Group Title: BMC Genomics
Title: Gene expression responses in male fathead minnows exposed to binary mixtures of an estrogen and antiestrogen
CITATION PDF VIEWER THUMBNAILS PAGE IMAGE ZOOMABLE
Full Citation
STANDARD VIEW MARC VIEW
Permanent Link: http://ufdc.ufl.edu/UF00099910/00001
 Material Information
Title: Gene expression responses in male fathead minnows exposed to binary mixtures of an estrogen and antiestrogen
Physical Description: Book
Language: English
Creator: Garcia-Reyero, Nat
Kroll, Kevin
Liu, Li
Orlando, Edward
Watanabe, Karen
Sepulveda, Maria
Villeneuve, Daniel
Perkins, Edward
Ankley, Gerald
Denslow, Nancy
Publisher: BMC Genomics
Publication Date: 2009
 Notes
Abstract: BACKGROUND:Aquatic organisms are continuously exposed to complex mixtures of chemicals, many of which can interfere with their endocrine system, resulting in impaired reproduction, development or survival, among others. In order to analyze the effects and mechanisms of action of estrogen/anti-estrogen mixtures, we exposed male fathead minnows (Pimephales promelas) for 48 hours via the water to 2, 5, 10, and 50 ng 17a-ethinylestradiol (EE2)/L, 100 ng ZM 189,154/L (a potent antiestrogen known to block activity of estrogen receptors) or mixtures of 5 or 50 ng EE2/L with 100 ng ZM 189,154/L. We analyzed gene expression changes in the gonad, as well as hormone and vitellogenin plasma levels.RESULTS:Steroidogenesis was down-regulated by EE2 as reflected by the reduced plasma levels of testosterone in the exposed fish and down-regulation of genes in the steroidogenic pathway. Microarray analysis of testis of fathead minnows treated with 5 ng EE2/L or with the mixture of 5 ng EE2/L and 100 ng ZM 189,154/L indicated that some of the genes whose expression was changed by EE2 were blocked by ZM 189,154, while others were either not blocked or enhanced by the mixture, generating two distinct expression patterns. Gene ontology and pathway analysis programs were used to determine categories of genes for each expression pattern.CONCLUSION:Our results suggest that response to estrogens occurs via multiple mechanisms, including canonical binding to soluble estrogen receptors, membrane estrogen receptors, and other mechanisms that are not blocked by pure antiestrogens.
General Note: Periodical Abbreviation:BMC Genomics
General Note: Start page308
General Note: M3: 10.1186/1471-2164-10-308
 Record Information
Bibliographic ID: UF00099910
Volume ID: VID00001
Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: Open Access: http://www.biomedcentral.com/info/about/openaccess/
Resource Identifier: issn - 1471-2164
http://www.biomedcentral.com/1471-2164/10/308

Downloads

This item has the following downloads:

PDF ( PDF )


Full Text




BMC Genomics Central



Research article

Gene expression responses in male fathead minnows exposed to
binary mixtures of an estrogen and antiestrogen
Natalia Garcia-Reyero1,8, Kevin J Kroll', Li Liu2, Edward F Orlando3,
Karen H Watanabe4, Maria S Septilveda5, Daniel L Villeneuve6,
Edward J Perkins7, Gerald T Ankley6 and Nancy D Denslow* I


Address: 'Department of Physiological Sciences and Center for Environmental and Human Toxicology, University of Florida, Gainesville, FL
32611, USA, 2ICBR, University of Florida, Gainesville, FL 32611, USA, 3Department of Animal & Avian Sciences, University of Maryland, College
Park, MD 20742, USA, 4Division of Environmental and Biomolecular Systems, Oregon Health & Science University, West Campus, Beaverton, OR,
97006, USA, 5Department of Forestry & Natural Resources, Purdue University, Lafayette, IN, 47907, USA, 6U.S. Environmental Protection Agency,
ORD, NHEERL, MED, Duluth, MN, 55804, USA, 7Environmental Laboratory, US Army Engineer Research and Development Center, Vicksburg,
MS, 39180, USA and 8Current address: Department of Chemistry, Jackson State University, Jackson, MS 39217, USA
Email: Natalia Garcia-Reyero natalia@ccmsi.us; Kevin J Kroll krollk@ufl.edu; Li Liu liliu@biotech.ufl.edu;
Edward F Orlando eorlando@umd.edu; Karen H Watanabe watanabe@ebs.ogi.edu; Maria S Sepulveda mssepulv@purdue.edu;
Daniel L Villeneuve -Villeneuve.Dan@epamail.epa.gov; Edward J Perkins Edward.J.Perkins@erdc.usace.army.mil;
Gerald T Ankley Ankley.Gerald@epamail.epa.gov; Nancy D Denslow* ndenslow@ufl.edu
* Corresponding author



Published: 13 July 2009 Received: 30 December 2008
BMC Genomics 2009, 10:308 doi: 10. 186/1471-2164-10-308 Accepted: 13 July 2009
This article is available from: http://www.biomedcentral.com/1471-2164/10/308
2009 Garcia-Reyero et al; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.ore/licenses/by/2.0),
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.



Abstract
Background: Aquatic organisms are continuously exposed to complex mixtures of chemicals,
many of which can interfere with their endocrine system, resulting in impaired reproduction,
development or survival, among others. In order to analyze the effects and mechanisms of action
of estrogen/anti-estrogen mixtures, we exposed male fathead minnows (Pimephales promelas) for
48 hours via the water to 2, 5, 10, and 50 ng 17a-ethinylestradiol (EE2)/L, 100 ng ZM 189,154/L (a
potent antiestrogen known to block activity of estrogen receptors) or mixtures of 5 or 50 ng EE2/
L with 100 ng ZM 189,154/L. We analyzed gene expression changes in the gonad, as well as
hormone and vitellogenin plasma levels.
Results: Steroidogenesis was down-regulated by EE2 as reflected by the reduced plasma levels of
testosterone in the exposed fish and down-regulation of genes in the steroidogenic pathway.
Microarray analysis of testis of fathead minnows treated with 5 ng EE2/L or with the mixture of 5
ng EE2/L and 100 ng ZM 189,154/L indicated that some of the genes whose expression was changed
by EE2 were blocked by ZM 189,154, while others were either not blocked or enhanced by the
mixture, generating two distinct expression patterns. Gene ontology and pathway analysis
programs were used to determine categories of genes for each expression pattern.
Conclusion: Our results suggest that response to estrogens occurs via multiple mechanisms,
including canonical binding to soluble estrogen receptors, membrane estrogen receptors, and
other mechanisms that are not blocked by pure antiestrogens.





Page 1 of 17
(page number not for citation purposes)







BMC Genomics 2009, 10:308


Background
Worldwide, aquatic organisms are exposed to mixtures of
chemicals (e.g., pharmaceuticals, pesticides, and indus-
trial chemicals), which enter the environment through
wastewaters as well as other sources. Many of these chem-
icals are capable of interfering with endocrine signaling
via a complex array of biomolecules (e.g., hormones) to
regulate processes such as reproduction and metabolism.
These endocrine disrupting chemicals (EDCs) alter signal-
ing through a variety of mechanisms including binding to
soluble sex hormone receptors or membrane receptors
and acting as agonists or antagonists, or by inhibiting/
inducing enzymes and proteins, which produce naturally
occurring steroid hormones. Compared to other chemical
pollutants, EDCs are likely to have effects at relatively low
concentrations [1].

Of the EDCs, xenoestrogens have been the most studied
because estrogenic effects have been observed in field
studies of fish and wildlife populations [2-4]. In ovipa-
rous animals such as fish, a sensitive and robust biomar-
ker (i.e. vitellogenin, VTG) exists for evaluating exposure
to xenoestrogens. Early studies of sewage treatment efflu-
ents attributed the feminization of fish to exposure to
mixtures of natural (e.g., estrone and 17p3-estradiol, E2)
and synthetic (e.g., 17a-ethinylestradiol, EE2) estrogens
[1,5]. One of the most potent estrogens known is EE2, a
pharmaceutical that is one of the active ingredients in con-
traceptives. Indeed, EE2 has been shown to be up to 27
times more potent than E2 [6]. In the United States, EE2
use is estimated at 170 kg/yr [7]; and in the United King-
dom, its use is roughly 26 kg/yr [8]. Measured EE2 surface
water concentrations in the United States, United King-
dom, The Netherlands, and Germany range from 0.5 to 15
ng/L [7], and it has been frequently measured in United
States streams [9].

In laboratory studies, exposures of fish to environmen-
tally relevant EE2 concentrations cause a variety of effects
that include testis-ova (the appearance of both sperm and
egg follicles in the testis), increased plasma VTG concen-
trations, reduced gonad size, and altered sex ratios. Stud-
ies have used exposure durations of various lengths,
including short (<7 days of exposure), intermediate (7 to
28 days exposure), and long (> 28 days) term. In female
fish, environmentally relevant EE2 exposures can increase
plasma VTG concentrations [10-12] and decrease egg pro-
duction [13] in long-term studies, but seem to have little
or no effect on fecundity for intermediate length expo-
sures [10,12]. In some studies, long-term exposure to EE2
completely inhibits spawning in fish [11,14].

Long-term EE2 exposure of embryos has been shown to
disrupt sexual differentiation of male fish. Fathead min-
now (FHM, Pimephales promelas) embryos continuously
exposed to EE2 concentrations as low as 4 ng/L did not


http://www. biomedcentral.com/1471-2164/10/308



clearly sexually differentiate at 176 days post-fertilization
[12]. Similarly, continuous exposure of zebrafish (Danio
rerio) embryos to EE2 concentrations as low as 3 ng/L
resulted in all fish having ovaries [11]. EE2 also reduced
gonad size and circulating testosterone (T) levels [15],
increased VTG [11,12,16], and arrested the developmen-
tal transition of the gonads of genetically male zebrafish
[11]. The steroid also can cause hepatotoxicity, nephro-
toxicity and gonadotoxicity [17]. Overall, studies to date
suggest that exposure to EE2 elicits adverse effects on fish
reproduction primarily through the feminization of male
fish, and in females through cessation of spawning. These
findings have alerted scientists and environmental regula-
tors to the potential for severe adverse effects on aquatic
populations [18], and, potentially, aquatic ecosystems
[19]. The current research was conducted to provide a bet-
ter understanding of the mechanistic basis for effects of
estrogenic chemicals in fish.

Effects on gene expression have been investigated with
short- and intermediate-term exposures to EE2 [20-22] in
order to discover gene expression profiles indicative of
potential adverse effects. In addition to affecting gene
expression through soluble nuclear hormone receptors, it
is now clear that sex hormones can also bind directly to
membrane receptors and enact immediate changes in sig-
naling via non-genomic pathways [23,24]. Specific sex
hormone receptors in membranes have been identified in
fish testis and ovaries for E2 [25,26], T [27] and progestins
[28]. It is difficult to distinguish gene transcription regula-
tion through classical receptor-dependent mechanisms,
where estrogen receptor homo- and heterodimers bind to
estrogen receptor elements in promoters, from action due
to binding of estrogen receptors (ERs) to other transcrip-
tion factors that activate through Spl stimulatoryy protein
1) or AP-1 (activating protein 1) binding sites or that acti-
vate signaling cascades that start at the membrane.
ZM189,154 (ZM) was produced by Astra-Zeneca (Alderly
Park, Cheshire, UK) and there are reports that it functions
as a "pure" antiestrogen in mammals [29] and in fish
[30,31 ], meaning that it will bind to and inhibit activation
of the ERs in all tissues. But even pure antiestrogens
appear to fail in this regard with some genes that are reg-
ulated by E2 [32,33]. ICI 182,780, the most studied pure
antiestrogen, can bind to membrane receptors of GnRH-
producing GT1-7 cells and displace binding of E2 coupled
to bovine serum albumin [34], suggesting that its binding
to membrane receptors is inhibited, but it is not clear if
this influences all E2 membrane activity [32]. The Atlantic
croaker G protein-coupled receptor 30 has been shown to
function as a membrane-bound estrogen receptor and its
function is agonized by ICI 182,780 [35]. Other E2 acti-
vated pathways may not be inhibited by ICI 182,780, as
has been shown for E2-stimulated gene regulation
through an SP1 site [33]. ZM interactions with membrane
receptors have not been studied.

Page 2 of 17
(page number not for citation purposes)







http://www. biomedcentral.com/1471-2164/10/308


Unlike mammalian species, as many as three to four dif-
ferent ERs have been identified in teleost fish [31,36-38]
making evaluation of gene regulation by different ER iso-
types even more challenging to understand than in mam-
malian systems. Using in vitro transfection experiments for
largemouth bass (Micropterus salmoides) ERs, we have
determined that ZM is equally effective at antagonizing
the three soluble receptors [31].

A few studies have investigated the effects of estrogenic
mixtures on fish [20,39,40] and the binary mixture of E2
with tamoxifen and letrizole, two antiestrogens [41].
However, no studies in fish have investigated the effects of
a mixture of EE2 with the potent anti-estrogen, ZM. In this
study, the objective was to determine changes in steroido-
genesis and in gene expression profiles associated with
different exposures by exposing adult male FHM to aque-
ous doses of EE2, (2, 5, 10 and 50 ng/L); to the pure anti-
estrogen, ZM (100 ng/L); and to mixtures of EE2 and ZM.
The hypothesis we tested was that ZM in the mixture
would block the action of EE2 on soluble ERs in the FHM
gonad and effectively block gene expression changes
observed with EE2 alone.

Results
Water Chemistry
Two distinct experiments were performed. In Exp 1, FHM
were treated with three concentrations of EE2 (2, 10 and
50 ng EE2/L), 100 ng ZM/L or a mixture of 50 ng EE2 with
100 ng ZM/L. In Exp 2, FHM were treated with vehicle, 5
ng EE2/L or with a mixture of 5 ng EE2 with 100 ng ZM/L.
Water concentrations of EE2 alone and in the mixture were
close to target values but decreased after 24 h when they
were again renewed to target concentrations (Table 1).
Actual concentrations of ZM were not measured.

Biological responses
There were no mortalities in any of the treatments.
Changes in plasma T and VTG were assessed only for a
subset of the exposures for Exp 1 (10 and 50 ng EE2/L, 100
ng ZM/L and the mixture of 50 ng EE2/L and 100 ng ZM/
L) and only plasma VTG was assessed for exposures for
Exp 2. Within 48 h, plasma T levels in males were dramat-
ically reduced in all treatments that were measured for Exp
1 (Figure 1A). In the same time frame there was a signifi-
cant increase in plasma VTG for the two EE2 concentra-
tions tested, and for the mixture of 50 ng EE2/L and 100
ng ZM/L (Figure IB). Exposure to 100 ng ZM/L alone did
not induce VTG. In the second experiment plasma VTG
was significantly up-regulated for the 5 ng EE2/L and for
the mixture of 5 ng EE2 with 100 ngZM/L (Figure IC).

Microarray Results
As described in the Methods section, two microarray
experiments were performed, one using testis from FHM
exposed to 50 ng EE2/L, 100 ng ZM/L and a combination


Table I: Chemical analysis of water exposures.

EE2 Conc, nglLa


Spike SEb 24 h Post spike


Experiment I
TEGd
EE2-2
EE2-10
EE2-50
Mixture EE2-50/ZM-100

Experiment 2
TEG
EE2-5
Mixture EE2-5/ZM-100


BDLe
1.16
9.02
57.92
60.36


BDL
2.98
3.50


a, Detection limit for the ELISA in 50 ng/L
b, SE, Standard error
c, Concentration of EE2 in tank at the end of 24 h and before
exposure solutions were replaced
d, TEG, triethylene glycol; EE2, 17a-ethinylestradiol; ZM, ZM 189,154
e, BDL, below detection limit


of both and another using testis from FHM exposed to 5
ng EE2/L or to a combination of 5 ng EE2 with 100 ng ZM/
L. The rest of the samples from other EE2 doses were
reserved for the quantitative real time PCR (Q-PCR)
experiments described below. Samples from the first
experiment were analyzed using a 2,000 gene oligonucle-
otide microarray, and the results are shown in the two
sided hierarchical cluster in Figure 2A. The heat map rep-
resents genes differentially expressed (p < 0.01) between
testis of vehicle control and treated fish. We analyzed four
biological samples for each of the exposures; each column
in Figure 2A represents one of the samples. As expected,
control fish clustered together, whereas fish treated with
EE2 alone or with a combination of EE2 and ZM formed a
different cluster. Exposure to ZM alone showed the least
difference compared to solvent controls; however, even in
this comparison there were some differences, suggesting
that ZM can influence up- and down-regulation of gene
expression in males. There were minor differences
between the non-solvent and solvent controls (data not
shown).

Exposure to 50 ng EE2/L caused many differences in gene
expression. The mixture of 100 ng ZM/L and 50 ng EE2/L
reversed the change for several genes affected by EE2
alone, but at this 2:1 ratio the antiestrogen concentration
seemed insufficient to totally block the effects of EE2.

Based on these initial results, we conducted a second
study, this time using 5 ng EE2/L and a mixture of 100 ng
ZM/L with 5 ng EE2/L (a ratio of 20:1; Figure 2B). For this
analysis, we used a newer 22,000 gene array that had sub-
sequently become available. Exposure to 5 ng EE2/L

Page 3 of 17
(page number not for citation purposes)


BMC Genomics 2009,10:308








http://www. biomedcentral.com/1471-2164/10/308


9

7
64 -
5
I-
04
B B ** *
Water ntr EE210 EE250 ZM100 Mix:2


Water Cntrl EE2-10 EE2-50 ZM-100 Mix1:2


100000

10000 -
1 ooooo^------t -- 1----1


1000

100

10


Water Cntrl EE2-10 EE2-50


ZM-100


100000


10000

1000

100

10


Cntrl EE2-5 Mix 1:20


Mix 1:2


Figure I
Phenotypic anchoring measurements for male fathead minnows. (A and B) Experiment I. (A) Plasma T concentra-
tions (ng/mL), (B) Plasma vitellogenin concentrations (pg/mL) in the same fish samples. (Cntrl) triethylene glycol control, (EE2-
10) 10 ng EE2/L, (EE2-50) 50 ng EE2/L, (ZM- 100) 100 ng ZM/L, (Mix 1:2) 50 ng EE2/L and 100 ng ZM/L. (C) Experiment 2. Plasma
VTG concentrations (pg/mL). (EE2-5) 5 ng EE2/L; (Mix 1:20) 5 ng EE2/L and 100 ng ZM/L. Significance ** P<0.00 I and P<0.05.


increased plasma VTG (Figure IC), while the 20-fold
excess of ZM in the mixture did not affect this increase. A
group of 173 genes was altered (p < 0.01) after exposure
to either 5 ng EE2/L or to the mixture of 5 ng EE2/L and
100 ng ZM/L (Figure 3). These changes are plotted in
order of their degree of expression change for EE2 (Figure
3A), with 83 genes up-regulated and 90 genes down-regu-
lated. Keeping the same order of genes, their fold-expres-
sion is plotted for the mixture (Figure 3B). It is clear from
this graph that while ZM blocks the EE2 effects for some
genes, it does not do so for all. There also appears to be a
few genes in the middle of this distribution that are signif-
icantly altered only by the mixture and not by EE2 alone.

Of the 173 regulated genes, 71 genes were modulated by
EE2 and blocked by ZM (i.e. reduced expression relative to
EE2 alone) in the mixture treatment (Figure 4A and 4B).
These genes are likely directly regulated by one or more of


the soluble ERs and include "cellular processes involved
in calcium-dependent cell-cell adhesion," "sugar trans-
porters," gonadall mesoderm development," "protein
repair," and proteolysiss and gas transport" (see Addi-
tional file 1). Expression of the remaining 102 genes mod-
ulated by EE2 was either not affected or was enhanced in
either direction by the addition of ZM (Figure 4C and
4D). Many of these genes appear to be involved in signal-
ing cascades, as well as other functions such as "peptide
crosslinking," "amino acid biosynthesis and metabo-
lism," "regulation of the immune response," "lipid modi-
fication," or "response to stress and to radiation" (see
Additional file 2).

Quantitative real-time reverse transcriptase PCR (Q-PCR)
Genes that were tested by Q-PCR (Figure 5) were used to
both validate the arrays and to focus on genes whose pro-
tein products are involved in steroidogenesis and were



Page 4 of 17
(page number not for citation purposes)


BMC Genomics 2009,10:308







http://www. biomedcentral.com/1471-2164/10/308


H H ".q "I N N N 1 r

M..EMO. a f
nm Mec ~e ~-EE


Figure 2
Bi-directional hierarchical cluster analysis of gene expression changes. Green indicates down-regulation relative to
control and red indicates up-regulation relative to control. Fathead minnows were exposed to (A) 50 ng EE2/L (EE2), 100 ng
ZM/L (ZM), a mixture of 50 ng EE2/L and 100 ng ZM/L (Mix), or TEG control (Cntrl). Array analysis was on the 2 K array. (B)
5 ng EE2/L (EE2), a mixture of 5 ng EE2/L with 100 ng ZM/L (EE2/ZM) or TEG control (Cntrl). Array analysis was on the 22 K
array. Top, clustering was performed by treatment; side, clustering was performed by gene. Each column represents a different
array.


expected to be affected by EE2 [42]. Of the genes tested,
steroidogenic acute regulatory protein (StAR), cholesterol
side-chain cleavage enzyme (P450scc), cytochrome P450
17u. hydroxylase, 17,20 lyase (CYP17) and inhibin were
significantly down-regulated by 2 to 50 ng EE2/L. Genes
for hydroxysteroid dehydrogenases (HSDs) 3P-HSD and
llP-HSD and cytochrome P450 aromatase A-isoform
(CYP19A) were not significantly altered, but 1lp-HSD
and CYP 19A showed a downward tendency.

Functional Analysis
While it is interesting to identify individual genes regu-
lated by EE2, most biological processes occur through
functional pathways. To assess this, we first assigned as
many of the FHM genes as possible to GO categories and
to human homologs and then used this information to


visualize pathways via Pathway Studio, software from
Ariadne Genomics (Rockville, MD, USA). Of the 1,048
genes regulated by any treatment (p < 0.05), we were able
to assign GO categories to 684 genes (65%). Of these we
were able to assign human homologs to 536 genes (51%
of the original group).

Because of its environmental significance, we focused on
the 5 ng EE2/L data for GO analyses. The data set was
reduced by statistically determining GO categories for bio-
logical processes that were over-represented among the
regulated genes which are arranged by increasing p-value
(up to 0.05) in Table 2. Since GO categories are listed in a
hierarchical format, we removed higher order categories if
a lower category was present. We found 39 GO biological
process categories up-regulated and 51 categories down-

Page 5 of 17
(page number not for citation purposes)


BMC Genomics 2009,10:308


NNN I








http://www. biomedcentral.com/1471-2164/10/308


0
4
C4 83
3,
0
2
0
*1
0o
.0
-1

-2
x -3
LLI
-4
-5 1
1 11 21 31 41 51 61 71 81 91 101 111 121 131 141 151 161 171


1 11 21 31 41 51 61 71 81 91 101 111 121 131 141 151 161 171



Figure 3
Comparison of overall gene regulation. (A) 5 ng EE2/L and (B) a mixture of 5 ng EE2/L and 100 ng ZM/L as determined by
the 22 K array. The genes were ordered according to their expression level in the EE2 treatment (p < 0.01) and represent
median expression values of the four arrays for each condition.


regulated. The most significantly up-regulated GO cate-
gory was "development," while "DNA replication,"
"response to radiation," "mutagenesis," "DNA repair,"
"response to light stimulus," "response to DNA damage
stimulus," "DNA metabolism," and "response to endog-
enous stimulus" were the most significantly down-regu-
lated categories.

Discussion
Steroidogenesis
We chose three test concentrations of EE2 (2, 5, and 10 ng
EE2/L) with known environmental relevance, and one
concentration (50 ng EE2/L) higher than normally seen in
the environment [43,44]. In our experiments, 10 and 50
ng EE2/L decreased plasma T levels, while 5 to 50 ng EE2/
L increased plasma VTG concentrations in male fish. To
our best knowledge, ZM is not present in the environ-


ment, although it represents a potentially important
mechanism of action, ER antagonism [45]. The concentra-
tion we used, 100 ng ZM/L, and the time of exposure, 48
h, are lower and shorter, respectively than in most other
studies [46,47] where ZM has been shown to have effects
in fish. We chose 100 ng ZM/L to attempt to discern inter-
mediate effects on sensitive genes.

In our study, ZM treatment alone or in the mixture with
EE2 decreased plasma T levels after 48 h but alone it did
not induce plasma VTG concentrations nor did it inhibit
the increase in VTG induced by EE2 in the mixture in
males. In a study by Panter et al [47] ZM significantly
decreased VTG after 4 d in E2-treated juvenile FHM, but
only at a concentration of 76 jg/L, a concentration almost
100-times greater than tested in our experiment. In mum-
michog (Fundulus heteroclitus), there was decrease of

Page 6 of 17
(page number not for citation purposes)


BMC Genomics 2009,10:308







http://www. biomedcentral.com/1471-2164/10/308


1 fI1,,,,,,.
-2
-3
-4
-5
1 4 7 101316192225283134374043464952555861646770


4







-4
00


1 4 7 101316192225283134374 43464952555861646770
0


1 6 11 1621 2631 3641 4651 5661 6671 7681 8691 96101


1 6 11 162126313641465156616671768186919610'


Figure 4
Competitive and non-competitive blocking of gene expression by ZM. (A) Genes differentially changed by 5 ng EE2/L
and (B) blocked by the treatment with the mixture of 5 ng EE2/L and 100 ng ZM/L (p < 0.01). (C) Genes differentially changed
by 5 ng EE2/L but (D) whose expression was either not changed or enhanced by the treatment with the mixture of 5 ng EE2/L
and 100 ng ZM/L. Genes are plotted in order of their change in expression with EE2 (p < 0.01).


plasma T levels in males exposed for 7 days to 250 ng ZM/
L but not when treated with 100 ng ZM/L; in those studies
there were no effects on VTG levels in males or females
with as much as 1,000 ng ZM/L [46].

The Q-PCR data on mRNAs for specific enzymes involved
in the biosynthesis of T suggest that the depression of
plasma T levels may have occurred directly at the level of
steroidogenesis, possibly by direct ER-mediated control of
promoters. In the case of CYP17, its down-regulation was
blocked by ZM (microarray data), suggesting that it may
be regulated via ERs.

Pathway Analysis
Pathway Studio [48] was used to visualize changes in
gene expression from exposure to 5 ng EE2/L, or to the
mixture of 5 ng EE2/L and a 100 ng ZM/L. This software
can be used effectively to compare expression changes


with the much larger database of human protein interac-
tions, but only if gene identities are converted to their
human homologs. Important caveats for this type of anal-
ysis are that there may be many fish genes for which there
are no human homologs (e.g., VTG), and some genes in
fish belonging to gene families conserved in mammals
may actually function differently in fish due to chromo-
somal duplications. Given these caveats, this type of anal-
ysis can help visualize interactions among gene products
and their localization in cellular compartments and assist
in the formulation of hypotheses that can be tested in
future research.

An interactome is defined as a set of genes whose protein
products are functionally linked together either by direct
binding, regulation of activity, regulation of expression,
promoter binding, protein modification or molecular
transport [48]. Using the databases available in PubMed


Page 7 of 17
(page number not for citation purposes)


BMC Genomics 2009, 10:308








BMC Genomics 2009, 10:308


http://www. biomedcentral.com/1471-2164/10/308


A

55

-5.5
-1
-~ -15


2 5 10 50
EE2 (ngaL)


C 1- D






-22i
-a


2 5 10 50
EE2 (ngfL)













2 5 10 50
EE2 (ng/L)


2 5
EE2 (ngsL)


-15

-H
-2
-3


H


-3---


2 5 10 50
EE2 (ngfL)


2 5 10 50
EE2 (ngiL)






t!-im.m


2 5
EE2 (ngiL)


10 50


E~i C- -G


10 50


Figure 5
Q-PCR analysis of mRNAs for proteins involved in steroidogenesis. Q-PCR results are expressed as fold difference
compared to control. Panel A, StAR; Panel B, P450scc; Panel C, CYPI7; Panel D, Inhibin; Panel E, CYP19; Panel F, 3p-HSD;
Panel G, II P-HSD; Panel H, model for steroidogenesis. Green boxes refer to mRNAs that are significantly decreased by the
treatment in accordance with the Q-PCR graphs illustrated within the panels. Yellow boxes refer to mRNAs that are not sig-
nificantly changed by the treatments. FHM were treated with TEG, 2, 5, 10 or 50 ng EE2/L. StAR, steroidogenic acute regula-
tory protein, P450scc, Cytochrome P450 side chain cleavage enzyme, CYP17, Cytochrome P450 17, CYP 19, gonadal
aromatase, inhibin, hydroxysteroid dehydrogenases including 3p-HSD and I I P-HSD.





Page 8 of 17
(page number not for citation purposes)


0.5

-0D



-2

-3


G



0
-0.5

S -15I

-2
-2;5
-3


- -'E


-3.5


-
-
-








http://www. biomedcentral.com/1471-2164/10/308


Table 2: GO biological processes that are regulated by 5 ng/L EE2

UPREGULATED
GO ID GO Biological Process Fisher p Value # of Genes Selected # of Genes on Array

GO:0007275 development 4.35E-03 36 1250
GO:0040036 regulation of fibroblast growth factor receptor signaling I.58E-02 2 9
GO:00 16265 death I.62E-02 3 27
GO:0018149 peptide cross-linking 1.88E-02 2 10
GO:0050777 negative regulation of immune response I.88E-02 2 10
GO:0006955 immune response 1.93E-02 10 251
GO:0050776 regulation of immune response 2.09E-02 3 30
GO:0050727 regulation of inflammatory response 2.19E-02 2 II
GO:0006694 steroid biosynthesis 2.26E-02 3 31
GO:0006730 one-carbon compound metabolism 2.44E-02 3 32
GO:0008543 fibroblast growth factor receptor signaling pathway 2.53E-02 2 12
GO:0015758 glucose transport 2.53E-02 2 12
GO:0042770 DNA damage response, signal transduction 2.53E-02 2 12
GO:0008645 hexose transport 2.88E-02 2 13
GO:0015749 monosaccharide transport 2.88E-02 2 13
GO:0008284 positive regulation of cell proliferation 3.24E-02 3 36
GO:0019439 aromatic compound catabolism 3.26E-02 2 14
GO:0007154 cell communication 3.56E-02 41 1692
GO:0043281 regulation of caspase activity 3.65E-02 2 15
GO:0051241 negative regulation of organismal physiological process 3.65E-02 2 15
GO:000961 I response to wounding 3.73E-02 7 167
GO:0009607 response to biotic stimulus 3.91E-02 II 324
GO:0051707 response to other organism 4.03E-02 7 170
GO:0045596 negative regulation of cell differentiation 4.06E-02 2 16
GO:0009605 response to external stimulus 4.18E-02 8 209
GO:0051239 regulation of organismal physiological process 4.19E-02 4 69
GO:0051242 positive regulation of cellular physiological process 4.48E-02 5 103
GO:0006952 defense response 4.48E-02 10 291
GO:0019882 antigen presentation 4.92E-02 2 18

DOWNREGULATED
GO ID GO Name Fisher p Value # of Genes Selected # of Genes on Array

GO:0006260 DNA replication 9.27E-04 9 124
GO:0009314 response to radiation 1.51E-03 5 40
GO:0006280 mutagenesis 2.08E-03 2 2
GO:0006281 DNA repair 5.33E-03 9 163
GO:0009416 response to light stimulus 5.51 E-03 4 34
GO:0006974 response to DNA damage stimulus 7.91E-03 9 174
GO:0006259 DNA metabolism 8.60E-03 17 458
GO:0009719 response to endogenous stimulus 9.05E-03 9 178
GO:0006139 nucleobase, nucleoside, nucleotide and nucleic acid 1.29E-02 56 2183
metabolism
GO:0007623 circadian rhythm 1.74E-02 2 9
GO:0018149 peptide cross-linking 2.07E-02 2 10
GO:00 16339 calcium-dependent cell-cell adhesion 2.41 E-02 2 II
GO:0006885 regulation of pH 2.78E-02 2 12
GO:000 1775 cell activation 3.00E-02 3 33
GO:0045321 immune cell activation 3.00E-02 3 33
GO:0006508 proteolysis 3.17E-02 16 493
GO:0000245 spliceosome assembly 3.17E-02 2 13
GO:0046839 phospholipid dephosphorylation 3.17E-02 2 13
GO:0043283 biopolymer metabolism 3.56E-02 53 2167
GO:0007169 transmembrane receptor protein tyrosine kinase signaling 3.65E-02 5 92
pathway
GO:0007156 homophilic cell adhesion 3.94E-02 4 64
GO:0006289 nucleotide-excision repair 4.00E-02 2 15
GO:0009266 response to temperature stimulus 4.00E-02 2 15



Page 9 of 17
(page number not for citation purposes)


BMC Genomics 2009,10:308







http://www. biomedcentral.com/1471-2164/10/308


Table 2: GO biological processes that are regulated by 5 ng/L EE2 (Continued)


ear morphogenesis
response to stimulus
modification-dependent protein catabolism
modification-dependent macromolecule catabolism
axis specification
lipid modification
T cell activation


at NCBI (National Center for Biotechnology Information,
http://www.ncbi.nlm.nih.gov), we have identified inter-
actomes for both the genes that were regulated by EE2 and
then blocked by the combination of EE2 and ZM (Figure
6A called "competitive interactome" in the discussion
below), and those that were regulated by EE2 and either
not affected by ZM or enhanced (in either direction) by
the combination (Figure 6B called "non-competitive
interactome"). We analyzed these separately in order to
determine the types of genes that were included in each.

To reduce the complexity of the data, we only examined
genes whose products had direct interactions with other
entities. We were only able to assign human homologs to
about half of the regulated genes, thus our data set under-
estimates the genes that are directly linked. Entities that
showed no linkages to other entities were removed from
the figures, but all entities for which we have human
homologs are listed in additional files 1 and 2. While it is
possible to allow missing entities in the figures in an effort
to link all of the entities, this was not attempted because
we wanted to exemplify direct interactomes for which
there were expression data. Pathway Studio assigns gene
products to cellular compartments depending on their
cellular GO terms.

Many of the genes that are found in the "competitive
interactome" are known to be regulated by E2 and antago-
nized by estrogen antagonists such as ICI 182,780 in
mammalian systems. These genes fit a classical pattern of
regulation via soluble ERs. For some of these genes, there
is evidence that they contain EREs in their promoters in
mammalian systems. For example, angiotensinogen
(AGT) is highly prominent in the example shown (Figure
6A) and serves as a node for the "competitive interac-
tome". AGT is normally secreted from the liver into the
blood, but there are reports indicating secretion by other
organs as well [49]. Our data suggest that it is also pro-
duced by the testis of FHM. AGT helps to control blood
pressure and, as illustrated by the large number of interac-
tions in Figure 6A, can interact with other proteins in a
complex way. In mammals, AGT contains an ERE in its
promoter which is up-regulated by both natural and syn-
thetic estrogenic steroids [50]. Thus, the observation that
the EE2-enhanced expression of this gene is blocked by the
EE2-ZM mixture lends support to the assumption that the


competitive interactome includes genes directly regulated
by soluble ERs. The other genes in this interactome have
also been implicated in E2 signalling in mammalian sys-
tems or in cell culture, but there are insufficient data in the
literature to determine whether they are all regulated
directly by soluble ERs. Furthermore, depending on the
tissue the direction of regulation may differ from what we
observed in the testis of FHM.

Endothelin receptor type A (EDNRA) is up-regulated by E2
during the proliferative phase of the endometrial glandu-
lar epithelium [51]. There are no reports on whether or
not this up-regulation is through an ERE in the promoter.
Different from our results, clusterin (CLU) is down-regu-
lated by E2 in rat endometrium, but this regulation is
reversed by tamoxifen, another ER antagonist [52]. CLU is
known to be regulated by TGF beta and c-fos through an
AP-1 site [53]. CLU is a glycoprotein also known as testo-
sterone-repressed prostate message-2 [54]. This gene is
expressed in mammalian testis and apparently has many
roles including involvement in apoptosis of the seminal
vesicle [55]. Complement component factor H (Mudl)
contains an imperfect palindrome motif in its promoter in
L cells that is present in EREs [56], suggesting that this
gene could be directly regulated by soluble ERs. Inhibitor
of DNA binding 2 (ID2) has been shown to be down reg-
ulated by E2 in MCF-7 cells [57] and is directly related to
the down-regulation of inhibin alpha, which in turn has a
role inhibiting the secretion of FSH from pituitary gona-
dotrophs [58].

Several genes interconnected with this set were down-reg-
ulated by EE2 and blocked by ZM in our experiment. For
example, receptor calcitoninn) activity modifying protein
1 (RAMP1) has been shown to be down-regulated by E2 in
rat placenta [59]. Different from our study, some of the
down-regulated genes in the FHM testis have been shown
to be up-regulated by E2 in various mammalian tissues.
Pleiotrophin (PTN) is up-regulated in human endome-
trial epithelial cells [60], and annexin Al (ANXA1) is up-
regulated in a lymphoblastic leukemia cell line [61]. Cas-
pase 8 (CASP8) is regulated by activation of human ERP3
but not by ERua [62]. Tissue inhibitor of metalloproteinase
3 (TIMP3) is increased in breast cancer cell growth [63]. It
is not clear why the direction of regulation is different in
FHM testis, but this may be a tissue specific effect.


Page 10 of 17
(page number not for citation purposes)


GOU:UU00424 I
GO:0050896
GO:0019941
GO:0043632
GO:0009798
GO:0030258
GO:0042110


4.UUb-U2
4.50E-02
4.53E-02
4.53E-02
4.91 E-02
4.91E-02
4.91 E-02


BMC Genomics 2009,10:308







http://www. biomedcentral.com/1471-2164/10/308


Transcription factor


Nuclear receptor


Kinase


4_1


Phosphatase


Membrane receptor


Ligand


Figure 6
Pathway Studio analysis. (A) Competitive interactome consisting of genes that are regulated by 5 ng EE2/L and blocked by
the mixture of 5 ng EE2/L and 100 ng ZM/L. (B) Non-competitive interactome consisting of genes that are regulated by 5 ng
EE2/L but either not changed or enhanced by the mixture of 5 ng EE2/L and 100 ng ZM/L. Red indicates up-regulation, green
indicates down-regulation.


In the case of the "non-competitive interactome" (Figure
6B), the genes were differentially expressed in response to
EE2 exposure and either were not affected by ZM or further
amplified by ZM in the mixture. We did not expect to see
many genes in this category. This type of effect could be
due to activation by E2 on non-canonical response ele-
ments, as recently demonstrated in transgenic mice
expressing a reporter construct containing SP1 sites [33]
or by secondary effects that may have occurred in the 48 h
timeframe. In Figure 6B, we have accentuated one path-
way to illustrate this effect. Prostaglandin-endoperoxide
synthase 2 (PTGS2) is a central node in this figure and is
induced 1.5 fold by EE2 alone but not changed apprecia-
bly by the mixture (1.8 fold change). PTGS2 is involved in
the synthesis of prostaglandins from arachidonic acid and
is influenced by E2 in mammalian tissues [64]. Important
in this set of genes is the gene for "signal transducer and
activator of transcription 1" (STAT1) which is a critical


transcription factor involved in the JAK-STAT signalling
pathway central for innate immunity [65] and apoptosis
[66], among other functions. This transcription factor is
also activated via the retinoic acid receptor signalling
pathway [67], thus bridging both the E2 and retinoic acid
pathways. Also important is histone deacetylase 9
(HDAC9), a gene product that is involved in chromatin
remodelling, allowing access of transcription factors to
regions in DNA. No information exists regarding the
influence of estrogen on HDAC9 in mammalian tissues
but inactivation of other histone deacetlyases is an impor-
tant step for ER activation in cell lines no longer respon-
sive to E2 [68]. Tnf receptor-associated factor 6 (TRAF6) is
a protein known to be involved in signal transduction
through membrane receptors [69], and RAS p21 protein
activator 1 appears to play a role in Ras GTPase mediated
signal transduction [70].


Page 11 of 17
(page number not for citation purposes)


0


BMC Genomics 2009,10:308







BMC Genomics 2009, 10:308



Table 3: Real time PCR primers


http://www. biomedcentral.com/1471-2164/10/308


GENE

CYP 17
3P-HSD
II Ip-HSD
INHB
CYPI9A
P450scc
StAR


FWD PRIMER (5' 3')

ACACAAGGTGGATTACAGTGATAACGT
ATGAGATGCCCTACCCAAAGAC
GCATCGGCGAGCAGTTG
ACCACGCTACTCGGGATCAA
TGCTGACACATGCAGAAAAACTC
CGACACCCGGACTTGCA
CTTGAACAGCAAACAGATGACCTT


Among the down-regulated genes were several transcrip-
tion factors, including transcription factor 12 (TCF12)
involved in control of immunoglobulin transcription
[71], transcription factor 8 (TCF8), a negative regulator of
cadherin [72], myeloblastosis oncogene (MYB), known to
be involved in estrogen signalling in some breast cancer
cells [73] and AF4/FMR2 family, member 4 (AF5Q31),
which functions as a transcriptional regulator in testicular
somatic cells, essential for male germ cell differentiation
and survival [74]. Karyopherin (importin) alpha 4
(KPNA4) helps import proteins into the nucleus during
spermatogenesis [75]. RAN binding protein 3 isoform b
(RANBP3) links the RAS and PI3-kinase signaling path-
ways with nuclear transport [76] and Eph receptor A2
(EPHA2), is a protein in the tyrosine kinase family [77].
The roles of other genes in this interactome are listed in
additional file 2.

It is not clear at this time why so many genes have escaped
antagonism by ZM in the mixture exposure. It is possible
that they are activated via non-canonical ER interactions
with other transcription factors [33] or are the results of
activation through G protein-coupled receptor 30
(GPR30), a membrane-bound estrogen receptor [35]. A
large percentage of genes in the non-competitive interac-
tome function in non-genomic signaling pathways, rais-
ing the possibility that these genes are all regulated via
membrane receptors which escape antagonism. Further
work will be required to sort out exactly how each of these
genes is regulated.

Conclusion
We used genomics to try to elucidate the mechanisms of
action of estrogenic and anti-estrogenic compounds and
their potential effects on aquatic organisms. Our data pro-
vides some insight into the estrogen-regulated effects, sug-
gesting that response to estrogens occurs via different
mechanisms. The use of an estrogen/antiestrogen mixture
provides a distinction among different modes of action of
estrogenic compounds: through canonical binding to sol-
uble ERs; membrane ERs; or some other potential mecha-
nisms that may not be blocked by pure antiestrogens.


REV PRIMER (5' 3')

CTGCGTTTGGCCCTCAGA
CCCTTTACCTTTGTGCCATTG
CTCCTCGCCGTGATAACGA
CGGAGGGACTTCATGCTCTCT
CAGCTCTCCGTGGCTCTGA
CACGTCTCCTTTAGAGGTGATACG
CTCCCCCATTTGTTCCATGT



Methods
Fish Exposure and Tissue Collection
Reproductively-mature, pond-reared FHM were pur-
chased from Andersen Minnow Farm, AR, 4 days prior to
starting the experiment. Upon arrival, the fish were treated
for parasites and bacteria by a prophylactic salt-water dip
(3%, 1 min). Males were separated from the population
the following day, and acclimated in the treatment
aquaria for 48 h. The water used for this study was carbon-
filtered, dechlorinated tap water.

The exposure system consisted of 40 L glass aquaria. Each
exposure was conducted in quadruplicate and each aquar-
ium contained eight male FHM in 25 L of treatment water.
Test chemicals for each treatment group (100 L for 4
aquaria) were prepared in separate (by treatment) 250 L
fiberglass tanks the day of exposure. Aquaria were equili-
brated with test chemicals for 24 h prior to the introduc-
tion of fish. Test solutions were renewed to 90% of the 25
L exposure volume after 24 h and the exposure was ended
at 48 h. The positions of the treatment tanks were rand-
omized and test initiation times were staggered to ensure
an exposure/sampling interval of 48 h. The fish were not
fed the day before and during the experiment. Tempera-
ture was maintained at 25 C with a photoperiod of 16 h
light: 8 h dark.

Exposure Solutions
EE2 was purchased from Sigma Chemical Company (St.
Louis, MO). ZM189,154 was a generous gift from Astra-
Zeneca. Working solutions for each test chemical con-
sisted of 1 mg/ml test compound in 70% triethylene
glycol (TEG) and 28.5% ethanol. This working solution
was further diluted to make stock solutions for each treat-
ment (nominal concentrations of 2, 5, 10 and 50 ng EE2/
L and 100 ng ZM/L and mixtures containing 5 ng EE2/L or
50 ng EE2/L and 100 ng ZM/L), so as to maintain a con-
centration of 50 pl TEG/L of test water. EE2 concentrations
spanned the environmentally relevant levels (2-10 ng
EE2/L) to a concentration higher than would typically
occur in the environment. The antiestrogen ZM concen-
tration was chosen to be higher than EE2 so that it could




Page 12 of 17
(page number not for citation purposes)







BMC Genomics 2009, 10:308


effectively block action on the ERs. The concentration of
ZM in the two mixtures was 100 ng ZM/L.

Water samples were collected at the start of the exposures
(0 hr), and after 24 h (both before and after change of
tank water) and after 48 h. A sample of the test solution (1
L) was collected in an amber glass bottle with a teflon cap
and stored at 40C. The water was passed through an
AccuBond II ODS-C18 solid phase extraction column
(Agilent, Palo Alto, CA) and the EE2 was eluted with 5 ml
dichloromethane. After drying, the EE2residue was recon-
stituted in 1 ml of buffer and analyzed using an enzyme-
linked immunosorbent assay (ELISA) kit (Abraxis, Los
Angeles, CA), following the manufacturer's instructions.
The detection limit for this assay is 50 ng EE2/L in the
reconstituted solution. We were not able to determine
actual concentrations of ZM, so we report only nominal
concentrations.

All procedures involving live fish were reviewed and
approved by the University of Florida Institutional Ani-
mal Care and Use Committee (IACUC). At the conclusion
of the exposures, fish were anesthetized (MS-222),
weighed to the nearest 0.1 g and blood samples were col-
lected from the caudal vasculature for analysis of VTG and
T concentrations, as described below. The testes were
removed and cut into small pieces. Dissected tissues were
flash frozen using liquid nitrogen and stored at -80C
until needed.

Vitellogenin Assay
Plasma concentrations of VTG were determined by ELISA
using a monoclonal antibody, 2D3, previously validated
for the FHM [78]. The limit of detection for the FHM VTG
ELISA in plasma was 0.5 Mjg/mL. All assays were performed
in triplicate and reported as the mean of the three meas-
urements. The coefficient of variation was < 10% for all
samples analyzed. Inter and intra-assay variability was
routinely measured by analyzing positive controls on sev-
eral plates and found to be < 10% and < 5%, respectively.

Testosterone Radioimmunoassay
Plasma concentrations of T were measured using a radio-
immunoassay (RIA) validated for the FHM based on a
slight modification of a previously published protocol
[79]. The antibody against T, 20-TR05, was purchased
from Fitzgerald Industries International, Concord, MA.
Tritiated label ([1,2,6,7-3H] T) was from GE Healthcare
(Piscataway, NJ). The T standard (Sigma T-1500) was
obtained from Sigma Chemical Company (St. Louis,
MO). Plasma samples (12 jtL each) were extracted with 2
mL of ethyl ether, as described previously [79]. The extrac-
tion efficiency was 93%. Samples were analyzed in dupli-
cate. The intraassay coefficients of variance were generally
05% and all samples were run in one assay to prevent inte-
rassay variability.


http://www. biomedcentral.com/1471-2164/10/308



Data analysis
Plasma concentrations of T were analyzed by one-way
ANOVA, followed by Fisher Protected Least Significant
Difference (PLSD) test for post-hoc analysis. All analyses
were carried out using StatView 5.0 (SAS Institute, Inc.,
Cary, NC). Homoscedasticity was assessed using F tests,
and, where necessary (p < 0.05), data were log trans-
formed [80]. All data are reported as nontransformed val-
ues, as mean SEM, and significance was determined at p-
value < 0.05. Plasma VTG concentrations were analyzed
by Dunnett's pairwise multiple comparisons on log trans-
formed data.

RNA Extraction
Total RNA was isolated from 30-50 mg FHM gonadal tis-
sue with the RNA Stat-60 reagent (Tel-test, Friendswood,
TX), as previously described [81]. Total RNA was treated
with DNase and the quality assessed with an Agilent 2100
BioAnalyzer (Agilent, Palo Alto, CA), and the quantity
determined on a NanoDrop spectrophotometer (Nano-
Drop Technologies, Wilmington, DE). RNA was stored at
-80 C until further use.

Microarrays
Fathead minnow microarrays manufactured by Agilent
(Palo Alto, CA) were purchased from EcoArray (Alachua,
FL). For the first experiment we used a targeted 2,000 gene
array (GPL6516) while for the other we employed a
22,000 gene array (4 x 44 K format, GPL7282). Array
hybridizations were performed using a reference design.
The reference material, which was used for all studies,
consisted of equal amounts of RNA from both female and
male tissues (liver, brain and gonad). Four replicates con-
sisting of four different individuals were analyzed for each
of the treatments (solvent (TEG) control, non-solvent
control, EE2, ZM, EE2/ZM). The cDNA synthesis, cRNA
labeling and hybridization were performed following the
manufacturer's kits and protocols (Agilent Low RNA Input
Fluorescent Linear Amplification Kit and Agilent 60-mer
oligo microarray processing protocol; Agilent, Palo Alto,
CA). The gonad samples were labeled with Cy5 while the
reference sample was labeled with Cy3. Once the labeling
was complete, samples were hybridized to the microarray
using conditions recommended by the manufacturer.
After hybridizing for 17 h, microarrays were washed and
then scanned with a laser-based detection system (Agilent,
Palo Alto, CA). Text versions of the Agilent raw data have
been deposited at the Gene Expression Omnibus website
(GEO: http://www.ncbi.nlm.nih.gov/geo/: Accession
series record number GSE14235).

Bioinformatics
Microarray image processing and data pre-processing
were performed using Agilent's Feature Extraction soft-
ware v 9.5 (Agilent, 2007). The intensity of each spot was
summarized by the median pixel intensity. A log2 trans-

Page 13 of 17
(page number not for citation purposes)







BMC Genomics 2009, 10:308


formed signal ratio between the experimental channel
and the reference channel was calculated for each spot,
followed by within-array LOWESS transformation and
between array scale normalization on median intensities
[821.

Two-way ANOVA was performed on log2 transformed sig-
nal ratios of each probe individually, followed by Tukey-
HSD pair-wise comparisons to determine genes whose
expression was significantly regulated by the treatments. A
p-value <0.05 was used as the cutoff. Genes whose fold
expression changes were less than 1.5 fold were elimi-
nated from further analyses irrespective of statistical sig-
nificance.

GeneOntology (GO) annotations were provided by
EcoArray Inc. based largely on homologies between FHM
genes and human genes. Overrepresentation of differen-
tially expressed genes in the biological process GO cate-
gory was determined by Fisher Exact Test with a p-value <
0.05 as a cutoff, and the false discovery rate was deter-
mined [83]. PathwayStudio software [48] from Ariadne
Genomics (Rockville, MD) was used to determine the list
of common regulators among the genes that were differ-
entially expressed in the experiments.

Real-time Polymerase Chain Reaction (Q-PCR)
Total RNA (1 Ng) was reverse transcribed into cDNA using
3 Wl random primers (0.1 Wtg/Itl), 0.8 Wl dNTP mix (25 mM
each dNTP), 2 Wl transcription buffer (10x), 1 [tl
StrataScript RT (50 U/tl), and 0.5 [l RNAse Block (40 U/
Wl) in a final volume of 20 pl (all reverse transcription rea-
gents were from Stratagene, La Jolla, CA). The resulting
cDNA was used as a template for Q-PCR. Specific primers
for selected genes were designed to perform Q-PCR (Table
3).

Each Q-PCR reaction consisted of lx iQ SYBR Green
Supermix (Bio-Rad, Hercules, CA), 0.4 WtM primers and 1
Wl of cDNA in a 25 [l reaction. The Q-PCR conditions
were 95 C for 3 min and 40 cycles at 95 C for 15 sec and
60C for 1 min in an iCycler Thermal Cycler (Bio-Rad,
Hercules, CA). The Q-PCR results were normalized to 18S
rRNA (Applied Biosystems, Foster City, CA) and analyzed
using the AACt method, compared to the vehicle controls.
We measured the following mRNAs: cytochrome P450
17thydroxylase, 17,20 lyase (CYP17) [84], steroidogenic
acute regulatory protein (StAR) [85], cholesterol side-
chain cleavage enzyme (P450scc) [85], hydroxysteroid
dehydrogenases (HSDs) 3P-HSD [85] and 11P-HSD [86],
inhibin (INHB) and cytochrome P450 aromatase A-iso-
form (CYP19A) [871.

List of abbreviations
AF5Q31: AF4/FMR2 family, member 4; AGT: angi-
otensinogen; ANXA1: annexin Al; AP-1: activating pro-


http://www. biomedcentral.com/1471-2164/10/308



tein 1; 3P-HSD: 3 beta hydroxysteroid dehydrogenase;
11 P-HSD: 11 beta hydroxysteroid dehydrogenase; CASP8:
caspase 8; CBL: CBL E3 ubiquitin protein ligase; CLU:
clusterin; Cntrl: control; CYP 17: cytochrome P450, fam-
ily 17, subfamily a, polypeptide 1; CYP19A: cytochrome
P450 aromatase A-isoform; DUSP6: dual specific phos-
phatase 6; EDCs: Endocrine disrupting chemicals; E2: 17p
estradiol; EE2: 17u ethinylestradiol; ELISA: enzyme-linked
immunosorbent assay; ENDRA: endothelin receptor type
A; EPHA2: Eph receptor A2; ER: estrogen receptor; FHM:
fathead minnow; GADD45B: growth arrest and DNA-
damage-inducible 45 beta; GO: gene ontology; HDAC9:
histone deacetylase 9; ID2: inhibitor of DNA binding 2;
INHA: inhibin alpha; KPNA4: karyopherin (importin)
alpha 4; MYB: myeloblastosis oncogene; Mud 1: comple-
ment component factor H; NR4A3: nuclear receptor sub-
family 4, group A, member 3; Q-PCR: quantitative real
time reverse transcriptase polymerase chain reaction;
P450scc: Cytochrome P450 side chain cleavage enzyme;
PTGS2: prostaglandin-endoperoxide synthase 2; PTN:
pleiotrophin; PURA: purine rich element binding protein
A; RAMP1: receptor calcitoninn) activity modifying pro-
tein 1; RANBP3: RAN binding protein 3 isoform; RASA1:
RAS p21 protein activator 1; RIA: radioimmunoassay;
SH2D3C: SH2 domain containing 3C; Spl: stimulatory
protein 1; StAR: steroidogenic acute regulatory protein;
STAT1: signal transducer and activator of transcription 1;
T: testosterone; TCF8: transcription factor 8; TCF12: tran-
scription factor 12; TIMP3: tissue inhibitor of metallopro-
teinase 3; TRAF6: Tnf receptor-associated factor 6; VTG:
vitellogenin; ZFP36L1: zinc finger protein 36, C3H type-
like 1; ZM: ZM 189,154.

Authors' contributions
NGR, NDD, KHW, MSS and EFO, conceived of the study
and helped draft the manuscript; NGR, DLV, EFO, and
KJK, performed the experimental work; LL, performed
bioinformatics analysis; EJP, GTA, revised the manuscript
critically for important intellectual content. All authors
read and approved the final manuscript.

Additional material


Additional file 1
Human homologs of genes competitively regulated by EE2 and ZM
Click here for file
[http://www.biomedcentral.com/content/supplementary/1471-
2164-10-308-Si.xls]

Additional file 2
Human homologs of genes non-competitively regulated by EE2 and
ZM
Click here for file
[http://www.biomedcentral.com/content/supplementary/1471-
2164-10-308-S2.xls]


Page 14 of 17
(page number not for citation purposes)








BMC Genomics 2009, 10:308


Acknowledgements
This work was supported by the Environmental Protection Agency STAR
grant, (R83 1848) to ND, MS, EO and KW, and by a fellowship from the
Spanish Ministry of Sciences and Technology (EX-2004-0986) co-funded by
the European Union to NGR. We wish to thank Dr. Thomas Hutchinson,
(formerly of AstraZeneca) for the generous gift of ZM 189,154. The
research described in this article does not necessarily reflect the views of
the EPA and no official endorsement should be inferred. NDD holds equity
in EcoArray, Inc., a company commercializing the microarray technology
used in this study.

References
I. Sumpter JP: Endocrine disrupters in the aquatic environment:
An overview. Acta Hydrochimica et Hydrobiologica 2005, 33:9-16.
2. Damstra T, Barlow S, Bergman A, Kavlock RJ, Kraak G Van der: Glo-
bal Assessment of the State-of-the-Science of Endocrine Dis-
ruptors. International Programme on Chemical Safety, World Health
Organization: 2002; Geneva, Switzerland 2002:180.
3. Pickering AD, Sumpter JP: Comprehending endocrine disrupt-
ers in aquatic environments. Environmental Science & Technology
2003, 37(17):33 I1A-336A.
4. Jobling S, Nolan M, Tyler CR, Brighty G, Sumpter JP: Widespread
sexual disruption in wild fish. Environmental Science & Technology
1998, 32(17):2498-2506.
5. Folmar LC, Denslow ND, Rao V, Chow M, Crain DA, Enblom J, Mar-
cino J, Guillette LJ Jr: Vitellogenin induction and reduced serum
testosterone concentrations in feral male carp (Cyprinus
carpio) captured near a major metropolitan sewage treat-
ment plant. Environ Health Perspect 1996, 104(10):1096-1101.
6. Thorpe KL, Cummings RI, Hutchinson TH, Scholze M, Brighty G,
Sumpter JP, Tyler CR: Relative potencies and combination
effects of steroidal estrogens in fish. Environ Sci Technol 2003,
37(6):l 142-1149.
7. Ericson JF, Laenge R, Sullivan DE: Comment on "Pharmaceuti-
cals, Hormones, and Other Organic Wastewater Contami-
nants in U.S. Streams, 1999-2000: A National
Reconnaissance. Environmental Science and Technology 2002,
36(18):4005-4006.
8. Ankley GT, Brooks BW, Huggett DB, Sumpter JP: Repeating his-
tory: Pharmaceuticals in the environment. Environmental Sci-
ence & Technology 2007, 41 (24):821 1-8217.
9. Kolpin DW, Furlong ET, Meyer MT, Thurman EM, Zaugg SD, Barber
LB, Buxton HT: Pharmaceuticals, hormones, and other
organic wastewater contaminants in U.S. streams, 1999-
2000: A national reconnaissance. Environ Sci Technol 2002,
36(6):1202-121 I.
10. Pawlowski S, van Aerle R, Tyler CR, Braunbeck T: Effects of
17alpha-ethinylestradiol in a fathead minnow (Pimephales
promelas) gonadal recrudescence assay. Ecotoxicol Environ Saf
2004, 57(3):330-345.
I I. Fenske M, Maack G, Schafers C, Segner H: An environmentally
relevant concentration of estrogen induces arrest of male
gonad development in zebrafish, Danio rerio. Environ Toxicol
Chem 2005, 24(5): 1088-1098.
12. Lange R, Hutchinson TH, Croudace CP, Siegmund F, Schweinfurth H,
Hampe P, Panter GH, Sumpter JP: Effects of the synthetic estro-
gen 17 alpha-ethinylestradiol on the life-cycle of the fathead
minnow (Pimephales promelas). Environ Toxicol Chem 2001,
20(6):1216-1227.
13. Santos EM, Paull GC, Van Look KJW, Workman VL, Holt WV, Van
Aerle R, Kille P, Tyler CR: Gonadal transcriptome responses
and physiological consequences of exposure to oestrogen in
breeding zebrafish (Danio rerio). Aquatic Toxicology 2007,
83(2):134-142.
14. Parrott JL, Blunt BR: Life-cycle exposure of fathead minnows
(Pimephales promelas) to an ethinylestradiol concentration
below I ng/L reduces egg fertilization success and demascu-
linizes males. Environ Toxicol 2005, 20(2): 13 1-141.
15. Martyniuk CJ, Xiong H, Crump K, Chiu S, Sardana R, Nadler A, Gerrie
ER, Xia X, Trudeau VL: Gene expression profiling in the neu-
roendocrine brain of male goldfish (Carassius auratus)
exposed to 17alpha-ethinylestradiol. Physiol Genomics 2006,
27(3):328-336.


http://www. biomedcentral.com/1471-2164/10/308




16. Andersen L, Holbech H, Gessbo A, Norrgren L, Petersen GI: Effects
of exposure to 17alpha-ethinylestradiol during early devel-
opment on sexual differentiation and induction of vitello-
genin in zebrafish (Danio rerio). Comp Biochem Physiol C Toxicol
Pharmacol 2003, 134(3):365-374.
17. Weber LP, Balch GC, Metcalfe CD, Janz DM: Increased kidney,
liver, and testicular cell death after chronic exposure to
17alpha-ethinylestradiol in medaka (Oryzias latipes). Environ
Toxicol Chem 2004, 23(3):792-797.
18. Miller DH,Jensen KM, Villeneuve DL, Kahl MD, Makynen EA, Durhan
EJ, Ankley GT: Linkage of biochemical responses to popula-
tion-level effects: a case study with vitellogenin in the fat-
head minnow (Pimephales promelas). Environ Toxicol Chem
2007, 26(3):521-527.
19. Kidd KA, Blanchfield PJ, Mills KH, Palace VP, Evans RE, LazorchakJM,
Flick RW: Collapse of a fish population after exposure to a
synthetic estrogen. Proc Natl Acad Sci USA 2007,
104(21):8897-8901.
20. Filby AL, Neuparth T, Thorpe KL, Owen R, Galloway TS, Tyler CR:
Health impacts of estrogens in the environment, considering
complex mixture effects. Environ Health Perspect 2007,
115(12):1704-1710.
21. Filby AL, Thorpe KL, Maack G, Tyler CR: Gene expression profiles
revealing the mechanisms of anti-androgen- and estrogen-
induced feminization in fish. Aquat Toxicol 2007, 81(2):219-231.
22. Martyniuk CJ, Gerrie ER, Popesku JT, Ekker M, Trudeau VL: Micro-
array analysis in the zebrafish (Danio rerio) liver and telen-
cephalon after exposure to low concentration of 17alpha-
ethinylestradiol. Aquatic Toxicology 2007, 84(1):38-49.
23. Thomas P, Dressing G, Pang Y, Berg H, Tubbs C, Benninghoff A,
Doughty K: Progestin, estrogen and androgen G-protein cou-
pled receptors in fish gonads. Steroids 2006, 71 (4):3 10-316.
24. Braun AM, Thomas P: Androgens inhibit estradiol-17beta syn-
thesis in Atlantic croaker (Micropogonias undulatus) ovaries
by a nongenomic mechanism initiated at the cell surface. Biol
Reprod 2003, 69(5): 1642-1650.
25. Loomis AK, Thomas P: Effects of estrogens and xenoestrogens
on androgen production by Atlantic croaker testes in vitro:
evidence for a nongenomic action mediated by an estrogen
membrane receptor. Biol Reprod 2000, 62(4):995-1004.
26. Thomas P, Doughty K: Disruption of rapid, nongenomic steroid
actions by environmental chemicals: interference with pro-
gestin stimulation of sperm motility in Atlantic croaker. Envi-
ron Sci Technol 2004, 38(23):6328-6332.
27. Braun AM, Thomas P: Biochemical characterization of a mem-
brane androgen receptor in the ovary of the Atlantic croaker
(Micropogonias undulatus). Bio/Reprod 2004, 71(1):146-155.
28. Patino R, Thomas P: Characterization of membrane receptor
activity for 17 alpha, 20 beta, 21 -trihydroxy-4-pregnen-3-one
in ovaries of spotted seatrout (Cynoscion nebulosus). Gen
Comp Endocrinol 1990, 78(2):204-217.
29. Dukes M, Chester R, Yarwood L, Wakeling AE: Effects of a non-
steroidal pure antioestrogen, ZM 189,154, on oestrogen tar-
get organs of the rat including bones. J Endocrinol 1994,
141(2):335-341.
30. Marlatt VL, Hewitt LM, Kraak G Van Der: Utility of in vitro test
methods to assess the activity of xenoestrogens in fish. Envi-
ron Toxicol Chem 2006, 25(12):3204-3212.
31. Sabo-Attwood T, Blum JL, Kroll KJ, Patel V, Birkholz D, Szabo NJ,
Fisher SZ, McKenna R, Campbell-Thompson M, Denslow ND: Dis-
tinct expression and activity profiles of largemouth bass
(Micropterus salmoides) estrogen receptors in response to
estradiol and nonylphenol. J Mol Endocrinol 2007, 39(4):223-237.
32. Sismondi P, Biglia N, Ponzone R, Fuso L, Scafoglio C, Cicatiello L, Ravo
M, Weisz A, Cimino D, Altobelli G, et al.: Influence of estrogens
and antiestrogens on the expression of selected hormone-
responsive genes. Maturitas 2007, 57(1):50-55.
33. Wu F, Xu R, Martin J, Safe S: In vivo profiling of estrogen recep-
tor/specificity protein-dependent transactivation. Endocrinol-
ogy 2008, 149(I I):5696-5705.
34. Morales A, Gonzalez M, Marin R, Diaz M, Alonso R: Estrogen inhi-
bition of norepinephrine responsiveness is initiated at the
plasma membrane ofGnRH-producing GTI-7 cells. J Endocri-
nol 2007, 194(1):193-200.
35. Pang Y, Dong J, Thomas P: Estrogen signaling characteristics of
Atlantic croaker G protein-coupled receptor 30 (GPR30)



Page 15 of 17
(page number not for citation purposes)








BMC Genomics 2009, 10:308


and evidence it is involved in maintenance of oocyte meiotic
arrest. Endocrinology 2008, 149(7):3410-3426.
36. Hawkins MB, Thornton JW, Crews D, Skipper JK, Dotte A, Thomas
P: Identification of a third distinct estrogen receptor and
reclassification of estrogen receptors in teleosts. Proc NatI
Acad Sci USA 2000, 97(20): 1075 1-10756.
37. Nagler JJ, Cavileer T, Sullivan J, Cyr DG, Rexroad C 3rd: The com-
plete nuclear estrogen receptor family in the rainbow trout:
discovery of the novel ERalpha2 and both ERbeta isoforms.
Gene 2007, 392(1-2):164-173.
38. Sabo-Attwood T, Kroll KJ, Denslow ND: Differential expression
of largemouth bass (Micropterus salmoides) estrogen recep-
tor isotypes alpha, beta, and gamma by estradiol. Mol Cell
Endocrinol 2004, 218(1-2): 107- 18.
39. JukoskyJA, Watzin MC, LeiterJC: The effects of environmentally
relevant mixtures of estrogens on Japanese medaka (Oryzias
latipes) reproduction. Aquat Toxicol 2008, 86(2):323-33 I.
40. Lin LL, Janz DM: Effects of binary mixtures ofxenoestrogens on
gonadal development and reproduction in zebrafish. Aquat
Toxicol 2006, 80(4):382-395.
41. Sun L, Zha J, Wang Z: Effects of binary mixtures of estrogen and
antiestrogens on Japanese medaka (Oryzias latipes). Aquat
Toxicol 2009, 93(l):83-89.
42. Villeneuve DL, Larkin P, Knoebl I, Miracle AL, Kahl MD, Jensen KM,
Makynen EA, Durhan EJ, Carter BJ, Denslow ND, et al.: A graphical
systems model to facilitate hypothesis-driven ecotoxicoge-
nomics research on the teleost brain-pituitary-gonadal axis.
Environ Sci Technol 2007, 41 (I):321-330.
43. Desbrow C, Routledge EJ, Brighty GC, SumpterJP, Waldock M: Iden-
tification of estrogenic chemicals in STW effluent. I. Chem-
ical fractionation and in vitro biological screening.
Environmental Science & Technology 1998, 32(I I):1549-1558.
44. Kashiwada S, Ishikawa H, Miyamoto N, Ohnishi Y, Magara Y: Fish
test for endocrine-disruption and estimation of water quality
of Japanese rivers. Water Res 2002, 36(8):2161-2166.
45. Dukes M, Chester R, Yarwood L, Wakeling AE: Effects of a nons-
teroidal pure antiestrogen, ZM-189,154, on estrogen target
organs of the rat including bones. J Endocrinol 1994,
141 (2):335-341.
46. MacLatchy DL, Courtenay SC, Rice CD, Kraak GJ Van der: Develop-
ment of a short-term reproductive endocrine bioassay using
steroid hormone and vitellogenin end points in the estuarine
mummichog (Fundulus heteroclitus). Environ Toxicol Chem
2003, 22(5):996-1008.
47. Panter G, Hutchinson T, Lange R, Lye C, JP S, Zerulla M, Tyler C:
Utility of a juvenile fathead minnow screening assay for
detecting (anti-) estrogenic substances. Environmental Toxicol-
ogy and Chemistry 2002, 21 (2):319-326.
48. Nikitin A, Egorov S, Daraselia N, Mazo 1: Pathway studio the
analysis and navigation of molecular networks. Bioinformatics
2003, 19(16):2155-2157.
49. Wong MK, Ge W, Woo NY: Positive feedback of hepatic angi-
otensinogen expression in silver sea bream (Sparus sarba).
Mol Cell Endocrinol 2007, 263(1-2):103-1 11.
50. Krattenmacher R, Knauthe R, Parczyk K, Walker A, Hilgenfeldt U,
Fritzemeier KH: Estrogen action on hepatic synthesis of angi-
otensinogen and IGF-I: direct and indirect estrogen effects.
J Steroid Biochem Mol Biol 1994, 48(2-3):207-214.
51. Samsioe G: The endometrium: effects of estrogen and estro-
gen-progestogen replacement therapy. Int J Fertil Menopausal
Stud 1994, 39(Suppl 2):84-92.
52. Heikaus S, Winterhager E, Traub 0, Grummer R: Responsiveness
of endometrial genes Connexin26, Connexin43, C3 and clus-
terin to primary estrogen, selective estrogen receptor mod-
ulators, phyto- and xenoestrogens. J Mol Endocrinol 2002,
29(2):239-249.
53. Jin G, Howe PH: Transforming growth factor beta regulates
clusterin gene expression via modulation of transcription
factor c-Fos. Eurj Biochem 1999, 263(2):534-542.
54. Londou A, Mikrou A, Zarkadis IK: Cloning and characterization
of two clusterin isoforms in rainbow trout. Mol Immunol 2008,
45(2):470-478.
55. Wong P, PineaultJ, Lakins J, Taillefer D, LegerJ, Wang C, Tenniswood
M: Genomic organization and expression of the rat TRPM-2
(clusterin) gene, a gene implicated in apoptosis. J Biol Chem
1993, 268(7):5021-5031.


http://www. biomedcentral.com/1471-2164/10/308




56. Munoz-Canoves P, Vik DP, Tack BF: Mapping of a retinoic acid-
responsive element in the promoter region of the comple-
ment factor H gene. J Biol Chem 1990, 265(33):20065-20068.
57. Wang DY, McKague B, Liss SN, Edwards EA: Gene expression pro-
files for detecting and distinguishing potential endocrine-dis-
rupting compounds in environmental samples. Environ Sci
Technol 2004, 38(23):6396-6406.
58. Chaudhary J, Sadler-Riggleman I, Ague JM, Skinner MK: The helix-
loop-helix inhibitor of differentiation (ID) proteins induce
post-mitotic terminally differentiated Sertoli cells to re-
enter the cell cycle and proliferate. Biol Reprod 2005,
72(5):1205-1217.
59. Dong YL, Vegiraju S, Chauhan M, Yallampalli C: Expression of cal-
citonin gene-related peptide receptor components, calci-
tonin receptor-like receptor and receptor activity modifying
protein I, in the rat placenta during pregnancy and their cel-
lular localization. Mol Hum Reprod 2003, 9(8):481-490.
60. Zhang L, Rees MC, Bicknell R: The isolation and long-term cul-
ture of normal human endometrial epithelium and stroma.
Expression of mRNAs for angiogenic polypeptides basally
and on oestrogen and progesterone challenges. j Cell Sci 1995,
108(Pt 1):323-331.
61. Castro-Caldas M, Duarte CB, Carvalho AR, Lopes MC: 17beta-
estradiol promotes the synthesis and the secretion of
annexin I in the CCRF-CEM human cell line. Mediators Inflamm
2001, 10(5):245-251.
62. Huang EJ, Wu CC, Lee SD, Chen JH, Liu JY, Ko JL, Lin JA, Lu MC,
Chen LM, Huang CY, et al.: Opposing action of estrogen recep-
tors alpha and beta on tumor necrosis factor-alpha gene
expression and caspase-8-mediated apoptotic effects in
HA22T cells. Mol Cell Biochem 2006, 287(1-2):137-145.
63. Stevens TA, Meech R: BARX2 and estrogen receptor-alpha
(ESRI) co-ordinately regulate the production of alterna-
tively spliced ESR I isoforms and control breast cancer cell
growth and invasion. Oncogene 2006, 25(39):5426-5435.
64. Shah BH: Estrogen stimulation of COX-2-derived PG12 con-
fers atheroprotection. Trends Endocrinol Metab 2005,
16(5):199-201.
65. Durbin JE, Hackenmiller R, Simon MC, Levy DE: Targeted disrup-
tion of the mouse StatI gene results in compromised innate
immunity to viral disease. Cell 1996, 84(3):443-450.
66. Kim HS, Lee MS: STATI as a key modulator of cell death. Cell
Signal 2007, 19(3):454-465.
67. Shang Y, Baumrucker CR, Green MH: The induction and activa-
tion of STATI by all-trans-retinoic acid are mediated by
RAR beta signaling pathways in breast cancer cells. Oncogene
1999, 18(48):6725-6732.
68. Zhou Q, Atadja P, Davidson NE: Histone deacetylase inhibitor
LBH589 reactivates silenced estrogen receptor alpha (ER)
gene expression without loss of DNA hypermethylation.
Cancer Biol Ther 2007, 6(1):64-69.
69. Blair HC, Robinson LJ, Zaidi M: Osteoclast signalling pathways.
Biochem Biophys Res Commun 2005, 328(3):728-738.
70. Boon LM, Mulliken JB, Vikkula M: RASAI: variable phenotype
with capillary and arteriovenous malformations. Curr Opin
Genet Dev 2005, 15(3):265-269.
71. Hikimaj, Lennard ML, Wilson MR, Miller NW, Clem LW, Warr GW:
Evolution of vertebrate E protein transcription factors: com-
parative analysis of the E protein gene family in Takifugu
rubripes and humans. Physiol Genomics 2005, 21(2): 144-15 1.
72. Hurteau GJ, Carlson JA, Spivack SD, Brock GJ: Overexpression of
the microRNA hsa-miR-200c leads to reduced expression of
transcription factor 8 and increased expression of E-cad-
herin. Cancer Res 2007, 67(17):7972-7976.
73. Drabsch Y, Hugo H, Zhang R, Dowhan DH, Miao YR, Gewirtz AM,
Barry SC, Ramsay RG, Gonda TJ: Mechanism of and requirement
for estrogen-regulated MYB expression in estrogen-recep-
tor-positive breast cancer cells. Proc Natl Acad Sci USA 2007,
104(34):13762-13767.
74. Urano A, Endoh M, Wada T, Morikawa Y, Itoh M, Kataoka Y, Taki T,
Akazawa H, Nakajima H, Komuro I, et al.: Infertility with defective
spermiogenesis in mice lacking AF5q31, the target of chro-
mosomal translocation in human infant leukemia. Mol Cell Biol
2005, 25(1 5):6834-6845.





Page 16 of 17
(page number not for citation purposes)








BMC Genomics 2009, 10:308


http://www. biomedcentral.com/1471-2164/10/308


75. Hogarth CA, Calanni S, Jans DA, Loveland KL: Importin alpha
mRNAs have distinct expression profiles during sperma-
togenesis. Dev Dyn 2006, 235(1):253-262.
76. Yoon SO, Shin S, Liu Y, Ballif BA, Woo MS, Gygi SP, Blenis J: Ran-
binding protein 3 phosphorylation links the Ras and P13-
kinase pathways to nucleocytoplasmic transport. Mol Cell
2008, 29(3):362-375.
77. Fang WB, Brantley-Sieders DM, Hwang Y, Ham A, Chen J: Identifi-
cation and functional analysis of phosphorylated tyrosine
residues within EphA2 receptor tyrosine kinase. j Biol Chem
2008, 283(23):16017-16026.
78. Hemming JM, Waller WT, Chow MC, Denslow ND, Venables B:
Assessment of the estrogenicity and toxicity of a domestic
wastewater effluent flowing through a constructed wetland
system using biomarkers in male fathead minnows
(Pimephales promelas rafinesque, 1820). Environ Toxicol Chem
2001, 20(10):2268-2275.
79. Jensen KM, Korte JJ, Kahl MD, Pasha MS, Ankley GT: Aspects of
basic reproductive biology and endocrinology in the fathead
minnow (Pimephales promelas). Comp Biochem Physiol C Toxicol
Pharmacol 2001, 128(I):127-141.
80. Sokal R, Rohlf F: Biometry. New York: Freeman and Company;
1995.
81. Garcia-Reyero N, Barber DS, Gross TS, Johnson KG, Sepulveda MS,
Szabo NJ, Denslow ND: Dietary exposure of largemouth bass
to OCPs changes expression of genes important for repro-
duction. Aquat Toxicol 2006, 78(4):358-369.
82. Zahurak M, Parmigiani G, Yu W, Scharpf RB, Berman D, Schaeffer E,
Shabbeer S, Cope L: Pre-processing Agilent microarray data.
BMC Bioinformatics 2007, 8:142.
83. Benjamini Y, Hochberg Y: Controlling the false discovery rate -
a practical and powerful approach to multiple testing. j Roy
Stat Soc B Met 1995, 57(1):289-300.
84. Ankley GT, Jensen KM, Kahl MD, Makynen EA, Blake LS, Greene KJ,
Johnson RD, Villeneuve DL: Ketoconazole in the fathead min-
now (Pimephales promelas): reproductive toxicity and bio-
logical compensation. Environ Toxicol Chem 2007,
26(6):1214-1223.
85. Villeneuve DL, Blake LS, Brodin JD, Greene KJ, Knoebl I, Miracle AL,
Martinovic D, Ankley GT: Transcription of key genes regulating
gonadal steroidogenesis in control and ketoconazole- or vin-
clozolin-exposed fathead minnows. Toxicol Sci 2007,
98(2):395-407.
86. Martinovic D, Blake LS, Durhan EJ, Greene KJ, Kahl MD, Jensen KM,
Makynen EA, Villeneuve DL, Ankley GT: Reproductive toxicity of
vinclozolin in the fathead minnow: confirming an anti-andro-
genic mode of action. Environ Toxicol Chem 2008, 27(2):478-488.
87. Villeneuve DL, Knoebl I, Kahl MD, Jensen KM, Hammermeister DE,
Greene KJ, Blake LS, Ankley GT: Relationship between brain and
ovary aromatase activity and isoform-specific aromatase
mRNA expression in the fathead minnow (Pimephales
promelas). Aquat Toxicol 2006, 76(3-4):353-368.








Publish with BioMed Central and every
scientist can read your work free of charge
"BioMed Central will be the most significant development for
disseminating the results of biomedical research in our lifetime."
Sir Paul Nurse, Cancer Research UK
Your research papers will be:
available free of charge to the entire biomedical community
peer reviewed and published immediately upon acceptance
cited in PubMed and archived on PubMed Central
yours you keep the copyright

Submit your manuscript here: BioMedcentral
http://www.biomedcentral.com/info/publishingadv.asp


Page 17 of 17
(page number not for citation purposes)




University of Florida Home Page
© 2004 - 2010 University of Florida George A. Smathers Libraries.
All rights reserved.

Acceptable Use, Copyright, and Disclaimer Statement
Last updated October 10, 2010 - - mvs