Group Title: BMC Biotechnology
Title: Directed evolution of a filamentous fungus for thermotolerance
CITATION PDF VIEWER THUMBNAILS PAGE IMAGE ZOOMABLE
Full Citation
STANDARD VIEW MARC VIEW
Permanent Link: http://ufdc.ufl.edu/UF00099904/00001
 Material Information
Title: Directed evolution of a filamentous fungus for thermotolerance
Physical Description: Book
Language: English
Creator: de Crecy, Eudes
Jaronski, Stefan
Lyons, Benjamin
Lyons, Thomas
Keyhani, ENemat
Publisher: BMC Biotechnology
Publication Date: 2009
 Notes
Abstract: BACKGROUND:Filamentous fungi are the most widely used eukaryotic biocatalysts in industrial and chemical applications. Consequently, there is tremendous interest in methodology that can use the power of genetics to develop strains with improved performance. For example, Metarhizium anisopliae is a broad host range entomopathogenic fungus currently under intensive investigation as a biologically based alternative to chemical pesticides. However, it use is limited by the relatively low tolerance of this species to abiotic stresses such as heat, with most strains displaying little to no growth between 35–37°C. In this study, we used a newly developed automated continuous culture method called the Evolugator™, which takes advantage of a natural selection-adaptation strategy, to select for thermotolerant variants of M. anisopliae strain 2575 displaying robust growth at 37°C.RESULTS:Over a 4 month time course, 22 cycles of growth and dilution were used to select 2 thermotolerant variants of M. anisopliae. Both variants displayed robust growth at 36.5°C, whereas only one was able to grow at 37°C. Insect bioassays using Melanoplus sanguinipes (grasshoppers) were also performed to determine if thermotolerant variants of M. anisopliae retained entomopathogenicity. Assays confirmed that thermotolerant variants were, indeed, entomopathogenic, albeit with complex alterations in virulence parameters such as lethal dose responses (LD50) and median survival times (ST50).CONCLUSION:We report the experimental evolution of a filamentous fungus via the novel application of a powerful new continuous culture device. This is the first example of using continuous culture to select for complex phenotypes such as thermotolerance. Temperature adapted variants of the insect-pathogenic, filamentous fungus M. anisopliae were isolated and demonstrated to show vigorous growth at a temperature that is inhibitory for the parent strain. Insect virulence assays confirmed that pathogenicity can be retained during the selection process. In principle, this technology can be used to adapt filamentous fungi to virtually any environmental condition including abiotic stress and growth substrate utilization.
General Note: Start page 74
General Note: M3: 10.1186/1472-6750-9-74
 Record Information
Bibliographic ID: UF00099904
Volume ID: VID00001
Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: Open Access: http://www.biomedcentral.com/info/about/openaccess/
Resource Identifier: issn - 1472-6750
http://www.biomedcentral.com/1472-6750/9/74

Downloads

This item has the following downloads:

PDF ( PDF )


Full Text




BMC Biotechnology Bioled Central


Research article


Directed evolution of a filamentous fungus for thermotolerance
Eudes de Crecy', Stefan Jaronski2, Benjamin Lyons', Thomas J Lyons' and
Nemat 0 Keyhani* 3


Address: 'Evolugate LLC, 2153 SE Hawthorne Road, 15 Gainesville, FL, 32641, USA, 2USDAARSNPARL, 1500 N. Central Ave., Sidney MT 59270,
USA and 3Department of Microbiology and Cell Science, University of Florida, Gainesville, FL 32611, USA
Email: Eudes de Crecy acp@evolugate.com; Stefan Jaronski Stefan.Jaronski@ARS.USDA.GOV; Benjamin Lyons blyons@evolugate.com;
Thomas J Lyons tomlyons@evolugate.com; Nemat 0 Keyhani* keyhani@ufl.edu
* Corresponding author



Published: 26 August 2009 Received: 17 April 2009
BMC Biotechnology 2009, 9:74 doi:10.1 186/1472-6750-9-74 Accepted: 26 August 2009
This article is available from: http://www.biomedcentral.com/1472-6750/9/74
2009 de Crecy et al; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.ore/licenses/by/2.0),
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.



Abstract
Background: Filamentous fungi are the most widely used eukaryotic biocatalysts in industrial and
chemical applications. Consequently, there is tremendous interest in methodology that can use the
power of genetics to develop strains with improved performance. For example, Metarhizium
anisopliae is a broad host range entomopathogenic fungus currently under intensive investigation as
a biologically based alternative to chemical pesticides. However, it use is limited by the relatively
low tolerance of this species to abiotic stresses such as heat, with most strains displaying little to
no growth between 35-37C. In this study, we used a newly developed automated continuous
culture method called the EvolugatorTM, which takes advantage of a natural selection-adaptation
strategy, to select for thermotolerant variants of M. anisopliae strain 2575 displaying robust growth
at 37C.
Results: Over a 4 month time course, 22 cycles of growth and dilution were used to select 2
thermotolerant variants of M. anisopliae. Both variants displayed robust growth at 36.5C, whereas
only one was able to grow at 37C. Insect bioassays using Melanoplus sanguinipes (grasshoppers)
were also performed to determine if thermotolerant variants of M. anisopliae retained
entomopathogenicity. Assays confirmed that thermotolerant variants were, indeed,
entomopathogenic, albeit with complex alterations in virulence parameters such as lethal dose
responses (LD50) and median survival times (STso).
Conclusion: We report the experimental evolution of a filamentous fungus via the novel
application of a powerful new continuous culture device. This is the first example of using
continuous culture to select for complex phenotypes such as thermotolerance. Temperature
adapted variants of the insect-pathogenic, filamentous fungus M. anisopliae were isolated and
demonstrated to show vigorous growth at a temperature that is inhibitory for the parent strain.
Insect virulence assays confirmed that pathogenicity can be retained during the selection process.
In principle, this technology can be used to adapt filamentous fungi to virtually any environmental
condition including abiotic stress and growth substrate utilization.






Page 1 of 11
(page number not for citation purposes)


70p7en7A7c







http://www.biomedcentral.com/1472-6750/9/74


Background
Filamentous fungi are among the most widely used whole
cell biocatalysts in a host of agricultural, food, environ-
mental and bioenergy related applications [1,2]. Not sur-
prisingly, there is tremendous interest in manipulating the
genetics of fungi to improve their industrial performance.
Unfortunately, traditional methods of genetic engineering
are expensive, slow and manually intensive. Moreover,
fungi possess complex regulatory circuits that intimately
control cellular growth and metabolism. Consequently,
single, or even multiple directed mutations often fail to
produce the desired results. Newer methods, such as gene
prospecting [3], have been developed that are higher
throughput, however such methods are still limited by the
fact that many favorable phenotypes, like sustained ther-
motolerance, often require genome-wide changes [4] that
are difficult to select for by inserting individual genes or
even groups of genes. The only practical way to alter such
complex phenotypes is using continuous culture to select
for genetic variants that can adapt to gradual changes in
environmental conditions in essence, harnessing the
power of evolution by natural selection [5].

There are two widely used methods for continuous cul-
ture, serial dilution and chemostats, both of which are
plagued by serious limitations that prevent their use for
experimental evolution. For a detailed discussion of these
limitations see de Crecy et al., 2007 [6]. Serial dilution
requires the periodic transfer of a random sampling of
cells to a new vessel and, consequently, is troubled by con-
tamination problems. While serial dilution has been used
to experimentally evolve filamentous microbes on plates
[7], this methodology cannot be used in liquid cultures
because the cells form aggregates and individual cells can-
not be randomly chosen for dilution. Chemostats and
similar continuous culture devices are closed systems and
are not plagued by contamination. Indeed, filamentous
fungi have been cultured in chemostats [8]. However, fil-
amentous fungi prefer to grow on solid surfaces and they
readily adhere to the walls of chemostats, thus evading
dilution as well as forming heterogeneous populations.
Wall growth, even small amounts of it, limits the length of
time cells can spend adapting in a chemostat, making the
technology inadequate for long-term adaptation.

A new method of continuous culture, called the Evoluga-
torf, has been developed that circumvents many of the
problems associated with serial dilution and chemostat
technology [6]. More importantly, the Evolugator" is, in
principle, capable of culturing filamentous fungi continu-
ously ad infinitum without wall growth becoming prob-
lematic. This technology represents a critical
breakthrough for industrial mycology, allowing the devel-
opment of fungal strains for virtually any application.


Herein, we report the first application of the EvolugatorM
technology for the evolutionary adaptation of filamen-
tous fungi of commercial importance. The use of the ento-
mopathogenic fungus Metarhizium anisopliae as a
biological alternative to chemical pesticides has gained
prominence and commercialized products based upon
the fungus are available worldwide [9 -11]. As a species, M.
anisopliae has a broad host range that includes over 900
insects species and includes ticks, mites, and other mem-
bers of the class Arachnida, although many individual
strains have a narrower host range [9,12,13]. Commercial
M. anisopliae formulations have been developed as biolog-
ical control agents for various beetles, cockroaches, wee-
vils, termites, flies, gnats, thrips and ticks [ 10,14]. In other
countries, M. anisopliae has been applied for the control of
grasshoppers, locusts, cockchafers, grubs, borers and even
malaria-vectoring mosquitoes [15-19].

Despite their potential, however, several factors have hin-
dered widespread adoption of fungi as part of biological
control regimes. In particular, efficacy against certain
insects is impeded by the relatively low resistance of these
fungi to elevated temperatures [20,21]. Thermotolerance
is important because some insects can elevate their body
temperatures above ambient, particularly when diseased,
either as part of their innate immune response or by bask-
ing in sunlight; a phenomenon termed "behavioral fever"
[22-25]. Since the upper thermal limit for conidial germi-
nation and growth of many commercially useful fungi is
generally 32-34C [26-28], this represents an effective
means of staving off fungal infections. It is also important
to note that non-thermotolerant fungi are not effective in
tropical and subtropical climates where ambient temper-
atures exceed those that permit fungal growth.

Not surprisingly, significant resources have been dedi-
cated to developing methods for genetic engineering and
other manipulation of M. anisopliae to improve its efficacy
as a biocontrol agent [29-33]. Of particular interest is the
development of thermotolerant strains that can both
evade the host thermal response and retain efficacy in hot
climates. This is the ideal problem to test the power of the
EvolugatorTM technology, which uses flexible tubing as a
culture chamber. Since both the tubing and medium is
changed with every dilution cycle, the EvolugatorM can, in
principle, allow the growth and selection of fast-growing
variants of filamentous fungal cells that could use the tub-
ing as a solid surface upon which to grow [6]. As a proof-
of-principle regarding the EvolugatorM technology, we
adapted Metarhizium anisopliae strain ARSEF2575 (USDA
ARS Insect Pathogenic Fungus Collection, Ithaca, NY),
whose normal upper thermal limit for growth is 32 C, to
grow at 37 C.




Page 2 of 11
(page number not for citation purposes)


BMC Biotechnology 2009, 9:74







http://www.biomedcentral.com/1472-6750/9/74


Results
Selection of thermostable M. anisopliae isolates
An actively growing culture of M. anisopliae was inocu-
lated inside the EvolugatorTM growth chamber at 28 C as
described in the Methods section. Growth was monitored
by optical density (OD) and dilution cycles were initiated
according to OD or cycle duration. Figure 1 presents a
detailed description of 22 successive selection cycles over
a 4 month period. For each cycle, the temperature of the
culture chamber was recorded as well as the starting OD
and ending OD. The starting OD is always low because
the cells have just been diluted with fresh medium. The
ending OD is higher because the cells have multiplied.
Figure 1 also shows the duration of each dilution cycle,
which is the length of time the cells are allowed to grow
prior to initiating a new dilution cycle.

The fungus displayed rapid growth characteristics in cycles
1-4 where the temperature increased from 28 C to 30 C.
During these cycles the culture duration was 1-2 days.
Beginning at cycle 5, however, the growth rate slowed
down as evidenced by an increase in the amount of time
it takes to grow enough cells to initiate a dilution. This
indicated that it was taking longer for favorable variants to
take over the population. Moreover, the maximal cell
yield (OD) dropped significantly during cycles 7 (31 C)
and 8 (32oC), even though cells were allowed to grow for
over 200 hours each time, indicating decreased overall fit-



I OD cyde staring 135 5
mm OD cvde ending
25 --Temperature 166


20
70
Optical 33
Density 15 --- -
69 13 23 133
10-- -5
I 237 237


5 ^1- -^^ ^ J ,


ness. In cycles 8 and 9, the chamber temperature was not
varied significantly in order to allow variants that can
grow rapidly at this temperature to take over the popula-
tion. Similar phenomena, where cycle duration needed to
be increased and temperature stabilized to allow fast
growing variants to take over, were also seen in cycles 16
(34.60C) and 20 (380C). Two strains, termed EVG016
and EVG017 were isolated from cells cultured in cycles 18
and 22, respectively. Sequencing of the ITS1 and a frag-
ment of the M. anisopliae specific protease Pri genes
revealed that both isolates were derivatives of the original
wild type strain.

Phenotypic characterization of M. anisopliae
thermostable isolates
Isolates EVG016 and EVG017 were streaked on Potato-
dextrose agar (PDA) plates. Wild-type M. anisopliae
(2575) typically produces green pigmented spores
conidiaa) within 3-5 days of cultivation on these plates.
EVG016 produced colonies that appeared less green than
the wild-type, whereas EVG017 produced white colonies
with occasional spores visible at colony fringes or at the
center of the colony. Microscopic examination revealed
reduced spore production in EVG017. Conidial produc-
tion in replicated solid substrate fermentation confirmed
reduced sporulation. EVG016 produced a mean of 7.7 x
1011 conidia/kg barley substrate versus 3.9 x 1012 for the
parent strain, a statistically significant difference (P < 0.05,



89 77 95 90 94 104 332 96 40

35

30
25

S__ 20 Temp
(C)
169 385- 15

10
394
- ~- ~ -1-


1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22
Cycle number


Figure I
Directed evolution of thermotolerant M. anisopliae isolates. The temperature (red line), the starting OD (blue bar
graph) and the OD at the time of initiation of the dilution cycle (green graph) are plotted versus the cycle number. The length
of time (hr) of each cycle before dilution is shown above the OD values for each cycle.



Page 3 of 11
(page number not for citation purposes)


BMC Biotechnology 2009, 9:74







http://www.biomedcentral.com/1472-6750/9/74


Student t-test). EVG017 produced less than 1% of the
spores of the wild-type strain. We isolated a variant of
EVG017, named EVG017g, that retained thermotolerance
but was as capable of conidiation as wild type (See
below).

The growth characteristics of the wild-type parent,
EVG016 and EVG017 in liquid media were examined at
various temperatures. All three strains displayed similar
growth kinetics at 28C, whereas only EVG016 and
EVG017 displayed robust growth at 36.5C (Figure 2).
Only EVG017 grew at 37C and no growth was evident
for any of the strains at 38 C, indicating a narrow thresh-
old for the adaptive response. In contrast, neither the
wild-type nor the heat adapted strains displayed apprecia-
ble radial growth at 36-37C when plated on solid (agar)
media, although all displayed similar growth kinetics at
28 C. The strains did remain viable, and radial growth on
plates was evident after a short lag period when plates
were shifted from 37C to 280C (data not shown).
Microscopic examination of the growth of the adapted
and wild-type strains revealed that whereas both the wild-
type and EVG016 germinated and grew across the surface


c 0.8
0.6
a 0.4
"S 0.2
S0.0


0 50 100 150
Time (hr)


200 250


aI,-


S1.0-
0.8 -
0.6 -
a 0.4 -
0.2 -
C 0.0
0


- Ma2575
----- EVG016
- -EVG017


Temp= 37C
..0 .0


of the agar, EVG017 displayed more rapid formation of
appressoria than the parent and the fungal hyphae of this
strain appeared to begin to penetrate the agar during the
initial stages of growth. The two adapted strains also dis-
played different hyphal morphologies. Microscopic exam-
ination of the growing cells (in liquid culture) revealed
short-tubular growth of EVG016 at 370C, whereas
EVG017 at 37 C appeared similar to wild-type grown at
28 oC (Figure 3). Interestingly, our results indicate that the
wild-type strain was able to germinate at 37 o C, but failed
to subsequently grow.


"EM
*j 4 ^.VKi
-A-^Sr


----------


0 50 100
Time (hr)


4


150 200


Figure 2
Growth curves at 36.5*C (A) and 37*C (B) of wild-
type and temperature adapted M. anisopliae isolates.
Growth experiments were performed using a high-through-
put Bioscreen C plate reader and are the averages of at least
30 independent growth curves each for three independent
batches of fungal conidia (>90 cultures).


p~.


I

I


Figure 3
Differential interference contrast (DIC) images of
wild-type and temperature adapted M. anisopliae
strains grown at 37C. EVG016 2 d (A) and 5 d (B),
EVG0 17 2 d (C) and 5 d (D), Wild-type 2575 2 d (E) and 5 d
(F). Bar = 20 prm.


Page 4 of 11
(page number not for citation purposes)


Lk


BMC Biotechnology 2009, 9:74


Is


*







http://www.biomedcentral.com/1472-6750/9/74


Insect bioassays
Insect bioassays against the Migratory Grasshopper,
Melanoplus sanguinipes, were performed using the wild-
type and adapted strains. Due to the reduced sporulation
of EVG017, not enough spores could be directly harvested
for insect bioassays. Therefore, the strain was passage
once through M. sanguinipes by rubbing the abdomen of
host insects on an agar culture of EVGO 17. The fungus was
then re-isolated from an insect cadaver after 6 d incuba-
tion and single spores isolated. The resultant strain,
EVG017g, yielded satisfactory sporulation on solid sub-
strate at 28 oC (1.61 x 1012 conidia/Kg barley), displayed
the same growth kinetics and morphology as EVG017 (at
28 o C and 37 o C) and was therefore used for the insect bio-
assays.

Infectivity and virulence of the wild type, EVG016 and
EVG017g was evaluated using a topical 5-dose bioassay
with doses bracketing the approximate LD5s based on
exploratory assays (see Methods). Both EVG016 and
EVG017g displayed lowered infectivity as expressed by
greater LD5s values compared to the wild-type parent,
although due to the slopes of the dose-response curves the
effect was dramatically reduced at LD95 values (Figure 4,
Table 1). Given that most biological control regimes
require >90% mortality towards target insect in order to
be effective, the latter values, may in fact be more impor-
tant.

Virulence at 28C, in terms of Median Survival Time
(ST5o) calculated using Kaplan Meier Survivorship Analy-
sis [34], showed overall significant differences among the
three fungal strains (Logrank Test Chi Square 16.45, 2 df,
p = 0.0003). EVG017g had a significantly faster kill (ST5o),
5.5 d (95% Confidence Limits of 5.0-6.0 d), compared to
7 d (95% Confidence Limits of 7.0-7.0 d) for the wild-
type parent (Logrank Test, S = -15.12; p = 0.0001), for a
decrease of 20%. The ST5o value for EVG016, 6.0 d (95%
Confidence Limits 6.0-7.0 d), was also significantly lower


than that of the wild type (Logrank Test S = -9.0632, p =
.025). EVG016 and EVG017g were not significantly differ-
ent from each other (Logrank Test, S = 7.032; p = 0.063).
The LDso and ST5s of EVG017g may have been affected by
its passage through and reisolation from a grasshopper.
Nevertheless, EVG017g still demonstrated reduced infec-
tivity as did EVGO 16. None of the strains were pathogenic
or able to cause mortality in hosts at 36C. However,
when insects infected at 36 oC were subsequently placed at
28C, the hosts were rapidly killed by all three fungal
strains, indicating that the wild type and adapted strains
remained viable at 36 o C, but could not cause pathogenic-
ity and death.

Discussion
Although there are a few technologies that can be used to
experimentally adapt and/or select organisms for specific
characteristics, these have been for the most part limited
to short-term experiments. Both serial dilution and chem-
ostats have critical limitations that make long-term evolu-
tionary adaptation impossible. For serial dilution, this
limitation is the high probability of contamination. For
chemostats, this limitation is the "wall growth" problem.
These problems are particularly problematic for continu-
ously culturing adherent cells like filamentous fungi,
although there are examples of both being used for the
short term selection of filamentous fungi [7,8]. The Evolu-
gator" circumvents the contamination problem because
the culture chamber is a continuous length of flexible tub-
ing and cultures are never exposed to the outside. Further-
more, wall growth is not an issue for the Evolugator"
because the majority of the "wall" is replaced with each
dilution. This means that cells can be cultured continu-
ously for very long periods of time, allowing for the selec-
tion of complicated traits that cannot be achieved with
short-term experimental evolution.

The Evolugator" is the ideal method for selecting variants
of filamentous fungi with complex phenotypes. The avail-


Table I: Lethal dose response data derived from topical bioassays of the parent M. anisopliae ARSEF2575, EVGO 16 and EVGO 17g
strains with adult M. sanguinipes grasshoppers at 28*C.


Assay LDso


I 799
2 1,815
mean (S.D.) 1,307 (718)
I 25,453
2 19,758
mean (S.D.) 22,605 (4,027)
I 8,939
2 14,007
mean (S.D.) 11,473
(3,584)


95% CL


63-1,722
1,174-3,042

19,600-41,000
14,000-2.7400

4,425-13,194
4,365-25,838


Slope (SE) Chi Sqr


1.46 (0.51) 0.04 10,599
1.60 (0.24) 1.55 19,503
15,051 (6,296)
3.73 (0.82) 0.75 70,257
2.55 (0.37) 2.89 87,347
78,802 (12,084)
2.50 (0.64) 0.71 40,787
1.62 (0.41) 2.35 145,180
92,983 (73,817)


Units for LD and confidence levels: conidia/insect. Data are derived from two replicate bioassays using a total of 120-150 insects/bioassay.


Page 5 of 11
(page number not for citation purposes)


M.a. strain


2575


EVGO 16


EVGO 17g


95% CL


4,415-36,196
9.279-68,978

50,534-138,856
57,234-169,968

25,601-127,114
71,373-765,860


BMC Biotechnology 2009, 9:74








http://www.biomedcentral.com/1472-6750/9/74


100%
90%
80%
70%
60%
50%
40%
30%
20%
10%
0%


4 6 8 1
Day after infection


0 12 14 16


Figure 4
Mortality assays of wild-type and temperature adapted M. anisopliae isolates. Insect bioassays were performed
using the migratory grasshopper, Melanoplus sanguinipes as described in the Methods section. The cumulative mortality over
time is plotted for each strain with bioassays performed at 280C and 36C as indicated.


ability of a robust selection method for filamentous fungi
is an important new tool for directed adaptation that
could have significant applications ranging from
improved industrial strains to the examinations of the
mechanisms that underlie evolution in eukaryotic organ-
isms. In this report, we demonstrate the successful adapta-
tion of a filamentous fungus for thermotolerance as
proof-of-principle that the technology can be applied for
this purpose. Samples taken during the adaptation phase
yielded two thermostable isolates with different pheno-
typic characteristics, although both were able to grow at
36.5C, whereas the parental isolate could not. To our
knowledge, this is the first report of the directed adapta-
tion of a filamentous fungus for a complex phenotype via
continuous culture.

Analysis of secondary non-selected traits, such as conidia-
tion and virulence, revealed complex consequences of
thermal adaptation. For example, EVG016 showed
decreased infectivity when compared to wild type as
measured by LDso, yet was not significantly less infective
than wild type as measured by LD95. These results could
simply be due to the long term culture of EVG016 in rich
liquid media, conditions that are known to be able to
cause attenuation of pathogenicity. However, the ST5s
value for EVG016 was significantly lower than that of
wild-type, i.e. it was a better pathogen. Absent additional
thermotolerant isolates it is difficult to determine if the
increased pathogenicity is associated with the thermotol-
erant phenotype or was a trait that was selected for seren-
dipitously. EVG017, our second isolate from the same
lineage, showed greatly impaired conidiation that could,
in part, be offset or recovered by passage of the adapted
isolate through an insect host. Remarkably, the resulting


variant, EVG017g, maintained thermotolerance after pas-
sage through the insect and showed increased virulence
compared to the non-insect passage parent strain as
measured by ST5s. The LD5s remained higher than wild-
type, but was lower than that of EVG016. The most likely
explanation for these results is that the increased virulence
of EVG017g was acquired during passage through the
insect rather than during the thermal adaptation. Another
possibility is that the increased infectivity (STs0) is an
independent trait that arose in the lineage prior to the iso-
lation of EVG016. A final possibility is that the enhanced
infectivity is linked to the thermolerant trait. Much more
work needs to be done to distinguish between these pos-
sibilities. However, we have shown that virulence can be
recovered following loss due to the thermal adaptation
protocol.

While the purpose of this experiment was to produce ther-
motolerant strains, the eventual goal is to produce better
entomopathogens by generating variants that can sustain
the insect thermal response. It is intriguing to speculate
that the changes we measured in virulence parameters are
related to the acquisition of thermotolerance. To test this,
we reared the infected M. sanguinipes at 36-37C to
mimic the insects' ability to thermoregulate to a tempera-
ture that is the new upper threshold of the evolved strains.
Measurements of body temperature revealed that the
insects maintained a constant body temperature that was
in equilibrium with the cage temperature (36-36.5C).
Despite their confirmed thermotolerance, the adapted
variants did not show increased virulence at 36-37C,
indicating that the ability to grow in vitro at 36- 37 C does
not necessarily mean that in vivo growth and pathogenesis
will occur.



Page 6 of 11
(page number not for citation purposes)


_-&-Ma2575 281C -
--A EVG01 6 28C -
--g-EVG017 28C -
-a Ma2575 36C -
-6 EVG016 36cC
-0 EVG01 7 36cC
2 --- 13 --- 13 --- 2 --- 8 --- 2 --- 2 --- 13 --- El
n


BMC Biotechnology 2009, 9:74







http://www.biomedcentral.com/1472-6750/9/74


It should be noted that the selection was not directed
towards an insect target, simply for growth in a rich broth
liquid medium at previously non-permissive tempera-
tures. We hypothesize that insect target specificity and/or
virulence might be increased via continuous culture adap-
tation on specific insect cuticular extracts as the growth
substrate. Alternately, the technology can be applied to
adapt strains for greater resistance to abiotic stresses such
as UV-irradiation. All of these approaches can be
employed be obtain better biocontrol agents via continu-
ous culture.

From a population biology and genetic framework, within
our experimental set-up any novel mutation in a popula-
tion of cells will spread, ultimately replacing the wild-
type, at a rate dependant upon the growth advantage it
has. This growth advantage is itself a variable dependant
upon the selective pressure. Thus, for a given mutation
with a frequency of 1/N, where N is the number of cells in
the population, the ability of the observer to detect an
overall population of cells with the altered growth rate
may appear to be stepwise although it is likely to be a
reflection of changes in the frequency of the mutant in the
population, since it takes as long to change from a fre-
quency of 1/1000 to 1/100 as it takes to change from 1/
100 to 1/10, with the former change likely undetectable,
whereas the latter would be visible by the observer. This
issue would be further complicated by instances in which
multiple variants with ranges of growth advantages might
arise, resulting in mixed populations of variants at discrete
stages, although presumably if the selection occurs for
long enough one variant will take over.

It is likely that more than one evolutionary pathway to
thermotolerance exists and the EvolugatorTM could be used
to probe this interesting question. Essentially, the Evolu-
gatorTM selects for variants with positive growth rates over
those with zero or negative growth rates. During our adap-
tation experiment it was noted that it takes longer for
favorable variants to take over during certain cycles,
appearing to indicate that the evolution is occurring in
discrete steps, although this may be inaccurate. For exam-
ple, we observed that for most incremental increases in
temperature, the selection for faster growing variants was
rapid and took roughly the same amount of time. How-
ever, at certain temperatures (32 C, 36.5 C and 37.5 C),
it took longer for favorable variants to take over, hence
these temperatures were considered as thermal barriers,
perhaps requiring multiple or complex mutations to arise
in the population. It is possible that a different evolution-
ary pathway might encounter different thermal barriers.
More experiments are needed to determine if these tem-
peratures represent concrete barriers or if they are an arti-
fact of the peculiar evolutionary pathway taken in our
experiment. It will also be important to compare the


genome sequence of the thermotolerant variants with that
of wild type to determine the genetic changes involved in
the acquisition of thermotolerance.

Conclusion
We report the successful directed adaption of a eukaryotic
organism, namely the filamentous fungus, M. anisopliae,
for increased thermotolerance using a novel continuous
culture machine whose operation is fundamentally differ-
ent from chemostats and other current methods. The
selection regime had no a priori suppositions regarding
the mutation(s) required and it remains to be seen how
many different mutational pathways can lead to thermo-
tolerance. Experiments isolating additional thermotoler-
ant mutants should be able to shed light on this issue.
Selected mutants displayed complex phenotypes with
respect to non-selected attributes such as conidiation and
virulence, although both parameters could be retained or
recovered while maintaining the thermotolerant pheno-
type.

The immediate goal of future research will be to generate
"designer" strains of entomopathogenic fungi that are
more efficient biocontrol agents than currently used wild
type strains for specific insect infestations and defined
environmental conditions. Such strains would have sig-
nificant advantages over other types of insecticide cur-
rently in use. First, because these strains are more specific
for insect species and environmental conditions, less
agent would be required to achieve the same result. Sec-
ond, since they are biological control agents, they would
lack the environmental impact of chemical pesticides.
Third, these strains would be generated by the same mech-
anism that drives natural selection and, consequently,
they will not carry the stigma of genetically-engineered
products.

In theory, this technology can be applied for the adapta-
tion of any cultivatable eukaryotic organism to specific
selection and growth conditions. For example, the ther-
mostability of eukaryotic microorganisms remains an
important engineering constraint in a variety of biocata-
lytic applications, such as the conversion of lignocellu-
losic biomass to desirable end-products like biofuels.
Accordingly, long-term research goals involve expanding
the use of this technology to other important biotechno-
logical problems.

Methods
Isolation of thermotolerant M. anisopliae and
determination of growth kinetics
The details of how the EvolugatorM achieves continuous
culture and the inherent advantages of this technology
over other methods of continuous culture are extensively
described elsewhere [6]. However, since the technology is


Page 7 of 11
(page number not for citation purposes)


BMC Biotechnology 2009, 9:74







http://www.biomedcentral.com/1472-6750/9/74


so new, it is important to summarize how it works. Briefly,
directed selection occurs inside a growth chamber made
of 100% silicone tubing (12.7 mm external diameter and
9.5 mm internal diameter, Saint Gobain, France) that is
flexible, transparent and gas-permeable. The tubing is
filled with growth medium and sterilized prior to mount-
ing into the EvolugatorT, where it is subdivided using
"gates", which are clamps that prevent the flow of
medium and cultured organisms from one subdivision to
the next. Between the central gates is the "growth cham-
ber", which has a volume of ~10.8 mL. Oxygenation of
the growth chamber is augmented beyond the permeabil-
ity of the tubing by maintaining a 1.8 mL ( 5%) bubble
of filtered air in the growth chamber. Cultures are inocu-
lated into the growth chamber through the tubing using
sterilized syringes. The growth medium and the inner sur-
face of the tubing are static with respect to each other, and
both are regularly and simultaneously replaced by peri-
staltic movement of the tubing through the gates. A fresh
air bubble is delivered with each dilution cycle by move-
ment of air in predetermined volumes through the
unused portion of media upstream of the growth cham-
ber.

In summary, the gates are periodically released allowing
unused medium to mix with saturated culture. The tubing
is then moved and the gates reclosed essentially, the
majority of the medium and growth chamber are entirely
replaced during every dilution cycle. In the "new growth
chamber", culture is diluted with unused medium. The
"old' growth chamber is now what is called the "sampling
chamber" from which samples can be extracted by syringe
without fear of contaminating the "new growth chamber".

Dilutions were conducted automatically and controlled
through specifically designed software. Dilution can be
initiated at a certain cycle duration (chemostat mode),
when the culture attains a certain OD (turbidostat mode)
or a combination of both. Two turbidimeters (X = 680
nm, power = 0.7 V) (EFS, Montagny, France) measure the
optical density and are zeroed with unused growth
medium prior to each experiment.

Since filamentous fungi adhere to solid surfaces, they
grow along the inner surface of the "growth chamber".
Since the cells from the previous cycle adhere closest to
the gate separating the "sampling chamber" and the "new
growth chamber", dividing cells will grow along the fresh
chamber surface towards the gate separating the "new
growth chamber" from unspent medium. Consequently,
the cells that reach this gate by growing along the surface
are the most recent (and presumably most fit) additions
to the population and will be retained in the active culture
when the tubing moves again to achieve the next dilution.


For directed evolution of M. anisopliae, the tubing was
filled with Sabouraud dextrose (SAB) media and auto-
claved prior to use. 2 mL of a growing culture of M. anisop-
liae 2575 grown in SAB was injected into the first section
of the growth chamber and dilution cycles were initiated
as described. Temperature was monitored using a PT100
probe (IEC/Din Class A) and regulated via a Proportional
Integral & Derivative controller (West P6100). Growth
kinetics were determined using a Bioscreen C plate reader
system (Growth Curves USA, Piscataway, NJ) in multiple
volumes of 250-300 gL. Aliquots of growing cultures
were mounted on slides and examined using a PASCAL
LSM5 confocal microscope fitted with Nomarski differen-
tial interference contrast (DIC) optics.

Identification of recovered adapted fungal strains
Single isolated fungal colonies (corresponding to
EVG016, EVG017, and EVG017g) were re-streaked onto
fresh Potato dextrose agar plates and used for identifica-
tion purposes. Fungal identity was confirmed by PCR
amplification and sequencing of a portion of the 5.8 S
rRNA with its flanking internal transcribed spacer
sequences (ITS) and the M. anisopliae specific protease Pri
as described [35,36]. Primer pairs used were: (1) ITS5; 5'-
gcaagtaaaagtcgtaacaagg, and ITS4; 5'-tcctccgcttattgatatgc-3'
and (2) Prif, 5'-gccgacttcgtttacgagcac, and Prir, 5'-ggag-
gcctcaataccagtgtc. Genomic DNA was isolated using the
Qiagen DNeasy Plant mini-extraction kit according to the
manufacturer's protocols (Qiagen Inc., Valencia, CA).
PCR reactions were performed using ExTaq DNA
polymerase (Takara Corp., obtained from Fisher Sci, Pitts-
burgh, PA). PCR products were cloned into the pCR 2.1-
TOPO vector (Invitrogen, Carlsbad, CA) according to the
manufacturer's protocols. Plasmid inserts were sequenced
at the University of Florida, ICBR, Sequencing Facility.

Evaluation of conidial production and production of
conidia for bioassays
Conidia of M. anisopliae Strain ARSEF2575 and the two
temperature tolerant clones, EVG016 and EVG017, were
produced in a biphasic system by ARS at Sidney MT fol-
lowing the methods of Bradley et al 1992[37]. In brief,
conidia from agar media were used to inoculate flasks of
liquid medium (40 g L-1 glucose, 20 g L-1 yeast extract, 15
ml L-1 corn steep liquor). The liquid cultures were incu-
bated for 3-4 d at 25-26 C and 150 rpm and then used
to inoculate flaked barley (Minnesota Grain, Eagan MN)
that had been premoistened with reverse osmosis water
(3:5 v:w), and autoclaved (103 KPa for 30 min/kg) in
vented, plastic mushroom spawn bags (SacO2, Microsac,
Belgium). The liquid cultures were mixed with the sub-
strate within the bags under aseptic conditions, at a ratio
of 3:10 (v/w) and the open ends of the bags were heat-
sealed. The solid substrate fermentation phase proceeded
at 26-27 C in constant darkness. Cultures were observed


Page 8 of 11
(page number not for citation purposes)


BMC Biotechnology 2009, 9:74







http://www.biomedcentral.com/1472-6750/9/74


daily and crumbled by hand within spawn bags as needed
to prevent binding of the substrate and provide aeration
throughout the culture substrate. After 8-10 days the
whole cultures were then transferred to kraft paper bags in
which they were dried for 10 days at 23-25 C, to a final
moisture of < 0.4 Water Activity Units (< 6% gravimetric
moisture). Conidia were harvested by mechanical sieving
through 20-and 100-mesh sieves under standardized con-
ditions in an ultrasonic sieve shaker (AS200, Retsch Corp.,
Newton PA) with the conidial fractions < 0.150 mm (100
U.S. Mesh) retained for yield determination and use in
bioassays. After conidia were harvested, the mass of har-
vested conidia and conidial counts were used to calculate
yield per kg of dry barley. Three replicate batches of 500 g
dry barley were used for each strain as described above.
For conidial counts two replicate samples of 0.1 g of har-
vested conidia were suspended in 0.1% Silwet L77"M
(Loveland Chemicals), serially diluted with water as
appropriate and counted using an Improved Neubauer
hemocytometer under 400x phase contrast microscopy.
All conidial preparations were stored at 3 C until use.

Insect Bioassays
Prior to use in bioassays, conidial viabilities were deter-
mined by plating dilute aqueous suspensions of each
technical powder onto potato dextrose agar, incubating at
27-280C for 16-19 hr, and then examining the conidia
with 400x phase contrast microscopy. A preliminary step
to determine fungal viability was performed, in which a
small quantity of dry conidia was exposed to 100% rela-
tive humidity for 1-2 hr before suspension and plating. A
minimum of 400 conidia were examined for germination;
a conidium was considered viable (germinated) if it had
produced a visible germination peg during the specified
incubation time. Viabilities of the two M. anisopliae tech-
nical powders were 90 and 92% for 2575 and EVG016,
respectively. Because the conidial production of the origi-
nal EVG017 was insufficient to provide enough conidia
for bioassay, the clone was passed through adult Melano-
plus sanguinipes, reisolated from a single colony and grown
for two cycles on agar media. The passage fungus,
EVG017g, regained ability to sporulate on Sabouraud dex-
trose agar supplemented with 0.1% yeast extract (SDAY)
and Potato dextrose agar (PDA), as well as in solid sub-
strate fermentation and was used to evaluate conidial pro-
duction and to produce conidia for bioassays as described
above. Conidial viability of the conidia powder used for
bioassays was 88%.

For bioassays, the dry conidial powders were first formu-
lated in culinary canola oil with the final titers determined
by hemocytometer counts of serial dilutions made with
kerosene. To determine the relative infectivity (median
infectious dose) and virulence (median and average lethal
times of one selected dose), a series of conidial suspen-


sions in canola were prepared with the actual spore con-
centrations determined by hemocytometer count and
adjusted for conidial viability. One week old, adult M.
sanguinipes from a nondiapausing laboratory colony were
used in all bioassays. A topical, 5-dose bioassay with adult
Melanoplus sanguinipes was conducted with doses bracket-
ing the estimated LD50 for each strain, based on a prelim-
inary bioassay. In the bioassay a one gl droplet of spores
in oil was applied to the front left coxa of each insect, with
20-25 insects per dose. Dosed insects and controls incu-
bated at 28 C in cylindrical cellulose acetate cages (50 cm
x 10 cm) with mesh covered openings. Bioassays were
replicated twice in their entirety, with a total of 120-150
insect per bioassay. Day 7 mortalities were used to calcu-
late LD50 and associated statistics by probit analysis with
Polo-Plus" (LeOra Software). Median and average sur-
vival times were calculated using Kaplan Meier survivor-
ship statistics [34] with KMSsurv.exe [38]. The replicate
tests for each fungus were first compared, and, being not
significantly different were combined for further analysis.

To determine the heat tolerance of the parent and both
mutant strains in vivo, adult M. sanguinipes were dosed
topically at the ~LD95 for each clone or parent and incu-
bated at 36 + 0.5C or 28 + 0.5C. Daily mortality was
recorded for 14 days. Temperatures were monitored con-
tinuously by means of a Hobo temperature logger placed
in an empty grasshopper container, which was positioned
amidst the grasshopper containers. All assays were repli-
cated twice in their entirety. Median and average lethal
times were calculated as described above. The ST50 for
each strain was calculated as described above for the 28 C
treatments; this parameter could not be calculated for the
higher temperature because of the low mortalities. Insect
body temperatures were monitored with a thermocouple
inserted into a thermal surrogate placed within an empty
cage along with the cages with grasshoppers, a technique
that has been shown to accurately reflect grasshopper
body temperatures during both normal and thermoregu-
latory behavior [39,40].

Conidial germination and radial growth studies of the
three fungi were conducted in parallel with the insect bio-
assays to better understand the assay mortalities. The
reisolated EVG017g was evaluated along with the original
ARSEF2575 and EVG016 fungi. Conidial germination
tests were conducted as the viability determinations
described earlier but parallel plates were incubated at
36.5C as well as 28C and conidia examined at 18, 24,
48, 72 and 96 hr. After the last observation the Petri plates
of fungi incubated at 36.5 C were transferred to 28 C and
observed daily for another 2-3 days.

Radial growth tests were carried out in several ways. Rep-
licate 60 mm Petri plates of SDAY agar were point-inocu-


Page 9 of 11
(page number not for citation purposes)


BMC Biotechnology 2009, 9:74








BMC Biotechnology 2009, 9:74


lated with the fungi, and initially incubated at 36.5 C. for
4 days, then half of the samples were transferred to 28 0 C
for further observation. Other plates were incubated at
28C until the colonies were 3-4 mm in diameter at
which time one half were transferred to 36.50 C and sub-
sequent radial growth monitored for up to 18 days. In all
cases, colony radii were measured daily across two per-
pendicular axes with a digital Vernier caliper. There were
three replicate plates for each treatment.


Authors' contributions
EC and NK conceived the experiments, analyzed the data
and wrote the paper. EC conducted the evolution experi-
ment. SJ conducted the conidial production studies, fun-
gus passage and reisolation steps, insect bioassays, and in
vitro radial growth experiments, BL, and TL performed
assays, assisted in the evolution experiment, assisted in
analyzing the data and writing the paper.


Acknowledgements
We are grateful to Rob Schlothauer, USDA ARS, Sidney MT for assistance
in conducting insect bioassays and to M. Penicaud, Evolugate LLC, Gaines-
ville FL, and V. de Crecy-Lagard, University of Florida, Gainesville FL for
critical reading and editing of the manuscript.

References
I. Arora DK, ed: Handbook of Fungal Biotechnology. 2nd edition.
New York: Marcel Dekker; 2003.
2. Pointing SB, Hyde KD, eds: Bio-exploitation of filamentous
fungi. Fungal Diversity Press; 2001.
3. Streit WR, Daniel R, Jaeger KE: Prospecting for biocatalysts and
drugs in the genomes of non-cultured microorganisms. Cur-
rent Opinion in Biotechnology 2004, 15(4):285-290.
4. Riehle MM, Bennett AF, Lenski RE, Long AD: Evolutionary changes
in heat-inducible gene expression in lines of Escherichia coli
adapted to high temperature. Physiological Genomics 2003,
14(1):47-58.
5. Witten JT, Chen CT, Cohen BA: Complex genetic changes in
strains of Saccharomyces cerevisiae derived by selection in
the laboratory. Genetics 2007, 177(1):449-456.
6. de Crecy E, Metzgar D, Allen C, Penicaud M, Lyons B, Hansen CJ, de
Crecy-Lagard V: Development of a novel continuous culture
device for experimental evolution of bacterial populations.
Applied Microbiology and Biotechnology 2007, 77(2):489-496.
7. Kohn LM, Schaffer MR,AndersonJB, Grunwald NJ: Marker stability
throughout 400 days of in vitro hyphal growth in the filamen-
tous ascomycete, Sclerotinia sclerotiorum. Fungal Genetics and
Biology 2008, 45(5):613-617.
8. Larsen B, Poulsen BR, Eriksen NT, Iversen JJL: Homogeneous
batch cultures of Aspergillus oryzae by elimination of wall
growth in the Variomixing bioreactor. Applied Microbiology and
Biotechnology 2004, 64(2): 192-198.
9. de Faria MR, Wraight SP: Mycoinsecticides and mycoacaricides:
A comprehensive list with worldwide coverage and interna-
tional classification of formulation types. Biological Control 2007,
43:237-256.
10. Biopesticide Active Ingredient Fact Sheets [http://
www.epa.gov/pesticides/biopesticides/ingredients/]
I I. Goettel MS, Eilenbergj, Glare TR: Entomopathogenic Fungi and
their role in regulation of insect populations. In Comprehensive
Molecular Insect Science Volume 6. Edited by: Gilbert LI, latrou K, Gill
S. Elsevier; 2005:361-406.
12. Kirkland BH, Westwood GS, Keyhani NO: Pathogenicity of ento-
mopathogenic fungi Beauveria bassiana and Metarhizium ani-
sopliae to Ixodidae tick species Dermacentor variabilis,
Rhipicephalus sanguineus, and Ixodes scapularis. j Med Entomol
2004, 41 (4):705-71 II.


http://www.biomedcentral.com/1472-6750/9/74


13. Roberts DW, St Leger R: Metarhizium spp., Cosmopolitan
Insect-Pathogrnic Fungi: Mycological Aspects. Advances in
Applied Microbiology 2004:1-70.
14. Kirkland BH, Cho EM, Keyhani NO: Differential susceptibility of
Amblyomma maculatum and Amblyomma americanum (Acari:
Ixodidea) to the entomopathogenic fungi Beauveria bassiana
and Metarhizium anisopliae. Biological Control 2004,
3 1(3):414-421.
15. Barrientos-Lozano L, Hernandez-Velazquez VM, Milner RJ:
Advances in biological control of locusts and grasshoppers in
Mexico. Journal of Orthoptera Research 2002, 11:77-82.
16. Blanford S, Chan BH, Jenkins N, Sim D, Turner RJ, Read AF, Thomas
MB: Fungal pathogen reduces potential for malaria transmis-
sion. Science 2005, 308:1638-164 1.
17. Milner RJ, Hunter DM: Recent developments in the use of fungi
as biopesticides against locusts and grasshoppers in Aus-
tralia. journal of Orthoptera Research 2001, 10:271-276.
18. Inglis GD, Goettel MS, Butt TM, Strasser H: Use of hyphomycet-
ous fungi for managing insect pests. In Field manual of techniques
in invertebrate pathology Edited by: Lacey LA, Kaya HK. Netherlands:
Kluwer Academic; 2001:65 1-679.
19. Scholte EJ, Knols BG, Takken FL: Infection of the malaria mos-
quito Anopheles gambiae with the entomopathogenic fungus
Metarhizium anisopliae reduces blood feeding and fecundity.
journal of Invertebrate Pathology 2006, 91:43-49.
20. Rangel DE, Alston DG, Roberts DW: Effects of physical and nutri-
tional stress conditions during mycelial growth on conidial
germination speed, adhesion to host cuticle, and virulence of
Metarhizium anisopliae, an entomopathogenic fungus. Myco-
logical Research 2008, I 12:1355-1361.
21. Rangel DE, Braga GU, Anderson AJ, Roberts DW: Variability in
conidial thermotolerance of Metarhizium anisopliae, iso-
lates from different geographic origins. journal of Invertebrate
Pathology 2005, 88(2):l 16-125.
22. Roy HE, Steinkraus DC, EilenbergJ, HajekAE, Pell JK: Bizarre inter-
actions and endgames: Entomopathogenic fungi and their
arthropod hosts. Annual Review of Entomology 2006, 5 1:331-357.
23. Chown SL, Addo-Bediako A, Gaston KJ: Physiological variation in
insects: large-scale patterns and their implications. Compara-
tive Biochemistry and Physiology B-Biochemistry & Molecular Biology 2002,
131(4):587-602.
24. Gardner SN, Thomas MB: Costs and benefits of fighting infec-
tion in locusts. Evolutionary Ecology Research 2002, 4(1):109-13 1.
25. Heinrich B: Insect Thermoregulation. Endeavour 1995,
19(1):28-33.
26. Fargues J, Goettel MS, Smits N, Ouedraogo A, Rougier M: Effect of
temperature on vegetative growth of Beauveria bassiana
isolates from different origins. Mycologia 1997, 89(3):383-392.
27. Fargues J, Goettel MS, Smits N, Ouedraogo A, Vidal C, Lacey LA,
Lomer CJ, Rougier M: Variability in susceptibility to simulated
sunlight of conidia among isolates of entomopathogenic
Hyphomycetes. Mycopathologia 1996, 135(3): 171-181.
28. Ouedraogo A, Fargues J, Goettel MS, Lomer CJ: Effect of temper-
ature on vegetative growth among isolates of Metarhizium
anisopliae and M-flavoviride. Mycopathologia 1997, 137(1):37-43.
29. Wang C, St. Leger R: A scorpion neurotoxin increases the
potency of a fungal insecticide. Nature Biotechnology 2007,
25:1455-1456.
30. Kirkland BH, Eisa A, Keyhani NO: Oxalic acid as a fungal acara-
cidal virulence factor. journal of Medical Entomology 2005,
42(3):346-351.
31. Kurtti TJ, Keyhani NO: Intracellular infection of tick cell lines by
the entomopathogenic fungus Metarhizium anisopliae.
Microbiology 2008, 154(Pt 6): 1700-9.
32. St. Leger R, Joshi L, Bidochka MJ, Roberts DW: Construction of an
improved mycoinsecticide overexpressing a toxic protease.
Proceedings of the National Academy of Science 1996, 93:6349-6354.
33. Wraight SP, Jackson MA, De Kock SL: Production, stabilization,
and formulation of fungal biocontrol agents. In Fungi as Biocon-
trol Agents: Progress, Problems, and Potential Edited by: Butt TM, Jackson
CW, Magan N. Wallingford, UK: CAB International; 2001:253-287.
34. Klein JP, Moeschberger : Survival Analysis: Techniques for Cen-
sored and Truncated Data. Springer; 1997.
35. White TJ, Bruns T, Lee S, Taylor J: Amplification and direct
sequencing of fungal ribosomal RNA genes for phylogentics.




Page 10 of 11
(page number not for citation purposes)








BMC Biotechnology 2009, 9:74


http://www.biomedcentral.com/1472-6750/9/74


In PCR Protocols: A Guide to Methods and Applications Edited by: Innis M,
White M, Sninsky JJ. New York, NY: Academic Press; 1990:315-322.
36. Stleger RJ, Frank DC, Roberts DW, Staples RC: Molecular-Cloning
and Regulatory Analysis of the Cuticle-Degrading-Protease
Structural Gene from the Entomopathogenic Fungus
Metarhizium-Anisopliae. European journal of Biochemistry 1992,
204(3):991-1001.
37. Bradley CA, Black WE, Kearns R, Wood P: Role of production
technology in mycoinsecticide development. In Frontiers in
Industrial Microbiology Edited by: Leatham GE. New York: Chapman &
Hall; 1992:160-173.
38. Campos N, Franco EL: Microcomputer assisted univariate sur-
vival data analysis using Kaplan-Meier life table estimators.
Computer Methods and Programs in Biomedicine 1988, 27(3):223-228.
39. Lactin DJ, Johnson DL: Behavioural optimization of body tem-
perature by nymphal grasshoppers (Melanoplus sanguinipes,
Orthoptera: Acrididae) in temperature gradients estab-
lished using incandescent bulbs. journal of Thermal Biology 1996,
21(4):231-238.
40. Lactin DJ, Johnson DL: Effects of insolation and body orienta-
tion on internal thoracic temperature of nymphal Melano-
plus packardii (Orthoptera: Acrididae). Environmental
Entomology 1996, 25(2):423-429.


Page 11 of 11
(page number not for citation purposes)


Publish with BioMed Central and every
scientist can read your work free of charge
"BioMed Central will be the most significant development for
disseminating the results of biomedical research in our lifetime."
Sir Paul Nurse, Cancer Research UK
Your research papers will be:
available free of charge to the entire biomedical community
peer reviewed and published immediately upon acceptance
cited in PubMed and archived on PubMed Central
yours you keep the copyright
Submit your manuscript here: BioMedcentral
http://www.biomedcentral.com/info/publishing adv.asp




University of Florida Home Page
© 2004 - 2010 University of Florida George A. Smathers Libraries.
All rights reserved.

Acceptable Use, Copyright, and Disclaimer Statement
Last updated October 10, 2010 - - mvs