Group Title: BMC Microbiology
Title: Biofilm formation and virulence expression by Streptococcus mutans are altered when grown in dual-species model
CITATION PDF VIEWER THUMBNAILS PAGE IMAGE ZOOMABLE
Full Citation
STANDARD VIEW MARC VIEW
Permanent Link: http://ufdc.ufl.edu/UF00099894/00001
 Material Information
Title: Biofilm formation and virulence expression by Streptococcus mutans are altered when grown in dual-species model
Physical Description: Book
Language: English
Creator: Wen, Zezhang
Yates, David
Ahn, Sang-Joon
Burne, Robert
Publisher: BMC Microbiology
Publication Date: 2010
 Notes
Abstract: BACKGROUND:Microbial cell-cell interactions in the oral flora are believed to play an integral role in the development of dental plaque and ultimately, its pathogenicity. The effects of other species of oral bacteria on biofilm formation and virulence gene expression by Streptococcus mutans, the primary etiologic agent of dental caries, were evaluated using a dual-species biofilm model and RealTime-PCR analysis. RESULTS:As compared to mono-species biofilms, biofilm formation by S. mutans was significantly decreased when grown with Streptococcus sanguinis, but was modestly increased when co-cultivated with Lactobacillus casei. Co-cultivation with S. mutans significantly enhanced biofilm formation by Streptococcus oralis and L. casei, as compared to the respective mono-species biofilms. RealTime-PCR analysis showed that expression of spaP (for multi-functional adhesin SpaP, a surface-associated protein that S. mutans uses to bind to the tooth surface in the absence of sucrose), gtfB (for glucosyltransferase B that synthesizes alpha1,6-linked glucan polymers from sucrose and starch carbohydrates) and gbpB (for surface-associated protein GbpB, which binds to the glucan polymers) was decreased significantly when S. mutans were co-cultivated with L. casei. Similar results were also found with expression of spaP and gbpB, but not gtfB, when S. mutans was grown in biofilms with S. oralis. Compared to mono-species biofilms, the expression of luxS in S. mutans co-cultivated with S. oralis or L. casei was also significantly decreased. No significant differences were observed in expression of the selected genes when S. mutans was co-cultivated with S. sanguinis. CONCLUSIONS:These results suggest that the presence of specific oral bacteria differentially affects biofilm formation and virulence gene expression by S. mutans.
General Note: Start page 111
General Note: M3: 10.1186/1471-2180-10-111
 Record Information
Bibliographic ID: UF00099894
Volume ID: VID00001
Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: Open Access: http://www.biomedcentral.com/info/about/openaccess/
Resource Identifier: issn - 1471-2180
http://www.biomedcentral.com/1471-2180/10/111

Downloads

This item has the following downloads:

PDF ( PDF )


Full Text



BMC Microbiology


Q BioMed Central


This Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formatted
PDF and full text (HTML) versions will be made available soon.

Biofilm formation and virulence expression by Streptococcus mutans are altered
when grown in dual-species model


BMC Microbiology 2010, 10:111


doi: 10.1186/1471-2180-10-111


Zezhang T Wen (zwen@lsuhsc.edu)
David Yates (darthyater@hotmail.com)
Sang-Joon Ahn (sahn@dental.ufl.edu)
Robert A Burne (rburne@dental.ufl.edu)




ISSN 1471-2180


Article type

Submission date

Acceptance date

Publication date

Article URL


Research article

11 November 2009

14 April 2010

14 April 2010

http://www.biomedcentral.com/1471-2180/10/111


Like all articles in BMC journals, this peer-reviewed article was published immediately upon
acceptance. It can be downloaded, printed and distributed freely for any purposes (see copyright
notice below).

Articles in BMC journals are listed in PubMed and archived at PubMed Central.

For information about publishing your research in BMC journals or any BioMed Central journal, go to

http://www.biomedcentral.com/info/authors/


2010 Wen et al. licensee BioMed Central Ltd.
This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0),
which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.















Biofilm formation and virulence expression by Streptococcus

mutans are altered when grown in dual-species model





Zezhang T. Wen'*, David Yates2, Sang-Joon Ahn2 and Robert A. Burne2


Addresses: 1Department of Oral and Craniofacial Biology and Department of
Microbiology, Immunology and Parasitology, Louisiana State University Health Sciences
Center, New Orleans, LA 70119, USA; 2Department of Oral Biology, College of
Dentistry, University of Florida, Box 100424, Gainesville, FL 32610, USA.


Email: ZT Wen*, zwen@lsuhsc.edu; D Yates, darthyater@hotmail.com; SJ Ahn,
sahn@dental.ufl.edu; RA Burne, rbume@dental.ufl.edu


*Corresponding Author









Abstract

Background: Microbial cell-cell interactions in the oral flora are believed to play an

integral role in the development of dental plaque and ultimately, its pathogenicity. The

effects of other species of oral bacteria on biofilm formation and virulence gene

expression by Streptococcus mutans, the primary etiologic agent of dental caries, were

evaluated using a dual-species biofilm model and RealTime-PCR analysis. Results: As

compared to mono-species biofilms, biofilm formation by S. mutans was significantly

decreased when grown with Streptococcus sanguinis, but was modestly increased when

co-cultivated with Lactobacillus casei. Co-cultivation with S. mutans significantly

enhanced biofilm formation by Streptococcus oralis and L. casei, as compared to the

respective mono-species biofilms. RealTime-PCR analysis showed that expression of

spaP (for multi-functional adhesin SpaP, a surface-associated protein that S. mutans uses

to bind to the tooth surface in the absence of sucrose), gtfB (for glucosyltransferase B that

synthesizes Ul,6-linked glucan polymers from sucrose and starch carbohydrates) and

gbpB (for surface-associated protein GbpB, which binds to the glucan polymers) was

decreased significantly when S. mutans were co-cultivated with L. casei. Similar results

were also found with expression of spaP and gbpB, but not gtfB, when S. mutans was

grown in biofilms with S. oralis. Compared to mono-species biofilms, the expression of

luxS in S. mutans co-cultivated with S. oralis or L. casei was also significantly decreased.

No significant differences were observed in expression of the selected genes when S.

mutans was co-cultivated with S. sanguinis. Conclusions: These results suggest that the

presence of specific oral bacteria differentially affects biofilm formation and virulence

gene expression by S. mutans.









Background

Oral biofilms are compositionally and structurally complex bacterial communities.

To date, more than 750 different species or phylotypes of bacteria have been identified in

mature dental plaque [1]. Microbial cell-cell interactions in the oral flora and their

impact on bacterial adherence and biofilm formation are beginning to be appreciated [1-

4]. Cross-feeding or metabolic cooperation is well-documented among certain bacterial

species in the oral flora. Veillonellae can utilize the lactic acid produced by streptococci

and Porphyromonas gingivalis benefits from succinate produced by T. denticola.

Similarly, isobutyrate secreted by P. ginivalis stimulates the growth of T. denticola [2, 3].

Adhesin-ligand mediated physical interactions such as those between Streptococcus

gordonii and P. gingivalis may be important for secondary colonizers like P. gingivalis to

establish and persist in the oral cavity [5]. A recent study has also provided evidence that

a mutualistic effect in biofilm formation between Actinomyces naeslundii and

Streptococcus oralis is facilitated by autoinducer-2 (Al-2) [6]. Intra- and inter-species

interactions are believed to play a crucial role in community dynamics, contributing to

the formation of plaque and, ultimately, the development of polymicrobial diseases,

including caries and periodontitis [2, 5]. Therefore, a better understanding of cell-cell

interactions between oral pathogens and commensal bacteria, and the impact of these

interactions on expression of virulence factors and pathogenicity, could lead to

development of novel preventive and therapeutic strategies against dental caries and

periodontitis.

As the principal etiological agent of human dental caries, Streptococcus mutans has

developed multiple mechanisms to colonize the tooth surface and, under certain









conditions, to become a numerically significant species in cariogenic biofilms [7]. The

multi-functional adhesin SpaP, also called P1 and PAc 1, is considered the primary factor

mediating early attachment of S. mutans to tooth enamel in the absence of sucrose [8]. S.

mutans also produces at least three glucosyltransferases (GtfB, -C & -D), which

polymerize the glucosyl moiety from sucrose and starch carbohydrates into al,3- and

al,6-linked glucans [7, 9]. Binding to glucans by glucan binding proteins (GbpA, -B, -C

and -D) and by the Gtfs facilitates bacterial adherence to tooth surfaces, inter-bacterial

adhesion and accumulation of biofilms [9, 10]. GtfBC&D and GbpABC&D, together

with the adhesive extracellular glucans, constitute the sucrose-dependent pathway for S.

mutans to establish on the tooth surface and are of central importance in plaque formation

and development of caries [7, 9-14].

Multiple regulatory networks that integrate external signals, including the cell

density-dependent Com system and other two-component regulatory systems, including

CiaHR, LiaSR and VicRK, with CiaH, LiaS and VicK being the sensor kinases and CiaR,

LiaR and VicR the response regulators of two-component system, are required for

biofilm formation [15-20, 21]. S. mutans also possesses a LuxS-mediated signaling

pathway that affects biofilm formation and bacteriocin production [18, 22, 23]. LuxS is

the enzyme that catalyzes the reactions leading to the production of the AI-2 signal

molecule [24]. In addition, a number of other gene products, such as BrpA (a cell

surface-associated biofilm regulatory protein), have also been shown to play critical roles

in environmental stress responses and biofilm development by S. mutans [25, 26]. While

much effort has been devoted to understanding the molecular mechanisms of adherence,

biofilm development and virulence gene expression by S. mutans in pure cultures, there









are large gaps in our knowledge of how this cariogenic bacterium behaves in response to

inter-generic interactions with bacteria commonly found in the supragingival plaque.

In this study, we developed a dual-species in vitro model to examine the impact of

co-cultivation of S. mutans with S. oralis or S. sanguinis, two primary colonizers and

members of the normal flora, or with Lactobacillus casei, a bacterium frequently isolated

from carious sites, on biofilm formation by these bacteria and expression of known

virulence factors of S. mutans. Data presented here suggest that growth in dual-species

impacts surface biomass accumulation by some of the bacterial species analyzed, as

compared to the respective mono-species biofilms and that the expression of known

virulence factors by S. mutans can be differentially modulated by growth with other

bacteria commonly found in dental plaque. Such interactions may influence the

formation, architecture and pathogenic potential of human dental plaque.









Methods

Bacterial strains and growth conditions. S. mutans UA159, S. oralis SK92 and S.

sanguinis SK150 were maintained in Brain Heart Infusion (BHI, Becton, Dickinson and

Company, MD), and L. casei 4646 was maintained in Lactobacillus MRS (Difco

Laboratories, MI). For biofilm formation, all cultures were grown on semi-defined

biofilm medium (BM) [27] with 18 mM glucose and 2 mM sucrose as the supplemental

carbohydrate sources (BMGS) [18, 26]. Biofilms were grown in a 5% CO2-aerobic

atmosphere at 370C. For growth studies using a Bioscreen C (Oy Growth Curves AB

Ltd, Finland), cultures were grown at 370C aerobically and the optical densities were

monitored every 30 minutes, with shaking for 10 seconds before measurement [28].



Growth of dual-species biofilms. Sterile glass slides were used as substratum and

biofilms were grown by following a protocol described previously [25, 26]. Briefly,

overnight broth cultures were transferred by 1:50 dilutions into fresh, pre-warmed, broth

medium (BHI for streptococci and MRS for lactobacillus) and were allowed to grow until

mid-exponential phase (OD600nm 0.5) before transfer to BMGS for biofilm formation.

For mono-species biofilms, 450 pl of the individual cultures was added to the culture

tube, and for two-species biofilms, 450 pl of each culture was used as inoculum. The

biofilms grown on the glass slides that were deposited in 50 ml Falcon tubes were

aseptically transferred daily to fresh BMGS. After four days, the biofilms were scratched

off with a sterile spatula and suspended in 7.5 ml of 10 mM potassium phosphate buffer,

pH 7.0. To de-chain and separate the cells, the biofilms were sonicated using a Sonic

Dismembrator (model 100, Fisher Scientific, Idaho) at energy level 3 for 25 seconds,









twice, with 2 minutes on ice between treatments. To determine the total number of viable

bacterial cells (colony-forming units, CFU), 100 p1 from dispersed, four-day biofilms

was serially diluted in potassium phosphate buffer, 10 mM, pH 7.0, and plated in

triplicate on BHI agar plates.



RNA extraction. Immediately after sampling for plating, bacterial cells were treated

with RNAProtect (Qiagen Inc., CA) as recommended by the supplier. The cells were

then pelleted by centrifugation and total RNA extractions were performed using a hot

phenol method [18, 26]. To remove all DNA, the purified RNAs were treated with

DNAse I (Ambion, Inc., TX) and RNA was retrieved with the Qiagen RNeasy

purification kit, including an additional on-column DNAse I treatment with RNase-free

DNase I.



RealTime-PCR. For RealTime-PCR, gene-specific primers were designed using the

DNA mfold program (http://www.bioinfo.rpi.edu/application/mfold/old/dna) and Beacon

Designer 3.0 (PREMIER Biosoft International, Palo Alto, CA) using the following

criteria: primer length 20-22 nucleotides, Tm > 60C with 50 mM NaCl and 3 mM MgC12,

and the expected length of PCR products 85-150 bp (Table 1). For RealTime-PCR,

cDNA was generated with gene-specific primers using SuperScript III First Strand

Synthesis Kit (InVitorgen, CA) by following the supplier's recommendations. For

validation assays, iScript Reverse Transcriptase was also used to generate cDNA

templates with random nanomers as primers (Bio-Rad laboratories, CA). RealTime-PCR









was conducted using the iCycler iQ real time PCR detection system (Bio-Rad

Laboratories), with controls and standards as described previously [20, 26].



Data analysis. The mRNA copy number of selected virulence factors was determined

per pg of total RNA. When grown in the dual-species model, the values were further

normalized to relative numbers of S. mutans by multiplying the copy number by the ratio

of S. mutans CFU to the total CFU in the mixed-species biofilms. The resulting data

were expressed as copy number per pg of S. mutans total RNA. Statistical analysis was

carried out using the non-parametric Kruskal-Wallis test and t-test.



Results and Discussion

Establishment of a suitable biofilm model for the reliable monitoring of gene

expression in S. mutans. Glass slides can be used very effectively to cultivate biofilms

of oral bacteria [26, 29]. As compared to tooth enamel model systems, e.g.

hydroxylapatite disks, glass slides are easier to handle, stable and non-reactive. By daily

transfer to fresh medium, bacteria on glass surfaces continue to accumulate and generate

sufficient biofilms after 3-4 days for multiple experiments [29], including whole genome

transcriptional profiling [26].

For measurement of the expression levels of selected virulence factors by S. mutans,

total RNA was extracted from mono- and dual-species biofilms and RealTime-PCR

reactions were carried out using gene-specific primers (Table 1). To confirm that no

genomic DNAs left in the RNA preps, cDNA synthesis reactions that received no reverse

transcriptase were used as controls and results of RealTime-PCR using gene-specific









primers (Table 1) showed that none of the RNA preps used in this study had any

significant genomic DNA contamination. To verify that the primers did not amplify non-

S. mutans genes under the conditions tested, total RNA of S. oralis, S. sanguinis and L.

casei, either alone or in mixtures with known quantities of S. mutans RNA, were used as

a template for reverse transcription and RealTime-PCR. No cDNA was detected when S.

oralis, S. sanguinis or L. casei total RNA alone was used as a template with primers for

spaP, gtfB, gbpB, luxS, and brpA, as well as the Idh gene encoding lactate

dehydrogenase) (data not shown). Melting curves consistently presented unique

amplification products for every amplicon tested. Results also demonstrated that the

presence of RNA from non-mutans streptococci or from lactobacilli had no significant

effect on the efficiency of amplification of S. mutans specific products. Specifically,

quantification of the respective genes in mixed RNA samples yielded results that were

proportional to the amount of S. mutans RNA used in the reactions (data not shown).

Similar results were also obtained with genomic DNA from the respective strains as

templates (data not shown).

The choice of appropriate controls for this study was carefully considered.

Ribosomal RNA is the most commonly used reference in single species transcriptional

analysis, and has often been used as a control in Northern analysis of S. mutans RNA [18,

30]. However, use of ribosomal RNAs could be misleading when it is used for analysis

of gene expression in mixed-species biofilms, especially when closely related species are

present in the consortium. Specifically, during calibration of the methods, cross-reactions

between rRNA of different bacterial sources were noted, as shown by multiple peaks in

the melting curves in the RealTime-PCR reactions (data not shown). Therefore, rather









than use rRNA total viable counts (CFU) were used to normalize the RealTime-PCR

data. Brief sonication was used to disperse the biofilms. When plated on BHI agar

plates, the distinctive colony morphology of S. mutans (flat, opaque, dry colonies with

rough surface) versus S. oralis (small, flat and smooth colonies), S. sanguinis and L. casei

(both forming small, wet, convex colonies with shiny and smooth surfaces) made it easy

to distinguish S. mutans from the other streptococci and L. casei. For S. mutans-L. casei

dual-species biofilms, an erythromycin resistant L. casei strain (Browngardt and Bume,

unpublished data) was also used in dual-species biofilms, and BHI agar plates containing

erythromycin (5 pg ml -1) were used for viable counts of L. casei. The results were

similar to those when BHI agar plates were used (data not shown).

The lactate dehydrogenase gene Idh of S. mutans has been reported to be

constitutively expressed [31] (Wen and Bume, unpublished data), so we also examined

whether this gene may serve as a suitable reference. No cross-reactions were detected

between primers of S. mutans Idh and genes of other bacteria (data not shown). As

expected, no significant difference in expression of Idh was observed between S. mutans

grown in mono-species biofilms and those in dual-species biofilms, following proper

normalization to CFU (Figure 1)._ Similar results were obtained when random primers

were used to generate cDNA template instead of Idh-specific primers. These results add

additional support to the finding that RealTime-PCR with normalization to CFU is a

reliable approach for assessment of gene regulation in S. mutans growing in this mixed-

species biofilm model.









S. mutans enhances biofilm formation by S. oralis and L. casei in dual-species model.

When grown on glass slides, S. mutans accumulated an average of 8.8x1010 CFU after 4

days (Figure 2). S. sanguinis also formed biofilms efficiently on glass surfaces,

averaging 8.2x1010 CFU after 4 days. When these two bacteria were grown in the dual-

species model, the level of S. mutans decreased by more than 8-fold (P<0.05), yielding

an average of 1.0x1010 CFU, while S. sanguinis accumulated to 5.1x1010 CFU. S. oralis

displayed a relatively poor capacity to form biofilms when grown alone, averaging

2.6x109 CFU after 4 days. When grown in dual-species with S. mutans, however, the

number of S. oralis in the biofilms increased to an average of 1.4x1010 CFU (P<0.01).

On the other hand, biofilm formation by S. mutans was decreased when grown together

with S. oralis, although the difference between mono-species and dual-species was not

statistically significant. L. casei alone formed biofilms poorly, accumulating only

2.9x107 CFU after 4 days. However, the capacity of L. casei to form biofilms was

enhanced significantly (P<0.001) when co-cultivated with S. mutans, resulting in an

increase of more than 60-fold to an average of 1.7x109 CFU after 4 days. Notably, when

S. mutans was cultivated in dual-species biofilms with L. casei, the organisms

accumulated in about 2-fold greater numbers than when S. mutans was grown alone,

averaging 1.8x1011 CFU.

Various bacterial cell-cell interactions may exist when growing in dual-species

biofilms, including competition for binding sites and nutrients available. In this study,

the same amount of inoculum was used in mono- and dual-species biofilms. For bacteria

that grow similarly well in mono-species model, slight decreases will be expected for

both constituents when grown in dual-species biofilms. The observed decreases in









population of both S. mutans and S. sanguinis when they were cultivated together (Figure

2), as compared to the respective mono-species biofilms, could be at least in part

attributed to competition for binding sites. Both S. sanguinis and S. oralis grew well in

BMGS broth, with a doubling time of 86.5 (2.7) and 80 (6.1) minutes, respectively,

whereas S. mutans took 134.7 (11.6) minutes to double its optical density. These results

suggest that S. sanguinis and S. oralis should possess advantages over S. mutans for

available nutrients when grown in a mixed-species consortium. Disadvantages in nutrient

competition could certainly affect the capacity of S. mutans to accumulate on the glass

surfaces, contributing to the observed decreases in biofilm formation when grown

together with S. sanguinis or S. oralis (Figure 2). S. sanguinis is also known to produce

hydrogen peroxide, which can inhibit the growth of S. mutans [4, 32], although such an

impact on S. mutans growth was shown to be limited when the organisms were

inoculated simultaneously [32], as they were in this study.

L. casei did not grow well in BMGS broth, yielding an average of 4.7x107 CFU ml-1

after 24 hours, as compared to 6.0xl08 CFU ml-1 for S. mutans. Poor growth could

certainly contribute to poor biofilm formation by this bacterium. As was observed with

dual-species biofilms, however, co-cultivation of L. casei and S. mutans planktonically in

BMGS broth also increased S. mutans CFU by more than 3-fold, with an average CFU of

2.3x109 ml-1, although the numbers of L. casei remained similar to those in mono-species

cultures (data not shown). The mixed-species broth cultures also had a slightly decreased

doubling time (121.48.8 minutes), as compared to S. mutans (134.711.8 minutes) and

L. casei (24024 minutes) in mono-species planktonic cultures. BHI, and especially

MRS, yielded much better growth of L. casei than BMGS, although no major differences









were observed in biofilm formation by L. casei when grown in BHI or MRS (data not

shown).

Oral lactobacilli, such as L. casei, are a group of acid tolerant bacteria that are

commonly isolated in relatively significant proportions from cariogenic dental plaque

[33-36]. However, the ability of lactobacilli to adhere to the tooth surface was known to

be poor [36]. Results presented here also suggest that L. casei alone does not form

biofilms on glass surfaces very effectively, but biofilm formation by this bacterium can

be dramatically improved when mixed with S. mutans. S. mutans produces at least three

Gtf enzymes [7] that produce high molecular weight glucans that promote bacterial

adhesion and biofilm accumulation. Recent studies have shown that these enzymes,

especially GtfB, are capable of directly binding to L. casei and other oral bacteria [37].

Adsorption of Gtfs to the surface of non-mutans streptococci can promote adhesion of the

bacteria via glucan-mediated pathways [37]. Thus, the Gtf enzymes of S. mutans and the

adhesive glucans likely contribute to the enhanced biofilm formation by L. casei, and

probably S. oralis, when grown in mixed-species biofilms with S. mutans. Notably,

enhanced biofilm formation by Lactobacillus plantarum and Lactobacillus rhamnosus

was noted in a mucin-based medium [38], so the presence of polysaccharides may have a

general ability to promote biofilm formation by lactobacilli. However, the actual

mechanism for the enhancement of L. casei levels in biofilms with S. mutans requires

further investigation.

While the close association of L. casei and S. mutans in carious sites is well

documented, little information is available concerning the interaction between these two

bacteria with respect to S. mutans biofilm formation and its cariogenicity. While co-









cultivation with S. mutans significantly enhanced biofilm formation by L. casei, the

sessile population of S. mutans was also found to be increased by more than 2-fold in

dual species model with L. casei (Figure 2), which is contrary to what was observed with

the other bacteria studied. While the exact nature and the underlying mechanism await

further investigation, the interaction observed between S. mutans and L. casei may partly

explain the prevalence and the close association of these two bacteria in cariogenic

plaque.



Expression of genes critical to cariogenicity of S. mutans can be altered when grown

in mixed-species biofilms. RealTime-PCR was used to analyze the expression of several

genes that have critical roles in bacterial adherence and biofilm accumulation by S.

mutans [7-10], including spaP, gtfB and gbpB. As shown in Figure 3, slight decreases

were observed in expression of spaP, gtfB and gbpB by S. mutans when grown in dual-

species with S. sanguinis as compared to those in mono-species biofilms, although the

differences were not statistically significant. When grown in dual-species with L. casei,

however, expression of spaP, gbpB and gtfB by S. mutans was decreased by as much as

40-fold, at a significance level of P<0.05 for spaP and P<0.001 for gtfB and gbpB,

respectively, as compared to cells in mono-species biofilms. The expression of spaP

(P<0.05) and gbpB (P<0.001), but not gtfB, was also lower by more than 30-fold in S.

mutans when grown with S. oralis. As compared to mono-species biofilms, expression of

luxS was decreased by more than 7-fold in cells grown with L. casei (P<0.001) and by

more than 15-fold in cells with S. oralis (P<0.001), but again no significant differences

were observed when S. mutans was grown with S. sanguinis. Expression of brpA was









decreased by more than 3-fold (P<0.05) in cells grown with S. oralis, but no major

differences were observed when grown with S. sanguinis and L. casei. As a control, the

expression of the Idh gene, a constitutively expressed gene (Wen and Burne, unpublished

data) [4], was also analyzed and no significant differences were observed between S.

mutans grown in single-species and those grown in dual-species (Figure 1).

Glucosyltransferases and glucan-binding proteins of S. mutans are known to be

differentially expressed in response to environmental conditions, such as carbohydrate

source and availability, pH and growth of the bacteria on surfaces [9, 39-41]. Results

presented here further demonstrate that the level of expression of these known virulence

attributes can be altered when S. mutans is grown in dual-species biofilms and that the

effect varies as a function of the species of bacteria in the biofilms. Among the three

different bacterial species analyzed, the most significant effect on the expression of the

selected genes was seen with L. casei, followed by S. oralis. No significant effect was

observed with S. sanguinis in expression of either spaP, gtfB or gbpB. As described

above, nutrient availability, especially when grown together with faster growing

microorganisms, such as S. oralis, could have an impact on gene expression in S. mutans,

and consequently affect biofilm formation [42].

L. casei, as a frequent isolate from the cariogenic plaque, is also known for its high

capacity for acid production from carbohydrates. When grown on BMGS in mono-

species cultures, S. mutans overnight (24-hour) cultures had an average pH of 5.75

(0.28). As expected, the pH was decreased slightly when grown in dual species with L.

casei, averaging 5.63(0.20). Similar results were also observed when S. mutans was

grown together with S. oralis, with an average pH measured at 5.69 (0.08). In contrast,









however, the pH of overnight cultures of S. mutans co-cultured with S. sanguinis was

5.95(+0.03). Environmental pH has been shown to influence the expression of some of

the genes selected [39]. Although not necessarily fully reflective of what occurs in

sessile populations, the decreases in culture pH suggest that S. mutans may endure a more

significant acid challenge when grown in dual-species with L. casei as well as S. oralis

and that such decreases could at least in part contribute to the down-regulation of the

selected genes in S. mutans grown in dual-species with L. casei and S. oralis.

Many bacteria produce autoinducer 2 through LuxS enzymes [43]. Recent studies of

the oral flora have yielded evidence that AI-2 mediated signaling in the flora may play an

important role in inter-species communication, affecting plaque formation and,

ultimately, development of oral diseases [6, 23, 44, 45]. Neither S. oralis nor A.

naeslundii alone were found to form good biofilms, but growth in the two-species model

resulted in abundant mutualistic growth [46]. AI-2 of S. oralis was recently found to be

critical for such a mutualistic interaction [6]. Below and above the optimal

concentration, mutualistic biofilm growth was suppressed. In S. mutans, LuxS was

shown to be involved in biofilm formation and to affect the structure of biofilms [18, 22,

23], although its role in regulation of factors critical to bacterial adherence and biofilm

formation is somewhat controversial. As shown previously, LuxS-deficiency

significantly decreased brpA expression, but no major differences were seen between

wild-type and the LuxS-deficient mutants in expression of gtfBC, gbpB or spaP [18].

Similar results were also obtained by DNA microarray analysis in both planktonic [47]

(Wen et al., unpublished data) and sessile populations (Wen et al., unpublished data). In

a study using RealTime-PCR, however, Yoshida et al. [23] reported that transcription of









gtfB and gtfC, but not gtfD, was up-regulated in response to LuxS-deficiency. Like S.

mutans and S. oralis, both S. sanguinis (www.oralgen.lanl.gov) and L. case (Wen and

Burne, unpublished data) possess LuxS. It remains unclear, however, whether LuxS in

these bacteria is in fact involved in cell-cell communication. Nevertheless, down

regulation of luxS expression in S. mutans when grown in dual-species with L. casei and

S. oralis would likely affect the absolute concentration of AI-2 in the biofilms. Studies

are ongoing to determine whether AI-2 signaling is functional between these bacterial

species and whether alterations in luxS expression does in fact affect the expression of

known virulence factors by S. mutans in mixed-species biofilms.

It is well established that GtfB and GbpB are critical components of the sucrose-

dependent pathway in S. mutans biofilm formation and cariogenicity. In the presence of

sucrose, GtfB synthesizes copious cl,3-linked, water insoluble glucan polymers. Then,

surface-associated glucan-binding protein GbpB and others bind to these polymers,

facilitating intercellular adherence and biofilm accumulation by S. mutans. It would be

expected that down-regulation of GtfB and GbpB would result in less biofilm formation.

Surprisingly, our S. mutans-L. casei dual-species data showed that S. mutans accumulated

more than 2-fold more biofilms while the expression of gtfB and gbpB was decreased.

One possible explanation is that down regulation of GtfB and GbpB (and probably some

other members of the Gtfs and Gbps) when grown together with L. casei altered the

balance of glucans to glucan-binding proteins ratio or altered the glucan structure in a

way that altered biofilm architecture. In fact, similar observations have also been

reported recently by us and some other groups [11, 12, 48]. In particular, deficiency of

trigger factor (RopA) in S. mutans reduced production of GtfB and -D as revealed by









Western blotting, but the ropA-mutant formed more than 50% more biofilms than the

parental strain when sucrose was provided as the supplemental carbohydrate source [48].

During characterization of GbpA of S. mutans, the Banas group showed that strains

deficient in GbpA were more adherent in vitro and more cariogenic in vivo than the

parental strain [11, 12]. As compared to the biofilms by the parent strain, which were

composed of big cellular clusters with large gaps in between, the biofilms formed by the

gbpA- mutant were relatively small, but more compact and more evenly distributed.

Interestingly, GbpA-deficiency was later found to increase the frequency of

recombination between the tandemly arranged, highly homologous gtfB and gtfC genes,

resulting in a dramatic decrease in production of water-insoluble glucans. Additional

experiments that probe the basis for altered gtfand gbp expression, coupled with

measurements of Gtf and Gbp protein and activity and glucan structure will be needed to

shed light on the basis for the observations.



Conclusions

In vitro dual-species biofilm model and RealTime-PCR analysis showed that biofilm

formation and virulence expression by S. mutans could be altered in response to the

presence of other oral bacterial species. Effort is currently directed to further

investigation of the underlying mechanism of the altered expression of selected genes and

the impact of such alterations on biofilm formation by S. mutans. Considering the

frequent association of L. casei and S. mutans in carious sites and their role in caries

development, information yielded from these studies could be used to formulate novel

strategies against human dental caries.











List of abbreviations

AI-2, autoinducer 2; GtfB, -C & -D, glucosyltransferase B, C & D; GbpA, -B, -C, & -

D, glucan-binding protein A, B, C & D; CFU, colony-forming-unities; BHI, brain heart

infusion; MRS, lactobacilli MRS medium; SpaP, adhesin Pl; BrpA, biofilm regulatory

protein A; Idh, lactate dehydrogenase gene; BM, biofilm medium; BMG, BM plus

glucose; BMS, BM plus sucrose; BMGS, BM plus glucose and sucrose.



Authors' contributions

ZTW conceived the study, designed and implemented most of the experiments, and

drafted the manuscript; DY carried out most of the biofilm assays and RealTime-PCR

analysis; SJA was involved in parts of experimental design and data analysis; RAB

participated the experimental design and data analysis and revised critically the

manuscript. All authors have read and approved the manuscript.


Acknowledgements

This work is supported by NIDCR grants DE13239 and 12236 to R.A.B. and DE15501

and DE019452 to Z.T.W. We thank Mr. Christopher Browngardt for his kind help with

statistical analysis.









References


1. Jenkinson HF, Lamont RJ: Oral microbial communities in sickness and in
health. Trends Microbiol 2005, 13(12):589-595.
2. Kolenbrander PE, Andersen RN, Blehert DS, Egland PG, Foster JS, Palmer RJ,
Jr.: Communication among oral bacteria. Microbiol Mol Biol Rev 2002,
66(3):486-505, table of contents.
3. Kuramitsu HK, He X, Lux R, Anderson MH, Shi W: Interspecies interactions
within oral microbial communities. Microbiol Mol Biol Rev 2007, 71(4):653-
670.
4. Kreth J, Zhang Y, Herzberg MC: Streptococcal antagonism in oral biofilms:
Streptococcus sanguinis and Streptococcus gordonii interference with
Streptococcus mutans. J Bacteriol 2008, 190(13):4632-4640.
5. Rosan B, Lamont RJ: Dental plaque formation. Microbes Infect 2000,
2(13):1599-1607.
6. Rickard AH, Palmer RJ, Jr., Blehert DS, Campagna SR, Semmelhack MF, Egland
PG, Bassler BL, Kolenbrander PE: Autoinducer 2: a concentration-dependent
signal for mutualistic bacterial biofilm growth. Mol Microbiol 2006,
60(6):1446-1456.
7. Burne RA: Oral streptococci...products of their environment. J Dent Res 1998,
77(3):445-452.
8. Bowen WH, Schilling K, Giertsen E, Pearson S, Lee SF, Bleiweis A, Beeman D:
Role of a cell surface-associated protein in adherence and dental caries. Infect
Immun 1991, 59(12):4604-4609.
9. Banas JA, Vickerman MM: Glucan-binding proteins of the oral streptococci.
Crit Rev Oral Biol Med 2003, 14(2):89-99.
10. Banas JA: Virulence properties of Streptococcus mutans. Front Biosci 2004,
9:1267-1277.
11. Hazlett KR, Mazurkiewicz JE, Banas JA: Inactivation of the gbpA gene of
Streptococcus mutans alters structural and functional aspects of plaque
biofilm which are compensated by recombination of the gtfB and gtfC genes.
Infect Immun 1999, 67(8):3909-3914.
12. Hazlett KR, Michalek SM, Banas JA: Inactivation of the gbpA gene of
Streptococcus mutans increases virulence and promotes in vivo accumulation
of recombinations between the glucosyltransferase B and C genes. Infect
Immun 1998, 66(5):2180-2185.
13. Ooshima T, Matsumura M, Hoshino T, Kawabata S, Sobue S, Fujiwara T:
Contributions of three glycosyltransferases to sucrose-dependent adherence
of Streptococcus mutans. J Dent Res 2001, 80(7):1672-1677.
14. Tsumori H, Kuramitsu H: The role of the Streptococcus mutans
glucosyltransferases in the sucrose-dependent attachment to smooth
surfaces: essential role of the GtfC enzyme. Oral Microbiol Immunol 1997,
12(5):274-280.
15. Li YH, Hanna MN, Svensater G, Ellen RP, Cvitkovitch DG: Cell density
modulates acid adaptation in Streptococcus mutans: implications for survival
in biofilms. J Bacteriol 2001, 183(23):6875-6884.









16. Li YH, Lau PC, Tang N, Svensater G, Ellen RP, Cvitkovitch DG: Novel Two-
Component Regulatory System Involved in Biofilm Formation and Acid
Resistance in Streptococcus mutans. J Bacteriol 2002, 184(22):6333-6342.
17. Li YH, Tang N, Aspiras MB, Lau PC, Lee JH, Ellen RP, Cvitkovitch DG: A
quorum-sensing signaling system essential for genetic competence in
Streptococcus mutans is involved in biofilm formation. J Bacteriol 2002,
184(10):2699-2708.
18. Wen ZT, Burne RA: LuxS-mediated signaling in Streptococcus mutans is
involved in regulation of acid and oxidative stress tolerance and biofilm
formation. J Bacteriol 2004, 186(9):2682-2691.
19. Qi F, Merritt J, Lux R, Shi W: Inactivation of the ciaH Gene in Streptococcus
mutans diminishes mutacin production and competence development, alters
sucrose-dependent biofilm formation, and reduces stress tolerance. Infect
Immun 2004, 72(8):4895-4899.
20. Ahn SJ, Wen ZT, Burne RA: Multilevel control of competence development
and stress tolerance in Streptococcus mutans UA159. Infect Immun 2006,
74(3):1631-1642.
21. Suntharalingam P, Senadheera MD, Mair RW, Levesque CM, Cvitkovitch DG:
The LiaFSR system regulates the cell envelope stress response in
Streptococcus mutans. J Bacteriol 2009, 191(9):2973-2984.
22. Merritt J, Qi F, Goodman SD, Anderson MH, Shi W: Mutation of luxS Affects
Biofilm Formation in Streptococcus mutans. Infect Immun 2003, 71(4): 1972-
1979.
23. Yoshida A, Ansai T, Takehara T, Kuramitsu HK: LuxS-based signaling affects
Streptococcus mutans biofilm formation. Appl Environ Microbiol 2005,
71(5):2372-2380.
24. Bassler BL: Small talk. Cell-to-cell communication in bacteria. Cell 2002,
109(4):421-424.
25. Wen ZT, Burne RA: Functional genomics approach to identifying genes
required for biofilm development by Streptococcus mutans. Appl Environ
Microbiol 2002, 68(3): 1196-1203.
26. Wen ZT, Baker HV, Burne RA: Influence of BrpA on critical virulence
attributes of Streptococcus mutans. J Bacteriol 2006, 188(8):2983-2992.
27. Loo CY, Corliss DA, Ganeshkumar N: Streptococcus gordonii biofilm
formation: identification of genes that code for biofilm phenotypes. J
Bacteriol 2000, 182(5): 1374-1382.
28. Zeng L, Wen ZT, Bume RA: A novel signal transduction system and feedback
loop regulate fructan hydrolase gene expression in Streptococcus mutans. Mol
Microbiol 2006, 62(1): 187-200.
29. Phan TN, Reidmiller JS, Marquis RE: Sensitization of Actinomyces naeslundii
and Streptococcus sanguis in biofilms and suspensions to acid damage by
fluoride and other weak acids. Arch Microbiol 2000, 174(4):248-255.
30. Wen ZT, Browngardt C, Bume RA: Characterization of two operons that
encode components of fructose- specific enzyme II of the
sugar:phosphotransferase system of Streptococcus mutans. FEMS Microbiol
Lett 2001, 205(2):337-342.









31. Merritt J, Kreth J, Qi F, Sullivan R, Shi W: Non-disruptive, real-time analyses
of the metabolic status and viability of Streptococcus mutans cells in response
to antimicrobial treatments. J Microbiol Methods 2005, 61(2):161-170.
32. Kreth J, Merritt J, Shi W, Qi F: Competition and coexistence between
Streptococcus mutans and Streptococcus sanguinis in the dental biofilm. J
Bacteriol 2005, 187(21):7193-7203.
33. Shu M, Browngardt CM, Chen YY, Bume RA: Role of urease enzymes in
stability of a 10-species oral biofilm consortium cultivated in a constant-
depth film fermenter. Infect Immun 2003, 71(12):7188-7192.
34. Sheng J, Marquis RE: Enhanced acid resistance of oral streptococci at lethal
pH values associated with acid-tolerant catabolism and with ATP synthase
activity. FEMS Microbiol Lett 2006, 262(1):93-98.
35. Keltjens HM, Schaeken MJ, van der Hoeven JS, Hendriks JC: Microflora of
plaque from sound and carious root surfaces. Caries Res 1987, 21(3): 193-199.
36. Van Houte J, Sansome C, Joshipura K, Kent R: Mutans streptococci and non-
mutans streptococci acidogenic at low pH, and in vitro acidogenic potential of
dental plaque in two different areas of human dentition. J Dent res 1991,
70:1503-1507.
37. Vacca-Smith AM, Bowen WH: Binding properties of streptococcal
glucosyltransferases for hydroxyapatite, saliva-coated hydroxyapatite, and
bacterial surfaces. Arch Oral Biol 1998, 43(2):103-110.
38. Filoche SK, Anderson SA, Sissons CH: Biofilm growth of Lactobacillus species
is promoted by Actinomyces species and Streptococcus mutans. Oral Microbiol
Immunol 2004, 19(5):322-326.
39. Li Y, Burne RA: Regulation of the gtfBC andftf genes of Streptococcus
mutans in biofilms in response to pH and carbohydrate. Microbiol 2001,
147(Pt 10):2841-2848.
40. Hudson MC, Curtiss R, 3rd: Regulation of expression of Streptococcus mutans
genes important to virulence. Infect Immun 1990, 58(2):464-470.
41. Wexler DL, Hudson MC, Burne RA: Streptococcus mutans fructosyltransferase
(ftjf) and glucosyltransferase (gtfBC) operon fusion strains in continuous
culture. Infect Immun 1993, 61(4):1259-1267.
42. Nascimento MM, Lemos JA, Abranches J, Lin VK, Bume RA: Role of RelA of
Streptococcus mutans in global control of gene expression. J Bacteriol 2008,
190(1):28-36.
43. Bassler BL, Losick R: Bacterially speaking. Cell 2006, 125(2):237-246.
44. McNab R, Ford SK, El-Sabaeny A, Barbieri B, Cook GS, Lamont RJ: LuxS-
based signaling in Streptococcus gordonii: autoinducer 2 controls
carbohydrate metabolism and biofilm formation with Porphyromonas
gingivalis. J Bacteriol 2003, 185(1):274-284.
45. Lonn-Stensrud J, Petersen FC, Benneche T, Scheie AA: Synthetic bromated
furanone inhibits autoinducer-2-mediated communication and biofilm
formation in oral streptococci. Oral Microbiol Immunol 2007, 22(5):340-346.
46. Palmer RJ, Jr., Kazmerzak K, Hansen MC, Kolenbrander PE: Mutualism versus
independence: strategies of mixed-species oral biofilms in vitro using saliva
as the sole nutrient source. Infect Immun 2001, 69(9):5794-5804.









47. Sztajer H, Lemme A, Vilchez R, Schulz S, Geffers R, Yip CY, Levesque CM,
Cvitkovitch DG, Wagner-Dobler I: Autoinducer-2-regulated genes in
Streptococcus mutans UA159 and global metabolic effect of the luxS
mutation. J Bacteriol 2008, 190(1):401-415.
48. Wen TZ, Suntharaligham P, Cvitkovitch DG, Bume RA: Trigger factor in
Streptococcus mutans is involved in stress tolerance, competence
development, and biofilm formation. Infect Immun 2005, 73(1):219-225.









Table 1. Primers used for RealTime-PCR


Primer DNA sequence (5' 3') Application Amplicon


spaP-Fw TCCGCTTATACAGGTCAAGTTG


GAGAAGCTACTGATAGAAGGGC

AGCAATGCAGCCATCTACAAAT

ACGAACTTTGCCGTTATTGTCA

CGTGTTTCGGCTATTCGTGAAG

TGCTGCTTGATTTTCTTGTTGC

ACTGTTCCCCTTTTGGCTGTC

AACTTGCTTTGATGACTGTGGC

CGTGAGGTCATCAGCAAGGTC

CGCTGTACCCCAAAAGTTTAGG

TTGGCGACGCTCTTGATCTTAG

GTCAGCATCCGCACAGTCTTC


spaP fragment


gtfB fragment



gbpB fragment



luxS fragment



brpA fragment



Idh fragment


spaP-Rv

gtfB- Fw

gtfB- Rv

gbpB- Fw

gbpB- Rv

luxS- Fw

luxS- Rv

brpA- Fw

brpA- Rv

ldh-Fw

ldh-Rv


121 bp


98 bp



108 bp



93 bp



148 bp



92 bp









Figure legends


Figure 1. RealTime-PCR analysis of Idh gene as an internal control.

Data presented here were generated from at least four separate sets of biofilm cultures

and RealTime-PCR was carried out in triplicate and was repeated at least once. These

data were normalized and further analyzed using a non-parametric Kruskal-Wallis Test

and student t-test. The bar graphs represent the average standardd deviation in error

bars) of normalized copy numbers x (pg S. mutans total RNA)-1. No significant

differences were observed between S. mutans grown in mono-species and those grown in

dual-species biofilms. Abbreviations: Sm, S. mutans; Ss, S. sanguinis; So, S. oralis; Lc,

L. case, with Sm-Ss, Sm-So and Sm-Lc indicating dual-species biofilm of the selected

bacteria.



Figure 2. Biofilm formation in mono- and dual-species model.

Data presented here were generated from more than ten independent sets of experiments

and were further analyzed using a non-parametric Kruskal-Wallis Test and student t-test.

This graph shows the average standardd deviation, in error bars) of CFU in biofilms

formed by S. mutans and the other oral bacteria tested when grown in the mono- and

dual-species models with S. mutans. A *, # and @ indicate significant difference at

P<0.05, 0.01 and 0.001, respectively, when compared to those grown in mono-species

biofilms. All abbreviations are the same as in Figure 1.



Figure 3. RealTime-PCR analysis of selected genes.









RealTime-PCR for specific genes was carried out in triplicate and repeated at least once.

Data presented here were generated from at least four independent sets of experiments.

These data were normalized and further analyzed using a non-parametric Kruskal-Wallis

Test and student t-test. The bar graphs represent the average (+standard deviation in error

bars) of copy numbers x (pg S. mutans total RNA) -1, with *, # and @ illustrating

statistical differences at P<0.05, 0.01, and 0.001, respectively, when compared to the

respective genes in mono-species biofilms.





oz

orr

0 CZ)



E

o --
(D


S. mutans grown in mono- and dual-
species with So, Ss and Lc


1.OOE+07

1.OOE+06

1.OOE+05

1.OOE+04

1.OOE+03

1.OOE+02

1.OOE+01

1.OOE+00


1:1Sm IDSm-Ss
0 sm-so E2Sm-Lc


Figure 1






1.00E+12


1.00E+11


1.00E+10


1.00E+09


1.00E+08


1.00E+07


1.00E+06


1.00E+05


1.00E+04


1.00E+03


1.00E+02


1.00E+01


Figure 2


Sm Ss






A1:


Sm, Ss, So and Lc

in mono-species

model


Ss #

"6So


Ss, So and Lc in

dual-species

model


Ft Ss*


...... ......
...... ......
....... ......
....... ......
..............
..............
..............
..............
..............
..............
..............
..............
..............
..............
..............
..............
..............
..............
..............
..............
..............
..............
..............
..............
..............
..............
..............
..............
..............
..............
..............
..............
..............
..............
..............
..............
..............
..............
..............
..............
..............
..............
..............
..............
..............
..............


Sm in mono- and

dual-species with Ss,

So and Lc


"""""""- _


. . . .








U)

(DE




o ~

.- x


1.OOE+08

1.OOE+07

1.OOE+06

1.OOE+05

1.OOE+04

1.OOE+03

1.OOE+02

1.OOE+01

1.OOE+00


gbpB


Figure 3 spaP


SS. mutans/S. sanguinis


gtfB


brpA


luxS




University of Florida Home Page
© 2004 - 2010 University of Florida George A. Smathers Libraries.
All rights reserved.

Acceptable Use, Copyright, and Disclaimer Statement
Last updated October 10, 2010 - - mvs