Group Title: BMC Clinical Pathology
Title: Preservation of biomolecules in breast cancer tissue by a formalin-free histology system
CITATION PDF VIEWER THUMBNAILS PAGE IMAGE ZOOMABLE
Full Citation
STANDARD VIEW MARC VIEW
Permanent Link: http://ufdc.ufl.edu/UF00099967/00001
 Material Information
Title: Preservation of biomolecules in breast cancer tissue by a formalin-free histology system
Physical Description: Book
Language: English
Creator: Nassiri, Mehdi
Ramos, Sharon
Zohourian, Hajir
Vincek, Vladimir
Morales, Azorides
Nadji, Mehrdad
Publisher: BMC Clinical Pathology
Publication Date: 2008
 Notes
Abstract: BACKGROUND:The potential problems associated with the use of formalin in histology, such as health hazards, degradation of RNA and cross-linking of proteins are well recognized. We describe the utilization of a formalin-free fixation and processing system for tissue detection of two important biopredictors in breast cancer – estrogen receptor and HER2 – at the RNA and protein levels.METHODS:Parallel sections of 62 cases of breast cancer were fixed in an alcohol-based molecular fixative and in formalin. Molecular fixative samples were processed by a novel formalin-free microwave-assisted processing system that preserves DNA, RNA and proteins. Formalin-fixed samples were processed using the conventional method. Estrogen receptor was assessed by immunohistochemistry and real-time PCR. HER2 was assessed by immunohistochemistry, FISH, CISH and real-time PCR.RESULTS:The immunohistochemical reaction for estrogen receptor was similar in molecular- and formalin-fixed samples (Spearman Rank R = 0.83, p < 0.05). Also HER2 result was similar to that of formalin-fixed counterparts after elimination of antigen retrieval step (Spearman Rank R = 0.84, p < 0.05). The result of HER2 amplification by FISH and CISH was identical in the molecular fixative and formalin-fixed samples; although a shorter digestion step was required when using the former fixative. Real-time PCR for both estrogen receptor and HER2 were successful in all of the molecular fixative specimens.CONCLUSION:The formalin-free tissue fixation and processing system is a practical platform for evaluation of biomolecular markers in breast cancer and it allows reliable DNA and RNA and protein studies.
General Note: Start page 1
General Note: M3: 10.1186/1472-6890-8-1
 Record Information
Bibliographic ID: UF00099967
Volume ID: VID00001
Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: Open Access: http://www.biomedcentral.com/info/about/openaccess/
Resource Identifier: issn - 1472-6890
http://www.biomedcentral.com/1472-6890/8/1

Downloads

This item has the following downloads:

PDF ( PDF )


Full Text



BMC Clinical Pathology goll Central


Research article


Preservation of biomolecules in breast cancer tissue by a
formalin-free histology system
Mehdi Nassiri*l, Sharon Ramos', Hajir Zohourian', Vladimir Vincek2,
Azorides R Morales' and Mehrdad Nadji'


Address: 'Department of Pathology, University of Miami Miller School of Medicine, Miami, Florida, USA and 2Department of Pathology,
University of Florida, Gainesville, Florida, USA
Email: Mehdi Nassiri* mnassiri@med.miami.edu; Sharon Ramos sramos@med.miami.edu; Hajir Zohourian hajirbrain@hotmail.com;
Vladimir Vincek vincek26@pathology.ufl.edu; Azorides R Morales amorale@med.miami.edu; Mehrdad Nadji mnadji@aol.com
* Corresponding author



Published: 29 January 2008 Received: 14 March 2007
BMC Clinical Pathology 2008, 8:1 doi: 10.1 186/1472-6890-8-1 Accepted: 29 January 2008
This article is available from: http://www.biomedcentral.com/1472-6890/8/1
2008 Nassiri et al; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0),
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.



Abstract
Background: The potential problems associated with the use of formalin in histology, such as
health hazards, degradation of RNA and cross-linking of proteins are well recognized. We describe
the utilization of a formalin-free fixation and processing system for tissue detection of two
important biopredictors in breast cancer estrogen receptor and HER2 at the RNA and protein
levels.
Methods: Parallel sections of 62 cases of breast cancer were fixed in an alcohol-based molecular
fixative and in formalin. Molecular fixative samples were processed by a novel formalin-free
microwave-assisted processing system that preserves DNA, RNA and proteins. Formalin-fixed
samples were processed using the conventional method. Estrogen receptor was assessed by
immunohistochemistry and real-time PCR. HER2 was assessed by immunohistochemistry, FISH,
CISH and real-time PCR.
Results: The immunohistochemical reaction for estrogen receptor was similar in molecular- and
formalin-fixed samples (Spearman Rank R = 0.83, p < 0.05). Also HER2 result was similar to that
of formalin-fixed counterparts after elimination of antigen retrieval step (Spearman Rank R = 0.84,
p < 0.05). The result of HER2 amplification by FISH and CISH was identical in the molecular fixative
and formalin-fixed samples; although a shorter digestion step was required when using the former
fixative. Real-time PCR for both estrogen receptor and HER2 were successful in all of the
molecular fixative specimens.
Conclusion: The formalin-free tissue fixation and processing system is a practical platform for
evaluation of biomolecular markers in breast cancer and it allows reliable DNA and RNA and
protein studies.



Background However, tissue processed by this system has limited
Formaldehyde-fixed, paraffin-embedded tissue (FFPE) is application beyond routine histology and immunohisto-
the product of a century old histopathology practice [1]. chemistry. For example, most of the current clinical


Page 1 of 10
(page number not for citation purposes)


EOpen Ac







http://www.biomedcentral.com/1472-6890/8/1


molecular tests require fresh tissue. Fresh or fresh-frozen
tissue specimens, on the other hand, are of limited value
for the assessment of histomorphology, and are impracti-
cal for long-term retrospective studies due to their inher-
ent logistical and storage problems [2,3].

It is not surprising, therefore, that alternative formalin-
free tissue handling methodologies have been introduced
in recent years. We have previously reported our experi-
ence with a new, simple and practical, yet standardized,
tissue fixation and processing method that preserves his-
tomorphology and protects macromolecules at ambient
temperature [4-9]. This method is easily applicable to
both clinical and research settings. It includes standard tis-
sue sectioning, fixation by an alcohol-based fixative, and
processing in an automated formalin-free microwave-
based tissue processor. Here we report results from studies
of breast cancer processed with this new molecular-
friendly platform and compare it with conventional tissue
processing.

Methods
Tissue Samples
Paired tissue section of similar dimensions, 1.5 x 1.5 x 0.2
cm were taken from 62 surgically excised breast cancer
specimens and fixed in UMFIX (Universal Molecular Fixa-
tive, marketed as Tissue-Tek Xpress"M Molecular Fixative,
Sakura Finetek, Torrance, CA) and 10% neutral buffered
formalin. Molecular fixative is composed of methanol
and polyethylene glycol at predetermined ratio (US patent
# 7,138,226). All samples were immersed in fixative
within 30 minutes of surgery. Immersion time was similar
for both fixatives for each specimen (less than 24 hours
for 32 cases, 24-48 hours for 18 cases, 48-72 hours for 12
cases). Formalin-fixed samples were then processed using
a conventional method (VIP, Sakura Finetek, Torrance,
CA). Samples fixed in molecular fixative were processed
by a recently described automated microwave-based rapid
tissue-processing instrument (Tissue-Tek Xpress", Sakura
Finetek, Torrance, CA). H&E-stained slides were reviewed
to confirm the presence of tumor and the non-neoplastic
mammary epithelium. All studies were approved by the
University of Miami Institutional Review Board.

Immunohistochemistry
Three-micron sections mounted on charged slides were
stained for estrogen receptor (ER) using the ER pharmDx
Kit" (Dako, Carpinteria, CA) following the kit's protocol.
Adjacent sections of each case were also stained with a
monoclonal antibody to ER (clone 1D5) following a pre-
viously published protocol [10] that includes an antigen
retrieval step and L-SAB detection system (Dako). The
number of positive nuclei and the intensity of reactions
were evaluated and graded in tumor cells according to the
respective protocols. When present, the reaction in adja-


cent non-neoplastic mammary epithelium served as the
internal control. The intensity and pattern of reactions
were compared in tissue samples fixed by the two meth-
ods.

The HercepTest kit (Dako, Carpinteria, CA) was used for
HER2 immunohistochemistry. The kit's protocol was
strictly followed to for both types of samples. In addition,
one section from the UMFIX-exposed tumors was stained
without the antigen retrieval step. The HER2 reactions
were scored according to ASCO/CAP recommendations
[ 11 ]. A positive result for HER2 was considered when IHC
staining of 3+ (uniform, intense membrane staining of
>30% of invasive tumor cells) was present.

HER2-FISH and HER2-CISH
Chromogenic in situ hybridization for HER2 gene ampli-
fication was performed using Zymed (South San Fran-
cisco, CA) probe and reagents. For HER2-FISH, reagents
and probes were from Dako. A duplicate slide of all
UMFIX tumors was used to repeat FISH and CISH proce-
dures with reduced enzyme digestion times (from 25 min-
utes to 7 minutes for FISH and from 20 to 5 minutes for
CISH). The reduction in enzyme digestion time was nec-
essary to prevent the overdigestion of UMFIX tissue sec-
tions resulting in their loss during the wash steps. The
interpretation of results and scoring was carried out fol-
lowing the manufacturers' guidelines. A fluorescent in situ
hybridization (FISH) ratio (HER2 gene signals to chromo-
some 17 signals) of more than 2.2 was considered positive
or amplified; a FISH ratio of less than 1.8 was considered
negative or not amplified.

To evaluate the IHC and CISH staining, random selections
of slides were evaluated simultaneously on a multi-
headed microscope by three pathologists and a consensus
score was reported for each slide. FISH slides were scored
by one pathologist. All slides had been stripped of any
identifier referring to fixation or processing method.

RNA and DNA Studies
RNA was extracted from 50-micron thick sections of the
paraffin-embedded tissue. Extraction was performed by
addition of Trizol reagent (Invitrogen, Carlsbad, CA) and
subsequent homogenization using a Tissue Tearor
(Biospec Products Inc., Bartlesville, OK). The RNA from
homogenized tissue was extracted using aqueous phase
separation by chloroform followed by isopropyl precipi-
tation on ice. The RNA pellet was further purified on Qia-
gen (Valencia, CA) RNAeasy column and treated with
DNase. A standard 1% agarose gel under denaturing con-
ditions with ethidium bromide was used to assess the
integrity of RNA. In addition, RNA was evaluated on an
Agilent Technologies Bioanalyzer 2100 using RNA 6000
Nano Chips (Lindenhurst, NY) to determine the RNA


Page 2 of 10
(page number not for citation purposes)


BMC Clinical Pathology 2008, 8:1







http://www.biomedcentral.com/1472-6890/8/1


integrity and the ratio of ribosomal RNA. Quantitation
was performed with ND-1000 Spectrophotometer (Nano-
Drop Technologies Wilmington, DE).

DNA was isolated from the organic phase of the Trizol tis-
sue homogenate using Gentra (Minneapolis, MN) Pure-
gene Kit and treated with RNase. The quantity of the
extracted RNA and DNA was determined by spectropho-
tometery (NanoDrop Technologies Wilmington, DE)).
Two micrograms of cleaned RNA was reverse transcribed
to cDNA using Invitrogen (Carlsbad, CA) Cloned AMV
cDNA synthesis kit and random hexamers.

PCR was performed using primers for estrogen receptor
(ESR1 transcript ENST00000206249, 114 bp spanning
exons 3 and 4, Sense 5'-GTGGGATACGAAAAGAC-
CGAAGA, Antisense 5'-GGTTGGCAGCTCTCATGTCTC)
and HER2 (ERBB2 transcript ENST00000269571, 113 bp
spanning exons 2 and 3, sense 5'-GGGAAACCTGGAACT-
CACCTAC, Antisense 5'-GGACCTGCCTCACITGGTTG).
For real-time PCR 0.5 jig of cDNA or RNase-treated DNA
was used as the template, utilizing Qiagen Quantitect
Sybrgreen Mastermix on a Bio-Rad I-cycler (Hercules, CA).
Serial dilutions of a known quantity of template for each
gene were used to measure the copy numbers. To create
the standard dilution series templates, ER and HER2
amplicons were cloned from pooled samples of known
ER- and HER2-positive breast cancer samples using Invit-
rogen TOPO TA cloning kit. Only copy numbers above
"1" were considered reliable values for further data analy-
sis. Real-time PCR of Cyclophilin A (PPIA,
ENST00000244636, Biosource Camarillo, CA) and 7SL
RNA (RN7SL1, NR_002715.1 GI:84871994, sense
ACCACCAGGTTGCCTAAGGA, Antisense 5'-CACG-
GGAGTITTGACCTGCT) was performed as control. Con-
ditions for all real-time PCR reactions were an initial Taq
activation at 95 C for 20 minutes followed by 40 cycles at
95 oC for 15 seconds, and 60 C for 1 minute.

Twenty samples were studied using 3-actin
(ENST00000331789) primers to amplify transcripts rang-
ing from 131 to 705 bp as described before [12] with fol-
lowing primer sets: sense 5'-
CCACACTGTGCCCATCTACG, antisense-1 131 bp CCGT-
GGTGGTGAAGCTGTAG, antisense-2 291 bp CAGCG-
GAACCGCTCATTGCCAATGG, antisense-3 402 bp
TACAGGTCTITGCGGATGTCCA, antisense-4 502 bp
GATCTTCATTGTGCTGGGTGCC, antisense-5 601 bp
CTGCTTGCTGATCCACATCTG, antisense-6 705 bp
CTGCGCAAGTTAGGTITTGTC. Amplified products were
run on an Agilent Technologies Bioanalyzer 2100 using
DNA 1000 LabChip kit (Lindenhurst, NY). PCR was per-
formed for a 450 bp fragment of Glyceraldehyde-3-phos-
phate dehydrogenase DNA (GAPDH,
ENSG00000111640) with commercial primers from


Clonetech (Palo Alto, CA) using 0.5 jig of RNase-treated
isolated DNA and Qiagen TaqPCR Mastermix (Qiagen,
Valencia, CA). The conditions for DNA PCR were: 95 C,
15 minutes; 35 cycles at 94C, 45 seconds; 60C, 45 sec-
onds; 720 C, 2 minutes.

Samples were stripped of any identifier referring to fixa-
tion or processing method during all experimental steps.
Statistical analysis was performed with the aid of Statistica
software (StatSoft, Tulsa, OK).

Results
The presence of invasive mammary carcinoma was con-
firmed on H & E slides of all 62 samples. In 58 cases there
was normal and/or hyperplasic breast epithelium present
adjacent to tumor.

Overall 42 (68%) of formalin- and UMFIX-exposed paraf-
fin-embedded (UFPE) tumors were positive for ER. The
ER reaction was diffuse in distribution and uniform in
intensity in more than 90% of the nuclei of all positive
tumors (Figures 1). Conversely, in adjacent benign epithe-
lia, strongly positive, weakly positive and negative nuclei
were randomly distributed. The number and the intensity
of positive nuclei were similar in ER-pharmDX kit- and
ER-1D5-stained tumors (Spearman Rank R = 0.88 p <
0.05). Similarly, the ER reaction in tumor cells and in
non-neoplastic epithelium in formalin-fixed tissue and
molecular fixative-exposed specimens was exactly the
same when a dichotomized score (positive/negative) was
used. Using a 0-3+ score scheme there was a good correla-
tion between UFPE and FFPE samples (Spearman Rank R
= 0.83 p < 0.05) and there was no significant difference
(Wilcoxon matched pair test). There were no false-nega-
tive results (Figure 2A).

The overall staining intensity of HercepTest in UMFIX
breast cancers was greater than formalin-fixed tumors.
When the antigen retrieval step for UMFIX samples was
omitted, however, the scoring of HercepTest in UMFIX
and formalin samples became similar (Spearman Rank R
= 0.84 p < 0.05, Wilcoxon test p = not significant).

Regarding the predictive potential of ER and HER2 immu-
nohistochemistry, no case was misclassified in UFPE tis-
sue (ER positive, HER2 positive or 3+). All ER positive
cases in FFPE samples were also positive in UFPE tissue.
Although more case were HER2 positive (HER2 3+) in
UFPE tissue, these cases also showed amplification by
FISH. Furthermore, in UFPE samples only two cases were
considered indeterminate for HER2 by immunohisto-
chemistry (HER2 score of 2+) compared to seven FFPE
samples (Figure 2B). We have not evaluated the suitability
of HercepTest performed on tissues fixed in molecular fix-
ative for predicting response to Herceptin. There were no


Page 3 of 10
(page number not for citation purposes)


BMC Clinical Pathology 2008, 8:1







http://www.biomedcentral.com/1472-6890/8/1


A B


Figure I
Representative histology (A) and immunohistochemistry for ER (B) and HER2 (40x) (C), and chromogenic (60x) (D) and fluo-
rescent (E) in situ hybridization for HER2 (100x). (Top = UMFIX, Bottom = Formalin).


discrepancies of HER2-FISH and HER2-CISH results
between UMFIX and formalin samples. There were no
equivocal cases by FISH in our series (HER2/Chromo-
some 17 ratio of 1.8-2.2).

While the DNA yield was similar in formalin and UMFIX
samples (Figure 3A), the RNA yield was significantly
higher in the latter (p < 0.05 t-test, Figure 3B). Using the
same amount of RNA template (2 gg), the cDNA yield was
similar between two groups. Real-time PCR for HER2- and
ER-RNA showed at least a ten fold difference in transcript
copy number between UMFIX and formalin samples (Fig-
ure 4). Two control transcripts, PPIA and RN7sL had dif-
ferent dynamic ranges. PPIA was, on average, twofold
higher in UMFIX samples. However, RN7SL1 copies were
50 times higher in UMFIX samples. These results indicate
greater reverse-transcription efficiency and amplification
in the UMFIX samples.

Larger size amplicons could be reliably amplified in
UMFIX samples but not from formalin-fixed tissues. For
example, a 450-bp segment of GAPDH DNA could be eas-
ily detected in all UMFIX samples whereas it was rarely
amplified from formalin-fixed tissue (Figure 5). We stud-
ied twenty samples with PCR for 3-actin to evaluate the


length of a transcript that can be amplified. Only products
up to 291 bp could be seen in formalin fixed samples. In
contrast, all UMFIX samples showed the 705 bp product
(Figure 6).

Discussion
The current formalin-based methods of fixation and
processing of tissue for histopathological evaluation
hinder the reliable analysis of macromolecules. For exam-
ple, of many available ER antibodies, only a few reliably
react with formalin-fixed paraffin-embedded tissue anti-
gens [101. However, several other antibodies cannot be
optimized for use in formalin fixed tissue as the cross-
linking of the target protein leads to masking of the anti-
genic sites [13-151. Similarly, DNA and RNA are not well
preserved when formalin is used as a fixative. It has been
shown that formaldehyde fixation results in nucleic acid
fragmentation [161. Thus nucleic acid studies conducted
on conventionally processed tissue have been limited to
amplification of small size amplicons. Nucleic acid seg-
ments larger than 200-bp cannot be reproducibly ampli-
fied from formalin-fixed material [171. Formalin fixation
also introduces conformational and chemical changes in
DNA that lead to infidelity of DNA replication by
polymerases. Chemical modification of RNA by formalin


Page 4 of 10
(page number not for citation purposes)


BMC Clinical Pathology 2008, 8:1








BMC Clinical Pathology 2008, 8:1


http://www.biomedcentral.com/1472-6890/8/1


A. ER B. HER2


ER IHC UFPE ER IHC FFPE HER2 FISH HER2 IHC UFPE HER2 IHC FFPE
0 0 0 0
0 0 0 0
0 0 0 0
0 0 0 0
0 0 0 0
0 0 0 0
0 0 0 0
0 0 0 0
0 0 0 0
0 0 0 0
0 0 0 0
0 0 0 0
0 0 0 0
0 0 0 0
0 0 0 0
0 0 0 0
0 0 0 0
0 0 0 0
0 0 0 0
0 0 0 0
1 1 0 0
2 1 0 0
1 2 0 0
1 2 0 0
2 2 0 0
2 2 0 0
2 2 0 0
2 2 0 0
2 2 0 0
2 2 0 0
2 2 0 0
2 2 0 0
2 0 0
2 0 0
2 0 0
2 0 0
2 0 0
2 0 0
2 0 0
2 0 0
2 Not Amp 1 0
2 Not Amp 1 0
2 Not Amp 0 1
2 Not Amp 0 1



Not Amp 0 2
Not Amp 1 2
Not Amp 2 2
2 2












Figure 2
Heat map depiction of immunohistochemistry consensus score for ER (A) and HER2 (B) for UFPE and FFPE samples. Data
were sorted based on FFPE score results. Category (top) describes the result of ER IHC (0-3+), FISH for both UMFIX and For-
malin samples (Not Amp: not amplified, Amp: amplified), HER 2 IHC (0-3+). HER2 FISH result were the same in UFPE and
FFPE sections, results only are shown for HER2 IHC I-3+ cases. Each row represents one case.





Page 5 of 10
(page number not for citation purposes)









http://www.biomedcentral.com/1472-6890/8/1


A. DNA


0 2000 4000


6000 8000 10000 12000 14000 16000 18000 20000
UFPE (ng)


Figure 3
Scatter plot of the yield (in nanogram) of DNA (A) and RNA (B) from 50 micron thick sections of UFPE and FFPE breast can-
cer.





Page 6 of 10
(page number not for citation purposes)


B.


18000


0







-00 0


BMC Clinical Pathology 2008, 8:1


10000

9000

8000

7000

6000

5000

4000

3000,

2000 o-----





0
0 1000 2000 3000 4000 5000 6000 7000 8000 9000 10000
UFPE (ng)



RNA

















A. ER


B. HER2
















C. PPIA
















D. RN7SL1


http://www.biomedcentral.com/1472-6890/8/1


0
0 00
0
S0 00


1 0 00 0 0











0
u Pe -py .m












0 0
0 >




0








0 ____ o^000 %



0










0


0 0 0 0^
0-- O^ ^-


Figure 4
Scatter plot (logarithmic scale) of transcript copy number data for ER (A), HER2 (B), Cyclophilin A (PPIA) (C) and RN7SLI (D).





Page 7 of 10
(page number not for citation purposes)


BMC Clinical Pathology 2008, 8:1








http://www.biomedcentral.com/1472-6890/8/1


Figure 5
Agilent DNA 1000 chip result of 450-base pair GAPDH DNA PCR product in five paired breast cancer samples. L = ladder,
numbers in base-pairs, U = UFPE, F = FFPE, POS = positive control NEG = no template.


seriously compromises the reliability of amplification
methods [18,19].

Development of quantitative molecular assays using FFPE
tissue has been difficult. Beside inherent problems in cre-
ating standards in tissue-based assays, formalin-fixed tis-
sues require different methodological approaches
compared to fresh samples. For example, Specht et al stud-


ied FFPE samples and fresh tissue after microdissection
and compared different extraction RNA methods [20].
They show, by modification of digestion, extraction and
amplification methods it is possible to achieve results
similar to fresh samples. Also Gjerdrum et al describe use
of microdissected tumor cells from FFPE breast cancer tis-
sue for HER2-RNA and DNA study with success rate of
97% for DNA and 94% for RNA. However they used gene-


Figure 6
Representative result of PCR for P-actin RNA from a paired set of UFPE and FFPE breast cancer tissue. PCR products analyzed
using Agilent DNA 1000 chip. L = ladder, numbers in base-pairs, Lane 1-6 = UFPE, 7-12 = FFPE, I and 7 = 705 bp, 2 and 8 =
601 bp, 3 and 9 = 502 bp, 4 and 10 = 402 bp, 5 and I I =291 bp, 6 and 12= 131 bp.




Page 8 of 10
(page number not for citation purposes)


BMC Clinical Pathology 2008, 8:1


L 1U 11' 2U 2F 3U 3F 4U 4F 5U 5F POS NEG

000
850
700

buu
400

300


200

150
too
50
.........................







http://www.biomedcentral.com/1472-6890/8/1


specific antisense primers during the reverse transcription
phase rather than random hexamers, and amplified very
short sequences of 72 base-pairs for HER2. Despite their
promising result these authors suggest that HER2 gene
expression data from FFPE tissue studies should be used
with caution, especially in the clinical setting [21]. This
may be due to significant differences in the replicate
results of mRNA levels within individual patients. They
attribute this irreproducibility to both tumor heterogene-
ity and technical inaccuracies. Therefore, despite progress
in the technical aspects of studying FFPE samples, they
have not yet gained widespread acceptance due to the lack
of reproducibility.

There have been many attempts in recent years to intro-
duce alternative methods of tissue fixation and processing
[22-24]. Most have impractical aspects for routine labora-
tory use; e.g. the requirement for fixation and/or process-
ing at or below -4 C, or the lack of potential for high
throughput automation. With few exceptions, these meth-
ods and reagents have not been evaluated or validated for
molecular studies [25,26].

We recently developed a continuous flow, high through-
put formalin-free tissue processing system (CRTP) and
UMFIX, an alcohol-based molecular-friendly fixative. Par-
affin blocks of tissues fixed and processed by this system
yield high quality histomorphology along with preserva-
tion of intact high molecular weight nucleic acids and pro-
teins in the paraffin-embedded blocks [7,8].

The current study demonstrates that this platform is not
only reliable for immunohistochemistry of ER and HER2
in breast cancer, but also for DNA and RNA studies. We
used the same methods for extraction of DNA and RNA
from fresh tissue for UMFIX/CRTP samples and were able
to amplify large amplicons in all of them. Furthermore,
application of the new methods required less time com-
pared to formalin-fixed material. While conventional for-
malin-fixed, overnight processed tissue samples have a
considerable failure and reproducibility issues for DNA or
RNA studies, we have yet to encounter a single specimen
prepared with our method that its nucleic acids could not
be used for downstream applications. Better preservation
of DNA and RNA was evident in our samples by greater
amplification efficiency. Immunohistochemical studies
require many technical optimization steps. An often
neglected pre-analytical step is the tissue fixation part,
which includes time to fixation, fixative, and duration of
fixation. Lack of strict criteria in tissue handling steps has
direct effect on therapeutic decisions that are being made
based on tissue markers expression [10,27]. Recent
ASCO/CAP recommendation has addressed some of these
steps [12]. For example, therapeutic decision is based on
HER2 3+ positive results by IHC or evidence of amplifica-


tion by FISH. Since performance of FISH as a primary test
is prohibitively expensive, many institutions use a two-tier
system of performing IHC as the first step and FISH as the
second step. Cases with Her2-IHC score of 2+ are consid-
ered equivocal and are not treatment-candidate. These
cases need to be confirmed by FISH and must show ampli-
fication in order to receive Herceptin. In our study, 7 for-
malin-fixed samples had 2+ IHC score; three of these cases
had 3+ score in parallel UMFIX section (all showed ampli-
fication by FISH) and two had 2+ score (one with ampli-
fication by FISH, Figure 2B). Therefore UFPE samples had
lower number of equivocal HER2 IHC score compared to
FFPE samples. Since all of the 3+ IHC positive UFPE cases
were also positive by FISH, there was no false positive
result that might affect therapeutic decision based on
HER2 IHC score of UFPE tissue. On the other hand, fewer
cases with equivocal IHC scores in UFPE blocks means
decrease in laboratory workload to perform FISH studies
to validate these results. This might decrease the financial
burden of performing more expensive FISH assay to con-
firm the equivocal IHC results. Clinical application of
HercepTest performed on tissues fixed in molecular fixa-
tive need to be further studied in a larger series of cases
and correlated with the response to Herceptin. However,
this method seems to be associated with fewer fixative-
related artifacts. With the new methods, the pre-analytical
quality of tissue samples are assured and standardized
before they are used for expensive molecular testing an
important consideration given the growing importance of
assaying archival specimens for the suitability of new ther-
apy. The current lack of standards in tissue handling, as
well as complex chemical reactions that take place during
routine formalin-based tissue processing, make it unlikely
that the final product can serve as a reliable source for
quantitative molecular diagnostics.

Conclusion
Medical practice is increasingly dependent upon accurate
molecular diagnostics. The present study shows that it is
feasible to simultaneously evaluate histomorphology and
perform reliable molecular studies on fixed and processed
human breast cancer tissue. The DNA, RNA, and protein
epitopes are all preserved, intact in paraffin-embedded
UMFIX/CRTP tissue, enabling current, routine, and
future, as yet to be imagined molecular studies.

Abbreviations
bp = base pair, IHC = immunohistochemistry, UFPE =
UMFIX-exposed paraffin embedded, FFPE = Formalin-
fixed paraffin embedded

Competing interests
The authors have been granted one (M Nassiri, V Vincek,
M Nadji) or more (AR Morales) patents for their inven-
tions in histology. The University of Miami licensed these


Page 9 of 10
(page number not for citation purposes)


BMC Clinical Pathology 2008, 8:1








http://www.biomedcentral.com/1472-6890/8/1


inventions which are the basis of UMFIX fixative (Tissue-
Tek Xpress"M Molecular Fixative), and Tissue-Tek XpressTM
tissue processor to Sakura Finetek, Inc. The authors have
received royalties and research support from Sakura Fine-
tek.


Authors' contributions
This study was planned by MNassiri, MNadji, VV and
ARM. Samples were collected and evaluated by MNassiri,
MNadji and ARM. Experiments were performed by MNas-
siri, HZ and SR. MNassiri analyzed the data. Manuscript
was prepared by MNassiri and MNadji. All authors have
read and approved the final version of the manuscript.
The authors are grateful to Dr Christian Wunsch for his
comments and criticism.


References
I. Eltoum I, Fredenburgh Fredenburgh J, Myers RB, Grizzle WE: Introduction to
the theory and practice of fixation of tion of tissues. Histotech 2001,
24:173-190.
2. Emmert-Buck MR, Strausberg RL, Krizman DB, Bonaldo MF, Bonner
RF, Bostwick DG, Brown MR, Buetow KH, Chuaqui RF, Cole KA,
Duray PH, Englert CR, Gillespie JW, Greenhut S, Grouse L, Hillier
LW, Katz KS, Klausner RD, Kuznetzov V, Lash AE, Lennon G, Linehan
WM, Liotta LA, Marra MA, Munson PJ, Ornstein DK, Prabhu VVW,
Prang C, Schuler GD, Soares MB, Tolstoshev CM, Vocke CD, Water-
ston RH: Molecular profiling of clinical tissues specimens: fea-
sibility and applications. j Mol Diagn 2000, 2:60-6.
3. Nassiri M, Nadji M: Tissue detection of biomolecular predic-
tors in breast cancer. Expert Rev Anticancer Ther 2006, 6:1225-32.
4. Cleary TJ, Morales AR, Nadji M, Nassiri M, Vincek V: Antimicrobial
activity of UMFix tissue fixative. j Clin Patho1 2005, 58:22-5.
5. Morales AR, Essenfeld H, Essenfeld E, Duboue MC, Vincek V, Nadji
M: Continuous specimen-flow, high-throughput, I-hour tis-
sue processing: a system for rapid diagnostic tissue prepara-
tion. Arch Pathol Lab Med 2002, 126:583-590.
6. Morales AR, Nassiri M, Kanhoush R, Vincek V, Nadji M: Experience
with an automated microwave-assisted rapid tissue process-
ing method validation of histologic quality and impact on the
timeliness of diagnostic surgical pathology. Am j Clin Pathol
2004, 121:528-36.
7. Nadji M, Nassiri M, Vincek V, Kanhoush R, Morales AR: Immunohis-
tochemistry of tissue prepared by a molecular-friendly fixa-
tion and processing system. Apple Immunohistochem Mol Morphol
2005, 13:277-82.
8. Vincek V, Nassiri M,Nassiri M, Nadji M, Morales AR: A tissue fixative that
protects macromolecules (DNA, RNA, and protein) and his-
tomorphology in clinical samples. Lab Invest 2003, 83:1-9.
9. Nassiri M, Gugic D, Olczyk J, Ramos S, Vincek V: Preservation of
Skin DNA for Oligonucleotide Array CGH Studies, A Feasi-
bility Study. Arch Dermatol Res 2007, 299:353-7.
10. Nadji M, Gomez-Fernandez C, Ganjei-Azar P, Morales AR: Immuno-
histochemistry of estrogen and progesterone receptors
reconsidered: experience with 5,993 breast cancers. AmJ Clin
Pathol 2005, 123:21-7.
II. Chen J, Byrne GEJr, Lossos IS: Optimization of RNA extraction
from formalin-fixed, paraffin-embedded lymphoid tissues.
Diagn Mol Patho1 2007, 16:61-72.
12. WolffAC, Hammond ME, Schwartz JN, Hagerty KL, AIIred DC, Cote
RJ, Dowsett M, Fitzgibbons PL, Hanna WM, Langer A, McShane LM,
Paik S, Pegram MD, Perez EA, Press MF, Rhodes A, Sturgeon C, Taube
SE, Tubbs R, Vance GH, van de Vijver M, Wheeler TM, Hayes DF,
American Society of Clinical Oncology; College of American Patholo-
gists: American Society of Clinical Oncology/College of
American Pathologists guideline recommendations for
human epidermal growth factor receptor 2 testing in breast
cancer. Arch Pathol Lab Med 2007, 131:18-43.
13. Nadji M, Morales AR: Immunoperoxidase: Part I. Technique
and its pitfalls. Lab Med 1983, 14:767-771.


14. Puchtler H, Meloan SN: On the chemistry of formaldehyde fix-
ation and its effects on immunological reactions. Histochem
1985, 82:201-204.
15. Werner M, Chott A, Fabiano A, Battifora H: Effect of formalin fix-
ation and processing on immunohistochemistry. Am ] Surg
Pathol 2000, 24:1016-1019.
16. Feldman NY: Reaction of nucleic acids and nucleoproteins
with formaldehyde. Prog Nucleic Acid Res Mot Biol 1973, I 3:1-49.
17. Lehmann U, Kreipe H: Real-time PCR analysis of DNA and
RNA extracted from formalin-fixed and paraffin-embedded
biopsies. Methods 2001, 25:409-418.
18. Masuda N, Ohnishi T, Kawamoto S, Monden M, Okubo K: Analysis
of chemical modification of RNA from formalin-fixed sam-
ples and optimization of molecular biology application for
such samples. Nuc Acids Res 1999, 27:4436-4443.
19. Rait VK, Zhang Q, Fabris D, Mason JT, O'Leary TJ: Conversions of
formaldehyde-modified 2-Deoxyadenosine 5'-Monophos-
phate in conditions modeling formalin-fixed tissue dehydra-
tion. j Histochem Cytochem 2005, 54:301-10.
20. Specht K, Richter T, Muller U, Walch A, Werner M, Hofler H: Quan-
titative gene expression analysis in microdissected archival
formalin-fixed and paraffin-embedded tumor tissue. Am j
Pathol2001, 158:419-428.
21. Gjerdrum LM, Sorensen BS, Kjeldsen E, Sorensen FB, Nexo E, Ham-
ilton-Dutoit S: Real-time quantitative PCR of microdissected
paraffin-embedded breast carcinoma: an alternative method
for HER-2/neu analysis. j Mol Diag 2004, 6:42-51.
22. Gillespie JW, Best CJ, Bichsel VE, Cole KA, Greenhut SF, Hewitt SM,
Ahram M, Gathright YB, Merino MJ, Strausberg RL, Epstein JI, Hamil-
ton SR, Gannot G, Baibakova GV, Calvert VS, Flaig MJ, Chuaqui RF,
Herring JC, PfeiferJ, Petricoin EF, Linehan WM, Duray PH, Bova GS,
Emmert-Buck MR: Evaluation of non-formalin tissue fixation
for molecular profiling studies. Am Patho1 2002, 160:449-57.
23. Shibutani M, Uneyama C, Miyazaki K, Toyoda K, Hirose M: Meth-
acarn fixation: a novel tool for analysis of gene expressions in
paraffin-embedded tissue specimens. Lab Invest 2000,
80:199-208.
24. Warmington AR, Wilkinson JM, Riley CB: Evaluation of ethanol-
based fixatives as a substitute in a diagnostic clinical labora-
tories. j Histotechno1 2000, 23:299-308.
25. Delfour C, Roger P, Bret C, Berthe ML, Rochaix P, Kalfa N, Raynaud
P, Bibeau F, Maudelonde T, Boulle N: RCL2, a new fixative, pre-
serves morphology and nucleic acid integrity in paraffin-
embedded breast carcinoma and microdissected breast
tumor cells. j Mol Diag 2006, 8:157-169.
26. Uneyama C, Shibutani M, Masutomi N, Takagi H, Hirose M: Meth-
acarn fixation for genomic DNA analysis in microdissected,
paraffin-embedded tissue specimen. j Histochem Cytochem 2002,
52:903-913.
27. Rhodes A, Jasani B, Anderson E, Dodson AR, Balaton AJ: Evaluation
of HER-2/neu immunohistochemical assay sensitivity and
scoring on formalin-fixed and paraffin-processed cell lines
and breast tumors: a comparative study involving results
from laboratories in 21 countries. Am j Clin Pathol 2002,
118:408-17.

Pre-publication history
The pre-publication history for this paper can be accessed
here:

http://www.biomedcentral.com/1472-6890/8/1/prepub


Page 10 of 10
(page number not for citation purposes)


BMC Clinical Pathology 2008, 8:1




University of Florida Home Page
© 2004 - 2010 University of Florida George A. Smathers Libraries.
All rights reserved.

Acceptable Use, Copyright, and Disclaimer Statement
Last updated October 10, 2010 - - mvs