours in 2x
block buffer [34], and hybridized overnight at 65 oC with
GFPuv digoxigenin-labeled probes prepared with the PCR
DIG Probe Synthesis kit (Roche) and end-terminal prim-
ers. Blots were washed twice in 2x SSC-0.1% SDS for 5
min at 220C, once in 0.5x SSC-0.1% SDS for 15 min at
650C, once in 0.25x SSC-0.1% SDS for 15 min at 650C,
and once in 0.1 x SSC-0.1% SDS for 15 min at 65 C. They
were then developed with the DIG Wash and Block Buffer
Set and CDP-Star detection reagent according to the pro-
tocol of the manufacturer (Roche), and exposed to Kodak
X-OMAT AR film.

Cloning and sequencing of transposon integration sites
Genomic GFP/Ap DNA was isolated from purified bacte-
ria using the AquaPure DNA isolation kit (Bio-Rad), cut
with BglII and ligated into pLITMUS28 cut with BglII
(BglII lies outside the transposon in pHIMAR1-UV-SS). E.
coli was electroporated with this ligation and 46 colonies
were picked from SOB plates containing ampicillin 75 |ig/
ml, spectinomycin 50 ig/ml and streptomycin 50 ig/ml.
Plasmid DNA, isolated from cultures grown from the col-


onies, was cut with BglII and electrophoresed on agarose
gels to size the inserts. Plasmid DNAs from each insert size
class were sequenced with the vector primers M13 FOR
and M 13 REV and primers that bind inside the transposon
and face outward (UV-SS up and out, UV-SS down and
out) to allow sequencing of the transposon-genomic DNA
junction. The insertions were mapped using the published
genomic sequence of the Ap HZ strain [20] (note that the
transformed strain described here is HGE1).

Microscopy
Microscopic images of GFP/Ap were obtained of cells and
bacteria cultured in 35 mm glass bottom culture dishes
(MatTek, Ashland, MA). Cells were examined on a
TE2000-U Inverted microscope (Nikon, Melville, N.Y.)
using epifluorescent illumination, piezo actuated z move-
ment (Mad City Labs, Madison WI), with FITC and TRITC
filter sets. Monochrome serial z planes were collected with
a Cascade 1 K (Photometric) camera. To clearly image
host cells and bacteria, collected images from the red and
green emission channels were processed by maximum
projection of z planes and adjustment of the look up table
using Metamorph (Molecular Devices).

GFP/Ap infection of mice
A C3H scid mouse was challenged by intraperitoneal (ip)
injection with 2 x 105 GFP/Ap infected HL-60 cells sus-
pended in 500 tiL cell culture medium. Six days later the
mouse was humanly sacrificed, blood was aseptically
drawn by cardiac puncture, and 200 tiL inoculated into a
culture of HL-60 cells. A blood smear was also prepared
and Giemsa stained. Microscopic examination revealed
an Ap infected neutrophil. After eight days incubation,
cytocentrifuged cells from the blood-inoculated HL-60
culture were shown by Giemsa stain to be Ap infected. Five
days later, when most cells were infected, a wet mount was
prepared (_2 x 106 cells in 15 tiL medium overlaid with a
cover slip) and microscopically examined by epifluores-
cence. Green fluorescent Ap bacteria with normal morula
morphology that commonly seen with wild-type Ap -
were clearly seen in cells.

Two inmmunocompetent (C57BL/6) mice were then
inoculated ip with the scid mouse-isolated GFP/Ap.
Twenty-four hours later, one mouse was sacrificed, blood
collected by cardiac puncture, a smear prepared, and an
HL-60 culture inoculated. On day 12 the second mouse
was sacrificed and blood was drawn for culture and micro-
scopy analysis. Both blood samples cultured in HL-60
yielded GFP/Ap. No infected cells were found in either
blood smear.

Authors' contributions
RFF designed and developed expression strategies and
constructs, carried out all DNA manipulations, and


Page 8 of 9
(page number not for citation purposes)


BMC Biotechnology 2006, 6:42








http://www.biomedcentral.com/1472-6750/6/42


assisted with drafting the manuscript. MJH designed study
approaches and methods, performed the cell culture, elec-
troporations, microscopy, and drafted the manuscript.
CMN carried out the mouse work and participated in
manuscript preparation. NYB did the Southern blot and
participated in manuscript preparation. TJK and UGM
performed the analysis of transformed anaplasma in tick
cell culture. AFB contributed intellectually and by provi-
sion of DNA constructs to the initiation of the study.
UGM conceived and coordinated the study, participated
in experimental design, and assisted with drafting the
manuscript. All authors have read and approved the final
manuscript.


Acknowledgements
This study was supported by a grant from NIH to UGM, Nr. RO I Al 042792.

References
I. Baldridge GD, Burkhardt N, Herron MJ, Kurtti TJ, Munderloh UG:
Analysis of fluorescent protein expression in transformants
of Rickettsia monacensis, an obligate intracellular tick sym-
biont. AppI Environ Microbiol 2005, 71:2095-2105.
2. Thompson HA, Suhan ML: Genetics of Coxiella burnetii. FEMS
Microbiol Lett 1996, 145:139-146.
3. Rybniker J, Wolke M, Haefs C, Plum G: Transposition of Tn5367
in Mycobacterium marinum, using a conditionally recom-
binant mycobacteriophage. j Bacteriol 2003, 185:1745-1748.
4. Lukacova M, Valkova D, Quevedo Diaz M, Perecko D, Barak I: Green
fluorescent protein as a detection marker for Coxiella bur-
netii transformation. FEMS Microbiol Lett 1999, 175:255-260.
5. Rachek LI, Hines A, Tucker AM, Winkler HH, Wood DO: Transfor-
mation of Rickettsia prowazekii to erythromycin resistance
encoded by the Escherichia coli ereB gene. j Bacteriol 2000,
182:3289-3291.
6. Zhang L, Sankar U, Lampe DJ, Robertson HM, Graham FL: The
Himarl mariner transposase cloned in a recombinant aden-
ovirus vector is functional in mammalian cells. Nucleic Acids
Res 1998, 26:3687-3693.
7. Rubin EJ, Akerley BJ, Novik VN, Lampe DJ, Husson RN, Mekalanos JJ:
In vivo transposition of mariner-based elements in enteric
bacteria and mycobacteria. Proc Natl Acad Sci USA 1999,
96:1645-1650.
8. Pelicic V, Morelle S, Lampe D, Nassif X: Mutagenesis of Neisseria
meningitidis by in vitro transposition of Himarl mariner. J
Bacteriol 2000, I 82:5391-5398.
9. Ashourj, Hondalus MK: Phenotypic mutants of the intracellular
actinomycete Rhodococcus equi created by in vivo Himarl
transposon mutagenesis. j Bacteriol 2003, 185:2644-2652.
10. Ran Kim Y, Haeng Rhee J: Flagellar basal body fig operon as a
virulence determinant ofVibrio vulnificus. Biochem Biophys Res
Common 2003, 304:405-410.
I I. May JP, Walker CA, Maskell DJ, Slater JD: Development of an in
vivo Himarl transposon mutagenesis system for use in
Streptococcus equi subsp. equi. FEMS Microbiol Lett 2004,
238:401-409.
12. Maier TM, Pechous R, Casey M, Zahrt TC, Frank DW: In vivo
Himarl-based transposon mutagenesis of Francisella tula-
rensis. Apple Environ Microbiol 2006, 72:1878-1885.
13. Le Breton Y, Mohapatra NP, Haldenwang WG: In vivo random
mutagenesis of Bacillus subtilis by use of TnYLB-1, a mari-
ner-based transposon. Appl Environ Microbiol 2006, 72:327-333.
14. Morozova OV, Dubytska LP, Ivanova LB, Moreno CX, Bryksin AV,
Sartakova ML, Dobrikova EY, Godfrey HP, Cabello FC: Genetic and
physiological characterization of 23S rRNA and ftsj mutants
of Borrelia burgdorferi isolated by mariner transposition.
Gene 2005, 357:63-72.
15. Lampe DJ, Akerley BJ, Rubin EJ, Mekalanos JJ, Robertson HM: Hyper-
active transposase mutants of the Himarl mariner transpo-
son. Proc Natl Acad Sci USA 1999, 96:1 1428-11433.


16. Bourhy P, Louvel H, Saint Girons I, Picardeau M: Random inser-
tional mutagenesis of Leptospira interrogans, the agent of
leptospirosis, using a mariner transposon. j Bacteriol 2005,
I 87:3255-3258.
17. Sato Y, Okamoto K, Kagami A, Yamamoto Y, Ohta K, Igarashi T,
Kizaki H: Application of in vitro mutagenesis to identify the
gene responsible for cold agglutination phenotype of Strep-
tococcus mutans. Microbiol Immunol 2004, 48:449-456.
18. Lamichhane G, Zignol M, Blades NJ, Geiman DE, Dougherty A, Gros-
set J, Broman KW, Bishai WR: A postgenomic method for pre-
dicting essential genes at subsaturation levels of
mutagenesis: application to Mycobacterium tuberculosis.
Proc Natl Acad Sci USA 2003, 100:7213-7218.
19. Zhang JK, Pritchett MA, Lampe DJ, Robertson HM, Metcalf WW: In
vivo transposon mutagenesis of the methanogenic archaeon
Methanosarcina acetivorans C2A using a modified version of
the insect mariner-family transposable element Himarl.
Proc Natl Acad Sci USA 2000, 97:9665-9670.
20. Hotopp JC, Lin M, Madupu R, CrabtreeJ, Angiuoli SV, Eisen J, Seshadri
R, Ren Q, Wu M, Utterback TR, et al.: Comparative genomics of
emerging human ehrlichiosis agents. PLoS Genet 2006, 2:e21.
21. Moran JS, Levine WC: Drugs of choice for the treatment of
uncomplicated gonococcal infections. Clin Infect Dis 1995,
20(Suppl I):S47-65.
22. Barbet AF, Agnes JT, Moreland AL, Lundgren AM, Alleman AR, Noh
SM, Brayton KA, Munderloh UG, Palmer GH: Identification of
functional promoters in the msp2 expression loci of Ana-
plasma marginale and Anaplasma phagocytophilum. Gene
2005, 353:89-97.
23. Lampe DJ, Grant TE, Robertson HM: Factors affecting transposi-
tion of the Himarl mariner transposon in vitro. Genetics 1998,
149:179-187.
24. Munderloh UG, Lynch MJ, Herron MJ, Palmer AT, Kurtti TJ, Nelson
RD, Goodman JL: Infection of endothelial cells with Anaplasma
marginale and A. phagocytophilum. Vet Microbiol 2004,
101:53-64.
25. Munderloh UG, Jauron SD, Fingerle V, Leitritz L, Hayes SF, Hautman
JM, Nelson CM, Huberty BW, Kurtti TJ, Ahlstrand GG, et at.: Inva-
sion and intracellular development of the human granulo-
cytic ehrlichiosis agent in tick cell culture. ] Clin Microbiol 1999,
37:2518-2524.
26. Goodman JL, Nelson C, Vitale B, Madigan JE, Dumler JS, Kurtti TJ,
Munderloh UG: Direct cultivation of the causative agent of
human granulocytic ehrlichiosis. N Engl j Med 1996,
334:209-215.
27. Ades EW, Candal FJ, Swerlick RA, George VG, Summers S, Bosse DC,
Lawley TJ: HMEC- I: establishment of an immortalized human
microvascular endothelial cell line. j Invest Dermatol 1992,
99:683-690.
28. Shaner NC, Campbell RE, Steinbach PA, Giepmans BN, Palmer AE,
Tsien RY: Improved monomeric red, orange and yellow fluo-
rescent proteins derived from Discosoma sp. red fluorescent
protein. Nat Biotechnol 2004, 22:1567-1572.
29. Ivics Z, Hackett PB, Plasterk RH, Izsvak Z: Molecular reconstruc-
tion of Sleeping Beauty, a Tc I -like transposon from fish, and
its transposition in human cells. Cell 1997, 91:501-510.
30. Maniatis T, Fritsch EF, Sambrook J: Molecular cloning: a labora-
tory manual. 1982.
31. Sambrook J, Russell D: Molecular Cloning Cold Spring Harbor: CSHL
Press; 2001.
32. Dotson SB, Lanahan MB, Smith AG, Kishore GM: A phosphonate
monoester hydrolase from Burkholderia caryophilli PG2982
is useful as a conditional lethal gene in plants. Plant J 1996,
10:383-392.
33. DonahueJP, Israel DA, Peek RM, Blaser MJ, Miller GG: Overcoming
the restriction barrier to plasmid transformation of Helico-
bacter pylori. Mol Microbiol 2000, 37:1066-1074.
34. Engler-Blum G, Meier M, Frank J, Muller GA: Reduction of back-
ground problems in nonradioactive northern and Southern
blot analyses enables higher sensitivity than 32P-based
hybridizations. Anal Biochem 1993, 210:235-244.








Page 9 of 9
(page number not for citation purposes)


BMC Biotechnology 2006, 6:42




University of Florida Home Page
© 2004 - 2010 University of Florida George A. Smathers Libraries.
All rights reserved.

Acceptable Use, Copyright, and Disclaimer Statement
Last updated October 10, 2010 - - mvs