• TABLE OF CONTENTS
HIDE
 Statement on editorship of Florida...
 New synonyms and redescriptions...
 Distribution and habitat preference...
 Intrapopulation variation in an...
 Two new species of the genus Longipenis...
 Ischnorhynchinae from Costa Rica...
 Bemisia tabaci biotype Q dominates...
 Molecular phylogeny of Bactrocera...
 Impacts of an orange oil solvent...
 The detection of Bacillus thuringiensis...
 Oriental bamboo planthoppers: two...
 Life cycle of Scyphophorus...
 Two new species of Anteon (Hymenoptera:...
 Effect of straw mulch on populations...
 Size-specific provisioning by cicada...
 Yeast extract: sucrose ratio effects...
 Mating arena dynamics for Ostrinia...
 Genetic characteristics of bisexual...
 Range expansion and adult flight...
 New record of Red Palm Weevil,...
 Fire ants (Hymenoptera: Formicidae)...
 Suitability of 'Cleopatra' mandarin...
 Herbivorous insect fauna of kudzu,...
 A case history of concurrent Rocky...
 First report of Idiopterus nephrelepidis...
 Real-time PCR reveals endosymbiont...
 Inhibition of the fungal pathogen...
 New Records for Mexico: Gynaikothrips...
 Correction to new state record...
 Dale H. Habeck, 1931-2010
 Member list
 Instructions to authors














Group Title: Florida Entomologist
Title: The Florida entomologist
ALL VOLUMES CITATION
Full Citation
STANDARD VIEW MARC VIEW
Permanent Link: http://ufdc.ufl.edu/UF00098813/00365
 Material Information
Title: The Florida entomologist
Uniform Title: Florida entomologist (Online)
Abbreviated Title: Fla. entomol. (Online)
Physical Description: Serial
Language: English
Creator: Florida Entomological Society
Florida Center for Library Automation
Publisher: Florida Entomological Society
Place of Publication: Gainesville Fla
Gainesville, Fla
Publication Date: September 2010
Frequency: quarterly
regular
 Subjects
Subjects / Keywords: Entomology -- Periodicals   ( lcsh )
Insects -- Periodicals -- Florida   ( lcsh )
Genre: review   ( marcgt )
periodical   ( marcgt )
 Notes
Additional Physical Form: Also issued in print.
System Details: Mode of access: World Wide Web.
Language: In English; summaries in Spanish.
Dates or Sequential Designation: Vol. 4, no. 1 (July 1920)-
Issuing Body: Official organ of the Florida Entomological Society; online publication a joint project of the Florida Entomological Society and the Florida Center for Library Automation.
General Note: Title from caption (JSTOR, viewed Sept. 13, 2006).
General Note: Place of publication varies.
General Note: Latest issue consulted: Vol. 87, no. 4 (Dec. 2004) (JSTOR, viewed Sept. 13, 2006).
 Record Information
Bibliographic ID: UF00098813
Volume ID: VID00365
Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
Resource Identifier: isbn - 0015-4040
issn - 1938-5102
oclc - 33223434
lccn - sn 95026670
 Related Items
Preceded by: Florida buggist (Online)

Table of Contents
    Statement on editorship of Florida entomologist
        Page 331
        Page 332
    New synonyms and redescriptions of three species of the mycophagous genus Gyrophaena (Coleoptera: Staphylinidae: Aleocharinae) in East Asia
        Page 333
        Page 334
        Page 335
        Page 336
        Page 337
        Page 338
    Distribution and habitat preference of Carabidae and Staphylinidae (Coleoptera) in an orange orchard and a forest fragment
        Page 339
        Page 340
        Page 341
        Page 342
        Page 343
        Page 344
        Page 345
    Intrapopulation variation in an Australian population of the North American thrips, Bagnalliella yuccae (Thysanoptera: Phlaeothripidae), a new record from Australia
        Page 346
        Page 347
        Page 348
        Page 349
        Page 350
        Page 351
    Two new species of the genus Longipenis (Lepidoptera: Lecithoceridae) from China
        Page 352
        Page 353
        Page 354
        Page 355
        Page 356
    Ischnorhynchinae from Costa Rica (Hemiptera-Heteroptera: Lygaeoidea: Lygaeidae) with description of one new species of Kleidocerys
        Page 357
        Page 358
        Page 359
        Page 360
        Page 361
        Page 362
    Bemisia tabaci biotype Q dominates other biotypes across China
        Page 363
        Page 364
        Page 365
        Page 366
        Page 367
        Page 368
    Molecular phylogeny of Bactrocera species (Diptera: tephritidae: dacini) inferred from mitochondrial sequences of 16S rDNA and COI sequences
        Page 369
        Page 370
        Page 371
        Page 372
        Page 373
        Page 374
        Page 375
        Page 376
        Page 377
    Impacts of an orange oil solvent and Stickem on the detection of Xylella fastidiosa DNA in glassy-winged sharpshooters, Homalodisca vitripennis (Hemiptera: Cicadellidae)
        Page 378
        Page 379
        Page 380
        Page 381
        Page 382
        Page 383
        Page 384
    The detection of Bacillus thuringiensis in mass rearing of Cactoblastis cactorum (Lepidoptera: Pyralidae)
        Page 385
        Page 386
        Page 387
        Page 388
        Page 389
        Page 390
    Oriental bamboo planthoppers: two new species of the genus Bambusiphaga (Hemiptera: Fulgoroidea: Delphacidae) from Hainan Island, China
        Page 391
        Page 392
        Page 393
        Page 394
        Page 395
        Page 396
        Page 397
    Life cycle of Scyphophorus acupunctatus
        Page 398
        Page 399
        Page 400
        Page 401
        Page 402
    Two new species of Anteon (Hymenoptera: Dryinidae) from China
        Page 403
        Page 404
        Page 405
        Page 406
    Effect of straw mulch on populations of Microtheca ochroloma (Coleoptera: Chrysomelidae) and ground predators in turnip Brassica rapa in Florida
        Page 407
        Page 408
        Page 409
        Page 410
        Page 411
    Size-specific provisioning by cicada killers, Sphecius speciosus, (Hymenoptera: Crabronidae) in north Florida
        Page 412
        Page 413
        Page 414
        Page 415
        Page 416
        Page 417
        Page 418
        Page 419
        Page 420
        Page 421
    Yeast extract: sucrose ratio effects on egg load, survival, and mortality caused by GF-120 in western cherry fruit fly (Diptera: Tephritidae)
        Page 422
        Page 423
        Page 424
        Page 425
        Page 426
        Page 427
        Page 428
        Page 429
        Page 430
        Page 431
    Mating arena dynamics for Ostrinia nubilalis (Lepidoptera: Crambidae)
        Page 432
        Page 433
        Page 434
        Page 435
        Page 436
    Genetic characteristics of bisexual and female-only populations of Odontosema Anastrephae (Hymenoptera: Figitidae)
        Page 437
        Page 438
        Page 439
        Page 440
        Page 441
        Page 442
        Page 443
    Range expansion and adult flight activity of Agrilus subrobustus (Coleoptera: buprestidae) in Tennessee
        Page 444
        Page 445
    New record of Red Palm Weevil, Rhynchophorus ferrugineus (Coleoptera: Curculionidae) on Arecanut (Areca catechu) from Meghalaya, India
        Page 446
        Page 447
        Page 448
    Fire ants (Hymenoptera: Formicidae) along an important sea turtle nesting beach on St. Croix, USVI
        Page 449
        Page 450
    Suitability of 'Cleopatra' mandarin as a host plant for Diaphorina citri (Hemiptera: Psyllidae)
        Page 451
        Page 452
        Page 453
    Herbivorous insect fauna of kudzu, Pueraria montana (Leguminosae), in Japan
        Page 454
        Page 455
        Page 456
    A case history of concurrent Rocky Mountain spotted fever and human monocytic ehrlichiosis in Florida
        Page 457
        Page 458
        Page 459
    First report of Idiopterus nephrelepidis (Hemiptera: Aphididae) in Central America
        Page 460
        Page 461
        Page 462
        Page 463
    Real-time PCR reveals endosymbiont titer fluctuations in Metaseiulus occidentalis (Acari: Phytoseiidae) colonies held at different temperatures
        Page 464
        Page 465
        Page 466
    Inhibition of the fungal pathogen Metarhizium anisopliae in the alimentary tracts of five termite (Isoptera) species
        Page 467
        Page 468
        Page 469
        Page 469a
        Page 469b
        Page 469c
        Page 469d
        Page 469e
        Page 469f
    New Records for Mexico: Gynaikothrips uzeli, Androthrips ramachandrai (Thysanoptera: Phlaeothripidae) and Montandoniola confusa (Hemiptera: Anthocoridae)
        Page 470
        Page 471
        Page 472
    Correction to new state record and northeastern range extension for Caenocholax fenyesi sensu lato (Strepsiptera: Myrmecolacidae)
        Page 473
        Page 474
        Page 475
        Page 476
        Page 477
    Dale H. Habeck, 1931-2010
        Page 478
        Page 479
    Member list
        Page 480
    Instructions to authors
        Page 481
        Page 482
Full Text







STATEMENT ON EDITORSHIP OF FLORIDA ENTOMOLOGIST


Effective on January 1, 2011, Dr. Waldemar
Klassen will take editorship of Florida Entomol-
ogist. Dr. Klassen has had a distinguished ca-
reer as an entomologist with the USDA. After
retiring from Federal service, he served for four
years with the Joint FAO/IAEA Division of Nu-
clear Techniques in Food and Agriculture, and
then as Director of the University of Florida
Tropical Research and Education Center
(TREC) in Homestead, FL. Dr. Klassen is now
retired in Homestead, FL, but maintains an of-
fice at the TREC where he can receive E-mail


and postal service mail. His E-mail address is
WKlassen@ufl.edu and his mailing address is
University of Florida, TREC, 18905 SW 280th
Street, Homestead, FL 33031-3314. Authors
should send new manuscripts to Dr. Klassen be-
ginning in December 2010. Until then, manu-
scripts should continue to come to James L. Na-
tion, Editor, Florida Entomologist, University of
Florida, Gainesville, FL 32611. The E-mail ad-
dress is JLN@ufl.edu. More details on the
change in editorship will be printed in the De-
cember issue of Florida Entomologist.











NEW SYNONYMS AND REDESCRIPTIONS OF THREE SPECIES OF THE
MYCOPHAGOUS GENUS GYROPHAENA (COLEEOPTERA:
STAPHYLINIDAE: ALEOCHARINAE) IN EAST ASIA

YooN-Ho KIM AND KEE-JEONG AHN
Depaliment of Biology, Chungnam National University, Daejeon 305-764, Republic of Korea

ABSTRACT

Three new synonyms are proposed for the Gyrophaena Mannerheim species from East Asia: G.
cariniventris Cameron, 1933 = G. tricuspidata Assing, 2005; G. triquetra Weise, 1877 = G. su-
nanica Pasniik, 2001; and G. yotsudeba Cameron, 1933 = G. defecta Cameron, 1933. Redescrip-
tions, habitus photos, and line drawings of diagnostic characters are provided. Gyrophaena
cariniventris and G. yotsudeba are reported for the first time in the Korean peninsula.

Key Words: Gyrophaena cariniventris, Gyrophaena triquetra, Gyrophaena yotsudeba, new
synonym, Korea

RESUME

Se proponen tres nuevas sinonimias para las species de Gyrophaena Mannerheim de Asia
Este: G. cariniventris Cameron, 1933 = G. tricuspidata Assing, 2005; G. triquetra Weise, 1877
= G. sunanica Pasriik, 2001; y G. yotsudeba Cameron, 1933 = G. defecta Cameron, 1933. Se
proven redescripciones, fotos del habitus, y dibujos de las caracteristicas diagn6sticas. Se re-
portan Gyrophaena cariniventris y G. yotsudeba por primera vez para la peninsula de Corea.


Kim & Ahn: Three New Synonyms in Gyrophaena


In an ongoing taxonomic study of the East
Asian Gyrophaenina, we have borrowed many ho-
lotypes and syntypes from several European Nat-
ural History Museum. After detailed morphologi-
cal comparative study, we propose 3 new syn-
onyms in the genus Gyrophaena Mannerheim (G.
cariniventris Cameron = G. tricuspidata Assing;
G. triquetra Weise = G. sunanica Pas'nik; and G.
yotsudeba Cameron = G. defecta Cameron), none
of which has been described in detail and illustra-
tions were not provided. We have studied 7 speci-
mens of G. cariniventris, 136 specimens of G. tri-
quetra, and 188 specimens of G. yotsudeba includ-
ing 1 holotype and 7 syntypes.
In this paper, we redescribe these 3 species
with habitus and line illustrations of the diagnos-
tic characters, and report Gyrophaena cariniven-
tris and G. yotsudeba for the first time in the Ko-
rean peninsula. The Korean specimens studied
are deposited in the Chungnam National Univer-
sity Insect Collection (CNUIC, Daejeon), Korea.

Gyrophaena cariniventris Cameron
(Figs. 1 and 4-12)

Gyrophaena cariniventris Cameron, 1933: 173; Smet-
ana, 2004: 443.

Gyrophaena tricuspidata Assing, 2005: 26. New syn-
onym.

Description. Body length 2.8-3.6 mm, light
brown to brown; head dark brown, antenna yellow,


legs yellow, abdominal tergites VI-VIII dark
brown. Body shape narrow and elongate in dorsal
aspect, widest at posterior margin of elytra, sur-
face subglossy and slightly pubescent (Fig. 1).
Head 1.3 times wider than long, widest across eye,
several punctures present. Antennomere 4 about
1.4 times longer than wide, 5 about 1.7 times
longer than wide, 6-7 about 1.4 times longer than
wide, 8 about 1.3 times longer than wide, 9 about
1.1 times longer than wide, 10 about as long as
wide, 11 about 2.1 times longer than wide (Fig. 4).
Pronotum 1.4 times wider than long, widest at
middle, anterior margin straight, posterior margin
broadly round (Fig. 5). Elytra 1.6 times longer than


Figs. 1-3. Habitus. 1, Gyrophaena cariniventris,
male, 3.2 mm; 2, Gyrophaena triquetra, male, 1.5 mm; 3,
Gyrophaena yotsudeba, male, 2.5 mm.


1 liI







Florida Entomologist 93(3)


September 2010


r4


Figs. 4-12. Gyrophaena cariniventris. 4, antenna, dorsal aspect; 5, pronotum, dorsal aspect; 6, male tergite VII,
dorsal aspect; 7, male tergite VIII, dorsal aspect; 8, male sternite VIII, ventral aspect; 9, female sternite VIII, ven-
tral aspect; 10, paramere, lateral aspect; 11, median lobe, lateral aspect; 12, spermatheca, lateral aspect. Scales =
0.1 mm.







Kim & Ahn: Three New Synonyms in Gyrophaena


wide, postero-lateral angles ofelytra sinuate. Terg-
ites II-VI transversely impressed. Male tergite VII
with one distinct tubercle (Fig. 6). Male tergite VIII
with three processes, outer two processes longer
than inner process and sharp at apex, inner pro-
cess narrow and bifid at apex (Fig. 7). Male stern-
ite VIII postero-medially truncate (Fig. 8), female
sternite VIII more or less round (Fig. 9). Median
lobe cylindrical and asymmetrical, apical process
of median lobe slightly curved (Fig. 11). Flagellum
moderate and not coiled. Apical lobe of paramere
as in Fig. 10. Spermatheca as in Fig. 12.
Materials Examined. Syntype (1 male, NHM)
labeled as follows: Japan Chuzenji, AT FT J.E.A.
Lewis, M. Cameron. Bequest. B.M. 1955-147, Gy-
rophaena cariniventris Cam.; Korea: Gangwon
Province, Jeongseon-gun, Gohan-eup, Mt. Ham-
backsan, 13 VII 1999, HJ Kim, ex- mushroom (1
male, CNUIC); Pyeongchang-gun, Jinbu-myeon,
Mt. Odaesan, Sangwonsa, 22 VI 16 VIII 2001, SJ
Park, CW Shin, FIT (3 males, CNUIC); Taeback-
city, Mt. Taebacksan, Backtansa Area, 14 VI
1999, US Hwang, HJ Kim, ex mushroom (2 fe-
males, CNUIC).
Distribution. Korea, China, and Japan.
Remarks. Assing (2005) described G. tricuspi-
data from China but diagnostic characteristics
(structure of antenna, male tergite VII and VIII,
sternite VIII, median lobe, and spermatheca) of
this species were not sufficient to maintain the
separation of G. tricuspidata and G. cariniventris.
Therefore, we synonymized G. tricuspidata under
G. cariniventris.
Gyrophaena cariniventris is similar to G. lae-
vior Cameron but can be distinguished by slender
body, antennomeres 6-9 elongate (antennomeres
6-9 subquadrate in G. laevior) (Fig. 4), male terg-
ite VII with 1 tubercle (male tergite VII without
tubercle in G. laevior) (Fig. 6), male tergite VIII
with 3 processes inner process narrow and bifid at
apex (male tergite VIII with 3 processes inner
process broad in G. laevior) (Fig. 7), and the struc-
ture of median lobe (Fig. 11).

Gyrophaena triquetra Weise
(Figs. 2 and 13-21)

Gyrophaena triquetra Weise, 1877: 91; Smetana, 2004:
446.
Gyrophaena sunanica Pasilik, 2001: 191; Smetana,
2004: 446. New synonym.
Description. Body length about 1.4-1.8 mm,
light brown to brown; head dark brown, legs yel-
low, abdominal tergites III-VI dark brown. Body
shape moderate and elongate in dorsal aspect, wid-
est at posterior margin of elytra, surface subglossy
and slightly pubescent (Fig. 2). Head 1.3 times
wider than long, widest across eye, several punc-
tures present. Antennomere 4 about 1.1 times
longer than wide, 5-8 as long as wide, 9-10 about


1.1 times wider than long, 11 about 1.7 times
longer than wide (Fig. 13). Pronotum 1.4 times
wider than long, widest at middle, anterior margin
straight, posterior margin broadly round (Fig. 14).
Elytra 1.5 times longer than wide, postero-lateral
angles of elytra slightly sinuate. Tergites III-VI
transversely impressed. Male tergite VII with 2 tu-
bercles at postero-middle margin (Fig. 15). Male
tergite VIII with 2 processes, protruded at middle
(Fig. 16). Male sternite VIII postero-medially more
or less round (Fig. 17), female sternite VIII more or
less round (Fig. 18). Median lobe cylindrical and
asymmetrical, apical processes of median lobe tri-
fid, slightly curved (Fig. 20). Flagellum moderate
and not coiled. Apical lobe of paramere as in Fig.
19. Spermatheca as in Fig. 21.
Materials Examined. Syntype (3 specimens,
MNHUB) labeled as follows: Japan, S. Hiller, Gy-
rophaena triquetra W., Syntypus Gyrophaena tri-
quetra Weise, 1877 labeled by MNHUB 2007; Syn-
type (1 male, SDEI) labeled as follows: coll. DEI,
Miincheberg, Syntypus, Coll. Weise; Syntype (1 fe-
male, SDEI) labeled as follows: Japan, Hiller, Coll.
Weise, Syntypus, Gyrophaena triquetra W., coll.
DEI, Miincheberg, Gyrophaena triquetra Weise;
Korea: Gangwon Province, Yangyang-gun, Seo-
myeon, Mt. Seolaksan, Seolakkyegok, 16 VIII
2000, MH Kim, ex- mushroom (93 specimens,
CNUIC); Sokcho-city, Mt. Seolaksan, Osackyaksu,
20 VII 2004, JS Park, ex- mushroom (19 specimens,
CNUIC); Chungbuk Province, Boeun-gun, Mt.
Songnisan, 12 IX 1999, MH Kim, ex- mushroom (12
specimens, CNUIC); Chungnam Province, Taean-
gun, Mt. Backhwasan, 6 VII 2001, SJ Park, ex
mushroom (7 specimens, CNUIC).
Distribution. Korea and Japan.
Remarks. Pas'nik (2001) described G. sunan-
ica from North Korea but diagnostic characteris-
tics (structure of antenna, male tergite VII and
VIII, median lobe) of this species were not suffi-
cient to separate G. sunanica from G. triquetra.
Therefore, we synonymized G. sunanica under G.
triquetra.
Gyrophaena triquetra is very similar to G.
rousi Dvof~ik but can be distinguished by male terg-
ite VII with 2 tubercles (male tergite VII with 1 tu-
bercle in G. rousi) (Fig. 15), postero-middle margin
of male tergite VIII protrude (postero-middle mar-
gin of male tergite VIII truncate in G. rousi)
(Fig. 16), and the structure of median lobe (Fig. 20).

Gyrophaena yotsudeba Cameron
(Figs. 3 and 22-30)

Gyrophaena yotsudeba Cameron, 1933: 208; Smetana,
2004: 446.

Gyrophaena defecta Cameron, 1933: 209; Smetana,
2004: 443. New synonym.

Description. Body length about 2.1-2.6 mm,
light brown to brown; head dark brown, antennae







Florida Entomologist 93(3)


September 2010


Figs. 13-21. Gyrophaena triquetra. 13, antenna, dorsal aspect; 14, pronotum, dorsal aspect; 15, male tergite VII,
dorsal aspect; 16, male tergite VIII, dorsal aspect; 17, male sternite VIII, ventral aspect; 18, female sternite VIII,
ventral aspect; 19, paramere, lateral aspect; 20, median lobe, lateral aspect; 21, spermatheca, lateral aspect. Scales
= 0.1mm.


_1








Kim & Ahn: Three New Synonyms in Gyrophaena


Figs. 22-30. Gyrophaena yotsudeba. 22, antenna, dorsal aspect; 23, pronotum, dorsal aspect; 24, male tergite VII,
dorsal aspect; 25, male tergite VIII, dorsal aspect; 26, male sternite VIII, ventral aspect; 27, female sternite VIII,
ventral aspect; 28, paramere, lateral aspect; 29, median lobe, lateral aspect; 30, spermatheca, lateral aspect. Scales
= 0.1mm.







Florida Entomologist 93(3)


September 2010


and legs yellow. Body shape moderate and elon-
gate in dorsal aspect, widest at posterior margin
of elytra and abdominal tergite IV (Fig. 3). Head
1.3 times wider than long, widest across eye,
many distinct punctures present. Antennomere 4
about 1.1 times longer than wide, 5-6 as long as
wide, 7-9 about 1.1 times wider than long, 10 as
long as wide, 11 about 1.8 times longer than wide
(Fig. 22). Pronotum 1.3 times wider than long,
widest at middle, anterior margin straight, poste-
rior margin broadly round (Fig. 23). Elytra 1.5
times longer than wide, postero-lateral angles of
elytra slightly sinuate. Tergites III-VI trans-
versely impressed. Paratergites III-VII well de-
veloped. Male tergite VII with 1 distinct tubercle
at postero-middle margin (Fig. 24). Male tergite
VIII with 6 processes, inner 4 processes minute
(Fig. 25). Male sternite VIII postero-medially con-
vex, more or less round (Fig. 26), female sternite
VIII more or less round (Fig. 27). Median lobe cy-
lindrical and asymmetrical, apical process of me-
dian lobe as in Fig. 29. Flagellum moderate and
not coiled. Apical lobe of paramere as in Fig. 28.
Spermatheca as in Fig. 30.
Materials Examined. Syntype (1 male, NHM)
labeled as follows: Japan Chuzenji, AT FT J.E.A.
Lewis, M. Cameron. Bequest. B.M. 1955-147., yot-
sudeba, Gyrophaena yotsudeba Cam. P.M. Ham-
mond det. 1973; Holotype (1 male, NHM) labeled
as follow: Japan Chuzenji, AT FT. J.E.A. Lewis,
M. Cameron. Bequest. B.M. 1955-147, G. defecta
Cam. Type; Korea: Gangwon Province, Pyeo-
ngchang-gun, Mt. Odaesan, Chongmyolbogung, 8
VII 1998, KJ Ahn, ex mushroom (42 specimens,
CNUIC); Mt. Odaesan, Bukdaesa, 23 VIII 2000,
MH Kim, ex mushroom (37 specimens, CNUIC);
Yangyang-gun, Seo-myeon, Mt. Seolaksan,
Seolakkyegok, 16 VIII 2000, MH Kim, ex mush-
room (48 specimens, CNUIC); Taeback-city, Jang-
seong-dong, Mt. Taebacksan, Backdansa, 16 VII
2000, MH Kim, ex- mushroom (59 specimens,
CNUIC).
Distribution. Korea and Japan.
Remarks. The holotype of G. defecta was very
similar to syntypes of G. yotsudeba, both of which


were simultaneously described by Cameron
(1933). Diagnostic characteristics (structure of
antenna, male tergite VII and VIII, sternite VIII,
median lobe, paramere, and spermatheca) of G.
defecta were exactly same as G. yotsudeba. There-
fore, we synonymized G. defecta under G. yot-
sudeba.
Gyrophaena yotsudeba is similar to G. yot-
sumata Cameron but can be distinguished by an-
tennomeres 5-6 subquadrate (slightly elongate in
G. yotsumata) (Fig. 22), male tergite VIII with 6
processes, inner 4 processes minute (male tergite
VIII with 4 processes in G. yotsumata) (Fig. 26),
and the structure of median lobe (Fig. 29).

ACKNOWLEDGMENTS

We thank Dr. R. Booth (The Natural History Mu-
seum, NHM, London), Dr. L. Zerche (Senckenberg Deut-
sches Entomologisches Institute, SDEI, Miincheberg)
and Dr. J. Willers (Museum fiir Naturkunde der Hum-
bolt-Universitat zu Berlin, MNHUTB, Berlin) for the
loan of type specimens. Volker Assing (Hanover, Ger-
many) read the manuscript and made helpful sugges-
tions. This research was supported by the project on
survey and excavation of Korean indigenous species of
the National Institute of Biological Resources (NIBR)
under the Ministry of Environment, Korea.

REFERENCES CITED

ASSING, V. 2005. New species and records of Staphylin-
idae from China (Coleoptera). Entomol. Bl. 101: 21-
42.
CAMERON, M. 1933. New species of Staphylinidae (Col.)
from Japan. Entomol. Mon. Mag. 69: 168-175, 208-
219.
PASINIK, G. 2001. The North Korean Aleocharinae (Co-
leoptera, Staphylinidae): diversity and biogeogra-
phy. Acta Zool. Cracov. 44(3): 185-234.
SM1EAA Sn 2004.aA ec]aine 1p 353419a nI cbc
leoptera Vol. 2, Hydrophiloidea, Histeroidea, Sta-
phylinoidea. Apollo Books Stenstrup. 942 pp.
WEISE, J. 1877. Japanische Staphilinidae und Pse-
laphidae. In: Beitrage zur Kaferfauna von Japan,
meist auf R. Hiller's Sammlungen basirt. Dtsche.
Entomol. Z. 21: 88-100.







Cividanes et al.: Habitat Preference and Abundance of Carabids and Staphylinids 339



DISTRIBUTION AND HABITAT PREFERENCE OF CARABIDAE AND
STAPHYLINIDAE (COLEOPTERA) IN AN ORANGE ORCHARD AND A
FOREST FRAGMENT

FRANCIsco J. CIVIDANES', EDILEUSA S. ARAirJO', SERGOl IDE2 AND JirLlO C. GALLI'
'Universidade Estadual Paulista--FCAV, Via de Acesso Prof. Paulo Donato Castellane s/n, Jaboticabal,
SP, 14884-900, Brazil

2Instituto Biol6gico, Av. Conselheiro Rodrigues Alves 1252, Sgo Paulo, SP, 04014-900, Brazil

ABSTRACT

A survey of Carabidae and Staphylinidae (Coleoptera) was conducted in a forest fragment
and an orange orchard located in the Gaviao Peixoto municipality, Sgo Paulo State, Brazil to
identify dominant predator species that may be important in the biocontrol of orange pests.
Beetles were captured by pitfall traps arranged along 2 parallel transects 200 m long, placed
across the orchard/forest boundary, extending 100 m into each habitat. The Shannon-Wiener
diversity and Bray-Cultis similarity indices were calculated for both habitats, and habitat
preference of abundant species were investigated by analysis of variance. Carabids com-
prised 91% and 86% of the beetles observed in the fragment and orchard, respectively.
Abaris basistriata Chaudoir, Athrustictus sp.1, Tetracha brasiliensis (Kirby), Pseudabarys
sp.1i, Selenophorus seriatoporus Putzeys, Selenophorus sp.4, and the staphylinid Xenopygus
sp.2 were the dominant species. There was no significant increase or decrease in carabid and
staphylinid species richness from the edge to the interior of the fragment and orchard.
Abaris basistriata preferred the forest fragment and the orange orchard, while Athrustictus
sp.1, Pseudobarys sp., Selenophorus sp.4, and S. seriatoporus were orchard associated. The
presence of ground vegetation on the orchard soil can have favored the establishment of
ground-dwelling beetles that may be acting to control important orange pests. Dominant
species determined in this study should be considered in future researches aiming to en-
hance the biocontrol in orange orchards.

Key Words: biological control, Citrus sinensis, diversity, similarity indices

RESUMO

Neste estudo foi realizado um levantamento populacional de Carabidae e Staphylinidae (Co-
leoptera) em fragmento florestal e pomar de laranja localizados no municipio paulista de Ga-
viho Peixoto, para identificar espi~cies dominantes de predadores que podem ser importantes
no control biol6gico de pragas da laranja. Os besouros foram amostrados com armadilhas de
solo distribuidas em dois transectos paralelos de 200 m de comprimento instalados no frag-
mento e pomal; com 100 m em cada h~bitat. A fauna foi caracterizada pelos indices de diver-
sidade de Shannon-Wiener e de similaridade de Bray-Cultis e a preferi~ncia pelo habitat foi
avaliada por andlise de varibncia. Os carabideos representaram 91% e 86% dos besouros ob-
servados no fragmento e pomal; respectivamente. As espi~cies dos carabideos Abaris basis-
triata Chaudoir, Athrustictus sp.1, Tetracha brasiliensis (Kirby), Pseudabarys sp.1,
Selenophorus seriatoporus Putzeys, Selenophorus sp.4 e do estafilinideo Xenopygus sp.2 dis-
tinguiram-se como dominantes. Ngo houve aumento ou declinio significativo da riqueza de es-
pi~cies de carabideos e estafilinideos da interface para 0 interior do fragmento e pomar.Albaris
basistriata teve preferi~ncia pelo pomar de laranja e fragmento florestal, enquanto Athrustic-
tus sp.1, Pseudobarys sp., Selenophorus sp.4 and S. seriatoporus mostraram-se associados ao
pomar. A presenga de vegeta~go de cobertura no solo do pomar pode ter favorecido o estabe-
lecimento de carabideos e estafilinideos que devem atuar no control de importantes pragas
de laranja. Espi~cies dominantes determinadas neste estudo devem ser consideradas em fu-
turas pesquisas visando incrementar o control biol6gico em pomares de laranja.

Translation Provided by the authors.


Studies dealing with the occurrence of arthro- 2006). Some studies have reported on the occur-
pod predators in citrus orchards are rare in Bra- rence of parasitoids in orchards (Garcia et al.
zil. The information available is related to coc- 2001; Jahnke et al. 2005).
cinellids, lacewings, and syrphids (Rodrigues et Ground beetles (Carabidae) and rove beetles
al. 2004), ants (Carvalho et al. 2000), wasps (Gal- (Staphylinidae) include important ground dwelling
van et al. 2002), and mites (Silva & Oliveira predator species that can contribute to the natural







Florida Entomologist 93(3)


September 2010


control of pests, and are strongly influenced by envi-
ronmental conditions (Pfiffner & Luka 2000; Hol-
land 2002). Factors known to influence their abun-
dance and distribution include vegetation type,
temperature, humidity, food availability, and the
species' life cycles (Lovei & Sunderland 1996;
Kromp 1999).
In Brazilian citrus orchards occur several insect
pests whose larval and/or pupae stage develop in
the soil and, therefore, can be encountered and
consumed by ground-dwelling beetles. Among
these pests are the Mediterranean fruit fly Cerati-
tis capitata (Wied.) and several species of Anas-
trepha (Diptera: Tephritidae), the citrus borer,
Ecdytolopha aurantiana (Lima) (Lepidoptera: Tor-
tricidae) and the beetles Macrodactylus pumilio
Burm. (Coleoptera: Scarabaeidae), Naupactus
cervinus (Boheman) and Naupactus riculosus
(Oliv.) (Coleoptera: Curculionidae). It is notewor-
thy that already carabid species have been ob-
served and considered voracious consumers of C.
capitata pupae (Urbaneja et al. 2006). On the other
hand, currently most of Brazilian orange orchards
have been conducted without cultivation for weed
suppression. As a consequence, the soils of these
orchards are covered with spontaneous vegetation
composed mainly of grasses. This agricultural
practice can contribute to the natural control of
pests by providing refuge to natural enemies of
pests including ground-dwelling beetles (Mifiarro
& Dapena 2003; Bone et al. 2009).
The diversity and abundance of predatory in-
sects in crops are related to the vegetation in the vi-
cinity, which may favor the occurrence of these in-
sects in agroecosystems (Thomas et al. 2002). The
presence of natural habitats may increase the oc-
currence of carabids and staphylinids in crops (Dyer
& Landis 1997). As these predators are potentially
important natural pest-control agents, they can be
crucial for sustainable agricultural systems by pre-
venting insect pest outbreaks (Kromp 1999).
Farming practices such as cultivation of differ-
ent plant species and changes in habitat struc-
ture due to cultivation methods can alter the spe-
cies composition, distribution, and abundance of
insects (Lovei & Sunderland 1996). To increase
the effectiveness of carabids and staphylinids as
biological control agents, it is necessary to evalu-
ate the influence of habitat type on their assem-
blage composition (Holland & Luff 2000).
The objectives of this study were to determine
the habitat preferences of abundant species, the
species diversity, and the distribution of individ-
ual species of Carabidae and Staphylinidae
across a forest fragment, an orange orchard and
the edge between these habitats.

MATERIALS AND METHODs

The study was carried out in an area located in
Gaviao Peixoto municipality, San Paulo State,


Brazil (21o49'19"S, 48024'46"W). The soil is classi-
fied as an Ultisol. The site comprised 10 ha of an
orange Citrus sineasis (L.) Osbeck orchard adja-
cent to 19 ha of a semi-deciduous broadleaf tropi-
cal forest fragment.
Beetles were sampled by pitfall traps, ar-
ranged on 2 parallel 200-m transects, 10 m apart,
from Nov 2004 to Oct 2006, totaling 36 sampling
dates. A total of 48 traps were installed (20 traps
in the fragment, 20 in the orchard and 8 in the
edge). Each transect spanned the habitat bound-
ary, with 100 m in the crop field and 100 m in the
forest fragment. Four traps were set close to each
other (1 m) at the edge between the forest frag-
ment and the crop, and from this point additional
traps were installed at 10-m intervals. Sampling
was biweekly during the growing season and
monthly otherwise. On each sampling date, the
traps were set and remained in the field for 1
week. Beetles were preserved for identification at
the Insect Ecology Laboratory at Unesp, Jabotica-
bal Campus. Identifications were made by 1 of the
authors (SI). The specimens were identified to ge-
neric level with help of keys by Navarrete-
Heredia et al. (2002) and Reichardt (1977). Spe-
cific identifications were done by comparison with
specimens deposited in the Colegao Entomolbgica
Adolph Hempel, Instituto Biolbgico, San Paulo
(IBSP-IB) and Museu de Zoologia, Universidade
de San Paulo, San Paulo. The exemplars are de-
posited in IBSP-IB.
Beetle communities were assessed by the Sh-
annon-Wiener (H) and Bray-Curtis (I,,) indices
(Brower et al. 1998). Species with the highest
abundance, dominance, frequency, and constancy
faunistic coefficients (Silveira Neto et al. 1995)
were designated as dominant. Regression analy-
sis was used to determine the effect of distance
from the edge on species richness, for orchard and
forest habitats. To establish the distribution fre-
quency of species that had at least 20 individuals
captured during the study, the total number of in-
dividuals caught in a trap was plotted against
their position on the transect. The habitat prefer-
ence of these species were determined by analysis
of variance (ANOVA) and Tukey test, considering
the total number of individuals captured in the
fragment, orchard and edge, at each sampling
date.

RESULTS AND DIsCussioN

Among the beetles captured, 71% of individu-
als occurred in the orange orchard and 21% in the
forest fragment. The carabids comprised 91% and
86% of the individuals observed in the fragment
and orchard, respectively (Table 1), and were
therefore more abundant in the forest fragment
and orange orchard than the staphylinids. Ma-
gagula (2006) observed that carabids were at
least 26 times more numerous than staphylinids







Cividanes et al.: Habitat Preference and Abundance of Carabids and Staphylinids 341



TABLE 1. TOTAL NUMBER OF CAPTURED INDIVIDUALS OF CARABIDAE AND STAPHYLINIDAE IN ORANGE ORCHARD, FOR-
EST FRAGMENT AND EDGE. DOMINANT SPECIES IN BOLD TYPE.

Family/species Orchard Forest Edge Total

Carabidae
Selenophorus sp.4 137 5 6 148
Abaris basistriata Chaudoir 64 59 4 127
Athrostictus sp.1 74 2 9 85
Tetracha brasiliensis (Kirby) 27 2 9 38
Selenophorus seriatoporus Putzeys 35 0 0 35
Pseudabarys sp.1 19 7 4 30
Scarites sp.2 7 11 6 24
Sphalera plaumanni Liebke 3 9 1 13
Scarites sulcipes Chaudoir 3 8 1 12
Odontochila nodicornis (Dejean) 0 9 0 9
Loxandrus aff. subvittatus Straneo 5 3 0 8
Scarites sp.3 0 5 2 7
Notiobia sp.1 6 0 0 6
Barysomus punctatostriatus van Emden 4 1 1 6
Notiobia amethystinus Dejean 1 4 0 5
Helluomorphoides squiresi (Chaudoir) 4 0 1 5
Cymindis sp.1 3 1 0 4
Selenophorus alternans Dejean 4 0 0 4
Selenophorus discopunctatus Dejean 4 0 0 4
Arthrostictus speciosus (Dejean) 0 1 0 1
Eucheila strandi (Liebke) 1 0 0 1
Loxandrus catharinae Tschitschi~rine 0 1 0 1
Notiobia chalcites (Germar) 1 0 0 1
Odontochila cupricollis Kollar 1 0 0 1
Selenophorus sp.2 1 0 0 1
Trichonilla festiva Tschitschi~rine 1 0 0 1
Total no. individuals 405 128 44 577
Total no. species 22 16 11 26

Staphylinidae
Xenopygus sp.2 43 5 1 49
Atheta sp.6 16 0 0 16
Atheta sp.3 0 4 0 4
Eulissus chalybaeus Mannerheim 4 0 1 5
Glenus biplagiatus Perty 1 1 0 2
Lathropinus torosus (Erichson) 1 1 0 2
Renda sp.1 0 2 0 2
Lathrobium sp.1 1 0 0 1
Smilax pilosa (Fabricius) 1 0 0 1
Xenopygus sp.1 1 0 0 1
Total no. individuals 68 13 2 83
Total no. species 8 5 2 10


in a citrus orchard and a windbreak. The low oc-
currence of carabids and staphylinids in the frag-
ment (141 individuals) compared to 473 individu-
als in the orchard may result from a smaller num-
ber of prey, and/or unfavorable habitat character-
istics. Lovei & Sunderland (1996) reported
similar results where the density of adult cara-
bids in annual crops was 32/m2, but was ex-
tremely low in forests II! n0.
The carabids classified as dominant species
were: Abaris basistriata Chaudoir, Athrostictus


sp.1, Tetracha brasiliensis (Kirby), Pseudabarys
sp.1, Selenophorus seriatoporus Putzeys, and Se-
lenophorus sp.4; only Xenopygus sp.2 was domi-
nant among the staphylinids (Table 1).
The species richness of carabids and staphylin-
ids was higher in the orchard than in the frag-
ment (Fig. 1). A relatively high number of beetle
species was observed at the edge, often exceeding
the number of species in the fragment. The spe-
cies richness of carabids at the edge was lower
than in the orchard, whereas for staphylinids it




















1:-2 0-Oo -so -6o -so 0 0 2 O 1 0 to SO 100 120



Staplhydrdae


~ r m *

+ * *
. o .
-120-100 -80 -60 -40 -20 0 20 410 60 80 100 120
Position on transect (m)

Fig. 1. Carabidae and Staphylinidae species richness
plotted against position on the transect. The zero indi-
cates the edge between the orange orchard (positive
numbers) and the forest fragment (negative numbers).



was similar from the edge to 40 m within the or-
chard. Regression analyses did not indicate a sig-
nificant relationship between species-richness
distribution of carabids and staphylinids, and the
distance from the edge for both the fragment (ya, ~
abida = 4.9535 + 0.0065x, r = 0.0860, P > 0.05; ysta
phyhmdae = 1.8252 0.0071x, r = 0.2256, P > 0.05) and
orchard (yarabida = 8.6926 + 0.0267x, r = 0.4293, P
> 0.05; ytaphyhmdae = 2.447 0.0025x, r = 0.0600, P >
0.05). Therefore the variation in number of spe-
cies did not depend on the position on the
transect.
The carabid species diversity coefficients for
the fragment (H = 0.871) and orchard (H =
0.900) were close to each other, indicating that


TABLE 2. NUMBER (MEAN + STANDARD ERROR) OF CARABIDAE AND STAPHYLINIDAE CAPTURED IN FOREST FRAGMENT,
ORANGE ORCHARD AND EDGE.

Family/species Orchard Forest Edge F

Carabidae
Abaris basistriata Chaudoir 1.8 + 0.50 a 1.6 + 0.31 a 0.1 + 0.07 b 7.67
Athrostictus sp.1 2.1 + 0.50 a 0.06 + 0.03 b 0.3 + 0.13 b 11.0(7"
Tetracha brasiliensis (Kirby) 0.8 + 0.24 a 0.06 + 0.02 a 0.3 + 0.10 a 2.7T"
Pseudabarys sp.1 0.5 + 0.19 a 0.2 + 0.05 b 0.1 + 0.06 b 4.54"
Scarites sp.2 0.2 + 0.07 a 0.3 + 0.11 a 0.2 + 0.05 a 0.07NS
Selenophorus seriatoporus Putzeys 1.0 + 0.27 a 0.0 + 0.00 b 0.0 + 0.00 b 12.2(T"
Selenophorus sp.4 3.8 + 1.11 a 0.1 + 0.06 b 0.2 + 0.17 b 10.78*"

Staphylinidae
Xenopygus sp.2 1.2 + 0.83 a 0.1 2 0.07 a 0.03 + 0.02 a 1.67"

Values followed by different letters in same line are different by Tukey test (P < 0.05).
Nsnon-significant.


Florida Entomologist 93(3)


September 2010


Carabidae


they are similar in richness and dominance
structure. Because the occurrence of carabids
depends on environmental conditions such as
temperature, moisture, and vegetation type
(Kromp 1999; Holland 2002), the present re-
sults indicate that the forest fragment and the
orange orchard with ground vegetation support
carabid assemblages of similar diversity. A
greater diversity of staphylinids was found in
the fragment (H = 0.614) than in the orchard (H
= 0.483), which may indicate that the fragment
was more favorable for the occurrence of species
of these beetles. However, there are limitations
to the interpretation of results on staphylinids,
because of the lack of information on the ecol-
ogy and adult behavior of these beetles (Frank
& Thomas 2008).
A low species similarity was observed between
the carabid and staphyhmnd commumitles present
in the orchard and the fragment (Ia Carabidae =
0.353; Ia Staphylinidae = 0.173). In agricultural
areas, soil arthropods have been observed to move
between crops and forest fragments (French et al.
2001; Thomas et al. 2002). The apparent low rate
of movement of carabids and staphylinids be-
tween the fragment and the orchard may be re-
lated to the presence of ground vegetation on the
orchard soil providing favorable conditions that
kept the beetles in the orchard.
Table 2 shows the average number of carabids
and staphylinids captured in 36 sampling dates.
Abaris basistriata appears to prefer the fragment
and orchard, while Athrostictus sp.1, Pseudobarys
sp., Selenophorus sp.4, and S. seriatoporus are or-
chard associated. The remaining species show no
clear preference and may be regarded as wide-
spread.
Carabids can be classified according to the
habitat where they are observed in the agroeco-
system (Fournier & Loreau 1999; French & El-
liott 1999). In Brazil, TS brasiliensis and species of


14
sc
. * .6*
* *


,
* *
*

















19s 90 Bo 70 60 50 40 30 2 1 1 0 0 1 10 20 30 40 50 60 n 80 90 19
Ath~rustichs sp.1
Fragmant Edge Orchard





19s 90 Bo 70 60 50 40 30 20 1 1 0 0 1 10 20 30 40 50 60 7o0 Bo In
Aeudabarus sp.1
Fragmant Edge Orchard




.. 1 .... .1.11 I
10W 90 BO 70 60 50 40 33 10 1 0 0 1 10 20 30 40 50 60 E 90 19 I
nstance (m)


19r 80 Bo 70 60 50 40 30 2 1 1 0 0 1 10 20 30 40 50 60 70 BO0 1 9


10~ 90 BO7 60 50 47 jD 20 10 1 0 0 1 10 20 30 40 50 60 70 B 9 100
Tekacha brarliersi
Fragment Edge CGehard





10W 90 BO7 60 50 40 30 2 10 1 0 0 1 10 20 30 40 50 A 70 BO9 10
Ale247gus sp.2
12Fragment Edge I Orchard




100 90 BO7 60 50 40 30 2 10 1 0 0 1 10 3 30 40 50 60 70 BO 9 10
nslatle (m)
Fig. 3. Catch frequency of individual species of Car-
abidae and Staphylinidae (Xenopygus sp.2) plotted
against position on the transect. The vertical lines indi-
cate the position of the edge.


at the edge to at least 30 m into the orchard and
fragment, whereas TS brasiliensis was abundant
from the edge to 80 m into the orchard. Among the
orange-orchard species, the catch frequency of
Athrostictus sp.1 declined abruptly from inside
the orchard to the edge, whereas S. seriatoporus,
Pseudabarys sp.1 and Selenophorus sp.4 showed
a more gradual drop in abundance toward the
edge. The staphylinid Xenopygus sp.2 was abun-
dant in the orange orchard, with a clear decrease
in abundance near the edge.
This study indicated low similarity between the
carabid and staphylinid communities in the or-
ange orchard and forest fragment, but, on the
other hand, we observed high species diversity of
carabids in the orchard where most of the domi-


1090 BO 70 60 50 40 30 2 10 1 0 0 1 10 20 30 40 50 60 70 80 9 10

Fig. 2. Catch frequency of individual species of Car-
abidae plotted against position on the transect. The ver-
tical lines indicate the position of the edge.


genus Selenophorus were found in cotton (Ramiro
& Faria 2006), maize (Aradijo et al. 2004), sugar
cane (Macedo & Aradijo 2000; Aradijo et al. 2005),
and vegetables (Cividanes et al. 2003). These
findings corroborate the results of the present
study, indicating S. seriatoporus, and Selenopho-
rus sp.4 as crop inhabiting species.
Although the abundance distribution of cara-
bids might potentially be affected by many factors
(Thomas et al. 2002), the distribution frequency
of selected species gave some indication of their
response to the transition zone (edge) between
the fragment and the orchard (Figs. 2 and 3).
Abaris basistriata showed a gradual decline in
catch frequency from inside the orchard/fragment
toward the edge. Scarites sp.2 was most abundant


I I I I I


Fragment Edge




II I


I I


Cividanes et al.: Habitat Preference and Abundance of Carabids and Staphylinids 343


Abaris barsbisklat


Se~lemrqhoas seriztgnras


Fragmat~ 1


Fragment


.1einrd1


Selemrqhoas sp.4l
Edge GeChhard 1


Fragment


Scarite sp.2


Gehard


a Geh


II








Florida Entomologist 93(3)


September 2010


nant species also prevailed. Low similarity be-
tween communities can indicate low rate of move-
ment of the ground-dwelling beetles between the
fragment and orchard (Kajak & Lukasiewicz
1994). Therefore, the high diversity of carabids and
the presence of dominant species in the orchard
are due probably to no soil disturbance and the
presence of ground vegetation on the orchard soil.
These characteristics of the orchard favored the es-
tablishment of ground-dwelling beetles that may
be acting to control important pests such as the
fruit flies C. capitata and several species ofdnas-
trepha, the citrus borer, E. aurantiana and the bee-
tles M. pumilio, N. cervinus and N. riculosus. As
most of Brazilian orange orchards employ the
same agricultural practice of keeping ground veg-
etation, further studies are needed to clarify the
actual role of these ground-dwelling beetles as bio-
logical control agents of pests in orange orchards.
Considering that dominant species have the poten-
tial to be used in biological control programs (Ells-
bury et al. 1998), research in an orange orchard
aiming to improve biocontrol should consider the
dominant species determined mn this study.


ACKNOWLEDGMENTS

We thank the Funda~go de Amparo g Pesquisa do
Estado de Sgo Paulo (Fapesp), for financial support; and
the Conselho Nacional de Desenvolvimento Cientifico e
Tecnol6gico (CNPq), for financial support and for pro-
viding a scholarship to the first author.

REFERENCES CITED

ARAirJO, R. A., ARAirJO, M. S., GORING, A. H. R., AND
GUEDES, R. N. C. 2005. Impacto da queima controla-
da da palhada da cana-de-agricar sobre a comu-
nidade de insetos locals. Neotrop. Entomol. 34: 649-
658.
ARAirJO, R. A., BADJI, C. A., CORRO'A, A. S., LADEIRA, J.
A., AND GUEDES, R. N. C. 2004. Impacto causado por
Deltametrina em cole6pteros do solo associados a
cultural do milho em sistema de plantio direto e con-
vencional. Neotrop. Entomol. 33: 379-385.
BONE, N. J., THOMSON, L. J., RIDLAND, P. M., COLE P.,
AND HOFFMANN, A. A. 2009. Cover crops in Victorian
apple orchards: effects on production, natural ene-
mies and pests across a season. Crop Prot. 28: 675-
683.
BROWER, J. B., ZAR, J. H., AND VoN ENDE, C. N. 1998.
Field and Laboratory Methods for General Ecology.
Boston, McGraw-Hill, 273 pp.
CARVALHO, R. S., NASCIMENTO, A. S., AND MATRANGO-
LO, W. J. R. 2000. Control biol6gico, pp. 113-118 In
A. Malavasi and R. A. Zucchi [eds.], Moscas-das-fru-
tas de importbncia econ~mica no Brasil: conheci-
mento b~sico e aplicado. Ribeirio Preto, Holos Edito-
ra. 327 pp.
CIVIDANEs, F. J., SOUZA, V. P., AND SAKEMI, L. K. 2003.
Composi~go faunistica de insetos predadores em
fragmento florestal e em Brea de hortaligas na region
de Jaboticabal, estado de Sgo Paulo. Acta Sci., Biol.
Sciences 25: 315-321.


DYER, L. E., AND LANDIs, D. A. 1997. Influence of non-
crop habitats on the distribution of Eriborus tere-
brans (Hymenoptera: Ichneumonidae) in cornfields.
Environ. Entomol. 26: 924-932.
ELLSBURY M. M.L POWELL, J. E., FORCEELLLA, .E 1OD

Diversity and dominant species of ground beetle as-
semblages (Coleoptera: Carabidae) in crop rotation
and chemical input systems for the Northern Great
Plains. Ann. Entomol. Soc. America 91: 619-625.
FOURNIER, E., AND LOREAU, M. 1999. Effects of newly
planted hedges on ground-beetle (Coleoptera: Cara-
bidae) in an agricultural landscape. Ecography 22:

FRANK, J. H., AND THOMAS, M. C. 2008. Rove beetles of
Florida, Staphylinidae (Insecta: Coleoptera: Sta-
phylinidae). University of Florida, IFAS Extension.
http://creatures. ifas.ufl. edu
FRENCH, B. W., ELLIOTI, N. C., BERBERET, R. C., AND
BURD, J. D. 2001. Effects of riparian and grassland
habitats on ground beetle (Coleoptera: Carabidae)
assemblages in adjacent wheat fields. Environ. En-
tomol. 30: 225-234.
FRENCH, B. W., AND ELLIOTT, N. C. 1999. Temporal and

Caa ddisae osebna s i rsslad an ajce t
wheat fields. Environ. Entomol. 28: 73-84.
GALVAN, T. L., PICANQO, M. C., BACCI, L., PERREIRA, E.
J. G., AND CRESPO, A. L. B. 2002. Seletividade de oito
inseticidas a predadores de lagartas em citros. Pesq.
Agropec. Bras. 37: 117-122.
GARCIA, R. R. M., CARABAGIALLE, M. C., SA, L. A. N.,
AND CAMPOs, J. V. 2001. Parasitismo natural de
Phyllocnistis citrella Stainton, 1856 (Lepidoptera,
Gracillariidae, Phyllocnistinae) no oeste de Santa
Catarina, Brasil. Rev. Bras. Entomol. 45: 139-143.
HOLLAND, J. M. 2002. Carabid beetles: their ecology,
survival and use in agroecosystems, pp. 1-40 In J. M.
Holland [ed.], The Agroecology of Carabid Beetles.
Andover, Intercept. 356 pp.
HOLLAND, J. M., AND LUFF, M. L. 2000. The effects of
agricultural practices on Carabidae in temperate
agroecosystems. Integr. Pest Manage. Rev. 5: 109-
129.
JAHNKE, S. M., REDAELLI, L. R., AND DIEFENBACH, L. M.
G. 2005. Complexo de parasit6ides de Phyllocnistis
citrella (Lepidoptera, Gracillariidae) em dois pomar-
es de citros em Montenegro, RS, Brasil. Iheringia,
Ser. Zool. 95: 359-363.
KAJAK, A., AND LUKASIEWICZ, J. 1994. Do semi-natural
patches enrich crop fields with predatory epigean ar-
thropods. Agric. Ecosys. Environ. 49: 149-161.
KROMP, B. 1999. Carabid beetles in sustainable agricul-
ture: a review on pest control efficacy, cultivation
impacts and enhancement. Agric. Ecosys. Environ.
74: 187-228.
LOVEI, G. L., AND SUNDERLAND, K. D. 1996. Ecology and
behavior of ground beetles (Coleoptera: Carabidae).
Annu. Rev. Entomol. 41: 231-256.
MACEDO, N., AND ARAirJO, J. R. 2000. Efeito da queima
do canavial sobre insetos predadores. An. Soc. Ento-
mol. Bras. 29: 71-77.
MAGAGULA, C. N. 2006. Habitat specificity and varia-
tion of coleopteran assemblages between habitats in
a south African (Swaziland) agricultural landscape.
Biodivers. Conserv. 15: 453-463.
MIFIARRO, M., AND DAPENA, E. 2003. Effects of ground-
cover management on ground beetles (Coleoptera:








Cividanes et al.: Habitat Preference and Abundance of Carabids and Staphylinids 345


Carabidae) in an apple orchard. Appl. Soil Ecol. 23:
111-117.
NAVARRETE-HEREDIA, J. L., NEWTON, A. F., THAYER, M.
K., ASHE, J. S., AND CHANDLER, D. S. 2002. Illustrat-
ed Guide to the Genera of Staphylinidae (Co-
leoptera) of Mexico. Guadalajara, Universidad de
Guadalajara & Comisi6n Nacional para el Cono-
cimiento y Uso de la Biodiversidad, 401 pp.
PFIFFNER, L., AND LUKA, H. 2000. Overwintering of ar-
thropods in soils of arable fields and adjacent semi-
natural habitats. Agric. Ecosys. Environ. 78: 215-
222.
RAMIRO, Z. A., AND FARIA, A. M. 2006. Levantamento de
insetos predadores nos cultivares de algodio Boll-
gard@DP90 e conventional Delta Pine Acala 90. Arq.
Inst. Biol. 53: 119-121.
REICHARDT, H. 1977. A synopsis of the genera of Neotro-
pical Carabidae (Insecta: Coleoptera). Quaest. Ento-
mol. 13: 346-493.
RODRIGUEs, W. C., CASSINO, P. C. R., AND SILVA-FILHO,
R. 2004. Ocorriencia e distribui~go de crisopideos e
sirfideos, inimigos naturals de insetos-pragas de cit-


ros, no estado do Rio de Janeiro. Agronomia 38: 83-
87.
SILVA, M. Z. DA, AND OLIVEIRA, C. A. L. DE. 2006. Sele-
tividade de alguns agrot6xicos em uso na citricultura
ao Bcaro predador Neoseiulus californicus (MacGre-
gor) (Acari: Phytoseiidae). Rev. Bras. Frutic. 28: 205-
208.
SILVEIRA NETO, S., MONTEIRO, R. C., ZUCCHI, R. A., AND
MORAES, R. C. B. 1995. Uso da andlise faunistica de
insetos na avalia~go do impact ambiental. Sci. Ag-
ric. 52: 9-15.
THOMAs, C. F. G., HOLLAND, J. M., AND BROWN, N. J.
2002. The spatial distribution of carabid beetles in
agricultural landscapes, pp. 305-344 In J. M. Hol-
land [ed.], The Agroecology of Carabid Beetles. An-
dover, Intercept. 356 pp.
URBANEJA, A., GARCIA MARI, F., TORTOSA, D., NAVARRO,
C., VANACLOCHA, P., BARGUEs, L., AND CASTANERA,
P. 2006. Influence of ground predators on the surviv-
al of the Mediterranean fruit fly pupae, Ceratitis
capitata, in Spanish citrus orchards. BioControl 51:
611-626.







Florida Entomologist 93(3)


September 2010


INTRAPOPULATION VARIATION IN AN AUSTRALIAN POPULATION OF THE
NORTH AMERICAN THRIPS, BAGNALLIELLA YUCCAE (THYSANOPTERA:
PHLAEOTHRIPIDAE), A NEW RECORD FROM AUSTRALIA


DESLEY J. TREE
Entomology Collection, Queensland Primary Industries and Fisheries, Depaliment of Employment,
Economic Development and Innovation, 80 Meiers Rd., Indooroopilly, Qld, Australia 4068

ABSTRACT

The genus Bagnalliella Karny is an endemic North American genus of Phlaeothripidae with
7 species associated with the New World plant genus Yucca; 2 Old World species currently
placed in the genus are probably not congeneric. The number of sensoria on antennal seg-
ments III and IV has been used to distinguish the Bagnalliella species on Yucca, but an in-
vasive population of Bagnalliella yuccae (Hinds) is reported here from Australia, at
Brisbane, Queensland, in which the number of sensoria varied between individuals and
even between left and right antennae of single individuals. These observations cast consid-
erable doubt on the validity of some of the North American species of Bagnalliella The Aus-
tralian population was damaging young leaves of Yucca elephantipes, and indicates the ease
with which thrips can be distributed by the horticultural trade.

Key Words: Bagnalliella yuccae, Yucca elephantipes, thrips, Thysanoptera

RESUME

El gi~nero Bagnalliella Karny es un gi~nero de la familiar Phlaeothripidae endi~mico de Nor-
teamibrica con 7 species associadas con plants del gi~nero Yucca en el Nuevo Mundo; 2 es-
pecies del Mundo Antiguo actualmente puestos en el mismo gi~nero pero probablemente no
son congi~neres. Se ha usado el n~mero de sensoria sobre los segments III y IV de la antena
para distinguir las species de Bagnalliella sobre Yucca, pero una poblaci6n invasora de
Bagnalliella yuccae (Hinds) de Brisbane, Queensland, Australia que es reportada aqui varia
en el n~mero de sensoria entire individuos y adn entire la antenna izquierda y derecha del
mismo individuo. Estas observaciones ponen una duda considerable sobre la validez de al-
gunos de las species de Bagnalliella en Norteamibrica. La poblaci6n australiana estuvo da-
fiando hojas tiernas de Yucca elephantipes, e indica la facilidad en que los trips pueden ser
distribuidos por medio del comercio de products horticolas.


Seven of the 9 thrips species listed in the genus
Bagnalliella Karny are known from Yucca plants
in North America (B. arizonae, B. australis, B. de-
sertae, B. glaucae, B. huachucae, B. mojave, and B.
yuccae). These species have been described from
various Yucca spp. covering large areas from east
coast North America, Central America, and
across to west coast North America (Table 3). In
contrast, 2 species, B. flavipes from New Guinea
and B. robusta from Africa, possibly belong in
other genera (Hoddle et al. 2009).
Bagnalliella yuccae (Hinds) was first described
in 1902 from Amherst, Massachusetts and Wash-
ington District of Columbia on the East coast of
North America on Yucca filamentosa and Sol-
idago spp. flowers goldenrodd) as Cephalothrips
yuccae Hinds (see Mound 2009). Cott (1956) re-
ported that B. yuccae was known from several
Yucca spp. including Yucca filamentosa, and Sol-
idago spp., and was also only known to occur east
of the Mississippi River, USA. Only one female
specimen was recorded from Solidago (Cott
1956), raising considerable doubt of this being a


true host record. Currently B. yuccae is known
from Japan, Korea, the Mediterranean region of
Europe, Russia, North America (Okajima 2006),
and now Australia. The genus Yucca contains ap-
proximately 47 species and their natural distribu-
tions cover North and Central America, extend-
ing into the West Indies (Mabberley 2008). Bag-
nalliella. yuccae has undoubtedly been trans-
ported around the world by the horticultural
trade on cultivated Yucca species (Mound &
Marullo 1996; Okajima 2006).
No key to distinguish between the 7 species of
Bagnalliella from Yucca has ever been produced,
although Cott (1956) produced a key distinguish-
ing 3 of these species. That key relies heavily on
the number of sensoria on antennal segments III
and IV. According to their original descriptions,
the American species differ from the type species,
B. yuccae (Figs. IB and C) as follows; B. arizo-
nae-body color and size of tenth abdominal seg-
ment (Hood 1927a), B. australis olor of head
and antennae, size of antennal segments (Hood
1939), B. desertae-1l minute sensorium on anten-







Tree: Intrapopulation Variation in Bagnalliella yuccee


Fig. 1. A--Bagnalliella yuccae feeding at the bases of young leaves of Y: elephantipes 'Silver Star' (variegated va-
riety), in Brisbane, Australia (feeding damage marked by white arrow); B--Adult female Bagnalliella yuccae; C -
Head of adult female Bagnalliella yuccae.


nal segment III (Hood 1927a), R. glaucae color of
subhypodermal pigmention (Hood 1927b), R. hua-
chucae-size of antennal segment II and tenth
abdominal segment (Hood 1927a), R. mojave-
color of antennae and 1 minute sensorium on an-
tennal segment III (Hood 1927a).


In Sep 2009, a routine inspection at a whole-
sale nursery in Brisbane, Queensland, Australia
found cultivated plants of Yucca elephantipes
(Agavaceae) with established populations of
large, dark thrips feeding at the bases of the
young leaves (Fig. 1A). Although confirmed as a




































TABLE 2. NUMBER OF SENSORIA ON LEFT AND RIGHT ANTENNAL SEGMENTS III AND IV ON INDIVIDUALS OF INTERCEPTED
AND AUSTRALIAN SPECIMENS.

Left antenna Right antenna

Specimens III IV III IV

Melbourne, Interception
Female 3 4 3 4
Female 3 4 4 4
Female 3 4 3 4
Female 3 4 3 4
Female 3 4 3 4
Female 3 4 2 4
Female 3 4 3 4
Female 3 4 3 4
Male 2 3 2 3

Brisbane Population 1
Female 3 3 3 4
Female 3 3 3 4
Female 2 4 3 4
Female 3 4 3 4
Male 3 4 3 3
Male 2 3 2 2

Brisbane Population 2
Female 3 3 3 4
Female 3 4 3 4
Female 3 4 3 4
Female 3 2 2 3
Female 3 4 2 4
Male 2 3 3 3
Male 3 3 2 3

Brisbane Population 3
Female 3 4 3 4
Female 3 3 3 4
Female 3 4 3 4
Female 3 4 3 4
Male 2 3 2 3
Male 2 3 2 3
Male 2 3 2 3


Florida Entomologist 93(3)


September 2010


TABLE 1. NUMBER OF SENSORIA ON ANTENNAL SEGMENTS III AND IV ON BAGNALLIELLA YUCCAE FROM ORIGINAL DE-
SCRTPTTON TN 4 MAJOR PUBTTCATTONS AND VARTATTON ACROSS AUSTRATTAN SPECIMENS.


Number of sensoria
on antennal segment III


Number of sensoria
on antennal segment IV


Hinds (1902)
Cott (1956)
Stannard (1968)
Okajima (2006)
Hoddle et al. (2009)
Interception, Melbourne

Brisbane, Australia
Population 1
Population 2
Population 3


Not included

Not included






2 or 3
2 or 3
2 or 3


Not included


3 r4



2,3 or 4

2, 3 or 4
2,3 or 4







Tree: Intrapopulation Variation in Bagnalliella yuccee


species of Bagnalliella Hinds (Laurence A.
Mound, Australian National Insect Collection,
Canberra), further study indicated that these
specimens failed to match precisely the available
descriptions of B. yuccae (Cott 1956; Stannard
1968; Okajima 2006; Hoddle et al. 2009) because
of variation in the number of sensoria on the third
and fourth antennal segments. Several thrips
identified as Bagnalliella sp. (LAM, ANIC) were
intercepted by the Australian Quarantine and In-
spection Service (AQIS), Melbourne, Australia
during 2005 and 2006 (B. Crowe, AQIS, personal
communication). These thrips were found on
stems of Yucca elephantipes imported from Costa
Rica and Guatemala and were consequently fumi-
gated. In order to help with identifying this inva-
sive species, a study was made of the variation in
the number of antennal sensoria.

MATERIAL AND METHODS

Three collections of B. yuccae were taken from
new leaf bases of E: elephantipes (non-variegated
variety) and E: elephantipes 'Silver Star' (varie-
gated variety), in Brisbane, Australia, and the
number of sensoria on antennal segments III and
IV were counted. The first collection taken in late
Sep 2009 was from E: elephantipes 'Silver Star'
and 2 weeks later the second collection was taken
again from E: elephantipes 'Silver Star' (Fig. 1A),
together with the third collection from E: elephan-
tipes. Specimens of intercepted thrips from Mel-
bourne, Australia (origin, Costa Rica; May and


Sep 2005, Jan 2006) were borrowed and included
for analysis in this study.
In total, 20 B. yuccae specimens (13 females
and 7 males) from the 3 Brisbane collections were
mounted onto glass microscope slides in Canada
balsam (see Hoddle et al. 2009 for mounting pro-
tocol) (Figs. IB and C). These specimens, together
with 9 slide-mounted specimens from the inter-
ception in Melbourne were studied under a Nikon
90i compound microscope with Differential Inter-
ference Contrast objectives. The number of senso-
ria on antennal segments III and IV was counted
and recorded for left and right antennae. All slide-
mounted specimens of B. yuccae have been lodged
as voucher specimens in the Queensland Primary
Industries and Fisheries Entomology Collection
and ANIC.

RESULTS

Variation in Antennal Sensoria

Table 1 indicates the number of sensoria on
antennal segments III and IV of B. yuccae as indi-
cated in the original description and 4 major pub-
lications on this species, together with the range
of variation found within the intercepted material
and established populations from Australia. It
should be noted that 3 authors claim that there
are 4 sensoria on segment four (Cott 1956; Stan-
nard 1968; Hoddle et al. 2009) but 1 author states
that there are only 3 sensoria on this segment
(Okajima 2006) (Table l). All authors agree there


A BC D

Fig. 2. Dorsal and ventral views of a Bagnalliella yuccae individual's antennal segments III and IV showing vari-
ation of sensorial (arrows). A--Left antennae dorsal view, III has 1 sensorium, IV has 1 sensorium; B--Left anten-
nae ventral view, III has 2 sensoria, IV has 2 sensoria (1 split); C--Right antennae dorsal view, III has 1 sensorium,
IV has 2 sensoria; D--Right antennae ventral view, III has 2 sensoria, IV has 2 sensoria.








Florida Entomologist 93(3)


September 2010


are 2 sensoria on the third segment (Table 1). In
contrast, within the Australian population, the
number of sensoria varied between individuals as
well as between the left and right antennae of in-
dividuals (Table 2). The numbers of sensoria
found on the left and right antennal segment III
varied among individuals between 2, 3, or 4 in
varying combinations (Fig. 2). Sensoria on the left
and right antennal segment IV numbered 2, 3, or
4, again in varying combinations. Remarkably, 1
sensorium was unusually split (Fig. 2B). Within
the 29 specimens included in this study, the most
common combination of sensoria on antennal seg-
ments III and IV was as follows: 3 on III and 4 on
IV in 12 females, and 2 on III and 3 on IV in 4
males. The 9 specimens intercepted in Mel-
bourne, that originated from Costa Rica, showed
little variation in the number of sensoria on an-
tennal segments III and IV, with 7 specimens pos-
sessing the most common combination (3 on III
and 4 on IV in females).

DIscussioN

Within Thysanoptera, variation in numbers of
sensoria on antennal segments III and IV is rela-
tively uncommon (LAM, ANIC, personal commu-
nication). The tribe Haplothripini, of which Bag-
nalliella is a member, is reported to have 5 species
that show variation in the number of sensoria on
either antennal segment three or four; Karyno-
thrips flavipes and K. melaleucus have either 3 or
4 sensoria on antennal segment IV (Goldarazena
et al. 2008), Haplothrips bituberculatus has 3 or 4
sensoria on antennal segment IV, Haplothrips
dicksoniae has 2 or 3 sensoria on antennal seg-
ment IV and Haplothrips frici 1 or 2 sensoria on
antennal segment III (Mound & Minaei 2007). In
Haplothripini species, the possession of 3 senso-
ria on antennal segment III is a plesiomorphic
character state, which is retained by only a few
genera (Mound & Minaei 2007).
The Australian specimens most closely match
the descriptions of B. yuccee from the 4 major
publications by Cott (1956), Stannard (1968),
Okajima (2006), and Hoddle et al. (2009), except
for the number of sensoria number on antennal
segments III & IV. The possibility of the Austra-
lian populations being a mixture of different spe-
cies seems unlikely. The lack of any consistency
in the number of sensoria on antennal segments
III & IV is most likely due to intra-specific varia-
tion. Bagnalliella yuccee specimens held in the
Ewart Thrips Collection, University of California,
Riverside, also exhibit similar variation in senso-
ria numbers on antennal segments III and IV as
seen in the Australian material (M. Hoddle, UC,
Riverside, California, personal communication).
The most recent publication concerning differ-
ences in Bagnalliella species was published over
50 years ago, and a re-examination of the genus is


a,
ct .,
a
a,
o
u
,$ c
X o
a,
'El
d 5; i
B ~" "
4' . 4
d~d ~d
~ a ~
~~~dd~E;~
.,
4s~a~~3~
r: uo u cl


~clcB ~cl.r cB
a, ~cl ~cl

~oa~ ao
ogO 08
oo

~W YU~~W

a

a
M
d
a




o,
a


S

d 3
add"dd~l
,,,~,,~
99999~1~1
0000000
0000000
3333333
~1~1~1~1~1~1~I




~,~~~~~
hlmhlhlhlhlg)
Q~Q~Q~Q~Q~Q~~
aaaaaaa
oooooo


~ 8 3~
oee me








Tree: Intrapopulation Variation in Bagrealliella yuccee


well overdue. Such a study should include not
only the morphological differences between spec-
imens from different species of Yucca, but also
molecular analyses of DNA to help with species
designations.

ACKNOWLEDGMENTS

Many thanks to Andrew Manners (QPI&F) for de-
tecting and collecting populations of B. yuccae in Bris-
bane. Thanks to Luke Watson, Bill Crowe, and Mark
Hoddle for providing information and specimens of B.
yuccae. I am grateful to Laurence Mound, Andrew Man-
ners, and Mark Hoddle for helpful comments on earlier
drafts of this paper.

REFERENCES CITED

COTT, H. E. 1956. Systematics of the Suborder Tubu-
lifera (Thysanoptera) in California. Publications in
Entomology, University of California 13: 1-216.
GOLDARAZENA, A., MOUND, L. A., AND ZUR STRASSEN, R.
2008. Nomenclatural problems among Thysanoptera
(Insecta) of Costa Rica. Revista Biologia Tropical 56:
961-968
HINDS, W. E. 1902. Contribution to a Monograph of the
insects of the order Thysanoptera inhabiting North
America. Proc. United States Natl. Museum 23: 79-
242.
HODDLE, M. S., MOUND, L. A., AND PARIS, D. L. 2009.
Thrips of California. Cd-rom published by CBIT
Publishing, Queensland. http://www.1ucidcen-


tral.org/keys/v3/thrips_of_california/
Thrips_of_C alifornia.html
H(X)D, J. D. 1927a. New western Thysanoptera. Proc.
Biol. Soc. Washington 40: 197-204.
H(X)D, J. D. 1927b. New Thysanoptera from the United
States. J. New York Entomol. Soc. 35: 123-142.
H(X)D, J. D. 1939. New North American Thysanoptera,
principally from Texas. Revista de Entomologia 10:
550-619.
MABBERLEY, D. J. 2008. Mabberley's Plant Book, A
Portable Dictionary of Plants, Their Classification
and Uses. Cambridge University Press, Cam-
bridge, UK.
MOUND, L. A. 1997. Biological Diversity, pp. 197-215 In
T. Lewis [ed.], Thrips as Crop Pests. CAB Interna-
tional, UK. 740 pp.
MOUND, L. A. 2009. Thysanoptera (Thrips) of the World
-a checklist http://www~ento .csiro. au/thysanoptera/
worldthrips.html
MOUND, L. A., AND MARULLO, R. 1996. The Thrips of
Central and South America: An Introduction (Insec-
ta: Thysanoptera). Associated Publishers, Florida
USA.
MOUND, L. A., AND MINAEI, K. 2007. Australian thrips
of the Haplothrips lineage (Insecta: Thysanoptera).
J. Natural History 41: 2919-2978.
OKAJIMA, S. 2006. The Insects of Japan Vol. 2. The Sub-
order Tubulifera (Thysanoptera). Touka Shobo Co.
Ltd., Fukuoka, Japan.
STANNARD, L. J. 1968. The Thrips, Thysanoptera, of Illi-
nois. Bull. Illinois Natural History Survey 29: 213-
552.







Florida Entomologist 93(3)


September 2010


TWO NEW SPECIES OF THE GENUS LONGIPENIS
(LEPIDOPTERA: LECITHOCERIDAE) FROM CHINA

HOUSHUAI WANG', WEl XIONG' AND MIN WANG'~
1Depaliment of Entomology, College of Natural Resources & Environment, South China Agricultural University,
Guangzhou 510642, China

2Corresponding author; E-mail: wangminl68@yahoo.com.cn

ABSTRACT

Two new species of the genus Longipenis Wu (Lepidoptera: Lecithoceridae), L. paradeltidius
M. Wang and Xiong, sp. nov. and L. denticalous H. Wang and M. Wang, sp. nov. are de-
scribed from South China. Longipenis paradeltidius is very similar to L. deltidius Wu in ex-
ternal morphology, but can be easily distinguished from the latter by M, free from CuA, in
the hindwing and cornutus as long as 2/31length of aedeagus. Longipenis denticalous differs
from the 2 preceding species by uncus not apically forked. Adults, male genitalia, and wing
venation are illustrated. A key and a distribution map of the species are given. The type
specimens are deposited in the Depaliment of Entomology, South China Agricultural Uni-
versity, Guangzhou, China.

Key Words: Lepidoptera, Lecithoceridae, Longipenis, new species, China

RESUME

Se described dos nuevas species del gi~nero Longipenis Wu (Lepidoptera: Lecithoceridae), L.
paradeltidius Wang y Xiong, sp. nov. y L. denticalous Wang y Wang, sp. nov. del sur de
China. Longipenis paradeltidius es muy parecida a L. deltidius Wu en su morfologia ex-
temna, pero puede ser distinguida de la segunda por tener la ala posterior con M, libre de
CuA, y el cornutus 2/3 del largo del aedeago. Longipenis denticalous se distingue de las es-
pecies anteriores por tener el Apice del uncus no bifurcado. Se ilustran los adults, los geni-
tales del macho y las nervaduras del ala. Se provee una clave y un mapa de la distribuci6n
de las species. Los especimenes tipos son depositados en el Depaltamento de Entomologia,
Universidad Agricola del Sur de China, Guangzhou, China.


The subfamily Torodorinae in the order Lep-
idoptera includes more than 270 species belong-
ing to 37 genera, and more than 90% of the spe-
cies are distributed in the Oriental Region and
a few occur in the Australian and Palaearctic
Regions, except for 1 species from the Neotropi-
cal Region (Park & Lee 1999; Park et al. 2006;
Park 2008; Park & Byun 2008; Park & Kim
2009). The genus Longipenis, established by Wu
in 1994 on the basis of the type species L. del-
tidius Wu, is a monotypic genus of Torodorinae
distributed only in China so far. It is generally
characterized by the following features: forew-
ing venation with R,, R, and R, stalked, R, ex-
tending to the apex, M, very close to M,, CuA,
and CuA, stalked at basal 1/3; hindwing 1/4-1/3
wider than forewing, Rs and M, stalked at 2/5,
M, and CuA, with short stalk or free; abdominal
tergites with spinose zones. This genus is very
similar to the genus Torodora Meyrick, but dif-
fers from the latter by discal cell with remains
of closing vein, the male genitalia with long tri-
angle-shaped vinculum, and a relatively long
aedeagus.
During surveys of the Lepidopterous fauna of
South China, we found 2 new species which are


described in this paper, and presented along with
a distribution map of the genus (Fig. 1).

MATERIALS AND METHODS

Descriptions are based on the dried specimens
from the Department of Entomology, South China
Agricultural University, Guangzhou, China. Pho-
tographs of adults were taken with a Nikon
Coolpix 4500 digital camera. Genitalia were dis-
sected in water after the abdomen was removed
and dipped in boiled 10% KOH solution for 3-4
min. Wings of the paratypes were prepared for ve-
nation images by cleaning with 95% absolute
ethyl alcohol and then stained with acetocarmine
solution. Genitalia and wing venation were sub-
sequently mounted on microscope slides with
glycerin for photographing and then preserved in
a micro-tube attached to the specimens. The im-
ages of genitalia and wing venation were taken
through a Carl Zeiss Stemi 2000-CS stereoscope
with the Nikon Coolpix 4500 camera body at-
tached to the stereoscope phototube and com-
pared with illustrations of L. deltidius by Wu
(1994). Post processing of all the photos was done
with Adobe Photoshop 6.0.





Fig. 1. Distribution of Longipens species. L. deltidius Wu (jr); L. paradeltidius M. Wang and Xiong, sp. nov. ();
L. dentiualous H. Wang and M. Wang sp. nov. (A).


KEY TO THE SPECIES OF LONGIPENIs BASED ON IVALE GENITALIA

1 Uncus not apically forked . . . . . . .. .. .. .. L. dentiualous H. Wang and M. Wang, sp. nov.
- Uncus apically forked. .............. ..........2.... ..............
2 Cornutus longer than aedeagus .......... . . . ... .. .. . . .. L. deltidius Wu


Wang et al.: New Species of Longipenis from China


LC n

i.


*~,? 1~..

7 ~
.~ i I
i- n
!li i L~-Y'
11 111 (~ Lil


(


'si


-Cornutus 2/3 length of aedeagus .. . . . .

Longipenis paradeltidius M. Wang and Xiong,
new species,
(Figs. 2, 4, 6 and 7)

Diagnosis. The new species, in external mor-
phology, is hardly distinguishable from L. deltid-


. .. .. .. L. paradeltidius M. Wang and Xiong, sp. nov.

lus Wu which was described from Fujian Prov-
ince, China, except for its slightly smaller size.
However, distinguishing characters are found in
the male genitalia and the hindwing venation. In
males of the new species, the aedeagus is thick
and short with the cornutus length 2/3 that of the


B2


3


Figs. 2 and 3. Adults of Longipenis species. (2) L. paradeltidius M. Wang and Xiong, sp. nov., male holotype. up-
perside; (3) L. dentiualous H. Wang and M. Wang, sp. nov., male holotype, upperside.


-J
i'~----:
i




,I



--(I~
-r
i;i

Iw~P-*"







Florida Entomologist 93(3)


September 2010


margin and forewing grayish brown; Rs and M,
stalked at 2/5, M, free from CuA,. Abdomen yel-
low, with spinose zones. Legs yellowish brown.
Male Genitalia. Uncus broad basally, apically
forked. Gnathos broad ellipse-shaped basally,
with a rectangular hook at apex. Valva triangular
with dorsally recurved apex and concaved dorsal
margin. Juxta with a pair of long caudal pro-
cesses. Vinculum broad triangle-shaped medially,
apex with minute setae. Aedeagus curved basally,
longer than valva. Cornutus slender, as long as 2/
3 length of aedeagus.
Female. Unknown
Holotype: Male, Cenwanglaoshan Mt.,
Guangxi Zhuang Autonomous Region, China, 30-
V-2002, leg. Wang Min. Paratype: 1 male, same
data as holotype, which was used for the venation
preparation.
Distribution. China (Guangxi Zhuang Autono-
mous Region).
Etymology. The specific name is derived from
Latin, "para" meaning next to or near, referring to
similarity between this species and L. deltidius
Wu.


Longipenis dentiualous H. Wang and M. Wang,
new species,
(Figs. 3, 5, 8 and 9)


Diagnosis. This new species is very similar to
L. deltidius Wu and the preceding species, but can
be distinguished by the uncus not apically forked,
shorter cornutus and valva with a dentiform pro-
jection on dorsal margin.
Description. Adult. Wingspan 29-30 mm. Head
brown, with dark yellow scales dorsally; antenna
almost as long as forewing, basal half black, api-
cal half festucine; labial palpus long, upcurved,
first segment very short, covered with yellow
scales, second segment with rough, yellow scales,
third segment brown, being more slender than
second segment; compound eye surrounded by
yellowish brown scales. Thorax and tegula dark
brown. Forewing dark brown, with purplish, a
yellow spot at 3/4 of costal margin, radius base
with a yellow transverse fascia, a yellow crescent
longitudinal fascia in middle; fringe scales yellow,
inner margin slightly concave; R, and R2 arising
before discal cell, R,, R4,and R, stalked, R, to the
apex, M, almost parallel to M2, CuA,, and CuA,
stalked about 1/3, 1A+2A stalked at base. Hind-
wing wider than forewing, brownish black, apical
angle acute, outer margin oblique, fringe scales
yellow, area between costal margin and forewing
yellow. Rs and M, stalked at 2/5, M2 apprOaching
short stalk of M,+CuA,. Abdomen with spinose
zones, anterior half part dark brown, posterior
half part yellow. Legs yellow.
Male Genitalia. Uncus long and thick, trun-
cate, slightly concaved. Gnathos long, apex


Fig. 5. Venation of L. dentiualous H. Wang and M.
Wang, sp. nov. (male, Paratypes)


4 sc+a=






;A~Cc~uA CuA'

Fig. 4. Venation of L. paradeltidius M. Wang and
Xiong, sp. nov. (male, Paratypes)


aedeagus, whereas in L. deltidius, the aedeagus is
slender and the cornutus length exceeds that of
the adeagus; in the hindwing venation of the new
species, M,free with CuA,, but M, and CuA, short
stalked in L. deltidius.
Description. Adult. Wingspan 23 mm. Head
brown, occiput with dark yellow scales; antenna
almost as long as forewing, basal half black, api-
cal half whitish yellow, with white fringe scales;
labial palpus long, second segment yellowish
brown, third segment brown; compound eye sur-
rounded by yellowish brown scales. Thorax and
tegula dark brown. Forewing dark brown and
purplish, with a yellow costal margin patch at 3/4
costa, radius base with yellow transverse fasciae
yellow crescent longitudinal fasciae at middle'
fringe scales brown, inner margin slightly con
cave; R, and R2 arising before discal cell, R,, R4 and
R, stalked, R, to termen, M, almost parallel to M ,
CuA, and CuA, stalked about 1/3, 1A+2A stalked
near base. Hindwing wider than forewing, brown-
ish black, apical angle acute, outer margin ob-
lique, fringe scales brown, area between costal







Wang et al.: New Species of Longipenis from China


i Lk
'5"


I


i



8\


Figs. 6-9. Genitalia of Longipenis species. (6-7) Male genitalia of L. paradeltidius M. Wang and Xiong, sp. nov.,
holotype; (8-9) Male genitalia of L. dentiualous H. Wang and M. Wang, sp. nov., holotype.


slightly bent, obtuse angle, large and stout at
basal part, emarginated on caudal margin. Valva
trianglar, apex acute, with a process on outer
margin. Sacculus broad. Juxta with a ligulate
process medially and a pair of narrow, long lateral
processes. Aedeagus slender, narrower than
valva, apically with a long cornutus. Coruntus as
long as width of valva base.
Female. Unknown
Holotype: Male, Nanling Mt., Guangdong
Province, China, 3-VI-2006, leg. Liusheng Chen.
Paratype: 1 male, data same as holotype, which is
used for the venation preparation.
Distribution. China (Guangdong Province).
Etymology. The species name is derived from
the Latin "dent" and "valva", referring to the costa
of valva with a median dentiform projection,


DIscussioN

There is some variation in the hindwing vena-
tion of the genus Longipenis. In the type species
L. deltidius, M, and CuA, shortly stalked and Rs
stalked with M, at 2/5. However, examination of
the 2 new species reveals that M, and CuA, are
free in L. paradeltidius and Rs stalked with M,
near 1/3 in L. dentivalous. The variation of vena-
tion is also found in other genera of Torodorinae
(Park 2003; Park 2007; Park 2008). Therefore, the
2 new species are doubtlessly placed in this genus
due to the similarity of the male genitalia and
Other external characteristics. In addition, the ge-
nus is probably belonging to diurnal moths group,
for both of the 2 new species were collected when
they were flying during the daytime.








Florida Entomologist 93(3)


September 2010


ACKNOWLEDGMENTS

We sincerely appreciate Prof. Chunsheng Wu, Insti-
tute of Zoology, Academia Sinica, Beijing, China, and Dr.
Kyu-Tek Park, The Korean Academy of Science and
Technology, Korea, for help in providing useful refer-
ences. We thank Dr. Liusheng Chen, Shihezi University,
for collecting the materials.

REFERENCES CITED

PARK, K. T. 2003. Thubana species (Lepidoptera, Leci-
thoceridae) in Thailand, with descriptions of twelve
new species. J. Asia-Pacific Entomol. 6(2): 137-150.
PARK, K. T. 2007. A review of the Torodora nzanoconta
species-group (Lepidoptera: Lecithoceridae), with
descriptions of three new species. Zootaxa 1465: 55-
56.
PARK, K. T. 2008. A new species of the Monotypic genus
Anaxyrina Meyrick (Lepidoptera, Lecithoceridae,
Torodorinae). The Korean J. Systematic Zool. 24(2):
165-167.
PARK, K. T., AND BYUN, B. K. 2008. A new genus Chryso-
nasnza (Lepidoptera, Gelechioidea, Lecithoceridae),


with description of a new species from the Philip-
pines. Florida Entomol. 91(2): 205-209.
PARK, K. T., AND KIM, M. Y. 2009. Notialis Park n. gen.
from the Philippines, with descriptions of two new
species (Lepidoptera: Lecithoceridae). Proc. Ento-
mol. Soc. Washington 111(1): 121-127.
PARK, K. T., KIM, M. Y. CHAE, M. Y., KANG, T. M., BAE,
Y. S., NGUYEN, C., AND PHAM, V. 2006. A taxonomic
review of the subfamily Torodorinae (Lepidoptera,
Lecithoceridae) of Vietnam, with descriptions of
five new species. J. Asia-Pacific Entomol. 9(4): 327-
337.
PARK, K. T., AND LEE, S. M. 1999. A review of the Leci-
thocrinae and Torodorinae (Lepidoptera, Lecithocer-
idae) in Korea. Insecta Koreana 16(2): 119-129.
WU, C. S. 1994. Study on Lecithoceridae in China. Sino-
zoologia 11: 123-174.
WU, C. S. 1997. Lepidoptera Lecithoceridae. Fauna Sin-
ica, Insecta, Vol. 7. Science Press, Beijing, China. 306
pp.
WU, C. S. 2001. Lecithoceridae, In B. K. Huang (ed.),
Fauna of Insects in Fujian Province of China, Vol. 5.
Science & Technology Publishing House, Fuzhou,
China. 664 pp.
















































Translation provided by the authors.


Cervantes Peredo et al.: Ischnorhynchinae from Costa Rica


ISCHNORHYNCHINAE FROM COSTA RICA (HEMIPTERA-HETEROPTERA:
LYGAEOIDEA: LYGAEIDAE) WITH DESCRIPTION OF ONE NEW SPECIES
OF KLEIDOCERYS

LUIs CERVANTEs PEREDO' AND HARRY BRAILOVSKY2
'Instituto de Ecologia, A.C. Km 2.5 Antigua Carretera a Coatepec # 351 CP 91070, Xalapa, Veracruz, Mexico
E-mail: luis.cervantes~inecol.edu.mx

2IHStituto de Biologia, UNAM. Apartado Postal 70153 CP. 04510 Mi~xico, D.F.
E-mail: coreidae~ibiologia.unam. mx

ABSTRACT

The subfamily Ischnorhynchinae is distributed worldwide and is represented by 3 genera
Kleidocerys, Neokleidocerys, and Polychisme in the American Continent. Here, we report this
subfamily for the first time from Costa Rica, redescribe Kleidocerys virescens, Neokleidocerys
goldmani, Polychisme poecilus, and describe a new species, Kleidocerys costaricensis n. sp.
A dorsal habitus illustration of the male, drawings of the male genitalia, and scanning elec-
tron micrographs of some morphological features are provided for this new species. A key to
all Costa Rican species in the subfamily is presented.

Key Words: Neokleidocerys, Polychisme, Central America

RESUME

La subfamilia Ischnorhynchinae est6 distribuida mundialmente, en el Continente Americano
est6 representada por tres gi~neros Kleidocerys, Neokleidocerys y Polychisme. Reportamos aquf
por primera vez a la subfamilia para Costa Rica, incluyendo a Kleidocerys virescens, Neoklei-
docerys goldmani, Polychisme poecilus y la descripci6n de una nueva especie, Kleidocerys cos-
taricensis. Ilustraci6n dorsal del macho, dibujos de la genitalia del macho, y microfotograffas
de microscopio electr6nico de algunas estructuras morfol6gicas de esta nueva especie. Una
clave para todas las species costarricenses de la subfamilia tambii~n se present.


The lygaeid subfamily Ischnorhynchinae has
worldwide distribution and was reviewed by
Scudder (1962). This review included 15 genera,
54 species, and host plant information. Species in
the genus Kleidocerys Stephens occur in the Pale-
arctic, Nearctic, and Neotropical Regions. In the
American Continent 12 species have been re-
ported: K. denticollis Stil, K. dimidiatus Barber,
K. franciscanus Stil, K. modestus Barber, K. obo-
vatus Van Duzee, K. ovalis Barber, K. pallipes
Brailovsky, K. punctatus Distant, K. resedae Pan-
zer (with 2 subspecies K. resedae fuscomaculatus
Barber and K. resedae geminatus Say), K. suffus-
sus Barber, K. virescens Fabricius, and K. hispan-
iola Baranowski (Barber 1953; Scudder 1962;
Baranowski & Slater 2005). Although Slater &
Brailovsky (1986) transferred from Ischno-
rhynchinae the genus Polichisme, and put it in
Artheneinae, later on Kerzhner (1997) trans-
ferred again this genus to Ischnorhynchinae.
This paper reports the first record of the sub-
family for Costa Rica. The only reports from Cen-
tral America are K punctatus and K. virescens for
Panama, K. virescens in Honduras and Guate-


mala (Scudder 1962; Slater 1964; Brailovsky 1976;
Slater & O'Donnell 1995), K. resedae geminatus in
Panama (Slater 1964), and Neokleidocerys god-
mani (Distant) and Neokleidocerys salvini (Dis-
tant) in Guatemala (Distant 1882). Slater &
Brailovsky (1989) studied the genus Neok-
leidocerys and described N. variolosus from Peru,
N. salvini from Mexico, and N. godmani from Pan-
ama and Venezuela. Polychisme poecilus (Spinola)
has been recorded only for South America and
Polychisme ferruginosus (Stil) for Colombia. Here
we include Kleidocerys costaricensis new species,
Kleidocerys virescens, Neokleidocerys godmani,
and Polychisme poecilus as the first records of
these species and genera for Costa Rica as well as
a diagnostic key to all Costa Rican species.

MATERIALS AND METHODS

Specimens examined were borrowed from the
Coleccion Nacional de Insectos from Instituto de
Biologia, UNAM, Mexico (CNIN), and from Colec-
cion Entomologica del Instituto Nacional de
Biodiversidad, Costa Rica (INBIO). Some speci-







Florida Entomologist 93(3)


September 2010


mens are deposited in the following institutions:
Coleccion Entomologica del Instituto de Ecologia,
A.C. (IEXA), and in The National Museum of Nat-
ural History, Smithsonian Institution, Washing-
ton, D.C. (USNM). Scanning electron micrograph
(SEM) images were taken with a JEOL JSM-
5600LV Scanning Electron Microscope. Measure-
ments are given in mm + SE.


RESULTS

Kleidocerys costaricensis Cervantes and Brailovsky
new species,
Figs. 1-5

Type Specimens. Holotype. Male. COSTA
RICA. Provincia Cartago, Crater Volcan Irazu, 3-


Fig. 1. Dorsal view of male of Kleidocerys costaricensis, new species.







Cervantes Peredo et al.: Ischnorhynchinae from Costa Rica


yellowish with last 2 segments dark brown and
slightly surpassing metacoxae. Scutellum red-
dish brown to yellow with base usually darker, all
covered with dense punctures. Clavus with 3 reg-
ular rows of punctures. Corium with 1 complete
row of punctures parallel to the claval suture and
1 incomplete row with 3 to 5 punctures; corium
usually whitish, although some specimens with
translucent areas; in both cases punctures are
distributed along the R+M vein and between
R+M and discal area reaching posterior margin of
corium; corium also with 2 rectangular dark
brown spots mesially on the punctuated area be-
tween R+M and disc; and with 4 rectangular
spots along posterior corial margin (Fig. 2). Legs
with coxae and femora reddish yellow; tibiae and
first tarsi yellow; other tarsi pale brown. Venter of
head dark brown to black; propleura with ante-
rior and posterior third yellowish, middle third
dark brown; meso- and metapleura with anterior
half dark brown and posterior half varying from
whitish to yellow; pro-, meso- and metapleura
with a darker delimited spot near dorsal margin.
Peritreme of scent gland yellowish and with an
elongated auricle with a pointed apex (Fig. 5). Ab-
dominal venter with first 5 segments dark brown
and rest of segments varying from red to yellow.
Male Genitalia. Opening of genital capsule
with a mesial constriction (Fig. 3). Paramere with
acute apex, internal margin entire and external
margin with a prominent tubercle on basal third
(Fig. 4).
Male Measurements (n = 9). Body length 3.75
+ 0.09; head length 0.41 + 0.06; width across eyes
0.68 + 0.02; interocular distance 0.39 + 0.03; an-
tennal segments: I 0.28 + 0.03, II 0.44 + 0.03, III
0.34 + 0.03, IV 0.48 + 0.04; rostral segments: I
0.43 + 0.03, II 0.41 + 0.02, III 0.38 + 0.03, IV 0.29
+ 0.02; pronotum:1length 0.74 + 0.05, width across
anterior margin 0.62 + 0.04, width across hu-
meral angles 1.3 + 0.04; scutellum: length 0.45 +
0.04, width 0.7 + 0.02; length claval comissure
0.38 + 0.04; width across apex of clavus 1.63 +
0.05; length hemelytra 2.73 + 0.06; length mem-
brane 1.29 + 0.03.
Female Measurements (n = 3). Body length
4.12 + 0.25; head length 0.48 + 0.1; width across
eyes 0.72 + 0.02; interocular distance 0.41 & 0.04;
antennal segments: I 0.29 + 0.01, II 0.48 + 0.02,
III 0.33 + 0.03, IV 0.55 + 0.05; rostral segments: I
0.43 + 0.04, II 0.44 + 0.05, III 0.38 + 0.08, IV 0.35
+ 0.05; pronotum: length 0.83 + 0.06, width across
anterior margin 0.7 + 0.01, width across humeral
angles 1.42 + 0.08; scutellum: length 0.54 + 0.04,
width 0.72 + 0.02; length claval comissure 0.42 +
0.02; width across apex of clavus 1.83 + 0.14;
length hemelytra 2.97 + 0.11; length membrane
1.38 + 0.08.
Etymology. The species name refers to the
country where specimens of this new species were
collected.


3


Figs. 2-4. Kleidocerys costaricensis new species. 2.
Hemelytra. 3. Paramere. 4. Male genital capsule.


IV-2007, H. Brailovsky, B. Kohlman, 3500 m
(CNIN). Paratypes. 3 9 8 6 Same data as Holo-
type (CNIN, IEXA, INBIO, USNM); 1 9 Provincia
de Cartago, Cerro de la Muerte, Rt 2, InterAmer-
ican Hwy. 27-II-1978, E.R. Snyder Hodges, 2700
m (USNM); 1 6 Provincia Limon, P. Int. La Amis-
tad, Vallecito Los Sphagnum, 26-VI-2003, R.
Gonzalez, A. Rodriguez, 2470 m, L.S.
339200_576850 #74152 (INBIO); 1 9 1 6 Provin-
cia Limon, P. Int. La Amistad, Valle del Silencio,
Los Sphagnum, 27-IX-2003, R. Gonzalez, 25000
m, L.S. 339200 576850 #75024 (INBIO); 1 9 Pro-
vincia San Jose de Costa Rica, La Cima de Dota,
14-V-1993, M. Chavarria, 2300 m, L.S.
183500_548300 # 2154 (INBIO); 1 6 Provincia
San Jose de Costa Rica, 14 miles N San Isidro del
General, 10-VII-1974, L. and C.W. O'Brien, G.B.
Marshall, 7300' (CNIN).
Diagnosis. This species can be differentiated
from other species in the genus by the whitish co-
rium and by the presence of 4 rectangular spots
along the posterior corial margin.
Description. Head and pronotum variegated
with amber, yellow, brown, and dark brown; head
with 2 dark brown bands that run almost parallel
to eyes and anterior lobe of pronotum with 2 cica-
trices dark brown to black; punctures of head and
pronotum widely distributed, those of head
smaller; antenna with first and last segments
dark brown to black, second and third segments
yellow with base and apex dark brown; rostrum







Florida Entomologist 93(3)


September 2010


Fig. 5. Scanning electron micrograph of scent gland ofKleidocerys costaricensis, new species.


Distribution. Costa Rica
Discussion. This species differs from others in
the genus Kleidocerys, by the presence of a whit-
ish corium and the very sharp apex of the peri-
treme. It is very similar to Kleidocerys modestus
Barber that is found only in United States, but K.
modestus has an almost complete inmaculated co-
rium.

Kleidocerys uirescens (Fabricius)
Acanthia cirescens Fabricius, 1794. Ent. Syst. 4: 70

Redescription. Head and pronotum pale ochra-
ceous, thickly covered with dark punctures. Hem-
elytra yellowish brown. Most of antennal seg-
ments ochraceous, basal segment brown, bases of
segments III and IV dark brown. Rostrum ex-
tended to posterior coxae. Scutellum pale ochra-
ceous, thickly, coarsely, and darkly punctuated at


base, a few coarse dark punctures along lateral
margins, and a very characteristic central elon-
gated dark spot. Corium, pale ochraceous, with 2
dark spots on disk and 4 along apical margin.
Femora and apices of tibiae castaneous, tibiae
and apices of femora pale ochraceous, tarsi ochra-
ceous. Body length around 3.2 mm.
New Records. COSTA RICA. 1 6 Provincia
Guanacaste, Estacion Pitilla, 9 km S. Santa Ce-
cilia, VIII-1991, P. Rios, L-N-330200,380200 (IN-
BIO); 3 9 3 6 Provincia Guanacaste, Estacion Pit-
illa, 9 km S. Santa Cecilia, 31-III-29-IV-1992, K.
Taylor, 700 m, L-N-330200,380200 (CNIN, IEXA,
INBIO); 1 6 Provincia Guanacaste, Estacion Mar-
itza, Lado Oeste del Volcan Orosi, VIII-1990, II
cursor Parataxonomos, 600 m, L-N-326900,373300
(INBIO); 1 6 Provincia Guanacaste, Rio San
Lorenzo, Tierras Morenas, Z.P. Tenorio, IV-1992, F.
Quesada, L-N- 287800, 427600 (INBIO); 6 93 &







Cervantes Peredo et al.: Ischnorhynchinae from Costa Rica


Provincia Heredia, Vara Blanca, Finca Georgina,
IX-1989, Hanson, 2100 m; Provincia Heredia,
Santo Domingo, Santa Rosa, INBIO parque, 1-XI-
2004, R. Kriebel, 1100 m, L-N- 217300-526300 #
782365 (CNIN, IEXA, INBIO).
Distribution. Costa Rica, Guatemala, Hondu-
ras, Mexico, Panama, United States of America,
and West Indies.
Discussion. This species is very similar to
Kleidocerys sufftsus Barber that is distributed in
several islands in the Caribbean. Kleidocerys
virescens is also recorded in the Caribbean but is
widely distributed from the South of the USA to
Central America. Kleidocerys sufftsus differs
from K. virescens by the reddish coloration of
head, pronotum, and scutellum.

Neckleidocerys godnzani (Distant)
Ischnorhynchus godnzani Distant, 1882. Biol. Cent.
Amer. 1: 193-194

Redescription. Head dark brownish orange,
with 2 black maculae on posterior third of interoc-
ular space; tylus pale orange; most of juga and
margin near eyes cover with a whitish cerumen;
antennal segment I pale orange, segments II and
III bright yellow with base and apex slightly
darker, segment IV dark brown or reddish brown
with base yellow; anterior lobe of pronotum dark
brownish orange, posterior lobe yellowish orange
with punctures slightly darker; scutellum with
basal third yellowish orange and the rest reddish
brown; clavus ochraceus with brownish orange
punctures; corium hyaline, with punctures, a
macula situated near middle third of endocorium,
and a rectangular macula situated in the apical
angle pale orange in color; membrane ambar.
Ventrally the head and prothorax are pale orange
with following areas black: posterior area of gula,
and a long macula on propleura; rostral segments
ochraceous with most of segment IV black; me-
sothorax dark orange with a fine whitish ceru-
men, acetabula ochraceous and mesosternum


black; metathorax dark orange with a fine whit-
ish cerumen, acetabula and posterior margin
whitish yellow; posterior margin of metathorax
with a middle rectangular pale brown macula;
coxae brownish orange with apex yellow; tro-
canter, tarsi and femora bright yellow; femora
with a brown orange subapical ring; sternites
brownish orange with brownish scattered areas.
Body length between 4.5 and 5.1 mm.
New Records. COSTA RICA. 1 9 Provincia
Guanacaste, Estacion Cacao, SW side Volcan Ca-
cao, IX-1989, R. Blanco, C. Chavez, 1000-1400 m,
323300-375700 (INBIO).
Distribution. Costa Rica, Panama, Venezuela.

Polychisnze poecilus (Spinola)
Pachynzerus poecilus Spinola, 1852.
In Gay, Hist. Chile Zool. 7: 149

Description. This species can be distinguished
by a single row of punctures along claval suture,
and by the pronotum laterally carinated. General
coloration dull yellowish; head slightly punctured
with darker areas around juga; antenna and ros-
trum ochraceus, with base and apex of antennal
segments paler; pronotum evenly punctured,
with anterior margin and carina impunctated;
scutellum strongly punctated, except the V shape
that is pale; pleura densely punctured; legs ochra-
ceus, with apex of tibia and all tarsi dark brown.
Abdominal venter without punctures. Body
length between 4.3 and 5 mm.
New Records. COSTA RICA. 1 9 Provincia
Alajuela. Zarcero, Alfaro Ruiz, IV-V-1989, A. Del
Valle, A. Solis, 1700 m, 240500, 493500 (INBIO);
1 6 Provincia Guanacaste, Miravalles, Volcan
Miravalles, 4-VII-31-VIII-2005, J. Azofeita, 1900
m, Malaise trap, L-N 303100 410400 # 84550
(IEXA); 1 9 Provincia Heredia, Estacion Barva.
Braulio Carrillo, IV-1990, A. Fernandez, 2500 m
(INBIO).
Distribution. Argentina, Bolivia, Chile, Costa
Rica.


KEY TO THE IS(1HNORHYN(1HINAE OF COSTA RI(TA

1-- Corium with 2 rows of punctures along claval suture near inner angle and a complete row extending the whole
length; pronotum laterally ecarinate . . . . . ......... . .. . . .. 2
1'- Corium with 1 row of punctures along claval suture; pronotum laterally carinate
............... .............. ................... .Polychisnze poecilus (Spinola)
2- Pronotum with a distinct anterior constriction or collar; apical portion of corium broadly dark brown
............... .............. ................ Neckleidocerys goldnzani (Distant)
2'-Pronotum without a distinct anterior constriction or collar; apical portion of corium usually pale, with few small
dark maculae all around corium. . . . . . ......... .. .. . . .. . 3

3- Scutellum with a central elongate dark spot; length approximately 3.2 mm
............... .............. .............. .. Kleidocerys virescens (Fabricius)
3'- Scutellum without a central elongate dark spot; length more than 3.7
............... .............. ............ .Kleidocerys costaricensis, new species








Florida Entomologist 93(3)


September 2010


ACKNOWLEDGMENTS

We thank Edmundo Saavedra and Tiburcio La~z
from Instituto de Ecologia, A. C. for drawing the adult of
Kleidocerys costaricensis, and for taking the scanning
electron image, respectively. We thank Jesus Ugalde
and Jim Lewis for the loan of some of the specimens
from INBIO.


REFERENCES CITED

BARANOWSKI, R. M., AND SLATER, J. A. 2005. The Lyga-
eidae of The West Indies. University of Florida. Flor-
ida Agricultural Experiment Station. Gainsville,
Florida. 266 pp.
BARBER, H. G. 1953. A revision of the genus Kleidocerys
Stephens in the United States. Proc. Entomol. Soc.
Washington. 55: 273-283.
BRAILOVSKY, H. 1976. Contribucion al studio de los
Hemiptera-Heteroptera de Mexico: X. Una nueva es-
pecie del genero Kleidocerys Stephens (Lygaeidae-
Ischnorhynchinae) y datos de la distribuci6n
geografica de las species mexicanas del genero.
Anales del Instituto de Biologia Universidad Nacio-
nal Autonoma de Mexico. Serie Zoologia 47(2): 43-48.


DISTANT, W. L. 1880-1893. Insecta Rhynchota. Hemi-
ptera-Heteroptera. Vol. 1. Biologia Centrali Ameri-
cana. London: 1-462.
KERZHNER, I. M. 1997. East Palaearctic species of the
genus Artheneis (Heteroptera: Lygaeidae). Zoosys-
tematica Rossica, 6: 213-222
SCUDDER, G. G. E. 1962. The Ischnorhynchinae of the
World (Hemiptera: Lygaeidae). Trans. Royal Ento-
mol. Soc. London. 114(6): 163-194.
SLATER, J. A. 1964. A Catalogue of the Lygaeidae of the
World. Vol. 1 & 2. University of Connecticut, Storrs:
1-1688.
SLATER, J. A., AND BRAILOVSKY, H. 1986. The first occur-
rence of the subfamily Artheneinae in the Western
Hemisphere with the description of a new tribe
(Hemiptera: Lygaeidae). J. New York Entomol. Soc.
94: 409-415.
SLATER, J. A., AND BRAILOVSKY, H. 1989. El genero
Neokleidocerys (Scudder) status nov. y description de
una especie nueva (Hemiptera-Heteroptera : Lyga-
eidae: Ischnorhynchinae). Anales Instituto de Biolo-
gia Universidad Nacional Autonoma de Mexico Ser.
Zool. 59: 181-192.
SLATER, J. A., AND O'DONELL, J. O. 1995. A Catalogue of
the Lygaeidae of the World (1960-1994). New York
Entomol. Soc., New York, U.S.A. 410 pp.








Teng et al.: Bemisia tabaci biotype Q Dominates in China


BEMITSIA TABACI BIOTYPE Q DOMINATES OTHER BIOTYPES ACROSS CHINA


XI TENG FANG-HAO WAN' AND DONG CHU2.
'State Key Laboratory for Biology of Plant Diseases and Insect Pests, Institute of Plant Protection, Chinese
Academy of Agricultural Science, Beijing 100094, China
E-mail for Xi Teng: tengxil23@163.com; Corresponding author; E-mail for Fang-Hao Wan: wanfhn~mail.caas.net.cn

2High-tech Research Center, Shandong Academy of Agricultural Sciences, Jinan 250100, China
E-mail: chinachudong~sina.com

*Contributed equally as first author

ABSTRACT

Bentisia tabaci (Gennadius) biotype Q was first reported as an invasive species in 2005 in
China. The present study is the first with this serious pest to determine the distribution and
proportion with B. tabaci Q-SCAR (sequence characterized amplified region) marker, and to
identify the distribution of the biotype Q through extensive survey and systematic sampling
in most regions of China. We made 22 collections from 15 provinces in Sep-Oct, 2007. The re-
sults showed that B. tabaci biotype Q was found in 19 collections from Shangdong, Gansu,
Shaanxi, Guangxi, Zhejiang, Guizhou, Tianjin, Shanxi, Hunan, Henan, Hubei, Jiangsu, and
Hainan provinces. The proportion (%) of B. tabaci biotype Q occurrence varied from 6.4% to
95.2% in these 19 collections, and it dominated (>50%) in 10 collections. The genetic diver-
gence analysis based on mitochondrial cytochronze oxidase I (mtCOI) gene revealed that Q-
SCAR marker was specific to biotype Q, and the non-Q biotypes mainly consisted of biotype
B. The present results revealed that the biotype Q has become dominant across the country,
and suggested that the displacement of non-Q biotypes by biotype Q has occurred in many
regions. Furthermore, the introduction of the biotype Q might has mainly occurred through
human activities rather than natural sources.

Key Words: biological invasion, Bentisia tabaci biotype Q, displacement, mitochondrial cyto-
chrome oxidase I, systematic survey, China

RESUME

El biotipo Q de Bentisia tabaci (Gennadius) fue reportado por primera vez como una especie
invasora en 2005 en China. E1 present studio es el primero de esta seria plaga para deter-
minar su distribuci6n y proporci6n con el marcador, B. tabaci Q-SCAR (region amplificada
caracterizada por la sequencia [RACS]), y para identificar la distribuci6n del biotipo Q con
una evaluaci6n extensive y muestreo sistemitico de la mayorfa de las regions de China. Hi-
cimos 22 colecciones en 15 provincias en septiembre y octubre del 2007. Los resultados mos-
traron que el biotipo Q de B. tabaci fue encontrado en 19 de las colecciones de las provincias:
Shangdong, Gansu, Shaanxi, Guangxi, Zhejiang, Guizhou, Tianjin, Shanxi, Hunan, Henan,
Hubei, Jiangsu, y Hainan. La proporcion (%) de la ocurencia del biotipo B de B. tabaci varia
de 6.4% a 95.2% en estas 19 colecciones, y fue el biotipo dominant (>50%) en 10 colecciones.
El andlisis de divergencia geni~tica basado en la subunidad I del gen citocromo oxidase del
ADN mitocondrial (mtCOI) revel6 que el marcador Q-RACS fue especifico para el biotipo Q,
y los biotipos no Q consistieron principalmente de biotipo B. Los resultados revelaron que el
biotipo Q ahora es el biotipo dominant en todo el pais, y sugiere que el desplazamiento de
los biotipos no-Q por el biotipo Q ha sucedido en varias regions. Ademas, la introduci6n de
biotipo Q ha sucedido por actividades humans y no por fuentes naturales.



The sweet potato whitefly, Bemisia tabaci host plant species (Muniz et al. 2000; Nombela et
(Gennadius), is a serious pest of agricultural al. 2001). Biotype Q may have originated in the
crops worldwide (Jones 2003). This species com- Mediterranean/North Africa based on phyloge-
plex includes many biotypes such as A, B, Q and netic analysis (Boykin et al. 2007). It was first re-
Ms (Perring 2001), which can be morphologically corded in the Iberian Peninsula (Guirao et al.
indistinguishable (Liu et al. 2007). Biotype B is 1997; Moya et al. 2001) and is now reported from
one of the most invasive biotypes that has caused many non-Mediterranean countries (Chu et al.
serious economic losses. Biotype Q, another inva- 2006; Ueda & Brown 2006; Brown 2007).
sive biotype, has caused even greater damage, In China, B. tabaci has become a serious eco-
and is more adaptable than biotype B on some nomic pest of many agricultural crops, and has







Florida Entomologist 93(3)


September 2010


been found in 22 provinces of the country, where it
has shown high tendencies of spreading and inva-
sion (Wan et al. 2005; Ma et al. 2007). Based on
molecular markers, biotype B occurred in most
provinces of China before 2004 (Qiu et al. 2007).
Phylogenetic analysis based on mtCOI showed
that the non-B biotype collected in Guangdong,
Hubei, Hunan, Taiwan, Jiangsu, and Chongqing
during 2001-2004 was the indigenous whitefly in
China (Qiu et al. 2007). In 2005, biotype Q was
first reported based on the mtCOI marker in Kun-
ming of Yunan Province in China (Chu et al.
2005), and later reported from Beijing, Henan,
and Shandong Provinces (Chu et al. 2006, 2007).
Recently, researchers reported that biotype Q has
better survival than biotype B due to its higher
tolerance to extreme temperature and greater re-
sistance to insecticides (Horowitz et al. 2005;
Bonato et al. 2007). Thus, biotype Q probably pos-
sesses greater potential to expand rapidly to
other regions and result in severe ecological and
economic damage to the country.
Little work has been done so far on the preva-
lence and abundance of biotype Q under field con-
ditions throughout China after it was first discov-
ered in Yunnan Province (Chu et al. 2005). Our
objectives were to determine the current distribu-
tion and proportion of biotype Q in China.

MATERIALS AND METHODs

Survey and Systematic Sampling of B. tabaci

Twenty-two collections of B. tabaci were made
from host plants in 216 villages of 53 counties in
15 provinces of China in Sep-Oct 2007. In each of
the collections, 25 plots of various crops were
sampled, with plots being at least 2 kilometers
apart. The pest was sampled by the five-spot-sam-
pling method in each plot. The samples were pre-
served in 100% ethanol and stored at -20oC until
DNA extraction. There were at least 100 B. tabaci
individuals in each collection and one-fourth of
the individuals from each collection were ran-
domly selected for the biotype determination.

DNA Extraction and Determination ofB. tabaci Biotype Q

Bemisia tabaci adults were placed in 1.5-ml
tubes and crushed singly with a pin in 20 p-L ex-
traction buffer (50 mM Tris-HC1, 400 mM NaC1,
20 mM EDTA, 1% SDS). The mixture was incu-
bated at 60oC for 1h after addition of 5 pL protein-
ase K (20 mg/mL). NaC1 (80 pL of 5 M) was added
and the preparation was shaken for 15 s. After
centrifugation at 14,000 rpm for 10 min, the su-
pernatant was mixed with an equal volume of ice-
cold 100% ethanol. After incubation at -20oC for
50 min, the mixture was centrifuged at 14,000
rpm for 10 min. The DNA was washed with 75%


ethanol. Finally, the dried DNA was dissolved in
20 p-L ddHO and stored at -20oC.
The Q-SCAR (sequence characterized ampli-
fied region) marker, which has proven specific and
effective for identification of biotype Q, was used
for identification of the B. tabaci biotype Q
(patent application number in China is
200910083559.4). The marker has been proved to
effectively differentiate the Q biotype and other
biotypes (includes ZHJ-1, ZHJ-2, B) in China. A
total of 1439 individuals were used for biotype
identification with the Q-SCAR marker, and
among them 145 individuals from the 22 collec-
tions were re-identified based on mtCOI se-
quences (~840 bp) amplified with the primers C1-
J-219 5 (5'-TTGA TTTTTTTTTTTGGTCATC CA-
GAAGT-3') and L2-N-3014 (5'-TCCAATGCACT
AATCTGCCATATTA-3') (Simon et al. 1994).
From each collection, at least 4 individuals were
used to obtain the mtCOI fragments. The 20 uL-
PCR reaction mixture of the mtCOI fragments
contained 2 uL buffer, 1 U Taq polymerase, 2 mM
Mg2', 2 mM dNTP, 10 mM forward primer and re-
verse primers, and 50 ng DNA templates. PCR re-
action was conducted in a PTC-200 PCR machine.
The amplification conditions were as follows: ini-
tially 94oC for 4 min, followed by 38 cycles (94og
for 1 min, 50oC for 1 min, 72oC for 1 min), and a
final extension at 72oC for 5 min. The products
were stored at 4oC until DNA sequencing was car-
ried out.

MtCO1 Sequencing and Genetic Divergence Analysis

The PCR products were separated on 1.0%
agarose gel. The bands were visualized by ethid-
ium bromide staining and the PCR products were
purified with a kit (OMEGA BIO-TEK) according
to the manufacturer's instructions. The DNA se-
quences were directly determined from a purified
PCR product. The sequence for each PCR product
was determined from the 5'end at the Sangon
Technology Company, Shanghai, and submitted
to GenBank.
All of the 145 sequences of partial mtCOI gene
from the 22 collections were used to perform ge-
netic divergence analysis. All sequences were
aligned with Clustal W (Thompson et al. 1994)
and the ends trimmed. All sequences were
checked for the gaps, idels, numts, and pseudo-
genes. The sequences which have no the gaps,
idels, or numts were compared against the con-
sensus sequences for Mediterranean clade ac-
cording to the methods of Dinsdale et al. (2010).
The Q sequences were to have Mediterranean as
their best match. Each unknown sequence was
associated to the consensus sequence with which
it had the lowest divergence match difference. In
addition, we used the Bayesian Inference (BI) in
PAUP* 4.0b10 (Swofford 2000) to analyze the
phylogenetic relationship of the sequences.















































TABLE 1. PERCENTAGE OF BIOTYPE Q AMONG THE DIFFERENT B. TABACI COLLECTIONS IN 2007.

Code Location Number of individuals Number of biotype Q Percentage biotype Q

1 Tulufan, Xinjiang 56 0 0.0
2 Langfang, Hebei 53 0 0.0
3 Chengde, Hebei 63 0 0.0
4 Jiuquan, Gansu 80 6 7.5
5 Baoji, Shaanxi 78 7 9.0
6 Taian, Shandong 78 5 6.4
7 Guilin, Guangxi 85 21 24.7
8 Nanning, Guangxi 83 10 12.0
9 Tianjin 59 27 45.8
10 Laiyang, Shandong 55 20 36.4
11 Ningbo, Zhejiang 76 24 31.6
12 Guiyang, Guizhou 30 13 43.3
13 Yuncheng, Shanxi 80 49 61.3
14 Xinxiang, Henan 61 56 91.8
15 Xiangfan, Hubei 84 80 95.2
16 Yangzhou, Jiangsu 47 43 91.5
17 Hangzhou, Zhejiang 58 49 84.5
18 Wuhan, Hubei 49 45 91.8
19 Jingzhou, Hubei 67 61 91.0
20 Yueyang, Hunan 49 40 81.6
21 Xiangtan, Hunan 66 61 92.4
22 Sanya, Hainan 79 75 94.9

Total 1439 692 48.2 (mean)


Teng et al.: Bemisia tabaci biotype Q Dominates in China


RESULTs

Geographic Distribution of B. tabaci Biotype Q

Biotype Q was found in 19 collections by the
SCAR marker from Jingzhou, Xiangfan, and Wu-
han (Hubei Province), Laiyang and Taian (Shan-
dong Province), Sanya (Hainan Province), Guilin
and Nanning (Guangxi Autonomous Region),
Guiyang (Guizhou Province), Hangzhou and
Ningbo (Zhejiang Province), Xiangtan and Yuey-
ang (Hunan Province), Yangzhou (Jiangsu Prov-
ince), Xinxiang (Henan Province), Baoji (Shaanxi
Province), Jiuquan (Gansu Province), Yuncheng
(Shanxi Province) and Tianjin (Table 1 and
Fig. 1). Biotype Q was not found in 3 collections
from Langfang and Chengde (Hebei Province)
and Tulufan (Xinjiang Province).

Genetic Divergence Analysis Based on MtCO1 and Bio-
type Determination

A fragment of partial mtCOI gene (about 680
bases) from 145 B. tabaci individuals was se-
quenced and the representative sequences of the
collections were deposited in the Gene Bank (ac-
cession numbers: FJ375346-FJ375358,
FJ594428-FJ594434, and FJ647195-FJ647217).
In the present study, gaps, idels, and numts were
not found in these sequences, and all sequences


should not be pesudogenes. Forty-nine sequences
were identified as biotype Q because the genetic
divergence between these sequences and the con-
sensus sequences within the Mediterranean clade
(Dinsdale et al. 2010) was close to zero. Ninety-
two sequences (non-Q biotype based on SCAR)
were determined as biotype B because the genetic
divergence between these sequences and the con-
sensus sequences within the Middle East-Asia
Minor 1 clade (Dinsdale et al. 2010) was close to
zero. Four sequences (non-Q biotype based on
SCAR) were non-B/Q biotype, which might be in-
digenous haplotypes in China (tree not shown).
These results were consistent with the ones based
on the SCAR marker.

Proportion of Biotype Q in the B. tabaci Biotypes

Biotype Q was found in 19 collections made
from across the country ranging from 6.4% (Ta-
ian, Shandong Province) to 95.2% (Xiangfan,
Hubei Province) occurrence (Table 1 and Fig. 1).
Biotype Q dominated (>50%) the other biotypes in
10 collections from Yuncheng (Shanxi Province),
Yueyang and Xiangtan (Hunan Province), Hang-
zhou (Zhejiang Province), Xinxiang (Henan Prov-
ince), Jingzhou, Xiangfan, and Wuhan (Hubei
Province), and Yangzhou (Jiangsu Province),
Sanya (Hainan Province), while it ranged from
30%-50% in the other 4 collections, i.e., Ningbo







Florida Entomologist 93(3)


September 2010


Fig. 1. Distribution and proportion of B. tabaci biotype Q in China in 2007. The codes for each sample are as in
Table 1. Circles 1, 2, and 3 indicate no biotype Q; Circles 4-8 indicate less than 30% biotype Q; Circles 9-12 indicate
between 30% and 50% of biotype Q; and Circles 13-22 indicate more than 50% biotype Q.


(Zhejiang Province), Laiyang (Shandong Prov-
ince), Guiyang (Guizhou Province), and Tianjin.
The proportion of biotype Q was below 30% in
only 5 collections, i.e., Taian (Shandong Province),
Jiuquan (Gansu Province), Baoji (Shaanxi Prov-
ince), and Nanning and Guilin (Guangxi Autono-
mous Region).

DIscussioN

Biotype Q has greater survival ability than
biotype B under low as well as high temperature
conditions (Bonato et al. 2007), and has shown
greater resistance to neonicotinoides and py-
riproxyfen insecticides than biotype B (Horowitz
et al. 2005), perhaps contributing to the displace-
ment of biotype B by Q (Pascual 2006). Biotype Q
has successfully invaded and dominated (>50%)
the other B. tabaci biotypes in most of the south-
eastern provinces of China, and is distributed in
several under-developed western provinces. Bio-
type Q was not found in Langfang and Chengde
(Hebei Province), but detected in the collections
from Beijing and Tianjin. Our samples may not be
large enough to thoroughly cover these regions.


Our data suggest that more than 1 factor is re-
sponsible for the current distribution and high
proportion of the biotype Q in China. Further-
more, transportation and human activities in the
developed south-eastern provinces of the country
are more than in the under-developed western
provinces, and these factors might have affected
the introduction, spread, and abundance of the
biotype Q in these provinces.
Our study provided evidence that the 2 bio-
types B and Q prevailed in the same collections.
Based on mtCOI sequencing, biotype Q was de-
tected in 19 collections in which biotype B was
also found. The co-existence of biotypes B and Q
has also been detected in other countries, e.g.,
Spain (Guirao et al. 1997), Japan (Ueda & Brown
2006) and Southern France (Dalmon et al. 2008).
In USA, biotype B has displaced the previously
established biotype A (Brown et al. 1995). In
Spain, biotype B could not displace the estab-
lished biotype Q, which might be due to the
greater insecticide resistance of the latter biotype
(Pascual 2006). During 2005-2008, the displace-
ment of biotype B by Q in several regions of the
Shandong Province was observed (Chu et al.








Teng et al.: Bemisia tabaci biotype Q Dominates in China


2010). For example, in 2005, biotype Q comprised
zero of the B. tabaci population on cotton in Jinan
of Shandong Province. In 2006, biotype Q com-
prised 15.2% of the B. tabaci population on cotton.
In 2007, biotype Q comprised 60.9% of the B.
tabaci population on cotton and finally, in 2008,
biotype Q comprised 96.7% of the B. tabaci popu-
lation on cotton. Similar results have been ob-
served in other regions (Chu et al. 2010). Based
on the results of the present study, it was as-
sumed that partial displacement of biotype B by
biotype Q has occurred in many regions of the
country. There is a high probability that biotype
Q, due to its greater tolerance to extreme temper-
ature and resistance to insecticides, will continue
to spread, displace, and dominate biotype B and
other indigenous biotypes in other regions of the
country. In the displacement of biotype B by Q,
the application of insecticides in the main agricul-
tural cropping systems of the country might play
an important role. The present results might help
understand the displacement mechanism of the
B. tabaci biotypes and provide a theoretical basis
for prophylaxis and control of this invasive pest in
China.


ACKNOWLEDGMENTS

We thank Dr. Dan L. Johnson (Professor of Environ-
mental Science, Canada Research Chair in Sustainable
Grassland Fo~s tems) and r. Im tia 1 hannivDe

sity Peshawar, NWFP, Pakistan) for reviewing and
SdtIn Oh orgnol mau rilt ei r hoandk Dr .De Iar
Qld 4068, Australia) for providing the consensus se-
quences in the genetic divergence analysis. This work
was fun ed by t Key Poject of Chinese N tina Pro-

(2009CB119200), Key Program of National Natural Sci-
ence Foundation of China (30930062) and Outstanding
Youth Science Foundation of Shandong Province
(JQ200811).

REFERENCES CITED

BONATO, O., LURETIE, A., VIDAL, C., AND FARGUEs, J.
2007. Modelling temperature-dependent bionomics
of Bemisia tabaci (Q biotype). Physiol. Entomol. 32:
50-55.
BOYKIN, L. M., SHATTERS, R. G., ROSELL, R. C., McKEN-
ZIE, C. L., BAGNALL, R. A., DE BARRO, P. J., AND
FROHLICH, D. R. 2007. Global relationships of Bemi-
sia tabaci (Hemiptera: Aleyrodidae. revealed using
Bayesian analysis of mitochondrial COI DNA se-
quences. Mol. Phyl. Evol. 144: 1306-1319.
BRowN, J. K. 2007. The Bemisia tabaci complex: genetic
and phenotypic variability drives begomovirus
spread and virus diversification. http: //www.aps-
net.org/ online/feature/ btabaci/.
BRowN, J. K., FROHLICH, D. R., AND ROSELL, R. C. 1995.
The sweet potato or silver leaf whiteflies: biotypes of
Bemisia tabaci or a species complex? Annu. Rev. En-
tomol. 40: 511-534.


CHU, D., JIANG, T., LIU, G. X., JIANG, D. F., TAO, Y. L.,
FAN, Z. X., ZHOU, H. X., AND BI, Y. P. 2007. Biotype
status and distribution of Bemisia tabaci (Hemi-
ptera: Aleyrodidae. in Shandong Province of China
boae 03n mi ochan~drial DNA markers. Environ. En-
CHU, D., WAN, F. H., ZHANG, Y. J., AND BROWN, J. K.
2010. Change in the biotype composition of Bemisia
tabaci in Shandong Province of China from 2005 to
2008. Environ. Entomol. 39(3). DOI: 10.1603/
ENO9161.
CHU, D., ZHANG, Y. J., BRowN, J. K., CONG, B., XU, B.
Y., WU, Q. J., AND ZHU, G. R. 2006. The introduction
of the exotic Q biotype ofBemisia tabaci (Gennadius)
from the Mediterranean region into China on orna-
mental crops. Florida Entomol. 89: 168-174.
CHU, D., ZHANG, Y. J., CONG, B., XU, B. Y., AND WU, Q.
J. 2005. Identification for Yunan Q-biotype Bemisia
tabaci population. Entomological Knowledge 42: 59-
62. (in Chinese)
DALMON, A., HALKETT, F., GRANIER, M., DELATTE, H.,
AND PETERSCHMITT, M. 2008. Genetic structure of
the invasive pest Bemisia tabaci: evidence of limited
but persistent genetic differentiation in glasshouse

DINSoDpAull d. yOK 1. 2IINS C.UCKLEY, Y., AND
DE BARRO, P. J. 2010. Refined global analysis of Be-
misia tabaci (Hemiptera: Sternorrhyncha: Aleyro-
doidea: Aleyrodidae) mitochondrial cytochrome oxi-
dase 1 to identify species level genetic boundaries.
Ann. Entomol. Soc. America 103(2). DOI: 10.1603/
ANO9061
HORowITZ, A. R., KONTSEDALOV, S., KHASDAN, V., AND
ISHAAYA, I. 2005. Biotypes B and Q of Bemisia tabaci
annd thseiir relevanc to neonicoB noidmnd pr proxy
216-225.
JoNES D. 2003 Pant virue trans12teld by whiteflies.

LIU, S. S., DE BARRO, P. J., XU, J., LUAN, J. B., ZANG, L.
S., RUAN, Y. M., AND WAN, F. H. 2007. Asymmetric
m ginginte actions dt ve wic spread ddnvasi70n and

MA, D. Y., GORMAN, K., DEVINE, G., LUo, W. C., AND
DENHOLM, I. 2007.The biotype and insecticide-resis-
tance status of whiteflies, Bemisia tabaci (Hemi-
ptera: Aleyrodidae), invading cropping systems in
Xinjiang Uygur Autonomous Region, northwestern
China. Crop Protection 26: 612-617.
MOYA, A., GUIRAO, P., CIFUENTEs, D., BEITIA, F., AND
CENIs, J. L. 2001. Genetic diversity of Iberian popu-
lations of Bemisia tabaci (Hemiptera: Aleyrodidae)
based on random amplified polymorphic DNA-poly-
merase chain reaction. Mol. Ecol. 10: 891-897.
MUNIZ, M. 2000. Host suitability of two biotypes of Be-
misia tabaci on some common weeds. Ent. Exp. et
Apple. 95: 63-70.
NOMBELA, G., BEITIA, F., AND MUNIZ, M. 2001. A differ-
ential interaction study of Bemisia tabaci Q-biotype
on commercial tomato varieties with or without the
Mi resistance gene, and comparative host responses
with the B-biotype. Ent. Exp. et Appl. 3: 339-344.
PASCUAL, S. 2006. Mechanisms in competition, under
laboratory conditions, between Spanish biotypes B
and Q of Bemisia tabaci (Gennadius). Spanish J. Agr.
Res. 4: 351-354.
PERRING, T. M. 2001. The Bemisia tabaci species com-
plex. Crop Prot. 20: 725-737.








368 Florida Ento



QIU, B. L., COATs, S. A., REN, S. X., IDRIs, A. M., XU, C.
X., AND BROWN, J. K. 2007. Phylogenetic relation-
ships of native and introduced Bemisia tabaci (Ho-
moptera: Aleyrodidae) from China and India based
on mtCOI DNA sequencing and host plant compari-
sons. Prog. Nat. Sci. 17(6): 645-654.
SIMON, C., FRATI, F., BECKE~NBACH, A., CRESPI, B., LIU,
H., AND FLOOK, P. 1994. Evolution, weighting, and
phylogenetic utility of mitochondrial gene sequences
and a compilation of conserved polymerase chain reac-
tion primers. Ann. Entomol. Soc. America 6: 651-701.
SWOFFORD, D. L. 2000. PAUP*: Phylogenetic analysis
using parsimony (*and other methods), Ver. 4.
Sinauer, Sunderland, MA.


m7


lologist 93(3) September 2010



THOMPSON, J. D., HIGGINs, D. G., AND GIBSON, T. J.
1994. CLUSTAL W: Improving the sensitivity of
progressive multiple sequence alignment through
sequence weighting, position specific gap penalties
and weight matrix choice. Nucl. Acid Res. 22:
4673-4680.
UEDA, S., AND BROWN, J. K. 2006. First report of the Q
biotype of Bemisia tabaci in Japan by mitochondrial
oxidase I sequence analysis. Phytoparasitica 34:
405-411.
WAN, F. H., ZHENG, X. B., AND GUo, J. Y. 2005. Biology
and Management of Invasive Alien Species in Agri-
culture and Forestry. Science Press, Beijing, China.
71 pp.








Zhang et al.: Molecular Phylogeny of Bactrocera species


MOLECULAR PHYLOGENY OF BACTROCERA SPECIES (DIPTERA:
TEPHRITIDAE: DACINI) INFERRED FROM MITOCHONDRIAL SEQUENCES
OF 16S rDNA AND COI SEQUENCES


BIN ZHANG YING HONG LIU ',3 WAN XUAN WU AND ZE LE WANG2
1Chongqing Key Laboratory of Entomology and Insect Control Engineering, College of Plant Protection,
Southwest University, Chongqing, China

2Chongqing Agriculture Technique Extension Station, Chongqing, China
3Corresponding author; E-mail: yhliu~swu.edu.cn

ABSTRACT

Many fruit flies in the genus Bactrocera (Diptera: Tephritidae: Dacini) are economically impor-
tant insects. However, little attention has been given to the molecular phylogenetic relationship
among Bactrocera subgenera. We explored the phylogenetic relationship among the 8 subgen-
era Afrodacus, Austrodacus, Bactrocera, Daculus, Gynznodacus, Paratridacus, Tetradacus, and
Zeugodacus based on the sequences of 2 mitochondrial DNA fragments with a combined length
of 1034 base pairs. The 2 mtDNA fragments are a 689-bp segment of the COI gene and a 345-
bp segment of the 16S rDNA gene. Thilty-five individuals representing 7 Bactrocera species
found in the Chongqing region in China were sequenced for both fragments, and sequences of
the same gene regions were acquired from GenBank for another 20 Bactrocera species and 2
other tephritid species, Anastrepha ludens and Ceratitis capitata, which were used as out-
groups for the phylogenetic analyses. We reported Bactrocera (Tetradacus) nzinax and Bactro-
cera (Zeugodacus) diaphora sequences for the first time, and the subgenus Bactrocera
(Tetradacus), here represented by B. (TI) nzinax and B. (TI) tsuneonis, was included for the first
time in an analysis of the genus Bactrocera phylogeny. Results of our analyses showed within-
subgenus nucleotide diversity ranged from 9.1 to 19.0% among the subgenera, and the net di-
vergence among sub genera ranged from 4.6 to 12.7%. Results of phylogenetic analyses based on
maximum parsimony method supported that sub genus Bactrocera (Bactrocera) and Bactrocera
(Zeugodacus) are paraphyletic. The subgenus Zeugodacus, Bactrocera (Zeugodacus) caudate,
Bactrocera (Zeugodacus) diaphora, and Bactrocera (Zeugodacus) scutellata are closely related
to Bactrocera (Zeugodacus) tau and Bactrocera (Zeugodacus) cucurbitae. This results indicated
that subgenus Austrodacus and Zeugodacus, which attack cucurbit plants, are closely related
to species of the sub genus Afrodacus, Bactrocera, and Gynznodacus, which attack plants of nu-
merous families. In addition, subgenus Paratridacus is a sister group to subgenus Tetradacus,
and 7 species of the Bactrocera (Bactrocera) dorsalis complex (as defined by Drew & Hancock
1994) included in this study formed a monophyletic clade. Subgenus Daculus is 11ineage by it-
self, which does not fall into the Bactrocera group or Zeugodacus group.

Key Words: Bactrocera spp., 16s rDNA, COI, mitochondrial DNA, molecular phylogeny

RESUME

Muchas moscas de la fruta en el gi~nero Bactrocera (Diptera: Tephritidae: Dacini) son insec-
tos economicamente importante. Sin embargo, se han puesto poca atenci6n en cuanto de la
relaci6n filogeni~tica molecular entire los subgi~neros de Bactrocera. Exploramos la relaci6n
filogeni~tica entire los 8 subgi~neros Afrodacus, Austrodacus, Bactrocera, Daculus, Gynznoda-
cus, Paratridacus, Tetradacus, y Zeugodacus basado en las secuencias de 2 fragments de
ADN mitocondrial con un longitud combinado total de 1034 pares de bases. Los 2 fragments
de mtADN son un segment de 689-pb del gene COl y un segment de 345-pb de gene 16S
rADN. Se secuenciaron treinta y cinco individuos representando 7 species de Bactrocera en-
contrados en la regi6n de Chongqing en China para ambos fragments, y secuencias de las
mismas regions de los genes fueron adquiridas del GenBank para otras 20 species de Bac-
trocera y otras 2 species de tefritidos, Anastrepha ludens y Ceratitis capitata, que fueron
usadas como grupos externos para el andlisis filogen~tico. Reportamos las secuencias de
Bactrocera (Tetradacus) nzinax y Bactrocera (Zeugodacus) diaphora por la primera vez, y el
subgi~nero Bactrocera (Tetradacus), aqui representado por B. (TI) nzinax y B. (TI) tsuneonis,
fueron incluidos por la primera vez en el andlisis de la filogenia del gi~nero Bactrocera. Los
resultados de nuestro andlisis mostraron una diversidad de 9,1 a 19.0% entire los nucle6tidos
dentro de los subgi~neros, y una divergencia total entire los subgi~neros de 4.6 a 12.7%. Los
resultados del andlisis filogeni~tico basado en el mi~todo de parsimonia maxima apoyaron que
ambos subgi~neros Bactrocera (Bactrocera) y Bactrocera (Zeugodacus) son parafil~ticos. Los
subgi~neros Zeugodacus, Bactrocera (Zeugodacus) caudate, Bactrocera (Zeugodacus) dia-







Florida Entomologist 93(3)


September 2010


phora y Bactrocera (Zeugodacus) scutellata estan estrechamente relacionados con Bactro-
cera (Zeugodacus) tau y Bactrocera (Zeugodacus) cucurbitae. Estos resultado indican que los
subgi~neros Austrodacus y Zeugodacus, que atacan plants cucurbitas, estan estrechamente
relacionados a las species en los subgi~nerosAfrodacus, Bactrocera, y Gymnodacus, que ata-
can plants en un gran mimero de families. Ademis, el subgi~nero Paratridacus es un grupo
hermano de subgi~nero Tetradacus, y 7 de las species de complejo de Bactrocera (Bactrocera)
dorsalis (definido por Drew & Hancock 1994) incluidas en este studio formaron un grupo
monofili~tico. El subgi~nero Daculus tiene su propio linaje, que no cae dentro de los grupos de
Bactrocera o de Zeugodacus.


The genus Bactrocera (Diptera: Tephritidae:
Dacini) is widespread in Asia and Australia and is
one of the largest genera within Tephritidae with
about 500 described species arranged in 28 sub-
genera (Drew 1989; Drew & Hancock 2000). Sev-
eral Bactrocera species are serious pests of fruits
and vegetables (Allwood et al. 1999; White et al.
1992).
Bactrocera and Dacus are sister taxa which
share the following apomorphies: radial veins
crowded anteriorly and medial cells very broad;
female abdominal tergite 6 separate from pre-
ceeding tergites; and tergite 5 of both sexes with
glandular areas ("ceromae") (Munro 1984). Simi-
lar to many other tephritid genera, classification
and taxonomy of the group is controversial. Taxo-
nomic status of this group has been repeatedly re-
vised since it was first recognized in 1835, (Drew
1972; Hardy 1955, 1976), and its current status
as a genus was established by Drew (1989). Taxo-
nomic positions of related groups have also been
subject to changes. This situation results from
differences in the morphological features used in
the various taxonomic studies, some of which are
quite questionable (Drew 1989; Drew & Hancock
1994; White & Hancock 1997; Drew & Hancock
2000; White 2000). After White (2000) chose 37
morphological characters from 51 economically
important species and quantitatively analyzed
cladisticly Bactrocera species, representing 9
Bactrocera subgenera, he pointed out that inde-
pendent characters, such as DNA sequences,
should play a more important role in rigorous
phylogenetic analyses. Many closely related sib-
ling species are not morphologically distinct. For
example, the B. dorsalis complex presumably in-
cludes more than 60 geographically diverse spe-
cies (Drew & Hancock 1994), the majority of
which were treated as a single species before a re-
visionary report by Drew & Hancock (1994).
Therefore, it is highly desirable to search for more
stable and reliable methods to study the evolu-
tionary relationships among Bactrocera taxa and
use this information to solve the taxonomic place-
ment of the problematic species. Mitochondrial
DNA sequences have been used as common mo-
lecular markers in phylogenetic analyses and
population genetic studies in animals (Boyce et
al. 1994; Langor & Sperling 1997). The advantage
of using mitochondrial genes in evolutionary


study is that mutations that create new haplo-
types are rare. Therefore, 2 individuals that
share the same haplotype are likely to have a
common ancestor (Li 1997). An A+T bias has been
found in most insect mtDNA genes (Lunt et al.
1996; Han & McPheron 1997; Langor & Sperling
1997) and it has been suggested that regions with
high A+T content might be useful for studying
phylogenetic relationships among closely related
insect species (Lunt et al. 1996). The phylogenetic
relationships of some tephritid taxa have been re-
solved with strong support based on mtDNA se-
quence data (Han & McPheron 1997; Han 2000),
especially at the generic level (Smith & Bush
1997).
In the present study, we conducted combined
analyses of 16s rDNA and COI mtDNA sequence
data in order to resolve the phylogenetic relation-
ships of Bactrocera fruit flies. In most cases, com-
bined analyses are more likely to recover a phylo-
genetic tree close or identical to the "true" tree,
because the amount of information available to
infer a phylogenetic tree is maximized (Smith
2002, 2003; Muraji & Nakahara 2001). All the
genes used were mitochondrial, and thus, pre-
sumably share the same evolutionary history. The
approximately 1040-bp long fragment of the
mtDNA contains the 16S rDNA (about 345-bp)
and COI (about 690-bp) (Fig. 1). Both 16s rDNA
and COI sequences of B. (TS) minax and B. (Z. ) di-
aphora are reported for the first time and subge-
nus Tetradacus including B. (TS) minax and B. (TS)
tsuneonis also is introduced into Bactrocera phy-
logenetic analysis for the first time. The results
are discussed in relation to the phylogenetic and
diagnostic utility of the mtDNA fragment, and to
the taxonomic positions of each species included
in this study.

MATERIALS AND METHODS

Collection and Handling of Fruit Flies

A list of analyzed taxa including origin and as-
sociated GenBank accession number is presented
in Table 1. The specimens were collected from dif-
ferent host plants growing in various areas of
Chongqing region from May to Nov 2007. All of
them are Bactrocera species, including Bactrocera
cucurbitae (Coquillett), B. tau (Walker), B. dia-


















About 16K bp.


Zhang et al.: Molecular Phylogeny of Bactrocera species


Around
13310


Around
12965


Fl-RI


2408


3097


Fig 1. The position plot of 16s rDNA and COlgene fragment used in present study.


phora (Hendel), B. caudate (Fabricius), B. scutel-
lata (Hendel), B. dorsalis (Hendel), and B. minax
(Enderlein). Specimens were stored in absolute
ethyl alcohol at -4oC until required for molecular
analysis.

Template Preparation and DNA Manipulation

Total DNA was extracted from individual
fruit fly adults by the crude boiling methods
(O'Neill et al. 1992). Thoracic tissue was homog-
enized with a sterilized pestle in a 1.5-mL micro-
centrifuge tube filled with 100 p-L of STE buffer
(100 mM NaC1, 10 mM Tris-HC1 (pH 8.0)), and 1
mM EDTA (pH 8.0). The homogenate was heated
at 95oC for 10 min before being centrifuged at
4000 rpm for 1 min at room temperature. Two
microliters of supernatant were used as the
DNA template for the polymerase chain reaction
(PCR).
Two different DNA fragments comprising
portions of the 16S rRNA and Cytochrome Oxi-
dase I mitochondrial genes were amplified and
sequenced with the oligonucleotide primers
listed in Table 2. The 16s rDNA primers used in
this study were designed by Simon (1994) and
Muraji (2002). The primers were used to amplify
a 350-bp fragment from 35 individuals of the 7
species noted above. Polymerase chain reaction
(PCR) amplifications were performed in 20 p-L-
volumes. The specific volumes were 5p.L DNA
template, 6.05 p-L dd H,O, 3.75 p-L 10*PCR
buffer, 1.5 pL 25 mM MgCs,, 0.5 p-L dNTPs (10
mM each),1.5 p-L of 20 pM forward and reverse
primers and 1 unit of Taq DNA polymerase
(Promega). The temperature profile for the am-
plification of the gene fragments included an ini-
tial denaturation step of 94oC for 3 min followed
by 35 cycles of 94oC for 45 s, 56oC for 60 s, 72oC
for 90 s, and a final extension step at 72oC for 10


min. A 690-bp long COI fragment was polymer-
ized with the sense primer UEA 7 and the anti-
sense primer UEA 10, both of which were devel-
oped by Lunt et al. (1996). PCR amplification
was done in 20 p-L reaction volume, as follows:
12.5 p-L ddH20, 2 pL 10xPCR buffer (Promega,
Madison, Wis.), 2 p-L of 25 mM MgCl2, 0.5 p-L
dNTP (10 mM each), 0.5 pL of 20 pM forward
and reverse primers, and 1 U Taq DNA poly-
merase (Promega). PCR amplification was done
with initial denaturation at 94oC for 3 min, fol-
lowed by 35 cycles of 94oC for 1 min, 50oC for 1
min, 72oC for 1 min, and final extension step at
72oC for 30 min. Ten microliters of each PCR
product were run on a 1% agarose gel to deter-
mine the presence and size of amplified DNA.
Both strands of the PCR product were sequenced
for all samples. The sequencing of inserts in both
directions was carried out on an ABI 377 auto-
mated sequencer. Sequences of all 7 tephritid
fruit fly species have been deposited in GenBank
under accession Nos. FJ866820-FJ866826 (16s
rDNA) and GQ458042-GQ458048 (COI) (Table
1).

Data Analysis

In addition to mitochondrial 16s rDNA and
COI gene sequences of the 27 Bactrocera species,
16s rDNA and COI sequences of the same region
for Ceratitis capitata anddnastrepha ludens were
used in the analysis as outgroups.
A consensus sequence of 16s rDNA and COI
fragments combined from 1 specimen of each fruit
fly species was constructed by using the SeqMan
program (DNAstar, Lasergene). The sequences
were initially aligned in the Clustal X 1.81 pro-
gram (Thompson et al. 1997) and manually ad-
justed as needed. Nucleotide sequence differences
and the overall transition-transversion ratio


16s rDNA
About 345bp


5'Abu

C0l
Around UA7UE0 Around











TABLE 1. LIST OF TAXA EXAMINED WITH GEOGRAPHIC ORIGIN AND GENBANK ACCESSION NUMBERS.

Species 16s rDNA COI Original region

Bactrocera (Bactrocera) caranzbolae EF0 14414* EF0 14414* NT, OR
Bactrocera (Bactrocera) correct ABO48752* AY530905* OR
Bactrocera (Bactrocera) dorsalis FJ866822 GQ458045 OR, AU
Bactrocera (Bactrocera) latifrons FJ009200* FJ903498* OR, AU
Bactrocera (Bactrocera) nausae ABO74023* AB l92432* AU
Bactrocera (Bactrocera) papayae DQ917578* DQ917578* OR
Bactrocera (Bactrocera) philippinensis DQ995281* DQ995281* OR
Bactrocera (Bactrocera) zonata ABO48757* AB l92445* AF, OR, AU
Bactrocera (Afrodacus) jarvisi ABO74022* AY530904* AU
Bactrocera (Austrodacus) cucunzis ABO74019* AB l92448* AU
Bactrocera (Bactrocera) curvipennis ABO74020* AY530895* AU
Bactrocera (Bactrocera) frauenfeldi ABO74021* AB l92428* AU
Bactrocera (Bactrocera) kandiensis ABO48738* AB l92431* OR
Bactrocera (Bactrocera) occipitalis ABO48742* ABl92435* OR
Bactrocera (Bactrocera) psidii ABO74027* ABl92440* AU
Bactrocera (Bactrocera) tryoni ABO74029* AY530892* AU
Bactrocera (Bactrocera) unabrosa ABO48749* AY530897* OR, AU
Bactrocera (Daculus) oleae AY210702* AY210702* PA, AF, OR
Bactrocera (Gynznodacus) calophylli ABO35109* AB l92419* OR, AU
Bactrocera (Paratridacus) expandens ABO35110* AB l92427* UK
Bactrocera (Tetradacus) nzinax FJ866821 GQ458044 PA, OR
Bactrocera (Tetradacus) tsuneonis DQ419809* AB l92447* PA, OR
Bactrocera (Zeugodacus) caudate FJ866826 GQ458048 PA, OR
Bactrocera (Zeugodacus) diaphora FJ866824 GQ458043 OR
Bactrocera (Zeugodacus) scutellata FJ866825 GQ458046 PA, OR
Bactrocera (Zeugodacus) tau FJ866823 GQ458047 OR
Bactrocera (Zeugodacus) cucurbitae FJ866820 GQ458042 PA, AF, OR, AU
Anastrepha ludens ABO35102* AB l92462* NE, NT
Ceratitis capitata AJ242872* AB l92447* NTPA, AF, AU

*Represent the data is previously published sequence obtained from GenBank.
AF = Afrotropical; AU = Australasian; HO = Holarctic; NE = Ne arctic; NT = Neotropical; OR = Oriental; PA = Pale arctic; and UK
= Unknown.


TABLE 2. OLIGONUCLEOTIDE PRIMERS USED FOR POLYMERASE CHAIN REACTION (PCR) AMPLIFICATIONS.

Name Sequence

(16s rDNA-F) F1 5'-ATCCAACATCGAGGTCGCAAAC-3'
(16s rDNA-R) R1 5'-GGCTGGTATGAAC GGTTGGAC GAG-3'
(CO1-F) UEA-7 5'-TACAGTTGGAATAGAC GTTGATAC -3'
(CO1-R) UEA-10 5'-TC CAATGCACTAATCTGC CATATTA-3'


Florida Entomologist 93(3)


September 2010


among the Bactrocera species were calculated
with MEGA software 4.1. The Jukes-Cantor dis-
tance method was used to calculate nucleotide se-
quence differences. We conducted Maximum Par-
simony (MP) and Neighbour-joining (NJ) analysis
with PAUP* 4.1 and heuristic search procedure
with TBR (tree bisection reconnection) swapping
and 100 maxtree options. The gaps were treated
as missing data. Bootstrap analyses were done
with 1000 replicates.
Jukes-Cantor distance is recommended
when the value is lower than 0.3 (Kumar et al.


1993), Kimura 2-parameter distance was used
when the transition/transversion ratio was
high, and Tamura and Tamura-Nei distances
were used when A + T content bias was obvi-
ously high. In the present study, the number of
nucleotide substitutions per site ranged from
0.09 to 0.18, overall transition (ti)/transversion
(ty) ratio was 1.451 and A + T content occupied
68.1%. We chose all 3 methods and we found
similar result. In the present study, we use the
result by Jukes-Cantor to generate Neighbour-
joining tree.































































TABLE 3. NUCLEOTIDE SEQUENCE DIFFERENCES OF THE COMBINED DATA SETS BY 18S RDNA AND CYTOCHROME OXI-
DASE I GENE BASED ON THE JUKES-CANTOR DISTANCE METHOD.

Subgena 1 2 3 4 5 6 7 8

Bactrocera
Afrodacus 0.091
Gymnodacus 0.101 0.121
Zeug-odacus 0.122 0.127 0.154
Austrodacus 0.126 0.122 0.155 0.092
Daculus 0.120 0.127 0.138 0.125 0.131
Paratridacus 0.135 0.141 0.142 0.153 0.157 0.143
Tetradacus 0.168 0.177 0.190 0.176 0.183 0.178 0.178


Zhang et al.: Molecular Phylogeny of Bactrocera species


RESULTS

Characterization of the Nucleotide Data

Through MEGA 4.1, a total of about 1,049 bp
nucleotide sequences of the 16s rDNA and COI
combined genes among the genus Bactrocera
were employed in the analyses. The overall mean
sequence divergence among the Bactrocera spe-
cies was 11.0%. Between different subgenera, the
highest nucleotide sequence divergence was
found between Tetradacus and Gymnodacus
(18.1%) and the lowest between Bactrocera and
Afrodacus, Zeugodacus and Austrodacus (9.0%).
(Table 3)
The nucleotide frequencies are 0.336 (A), 0.345
(T), 0.194 (C), and 0.124 (G). The base composi-
tion of the 2 mitochondrial gene fragments was
biased toward adenine (A) and thymine (T), which
together constituted an estimated 68.1% of the to-
tal. The overall transition (ti)/transversion (ty)
ratio was 1.451. Among transitions, 18.36% were
A-G transitions and 49.8% were C-T transitions.
The estimated relative proportions of the 8 types
of transversions were: A-T; 10.85%; A-C; 8.44%;
G-T; 7.48%; and G-C; 5.07%. Summary statistics
for the different substitutional changes are
shown in Table 4.
Amino acids varied at 83 locations across the
347 amino acid sequences of the segment of 16s
rDNA and COI among the 27 Bactrocera species.
Within the subgenus Bactrocera, 46 amino acid
variation sites were found, and fewer amino acid
variation sites (17 sites) were found within the
subgenus Zeugodacus.

Phylogenetic Analyses

In the 1,049 characters including two out
groups, 350 (33.4%) were variable, and 283
(27.0%) were parsimony informative. The charac-
ter statistics and results of parsimony analysis
are shown in Table 5. The consensus tree gener-
ated by Maximum parsimony indicated the fol-
lowing relationships: (1) subgenus Bactrocera is


paraphyletic, (2) subgenus Zeugodacus is para-
phyletic, (3) subgenus Paratridacus is a sister
group to subgenus Tetradacus, (4) subgenus Dac-
ulus, represented here by Bactrocera (Daculus)
oleae show different classification positions in NJ
and MP phylogennetic trees (Fig. 2 and Fig. 3),
but subgenus Daculus is 1 lineage by itself, (5)
subgenus Austrodacus and Zeugodacus were
closely related to the subgenusAfrodacus, Bactro-
cera, and Gymnodacus, and (6) seven species of
the B.(B.) dorsalis complex (as defined by Drew &
Hancock 1994) included in this study form a
monophyletic clade (Fig. 2 and Fig. 3).

DIscussION

Some researchers have proposed a phyloge-
netic analysis of the Bactrocera subgenera group-
ings based on morphological characters (Drew
1989; Drew & Hancock 2000; White 2000). Ac-
cording to Drew (1989), the subgenera of Bactro-
cera were divided into 4 groups, the Bactrocera
group, Queenslandacus group, Zeugodacus group,
and Melanodacus group. In the present study, the
subgenera Afrodacus, Tetradacus, and Gymnoda-
cus are placed in the Bactrocera group and the
subgenus Austrodacus in the Zeugodacus group.
This agrees with the classification by Drew
(1989). However, subgenus Paratridacus is lo-
cated within the Bactrocera group in our study,
and this differs from Drew (1989), who classified
Paratridacus in the Zeugodacus group. Muraji &
Nakahara (2001) used mitochondrial DNA se-
quences from 18 Bactrocera species in 4 subgen-
era to investigate the evaluation of Bactrocera,
and their study supported our result that subge-
nus Paratridacus should not be in the Zeugodacus
group but in the Bactrocera group. Drew's (1989)
classification was not based on cladistic principles
but only on the shape of male sternite 5 and
length of male surstylus lobe. We suggest that
Paratridacus should be put in the Bactrocera
group of subgenera.
The subgenus Daculus, represented here by B.
(D.) oleae, shows different classification positions











TABLE 4. MAXIMUM COMPOSITE LIKELIHOOD ESTIMATE
OF THE PATTERN OF NUCLEOTIDE SUBSTITU-
TION FROst 27 BACTROCERA SPECIES.

A T C G

A 5.5 .7.09 4.96
T 5..75 17.93 1.98
C 5..75 31.87 1.98
G 13.4 5.5 .7.09

Each entry shows the probability of substitution from one
base (row) to another base (column) instantaneously. Only en-
tries within a row should be compared. Rates of different tran-
sitional substitutions are shown in bold and those of
transversional substitutions are shown in italics.



in NJ and MP phylogennetic trees. According to
Drew (1989), B. (D.) oleae belongs to the Melano-
dacus group, and never falls into the Bactrocera
group or Zeugodacus group. Smith et al. (2003),
however, indicated that B. (D.) oleae fell within
the Bactrocera group.
The question whether subgenus Bactrocera is
monophyletic or paraphyletic has been debated.
White (2000) chose 37 morphological characters
from 51 economically important species to quan-
titatively analyze cladisticly genus Bactrocera
species, which represented 9 Bactrocera subgen-
era. White's (2000) study indicated that B. (Bac-
trocera) is paraphyletic in both unweighted and
weighted analyses, and based on DNA sequences
data, Muraji & Nakahara (2001) also proposed
that subgenus Bactrocera was paraphyletic. How-
ever, Smith et al. (2003) reported that subgenus
Bactrocera was monophyletic. Drew (1989) re-
ported that there were various characters in the
presence of a medial postsutural vitta and the ab-
sence of a prescutellar bristle among species be-
longing to subgenus Bactrocera. Absence of a
prescutellar bristle was an important diagnostic
character to discriminate among genera of Bac-
trocera and may be a reason for the debate
whether subgenus Bactrocera is monophyletic or
paraphyletic. Both NJ trees and MP phylogenetic
trees in this study indicated subgenus B. (Bactro-
cera) is paraphyletic because both sub genus Gyn-


TABLE 5. SUMMARY OF CHARACTER STATISTICS AND RESULTS OF PARSHIONY ANALYSIS OF DATA FROst 27 BACTROCERA
SPECIES.

Characters Characters Variable
Data partition (including gaps) constant sites PIC TL CI HI RI RCI

16S 352 265 87 53 206 0.54 0.46 0.61 0.33
CO1 698 429 271 228 1095 0.37 0.63 0.50 0.19
16S+CO1 1049 699 350 283 1311 0.39 0.61 0.50 0.20

PIC, number of parsimony informative characters; TL, most parsimonious tree length; EPT, number of equally parsimonious
trees; CI, consistency index; HI, homoplasy index; RI, retention index; RCI, rescaled consistency index.


Florida Entomologist 93(3)


September 2010


nodacus and subgenus Afrodacus locate within
the clade of subgenus Bactrocera. Further analy-
ses must be conducted to examine phylogenetic
classification of subgenus Bactrocera.
Our study demonstrated subgenus Zeugoda-
cus is paraphyletic, and is based on the result
that subgenus Austrodacus is located within the
clade of subgenus Zeugodacus. This result is sup-
ported by Smith et al. (2003), who proposed that
subgenus Zeugodacus is paraphyletic. However,
Muraji & Nakahara (2001) believed that the sub-
genus Zeugodacus is a monophyletic clade, but
they were uncertain of the conclusion because of
limitation of samples. The subgenus Zeugodacus,
the main tephritid species in Chongqing region,
was divided into 2 groups, with one as B. (Z. )cau-
date, B. (Z.) diaphora, and B. (Z.) scutellata, and
the other as B. (Z. ) tau and B. (Z. ) cucurbitae. Mu-
raji & Nakahara (2001) reported that B. (Z.) tau
and B. (Z.) cucurbitae were closely related to B.
(Z. scutellataa.
Phylogenetic tree analysis also showed that
the subgeneradustrodacus and Zeugodacus were
closely related to the subgenera Afrodacus, Bac-
trocera, and Gymnodacus. An interesting phe-
nomenon is that the former clade that includes
subgenera Austrodacus and Zeugodacus usually
attack cucurbit plants, but the latter clade that
includes subgenera Afrodacus, Bactrocera, and
Gymnodacus prefers to attack plants of numerous
families,
The 7 members of the B. (B. ) dorsalis complex
species (as defined by Drew & Hancock 1994) in-
cluded in this study are monophyletic. Smith et
al. (2003) once analyzed 4 members of the B. (B. )
dorsalis complex species (as defined by Drew &
Hancock 1994) and also found that the B. (B. ) dor-
salis complex species are monophyletic. Muraji &
Nakahara (2001) supported that B. (B.) dorsalis
complex species are monophyletic. All these re-
sults show that although some B. (B.) dorsalis
complex species have quiet different biological
features from each other, the B. (B.) dorsalis com-
plex species seem to have a common ancestor.
The complete sequence of mitochondrial ge-
nome of B. (B.) dorsalis complex species (Bactro-
cera (Bactracera) dorsalis, Bactrocera (Bactro-








Zhang et al.: Molecular Phylogeny of Bactrocera species


92 B. papayae
55'- B. B.phlippinens
79- B. B. carambolae
67~- B. B.dorsalis
100 B. B. oceiptalis
68 B. B. musae
B. B. kandiensis
27
10 B. tryoni
61- B. B. cumpennis
21 B.G calophylli
57B. B. correcta
67 13B. B. zonate
B. B. fauenfeldi
34 ; B. B. psidii
B. Af jaruisi
3 B B8. umbrose
71 8BB aihrons

CF 74-B Te tsuneoms
$ ~ ~~~B. e ia Paraltidacus ex
6. D oleae
-83 BI diaphora
100
100-- B-L scutellata
B. Z caudata
706 Z. tau
99
99g- 8 Z cucurbitae
B Au cucumis
A ludens
C capitata

Fig. 2. The strict consensus of the most parsimonious trees (Tree length: 1311; CI: 0.39) for 27 species of Bactro-
cera and two out groups Anastrepha ludens and Ceratitis capitata based on the combined DNA sequence (1049-bp
including gaps) of mitochondrial l6S rRNA and Cytochrome Oxidase I. Numbers above branches are bootstrap val-
ues (%).


cera) papaya, Bactrocera (Bactrocera) caram-
bolae, and Bactrocera (Bactrocera) philippineasis)
has been deposited in GenBank. More and more
complete sequence of mitochondrial genome of B.
(B.) dorsalis complex species sequenced will con-
tribute to rigorous phylogenetic analyses about B.
(B. ) dorsalis complex species,
In present study, 2 subgenus Tetradacus spe-
cies were included in a phylogenetic analysis for
the first time. We found that subgenus Tetradacus
is a sister group to subgenus Paratridacus, and
the subgenus Tetradacus has greater genetic dis-
tance to other subgenera in Bactrocera group. Be-
cause the subgenus Tetradacus has not been in-
troduced into phylogentic studies before, it is nec-
essary that further molecular phylogentic studies
should be done to examine taxonomic status of
subgenus Tetradacus.
Although there are some molecular evolu-
tional studies of genus Bactrocera phylogeny, how
to choose appropriate gene sections to infer taxo-
nomic clades is still a problem. Some researchers
tended to use longer gene sequences to study ge-
nus Bactrocera phylogeny (Smith 2002, 2003; Mu-
raji & Nakahara 2001), but too long sequences re-


quire much work and time. Additionally, the main
reason for debate on the phylogeny of Bactrocera
species is limited taxon samples, e.g., many taxon
sites only were represented species. Morpholog-
ical classification is still the basic of phylogenetic
analysis for the Bactrocera. More cladistic charac-
ters should be investigated in the future; e.g.,
Smith et al. (2003) suggested that the male surst-
ylus lobe is the more important in phylogenetic
analysis of Bactrocera. They also pointed out that
a short posterior lobe of the male surstylus and a
shallow V-shaped emargination of male sternite 5
are plesiomorphic and a deep V-shaped emargin-
ation of male sternite 5 is apomorphic. Some re-
searchers have proposed that different attraction
reactions to methyleugenol and cue-lure can be a
reliable way to discriminate species within Bac-
trocera (White & Hancock 1997; Drew & Hancock
2000; White 2000; Smith et al. 2003).

ACKNOWLEDGMENTS

We are thankful to Dr. James L. Nation and anony-
mous reviews whose invaluable critical comments
helped greatly to improve this article. We wish to ex-








Florida Entomologist 93(3)


September 2010


9 B. papayae
60- 8. B.philippinens
71- B B. dosalis
44~ B B carambolae
97- 8. B. occiptdas
33~ B B musae
BB 8 kandienwss

100BBtyn
3 ~ 30- B B cumpennis
B G calophylli
B B umbrosa
S8 9B I adfrons
B B correct
28
2g B B zonata
B. At jaclusi
B. B. fraenfeldi
45 B B. psidli
10B Te. minax
77- B Te tsuneonis
-41 B P. expandens
10 Z. diaphora
94- B Z. scutellata
8. Z caudata
9 7 tau
90- B. Z cucurbitae
9 Au. cucumis
B D. oleae
A.ludens
C.capitaa

Fig. 3. Neighbour-joining dendrogram The strict consensus of the most parsimonious trees for 27 species of Bac-
trocera and 2 out groups Anastrepha ludens and Ceratitis capitata based on the Jukes-Cantor distances with com-
bined DNA sequence (1049-bp including gaps) of the mitochondrial l6S rRNA and Cytochrome Oxidasel. Numbers
above branches are bootstrap values (%).


press our thanks to Dr. Helen Hull Sanders for helpful
comments on construction of this article. We thank
workers at Chongqing Agriculture Technique Extension
Station for collecting and identifying insect samples.
This work was supported in part by National Key Tech-
nology R&D Program (2007BAD47BO3) and the "Molec-
ular Detection and exploitation of Monitoring and
Warning technology of dangerous diseases and pests on
orange" (CSTC, 2007AA1024) supported by Chongqing
Science and Technology Commission, China.

REFERENCE CITED

ANNA, Z., ANTIGONE, Z., AND ZACHARIAs, G. S. 1999. The
genome of the olive fruit fly Bactrocera oleae: local-
ization of molecular markers by in situ hybridization
to the salivary gland polytene chromosomes. Ge-
nome 42: 744-751.
BAIMAI, V., PHINCHONGSAKULDIT, J., AND SUMRANDEE,
C. 2000. Cytological evidence for a complex of species
within the taxon Bactrocera tau (Diptera: Tephriti-
dae) in Thailand. Biol. J. Linnean Soc. 69: 399-409.
BEARD, C. B., HAMM, D. M., AND COLLINs, F. H. 1993.
The mitochondrial genome of the mosquito Anophe-
les gambiae: DNA sequence, genome organization
and comparisons with mitochondrial sequences of
other insects. Insect Mol. Biol. 2: 103-124.
BERLOCHER, S. H. 1980. An electrophoretic key of distin-
guishing species of the genus Rhagoletis (Diptera:


Tephritidae) as larvae, pupae or adults. Ann. Ento-
mol. Soc. America 73: 131-137.
BOYCE, T. M., ZWICK, M. E., AND AQUADRO, C. F. 1994.
Mitochondrial DNA in the bark weevils: phylogeny
and evolution in the P. strobi group. Mol. Biol. Evol.
11: 183-194.
BUSH, G. L. 1975. Modes of animal speciation. Annu.
Rev. Ecol. Syst. 6: 339-364.
DAVID, H., TINA, T., AND CHARI, T. 1994. DNA probes
can be used to discriminate between tephritid spe-
cies at all stages of life cycle (Diptera: Tephritidae).
J. Econ. Entomol. 87: 741-746.
DREW, R. A. I., AND HARDY, D. E. 1981. Dacus (Bactro-
cera) opiliae, a new sibling species of the dorsalis
complex of fruit flies from Northern Australia
(Diptera: Tephritidae). J. Australian Entomol. Soc.
20: 131-137.
DREW, R. A. I. 1989. The Tropical Fruit Flies (Diptera:
Tephritidae: Dacinae) of the Australian and Ocean-
ian Regions. Memoirs Queensland Museum 26: 1-
521.
DREW, R. A. I., AND HANCOCK, D. L. 1994. The Bactro-
cera dorsalis complex of fruit flies (Diptera: Tephriti-
dae: Dacinae) in Asia. Bull.ent. Res. Supplement, 2:
68.
DREW, R. A. I., AND HANCOCK, D. L. 2000. Phylogeny of
the tribe Dacini (Dacinae) based on morphological,
distributional, and biological data, pp. 491-504 In M.
Aluja and A. L. Norrbom (eds.), Fruit Flies (Tephriti-








Zhang et al.: Molecular Phylogeny of Bactrocera species


dae) Phylogeny and Evolution of Behavior, CRC
Press, New York.
FLOOK, P. K., ROWELL, C. H., AND GELLISSEN, G. 1995.
The sequence, organization and evolution of the Lo-
custa migratoria genome. J. Mol. Evol. 41: 928-941.
HAN, H. Y., AND MCPHERON, B. A. 1997. Molecular phy-
logenetic study of Tephritidae (Insecta: Diptera) us-
ing partial sequences of the mitochondrial 16S ribo-
somal DNA. Mol. Phylogenetic Evol. 7: 17-32.
HAN, H. Y. 2000. Molecular phylogenetic study of the
tribe Trypetini (Diptera: Tephritidae) using mito-
chondrial 16S ribosomal DNA sequences. Biochem.
Syst. Ecol. 28: 501-513.
HARDY, D. E. 1973. The Finit Fies (Tephritidae: Diptera)
of Thailand and Bordering Countries. Pacific Insects
Monogr. 31: 1-353.
HE, M., AND HAYMER, D. S. 1997. Polymorphic intron se-
quence detected within and between populations of
the oriental finit fly (Diptera: Tephritidae). Ann. En-
tomol. Soc. America 90: 825-831.
HE, M., AND HAYMER, D. S. 1999. Genetic relationships
of populations and the origins of new infestations of
the Mediterranean finit fly. Mol. Ecol. Syst. 8: 1247-
1257.
HE, M., AND HAYMER, D. S. 2003. The use of intron se-
quences for molecular taxonomic and systematic
studies of species in the Bactrocera dorsalis complex.
Plant Prot. Bull. Spec. Publ. New 5: 35-47.
KUMAR, S., TAMURA, K., AND NEI, M. 1993. MEGA: Mo-
lecular Evolutionary Genetics Analysis, Version
1.01. The Pennsylvania State University, University
Park, PA 16802.
LANGOR, D. W., AND SPERLING, F. A. H. 1997. Mitochon-
drial DNA sequence divergence in weevils of the Pis-
sodes strobi species complex (Coleoptera: Cucurlion-
idae). Insect Mol. Biol. 6: 255-265.
LEWIS, D. L., FARR, C. L., AND KAGUNI, L. S. 1995.
Drosophila nzelanogaster mitochondrial DNA: com-
pletion of the nucleotide sequence and evolutionary
comparisons. Insect Mol. Biol. 4: 263-278.
LI, W. H. 1997. Molecular Evolution. Sinauer Associ-
ates, Sunderland, MA.
LUNT, D. H., ZHANG, D. X., SZYMURA, J. M., AND
HEWITT, G. M. 1996. The insect cytochrome oxidase I
gene: evolutionary patterns and conserved primers
for phylogenetic studies. Insect Mol. Biol. 5: 153-165.
MUNRO, H. K. 1984. A taxonomic treatise on the
Dacidae (Tephritoidea: Diptera) of Africa. Entomol.
Mem. South Africa Dept. Agric. 61: 313.
MURAJI, M., AND NAKAHARA, S. 2001. Phylogenetic rela-
tionships among fmuit flies, Bactrocera (Diptera: Te-
phritidae), based on the mitochondrial rDNA se-
quences. Insect Mol. Biol. 10: 549-559.
NAELOE, C. K. M., AND HAYMER, D. S. 2003. Use of oligo-
nucleotide arrays for molecular taxonomic studies of
closely related species in the oriental fluit fly (Bac-
trocera dorsalis) complex. Mol. Ecol. Notes 3: 662-
665.


NEI, M., AND GOJOBORI, T. 1986. Simple methods for es-
timating the number of synonymous and nonsynon-
ymous substitutions. Mol. Biol. Evol. 3: 418-426.
O'NEILL, S. L., GIORDANO, R., COLBERT, A. M., KARR, T.
L., AND ROBERTSON, H. M. 1992. 16S rRNA phyloge-
netic analysis of the bacterial endosymbionts associ-
ated with cytoplasmic incompatibility in insects.
Proc. Natl. Acad. Sci. USA 89: 2699-2702.
POSADA, D., AND CRANDALL, K. A. 1998. Modeltest: test-
ing the model of DNA substitution. Bioinformatics
14: 817-818.
SAELEE, A. 1999. Electrophoretic Study of Bactrocera
tau Complex (Diptera: Tephritidae) in Certain Popu-
lations in Thailand. M.S. Thesis, Mahidol University,
Bangkok, Thailand.
SM1ITH, P. T., MCPHERON, B. A., AND KAMBHAMPATI, S.
2002. Phylogenetic analysis of mitochondrial DNA
supports the monophyly of dacini fruit flies (Diptera:
Tephritidae). Ann. Entomol. Soc. Am. 95(6): 658-664.
SM1ITH, P. T., KAMBHAMPATI, S., AND ARMSTRONG, K. A.
2003. Phylogenetic relationships among Bactrocera
species (Diptera: Tephritidae) inferred from mito-
chondrial DNA sequences. Mol. Phylogenetic Evol.
26:8-17.
SM1ITH, J. J., AND BUSH, G. L. 1997. Phylogeny of the ge-
nus Rhagoletis (Diptera: Tephritidae) inferred from
DNA sequences of mitochondrial cytochrome oxi-
dasell. Mol. Phylogenetic Evol. 7: 33-43.
SPANOS, L. G., KOUTROUMBAS, M., AND LOUls, K. C.
2000. The mitochondrial genome of the Mediterra-
nean finit fly, Ceratitis capitata. Insect. Mol. Biol. 9:
139-144.
THOMPSON, J. D., GIBSON, T. J., PLEWNIAK, F., JEAN-
MOUGIN, F., AND HIGGINS, D. G. 1997. The ClustalX
windows interface: flexible strategies for multiple
sequence alignment aided by quality analysis tools.
Nucl. Acids Res. 24: 4876-4882.
WANWISA, J., AND VISUT, B. 2003. Molecular phylogeny
ofTephritid fmuit flies in the Bactrocera tau complex
using the mitochondrial CO1 sequences. Genome,
46: 112-118.
WHITE, I. M. 2000. Morphological features of the Dacini
(Dacinae): their significance to behavior and classifi-
cation, pp. 505-533 In M. Aluja and A. L. Norrbom
(eds.), Fruit Flies (Tephritidae): Phylogeny and Evo-
lution of Behavior. CRC Press, Boca Raton, FL.
WHITE, I. M., AND HANCOCK, D. L. 1997. CABIKEY to
the Indo-Australasian Dacini Fruit Flies. CAB Inter-
national, Wallingford, CDROM.
WHITE, I. M., AND ELSON-HARRIS, M. M. 1992. Fruit
Flies of Economic Significance: Their Identification
and Bionomics. Centre for Agriculture and Bio-
sciences International.
YANG, A. 1994. Estimating the pattern of nucleotide
substitution. J. Mol. Evol. 39: 105-111.
ZHAO, J. T., FORMAIER, M., AND SVED, J. A. 2003. Genet-
ic and molecular markers of the Queensland fluit fly,
Bactrocera tryoni. J. Heredity, 94: 416.







Florida Entomologist 93(3)


September 2010


IMPACTS OF AN ORANGE OIL SOLVENT AND STICKEM@ ON THE DETECTION
OF XYLELIA FASTIDIOSA DNA IN GLASSY-WINGED SHARPSHOOTERS,
HOM~ALODISCA VITRIPENNIS (HEMIPTERA: CICADELLIDAE)

PATRICK MARSHALL', DAYMON HAIL FORREST MITCHELL2 AND BLAKE. BEXTINE'
'Dept. of Biology, University of Texas-Tyler, 3900 University Blvd., Tyler, TX 75799

2Texas AgriLife Research, 1229 N. Highway 281, Stephenville, TX 76401

ABSTRACT

Xylella fastidiosa is a plant pathogenic bacterium that causes many economically important
agricultural diseases and is transmitted by the glassy-winged sharpshooter, Honzalodisca
citripennis (Hemiptera: Cicadellidae). Efficient detection ofX. fastidiosa in field collected H.
uitripennis in an area-wide management program can contribute to risk assessment associ-
ated with insect presence in vineyards. Prior to conducting molecular assays for detection of
X. fastidiosa in individual insects, H. uitripennis must be removed from yellow sticky traps
with a solvent such as orange oil. In this study, we determined the effect of orange oil con-
centration on extraction of individual H. uitripennis following trap removal on detection of
X. fastidiosa by qRT-PCR. In a ten-fold dilution series of orange oil, increasing amounts of
orange oil caused decreasing levels of X fastidiosa detection in standardized positive sam-
ples. Additionally, tests on the effects of Stickem@ brand trap adhesive on qRT-PCR and de-
velopment of methods which lowered the concentration of orange oil often present in field
samples determined the point where detection of X. fastidiosa was negatively impacted.
These results benefit the monitoring and screening for Xylella fastidiosa from leafhoppers
collected on sticky cards used in regulatory area-wide management.

Key Words: orange oil, Xylella fastidiosa, glassy-winged sharpshooter, Honzalodisca citrip-
ennis, PCR

RESUME

Xylella fastidiosa es una bacteria patogi~nica de plants que causa muchas enfermedades
agricolas economicamente importantes y es transmitida por el salta hojas, Honzalodisca ci-
tripennis (Hemiptera: Cicadellidae). La detecci6n eficiente de X. fastidiosa de H. uitripennis
recolectados en el campo en un program de manejo de largas Breas puede contribuir a la de-
terminaci6n del riesgo asociado con la presencia del insecto en los vifieros.Antes de realizar
los ensayos moleculares para la detecci6n de X. fastidiosa en individuos del insecto, H. uitri-
pennis debe ser recolectados de trampas pegajosas amarillas con un solvente como el aceite
de naranj a. En este studio, determinamos el efecto de la concentraci6n del aceite de naranj a
sobre la extracci6n de individuos de H. uitripennis despui~s de que fueron quitados de las
trampas para la detecci6n deX. fastidiosa usando qRT-RPC. En una series con el aceite de na-
ranja diluido 10 veces, un aumento de la cantidad de aceite de naranja causo una disminu-
ci6n en los niveles de X. fastidiosa detectados en muestras positivas estandarizadas. En
adici6n, las pruebas sobre los efectos del adhesive de trampa de la marca Stickem@ sobre
qRT-RPC y el desarrollo de mi~todos que bajan la concentraci6n del aceite de naranja en
muestras de campo determinaron el punto donde la detecci6n deX. fastidiosa fue impactado
negativamente. Estos resultados benefician el monitoreo y la detecci6n de Xylella fastidiosa
de los salta hojas recolectadas en tarjetas pegajosas usadas en un program regulatorio de
manejo por todo el Brea.


The glassy-winged sharpshooter, Homalodisca
vitripennis (Hemiptera: Cicadellidae), is a major
vector of Xylella fastidiosa (Wells et al. 1987) in
the southern USA (Adlerz 1980; Blua et al. 2003).
The plant pathogenic bacterium, X. fastidiosa,
has caused economic losses to several agricul-
tural industries in North, Central, and South
America. Xylella-related complications and dis-
eases in agriculture are well understood; the vec-
tor model is well known and the epidemiology of
the disease is well documented (Hopkins et al.


2002; Mizell et al. 2008). Xylella fastidiosa is the
causative agent of Pierce's disease in grapevines.
The introduction of H. vitripennis into new areas
is directly related to increased occurrence of
Pierce's disease in vineyards (Perring et al. 2001).
Therefore, the management and control of
Pierce's disease depends heavily on the ability to
closely and accurately monitor its leafhopper vec-
tors, especially H. vitripennis.
In area-wide management programs in Cali-
fornia and Texas, H. vitripennis typically are col-







Marshall et al.: Detection of Xylella festidiose in Glassy-winged Sharpshooters 379


elected on yellow sticky cards. The method is use-
ful for monitoring population numbers and iden-
tifying insect species that occur in the field; how-
ever, the adhesive (Stickem@, Seabright
Laboratories, Emeryville, CA) that coats these
cards can be problematic when applying molecu-
lar techniques (amplification of DNA and RNA
studies) to insects removed from the traps. A pro-
cess involving application of a strong organic sol-
yent to dissolve the adhesive on the insects must
be performed. Downstream molecular assays re-
quire DNA extraction and PCR, both of which in-
volve heating of samples; therefore, a solvent
with a high flashpoint is essential.
Orange oil (Florida Chemical Co. Inc., Winter
Haven, FL) has the highest flashpoint of any or-
ganic solvent on the market, 118oF/48oC. In addi-
tion to its low volatility, this product is inexpen-
sive, nontoxic, and effective at removing sticky
adhesives. Orange oil is the most common prod-
uct used in studies involving the removal of in-
sects from yellow sticky cards and is usually ap-
plied directly to insects adhered to traps (Bextine
et al. 2004). Because all specimens come in direct
contact with the solvent as well as the adhesive,
they often absorb unknown amounts of both. Our
speculation was that orange oil or Stickem~re-
tained by H. vitripennis specimens might inhibit
the extraction of DNA, the amplification of target
X. fastidiosa DNA during PCR, or the fluores-
cence signal emitted during quantitative Real-
Time PCR (qRT-PCR). In this study, a 10-fold di-
lution series of different volumes of orange oil and
Stickem@ mixed with positive X. fastidiosa con-
trol specimens were analyzed by qRT-PCR to de-
termine the amount of interference caused by the
solvent or the adhesive. We determined individu-
ally the amount of orange oil and Stickem~con-
tained in a typical extracted leafhopper sample
and discussed the potential effect this may have
on X. fastidiosa detection in field samples.

MATERIALS AND METHODs

Sample Collection

Insect samples were collected with sticky ad-
hesive-based traps. Traps were either standard
double-sided traps (Seabright Laboratories, Em-
eryville, CA), each 23 x 14 cm, bright yellow in
color and coated with Stickem Special@ glue
(2004 to date) or sheets of yellow sticky strips sold
by Great Lakes IPM (Vestaburg, MI) and cut to fit
the trap frame in 2003 and 2004. These samples
were analyzed at the University of Texas at Tyler,
TX. Homalodisca vitripennis were individually
recovered by placing traps in 4.43-L plastic con-
tainers (Tupperware Brands Corp., Orlando, FL)
with 2 L orange oil (Citrus Depot, St. Petersburg,
FL) for 5 min per two-sided card. Insects were re-
moved from the traps via forceps and placed into


1.5-mL centrifuge tubes labeled according to trap
location and corresponding vineyard.

DNA Extraction

Homalodisca vitripennis heads were removed
and placed in 96-well plates, 1 head per well con-
taining 200 p-L PBS buffer (Bextine et al. 2004).
The plates were placed under vacuum for 2 min 5
times consecutively. The heads were removed,
and 200 p-L of Lysis Buffer L6 (Boom et. al. 1990)
added to each well. The plates were centrifuged at
4,295 g for 5 min, and 300 pL were transferred
from the supernatant in each well to a corre-
sponding micro-centrifuge tube. Next 53 p-L of sil-
ica slurry (Boom et al. 1990) were mixed into the
300 pL-solution, and samples were incubated at
room temperature for 5 min and centrifuged at
687 g for another 5 min. Afterward, the superna-
tant was discarded, and 200 pL of silica wash
buffer added. Samples were then centrifuged at
687 g for 5 min, and the supernatant was aspi-
rated and discarded. This washing step was re-
peated twice. The samples were dried at 60oC for
10 min, or until the silica was dry. DNA was then
eluted with 100 p-L TE buffer and centrifuged at
2000 rpm for 5 min. Lastly, 70 p-L of the superna-
tant were transferred to a sterile 1.5-mL centri-
fuge tube in preparation for qRT-PCR.

qRT-PCR

PCR was conducted in 10-p~L reactions, includ-
ing 2 X. fastidiosa positive controls and 2 No Tem-
plate Controls (NTCs). Each sample reaction, a
total of 10 pL, included 5 p-L iQTM Supermix (Bio-
Rad Laboratories, Hercules, CA), 0.5 pL SYBR@
Green nucleic acid gel stain (Invitrogen Molecu-
lar ProbesTM, Eugene, OR), 1.7 p-L nanopure wa-
ter, 0.4 p-L of 10 pM primer INF2 (GTTTGAT-
TGATGAACGTGGTG), 0.4 pL of 10 pM primer
INR1 (CATTGTTTCTTGGTAGGCATCA)
(Sigma-Aldrich, St. Louis, MO) (Bextine & Child
2007), and 2 pL-sample DNA. Each X. fastidiosa
positive control contained 1 p-L DNA, and each
NTC contained 10 p-L master mix. Each reaction
was carried out in 0.1-mL PCR tubes (Corbett Re-
search, St. Neots, Cambridgeshire, UK). The pre-
pared samples were placed into a Rotor-Gene RG-
3000 qRT-PCR machine (Corbett Research, St.
Neots, Cambridgeshire, UK) and screened for X.
fastidiosa DNA.

Orange Oil or Stickem@ Retained

In order to create an applicable orange oil di-
lution series, the average amount of orange oil re-
tained in each H. vitripennis body extracted from
a sticky trap was determined. The average mass
of the centrifuge tube + retained orange oil was
965.84mg. The average mass of a micro-centri-







Florida Entomologist 93(3)


September 2010


fuge tube containing retained orange oil minus
the average mass of an empty microcentrifuge
tube was determined to be the average mass of re-
tained orange oil in an R. vitripennis head
(965.84 mg 965.7 mg = 0.14 mg). Stickem@ re-
tained was calculated similarly.

Dilution Series

The inhibitory effects on fluorescence of 2 or-
ange oil and 2 Stickem@ adhesive dilution series
were examined by qRT-PCR. The first was a ten-
fold dilution series. Triplicates containing 8 p-L
master mix, 1 p-L X. fastidiosa DNA, and 1 pL of
either 100%, 10%, or 1% orange oil or Stickem@
were analyzed by qRT-PCR. With the information
gained from the initial ten-fold dilution series, a
more precise dilution series was developed. Other
non-inhibitory dilutions were ruled out. The re-
sulting dilution series was a 1:1-1:10 dilution of
orange oil or Stickem@. The same PCR reaction
volumes were used and the same procedure was
followed.

PCR and Gel Electrophoresis

In order to determine whether or not complete
inhibition of Xylella DNA amplification was oc-
curring, a separate traditional PCR reaction was
performed. A dilution series containing orange oil
and another containing Stickem@ were subjected
to traditional PCR followed by electrophoresis in
a 1% agarose gel suspended in TE buffer for 60
min at 400 amperes and 85 volts. The ladder used
was TrackIt"^' 1Kb Plus DNA Ladder, (Invitrogen
Molecular Probes"^', Eugene, OR, cat. no. 10488-
085), These dilution series were constructed iden-
tically to the series used in the qRT-PCR test. Pos-
itive samples (123,457 copies/p-L) were visualized
WITH the Bio Doc-It Imaging System (Cole-
Parmer"^', Hanwell, London).

RESULTS

Inhibitory Effect of Orange Oil

The average volume of orange oil retained by
an individual H. vitripennis head (Vet) Was 0.178
p-L, respectively. This figure was reached by first
determining the average mass of 5 sterile, empty
1.5-mL microcentrifuge tubes ln1, = 965.7 mg,
SD = 12.77 mg). Next, the average mass of 5 mi-
crocentrifuge tubes containing retained orange
oil was determined I4 .I = 965.84 mg, SD = 11.33
mg). The average mass of a centrifuge tube con-
taining retained orange oil minus the average
mass of an empty centrifuge tube was the average
mass of retained orange oil in an H. vetripeniats
head ( nI, = M,, Male, = 965.84 mg 965.7 mg =
0.14 mg). The average mass of 5 micro-centrifuge
tubes containing 100 p-L orange oil ln1, ~ ~=


1044.5 mg, SD = 12.58 mg) minus the average
mass of an empty microcentrifuge tube equaled
the average mass of 100 pL of orange oil I nI,=
M,,,,,, Male, = 1044.5 mg 965.7 mg = 78.8 mg).
Since Massl/Mass2 = Volumel/Volume2, the av-
erage mass of orange oil retained divided by the
average mass of 100 pL of orange oil was equal to
the volume of orange oil retained divided by 100
p-L orange oil lnI, ,/Minno,, = 0.14 mg/78.8 mg = Vet
100 p-L). The average volume of orange oil re-
tained by an individual H. vitripennis head was
0.178 p-L (Vet Re 100011,~ X 100 pL = 0.14 mg/78.8
mg x 100 p-L = 0.178 p-L).
The average volume of orange oil retained by
an individual H. vitripennis head, 0.178 p-L, was
used to determine the range of an orange oil dilu-
tion series. Analysis of qRT-PCR data revealed
that 1 p-L of 100% orange oil as well as 1 pL of 10%
orange oil in a 10 pL-reaction completely inhib-
ited fluorescence ofX. fastidiosa DNA, and 1% or-
ange oil had no effect. Analysis of qRT-PCR data
collected in a second, narrower 1:1-1:10 dilution
of orange oil produced similar results (Fig. 1). The
result was a strong deviation from fluorescence
expected under normal conditions (samples con-


ofXF i.1 Dyln and eltn c u grah1 a 1 aclyi
inverse proportion of Orange Oil to Xylella DNA fluores-
cence. The positive Xylella control sample containing no
Orange Oil fluoresces the highest, while the sample con-
taining 1p.L of Orange Oil shows no fluorescence at all.
Values are averages.







Marshall et al.: Detection of Xylella festidiose in Glassy-winged Sharpshooters 381


training X. fastidiosa DNA and PCR reaction re-
agents) in samples containing between 1 p-L and
0.1 p-L of orange oil. Further statistical analysis of
qRT-PCR data yielded an inverse proportion of or-
ange oil concentration to fluorescence (Fig. 2).

Effects of Stickeme

The average mass of Stickem@ retained by an
individual H. vitripennis head was 0.0077 g, re-
spectively. This figure was reached by first deter-
mining the average mass of 10 sterile, empty 1.5-
mL micro-centrifuge tubes ln1, = .9632 g, SD =
.0054 g). Next, 10 GWSS bodies were placed on a
sticky trap, removed, and decapitated. After-
wards, the average mass of 10 GWSS heads was
determined ( nI,, ,= .0099 g, SD = .0037 g). These
10 GWSS heads were placed into their corre-
sponding sterile, pre-weighed centrifuge tubes to
determine the average mass of a microcentrifuge
tube containing a GWSS head with Stickem@
In 41 ,,, , ,.= .9808 g, SD = .0091 g). The average
mass of a microcentrifuge tube containing GWSS
head + Stickem@ (Mtz Head+AIC = .9808 g) minus
the average mass of a G SS head I nI,, ,= .0099 g)
minus the average mass of a sterile, empty micro-
centrifuge tube (41, = .9632 g) equals the aver-
age mass of Stickem@ retained by a GWSS head
removed from a yellow, sticky trap I n1 , = Mticky-
Head+AIC Head, MET, = .0077 g).


The average mass of Stickem@ retained by an
individual H. vitripennis head, .0077 g, was used
to determine the range of a Stickem@ dilution se-
ries (Fig. 3). Statistical analysis of qRT-PCR data
from a Stickem@ dilution series showed an in-
verse proportion of fluorescence to Stickem@ con-
centration (Fig. 4).

Mode of Fluorescence Inhibition in qRT-PCR

Following qRT-PCR, gel electrophoresis was
performed on orange oil and Stickem@ dilution
series qRT-PCR products. Despite variation in
qRT-PCR, endpoint analysis by gel electrophore-
sis yielded no complete inhibition ofXylella DNA
amplification by either orange oil or Stickem@
(Fig. 5). However, according to data collected,
both orange oil and Stickem~are fluorescence in-
hibitors.

DIscussioN

The presence of orange oil and Stickem@ can
inhibit the ability to detect X. fastidiosa DNA by
qRT-PCR. The root of this inhibition was not
known but presence of strong bands by gel elec-
trophoresis following DNA extraction ruled out
this step being the root of the problem. Therefore,
inhibition had to be the result of either poor am-
plification of target DNA during PCR or interfer-


Orange Oil Concentration

Fig. 2. Orange Oil dilution vs. rate of change in fluorescence/rate of change in temperature ofXylella DNA. Note
a negative correlation in Xylella DNA fluorescence with respect to an increase in Orange Oil concentration. Also
note that the R2 value of the trend line is 0.8942.


Fluorescence (dP/dT) vs Orangle Oil Dilution







Florida Entomologist 93(3)


September 2010


Fig. 3. Cycling and melting curve graphical analysis ofgylella DNA fluorescence during qRT-PCR. Notice an in-
verse proportion of Stickem@ concentration to fluorescence ofgylella DNA during qRT-PCR. The positive Xlella
control containing no Stickem@ fluoresces the highest, while the sample containing 1p.L of Stickem@ fluoresces the
lowest.


ence with SYBR green fluorescence. End point
analysis of qRT-PCR product by gel electrophore-
sis yielded no affect on Xylella DNA amplification
(i.e., amplicons were seen on gels when qRT PCR
results were negative). Further studies may ben-
efit from the determination of the exact cause of
fluorescence inhibition in qRT-PCR by orange oil
and Stickem@.
Practically speaking, we did not find levels of
either compound in our field samples to be above
amounts that resulted in inhibition that produced
false-negatives. The average volume of retained
orange oil per H. vitripennis head was deter-
mined to be 0.178 p-L which is within the range
calculated to interfere with qRT-PCR; however,
H. vitripennis samples collected and extracted
prior to this study did not contain a level consid-
ered critical.
Precautions were taken in collection and ex-
traction of H. vitripennis samples that allowed
contamination to be controlled and closely moni-
tored. These precautions or modifications to the
collection and extraction procedures include the
use of a squeeze bottle that can directly apply


small amounts of orange oil to each individual in-
sect instead of soaking an entire trap. Also,
prompt transfer of each insect into a 70% ethanol
wash, followed by a DI water wash, before being
placed in a sterile micro-centrifuge tube is recom-
mended. Concentrated orange oil may also be di-
luted. Other solvents such as turpentine, hex-
anes, or ethers have flashpoints lower than the
denaturing temperature needed for qRT-PCR and
may be hazardous to use.
End point analysis of qRT-PCR product by gel
electrophoresis yielded no affect on Xylella DNA
amplification. This determination that orange oil
and Stickem~ are non-inhibitors of DNA amplifi-
cation in qRT-PCR is essential in further examin-
ing the mode of fluorescence inhibition during
qRT-PCR.
The results of this experiment are crucial to
the successful monitoring of the spread and oc-
currence of Xylella in area-wide management
programs. The management and control of
Pierce's disease depends heavily on the ability
to closely and accurately monitor its vectors.
These results impact the successful analysis by







Marshall et al.: Detection of Xylella festidiose in Glassy-winged Sharpshooters


F3



1 .5


o


0.5

0


0.2 0.4 0.6 0.8 1

Sti ckem@~ Co nce ntratio n


Fig. 4. Stickem@ dilution vs rate of change in fluorescence/rate of change in temperature of Xylella DNA. Notice
a negative correlation in Xylella DNA fluorescence with respect to an increase in Orange Oil concentration. Also
note that the R2 value of the trend line is 0.9644.


Fig. 5. Shown is a 1% agarose gel after being suspended in TE buffer for 60 min at 400 amperes and 85 volts.
The ladder used was TrackItThl 1Kb Plus DNA Ladder, (Invitrogen Molecular ProbesThl, Eugene, OR, cat. no. 10488-
085. Positive samples (123,457 copies/p-L) were visualized with the Bio Doc-It Imaging System (Cole-ParmerTM,
Hanwell, London). This figure shows no complete inhibition ofXylella fastidiosa DNA amplification with varying
amounts of Orange Oil and Stickem@. Note that no visible effect on Xylella DNA amplification by Orange Oil or
Stickem@ suggests a direct effect on fluorescence ofXylella DNA in qRT-PCR.


PCR needed for any insect being removed from
sticky cards involving organic solvents, and
processed for nucleic acid extraction, a promi-
nent practice in the fields of regulation and en-
tomology.


ACKNOWLEDGMENTS

Funding was provided by the Texas Pierce's Disease
Research and Education Program and USDA-APHIS.
Insect trap samples were retrieved from archival stor-


Fluorescence (dF/dT) vs Stickem@ Dilution








Florida Entomologist 93(3)


September 2010


age by Danny McDonald, Texas AgriLife Research,
Stephenville, TX 76401.

REFERENCES CITED

ADLERZ, W. C. 1980. Ecological observations on two leaf-
hoppers that transmit the Pierce's disease bacteri-
um. Proc. Florida State Hort. Soc. 93:115-120.
BEXTINE, B. R., AND CHILD, B. 2007. Xylella fastidiosa
genotype differentiation by SYBR Green-based QRT-
PCR. FEMS Microbiol. Lett. 276(1): 48-54.
BEXTINE, B. R., BLUA, MATIHEW J., AND REDAK, R.
2004. Developing a method to detect Xylella fastid-
iosa in the glassy-winged sharpshooter. Pierce's Dis.
Res. Symp.
BEXTINE, B. R., SHAIKH, H., TUAN, S., BLUA, M. J., AND
MILLER, T. A. 2004. Evaluation of methods for ex-
tracting Xylella fastidiosa DNA from the glassy-
winged sharpshooter. J. Econ. Entomol. 97: 757-763.
BEXTINE, B. R., BLUA, M. J., AND MILLER, T. A. 2005. A
SYBR green-based real-time polymerase chain reac-
tion protocol and novel DNA extraction technique to
detect Xylella fastidiosa in Homalodisca coagulata.
J. Econ. Entomol. 98(3): 67-72.


BLUA, M. J., AND MORGAN, D. J. W. 2003. Dispersion of
Homalodisca coagulata (Hemiptera: Cicadellidae),
a Vector of Xylella fastidiosa, into Vineyards in
Southern California. J. Econ. Entomol. 96(5): 1369-
1374.
BooM, R., SOL, C. J., SALIMANs, M. M., JANSEN, C. L.,
WERTHEIM-VAN DILLEN, P. M., AND VAN DER NOOR-
DA, J. Rapid and simple method for purification of
nucleic acids. J. Clin. Microbiol. 28(3): 495-503.
HOPKINs, D. L., AND PURCELL, A. H. 2002. Xylella fas-
tidiosa: Cause of Pierce's Disease of Grapevines and
Other Emergent Diseases. American Phytopath.
Soc. 86(10): 1056-1064.
REDAK, R. A., PURCELL, A. H., LOPEs, J. R. S., BLUA, M.
J., MIZELL III, R. F., AND ANDERSEN, P. C. 2004. The
biology of xylem fluid-feeding insect vectors of Xylel-
la fastidiosa and their relation to disease epidemiol-
ogy. Annu. Rev. Entomol. 49: 243-270.
WELLs, JOHN M., RAJU, BOLIGALA C., HUNG, HSUEH-
YUN, WEISBURG, WILLIAM G., MANDELCO-PAUL, LIN-
DA, AND BRENNER, DON J. 1987. Xylella fastidiosa:
Gram-Negative, Xylem-Limited, Fastidious Plant
Bacteria Related to Xanthomonas. Intl. J. Syst. Bac-
teriol. 37: 136-143.











THE DETECTION OF BACILLUS THURINGIENSIS IN MASS REARING OF
CACTOBLASTIS CACTORUM~ (LEPIDOPTERA: PYRALIDAE)


VERENA-ULRIKE. LIETZE', GEORGE SCHNEIDER PANNIPA PROMPIBOON' AND DRION G. BOUCIAS'
EFntomology and Nematology Depaliment, University of Florida, 970 Natural Area Drive,
Gainesville, FL 32611, USA

2Florida Depaliment of Agriculture and Consumer Services, Division of Plant Industry,
1911 S.W. 34th Street, Gainesville, FL 32608, USA

ABSTRACT

A colony of the cactus moth, Cactoblastis cactorunt Berg, suffered a die-off that involved
100% lalval mortality in selected rearing containers. Preliminary microscope examination
of wet mounts prepared from dead larvae revealed the presence of numerous uniform, highly
refractive particles reminiscent of bacterial spores. Utilizing a combination of bacteriologi-
cal, molecular, and chemical methods the causal agent responsible for this die-off was found
to be a strain of the insecticidal Bacillus thuringiensis var. kurstaki. Significantly, larvae
that were killed supported bacterial growth and sporulation. The gregarious feeding habit of
this insect combined with the ability of this bacterium to amplify in dead larvae explains in
palt the observed rapid spread of sepsis in the rearing containers. Screening the various diet
ingredients demonstrated that the cannellini bean flour harbored a variety of heat resistant
bacilli including both Bacillus cereus and B. thuringiensis implicating it as the likely source
of toxicity.

Key Words: cactus moth, Bt, insect rearing, entomopathogen

RESUME

Una colonia de la polilla del cactus, Cactoblastis cactorunt Berg, sufri6 una moltalidad de
100% de las lalvas en recipients de cria seleccionadas. Una examinaci6n microsc6pica pre-
liminaria de montajes humedos preparados de lairas mueltas, revelaron la presencia de nu-
meros palticulares altamente refractivos semejantes de esporas de bacteria. Utilizando una
combinaci6n de m~todos bacteriologicos, moleculares y qufmicos, encontramos que el agent
causante responsible para el muelte fue una cepa insecticide de Bacillus thuringiensis var.
kurstaki. Significativamente, las lalvas que fueron eliminadas soportaron el crecimiento y
esporulaci6n bacterial. El comportamiento de este insecto de alimentarse gregariamente
combinado con la abilidad de esta bacteria para amplificarse en lalvas mueltas, explica en
patte, el esparcimiento rapido observado de sepsis en los recipients de cria. Al filtrar los va-
rios ingredients de dieta, demonstramos que la harina de frijol cannellini alberg6 una va-
riedad de bacilos resistentes al calor incluyendo ambas Bacillus cereus y B. thuringiensis que
implica que probablemente sea la fuente de toxicidad.


Lietze et al.: Bt Infecting Colonized Cactoblastis cactorum


Cactoblastis cactorum Berg (Lepidoptera:
Pyralidae), or cactus moth, is recognized for its
beneficial role as a biological control agent of in-
vasive prickly pear cactus, Opuntia spp. (Caryo-
phyllales: Cactaceae), in Australia. This insect, a
native of Argentina, has recently invaded the
Caribbean, Central America, and coastal areas of
the southeastern U.S. and threatens to destroy
the diversity of native Opuntia species (Zimmer-
mann et al. 2001). In response to its U.S. pres-
ence, USDA-APHIS in collaboration with other
federal and state agencies outlined a plan to con-
tain and prevent the western expansion of its geo-
graphical range by a combination of control tac-
tics. One component of the management plan in-
cluded the implementation of the sterile insect
technique (Carpenter et al. 2001). In order to pro-
vide the insects for sterilization, a large-scale


rearing program of this moth was initiated in
2006 by the Florida Department of Agriculture,
Division of Plant Industry (DPI) in Gainesville,
Florida in cooperation with the USDA-ARS, Crop
Protection and Management Research Labora-
tory in Tifton, Georgia.
To date, the establishment of large-scale colo-
nies for mass rearing of this insect on an artificial
diet has been hindered by the presence of ento-
mopathogens. On several occasions, these colo-
nies have become chronically infected with mi-
crosporidia. The responsible pathogen replicating
in the Malpighian tubules spreads via fecal de-
posits to healthy conspecifies and is gradually
amplified within containers. The presence of mi-
crosporidia causes retardation in larval develop-
ment and often death at larval-pupal transition.
Whether or not the Nosema-like microsporida de-







Florida Entomologist 93(3)


September 2010


tected in recent years in these colonies is the
same as that collected by Pemberton & Cordo
(2001) is unknown. However, implementing both
an increased level of sanitation and destruction of
larvae in rearing containers with detectable lev-
els of microsporidia has decreased the impact of
this disease on the colony to tolerable levels.
Other issues including unexplained aberrations
in larval development have been observed in lim-
ited numbers of rearing containers.
Recently, rearing containers were found to
contain large numbers of heavily melanized,
mixed-aged dead larvae. Unlike the situation ob-
served with microsporidia infection, all larvae in
these containers were killed within days suggest-
ing the presence of a highly virulent virus or
toxin-producing bacterial pathogen. Microscope
examination of wet mounts from these insects re-
vealed that all of the dead larvae contained nu-
merous uniform, highly refractive particles remi-
niscent of bacterial spores. In this study, we have
isolated and identified the causal agent of disease
to be a Bacillus thuringiensis strain that is lethal
and that replicates within C. cactorum.

MATERIALS AND METHODs

Insect Rearing

Egg sticks were obtained from a C. cactorum
colony located at the USDA-ARS laboratory in
Tifton, Georgia in order to reduce the incidence of
Nosema and other entomopathogens. Egg sticks
were held at 27oC and 70% relative humidity
(RH) for 21 d or until egg sticks showed character-
istic darkening prior to hatch. Egg sticks, totaling
300 eggs, were then transferred to a diet block
and sealed in 4-liter Rubbermaid@ containers.
These containers were incubated at 26-27oC and
50-55% RH under a photoperiod of 8.5 h:15.5 h
(L:D). At approximately 3 weeks post-transfer the
solid container lid was exchanged for one with a
single 5-cm diameter screened vent to allow for
moisture exchange and reduce the likelihood of
mold development on the diet block or frass. A
new diet block was added at 4 weeks post-transfer
and then weekly thereafter until no more pupae
were formed. Collection of pupae was performed
weekly once initiated. The containers were con-
tinually monitored for excess moisture and the
venting adjusted accordingly with different
screened lid configurations to limit mold develop-
ment. To enhance sanitation, spent diet blocks,
silk, and frass were removed during container
servicing for food addition or collection of pupae.
The diet was composed of the same basic ingredi-
ents previously developed for C. cactorum by
Marti & Carpenter (2008). The main constituents
were as follows: 2.5 L of boiling water, 630 g of
cannellini bean flour, 186 g of Brewer's yeast, 100
g of sucrose, 45 g of agar, 9.6 g of ascorbic acid, 6


g of methyl paraben, and mold inhibitor (15 mL of
a solution consisting of 418 mL propionic acid, 42
mL phosphoric acid, and 540 mL water). The diet
was prepared in 8-L batches in a Hobart HCM450
Cutter mixer and then poured to a depth of 2 cm
in cookie sheets and left to harden. Once firm it
was cut into 4 x 6 cm blocks which were then
dipped into beeswax to provide a thin waxy outer
layer to simulate a cactus cladode and help retain
moisture within the food block.

Detection and Isolation of Bacteria

Individual dead larvae were randomly selected
from containers, transferred to sterile microcen-
trifuge tubes containing 500 p-L of 0.85% NaCl
and homogenized with a sterile pestle. The homo-
genates were incubated at 70oC for 30 min, subse-
quently cooled on ice for several minutes, and
then filtered through MiraclothTM (22-25 p-m pore
size, Calbiochem Inc., Gibbstown, NJ) to remove
insect debris. The filtrates were streaked (100 pl/1
plate) on nutrient agar (NA) and incubated at
28oC. The growth development of the bacterial
colony phenotype was monitored daily. After 3 d,
single colonies were randomly selected and iso-
lated to new NA plates. Plates were incubated at
28oC to produce colonies for bioassays. Selected
colonies developing on these plates were Giemsa-
stained and examined with a light microscope.
Biochemical and Molecular Characterization of a Bacil-
lus thuringiensis

Colonies displaying the typical phenotype de-
scribed in the results section were selected from
the NA plates and propagated on trypticase soy
broth agar (TSBA) plates at 28oC for 2-3 d. Cells
were harvested and treated chemically to extract
and convert the fatty acids present in the cell wall
or cell membrane fractions to fatty acid methyl es-
ters (FAMEs) following the methods described by
Botha & Kock (1993). The total cellular FAMEs
were analyzed by GC and the resulting profiles
matched with those of yeasts available in the Mi-
crobial Identification system (MIDI) database in
Sherlock Version 4.5 software (Microbial ID, 1993).
Selected bacterial clones were subjected to the
polymerase chain reaction (PCR) based identifi-
cation reaction outlined by Vidal-Quist et al.
(2009). DNA was obtained by subjecting 24-h-old
cultures to thermal shock (Bravo et al., 1998). The
primer pair, UnlF 5'-CATGATTCATGCGGCA-
GATAAAC and UnlR 5'-TTGTGACACTTCT-
GCTTCCCATT, was used to amplify a 277-bp re-
gion of the cry1 gene (Vidal-Quist et al. 2009). Re-
sulting PCR products were sequenced with an
ABI Prism DNA Sequencer at the Interdiscipli-
nary Center for Biotechnology Research Core Fa-
cility at the University of Florida, Gainesville,
and the DNA sequences were compared to those
deposited in GenBank with BLAST (blastn).







Lietze et al.: Bt Infecting Colonized Cactoblastis cactorum


Bioassays


RESULTS AND DIsCussioN


The initial tier of assays was conducted to
determine if the particles observed in the killed
larvae were infectious. Approximately 100 mg
of dead larvae were homogenized in 1 mL of
sterile water and filtered through Miracloth".
The filtrate was applied onto the outer surface
of a block of diet. These blocks were then in-
fested with 25-50 mixed age larvae and incu-
bated at 25oC. These treated blocks were in-
spected daily.
A second series of bioassays were conducted
on bacteria isolated from heat-treated homoge-
nates from dead insects. A culture of B. thuring-
iensis var. kurstaki HD-1 was incorporated as a
positive control for the bioassays. Bacteria from
both sources were grown on NA for 5 d and
sporulating cultures transferred and suspended
into 1 mL of sterile 0.85% NaCl solution. These
suspensions were mixed vigorously and bacte-
rial/spore concentrations were estimated by
measuring optical density at 600 nm. In addi-
tion, serial dilutions were prepared and spot-
plated onto NA to determine colony forming
units (CFUs). A range of dilutions were applied
to small blocks of diet (101 to 106 CFUs/cm2 of diet
surface) that lacked the wax coating. A total of
10 third instars, sampled from containers
deemed clean of any detectable disease, were
placed on each block in individual 2.5-oz plastic
cups. Appropriate controls were established on
diet treated either with saline (blank) or with di-
lutions of a nonpathogenic Bacillus cereus spore
preparation (106 CFUs/cm2 of diet surface). In-
sects were incubated at 28oC under a photope-
riod of 12 h:12 h (L:D) and observed daily. Tissue
samples from dead larvae were sampled post-
mortem and examined under a phase contrast
microscope.
Larvae from each treatment that succumbed
to sepsis as well as insects fed the B. cereus prep-
arations were assayed to estimate bacteria
growth and sporulation. Insects collected 24 h
postmortem and living larvae from B. cereus
treatments were weighed, homogenized in sterile
saline (1 mg of insect tissue/100 p-L) and incu-
bated at 70oC for 30 min to select for heat resis-
tant bacterial spores. Heat-treated homogenates
were serially diluted and 2-pL aliquots of each di-
lution were spot-plated onto NA to estimate the
number of in vivo produced endospores. Statisti-
cal analysis was conducted with the Statistical
Analysis System (SAS) for Windows (SAS, 2004).
To obtain normal distribution, CFU counts were
logy, transformed. Transformed data were sub-
jected to ANOVA with the mixed procedure of
SAS and means were separated by the least-
square (1smeans) statement. Untransformed data
were expressed as average CFU/mg insect tissue
+ standard error.


The onset of disease symptoms in the colony
were dramatic, and within days after initial de-
tection all larvae within an affected container
succumbed to sepsis. None of these individuals
contained detectable Nosema-like spores that
were found previously to infest this colony
(Fig. 1). Microscopic examination of the tissue
smears from freshly killed larvae revealed the
presence of numerous Gram-positive rod shaped
bacteria (Fig. 2A). Within 24-48 h postmortem,
the rod shaped bacteria in the dead larvae sporu-
lated producing oval endospores and associated
inclusions (Fig. 2B). The initial tier of assays dem-
onstrated that crude insect homogenates were
highly virulent to second through fourth instars.
Within 24 h of exposure 100% of the larvae ex-
posed to homogenate-treated diet were dead and
displayed external symptoms identical to those
observed in the colony.
Plating of heat-treated insect homogenates
produced a uniform pattern containing thousands
of bacterial colonies. These colonies were cream-
colored and opaque with undulating margins and
had the general phenotype of bacilli. Examina-
tion of either wet mounts or Giemsa-stained
smears of the 1-d-old cultures revealed the pres-
ence of numerous rod shaped bacteria measuring
4-6 p-m long by 1 p-m in diameter. In addition to
these rods, a wide range of longer rods extending
greater than 25 p-m in length were observed in
these cultures (Fig. 3A). After 3 d of incubation
the cultures produced an abundance of highly re-
fractive oval spores. Microscopic examination of
Giemsa-stained preparations revealed that these
cultures also produced numerous parasporal
crystals (Fig. 3B) suggesting that the causal
agent was B. thuringiensis (Bt).
The MIDI analysis of spore-forming bacteria
isolated from heat-treated dead larvae best fit
(0.649) to the B. cereus subgroup A. The second
best fit (0.440) was B. thuringiensis var. kurstaki.
The inability of this method to place this isolate
close to known B. thuringiensis may reflect the
wide variation among different Bt isolates and/or
the fact that the precision of MIDI is reliant on a
high stringency of method standardization (Ad-
ams et al. 2005). The association of Bt isolates
with B. cereus subgroup A is in agreement with
the results of both MIDI and sequence analyses
that have been conducted on this bacterial group
(Wintzingerode et al. 1997; Bavykin et al. 2004).
In light of the presence of parasporal crystals in
cultures derived from dead C. cactorum, a series
of PCRs were conducted using universal primers
designed to amplify a fragment of the cry toxin.
All of the tested bacteria including the control B.
thuringiensis HD-1 strain produced identical
245-bp trimmed amplicons that had 100% homol-
ogy to the B. thuringiensis crylAb gene. In light of







Florida Entomologist 93(3)


September 2010


Fig. 1. Differential interference contrast micrograph of Malpighian tubules dissected from Nosenza-infected Cac-
toblastis cactorunz larvae. Numerous spores are produced throughout the length of tubules. As the infection devel-
ops, infected cells lyse and release numerous oval-shaped spores (see insert) into the hemocoel.


detection of the K-endotoxin gene the bacterial
isolates derived from C. cactorum have been de-
noted as BtCc.
The source of the BtCc was likely the ground
bean flour used in the artificial diet. Incubation of
the cannellini beans in nutrient broth after heat


treatment produced an array of sporulating
Gram-positive colonies. The majority of clones (19
out of 20) were Gram-positive bacilli that pro-
duced distinct centrally located endospores.
These clones lacked detectable parasporal crys-
tals, produced no PCR-generated amplicons with


Fig. 2. Phase contrast micrograph of tissue smears dissected from Cactoblastis cactorunt fed homogenates of dead
larvae sampled from infected rearing containers. Note the initial production of rod-shaped vegetative cells in the tis-
sues sampled several h postnzortent (A). After 24 h postnzortent (B) these vegetative cells in the hemolymph underwent
sporulation producing numerous highly refractive endospores and associated crystals (bars equal 20 p~m).







Lietze et al.: Bt Infecting Colonized Cactoblastis cactorum


**


Fig. 3. Micrographs of bacterial cells from nutrient broth cultures derived from heat-treated tissue homogenates
of dead Cactoblastis cactorum larvae. (A) Phase contrast micrograph of the exponentially growing vegetative cells
(bar equals 20 p~m). (B) Light micrograph of Giemsa-stained cells harvested during the stationary growth phase de-
picting sporulating cells with unstained refractive spores and numerous parasporal shaped crystals (cry) presumed
to be composed of the highly insecticidal 8-endotoxin.


the cry primers, and were nonpathogenic to C.
cactorum. These clones were presumed to be a
nonpathogenic B. cereus. However, one clone orig-
inating from the heat-treated bean flour produced
spores and associated parasporal crystals that
were identical to those in Fig. IB. This clone sub-
jected to PCR diagnostic testing produced an am-
plicon with a sequence identical to that observed
with isolates derived from the dead larvae.
The bioassays with spore crystal preparations
demonstrated that C. cactorum was highly sensi-
tive to B. thuringiensis. Exposure to diet treated
with high dosages (104-106 Spores /cm2 Of diet) of
either BtCc or HD-1 strains killed 100% of the
test larvae within 48 h post-exposure. At these
higher dosages there was no evidence of feeding
as reflected by the lack of frass production. It is
assumed that the ingestion of Bt-produced 6-en-
dotoxins induced an immediate disruption of gut
tissue that preceded larval death. At a lower dos-
age of 103 spores/cm2 Of diet, the two Bt prepara-
tions killed approximately 50% of the test larvae.
Treatments below this dosage level, including
control treatments, caused no larval mortality af-
ter 1 week of incubation. The overall sensitivity of
C. cactorum to the HD-1 is in agreement with the
data of Bloem et al. (2005). In their report, dip-
ping individual cladodes of Opuntia stricta in the
1X Dipel rate (Valent USA Corp., Walnut Creek,
CA) resulted in 100% neonate mortality.
Larvae that succumbed from the BtCc and
HD-1 treatments supported both bacterial
growth and sporulation. The BtCc isolate ap-
peared to be better adapted to replicate/sporulate
in C. cactorum than the HD-1 isolate. Plating ho-
mogenates of dead larvae taken from treatments
with 104 Or 105 spores/cm2 Of diet demonstrated
that the BtCc strain produced 4.1 x 105 + 1.4 x 106


heat resistant spores/mg larval tissue which was
significantly greater (t = 2.54, P = 0.016, df = 1)
than 2.0 x 105 + 1.1 x 105 heat resistant spores/mg
larval tissue produced in HD-1 killed larvae. In-
sects fed diet treated with nonpathogenic B.
cereus (high dosage) harbored 2.5 x 102 + 1.0 x 102
heat resistant spores/mg larval tissue. These
spore concentrations may be considered as back-
ground levels present in the food bolus. The abil-
ity of Bt to develop in this insect may explain the
rapid spread of this pathogen in the rearing con-
tainers. The response of an insect to B. thuring-
iensis treatment depends upon the level and the
type of bacterial toxins produced by the bacterial
strain, the presence and levels of endospores, and/
or the intrinsic properties of the hosts (Tanada &
Kaya 1993). Many insects are highly susceptible
to exposure to the K-endotoxins and undergo im-
mediate gut paralysis followed by death within Id
post-exposure without subsequent growth of the
ingested B. thuringiensis. In the present study,
sporulating cultures of both HD-1 and BtCc pre-
sumably produced K-endotoxins that caused a
rapid toxemia in treated larvae. Significantly, the
BtCc and to a lesser extent the HD-1 strain were
able to invade, replicate, and sporulate in C. cac-
torum. These findings conflict with the earlier bio-
assay results of Huang & Tamashiro (1966). In
this previous report, C. cactorum was found to be
highly sensitive to the toxic effects of B. thuring-
iensis, but dead larvae did not support bacterial
sporulation. Additional experiments conducted
by Huang & Tamashiro (1966) demonstrated that
the homogenates of larvae killed by B. thuringien-
sis, although containing vegetative cells, had no
impact on healthy conspecifics. It should be noted
that Huang & Tamashiro (1966) conducted their
assays with a B. thuringiensis var. thuringiensis.








Florida Entomologist 93(3)


September 2010


Their results suggested that application of this B.
thuringiensis isolate, although producing short-
term pest suppression, would not cycle in the in-
sect population.
In general, the response of C. cactorum to the
BtCc strain is similar to that found with stored
product insects and silkworm species that are
highly susceptible to the K-endotoxins and also
serve as a substrate for bacterial development
(Tanada & Kaya 1993). The ability of the highly
toxic BtCc isolate to replicate and sporulate in C.
cactorum is a key requisite for its long-term sur-
vival and dissemination in the population. Cacto-
blastis cactorum feeds in aggregates within the
cladodes of the cactus. Under this scenario, a sin-
gle larva succumbing to BtCc would produce
enough spores/6-endotoxins to kill all of the asso-
ciated healthy conspecifies feeding within a cac-
tus or in containers with semisynthetic diet.

ACKNOWLEDGMENTS

The authors gratefully acknowledge James Carpen-
ter and Susan Drawdy for providing the colony egg
sticks utilized to rear C. cactorum and Michael Ban-
aszek for providing the larvae and diet ingredients for
analysis.

REFERENCES CITED

ADAMs, D. J., GURR, S., AND HOGGE, J. 2005. Cellular
fatty-acid analysis of Bacillus thuringiensis var.
kurstaki commercial preparations. J. Agric. Food
Chem. 53: 512-517.
BAVYKIN, S. G., LYsov, Y. P., ZAKHARIEV, V., KELLY, J.
J., JACKMAN, J., STAHL, D. A., AND CHERNI, A. 2004.
Use of 16S rRNA, 23S rRNA, and gyrB gene se-
quence analysis to determine phylogenetic relation-
ships of Bacillus cereus group microorganisms. J.
Clin. Microbiol. 42: 3711-3730.
BLOEM, S., MIZELL III, R. F., BLOEM, K. A., HIGHT, S. D.,
AND CARPENTER, J. E. 2005. Laboratory evaluation
of insecticides for control of the invasive Cactoblastis
cactorum (Lepidoptera: Pyralidae). Florida Entomol.
88: 395-400.


BOTHA, A., AND KOCK, J. L. 1993.Application of fatty ac-
id profiles in the identification of yeasts. Intl. J. Food
Microbiol. 19: 39-51.
BRAVO, A., SARABIA, S., LOPEZ, L., ONTIVEROs, H.,
ABARCA, C., ORTIZ, A., ORTIZ, M., LINA, L., VILLALO-
BOs, F. J., PENA, G., NUNEZ-VALDEZ, M. E., So-
BERON, M., AND QUINTERO, R. 1998. Characteriza-
tion of cry genes in Mexican B. thuringiensis strain
collection. Appl. Environ. Microbiol. 64: 4965-4972.
CARPENTER, J. E., BLOEM, K. A., AND BLOEM, S. 2001.
Applications of F, sterility for research and manage-
ment of Cactoblastis cactorum (Lepidoptera: Pyral-
idae). Florida Entomol. 84: 531-536.
HUANG, S. S., AND TAMASHIRO, M. 1966. The suscepti-
bility of Cactoblastis cactorum (Berg) to Bacillus
thuringiensis var. thuringiensis. Proc. Hawaiian En-
tomol. Soc. 14: 213-221.
MARTI, O. G., AND CARPENTER, J. E. 2008. Rearing Cac-
toblastis cactorum (Lepidoptera: Pyralidae) on a fac-
titious meridic diet at different temperatures and
larval densities. Florida Entomol. 91: 679-685.
MICROBIAL ID INC. (1993) Microbial Identification Sys-
tem Operating Manual, Version 4. Microbial ID Inc.
(Newark, Del.).
PEMBERTON, R. W., AND CORDO, H. A. 2001. Nosema
(Microsporida: Nosematidae) species as potentialbi-
ological control agents of Cactoblastis cactorum
(Lepidoptera: Pyralidae): surveys for the microspo-
ridia in Argentina and South Africa. Florida Ento-
mol. 81: 527-529.
SAS. 2004. User's Guide, version 9.1. Cary, NC: SAS In-
stitute.
TANADA, Y., AND KAYA, H. K. 1993. Insect Pathology.
San Diego: Academic Press.
VIDAL-QUIST, J. C., CASTAFIERA, P., AND CABRERA, J. G.
2009. Simple and rapid method for PCR character-
ization of large Bacillus thuringiensis strain collec-
tions. Curr. Microbiol. 59: 421-425.
WINTZINGERODE, F., RAINEY, F. A., KROPPENSTEDT, R.
M., AND STACKEBRANDT, E. 1997. Identification of
environmental strains of Bacillus mycoides by fatty
acid analysis and species-specific 16S rDNA oligonu-
cleotide probe. FEMS Microbiol. Ecol. 24: 201-209.
ZIMMERMANN, H. G., MORAN, V. C., AND HOFFMANN, J.
H. 2001. The renowned cactus moth, Cactoblastis cac-
torum (Lepidoptera: Pyralidae): Its natural history and
threat to native Opuntia floras in Mexico and the Unit-
ed States of America. Florida Entomol. 84: 543-551.







Hou & Chen: New Species of Bambusiphage from China


ORIENTAL BAMBOO PLANTHOPPERS: TWO NEW SPECIES OF THE GENUS
BAM~BUSIPHAGA (HEMIPTERA: FULGOROIDEA: DELPHACIDAE) FROM
HAINAN ISLAND, CHINA


XIAOHUI HOU'.. AND XIANGSHENG CHEN'.2
1The Provincial Key Laboratory for Agricultural Pest Management of Mountainous Region, Guizhou University,
Guiyang, Guizhou Province, 550025 China

2Institute of Entomology, Guizhou University, Guiyang, Guizhou Province, 550025 China

3Zunyi Medical College, Zunyi, Guizhou Province, 563003 China

*Corresponding author; E-mail: chenxs3218@163.com

ABSTRACT

Two new species of the bamboo-feeding genus Banzbusiphaga, B. hainanensis Hou and Chen
sp. nov. and B. basifusca Hou and Chen sp. nov. (Hemiptera: Delphacidae), from Hainan Is-
land, Hainan Province, southern China, are described and illustrated. Banzbusiphaga hain-
anensis belongs to the citricolorata group and B. basifusca belongs to the fasica group. A key
to the 22 known species of this genus in the world is provided.

Key Words: Hemiptera, Fulgoroidea, Delphacidae, Banzbusiphaga, new species, China

RESUME

Se described e ilustran dos species nuevas del gi~nero Banzbusiphaga que se alimentan de
bambri, B. hainanensis Hou y Chen sp. nov. yB. basifusca Hou y Chen sp. nov. (Hemiptera:
Delphacidae), encontradas en la Isla Hainan Island, Provincia de Hainan, en el sur de
China. Banzbusiphaga hainanensis pertenece al grupo citricolorata y B. basifusca pertenece
al grupo fasica. Se provee una clave de las 22 species conocidas de este gi~nero en el mundo.


The delphacid genus Bambusiphaga (Hemi-
ptera: Fulgoroidea: Delphacidae: Delphacinae:
Tropidocephalini) was established by Huang &
Ding (1979) with 6 new species from southwest-
ern, southern, and eastern China (type species: B.
nigripuncata Huang & Ding 1979). Since then, 13
species have been added to the genus, respec-
tively, from China (11 species) (Kuoh 1980; Kuoh
et al. 1980; Ding 1982; Ding & Hu 1982; Asche
1983; Ding et al. 1986; Yang & Yang 1986; Yang
1989; Qin & Yuan 1999; Chen & Li 2000; Chen et
al. 2000; Qin et al. 2006; Chen & Liang 2007), The
Philippines (1 species) (Asche 1983), Singapore (1
species) (Asche 1983), Malaysia (1 species) (Asche
1983) and Northeastern Himalaya (1 species)
(Asche 1983). Twenty species have been recorded
in the world (Chen & Liang 2007). Chen & Liang
(2007) revised the species of Bambusiphaga and
divided the 20 known species into 7 species
groups based primarily on characters of male gen-
italia.
Species of Bambusiphaga feed exclusively on
bamboo (Bambusoideae) (Huang et al. 1979; Ding
et al. 1986; Yang & Yang 1986; Yang et al. 1999;
Ding 1999; Chen 2002; Chen 2003; Liu & Chen
2008). Specimens have been collected on the
leaves of several genera of bamboo including


Bambusa, Dendrocalamus, Sinocalamus, Neosi-
nocalamus, and Phyllostachys (Huang et al. 1979;
Ding & Hu 1982; Ding et al. 1986; Yang & Yang
1986; Chen & Li 2000; Chen et al. 2000; Ding
2006; Chen & Liang 2007).
We now describe and illustrate B. hainanensis
Hou and Chen, sp. nov. and B. basifusca Hou and
Chen, sp. nov., from southern China (Hainan
Province). Based on the morphological characters
and male genitalia, the 2 new species belong, re-
spectively, to the citricolorata group and the fa-
sica group. A key for identifying the 22 species of
the genus Bambusiphaga is provided.

MATERIALS AND METHODS

Morphological terminology used in this work
follows Yang & Yang (1986). Dry specimens were
used for the description and illustration. External
morphology of specimens was observed with a ste-
reoscopic microscope and characters were mea-
sured with an ocular micrometer. The genital seg-
ments of the examined specimens were macer-
ated in 10% KOH and details of the genitalia were
drawn from preparations in glycerin jelly with aid
of a light microscope. Illustrations of the speci-
mens were made with a Leica MZ 12.5 stereomi-







Florida Entomologist 93(3)


September 2010


croscope and were scanned with Canon CanoScan
LiDE 200, and then were imported into Adobe
Photoshop 8.0 for labeling and plate composition.
The designation of spines refers to the numbers of
apical spines of the hind tibiae and 1st and 2nd
hind tarsomeres. The type specimens and exam-
ined specimens are deposited in the Insect Collec-
tion at the Institute of Entomology, Guizhou Uni-
versity, Guiyang, Guizhou Province, China
(IEGU).

DESCRIPTIVE TAXONOMY
Banzbusiphaga Hung and Ding

Bambusiphaga Huang and Ding 1979: 170;
Asche, 1983: 211; Ding & Tian, 1983 (in Kuoh et
al. 1983): 49; Yang & Yang, 1986: 37; Wang &
Ding, 1996: 22; Ding et al., 1999: 441; Ding, 2006:
126; Chen & Liang, 2007: 504.
Type Species: Bambusiphaga nigripuncata
Huang and Ding 1979, by original designation.
Description: Slender and elongate delphacid
species, body length 2.8-5.2 mm (from apex of ver-
tex to end of forewing). General color milky-yel-
low to yellowish-brown, often with brown or black
markings.
Head, including eyes, narrower than prono-
tum. Vertex quadrate or rectangular, slightly
longer or shorter medially than width at base,
slightly narrower at apex than at base, lateral
margins more or less diverging anteriorly, apical
part slightly projecting in front of eyes, apical
margin evenly rounded into frons, submedian
carinae originating from near apical 1/3 of lateral
carinae, uniting at apex of vertex, lateral carinae
curved inward, Y-shaped carina distinct and fine.


Frons elongate, rectangular, longer at middle line
than wide (2.0-2.7:1), median carina distinct and
simple, lateral carinae parallel or subparallel.
Postclypeus with incomplete median carina, lat-
eral carinae absent. Rostrum reaching mesotro-
chanters, apical segment slightly longer than
wide. Antennae cylindrical, basal segment
slightly longer or equal to width, 2nd segment
longer than 1st (more than 2.7:1), reaching or not
reaching frontoclypeal suture. Pronotum about as
long as vertex, lateral carinae straight, reaching
or almost reaching hind margin. Mesonotum
longer at middle line than vertex and pronotum
together (about 1.3-2.0:1), median carina extend-
ing to tip of scutellum. Spinal formula of hind leg
5-6-4. Post-tibial spur without teeth along poste-
rior margin, but with an apical tooth. Forewing
much longer than abdomen, hyaline, cross vein
deposited medially, apical margin acutely
rounded.
Anal style small. Anal segment of male ring-
like, ventral margin with or without a process.
Pygofer with or without medioventral processes,
Aedeagus with or without phallobase; phallus
complex, tubular. Genital styles simple, with a
process, or forked apically. Seventh abdominal
sternite of female present or absent.
Host Plant: Bamboo (Bambusoideae). Speci-
mens were collected on leaves of bamboo in sev-
eral genera, Bambusa, Dendrocalamus, Sinocala-
mus, Neosinocalamus, and Phyllostachys (Huang
et al. 1979; Ding & Hu 1982; Ding et al. 1986;
Yang & Yang 1986; Chen and Li 2000; Chen et al.
2000; Chen & Liang 2007).
Distribution: Oriental region, with abundant
species in China.


KEY To SPECIES OF BAMBUSIPHAGA HUANG AND DING

1. Vertex dark brown or with blackish-brown markings ......... . . . .. . .. . .. 2
- Vertex without markings ......... .......... . . . .... .. .. .. ...3
2. Vertex yellowish-brown, basal compaliment with a black oval spot in middle palt (Huang et al. 1979); anal seg-
ment of male without process, pygofer without medioventral process. .. .. .. .. .. .. .. B. nigropunctata
- Vertex dark brown, basal compaliment of veltex without black oval spot; anal segment of male with a very long
process which surpasses base of genital styles; pygofer with conjugated medioventral processes

3. Mesonotum with blackish-brown markings .......... . . . . .. ..... .. .. .. .. 4

- Mesonotum lacking blackish-brown markings ......... . . . ... .... .. .. .. .. 7
4. Pronotum with blackish-brown markings on lateral areas; tegmina with blackish-brown markings on basal 1/2


-Pronotum and tegmina without above marking. .......... . . . . . ... .. .. .. 6

5. Basal 1/2 of tegmina black; pygofer without medioventral process; genital styles not forked at apex


- Basal 1/3 of tegmina with black marking; pygofer with conjugated medioventral processes; genital styles with
forked apex. ....................... .......... ..........B~zclt








Hou & Chen: New Species of Bambusiphage from China


6. Tegmina somewhat reddish-orange, costal margin blackish-brown; genital styles relatively broad and short
................................................ .Bngrnagna

- Tegmina somewhat yellowish-brown, costal margin yellowish-brown; genital styles relatively slender
...................~ ~ ~ ~ ~ .......... B.......... taiwanensis

7. Ventral margin of anal segment with a process .......... . . . . .. .. .. . . .. 8

- Ventral margin of anal segment without a process ......... .. . . . . .. . .. 13

8. Pygofer with 1 or 3 medioventral processes .......... . . . . .. ..... .. .. .. .. 9

- Pygofer without a medioventral process .......... . . . ... .. .. .. . . .. 10

9. Tegmina with a brown band along transverse vein, pygofer with 1 medioventral process .. .. .. .. B. bakeri

- Tegmina dark brown at basal 1/2, pygofer with 3 medioventral processes. .. .. .. .. .. ..B. basifusca sp. nov.

10. Process of anal segment very long, reaching ventral margin of pygofer. . . . .. .. .. . .. 11

- Process of anal segment very short ......... .......... .. .. .. .. . .. . 12

11. Body length of male 3.5-3.6 mm; genital styles with a process at base (Ding et al. 1986). . .. B. jinghongensis

-Body length of male 4.3 mm; genital styles without a process at base (Huang et al. 1979) .. .. B. nzirostylis

12. Apical 1/2 of pterygodes blackish-brown; hind margin of male pygofer with produced acute angle medially; gen-
ital styles slender; aedeagus without phallobase (Ding & Hu 1982) .. .. .. .. .. .. . .. . B. huangi

-Pterygodes yellowish-brown; hind margin of male pygofer not produced into an angle medially; genital styles
broad and short; aedeagus with developed phallobase . . . . . .. .. .. . ..B. wangnzoensis

13. Ventral margin of pygofer with a spine. ......... .......... . ... .. . . .. 14

- Ventral margin of pygofer without a spine .......... . . . . .. .. .. .. . . .. 15

14. With reddish-orange stripes along median carina of vertex and of pronotum; aedeagus without a process
...................~ ~ ~ ~ ~ B.......... luodianensis.........

- Without reddish-orange stripe along median carina of vertex or of pronotum; aedeagus with a contrary process
...................~ ~ ~ ~ ~ B.......... singaporensis. .......

15. Base of genital styles with a finger-like process. ......... . . . .... .. .. .. . .. 16

- Base of genital styles without a finger-like process ......... .. . . . . .. . .. 17

16. Near apex of genital styles with a finger-like process . . ...... ...... .. . . .. B. nzaolanensis

- Near apex of genital styles with a lobation-like process ... .. .. .. .. .. . .. . . B. hainanensis sp. nov.

17. Apex of genital styles forked (Asche 1983) .......... . . . . .. .. .. .. . . .. 18

- Apex of genital styles not forked ......... .......... .. . . .. .. . .. .. 20

18. Frons longer at middle line than wide at widest part, about 2.0: 1; basocaudal portion of genital styles in profile
produced into a right angle, granulate. ......... .. .. .. .. . .. . B. nzenbranacea

- Frons longer at middle line than wide at widest part, about 2.5: 1; basocaudal portion of genital styles in profile
not produced into a right angle (Asche 1983) ......... . .. .. .. . .. . .. .. . .. 19

19. Median portion of genital styles granulate. ......... . . . ... .. .. . .. B. furca

- Median portion of genital styles not granulate (Asche 1983) . . ...... .. .. .. .. . ..B. lynchi

20. Ventral margin of anal segment incised medially; genital styles short, lamellate. .. .. .. .. .. B. lacticolorata

- Ventral margin of anal segment not incised medially; genital styles slender .. .. .. .. . . .. . . .21

21. Apex of vertex obviously broadened, frons widest at base; apex of genital styles without small tooth; aedeagus
short, stout (Huang et al. 1979) . . . . .. ......... .. .. . . .. B. sintilis

- Apex of vertex not broadened, frons widest at apex; apex of genital styles with several small teeth; aedeagus
relatively long ......... .......... . . . .. . . .. ..B. citricolorata







Florida Entomologist 93(3)


September 2010


Banzbusiphaga hainanensis Hou and Chen
sp. nov. (Figs. 1-10)

Description. Length of body 1.5-1.8mm (male),
1.9-2.1mm (female); including forewing 2.9-
3.1mm (male), 3.4-3.5mm (female).
Coloration. General coloration light yellow or
reddish-orange. Forewings color lighter than
body, veins same to body, with a small brown
mark along cross vein near apex of clavus. Ocelli,
eyes dark brown. Abdomen color darker than


other area, pygofer yellowish white, anal style
dark brown.
Head and Thorax. Structural features as in ge-
neric descriptions. Vertex quadrate, length than
wider at base about 1.1:1, broader at apex than at
base (1:1.3), apical margin arch, carinae distinct,
submedian carinae uniting at apex. Frons oblong,
longer in middle line than wide at widest part
about 2.4:1, slightly narrower at apex than at
base, median carina simple. Clypeus developed,
postclypeus wider at base than frons at apex obvi-


Figs. 1-10. Banzbusiphaga hainanensis Hou and Chen, sp. nov. 1. Head and thorax, dorsal view; 2. Frons and
clypeus; 3. Fore wing; 4. Male genitalia, caudal view; 5. Male genitalia, lateral view; 6. Pygofer, caudal view; 7. Anal
segment, aedeagus, connective and genital style, lateral view; 8. Anal segment and suspensorium, posterior view;
9. Aedeagus, left side; 10. Left genital style, caudal-lateral view. Scale bars = 0.2 mm (Figs. 1-2, 4-7, 9-10); 0.4 mm
(Fig. 3); 0.1 mm (Fig. 8).


10







Hou & Chen: New Species of Bambusiphage from China


ously, median carina feeble. Antennae with first
segment long equal to wide, second segment 2.7
times as long as first, 2 segments together reach-
ing to frontoclyeal suture. Pronotum as long as
vertex, lateral carinae attaining hind margin.
Mesonotum about 1.3 times the length of vertex
and pronotum together, median carina attaining
the end of scutellum.
Male Genitalia. Anal segment of male ring-
like, no process. Pygofer in profile much longer
ventrally than dorsally, in posterior view opening
longer than wide, no process at ventral margin.
Aedeagus slender, very long, tubular, several
spines at dorsal and ventral margin of apical half,
blunt end with some small spines at apex. Genital
styles long, S-shaped, apical part turning out-
ward, tapering to apex, near apex and near base
respectively with 1 lobe-like process and 1
spinous process.
Specimens Examined. Holotype male, CHINA:
Hainan, Changjiang, Bawangling National Natu-
ral Reserve (19005'N, 109007'E), 600-880m,
24~28-IV-2009 (X.-H. Hou). Paratypes 4 males, 6
females, same data as for holotype; 11 males, 6 fe-
males, Hainan, Wuzhishan, Wuzhishan National
Natural Reserve (18o54'N, 109040'E), 668-800m,
13~15-IV-2009 (X.-H. Hou); Imale, 1 female,
Hainan, Lingshui, Diaoluoshan National Natural
Reserve (18o43'N, 109052'E), 300-850m, 9~12-IV-
2009 (X.-H. Hou).
Host Plant. Bamboo.
Etymology. This new species is named after
the type locality, Hainan Province, China.
Distribution. Southern China (Hainan:
Changjiang, Wuzhishan and Lingshui).
Remarks. Based on the morphological charac-
ters and male genitalia, this species should be-
long to the citricolorata group. This species re-
sembles B. maolanensis, but differs in the follow-
ing: genital styles near apex with 1 lobe-like pro-
cess (with 1 finger-like process in the latter);
aedeagus straight, with several teeth at dorsal
and ventral margin of apical half (in the latter,
aedeagus arched in middle, with 4 teeth sur-
rounding gonopore). It is distinguished from B.
citricolorata by aedeagus slender, with several
teeth at apical half, and some small spines at
apex (in B. citricolorata, aedeagus stout, with a
node and several short gear-like processes at
apex); genital styles tapering to apex, with 110be-
like process near apex (narrowing to apex, with
small teeth at apex in B. citricolorata).

Bambusiphaga basifusca Hou and Chen
sp. nov. (Figs. 11-21)

Description. Length of body 1.5-1.6 mm (male),
1.9-2.0 mm (female); including forewing 2.8-2.9
mm (male), 3.2-3.5 mm (female).
Coloration. Generally color yellowish white
with dark brown markings. Basal half of vertex,


margins and area between lateral carina of
pronotum (except oblong area dark brown mark-
ings), area of inner omia and escutcheon dirty yel-
lowish white. Apex half of vertex light yellowish
brown. Areas of outer lateral carinae of prono-
tum, mesonotum and outer area of omia dark
brown to blackish brown. Base and apical 1/3 of
fron and area of inner half of genae yellowish
brown, fron medial mostly, area of outer half of
genae and clypeus dark brown. First segment of
antennae brown, 2nd yellowish brown. Ocelli and
eye reddish brown to brown. Basal l/2 of forewing
black. Thorax yellowish brown to dark brown.
Femora of fore legs and median legs dark brown,
tibiae and digitus of fore legs and median legs and
femora of hind legs yellowish brown, tibiae and
tarsi of hind legs yellowish white. Abdomen dark
brown, except yellowish brown posterior margin
of each segment. Pygofer and anal segment dark
brown.
Head and Thorax. Structural features as in ge-
neric descriptions. Vertex quadrate, length than
wider at base about 1.1:1, narrower at apex than
at base (1:1.6), apical margin arch, carinae dis-
tinct, submedian carinae uniting at apex. Frons
oblong, longer in middle line than wide at widest
part about 2.5:1, broader at apex than at base,
median carina simple. Clypeus developed, post-
clypeus as wide at base as frons at apex, median
carina distinct. Antennae with first segment long
equal to wide, second segment 2.7 times as long as
first, both segments together not reaching to fron-
toclyeal suture. Pronotum as long as vertex, lat-
eral carinae attaining hind margin. Mesonotum
about 1.3 times the length of vertex and prono-
tum together, median carina attaining the end of
scutellum.
Male Genitalia. Anal segment of male ring-
like, right lateroapical angle strongly produced
into a long and slender process, surpassing ven-
tral margin of pygofer, slightly arched in lateral
view. Dorsal margin of pygofer obviously shorter
in profile than ventral margin. Opening of pygofer
longer than wide in posterior view, with 3 small
10be-shape processes on ventral margin medially.
Aedeagus slender, with simple phallobase. Phal-
lobase small, in profile broad at base, thin and
curved at apex. Phallus slender, long, tubular,
curved medially, blunt end. Genital styles moder-
ate long, broad at base, apical part turning in-
ward, tapering apically.
Specimens Examined. Holotype male, CHINA:
Hainan, Ledong, Jianfengling National Natural
Reserve (18o43'N, 108o53'E), 800-1400m, 17~20-
IV-2009 (X.-H. Hou). Paratype 4 males, 4 females,
same data as for holotype.
Host plant. Bamboo.
Etymology. This new species is named after
the distinctive characters by basal half of forew-
ing black, which can be distinguished from the
other species.







Florida Entomologist 93(3)


September 2010


19


Figs. 11-21. Bambusiphaga basifusca Hou and Chen sp. nov. 11. Head and thorax, dorsal view; 12. Frons and
clypeus; 13. Forewing; 14. Male genitalia, caudal view; 15. Male genitalia, lateral view; 16.Pygofer, caudal vew; 17.
Anal segment, aedeagus, connective and genital styles, lateral view; 18. Anal segment, right side; 19. Aedeagus,
ventral view; 20. Genital style, caudal view; 21. Right genital style, lateral view. Scale bars = 0.2 mm (Figs. 11-12,
14-19); 0.4 mm (Fig. 3); 0.1 mm (Figs. 20-21).


Distribution. Southern China (Hainan:
Ledong).
Remarks. Based on the morphological charac-
ters and male genitalia, this species should be-
long to the fasica group. This species resembles B.
fascia, but differs in the following: forewing of
male and female with basal half black (in the lat-
ter, forewing of female only with a dark brown
transverse stripe medially); median area of frons
dark brown (frons yellowish white in the latter);
pygofer with 3 small lobe-shaped medioventral


processes (absent in the latter); anal segment
with a right lateroapical angle process (with a left
lateroapical angle process in the latter); aedeagus
with simple phallobase (absent in the latter).

ACKNOWLEDGMENTS

This research was supported by the National Natu-
ral Science Foundation of China (No. 30100015,
30560020), China Postdoctoral Science Foundation (No.
2005037111), Program for New Century Excellent Tal-


20








Hou & Chen: New Species of Bambusiphage from China


ents in University (NCET-07-0220), the Provincial
Foundation for Excellent Youth in Science and Technol-
ogy Field of Guizhou (No. 20050520), Specialized Re-
search Fund for the Doctoral Program of Higher
Education (No. 20060657001), the Nomarch Foundation
for Excellent Talents in Science, Technology and Educa-
tion Field of Guizhou (No. 2005357), and the Interna-
tional Science and Technology Cooperation Program of
Guizhou (20107005), all awarded to X.-S. Chen.

REFERENCES CITED

ASCHE, M. 1983. Banzbusiphaga lynchi nov. spec., a
new Delphacid from Northeastern Himalaya, and
some contributions to the genus Banzbusiphaga
Huang and Ding, 1979 (Homoptera: Auchenorrhyn-
cha: Fulgoromorpha: Delphacidae). Marburger En-
tomological Publication 1: 197-210.
CHEN, X. S. 2002. Homoptera: Delphacidae, pp. 155-166
In Z.-Z. Li and D.-C. Jin [eds.], Insects from Maolan
Landscape. Guizhou Science and Technology Pub-
lishing House, Guiyang.
CHEN, X. S. 2003. Key to genera of the tribe Tropi-
docephalini (Hemiptera: Fulgoroidea: Delphacidae)
from the People's Republic of China, with description
of a new genus. The Canadian Entomol. 135: 811-
821.
CHEN, X. S., AND LI, Z. Z. 2000. Description of two new
species of Delphacidae attacking bamboo from
Guizhou Province, China (Homoptera: Delphacidae).
Acta Zootaxonomica Sinica 25: 178-182.
CHEN, X. S., LI, Z. Z., AND JIANG, S. N. 2000. Description
of two new species of Delphacidae attacking bamboo
from China (Homoptera: Fulgoroidea). Scientia Sil-
vae Sinicae 36: 77-80.
CHEN, X. S., AND LIANG, A. P. 2007. Revision of the Ori-
ental Genus Bambusiphaga Huang and Ding (Hemi-
ptera: Fulgoroidea: Delphacidae). Zoological Stud-
ies. 46(4): 503-519.
DING, J. H. 1982. Two new species of the tribe Tropi-
docephalini (Homoptera: Delphacidae). J. Nanjing
Agricultural College 4: 42-45.
DING, J. H. 2006. Fauna Sinica. Insecta Vol. 45. Ho-
moptera Delphacidae. Editorial Committee of Fauna
Sinica, Chinese Academy of Science. Science Press,
Beijing, China.
DING, J. H., AND HU, G. W. 1982. A new species of the ge-
nus Banzbusiphaga from Yunnan (Homoptera: Del-
phacidae). Acta Entomologica Sinica 25: 443-444.


DING, J. H., YANG, L. F., AND HU, C. L. 1986. Descrip-
tions of new genera and species of Delphacidae at-
tacking bamboo from Yunnan Province, China. Acta
Entomologica Sinica 29: 415-425.
DING, J. H., HUANG, B. K., AND ZHOU, W. X. 1999. Del-
phacidae of Fujian (Homoptera: Fulgoroidea), pp.
432-464 In B.-K. Huang [ed.], Fauna of Insects in
Fujian Province of China, Vol. 2. Fujian Science and
Technology Publishing House, Fuzhou.
HUANG, C. L., TIAN, L. X., AND DING, J. H. 1979. A new
genus and some new species of Delphacidae attack-
ing bamboos in China. Acta Zootaxonomica Sinica 4:
170-181.
KUOH, C. L. 1980. Descriptions of five new species of
Delphacidae (Homoptera). Acta Entomologica Sinica
23: 195-201.
KUOH, C. L., DING, J. H., TIAN, L. X., AND HUANG, C. L.
1983. Economic insect fauna of China, fasc. 27, Ho-
moptera, Delphacidae. Beijing: Science Press.
KUOH, C. L., HUANG, C. L., TIAN, L. X., AND DING, J. H.
1980. New species and new genus of Delphacidae
from China. Acta Entomologica Sinica 23: 413-426.
LIU, M. H., AND CHEN, X. S. 2008. Occurrence and harm
of planthoppers in bamboo grove in Guiyang.
Guizhou Agricultural Science 36: 87-89.
MUIR, F. 1917. A new Philippine genus of Delphacidae.
The Philippine J. Science 12: 351-352.
MUIR, F. 1919. Some Malayan Delphacidae (Ho-
moeptera). The Philippine J. Science 15: 521-531.
QIN, D. Z., AND YUAN, F. 1999. One new species of the
genus Banzbusiphaga (Homoptera: Delphacidae)
from China. Entomotaxonomia 21: 33-35.
QIN, D. Z., ZHANG, Y. L., AND DING, J. H. 2006. A taxo-
nomic study of the genus Banzbusiphaga (Hemi-
ptera, Fulgoroidea, Delphacidae). Acta Zootaxonom-
ica Sinica 31: 148-151.
WANG, J. C., AND DING, J. H. 1996. Delphacidae fauna of
Gansu Province, China (Homoptera: Fulgoroidea).
Gansu Science and Technology Press, Lanzhou.
YANG, C. T. 1989. Delphacidae of Taiwan (II) (Ho-
moptera: Fulgoroidea). National Science Council
Special Publication 6: 1-334.
YANG, J. T., AND YANG, C. T. 1986. Delphacidae of Tai-
wan (I) Asiracinae and the tribe Tropidocephalini
(Homoptera: Fulgoroidea).Taiwan Museum Special
Publication Series 6: 1-79.
YANG, L., CHEN, X. S., AND CHEN, H. M. 1999. Notes on
planthoppers infesting bamboo in Guizhou. J. Moun-
tain Agriculture and Biology 18: 154-161.







Florida Entomologist 93(3)


September 2010


DETERMINATION OF THE LIFE CYCLE OF SCYPHOPHORUS
ACUPUNCTATUS (COLEOPTERA: CURCULIONIDAE) UNDER
LABORATORY CONDITIONS


MA. ELENA VALDis ESTRADA MARiA CANDELARIA HERNANDEZ REYES MIRNA GUTIERREZ OCHOA'
AND LUCILA ALDANA LLANOS'
'Centro de Desarrollo de Productos Bi6ticos del lnstituto Politi~cnico Nacional, Carretera Yautepec-Jojutla Km. 8.5,
Col. San Isidro, Yautepec, Morelos, M~xico, C.P. 62731

1Becarias COFAA, EDI, mvaldes~ipn.mx

ABSTRACT

In this study of the development cycle of Scyphophorus acupunctatus Gyllenhal, during the
month of Feb the incubation period of eggs averaged of 5.9 d. There were 6 instars, and larval
development was completed in an average of 34.9 d. Adults lived an average of 413.8 d. Dur-
ing Sep, eggs hatched in 5.5 d, and there were 8 instars, lasting 54.2 d; adult longevity av-
eraged of 433.7 d. There were 7 instars. The size of the head capsule was 0.7 mm for L1 and
up to 2.8 mm for L7. Measurements of head capsule width used to determine instar in the
field fell into 9 numerical groups, indicating there are 9 well-defined larval stages for S. acu-
punctatus. There is high mortality in the egg stage and of larvae in the first stages; while in
the final larval stages and in the emergence of the adults there is a long period of stability
in which the mortality is reduced to the minimum, and increases noticeably at the end of the
adult stage.

RESUME

En este studio de ciclo de desarrollo se obselv6, que para el period de febrero la incubaci6n
de los huevos fue de 5.9 dias en promedio, se detectaron seis estadios larvales, con una du-
raci6n de 34.9 dias, mientras que la longevidad del adulto fue de 413.8 dias en promedio. En
el period de septiembre la incubaci6n de los huevos fue de 5.5 dias, con ocho estadios larva-
les, que tuvieron una duraci6n de 54.2 dias; la longevidad del adulto fue de 433.7 en prome-
dio. Se determinaron siete estadios larvales para S. acupunctatus. El tamafio de la c~psula
cefilica que fue de 0.7 para L1 hasta 2.8 mm, para L7. Con el mi~todo de medici6n de la an-
chura de c~psula cefilica de lairas obtenidas en campo para determinar los estadios larva-
les, se determinaron nueve grupos numibricos, lo que indica que los valores representan a
nueve estadios larvales bien diferenciados para S. acupunctatus. En las curvas de sobrevi-
vencia se obselv6 que hay una alta moltalidad en la etapa de huevo y de lairas en los pri-
meros estadios; mientras que en los Tiltimos estadios larvales y en la emergencia de los
adults se present una etapa larga de estabilidad en la que la moltalidad se reduce al mi-
nimo y despui~s aumenta marcadamente al final de la etapa adulta.

Translation provided by the authors.


In the state of Morelos, Mexico, the cultivation
of ornamental plants is an important component
of the economy. The warm climate of the southern
and central zones of this state (18026' to 18052'
and 900-1330 msnm) favors commercial produc-
tion of ornamentals such as the tuberose, Polian-
thes tuberusa L. (Liliales: Agavaceae). The black
weevil Scyphophorus acupunctatus Gyllenhal, is
a major pest of this plant, infesting 51% of the
bulbs (Camino et al. 2002). This insect also has
been reported as an important pest of other com-
mercial crops (Agave tequilana Weber, Agave
americana var. expansa) (Valenzuela 1994; War-
ing & Smith 1986), as well as wild yuccas and
agaves (Pott 1975; Morton & Dawling 1992).
The weevil is considered a multivoltine species
with generations overlapping throughout the


year (Solis et al. 2001; Waring & Smith 1986). The
larvae as well as the adults feed on the bulbs of
tuberose, where they form a series of chambers
before they pupate. Pupation occurs within a co-
coon formed from fiber and mud. After emergence,
the adults remain among the bulbs where they
copulate, and where the females lay eggs
(Hermindez et al. 2001). In addition to the dam-
age caused by the boring of larvae in the plant tis-
sue, some phytopathogens associated with the
weevil may cause wilting and later death of the
plant (Waring & Smith 1986).
Siller (1985) studied development of the weevil
in the laboratory on Agave atrovirens and found
that on this food plant the incubation period of
the eggs was 8 d, the average duration of the lar-
val stage was 58 d and the average pupal period







Valdds Estrada et al.: Life Cycle of Scyphophorus acupunctatus


was 13 d, and the total period from oviposition to
adult emergence was 81 d. Lock (1969) indicated
that the larval stage of this species may have a
duration of 21 to 58 d with 5 instars on sisal de-
pending on the relative humidity of the environ-
ment. In henequen (Agave fourcroydes), Ramirez
(1993) reported 11 larval stages with a life cycle
averaging 108 d. This differs, however, from the
life cycle duration observed in tuberose.
The objective of the present study was to deter-
mine the life cycle of the black weevil S. acupunc-
tatus feeding on tuberose bulbs under laboratory
conditions, and to develop life tables, which are
useful for understanding the population dynam-
ics (Cividanes 2002) of a species and to study
some aspects of the biology of the insect (Kazak et
al. 2002). This information will support develop-
ment of better strategies for management of this
pest.

MATERIALS AND METHODs

Study Site

The work was done in the Entomology Labora-
tory of the Plant-Insect Interactions Department,
Biotic Products Development Center, Instituto
Polit~cnico Nacional in Yautepec, Morelos, Mex-
ico. A Precision model 818 incubator (USA) was
used to maintain the following conditions: tem-
perature of 27 + 2oC, relative humidity 60% and a
photoperiod of 12-12 h.

Insects

Laboratory cultures of S. acupunctatus were
established with weevils in various stages of de-
velopment from collections in a commercial tube-
rose plantation in the Municipality of Emiliano
Zapata, Morelos. In the laboratory, the larvae and
adults were fed separately on tuberose bulbs, un-
til F2 adults were obtained. Eggs were then col-
lected from 45 pairs of adults.

Development Cycle

The study was done during 2 periods, one be-
ginning in Feb 2000 and the other beginning in
Sep 2001. Life tables were used to estimate the
duration of the different stages of the life cycle. A
cohort of 64 eggs was used for the period begin-
ning in Feb 2000 and 59 eggs for the period begin-
ning in Sep 2001. In both studies, the eggs were
separated and placed on moistened filter paper in
plastic Petri dishes (60 mm in diameter). These
dishes were held in the incubator at constant
temperature and relative humidity. Observations
were made daily during the incubation period.
As they emerged, each larva was placed in a
hole 3 mm deep made with a dissecting needle in
a 5-g tuberose bulb. Larvae were transferred to


these holes with a No. O camel's hair brush, and
the bulbs containing larvae were placed in 70-ml
plastic containers with small perforations in the
cover to allow for air circulation to prevent accu-
mulation of excess moisture. The containers with
the bulbs and larvae were placed in the incubator
at the specified environmental conditions. The
bulbs were replaced every 3 d so that the larvae
would always have fresh food. As the larvae grew
(stages 5 to 8) heavier bulbs were used (15 to
17 g). Observations were made daily and the fol-
lowing events were recorded: successive larval
molts, pupation, adult eclosion, and mortality.
Pupae were retained in the plastic containers in
which they had developed, but the bulbs were re-
moved. The pupae were inspected daily and
changes recorded until adult eclosion. The adults
obtained were fed in groups with tuberose bulb
and their longevity was recorded. The life table
and survivorship curves were constructed from
these observations. The Mann-Whitney test was
applied (P s 0.05) to compare the development cy-
cle in the 2 periods of the year.
The number of larval stages was determined
by 2 methods: (a) direct observation and quantifi-
cation of larval molts in the laboratory and (b)
quantification of the width of the head capsule of
400 larvae obtained in field collections. Direct ob-
servations in the laboratory were made daily and
molts were recorded. Molts were indicated by the
presence of exuviae, in which the head capsule
was the most evident structure. The width of each
head capsule was measured at its widest point.
For the second method, 400 larvae collected in the
field were fixed in alcohol at 70%, and then were
classified by the different sizes detected and the
width of the cephalic capsules. The measure-
ments in both methods were done with the aid of
a vernier and a Nikon stereoscopic microscope.
The data were used to construct a frequency dis-
tribution for graphic representation. For this pur-
pose, the number of intervals was determined by
the equation proposed by Sturges: K = 1 + 3.322
log n, where K is the number of class intervals
and n is the number of values in the data set. In
addition, the amplitude of the interval was calcu-
lated by the relationship, W = R/k, where R is the
amplitude and W is the dimension of the class in-
tervals (Pagano & Gauvreau 2001).

RESULTS AND DIsCussioN

Description of the Developmental Stages

Recently laid eggs are white, turning yellow as
the embryo develops. They are elongate measur-
ing 1.2 to 1.5 mm in length and 0.5 to 0.6 mm di-
ameter (Fig. la); incubation requires 4-5 d. The
larvae are legless, yellowish white in color
(Fig. lb). Recently hatched larvae are the same
size as the egg, with spiracles on the abdominal











snout in the tuberose bulbs and covered with a
sticky substance that dries after a few minutes,
turns black, and hardens. This cover protects the
larva when it hatched and begins to feed by bor-
ing into a bulb. This description agrees with that
of Siller (1985) for the same species.

Development Cycle

For the period of development in Feb 2000, the
eggs hatched on average at 5.9 d. Six 6 instars
were detected, with larval development requiring
34.9 d, and longevity of adults was an average of
413.8 d. In Sep 2001 eggs hatched in 5.5 d, and
there were 8 instars. Larval development oc-
curred in 54.2 d and adults lived an average of
433.7 d (Table 1). The results indicated a signifi-
cant difference between the 2 periods of the year
in the duration of the egg, larval, and adult
stages. These differences are probably due to the
fact that although the insects were maintained
under controlled conditions of temperature and
humidity, the environmental conditions were dif-
ferent at the start of the observations, given that
in Sep (the rainy season) the humidity and tem-
perature are higher than in Feb. The prepupal
and pupal stages are probably less vulnerable or
sensitive to the influence of environmental fac-
tors, because they are within the cocoon and their
metabolism is diminished.
These results agree, except for the number of
instars, with those reported by Siller (1985), who
pointed out that in pulque maguey A. atrovirens
the incubation period of the eggs varies from 3 to
8 d, with 3instars that require 58 d to complete
their development in the fall period. Lock (1969)
indicated that the larval stage in sisal Agave si-
salana depends on the moisture content in the en-
vironment and can require a duration of 21 to 58
d with five instars, whereas in the henequen crop
Agave fourcroydes, Ramirez (1993) reported 11 in-
stars with a life cycle duration of 108 d on aver-
age. In addition, he pointed out that the life cycle
duration can be affected by nutrition, and the pu-
pal stage required approximately 3 d.


TABLE 1. DURATION IN DAYS (AVERAGE + STANDARD ER-
non) IN THE DEVELOPMENT STAGES OF S. ACU-
PUNCTATUS FOR 2 SEASONS OF THE YEAR.

Stages/periods Feb Sep

Egg 5.9 20.10* 5.5 20.07
Larva 34.9 2 0.24* 54.2 e0.26
Prepupa 2.2 e0.06 2.1 e0.07
Pupa 9.7 20.08 9.7 20.07
Adult longevity 413.8 24.68* 433.7 2 5.74

*Significant differences are indicated for each stage when
comparing the 2 periods of the year (Mann-Whitney nl = 64, n.2
= 59. Ps 0.05).


Florida Entomologist 93(3)


September 2010


a b


c d

Fig. 1. Developmental stages of S. acupunctatus (a)
eggs, (b) larvae of different stages, (c) pupa and cocoon
(d) adult.



segments. Seta of the meso- and metathoracic epi-
pleurites are subequal in length; the back edge of
abdominal segment 9 with a pair of projections
(longer than wide), each one with 3 elongated se-
tae (Woodruff & Pierce 1973). Larvae develop
through 7-9 instars with an average development
time of 34.9 to 54.2 d. In this stage great losses oc-
cur, given that it passes its entire larval stage
feeding on the interior of the tuberose bulb. The
larva in the final stage forms a cocoon, with fibers
of the tuberose bulb or with mud. In the prepupal
stage, it stops feeding (it still has the larval form),
is almost immobile, and makes only circular
movements of its terminal segments, passing
from 1 to 2 d in this stage.
The pupa is exarate, measuring an average of
16 mm in length, cream colored, turning dark as
it matures (Fig. Ic). The pupal stage lasts 9-10 d.
Developing wings are apparent on the dorsal side
of the pupa, and the head, snout, eyes, and anten-
nae on the ventral side. In the thorax the legs can
be seen in process of formation. Adults are robust
and shiny black, finely punctuate, measuring 12-
15 mm in length, (Fig. Id), without scales or dor-
sal setae, elytra striated without pubescence; the
face (snout) is thick and curved, nearly as long as
the pronotum, antenna geniculate, inserted at the
base of the snout, and the antennal club corneous
is compact with the apical part of a spongy ap-
pearance and concave. The adults are relatively
long lived, surviving from 414 to 433 d under lab-
oratory conditions. The observed sex ratio
(male:female) was 2:1. The eggs are laid singly in
small perforations made by the female with the











Determination of the Number of Instars

Based on direct quantification of molts and
width of cephalic capsule of laboratory larvae, 7
instars were determined for C. acupunctatus. The
size of the cephalic capsule was 0.7 mm for L1,
and up to 2.8 mm for L7 (Table 2). The average
larval life was 47 d, while the pupal stage had an
average duration of 10.5 d. Based on cephalic cap-
sule widths on larvae obtained from the field, we
observed nine numerical groups, indicating 9 well
differentiated instars for S. acupunctatus (Fig. 2).
These data do not coincide with what was re-
ported by Siller (1985) in pulque maguey, in
which he found 3 instars after measuring the
cephalic capsules.
One disadvantage of the daily inspection of in-
sects is that larvae can be damaged by manipula-
tion, exposure to light, and loss of moisture. Be-
cause they are so small, the exuviae of the larvae
of the 2 instars can be lost among the debris or the
decayed parts of the bulb.
The difference with respect to the number of
instars and the width of the cephalic capsule (Ta-
ble 2 and Fig. 2) from our laboratory study com-
pared with the measurement from the field popu-
lation is that the field population was not manip-
ulated on a regular basis, and cephalic capsules
are larger in the insects collected in the field and
smaller in the insects maintained in the labora-
tory. Our study indicates that the number of in-
stars in this species varied from 6 to 9 instars. Ac-
cording to Salas & Frank (2001), this is due to the
fact that Curculionidae, in contrast to other fam-
ilies of insects, do not present a fixed number of
larval stages. Thus Hill (1983) reported 5 instars
lasting 21 to 53 d for S. acupunctatus feeding on
sisal A. sisalana, whereas Ramirez (1993) found
that in henequen A. fourcroydes, the cycle is com-
pleted in an average of 108 d with 111nstars, and
mentioned that this can be affected by nutrition
during the larval stage. In contrast, Siller (1985)
and Ramos-Elorduy et al. (1986) indicated 3 in-
stars for this weevil in pulque maguey A. atrovi-



TABLE 2. MEASUREMENTS OF THE CEPHALIC CAPSULE OF
THE LARVAL STAGES OF S. ACUPUNCTATUS.

Cephalic capsule
Stage mm

L1 0.7
L2 1.4
L3 1.5
L4 1.7
L5 2
L6 2.4
L7 2.8

Beginning of the study Feb of 2000, n. = 64.


Valdds Estrada et al.: Life Cycle of Scyphophorus acupunctatus


a w


8


mangtin mm


Fig. 2. Frequency distribution of head capsule width
in larvae of S. acupunctatus n = 400.



rens. These results indicate that S. acupunctatus
is able to vary the number of larval stages, larval
length, and width of head capsule according to
the type of host and environmental conditions
such as nutrition.


Life Table

In the life table of S. acupunctatus for the 2
seasons, the highest values of life expectancy for
both cases are found in the final instars, in the pu-
pal stage, and at the beginning of the adult stage.
In this case we believe that the key mortality fac-
tor was the manipulation of the individuals in the
experiments. The survival curves show that there
was high mortality in the egg stage and early in-
stars. On the other hand, in the final instar and in
the emergence of the adults there is a long period
of stability in which mortality was reduced to a
minimum, but later increased considerably at the
end of the adult stage, which lasted for up to 445
d in the Feb study and 475 d in the Sep study (Fig.
3). The above indicates that the resulting curves
could be placed between type III and type IV, re-
spectively, according to Krebs (1985), because ac-
cording to these curves, the mortality is concen-
trated in the early stages of development, while in
the adult phase the mortality tends to be lower.
According to the results obtained, the tuberose
black weevil could be catalogued as a "K" strate-
gist, along with the black banana weevil Cosmop-
olites sordidus, which has a prolonged life span,
given that the adults can live more than 1 year
and is considered to have "K" strategy, according
to Gold & Messiaen (2000).








Florida Entomologist 93(3)


September 2010


0-5 21-25 41-4 51-85 81.85 S-10510121-12514t.I~145461.t6515-002162i ~237 0 2 S~1183-225262 1-25t-153316333351-35557-575401-40542U11-4241Sb-445 61-

time [days

-*-nx(febnrary00 1 ---nx(septem ber 01


Fig. 3. Survival curve of S. acupunctatus under laboratory conditions (temperature of 27 -t 2"C relative humidity
609').


The results obtained in this work are very impor-
tant for designing a management program in which
several strategies are used within a program of in-
tegrated pest management, according to the biology
of the species in different hosts, and regions with
different conditions temperature and humidity.

REFERENCES CITED

CAMINO, L. M., CASTREJi)N, G. V., FIGUEROA, B. R., AL-
DANA, L. L., AND VALDis, E. M. E. 2002. Scyphopho-
rus acupunctatus Gyllenhall, (Coleoptera: Curcu-
lionidae) Attacking Polianthes tuberosa (Liliales:
Agavaceae) in Morelos, M~xico. Florida Entomol.
85(2): 392-393
CIVIDANES, F. J. 2002. Tabelas de vida de fertilidade de
Brevicoryne brassicae (L.) (Hemiptera: Aphididae)
em condicoes de campo. Neotropical Entomology
Brasil 31(3): 419-427.
GOLD, C., AND MESSIAEN, S. 2000. El picudo negro del
banano Cosnzopolite sordidus. INIBAP. Red Interna-
cional para el mejoramiento del banano y el pl~tano.
Hoja divulgativa. Plagas de musa. No. 4.
HERNANDEZ, R. M. C., GUTIERREZ, O. M., VALDis, E.
MA. E., ALDANA, LL. L., AND FIGUEROA, B. R. 2001.
Desarrollo del picudo negro Scyphophorus acupune-
tatus Gyllenhall (Coleoptera: Curculionidae), en bul-
bos de nardo. Memoria de Reuni6n Interamericana
de Ciencias Horticolas, Oaxatepec, Morelos. Mi~xico.
HILL, D. S. 1983. Agricultural insect Pests of the Tropics
and Their Control. Cambridge Univ. Press. New
York. 394 pp.
KAZAK, C., YILDIZ, S., AND SEKE~ROGLU, E. 2002. Biolog-
ical characteristics and life tables of Nreoseiulus um-
braticus Chant (Acari, Phytoseiidae) at three con-
stant temperatures. Anzeiger fur Schadlingskunde.
Turquia 75(5): 118-121.
KREBS, C. H. J. 1985. Ecologia Estudio de la Distribuci6n y
la Abundancia. Ed. Harla. M~xico, D. F. 189 pp.
LOCK, G. W. 1969. Sisal. Thirty Years Sisal Research in
Tanzania. Second Edition. Tanganyika Sisal Grow-
ers' Association. Longmans Green and Coltd. Lon-
don. 365 pp.


MORTON, J. F., AND DAWLING, C. F. 1992. The spineless
yucca deserves more attention as an ornamental and
food plant. Proc. Florida State Holt. Soc. 104: 341-

PAC )O, M., AND GAUVREAU, K. 2001. Fundamentos de
Bioestadistica. Segunda edici6n. Thomson Learning.
Mi~xico D.F. 97-124 pp.
POTT, J. N. 1975. A yucca borer Scyphophorus acupunc-
tatus in Florida. Proc. Florida State Hort. Soc. 88:
414-416.
RAMiREZ, CH. J. L. 1993. Max del henequi~n Scyphopho-
rus interstitialis bioecologia y control. Serie libro ti~c-
nico. Centro de investigaci6n Regional del Sureste.
INIFAP- SARH. Mi~rida, Yucat~n, M~xico.
RAMOS-ELORDUY, J. M., SILLER, G., AND RAMiREZ, S.
1986. Ciclo Biol6gico de Scyphophorus acapunctatus
Gyll. (Coleoptera: Curculionidae) en laboratorio y al-
gunas consideraciones sobre su impact econ6mico.
Folia Ent. Mex. 49: 98-99.
SALAS, J., AND FRANK, J. H. 2001. Development of Meta-
nzasius callizona. Florida Entomol. 84(1): 123-126.
SILLER, J. M. G. 1985. Ciclo biol6gico en laboratorio del
picudo del maguey Scyphophorus acupunctatus Gyll.
(Coleoptera: Curculionidae) y algunas consid-
eraciones sobre su impact econ6mico. Tesis profe-
sional. UNAM. Mi~xico, D.F. 91 pp.
SOLis, A. J. F., GONZALEZ, H. H., LEYVA, V. J. L.,
EQUIHUA, M. A., FLORES, M. F. J., AND MARTiNEZ, G.
A. 2001. Scyphophorus acupunctatus Gyllenhal pla-
ga del agave tequilero en Jalisco, Mi~xico. Agrocien-
cia. 35(6): 663-670.
VALENZUELA-ZAPATA, A. G. 1994. El agave tequilero.
Ed. Litteris. pp. 121-137.
WARING, G. L., AND SM1ITH, R. L. 1986. Natural history
and ecology of Scyphophorus acupunctatus (Co-
leoptera: Curculionidae) and its associated microbes
in cultivated and native agaves. Ann. Entomol. Soc.
America. 79(2): 334-340.
WOODRUFF, R. E., AND PIERCE, W. H. 1973. Scyphopho-
rus acupunctatus, a weevil pest of Yucca and Agave
in Florida (Coleoptera: Curculuionidae). Entomology
Circular No.135. Division of Plant Industry, Florida
Depaliment of Agriculture and Consumer services,
Tallahassee, Florida.







Xu et al.: New Species ofAn~teon. from China


TWO NEW SPECIES OF ANTEON (HY1VENOPTERA: DRYINIDAE) FROM CHINA


ZAIFU XU', MASSIMO OLMI2 AND JUNHUA HE3
1College of Nature Resources and Environment, South China Agricultural University, Guangzhou,
Guangdong 510642, P. R. China

2Depaliment of Plant Protection, University of Tuscia, I-01100 Viterbo, Italy

3Depaliment of Plant Protection, Zhejiang University, Hangzhou, Zhejiang 310029, P. R. China

ABSTRACT

Two new species, Anteon liui sp. nov. and Anteon zhangae sp. nov., are described from
China. The first species was collected in Henan Province, Mt. Baiyunshan, and Zhejiang
Province, Mt. Fenyangshan; the second species was collected in Guizhou Province, Mt.
Leigongshan. Anteon liui can be recognized from the related Oriental species A. hirashintai
Olmi 1993 and A. austini Olmi 1991 by the different length of notauli (reaching about 0.65
length of scutum in A. liui, reaching 0.3-0.4 length of scutum in A. hirashintai and A. aus-
tini).Alnteon zhangae can be recognized from the related Oriental species A. nzuiri Olmi 1984
by the following characters: in A. nzuiri, notauli reaching about 0.65 length of scutum;
scutum weakly punctate; head with OOL more than twice as long as OL; inA. zhangae, no-
tauli reaching about 0.8 length of scutum; scutum sculptured by large and deep punctures
similar to areolae; head with OOL slightly longer than OL.

Key Words: Taxonomy, Hymenoptera, Dryinidae, Anteon, new species, China

RESUME

Se described dos nuevas species de China, Anteon liui sp. nov. y Anteon zhangae sp. nov.
La primera de ellas fue colectada en la Provincia de Henan, Monte Baiyunshan, y en la Pro-
vincia de Zhejiang, Monte Fenyangshan: la segunda especie fue colectada en la Provincia de
Guizhou, Monte Leigongshan.Anteon liui puede ser diferenciado de las otras species rela-
cionadas en la Regi6n Oriental, A. hirashintai Olmi 1993 yA. austini Olmi 1991, por la lon-
gitud de las notauli (alcanzando aprox. 0.65 del largo del scutum enA. liui, mientras que en
A. hirashintai yA. austini alcanza entire 0.3-0.4 del largo). Anteon zhangae puede ser reco-
nocido de la especie oriental relacionada, A. nzuiri Olmi 1984, por los siguientes caricteres:
enA. nzuiri, las notauli alcanzan un 0.65 del largo del scutum; scutum d~bilmente punteado;
cabeza con OOL mas de dos veces mas larga que OL; enA. zhangae, las notauli alcanzan un
0.8 de la longitud del scutum; el scutum muestra un punteado grande y profundo similar a
areolae; cabeza con OOL ligeramente mas largo que OL.


Translation provided by the authors.


Dryinidae (Hymenoptera: Chrysidoidea) are
parasitoids of Hemiptera Auchenorrhyncha
(Guglielmino & Olmi 1997, 2006, 2007). Anteon
Jurine 1807 is a genus present in all zoogeograph-
ical regions. About 326 species have been de-
scribed from all continents (Olmi 1999). The ge-
nus was revised by Olmi (1984, 1991).
Ninety-seven species of Anteon are known
from China. They were studied in the last 20
years mainly by Olmi (1991, 1993, 1995), He & Xu
(2002), and Xu et al. (1998, 2001, 2003, 2006a,
2006b). However, in spite of the above papers,
they are considered insufficiently known, both
from systematic and biological points of view. The
hosts of only 5 species are known, all belonging to
Cicadellidae. In 2008 we have examined addi-
tional specimens ofdnteon from P. R. China and
have found 2 new species described herein.


MATERIALS AND METHODS

The descriptions follow the terminology used
by He & Xu (2002) and Olmi (1984, 1994, 1999).
The measurements reported are relative, except
for the total length (head to abdominal tip, with-
out the antennae), which is expressed in millime-
tres. In the descriptions, POL is the distance be-
tween the inner edges of the 2 lateral ocelli; OL is
the distance between the inner edges of a lateral
ocellus and the median ocellus; OOL is the dis-
tance from the outer edge of a lateral ocellus to
the compound eye; OPL is the distance from the
posterior edge of a lateral ocellus to the occipital
carina; and TL is the distance from the posterior
edge of an eye to the occipital carina.
All specimens studied in this paper are depos-
ited in the Hymenoptera collection of South







Florida Entomologist 93(3)


September 2010


China Agricultural University, Department of
Entomology, Guangzhou, Guangdong, P. R. China
(SCAU).

SYSTEMATIC ACCOUNTs

Anteon liui sp. nov. (Fig. 1)

Description. Holotype female. Fully winged.
Length 4.9-6.2 mm holotypee 4.9 mm). Head
black, except mandibles testaceous; antennae
testaceous, except segments 7-10 and dorsal side
of segments 1-2 brown; mesosoma black; gaster
brown; fore legs testaceous, except clubs of femora
partly brown; mid and hind legs brown, except ar-
ticulations testaceous. In a paratype from P. R.
China, Mt. Baiyunshan, antennae testaceous, ex-
cept segments 7-10 brown; legs testaceous, except
hind coxae partly brown. Antennae clavate; an-
tennal segments in the following proportions:
21:11:20:15:16:16:15:16:15:20. Head shiny; ver-
tex and face partly reticulate rugose (sensu Olmi
1984) and strongly impressed by large punctures
similar to areolae, except a smooth area in front of
anterior ocellus and 2 smooth areas on the sides
of posterior ocelli; face with 2 lateral longitudinal
keels around orbits directed towards antennal
toruli; frontal line complete; occipital carina com-
plete; POL = 8; OL = 5; OOL = 9; OPL = 10; TL =
8; greatest breadth of posterior ocelli shorter than
OL (4:5). Pronotum shiny, with anterior surface
sculptured by strong transverse keels; posterior
surface smooth, punctate, without sculpture
among punctures, shorter than scutum (13:30).
Scutum, scutellum and metanotum shiny,
smooth, punctate, without sculpture among punc-
tures. Notauli incomplete, reaching approxi-
mately 0.65 length of scutum. Propodeum with a
strong transverse keel between dorsal and poste-
rior surface; dorsal surface reticulate rugose; pos-
terior surface with 2 complete longitudinal keels,
1 Notauli reaching about 0.65 length of scutum .. .


lateral areas reticulate rugose and median area
rugose and with a central smooth surface. Forew-
ing hyaline, without dark transverse bands; dis-
tal part of stigmal vein much shorter than proxi-
mal part (5:21). Fore tarsal segments in the fol-
lowing proportions: 17:3:5:9:24. Fore tarsal seg-
ments 3 and 4 produced into a hook. Enlarged
claw (Fig. 1) with a proximal prominence bearing
a long bristle. Segment 5 of fore tarsus (Fig. 1)
with basal part much longer than distal part
(16:8), inner margin straight, 2 proximal lamellae
and a group of about 25-40 lamellae situated in
the distal part (in a paratype from P. R. China,
Mt. Baiyunshan, there are 2 proximal lamellae, 3
medial lamellae and a group of many distal
lamellae). Tibial spurs 1, 1, 2.
Male. Unknown.
Hosts. Unknown.
Holotype: Female, P. R. CHINA, Zhejiang
Prov., Mt. Fenyangshan, Huangmaojian,
2.VIII.2008, Liu Jingxian, No. 200801155
(SCAU). Paratypes: Female: same label as holo-
type, No. 200801139 (SCAU); Female: Henan
Prov., Songxian, Mt. Baiyunshan, 17.VIII.2008,
Shi Min, No. 200801242 (SCAU).
Etymology: This species is named after the col-
lector of the holotype Mr. Liu Jingxian,
Remarks.Anteon liui is similar to the Oriental
species A. hirashimai Olmi 1993 (known from
Burma, Malaysia, P. R. China, and Vietnam) and
A. austini Olmi 1991 (known from Malaysia, P. R.
China, Taiwan, and Thailand) because of the fol-
lowing characters: segment 4 of fore tarsus about
0.5 as long as segment 1; posterior surface of pro-
podeum with 2 complete longitudinal keels; head
almost completely reticulate rugose, black, except
mandibles testaceous; scutum and scutellum
punctate, without sculpture among punctures;
notauli present. The above species of Anteon can
be recognized by the different length of notauli, as
follows:

.......... ... .. . . .. A. liui sp. nov.


- Notauli reaching about 0.3 0.4 length of scutum .......... . . . . . ... .. .. .. 2

2 Segment 5 of fore tarsus provided of proximal and medial lamellae (Fig. 13A in Olmi 1991)
.............. .............. .............. .......... A. hirashimai Olmi

- Segment 5 of fore tarsus without proximal and medial lamellae, provided of proximal and medial bristles
(Fig. 17A in Olmi 1991) .......... . . . . .. .... .. . . .. A. austini Olmi


Anteon zhangae sp. nov. (Fig. 2)

Description. Holotype female. Fully winged.
Length 4.18 mm. Head black, except mandibles
testaceous and clypeus ferruginous; antennae
testaceous; mesosoma black, except distal apex
of propodeum reddish; petiole black; gaster fer-
ruginous; legs testaceous. Antennae clavate; an-
tennal segments in the following proportions:
22:6:9:9:8:9:9:9:8:12. Head dull, completely re-
ticulate rugose; face with 2 lateral longitudinal


keels around orbits directed towards antennal
toruli; frontal line complete; occipital carina
complete; POL = 5; OL = 4; OOL = 5; OPL = 8; TL
= 7; greatest breadth of posterior ocelli shorter
than OL (3:4). Pronotum dull, almost completely
sculptured by strong transverse keels and large
and deep punctures similar to areolae; posterior
margin smooth, shiny, without sculpture; poste-
rior surface slightly shorter than scutum (18:20).
Scutum completely strongly sculptured by large
and deep punctures similar to areolae. Notauli








Xu et al.: New Species ofAn~teon. from China


transverse keel between dorsal and posterior
surface; dorsal surface reticulate rugose; poste-
rior surface with 2 complete longitudinal keels,
with median and lateral areas dull and reticu-
late rugose. Forewing hyaline, totally weakly
yellowish, without dark transverse bands; distal
part of stigmal vein much shorter than proximal
part (6:18). Fore tarsal segments in the following
proportions: 11:3:6:17:33. Fore tarsal segment 2
produced into a hook. Enlarged claw (Fig. 2) with
a proximal prominence bearing a long bristle.
Segment 5 of fore tarsus (Fig. 2) with basal part
much shorter than distal part (8:25), with inner
margin almost straight, with 3 rows of 9 very
long lamellae + 4 proximal lamellae + 27 lamel-
lae; distal apex with a group of 4 lamellae. Tibial
spurs 1, 1, 2.
Male. Unknown.
Hosts. Unknown.
Holotype: Female, P. R. CHINA, Guizhou
Prov., Mt. Leigongshan Nature Reserve,
1.VI.2005, Zhang Hongying, No. 20059236
(SCAU).
Etymology: The species is named after the col-
lector Miss Zhang Hongying.
Remarks. Anteon zhangae is similar to A.
muiri Olmi 1984 (known from Indonesia) because
of the following characters: segment 4 of fore tar-
sus longer than segment 1; posterior surface of
propodeum with 2 longitudinal keels; head com-
pletely reticulate rugose; forewing without dark
transverse bands; body mostly black; segment 5
of fore tarsus with basal part much shorter than
distal part. The above species can be recognized
as follows:


(0, 1 f
ii I~, ~j


h~-
C-
^=


2I



(fl I


Ie \


Figs. 1 and 2. Chelae ofilnteon liui sp. nov. (1); ho-
lotype; scale bar = 0.14 mm) and Anteon zhangae sp.
nov. (2); holotype; scale bar = 0.16 mm).


incomplete, reaching approximately 0.8 length
of scutum. Scutellum and metanotum shiny,
smooth, strongly punctate, without sculpture
among punctures. Propodeum with a strong


1 Scutum weakly punctate, without sculpture among punctures; head with OOL more than twice as long as OL;
notauli reaching about 0.65 length of scutum. ......... .. .. ... .. . . .. A. muiri Olmi

- Scutum sculptured by large and deep punctures similar to areolae; head with OOL slightly longer than OL; no-
tauli reaching about 0.8 length of scutum . ........ .. .... .. . . .. A. zhangae sp. nov.


ACKNOWLEDGMENTS

We are grateful to Dr. Liu Jingxian, Dr. Shi Min, and
Dr. Zhang Hongying for help in collecting dryinids in
the field. This study was supported by the Ministry of
Science and Technology of P. R. China (MOST grant N.
2006FY110500).


REFERENCES CITED

GUGLIELMINO, A., AND OLMI, M. 1997. A Host-parasite
Catalog of World Dryinidae (Hymenoptera: Chrysi-
doidea). Contrib. Entomol. Internat. 2: 165-298.
GUGLIELMINO, A., AND OLMI, M. 2006. A host-parasite
catalog of world Dryinidae (Hymenoptera: Chrysi-
doidea): first supplement. Zootaxa 1139: 35-62.
GUGLIELMINO, A., AND OLMI, M. 2007. A host-parasite
catalog of world Dryinidae (Hymenoptera: Chrysi-
doidea): second supplement. Boll. Zool. Agr. Bachic.
(Ser. ii) 39: 121-129.


HE, J., AND XU, Z. 2002. Hymenoptera Dryinidae. Fau-
na Sinica 29. Science Press, Beijing: xii + 464 pp.
OLMI, M. 1984. A revision of the Dryinidae (Hy-
menoptera). Mem. American Entomol. Inst. 37: xii +
193pp.
OLMI, M. 1991. Supplement to the revision of the world
Dryinidae (Hymenoptera: Chrysidoidea). Frustula
entomol. (1989) (N.S.) 12(25): 109-395.
OLMI, M. 1993. A new generic classification for Thauma-
todryininae, Dryininae and Gonatopodinae, with de-
scriptions of new species (Hymenoptera: Dryinidae).
Boll. Zool. Agr. Bachic. (Ser. ii), 25: 57-89.
OLMI, M. 1994. The Dryinidae and Embolemidae (Hy-
menoptera: Chrysidoidea) ofFennoscandia and Den-
mark. Fauna Entomologica Scandinavica 30. Brill,
Leiden: 100 pp.
OLMI, M. 1995. A contribution to the knowledge of the
Dryinidae of Taiwan (Hymenoptera: Chrysidoidea).
Boll. Zool. Agr. Bachic. (Ser. ii) 27: 19-34.
OLMI, M. 1999. Hymenoptera Dryinidae Embolemi-
dae. Fauna d'Italia 37. Edizioni Calderini, Bologna:
xvi + 425 pp.








406 Florida Ento



XU, Z., HE, J., AND OLMI, M. 1998. New species of Dry-
inidae from China (Hymenoptera, Chrysidoidea).
Phytophaga 8: 21-37.
XU, Z., HE, J., AND OLMI, M. 2001. Descriptions of new
species of Dryinidae from China (Hymenoptera,
Chrysidoidea). Frustula entomol. (2000) (N.S.) 23
(36): 1-22.
XU, Z., OLMI, M., AND HE, J. 2003. Three new species of
Dryinidae from China (Hym., Chrysidoidea). Ento-
mol. Monthly Mag. 139: 233-236.


m17


lologist 93(3) September 2010



XU, Z., OLMI, M., AND HE, J. 2006a. Description of a new
species ofAnteon Jurine from the People's Republic
of China and of the male ofAnteon fidum Olmi (Hy-
menoptera: Dryinidae). Zootaxa 1164: 57-61.
XU, Z., OLMI, M., AND HE, J. 2006b. Descriptions of five
new species of Anteon Jurine from China (Hy-
menoptera: Chrysidoidea: Dryinidae). J. Kansas En-
tomol. Soc. 79: 92-99.








Manrique et al.: Effect of Straw Mulch on M. ochroloma and Predators in Turnips 407



EFFECT OF STRAW MULCH ON POPULATIONS OF M~ICROTHECA
OCHROLOM~A (COLEOPTERA: CHRYSOMELIDAE) AND GROUND
PREDATORS IN TURNIP BRASSICA RAPA IN FLORIDA


VERONICA MANRIQUE CECIL O. MONTEMAYOR RONALD D. CAVE', EDWARD A. SKVARCIP AND BRADLEY W. SMITH'
1University of Florida, Indian River Research and Education Center, 2199 South Rock Road, Fort Pierce, FL 34945

2St. Lucie Co. Cooperative Extension Service, University of Florida, 8400 Picos Rd., Fort Pierce, FL 34945

ABSTRACT

Microtheca ochrolonza Stal (Coleoptera: Chrysomelidae), the yellow-margined leaf beetle, is
a serious pest of crucifer crops in the southeastern USA. The objective of this study was to
investigate the effect of straw mulch on the abundance of M. ochrolonza and ground preda-
tors in turnips in Florida, and subsequent influence on crop damage and yield. Eight plots
(5 m long x 9 m wide) were established, and each plot consisted of 5 beds with 10 turnip
plants each (50 turnips per plot). An 8-10-cm layer of straw mulch was applied by hand 2 d
after planting to half of the plots in a complete randomized block design. The abundance of
M. ochrolonza and other insect herbivores were recorded twice weekly from Mar 13 to Apr
24, 2009. In addition, 3 pitfall traps per plot were used for sampling predatory arthropods
during each sampling period. Higher numbers of M. ochrolonza were found in plots with
mulch compared to plots with no mulch, whereas greater numbers of ground predators were
obtained in the no mulch treatment. The most abundant predators found in pitfall traps
were ants, earwigs, and spiders, while lower numbers of predatory beetles were recorded. At
the end of the experiment, greater leaf biomass (dry weight) was obtained from turnip plants
grown in plots with straw mulch, but those plants suffered greater herbivory since the leaf
area removed was greater in that treatment. Mean weight of tubers did not vary signifi-
cantly between treatments. In conclusion, the use of straw mulch as a pest management op-
tion for M. ochrolonza in crucifer crops on organic farms is not recommended.

Key Words: organic mulch, insect populations, cultural control, yellow-margined leaf beetle,
pitfall traps

RESUME

El escarabajo de la hoja, Microtheca ochrolonza Stal (Coleoptera: Chrysomelidae), es una
plaga importante de cultivos de cruciferas en el sudi~ste de los Estados Unidos. El objetivo
de 6~ste studio fue investigar el efecto de la cobertura de heno en la abundancia de M. ochro-
lonza y los depredadores de suelo en cultivos de nabo en Florida, y el subsecuente dafio foliar
y el rendimiento del cultivo. Se establecieron 8 parcelas (5 m de largo x 9 m de ancho) y cada
parcela estuvo compuesta de 5 camas con 10 plants de nabo cada una (50 plants por par-
cela). Dos dias luego de haberse plantado el cultivo, se agreg6 una cobertura muelta de heno
de 8-10 cm de ancho a la mitad de las parcelas siguiendo un modelo de bloques aleatorizados.
La abundancia de M. ochrolonza y de otros insects herbivores fueron evaluadas 2 veces por
semana desde marzo 13 hasta abril 24 de 2004. Tambii~n se utilizaron trampas de intercep-
ci6n o "pitfall traps"(3 por parcela) para la capture de artr6podos depredadores durante cada
muestreo. Se encontr6, mayor n~imero de M. ochrolonza en las parcelas con cobertura de heno
en comparaci6n con las parcelas sin cobertura; mientras que los depredadores de suelo fue-
ron mis abundantes en las parcelas sin cobertura. Hormigas, tijeretas, y arafias fueron los
depredadores mis abundantes capturados en las trampas de intercepci6n. Al final del expe-
rimento, se obtuvo mayor biomasa foliar (peso seco) en las plants de nabo provenientes de
las parcelas con cobertura de heno. Sin embargo, 6~sas plants sufrieron un mayor dafio dado
que el Brea de la hoja removida fue mayor en i&se tratamiento. El promedio de peso de los tu-
bi~rculos no vari6 significativamente entire tratamientos. En conclusion, no se recomienda el
uso de la cobertura de heno para el manejo de M. ochrolonza en cultivos de cruciferas en
granjas org~nicas.

Translation provided by the authors.



Microtheca ochroloma Stal (Coleoptera: Chry- USA (Chamberlin & Tippins 1949). The pest is a
somelidae), the yellow-margined leaf beetle, is a native of southern South America and was first
serious pest of crucifer crops in the southeastern found in Florida on watercress near Tampa in







Florida Entomologist 93(3)


September 2010


1972 (Woodruff 1974). It is currently distributed
along the Gulf Coast from Florida to Texas, and in
Georgia, North Carolina, and Arizona. The biol-
ogy, ecology, and feeding preferences of M. ochro-
loma were studied by Ameen & Story (1997a, b).
Larvae and adults are defoliators that feed only
on plants in the family Brassicaceae. Preferred
hosts are turnips, mustard, radish, watercress,
and Chinese cabbage, while less preferred hosts
include cabbage and cauliflower (Chamberlin &
Tippins 1949; Ameen & Story 1997b).
There are at least 497 organic farms in Florida
involved in the production of crucifer vegetables
(Florida Organic Grower 2008). However, many
growers have reduced the proportion of crucifer
crops as a consequence of damage by M. ochro-
loma (Bowers 2003). This pest is a serious prob-
lem from Oct to Apr, which corresponds to the pri-
mary growing season for organic farmers in many
parts of Florida (Capinera 2001). Damage caused
by M. ochrolome prevents the growers from sell-
ing high quality products, thus resulting in signif-
icant economic losses. Management of M. ochro-
loma is usually achieved with foliar insecticides
(Capinera 2001), which are not an option for or-
ganic farmers. Management by cultural control
has received limited study. According to Bowers
(2003), intercropping mizuna (Brassica rapa L.
var. Kyona) and oak leaf lettuce (Lactuca sativa
L.) did not provide effective control of M. ochro-
loma. Therefore, organic farmers are desperately
searching for alternative and more effective con-
trol measures against this pest.
Cultural practices have been used as a compo-
nent of integrated pest management in several
cropping systems. For example, the use of organic
mulches has resulted in reduced pest populations,
increased soil moisture, suppression of weeds,
and increased crop yield (Greer & Dole 2003). In
addition, the positive effect of mulches on ground
predator populations has been reported in several
cropping systems, including onion, potato, and
soybeans (Halaj et al. 2000; Johnson et al. 2004).
The objective of our study was to investigate the
effect of straw mulch on the abundance of M.
ochroloma and ground predators in turnip in
Florida. In addition, measurements of leaf dam-
age and yield were compared between treatment
plots at the end of the experiment.

MATERIALS AND METHODs

Field Site

This study was conducted during Mar and Apr
2009 at the University of Florida's Indian River
Research & Education Center, Fort Pierce, FL
(27o25'34.3"N, 80o24'20.31"W). The experimental
plots had not been cultivated for at least 2 years
prior to this study and were separated from adja-
cent crops (cucumber and tomato) by at least 200


m. The experimental design consisted of 2 treat-
ments (straw mulch, no straw mulch) in a com-
plete randomized block design, with 4 replica-
tions per treatment. Before planting, 2 fertilizers
were incorporated into the plot beds, a root fertil-
izer 4-16-4 N-P-K (5 kg/30.5 m) and a plant
growth fertilizer 8N-12P,O,-20-K20 (10 kg/30.5
m) (Howard Fertilizer Co., Inc., Orlando, FL).
Flood irrigation was provided between beds
throughout the experimental plot. Turnip plants
(Brassica rapa rapifera, Seven Top) (2 weeks old)
were transplanted to the field on Mar 10, and an
8-10-cm thick layer of dried straw mulch was ap-
plied by hand 2 d later to half of the plots. The
straw mulch (Bahia hay, Fair-Us Tractor Service,
Okeechobee, FL) was 3 months old when the ex-
periment started. Eight plots (5 m long x 9 m
wide) separated by at least 10 m were arranged in
a complete randomized block design. Each plot
consisted of 5 beds separated by 1 m. Ten turnip
plants were planted with a spacing of 50 cm in
each bed (50 turnips per plot).

Sampling Insect Herbivores

Abundance of M. ochroloma and other insect
herbivores was recorded twice weekly from Mar
13 to Apr 24. Six plants (2 plants in each of 3 in-
ner beds) from each plot were selected randomly
and visual observations of whole plants were con-
ducted. Because M. ochroloma was not found on
the experimental plots during the first 2 weeks of
sampling, 10 pairs of adults were released in the
outer beds of each plot on Mar 27.

Sampling Ground Predators

A pitfall trap consisting of a plastic cup (9 cm
diameter at soil surface, 12 cm depth) was placed
in each of the 3 inner beds of each plot (3 traps per
plot). Traps were half-filled with soapy water and
checked twice weekly from Mar 13 to Apr 24. The
arthropods from each trap were preserved in sep-
arate vials with 75% EtOH. All predators were
counted and identified to order or family.

Foliar Damage and Yield

At the end of the experiment (Apr 24), 6 ran-
domly selected turnip plants from each plot were
collected and brought to the laboratory. One new
leaf and 1 older leaf were selected randomly from
each plant and the leaf area consumed per leaf
was determined by scanning each leaf and mea-
suring the total area removed by herbivory with
the software Image-J (http://rsb.info.nih.gov).
New leaves were those that ranged from 10 to 15
em in length, and older leaves were those ranging
from 30 to 35 cm. Fresh weight of the tuber and
dry weight of all leaves were recorded for each
plant.







Manrique et al.: Effect of Straw Mulch on M. ochroloma and Predators in Turnips 409


Data Analysis

Repeated measure analysis of variance was
used to compare the abundance of M. ochroloma,
total herbivores, predators per taxon, and total
predators between treatments (mulch versus no
mulch) over time. Data for each predator were
combined for all dates because there were no in-
teractions (treatment x time effect), except for
earwigs and spiders, which were analyzed by sin-
gle factor analysis of variance for each date. Leaf
area consumed and yield were compared between
treatments by single factor analysis of variance.
Means were separated with the Student-New-
man-Keuls (SNK) test (SAS Institute, 1999). A
significance level of a = 0.05 was used for all sta-
tistical analyses. Means are reported with their
standard error.

RESULTS

Insect Herbivores

Differences were detected in the number of M.
ochroloma found between treatments over time,
with a significant interaction between treatment
and time (F = 3.65, df = 11, 95, P = 0.0005). When
analyses were conducted separately for each date,
higher numbers of M. ochroloma were found in
plots with mulch compared to plots with no mulch
(Fig. 1). Other insect herbivores found on turnip
plants included aphids, several lepidopteran spe-
cies, and other leaf beetles. However, no signifi-
cant differences between treatments were de-
tected for total number of herbivores per plant
(~28 per plant) (treatment x time: F = 1.24, df =
11, 95, P = 0.27; treatment: F = 1.48, df = 1, 95, P
= 0.22). Aphids were the most abundant insect
herbivore in Mar, whereas M. ochroloma was the
most abundant herbivore in Apr. The high num-
bers of M. ochroloma (20-28 per plant) recorded in


Apr may not correspond to natural infestations
since adults were released in each plot at the be-
ginning of the experiment.

Ground Predators

Higher numbers of predators (each predator
taxon and total predators) were recorded in the
no-mulch treatment compared with the mulch
treatment (Table 1). Fewer predatory beetles
(ground beetles, Carabidae; rove beetles, Sta-
phylinidae; and lady beetles, Coccinellidae) were
captured compared with the higher numbers of
ants (Formicidae), earwigs (Dermaptera), and
spiders (Aranaeae). Overall, significantly more
ground beetles and rove beetles were captured in
traps in the no mulch treatment versus the mulch
treatment. No significant difference in abundance
of lady beetles between treatments was detected
on any date. Significant treatment x time effect
interactions were observed for earwigs and spi-
ders; therefore, data were analyzed separately for
each date. Significantly more earwigs were re-
corded in the no-mulch treatment on all but 2 of
the 13 sampling dates (P < 0.05). For spiders, sig-
nificantly higher numbers were recorded from the
traps in the no-mulch treatment on 5 of the sam-
pling dates (P < 0.05); on all but 2 dates for which
there was no significant difference between treat-
ments, more spiders were noted in the no-mulch
treatment.

Foliar Damage and Yield

Leaf area consumed from new turnip leaves
was greater in plants from plots with straw mulch
(mean = 4.1 + 0.4 cm2) compared to those from
plots without mulch (mean = 2.0 + 0.5 cm2) (F =
9.09; df = 1, 7; P = 0.02). However, no differences
were detected between treatments for damage to
older leaves (no-mulch treatment mean = 5.6 + 1.5
cm2, mulch treatment mean = 8.4 + 1.4 cm2) (F =
1.88; df = 1, 7; P = 0.22). Similar mean tuber
weights were recorded for turnips in the no-
mulch (mean = 130.7 + 24.9 g) and the straw
mulch (mean = 145.9 + 18.1 g) treatments (F =
0.25; df = 1, 47; P = 0.62). However, greater dry
leaf Weight was obtained for turnips in the straw
mulch treatment (mean = 142.9 + 16.4 g) com-
pared with the no-mulch treatment (mean = 97.8
+ 9.5 g) (F = 5.66; df = 1, 47; P = 0.02).

DIscussioN

Our study shows that the use of straw mulch
does not provide a means for adequately control-
ling populations of M. ochroloma in turnips.
Moreover, greater pest populations occur in plots
with straw mulch compared to plots without
mulch during Mar and Apr 2009. These data sug-
gest that adults of M. ochroloma are able to suc-


-Namulch

;5so
25
S20
~15






Fig. 1. Mean numbers (-t SE) of Microtheca ochro-
loma per turnip plant in straw mulch and no straw
mulch treatments. Arrow indicates the date that adults
were released in each treatment plot. Different letters
above paired bars for a date indicate significant differ-
ences between treatments (P < 0.05).







Florida Entomologist 93(3)


September 2010


TABLE 1. 1VEAN NUMBERS (-tSE) OF PREDATORS RECOVERED PER PITFALL TRAP IN STRAW MULCH AND NO STRAW
ATUTCH POTS OF TURNIPS.


Straw
mulch


No straw
mulch


Treatment x
time effect


Predator


Treatment effect


Time effect


Carabidae
(ground beetles)
Staphylinidae
(rove beetles)
Coccinellidae
(lady beetles)
Formicidae
(ants)
Dermaptera
(earwigs)
Araneae
(spiders)
Total


0.12 0.08 b 0.41 0.17 a F = 19.40, P < 0.0001 F = 1.64, P = 0.09 F = 1.57, P = 0.11

0.07 0.04 b 0.19 0.11 a F = 7.74, P = 0.006 F = 1.25, P = 0.26 F = 0.73, P = 0.72


0.05 0.04 a 0.11 0.07 a F = 2.89, P = 0.09


F =2.19, P =0.02 F =1.45, P =0.16


2.81 0.82 b 4.12 1.18 a F = 7.88, P = 0.006 F = 1.97, P = 0.03 F = 0.48, P = 0.92

0.43 0.23 b 2.45 0.62 a F = 100.06, P < 0.0001 F = 2.58, P = 0.006 F = 2.03, P = 0.03

1.07 0.3 b 2.01 0.40 a F =39.57, P <0.0001 F =2.81, P =0.003 F =2.18, P =0.02

4.69 1.51 b 10.02 2.55 a F =48.45, P <0.0001 F =1.26, P =0.26 F =0.68, P =0.76


Different letters within each predator group indicate a significant difference between straw mulch and no straw mulch treat-
ments (P < 0.05).


cessfully locate and recognize their host plants
growing in straw mulch and that the pest popula-
tion increases following colonization. Similarly,
other pests, for example the squash bug, Anasa
tristis (DeGeer), and the American palm cixiid,
Myndus crudus Van Duzee, are favored by the use
of organic mulches (Howard & Oropeza 1998;
Cranshaw et al. 2001). In contrast, the use of or-
ganic mulches in other cropping systems has re-
sulted in a decrease in pest populations. This has
been observed for the onion thrips, Thrips tabaci
Lindeman, in onions (Larentzaki et al. 2008), the
silverleaf whitefly, Bemisia argentifolii Bellows &
Perring, in zucchini squash (Summers et al.
2004), and the Colorado potato beetle, Stilodes de-
cemlineata (Say), in potato (Johnson et al. 2004).
The use of straw mulch has been reported to
increase the abundance of predators in the field,
which in turn reduces pest populations (Halaj et
al. 2000; Johnson et al. 2004). In our study, how-
ever, a greater abundance of ground predators
was recorded in plots with no straw mulch com-
pared to plots with straw mulch. The most abun-
dant predators in pitfall traps were ants, earwigs,
and spiders, while lower numbers of predatory
beetles were recorded. The reduced numbers of
M. ochroloma in the no-mulch treatment may be a
direct effect of the greater ground predator popu-
lation in that treatment. It could be that the ab-
sence of mulch facilitated the searching behavior
of the predators on both the soil and the plant. Al-
though M. ochroloma larvae and adults occur
more frequently on the foliage, the larvae do move
to the lower parts of the plant and to the leaf litter
to pupate and the adult females move to the leaf
litter and soil to deposit eggs (C. O. Montemayor,
personal observation). This behavior in plots
without straw mulch may make the prey more


susceptible to predation by ground predators,
whereas in plots with the structurally complex
straw mulch the larvae and adults can easily hide
and escape predation from the fewer ground pred-
ators. Other factors that may affect pest and
predator populations are differences in plant
quality and soil moisture. For example, turnip
plants in the plots with straw mulch were larger
(more leaf biomass), thus presenting higher qual-
ity host plants to the pest.
The commercially valuable part of a turnip
crop is the tubers and leaves that are sold in fresh
markets. Although greater leaf biomass was ob-
tained from turnip plants grown in plots with
straw mulch, those plants suffered greater dam-
age since the leaf area removed by herbivory was
greater in plots with straw mulch compared to
plots without mulch. Thus, the damaged leaves
cannot be marketed and must be discarded,
thereby resulting in lower yield from a turnip
crop grown in straw mulch. The increase in leaf
damage was correlated with the increase of M.
ochrolome population in the straw mulch treat-
ment, which highlights the importance of this
pest as an economically important defoliator of
turnips and other leafy green crucifer crops. Al-
though our study was conducted during 1 growing
season in 2009, the trends observed in the abun-
dance of insect populations between treatment
plots were quite significant. For example, there
was a two-fold increase in M. ochrolome popula-
tions in the plots with straw mulch compared to
the plots without mulch.
In conclusion, the use of straw mulch as a pest
management option for M. ochroloma in crucifer
crops on organic farms is not recommended. More
appropriate management tactics that are envi-
ronmentally-friendly and effective in reducing








Manrique et al.: Effect of Straw Mulch on M. ochroloma and Predators in Turnips 411


pest populations (e.g., biological control) should
be evaluated to help organic farmers in Florida
and elsewhere.


ACKNOWLEDGMENTS

The authors are grateful to Daniel Mancero Castillo
and Jos6? A. Castillo Altamirano for providing field assis-
tance during this study. In addition, we appreciate the
help of other colleagues from the Indian River Research
and Education Center in Fort Pierce: Janet Dawson, Ro-
drigo Diaz, and Randy Burton. This research project
was supported by grants from the Florida Specialty
Crop Foundation and Florida Department of Agricul-
ture and Consumer Services.


REFERENCES CITED

AMEEN, A. O., AND STORY, R. N. 1997a. Biology of the
yellowmargined leaf beetle (Coleoptera: Chrysomel-
idae) on crucifers. J. Entomol. Sci. 32: 478-486.
AMEEN, A. O., AND STORY, R. N. 1997b. Feeding prefer-
ences of larval and adult Microtheca ochroloma (Co-
leoptera: Chrysomelidae) for crucifer foliage. J. Agr.
Entomol. 14: 363-368.
BOWERS, K. 2003. Effects of Within-field Location of
Host Plants and Intercropping on the Distribution of
Microtheca ochroloma (Stil) in Mizuna. MSc Thesis,
University of Florida, Gainesville, FL. 63 pp.
CAPINERA, J. L. 2001. Handbook of Vegetable Pests. Ac-
ademic Press, San Diego, CA. 729 p.
CHAMBERLIN, F. S., AND TIPPINs, H. H. 1949. Microthe-
ca ochroloma, an introduced pest of crucifers, found
in Alabama. J. Econ. Entomol. 41: 979.


CRANSHAW, W., BARTOLO, AND SCHWEISSING, F. 2001.
Control of squash bug injury: management manipu-
lations at the base of pumpkin. Southwest. Entomol.
26: 147-150.
FLORIDA ORGANIC GROWER. 2008. List of Certified
Growers and Handlers. http://www.foginfo.org/. Ac-
cessed on February 2009.
GREER, L., AND DOLE, J. M. 2003. Aluminum foil, alumi-
num-painted plastic, and degradable mulches in-
crease yields and decrease insect-vectored viral dis-
eases of vegetables. HorTechnology 13: 276-284.
HALAJ, J., CADY, A. B., AND UETZ, G. W. 2000. Modular
habitat refugia enhance generalist predators and
lower plant damage in soybeans. Environ. Entomol.
29: 383-393.
HOWARD, F. W., AND OROPEZA, C. 1998. Organic mulch
as a factor in the nymphal habitat ofMyndus crudus
(Hemiptera: Auchenorrhyncha: Cixiidae). Florida
Entomol. 81: 92-97.
JOHNSON, J. M., HOUGH-GOLDSTEIN, J. A., AND VANGES-
SEL, M. J. 2004. Effects of straw mulch on pest in-
sects, predators, and weeds in watermelons and po-
tatoes. Environ. Entomol. 33: 1632-1643.
LARENTZAKI, E., PLATE, J., NAULT, B. A., AND SHELTON,
A. M. 2008. Impact of straw mulch on populations of
onion thrips (Thysanoptera: Thripidae) in onion. J.
Econ. Entomol. 101: 1317-1324.
SUMMERS, C. G., MITCHELL, J. P., AND STAPLETON, J. J.
2004. Management of aphid-borne viruses and Bemi-
sia argentifolii (Homoptera: Aleyrodidae) in zucchini
squash by using UV reflective plastic and wheat
straw mulches. Environ. Entomol. 33: 1447-1457.
WOODRUFF, R. E. 1974. A South American Leaf Beetle
Pest of Crucifers in Florida (Coleoptera: Chrysomel-
idae). FDACS-DPI Entomology Circular 148,
Gainesville, FL.












SIZE-SPECIFIC PROVISIONING BY CICADA KILLERS, SPHECIUS
SPECIOSUS, (HYMENOPTERA: CRABRONIDAE) IN NORTH FLORIDA


JON M. HASTINGS CHARLES W. HOLLIDAY ANDREW LONG3, KATIE JONES3 AND GRAYSON RODRIGUEZ3
1Depaliment of Biological Sciences, Northern Kentucky University, Highland Heights, KY 41099


2Depaliment of Biology, Lafayette College, Easton, PA 18042


3Depaliment of Mathematics, Northern Kentucky University, Highland Heights, KY 41099

ABSTRACT

Eastern cicada killer wasps (Sphecius speciosus Drury) mass-provision underground nest
burrows with cicadas they capture and paralyze in nearby trees. We studied provisioning by
female cicada killers at 2 aggregations in north Florida where a variety of cicada species,
with a large range in body size, are used as prey. We captured and measured samples of male
and female wasps and we uniquely marked samples of females. We measured and identified
paralyzed cicadas that we retrieved from females as they were provisioning their nests. We
compared the body sizes of male and female wasps, and cicada prey, between locations. The
mean body sizes of male wasps, female wasps, and cicadas from the St. Johns site were much
larger than those from the Newberry site. We determined the relationship between the size
of individual female wasps and the size of their prey at both locations. Previous studies had
concluded that cicada killer hunting is opportunistic, with females provisioning their nests
with cicadas of different sex, species, and size in proportion to their relative abundance in
the environment. However, we found that individual female cicada killers at these locations
exhibited prey specificity by size. Small wasps brought only small cicadas to their nests, as
they are likely constrained from carrying large cicadas in flight. Large wasps, not similarly
constrained, rarely provisioned with small cicadas. The wasps appear to selectively hunt the
largest prey they can carry in flight. Evidence suggests that the cicadas retrieved from
wasps at the Newberry site were smaller because small female wasps predominate there,
and not because there is a difference in the body size distributions of the cicadas between the
2 local environments.

Key Words: mass-provisioning, size variation, prey size, selective hunting, solitary wasp

RESUME

La avispa asesina de cigarras del este (Sphecius speciosus Drury) recolectan provisions ma-
sivas de cigarras que ellas capturan y paralizan en sus nidos subterraneo~s en Arboles cerca-
nos. Estudiamos como las hembras de la avispa asesina de cigarras aprovisionan sus nidos
en 2 agrupaciones en el norte de la Florida donde una variedad de species de cigarras, con
una amplia gama de tamarios de cuerpo, son usadas como press. Capturamos y medimos
muestras de los machos y hembras de las avispas y marcamos unicamente las muestras de
las hembras. Medimos y identificamos las cigarras paralizadas que fueron recuperadas de
las hembras mientras que aprovisionaron sus nidos. Comparamos el tamario del cuerpo de
los machos y hembras de las avispas y de las press cigarras en las dos localidades. Los pro-
medios del tamario de las avispas machos, avispas hembras y cigarras del sitio de St. John
fueron much mas grandes que los del sitio de Newberry. Determinamos la relaci6n entire el
tamario de los individuos de las hembras avispas y el tamario de sus press en ambas loca-
lidades. Estudios anteriores han concluido que la caseria por las avispas asesinas de cigarras
es oportunistica, que las hembras aprovisionan sus nidos con cigarras de diferente sexos, es-
pecies y tamarios en proporci6n de su abundancia relative en el ambiente. Sin embargo, en-
contramos que los individuos de las hembras de la avispa asesina de cigarras en estas
localidades mostraron una preferencia por el tamario de la presa. Avispas pequerias 11evaron
solamente cigarras pequerias a sus nidos, esto probablemente a que estan limitadas de 11evar
cigarras grandes mientras que vuelan. Avispas grandes, no estan limitadas y raramente
aprovisionaron sus nidos con cigarras pequerias. Parece que las avispas cazan selectiva-
mente las press mis grandes que puede 11evar cuando vuelan. La evidencia indica que las
cigarras recuperadas de las avispas en el sitio de Newberry fueron mas pequerias por que las
avispas pequerias hembras predominaron ahi, y no por que hay una diferencia en la distri-
buci6n de tamario del cuerpo de las cigarras entire los 2 ambientes locales.


Florida Entomologist 93(3)


September 2010







Hastings et al.: Provisioning By Cicada Killer Wasps


Eastern cicada killers, Sphecius speciosus
Drury, are mass-provisioning wasps found in all
but 2 states (Vermont and Maine) of the USA east
of the continental divide (Holliday & Coelho
2006). Over this range they hunt cicadas of at
least 30 species in 5 genera (Holliday et al. 2009);
further, these prey cicadas vary considerably in
size. Females dig nest burrows in well-drained
soil, often forming large nesting aggregations,
and provision nest cells with cicadas they capture
and paralyze in nearby trees. Studies by Dow
(1942a, 1942b), Lin (1979a), Coelho (1997), and
Grant (2006) report that the number of cicadas
provided to each offspring is fairly consistent,
with sons given 1, sometimes 2, cicadas, whereas
daughters are given 2, sometimes 3, cicadas re-
gardless of cicada size. If, as in many other provi-
sioning Hymenoptera, the size of individual off-
spring in cicada killers is determined largely by
the mass of their provision (Punzo 1994; Strohm
2000; Seidelmann 2006), then female cicada kill-
ers should generally be much larger than males.
This pattern of sexual size dimorphism has been
described in all published reports of relative male
and female size in this species (Evans & O'Neill
2007) and it is the pattern that we have observed
in the many Sphecius populations that we have
studied (Hastings et al. 2008).
Lin (1979b3) presented evidence that female ci-
cada killers hunt cicadas selectively by size, spe-
cies, and sex. He concluded that females know the
sex of the egg that they will lay in each nest cell in
advance of their hunts. Presumably, when a fe-
male is hunting for a future daughter, she will not
only dig a larger nest cell and provide it with 2 or
3 cicadas, but she will also hunt selectively for
heavy prey individuals. As a result, daughters are
provided with large provisions, enabling them to
attain large body size. However, other studies of
nest provisioning by female cicada killers have
concluded that they are opportunistic, rather
than selective, hunters (Coelho 1997; Grant
2006). Evidence presented in these more recent
studies suggests that, at the population level, fe-
male cicada killers hunt largely at random with
regard to the species, sex, and the size of cicada
prey. Consequently, samples of cicadas taken
from provisioning females were not very different
from samples gathered from the environment.
Grant (2006) also investigated the possibility
that, in the absence of overall size bias in provisions
at the population level, individual wasps within the
population might exhibit size-specific hunting, with
large females hunting large prey and small females
hunting small prey. However, he found there to be
little evidence in support of individual size-selectiv-
ity other than that the smallest females were con-
strained from provisioning with the largest cicadas.
This constraint was likely due to the inability of the
small wasps to carry large prey in flight. Coelho
(1997) came to similar conclusions.


In a previous study of cicada killers from 12
geographic locations, Hastings et al. (2008) found
that the mean body size of male and female wasps
and of their cicada prey varied among locations.
They reported that a direct relationship existed
between the mean size of cicada prey available in
the local environment and the size of the wasps;
in locations where cicadas were large, the male
and female wasps were large; where prey were
small, the wasps were small. This relationship be-
tween prey size and wasp size should exist if (1)
female wasps are opportunistic hunters, (2) fe-
males provision their nest cells with a fairly con-
sistent number of cicada prey, and (3) the size of
wasps is largely determined by the mass of cicada
prey provided to them by their mothers. At most
locations of this study, wasps provisioned their
nests primarily with 1 species of prey or with 2
species of similar size. However, at 2 locations in
north Florida, Hastings et al. (2008) reported that
several cicada species with a body mass range ex-
ceeding an order of magnitude were used as prey.
They noted that the wasps from Newberry, FL
were small and the wasps from St. Johns, FL
were much larger, despite the fact that the loca-
tions were less than 100 km apart, and that at
least 2 of the same species of cicadas were used as
prey. They tentatively concluded that the size dif-
ference in wasps likely reflects differences in the
relative abundance of prey of various sizes at the
different locations; presumably small cicadas pre-
dominated in Newberry, large cicadas in St.
Johns. They also concluded that further study of
provisioning by cicada killers at these Florida lo-
cations was warranted and could provide im-
proved understanding of hunting behavior in
these wasps and of the causes of local variation in
their body size. The present study is an expansion
of this earlier work; our focus was on only these 2
locations in north Florida, and the application of
additional sampling methods has provided us
with a very different, and likely a clearer, under-
standing of cicada killer hunting and provisioning
in environments with a broad diversity of poten-
tial cicada prey.

MATERIALS AND METHODS

We conducted field research between 14 Jul
and 5 Aug 2008 in 2 locations in north Florida.
The study site in Newberry, FL (lat/10ng =
29.653005, -82.485275), a residential area, in-
cludes the front yards of 2 houses on the same
block. The St. Johns County, FL site (30.028234,-
81.604746) is within and around the stable and
equipment shed of a small horse farm. We col-
lected data on 16-19 Jul, 24-25 Jul, 31 Jul-3 Aug
in Newberry, and on 14-15, 21-23, 28-30 Jul, and
4-5 Aug in St. Johns. Thirty wasps and 13 cicadas
brought to nests by female wasps, collected 29
Jun-11 Jul at the Newberry site by a local resi-







Florida Entomologist 93(3)


September 2010


dent, who froze and dried them, are included in
our analyses.
Male wasps were netted, killed with ethyl ace-
tate, and weighed to the nearest mg (Adventurer
Pro AV53 electronic scale, Ohaus Corp., Pine
Brook, NJ). The right wing length (RWL) was
measured to the nearest 0.01 mm with digital cal-
ipers (Cen Tech #47256, Harbor Freight, Cama-
rillo, CA) as the distance from the distal end of the
wing to the distal tip of the tegula. Female wasps
were netted, anesthetized in 100% CO,(ISI Soda
Siphon, iSi, GmbH, Vienna, Austria) for 30 s,
weighed to the nearest mg, labeled with num-
bered paper tags affixed to the scutum with al-
pha-cyanoacrylate glue (Duro Quick Gel thick for-
mulation, Henkel Corp., Avon, OH) and the RWL
was measured as above. Recovery from anesthe-
sia occurred in 90-120 s; the few wasps that did
not recover promptly were killed with ethyl ace-
tate and kept as voucher specimens. Of the 220 la-
beled females released in the 2 study areas, 124
(56.4%) were seen again after release, and many
were seen regularly over the entire remaining pe-
riod of the study.
Female cicada killers usually enter their bur-
rows rapidly when returning with or without par-
alyzed cicadas and, therefore, we developed a
method to detain them briefly to allow identifica-
tion of wasp and prey. We detained female wasps
and their prey together by plugging nest openings
with dowels after we saw females leave their
nests to hunt cicadas. When females returned to
the plugged burrows with or without a paralyzed
cicada, they would try to dig into the burrow
along one side of the dowel; this allowed us time
to identify the female by the numbered tag on her
scutum and to identify the sex and, tentatively,
the species, of her cicada. In some instances, after
prey identification, the dowel was slowly removed
from the burrow, allowing the wasp to enter with
her prey and then replaced when she left the bur-
row to hunt again. However, in most instances we
retrieved the cicada provisions from the female
wasps; these cicadas were weighed and RWL was
measured as noted above. Retrieved cicadas were
killed in ethyl acetate and pinned for verification
of our field identifications.
We noted that cicada prey, which were of sev-
eral different species, were extremely variable in
body size. 2 species, later determined to be Neoci-
cada hieroglyphica Say, and Diceroprocta olyn-
puse Walker, were much smaller than the others.
We classified all individuals of these 2 species as
small cicadas. Another species, later determined
to be Tibicen resonans Walker, was significantly
larger than all other species; we classified all T
resonans as large cicadas. We classified all other
cicada species, which were of intermediate size,
as medium cicadas.
We conducted focal studies of provisioning be-
havior by 59 labeled females in Newberry and 19


in St. Johns in order to determine how much time
is required for females to find, capture, paralyze,
and return with cicadas to their nest burrows.
Clusters of several active burrows were continu-
ally observed by each researcher throughout the
day. Whenever females would exit their burrows,
we would block the openings and note the time of
their exit. The time of the females' return with
prey was noted, and the cicadas were identified.
The plugs were then slowly removed without dis-
turbing the wasps and they were allowed into
their burrows with their prey cicadas. Hunt times
were calculated as the time period between
wasps' exit from the burrows and their return
with cicadas. Occasionally females would return
to their nests without prey; as we had no way of
knowing whether such events were unsuccessful
hunts or if the females were returning to their
nests following bouts of feeding or other activity,
we did not include these time periods in the hunt
time calculations.
Direct sampling of the cicada communities at
both locations was impractical for a variety of rea-
sons, but primarily because the cicadas were ac-
tive in the canopies of tall trees that were out of
our reach and our view. We then attempted to use
male cicada song counts as a crude method of de-
termining the relative abundance of various ci-
cada species. We learned to identify the songs of
males of several local cicada species, including
Neocicada hieroglyphica, Diceroprocta olympusa,
Tibicen tibicen australis Davis, and Tibicen reso-
nans by 2 methods, as follows: (1) we used a cam-
corder to record singing cicadas that we could
identify; we then studied these recordings, and,
(2) we studied recordings of songs of local cicada
species that were available on an Internet site
created by Walker & Moore (http://entomol-
ogy.ifas.ufl.edu/walker/buzz/c700fl2.htm). Twice
each morning and twice each afternoon, when the
sun was not covered by clouds, we spent 10 min
listening to cicada songs. Based on our perception
of the relative number of males of each species
that we heard singing, we made daily subjective
rankings of the relative abundance of the various
cicada species. We acknowledge the limitations of
this crude census method. For example, it as-
sumes equal proportions of males and females
among the different species. It also assumes that
there are no significant differences in how fre-
quently and when, during the diurnal cycle,
males of the different species sing. However, de-
spite these shortcomings, we contend that the
method provides useful information about the rel-
ative abundance of prey species in the local envi-
ronments.

Data Analysis

We used independent-samples t-tests to com-
pare the mean body sizes of cicadas retrieved

































































TABLE 1. DESCRIPTIVE STATISTICS OF BODY SIZE MEASUREMENTS OF MALE AND FEMALE CICADA KILLERS FROM 2 LO-
CATIONS IN NORTH FLORIDA, USA. SHOWN ARE MEAN + SEM FOR WET BODY MASS IN MG AND FOR RIGHT
WING LENGTH (RWL) IN M13, AND NUMBER OF SPECIMENS, N.

St. Johns Newberry

Males
wet mass (mg) 532.2 + 11.1, n = 110 329.2 + 9.0, n = 73
RWL (mm) 24.3 20.2, n =110 21.8 e0.1, n =90
Females
wet mass (mg) 1141.4 + 33.4, n = 90 612.6 + 12.6, n = 129
RWL (mm) 30.7 20.3, n= 93 24.0 a0.2, n =142


Hastings et al.: Provisioning By Cicada Killer Wasps


from female wasps between locations, and to com-
pare mean hunt times for small cicadas between
locations. Lack of hunt time data for medium and
large cicadas at the Newberry site precluded sim-
ilar between-location comparisons for these prey
size categories. Two-way ANOVA was used to
compare mean wet body masses and RWL of
wasps between sexes and between locations and
one-way ANOVA was used to compare mean hunt
times among different cicada prey size classes at
the St. Johns location. For each of these statistical
tests we used SPSS version 15.0.
The use of RWL, instead of wet mass, as a mea-
sure of body size in wasps and in cicadas in-
creases our sample sizes for some analyses, and it
is a measure of body size commonly used in wasp
research (Ohl & Thiele 2007), including by Hast-
ings et al. (2008), for populations of S. speciosus at
the same locations as those of the present study.
Consequently, some of our results make use of
RWL as the measure of body size in the wasps
and the prey. However, it is useful for us to be able
to convert size measurements between RWL and
wet mass. Therefore, we determined the relation-
ship between these size variables in the wasps
and in the cicadas using the statistics package R
(R Development Core Team 2008). Coelho (1997)
found no difference in the scaling of RWL and wet
mass between male and female S. speciosus. Con-
sequently, male and female wasp samples from
both locations were combined for this analysis. R
was used to determine the relationship between
RWL and wet mass within samples of cicadas re-
trieved from female wasps.
We also used R to determine the relationship
between the RWL of individual female wasps and
the RWL of cicada prey they brought to their
nests. For this analysis, we assumed that wasps
of any given size provision their nests in an inde-
pendent and identically distributed way. There-
fore, we included each provisioning event by each
female in the analysis, which included 96 provi-
sioning events by 68 Newberry female wasps and
51 provisioning events by 28 female wasps from
St. Johns. We combined data from the 2 locations
for the analysis.


RESULTS

Body size samples of male and female wasps
from both locations are summarized in Table 1.
ANOVA revealed significant differences in wet
mass between the sexes (F = 549,,z P < 0.001)
and between locations (F = 368 ,~, P < 0.001). At
both locations females are much larger than
males, and for both sexes, the wasps from St.
Johns are much larger than those from Newberry.
Similar results were obtained from comparison of
RWL among the samples. These comparisons fol-
low the same pattern reported by Hastings et al.
(2008) for cicada killers sampled at these loca-
tions.
The species and descriptive statistics of the
wet masses and RWL of cicadas retrieved from fe-
male wasps at the 2 locations are summarized in
Table 2. Comparison of samples (independent-
samples t-tests) of N. hieroglyphica and D. olym-
pusa, and iS t. australis between locations re-
vealed no significant difference in RWL, hence
samples for each species from both locations were
combined. No TS resonans were sampled from
Newberry and no TS similaris or TS pruinosus were
found at St. Johns. The cicadas fell into 3 size cat-
egories; we classify N. hieroglyphica and D. olym-
pusa as small cicadas, TS resonans as large cica-
das, and other Tibicen species as medium cicadas.
Table 3 summarizes the number of cicadas of
the different size classes brought to nests by pro-
visioning female wasps at each location. Also
shown are the descriptive statistics of the body
sizes of the cicadas that we retrieved from the
wasps, all size classes combined, sampled from
each location. At the Newberry site, females pro-
visioned nearly exclusively with small cicadas,
whereas the St. Johns females brought similar
numbers of cicadas of the 3 size classes to their
nests. The mean wet mass of the Newberry cica-
das was much smaller than that of the St. Johns
cicadas (t = 12.4, df = 141, P < 0.001); a similar re-
sult was found for the comparison of cicada mean
RWL between locations (t = 14.8, df = 156, P <
0.001). As Hastings et al. (2008) previously found,
the cicada provisions of the female wasps at the











TABLE 2. SIZE CATEGORIES OF DIFFERENT SPECIES OF CICADAS RETRIEVED FROM FEMALE CICADA KILLER WASPS AT
NEWBERRY AND ST. JOHNs, FL. ALSO SHOWN ARE MEAN + SEM WET MASS IN MG, MEAN RIGHT WING LENGTH
(RWL) IN MM AND THE NUMBER OF SPECIMENS (N) FOR EACH SPECIES.

Cicada species Size category mg Wet mass (n) mm RWL (u)

Neocicada heiroglyphica small 339.5 + 5.3 (87) 26.5 + 0.1 (99)
Diceroprocta olympusa small 419.4 + 18.1 (14) 27.9 + 0.3 (14)
Tibicen tibicen australis medium 1897.2 + 54.2 (24) 43.1 + 0.3 (27)
Tibicen pruinosus medium 1632.0 + 264.0 (3) 42.15 + 1.0 (3)
Tibicen similaris medium 36. 97 (1)
Tibicen resonans large 2723 + 97.0 (18) 52.54 + 0.5 (18)



TABLE 3. TOTAL NUMBER OF CICADAS OF EACH SIZE CATEGORY BROUGHT TO NESTS BY FEMALE S. SPECIOSUS AT EACH
LOCATION. ALSO SHOWN ARE MEAN + SEM, NUMBER (N) WET MASS AND RWL FOR SAMPLES OF CICADAS RE-
TRIEVED FROM PROVISIONING FEMALES.

Cicada size category Mean Cicada Body Size

Location Small Medium Large mg Wet mass (n) mg RWL (u)

Newberry 294 7 0 389.96 2 26.2 (90) 26.98 2 0.3 (102)
St. Johns 61 68 43 998.31 2 137.1 (53) 42.28 e 0.3 (56)


Florida Entomologist 93(3)


September 2010


Newberry location were generally much smaller
than they were at the St. Johns site.
The relationship between RWL and wet body
mass of wasps collected from both sites is shown
in Fig. 1. The graph is a scatterplot of trans-
formed data, obtained by taking the natural loga-
rithm of both RWL and wet mass measurements
for each wasp; linear regression was then per-
formed on the transformed data. The high R2
(0.94) indicates that RWL is an excellent predic-
tor of wet body mass. Wet mass is an exponential,
rather than a linear, function of RWL, which
should be expected, as mass should increase as a
cubic function of linear measurements such as
wing length.
Fig. 2 displays the relationship between RWL
and wet body mass, both variables log-trans-
formed, for cicadas retrieved from female wasps,
with all species from both locations combined.
The relationship was the same for small and large
cicadas; the best-fit line for medium cicadas fol-
lowed a similar slope, but had a different Y-inter-
cept, indicating that for any given RWL, the me-
dium cicadas were slightly more massive than
were cicadas of the other size categories. As with
the wasps, wet mass is an exponential function of
RWL, and the high R2 (0.98), shows that RWL is
an excellent predictor of wet mass in cicadas.

Prey Loads

Fig. 3 is based on a similar figure published
by Grant (2006). In it we plot individual provi-
sioning events by wet masses of the female
wasp and her prey, as well as lines of various


~ 1In(W~aspRWL)= -4.19+ (327)(In(WaspRWL}}
cD R-square sla SE NP Ue .*
a o Intercept -419 014 <00001 L
Sr Slope 3.27 0 04 <0.0001 1 .


g* *

o .



a n 1 /7*



3.0 3.2 3.4 3.6

Natural Log of Wasp RWL (mm)

Fig. 1. The relationship between body wet mass in
mg and right wing length (RWL) in mm in S. speciosus;
samples of both sexes from both locations combined. In
the scatter plot both variables have been log-normal-
ized. The straight line of best fit and its equation are
shown.



slopes passing through the origin; these lines
represent possible relative prey and wasp
masses and, for example, the line labeled "2"
represents cicada masses twice that of their
wasp captors. Newberry provisioning events
are distinguished from those occurring at St.
Johns. Relative prey loads varied greatly at
both sites, with prey mass ranging from approx-








Hastings et al.: Provisioning By Cicada Killer Wasps


of the wasps' ability to carry prey in flight (Co-
elho 1997). However, in contrast with Grant's
findings, there is a much broader range of prey
loads, with many wasps carrying cicadas signif-
icantly less than their own mass. In fact, many
of the wasps had prey loads of less than 0.5.
Most wasps from Newberry are small and
therefore constrained from provisioning with
medium and large cicadas, which are, on aver-
age more than 2.5 times their mass. They must,
by necessity, provision with small cicadas,
which generally weigh much less than they do.
The few provisioning events in Newberry with
medium cicadas involved the largest female
wasps. The wasps in St. Johns, which are gener-
ally much larger, and are not similarly con-
strained, mainly provisioned with medium and
large cicadas. As in Grant (2006), most provi-
sioning events at St. Johns were clustered
around the relative prey-load line with a slope
of 2.0. Some St. Johns females provisioned with
small cicadas; with only 2 exceptions, these
were relatively small wasps. In other words,
large wasps rarely provisioned with small cica-
das.


The Relationship between RWL in Wasps and their Prey

In Fig. 4, individual provisioning events are
plotted by the RWL of the provisioning female
and the RWL of her prey. The data suggest a set of



"icdas e= 0.0169(CicadaRWL)30 J O
8 Medium
SCicadaMass= 0 0212(CicadaRWL) o2 -*




.*' :








25 35 45 55

Cicatdas RWL (mm)

Fig. 2. The relationship between body wet mass in
mg and right wing length (RWL) in mm in cicadas of all
species retrieved from female S. speciosus, both loca-
tions combined. Also shown are the curves that best de-
scribe this relationship; the curve for medium wasps
has a different Y-intercept than does the one for the
small and large wasps.



imately 0.25 to 2.5 times the mass of the wasp.
As in a New Jersey cicada killer population
(Grant 2006), the upper limit for prey load ap-
pears to be 2.5, which is likely the physical limit


2.5.

2.0 +




1.0-


+ St. Johns
*Newberry


*T #



+


400 800 1200


1600


20 25 30 35


Mass of wasp (mg)

Fig. 3. Prey loads of individual female S. speciosus
shown as body wet masses of the female wasp and her
prey. Provisioning events occurring at Newberry are
contrasted from those at St. Johns. Also shown are lines
of various slopes passing through the origin; these lines
represent possible relative prey and wasp masses, with
the line labeled "2" indicating cicada masses twice those
of their wasp captors. This figure is based on a similar
one in Grant (2006).


Female Wasp RWL (mm)

Fig. 4. Individual provisioning events are plotted by
the right wing length (RWL) in mm of the provisioning
female and the RWL of her prey. Provisioning events oc-
curring at the 2 locations are combined. Also shown is
the non-linear stair-step model that describes the rela-
tionship between wasp RWL and prey RWL. Symbols
for provisioning events are distinguished by cicada size
category. Coordinates of the switch-points of the stair-
step model are shown in parentheses.


~
:yc-~i rc~

































































TABLE 4. PARAMETERS OF THE STAIR-STEP REGRESSION MODEL (SEE FIG. 4) OF THE RELATIONSHIP BETWEEN THE RWL
OF S. SPECIOSUS FEMALES AND THE RWL OF THEIR CICADA PREY; DATA FROM BOTH LOCATIONS COMBINED.
THE PARAMETERS DEFINE THE LOCATIONS AND SIZES (HEIGHTS) OF THE STEPS OF THE MODEL.

Feature of model Parameter Estimate Standard error P-value

Baseline height a 26.588 0.342 <.0001
Size of first step B 16.038 0.671 <.0001
Size of second step Y 10.960 1.299 <.0001
Location of first step 1-1 28.372 0.009 <.0001
Location of second step 1-1 33.664 0.008 <.0001


Florida Entomologist 93(3)


September 2010


stairs; small wasps provisioned with small cica-
das, medium-sized wasps primarily with medium
cicadas, and large wasps with large cicadas. We
used a seven-parameter model of the following
form to model the data:

cicada RWL = at + [3+ S (wasp RWL; y,, o,) +
y S (wasp RWL; y2, 02),

where S (x; y, o) is the normal cumulative distri-
bution function centered at 1- with standard devi-
ation o. This represents one choice out of many
possible sigmoidal functions which we could have
used to make the transition between 2 levels. We
felt that such a model, made up of 3 distinct levels
separated by smooth transitions, would capture
the behavior of the predation as seen in the preda-
tion data. Upon using weighted non-linear regres-
sion to select the best parameters, we discovered
that the result became effectively a step function,
such that the values o, and o, were essentially
zero (not significant at the at = 0.05 level).
The best model we obtained is represented by
the parameters presented in Table 4. We contend
that predation is based on wasp size: there exist
discrete switch-points in wasp RWL at which
wasps suddenly switch to hunting larger prey. We
suggest that this occurs at the RWLs at which the
wasps are physically capable of carrying the
larger cicadas. The case for the transitions occur-
ring when the wasps become physically capable of
carrying the larger cicadas is based in part on the
mass ratio of the transition points in the stair-step
model of RWL. The values of y occur at points such
that the wasp and cicada masses would be along
the slope = 2.0 line of Fig. 3. That is, if we use the
regression models described above to predict wasp
and cicada masses corresponding to the points
(28.372, 42.626) and (33.664, 53.586), we obtain
masses of (856.9, 1793) and (1499, 2850), leading
to mass ratios of 2.093 and 1.901, respectively.

Provisioning by Large Females in St. Johns, FL

With few exceptions, the Newberry wasps, as a
consequence of their small size, are constrained to


provision their nests with small cicadas. How-
ever, the St. Johns wasps are not similarly lim-
ited, and similar numbers of cicadas of the 3 size
classes were brought to nests by the St. Johns fe-
males. Table 5 summarizes the number of cicadas
of each size class brought to nests by female
wasps at the St. Johns location. The wasps, like
the cicadas, are divided into 3 size classes; the
wasp size classes are defined by the stair-step
model presented above. Small female wasps pro-
visioned only with small cicadas, medium females
primarily with medium cicadas, and large fe-
males almost exclusively with large cicadas. For
the purpose of this analysis, if we assume that the
overall provisioning result is an approximate cen-
sus of the cicada prey in the local environment,
then the relative frequencies of the small, me-
dium, and large cicadas would be 0.35, 0.40, and
0.25, respectively. The large female wasps are
presumably capable of carrying all available cica-
das in flight to their nests. Consequently, if these
large females had hunted opportunistically, the
proportions of the size classes of their prey should
be reflective of the relative frequencies of these ci-
cada size classes. However, of the 30 cicadas
brought to nests by large St. Johns females, none
were small, only one was medium, and 29 were
large. Assuming non-selective hunting, the prob-
ability of such an extreme hunting outcome is es-
sentially zero (X2 = 82.2, df = 2, P < 0.001).

Hunt Times

The mean + SEM hunt time for small cicadas
at the Newberry site was 23.5 + 1.9 min (n = 118);
it was not significantly different from the mean
hunt time for small cicadas at the St. Johns site,
which was 29.6 + 7.0 (n = 12) (independent-sam-
ples t = 0.94, df = 128, P = 0.349). No hunt times
were recorded for large cicadas at the Newberry
site; only one was recorded for medium cicadas,
and it was excluded from subsequent analysis.
ANOVA revealed a significant difference in mean
hunt times among cicada size categories at the St.
Johns location (F = 4.6,,,, P = 0.019, power =
0.731) with the mean hunt time for small cicadas











TABLE 5. THE NUMBER OF CICADAS OF EACH SIZE CLAss
BROUGHT TO NESTS BY FEMALE S. SPHECIUS OF
EACH SIZE CLASS AT THE ST. JOHNS LOCATION.
WASP SIZE CLASSES ARE DEFINED BY THE STAIR-
STEP MODEL PRESENTED ABOVE. SMALL WASPS
HAVE RWL < 28.37 MM, MEDIUM WASPS HAVE
RWL BETWEEN 28.37 33.66 MM, AND LARGE
WASPS HAVE RWL > 33.66 MM.

Cicada prey size class

Wasp size class Small Medium Large Total

Small 47 0 0 47
Medium 14 67 14 95
Large 0 1 29 30
Total 61 68 43 172

Relative frequency 0.35 0.40 0.25 1.00



(29.6 -t 7.0 min, n = 12) being significantly shorter
than the mean hunt time for medium cicadas
(54.0 -t 5.8 min, n = 13) (Tukey post hoc multiple
comparison, P = 0.021). No other significant dif-
ferences in mean hunt times were found.

Cicada Communities

Our attempts to census the different prey spe-
cies by song were met with several unanticipated
challenges, including interruption of the attempts
by changes in cloud cover; males generally did not
sing unless direct sunlight was available. We had
difficulty determining the exact number of indi-
vidual males of each species singing at any given
time. Consequently, our census data consisted
only of subjective daily rank orders of abundance.
For each day of study N. hieroglyphica were
judged to be the most abundant followed by D.
olympusa. Tibicen resonans, and iS t. australis
were judged to be equally abundant and less com-
mon than the other 2 species. We concluded that
at both locations, cicadas of each size class were
active each day, and that small cicadas were more
abundant than the medium and the large ones.
Our results suggest that female S. speciosus
exhibit size-specific provisioning at these loca-
tions. Consequently, it is reasonable to expect the
mean hunt time for each cicada size class to be in-
versely related to their abundance; it should take
less time for a female wasp to find a cicada of ap-
propriate size when those cicadas are more abun-
dant. The fact that there was no significant differ-
ence in mean hunt times for small cicadas be-
tween locations is consistent with the conclusion
that small cicadas were similarly abundant at the
2 study sites. Our finding that the mean hunt
time for small cicadas was shorter than it was for
medium cicadas at St. Johns is consistent with
our judgment that small cicadas were more abun-
dant than the medium ones there. We acknowl-


Hastings et al.: Provisioning By Cicada Killer Wasps


edge that factors other than relative abundance of
cicadas of the various size classes in the environ-
ment could affect mean hunt time. For example,
cicada tree preference might be species-specific,
and distances of trees of different species from the
wasp aggregation could vary, thereby affecting
travel time of provisioning wasps. Consequently,
as with our estimates of relative abundance of dif-
ferent cicadas based on song frequency, we re-
main cautious in our assertions that the relative
abundance of a cicada species can be inferred
from mean hunt times.
Though none of the large TS resonans were
brought to nests by female wasps in Newberry, we
heard them singing each day that we were
present in that location, and they are apparently
common throughout the summer in that county
(Walker & Moore 2009). Additionally, in our pre-
vious study at this location (Hastings et al. 2008)
we did collect several of these large cicadas. Aside
from the difference in the cicadas sampled by fe-
male wasps between locations, we found no evi-
dence of any difference in the cicada communities
between these study sites. As we now have evi-
dence that female cicada killers, at least at these
locations, do not capture the available prey cica-
das randomly, we have no reason to assume that
there is a significant difference in the composition
of the cicada communities between Newberry and
St. Johns; in fact, we suggest that they are quite
similar.

DiscussioN

Our findings that the sample mean body sizes
of male wasps, female wasps, and cicada prey
from St. Johns, FL are larger than those from
Newberry, FL are consistent with the results re-
ported by Hastings et al. (2008). However, these
authors proposed that the size of the wasps is de-
termined by the size of the prey available in the
local environment. They stated that a possible ex-
planation for the difference in size of the wasps
between these locations was that the available ci-
cada prey were, on average, smaller at the New-
berry site than they were at St. Johns. Key as-
sumptions of this explanation were that (1) fe-
male cicada killers hunt opportunistically (in
other words, they sample the available cicadas at
random), (2) females provision nest cells with a
consistent number of cicadas, and (3) the size of
offspring is directly related to provision mass.
This first assumption is not supported by evi-
dence presented here. In fact, we found that hunt-
ing by female S. speciosus is size-specific, and if
hunting female S. speciosus in north Florida do
not randomly sample cicadas from the available
pool of potential prey, then the reasoning of this
assumption lacks empirical support. Small wasps
do not provision with large cicadas, probably due
simply to mechanical constraints, and large







Florida Entomologist 93(3)


September 2010


wasps, though apparently not constrained, provi-
sion mainly with large cicadas. Though these re-
sults differ from those reported in other studies of
Sphecius, size-specific provisioning has been ob-
served in other mass-provisioning, Crabronid
wasps such as the digger wasps Cerceris arenaria
L. (Polidori et al. 2005) and Palmodes laeviventris
Cresson (Gwynne & Dodson 1983).
We do not refute the findings of Coelho (1997),
and Grant (2006), which concluded that female S.
speciosus, at the locations of their respective stud-
ies, hunted opportunistically. However, at these
locations, the available prey were relatively uni-
form in size. In contrast, in Newberry and St.
Johns, Florida, we found that cicada killer wasps
preyed on cicadas of distinct size classes, with a
wet body mass range equal to or exceeding an or-
der of magnitude (217-2150 mg in Newberry and
303-3421 mg in St. Johns). This diversity in prey
size likely creates a very different set of selective
influences on S. speciosus body size and provision-
ing behavior than is present at locations where
prey cicadas are not so variable in size.
Hastings et al. (2008) further argued that their
observed difference in the mean body size of cica-
das retrieved from female S. speciosus between
Newberry and St. Johns was likely due to a differ-
ence in the size distribution of available cicada
prey in the respective local environments. How-
ever, we found no evidence that the relative spe-
cies compositions and abundances of the cicada
communities are different at these 2 locations. In
fact, based on judgement of relative frequencies of
songs of the various cicada species, and of hunt
times required for wasp provisioning with them,
we suspect that the cicada communities at the 2
locations are quite similar. Consequently, the dif-
ference in mean body size of cicadas we retrieved
from wasps at the 2 locations might well be a re-
sult of the difference in size of the female wasps.
The cicadas sampled by the wasps in Newberry
were smaller because the wasps there were
smaller, and not because small cicadas predomi-
nate there, and medium-sized and large ones pre-
dominate in St. Johns. As we did not directly sam-
ple the cicadas in the local environments, we state
this conclusion with caution.
It is reasonable to assume that the size of indi-
vidual adult S. speciosus is determined largely by
the mass of the cicadas provided to them by their
mothers, as is the case in some other Hy-
menoptera (Punzo 1994; Strohm 2000; Seidel-
mann 2006). Dow (1942b3) presented evidence of
this assumption, although the evidence was
based on provision mass estimates, rather than
on direct measurements of masses of cicadas pro-
vided to each offspring. Analysis of Dow's data re-
veals that, on average, conversion of provision
mass to adult wasp mass is approximately 25% in
S. speciosus, indicating that an adult wasp of 500
mg is likely to develop from a 2000 mg mass of ci-


cada provisions. Preliminary data from the use of
trap nests in an Easton, PA, cicada killer popula-
tion in 2008 yield similar prey conversion effi-
ciency for male offspring (24.6 + 1.4%, a = 7; Hol-
liday, unpublished data).
As Grant (2006) reported for New Jersey cicada
killers, the prey loads we found for medium-sized
and large female cicada killers in St. Johns were
clustered around the relative prey-load line with a
slope of 2.0 (Fig. 3); the prey were generally twice
as massive as the provisioning female. Assuming a
25% conversion of provision mass to offspring
mass, daughters given 2 such cicadas would
achieve an adult size similar to that of their
mother. The common provisioning pattern exhib-
ited by S. speciosus whereby daughters are usually
given 2 cicadas means that the size of daughters
will tend to be similar to that of their mothers. In-
deed, we hypothesize that the size of daughters in
this species is probably directly related to the size
of mothers. A testable prediction of this hypothesis
is that in the St. Johns location, large females,
which selectively hunt large cicadas, should pro-
duce larger offspring than those produced by me-
dium-sized females, which more often bring me-
dium cicadas to their nests. We hope to test this hy-
pothesis in St. Johns in the near future by excavat-
ing nest cells and/or using trap nests.
We found that small female wasps at both loca-
tions provision only with small cicadas which, in
nearly all cases, weighed less than their predator.
Frequently, these prey had a wet mass less than
one-half that of the female wasp. This result sug-
gests that, unlike larger wasps, small female
wasps must provide each daughter with many
more than just 2 cicadas, assuming that daughters
are similar in size to their mothers, and that about
25% of the provision mass is converted to adult
wasp mass. Given these assumptions, a small fe-
male wasp hunting cicadas one-half her size must
provide each daughter with 8 cicadas. In fact, this
hypothesis is supported by preliminary evidence
from our focal studies of provisioning females. We
noted that females provisioning with small cicadas
commonly exhibited bouts of continuous provision-
ing, with a final total of 7-9 cicadas, uninterrupted
by digging activity. These bouts of uninterrupted
hunting likely correspond to complete provisioning
of nest cells for individual female offspring. Nu-
merous uninterrupted provisioning bouts with 4
small cicadas also were observed, which we pre-
sumed to be completed nest cells for male off-
spring. We plan to test our interpretations of this
provisioning activity when we return to these
study sites in the near future, again by excavating
nest cells and/or using trap nests. It is unlikely
that the general pattern of provisioning previously
described for this species (1, sometimes 2, cicadas
for sons; 2, sometimes 3 cicadas for daughters), is
exhibited by the small S. speciosus in north Flor-
ida. In this regard, these small wasps are probably








Hastings et al.: Provisioning By Cicada Killer Wasps


similar to Sphecius hogardii Latreille in Cuba,
which have been reported to provision nest cells
with 4-6 cicadas, Uhleroides wualkerii Gudrin-
Mineville (Genaro & de Varona 1998), which are
slightly larger than the 2 species in the "small" size
category in the present study.
This study has provided evidence of size-spe-
cific provisioning by female cicada killer wasps at
2 locations in north Florida; female wasps appear
to provision nests with the largest available cica-
das that they can carry in flight. At these loca-
tions, a much broader size range of potential prey
is available than is apparently present where
hunting by these wasps has been described as op-
portumistic. Perhaps selective provisioning by S.
speciosus occurs at other locations where diverse
sizes of cicada prey are found; this is a question
we intend to investigate in the future.
This study also supports the finding of Hast-
ings et al. (2008) that the wasps of both sexes and
the cicadas brought to nests by female wasps are
much lar er in St. Johns than they are in New-
berry, FL. However, in contrast with this previous
study, we contend that the prey retrieved from fe-
male wasps at St. Johns are larger because the
wasps hunting them there are larger, and not be-
cause there is a significant difference in the ci-
cada communities between these locations. If, as
we contend, the observed difference in size of ci-
cada killers between Newberry and St. Johns can-
not be attributed to a difference in size of avail-
able prey in the local environments, then what
could account for the difference in the size of the
wasps? At this point, any attempts at explanation
would be speculative. However, we intend to in-
vestigate this issue over the next few years.

ACKNOWLEDGMENTS

We are grateful to Carrie and Wes Simmons, Les
Auerbach, and Jill Morris for allowing us to collect
wasps on their properties. We thank Caroline Peet for
helping us collect cicadas, and Allen Sanborn for identi-
fying many of the cicadas. We thank 3 anonymous re-
viewers for helpful suggestions for revision. This
research was partially supported by a CURM mini-
grant funded by the NSF grant DMS-0636648, and by
the Lafayette College Academic Research Committee.

REFERENCES CITED

Coelho, J. R. 1997. Sexual size dimorphism and flight
behavior in cicada killers, Sphecius speciosus. Oikos
79: 371-375.
DOW, R. 1942a. The relation between prey and sex in the
cicada killer. Proc. Entomol. Soc. Washington 44 (6 -
June): 127-128.
DOW, R. 1942b3. The relation of the prey of Sphecius spe-
ciosus to the size and sex of the adult wasp (Hy-


menoptera: Sphecidae). Ann. Entomol. Soc. America
35: 310-317.
EVANs, H. E., AND O'NTEILL, K. M. 2007. The Sand
Wasps: Natural History and Behavior: Harvard Uni-
GEversity Pre s. Cambri~dg Massachusetts. 34 pl 9.
Comportamiento de Sphecius hogardii durante la
nidificaci6n (Hymenoptera: Sphecidae). Caribbean J.
Sci. 34: 323-324.
GRANT, P. R. 2006. Opportunistic predation and off-
spring sex ratios of cicada-killer wasps (Sphecius
speciosus Drury). Ecol. Entomol. 31: 539-547.
GWYNNE, D. T., AND DODSON, G. N. 1983. Nonrandom
provisioning by the digger wasp, Palmodes laeviven-
mei c meot4a 6Sphecidae). Ann. Entomol. Soc.
HASTINGS, J. M., HOLLIDAY, C. W., AND COELHo, J. R.
2008. Body size relationship between Sphecius spe-
ciosus (Hymenoptera: Crabronidae) and their prey:
prey size determines wasp size. Florida Entomol.
91(4): 657-663.
HOLLIDAY, C. W., AND COELHo, J. R. 2006. Improved
key to New World species of Sphecius (Hymenoptera:
Crabronidae). Ann. Entomol. Soc. America 99: 793-
798.
HOLLII AY, C. W., HASTINGS, J. M., AND COELHo, J. R.
2009. Cicada prey of New World cicada killers,
Sphecius spp. (Dahlbom 1843) (Hymenoptera:
Crabronidae). Entomol. News 120(1): 1-17.
LIN, N. 1979a. The weight of cicada killer wasps,
Sphecius speciosus, and the weight of their prey. J.
Washington Acad. Sci. 68: 159-163.
LIN, N. 1979b. Differential prey selection for the sex of
offspring in the cicada killer Sphecius speciosus (Hy-
menoptera: S~ph cidae). Proc. Entomol. Soc. Wash-

OHL, M., AND THIELE, K. 2007. Estimating body size in
apoid wasps: the significance of inear variables in a
morphologically diverse taxon (Hymenoptera,
Apoidea). Museum fiir Naturkudeder Humbolt Uni-
versitat zu Berlin 83(2): 110-124.
POLIDORI, C., BOESI, R., ISOLA, F., AND ANDRETTI, F.
2005. Provisioning patterns and choice of prey in the
digger wasp Cerceris arenaria (Hymenoptera:
Crabronidae): the role of prey size. European J. En-
tomol. 102: 801-804.
PUNZO, F. 1994. The biology of the spider wasp, Pepsis
thisbe (Hymenoptera: Pompilidae) from Trans Pecos,
Texas. I. Adult morphometrics, lalval development
and the ontogeny of lalval feeding patterns. Psyche
101: 229-242.
R DEVELOPMENT CORE TEAM (2008). R: A Language and
Environment For Statistical Computing. R Founda-
tion for Statistical Computing, Vienna, Austria. IS-
BN 3-900051-07-0, URL http://www.R-project.org.
Last accessed. May 22, 2009.
SEIDELMANN, K. 2006. Open-cell parasitism shapes ma-
ternal investment patterns in the red mason bee Os-
nzia rufa. Behav.Ecol. 17(5): 839-848.
STROHM, E. 2000. Factors affecting body size and fat
content in a digger wasp. Oecol. 123(2): 184-191.
WALKER, T. J., AND MOORE, T. E. Singing Insects of
North America. http ://entomology.ifas.ufl.edu/walk-
er/buzz/c700fl2.htm. Last accessed 17 May, 2009.







Florida Entomologist 93(3)


September 2010


YEAST EXTRACT: SUCROSE RATIO EFFECTS ON EGG LOAD, SURVIVAL,
AND MORTALITY CAUSED BY GF-120 IN WESTERN CHERRY FRUIT FLY
(DIPTERA: TEPHRITIDAE)


WEE L. YEE
United States Depaliment of Agriculture, Agricultural Research Service, Yakima Agricultural Research
Laboratory, 5230 Konnowac Pass Road, Wapato, WA 98951

ABSTRACT

It is unclear which ratios of yeast extract to sucrose result in maximum egg production and
survival in many tephritid fruit flies. Objectives here were to determine yeast extract:su-
crose ratios that maximize egg loads without compromising survival in western cherry fruit
fly, Rhagoletis indifferens Curran, and their effects on mortality caused by spinosad bait
(GF-120). Yeast extract:sucrose ratios of 20:80 and 30:70 maximized egg loads without re-
ducing survival in most cases. In 1 experiment, mortality of flies with low to high egg loads
exposed to fresh GF-120 for 1 or 2 h in the absence of food did not differ. In a separate exper-
iment, egg loads were lowest in flies fed 0:100 and 1:99 diets and highest in flies fed 20:80,
30:70, and 50:50 diets. When these flies were exposed to dried GF-120 for 6 h in presence of
yeast extract and sucrose, percent mortality was lower in flies fed 20:80 and 30:70 (40%)
than 0:100 (69%) and 1:99 (63%) diets. In another experiment, egg loads were lowest in flies
fed 0:100 and 1:99 diet and highest in flies fed 20:80 diet. When these flies were exposed to
dried GF-120 for 6 h in the presence of sucrose only, percent mortality was lower in flies fed
20:80 (39%) than 0:100 (72%) and 1:99 (62%) diets. High yeast extract:sucrose ratios result
in high egg loads in R. indifferens and may reduce the fly's feeding responses to GF-120, al-
though not to the extent that the bait is rendered completely ineffective.

Key Words: feeding, egg production, spinosad bait, survival, diet intake

RESUME

No es claro cuales son las proporciones de extract de levadura a sucrosa que resultan en la
producci6n maxima de huevos y sobrevivencia en muchas moscas de la fruta en la familiar Te-
phritidae. Los objetivos fueron para determinar las proporciones de extract de levadura a
sucrosa que resultan en el m~ximo n~imero de huevos sin comprometer la sobrevivencia de
la mosca occidental de cereza, Rhagoletis indifferens Curran, y sus efectos sobre la moltali-
dad causada por cebo de 'spinosad' (GF-120). Proporciones de extract de levadura: sucrosa
de 20:80 y de 30:70 resultaron en la maxima cantidad (carga) de huevos sin reducir la sobre-
vivencia en la mayoria de los casos. En el experiment, la moltalidad de las moscas con can-
tidades bajas y altas de huevos expuestos a GF-120 fresco por 1 o 2 horas en la ausencia de
comida no fue diferente. En un experiment separado, la cantidad de huevos fue la mis baja
en moscas alimentadas de dietas de 0:100 y 1:99 y la mis alta en moscas alimentadas de die-
tas de 30:70, y 50:50. Cuando las moscas fueron expuestas a GF-120 seco por 6 horas en la
presencia de extract de levadura y sucrosa, el porcentaje de moltalidad fue mas bajo en
moscas alimentadas de dietas de 20:80 y 30:70 (40%) que en las dietas de 0:100 (69%) y 1:99
(63%). En otro experiment, la cantidad de huevos fue mis bajo en moscas alimentadas de
dietas de 0:100 y 1:99 y la mis alta en moscas alimentadas de una dieta de 20:80. Cuando
las moscas fueron expuestas a GF-120 seco por 6 horas en la presencia de solo sucrosa, el
porcentaje de moltalidad fue mis bajo en moscas alimentadas de dietas de 20:80 (39%) que
en dietas de 0:100 (72%) y 1:99 (62%). Proporciones altas de extract de levadura: sucrosa re-
sultaron en altas cantidades de huevos en R. indifferens y pueden reducir la respuesta de ali-
mentaci6n de la mosca a GF-120, aunque no al punto en que el cebo result completamente
inefectivo.



Consumption of yeast hydrolysate or extract sugar may have important effects on various be-
by many tephritid fruit flies increases egg produc- havioral and physiological parameters (Prabhu et
tion and benefits other physiological processes al. 2008), including egg production and survival.
and behaviors (Webster et al. 1979; Cangussu & In nature, flies may not always have the choice of
Zucoloto 1997; J~icome et al. 1999; Aluja et al. self regulating intake of protein and carbohy-
2001; Meats & Leighton 2004; Prabhu et al. drates because nitrogenous and carbohydrate
2008). Particular ratios of amino acids, peptides, foods often do not occur as separate, discrete units
and protein (such as in yeast extract or yeast) to (e.g., leachates and fruit juice are mixtures of







Yee: Yeast Extract Ratio Effects on Cherry Fruit Fly


both) (Hendrichs et al. 1993; Yee 2003, 2008),
making ratios of nutrients in foods biologically
important. It remains unclear which ratios of
yeast extract to sucrose result in maximum egg
production and survival in many fruit fly species.
Clarifying these ratios is important for producing
flies with high egg loads and survival, needed for
colony maintenance and experimentation, as well
as for testing hypotheses about egg load effects on
behaviors.
In studies to determine egg load effects on be-
haviors, egg loads can be manipulated by varying
access to yeast hydrolysate. In Rhagoletis flies, in-
creasing egg loads this way increased the propen-
sity of flies to engage in oviposition-type behav-
iors, including on fruit marked by oviposition de-
terring pheromone (Prokopy et al. 1994; van
Randen & Roitberg 1996). Rhagoletis pomonella
(Walsh) with low egg loads were more attracted to
vials with yeast hydrolysate + bird droppings
than flies with high egg loads (Prokopy et al.
1995), suggesting egg loads and feeding responses
to nitrogenous foods are negatively correlated.
Protein-deficient Ceratitis capitata (Wiedemann)
flies were more active and found protein bait
more often than protein-fed flies and were more
likely to feed on protein than protein-deprived
flies (Vargas et al. 2002; Barry et al. 2003). In
these cases, it can be assumed protein-fed flies
had higher egg loads than protein-deficient flies.
The western cherry fruit fly, Rhagoletis indif-
ferens Curran (Diptera: Tephritidae), is the major
insect pest of sweet cherry, Prunus avium (L.) L.,
in the Pacific Northwest of the U.S. that benefits
from feeding on yeast extract (Yee 2003). How-
ever, effects of different yeast extract:sucrose ra-
tios on its egg production, survival, and feeding
responses are not well known. A ratio of 20:80 has
been used to maintain this species for experimen-
tal work (Yee 2003), but no data have been pub-
lished to confirm this is the optimal ratio to use
for egg production and survival,
Generating flies with low to high egg loads
will help us test hypotheses about egg load effects
on feeding responses in R. indifferens. Control of
this fly is achieved mostly through use of protein-
aceous-sugar bait with spinosad (GF-120@ NF
Naturalyte@ Fruit Fly Bait, Dow AgroSciences,
Indianapolis, IN) (Warner 2008) rather than
broad cover sprays. GF-120 was developed to at-
tract flies, stimulate them to feed, and then kill
them (Moreno & Mangan 2003). Because R. indif-
ferens begins laying eggs about 5-10 d post eclo-
sion at 26.7oC (Frick et al. 1954), bait is applied
weekly. Flies that have fed on high amounts of
yeast extract should have higher egg loads than
those that have fed on lower amounts and may
less likely respond to GF-120 because they need
less protein, resulting in lower mortality. How-
ever, the strength of any egg load-mortality rela-
tionship is unknown.


The objectives of this study were to determine
yeast extract:sucrose ratios that maximize egg
loads without compromising survival in R. indiffe-
rens and their effects on fly mortality caused by
GF-120. The hypothesis that R. indifferens with
greater egg loads (produced by feeding flies higher
yeast extract diets) suffer lower mortality than
flies with lower egg loads after exposure to GF-120
was tested. Intake of diets was determined.

MATERIALS AND METHODS

Flies were collected as eggs or larvae in in-
fested sweet cherries in Jun and Jul 2007 and
2008 in the cities of Richland and Yakima in cen-
tral Washington state, U.S.A. Larvae emerged
from cherries and pupariated in soil in tubs. Pu-
paria were held in moist soil at 3-4oC for 4-8
months, and then removed from chilling and held
at 26-28oC, 30-35% RH, and 16 h of light for adult
emergence and experimentation in 2008 and
2009.

Yeast Extract:Sucrose Diets

Dried yeast extract and sucrose diets similar
to dry mixes used by Prabhu et al. (2008) were
tested. Yeast extract:sucrose ratios (w:w) tested
were (1) 0:100, (2) 1:99, (3) 5:95, (4) 10:90, (5)
20:80, (6) 30:70, and (7) 50:50. Dry granulated
yeast extract (EMD Chem., Merck KGaA, Darm-
stadt, Germany) was used. Based on the manu-
facturer's certificate of analysis, the yeast extract
had a pH of 7.0 and consisted (w:w) of 10.9% N,
0.03% chloride (as NaC1), 1.3% phosphorous com-
pounds (as P), <0.005% heavy metals (as Pb),
<0.05% calcium (Ca), <0.10% magnesium (Mg),
and 15.5% sulfated ash (600oC). To make the di-
ets, yeast extract was first dissolved in water. Su-
crose (Great Value Brand, Walmart, Bentonville,
AR) was added and mixed until it dissolved. Each
treatment when wet was a 1:1 ratio (w:w) of yeast
extract + sucrose:water. A micropipette was used
to place about 250 mg of wet diet onto a glass
cover slip (22 x 22 mm). Diets were dried by plac-
ing them in an oven at 70-80oC for 4 h, resulting
in 135-140 mg of dry diet per cover slip for expo-
sure to flies.

Experiment 1: Egg Loads in Virgin Flies

Virgin flies were first tested because there is
some evidence that in R. pomonella the absence of
males affects fecundity (Opp & Prokopy 1986).
Also, keeping sexes separate was the only way to
document diet intake by males and by females.
Fifteen female or 15 male flies, collected within 12
h of emergence, were placed inside a 1.9-L paper
container (16.2 cm diameter x 10.5 cm high) that
was white inside and covered with light organdy
cloth. (The 4 other experiments below also used









































4(
A. 5-d-Old Virgin Flies








S30





20


is 0 ~9 :5 1:9 08
uss xrc:ucoe(~)De




an B. 10-d-Old Virgin Flies eti Anifrn edo
vaiu es xrc*uroedes en ihsm
lte as entsgiiatydifrn P>00)


Florida Entomologist 93(3)


September 2010


this type of container.) Flies were exposed to diets
(1) to (5) above. Before exposure to flies, cover
slips with diet were weighed on a balance (Adven-
turerTM, AR2140, Ohaus Corp., Pine Brook, NJ).
One pre-weighed cover slip with diet was placed
in a container. Water was provided on a cotton
wick plugged into a 12-ml glass vial. Diets were
left in containers for 5 d for 1 test and 10 d for a
second test. Fly mortality was recorded daily. At
the end of 5 or 10 d, females were placed in 70%
ethanol and later dissected to determine numbers
of fully developed, mature eggs. Flies that died
before the end of 5 or 10 d were not used for egg
counts because different longevities could affect
egg loads (e.g., a 1-d-old fly would not have devel-
oped as many eggs as a 5-d-old fly). Cover slips
with diet were reweighed after 5 or 10 d to deter-
mine diet intake, expressed as mg intake/fly/day.
Flies from 5 of 11 replicates were used to deter-
mine egg loads (flies from the other 6 were used
for a test not reported here), whereas all 11 repli-
cates were used to generate survival and diet in-
take data, except in 10-d-old males and females
fed 20:80 diet, where there were 10 replicates.

Experiment 2: Egg Loads in Mated Flies

Methods here were similar to those in Experi-
ment 1, except 15 female and 15 male flies were
held together in containers, 2 cover slips (instead
of 1) with diet were provided, diets (1) to (7) were
tested, and there was only a 10-d-old group. Five
replicates were completed, except for (7), where 7
were completed.

Experiment 3: Mortality After 1- and 2-h-Exposures to
GF-120 in Absence of Food

Diets (1) to (5) were tested with 10-d-old flies.
Before exposure to GF-120, methods followed
those of Experiment 2. At 10 d, diet was removed
from a container, and one clear dish (9.0 cm diam-
eter x 1.4 cm) with five 20-pL drops of fresh 20%
GF-120 (v/v) (exposed to air for about 20 min at
21oC) was placed on the bottom of the white con-
tainer. There was no food during exposure to GF-
120. GF-120 was left in the container for 1 h in Test
1 and for 2 h in Test 2, and then removed. Three su-
crose cubes were then placed in the container as
food. Mortality was recorded 24 h after removal of
GF-120. Flies were considered dead if they did not
move or could not walk when probed. For Test 1,
five replicates were completed, except for the 1:99
and 20:80 diets, where there were 4 and 6, respec-
tively. For Test 2, five replicates were completed.

Experiment 4: Mortality After 6-h-Exposure to GF-120
in Presence of Yeast Extract Diets

As in Experiment 3, 15 females and 15 males
were held together in 1.9-L containers with 2


cover slips with diet. Unlike Experiment 3, how-
ever, diets (1) to (7) were tested, flies were 7-d-old
when tested, and flies were exposed to dried GF-
120 on artificial silk leaves for 6 h. Eighteen h be-
fore testing, 5 drops of 20% GF-120 were placed
on a 19.5-cm2 light green silk leaf (7.0 cm long, 4.0
cm wide). Drops were dried at 21oC and were
about 5 mm in diameter. Immediately before ex-
posure to GF-120, the 2 diet slips were removed.
A new pre-weighed slip with the same diet that
flies had fed on was placed in the container. The
leaf with GF-120 drops was then clipped onto the
top edge of the container, with the leaf tip 3.5 cm
above the bottom. After 6 h, the leaf and diet slip
were removed, and the diet slip reweighed. One
sucrose cube was then added to the container.
Mortality was recorded as before. There were 5 to
9 replicates of the control and all treatments. Di-
ets not exposed to flies inside separate containers
also were weighed before and after the 6-h-expo-
sure period to confirm weight loss was caused by
feeding.











TABLE 1. EXPERIMENT 1: MEAN SURVIVAL AND DIET INTAKE (MG) + SE IN 5- AND 10-D-OLD VIRGIN RHAGOLETIS INDIF-
FERENS USED TO DETERMINE EGG LOADS.

Percent Alive at 5 or 10 d

Y:S" Males (5 d) Females (5 d) Males (10 d) Females (10 d)

0:100 97.9 + 0.9 Aa 97.0 + 1.4 Aa 90.6 + 1.5 Bb 69.1 + 5.1 Dc
1:99 98.2 + 1.3 Aa 95.2 + 2.6 Aa 96.3 + 1.1 Aa 81.8 + 3.4 Cb
5:95 94.5 + 2.0 Ab 99.4 + 0.6 Aa 95.1 + 2.0 Ab 92.7 + 1.1 Bb
10:90 96.4 + 1.4 Aa 98.2 + 0.9 Aa 97.6 + 1.4 Aa 97.0 + 1.1 Aa
20:80 95.8 + 2.1 Aa 95.7 + 1.9 Aa 97.3 + 1.1 Aa 90.7 + 1.8 BCb

Diet Intake/Fly/d

Y:S" Males (0-5 d) Females (0-5 d) Males (0-10 d) Females (0-10 d)

0:100 0.620 + 0.039 Ab 0.752 + 0.024 Ca 0.567 + 0.024 Bb 0.739 + 0.021 Ba
1:99 0.703 + 0.032 Ab 0.832 + 0.024 BCa 0.590 + 0.018 Be 0.750 + 0.030 Bb
5:95 0.673 + 0.020 Ab 0.870 + 0.042 Ba 0.587 + 0.014 Be 0.733 + 0.020 Bb
10:90 0.658 + 0.011 Ac 0.850 + 0.024 Ba 0.598 + 0.015 Bd 0.782 + 0.013 Bb
20:80 0.702 + 0.015 Ac 0.964 + 0.029 Aa 0.673 + 0.022 Ac 0.886 + 0.025 Ab

11 replicates of 15 flies each (10 replicates in 10-d-old flies, 20:80 diet).
"Yeast Extract:Sucrose (w:w).
Means followed by same uppercase letters within columns are not significantly different (P > 0.05); means followed by same low-
ercase letters within rows are not significantly different (P > 0.05).


so 10~-d-Od Mated Flies

do- A


Sso



g lo



O 100 1.99 5:95 10:90 20:80 30:70 50:50
Yeast Extract:Sucrose (w:w) Diet

Fig. 2. Experiment 2: Mean egg loads in 10-d-old
mated Rhagoletis indifferens held on various yeast ex-
tract:sucrose diets. Means with same letters are not sig-
nificantly different (P > 0.05).



yeast extract:sucrose ratios. The Statistical
Analysis System (SAS Institute Inc. 2008) was
used for all analyses. Untransformed means -t
SEs are presented.


RESULTS

Experiment 1: Egg Loads in Virgin Flies

Egg loads were higher in 5-d-old virgin flies fed
5:95, 10:90, and 20:80 diets than in flies fed 0:100


Yee: Yeast Extract Ratio Effects on Cherry Fruit Fly


Experiment 5: Mortality After 6-h-Exposure to GF-120
in Presence of Only Sucrose

Test 1 of Experiment 5 was the same as Exper-
iment 4, except that only sucrose was present
during the 6-h-exposure to GF-120 and only diets
(1), (2), (5), and (6) were tested. Five replicates
were completed. In Test 2 of Experiment 5, the
same methods were used, except that after expo-
sure to GF-120, a 10:90 diet was provided in case
it could reduce mortality after exposure to GF-
120 compared with sucrose only. Three to 6 repli-
cates were completed.


Statistical Analysis


In Experiment 1, three-way analysis of vari-
ance (ANOVA) was conducted, with diet, sex,
and fly age as factors. One-way ANOVA was
conducted among diets within sexes, age
groups, and diets across sex and age groups.
Fisher's protected LSD test was used for pair-
wise comparisons. In Experiments 2-5, three,
two-, or one-way ANOVAs were conducted. In
all experiments, numbers of eggs were square-
root transformed for ANOVA. Fly mortality af-
ter exposure and percent survival before expo-
sure to GF-120 were arcsine-transformed for
ANOVA. Mortality data from sexes were com-
bined when there was no sex effect and no sex x
diet interaction (P > 0.05). In Experiments 4
and 5, Pearson correlation coefficients were cal-
culated to describe the relationship between
egg loads and female mortality irrespective of











TABLE 2. EXPERIMENT 2: MEAN SURVIVAL AND DIET INTAKE (MG) + SE IN 10-D-OLD MATED RHAGOLETIS INDIFFERENS
USED TO DETERMINE EGG LOADS.

Percent Alive at 10 d Diet Intake/Fly/d
Y:S" Males + Females Males + Females

0:100 87.8 + 3.1 A 0.5788 + 0.0174 D
1:99 90.7 + 2.9 A 0.5941 + 0.0091 D
5:95 91.3 + 3.9 A 0.6093 + 0.0110 CD
10:90 97.4 + 1.2 A 0.6589 + 0.0142 BCD
20:80 92.5 + 3.5 A 0.7651 + 0.0177 BC
30:70 95.3 + 1.4 A 0.7841 + 0.0198 B
50:50 57.6 + 13.9 B 1.1373 + 0.1071 A

Five or 7 replicates of 30 flies each. "Yeast Extract:Sucrose (w:w).
Percent Alive: F = 2.9; df = 6, 30; P = 0.0235; Diet Intake: F = 14.4; df = 6, 30; P < 0.0001.
Means followed by same letters within columns and within parameters are not significantly different (P > 0.05).


Florida Entomologist 93(3)


September 2010


diet (F = 6.5; df = 4, 20; P = 0.0015), but those in
flies fed 0:100 and 1:99 diets did not differ (Fig.
1A). Many eggs were produced between 5 and 10
d. In 10-d-old virgins, egg load was highest in flies
fed 20:80 diet (F = 52.3; df = 4, 19; P < 0.0001)
(Fig. IB). Inspection of containers after tests re-
vealed no eggs, so there was no "egg dumping"
caused by a lack of oviposition substrates (true in
all experiments). Survival was affected by age,
diet, and sex (P < 0.05) (no interactions). Even
though the 20:80 diet resulted in the highest egg
load in 10-d-old virgins, survival of virgin females
on it was lower than on the 10:90 diet (Table 1).
Survival of females was lower than that of males
within the 0:100 diet. There were significant dif-
ferences between males and females (10-d-old) in
the cases of 1:99 and 20:80 diets (Table 1).
After 5 and 10 d, 70-90 and 20-60 mg of diets '
respectively, remained, so diet was not limiting
(also true in Experiments 2-5). Intake of the 20:80

(dtablewa)s Int keews aff ctmd b0 5 e,old etm a
sex (P < 0.05) (no interactions). Based on amounts
of dry sucrose in each diet and the assumption
that fhies ingested yeast extract and sucrose in
proportion to their ratios, intake of sucrose from
all diets was similar, ranging from 0.696-0.742
mg/fly/d (also true in Experiments 2-5).

Experiment 2: Egg Loads in Mated Flies

Egg loads were higher in 10-d-old mated flies fed
10:90, 20:80, 30:70, and 50:50 than 0:100, 1:99, and
5:95 diets (F = 24.5; df = 6, 30; P < 0.0001) (Fig. 2).
Survival was lowest on the 50:50 diet (no sex effect,
P > 0.05) (Table 2). Diet intake by 10-d-old mated
flies (no sex effect, P > 0.05) increased numerically
as yeast extract:sucrose ratios increased (Table 2).

Experiment 3: Mortality After 1- and 2-h-Exposures to
GF-120 in Absence of Food

Egg loads in dead and live flies after exposure
to GF-120 in Tests 1 and 2 did not differ (P > 0.05),


so data were combined. Egg load was highest in
flies fed 20:80 diet (Fig. 3A), but for both 1- and 2-
h-exposures, no differences in mortality among
diet treatments were detected (sex, sex x diet ef-
fect, P > 0.05) (Figs. 3B and 3C) (1 h: F = 0.8; df =
4, 20; P = 0.5508; 2 h: F = 1.3; df = 4, 20; P =
0.2890). Survival of females on 0:100 was lower
than on other diets (Table 3). The diet intake pat-
tern before GF-120 exposure (Table 3) was similar
to that in Experiment 2.


Experiment 4: Mortality After 6-h-Exposure to GF-120
in Presence of Yeast Extract Diets

Egg load data from dead and live flies after
exposure to GF-120 were combined (P > 0.05).
Egg loads were lowest in flies fed 0:100 and 1:99
diets and highest in flies fed 20:80, 30:70, and
50:50 diets (Fig. 4A). Mortality caused by GF-
120 was lower in flies fed 20:80 and 30:70 than
010 ad 1:99 diet (s3x fsx x3de .fcO, 6P7

Although not significant, there was an unex-
pected increase in mortality of flies fed 50:50
compared with 20:80 and 30:70 diets. There was
a significant negative correlation between egg

100 84; = m.0018). Fl ds cosmedF 02902 .416
mg yeast extract diet/fly during the 6-h-expo-
sure to GF-120. Greater amounts of higher than
lower yeast extract diets were consumed. Sur-
vival before exposure to GF-120 (Table 4) was
lowest in flies fed 50:50 diet, even though egg
load in these flies was similar to that in flies fed
20:80 diet (Fig. 4A). Survival of flies fed 0:100
diet was as high as that of flies fed 1:99 to 30:70
diets before exposure to GF-120 (Table 4), but
flies fed 0:100 diet suffered higher mortality
than flies fed 5:95 to 30:70 diets after GF-120
exposure (Fig. 4B), suggesting the absence of
yeast extract in diet caused a greater response
to GF-120. Food intake increased as yeast ex-
tract in diets increased (Table 4).







Yee: Yeast Extract Ratio Effects on Cherry Fruit Fly



No Food Present During Exposure to GF-120 in Dishes

A. Egg Loads (1-h- and 2-h-Exposure Tests Combined, P > 0.05)


0:100


1:99


5:95


10:90 20:80


d
CV

Wcu
V)T
+ul

B
m
rp~
o,
5u,
o
ca
cux

QL

nr
(p
a,
5


0:100 1:99 5:95 10:90 20:80


0:100 1:99 5:95 10:90 20:80


Yeast Extract:Sucrose (w:w) Diet

Fig. 3. Experiment 3: (A) Mean egg loads and (B) percent mortality of 10-d-old mated male and female Rhago-
letis indifferens held on various yeast extract:sucrose diets at 24 h after 1-h- and (C) 2-h-exposures to fresh GF-120
in dishes. Means with same letter or no letters (NS) are not significantly different (P > 0.05).

Experiment 5: Mortality After 6-h-Exposure to GF-120 bined. Egg loads in dead and live flies after expo-
in Presence of Only Sucrose sure to GF-120 did not differ (P > 0.05), and were
lowest in flies fed 0:100 and 1:99 diets and highest
There were no differences between Tests 1 and in flies fed 20:80 diet (Fig. 5A). Mortality caused
2 for any parameters (P > 0.05), so data were com- by GF-120 was higher in flies fed 0:100 and 1:99












TABLE 3. EXPERIMENT 3: MEAN SURVIVAL AND DIET INTAKE (MG) + SE IN 10-D-OLD MATED RHAGOLETIS INDIFFERENS
TESTED FOR MORTALITY CAUSED BY 1- AND 2-H-EXPOSURES TO GF-120.

Percent Alive at 10 d Diet Intake/Fly/d

Y:S" Males Females Males + Females

0:100 88.8 + 2.8 A 59.8 + 5.1 C 0.634 + 0.022 C
1:99 92.6 + 2.1 A 83.0 + 3.7 B 0.630 + 0.012 C
5:95 92.7 + 1.9 A 95.2 + 1.8 A 0.649 + 0.010 BC
10:90 95.3 + 2.2 A 90.7 + 2.2 AB 0.684 + 0.015 B
20:80 93.9 + 3.0 A 89.0 + 4.5 AB 0.792 + 0.016 A

1-h- and 2-h-exposure tests combined: 9 to 11 replicates of 15 (percent alive) or 30 flies (diet intake) each."Yeast Extract:Sucrose
(w:w). Percent Alive, Males: F = 1.6; df = 4, 45; P = 0.1940; Percent Alive, Females: F = 11.2; df = 4, 45; P < 0.0001; Diet Intake: F
= 21.7; df = 4, 43; P <0.0001.
Means followed by same letters within columns are not significantly different (P > 0.05).


TABLE 4. EXPERIMENT 4: MEAN SURVIVAL AND DIET IN-
TAKE (MG) e SE IN 7-D-OLD MATED RHAGOLE-
TIS INDIFFERENS TESTED FOR MORTALITY
CAUSED BY GF-120.


Percent Alive at 7 d Diet Intake/Fly/d
Y:S" Males + Females Males + Females

0:100 91.6 + 1.4 B 0.609 + 0.016 C
1:99 93.8 + 1.7 AB 0.599 + 0.013 C
5:95 99.3 + 0.7 A 0.607 + 0.013 C
10:90 95.2 + 2.6 AB 0.628 + 0.023 C
20:80 95.1 + 1.0 AB 0.764 + 0.025 B
30:70 97.3 + 1.9 AB 0.833 + 0.031 B
50:50 67.2 + 14.3 C 1.210 + 0.127 A

Five to 9 replicates of30 flies each.
"Yeast Extract:Sucrose (w:w). Percent Alive: F = 3.0; df = 6,
35; P =0.0178; Diet Intake: F =21.1; df = 6, 43; P <0.0001.
Means followed by same letters within columns are not signifi-
cantly different (P > 0.05).



consumed 0.198-0.292 mg sucrose/fly during the
6-h-exposure to GF-120 (P > 0.05). Survival of fe-
males fed 0:100 diet before exposure to GF-120
was lower than that of females fed other diets (Ta-
ble 5), and flies fed 0:100 diet suffered higher
mortality than flies fed 20:80 and 30:70 diets af-
ter GF-120 exposure (Fig. 5B). The diet intake
pattern before GF-120 exposure (Table 5) fol-
lowed that in Experiment 4.

DIscussioN

Results from 5 experiments with virgin and
mated R. mndifferens showed that overall the yeast
extract:sucrose ratios of 20:80 and 30:70, which
equated to 2.2 and 3.3% nitrogen in diets, maxi-
mized egg loads without reducing survival up to 7
or 10 d. However, there were exceptions. In 1 of 3
experiments, the 30:70 diet resulted in lower egg
loads than the 20:80 diet, suggesting that yeast
extract above that found in a 20:80 diet is unnec-


Florida Entomologist 93(3)


September 2010


Yeast Exract Deet Present Dunng Exposure to GF-120 on Leaves (Except 0:10D Daly


0:100 1:99 5:95 10:90 20:80 30:70 50:50
.Mortality After 6-h-Exposure: 7-d-Old Males and Females


0:100 1:99 5:95 10:90 20:80 30:70 50:50
Yeast Extract:Sucrose (w:w) Dier

Fig. 4. Experiment 4: (A) Mean egg loads and (B) per-
cent mortality in 7-d-old mated male and female Rhago-
letis indifferens held on various yeast extract:sucrose
diets at 24 h after a 6-h-exposure to dried GF-120 on ar-
tificial silk leaves, with yeast extract:sucrose diet
pee ta osin exposure Ity G -120. 1Weans with same


than 20:80 diets (sex, sex x diet effect, P > 0.05)
(Fig. 5B) (F = 11.1; df = 3, 32; P < 0.0001). Mortal-
ity of flies fed 20:80 diet was lower than of flies
fed 0:100 and 1:99 diets. There was a significant
correlation between egg loads and mortality (r =
-0.5893, P = 0.0002). Flies in all diet treatments




























0:100 1:99 20:80 30:70
| 8. Mortality After 6-F-Exposure:7`-d-okI Males and Females


TABLE 5. EXPERIMENT 5: MEAN SURVIVAL AND DIET INTAKE (MG) + SE IN 7-D- OLD MATED RHAGOLETIS INDIFFERENS
TESTED FOR MORTALITY CAUSED BY GF-120.

Percent Alive at 7 d Diet Intake/Fly/d

Y:S" Males Females Males + Females

0:100 96.9 + 1.1 A 82.4 + 3.1 B 0.648 + 0.023 B
1:99 97.6 + 1.7 A 95.0 + 2.7 A 0.677 + 0.014 B
20:80 94.8 + 1.5 A 100.0 + 0.0 A 0.838 + 0.015 A
30:70 96.7 + 1.7 A 92.2 + 0.8 A 0.838 + 0.024 A

Tests 1 and 2 combined: 8 to 11 replicates of 15 (percent alive) or 30 flies (diet intake) each. "Yeast Extract:Sucrose (w:w).
Percent Alive, Males: F = 0.8; df = 3, 32; P = 0.4821; Percent Alive, Females: F = 17.2; df = 3, 32; P < 0.0001; Diet Intake: F =
25.8; df = 3, 32; P <0.0001.
Means followed by same letters within columns are not significantly different (P > 0.05).


Yee: Yeast Extract Ratio Effects on Cherry Fruit Fly


uni Froggatt (Prabhu et al. 2008). Even though the
20:80 diet lowered survival in one instance, in-
gesting a diet with 2.2% nitrogen may have an ad-
vantage for an insect such as R. indifferens, which
in nature probably lives only about 1 month (Frick
et al. 1954). In Drosophila melanogaster Meigen,
egg laying was maximized at a protein:carbohy-
drate ratio of 1:2, but longevity was highest at
1:16, and when offered a choice, flies regulated
food intake to maximize lifetime egg production
rather than longevity (Lee et al. 2008).
The hypothesis that R. indifferens with
greater egg loads suffer lower mortality than flies
with lower egg loads after exposure to GF-120
was not supported in Experiment 3 with 1- and 2-
h-exposures to GF-120, but it was in Experiments
4 and 5, so results remain somewhat inconclusive.
Possibly the fresh drops, which were brown in
color, stood out against the white background of
the containers in Experiment 3, making them
more easily seen and found by flies with high
loads than the dry drops presented on green
leaves in Experiments 4 and 5. Also, fresh drops
may have had more attractive odor than dry
drops. GF-120 began losing attractiveness to Bac-
trocera cucurbitae Coquillett after aging for 1-5 h
and lost all attractiveness after 24 h (Prokopy et
al. 2003; Revis et al. 2004). Mortality in R. indif-
feTCHS presumably resulted from feeding on GF-
120 by flies (Yee 2006a). Interestingly, within diet
treatments, mortality of males and females
caused by GF-120 did not differ in any test, sug-
gesting yeast extract:sucrose ratios affected sexes
similarly.
High yeast extract:sucrose ratios result in
high egg loads and may reduce feeding responses
by R. indifferens to GF-120, although not to the
extent that the bait is rendered completely inef-
fective. In Experiments 4 and 5, about 60% of flies
fed 20:80 diet apparently did not respond to dried
GF-120 within 6 h. Based on this finding, it may
be important to apply bait in a way that results in
a very high percentage of flies with high egg loads
finding it quickly, perhaps a way that results in a


Only Sucrose Present Dwring Exposure to GF-120 on Leaves


3-

to






S1-


n-
so -
-



+7-

so
.

a
o-


0:100 1:99 20:80
Yeast Extract:Sucrose (w:w) Diet


30:70


Fig. 5. Experiment 5: (A) Mean egg loads and (B) per-
cent mortality in 7-d-old mated male and female Rhago-
letis indifferens held on various yeast extract:sucrose
diets at 24 h after a 6-h-exposure to dried GF-120 on ar-
tificial silk leaves, with only sucrose present during ex-
posure to GF-120. Means with same letters are not
significantly different (P > 0.05).



essary to maximize egg production. This result
supports the 20:80 ratio currently used for main-
tenance of R. indifferens. The 50:50 (5.4% nitro-
gen) diet also maximized egg loads, but it compro-
mised survival. Similarly, diets with 50-91% yeast
hydrolysate reduced longevity in Bactrocera try-








Florida Entomologist 93(3)


September 2010


uniform rather than a spotty bait distribution.
Flies that do not find the bait quickly could ovi-
posit before feeding and dying. This could contrib-
ute to the variable control (42-91%) using GF-120
in heavily infested residential trees after 1 season
of spraying (Yee & Chapman 2005; Yee 2006b).
Rhagoletis indifferens consumed greater
amounts of diets with higher than lower yeast ex-
tract: sucrose ratios. Flies apparently extracted
similar amounts of sucrose from all diets irrespec-
tive of yeast extract levels, and coincidentally in-
gested the yeast extract that was mixed in them.
This would suggest intake of mixed diets is regu-
lated by sucrose. In general, this explanation for
the observed intake pattern is consistent with
work on C. capitata (Nestel et al. 1985; Phicido-
Silva et al. 2006) and Anastrepha obliqua (Mac-
quart) (Fontellas & Zucoloto 1999; Cresoni-
Pereira & Zucoloto 2001; Medeiros & Zucoloto
2006), and now has been extended to R. indiffer-
ens.

ACKNOWLEDGMENTS

I thank Janine Jewett (USDA-ARS, Wapato, WA) for
laboratory assistance and Roger Vargas, Grant Mc-
Quate (both at USDA-ARS, Hilo, HI), and Carol Lauzon
(California State University, East Bay) for reviewing
early drafts of the manuscript, as well as 2 anonymous
reviewers for helpful comments.

REFERENCES CITED

ALUJA, M., DiAZ-FLEISCHER, F., PAPAJ, D. R., LAGUNES,
G., AND SIVINSKI, J. 2001. Effects of age, diet, female
density, and the host resource on egg load in Anas-
trepha ludens and Anastrepha obliqua (Diptera: Te-
phritidae). J. Insect Physiol. 47: 975-988.
BARRY, J. D., VARGAS, R. I., MILLER, N. W., AND MORSE,
J. G. 2003. Feeding and foraging of wild and sterile
Mediterranean fruit flies (Diptera: Tephritidae) in
the presence of spinosad bait. J. Econ. Entomol. 96:
1405-1411.
CANGUSSU, J. A., AND ZUCOLOTO, F. S. 1997. Effect of
protein sources on fecundity, food acceptance and
sexual choice by Ceratitis capitata (Diptera: Te-
phritidae). Rev. Bras. Biol. 57: 611-618.
CRESONI-PEREIRA, C., AND ZUCOLOTO, F. S. 2001. Influ-
ence of quantities of brewer yeast on the perfor-
mance ofAnastrepha obliqua wild females (Diptera,
Tephritidae). Iheringia, Si~r. Zool. 91, doi: 10.1590/
S0073-47212001000200007
FONTELLAs, T. M. L., AND ZUCOLOTO, F. S. 1999. Nutri-
tive value of diets with different carbohydrates for
adult Anastrepha obliqua (Macquart) (Diptera, Te-
phritidae). Rev. Bras. Zool. 16: 1135-1147.
FRICK, K. E., SIMKOVER, H. G., AND TELFORD, H. S.
1954. Bionomics of the Cherry Fruit Flies in Eastern
Washington. Washington Agric. Exp. Stat. Tech.
Bull. 13: 66 pp.
HENDRICHS, J., LAUZON, C. R., COOLEY, S. S., AND
PROKOPY, R. J. 1993. Contribution of natural food
sources to adult longevity and fecundity of Rhagole-
tis pomonella (Diptera: Tephritidae). Ann. Entomol.
Soc. America 86: 250-264.


JACOME, I., ALUJA, M., AND LIEDO, P. 1999. Impact of
adult diet on demographic and population parame-
ters of the tropical fruit fly Anastrepha serpentina
(Diptera: Tephritidae). Bull. Entomol. Res. 89: 165-
175.
LEE, K. P., SIMPSON, S. J., CLISSOLD, F. J., BROOKS, R.
BALLAD, J. W. O., TAYLOR, P. W., SORAN, N., AND
RAUBENHEIMER, D. 2008. Lifespan and reproduction
in Drosophila: new insights from nutritional geome-
try. Proc. Natl. Acad. Sci. U.S.A. 105: 2498 -2503.
MEATs, A., AND LEIGHTON, M. 2004. Protein consump-
tion by mated, sterile and fertile adults of the
Queensland fruit fly, Bactrocera tryoni and its rela-
tion to egg production. Physiol. Entomol. 29: 176-

MEDEIROs, L., AND ZUCOLOTO, F. S. 2006. Nutritional
balancing in fruit flies: performance of wild adult fe-
males of Anastrepha obliqua (Diptera: Tephritidae)
fed on single-food or food-pair treatments. J. Insect
Physiol. 52: 1121-1127.
MORENO, D. S., AND MANGAN, R. L. 2003. Bait matrix
for novel toxicants for use in control of fruit flies
(Diptera: Tephritidae), pp. 333-362 In C. Schwalbe
[ed.], Invasive Arthropods in Agriculture. Science
Publishers, Inc., Enfield, NH.
NESTEL, D., GALUN, R., AND FRIEDMAN, S. 1985. Long-
term regulation of sucrose intake by the adult Medi-
terranean fruit fly Ceratitis capitata. J. Insect Phys-
iol. 31: 533-536.
OPP, S. B., AND PROKOPY, R. J. 1986. Variation in labo-
ratory oviposition by Rhagoletis pomonella (Diptera:
Tephritidae) in relation to mating status. Ann. Ento-
mol. Soc. America 79: 705-710.
PLACIDO-SILVA, M. C., DA SILVA NETO, A. M., ZUCOLO-
To, F. S., AND JOACHIM-BRAVO, I. S. 2006. Effects of
different protein concentrations on longevity and
feeding behavior of two adult populations of Cerati-
tis capitata Wiedemann (Diptera: Tephritidae). Neo-
tropical Entomol. 35, doi: 10.1590/S1519-
566x2006000600004
PRABHU, V., PEREZ-STAPLEs, D., AND TAYLOR, P.W.
2008. Protein:carbohydrate ratios promoting sexual
activity and longevity of male Queensland fruit flies.
J. Applied Entomol. 132: 575-582.
PROKOPY, R. J., ROITBERG, B. D., AND VARGAS, R. I.
1994. Effects of egg load on finding and acceptance of
host fruit in Ceratitis capitata flies. Physiol. Ento-
mol. 19: 124-132.
PROKOPY, R. J., COOLEY, S. S., LUNA, I., AND DUAN, J. J.
1995. Combined influence of protein hunger and egg
load on the resource foraging behavior of Rhagoletis
pomonella flies (Diptera: Tephritidae). European J.
Entomol. 92: 655-666.
PROKOPY, R. J., MILLER, N. W., PIFIERO, J. C., BARRY, J.
D., TRAN, L. C., ORIDE, L., AND VARGAS, R. I. 2003.
Effectiveness of GF-120 Fruit Fly Bait spray applied
to border area plants for control of melon flies
(Diptera: Tephritidae). J. Econ. Entomol. 96: 1485-
1493.
REVIs, H. C., MILLER, N. W., AND VARGAS, R. I. 2004. Ef-
fects of aging and dilution on attraction and toxicity
of GF-120 Fruit Fly Bait spray for melon fly control
in Hawaii. J. Econ. Entomol. 97: 1659-1665.
SAS INSTITUTE INC. 2008. SAS/STAT@ user's guide,
version 9.2, Cary, NC.
VAN RANDEN, E. J., AND ROITBERG, B. D. 1996. The ef-
feet of egg load on superparasitism by the snowberry
fly. Entomol. Exp. Appl. 79: 241-245.




University of Florida Home Page
© 2004 - 2010 University of Florida George A. Smathers Libraries.
All rights reserved.

Acceptable Use, Copyright, and Disclaimer Statement
Last updated October 10, 2010 - Version 2.9.9 - mvs