Group Title: BMC Medical Genetics
Title: Gene sequence variations of the platelet P2Y12 receptor are associated with coronary artery disease
CITATION PDF VIEWER THUMBNAILS PAGE IMAGE ZOOMABLE
Full Citation
STANDARD VIEW MARC VIEW
Permanent Link: http://ufdc.ufl.edu/UF00099984/00001
 Material Information
Title: Gene sequence variations of the platelet P2Y12 receptor are associated with coronary artery disease
Physical Description: Book
Language: English
Creator: Cavallari, Ugo
Trabetti, Elisabetta
Malerba, Giovanni
Biscuola, Michele
Girelli, Domenico
Olivieri, Oliviero
Martinelli, Nicola
Angiolillo, Dominick
Corrocher, Roberto
Pignatti, Pier
Publisher: BMC Medical Genetics
Publication Date: 2007
 Notes
Abstract: BACKGROUND:The platelet P2Y12 receptor plays a key role in platelet activation. The H2 haplotype of the P2Y12 receptor gene (P2RY12) has been found to be associated with maximal aggregation response to adenosine diphosphate (ADP) and with increased risk for peripheral arterial disease. No data are available on its association with coronary artery disease (CAD).METHODS :The H2 haplotype of the P2RY12 was determined in 1378 unrelated patients of both sexes selected according to the presence of significant coronary artery disease (CAD group) or having normal coronary angiogram at cardiac catheterization (CAD-free group). Significant coronary artery disease was angiographically determined, and was defined as a greater than 50% visually estimated luminal diameter stenosis in at least one major epicardial coronary artery.RESULTS:In the studied population 71.9% had CAD (n = 991) and 28.1% had normal coronary angiogram (n = 387). H2 haplotype carriers were more frequent in the CAD group (p = 0.03, OR = 1.36, 95%CI = 1.02–1.82). The H2 haplotype was significantly associated with CAD in non-smokers (p = 0.007, OR = 1.83 95%CI = 1.17–2.87), but not in smokers. The association remained significant after adjustment for other covariates (age, triglycerides, HDL, hypertension, diabetes) by multivariate logistic regression (p = 0.004, OR = 2.32 95%CI = 1.30–4.15).CONCLUSION:Gene sequence variations of the P2Y12 receptor gene are associated with the presence of significant CAD, particularly in non-smoking individuals.
General Note: Start page 59
General Note: M3: 10.1186/1471-2350-8-59
 Record Information
Bibliographic ID: UF00099984
Volume ID: VID00001
Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: Open Access: http://www.biomedcentral.com/info/about/openaccess/
Resource Identifier: issn - 1471-2350
http://www.biomedcentral.com/1471-2350/8/59

Downloads

This item has the following downloads:

PDF ( PDF )


Full Text


0
BMC Medical Genetics Central



Research article

Gene sequence variations of the platelet P2Y 12 receptor are
associated with coronary artery disease
Ugo Cavallaril, Elisabetta Trabetti* 1, Giovanni Malerbal, Michele Biscuola1,
Domenico Girelli2, Oliviero Olivieri2, Nicola Martinelli2,
Dominick J Angiolillo3, Roberto Corrocher2 and Pier Franco Pignattil

Address: 'Department of Mother and Child and of Biology-Genetics, Section of Biology and Genetics, University of Verona, Verona, Italy,
2Department of Clinical and Experimental Medicine, University of Verona, Verona, Italy and Division of Cardiology, University of Florida-Shands
Jacksonville, FL USA
Email: Ugo Cavallari ugo.cav@fastwebnet.it; Elisabetta Trabetti* elisabetta.trabetti@univr.it; Giovanni Malerba giovanni.malerba@univr.it;
Michele Biscuola michele.biscuola@gmail.com; Domenico Girelli domenico.girelli@univr.it; Oliviero Olivieri oliviero.olivieri@univr.it;
Nicola Martinelli trentinik@jumpy.it; Dominick J Angiolillo dominick.angiolillo@jax.ufl.edu;
Roberto Corrocher roberto.corrocher@univr.it; Pier Franco Pignatti pierfranco.pignatti@univr.it
* Corresponding author



Published: 5 September 2007 Received: 6 April 2007
8MC Medical Genetics 2007, 8:59 doi: 10.1 186/1471-2350-8-59 Accepted: 5 September 2007
This article is available from: http://www.biomedcentral.com/1471-2350/8/59
2007 Cavallari et al; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0),
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.



Abstract
Background: The platelet P2Y12 receptor plays a key role in platelet activation. The H2 haplotype
of the P2Y12 receptor gene (P2RYI2) has been found to be associated with maximal aggregation
response to adenosine diphosphate (ADP) and with increased risk for peripheral arterial disease.
No data are available on its association with coronary artery disease (CAD).
Methods : The H2 haplotype of the P2RYI2 was determined in 1378 unrelated patients of both
sexes selected according to the presence of significant coronary artery disease (CAD group) or
having normal coronary angiogram at cardiac catheterization (CAD-free group). Significant
coronary artery disease was angiographically determined, and was defined as a greater than 50%
visually estimated luminal diameter stenosis in at least one major epicardial coronary artery.
Results: In the studied population 71.9% had CAD (n = 991) and 28.1% had normal coronary
angiogram (n = 387). H2 haplotype carriers were more frequent in the CAD group (p = 0.03, OR
= 1.36, 95%CI = 1.02-1.82). The H2 haplotype was significantly associated with CAD in non-
smokers (p = 0.007, OR = 1.83 95%CI = 1.17-2.87), but not in smokers. The association remained
significant after adjustment for other covariates (age, triglycerides, HDL, hypertension, diabetes) by
multivariate logistic regression (p = 0.004, OR = 2.32 95%CI = 1.30-4.15).
Conclusion: Gene sequence variations of the P2Y12 receptor gene are associated with the
presence of significant CAD, particularly in non-smoking individuals.



Background platelet function varies considerably among individuals
Platelets play a key role in the pathophysiology of athero- and subjects with enhanced platelet reactivity have
sclerotic disease and its complications [1,2]. Importantly, increased atherothrombotic risk [3]. The adenosine


Page 1 of 6
(page number not for citation purposes)







http://www.biomedcentral.com/1471-2350/8/59


diphosphate (ADP) P2Y12 receptor plays a central role in
platelet activation [4]. The relevance of this receptor is
demonstrated by the clinical benefit obtained in patients
when it is blocked by the P2Y12 receptor antagonist clopi-
dogrel [5,6]. Recently, Fontana et al. identified two func-
tional haplotypes designated as HI and H2, tagged by 4
single nucleotide polymorphisms (SNPs) in absolute
linkage disequilibrium (i-C139T, i-T744C, i-ins801A,
G52T). Importantly, the minor haplotype (H2) was found
to be associated with enhanced platelet reactivity suggest-
ing a role for gene sequence variations of the P2Y12 recep-
tor in atherothrombotic processes [7]. Notably, the H2
haplotype has also shown to be associated with peripheral
arterial disease [8]. However, its association with coronary
atherosclerotic disease has still been poorly explored. To
investigate whether this H2 haplotype of the P2Y12 recep-
tor gene may be associated with coronary artery disease,
we studied the distribution of the i-T744C SNP in 1378
unrelated patients, selected according to the presence of
significant coronary artery disease (N = 991) or of normal
coronary angiogram at cardiac catheterization (N = 387).

Methods
Study population
A total of 1945 consecutive subjects undergoing cardiac
catheterization at the University Hospital of Verona were
recruited from 1996 to 2005. All subjects were unrelated
and of Italian origin from the same geographic area in
North-Eastern Italy. Further details on the enrolling crite-
ria have been described elsewhere [9,10].

In the present study we used data from 1378 patients, for
whom P2RY12 genotypes were available, selected accord-
ing to the presence of significant coronary artery disease
(CAD group) or having normal coronary angiogram at
cardiac catheterization (CAD-free group). Significant cor-
onary artery disease was angiographically determined
after the first manifestation of symptoms of ischemic
heart disease and was defined as a greater than 50% visu-
ally estimated luminal diameter stenosis in at least one
major epicardial coronary artery. Most of CAD patients
were candidate to coronary artery bypass grafting (CABG).
Since the primary aim of our selection was to provide an
objective and clear-cut definition of the atherosclerotic
phenotype, subjects with non significant coronary steno-
sis (< 50%) were not included in the study. Most of the
patients have not been treated with antiplatelet drugs
before the recruitment. After CABG, 90% of patients have
been treated with aspirin, about 9% with ticlopidina and
1% with indobuphen. No patients had therapy with clopi-
dogrel. Controls (CAD-free group), mainly examined for
valvular heart disease, were enrolled providing that they
had not only a normal coronary angiogram at cardiac
catheterization, but also neither history nor clinical or
instrumental evidence of atherosclerosis in vascular dis-


tricts other than the coronary bed. The angiograms were
assessed by two cardiologists unaware that the patients
were to be included in the study.

All individuals gave a written consent before entering the
study, which was approved by the Ethical Committee of
the University Hospital of Verona.

Genotyping
Individuals were genotyped for the i-T744C SNP (NCBI
refSEQ: rs2046934) of the P2Y12 receptor gene (P2RY12)
in order to tag the Hi(744T) and H2 (744C) haplotypes
[7]. Genomic DNA was prepared from whole blood sam-
ples by standard procedures. Genotyping was performed
with LightCycler 2.0 System (Roche Applied Science,
Mannheim, Germany) by Real-Time PCR assay and anal-
ysis of samples melting curves. Primers and Fluorescence
Resonance Energy Transfer (FRET) probes were designed
using LightCycler Probe Design Software 2.0 (Roche
Applied Science, Mannheim, Germany), as shown in
Table 1.

Genotyping assay consisted of four programs, including
pre-incubation (95C x 10 min), amplification (95C x
10 sec 58C x 10 sec 72C x 12 sec, 40 cycles, ramp:
20C/sec), melting-curve analysis (50 C to 75 C, ramp:
0.2C/sec) and cooling (20C x 10 sec). Primers and
probes concentrations were determined according to
standard protocols. Since the i-T744C SNP of the P2RY12
gene is a component in total linkage disequilibrium with
other 3 SNPs used to tag the H I/H2 haplotype, subjects
carriers of the variant C allele are also referred to as H2
haplotype carriers.

In addition to observing the association of a specific gen-
otype presentation (HI/HI; H1/H2; H2/H2) on CAD,
considering also the low number of H2/H2 subjects, we
compare subjects homozygous for the wild-type allele
with subjects carrying the minor allele, according to a
dominant model. Therefore, patients were considered as
carriers (H /H2 and H2/H2) and non carriers (H /H1) of
the H2 haplotype.

Statistical analysis
All the statistical analyses were performed with the R sta-
tistical package [11]. Our calculations, based on the
marker allele frequency in CEU population derived from
the HapMap Project [121, indicate that our sample size is
adequate to detect a SNP or haplotype with a modest
effect (significance level = 0.05, power = 80%, OR > 1.42).

Distribution of continuous variables in groups was
expressed as mean + standard deviation. Quantitative data
were analysed using Student's t-test. Qualitative data were
analysed with a z2 test. Genotype frequencies of different


Page 2 of 6
(page number not for citation purposes)


BMC Medical Genetics 2007, 8:59








http://www.biomedcentral.com/1471-2350/8/59


Table I: Primers and probes used to genotype the i-T744C
polymorphism of the P2RYI 2 gene

Oligonucleot Sequence
ide

Forward 5'-ATACTGTGACAACATGATTCTTAATCG-3'
primer
Reverse primer 5'-CACAATAGGCAGCTATAATGAAAACT-3'
Sensor probe 5'-
TATCTCTGGTGAAATAAAAAGATTACAAAC
GTCAT-3'Fluorescein
Anchor probe RED-S'-
CAAATTCCCAAGATGTAGATGCCATATAGC
ATATT-3'-Phosphate


subgroups of patients were compared by contingency
tables. Significant difference in genotype distribution
were estimated by z2test. Hardy-Weinberg equilibrium
was tested in patients with and without CAD by X2 test
with Yates' correction for continuity. Risk adjustment was
performed in a multiple forward stepwise logistic regres-
sion analysis. Variables included in this model were age,
sex, body mass index, glucose, total cholesterol, HDL,
LDL, triglycerides, diabetes, smoking habitus, hyperten-
sion status.

Results
All 1378 subjects were successfully genotyped; of these
991 subjects had significant CAD. Demographics of the
study population are described in Table 2. As expected,
cardiovascular risk factors were more frequently found in
subjects with angiographic evidence of significant CAD.

In the overall patient population, the allele and genotype
distribution were as follows: C allele frequency, 12.8%;
H1/HI, 1046 (75.9%); H1/H2, 310 (22.5%); H2/H2, 22
(1.6%). Genotype distribution of the i-T744C polymor-
phism tagging the H1/H2 haplotype in the study popula-
tion in the CAD and CAD-free groups is shown in Table 3.
C allele frequency was 13.47% and 11.24% in CAD and

Table 2: Demographics of the study population in the CAD and
CAD-free groups


CAD = 991 CAD-free = 387


Age (yr)
Males
Body Mass Index (kg/m2)
Glucose (mmol/1)
Total cholesterol (mmol/1)
HDL (mmol/1)
LDL (mmol/1)
Triglycerides (mmol/dl)
Diabetes Mellitus
Hypertension
Current smokers


61.38 9.81
79.8%
26.74 3.54
5.84 1.6
5.56 1.17
1.19 0.31
3.73 0.99
1.92 1.05
20.1%
65.4%
65.6%


58.78 12.3
65%
25.35 3.45
5.51 0.93
5.44 1.1I
1.42 0.42
3.52 0.93
1.48 0.68
7.2%
40.4%
41.1%


p-value

< 0.001
< 0.00 I1
< 0.00 I1
< 0.001
n.s.
< 0.001
<0.01
< 0.001
< 0.001
< 0.00 I1
< 0.001


CAD-free subjects, respectively (p > 0.05). Genotype dis-
tribution was in Hardy-Weinberg equilibrium. A signifi-
cant difference was observed in the distribution of the
three genotypes between the two groups (p = 0.017). Car-
riers of the minor haplotype (H 1/H2 + H2/H2) were more
frequent in patients with significant CAD (p = 0.03, OR =
1.36, 95%CI = 1.02-1.82). Such association was close to
significance in males (p = 0.05), but not in females, even
if in the two subgroups the H2 haplotype carriers tended
to be more frequent among CAD patients (data not
shown). The association remained close to significance
threshold after adjustment for other covariates (age, sex,
BMI, triglycerides, HDL, LDL, hypertension, smoking and
diabetes) by multivariate logistic regression (p = 0.05, OR
= 1.42, 95%CI = 1.18-1.71).

The hypothesis of interaction between the P2RY12 gene
and variables involved in atherosclerotic risk was then
evaluated. Interactions with a p-value < 0.1 were further
evaluated through stratification of the studied population
for the interacting factor. Only smoking met this criterion
(p for interaction = 0.026), consequently genotype distri-
bution of the i-T744C polymorphism of the P2RY12 gene
was evaluated in smokers and non-smokers as shown in
Table 4. Non-smokers carrying the minor haplotype H2
were highly associated with significant CAD (p = 0.007,
OR = 1.83, 95%CI = 1.17-2.87). The association
remained significant after adjustment for other covariates
(age, sex, BMI, triglycerides, HDL, LDL, hypertension and
diabetes) by multiple logistic regression (p = 0.004, OR =
2.32, 95%CI = 1.30-4.15) and after adjustment for multi-
ple tests (p = 0.014). No other significant interaction was
found between the H2 haplotype of the P2RY12 gene and
other variables.

Discussion
The present report is the first to demonstrate an associa-
tion between the minor H2 haplotype of the P2RY12 gene
and presence of significant coronary artery disease. Thus
the finding of the present study further extends our
knowledge on the implications of gene sequence varia-
tions of this receptor, a key player in platelet function, on
atherothrombosis. In fact, to date this polymorphism has
shown to be associated with peripheral arterial disease
[81, while its association with coronary artery disease has
been poorly explored.

One prior report has assessed the association between this
haplotype and long term complications of coronary artery
disease (cardiac death, myocardial infarction and refrac-
tory angina requiring revascularization) but failed to find
any association [131. It may be argued that this study had
a limited statistical power to detect the implications of
this polymorphism given the relatively small sample size


Page 3 of 6
(page number not for citation purposes)


BMC Medical Genetics 2007, 8:59








http://www.biomedcentral.com/1471-2350/8/59


Table 3: Genotype frequency of the i-T744C SNP of the P2RYI 2 gene in patients with and without significant coronary artery disease


CAD


T/T
T/C

C/C
TC+CC


737 (74.37%)
241 (24.32%)

13 (1.31%)
254 (25.63%)


CAD-free

309 (79.84%)
69(17.83%)

9 (2.33%)
78(20.16%)


OR (Cl 95%) p-value*


1.36

1.02-1.82
0.03


*T/C and C/C genotypes (H l/H2 and H2/H2 haplotypes, respectively) are pooled in the CAD and in the CAD-free group for p-value and OR
calculation.


of the study and the different types of patient population
evaluated.

The P2RYI 2 gene is located in the P2 receptor gene cluster
on chromosome 3q24-q25. The mechanisms through
which these gene sequence variations might lead to an
increased atherothrombotic risk are still not well estab-
lished. Fontana et al. showed that the H2 haplotype of the
P2RYI 2 gene is associated with increased platelet function
in non-medicated healthy volunteers [7]. Notably, plate-
let activation plays a leading role in the initiation and
development of atherosclerosis as well as in its complica-
tions. The seminal findings from Fontana et al have led to
the hypothesis that this genetic polymorphism may be
responsible for modulation of individual responsiveness
to antiplatelet agents.

On the other hand, platelet function studies performed by
the same authors as well as other executed in medically
treated patients with clinical manifestations of atheroscle-
rotic disease did not show any modulating effects of this
genetic polymorphism on individual responsiveness to
aspirin or clopidogrel [14-17]. Therefore, despite the key
role of P2RY1 2 receptor on inducing platelet activation, it
is likely that genetic polymorphisms of other targets may
be more important in modulating aspirin and clopidogrel
effects[ 18]. Moreover, Hetherington et al [19] reported no
significant effect of P2RY12 SNPs, including the i-T744C
one, on platelet response to ADP in subjects without his-


tory of CAD, and an association of a common variant in
P2Y1 gene with platelet reactivity.

Atherosclerosis is a multifactorial disease and involves
both environmental and genetic factors. Therefore, the
low penetrance of a single functional polymorphism may
not always lead to a clinical phenotype as this may be
obscured by environmental factors. This may explain why
the H2 haplotype of P2RY12 gene had its strongest associ-
ation with CAD in non-smoking individuals. Notably,
platelets isolated from smokers exhibit increased reactiv-
ity as well as spontaneous aggregation [20]. Moreover,
nicotine upregulates the expression of P2Y12 receptors on
vascular cells and megakaryoblasts, and smokers exhibit
higher P2Y12 expression [21]. Therefore, the presence of
genetic determinants leading to increased platelet func-
tion profiles may be masked by cigarette smoking. Nota-
bly, the association between the H2 haplotype and CAD
in non-smokers remained significant even after adjust-
ment for other covariates (age, sex, BMI, triglycerides,
HDL, LDL, hypertension, smoking and diabetes) by mul-
tivariate logistic regression, suggesting that the P2RY12
gene is an independent risk factor for coronary artery dis-
ease in these subjects.

The complex interplay between genetic and environmen-
tal factors on the development of atherosclerotic disease
explains why large study populations are required to
define if a particular functional polymorphism may have


Table 4: Genotype frequency of the i-T744C SNP of the P2RYI 2 gene according to smoking habit


Smokers (n = 809)


Non-smokers (n = 503)


CAD


490 (75.4%)
150 (23%)

10(1.6%)
160 (24.6%)


CAD-free


121 (76.1%)
35 (22%)

3 (1.9%)
38 (23.9%)


OR (Cl 95%)
p-value *


1.04
(0.69-1.56)
p = 0.85


CAD


221 (72.5%)
81 (26.5%)

3 (1%)
84 (27.5%)


CAD-free


164 (82.8%)
28(14.2%)


OR (Cl 95%)
p-value *


6 (3%) (1.17-2.87)
34 (17.2%) p = 0.007


*T/C and C/C genotypes (H I/H2 and H2/H2 haplotypes, respectively) are pooled in the CAD and in the CAD-free group for p-value and OR
calculation.


Page 4 of 6
(page number not for citation purposes)


T/T
T/C

C/C
TC+CC


BMC Medical Genetics 2007, 8:59








http://www.biomedcentral.com/1471-2350/8/59


effects not only on intermediate phenotypes (i.e. platelet
activation), but also on clinical phenotypes (e.g. athero-
sclerosis). In the present study, as expected, conventional
cardiovascular risk factors were more common in patients
with CAD. However, it was also demonstrated that the H2
haplotype was more frequently present in patients with
CAD. This observation is in keeping with the concept that
in multifactorial diseases, genetic polymorphisms influ-
ence the risk of disease by determining a different individ-
ual susceptibility to environmental risk factors rather than
being the cause of the disease process itself.

The primary end-point of the present work was to investi-
gate the association between CAD and the i-T744C SNP of
the P2RY12 gene through a case-control study in unre-
lated individuals. Certainly the study has some limita-
tions, such as the relatively low number of controls and
no available data on platelet aggregation. On the other
hand, the sample size of our study-population was ade-
quate to detect a mild effect on phenotype by this genetic
variant. A strength of this work was the clear-cut defini-
tion of CAD phenotype on the basis of coronary angiogra-
phy, which is of pivotal importance in the analysis of
genotype-phenotype correlation. Male and female sub-
groups showed H2 haplotype carriers more frequently in
CAD patients, and it is likely that these observation did
not reach the statistical significance due to the small size
of each group after stratification.

Conclusion
This study supports the previously reported association of
P2RY12 gene with atherosclerosis, giving for the first time
genetic association data for the presence of significant cor-
onary artery disease, particularly in non-smoking individ-
uals. Nonetheless, this correlation remains still
controversial [7,19] and further studies, possibly with
prospective design, are needed to confirm these data.

Competing interests
Dominick J. Angiolillo is on the speaker bureau and is a
consultant for Sanofi-Aventis and Bristol Myers Squibb.
The remaining authors report no conflicts.

Authors' contributions
HC conceived of the study, carried out genotyping and
drafted the manuscript. ET designed of the study and par-
ticipated in its coordination and helped to draft the man-
uscript. GM performed the statistical analyses. MB carried
out genotyping. NM helped in the analysis and interpreta-
tion of data. DJA, DG, 00, RC and PFP helped in revising
the manuscript critically for intellectual content. All
authors read and approved the final manuscript.


Acknowledgements
This project was supported by the Italian Ministry of Education, University
and Research, Italian Ministry of Health and Foundation "Cassa di Risparmio
di Verona, Vicenza, Belluno e Ancona".

References
I. Ruggeri ZM: Platelets in Atherothrombosis. Nat Med 2002,
8:1227-1234.
2. Huo Y, Ley KF: Role of platelets in the development of athero-
sclerosis. Trends Cardiovasc Med 2004, 14:18-22.
3. Wang TH, Bhatt DL, Topol EJ: Aspirin and clopidogrel resist-
ance: an emerging clinical entity. Eur HeartJ 2006, 27:647-54.
4. Hollopeter G, Jantzen HM, Vincent D, Li G, England L, Ramakrishnan
V, Yang RB, Nurden P, Nurden A, Julius D, Conley PB: Identification
of the platelet ADP receptor targeted by antithrombotic
drugs. Nature 2001, 409:202-207.
5. Yusuf S, Zhao F, Mehta SR, Chrolavicius S, Tognoni G, Fox KK:
Clopidogrel in unstable angina to prevent recurrent events
trial investigators. Effects of clopidogrel in addition to aspirin
in patients with acute coronary syndromes without ST-seg-
ment elevation. N Englj Med 2001, 345:494-502.
6. CAPRIE Steering Committee: A randomised, blinded trial of
clopidogrel versus aspirin in patients at risk of ischaemic
events (CAPRIE). Lancet 1996, 348:1329-1339.
7. Fontana P, Dupont A, Gandrille S, Bachelot-Loza C, RenyJL, Aiach M,
Gaussem P: Adenosine diphosphate-induced platelet aggrega-
tion is associated with P2YI 2 gene sequence variations in
healthy subjects. Circulation 2003, 108:989-995.
8. Fontana P, Gaussem P, Aiach M, Fiessinger JN, Emmerich J, Reny JL:
P2YI 2 H2 haplotype is associated with peripheral arterial
disease. A case-control study. Circulation 2003, 108:2971-2973.
9. Girelli D, Friso S, Trabetti E, Olivieri 0, Russo C, Pessotto R, Faccini
G, Pignatti PF, Mazzucco A, Corrocher R: Methylenetetrahydro-
folate reductase C677T mutation, plasma homocysteine,
and folate in subjects from northern Italy with or without
angiographically documented severe coronary atheroscle-
rotic disease: evidence for an important genetic-environ-
mental interaction. Blood 1998, 91:4158-4163.
10. Martinelli N, Girelli D, Olivieri 0, Stranieri C, Trabetti E, Pizzolo F,
Friso S, Tenuti I, Cheng S, Grow MA, Pignatti PF, Corrocher R: Inter-
action between smoking and PON2 Ser31 I Cys polymor-
phism as a determinant of the risk of myocardial infarction.
Eurj Clin Invest 2004, 34:14-20.
I I. R Development Core Team R: A language and environment for statistical
computing R Foundation for Statistical Computing, Vienna, Austria;
2006. ISBN 3-900051-07-0
12. The International HapMap Consortium: The International Hap-
Map Project. Nature 2003, 426:789-796.
13. Schettert IT, Pereira AC, Lopes NH, Hueb WA, Krieger JE: Associ-
ation between platelet P2YI 2 haplotype and risk of cardio-
vascular events in chronic coronary disease. Thromb Res 2006,
118:679-683.
14. Angiolillo DJ, Fernandez-Ortiz A, Bernardo E, Ramirez C, Cavallari U,
Trabetti E, Sabate M, Jimenez-Quevedo P, Hernandez R, Moreno R,
Escaned J, Alfonso F, Banuelos C, Costa MA, Bass TA, Pignatti PF,
Macaya C: Lack of association between the P2YI 2 receptor
gene polymorphism and platelet response to clopidogrel in
patients with coronary artery disease. Thromb Res 2005,
I 16:491-497.
15. von Beckerath N, von Beckerath 0, Koch W, Eichinger M, Schomig
A, Kastrati A: P2YI 2 gene H2 haplotype is not associated with
increased adenosine diphosphate-induced platelet aggrega-
tion after initiation of clopidogrel therapy with a high loading
dose. Blood Coagul Fibrinolysis 2005, 16:199-204.
16. Lev El, Patel RT, Guthikonda S, Lopez D, Bray PF, Kleiman NS:
Genetic polymorphisms of the platelet receptors P2Y(I 2),
P2Y(I) and GP Ilia and response to aspirin and clopidogrel.
Thromb Res 2007, I 19:355-60.
17. Smith SM, Judge HM, Peters G, Armstrong M, Fontana P, Gaussem P,
Daly ME, Storey RF: Common sequence variations in the
P2YI 2 and CYP3A5 genes do not explain the variability in
the inhibitory effects of clopidogrel therapy. Platelets 2006,
17:250-8.
18. Angiolillo DJ, Fernandez-Ortiz A, Bernardo E, Ramirez C, Cavallari U,
Trabetti E, Sabate M, Hernandez R, Moreno R, Escaned J, Alfonso F,


Page 5 of 6
(page number not for citation purposes)


BMC Medical Genetics 2007, 8:59








http://www.biomedcentral.com/1471-2350/8/59


Banuelos C, Costa MA, Bass TA, Pignatti PF, Macaya C: Contribu-
tion of gene sequence variations of the hepatic cytochrome
P450 3A4 enzyme to variability in individual responsiveness
to clopidogrel. Arterioscler Thromb Vasc Biol 2006, 26(8): 1895-900.
19. Hetherington SL, Singh RK, Lodwick D, Thompson JR, Goodall AH,
Samani NJ: Dimorphism in the P2YI ADP Receptor Gene is
associated with increased platelet activation response to
ADP. Arterioscler Thromb Vasc Biol 2005, 25:252-257.
20. Ambrose JA, Barua RS: The pathophysiology of cigarette smok-
ing and cardiovascular disease. An update. j Am Coll Cardiol
2004, 43:1731-1737.
21. Shanker G, Kontos JL, Eckman DM, Wesley-Farrington D, Sane DC:
Nicotine upregulates the expression of P2YI2 on vascular
cells and megakaryoblasts. J Thromb Thrombolysis 2006,
22:213-220.

Pre-publication history
The pre-publication history for this paper can be accessed
here:

http://www.biomedcentral.com/1471-2350/8/59/prepub




































Publish with BioMed Central and every
scientist can read your work free of charge
"BioMed Central will be the most significant development for
disseminating the results of biomedical research in our lifetime."
Sir Paul Nurse, Cancer Research UK
Your research papers will be:
available free of charge to the entire biomedical community
peer reviewed and published immediately upon acceptance
cited in PubMed and archived on PubMed Central
yours you keep the copyright
Submit your manuscript here: BioMedcentral
http://www.biomedcentral.com/info/publishingadv.asp


Page 6 of 6
(page number not for citation purposes)


BMC Medical Genetics 2007, 8:59




University of Florida Home Page
© 2004 - 2010 University of Florida George A. Smathers Libraries.
All rights reserved.

Acceptable Use, Copyright, and Disclaimer Statement
Last updated October 10, 2010 - - mvs