Group Title: BMC Cancer
Title: A Smac-mimetic sensitizes prostate cancer cells to TRAIL-induced apoptosis via modulating both IAPs and NF-kappaB
CITATION PDF VIEWER THUMBNAILS PAGE IMAGE ZOOMABLE
Full Citation
STANDARD VIEW MARC VIEW
Permanent Link: http://ufdc.ufl.edu/UF00099901/00001
 Material Information
Title: A Smac-mimetic sensitizes prostate cancer cells to TRAIL-induced apoptosis via modulating both IAPs and NF-kappaB
Physical Description: Archival
Language: English
Creator: Dai, Yao
Liu, Meilan
Tang, Wenhua
Li, Yongming
Lian, Jiqin
Lawrence, Theodore
Xu, Liang
Publisher: BMC Cancer
Publication Date: 2009
 Notes
Abstract: BACKGROUND:Although tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is a promising agent for human cancer therapy, prostate cancer still remains resistant to TRAIL. Both X-linked inhibitor of apoptosis (XIAP) and nuclear factor-kappaB function as key negative regulators of TRAIL signaling. In this study, we evaluated the effect of SH122, a small molecule mimetic of the second mitochondria-derived activator of caspases (Smac), on TRAIL-induced apoptosis in prostate cancer cells.METHODS:The potential of Smac-mimetics to bind XIAP or cIAP-1 was examined by pull-down assay. Cytotoxicity of TRAIL and/or Smac-mimetics was determined by a standard cell growth assay. Silencing of XIAP or cIAP-1 was achieved by transient transfection of short hairpin RNA. Apoptosis was detected by Annexin V-PI staining followed by flow cytometry and by Western Blot analysis of caspases, PARP and Bid. NF-kappaB activation was determined by subcellular fractionation, real time RT-PCR and reporter assay.RESULTS:SH122, but not its inactive analog, binds to XIAP and cIAP-1. SH122 significantly sensitized prostate cancer cells to TRAIL-mediated cell death. Moreover, SH122 enhanced TRAIL-induced apoptosis via both the death receptor and the mitochondrial pathway. Knockdown of both XIAP and cIAP-1 sensitized cellular response to TRAIL. XIAP-knockdown attenuated sensitivity of SH122 to TRAIL-induced cytotoxicity, confirming that XIAP is an important target for IAP-inhibitor-mediated TRAIL sensitization. SH122 also suppressed TRAIL-induced NF-kappaB activation by preventing cytosolic IkappaB-alpha degradation and RelA nuclear translocation, as well as by suppressing NF-kappaB target gene expression.CONCLUSION:These results demonstrate that SH122 sensitizes human prostate cancer cells to TRAIL-induced apoptosis by mimicking Smac and blocking both IAPs and NF-kappaB. Modulating IAPs may represent a promising approach to overcoming TRAIL-resistance in human prostate cancer with constitutively active NF-kappaB signaling.
General Note: Periodical Abbreviation: BMC Cancer
General Note: Start page 392
General Note: M3: 10.1186/1471-2407-9-392
 Record Information
Bibliographic ID: UF00099901
Volume ID: VID00001
Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: Open Access: http://www.biomedcentral.com/info/about/openaccess/
Resource Identifier: issn - 1471-2407
http://www.biomedcentral.com/1471-2407/9/392

Downloads

This item has the following downloads:

PDF ( PDF )


Full Text


r)4


BMC Cancer BioMed C



Research article

A Smac-mimetic sensitizes prostate cancer cells to TRAIL-induced
apoptosis via modulating both lAPs and NF-kappaB
Yao Dait1,4, Meilan Liut2, Wenhua Tang', Yongming Lil, Jiqin Lian1,
Theodore S Lawrencel,3 and Liang Xu*1,3


Address: 'Department of Radiation Oncology, University of Michigan, Ann Arbor, MI 48109, USA, 2Department of Pathology, University of
Michigan, Ann Arbor, MI 48109, USA, 3Comprehensive Cancer Center, University of Michigan, Ann Arbor, MI 48109, USA and 4Current address
: Department of Radiation Oncology, University of Florida Health Science Center, Gainesville, FL 32610
Email: Yao Dai daiyao@umich.edu; Meilan Liu lmiu@umich.edu; Wenhua Tang wenhuat@med.umich.edu;
Yongming Li yongmli@umich.edu; Jiqin Lian lianj@umich.edu; Theodore S Lawrence tsl@umich.edu; Liang Xu* liangxu@umich.edu
* Corresponding author tEqual contributors


Published: 6 November 2009
BMC Cancer 2009, 9:392 doi:10.1 186/1471-2407-9-392


Received: 30 October 2008
Accepted: 6 November 2009


This article is available from: http://www.biomedcentral.com/1471-2407/9/392
2009 Dai et al; licensee BioMed Central Ltd.
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0),
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.



Abstract
Background: Although tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is a
promising agent for human cancer therapy, prostate cancer still remains resistant to TRAIL. Both
X-linked inhibitor of apoptosis (XIAP) and nuclear factor-kappaB function as key negative
regulators of TRAIL signaling. In this study, we evaluated the effect of SH122, a small molecule
mimetic of the second mitochondria-derived activator of caspases (Smac), on TRAIL-induced
apoptosis in prostate cancer cells.
Methods: The potential of Smac-mimetics to bind XIAP or clAP-1I was examined by pull-down
assay. Cytotoxicity of TRAIL and/or Smac-mimetics was determined by a standard cell growth
assay. Silencing of XIAP or clAP- I was achieved by transient transfection of short hairpin RNA.
Apoptosis was detected by Annexin V-PI staining followed by flow cytometry and by Western Blot
analysis of caspases, PARP and Bid. NF-kappaB activation was determined by subcellular
fractionation, real time RT-PCR and reporter assay.
Results: SH 122, but not its inactive analog, binds to XIAP and clAP- I1. SH 122 significantly sensitized
prostate cancer cells to TRAIL-mediated cell death. Moreover, SH122 enhanced TRAIL-induced
apoptosis via both the death receptor and the mitochondrial pathway. Knockdown of both XIAP
and clAP- I sensitized cellular response to TRAIL. XIAP-knockdown attenuated sensitivity of SH 122
to TRAIL-induced cytotoxicity, confirming that XIAP is an important target for lAP-inhibitor-
mediated TRAIL sensitization. SH122 also suppressed TRAIL-induced NF-kappaB activation by
preventing cytosolic IkappaB-alpha degradation and RelA nuclear translocation, as well as by
suppressing NF-kappaB target gene expression.
Conclusion: These results demonstrate that SH 122 sensitizes human prostate cancer cells to
TRAIL-induced apoptosis by mimicking Smac and blocking both lAPs and NF-kappaB. Modulating
lAPs may represent a promising approach to overcoming TRAIL-resistance in human prostate
cancer with constitutively active NF-kappaB signaling.


Page 1 of 15
(page number not for citation purposes)


central


ess







http://www.biomedcentral.com/1471-2407/9/392


Background
Primary or acquired resistance of prostate cancer to cur-
rent treatment protocols has been associated with apopto-
sis-resistance in cancer cells, leading to therapy failure
[1,2]. Tumor necrosis factor-related apoptosis-inducing
ligand (TRAIL) is a member of the TNF family that is in
clinical trials for the treatment of prostate cancer, either
alone or in combination with other treatments [3]. TRAIL
selectively induces apoptosis in prostate cancer cells com-
pared to normal prostate epithelial cells [4]. The relative
resistance of normal cells to TRAIL has been explained by
the lower expression levels of functional death receptors
relative to cancer cells [5,6]. Hence, TRAIL exerts a selec-
tive antitumor activity without eliciting systemic toxicity
in multiple preclinical models, and is considered to be a
prime candidate for prostate cancer therapy [3].

Mechanistically, TRAIL triggers apoptosis via binding to
its functional death receptors DR4 and DR5, and activat-
ing both death receptor (extrinsic) and mitochondria
(intrinsic) apoptosis pathways [7]. Ligation of DR4/DR5
by TRAIL results in caspase-8 activation and directly
cleaves downstream effector caspases [8]. Signals originat-
ing from death receptors can be linked to mitochondria
via Bid, which causes mitochondrial cytochrome c release
and caspase-9 activation. The mitochondrial pathway is
engaged by the release of multiple pro-apoptotic factors
from mitochondria into the cytosol, such as cytochrome
c, Smac and apoptosis inducing factor (AIF). These factors
execute cells through apoptosis in either a caspase-
dependent or independent manner [9].

Despite the fact that TRAIL selectively induces apoptosis
in cancer cells, TRAIL-resistance has been observed in a
substantial number of cancers, including prostate cancer
[10]. It is widely accepted that the inhibitor of apoptosis
proteins (IAP) function as a key negative regulator in
TRAIL resistance [11,12]. Mounting evidence confirms
that XIAP, the most potent anti-apoptotic protein among
IAPs, is responsible for primary or acquired TRAIL resist-
ance in tumor cells [13-16]. Overexpression of XIAP
increases resistance to TRAIL-induced apoptosis, while
downregulation of XIAP restores responsiveness to TRAIL
[17,18]. At the transcriptional level, almost all IAP pro-
teins are driven by the upstream transcription factor NF-
kappa B (NF-KB), which can be stimulated by multiple
stimuli, including TRAIL [19]. TRAIL-induced NF-KB acti-
vation attenuates apoptosis, predominantly by upregulat-
ing various anti-apoptotic proteins, including IAPs
[20,21]. Therefore, NF-KB functions as an upstream regu-
lator of IAPs and negatively regulates TRAIL signaling. The
role of NF-KB in the anti-apoptotic process has been stud-
ied in prostate cancer cells both in vitro and in vivo. In
prostate cancer cell lines, there seems to be an inverse cor-
relation between androgen receptor (AR) status and con-


stitutive NF-KB activity [22]. Thus it is tempting to
speculate that the constitutive activation of NF-KB may
contribute to prostate cancer cell survival and treatment
resistance following androgen ablation [22].

Smac functions as an endogenous IAP-antagonist [23].
Upon stimulation by TRAIL, Smac is released from mito-
chondria into the cytosol [24]. The released Smac interacts
with XIAP through the N-terminal four conserved amino
acid residues (AVPI) that bind to the baculoviral IAP
repeat 3 (BIR3) domain of XIAP and eliminates the inhib-
itory effect of XIAP on caspase activation [25-27]. Due to
the impressive pro-apoptotic role of Smac, synthetic small
molecule Smac-mimicking compounds (Smac-mimetics)
are being developed to sensitize apoptosis-resistant cancer
cells to various apoptotic stimuli [3,28]. Smac-mimetic
IAP-antagonists induce TNFa-dependent apoptosis in sev-
eral transformed cell lines [29-31], and small molecule
Smac-mimetics successfully sensitize TRAIL-induced
apoptosis by blocking functions of IAPs in multiple can-
cer cells [11,16,32,33]. These studies provide a solid foun-
dation for our assertion that mimicking Smac may
represent a promising strategy for restoring defective
apoptosis signaling triggered by TRAIL in prostate cancer
therapy.

Based on the high-resolution experimental 3D structure of
Smac in complex with the XIAP BIR3 domain, a group of
potent non-peptidic Smac-mimetics, called SH-com-
pounds, were designed that mimic the tetra-peptide at the
N-terminal of the Smac protein [34,35]. These cell-perme-
able compounds show at least 20-fold more potential
than the natural Smac peptide to bind to the XIAP BIR3
domain in a cell-free system [34-36]. In the current study,
we evaluated the sensitizing potential of one of these
compounds, SH122, on TRAIL-mediated cell death in sev-
eral human prostate cancer cell lines. We also investigated
potential molecular targets and the mechanism of action
involved in SH 122-mediated TRAIL sensitization.

Methods
Cell Culture and Reagents
Human prostate cancer DU145 and LNCaP cells were
obtained from the American Type Culture Collection
(Manassas, VA). Androgen-independent prostate cancer
cell line CL1 derived from its androgen-dependent cell
line LNCaP was kindly provided by Dr. Arie Belldegrun
(University of California, Los Angeles). Cells were rou-
tinely maintained in Dulbecco's Modified Eagle Medium
(DMEM, Gibco) with 10% fetal bovine serum (FBS) and
2 mM L-glutamine. Cultures were maintained in a humid-
ified incubator at 37C with 5% CO2. Small molecule
Smac-mimetic SH122 as well as its inactive analogs
SH123 and SH110 were kindly provided by Dr.
Shaomeng Wang, University of Michigan. TRAIL was pur-


Page 2 of 15
(page number not for citation purposes)


BMC Cancer 2009, 9:392







http://www.biomedcentral.com/1471-2407/9/392


chased from Cell Sciences (Canton, MA). Antibodies
against XIAP and cIAP-1 were purchased from BD Bio-
sciences (San Jose, CA). Antibodies against PARP, RelA
and IKBa were purchased from Santa Cruz Biotechnology
(Santa Cruz, CA). Other antibodies include: anti-caspase-
3 (BioVision, Mountain View, CA), anti-caspase-8 (Calbi-
ochem, San Diego, CA), anti-caspase-9 (Novus Biologi-
cals, Littleton, CO), anti-Bid (Cell Signaling Technology,
Beverly, MA), and anti-3-actin (Sigma, MO). Chemicals
were from Sigma unless otherwise indicated.

Cytotoxicity Assay
To detect the survival of cells after treatment, a standard
cell growth assay was performed using the CCK-8 detec-
tion kit (Dojindo Molecular Technologies, Gaithersburg,
MD) following the manufacturer's instructions. Absorb-
ance was detected at 450 nm and 650 nm respectively,
using a microplate reader (TECAN ULTRA, Research Tri-
angle Park, NC). Cell viability (%) was normalized by
dividing normalized absorbance of treated samples by
that of the untreated control [37]. Inhibitory concentra-
tion 50% (ICso0) was calculated by GraphPad Prism 5.0
(San Diego, CA).

Pull-down Assay
Cells (1.0 x 107) were disrupted in a lysis buffer (50 mM
Tris-HCl, pH 7.5, 150 mM NaCl, 1% Nonidet P-40, 0.5%
sodium deoxycholate), with freshly added protease inhib-
itor cocktail (Roche). Cell lysates were homogenized by
passing through a 27-1/2G syringe needle (BD). After cen-
trifugation at 10,000 x g for 15 min at 4C, the superna-
tant was harvested and incubated with biotin-labeled
Smac-mimetic compounds with or without non-labeled
compounds, for 1 hour at 40C. Lysates were incubated
with pre-cleared Streptavidin-Agarose beads (Invitrogen)
by gently rotating for 2 hours at 4 o C. The beads were col-
lected and washed with washing buffer (Roche) and
eluted in 60 il of loading buffer (Bio-Rad, Hercules, CA).
After boiling for 5 min, the eluents were analyzed by
immunoblotting to detect proteins that interacted with
the compounds [38].

Apoptosis Assay
For apoptosis analysis by flow cytometry, DU145 cells
were treated with SH 122 and TRAIL, alone or in combina-
tion, with SH110 used as a negative control. Cells were
harvested by trypsinization and washed twice with ice-
cold PBS. After centrifuge, cells were stained with 100 1il
Annexin V-FITC diluted in binding buffer (10 mM
HEPES,100 mM NaCl, 10 mM KC1, 1 mM MgCl2, 1.8 mM
CaC12) containing propidium iodide (50 ig/ml). Cells
were incubated for 15 min at room temperature before
analysis by flow cytometry with FACScan (BD) using a
488-nm laser line. Data were analyzed using WinMDI 2.8


software (Purdue University Cytometry Laboratories) as
described previously [38].

shRNA Transfection
The shRNA specific for XIAP in plasmid pRS-shXIAP29
was purchased from OriGene (Rockville, MD). The
shRNA specific for clAP-1 in plasmid pGB-shcIAP-1 was
purchased from BioVision (Mountain View, CA). shRNA
plasmids (2.0 rig) were transfected into DU145 cells using
LipofectAMINE 2000 (Invitrogen, Carlsbad, CA), follow-
ing the manufacturer's instructions. Forty-eight hours
after transfection, cells were treated with Smac-mimetic
compounds and/or TRAIL and processed for cytotoxicity
analysis. Knockdown effect was detected by Western blot.

Western Blot Analysis
Whole cell proteins were isolated by RIPA buffer (50 mM
Tris-HCl, pH 8.0, 150 mM NaCl, 0.1% SDS, 1% NP-40,
0.25% Sodium deoxycholate and 1 mM EDTA) with
freshly added protease inhibitor cocktail (Roche). Whole
cell lysates were clarified by centrifugation at 10,000 x g
for 10 minutes at 40 C. Total protein concentrations were
determined by BCA Protein Assay (Pierce, Rockford, IL).
Equal amounts of proteins were loaded to pre-cast 4-20%
SDS-PAGE gels (Invitrogen). Proteins resolved on gels
were transferred to PVDF membranes (Bio-Rad). After
electro-transfer, membranes were blocked with 5 % nonfat
milk in TBS-T buffer (20 mM Tris-HCl, pH 8.0, 150 mM
NaCl, 0.05% Tween 20), and probed with the desired pri-
mary antibodies. Blots were then incubated with horse-
radish-conjugated secondary antibodies and detected
with the SuperSignal West Pico chemiluminescence sub-
strate (Pierce), and exposed to an X-ray film (Kodak,
Rochester, NY). Intensity of the desired bands was ana-
lyzed using TotalLab software (Nonlinear Dynamics, Dur-
ham, NC).

Cytosol and Nuclei Fractionation
To detect subcellular redistribution of NF-KB proteins,
cytoplasmic and nuclear fractions were prepared accord-
ing to the method reported [39] with modifications.
Briefly, treated cells (5 x 106 cells) were resuspended in
200 Al of hypotonic buffer (10 mM HEPES, 5 mM KC1, 1.5
mM MgCl2, 1 mM phenylmethylsulfonyl fluoride
(PMSF), 1 mM dithiothreitol (DTT), and protease inhibi-
tors), mixed well, and incubated with constant rotation at
4C for 15 min. Nonidet P-40 (10%) was then added to
reach a final concentration of 0.5%. Cytosolic extract was
cleared by centrifugation at 12,000 rpm for 1 min. The
pellets were washed once with hypotonic buffer, and
resolved in nucleus extraction buffer (20 mM HEPES, 50
mM KC1, 300 mM NaCl, 1 mM PMSF, 1 mM DTT, and
protease inhibitors), with constant rotation at 40 C for 45
min. Nuclear extracts were harvested after centrifuging for
10 min at 12,000 rpm. Subcellular proteins were quanti-


Page 3 of 15
(page number not for citation purposes)


BMC Cancer 2009, 9:392







http://www.biomedcentral.com/1471-2407/9/392


fled by BCA assay before being employed to Western blot
analysis.

Quantitative Real-time PCR (qRT-PCR)
qRT-PCR was performed to determine the NF-KB target
gene expression level [40]. Total RNA was extracted from
DU 145 cells using TRIzol (Invitrogen). Reverse transcrip-
tion reaction with 1 jig of total RNA in 100 il was carried
out following the instructions of the TaqMan Reverse
Transcription Kit (Applied Biosystems, Foster City, CA).
For quantitative PCR, 1 jil of gene primers with SYBR
Green (Applied Biosystems) in 20 jil of reaction volume
was applied [41]. Primers were designed as: TNF, forward,
5'CCAGGGACCTCTCTCTAATCAGC3', reverse,
5'CTCAGCTTGAGGGTITGCTACAA3'; IL8, forward,
5'CGTGGCTCCTCTGGCAGC3', reverse,
5'TCTITAGCACTCCITGGCAAAAC3'; Actin (as an inter-
nal control): forward, 5'ATGCAGAAGGAGATCACTGC3',
reverse, 5'TCATAGTCCGCCTAGAAGCA3'. BIRC4, for-
ward, 5'AGTGGTAGTCCTGTITCAGCATCA3', reverse,
5'CCGCACGGTATCTCCITCA3'. FAM probed ICAM-1
primers were commercially obtained from Applied Bio-
systems. All reactions with TaqMan PCR Master Mix
(Applied Biosystems) were performed on the Mastercycler
realplex2 S (Eppendorf, Westbury, NY). Target gene mRNA
levels were normalized to actin mRNA according to the
following formula: [2^-(Cr target Cr Actin)] x 100%,
where CT is the threshold cycle. Fold increase was calcu-
lated by dividing the normalized target gene expression of
the treated sample by that of the untreated control
[41,42].

NF-KB Reporter Assay
DU145 cells were seeded into a 48-well plate 24 h before
transfection. For each well, cells were transiently cotrans-
fected with 0.1 jig of a NF-KB reporter construct (pNF-KB)
or a control reporter plasmid (pControl) (Panomics Inc.,
Fremont, CA), together with 0.06 jig of P-galactosidase
reporter vector (Promega, Madison, WI), which was used
to normalize NF-KB reporter gene activity, using Lipo-
fectAMINE 2000 (Invitrogen). Twenty-four hours after
transfection, cells were treated with TNF-a or TRAIL for 0
h, 1 h, 2 h, 4 h and 6 h. To determine the effect of SH122
on TRAIL-induced NF-KB activation, cells were pretreated
with SH 122 or SH 123 for 1 h followed by TRAIL stimula-
tion for 4 h. Cell lysates were prepared using Reporter
Lysis Buffer (Promega). For luciferase and P-galactosidase
assays, the samples were measured on a microplate lumi-
nometer using the Bright-Glo luciferase assay kit and P-
galactosidase enzyme assay kit (Promega), respectively,
according to the manufacturer's instructions. Fold of acti-
vation was calculated for each treated sample by dividing
normalized luciferase activity with that of the untreated
control.


Statistical Analysis
Two-tailed Student's t-test was employed, using GraphPad
Prism 5.0 software (San Diego, CA). A threshold of P <
0.05 was defined as statistically significant.

Results
Validation of interactions between Smac-mimetic
compound SH122 and lAPs
Based on 3-D rational design and computational mode-
ling, SH 122 (Figure 1A) was synthesized and developed as
a non-peptide small molecule lAP-antagonist that is
20~30-fold more potent than the N-terminal tetrapeptide


A


R N NH


SH122: R= -NHCH3
SH123: R= -OH



C


-SH22BL 0 20 20
SH122BL 0 20 20
SH122 0 0 200

XIAP -- -


clAP-1 -



,iM


SH122BL 0 1 1 2.5 2.5 0 0

SH122 0 0 10 0 25 0 0

SH123BL 0 0 0 0 0 2.5 2.5


SH123 0 0 0 0

XIAP --


0 25


clAP-1 -p


Figure I
Smac-mimetic compound interacted with XIAP and
clAP-I in human prostate cancer cells. A. Structure of
the Smac-mimetic compound SH 122, and its inactive control
compounds SH 123 and SH I 10. B. Pull-down assay. Biotin-
labeled SH 122 (SH I 22BL, 20 jiM) was incubated with whole
cell lysates of DU 145 cells with or without 10-fold excess of
non-labeled SH 122, followed by incubation with precleared
Streptavidin agarose beads. Eluted beads were employed to
Western blot analysis with anti-XIAP or clAP- I antibody.
Data shown represent one of at least three independent
experiments. SHI22BL, Biotin-labeled SH122. C. CLI cell
lysate was incubated with I jiM and 2.5 jiM of SH 122BL, or
2.5 jiM of SH-123BL, with or without 10-fold excess of their
unlabeled forms. SH 123BL, Biotin-labeled SH 123.


Page 4 of 15
(page number not for citation purposes)


BMC Cancer 2009, 9:392







http://www.biomedcentral.com/1471-2407/9/392


of Smac in binding to IAPs, while inactive analogs SH123
and SH110 were shown to be 200-fold less potent [35]. To
verify the specific binding of SH122 to IAPs, we employed
a pull-down assay with biotin-labeled SH122 (SH 122BL)
in human prostate cancer cells. As shown in Figure 1 B,
both XIAP and clAP-1 were pulled down by SH122 in
DU145 cells. Furthermore, pre-incubation with a 10-fold
excess of non-biotin-labeled SH122 resulted in a more
than 90% block of the binding of SH122BL to XIAP/clAP-
1, suggesting that the binding was specific. In another
androgen-independent prostate cancer CL1 cell line, 1 gM
of SH 122 was sufficient to pull down both XIAP and clAP-
1 (Figure IC), and as with DU145, the binding effect was
blocked by a 10-fold excess of non-labeled SH122. By
contrast, the negative control compound SH123BL
showed almost no binding to either XIAP or clAP-1, as
evidenced in the previous report [38]. These results dem-
onstrate that Smac-mimetic SH122 potently and specifi-
cally interacts with XIAP and clAP-1 in human prostate
cancer cells.

SH 122 sensitizes TRAIL-induced prostate cancer cell
growth inhibition
To detect the combination effects of a Smac-mimetic and
TRAIL, cytotoxicity was tested after concurrent treatment
with TRAIL and SH122. In DU145 cells, while TRAIL
alone had a minor effect on decreasing cell viability, 5 gM
and 10 gM of SH122 showed a 100- and 600-fold sensiti-
zation, respectively, compared to TRAIL alone (Figure
2A). By contrast, the negative control compound SH110
produced no sensitization. Similar results were observed
in two other prostate cancer cell lines. As shown in Figure
2B, SH122, but not SH110, potentiated TRAIL-induced
cell growth inhibition in LNCaP cells. In CL1 cells that
were derived from LNCaP, SH122 showed dose-depend-
ent effects on TRAIL sensitization, although the concen-
tration used was approximately 10-fold less than that for
LNCaP cells (Figure 2C). Notably, CL1 seemed to be more
sensitive to TRAIL compared with LNCaP, as shown by
IC5s, suggesting that ablation of the androgen-receptor
may result in upregulation of TRAIL receptor expression.
These data demonstrate that the Smac-mimetic com-
pound SH 122 potentiates TRAIL-mediated cytotoxicity in
both TRAIL-resistant and TRAIL-sensitive prostate cancer
cell lines.

SH122 enhances TRAIL-induced apoptosis
To determine whether apoptosis was involved in TRAIL-
induced cell death, we examined apoptosis induced by
TRAIL in combination with SH122, with Annexin V-FITC
and PI staining by flow cytometry analysis. As shown in
Figure 3, SH122 increased TRAIL-induced apoptosis in a
dose-dependent manner. Even at a lower concentration
(2.5 gM), SH122 enhanced TRAIL-induced total apopto-
sis as compared with TRAIL and SH122 alone (Figure 3).


In contrast, TRAIL alone (50 ng/ml) moderately induced
apoptosis, and SH122 alone showed a minor effect on
apoptosis, with a slightly increased apoptotic cell popula-
tion compared with the control even at the highest con-
centration (Figure 3).

Both death receptor and mitochondrial pathways are
involved in SH 122-sensitized, TRAIL-induced apoptosis
Based on TRAIL-induced apoptotic signaling, we exam-
ined the expression of caspases treated with SH122 and
TRAIL. Caspase-8 was cleaved into fragments (p43/41 and
pl18) as early as 4 h after exposure to TRAIL alone, while
cleavage of caspase-8 became more intense with increased
concentrations of SH122, especially at 6 h after treatment
(Figure 4A). A similar tendency was observed for caspase-
3. Activation of caspase-3 was further confirmed by
poly(ADP-Ribose) polymerase (PARP) cleavage, a typical
feature of caspase-dependent apoptosis. PARP was
cleaved by TRAIL alone at 4 h (Figure 4A), while in com-
bination with SH122, cleaved PARP survived up to 8 h.
These results suggest that SH 122 enhances TRAIL-induced
apoptosis by activating caspases and promoting PARP
cleavage.

To determine the combination effect of TRAIL and SH 122
on the mitochondrial pathway, caspase-9 and Bid activa-
tion were examined. As shown in Figure 4B, Bid levels did
not change at 4 h or 6 h, while at 8 h, Bid levels decreased
after combination treatment, but not from treatment by
TRAIL alone. Furthermore, caspase-9 cleavage could be
detected as early as 4 h by either TRAIL alone or in combi-
nation with SH122, as evidenced by the appearance of its
cleaved forms, p35 and pl7. Interestingly, both pro- and
cleaved caspase-9 were diminished at 8 h, indicating that
caspase-9 activation was an early event with Bid cleavage
(Figure 4B). These data suggest that the mitochondria
pathway is also involved in TRAIL-induced, SH 122-medi-
ated apoptosis. Taken together, these in vitro apoptosis
data reveal that SH122 potentiates TRAIL-induced apop-
tosis by activating both the extrinsic death receptor path-
way and the intrinsic mitochondrial pathway, typically
through activation of the caspase cascade. More impor-
tantly, SH-122 combined with TRAIL induced a longer-
lasting apoptosis than TRAIL alone (8 h vs. 4 h), showing
that SH-122 enhanced the effect of TRAIL treatment.

Downregulation of XIAP and clAP-I sensitizes TRAIL-
induced cell death
It is well established that IAPs (especially XIAP) are
responsible for blocking TRAIL-induced apoptosis by
inhibiting caspase functions [ 11,14,43]. To investigate the
potential link between IAPs and TRAIL-resistance, short-
hairpin RNA (shRNA) of XIAP or clAP-1 was transfected
into DU145 cells, and cytotoxicity was examined. As
shown in Figure 5, XIAP or clAP-1 knockdown shifted the


Page 5 of 15
(page number not for citation purposes)


BMC Cancer 2009, 9:392







http://www.biomedcentral.com/1471-2407/9/392


IC50 (ng/ml)
-m- DMSO >300
-0- SH110(10 pM) >300
-A- SH122(2.5 M) 72.9
-*- SH122(5 M) 2.4
--- SH122(10 iM) 0.5


TRAIL conc.(ng/ml)


IC50 (ng/mi)
-0- DMSO 292.1
-B- SH110 20um >300
-a- SH122 5um 137.6
-V- SH122 10um 52.3
-*- SH122 20um 8.5


TRAIL conc.(ng/ml)


IC50 (ng/ml)
63.5
.5 p.M) 19.5
ipM) 17.9


1 10 100 1000
TRAIL conc.(ng/ml)

Figure 2
SH122 promoted TRAIL-induced cell death in prostate cancer cell line DU145 (A), LNCaP (B) and CLI (C).
Cells (5,000 cells/well in 96-well plates) were treated with different concentrations of TRAIL and SH 122, alone or in combina-
tion, with SH I 10 as a negative control. After incubation for 96 h, cells were stained with Cell Counting kit-8 reagent. The opti-
cal density of each sample was measured. Data were normalized as described in Materials and Methods. Data were presented as
mean SD (n = 3).




Page 6 of 15
(page number not for citation purposes)


*.o~
0
0 0

5.,-










C


W 0

0
00
.0'
Mo
^,


BMC Cancer 2009, 9:392







http://www.biomedcentral.com/1471-2407/9/392


SH122


0

9.7%




9E7%
i .'. : .




s 18.3%


'. IJ.




A"M


2.5

14.0%







oE% 5,1


11.9%


~*~L ~
* .4


11.5%


20.6% 251-%





^ ^jg*^ 2...*.
# I #
MWXMIi % 7 E tX I S2t


Annexin V

Figure 3
SH 122 enhanced TRAIL-induced apoptosis. DU 145 cells were seeded into 6-well plates at a concentration of 2 x I 0/ml,
and exposed by 2.5, 5 and 10 iM of SH 122, with or without TRAIL (50 ng/ml). Eighteen hours after incubation, cells were har-
vested and processed for Annexin V-FITC and PI staining by flow cytometry. Numbers represented total apoptosis (Annexin V
positive cell population). Data represented one of three independent experiments.


cytotoxicity curve to the left, i.e., sensitized the cells to
TRAIL. Based on IC50, a more than 300-fold sensitization
was observed in the cells transfected with XIAP shRNA as
compared with the vector control (Figure 5A and 5B).
Similarly, in clAP-1-shRNA transfected cells, an approxi-
mately 100-fold sensitization was achieved as compared
with that of the vector control (Figure 5C and 5D). These
results demonstrate that knockdown of XIAP and clAP-1
effectively sensitizes the cells to TRAIL, indicating that
both XIAP and clAP-1 are involved in TRAIL-resistance,
and that silencing XIAP and/or c-IAPl can overcome such
resistance in prostate cancer cells.

Downregulation of XIAP attenuates sensitization potential
of SH122 on TRAIL-induced cell death
Earlier studies have shown that both XIAP and clAP-1 are
specific targets of SH122 (Figure 1B and IC), and knock-
down of XIAP/clAP-1 resulted in significant TRAIL-sensi-
tization (Figure 5). To evaluate the role of XIAP in SH122-
mediated TRAIL sensitization, we treated XIAP knock-
down cells with SH122 and TRAIL. In vector shRNA


(shControl)-transfected cells, negative compound SH 110
showed a moderate sensitizing effect, while SH122 dra-
matically synergized TRAIL-induced cell death in a dose-
dependent manner. Even at the lowest concentration (0.1
riM), SH 122 was 22-fold more potent in sensitizing TRAIL
than a high concentration of SH 110 (10 riM) (Figure 6A).
However, in XIAP shRNA-transfected cells, the sensitizing
potential of SH122 was 102l104-fold less potent than
shown by the shControl cells (Figure 6B). These results
demonstrate that silencing XIAP dramatically attenuates
SH122-mediated sensitization of TRAIL-induced cytotox-
icity, suggesting that XIAP is an important target of IAP-
inhibitors involved in TRAIL sensitization.

SHI22 inhibits TRAIL-induced NF-KB activation
Because NF-KB activation is known to play a crucial role in
inhibiting apoptosis [19,21], we thought it was important
to evaluate the effect of SH122 on NF-KB activation
induced by TRAIL. First, we treated cells with TRAIL alone
at the concentration that achieved apoptosis, to create
optimal conditions for NF-KB activation in our system.


Page 7 of 15
(page number not for citation purposes)


10 (pM)
35%t


BMC Cancer 2009, 9:392


Dirk.


M%







http://www.biomedcentral.com/1471-2407/9/392


4 hours


TRAIL (ng/ml) -- -- -- 300 300 300 300 300
SH122 (plM) -- 10 20 -- 10 20 10 20
zVAD (WM) -- -- -- -- -- 2 2

A Death receptor pathway


Procaspase-8--
p43--

p26


Procaspase-3, r

p16

PARP-.-
p85-*


m


ba"WO


B Mitochondria pathway

BID--__ ep.


Procaspase-9- __ - _


Actin--


- -e -


6 hours


-- 10


300 300 300 300 300
-- 10 20 10 20
- -- 2 2


a-
- ~


e -


8 hours


- -- 300 300 300 300
10 20 -- 10 20 10
-- -- -- -- -- 2


S


eflOf 40 ma- I OMWewa"


- r ~ -


nAw0


a mm a - -~


I. I.


---------


Figure 4
SH 122 potentiated TRAIL-induced apoptosis by activating both the death-receptor pathway (A) and mito-
chondrial pathway (B). DU 145 cells were treated with 10 and 20 gtM of SH 122, in the presence or absence of 300 ng/ml of
TRAIL, with or without pretreatment with zVAD (2 gtM), for 4, 6, and 8 h, respectively. Whole cell lysates (30 gtg) were sub-
jected to Western blot analysis. Membranes were probed with antibodies against caspase-8, caspase-3, caspase-9, PARP and
Bid. Actin was shown as a loading control.


TRAIL induced IKBa degradation by 60% at 40 min post-
treatment, and concomitantly, nuclear RelA expression
increased over 3-fold at 40 min and lasted for 3 h of treat-
ment (Figure 7A). This revealed that TRAIL induced NF-KB
activation via the classic pathway by degrading cytosolic
IKBa and promoting RelA nuclear translocation. It is
worth noting that at 120 min post treatment, cleaved
PARP was observed in the nuclei extracts, suggesting a
quick apoptosis induced by TRAIL along with NF-KB acti-
vation, also reflecting a balance of cell death and cell sur-
vival triggered by the same stimuli (Figure 7A). TRAIL
consistently induced multiple NF-KB target genes expres-
sion. For the four target genes examined, TNF and IL8


expression reached their peak at 2 h post treatment, while
ICAM-1 and BIRC4 expression continued to increase dur-
ing treatment (Figure 7B).

Next, we pretreated DU145 cells with varying concentra-
tions of SH122 or SH123 to evaluate the effect of the IAP-
antagonist on TRAIL-induced NF-KB activation. Pre-treat-
ment of SH122 potently suppressed IKBa degradation
and RelA translocation in a dose-dependent manner (Fig-
ure 7C). At the same time point, SH122 was consistently
shown to suppress expression of all three NF-KB target
genes by 30-80% (P < 0.01 vs. control) even at a lower
concentration (Figure 7D). In comparison, even high con-


Page 8 of 15
(page number not for citation purposes)


BMC Cancer 2009, 9:392







http://www.biomedcentral.com/1471-2407/9/392


TRAIL (ng/ml)


shRNA
Vector clAP-1


clAP-1---m -


Actinf


D 120-
- 100-

> 80-

60-
'I-

J 40-

0 20-


r\I


IC50 (ng/ml)
A shVector >300
shclAP-1 3.8


U ----
0.001 0.01


0.1 1 10
TRAIL (ng/ml)


Figure 5
Downregulation of XIAP or clAP-I sensitized TRAIL-induced cell death. DU 145 cells were transfected with shRNA
of XIAP (shXIAP) (A, B) or clAP- I (shclAP- I1) (C, D), or the vector control (shVector), and knockdown effect was measured
48 h after transfection (A, C). Transfected cells were treated with TRAIL, and cytotoxicity was determined by CCK-8 detec-
tion kit (B, D). Normalized data were presented as mean SD (n = 3).


centrations of the negative compound SH 123 altered nei-
ther NF-KB protein redistribution (Figure 7C) nor NF-KB
target genes expression (Figure 7D).

To further validate that SH-122 inhibits NF-KB pathway,
we analyzed the effects of SH122 on NF-KB activation
induced by TRAIL in DU145 cells using luciferase-based
NF-KB reporter assay. We first examined the time-course
of TRAIL-induced NF-KB activation by NF-KB reporter
assay. 4 h TRAIL treatment resulted in ~5-fold NF-KB acti-
vation, and at 6 h over 9-fold activation was observed
(Figure 7E), but at this time point the cells started to show
signs of cell death. Therefore, we selected the 4 h TRAIL
treatment in our NF-KB reporter assay. As shown in Figure
7F, SH122 inhibited TRAIL-induced NF-KB activation by
>60% at doses of 5 and 10 uM, whereas the control com-
pound SH 123 had no such effect. Similar results were also
observed in DU145 cells stimulated with TNFa (data not
shown). These results demonstrate that SH122 exhibits a


promising effect of blocking the TRAIL-induced NF-KB
activation.

Discussion
In this study, we found that the small molecule Smac-
mimetic SH 122 potently sensitized TRAIL-induced apop-
tosis in multiple human prostate cancer cell lines. We also
found that although downregulation of either XIAP or
clAP-1 sensitized TRAIL-mediated cytotoxicity, XIAP
knockdown attenuated SH 122-mediated TRAIL sensitiza-
tion. Our results demonstrate that IAPs are valid molecu-
lar targets for modulating TRAIL sensitivity in prostate
cancer cells, and show that blocking IAPs achieves
improved efficacy and overcomes resistance to TRAIL. In
addition, our results demonstrate that NF-KB is involved
in regulating sensitivity of prostate cancer cells to TRAIL,
and a Smac-mimetic can augment TRAIL-induced apopto-
sis by blocking both IAPs and NF-KB (Figure 8).




Page 9 of 15
(page number not for citation purposes)


shRNA

Vector XIAP


XIAP-.


Actin-'


100 1000


BMC Cancer 2009, 9:392








http://www.biomedcentral.com/1471-2407/9/392


DU145-shVector


Sensitization (Fold)

DM SO 1.0
SH110 (10 pM) 8.8X102
SH122 (0.1 piM) 2.1X104
SH122 (1 pIM) 3.4X105
SH122 (10 pM) 1.2X106


TRAIL (ng/ml)


DU145-shXIAP


-H-I-
-B-
-2-
-0-


Sensitization (Fold)
DMSO 1.0
SH110 (10 pM) 1.9
SH122 (0.1 IM) 12.0
SH122 (1 piM) 41.3
SH122 (10 uM) 143.9


0.001 0.01 0.1 1 10 100
TRAIL (ng/ml)

Figure 6
Downregulation of XIAP attenuated sensitization effect of SH 122 on TRAIL-induced cell death. Cells transfected
with either XIAP shRNA (A) or the vector control shRNA (B) were treated with serial diluted TRAIL, alone or in combination
with 0.1, I and 10 iM of SH 122, respectively, with 10 iM of SH I 10 as a negative control. Cytotoxicity was determined by
CCK-8 detection kit. Normalized data were presented as mean SD (n = 3). Fold of sensitization was calculated by dividing
ICs0 of the compound-treated group by that of DMSO control.















Page 10 of 15
(page number not for citation purposes)


BMC Cancer 2009, 9:392








BMC Cancer 2009, 9:392


http://www.biomedcentral.com/1471-2407/9/392


TRAIL


35 0


0 20 40 60 120 180 (min)

|KBa -
1.0 1.0 0.4 0.9 1.0 1.2 Fold CE
Actin (IKBalAclIn)

RelA- ]-ill llllglillll -
1.0 1.3 3.2 3.1 3.4 3.3 Fold NE
P5 (RelAPARP)

p85 -0'


TRAIL

SH122 SH123 MG132

Con Con 1 5 10 10 10 (liM)
IhBa -I W- i

1.0 0.3 0.4 0.9 1.3 0.4 0.8 Fold A CEt
(IKBa/Actin)
Actin

RelA -I1 - ]
1.0 2.8 3.2 3.0 0.9 4.0 0.2 Fold NE
PARP O- eM- aft -ag n so .M (Re lAPARP)


-*-TNF
-u-IL8
-A-ICAM1
-*-B IRC4


0 20 40 60 120 180 min



10 TNF

8-
6-
4

o
4 IL8
, 3

a 2


Wf'f


Con Con 1 5 10 10 10 (gM)

SH122 SH123 MG132

TRAIL


Cl pControl
- pNF-kB


= pControl
- pNF-kB


0 1 2 4 6
Time after TRAIL treatment (hours)


Con Con Sum 10um 10um

SH122 SH123
TRAIL +


Figure 7 (see legend on next page)


Page 11 of 15
(page number not for citation purposes)







http://www.biomedcentral.com/1471-2407/9/392


Figure 7 (see previous page)
SH 122 suppressed TRAIL-induced NF-KB activation. A. DU 145 cells were treated with 300 ng/ml of TRAIL for the
indicated time. Cytosol and nuclei subcompartments were fractionated for detection of IKBa and RelA, with Actin and PARP
used as markers of cytosolic and nuclear extracts, respectively. Relative expression of IKBa and RelA was shown by dividing
band intensity by that of Actin and PARP, respectively. CE, cytosolic extract; NE, nuclear extract. B. After treatment with 300
ng/ml of TRAIL, cells were harvested for quantitative RT-PCR detect NF-KB target genes. Fold increase of gene expression was
calculated by dividing the normalized gene expression activity by that of the untreated control. C. Cells were pre-treated with
desired compounds for I h, and challenged with TRAIL (300 ng/ml) for 40 min. Cytosol and nuclei subcellular compartments
were fractionated for detection of IKBa and RelA, respectively. MG 132 was used as a positive control for blocking NF-KB. D.
After treatment as described in C, cells were harvested for quantitative RT-PCR to detect three NF-KB target genes. E, Time-
course of TRAIL-induced NF-KB activation examined by NF-KB luciferase reporter assay. DU145 cells were transiently co-
transfected with pNF-KB or pControl together with P-galactosidase plasmid, and then treated with TRAIL for the indicated
time. Luciferase and P-galactosidase activities were measured as described in Materials and Methods. F, SH 122 inhibited TRAIL-
induced NF-KB activation in NF-KB luciferase reporter assay. Transfected DU 145 cells were pretreated with SH 122 or SH 123
for I h followed by TRAIL treatment for 4 h. Fold of NF-KB activation was calculated by dividing the normalized luciferase
activity by that of the untreated control. Representative results of at least two independent experiments. Columns, mean; bars,
SD (n = 3). Con, DMSO vehicle control. ** P < 0.01; P < 0.05, Student's t-test (n = 3).


Smac-mimetic IAP-antagonists sensitize TRAIL-induced
apoptosis by blocking XIAP function in multiple tumor
models, including breast cancer [32], multiple myeloma
[16], glioblastoma [11] and ovarian cancer [33]. Embelin,
a natural XIAP inhibitor [44], sensitized TRAIL-induced
apoptosis in pancreatic cancer cells [45]. These findings
provide a strong rationale for using Smac-mimetics to
achieve TRAIL-sensitization by functional inhibition of
the overexpressed XIAP. To our knowledge, only a limited
number of studies have reported on the combination of
small molecule Smac-mimetic candidates with TRAIL in
prostate cancer therapy. Interestingly, in prostate cancer
cell lines, no strict correlation has been observed between
XIAP expression and TRAIL responsiveness [3]. This dis-
crepancy indicates that XIAP is not the only determinant
of TRAIL-resistance in prostate cancer. Nevertheless,
blocking XIAP function by transient overexpression of
Smac achieved a promising enhanced efficacy in combi-
nation with TRAIL in prostate cancer cell lines [46], indi-
cating that XIAP is the predominant target for TRAIL
sensitivity. In our system, we found that the lAP-antago-
nist alone did not induce apoptosis [35], but potently sen-
sitized TRAIL-induced cytotoxicity in TRAIL-resistant
DU145 and LNCaP cells, as well as in relatively TRAIL-
sensitive CL1 cells. Our finding, consistent with other
reports [17,47,48], suggests that the lAP-antagonist exerts
a potent sensitization effect independent of cell respon-
siveness to TRAIL, and provides an attractive strategy for
using lAP-antagonists in combination treatment.

In addition to IAPs, NF-KB is another well documented
pro-survival factor that is involved in mediating resistance
to TRAIL-induced apoptosis in tumor cells [49]. It has
been reported that constitutively active NF-KB signaling
leads to TRAIL-resistance by upregulating XIAP in multi-
ple human cancer cells [50], and in certain tumor cell


types, NF-KB is the primary cause for TRAIL resistance
[10]. Moreover, there is mounting evidence that clAP-1
physically interacts with adaptor proteins in TNFa/TRAIL-
mediated NF-KB signaling [51-53], suggesting that lAPs
serve as "bridging" molecules between the apoptosis path-
way and NF-KB pathway triggered by TRAIL (Figure 8).
Thus it is reasonable to postulate that the pro-apoptotic
lAP-antagonists may modulate NF-xKB. Indeed, several
recent studies reveal that Smac-mimetics (lAP-antago-
nists) can induce TNFa-dependent apoptosis in Smac-
sensitive cell lines by degrading clAPs and regulating NF-
KB signaling [29-31]. These findings indicate that in cell
lines that are sensitive to both Smac and TNFa, an IAP-
antagonist itself is sufficient to induce cell death through
autocrine TNFa signaling and caspase-8-dependent apop-
tosis [31,53].

Apart from these findings, our study shows that Smac-
mimetics as a single agent induce neither cell death nor
NF-KB activation in androgen-independent prostate can-
cer cells, suggesting that both apoptosis and NF-KB failed
to be activated by the Smac-mimetic alone in chemo- or
radioresistant cells with constitutively active NF-KB signal-
ing. The mechanism underlying such a discrepancy in dif-
ferent cell types remains to be investigated. However, our
data provide the first evidence that a potent Smac-mimetic
lAP-antagonist directly blocks TRAIL-induced NF-KB acti-
vation in prostate cancer cells. In fact, at the concentration
that effectively suppressed NF-KB activation, SH 122 sensi-
tized the effect of TRAIL several-hundred-fold, suggesting
that blocking NF-KB by a Smac-mimetic is sufficient for
TRAIL sensitization. Additionally, SH122-mediated inhi-
bition of IKBa degradation reflects an effect at the level of
the IKBa kinase (IKK) complex that is in agreement with
others' observations in different systems [11,54], indicat-
ing activation of the canonical NF-KB pathway. Further-


Page 12 of 15
(page number not for citation purposes)


BMC Cancer 2009, 9:392







http://www.biomedcentral.com/1471-2407/9/392


TRAIL


IBBa
degradation



XII
I ^^ LclAP-1J




SApoptosis
PARP cleavage


Figure 8
Working model of Smac-mimetic lAP-antagonist sensitizing TRAIL-induced apoptosis by suppressing NF-KB.
TRAIL triggers apoptosis via both the death-receptor (DR4/DR5) and mitochondrial pathways, by activating initiator caspase-8
and -9, and effector caspase-3. Furthermore, both Bid and PARP are cleaved by caspases, which are typical predictors of
TRAIL-mediated apoptosis. A Smac-mimetic effectively blocks IAP (XIAP/clAP-1) function and facilitates caspase activation.
Simultaneously, the Smac-mimetic suppresses TRAIL-induced classical NF-KB activation by preventing IKBUc degradation and
RelA nuclear translocation. Blockade of NF-KB XIAP signaling by small molecule Smac-mimetic abolishes counteraction of
pro-survival factors on TRAIL-mediated apoptosis.


more, SH122 suppresses XIAP mRNA expression driven
by NF-xB, demonstrating that TRAIL-mediated sensitiza-
tion by small molecule Smac-mimetic is associated with
functional inhibition of both XIAP and NF-xB, especially
in androgen-independent prostate cancer. Future work
will focus on evaluating the response to TRAIL and the
lAP-antagonists in androgen-dependent (AD) LNCaP
cells and their androgen-independent (AI) derivative CL1
cells. This isogenic (for hormone dependence) cell model
should permit us to determine if NF-KB plays an essential
role in the transition from AD to AI prostate cancer and to
discover if overcoming resistance to TRAIL-induced apop-
tosis can be achieved by down-modulating the NF-KB -
IAP signaling pathway.

Conclusion
Resistance to chemo- or radiotherapy, which is often asso-
ciated with recurrence after prior androgen deprivation
therapy in human prostate cancer, remains a severe clini-
cal problem [55]. TRAIL is currently being evaluated in


Phase I/II clinical trials, alone or in combination with
other therapies, for the treatment of prostate cancer
[3,10]. Our study indicates that blockade of IAPs by a
small molecule Smac-mimetic promotes TRAIL-induced
apoptosis in prostate cancer cells via modulating both the
apoptosis pathway and NF-KB pathway. As IAPs are key
molecular targets for the development of cancer cell-selec-
tive therapeutics, our findings reveal a potential mecha-
nism for a Smac-mimetic IAP-antagonist on TRAIL-
mediated signaling, and suggest that modulating IAPs
may contribute to enhanced TRAIL efficacy, especially in
androgen-independent prostate cancer with high levels of
IAPs and constitutively active NF-KB signaling. Therefore,
small molecule Smac-mimetics that specifically target
IAPs may yield a potential therapeutic benefit with TRAIL-
based therapy in chemo- or radioresistant prostate cancer.






Page 13 of 15
(page number not for citation purposes)


BMC Cancer 2009, 9:392








http://www.biomedcentral.com/1471-2407/9/392


Competing interests
LX is a co-inventor of the Smac-mimetic compounds
involved in the study. All other authors declare no com-
peting interests.


Authors' contributions
YD and ML contributed equally to this study. YD partici-
pated in the design of the study, performed NF-KB assay
and drafted the manuscript; ML performed the cell cul-
ture, MTT assay, apoptosis assay, transfection and Western
Blot, WT helped with the Western Blot analysis; YL and JL
carried out NF-KB luciferase reporter assay; TSL partici-
pated in the project design and in revising the manuscript;
LX supervised the study, experimental design, data analy-
sis, and revision of the manuscript. All authors read and
approved the final manuscript.


Acknowledgements
We thank Dr. Arie Belldegrun at University of California Los Angeles for
kindly providing the androgen-independent prostate cancer cell line CL I;
Dr. Susan Harris for help with the manuscript; Drs. Shaomeng Wang and
Haiying Sun at University of Michigan for providing the Smac-mimetic com-
pounds; and the University of Michigan Comprehensive Cancer Center
(UMCCC) Flow Cytometry Core for flow cytometry analysis.

Grant support: This study was supported in part by Department of
Defense Prostate Cancer Research Program W81XWH-06-1-0010 (to L.
X.), NIH grants CA121830, CA128220 and CAl 34655 (to L. X.), and by
NIH through the University of Michigan's Cancer Center Support Grant (5
P30 CA46592).

References
I. DiPaola RS, Patel J, Rafi MM: Targeting apoptosis in prostate
cancer. Hematol Oncol Clin North Am 2001, I5(3):509-524.
2. Xu L, Frederik P, Pirollo KF, Tang WH, Rait A, Xiang LM, Huang W,
Cruz I, Yin Y, Chang EH: Self-assembly of a virus-mimicking
nanostructure system for efficient tumor-targeted gene
delivery. Hum Gene Ther 2002, I3(3):469-481.
3. Bucur 0, Ray S, Bucur MC, Almasan A: APO2 ligand/tumor
necrosis factor-related apoptosis-inducing ligand in prostate
cancer therapy. Front Biosci 2006, 11:1549-1568.
4. Shankar S, Siddiqui I, Srivastava RK: Molecular mechanisms of res-
veratrol (3,4,5-trihydroxy-trans-stilbene) and its interaction
with TNF-related apoptosis inducing ligand (TRAIL) in
androgen-insensitive prostate cancer cells. Mol Cell Biochem
2007, 304(1-2):273-285.
5. Steele LP, Georgopoulos NT, Southgate J, Selby PJ, Trejdosiewicz LK:
Differential susceptibility to TRAIL of normal versus malig-
nant human urothelial cells. Cell Death Differ 2006,
13(9):1564-1576.
6. Almasan A, Ashkenazi A: Apo2L/TRAIL: apoptosis signaling,
biology, and potential for cancer therapy. Cytokine Growth Fac-
tor Rev 2003, 14(3-4):337-348.
7. Ng CP, Zisman A, Bonavida B: Synergy is achieved by comple-
mentation with Apo2L/TRAIL and actinomycin D in Apo2L/
TRAIL-mediated apoptosis of prostate cancer cells: role of
XIAP in resistance. Prostate 2002, 53(4):286-299.
8. Knight MJ, Riffkin CD, Ekert PG, Ashley DM, Hawkins CJ: Caspase-
8 levels affect necessity for mitochondrial amplification in
death ligand-induced glioma cell apoptosis. Mol Carcinog 2004,
39(3):173-182.
9. Fulda S, Meyer E, Debatin KM: Inhibition of TRAIL-induced
apoptosis by Bcl-2 overexpression. Oncogene 2002,
21(15):2283-2294.
10. Kruyt FA: TRAIL and cancer therapy. Cancer Lett 2008,
263(1): 14-25.


I I. Li L, Thomas RM, Suzuki H, De Brabander JK, Wang X, Harran PG: A
small molecule Smac mimic potentiates TRAIL- and TNFal-
pha-mediated cell death. Science 2004, 305(5689): 1471-1474.
12. Cummins JM, Kohli M, Rago C, Kinzler KW, Vogelstein B, Bunz F: X-
linked inhibitor of apoptosis protein (XIAP) is a nonredun-
dant modulator of tumor necrosis factor-related apoptosis-
inducing ligand (TRAIL)-mediated apoptosis in human can-
cer cells. Cancer Res 2004, 64(9):3006-3008.
13. Fulda S, Wick W, Weller M, Debatin KM: Smac agonists sensitize
for Apo2L/TRAIL- or anticancer drug-induced apoptosis and
induce regression of malignant glioma in vivo. Nat Med 2002,
8(8):808-815.
14. Schimmer AD, Welsh K, Pinilla C, Wang Z, Krajewska M, Bonneau
MJ, Pedersen IM, Kitada S, Scott FL, Bailly-Maitre B, Glinsky G, Scud-
iero D, Sausville E, Salvesen G, Nefzi A, Ostresh JM, Houghten RA,
Reed JC: Small-molecule antagonists of apoptosis suppressor
XIAP exhibit broad antitumor activity. Cancer Cell 2004,
5(1):25-35.
15. Gaither A, Porter D, Yao Y, Borawski J, Yang G, Donovan J, Sage D,
Slisz J, Tran M, Straub C, Ramsey T, lourgenko V, Huang A, Chen Y,
Schlegel R, Labow M, Fawell S, Sellers WR, Zawel L: A Smac
mimetic rescue screen reveals roles for inhibitor of apopto-
sis proteins in tumor necrosis factor-alpha signaling. Cancer
Res 2007, 67(24):l 1493-1 1498.
16. Chauhan D, Neri P, Velankar M, Podar K, Hideshima T, Fulciniti M,
Tassone P, Raje N, Mitsiades C, Mitsiades N, Richardson P, Zawel L,
Tran M, Munshi N, Anderson KC: Targeting mitochondrial fac-
tor Smac/DIABLO as therapy for multiple myeloma (MM).
Blood 2007, 109(3): 1220-1227.
17. Chawla-Sarkar M, Bae SI, Reu FJ, Jacobs BS, Lindner DJ, Borden EC:
Downregulation of Bcl-2, FLIP or lAPs (XIAP and survivin)
by siRNAs sensitizes resistant melanoma cells to Apo2L/
TRAIL-induced apoptosis. Cell Death Differ 2004, II (8):915-923.
18. Zhang L, Fang B: Mechanisms of resistance to TRAIL-induced
apoptosis in cancer. Cancer Gene Ther 2005, 12(3):228-237.
19. Sarkar FH, Li Y: NF-kappaB: a potential target for cancer che-
moprevention and therapy. Front Biosci 2008, 13:2950-2959.
20. Pahl HL: Activators and target genes of Rel/NF-kappaB tran-
scription factors. Oncogene 1999, 18(49):6853-6866.
21. Falschlehner C, Emmerich CH, Gerlach B, Walczak H: TRAIL sig-
nalling: decisions between life and death. IntJ Biochem Cell Biol
2007, 39(7-8): 1462-1475.
22. Suh J, Rabson AB: NF-kappaB activation in human prostate
cancer: important mediator or epiphenomenon? J Cell Bio-
chem 2004, 91(1):100-1 17.
23. Dai Y, Lawrence TS, Xu L: Overcoming cancer therapy resist-
ance by targeting inhibitors of apoptosis proteins and
nuclear factor-kappa B. Am J Transl Res 2009, I(I):4-18.
24. Irmler M, Steiner V, Ruegg C, Wajant H, Tschopp J: Caspase-
induced inactivation of the anti-apoptotic TRAFI during Fas
ligand-mediated apoptosis. FEBS Lett 2000, 468(2-3):129-133.
25. Holcik M, Gibson H, Korneluk RG: XIAP: apoptotic brake and
promising therapeutic target. Apoptosis 2001, 6(4):253-261.
26. Wu G, Chai J, Suber TL, Wu JW, Du C, Wang X, Shi Y: Structural
basis of IAP recognition by Smac/DIABLO. Nature 2000,
408(6815):1008-1012.
27. Liu Z, Sun C, Olejniczak ET, Meadows RP, Betz SF, OostT, Herrmann
J, Wu JC, Fesik SW: Structural basis for binding of Smac/DIA-
BLO to the XIAP BIR3 domain. Nature 2000,
408(6815):1004-1008.
28. Srinivasula SM, Ashwell JD: lAPs: What's in a Name? Mol Cell
2008, 30:123-135.
29. Varfolomeev E, Blankenship JW, Wayson SM, Fedorova AV, Kayagaki
N, Garg P, Zobel K, Dynek JN, Elliott LO, Wallweber HJ, Flygare JA,
Fairbrother WJ, Deshayes K, Dixit VM, Vucic D: IAP antagonists
induce autoubiquitination of c-lAPs, NF-kappaB activation,
and TNFalpha-dependent apoptosis. Cell 2007,
131(4):669-681.
30. Vince JE, Wong WW, Khan N, Feltham R, Chau D, Ahmed AU,
Benetatos CA, Chunduru SK, Condon SM, McKinlay M, Brink R,
Leverkus M, Tergaonkar V, Schneider P, Callus BA, Koentgen F, Vaux
DL, Silke J: IAP antagonists target clAP I to induce TNFalpha-
dependent apoptosis. Cell 2007, 131(4):682-693.
31. Petersen SL, Wang L, Yalcin-Chin A, Li L, Peyton M, Minna J, Harran
P, Wang X: Autocrine TNFalpha signaling renders human




Page 14 of 15
(page number not for citation purposes)


BMC Cancer 2009, 9:392








http://www.biomedcentral.com/1471-2407/9/392


cancer cells susceptible to Smac-mimetic-induced apoptosis.
Cancer Cell 2007, I 2(5):445-456.
32. Bockbrader KM, Tan M, Sun Y: A small molecule Smac-mimic
compound induces apoptosis and sensitizes TRAIL- and
etoposide-induced apoptosis in breast cancer cells. Oncogene
2005, 24(49):7381-7388.
33. Petrucci E, Pasquini L, Petronelli A, Saulle E, Mariani G, Riccioni R, Bif-
foni M, Ferretti G, Benedetti-Panici P, Cognetti F, Scambia G, Hum-
phreys R, Peschle C, Testa U: A small molecule Smac mimic
potentiates TRAIL-mediated cell death of ovarian cancer
cells. Gynecol Oncol 2007, 105(2):481-492.
34. Sun H, Nikolovska-Coleska Z, Yang CY, Xu L, Liu M, Tomita Y, Pan
H, Yoshioka Y, Krajewski K, Roller PP, Wang S: Structure-based
design of potent, conformationally constrained Smac
mimetics. j Am Chem Soc 2004, I 26(51): 16686-16687.
35. Sun H, Nikolovska-Coleska Z, Yang CY, Xu L, Tomita Y, Krajewski K,
Roller PP, Wang S: Structure-based design, synthesis, and eval-
uation of conformationally constrained mimetics of the sec-
ond mitochondria-derived activator of caspase that target
the X-linked inhibitor of apoptosis protein/caspase-9 interac-
tion site. j Med Chem 2004, 47(1 7):4147-4150.
36. Sun H, Nikolovska-Coleska Z, Lu J, Qiu S, Yang CY, Gao W, Meagher
J, Stuckey J, Wang S: Design, synthesis, and evaluation of a
potent, cell-permeable, conformationally constrained sec-
ond mitochondria derived activator of caspase (Smac)
mimetic. j Med Chem 2006, 49(26):7916-7920.
37. Jia G, Zhan Y, Wu D, Meng Y, Xu L: An improved ultrasound-
assisted extraction process of gossypol acetic acid from cot-
tonseed soapstock. AlChEj 2009, 55(3):797-806.
38. Dai Y, Liu M, Tang W, Desano J, Burstein E, Davis M, Pienta K, Law-
rence T, Xu L: Molecularly targeted radiosensitization of
human prostate cancer by modulating inhibitor of apoptosis.
Clin Cancer Res 2008, 14(23):7701-7710.
39. Burstein E, Hoberg JE, Wilkinson AS, Rumble JM, Csomos RA,
Komarck CM, Maine GN, Wilkinson JC, Mayo MW, Duckett CS:
COMMD proteins, a novel family of structural and functional
homologs of MURRI. j Biol Chem 2005, 280(23):22222-22232.
40. Maine GN, Burstein E: COMMD proteins and the control of the
NF kappa B pathway. Cell Cycle 2007, 6(6):672-676.
41. Ji Q, Hao X, Meng Y, Zhang M, Desano J, Fan D, Xu L: Restoration
of tumor suppressor miR-34 inhibits human p53-mutant gas-
tric cancer tumorspheres. 8MC Cancer 2008, 8(1):266.
42. Dai Y, DeSano JT, Meng Y, Ji Q, Ljungman M, Lawrence TS, Xu L:
Celastrol potentiates radiotherapy by impairment of DNA
damage processing in human prostate cancer. Int ] Radiat
Oncol Biol Phys 2009, 74(4): 1217-1225.
43. Ng CP, Bonavida B: X-linked inhibitor of apoptosis (XIAP)
blocks Apo2 ligand/tumor necrosis factor-related apoptosis-
inducing ligand-mediated apoptosis of prostate cancer cells
in the presence of mitochondrial activation: sensitization by
overexpression of second mitochondria-derived activator of
caspase/direct lAP-binding protein with low pi (Smac/DIA-
BLO). Mol Cancer Ther 2002, I (I 2): 1051-1058.
44. Nikolovska-Coleska Z, Xu L, Hu Z, Tomita Y, Li P, Roller PP, Wang
R, Fang X, Guo R, Zhang M, Lippman ME, Yang D, Wang S: Discov-
ery of embelin as a cell-permeable, small-molecular weight
inhibitor of XIAP through structure-based computational
screening of a traditional herbal medicine three-dimensional
structure database. j Med Chem 2004, 47(10):2430-2440.
45. Naumann U, Bahr 0, Wolburg H, Altenberend S, Wick W, Liston P,
Ashkenazi A, Weller M: Adenoviral expression of XIAP anti-
sense RNA induces apoptosis in glioma cells and suppresses
the growth of xenografts in nude mice. Gene Ther 2007,
14(2):147-161.
46. Mitsiades CS, Mitsiades N, Poulaki V, Schlossman R, Akiyama M,
Chauhan D, Hideshima T, Treon SP, Munshi NC, Richardson PG,
Anderson KC: Activation of NF-kappaB and upregulation of
intracellular anti-apoptotic proteins via the IGF- I/Akt signal-
ing in human multiple myeloma cells: therapeutic implica-
tions. Oncogene 2002, 21 (37):5673-5683.
47. Amantana A, London CA, Iversen PL, Devi GR: X-linked inhibitor
of apoptosis protein inhibition induces apoptosis and
enhances chemotherapy sensitivity in human prostate can-
cer cells. Mol Cancer Ther 2004, 3(6):699-707.
48. Mao HL, Liu PS, ZhengJF, Zhang PH, Zhou LG, Xin G, Liu C: Trans-
fection of Smac/DIABLO sensitizes drug-resistant tumor


cells to TRAIL or paclitaxel-induced apoptosis in vitro. Phar-
macol Res 2007, 56(6):483-492.
49. Morales JC, Ruiz-Magana MJ, Ruiz-Ruiz C: Regulation of the resist-
ance to TRAIL-induced apoptosis in human primary T lym-
phocytes: role of NF-kappaB inhibition. Mol Immunol 2007,
44(1 0):2587-2597.
50. Braeuer SJ, Buneker C, Mohr A, Zwacka RM: Constitutively acti-
vated nuclear factor-kappaB, but not induced NF-kappaB,
leads to TRAIL resistance by up-regulation of X-linked inhib-
itor of apoptosis protein in human cancer cells. Mol Cancer Res
2006, 4(10):715-728.
51. Kuai J, Nickbarg E, Wooters J, Qiu Y, Wang J, Lin LL: Endogenous
association of TRAF2, TRAF3, clAPI, and Smac with lym-
photoxin beta receptor reveals a novel mechanism of apop-
tosis. j Biol Chem 2003, 278(16):14363-14369.
52. Samuel T, Welsh K, Lober T, Togo SH, Zapata JM, Reed JC: Distinct
BIR domains of clAPI mediate binding to and ubiquitination
of tumor necrosis factor receptor-associated factor 2 and
second mitochondrial activator of caspases. j Biol Chem 2006,
281 (2):1080-1090.
53. Bertrand MJ, Milutinovic S, Dickson KM, Ho WC, Boudreault A, Dur-
kinj, Gillard JW,JaquithJB, Morris SJ, Barker PA: clAPI and clAP2
facilitate cancer cell survival by functioning as E3 ligases that
promote RIPI ubiquitination. Mol Cell 2008, 30(6):689-700.
54. Ahn KS, Sethi G, Aggarwal BB: Embelin, an inhibitor of X chro-
mosome-linked inhibitor-of-apoptosis protein, blocks
nuclear factor-kappaB (NF-kappaB) signaling pathway lead-
ing to suppression of NF-kappaB-regulated antiapoptotic
and metastatic gene products. Mol Pharmacol 2007,
71(1):209-219.
55. Johnstone RW, Ruefli AA, Lowe SW: Apoptosis: a link between
cancer genetics and chemotherapy. Cell 2002, 108(2): 153-164.

Pre-publication history
The pre-publication history for this paper can be accessed
here:


http://www.biomedcentral.com/1471-2407/9/392/pre


Page 15 of 15
(page number not for citation purposes)


Publish with BioMed Central and every
scientist can read your work free of charge
"BioMed Central will be the most significant development for
disseminating the results of biomedical research in our lifetime."
Sir Paul Nurse, Cancer Research UK
Your research papers will be:
available free of charge to the entire biomedical community
peer reviewed and published immediately upon acceptance
cited in PubMed and archived on PubMed Central
yours you keep the copyright
Submit your manuscript here: BioMedcentral
http://www.biomedcentral.com/info/publishing adv.asp


BMC Cancer 2009, 9:392




University of Florida Home Page
© 2004 - 2010 University of Florida George A. Smathers Libraries.
All rights reserved.

Acceptable Use, Copyright, and Disclaimer Statement
Last updated October 10, 2010 - - mvs