• TABLE OF CONTENTS
HIDE
 Evidence of a sex pheromone and...
 Survival of diaprepes abbreviatus...
 Effects of host quality on flight...
 An artificial larval diet for hearing...
 Diversity and abundance of hymenopterous...
 Mulch as a potential management...
 Identification of fall armyworm...
 New report of Chaetopsis massyla...
 Cryptic invasion of the exotic...
 Natural history and flash repertoire...
 Wild Florida house flies (Musca...
 Potential for population growth...
 Host specificity tests of Gratiana...
 Description of the larvae of Tapinoma...
 Foraging by red imported fire ants,...
 Resistance in zoysiagrass (Zoysia...
 Visitation of heliotrope and western...
 Description of the immatures of...
 Occurrence of Ceratitis capitata...
 Pupation and emergence of blueberry...
 Establishment of a new stink bug...
 Royal Palm bug Xylastodoris luteolus...
 A new genus Neopectinimura (Lepidoptera,...
 Effect of integrating soil solarization...
 Tunnel orientation by workers of...
 A biological agent control for...
 A simple, efficient method for...
 Response of Anastrepha obliqua...
 First record of the ant Rhopalothrix...
 First record of Alcathoe carolinensis...
 Spatial distribution of Phyllophaga...
 A new record of Euproctis wilemani...
 First report of Reticulitermes...
 Book reviews
 Back Matter














Group Title: Florida Entomologist
Title: The Florida entomologist
ALL VOLUMES CITATION THUMBNAILS PAGE IMAGE ZOOMABLE
Full Citation
STANDARD VIEW MARC VIEW
Permanent Link: http://ufdc.ufl.edu/UF00098813/00364
 Material Information
Title: The Florida entomologist
Uniform Title: Florida entomologist (Online)
Abbreviated Title: Fla. entomol. (Online)
Physical Description: Serial
Language: English
Creator: Florida Entomological Society
Florida Center for Library Automation
Publisher: Florida Entomological Society
Place of Publication: Gainesville Fla
Gainesville, Fla
Publication Date: June 2010
Frequency: quarterly
regular
 Subjects
Subject: Entomology -- Periodicals   ( lcsh )
Insects -- Periodicals -- Florida   ( lcsh )
Genre: review   ( marcgt )
periodical   ( marcgt )
Periodicals   ( lcsh )
 Notes
Additional Physical Form: Also issued in print.
System Details: Mode of access: World Wide Web.
Language: In English; summaries in Spanish.
Dates or Sequential Designation: Vol. 4, no. 1 (July 1920)-
Issuing Body: Official organ of the Florida Entomological Society; online publication a joint project of the Florida Entomological Society and the Florida Center for Library Automation.
General Note: Title from caption (JSTOR, viewed Sept. 13, 2006).
General Note: Place of publication varies.
General Note: Latest issue consulted: Vol. 87, no. 4 (Dec. 2004) (JSTOR, viewed Sept. 13, 2006).
 Record Information
Bibliographic ID: UF00098813
Volume ID: VID00364
Source Institution: University of Florida
Holding Location: University of Florida
Rights Management: All rights reserved by the source institution and holding location.
Resource Identifier: isbn - 0015-4040
issn - 1938-5102
oclc - 33223434
lccn - sn 95026670
 Related Items
Preceded by: Florida buggist (Online)

Table of Contents
    Evidence of a sex pheromone and daily calling pattern of females of Zamagiria dixolophella (Lepidoptera: Pyralidae)
        Page 147
        Page 148
        Page 149
        Page 150
        Page 151
        Page 152
    Survival of diaprepes abbreviatus (Coleoptera: Curculionidae) larvae on green buttonwood trees in flooded marl soil and potting medium
        Page 153
        Page 154
        Page 155
        Page 156
        Page 157
        Page 158
        Page 159
        Page 160
    Effects of host quality on flight muscle development in Neochetina Eichhorniae and N. Bruchi (Coleoptera: Curculionidae)
        Page 161
        Page 162
        Page 163
        Page 164
        Page 165
        Page 166
    An artificial larval diet for hearing of Anastrepha Striata (Diptera: Tephritidae)
        Page 167
        Page 168
        Page 169
        Page 170
        Page 171
        Page 172
        Page 173
        Page 174
    Diversity and abundance of hymenopterous parasitoids associated with Anastrepha fraterculus (Diptera: Tephritidae) in native and exotic host plants in Misiones, northeastern Argentina
        Page 175
        Page 176
        Page 177
        Page 178
        Page 179
        Page 180
        Page 181
        Page 182
    Mulch as a potential management strategy for lesser cornstalk borer, Elasmopalpus lignosellus (Insecta: Lepidoptera: Pyralidae), in bush bean (Phaseolus vulgaris)
        Page 183
        Page 184
        Page 185
        Page 186
        Page 187
        Page 188
        Page 189
        Page 190
    Identification of fall armyworm (Lepidoptera: Noctuidae) hosts strains based on male-derived spermatophores
        Page 191
        Page 192
        Page 193
        Page 194
        Page 195
        Page 196
        Page 197
    New report of Chaetopsis massyla (Diptera: Ulidiidae) as a primary pest of corn in Florida
        Page 198
        Page 199
        Page 200
        Page 201
        Page 202
    Cryptic invasion of the exotic Bemisia tabaci biotype Q occurred widespread in Shandong province of China
        Page 203
        Page 204
        Page 205
        Page 206
        Page 207
    Natural history and flash repertoire of the synchronous firefly Photinus carolinus (Coleoptera: Lampyridae) in the Great Smoky Mountains National Park
        Page 208
        Page 209
        Page 210
        Page 211
        Page 212
        Page 213
        Page 214
        Page 215
        Page 216
        Page 217
    Wild Florida house flies (Musca Domestica) as carriers of pathogenic bacteria
        Page 218
        Page 219
        Page 220
        Page 221
        Page 222
        Page 223
    Potential for population growth of the small hive beetle Aethina tumida (Coleoptera: Nitidulidae) on diets of pollen dough and oranges
        Page 224
        Page 225
        Page 226
        Page 227
        Page 228
        Page 229
        Page 230
        Page 230a
        Page 230b
        Page 230c
        Page 230d
        Page 230e
        Page 230f
        Page 230g
        Page 230h
        Page 230i
        Page 230j
        Page 230k
    Host specificity tests of Gratiana graminea (Coleoptera: Chrysomelidae), a potential biological control agent of tropical soda apple, Solanum viarum (Solanaceae)
        Page 231
        Page 232
        Page 233
        Page 234
        Page 235
        Page 236
        Page 237
        Page 238
        Page 239
        Page 240
        Page 241
        Page 242
    Description of the larvae of Tapinoma melanocephalum (Hymenoptera: Formicidae)
        Page 243
        Page 244
        Page 245
        Page 246
        Page 247
    Foraging by red imported fire ants, Solenopsis invicta (Hymenoptera; Formicidae) on turfgrasses
        Page 248
        Page 249
        Page 250
        Page 251
        Page 252
        Page 253
    Resistance in zoysiagrass (Zoysia SPP.) to the fall armyworm (Spodoptera frugiperda) (Lepidoptera: Noctuidae)
        Page 254
        Page 255
        Page 256
        Page 257
        Page 258
        Page 259
    Visitation of heliotrope and western purslane flowers by Hesperopsis gracielae (Lepidoptera: Hesperiidae)
        Page 260
        Page 261
        Page 262
        Page 263
        Page 264
    Description of the immatures of workers of the ant Camponotus vittatus (Hymenoptera: Formicidae)
        Page 265
        Page 266
        Page 267
        Page 268
        Page 269
        Page 270
        Page 271
        Page 272
        Page 273
        Page 274
        Page 275
        Page 276
    Occurrence of Ceratitis capitata and Anastrepha fraterculus (Diptera: Tephritidae) on cultivated, exotic fruit species in the highland valleys of Tucuman in Northwest Argentina
        Page 277
        Page 278
        Page 279
        Page 280
        Page 281
        Page 282
    Pupation and emergence of blueberry gall midge, Dasineura oxycoccana (Diptera: Cecidomyiidae), under varying temperature conditions
        Page 283
        Page 284
        Page 285
        Page 286
        Page 287
        Page 288
        Page 289
        Page 290
    Establishment of a new stink bug pest, Oebalus insularis (Hemiptera: Pentatomidae), in Florida rice
        Page 291
        Page 292
        Page 293
    Royal Palm bug Xylastodoris luteolus (Hemiptera: Thaumastocoridae) control with soil applied systemics
        Page 294
        Page 295
        Page 296
        Page 297
    A new genus Neopectinimura (Lepidoptera, Gelechioidea, Lecithoceridae), with five new species from Papua New Guinea
        Page 298
        Page 299
        Page 300
        Page 301
        Page 302
        Page 303
        Page 304
        Page 305
        Page 306
        Page 307
    Effect of integrating soil solarization and organic mulching on the soil surface insect community
        Page 308
        Page 309
    Tunnel orientation by workers of Coptotermes formosanus (Isoptera: Rhinotermitidae) subjected to unilateral antennal ablation
        Page 310
        Page 311
        Page 312
    A biological agent control for Parkinsonia aculeata, the seed beetle Penthobruchus germaini, is recorded for a new country
        Page 313
        Page 314
    A simple, efficient method for extracting Neochetina eichhorniae and N. bruchi (Coleoptera: Curculionidae) from waterhyacinth (Eichhornia crassipes: Pontederiaceae)
        Page 315
        Page 316
    Response of Anastrepha obliqua (Diptera: Tephritidae) to fruit odors and protein-based lures in field trials
        Page 317
        Page 318
    First record of the ant Rhopalothrix weberi (Hymenoptera: Formicidae: Myrmicinae) for Mexico
        Page 319
        Page 320
    First record of Alcathoe carolinensis (Lepidoptera: Sesiidae) collected in Tennessee
        Page 321
        Page 322
    Spatial distribution of Phyllophaga vandinei (Coleoptera: Scarabaeidae) emergence within and around a mamey sapote orchard
        Page 323
        Page 324
    A new record of Euproctis wilemani (Lepidoptera: Lymantriidae) from Hainan Island
        Page 325
        Page 326
    First report of Reticulitermes flavipes (Isoptera: Rhinotermitidae) in Italy
        Page 327
        Page 328
    Book reviews
        Page 329
        Page 330
    Back Matter
        Page 331
        Page 332
        Page 333
Full Text



Castrej6n-G6mez: Daily Calling Pattern ofZ. dixolophella


EVIDENCE OF A SEX PHEROMONE AND DAILY CALLING PATTERN OF
FEMALES OF ZAMAGIRIA DIXOLOPHELLA (LEPIDOPTERA: PYRALIDAE)

VICTOR R. CASTREJON-GOMEZ'2
'Becario COFAA. Departamento de Interacciones Planta-Insecto, Centro de Desarrollo de Productos Bi6ticos
(CEPROBI), del Instituto Polit6cnico Nacional, Apdo. postal. 24, San Isidro, Yautepec, Morelos C. P. 62730, M6xico
E- mail: vcastrejon@ipn.mx

2Departamento de Entomologia Tropical, El Colegio de la Frontera Sur (ECOSUR), Apdo. Postal 36, 30700,
Tapachula, Chiapas, M6xico


ABSTRACT

Evidence of a sex pheromone released by sapodilla bud borer, Zamagiria dixolophella Dyar
(Lepidoptera: Pyralidae), females was obtained under field conditions. Delta type traps
baited with 2-d-old virgin females captured wild males in a sapodilla (Manilkara zapota (L.)
van Royen) plantation. Once the existence of the sex pheromone was demonstrated, the fol-
lowing study was undertaken to describe calling behavior of Z. dixolophella under labora-
tory conditions. The calling position observed in this moth is similar to that reported for
other species of this subfamily. A single period of calling was observed. The calling observed
is of the continuous type and was observed only during scotophase. The females initiated
calling when 1-d-old. The maximum number of insects calling was observed in 2-3-d-old fe-
males between the fourth and eighth h of scotophase. Calling in these females is controlled
by a circadian rhythm. The results are discussed in view of the importance of later studies
related to the identification of the sex pheromone.

Key Words: Zamagiria dixolophella, calling behavior, sex pheromone

RESUME

La evidencia de una feromona sexual liberada por las hembras del barrenador de los brotes
del chicozapote, Zamagiria dixolophella Dyar (Lepidoptera: Pyralidae) fue obtenida en con-
diciones de campo. Trampas tipo delta con dos hembras virgenes de dos dias de edad como
atrayentes, capturaron machos silvestres en un rancho de chicozapote (Manilkara zapota
(L.) van Royen). Una vez demostrada la existencia de dicha feromona, el siguiente paso fue
estudiar el comportamiento de llamado de Z. dixolophella en condiciones de laboratorio. La
posici6n de llamado observada en esta palomilla es similar a la reportada para otras species
de esta subfamilia. Un solo period de llamado fue observado. El tipo de llamado observado
es del tipo continue y fue observado solamente durante el period de oscuridad. Las hembras
llamaron desde el primer dia de edad. El pico maximo de llamado fue observado de la cuarta
a la octava hora de oscuridad en hembras de 2 a 3 dias de edad. El llamado en estas hembras
esta controlado por un ritmo circadiano. Se discuten los resultados en base a la importancia
de conocer el comportamiento de llamado para studios posteriores relacionados con la iden-
tificaci6n de la feromona sexual.


Translation provided by the author.


Zamagiria dixolophella Dyar (Lepidoptera:
Pyralidae), the sapodilla bud borer, is found in
Mexico, Central America, and possibly South
America (Heinrich 1956; Iruegas et al. 2002). Sa-
podilla fruit in the Soconusco region of Chiapas
are attacked by this moth, which is considered an
important pest by local producers (Iruegas et al.
2002). The females lay eggs on the sapodilla
branch shoots and the larvae feed on the shoots,
flower petals, and occasionally on the fruits. In-
festation persists throughout the year although
the population peak coincides with the peak sapo-
dilla flowering period between Mar and Jun (Irue-
gas et al. 2002). Currently, control of this species


is based on the use of insecticides. However,
chemical control of this species has proved to be
difficult due to the cryptic nature of the moth and
the fact that no effective method exists to detect
the first infestations of this pest, which would fa-
cilitate directed applications.
Sexual pheromones have proved to be effective
in monitoring programs and, in a few cases, in
mating interruption (Walton et al. 2004; Carde
1990). A sex pheromone has been identified in
various species in the Phycitinae subfamily
(Millar et al. 1996; Teal et al. 1995; Cork et al.
1991; Zagatti et al. 1991) to which Z. dixolophella
belongs, but it is unknown whether the sexual be-







Florida Entomologist 93(2)


havior of this moth species is mediated by a pher-
omone. In this study I present evidence of the ex-
istence of a sexual pheromone released by female
Z. dixolophella. Under laboratory conditions, the
calling position, daily calling pattern, calling pe-
riodicity during each dark phase h and the calling
endogenous circadian rhythm is described.

MATERIALS AND METHODS

Zamagiria dixolophella larvae were collected
in sapodilla trees Manilkara zapota van Royen, in
the following orchards: "El Nayar" (14'49'36"N
and 92'20'52"W at 44 masl) and "Cazanares"
(14'44'40"N and 9224'20"W at 20 masl), both lo-
cated in the municipality of Tapachula, Chiapas,
Mexico. In the laboratory, the larvae were held
until pupation in 3-L clear plastic cylindrical con-
tainers (23 cm height x 14 cm diameter), and al-
lowed to feed upon their host plant (tender young
shoots) in controlled conditions at 25 5'C and 65
+ 5% R H with a reversed photoperiod of 16: 8 h
(L: D). The photophase was from 17:00 h to 09:00
h and the scotophase from 09:00 h to 17:00 h. Pu-
pae obtained were placed in groups in Petri
dishes inside plastic cages (30 x 30 cm) and ob-
served hourly 1 d before emergence. Adults eclos-
ing during the photophase were separated accord-
ing to sex immediately after emergence.

Field Evidence of a Sexual Pheromone

The experiment was performed in the "El Na-
yar" plantation which has 30 ha of sapodilla trees
aged between 12 and 15 years, although only 1
hectare was used in this study. Four white delta
traps (Pherotech, Delta, BC, Canada) (20 x 21 cm
wide and 10.5 cm high) were used. Two 2-d-old
virgin females, enclosed in a small wire mesh
cage, were placed inside each trap. A drop of nat-
ural honey was provided as food ad libitum. The
bases of the traps were impregnated with glue
(Tanglefoot, EUA). A trap without females acted
as the control. The traps were hung from the
branches at the outermost point of the tree crown
at a height of between 2 and 2.5 m. The distance
between each trap was approximately 200 m.
Traps were revised and rotated daily and the
number of captured males recorded; the females
and bases with glue were replaced. The experi-
ment was repeated 2 times, from the 10-13 May
and from the 13-16 May, each test lasting 3 d. In
the second test the traps and control were re-ran-
domized.

Daily Calling Pattern

Twenty recently emerged virgin females were
individually placed in the cylindrical containers
described above. A fresh, tender young host plant
shoot (approximately 15 cm long) with leaves and


flowers was inserted in a plastic vial with cotton
soaked in water and placed in each container. The
host plant was changed daily after each sc-
otophase. The opening of the containers was cov-
ered with gauze to permit circulation of air. A drop
of natural honey was placed daily on gauze to en-
sure that females had food ad libitum. The obser-
vations began during the first scotophase after
emergence and were carried out under the same
conditions described for larval maintenance.
The observations undertaken for the calling
position indicated that this occurs during the sc-
otophase. Consequently the females were ob-
served every 10 min throughout their first 6 sc-
otophases under a red lamp and in absence of
males. If a female called during 2 consecutive ob-
servations this was regarded as if the female had
called for 20 min, if a female called during only 1
of the 2 observations this was taken as a 10 min
calling period (Turgeon & McNeil 1982). The re-
corded parameters in these observations were, as
follows: female age when calling was initiated (sc-
otophases after emergence), the percentage of fe-
males calling daily, the daily onset of calling time
(time after lights off), number of times that each
female called each night and duration of calling of
each female. In order to determine if a relation-
ship existed between female age and the time
when calling behavior began, a linear regression
analysis was conducted with the "Statistica" ver-
sion 6 (StatSof, 2003) statistical package, after
the data were transformed (In) because there was
lack of homogeneity of variance.

Endogenous Calling Periodicity
Pupae were collected from the plantations de-
scribed above 1-2 d before the experiments and
maintained in the laboratory with the same pho-
toperiod as natural conditions (13L: 11D), at 25
5'C and 65 5% R H. Twenty recently emerged fe-
males were placed in the cylindrical containers as
in the calling daily pattern experiment and ob-
served on the first night to quantify the percent-
age of females calling. All 20 females were then
maintained under continuous light for 5 more d.
The females were observed every 30 min for evi-
dence of calling behavior. When calling behavior
was observed, they were checked at 10-min inter-
vals until calling behavior ceased. The percentage
of females calling, time, and duration of calling of
each female were recorded.

RESULTS

Field Evidence of a Sexual Pheromone
In the first experiment performed 10-13 May, a
total of 34 males of Z. dixolophella were captured
with 4 traps. In the second experiment, carried
out 13-16 May, 12 males were captured. Traps
without females had no captures.


June 2010








Castrej6n-G6mez: Daily Calling Pattern of Z. dixolophella


Calling Position

The sexual calling position in Z. dixolophella
females consists of dorsally flexing the abdomen
at an approximately 450 angle and then protrud-
ing the ovipositor to expose the putative phero-
mone gland located in the ventral part of the last
abdominal segments. Wings were maintained at
the sides of the abdomen, lightly touching the sur-
face, when the females were resting. No wing vi-
bration was observed. The antennae were con-
stantly in motion. Once the calling position was
adopted it was maintained until calling was over.


Daily Calling Pattern


Female
after emer
peak was ol
with 95% o
the number
sixth night:
ing pattern
ual females
period dur
males throi
SE) (range
showed jus
observed cc
occurred on
to 2-d-old fi
ter turning
ing showed
age (n = 10
= 0.16) (Fig
3-6-d-old fe
The mean
6 h while t]
(Fig. 4). ThE
served bet
otophase ir
duration w.
females cal
females (33


Fig. 1. Pe
daily during
photoperiod


Endogenous Calling Periodicity

Maintaining females to a 13L: 11D photope-
riod until the first night and then placing them in
continuous light affected calling behavior. On the
first night after emergence the percentage calling
was 95%, but when placed under continuous light
this percentage decreased from the second until
the sixth day with the exception of the fifth day
where there was a small increase. However, the
females called every 24 h during continuous light,
presenting a circadian calling rhythm (Fig. 5).


DISCUSSION


The existence of a sexual pheromone released
calling was initiated on the first night by Z. dixolophella females attractive to conspe-
gence (85%). The maximum calling cific males was demonstrated with the capture in
served on the second and third night, the field of wild males by caged 2-d-old virgin fe-
fthe females calling in both cases, and males. In the majority of moth species, females
r calling diminished on the fourth and adopt a specific body position, known as the call-
s (Fig. 1). There was considerable call- ing position, to release the sexual pheromone.
variation regarding how long individ- This behavior varies between Lepidoptera species
s called each night. The mean calling in the characteristic position of the abdomen,
nation in the 20 individually caged fe- wings, antennas, legs and other body parts (Mo-
ughout 6 d was 303 t 7 min (mean zuraitis 2000). The calling position observed in Z.
of 10 to 400 min) (Fig. 2). Females dixolophella is characteristic of the Phycitinae
t 1 calling period. The calling behavior subfamily (Richards & Thomson 1932). The ex-
)rresponds to the continuous type and tension of the abdomen upwards in order to ex-
ly during the scotophase (Fig. 2). One pose the cuticle of the pheromone gland is the
males initiated calling activity 4 h af- main characteristic of the calling position in this
off the lights. The daily onset of call- moth species. The calling position in Phycitinae
a significant positive correlation with females is very similar to that described for Phyl-
6; df = 1, 104; F = 20.05; P = 0.001; R' lonorictidae females (Mozuraitis 2000) only dif-
. 3). The oldest females called earlier, fearing in that in the former case the antennae are
males calling 1 h earlier on average. raised and continue moving whereas in the latter
calling duration for these females was case they are placed alongside the wings and are
he youngest called for a mean of 4.5 h motionless. Only 1 calling position was observed
e highest percentage of calling was ob- in this study while in other species such as Di-
ween the third and eighth h of sc- atrea considerate Heinrich (Osorio & Cibrian
3-6-d-old females. The mean calling 2000) 2 different positions were observed.
as clearly influenced by age. One-d-old The daily individual calling pattern ofZ. dixol-
led for less time (234 min) than 5-d-old ophella females varied considerably regarding
5 min). calling duration time in contrast to the number of
calling periods whereby all females presented
just 1 calling period. In this study, Z. dixolophella
females initiated calling on the first night after
emergence from the pupae. Similar results were
described for D. abietella females (Fatzinger &
Asher 1971). Other species such as P unionalis
(Mazomenos et al. 2002) called from the second
night after emergence onwards. Studies carried
out on different Pyralidae species have estab-
lished that a correlation exists between ovary de-
velopment and calling behavior (Swier et al.
1 2 3 4 5 6 1976) and that females which call on the first
Age (days) night after emergence are reproductively mature
(West et al. 1984). Matthews & Matthews (1988),
rcentage of Z. dixolophella females calling mention that insects which mate quickly after
the 6 nights of the experiment exposed to a emergence generally have a short life span. Our
of 16 L: 8 D at 25'C and 60 5% RH (n = 20). laboratory results on calling have to be corrobo-



I






Florida Entomologist 93(2)


Day I


Ilii I 1|IIIIIII.ID


Day 2


111111 lllllllll||l


600 Day 3
400
300
lllil IiIIIllII I
1200
0 1 2 3 4 5 6 7 8 9 1011121314151617181920


600 Day4
500
4-5

111111 II IIllIllli
200
100

600 Day 5

300
2010 111111 llI'illI
200



600- Day 6


40011111 11 ir'Illll
1 2 3 4 5 6 7 8 9 1011121314151617181920


Female identification number


Fig. 2. Daily calling pattern of individually caged 1-6-d-old Z. dixolophella virgin females. Each number repre-
sents an individual female. The arrows indicate the start (inwards) and end (outwards) of the scotophase (n = 20).

rated in the field. In our study, the maximum call- the maximum peak. Similar results have been re-
ing peak was observed on the second and third ported in species not belonging to the Pyralidae
night in contrast to P unionalis, in which this oc- family, for example Mamestra configurata Walker
curred on the fourth night (Mazomenos et al. (Howlader & Gerber 1986) and Heliothis zea
2002). In both cases, this behavior decreased after (Boddie) (Raina et al. 1986). As in our study, the
older P unionalis females called earlier (Ma-
zomenos et al. 2002). Howlader (1985) estab-
5.5 lished that in M. convecta both daily onset of call-
ing and calling duration varied with age in fe-
J- -males. Some Z. dixolophella females continued
S 5 calling several min after the light photoperiod
P Swas initiated. Prolonged calling in the oldest fe-
g Sales may be partly due to isolation of the fe-
S4.5 Ln y -00718 X +53272 males (Lawrence & Bartell 1972) and/or attribut-
- o181 able to the fact that under laboratory conditions
the lights are abruptly turned on and off with no
4 gradual increase or decrease in light as in natural
0 1 2 3 4 5 6 conditions.
Age (days) In Z. dixolophella, the calling circadian
rhythm is endogenously based, demonstrated by
Fig. 3. Relationship between Z. dixolophella female the fact that the females called at 24-h intervals
age and the daily onset of calling time under laboratory over 5 d under continuous light after having
conditions (n = 106; df = 1, 104; F = 20.05; P = 0.001; R called during 1 night in a normal photoperiod.
= 0.16). The averages of each day are displayed. *The This has also been reported for other moths be-
data are in Ln values. The corresponding values are: d 1 .
(Ln of 218 min = 5.38 0.04), d 2 (Ln of 181 min = 5.19 longing to this subfamily such as Anagasta kuh-
+ 0.06), d 3 (Ln of 142 min = 4.95 0.05), d 4 (Ln of 136 niella Zeller (Traynier 1970), although in that
min = 4.91 0.06), d 5 (Ln of 145 min = 4.97 0.07), d 6 species the moths were kept in continual dark-
(Ln of 153 min = 5.02 0.07) (n = 20). ness. In insects, the circadian rhythm is regulated


June 2010


-*0


600
4 500
300
E 200
100







Castrej6n-G6mez: Daily Calling Pattern ofZ. dixolophella


Day I




.11111

Day 2







Day 3






1 2 3 4 5 6 7 8


Hours of scotophase


Day 4






Day 5














I 2 3 4 5 6 7 8


Fig. 4. Percentage ofZ. dixolophella virgin females calling each h during 8 h in scotophase. The females were ob-
served during 6 consecutive scotophases (n = 20).


by specific neurons and peripheral tissue cells
(Giebultowicz 2000), synchronizing the time of
the day males search for a mate and thus increas-
ing communication efficiency (Levine 2004).
The importance of knowing female age and
calling time is due to the fact that in many moth
species sexual pheromone release (calling) by fe-
males is correlated with the time of male maxi-
mum response, and in accordance with a daily
rhythm regimen (Mazomenos et al. 2002 and
cited authors; Raina & Menn 1987). Currently,



o o





1 2 3 4 5 6
I II
Age( days)

Fig. 5. Percentage of calling Z. dixolophella females
during 1 scotophase subject to 13L: 11D photoperiod
(black bar) and then submitted to continual light for 5 d
(white bar) (n = 20).


the sexual pheromone of Z. dixolophela is being
researched by using glandular extracts analyzed
by gas chromatography coupled with mass spec-
trometry in 2-3-d-old females calling between the
fourth and eighth h of darkness.

ACKNOWLEDGMENTS
Thanks to Sra. Martha Foursali and Sr. Sergio
Gonzalez for allowing the collection of insects and field-
work on their farms; Armando Virgen in the Chemical
Ecology Laboratory of ECOSUR-Tapachula for his un-
conditional support during the entire study; Dr. Alfredo
Jim6nez P6rez for help with statistical analysis; Dr.
Julio Rojas for his comments on the initial version of
this manuscript. I thank 2 anonymous reviewers for
helpful comments on earlier version of the manuscript.
This study was supported by CONACYT (grant no
91489) and by the Instituto Polit6cnico Nacional (grant
COTEPABE 295).

REFERENCES CITED
CARDE, R. T 1990. Principles of mating disruption, pp.
47-71 In R. L. Ridgway, R. M. Silverstein, and M. N.
Inscoe [eds.], Behavior-modifying Chemicals for In-
sect Management: Applications of Pheromones and
Other Attractants. Marcel Dekker, New York.
FATZINGER, C. W., AND ASHER, W. C. 1971. Mating be-
haviour and evidence for a sex pheromone ofDioryc-







Florida Entomologist 93(2)


tria abietella (Lepidoptera: Pyralidae (Phycitinae)).
Ann. Entomol. Soc. America 64: 612-620.
GIEBULTOWICZ, J. M. 2000. Molecular mechanism and
cellular distribution of insect circadian clocks. Annu.
Rev. Entomol. 45: 769-793.
HEINRICH, C. 1956. American moths of the subfamily
Phycitinae. United States National Museum Bulle-
tin 207. Smithsonian Institution Washington D.C.
HOWLADER, M. A. 1985: The Biology of Calling Behavior
in the Bertha Armyworm, Mamestra configurata
Walker (Lepidoptera: Noctuidae). Ph.D. Thesis,
Univ. Manitoba, Winnipeg, 108 pp.
HOWLADER, M. A., AND GERBER, G. H. 1986. Calling be-
haviour of the bertha armyworm, Mamestra configu-
rata (Lepidoptera: Noctuidae). Canadian Entomol.
118: 735-743.
IRUEGAS, R., GOMEZ, B., CRUZ-LOPEZ, L., MALO, E. A.,
AND ROJAS, J. C. 2002. A new record of moth attacking
sapodilla, with descriptions of female genitalia and
the last instar larva. Florida Entomol. 85: 394-397.
LAWRENCE, L. A., AND BARTELL, R. J. 1972. Effect of age
on calling behavior of virgin females of Epiphyas
postvittana (Lepidoptera) and their pheromone con-
tent and ovarian development. Entomol. Exp. Appl.
15: 455-464.
LEVINE, J. D. 2004. Sharing time on the fly. Current
Opinion in Cell Biology, 16: 210-216.
MATTHEWS, R. W., AND MATTHEWS, J. R. 1988. Insect
Behavior. New York, John Wiley and Sons, 507 p.
MAZOMENOS, B. E., KONSTANTOPOULOU, M., STEFANOU,
D., SKAREAS, S., AND TZEIRANAKIS, L. C. 2002. Fe-
male calling behavior and male response to the syn-
thetic sex pheromone components ofPalpita uniona-
lis (Lepidoptera: Pyralidae), pp. 203-211 In Use of
the Pheromones and Other Semiochemicals in Inte-
grated Production. IOBC WPRS Bulletin 25.
MOZURAITIS, R. 2000. Chemical Communication in Leaf
Mining Moth of the Genus Phyllonorycter. Disserta-
tion. Royal institute of Technology department of
Chemistry, Organic Chemistry, Kungl, Tekniska,
H6gskolan, TRITA, IOK. KTH, Chemistry, Tekni-
kringen 56, 10044 Stockholm. 57 pp.


NORDLUND, D. A., AND BRADY, U. E. 1974. Calling be-
haviour of female Plodia interpunctella (Htibner) un-
der two light regimes. Environ. Entomol. 3: 793-796.
OSORIO, O. R., AND CIBRIAN-TOVAR, J. 2000. Conducta
de cortejo del barrenador de la cana de azicar Di-
atraea considerate Heinrich (Lepidoptera: Pyral-
idae). Agrociencia, 34: 619-626.
RAINA, A. K., KLUN, J. A., AND STADELBACHER, E. A.
1986. Diel periodicity and effect of age and mating
on female sex pheromone titer in Heliothis zea (Lep-
idoptera: Noctuidae). Ann. Entomol. Soc. America
79: 128-131.
RICHARDS, O. W., AND THOMSON, W. S. 1932. A contribu-
tion to the study of the general Ephestia Gn. (includ-
ing Strymax Dyar) and Plodia Gn. (Lepidoptera:
Phycitidae), with notes on parasites of the larvae.
Trans. Entomol. Soc. London, 80: 169-250.
SWIER, S. R., RINGS, R. W., AND MUSIC, G. J. 1976. Re-
productive behaviour of the black cutworm, Agrotis
ipsilon. Ann. Entomol. Soc. America 69: 546-550.
TEAL, P. E. A., AND BYERS, J. R. 1980. Biosystematics of
the genus Euxoa (Lepidoptera: Noctuidae) XIV. Ef-
fect of temperature on female calling behavior and
temporal partitioning in the three sibling species of
the Declarata group. Canadian Entomol. 112: 113-
117.
TRAYNIER, R. M. M. 1970. Sexual behavior of the Medi-
terranean flour moth, Anagasta kuhniella: some in-
fluences of age, photoperiod, and light intensity. Ca-
nadian Entomol. 102: 534-540.
TURGEON, J. J., AND MCNEIL, J. N. 1982. Calling behav-
ior of the armyworm, Pseudaletia unipuncta. Ento-
mol. Exp. Appl. 31: 402-408.
WALTON, V. M., DAANE, K. M., AND PRINGLE, K. L. 2004.
Monitoring Planococcus ficus in South African vine-
yards with sex pheromone-baited traps. Crop Protec-
tion 23: 1089-1096.
WEST, R. J., TEAL, P. E. A., AND LAING, J. E. 1984. Call-
ing behavior of the potato stem borer, Hydraecia
micacea Esper (Lepidoptera: Noctuidae), in the
laboratory and the field. Environ. Entomol. 13:
1399-1404.


June 2010







Martin et al.: Survival ofD. abbreviatus in Flooded Soils


SURVIVAL OF DIAPREPES ABBREVIATUS
(COLEOPTERA: CURCULIONIDAE) LARVAE ON GREEN BUTTONWOOD
TREES IN FLOODED MARL SOIL AND POTTING MEDIUM

CLIFF G. MARTIN', CATHARINE M. MANNION1 AND BRUCE SCHAFFER1
'University of Florida, Tropical Research and Education Center, 18905 S.W. 280 Street, Homestead, FL 33031


ABSTRACT

Survival of Diaprepes root weevil Diaprepes abbreviatus (L.) (Coleoptera: Curculionidae)
larvae was assessed in flooded marl soil and a flooded nursery potting medium with green
buttonwood (Conocarpus erectus L., Combretaceae) as a food source for the larvae. Root-zone
flooding may be a viable control option for flood-tolerant ornamental plants including but-
tonwood. Significantly more larvae survived after 38 d in non-flooded than in flooded marl
soil. Similarly, more larvae survived in non-flooded than in flooded potting medium; no lar-
vae were recovered from flooded potting medium. Larval survival rates were significantly
higher in flooded marl soil than in flooded potting medium, but there was no difference in
survival between non-flooded marl soil and non-flooded potting medium. Larvae recovered
from flooded marl soil had significantly smaller head capsule widths and probably were at
least 1 instar younger than larvae recovered from non-flooded marl soil or non-flooded pot-
ting medium. In summary, flooding marl soil or potting medium reduced survival, and in
marl soil flooding slows the growth ofD. abbreviatus larvae.

Key Words: Diaprepes abbreviatus, buttonwood, flooding, marl, potting medium

RESUME

Las supervivencias de larvas del picudo de las raiz, Diaprepes abbreviatus (L.) (Coleoptera:
Curculionidae) fueron investigado en suelo de marl inundado o en medio de tiesto inundado
y usado por criaderos con buttonwood verde (Conocarpus erectus L., Combretaceae) como
fuente de comida para larvas. Inundando los raiz puede ser un opci6n de control en plants
ornamentales y tolerente de inundaci6n incluyendo buttonwood. En suelo marl, significati-
vamente menos larvas sobreviviron despu6s de 38 dias en condici6nes inundados compara-
dos a no inundados. Semejantemente, mas larvas sobreviviron en medio de tiesto no
inundado comparado al medio de tiesto inundado, desde que no larvas fueron recuperadas.
Tasas de supervivencias para larvas fueron significativamente mas alta en el suelo de marl
inundado comparado al medio de tiesto inundado, pero no fueron diferencias en superviven-
cia entire suelo marl no inundado y medio de tiesto no inundado. Larvas recuperadas de suelo
marl inundado fueron significativamente mas pequenos en anchos de cabezas, y por lo tanto,
fueron a menos de un etapa mas pequeio comparado a larvas recuperadas de suelo marl no
inundado o de medio de tiesto no inundado. En resume, inundando suelo marl o medio de
tiesto redujo la supervivencia, y en suelo marl, la augmentaci6n por larvas de D. abbreviatus.


Translation provided by the authors.


Diaprepes root weevil, Diaprepes abbreviatus
(L.) (Coleoptera: Curculionidae), is an abundant
and serious pest of citrus and sugarcane in its
home range of Puerto Rico (Woodruff 1964). In
Florida, about 100,000 ac (40,469 ha) of citrus are
infested (Weissling et al. 2004), and control costs
and losses have exceeded $1,200 per ac ($2,965
per ha) (Stanley 1996). The weevil has caused
about $70 million in damage annually (crops not
specified) (Weissling et al. 2004). Inadequate
management and the wide host range sustain D.
abbreviatus as a threat to numerous crops includ-
ing many ornamental plants. Transport of the
weevils to regions where it is not established on
infested plants has become a recent concern. Flor-
ida is most likely the source ofD. abbreviatus re-


cently found in Texas (Knapp et al. 2001; Skaria
& French 2001) and California (Klunk 2005). The
need to reduce the introduction ofD. abbreviatus
into other states and countries has resulted in
regulation, inspection, and pesticide application
to nursery stock and other commodities trans-
ported from areas where the weevil is estab-
lished.
Tropical agriculture in southern Florida tends
to occur in low-lying areas with high water tables,
which are prone to periodic flooding (Schaffer
1998). Changing water delivery practices in Ever-
glades National Park have caused raising of wa-
ter tables in these areas (Schaffer 1998). This has
increased the severity, duration, and extent of
flooding in regions that produce tropical fruit and







Florida Entomologist 93(2)


ornamental plants. Elevation of the water table
above the root zone typically depletes soil 02 lev-
els (Kozlowski 1997). The effects of flooding on the
physiology and growth of a woody perennial plant
species can vary among soil types and is partly
based on the rates of soil 02 depletion and other
factors such as soil pH (Schaffer et al. 1992). In
southern Florida plant nurseries, woody orna-
mental plants are grown either in pots containing
standard potting medium or in the field in marl
soils. The marl type agricultural soil in southern
Florida is classified as Biscayne soil (loamy, car-
bonatic, hyperthermic, shallow, and Typic Fluva-
quent) (Nobel et al. 1996; Li 2001). These marl
soils are derived from Miami limestone in areas
with several months of flooding (hydroperiod)
combined with several months of non-flooded con-
ditions per year. The resulting "calcite mud" soil is
high in calcium, has pH of 7.4-8.4, and poor drain-
age (Li 2001).
Diaprepes abbreviatus is a problematic pest due
to its very large host range, which includes at least
317 varieties, 280 species, 180 genera, and 68 fam-
ilies of plants (Simpson et al. 1996, 2000; Knapp et
al. 2000; Mannion et al. 2003; Godfrey et al. 2006).
Although some plants support only 1 stage of the
insect, many plants support all stages of D. abbre-
viatus, including green buttonwood, Conocarpus
erectus L. (Simpson et al. 1996). Green buttonwood
is widely grown as an ornamental tree or shrub in
southern Florida and is native to the tidal swamps
of central and southern Florida (Watkins & Shee-
han 1975; Wunderlin 1998). As suggested from its
native range, it is very tolerant of flooding, al-
though it thrives in non-flooded, moderately moist
soil, which is common for landscape plants. Flood-
ing has been suggested as a method for control of
D. abbreuiatus larvae in sugarcane (Shapiro et al.
1997). Flooding also may be a viable control option
for flood-tolerant ornamental plants including but-
tonwood, but flooding of the root zone may exacer-
bate the effects of root feeding by D. abbreuiatus
larvae. The objective of this study was to deter-
mine the survival of D. abbreviatus larvae in
flooded marl soils and in a flooded nursery potting
medium, with green buttonwood serving as a food
source.

MATERIALS AND METHODS

The experiment was conducted in the winter
and spring of 2007 in Homestead, FL, with D. ab-
breviatus infested green buttonwood trees in 4-L
containers filled with either marl soil or potting
medium in an outdoor, open site. Plants were ob-
tained from a commercial nursery in Dec 2006
and replanted 12 Jan 2007. At the time treat-
ments were initiated, buttonwood plants were ap-
proximately 6-12 months old.
Each plant was repotted into a 4-L plastic con-
tainer, with half the plants in a nursery potting


medium (40% Florida peat, 30% pine bark, 20%
cypress sawdust, and 10% sand) and the other
half in marl soil. The marl soil was obtained from
a fallow agricultural field (Homestead, FL).
Plants were fertilized (13 Feb 2007) 10 d before
beginning the experiment with liquid fertilizer
(Miracle-Gro 15-30-15, Stern's Miracle-Gro Prod-
ucts, Port Washington, NY) at the manufacturers
recommended rate. Insect pests other than D. ab-
breviatus were removed manually. A total of 24
plants were used in this study with 2 soil treat-
ments (potting medium and marl soil) and 2 flood
treatments (flooded and non-flooded) arranged in
a 2 x 2 factorial design with 6 single-plant repli-
cations per treatment. An additional 8 "monitor-
ing" plants (4 flooded plants in each soil type)
were used for periodic destructive harvest to as-
sess larval survival on 1 plant in each soil type at
each assessment time. The monitoring plants
were used to determine when to remove test
plants from flooding and when to harvest and
evaluate the test plants. Data from the monitor-
ing plants were not included in the statistical
analysis.

Larval Infestation

Six weeks after repotting (23 Feb 2007), each
container was infested with 15 D. abbreuiatus lar-
vae raised on an artificial diet and supplied by the
Florida Department of Agriculture and Consumer
Services, Division of Plant Industry, Gainesville,
FL. Head capsule widths of larvae used to infest
plants were 1.15 0.21 mm, indicating that they
were fourth through sixth instars (mean fifth in-
star) (Quintela et al. 1998). These sample larvae
were raised from eggs oviposited on the same day
and reared from the same artificial diet and other
laboratory conditions as infesting larvae, but they
were not used for infestation. Larvae were placed
individually into each of 15 holes in the soil, 3-5
cm deep, 4-8 cm from the stem, and 2.5 cm apart,
which were then recapped with soil. All contain-
ers remained non-flooded for 16 d to allow larvae
to become established.

Flooding

Sixteen days after infestation (11 Mar 2007), 6
plants in each soil type (marl soil or potting me-
dium) were flooded by placing each plant con-
tainer into a larger 19-L plastic container filled
with tap water with the water level maintained
10 cm above the soil surface (24 cm total depth).
The remaining 6 plants from each soil type were
used as the control plants (non-flooded). One
flooded monitoring plant in each soil type was
evaluated after 3, 6, 9, and 23 d to determine
when to evaluate the test plants based on the
number and size of live larvae found in the soil.
Test plants in each treatment were harvested


June 2010







Martin et al.: Survival of D. abbreviatus in Flooded Soils


when less than 30% of the 15 larvae originally
added per monitoring plant were found alive in
both soil types (after 38 d of flooding). Here, 30%
survival was arbitrarily chosen to represent a
likely significant reduction compared to 100%
survival when initially infested. Once the treat-
ment combinations had below 30% survival be-
cause of flooding, soil type, or other reasons, they
could be effectively compared to determine if the
mortality was due to differences in treatment
(flooding or soil type) or other factors. After this
"30% date" was reached, an additional 2 weeks
were allowed to further ensure any significant
differences between flooded and non-flooded
treatments. Non-flooded plants were irrigated by
overhead sprinkler 30 min once a day until 23
Mar, when irrigation times were changed to 30
min twice a day. Flooded plants were irrigated be-
fore flooding began or after it ended, but not dur-
ing the flood period.

Data Collection

Data collected included soil temperature, num-
bers of live and dead larvae recovered per plant,
and larval head capsule widths. Soil temperature
for non-flooded plants was recorded at 1 h inter-
vals throughout the experiment with sensors
(StowAway Tidbit@ temploggers, Onset Co.,
Pocasset, MA). Soil temperature of flooded plants
was not recorded because it was believed to not
differ significantly from that of non-flooded
plants. The sensors were placed in the soil of 3
non-flooded plants not included in the experiment
but held under the same experimental conditions.
Sensors were located at a soil depth of 6 cm two-
thirds the distance from the center to the outer
edge of the pot.
When flooded plants were unflooded and all
plants harvested, roots were removed from the
soil, which was placed into bins and carefully in-
spected for larvae. The number of live and dead
larvae were then determined for each plant con-
tainer and preserved in separate vials of 75% eth-
anol. Head capsule widths were measured in the
laboratory with a microscope micrometer with 50
micrometer units per mm and 80 x magnification.
All data for percentage of larvae found alive were
based on live/total ratios.

Statistical Analyses

A two-way analysis of variance (ANOVA) was
used to determine flooding and soil type interac-
tion in a factorial design for percentages of larvae
found alive. However, because no larvae were re-
covered from 1 treatment combination (flooded
potting medium), data for head capsule widths
were analyzed with a one-way ANOVA with 3
treatments followed by a Duncan-Waller K-ratio
test. For percentage of larvae surviving, propor-


tional data based on ratios of live/total were arc-
sine transformed before analyses by standard t-
tests. All statistical analyses were performed
with SAS Statistical Software Version 9.1 (SAS
Institute, Cary, North Carolina).

RESULTS AND DISCUSSION

For plants used for monitoring only, mean per-
centages of live larvae found in flooded marl soil
were 47, 87, 60, and 27 on flood days 4, 7, 10, and
24, respectively, and for flooded potting medium
they were 20, 7, 7, and 0, respectively, on the same
flood days. The sample on flood d 24 was the first
with larval survival less than 30% in both soil
types. As noted, to ensure significant differences
in survival between flooded and non-flooded
treatments, all flooded test plants were harvested
2 weeks after that date, or 38 d after flooding
treatments commenced. No pupae or adults were
found in either monitoring or test plants.
For test plants, there was no significant inter-
action between effects of flooding and soil type on
the numbers of live/total larvae (F = 3.98; df = 3,
23; P = 0.06). However, because this interaction
was nearly significant, data were not pooled for
determination of the percentages of larvae that
survived (Fig. 1). Flooding significantly reduced
the mean percentage of larvae surviving com-
pared with non-flooded conditions in marl soil (t =
-5.45, df = 9.3, P = 0.0004) (Fig. la) and in potting
medium (t = -6.36, df = 5, P = 0.0014) (Fig. Ib).
The mean percentage survival out of 15 original
larvae per container was significantly lower in
flooded potting medium than in flooded marl soil
(t = 4.58, df= 5, P = 0.006) (Fig. Ic). In non-flooded
soil, there were no significant effects of soil type
on percentages of live larvae recovered (Fig. Id).
There were significant differences in head cap-
sule width among 3 treatments for which data
were available (flooded marl soil, non-flooded
marl soil, and non-flooded potting medium) (F =
37.3; df = 2, 17; P <0.0001). Mean head capsule
widths were significantly smaller for larvae in
flooded marl soil than for larvae in non-flooded
marl soil or non-flooded potting medium (Fig. 2).
Larval head capsule widths from non-flooded
marl and non-flooded potting medium were sta-
tistically the same and averaged eighth instar,
whereas flooded marl larvae averaged sixth to
seventh instar.
Lapointe (2000) examined the effects of con-
stant, 22, 26, and 30'C temperatures on Di-
aprepes abbreuiatus larval survival and rates of
development on an artificial diet. The highest sur-
vival rates occurred at 22 and 26C with lowest
survival at 30'C, and the highest development
rate was at 26C with slower rates at 22 and 30'C
(Lapointe 2000). Mean daily soil temperatures
during the treatment period of the present study
ranged from 16 to 25C with monthly averages







Florida Entomologist 93(2)


k*k


60







30


I 20
120
510

0


60 -

S50


40


30 -


|20 -


110 '

0 -


Mul-FL PotMed-FL


PotMeld-NF PotMel.FL


10



Mari-IF PoltMed-IIF


Fig. 1. Effects of flooding and soil type on percentage of 15 larvae added to each container that were found live
at harvest based on ratios of live/total. (A) Non-flooded marl soil (Marl-NF) versus flooded marl soil (Marl-FL). (B)
Non-flooded potting medium (PotMed-NF) versus flooded potting medium (PotMed-FL). (C) Flooded marl soil
(Marl-FL) versus flooded potting medium (PotMed-FL). (D) Non-flooded marl soil (Marl-NF) versus non-flooded pot-
ting medium (PotMed-NF). Bars represent means SD. Asterisks indicate significant differences between treat-
ments at P : 0.05, ** P < 0.01, and *** P < 0.001 according to a standard t-test.


17.9 to 21.7C (Fig. 3). Thus, average monthly soil
temperatures for the present study were 4.3-
8.1C less than 26C (ideal developmental tem-
perature) and 0.3-4.1C less than 22C (ideal sur-
vival temperature). Although rates of larval sur-
vival may have been close to their maximum rates
in the present study, larval development rates
were probably slower than their maximum.
The present study focused on larval growth
and survival and did not examine flooding and
herbivory effects on biomass such as fresh and
dry root, stem, and leaf weights, stem diameter,
and plant height. However, larval herbivory tends
to significantly reduce biomass and gas exchange


of buttonwood in potting medium (Diaz 2005;
Diaz et al. 2006; Martin et al. 2009). In addition,
flooding buttonwoods in potting medium signifi-
cantly reduced photosynthesis, transpiration,
and stomatal conductance beginning 1 wk after
flooding (Diaz 2005). However, flooding button-
wood plants did not significantly affect fresh or
dry root, stem, or leaf weights (Diaz 2005). In an-
other study with buttonwood, flooding did not
cause significant differences in photosynthesis,
stomatal conductance, or dry weight of plants
grown in potting medium (Martin et al. unpub-
lished data). However when grown in marl soil,
flooding significantly reduced photosynthesis,


Mu-IIF Mrt-FL


June 2010







Martin et al.: Survival of D. abbreviatus in Flooded Soils


2.4

2.3
Z-V
2.2 -


I2-
2,1 -
S 2



"1.7 -


*1.8 -

1,5 -
1.4


a
(11= 3?l


(11 33)


(n= ?3
T


Mad-IIF Mad-FL PotMed-lIF
Treatment
Fig. 2. Mean head capsule widths and instars (SD)
of larvae found at harvest. Values for live and dead lar-
vae were pooled. N is the total number of larvae found in
each treatment. X-axis symbols are Marl-NF (non-
flooded marl soil), Marl-FL (flooded marl soil), and Pot-
Med-NF (non-flooded potting medium).



stomatal conductance, and leaf dry weight com-
pared with non-flooded plants. The native tidal-
swamp habitat of buttonwood is frequently
flooded and has marl soil, which is the environ-
ment where buttonwood evolved and should be
best adapted.
Live/total ratios may better represented larval
survival than live/found or found/total ratios be-
cause larvae not found were presumed dead and
decomposed (although some larvae were found
dead), and the objective was to determine sur-
vival of D. abbreviatus larvae. Hence, all data for
percentage of larvae found alive were based on
live/total ratios, and not live/found or found/total
ratios, although all 3 ratios seem to be plausible
definitions of survival. Comparing D. abbreviatus
larval survival in flooded marl soil with flooded
potting medium was difficult because of the high
proportion of larvae not recovered. However, this
was not surprising because larvae quickly decom-
pose when they die. Survival of D. abbreviatus
larvae in flooded marl soil was much higher than
its survival in flooded potting medium. In fields of
marl soil with mixed nursery stock including
flood-sensitive and flood tolerant plants, flooding
is probably not a good means to control this pest
because of possible harm to flood-sensitive plants
like Surinam cherry (Eugenia uniflora L., Myrta-
ceae). For plants grown in a potting medium sim-
ilar to ours, results of our study suggest root-zone


flooding of at least 3 d will help control D. abbre-
viatus larvae in flood-tolerant to moderately
flood-sensitive plant species. This regime is espe-
cially suggested for plants tolerant or moderately
tolerant to flooding, however, flooding container-
ized plants may not always be practical.
When not flooded, soil type such as marl soil or
potting medium did not affect larval survival or
growth of D. abbreviatus during this 54-d experi-
ment. However when flooded, soil type did signif-
icantly affect percent larval survival. In addition,
larvae recovered from flooded marl soil had sig-
nificantly smaller head capsule widths, which in-
dicates they averaged at least one instar smaller
than larvae from non-flooded marl or non-flooded
potting medium. Reduced oxygen concentration
in flooded soil may have reduced larval respira-
tion and decreased survival and size of larvae
from flooded compared with non-flooded soil of ei-
ther soil type. Larval survival and growth seem to
be more affected by flooding than by soil type, al-
though both treatment effects may cause signifi-
cant differences in larval survival.
Flooding is sometimes used in southern Flor-
ida sugarcane fields to control pests such as grubs
Tomarus subtropicus (Blatchley) (Coleoptera:
Scarabaeidae) (Cherry 1984) and wireworm lar-
vae Melanotus communis (Gyllenhal) (Co-
leoptera: Elateridae) (Hall & Cherry 1993). In
those studies, wireworm larvae (M. communis)
had 80% mortality after 6 wk of submergence at
27C, whereas scarab grubs (T subtropicus) had
100% mortality after ~1 wk (5-10 d) of submer-
gence. Mortality may have been caused by drown-
ing (suffocation) from a lack of oxygen and sur-
plus carbon dioxide, or by sepsis, from a buildup
of microbes in stagnant water and larval cadavers
(Shapiro et al. 1997). Shapiro et al. (1997) ex-
posed D. abbreviatus larvae to flooding to test the
effects of varying temperature (18, 21, 24, and
27C) and flood periods (0, 1, 2, 3, 4, or 5 weeks) on
larval mortality. They found that mean mortality
exceeded 90% by 3 weeks at 24 and 27C and by 5
weeks at 21'C, but was only 46% after 5 weeks at
18'C. In addition, soil pH increased significantly
with time and mortality (Shapiro et al. 1997). Li
et al. (2004, 2007) found that pH increased with
increasing flood period, which is related to re-
duced oxygen content of flooded soil and not nec-
essarily effects of D. abbreviatus larval infesta-
tion, such as respiration. Reduced oxygen in
flooded soil is caused by many factors including
replacement of soil oxygen with water and micro-
bial and chemical conversion of oxygen to other
substances. Flooding may be useful for control-
ling D. abbreviatus larvae in sugarcane fields, al-
though only in the summer and fall when flood-
water temperatures are close to maximum (27C)
(Hall & Cherry 1993; Shapiro et al. 1997).
Lapointe & Shapiro (1999) tried to determine
levels of soil moisture that optimized production







Florida Entomologist 93(2)


25





20 MFeb




15
1-Mar 15-Mar (2007 1-pr 15-Apr
Date (2007)
Fig. 3. Soil temperature during the experiment. Each point is the average of three temperature sensors each
buried 6 cm below the soil surface in potted plants not used in the experiment but held under the same environ-
mental conditions and with the same media as in the experiment. For Feb, the monthly average is for the whole
month; however, because plants were infested on Feb 23, daily averages are shown only for Feb 23-28. Similarly, the
Apr monthly average is for the entire month, but daily averages are for Apr 1-17 because plants were harvested and
unflooded Apr 17. All of Mar was in the experimental period, hence, the monthly average and all daily averages are
shown for the entire month.


of D. abbreviatus adults in the laboratory. Opti-
mal survival to pupation occurred at 30-70% soil
moisture, and about 60-65% of larvae survived to
pupation under these ideal moisture conditions.
The poorest survival of larvae occurred in low
(20%) and in high (80%) soil moisture levels
(Lapointe & Shapiro 1999). Thus, poorest larval
survival would be expected under flooded condi-
tions, which presumably have over 80% moisture
levels, whereas un-flooded plants may have soil
moisture levels more favorable to larval survival,
30-70%.
In the present study and the earlier study by
Shapiro et al. (1997), larvae of D. abbreviatus
were exposed directly to flooding. Several studies
examined the interaction of flooding and larval
feeding by D. abbreviatus (Li et al. 2003; Diaz
2005) or the interaction of flooding and soil type
or pH on larval survival or growth (Li et al. 2006,
2007). However in these latter experiments, lar-
vae in flooded treatments were added to previ-
ously flooded plants and were not exposed di-
rectly to flooding.
Overall, plant gas exchange and plant weights
observed by Diaz (2005) seemed to have been
more affected (decreased) by flooding than by lar-
val infestation in buttonwood or live oak. How-
ever with larval recovery, there were no signifi-
cant differences between previously flooded and
non-flooded buttonwoods or live oaks (Diaz 2005).
This lack of difference may reflect similar soil
moisture contents between previously flooded
and non-flooded plants during larval infestation.
For Li et al. (2003), survival of Diaprepes larvae
was significantly higher in previously flooded soil


than in non-flooded soil, and flood-damaged seed-
lings were more susceptible to larval feeding in-
jury than non-flooded seedlings. Similarly, Li et
al. (2006) found that plants flooded for at least 20
d were more stressed and more prone to feeding
injury from Diaprepes larvae after removal of
plants from flooding than non-flooded control
plants. Li et al. (2006) also found that larval sur-
vival averaged 25% higher in sandy soil than in
loam soil in plants previously flooded for 20 d.
Their results suggest that avoidance of flooding
and early control of Diaprepes larvae may help
protect young plants.
Soil type affects larval growth and survival
rates, and the effects of soil type on larval sur-
vival may be chiefly based on physical character-
istics of the soil, which affect soil moisture and ox-
ygen levels (Rogers et al. 2000). Soil pH also in-
creases with flood duration and could adversely
affect larval survival (Shapiro et al. 1997; Li et al.
2006). Waterlogged soils are also typically denser
than non-flooded soils (Saqib et al. 2004), which is
a potential problem for survival of larvae in
flooded soil (Li et al. 2006). Li et al. (2007) found
that when not limed, flooding increased the aver-
age soil pH up to 0.3 units for citrus seedlings
flooded for 40 d, which also had the lowest larval
weights and survival rates compared with seed-
lings flooded for shorter flood durations; this may
reflect the higher soil pH at longer flood dura-
tions. Larval survival and growth were signifi-
cantly decreased by pre-applied flooding (Li et al.
2007). When the soil was limed to pH 4.8-5.7, lar-
val survival was highest at pH 5.0 for non-flooded
plants. Larval survival and weight gain were sig-


June 2010







Martin et al.: Survival of D. abbreviatus in Flooded Soils


nificantly correlated with pH; increasing pH from
4.8 to 5.7 decreased larval survival and increas-
ing pH from 5.1 to 5.7 significantly decreased lar-
val weights (Li et al. 2007).
Other factors such as soil compaction, bulk
density, and water content may also influence lar-
val survival and growth (Riis & Esbjerg 1998;
Rogers et al. 2000; Li et al. 2007). Increasing the
soil pH by at least 1 unit in acidic soils was recom-
mended for optimum citrus growth, which occurs
at pH 6.0-6.5, and to help control D. abbreviatus
(Li et al. 2007). Flooding was also recommended
as a possible control method in citrus (Li et al.
2007). Flooding may hence reduce larval survival
while plants are flooded. However, depending on
soil pH, water-stressed plants may be more sus-
ceptible to D. abbreviatus larval feeding when un-
flooded than non-stressed plants that were either
never flooded or flood-tolerant and previously
flooded.
As noted, marl soil native to south Florida has
pH of 7.4-8.4 (Li 2001), whereas the potting me-
dium in the present study had a pH of 6.0. As sug-
gested above by Li et al. (2007), increasing the soil
pH from 4.8 to 5.7 decreases larval survival and/
or weight. Thus, a pH of 6.0 would appear less fa-
vorable than 5.0 for D. abbreviatus survival. Soil
pH in the range of marl soil was not investigated
in the foregoing studies. Hence, marl soil may of-
fer a pH range more favorable to larval survival
and growth than our potting medium, which is
suggested by our higher larval survival rates in
flooded marl soil than in flooded potting medium.
However, this difference in survival was not
present between non-flooded marl soil and non-
flooded potting medium. There is a need to inves-
tigate possible survival advantages to D. abbre-
viatus larvae in the pH range of marl soil (7.4-8.4)
compared with their survival in lower pH (4.8-
6.0) of potting medium in the present study and of
Florida sandy loam soil used by Li et al. (2007).

ACKNOWLEDGMENT

We thank Julio Almanza, Luis Bradshaw, and Holly
Glenn for assistance with this study. We also thank Su-
zanne Fraiser and the Florida Department of Agricul-
ture and Consumer Services, Division of Plant Industry,
Gainesville, for providing larvae and Fred Davies and
Eileen Buss for review of drafts.


REFERENCES CITED

CHERRY, R. H. 1984. Flooding to control the grub Ligy-
rus subtropicus (Coleoptera: Scarabaeidae) in Flori-
da sugarcane. J. Econ. Entomol. 77: 254-257.
DIAZ, A. P. 2005. Effect of Diaprepes Root Weevil on Leaf
Gas Exchange and Growth of Select Ornamental
Tree Species. M.S. Thesis, University of Florida,
Gainesville.
DIAZ, A. P., MANNION, C. M., AND SCHAFFER, B. 2006.
Effect of root feeding by Diaprepes abbreviatus (Co-


leoptera: Curculionidae) larvae on leaf gas exchange
and growth of three ornamental tree species. J. Econ.
Entomol. 99: 811-821.
GODFREY, K., BENDER, G., ELLIS, T., BETHKE, J., AND
MORSE, J. 2006. Diaprepes phenology and insecticid-
al control in San Diego County. California Dept. of
Food and Agriculture (CDFA), citrus research board,
and the University of California, San Diego and Riv-
erside Counties.
HALL, D. G., AND CHERRY, R. H. 1993. Effect of temper-
ature in flooding to control the wireworm Melanotus
communis (Coleoptera: Elateridae). Florida Ento-
mol. 76: 155-160.
KLUNK, S. 2005. Invasive Root Weevil Spreads to South-
ern California. University of California ANR, News
and Outreach. URL (Sept 2008): (http://
news.ucanr.org/newsstorymain.cfm?story=716).
KNAPP, J. L., NIGG, H. N., SIMPSON, S. E., DUNCAN, L.
W., GRAHAM, J. H., PENA, J. E., MCCOY, C. W., AND
MANNION, C. M. 2001. Diaprepes Root Weevil: A Pest
of Citrus, Ornamental, and Root Crops in Florida.
ENY-645. Florida Coop. Ext. Serv., Inst. Food Agric.
Sci., University of Florida, Gainesville.
KNAPP, J. L., SIMPSON, S. E., PENA, J. E., AND NIGG, H.
N. 2000. Diaprepes Root Weevil Host List. ENY-641,
Florida Coop. Ext. Serv, Inst. Food Agric. Sci., Uni-
versity of Florida, Gainesville.
KOZLOWSKI, T. T. 1997. Response of woody plants to
flooding and salinity. Tree Physiol. Monograph 1: 1-
29.
LAPOINTE, S. L. 2000. Thermal requirements for devel-
opment of Diaprepes abbreviatus (Coleoptera: Cur-
culionidae). Environ. Entomol. 29: 150-156.
LAPOINTE, S. L., AND SHAPIRO, J. P. 1999. Effect of soil
moisture on development of Diaprepes abbreviatus
(Coleoptera: Curculionidae). Florida Entomol. 82:
291-299.
LI, H., McCoY, C. W., AND SYVERTSEN, J. P. 2007. Con-
trolling factors of environmental flooding, soil pH,
and Diaprepes abbreviatus (L.) root weevil feeding in
citrus: larval survival and larval growth. Appl. Soil
Ecol. 35: 553-565.
LI, H., SYVERTSEN, J. P., McCOY, C. W., SCHUMANN, A.
W., AND DUNLOP, J. 2003. Soil redox potential and
leaf stomatal conductance of two citrus rootstocks
subjected to flooding and root weevil feeding. Proc.
Florida State Hort. Soc. 116: 252-256.
LI, H., SYVERTSEN, J. P., McCOY, C. W., STUART, R. J.,
AND SCHUMANN, A. W. 2004. Soil liming and flooding
effects on Diaprepes root weevil larval survival and
citrus seedling growth. Proc. Florida State Hort. Soc.
117: 139-143.
LI, H., SYVERTSEN, J. P., McCOY, C. W., STUART, R. J.,
AND SCHUMANN, A. W. 2006. Water stress and root
injury from simulated flooding and Diaprepes abbre-
viatus root weevil larval feeding in citrus. Soil Sci.
171: 138-151.
LI, Y. 2001. Calcareous Soils in Miami-Dade County.
Inst. Food Agric. Sci., Florida Coop. Ext. Serv. Fact
sheet #SL 183, University of Florida, Gainesville.
MANNION, C. M., HUNSBERGER, A., PENA, J. E., AND OS-
BORNE, L. S. 2003. Oviposition and larval survival
of Diaprepes abbreviatus (Coleoptera: Curculion-
idae) on select host plants. Florida Entomol. 86:
165-173.
MARTIN, C. G., MANNION, C. M., AND SCHAFFER, B.
2009. Effects of herbivory by Diaprepes abbreviatus
(Coleoptera: Curculionidae) larvae on four woody or-







Florida Entomologist 93(2)


namental plant species. J. Econ. Entomol. 102: 1141-
1150.
NOBEL, C. V., DREW, R. W., AND SLABAUGH, J. D. 1996.
Soil Survey of Dade County Area Florida. USDA,
Nat. Res. Cons. Serv., Washington, D.C.
QUINTELA, E. D., FAN, J., AND MCCOY, C. W. 1998. De-
velopment of Diaprepes abbreviatus (Coleoptera:
Curculionidae) on artificial and citrus root sub-
strates. J. Econ. Entomol. 91: 1173-1179.
RIIS, L., AND ESBJERG, P. 1998. Seasonal and soil mois-
ture effect on movement, survival, and distribution
of Cyrtomenus bergi (Hemiptera: Cydnidae) within
the soil profile. Environ. Entomol. 27: 1182-1189.
ROGERS, S., MCCOY, C. W., AND GRAHAM, J. H. 2000.
Larval growth of Diaprepes abbreviatus (Coleoptera:
Curculionidae) and resulting root injury to three cit-
rus varieties in two soil types. J. Econ. Entomol. 93:
380-387.
SAQIB, M., AKHTAR, J., AND QURESHI, R. H. 2004. Pot
study on wheat growth in saline and waterlogged,
compacted soil, II. Root growth and leaf ionic rela-
tions. Soil Tillage Res. 77: 179-187.
SCHAFFER, B. A. 1998. Flooding responses and water-
use efficiency of subtropical and tropical fruit trees
in an environmentally sensitive wetland. Ann. Bot.
81:475-481.
SCHAFFER, B., ANDERSEN, P. C., AND PLOETZ, R. C.
1992. Responses of fruit crops to flooding. Hort. Re-
views 13: 257-313.
SHAPIRO, J. P., HALL, D. G., AND NIEDZ, R. P. 1997. Mor-
tality of the larval root weevil Diaprepes abbreviatus


(Coleoptera: Curculionidae) in simulated flooding.
Florida Entomol. 80: 277-285.
SIMPSON, S. E., NIGG, H. N., COILE, N. C., AND ADAIR, R.
A. 1996. Diaprepes abbreviatus (Coleoptera: Curcu-
lionidae): host plant associations. Environ. Entomol.
25: 333-349.
SIMPSON, S. E., NIGG, H. N., AND KNAPP, J. L. 2000.
Host Plants of Diaprepes Root Weevil and Their Im-
plications to the Regulatory Process. Citrus Re-
search and Education Center, University of Florida,
Lake Alfred. 18 pp. URL (4 Oct 2005): (http://
www.fcprac.ifas.ufl.edu/citrustopics).
SKARIA, M., AND FRENCH, J. V. 2001. Phytophthora dis-
ease of citrus associated with root weevils in Texas.
Phytopathology 91(6): Supplement S203.
STANLEY, D. 1996. Suppressing a serious citrus pest. Ag-
ric. Res. 44: 22.
WATKINS, J. V., AND SHEEHAN, T. J. 1975. Florida Land-
scape Plants. University Press of Florida, Gaines-
ville. 420 pp.
WEISSLING, T. J., PENA, J. E., GIBLIN-DAVIS, R. M., AND
KNAPP, J. L. JR. 2004. Common Name: Diaprepes Root
Weevil. Featured Creatures, Univ. Florida #EENY-24.
URL(24 Dec 2005): (http://creatures.ifas.ufl.edu/cit-
rus/Sugarcane_rootstock_borer_weevil.htm).
WOODRUFF, R. E. 1964. A Puerto Rican Weevil New to
the United States (Coleoptera: Curculionidae). Flori-
da Dept. Agric., Div. Plant Ind. Entomol. Circ. 30: 1-2.
WUNDERLIN, R. P. 1998. Guide to the Vascular Plants of
Florida. University Press of Florida, Gainesville. 806
pp.


June 2010








Center & Dray: Neochetina spp. Flight Response to Host Quality


EFFECTS OF HOST QUALITY ON FLIGHT MUSCLE DEVELOPMENT
IN NEOCHETINA EICHHORNIAE AND N. BRUCHI
(COLEOPTERA: CURCULIONIDAE)

TED D. CENTER AND F. ALLEN DRAY, JR.
USDA/ARS, Invasive Plant Research Laboratory, 3225 College Ave., Ft. Lauderdale, FL 33314

ABSTRACT
Neochetina eichhorniae Warner and N. bruchi Hustache, biological control agents of Eichhor-
nia crassipes (Martius) Solms-Laubach, are usually incapable of flight but occasionally de-
velop indirect flight muscles enabling dispersal. This reportedly alternates with o6genesis
and is reversible. We examined host quality as a possible explanation for the transitions be-
tween these 2 states by allowing populations of the 2 species to develop on plants differing
in nutritive quality and then examining the status of their ovaries and flight muscle devel-
opment. The leaf nitrogen content of the plants increased directly with fertilizer treatment
levels but herbivory by the weevils changed the pattern of variation. Neochetina eichhorniae
suppressed overall nutritive quality while still enabling tissue nitrogen levels to increase
with fertilizer treatments. Neochetina bruchi, however, negated these effects and tissue ni-
trogen levels failed to correlate with fertilizer treatments. As a result, herbivore intensity
(the number of weevils per plant) and the proportion of the populations that responded in
one way or the other (either o6genesis or flight muscle development) differed between the 2
species. Very few N. eichhorniae responded in the lowest fertilizer treatment and none pro-
duced flight muscles. This increased in the intermediate treatments to about an 80% re-
sponse with most individuals reproductive. At higher levels, the overall response declined
somewhat with an increasing proportion becoming dispersive. Very few N. bruchi developed
flight muscles except in the highest fertilizer treatment. The frequency of reproductive N.
bruchi varied little across fertilizer treatments, tracking host quality instead. We conclude
that transitions from reproduction to dispersal in these 2 species are not in response to low
nutritive quality of the plant tissue and require adequate nutrition to occur. Host quality,
however, is affected by a multitude of factors, including the intensity of herbivory, which
complicates interpretation of nuanced responses.

Key Words: biological control, invasive plants, herbivory, dispersal, fecundity, reproductive
biology

RESUME
El agent de control biol6gico de Eichhornia crassipes (Martius) Solms-Laubach, Neochetina ei-
chhorniae Warner y N. bruchi Hustache, usualmente no son capaces de volar pero ocasional-
mente desarrollan musculos indirectos de vuelo para permitir su dispersion. Ha sido reportado
que este se alterna a o6genesis y es reversible. Examinamos la calidad del hospedero como una
explicaci6n possible de las transiciones entire estos 2 estados al permitir que poblaciones de las 2
species se desarrollen sobre plants que varian en su calidad nutritiva para luego examiner el
status de sus ovarios y el desarrollo de los musculos de vuelo. El contenido de nitr6geno en las
hojas de las plants aument6 directamente con los niveles de tratamiento de fertilizante pero la
alimentaci6n de los picudos (gorgojos) cambi6 el patron de la variaci6n. Neochetina eichhorniae
suprimio la calidad nutritiva total mientras que permitia que los niveles de nitr6geno en los te-
jidos aumentaran con el tratamiento de fertilizante. Sin embargo, Neochetina bruchi, anulo estos
afectos y los niveles de nitr6geno de los tejidos no correlacionaron con los tratamientos de ferti-
lizante. Por conseguiente, la intensidad herbivora (el numero de picudos por plant) y la propor-
ci6n de la poblaci6n que respondi6 en una manera u otra (por o6genesis o desarollo de musculos
de vuelo) varian entire las dos species. Muy pocos de los N. eichhorniae respondieron en el tra-
tamiento de menor nivel de fertilizante y ninguno de ellos producieron musculos de vuelo. Este
aument6 en los tratamientos intermediaries hasta una respuesta cerca de 80% con la mayoria
de los individuos reproductivos. En los niveles mas altos, la respuesta total se redujo con una pro-
porci6n mayor de ellos dispersandose. Muy pocos de los N. bruchi desarrollaron musculos de
vuelo, menos en el tratamiento de alto nivel de fertilizante. La frecuencia de individuos repro-
ductivos deN. bruchi varia poco en los tratamientos de fertilizantes, apuntando en su lugar a la
calidad de hosperdero. Concluimos que la transici6n de reproducci6n a dispersion en estas 2 es-
pecies no son en respuesta de la calidad baja nutritiva de los tejidos de la plant y requieren nu-
trici6n adecuada para suceder. Sin embargo, la calidad de hospedero, es afectada por una
multitud de factors, incluyendo la intensidad de herbivoros, que complica la interpretaci6n de
las erraticas respuestas.







Florida Entomologist 93(2)


The South American weevils Neochetina eich-
horniae Warner and N. bruchi Hustache (Co-
leoptera: Curculionidae) were released in Florida
during 1972 and 1974, respectively, to aid in the
control waterhyacinth (Eichhornia crassipes
(Martius) Solms-Laubach: Pontederiaceae), a
floating aquatic weed (Center 1994). Populations
established readily and dispersed widely with N.
eichhorniae most often the predominate species
(Center & Dray 1992; Center et al. 1999). Their
early presence at sites distant from release areas
was puzzling in that the adult weevils were gen-
erally believed incapable of flight. The subse-
quent discovery of large numbers of N. eichhor-
niae at street lights (Center 1982; Stark & Goyer
1983) refuted this notion and explained the
nearly ubiquitous occurrence of this species
throughout the Southeast. Stark & Goyer (1983),
however, were not able to induce the weevils to fly,
so flight behavior remained inexplicable. Buck-
ingham & Passoa (1985) then discovered that
these species underwent a periodic degeneration
and regeneration of indirect flight muscles, which
seemed to alternate with odgenesis, similar to the
rice water weevil (Lissorhoptrus oryzophilus Kus-
chel) (Palrang & Gregarick 1993). They related
flight muscle regeneration to temperature, with a
threshold for development at about 21C.
We have observed an apparent connection be-
tween flight muscle development in Neochetina
spp. populations and the intensity of herbivory on
the plants on which they resided (Center & Dray
1992). We also have noticed that weevils from
high quality plants (as exemplified by the nitro-
gen content of the leaf tissue) exhibited a higher
frequency of flight muscle development than
those from poor quality plants (unpublished
data). We therefore hypothesized that the nutri-
tive quality of the plant tissue influenced indirect
flight muscle development and factored into this
odgenesis-flight syndrome. To test this, we grew
plants in 5 different fertilizer regimens to vary
plant quality and released both species into these
cultures during spring 2008. The progeny of these
weevils were recovered at the end of the summer
and dissected to assess indirect flight muscle de-
velopment and reproductive status. The nitrogen
content of the leaf tissue was assessed near the
beginning and towards the end of the study to
quantify the nutritional quality of the plants.

MATERIALS AND METHODS

Stock cultures of waterhyacinth (Eichhornia
crassipes (Martius) Solms-Laubach: Pontederi-
aceae) were cultivated outdoors in 20 concrete
mesocosm tanks (0.8 m wide x 2.2 m long x 0.65 m
deep, water depth 0.5 m, vol. 0.88 m3). Individual
rosettes from these cultures were then equally
distributed among 60 identical tanks during 3-4
Mar 2008 until each contained 21 plants. All


tanks were fertilized with 22 g of Peter's 20:20:20
N:P:K fertilizer and 18 g of Miller 10% Fe Che-
late. The plants were allowed to grow to full cov-
erage. The water was then drained and replaced
with clean, unfertilized well water. The numbers
of rosettes in each tank were counted and then re-
duced to 120 plants of approximately equal size
during 8-10 Apr 2008.
The plants were retained in unfertilized water
for about 3 weeks to induce deficiency symptoms.
Slow-release fertilizer (Scott's Osmocote Plus 15-
9-12 N:P:K, Southern 8-9 month formulation) was
then added at 5 different treatment rates: 30,
150, 270, 390, and 510 g/tank. We knew from pre-
vious studies that this procedure produced vary-
ing concentrations of nitrogen in the plant tissue
and that these levels affected fecundity of the
weevils (Center & Dray, in press). Each rate was
applied to 4 tanks for each herbivory by fertilizer
treatment during 23-24 Apr 2008 which provided
4 replicates for each treatment combination. The
fertilizer was dispensed in screen packets con-
taining ballast and floatation and tethered to an
anchor so that they floated upright within the
root zone of the plants. Iron chelate (Miller Iron
Chelate DP 10% Fe) was added at rates of 1.06,
5.29, 9.53, 13.76, and 18.00 g/tank in the low to
high fertilizer treatments, respectively. The fertil-
izer packets were replaced after 3 months (22-24
Jul 2008) when iron chelate was again added. Air
temperature and relative humidity were moni-
tored at 30-min intervals in 5 tanks with iBut-
ton Data Loggers Model DS1923-F5 suspended
at the level of the plant canopy in an inverted cup.
Water temperature was monitored with a sepa-
rate Data Logger in a sealed capsule suspended
within the root zone of the plants.
The leaf blade was excised from the youngest
mature leaf of each of 3 plants in each tank on 2
Jun, by which time a complete leaf turnover
would have occurred, and again on 4 Aug 2008.
They were weighed fresh, dried at 53.4 0.1C
and 5.8 0.1% RH to constant weight, and
weighed again. The dried leaves were composite
into a single sample per tank and ground in a Wil-
ley mill to pass a 40-mesh screen. Samples of the
ground tissue were analyzed with a C-H-N ana-
lyzer (Perkin-Elmer Series II CHNS/O Analyzer
Model 2400) and compared against tomato leaf
standards to determine % N.
Both species of weevils (Neochetina eichhorniae
and N. bruchi) were obtained at a local field site in
western Broward County, FL (26.55115N,
80.70675W). They were sorted by species and gen-
der and placed on the plants during 21 Apr to 13
May 2008, until an infestation level of 24 pairs/tank
was achieved. All tanks were infested with an equal
number of weevils on each release date. Each spe-
cies was released into 20 tanks. An additional set of
20 tanks was used as a no-weevil control to deter-
mine if herbivory affected plant quality.


June 2010







Center & Dray: Neochetina spp. Flight Response to Host Quality


= 0.6746, 1 df), so these were dropped from fur-
ther analysis. Overall, N. bruchi and N. eichhor-
niae differed in the proportions of adults with
flight muscles (9% vs 19%, respectively, Wald X2 =
6.29, P = 0.0121, 1 df), and this difference varied
according to fertilizer level (species x fertilizer
Wald X2 = 15.96, P = 0.0031, 4 df).
About 40% of females of both species were re-
productive, but fertilizer treatment affected the 2
species differently (species x fertilizer Wald X2 =
27.24, P < 0.0001, 4 df). Very few female N. eich-
horniae were reproductive in the lowest fertilizer
treatment, whereas a maximal number were re-
productive in the second lowest and middle treat-
ments (Fig. 1). The frequency of reproductive N.
eichhorniae progressively declined at higher fer-
tilizer levels. In contrast, reproductive female N.
bruchi were relatively evenly distributed across
fertilizer levels (Fig. 2).

DISCUSSION

Flight muscles are energetically and materi-
ally expensive to produce and their production
constrains fecundity (Marden 2000). Hence, the
development of full flight musculature probably
requires adequate nutrition and would therefore
be expected to occur more frequently in weevil
populations fed high quality plant tissue. Alter-
natively, dispersal allows species to meet nutrient
demands by moving to higher quality resources
(Huberty & Denno 2006), so a greater frequency
of flight muscle development might instead occur
in response to nutritionally inadequate plant tis-
sue. Our data supports the first hypothesis, that
flight ability in Neochetina spp. is linked to high
host plant quality as reflected in the nitrogen con-
tent of the tissue. However, plant quality is influ-
enced by a multitude of factors including nutrient
supply, inter- and intraspecific plant competition,
the growth stage of the plant, and herbivore in-
tensity. These factors interact to greater or lesser
degrees causing nuanced patterns in field popula-
tions. For example, increased plant quality leads
to increased fecundity and ultimately greater
herbivore intensity which feeds back to reduce
plant quality. Flight muscle development in this
circumstance may be seen as a response to in-
creased herbivore density when, in fact, it may be
due to deterioration of the host resource. It may
not be possible to segregate these subtle effects,
but it is clear that flight muscles in both Neochet-
ina species are not developed in response to low
host plant quality as evidenced by the lack of
flight muscle incidence in our lowest fertilizer
treatments.
In previous studies, we found N. bruchi to be
more sensitive to host quality than N. eichhorniae
(Center & Dray 2010) so we were surprised by the
lack of response to fertilizer treatments on the
part ofN. bruchi. However, the fact that herbivory


by this species suppressed the effects of fertilizer
suggests that they responded to the resultant nu-
tritive quality rather than the actual experimen-
tal treatment. The developmental period of N.
bruchi is shorter than that ofN. eichhorniae (De-
Loach & Cordo, 1976) so it is possible that the
population development was more advanced with
their response to fertilizer treatments having oc-
curred earlier. This comports well with Bucking-
ham & Passoa (1985) who reported that flight
muscles appeared earlier in N. bruchi (6 d post-
emergence for males, 7 for females) than in N.
eichhorniae (11 d post-emergence for males, 12 for
females). Similarly, female N. bruchi were fecund
within 5 d of emergence whereas female N. eich-
horniae did not produce eggs until d 7.
We cannot rule out the possibility that in-
creased herbivore intensity affected flight muscle
development in the case ofN. eichhorniae. In this
instance, herbivore intensity increased with in-
creasing fertilizer treatments along with tissue
nitrogen and the proportion of dispersive individ-
uals among those that responded. In the case of
N. bruchi herbivore intensity varied little among
fertilizer treatments as did the frequency of re-
productive individuals, which mirrored tissue ni-
trogen levels at the end of the study. Flight mus-
cle frequency was low in all but the highest fertil-
izer treatment, which also tracked tissue nitrogen
levels. However, the exceptional result in the
highest fertilizer treatment, in terms of the com-
bined response and the increased proportion of
dispersive individuals, was not readily explain-
able in terms of host plant quality. Perhaps this
relates to the earlier history in that treatment
wherein tissue N levels were initially quite high
but decreased late in the study. Thus, it may be
change in tissue N that triggers the dispersive re-
sponse rather than the actual nutrient status at
any given point in time. This merits further inves-
tigation.

ACKNOWLEDGMENTS

We thank Beth Mattison, Paul Madeira, Hilda Agu-
ilar, Willey Durden, Phil Tipping, Eileen Pokorny, and
Danyelle Fitzgerald for technical assistance during this
study.

REFERENCES CITED

BUCKINGHAM, G., AND PASSOA, S. 1985. Flight muscle
and egg development in waterhyacinth weevils, pp.
497-510 In E. S. Delfosse [ed.], Proc. VI Intl. Symp.
on Biol. Control ofWeeds. Agriculture Canada, Otta-
wa, Canada.
CENTER, T. D. 1982. The waterhyacinth weevils Neochet-
ina eichhorniae and N. bruchi. Aquatics 4(2): 8, 16,
18-19.
CENTER, T. D. 1994. Biological control of weeds: water-
hyacinth and waterlettuce, pp. 481-521 In D. Rosen,
F. D., Bennett, and J. L. Capinera [eds.], Pest Man-








Florida Entomologist 93(2)


agement in the Subtropics. Biological Control-A
Florida Perspective. Intercept Ltd., U.K.
CENTER, T. D., AND DRAY, JR, F. A. 1992. Associations
between waterhyacinth weevils (Neochetina eichhor-
niae and N. bruchi) and phenological stages of Eich-
hornia crassipes in southern Florida. Florida Ento-
mol. 75: 196-211.
CENTER, T. D., AND DRAY, JR., F.A. 2010. Bottom-up con-
trol of water hyacinth weevil populations: Do the
plants regulate the insects. J. Appl. Ecol. 47: 329-337.
CENTER, T. D., DRAY, JR., F. A., JUBINSKY, G. P., AND
GRODOWITZ, M. J. 1999. Biological control of water
hyacinth under conditions of maintenance manage-
ment: Can herbicides and insects be integrated? En-
viron. Manage. 23: 241-256.
DELOACH, C. J., AND CORDO, H. A. 1976. Life cycle and
biology of Neochetina bruchi, a weevil attacking wa-
terhyacinth in Argentina, with notes on N. eichhor-
niae. Ann. Entomol. Soc. America 69: 643-652.
GOTELLI, N. J., AND ELLISON, A. M. 2004. A Primer of
Ecological Statistics. Sinauer Assoc. Inc, Sunder-
land, MA.
GRODOWITZ, M. J., CENTER, T. D., AND FREEDMAN, J. E.
1997. A physiological age-grading system for


Neochetina eichhorniae (Warner) (Coleoptera: Cur-
culionidae), a biological control agent of water hya-
cinth, Eichhornia crassipes (Mart.) Solms. Biol. Con-
trol 9: 89-105.
HUBERTY, A., AND DENNO, R. 2006. Trade-off in invest-
ment between dispersal and ingestion capability in
phytophagous insects and its ecological implications.
Oecologia 148: 226-234.
MARDEN, J. H. 2000. Variability in the size, composition,
and function of insect flight muscles. Annu. Rev.
Physiol. 62: 157-178.
PALRANG, A. T., AND GREGARICK, A. A. 1993. Flight re-
sponse of the rice water weevil (Coleoptera: Curcu-
lionidae) to simulated habitat conditions. J. Econ.
Entomol. 86: 1376-1380.
SAS INSTITUTE INC. 2004. SAS/STAT 9.1 User's Guide.
Cary, NC: SAS Institute Inc.
SOKAL, R. R., AND ROHLF, F. J. 1995. Biometry, 3rd Ed. W.
H. Freeman and Co., New York.
STARK, J. D., AND GOYER, R. A. 1983. Life cycle and be-
havior of Neochetina eichhorniae Warner (Co-
leoptera: Curculionidae) in Louisiana: a biological
control agent of waterhyacinth. Environ. Entomol.
12: 147-150.


June 2010







Hernandez et al.: Artificial Larval Diet for A. striata


AN ARTIFICIAL LARVAL DIET FOR REARING OF ANASTREPHA STRIATA
(DIPTERA: TEPHRITIDAE)

EMILIO HERNANDEZ', J. PEDRO RIVERA', DINA OROZCO-DAVILA1, MIGUEL SALVADOR2 AND JORGE TOLEDO3
'Programa Moscafrut-Desarrollo de M6todos (SAGARPA-IICA), Central Poniente No. 14-Altos, Tapachula,
Chiapas, 30700, Mexico

2Centro de Biociencias, Universidad Autonoma de Chiapas, Tapachula, Chiapas, 30700, Mexico

'Departamento de Entomologia Tropical, El Colegio de la Frontera Sur, Apartado Postal 36, Tapachula,
Chiapas, 30700, Mexico

ABSTRACT

An artificial larval diet for Anastrepha striata (Schiner) was developed and the changes in
the rearing and quality parameters through 6 generations during the adaptation were char-
acterized. In the first experiment we tested diet formulations that had already been devel-
oped for the mass-rearing ofAnastrepha ludens (Loew),A. obliqua (Macquart),A. serpentina
(Wiedemann) and Ceratitis capitata (Wiedemann) by sowing A. striata eggs (20-40%
hatched) in each diet. In those tested diets, the maximum larval recovery percentage was
4.82%. In the second experiment, in the AOII modified diet ofA. obliqua, we substituted the
protein source, torula yeast by NutriflyTM, torula yeast-casein and hydrolyzed protein. A for-
mulated diet contained 4.83% NutriflyTM, 15% corn cob fractions, 8.0% corn flour, 8.33%
sugar, 0.23% sodium benzoate, 0.11% nipagin, 0.13% citric acid, and 63.37% water allowed
higher larval survival compared to diets with different protein sources. In the third experi-
ment, we evaluated adaptation of the larvae to Nutrifly diet. Over 6 generations, the larval
and pupal weights and pupation percentage decreased from parental to first generation and
increased after the third generation, recovering the initial value. Larval recovery and adult
emergence increased from parental generation to the next generations; and was maintained
during the next 5 generations. Larval recovery only a light decreased in the third genera-
tion. The laboratory colonization ofA. striata reared on this artificial diet required at least
5 generations for the larvae to adapt to the artificial diet and increase pupal weight and
adult emergence.

Key Words: American guava fruit fly, colonization, sterile insect technique, mass rearing

RESUME

Se desarrollo una dieta para Anastrepha striata (Schiner), caracterizando los cambios ocu-
rridos en los parametros de cria y calidad durante seis generaciones. En el primer experi-
mento se utilizaron huevos que registraron entire 20 y 40% de eclosi6n al moment de
sembrarse sobre las dietas utilizadas en las crias de Anastrepha ludens (Loew), A. obliqua
(Macquart), A. serpentina (Wiedemann) y Ceratitis capitata (Wiedemann). En estas dietas,
la mayor recuperaci6n larvaria fue de 4.8%. En el segundo experiment, en la dieta AOII mo-
dificada de A. obliqua fue sustituida la fuente de protein, y la levadura torula por Nutri-
flyTM, torula-caseina y protein hidrolizada. En la dieta formulada con 4.83% de NutriflyTM,
15% de polvo de olote, 8.0% de harina de maiz, 8.33% de azucar, 0.23% de benzoato de sodio,
0.11% de nipagin, 0.13% de acido citrico y 63.37% de agua, se obtuvo la mayor recuperaci6n
de larvas en comparaci6n con las otras dietas formuladas con diferentes fuentes de protein.
En el tercer experiment, se caracteriz6 la adaptaci6n de las larvas a la dieta NutriflyTM. Du-
rante seis generaciones, el peso de larva y de pupa disminuy6 de la generaci6n parental a la
primera generaci6n, y ambos parametros se incrementaron a partir de la tercera generaci6n,
hasta registrar un peso similar al observado en la generaci6n progenitora. La recuperaci6n
larvaria y la emergencia de adults se increments de la generaci6n parental a las siguientes
generaciones y mantuvo dicha tendencia durante las cinco generaciones, y solamente la re-
cuperaci6n larvaria registry una ligera disminuci6n durante la tercera generaci6n. Se discu-
ten los resultados que la adaptaci6n de Anastrepha striata a una dieta larvaria artificial
require de al menos cinco generaciones.

Translation provided by the authors.


The American guava fruit fly, Anastrepha stri- portant fruit fly species in Mexico (Aluja 1994). It
ata (Schiner), is the third most economically im- is distributed from southern United States







Florida Entomologist 93(2)


(Texas) to Brazil (Weems, Jr. 1982; Hernandez-
Ortiz & Aluja 1993; Jiron & Hedstrdm 1988). In
Mexico, it has been recorded in the tropical re-
gions of both coastal plains in the Balsas depres-
sion. Also, it is present in the highland locations
of the states of Aguascalientes and southern
Zacatecas over an area of about ~20,000 hectares
(Hernandez-Ortiz 1992), where guava orchards
suffer serious infestation by fruit flies. In these
growing areas, the farmers are interested in the
application of the Sterile Insect Technique (SIT)
based on the success of this control method of
Anastrepha ludens (Loew) and A. obliqua (Mac-
quart) (Rull-Gabayet et al. 1996; Reyes et al.
2000).
The SIT requires the capability of rearing
large numbers of sterile flies of the target pest.
However, knowledge of A. striata is limited to
some aspects of its physiology (Ramirez-Cruz et
al. 1996), behavior (Aluja et al. 1993), insecticide
susceptibility (Gonzalez et al. 1997), natural
hosts (Aluja et al. 1987; Boscan de Martinez et al.
1980), and population fluctuations (Celedonio-
Hurtado et al. 1995; Carballo 1998). There is only
one previous study regarding artificial rearing of
this species and that includes description of an
artificial substrate for oviposition and egg collec-
tion (Hernandez et al. 2004).
Mass-rearing of fruit flies requires the devel-
opment of an artificial diet that is effective, easy
to prepare and manage, and inexpensive. For in-
sects not previously reared on an artificial diet,
one approach is to adopt or modify an existing
diet of a closely related species (Cohen 2004;
Parker 2005). Modified diets of the Mediterra-
nean fruit fly (medfly), Ceratitis capitata (Wied.)
have proven useful in developing diets for the
Mexican fruit fly, A. ludens (Stevens 1991), the
South American fruit fly, A. fraterculus (Wiede-
mann) (Jaldo et al. 2001), and the West Indian
fruit fly, A. obliqua (Artiaga-L6pez et al. 2004).
Diet formulations usually include a source of pro-
tein, bulking agents, acidifying agents, preserva-
tives, and water. The bulking agents generally
comprise 15-20% of the diet (w/w), and the more
common agents used are sugar cane bagasse (Pe-
leg & Rhode 1970; Vargas et al. 1983), texturized
soy (Schwarz et al. 1985), or corn cob fractions
(Stevens 1991; Vargas et al. 1994; Artiaga-L6pez
et al. 2004). Yeast is typically a source of protein,
but it also provides lipids, vitamins, mineral, car-
bohydrates, and micro-nutrients (Moreno et al.
1997). Sugar cane is the common carbohydrates
source. Citric acid, methyl paraben, and sodium
benzoate are the typically acidifiers and preserva-
tive agents (Stevens 1991; Jaldo et al. 2001; Arti-
aga-Lopez et al. 2004).
When flies are introduced to the laboratory on
an artificial diet for larval development, the es-
tablishment might require several generations.
Once the insects are adapted, however, there is a


good development and many quality parameters
such as pupal weight and adult performance are
improved (Pinson et al. 2006; Liedo et al. 2007).
Using the knowledge obtained from another
species as a starting point, we describe develop-
ment of the first artificial larval diet for artificial
rearing ofA. striata. We monitored quality control
parameters over 6 generations to describe how
the larva ofA. striata was adapted to the diet and
displayed increased rearing performance.

MATERIALS AND METHODS

Biological Material

The eggs used in this study were obtained from
a strain maintained during 10 generations on
guava fruits (Psidium guajava L.) at the Coloni-
zation and Rearing Laboratory, Development
Methods Department, Moscamed-Moscafrut
mass rearing facility (SAGARPA-IICA) at Metapa
de Dominguez, Chiapas, Mexico, according to the
methods described by Hernandez et al. (2004).
This strain was started in 2004 with 8,000 larvae
obtained from infested guava fruits collected near
Tapachula, Chiapas, Mexico.

Previously Formulated Larval Diets

Larval diets investigated were based on known
formulations used in mass-rearing of A. ludens
(ALU diet) (Stevens 1991), A. obliqua (AOI diet)
(Artiaga-L6pez et al. 2004), A. serpentina (ASE
diet) (Pinson et al. 1993), and C. capitata (CCA
diet) (Schwarz et al. 1985). In addition, 2 formu-
lations, AOII and AOIII, derived from the AOI
diet were included. The compositions of the 6 di-
ets are summarized in Table 1. The AOI was rep-
licated 11 times; ALU, ASE and CCA were repli-
cated 10 times, while AOII and AOIII were repli-
cated 5 times to give a total of 51 experimental
units. Plastic rearing trays (20 Length x 4 Width
x 15 Height cm) contained 500 g of diet. For each
replication the diet was prepared independently
with enough ingredients for only 1 batch.
Eggs collected during the second oviposition
day, were uniformly dispersed on pieces of black
cloth on moistened filter paper in Petri dishes (150
mm diameter x 25 mm depth), and maintained in
a Lindberg/Blue M, Stabil-Therm (Asheville NC,
USA) incubator for 3 d at 28 1C. When 50% of
the eggs had hatched in the Petri dishes, eggs
were seeded onto the larval diet surface of each
tray. Before placement on the diet, the eggs were
disinfected with chlorine at 100 ppm, and 0.1 mL
eggs (-1,100 eggs) were suspended in 50 mL of
0.4% guar gum solution that had been homoge-
nized, and the mixture poured on the surface of
the diet. During the first 2 d, the trays with egg-
sown diet were kept at 29 1C, and 90% R.H. to
complete hatching. Subsequently, the trays with


June 2010







Hernandez et al.: Artificial Larval Diet for A. striata


TABLE 1. COMPOSITION (% BY WEIGHT) OF THE DIETS PREVIOUSLY DEVELOPED FOR OTHER SPECIES OF THE ANAS-
TREPHA GENUS AND TESTED FOR THE DEVELOPMENT OF ANASTREPHA STRIATA LARVAE.

Diet Type

Ingredients CCA ALU ASE AOI AOII AOIII

Corn-cob fractions' 0.00 10.20 10.20 15.00 15.00 15.00
Corn flour2 0.00 0.00 7.00 8.00 8.00 8.00
Carrot meal3 0.00 7.00 0.00 0.00 0.00 0.00
Texturized soy' 14.20 0.00 0.00 0.00 0.00 0.00
Wheat germ5 14.20 0.00 0.00 0.00 0.00 0.00
Sugar6 7.30 7.00 7.00 8.33 8.33 8.33
Yeast7 6.70 5.00 9.00 5.83 4.83 6.83
Methylparaben8 0.60 0.20 0.20 0.11 0.11 0.11
Sodium benzoate' 0.00 0.01 0.20 0.23 0.23 0.23
Guar gum10 0.00 0.00 0.00 0.10 0.10 0.10
Citric acid" 0.00 0.00 0.44 0.63 0.63 0.63
HC112 0.60 0.60 0.00 0.00 0.00 0.00
Water 57.00 69.99 69.99 61.77 62.77 60.77

AOI (Artiaga-L6pez et al. 2004), CCA (Schwarz et al. 1985), ALU (Stevens 1991), ASE (Pinson et al. 1993), AOII (modified AOI),
AOIII (modified AOI). 'Corn cob fractions 100, Mt. Pulaski Products Inc., Chicago IL.; 'Maiz Industrializado del Sureste, S.A. de
C.V., Arriaga, Chiapas; Carrot meal, 'Colpac, Navajoa, Sonora, Mexico. 'Wheat germ, 6Ingenio Huixtla, Chiapas, Mexico; 'Lake
States Div. Rhinelander Paper Co. Rhinelander Wis.; 'Mallinckrodt Speciality, Chemicals Co. St. Louis Miss.;9Cia. Universal de In-
dustrias, S.A. de C.V., Mexico; "Tic gums, Inc. Belcamp, Md.; "Anhidro acidulante FNEUM, Mexana, S.A. de C.V., Morelos, Mexico.
"Omnichem, Procesos Quimicos Cientificos, S.A. de C.V., Puebla, Mexico.


diet and larvae were kept at 27 1VC, and 85-90%
R.H, until larval development was completed. At
the 10th day, when the first pupa was observed on
the surface of the diet (larvae of Anastrepha spp.
do not jump out of the diet), the larvae were sepa-
rated by diluting the diet with water and pouring
the mixture through a sieve (Mesh 14). Recovered
larvae were mixed with fine vermiculite to elimi-
nate excess humidity (Strong-lite fine, Sungro
Horticulture, Seneca, IL, USA), and larvae were
separated by sieving, counted, and weighed. To
promote high pupation percentage in a short pe-
riod of time and uniform distribution of the pupae,
larvae were allowed to pupate without substrate
(naked) at 21 + 1VC, and 70% R.H. on the surface
of the tray. After 24 h, pupae were covered with
vermiculite and maintained for 14 d at 25 1VC,
and 80% R.H. to complete the maturation process.
One day before adult emergence, the pupae were
sieved to separate them from the vermiculite,
counted, and weighed.
For each treatment, the following parameters
were recorded: (1) larval recovery was defined as
the estimated percentage of eggs seeded (on the
assumption of 1,100 eggs per 0.1 mL) and devel-
oped into mature larvae, (2) Average weight (mg)
per larva was estimated by weighting and count-
ing the total number of individuals from each rep-
lication (Hernandez et al. 2005).

Modification and Improving Larval Diets

The most economical diet (AOII) with the best
larval recovery in the previous test was used in


further experiments by substituting torula yeast
with another protein source. The treatments were
as follows: (1) NutriflyTM diet (commercial con-
tent: yeast, sugar, corn starch, rice starch and po-
tato starch); (2) torula yeast and casein diet
(3.62% casein, and 1.21% yeast) (TYC), and (3)
hydrolyzed protein diet (HP) (MP Biomedical, Ir-
vine, CA). Twelve replications were conducted for
each treatment yielding a total of 36 experimen-
tal units (plastic trays described previously). Col-
lection and incubation of eggs, addition of eggs to
the diet, larval recovery, pupae separation, and
adults were managed as described previously.
For each treatment, the following data were
obtained: (1) larval recovery (%) and (2) larval
weight (mg), as described in the previous section.
We also recorded (3) pupation percentage at 24 h
after larval recovery, (4) average weight per pupa
(mg) before adult emergence, and (5) adult emer-
gence (percentage based on relation of emerged
adults/ pupae) (FAO/IAEA/USDA 2003; Hernan-
dez et al. 2005; Rivera et al. 2007).

Adaptation on Artificial Diet

In order to determine if A. striata when
adapted to the artificial diet displayed increased
rearing performance, the changes in rearing and
quality parameters through the colonization pro-
cess over 6 generations (parental, and 5 subse-
quent generations) were analyzed by using a Nu-
triflyiM diet for larval development and under the
same environmental conditions. Each generation
began with the collection of eggs from the 1000







Florida Entomologist 93(2)


newly emerged adults from each diet trays that
were placed in 27-dm3 glass cages with one side cov-
ered a screen mesh to facilitate providing food to
the flies. Adults were fed ad libitum with a mixture
of sucrose and enzymatic yeast hydrolysate (3:1),
and water was provided in plastic containers with a
vertical strip of filter paper. The adult colonies were
kept at 26 1C, 75% R.H. and a photoperiod of
14:10 (L:D) h. Light was provided by white 75-W
fluorescent tubes placed 60 cm above the cages, and
the light intensity was ~300 lux inside the cage.
Ten days after emergence of the adults, mating
were observed, and placement and examination of
oviposition devices began the next day.
Eggs were collected with oviposition spheres
prepared with furcelleran as described by Boller
(1968). The spheres were placed inside the cages
for 24 h, and the eggs were recovered by cutting
the spheres into slices and dispersing them in wa-
ter (22-24C) by a bubbling system (aquarium air
pump, airflow of 3 L/min, 4.5 p.s.i., 110V, 50/60 Hz)
as was described by Hernandez et al. (2009). The
water was decanted, and the eggs from each daily
collection were counted and placed on pieces of
black cloth on a moistened filter paper in a Petri
dish (150 by 25 mm). The eggs were incubated for
3 d at 28 1C, and egg hatch was estimated by
counting the eggs and larvae from a sample ob-
served under a stereoscopic microscope. When we
observed between 20 and 40% of larval hatch, then
were seeded them onto larval diet in order to start
the evaluation of the next generation.
Twelve different batches of eggs were used to
start each generation, each one with 500 g of diet
with 0.1 mL of eggs collected from different co-
horts. At each generation, records were kept on
the following: (1) larval recovery, (2) larval
weight, (3) pupation percentage at 24 h, (4) pupal
weight, and (5) adult emergence, estimated as de-
scribed earlier.

Data Analysis

The data for larvae recovered (%), pupation at
24 h (%), and adult emergence (%) were trans-
formed to arc-sin by the function x' = sin-'1 ;
where x corresponded to the original value as a


ratio (percent/100). When a Bartlett test (Zar
1999) for equal variances was not significant for
arc-sin transformed data (P < 0.05), a one way
analysis of variance was applied (Underwood
2005), and the separation of means was made by
applying Tukey's test for larval recovery, pupa-
tion and adult emergence. If the Bartlett test
was significant, a Kruskal-Wallis test was ap-
plied to compare treatments (larval and pupae
weights) (SAS Institute 2003). The data for lar-
val recovery (%), larval weight (mg), pupation
percentage at 24 h, pupal weight, and adult
emergence by generation, during the process to
adaptation to artificial diet were subjected to a
simple linear or quadratic regression analysis
with JMP version 5.01 statistical software (SAS
Institute 2003).

RESULTS

Previous Formulated Larval Diets

Larval recovery from the initial diet formula-
tions tested ranged from 2.12 to 4.82%. The
higher values were obtained in the AOI and AOII
diets and the lowest in the ASE diet (F = 3.2; df
= 5, 45; P = 0.015) (Table 2). Larval weight
ranged from 15.35 to 16.41 mg, without signifi-
cant difference among means of the 6 diet types
(Table 2). Differences between treatments were
not significant (F = 0.4; df= 5, 45; P = 0.871) (Ta-
ble 2).

Improved Larval Diets

Larval recovery ranged from 7 to 38% with the
improved diets. The comparisons indicated that
the highest mean larval recovery (%) was from
NutriflyTM diet and the lowest larval recovery was
recorded with the hydrolyzed protein diet (F =
604.4; df = 2, 33; P < 0.001) (Table 3). The Nutri-
flyTM and torula yeast-casein diets allowed higher
larval weight than hydrolyzed protein diet (H =
23.4; df = 2; N = 36; P < 0.001) (Table 3).
The highest pupation value occurred with the
NutriflyTM diet, and the lowest on the hydrolyzed
protein diet (F = 54.7; df = 2, 33; P < 0.001), with


TABLE 2. DEVELOPMENT OF ANASTREPHA STRIATA LARVAE ON ARTIFICIAL DIETS*.

Diet Type Larval recovery (%) Larval weight (mg)

AOII (modified AOI) 4.82 0.32 a 16.31 1.16 a
AOI (Artiaga-L6pez et al. 2004) 4.77 0.67 a 15.79 0.63 a
AOIII (modified AOI) 4.73 0.86 ab 15.35 0.85 a
CCA (Schwarz et al. 1985) 3.21 0.70 ab 16.21 0.50 a
ALU (Stevens 1991) 2.51 0.35 ab 16.41 0.63 a
ASE (Pinson et al. 1993) 2.12 0.56 b 15.56 0.62 a

*Means within a column followed by the same letter do not differ significantly by Tukey HSD (P < 0.05) test.


June 2010







Hernandez et al.: Artificial Larval Diet for A. striata


TABLE 3. REARING AND QUALITY CONTROL PARAMETERS FOR ANASTREPHA STRIATA REARED ON 3 DIFFERENT DIETS
UNDER LABORATORY CONDITIONS.

1NutriflyTM 2Torula Yeast Casein 3Hydrolyzed Protein
Parameter Diet (TYC diet) (HP diet)

Larval recovery (%) 38.50 0.54 a 32.17 0.82 b 7.17 0.56 c
Larval weight (mg) 22.52 0.29 a 22.65 0.69 a 13.78 0.66 b
Pupation (%) at 24 h 97.51 + 0.58 a 93.33 0.95 a 77.33 2.24 b
Pupal weight (mg) 17.64 0.23 a 16.26 0.48 ab 15.21 0.62 b
Emergence (%) 95.50 0.83 a 91.95 1.34 a 83.79 2.82 b

Means within a row followed by the same letter do not differ significantly by Tukey HSD (P < 0.05) test.
Coltec (Comercializadora Agrotecnol6gica. Guatemala, C.A.).
2Casec (Bristol-Myers Suquibb de Mexico. Mexico, D. F.).
'ICN (MP Biomedicals, Irvine, CA).


no significant differences among the NutriflyTM
diet and torula yeast-casein diet (Table 3).
The highest pupal weight was obtained with
the NutriflyTM diet. The lowest average was ob-
served in the hydrolyzed protein diet, while the
torula yeast with casein diet presented an inter-
mediate average (H = 12.55; df = 2; N = 36; P =
0.002) (Table 3).
Highest adult emergence was obtained with
NutriflyTM whereas lowest emergence was ob-
served in hydrolyzed protein diet adults (F = 12.8;
df = 2, 33; P < 0.001). Average emergence ob-
tained with NutriflyTM and torula yeast- casein di-
ets were not significantly different (Table 3).

Adaptation on Artificial Diet
There is a no significant fit to linear regression
based on generational data for larval recovery
(larval recovery = -0.11 generation + 37.35, r2 =
0.03) (F = 0.16; df = 1, 70; P = 0.689) (Fig. 1). Lar-
val recovery ranged from 34 to 40% over 6 gener-
ations without significant differences among val-
ues (F = 1.03; df= 5, 66; P = 0.405). The lowest av-
erage was observed in the parental and third gen-
eration, while the highest corresponded to the
first generation.
Larval weight was fitted to a quadratic equa-
tion, y = 0.42x2 0.04 x + 18.87, r2 = 0.78 (F = 5.89;
df = 2, 69; P = 0.004) (Fig. 2A), with mean values
ranging from 18.1 to 21.4 mg through 5 genera-
tions. The highest average was observed in paren-
tal and fifth generation, which decreased in first
and second generations, with medium averages in
the third and fourth generations (F = 3.03; df= 5,
66; P = 0.016).
In the pupal weight, described by the equation
y = 0.19x2 + 0.14 x + 16.52, r2 = 0.68 (F = 8.14; df
= 2, 69;P < 0.001) (Fig. 2B), the mean ranged from
16.8 to 18.6 mg through 5 generations. The high-
est average was observed in the parental and fifth
generation, with significant decreases in the first
and second generations; and medium averages in
the third and fourth generation (F = 5.12; df = 5,
66; P < 0.001).


a a
Sa a

T T


P 1 2 3 4 5
Generation
Fig. 1. Larval recovery ofAnastrepha striata reared
on NutriflyTM diet during colonization under laboratory
conditions. [E Mean, [ Mean S.E., I Mean (1.96)
S.E.].


In pupation at 24 h, described by the equation
y = 1.84x2 + 3.19 x + 63.81, r2 = 0.48 (F = 4.68; df
= 2, 69; P = 0.012) (Fig. 3), the mean ranged from
65.8 to 89.2% through 6 generations. In the pa-
rental and from third to fifth generation higher
values were obtained than in the first and second
generations (F = 4.34; df = 5, 66; P < 0.001).
The mean adult emergence over 6 generations
ranged from 86.3 to 95.5% and was described by
the equation y = 1.46x + 86.29, r2= 0.77) (F =
22.87; df= 1, 70; P < 0.001) (Fig. 4). The lowest av-
erage was observed in the parental generation
while the highest corresponded to the fifth gener-
ation (F = 6.21; df = 5, 66; P < 0.001).

DISCUSSION

The developed for first time of an artificial lar-
val diet forA. striata was based initially on the di-
ets used for mass-rearing another species of fruit
flies. The diet that yielded the highest number of
larvae in the current study was the formulation
developed for the mass-rearing of A. obliqua by







Florida Entomologist 93(2)


24 r A


ab


b ab


- 90
80




S60

50


18


B

S18
s
17

16


15


ab ab


-D b
ID 0


P 1 2 3 4 5
Generation
Fig. 2. Larval (A) and pupal (B) weight ofAnastrepha
striata reared on NutriflyTM diet during colonization un-
der laboratory conditions. [E Mean, D MeantS.E., I
Mean (1.96) S.E.].



Artiaga-L6pez et al. (2004). The diets used for A.
ludens (Stevens 1991),A. serpentina (Pinson et al.
1993), and C. capitata (Schwarz et al. 1985) per-
mitted development ofA. striata larvae although
to a lesser degree. However, the low values re-
garding larval recovery indicate that it may be
necessary to develop a diet with specific chemical,
physical, and nutrient characteristics that permit
the survival and growth of a greater number of
larvae that would provide greater genetic varia-
tion in the population (Ochieng-Odero 1994).
Torula yeast appeared to benefit larval devel-
opment, but allowed a greater quantity of recov-
ered larvae and high larval weight suggesting
thatA. striata diets required casein. These results
agree with observations made in A. obliqua in
which larval weight increased when casein was
added to the diet (Moreno et al. 1997; Rivera et al.
2007). For A. ludens and A. serpentina, torula
yeast and corn flour provided the amino acids, vi-
tamins, and other nutrients to promote larval
growth (Rivera et al. 2007).


a
bb



b T?


40
P 1 2 3 4 5
Generation
Fig. 3. Pupation (%) ofAnastrepha striata reared on
NutriflyTM diet during colonization under laboratory
conditions. [E Mean, D Mean S.E., I Mean (1.96)
S.E.].


In this study we identified useful combinations
of ingredients for rearing ofA. striata on an arti-
ficial diet. This finding provides baseline informa-
tion for development of low cost diets based on al-
ternative substrates. Nevertheless, we found that
larval and pupal weight and pupation at 24 h de-
creased from the parental generation maintained
on guava fruits to the first generation maintained
on artificial diet. With C. capitata and A. obliqua
a precipitous decline in yield was observed during
the first generation following a change from nat-
ural host to artificial mass-rearing methods (Lep-
pla et al. 1983; Hernandez et al. 2009). This trend
could be explained by the fact that colony
founders are forced through genetic bottlenecks
to eliminate variability as well as phenotypes


100




go
- 95





85


80


a
ab abc




"r*co


P 1 2 3 4 5
Generation
Fig. 4. Adult emergence (%) of Anastrepha striata
reared on NutriflyTM diet during colonization under lab-
oratory conditions. [E Mean, D Mean + S.E., I Mean
(1.96) S.E.].


June 2010







Hernandez et al.: Artificial Larval Diet for A. striata


that prevent adaptation to the larval diet. Larval
recovery and adult emergence of A. striata in-
creased from the parental to the first generation.
These results are similar with other previously
reported in flies reared in artificial conditions
(Manoukas 1983; Leppla 1989; Liedo et al. 2007;
Hernandez et al. 2009), which suggests that colo-
nization for mass-rearing is a selection process in
which insects are adapted to the rearing condi-
tions and that attributes require several genera-
tions to improve. For example, the pupal recovery
increased throughout the generations during the
colonization of Bactrocera invadens Drew, Tsu-
ruta and White (Ekesi et al. 2007), and the same
result was observed for the pupal weight, demo-
graphic parameters, and mating attributes dur-
ing the colonization of C. capitata (Liedo et al.
2007). Larval recovery and fecundity inA. obliqua
showed the same trend through colonization
(Hernandez et al. 2009).
This study provides basic information regard-
ing artificial diets for larval development of A.
striata. However, additional studies into nutrient
requirements are needed to optimize the rearing
process to improve the production of quality in-
sects at lower cost.


ACKNOWLEDGMENTS

The authors thank S. Ekesi and D. Nestel and 3
anonymous reviewers for helpful review of this manu-
script. We are grateful to Y. Margoth Garcia (Subdirec-
ci6n de Desarrollo de Metodos-Programa Moscafrut,
SAGARPA-IICA), for technical help in the rearing pro-
cedures and Miguel Arenas for the computer assistance.
This research was partially funded by the FAO/IAEA
(Contract No. 13023/RO. 2005-2010) and the Campaia
Nacional Contra Moscas de la Fruta, Programa Mos-
camed-Moscafrut (SAGARPA-SENASICA). We are
grateful to Jorge Hendrichs, Andrew Jessup, and Carlos
Caceres of the IAEA staff.


REFERENCES CITED

ALUJA, M., GUILLEN, J., DE LA ROSA, G., CABRERA, M.,
CELEDONIO, H., LIEDO, P., AND HENDRICHS, J. 1987.
Natural host plant survey of the economically impor-
tant fruit flies (Diptera: Tephritidae) of Chiapas,
Mexico. Florida Entomol. 70: 329-338.
ALUJA, M., JACOME, I., BIRKE, A., LOZADA, N., AND
QUINTERO, G. 1993. Basic patterns of behaviour in
wild Anastrepha striata (Diptera: Tephritidae) flies
under field-cage conditions. Ann. Entomol. Soc.
America 86: 776-793.
ALUJA, M. 1994. Bionomics and management ofAnas-
trepha. Annu. Rev. Entomol. 39: 155-178.
ARTIAGA-LOPEZ, T., HERNANDEZ, E., DOMINGUEZ-GOR-
DILLO, J., MORENO, D. S., AND OROZCO-DAVILA, D.
2004. Mass-Production ofAnastrepha obliqua at the
Moscafrut fruit fly facility, Mexico, pp. 389-392 In B.
N. Barnes [ed.], Proc. 6th Intl. Symp. on Fruit Flies
of Economic Importance. 6-10 May 2002, Heriotdale,
Johannesburg, South Africa.


BOLLER, E. 1968. An artificial oviposition device for the
European cherry fruit fl. Ri......... ,cerasi. J. Econ.
Entomol. 61: 850-852.
BOSCAN DE MARTINEZ, N., DEVORDY, J. R., AND REQUE-
NA, J. R. 1980. Estado actual de la distribuci6n
geografica y hospederas de Anastrepha spp.
(Diptera: Tephritidae) en Venezuela (1). Agronomia
Tropical. 30: 55-63.
CARBALLO, V. M. 1998. Abundancia estacional y daio de
Anstrepha striata en genotipos de guayaba y cas.
Manejo Integrado de Plagas (Costa Rica) 50: 66-72.
CELEDONIO-HURTADO, H., ALUJA, M., AND LIEDO, P.
1995. Adult population fluctuations of Anastrepha
species (Diptera: Tephritidae) in tropical orchard
habitats of Chiapas, M6xico. Environ. Entomol. 24:
861-869.
COHEN, A. C. 2004. Insect Diets. Science and Technolo-
gy. CRC Press, Boca Raton. 324 p.
FAO/IAEA/USDA/ 2003. Manual for Product Quality
Control and Shipping Procedures for Sterile Mass-
reared Tephritid Fruit Flies. Version 5.0 Internation-
al Atomic Energy Agency, Viena, Austria. 85 p.
GONZALEZ, G. E., DEIBIS, J., AND CASARES, M. R. 1997.
Susceptibilidad de poblaciones adults, machos y
hembras de Anastrepha striata Schiner al insectici-
da malati6n, usando t6cnicas de aplicaciones t6picas
y consume de cebos t6xicos. Bol. Entomol. Venezola-
na (N. S.) 12: 51-57.
HERNANDEZ, E., ARTIAGA, T., AND FLORES, S. 2004. De-
velopment of an artificial oviposition device for
Anastrepha striata Schiner (Diptera: Tephritidae),
pp. 393-398 In B. N. Barnes [ed.], Proc. 6th Intl.
Symp. on Fruit Flies of Economic Importance. 6-10
May 2002, Heriotdale, Johannesburg, South Africa.
HERNANDEZ, E., FLORES-BRECEDA, S., SOSA-ITURBE, M.
DE LA L., AND EZQUIVEL, H. 2005. Tamaio de unidad
muestral y nimero de repeticiones para la esti-
maci6n de los parametros de desarrollo de Anas-
trepha obliqua y Anastrepha ludens (Diptera: Te-
phritidae). Folia Entomol. Mexicana 44: 155-164.
HERNANDEZ, E., TOLEDO, J., ARTIAGA-LOPEZ, T., AND
FLORES, S. 2009. Demographic changes in Anas-
trepha obliqua (Diptera: Tephritidae) throughout
the laboratory colonization process. J. Econ. Ento-
mol. 102: 542-551.
HERNANDEZ-ORTIZ, V. 1992. El g6nero Anastrepha
Schiner en M6xico (Diptera: Tephritidae). Tax-
onomia, distribuci6n y sus plants hu6spedes. Insti-
tuto de Ecologia, and Sociedad Mexicana de Ento-
mologia. Publ. 33. M6xico 162 p.
HERNANDEZ-ORTIZ, V., AND ALUJA, M. 1993. Listado de
species del g6nero neotropicalAnastrepha (Diptera:
Tephritidae) con notas sobre su distribuci6n y plan-
tas hospederas. Folia Entomol. Mexicana. 88: 89-
105.
JALDO, H. E., GRAMAJO, M. C., AND WILLINK, E. 2001.
Mass rearing ofAnastrepha fraterculus (Diptera: Te-
phritidae): A preliminary strategy. Florida Entomol.
84: 716-718.
JIRON, L. F., AND HEDSTROM, I. 1988. Occurrence of
fruit flies of the genera Anastrepha and Ceratitis
(Diptera: Tephritidae), and their host plant avail-
ability in Costa Rica. Florida Entomol. 71: 62-73.
LEPPLA, N. C., HUETTEL, M. D., CHAMBERS, D. L., ASH-
LEY, T. R., MIYASHITA, D. H., WONG, T. T. Y., AND
HARRIS, E. J. 1983. Strategies for colonization and
maintenance of the Mediterranean fruit fly. Ento-
mol. Exp. Appl. 33: 89-96.








Florida Entomologist 93(2)


LEPPLA, N. C. 1989. Laboratory Colonization of Fruit
Flies, pp. 91-103 In A. S. Robinson, and G. Hooper
[eds.]. Fruit Flies, Their Biology, Natural Enemies
and Control. Vol. 3B. Elsevier. Amsterdam, The
Netherlands.
LIEDO, P., SALGADO, S., OROPEZA, A., AND TOLEDO, J.
2007. Improving mating performance of mass-
reared sterile Mediterranean fruit flies (Diptera: Te-
phritidae) through changes in adult holding condi-
tions: Demography and mating competitiveness.
Florida Entomol. 90: 33-40.
MANOUKAS, A, C, 1983. The adaptation process and the bi-
ological efficiency ofDacus oleae, pp. 91-95 In R. Caval-
loro [ed.], Fruit Flies of Economic Importance. CEC/
IOBC International Symposium, Athens, Greece, 16-
19 November 1982. A. A. Balkema, Rotterdam.
MORENO, D. S., ORTEGA-ZALETA, D. A., AND MANGAN, R.
L. 1997. Development of artificial larval diets for the
West Indian fruit fly (Diptera: Tephritidae). J. Econ.
Entomol. 90: 427-434.
OCHIENG-ODERO, J. P. R. 1994. Does adaptation occur in
insect rearing systems, or is it a case of selection, ac-
climatization and domestication? Insect Science Ap-
plic. 15: 1-7.
PARKER, A. G. 2005. Mass-Rearing for Sterile Insect Re-
lease, pp. 209-232 In V. A. Dyck, J. Hendrichs and A.
S. Robinson [eds.], Sterile Insect Technique: Princi-
ples and Practice in Area-Wide Integrated Pest Man-
agement, IAEA, Springer. The Netherlands.
PELEG, B. A., AND RHODE, R. H. 1970. New larval medi-
um and improved pupal recovery method for the
Mediterranean fruit fly in Costa Rica. J. Econ. Ento-
mol. 63: 1319-1321.
PINSON, E., CELEDONIO, H., AND ENKERLIN, W. 1993.
Colonization and establishment of Anastrepha ser-
pentina for mass-rearing: Preliminary results, pp.
281-284 In M. Aluja and P. Liedo [eds.]. Fruit flies:
Biology and Management. Springer-Verlag. New
York, USA.
PINSON, E. P., TEJADA, L. 0., TOLEDO, J., ENKERLIN, W.,
CELEDONIO-HURTADO, H., VALLE, J., PEREZ, J. N.,
AND LIEDO, P. 2006. Caracterizaci6n de la adapt-
aci6n deAnastrepha serpentina (Wied.) (Diptera: Te-
phritidae) a condiciones de cria masiva. Folia Ento-
mol. Mexicana 45: 97-112.
RAMIREZ-CRUZ, A., HERNANDEZ-ORTIZ, V., AND MARTIN-
EZ, M. I. 1996. Maduraci6n ovarica de las moscas de
la guayaba Anastrepha striata Schiner (Diptera: Te-
phritidae). Acta Zool. Mexicana 69: 105-116.


REYES, F. J., SANTIAGO M., G., AND HERNANDEZ, M. P.
2000. The Mexican fruit fly eradication programme,
pp. 377-380 In K. H. Tan [ed.], Area-Wide Control of
Fruit Flies and Other Insect Pests. Penerbit Univer-
siti Sains Malaysia. Penang, Malaysia.
RIVERA, J. P., HERNANDEZ, E., TOLEDO, J., SALVADOR,
M., AND SILVA, R. 2007. Dieta texturizada con agar
para el desarrollo larvario de tres species de moscas
de la fruta (Diptera: Tephritidae). Folia Entomol.
Mexicana 46: 37-52.
RULL-GABAYET, J. A., REYES-FLORES, J., AND ENKER-
LIN-HOEFLICH, W. 1996. The Mexican national fruit
fly eradication campaign: Largest fruit fly industrial
complex in the world, pp. 561-563 In B. A. McPheron
and G. J. Steck [eds.], Fruit Fly Pests. A World As-
sessment of Their Biology and Management. St. Lu-
cie Press. Fla., USA.
SAS INSTITUTE. 2003. JMP Statistical, Discovery Soft-
ware, Version 5.0.1. SAS Institute Inc., Cary, North
Carolina.
SCHWARZ G. A., ZAMBADA, A., OROZCO, D., ZAVALA, J. L.,
AND CALKINS, C. 0. 1985. Mass rearing of the Medi-
terranean fruit fly at Metapa, Mexico. Florida Ento-
mol. 68: 467-477.
STEVENS, L. 1991. Manual of Standard Operating Pro-
cedures (SOP) for the Mass-Rearing and Steriliza-
tion of the Mexican Fruit Fly, Anastrepha Ludens
(Loew). USDA-APHIS, South Central Region, Mis-
sion Texas. 39 p.
UNDERWOOD, A. J. 2005. Experiments in Ecology: Their
Logical Design and Interpretation Using Analysis of
Variance. Cambridge University Press. Cambridge,
UK. 504 p.
VARGAS, R. I., CHANG, H., AND WILLIAMSON, D. L. 1983.
Evaluation of a sugarcane bagasse larval diet for
mass production of the Mediterranean fruit fly
(Diptera: Tephritidae) in Hawaii. J. Econ. Entomol.
76: 1360-1362.
VARGAS, R. I., MITCHELL, S., HSU, C., AND WALSH, W. A.
1994. Laboratory evaluation of diets of processed
corncob, torula, yeast, and wheat germ on four devel-
opmental stages of Mediterranean fruit fly (Diptera:
Tephritidae). J. Econ. Entomol. 87: 91-95.
WEEMS, JR., H. V. 1982. Anastrepha striata Schiner
(Diptera: Tephritidae). Entomology circular No. 245.
December, 1982. Fla. Dept. Agric. and Consumer
Serv. Division of Plant Industry. 2 p.
ZAR, J. H. 1999. Biostatistical Analysis. Prentice-Hall,
Inc. New Jersey. 663 p.


June 2010







Schliserman et al.: Fruit Fly Parasitoids in NE Argentina


DIVERSITY AND ABUNDANCE OF HYMENOPTEROUS PARASITOIDS
ASSOCIATED WITH ANASTREPHA FRATERCULUS
(DIPTERA: TEPHRITIDAE) IN NATIVE AND EXOTIC HOST PLANTS IN
MISIONES, NORTHEASTERN ARGENTINA

PABLO SCHLISERMAN', SERGIO M. OVRUSKI', OLGA R. DE COLL2 AND ROBERT WHARTON3
PROIMI Biotecnologia-CONICET, Divisi6n Control Biol6gico de Plagas, Laboratorio Moscas de La Fruta. Avda.
Belgrano y Pje. Caseros s/n", (T4001MVB) San Miguel de Tucuman, Tucuman, Argentina

'INTA-EEA Montecarlo. Avda. Libertador 2472, C.P.: 3384 Montecarlo, Misiones, Argentina

'Department of Entomology, Texas A&M University, College Station, TX 77843, USA

ABSTRACT

Some Major host species used by the tephritid fruit flies Anastrepha fraterculus (Wiede-
mann) and Ceratitis capitata (Wiedemann), including Acca sellowiana (0. Berg) Burret,
Campomanesia xanthocarpa 0. Berg, Psidium guajaua L., Prunus persica (L.) Batsch, Eri-
obotrya japonica (Thunb.) Lindl., Citrus reticulata Blanco var. Murcott, C. aurantium L., C.
paradisi Macfadyen var. Dalan Dan, and C. paradisi var. Sudashi, were sampled for fruit fly
larvae between Feb and Dec 2000 in the northernmost section of the Paranaense forest, in
the Province of Misiones, NE Argentina. Both A. fraterculus and C. capitata were obtained
from these host plant species, withA. fraterculus accounting for 93% of all tephritid puparia
identified. Ten species of larval-pupal parasitoids were recovered fromA. fraterculus: Doryc-
tobracon areolatus (Sz6pligeti), D. brasiliensis (Sz6pligeti), Utetes anastrephae (Viereck),
Opius bellus (Gahan), Diachasmimorpha longicaudata (Ashmead) (Opiinae, Braconidae),
Odontosema anastrephae Borgmeier, Lopheucoila anastrephae (Rohwer), Aganaspis peller-
anoi (Brethes) (Eucoilinae, Figitidae), Asobara anastrephae (Muessebeck) (Alyssinae, Bra-
conidae), and Aceratoneuromyia indica (Silvestri) (Tetrastichinae, Eulophidae). All these
parasitoids, with the exception of D. longicaudata andA. indica, are native to the Neotropi-
cal region. No parasitoids were recovered from C. capitata puparia. Asobara anastrephae
and 0. anastrephae are newly recorded in Argentina, whereas D. brasiliensis, U. anas-
trephae, and L. anastrephae are newly reported in Misiones. The eucoilineA. pelleranoi was
the most abundant parasitoid species.Acca sellowiana and P. guajaua harbored the highest
parasitoid abundance and diversity.

Key Words: fruit flies, host plants, parasitoids, diversity, abundance, Argentina

RESUME

Las species de plants hospederas Acca sellowiana (0. Berg) Burret, Campomanesia xan-
thocarpa 0. Berg, Psidium guajava L., Prunus persica (L.) Batsch, Eriobotrya japonica
(Thunb.) Lindl., Citrus reticulata Blanco var. Murcott, C. aurantium L., C. paradisi Macfa-
dyen var. Dalan Dan, y C. paradisi var. Sudashi fueron colectadas entire Febrero y Diciembre
de 2000 en la secci6n mas nortefia de la selva Paranaense (Misiones, noreste argentino). De
estas plants hospederas se obtuvieron dos species de Tephritidae: Anastrepha fraterculus
(Wiedemann) y Ceratitis capitata (Wiedemann). La primera especie de tefritido represent
el 93% de todos los puparios identificados. Se recuperaron 10 species de parasitoides larvo-
pupales de A. fraterculus: Doryctobracon areolatus (Sz6pligeti), D. brasiliensis (Sz6pligeti),
Utetes anastrephae (Viereck), Opius bellus (Gahan), Diachasmimorpha longicaudata (Ash-
mead) (Opiinae, Braconidae), Odontosema anastrephae Borgmeier, Lopheucoila anastre-
phae (Rohwer), Aganaspis pelleranoi (Brethes) (Eucoilinae, Figitidae), Asobara anastrephae
(Muessebeck) (Alyssinae, Braconidae) yAceratoneuromyia indica (Silvestri) (Tetrastichinae,
Eulophidae). Todas estas species de parasitoides, con la excepci6n de D. longicaudata yA.
indica, son nativas de la Regi6n Neotropical. No fueron recuperados parasitoides de pupa-
rios de C. capitata. Las species A. anastrephae y 0. anastrephae son nuevos registros para
Argentina, mientras que D. brasiliensis, U. anastrephae y L. anastrephae son nuevas citas
para Misiones. El eucoilino A. pelleranoi fue la especie de parasitoide mas abundante. Las
plants hospederas A. sellowiana y P. guajaua manifestaron los valores mas altos de diver-
sidad y abundancia de parasitoides.


Translation provided by the authors.







Florida Entomologist 93(2)


There are 2 tephritid fly species in Argentina
that have a major economic impact: the native
Anastrepha fraterculus (Wiedemann) (South
American fruit fly) and the exotic Ceratitis capi-
tata (Wiedemann) (Mediterranean fruit fly).
These pests represent an obstacle for fruit crop
expansion and for diversification plans in the
northeastern Argentinean provinces of Misiones,
Corrientes and Entre Rios (Guillen & Sanchez
2007). In this Argentinean region there are im-
portant Citrus-growing areas and patches of na-
tive forest locally known as the "Selva Para-
naense" (Cabrera 1976), where A. fraterculus and
C. capitata infest both wild and cultivated native
and exotic fruit species (Turica & Mallo 1961; Pu-
truelle 1996; Segura et al. 2006).
Ogloblin (1937) and Turica & Mallo (1961) are
the only previous studies of the native parasitoid
fauna ofA. fraterculus in the northernmost exten-
sion of the Argentinean Paranaense forest. Since
then, the exotic fruit fly parasitoids, Diachasmi-
morpha longicaudata (Ashmead) and Acerato-
neuromyia indica (Silvestri), were recovered from
A. fraterculus pupae in Misiones (Schliserman et
al. 2003; Ovruski et al. 2006). Both D. longicau-
data and A. indica, natives of Southeast Asia,
were introduced during the 1960s and released in
limited numbers in several fruit-growing areas of
Argentina, including Misiones (Ovruski et al.
2000), and these are the only exotic parasitoids
currently established in Argentina.
The aim of the present study is to survey wild
and cultivated fruit species commonly infested by
A. fraterculus and C. capitata with the purpose of
providing more detailed information on the diver-
sity, abundance, and distribution ranges of hy-
menopterous parasitoid species associated with
both tephritid species in Misiones, northeastern
Argentina, as well as to record the degree of infes-
tation and parasitism in each fruit species.


MATERIALS AND METHODS

Fruit collections were made weekly between
Feb and Dec 2000 in Caraguatay (2666'S,
5475'W, elevation 193 m), Laharrague (26'50'S,
54o77'W, 159 m), and Montecarlo city (2657'S,
5445'W, 161 m) localities of the Misiones prov-
ince, NE Argentina. The region has a temperate-
warm humid climate with a summer average
temperature of 25C, and a winter average tem-
perature of 16'C. It rains periodically all year
long, and the annual rainfall varies from 1,500 to
2,500 mm (Anonymous 1992). The original native
vegetation is the subtropical rainforest locally
known as the "Selva Paranaense", which has been
intensely modified into agricultural and managed
forest areas (Cabrera 1976).
The fruit samples consisted of fallen ripe fruit
(40-50%) and ripe fruit still on the tree (50-60%).
Table 1 contains fruit tree species surveyed, with
information on mean individual weight of fruit,
status (exotic or native and wild or cultivated),
common name, and plant family. Fruit were
mainly collected in forest patches adjacent to cit-
rus groves covered with wild native vegetation,
and orchards located at the experimental station
"Campo Experimental Laharrague", an agricul-
tural area maintained by the National Institute
of Agricultural Technology (Instituto Nacional de
Tecnologia Agropecuaria, INTA). No insecticides
were applied in any of the collection sites.
Fruit samples were processed in the laboratory
of the Montecarlo Experimental Agricultural Sta-
tion (Estaci6n Experimental Agropecuaria Mon-
tecarlo, EEAM)-INTA located in Montecarlo
city. Fruits collected from tree and from the
ground were kept separate. All fruits in the sam-
ple were weighed and rinsed with a 20% solution
of sodium benzoate. Each sample was placed in a
plastic tray (55 x 40 x 20 cm) with sand in the bot-


TABLE 1. PLANT FAMILY, FRUIT SPECIES, AVERAGE INDIVIDUAL FRUIT WEIGHT, AND NUMBER OF TREES SAMPLED IN MI-
SIONES, NE ARGENTINA, DURING 1-YEAR STUDY (2000).

Mean ( SD)
individual
fruit weight (g)
Plant Family Fruit species and (common name) Status (n = 100 fruits)

Myrtaceae Acca sellowiana (0. Berg) Burret (feijoa) Native, Wild 18.9 2.7
Campomanesia xanthocarpa 0. Berg (guabird) Native, Wild 4.9 1.6
Psidium guajava L. (guava) Exotic, Wild 30.1 2.1
Rosaceae Prunus persica (L.) Batsch (peach) Exotic, Cultivated 38.8 6.9
Eriobotryajaponica (Thunb.) Lindl. (loquat) Exotic, Wild 8.1 2.9
Rutaceae Citrus aurantium L. (sour orange) Exotic, Cultivated 250.8 64.5
C. paradisi Macfadyn var. Dalan Dan (grapefruit) Exotic, Cultivated 336.9 46.5
C. paradisi Macfadyn var. Sudashi (grapefruit) Exotic, Cultivated 234.5 28.7
C. reticulata Blanco, var. Murcott (mandarin orange) Exotic, Cultivated 99.3 15.3


June 2010







Schliserman et al.: Fruit Fly Parasitoids in NE Argentina


tom as pupation medium for larvae. All trays
were kept inside a room at 26 2C and 65 10%
relative humidity for 4 weeks. Afterwards, fruits
were dissected to find larvae or puparia in the
pulp. Live larvae were allowed to pupate and
were then added to the other pupae collected from
the same sample. The sand inside trays was sifted
2 times each week to collect tephritid pupae,
which then were transferred to glass vials (11 cm
high and 6 cm of diameter) containing sterilized
humid sand at the bottom. Puparia of C. capitata
and Anastrepha Schiner were separated based on
pupal characters (White & Elson-Harris 1992).
Parasitoid specimens were identified to species
by the authors P. S, S. O., and R. W. Fruit flies
were identified by S. O. using Zucchi's (2000) tax-
onomic key. The nomenclature corresponds to
Wharton (1997) for the Opiinae and Wharton et
al. (1998) for the Eucoilinae. Parasitoid and fly
specimens were placed in the entomological col-
lections of the Miguel Lillo Foundation (Fun-
daci6n Miguel Lillo, FML) (Tucuman, Argentina),
EEAM (Misiones, Argentina), and Texas A&M
University (Texas, USA). All plant species were
identified by author O. De Coll.
The rate of parasitism was calculated by divid-
ing the total number of adult parasitoids emerg-
ing from pupae obtained from a fruit sample by
the total number of pupae recovered from that 1
fruit sample and multiplying it by 100 (Aluja et
al. 2003). Fruit infestation levels were obtained
by dividing the total number of pupae obtained
from a fruit sample by the total weight of the sam-
ple (Aluja et al. 2003).

RESULTS

A total of 261.35 kg of fruit was processed dur-
ing this study (Table 2). Only A. fraterculus was
recovered from P guajava, A. sellowiana, E.
japonica, and C. xanthocarpa, whereas both A.
fraterculus and C. capitata were recovered from
the remaining fruit species. Ceratitis capitata
constituted 93, 38, 15, 20, and 25% of the total re-
covered fly puparia from C. aurantium, C. reticu-
lata, C. paradise var. Dalan Dan, C. paradise var
Sudashi, and P persica (Table 2).
The highest infestation rates by A. fraterculus
were found in P guajava and A. sellowiana, and
the lowest levels in the Citrus species (Table 2).
Infestation patterns by C. capitata were low and
ranged from 0 to 14 pupae per kg of sampled fruit
(Table 2).
Five species of opiine Braconidae, 3 species of
eucoiline Figitidae, 1 species of alysiine Bra-
conidae, and 1 species of tetrastichine Eu-
lophidae, all larval-pupal parasitoids, were recov-
ered from A. fraterculus pupae. The parasitoids
comprised Doryctobracon areolatus (Szepligeti),
D. brasiliensis (Szepligeti), Utetes anastrephae
(Viereck), Opius bellus Gahan, Diachasmimor-


pha longicaudata (Ashmead) (Opiinae, Bra-
conidae), Odontosema anastrephae Borgmeier,
Lopheucoila anastrephae (Rohwer), Aganaspis
pelleranoi (Brethes) (Eucoilinae, Figitidae), Aso-
bara anastrephae (Muessebeck) (Alyssinae, Bra-
conidae), andAceratoneuromyia indica (Silvestri)
(Tetrastichinae, Eulophidae). All these parasitoid
species, with the exception ofD. longicaudata and
A. indica, are native to the Neotropical region. No
parasitoids were recovered from C. capitata pu-
paria.
Nine parasitoid species were found attacking
A. fraterculus larvae in A. sellowiana, which had
the most diverse assemblage of parasitoids
(Table 3). In 3 of the fruit species, only a single
parasitoid species was associated with A. frater-
culus larvae (Table 3). Nearly 80% of the figitid
parasitoids were recovered from fruit gathered
from the ground. On the contrary, approximately
60% of the braconid parasitoids were obtained
from fruit collected from the tree canopy (Table 3).
Percent parasitism was variable and ranged from
0 to 15% in the different fruit species found to be
hosts ofA. fraterculus in the study area (Fig. 1).

DISCUSSION

Six findings are noteworthy: (1) a higher pro-
portion of A. fraterculus than C. capitata were
found in 90% of the host plants surveyed, (2) the
diversity of native A. fraterculus parasitoids was
high in the northernmost section of the subtropi-
cal Paranaense forest, (3) the new data extended
the known distribution of A. fraterculus parasi-
toids, (4) the permanent establishment of A. in-
dica in the Paranaense biogeographical region
was confirmed, (5) the eucoilineA. pelleranoi was
relatively abundant and had an uncharacteristi-
cally wide host plant breadth, and (6) the impor-
tance of host plants of the Myrtaceae family, such
as the A. sellowiana and P guajava, harbored un-
usually high levels of parasitoid diversity and
abundance.
Although the number and size of fruit samples
surveyed during this study were relatively small,
the data suggest that A. fraterculus appears to be
more abundant than C. capitata in wild native,
"feral" exotic, and cultivated exotic fruit species,
with the sole exception of C. aurantium, in the
northernmost portion of NE Argentina. Both A.
sellowiana and P guajava wild fruit species were
principal reservoirs from which A. fraterculus
could spread to Citrus-growing areas. Similar ob-
servations have been made by Ovruski et al.
(2004, 2005) in NW Argentina. As noted by Norr-
bom (2000), fruits in the family Myrtaceae are the
principal hosts ofA. fraterculus.
The alysiine A. anastrephae and the eucoiline
0. anastrephae are 2 new native A. fraterculus
parasitoid species recorded for Argentina. Before
this study, 11 neotropical parasitoid species asso-









Florida Entomologist 93(2)


CO


+1
Cl
cq
4


+1
(0
1-4


+-1







OS^S
bfj






dk





-a
5
2o~c



CD 3
SH^



k 1













o a ,
0,
o r<












6a
t 0











a








~- 0~
_ "E




















0
-^ C









oca
m

a *






*a



^^a
o ^c


CM I0 CO C CM







Cl 0 00 (0
00 00c
il CM CO (0
,-I ,- CM


cc


+1
CO


II I CO
cq | | C
i-l I I 1


cci


,-I t^- CO I
CM CM ^' ^





il 0 t^- 01
Ini L- cc U





CM
cq cqu



00 Ic



cqs~


LN- c-


C) cc



E: Q a



. c c 8 g
Sd cc oc



12-~
S J -S
g Q M ei



r. r k a






~9 m
t B"' B- i^ c, Q. B B t Q

gc~f rc cci ^ gl g ig |g ^

i_]^ i_]^ i_]^ i_]5 i_] g. m i-l . i-ki] i] ^ S


June 2010


"t c q x~






I I c C c'l .o
Ii 1 t-- CO .-


hi







Cl i
10 U1
c c1




C6




cq .
(M 0


CM (M (-
-- -I CqI T- -I T-









Schliserman et al.: Fruit Fly Parasitoids in NE Argentina


C1 cx C1
+1 +1 +1
S=I-
C11 c x


0
ao
m^


Sct




0-
E

1^


i
zc-
bfj





r
a+
c^c











a,



ct
E- +



















Q,t
i
+1




















a ,
cc























0

H
0




cflM













0
c-fl


lM 10 C
,It C := c


C11 C11.
+1 +1 +1
iCl In 1
t[- CO i.l







L- c C'I
+1 +1 +1

In CC C
f; 10 0
10 (0 O


+1 +1 +1








Cx In C1

+1 +1 +1
,d (M ,d


m I- C1l


(M(M0

+1 +1 +1
0 In
(0 c(c


(0 t- (0



000






[1 0 +1
Cl +' Cl




0+0 +0 +
(M ^ (
000


O0n 0 U, -l .q -l 0
CO Cx Cl


+1 +1 +1 +1
0 C 'l '
00 00







C+ C+ +
+1 +1 +1 +1


m c 1l Cl


+1 +1 +1 +1











+1 +1 +1 +1
I n coI


cc :=l CO
i 006


+1

K
01




6


CC 0 0 0 0 O(=


+1 +1 +1

'00
o6 C6









+1 +1 +1
0 0 0a
6co 6






C1l


L- C1 C1C1l


dd aa ~ a
-.- -1
- ~ ~ ~ ~ ~ ~ ~ *8.OC~iY~ l ~
d~, kkk ddS S~ k
a" 9 ka k~ k~
a~ -9 a
~~o~d dd~
~ kk 9 ,k ~


k a
kr r.

cj k~r


In
0
+1

0









+1

0







Florida Entomologist 93(2)


16 -
Is
14 T
12
10

4-i


0 0


Host plant.


Fig. 1. Mean ( SD) parasitism percentage recorded
in 7 host fruit species ofA. fraterculus collected in Mis-
iones, NE Argentina.


ciated with A. fraterculus on native and exotic
host fruit species had been found in Argentina (5
Braconidae, 4 Figitidae, and 2 Diapriidae)
(Ovruski et al. 2005). In decades old studies, D.
areolatus, 0. bellus, and A. pelleranoi were the
only native parasitoid species recovered from A.
fraterculus in Misiones (Ogloblin 1937, Turica &
Mallo 1961).
The present detection ofAsobara anastrephae
represents the southernmost collection of this
species. It was previously reported in association
with Anastrepha spp. in Panama, Colombia, and
Brazil (Sao Paulo, Mato Grosso do Sul, Rio
Grande do Norte, Goias, and Amazonas states)
(Ovruski et al. 2000; Canal & Zucchi 2000; Souza
Filho et al. 2009). Previous to this study, Odon-
tosema anastrephae had only been recorded from
Anastrepha spp. in Brazil, Costa Rica, and Mexico
(Guimaraes et al. 2003). Possibly, 0. anastrephae
is widespread throughout the Neotropical Region
(Wharton et al. 1998).
This study also corroborates the permanent es-
tablishment of the exotic parasitoid species A. in-
dica on A. fraterculus in northeastern Argentina.
Previously, A. indica had only been recorded from
A. fraterculus pupae obtained from guava fruits
approximately 38 years after its first release in
Misiones (Ovruski et al. 2006). The specimens of
D. longicaudata recorded in this study had been
previously cited by Schliserman et al. (2003) and
their collection marks a new southern limit for
their distribution (26'50'S, 54o77'W). This exotic
opiine species also had been found at 23'06'S lat-
itude and 6424'W longitude in the NW Argentina
(Orono & Ovruski 2007).
Of all larval-pupal/prepupal parasitoids col-
lected, A. pelleranoi and D. areolatus were the
most abundant. This pattern has also been re-
ported in similar surveys carried out in NW Ar-
gentina (Ovruski et al. 2004, 2005) and in the
southern portion of NE Argentina (Ovruski &
Schliserman 2003; Ovruski et al. 2007). In all
those studies D. areolatus represented between


48 and 61% of the total number of specimens
identified, while the A. pelleranoi ranged between
14 and 28%. By contrast, in the present study
48% of 605 parasitoids recovered were A. pellera-
noi.
Both D. areolatus and A. pelleranoi frequently
have been recovered from several wild, exotic,
and native fruit species in Latin America (Aluja
1999; Sivinski et al. 2000; Ovruski et al. 2000;
Souza-Filho et al. 2009). In the present study the
only parasitoid species found in association with
large-sized, introduced fruit species, such as Cit-
rus paradisi and C. reticulata, was A. pelleranoi.
This information is consistent with data pub-
lished by Schliserman & Ovruski (2004) who col-
lected 2,820 C. aurantium fruits in NW Argentina
but recoveredA. pelleranoi as the only parasitoid.
Previous studies by Sivinski et al. (1997) in Mex-
ico and Ovruski et al. (2004) in Argentina showed
that A. pelleranoi mostly parasitized Anastrepha
larvae in fallen fruit by entering through fissures
in the fruit. Large fruits with a thick pericarp al-
lows A. pelleranoi to exploit a larval resource that
is unavailable to species such as D. areolatus,
which forages at canopy level (Garcia-Medel et al.
2007) and always oviposits by drilling through
the pericarp from the outside of the fruit (Sivinski
& Aluja 2003). Data reported in Table 3 corrobo-
rated the differences in the foraging patterns be-
tween the figitid A. pelleranoi and the opiines D.
areolatus and D. brasiliensis. In the cases of the
other parasitoid species identified in this study,
the total number of adults recovered were quite
low (Table 3), and no definitive conclusions can be
achieved. However, previous reports by Sivinski
et al. (1997), L6pez et al. (1999), and Garcia-
Medel et al. (2007) indicated that 0. anastrephae
preferentially attacks larvae in fallen fruit upon
the ground, U. anastrephae forages at canopy
level, and D. longicaudata can parasitized larvae
at ground level, and also in the canopy.
Two members of the family Myrtaceae,A. sell-
owiana and P guajaua, generated 87% of all par-
asitoid specimens recovered from A. fraterculus
pupae, and showed the highest diversity values.
Similar studies conducted in tropical and sub-
tropical forests of Mexico (L6pez et al. 1999; Siv-
inski et al. 2000), Brazil (Aguiar Menezes et al.
2001; Souza-Filho et al. 2009), NW Argentina
(Ovruski et al. 2004, 2005) and Bolivia (Ovruski
et al. 2009) highlighted the importance of wild or
"feral" Psidium species and other native Myrta-
ceae species as reservoirs for native Anastrepha
parasitoids. In general, Myrtaceae fruits have
several characteristics, such as thin pericarp, soft
endocarp, volatiles, color, and size that may favor
parasitoid success, either by increasing attrac-
tiveness to wasps or by establishing easier host
larva detection (Sivinski et al. 1997; Ovruski et
al. 2000). Our samples of C. xanthocarpa, how-
ever, suggest that not all myrtaceans are equally


June 2010


010







Schliserman et al.: Fruit Fly Parasitoids in NE Argentina


attractive. Our data point to the need for more
thorough monitoring of fruit fly host plants over
several years to assess seasonal and annual vari-
ation in impact of parasitoids upon natural popu-
lations of C. capitata and A. fraterculus in NE Ar-
gentina.

ACKNOWLEDGMENTS

We express our gratitude to German E. Tietjen
(INTA-EEA Montecarlo, Argentina) for valuable techni-
cal support. P. S. and S. O thank Martin Aluja (IN-
ECOL, A.C., Xalapa, Veracruz, M6xico) for sharing with
us his vast experience on ecology, biology, and ethology
of fruit fly parasitoids. We thank 2 anonymous review-
ers for helping us produce a better manuscript. Finan-
cial support was provided by the Consejo Nacional de
Investigaciones Cientificas y T6cnicas de la Republica
Argentina (CONICET) (Grant PIP Nos. 5129/05 and
112-200801-01353/2008) and Instituto Nacional de Tec-
nologia Agropecuaria-Estaci6n Experimental
Agropecuaria Montecarlo, Misiones, Argentina.


REFERENCES CITED

AGUIAR-MENEZES, E. L., MENEZES, E. B., SILVA, P. S.,
BITTAR, A. C., AND CASSINO, P. C. R. 2001. Native
Hymenoptera parasitoids associated with Anas-
trepha spp. (Diptera: Tephritidae) in Seropedica city,
Rio de Janeiro, Brazil. Florida Entomol. 84(84): 706-
711.
ALUJA, M. 1999. Fruit fly (Diptera: Tephritidae) re-
search in Latin America: myths, realities and
dreams. Anais Soc. Entomol. Brasil 28: 565-594.
ALUJA, M., RULL, J., SIVINSKI, J., NORRBOM, A. L.,
WHARTON, R., MACiAS-ORDONEZ, R., DiAZ-FLEIS-
CHER, F., AND LOPEZ, M. 2003. Fruit flies of the ge-
nus Anastrepha (Diptera: Tephritidae) and associat-
ed native parasitoids (Hymenoptera) in the tropical
rainforest biosphere reserve of Montes Azules, Chia-
pas, M6xico. Environ. Entomol. 32: 1377-1385.
ANONYMOUS. 1992. Atlas de la Republica Argentina. Ed-
itorial El Ateneo, Buenos Aires, Argentina.
CABRERA, A. 1976. Regions fitogeograficas argentinas.
Enciclopedia Agricultura y Jardineria. Ediciones
ACME, SACI, Buenos Aires, Argentina, 135 pp.
CANAL, N. A., AND ZUCCHI, R. A. 2000. Parasit6ides-
Braconidae, pp. 119-126 In A. Malavasi and R. A.
Zucchi [eds.], Moscas-das-frutas de Importancia
Econ6mica no Brasil. Conhecimento Basico e Aplica-
do. Holos Editora, Riberao Preto, Brasil.
GARCIA-MEDEL, D., SIVINSKI, J., DIAZ-FLEISCHER, F.,
RAMIREZ-ROMERO, R., AND ALUJA, M. 2007. Foraging
behavior by six fruit fly parasitoids (Hymenoptera:
Braconidae) released as single- or multiple-species
cohorts in field cages: influence of fruit location and
host density Biol. Control 43: 12-22.
GUILLEN, D, AND SANCHEZ, R. 2007. Expansion of the
national fruit fly control programme in Argentina,
pp. 653-660 In M. J. B. Vreysen, A. S. Robinson and J.
Hendrichs [eds.], Area-Wide Control of Insect Pests:
From Research To Field Implementation. Springer,
The Netherlands.
GUIMARAES, J. A., GALLARDO, F. E., DIAZ, N. B., AND
ZUCCHI, R. A. 2003. Eucoilinae species (Hy-
menoptera: Cynipoidea: Figitidae) parasitoids of


fruit-infesting dipterous larvae in Brazil: identity,
geographical distribution and host associations.
Zootaxa 278: 1-23.
LOPEZ, M., ALUJA, M., AND SIVINSKI, J. 1999. Hy-
menopterous larval-pupal and pupal parasitoids of
Anastrepha flies (Diptera: Tephritidae) in Mexico.
Biol. Control 15: 119-129.
MONTOYA P., LIEDO, P., BENREY, B., CANCINO, J., BAR-
RERA, J. F., SIVINSKI, J., AND ALUJA, M. 2000. Biolog-
ical Control of Anastrepha spp. (Diptera: Tephriti-
dae) in mango orchards through augmentative
releases of Diachasmimorpha longicaudata (Ash-
mead) (Hymenoptera: Braconidae). Biol. Control 18:
216-224.
NORRBOM, A. L. 2004. Host plant database for Anas-
trepha and Toxotrypana (Diptera: Tephritidae: Tox-
otrypani). Diptera Data Dissemination Disk 2, US-
DA-APHIS.
OGLOBLIN, A. 1937. La protecci6n de los enemigos natu-
rales de la mosca de la fruta (Anastrepha fratercu-
lus). Almanaque Min. Agric. 3: 177-179.
ORONO, L. E., AND OVRUSKI, S. M. 2007. Presence of Di-
achasmimorpha longicaudata (Hymenoptera: Bra-
conidae) in a guiad of parasitoids attacking Anas-
trepha fraterculus (Diptera: Tephritidae) in
northwestern Argentina. Florida Entomol. 90(2):
410-412.
OVRUSKI, S. M., AND SCHLISERMAN, P. 2003. Opiine and
eucoiline parasitoids (Hymenoptera: Braconidae,
Figitidae) of Anastrepha fraterculus (Diptera: Te-
phritidae) in the citrus orchard areas in Corrientes,
northeastern Argentina. Canadian Entomol. 135(6):
863-865.
OVRUSKI, S. M., SCHLISERMAN, P., AND ALUJA, M. 2004.
Indigenous parasitoids (Hymenoptera) attacking
Anastrepha fraterculus and Ceratitis capitata
(Diptera: Tephritidae) in native and exotic host
plants in Northwestern Argentina. Biol. Control 29:
43-57.
OVRUSKI, S. M., ALUJA, M., SIVINSKI, J., AND WHARTON,
R. A. 2000. Hymenopteran parasitoids on fruit-in-
festing tephritidae (Diptera) in Latin America and
the southern United States: diversity, distribution,
taxonomic status and their use in fruit fly biological
control. Int. Pest Management Reviews 5: 81-107.
OVRUSKI, S. M., WHARTON, R. A., SCHLISERMAN, P., AND
ALUJA, M. 2005. Abundance ofAnastrepha fratercu-
lus (Diptera: Tephritidae) and its associated native
parasitoids (Hymenoptera) in "feral" guavas growing
in the endangered northernmost Yungas forests of
Argentina with an update on the taxonomic status of
Opiine parasitoids previously reported in this coun-
try. Environ. Entomol. 34(4): 807-818.
OVRUSKI, S. M., SCHLISERMAN, P., DECOLL, O. R.,
PENALOZA, C., ORONO, L., AND COLIN, C. 2006. The
establishment of Aceratoneuromyia indica (Hy-
menoptera: Eulophidae) in three biogeographical re-
gions of Argentina. Florida Entomol. 89(2): 270-273.
OVRUSKI, S. M., SCHLISERMAN, P., ORONO, L. E.,
NirEZ-CAMPERO, S. R., ALBORNOZ-MEDINA, P.,
BEZDJIAN, L. P., AND VAN NIEUWENHOVE, G. A. 2008.
Natural occurrence of hymenopterous parasitoids
associated withAnastrepha fraterculus (Diptera: Te-
phritidae) in Myrtaceae species in Entre Rios,
Northeastern Argentina. Florida Entomol. 91(2):
220-227.
OVRUSKI, S. M., SCHLISERMAN, P., NUNEZ-CAMPERO, S. R.,
ORONO, L. E., BEZDJIAN, L. P., ALBORNOZ-MEDINA, P.,







Florida Entomologist 93(2)


AND VAN NIEUWENHOVE, G. A. 2009. A survey of hy-
menopterous larval-pupal parasitoids associated
with Anastrepha fraterculus and Ceratitis capitata
(Diptera: Tephritidae) infesting wild guava (Psidium
guajaua) and peach (Prunus persica) in the south-
ernmost section of the bolivian Yungas forest. Flori-
da Entomol. 92 (2): 269-275.
PUTRUELE, M. T. G. 1996. Hosts for Ceratitis capitata
and Anastrepha fraterculus in the Northeastern
province of Entre Rios, Argentina, pp. 343-345 In B.
A. McPheron and G. J. Steck. [eds.], Fruit Fly Pests:
A World Assessment of Their Biology and Manage-
ment. St. Lucie Press, Delray Beach, Florida.
SCHLISERMAN, P., OVRUSKI, S. M., AND DECOLL, 0. R.
2003. The recovery and permanent establishment of
Diachasmimorpha longicaudata (Hymenoptera:
Braconidae) in Misiones, northeastern Argentina.
Florida Entomol. 86(4): 491-492.
SCHLISERMAN, P., AND OVRUSKI, S. M. 2004. Incidencia
de moscas de la fruta de importancia econ6mica so-
bre Citrus aurantium (Rutaceae) en Tucuman, Ar-
gentina. Rev. Manejo Integr. Plagas y Agroecologia
(Costa Rica) 72: 52-61.
SEGURA, D. F., VERA, M. T., CAGNOTTI, C. L., VACCARO,
N., DECOLL, 0. R., OVRUSKI, S. M., AND CLADERA, J.
L. 2006. Relative abundance of Ceratitis capitata
andAnastrepha fraterculus (Diptera: Tephritidae) in
diverse host species and localities of Argentina. Ann.
Entomol. Soc. America 99(1): 70-83.
SIVINSKI, J., AND M. ALUJA. 2003. The evolution of ovi-
positor length in the parasitic Hymenoptera and the
search for predictability in biological control. Florida
Emtomol. 86(2): 143-150.
SIVINSKI, J., ALUJA, M., AND LOPEZ, M. 1997. The spa-
tial and temporal distributions of parasitoids of
Mexican Anastrepha species (Diptera: Tephritidae)


within the canopies of fruit trees. Ann. Entomol. Soc.
America 90: 604-618.
SIVINSKI, J., PINERO, J., AND ALUJA, M. 2000. The distri-
butions of parasitoids (Hymenoptera) of Anastrepha
fruit flies (Diptera: Tephritidae) along an altitudinal
gradient in Veracruz, Mexico. Biol. Control 18: 258-
269.
SOUZA-FILHO, M. F., RAGA, A., AZEVEDO-FILHO, J. A.,
STRIKIS, P. C., GUIMARAES, J. A., AND ZUCCHI, R. A.
2009. Diversity and seasonality of fruit flies
(Diptera: Tephritidae and Lonchaeidae) and their
parasitoids (Hymenoptera: Braconidae and Figiti-
dae) in orchards of guava, loquat and peach. Brazil-
ian J. Biol. 69(1): 31-40.
TURICA, A., AND MALLO, R. G. 1961. Observaciones so-
bre la poblaci6n de las "Tephritidae" y sus en-
doparasitos en algunas regions citricolas argentin-
as. Rev. IDIA (Argentina), Supl. 6: 145-161.
WHARTON, R. A. 1997. Generic relationships of opiine
braconidae (Hymenoptera) parasitic on fruit-infest-
ing Tephritidae (Diptera). Contributions American
Entomol. Institute 30: 1-53.
WHARTON, R. A., OVRUSKI, S. M., AND GILSTRAP, F. E.
1998. Neotropical Eucoilidae (Cynipoidea) associat-
ed with fruit infesting Tephritidae, with new records
from Argentina, Bolivia and Costa Rica. J. Hym. Res.
7: 102-115.
WHITE, I. M., AND ELSON-HARRIS, M. M. 1992. Fruit
Flies Of Economic Significance: Their Identification
And Bionomics. CAB international, ACIAR, Red-
wood Press Ltd., Melksham, UK, 601 pp.
ZUCCHI, R. A. 2000. Taxonomia. pp. 13-24 In A. Mala-
vasi and R. A. Zucchi [eds.], Moscas-das-frutas de
Importancia Econ6mica no Brasil: Conhecimento
Basico e Aplicado. Holos Editora, Riberao Preto,
Brasil.


June 2010









Gill et al.: Mulch as a Potential Management Strategy for Lesser Cornstalk Borer 183



MULCH AS A POTENTIAL MANAGEMENT STRATEGY FOR LESSER
CORNSTALK BORER, ELASMOPALPUS LIGNOSELLUS (INSECTA:
LEPIDOPTERA: PYRALIDAE), IN BUSH BEAN (PHASEOLUS VULGARIS)

HARSIMRAN K. GILL', ROBERT MCSORLEY', GAURAV GOYAL AND SUSAN E. WEBB1
'Entomology and Nematology Department, University of Florida, Gainesville, FL 32611-0620
E-mail: simgill@ufl.edu


2Everglades Research and Education Center, University of Florida, Belle Glade, FL 33430


ABSTRACT

Lesser cornstalk borer (LCB), Elasmopalpus lignosellus (Zeller), is a serious pest of bean
(Phaseolus vulgaris L.) and many other crops. The effect of mulching as a management
method for LCB was examined in 2 field experiments conducted in small plots (1 m2) at 2 dif-
ferent locations (experiments A and B) in Alachua Co., FL. Both experiments were conducted
in the summer and repeated in the fall, 2007. The treatments were arranged in a random-
ized complete block design with 5 replications at both locations. In experiment A, treatments
were bare ground, plots with mulch, and plots with weeds (original weed cover); while in ex-
periment B, treatments were bare ground and mulched plots. The mulch was obtained from
a crop of sunn hemp (Crotalaria juncea L.) planted at another location. Data were collected
on bean plant mortality, plant growth parameters (fresh weight, height, and length includ-
ing roots of surviving plants), and population levels of potential predators. LCB attack was
less (P s 0.10) in mulched plots compared with bare ground, considering a number of factors
such as location and background of field, season, and amount of precipitation. Greater num-
bers of surviving plants were found in mulched plots compared with bare ground and weedy
plots. In general, fresh weight, height, and total length of bean plants were greater in
mulched plots compared with other plots. Treatments did not affect numbers of potential
predators of LCB. Evidence suggests that LCB attack is reduced by mulches or weeds
around host plants.

Key Words: cultural control, Crotalaria juncea, plant mortality, non- target insects, plant
disease, sunn hemp

RESUME

El barrenador menor del tallo de maiz (BMT), Elasmopalpus lignosellus (Zeller), es una
plaga seria de frijol (Phaseolus vulgaris L.) y muchos otros cultivos. El efecto de poner man-
tillo como un metodo de manejo para el BMT fue examinado en 2 experiments de campo que
se realizaron en parcelas pequenas (1 m2) en dos localidades diferentes experimentss A y B)
en el condado de Alachua, Florida. Se realizaron ambos experiments en el verano y fueron
repetidos en el otono de 2007. Los tratamientos fueron arreglados en un diseho de bloques
completamente aleatorizados con 5 replicaciones en ambas localidades. En experiment A,
los tratamientos fueron tierra desnuda (sin vegetaci6n), parcelas con mantillo, y parcelas
con malezas (la cobertura de malezas original); mientras en experiment B, los tratamientos
fueron tierra desnuda y parcelas con mantillo. El mantillo se consegui6 de un cultivo de
"sunn hemp" (Crotalaria juncea L.) sembrado en otra localidad. Se recolectaron datos sobre
la mortalidad de las plants de frijol, los parametros de crecimiento de la plant (peso fresco,
altura y longitud incluyendo las raices de plants que sobrevivieron), y niveles de la pobla-
ci6n de depredadores potenciales. El ataque de BMT fue menor (P s 0.10) en parcelas con
mantillo en comparaci6n con la tierra desnuda, considerando un numero de factors como la
localidad e historic del campo, la estaci6n y la cantidad de precipitaci6n. Se encontr6 un nu-
mero mayor de plants sobrevivientes en parcelas con mantillo comparado con las parecelas
de tierra desnuda y con malezas. Por lo general, el peso fresco, la altura, y la longitud total
de las plants de frijol fueron mayor en parcelas con mantillo comparados con otras parcelas.
Los tratamientos no afectaron el numero de depredadores potenciales de BMT. La evidencia
indica que el ataque de BMT es reducido por el mantillo o malezas alrededor de las plants
hospederas.


Lesser cornstalk borer (LCB), Elasmopalpus table crops, and field crops (Funderburk et al.
lignosellus (Zeller), is a polyphagous pest with a 1985). Larvae burrow into the stalk base near the
wide range of host plants including weeds, vege- soil surface, damaging vascular tissues resulting







Florida Entomologist 93(2)


in "deadheart" symptoms and allowing pathogens
to enter the plant (Smith & Ota 2002). The larval
stage tunnels within stems and roots. Wilting is
the first sign of an infestation in affected plants,
followed by stunting, plant deformities, and a
thin crop stand (Gill et al. 2009).
Cultural control practices, including the use of
cover crops and mulches, are environmentally
safe methods for managing some specific insect
pests (Prasifka et al. 2006; Schmidt et al. 2007;
Teasdale et al. 2004; Tremelling et al. 2002), and
may be applicable against LCB. Organic mulches
may be derived from hay, straw, crop residues,
pine needles, shredded bark, or other plant mate-
rial that is readily available. Mulching is an effec-
tive way to provide shelter for predatory insects
and to control weeds (Brown & Tworkoski 2004).
Mulches help to maintain soil moisture required
for plant vigor and to promote tolerance in plants
to attack of insect pests (Johnson et al. 2004).
Previous experiments showed that early plant-
ing in Alabama effectively reduced LCB popula-
tions in both conventionally and reduced-tillage
peanuts (Arachis hypogaea L.), but the tillage
systems did not effect population levels of LCB
and predators including carabids, elaterids, and
labidurids in pitfall traps (Mack & Backman
1990). In Alabama, a diverse fauna of predatory
arthropods was captured in pitfall traps and
numbers of arthropods increased throughout the
peanut growing season (Kharboutli & Mack
1991). Fungi, predators, and other factors af-
fected LCB mortality in a commercial peanut ex-
periment in Texas (Smith & Johnson 1989). Mor-
tality-density relationships revealed that mortal-
ity of LCB was density independent, in terms of
initial egg density (Smith & Johnson 1989).
The objectives of the current study were to: (1)
evaluate the effect of mulch on LCB incidence, (2)
examine the effect of mulch on plant mortality
and plant growth parameters including fresh
weight, plant height, and total length, and (3) de-
termine the effect of mulch on non-target organ-
isms. Mulch was obtained from a cover crop of
sunn hemp (Crotalaria juncea L.) that was cut
and dried before application. Sunn hemp is a
tropical legume that is being grown as a nitrogen-
rich cover crop. It is an excellent choice as a sum-
mer cover crop in Florida (Treadwell & Alligood
2008) and was readily available for this study.

MATERIALS AND METHODS

Field experiments were conducted in small
plots at 2 different locations, the Experimental
Design Field Teaching Laboratories (Experiment
A) and Plant and Soil Sciences Field Teaching
Laboratories (Experiment B), both on the Univer-
sity of Florida, campus in Gainesville, FL (lat.
29'39'N and long. 8222'). Experiments were con-
ducted in the summer and repeated in the fall,


2007 (4 tests total). The soil was Millhopper sand
(loamy, siliceous, hyperthermic, Grossarenic
Paleudult, with 92% sand, 3% silt, and 5% clay,
and low (<2%) organic matter). Vegetable crops
were planted during the previous year in these
sites, which had a history of LCB problems.

Experiment A

Summer 2007

The experiment area was 44 m x 19 m. Plots of
1m2 area (Im x Im) were demarcated within this
total field area. Prior to treatment establishment,
the field was relatively weedy in early summer
2007. The most abundant weeds present were
eveningprimrose (Oenothera laciniata Hill), Flor-
ida pusley (Richardia scabra L.), and purple nut-
sedge (Cyperus rotundus L.). Other less common
weeds were clover (Trifolium spp.), crabgrass
(Digitaria sanguinalis (L.) Scop.), cudweed
(Gnaphalium purpureum L.), goosegrass
(Eleusine indica Gaertn), nightshade (Solanum
spp.), purslane (Portulaca oleracea L.), and toad-
flax (Linaria canadensis (L.) Dumont). Plots were
prepared on Jun 10 by removing weeds, hoeing to
break soil clods and debris, and irrigating to have
optimal soil moisture for planting. Three treat-
ments were compared: bare ground (with all
weeds removed), mulch (plot area was first
cleaned by removing weeds), and weeds (original
weed cover maintained). Treatments were ar-
ranged in a randomized complete block design
with 5 replications (total of 15 plots). 'Roma II'
bush beans (Phaseolus vulgaris L.) were planted
on Jun 12 in 3 rows 15 cm apart and 70 cm long at
a rate of 20 seeds per row and at a soil depth of 2
cm. Bean emergence was observed on Jun 19. A
mulch of sunn hemp hay, 3 cm thick (2.8 kg total
weight/plot), was applied manually (on the same
day that plants emerged) in between rows of
beans and surrounding bean plants in the mulch
plots only. The mulch was obtained from a crop of
'Tropic Sun' sunn hemp planted at another loca-
tion on May 8 and harvested on Jun 12 by clipping
plants at the base, and air-drying the clippings for
1 week. Mulch was a composite of leaves and
stems. Plots were irrigated as needed, and weeds
were removed from time to time to maintain bare
ground and mulch treatment plots free of weeds.

Fall 2007

The test was repeated at the same site in the
following fall season, with all the same treat-
ments. Experimental procedure remained the
same as that of the summer season, with a few
minor changes. Beans were planted 1-m2in plots
on Sep 10 in 3 rows 15 cm apart at a rate of 35
seeds per row (higher seedling rate than summer
test) with row length of 70 cm. Sunn hemp mulch


June 2010







Gill et al.: Mulch as a Potential Management Strategy for Lesser Cornstalk Borer 185


was harvested on Sep 13 and bean emergence
started on Sep 14. Sunn hemp hay was applied 3
cm thick (2.8 kg total weight/plot) on the same
day of plant emergence.

Data Collection

Bean mortality was recorded throughout both
the seasons by counting numbers of dead bean
plants/plot due to "deadheart" symptoms. Dead
bean plants were removed, brought back to the
laboratory, and stems dissected. The plants were
examined for presence or symptoms of LCB lar-
vae as well as the presence of pathogens. At the
end of both seasons, 5 of the remaining surviving
plants were removed, and average fresh weight,
above ground plant height, and total length
(height of plant plus root length) were measured.
Bean yields were not recorded due to the high
percentage of dead plants. Insects were collected
with pitfall traps on Jun 25 for the summer sea-
son and Sep 18 for the fall season. A plastic sand-
wich container (14 cm x 14 cm x 4 cm) was used as
a pitfall trap (Borror et al. 1989). One pitfall trap
was placed in the middle of the plot, and buried so
that the upper edge was flush with soil surface.
The traps were filled three quarters with water,
along with 3 to 4 drops of dish detergent (Ultra
Joy, Procter & Gamble, Cincinnati, OH) to
break surface tension, ensuring that the insects
would remain in the trap. Pitfall traps were set
out in the morning and collected before noon the
next day (which was recorded as sampling date).
The traps were brought to the laboratory, kept in
a cold room at 10C, and contents transferred and
stored in 70% ethanol in vials. Insects were iden-
tified to order and family levels with the aid of a
dissecting microscope.


Experiment B

Summer 2007


Unlike experiment A, this site had been roto-
tilled in early Jun 2007 and was free of weeds.
Plots of 1m2 area (Im x Im) were established on
Jun 20, and soil was prepared for planting by
hand with a hoe and irrigated to have optimal soil
moisture for seed germination. Two treatments
were compared: bare ground and mulch. The
treatments were arranged in a randomized com-
plete block design with 5 replications (total of 10
plots).'Roma II' bush beans were planted on Jun
22 in 3 rows 15 cm apart at a rate of 40 seeds per
row at a soil depth of 2 cm. Bean emergence was
observed on Jun 26. Sunn hemp harvested on Jun
12 was air-dried and applied on Jun 29 to form a
mulch 3 cm deep (2.0 kg total weight/plot) using
similar protocol as described for experiment A.
Hay was placed between rows of beans plants and
surrounding the beans plants in mulch plots only.


Weeds were removed as needed to maintain bare
ground and mulch treatments free of weeds.

Fall 2007

The test was repeated at the same site in the
following fall season, with the same 2 treatments.
The experimental procedure remained the same
as in summer, with some minor changes. Beans
were planted on Sep 19 in 3 rows 15 cm apart at
a rate of 35 seeds per row with row length of 70
cm. Sunn hemp mulch was harvested on Sep 13
and bean emergence was observed on Sep 23. A
layer of sunn hemp hay 3 cm deep (2.0 kg total
weight/plot) was applied on the same day of bean
emergence in the mulch plots.

Data Collection

Insects were collected on Jul 19 for summer
and Oct 16 for the fall season. Procedures for in-
sect trapping and for data collection on plant mor-
tality and plant parameters remained the same
as in Experiment A.

Data Analysis

For each data set, data were subjected to one-
way analysis of variance (ANOVA) with the Sta-
tistical Analysis System (version 9.1; SAS Insti-
tute, Cary, NC). For Experiment A, treatment
means were separated by the least significant dif-
ference (LSD) range test, when analysis of vari-
ance showed a significant treatment effect (P <
0.10).

RESULTS


Experiment A

Summer 2007


Plant mortality did not differ between bare
ground and mulched plots (Table 1). Dead plants
in this experiment showed typical symptoms
caused by LCB which included "deadheart",
silken webbing, and plant wilting. Dead plants
were removed and examined for the presence of
LCB and other pathogens. Of the plants removed
and examined in the laboratory, all showed these
typical symptoms and most had feeding damage
to the stems from LCB. Many contained LCB
within the stem. At the end of the experiment,
more plants survived in mulched plots than in
weedy plots (Table 1). No significant difference
was observed in plant weight among treatments,
although plant height and length (height + root
length) were significantly greater in mulched and
weedy treatments compared with the bare
ground (Table 2).







Florida Entomologist 93(2)


TABLE 1. NUMBER OF DEAD BEAN PLANTS/PLOT COLLECTED ON SELECTED SAMPLING DATES FOR EXPERIMENT A, SUMMER.

Days after bean emergence1

Treatment 10 21 24 30 Total Mortality Surviving Plants

Bare 10.00 a 0.71 6.20 a 3.65 5.60 a 2.25 3.20 b 1.39 28.00 a 7.78 11.00 ab 2.59
Mulch 7.00 ab 0.84 2.80 a 1.50 4.80 a 0.80 8.20 a 1.77 24.00 a 1.64 18.80 a 3.65
Weed 6.20 b 1.50 5.80 a 2.13 5.80 a 1.91 6.40 ab 0.93 26.00 a 4.05 4.80 b 1.39
ANOVA2:
F value 3.50 0.51 0.09 3.24 0.15 6.72
df 2,12 2,12 2,12 2,12 2,12 2,12
P value 0.0635 0.6102 0.9146 0.0750 0.8618 0.011

Days after bean emergence = number of days after bean plants emerged. Surviving plants measured at end of experiment.
'Statistics from analysis of variance (ANOVA).
Data are means + standard error of 5 replications.
Means followed by the same letters do not differ significantly based on LSD test (P s 0.10).


Major groups of predatory arthropods found in
pitfall traps in both summer and fall of 2007 in
this experiment were Carabidae (1.93 0.6/plot),
Formicidae (21.6 13.69/plot), Araneae (1.26 +
0.53/plot), and Staphylinidae (0.1 0.1/plot) but
all were unaffected by treatment. The most com-
mon non-predators were Dolichopodidae, Collem-
bola, and Cicadellidae (data not shown). No sig-
nificant differences with treatment were observed
in numbers of these different kinds of insects.

Fall 2007

Plant mortality was higher in the bare ground
treatment compared with other treatments to-
ward the middle of the experiment, but at the end
of the experiment, total mortality and number of
surviving plants remained the same in all treat-
ments (Table 3). Unlike in the summer, dead
plants had rotten roots and therefore were exam-
ined in the laboratory for the presence of patho-
gens. In most cases, plant mortality was caused
by Rhizoctonia fungus. Plant weight and plant
length were greatest in the mulched treatment
(Table 2). As in the summer experiment, no differ-
ences among treatments were found in any of the
arthropod groups caught in pitfall traps (data not
shown).

Experiment B


Summer 2007


Greater plant mortality in the bare ground
treatment than in the mulch treatment (P < 0.10)
was observed on every sampling date (Table 4).
The main cause of mortality was LCB, and plants
showing symptoms of LCB attack were isolated
from all plots. At the end of the experiment,
higher numbers of surviving plants were present
in mulched plots than in the bare ground. Among


these surviving plants, no significant differences
were found in weight or height, but a slight in-
crease in length was observed in mulched plots
(Table 2).
Major groups of predatory arthropods found in
pitfall traps in both summer and fall of 2007 were
Carabidae (0.6 0.4/plot) and Formicidae (65.6
12.48/plot). The most common non-predators
were Dolichopodidae, Collembola, and Cicadel-
lidae (data not shown). The only significant differ-
ences between treatments were observed among
Dolichopodidae (42.8 12.94 in bare and 15.6
5.78 in mulch plots) in summer and Collembola in
both summer (55.20 16.52 in bare and 299.0
155.9 in mulch plots) and fall (32.40 11.82 in
bare and 126.0 30.22 in mulch plots) seasons.

Fall 2007

No difference in plant mortality was found be-
tween treatments except that higher plant mor-
tality was observed in bare ground plots on the
last sampling date (Table 5). Total mortality and
number of surviving plants remained same in
both treatments. In fall, plant mortality was
mainly caused by attack from fungal pathogens
rather than from LCB as in the summer season.
Plant weight, height, and length were signifi-
cantly higher in the mulched treatment compared
with the bare ground treatment (Table 2).


DISCUSSION


During the fall season, the major cause of
plant mortality was the fungal pathogen Rhizoc-
tonia spp. in both experiments A and B. The
amount of rainfall was higher in the fall season
compared with the summer season. Total rainfall
in Jun between planting and emergence was 0.69
cm in experiment A and 1.65 cm in experiment B,
while corresponding levels in Sep were 2.49 cm in


June 2010







Gill et al.: Mulch as a Potential Management Strategy for Lesser Cornstalk Borer 187



TABLE 2. WEIGHT, HEIGHT, AND LENGTH OF SURVIVING PLANTS IN EXPERIMENTS A AND B, SUMMER AND FALL.

Plant parameters

Treatment Weight (g/plant) Height (cm) Length (cm)

Experiment A, summer


3.73 a 1.30
6.84 a 1.02
3.51 a 0.97


12.08 b 3.85
30.76 a 2.73
26.92 a 4.37


7.05
2,12
0.0094


Experiment A, fall


8.44 b 0.63
11.63 a 1.12
8.58 b 1.10


3.41
2,12
0.0670


10.91 a 0.50
11.51 a 0.55
9.59 a 1.13


1.58
2,12
0.2467


Bare
Mulch
Weed
ANOVA':
F value
df
P value


Bare
Mulch
Weed
ANOVA':
F value
df
P value


Bare
Mulch
ANOVA':
F value
df
P value


Bare
Mulch
ANOVA':
F value
df
P value


5.47 1.06
10.78 2.97


18.81 1.75
27.39 5.14


2.49
1,8
0.1529


20.96 b 4.97
40.20 a 3.26
36.72 a 3.86


6.28
2,12
0.0136


45.97 b 1.86
56.57 a 1.77
50.66 ab 2.61


6.32
2,12
0.0134


30.38 1.40
40.87 5.08


3.97
1,8
0.0815


Experiment B, fall


5.75 0.43
10.42 0.97


19.45
1,8
0.0023


9.29 0.56
11.62 0.74


1,8
0.0367


31.69 1.26
44.08 1.35

45.01
1,8
0.0002


'Statistics from analysis of variance (ANOVA).
Data are means + standard error of 5 replications.
Means followed by the same letters do not differ significantly based on LSD test (P s 0.10).


experiment A and 5.72 cm in experiment B (Anon-
ymous 2010). The higher rainfall in fall may have
led to higher soil moisture and the increased
growth of fungi, resulting in root rot and ulti-
mately bean plant mortality. LCB attack has been
reported to be less severe under moist conditions
(Biddle et al. 1992; Nuessly & Webb 2006). Dur-
ing the summer season in both experiments,
plant mortality was due to attack of LCB. This in-
sect has been considered a dryland insect, and
typically survives well in dry, hot conditions and
in sandy soils (Luginbill & Ainslie 1917).
In experiment B, consistently greater plant mor-
tality due to LCB was observed in bare ground plots
than in mulch plots throughout the season. Many


predators of LCB found in other studies (Kharboulti
& Mack 1991; Mack & Backman 1990; Smith &
Johnson 1989) including carabids, ants, spiders,
and staphylinids, were also recovered in the current
experiments. However, there was no evidence that
LCB was reduced by predation in the mulch plots
because similar numbers of predatory insects were
collected in both treatments. Differences may have
resulted from the ability of LCB adults to find and
oviposit on host plants in areas with differing crop
backgrounds (mulch vs. bare). The resource concen-
tration hypothesis argues that the presence of di-
verse flora negatively affects the ability of insect
pests to find and utilize host plants (Root 1973;
Dent 2000; Smith & McSorley 2000). Incidence of


2,12
0.0989


Experiment B, summer


2.84
1,8
0.1304







Florida Entomologist 93(2)


June 2010


TABLE 3. NUMBER OF DEAD BEAN PLANTS/PLOT COLLECTED ON SELECTED SAMPLING DATES FOR EXPERIMENT A, FALL.

Days after bean emergence1

Treatment 11 18 22 32 Total Mortality Surviving Plants

Bare 2.60 a 0.93 6.40 a 1.03 3.60 a 0.68 4.80 a 0.97 32.80 a 8.84 48.00 a 8.38
Mulch 1.20 a 0.80 3.20 b 0.66 1.20 b 0.37 3.80 a 2.24 17.40 a 5.04 62.40 a 4.48
Weed 4.00 a 0.89 2.00 b 0.84 1.20 b 0.58 2.00 a 0.84 16.00 a 2.30 55.60 a 5.82
ANOVA2:
F value 2.56 7.05 6.13 0.89 2.40 1.25
df 2,12 2,12 2,12 2,12 2,12 2,12
P value 0.1189 0.0094 0.0147 0.4358 0.1332 0.3201

Days after bean emergence = number of days after bean plants emerged. Surviving plants measured at end of experiment.
'Statistics from analysis of variance (ANOVA).
Data are means + standard error of 5 replications.
Means followed by the same letters do not differ significantly based on LSD test (P s 0.05).


TABLE 4. NUMBER OF DEAD BEAN PLANTS/PLOT COLLECTED ON SELECTED SAMPLING DATES FOR EXPERIMENT B, SUMMER.

Days after bean emergence'

Treatment 15 18 23 31 Total Mortality Surviving Plants

Bare 19.40 2.62 10.40 2.27 6.20 0.73 11.20 4.15 63.20 6.76 6.20 2.20
Mulch 11.60+ 2.98 4.00 0.84 2.20 0.86 2.40 1.50 41.80+ 6.79 23.60 6.46
ANOVA2:
F value 3.87 6.99 12.50 3.97 4.99 6.50
df 1,8 1,8 1,8 1,8 1,8 1,8
P value 0.0847 0.0295 0.0077 0.0814 0.0560 0.0342

'Days after bean emergence = number of days after bean plants emerged. Surviving plants measured at end of experiment.
Statistics from analysis of variance (ANOVA).
Data are means + standard error of 5 replications.


TABLE 5. NUMBER OF DEAD BEAN PLANTS/PLOT COLLECTED ON SELECTED SAMPLING DATES FOR EXPERIMENT B, FALL.

Days after bean emergence'

Treatment 13 18 23 31 Total Mortality Surviving Plants

Bare 1.40+ 0.51 1.80 1.36 0.20 0.2 2.80+ 1.16 18.20 2.67 29.60 9.54
Mulch 1.80 0.92 1.20 0.49 0.00 0.0 0.00 0.0 14.60 2.29 27.20 7.00
ANOVA2:
F value 0.15 0.17 1.00 5.85 1.05 0.04
df 1,8 1,8 1,8 1,8 1,8 1,8
P value 0.7128 0.6883 0.3466 0.0419 0.3365 0.8443

'Days after bean emergence = number of days after bean plants emerged. Surviving plants measured at end of experiment.
Statistics from analysis of variance (ANOVA).
Data are means + standard error of 5 replications.


LCB attack was higher in the bare ground treat-
ment than in the mulched treatment, possibly be-
cause insects may have difficulty in recognizing
host plants as compared with easy recognition of
host plants in bare plots. Smith (1976) reported in-
creased attraction of the cabbage aphid, Brevicoryne


brassicae (L.), by visual recognition of a sparsely
planted crop that stood out against bare ground.
In contrast, no difference was found between
mulch and bare plots in experiment A. The differ-
ences in effect of mulch on LCB attack at these 2
experiment locations may be due to the different







Gill et al.: Mulch as a Potential Management Strategy for Lesser Cornstalk Borer 189


location and background of the experiments. Ex-
periment A had a high, dense background popula-
tion level of weeds, especially Florida pusley and
evening primrose, while experiment B was free
from weeds. In fact, the small plots in experiment
A were established by removing these weeds from
the plots themselves, but weeds remained on the
borders of all plots. Because of the small size of
the plots, the border area and landscape around
the plots may have had a major influence on an
actively mobile pest like LCB. It is possible that
weeds could serve as alternate hosts and divert
LCB from attack on the bean plants. However,
Florida pusley and evening primrose are not
known hosts of LCB (Gardner & All 1982; Gill et
al. 2009; Isely & Miner 1994). Furthermore, inci-
dence of attack by LCB on bean plants was very
high at both locations, although differences
among treatments were not noted in experiment
A. The weedy background of experiment A may
have affected the ability of insects to recognize
host plants within the small plots at this site. In
contrast, the small plots at experiment B stood
out easily in a bare landscape, except when young
plants were obscured with mulch, which may
have led to higher attack of LCB in experiment B
during the summer season. This observation of
differential LCB attack in experiments A and B
may be additional evidence for the ability of this
insect to locate host plants when host resources
are concentrated. While visual cues may be in-
volved, the presence of weeds may offer olfactory
interference as well. Further research is needed
to determine the cues used by female moths to
find and oviposit on host plants.
In the current study, sunn hemp mulch was
found to be effective in managing LCB popula-
tions while considering a number of factors such
as background of field, treatment, and season.
Mulch was helpful in managing LCB when plots
stood out against a bare background, but was in-
effective when weeds surrounded the plots. Inci-
dence of LCB attack on host plants was severe in
experiments starting in Jun, but was absent in
experiments beginning in Sep, when Rhizoctonia
fungus was the major mortality factor.

ACKNOWLEDGMENTS

This paper is submitted in partial fulfillment of the
requirements for the Ph.D. degree of the senior author.
The authors thank Marc Branham and Danielle Tread-
well of the University of Florida for reviewing and im-
proving an earlier version of the manuscript. The
authors thank Simon Poon and Namgay Om for assis-
tance in the field.

REFERENCES CITED

ANONYMOUS. 2010. Florida Automated Weather Net-
work. University of Florida, Gainesville, FL. (http://
fawn.ifas. ufl.edu)


BIDDLE, A. J., HUTCHINS, S. H., AND WIGHTMAN, J. A.
1992. Pests living below ground, Lesser cornstalk
borer: Elasmopalpus lignosellus, pp. 202-203 In R.
G. McKinley [ed.], Vegetable Crop Pests. CRC Press,
Inc. Boca Raton, FL.
BORROR, D. J., TRIPLEHORN, C. A., AND JOHNSON, N. F.
1989. An Introduction to the Study of Insects, pp.
751-753, 6th ed., Saunders College Publishing, Chica-
go, IL.
BROWN, M. W., AND TWORKOSKI, T. 2004. Pest manage-
ment benefits of compost mulch in apple orchards.
Agric. Ecosyst. Environ. 103: 465-472.
DENT, D. 2000. Cultural and interference methods, pp
235-266 In Insect Pest Management 2nd edition. CA-
BI publishing, Cambridge, MA.
FUNDERBURK, J. E., HERZOG, D. C., MACK, T. P., AND
LYNCH, R. E. 1985. Sampling lesser cornstalk borer
(Lepidoptera: Pyralidae) adults in several crops with
reference to adult dispersion patterns. Environ. En-
tomol. 14: 452-458.
GARDNER, W. A., AND ALL, J. N. 1982. Chemical control
of the lesser cornstalk borer in grain sorghum. J.
Georgia Entomol. Soc. 17: 167-171.
GILL, H. K., CAPINERA, J. L., AND MCSORLEY, R. 2009.
Lesser Cornstalk Borer, Elasmopalpus lignosellus
(Zeller) (Insecta: Lepidoptera: Pyralidae). EENY-
155, Entomology & Nematology Department, Uni-
versity of Florida, Gainesville, FL. (http://edis.if-
as.ufl.edu/IN312)
ISELY, D., AND MINER, F. D. 1994. The lesser cornstalk
borer, a pest of fall beans. J Kansas Entomol Soc. 17:
51-57.
JOHNSON, J. M., HOUGH-GOLDSTEIN, J. A., AND VANGES-
SEL, M. J. 2004. Effects of straw mulch on pest in-
sects, predators, and weeds in watermelons and po-
tatoes. Environ. Entomol. 33: 1632-1643.
KHARBOULTI, M. S., AND MACK, T. P. 1991. Relative and
seasonal abundance of predaceous arthropods in Al-
abama peanut fields as indexed by pitfall traps. J.
Econ. Entomol. 84: 1015-1023.
LUGINBILL, P., AND AINSLIE, G. F. 1917. The Lesser
Cornstalk Borer. U.S. Dept. Agric. Bull. No. 529:1-27.
MACK, T. P., AND BACKMAN, C. B. 1990. Effect of two
planting dates and three tillage systems on the
abundance of Lesser cornstalk borer (Lepidoptera:
Pyralidae), other selected insects, and yield in pea-
nut fields. J. Econ. Entomol. 83: 1034-1041.
NUESSLY, G. S., AND WEBB, S. E. 2006. Insect Manage-
ment for Sweet Corn. ENY-472 (IG158), Entomolo-
gy & Nematology Department, University of Flori-
da, Gainesville, FL. (http://edis.ifas.ufl.edu/IG158)
PRASIFKA, J. R., SCHMIDT, N. P., KOHLER, K. A., O'NEAL,
M. E., HELLMICH, R. L., AND SINGER, J. W. 2006. Ef-
fects of living mulches on predator abundance and
sentinel prey on a corn-soybean-forage rotation. Pest
Manag. 35: 1423-1431.
ROOT, R. 1973. Organization of a plant-arthropod asso-
ciation in simple and diverse habitats. The fauna of
collards (Brassica oleracea). Ecol. Monogr. 34: 95-
124.
SCHMIDT, N. P., O'NEAL, M. E., AND SINGER, J. W. 2007.
Alfalfa living mulch advances biological control of
soybean aphid. Environ. Entomol. 36: 416-424.
SMITH, H. A., AND MCSORLEY, R. 2000. Intercropping
and pest management: A review of major concepts.
American Entomol. 46: 154-161.
SMITH, H. A., AND OTA, A. K. 2002. An overview of the
lesser cornstalk borer management program at







Florida Entomologist 93(2)


HARC-HSPA, 1986-2002. Hawaii Agric. Res. Center,
Pahala, HI. (http://www.harc-hspa.com/EntRl.htm/)
SMITH, J. G. 1976. Influence of crop background on
aphids and other phytophagous insects on Brussels
sprouts. Ann. Appl. Biol. 83: 1-13.
SMITH, J. W., AND JOHNSON, S. J. 1989. Natural mortal-
ity of the Lesser cornstalk borer (Lepidoptera: Pyral-
idae) in a peanut agroecosystem. Environ. Entomol.
18: 69-77.
TEASDALE, J. R., ABDUL-BAKI, A. A., MILL, D. J., AND
THORPE, K. W. 2004. Enhanced pest management
with cover crop mulches. Acta Hort. 638: 135-140.


TREADWELL, D. D., AND ALLIGOOD, M. 2008. Sunn
Hemp (Crotalaria juncea L.): A Summer Cover Crop
for Florida Vegetable Producers. HS 1126, Horticul-
tural Sciences Department, University of Florida,
Gainesville, FL. (http://edis.ifas.ufl.edu/pdffiles/HS/
HS37600.pdf)
TREMELLING, M. J., MCSORLEY, R., AND GALLAHER, R.
N. 2002. Effect of winter cover crops on soil surface
invertebrate community. Soil Crop Sci. Soc. Florida
Proc. 62: 77- 82.


June 2010







Meagher & Nagoshi: Fall Armyworm Spermatophores


IDENTIFICATION OF FALL ARMYWORM (LEPIDOPTERA: NOCTUIDAE)
HOST STRAINS BASED ON MALE-DERIVED SPERMATOPHORES

ROBERT L. MEAGHER AND RODNEY N. NAGOSHI
Center for Medical, Agricultural and Veterinary Entomology, USDA-ARS, Gainesville, FL 32608


ABSTRACT

Laboratory experiments were designed to identify the host strain paternity of fall army-
worm Spodoptera frugiperda (J. E. Smith) mated females. In no-choice tests, corn or rice
strain females were placed in cages with males of the opposite strain. After 48 h, females
were dissected and spermatophores were removed. Molecular markers in the cytochrome ox-
idase I (COI) gene were used to identify host strain identity from the spermatophores and
results showed the host strain pattern of the mating males. In choice tests, females of either
strain were placed in cages with males of both strains. After 48 or 96 h, spermatophores were
dissected and were molecularly analyzed to identify the host strain of the mating males.
Corn and rice strain females contained spermatophores from males of both strains, indicat-
ing that interstrain mating commonly occurs in the laboratory. The analysis of the spermato-
phores isolated from mated females provides a convenient means of identifying the strain of
the mated male. This technique has the promise of being able to directly measure interstrain
mating in wild populations.

Key Words: Spodoptera frugiperda, host strains, spermatophores, mating

RESUME

Experimentos de laboratorio fueron diseiados para identificar la paternidad de hembras apa-
readas de diferente sepas de cogollero, Spodoptera frugiperda (J. E. Smith) segun el hospedero.
En pruebas de "no opci6n", hembras de sepas de maiz y arroz fueron puestas enjaulas con ma-
chos de la sepa opuesta. Despu6s de 48 horas, las hembras fueron disectadas y los espermat6-
foros fueron quitados. Se utilizaron marcadores moleculares en el gene citocromo oxidase
(COI) tomados de los espermat6foros para identificar la sepa de cogollero y los resultados mos-
traron el patron de la sepa de los machos apareados. En pruebas de "con opci6n", escoger, hem-
bras de cualquiera de las dos sepas fueron puestas en jaulas con machos de ambas sepas.
Despues de 48 o 96 horas, los espermat6foros fueron disectados y analizados molecularmente
para identificar la sepa de los machos apareados. Hembras de la sepa de maiz y arroz tenian
espermat6foros de ambas sepas. Este indica que el apareamiento entire las dos sepas es comun
en el laboratorio. El analysis de los espermat6foros aislados de hembras apareadas provee una
manera convenient para identificar la sepa del macho apareado. Esta tecnica tiene la pro-
mesa de poder medir directamente el apareamiento entire las sepas en poblaciones salvajes.


Fall armyworm Spodoptera frugiperda (J. E.
Smith) provides a potentially useful system to
study sympatric speciation. This migratory,
polyphagous noctuid moth attacks a wide variety
of crops throughout the Nearctic and Neotropical
Western Hemisphere (Luginbill 1928; Sparks
1979). The species is composed of 2 morphologi-
cally identical strains that are defined by their
host plant preferences (Nagoshi & Meagher
2004a; Nagoshi & Meagher 2008). One strain was
identified from populations feeding on corn and
sorghum (corn strain) and the other was identi-
fied from populations feeding on rice (Oryza sa-
tiva L.) and forage grasses (Cynodon spp.) (rice
strain) (Pashley et al. 1985; Pashley 1986; Pash-
ley et al. 1987). The 2 strains can be distinguished
by genetic markers (Levy et al. 2002; Nagoshi &
Meagher 2003; Nagoshi et al. 2006b). Pheromone
trapping studies in agricultural habitats rou-
tinely attract males of both strains, though the


proportion will vary depending on the dominant
plant type, indicating that the strains overlap
substantially in their distribution and are mutu-
ally attracted to a common pheromone source
(Meagher & Nagoshi 2004; Nagoshi & Meagher
2004b).
The maintenance of strain integrity in sympa-
tric populations suggests some restrictions in in-
terstrain hybridization (Prowell et al. 2004; Na-
goshi et al. 2006a). Laboratory experiments pre-
sented evidence of directional premating barriers
where matings between corn strain females and
rice strain males did not result in the transfer of
spermatophores, but the opposite cross was suc-
cessful (Pashley & Martin 1987). They also found
that hybrid females produced by successful inter-
strain crosses could only successfully mate with
their hybrid brothers. In comparison, hybrid
males could mate with females of either strain
with near normal fertility. The strongest premat-







Florida Entomologist 93(2)


ing restriction to hybrid formation so far observed
is the temporal partitioning of mating behavior,
as laboratory experiments showed that corn
strain females initiated calling and copulated
earlier in the scotophase than rice strain females
(Pashley et al. 1992). Similar results were ob-
tained in a more recent set of experiments with
different laboratory corn and rice strain colonies
(Schdft et al. 2009). In these studies it was shown
that the timing of female calling was determined
by maternal effects, while copulation was influ-
enced by a combination of maternal and domi-
nant autosomal factors.
However, these strain-specific mating biases
were not observed by other groups working with
different colonies (Whitford et al. 1988; Quisen-
berry 1991). The 2 strains successfully hybridized
in both directions with no difference in fecundity
and the hybrids themselves showed no mating
specificity. We obtained similar results with colo-
nies in which the strains were defined by molecu-
lar markers (Nagoshi & Meagher 2003; unpub-
lished results). This inability to observe strain-
specific mating could be an artifact of prolonged
artificial rearing, as suggested by Pashley (1993),
and suggests that the behaviors are relatively la-
bile and readily influenced by environmental fac-
tors or genetic inbreeding.
The capacity for interstrain hybridization is of
importance to understanding how the integrity of
these sympatric strains is maintained and for
controlling the infestations of this important ag-
ricultural pest. With respect to the latter, there
are several observations that the viability and de-
velopment of the 2 strains differs between plant
hosts (Pashley 1986, 1988; Whitford et al. 1992;
Pashley 1993; Pashley et al. 1995; Meagher et al.
2004). The 2 strains also differ in their sensitivity
to a variety of pesticides (McCord & Yu 1987; Yu
1991; Veenstra et al. 1995; Adamczyk et al. 1997;
Yu 1999), and possibly to Bt susceptibility as well,
although in many cases the strain identity of the
lines being tested was unclear (Adamczyk et al.
1997; Lynch et al. 1999;Adamczyk et al. 2001; De-
quech et al. 2005; Polanczyk & Alves 2005; Mon-
nerat et al. 2006; Williams et al. 2006; Chilcutt et
al. 2007).
A major problem in addressing this issue is the
difficulty in performing such studies, particularly
in the field. Current methods require continued
observation during the scotophase period and the
collection of the mated pairs to determine the mo-
lecular markers carried by each parent. In this
paper we describe a method for identifying the oc-
currence of successful interstrain matings that
does not require monitoring, collecting, or analy-
sis of the male parent. Instead, spermatophores,
which are male products transferred to the fe-
male during a successful copulation (LaMunyon
2000; Blanco et al. 2006), were dissected from the
mated female and used to identify the strain of


the male. We used this method in no-choice and
choice experiments to examine the interstrain
mating capacity of several corn strain and rice
strain colonies, including those shown by Sch6ft
et al. (2009) to display strain-specific temporal
differences in mating behavior, as a proof-of-con-
cept to developing a direct method of measuring
the frequency of interstrain mating in the field.

MATERIALS AND METHODS

Generation of Strain-Specific Cultures

To generate the cultures used in these studies,
larvae were collected from either corn (corn
strain) or pasture grass (rice strain). It was previ-
ously reported that about 20% of the larvae typi-
cally collected from corn is of the rice strain, a
proportion that could even be higher depending
on the time of year (Nagoshi & Meagher 2004b;
Nagoshi et al. 2007). To insure the strain-specific-
ity of each culture, the larvae from each plant
host were raised to adulthood and pair-mated. Af-
ter oviposition, the parents were analyzed for
strain-identity by the COI markers (Nagoshi &
Meagher 2003). Only progeny from parents where
both were of the appropriate strain were used to
generate the laboratory cultures.
Culture procedures followed Stuhl et al.
(2008). Adults were placed in cylindrical screen
cages (28 cm height, 21 cm diameter) and sup-
plied with a 2% sugar-honey solution for nourish-
ment. Paper towels (SparkleTM, Georgia-Pacific,
Atlanta, GA) were stretched at the tops of the
cages as an oviposition substrate. Emerging neo-
nates were placed in rearing tubs (Rubbermaid
No. 4025, 9.1 1, Fairlawn, OH) that had plastic
grids (29 x 17.5 cm) on the bottom. Larvae were
raised on a pinto bean artificial diet according to
the procedures of Guy et al. (1985). After about 23
d, pupae were removed from the tubs, sexed, and
adults that emerged were placed in screen cages.
Larvae and adults were reared in incubators or
large rearing units at -3'C, 70% RH, and 14L:
10D photoperiod.
A total of 5 colonies were produced by this
method, 3 corn strain: 'CS-JS3' from larvae col-
lected in sweet corn in Miami-Dade Co., FL (13
months in culture), and 2 cultures from field corn
in Alachua Co., FL ('CS-Hague', 10 months and
'CS-DRU', 6 months), and 2 rice strain: 'RS-Ona'
from larvae collected in Hardee Co., FL in pasture
grasses (22 months) and 'RS-MS' from larvae col-
lected in Washington Co., MS in pasture grasses
(18 months).

No Choice and Choice Tests

Each of the 5 colonies was tested separately.
Two experiments (no-choice and choice) were con-
ducted and adults used were between 2 and 5 d


June 2010







Meagher & Nagoshi: Fall Armyworm Spermatophores


old. In the no-choice experiment, 10 females and
males each of opposite strains (5 RS-MS females x
5 CS-Hague males + 5 RS-Ona females x 5 CS-
DRU males in separate cages; 10 CS-DRU fe-
males x 10 RS-Ona males) were placed in a screen
cage (24 x 24 x 24 cm) with 2% honey/sugar solu-
tion for nourishment. After 96 h, females were
frozen (-20C) and later dissected to remove the
spermatophore(s). In the choice experiment, 6 fe-
males of 1 strain were placed in the screen cage
with 4 rice strain and 4 corn strain males. Twelve
trials were completed with corn strain females
(CS-JS, CS-Hague, or CS-DRU) while 10 trials
were completed with rice strain females (RS-MS
or RS-Ona). Females were held for either 48 or 96
h before being frozen and dissected. Spermato-
phores located in the female's corpus bursae were
gently removed in 70% ethanol. Care was taken
to keep the three sections (bulbous corpus, stem-
like collum, and hook-like frenum) in one piece
and to remove as much of the tissue around the
spermatophore as possible to avoid contamina-
tion from the female. Each spermatophore was
placed in 70% ethanol and in a separate snap vial
before being placed in a freezer.

Spermatophore DNA Preparation

Individual spermatophores were homogenized
in 800 pL of Genome lysis buffer (Zymo Research,
Orange, CA) in a dounce homogenizer. The homo-
genate was transferred to a 1.5-mL microcentri-
fuge tube and incubated at 55C for 5 min. The
supernatant was transferred to a Zymo-Spin I col-
umn (Zymo Research, Orange, CA) and processed
according to manufacturer's instructions. The
DNA preparation was collected in a final volume
of 20 pL with distilled water, sufficient for 2 PCR
amplification reactions.

Spermatophore PCR Analysis For Strain Identity

Strain-identity in spermatophores was deter-
mined by PCR amplification (PTC-200 Thermo
Cycler, MJ Research, Watertown, MA) by 3 meth-
ods defined by different primer pairs. PCR ampli-
fication was performed in a 30-pL reaction mix
containing 3 pL 10X manufacturer's reaction
buffer, 1 pL 10mM dNTP, 0.5 pL 20 pM primer
mix, 10 pL DNA template (between 0.05-0.5 pg),
and 0.5 unit Taq DNA polymerase (New England
Biolabs, Beverly, MA). The thermocycling pro-
gram was 94C (1 min), followed by 33 cycles of
92C (30 s), 56C (45 s), 72C (45 s), and a final
segment of 72C for 3 min. Digestions with re-
striction enzymes (New England Biolabs, Beverly,
MA) used manufacturer-provided buffers. Each
reaction used 10-20 units of restriction enzyme
and was incubated at 37C for 3 h to overnight.
Negative controls were performed with the same
reaction mixture but with no DNA template. For


gel electrophoresis, 6 pL of 6X gel loading buffer
was added to each reaction and the entire sample
run on 2% agarose horizontal gel containing Gel-
Red (Biotium, Hayward, CA) in 0.5X Tris-borate
buffer (TBE, 45 mM Tris base, 45 mM boric acid,
1 mM EDTA pH 8.0). Fragments were visualized
with a long-wave UV light box.
Primers were synthesized by Integrated DNA
Technologies (Coralville, IA). Amplification of the
COI region by Method I used the primer pair COI-
58F (5'- GGAATTTGAGCAGGAATAGTAGG-3')
and COI-1059R (5'- ACACCTGTTAATCCTC-
CTACAG-3') to produce a 1-kb fragment (Nagoshi
et al. 2006b). Method II used primers COI-893F
(5'-CACGAGCATATTTTACATCWGCA-3') and
COI-1472R (5'- GCTGGTGG-
TAAATTTTGATATC-3') to produce a 571-bp frag-
ment. Method III used primers COI-259F (5'-
CCTGATATAGCTTTCCCACG 3') and COI-
857R (5'- GCAGATGTAAAATATGCTCGTG 3')
to produce a 654-bp fragment. Restriction digest
was the same as Method I.

Adult Moth Strain Analysis

Individual specimens were homogenized in 4
mL of phosphate buffered saline (PBS, 20 mM so-
dium phosphate, 150 mM NaC1, pH 8.0) in a 15
mL-test tube with a tissue homogenizer (PRO Sci-
entific Inc., Oxford, CT). Cells and tissue were
pelleted by centrifugation at 6000g for 5 min at
room temperature. The pellet was resuspended in
800 pL cell lysis buffer (0.2 M sucrose, 0.1 M Tris-
HC1 at pH 8.0, 0.05 M EDTA, and 0.5% sodium
dodecyl sulfate), transferred to a 1.5- or 2.0-mL
microcentrifuge tube and incubated at 55C for 5
min. Proteins were precipitated by the addition of
100 pL of 8M potassium acetate. The supernatant
was transferred to a Zymo-Spin III column (Zymo
Research, Orange, CA) and processed according
to manufacturer's instructions. The DNA prepa-
ration was increased to a final volume of 40 pL
with distilled water. PCR amplification and re-
striction digest of the mitochondrial COI gene
was as described for spermatophore Method I ex-
cept that 1 pL of the DNA template (between
0.05-0.5 pg) was used for the amplification reac-
tion.

RESULTS AND DISCUSSION

Determining Spermatophore Strain Identity

We wanted to test the feasibility of using sper-
matophores dissected from mated fall armyworm
females to identify the strain of the male in-
volved. Noctuid spermatophores range in size
from 0.6-0.8 mg (He & Tsubaki 1992), so we used
PCR amplification methods that can generate mi-
crogram amounts of targeted DNA sequences
from very low levels of starting material. Two






Florida Entomologist 93(2)


methods were initially used to identify strain-
identity in spermatophores. In the preferred
method (designated I), a 1-kb PCR amplified
product was generated carrying both a single rice
strain and corn strain specific MspI site (Fig. 1;
Nagoshi et al. 2008). Digestion by MspI will
therefore produce strain diagnostic bands that
can be distinguished from any uncut fragment re-
sulting from a failure of restriction enzyme diges-
tion.
If this procedure did not provide an unambig-
uous strain identity, a second method (designated
II) was attempted to at least identify spermato-
phores of the rice strain. Method II generates a
571-bp product that because of its smaller size
should be more efficiently amplified. The frag-
ment contains a strain-specific polymorphism
that disrupts a single EcoRV site in the corn


strain but not the rice strain (polymorphism 1182
in Nagoshi et al. 2010), producing diagnostic
bands upon digestion with this enzyme. However,
this method is ambiguous for the corn strain be-
cause the diagnostic pattern cannot be distin-
guished from incomplete restriction digestion. In
subsequent analyses, a modification of method I
was used in which an internal pair of primers am-
plified a fragment about the size of that produced
by method II, but producing diagnostic PCR
bands for both strains after MspI digestion
(Fig. 1).

Spermatophores Identify Interstrain Mating
Representatives from each laboratory culture
were tested for interstrain mating capability
under laboratory conditions. Reciprocal no-


RS CS


Method I'1ll


I1I I.Sl 1 sl


I
.ispl


III I


11
II
I, k \,


Method II

SI S)
R 1"7


I1


III
NIspI


Fig. 1. Molecular markers in the COI gene that establish host strain identity used for the analysis of spermato-
phores (corn strain = CS, rice strain = RS). Shown are agarose gels with PCR amplified bands cut with the desig-
nated restriction enzyme. Methods I and III amplify overlapping regions with the method III primer pair internal
to that of method I. Strain-specific MspI sites are present on the fragment that produces diagnostic patterns for
strain identity. Method II amplifies a different portion of the COI gene that contains a corn strain specific EcoRV
site. A 571-bp fragment is frequently observed even when the primary bands are those associated with the rice
strain. This fragment is either due to incomplete restriction digest or contamination with corn strain tissue. Num-
bers on the side of the gel picture are sizes in base pairs (CS = corn strain; RS = rice strain).


-,IS







5-1




*312/2S7l








-I1 / /


June 2010







Meagher & Nagoshi: Fall Armyworm Spermatophores


choice experiments were performed and suc-
cessful mating was defined as the presence of
spermatophores in the females. After 96 h, 7
corn strain and 10 rice strain females success-
fully mated with males of the opposite strain to
produce 11 (1.57 0.3 spermatophores per
mated female) and 13 (1.3 0.15 spermato-
phores per mated female) spermatophores, re-
spectively. Multiple spermatophores were found
in 3 of the corn strain females and 3 of the rice
strain females, indicating that females mating
to multiple partners were common. The MspI
enzyme digestion reactions were successful for
10 spermatophores contained in corn strain fe-
males and 8 contained in rice strain females. Of
the 10 spermatophores from corn strain females
all were identified as rice strain by molecular
analysis (Table 1). Similarly, in the reciprocal
cross, all 8 spermatophores from rice strain fe-
males tested showed the COI markers consis-
tent with the corn strain.
In the choice experiments, females were si-
multaneously presented males of both strains.
A high percentage of both strain females mated
successfully (corn strain 81.8 3.8%; rice strain
88.2 3.6%) and contained more than 2 sper-
matophores per mated female (corn strain 2.04
+ 0.14; rice strain 2.22 0.18). For the DNA
analysis, 15 spermatophores were isolated from
10 corn strain females that were successfully
mated. Seven spermatophores exclusively dis-
played the same corn strain markers as the
mother, whereas the remaining 8 spermato-
phores expressed the rice strain marker indi-
cating interstrain mating (Table 1). Of the 20
spermatophores analyzed from rice strain fe-
males, 10 were of rice strain males and 10 were
indicative of interstrain mating. These observa-
tions demonstrate that there are no discernible
barriers to mating between the 2 strains under
our laboratory conditions.
Our inability to replicate the strain mating bi-
ases described by Pashley & Martin (1987) sug-


gests that this behavior is easily lost after pro-
longed laboratory culturing or is highly variable
within the fall armyworm population. There is ev-
idence that substantial interstrain hybridization
occurs in the wild. Multi-locus analysis of strain-
specific genetic markers can be used as an indi-
rect measure ofinterstrain hybrids, producing es-
timates of hybridization frequency ranging from
16-26% (Prowell et al. 2004; Nagoshi et al.
2006a). The data suggest that matings of rice
strain females to corn strain males were more fre-
quent than the reciprocal, the same bias observed
by Pashley & Martin (1987) in laboratory studies
(Nagoshi & Meagher 2003; Nagoshi et al. 2006a;
Nagoshi et al. 2008). If these estimates of hybrid-
ization in the wild are correct, then hybrids make
up a large part of the sampled population with po-
tentially different behaviors and physiologies
than the parental strains. This would indicate a
more genetically complex situation for fall army-
worm that would complicate efforts to control and
predict the infestations of this important agricul-
tural pest.
To accurately evaluate the importance of hy-
brid formation in fall armyworm field popula-
tions, we developed a methodology that can di-
rectly measure the frequency of hybrid forma-
tion in different habitats and seasons. Spermato-
phores have previously been used to clarify host
races in another sympatric species by measuring
for differences in stable isotope frequencies (Ma-
lausa et al. 2005). Our research is the first to
identify the host strain paternity of mated fe-
males with molecular markers. This makes it
possible to detect interstrain matings solely
from the collection of females, thereby facilitat-
ing the direct determination of hybrid frequency
in different habitats and seasons. As proof-of-
concept, we show in preliminary experiments
that the strains represented by our colonies are
capable of substantial interstrain mating and
show no indication of strain preference under
laboratory conditions.


TABLE 1. RESULTS OF NO-CHOICE AND CHOICE MATING EXPERIMENTS BASED ON SPERMATOPHORES AS A MEASURE OF
SUCCESSFUL MATING. CORN STRAIN = CS; RICE STRAIN = RS.

Spermatophore COI haplotype

Strain of # Y parents Y s with >1 Same strain Opposite strain
Strain of Y parent 6 parents) dissected spermatophore as Y parent of Y parent

CS RS 7 3 0 10 (10)b
RS CS 10 4 0 8
CS CS and RS 10 5 [2] 7 8 (2)"
RS CS and RS 19 11 [5] 10 10

brackets indicate number of clusters where spermatophores had different strain identity.
parentheses indicate number analyzed by Method II.







Florida Entomologist 93(2)


ACKNOWLEDGMENTS

We thank C. Dillard, A. Rowley, and J. Sharp for ex-
cellent technical support. We thank S. Fleischer (The
Pennsylvania State University) and P. Shirk (USDA-
ARS) for review of an early version of the manuscript.
The use of trade, firm, or corporation names in this pub-
lication is for the information and convenience of the
reader. Such use does not constitute an official endorse-
ment or approval by the United States Department of
Agriculture or the Agricultural Research Service of any
product or service to the exclusion of others that may be
suitable.

REFERENCES CITED

ADAMCZYK, JR., J. J., HARDEE, D. D., ADAMS, L. C., AND
SUMERFORD, D. V. 2001. Correlating differences in
larval survival and development of bollworm (Lep-
idoptera: Noctuidae) and fall armyworm (Lepi-
doptera: Noctuidae) to differential expression of
CrylA(c) delta-endotoxin in various plant parts
among commercial cultivars of transgenic Bacillus
thuringiensis cotton. J. Econ. Entomol. 94: 284-
290.
ADAMCZYK, JR., J. J., HOLLOWAY, J. W., LEONARD, B. R.,
AND GRAVES, J B. 1997. Susceptibility of fall army-
worm collected from different plant hosts to selected
insecticides and transgenic Bt cotton. J. Cotton Sci.
1: 21-28.
BLANCO, C. A., PERERA, O., RAY J. D., TALIERCIO, E.,
AND WILLIAMS III, L. 2006. Incorporation of
rhodamine B into male tobacco budworm moths He-
liothis virescens to use as a marker for mating stud-
ies. J. Insect Sci. 6:05 10pp.
CHILCUTT, C. F., ODVODY, G. N., CORREA, J. C., AND
REMMERS, J. 2007. Effects of Bacillus thuringiensis
transgenic corn on corn earworm and fall armyworm
(Lepidoptera: Noctuidae) densities. J. Econ. Ento-
mol. 100: 327-334.
DEQUECH, S. T. B., DA SILVA, R. F. P., AND FIUZA, L. M.
2005. Interaction between Spodoptera frugiperda (J.
E. Smith) (Lepidoptera: Noctuidae), Campoletis fla-
vicincta (Ashmead) (Hymenoptera: Ichneumonidae)
and Bacillus thuringiensis aizawai, in laboratory.
Neotropical Entomol. 34: 937-944.
GuY, R. N., LEPPLA, N. C., RYE, J. R., GREEN, C. W., BA-
RETTE, S. L., AND HOLLIEN, K. A. 1985. Trichoplusia
ni, pp. 487-494 In P. Sing & R. F. Moore [eds.], Hand-
book of Insect Rearing, vol. 2. Elsevier, Amsterdam.
HE, Y. B., AND TSUBAKI, Y. 1992. Variation in spermato-
phore size in the armyworm, Pseudaletia separate
(Lepidoptera, Noctuidae) in relation to rearing den-
sity. Appl. Entomol. Zool. 27: 39-45.
LAMUNYON, C. W. 2000. Sperm storage by females of the
polyandrous noctuid moth Heliothis virescens. Ani-
mal Behav. 59: 395-402.
LEVY, H. C., GARCIA-MARUNIAK, A., AND MARUNIAK, J.
E. 2002. Strain identification of Spodoptera frugiper-
da (Lepidoptera: Noctuidae) insects and cell line:
PCR-RFLP of cytochrome oxidase C subunit I gene.
Florida Entomol. 85: 186-190.
LUGINBILL, P. 1928. The Fall Armyworm. U.S. Dept. Ag-
ric. Tech. Bull. 34: 1-91.
LYNCH, R. E., WISEMAN, B. R., PLAISTED, D., AND WAR-
NICK, D. 1999. Evaluation of transgenic sweet corn
hybrids expressing CrylA (b) toxin for resistance to


corn earworm and fall armyworm (Lepidoptera: Noc-
tuidae). J. Econ. Entomol. 92: 246-252.
MALAUSA, T., BETHENOD, M.-T., BONTEMPS, BOURGUET,
CORNUET, J.-M., AND PONSARD, S. 2005. Assortative
mating in sympatric host races of the European corn
borer. Science 308: 258-260.
MCCORD, E., AND YU, S. J. 1987. The mechanisms of car-
baryl resistance in the fall armyworm, Spodoptera
frugiperda (J. E. Smith). Pestic. Biochem. Physiol.
27: 114-122.
MEAGHER, R. L., AND NAGOSHI, R. N. 2004. Population
dynamics and occurrence of Spodoptera frugiperda
host strains in southern Florida. Ecol. Entomol. 29:
614-620.
MEAGHER, R. L., NAGOSHI, R. N., STUHL, C., AND
MITCHELL, E. R. 2004. Larval development of fall ar-
myworm (Lepidoptera: Noctuidae) on different cover
crop plants. Florida Entomol. 87: 454-46.
MONNERAT, R., MARTINS, E., QUEIROZ, P., ORDiZ, S.,
JARAMILLO, G., BENINTENDE, G., COZZI, J., REAL, M.
D., MARTINEZ-RAMIREZ, A., RAUSELL, C., CERON, J.,
IBARRA, J. E., DEL RINCON-CASTRO, M. C., ESPINOZA,
A. M., MEZA-BASSO, L., CABRERA, L., SANCHEZ, J.,
SOBERON, M., AND BRAVO, A. 2006. Genetic variabil-
ity of Spodoptera frugiperda Smith (Lepidoptera:
Noctuidae) populations from Latin America is asso-
ciated with variations in susceptibility to Bacillus
thuringiensis Cry toxins. Appl. Environ. Microbiol.
72: 7029-7035.
NAGOSHI, R. N., AND MEAGHER, R. L. 2003. FR tandem-
repeat sequence in fall armyworm (Lepidoptera:
Noctuidae) host strains. Ann. Entomol. Soc. America
96: 329-335.
NAGOSHI, R. N., AND MEAGHER, R. L. 2004a. Behavior
and distribution of the two fall armyworm host
strains in Florida. Florida Entomol. 87: 440-449.
NAGOSHI, R. N., AND MEAGHER, R. L. 2004b. Seasonal
distribution of fall armyworm (Lepidoptera: Noctu-
idae) host strains in agricultural and turf grass hab-
itats. Environ. Entomol. 33: 881-889.
NAGOSHI, R. N., AND MEAGHER, R. L. 2008. Review of
fall armyworm (Lepidoptera: Noctuidae) genetic
complexity and migration. Florida Entomol. 91: 546-
554.
NAGOSHI, R. N., MEAGHER, R. L., AND JENKINS, D. A.
2010. Puerto Rico fall armyworm has only limited in-
teractions with those from Brazil or Texas, but could
have substantial exchanges with Florida popula-
tions. J. Econ. Entomol. 103: (in press).
NAGOSHI, R. N., MEAGHER, R. L., NUESSLY, G., AND
HALL, D. 2006a. Effects of fall armyworm (Lepi-
doptera: Noctuidae) interstrain mating in wild pop-
ulations. Environ. Entomol. 35: 561-568.
NAGOSHI, R. N., ARMSTRONG, J. S., SILVIE, P., AND
MEAGHER, R. L. 2008. Structure and distribution of
a strain-biased tandem repeat element in fall army-
worm (Lepidoptera: Noctuidae) populations in Flori-
da, Texas, and Brazil. Ann. Entomol. Soc. America
101: 1112-1120.
NAGOSHI, R. N., SILVIE, P., MEAGHER, R. L., LOPEZ, J.,
AND MACHADO, V. 2007. Identification and compari-
son of fall armyworm (Lepidoptera: Noctuidae) host
strains in Brazil, Texas, and Florida. Ann. Entomol.
Soc. America 100: 394-402.
NAGOSHI, R. N., MEAGHER, R. L., ADAMCZYK, JR., J. J.,
BRAMAN, S. K., BRANDENBURG, R. L., AND NUESSLY,
G. 2006b. New restriction fragment length polymor-
phisms in the cytochrome oxidase I gene facilitate


June 2010







Meagher & Nagoshi: Fall Armyworm Spermatophores


host strain identification of fall armyworm (Lepi-
doptera: Noctuidae) populations in the southeastern
United States. J. Econ. Entomol. 99: 671-677.
NAISBIT, R. E., JIGGINS, C. D., AND MALLET, J. 2001. Dis-
ruptive sexual selection against hybrids contributes
to speciation between Heliconius cydno and Helico-
nius melpomene. Proc. R. Soc. London B. 268: 1849-
1854.
PASHLEY, D. P. 1986. Host-associated genetic differenti-
ation in fall armyworm (Lepidoptera: Noctuidae): a
sibling species complex? Ann. Entomol. Soc. America
79: 898-904.
PASHLEY, D. P. 1988. Quantitative genetics, develop-
ment, and physiological adaptation in host strains of
fall armyworm. Evolution 42: 93-102.
PASHLEY, D. P. 1993. Causes of host-associated variation
in insect herbivores: an example from fall army-
worm, pp. 351-359 In K. C. Kim and B. A. McPheron
[eds.], Evolution of Insect Pests-Patterns of Varia-
tion. Wiley, New York.
PASHLEY, D. P., AND MARTIN, J. A. 1987. Reproductive
incompatibility between host strains of the fall ar-
myworm (Lepidoptera: Noctuidae). Ann. Entomol.
Soc. America 80: 731-733.
PASHLEY, D. P., HAMMOND, A. M., AND HARDY, T. N.
1992. Reproductive isolating mechanisms in fall ar-
myworm host strains (Lepidoptera: Noctuidae). Ann.
Entomol. Soc. America 85: 400-405.
PASHLEY, D. P., HARDY, T. N., AND HAMMOND, A. M.
1995. Host effects on developmental and reproduc-
tive traits in fall armyworm strains (Lepidoptera:
Noctuidae). Ann. Entomol. Soc. America 88: 748-755.
PASHLEY, D. P., JOHNSON, S. J., AND SPARKS, A. N. 1985.
Genetic population structure of migratory moths:
the fall armyworm (Lepidoptera: Noctuidae). Ann.
Entomol. Soc. America 78: 756-762.
PASHLEY, D. P., QUISENBERRY, S. S., AND JAMJANYA, T.
1987. Impact of fall armyworm (Lepidoptera: Noctu-
idae) host strains on the evaluation of bermuda
grass resistance. J. Econ. Entomol. 80: 1127-1130.
POLANCZYK, R. A., AND ALVES, S. B. 2005. Biological pa-
rameters of Spodoptera frugiperda (J. E. Smith)
(Lepidoptera: Noctuidae) assayed with Bacillus thu-
ringiensis Berliner. Sci. Agr. 62: 464-468.


PROWELL, D. P., MCMICHAEL, M., AND SILVAIN, J.-F.
2004. Multilocus genetic analysis of host use, intro-
gression, and speciation in host strains of fall army-
worm (Lepidoptera: Noctuidae). Ann. Entomol. Soc.
America 97: 1034-1044.
QUISENBERRY, S. S. 1991. Fall armyworm (Lepidoptera:
Noctuidae) host strain reproductive compatibility.
Florida Entomol. 74: 194-199.
SCHOFT, G., HECKEL, D. G., AND GROOT, A. T. 2009.
Time-shifted reproductive behaviours among fall ar-
myworm (Noctuidae: Spodoptera frugiperda) host
strains: evidence for differing modes of inheritance.
J. Evol. Biol. 22: (in press).
SPARKS, A. N. 1979. A review of the biology of the fall ar-
myworm. Florida Entomol. 62: 82-87.
STUHL, C. J., MEAGHER, R. L., AND NAGOSHI, R. N. 2008.
Genetic variation in neonate behavior of fall army-
worm (Lepidoptera: Noctuidae). Florida Entomol.
91: 151-158.
VEENSTRA, K. H., PASHLEY, D. P., AND OTTEA, J. A.
1995. Host-plant adaptation in fall armyworm host-
strains: comparison of food consumption, utilization,
and detoxication enzyme activities. Ann. Entomol.
Soc. America 88: 80-91.
WHITFORD, F., QUISENBERRY, S. S., AND MOELLENBECK,
D. J. 1992. Nutritional response by rice and corn fall
armyworm (Lepidoptera: Noctuidae) strains to di-
etary component substitution in artificial diets. J.
Econ. Entomol. 85: 1491-1496.
WHITFORD, F., QUISENBERRY, S. S., RILEY, T. J., AND
LEE, J. W. 1988. Oviposition preference, mating
compatibility, and development of two fall army-
worm strains. Florida Entomol. 71: 234-243.
WILLIAMS, W. P., BUCKLEY, P. M., AND DAVES, C. A.
2006. Identifying resistance in corn to southwestern
corn borer (Lepidoptera: Crambidae), fall armyworm
(Lepidoptera: Noctuidae), and corn earworm (Lepi-
doptera: Noctuidae). J. Agr. Urban Entomol. 23:87-95.
YU, S. J. 1991. Insecticide resistance in the fall army-
worm, Spodoptera frugiperda (J. E. Smith). Pestic.
Biochem. Physiol. 39: 84-91.
YU, S. J. 1999. Induction of new glutathione S-trans-
ferase isozymes by allelochemicals in the fall army-
worm. Pestic. Biochem. Physiol. 63: 163-171.







Florida Entomologist 93(2)


June 2010


NEW REPORT OF CHAETOPSIS MASSYLA (DIPTERA: ULIDIIDAE) AS A
PRIMARY PEST OF CORN IN FLORIDA

GAURAV GOYAL1, GREGG S. NUESSLY', GARY J. STECK2, DAKSHINA R. SEAL3, JOHN L. CAPINERA4
AND KENNETH J. BOOTE'
'Everglades Research and Education Center, University of Florida (UF), Institute of Food and Agricultural Sciences
(IFAS), 3200 E. Palm Beach Rd., Belle Glade, FL 33430

2Division of Plant Industry, Florida Dept. of Agriculture and Consumer Services, P.O. Box 147100,
Gainesville, FL 32614

'Tropical Research and Education Center, UF, IFAS, 18905 S.W. 280 St., Homestead, FL 33031

4Dept. of Entomology and Nematology, UF, IFAS, P.O. Box 110620, Gainesville, FL 32611

5Dept. of Agronomy, UF, IFAS, P.O. Box 110500, Gainesville, FL 32611

ABSTRACT

The picture-winged fly Euxesta stigmatias Loew (Diptera: Ulidiidae) has been a serious pest
of sweet corn in Florida since the 1930s and had been considered the only fly infesting Flor-
ida corn. In a sweet corn variety trial to evaluate E. stigmatias resistance in 2007, adult
Chaetopsis massyla (Walker) (Diptera: Ulidiidae) was reared from the ears. Choice and no-
choice trials were conducted in 2007 and 2008 to determine the pest nature of C. massyla on
corn. In no choice tests, C. massyla pairs were caged on uninfested corn ears in green house
and field trials. In choice tests, field collected corn ears were held for fly emergence. No choice
tests showed that C. massyla could infest and complete development in ears that had no pre-
vious damage. Chaetopsis massyla emerged from corn ears with and without prior infesta-
tion by other insect species in choice tests. Subsequently, C. massyla were reared from corn
ears collected from locations throughout the major sweet corn growing region of southern
Florida. Therefore, we present what we believe to be the first report of C. massyla as a pri-
mary pest of corn ears in Florida and in the United States of America.

Key Words: corn, Chaetopsis massyla, Euxesta stigmatias

RESUME

La mosca Euxesta stigmatias Loew (Diptera: Ulidiidae) ha sido una plaga seria del maiz
dulce en la Florida desde los anos 1930 y ha sido considerada como la unica mosca que in-
festa el maiz en la Florida. En una prueba para evaluar la resistencia de variedades de maiz
dulce hacia E. stigmatias en el 2007, adults de Chaetopsis massyla (Walker) (Diptera: Uli-
diidae) fueron criados sobre mazorcas. Se realizaron pruebas de opci6n y sin opci6n durante
2007 y 2008 para determinar la naturaleza de la plaga C. massyla sobre maiz. En las prue-
bas sin opci6n, parejas de C. massyla fueron puestas enjaulas con mazorcas no infestadas
en pruebas en hechas en un invernadero y en el campo. En las pruebas con opci6n, mazorcas
recolectadas en el campo fueron guardadas para la emergencia de moscas. Las pruebas sin
opci6n mostraron que C. massyla pueden infestar y desarrollar completemente en mazorcas
que no fueron danadas anteriormente. Chaetopsis massyla emergi6 de mazorcas con o sin in-
festaciones anteriores de otras species de insects en las pruebas con opci6n. Posterior-
mente, C. massyla fueron criadas de mazorcas recolectadas en sitios por toda la region
principal donde se siembra el maiz dulce en el sur de la Florida. Por lo tanto, presentamos
lo que creemos es el primer infomnne de C. massyla como una plaga primaria de la mazorca
en la Florida y en los Estados Unidos.


The picture-winged fly Euxesta stigmatias nels, and cobs. Economic losses can occur even in
Loew (Diptera: Ulidiidae) is a serious pest of fields where insecticides are frequently applied
sweet corn (Mossler 1999; Nuessly & Hentz 2004) (Seal & Jansson 1994; Seal 1996; Nuessly &
causing up to 100% damage to untreated crops Hentz 2004). While additional Euxesta spp. have
(Van Zwaluvenberg 1917). It was first described been reported damaging corn ears in Central and
as a sweet corn pest in Florida in 1938 (Barber South America (Painter 1955; Frias-L 1978; Diaz
1939). Fly larvae emerge from eggs deposited pri- 1982), no other ulidiid has been reported attack-
marily on corn silks (styles) and feed on silks, ker- ing corn in Florida. However, during the course of







Goyal et al: New report of Chaetopsis massyla Infesting Corn in Florida


a sweet corn variety trial in 2007 conducted at
Belle Glade, FL, we sweep netted and reared from
infested ears what appeared to be a second spe-
cies. Gary J. Steck (Division of Plant Industry,
Florida Department of Agricultural and Con-
sumer Services, Gainesville, FL) identified adults
collected and reared from the field as E. stigma-
tias Loew and Chaetopsis massyla (Walker)
(Diptera: Ulidiidae).
Previously referred to as Otitidae, Ulidiidae is
the family name currently accepted by dipterists
and used in the BioSystematic Database of World
Diptera (Thompson 2006). This family is reported
to have 671 species worldwide (Anonymous
2008a), including 285 in the Americas south of
the United States (Steyskal 1968). Ulidiidae is di-
vided into 2 subfamilies, Otitinae and Ulidiinae,
based on aedeagus differences (Hennig 1939).
Both Euxesta and Chaetopsis belong to the sub-
family Ulidiinae. The genus Chaetopsis is repre-
sented by 7 species in North America (Steyskal
1965) and 10 species in the Americas south of the
United States with 4 species common to both
(Steyskal 1968). Most species of this family have
saprophagous feeding habits, although some are
primarily phytophagous (Allen & Foote 1992).
Genera that are considered to be phytophagous
include Chaetopsis, Eumetopiella, Euxesta, Teta-
nops, and Tritoxa.
The literature indicates that C. massyla has
been reared from several other monocots, but
these finds have been associated with prior or
concurrent insect or fungal infestations. Chaetop-
sis massyla has been reared from onions, Allium
cepa L. (Liliales: Liliaceae) (Merrill 1951), decay-
ing Narcissus bulbs (Liliales: Liliaceae) (Blanton
1938), and cattail, Typha latifolia L. (Typhales:
Typhaceae) (Keiper et al. 2000). Allen & Foote
(1992) collected C. massyla larvae from decom-
posing cattail stems previously damaged by Noc-
tuidae (Lepidoptera) larvae and from Carex
lacustris Willd. (Cyperales: Cyperaceae) stems
previously damaged by Epichlorops exilis (Coquil-
lett) (Diptera: Chloropidae) larvae. The objective
of this study was to determine the pest nature of
C. massyla on corn.

MATERIALS AND METHODS

No-choice trials on sweet corn (Seminis'Obses-
sion') were conducted in Dec 2007 in a greenhouse
and again in May 2008 in a field at the Everglades
Research and Education Center (EREC), Belle
Glade, FL. Pre-silking ears were protected from
infestation by other ulidiids or Lepidoptera by 50-
mesh cloth bags secured with rubber bands.
Seven days after the start of silking, C. massyla
male-female pairs were added to the cages and
provided with 50% honey solution on cotton balls.
Each ear was caged with five, 8-14 d-old pairs in
the 2007 trials and one 5-15 d-old pair in the 2008


trials. As part of a larger experiment designed to
evaluate fly development on uninfested ears, 8
ears and 9 ears were caged solely with C. massyla
flies in 2007 and 2008, respectively. All ears were
collected 14 d later and placed individually in
0.93 L plastic bags with paper towels in a room
maintained at 26.0 1VC and photoperiod of
L14:D10 h. Pupae were collected from the bags
and held for adult emergence on moist filter paper
within parafilm-sealed Petri plates. Emerged
adults were preserved in 70% ethyl alcohol.
To evaluate C. massyla infestation of ears in
full choice tests, ears naturally infested by ulidi-
ids were collected from 2 additional field trials
conducted in 2008 at the EREC. Ears were se-
lected randomly from the fields at harvest (21-d-
old ears). Seventy-five ears were collected in May
from a Bt-enhanced sweet corn field (Syngenta
'GSS 0966'), and 360 ears were collected in De-
cember from a standard sweet corn field ('Obses-
sion') and examined for fly larvae within silk
channels. To remove the possibility of C. massyla
attacking only ears damaged previously by other
insects, ears with fly larvae and the presence of or
previous damage by Lepidoptera larvae, either
Helicoverpa zea (Boddie) or Spodoptera fru-
giperda L. (J. E. Smith) (Lepidoptera: Noctuidae),
were discarded from the samples. Ears infested
only with fly larvae were held for pupal develop-
ment and adult emergence as described above.

RESULTS

No choice trials resulted in 100% infestation
by Chaetopsis massyla with no other insects
emerging from caged ears. A mean (SEM) of 13
4 (range 6 to 40) adults emerged from each ear in
the Dec 2007 greenhouse trial, while 13 6 (range
4 to 20) per ear emerged in the May 2008 field
trail. These tests indicated that C. massyla could
successfully colonize and develop in sweet corn
ears not previously or concurrently infested with
other insects.
Chaetopsis massyla emerged from ears col-
lected in both choice field trials. In the Bt-en-
hanced sweet corn trial, C. massyla were found in
19 of the 30 ears infested only with fly larvae.
Three of these ears were infested solely by C.
massyla while 16 also held E. stigmatias. Mean C.
massyla adult emergence per ear was 25 6
(range 7 to 61) when infested only by C. massyla
and 16 3 (range 2 to 43) when infested by both
fly species. Of the 50 standard sweet corn ears
found infested solely by fly larvae, 42 contained C.
massyla. Half of these were infested by only C.
massyla, whereas the others were also infested by
E. stigmatias. Mean C. massyla emergence per
standard sweet corn ear was 7 2 (range 2 to 21)
when infested only by C. massyla and 6 2 (range
1 to 13) when infested by both fly species. Cha-
etopsis massyla was subsequently reared from fly-







Florida Entomologist 93(2)


Fig. 1. Adult females of Chaetopsis massyla (a) and Euxesta stigmatias (b); heads of C. massyla (c) and E. stig
matias (d); ovipositors of C. massyla (e) and E. stigmatias (f); flgml, first flagellomere; fr vit, frontal vitta.


infested corn ears collected from commercial
sweet corn fields throughout Palm Beach County.
This county is the major sweet corn producing
county in Florida (Anonymous 2008b; A. Kirstein,
Palm Beach Co. Coop. Ext. Economist, personal
communication).


DISCUSSION

In choice and no-choice trials, C. massyla suc-
cessfully infested and developed in ears without
prior infestation by other insect species. This is
the first known report of C. massyla as a primary


June 2010







Goyal et al: New report of Chaetopsis massyla Infesting Corn in Florida


pest of corn ears. However, in Nov 2009, examina-
tions of Ulidiidae specimens at the California De-
partment of Food and Agriculture collection by S.
D. Gaimari (CDFA Dipterist, personal communi-
cation) and at the Smithsonian National Museum
of Natural History by G. S. Nuessly (in collabora-
tion with Dipterist A. Norbaum) revealed C. mas-
syla adults were reared from sweet corn tassels in
Orange County, CA in 1942 and from corn ears in
Riverside County, CA in 1996, respectively. The
later specimens were collected from ears also in-
fested with E. stigmatias. Labels on C. massyla
specimens at the Smithsonian indicate they have
been collected from across the continental United
States.
Two other Chaetopsis species are reported to
feed on corn and other plants as larvae. Chaetop-
sis aenea (Wiedemann) were reared from dam-
aged corn stems in Ohio (Gossard 1919) and de-
cayed and smut-infected onions in Michigan (Sev-
erin & Severin 1915). Larvae of Chaetopsis fulvi-
frons (Macquart) were found in tunnels of
Ostrinia nubilalis (Hiibner) (Lepidoptera: Cram-
bidae) within corn stalks in Texas (Knutson
1987), and from barnyard grass, Echinochloa
crus-galli (L.) P. Beauv (Cyperales: Poaceae) dam-
aged by Eumetopiella rufipes (Macquart)
(Diptera: Ulidiidae) (Valley et al. 1969).
Chaetopsis massyla can be distinguished from
other pestiferous ulidiids occurring in Florida
corn by several characters. Wings of C. massyla
have 3 dark bands (Fig. la), while Euxesta spp.
attacking corn have a fourth band near the wing
base (Fig Ib). The legs of C. massyla are yellow,
whereas the legs of other species attacking corn
are brown to black in color. The upper apex of the
first antennal flagellomere is angulate or pointed
in Chaetopsis (Fig. Ic), but is rounded in Euxesta
spp. (Fig. Id) (Steyskal 1987). The frontal vitta of
C. massyla usually is bare (Fig. Ic), while it has
several scattered setae or cruciate bristles in Eu-
xesta spp. (Fig. Id) (Steyskal 1987). The ovipositor
is broad, depressed, thin and laminar apically in
Chaetopsis (Fig. le) compared with Euxesta spp.
where the ovipositor is narrow, soft and not lami-
nar apically (Fig. If) (Steyskal 1987).
In conclusion, the results from field surveys
and artificial infestation studies indicate that C.
massyla can attack and develop within corn ears
with or without prior infestation by other insect
species. Larval feeding by C. massyla renders
the ears unmarketable. Therefore, we report C.
massyla as a pest of corn and also confirm its pri-
mary nature of attack on corn ears in contrast to
reports by Allen & Foote (1992) that suggested
the species was limited to scavenging or second-
ary invasion of plant tissues. Cooperative stud-
ies are in progress to determine the geographical
distribution of corn-infesting populations of C.
massyla throughout the southeastern United
States.


ACKNOWLEDGMENTS

We thank B. Thapa for assistance in rearing Ulidi-
idae from collected ears. Nicholas Larsen translated the
abstract from English to Spanish. This research was
made possible by a Hand Fellowship awarded by the
Dolly and Homer Hand Group.

REFERENCES CITED

ALLEN, E. J., AND FOOTE, B. A. 1992. Biology and imma-
ture stages of Chaetopsis massyla (Diptera: Otiti-
dae), a secondary invader of herbaceous stems of
wetland monocots. Proc. Entomol. Soc. Washington
94: 320-328.
ANONYMOUS. 2008a. Biosystematic Database of World
Diptera. Available at http://www.sel.barc.usda.gov/
diptera/names/Status/bdwdstat.htm (verified 30 No-
vember 2009).
ANONYMOUS. 2008b. Florida Statistical Abstract. Uni-
versity of Florida, Gainesville, FL.
BARBER, G. W. 1939. Injury to sweet corn by Euxesta
stigmatias Loew in Southern Florida. J. Econ. Ento-
mol. 32: 879-880.
BLANTON, F. S. 1938. Some dipterous insects reared
from narcissus bulbs. J. Econ. Entomol. 31: 113-116.
DIAZ, W. 1982. Danos de Euxesta eluta y E. mazorca
(Dipt: Otitidae) sobre maices amilaceos en la Costa
Central del Peru. Rev. Peruvian Entomol. 1: 51-53.
FRIAS-L, D. 1978. Ecological studies in Euxesta eluta
and Euxesta annonae (Diptera: Otitidae). Agric. T6c-
nica (Chile) 38: 109-115.
GOSSARD, H. A. 1919. Insects resembling the European
corn borer. Mthly. Bull. Ohio Agric. Exp. Station 4:
372-379.
HENNIG, W. 1939. Otitidae, pp. 49-78 In E. Lindner [ed.],
Die Fliegen der Palaearktischen Region, vol. 5. Sch-
weizerbart, Stuttgart.
KEIPER, J. B., SANFORD, M., JIANNINO, J., AND WALTON,
W. E. 2000. Invertebrates inhabiting wetland mono-
cots damaged by Lepidoptera. Entomol. News 111:
348-354.
KNUTSON, A. 1987. Dynamics and Natural Enemies of
the Southwestern Corn Borer in the Texas High
Plains. Ph.D. Dissertation, Texas A & M University,
TX.
MERRILL, L. S., JR. 1951. Diptera reared from Michigan
onions growing from seeds. J. Econ. Entomol. 14:
1015-1015.
MOSSLER, M. A. 1999. Crop profile for sweet corn in Flor-
ida. CIR 1233, University of Florida. Available at ht-
tp://edis.ifas.ufl.edu/pdffiles/PI/PI03400.pdf (verified
30 November 2009).
NUESSLY, G. S., AND HENTZ, M. G. 2004. Contact and
leaf residue activity of insecticides against the sweet
corn pest Euxesta stigmatias Loew (Diptera: Otiti-
dae). J. Econ. Entomol. 97: 496-502.
PAINTER, R. H. 1955. Insects on corn and teosinte in
Guatemala. J. Econ. Entomol. 48: 36-42.
SEAL, D. R. 1996. Insect control in sweet corn, 1995. Ar-
thropod Manage. Tests 21: 111-111.
SEAL, D. R., AND JANSSON, R. K. 1994. Insect control in
sweet corn, 1991. Arthropod Manage. Tests 19: 96-
96.
SEVERIN, H. H. P., AND SEVERIN, H. C. 1915. Life histo-
ry, natural enemies and the poisoned bait spray as a
method of control of the imported onion fly (Phorbia







Florida Entomologist 93(2)


cepetorum Meade) with notes on other onion pests. J.
Econ. Entomol. 18: 342-350.
STEYSKAL, G. C. 1965. Family Otitidae, pp. 642-654 In
A. Stone, C. W. Sabrosky, W. W. Wirth, R. H. Foote,
and J. R. Coulson [eds.], A Catalog of the Diptera of
America North of Mexico, vol. 276. United States De-
partment of Agriculture, Washington, D.C.
STEYSKAL, G. C. 1968. Family Otitidae, pp. 1-31 In P. E.
Vanzolini, N. Papavero [eds.], A catalogue of the
Diptera of the Americas south of the United States.
Department de Zoologia, Secretaria da Agricultura,
Sao Paulo, Brazil.
STEYSKAL, G. C. 1987. Otitidae, pp. 799-808 In J. F.
McAlpine, B. V. Peterson, G. E. Shewell, H. J. Teskey,
J. R. Vockeroth, and D. M. Wood [eds.], Manual of Ne-


arctic Diptera, vol. 2. Agriculture Canada Mono-
graph No. 28. Research Branch, Agriculture Canada,
Ottawa, ON.
THOMPSON, F. C. 2006. Classification Notes, In N. L.
Evenhuis, T. Pape, A. C. Pont, and F. C. Thompson
[eds]. Biosystematic Database of World Diptera.
Available at http://www.sel.barc.usda.gov/Diptera/
names/FamClass.htm (verified 30 November
2009).
VALLEY, K., NOVAK, J. A., AND FOOTE, B. A. 1969. Biol-
ogy and immature stages of Eumetopiella rufipes.
Ann. Entomol. Soc. America. 62: 227-234.
VAN ZWALUWENBURG, R. H. 1917. Report of the Ento-
mologist: A new corn pest. Puerto Rico Agric. Exp.
Station 31-34.


June 2010







Chu et al: Bemisia tabaci Biotype Q in Shandong Province, China


CRYPTIC INVASION OF THE EXOTIC BEMISIA TABACI BIOTYPE Q
OCCURRED WIDESPREAD IN SHANDONG PROVINCE OF CHINA


DONG CHU12", YOU JUN ZHANG3 AND FANG HAO WAN4
1High-tech Research Center, Shandong Academy of Agricultural Sciences, and Key Laboratory for Genetic
Improvement of Crop Animal and Poultry of Shandong Province, Jinan 250100, China

2Key Laboratory of Crop Genetic Improvement and Biotechnology, Huanghuaihai, Ministry of Agriculture,
the People's Republic of China, Jinan 250100, China. 'Institute of Vegetables and Flowers,
Chinese Academy of Agricultural Sciences, Beijing 100081, China

4State Key Laboratory for Biology of Plant Diseases and Insect Pests, Institute of Plant Protection,
Chinese Academy of Agricultural Sciences, Beijing 100081, China


ABSTRACT

Bemisia tabaci (Gennadius) is an important agricultural pest worldwide. The pest is a
species complex composed of numerous biotypes, among which biotypes B and Q are the
2 most invasive and widely distributed. Our previous study found that the ratio of the
biotype Q has been increasing and displacement of biotypes B by Q has been occurring
on cotton and eggplant in Shandong Province of China during the past several years. To
determine whether biotype Q has been increasing on other hosts and possible displace-
ment of biotypes has been occurring in the province as a whole, we further surveyed B.
tabaci biotypes B and Q on cultivated and wild host species near cotton or eggplant fields
in 7 locations of Shandong Province during 2005-2008 with cleavage amplified polymor-
phic sequence (CAPS) of the mtCOI (mitochondrial cytochrome oxidase subunit I)
marker. This research showed biotype Q has been increasing on all kinds of host plants
and the displacement of biotypes B by Q has been occurring in the province as a whole.
The displacement mechanism should be further researched and such knowledge might
guide the application of the insecticides or adjustment of the crops to effectively control
the pest.

Key Words: Bemisia tabaci, biotype Q, mitochondrial cytochrome oxidase marker


RESUME

Bemisia tabaci (Gennadius) es una plaga important a la agriculture mundial. La especie
es un complejo de species compuesta de biotipos numerosos, entire ellos los biotipos B y Q
son los 2 mas invasivos y distribuidos ampliamente. Nuestro studio anterior encontr6 que
la proporci6n de biotipo Q ha ido incrementando y el desplazamiento del biotipo B por el
Q ha ido ocurriendo sobre algod6n y barenjena en la Provincia de Shangdon en China du-
rante various de los aios pasados. Para determinar si el biotipo Q se ha ido incrementando
sobre otros hospederos y si el possible desplazamiento de biotipos ha ido ocurriendo en toda
la provincia, tambien muestreamos los biotipos B y Q de B. tabaci sobre species de hos-
pederos cultivados y silvestres cerca de campos de algod6n y berenjena en 7 localidades en
la Provincia de Shandong durante 2005-2008 usando el metodo escisi6n de la secuencia po-
lim6rfica amplificado (ESPA) del marcador subunidad I de mtCOI (oxidasa citocromo mi-
tocondrial). Esta investigaci6n mostr6 que el biotipo Q se ha ido incrementando sobre toda
clase de plants hospederos y el desplazamiento de biotipo B por el Q ha ido ocurriendo en
toda la provincia. El mecanismo del desplazamiento debe ser investigado y este conoci-
miento puede guiar la aplicaci6n de insecticides o un ajuste de los cultivos para controlar
la plaga efectivamente.


Bemisia tabaci (Gennadius) is an important Some are labeled as biotypes or host races be-
agricultural pest worldwide. It damages crops cause of differences in host range, geographical
through direct feeding and vectors many plant distribution, transmission ability of plant virus,
viruses. The pest has been considered as a spe- and other biological characteristics. Biotype B is
cies complex that includes many genetic groups believed to originate from the Middle East-
that are morphologically indistinguishable. Northern Africa and have spread into many







Florida Entomologist 93(2)


countries or regions over the past 2 decades. Bio-
type Q may have originated in the Mediterra-
nean countries and circumstantial data shows
that this biotype has been introduced into many
non-Mediterranean countries or regions during
the past several years (Chu et al. 2005; Ueda
2006; Brown et al. 2007).
Bemesia tabaci outbreaks in the mid-1990s in
both Southern China and Northern China and
subsequent research showed that the whitefly
occurring in most of China was biotype B (Wu et
al. 2002). In 2003, biotype Q was found in Kun-
ming of Yunnan Province and then subsequently
found in Beijing and Henan (Chu et al. 2006).
Many populations of B. tabaci in Shandong
Province, one of the most important agricultural
provinces of China, have proved to be biotype B,
but biotype Q was discovered in 2006 by use of
mitochondrial cytochrome oxidase subunit I (mt-
COI) sequence (Chu et al. 2007). It is important
to monitor the spreading and the density of the
biotype Q because it possesses greater resistance
to many insecticides than biotype B in many
countries (Dennehy et al. 2005; Horowitz et al.
2005). The biotypes of B. tabaci on cotton and
eggplant in 6 locations within Shandong Prov-


D.Zhou


ince was determined with mtCOI sequences and
biotype B-specific primers (Chu et al. 2010), which
showed that the ratio of the biotype Q has been in-
creasing and displacement of biotypes B by Q has
been occurring during the past 4 years (2005-2008)
on these two crops. To determine whether biotype
Q has been increasing on other hosts and possible
displacement of biotypes has been occurring in the
province as a whole, we further surveyed B. tabaci
biotypes on cultivated and wild host species near
cotton or eggplant fields in 7 locations of Shandong
Province during 2005-2008.

MATERIALS AND METHODS

Bemisia tabaci biotype was determined with
the cleaved amplified polymorphic sequences
(CAPS) of mtCOI amplified with new primers
(C1-J-2195/R-BQ-2819). Adult whiteflies were
collected from different plants including crops
and weeds in 7 locations, DeZhou, ZiBo, Shou-
Guang, JiNan, LiaoCheng, LinYi and ZaoZhuang
in Shandong Province during 2005-2008
(Table 1). The adults were placed in tubes with
95% ethanol and stored at -20C. Individual
adults were ground and DNA was extracted. The


JIHAN


191

!


Fig. 1. Composition changes ofB. tabaci biotypes B and Q in Shandong Province during 2005-2008 biotype
Q; M, biotype B.


June 2010








Chu et al: Bemisia tabaci Biotype Q in Shandong Province, China 205



TABLE 1. DATA ON WHITEFLY COLLECTION AND BIOTYPE DETERMINATION BASED ON THE MARKERS.

Number of biotype Percentage of biotype (%)
Total
Location Year Host plant individuals B Q B Q

DeZhou 2006 Cotton 31 23 8 74.2 25.8
Eggplant 61 34 27 55.7 44.3
All host plants 92 57 35 62.0 38.0
2007 Tomato 21 7 14 33.3 66.7
Cotton 71 17 54 23.9 76.1
Eggplant 45 7 38 15.6 84.4
Zucchini 37 18 19 48.6 51.4
All host plants 174 49 125 28.2 71.8
2008 Cotton 27 0 27 0.0 100.0
Japanese hop 30 0 30 0.0 100.0
Eggplant 30 0 30 0.0 100.0
All host plants 87 0 87 0.0 100.0
ZiBo 2006 Cotton 45 32 13 71.1 28.9
Morning glory 20 0 20 0.0 100.0
Eggplant 25 23 2 92.0 8.0
All host plants 90 55 35 61.1 38.9
2007 Cotton 75 2 73 2.7 97.3
Eggplant 48 7 41 14.6 85.4
All host plants 123 9 114 7.3 92.7
2008 Japanese hop 28 0 28 0.0 100.0
Cotton 29 0 29 0.0 100.0
Eggplant 30 6 24 20.0 80.0
All host plants 87 6 81 6.9 93.1
ShouGuang 2006 Chinese cabbage 60 23 37 38.3 61.7
Rosebush 17 16 1 94.1 5.9
Eggplant 30 1 29 3.3 96.7
All host plants 107 40 67 37.4 62.6
2007 Tomato 49 0 49 0.0 100.0
Cucumber 24 0 24 0.0 100.0
Pepper 25 0 25 0.0 100.0
Japanese hop 66 1 65 1.5 98.5
Cotton 98 13 85 13.3 86.7
Pumpkin 62 0 62 0.0 100.0
Eggplant 57 3 54 5.3 94.7
Sweet pepper 24 0 24 0.0 100.0
Chinese cabbage 41 1 40 2.4 97.6
All host plants 446 18 428 4.0 96.0
2008 Japanese hop 29 0 29 0.0 100.0
Cotton 25 0 25 0.0 100.0
Eggplant 30 0 30 0.0 100.0
All host plants 84 0 84 0.0 100.0
JiNan 2005 Cotton 24 24 0 100.0 0.0
2006 Eggplant 28 28 0 100.0 0.0
Cotton 31 31 0 100.0 0.0
All host plants 59 59 0 100.0 0.0
2007 Cotton 47 18 29 38.3 61.7
2008 Japanese hop 24 1 23 4.2 95.8
Cotton 29 0 29 0.0 100.0
Eggplant 19 4 15 21.1 78.9
All host plants 72 5 67 6.9 93.1
LiaoCheng 2005 Cucumber 33 33 0 100.0 0.0
Cotton 39 38 1 97.4 2.6
All host plants 72 71 1 98.6 1.4







Florida Entomologist 93(2)


TABLE 1. (CONTINUED) DATA ON WHITEFLY COLLECTION AND BIOTYPE DETERMINATION BASED ON THE MARKERS.

Number of biotype Percentage of biotype (%)
Total
Location Year Host plant individuals B Q B Q


2006 Winter squash
Cotton
Morning glory
Eggplant
Cucumber
All host plants
2007 Cotton
Eggplant
All host plants
2008 Japanese hop
Cotton
Eggplant
All host plants
2006 Cotton
Eggplant
Cucumber
All host plants
2007 Cucumber
Cotton
Eggplant
All host plants
2008 Cotton
Eggplant
All host plants
2005 Cucumber
2006 Cucumber
2008 Pepper
Japanese hop
Cotton
Eggplant
All host plants


85.2
46.4
90.9
50.0
58.3
62.9
0.0
15.7
7.6
3.3
0.0
3.8
2.3
100.0
100.0
100.0
100.0
84.6
100.0
95.0
94.4
3.8
20.0
10.9
100.0
100.0
0.0
0.0
0.0
0.0
0.0


14.8
53.6
9.1
50.0
41.7
37.1
100.0
84.3
92.4
96.7
100.0
96.2
97.7
0.0
0.0
0.0
0.0
15.4
0.0
5.0
5.6
96.2
80.0
89.1
0.0
0.0
100.0
100.0
100.0
100.0
100.0


mtCOI fragment (about 620bp) was first cleaved
by the restriction endonucleases VspI (Khasdan
et al. 2005) and then the uncut fragment was
cleaved by the restriction endonucleases StuI
(Ueda 2006). All of the mtCOIthat could be cut by
VspI should be biotype Q and mtCOI cut by StuI
should be B.

RESULTS AND DISCUSSION

Our results shown in Fig. 1 and Table 1 re-
vealed the following: In 2005, the biotype of B.
tabaci populations in JiNan, LiaoCheng,
ZaoZhuang were determined and biotype Q was
only found in LiaoCheng in very low proportion
(1.4%). In 2006, biotype Q was found in DeZhou
(38.0%), ZiBo (38.9%), ShouGuang (62.6%), Li-
aoCheng (37.1%) and was absent in JiNan, LinYi
and ZaoZhuang. By 2007, biotype Q dominated in
most locations, DeZhou (71.8%), ZiBo (92.7%),
ShouGuang (96.0%), LiaoCheng (92.4%), and bio-


type Q also was found in JiNan (61.7%) and LinYi
(5.6%). In 2008, Q biotype comprised 100.0%,
93.1%, 100.0%, 93.1%, 97.7%, 89.1% and 100.0%
of the B. tabaci population in DeZhou, ZiBo, Shou-
Guang, JiNan, LiaoCheng, LinYi and ZaoZhuang,
respectively.
The present results are consistent with previ-
ous research on cotton and eggplant (Chu et al.
2010). These results suggest that the changes of
B. tabaci biotypes occurred not only on the cotton
and eggplant but also on the other plants includ-
ing crops and weeds in Shandong Province during
the past several years.
The displacement mechanism of biotypes Q
and B remains uncertain, though the increase of
biotype Q in many countries may be due to appli-
cation of insecticides because biotype Q possesses
greater resistance to insecticides than biotype B,
but ecological and economic factors should be also
considered. For example, the host plants that bio-
type Q preferred also might mediate the competi-


LinYi


ZaoZhuang


June 2010







Chu et al: Bemisia tabaci Biotype Q in Shandong Province, China


tion of B and Q. Multiple introduction ofbiotype Q
from the other provinces or regions through hu-
man activities or natural sources should not be
neglected.
Overall, our present result showed that the
biotypes of B. tabaci changed greatly and B.
tabaci biotype Q has been increasing on all kinds
of hosts during the past several years. The dis-
placement of biotypes B by Q has been occurring
in the province as a whole. The speed of the dis-
placement of biotypes B and Q was fast and es-
sentially a cryptic invasion (Geller et al. 1997) be-
cause the biotypes are morphologically indistin-
guishable.The displacement mechanism should
be further researched and such knowledge might
guide the application of the insecticides or adjust-
ment of the crops to effectively control the pest.
Differentiation of B. tabaci biotypes is important,
and molecular markers are important discrimi-
nation tools.

ACKNOWLEDGMENTS
This work was funded by the Outstanding Youth Sci-
ence Foundation of Shandong Province (JQ200811), Na-
tional Basic Research and Development Program
(2009CB119200), National Natural Science Foundation
of China (30771410), Special Scientific Research Fund
for Commonweal Trade of China (200803005) and Key
Projects in the National Science & Technology Pillar
Program in the Eleventh Five-year Plan Period
(2006BAD08A18).

REFERENCES CITED
BROWN, J. K. 2007. The Bemisia tabaci complex: genetic
and phenotypic variability drives begomovirus
spread and virus diversification. Plant Disease APS-
Net Feature Article December-January 2006-07. ht-
tp://www.apsnet.org/online/feature/btabaci/.
CHU, D., JIANG, T., LIU, G. X., JIANG, D. F., TAO, Y. L.,
FAN, Z. X., ZHOU, H. X., AND BI, Y. P. 2007. Biotype


status and distribution of Bemisia tabaci (Hemi-
ptera: Aleyrodidae) in Shandong Province of China
based on mitochondrial DNA markers. Environ. En-
tomol. 36: 1290-1295.
CHU, D., WAN, F. H., ZHANG, Y. J., AND BROWN, J. K.
2010. Change in the biotype composition of Bemisia
tabaci in Shandong Province of China From 2005 to
2008. Env. Entomol. 39. DOI: 10.1603/EN09161.
CHU, D., ZHANG, Y. J., BROWN, J. K., CONG, B., XU, B.
Y., Wu, Q. J., AND ZHU, G. R. 2006. The introduction
of the exotic Q biotype ofBemisia tabaci (Gennadius)
from the Mediterranean region into China on orna-
mental crops. Florida Entomol. 89: 168-174.
DENNEHY, T. J., DEGAIN, B. A., HARPOLD, V. S., BROWN,
J. K., MORIN, S., FABRIC, J. A., BYRNE, F. J., AND
NICHOLS, R. L. 2005. New challenges to manage-
ment of whitefly resistance to insecticides in Arizo-
na, p. 31 In University of Arizona Cooperative Ex-
tension, Vegetable Report. http://cals.arizona.edu/
pubs/crops/az1382/az 1382_2.pdf)
GELLER, J. B., WALTON, E. D., GROSHOLZ, E. D., AND
RUIZ, G. M. 1997. Cryptic invasions of the crab
Carcinus detected by molecular phylogeography.
Mol. Ecol. 6: 901-906.
HOROWITZ, A.R., KONTSEDALOV, S., KHASDAN, V., AND
ISHAAYA, I. 2005. Biotypes B and Q of Bemisia tabaci
and their relevance to neonicotinoid and pyriproxy-
fen resistance. Arch. Insect Biochem. Physiol. 58:
216-225.
KHASDAN, V., LEVIN, I., ROSNER, A., MORIN, S., KONT-
SEDALOV, S., MASLENIN, L., AND HOROWITZ, A. R.
2005. DNA markers for identifying biotypes B and Q
of Bemisia tabaci (Hemiptera: Aleyrodidae) and
studying population dynamics. Bull. Entomol. Res.
95: 605-613.
UEDA, S. 2006. Simple and rapid detection by mtCOI
PCR-RFLP to distinguish the Q biotype of Bemisia
tabaci. Kyushu Plant Protection Research 52: 44-48.
Wu, X. X., LI, Z. X., Hu, D. X., AND SHEN, Z. R. 2002. Us-
ing RAPD-PCR to distinguish biotypes of Bemisia
tabaci (Homoptera: Aleyrodidae) in China. Entomo-
logica Sinica 9:1-8.







Florida Entomologist 93(2)


June 2010


NATURAL HISTORY AND FLASH REPERTOIRE OF THE SYNCHRONOUS
FIREFLY PHOTINUS CAROLINUS (COLEOPTERA: LAMPYRIDAE) IN THE
GREAT SMOKY MOUNTAINS NATIONAL PARK


LYNN FRIERSON FAUST
11828 Couch Mill Rd., Knoxville, TN 37932
E-mail: TNLFAUST@Gmail.com

ABSTRACT

The synchronous firefly Photinus carolinus (Green) of the moist cove hardwood forests of the
Great Smoky Mountains National Park attracts much public attention during its spectacular
month-long mating display known as The Light Show. In previous studies flash synchrony
among P. carolinus males has been investigated, but little is known about its natural history
and mating behavior. This study provides additional information on the habits, flash signal
variation, mating strategies, predation and historical records ofP. carolinus. The polyandrous
females remate throughout their approximately 3-week adult lifespan, laying successive
clutches of eggs. While stationary females generally respond to male courtship signals with
a receptive doublet flash signal, they also produce a rhythmic flash while walking, and can re-
vert back to the receptive state. In this protandrous species, the average number of flashes
per flash train in male courtship signals increases after females have emerged. I describe
pseudo-female male flashes and group chaos flashing associated with mating clusters as well
as conditions causing distress flashing in both sexes. With a backdrop of changing habitat and
increasing human pressure, observations taken from the past 18 years and over 1000 h spent
in the field additionally describe male guarding of a female pupa, mate guarding via pro-
longed copulation, common predator and phorid infestation challenges for this firefly.

Key Words: synchronous flash behavior, polyandry, protandry, lightning bug, phorid

RESUME

La luci6rnaga sincr6nizada, Photinus carolinus (Green), de los bosques de madera noble en
areas humedas del Parque Nacional de las Montanas "Great Smoky" atrae much atenci6n
public durante su exposici6n espectacular de apareamiento que dura un mes conocido como
"El Espectaculo de Luz". En studios anteriores, la sincronizaci6n de los destellos entire los
machos de P. carolinus ha sido investigada, pero poco es conocido sobre su historic natural
y su comportamiento de aparearmiento. Este studio provee informaci6n adicional sobre los
habitos, variaci6n en las senales de destellos, estrategias de aparearmiento, depredaci6n y
registros hist6ricos de P. carolinus. Las hembras poliandrosas aparearon de nuevo durante
la duraci6n de su vida de aproximadamente 3 semanas, poniendo masas de huevos sucesi-
vas. Mientras que hembras estacionarias generalmente responded a las senales de cortejo
sexual de los machos con una seal receptive de un destello double, ellas tambien produce un
destello ritmico cuando estan caminando, y pueden revertir de nuevo al estado receptive. En
esta especie protandrosa, el numero promedio de los destellos por los machos en el tren de
seiales del cortejo sexual aumentan despues de que las hembras emergen. Se described los
destellos de tipo pseudo-hembra de los machos y el destello de caos del grupo asociados con
grupos de aparearmiento ademas de condiciones que causan el destello por angustia en am-
bos sexos. Con el acumulo de cambios en el habitat y la presi6n humana creciente, observa-
ciones hechas en los ultimos 18 aios y en mas de 1000 horas en el campo, adicionalmente se
described el comportamiento guard (protecci6n) de la pupa de la hembra por el macho, y la
guardia de su pareja por medio de la copulaci6n prolongada, los desafios de depredadores e
infestaciones comunes de moscas foridas para esta luci6rnaga.


Fireflies are unique; they are one of the few in- thousands of flying males which flash in discontin-
sects readily recognized and even admired by many uous synchrony (Copeland & Moiseff 1995) with
people. Among the most spectacular firefly displays each male producing flash trains containing 4-8
is "The Light Show" (Emily Faust pers.com. 1968; flashes given at 0.5 second intervals followed by 6-9
Landry 1994; Faust et al. 1998; Strogatz 2003) pro- seconds of dark, both time intervals being tempera-
duced on Jun nights by synchronizing P carolinus ture dependent. Beginning 37-43 min after sunset
males in the former logging town of Elkmont, TN (Lloyd 1966), on peak nights (Faust & Weston 2009)
(Weals 1991) within the Great Smoky Mountains thousands of males flash in unison and then go dark
National Park (GSMNP). This display consists of in unison, signaling together for up to 3 h.







Faust: Natural History of Firefly Photinus carolinus


Lloyd (1966) further detailed its range and
habitat by mapping the locations of small, scat-
tered populations stretching from the north Geor-
gia Appalachians to western Pennsylvania. Faust
& Weston (2009) added that this species is found
in lower elevations as it moves higher in latitude
and appears earlier in the season the further
south it is found. Green (1956), when first describ-
ing the morphology and range of P carolinus, con-
sidered this "an Appalachian offshoot of the more
northern P ardens Leconte". Bole (2001) offered
additional contemporary evidence linking P car-
olinus closely to P consimilis Green and P ardens.
Lloyd (1966), Copeland & Moiseff (1995), and
Bole (2001) provided excellent studies on the de-
tails of P. carolinus flash signals under natural
and controlled settings. While males signal in
flight, females remain stationary and well-hid-
den in the leaf litter or low ground cover. Fe-
males respond to male advertisements by emit-
ting a receptive doublet flash given midway
through the 6 s dark phase, averaging 3 s after
the final flash of the male flash train (Bole 2001;
Moiseff et al. 2001). Copeland et al. (2008) de-
scribed male landing distance to the signaling
females and Moiseff et al. (2001) the formation of
competitive male mating clusters around the re-
ceptive female, involving both satellite and nu-
clear males.
Marshad et al. (2008) designed a bioengineer-
ing model for analyzing the visual performance of
the sexually dimorphic eyes ofP. carolinus. Faust
& Weston (2009) presented a degree-day predic-
tion model and described the phenology of P. car-
olinus and 13 additional East Tennessee lampy-
rids. Photinus carolinus is protandrous, with the
first males appearing on May 24 on average, ap-
proximately half-peak male abundances reached
by Jun 5, first females by Jun 9, with the final
night of peak male activity being Jun 11 (Faust &
Weston, 2009).
This paper seeks to elucidate aspects of the
natural history of the southern Appalachian pop-
ulations of P carolinus, occurring primarily in the
GSMNP or private lands bordering the Park. Em-
phasis is on descriptions of male and female mat-
ing, non-courtship flash variations and compari-
sons of the 2 different female flash behaviors as
related to mating receptivity, polyandry, remat-
ing, ovipositing and phorids. Historical records of
the presence of this species through the past 60
years in the GSMNP is provided as is a brief dis-
cussion of the changing impact of man and the
habitat on this species.

MATERIALS AND METHODS

Study Sites

In the GSMNP, P. carolinus is found in the
highest densities at 732m (2400'), though isolated


individuals have been found as low as 488m
(1600') and as high as 1524 m (5000').
Photinus carolinus is found in the maturing
second growth cove hardwood forests in mountain
river valleys throughout the National Park. Tulip
poplar (Liriodendron tulipifera L.) is the primary
tree with oak (Quercus alba L. and Q. rubra L.),
maple (Acer saccharum L.), yellow buckeye (Aes-
culus octandra Marsh), hemlock (Tsuga canaden-
sis L.) and Rhododendron maximum L. with dog-
hobble (Leucothoe fontanesiana Steudal) also com-
mon. The prime display areas are open woodlands
bordering former or current open areas and aban-
doned railroad grades and trails, often near or on
a steep hillside and within a 100 m of a stream or
river. The rainfall averages 168 cm/yr (66") (NADP
2007) in these temperate near-rain forest moun-
tain valleys. Night temperatures during the mat-
ing season typically range from 15-21C (59-70F).
Every summer since 1992, the author has trav-
eled to Elkmont, TN in Sevier Co. (3539'13"N,
8334'50"W) in the GSMNP to observe P. caroli-
nus from the nights of first male emergence in
late May, through the peak display season in mid
Jun, until the final nights of the last remaining P
carolinus of the season in early Jul. Additional
sites within and just outside of the Park have
been utilized for observations and collections.

Field Observations

Nightly field notes, data charts and observa-
tions regarding all aspects of the P carolinus life
history were recorded from over 1000 h spent in
the field in the past 18 years. Additionally, for the
past 5 years, a Kodak Z740 Easyshare, an Olym-
pus SW720, a Sony super-nightshot Handycam
DCR-HC48, and a Bushnell Nightwatch 26-0224
night vision scope have been used to visually
record thousands of observations. An Olympus
VN2000 pocket voice recorder, a Digiwalker
SW651 stopwatch, a Mannix HDT303K digital
thermometer, and a Petzl TacTikka XP LED
Headlamp with blue filters were used for data col-
lection and observation. An Omano 7.5x-35x Ste-
reo Trinocular Microscope was used for details,
egg, phorid and external parasite counts.

Study Organism

Field marks for correctly identifying P carolinus
in its native setting were determined as there are at
least 13 Lampyridae species commonly found in
Elkmont during the P carolinus season including
Photinus pyralis L., P macdermotti Lloyd, P mar-
ginellus Leconte, P carolinus, Photunis versicolor
complex Fab and P lucicrescens complex Barber,
Pyractomena borealis Randall and P angulata Say,
Phausis reticulata (early and late varieties) Say,
Ellychnia corrusca L., Lucidota atra and Pyropyga
minute Leconte. Additionally, since P carolinus are







Florida Entomologist 93(2)


difficult to find except during mating flight times,
concentrated effort was made in 2007, 2008, and
2009 to determine the after-display and daytime lo-
cation of P carolinus and where captured adults go
upon release. NPS permit (Faust #GRSM-2009-
SCI-0026) guidelines stress sample numbers must
be kept as low as possible to protect this resource in
the National Park.

Male and Female Flash Repertoires

Photinus carolinus frequently exhibit different
types of flash behavior in addition to the species-
specific courtship flashes. Behavior was recorded
with data sheets, voice recorders, video cameras,
and a stopwatch to more accurately describe the
appearance and context for 5 additional flash be-
haviors: walking/flashing female, pseudo-female
male flash, male/female dialogue single flashing,
group chaos flashing, and distress flashes.

Variation in Male Flash Signals

In May through Jul 2007 and 2008, I examined
whether male flash signals changed after females
had emerged. Over 4500 individual flashes (617
flash trains) ofP. carolinus were counted by 3 ob-
servers using data sheets and voice recorders be-
ginning on the earliest nights of first male emer-
gence, and continuing until the final nights of the
mating season 6 weeks later. Times, weather,
moon phase, and temperatures during flash train
counts were recorded. No display occurred below
10C. We only recorded trains produced by flying
males in which the first flash in the train was
seen. Because of their predictable rhythm and
flight path, individuals could be followed for an
entire flash train. Any counts that could have in-
cluded more than 1 male were discarded. Stu-
dents t-test compared male flashes within each
flash train before females emerged (early season)
to flash numbers per flash train after females
were present (later season).

Female Flash Behavior, Mating/Remating, and Oviposi-
tion

From Jun 12-24, 2009, 20 P. carolinus females
were captured and labeled as displaying either
the typical receptive female flash or the more
rhythmic walking/flashing flash to determine if
flash behavior indicated future mating, remating
and oviposition outcomes. Females were kept sep-
arately in 4-oz containers with dampened filter
paper and a small amount of moss and soil from
their collection site, at natural temperatures, hu-
midity and photoperiod. Field-captured males
were placed into females' containers at dusk each
night, and pairs were observed with blue light ev-
ery 15 min for mating activity. A couple was
counted as mated if stage 2 copulation, in which


spermatophore transfer occurs (Lewis & Wang
1991; Demary & Lewis 2007), was achieved for at
least 1 h. Each morning males were removed and
all eggs were counted and set aside for release. To
compare mating outcomes for females exhibiting
walking-flashing vs. receptive flash behavior, the
percentage of females that mated at least once
was compared between groups by Fisher's Exact
test on a 2 x 2 table. This test also was used to
compare percentage of females that remated be-
tween these 2 groups. For all captive males and
females, the presence and number of mites and
parasitic phorid larvae (Brown 1994; Lewis &
Monchamp 1994) on or emerging from each host
was noted. The percentage of females parasitized
by phorid flies was compared between 2 separate
P. carolinus populations by Fisher's Exact Test.

Photinus carolinus and Man

Interviews were conducted with former resi-
dents of Elkmont, fishermen, campers, Eastern
Band of the Cherokee Nation tribal elders, and
manuscripts for records of when this synchronous
species was first noticed in the Elkmont area and
the Cherokee lands of Shaconage, now known as
GSMNP Additional information was gathered on
the presence of and changing perceived densities
of this species in specific locales around Elkmont
through the past 50 years and the impact of man
on the habitat of this species in these same years.

RESULTS

Field Marks for Identifying P. carolinus

Averaging a live total body length of 12.5 mm,
P. carolinus falls midway in size between the
larger P. pyralis and the smaller P. macdermotti
and P. marginellus, all of which can be found
flashing in Elkmont during the P. carolinus sea-
son in similar habitats (Fig. 1). Both sexes often
have a noticeable black margin on the anterior
lateral aspects of the black, pink and opaque
pronotum. Though alate (winged), the female,
who is often slightly wider than the male, is
rarely seen flying. Females have 1 dimpled half
moon shaped lantern in the center of abdominal
sternite 6; males have 2 lanterns on sternites 6
and 7 (Fig. 2a, b, c). As opposed to the other very
morphologically similar local Photinus species,
which sometimes have light abdominal markings
near the lanterns on the ventral surface, both
male and female P. carolinus are usually dark
ventrally except for the lanterns. I have noted
that it is often easier to distinguish similar firefly
species in the field by comparing female (if avail-
able) lantern shape and structure vs. male com-
parisons. Adults occasionally have retained vesti-
gial larval lanterns. Males fly flashing their syn-
chronous display in roughly horizontal flight


June 2010






Faust: Natural History of Firefly Photinus carolinus


P.macdermotti
P. macdermotti







irm


. -- W


% I


. V .:


- -'
-*" *"


Fig. 1. Size comparison of Photinus macdermotti (L) and Photinus carolinus (R). Because 13 sympatric Lampryid
species occur in Elkmont in Jun, proper field identification is critical.


paths 1-3 m off the ground covering up to 5 m per
flash train. These field marks, combined with the
distinctive male flash train pattern, the female
doublet and response delay, the specific habitat,
seasonality, and elevation parameters make field
identification relatively reliable in the GSMNP.
At the end of the evening's mating flight, the
majority of the P carolinus males appeared to
flash their final train as they rose high into the
treetops. In 2009, captive males (n = 20), released
at their original collection site during the day,
flew up into the trees instead of seeking shelter in
the dense, lower ground vegetation. By season's
end many of the males were perched instead of
flying as they flash during their nightly display
time.

Life Cycle Observations
Eggs. Egg counts from 1993-2005 showed that
captive P. carolinus females (n = 21) laid an aver-
age of 24 (range 1-83) off-white, 0.75-1.0 mm eggs
in up to 4 successive clutches over a period of 1-13
d. If provided with a sprig of moss or native soil,
the captive female individually placed each egg;
otherwise, egg retention was common with all the
eggs being expelled in a mass just prior to death.


Larvae. Photinus carolinus larvae, because of
their subterranean habit, were seldom seen in the
wild. In Jul 1993, I hatched 44 P. carolinus larvae
from 47 eggs laid 18 d earlier. Laterally pink,
these tan-brown-gray smooth, narrow-bodied 2-3-
mm larvae were fed tiny earthworms. The 25-d-
old larvae died in their second instar when their
container was accidentally destroyed. Typical of
other Photinus larvae, the larvae had active mul-
tifingered pygopodia (caudal tail organ) and 3 lon-
gitudinal pale dorsal lines. It is unknown
whether P. carolinus larvae become dormant in
the cold winter months or simply dig deeper into
the soil. As the time for pupation nears in May,
the occasional final instar (n = 3) appeared under
the leaf litter, often near damp rotting logs or
moss, where, glowing, they soon pupated.
Pupae. In Jun 2006, an adult male P carolinus
was observed clasping the body of a glowing pink
pupa which closed into an adult female 6 d later.
Two other P carolinus males with antennae ac-
tively moving, and 1 pair in copula were found on
top of the moss <5 cm above where the female
pupa and the adult male lay buried. Because I re-
moved only the female to gain a positive sexual
identification upon eclosion, the male was pre-
vented from further guarding the pupa.







Florida Entomologist 93(2)


IfI -
At-


Fig. 2. 2a, Comparison of female (L) and 2b, male lanterns (R). In the field, the female lanterns of the sympatric
species are often more distinct than the male lanterns. 2c, Stage 2 copulation. The female (L) is often slightly wider
posteriorly than the male (R).


Male and Female Flash Repertoire

Female walking/flashing behavior. In addition
to the typical doublet response flash given by re-
ceptive females, P carolinus also displayed walk-
ing/flashing behavior. This very rhythmic flash
was most often seen on or after peak nights, usu-


ally more than an hour after sunset. Females pro-
duced these rhythmic doublet flashes every 1.2-
2.5 s while walking out in the open. Walking!
flashing females were highly visible and active,
with antennae moving rapidly, and often hopped
and flew <15 cm, then continued walking rapidly.
This very conspicuous flash did not appear to at-


June 2010







Faust: Natural History of Firefly Photinus carolinus


tract males. On cool evenings (below 15'C) the
walking/flashing females often approached hu-
mans crouched on the ground and care needed to
be taken not to crush them. Females also sought
out the softer margin of the raised gravel (former)
railroad bed, which measured as much as 1C
warmer than the road-bed. Walking/flashing fe-
males appeared particularly vulnerable to the
large crowds coming to see The Light Show, as
they were the most exposed to trampling, as well
as easiest to see and to capture.
Male and female single flashing courtship dia-
logue. When a male and female P. carolinus be-
gan their close range mating dialogue, the male
switched from his multi-flash courtship signal to
give single flashes as he began to circle the fe-
male. At this point, the female also often switched
to give single flashes, although occasionally she
continued her doublet flash. During this dialog of
alternating, aimed flashes the male continued to
approach the female, first flying, then walking. In
the absence of competing males, these pairs usu-
ally achieved Stage 2 copulation within minutes
(Fig. 2c). Once coupled, females occasionally con-
tinued to sporadically emit single flashes or dou-
blets, and males sometimes gave slower than nor-
mal flash trains, but generally the couple ceased
flashing and moved to a sheltered location (un-
dersides of leaves or beneath leaf litter). If uncov-
ered, the female often attempted to crawl back
under cover, pulling the male backwards behind
her. Copulations often lasted until dawn with
mean duration of 11.4 1.0 h (n = 5).
Chaos flashing behavior Chaos describes the
sudden appearance of rapidly alternating, single
flashes emitted by multiple males gathered <20
cm around a single responding female. Looking
like a miniature laser show, chaos lasted less than
10 s before ending abruptly. When examined (with
a night vision scope or infrared camera) within
minutes after chaos flashing stopped, many males
were found in a tight cluster around the female,
often completely obscuring her from view; some-
times these males formed stacks of up to 6 males
on the female. These clustered males grappled
with one another by shoving, pushing, and dis-
lodging their competitors from the back of the fe-
male. Eventually, 1 male succeeded in achieving
Stage 1 mating with the female. However, females
were often observed rejecting these apparently
successful males after a few minutes in Stage 1 by
dislodging, twisting, or walking away from the
suitor who initially attempted to remount the fe-
male. When rejection did occur, scramble competi-
tion (Demary et al. 2006) described by (Copeland
et al. 2008) as frenzy resumed among the nuclear
males that remained, and a new cluster quickly
reformed around the female. Chaos flashing did
not normally recur this second time.
From years of field observations and video
footage review it appeared that both large and


small males were successful in securing Stage 2
copulations with females, although body size
could not be measured without disturbing the
clusters. Larger males appeared to have the ad-
vantage when shoving their way in to reach the
female, but the smaller males appeared more ag-
ile, and could slip into the cluster more easily.
Flashing does not appear important at this stage
of courtship.
Male pseudo-female flash behavior. Courtship
clusters of up to 30 males competing for 1 recep-
tive female have been described by Moiseff et al.
(2001) and Copeland et al. (2008). It was not un-
common in the mating clusters for the female to
reject a male after a few minutes of Stage 1 copu-
lation. When this occurred, the rejected male of-
ten gave female-like rhythmic doublet flashes re-
peated every 1.5-2.5 s while crawling away from
the cluster and female. Other males were often
attracted to this pseudo-female flashing and
dropped from the air or abandoned the female
they were courting to briefly follow this doublet-
flashing male. After crawling some distance from
the cluster, rejected males were observed resum-
ing their typical courtship flash pattern.
Distress flashing. Photinus carolinus adults
caught in spider webs or by harvestmen (Pha-
langiidae) emitted rhythmic flashes repeated ev-
ery 1.5-3 s. These distress flashes were sometimes
simple single flashes, while at other times they
appeared bimodal (as in female response dou-
blets). Distress flashes were produced by both
sexes, and also occurred when adults had fallen
into water, got caught in rhododendron sap or be-
come injured. Distress flashing often attracted
other males that subsequently became caught.
When males giving distress flashes were removed
from the water or spider webs, they often re-
sumed their normal courtship flash trains after a
short recovery.

Variation in Male Flash Signals

Flash trains given by P carolinus males had
significantly more flashes/pulses later in the sea-
son after females had emerged compared to flash
trains before female emergence (Fig. 3; Student's
t = 9.93, df = 615, P < 0.0001). Across both years,
the overall average was 6.77 flashes per male
flash train (n = 617 flash trains or > 4500 pulses),
although on peak nights male flash trains in-
cluded as many as 9-11 flashes, compared to the
earliest nights where many 4 pulse flash trains
were seen. On the nights included in this study,
early season temperatures averaged 22.4C; late
season averaged 20.6C.

Female Flash Behavior and Mating/Remating

During 2009, females that were collected giv-
ing either the normal courtship receptive (n = 6)







Florida Entomologist 93(2)


L-

SU6-






CU
Sa



jII


: : : : : : :
: : : : : : :
: :: :


: :: ::


:::::::::


:: ::::::


Fa a a-


-r


I I
Absent Present


Females
Fig. 3. Number of flashes per flash train given by P.
carolinus males early season, before females have
emerged (5.84, n = 102 flash trains) vs. late season when
females are present (6.91, n = 515 flash trains); means
+ SE shown.


doublet response or walking/flashing (n = 9) be-
havior were tested for receptivity to mating, re-
mating, and subsequent egg laying. When R car-
olinus females in captivity were given access to
males, there was no significant difference in the
proportion that mated between walking-flashing
vs. receptive females (Fisher's Exact test, P =
0.329). Similarly, there was no significant differ-
ence in the proportion of females that remated be-
tween these 2 groups (Fisher's Exact test, P =
0.200).
In 2-13 d of captivity, 10 P. carolinus females
with both flash behaviors mated 23 times (range
1-5). Although prior mating and ovipositing his-
tory was unknown before capture, both types of
females laid eggs, with clutch sizes ranging from
1-44 eggs in up to 4 separate clutches. Walking-
flashing females averaged 3.4 d (n = 5) until first
oviposting and receptive flash females averaged
3.5 d (n = 6). Parasitic phorids were found in fe-
males showing both flash behaviors (Table 1).

Natural Enemies

Orb-weaving spiders (Araneidae) prey on P.
carolinus. Late at night, after all courtship flash-


June 2010


ing had ceased, often the only lights visible were
the rhythmic distress flashes or the steady glow of
fireflies caught in webs. In addition, harvestmen
(Phalangiidae) often were seen carrying glowing
pupae, adult fireflies, or only the still glowing fire-
fly lantern, perhaps scavenged from another
predator. Incidence of mites on P. carolinus is low.
Though local Photuris fireflies readily eat cap-
tive R carolinus and regularly fly and signal
within the dense display areas of male P. caroli-
nus, predation by Photuris sp. of R carolinus in
the wild has not yet been observed.
Phorid flies (Apocephalus antennatus Malloch)
parasitize Photinus fireflies by ovipositing eggs
within the firefly's body (Brown 1994; Lewis &
Monchamp 1994), and these parasitoid larvae
were found emerging from R carolinus males and
females. In 2009, a significant difference (Fisher's
Exact test, P = 0.0048) in degree of phorid infes-
tation was noted between captive populations of
R carolinus females from 2 different watersheds
within the GSMNP with 62.5% (n = 8) parasitized
at one site; none (n = 11) were parasitized at the
other site (Table 1).

Local Ethnology of Photinus carolinus and Man

From interviews conducted in 2005 and 2008,
native American Cherokee Nation tribal elders
Jerry Wolf of Cherokee, NC, Alfred Wolf of the
Snowbird Blue Clan, and Dr. Michael Abram,
folklorist of the Cherokee Tribal Museum, agree
that, although named atsisdadagesgoya, mean-
ing "bug that makes a spark", there is no mention
of fireflies in their tribal history and mythology.
This is consistent with previous descriptions of
pre-1900 Cherokee culture, which also noted lack
of any mention of fireflies (Moodyl912). This
omission is curious, as much of the traditional
tribal lands in and surrounding the GSMNP are
prime P.carolinus habitat, in addition to shelter-
ing at least 20 additional local firefly species
(Mayor 2006).
Former residents of Elkmont first remember
seeing The Light Show in the early 1960s when
the display occurred over 2 kilometers upstream
of the Elkmont community in more mature forest.
By the 1970s, the Light Show had spread down
river and was visible in the open mown lawns and
surrounding forest of the Little River portion of
Elkmont, but not on the upper Jakes Creek Rd of
Elkmont a kilometer away. After the removal of
the Elkmont street lights in 1995, there appeared
to be an explosion of P. carolinus throughout the
entire community. This expansion could addition-
ally be related to the growing openness of the ma-
turing forest, which was approaching 75 years or
more in most areas of the Park. In 2009, Photinus
carolinus continued to be abundant throughout
the open forest surrounding the community, but
R carolinus had disappeared from the previously







Faust: Natural History of Firefly Photinus carolinus


TABLE 1. INCIDENCE OF PHORID PARASITOIDSAPOCEPHALUS ANTENNATUS AND OVERALL FECUNDITY IN P. CAROLINUS
FEMALES COLLECTED JUN 2009 FROM 2 LOCATIONS IN THE GSMNP.

Total % Ave # phorid larvae % firefly Ave # of eggs per
Location in GSMNP # females parasitized per infected female ovipositing ovipositing female

Little River watershed 8 62.5 5.8 50 5.2 4.4
West Prong Watershed 11 0 0 78 13.3 12.8


mown lawn areas, which had become tangled
thickets since the NPS vacated the residents and
their lawn mowers from Elkmont in 1992.
Prior to 1992, Elkmont was a quiet summer re-
treat where residents, before going to bed, ob-
served The Light Show from their porches. Since
2000, each year as many as 26,000 visitors come
to see The Light Show during its 10-d peak sea-
son, with the accompanying trampling of the
ground and vegetation. Flickering flashlights, the
now mandatory NPS visitor "firefly-shuttle"
buses, human noise, bug spray, and general dis-
turbance that up to 2000 people a night cause to
a normally quiet, dark area, all create potential
impacts to this population. Despite the crowds,
however, the Light Show remains breathtakingly
spectacular on peak nights (NPS 2009).

DISCUSSION

This study provides new descriptions of varia-
tion in the flash behavior of male and female P.
carolinus observed in the field, and also provides
new information on their mating system. This
study documents a major change in male flash be-
havior, with males producing more flashes per
flash train once females have emerged; on peak
nights, male flash trains can contain up to 11
flashes. This finding agrees with Carlson & Cope-
land's (1985) discussion of how male firefly
flashes are dependent on state of arousal; and
also agrees with Bole (2001), who found that fe-
male P carolinus are more likely to respond to
male flash trains containing more than the aver-
age of 6-7 flashes. In other Photinus species, such
selection pressure from females preferring more
conspicuous male flashes is balanced by increased
predation costs for these flashier males (Demary
& Lewis 2006; Woods et al. 2007).
Several male flash behaviors are described
here for P. carolinus for the first time. Photinus
carolinus males that have been rejected after con-
tacting a female sometimes produce doublet
flashes resembling those of females. Papi (1969),
Lloyd (1979), and Cicero (1983) described pseudo-
female flashes given by males under similar cir-
cumstances of intense male-male competition in
several other firefly species. The group flash in-
teraction that takes place during chaos flashing
in P carolinus has not yet been described in other
synchronic or Photinus species. Further studies


will be needed to determine whether this chaos
display signifies male to male competition, ag-
gression, communication of intent, species identi-
fication, male and/or female choice, or is simply
the accumulated visual spectacle created when
many courting males engaged in flash dialogues
with 1 female in a small area. Though witnessed
infrequently, chaos display is used by researchers
to find the cryptic females and evolving clusters.
The P. carolinus distress flash described here
could be considered similar to the non-courtship
or agitated flashes that have been discussed by
Lloyd (1984), Carlson & Copeland (1985) and
Buck (1990) in other species. Because they are
quite common, the function of these other flash
behaviors calls for further investigation.
This study also provides new information
about different female flash behaviors and P. car-
olinus mating systems. Females displaying both
the receptive doublet response flash and walking/
flashing behavior were observed to mate, to ovi-
posit, and often to remate on succeeding nights.
The high percentage of female remating clearly
demonstrates that P carolinus females are poly-
androus like many, but not all, other Photinus
species (Wing 1984, 1985; Lewis & Wang 1991;
Lewis & Cratsley 2008). The unexpected finding
of large differences in phorid infestation between
separate populations needs to be explored fur-
ther. The function of the walking/flashing female
behavior remains unknown, although the fact
that this behavior is exhibited by females cross-
ing open areas is consistent with its being used as
an aposematic warning signal. This flash behav-
ior is unlikely to signal oviposition readiness, as
no difference in egg-laying behavior was observed
between the receptive flashing females and the
walking-flashing females.
In many Photinus species, males transfer sper-
matophores to females (Lewis et al. 2004), and
comparisons of male reproductive structures sug-
gests that this also occurs in P. carolinus (Demary
& Lewis 2007). Spermatophore-producing Photi-
nus species have longer copulation durations
(Wing 1985; Lewis & Cratsley 2008), which is con-
sistent with the prolonged copulations seen here
in P. carolinus. Such prolonged copulations may
serve as copulatory mate-guarding, as they ex-
ceed the time required for spermatophore trans-
fer (Lewis & Wang 1991; van der Reijden et al.
1996).







Florida Entomologist 93(2)


Several previous studies have described court-
ship interactions in other Photinus species. As in
other Photinus species (Cicero 1983; Vend &
Carlson 1998), P carolinus females often con-
tinue responding to other males' signals after es-
tablishing a flash dialog with 1 male; this aug-
ments male competition and potentially increases
female mate choice. As in other species, males are
also attracted to male-female dialogs and aggre-
gations of males. Direct interference competition
among males appears intense in P carolinus, and
the mating clusters described here are similar to
Maurer's (1968) "love knots" described in P pyra-
lis. Scramble competition among males, found in
many species (Lloyd 1979; Vend & Carlson 1998;
Demary et al. 2006) appears common. Photinus
carolinus females appear to exert mate choice
even in these clusters, as often females were seen
to reject males during the first, dorsal-mounting
stage of copulation by twisting or tucking the ab-
domen or walking away from the rejected male
and then proceed to copulate with a different
male. Much more work is needed to further un-
derstand the evolutionary dynamics of these
large mating clusters and the roles of male and fe-
male choice.
Finally, the observation of an adult male P. car-
olinus guarding a female pupa suggests the possi-
bility that some matings may occur without any
flash interaction. Pyractomena borealis males of-
ten locate and guard both female larvae (unpub-
lished data) and pupae (Lloyd 1997) for several
weeks until female eclosion; males then couple
with the newly emerged female adults, often
while the general female is still in the white, un-
tanned cuticle stage (unpublished data). Buck
(1938), Lloyd (1979), Lewis & Wang (1991), and
Copeland et al. (2008), noted the high male/fe-
male ratio for various firefly species including P.
carolinus. If future studies show male guarding of
female pupae or adults to be a common behavior,
then it could be possible that human observers
simply never see some of the females who could be
mated as soon as they eclose, thus slightly skew-
ing the perceived operational sex ratio of these
polyandrous females.

CONCLUSIONS

Unlike so many other firefly sites in the USA
and the world, the GSMNP fireflies are relatively
unaffected by light pollution and habitat destruc-
tion, although human presence is certainly in-
creasing (GSMNP 2009). I hope that these obser-
vations on flash behavior, mating systems, natu-
ral history, and parasitoid challenges will help in
the management, conservation, field identifica-
tion, and understanding of Photinus carolinus
and ultimately other Lampyridae. No species can
be properly conserved until it can be easily iden-
tified and its life history is known. After 18 years


of studying Photinus carolinus and a lifetime of
appreciating their display as a thing of magic and
beauty, I am constantly humbled by how much re-
mains to be learned about this tiny bright crea-
ture.


ACKNOWLEDGMENTS

I thank my mother-in-law Emily Faust for first shar-
ing The Light Show with me almost 40 years ago; Jon Co-
peland, Andy Moiseff and Albert Carlson for 17 years of
answers and firefly nights; Jim Lloyd, Joe Cicero, and
Marc Branham for patiently responding to a never end-
ing barrage of questions about fireflies and their identi-
ties; Sara Lewis for advice, statistical help, and the 2009
season. I thank my husband Edgar and 3 sons, Will,
Hugh, and Ted for much encouragement, help in the
field, and feedback. I thank The Great Smoky Mountains
National Park, Keith Langdon, Adriean Mayor, Becky
Nichols, and Paul Super for providing the opportunity to
increase our understanding of the world of fireflies.

REFERENCES CITED

BERRY, W. 1983. The Earth Speaks. The Institute for
Earth Education. West Virginia, 182p.
BOLE, G. M. 2001. The Role of Sexual Selection in Spe-
ciation in Two Firefly Species, Photinus ardens and
Photinus carolinus. PhD Dissertation. State Univer-
sity of New York.
BROWN, B. V. 1994. Coleopterists Bull. Life history pa-
rameters and new host records of phorid (Diptera;
Phoridae) parasitoids of fireflies. 48(2): 145-147.
BUCK, J. 1938. Synchronous rhythmic flashing for fire-
flies. II. Q. Rev. Biol. 13: 301-314.
BUCK, J. 1990. Unisex flash controls in dialog fireflies.
Biol. Bull. 179: 87-95.
CARLSON, A. D., AND COPELAND, J. 1985. Flash commu-
nication in fireflies. Q. Rev. Biol. 60: 415-436.
CICERO, J. M. 1983. Lek assembly and flash synchrony
in the Arizona firefly Photinus knulli. The Coleopter-
ists Bull. 37: 318-342.
COPELAND, J., AND MOISEFF, A. 1995. The occurrence of
synchrony in the North American firefly Photinus
carolinus (Coleoptera: Lampyridae). J. Ins. Behav. 8:
381-394.
COPELAND, J., MOISEFF, A., AND FAUST, L. 2008. Land-
ing distance in a synchronic North American firefly.
Physiol. Entomol. 33: 110-115.
DEMARY, K. C., MICHAELIDIS, C., AND LEWIS, S. 2006.
Firefly courtship: behavioral and morphological pre-
dictors of male mating success in Photinus green.
Ethology 112: 485-92.
DEMARY, K., AND LEWIS S. M. 2007. Male courtship at-
tractiveness and paternity success in Photinus gree-
ni fireflies. Evolution 61: 431-439.
FAUST, L., MOISEFF, A., AND COPELAND, J. 1998. The
night lights of Elkmont. Tennessee Conservationist
64, No.3: 12-15. http://www.tennessee.gov/environ-
ment/tn consv/archive/
FAUST, L. F., AND WESTON, P. 2009. Degree-day predic-
tion of adult emergence of the firefly Photinus caroli-
nus. Environ. Entomol. 80: 1505-1512.
GREEN, J. 1956. Revision of the nearctic species of Photi-
nus (Coleoptera: Lampyridae). Proc. Calif. Acad. Sci.
28: 561-613.


June 2010







Faust: Natural History of Firefly Photinus carolinus


LANDRY, B., BILLMAN, L., AND MILLS, D. 1994. The
Heartland Series: The Light Show. WBIR-TV, Knox-
ville, TN. Vol. 19, No. 20.
LEWIS, S. M., AND WANG, O. 1991. Reproductive ecology
of two species of Photinus fireflies (Coleoptera:
Lampyridae) Psyche. 98:293-307.
LEWIS, S. M., AND MONCHAMP, J. D. 1994. Sexual and
temporal differences in Phorid parasitism of Photi-
nus marginellus fireflies (Coleoptera: Lampyridae).
Ann. Entomol. Soc. America 87: 572-575
LEWIS, S. M., CRATSLEY, C. K., AND ROONEY, J. 2004.
Nuptial gifts and sexual selection in Photinus fire-
flies. Integrative and Comp. Biol. 44(3): 234-237
LEWIS, S. M., AND CRATSLEY, C. K. 2008. Flash signal
evolution, mate choice, and predation in fireflies. An-
nu. Rev. Entomol. 53: 293-321.
LLOYD, J. E. 1966. Studies on the Flash Communication
System in Photinus Fireflies. Mus. Zool., University
of Michigan 130: 1-95.
LLOYD, J. E. 1979. Sexual selection in luminescent bee-
tles, pp. 293-342 In M. S. Blum and N. A. Blum [eds.],
Sexual Selection and Reproductive Competition in
Insects and Arachnids, New York, Academic
Press.463 pp.
LLOYD, J. E. 1984. Evolution of a firefly flash code. Flor-
ida Entomol.67: 228-239.
LLOYD, J. E. 1997. Firefly mating ecology, selection and
evolution, pp. 184-192 In J. C. Choe and B. J. Crespi
[eds.], The Evolution of Mating Systems in Insects
and Arachnids, Cambridge University Press, Cam-
bridge, UK.
MARSHAAD, H. A., CORDLESS, A., COPELAND, J., AND MOI-
SEFF, A. 2008. A method for measuring the surface
features of the firefly (Lampyridae) compound eye. J.
Entomol. Sci. in press.
MAURER, U. 1968. Some Parameters of Photic Signaling
Important to Sexual and Species Recognition in the
Firefly Photinus pyralis. Masters thesis. State Univ.
N.Y., Stony Brook. 114 pp.
MAYOR, A. 2006. National Park Service. Great Smoky
Mountains National Park. Gatlinburg, Tennessee.
Discover Life in America. DLIA. All Taxa Biodiversi-
ty Inventory. http://www.dlia.org/atbi/species/Ani-
malia/Arthropoda/Insecta/Coleoptera/Elateroidea/
Lampyridae


MOISEFF, A., AND COPELAND, J. 1995. Mechanisms of
synchrony in the North American firefly, Photinus
carolinus (Coleoptera: Lampyridae). J. Ins. Behav. 8:
395-407.
MOISEFF, A., COPELAND, J., KUBKE, F., AND FAUST, L.
2001. Mating Behavior of a synchronous firefly. Bi-
oluminescence and Chemiluminescence. 11: 153-
156.
(NADP) NATIONAL ATMOSPHERIC DEPOSITION PRO-
GRAM. 2007. Location TN11, Elkmont. http://
nadp.sws.uiuc.edu/sites/siteinfo.asp?id=TN11&net
=NTN
(NPS) NATIONAL PARK SERVICE. 2009. http://
www.nps.gov/grsm/parknews/firefly-09.htm
MOONEY, J., AND ELLISON, G. 1992. History, Myths, and
Sacred Formulas of the Cherokees. Bright Mountain
Books Inc., 206 Riva Ridge Drive Fairview, North
Carolina 28730. 397p.
PAPI, F. 1969. Light emission, sex attraction and male
flash dialogues in a firefly, Luciola lusitanica
(Charp.). Monit. Zoo. Ital. (N.S.) 3: 135-184.
STROGATZ, S. 2003. Sync, The Emerging Science of
Spontaneous Order. Hyperion, 77 West 66 St. NY,
NY, 10023-6298. 338 pp.
VAN DER REIJDEN, E. D., MONCHAMP J. D., AND LEWIS
S. M. 1997.The formation, transfer, and fate of sper-
matophores in Photinus fireflies (Coleoptera:
Lampyridae). Can. J. Zool. 75: 1202-1207.
VENCL F., AND CARLSON, A. 1998. Proximate mecha-
nisms of sexual selection in the firefly Photinus pyra-
lis (Coleoptera: Lampyridae). J. Insect Behav. 11:
191-207.
WEALS, V. 1991. The Last Train to Elkmont. Olden
Press, Knoxville, TN.
WING, S.1984. Female monogamy and male competition
in Photinus collustrans (Coleoptera: Lampyridae).
Psyche. 9: 153-160.
WING, S. 1985. Prolonged copulation in Photinus mac-
dermotti with comparative notes on Photinus collus-
trans (Coleoptera: Lampyridae). Florida Entomol.
68: 627-634.
WOODS, W. A., HENDRICKSON, H., MASON, J., AND
LEWIS, S. 2007. Energy and predation costs of firefly
courtship signals. American Nat. 170: 702-8.







Florida Entomologist 93(2)


June 2010


WILD FLORIDA HOUSE FLIES
(MUSCA DOMESTIC) AS CARRIERS OF PATHOGENIC BACTERIA

JERRY F. BUTLER', ALEJANDRA GARCIA-MARUNIAK1, FRANK MEEK2 AND JAMES E. MARUNIAK1
'Department of Entomology and Nematology, P.O. Box 110620, University of Florida, Gainesville, FL 32611

2Orkin Pest Control, 2170 Piedmont Rd. NE, Atlanta, GA 30324

ABSTRACT

Bacteria carried by wild house flies (Musca domestic L.) collected near the rear entrances
and dumpsters of 4 restaurants in north central Florida were identified. Live house flies
were collected and individually transferred to blood agar plates for 1 h. After removing the
flies, the plates were incubated overnight at 37'C. Bacterial colonies that were morphologi-
cally distinct were isolated from other colonies by streaking onto new plates. The bacteria
were identified by fatty acid analysis and sequence of their 16S rRNA gene. The bacterial
isolates included 5 new bacterial records for house flies: Acinetobacter baumanni, Bacillus
pumilus, Cronobacter sakazakii, Methylobacterium persicinum, and Staphylococcus sciuri.
Other bacteria identified have been associated previously with house flies, including Bacil-
lus cereus, B. thuringiensis, Escherichia coli 0157:H7, Shigella dysenteriae, Staphylococcus
saprophyticus, and Staphylococcus xylosus. Most of the organisms recovered from the house
fly are serious pathogens, known to produce diseases such as meningitis, food poisoning, di-
arrhea, abscesses, bloodstream infections, and hemorrhagic colitis. The possible exception is
Bacillus thuringiensis, a known pathogen for insects that only occasionally produces allergic
reactions in humans. If these organisms are not prevented from entering the food prepara-
tion and consumption areas, they could become a serious risk in the transmission of dis-
eases.

Key Words: 16S rRNA gene sequence, fatty acid analysis. Escherichia coli 0157:H7, bacteria

RESUME

Bacterias obtenidas de moscas (Musca domestic) colectadas en el area de los basureros de
cuatro restaurants en la region de norte central de Florida fueron identificadas. Moscas vi-
vas fueron transferidas individualmente a places de Petri con agar de sangre por 1 hora.
Despu6s de retirar las moscas, las places fueron incubadas por 16 h a 37'C. Las colonies de
bacteria con diferentes morfologias fueron aisladas de otras colonies resembrdndolas por es-
tria cruzadas en nuevas places. Las bacteria fueron identificadas atrav6s del andlisis de
acidos grasos y de la secuencia del gene del Acido Ribonucleico ribosomal 16S (16S rRNA).
Las bacteria aisladas durante este studio incluyen cinco species que no habian sido pre-
viamente aisladas de moscas:Acinetobacter baumanni, Bacilus pumilus, Cronobacter saka-
zakii, Methylobacterium persicinum y Staphylococcus sciuri. Las otras bacteria ya habian
sido encontradas asociadas con moscas en studios anteriores e incluyen: Bacillus cereus, B.
thuringiensis, Escherichia coli 0157:H7, Shigella dysenteriae, Staphylococcus xylosus, y S.
saprophyticus. La mayoria de las bacteria obtenidas en este studio son pat6genas, capaces
de producer enfermedades como meningitis, intoxicaci6n alimenticia, diarrea, abscesos, in-
fecci6n sanguinea y colitis hemorragica. La possible excepci6n es B. thuringiensis un pato-
geno de insects que solo ocasionalmente causa reacciones al6rgicas en humans. Estos
organismos, si no son prevenidos de entrar en el area de preparaci6n y consume de alimen-
tos, pueden resultar ser un serio riesgo en la transmisi6n de enfermedades.

Translation provided by the authors.


The house fly (Musca domestic L.) long has ciation with domestic environments (endophilic),
been considered a pathogen carrying insect pest (4) its equal attraction to excrements and human
(Howard 1911; West 1951; Greenberg 1971). How- food sources, and (5) its communicative behavior
ever, its classification as a "disease causing fly" is that allows the house fly to easily move from
based on 5 scientific criteria (Olsen 1998), as fol- heavily contaminated to human populated areas
lows: (1) its confirmed association with the food- House flies are capable of traveling up to 8 km in
borne pathogens Escherichia coli, Salmonella, 24 h to find food and reproductive sites (Quarter-
and Shigella, (2) the fact that it is ecologically as- man et al. 1954; Broce 1993). One of the most dan-
sociated with humans (synanthropic), (3) its asso- gerous characteristics of the house fly is its feed-








Butler et al: Pathogenic Bacteria Carried by House Flies


ing preferences because they are attracted to de-
caying plant and animal matter. This puts the fly
in contact with pathogenic organisms present in
our habitat, garbage, and animal wastes. The
house fly must liquefy its food before ingesting it.
This is done by placing a sponge like mouth part
on the food source, and secreting saliva or regur-
gitated gut contents that changes some of the food
to a liquid state which the fly can pump into its di-
gestive system (West 1951; Harwood & James
1979). While feeding or resting, house flies often
defecate, leaving fly specks and organisms pass-
ing through their digestive system (Sasaki et al.
2000). This is a simple mechanical transfer of mi-
crobes by a vector whose behavior places the con-
taminants from decayed and diseased sources di-
rectly onto the new food or host source they visit
(Holt et al. 2007). The organisms associated with
house flies number in the hundreds (Greenberg
1971; Olsen 1998; Nmoris et al. 2007) and com-
monly include dysentery-causing and tissue-in-
fecting agents such as Bacillus spp., Sr.l.-i.. 7. ..... -
cus spp., Enterococcus spp., Shigella spp., Escher-
ichia coli, Bacillus anthracis, Chlamydiales,
Corynebacterium spp., and other parasitic organ-
isms. The presence of house flies with these or-
ganisms in and around a restaurant often allows
them access to food. The objective of this study
was to identify the bacterial organisms present in
or on house flies collected near the rear entrances
of restaurants in Gainesville, Florida by using
biochemical techniques.

MATERIALS AND METHODS

House fly Collections

House flies were collected at the rear en-
trances and around dumpsters at 4 restaurants in
Gainesville, Florida, with new nets that had been
autoclaved. All handling of sample containers and
nets was done with sterile, vinyl gloved hands.
The collected flies were placed into sterile 150-mL
containers and kept separate for each location.
About 20 flies per location were collected and re-
turned to the laboratory.

Bacterial Isolation

Flies were anesthetized with filtered CO2 and
transferred individually with sterile tweezers to
100-mm Petri dishes containing Columbia agar
with 5% sheep blood (Becton Dickson Microbiol-
ogy). Flies were kept alive on the plates where
they moved over the surface while feeding, walk-
ing, and defecating. After either 1 or 16 h at room
temperature, the flies were removed and the
plates were incubated at 37C overnight (~16 h).
Bacterial colonies presenting morphological dif-
ferences were picked and streaked on new blood
agar plates. This colony selection and streaking


process was repeated 2 more times in new plates
to obtain individually isolated colonies.

Bacterial Identification

Analysis of Fatty Acids

Individual colonies presenting morphological
differences were selected and placed into sterile
15-mL polypropylene tubes (Corning) containing
10 mL of sterile water. The samples were sent to
the Bacterial Identification and Fatty Acid Anal-
ysis Laboratory, University of Florida, for bacte-
rial identification by gas chromatographic (MIDI,
Inc.) analysis of fatty acids (Welch 1991). Micro-
bial identification is based on a similarity index
(SI) presented as a numerical value that ex-
presses how closely the fatty acid composition of
an unknown sample compares with the mean
fatty acid composition of the strain used to create
the library entry listed as its match. Matches ob-
tained were valued as follows: 0.500-0.999 with a
separation of 0.100 between first and second
choice = excellent match for genus and species;
0.300-0.500 with a 0.100 separation from the sec-
ond choice = good match with the organism from
the library, but may be an atypical strain; lower
than 0.300 suggests that the sample does not
match with any species from the database but in-
dicates the most closely related species (Paisley
1997). For the current study, only samples that
had matches of 0.5 or higher to the database were
considered identified by this methods. Lipid com-
position, especially fatty acid composition, has
been an important tool in determining taxonomic
relationships among bacteria in the past and also
recently with computers to determine the genus
and species of bacteria (Shaw 1974; Slabbinck et
al. 2009).

Sequence Analysis of the 16S rRNA Gene

To confirm bacteria identification, individual
colonies were inoculated in 3 mL of LB media and
grown in a shaker bath at 37C for 16 h. The DNA
was extracted with DNeasy columns (QIAgen).
PCR amplification of the 16S RNA gene was ob-
tained by using the following primer set: SPIR F:
5' GAGTTTGATCCTGGCTCAG 3' and SPIR R: 5'
AGAAAGGAGGTGATCAGCC 3' (Rainey et al.
1992). The amplification was done with 2 mM
MgCl2, 200 pM dNTPs, 0.4 pM of each primer and
1.25 units of Taq polymerase (Invitrogen) and a
cycle program of 95C/3 min, followed by 30 cycles
of 95C/30 s, 50C/1 min and 72C/2 min, with a fi-
nal extension of 10 min at 72C. PCR products
were run in a 1% agarose gel, the DNA band was
cleaned from the agarose with QIAquick Gel Ex-
traction kit (QIAgen), and cloned in a pGEM-T
Easy vector (Promega) into DH5-a competent
cells (Invitrogen). Plasmid purification was done







Florida Entomologist 93(2)


with QIAprep Spin Miniprep kit (QIAgen). Se-
quencing of the inserted DNA was done by using
the vector primers T7 and SP6 with the Big Dye
Terminator Sequencing kit (Applied Biosystems).
The unincorporated labeled nucleotides were re-
moved by ethanol precipitation and sent to the
University of Florida Interdisciplinary Center for
Biotechnology Research (ICBR) to be processed.
The resulting electropherograms were analyzed,
edited, and aligned in our lab with the Se-
quencher program (Gene Codes Corporation). The
nucleotide sequences were compared to the nucle-
otide database by BLASTn (http://
www.ncbi.nlm.nih.gov/BLAST/).

RESULTS

Bacterial Isolation

Plates that were in contact with live flies for 16
h had confluent bacterial growth that made it im-
possible to isolate individual colonies. However, a
variety of morphologically distinct bacterial colo-
nies were obtained on the plates that were in con-
tact with the flies for 1 h. The morphology of the
colonies varied in color, size, mucus formation,
and the presence and size of a halo around the
hemolitic colony in the blood agar (Fig. 1). This
study did not aim to differentiate between bacte-
ria carried externally or internally by the house
fly.

Bacterial Identification

Fatty Acid Analysis of cultured isolates was
conducted and only the samples with similarity
indexes of 0.5 or higher to known bacteria were
considered identified by this method (Table 1).
The identification by sequence analysis of the 16S
rRNA gene was done for all the bacterial samples
isolated with the exception of Cronobacter saka-


Fig. 1. Bacterial colonies obtained after placing an
individual house fly on blood agar plate for 1 h followed
by overnight incubation.


zakii, and it was identified only by fatty acid anal-
ysis because it was not recovered for DNA extrac-
tion. A total of 11 pathogenic bacteria were iden-
tified and 8 of them were confirmed by both meth-
odologies. Table 1 presents a list of different
bacterial species identified, the % nucleotide
identity with known bacteria, and the accession
number of those sequences with the best nucle-
otide match. Five of the bacteria identified in this
study had not been reported previously associ-
ated with house flies: Acinetobacter baumanni,
Bacillus pumilus, Cronobacter sakazakii, Methy-
lobacterium persicinum, and S'r.,.l..i ..........: sci-
uri. All of these bacteria are pathogenic to hu-
mans.

DISCUSSION

Bacterial samples grown from blood agar ex-
posed to wild house flies were identified as a num-
ber of serious disease causal organisms both by
fatty acid analysis and 16S rRNA gene sequences.
Microbial identification by the analysis of cellular
fatty acid methyl esters (MIDI-FAME) was first
applied to bacteria (Shaw 1974), and also for
other organisms such as yeast and fungi (Sasser
1990; Graham et al. 1995). More recently, it has
been used to survey bacteria in recycling process
conditions (Namjoshi et al. 2010). Previous publi-
cations indicate a threshold of 97% nucleotide
identity separates bacterial species based upon
the 16S ribosomal gene (Stackebrant & Goebel
1994). Although this was not an exhaustive isola-
tion experiment, 5 bacterial species not previ-
ously associated with house flies were identified
by the tested methods. This study confirmed the
health risks linked with house flies and their
feeding preferences since they were collected near
the rear entrances and dumpsters of restaurants.
The risk to the public is determined by the pres-
ence of contaminated flies visiting food within the
restaurant. The number of bacteria carried by
house flies from contaminated to clean surfaces
has been found to range from 50 to 50,000 (De
Jesus et al. 2004). The bacteria not only can be
transported externally but also internally, most
often in the gut and crop of the house fly (Sasaki
et al. 2000; Holt et al. 2007). The amount of time
and the conditions under which contaminated
food are maintained is important in allowing the
bacteria to grow to large numbers. The suscepti-
bility of individuals exposed to an organism var-
ies with their challenged immune condition or
prior exposure. The presence of house flies in res-
taurants is real and disturbing.
Of the bacterial organisms carried in and on
wild house flies found near the back entrances
and dumpsters of restaurants, all but 5 have been
reported as carried by house flies by others
(Greenberg 1971; Levine & Levine 1991; Iwasa et
al. 1999; Sasaki et al. 2000; Sulaiman et al. 2000;


June 2010







Butler et al: Pathogenic Bacteria Carried by House Flies


TABLE 1. IDENTIFICATION OF BACTERIA ISOLATED FROM WILD HOUSE FLIES (MUSCA DOMESTICA.

16S rRNA GenBank
Bacteria Identification Fatty acid SI1 sequence identity (%) accession number2

Acinetobacter baumanni3 0.618 99 CP001172.1
Bacillus cereus 0.884 100 CP001177.1
Bacillus pumilus3 0.888 99 AE221329.1
Bacillus thuringiensis 0.845 99 AM778997.1
Cronobacter sakazakii3 0.879 N/R5
Escherichia coli 0157:H7 0.814 99 CP001368.1
Methylobacterium persicinum3 N/I" 98 AB252202.1
Shigella dysenteriae 0.856 98 CP000034.1
Staphylococcus saprophyticus 0.799 99 AP008934.1
Staphylococcus sciuri3 N/I4 99 NR025520.1
Staphylococcus xylosus 0.772 99 G0222240.1

SI = similarity index. Only samples with values over 0.500 are presented.
'best match by BLASTn.
'not previously identified in house flies.
'N/I: not identifiable by fatty acid analysis.
5N/R: not recovered for DNA analysis.


Kabkaew et al. 2000; Olsen & Hammack 2000;
Nmorsi et al. 2007). The most prominent is the
general presence ofEscherichia coli specific sero-
type 0157:H7 with its known human risk (Koba-
yashi et al. 1999;Ahmad et al. 2007). The bacteria
identified from house flies in this project, listed
below, have the potential to produce the following
problems (Greenberg 1971; Lennette et al. 1985;
Howard et. al. 1987; Forbes et al. 2002; Quinn et
al. 2002; Kato et al. 2008).
Acinetobacter baumanni can cause bactere-
mia, pneumonia, upper respiratory diseases and
pulmonary disease in infants, urethritis, disease
of newborn, complications of instrumentation and
surgery, complications of burns, complications of
compromised patients. This is a new record for
house flies.
Bacillus cereus is associated with food poison-
ing, emetic and diarrheal type. The diarrheal type
is commonly associated with meat sauces. Emetic
type is almost exclusively associated with rice
dishes. Wound infection, clinical infections, and
human infections occur. This is a new record for
house flies.
Bacillus pumilus causes food poisoning. The
diarrhea type is commonly associated with meat
sauces. Wound infection and human infections oc-
cur. This is a new record for house flies.
Bacillus thuringiensis produces a toxin used as
an insecticide. These are common bacteria used in
biological control of insects. This organism has,
however, been implicated in some human infec-
tions according to Lennette et al. (1985).
Cronobacter sakazakii is common in sputum,
pneumonia, lung abscess, and intestinal infec-
tions in humans and animals. It is most common
in urinary tract, pulmonary, and bloodstream in-
fections, and can be a rare cause of neonatal men-


ingitis and sepsis. In general, this group is noted
in peritonitis, bacteremia, diarrhea, enteric fe-
vers, typhoid fever, meningitis, endocarditis, in-
toxication, pyelonephritis, cystitis, nosocomial in-
fections in pediatrics, newborn, and infections in
homosexual men.
Escherichia coli is associated with 4 types of
human enteric disease, including enteropatho-
genic (diarrhea, mostly in infants), enterotoxi-
genic secretaryy diarrhea by elaboration of heat-
labile, heat stable enterotoxins or both, causing
profuse watery diarrhea, and are often implicated
in cases of traveler's diarrhea), enteroinvasive
and hemorrhagic (dysentery-like illness similar
to Shigella infections). Hemorrhagic colitis is a re-
cently recognized enteric infection due to E. coli
strains of a specific stereotype 0157:H7. These
strains cause severe diarrhea characterized by
grossly bloody stools. Organisms can be obtained
from partially cooked hamburgers and are com-
monly isolated from house flies associated with
livestock manure.
Methylobacterium persicinum is not patho-
genic and it may be a contaminant in food-pro-
cessing environments.
Shigella dysenteriae is primarily a human
pathogen causing severe cramping, abdominal
pain, and diarrhea with blood and mucus.
s'r.l.i, ....i..... .... sciuri has been associated
mostly with wound infections although it can be
isolated from other infections such as urinary
tract infections and endocarditis.
Sr. ,..7, l............. : saprophyticus is a common hu-
man pathogen that causes bacteremia and infec-
tive endocarditis, infection of shunts and intrave-
nous catheters. It is one of the most common
causes of urinary tract infections in young sexu-
ally active females and urethritis in males.







Florida Entomologist 93(2)


s'r..i]. i 7............ : xylosus is a rare pathogen or
undetermined pathogen often obtained through
contact with animals.
The majority of the bacteria recovered from
the house fly were human pathogens with the
possible exception of Bacillus thuringiensis that
is a known insect pathogen and Methylobacte-
rium persicium that is a contaminant in food
preparation areas. The bacteria described in this
study were obtained from house flies near areas
where food processing occurs, presenting a poten-
tial human risk if house flies are not prevented
from entering the food preparation and consump-
tion areas. The bacterial organisms were recov-
ered through contact of collected flies with culture
media. Contact could have been from the surface
of flies, from fly feeding and regurgitation, or def-
ecation by flies.

ACKNOWLEDGMENTS

This research was supported by a grant from Orkin
Pest Control, 2170 Piedmont Rd. NE, Atlanta, GA
30324.

REFERENCES CITED

AHMAD, A., NAGARAJA, T. G., AND ZUREK, L. 2007.
Transmission of Escherichia coli 0157:H7 to cattle
by house flies. Prev. Vet. Med. 80: 74-81.
BROCE,A. B. 1993. Dispersal of house flies and stable flies,
pp. 50-60 In G. D. Thomas and S. R. Skoda [eds.], Rural
Flies in the Urban Environment? Research Bulletin
No. 317/North Central Research Publication no 335,
NC-154. Ag. Experiment Station and USDA.
DE JESUS, A. J., OLSEN, A. R., BRYCE, J. R., AND WHIT-
ING, R. C. 2004. Quantitative contamination and
transfer ofEscherichia coli from foods by houseflies,
Musca domestic L (Diptera: Muscidae). Int. J. Food
Microbiol. 9: 259-262.
FORBES, B. A., SAHM, D. F., AND WEISSFELD, A. S. 2002.
Bailey & Scott's Diagnostic Microbiology. Eleventh
Edition. Mosby, Inc., St. Louis, MO. 1069 pp.
GRAHAM, J. H., HODGE, N. C., AND MORTON, J. 1995.
Fatty acid methyl ester profiles for the characteriza-
tion of glomalean fungi and their endomycorrhizea.
Appl. Environm. Microbiol. 61: 58-64.
GREENBERG, B. 1971. Flies and Disease Vol. I, Ecology,
Classification, and Biotic Association. Princeton
University Press, Princeton, NJ. 586 pp.
HARWOOD R. F., AND JAMES, M. T 1979. Entomology in
Human and Animal Health. Seventh Edition. Mac-
millan Publishing Co., Inc., NY pp. 248-295.
HOLT, P. S., GEDEN, C. J., MOORE R. W., AND GAST R. K.
2007. Isolation of Salmonella enterica serovar enteriti-
dis from houseflies (Musca domestic) found in rooms
containing Salmonella serovar enteritidis-challenged
hens. Appl. Environ. Microbiol. 73: 6030-6035.
HOWARD, L. O. 1911. The House Fly, Disease Carrier;
An Account of its Dangerous Activities and of the
Means of Destroying it. Second Edition. New York,
Fred A. Strokes Co. 312 pp.
HOWARD, B. J., KLAAS, J., RUBIN, S. J., WEISSFELD, A.
S., AND TILTON, R. C. 1987. Clinical and Pathogenic
Microbiology. The C. V. Mosby Co. Washington DC,
968 pp.


IWASA, M., MAKING, S.-I., ASAKURA, H., KOBORI, H., AND
MORIMOTO, Y. 1999. Detection of Escherichia coli
0157:H7 from Musca domestic (Diptera: Muscidae)
at a cattle farm in Japan. J. Med. Entomol. 36: 108-
112.
KABKAEW, S., MANASANANT BUNCHOO, BANYONG KHAN-
TAWA, KOM SUKONTASON, SOMSAK PIANGJAI, AND
WEJ CHOOCHOTE. 2000. Musca domestic as a me-
chanical carrier of bacteria in Chiang Mai, North
Thailand. J. Vector Ecol. 25: 114-117.
KATO, Y., ASAHARA, M., GOTO, K., KASAI, H., AND YOKO-
TA, A. 2008. Methylobacterium persicinum sp. nov.,
Methylobacterium komagatae sp. nov., Methylobac-
terium brachiatum sp. nov., Methylobacterium tar-
dum sp. nov. and Methylobacterium gregans sp.
Nov., isolated from freshwater. Int. J. Syst. Evol. Mi-
crobiol. 58: 1134-1141.
KOBAYASHI, M., SASAKI, T., SAITO, N., TAMURA, K., SU-
ZUKI, K., WATANABE, H., AND AGUI, N. 1999. House-
flies: not a simple mechanical vector of enterohemor-
rhagic Escherichia coli 0157:H7. American J. Trop.
Med. Hyg. 61: 625-629.
LENNETTE, E. H., BALOWA, A., HOUSE JR., W. J., AND
SHADOMY, H. J. 1985. Manual of Clinical Microbiol-
ogy, Fourth Edition. American Society for Microbiol-
ogy, Washington DC, 1149 pp.
LEVINE, O. S., AND LEVINE, M. M. 1991. Houseflies
(Musca domestic) as mechanical vector of shigello-
sis. Rev. Infect Dis. 13: 688-696.
NAMJOSHI, K., JOHNSON, S., MONTELLO, P., AND PULL-
MAN, G. S. 2010. Survey of bacterial populations
present in US-produced linerboard with high recycle
content. J. Appl. Microbiol. 108: 416-427.
NMORSI, O. P. G., AGBOZELE, G., AND UKWANDU, N. C.
D. 2007. Some aspects of epidemiology of filth flies:
Musca domestic, Musca domestic vicina, Droso-
philia melanogaster and associated bacteria patho-
gens in Ekpoma, Nigeria. Vector-Borne Zoonotic Dis.
7: 107-117.
OLSEN, A. R. 1998. Regulatory action criteria for filth
and other extraneous materials III. Review of flies
and foodborne enteric disease. Regul. Toxicol.
Pharm. 28: 199-211.
OLSEN, A. R., AND HAMMACK, T. S. 2000. Isolation of
Salmonella spp. from the housefly, Musca domestic
L., and the dump fly, Hydrotaea aenescens (Wiede-
mann) (Diptera: Muscidae), at caged-layer houses. J.
Food Prot. 63: 958-960.
PAISLEY, R. 1997. Training Manual: MIS Whole Cell
Fatty Acid Analysis by Gas Chromatography. MIDI,
Inc., Delaware, 15 pp.
QUARTERMAN, K. D., KILPATRIC, J. W., AND MATHIS, W.
1954. Fly dispersal in a rural area near Savannah,
Georgia. J. Econ. Entomol. 47: 413-419.
QUINN, P. J., MARKEY, B. K., CARTER, M. E., DONNELLY,
W. J., AND LEONARD, F. C. 2002. Veterinary Microbi-
ology and Microbial Disease. Blackwell Science Ltd.,
Oxford, UK. 536 pp.
RAINEY, F. A., DORSCH, M., MORGAN, H. W., AND STACK-
EBRANDT, E. 1992. 16S rDNA analysis of Spirochae-
ta thermophila: Its phylogenetic position and impli-
cations for the systematics of the order
Spirochaetales. Syst. Appl. Microbiol. 15: 197-202
SASAKI, T., KOBAYASHI, M., AND AGUI, N. 2000. Epide-
miological potential of excretion and regurgitation
by Musca domestic (Diptera: Muscidae) in the dis-
semination of Escherichia coli 0157:H7 to food. J.
Med. Entomol. 37: 945-949.


June 2010







Butler et al: Pathogenic Bacteria Carried by House Flies


SASSER, M. 1990. Tracking a strain using microbial
identification system. Technical Note 102. MIDI,
Newark, DE.
SHAW, N. 1974. Lipid composition as a guide to the clas-
sification of bacteria. Adv. Appl. Microbiol. 17: 63-
108.
SLABBINCK, B., DE BAETS, B., DAWYNDT, P., AND DE
VoS, P. 2009. Towards large-scale FAME-based bac-
terial species identification using machine learning
techniques. Syst. Appl. Microbiol. 32: 153-176.
STACKEBRANDT, E., AND GOEBEL, B. M. 1994. Taxonom-
ic note: a place for DNA-DNA reassociation and 16S


rRNA sequence analysis in the present species defi-
nition in bacteriology. Int. J. Syst. Bacteriol. 44: 846-
849.
SULAIMAN, S., OTHMAN, M. Z., AND AZIZ, A. H. 2000. Iso-
lation of enteric pathogens from synanthropic flies
trapped in downtown Kuala Lumpur. J. Vector Ecol.
25: 90-93.
WELCH, D. F. 1991. Applications of cellular fatty acid
analysis. Clinic. Microbiol. Rev. 4: 422-438.
WEST, L. C. 1951. The house fly. Its Natural History,
Medical Importance and Control. Cornell, Ithaca,
NY.








Florida Entomologist 93(2)


June 2010


POTENTIAL FOR POPULATION GROWTH OF THE SMALL HIVE BEETLE
AETHINA TUMIDA (COLEOPTERA: NITIDULIDAE) ON DIETS OF POLLEN
DOUGH AND ORANGES

RICHARD T. ARBOGAST1, BALDWYN TORTO AND PETER E. A. TEAL'
1USDA/ARS-CMAVE, 1600/1700 SW 23rdDr., Gainesville, FL 32608

2International Centre of Insect Physiology and Ecology (ICIPE), P.O. Box 30772-00100, Nairobi, Kenya

ABSTRACT

The small hive beetleAethina tumida Murray, is an African native that has become an invasive
pest of honeybees in North America. The beetle is capable of rapid population growth on pollen,
honey, and bee brood. It is also capable of feeding and reproducing on various kinds of fruit, but
its ability to sustain population growth on diets other than bee products has remained unknown.
We examined this question by observing A. tumida on 2 diets: pollen dough (inoculated with a
species of yeast carried by the beetle) and orange. Age-schedules of survival (1) and fecundity
(mn) were constructed for each diet and used to calculate the intrinsic rate of natural increase (r),
which was used to calculate other demographic parameters. The results showed potential for
population growth on both diets (r > 0), but the potential was less on orange (r = 0.0631) than on
inoculated pollen dough (r = 0.1047). The calculated multiplication per generation on pollen
dough was nearly double that on orange and the generation time was shorter by more than a
third. Survival ofA. tumida populations on oranges, or any other alternative diet, in a given en-
vironment would depend on the value of r relative to the strength of environmental conditions
opposing population increase. The ability to use alternative diets (fruit, possibly fungi, or other
food resources) would confer an adaptive advantage upon beetles dispersing over a landscape in
which honeybee colonies occur as small, widely scattered patches.

Key Words: honeybee pest, demography, intrinsic rate of natural increase, nutrition

Supplemental material online at http://www.fcla.edu/FlaEnt/fe932.htm#InfoLinkl.

RESUME

El escarabajo pequeio de las colmenas,Aethina tumida Murray, es native de Africa y ha lle-
gado a ser una plaga invasora de las abejas de miel en Norteam6rica. La poblacion del esca-
rabajo puede crecer de forma rapida sobre polen, miel y la cria de abejas. Tambi6n, puede
alimentarse y reproducirse sobre varias frutas, pero su capacidad de sustenta el crecimiento
de su poblacion sobre otras dietas ademas de los products de abejas es desconocida. Exami-
namos esta pregunta observandoA. tumida sobre 2 dietas: masa de polen (inoculada con una
especie de levadura llevada por el escarabajo) y naranja. Los programs de sobrevimiento (lx)
y fecundidad(mn) segun su edad fueron construidos para cada dieta y usados para calcular
la tasa intrinseca de crecimiento natural (r), y otros parametros demograficos. Los resulta-
dos demonstraron potential para el crecimiento de la poblaci6n sobre ambas dietas (r > 0),
pero el potential fue menor sobre las naranjas (r = 0.0631) que en la masa de polen inoculada
(r = 0.1047). La multiplicaci6n calculada por generaci6n sobre masa de polen fue casi el double
de aquella sobre naranja y el tiempo de generaci6n fue mas corto por mas de una tercera
parte. La sobrevivencia de poblaciones de A. tumida sobre naranjas, o cualquier otra dieta
alternative en un ambiente dado, dependera del valor de r en relaci6n de la fuerza de las con-
diciones ambientales en contra del aumento de la poblaci6n. La capacidad de utilizar dietas
alternatives (fruto, posiblemente hongo, u otros recursos alimenticios) conferird una ventaja
adaptiva sobre los escarabajos para esparcirse en terrenos donde las colonies de abejas estan
ampliamente distribuidas en pequeias parches.


The small hive beetle, Aethina tumida Murray, pate. Emerging adults disperse in search of suit-
is an African native that was unintentionally in- able hosts and either re-enter nearby honeybee
produced into North America, where it has be- colonies or scatter over the landscape.
come an invasive pest of honeybee colonies. The Dispersing beetles are subject to many haz-
eggs are laid in cracks and crevices inside hives or ards, not the least of which is failure to locate a
on the combs, and adults as well as larvae feed on bee colony, so alternative diets would confer a
pollen, honey, and bee brood. Upon completing de- significant adaptive advantage. Hoffman et al.
velopment, larvae leave the hive and fall to the (2008) recognized the adaptive advantage of
ground, where they burrow into the soil and pu- lower host specificity when they demonstrated








Arbogast et al.: Population Growth of Small Hive Beetle


host shift ofA. tumida to bumblebees. The abil-
ity of A. tumida to feed, develop, and reproduce
on various species of fruit is well known (Ellis
et al. 2002; Keller 2002; Arbogast et al. 2009b),
and the beetle's nitidulid affinities suggest ad-
ditional diets. Nitidulids exhibit a wide range of
trophic habits, but they are primarily saproph-
agous or mycophagous and are characteristi-
cally associated with yeasts and fungi that
cause fermentation in tree wounds, under bark,
or among decaying leaves, fruits, or flowers
(Parsons 1943; Lawrence 1991; Cline 2005). Al-
though A. tumida has become highly adapted to
life in bee colonies, its ability to develop and re-
produce on fruit suggests that it has retained
ancestral nitidulid food habits that confer an
adaptive advantage. These habits may include
mycophagy as well as saprophagous feeding on
materials other than fruit, although this re-
mains to be demonstrated. Dispersing adults
are attracted to shady areas (Arbogast et al.
2007, 2009a) and may feed on fungi, fallen fruit,
or other decaying materials in woodlands. Adult
beetles have been captured by baited flight
traps placed in woodlands near an apiary (Ar-
bogast et al. 2009a) as well as in woodlands 2.7
km or more from the nearest known bee colo-
nies (Arbogast et al. 2009b).
The adults, in both Africa and the U. S., carry
a strain of the yeast Kodamaea ohmeri (NRRL Y-
30722) that induces fermentation of bee-col-
lected pollen (Teal et al. 2006; Torto et al. 2007c).
Stored pollen becomes naturally inoculated with
the yeast when adult beetles invade a hive, and
the resulting fermentation produces volatiles
that mimic the honeybee alarm pheromone,
which is a potent attractant for the beetles. The
volatiles thus act as an aggregation kairomone
indicating a local concentration of pollen (Torto
et al. 2007a, b, c). Also, there is evidence that the
yeast may have nutritional value (Arbogast et al.
2009b).
Aethina tumida is capable of rapid population
growth on the concentrated resources found in
honeybee colonies, but its ability to sustain pop-
ulation growth on diets other than bee products
is unknown. Arbogast et al. (2009b) compared
the ability of the beetle to develop and reproduce
on pollen dough (either yeast-inoculated or not)
with its ability to develop on several kinds of
fruit: oranges, inoculated oranges, green grapes,
and cantaloupe. The number of adult progeny
produced on inoculated pollen dough and on in-
oculated oranges were the same, and signifi-
cantly higher than on either pollen dough or or-
anges without inoculation. Inoculated pollen
dough and non-inoculated oranges can therefore
be expected to provide a marked contrast in abil-
ity to support population growth of the beetle,
and for this reason, we selected them for our ex-
periments. The former represents a favorable


diet, similar to that found in infested bee hives;
and the latter is one of the least satisfactory of
the fruit diets studied. Although natural infesta-
tion of fallen oranges has not been demonstrated
even though a few unpublished attempts have
been made to do so, the negative results do not
prove that such infestation never occurs. Other
species of nitidulids are known to infest fallen
oranges (Vogt 1951; Lima & Davies 1981), and
dispersing small hive beetles would be likely to
encounter such oranges, especially when hives
are placed in groves for pollination and produc-
tion of orange blossom honey.
We determined the duration of immature de-
velopment, survival of the immature stages, age-
specific fecundity, and age-specific survival of A.
tumida on each of the 2 diets under controlled
laboratory conditions. The data was then used to
construct life tables and tables of age-specific fe-
cundity for calculation of the intrinsic rate of nat-
ural increase and other demographic parameters
(Birch 1948).
The intrinsic rate of natural increase can be
defined as the constant r in the exponential
growth equation N = Ne", where N, is the initial
number of individuals and N is the number after
some time t. It is the infinitesimal rate of increase
of a population having a stable age distribution
and living in an environment free of the suppres-
sive effects of crowding, predators, disease, etc.
The requirement for a stable age distribution is
not a serious limitation, because age distributions
gradually move toward stability, and once stable
they tend not to change (Lotka 1925). The value of
r is determined by life history traits (rate of devel-
opment, age-specific fecundity, age-specific mor-
tality) and is characteristic of a particular species
or strain, but its expression is influenced by the
prevailing physical conditions (such as tempera-
ture, humidity, and other parameters) and by the
nutritional situation. For this reason, r and other
demographic parameters derived from it are use-
ful in comparing the effects of various physical
conditions and diet on an insect's potential for
population increase.

MATERIALS AND METHODS

The beetles used in experiments were from
cultures that had been maintained at room tem-
perature in our CMAVE laboratory for -4 yr. They
were reared on commercially available pollen
dough (4% pollen with sugar, soy, yeast, and wa-
ter) (Global Patties, Airdrie, Alberta, Canada)
that had been inoculated with K. ohmeri to pro-
duce fermentation. The rearing procedures were
the same as described by Arbogast et al. (2009b).
All experiments were conducted at constant tem-
perature and humidity (27.5 0.5C, 60 + 5% RH)
in an environmental chamber (Percival model
I36VLC8, Perry, IA).







Florida Entomologist 93(2)


Demographic Calculations

The intrinsic rate of natural increase (r) was
calculated as outlined by Birch (1948). This calcu-
lation is based only on the female population and
requires construction of female life tables (I) and
tables of age-specific-fecundity (m ). The former
gives the probability at hatching of being alive at
age x, and the latter gives the mean number of fe-
male eggs laid in a unit of time by a female at age
x. We used 1 d as the unit of time and assumed
that all eggs were laid at the midpoint of each 1-d
interval.
The 1,and m, tables were entered in a spread-
sheet (Microsoft Office Excel, Microsoft Corp.,
Redmond, WA), which was then used to calculate
the values of r by substituting trial values in the
Euler-Lotka equation until the left hand side
rounded to unity at 5 decimal places:


S-rxlxm"
e lxAx


The values of r were then used to calculate the
following demographic parameters for each diet:
the net reproduction rate (R, = 7 Im = e"), which
is the multiplication per generation, or the mean
number of females produced by each female in a
lifetime; the generation time (T = In R, / r), which
is the mean time between generations, or the
mean time from birth of parents to birth of off-
spring; and the finite rate of increase (X = e'),
which is the multiplication rate of a population
with a stable age distribution expressed as Y Y /
/unit time.

Developmental Period and Survival of Immature Stages

The mean time required for development from
egg to adult was taken as the initial age (x) in the
adult life table, and the proportion of immature
stages reaching adulthood was taken as the prob-
ability (I) of surviving to that age. These parame-
ters were determined by rearing beetles from egg
to adult in clear plastic boxes (19 x 13.5 x 10 cm)
provided with a 3-cm layer of autoclaved soil (900
g soil to 100 g water) for pupation. The 2 diets (50
g of each), contained in petri dish lids lined with
filter paper, were placed on the soil in separate
boxes. Eggs were collected by confining about 50
pairs of adults in each of two 800-ml mason jars
with pollen dough (about 25 g) and 3 egg strips-
strips of transparency film (5 x 4.5 cm) folded in
thirds (in the form of a Z) and stapled to provide
2 crevices for insertion of eggs. The strips were re-
moved after 24 h, the eggs were counted, and 3
strips with eggs were placed on each diet. Obser-
vations were made daily until adult emergence


ended. The period in days from oviposition to
adult emergence was recorded for each emerging
adult, and the total number that emerged was di-
vided by the number of eggs to determine the pro-
portion surviving.
This experiment was repeated 3 times. The
mean developmental period for each diet was cal-
culated by pooling the 3 replicates, adding the de-
velopmental times for all of the adults that
emerged, and dividing by the total number of
adults. The mean proportion surviving was calcu-
lated by adding the proportions from the 3 repli-
cates and dividing by 3.

Adult Female Survival and Age-specific Fecundity

Data for constructing the adult portions of the
11 and m, tables were obtained in 2 experiments, 1
for inoculated pollen dough and 1 for orange. For
each experiment, pupae were collected from stock
cultures, sorted by sex, and held for adult emer-
gence. As adults emerged, 1 male and 1 female
were placed in each of 50 clear plastic petri dishes
(100 x 15 mm) with diet.
Orange slices were presented as wedges (30 x
30 x 5 mm), with 1 wedge and 1 egg strip per dish.
Most eggs were inserted into the egg strips, but
some were placed elsewhere, especially under the
orange. Inoculated pollen dough was presented as
a thin layer smeared on one surface of a standard
microscope slide. A small spot of pollen dough ap-
plied to each end of the other side attached the
slide to the bottom of the dish, leaving it slightly
elevated. Most eggs were laid in the crevice be-
tween the slide and the dish, but others were
scattered throughout the dish. This procedure for
determining oviposition was necessary, because
adults often burrowed into larger amounts of pol-
len dough and laid eggs where they could not be
seen. Larvae also became hidden by burrowing.
The dishes were checked daily for eggs and
adult deaths until all of the females were dead.
When eggs were found, the adults were trans-
ferred to clean dishes with fresh diet and (in the
case of orange) egg strips, and the old dishes were
monitored for at least 5 d to count hatching larvae
and un-hatched eggs. To minimize error due to
hidden eggs and larvae, the final egg count was
taken as the largest of total eggs, total larvae, or
total larvae plus un-hatched eggs. The total was
divided by the number of surviving females to ob-
tain the mean number of eggs per female for each
day. Because the sex ratio of A. tumida reared on
either inoculated pollen dough or orange is 1:1
(Arbogast et al. 2009b), only half of each mean
daily egg count was entered in the mtables.

Statistics

Descriptive statistics were calculated and sta-
tistical comparisons made for developmental pe-


June 2010







Arbogast et al.: Population Growth of Small Hive Beetle


riod, immature survivorship, oviposition pattern,
fecundity, and adult lifespan with SigmaStat 3.5
(Systat Software, Inc., Point Richmond, CA). Be-
fore making statistical comparisons, all data were
tested for normality and equal variance. Data
that passed both tests was analyzed by a t-test;
other data was analyzed by the nonparametric
Mann-Whitney test.

RESULTS AND DISCUSSION

Life-table and age-specific fecundity curves for
A. tumida breeding on either inoculated pollen
dough or orange revealed a marked effect of diet
on its life cycle (Fig. 1). Development from egg to


0.4


0.0 tfrl !rrlil
1I41T 200 I I T 1,T
14

12



8

6

4

2

U 1 .


adult was faster on orange than on pollen dough,
and the adult female lifespan was longer, but the
survival rate of immature stages was two-fold
less (Table 1). The average oviposition period was
66 d longer on orange than on pollen dough (Fig.
1C-D) (Mann-Whitney test, P < 0.01), but there
was no difference in lifetime fecundity (Mann-
Whitney test, P = 0.81). Females that laid no eggs
(8% of those on pollen dough and 10% of those on
orange) were assumed not to have mated. When
these females were ignored, lifetime fecundity
ranged from 2-2,614 on pollen dough with a me-
dian of 612.5, and from 4-4,775 on orange with a
median of 445.0. We cannot explain this extreme
range, but it could be related in part to wide vari-


I i -


0.8 -
: 1



II '


0.4 -







0 .. ,. ', i ,,


Il' \ ,,l ll ..I '_' (, V ul|!. l I,.. "i !
L 1, L I 1


Fig. 1. Survival (1.) and age-specific fecundity curves (m.) forA. tumida at 27.5C on inoculated pollen dough (A,
C) and orange (B, D). Dashed lines in A and B represent immature stages.


I l z 'I T1 I







Florida Entomologist 93(2)


TABLE 1. LIFE CYCLE OF A. TUMIDA ON INOCULATED POLLEN DOUGH (IPD) AND ON ORANGE.

Developmental period (d) Immature survival (proportion) Adult female lifespan (d)

Statistic IPD Orange IPD Orange IPD Orange

n 208 86 3 3 50 49
Median 29.0* 27.0* 0.79 0.36 85.0* 157.0*
Mean 28.5 27.5 0.78** 0.34** 81.3 163.4
SD 1.07 1.49 0.098 0.076 30.0 94.2

The number of observations is given by n (See Materials and Methods for explanation.).
The difference between IDP and orange was significant (P < 0.01) for all 3 characteristics: developmental period, immature sur-
vival, and female lifespan. Developmental period and female lifespan data failed normality tests, so medians were compared with
nonparametric Mann-Whitney test (*). Immature survival data passed normality and equal variance tests, so means were com-
pared by a t-test (**).


ation in adult female lifespan (from 15-123 d on
pollen dough and 16-345 d on orange). Total fe-
cundity would be reduced by early death, and
there was a tendency for adult lifespan and total
fecundity to increase together on pollen dough
(Pearson correlation coefficient = 0.51, P < 0.001).
This was not true for orange, however, in which
the coefficient was 0.08 (P = 0.59), and some fe-
males with a relatively long lifespan laid few eggs
on either diet.
The temporal pattern of oviposition typically
consisted of alternating episodes of egg laying
and inactivity, as illustrated by the example in
Fig. 2, and there was no significant difference be-
tween pollen dough and orange with respect to
the period between episodes (Mann-Whitney test,
P = 0.151), which ranged from 1-15 d for pollen
dough and from 1-16 d for orange with a median
of 1.0 in both.
The demographic parameters (Table 2) were
all derived either directly or indirectly from the 1,
and m, tables, but they describe different aspects
of population growth rate, each of which reflects
the difference between inoculated pollen dough
and orange. The finite rate of increase X simply
translates the infinitesimal rate (r) into a more
easily comprehended finite rate, the number of fe-
males produced by each female per unit time. Al-
though the values of X differed by only 0.045 Y Y/
$/d, the net reproduction rate (R0)-the multipli-
cation per generation-on pollen dough was
nearly double that on orange, while the genera-
tion time (T) was shorter by more than a third.
Clearly, A. tumida breeding on inoculated pollen
dough showed a distinctly higher potential for
population increase.
This is consistent with earlier findings that
progeny production on yeast-inoculated pollen
dough is higher than on orange (Arbogast et al.
2009b). The same study also showed that adult
and pupal weights are lower on orange (inocu-
lated or not) than on inoculated pollen dough. Al-
though the positive r value indicated that popula-
tion increase on oranges is possible, the rate of in-


crease would be lower than on inoculated pollen
dough, and the capacity to overcome environmen-
tal resistance would be diminished accordingly.
Whether or not A. tumida populations would be
able to survive on oranges, or on any other alter-
native diet, in a particular environment would de-
pend upon the value of r relative to the strength of
environmental conditions opposing population in-
crease.
The lower intrinsic rate of natural increase on
orange can be attributed directly to a higher rate
of immature mortality and a protracted oviposi-
tion period. Values of r increase with: (1) decreas-
ing developmental period, (2) increasing survivor-
ship to reproductive maturity, and (3) increasing
concentration of oviposition in early adulthood.
Although the developmental period of A. tumida
was 2 d less on oranges than on inoculated pollen
dough, this advantage was more than offset by
much lower immature survival and by a long ovi-
position period, in which the maximum rate (10.7
eggs /$/d) occurred 150.5 d after adult emer-
gence. In comparison, the maximum rate on inoc-
ulated pollen dough (12.7 eggs/9/d) was reached
in 60.5 d.
The general effect of diet on the growth poten-
tial of insect and mite populations is well known,
as can be illustrated by a few examples. The west-
ern flower thrips, Frankliniella occidentalis (Per-
gande), is a generalist herbivore but also a natu-
ral enemy of the spider mite Tetranychus urticae
Koch. On cotton leaves, the r value of the thrips
depends on cotton variety (mite resistant or not)
and the availability of cotton pollen and mite
eggs; r is maximum when pollen is available (r =
0.220 on susceptible and 0.223 on resistant
leaves) and lowest (0.021) on resistant leaves
with no pollen or mite eggs (Trichlo & Leigh
1988). Hulshof & Vanninen (2002) found that
when T urticae feeds on cucumber leaves, r varies
with the availability and species of pollen on the
leaves, ranging from 0.163 without pollen to 0.240
on pine pollen. Epiphyas postvittana (Walker) is a
leaf rolling tortricid moth known to feed on 123


June 2010







Arbogast et al.: Population Growth of Small Hive Beetle


100


worm, Earias uittella (F.), is a major pest of cotton
but also feeds on a number of alternative hosts,
A including okra and mesta (kenaf), Hibiscus can-
nabinus L. Satpute et al. (2005) reported r values
of 0.1334 on okra, 0.1111 on cotton, and 0.0888 on
mesta. Nanthagopal & Utamasamy (1989) found
that the r value of E. uittella also varies with spe-
cies of cotton: 0.1960 on Gossypium barbadense
L., 0.1928 on G. hirsutum L., 0.1175 on G. herba-
ceum L., and 0.0877 on G. arboretum L.
The effect of diet on r illustrated by these exam-
ples is much like that observed in our study of A.
tumida. All of the r values indicate a potential for
population increase, but at rates differing with the
quality of the diet. It should be noted that because
I r occurs in the exponent of the population growth
I iii I equation, a small difference in value has a large ef-
fect on population growth over short periods of
0 20 16 160 80 time. The adaptive advantage of alternative diets,
| I I m r. ,. even diets of relatively low quality, lies in their po-
tential for sustaining population growth when
more suitable diets are unavailable.
.r P This advantage becomes especially evident
when we recognize that the environment ofA. tu-
mida extents beyond bee colonies and their prox-
imity. Its total environment can, in fact, be viewed
as a landscape in which honeybee colonies occur
as small, widely scattered patches, and in which
there are patches of alternative food resources.
r Given this view of its environment, it is reason-
able to hypothesize that A. tumida is a generalist
species that is able to maintain adequate levels of
reproduction in marginal habitats but is able to
attain high levels of reproduction in resource rich
habitats such as bee colonies (Arbogast et al.
2009b). The generalist hypothesis is supported by
the beetle's ability to feed, develop, and reproduce
S----- -- -------r - on fruit; by its nitidulid affinities; and by its oc-
3 5 7 9 11 II 15 17 currency in woodlands, apparently far removed
from honeybee colonies. The hypothesis is further
I > between iiip'i'lr c-j.i.-& supported by its potential for population increase
on orange, one of the least satisfactory of the fruit
Temporal pattern of oviposition inA. tumida. diets studied by Arbogast et al. (2009b).
I oviposition pattern, with episodes of oviposi- The question remains: Does A. tumida actually
activity alternating, illustrated by a female utilize alternative diets to breed in natural habi-
g on inoculated pollen dough. (B) Relative fre- utlize alternative diets to breed in natural habi-
periods (d) between episodes of oviposition in tats devoid of bee colonies? Laboratory studies
iat laid 1,500 or more eggs (data for inoculated and field observations strongly suggest that it has
gh and orange combined, n = 591). One period this capacity, but definitive proof of breeding pop-
n orange) was omitted in calculating relative ulations is lacking. The presence ofA. tumida lar-
vae in fruit, fungi, or other alternative foods col-
lected in natural settings lacking bees would pro-
vide positive proof. So also would capture of
onus plants in Australia and more than adults in emergence traps placed on the soil. Un-
ew Zealand. Wijesiri et al. (1995) deter- fortunately, the sparse population levels indi-
r value on 4 common host plants (curled cated by our trapping efforts suggest that these
mex crispus L.; plantain, Plantago lan- methods would be unlikely to succeed. Our ap-
.; white clover, Trifolium repens L.; and proach to proving the hypothesis will be to con-
alus pumila Mill.) at various tempera- tinue collecting adults in woodlands using vari-
25.2C, (the optimum except for Malus), ous types of traps and lures, followed by testing of
from 0.146 on the best host (Rumex) to gut contents for evidence of feeding on materials
the poorest (Trifolium). The spotted boll- other than bee products, especially on fungi.


0







0 0.4C


.'


^ 0.02


0.01


I 1 <


Fig. 2.
(A) Typica
tion and i
ovipositin
quency of
females th
pollen dou
of 57 d (oi
frequency.


dicotyled
250 in N
mined its
dock, Ru
ceolata L
apple, M
tures. At
r ranged
0.080 on








Florida Entomologist 93(2)


June 2010


TABLE 2. DEMOGRAPHIC PARAMETERS FOR A. TUMIDA BREEDING ON INOCULATED POLLEN DOUGH (IPD) OR ORANGES.

Parameter IPD Oranges

*Infinitesimal rate of increase daily (r) 0.1047 0.0631
Finite rate of increase (0) (Y Y/I/d) 1.110 1.065
Net reproduction rate (R,) ( 9/9 /generation) 296.6 161.7
Generation time (T) (d) 54.38 80.58

*The fraction by which a population would increase during a period of time arbitrarily close to but greater than zero. It is the
natural logarithm of the finite rate of increase.


ACKNOWLEDGMENTS

We are indebted to Curtis Murphy and Steve Willms,
Technicians at our Center, for their untiring efforts in
setting up experiments, recording observations, and
tabulating data. We thank Paul Shirk (USDA/ARS-
CMAVE), Michael Toews (University of Georgia, Tifton),
and 2 anonymous reviewers for their insightful com-
ments and suggestions for improving the manuscript.
Use of trade, firm, or corporation names in this pub-
lication is for the information and convenience of the
reader. Such use does not constitute an official endorse-
ment or approval by USDA or ARS of any product or ser-
vice to the exclusion of others that may be suitable.

REFERENCES CITED

ARBOGAST, R. T., TORTO, B., AND TEAL, P. E. A. 2007. An
effective bait and trap combination for monitoring
the small have beetle, Aethina tumida (Coleoptera:
Nitidulidae). Florida Entomol. 90: 404-406.
ARBOGAST, R. T., TORTO, B., AND TEAL, P. E. A. 2009a.
Monitoring the small hive beetle Aethina tumida
(Coleoptera: Nitidulidae) with baited flight traps: ef-
fect of distance from bee hives and shade on the
number of beetles captured. Florida Entomol. 92:
165-166.
ARBOGAST, R. T., TORTO, B., WILLMS, S. AND TEAL, P. E.
A. 2009b. Trophic habits of Aethina tumida (Co-
leoptera: Nitidulidae): their adaptive significance
and relevance to dispersal. Environ. Entomol. 38:
561-568.
BIRCH, L. C. 1948. The intrinsic rate of natural increase
of an insect population. J. Anim. Ecol. 17: 15-26.
CLINE, A. R. 2005. Revision of Pocadius Erichson. PhD
dissertation, Louisiana State University, Baton
Rouge, LA.
ELLIS, J. D., NEUMANN, P., HEPBURN, H. R., AND ELZEN,
P. J. 2002. Longevity and reproductive success of
Aethina tumida (Coleoptera: Nitidulidae) fed differ-
ent natural diets. J. Econ. Entomol. 95: 902-907.
HOFFMANN, D., PETTIS, J. S., AND NEUMANN, P. 2008.
Potential host shift of the small hive beetle (Aethina
tumida) to bumblebee colonies (Bombus impatiens).
Insectes Soc. 55: 153-162.
HULSHOF, W., AND VANNINEN, I. 2002. Western flower
thrips feeding on pollen, and its implications for con-
trol, pp. 173-179 In R. Marullo and L. Mound [eds.],
Thrips and Tospoviruses: Proc. 7th Intl. Symp. on
Thysanoptera, 2-7 July 2001, Reggio Calabrio, Italy.
KELLER, J. J. 2002. Testing Effects of Alternative Diets
on Reproductive Rates of the Small Hive Beetle,
Aethina tumida. MS thesis, North Carolina State
University, Raleigh, NC.


LAWRENCE, J. F. 1991. Nitidulidae (Cucujoidea) (includ-
ing Brachypteridae, Cateretidae, Cybocephalidae,
Smicripidae): sap beetles, dried fruit beetles, pp.
456-460 In F. W. Stehr [ed.], Immature Insects, vol.
2. Kendall Hunt Publishing, Dubuque, IA.
LIMA, J. E. 0., AND DAVIES, F. S. 1981. Fruit set and
drop of Florida navel oranges. Proc. Florida State
Hort. Soc. 94: 11-14.
LOTKA, A. J. 1925. Elements of Physical Biology. Will-
iams and Wilkins Co., Baltimore.
NANTHAGOPAL, R., AND UTHAMASAMY, S. 1989. Life ta-
bles for spotted bollworm, Earias uittella (Fabricius).
Crop Prot. 8: 133-136.
PARSONS, C. T 1943. A revision of the Nearctic Nitidul-
idae (Coleoptera). Bull. Mus. Comp. Zool. Harv. Univ.
92: 121-278.
SATPUTE, N. S., DESHMUKH, S. D., RAO, N. G. V., AND
NIMBALKAR, S. A. 2005. Life tables and the intrinsic
rate of increase of Earias uittella (Lepidoptera: Noc-
tuidae) reared on different diets. Intl. J. Trop. Insect
Sci. 25: 73-79.
TEAL, P. E. A., TORTO, B., BOUCIAS, D., AND TUMLINSON,
J. H. 2006. In-hive trap and attractant composition
for control of the small hive beetle, Aethina tumida.
US Patent: 20060141904.
TORTO, B., ARBOGAST, R. T., ALBORN, H., SUAZO, A.,
VAN ENGLESDORP, D., BOUCIAS, D., TUMLINSON, J.
H., AND TEAL, P. E. A. 2007a. Composition of vola-
tiles from fermenting pollen dough and attractive-
ness to the small hive beetle Aethina tumida, a par-
asite of the honey bee Apis mellifera. Apidologie 38:
380-389.
TORTO, B., ARBOGAST, R. T., VAN ENGLESDORP, D.,
WILLMS, S., PURCELL, D., BOUCIAS, D., TUMLINSON,
J. H., AND TEAL, P. E. A. 2007b. Trapping of Aethina
tumida (Coleoptera: Nitidulidae) fromApis mellifera
(Hymenoptera: Apidae) colonies with an in-hive bat-
ed trap. Environ. Entomol. 36: 1018-1024.
TORTO, B., BOUCIAS, D. G., ARBOGAST, R. T., TUMLIN-
SON, J. H., AND TEAL, P. E. A. 2007c. Multitrophic in-
teraction facilitates parasite-host relationship be-
tween invasive beetle and the honey bee. Proc. Natl.
Acad. Sci. U.S.A. 104: 8374-8378.
TRICHILO, P. J., AND LEIGH, T. F. 1988. Influence of re-
source quality on the reproductive fitness of flower
thrips (Thysanoptera: Thripidae). Ann. Entomol.
Soc. America 81: 64-70.
VOGT, G. B. 1951. Occurrence records of Nitidulidae. Co-
leopt. Bull. 5: 4-11.
WIJESIRI, D., GU, H., AND ASHLEY, S. 1995. Population
growth potential of Epiphyas postuittana, the light-
brown apple moth (Lepidoptera: Tortricidae) in rela-
tion to diet, temperature, and climate. Australian J.
Zool. 43: 381-394.










Adult life table (Ix) and age-specific fecundity table (m,) for Aethina tumida reared on inoculated
pollen dough

Days post Pivotal Number of 2Proportion Total Number of Number of
Date of number of
emergence age surviving surviving eggs laid eggs/ eggs / 9
Y surviving eggs laid
26-Feb-08 1 28.5 50 0.777 0 0.00 0.00
27-Feb-08 2 29.5 50 0.777 0 0.00 0.00
28-Feb-08 3 30.5 50 0.777 0 0.00 0.00
29-Feb-08 4 31.5 50 0.777 72 1.44 0.72
1-Mar-08 5 32.5 50 0.777 0 0.00 0.00
2-Mar-08 6 33.5 50 0.777 454 9.08 4.54
3-Mar-08 7 34.5 50 0.777 269 5.38 2.69
4-Mar-08 8 35.5 50 0.777 379 7.58 3.79
5-Mar-08 9 36.5 50 0.777 375 7.50 3.75
6-Mar-08 10 37.5 50 0.777 390 7.80 3.90
7-Mar-08 11 38.5 50 0.777 705 14.10 7.05
8-Mar-08 12 39.5 50 0.777 434 8.68 4.34
9-Mar-08 13 40.5 50 0.777 559 11.18 5.59
10-Mar-08 14 41.5 50 0.777 465 9.30 4.65
11-Mar-08 15 42.5 49 0.761 827 16.88 8.44
12-Mar-08 16 43.5 49 0.761 584 11.92 5.96
13-Mar-08 17 44.5 48 0.746 662 13.79 6.90
14-Mar-08 18 45.5 48 0.746 814 16.96 8.48
15-Mar-08 19 46.5 48 0.746 422 8.79 4.40
16-Mar-08 20 47.5 48 0.746 160 3.33 1.67
17-Mar-08 21 48.5 47 0.730 106 2.26 1.13
18-Mar-08 22 49.5 46 0.715 198 4.30 2.15
19-Mar-08 23 50.5 46 0.715 404 8.78 4.39
20-Mar-08 24 51.5 45 0.699 572 12.71 6.36
21-Mar-08 25 52.5 45 0.699 366 8.13 4.07
22-Mar-08 26 53.5 45 0.699 398 8.84 4.42
23-Mar-08 27 54.5 45 0.699 300 6.67 3.33
24-Mar-08 28 55.5 45 0.699 489 10.87 5.43
25-Mar-08 29 56.5 45 0.699 261 5.80 2.90
26-Mar-08 30 57.5 45 0.699 483 10.73 5.37
27-Mar-08 31 58.5 45 0.699 1070 23.78 11.89
28-Mar-08 32 59.5 45 0.699 1146 25.47 12.73
29-Mar-08 33 60.5 45 0.699 530 11.78 5.89
30-Mar-08 34 61.5 45 0.699 315 7.00 3.50
31-Mar-08 35 62.5 44 0.684 601 13.66 6.83
1-Apr-08 36 63.5 43 0.668 357 8.30 4.15
2-Apr-08 37 64.5 43 0.668 710 16.51 8.26
3-Apr-08 38 65.5 42 0.653 677 16.12 8.06
4-Apr-08 39 66.5 42 0.653 823 19.60 9.80
5-Apr-08 40 67.5 42 0.653 1108 26.38 13.19
6-Apr-08 41 68.5 42 0.653 603 14.36 7.18
7-Apr-08 42 69.5 42 0.653 296 7.05 3.52
8-Apr-08 43 70.5 42 0.653 387 9.21 4.61
9-Apr-08 44 71.5 42 0.653 366 8.71 4.36
10-Apr-08 45 72.5 42 0.653 578 13.76 6.88
11-Apr-08 46 73.5 41 0.637 281 6.85 3.43










Adult life table (Ix) and age-specific fecundity table (m,) for Aethina tumida reared on inoculated
pollen dough

Days post Pivotal Number of 2Proportion Total Number of Number of
Date of number of
emergence age surviving surviving eggs laid eggs/ eggs / 9
Y surviving eggs laid
12-Apr-08 47 74.5 41 0.637 457 11.15 5.57
13-Apr-08 48 75.5 41 0.637 280 6.83 3.41
14-Apr-08 49 76.5 41 0.637 437 10.66 5.33
15-Apr-08 50 77.5 41 0.637 243 5.93 2.96
16-Apr-08 51 78.5 41 0.637 265 6.46 3.23
17-Apr-08 52 79.5 40 0.622 381 9.53 4.76
18-Apr-08 53 80.5 40 0.622 436 10.90 5.45
19-Apr-08 54 81.5 40 0.622 421 10.53 5.26
20-Apr-08 55 82.5 40 0.622 507 12.68 6.34
21-Apr-08 56 83.5 40 0.622 716 17.90 8.95
22-Apr-08 57 84.5 40 0.622 580 14.50 7.25
23-Apr-08 58 85.5 39 0.606 460 11.79 5.90
24-Apr-08 59 86.5 39 0.606 710 18.21 9.10
25-Apr-08 60 87.5 39 0.606 892 22.87 11.44
26-Apr-08 61 88.5 39 0.606 585 15.00 7.50
27-Apr-08 62 89.5 39 0.606 372 9.54 4.77
28-Apr-08 63 90.5 39 0.606 107 2.74 1.37
29-Apr-08 64 91.5 39 0.606 407 10.44 5.22
30-Apr-08 65 92.5 39 0.606 501 12.85 6.42
1-May-08 66 93.5 39 0.606 269 6.90 3.45
2-May-08 67 94.5 39 0.606 508 13.03 6.51
3-May-08 68 95.5 39 0.606 273 7.00 3.50
4-May-08 69 96.5 39 0.606 289 7.41 3.71
5-May-08 70 97.5 38 0.591 453 11.92 5.96
6-May-08 71 98.5 38 0.591 341 8.97 4.49
7-May-08 72 99.5 38 0.591 365 9.61 4.80
8-May-08 73 100.5 38 0.591 271 7.13 3.57
9-May-08 74 101.5 38 0.591 207 5.45 2.72
10-May-08 75 102.5 37 0.575 195 5.27 2.64
11-May-08 76 103.5 37 0.575 233 6.30 3.15
12-May-08 77 104.5 35 0.544 49 1.40 0.70
13-May-08 78 105.5 32 0.497 63 1.97 0.98
14-May-08 79 106.5 30 0.466 131 4.37 2.18
15-May-08 80 107.5 30 0.466 157 5.23 2.62
16-May-08 81 108.5 28 0.435 257 9.18 4.59
17-May-08 82 109.5 26 0.404 359 13.81 6.90
18-May-08 83 110.5 25 0.389 467 18.68 9.34
19-May-08 84 111.5 25 0.389 272 10.88 5.44
20-May-08 85 112.5 25 0.389 240 9.60 4.80
21-May-08 86 113.5 25 0.389 270 10.80 5.40
22-May-08 87 114.5 23 0.357 161 7.00 3.50
23-May-08 88 115.5 23 0.357 284 12.35 6.17
24-May-08 89 116.5 23 0.357 68 2.96 1.48
25-May-08 90 117.5 21 0.326 98 4.67 2.33
26-May-08 91 118.5 20 0.311 218 10.90 5.45
27-May-08 92 119.5 19 0.295 259 13.63 6.82













Adult life table (Ix) and age-specific fecundity table (m,) for Aethina tumida reared on inoculated
pollen dough

Days post Pivotal Number of 2Proportion Total Number of Number of
Date of number of
emergence age surviving surviving eggs laid eggs/ eggs / 9
Y surviving eggs laid
28-May-08 93 120.5 18 0.280 246 13.67 6.83
29-May-08 94 121.5 18 0.280 234 13.00 6.50
30-May-08 95 122.5 18 0.280 179 9.94 4.97
31-May-08 96 123.5 18 0.280 58 3.22 1.61
1-Jun-08 97 124.5 18 0.280 143 7.94 3.97
2-Jun-08 98 125.5 18 0.280 192 10.67 5.33
3-Jun-08 99 126.5 16 0.249 91 5.69 2.84
4-Jun-08 100 127.5 16 0.249 141 8.81 4.41
5-Jun-08 101 128.5 16 0.249 67 4.19 2.09
6-Jun-08 102 129.5 15 0.233 53 3.53 1.77
7-Jun-08 103 130.5 15 0.233 102 6.80 3.40
8-Jun-08 104 131.5 14 0.218 112 8.00 4.00
9-Jun-08 105 132.5 13 0.202 124 9.54 4.77
10-Jun-08 106 133.5 10 0.155 78 7.80 3.90
11-Jun-08 107 134.5 8 0.124 78 9.75 4.88
12-Jun-08 108 135.5 6 0.093 38 6.33 3.17
13-Jun-08 109 136.5 6 0.093 12 2.00 1.00
14-Jun-08 110 137.5 5 0.078 0 0.00 0.00
15-Jun-08 111 138.5 5 0.078 0 0.00 0.00
16-Jun-08 112 139.5 5 0.078 0 0.00 0.00
17-Jun-08 113 140.5 4 0.062 10 2.50 1.25
18-Jun-08 114 141.5 4 0.062 49 12.25 6.13
19-Jun-08 115 142.5 4 0.062 0 0.00 0.00
20-Jun-08 116 143.5 4 0.062 0 0.00 0.00
21-Jun-08 117 144.5 4 0.062 0 0.00 0.00
22-Jun-08 118 145.5 4 0.062 0 0.00 0.00
23-Jun-08 119 146.5 4 0.062 7 1.75 0.88
24-Jun-08 120 147.5 4 0.062 0 0.00 0.00
25-Jun-08 121 148.5 4 0.062 0 0.00 0.00
26-Jun-08 122 149.5 4 0.062 0
27-Jun-08 123 150.5 0 0.000 0

1 The initial pivotal age was taken as the mean time required for development from egg to adult.

2 This is the same as the probability of survival to each pivotal age. The initial probability of survival
was taken as the proportion of immature stages that reached adulthood.











Adult life table (Ix) and age-specific fecundity table (mx) for Aethina tumida reared on orange slices


e Days post 1 Pivotal Number of Proportion Total Number of Number of
Daf numberoftNumberlof NumberNofo
Date -of number of
emergence age $$surviving urvng es ld eggs / Y eggs /
Y Surviving eggs laid
17-Dec-07 1 27.5 50 0.337 0 0.00 0.00
18-Dec-07 2 28.5 50 0.337 0 0.00 0.00
19-Dec-07 3 29.5 50 0.337 0 0.00 0.00
20-Dec-07 4 30.5 50 0.337 0 0.00 0.00
21-Dec-07 5 31.5 49 0.330 0 0.00 0.00
22-Dec-07 6 32.5 49 0.330 0 0.00 0.00
23-Dec-07 7 33.5 49 0.330 0 0.00 0.00
24-Dec-07 8 34.5 49 0.330 53 1.08 0.54
25-Dec-07 9 35.5 49 0.330 153 3.12 1.56
26-Dec-07 10 36.5 49 0.330 67 1.37 0.68
27-Dec-07 11 37.5 49 0.330 1 0.02 0.01
28-Dec-07 12 38.5 49 0.330 300 6.12 3.06
29-Dec-07 13 39.5 49 0.330 64 1.31 0.65
30-Dec-07 14 40.5 49 0.330 124 2.53 1.27
31-Dec-07 15 41.5 49 0.330 234 4.78 2.39
1-Jan-08 16 42.5 49 0.330 21 0.43 0.21
2-Jan-08 17 43.5 48 0.324 40 0.83 0.42
3-Jan-08 18 44.5 48 0.324 112 2.33 1.17
4-Jan-08 19 45.5 48 0.324 170 3.54 1.77
5-Jan-08 20 46.5 48 0.324 183 3.81 1.91
6-Jan-08 21 47.5 47 0.317 7 0.15 0.07
7-Jan-08 22 48.5 47 0.317 364 7.74 3.87
8-Jan-08 23 49.5 46 0.310 0 0.00 0.00
9-Jan-08 24 50.5 46 0.310 432 9.39 4.70
10-Jan-08 25 51.5 46 0.310 65 1.41 0.71
11-Jan-08 26 52.5 46 0.310 395 8.59 4.29
12-Jan-08 27 53.5 46 0.310 104 2.26 1.13
13-Jan-08 28 54.5 45 0.303 0 0.00 0.00
14-Jan-08 29 55.5 45 0.303 43 0.96 0.48
15-Jan-08 30 56.5 44 0.297 232 5.27 2.64
16-Jan-08 31 57.5 43 0.290 149 3.47 1.73
17-Jan-08 32 58.5 43 0.290 291 6.77 3.38
18-Jan-08 33 59.5 43 0.290 294 6.84 3.42
19-Jan-08 34 60.5 43 0.290 90 2.09 1.05
20-Jan-08 35 61.5 43 0.290 142 3.30 1.65
21-Jan-08 36 62.5 43 0.290 214 4.98 2.49
22-Jan-08 37 63.5 43 0.290 223 5.19 2.59
23-Jan-08 38 64.5 43 0.290 195 4.53 2.27
24-Jan-08 39 65.5 43 0.290 423 9.84 4.92
25-Jan-08 40 66.5 43 0.290 337 7.84 3.92
26-Jan-08 41 67.5 43 0.290 633 14.72 7.36
27-Jan-08 42 68.5 43 0.290 125 2.91 1.45
28-Jan-08 43 69.5 42 0.283 204 4.86 2.43
29-Jan-08 44 70.5 42 0.283 488 11.62 5.81
30-Jan-08 45 71.5 42 0.283 295 7.02 3.51
31-Jan-08 46 72.5 42 0.283 451 10.74 5.37











Adult life table (Ix) and age-specific fecundity table (mx) for Aethina tumida reared on orange slices


e Days post 1 Pivotal Number of Proportion Total Number of Number of
Daf numberoftNumberlof NumberNofo
Date -of number of
emergence age $$surviving urvng es ld eggs / Y eggs /
Y Surviving eggs laid
1-Feb-08 47 73.5 42 0.283 246 5.86 2.93
2-Feb-08 48 74.5 42 0.283 220 5.24 2.62
3-Feb-08 49 75.5 42 0.283 181 4.31 2.15
4-Feb-08 50 76.5 42 0.283 340 8.10 4.05
5-Feb-08 51 77.5 42 0.283 293 6.98 3.49
6-Feb-08 52 78.5 42 0.283 492 11.71 5.86
7-Feb-08 53 79.5 42 0.283 290 6.90 3.45
8-Feb-08 54 80.5 42 0.283 309 7.36 3.68
9-Feb-08 55 81.5 42 0.283 206 4.90 2.45
10-Feb-08 56 82.5 42 0.283 259 6.17 3.08
11-Feb-08 57 83.5 41 0.276 431 10.51 5.26
12-Feb-08 58 84.5 41 0.276 127 3.10 1.55
13-Feb-08 59 85.5 41 0.276 316 7.71 3.85
14-Feb-08 60 86.5 40 0.270 131 3.28 1.64
15-Feb-08 61 87.5 40 0.270 102 2.55 1.28
16-Feb-08 62 88.5 39 0.263 447 11.46 5.73
17-Feb-08 63 89.5 39 0.263 366 9.38 4.69
18-Feb-08 64 90.5 39 0.263 215 5.51 2.76
19-Feb-08 65 91.5 39 0.263 317 8.13 4.06
20-Feb-08 66 92.5 39 0.263 71 1.82 0.91
21-Feb-08 67 93.5 39 0.263 276 7.08 3.54
22-Feb-08 68 94.5 39 0.263 116 2.97 1.49
23-Feb-08 69 95.5 39 0.263 117 3.00 1.50
24-Feb-08 70 96.5 39 0.263 205 5.26 2.63
25-Feb-08 71 97.5 39 0.263 333 8.54 4.27
26-Feb-08 72 98.5 39 0.263 83 2.13 1.06
27-Feb-08 73 99.5 39 0.263 182 4.67 2.33
28-Feb-08 74 100.5 39 0.263 190 4.87 2.44
29-Feb-08 75 101.5 39 0.263 36 0.92 0.46
1-Mar-08 76 102.5 39 0.263 505 12.95 6.47
2-Mar-08 77 103.5 39 0.263 74 1.90 0.95
3-Mar-08 78 104.5 39 0.263 220 5.64 2.82
4-Mar-08 79 105.5 38 0.256 234 6.16 3.08
5-Mar-08 80 106.5 38 0.256 286 7.53 3.76
6-Mar-08 81 107.5 38 0.256 363 9.55 4.78
7-Mar-08 82 108.5 37 0.249 419 11.32 5.66
8-Mar-08 83 109.5 37 0.249 371 10.03 5.01
9-Mar-08 84 110.5 37 0.249 387 10.46 5.23
10-Mar-08 85 111.5 37 0.249 259 7.00 3.50
11-Mar-08 86 112.5 37 0.249 305 8.24 4.12
12-Mar-08 87 113.5 36 0.243 197 5.47 2.74
13-Mar-08 88 114.5 36 0.243 513 14.25 7.13
14-Mar-08 89 115.5 36 0.243 403 11.19 5.60
15-Mar-08 90 116.5 36 0.243 425 11.81 5.90
16-Mar-08 91 117.5 36 0.243 629 17.47 8.74
17-Mar-08 92 118.5 36 0.243 381 10.58 5.29











Adult life table (Ix) and age-specific fecundity table (mx) for Aethina tumida reared on orange slices


S Days post 1 Pivotal Number of Proportion Total Number of Number of
Daf numberoftNumberlof NumberNofo
Date -of number of
emergence age $$surviving urvng es ld eggs / Y eggs /
Y Surviving eggs laid
18-Mar-08 93 119.5 36 0.243 618 17.17 8.58
19-Mar-08 94 120.5 36 0.243 376 10.44 5.22
20-Mar-08 95 121.5 36 0.243 259 7.19 3.60
21-Mar-08 96 122.5 36 0.243 450 12.50 6.25
22-Mar-08 97 123.5 36 0.243 270 7.50 3.75
23-Mar-08 98 124.5 36 0.243 445 12.36 6.18
24-Mar-08 99 125.5 36 0.243 180 5.00 2.50
25-Mar-08 100 126.5 36 0.243 368 10.22 5.11
26-Mar-08 101 127.5 35 0.236 237 6.77 3.39
27-Mar-08 102 128.5 35 0.236 384 10.97 5.49
28-Mar-08 103 129.5 35 0.236 180 5.14 2.57
29-Mar-08 104 130.5 35 0.236 239 6.83 3.41
30-Mar-08 105 131.5 35 0.236 35 1.00 0.50
31-Mar-08 106 132.5 35 0.236 360 10.29 5.14
1-Apr-08 107 133.5 35 0.236 216 6.17 3.09
2-Apr-08 108 134.5 34 0.229 215 6.32 3.16
3-Apr-08 109 135.5 34 0.229 450 13.24 6.62
4-Apr-08 110 136.5 33 0.222 276 8.36 4.18
5-Apr-08 111 137.5 33 0.222 302 9.15 4.58
6-Apr-08 112 138.5 33 0.222 253 7.67 3.83
7-Apr-08 113 139.5 33 0.222 568 17.21 8.61
8-Apr-08 114 140.5 33 0.222 349 10.58 5.29
9-Apr-08 115 141.5 33 0.222 433 13.12 6.56
10-Apr-08 116 142.5 33 0.222 395 11.97 5.98
11-Apr-08 117 143.5 33 0.222 132 4.00 2.00
12-Apr-08 118 144.5 33 0.222 269 8.15 4.08
13-Apr-08 119 145.5 33 0.222 639 19.36 9.68
14-Apr-08 120 146.5 33 0.222 268 8.12 4.06
15-Apr-08 121 147.5 33 0.222 503 15.24 7.62
16-Apr-08 122 148.5 33 0.222 169 5.12 2.56
17-Apr-08 123 149.5 33 0.222 159 4.82 2.41
18-Apr-08 124 150.5 32 0.216 684 21.38 10.69
19-Apr-08 125 151.5 32 0.216 293 9.16 4.58
20-Apr-08 126 152.5 32 0.216 540 16.88 8.44
21-Apr-08 127 153.5 32 0.216 410 12.81 6.41
22-Apr-08 128 154.5 32 0.216 309 9.66 4.83
23-Apr-08 129 155.5 32 0.216 387 12.09 6.05
24-Apr-08 130 156.5 32 0.216 316 9.88 4.94
25-Apr-08 131 157.5 32 0.216 248 7.75 3.88
26-Apr-08 132 158.5 31 0.209 411 13.26 6.63
27-Apr-08 133 159.5 31 0.209 319 10.29 5.15
28-Apr-08 134 160.5 31 0.209 270 8.71 4.35
29-Apr-08 135 161.5 31 0.209 59 1.90 0.95
30-Apr-08 136 162.5 31 0.209 259 8.35 4.18
1-May-08 137 163.5 31 0.209 163 5.26 2.63
2-May-08 138 164.5 30 0.202 249 8.30 4.15











Adult life table (Ix) and age-specific fecundity table (mx) for Aethina tumida reared on orange slices


S Days post 1 Pivotal Number of Proportion Total Number of Number of
ofe numberoftNumberlof NumberNofo
Date -of number of
emergence age $$surviving urvng es ld eggs / Y eggs /
Y Surviving eggs laid
3-May-08 139 165.5 30 0.202 261 8.70 4.35
4-May-08 140 166.5 29 0.195 109 3.76 1.88
5-May-08 141 167.5 28 0.189 463 16.54 8.27
6-May-08 142 168.5 28 0.189 84 3.00 1.50
7-May-08 143 169.5 27 0.182 262 9.70 4.85
8-May-08 144 170.5 27 0.182 108 4.00 2.00
9-May-08 145 171.5 26 0.175 43 1.65 0.83
10-May-08 146 172.5 26 0.175 112 4.31 2.15
11-May-08 147 173.5 26 0.175 165 6.35 3.17
12-May-08 148 174.5 26 0.175 97 3.73 1.87
13-May-08 149 175.5 26 0.175 236 9.08 4.54
14-May-08 150 176.5 26 0.175 95 3.65 1.83
15-May-08 151 177.5 26 0.175 168 6.46 3.23
16-May-08 152 178.5 26 0.175 221 8.50 4.25
17-May-08 153 179.5 26 0.175 100 3.85 1.92
18-May-08 154 180.5 25 0.169 185 7.40 3.70
19-May-08 155 181.5 25 0.169 29 1.16 0.58
20-May-08 156 182.5 25 0.169 254 10.16 5.08
21-May-08 157 183.5 24 0.162 472 19.67 9.83
22-May-08 158 184.5 24 0.162 172 7.17 3.58
23-May-08 159 185.5 24 0.162 473 19.71 9.85
24-May-08 160 186.5 24 0.162 176 7.33 3.67
25-May-08 161 187.5 24 0.162 99 4.13 2.06
26-May-08 162 188.5 24 0.162 151 6.29 3.15
27-May-08 163 189.5 24 0.162 81 3.38 1.69
28-May-08 164 190.5 24 0.162 70 2.92 1.46
29-May-08 165 191.5 24 0.162 235 9.79 4.90
30-May-08 166 192.5 24 0.162 158 6.58 3.29
31-May-08 167 193.5 23 0.155 284 12.35 6.17
1-Jun-08 168 194.5 23 0.155 141 6.13 3.07
2-Jun-08 169 195.5 22 0.148 318 14.45 7.23
3-Jun-08 170 196.5 22 0.148 266 12.09 6.05
4-Jun-08 171 197.5 22 0.148 110 5.00 2.50
5-Jun-08 172 198.5 22 0.148 390 17.73 8.86
6-Jun-08 173 199.5 22 0.148 109 4.95 2.48
7-Jun-08 174 200.5 22 0.148 103 4.68 2.34
8-Jun-08 175 201.5 22 0.148 183 8.32 4.16
9-Jun-08 176 202.5 21 0.142 176 8.38 4.19
10-Jun-08 177 203.5 21 0.142 120 5.71 2.86
11-Jun-08 178 204.5 21 0.142 180 8.57 4.29
12-Jun-08 179 205.5 21 0.142 179 8.52 4.26
13-Jun-08 180 206.5 20 0.135 174 8.70 4.35
14-Jun-08 181 207.5 19 0.128 110 5.79 2.89
15-Jun-08 182 208.5 19 0.128 95 5.00 2.50
16-Jun-08 183 209.5 19 0.128 0 0.00 0.00
17-Jun-08 184 210.5 19 0.128 11 0.58 0.29











Adult life table (Ix) and age-specific fecundity table (mx) for Aethina tumida reared on orange slices


e Days post 1 Pivotal Number of Proportion Total Number of Number of
Daf numberoftNumberlof NumberNofo
Date -of number of
emergence age $$surviving urvng es ld eggs / Y eggs /
Y Surviving eggs laid
18-Jun-08 185 211.5 19 0.128 177 9.32 4.66
19-Jun-08 186 212.5 19 0.128 108 5.68 2.84
20-Jun-08 187 213.5 19 0.128 48 2.53 1.26
21-Jun-08 188 214.5 19 0.128 140 7.37 3.68
22-Jun-08 189 215.5 19 0.128 192 10.11 5.05
23-Jun-08 190 216.5 19 0.128 0 0.00 0.00
24-Jun-08 191 217.5 18 0.121 61 3.39 1.69
25-Jun-08 192 218.5 18 0.121 0 0.00 0.00
26-Jun-08 193 219.5 18 0.121 79 4.39 2.19
27-Jun-08 194 220.5 18 0.121 13 0.72 0.36
28-Jun-08 195 221.5 18 0.121 73 4.06 2.03
29-Jun-08 196 222.5 18 0.121 89 4.94 2.47
30-Jun-08 197 223.5 17 0.115 31 1.82 0.91
1-Jul-08 198 224.5 16 0.108 107 6.69 3.34
2-Jul-08 199 225.5 16 0.108 115 7.19 3.59
3-Jul-08 200 226.5 16 0.108 51 3.19 1.59
4-Jul-08 201 227.5 16 0.108 15 0.94 0.47
5-Jul-08 202 228.5 16 0.108 27 1.69 0.84
6-Jul-08 203 229.5 16 0.108 0 0.00 0.00
7-Jul-08 204 230.5 16 0.108 76 4.75 2.38
8-Jul-08 205 231.5 16 0.108 23 1.44 0.72
9-Jul-08 206 232.5 16 0.108 118 7.38 3.69
10-Jul-08 207 233.5 16 0.108 0 0.00 0.00
11-Jul-08 208 234.5 16 0.108 158 9.88 4.94
12-Jul-08 209 235.5 16 0.108 34 2.13 1.06
13-Jul-08 210 236.5 16 0.108 69 4.31 2.16
14-Jul-08 211 237.5 15 0.101 54 3.60 1.80
15-Jul-08 212 238.5 15 0.101 74 4.93 2.47
16-Jul-08 213 239.5 15 0.101 7 0.47 0.23
17-Jul-08 214 240.5 15 0.101 115 7.67 3.83
18-Jul-08 215 241.5 14 0.094 40 2.86 1.43
19-Jul-08 216 242.5 14 0.094 45 3.21 1.61
20-Jul-08 217 243.5 14 0.094 165 11.79 5.89
21-Jul-08 218 244.5 14 0.094 80 5.71 2.86
22-Jul-08 219 245.5 14 0.094 86 6.14 3.07
23-Jul-08 220 246.5 14 0.094 64 4.57 2.29
24-Jul-08 221 247.5 14 0.094 106 7.57 3.79
25-Jul-08 222 248.5 13 0.088 187 14.38 7.19
26-Jul-08 223 249.5 13 0.088 51 3.92 1.96
27-Jul-08 224 250.5 13 0.088 30 2.31 1.15
28-Jul-08 225 251.5 13 0.088 148 11.38 5.69
29-Jul-08 226 252.5 13 0.088 31 2.38 1.19
30-Jul-08 227 253.5 13 0.088 29 2.23 1.12
31-Jul-08 228 254.5 13 0.088 0 0.00 0.00
1 -Aug-08 229 255.5 13 0.088 58 4.46 2.23
2-Aug-08 230 256.5 13 0.088 131 10.08 5.04











Adult life table (Ix) and age-specific fecundity table (mx) for Aethina tumida reared on orange slices


Days post 1 Pivotal Number of 2 Proportion Total Number of Number of
Daf numberoftNumberlof NumberNofo
Date -of number of
emergence age $$surviving surfing egs eggs / Y eggs /
Y Surviving eggs laid
3-Aug-08 231 257.5 13 0.088 109 8.38 4.19
4-Aug-08 232 258.5 13 0.088 7 0.54 0.27
5-Aug-08 233 259.5 13 0.088 182 14.00 7.00
6-Aug-08 234 260.5 13 0.088 17 1.31 0.65
7-Aug-08 235 261.5 13 0.088 114 8.77 4.38
8-Aug-08 236 262.5 13 0.088 23 1.77 0.88
9-Aug-08 237 263.5 13 0.088 0 0.00 0.00
10-Aug-08 238 264.5 13 0.088 35 2.69 1.35
11-Aug-08 239 265.5 13 0.088 0 0.00 0.00
12-Aug-08 240 266.5 13 0.088 4 0.31 0.15
13-Aug-08 241 267.5 13 0.088 108 8.31 4.15
14-Aug-08 242 268.5 13 0.088 79 6.08 3.04
15-Aug-08 243 269.5 13 0.088 44 3.38 1.69
16-Aug-08 244 270.5 13 0.088 0 0.00 0.00
17-Aug-08 245 271.5 13 0.088 0 0.00 0.00
18-Aug-08 246 272.5 11 0.074 4 0.36 0.18
19-Aug-08 247 273.5 11 0.074 0 0.00 0.00
20-Aug-08 248 274.5 11 0.074 28 2.55 1.27
21-Aug-08 249 275.5 10 0.067 13 1.30 0.65
22-Aug-08 250 276.5 10 0.067 0 0.00 0.00
23-Aug-08 251 277.5 10 0.067 0 0.00 0.00
24-Aug-08 252 278.5 10 0.067 0 0.00 0.00
25-Aug-08 253 279.5 10 0.067 0 0.00 0.00
26-Aug-08 254 280.5 10 0.067 34 3.40 1.70
27-Aug-08 255 281.5 10 0.067 18 1.80 0.90
28-Aug-08 256 282.5 10 0.067 62 6.20 3.10
29-Aug-08 257 283.5 10 0.067 29 2.90 1.45
30-Aug-08 258 284.5 10 0.067 0 0.00 0.00
31-Aug-08 259 285.5 10 0.067 0 0.00 0.00
1 -Sep-08 260 286.5 10 0.067 0 0.00 0.00
2-Sep-08 261 287.5 10 0.067 43 4.30 2.15
3-Sep-08 262 288.5 10 0.067 8 0.80 0.40
4-Sep-08 263 289.5 10 0.067 37 3.70 1.85
5-Sep-08 264 290.5 10 0.067 6 0.60 0.30
6-Sep-08 265 291.5 10 0.067 0 0.00 0.00
7-Sep-08 266 292.5 10 0.067 0 0.00 0.00
8-Sep-08 267 293.5 9 0.061 0 0.00 0.00
9-Sep-08 268 294.5 9 0.061 12 1.33 0.67
10-Sep-08 269 295.5 8 0.054 26 3.25 1.63
11-Sep-08 270 296.5 7 0.047 9 1.29 0.64
12-Sep-08 271 297.5 7 0.047 0 0.00 0.00
13-Sep-08 272 298.5 7 0.047 0 0.00 0.00
14-Sep-08 273 299.5 7 0.047 0 0.00 0.00
15-Sep-08 274 300.5 7 0.047 4 0.57 0.29
16-Sep-08 275 301.5 7 0.047 16 2.29 1.14
17-Sep-08 276 302.5 7 0.047 0 0.00 0.00











Adult life table (Ix) and age-specific fecundity table (mx) for Aethina tumida reared on orange slices


e Days post 1 Pivotal Number of Proportion Total Number of Number of
Daf numberoftNumberlof NumberNofo
Date -of number of
emergence age $$surviving urvng es ld eggs / Y eggs /
Y Surviving eggs laid
18-Sep-08 277 303.5 7 0.047 3 0.43 0.21
19-Sep-08 278 304.5 7 0.047 0 0.00 0.00
20-Sep-08 279 305.5 7 0.047 0 0.00 0.00
21-Sep-08 280 306.5 7 0.047 0 0.00 0.00
22-Sep-08 281 307.5 7 0.047 0 0.00 0.00
23-Sep-08 282 308.5 7 0.047 0 0.00 0.00
24-Sep-08 283 309.5 7 0.047 36 5.14 2.57
25-Sep-08 284 310.5 7 0.047 0 0.00 0.00
26-Sep-08 285 311.5 7 0.047 17 2.43 1.21
27-Sep-08 286 312.5 7 0.047 0 0.00 0.00
28-Sep-08 287 313.5 7 0.047 0 0.00 0.00
29-Sep-08 288 314.5 6 0.040 0 0.00 0.00
30-Sep-08 289 315.5 6 0.040 0 0.00 0.00
1-Oct-08 290 316.5 6 0.040 0 0.00 0.00
2-0ct-08 291 317.5 6 0.040 0 0.00 0.00
3-0ct-08 292 318.5 6 0.040 5 0.83 0.42
4-0ct-08 293 319.5 6 0.040 0 0.00 0.00
5-0ct-08 294 320.5 6 0.040 0 0.00 0.00
6-0ct-08 295 321.5 6 0.040 0 0.00 0.00
7-0ct-08 296 322.5 6 0.040 0 0.00 0.00
8-0ct-08 297 323.5 6 0.040 0 0.00 0.00
9-0ct-08 298 324.5 6 0.040 0 0.00 0.00
10-0ct-08 299 325.5 5 0.034 0 0.00 0.00
11-Oct-08 300 326.5 5 0.034 0 0.00 0.00
12-0ct-08 301 327.5 5 0.034 0 0.00 0.00
13-0ct-08 302 328.5 5 0.034 0 0.00 0.00
14-0ct-08 303 329.5 4 0.027 0 0.00 0.00
15-0ct-08 304 330.5 4 0.027 0 0.00 0.00
16-0ct-08 305 331.5 4 0.027 0 0.00 0.00
17-0ct-08 306 332.5 4 0.027 0 0.00 0.00
18-0ct-08 307 333.5 4 0.027 0 0.00 0.00
19-0ct-08 308 334.5 4 0.027 0 0.00 0.00
20-0ct-08 309 335.5 4 0.027 0 0.00 0.00
21-0ct-08 310 336.5 4 0.027 0 0.00 0.00
22-0ct-08 311 337.5 4 0.027 0 0.00 0.00
23-0ct-08 312 338.5 4 0.027 0 0.00 0.00
24-0ct-08 313 339.5 4 0.027 0 0.00 0.00
25-0ct-08 314 340.5 4 0.027 0 0.00 0.00
26-0ct-08 315 341.5 4 0.027 0 0.00 0.00
27-0ct-08 316 342.5 4 0.027 0 0.00 0.00
28-0ct-08 317 343.5 4 0.027 0 0.00 0.00
29-0ct-08 318 344.5 4 0.027 25 6.25 3.13
30-0ct-08 319 345.5 4 0.027 0 0.00 0.00
31-Oct-08 320 346.5 4 0.027 0 0.00 0.00
1-Nov-08 321 347.5 4 0.027 0 0.00 0.00
2-Nov-08 322 348.5 4 0.027 0 0.00 0.00











Adult life table (lx) and age-specific fecundity table (m,) for Aethina tumida reared on orange slices


Dae Days post 1 Pivotal Number of 2 Proportion Total Number of Number of
Date -of number of
emergence age $$surviving n e li eggs / Y eggs /
SYsurviving eggs laid
3-Nov-08 323 349.5 3 0.020 0 0.00 0.00
54-Nov-08 324 350.5 3 0.020 0 0.00 0.00
5-Nov-08 325 351.5 3 0.020 0 0.00 0.00
6-Nov-08 326 352.5 3 0.020 0 0.00 0.00
7-Nov-08 327 353.5 3 0.020 0 0.00 0.00

1 The initial pivotal age was taken as the mean time required for development from egg to adult.

2 This is the same as the probability of survival to each pivotal age. The initial probability of survival
was taken as the proportion of immature stsges that reached adulthood.


n of immature stsges that reached adulthood.







Medal et al.: Host Specificity Tests with Gratiana graminea


HOST SPECIFICITY TESTS OF GRATIANA GRAMINEA (COLEOPTERA:
CHRYSOMELIDAE), A POTENTIAL BIOLOGICAL CONTROL AGENT OF
TROPICAL SODA APPLE, SOLANUM VIARUM (SOLANACEAE)

J. MEDAL', N. BUSTAMANTE', M. VITORINO2, L. BEAL2, W. OVERHOLT', R. DIAZ1 AND J. CUDA1
1University of Florida, Department of Entomology and Nematology, Gainesville, FL 32611

2Universidade Regional de Blumenau, Santa Catarina, Brazil

ABSTRACT

Multiple-choice and no-choice tests were conducted at the Department of Agriculture, Divi-
sion of Plant Industry Quarantine facility in Gainesville, FL to determine the specificity of
the Brazilian leaf-beetle Gratiana graminea Klug, a candidate for biological control of
Solanum uiarum, tropical soda apple. One hundred fifteen plant species in 32 families were
included in the feeding-oviposition multiple-choice tests including the target weed and the
5 major cultivated Solanaceae Capsicum annuum L., Lycopersicon sculentum Mill., Nicoti-
ana tabacum L., Solanum melongena L., and Solanum tuberosum L. Eight to 12 plant spe-
cies, including always the main target weed, growing in 1-gallon pots were simultaneously
exposed to 20 G. graminea adults (10 males and 10 females that most of the time had re-
cently emerged from pupae) in an aluminum cage (60 x 60 x 60 cm). At the beginning of each
test the insects were placed at the bottom center of each cage to allow them to orient by
themselves to the tested plants. Plant species in each test were replicated 3-4 times (one rep-
lication of tested plants in each separate cage). Plants tested were exposed to G. graminea
adults from 3-6 weeks. Observation of oviposition and feeding were made during almost all
the weekdays. No-choice host specificity tests were conducted with G. graminea adults on
potted plants in cages made of clear-plastic cylinders and with G. graminea larvae placed on
cluster of leaves of each individual plant tested. Ten G. graminea adults were exposed to 29
plant species individually tested during 3 to 5 weeks, and 10 neonate larvae were exposed
to 31 plant species. Plant species in each test were replicated 3-4 times. Results indicated
that G. graminea fed and developed only on the target weed. The tests indicated that a host
range expansion of G. graminea to any of the major cultivated Solanaceae species is highly
unlikely. A petition for field release in Florida was submitted to the Technical Advisory
Group for Biological Control Agents of Weeds (TAG) in Sep 2008.

Key Words: weed biological control, host-specificity tests, Gratiana graminea, Solanum vi-
arum, tropical soda apple, Solanaceae

RESUME

Pruebas de ovoposici6n y alimentaci6n (con y sin elecci6n), se realizaron para evaluar la espe-
cificidad del escarabajo defoliador, de origen Brasileiro, Gratiana graminea Klug como agent
potential para el control biol6gico de tropical soda apple, Solanum viarum Dunal en los Esta-
dos Unidos. Las pruebas se efectuaron en la cuarentena del Departamento de Agricultura de
la Florida, Divisi6n de Industria de Plantas en Gainesville. Ciento quince species de plants,
en 32 families, fueron incluidas en las pruebas de especificidad de elecci6n multiple, inclu-
yendo la maleza objetivo y las cinco plants cultivadas pertenecients a la familiar Solanaceae
mas importantes: Capsicum annuum L., Lycopersicon sculentum Mill., Nicotiana tabacum L.,
Solanum melongena L., y Solanum tuberosum L. En cada prueba se utilizaron de ocho a doce
plants, icluyendo siempre la maleza objetivo, creciendo en macetas de un gal6n las cuales fue-
ron expuestas a 20 adults de G. graminea (10 machos y 10 hembras reci6n emergidos de
pupa) durante 3 a 6 semanas. Registros de alimentaci6n y ovoposici6n fueron realizados casi
todos los dias de la semana. Pruebas de alimentaci6n/ovoposici6n sin elecci6n fueron tambien
realizadas usando plants creciendo en macetas yjaulas cilindricas hechas de plastico claro
transparent. Diez adults de G. graminea fueron expuestos a 29 species de plants en forma
individual durante 3 a 5 semanas. Diez larvas reci6n nacidas fueron tambi6n expuestas a 31
species de plants en forma individual. Cada prueba tuvo 3-4 repeticiones. Los resultados in-
dicaron que G. graminea se aliment6, coloc6 posturas y complete su desarrollo unicamente en
la maleza objetivo. Las pruebas de especificidad indicaron que la posibilidad de G. graminea
de llegar a ser una plaga de las Solanaceas cultivadas es muy remota. La solicitud a TAG para
liberar el escarabajo fue presentada en septiembre 2008.


Translation provided by the authors.







Florida Entomologist 93(2)


Tropical soda apple, Solanum viarum Dunal
(Solanaceae), is a perennial weed, originally from
northeast Argentina, southern Brazil, Paraguay,
and Uruguay, that has been spreading throughout
Florida at an alarming rate during the last two de-
cades. The pasture-land infested in 1992 was esti-
mated to be approximately 60,000 hectares (Mul-
lahey et al. 1993), and increased to more than
300,000 hectares in 1995-96 (Mullahey et al.
1997). Currently, the infested area is estimated at
more than 400,000 hectares (Medal et al. 2008).
Tropical soda apple, first reported in the United
States in Glades County, Florida in 1988 (Coile
1993; Mullahey & Colvin 1993), is also present in
Alabama, Georgia, Mississippi, North Carolina,
South Carolina, Texas, and Puerto Rico (Bryson &
Byrd, Jr. 1996; Dowler 1996; Mullahey et al. 1997;
Medal et al. 2003). The potential range of tropical
soda apple in the United States may be extended
even further based on studies of the effects of tem-
peratures and photoperiods conducted by Patter-
son (1996) in controlled environmental chambers.
This invasive exotic weed was placed on the Flor-
ida and Federal Noxious Weed Lists in 1995.
In addition to its invasion of pasture lands and
reduction of cattle carrying capacity (Mullahey et
al. 1993; Bredow et al. 2007), tropical soda apple is
known to harbor at least 6 viruses that affect cul-
tivated solanaceous crops such as tomato, tobacco,
and pepper (McGovern et al. 1994a, 1994b, 1996).
Tropical soda apple is also an alternative host for
key pests such as the Colorado potato beetle, Lept-
inotarsa decemlineata (Say) (Coleoptera: Chry-
somelidae), major defoliating insect pest of potato
in North America; the tomato hornworm, Mand-
uca quinquemaculata (Haworth) and the tobacco
hornworm, Manduca sexta (L.), (Lepidoptera: Sph-
ingidae), major pests of tomato and tobacco plants;
the silverleaf whitefly, Bemisia argentifolii Bellows
and Perring (Homoptera: Aleyrodidae) one of the
most troublesome insect pest worldwide of many
field and vegetable crops; the tobacco budworm,
Heliothis uirescens (Fabr.) (Lepdoptera: Noctuidae)
one of the most destructive pests of tobacco; the
green peach aphid, Myzus persicae (Sulzer) an im-
portant pest of peach trees and vector of plant vi-
ruses to solanaceous plants and other food crops
(Homoptera: Aphididae); the southern green stink-
bug, Nezara uiridula (L.) (Hemiptera: Pentatomi-
dae) an important pest of soybean and vegetable
crops; and the suckfly, Tupiocoris notatus (Distant)
(Hemiptera: Miridae) a pest of several crops in-
cluding tobacco (Habeck et al. 1996; Medal et al.
1999a; Sudbrink et al. 1999). Although it is very
difficult to estimate the real (direct and indirect)
economic losses due to this invasive weed, the pro-
duction loss to Florida ranchers by tropical soda
apple was estimated from $6.5-16 million annually
(Thomas 2007).
Although tropical soda apple is able to spread
vegetatively from the root system, the primary


method of dispersal is by seed dissemination
(Bryson et al. 1995; Medal et al. 1999b), which oc-
curs mainly by livestock and wildlife that feed on
the fruits and scarify the seeds (Akanda et al.
1996; Brown et al. 1996). A single plant of tropical
soda apple can produces up to 150 fruits per year,
with each fruit containing on average 400 seeds.
The estimated seed production is 60,000 seeds/
plant/season with a viability of more than 75%
(Mullahey & Colvin 1993; Pereira et al. 1997).
Currently recommended management prac-
tices for this invasive plant in southeastern
United States include herbicide applications and
mechanical techniques (mowing/tilling) (Mislevy
et al. 1996; Mullahey et al. 1996; Sturgis & Colvin
1996; Akanda et al. 1997). These control tactics
provide temporary weed suppression at an eco-
nomic cost estimated at $62 and $47 per hectare
in chemical and mechanical control methods, re-
spectively (Thomas 2007). However, application
of these control methods is often difficult to em-
ploy in remote and/or inaccessible areas.
A biological control project for tropical soda ap-
ple was started in Dec 1996 by the University of
Florida in collaboration with the Universidade
Estadual Paulista, Jabotical campus, Brazil, Uni-
versidade Federal do Parana in Curitiba, Brazil,
Universidade Regional de Blumenau, Santa
Catarina state, Brazil, Universidade Centro-
Oeste in Irati, Parana state, Brazil, and the US-
DAS-ARS, Biological Control Laboratory in Hurl-
ingham, Buenos Aires Province, Argentina. The
release of the Brazilian leaf-beetle Graminea
graminea Klug (Coleoptera: Chrysomelidae) in
Florida will complement the defoliation effects
that Gratiana boliviana Spaeth has been making
on tropical soda apple plants during the warm
season in Florida since it was released in the sum-
mer 2003 (Medal et al. 2008; Overholt et al. 2008).
Tropical soda apple defoliation by G. boliviana
and G. graminea, in southern Brazil is causing a
major suppressive effect on tropical soda apple
density (Gandolfo et al. 2007; Medal et al. unpub-
lished data). These two leaf-feeder beetles have a
synergistic effect on tropical soda apple defolia-
tion and occupy different niches in somewhat
overlapped geographical regions in southern
parts of Brazil.
In this paper we report the results of the host-
specificity tests conducted at the Florida Depart-
ment of Agriculture-Division of Plant Industry
quarantine facility in Gainesville with the leaf-
beetle G. graminea as a potential biological control
agent of the non-native weed tropical soda apple.

MATERIALS AND METHODS

Host-Feeding Specificity Tests

Plant-host specificity tests with Gratiana
graminea adults and first instars were conducted


June 2010







Medal et al.: Host Specificity Tests with Gratiana graminea


from Sep 2000 to Aug 2004 at the Florida Depart-
ment of Agriculture and Consumer Services-Divi-
sion of Plant Industry quarantine facility in
Gainesville, Florida. Additional feeding/oviposi-
tion tests with G. graminea adults were con-
ducted at the Gainesville quarantine facility from
May to Sep 2008. Gratiana graminea (all develop-
mental stages) were collected on tropical soda ap-
ple plants in Rio Grande do Sul, Brazil, intro-
duced into Florida-quarantine, placed on caged
plants of tropical soda apple growing in 1-gallon
pots and eggs were removed twice a week to pro-
vide the insects required for testing.

Multiple-Choice Feeding and Oviposition Tests

One hundred fifteen plant species in 32 fami-
lies were included in the feeding and oviposition
preference tests in quarantine (Table 1). The
plants tested included 56 species in the family of
the target weed (Solanaceae) of which 29 were
from the genus Solanum and 27 from 15 other
genera that include plants of agricultural or eco-
logical importance. Ten species representing 5
families (Boraginaceae, Convolvulaceae, Ehreti-
aceae, Nolanaceae, Polemoniaceae) that are very
closely related phyllogenetically to the Solan-
aceae and in the same order Polemoniales (Hey-
wood 1993) were included. Forty-nine plant spe-
cies representing 26 families, most of them with
an economically and/or environmentally value in
North America, were also tested. The major tar-
get weed (tropical soda apple), and 10 plant spe-
cies in the Solanaceae were tested at least 3 times
(Table 1). They included Solanum donianum
Walpers that is in the list of Florida threatened
plants (Coile 1998); 4 secondary target-weeds
(Solanum tampicense Dunal, Solanum toruum
Sw., Solanum capsicoides All., Solanum elaeagni-
folium Cavy.); and the 5 major cultivated Solan-
aceae (Capsicum annuum L., Lycopersicon escu-
lentum Mill., Nicotiana tabacum L., Solanum
melongena L., Solanum tuberosum L.). Eight to
12 plant species, including always the main tar-
get weed, growing in 1-gallon pots were simulta-
neously exposed to 20 G. graminea adults (10
males and 10 females which were newly emerged
from pupae most of the time) in an aluminum
cage (60 x 60 x 60 cm). At the beginning of each
test the insects were placed at the bottom center
of each cage to allow them to orient by themselves
to the tested plants. Plant species in each test
were replicated 3-4 times (1 replication of tested
plants in each separate cage). Plants were ex-
posed to G. graminea adults from 3-6 weeks. Ob-
servations of oviposition and feeding were made
during most of the weekdays. Plants consumed
were replaced as needed. Plants were checked for
oviposition sites and eggs were removed and
counted weekly. On the last day of each experi-
ment, plants were checked for feeding and eggs


laid on them. Leaf area consumed was measured
with a Portable Area Meter Model LI-3000
(Lambda Instrument Corporation) and the leaf-
feeding area is reported on a scale from 0-5 (0 = no
feeding, 1 = probing or <5% of leaf area consumed,
2 = light feeding or 5-20% of the area, 3 = moder-
ate feeding or 21-40%, 4 = heavy feeding or 41-
60%, and 5 = intense feeding or >60% of the leaf
area consumed).

No-Choice Larval Feeding Tests

No-choice host specificity tests were conducted
with G. graminea neonate larvae in an environ-
mental chamber at a temperature of 22 2C, rel-
ative humidity of 55-65%, and a photoperiod of
12:12 (L:D). Recently hatched non-fed larvae
were exposed to 31 plant species including 30 spe-
cies in the family of the target weed (Solanaceae)
and 1 species in the family Convolvulaceae. The
species tested included 7 genera of plants very
closely related phyllogenetically in the same fam-
ily as the target weed, and with an economical
and/or environmental value in North America
(Table 2). Larvae were exposed to clusters of
leaves of each individual plant tested by placing
the clusters individually in a 30-mL plastic-cup
containing water and fitted with a paper lid to
avoid insect contact with the water. The leaf peti-
ole was inserted through a hole (3-4 mm diame-
ter) made in the middle of the paper-lid. The cup
and plant cluster was placed inside a clear-plastic
container covered with a plastic-lid having 6-7
small holes to allow air circulation. Moistened tis-
sue paper was placed at the bottom of the plastic
container and under the plastic-lid to provide
moisture. The plants (treatments) were arranged
in a completely randomized design. Three to 4
replications were used with 10 one-d- old larvae
per replication. Each group of 10 G. graminea lar-
vae was provided with only 1 plant species which
they fed on or died. Daily observations of feeding
were made and leaves were replaced as needed.
Larval mortality counts were made 3 and 7 d af-
ter the experiment started.

No-Choice Adult Feeding Tests

No-choice host specificity tests were conducted
with G. graminea adults at the Gainesville quar-
antine facility with potted plants (20-60 cm
height) in cages. Gratiana graminea adults were
exposed to 29 plant species including S.
donianum in the list of Florida threatened plants,
all major cultivated Solanaceae, and 7 exotic (Ta-
ble 3). Five to 6 plant species were individually
tested each time due to limitation in availability
of cages. Ten G. graminea adults (5 males, 5 fe-
males) per replication (3-4 replications) were ex-
posed to plants during 21 to 35 d. Cages were
made of clear plastic cylinders (15 cm diameter,









Florida Entomologist 93(2)


TABLE 1. HOST RANGE ADULT FEEDING AND OVIPOSITION TESTS WITH GRATIANA GRAMINEA IN FLORIDA.


Plant Family Species


Common Names
(*indicates native
Solanum species)


No. No. Feeding
of Tests of Insects Score'


Category 1. Genetic types of the target weed species found in North America
SOLANACEAE
Tribe Solaneae
Genus Solanum
Subgenus Leptostemonum
Section Acantophora


Solanum viarum Dunal


Tropical soda apple


9 600 4-5 58-124


Category 2. Species in the same genus as the target weed, divided by subgenera (if applicable)


Tribe Solaneae
Genus Solanum
Subgenus Leptostemonum
Solanum capsicoides All.
Solanum mammosum L.
Section Lasiocarpum
Solanum quitoense Lam.
Solanum pseudolulo Heise
Solanum sessiliflorum Dunal
Section Micracantha
Solanum tampicense Dunal
Solanum jamaicense Mill.
Section Melongena
Subsection Lathyrocarpum
Solanum carolinense L.
Solanum dimidiatum Raf.
Section Persicariae
Solanum bahamense
Solanum torvum Sw.
Solanum verbascifolium L.
Subgenus Solanum
Solanum americanum Mill.
Solanum diphyllum L.
Solanum erianthum Don.
Solanum jasminoides Paxt.
Solanum mauritianum Scop.
Solanum nigrescesns Mart. & Gal
Solanum nigrum L.
Solanum parishii heller
Solanum ptycanthum Dunal
Solanum seaforthianum Andr.
Solanum tuberosum L.


Red soda apple
Nipplefruit

Naranjilla
Falso lulo
Nightshade

Wetland nightshade
Jamaican nightshade


Horse nettle"
Western horsenettle"

Bahama nightshade
Turkeyberry
Mullein nightshade*

American nightshade"
Two-leaf nightshade"
Potato tree*
White potato vine
Earleaf nightshade
Divine nightshade*
Black nightshade"
Parish nightshade"
Wonder berry
Brazilian nightshade
Potato


3 220
2 120


5 220 1
2 120 0


2 140 0
2 140 0


Category 3. Species in other genera in the same family as the target weed,
Genus Acnistus
Acnistus australe (Griseb.) Griseb. Acnistus 2
Genus Capsicum
Capsicum annuum L. Bell pepper 6
Capsicum frutescens L. Chile 2
Genus lochroma
lochroma sp. Iochroma 2
Genus Physalis
Physalis angulata L. Cutleaf Ground-Cherry 2
Physalis arenicola Kearney Cypresshead 2


divided by subfamily (if applicable)


140 0

420 0
140 0

140 0

140 0
140 0


June 2010


Eggs Laid
per Female


Each test included 3-4 replications with 20 adults (10 males, 10 females) per replication.
0 = no feeding, 1 = probing (<5% of leaf area), 2 = light feeding (5-20%), 3 = moderate feeding (21-40%), 4 = heavy feeding (41-
60%), 5 = intense (60% of leaf-area).







Medal et al.: Host Specificity Tests with Gratiana graminea


TABLE 1. (CONTINUED) HOST RANGE ADULT FEEDING AND OVIPOSITION TESTS WITH GRATIANA GRAMINEA IN FLORIDA.


Plant Family Species


Physalis crassifolia Benth
Physalis gigantea L.
Physalis ixocarpa Brot.
Physalis pubescens L.
Physalis walteri Nutt.
Tribe Daturae
Genus Brugmansia
Brugmansia sanguinea
(Ruiz & Pav.) Don
Genus Datura
Datura discolor Bernh
Datura metel L.
Datura meteloides D.
Datura stramonium L.
Tribe Lycieae
Genus Lycium
Lycium carolinianum Walt.
Lycium fremontii Gray.
Genus Lycopersicon
Lycopersicon esculentum Mill.
Tribe: Nicandreae
Genus: Nicandra
Nicandra physaloides (L.) Gaertn.
Tribe Nicotianae
Genus Nicotiana
Nicotiana tabacum L.
Nicotiana rustica L.
Nicotiana sylvestris Speg. & Comes
Genus Nierembergia
Nierembergia scoparia Sendtri
Genus Petunia
Petunia x hybrida
Tribe Salpiglossidae
Genus Salpiglossis
Salpiglossis sinuata Ruiz & Pav
Genus Schizanthus
Schizanthus spp.
Tribe Solandeae
Genus Solandra
Solandra glandiflora Swartz


Common Names
(*indicates native
Solanum species)

Ground-Cherry
Ground-cherry
Tomatillo
Strawberry tomato
Ground-cherry


Red floripontio


Angels'trumpet
Downy thorn apple
Datura
Jimson weed


Christmas berry
Lycium

Tomato


Apple of Peru


Tobacco
Wild tobacco
Tobacco

Cupflower

Garden-petunia


Painted tongue

Butterfly flower


Chalice vine


No. No. Feeding Eggs Laid
of Tests of Insects Score' per Female


2 140 0


2 140 0
2 140 0

6 420 0


2 140 0


2 140 0

2 140 0


2 140 0

2 140 0


2 140 0


Category 4. Threatened and endangered species in the same family as the target weed divided by subgenus, genus,
and subfamily
Section Torva
Solanum donianum Walpers Mullein nightshade* 4 300 0 0
Category 5. Species in other families in the same order that have some phylogenetic, morphological, or biochemical
similarities to the target weed
BORAGINACEAE
Heliotrope sp. Heliotrope 1 80 0 0
Myosotis alpestris Schmidt Forget-Me-Not 1 80 0 0
CONVOLVULACEAE


Convolvulus purpurea L.


Convolvulus


1 80 0


Each test included 3-4 replications with 20 adults (10 males, 10 females) per replication.
0 = no feeding, 1 = probing (<5% of leaf area), 2 = light feeding (5-20%), 3 = moderate feeding (21-40%), 4 = heavy feeding (41-
60%), 5 = intense (60% of leaf-area).




University of Florida Home Page
© 2004 - 2010 University of Florida George A. Smathers Libraries.
All rights reserved.

Acceptable Use, Copyright, and Disclaimer Statement
Last updated October 10, 2010 - Version 2.9.7 - mvs


TRACE ROUTE

Total Execution Time: 112 Milliseconds

MILLISECOND   CLASS.METHODMESSAGE
0sobekcm_page_globals.constructor
0sobekcm_page_globals.constructorApplication State validated or built
0sobekcm_database.verify_item_lookup_object
0sobekcm_page_globals.constructorNavigation Object created from URI query string
0sobekcm_database.verify_item_lookup_object
0sobekcm_page_globals.display_itemRetrieving item or group information
0sobekcm_page_globals.get_entire_collection_hierarchyRetrieving hierarchy information
0sobekcm_assistant.get_entire_collection_hierarchy
0cached_data_manager.retrieve_item_aggregation
0cached_data_manager.retrieve_item_aggregationFound item aggregation on local cache
0item_aggregation_builder.get_item_aggregationFound 'all' item aggregation in cache
0system.web.ui.page.page_load (ufdc.page_load)
0sobekcm_page_globals.constructor.on_page_load
0html_echo_mainwriter.add_style_referencesAdding style references to HTML
0html_echo_mainwriter.add_text_to_pageReading the text from the file and echoing back to the output stream
112html_echo_mainwriter.add_text_to_pageFinished reading and writing the file