Group Title: BMC Genomics
Title: Characterization of the equine 2'-5' oligoadenylate synthetase 1 (OAS1) and ribonuclease L (RNASEL) innate immunity genes
CITATION PDF VIEWER THUMBNAILS PAGE IMAGE ZOOMABLE
Full Citation
STANDARD VIEW MARC VIEW
Permanent Link: http://ufdc.ufl.edu/UF00099992/00001
 Material Information
Title: Characterization of the equine 2'-5' oligoadenylate synthetase 1 (OAS1) and ribonuclease L (RNASEL) innate immunity genes
Physical Description: Book
Language: English
Creator: Rios, Jonathan
Perelygin, Andrey
Long, Maureen
Lear, Teri
Zharkikh, Andrey
Brinton, Margo
Adelson, David
Publisher: BMC Genomics
Publication Date: 2007
 Notes
Abstract: BACKGROUND:The mammalian OAS/RNASEL pathway plays an important role in antiviral host defense. A premature stop-codon within the murine Oas1b gene results in the increased susceptibility of mice to a number of flaviviruses, including West Nile virus (WNV). Mutations in either the OAS1 or RNASEL genes may also modulate the outcome of WNV-induced disease or other viral infections in horses. Polymorphisms in the human OAS gene cluster have been previously utilized for case-control analysis of virus-induced disease in humans. No polymorphisms have yet been identified in either the equine OAS1 or RNASEL genes for use in similar case-control studies.RESULTS:Genomic sequence for equine OAS1 was obtained from a contig assembly generated from a shotgun subclone library of CHORI-241 BAC 100I10. Specific amplification of regions of the OAS1 gene from 13 horses of various breeds identified 33 single nucleotide polymorphisms (SNP) and two microsatellites. RNASEL cDNA sequences were determined for 8 mammals and utilized in a phylogenetic analysis. The chromosomal location of the RNASEL gene was assigned by FISH to ECA5p17-p16 using two selected CHORI-241 BAC clones. The horse genomic RNASEL sequence was assembled. Specific amplification of regions of the RNASEL gene from 13 horses identified 31 SNPs.CONCLUSION:In this report, two dinucleotide microsatellites and 64 single nucleotide polymorphisms within the equine OAS1 and RNASEL genes were identified. These polymorphisms are the first to be reported for these genes and will facilitate future case-control studies of horse susceptibility to infectious diseases.
General Note: Periodical Abbreviation:BMC Genomics
General Note: Start page 313
General Note: M3: 10.1186/1471-2164-8-313
 Record Information
Bibliographic ID: UF00099992
Volume ID: VID00001
Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: Open Access: http://www.biomedcentral.com/info/about/openaccess/
Resource Identifier: issn - 1471-2164
http://www.biomedcentral.com/1471-2164/8/313

Downloads

This item has the following downloads:

PDF ( PDF )


Full Text


r)%


BMC Genomics BioMed



Research article Ws-

Characterization of the equine 2'-5' oligoadenylate synthetase I
(OASI) and ribonuclease L (RNASEL) innate immunity genes
Jonathan J Riost1, Andrey A Perelygint2, Maureen T Long3, Teri L Lear4,
Andrey A Zharkikh5, Margo A Brinton2 and David L Adelson*6


Address: IDepartment of Animal Science, Texas A&M University, 2471 TAMU, College Station, Texas 77843, USA, 2Biology Department, Georgia
State University, 24 Peachtree Center Ave., Atlanta, Georgia 30302, USA, 3College of Veterinary Medicine, University of Florida, 2015 SW 16th
Ave., Gainesville, Florida 32608, USA, 4Department of Veterinary Science, University of Kentucky, 108 Maxwell H. Gluck Equine Research Center,
Lexington, Kentucky, 40546, USA, 5Bioinformatics Department, Myriad Genetics, Inc., 320 Wakara Way, Salt Lake City, UT, 84108, USA and
6School of Molecular and Biomedical Science, University of Adelaide, SA 5005, Australia
Email: Jonathan J Rios jonathanrios@tamu.edu; Andrey A Perelygin aperelygin@gsu.edu; Maureen T Long LongM@mail.vetmed.ufl.edu;
Teri L Lear equigene@uky.edu; Andrey A Zharkikh zharkikh@myriad.com; Margo A Brinton biomab@langate.gsu.edu;
David L Adelson* david.adelson@adelaide.edu.au
* Corresponding author tEqual contributors


Published: 7 September 2007
BMC Genomics 2007, 8:313 doi:10.l 186/1471-2164-8-313


Received: 21 March 2007
Accepted: 7 September 2007


This article is available from: http://www.biomedcentral.com/1471-2164/8/313
2007 Rios et al; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0),
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.



Abstract
Background: The mammalian OAS/RNASEL pathway plays an important role in antiviral host
defense. A premature stop-codon within the marine Oaslb gene results in the increased
susceptibility of mice to a number of flaviviruses, including West Nile virus (WNV). Mutations in
either the OASI or RNASEL genes may also modulate the outcome of WNV-induced disease or
other viral infections in horses. Polymorphisms in the human OAS gene cluster have been
previously utilized for case-control analysis of virus-induced disease in humans. No polymorphisms
have yet been identified in either the equine OASI or RNASEL genes for use in similar case-control
studies.
Results: Genomic sequence for equine OASI was obtained from a contig assembly generated from
a shotgun subclone library of CHORI-241 BAC 100110. Specific amplification of regions of the OASI
gene from 13 horses of various breeds identified 33 single nucleotide polymorphisms (SNP) and
two microsatellites. RNASEL cDNA sequences were determined for 8 mammals and utilized in a
phylogenetic analysis. The chromosomal location of the RNASEL gene was assigned by FISH to
ECA5p 17-p 16 using two selected CHORI-241 BAC clones. The horse genomic RNASEL sequence
was assembled. Specific amplification of regions of the RNASEL gene from 13 horses identified 31
SNPs.
Conclusion: In this report, two dinucleotide microsatellites and 64 single nucleotide
polymorphisms within the equine OASI and RNASEL genes were identified. These polymorphisms
are the first to be reported for these genes and will facilitate future case-control studies of horse
susceptibility to infectious diseases.


Page 1 of 14
(page number not for citation purposes)


central


ess







http://www. biomedcentral.com/1471-2164/8/313


Background
The innate immune responses are the first line of host
defense against a virus infection. An important compo-
nent of the intracellular antiviral response is mediated by
the 2'-5' oligoadenylate synthetase (OAS)/ribonuclease L
(RNase L) pathway. OAS genes are interferon-inducible
and activated by binding to double-stranded RNA
(dsRNA). dsRNA, present in virus infected cells, activates
OAS proteins to catalyze the oligomerization of ATP to
form 2',5' -linked oligoadenylate chains (pppA(2'p5'A)n)
[1-3]. Originally discovered as a low molecular weight
inhibitor of protein synthesis, pppA(2'p5'A)n induces the
activation of the latent endoribonuclease, RNase L, which
degrades both cellular and viral RNA in a non-preferential
manner [1,4-6]. The OAS/RNASEL pathway has also been
implicated in the induction of apoptosis [7-11].

The murine flavivirus resistance gene, Fly, was positionally
cloned and identified as Oas1b [12]. A cDNA sequence
comparison among susceptible and resistant strains of
mice identified a single nucleotide substitution that
causes a premature stop codon in the Oasib transcripts of
susceptible mice [ 12,13 ].

The human OAS gene cluster, consisting of genes OAS1,
OAS3 and OAS2, is located on chromosome 12q24.2
[14]. The small synthetases are transcribed from the OAS1
gene while the medium and large synthetases are encoded
by the OAS2 and OAS3 genes, respectively. Alternative
splicing was previously reported in both OAS1 and OAS2
transcripts [15,16]. For example, the human OAS1 tran-
script El 16 corresponds to the p42 protein, which is trans-
lated from a 1.6 kilobase (kb) mRNA, while the
alternatively spliced El 18 transcript encoding the p46 pro-
tein is about 1.8 kb [17]. Both p42 and p46 proteins are
identical in their first 346 N-terminal amino acids but dif-
fer at the C-terminus [18]. Variations in the human OAS1
gene that may be relevant to the outcome of virus infec-
tions have been reported [19-23].

The human RNASEL gene maps to chromosome 1q25
[24]. The 741 amino acid, 83,539 Dalton protein is trans-
lated from a ~2.8 kb transcript [25,26]. The RNase L pro-
tein consists of three domains: 1) an N-terminal domain
of ankyrin repeats with P-loop motifs between the seventh
and eighth repeat, 2) a serine/threonine protein kinase
domain, and 3) a C-terminal ribonuclease domain [27].
RNase L activation requires binding of a single 2-5A mol-
ecule to the N-terminal ankyrin repeats 2-4 [28,29]. 2-5A
binding reverses the naturally repressive state of the RNase
L ankyrin repeats, ultimately producing a functional
homodimer with ribonuclease activity [27,29-31].

Previously, the equine OAS gene cluster was mapped to
horse (Equus caballus; ECA) chromosome 8pl5 and


shown to have an organization similar to that in the
human genome: OAS1-OAS3-OAS2 [32]. Two clones were
identified from segment 1 of the CHORI-241 equine BAC
library, 77F4 (~200 kb) and 100110 (~130 kb), that con-
tain complete OAS1 and OAS3 sequences. BAC clone
77F4 also contains nine 5'-terminal exons of OAS2 [32].

In this report, a subclone library generated from CHORI-
241 BAC 100110 was sequenced and then used to con-
struct a contig assembly spanning the OAS1 gene. The
equine RNASEL gene was identified in multiple BAC
clones of the CHORI-241 library and was FISH mapped
on metaphase spreads to ECA5pl7-pl 6. Equine RNASEL
genomic sequence was obtained from BAC clone 159N12
and an assembly similar to that for OAS1 was constructed.
Full-length RNASEL cDNA from 8 species were deter-
mined and compared in a phylogenetic analysis. Re-
sequencing of genomic DNA from multiple horses of dif-
ferent breeds identified a total of 64 SNPs and 2 microsat-
ellites within the OAS1 and RNASEL genes.

Results
BAC 100110 sequencing and OAS I contig assembly
A shotgun subclone library was constructed from sheared
fragments of CHORI-241 BAC 100110. Nine hundred sub-
clones were bi-directionally sequenced, resulting in
513,390 bases with quality scores > 15, providing 3.95X
coverage. The individual chromatogram files were ana-
lyzed by Phred, Phrap and Consed [33-37] and individual
contigs were scaffolded on the human genome sequence
using BLAST. The scaffold was further validated by the
addition of multiple sequences from TraceDB [38]
retrieved via BLAST searches using full length equine
OAS1 mRNA [GenBank: AY321355]. The scaffold con-
tained four genomic contigs spanning a substantial part of
the equine OAS1 gene, including 4.5 kb of promoter
sequence upstream of exon 1 and 1.6 kb of sequence
downstream of exon 6, and was submitted to GenBank
under accession number D0536887. The genomic assem-
bly also included sequence for the downstream equine
OAS3 gene as well as an upstream gene orthologous to
human RPH3A (data not shown). This assembly com-
pletely overlaps two whole genome shotgun sequences,
AAWR01028567 (55,475 bp) and AAWR01028568
(31,407 bp), that were recently submitted to GenBank
from the Broad Institute.

Identification of OAS I microsatellites
The genomic sequence assembly identified two microsat-
ellites, one located within the promoter and the other
downstream of exon 6. The promoter GT-microsatellite is
located 575 bp upstream of the ATG translation initiation
site. A shorter GT-microsatellite is in the same relative
position in the human OAS1 promoter and the flanking
regions were well conserved between the two sequences


Page 2 of 14
(page number not for citation purposes)


BMC Genomics 2007, 8:313







http://www. biomedcentral.com/1471-2164/8/313


(Figure 1). This microsatellite may affect the functions of OAS I SNP identification
flanking regulatory elements. Sequencing the OAS1 pro- The assembled OAS1 scaffold was aligned to the full
mother regions of 13 horses established that this promoter length, 1.6 kb cDNA equine transcript [GenBank:
microsatellite is polymorphic in length. The second poly- AY321355] to delineate individual exons and flanking
morphic microsatellite was a GT-dinucleotide repeat intron sequences from the genomic contigs. Genomic
located 43 bp downstream ofexon 6 within the 3' UTR. It primers were designed within flanking intron sequences
has previously been reported that a 3' UTR microsatellite as well as for the proximal promoter (Table 1).
can alter the level of synthesis of a mRNA. [39].
Sequence data obtained from the screening population
and from CHORI BAC 100110 were analyzed using Phred,
Phrap and Consed programs [33-371. Both visual analysis


HUMAN -954 ATATCAATTCATCAATTGTAACAA-ATGTATCACAGTACTGTTAATAATAGAGGAACTTA -896
II IlIlI llll IIIii11 II 11111 11 1111 III 1 I II IIi III
HORSE -800 ATGTCAATTCATCAGTTGTAAAAATATGTACCACGCCAATGTTAATGACAGGAGAAATTA -741

HUMAN -895 T---TGGCAGGAGAGAGAGCTTATGGAACTCTCTGCACATTCAGCTCAATATTTCTGTAA -839

HORSE -740 CGGGTGGAAGGAGAGGGGGCATATGGGAGTCTGTGCT--TTCTGTTCAGTTTTTCTGTAA -683

HUMAN -838 GCCTAAAACTGCTGTGAGAAATAAAATCCAAC -807

HORSE -682 ACATAAAACTGCTGTAAGAAATAATGTCTAAC -651

Alu repeat in human sequence from -811 >>> -590

HUMAN -566 GCATAGTATAATACCATTCTTAACAAAAAGAAAAGAGACCTGTGTTTGTGTGTGTGTTAA -507
I I I I I I I I I I I I I I I I I l l I I i i i i i i i I I I
HORSE -633 GCATAATGGGATGCCATTTTTATAAAACAGAAGAGAGAGCTTGGTGTOTGOGTTZOGTO -574

HUMAN -506 CAT---- TTGAAAAAAATCTGGAAAGCTCTATATCAAAACGTTTATAGAGGiCAATTTGT -451
II I I1l IIIIIIIIIIIIIII II II III
HORSE -573 CTTAACCTAGAAACGCGTCTGAGAAGGCCGGTACCAAGATGTCTGCAGTGGTCGTCTTCG -514

HUMAN -450 AGTGTTAGAATCATAGATGATCTTTCCACTTCCTGGTTTTTCTGACTTTTTTTCTTTTTG -391

HORSE -513 GGTTTGAGGATCGTGGGTGATCTTTACGCTTCCTGATTTTTCTCCTTTTTTCTTTTTCT -454

HUMAN -390 CAGTGGGCATGTATTGCTGGAAAATACCACAGACAACTGTGAAAGGATTTCATCAACAAC -331
II I iii I I Ii i I i II I I i1III liii II II
HORSE -453 CA-TATGCACACGCTGCT-GTAAAGATCATAGCAGACTATAAAACAATTTTGCCAGCAAC -396

HUMAN -330 AAAAAAAAGATAAAGAAGGAAACACAAAA -302
111111111 II I III Ii IlIII
HORSE -395 -AAAAAAAGACAAGGAAGGAAAATTAAAA -368


Figure I
Local alignment of human and horse OAS I promoters. BLAST2 alignment of the 1000 bp upstream of the transcription
start for human OASI and equine OASI genes. The following BLAST parameters were used: a mismatch penalty of-I and word
size of 7. Lower case masking of repeats was used. The alignment shows that the sequence from -800 bp to ~-350 bp in the
horse promoter is similar to a region of the human promoter interrupted by a 200 bp Alu repeat (--81 I bp ~-590 bp). The
horse microsatellite is shown in underlined bold and corresponds to a smaller dinucleotide repeat in the human sequence.
Numbering shown in the alignments is from the translation ATG start sites.




Page 3 of 14
(page number not for citation purposes)


BMC Genomics 2007, 8:313








http://www. biomedcentral.com/1471-2164/8/313


Table I: Primers used to detect equine polymorphisms


Forward Primer

AACCCACAGAATAAACACCACA
CCAGACTCAGGCAACGTAAG
GTGATTGTTGTCTGGTGATGG
GTAACTTGGTTGTGTCCGTGG
AGCGTGAAAACCACCACAGA
CACTGGGCTGGTCCTCCT
GCAGGTGGCACGTCACAG

CATCTCCCTTCTCCGTCCTCG
CAAAGTACTTCTCTCATCCCCAG
AAGATCCTCCTTGATGAGATGG
AAATGTAAGTCCTGCTCTTGGC
CTCGTAGCCTGCACCACAC
CCATGTTAATTCTCTCATCTTCAG
GCTCCTACATTTTTGCGTAATG
ATCTCTGGAACCGGGTGCT
CTCTGGGTGGCTCATTCATT


Reverse Primer

GTCGATGGCTTCTCGGAC
GTTTTGCTCTCTCCCTTCCT
AAACTGTGGGAGATTTCTGCT
AGACTGGATGGAGGGCCATA
TCCCACATCCTCCATTTCC
CCTCCAAACGGGGTCAAA
GGCACTGTGCCCTGAAGTTAA

TGCAATGGATGAGTCCTGGT
TCCGAAGAGCATGGAACAAA
GGCCTTTCCTATCTGCAATG
CAAGCAACTCCACACCAACC
CACGGTAGATCGCGGAACTT
TCTCTCACCTCTTGGTAGGGC
GTTCTTCCCATCAAATAGCAGA
CACTACCAAATGGCCCTGAG
TCCCAGCTCTTCCCATTACA


Forward and reverse primers for amplification of the OASI promoter and individual exons of equine OASI and RNASEL.


of the chromatogram data to identify heterozygotes and
computer analysis using the Consed visualization tool
identified 33 single nucleotide substitutions within the
proximal promoter and exons of OAS1 (Table 2). Of
these, 11 were within coding regions, 9 within non-cod-
ing regions and the remaining 13 within the proximal
promoter upstream of exon 1. Four of the 9 non-coding
polymorphisms were located within the 5' and 3' untrans-
lated regions (UTR). Of the 11 coding polymorphisms, 4
were synonymous and 7 were non-synonymous. Five of
the 7 non-synonymous SNPs resulted in substitutions of
amino acids with different properties. Interestingly, the
amino acids encoded by the major alleles of 4 of the 7
non-synonymous mutations were identical to the corre-
sponding amino acids in the human OAS1 protein [Uni-
ProtKB: P00973]. The genotypes of each individual were
used to identify potential haplotypes within equine OAS1
using PHASE v2.1 software [40,41]. Only those SNPs ver-
ified within multiple individuals were used for the haplo-
type analysis (minor allele frequency = 0.08). The best
reconstruction produced 15 haplotypes from the 33 dial-
lelic SNPs (Table 3). The polymorphic microsatellites
were not included in the analysis.

Assembling full-length RNASEL mRNA sequences of
cattle, dog, horse, cat, domestic pig, Guinea pig, elephant
and opossum
A limited number of mammalian RNASEL mRNA
sequences were previously deposited to GenBank and
some of these sequences were predicted from whole
genome annotations. However, this GenBank informa-
tion was not sufficient to identify evolutionarily con-
served regions in mammalian RNASEL sequences that


could be used to design PCR primers to amplify equine
RNASEL fragments. The predicted sequences of cattle
[GenBank: XM 597290] and dog [GenBank:
XM 547430] RNASEL ORFs were amplified from com-
mercial cDNA (BioChain, Hayward, CA), directly
sequenced and extended to full-length cDNA sequences
by DNA walking. The full-length cattle and dog RNASEL
sequences were submitted to GenBank under accession
numbers DQ497162 and D0497163, respectively. These
two sequences as well as the human full-length RNASEL
sequence NM 021133 were aligned and degenerate prim-
ers were designed from conserved regions (Table 4) and
used to amplify the middle portions of equine RNASEL
cDNA. This partial sequence was extended to the full-
length sequence by DNA walking and submitted to Gen-
Bank under accession number D0497159.

Several additional mammalian RNASEL sequences were
also determined and subsequently used to perform a phy-
logenetic analysis. The GenBank feline Whole Genome
Sequence (WGS) database was searched with the canine
RNASEL sequence [GenBank: DQ497163]. Four genomic
contigs, AANG01026257, AANG01026302,
AANG01630549 and AANG01026248, were detected.
These contigs contain the first, second and third, as well as
the fifth and sixth feline RNASEL coding exons, respec-
tively. No contigs containing the fourth coding exon of
the feline RNASEL gene were found in GenBank. Two
primers were designed based on the 3'- end
AANG01026302 sequence and the 5'-end
AANG01630549 sequence (Table 4) and used to amplify
and sequence this region from a commercial cat genomic
DNA (Novagen, Madison, Wisconsin). The sequence of



Page 4 of 14
(page number not for citation purposes)


Gene

OAS I







RNASEL


Region

Promoter
Exon I
Exon 2
Exon 3
Exon 4
Exon 5
Exon 6

Exon I
Exon 2
Exon 2
Exon 3
Exon 4
Exon 5
Exon 6
Exon 7
Exon 7


BMC Genomics 2007, 8:313








http://www. biomedcentral.com/1471-2164/8/313


Table 2: Equine OASI single nucleotide polymorphisms and microsatellites

Region Accession Alleles Residue
D0536887

3640 C
T
3687 G
T
3718 A
G
3724 C
T
3825 C
T
3830 A
T
3973 C
T
4032-4063
4234 C
T
4333 C
T
4455 C
G
4487 C
T
4501 C
T
4531 A
G
5' UTR 4598 C
G
5' UTR 4625 A
C
Exon I 4690 A 18Tyr
G 18Cys
Exon I 4783 C 49Ala
T 49Val
Intron I 5609 C
T
Exon 2 5701 C 77Leu
T 77Leu
Exon 2 5743 C 9lPhe
T 91Phe
Exon 2 5765 A 99Lys
G 99Glu
Exon 2 5776 A 102Arg
G 102Arg
Exon 2 5786 A 106Lys
G 106Glu
Exon 2 5920 G 150Pro
T I50Pro
Exon 3 9374 C 209Arg
T 209Cys
Exon 4 12714 C 264Asn
G 264Lys
Intron 4 12810 C
T
Intron 4 12853 A
G
Intron 5 13628 A
T


Amino Acid
Type







































Uncharged Polar
Uncharged Polar
Nonpolar
Nonpolar


Nonpolar

Nonpolar

Basic Polar
Acidic Polar
Basic Polar

Basic Polar
Acidic Polar
Nonpolar

Basic Polar
Uncharged Polar
Uncharged Polar
Basic Polar


Frequency Polymorphism


Transition

Transversion

Transition

Transition

Transition

Transversion

Transition

GT repeat
Transition

Transition

Transversion

Transition

Transition

Transition

Transversion

Transversion

Transition

Transition

Transition

Transition

Transition

Transition

Transition

Transition

Transversion

Transition

Transversion

Transition

Transition

Transversion


Page 5 of 14
(page number not for citation purposes)


BMC Genomics 2007, 8:313








http://www. biomedcentral.com/1471-2164/8/313


Table 2: Equine OASI single nucleotide polymorphisms and microsatellites (Continued)


Intron 5

Exon 6

3' UTR

3' UTR


13649

15320

15410

15537


0.46
0.54


370Arg
370Trp


Basic Polar
Nonpolar


0.81


15798-15855


I ransversion

Transition

Transversion

Transversion

GT repeat


SNPs and microsatellites identified from sequencing the OASI proximal promoter and exons from 13 equine individuals and CHORI BAC 100110.
Positions are identified from the genomic consensus sequence submitted to GenBank [GenBank: D0536887].


this exon was submitted to GenBank under accession
number EF062998. Using this sequence as well as the
other exon sequences derived from GenBank (see above),
the predicted full-length mRNA sequence of the feline
RNASEL gene was assembled.

The TIGR porcine database [421 was searched using the
cattle sequence [GenBank: DQ4971621 and five partial
RNASEL sequences were found. The TC212507 and
TC212872 sequences correspond to the 5'-end of porcine
RNASEL mRNA, while the TC218317, TC237301, and
TC236970 sequences represent the 3'-end. An additional


5'-end cDNA sequence, 20060611 S-038813, was detected
in the Pig EST Data Explorer [43]. A pair of primers were
designed based on the partial sequence (Table 4) and used
to amplify pooled cDNA (kindly provided by Dr.
Jonathan E. Beever, University of Illinois at Urbana-
Champaign). The middle portions of the porcine RNASEL
cDNA were directly sequenced. The partial sequence was
then extended to the full-length sequence by DNA walk-
ing and submitted to GenBank under accession number
DQ497160.


Table 3: Equine OASI and RNASEL haplotypes


Haplotype Sequence


Count Frequency


CTGTCATTCGCTGGAACCCTAGGTCGTAACCTT
CTGTCTTTCGCTGGAACCCTAGGTCCCATGCGT
CTGTCTTTCGCTGGAACCCTAGGTCCCGTGCGT
CTGTCTTTCGCTGGAACCCTAAGTCCCGTGCGT
TGACTACCTGCCGCCATCCTAGGTCGTAACCTT
TGACTACCTGCCGCCATCCTAGGTCGTAAGCTT
TGACTACCTGCCGCCATCCTAGGTCGCAACCTT
TGACTACCTGCCGCCATCCTAGGGCGTAACCTT
TGACTACCTGCCGCCATTTCGAATCCCGTGTGT
TGACTACCTGCCGCCGTTTCGAATCCCAACCGT
TGACTACCTGTCGCCGTTTCGAATCCCGACCGG
TGACTACCTCCCACCATTTCGAATCCCGTGTGT
TGACTACCTCCCACCATTTCGAAGCCCGTGTGT
TTGTCATTCGCTGGAACCCTAGGTTCCGTGTGG
TTGTCATTCGTTGGCACCCTAGGTTCCGTGTGG

GACTGCAAAGGGAGCGCTGGGCAGTTTCTTT
GATCGCAAGGACGGCGCTGGGCACACCCCCC
GATCGCAAGGACGGCGCTGGGCACACCTCCC
GATCTCACAGGGAGCGCTGGGCAGATTCTTC
GATCTCACAGGGAATAACAAGTGGACCCCCC
GATCTAGAGGACGGCGCTAGGCAGATTCTTC
GCCCGCAAGGGCGGCGCTAGGCAGATTCTTC
GCCCGAAAGGGGAATAACAAGTAGATTCTTC
GCCCGAAAGTGGAGCGCTGGGCAGTTTCTTT
CCCCGAAAGTGGAGCGCTAGACAGACCCCCC


Haplotypes were assembled using PHASE v2.1 [40, 41] under default settings. The haplotypes identified from the best reconstruction are shown
with their corresponding frequencies among the 13 horses screened for both OASI and RNASEL SNPs. Both OASI microsatellites were omitted
from the haplotype reconstruction.




Page 6 of 14
(page number not for citation purposes)


Gene

OAS I


RNASEL


BMC Genomics 2007, 8:313







BMC Genomics 2007, 8:313



Table 4: RNASEL primers


http://www. biomedcentral.com/1471-2164/8/313


Forward primer

CAGGCATCCAGAAGGGAGAC
GCTGGTCACCTTTGCATAATGC
ATGGAGACCAAGCGCCATAACA
ATATCCCTACTAGCCTGACGAG
AGCTGTAGGATGTAACTCTCACT
GCGGTACCTCATTGTGGTTTTG
TGCCTTTGAATTGTGGTGTTGGT
GTTGAGGTGTCAGGATCTGCAT
TAATGGTCTGGACCATTCCTCC
TTCACRGCYTTCATGGAAGC


Reverse primer

CAGAGGCAGCCAATCTCTCC
CCCAACTCCAAAAGAAGGGATG
TGTTCTCCCAAGTTCCGGATGA
TTGCCTTGACACCCCCAATTCT
GATTAGAGGAACCACTGAGAGG
CCTCTGTATCTTCATGGTCTGG
CCATGTGGTGGATTCATTATAGG
GGGGTAACACTGGAACTGTTTC
GTTTGAGGAAAGTGCCTTGCGT
CYTTKATCAAAATCTGCCAG


Primers used to assemble the full-length RNASEL mRNA sequences of cattle, dog, horse, cat, domestic pig, Guinea pig, elephant and opossum.


The GenBank Guinea Pig whole genome sequence data-
base was searched using both mouse [GenBank:
NM 011882] and rat [GenBank: NM 182673] full-length
RNASEL sequences. Two Guinea pig sequences,
AAKN01052053 andAAKN01424676, showed significant
similarity to the 5' and 3' regions of the rodent RNASEL
sequences, respectively. These two sequences were used to
design primers (Table 4) to amplify commercial cDNA
(BioChain, Hayward, CA) and directly sequence the mid-
dle portions of Guinea pig RNASEL cDNA. This partial
sequence was extended to the full-length sequence by
DNA walking, and submitted to GenBank under accession
number DQ497161.

Cattle, dog, horse and pig RNASEL sequences were used to
search the GenBank elephant genome trace archive using
the discontiguous Mega BLAST program. The same
sequences were also used to search the GenBank elephant
whole genome sequence database using the BLASTN pro-
gram. The sequences for all potential exons of the ele-
phant RNASEL gene were identified. Based on these
sequences, five primer pairs (Table 4) were designed to
amplify genomic DNA (kindly provided by Drs. Alfred L.
Roca and Stephen J. O'Brien, National Cancer Institute)
and directly sequence each of the elephant RNASEL exons.
The resulting sequence was submitted to GenBank under
accession number DQ497164.

The RNASEL ORF sequence of the laboratory opossum
(Monodelphis domestic) was predicted by searching the
UCSC genome browser [44] using the BLAT program. No
sequence traces similar to RNASEL were detected in frog
(Xenopus tropicalis) or several fish species (Danio rerio, Tak-
ifugu rubripes and Tetraodon nigroviridis).

Phylogenetic analysis of vertebrate RNASEL gene
sequences
Only sequences of human and mouse RNASEL genes were
previously reported [26]. Sequences of orthologous rat
(GenBank: AY262823) and chicken (GenBank:


AM0492248) genes were recently submitted to GenBank
but have not been reported in any publications. In addi-
tion, annotations of chimpanzee, orangutan and rhesus
macaque genomes using a GNOMON method resulted in
predicted RNASEL sequences in these three species. Pri-
mate, rodent and avian RNASEL sequences were down-
loaded from GenBank and aligned to orthologous
sequences described above to build a phylogenetic tree
(Figure 2). Rodents showed the highest rate of nucleotide
substitutions, while primates showed the lowest rate of
evolution. Evolution rates were found to be fairly uniform
in the three different RNase L domains: ankyrin repeats,
serine/threonine protein kinase domain, and ribonucle-
ase domain. The percent identity between the RNASEL
ORFs of horse and the other species compared is shown in
Table 5.

Assignment of the RNASEL gene to horse chromosome
ECA5p 7-p16
The horse CHORI-241 BAC library was searched with a
probe derived from the partial equine RNASEL cDNA frag-
ment. Twelve positive clones were identified and two of
them, 108P15 and 189119, were FISH mapped to assign
the RNASEL gene to the horse chromosomal location
ECA5p17-p16 (Figure 3).

Exonlintron structures of vertebrate RNASEL genes
Partial sequence for the equine RNASEL gene was
obtained by sequencing PCR fragments of BAC 159N12.
The mRNA sequence [GenBank: DQ497159] was used as
a reference for determining intron/exon junctions. Suffi-
cient genomic sequence was obtained to build a scaffold
as described for the equine OAS1 gene. The scaffold was
verified using sequences from TraceDB [38] and submit-
ted to GenBank under accession number EF070193. This
scaffold completely overlaps the whole genome shotgun
sequence AAWR01030439 (193510 bp) that was recently
submitted to GenBank from the Broad Institute. Compar-
ison of genomic and mRNA sequences revealed six coding
and one 5'-terminal non-coding exon in the equine RNA-


Page 7 of 14
(page number not for citation purposes)


Species

Cat
Cattle/Dog
Domestic pig
Elephant




Guinea pig
Horse








http://www. biomedcentral.com/1471-2164/8/313


I mouse


Figure 2
Phylogenetic tree of RNASEL genes. RNASEL ORF
sequences from 15 vertebrate species were aligned and the
njtree program was used for tree construction.


Figure 3
FISH mapping of equine RNASEL. FISH map position
ECA5p 17-p 16 of horse RNASEL gene (orange) on DAPI
counterstained metaphase chromosomes (blue).


Table 5: Lengths of coding exons (bp) within the ORFs of vertebrate RNASEL genes and percent identity between horse and other
species RNASEL ORFs


Exon F

130
139
139
145
187
187
187
187
187
172
172
187
139
136


Identity

100.0
83.0
8 1.1
79.2
75.1
81.9
79.7
81.2
79.7
66.3
65.5
69.7
56.5
37.3


Page 8 of 14
(page number not for citation purposes)


Species

Horse
Cat
Dog
Cattle
Elephant
Human
Chimpanzee
Orangutan
Rhesus
Mouse
Rat
Guinea Pig
Opossum
Chicken


Exon A

1480
1477
1477
1474
1510
1480
1480
1480
1480
1474
1489
1462
1453
1402


Exon B

86
86
86
86
86
86
86
86
86
86
86
86
86
89


Exon C

206
206
206
206
206
206
206
206
206
206
206
206
206
191


Exon D

133
133
133
130
133
133
133
133
133
133
133
133
129
124


Exon E

134
134
134
13 1
137
134
134
134
134
137
13 1
134
13 1
122


BMC Genomics 2007, 8:313







http://www. biomedcentral.com/1471-2164/8/313


SEL gene. This exonic composition is similar to that of a
number of other mammalian RNASEL genes. However,
two and three 5'-terminal non-coding exons were found
in the chicken and mouse RNASEL genes, respectively.
The coding vertebrate RNASEL exons were designated A
through F. Comparison of the genomic and mRNA
sequences of vertebrate RNASEL genes revealed significant
length variation in both the 5'- (1402-1510 bp) and 3'-
terminal (130-187 bp) coding exons (Table 5).

SNP identification in the horse RNASEL gene
After identification of the equine RNASEL introns, exon-
specific genomic primers were designed (Table 1). Exon-
specific sequencing of DNA from the screening popula-
tion identified 31 SNPs within the RNASEL gene (Table
6). Of the 10 non-coding polymorphisms, one was within
the second intron and the others were located in the 5'
and 3' UTRs. Seventeen of the 31 SNPs were located
within the ankyrin repeat-encoding exon 2, 13 of which
are non-synonymous, with 10 resulting in substitutions of
amino acids with different properties. Three non-synony-
mous polymorphisms were identified within exons 3 and
5. The remaining exons, including the non-coding exon 1
were invariant among these horses. The amino acids
encoded by the major allele of 11 of the 16 non-synony-
mous mutations were identical to the corresponding
human RNase L amino acid [UniProtKB: Q05823]. Using
MOTIF Search [45] to identify putative transcription fac-
tor binding motifs in the TRANSFAC database, the pro-
moter SNP was found to be located within a potential
cAMP-response element binding site (Score: 90) upstream
of the first exon. Haplotypes were assembled in the same
manner as for the equine OAS1 gene. The best reconstruc-
tion from Phase analysis produced 10 haplotypes among
the 31 verified diallelic SNPs with minor allele frequen-
cies = 0.08 (Table 3). As with OAS1, only good quality,
unambiguous resequencing data were used for the haplo-
type analysis.

Identifying single nucleotide polymorphisms by sequenc-
ing DNA from multiple individuals enhances the possibil-
ity of artifacts either from PCR or sequencing error. The 64
SNPs identified from the equine OAS1 and RNASEL genes
were considered valid if each allele was identified in at
least two individuals. Eight additional SNPs were identi-
fied but could not be verified in more than one individual
(minor allele frequency < 0.08). Within the 3,864 and
5,406 base pairs re-sequenced during the SNP identifica-
tion for OAS1 and RNASEL, respectively, equine OAS1
contained an average of one polymorphism per 117
bases, while equine RNASEL averaged one polymorphism
per 174 bases.


Discussion
Sequence characterization of the horse OAS1 gene in
CHORI-241 BAC 100110 enabled a partial genomic
sequence assembly [GenBank: DQ536887] and compari-
son among multiple equine individuals. We identified 2
polymorphic microsatellites and 33 single nucleotide pol-
ymorphisms from a group of 13 individuals and CHORI-
241 BAC 100110 (Table 2). In an attempt to identify
potential structural and/or functional consequences of the
coding non-synonymous SNPs, each was analyzed using
PolyPhen software [46-48]. Each polymorphic variant
identified in equine OAS1 was predicted to cause benign
effects at their respective residue position. However, the
single mutation resulting in an Arg209Cys substitution
may significantly change OAS 1 enzymatic activity. Arg209
in the equine OAS1 protein corresponds to Arg544 in the
human OAS2 protein, which is located in the donor bind-
ing domain. Substitution of Arg544 with either Ala or Tyr
significantly decreased enzymatic activity of the OAS2
protein [49]. In addition, the equine OAS1 promoter SNP
at position 4531 is located in an interferon stimulating
response element [29]. Inactivation of this regulatory ele-
ment by a single nucleotide substitution may alter expres-
sion of the equine OAS1 gene.

RNASEL enzymatic activity was previously reported in
reptiles, birds, and mammals [50]. However, no RNASEL
genes have been found for amphibians or fishes to date.
Interestingly, the same classes of vertebrates also do not
have OAS genes[51].

The horse RNASEL gene was FISH mapped to chromo-
somal location ECA5p17-p16. Orthologous genes are
located on primate chromosome 1 (human, chimpanzee
and rhesus macaque), cattle chromosome 16, dog chro-
mosome 7, mouse chromosome 1, rat chromosome 13
and chicken chromosome 8 [52]. Using comparative
chromosome painting (Zoo-FISH), similarities between
human chromosome 1 and horse chromosome 5 [53],
mouse chromosome 1, rat chromosome 13 [54], dog
chromosome 7 [55,56] and cattle chromosome 16 [57]
were previously established. Our results further confirm
the conservation of RNASEL-containing syntenic chromo-
somal segments in horses.

Thirty one SNPs were identified for equine RNASEL
(Table 6). Interestingly, all but three of the 20 coding
SNPs identified are located within exon 2. The RNase L
protein contains 9 N-terminal ankyrin repeats responsible
for binding 2-5A molecules that are essential for activa-
tion [27]. Exon 2 of the human RNASEL gene encodes the
entire ankyrin repeat region (amino acid 24 to 329). The
high frequency of non-synonymous polymorphisms
within exon 2 suggests that a single SNP or haplotype
could ablate 2-5A binding and/or other RNase L interac-


Page 9 of 14
(page number not for citation purposes)


BMC Genomics 2007, 8:313








http://www. biomedcentral.com/1471-2164/8/313


Table 6: Equine RNASEL single nucleotide polymorphisms

Region Accession Alleles
EF070193

143 C
G
5'UTR 1857 A
C
Exon 2 1991 C
T
Exon 2 2020 C
T
Exon 2 2021 G
T
Exon 2 2118 A
C
Exon 2 2121 A
G
Exon 2 2316 A
C
Exon 2 2332 A
G
Exon 2 2374 G
T
Exon 2 2635 A
G
Exon 2 2680 C
G
Exon 2 2771 A
G
Exon 2 3144 A
G
Exon 2 3152 C
T
Exon 2 3281 A
G
Exon 2 3301 A
C
Exon 2 3311 C
T
Exon 2 3372 A
G
Intron 2 3404 A
G
Exon 3 5108 A
G
Exon 3 5111 C
T
Exon 5 7314 A
G
3' UTR 9994 C
G
3' UTR 9999 A
T
3'UTR 10247 C
T
3'UTR 10914 C
T
3'UTR 11105 C
T
3'UTR 11146 C
T
3'UTR 11184 C


Residue Amino Acid
Type


27His
27Tyr
36Gly
36Gly
37Asp
37Tyr
69Asn
69Thr
70Tyr
70Cys
135Lys
135Thr
140Ala
140Ala
154Arg
I54Ser
241Thr
241Thr
256Ser
256Ser
287Lys
287Glu
411 Asn
41 ISer
414Arg
414Cys
457Lys
457Glu
463 Lys
463Asn
467Pro
467Ser
487Gln
487Arg


513Lys
513Glu
514Pro
514Ser
598Asn
598Asp


Basic Polar
Uncharged Polar
Uncharged Polar

Acidic Polar
Uncharged Polar
Uncharged Polar
Uncharged Polar
Uncharged Polar
Uncharged Polar
Basic Polar
Uncharged Polar
Nonpolar

Basic Polar
Uncharged Polar
Uncharged Polar

Uncharged Polar

Basic Polar
Acidic Polar
Uncharged Polar
Uncharged Polar
Basic Polar
Uncharged Polar
Basic Polar
Acidic Polar
Basic Polar
Uncharged Polar
Nonpolar
Uncharged Polar
Uncharged Polar
Basic Polar


Basic Polar
Acidic Polar
Nonpolar
Uncharged Polar
Uncharged Polar
Acidic Polar


Frequency Polymorphism


Transversion

Transversion

Transition

Transition

Transversion

Transversion

Transition

Transversion

Transition

Transversion

Transition

Transversion

Transition

Transition

Transition

Transition

Transversion

Transition

Transition

Transition

Transition

Transition

Transition

Transversion

Transversion

Transition

Transition

Transition

Transition

Transition


Page 10 of 14
(page number not for citation purposes)


BMC Genomics 2007, 8:313







http://www. biomedcentral.com/1471-2164/8/313


Table 6: Equine RNASEL single nucleotide polymorphisms (Continued)


3' UTR


0.65
0.83


11228


Transition


SNPs identified from sequencing RNASEL exons from 13 equine individuals, CHORI BAC 159N 12 and the reference transcript sequence. Positions
are identified from the genomic consensus sequence submitted to GenBank [GenBank: EF070 193].


tions. As well, the SNP identified within the promoter
upstream of the first exon is located within a potential
cAMP-response element binding site. Mutations within
this promoter element have been shown to affect gene
expression [58-601. PolyPhen analysis was also conducted
on the non-synonymous coding SNPs identified within
equine RNASEL. All but 4 of the RNase L SNPs were pre-
dicted to have benign effects. However, the SNP at residue
287 was predicted to change hydrophobicity at a buried
site within the RNase L protein and the effect of this on
protein function is unknown. The predictions provided by
PolyPhen analysis are based on functional effects identi-
fied using human nsSNPs and may differ for the horse
RNase L. Four SNPs within the ankyrin repeat region in
exon 2 (residues 414, 463, 467 and 487) were predicted
to have a negative effect on function. These data support
our hypothesis that a single SNP or haplotype could affect
2-5A binding within the equine RNase L ankyrin repeats.

A number of SNPs were detected within the 3'UTR region
of the equine RNASEL gene. Of the eight SNPs found
within this region, six result in transitions. The 3'UTR
regions of mRNAs contain regulatory regions capable of
protein and microRNA binding that control mRNA stabil-
ity, translation and localization. A simple analysis of
octamer motifs containing equine 3' UTR SNPs identified
SNP 10247 as being within a human miRNA target site
[61]. If this target site is conserved in horses, this SNP
could significantly affect the synthesis of RNase L. How-
ever, this particular octamer motif was not found in
human or rodent RNASEL 3'UTRs. Furthermore, cross-
species sequence comparison using mVISTA[62,63] also
revealed no significant longer range conservation in this
region between species (data not shown).

Genotype analysis using PHASE v2.1 [40,41] identified 15
and 10 haplotypes among equine OAS1 and RNASEL
genes, respectively, and suggested the existence of haplo-
type blocks spanning most of each gene (Table 3). Even if
efforts to show an association between viral-induced dis-
ease susceptibility and OAS1 and/or RNASEL SNPs are
successful, it may prove difficult to unambiguously iden-
tify a single causal SNP because of potential linkage dise-
quilibrium at these loci. As determined from our
screening population, a single haplotype occurred more
frequently than any other, with a frequency of 0.19 and
0.23 in OAS1 and RNASEL, respectively (Table 3).


The frequency of SNP identification in this study in two
equine genes was high considering the previously esti-
mated equine SNP frequency of 1 per 1500 bp [64]. In
dogs, the estimated SNP rate is ~1 per 1600 bp (based on
entire genome re-sequencing), but a higher frequency of
~1 per 900 bp was estimated between breeds [65]. Re-
sequencing of specific genes in several breeds of the
domestic dog identified polymorphisms at frequencies
comparable to our estimates, with 1 SNP per ~250-330
bp [S. Canterbury, personal communication]. Further-
more, re-sequencing within an Elk (Cervus elaphus nelsoni)
putative promoter region, which is highly conserved
between mule deer, cow and sheep, detected an average
SNP frequency of 1 per 69 bp [unpublished data].

The microsatellite identified within the promoter region
in this study may also alter expression of the equine OAS1
gene. The alleles observed to date indicate that dinucle-
otide repeat lengths of 9 and 18 may represent the major
alleles at this locus. The over-representation of these alle-
les may be due to the fact that they correspond to one
complete rotation of the DNA helix. If this microsatellite
separates cis-regulatory elements, alterations in its length
could affect the binding of transcriptional regulators to
these elements and significantly alter gene expression [66-
71]. In support of this hypothesis, there is a high degree of
conservation between human and horse OAS1 promoters
in the regions flanking the microsatellite (Figure 1). As
well, recent micro-array data provide evidence of an
inverse relationship between gene expression and dinu-
cleotide microsatellite length, supporting the significantly
higher frequency with which we identified the (GT), allele
within the individuals screened[66]

Conclusion
We report the genomic sequences of the equine OAS1 and
RNASEL genes and identify 64 single nucleotide polymor-
phisms and 2 polymorphic microsatellites in these genes.
On the basis of the allelic variants characterized, we con-
clude that a number of these are plausible candidates for
regulatory or structural mutations which may influence
transcription or enzymatic activity of OAS1 and RNase L
proteins. Also, RNASEL cDNA sequences were determined
for 8 mammals and utilized in a phylogenetic analysis.
The chromosomal location of the RNASEL gene was
assigned by FISH to ECA5pl7-pl6.





Page 11 of 14
(page number not for citation purposes)


BMC Genomics 2007, 8:313







http://www. biomedcentral.com/1471-2164/8/313


Methods
RNASEL cDNA and FISH
Preparation of horse cDNA was described previously [32].
Partial RNASEL sequences were extended using a DNA
Walking SpeedUp Kit (Seegene USA, Del Mar, CA) accord-
ing to the manufacturer's protocol. Four high-density fil-
ters for segment 1 of the CHORI-241 equine genomic BAC
library were purchased from the Children's Hospital Oak-
land Research Institute (CHORI), Oakland, CA. These fil-
ters were screened using a P32-labeled equine RNASEL
cDNA probe according to the supplier's protocol. Two
positive equine BAC clones were purchased from CHORI.
Each of these BAC clones was grown individually in 500
mL of LB media. BAC DNA was isolated using the Nucle-
oBond BAC Maxi Kit (BD Biosciences Clontech, Palo Alto,
CA) and used as the template for direct partial sequencing
with a BigDye terminator vi. 1 Cycle Sequencing Kit on an
ABI 3100 Genetic Analyzer according to the manufac-
turer's recommendations. DNA from equine BAC clones
108P15 and 189119 was FISH mapped as described previ-
ously [67]. International cytogenetic nomenclature of the
domestic horse [68] was used to identify individual horse
chromosomes.

The njtree program was used to construct a phylogenetic
tree as described previously [51] and tree topology was
inferred by the Neighbor-Joining algorithm. The boot-
strap algorithm with 1000 replications was used to esti-
mate the confidence of each node. The njtree program is
available upon request.

Construction of subclone library
BAC clone 100110 was isolated from segment 1 of the
CHORI-241 equine BAC library at Texas A&M University
and confirmed by PCR as containing OAS1. The colony-
isolated clone was cultured and BAC DNA was isolated by
standard alkaline/lysis miniprep using Millipore Solu-
tions and treated with Plasmid-Safe ATP-dependent
DNAse (Epicentre, Madison, WI). BAC DNA was frag-
mented using a HydroShear DNA Shearing Device (Gen-
eMachine, San Carlos, CA) at Speed Code 8 for an
estimated fragment size of 2.5 kb. The fragmented prod-
uct was analyzed by agarose gel electrophoresis stained
with ethidium bromide and gel extracted using the
QIAquick Gel Extraction Kit (Qiagen, Valencia, CA).
Extractions were eluted in water according to the manu-
facturer's protocol. Purified fragments were cloned into
vector pCR" 4Blunt-TOPO using the TOPO' Shotgun Sub-
cloning Kit (Invitrogen, Carlsbad, CA) following the man-
ufacturer's protocol. Ligation reactions were incubated 30
minutes at room temperature and electroporated into E.
coli. Colonies were screened for lack of 3-galactosidase
activity and selected for ampicillin resistance on LB-agar-
ose plates containing 50 |ig/mL ampicillin. White colo-
nies were cultured and screened for appropriate insert size


by PCR using vector-sequence Ml 13 primer sites flanking
the cloned insert, prior to sequencing.

Sequencing of clones
Individual OAS1 inserts were amplified directly from indi-
vidual colonies by PCR using vector-sequence M13 primer
sites flanking the cloned insert. Amplification products
were purified by centrifugation with the PSI-Clone PCR
96 kit (Princeton Separations, Adelphia, NJ) according to
manufacturer's protocol. Purified products were
sequenced in separate reactions with each M13 primer
using a cycle sequence of 96C, 10 sec; 50C, 5 sec; 60C, 4
min with BigDye Terminator Mix vi. 1 (Applied Biosys-
tems, Foster City, CA). Sequencing reactions were ana-
lyzed using an ABI Prism 3100 Genetic Analyzer (Applied
Biosystems, Foster City, CA).

Primers were designed to amplify the immediate pro-
moter and exons of OAS1 and RNASEL genes from 13
individual horses by PCR (Table 1). Sequencing was car-
ried out in the same manner as used for the library sub-
clones. Sequences obtained were compared between
individuals to identify SNPs within the amplified regions.

Sequence analysis and contig assembly
Sequences were assembled and analyzed using Phrap
assembly software [33,34,37] and viewed with the
Consed visualization tool [35-37]. Contig and singleton
reads were assembled by scaffolding onto the human
genome using BLASTN [69-71].

Additional sequences were added to the assembly data
and re-analyzed with Phrap and BLAST until the consen-
sus sequence spanned the genes from the promoter to the
3' UTR. The genomic equine consensus sequence was con-
firmed using data from the Equine Genome Sequencing
Project (2x) [38] and intron/exon boundaries were
assigned by local alignment to the full-length equine
OAS1 [GenBank: AY321355] and RNASEL [GenBank:
DQ497159] cDNAs. The equine genomic sequences of
OAS1 and RNASEL were submitted to GenBank and
assigned the accession numbers DQ536887 and
EF070193, respectively.

Genotyping population
Blood samples were collected at the Texas A&M University
Equestrian Center in accordance with ethical standards.
The sampled set used for screening consisted of 13 horses,
including 10 geldings/stallions and 3 mares, ranging in
age from 21 months to 20 years. Breeds represented
include American Quarter Horse (9), Arabian (1), Ameri-
can Paint Horse (1), Appaloosa (1) and Thoroughbred
(1).




Page 12 of 14
(page number not for citation purposes)


BMC Genomics 2007, 8:313








http://www. biomedcentral.com/1471-2164/8/313


Authors' contributions
JJR and DLA provided the OAS1 and RNASEL genomic
sequence and assembled the haplotypes for both genes.
AAP and MAB contributed all of the cDNA sequences for
RNASEL. AAZ completed the phylogeny analysis. TLL
completed the FISH analysis for RNASEL. JJR, AAP, MAB
and DLA contributed to the identification of polymor-
phisms and helped to draft the manuscript. All authors
read and approved the final manuscript.


Acknowledgements
This work was supported by Grant C1000216 from the National Center for
Infectious Diseases, Centers for Disease Control and Prevention to MAB
and AAP.

References
I. Baglioni C, Minks MA, Maroney PA: Interferon action may be
mediated by activation of a nuclease by pppA2'p5'A2'p5'A.
Nature 1978, 273(5664):684-687.
2. Clemens MJ, Williams BR: Inhibition of cell-free protein synthe-
sis by pppA2'p5'A2'p5'A: a novel oligonucleotide synthesized
by interferon-treated L cell extracts. Cell 1978, 13(3):565-572.
3. Kerr IM, Brown RE: pppA2'pS'A2'pS'A: an inhibitor of protein
synthesis synthesized with an enzyme fraction from inter-
feron-treated cells. Proc Natl Acad Sc USA 1978, 75( ):256-260.
4. Hovanessian AG, Brown RE, Kerr IM: Synthesis of low molecular
weight inhibitor of protein synthesis with enzyme from
interferon-treated cells. Nature 1977, 268(5620):537-540.
5. Kerr IM, Brown RE, Hovanessian AG: Nature of inhibitor of cell-
free protein synthesis formed in response to interferon and
double-stranded RNA. Nature 1977, 268(5620):540-542.
6. Roberts WK, Hovanessian A, Brown RE, Clemens MJ, Kerr IM: Inter-
feron-mediated protein kinase and low-molecular-weight
inhibitor of protein synthesis. Nature 1976, 264(5585):477-480.
7. Castelli JC, Hassel BA, Maran A, Paranjape, HewittJA, Li XL, Hsu YT,
Silverman RH, Youle RJ: The role of 2'-5' oligoadenylate-acti-
vated ribonuclease L in apoptosis. Cell Death Differ 1998,
5(4):3 13-320.
8. Diaz-Guerra M, Rivas C, Esteban M: Activation of the IFN-induc-
ible enzyme RNase L causes apoptosis of animal cells. Virology
1997, 236(2):354-363.
9. Mullan PB, Hosey AM, Buckley NE, Quinn JE, Kennedy RD, Johnston
PG, Harkin DP: The 2,5 oligoadenylate synthetase/RNaseL
pathway is a novel effector of BRCAI- and interferon-
gamma-mediated apoptosis. Oncogene 2005, 24(35):5492-550 I.
10. Zhou A, Paranjape J, Brown TL, Nie H, Naik S, Dong B, Chang A,
Trapp B, Fairchild R, Colmenares C, et al.: Interferon action and
apoptosis are defective in mice devoid of 2',5'-oligoade-
nylate-dependent RNase L. Emboj 1997, 16(21):6355-6363.
II. Domingo-Gil E, Esteban M: Role of mitochondria in apoptosis
induced by the 2-5A system and mechanisms involved. Apop-
tosis 2006, II (5):725-738.
12. Perelygin AA, Scherbik SV, Zhulin IB, Stockman BM, Li Y, Brinton MA:
Positional cloning of the murine flavivirus resistance gene.
Proc Natl Acad Sci USA 2002, 99(14):9322-9327.
13. Mashimo T, Lucas M, Simon-Chazottes D, Frenkiel MP, Montagutelli
X, Ceccaldi PE, Deubel V, GuenetJL, Despres P: A nonsense muta-
tion in the gene encoding 2'-5'-oligoadenylate synthetase/L I
isoform is associated with West Nile virus susceptibility in
laboratory mice. Proc Natl Acad Sci USA 2002,
99(17): 11311-11316.
14. Hovnanian A, Rebouillat D, Mattei MG, Levy ER, Marie I, Monaco AP,
Hovanessian AG: The human 2',5'-oligoadenylate synthetase
locus is composed of three distinct genes clustered on chro-
mosome I 2q24.2 encoding the 100-, 69-, and 40-kDa forms.
Genomics 1998, 52(3):267-277.
15. Chebath J, Benech P, Hovanessian A, Galabru J, Revel M: Four differ-
ent forms of interferon-induced 2',5'-oligo(A) synthetase
identified by immunoblotting in human cells. ] Biol Chem 1987,
262(8):3852-3857.


16. Hovanessian AG, Laurent AG, Chebath J, Galabru J, Robert N, Svab J:
Identification of 69-kd and 100-kd forms of 2-5A synthetase
in interferon-treated human cells by specific monoclonal
antibodies. Emboj 1987, 6(5): 1273-1280.
17. Merlin G, Chebath J, Benech P, Metz R, Revel M: Molecular cloning
and sequence of partial cDNA for interferon-induced (2'-
5')oligo(A) synthetase mRNA from human cells. Proc Natl
Acad Sci USA 1983, 80(16):4904-4908.
18. Benech P, Merlin G, Revel M, Chebath J: 3' end structure of the
human (2'-5') oligo A synthetase gene: prediction of two dis-
tinct proteins with cell type-specific expression. Nucleic acids
research 1985, 13(4):1267-1281.
19. Bonnevie-Nielsen V, Field LL, Lu S, Zheng DJ, Li M, Martensen PM,
Nielsen TB, Beck-Nielsen H, Lau YL, Pociot F: Variation in antiviral
2',5'-oligoadenylate synthetase (2'5'AS) enzyme activity is
controlled by a single-nucleotide polymorphism at a splice-
acceptor site in the OASI gene. Am j Hum Genet 2005,
76(4):623-633.
20. Yakub I, Lillibridge KM, Moran A, Gonzalez OY, BelmontJ, Gibbs RA,
Tweardy DJ: Single nucleotide polymorphisms in genes for 2'-
5'-oligoadenylate synthetase and RNase L inpatients hospi-
talized with West Nile virus infection. j Infect Dis 2005,
192(10):1741-1748.
21. Hamano E, Hijikata M, Itoyama S, Quy T, Phi NC, Long HT, Ha le D,
Ban VV, Matsushita I, Yanai H, et al.: Polymorphisms of inter-
feron-inducible genes OAS-I and MxA associated with SARS
in the Vietnamese population. Biochem Biophys Res Commun
2005, 329(4): 1234-1239.
22. He J, Feng D, de Vlas SJ, Wang H, Fontanet A, Zhang P, Plancoulaine
S, Tang F, Zhan L, Yang H, et al.: Association of SARS susceptibil-
ity with single nucleic acid polymorphisms of OAS I and MxA
genes: a case-control study. BMC Infect Dis 2006, 6:106.
23. Knapp S, Yee LJ, Frodsham AJ, Hennig BJ, Hellier S, Zhang L, Wright
M, Chiaramonte M, Graves M, Thomas HC, et al.: Polymorphisms
in interferon-induced genes and the outcome of hepatitis C
virus infection: roles of MxA, OAS- I and PKR. Genes Immun
2003, 4(6):41 1-419.
24. Squire J, Zhou A, Hassel BA, Nie H, Silverman RH: Localization of
the interferon-induced, 2-5A-dependent RNase gene (RNS4)
to human chromosome Iq25. Genomics 1994, 19(1):174-175.
25. Squire J, Meurs EF, Chong KL, McMillan NA, Hovanessian AG, Wil-
liams BR: Localization of the human interferon-induced, ds-
RNA activated p68 kinase gene (PRKR) to chromosome
2p21-p22. Genomics 1993, 16(3):768-770.
26. Zhou A, Hassel BA, Silverman RH: Expression cloning of 2-5A-
dependent RNAase: a uniquely regulated mediator of inter-
feron action. Cell 1993, 72(5):753-765.
27. Dong B, Silverman RH: A bipartite model of 2-5A-dependent
RNase L. j Biol Chem 1997, 272(35):22236-22242.
28. Cole JL, Carroll SS, Kuo LC: Stoichiometry of 2',5'-oligoade-
nylate-induced dimerization of ribonuclease L. A sedimenta-
tion equilibrium study. J Biol Chem 1996, 271(8):3979-3981.
29. Tanaka N, Nakanishi M, Kusakabe Y, Goto Y, Kitade Y, Nakamura
KT: Structural basis for recognition of 2',5'-linked oligoade-
nylates by human ribonuclease L. Embo j 2004,
23(20):3929-3938.
30. Dong B, Silverman RH: 2-5A-dependent RNase molecules
dimerize during activation by 2-5A. j Biol Chem 1995,
270(8):4133-4137.
31. Nakanishi M, Goto Y, Kitade Y: 2-5A induces a conformational
change in the ankyrin-repeat domain of RNase L. Proteins
2005, 60(1):131-138.
32. Perelygin AA, Lear TL, Zharkikh AA, Brinton MA: Structure of
equine 2'-5'oligoadenylate synthetase (OAS) gene family and
FISH mapping of OAS genes to ECA8plS-->pl4 and
BTAI 7q24-->q25. Cytogenet Genome Res 2005, 111 I (1):51-56.
33. Ewing B, Green P: Base-calling of automated sequencer traces
using phred. II. Error probabilities. Genome Res 1998,
8(3):186-194.
34. Ewing B, Hillier L, Wendl MC, Green P: Base-calling of automated
sequencer traces using phred. I. Accuracy assessment.
Genome Res 1998, 8(3): 175-185.
35. Gordon D: Viewing and Editing Assembled Sequences Using
Consed. In Current Protocols in Bioinformatics Edited by: Baxevanis
AD, Davison DB. New York: John Wiley & Co;
2004:11.12.11-I 1.12.43.



Page 13 of 14
(page number not for citation purposes)


BMC Genomics 2007, 8:313








http://www. biomedcentral.com/1471-2164/8/313


36. Gordon D, Abajian C, Green P: Consed: a graphical tool for
sequence finishing. Genome Res 1998, 8(3):195-202.
37. Laboratory of Phil Green [http://www.phrap.org]
38. NCBI Trace Archive [http://www.ncbi.nlm.nih.gov/Traces/
trace.cgi?]
39. Chen TM, Kuo PL, Hsu CH, Tsai SJ, Chen MJ, Lin CW, Sun HS: Mic-
rosatellite in the 3' untranslated region of human fibroblast
growth factor 9 (FGF9) gene exhibits pleiotropic effect on
modulating FGF9 protein expression. Human mutation 2007,
28(1):98.
40. Stephens M, Scheet P: Accounting for decay of linkage disequi-
librium in haplotype inference and missing-data imputation.
Am j Hum Genet 2005, 76(3):449-462.
41. Stephens M, Smith NJ, Donnelly P: A new statistical method for
haplotype reconstruction from population data. Am ] Hum
Genet 2001, 68(4):978-989.
42. TIGR Institute for Genomic Research [http://compbio.dfci.har
vard.edu/tgi/cgi-bin/tgi/Blast/l
43. Pig EST Data Explorer [http://pede.dna.affrc.go.ip/]
44. UCSC Genome Bioinformatics [http://www.genome.ucsc.edu]
45. MOTIF Search [http://motif.genome.jp/]
46. Ramensky V, Bork P, Sunyaev S: Human non-synonymous SNPs:
server and survey. Nucleic acids research 2002, 30(1 7):3894-3900.
47. Sunyaev S, Ramensky V, Bork P: Towards a structural basis of
human non-synonymous single nucleotide polymorphisms.
Trends Genet 2000, 16(5): 198-200.
48. Sunyaev S, Ramensky V, Koch I, Lathe W 3rd, Kondrashov AS, Bork
P: Prediction of deleterious human alleles. Human molecular
genetics 2001, 10(6):591-597.
49. Sarkar SN, Miyagi M, CrabbJW, Sen GC: Identification of the sub-
strate-binding sites of 2'-5'-oligoadenylate synthetase. J Biol
Chem 2002, 277(27):24321-24330.
50. Cayley PJ, White RF, AntoniwJF, Walesby NJ, Kerr IM: Distribution
of the ppp(A2'p)nA-binding protein and interferon-related
enzymes in animals, plants, and lower organisms. Biochem Bio-
phys Res Commun 1982, 108(3):1243-1250.
51. Perelygin AA, Zharkikh AA, Scherbik SV, Brinton MA: The mam-
malian 2'-5' oligoadenylate synthetase gene family: evidence
for concerted evolution of paralogous OasI genes in Roden-
tia and Artiodactyla. j Mol Evol 2006, 63(4):562-576.
52. Ensembi [http://www.ensembl.org]
53. Raudsepp T, Fronicke L, Scherthan H, Gustavsson I, Chowdhary BP:
Zoo-FISH delineates conserved chromosomal segments in
horse and man. Chromosome Res 1996, 4(3):218-225.
54. Nilsson S, Helou K, Walentinsson A, Szpirer C, Nerman 0, Stahl F:
Rat-mouse and rat-human comparative maps based on gene
homology and high-resolution zoo-FISH. Genomics 2001,
74(3):287-298.
55. Breen M, Thomas R, Binns MM, Carter NP, Langford CF: Reciprocal
chromosome painting reveals detailed regions of conserved
synteny between the karyotypes of the domestic dog (Canis
familiaris) and human. Genomics 1999, 61(2): 145-155.
56. Yang F, O'Brien PC, Milne BS, Graphodatsky AS, Solanky N, Trifonov
V, Rens W, Sargan D, Ferguson-Smith MA: A complete compara-
tive chromosome map for the dog, red fox, and human and
its integration with canine genetic maps. Genomics 1999,
62(2): 189-202.
57. Solinas-Toldo S, Lengauer C, Fries R: Comparative genome map
of human and cattle. Genomics 1995, 27(3):489-496.
58. Feng Y, Goulet AC, Nelson MA: Identification and characteriza-
tion of the human Cdc212 gene promoter. Gene 2004,
330:75-84.
59. Ogasawara K, Terada T, Asaka J, Katsura T, Inui K: Human organic
anion transporter 3 gene is regulated constitutively and
inducibly via a cAMP-response element. j Pharmacol Exp Ther
2006, 319(1):317-322.
60. Rani CS, Qiang M, Ticku MK: Potential role of cAMP response
element-binding protein in ethanol-induced N-methyl-D-
aspartate receptor 2B subunit gene transcription in fetal
mouse cortical cells. Mol Pharmacol 2005, 67(6):2126-2136.
61. Patrocles Targets Database [http://www.patrocles.org/]
62. Frazer KA, Pachter L, Poliakov A, Rubin EM, Dubchak I: VISTA:
computational tools for comparative genomics. Nucleic acids
research 2004, 32(Web Server):W273-279.
63. Mayor C, Brudno M, Schwartz JR, Poliakov A, Rubin EM, Frazer KA,
Pachter LS, Dubchak I: VISTA : visualizing global DNA


sequence alignments of arbitrary length. Bioinformatics (Oxford,
England) 2000, 16(1 I):1046-1047.
64. Lindblad-Toh K: Plant & Animal Genome XV: January 13-17, 2007 2007
San Diego, California, USA; 2007.
65. Lindblad-Toh K, Wade CM, Mikkelsen TS, Karlsson EK, Jaffe DB,
Kamal M, Clamp M, Chang JL, Kulbokas EJ 3rd, Zody MC, et al.:
Genome sequence, comparative analysis and haplotype
structure of the domestic dog. Nature 2005,
438(7069):803-819.
66. Sharma VK, Kumar N, Brahmachari SK, Ramachandran S: Abun-
dance of Dinucleotide Repeats and Gene Expression are
Inversely Correlated: a role for gene function in addition to
intron length. Physiol Genomics 2007.
67. Perelygin AA, Lear TL, Zharkikh AA, Brinton MA: Comparative
analysis of vertebrate EIF2AK2 (PKR) genes and assignment
of the equine gene to ECAI 5q24-q25 and the bovine gene to
BTA I q 2-qi5. Genet Sel Evol 2006, 38(5):551-563.
68. Bowling AT, Breen M, Chowdhary BP, Hirota K, Lear T, Millon LV,
Ponce de Leon FA, Raudsepp T, Stranzinger G: International sys-
tem for cytogenetic nomenclature of the domestic horse.
Report of the Third International Committee for the Stand-
ardization of the domestic horse karyotype, Davis, CA, USA,
1996. Chromosome Res 1997, 5:433-443.
69. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ: Basic local
alignment search tool. j Mol Biol 1990, 215(3):403-410.
70. Altschul SF, Madden TL, Schaffer AA, ZhangJ, Zhang Z, Miller W, Lip-
man DJ: Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs. Nucleic acids research 1997,
25(1 7):3389-3402.
71. National Center for Biotechnology Information [http://
www.ncbi.nlm.nih.gov/]


Page 14 of 14
(page number not for citation purposes)


Publish with BioMed Central and every
scientist can read your work free of charge
"BioMed Central will be the most significant development for
disseminating the results of biomedical research in our lifetime."
Sir Paul Nurse, Cancer Research UK
Your research papers will be:
available free of charge to the entire biomedical community
peer reviewed and published immediately upon acceptance
cited in PubMed and archived on PubMed Central
yours you keep the copyright

Submit your manuscript here: BioMedcentral
http://www.biomedcentral.com/info/publishing adv.asp


BMC Genomics 2007, 8:313




University of Florida Home Page
© 2004 - 2010 University of Florida George A. Smathers Libraries.
All rights reserved.

Acceptable Use, Copyright, and Disclaimer Statement
Last updated October 10, 2010 - - mvs